<%BANNER%>

Nitrate as an Endocrine Disrupting Contaminant in Captive Siberian Sturgeon, Acipenser baeri

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101112_AAAABU INGEST_TIME 2010-11-12T10:53:42Z PACKAGE UFE0019384_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 6995 DFID F20101112_AABANG ORIGIN DEPOSITOR PATH hamlin_h_Page_058thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
1a0f6ac378bca5efc94d09d882c27726
SHA-1
aba8510064d5034b924301f927ebb5054af63697
27743 F20101112_AABANH hamlin_h_Page_059.QC.jpg
09e95428b446a7d1accb3e9f37f37213
480b553f4e3a83e5be3bccc911754dc449f32a98
6579 F20101112_AABAMS hamlin_h_Page_048thm.jpg
d3a367a1c51ed31e635337e39f2b6216
819aa8ed6e5a67f6cc1d132256abb3a00adf6620
7433 F20101112_AABANI hamlin_h_Page_059thm.jpg
053db31e9780333ff82fc490c8edd9bd
ea67ea8c3d6af8909f1d73b44bcbbf6bfe20a801
6491 F20101112_AABAMT hamlin_h_Page_049thm.jpg
2ac75b7f97650682a6d4c6d84bd43022
817ae4173f1adccd12ab6ceabb388c96e7772a72
6883 F20101112_AABANJ hamlin_h_Page_060thm.jpg
13e8357b3b7f804b11ba83e3de7ea7aa
6adfbff6b81a1e37eba142412283727abb0b7d53
24016 F20101112_AABAMU hamlin_h_Page_050.QC.jpg
a5c08f7e075a8cb0ca42ae8fb54accbc
26da75e3f0d7bf8f2e0eaa698d7ca258b657448a
24975 F20101112_AABANK hamlin_h_Page_061.QC.jpg
d5a6973e0da59bcb9ffcff3739355949
1a0b7e3ae01835abb6ac5fc30ba754cee6401b5d
25481 F20101112_AABAMV hamlin_h_Page_051.QC.jpg
d7283a42907bde197a5e36c68f705599
a2b7ba249e1995a9f3550415e3aa8688a18b8591
6635 F20101112_AABANL hamlin_h_Page_061thm.jpg
36683ecb759b9acca618a43d13c7053d
ee83dc5a88d8a36a2b0cb037fdb20a483eea60f8
6827 F20101112_AABAMW hamlin_h_Page_051thm.jpg
bf79baf352655d4d7057306a14d37aa6
051b20632d0fa1975066cfda8f6717fd7618928a
25506 F20101112_AABAOA hamlin_h_Page_070.QC.jpg
aa75c3a5d9f7a0c5fb165623fc9967bd
99a744cd318f2a3118f7487623223b5205d4b2ec
23950 F20101112_AABANM hamlin_h_Page_062.QC.jpg
508ba7d334a89924e1fc768aa9e8f7b1
f8ce1aff14976e418d156120951d08fe0c49bb9b
24826 F20101112_AABAMX hamlin_h_Page_052.QC.jpg
060201607a685ab0c789b6cd212ce433
26940f3ac83458c04b6e6871d72903c37807c385
6713 F20101112_AABAOB hamlin_h_Page_070thm.jpg
f74c97bd0be9c627da7c9f0daa27718c
c8556d543206fbbd775c887d5a5674fb60a0c2da
6725 F20101112_AABANN hamlin_h_Page_062thm.jpg
b12199404a77ceee00d3f6b1847517b2
5e356f40439250974e43f4966d0edeef32925086
6959 F20101112_AABAMY hamlin_h_Page_052thm.jpg
a3af67dccaab25a63493a814bd0cd617
ff39f845e12247296c674498f97bb29749371b61
24618 F20101112_AABAOC hamlin_h_Page_071.QC.jpg
494107e517c7e454ee55bbd474b74cc9
ce92b42ce2bfed62591575cf8f1b6379bd2a1d03
6564 F20101112_AABANO hamlin_h_Page_063thm.jpg
3955e0df7e788fdf7b07702cbe90d1ce
302628cbf829954c18c64a2a7b50ee086cad0794
26094 F20101112_AABAMZ hamlin_h_Page_053.QC.jpg
b88ab710ea9a415a941ec083b8e7161a
af1d190ee5e376bdde68a44a195aeb24063e0eea
6771 F20101112_AABAOD hamlin_h_Page_071thm.jpg
e1fe0db6b15a00741faaad56928be0ca
e2b8855d8bc471a1ac29a50ef07032cb900ad77e
26333 F20101112_AABANP hamlin_h_Page_064.QC.jpg
9c4278d609dce987371ddd867eb7489e
e4c36d79660cd6059fb2a9a6b30f254c4a9364f8
24674 F20101112_AABAOE hamlin_h_Page_072.QC.jpg
2faee83eabe0ed53a75293d930c5ffc2
500cd9887ce3bc5b3ca45898e3674d2fe83335b1
6935 F20101112_AABANQ hamlin_h_Page_064thm.jpg
689d45ff9a2ecf1cced95c480bc31005
58dacbb4d60869fcf044249826e8039476e2e9ca
6733 F20101112_AABAOF hamlin_h_Page_072thm.jpg
addd76fc29ca3d4b73766b0b2663c8a6
1aad79b46da44b376900217bb4b6e7b818814598
22430 F20101112_AABANR hamlin_h_Page_065.QC.jpg
ef4dbd0f150bada97c3f08270d9f8050
b97cdf433b96950be6e7c491a4f46bc43c53e310
25228 F20101112_AABAOG hamlin_h_Page_073.QC.jpg
8837d70f588aaaf15510f23693f609e3
51bc743261dca3a6e6439e7dce902d6c79dedb69
6226 F20101112_AABANS hamlin_h_Page_065thm.jpg
623f9a50844a37b4f0a431a6ff999529
503fa50dfc79aebfae58776a1e472bac113878ab
6944 F20101112_AABAOH hamlin_h_Page_073thm.jpg
c8e7a239011d09beb1bdd140fdb67671
4dd9556277eb7b8ad3a5f04fb6fd139d478f4d78
4825 F20101112_AABAOI hamlin_h_Page_074.QC.jpg
88cd4b07459505db154a26eec64626bf
a1021aeeb9d72b2cc4b0a05eaece52b16e3d4593
21240 F20101112_AABANT hamlin_h_Page_066.QC.jpg
15c773a7e2763a297320aa593aa7df71
2405119dbd1da0ead3d34d61edd6f8b913e212a5
1854 F20101112_AABAOJ hamlin_h_Page_074thm.jpg
08ccb008015fefcad4620675a9360b82
e3e325a3bb73816abb62e1e4f05ed522e056f861
6262 F20101112_AABANU hamlin_h_Page_066thm.jpg
c7250e82a3add8b1970a98667620058d
d6a2711331614d3a329248102ca38a6c2eabe09b
2326 F20101112_AABAOK hamlin_h_Page_075thm.jpg
9b6c5f5644d3bbe0d580e14796cbb2f3
de0569315178c971875dd81c3f98d3a3c0c99920
25109 F20101112_AABANV hamlin_h_Page_067.QC.jpg
2960644c36ec8796984c137fc68c0456
81c9e984d23c4478684d09324bf25547ce3e4351
2974 F20101112_AABAOL hamlin_h_Page_076thm.jpg
e856478699db7a41bfedbb86de21efb1
7661f4e0ecc3990113861fc7adf831a08d2a5db4
6812 F20101112_AABANW hamlin_h_Page_067thm.jpg
208c76a211c093d0d8942e29ad08067d
2189cabfb31454255513b5c239348244682d2cbb
6521 F20101112_AABAPA hamlin_h_Page_085thm.jpg
bd1c3b9f72bffb6cb3fb9d8c477cd362
866ad6a8e348fb8f789ab693b6cd5d54d86eda0d
10321 F20101112_AABAOM hamlin_h_Page_077.QC.jpg
5e9a5a1bcf4a1898e9e256f7f638ecae
260a0ceb0d1563ee294c1d3af331c4c0ea45e627
23288 F20101112_AABANX hamlin_h_Page_068.QC.jpg
14c4a72f6d2177b46466317ed151e0d4
188654634b1f5b07bfcbe111d36562c1ca1ae507
26364 F20101112_AABAPB hamlin_h_Page_086.QC.jpg
eeec2957f93c2875ad3642e920c8c935
b730ee518e174a09fc9ef2e53ffc76e35bdbcb61
9039 F20101112_AABAON hamlin_h_Page_078.QC.jpg
463c283d527a75048cc3f474c173b3f3
03ec2ff1339f6f2d0a4de474c063165bfeaa5b44
24142 F20101112_AABANY hamlin_h_Page_069.QC.jpg
bdd0aa2f02b8d2e1660e10708aeab001
0e912ab6f5caf0df468f83b828b1208b651683a1
7021 F20101112_AABAPC hamlin_h_Page_086thm.jpg
e4575dd7b935532fe1a5ad900ed4e77c
cbe54e64c9407656eaf9fc0a3779c31998744f69
3027 F20101112_AABAOO hamlin_h_Page_078thm.jpg
2dc205e047f38b4c4d9ff810668ff326
5cd480751625b91ecb5669580f54ef09b96d450c
6727 F20101112_AABANZ hamlin_h_Page_069thm.jpg
77aeec8fe741a293fc2420639d8233f8
77e06887ba02ce745bea36a5f1371244a7dc1ef0
26554 F20101112_AABAPD hamlin_h_Page_087.QC.jpg
aefa4f1cade64faa9730dcfb5a4b03d6
4f0ed95f7a8e6bb39644e2a4267933083b9907b1
11522 F20101112_AABAOP hamlin_h_Page_079.QC.jpg
69b268a74b4236e308db96725336a57d
56da508ecf41525cff2514066ce47f9220821012
25609 F20101112_AABAPE hamlin_h_Page_088.QC.jpg
6dfd5233d7ff01295dac655a9b9ce5d2
50dddf1c952a5e5700c11e9f78f9035cc32754ec
3407 F20101112_AABAOQ hamlin_h_Page_079thm.jpg
6462d93d5fc6abcd43824a8ae1219c5d
8dbd8775d0f921498726532d83af7bc94b4ccf87
6951 F20101112_AABAPF hamlin_h_Page_088thm.jpg
3adaa6c1375c598964ee160098d08248
082088c345c4918f7c95021a388a6256be6c422b
11571 F20101112_AABAOR hamlin_h_Page_080.QC.jpg
4315356137e3ebcce4a113fcf0d57971
cd6cad88d75fdf6fdfd8c6c76ee21c94602bc901
24135 F20101112_AABAPG hamlin_h_Page_089.QC.jpg
4b08b3f91b488c39d03292964bfb96d0
c516396a99b80b87b57fade12d85d227ee1e2587
3683 F20101112_AABAOS hamlin_h_Page_080thm.jpg
215cf570605d69edc7c626774857b498
0a3443c24c7bce991402cfaf7d6444e7ba4979a4
6599 F20101112_AABAPH hamlin_h_Page_089thm.jpg
627ba42b3ec29635c6def347f8e6ef7d
f9004cc156d02f91cf50245230fa9fb9978fa9e8
24249 F20101112_AABAOT hamlin_h_Page_081.QC.jpg
c6da3615d892eee18381ebf17b58ba9f
cf0cd487dd71ecc1121bc390fbcd7e043f788689
23062 F20101112_AABAPI hamlin_h_Page_090.QC.jpg
ff594f1ec78029cd6dfe83ae1fbed128
5352ca42944c57976408d631a4fd90d8511540ee
69574 F20101112_AAAZGA hamlin_h_Page_034.jpg
d50decf3cec450d8517c7b22b5655390
04dfa86ed4f47e624a1144b5cc8edd7fa940b17e
26394 F20101112_AABAPJ hamlin_h_Page_091.QC.jpg
d0b3742cec2f8987f231eda04836a936
c11535db0306d443f654405af55aa3517d0bd84c
6525 F20101112_AABAOU hamlin_h_Page_081thm.jpg
b37905c5a19d2b13f4138bd4b705d874
3a2cec7850330a9c567018f72fc06d700f5ab5b4
54899 F20101112_AAAZGB hamlin_h_Page_059.pro
ba2b583d9389b58af67ae4b5d797dc4b
90279ef23ce02b82d72b350364ebc7bbd7e7a6ea
6911 F20101112_AABAPK hamlin_h_Page_092thm.jpg
3c73b01d5f6ad560748a01fef2fa3031
3a97a70dc1e64851d32dd14c65773162de06b530
25224 F20101112_AABAOV hamlin_h_Page_083.QC.jpg
a4670dc222258b9f205dbcdc0ceb58b8
71136fd71f0895b499aada89b0bdc2e438bf8379
21741 F20101112_AAAZGC hamlin_h_Page_020.QC.jpg
1ae69f72722b91413feaa3440a2eadb7
74c64d75b852cacd8d22f0db4ea178ebd41e44bc
25540 F20101112_AABAPL hamlin_h_Page_093.QC.jpg
9dd8adc91befda9a7ab4c8f41d287942
300f23a9c71f4fa116df90af9e0b1c4274ac649d
F20101112_AABAOW hamlin_h_Page_083thm.jpg
cec765e1d7caa3c37f19de9767e120b7
43bec3f3f6abd394c44db3279816131f9e278105
73965 F20101112_AAAZGD hamlin_h_Page_022.jpg
98ca44bffd5bc68730b63c187b3c9524
a6fcbcc672e9f5d1aa04b929cce5b617d695b834
5651 F20101112_AABAQA hamlin_h_Page_101thm.jpg
302cf0817284d3653cc378ebfc9a8452
f9ca32d5b7548dab4d5aa8a551f8f4e0e6915875
25019 F20101112_AABAPM hamlin_h_Page_094.QC.jpg
383e7d70f703620b74bf7cf0c377fa46
d1959d4aa3309e521c1f67efdef826e1831daa06
25541 F20101112_AABAOX hamlin_h_Page_084.QC.jpg
803f5decb73854f9476345ca8222b41c
76b1040ddc0a6da3846a9b1dca196ae7e7ac1352
25271604 F20101112_AAAZGE hamlin_h_Page_105.tif
7c6f3fcb703c6c8ddb8fef9e42dd019d
a61dbf96eaa52aa5895582a5df4370d72e96885c
19832 F20101112_AABAQB hamlin_h_Page_102.QC.jpg
e46d38824b0893a6a136428f1da67a1d
01ebe1487a1da71d819cc6a09ff26a559ffca932
6756 F20101112_AABAPN hamlin_h_Page_094thm.jpg
87e84db2f14a67642af9bc99fb306687
79c7680f745d28226a9add3f457a2c27f9a85f13
6779 F20101112_AABAOY hamlin_h_Page_084thm.jpg
793af5fa07910913dab6593be1823dfc
5fa7abfca97417210a5ed13aac14e5f08c51ac3f
68168 F20101112_AAAZGF hamlin_h_Page_124.pro
591bf5b063c92923b43c77683b50a6d3
71d3bcc90a2b668d6c58ad741e52bcf3175b4865
5066 F20101112_AABAQC hamlin_h_Page_102thm.jpg
1e839946196433fd4741650103dbce14
650243ef52408d751bc6b6c150587025820ae3aa
25469 F20101112_AABAPO hamlin_h_Page_095.QC.jpg
8d99f951101dab0933f513b66e46c07a
bce099837e9d44072215ab5fda5aff7bfd69af06
23980 F20101112_AABAOZ hamlin_h_Page_085.QC.jpg
4a5e230991ded228052773e7d56d142f
edff9bf5a08f1eda0e54c613c4c7aeba28408485
7199 F20101112_AAAZGG hamlin_h_Page_125thm.jpg
760f170971765c0423d90055ccb5c5c5
d4165258b97101c09c864325e6f825a038385f78
4419 F20101112_AABAQD hamlin_h_Page_103thm.jpg
140e0008d777d15c7693c0a7094fc5e5
086b8fa10d89a729f5a84fccdf5c61d35df11871
6710 F20101112_AABAPP hamlin_h_Page_095thm.jpg
f13cc930335c9e6c8df0a44af069cd52
c3db4763eca5a73409876ba9f1b4b4173a14d11f
1053954 F20101112_AAAZGH hamlin_h_Page_117.tif
168cf8ba53812de91db45a663c5f8274
5d90158f390bb280e76a4745fe8b3cc475b72581
14132 F20101112_AABAQE hamlin_h_Page_104.QC.jpg
9d5f01c439eeca7b4ba40196634b5670
7cf3fbd6c02fcc281151c12b1719d5820ea92a36
22720 F20101112_AABAPQ hamlin_h_Page_096.QC.jpg
4f9c3d0ceb3deec566c86b2a8f231210
d92a3046c21e55e495ea7560f862783e1d5764a8
90047 F20101112_AAAZGI hamlin_h_Page_102.jp2
44a4820367de550d83a5b9fde5d4d1cc
eafde9d93c97e4174baee7a71944701afe6ff2e6
3674 F20101112_AABAQF hamlin_h_Page_104thm.jpg
2fcf5ebfa5a38f6b112e732c953e84a8
d0f4d4cdca01daa51a47d76dcf75664f60aed936
6337 F20101112_AABAPR hamlin_h_Page_096thm.jpg
01d8bd70399eb5f00e3c946071d73b88
48250448057da1fb13dab22e14b006665cf91dcf
125042 F20101112_AAAZGJ hamlin_h_Page_122.jp2
16ee3dc628bdc074db107c64a77f6925
2693371883e9e78cea90e69942ab24eae495456b
25214 F20101112_AABAQG hamlin_h_Page_105.QC.jpg
c526ab431adc4e209c6087b3713de7d4
31f413dcd671859dea288b7084fbccbf44bbd89f
7985 F20101112_AABAPS hamlin_h_Page_097.QC.jpg
c6bc7315405398c4cbb5f632bd947651
e79fa84342171d63eadc8e3d3144b7139f9011c9
F20101112_AAAZGK hamlin_h_Page_086.tif
2d28e9d8bf8b97c5060e8e871f210ed3
efe02edd2dcff265422640e5f46f8fcd7c9606e0
6560 F20101112_AABAQH hamlin_h_Page_105thm.jpg
05baf99988d91262be66851b3866d014
f04ce0686faba3cdc66fc97c0bbc7aba33360b11
2468 F20101112_AABAPT hamlin_h_Page_097thm.jpg
aed787ce6cc5d5d12a5bbeb854c9bca9
9d96b2d343eaeac4af9654f3da9ad2d6773ddf4c
F20101112_AAAZGL hamlin_h_Page_079.tif
d6bd4670e49574bad77eebb31c93723b
b4032afa935553bef1fc5c8a420f743e6a4f6ecb
6140 F20101112_AABAQI hamlin_h_Page_106thm.jpg
01f9a939fb5ed780b20d20a11f11c3ec
fd3a301c01e334c83010c68799a3341dc55930d5
4658 F20101112_AABAPU hamlin_h_Page_098thm.jpg
791cf6ed5a53d5c51c59caa4c28f6a52
80500cac28f92c17cc70b734a93bcea5944884f3
457 F20101112_AAAZHA hamlin_h_Page_075.txt
4c05ba73a12c428c145a38c4df921eb0
887e9d047016f41a84b5186e0d8d94fbac47d72e
6813 F20101112_AAAZGM hamlin_h_Page_010thm.jpg
98c49e73e8e9589067d7042b1397c9bd
6ce2f05d176851e71d515a836902606961f1d0b6
6662 F20101112_AABAQJ hamlin_h_Page_107thm.jpg
9fdc176655bf9a260a5c132a7e4170fb
cf156204012c6ab3846d627698b2fbc98f901626
F20101112_AAAZHB hamlin_h_Page_121.tif
533cb7276ccba3c35f7a5a97936632b6
4c06aebb0733f710c93ee06bdcd0507c9f2bd2a8
53691 F20101112_AAAZGN hamlin_h_Page_117.pro
13d57db5cb9f59e247e696ab69d5715f
21d3b9d6d32a1aa72b2b32a87b37fdbbac91b298
5710 F20101112_AABAQK hamlin_h_Page_108.QC.jpg
9b3a3b43429fc06abe203ff8237b3997
2c1d695f4fc0958ebbe2b0dda0bdb1e90a1a0c0c
12648 F20101112_AABAPV hamlin_h_Page_099.QC.jpg
a8b54e42c7fd5bd326b6a3624a1d61a1
f6de4ea7ad48d64f071edeb5a1473af2f8b73620
2415 F20101112_AAAZHC hamlin_h_Page_137.txt
a7485067c7e2b48e31c539eeb8d25cb8
b636db5e0ae3231fb289a2bb7f377ba4b14641aa
6880 F20101112_AAAZGO hamlin_h_Page_082thm.jpg
e53d8e1276b0a82214009447f5fbd3d9
fe6e751b20857eb6715c25e56191592e284ea364
48105 F20101112_AAAZFZ hamlin_h_Page_089.pro
30d47ffdd5482629a18e772724a2fc67
37f64a4123139d3e5535e356735be8dfd813cc32
2215 F20101112_AABAQL hamlin_h_Page_108thm.jpg
d426cc6dd252e7224dc9def60a1581fc
267cd857b0e3c2a5d8e317743e218b53ecd27cda
3841 F20101112_AABAPW hamlin_h_Page_099thm.jpg
2c5964c900f652e038c3cd5b5d5a9c71
1a5105a6c866dd3333eaeea6db73b5cf0bba923c
5618 F20101112_AAAZHD hamlin_h_Page_141thm.jpg
a3ce13fff2ef70e131347f44cbe9532f
1a50983a5802a1cf82f00a65ca235229010617e2
1700 F20101112_AAAZGP hamlin_h_Page_040.txt
38e337c6d6b4cd1ad733a16e8e94ab38
d2f66a00a92b0a5832472cd14b8d9897748da37d
6837 F20101112_AABARA hamlin_h_Page_117thm.jpg
a4d070e6bb744221d334a2dc7ee4a898
80695bcd0a879dae5922b2a69847461a8f90852d
6251 F20101112_AABAQM hamlin_h_Page_109.QC.jpg
0e4df453f6017cc36c49389afe0d9cbc
440e6dd9c7f3b8242ded74157dcae7ee9e8dc6d2
11190 F20101112_AABAPX hamlin_h_Page_100.QC.jpg
fcf7e29c1e74bdf6f373a97b9abbb6c4
c764aa9cf629799f0ed4cbc43968f801a18e6c69
61910 F20101112_AAAZHE hamlin_h_Page_128.pro
e2fcd868f02ff2c5d5d77b7a36844da4
d2992df08f2b8dc6d800715155fd689b6523cb0b
2411 F20101112_AAAZGQ hamlin_h_Page_001thm.jpg
5b7154dc46ef7c276fb4922f82a69a9a
f4010e473264bdeaeb753e05787370a6f4120885
6862 F20101112_AABARB hamlin_h_Page_118thm.jpg
6f044f7e66d66aa26f2809a71521a206
5aedb06ecbb319456bd06257794f8218d784ba2c
2084 F20101112_AABAQN hamlin_h_Page_109thm.jpg
fd34e7cb521b6fc9901023c530d8443b
ea1dbfe68e30ab91c22e6784ba24f52ac3fc8dac
3308 F20101112_AABAPY hamlin_h_Page_100thm.jpg
e7891670df702339d27f422b219ff62c
14ea25be8a1bc4c2fd054b9f822295330a7c3970
2074 F20101112_AAAZHF hamlin_h_Page_021.txt
1d727d1208ba422973547a9f5db60af6
effb873a022acfe5d34cdb64d42b31b81c4efa67
17208 F20101112_AAAZGR hamlin_h_Page_110.jpg
e88ac7b02833d23ffbd30f875c69bd9d
b69504bb105c8f298a2a0f247feb1da1c0cdfeed
5924 F20101112_AABARC hamlin_h_Page_121thm.jpg
a78b10918743734d4e24fa28d06f88e2
7f27753491f143effa2c0f452a94d39a73bfd48d
5812 F20101112_AABAQO hamlin_h_Page_110.QC.jpg
e29e34b630aebe1d0883a52d40d2ef4e
32b8547d18d8299480203cdd71fad6fcaa3ae6fc
22676 F20101112_AABAPZ hamlin_h_Page_101.QC.jpg
224c6883b53c0724d2abc5991f6c7225
d1d14301b936b435dfeb2339616e6fab23d93edd
F20101112_AAAZHG hamlin_h_Page_124.tif
8bb3e9f6036ce00305f41696a13b747f
bd36e542d1259e2aa41e3cbd75e66a90c6665e62
24549 F20101112_AABARD hamlin_h_Page_122.QC.jpg
8b14e89c55f4082150ca16431516013b
b10d7306688e429698f2a5b4932ec65c5f3d6a5c
1990 F20101112_AABAQP hamlin_h_Page_110thm.jpg
1658c0284fee6e5cd9e53f95b09a60cf
78f78d318ff2ad624fd34b04cd2246a9875d5007
23193 F20101112_AAAZHH hamlin_h_Page_063.QC.jpg
e34b972d20317759bf642a3404be0a1f
5c312a717c49bd01b39126fd773e3c8e3294cbcc
13136 F20101112_AAAZGS hamlin_h_Page_026.QC.jpg
df74e22fed45c60464cfc5eaf0dd4d74
000401221c170e2162941ad478f0352b3156b39f
F20101112_AABARE hamlin_h_Page_122thm.jpg
c4bcea928e036bd286860c36b9a78fb7
28a76310789bf8e3698fe6ccf485a5c3759b37fa
6688 F20101112_AABAQQ hamlin_h_Page_111.QC.jpg
64056a02cae62855e5f02ceae251c92d
5e4e975ded7f257cccba40ab49c9d7abf0d8b03b
1964 F20101112_AAAZHI hamlin_h_Page_088.txt
4a247c56c5fe43253f6e390c9c853dd6
df4f3d033c571747eb0193699d13242f7628a705
45276 F20101112_AAAZGT hamlin_h_Page_105.pro
a329430d290e636b92878e65880d1be6
fa358d6915d76ae05e19b0d58bc574e5b69476c4
25945 F20101112_AABARF hamlin_h_Page_123.QC.jpg
93f131cfe75d0b50787a87c28d9a1f52
185a55a4f8ed9da0ea2151d94a32217224b212a5
2516 F20101112_AABAQR hamlin_h_Page_111thm.jpg
e81c068f0372ab18459f10c723e34ab2
aa093f670f5909244058a449e32d74a2a6fa4bac
2197 F20101112_AAAZHJ hamlin_h_Page_064.txt
91616f781f8b31253ac3b7af03c2f9a5
5458f9ebe7965bc7e7ed037a76425c55eaec4159
6567 F20101112_AAAZGU hamlin_h_Page_017thm.jpg
a5e6ab2de5659d1cae8fa5a591f1cff5
a5542987483e8ea4d2388696aafca301987f3d01
6703 F20101112_AABARG hamlin_h_Page_123thm.jpg
883f61e2543bde52ef3b147cd564a600
feb442cbcda7fe16f1e8aadc60b498db1348262d
2407 F20101112_AABAQS hamlin_h_Page_112thm.jpg
a1087b984209c0e575149df796754977
afb401c1f7eb64ba8cc3f9e2e30f704d201f2871
2593 F20101112_AAAZHK hamlin_h_Page_010.txt
1758f757a5f0f9b8a4bebef75b1d3f1b
2a1a69da0613984c1eea9e6aa9bc01e6ed6591c6
59349 F20101112_AAAZGV hamlin_h_Page_040.jpg
f94014bd0e6fa2bdaf1101e69a1774e4
b4895bf7bc1679019e8279d0a4bc8f07c21ed76f
27154 F20101112_AABARH hamlin_h_Page_124.QC.jpg
610ff0d95e8c4d848624bd4558b8416d
aa20f2bd466933c98fd392ef9998f911e75c77cf
7847 F20101112_AABAQT hamlin_h_Page_113.QC.jpg
d1913a41702e336f364c9345a65bf0c7
6eef18dce96580d2a70f29f58cdf2da548b6346f
8394 F20101112_AAAZHL hamlin_h_Page_001.pro
8c8238a7672025c29bf472363bccab0e
da67bad22a82e7b146f918ab05a000d771ce7283
30903 F20101112_AAAZGW hamlin_h_Page_039.jpg
4727eee6185688fdba2791435b5295b6
b195dece8edd711a95ef46b1758604e96308347d
7367 F20101112_AABARI hamlin_h_Page_124thm.jpg
c1725bb3d83438aa67b4036148c6e962
d62e051a1fe9203601456177432d62437ca83ec9
7817 F20101112_AABAQU hamlin_h_Page_114.QC.jpg
3bd8193fa8535c22143efa27f93a4809
0207b481483dd723bf380b8b339e42cc6d24cee7
25671 F20101112_AAAZHM hamlin_h_Page_060.QC.jpg
264514bef84e2f9632ae52063016403d
c34db5f773cb06c46cd962339641c9bfb3e0c307
2659 F20101112_AAAZGX hamlin_h_Page_130.txt
479f03c4b294b61c42cc29ac8a1e7265
817dc5a0f6426a9e05ede57ded2cf6014801d3a5
93093 F20101112_AAAZIA hamlin_h_Page_134.jpg
406480a246158eb18d29923c3a6073ca
cbd09d33ccb0c876c9454664bd90c579d83c41a3
25443 F20101112_AABARJ hamlin_h_Page_126.QC.jpg
8ac7ca9ed874bcb8ac0abb71251e2e16
1f77b98b80e77419982376d438f573eb7413c8a4
2495 F20101112_AABAQV hamlin_h_Page_114thm.jpg
553b9a53f87c4db23870ae6b63b97ddc
b8b9eae3eae22a5106b73cc2df48d1620bdc0ec1
63857 F20101112_AAAZHN hamlin_h_Page_120.jpg
5815675adfdf5cf7ca4ad977b0580f67
25f24fd8cdb68de69fb7dabf93f62423a0366c88
1935 F20101112_AAAZGY hamlin_h_Page_068.txt
0031b9795e86e24ec68d20d2fa0ba17e
84ba735700254cb8d01053d3229c12675121d019
74244 F20101112_AAAZIB hamlin_h_Page_023.jpg
0c0e6c06319c4871296f70d1919efd08
fc1a2e578ae55366aca2f0290ad481866ddbf291
6926 F20101112_AABARK hamlin_h_Page_126thm.jpg
edc80001cfa1c7f13702c652faa0bd62
a03d47494c6628b81f6d71ae4bd165cfee205dcb
77243 F20101112_AAAZHO hamlin_h_Page_051.jpg
74ff79a1bba44c932fa2209b777e973e
45f5cd9b3e8d56a64d345a9c6439decd76ab868e
F20101112_AAAZGZ hamlin_h_Page_085.tif
a6d0447682d57652a46307424265c676
2480089535270b41c020b694d1b4e283f631ac43
5773 F20101112_AAAZIC hamlin_h_Page_120thm.jpg
3149cb981ea2723250b8467f4793d667
506ad73bbfedd73b3aac4507ba67be1565df4575
26935 F20101112_AABARL hamlin_h_Page_127.QC.jpg
3badb7a84f9b44a6ecc7af1800747e1a
d1091f1266848dad2d84bbc0998b00416995ee5e
24809 F20101112_AABAQW hamlin_h_Page_115.QC.jpg
c8aa084197db5ea0e89427c0c5a9736c
0c792c34bc3db2791c986db39211ac0e7983de99
45699 F20101112_AAAZHP hamlin_h_Page_065.pro
6768917724787efe64e4d1c859213e90
d334a6f65e24d479280f12a8056ec25e8f4078a4
F20101112_AAAZID hamlin_h_Page_095.tif
f8ed0247307d294e2ca9c7cc75702fe2
7860459392e273be3bf700fa6b251cd9a0fe0a08
6866 F20101112_AABASA hamlin_h_Page_137thm.jpg
e64c949e9bffefdd98d35c888ae050e9
286b021550e2ed26f84517cd24ee3b1f758c80c5
25561 F20101112_AABARM hamlin_h_Page_128.QC.jpg
6c294761a91a769de5e012e2f48a76c2
ba59d3cf805fc4bffd4ada479c9187f78192d15e
6685 F20101112_AABAQX hamlin_h_Page_115thm.jpg
31b19cb108559df978e10146a967321e
c8267aa01def804495871366c426b3bc4da84d14
23656 F20101112_AAAZHQ hamlin_h_Page_119.QC.jpg
936f478c1754690428e539145c4883ee
787d6a5d9ca42f7f3ae30e142d8eac6826c4e2bc
7344 F20101112_AAAZIE hamlin_h_Page_112.QC.jpg
51311159718d4a09a7717693f3686996
5753ebd9b68f73c048a5b388ed978b791c82505e
26178 F20101112_AABASB hamlin_h_Page_138.QC.jpg
9b53519fbbfba7097de39cdfc2c4b00e
f0b810af08885181aef28af2dceeb7d0e3f23e70
6875 F20101112_AABARN hamlin_h_Page_128thm.jpg
9608fb65d64b1e037f801c136f75ebaa
247c148d3016637c4241decfde4dacd94719fb1d
6722 F20101112_AABAQY hamlin_h_Page_116thm.jpg
3d1ca5dd506d50c27b4430c210b16924
4b5986858fd3f0a7f0986cfe5482ffdc099c7563
56183 F20101112_AAAZHR hamlin_h_Page_093.pro
90e8926846f54214b97a7d0f6b8f726e
9098d575caa77542c1aa0b9bfb0dc76c956dfee1
96355 F20101112_AAAZIF hamlin_h_Page_135.jpg
de33b47d62efd141be36d34b4394f251
9f280209456b99816d3977d03e5bad83d3f59bdb
7015 F20101112_AABASC hamlin_h_Page_138thm.jpg
962c3e736bbe875021f52895b020c119
83bb0dfb867b2a97c3478c4b17c0af23f5422591
26920 F20101112_AABARO hamlin_h_Page_129.QC.jpg
cd6111f9ef639c9e3e93b0417a8a4380
f6a4c953c71169bb444c87d9ec3e7e6d2026785c
24357 F20101112_AABAQZ hamlin_h_Page_117.QC.jpg
fa539320124ded8f1f842a17ac15f537
0c9a07302938210bef742c3f1910ebb1f1c4e209
55822 F20101112_AAAZHS hamlin_h_Page_051.pro
6223e8245eb92e4415c88ae88366e57b
6163590d5c897697713f539422efbfa4f6559370
103551 F20101112_AAAZIG hamlin_h_Page_013.jp2
974a2128ff64f33d0569653d362a0d32
b95a573acbb539549b180f858d023eaa87b10306
7130 F20101112_AABASD hamlin_h_Page_139thm.jpg
339d8f2b3997eff35975eb998b3f3ec3
d9da91b71ac0246cf4eb7529821060fe3ca3430b
7240 F20101112_AABARP hamlin_h_Page_129thm.jpg
94cb94fb8ca48a06b16af370ba289923
9df18f8181413b5f89a30970f389bd3d89974210
26499 F20101112_AAAZIH hamlin_h_Page_133.QC.jpg
de4c86928ca30f25bb0c104698290e20
7df281a24f55866aa8b86f26ca6c0d379cefa2ac
26358 F20101112_AABASE hamlin_h_Page_140.QC.jpg
7150af40d19fa24322f3b80178d86695
74a6d691d91c76fb9d42b63ca341e7e33ae3f17a
7118 F20101112_AABARQ hamlin_h_Page_130thm.jpg
87ad3b71cb40dc69452356272fad41ce
2d7fa893769c795083250cc1b1cee721e57c350d
2109 F20101112_AAAZHT hamlin_h_Page_067.txt
2ac367d96cbf26905dd74ba71e344e6d
6d954d8e5d00fb2f6ff91c3e672c56236fdd3366
103504 F20101112_AAAZII hamlin_h_Page_020.jp2
99587b8f9c8a256baf07f67954cb86c9
814e37cbe0ef687b267c91bb2c1217d78a0d07c0
7014 F20101112_AABASF hamlin_h_Page_140thm.jpg
13843ccffbe914ac272c6fec56e8c5b4
35fb599290ac2e50ecb746dad887cba4b9b549c1
25787 F20101112_AABARR hamlin_h_Page_131.QC.jpg
6825763159e80d204439c0dd76ca5f49
f796aef341789286e25198b9b9418d4b6c824fe5
25010 F20101112_AAAZHU hamlin_h_Page_004.QC.jpg
29959678839c9687795e28515a649a8f
d055f8d6b1f6fa3ea9d3f2e06b51401abeadb74c
52284 F20101112_AAAZIJ hamlin_h_Page_015.pro
489354164b3ded3f6526a90d168ad207
8645c5c233ddc691598ab04434962321cf98b6ec
20230 F20101112_AABASG hamlin_h_Page_141.QC.jpg
5928404ce84eb2bdbe5754ef81ebc028
dc454cf19586be49db85b27041f3051788e9d6d9
6910 F20101112_AABARS hamlin_h_Page_131thm.jpg
853646f6d0bef570ab154b6bfc80abe4
65fe27c1eae8ae1cd4e972e7c7a8a3b7cccb0fed
75222 F20101112_AAAZHV hamlin_h_Page_117.jpg
fcf0e19314d875138357611d2a52bca6
61cfa972c4faf73983a736a5aea70af4478486ff
79055 F20101112_AAAZIK hamlin_h_Page_053.jpg
821077492167e1e60e5690dd09a424fb
07d5058239889edd2d7a9ecbbc8372fb09739b21
13915 F20101112_AABASH hamlin_h_Page_142.QC.jpg
930f6814afa4c0cc20944f5978c53e1f
94ee77b1188ae797f50b97473c30fc1d8e9fd13a
7434 F20101112_AABART hamlin_h_Page_132thm.jpg
61daadd12ffe3710f4ffb19300cd05b1
e2bc9e40d788f55d26e26a9be96c0523a9d8ebe0
55588 F20101112_AAAZIL hamlin_h_Page_086.pro
4cdfbe288e409ee79e02e06f011ec729
c90285b5cf94b6a985e1f2ea8ff8af859e240be1
49602 F20101112_AAAZHW hamlin_h_Page_063.pro
ca889c45ad0f61204cf0f9f8a9f61378
ed23f9643b0a67f8e84543b14bbe4c7c75650be4
4014 F20101112_AABASI hamlin_h_Page_142thm.jpg
4b8f36ef4b78586ec23ff50291cbc78b
78b9d4f3b2607702be3ab82c2c046f086277ad47
7020 F20101112_AABARU hamlin_h_Page_133thm.jpg
e19d4a8c2d3574a260c975d75d3758fc
29173bc6f1a21135e7f761439c8f7422b73f33b7
114216 F20101112_AAAZJA hamlin_h_Page_115.jp2
7cd21ac7e02d9af0290970ba23dc1d19
f4d14785103280db6345a928a849ce6cbfd129cb
2107 F20101112_AAAZIM hamlin_h_Page_072.txt
c0ca570a3d54df2dea560545aacd6be1
76d236f58c65eb09329ad9a1cc9055e846d80571
26943 F20101112_AAAZHX hamlin_h_Page_125.QC.jpg
18c27875ff35baadc9d234ae63a2f5e5
722117a0320a9491d711883f812a226a9f07ada7
163890 F20101112_AABASJ UFE0019384_00001.mets FULL
20d8b46aa5369ff748242f7f07c92e75
8ba37ef5202f29d6fb2cc9488af92b656954caab
27645 F20101112_AABARV hamlin_h_Page_135.QC.jpg
b41d25e28972ff06ff8d8caeae4f48c7
165bd7f4d028f68369c01de62a84a9a9b37b4767
8423998 F20101112_AAAZJB hamlin_h_Page_075.tif
042e43f04a5e65cb7231619e040a7dc5
ba8608d6ebcce7d094158ff6be5fde1421bbaae3
59118 F20101112_AAAZIN hamlin_h_Page_136.pro
50c9d172cd004436d52292b6ea56df41
10502e56d334125cd8296bfa7cb72e96b4838eb6
2181 F20101112_AAAZHY hamlin_h_Page_060.txt
016eb33b65b025e94bf7606b81131b8a
829f52714b9a6680ba0f521df11520780c3ed5e1
7429 F20101112_AABARW hamlin_h_Page_135thm.jpg
b60d62be576ee91f5b4363171c54fbde
89704c47f2634081ee8d3ef2d74be23b9d796a0d
F20101112_AAAZJC hamlin_h_Page_107.tif
38f4e1eae9bcc6b1adbeb8fa7b349410
2cfd7e8373cd414cf6a3af485c20b834666e8096
579 F20101112_AAAZIO hamlin_h_Page_111.txt
53c57b602a514bbd8820c30708d49448
da86cd524ccc23828eb611c36a524ae9c7eaea23
358150 F20101112_AAAZHZ hamlin_h_Page_056.jp2
c9a1cbcb885cb5ea203ff0e4f18a5ea3
01eaaf7c82c73a6ebfd163768ec7db8e5b8affe2
6793 F20101112_AAAZJD hamlin_h_Page_025thm.jpg
2d1efd361fefc950a7bab8ee126cd7a0
46d7b2aeb4b3a932788201832296d361ccc087b1
77681 F20101112_AAAZIP hamlin_h_Page_060.jpg
bf03ede3f4df64b88c500e1e7b9fa73b
f08fa987a490f69b3ff2293781a8c5c48efef09a
24479 F20101112_AABARX hamlin_h_Page_136.QC.jpg
e22040752051639829a5480f778b469d
a7998efcd0ad35fa6205aa053e05666f67c9cf68
F20101112_AAAZJE hamlin_h_Page_028.tif
d023507b0e39a84d97a10546fe090f97
b7b4b330118f4d6ed972b25241333b29ed54116d
4342 F20101112_AAAZIQ hamlin_h_Page_110.pro
95e649493777b02b50d72ce063b3b3a8
e46aa560443aaf38939898ab3d42ce65a25e0c39
6803 F20101112_AABARY hamlin_h_Page_136thm.jpg
1dbe3ac6bc59d89bc91d751812240a00
99b46f505119dc07e31a778ae66aad05a23c4100
2034 F20101112_AAAZJF hamlin_h_Page_036.txt
d2d5c94ac2c63ec2568846fda16e9319
2e6cb95cb5803d0a6127a3c188d9a899cbdb14e4
F20101112_AAAZIR hamlin_h_Page_035.tif
635ca557142db2c55fe1b7f968df38d9
cae6d250c82ede3a03108473af7ed10c2946befa
24315 F20101112_AABARZ hamlin_h_Page_137.QC.jpg
a7938e3676b1ea68d548d29232324f8c
43793b6c7f96635debecfcaa3bb83b9e794b5311
138681 F20101112_AAAZJG hamlin_h_Page_139.jp2
28a86ef403ea5b4fb762c5c73400e380
22d8c08b47c2eb420e55f1f37ce6a10d00d2d549
51508 F20101112_AAAZIS hamlin_h_Page_062.pro
bf1c1fa9140ed3a28470d24f2e28b13b
e599ef516b12095f9755416c0c4e12ba1d3dbd71
18092 F20101112_AAAZJH hamlin_h_Page_054.QC.jpg
51efb6567799f8aaf92f1afdd6a5f280
852e9ce444b86113c74d800ab326b53e1a37fe3e
12874 F20101112_AAAZIT hamlin_h_Page_005.jp2
5d9ccc7f9f2be9e60a8b3f9928ca6596
3bcb799288b8b2308eef5de87ae4117297e6d64e
22395 F20101112_AAAZJI hamlin_h_Page_049.QC.jpg
910b4b1a710e3f6531d15582e46cea4e
07cfb00d4499049fcdc58cfa138834401fcde858
2160 F20101112_AAAZJJ hamlin_h_Page_059.txt
418d5b17ee79f05454d78116dca4e650
f2891082973f243a18dfa4848d6e2b1f8425b520
9863 F20101112_AAAZIU hamlin_h_Page_076.pro
67b3c682547ec36cbc6d49762bdfd112
fd784508bc680eb7edc2ad0588e8dc2cab0f20d2
10009 F20101112_AAAZJK hamlin_h_Page_056.QC.jpg
f6d12317255721723703eb10bf77e2f8
18d9200e31b48f30051cf0063f084ab8846ab951
53956 F20101112_AAAZIV hamlin_h_Page_084.pro
e51669868413bff130aad3e664b49b32
f26d7b7251e7f49f752f3e2a19414a2d6f06bbcf
65960 F20101112_AAAZJL hamlin_h_Page_123.pro
1ee8b16cd30f050ca89c7cc1e5d04d72
4d4a28057bfcb55eda34bb57f99405387ae6f4b8
7456 F20101112_AAAZIW hamlin_h_Page_087thm.jpg
adc39bc5e338301d9ebaa98cab5652d8
a5f4a49e94cd40083cba46bdf9ed9da9c6af7463
53581 F20101112_AAAZJM hamlin_h_Page_067.pro
581df592d6b470c2f87c0dc3a535b308
fac2946648f066577d8b9d62981d2ffb028f7583
6596 F20101112_AAAZIX hamlin_h_Page_090thm.jpg
0a96915c2e6918ef80d5ab3d0f7b00af
8ff7ee9e757573a72219e3f63dc7fcd433f3d6a9
F20101112_AAAZKA hamlin_h_Page_012.tif
21e64550724aaffd9636d279f939f2c5
05cb44226786df24f9fa4bb5e8f660ca3bea8652
1783 F20101112_AAAZJN hamlin_h_Page_005thm.jpg
6fd13d26162cc0e90d7d032087c89845
2fb8d5409d04db4b61415bbeb194cd6b4bc4616a
48762 F20101112_AAAZIY hamlin_h_Page_068.pro
fa83b73735dc5f7d38fcfe873b98e2da
720513e6621f08de237b683b953c03a018810d3a
25122 F20101112_AAAZKB hamlin_h_Page_075.jpg
a03cc4b4e75daa4e016d3976f19c2e19
4f06d2f95a052fb42184d4d282fe0c2309e41949
17924 F20101112_AAAZJO hamlin_h_Page_108.jpg
96df6382b7491e452e32fe27e0a0b98d
92f5b4c37cc20290df872242a05c56f21166eca0
27164 F20101112_AAAZIZ hamlin_h_Page_134.QC.jpg
12486ac0096e2da7b7ef34fc070df572
b58935ccfe0631f7ca00c46fac67f23ec1d0f925
55129 F20101112_AAAZKC hamlin_h_Page_107.pro
ccf1ad620151710e29141d73398b5571
1fdd2e139fc575bf0aed1c60f0074c4602b40b57
5987 F20101112_AAAZJP hamlin_h_Page_031thm.jpg
a6b54c527e398d719d0e5edd90576078
9588d8b5ca590ef7fd21cc9a68caddbba23a088f
37452 F20101112_AAAZKD hamlin_h_Page_079.jpg
06c807728cca23dc552f90062f87687f
973ac398ed18723f8e709a60086fbb842ad05750
262469 F20101112_AAAZJQ hamlin_h_Page_113.jp2
a92d70b54c9cf0a57c74c017be19c1cb
ba648899643a6209c6be1e45fbb50fa81e794aa5
24860 F20101112_AAAZKE hamlin_h_Page_116.QC.jpg
7754f5bcbb45160bacd73e5cd18aaeef
0549f1d682eb74a6942428044df098e5d1362742
48569 F20101112_AAAZJR hamlin_h_Page_033.pro
ffb114c17f206bf9da356c4b10300648
df18db9118364accff40dccde73ed69298f106d1
6488 F20101112_AAAZKF hamlin_h_Page_068thm.jpg
ef6845eb300874e736c6e10003912ad5
aa6149cd8ea47a83af7ab5804c5846836afe3952
27416 F20101112_AAAZJS hamlin_h_Page_132.QC.jpg
a8ee06c3cc8caa1783fd57e57fc2de85
058f35257d575f322ace6b270c5549d678b7e4e0
6515 F20101112_AAAZKG hamlin_h_Page_119thm.jpg
fc9a028e92cabecb9aa8ea7874f0d5b5
5f55db8abbe743c916d35158ac8319db335e9208
138327 F20101112_AAAZJT hamlin_h_Page_132.jp2
c6d19e6f9743fc9c456b6a1a910c87fe
4df78c30a7658e1dfa102d00be27ad8185048ce4
F20101112_AAAZKH hamlin_h_Page_011.tif
466654206a6e65b73cf440d38b626cb3
1e1848513457fd54a8c75033611c9d60a84c7d84
F20101112_AAAZJU hamlin_h_Page_020.tif
bd916dc00a13a31e73f3d2affbf6ee37
f42bc8a7a089d02b15a2a1182bcf2ceae183f8e1
73706 F20101112_AAAZKI hamlin_h_Page_081.jpg
5d14fb6136472df3cf71b22e96d19d37
954302ceee87c4d572c18c52a6130ea7130fb4f8
5079 F20101112_AAAZKJ hamlin_h_Page_054thm.jpg
9e1b63dd8533038c653ccb45caf83886
15d53022121295d8afb3227b1b3cc10651036cfb
115765 F20101112_AAAZJV hamlin_h_Page_071.jp2
7be5487553157a32373c7271565aecea
64bb6f5fcbee8c1ac2b0ab2e8a44b8f08743c9bf
55083 F20101112_AAAZKK hamlin_h_Page_052.pro
d0d69cfd5d00a30054af74357816efaa
2a0667c8745282a73350edded648a2bc323db5c2
F20101112_AAAZJW hamlin_h_Page_140.tif
0516c6cd9e38aace8982e34b80d415e7
d777a66aa7d99764252f06430d246cc2fa76de99
26108 F20101112_AAAZKL hamlin_h_Page_092.QC.jpg
c04a084e0ddb6d63db95e3ed5454931b
44dd75a89993c18bc7239fc1569eba82d4b04f5d
2159 F20101112_AAAZJX hamlin_h_Page_115.txt
442ed8049fd005338da1ac94ab6edb6f
45fc45153209b5d5ca99558389df3ff2fcb6c2ca
74850 F20101112_AAAZLA hamlin_h_Page_019.jpg
463065a44c751e36ee7826f295469abd
9ef0a4fe3b38ecd5ac3b0016032913da72ffd753
F20101112_AAAZKM hamlin_h_Page_135.tif
4d36c0173c30b71b632a60cd8e594065
18de1ba6a1bc231b6e1552bd0c1bd834103f94dd
52357 F20101112_AAAZJY hamlin_h_Page_022.pro
6f304b93c16486cdf0beba6632d587ff
23512246708c8ba1b5f600246dbbce1ec8e9736a
F20101112_AAAZLB hamlin_h_Page_116.tif
c8cbc20aefb3f50201aba0ce312ae445
9a6b314b4a9db431d2dc05d92ca5dc22796a2c09
126039 F20101112_AAAZKN hamlin_h_Page_140.jp2
3cb813507e2e2653b6543104c14fa2e3
7104d9b27400630e945453c1789aa2591ec72b43
6788 F20101112_AAAZJZ hamlin_h_Page_009thm.jpg
8ab1013ce2ed935380f65f3085a939a5
4dc5baad1bc81d6bde92b4b41fca77633faf18c2
F20101112_AAAZLC hamlin_h_Page_038.tif
a457d0525e5a2558a6d7d97d4618d4cb
c07eb8159c85edf10bb43b19b053c2d158a7c150
F20101112_AAAZKO hamlin_h_Page_067.tif
7cb210cac4f1972bdd6df0eb03fd6315
4e101f0cbff0e93c7abf42ae5b0e24b861773f6c
2245 F20101112_AAAZLD hamlin_h_Page_053.txt
fb25a736d72d3d93d4dd224faaa6e0c4
600a288d4e1f1702962d3549798c3cf512fba5d1
2090642 F20101112_AAAZKP hamlin_h.pdf
e70b8311bc6b38ed3eebe8d40e880cac
114df0581f076e13f45020c5d8ffb2ecb6a3b78c
92501 F20101112_AAAZLE hamlin_h_Page_132.jpg
39bf2bd16b04425acfb261cc44f4e844
acbe16663053721ba061707c57e5a208941a8fd9
22055 F20101112_AAAZKQ hamlin_h_Page_007.QC.jpg
b57c6432eb3864397c792cfdd4258258
1a1558fe4213bc3654c656aed3726949e5f52934
1818 F20101112_AAAZLF hamlin_h_Page_120.txt
7d052ebd52319ba69727918daafbfc32
b3b2e9eef009e852b858095774e20d6d016606df
F20101112_AAAZKR hamlin_h_Page_022.tif
a4324ad8838fd0c9fb2ea8c14ec2cff1
0b3a8ec204bf086fd6807332d4899381244c9c28
1362 F20101112_AAAZLG hamlin_h_Page_002thm.jpg
880444dd82ffacfc96a77464dd2460dc
df60fede5e043257b1f0d1d3da4c34513e38d9f8
86064 F20101112_AAAZKS hamlin_h_Page_140.jpg
bb51f69aba92c73f3a2076f38d70cc03
1eb70b23b295099e9ba6c0e3f25d24ae8c6e0d68
134243 F20101112_AAAZLH hamlin_h_Page_130.jp2
8f48fa86b4ac543f1fdcc73b3edf94bc
556a7d5c12ff923773099bc8173429417cd386bf
6121 F20101112_AAAZKT hamlin_h_Page_032thm.jpg
d5e4319e0f2f4bfdb8f20c4c8e4fc517
8d72316b2b7d83fd3f213430fe1af60dc410fedb
9733 F20101112_AAAZLI hamlin_h_Page_076.QC.jpg
83bb8f927b583789a3c9933622097131
1c610294279ac43107c5f6560e32983eef76fa19
46252 F20101112_AAAZKU hamlin_h_Page_031.pro
ad0ffbf41cfa746e52f9cdc7f856ed8c
0d52574d4e3bef0906b79b226539080e55eb7c1a
F20101112_AAAZLJ hamlin_h_Page_027.tif
741e7f9b5559f505593cc5e3e6462975
d496fe6c8a14f6dc08c69b8954ea578b23c80501
50729 F20101112_AAAZKV hamlin_h_Page_045.pro
83910b6cf9a63ead923011a1438c7332
deaed9fde7b3bf0bfc410a1856284dfd7994a151
36738 F20101112_AAAZLK hamlin_h_Page_054.pro
139af3f27c2c3f5bae8c8816afb94fe7
a01f66eab9545af2e9f8f74db9e5609c130fccf8
F20101112_AAAZLL hamlin_h_Page_057.tif
3317d4383ecc22ed355d679b6cb4676f
04bad4912147cedfdeb64ce542f66e88d687d612
23689 F20101112_AAAZKW hamlin_h_Page_106.QC.jpg
ec3855d6a024516cf06476cfd6dad14a
42ab65793d8ccc13d0721fa942e5d0719f562a14
43544 F20101112_AAAZMA hamlin_h_Page_057.jp2
672bc591e8b0e5131d7a349d4a5bca16
d867f69f6ca93b8562271d8ddfbe424b2762e6ad
16999 F20101112_AAAZLM hamlin_h_Page_098.QC.jpg
61b00925cb4fa00ed492ac455be73c0a
0065fc60153f7ed107b5c848bee5ff0dd2289d3d
7316 F20101112_AAAZKX hamlin_h_Page_134thm.jpg
836320eb13947cbe258550cde79b0678
6696c0c9a3998f3bfa817917a0368debcc1685e3
F20101112_AAAZMB hamlin_h_Page_022thm.jpg
4810e2a4e6bc85af7441ab5b3161cb60
6a9c933d291cd613120c8a92235873123d1149e5
16479 F20101112_AAAZLN hamlin_h_Page_103.QC.jpg
5003091cf4fca2138e9b72fd2fa1319e
df0b58a8bf746ea3c1afb868e356daf93d586fa0
21148 F20101112_AAAZKY hamlin_h_Page_120.QC.jpg
fc08990d1ba7ce576466b3fb18d8bfa6
9955c76231e8e9ff296201eb9b092a45c6dde818
2144 F20101112_AAAZMC hamlin_h_Page_091.txt
b533edcb6f539747c07a530f8b8f3282
d6ef4116babd1d1537c7dd5f96880fbc0ee408e5
21421 F20101112_AAAZLO hamlin_h_Page_011.QC.jpg
50dd84d41de2572c5e858fc0103a1071
5576baf1eea1d6404a661cc6898c73df78f72d65
1192 F20101112_AAAZKZ hamlin_h_Page_102.txt
6ab74449570d79f4146018f90153d004
33b2075764a5759b3c3aff7b10f38fa83b52438b
F20101112_AAAZMD hamlin_h_Page_081.tif
0160988fdcad641f2fac5bbece5a5f1a
a3052a54b4b4d27ec5e27178c68315c5673efda2
638 F20101112_AAAZLP hamlin_h_Page_112.txt
417e7b80baa067bd78748a773919877b
d47dc2765f44644356973330c6d9c745c9bee3aa
6127 F20101112_AAAZME hamlin_h_Page_011thm.jpg
60d08b84d6e4d274e6076c40f5efdb8b
75b1653ecb25103b0c0b087fe7a31581d051301d
7091 F20101112_AAAZLQ hamlin_h_Page_091thm.jpg
2eb32f0e1d9ad20f4162601dc5b7ab49
67de1922cd0b9f405e6dd475c6f29a983a537ec1
56128 F20101112_AAAZMF hamlin_h_Page_082.pro
62d6c30d9411ced8b19ce648729214de
fe8c4e509ab340ba7b43b3954dcdc931d8d42b46
6953 F20101112_AAAZLR hamlin_h_Page_018thm.jpg
052e945b72615317fe83f55a70358db1
0d01647dada6951976dc7cbda8522ec90c817f30
52405 F20101112_AAAZMG hamlin_h_Page_095.pro
715b611328385afa66234c6adc1760ac
a6dddb3e2059417b865c36f19c13d7b3cebdd73d
6469 F20101112_AAAZLS hamlin_h_Page_050thm.jpg
3a8ab01373b23899114e5a3b28a6cc9f
6b1916c26338cfe233695b30e62388edf985e2be
1829 F20101112_AAAZMH hamlin_h_Page_066.txt
62195ca369b51cf42fcf590856e7b839
30b5d2ac989d9a30e9e7cfc58f7f9a4591975141
F20101112_AAAZLT hamlin_h_Page_101.tif
15d92a31acb778d1415e45e20116b86e
41e7eda82327dd671e50a8f86d0448e5f4b74535
7681 F20101112_AAAZMI hamlin_h_Page_075.QC.jpg
ff093503cfa46f9926312607f043e300
5cf091484ce87a69ff7207962a2dc29d0f89b8d4
61228 F20101112_AAAZLU hamlin_h_Page_140.pro
9a9b7bfde6315a97b84466390d92ff2f
dc81c67b8f33c23b92dd2a933e3ff814e50d5210
F20101112_AAAZMJ hamlin_h_Page_093.tif
877737fa7957720ae50e5a0bc4d13abc
a98511027c2e28dffd3ff17ece9e8f631642400e
77317 F20101112_AAAZLV hamlin_h_Page_083.jpg
c7e81e91eee73aacbc51e7b24f341198
8e6d017e454556d88fdcb2298373c202fbeec0a4
7079 F20101112_AAAZMK hamlin_h_Page_093thm.jpg
ed5c9ef228a992733a56f064e6cf5704
ab6fae058333185896b298b65711102b8a133024
1910 F20101112_AAAZLW hamlin_h_Page_105.txt
8a44ce80ad3ff9754529cb3124e58580
d33566796531c550f88225993e02656c2e3ffb64
72987 F20101112_AAAZML hamlin_h_Page_050.jpg
1043228bc53a4120bed98e5920d954b9
d53f8a099a02fad09ccb9f3a372a6aff14b3dcd9
6999 F20101112_AAAZMM hamlin_h_Page_127thm.jpg
4443c4c09afefcf8d587faa31764739a
c07856b099d910f3fce6715d023b6d7bd6760d21
118407 F20101112_AAAZLX hamlin_h_Page_084.jp2
15442cc590bb7579563325c5ecf86085
51bf0a89defd518ae2fa6fd14310575a4efaaaa3
47635 F20101112_AAAZNA hamlin_h_Page_141.pro
b549479345ddd93ad0729657ea54206b
89f93c52782df639dbb3bb5408ce980c153b1056
64064 F20101112_AAAZMN hamlin_h_Page_121.jpg
ae7527f81a3726dcebb86bd027162ea0
42d7e1ac50a58e4a14eff97f6507692966d33c66
F20101112_AAAZLY hamlin_h_Page_103.tif
5a59cf104101099395aaa893456832d8
c8e6f365088d60f27f2e8d294f45b120405e308b
20465 F20101112_AAAZNB hamlin_h_Page_041.jpg
4f3e978b46ebd7c1eea7aa7e6e7ca9ea
33e9d30cdde6a0002981ea22b746f52da5ca3971
2131 F20101112_AAAZMO hamlin_h_Page_061.txt
be721055cbed5f5f8ab94cc0d3024da8
26a3647db36150f7887f08383c674803e51193fa
68950 F20101112_AAAZLZ hamlin_h_Page_127.pro
6b936fb8afbcaef5f8e8a42c3a11b47e
22c2d5647db3b61746255f6cee8e26c772035008
48566 F20101112_AAAZNC hamlin_h_Page_034.pro
eb46505e1b45723eb3ed4cd88d89724b
e8313ec1cab00007310d08ed077d8d883bb5543e
81886 F20101112_AAAZMP hamlin_h_Page_087.jpg
ad2fe2c01708b060a0aee14dd6a98dcc
a9aefcd2d3b6e2deaf9f19dc1da1d3bd0de5d036
19779 F20101112_AAAZND hamlin_h_Page_027.QC.jpg
3f579a2ddf790303addddf086b5f8b7b
74888a7d894fb197c348a771ac41878a68cd4dce
1051974 F20101112_AAAZMQ hamlin_h_Page_027.jp2
06552dd8282a73631f95040335525cb4
2ec21614d8c554155b7e7eb1c95eab829103cb65
9610 F20101112_AAAZNE hamlin_h_Page_097.pro
f4f43f5278d921b9721613f22a73a82b
80657b1cd2d1c62200e59b0e62e4642f789f23cc
69266 F20101112_AAAZMR hamlin_h_Page_096.jpg
f690ae7c2b63e6724fde7b20a9916756
e9bff709a72cd87d50f8771d28a8738063640e57
25455 F20101112_AAAZNF hamlin_h_Page_104.pro
562dfa354017d41860c62ace404ea063
5a24c9d4cd48100e5414dd011d609ac584312ec5
134192 F20101112_AAAZMS hamlin_h_Page_138.jp2
1b63ff5aeac09899e8e225b15c926c70
4c0ae3667ed1d2645a79f0d7658932b62df30b11
1244 F20101112_AAAZNG hamlin_h_Page_080.txt
d1ef2cd0c6c8ef94ff2e37dbb0841379
4185bee803a7669fc9dc0f3c0eafdab833ea1b36
F20101112_AAAZMT hamlin_h_Page_102.tif
87571440b7652ee50649a80a8c7d2e12
e883d7d3101d18c6b455a449d06fbe18ad133fde
100205 F20101112_AAAZNH hamlin_h_Page_066.jp2
6d1857e3c1d31608af256f82b1a40d1d
e8512ddacfb1266e66a1c791cfbee4a431c10543
56006 F20101112_AAAZNI hamlin_h_Page_064.pro
4528a6ca1234ab1687fec8b6a12c56e6
d798bdb6a5a28a13c7b87a4db15a0e836da1eea1
19052 F20101112_AAAZMU hamlin_h_Page_121.QC.jpg
682fc6b12236038e559d93a6477e044f
97326d1644b4c9a73df3a311cbc5c78af006a11d
50315 F20101112_AAAZNJ hamlin_h_Page_081.pro
1d725c0e795675678e766cc089560f03
ed7251ed0bed2f8cea9e5cb31eb14e58daa130a5
115546 F20101112_AAAZMV hamlin_h_Page_072.jp2
0db4c343d751ebd3d4359f7a49802fbf
403e835e204940f0a474abce49df4daf23df34c6
2112 F20101112_AAAZNK hamlin_h_Page_004.txt
cf6c5f7039763f0fde87b857f477c3ce
308592c0144c7a5011397b0221a9be2b9a4dfb9f
52127 F20101112_AAAZMW hamlin_h_Page_046.pro
4418c7739772a4e5ab5f8fc6c9e23a3d
73c0a5732aa473adf1732a9ab9386dfe0638f657
1051979 F20101112_AAAZNL hamlin_h_Page_007.jp2
89889e81aeec7d8fd4c6896cb9627726
c7b7fdd0e18733ff64db6667d5911cdb9470c471
F20101112_AABAAA hamlin_h_Page_064.tif
a8507e2574e93e8e049575b2c1589bd5
fefd76a896a5d7756422cf8ac1ee63581ce00bce
F20101112_AAAZMX hamlin_h_Page_071.tif
9870d131e736c5c2402d2924d355bbea
bc2559a86c9600059d6c85c9fe7919c435f5c579
26204 F20101112_AAAZOA hamlin_h_Page_130.QC.jpg
25363234c5cfccf6e71aff84e9dbde5e
53fc367c4be3d60d5d38b10a45e13bb402a01f39
1051985 F20101112_AAAZNM hamlin_h_Page_009.jp2
80bb12f6772a1c6a512c54664e4528c3
2320f484412bb7aee2fedff78dd9d48473a7cff5
F20101112_AABAAB hamlin_h_Page_065.tif
7596a5be84148ae75900c04903b3ce61
52d4f7a854f2ad5564e36d90f910c45c2b2328ab
F20101112_AAAZOB hamlin_h_Page_115.tif
37a176252ed3e1e2e41b669d110d523b
eb62f95c987500f0c015f1efdd979f9c2368d852
70348 F20101112_AAAZNN hamlin_h_Page_033.jpg
ca88d178a6a1cbc96d9d0361576ee4e3
074788050465652c2b50f025246da143511e97d5
F20101112_AABAAC hamlin_h_Page_066.tif
9a2e8e74bd207b17fd4f2333941dfb92
32169d58bc920dcf3d35093477600f500142618e
1844 F20101112_AAAZMY hamlin_h_Page_049.txt
01c1415f5aefc63c0c239efc6c4c023e
c6e93955df1ad4e44025697d207d6afe03e0d039
23791 F20101112_AAAZOC hamlin_h_Page_026.pro
fe04524732b0df486af9a99f90b5164f
811b17b2831f42379709f2501648892519a89de3
25774 F20101112_AAAZNO hamlin_h_Page_107.QC.jpg
3c59fc4065118847dbdeda37f3db4d1a
ca8c413d88e933085180fb92983f6994ebed741d
F20101112_AABAAD hamlin_h_Page_068.tif
4140f11a33528844e9db34ca0aee1f1f
c8d9e34a8cfbcf324439ce3ca20304ca68b41485
24322 F20101112_AAAZMZ hamlin_h_Page_016.QC.jpg
54753be07b4040374be7c33794f557ed
fc42ac18ac451e249fcd7bc6981691094b72ce36
1051916 F20101112_AAAZOD hamlin_h_Page_008.jp2
f52f1b4a649e4fb37472db6dc7a138bd
02b0629275c298611b998d623da2b71cb0642b57
98056 F20101112_AAAZNP hamlin_h_Page_105.jpg
805c92dbd7220678e782bfcf1112fbfe
1eac8b36237a373a4e158b6e0caae493e95c7199
F20101112_AABAAE hamlin_h_Page_069.tif
310199436b09a273b69bac07c2e29984
aa2b8fd8e551fa946fe75847a10aa1b3bf5b7325
3051 F20101112_AAAZOE hamlin_h_Page_006.txt
a9f964a8a6c8d908134837ecc03f46c7
9efb38fdf7569b1ad2867a6852e597057080258e
865 F20101112_AAAZNQ hamlin_h_Page_028.txt
d89efbd87415c6d31b17dafab6341503
eb1b452df5d539374dd4451d854e2e882389fbff
F20101112_AABAAF hamlin_h_Page_070.tif
08610c8de1a7b96ad97e24eddf6656c1
b75630c59d7fca0ac38e676cc9c4aaaf27f74e1e
686 F20101112_AAAZOF hamlin_h_Page_100.txt
e91af8306d48246c99643c3e1c1d3536
39ceb727b3b3f4264a8a0564c321a347fd74f22f
25556 F20101112_AAAZNR hamlin_h_Page_118.QC.jpg
388102d9adcfa555866392460c705df9
7f48f6e5082700618df6ad8ed38959b7f40aec7d
F20101112_AAAZOG hamlin_h_Page_034.tif
8f843864c011f4726754842b6aec6373
215bb7bac30e7aed3d4bb988769b38d79fb89d10
2519 F20101112_AAAZNS hamlin_h_Page_128.txt
5d2510f1eb4418ea6fd1190e99880833
db6ab6d7ee86dd5d47f1400b95c0f8e7dd1fd1b9
F20101112_AABAAG hamlin_h_Page_072.tif
099f364f351af4123cc38f61e8c2f92f
0a76751a273316ec85a6f68875bf0dade1ec6362
2565 F20101112_AAAZOH hamlin_h_Page_113thm.jpg
2ede0ce8d9eadcfe768f0eb4842d8b82
4f823abd7c27015193bb85132f3503f4b67a919b
1051943 F20101112_AAAZNT hamlin_h_Page_010.jp2
58b6faad772e3ecf8b7757d1aa811731
f05677ac4d15e8a39de1a0c53e813dde6d9388b2
F20101112_AABAAH hamlin_h_Page_073.tif
2d3a801d0d36e6e87c42fe0fb11f81a8
e6af72d912cc57255245410e377dc1d93e8ad902
2059 F20101112_AAAZOI hamlin_h_Page_022.txt
4883151cf3817e99984ec76bff248708
eb4964e24bceba3c302bacabe1b1a124a8a660fc
85574 F20101112_AAAZNU hamlin_h_Page_040.jp2
a6bf6c5e5a28f682f045290a564158ee
3c58199da88ee5e9daea5e5f487f225e7cf1718d
F20101112_AABAAI hamlin_h_Page_074.tif
73515f21ca955d76e6511e69d006eb16
5bef393e29b711057017ad67850ce0625e8e98bc
116091 F20101112_AAAZOJ hamlin_h_Page_094.jp2
2d7e8e201dd3d542e915281f38ba398d
d9cf7844923870caedaf31da35e0f89cfa7c8a80
108633 F20101112_AAAZNV hamlin_h_Page_024.jp2
9364c26eb9e3f42f1bbea442798f1834
2752cd628aae9bd627bff9dcc1fcd36bacdb2da8
F20101112_AABAAJ hamlin_h_Page_076.tif
6e7bf719b25816aeecdef5bdc48272c5
a47d7b88821e3fc1c4ce05a44ed0eed90366d965
2211 F20101112_AAAZOK hamlin_h_Page_093.txt
20b9846d80912d0ba4b57da71a374300
fa8dd6d29c0936701e669cd2989ad899f3c04e27
F20101112_AAAZNW hamlin_h_Page_053.tif
ff0968b929a130790a5b560810ab1d17
a08a5493bb01760cb3d1a7e79a1b7ddb8c4aa66e
F20101112_AABAAK hamlin_h_Page_077.tif
ce0694ed50c63d0f375f8715eb20ade0
327e6e0f10d72a9f0542f7cddec4692349b761cc
4032 F20101112_AAAZOL hamlin_h_Page_057thm.jpg
a779655b315bd0e37ec85ae498c6df9e
fcc039fb45535712d3c649932f5123afaa7c596d
F20101112_AABABA hamlin_h_Page_099.tif
79f98528a5b96cff0398bdecda8e493b
b05ddcac1bd3d785a78871989653a03798563a58
76734 F20101112_AAAZNX hamlin_h_Page_004.jpg
8dff5fd55d528bd9f0a1c805dbb58ca7
2eb39d14b43035270fce3ec10ad0caab6b2c8cd4
F20101112_AABAAL hamlin_h_Page_078.tif
fe47b3a97bbc21a52560ec71cd41f810
55ea4c4669250f14133840c03a185aea9994e986
13837 F20101112_AAAZOM hamlin_h_Page_074.jp2
34629a7cd568783ac836dc0b0e7170d1
77cf14692bb9afb7b56cec07bf00fed9fc055f15
F20101112_AABABB hamlin_h_Page_100.tif
729374aa46db2addb4e93bdcad76e0d7
6aebb0c20484ea7070f07f0a103af7925610ecb0
F20101112_AAAZNY hamlin_h_Page_054.tif
57539ff59fa3e2bf61e13eddcc41ede8
8dbdd157b5ed3733adef452d55989af6c26b3d12
F20101112_AABAAM hamlin_h_Page_080.tif
6de0ba623ba600197d2c73b25c8bdcea
aeb787f0cb39e1904d071aaf0e451efd736f0eb1
49409 F20101112_AAAZPA hamlin_h_Page_090.pro
439cfabfafb40f08619defb84871491e
945e3ad0217d39cf3e5ee195e325f0bc840ba883
F20101112_AAAZON hamlin_h_Page_007.tif
6f37468c536a1cf2dde6e03bede076ef
ffde7fc2eb75bb3aef097ec506166f994fea9b52
F20101112_AABABC hamlin_h_Page_104.tif
076ae437f4a1b198529d3fa8be090adf
cf9438397840ba9f93993212a34ac8ef7d547401
F20101112_AABAAN hamlin_h_Page_082.tif
7230fdfb98df3094a40bdba663f68612
f0c10e017dd1f4c88c959f2573ea60a7c38bcb73
18310 F20101112_AAAZPB hamlin_h_Page_029.QC.jpg
4776ffac96469854048a5bb278f78c30
4f132317418d6ca48cdb195d9ef54cba2209cb96
F20101112_AAAZOO hamlin_h_Page_063.txt
fd733020ef54138841f73c4a32785b0b
809753934a2f383e36126221766eb621b5b5f5c4
F20101112_AABABD hamlin_h_Page_106.tif
1075c0a7fd1d0627dcc4acc04cea914f
374a8f8db5245c9e3886705ae91907db24e52197
48990 F20101112_AAAZNZ hamlin_h_Page_099.jp2
939b21647e505008f21a45e068b3d2c9
80261dbbe518e50629f4bec4c3dc80f2796bdc06
F20101112_AABAAO hamlin_h_Page_083.tif
ce672ec92bb20a6e94dc63ced9e06d3b
dc1a4c46b0d2c1c1c54ced1ea86f33d9c0757895
454 F20101112_AAAZPC hamlin_h_Page_097.txt
df0f15c5309f2b10b8710c044a0ee8e7
22be9ded9ad0b9d09a400d2e2dc472c1b8db7383
2989 F20101112_AAAZOP hamlin_h_Page_077thm.jpg
738f9c7e546016ff66842cadf6097a78
e44a02d45fee721c38aeda577febc586f27acf85
F20101112_AABABE hamlin_h_Page_108.tif
f7712aa24a976bbea23570bd5f253cf5
f2558be44d2ba16ec94e430b3734af07d2f895a3
F20101112_AABAAP hamlin_h_Page_084.tif
481624ac3ece58303c2146bad64b14c1
91cedba7a57eecb89180e86a390850050179d0f3
1957 F20101112_AAAZPD hamlin_h_Page_034.txt
8b798872bba8fc697ef9532ff442638c
3371ca74f959620cb19834451301567f6583eafb
4047 F20101112_AAAZOQ hamlin_h_Page_074.pro
f01f41ad64dbd233b9e74a0ae8d206bc
2dd9e60f389fa4a820a0e960de4ef451a6256cd8
F20101112_AABABF hamlin_h_Page_109.tif
b299ed255863a64308883becaa36468d
42cb899d535a036d3596b01076a897d594938984
F20101112_AABAAQ hamlin_h_Page_087.tif
a8a3bb1032a66eb9cf968c8f68dec286
cbbc62f0bb5fcf04100c9a8ba2a09f1c658f8a30
F20101112_AAAZPE hamlin_h_Page_040.tif
7477e3150853a2b6a2c835328b43ef53
38fa87fa08d56461af796e70c5e1cf067de0b5ba
120848 F20101112_AAAZOR hamlin_h_Page_060.jp2
d5eb2a6911ef7c3cb7679f53e2876f1e
cb3a56d8accf726180adc148212c52f18ffad5f0
F20101112_AABABG hamlin_h_Page_110.tif
980e848bf2835a70b157b0a9e528f752
0713da464b4d4b03cdda1ba2ca88d5f5d1b89f1f
F20101112_AABAAR hamlin_h_Page_088.tif
02066cef743f63c1e806f724627bca9c
64885f036c26fa0946124d061a6f0e27cb30f883
945 F20101112_AAAZPF hamlin_h_Page_077.txt
e967e906ccd4e7831681fe6b6ead3db0
6f94874cb289452e1052b536bb018ed47f062bee
27596 F20101112_AAAZOS hamlin_h_Page_139.QC.jpg
dad645a881e51da67f4c44728c424218
91e6724ba4064e0bcfd9a5679df98bb8fd5c4915
F20101112_AABAAS hamlin_h_Page_089.tif
9174dadf9a363c10c7e290b7b1d633ec
0b6b947d7c46705b9aca2b7958feeee4acb07459
2191 F20101112_AAAZPG hamlin_h_Page_106.txt
c2da47233b1d6756e0b4ed3090068686
b040663273a3c8a1b6730a50aa68b9918faba153
47925 F20101112_AAAZOT hamlin_h_Page_013.pro
0122f619de59c2602584accf43034e74
e296dcf3204919c20155a9090a38928f788c8c9a
F20101112_AABABH hamlin_h_Page_111.tif
417a0942888b0732cf492d8d4c73200a
57ebb1311e77d21fd43021e39680462e5d94712d
F20101112_AABAAT hamlin_h_Page_090.tif
1f3050d96c738d09a357c9e062899a77
d8d0981c5a591967e54249bf0c806d5acd44b8ed
54519 F20101112_AAAZPH hamlin_h_Page_091.pro
4f6d7d15717af85140b4979444a1eb18
409f1bf95708cf07ba80786f2ac0a0a828fa0b2f
25572 F20101112_AAAZOU hamlin_h_Page_082.QC.jpg
928f55faf534ef3b631ec3106a22b7f1
f0527eff6720ef021878582d2ffece8289478570
F20101112_AABABI hamlin_h_Page_112.tif
cb6d57cfaaeb9c51b3f949ebf598f859
40c0d3f46cc76656640afec63c357c961082dfc9
F20101112_AABAAU hamlin_h_Page_091.tif
5569deaacfd6617e70a13c393b43cd30
000654717ddc3869c90f10b36f947f1dad5635ee
1998 F20101112_AAAZPI hamlin_h_Page_023.txt
4b0e1329d97b1a9af98c1fc8eb7c01d9
ecc482068ce6f05df49b364bfd9df4363885c79e
F20101112_AAAZOV hamlin_h_Page_045.tif
d0e800a97ae03bd48621e808efd99c77
46c68be5ee3bd53c34ff4773a4c5078474087492
F20101112_AABABJ hamlin_h_Page_113.tif
aa995b78928c298d6ca73c4e9c56ff41
b4c790e34623334ff35d5559a303021b1d887918
F20101112_AABAAV hamlin_h_Page_092.tif
1f221d64bdd079503ec28631e1d0dfb8
43f5967d254e00d4365307d24f3913c3a3e4d25b
F20101112_AAAZPJ hamlin_h_Page_016.tif
e8b5c6d549f233f0ce49e5dbab705dc8
c596344dd10c124fc87235aa7573a496e5c4d86b
1010683 F20101112_AAAZOW hamlin_h_Page_048.jp2
337f87a261f72856971e3113feb370e7
f50eb20f71d080d4db3aae116fce176f042db396
F20101112_AABABK hamlin_h_Page_114.tif
1d8e8b92a7db16de5b6edd97b31866fd
8f56459392bf8222ff7792fceb68d4db301cbd99
F20101112_AABAAW hamlin_h_Page_094.tif
1e88fa02a5c6e5572945e98f0d6fc606
3fc5cc9d0da2c54f5c58ea7fa9433477ee295642
65238 F20101112_AAAZPK hamlin_h_Page_133.pro
a44cb73465ac948ba2e9c6210138dfa0
77d1b94494c1bc2b1050bc72f6a9e3f6ba8e7fce
F20101112_AABACA hamlin_h_Page_136.tif
3100e56a795149de01a56ef37020358c
42deee14a5b3ae187f53a94076e8ed916f2fcd39
105132 F20101112_AAAZOX hamlin_h_Page_068.jp2
c0b12f2b3c8d0fb0a5670dbda305a7b7
76e48419072da635c36fe53537dd2a036c5fab90
F20101112_AABABL hamlin_h_Page_118.tif
42c89bc86a5464012190f46eb83555b3
a9a1e6b4efb94a527776eef4c75afbf64fbd85ca
F20101112_AABAAX hamlin_h_Page_096.tif
3ae7d53e2c4de32782d4016a3a1f67d8
cc644f6e42e78dc75a23281e40dc919119abaf86
70815 F20101112_AAAZPL hamlin_h_Page_068.jpg
1c78eb89ff1204b019813b638c48d1fe
eb3d85dce2a8c7d4d19e5bf2076e79df16f84f83
F20101112_AABACB hamlin_h_Page_137.tif
291d5d099cc137c54185c801c7374886
804eff771ad8ac1ad3d72596d69d6f143fc450c0
16117 F20101112_AAAZOY hamlin_h_Page_100.pro
04d0c60c92e56fd21d9d8c593160efcc
7575ed6e411d1681c1f896109abbffd678433844
F20101112_AABABM hamlin_h_Page_119.tif
6ac7e4cb59dabd00ef8ed20ab143aa4a
8b059004e9f8d6d15dc6a22ccffe4ec547437e0e
69455 F20101112_AAAZQA hamlin_h_Page_011.jpg
7c5102c94fadc5da24a812b5fb1f93e0
21811454ec950c5443e84eb0472bc67e436b137a
F20101112_AABAAY hamlin_h_Page_097.tif
1b26e35c02b55a1373b151b20ebfb413
3f40de8c508fbf8d5241e32b0c1bbe655c0b9711
54356 F20101112_AAAZPM hamlin_h_Page_054.jpg
af4092ee9f1893918e68349d397632c0
82cdbbff760bc524e317b7cf41c9e783d7589915
F20101112_AABACC hamlin_h_Page_138.tif
70bcd70c39d70642e2e52c24c41c716e
5914e78828e8f890c00d4250b16aeb16d227611e
2024 F20101112_AAAZOZ hamlin_h_Page_011.txt
9df0478babbe62a67a4b8725269f486f
55932b692e2d11b6f1d97184ef7c4864b901b646
F20101112_AABABN hamlin_h_Page_120.tif
285394d45eddb3d6e479e53c70291552
94c3fb84c82c92acd132bab8ac163be9f9b73f43
45360 F20101112_AAAZQB hamlin_h_Page_012.jpg
7966fcd8941379262c70712cb1a3107f
c36afb2df4064553ef99d09aa2c51f57d022e338
F20101112_AABAAZ hamlin_h_Page_098.tif
593c00e9055d166f2874cb9803dd3d5d
44005f970507dbcf6257d4eca1c465c4683f3e29
74234 F20101112_AAAZPN hamlin_h_Page_007.pro
5d429cf6e3ebf40870171fedc531efb9
3feb7e25048d395aadcb7f07138d8604935a672b
F20101112_AABACD hamlin_h_Page_139.tif
7e5aac4da2128f88d7414f84b803e736
f742a033f00fc35068d936608b9ee4d0a8586053
F20101112_AABABO hamlin_h_Page_122.tif
18c30dfa44d074f7d7e414743e474a5d
c3bc2c50a7a3a74db211bc1e0cc21b1f34631543
70002 F20101112_AAAZQC hamlin_h_Page_013.jpg
27c548cd328fc5df5969e5f3e782a0b1
92cfdf04371fc1d5a0d4ad2def294a1f57769ab7
212425 F20101112_AAAZPO UFE0019384_00001.xml
e545954aa84f033b4a9748b0abef60fd
11f61bb49cfd1ed18dd610f1d3e9e9f7f84f7893
F20101112_AABACE hamlin_h_Page_141.tif
1097c4991f45e11a5ce3189a3cc81915
fa40bd905a2e7c3b014c50794dc9c85086f52c76
F20101112_AABABP hamlin_h_Page_123.tif
8c43cef422a3b10e0a0dc6a990d96b10
fb69b96d982a55d3576aa32186c9f63f216f1687
74399 F20101112_AAAZQD hamlin_h_Page_014.jpg
61480b7c77b4165307a490127d273df1
7ea2b51985ffdc079d339adbf807c85486ff8d77
F20101112_AABACF hamlin_h_Page_142.tif
db6d3cdce20e5ae445d90f3bede757b5
e27d486957701d07d32cf358f2768c016e3c329c
F20101112_AABABQ hamlin_h_Page_125.tif
f65d7838ac6e03d5b36e62fd25c122ac
f66d5ddfb1f7a707c510d1c4a76b1ffb0cd0f193
73728 F20101112_AAAZQE hamlin_h_Page_015.jpg
767c996a6ccb6a113e58b24c285d8711
fe3450c5037fcb181e9969e6738eaf1e28a85e70
1224 F20101112_AABACG hamlin_h_Page_002.pro
5b99fc8861157b4e2222b0e3ed753bcb
e885af643928b1f5f575393c4c052dab0ec01f38
F20101112_AABABR hamlin_h_Page_126.tif
19d0d94bc2b7430e9ae981d49e46c6bf
a66ab3ed677c92c883dd7dd5c095877288bdd980
75112 F20101112_AAAZQF hamlin_h_Page_016.jpg
7329bcdd5b1bbf61571ee9a7979786bd
0460cc6fbb2e726c593b1ece6a34f6b7099e81cc
24591 F20101112_AAAZPR hamlin_h_Page_001.jpg
70daf90debbbf523bdc34f123d4077a5
a090f1ccb3caf00c1456dfab22ebb1096817d3d4
596 F20101112_AABACH hamlin_h_Page_003.pro
981a641f4efcc1c5cb3172100179b212
e5f4cfd4b2c3f87307db4799ecfe30f9f1fe85e4
F20101112_AABABS hamlin_h_Page_127.tif
7ef0097762ce9c2a0e737527b4e9bbd0
23cd36e2e0d2bd8881976a300fc0a41e7c70ca0f
74672 F20101112_AAAZQG hamlin_h_Page_017.jpg
f03feb666e4bfbeded7712dfae2a3431
9d7eb3921f5595ad982c4a86c97bad54ad1f7482
10308 F20101112_AAAZPS hamlin_h_Page_002.jpg
2399a2c1afca121aa432e725ab23d99f
9082431fbd751fcfb0f245295f9ec4fc17268bc6
F20101112_AABABT hamlin_h_Page_128.tif
855d34450859afb86ca542698abbf7c0
e488922faf38fa255ef5ed6c51fb2d77f265ba98
75967 F20101112_AAAZQH hamlin_h_Page_018.jpg
ad85a96d1b87b1d7122dabc758052402
303843d8efdd0a4c0e42b3f698b0865340985b85
9397 F20101112_AAAZPT hamlin_h_Page_003.jpg
95ee91621158c10f3ce94c05d9a584d9
05cb54b90afd2a77f6fd8f892fcdcb0f1b5393ea
52792 F20101112_AABACI hamlin_h_Page_004.pro
4d9cbd1ce72c9a78ba971739944e4307
822b9734649f1ada5fe84f88500961280dc00a38
F20101112_AABABU hamlin_h_Page_129.tif
f0ec7d50be95923008c3d27f328a9923
64562bd72553b663e5f9ba7c9447fcc9b58442b0
67146 F20101112_AAAZQI hamlin_h_Page_020.jpg
d294ea5a374f9f726834d846a85aa4e6
7f8c528a344f9596dd33302f64bf7c2d502a96fc
14378 F20101112_AAAZPU hamlin_h_Page_005.jpg
6b35c695cdfbe014f548928e6300523e
b44b23947bc0876aea45f47b22834e2aac1863d1
F20101112_AABABV hamlin_h_Page_130.tif
5bfda47ebd9503fe344e72b4668ad35a
6d8dd01d486896df838108926c18fa07f601059e
73821 F20101112_AAAZQJ hamlin_h_Page_021.jpg
0007883e89595298c5877814bd978f04
a78c8d45d644b4e83320358455bad788021533f6
81574 F20101112_AAAZPV hamlin_h_Page_006.jpg
6b702fbe6a416d800aff77f4e3fab84f
c6c5a41d3fe3db7c97c3356b98f7397dd9f4955d
4485 F20101112_AABACJ hamlin_h_Page_005.pro
1eebe82d2c54f6aaa14a7ae0d689e3fb
98a72c815064c66cfc38b61104393ba85d003ce8
F20101112_AABABW hamlin_h_Page_131.tif
d3f48a842672d4aff4ffb4b21c561fec
280e815d6518de3c087e5087f1c46d8f35f46a64
71328 F20101112_AAAZQK hamlin_h_Page_024.jpg
c3ca271a5e5c5bf41b626660a03e5da0
9b3390a43c8b92a2a067ffd0a9088fa55eae0022
90939 F20101112_AAAZPW hamlin_h_Page_007.jpg
645e7d4747cf5393c5e65cc47ea90768
e1973f1606a0e3dbcac7d338c622615c304d9be3
69837 F20101112_AABACK hamlin_h_Page_006.pro
2f8dc8c10c50c1bd628c45e5e0785f4a
9ad8c8fe9512bb4df8e53a5f4a15fd51e4f55e6c
F20101112_AABABX hamlin_h_Page_132.tif
8a564fb06ddf75ee5338282f8f8f54bb
21839833bfbf487bb655dbc9e956c561d85b41dd
75186 F20101112_AAAZQL hamlin_h_Page_025.jpg
5e2928276c85668c3c60dc5a5b848751
418d5ad878932cb2fc86c0a8f10e33b250d3286d
24122 F20101112_AABADA hamlin_h_Page_027.pro
3f3a27df350f128967b65e58a3b28075
cbfc17227cf6a3a040a8cf5f4a92d7de4f6fe369
43586 F20101112_AAAZPX hamlin_h_Page_008.jpg
f5cd07ff206bada8791fe2949133b98d
86c6e609f777a967f4996d70846d2127b88fb6e6
23348 F20101112_AABACL hamlin_h_Page_008.pro
2726971fb8836a726d2e4c5e9f1447d3
52929bd3646356de8e260c467e4e3cffb6ee13e2
72143 F20101112_AAAZRA hamlin_h_Page_045.jpg
53e6897969290f00228c5cc8387209cc
bd7aa715dd26d46036d3934a5dc6dc7adc7f8c7e
F20101112_AABABY hamlin_h_Page_133.tif
54fed3d32103eea9020dfbd31eebf72b
ebef49404883246ab1ccee60433b16d3dd473e08
39178 F20101112_AAAZQM hamlin_h_Page_026.jpg
9dfaf9ab4d3708bc5a24d5c02b600ea6
897e49db6e49112f11949727b72f82b64660c7a4
18734 F20101112_AABADB hamlin_h_Page_028.pro
a088108ed985c842464a51eb629c361b
98e7608ba401b5d83263e47adcddad880b0ccb84
100407 F20101112_AAAZPY hamlin_h_Page_009.jpg
76827402f745d274739ab69cd369d236
ccca5c51fa8d1f65d1c4f7881b132930a6536f4b
65696 F20101112_AABACM hamlin_h_Page_009.pro
a3bdbf192e2193cb381d7b6260df38d9
93cec739c48537d33314d4608fc3fff9c92514e7
74939 F20101112_AAAZRB hamlin_h_Page_046.jpg
407fbe2aced9fb68e922e2bc4cdd370a
dc6d7818fa97358c969e1a2a3a505e7a5ab45555
F20101112_AABABZ hamlin_h_Page_134.tif
0fe662ee1b0b6b165dbcf663a3996bdf
9a5111193aeaca7c243ec0f5ab0de73057c9c611
67349 F20101112_AAAZQN hamlin_h_Page_027.jpg
6f2c8db8ac035e099c8ecade69bc3233
7f187f7a889a68374378e619f1ebb5e0f599cc1c
16669 F20101112_AABADC hamlin_h_Page_029.pro
8b284b7c14106a9254b6927b96d01f95
a3269a358a473b236b687ae9fc2074d6328e1122
88100 F20101112_AAAZPZ hamlin_h_Page_010.jpg
8006c6ce81236fa54a78e8389830a3cc
505778d3f7f8340a13c66cae16f9607bc2b49983
61741 F20101112_AABACN hamlin_h_Page_010.pro
3637b3a9abe894d8996c076dc785cf77
21be4ff12677378f5800350e0c21eeee11480d29
78571 F20101112_AAAZRC hamlin_h_Page_047.jpg
9b3afecedce0ca02f12914da0f11ec7f
9322f19b82b3df652d4687e471a3309209276caf
71490 F20101112_AAAZQO hamlin_h_Page_028.jpg
3debe9dc455e47368a1df150c2d6d1d2
8f9ee8f71593e26dd7c1587cfbb49294653044d5
47809 F20101112_AABADD hamlin_h_Page_030.pro
fae91688ba69c979100f7fd5e9bb66aa
6b0c131683df5ca8145f70372d472c20755c7850
46092 F20101112_AABACO hamlin_h_Page_011.pro
5c9a0e28194aad5c9a2f4079776bfcab
e6162b3181650bc1d56f716d424138823e1ca595
71600 F20101112_AAAZRD hamlin_h_Page_048.jpg
1fa866c38eb3e789aea6468a047deb9e
793a7cb45c3d4a32d9cd2644dfae8d03a05439ed
61833 F20101112_AAAZQP hamlin_h_Page_029.jpg
956f8f2b551265648728c5ce5b554d92
42c3a0d8c4d3a5e8a19eb2a6764b1b0e264fe756
45152 F20101112_AABADE hamlin_h_Page_032.pro
6bf281e1a0625f564b56be5b7dd1adee
e2a045b536da06f0012b9564d2ca88915ac5dbde
29359 F20101112_AABACP hamlin_h_Page_012.pro
daafa73b72fd68d670b60fd09dfd0882
e5a1915d7b2ca646479ef5f160d009c5e7dd57bd
67050 F20101112_AAAZRE hamlin_h_Page_049.jpg
21e033f3793e4db1eb3754ece8773726
25ad5105d6062a54d71ffafad5aea308f2819768
69691 F20101112_AAAZQQ hamlin_h_Page_030.jpg
6baad0520539575ca56dbc559569c488
a61987679ea332c20e3c9ee11807a5b53a34d47a
50251 F20101112_AABADF hamlin_h_Page_035.pro
0fb852096022400abca961cb5fc60c66
3414a0a5d9615270fca6465890c132564bbbd579
51560 F20101112_AABACQ hamlin_h_Page_014.pro
f12cb5e67fea1598b7bc5fa1ffdb305c
c20f33bcedf4e69810b26d5b1ba150a41af64516
76606 F20101112_AAAZRF hamlin_h_Page_052.jpg
e4a30ae2460caa1bf0b803fb87695638
8d9e91e60718148d8029231b6f7d2c0c3f7b511d
66417 F20101112_AAAZQR hamlin_h_Page_031.jpg
a45a77423c5fef7dd732ceea7df25044
37c838484f6bf04903007d69ff27ca9447e24aaa
51670 F20101112_AABADG hamlin_h_Page_036.pro
dd56127b5546b044c1f022e9977e78cd
1f8e61b4709aaf9f1b4f9ca77cb04821e872d279
52685 F20101112_AABACR hamlin_h_Page_016.pro
442ec9a9d301d0dbf23e717b8908068c
6b616fb2d505bdcc51188d6df9339e4ea51b28f9
20200 F20101112_AAAZRG hamlin_h_Page_055.jpg
5c23d4f8fddc8b118fdef1c4405a9df7
9d044841e55c44a1a161f86961d389aedb87464a
67086 F20101112_AAAZQS hamlin_h_Page_032.jpg
135e2f38291390dfb9a19042aaac24f5
a967a2e00a1fdd88a945dc40a9d248b12a9cc3f3
53482 F20101112_AABADH hamlin_h_Page_037.pro
8e1d0e22a372b0a322b1148876fd3dbf
b31bc2391eeb74bd1a97be731fe3ef526689f825
52896 F20101112_AABACS hamlin_h_Page_017.pro
7447f7f5850ba3f45f9fad66bc9f73c1
17f54bc5e96508a8ef96b68d31239ffccf09d89e
34117 F20101112_AAAZRH hamlin_h_Page_056.jpg
76b53faafbc55da64f90b39a8e8b2799
1f770d7cf95b53b92f67ea560e683323a71ee871
71274 F20101112_AAAZQT hamlin_h_Page_035.jpg
3cb9faa91b1985732ad8b53ade48bd51
a4c271bd5c541acd43ea65d003a68537d0ea092b
9934 F20101112_AABADI hamlin_h_Page_038.pro
d36d962c90e55d7f8e3aa02ccd319f74
fb055af1073d1e87d822e36b1814671529c608ce
53492 F20101112_AABACT hamlin_h_Page_018.pro
47f4ec0fcb2f666488081a274b18edb0
3d51cf0704c2fdbb1634ffb523e792f2454eeebd
36338 F20101112_AAAZRI hamlin_h_Page_057.jpg
a5d6b0f2b11f8cb8ffac3e54ae21fe57
54c7b48cbe6620048ee82ca144ddf42be147f0c4
82122 F20101112_AAAZQU hamlin_h_Page_036.jpg
d88962b57a3e94dece0b4c357ef109b0
cd4d9ee258acacef83ba3aadbf47403413d10ee1
52089 F20101112_AABACU hamlin_h_Page_019.pro
cd33b1b79ba880b728ec5cf1885b3dc2
f4ddf334be3435acef8a7ac0a3833bd808942bac
78828 F20101112_AAAZRJ hamlin_h_Page_058.jpg
43cd3d8594ad57f5293ba27c46ae788f
9e491824db54f7f3b61534572cf009af99153b22
83139 F20101112_AAAZQV hamlin_h_Page_037.jpg
9bd0c5f97e31c8c72dc710d35bb3064f
483e915e2ff25bff600d57634343b60dbca4b35b
15837 F20101112_AABADJ hamlin_h_Page_039.pro
df093cde9287a2449060f149d2010ecb
69eb6eb158e9398672eb82c40ad59b5161371bd6
47576 F20101112_AABACV hamlin_h_Page_020.pro
78a2876b5468bd43490b3845c1eef268
14d0b1b0a7b431ee2414a9938324226054017c15
86216 F20101112_AAAZRK hamlin_h_Page_059.jpg
94607f6dad1fc33b45eb84cc1abf12fc
bc901961ddf6f10634abe2e45e4d4e0855f6203d
20447 F20101112_AAAZQW hamlin_h_Page_038.jpg
8a4cdf3706997cea54d3c9dd451672b8
eaf408a84e6bf5b62cc5c2c1c43dc694e838f558
37236 F20101112_AABADK hamlin_h_Page_040.pro
c4471ad196d3662deedaceb119521038
7616809247d44bbc218ec4bcf25be0796b145487
52571 F20101112_AABACW hamlin_h_Page_021.pro
783bec9284fdcd8b07ede2d741b1d1b5
ea17ae1deaf9abe100fccc0aca2ac74e05327bc3
74956 F20101112_AAAZRL hamlin_h_Page_061.jpg
a9957fd5af6cb4a5e2136ab5a1e3316a
61ec2cd59714751893403d535c4c10db36b819dd
45006 F20101112_AABAEA hamlin_h_Page_066.pro
da9045fdbd5203162affd6e2359bb32a
270b15a4a6f187438079f3de66f0b7358aeed7b2
76430 F20101112_AAAZQX hamlin_h_Page_042.jpg
bae6e80255e40a5d390d7c07be403ccd
e0df301bfc40caa3e3ad78b1d76321936934ef54
5966 F20101112_AABADL hamlin_h_Page_041.pro
877db36ae4b39999f00089ffce28b46a
92066f36d04b34b5edbdec7555fcdf3d795534c8
50840 F20101112_AABACX hamlin_h_Page_023.pro
4af258f1135d6e981ef715f7f63e70df
a20b79e3d4fcae9d3ae8ba3b182f84e3934ebff9
72941 F20101112_AAAZRM hamlin_h_Page_062.jpg
d22d83b7fb3c06a431b6b3fab4a0e144
5e25aa4b8b8f2977a9e40832a45a976ae214b7bb
52308 F20101112_AABAEB hamlin_h_Page_069.pro
bb1d88fc85dcd2333dd3f0e18382c392
fcadc8b6b2203b0ed1ca498bb9e689a8f94c7367
78116 F20101112_AAAZQY hamlin_h_Page_043.jpg
c42a9c5004712fa2fbfe39056b0f891e
c14f56a08c0178c5dfd93d64f926d0ed99bf4242
51840 F20101112_AABADM hamlin_h_Page_042.pro
d5545219f2e8fb7c45b8cc14becee1f7
6052d0847078cc9825b6f361e866e1133bfe3be0
29849 F20101112_AAAZSA hamlin_h_Page_078.jpg
c5db769e46c2d687080a425308cd90bb
10cd1ef93a791b9a39bdade8c336a2e0068cd976
50753 F20101112_AABACY hamlin_h_Page_024.pro
9a695f39d0b22ca243b7c159ef70a8e7
48c566b2f0d0e1d9ebdd6ce07e1287cde3a4aa41
71094 F20101112_AAAZRN hamlin_h_Page_063.jpg
c40453ec8c546949a6a61626fca303b3
9a595ff6a96e8216793e38db3b338f3515b0eba7
55664 F20101112_AABAEC hamlin_h_Page_070.pro
1a31597ceb2689356b7142b3a653b3d8
9db3a97a31af5a358cad214132f521fd08d7b4ba
79287 F20101112_AAAZQZ hamlin_h_Page_044.jpg
92b14535fea08f95ba4e159e913e1e83
ced5c063bdf7924079da4a54a9ac3aa269d1d64c
55735 F20101112_AABADN hamlin_h_Page_043.pro
f5021d4ded36431a17591a2b054cceee
51283b1e3a0835c16b4467be839b4ab516b0edbf
38242 F20101112_AAAZSB hamlin_h_Page_080.jpg
b1cfc1531d6193b2d0b172d0b312b153
29821e1ffbf54dfde0d1d490384524f9e8ae2dd8
53831 F20101112_AABACZ hamlin_h_Page_025.pro
399f89c3f53d5bc3d20b63643cf5e094
507ff57461e62c35dd0bf86a916089643c66f1c8
77740 F20101112_AAAZRO hamlin_h_Page_064.jpg
099e770fd589b53fad5a0e897026c9b8
53abbf6afcab011256580d5cae43f55508aed9c7
53837 F20101112_AABAED hamlin_h_Page_071.pro
83cd3524fc63408091a08ef758f1f429
42391d361c95ec6ba4fe80f50c7b252c5baadb80
56000 F20101112_AABADO hamlin_h_Page_044.pro
406ee2c478cd6c6db76654b1034fe961
6aaadf59c3f74627f2be351048a4fca0b089c249
78447 F20101112_AAAZSC hamlin_h_Page_082.jpg
1198cbcf34aeb57e9e6c92ce7f45a705
005723d71958befcfdcdb8b0cb3be82df1e80f1e
68392 F20101112_AAAZRP hamlin_h_Page_065.jpg
4bd2c9b762ba975f3bddf087e30c26b1
fab456c717f82129b9ed8a26cf1bfb26ab582016
53660 F20101112_AABAEE hamlin_h_Page_072.pro
9f5e3b7b22f47cffc0c12c3414e6c159
ab4f8391280c7bfd57eeac4838b40d46e665ecbb
56019 F20101112_AABADP hamlin_h_Page_047.pro
0b8ff7e07cbc8bfc7222770e71e57cea
73bfaaafd0bbf0b44236ab79ae1e506453fa0b6e
76767 F20101112_AAAZSD hamlin_h_Page_084.jpg
bbfff7b3d3d16d3a1bf7080f70d65d0d
b15be59bdfc9db58acded23f1038ecf7fdae3261
66709 F20101112_AAAZRQ hamlin_h_Page_066.jpg
0e29a1bf5a7592b45103013d1eff3fb5
017085f7a7b184d2149bb931c3b1eebd1acbe15b
54948 F20101112_AABAEF hamlin_h_Page_073.pro
65b59b92f9ffec8e9b8639bafd9328ca
791ff92ebd270047c65d8f51a51346c11fc54642
43904 F20101112_AABADQ hamlin_h_Page_048.pro
871f5b8d6dd605d561f65ca851c3837a
8d759b0d8cd2cba253064c1c8a4e34aab531eb4a
71585 F20101112_AAAZSE hamlin_h_Page_085.jpg
ee6c94b878002cec5b199916204f658e
670b98ca224d8ad72716988650f348135e75f464
10000 F20101112_AABAEG hamlin_h_Page_075.pro
9b6d936f386c424948aed3a660c5116a
eae6b66500a31c05eca87035f2f677d8cb8732b7
46636 F20101112_AABADR hamlin_h_Page_049.pro
d29e7e5d8f4fa4fa8a7f77090aca6c81
5765f1721c31dc7706ca5a11981d4e2b7c4c2549
79606 F20101112_AAAZSF hamlin_h_Page_086.jpg
3bbefb0dd1c8e5027f42287dda2e7aef
6ae7e799ab2d969b4468b53f8f9a35a0193c5e66
76341 F20101112_AAAZRR hamlin_h_Page_067.jpg
b8899ba946d105843c480f7a8cc26e71
279b5f81bf2679f3051c84c04a63ab48edec870f
15046 F20101112_AABAEH hamlin_h_Page_077.pro
da887238271ae7736bc716fdc0395a32
efae97795bd4f71ff24c487797a19032d2ac0816
52193 F20101112_AABADS hamlin_h_Page_050.pro
ce097a130d83403b6666cbcd9fea5f58
fe427a102c20ec8f605a420e4bb60254a9b97c81
75619 F20101112_AAAZSG hamlin_h_Page_088.jpg
6a7a56ff8429dfad91b5a46cad47047b
e839340b7a554bca961feda3259c8e258c937501
73854 F20101112_AAAZRS hamlin_h_Page_069.jpg
300cd276e7f24afd9450a95230c9e73a
4a64eb5ffccfa525f6857ecd76f888bd6dfa2983
12046 F20101112_AABAEI hamlin_h_Page_078.pro
01288830c91ec963f0b3af372e10eb07
f3c6f8f1b8bb29da8a68402d3f559def07784026
57194 F20101112_AABADT hamlin_h_Page_053.pro
9afb1939ad5f0d71e98d0a412db48938
0c669f9990e2fed2d9ba47eed0c53908f56f321a
71728 F20101112_AAAZSH hamlin_h_Page_089.jpg
c59b92dfbf571693ae6d82e194f2e1a4
c6a5be757d160e38b0e842251d1024327ba28f3b
77717 F20101112_AAAZRT hamlin_h_Page_070.jpg
c4ebe8e9e7bdbe94245e6df5f722d2ff
5025aec575e42e0218150747bd94524599957b2a
12264 F20101112_AABAEJ hamlin_h_Page_079.pro
853e732d11acf6f0062a2f80e5c9e20a
162f4aa8f6f4a79cb1563f039157d950827862dc
6370 F20101112_AABADU hamlin_h_Page_055.pro
60f9ba221fb44d75061f285849407a94
4e529b07ddd08e1318bea6c5ff6bb08642c38b9a
72677 F20101112_AAAZSI hamlin_h_Page_090.jpg
a23102b0e93ed5da3894cf6076f661f7
2d02f8c56dba737b0cf709e6c622cd142c978ef1
74807 F20101112_AAAZRU hamlin_h_Page_071.jpg
23f0f75eedda9399833822fa28013a79
44ea7d5d217a427843cfcab622776c0cb0606d62
9081 F20101112_AABADV hamlin_h_Page_056.pro
18b4f3a6e1a76e49df4cc572965c5faf
23198c61b20bdc264a8352a342c62f4c56e698eb
77844 F20101112_AAAZSJ hamlin_h_Page_091.jpg
dd65b5ebf89163eddcdb696adf117aff
b3449c2a23c12b682d0f671819343178fc46f4de
76200 F20101112_AAAZRV hamlin_h_Page_072.jpg
a02e23e84b0a55c2f33d909bd149bce2
1e0be127a721d2cf68234c76592bbd827dd5d309
14533 F20101112_AABAEK hamlin_h_Page_080.pro
cd7f7a89c5b3a533870c29092e82352b
aeaf3b756c7f5409f3a7da06298cace78c230924
16711 F20101112_AABADW hamlin_h_Page_057.pro
fdf2e52ed03136c9024892abef99c2da
da3af43d6bc6b30a4bc4b4ed8bd5bd05a25bdfdf
79765 F20101112_AAAZSK hamlin_h_Page_092.jpg
e657d700d8f0a5f6b950a657d3a5ea90
dcb7bd8415bd38e16523e6f77e25a5169ebec877
75826 F20101112_AAAZRW hamlin_h_Page_073.jpg
aef918baf62b9c1619486be733eb2834
6dc0c342139d1b5b248f316f6fb41e185fa583af
55309 F20101112_AABAEL hamlin_h_Page_083.pro
a80356d8ca75759dc768a06477d339d2
cb8a4753dd0cbb5e2ed66bc50bd3b9779b59ccad
53339 F20101112_AABADX hamlin_h_Page_058.pro
dcebd9ef70fe26f25c469acb5e48ba4b
8e9159fc85a85923b530a03aae833296f72810f8
78687 F20101112_AAAZSL hamlin_h_Page_093.jpg
bffd060969f54fbfb9e50afa8d7b4a47
437032ef3f1f9fb292d56e324fce52fd51fff177
7102 F20101112_AABAFA hamlin_h_Page_111.pro
816fbcd6d157531e80d67d63d17915b8
98a3dfab6edb1d9ba75eca68de64cce1f07ce9fa
14605 F20101112_AAAZRX hamlin_h_Page_074.jpg
7599939631171ccc49ec2f2e71823473
6baa59c61cea64f0a3b309ebeeea99869a0ceced
48307 F20101112_AABAEM hamlin_h_Page_085.pro
91e0b3bf1e19d865e365a591396a9903
49175740f9eac3eb73e13359034b5e3522e6f0b7
22057 F20101112_AAAZTA hamlin_h_Page_112.jpg
df240b15a6c671433a1802256789384e
c422b5318dec3e5a2ccc12f0a8f2c02b79760553
55583 F20101112_AABADY hamlin_h_Page_060.pro
4e43361930f14c6530349e7a7f58872f
3cd70b9eeb1aa1e94ac6ebb2701b6c7612fb7606
76215 F20101112_AAAZSM hamlin_h_Page_094.jpg
198b86c555f5c8a5c582c3148073a926
0ccfcd087fd05002b4a77bb84c0506071333e7a7
6318 F20101112_AABAFB hamlin_h_Page_112.pro
de2e502d354c4de400206c3e12315f20
3dde018e9aea6bd4dbdc463bc90ea1c3a8d5810b
33719 F20101112_AAAZRY hamlin_h_Page_076.jpg
ae8bf48994732900b4e884be53a48960
c0b6d3b4d08df795b250309d0e1291882c6c6d6c
49088 F20101112_AABAEN hamlin_h_Page_087.pro
7f17f3915fe39acd6fc982098fd98e49
05ff43d01c6108f01b1efdd17175159a3b9b21f0
24692 F20101112_AAAZTB hamlin_h_Page_113.jpg
f174881a106d9dd4a2cf3096db860a03
8867708b71472eca43c75e1e3f950edf3786c04e
53199 F20101112_AABADZ hamlin_h_Page_061.pro
760745dbfd7cabf36026b1e2de5c8bbe
782c3dfc6ddafb24424ca7785c9b7a1c410a4788
75563 F20101112_AAAZSN hamlin_h_Page_095.jpg
b32647de8847db94bc292f02f43a782b
8bd11d1b9fd7572d5b6aa6c06b5664f32c3291f3
8844 F20101112_AABAFC hamlin_h_Page_113.pro
7a423007dfcd0aa38eab288e7f3d02b6
f908703a3f30c2a66e08762dbc972de5e5351bbc
33720 F20101112_AAAZRZ hamlin_h_Page_077.jpg
21334c941065cbbbce4f182c82c18db4
f2aaf2e510ebf9687e571d35ecdcd5e23fac60d8
49903 F20101112_AABAEO hamlin_h_Page_088.pro
e8a197d51b273159238f95e51b888c34
18b0787bff90487d02de84e777842428e92a5d2e
F20101112_AAAZTC hamlin_h_Page_114.jpg
e69c0505bc6e9828533b25a69184b355
a9b972507d0fd031e783b63dc0c121ef5f969a83
26652 F20101112_AAAZSO hamlin_h_Page_097.jpg
30a9318bf24cb5ea07d777dba9221283
564086dbd623acaf94c2a3225654dc80ab5916fe
8954 F20101112_AABAFD hamlin_h_Page_114.pro
e42c3188cffe066b892a072149c53234
d8268c9b3f48c257a752c9db6746b7824bc20408
56484 F20101112_AABAEP hamlin_h_Page_092.pro
31417d97ff3015b72a78cdcee7a80a08
fd1910965035056f7d6afbce79201a2d5628b951
76449 F20101112_AAAZTD hamlin_h_Page_115.jpg
5dbada8d4cd5222b2c124b68582bcb3b
98df9fa675fe3effa0c01831c044d7e03258756a
58789 F20101112_AAAZSP hamlin_h_Page_098.jpg
54a322e206ae771a48057985ddb36fb2
ee44de423e6740b97dfd72be8608a62417bff8b4
52306 F20101112_AABAFE hamlin_h_Page_115.pro
2b7e3b1167e6462761d0d969f2f37a8f
430c2ff0fb3ada89f2a3d91ac1df768c4610cfd3
54134 F20101112_AABAEQ hamlin_h_Page_094.pro
4de3e8c62de3c4bb37132cfca7520c30
a817fc7a29e0f562e7786b335e124ecbe65a97d1
75845 F20101112_AAAZTE hamlin_h_Page_116.jpg
9359aaefb8e058acb7af5f510c58c4ca
e3748e2babdd3150dcc3a3f8b89f7c3a940b68b3
41850 F20101112_AAAZSQ hamlin_h_Page_099.jpg
a76990e916059aeb370686fe5603f0a9
8893755d99466b50f062a4a43d513414fca018f7
53390 F20101112_AABAFF hamlin_h_Page_116.pro
e021e345484f11bf87d4226366a954e9
7799ac3bd1b3919460c2d526b622c7d0c2234e1b
47467 F20101112_AABAER hamlin_h_Page_096.pro
c818ea74763823d73e5266d57f6f4796
0f292ea835326a7970e9f564f3c17b42614fb721
77622 F20101112_AAAZTF hamlin_h_Page_118.jpg
b89f769135094d122ff8ce23b3fbcfda
0cee2101fb2ad5650e58057697cce5e9acfa2f10
38170 F20101112_AAAZSR hamlin_h_Page_100.jpg
d06b0ece086ae3c54d60d45392a26450
03494951d5e81f354edd66b80d830b545ba9d318
54454 F20101112_AABAFG hamlin_h_Page_118.pro
c8025600ee38633c1ff40eb1a95e4aa6
7336593d9c2ca8e2f6fa76604b4695c625058c5f
33687 F20101112_AABAES hamlin_h_Page_098.pro
46496bbd554c2f2e45bcbed891f8c45d
43430c8a4cadc3b30938a51dab5334bc728fb8b3
72217 F20101112_AAAZTG hamlin_h_Page_119.jpg
9deae45a8984d1909e3ca690cc898b60
d80d13203d55099aaea3ae5b761635d2a26739e2
78109 F20101112_AAAZSS hamlin_h_Page_101.jpg
bf8874d963dbc3e5887986e29622b0b4
0172cd18233903e8b4469626e4dcc893ea75a6e1
51988 F20101112_AABAFH hamlin_h_Page_119.pro
e38920009558fa638275ae5d7dadfc00
6b425da0b1113ea958a6a15d93d4ba579c886a12
21219 F20101112_AABAET hamlin_h_Page_099.pro
bdc4dd58611a2f17aacc1cd8f7318214
694d2d7d88ba3ce15020d8fcf72c1982afd0e13a
83545 F20101112_AAAZTH hamlin_h_Page_122.jpg
12be5660e698d5299450786a314fcca5
993e0208491c50f13bb7b454e3443313269878d0
66072 F20101112_AAAZST hamlin_h_Page_102.jpg
9e203ccf1aaed0b9b37ad14afcb848c9
81d45681298a5a715449be601045b5951a219f6e
44490 F20101112_AABAFI hamlin_h_Page_120.pro
2469821e561657652d4bba494a5bcc0f
11e62b03fc2f0d036dc366a45d216737e9d7cf23
36030 F20101112_AABAEU hamlin_h_Page_101.pro
63440e9c7832ac05adb1147328ed1240
0a7c40b7dddd18676a97144b47d5976798b72a8a
87621 F20101112_AAAZTI hamlin_h_Page_123.jpg
ecf0cf0ad3a7c09ae5a0748ed99be208
7cc2ac90742913ba8aec102e7e92b789696d709f
56129 F20101112_AAAZSU hamlin_h_Page_103.jpg
248a4b6994ac931747cc88f624f0ca94
ab57f3cec4d68635e9dcf0fe63de25845e8ea226
21598 F20101112_AABAFJ hamlin_h_Page_121.pro
14b52c4628f43b95371b10934ee8473c
926677b99cbfca24fa884f323a9f528e7c16690b
29678 F20101112_AABAEV hamlin_h_Page_102.pro
f4af143bdc18b7d3f16de364b80a92f0
13370f8c7f52a93d2e67b564bb1f4cbeed232a52
88923 F20101112_AAAZTJ hamlin_h_Page_124.jpg
59fa0d4d72f3d2dfc68d66f99ff35617
365cbcefdf888a0fc876f1d2ea5e759655a4e588
54691 F20101112_AAAZSV hamlin_h_Page_104.jpg
d3ea77e387024149680f0d24a09f3942
bae2e95b53e018936d3ba4a4ee0b046aa4ca9985
61324 F20101112_AABAFK hamlin_h_Page_122.pro
0bc4d44078d2c5160df27400774d4d61
f88dbff645dcf70dd276df048d722a24701a70a8
26608 F20101112_AABAEW hamlin_h_Page_103.pro
cd96723eb4032b48ca5e37b5e8265566
ee92e3cc742c287379212bb2290192a8b2931db4
89968 F20101112_AAAZTK hamlin_h_Page_125.jpg
aab12c9ba42abb30be6381239b91f86b
ad23c48812ca41a3dce5adf466f623f4b7192f81
95038 F20101112_AAAZSW hamlin_h_Page_106.jpg
659b0e60cd81fa4018059ec2d1974e40
3520eb84ee8fa431d65bb39fde0dcb053d60cf0c
51427 F20101112_AABAEX hamlin_h_Page_106.pro
16fa75baf0fb1137aa89618efea7b3bb
a05a7606bd47ee8c74882bce766bb89293c6ebd6
85056 F20101112_AAAZTL hamlin_h_Page_126.jpg
fa9c201a939c0ca332e07b09e2ebd547
b4dd03fa8ab6ecf7e19a5ee9ccfea797b34b82d5
181 F20101112_AABAGA hamlin_h_Page_005.txt
b26b2369d29e7580c525b46c7c8df5a5
14563cb4f3cff5c26e7e7ec0d08c9951ae52be02
104441 F20101112_AAAZSX hamlin_h_Page_107.jpg
83f231cc37381d999cbe4de3d38e3210
dc832e8ce83800c1a9e5348df1e61cb1791f4638
63568 F20101112_AABAFL hamlin_h_Page_125.pro
00bcb0812c43f57e22cc58dd6f00daba
78cd82a16f7278eb7375183ed29822f6f10fd8b3
4516 F20101112_AABAEY hamlin_h_Page_108.pro
83f9542338a9add804417acc9a6f5aa4
10cfc4547d55c9073cb6944936da83dac9cbe5a6
90107 F20101112_AAAZTM hamlin_h_Page_127.jpg
d409fafa86fe834f0b3f5bd4c70a9c83
c525087ae11ec7b09cd80dfc517142fe8c4a97fd
3217 F20101112_AABAGB hamlin_h_Page_007.txt
d375c4585f508b6a07905265f67740ee
bebe40a33acf24a67d029451dc01f9c30d3270ea
17840 F20101112_AAAZSY hamlin_h_Page_109.jpg
a2b483d162c4ec684500e7e5a7d82484
53b2c7617434701d59082f0ade17fe8faa3724cc
61509 F20101112_AABAFM hamlin_h_Page_126.pro
9fcb22866e6ef21646a00f29934cd0ef
aa9ff25b835066b596181f4e0e09afc4c0197b47
4048 F20101112_AAAZUA hamlin_h_Page_003.jp2
db4c18d91aba62dabf1421b7987e8d60
73281023702e6142438fbbfb0715fbd7278c8427
5444 F20101112_AABAEZ hamlin_h_Page_109.pro
0eb26dc7ed1e961c278b224d96aedac3
3695bbcc2f77e203d0e8b0e6be4c798e3bf2dd7d
85653 F20101112_AAAZTN hamlin_h_Page_128.jpg
4bac1411ee9a198fa049c7d7426b9ba5
83bda77cc2e157810518dc05f834cb10f5232749
1003 F20101112_AABAGC hamlin_h_Page_008.txt
b0444deb73e28d2ae4c4740c84f3b10f
21a3150bbad6c14e6dbc36f9f44fde8c2b803a8c
21141 F20101112_AAAZSZ hamlin_h_Page_111.jpg
eac0c16d6cbbfcf7f995489dc9c4ecee
0d77b872d1ab3b54e295ca60d5ad01e978462523
67125 F20101112_AABAFN hamlin_h_Page_129.pro
bccdc9d1c829e3c9ae955f2db289cd52
be7dd2bc0b783f57f01238b493c94b2e898138b3
113618 F20101112_AAAZUB hamlin_h_Page_004.jp2
ba9ec154c022a2aaeeb232148d387e9b
519e69e30dbe46d43e529d153678fee3286d971b
92327 F20101112_AAAZTO hamlin_h_Page_129.jpg
967694c8a6178bf87964fa380850a9bc
d2562d68baab9657a41f66100f35a0c988c23db9
2759 F20101112_AABAGD hamlin_h_Page_009.txt
0e11ed17fce0c2099beed764623bd323
34ab5801de02b48ac2fd1c5cb8ee1b6a34274bd2
65733 F20101112_AABAFO hamlin_h_Page_130.pro
413c17aee1a01271dfc84e8db1cf3db1
58e2d40875b072d13b1a9123094830c29c50ec44
1051982 F20101112_AAAZUC hamlin_h_Page_006.jp2
f52a75b9ebaf5f913469668bd17f21be
71af317d227343dd8ede6b7f279b682734f90aa1
87662 F20101112_AAAZTP hamlin_h_Page_130.jpg
4d0f5bfe64a42c22e6e0514229bd7a20
54fbaaefa8f32b34b3c3b87d0848729b6e3f1c5e
1183 F20101112_AABAGE hamlin_h_Page_012.txt
d4840420d092508130761663d59fe030
8e4a89464ecde1d9d4f3b8a35b06161b74e56566
61848 F20101112_AABAFP hamlin_h_Page_131.pro
9dbc8531fe20d1fadf1f82b409f786b3
6c2c36bd86990db303c7ead29e2cd7b72f821ebf
102081 F20101112_AAAZUD hamlin_h_Page_011.jp2
03c00c78f1e46d4139654eda3a48f0a6
66efbacde0646a07fe5e412764f964b771e34086
84450 F20101112_AAAZTQ hamlin_h_Page_131.jpg
05a31f72b5f57743eb68f883d743544a
544cd8741738f45097b68891be51320905cb7252
1994 F20101112_AABAGF hamlin_h_Page_013.txt
a9df116ed23f44d4127679b16e9e37d0
d47e4e1c8aebb2ac89527bf8bfbc5fff12e38e89
67337 F20101112_AABAFQ hamlin_h_Page_132.pro
949e0c3155d0e70630785f6472af12ef
382e9d90547c7bbe5fbea7e821dcaff2cda66dfe
67305 F20101112_AAAZUE hamlin_h_Page_012.jp2
eca6e6095e7f33b582b05c79f0e01837
4ee205aa4d49e2b628e7cf6c8074d5175a692aa0
91266 F20101112_AAAZTR hamlin_h_Page_133.jpg
4ed3610ce115b916b4dfe6d80c0ce6e2
108d7db1a2d4b16db0d9ba047546b7dd53ee7f42
2029 F20101112_AABAGG hamlin_h_Page_014.txt
a4c79c5ffc2a241cb11b47540d00db17
a10ccf2e1c54a8d01ffc87ee43fd62f8b49774ae
70117 F20101112_AABAFR hamlin_h_Page_134.pro
82b817289e142169b7b323e76175eed9
92e6bf901e284e87eacfc8771a2a50ca0b65f7bb
110623 F20101112_AAAZUF hamlin_h_Page_014.jp2
2fa24c26c6ce5636034dc7804a538287
f4cec36b9887030497682de7dcd198426a19f49c
81150 F20101112_AAAZTS hamlin_h_Page_136.jpg
38d1b577c43105ce3eb23f23a77af02a
81d7818edc3719a2ca63e4daf78ece7b17bf031b
2057 F20101112_AABAGH hamlin_h_Page_015.txt
20bd936dca806faa749b2d2b5b60673b
7f7d94f093bc0cc853d3b43b53fd3c351010a883
70120 F20101112_AABAFS hamlin_h_Page_135.pro
a9d98733a5d6971bf875e7ad5ac2900a
964c0088c02f11b58356771b9b0d058a695dccd3
112059 F20101112_AAAZUG hamlin_h_Page_015.jp2
abc1e19b3849d1be07194d0f0154164f
97a29fb7964372c25a29532bfa81d996e9c4c1b4
81173 F20101112_AAAZTT hamlin_h_Page_137.jpg
09b1966ad0ce1edce3a97400d7a4740e
77b9c4bc678c4f46536a8c4e96dbff6cba51f949
2072 F20101112_AABAGI hamlin_h_Page_016.txt
baa67832d5535f4b80f9548d72a3f8fd
1b48b141868a0dbe9732aca09b425756d8b1990f
59426 F20101112_AABAFT hamlin_h_Page_137.pro
144dbea70861f1816e696f2779220c1d
6d87672f1a3bab1373700e113c68101b3f9c8ff5
112608 F20101112_AAAZUH hamlin_h_Page_016.jp2
0fc152c48ddf81e6709040e7df4384ed
d45568734cd62fb0da73099414123062e0a74425
88156 F20101112_AAAZTU hamlin_h_Page_138.jpg
1bc3cb8dc476436bf8c933e67bb40bd7
e0a5ff91e1cfd8aa3097894cc3eef42ea9a457b8
2095 F20101112_AABAGJ hamlin_h_Page_017.txt
004a8531ebec64668c3d1a0b7efb09ab
30d5f48069056f56389627da3713cf80a12ea77a
65418 F20101112_AABAFU hamlin_h_Page_138.pro
01295648c13f3b3f54ad93d79eb2b36e
c1041c06056132de0c128a2987050e5eb0ae703a
112724 F20101112_AAAZUI hamlin_h_Page_017.jp2
530449e20fa778b0956609cc46c6d5e3
a8cc618e0c5d6ee29e76dcbe52bdcc1d6234fa66
93313 F20101112_AAAZTV hamlin_h_Page_139.jpg
00358f25058dae718508aaf4f0be041c
9963e33c7919b78d2b897f8c77901f0851c3ddf9
2105 F20101112_AABAGK hamlin_h_Page_018.txt
a19db8a0204592aab6782cab81f918f2
325317425f76c98c9cfac4f52233573a83c2d7ed
68792 F20101112_AABAFV hamlin_h_Page_139.pro
da267149b3905ddb684108dd6e042978
4cacb0e7d1764e97ed95db63aae5baf81420d208
115763 F20101112_AAAZUJ hamlin_h_Page_018.jp2
26c08d7be7317b0efb09e881b33f8266
e31624b0b7797a405ccf6009f7423bdfc898bee2
68223 F20101112_AAAZTW hamlin_h_Page_141.jpg
55ed05efc88ffb6fe32ec7398b361b59
83709cdbd240a283d41a518f90fa6009e1120f39
2044 F20101112_AABAGL hamlin_h_Page_019.txt
2d5da20e6072a77e7a37c52c697c86e9
eb31fdfae00564b6e511f5668729108ed2b35226
23927 F20101112_AABAFW hamlin_h_Page_142.pro
da7ed6c4d30f44970d2e26ce1eae85f8
f8cb1989f8b3d48981a30ad9efeccce9cce52fba
114079 F20101112_AAAZUK hamlin_h_Page_019.jp2
1a288a011032cf476d75c1c45455e8da
1adbac7ebc217e2082de25377c7b1e53d01a1a51
288 F20101112_AABAHA hamlin_h_Page_041.txt
8b6ab94c3ce885a1b9749ebfd15725c1
87f4dccb04d3c7cabd76bbd56e57e37583f10f55
40798 F20101112_AAAZTX hamlin_h_Page_142.jpg
d683afad0aac92d819fd0b1b53a86a61
37a92b53a51a6b4fc8d0883aeafc4732929e6a75
24269 F20101112_AAAZVA hamlin_h_Page_038.jp2
95efba3e5d604705e6b9dcf6268c5fe0
00d81bf6c7c371625d94a86421ea9d89d4725bc0
485 F20101112_AABAFX hamlin_h_Page_001.txt
eb43759efb0cd57de8ededacb092ea8c
2faee8e8309f403fc9d4bd50994293d4d02cfbe0
112653 F20101112_AAAZUL hamlin_h_Page_021.jp2
4173c0e966ad2b99af894311d87d06e0
0a787316a259c2e8515253b3d29d1c83075aadb9
2151 F20101112_AABAHB hamlin_h_Page_042.txt
c74d9e7271f6ecda7d9c1229cfe56bed
cb2143d2a5321b865c14b23a145ae4b9394adb8d
24531 F20101112_AAAZTY hamlin_h_Page_001.jp2
be697a32f02eefff7fbf13c81445a952
37687f3bc6416e5c5134bf90cfdbfb84c8c6a7dd
1884 F20101112_AABAGM hamlin_h_Page_020.txt
e721d5b6097ad2306cd7469f937c03b3
dda768d3d53135cdfafae282149486906ce1d637
113 F20101112_AABAFY hamlin_h_Page_002.txt
b28639ba5abe54cbd1e0de5fca741820
403fd77d054194419fc7cca689b0e9c1690bacc4
112574 F20101112_AAAZUM hamlin_h_Page_022.jp2
c3a97b992292e67f4b54cc2c8a1867cf
7a1d1dcc969048aa5a93379c26ed6947e5d612f2
2186 F20101112_AABAHC hamlin_h_Page_043.txt
9524c5f28e35d8b119a5c296b95a322e
32d6c8da752174a482a51f0f4170fdf4e23f1699
5518 F20101112_AAAZTZ hamlin_h_Page_002.jp2
79b6f93ff0bc5b8b8ea36ab353b8bb81
153e9adb94e79f28af14d1892d26bd7d4397d3d1
2005 F20101112_AABAGN hamlin_h_Page_024.txt
8b470dfef3ae381767b6c57af92e7fa9
a69e00f7d666329c5e4aa06378c577e784e99407
38940 F20101112_AAAZVB hamlin_h_Page_039.jp2
f17bb091ab7a9afa42acb774b4cef8e2
9b133c7a0175b378b30c4f5ad95695234bf75b10
77 F20101112_AABAFZ hamlin_h_Page_003.txt
c0fa3df3a92f681eb090f61ce2d4b584
69f9b7770cbb58247e5aa83212e07ac0fc26d502
111474 F20101112_AAAZUN hamlin_h_Page_023.jp2
fa41ec977a2dee798d99dacca2b7e875
456acb5768dc34a95f1447a9d4c7022522738645
2192 F20101112_AABAHD hamlin_h_Page_044.txt
95f40a1ed50cc7c0dfafdf30b587be2e
38b3513894d8e59a6fcea79a0bd9b5b64505bf74
2114 F20101112_AABAGO hamlin_h_Page_025.txt
0227d6088915d0bf69747ac396a3998d
e4291ef8e6280fc7cb1da608a377b7a3b44a51ba
20003 F20101112_AAAZVC hamlin_h_Page_041.jp2
69556071b020b3804f222094f111ab35
d33f53a1809defd118aa3d894f4ef312e78469cb
115117 F20101112_AAAZUO hamlin_h_Page_025.jp2
acb44903d418ed585ac78db2f1d3103e
cf2c1d542694aae54591f4b1f3fe4ae3cb13a8df
2041 F20101112_AABAHE hamlin_h_Page_045.txt
0b52060599dd3c75f20222db455bd559
4396d724eafbf42c500fc7a879fbb911eddf05e2
957 F20101112_AABAGP hamlin_h_Page_026.txt
6408634f6e06cdddc749c86577b7e5f1
8a76d0446cebd1fa25f5c1c65eb75b94ac135f07
112935 F20101112_AAAZVD hamlin_h_Page_042.jp2
4e429c6c2b207a102ab6a8fe54a4894a
8248d633d08b47d59d99c12f79571a35f52a78b9
54591 F20101112_AAAZUP hamlin_h_Page_026.jp2
40a34957728dfc0e6f85cea38077ad4c
d8f5171f9e68aec92e5d9e67b2381263299bcf2a
2056 F20101112_AABAHF hamlin_h_Page_046.txt
a828e7dc9d0a7beb657556178e735863
645d06b49cdcd8e8e4026e614f25a0ab29b1a62a
956 F20101112_AABAGQ hamlin_h_Page_027.txt
74d9b1822daab1762f0585c1aef49922
62f5a1b769a8011ac62373db0bc049e21a528396
120269 F20101112_AAAZVE hamlin_h_Page_043.jp2
ea3dd6f72f4d4afa616b3cd894a935c6
744e2f395b941e5a9a2f19fd9d5568c5d570527a
870092 F20101112_AAAZUQ hamlin_h_Page_028.jp2
87964fe250397efad3771ce78decf2a4
3a6e24694c4c08c266a7c20444d196a9874a4611
2196 F20101112_AABAHG hamlin_h_Page_047.txt
1ed997e01eb0f7ed319aa93c9e2a40ff
62603a184f02cf2986fa1ea564b69b42af62b352
785 F20101112_AABAGR hamlin_h_Page_029.txt
83e48930da9feebe470c7a9acf0ba842
ab12258867e9abfa5f025513865943518e006587
122383 F20101112_AAAZVF hamlin_h_Page_044.jp2
298b7d796df8a0c3b1a7a28bab48e803
08da1fb3649473f7f4af7e7dfca0bfaf2140386d
747794 F20101112_AAAZUR hamlin_h_Page_029.jp2
537f0ad480dc65c0e48de6b0ef817010
f5bf69d4cdebb182cedb49155bec9b1b6651ab4e
1978 F20101112_AABAGS hamlin_h_Page_030.txt
a7486f6ee9ff2202bb85b918d856f636
7be45982eb58d6e3205f700dd78ac4f091d76ad9
110613 F20101112_AAAZVG hamlin_h_Page_045.jp2
634562e834943c79d949843f5af2da40
17ae8247427e50826fa1c955be432401663edf8a
103631 F20101112_AAAZUS hamlin_h_Page_030.jp2
73d8ec6d8cafc6c512ef7ecbeac886bf
9ae038c5df5bf0a11e983d97ff9ec139585afb44
1787 F20101112_AABAHH hamlin_h_Page_048.txt
b11e122ca05e3f3533df1784ccc0b71b
2f45ad371b9aed3ed672ac02764fea21e6a53974
1839 F20101112_AABAGT hamlin_h_Page_031.txt
286cfce96010476cda1f1154662b60d0
44a8cdff567f699eacdd2aea4e11dabe38cf15b0
111565 F20101112_AAAZVH hamlin_h_Page_046.jp2
a181674b55e191a9481065538de1b622
5bd1ab21559923d9ced1e90ba1e0c2cd803c0c40
99917 F20101112_AAAZUT hamlin_h_Page_031.jp2
ef716331fc47f850d8ed7f5f06abf82f
14e018e14174630a75dae44271c4caac14d39187
2094 F20101112_AABAHI hamlin_h_Page_050.txt
9766c48b22340397f9e417243db73d08
6a420d6d2062f5703ed2b67c15590f91b6017c04
1825 F20101112_AABAGU hamlin_h_Page_032.txt
42fb937638168c19aad86a9c689629db
aee7cf8993c28418e180bd07855c5062d421fa0e
118240 F20101112_AAAZVI hamlin_h_Page_047.jp2
1b17ad4eb983f66ebd039f59d5ad68df
6741526ca9571c8ae2da41b749b8134e45ce2585
98932 F20101112_AAAZUU hamlin_h_Page_032.jp2
647171795c89efbeae54f22a7468f063
e2d2548d69f489c02db980477fe8b32cb033026c
F20101112_AABAHJ hamlin_h_Page_051.txt
ef392b95d6993d5aee4df700c54cf54f
c6d71cc106566fcdd34d1202f574efaf5a42a5a5
1917 F20101112_AABAGV hamlin_h_Page_033.txt
e1cc6b3b283596dc47e66f235986db36
07c47e4ac749403a2a08effa40819973a1dd8cf4
100151 F20101112_AAAZVJ hamlin_h_Page_049.jp2
9c02468602a3359125f8edb5eb54cb73
38e84625db545fc527698957c255a2d94fefb16a
104125 F20101112_AAAZUV hamlin_h_Page_033.jp2
ef2b978a7bdc884917206ef9a52597b9
9c999373d2cfc018b2fe8fc7225d2cb4608a939c
2162 F20101112_AABAHK hamlin_h_Page_052.txt
51c4ef62d938749d566ee4430a280a8a
c117fa74d4322e600fe2937f2d2c7c94aa35af67
2011 F20101112_AABAGW hamlin_h_Page_035.txt
60412b9a0cd0c81936ce43f9a3f99ca3
fb9458599432581eda13f437dc13ca906ea055de
112087 F20101112_AAAZVK hamlin_h_Page_050.jp2
718656f16bcc3b176a7b1d3712a1127f
4db908bc331270e2f12cb24d2107a7f36ef80104
105392 F20101112_AAAZUW hamlin_h_Page_034.jp2
5844e04b1a606a5b85f20838e09b78b1
88457febf765cc36a2d6fb7d87bcf5e9dc1e3733
1455 F20101112_AABAHL hamlin_h_Page_054.txt
b622fc802222c4b7545750c537b5722c
2153db722a61a6843dfa76b3162f8d833de03fde
118094 F20101112_AAAZWA hamlin_h_Page_073.jp2
88abbe03e6686b0755019d54ccad737d
0e159379ad65bb0a73506bef6d72c90b83bb431e
2102 F20101112_AABAGX hamlin_h_Page_037.txt
eca3318fad1a532fd7354d824e40796e
185a767dab5d5ce21a4560e310c30bf7f2c5844c
117998 F20101112_AAAZVL hamlin_h_Page_051.jp2
9eb434b4bc4e5465883ddb9f96a5dfc3
4fed809b28354966d5a6ce298825296998f3a0c4
2089 F20101112_AABAIA hamlin_h_Page_081.txt
ad2cb8ed3e4325a5afdca21eebfa84fb
f451d85dc4c2232adf58e1368f5fafbe5ff8681b
108008 F20101112_AAAZUX hamlin_h_Page_035.jp2
2563810831b87b2ed6bf5ef6d56bdd7a
55adfb42803d67ad2bb336f96b97776657cf8a12
281 F20101112_AABAHM hamlin_h_Page_055.txt
94212824fe0eb9beac5c05257739f77c
a0aa672980c958e2c10c222bad2b08c60af5ebcc
277873 F20101112_AAAZWB hamlin_h_Page_075.jp2
cd126d13bf2c233263ad33c167595667
12b997c11fe52247b0a543d0dd967958bbc1e1bd
400 F20101112_AABAGY hamlin_h_Page_038.txt
eb4b55bd2282395285d622ba0b1eb849
f5df20606d2bf6bdcb60e39b3674b9a5d4ccc2eb
115904 F20101112_AAAZVM hamlin_h_Page_052.jp2
8a540592323df7d5653113803a528470
c062bdae4915d2182f2308656652abaf8dee066a
F20101112_AABAIB hamlin_h_Page_082.txt
40c81858d020d219e86a7802b7a4a742
fa006ecb5c3a541250c42a2f6466614d44c29ccf
1051976 F20101112_AAAZUY hamlin_h_Page_036.jp2
305d7bd88d2ddd0da2e8614a202a2e65
dfb75fffdfc14c6ada740bcd0b2ab7cc8a0dcbf3
649 F20101112_AABAGZ hamlin_h_Page_039.txt
dbde41d0e0b21b2ab15dc58492796f4e
db88bd51a5f6d9ec760cbbd79bb132a9b0b8e10d
120761 F20101112_AAAZVN hamlin_h_Page_053.jp2
153427d87f1a08d0d1d71adece13df40
fddb41d9d47bca76652274ecfd5c9dd27efb3c44
2178 F20101112_AABAIC hamlin_h_Page_083.txt
b2a6e3ac6a7af2077ffdf70df3bc48ab
c81bbc1d976bb6794d3005e482c031007a6eb027
1051902 F20101112_AAAZUZ hamlin_h_Page_037.jp2
c13b414a3ae034d07b4a3de05820d7ec
b90930a3aba43359d6d01cf16eae3b1eb5a37530
510 F20101112_AABAHN hamlin_h_Page_056.txt
6631cd424ec71554f9d032f780b850d2
3fd59f41367f11b72e3697213af6f3b436bbed81
365112 F20101112_AAAZWC hamlin_h_Page_076.jp2
18b7a35a17473ab07f730fa2d8cdc7a3
c7382e6def745d062995aafbf888dc7aff65176f
79758 F20101112_AAAZVO hamlin_h_Page_054.jp2
f340ca06a36a00692ff599f10b111a38
c9fb619fe273d992fd60fa23d2e59bda5a1b28d8
2121 F20101112_AABAID hamlin_h_Page_084.txt
601612ba03a4aa09cb9043c92f95e2ea
9de9f9c24b1de2a35d9f146e96d07ae0538f989b
909 F20101112_AABAHO hamlin_h_Page_057.txt
97bf65403dfa9d8d017349bfaea270b0
536acb5d5375d6ebee86e95d516010759f3832f2
379630 F20101112_AAAZWD hamlin_h_Page_077.jp2
f4a624176c79ab87af44706eb059e69e
dc8f90c9d90c5098364733735b3ae45a23e0e4b6
182403 F20101112_AAAZVP hamlin_h_Page_055.jp2
1141b01ffeaee7f1586a3111b6ec520b
6c906601f2702aa6999bb8bb5685906b1c95f6dc
1951 F20101112_AABAIE hamlin_h_Page_085.txt
91758a12cb7590f267513b0fc458c8b7
5d7e4ef2952403d3569de6abd981d6c8d493c666
2205 F20101112_AABAHP hamlin_h_Page_058.txt
1577e7e7bcf771a826fad49809361f12
20bf467237060d3cabe079ef7f9c3fb40628a907
333106 F20101112_AAAZWE hamlin_h_Page_078.jp2
7fd3d88c560b6beb613340c7e9e4c0be
caf5dcbd4dfa2e5c23db118f668ab6566c56ddc4
118165 F20101112_AAAZVQ hamlin_h_Page_058.jp2
2bf46501d449cad7fce815a1a7ea0248
3d8ff83f9f0cebda22f9992e0f55c70dc170b535
2180 F20101112_AABAIF hamlin_h_Page_086.txt
f653dee5f01d244f6cce02c61bb917d1
b641ed13305f4e510b3e8e50fb5c28439029bcf2
2032 F20101112_AABAHQ hamlin_h_Page_062.txt
75552b4078998ce209572cf17c60236c
7d780bd8a4d8cbb5fea1a2510bd36daae2221db0
440914 F20101112_AAAZWF hamlin_h_Page_079.jp2
933a7f58630e8efdcbc84fe70789c35e
8f28a05674982f1e45aba7012a269e742dc9c2e5
1051939 F20101112_AAAZVR hamlin_h_Page_059.jp2
2e7cc8b6556ba703e100ff8af1071a74
8f7ef7d5ee743d0cd8b21e7c9898184e2b56796a
1932 F20101112_AABAIG hamlin_h_Page_087.txt
6043320f2a3764376f33473a145e0264
f8867897644fc6c16d3392c69a632dc9acb93dde
1817 F20101112_AABAHR hamlin_h_Page_065.txt
c78ae6012085a21a0df4d6d3d8d03401
0f1241566dbeb760f37ed33ccbaf0fc4d159ac64
439528 F20101112_AAAZWG hamlin_h_Page_080.jp2
6b769f2686dd2289b82baa1e5cb51d06
1935c525cfebaa9622809fd13dbc65caec96878a
115567 F20101112_AAAZVS hamlin_h_Page_061.jp2
2beacc943c7578c0778057f371ce3f50
895d45cfc1a78563ac03aa37178fb18505fa80ab
1948 F20101112_AABAIH hamlin_h_Page_089.txt
cb7a583507bc58d0988d59307d70567c
bcd94c621d88361a0d0868a543d1cfd1bfeb975e
2101 F20101112_AABAHS hamlin_h_Page_069.txt
dadc248cb10718e4342ac4069155b19c
70c5de26715d0a897da6c2d39046006719419856
111093 F20101112_AAAZWH hamlin_h_Page_081.jp2
9033d38f6a67283f660be1eb8c9b09f1
2c224672cba14733000e1586ae09699064d6f607
110368 F20101112_AAAZVT hamlin_h_Page_062.jp2
83b13e8e55b88cbae1c3fc7bca5c62a6
31ebf23bcb3be97ebd3f8659533d5645b1954a71
1995 F20101112_AABAII hamlin_h_Page_090.txt
768a4c48d1dcc43684082121bb5c1f4c
da8c20f644860f37c41bf71a622c628071de562d
2185 F20101112_AABAHT hamlin_h_Page_070.txt
735a94690885577399df55ab9f3a7710
e5ab8997d993b2802f7483e855f9fcbe02535217
118867 F20101112_AAAZWI hamlin_h_Page_082.jp2
b622c089dc69bbeeb1175be1c2b9e60e
8ff567473b0c0b09852207980e64181c386e05f0
106219 F20101112_AAAZVU hamlin_h_Page_063.jp2
665dcdd3d3e7d6b7717ab4a88f2f4d41
26a0d38af73a8cb61da604f11cf11f69f93c5227
F20101112_AABAIJ hamlin_h_Page_092.txt
86424009696cd76e41a6c704c72d8589
9c24ae5c2fae7d9cc655423f2d2a1a16e59853e6
2122 F20101112_AABAHU hamlin_h_Page_071.txt
414bbbed60bce9219da34d263807b8d9
18fe20e469bed95bd0498d47e6fbb20b5b0f24a5
119023 F20101112_AAAZWJ hamlin_h_Page_083.jp2
73d0f0dd3fec5997cb1cabc2ad134355
1e929dcee09c877f6c8408dfea6ebca73472ed0d
116784 F20101112_AAAZVV hamlin_h_Page_064.jp2
2308cb641a8ab7f36ebcf41675000eed
198312dcf0f7fe2727380e65a7e451564ff061b5
2138 F20101112_AABAIK hamlin_h_Page_094.txt
a018246d4ef1f02b08e29cdd6742afb5
0c868dad1d1ed80e81425c2b7820c6fc82626a19
2157 F20101112_AABAHV hamlin_h_Page_073.txt
3b2a688ef42e3078ad586ec3e7531dde
34a750393777cbe46d3eb5a53c0905a43d933f55
106881 F20101112_AAAZWK hamlin_h_Page_085.jp2
d877632164a53ca71c254d23a0d660dc
336a2812a51e743c28f72755a60af85a0a3849c7
101913 F20101112_AAAZVW hamlin_h_Page_065.jp2
9e7753e1c73aa8496ca31a0c5d0b6dd9
10145cf99946d5f7993523e2925e37ee896b9c7e
2064 F20101112_AABAIL hamlin_h_Page_095.txt
8866bf30de4563a430d12a0a33cc05c5
a2f6227b0ffeee262ae9278289af201f3e47a357
255 F20101112_AABAHW hamlin_h_Page_074.txt
13dcb02df64ae49ad9c0a82ecee727bd
024d2989c58d7decdb61e2fb64b0b0cd396fb9a0
119035 F20101112_AAAZWL hamlin_h_Page_086.jp2
e57dba692ed6fe13ae77533679eea982
63a6c70f1dc090f81e71c19b6404bc05d5cb3732
2142 F20101112_AABAJA hamlin_h_Page_118.txt
df12d23a0fc5fb4379069072e13c9af6
2646569c47ac17cbc9ca62ecee7469602736fe5f
114907 F20101112_AAAZVX hamlin_h_Page_067.jp2
9a804e101839b00b9a58e6b2bef8460d
96a95c18db8987d9ba27c738067824e433335b30
1887 F20101112_AABAIM hamlin_h_Page_096.txt
667a7f3fc2a95ae28211368f0c17ff51
4157fcc46708a1d25fd1b3150714b979a42b00f0
904513 F20101112_AAAZXA hamlin_h_Page_104.jp2
4bd6f981ee4125737454a5621ec90a9d
fc21b41e28122711171e8fa2a72ebb32f3e810a8
473 F20101112_AABAHX hamlin_h_Page_076.txt
59fb80929d25725a35e6e94e16cc5683
760234a8dea690260c5c58ab9b51033600fea0db
1051980 F20101112_AAAZWM hamlin_h_Page_087.jp2
105bc704084110fce352786bc470e5a8
7a097fbe80713c01a170aa68eb7c6b62bd603a56
2090 F20101112_AABAJB hamlin_h_Page_119.txt
72da0d320e1e452684305ac8bbe64767
9ca169bb560acbbf15c5a310e024493d177406ab
112391 F20101112_AAAZVY hamlin_h_Page_069.jp2
bf7b27920c9153279e0364009eb1bdbd
15eb5bed1f402f5ac73f572a9eeeb898c2d603df
1482 F20101112_AABAIN hamlin_h_Page_098.txt
1178b0738d58ac6c1a7832906b10c2b8
6e67d7bfa5deb862f18f3b3953ef81c6e7fab850
1051984 F20101112_AAAZXB hamlin_h_Page_105.jp2
a38d90064f3620f0093da2881839c91e
e8fda93ac79d10698bba7d2ac83c2ae35cab657b
1033 F20101112_AABAHY hamlin_h_Page_078.txt
333666f10b64ea6cbc8cbe7c640c1cc6
2ac44be429ac45f26b0b9ff02de981b5e45e1fd5
115415 F20101112_AAAZWN hamlin_h_Page_088.jp2
f4ceb6d6b3fed0b557e3637a9f1d1c28
bbc271c86b6a3decd9ee11c908493751e7c4ab2f
941 F20101112_AABAJC hamlin_h_Page_121.txt
8f1345c4d8f75657a8b7a4e6c63b345d
62dddea3d4166ff6dfa7e691eccbe88025448fa1
117827 F20101112_AAAZVZ hamlin_h_Page_070.jp2
219177ba94a791ad1b88f4a596f1b3f9
7bc71b1d6b52dd116253191ac90e44e9b90cf3e7
1051899 F20101112_AAAZXC hamlin_h_Page_106.jp2
7f7fcf03ef8fdecc281ae2d17f4101d0
a745ee2fcdfce993505e75edf8e27dd407ffef2b
615 F20101112_AABAHZ hamlin_h_Page_079.txt
fd508e381d4f8b12be2fb0a4521654f9
e9c4e6ad934da4c14b311b4075ee8b29bdbb3631
2491 F20101112_AABAJD hamlin_h_Page_122.txt
c0e83f64864737b3f90f4dc6c20a8fcd
326e068ce86b05a2643fc49b84e282353874558b
1026 F20101112_AABAIO hamlin_h_Page_099.txt
50c4879439a68fa79eb6b17908066294
b94918dc99a770d0384c0d4856ed8e70d5c0445b
108714 F20101112_AAAZWO hamlin_h_Page_089.jp2
85188d14e948a67e1cefb3f527412456
5bf9490c54ebac98692fb34182ec7c824d78b94f
2676 F20101112_AABAJE hamlin_h_Page_123.txt
403587a42929172d583288e262724c9e
1998efdc3ec677f7775b90e99f95813b1f5b5476
1427 F20101112_AABAIP hamlin_h_Page_101.txt
e7747b9b2eeec53e824c1e6ccb3b32f6
d39049adfca497919b28c9100ba3934bf67ec536
1051977 F20101112_AAAZXD hamlin_h_Page_107.jp2
99ec916a98aa34a868d8b25d9bd37266
597303416c33a8bc7b3acd24c088df2a424c4874
108759 F20101112_AAAZWP hamlin_h_Page_090.jp2
36c2e7e3a9eadecd7059e0a9b0addce9
6c4f47ba8a77a3c15e3ed916c062eabdbc4b9be5
2743 F20101112_AABAJF hamlin_h_Page_124.txt
ac62627f21a29b96747474e469252822
c78b5f11e36c8675647fb3944e6c893dbea3d3de
1105 F20101112_AABAIQ hamlin_h_Page_103.txt
96ee32c537c4c3a93afacfbaa5c2d849
1074e8b177eabd3384b87d853b34ddb7339baaee
158062 F20101112_AAAZXE hamlin_h_Page_108.jp2
c96f6eeb9de9c23a42473bb2d7ae57b5
a5ff01b3a1655891642148ae9ca5529fd133396d
118095 F20101112_AAAZWQ hamlin_h_Page_091.jp2
b812dcfb9b4a154dfbecd2ad0e3ae8d9
78537a6998030e6ad7e9fd68654fd99ab14a11c5
2558 F20101112_AABAJG hamlin_h_Page_125.txt
30b48cd1f5e9c5be10c70b5f7a928e94
5c4aeaaaeeaa2be9e6bde6a425875229f2b2653a
1082 F20101112_AABAIR hamlin_h_Page_104.txt
cca8114b8b471ff627098f3aaad1b879
9096834ec2fd33ec53cd6efcfc0edd09f8f5cd8d
163643 F20101112_AAAZXF hamlin_h_Page_109.jp2
2adb5a587ca522a05e73a4df6564ecbc
26ca3326970f14e8fd6c57843d01880d12bdd579
121533 F20101112_AAAZWR hamlin_h_Page_092.jp2
bb429ba3095dd525b8794a9dae2f4e0b
47f4724e4db6a010774ba104cf816ba408e96b74
2482 F20101112_AABAJH hamlin_h_Page_126.txt
cfdfb5f110e0a2aadc73192b25df6b6f
4b6b2f911c1b56da720ee9094460566eef58e3dc
2404 F20101112_AABAIS hamlin_h_Page_107.txt
12c556702820886ef93729c30368a1e0
9f5b7ab68a5594a27698d0e26fcab80f4398314c
154622 F20101112_AAAZXG hamlin_h_Page_110.jp2
d955e95fd0daffdc26d423d91d659090
c03abe69b4800a1c66953ba446b114ae9211ec56
120467 F20101112_AAAZWS hamlin_h_Page_093.jp2
0c8dbfe41e9bcb7eca3e59a34298892b
5b3b88d0f93e0315ca75f4d85e09dc6da6190b84
2791 F20101112_AABAJI hamlin_h_Page_127.txt
c4a043a12b02004acddd6f8036b3893a
78109c8ad2c1c5a2b46532da83e9db80b269ad56
270 F20101112_AABAIT hamlin_h_Page_108.txt
2f2634ec970f913531d1cea8e6b02b20
bafcd7b2849c496ee9972848ad84c15bbcc959f7
199169 F20101112_AAAZXH hamlin_h_Page_111.jp2
c58341610fef47bf698f6c4984bf2bb4
b35d8982d47a7f17023072382d5059c42c8fdd4a
113653 F20101112_AAAZWT hamlin_h_Page_095.jp2
152c19c89f0f4c4cb7aaf81e557309df
b866882f05e9387cd9d3429a164692983451be28
2711 F20101112_AABAJJ hamlin_h_Page_129.txt
e32ce91c076837d8f585a7b65d22b36e
78728e93e36fdba6e97946d33f51852c70d609b5
312 F20101112_AABAIU hamlin_h_Page_109.txt
564313757f739621f4a76467c05a8eeb
26da03c5d3660c95938e6b4b0abc52fdecced58a
196611 F20101112_AAAZXI hamlin_h_Page_112.jp2
9274d20deeb7cc21087d7eb01af3910e
74dd99f5f60830d4465f8e5f81da175c3bc9384d
104021 F20101112_AAAZWU hamlin_h_Page_096.jp2
80fd35eaffdf6e7549b11dd3517ce92e
4e5ea8a46eacecd43b141c7bb635bf0ceb086603
2505 F20101112_AABAJK hamlin_h_Page_131.txt
8ff0d9c8030a6270cf284f02b5baaef5
8583a5e151873df2835e71394c2609a384d26b70
271 F20101112_AABAIV hamlin_h_Page_110.txt
013dc73999e31f41018a404ebfdcab08
d5becf7dbdffe2fda7265c899d53f9dec32f2776
260712 F20101112_AAAZXJ hamlin_h_Page_114.jp2
2c23f3ad1122d6dfd97dc813eba6d693
af544f8323fd585af0172334af8e597567fa7ff0
29726 F20101112_AAAZWV hamlin_h_Page_097.jp2
a8df4d601fa84b05909438912dbbeb2a
9fa35543a82b3cea8ca745385ec774ba2f06eeaa
2720 F20101112_AABAJL hamlin_h_Page_132.txt
f28271ca9976b0384aa39b6ecc8940e0
92cbfb54f98f0ae8daabb55b3281a74979a27d61
654 F20101112_AABAIW hamlin_h_Page_113.txt
f7c014ff6f2db88063d1bc2954b443bd
094a07ac11df46d67ef7c2091252fa12f4b6928c
114769 F20101112_AAAZXK hamlin_h_Page_116.jp2
fd8a7bd015a50e32fe6db67da820decb
3c8fe273f410cde538b03b8c66e9e2633971b8d9
73377 F20101112_AAAZWW hamlin_h_Page_098.jp2
4d2a5cf5da52cf1efa5daa298b8a98c2
595ed038d88f7a44567d88b02a751a30a0fb5464
2642 F20101112_AABAJM hamlin_h_Page_133.txt
8570ff76bf19518c7f3dbd917621b6ef
ee0bd7ef9f86591c8a9d1de709690b50180b744a
141919 F20101112_AAAZYA hamlin_h_Page_135.jp2
0c001a94a3a5c4d2ed8c140d99468e70
19e58f779f009d36e2a703527a3a78486fe27621
703 F20101112_AABAIX hamlin_h_Page_114.txt
ab9138ea374a3be872e45b0d17e3a53d
2cd84d8f2cdf3186620e87da47eea532c159770d
114734 F20101112_AAAZXL hamlin_h_Page_117.jp2
3f02d28e934e0c40e3199fbcf2753884
df124016fb3ad9e956c136f1b2d4b3dfd181c861
5033 F20101112_AABAKA hamlin_h_Page_005.QC.jpg
b35d5531d68f04070290bd4b72a51b6e
232824a3d6066873573b9f9632b44bf5ed676612
50202 F20101112_AAAZWX hamlin_h_Page_100.jp2
a0850efd21655974a18c9482ba96074e
079e2889f73f5b16d8e1483d1ba2eeaee35712e2
2826 F20101112_AABAJN hamlin_h_Page_134.txt
5a1eff93880c45c5c08f26123fcdc96e
6728079c6d94d6c01b00644d1292192f79dc91af
123668 F20101112_AAAZYB hamlin_h_Page_136.jp2
3bf0a106ded92a93e762144b38ad3cc2
cf86f9d5682977aedd86e3129a6bd01a8ef753bc
2100 F20101112_AABAIY hamlin_h_Page_116.txt
3b3f9c6ee67eaa79b88dd41585f0bb1e
763cc41de2b18c16a120930887a83e1b4651f554
119088 F20101112_AAAZXM hamlin_h_Page_118.jp2
718325714cf20cfb9ca12c8900b85aa3
5eaff3c9e026d9ac56c2c85c55d41cf607bf4f36
21062 F20101112_AABAKB hamlin_h_Page_006.QC.jpg
d977d77f15650b1acdcb3a344309d84b
03f72431ec954a5a38d201b3fcd9692e8a7e1bae
108118 F20101112_AAAZWY hamlin_h_Page_101.jp2
40cd9baccc91e5d779f97c0c4e6b8420
edb08d62e2863069adee8c415ed13a3a5fd4481f
2837 F20101112_AABAJO hamlin_h_Page_135.txt
9466db88279a99a8f6b9e378a6c6a6a1
63b80fa870743ed44b19b1e4518d5c1767b768fa
125147 F20101112_AAAZYC hamlin_h_Page_137.jp2
8f6c33214b8a11cd68f993fed03911b2
2a4f26c18b904d3a637481f14627feca285bf55b
2116 F20101112_AABAIZ hamlin_h_Page_117.txt
1a82f21a8f7e7c66d91011bb79520678
1bcfad7c8cf7b9b2643c4c327e5c6d7aa4cc82c5
111231 F20101112_AAAZXN hamlin_h_Page_119.jp2
4999ef9538fb7a9d0410c212656c269f
ca01b2c388f7439637b74ac2bda1b34295c81fe6
5450 F20101112_AABAKC hamlin_h_Page_006thm.jpg
3192e381823ba84cd98f33bea59732df
bb073452ab6c5c29c0bf69772694feb433c7ece2
77266 F20101112_AAAZWZ hamlin_h_Page_103.jp2
2cf185273b9109190d6e3d25d59b378e
f342bd150e4c43a02af155ce6133079c990d8a37
98606 F20101112_AAAZYD hamlin_h_Page_141.jp2
ce9fb24a9f2fd7f56e460e96b51e9b9f
8e7053eee7afdc920da6ff2cc3ddfe3cde2fde8d
97613 F20101112_AAAZXO hamlin_h_Page_120.jp2
da5070e13f8ffe7d071a5e1212755bbb
8765b63ca2fd804aade7976106b4e0afc49fb3bc
F20101112_AABAKD hamlin_h_Page_007thm.jpg
f3ce0533fcf9ec35c7b6abd1bd1e58ad
95ef6df1ada08a529f507371af7acc5f787fd235
2402 F20101112_AABAJP hamlin_h_Page_136.txt
1480fa8c76517a9c810ac431ff7587e4
2442b419ca90aa88f98de1d29c33842b961d0ce8
1051970 F20101112_AAAZXP hamlin_h_Page_121.jp2
c36a3a39a6acae4e77ed575aa3a0d0fc
f0ffb1a87020e94e631d4c18b21c4f926749538d
12047 F20101112_AABAKE hamlin_h_Page_008.QC.jpg
6d445efb88cbe1f5f6a072242aac4bbb
5306e3ada252b86badb9fde71c25458fd4a621e7
3283 F20101112_AABAKF hamlin_h_Page_008thm.jpg
589590c45324df3ee79807c05505477b
02ee6df320eacd262617bf2206e22a56fd202f98
2634 F20101112_AABAJQ hamlin_h_Page_138.txt
5e8ba5c1906d0bb9b061a54ef0073cec
9a4c7c74219dd0da411cedf14f6708412a6b3344
57259 F20101112_AAAZYE hamlin_h_Page_142.jp2
301e751abe884cbb46b7697324a362f3
9346dc6828ce2f22c5dfd3039392b4889c63475e
133812 F20101112_AAAZXQ hamlin_h_Page_123.jp2
5e82108b76f9292b23dcb12523b9936e
272ddea761c414de950bbdb6cf96ac61040071e4
26838 F20101112_AABAKG hamlin_h_Page_009.QC.jpg
a07c7b20a49b401399f9cf639267cac4
2f0194da38b7012a7a8b2937c27458070a38c0ed
F20101112_AABAJR hamlin_h_Page_139.txt
6e4829212d67b9bfe78744289423d583
df91ca137f205986896bfdb0f32385e2f01dc6b6
F20101112_AAAZYF hamlin_h_Page_001.tif
baab4ea61cd602e780fd1d462aab9904
405d599b7d43a2baa47d5407f2852ffba9ae0747
138414 F20101112_AAAZXR hamlin_h_Page_124.jp2
d53ed3c340448a61721d502918af2908
a9c91bfc9ba3eb355073e86c74956369de8524fd
25788 F20101112_AABAKH hamlin_h_Page_010.QC.jpg
2f8642ca898ebdb2d4cb3fad0afa7c07
ebc4b7e4cd5fd81a02403a24b97381cf4837195d
2478 F20101112_AABAJS hamlin_h_Page_140.txt
ef6f0799be8f8a3ef769410816060cc0
ad575db47e8c10c7612f855af0081c65033b5590
F20101112_AAAZYG hamlin_h_Page_002.tif
8bd87778549cf9bebb3096eec93762cf
27fcce77d0fffd9c0eb6f57b364f95b9998880d8
131114 F20101112_AAAZXS hamlin_h_Page_125.jp2
87b88d37eb21859a56c2c9c54fa3f062
61a331fe07e428733aa16a83971ec5506af1e75f
14815 F20101112_AABAKI hamlin_h_Page_012.QC.jpg
0a4429a483fdbc52e4e353576f3f8916
dbf30932be57ecae565a95553b30d9969c11c870
1943 F20101112_AABAJT hamlin_h_Page_141.txt
7f743f00441569cdcc67a530d8927508
a39d12dd9cc09f07d5e912a232fa8864e72ff05a
F20101112_AAAZYH hamlin_h_Page_003.tif
dfe7470307a567873b652c648f2cb6a4
f26b63c6c387e04636f8d343aadb15706df7bcfa
128029 F20101112_AAAZXT hamlin_h_Page_126.jp2
a776002adaea7a856e47c43a1c7e1f32
4ae9fbcb48d16f9c2f9573349bd8b74e3de675d2
4298 F20101112_AABAKJ hamlin_h_Page_012thm.jpg
543077f246a5409a09687ecaca046dd3
9030daa624e2be0ff724eb9fc1cb5eaad253506f
993 F20101112_AABAJU hamlin_h_Page_142.txt
7f460c51fd8f3cef8bdcd3e10c13fc61
1e78f6bbc5b1b372e0c6c036181974929da89448
F20101112_AAAZYI hamlin_h_Page_004.tif
ab15cac397b6058b3c11f85cc9993ce7
dacc8d93f44a8e5ef1c0c9f7b5f04714f33b677f
F20101112_AAAZXU hamlin_h_Page_127.jp2
878c654fc28ddd1e66ffbf3fa45d3485
703160334cf1cae269a434cc765f7c9661cd1ca7
22988 F20101112_AABAKK hamlin_h_Page_013.QC.jpg
eeaba9f2301b27bfc10d080a9238924a
745ec9ee13ccadc7fbdb44ed6446b93137499236
6859 F20101112_AABAJV hamlin_h_Page_001.QC.jpg
8f1d5aba689a5b677590c8ef941ed410
39f897719bd85ee9f1c89c3fa9f3881cc368d7e6
F20101112_AAAZYJ hamlin_h_Page_005.tif
5a024bcc9fc5e05b440c3c6a660fcd9a
a3d209bafd18f5fddf2eb91ccefac289984b44ab
126736 F20101112_AAAZXV hamlin_h_Page_128.jp2
3363d8f8608372f350ba4a337510884b
c7c965e07d5fd4b63270f01fc3612a4bb398d7a0
6327 F20101112_AABAKL hamlin_h_Page_013thm.jpg
2e33fc4d31d90de845c755b435e16c70
6f99739999a055ff8a1686de9df88696296df786
3287 F20101112_AABAJW hamlin_h_Page_002.QC.jpg
ddaf7ea459d7f542a05513e3b19551b9
f19261fa870cf9e2afed9c37df6f2ae2607d5ff7
F20101112_AAAZYK hamlin_h_Page_006.tif
89ea594a9a11cf9fac8587a9e44ea48f
9ac2b1dc6c2e9ea855b5aff9452652edeaef74ee
137482 F20101112_AAAZXW hamlin_h_Page_129.jp2
eb37395fc942a9052150f640b034b224
fdcceb0dd5e773c5ccdbe7593c3480682a89207c
6663 F20101112_AABALA hamlin_h_Page_023thm.jpg
8bdf9d4f6174c08364c18ae3581f9066
6040d1b58f84a3299bf86cce4f3338850a5a43d6
23701 F20101112_AABAKM hamlin_h_Page_014.QC.jpg
9ab499ac91482c6b9c83f57230dd0d34
258d0aac3b213a8b1c079f84a0f53bbaf2364497
2923 F20101112_AABAJX hamlin_h_Page_003.QC.jpg
9ea3d25560ab90566831a1304294d720
b9f4f7ca6d1de359cf12cf1cde94c5b2c2df48f1
F20101112_AAAZYL hamlin_h_Page_008.tif
0ae48bbd83c1db276e878ae82950bba7
f52d9c7dda81ec124528f34cf7a43d65baa1b30f
124862 F20101112_AAAZXX hamlin_h_Page_131.jp2
cc5ff998696b3ff041e6814c0c982d13
ef58451dd3cee5916fa36dbb583146143982a3e1
F20101112_AAAZZA hamlin_h_Page_030.tif
08c926023e6b3e61333f45a71880dbb0
1db85a3113aa6505028e2901c48bd4ee06e14a49
23803 F20101112_AABALB hamlin_h_Page_024.QC.jpg
da78f29c4d9f7fbbfe6427a17aea5690
fad729c7742d875d97212dceb909a713803c4001
F20101112_AABAKN hamlin_h_Page_014thm.jpg
02b09f1ff71fa5ba63b879f14db1f456
d5fe32f5e7363d03c67d2e63a7b7af7f48f9f3ee
1275 F20101112_AABAJY hamlin_h_Page_003thm.jpg
dbf6b10a9f97103a19ed211e40062173
66c8af789038e288d2585560709a29451e995382
F20101112_AAAZYM hamlin_h_Page_009.tif
fe85e685d9ab23ee999ada4d7de84403
741b1ec6a052f2d5e37b730817dd31e011bfb640
132914 F20101112_AAAZXY hamlin_h_Page_133.jp2
a99c16d32566bebf192d5e775925ea31
2ff8f2055ea017e9998e018bb3e47c90b2233d2e
F20101112_AAAZZB hamlin_h_Page_031.tif
32f4209bf0f0590f67a09674c9bde4df
93dd45dc973feb592ab93f84ce49284cb1fbdcbe
6473 F20101112_AABALC hamlin_h_Page_024thm.jpg
4e87c5cc346ea6a52b720174fef87482
4adaf5ce611c4f8707a68bdba7ba6bd31f21e66e
24722 F20101112_AABAKO hamlin_h_Page_015.QC.jpg
80b23a353a946ab4a843fbc3cac17851
690a1adff7501bf85f96ff8d42584708e7d223de
6791 F20101112_AABAJZ hamlin_h_Page_004thm.jpg
fa0fe90606a18286ea6065ba4cc7a8cc
4d3b05a26b1068844599421036d7c730664a71d1
F20101112_AAAZYN hamlin_h_Page_010.tif
4e6c1c92e0de5f5d64be449478841a8c
5c603c77b798f10530f4a90a2d11ef16c592a44a
141925 F20101112_AAAZXZ hamlin_h_Page_134.jp2
454e8bd2044ad720444aa0e952a5d555
84a0f18be6ba1a7abcf2b921bea6a5fc987a15bc
F20101112_AAAZZC hamlin_h_Page_032.tif
6432f51c73e9c0bd2ac0cbcc09ce6af8
462627dcf046afaab7ae96b40161ab9c96b1d110
25332 F20101112_AABALD hamlin_h_Page_025.QC.jpg
e2c9cefd414375284a9c6ece4b83b5be
2c154c985a4943405c9fe7bbfb2e4a0ea53a48dc
6641 F20101112_AABAKP hamlin_h_Page_015thm.jpg
8d14800e2e00ad632c26382aa39eb939
bcd5de1711fe7c941a7c6ab97c0c1d9fcade4c2f
F20101112_AAAZYO hamlin_h_Page_013.tif
4f411825cad154873ed3f3e4476b28a9
d23e37f691054db787e0b2b2869c2904c2f7bbea
F20101112_AAAZZD hamlin_h_Page_033.tif
b6b9c16453dcd37a0d4bcd2dd773a622
083340b4d15ed2f6cd9e3f8bbec2a65c9e2e657a
3836 F20101112_AABALE hamlin_h_Page_026thm.jpg
7733e62175c9523f7ef77c040e0f226e
c299781f8647280b268d5ca14c04e4c85d7631f4
F20101112_AAAZYP hamlin_h_Page_014.tif
36927bb3fe6d8353f66e31745b1802a6
195b4b3ef0e29a4310960ad477691043a89f6e2b
F20101112_AAAZZE hamlin_h_Page_036.tif
22491004551c6e2515a52fa287b47338
f95b224ba90699547b2b2704403b74d1cd1ceb01
5844 F20101112_AABALF hamlin_h_Page_027thm.jpg
9c6c2ca5f85d9cbc002a2e39861ae678
cb9e0cfb9231ce6709d0695828ad83974b0f9a08
6526 F20101112_AABAKQ hamlin_h_Page_016thm.jpg
de71fdfce8ae7b57ed323e99a818e990
09276667162b9305ec09decffa88ebc829b70fd4
F20101112_AAAZYQ hamlin_h_Page_015.tif
c1fbb7aa4d787c7502f0c05f4ead827f
28c4c2e713d500c0ffecc9917d26e1c98d5358cc
21337 F20101112_AABALG hamlin_h_Page_028.QC.jpg
e582af398fc6f5c14ae436cfb1ac9aa6
246d7e27c822a25b4b77d1985fc2f15c273c6de0
24711 F20101112_AABAKR hamlin_h_Page_017.QC.jpg
077514b20594e1a2770e4f278c0d9236
4ca0aa92e6ac8fdd3aa355ba8af22c7249bb7767
F20101112_AAAZYR hamlin_h_Page_017.tif
2dece655632cf62cd3ecc1c53f6e6615
4765c3a3cea38b30686fa757307205e44433a791
F20101112_AAAZZF hamlin_h_Page_037.tif
34773903ae8f44c9cca7b9ff33b08dfc
b00aee7197d5c58b1ad4717792933da792a1613e
6551 F20101112_AABALH hamlin_h_Page_028thm.jpg
1bb89c428011209d64a0cbac6f2f26bf
d73b37db53111038aa087090481214293612f736
25471 F20101112_AABAKS hamlin_h_Page_018.QC.jpg
246990e6fbb626531ee15dc01342b120
4bb53a1ff2c499e3e6a7b4901fd474c25f6ec31e
F20101112_AAAZYS hamlin_h_Page_018.tif
15ee881b7b19be098a50b87a4b00b6fa
ba882740e3133c0055f8dd11abf41d300d49bbe0
F20101112_AAAZZG hamlin_h_Page_039.tif
e5eeeec1e2c3a5f94ed9d6afbff63b9d
379476f12b0d36025f4e9d6ee388290429e8216b
5287 F20101112_AABALI hamlin_h_Page_029thm.jpg
2466328995644e2f14392610858b3801
4d0e5c63fa6fcdc9b2036572240290fe834b1f81
24356 F20101112_AABAKT hamlin_h_Page_019.QC.jpg
7f8e20651f6379dd9a34dbe3fbd43cc8
725e3f6e891934dc872e4c51c84217b032dd1bcd
F20101112_AAAZYT hamlin_h_Page_019.tif
6673622bb51eb6ec9609a847d4270d4b
25c960bf71429b5323a4bd45b7393cefe39a24aa
F20101112_AAAZZH hamlin_h_Page_041.tif
bc68456369004ac4a87a708cc08ab456
7c61ca2fee4be59b79f0465fdbc88169dab60964
22864 F20101112_AABALJ hamlin_h_Page_030.QC.jpg
bc0d85b94138ee477233c426ffd8a672
c280897d64dd0fde7eab30a054c075db87ac89d1
6693 F20101112_AABAKU hamlin_h_Page_019thm.jpg
4a5dc9c309da60684b6bfc1c9bfcbfff
a26ee1986d18765142747114d881f0e906f3e275
F20101112_AAAZYU hamlin_h_Page_021.tif
cd051903eb145b4bd24a4c840582c945
886264c586403b7c3b1f63f927a71bd887649217
F20101112_AAAZZI hamlin_h_Page_042.tif
7779b8aeb76e4e84527b8e09eb55e0be
9a52a435de40b1801f72c51a097d0b4a4d3a2a14
6188 F20101112_AABALK hamlin_h_Page_030thm.jpg
3d0051e450d4c2becc74684fe8cab8cc
5e1ece12b7c47f0e0e3f42b07b31f1f1578993e9
6201 F20101112_AABAKV hamlin_h_Page_020thm.jpg
dc65086416766d5315d2c2093e871927
5955be3d16bd3e0a896ed9b78698a764b2b1f265
F20101112_AAAZYV hamlin_h_Page_023.tif
f6629d60079e1b594404c721364ae728
9d0fa155bd515d48c824eeee47d131ba3f72d2c4
F20101112_AAAZZJ hamlin_h_Page_043.tif
022ff085c799e47c622adb7d5b14a1b8
0829cb5fa61ffa0e83c06df9ec1bb9b3987fa061
22009 F20101112_AABALL hamlin_h_Page_031.QC.jpg
82626b2e415c892595c4351fade52629
b69e8a66a7014b441062f7136443147895646a3a
24399 F20101112_AABAKW hamlin_h_Page_021.QC.jpg
6dbf3311918f3b3eff1ff3dfcb00b69a
cae64014196ae6b084150fc945345dc0e9eb44f2
F20101112_AAAZYW hamlin_h_Page_024.tif
815d7bc7c0e49174c1584614a3b45631
2dbd3593195777bf7487198afabedbbb7c7348f1
F20101112_AAAZZK hamlin_h_Page_044.tif
89ef0a443a3b8c99ab4e2b363618e421
a6d3e143c8096bdc12965748e35673a0653a1116
2904 F20101112_AABAMA hamlin_h_Page_039thm.jpg
2103a07c6f3b1c8625b3c5a6e10b34f0
a218e7f17c4d7a630ae9fb6187de3a45b7c2e359
22187 F20101112_AABALM hamlin_h_Page_032.QC.jpg
34ee7a22a2f0943523b49ec0a99859d4
7ab4af2dce7b502e939171ed715c51e00cecb1db
F20101112_AABAKX hamlin_h_Page_021thm.jpg
0de7d6fb9000ea04ef04dd88cd62ac06
34a7693c84b55ef970d03e96ad11e27e43aec28e
F20101112_AAAZYX hamlin_h_Page_025.tif
73e64b4cc075a31ed7be9f086c784b62
f84b6f4f4933a66dfaf391bceffddcd68542998a
F20101112_AAAZZL hamlin_h_Page_046.tif
8f91251776936f2ac03eee128d5978b5
90ebb9dc9568e9032011518d09464a495bc1365e
18830 F20101112_AABAMB hamlin_h_Page_040.QC.jpg
3c1fa5826f182fe8023d7f8f520dfe51
5baa729e67497bd508a477cba7e79fd832b748c2
22378 F20101112_AABALN hamlin_h_Page_033.QC.jpg
28b142f0b3445fff7ce8bfbbdd16aecf
569da68e30a7897b253cd47e4c6b2276a1d5e6b9
24158 F20101112_AABAKY hamlin_h_Page_022.QC.jpg
7f0642d0354bb346571112055c020b86
66ce9585c3e00649afe9a15f9d779ff41680a1d6
F20101112_AAAZYY hamlin_h_Page_026.tif
58836b4a10ff6a792dd6c05b85d9e0ee
6fa4ad12569bc542a2f99c9ab1e26b30f65edfd9
F20101112_AAAZZM hamlin_h_Page_047.tif
1eff074ae2cd5390055cade5a6c3fb07
ef30ca8602d89f99f3046b25e10ee1e0f570cdeb
5532 F20101112_AABAMC hamlin_h_Page_040thm.jpg
ccf6b1b5fc34de4a304477d36edf63c8
e6693f692568dba6b766d43b13031523bee633d1
6303 F20101112_AABALO hamlin_h_Page_033thm.jpg
d45a58b2b43fa703ff66c2c6f14435f6
02a0d43c86bcf592ced13ecda5c7910a3db81e89
24063 F20101112_AABAKZ hamlin_h_Page_023.QC.jpg
85ba57083ab195e3582a66679ce30ad2
98941995c317af364fd44d56b0303ff2c47aab9a
F20101112_AAAZYZ hamlin_h_Page_029.tif
78e45860b3d4e0d4ee6808afe492af3d
2a5d1b95a817c633e9f116f58abf735859d90af9
F20101112_AAAZZN hamlin_h_Page_048.tif
781c060aa277bcb23c41c0dbba3f645d
d265aafed02e7eb8fa224f3e61661d76a15de5da
6885 F20101112_AABAMD hamlin_h_Page_041.QC.jpg
ce945098838f65259fdb80902e0bdf55
097c38305fbf96cc120b8a4d8aa8c59043073302
23504 F20101112_AABALP hamlin_h_Page_034.QC.jpg
0fbcd1ab4d09cf07506e45fc5f608dc6
41aa352a001708b5904da1cbc8f599dae5866283
F20101112_AAAZZO hamlin_h_Page_049.tif
1f240d1245fde5981d26cad943959569
b283afb368b17c379700f8c0e30759a6e10ddca3
2298 F20101112_AABAME hamlin_h_Page_041thm.jpg
bc3e07ccebfa66680f5270ce89c29448
78493da8f0b49366a1a5e427d8479f7893d6ee88
6445 F20101112_AABALQ hamlin_h_Page_034thm.jpg
db85823afdf61fbeb5345919e51ab777
3aeed547e2f4b18aa87e948be1dcbb18bff7bb0f
F20101112_AAAZZP hamlin_h_Page_050.tif
c4afcf065fffdf523dbc73dbf3fdd53a
6aab2b5a4d4c9e75b7003f850e7722d8a0a013fa
25089 F20101112_AABAMF hamlin_h_Page_042.QC.jpg
daa7c8102687dd0d2c5f4e76f4df714c
7769eff547651ad14118cbdd847cf6c249e2ca9f
F20101112_AAAZZQ hamlin_h_Page_051.tif
1c7b7611511e8318e99125472bc80417
b288f0845b2ab148fbbc6ff3ffbfcb6a5f74912e
6729 F20101112_AABAMG hamlin_h_Page_042thm.jpg
7f9f36354691b6e190144ba11977c9dd
4c0ea7d005dffcacc26c08de596a10d29bce5263
23825 F20101112_AABALR hamlin_h_Page_035.QC.jpg
9fc2259bbcd8be8184c6cc03e106697f
3e736c330e985b79d24edb34f8263c3e9d49eb73
F20101112_AAAZZR hamlin_h_Page_052.tif
22b9680e04a7d6cf0cd9a5566825fc4e
ea1334e2523483276899085deadd837457adec86
25746 F20101112_AABAMH hamlin_h_Page_043.QC.jpg
1dab7b8b743b0e2f190463d40dac9f41
5ac00c7f9aeaae2a46626f6635f23aa494ec88f8
F20101112_AABALS hamlin_h_Page_035thm.jpg
a37fa80362cc54b4c99518d43082d9aa
029f0875c6febdd712cd2ad01c460d593463a264
F20101112_AAAZZS hamlin_h_Page_055.tif
7aebd14c856b282426e5ec871e25e989
f038d33314e4d38af932d86788c1e787cf573c42
7060 F20101112_AABAMI hamlin_h_Page_043thm.jpg
1cda18cb72ca1838758baca5a5f2efd8
376aa697bef1c6e804de50f049b70f9ec7e7c512
25904 F20101112_AABALT hamlin_h_Page_036.QC.jpg
6a611c8b2edf4d0baea6e6ab5f0b2f98
8e7219eebe865f973d81ed493969fe0ba20272e7
F20101112_AAAZZT hamlin_h_Page_056.tif
44de99d640515832ee14e411f87b9864
21e045fc3c2f3e23d6ce1cff1bd896cca8dec070
26249 F20101112_AABAMJ hamlin_h_Page_044.QC.jpg
6348c88113fa04bbe67d70045a9d03a3
f913735e9adc1e28b723bcaa4e585d094a954253
6893 F20101112_AABALU hamlin_h_Page_036thm.jpg
bc1b2a3480c30574871a15823a957fb6
26672d81fb14bb965262deb97707fd0dcb095a02
F20101112_AAAZZU hamlin_h_Page_058.tif
efd81a33ad147726fac4de2b32ad3202
0ddf6a3cdcb80eba2f11fae9a732304f858a01be
7001 F20101112_AABAMK hamlin_h_Page_044thm.jpg
e13307e4588fcc60dfdf5da29ffb9fcc
c3751d8331f495bf3550fe96ca7eff4eee5417ea
26431 F20101112_AABALV hamlin_h_Page_037.QC.jpg
3a9bfe0bedc38e0239da5a3b338fea5b
2e5ba3c0b9c20071b19699ba078d5232b6175af8
F20101112_AAAZZV hamlin_h_Page_059.tif
3479d6556db232513e983475f4616840
dfb55f5cc6ee129801f7d80c856290db849be57a
23708 F20101112_AABAML hamlin_h_Page_045.QC.jpg
98bdb917eaf3ecb20af66da2deaa13dc
29678087c7691f0091b4352cfa7fc8c03a6343e3
6960 F20101112_AABALW hamlin_h_Page_037thm.jpg
a19d2b48baa1c397bb832f9f607b3fbb
64e88c7f6cfcd5a6d601085a821965ebbf523779
F20101112_AAAZZW hamlin_h_Page_060.tif
af029b880039b38e3f6bf6d344e9b402
93e2c719e70ed4f39d170c1a75b625e7bdcada0a
6964 F20101112_AABANA hamlin_h_Page_053thm.jpg
d78024ea6efaf2d660277be587fe7aa7
55ceb50062db1d06f1859d8600a4fda792efcf34
F20101112_AABAMM hamlin_h_Page_045thm.jpg
1c20e423fd03c935643db43268b5ab7d
8282d1a2a6a1878a92f326fc6134a9013b037b35
6707 F20101112_AABALX hamlin_h_Page_038.QC.jpg
bfdd0018a5f1f6e23359dbec3ed46d3a
5dc73c8db75da608f342d9ee837ed69f65224844
F20101112_AAAZZX hamlin_h_Page_061.tif
539fb29877e17fd88bfbc2b73c8bbcc8
d9574bc81680daa94c95426b234c19c97b3e3ea4
6899 F20101112_AABANB hamlin_h_Page_055.QC.jpg
b04af99f9a36ee029eea3c267f3dbfd6
d7cf9c9d94048de7fded45e132b829421fb6090a
23475 F20101112_AABAMN hamlin_h_Page_046.QC.jpg
baa4d57e2d678471825e4efdb3fcc0b5
0d1abc62c6a8580ee1adf50b0553235896110abd
2296 F20101112_AABALY hamlin_h_Page_038thm.jpg
6e6666da2258d3164b46b5aa1c6370db
643ac073393a71f29c740833784420dd593e15a8
F20101112_AAAZZY hamlin_h_Page_062.tif
b523bcff07df70f61852a8440f2ca9bd
898e313ad85408098fe0fa940be93a35d475c273
2383 F20101112_AABANC hamlin_h_Page_055thm.jpg
19f6d3f8063f2f9633f050fb0e4c32cc
7b0a2eb307534e7dc9b2b478e795513f018e1599
6718 F20101112_AABAMO hamlin_h_Page_046thm.jpg
afaeb727cb7ab373dbbd53648ce3a562
707b8b20ecd3af4f540c9ff19878bc5759485bbe
9185 F20101112_AABALZ hamlin_h_Page_039.QC.jpg
94f6aead59f40b28a4e3b9b039a66597
7ccd6cc1174f7c1da33ab31927a42e1d63d4ca25
F20101112_AAAZZZ hamlin_h_Page_063.tif
9e1e15f42156fd82995933e8ebab83d8
fec9b8489a6cf7e58d6e20dd5a159d8def5a1aa0
3467 F20101112_AABAND hamlin_h_Page_056thm.jpg
b10b91aba7c6ce6e60561f43302fc9b2
20ba0e665a3576f608e091484b86ca24a0f87e73
26160 F20101112_AABAMP hamlin_h_Page_047.QC.jpg
ad01fe3616a771b75038d88dbeb44783
156f230378c13f3697cd735201eda511dba0d6ca
11526 F20101112_AABANE hamlin_h_Page_057.QC.jpg
de23c4380fffc94a2668de71360253d3
62e3cacad595136ad6ebf9ace0e08918c691b015
7089 F20101112_AABAMQ hamlin_h_Page_047thm.jpg
48390e3e4b231709fda060363a8217f0
b5b1996945779d345163fb1d0fcaf1d417149a84
25777 F20101112_AABANF hamlin_h_Page_058.QC.jpg
5d08c586923e3fb06731386b58e2939d
9dacfd77a745ebb10627713462d159067a1a21b1
24404 F20101112_AABAMR hamlin_h_Page_048.QC.jpg
db2c1c4387609186e4f98895f4ae899b
c7d03acb63be95dc8b4fd8581df29ef7e748ec06



PAGE 1

NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN STURGEON, Acipenser baeri By HEATHER J. HAMLIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

Copyright 2007 by Heather J. Hamlin

PAGE 3

To my family

PAGE 4

ACKNOWLEDGMENTS First and foremost I thank Lou Guillette for his tremendous mentorship, for sharing with me his wealth of knowledge and experience and for having more faith in me than I did at times. I am a better person for having worked with him. I thank my advisor and other members of my committee for their encouragement and support: Ruth Francis-Floyd wa s graciously supportive and gave me the freedom to do what I love ; Kevan Main gave me the opportunity and encouragement to fulfill my dream; Daryl Parkyn read my manuscripts and gave me valuable comments; Roy Yanong gave me valuable opinion s and comments on my manuscripts and Ill always appreciate his enthusiasm for disease. Id also like to thank Jim Michaels for allowing me access to my research animals and supporting my research. This journey would not have been nearly as fulfilling were it not fo r the comradery of my fellow lab mates: Thea Edwards, who taught me EI As and introduced me to the lab experience. Ill always treasure our late night conversations about ever ything from egg cups to egg development; Brandon Moore, who took the time to mentor me and with whom Ill always enjoy scientific discussions; Satomi Kohno, whose pa tience in teaching lab techniques deserves an award; Iske Larkin, for teaching me the wonders of RIAs. Lori Alberg otti, Ashley Boggs and Nicole Botteri, who made me wish I could spend mo re time in the lab. Id also like to thank all the undergraduate students who assisted me with collections and lab analyses. Finally, Id like to thank my friends and family, without whom the journey wouldnt be worth it: my Mother, Holly Paulsen, who let me have every creature known to man as a child, and spent countless hours with me as an adult coll ecting data and analyzing samples in this work. It wouldnt have been the same without her he lp; my Father, Greg Hamlin, who bought me my first aquarium; my best friend Ma ria Piccioni, who supported me tr emendously in this journey; iv

PAGE 5

Id love to be half the person she thinks I am; Dave Jenkins, who supported me more than he knows; and Amy Leighton, who made my childhood something to treasure. v

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS .............................................................................................................iv TABLE OF CONTENTS ...............................................................................................................vi LIST OF TABLES .......................................................................................................................viii LIST OF FIGURES .......................................................................................................................ix ABSTRACT ...................................................................................................................................xi 1 INTRODUCTION................................................................................................................. ...1 Background ...............................................................................................................................1 Overview of Reproductive Endocrinology in Fishes ........................................................1 Stress in Fish and Its Effects on Reproduction ..................................................................3 Endocrine Disruption in Aquatic Vertebrates ...................................................................6 Nitrate in Natural Water Systems ......................................................................................9 Nitrate in Aquaculture and Its Implications as an EDC ....................................................9 Sturgeon as a Model Species ...........................................................................................12 Research Objectives and Hypotheses ..............................................................................13 2 NITRATE TOXICITY IN SIBERIAN STURGEON............................................................18 Introduction .............................................................................................................................18 Methods ..................................................................................................................................20 Study Animals and Pre-Testing Conditions ....................................................................20 Range-Finding Studies ....................................................................................................20 Test Procedures ...............................................................................................................21 Statistical Analyses ..........................................................................................................22 Results .....................................................................................................................................22 Discussion ...............................................................................................................................23 3 STRESS AND ITS RELATION TO ENDOCRINE FUNCTION IN CAPTIVE FEMALE SIBERIAN STURGEON.......................................................................................30 Introduction .............................................................................................................................30 Methods ..................................................................................................................................33 Fish and Sampling...........................................................................................................33 Surgical Sexing................................................................................................................34 Treatments .......................................................................................................................34 Hormone Evaluations ......................................................................................................35 Statistical Analyses ..........................................................................................................36 Results .....................................................................................................................................36 Morphology and Chemistry .............................................................................................36 vi

PAGE 7

Hormones ........................................................................................................................37 Discussion ...............................................................................................................................38 4 NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN STURGEON........................................................................................................46 Introduction .............................................................................................................................46 Methods ..................................................................................................................................49 Fish and Sampling Procedures ........................................................................................49 Surgical Sexing................................................................................................................50 Experiment 1 ...................................................................................................................51 Experiment 2 ...................................................................................................................52 Hormone Evaluations ......................................................................................................53 Statistical Analyses .................................................................................................................54 Results .....................................................................................................................................54 Experiment 1 ...................................................................................................................54 Experiment 2 ...................................................................................................................56 Discussion ...............................................................................................................................57 5 EFFECTS OF NITRATE ON STEROIDOGE NIC GENE EXPRESSION IN CAPTIVE FEMALE SIBERIAN STURGEON.......................................................................................69 Introduction .............................................................................................................................69 Methods ..................................................................................................................................73 Fish and Experimental Systems .......................................................................................73 Surgical Sexing and Tissue Collection............................................................................73 Treatments and Experimental Conditions .......................................................................74 RNA Isolation and Primer Design ...................................................................................74 Quantitative Real-Time PCR ...........................................................................................75 Sequence Data .................................................................................................................76 Statistical Analyses ..........................................................................................................76 Results .....................................................................................................................................77 Water Chemistry ..............................................................................................................77 Steroidogenic Gene Expression and Horm one Regressions from Previous Studies .......78 Sequence Data .................................................................................................................77 Discussion ...............................................................................................................................78 6 SUMMARY AND FUTURE DIRECTIONS.......................................................................103 Summary ...............................................................................................................................103 Future Directions ..................................................................................................................107 Conclusions ...........................................................................................................................108 LIST OF REFERENCES .............................................................................................................110 BIOGRAPHICAL SKETCH .......................................................................................................130 vii

PAGE 8

LIST OF TABLES Table page 1-1 LC50 results and test conditions for three size classes of Siberian sturgeon exposed to sodium nitrate .....................................................................................................................27 1-2 Representative ac ute toxicity data for nitrate ....................................................................28 5-1 Forward and reverse prim ers used for quantitative real-time PCR ...................................85 5-2 Regression data mRNA expressi on patterns for P450 side chain cleavage enzyme (P450SCC), estrogen receptor (ER ), glucocorticoid receptor (GR), testosterone (T), 11-ketotestosterone (11KT), 17 -estradiol (E2) cortisol and glucose in sturgeon exposed to 1.5 and 57 mg/L NO3-N. ..................................................................................86 5-3 Regression data for testoste rone (T), 11-ketotestosterone (11KT), 17 -estradiol (E2) cortisol and glucose in sturge on exposed to 1.5 and 57 mg/L NO3-N from Chapter 4 .....87 viii

PAGE 9

LIST OF FIGURES Figure page 1-1 Overview of the hypothalami c-pituitary-gonadal axis in sturgeon ....................................15 1-2 A representative steroidogenic pathway of st eroid hormones in gonadal cells ..................16 1-3 A representative st eroidogenic pathway of cortisol production in an interrenal cell .........17 2-1 Linear regression of log10 transformed nitrate-N (mg/L) lethal concentration values versus log transformed fish weight (g). .............................................................................29 3-1 Blood sampling times for treatments 1-4 of fish held under confinement stress for 4-h ...43 3-2 Plasma cortisol (A) and pl asma glucose (B) concentrations (mean S.E.M.) during a 4-h capture and confinement period ..................................................................................44 3-3 Sex steroid data for treatment 2. Plasma 17 -Estradiol (A), testosterone (B), and 11ketotestosterone (C) taken fr om serial bleeds of cultured female Siberian sturgeon throughout the 4-h period of confinement stress ...............................................................45 4-1 Blood sampling times for treatments 1 and 2 of fish held under confinement stress for 6-h. .....................................................................................................................................62 4-2 Plasma cortisol (A) and glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N ..................................................................................................63 4-3 Plasma testosterone (A), 11-ketote stosterone (B) and estrad iol (C) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N ..............................................64 4-4 Plasma cortisol (A) and glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N ..................................................................................................65 4-5 Plasma cortisol (A), glucos e (B) testosterone concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N .......................................................................66 4-6 Plasma cortisol testosterone (A), 11-ketotestosterone (B) and estradiol-17 (C) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N .......................67 ix

PAGE 10

4-7 Plasma cortisol (A) and glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N ....................................................................................................68 5-1 Nucleotide and deduced amino acid sequ ences of Siberian stur geon ribosomal protein L8 (RPL8) ..........................................................................................................................88 5-2 Nucleotide and deduced amino acid sequences of Siberian sturgeon P450SCC..................89 5-3 Nucleotide and deduced amino acid sequences of Siberian sturgeon ER ........................90 5-4 Nucleotide and deduced amino acid sequences of Siberian sturgeon GR ..........................91 5-5 Sequence comparison of deduced ami no acid sequences for ribosomal protein L8 (RPL8) ................................................................................................................................92 5-6 Sequence comparison of deduced amino acid sequences for P450SCC...............................93 5-8 Sequence comparison of deduced amino acid sequences for ER .....................................95 5-9 Mean ( SE) expression of P450SCC mRNA in 4.5 year-old Siberian sturgeon. ................96 5-10 Mean ( SE) expression of glucocorticoid (GR) receptor mRNA in 4.5 year-old Siberian sturgeon. ..............................................................................................................97 5-11 Mean ( SE) expression of estrogen receptor(ER ) mRNA in 4.5 year-old Siberian sturgeon. ..............................................................................................................98 5-12 Linear regression of glucose (mmol/L) vs GR mRNA (normalized to L8 expression) for fish exposed to 1.5 mg/L nitrate-N...............................................................................99 5-13 Linear regression of ER mRNA and GR mRNA (normali zed to L8 expression) for fish exposed to 1.5 mg/L nitrate-N. .................................................................................100 5-14 Linear regression of P450SCC mRNA (normalized to L8 expression) and T for fish exposed to 57 mg/L nitrate-N ..........................................................................................101 5-15 Linear regression of P450SCC mRNA (normalized to L8 expression) and 11-KT for fish exposed to 57 mg/L nitrate-N ...................................................................................102 6-1 Possible a lterations in nitrate indu ced elevations of sex st eroid concentrations in Siberian sturgeon .............................................................................................................109 x

PAGE 11

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN STURGEON, Acipenser baeri By Heather J. Hamlin May 2007 Chair: Ruth Francis-Floyd Major: Fisheries and Aquatic Sciences Numerous environmental contaminants have been shown to alter reproductive endocrine function. Such compounds have been termed e ndocrine-disrupting contam inants (EDCs). EDCs exert their effects through numerous physiolo gical mechanisms, including alterations in steroidogenesis. Although a global pollutant of most aquatic systems, nitrate has only recently begun to receive attention for its ability to alter endocrine function in wildlife. We examined nitrate-induced endocrine disrupti on using the Siberian sturgeon (Acipenser baeri ) as a model species. Comparisons of captive populations of st urgeon cultured in nitr ate concentrations of 1.5, 11.5 and 57.5 mg/L nitrate-N revealed nitrate induced elevations in plasma concentrations of sex steroids including testoste rone, 11-ketotestosterone and 17 -estradiol. Alterations in circulating concentrations of sex steroids can be a response to several ph ysiological mechanisms, including an up-regulation of gona dal steroid synthesis, altered biotransformation and clearance by the liver or alterations in plasma storage by steroid bi nding proteins. To gain a better mechanistic understanding of the observed sex steroid elevations we examined mRNA expression patterns of steroidogenic enzymes (P450 SCC ) and receptor proteins (ER and GR). We found no significant differences in mRNA expression patterns, indicating xi

PAGE 12

that the observed sex steroid increases were not likely due to an up-regulation of gonadal synthesis. Cortisol and glucose, commonly examined as indicators of perceived stress, were not found to vary among groups exposed to any of the nitrate concentrations. Because responses to stress can be cumulative, endocrine responses to stress events in fish residing in the various nitrate concentrations were also investigate d. Results showed that nitrate does alter the associated stress response, defined by plasma glucose concentrations. These data suggest that long-term exposure to nitrate is associated with altered endocrine parameters (e.g., plasma hormone concentrations) in Siberian sturgeon. Future work must begin to examine the underlying causes of these cha nges. Although the data of gene expression suggest that mRNA concentrations of at least one steroidogenic enzyme were not altered, other enzymes in the pathway need to be examined. Th ese data indicated that nitrate concentrations must now be considered in the effective management of sturgeon populations in both natural and captive environments. xii

PAGE 13

CHAPTER 1 INTRODUCTION Background Overview of Reproductive Endocrinology in Fishes The production of circulating hormones is the result of numerous physiological reactions spanning many levels of biological organization. The regulation of hormone production is controlled by mechanisms that both create and destroy these chemical messengers, and is fine-tuned by various stimul atory and feedback mechanisms (Norris, 1997). Tropic hormones regulate many of the ac tivities of the thyroid gland, adrenal gland and the gonads (Norris, 1997). The endocrine regulation of reproduc tion is initiated in response to environmental cues, which stim ulate the release of gonadotropin-releasing hormone (GnRH) from the hypothalamus (Detlaff et al., 1993; Norris, 1997) (Figure 1-1). In response to GnRH, the anterior pituita ry releases gonadotropins, which circulate throughout the body, targeting various or gans, such as the gonads. Two chemically distinct gonadotropins have been characterized in fish, GTH-I and GTH-II, which are purportedly analogous to follicle stimulating hormone (FSH) and luteinizing hormone (LH), respectively, in terrestrial animals (Norris, 1997). Because few fish species have defined chemical hormone structures to date, much of the research literature employs heterologous hormones (Van Der Kraak et al., 1998). FSH stimulates oogenesis and spermatogenesis, and LH stimulates final gamete maturation and release. Like FSH and LH, GTH-I and GTH-II consist of an and subunit; the subunit is the same for both gonadotropins, with only the subunit conferring bi ological specificity (Norris, 1997; Vasudevan et al., 2002). The subunits of both gonadotropins have been cloned in Siberian sturgeon ( A. baeri ) and Russian sturgeon ( A. gueldenstaedti ), and based 1

PAGE 14

on their function and position in the phylogenetic tree, it wa s suggested these compounds be termed FSH and LH, respectively (Que rat et al., 2000; Hurvitz et al., 2005). FSH and LH stimulate gonadal steroidoge nesis, and the three steroid hormones relevant to this study are estradiol-17 (E 2 ), testosterone (T) and 11-ketotestosterone (11KT). In females, E 2 stimulates gonadal growth, sexua l maturation, vite llogenesis by the liver and oogenesis (Knobil and Neill, 1994; Norris, 1997; Denslow et al., 2001). In males, T stimulates sexual maturation, spermatogenesi s and spawning, and is implicated in sexual behavior for both males and females (Norris, 1997; Toft et al., 2003). In addition to inducing spermatogonial prolifer ation, 11-KT likely also participates in the former processes (Schultz and Miura, 2002). Circulating hormones can be detected by recep tors at the periphery of the cell, and through a cAMP mediated proce ss ultimately leads to increa sed levels of intracellular cholesterol (Stocco, 1999). This cholestero l is mobilized to the outer mitochondrial membrane and is the precursor for steroid biosynthesis. A protein inserted in the mitochondrial membrane, steroidogenic acute re gulatory (StAR) protein, functions to transport cholesterol from the outer mitoc hondrial membrane to the inner mitochondrial membrane, and this process is now thought to be the rate limiting step in steroidogenesis (Stocco, 1999). Its function has received cons iderable attention in recent studies of vertebrates (Stocco, 2001), including fish (G oetz et al., 2004). The inner mitochondrial membrane is the site of activity for the P450 side chain cleavage enzyme (P450 SCC ) that cleaves cholesterol to form the first steroid in the pathway, pregnenolone. Pregnenolone is then converted to progesterone by 3 -hydroxysteroid dehydrogenase (3 -HSD). Both P450scc and 3 -HSD are often evaluated in studies of steroidogenesis and related 2

PAGE 15

physiological mechanisms (Takase et al., 1999; Pozzi et al., 2002; Inai et al., 2003). Further pathways of steroi d production are shown in Figur es 1-2 and 1-3. Quantifying compounds in the biosynthetic pathways will assist in developing a mechanistic understanding of which pathways can be disrupted. Stress in Fish and Its Effects on Reproduction Stress has been defined in the literature in a number of ways, encompassing such definitions as diversions of metabolic ener gy, adaptive changes resulting in modifications to normal physiological states, and any change that impacts long term survival (Selye, 1956; Esch and Hazen, 1978; Wedemeyer and McLeay, 1991; Bayne, 1985; Barton and Schreck, 1987). Ultimately our interest in stress is attendant upon the causative factors mitigating the deleterious response. Once these causative factors are determined, we can then begin the process of remediation. In this sense, understanding stress is a means to an end and becomes a useful tool to predict if negative outcomes are likely to ensue. We can use this diagnostic tool to unde rstand environmental impact and determine at what point action is necessary to effectuate relief. As in other vertebrates, concentrations of coricosteroid hormones are sensitive indicators of acute stress in fi sh, and circulating concentratio ns generally reflect synthesis rates since little hormone is stored in the ad renal (mammals) or interrenal tissue (fish) (Norris, 1997). The production of corticostero ids is initiated by perc eived stress events, triggering the release of cort icotropin releasing hormone (CRH) from the hypothalamus, which then triggers the release of ACTH from the pituitary (Figure 12) (Flik et al., 2006). Circulating ACTH triggers the release of corticosteroids from the interrenal cells of the head kidney in most fish species; in sturge on cortisol releasing adrenocortical cells are present in small clusters throughout the kidney (Norris, 1997). 3

PAGE 16

The principal corticosteroid in most fi sh species is cortisol (Kime, 1997; Barton, 2002; Overli et al., 2005), which has been imp licated as a causal f actor in many of the deleterious effects of stress (Barton and Iwama, 1991; Ha rris and Bird, 2000; Schreck, 2001; Bernier et al., 2004). Cor tisol shows two primary actions in fish, regulation of water and mineral balance and energy metabolism (Wendelaar Bonga, 1997). The effects of corticosteroid hormones are mediated through intracellular re ceptors, which act as ligand binding transcription factors (N orris, 1997). Fish possess bot h a glucocorticoid receptor (GR) and a mineralcorticoid receptor (MR) w ith GR possessing various isoforms (Bury et al., 2003). While cortisol is the predominant ph ysiological ligand for GR, it is still unclear what is the primary ligand for MR in fish, which shows a high affinity for both deoxycorticosterone and al dosterone (Prunet et al., 2006). Th is is particularly interesting since there is no reliable evidence for the pres ence of aldosterone in teleosts, and it is becoming accepted that aldosterone is likely absent in most or potentially all fish groups (Prunet et al., 2006). The molecular characterization of corticoste roid receptors (CR) in the last 10 years has modified the initial consensus of a unique high affinity binding site for cortisol, and now depicts a multiple CR family with two cla sses of receptors (GR and MR) with splicing isoforms and duplicated genes (GR1 and GR2) (Prunet et al., 2006). Functional analyses in trout show that GR2 has a higher sensitivity to cortisol when compared to GR1, and that these isoforms show different patterns of expression sensit ivity depending on the tissues targeted (Greenwood et al., 2003). It has also been shown that GR can be less sensitive to corticosteroids than MR, suggesting that the la tter could serve as a high affinity cortisol receptor in fishes, a condition already described in humans (Hellal-Levy et al., 2000). 4

PAGE 17

The significance of cortisol in assessments of stress may be limited when examining chronic stressors, due in part to the acclimation of the interrenal tissues during chronic stress, which is mitigated by negative feedb ack mechanisms on the hypothalamo-pituitaryinterrenal (HPI) axis (R otllant et al., 2000). Other bio-ma rkers, such as expression levels of GR, have been shown to be more sensitive indicators of chronic stre ss. Quantification of GR in seabass ( Dicentrarchus labrax ) showed significantly reduced GR concentrations after a 3-month exposure to elevated stoc king densities (Terova et al, 2005). Environmental contaminants have been s hown to alter the stre ss response by altering GR activation. Organotins, compounds used as industrial stabilizers in paints now present in aquatic environments, have been shown to block GR activation (Odermatt et al., 2006). Other ubiquitous pollutants such as PCBs and arsenic have also been shown to alter GR receptor functioning (Johansson et al., 1998; Bodwell et al., 2004). The effects of stress can be manifest at multiple levels of the reproductive endocrine axis (Guillette et al., 1995; Pankhurst and Van Der Kraak, 1997). Although there is limited information on the effects of stress on the rel ease of GnRH on aquati c inhabitants, several studies have been conducted identifying stre ss impacts on circulating concentrations of GTH-I and GTH-II. For some species of fish such as brown trout ( Salmo trutta ), confinement stress results in an increase in circulating concentrati ons of GTHs (Pickering et al., 1987; Sumpter et al., 1987). For othe r species, such as the white sucker ( Catostomus commersoni ), capture and transport st ress results in depression of GTHs to undetectable concentrations within 24 h of capture (Stacey et al., 1984). The effects of stress on concentrations of gonadal steroids in both terrestrial and aquatic animals is well documented, resulting in a depression in plasma concentrations of 5

PAGE 18

both androgens and estrogens in most species st udied to date (Francis, 1981; Pickering et al., 1987; Carragher and Pankhurst, 1991). These reductions can be attributed to altered secretion of gonadotropins (Gra y et al., 1978) as well as by direct inhibition of gonadal steroid synthesis (Saez et al., 1977; Sapolsky, 1985). Cortisol has also been implicated in alteri ng endocrine function. Cortisols negative effects on reproduction includes depressed pl asma concentrations of sex steroids (Pankhurst and Dedual, 1994; Pott inger et al, 1999). However, this response is dependent upon the hormones involved and the species investigated. Elev ated plasma concentrations of cortisol in Stellate sturgeon ( A. stellatus) females have been shown to result in correspondingly lower concentrations of ci rculating plasma T and 11-KT, however, E 2 and progesterone (P) remain constant (Semenkova et al., 2002). Similarly, Bayunova (2002) observed an inverse relationship between cortisol and T after a 9-h period of confinement stress for both male and female stellate st urgeon. Consten et al. (2002) investigated whether the decrease in plas ma 11-KT of male carp was ca used by a direct effect of cortisol, or by an indirect effect (such as a decrease in plasma LH). Experimental animals were fed cortisol-containing food pellets over a prolonged peri od, and the results indicated that cortisol had a direct i nhibitory effect on testicular androgen secretion that was independent of LH secretion. Reductions in reproductive hormones can lead to a myriad of deleterious reproductive effects such as d ecreased gamete quality, embryo mortality, and behavioral changes (Pankhurst and Va n Der Kraak, 1997; Pankhurst, et al., 1995). Endocrine Disruption in Aquatic Vertebrates Xenobiotics, or man-made chemicals, have been shown to disrupt normal hormone function, and have received considerable attention over the last decade (Colborn and Clement, 1992; Guillette, 2000; McLachlan 2001 ). Compounds evaluated as endocrine 6

PAGE 19

disrupting contaminants have generally in cluded common environmental pollutants which have demonstrated abilities to mimic hormone s, alter hormone production, or act as antihormones (Guillette, 2000). Molecularly, xenobiot ics have the ability to bind directly to steroid hormone receptors or other proteins that initiate or facilitate the transcription of genes (Thomas, 1990; Rooney and Guillette, 2000) Compounds such as polychlorinated hydrocarbon pesticides (e.g., DDT derivatives), polychlorinated biphenyls (PCBs) and others have been shown to bind to estroge n receptors manifesting estrogenic or antiestrogenic actions in mammals and birds (B ulger and Kupfer, 1985; Rooney and Guillette, 2000). Extensive work has been conducted in fishes, and evidence indicates similar mechanisms occur (Thomas, 1990; White et al., 1994; Tyler et al., 1998a; 1998b; 1999; Jobling et al., 1995; 1996; 1998; 2002). Numerous studies document a vast array of endocrine disruptive effects in fish located in polluted aquatic systems and areas downstream of sewage or other industrial treatment plants (Jobling et al., 2003; Toft et al., 2004). Male walleye ( Stizostedion vitreum ) collected near a metropolitan sewage treatment plant exhibite d depressed serum T concentrations and elevated serum E 2 concentrations compared to reference males (Folmar et al., 2001). Reduced plasma concentrations of T have also been documented in lake whitefish ( Coregonus clupeaformis) and white sucker (Catostomus commersonii ) exposed to bleached Kraft mill and pulp mill effluent respectively (Munkittrick et al., 1992; 1994). Female mosquitofish downstream from Kraft paper-mill effluent in Florida demonstrated masculinization of the anal fins, which is an androgen-dependent trait (Parks, et al., 2001). Male mosquitofish from a Florida lake cont aminated with known endocrine disruptors displayed shorter gonopodium, significantly redu ced whole body T concentrations, reduced 7

PAGE 20

liver weights and had reduced sperm counts versus those of a reference population (Toft et al., 2003). Compounds such as the natural steroid E 2 have been measured in both industrial and municipal sewage treatment effluents, whic h represent the principl e sources of natural estrogens in the aquatic environment (Lai et al., 2002). Exposure to E 2 caused disruptions in sexual differentiation in young zebrafish and altered egg production patterns in adults (Brion et al., 2004). Exposure of the riverine species the roach ( Rutilus rutilus ) to a host of chemicals persistent in typical British waters, revealed significantly in creased incidences of intersexuality and plasma vitellogenin concentrations and attributed these alterations to estrogenic constituents of sewage effluents (Jobling et al., 1998). Considerable work also has been conducted on abnormalities of the reproductive system of Floridas alligators in relation to environmental co ntamination, notably in Lake Apopka, located northwest of Orlando. These studies report reducti ons in circulating concentrations of sex steroids, alterati ons in gonadal morphology, phallus size, enzyme activity and steroidogenesis (G uillette, et al., 1999; 2000). These modifications were attributed to both embryonic and post-hatc hing exposure to a complex mixture of chemicals from agricultural activities and stormwater runoff, including PCBs, p,p -DDE, dieldrin, endrin, mirex, and oxychlordane. Ex cess nitrate has also been shown to alter steroidogenesis and endocrine function in seve ral aquatic species (G uillette and Edwards, 2005; Barbaeu, 2004). Detailed lists of know n endocrine disrupting contaminants and their documented effects are readily availabl e (Edwards, 2006), and wi ll be discussed in further detail in Chapters 3, 4 and 5. 8

PAGE 21

Nitrate in Natural Water Systems In nature, organic and inorganic nitrogen is cycled through various environmental processes such as nitrifica tion, denitrification, fixation a nd decay. Nitrification and denitrification processes are esse ntial to the health of aquatic ecosystems. These processes generally begin with ammonia, which is broken down to nitrite by aerobic nitrifying bacteria (usually Nitrosomonas sp.), which is then converted by another group of bacteria to nitrate (usually by Nitrobacter sp.). Nitrate is often then fi xed by plants as a nutrient, or undergoes denitrification (Sharma and Ahlert, 1977). Complete deni trification converts nitrate to either nitrogen gas or organic nitrogen. Incomplete denitrification, resulting from inadequate sources of carbon or environmenta l conditions, results in nitrates conversion back to nitrite, or even ammoni a, by anaerobic denitrif ying bacteria (Van Rijn et al. 2006). Over the last several decades, concentrati ons of nitrate in natural water bodies from anthropogenic impact has increased significantly (Pucket, 1995), which has resulted in nitrate concentrations in many water sources fa r in excess of the EPA drinking standard of 10 mg/L nitrate-N (Kross et al., 1993; U. S. EPA, 1996). In northern Florida, concentrations as high as 38 mg /L nitrate-N were recorded in the Suwannee River (Katz et al., 1999). In addition to its direct effects, nitrate can encourage ex cessive algal and plant growth, adversely impacting the ecology of th e affected area (Attayde and Hansson, 1999; Capriulo et al., 2002). Nitrate in Aquaculture and It s Implications as an EDC As discussed previously, elevated con centrations of stress hormones have been shown to result in decreased concentrations of circulating sex ster oids. Environmental contaminants have been shown to elicit a st ress response, thereby decreasing circulating concentrations of sex steroids. In fact, some of the earliest reports of vertebrate stress 9

PAGE 22

responses were induced by chemical exposur e (Selye, 1936). While it is clear many manmade chemicals have considerable impact on horm one function in aquatic animals, it is less clear if naturally occurring compounds could also have the same effect. Contaminated aquatic ecosystems such as Lake Apopka, Fl orida provide ample opportunity to observe severe abnormalities of the reproductive system and are decidedly unhealthy for aquatic life. In aquaculture, aquatic animals are exposed to xenobiotic and natural compounds often far in excess of those experienced in nature, but resultant abnormalities are often overlooked since aquaculture fish are not necess arily expected to mimic wild fish. After all, they are held at higher densities, eat dramatically diffe rent diets, and are often held under unnatural temperature and light regimes. Additionally, defin itions of acceptable water quality standards of natu ral water environments (generally under EPA regulation) versus those of intensive aquaculture system s (under the regulation of the farm manager) are usually dramatically diffe rent. Commercial aquaculture operations have limited budgets (if any) for in-depth research into the factors that are contri buting to the success or failure of husbandry practices and protocols. Therefore, water quality estimates of safe operating levels in aquaculture are often the result of trial and error practices based on growth or mortality events. For species such as sturgeon, which take many years to reach reproductive maturity, and whose economic vi ability relies heavily on proper egg production, it may be important to investigat e more thoroughly the sublethal effects a potential hazard may impose. Nitrate has been overlooked as a material water quality hazard in both natural and aquaculture settings. Emerging information implic ates nitrate as a hazard at concentrations once thought to be innocuous for both reptile and amphibian species (see Guillette and 10

PAGE 23

Edwards, 2005). It has been shown that vertebrate mitochondria are capable of nitric oxide (NO) synthesis via non nitric oxide synthase (NOS) activity (Zweier et al., 1999) using nitrite as a precursor. Nitrat e can be converted to nitrite in-vivo (Panesar and Chan, 2000), and it is thought other enzyme s can generate NO directly from nitrate (Meyer, 1995). Nitric oxide is a gas that pl ays diverse roles in cellular signaling, vasodilation, immunity and has been documented to inhibit steroi d hormone synthesis (DelPunta et al., 1996; Panesar and Chan, 2000; Weitzberg and Lundberg, 1998). As discussed previously in this chapter, StAR and P450 SCC are key factors regulating steroi dogenesis. NO has been shown to alter the activity of St AR and may also alter P450 SCC by binding to the heme group which is present in all enzymes of the P450 fa mily (White et al., 1987). Bulls fed nitrate showed reduced sperm motility a nd degenerative lesions of the germ layers of the testes (Zraly et al., 1997). Medaka exposed for 2-months to no more than 75 mg/L NO 3 -N showed reduced fertilization and hatching rates (Shimura et al., 2002). A study of female mosquitofish ( Gambusia holbrooki ) in Florida showed reduced reproductive activity and embryo number in fish exposed to 5.06 mg/L NO 3 -N (Edwards et al., 2006b). Reproductive hormone concentrations have b een shown to be especially vulnerable to chemical and physical strain (Pickering, 1987), which as discussed can cause numerous reproductive complications. Since nitrate has been shown to negatively impact the reproductive physiology of a number of aquatic species (Edwards et al. 2006a; Edwards et al., 2006b) and sturgeon have been shown to be unusually susceptible to environmental impact (Akimova and Ruban; Dwyer et al., 2005), it stands to reason that nitrate could be an endocrine disrupting contaminant for Siberian sturgeon, and is worthy of investigation. 11

PAGE 24

In the United States and elsewhere, water is becoming a valuable and limited commodity, and its use is tightly regulated. New aquaculture operations will not be afforded the vast quantities of water establishe d facilities have been permitted to use, and will therefore need to use recirculating technolog ies which enable these facilities to reuse a significant portion of their water. In most of these recirculating facilities, the limiting factor for water exchange is nitrate concentration. Sturgeon as a Model Species Sturgeons belong to one of th e most ancient groups of Osteichthyes and are naturally distributed above the 30 th parallel. Although they can be found almost everywhere along the Pacific and Atlantic coasts, the Medite rranean and Black Seas, as well as rivers, lakes and inland seas, most sturgeon populations are sparse and occur in significant numbers in only a few regions (Detlaff et al., 1993). The Caspian Sea represents a unique reservoir, producing the bulk of the world s sturgeon capture fisheries. Sturgeon include anadromous, semi-anadromous and river-resident (freshwater) forms. The Siberian sturgeon have both semi-anadrom ous and river resident populations (Detlaff et al., 1993). Sturgeon have preserved primitive structural features relating them to chondrosteans, while at the same time the structure of their eggs is more similar to amphibians than either chondrosteans or teleosts, since th e inclusions of yolk are distributed throughout the cytoplasm. Alt hough sturgeon produce great numbers of large eggs, affording them great ecological advant age in hostile environm ents, ironically this production is at the nexus of their dwind ling population. Sturgeon eggs, termed caviar when processed, are a prized delicacy and commands very high prices. This has lead to over fishing on a grand scale (Birstein, 1993; W illiot et al., 2002). This over fishing, in 12

PAGE 25

concert with other anthropogenic impacts, such as river damming and pollution, has resulted in the reduction, or in some cas es decimation, of stur geon stocks worldwide (Williot et al., 2002). Aquaculture has been pr oposed as a mechanism to help save wild populations, either by reducing fishing pre ssures or by providing animals for stock enhancement. Due to the high value of cavia r, sturgeon aquaculture has great promise. As discussed above, nitrate is the limiting f actor for water exchange in recirculating aquaculture systems. The less water a facility uses, the greater the possible concentrations of nitrate, and although resear ch is underway to develop technologies to reduce nitrate concentrations, it is unclear what affects nitr ate has on fish residing in these systems. Additionally, environmental nitrate from anthropogenic sources is increasing at an alarming rate worldwide (Rouse et al., 1999), and with pollution implicat ed in reductions in wild sturgeon populations in the Caspian Sea, the worlds largest stur geon reservoir, the need to understand the affects of nitrate on st urgeon is becoming more and more apparent. That egg production is paramount to the viabilit y of sturgeon as an aquaculture species, and is of obvious ecological importance, necessitate s an understanding of the affects of nitrate on the reproductive system in particular. Research Objectives and Hypotheses The goal of this study was to gain a better mechanistic understanding of the potential for nitrate-induced disruptions in reproductive function, using Siberian sturgeon as a model. Based on previous studies review ed in this Chapter, I hypothesize that given nitrates ability to alter steroidogenic activity, notably thr ough NO induced alterations in P450 enzyme activities, that the fish exposed to elevated nitrate will demonstrate reduced concentrations of plasma sex steroid concentr ations, and these reductions will be mirrored in gonadal mRNA expre ssion patterns of P450 SCC ER and GR. I theorize that these 13

PAGE 26

alterations would not be caused by a generali zed stress response, but by disruptions in steroidogenic mechanisms directed at the produ ction of sex steroids, notably T, 11-KT and E 2 Compensatory mechanisms required to combat physiological challenges consumes energy and physiological resources that could otherwise be used to carry out other essential functions. Therefore, an animal experien cing simultaneous stressors, such as nitrate exposure in combination with an induced stresso r such as confinement, may not be as adept at responding to the stress events as an anim al experiencing a single stressor. I therefore hypothesize that long-term exposur e to elevated nitrate will alter the associated stress response. In addition, given th at GR has been shown to parallel chronic stress, I predict GR mRNA expression will be significantly reduced in animals exposed for 30 days to elevated nitrate. 14

PAGE 27

Figure 1-1. Overview of the hypothalamicpituitary-gonadal axis in sturgeon. The hypothalamic-pituitary-gonadal axis in st urgeon is similar to that of other vertebrates. Gonadotropic releasing hormone (GnRH) from the hypothalamus controls the release of gona dotropins (GTHs) from the pituitary that then enter circulation. The gonad responds by produc ing various sex steroids including 17 -estradiol, which stimulates hepa tic vitellogenin production. These processes are essential for normal ovarian follicle development. Similar to other fish species, the hypothalamic release of corticotropin-releasing hormone (CRH) controls the release of adreno-corticotropin hormone (ACTH) from the pituitary, which controls the release of glucocorticoids from the interrenal cells of the head kidney. 15

PAGE 28

CHOL P450SCCPREG PROG 3 -HSDAndrostenedione Testosterone 17 -Estradiol 17 -HSDP450AROMATASECholesterol Pool MITOCHONDRION STAR LH LH-R P450 17 hydroxylase 17 hydroxypregnenolone dehydroepiandrosterone 17 -h y drox yp ro g esterone Figure 1-2. Representative steroi dogenic pathway of steroid hormones in gonadal cells. In response to ligand binding of the receptor, the transfer of free cholesterol into the mitochondria facilitate d by steroidogenic acute regul atory (StAR) protein, is considered the acute rate limiting step in steroidogenesis. The enzymatic conversion of cholesterol to pregeneolone by P450 SCC is considered the chronic regulatory step in steroidogenesis. Pr egnenolone or progesterone is released into the cytoplasm/smooth endoplasmi c reticulum to be converted to androstenedione, which is in turn converted into testosterone and 17 -estradiol by 17 -HSD or aromatase respectively. 16

PAGE 29

ACTH CHOL P450SCCPREG PROG 3 -HSD 17 -h y drox y pro g esterone 11-deoxycortisol Cortisol P450 21-hydroxylase P450 11 -hydroxylase Cholesterol Pool MITOCHONDRION STAR P450 17 -hydroxylase ACTH Figure 1-3. Representative steroidogenic pathway of cortisol production in an interrenal cell. In response to ligand binding of the receptor, the transfer of free cholesterol into the mitochondria fac ilitated by steroidogeni c acute regulatory (StAR) protein, is consider ed the acute rate limiting step in steroidogenesis. The enzymatic conversion of chol esterol to pregeneolone by P450 SCC is considered the chronic regulatory step in steroidogenesis. 17 hydroxyprogesterone is released into the smooth endoplasmic reticulum for further processing and eventual conv ersion 11-deoxycortisol and cortisol. 17

PAGE 30

CHAPTER 2 NITRATE TOXICITY IN SIBERIAN STURGEON Introduction Ammonia is a product of the biological degrad ation of proteins and nucleic acids. Nitrifying bacteria convert ammoni a to nitrite, which is in turn converted to nitrate, the end product of nitrification (Sharma and Ahlert, 1977). Ammonia, a nd to a less extent nitrite, are ecologically relevant compounds and the to xicity of these compounds, both in terms of tolerable thresholds and physiologic mechanis m to aquatic animal health, has been well documented (Rubin and Elmaraghy, 1977; Meade, 1985; Huertas et al., 2002). Nitrate, however, does not normally reach toxic concentr ations in natural environments or in recirculating systems with high water exchange and has therefore received comparatively less attention as a material water quality hazard (Knepp and Arkin, 1973; Russo, 1985; Bromage et al., 1988; Meade and Watts, 1995). The absence of obvious pathophysiological effects in most aquatic species at ecologically relevant concentrations of nitrate, rationalizes the belief that nitrate is relatively non-toxic (Jensen, 1996). While nitrate is indeed much less toxic than ammoni a or nitrite on a mg/L basis, nitrate commonly rises to levels far in excess of those of the other compounds in intensive aquaculture environments with limited water exchange (Knepp and Arkin, 1973; Hrubec, 1996), and warrants more detailed investigations in to the effects thes e levels may have. Excess nitrate in aquaculture has traditionally been reduced by water exchange or the operation of denitrification filters (Timmons et al., 2001). Current trends in environmental regulation are limiting the amount of water which may be consumed or discharged, reducing the feasibility of using large infl uxes of water to rem ove excess nitrate. 18

PAGE 31

Denitrification filters can be technically challenging and costly, and as aquaculture operations become water limited, nitrate wi ll become a considerable concern. The levels of nitrate that are likely to cause concern are unknown for many aquatic species, as are how susceptibili ties to nitrate change ontoge netically. For large species such as sturgeon, it is logistical ly difficult and costly to cond uct acute toxicity evaluations on broodstock size animals. However, evalua tions using smaller animals may not mimic responses of larger fish. New evidence implicat es nitrate as a material water quality hazard at levels much lower than previously suspect ed for other aquatic sp ecies (Guillette and Edwards, 2005) and recommended levels of nitrate for warm-water fishes (90 mg N0 3 -N) (U.S. E.P.A., 1986) has been shown to be highly toxic to amphibians (Marco et al., 1999). Although a great deal of research needs to be conducted to elucid ate the effects of sublethal exposures, acute testing will assist researchers in understa nding how sensitive a particular species is to nitrate, and can be used as a tool to predict if susceptibilities may change over time. The most common analytic al method for evaluating acute toxicity in fish is the LC 50 (Parish, 1985) An LC 50 describes a lethal concentr ation (LC) at which 50% of the experimental population dies in a specified period of time. LC 50 data allows us to determine if a substance is toxic, how toxic it is, and allows for multi-species comparisons of sensitivity. The objectives of this study were to determine the acute toxicity of three ontogenetic size classes of Siberian sturgeon ( Acipenser baeri ) to nitrate, using the LC 50 criterion, to determine how life stage influences this response. 19

PAGE 32

Methods Study Animals and Pre-Testing Conditions Siberian sturgeon were reared from eggs in 250 L troughs in a recirculating system containing well water. Fish were initially fed Artemia and a soft moist formulated feed (Silver Cup, Nelson and Sons Inc., Murray, UT). When the fish reached 1.5 g they were transferred to 1300 L tanks and were fed only fo rmulated feeds by this time. Dissolved oxygen was monitored daily and rarely went below 90% saturation (Oxyguard Handy Beta, Point Four Systems Inc., Richmond, BC, Canada ). Temperatures were slowly increased throughout the fishs devel opment, and ranged from 15 C (at hatch) to 23.5 C. Other water quality parameters prior to the toxicity tr ials were evaluated weekly (ammonia-N and nitrite-N, Lamotte Smart Colorimeter, Ches tertown, MD; nitrate, Ion 6 Acorn Series, Oakton Instruments Vernon Hills, IL; pH, Acorn 6 Series, Oakton Instruments Vernon Hills, IL). In addition to the above parameters, alkalinity, chloride, total hardness and calcium hardness (Hach Company, Loveland, CO) were tested at the beginning and end of each 96-h toxicity trial. Range-Finding Studies Small-scale range finding studies using at le ast three nitrate concentrations with five fish/concentration were conducted prior to each test until a suitable test range was determined. Suitability was defined by total mortality in the highest concentration and no mortality in the lowest concentration in 96 hours within a narrow test range. Tests generally required 2-3 range findi ng studies per toxicity trial. Tanks were evaluated for mortalities every 3-4 hours from 08:00 to 20: 00, and dead fish were immediately removed and inspected for condition. 20

PAGE 33

Test Procedures Three partial exchange 96-h toxicity tests were conducted in tr iplicate using three weight classes of Siberian sturgeon spanning 3 orders of magnitude, with 10 fish per test container. Experiments were conducted ove r time using fish from the same cohort to eliminate cohort variability. New experimental animals were used for each trial. Water for each of the evaluations consisted of degassed well wa ter (nitrate-N 1.4 0.3 mg/L) from which nitrate solutions were created from food-grade sodium nitrate (JLM Marketing, Tampa, FL) Initial concentrations were confirmed with an Auto Analyzer and were periodically spot-checked with an ion specific probe (Ion 6 Acorn Series, Oakton Instruments Vernon Hills, IL) throughout the trials to ensure concentrations matched initial target values. Each trial evaluated f our geometrically consta nt concentrations of nitrate, as well as triplicate well water a nd sodium controls. Sodium controls were achieved with NaCl (Morton Salt, Chicago, IL ) with concentrations adjusted to match the sodium in the highest nitrat e concentration in the trial. Tanks were randomly assigned to each treatment. Tanks were evaluated for mortalities every 3-4 hours from 08:00 to 20:00 and dead fish were immediately removed and inspected for condition. The first trial evaluated concentratio ns of 555, 888, 1420, and 2273 mg/L nitrate-N using 6.9 0.31g fish. This trial was conducted in glass aquaria filled with 32.4 L of test solution, submersed in a water bath to maintain a temperature of 21 C. A 50% water exchange with the appropriate nitrate con centration was conducted half way through the trial to eliminate collateral effects from elevated ammonia or nitrite. Fish were not fed two days prior to and throughout the trial, a nd fecal debris was siphoned twice daily. 21

PAGE 34

At least twice daily, observations were made of fish behavior (orientation, gill ventilation rate, swimming speed) and appearan ce throughout the trial. The second trial evaluated concentrations of 216, 323, 485, and 727 mg/L nitrate-N using 66.9 3.4 g fish. This trial was conducted in fiberglass tanks fill ed to 670 L. The water was maintained at 23.5 C. The third trial evaluated concentr ations of 234, 421, 758 and 1364 mg/L using 673.8 18.6 g fish. This trial was conducted in fiberglass tanks filled to 587 L and the temperature was maintained at 23.5 C. Statistical Analyses Data from replicates were pooled prior to ca lculating the median le thal concentration. Median lethal concentrations and 95% confidence intervals were evaluated by the trimmed Spearman-Karber method for 24, 48, 72, and 96-hr time periods. Testing ranges, determined by range finding studies, were de signed to evaluate a 96-hr time period. Therefore, shorter time periods did not always result in enough mortality to compute the LC 50 values. Normal distribution was evaluated with the Shapiro-Wilks test. A linear regression of log 10 transformed data was conducted to predict susceptibilities of larger sturgeon using StatView statistical software package (SAS Institute, Cary, NC). Results No animals died in either the well water or sodium controls for any of the size classes tested, and appeared healthy th roughout the trial. The 96-h LC 50 of nitrate to 6.9 0.31 g Siberian sturgeon was 1028 mg/L nitrate-N (Tab le 2-1). Moribund fish in this size class tended to gill rapidly, but most showed few outwa rd signs of toxicity except a stiffening of the musculature and lethargy (decreased swim ming speed, frequent resting periods). The 96-h LC 50 of nitrate to the 66.9 3.4 g and 673.8 18.6 g sturgeon was 601 mg/L and 397 22

PAGE 35

mg/L nitrate-N respectively. Moribund fish in these treatments tended to exhibit additional evidence of the toxicity such as reddening around the mouth, and red specks and/or patches along the length of the body, most notably at the base of the pectoral fins. Log transformed nitrate vs. log transformed LC 50 values are shown in Fig. 2-1. Water chemistry parameters were as follows: unionized ammonia-N (NH 3 ) 0.04 0.02 mg/L; nitrite-N 0.01 mg/L; pH 7.9 0.2; alkalinity 208 12 mg/L; chloride 90 5 mg/L (exclusive of the NaCl control); total hardness 260 10 mg/L; calcium hardness 160 10 mg/L. Dissolved oxygen levels were maintained at 95% saturation throughout the trials. The ShapiroWilks test indicated normal distribution for a ll treatments. The 6.9 0.31 g sturgeon were maintained at 21.0 C while the latter two size cl asses were maintained at 23.5 C, which are typical temperatures for these size stages. Placing all three size classes at the same temperature would not represen t a realistic rearing condition, and previous toxicity tests with this species has not demonstrated a significant difference in LC50 values for temperatures ranging from 20 C-25 C for 6.0 g to 1 kg Siberian sturgeon (H. Hamlin, unpublished data). Discussion The United States is now recognizing wate r as a valuable and limited commodity, and its tight regulation is forc ing aquaculture technology to sh ift toward more sustainable and ecologically responsible practices. Theref ore, as the land-based aquaculture industry continues to grow, management strategies are shifting to recirculati ng systems with lower water exchange. This trend is creating new husbandry concerns as less clean water is available to flush out nitrate. In systems with limited water exchange, nitrate can build to levels of 150 mg/L nitrate-N or more (perso nal observation), and it is unclear the impact 23

PAGE 36

these elevated levels may have. Critical for the design of any aquaculture operation are the water quality standards to be maintained, a nd it is important to know what levels of substances are likely to cause concern (Bohl 1977). The etiology and effects of nitrate toxicity are relatively unknown in fishes, l eaving open future opportunities for research in this area. This information can then be used to understand toxi city thresholds and physiologic impact, as well as appropriately engineer remediation systems and technologies. Results of this study demonstrated the 96-h LC 50 for fish of 7-700 g to range between 397-1028 mg/L nitrate-N. These numbers are appreciably lower than those reported for most aquatic species tested to date. Comparative nitrate data from representative toxicity studies suggests that the majo rity of test populations can handle nitrate-N levels of 1000 mg/L nitrate-N or more (4426 mg/L total n itrate) without reachi ng 50% mortality, when sodium nitrate is used as the source of n itrate (Table 2). Some fish, such as the beaugregory ( Stegastes leucostictus ), exhibit LC 50 values of over 3000 mg/L NO 3 -N (13,280 mg/L total nitrate), substantially abov e the tolerance of most freshwater fish including Siberian stur geon (Peirce et al., 1993). Although diet may affect the relative toxicity of nitrate (Chow a nd Hong, 2002), a pervasive theory in the etiology of nitrate toxicity is that it is endogenous ly converted to nitrite (Hill, 1999), and it is in fact nitrite that is the biotoxic agent. In terrestrial anim als this theory has been the source of numerous debates (Hartman, 1982), and the mechanism of nitr ate toxicity in fishes is still unclear. Anecdotal evidence at Mote Marine Laboratorys Aquaculture Park (Sturgeon Commercial Demonstration Projec t) has shown Siberian sturgeon to be especially sensitive to nitrate, with larger animals exhibiting in creased incidence of t oxicity and mortality 24

PAGE 37

starting at levels as low as 90 mg/L nitrate-N (398 mg/L total nitrate, see Guillette and Edwards (2005) for an explanation of the re porting of nitrate concentrations) (H. Hamlin, unpublished data). Susceptibilities have been strongly affected by c ohort variability, with certain cohorts being more sensitive to elevated nitrate than others. Although the results in this study demonstrate a strong correlation between size and LC 50 values, caution must be taken in predicting susceptibilities of varying co horts of fish, or even fish within the same cohort, since LC 50 values have been shown to be highly variable (Buikema et al., 1982). Regression analysis of the curr ent data yield a predicted LC 50 of 247 mg/L nitrate-N (1093 mg/L total nitrate) for 6 kg fish (Fig. 2-1). Regardless of the high variability of toxicological responses to nitr ate, it is clear from this study that young Siberian sturgeon are far more tolerant to elevated nitrate than their adult counterparts, and this is the first study to demonstrate this finding. Often, the dose-response relationship is a scaled association between the concentration of chemical tested and the severi ty of the elicited re sponse (Lloyd, 1979). In general, younger or immature animals tend to be more susceptible to chemical insult or perturbation than are adults (Macek et al., 1978; Sprague, 1985). In fact, a common chronic toxicity test is the ear ly life stage test, because althou gh this test does not provide total life cycle exposure, it is purported to include exposur e during the most sensitive life stages (McKim, 1985). This study found an incr eased tolerance of Si berian sturgeon to nitrate at younger stages. Although this opposes general co nvention, this phenomenon has been reported for other fish species with othe r toxic compounds (Rosenberger et al., 1978). Acute toxicity tests are an effective tool to establish baseline toxicity thresholds in terms of responses to nitrate over time, and to compare the toxicity of nitrate to other 25

PAGE 38

species. Given the increased sensitivity of Si berian sturgeon to nitrate as compared to other species, it is clear much more work is needed to elucidate the sublethal effects of elevated nitrate exposure. The sensitive natu re of sturgeon to nitrat e renders them suitable candidates for further investig ation of the etiology and natu re of nitrate exposure and toxicosis. 26

PAGE 39

Table 1-1. LC 50 results and test conditions for thr ee size classes of Siberian sturgeon exposed to sodium nitrate Average weight 6.9 0.31 g 66.9 3.4 g 673.8 18.6 g 24-h LC 50 (mg/L NO 3 -N) 1510 n/a 803 95% confidence interval (1826-2631) (720-897) 48-h LC 50 (mg/L NO 3 -N) 1443 n/a 522 95% confidence interval (1309-1590) (486-562) 72-h LC 50 (mg/L NO 3 -N) 1195 n/a 438 95% confidence interval (1086-1316) (394-487) 96-h LC 50 (mg/L NO 3 -N) 1028 601 397 95% confidence interval (941-1124) (557-649) (357-441) Not enough partial kill res ponses to obtain a valid lethal concentration estimate. 27

PAGE 40

Table 1-2. Representative acute toxicity data for nitrate NO 3 NO 3 -N Species Source mg/L LC 50 Reference Cape sole ( H. capensis ) NaNO 3 5081 24-h LC 50 Brownell 1980 Common bluegill ( L. macrochirus ) NaNO 3 2909* 24-h LC 50 Dowden and Bennett 1965 Goldfish (C. carassius ) NaNO 3 2761* 24-h LC 50 Dowden and Bennett 1965 Tiger shrimp ( P. monodon) NaNO 3 1575 96-h LC 50 Tsai and Chen 2002 Catla ( C. catla ) NaNO 3 1565 96-h LC 50 Tilak et al. 2002 Channel catfish ( I. punctatus ) NaNO 3 1409 96-h LC 50 Colt and Tchobanoglous 1976 Chinook salmon ( O. tshawtscha) NaNO 3 1318 96-h LC 50 Westin 1974 Fathead Minnows ( P. promelas ) NaNO 3 1349 96-h LC 50 Scott and Crunkilton 2000 Guadalupe Bass ( M. treculi ) NaNO 3 1269 96-h LC 50 Tomasso and Carmichael 1986 African clawed frog ( X. laevis ) NaNO 3 1236 240-h LC 50 Schuytema and Nebeker 1999 Aquatic Snail ( P. antipodarum ) NaNO 3 1042 96-h LC 50 Alonso and Camargo 2003 Florida pompano ( T. carolinus ) NaNO 3 1006 96-h LC 50 Pierce et al. 1993 Sao Paulo shrimp ( P. paulensis) NaNO 3 494 96-h LC 50 Cavalli et al. 1996 Pacific treefrog ( P. regilla ) NaNO 3 266 240-h LC 50 Schuytema and Nebeker 1999 Guppy fry ( P. reticulatus) KNO 3 200 72-h LC 50 Rubin and Elmarachy 1977 Caddisflies ( C. pettiti ) NaNO 3 114 96-h LC 50 Comargo and Ward 1992 Publication did not specify whet her results were values for NO 3 or NO 3 -N 28

PAGE 41

2.5 2.6 2.7 2.8 2.9 3 3.1 0.511.522.533.5 Log fish weight (g)Log nitrate-N (ppm) Y=3.177 .208*X; R^2 = .994 Figure 2-1. Linear regression of log 10 transformed nitrate-N (mg/ L) lethal concentration values versus log transformed fish weight (g). 29

PAGE 42

CHAPTER 3 STRESS AND ITS RELATION TO ENDOCRI NE FUNCTION IN CAPTIVE FEMALE SIBERIAN STURGEON Introduction The central focus of comparative physiol ogy and endocrinology i nvolves understanding how various organisms respond to environmental infl uences. Fish are affected by stress in both their natural and captive environments. It is well recognized that common fishery and aquaculture practices, including cr owding, transport and confinement are stressful to fish and can negatively affect reprod uction (Pankhurst and Van Der Kraak 1997). The effects of stress can be manifested at many levels of the reproductive endocrine axis, and measuring the concentration of circulating hormones is a usef ul endpoint to understand if a stressor affects endocrine function. Numerous environmental stressors, including capture and confinement (Pankhurst and Dedual, 1994), time of day (Lankford et al., 2003), hypoxia (Maxime et al., 1995), and environmental contaminants (Orlando et al., 2002; Guillette and Edwards, 2005) have been shown to induce stress in fish. For most fish, including the Sibe rian sturgeon and other freshwater chondrosteans, cort isol is the predominant stress hormone (Maxime et al., 1995; Barton et al., 1998; Mommsen et al., 1999). Plasma glucose con centration has also been shown to be an indicator of secondary st ress responses (Bayunova et al., 2002). Sex steroids can have an invers e relationship with plasma conc entrations of stress steroids, an effect evident in fish and some other anim als (Carragher and Sump ter, 1990; Cooke et al., 2004). Negative effects of stress on reproduction have been attribut ed to the suppression of LH and FSH secretion from the pituita ry gland, disruptions in steroi dogenesis pathways, or alteration of hormone degradation by the liver and/or kidney (Krulich et al., 1974). Although plasma concentrations of corticosteroids often parallel acute st ress, there is evidence in teleosts that the 30

PAGE 43

estrogenic inhibitory effects of stress are not necessarily mediat ed by cortisol, and that these effects arise higher in the endocrine pathway than at the le vel of ovarian steroidogenesis (Pankhurst et al., 1995). Contradictory evidence has shown that the a ddition of cortisol to the culture medium reduces the secretions of 17 -estradiol (E 2 ) and testosterone (T) from cultured ovarian follicles of rainbow trout ( Oncorhynchus mykiss) (Carragher and Sumpter, 1989 ). Likewise, carp fed with cortisol-containing food pellets showed reduced androgeni c production, independent of LH secretion (Consten et al., 2002). Acute c onfinement stress in male brown trout ( Salmo trutta L.) resulted in low concentrations of plasma T and 11-KT in sexually mature animals (Pickering et al., 1987). White sturgeon ( Acipenser transmontanus ) injected with an AC TH analog exhibited a dose-dependent increase in cortisol concentration more than the co rtisol concentrations induced by stress events such as transport and handling (Belanger et al., 2001). A few studies, including one examining the effects of stress on serum cortis ol concentration in cult ured stellate sturgeon, actually demonstrated significantly increased game te quality in fish with elevated cortisol concentration, speculating that cortisol could be a normal endocrine component of the reproductive system, even though later studies of the same species showed reduced plasma concentrations of sex steroids during stress (Semenkova et al ., 1999; Bayunova et al., 2002). It has also been shown that fish require prolonged periods to recover from an acute stress event (Jardine et al., 1996). Other studies have show n that blood removal, a practice often necessary for evaluating endocrine endpoint s, can alter blood hemoglobin concentration (Hogasen, 1995). Stress studies typically focus on the causative factors mitigating the deleterious response, but defining these relationships often requires sampling and research measures that themselves contribute to enhancing the stress response. Understanding the eff ects of potential stressors is 31

PAGE 44

critical to properly manage wild fisheries or successfully culture endangered or economically important fishes. It is importa nt to know which stressors are na turally present in the fishs environment, which are caused by typical aqu aculture practices, and which are induced by the testing procedures th emselves (Conte, 2004). Sturgeons ( Acipenseriformes ) are among the most ancient fishes on earth, originating over 200 million years ago (see review by Birstein, 1993). Twenty-five extant sturgeon species occupy the Northern Hemisphere; however, exce ssive fishing, loss of spawning grounds and other environmental pressures have contributed to the reduction of sturgeon stocks worldwide, particularly Caspian Sea varieties (Williot et al ., 2002). Today, all 25 species of sturgeon are listed as endangered or threatened in some regard (Birstein, 1993). Aquaculture has been proposed as a means to conserve sturgeon, and ge nerating commercial stocks has the dual benefit of providing fish for stock enhancement, as we ll as for food production, thus conserving wild populations (Beamesderfer and Farr, 1997; Wald man and Wirgin, 1997; Chebanov et al., 2002; Stone, 2002). The Siberian sturgeon is rapidly beco ming a species of great economic interest in the United States, and is currently the most wide spread sturgeon species utilized for commercial aquaculture in Europe (Gisbert and Williot, 2002) Despite this, very few studies have been conducted to clarify the physiolo gical effects of stress on this species. Understanding the endocrine disruptive effects of induced stress will serve as a baseline for understanding the effects of other environmental stressors, such as contaminants commonly found in both natural and constructed environments. Nitrate, for exam ple, has recently been shown to be highly toxic to Siberian sturgeon in aquaculture environm ents with limited water exchange (Hamlin, 2006), and is predicted to be of cons iderable concern for commercial aquaculture operations, which are already being forced to significantly reduce their water usage. Nitr ates and other ions have also 32

PAGE 45

been established as ecologically relevant endoc rine disruptors in natural environments for numerous other vertebrates (see review by Gu illette and Edwards, 2005). For late maturing species such as sturgeons, w hose economic viability relies heavily on successful egg production (caviar), it is of particular importance to understand the relationships between stress and reproductive health. The purpose of this study is to define the relationship between induced stress and circulating concentrations of steroid hormones in cultured Siberian sturgeon, and to identify mitigating stress factors in typical testing pr ocedures, most notably the techniques of blood withdrawal and surgical sexing, to understand what factors contribu te significantly to the stress response. Methods Fish and Sampling Three-year-old Siberian sturgeon were collected from two 30,000 L tanks, each from separate commercial recirculating aquaculture sy stems at Mote Marine Laboratorys Aquaculture Park (Commercial Sturgeon Demonstration Project) in Sarasota, Florida. Experiments were started at approximately 10:30 a.m. in May of 2004. Water chemistry in each of these systems was analyzed weekly for the levels of ammonia-N, nitrite-N, nitrate, and pH prior to the start of experiments. Dissolved oxygen a nd temperature were monitored continuously using stationary probes, which were spot-checked biweekly for calibration using portable probes. Hardness, alkalinity, and chloride concentr ation was analyzed the day prior to the start of experiments. The sturgeon were pulled from the water by ha nd at the side of the tank and immediately held down on a padded V-shaped surgical table. Pulling the sturgeon from the tank by hand (versus netting) decreased the likelihood of stre ssing the remaining fish in the tank and allowed immediate access to the fish for blood sampling. Blood was extracted from the caudal vein (5 33

PAGE 46

ml) using a 10 ml syringe (20 gauge needle) within 1 min of captur e; most captures took 30 sec for the full blood sample to be drawn. The blood sample was placed into lithium heparin Vacutainer tubes, and stored on ice for less than 30 minutes before centrifugation. Plasma was separated via centrifugation (5-10 min at 2000 g), placed into cryovials, rapidly frozen in liquid nitrogen and stored at -80 C for 2-3 weeks prior to analysis. Surgical Sexing For surgical sexing, the sturge on were anesthetized in a 5 C water bath containing carbon dioxide. Carbon dioxide was used be cause it is a low regulatory prio rity anesthetic for fish that are grown for food production and requires no withdr awal period; the sturgeon used in this study were part of a commercial food production pr ogram. Pure oxygen gas administered through a fine air stone was used to maintain dissolved oxygen concentrations in the range of 8.0 12.0 mg/L in the anesthetic bath, and sodium bicarbon ate was added to maintain pH in the range of 6.8 7.5 throughout the procedure. The stur geon generally took 3 5 min for full anesthetization. A 2.5 3.8 cm incision was made on the ventral side of each fish, approximately 7.5 cm anterior to the vent, along the median axis to allow inspection of the gonads on either side of the fish for sex determination. The incision in each fish was closed by suturing with coated vicryl absorbable suture (Ethicon Inc ., Somerville, New Jersey), and the fish was allowed to recover in a confinement tank. Once anesthetized, the surgical procedure took approximately 1 min/fish, and the fish recovered fully from the anesthesia in 5 10 min. Treatments Six fish (3 fish/tank) were used for each trea tment. All fish were sexed immediately after initial bleedings/sham bleedings; if the fish was male, the sample was discarded, and another fish was extracted until 3 females had been sampled from each tank for each treatment. In this study, 34

PAGE 47

we focused on female sturgeon because they are part of a larger set of studies examining various environmental factors and ovarian development leading to commercial ca viar production. The female sturgeon were then weighed and measured just after sexing while they were still under anesthesia. The fish were th en placed into a square 0.64 m 3 insulated plastic tote filled with 530 liters of system water for a 4-h period of confinement stress. A numbered cable tie placed around the caudle peduncle id entified individual fish. The time at which the fish was removed from the tank for initial bleeding/sh am bleeding was considered 0-h. In all treatments, fish were sexed immediat ely after initial blood drawing/sham drawing prior to placement in the confinement tank. In treat ment 1, fish were bled at 0-h only and placed into an insulated tote as described previously. In treatment 2, fi sh were bled at 0-h, 1-h and 4-h. In treatment 3, fish were bled at time 1-h and 4h only, and in treatment 4, fish were bled at 4-h only. For treatments 3 and 4, during the sampling periods when the fish were not bled, the fish were held down on the surgical table momentaril y to mimic the bleeding procedure but were not pricked with the needle. Blood sampling times for all treatments during the 4-h period of confinement stress are shown in Fig. 3-1. Hormone Evaluations Plasma samples for steroid evaluations were thawed on ice, and the steroid fraction was extracted with diethyl ether. Extraction was re peated twice to enhance extraction efficiency. Plasma cortisol, E 2 T and 11-KT concentrations were an alyzed according to the instructions provided with the commercial competitive enzyme immunoassay kits (Cayman Chemical Co., Ann Arbor, MI), specific to each hormone. Each hormone was previously validated for Siberian sturgeon plasma by verifying that serial dilutions were parallel to the standard curve. Samples were run in duplicate and each plate contained d uplicate wells for interassay variance and a blank. Individual hormones were all run with plates from the sa me kit lot # and were completed 35

PAGE 48

in the same testing session to reduce testing va riance. Sample plates were analyzed using a microplate reader (BioRad, Hercules, CA). Intr a-assay and interassay variances, respectively, were as follows: estradiol, 3.5% and 7.0%; cortisol, 2.0% and 9.1%; testosterone, 3.7% and 12.8%; 11-KT, 4.9% and 11.9%. Plasma samples for glucose concentrati on determination were thawed on ice and evaluated according to the inst ructions provided with the comme rcial glucose oxidase assay kit (Invitrogen, Amplex Red, Eugene OR). The sample plat e was analyzed using a microplate reader (BioRad, Hercules, CA). Statistical Analyses Statistical analyses were performed using StatView for Windows (SAS Institute, Cary, NC, USA). Initial comparisons we re made to determine if there was a significant tank effect within treatments. F-tests were conducted to test variances am ong treatment groups for homogeneity. If variance was heterogenous, data were log 10 transformed to achieve homogeneity of variance; how ever, all reported means ( 1 SE) are from nontransformed data. Analyses of variance (ANOVA) of weight, leng th and hormone concentration was used to compare differences among treatment groups. If significance was determined ( P 0.05), Fishers protected least-signifi cant difference was used to dete rmine differences among treatment means. Results Morphology and Chemistry The average fish weights in this experime nt ranged from 4.13 to 4.55 kg, and the average fish length ranged from 88.8 to 92.2 cm. Neither weight nor length was significantly different among treatments, and there was no significant tank effect for any tested parameter. Water 36

PAGE 49

chemistry parameters were tested on the day of the experiment and were as follows: un-ionized ammonia (NH 3 ), 4.55 g/l; nitrite, 0.2 mg/L; pH, 7.5; alkalinity, 200 mg/L; chloride concentration, 85 mg/L; total ha rdness, 230 mg/L; and calcium ha rdness, 130 mg/L. Dissolved oxygen concentrations were maintained at 95% saturation throughout the trial and the temperature was 24 C. Hormones The 0-h plasma cortisol concentrations for treatments 1 and 2 averaged 6.65 3.58 and 4.63 1.02 ng/ml, respectively (Fig. 3-2A), and were statistically similar. The 0-h plasma glucose concentrations were sta tistically similar and averaged 2.13 0.12 and 2.21 0.11 mmol/L for treatments 1 and 2, respectively (Fig. 3-2B). The plasma concentrations of T, 11KT, and E 2 were statistically similar at 0-h for treatments 1 and 2 and averaged 25.53 2.9, and 10.2 0.8 ng/ml and 672.4 45.9 pg/ml, respectively. Plasma cortisol concentrati ons increased significantly (P 0.05) in the Siberian sturgeon from 0-h to the 1-h sampling period averaging 70.9 18.7 ng/ml at 1-h, and were not significantly different between treat ments 2 and 3 (Fig. 3-2A). Plasma glucose concentrations increased significantly from 0-h to th e 1-h sampling period and averaged 4.67 0.40 mmol/L at 1-h, and there were no significant differences am ong treatments 2 and 3 (Fig. 3-2B). At 4-h, plasma cortisol concentrations were similar for fish in treatments 2 (46.2 15.4 ng/ml) and 3 (36.27 14.0 ng/ml), but were significantly elevated compared with those observed for fish in the treatment 4 group (10.44 2.53 pg/ml) (Fig. 3-2A). Plasma gl ucose concentrations at the 4-h sampling period were similar for treatment 2 (4.70 0.27 mmol/L) and treatment 4 (4.14 0.38 37

PAGE 50

mmol/L), but were significantly lower than plas ma glucose concentrati on in treatment 3 (5.65 0.41 mmol/L) (Fig. 3-2B). The evaluation of treatment 2, in which the same group of fish at 0-h, 1-h and 4-h were sampled, demonstrated that plasma T concentrations increased significantly from time 0 to 1-h (20.3 1.76 and 31.45 4.19 ng/ml respectively), with a su bsequent decrease at 4-h to a concentration similar to that observed at 0-h (F ig. 3-3A). In the same fish, we observed no differences between bleeding times for E 2 or 11-KT (Fig. 3-3 B,C). Discussion The Siberian sturgeon that were exposed to capture and confinement stress exhibited significantly elevated plasma cortisol concentrat ions 1-h after the ini tiation of stress, which persisted throughout the 4-h sampling period. This re sponse is similar to the reactions of other fish species exposed to acute stressors (Thomas et. al., 1990). Cortisol and glucose have been shown to be more sensitive to stress than most other plasma constituents except catecholamines, and respond rapidly to a wide range of environmental stresso rs. Stress in fish and the concomitant increase in cortisol have been implicated in numerous physiological conditions including impaired immune functi on (Tort et al., 1996), altered feed ing behavior (Kentouri et al., 1994), oxygen radical production (Ruane et al., 2 002), and reproductive impairment (Pankhurst and Van Der Kraak, 1997). Responses to stress are largely dependent on the severity and type of environmental stressor. Previous studies with Siberian sturgeon exposed to acute and severe hypoxia have shown significantly elevated plas ma cortisol concentrations, with a peak concentration of 35,000 pg/ml (Maxime et al., 1995). The basal cortisol concentration in that study was approximately 5000 pg/ml, which is comparable to the basal cortisol concentration obtained in this study. However, the peak concen tration of cortisol in our study increased to 38

PAGE 51

nearly 75,000 pg/ml, demonstrating the plasticity of the physiological stress response in this species. In some species, plasma cortisol concentr ations can persist for da ys if the stressor is chronic or severe (Sumpter, 1997). This study is distinct from other studies in several regards. This is the first study to define the relationship between stress and pot ential reproductive functi on, as indicated by the plasma concentrations of various sex steroids, in Caspian Sea sturgeon, habituated to a warm environment and reared under commercial culture condi tions from the egg stage. This is also the first study to show the endocrine effects of surgical sexing, a procedure often necessary for sturgeon and other species that do not exhibit se xually dimorphic characteristics. The induced stressors in this study, caused by capture and c onfinement, bleeding, and surgical sexing are common stressors in a laboratory or fishery envi ronment, and it is important to understand what effects these stressors can have on mitigating experimental responses. In this experiment, fish underwent captur e and confinement stress, with multiple disturbances at 1-h and 4-h. It has been shown that serial stressors evoke cumulative physiological stress responses in other fish spec ies (Waring et al., 1997; Di Marco et al., 1999) and multiple stress events cause fish to be more sensitive to additional ac ute stress (Ruane et al., 2002). The multiple disturbances in this study likel y mitigated the expected decreases in plasma cortisol concentrations after 4-h, because in treatment 4, where fish were captured but not bled until the fourth hour of capture, fish exhibited lowe r plasma cortisol concentrations than fish in treatment 2 or 3. These lower concentrations co uld result from a more rapid return toward basal concentrations, due to the lack of repeated stresso rs, or a reduced stress effect as they were not bled initially, adding additional handling and blood loss to the stress. Our data indicate that serial bleedings intensify the associated stre ss response, as evidenced by significantly lower 39

PAGE 52

concentrations of F in fish in which a blood samp le was not drawn at 0-h or 1-h. This is an important consideration for future studies of this species involving multiple blood samples. Whether elevations in cortisol concentration for the serially bl ed fish are due to blood volume loss or its associated stressors su ch as pricking of the fish with a needle, or longer handling times to ensure that a fish is still for actual blood draw ing versus sham drawing, is uncertain. It is likely, however, that it is a combination of events and not solely blood loss that leads to elevated stress in serially bled fish. Note that surg ical sexing, an invasive procedure that is often necessary in aquaculture or fishery practice, did not induce a prolonged stress reaction, because fish in treatment 4, which were similarly sexed at 0-h, exhibited plasma cortisol concentrations similar to basal concentrations less than 4-h after the procedure. The 0-h blood sampling period was started in the morning and the experiment was concluded in the early afternoon. Cortisol conc entrations in sturgeon (Belanger et al., 2001; Lankford et al., 2003) and other animals (Young et al., 2004) have been shown to be highly sensitive to diurnal variation, so care was taken in this study to ensure that all samples were collected within a relatively short period to reduc e the possibility of daily hormone fluctuations as confounding variables. In addition to the con centrations of sex steroids, it has been shown that plasma cortisol concentration can be alte red depending on the reproduc tive stage in sturgeon (Barannikova et al., 2000) and other species (Pickering and Pottinger, 1985). The female sturgeon in this study were 3 years old, and a lthough all female sturgeon had formed clearly visible ovigerous lamellae or ovarian folds, none of them exhibited vitellogenic oocytes, and they appeared to be in a similar reproductive stag e. However, the plasma concentrations of sex steroids in this study were sim ilar to those of fish possessing fully vitellogenic oocytes in subsequent studies. 40

PAGE 53

Interestingly, the concentrations of sex steroi ds evaluated in this study did not demonstrate an inverse relationship with stress as defined by plasma cortisol c oncentrations; in fact, plasma T concentration was significantly elevated during pe riods of peak plasma cortisol concentration (Fig. 3-3A). Although there have been no studies of this kind, in which stress and reproductive function in Siberian sturgeon re ared in commercial culture conditions are evaluated, this response is distinct from that in published data with other fi sh species, including other sturgeon species. Of the reproductive hormones, testoste rone has been shown to be highly responsive to stress-induced alterations in sturgeons and othe r species (Pickering et al., 1987; Bayunova et al., 2002). Plasma E 2 and 11-KT concentrations were not si gnificantly affected by stress within the timeframe of this study. In Amer ican alligators, certain enviro nmental toxicants were found to increase plasma T concentrations in juveniles, but did not affect the plasma concentrations of other circulating hormones (Milnes et al., 2004). Our findings do not necessarily indicate, however, that stress is not detr imental to the reproduction of this species. Circulating concentrations of sex steroids are only one e ndpoint in the reproductive endocrine axis, and stress can manifest itself at many levels of th e steroidogenic pathway. Fo r example, sex steroids are generally removed from circulation via cleara nce by the liver. Reduc tions in sex steroid production would not necessarily be reflected in circulating concentrations if clearance is concomitantly affected. Other possible mechanis ms that would result in the alteration of the reproductive biology of this species include alterations in hypotha lamic-pituitary stimulation or alterations in transport mechanic s (i.e., transport proteins). Finally, the elevation in plasma T concentrations described here could be due to a technical problem; that is, although commercial antibodies ar e screened for cross r eactivity and specificity to a wide range of steroids, little is known a bout the steroid milieu released during stress in 41

PAGE 54

sturgeon. Although unlikely, it is possible that a unique androgen of adrenal origin is released during stress in this species that cross reacts with the antibody used in the testosterone but not in the 11-KT kits. Studies using advanced analy tical chemistry could determine the steroids released from stressed Siberian sturgeon. The data presented here indicate that the concentrations of sex steroids in Siberian st urgeon do not show an inverse relationship with elevated plasma cortisol concentration following acu te stress, as has been observed for most fish. This altered response needs further study, as this study differed from previ ous studies of sturgeon in that it coupled sturgeon habituated to warm temperature with a specific stress response. This is the first study to define the relationship be tween stress and endocrine function in cultured Siberian sturgeon, a threatened and commercially important species. Future studies need to address various aspects of the aquaculture envi ronment (e.g., temperature and water quality), reproductive stage (e.g., juvenile versus adult) and seasonality to determine which variables modify the stress response and thus potentially alter growth and reproductive potential. This work will also serve as a baseline to evaluate th e effects of material water quality hazards, such as nitrate, present in both natu ral and constructed environments. 42

PAGE 55

T 0 T 1h T4h Treatment 1 Treatment 2 Treatment 3 Treatment 4 Figure 3-1. Blood sampling times for Treatments 1 to 4 of fish held under confinement stress for 4 hours. Six female Siberian sturgeon were used for each treatment. 43

PAGE 56

a b b b b a a 100 90 80 70 60 50 40 30 20 10 0 A. Cortisol (ng/ml) 1-hr 0-hr 4-hr 0 1 2 3 4 5 6 7 0-hr 1-hr 4-hr Glucose (mmol/l) c B. bb b b a a Blood sampling time Figure 3-2. Plasma cortisol (A) and plas ma glucose (B) concentrations (mean S.E.M.) during a 4-h capture and confinement period. Mean s with the same superscript are not significantly different (P 0.05). 44

PAGE 57

A. 0 5 10 15 20 25 30 35 40 0-hr 1-hr 4-hra b a Plasma Testosterone (ng/ml) B. 0 2 4 6 8 10 12 14 0-hr 1-hr 4-hrPlasma 11-ketotestosterone (ng/ml) 0 100 200 300 400 500 600 700 800 900 0-hr 1-hr 4-hr Plasma Estradiol (pg/ml) C. Blood sampling time Figure. 3-3. Sex steroid data for treatment 2. Plasma 17 -Estradiol (A), testosterone (B), and 11-ketotestosterone (C) taken from serial bleeds of cultured female Siberian sturgeon throughout the 4-h period of confinement stress (mean 1 S.E.M.). Fish were serially bled at 0-h, 1-h and 4-h (see Fig. 3-1 legend for a description of treatment 2 bleeding times). Means with the same superscript or no superscript are not significantly different (P 0.05). 45

PAGE 58

CHAPTER 4 NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN STURGEON Introduction The endocrine disrupting actions of various chemical contaminants have become a significant concern for comparativ e endocrinologists (Col born et al., 1993; Guillette and Crain, 2000). A growing literature describes the effects of endocrine disrupting contaminants (EDCs) for both terrestrial (Iguchi a nd Sato, 2000) and aquatic (Sumpt er, 2005; Milnes et al., 2006) species. These effects include altered reproductive morphology, endocrine physiology and behavior, and involves such endpoi nts as reduced phallus size, decreased sperm count, depressed reproductive behaviors and altered ci rculating concentrations of sex steroids (e.g., Guillette et al., 1999; Orlando et al., 2002; Toft and Guillette, 2005). EDCs exert their effects by mimicking hormones, acting as hormone antagonists, altering the function or concentration of serumbinding proteins, or altering the synthesis or degradation of hormones. Aquatic organisms can receive continuous exposure to environmental co ntaminants throughout their lives, as the aquatic environment receives most of the intentionally released environmental pollutants. Thus, the effects of EDC exposure on aquatic life have re ceived considerable attention (Kime, 1999; McMaster, 2001; Sumpter, 2005; Milnes et al., 2006). Although nitrate is a ubiquitous component of aquatic environments, and has become a global pollutant in a variety of aquatic syst ems (Sampat, 2000), it has only recently begun to receive attention for its ability to alter endocrine function (G uillette and Edwards, 2005). The toxicological effects of nitr ate have long been known. As early as 1945, nitrate induced methemoglobinemia (Blue Baby Syndrome) in huma ns was associated with drinking well water contaminated with nitrate (Comly, 1945). Fi sh are also vulnerable to methemoglobinemia (Brown Blood Disease), and in Siberian sturgeon methemoglobinemia has been associated with a 46

PAGE 59

significant chloride imbalance (Gisbert et al ., 2004). Toxicity studies with fish (LC 50 ) have shown lethal concentrations of nitrate to range an order of magnitude or more (Brownell, 1980; Pierce et al., 1993; Hamlin, 2006), demonstrating significant plastici ty in response to elevated nitrate among fish species. Sublethal effects of nitrate include endocrine alterations which have been shown to alter metabolism, reproductive function and development. Frogs ( Rana cascadae) exposed to 3.5 mg/L nitrate-N metamorphosed more slowly, an d emerged from the water in a less developed state than control animals (Mar co and Blaustein, 1999). Rodents exposed to nitrate (50 mg/L NaNO 3 ) in their drinking water had significan tly lower circulating testosterone (T) concentrations than control anim als (Panesar and Chan, 2000). Bulls given oral administration of nitrate (100 250 g/day/animal) showed reduced sperm motility, depressed Leydig cell function, and degenerative lesions in the germ layers of the testes (Z raly et al., 1997). Studies in Southern toad tadpoles showed nitrate indu ced alterations in growth and thyroxine concentrations were mitigated by the source of cu lture water used, indicating that environmental context plays a significant role in mitigating th e effects of nitrate (Edwards et al., 2006a). Mosquitofish ( Gambusia holbrooki ) experienced significant reproductive alterations, such as reduced gonopodium length and fecundity (number of females per unit of female size), in nitrate concentrations as low as 5 mg/L NO 3 -N (Toft et al., 2004; Edward s et al., 2006b). Proposed mechanisms for nitrate induced steroidogenic di sturbances include mitochondrial conversion to nitric oxide (NO), altered chloride ion concentr ations and altered enzy matic action by binding to the heme region of P450 enzymes associated with steroidogenesis (Guille tte and Edwards, 2005). Stress effects on reproduction can be manife st at various levels of the reproductive endocrine axis, and stress has been shown to ha ve inhibitory effects on reproduction for most 47

PAGE 60

aquatic species studied to date (Pickering et al., 1987; Carragher and Sumpter, 1990; Pankhurst and Van Der Kraak, 1997; Consten et al., 2002). For many species of fish, including sturgeon and other chondrosteans, cortisol is the primary stre ss hormone (Idler and Sangalang, 1970; Barton et al., 1998) and cortisol has been impli cated in mediating the inhibitory reproductive effects induced by stress (P ankhurst and Van Der Kraak, 1997; Semenkova et al., 1999; Bayunova et al., 2002). There is evidence in tele osts, however, that the estrogenic inhibitory effects of stress are not mediated by cortisol and that the effects arise hi gher in the reproductive endocrine pathway (Pankhurst et al., 1995). Tilapia ( Oreochromis mossambicus) fed pellets containing cortisol to achieve pl asma cortisol concentrations t ypical of acutely stress fish, resulted in decreased plasma concentrations of T and 17 -estradiol (E 2 ), reduced oocyte diameter and gonad size in females, and reduced plasma T concentrations in males (Foo and Lam, 1993a,b). Female brown trout ( Salmo trutta ) exposed to 2 weeks of confinement stress had significantly reduced plasma T concentrations co mpared to unstressed fish (Campbell et al., 1994). Plasma glucose concentrations have also been shown to be reliable indicators of secondary stress responses. An animal under ch ronic stress can demonstrate a reduced capacity to handle subsequent stress events, and studies have shown responses of fish to multiple stressors are cumulative (Barton et al., 1986 ). Fish residing in laborato ries or fish farms are often subjected to chronic stress (sub-optimal water chemistry, cr owding, confinement) followed by acute stress events (sampling, netting), which can lead to dramatic and prolonged stress responses (Rotllant and Tort 1997; Heugens et al., 2001). Sturgeon are among the most ancient groups of Osteichthyes, and twenty-five extant species occupy the Northern Hemisphere (Birst ein, 1993). The dramatic decline in sturgeon populations due to overfishing, pollution, and habita t degradation have led to the necessity of 48

PAGE 61

commercial aquaculture as a means to provide an imals for stock enhancement, as well as food production, reducing pressures on wild populations (Beamesderfer and Farr, 1997; Waldman and Wirgin, 1997; Williot et al., 2002; Chebanov et al., 2002). The Siberian sturgeon is one of the leading species of sturgeon adapted to aquacult ure (reviewed by Gisbert and Williot, 2002). It was recently discovered that Siberi an sturgeon are more sensitive to nitrate toxicosis than most fish species reported to date (Hamlin, 2006). Fu rther, Siberian sturge on juveniles become less tolerant to nitrate as they grow a finding of considerable importance for the commercial culture of this species, since adult popul ations reared in recirculation systems often experience higher nitrate concentrations than their juvenile counterparts Although understanding what concentrations of nitrate are necessary to aver t mortality is generall y understood in commercial aquaculture, mortality is not an effective endpoi nt for producers interested in optimizing growth and reproductive function. Unde rstanding nitrates effects on re productive function is especially critical to sturgeon, whose economic viability relies heavily on proper endocrine function, notably the production of eggs (caviar). The purpose of this study is to begin to determine the potential effects of elevated environmental nitrate on endocrine function, and investigate whethe r elevated nitrate alters the stress response in captive female Siberian sturgeon. Methods Fish and Sampling Procedures Siberian sturgeon were collected from four 30,000 liter tanks, from separate commercial recirculating aquaculture systems at Mote Marine Laboratorys Aquaculture Park (Commercial Sturgeon Demonstration Project) in Sarasota, FL. Water chemistry in each of these systems was analyzed weekly for ammonia, nitrite, nitr ate, and pH prior to commencement of the experiments. Dissolved oxygen a nd temperature were monitored continuously with stationary 49

PAGE 62

probes, which were spot-checked bi-weekly fo r calibration with portable probes. Hardness, alkalinity and chloride were analyzed the da y prior to commencement of the experiment. The sturgeon were pulled by hand at the side of the tank and immediately held down on a padded V-shaped surgical table. Pulling th e fish from the tank by hand (versus netting) decreased the likelihood of stressing fish remaining in the tank and allowed for more immediate access to the fish for blood sampling. Blood was ex tracted from the caudal vein (5 ml) with a 10 ml syringe (20 gauge needle) within 1 minute of capture; most captures took 30 seconds for the full sample to be drawn. The blood was placed into lithium heparin Vacutainer tubes, and stored on ice for no more than 30 minutes before centrifugation. The plasma was separated via centrifugation (5 10 min at 2000 g), transferred to cryovials, flash frozen in liquid nitrogen and stored at -80 C for 1 3 weeks prior to analysis. Surgical Sexing For surgical sexing, the fish we re anesthetized in a 5 8 C water bath containing carbon dioxide (CO 2 ) gas; CO 2 was used because it is a low regulatory priority anesthetic for fish that are grown for food production and requires no withdr awal period; the sturgeon used in this study were part of a commercial food production pr ogram. Pure oxygen gas administered through a fine air stone was used to maintain a disso lved oxygen concentration of 9.0 13.0 mg/L, and sodium bicarbonate was added to maintain a pH of 6.8 7.6 in the bath throughout the procedure. Fish generally took 3 5 minutes for full anes thetization. A 2.5 3.5 cm incision was made on the ventral side of the fish, approximately 8 cm anterior to the vent, along the median axis to allow inspection of the gonads on either side of the fish for sex determination. The fish was sutured closed with coated vicryl absorbable su ture (Ethicon Inc., Somerville, New Jersey). 50

PAGE 63

Experiment 1 Experiment 1 was conducted in July of 2004 and consisted of two treatments, which sampled fish from each of four commercial cu lture tanks (30,000 l each) located in separate recirculating systems at Mote Marine Laboratory s Aquaculture Park. Two of the culture tanks were held at a nitrate concentr ation of 11.5 mg/L nitrate-N (50 mg /L total nitrate) for one month, and the other two tanks were held at 57 mg/L nitr ate-N (250 mg/L total nitr ate) for the same time period (two replicates each). Nitrate concentrations were achieved by adjusting the freshwater input to each system, typical of commercial culture practices. Prior to the 1-month exposure, nitrate concentrations in the four study tanks oscillated between 20 60 mg/L nitrate-N routinely. A nitrate concentration of 57 mg/L nitrate-N was chosen as the upper li mit in this study, as this is the maximum concentration deemed safe, defined by feeding behavior and mortality, at Motes Commercial Sturgeon Demonstratio n Project. The lower concen tration of 11.5 mg/L nitrate-N was chosen as this was considered extremely safe, yet realistically achievable under normal aquaculture practices. Although th ese concentrations may be typical of commercial recirculating aquaculture facilities, these levels are elevated relative to environmental levels or approved drinking water limits of 10 mg/L nitrate-N (U.S EPA, 1996). Treatment 1 sampled 15 fish from each of the four commercial recirculating culture tanks (two tanks/nitrate concentration; N = 30 per nitrate treatment). Ea ch fish was sampled at time 0 and was surgically sexed immediately after the blood sample was drawn. Only blood samples from female fish were used in the analyses for this study. Each fish was weighed and placed into a holding tank until treatment 2 fish were removed, to avoid stressing fish remaining in the tank. 51

PAGE 64

Treatment 2 sampled 18 fish from each of the four commercial recirculating culture tanks (N = 36 per nitrate treatment). Fi sh were sampled at time 0, and were then placed into square 0.64 m 3 insulated plastic totes (one tote per nitrat e concentration) filled with 530 L of system water for a 6-h period of confinement stress. A numbered tag (Duflex, St. Paul, MN) was placed on the pectoral fin of each fish for identifi cation. Fish were bled at 1 and 6 h during the confinement period (Fig. 4-1). After the 6-h samp ling period, the fish were surgically sexed as previously described. Experiment 2 Experiment 2 was conducted in May of 2005 and was procedurally identical to experiment 1 with the following exceptions. Two of the culture tanks we re held at a nitrate concentration of 1.5 mg/L nitrat e-N (6.5 mg/L total nitrate) fo r one month, and two tanks were held at 57 mg/L (250 mg/L total nitrate) for th e same time period. It should be noted that although the same tanks and population (different individuals) of an imals was used in this second experiment, the tanks that previously held the low nitrate concentrations in experiment 1, now held the elevated nitrate concentration and vice ve rsa, to reduce the possib ility of tank affect among treatment groups. The exposure in the first e xperiment should not affect the fish in either nitrate group in the second experi ment, since nitrate concentrati ons typically oscillate in the range of the upper limit (57 mg/L nitrate-N) and the lower limit (11.5 mg/L nitrate-N) routinely in recirculating aquaculture settings, includi ng our facility. Although 11.5 mg/L nitrate-N is considered low in commercial aquaculture, this concentration exceeds that which would occur in unpolluted natural environments. Th erefore 1.5 mg/L nitrate-N was chosen in this experiment as it would be more reflective of ecologically relevant exposures. Treatment 1 sampled 15 fish from each of the four commercial recirculating cu lture tanks (N = 30 per nitrate treatment) and treatment 2 sampled 25 fish from each of the f our tanks (N = 50 per nitrate treatment). 52

PAGE 65

Hormone Evaluations Plasma samples were thawed on ice, and th e steroid fraction was extracted twice with diethyl ether. Plasma cortisol (F), E 2 (experiment 1), T and 11-KT were analyzed according to instructions provided with the commercial co mpetitive enzyme immunoassay kits (Cayman Chemical, Ann Arbor, MI), specific to each horm one. Each hormone was previously validated for Siberian sturgeon by verifying that serial dilutions were para llel to the standard curve. Samples were run in duplicate and each plate contained duplicate wells for interassay variance and a blank. Individual hormones were all run with plates from the same kit lot number and were completed in the same testing session to reduce testing variance. Sample plates were analyzed with a plate reader (BioRad Hercules CA). Glucose was evaluated with an Amplex Red glucose/glucose oxidation kit (Invitrogen Carlsbad, CA). Radioimmunoassays for E 2 (validated for Siberian sturgeon) in experiment 2 were conducted as described previously by this lab (M ilnes et al., 2004). Br iefly, extracted samples were reconstituted in Borate Buffer (50 ul, 0.05 M, pH 8.0). Antibody (Endocrine Sciences, Tarazana, CA, USA) and radiolabeled steroid (2, 4,6,7,16,173 H) were added at 12,000 cpm per 100 l. Interassay variance tubes were similarly pr epared from pooled Siberian sturgeon plasma. Standards were prepared in duplicate at 0, 1.56, 3.13, 6.25, 12.5, 25, 50, 100, 200, 400 and 800 pg per tube. Assay tubes were incubated at 4 C overnight. Bound free separation was performed by adding charcoal a nd centrifuging for 30-min. The s upernatant was then drawn off and diluted with scinti llation cocktail and counted on a Beck man LS 5801 scintillation counter. 53

PAGE 66

Statistical Analyses Statistical analyses were performed using StatView for Windows (SAS Institute, Cary, NC, USA). Initial comparisons we re made to determine significan ce within treatments. F-tests were conducted to test variances among treatm ent groups for homogeneity. If variance was heterogenous, data were log 10 transformed to achieve homogene ity of variance, however, all reported mean ( 1 SE) values are from non-transformed data. Analyses of variance (ANOVA) of weights and hormone concentrations were used to compare differences among treatment groups. If significance was determined ( p 0.05), Fishers protected least-significant difference was used to determine differences among treatment means. Results Experiment 1 In treatment 1, of the 30 fish sampled and sexed in each nitrate concentration, 19 were females in the 11.5 mg/L nitrate-N group, and 18 were females in the 57 mg/L nitrate-N group. Of the 36 fish sampled and sexed in each nitrat e concentration for treatment 2, 16 were females in the low nitrate group, whereas 13 were females in the high nitrate group. The average weight for females in treatment 1 was 4.16 0.53 kg whereas females sampled in treatment 2 was 4.29 0.36 kg. There were no significa nt differences among the tanks within each nitrate group for any tested parameter. Water chemistry parameters were tested the da y of experimentation and were as follows: unionized ammonia (NH 3 ) 4.35 g/L, nitrite 0.15 mg/L; pH 7.4, alkalinity 230 mg/L, chloride 94 mg/L, total hardness 240 mg/L a nd calcium hardness 140 mg/L. Dissolved oxygen concentrations were maintained at 95% saturation throughout th e trial and temperature was 23.3 C. 54

PAGE 67

Time 0 females in treatment 1 were combined with time 0 females from treatment 2 to evaluate the effects of nitrate exposure for each experiment. Fig. 4-2 and 4-3 illustrates time 0 data for each hormone for experiment 1. Initial c oncentrations of plasma F or glucose were not different between females in the 11.5 and the 57 mg/L nitrate-N groups, averaging 5.95 1.08 ng/ml and 255.9 6.8 pg/ml respectively. Plasma T, 11-KT and E 2 concentrations were significantly elevated in the 57 mg/L nitrate-N group when compared to concentrations observed in females exposed to 11.5 mg/L nitrate-N ( p 0.05). Data for plasma F and glucose concentrations in treatment 2 are shown in Fig. 4-4. There was no significant difference in th e stress response, defined by plasma F concentrations, when the females exposed to the two nitrate concentrat ions were compared. The females in both the 11.5 mg/L and 57 mg/L nitrate-N concentration groups demonstrated a dramatic increase in plasma F concentrations at th e 1-h sampling period averaging 42.0 5.7 ng/ml, followed by a significant decrease at the 6-h sampling period. The 6-h plas ma F concentrations were still significantly elevated when compared to time 0 concentrations (11.5 1.7 ng/ml). Plasma glucose concentrations were similar for both nitrate groups at time 0 and 1-h, averaging 227.5 12.2 pg/ml at time 0, and rising sign ificantly to an average of 428 17.5 pg/ml by 1-h. The 11.5 mg/L nitrate-N concentration group females demonstrated a si gnificant increase in plasma glucose from time 1-h to 6-h (517.6 19 pg/ml at 6-h), whereas the 57 mg/L nitrate-N concentration group females exhibited no increase in plasma glucose between the 1-h and 6-h sampling period (427.9 25.1 pg/ml). During the six hour cap tive stress period, we observed no significant changes in plasma T, 11-KT or E 2 concentrations with plasma concentrations within each respective nitrate con centration averaging 10.9 0.8 ng/ml, 4.4 0.4 ng/ml and 784 16.6 pg/ml respectively. 55

PAGE 68

Experiment 2 In treatment 1, of the 30 fish sampled and sexed in each nitrate concentration, 14 were females in the 1.5 mg/L nitrate-N group, and 12 we re females in the 57 mg/L nitrate-N group. Of the 50 fish sampled and sexed in each nitrat e concentration for treatment 2, 22 were females in the 1.5 mg/L nitrate-N group, and 24 were fe males in the 57 mg/L nitrate-N group. The average weight for females in treatment 1 was 5.84 0.89 kg and the average weight for females sampled in treatment two was 6.14 1.10 kg. There were no significant differences among the tanks within each nitrate group for any tested water parameter. Water chemistry parameters were tested the da y of experimentation and were as follows: unionized ammonia (NH 3 ) 5.35 g/L, nitrite 0.20 mg/L; pH 7.6, alkalinity 240 mg/L, chloride 90 mg/L, total hardness 240 mg/L a nd calcium hardness 135 mg/L. Dissolved oxygen concentrations were maintained at 95% saturation throughout th e trial and temperature was 23.5 C. Time 0 females in treatment 1 were combined with time 0 females from treatment 2 to evaluate the effects of nitrate exposure for each experiment. Fig. 4-5 and 4-6 illustrates time 0 data for each hormone for experiment 2. Plas ma F concentrations were not significantly different among females when the 1.5 mg/L or the 57 mg/L nitrate-N groups were compared at time 0. Plasma T concentrations were signif icantly elevated in the 57 mg/L nitrate-N concentration group ( p = 0.010), with an average of 17.28 4.57 ng/ml for the 1.5 mg/L nitrateN group, and 31.17 4.57 for the 57 mg/L nitrate-N group. Plasma 11-KT concentrations were not significantly different for e ither nitrate group at time 0 ( p = 0.091) with an average of 8.5 2.1 ng/ml for the 1.5 mg/L nitrate-N group, and 13.3 2.9 ng/ml for the 57 mg/L nitrate-N group. 56

PAGE 69

Data for treatment 2 is shown in Fig. 4-7. There was no significant difference in plasma F concentrations between nitrat e groups. Initial plasma F concentrations averaged 6.9 1.1 ng/ml, rose to an average of 68.1 6.2 ng/ml at the 1-h sampling peri od and dropped to an average of 26.8 2.6 ng/ml by 6-h. Plasma F concentrations we re significantly different for each sampling period. There was no significant difference in stress response for plasma T or 11-KT for treatment 2 with plasma c oncentrations averaging 26.4 1.9 ng/ml and 11.7 1.4 ng/ml respectively, across all sampling periods. Discussion Absent from most investigations asse ssing the endocrine di srupting effects of environmental pollutants on aquatic inhabitants, ha ve been studies examining the effects of ions, such as nitrate and nitrite, which are ubiquito us components of most aquatic ecosystems. Anthropogenic activities have dramatically im pacted the amount of nitrogenous compounds entering freshwater systems, and recent reports have identified agricultural non-point source pollution, often caused by nitrate laden fertiliz ers, as the leading cause of water quality deterioration to freshwater systems (Sampat, 2000). This paper describes the effects of a chr onic 30 day exposure of Siberian sturgeon to elevated nitrate on circulating concentrations of plasma glucocorticoids (F and glucose) and sex steroids (T, 11-KT, and E 2 ). Results of the first experiment, in which animals were exposed to concentrations of 11.5 and 57 mg/L nitrate-N (50 mg/L and 250 mg/L total nitrate respectively), revealed significantly elevated concentrations of plasma T, 11-KT and E 2 in animals exposed to the higher nitrate concentration. Experiment 2, which evaluated the effects of animals exposed to 1.5 and 57 mg/L nitrate-N (6.6 and 250 mg/L tota l nitrate respectively), also demonstrated an elevated concentration of plasma T and E 2 in animals exposed to the hi gher nitrate concentration. 57

PAGE 70

Although the results of Experiment 2 did not de monstrate a significant el evation in plasma 11KT concentration ( p = 0.09) as shown in Experiment 1 ( p = 0.05), it should be noted that the second experiment was conducted at a slightly different time of the year, and in animals which were almost 1-yr older. S easonal variation and stage of reproductive development can have significant impacts on steroid profiles of mo st fish species (Stacey et al., 1984). This is the first study to demonstrate a nitr ate-induced elevation in concentrations of plasma sex steroids, using a Casp ian Sea sturgeon species habituated to a warm environment, typical of commercial culture. Since small-s cale trials do not always reflect the scale-up challenges of commercial culture environments, or mimic similar effects on physiologic response, this experiment is unique in that it was conducted at a commercial farm under typical culture conditions. This study is al so distinct in that it used naturally occurring nitrate produced by nitrification, to achieve desired nitrate concen trations, versus altering the nitrate environment by chemical addition (e.g. sodium nitrate). It has been proposed that nitrates and nitrites disrupt endocrine function by entering steroidogenic tissues, where they are metabolized to nitric oxid e (NO). NO possesses the ability to bind to the heme moiety of the cytochrome P450 enzymes, which are present at multiple locations along the steroidogenic pathway. Th e mechanism by which nitrate has led to the elevated concentrations of plasma sex steroids se en in this study is unc lear, and more work is necessary to understand the mechanisms involve d. Nitrate induced el evations in plasma concentrations of sex steroids does not necessarily imply that nitrate is not detrimental to the reproductive health of this species. Concentrations of circulating plasma sex steroids are only one endpoint in the reproductive-en docrine axis, and disruptions can occur which will not be manifest at the level of circulat ing steroids. I offer three potentia l explanations fo r the elevations 58

PAGE 71

in plasma concentrations of sex steroids seen in this study. First, nitrate triggered an upregulation of steroidogenic functi on resulting in increased gonadal synthesis of sex steroids. Second, nitrate induced alterations to transport proteins hamper trans port to the liver and concomitantly affect clearance. And lastly, el evated nitrate may impair liver function, thereby reducing its ability to clear these steroids from the blood. The female fish in this study demonstrated increased plasma concentrations of androgens, as well as E 2 Considerable attention in the literature evaluating the effects of endocrine disrupting contaminants on aquatic animals has b een directed at the estrogenic effects of compounds, because many effects reported in wi ldlife populations are a consequence of the feminization of males (Stoker et al., 2003; Sump ter 2005; Milnes et al., 2006). However, a growing literature recognizes that populations of female fish exposed to environmental contaminants exhibit masculinized features (Parrott et al., 2004). Toft et al. (2004) found that female mosquitofish ( Gambusia holbrooki ) exposed to paper mill effluent exhibited masculinized anal fins, and exhibited lower f ecundity (number of embryos per unit of female size) than reference fish. 17 -trenbolone is an anabo lic steroid used to promote growth in beef cattle and has shown strong androgenic activity, a nd is thought to be the cause of reproductive alterations in fish living downstream from anim al feedlot operations (Jegou et al., 2001; Wilson et al., 2002; Orlando et al., 2002). It is unclear what effects el evated androgens, or estrogens for that matter, have on Siberian sturgeon reproduction, and this lab is currently investigating the mechanisms involved. In aquaculture systems, nitrate has been ne glected as a material water quality hazard. Commercial aquaculture ope rations have traditionally used la rge influxes of water to maintain water chemistry, and it is not uncommon to have water exchanges of 100% or more per day. 59

PAGE 72

Consequently, nitrate has not trad itionally been a concern in comm ercial aquaculture since this flush rate is sufficient to maintain relatively low nitrate concentrations. Water is rapidly becoming recognized as a valuable and limited re source, and legislative mandate is becoming more stringent in its limits of the amount of wa ter which may be consumed or discharged. As aquaculture attempts to keep pace with glob al demand, the growing number of aquaculture operations will be forced to utilize recircula ting aquaculture technology, and significantly reduce the heavy water usage in current practice. Nitrification systems are well understood in aquaculture, and are decidedly effective at re ducing ammonia and nitrite to nitrate (Timmons, 2001). In recirculating aquacultu re systems with limited water ex change, nitrate can rise to concentrations far in excess of t hose of natural environments, and it is unclear what impact these concentrations can have on species residing in these environments Understanding the sublethal effects of exposure to nitrate is especially cr itical to sturgeon, whose ec onomic viability relies heavily on proper egg production and reproductive performance. Fish are highly sensitive to the chemical in fluences in their envi ronment, and negative influences are often reflected in an acute stress response, indicated by elevations in concentrations of glucocorticoid s (Guillette et al., 1997). St ress in fish, and the concomitant increase in plasma F concentrations, has been implicated in numerous physiological maladies, including reproductive impairment (Pankhurst and Van Der Kraak, 1997). Stress induced effects on reproduction include decreased plasma concentra tions of sex steroids, depressed vitellogenin production and decreased gamete quality (P ankhurst and Van Der Kraak, 1997). Although plasma concentrations of sex steroids were signifi cantly elevated in the groups of fish exposed to 57 mg/L nitrate-N, time 0 plasma F and glucos e concentrations were not affected by nitrate 60

PAGE 73

concentration in this study, indica ting that the alterations to concen trations of plasma sex steroids were unlikely to be mediated by glucocorticoid action. Induced stress in both experiments in this study, caused by confinement and associated blood sampling stressors, caused a dramatic increase in plasma F concentrations after 1-h, with a significant decrease by the 6-h sampling period; this response was not influenced by nitrate concentration in this study. Previous studies with gilthead sea bream ( Sparus aurata) have shown a decreased acute stress response in chroni cally stressed fish, speculating that the reduced plasma F response likely resulted from negative feedback of mild but chronically elevated F caused by the confinement stressor on the hypothala mic-pituitary-interrenal axis (Barton et al., 2005). Since the initial blood sample s (time 0) were taken generally within 30 s of capture, it is likely initial concentrations of plasma F seen in this study ( 6 ng/ml) are representative of basal plasma F concentrations of captive sturgeon in ou r facility. Previous studies with Siberian sturgeon exposed to severe hypoxic stress, demons trated peak plasma F concentrations of 35 ng/ml (Maxime et al., 1995). Peak concentrations of plasma F in our study rose to over 40 ng/ml in one experiment, and nearly 70 ng/ml in the second experiment, demonstrating the plasticity of physiological response for this spec ies. Nitrate in this study wa s shown to alter at least one component of the stress response, defined by pl asma glucose concentrations, during a 6-h period of confinement stress. In conclusion, elevated nitrate is capable of altering the steroid profiles of cultured female Siberian sturgeon, and is able to alter the secondary stress resp onse, defined by plasma glucose concentrations. We also show that responses to nitrate can change over time, and more work is necessary to uncover the mechanisms involved in steroid alterations seen in this study, as well as understand the impact these effects ma y have on reproductive performance. 61

PAGE 74

T0 T1-hr T6-hr Treatment 1 Treatment 2 Figure 4-1. Blood sampling times for treatments 1 a nd 2 of fish held under confinement stress for 6-h. 62

PAGE 75

A. 0 2 4 6 8 11.5 mg/l57 mg/lCortisol (ng/ml) B. 4.4 4.6 4.8 5.0 5.2 5.4 5.6 57 mg/L 11.5 mg/L Glucose (mmol/l) Figure 4-2. Plasma cortisol (A) and glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N (n = 35 and n = 31 respectively). Means with no superscript are not si gnificantly different ( p 0.05). 63

PAGE 76

A. B. 0 2 4 6 8 10 12 1411.5 mg/l57 mg/lTestosterone (ng/ml) 0 1 2 3 4 5 6 11.5 mg/l57 mg/l11-Ketotestosterone (ng/ml) b b a a C. 0 100 200 300 400 500 600 700 800 900 11.5 mg/l57 mg/lEstradiol (pg/ml) b a Nitrate-N concentration Figure 4-3. Plasma testosterone (A), 11-ketotestosterone (B) a nd estradiol (C) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N (n = 35 and n = 31 respectively). Superscripts design ate significantly different values ( p 0.05). 64

PAGE 77

Figure 4-4. Plasma cortisol (A) a nd glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N (n = 16 and n = 13 respectively). The fish were bled at time 0, 1-h and 6-h during a 6-h period of c onfinement stress. Means with the same superscript are not si gnificantly different ( p 0.05). 60 b Time 0 Time 1-h r Time 6-hrs A. Cortisol ( n g /ml ) b 50 40 30 c a 20 a c 10 0 11.5 57 mg/L B. Nitrate-N concentration 0 2 4 6 8 10 12 11.5 mg/L 57 c Glucose (mmol/l) b b b a a mg/L 65

PAGE 78

0 2 4 6 8 10 1.5 mg/l57 mg/lCortisol (ng/ml) A. 5.8 6.0 6.2 6.4 6.6 6.8 7.0 7.2 1.5 mg/L 57 mg/L B. Glucose (mmol/l) Nitrate-N concentration Figure 4-5. Plasma cortisol (A), glucos e (B) testosterone concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N (n = 36 for both nitrate groups). Means with no superscript are not significantly different ( p 0.05). 66

PAGE 79

a b 0 2 4 6 8 10 12 14 16 18 A. B. C. Testosterone (ng/ml) 57 mg/L 1.5 mg/L b a 0 5 10 15 20 25 30 35 40 11-Ketotestosterone (ng/ml) 57 mg/L 1.5 mg/L Nitrate-N concentration 0 100 200 300 400 500 600 1.5 mg/L 57 mg/L a b Estradiol (pg/ml) Figure 4-6. Plasma cortisol testosterone (A), 11-ketotest osterone (B) and estradiol-17 (C) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N (n = 36 for both nitrate groups). Superscripts desi gnate significantly different values ( p 0.05). 67

PAGE 80

Time 0 Time 1-h r Time 6-hrs 0 10 20 30 40 50 60 70 80 90 1.5 mg/l 57 mg/lCortisol (ng/ml) c b a c b a c a a c b a 12 10 Glucose (mmol/l) 8 6 4 2 0 1.5 mg/L 57 mg/L Figure 4-7. Plasma cortisol (A) a nd glucose (B) concentrations (mean 1 S.E.M.) in cultured female Siberian sturgeon ( Acipenser baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N (n = 22 and n = 24 re spectively). The fish were bled at time 0, 1-h and 6-h during a 6-h period of conf inement stress. Means with the same superscript are not si gnificantly different ( p 0.05). 68

PAGE 81

CHAPTER 5 EFFECTS OF NITRATE ON STEROIDOGE NIC GENE EXPRESSION IN CAPTIVE FEMALE SIBERIAN STURGEON Introduction Environmental contaminants capable of a ltering steroidogenic regul ation and function are well documented in the literature for both terrest rial and aquatic inhab itants (Guillette and Gunderson, 2001; Mills and Chiche ster, 2005; Sumpter, 2005; Ed wards et al., 2006c). These endocrine disrupting contaminants (EDCs) can exert their eff ects through numerous physiological mechanisms including mimicking naturally occurring steroids, altering hormone synthesis and degradation and interacting directly with steroid receptors (vom Saal et al., 1995; Rooney and Guillette, 2000). In the latter case, EDCs can either stimulate (Parks et al., 2001) or inhibit (Kelce et al., 1995) the expression of the target genes fo r that receptor. The endocrine system is responsible for numerous physiological processes, and as such, perturbations to this system have the potential to dele teriously affect reproductive a nd developmental performance of the affected organism. Stress has also been shown to alter endoc rine function, and is generally negatively correlated with concentrations of sex steroi ds (Pankhurst and Van De r Kraak, 1997; Orlando et al., 2002). Cortisol, a predominant glucocor ticoid, is the most commonly accepted plasma indicator of the degree to which an animal is st ressed and has been associ ated with inhibitory effects on reproduction (Pankhurst and Van Der Kraak, 1997). Commonly st udied stressors in fishes include capture and confinement or hand ling and alterations to various environmental parameters such as temperature, pH or sa linity (Pankhurst and Dedual, 1994). Certain contaminants, however, have also been shown to increase plasma glucocorticoid concentrations, further contributing to the suppres sion of circulating sex steroids (Schreck and Lorz, 1978). 69

PAGE 82

In the United States, the i nput of nitrogen from terrestrial agriculture has increased 20fold in the past 50 years (Pucket, 1995). Aqua tic nitrate concentrations of over 100 mg/L have been reported in some locations (Kross et al., 1993; Rouse et al., 1999), a ten-fold increase over the U.S. drinking water standards of 10 mg/L NO 3 -N (EPA, 1996). A growing body of literature implicates agricultural non-point source pollution as the leading cause of these elevations in freshwater systems, posing a direct health risk to both humans and wild life (Sampat, 2000). A global pollutant of aquatic habita ts, the ubiquitous presence of n itrate has only recently begun to receive attention for its ability to alter endocrine function, and now joins the list of environmental contaminants implicated in reproductive dysgenesis (see review by Guillette and Edwards, 2005). Unlike most environmental en docrine disrupting contaminants, nitrate is unique in that it exists naturally at low concentrations in the aqua tic environment as the degradative end product of nitrific ation. Therefore, the physiologica l disruptive actions of nitrate stem from its relative con centration, as well as its interactions within the environment in which it persists (Edwards et al., 2006a). The seafood trade deficit in the United States is exceeding eight billion dollars annually, a natural resource deficit second onl y to oil and natural gas in magn itude. With the oceans at or exceeding their maximum sustainable yields fo r 75% of commercially relevant species, aquaculture, or the culture of fish and other aquatic organisms, has been proposed as the only viable alternative to keep pace with global de mand (FAO, 2004). Like seafood, water is also becoming a limited and increasingly valuable resour ce, and the necessary increase in aquaculture operations will not be afforded the liberal quantitie s of water permitted to established facilities. Although recirculating aquaculture facilities, which recycle and reuse a significant portion of their water, are becoming increasingly common, the limiting factor for water exchange 70

PAGE 83

for most of these facilities is nitrate. Work is ongoing to devel op technologies to reduce nitrate in commercial aquaculture, but it is still uncl ear what concentrations of nitrate are safe, especially for sensitive physiological systems such as the endocrine system which have been shown to be vulnerable to the effects of nitrate (Suzuki et al., 2003; van Rijn et al., 2006). Sturgeon species are ideally suited to serve as models to study the endocrine disruptive effects of elevated nitrate e xposure. Many species are commer cially viable, highly endangered and have documented sensitivities to environm ental contaminants, including nitrate (Akimova and Ruban, 1995; Dwyer et al., 2005; Hamlin, 2006). The Caspian Sea, which houses some of the most endangered sturgeon species, is becoming increasingly affected by contaminants (Birstein, 1993; Stone, 2002) many of which are implicated in the disruption of reproduction in sturgeon species (Akimova and Ruban, 1995). It has been proposed that aquaculture, incor porating the development of captive broodstock programs, could be the best solution to reduce fi shing pressures, facilita ting recovery of wild populations (Williot et al., 2002). The economic viabi lity of sturgeon culture rests squarely with the successful production of eggs, or caviar, the commercial hallmark of this family of fishes. Therefore, environmental contaminants, that ha ve the potential to a lter reproductive endpoints such as egg production, are critical areas of investigation for threatened species whose promise in aquaculture relies almost enti rely on proper egg development. In many aquatic animals, including most fis h, nitrate enters the bloodstream by crossing the gill epithelia, either by di ffusion or against a concentratio n gradient by substituting for chloride, and accumulating in extracellular fl uid (Lee and Prichard, 1985; Jensen, 1995). Ingested nitrate is readily absorbed by the pr oximal small intestine in mammals (Walker, 1996), or can also be converted to ni trite, although the degree and mech anism of the latter has been a 71

PAGE 84

significant point of debate (Hartman, 1982). C oncentrations of excess nitrite can cause the potentially fatal methemoglobinemia, or brown blood disease in fishes, caused by an inability to reversibly carry oxygen in the blood (Scott and Cr unkilton, 2000). Both nitrate and nitrite are capable of generating nitric oxide (NO) (Mey er, 1995; Cadenas et al., 2000; Lepore, 2000). Nitric oxide has been shown to inhibit steroidogenesis through its interactions with steroidogenic acute regulatory protein (StAR) or the enzyme cytochrome P450 side chain cleavage (P450 SCC ) (White et al., 1987). In the mitochondria of steroidogenic cells, free cholesterol, the precursor for steroidogenesis, is transported across the mitochondrial membrane by StAR. This cholesterol is then converted to pregnenolone by the P450 SCC enzyme (Stocco, 1999). Pregnenolone is subsequently converted to progesterone by mitochondrial 3 hydroxysteroid dehydrogenase (3 HSD) (Stocco, 1999). Progesterone then exits the mitochondria and depending on the tissue, will be converted to either mineralcorticoids, glucocorticoids, progestins, androgens or estrogens in the smooth endoplasmic reticulum (Norris, 199 7). Noticeably absent from nitrate studies describing the mechanisms of altered steroid concentrations, are studies of enzymes and receptors involved in regulating the earliest stages of steroidogenesis. In fact, the majority of steroidogenic research has focused on enzymes and receptors further downstream from the conversions of cholesterol to pr egnenolone (Goto-Kazeto et al., 2004). The goal of this study is to examine nitrateinduced alterations in endocrine function and identify mechanisms through which environmental exposure to nitrate alters steroidogenesis at the molecular level. These mechanisms will be investigated by comparing the mRNA expression of a regulatory enzyme functioning at an early stage of steroidogenesis (P450 SCC ) as well as receptor proteins at the end of the steroidogenic cascade for both sex steroids and 72

PAGE 85

glucocorticoids, estrogen receptor (ER ) and glucocorticoid receptor (GR), the mRNA expression patterns of which have not been previously characterized in sturgeon. Methods Fish and Experimental Systems Siberian sturgeon were collected from four 30,000 liter tanks, from separate commercial recirculating aquaculture systems at Mote Marine Laboratorys Aquaculture Park (Commercial Sturgeon Demonstration Project) in Sarasota, FL. The fish were 4.5 years old and weighed an average of 6.14 1.10 kg. Water chemistry in each of th ese systems was analyzed weekly for ammonia, nitrite, nitrate, and pH prior to co mmencement of the experiments. Dissolved oxygen and temperature were monitored continuously with stationary probes, which were spot-checked bi-weekly for calibration w ith portable probes. Hardness, alkalinity and chloride were analyzed the day prior to commencement of the experiment. Surgical Sexing and Tissue Collection The sturgeon were pulled by hand at the side of the tank and immediately held down on a padded V-shaped surgical table. Pulling th e fish from the tank by hand (versus netting) decreased the likelihood of stressing fish remaining in the tank and allowed for more immediate access to the fish for sampling. For surgical sexing, the fish we re anesthetized in a 5 8 C water bath containing carbon dioxide (CO 2 ) gas; CO 2 was used because it is a low regulatory priority anesthetic for fish that are grown for food production and requires no withdr awal period; the sturgeon used in this study were part of a commercial food production pr ogram. Pure oxygen gas administered through a fine air stone was used to maintain a disso lved oxygen concentration of 9.0 13.0 mg/L, and sodium bicarbonate was added to maintain a pH of 6.8 7.6 in the bath throughout the procedure. 73

PAGE 86

Fish generally took 3 5 minutes for full anes thetization. A 2.5 3.5 cm incision was made on the ventral side of the fish, approximately 8 cm anterior to the vent, along the median axis to allow inspection of the gonads on either side of the fish for sex determination and tissue collection. A piece of gonad approximately 5 mm 3 was removed with a biopsy forcep (Ethicon Inc., Somerville, New Jersey), flash frozen in liquid nitrogen and stored at -80 C. The fish was sutured closed with coated vicryl absorbable suture (Ethicon Inc., Somerville, New Jersey). Treatments and Experimental Conditions Two treatments were established which samp led fish from each of four commercial culture tanks (30,000 L each) located in separate recirculating systems at Mote Marine Laboratorys Aquaculture Park in Sarasota, FL. Tw o of the culture tanks we re held at a nitrate concentration of 1.5 mg/L nitrat e-N (6.5 mg/L total nitrate) fo r one month, and two tanks were held at 57 mg/L (250 mg/L total nitrate). Nitr ate concentrations were achieved by adjusting the freshwater input to each syst em, typical of commercial aqu aculture practices. A nitrate concentration of 57 mg/L nitrate-N was chosen as the upper limit in this study, as this is the maximum concentration deemed safe, defined by feeding behavior and mortality, at Motes Commercial Sturgeon Demonstratio n Project. The lower concen tration of 1.5 mg/L nitrate-N was chosen because it reflects eco logically relevant exposures. Eight fish were sampled from each of the four commercial recirculating cultu re tanks (N = 16 per nitrate treatment). RNA Isolation and Primer Design Frozen gonadal tissues were weighed and im mediately homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA) at a ratio of 1 ml TRIzol / 100 mg tissue. Total RNA was isolated by collecting the aqueous phase of a chloroform/phe nol extraction and precip itated in isopropanol. The pellet was washed in 80% ethanol and then di ssolved in DEPC treated water. An SV Total RNA Isolation System kit (Promega, Madison, W I) was used to purify the samples and perform 74

PAGE 87

a DNase treatment The quality and concentration of the total RNA was determined with agarose gel electrophoresis and spectrophotomet er, respectively. First strand cDNA was synthesized with 2 g total RNA with Oligo (dT) 12-18 Primer (Invitrogen) and SuperScript III RNase H Reverse Transcriptase. Degenerate primers for L8 (a ribosomal prot ein used for normalization of mRNA levels), glucocorticoid rece ptor (GR), P450 SCC and ER were designed from conserved regions of the respective genes from other species. The PCR pr imers were used to amplify fragments of the sturgeon cDNA. Amplified cDNA were purifie d by Wizard SV Gel and PCR Clean-up System (Promega) and cloned by pGEM-T Vector System (P romega). Cloned plasmids were isolated by Wizard Plus SV Miniprep DNA Purification System (Promega). We used the BigDye Terminator Cycle Sequencing Kit (Applied Bios ystems, Foster City, CA) to sequence the amplifed fragments which were anal yzed with an ABI PRISM 3100. BLAST ( http://www.ncbi.nlm.nih.gov/BLAST/ ) was used to check for nucleotide and amino acid homology. Primer Express (Applied Biosystems, Fo ster City, CA) was used to design the realtime PCR primers (Table 5-1). Quantitative Real-Time PCR Quantitative real-time PCR (Q-PCR) was conduced using SYBR Green PCR Master Mix using a MyiQ Single Color Real-Time PCR Detecti on System (Bio-Rad) in a reaction volume of 15 l following the manufacturers protocol as prev iously described by this lab (Katsu et al., 2004). Conditions for Q-PCR for all genes were 3 min at 95 C and 40 cycles of 95 C for 10 seconds and 1 min. at the best annealing temp erature for each gene. The best annealing temperature for P450 SCC was 60.6 C, with L8, ER and GR running at an annealing temperature of 65 C. Starting quantities of cDNA (copies/ml) fo r each gene were calculated according to 75

PAGE 88

(Yin, 2001), based on optical density and molecular weight values. The ex pression of mRNA of the samples was calculated from a standard curve created from a serially diluted sample. Samples were run in triplicate and were normalized for ribosomal L8 expression. Sequence Data The sequence data were analyzed using CLC Free Workbench (CLC Bio A/S, Cambridge, MA), and homologous sequences of their deduc ed amino acid sequences were searched by BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). The amino acid sequences were aligned using ClustalX (Thompson et al., 1997). Genebank accession numbers for the amino acid sequences of RPL8 are Q6P0V6 (zebrafish), P41116 (X. leaves ), XP_416772 (Chicken), P62918 (Mouse) and P62917 (Human); those of GR are BAE92737 (zebrafish), P49844 ( X. laevis ), XP_420437 (chicken), NP_032199 (mouse) and P04150 (human); those of ER-beta are NP_851297 (zebrafish), NP_001035101 ( X. tropicalis ), NP_990125 (chicken), NP_034287 (mouse) and NP_001428 (human); those of P450 SCC are XP_691817 (zebrafish), NP_001001756 (chicken), Q9QZ82 (mouse) and AAH32329 (human). The Conserved Domains in amino acid sequences were searched by CD-search (http://www.ncbi.nlm.nih.gov/Stru cture/cdd/wrpsb.cgi). Statistical Analyses Statistical analyses were performed using StatView for Windows (SAS Institute, Cary, NC, USA). Initial comparisons we re made to determine significan ce within treatments. F-tests were conducted to test variances among treatm ent groups for homogeneity. If variance was heterogenous, data were log 10 transformed to achieve homogene ity of variance, however, all reported mean ( 1 SE) values are from non-transformed da ta. The relative expression of each gene was computed as a ratio with L8 and then multiplied by a consistent multiplier of 10 to ensure all values were greater than one prio r to analyses of variance (ANOVA). Figures, 76

PAGE 89

however, display original values. If significance was determined ( p 0.05). Fishers protected least-significant difference was used to determine differences among treatment means. Results Sequence Data Nucleotide and deduced amino acid sequences of RPL8 (L8), P450 SCC, ER and GR are shown in Figures 5-1 to 54. Cloned cDNAs are 309, 584, 698 and 845 base pairs encoding 102, 194, 232 and 281 amino acids, and are similar to L8, GR, ER and P450 SCC respectively (Figs. 5-1 to 5-8). These are partial cDNA sequences an d it is 40, 26, 42 and 55% of the length of the zebrafish coding region for L8, GR, ERand P450 SCC respectively. Cloned L8 included a partial conserved domain of ribosomal protein L2 C-terminal domain, and revealed higher than 97% of sequence identity among the ve rtebrates (Fig. 5-5). Cloned P450 SCC encoded a part of conserved region for cytochrome P450s, and rev ealed 77, 67, 49 and 51% of sequence identity compared with zebrafish, chicken, mouse and human, respectively (Fig. 5-6). Partially cloned GR included a complete hinge region, and a partial DNAand ligandbinding domain (Fig. 5-7). St urgeon GR showed 74, 67, 59, 67 and 65% of sequence identity with GR cloned from zebrafish, Xenopus leavis chicken, mouse and human, respectively (Fig. 57). Cloned partial cDNA for ER included a partial hinge re gion and ligand binding domain, and revealed 71, 58, 57, 59 and 57% of sequence identity with ER of zebrafish, Xenopus tropicalis chicken, mouse and human, respectively (Fig. 5-8). Water Chemistry Water chemistry parameters were tested the da y of experimentation and were as follows: unionized ammonia (NH 3 ) 5.35 g/L, nitrite 0.20 mg/L; pH 7.6, alkalinity 240 mg/L, chloride 90 mg/L, total hardness 240 mg/L a nd calcium hardness 135 mg/L. Dissolved oxygen 77

PAGE 90

concentrations were maintained at 95% saturation throughout th e trial and temperature was 23.5 C. Steroidogenic Gene Expression and Hormon e Regressions from Previous Studies Expression levels, normalized to L8 expression, of all genes evaluated were statistically similar between the fish residing in the 1.5 or 57 mg/L nitrate-N (Figs. 5-9 to 5-11). As expected, the expression of L8 was not significant for either treatment. Additionally, there was no tank effect among treatments. Mean expression levels for P450 SCC were 0.027 ( 0.007) and 0.026 ( 0.006) for the 1.5 and 57 mg/L nitrate-N treatments respectively (Fig. 5-8). Mean expression levels for GR averaged 0.359 ( 0.056) and 0.341 ( 0.035) for the 1.5 and 57 mg/L nitrate-N treatments respectively (Fig. 5-9). Mean expression level for ER was 0.440 ( 0.109) and 0.583 ( 0.160) for the 1.5 and 57 mg/L nitrate-N concentrations respectiv ely (Fig. 5-10). Simple regression analyses of mRNA expre ssion levels (normalized to L8) of P450 SCC ER and GR, as well as sex steroid and stress ho rmone plasma concentrations from Chapter 4 are summarized in Tables 5-2 and 5-3 as well as Figs. 5-12 to 5-15. Fish exposed to 1.5 mg/L NO 3 -N demonstrated significant regressions (p 0.05) for the following comparisons: GR vs. ER ; GR vs. glucose; and T vs. 11-KT. Fish exposed to 57 mg/L NO 3 -N demonstrated significant regressions for the following comparisons: ER vs. P450 SCC ; ER vs. 11-KT; P450 SCC vs. T; P450 SCC vs. 11-KT. Discussion This is the first study to successfully clone and describe the mRNA expression patterns of sturgeon P450 SCC ER and GR, key constituents in steroidogenic and stress receptor functioning. These genes represent both early (P450 SCC ) and late (ER and GR) steroidogenic endpoints, with their expressions offering in sight into several st eroidogenic pathways. 78

PAGE 91

In mammals, two ERs have been identified, in co ntrast to teleosts in which there are three known ERs, ER and two isoforms of ER (Filby and Tyler, 2005). Although both ER and ER are found in the gonads of fish and mammals, there is currently no agreement regarding the relative importance of one form ove r the other (Hall et al., 2001). ER has been shown to attenuate the ligand stimulated transcriptional activity of ER and has been shown to heterodimerize with ER in vitro, suggesting that relative expression levels of the receptors could dictate cellular se nsitivities to estrogens (Hall et al., 2001). ER is most strongly expressed in the gonad in most fishes. In a study of largemouth bass ( Micropterus salmoides ) the gonadal mRNA expression of ER was many fold greater than ER however its relative expr ession was strongly dependent upon time of the year (SaboAttwood et al., 2004). This study also showed that ER was more strongly expressed in the liver, but only for certain periods of the year. In rivulus ( Rivulus marmoratus ) the greatest expression of ER is found in the gonad and it has been shown that environmental pollutants can dramatically alter ER expre ssion in this species (Seo et al., 2006). Rivulus has both hermaphroditic and primary male forms, and it has been shown that expression levels of ER can vary dramatically depending on th e form (Orlando et. al., 2006). ER has been shown to be preferentially sensitive to synthetic an tiestrogens and phytoe strogens versus ER (Bodo and Rissman, 2006). Taken together, these da ta demonstrate the plasticity of ER mRNA expression and its capacity to be altere d by environmental variables. The fish in this study were part of a larg er body of work examining several endocrine endpoints associated with nitrate exposure. In Chapter 4, we documented a significant rise in plasma concentrations of sex steroids under condi tions of elevated nitrat e. In that study, I offered three possible explanations for the observed rise in plas ma sex steroid concentrations, 79

PAGE 92

which included increased steroidogenesis and a c oncomitant increase in gonadal synthesis of sex steroid hormones, alterations in transport proteins or reductions in liver clearance. The enzyme P450 SCC is regarded as the chronically regulated rate-limiting step in steroidogenesis (Miller, 2002) and functions at the early stag es of steroidogenesis. The P450 SCC enzyme is expressed very early in development; in mice expression be gins at embryonic day 11 (Hsu et al., 2006). During these early embryonic stages, mice with targeted disruption of the P450 SCC gene produce no steroids and have severe adre nal defects, and die shortly afte r birth; zebrafish with blocked P450 SCC function do not survive as well (Hsu et al., 2006). In general, gonadotropins regulate P450 SCC expression, however, sex steroids have been found to alter its expression in several tissues (Von Hofsten et al., 2002). In Arctic char ( Salvelinus alpinus ) 11-KT has been shown to up-regulate P450 SCC expression in the gonads (Von Hofsten et al., 2002). Although nitrate exposure did not appear to alter the mRNA expression of P450 SCC in sturgeon in this study, there was a significantly positive correlation with P450 SCC and both androgens (Chapter 4) in fish exposed to 57 mg/L NO 3 -N, that was not apparent in fish exposed to 1.5 mg/L NO 3 -N. Given this difference, I hypothesize that the sex steroids at the upper nitrate con centration, that were significantly elevated compared to the population of fish exposed to low nitrate, approa ched a threshold for feed back; that is, the binding of a critical number of receptors sufficient to trigger a response, and this elevated gene expression. It is logical to suggest, that although the fish in this study possessed vitellogenic oocytes, they were nonetheless early in their devel opment, and it is possible that the fish in the 1.5 mg/L NO 3 -N concentration would experience an elevation in sex steroid hormones concomitant with progressive egg development, and once these sex steroids reached a critical concentration, they too would demonstrate similar corr elations. It is also possible that nitrate is 80

PAGE 93

affecting an unknown mechanism, th at itself regulates both P450 SCC and sex steroid expression, and that their correlation is not necessarily directly causative. Interestingly, there was a positive correlation between ER and 11-KT in the fish exposed to 57 mg/L NO 3 -N that was not evident in fish exposed to 1.5 mg/L NO 3 -N. It has been shown in female sturgeon that both T a nd 11-KT rise significantly during vitellogenesis, and often peak just prior to final maturation (Barannikova et al., 2004). It is possi ble that under a normal reproductive cycle, that during a key period of de velopment in Siberian sturgeon, androgens of ovarian origin rise, providing a precursor for estr ogen synthesis, and thus, serving as a signal for the production of aromatase to facilitate th e conversion of androgens to estrogens. The estrogen receptor protein expression examined in this study represents an endpoint regulated far downstream, via negative feedback, in the steroidogenic pathway. That we did not observe an increase in mRNA expression for a ch ronically regulated upstream enzyme, nor for downstream estrogenic receptors, suggests that sex steroid elevations were not likely due to increased gonadal output. It is more likely th en, that the discord betw een plasma sex steroid concentrations and mRNA expression patterns could be explai ned by altered hepatic metabolism, either via alterations in transpor t proteins to the liver, or by direct action on the liver itself. Although these results do not provide a mechanis m for hepatic or transp ort protein failure, they do support the need for future studies clarifying liver perfo rmance under high nitrate conditions. Thibaut and Porte ( 2004) found significantly reduced metabolic liver clearance when carp ( C. carpio ) were exposed to estr ogenic nonylphenol and androgenic fenarimol at concentrations as low as 10 M and 50 M, respectively. Several othe r studies have shown that altered plasma sex steroid con centrations, induced by xenobiotics, could be caused by altered hydroxylase enzyme activity in the liver (see review by Guillette and Gunderson, 2001). 81

PAGE 94

NO, derived from nitrate or nitrite, has been shown to have inhibitory effects on steroidogenesis via its ac tions on StAR or P450 SCC by binding to the heme groups of these compounds (White et al., 1987). Heme groups ch aracterize all enzymes of the P450 family, and have been shown to be susceptible to chemi cal perturbation (White et al., 1987; Walsh and Stocco, 2000; Danielson, 2002). These studies pr ovide a possible mechanism for nitrate induced hepatic alterations by inhibiting en zymatic action of the various P450s in the liver responsible for clearance (Guillette and Edwards, 2005). This study is unique in several regards. It is the first st udy to evaluate the steroidogenic effects of nitrate exposure in a commercially viable and ecologically threatened species, habituated to a warm environment under comm ercial culture conditi ons. Of significant importance is the fact that this study used nitrate produced through nitrification as its source. Most studies examining nitrate exposure use a purified aquatic medium dosed with various nitrate salts (e.g. NaNO 3 KNO 3 ). Nitrate produced through nitrif ication brings with it a host of metabolites and oxidative end products not present in a purified medium, and is more relevant to ecological exposure. This is of particular impor tance because it has been shown that the nitrate medium itself can significantly alter its toxic eff ects, even if the same source of nitrate (i.e. NaNO 3 ) is used. Edwards et al. (2006a), found that Southern Toad ( Bufo terrestris) tadpoles exposed to various concentrations of nitrate responded differently de pending on the source of freshwater used, and this differe nce could not be attributed to differential electrolyte balances since both sources we re equivalent. Although we did not observe nitrate induced alterations in mRNA gene expression patterns of P450 SCC ER or GR in this experiment, it is important to note that these animals were exposed to the nitrate concentratio ns for 30 days, and it is probable that the fish were adapted to 82

PAGE 95

the nitrate concentrations in terms of gene expr ession, since most alterati ons in gene expression are observable hours or days after a disrupting ev ent. However, a goal of this study was to understand the implications of long-term exposure to elevated nitrate, and these adaptive and persistent mRNA expression patterns are relevant to aquaculture environments. It is now known that a major function of glucocorticoids (GCs ), including cortisol, is to protect against over stimulation by host defenses in a stress event (Li and Sanchez, 2005). GCs regulate numerous biological pr ocesses and play diverse role s in growth, development and maintenance of stress related homeostasis (Sapols ky et al., 2000). GCs eff ectuate their responses by their association with glucocorticoid receptors (GRs), and alte red GRs have been implicated as a causative factor in several pathologic stat es (Barden, 2004; Marchetti et al., 2005). That GR-deficient mice die within a few hours after bi rth clearly shows that proper GR function is essential for survival (Cole et al., 1995). Although nitrate did not alter the mRNA expr ession of GR in this study, there was a positive correlation between GR and both ER and glucose. There is no evidence in the literature of an overt regulatory me chanism for GR induction of either ER or glucose, or a mechanism by which glucose alters GR or ER expression, and it is possi ble this relationship is the result of an unknown or unapparent factor that is co-regulating these genes. However, it has been shown recently that glucose has the abil ity to regulate hepatic gene expression in a transcriptional manner, through the carbohydrate responsive element binding protein (ChREBP) (Dentin et al., 2006). In addition, glucose has been shown to direct ly up-regulate the mRNA expression of -defensin-1, an immune system peptide, in cultured human renal cells (Malik and Al-Kafaji, 2006). Therefore, although the relationship between glucose and GR mRNA 83

PAGE 96

expression is not yet clear, given that glucose has been shown to regulate gene expression in other systems, it is possible that glucose could regulate the expression patterns of these receptors. Cortisol bio-synthesis commences with the stimulation of interrenal tissues by adrenocorticotropic hormone, resulting in an enzymatic conversion of cholesterol which progresses through the steroidogeni c cascade through a series of en zymatic steps, including the cytochrome P450 family of proteins. It was recently shown in rainbow trout ( O. mykiss ) that xenobiotic stressors that activate aryl hydrocarbon signaling, im pair the corticosteroid response to stress by inhibiting both StAR and P450 SCC (Aluru and Vijayan, 2006). Other studies have also documented the impairment of the adaptive stress response by decreasing the capacity for interrenal cortisol produ ction (Wilson et al., 1998; Hontela, 2005). In Chapter 4 it was shown that basal cortisol production wa s not increased in animals exposed to elevated nitrate for 30 days. Expectedly, we did not observe a change in mRNA expression for GR in animals exposed to elevated nitrate, i ndicating nitrate may not alter the enzy mes involved in the adaptive stress response long term as these animals are likely adapted to the elevated nitrate at the tissue (interrenal) level, although the question of he patic alteration and clea rance still remains a concern. This study contributes a bette r mechanistic understanding of the endocrine disruptive effects of nitrate exposure. Futu re studies of the endocrinological effects of nitrate should focus on mechanisms of hepatic alteration including examining enzymes involved in clearance, expression of gonadal and hepatic StAR protein and vitellogenin pr oduction, as well as transport protein kinetics. 84

PAGE 97

Table 5-1. Forward and reverse primers used for quantitative real-time PCR Gene Forward Primer (5 3) Reverse Primer (3 5) Product Size (bp) L8 CCGGTGACCGTGGTAAACTG TCAGGGTTGTGGGAGATGACA 67 P450 SCC AGCCTCAGCGTCTCCTTTAT CCCTGTTGTGGACCATGTT 159 ER TGGTCAGCTGGGCCAAA CCAATAGGCATACCTGGTCATACA 69 GR CAAGCAACACCGCTACCAGAT CGTTAGCTGTGGCATCGATTT 66 85

PAGE 98

Table 5-2. Regression data mR NA expression patterns for P450 side chain cleavage enzyme (P450 SCC ), estrogen receptor (ER ), glucocorticoid receptor (GR), testosterone (T), 11-ketotestosterone (11KT), 17 -estradiol (E 2 ) cortisol and glucose in sturgeon exposed to 1.5 and 57 mg/L NO 3 -N. Bold numbers represent significant, positive correlations. 1.5 mg/L NO 3 -N P450 SCC ER GR ER p = 0.4821 r 2 = 0.064 GR p = 0.3927 r 2 = 0.093 p = 0.02 r 2 = 0.471 T p = 0.2849 r 2 = 0.161 p = 0.3249 r 2 = 0.121 p = 0.3923 r 2 = 0.093 11-KT p = 0.3640 r 2 = 0.119 p = 0.9435 r 2 = 0.001 p = 0.1477 r 2 = 0.243 E 2 p = 0.0704 r 2 = 0.512 p = 0.7351 r 2 = 0.021 p = 0.6785 r 2 = 0.031 Cortisol p = 0.7455 r 2 = 0.014 p = 0.8008 r 2 = 0.007 p = 0.5109 r 2 = 0.049 Glucose p = 0.2303 r 2 = 0.198 p = 0.2263 r 2 = 0.074 p = 0.035 r 2 = 0.444 57.0 mg/L NO 3 -N P450 SCC ER GR ER p = 0.0278 r 2 = 0.320 GR p = 0.3069 r 2 = 0.080 p = 0.4833 r 2 = 0.039 T p = 0.0002 r 2 = 0.673 p = 0.0827 r 2 = 0.214 p = 0.9835 r 2 = 0.000 11-KT p = 0.0019 r 2 = 0.567 p = 0.0193 r 2 = 0.378 p = 0.4818 r 2 = 0.042 E 2 p = 0.6361 r 2 = 0.026 p = 0.0678 r 2 = 0.324 p = 0.2330 r 2 = 0.060 Cortisol p = 0.9510 r 2 = 0.000 p = 0.8467 r 2 = 0.004 p = 0.7247 r 2 = 0.013 Glucose p = 0.1735 r 2 = 0.149 p = 0.6392 r 2 = 0.019 p = 0.7834 r 2 = 0.007 86

PAGE 99

Table 5-3. Regression data for testoster one (T), 11-ketotestosterone (11KT), 17 -estradiol (E 2 ) cortisol and glucose in sturge on exposed to 1.5 and 57 mg/L NO 3 -N from Chapter 4. Bold numbers represent significant, positive correlations. 1.5 mg/L NO 3 -N T 11-KT E 2 Cortisol 11-KT p = 0.0588 r 2 = 0.377 E 2 p = 0.9919 r 2 = 0.000 p = 0.8984 r 2 = 0.003 Cortisol p = 0.5528 r 2 = 0.046 p = 7108 r 2 = 0.018 p = 0.4648 r 2 = 0.092 Glucose p = 0.6245 r 2 = 0.031 p = 0.4601 r 2 = 0.070 p = 0.5398 r 2 = 0.066 p = 0.4326 r 2 = 0.079 57.0 mg/L NO 3 -N T 11-KT E 2 Cortisol 11-KT p = 0.0001 r 2 = 0.819 E 2 p = 0.9221 r 2 = 0.001 p = 0.4658 r 2 = 0.061 Cortisol p = 0.5190 r 2 = 0.043 p = 0.4652 r 2 = 0.061 p = 0.1247 r 2 = 0.347 Glucose p = 0.0563 r 2 = 0.271 p = 0.1029 r 2 = 0.223 p = 0.3525 r 2 = 0.109 p = 0.3397 r 2 = 0.091 87

PAGE 100

CTCAGCTGAATATTGGCAATGTTCTCCCAGTTGGCACCATGCCTGAAGGTACCATTATTT GCTGCCTGGAAGAGAAGCCCGGTGACCGTGGTAAACTGGCCCGTGCCTCTGGGAACTACG CCACTGTCATCTCCCACAACCCTGAAACTAAGAAATCCCGCGTGAAGCTGCCATCCGGGT CCAAGAAAGTAATCTCCTCTGCCAACAGAGCCGTAGTCGGTGTTGTTGCTGGTGGTGGTC GTATTGACAAACCAATCCTGAAGGCGGGTCGAGCCTATCACAAATACAAGGCCAAGAGAA ACTGCTGGC Q L N I G N V L P V G T M P E G T I I C C L E E K P G D R G K L A R A S G N Y A T V I S H N P E T K K S R V K L P S G S K K V I S S A N R A V V G V V A G G G R I D K P I L K A G R A Y H K Y K A K R N C W 60 120 180 240 300 309 20 40 60 80 100 102 Figure 5-1. Nucleotide and deduced amino acid sequences of Siberian sturgeon ribosomal protein L8 (RPL8). Partial cDNA of RP L8 was 309 base pairs encoding 102 amino acids. 88

PAGE 101

CACAAACAGATAGAGAGGAGTGGGAAAGGAAGCTGGACGGCAGATCTTTCACATGAGCTC TTCAGATTTGCACTTGAGTCGGTGAGCCACGTGCTGTATGGGGAGCGGCTGGGATTGCTG CAGGACCACATCGACCCTGATACCCAGAAGTTCATCGACTGCATCACCCTGATGTTCAAT ACCACGTCACCCATGCTGTACATCCCGCCTGCCCTACTGCGGAGAGTCGGGGCCAAGGTG TGGCGAGACCACGTGGAGGCCTGGGACGCCATCTTCAGTCACGCTGACCGATGCATTCAG AACATCTACAGGAAGTTACGTCAGTCTCCTGAAAGTGAGGGGAAGTACCCTGGAGTCCTG GCTAGCCTTCTCATGCTGGACAAGCTGTCCATTGAAGACATCAAGGCCAACGTGACTGAG CTAATGGCCGGAGGGGTTGACACTACTTCCATTACCCTGTTGTGGACCATGTATGAACTT GCCAGATACCCCGACCTGCAGGAACAGCTGCGGGCTGAGGTTCAGGATGCCTGGGCCTCT TCACAGGGGGACATGATCAAGATGTTAAAGTCAATTCCTTTGGTTAAAGGAGCCATAAAG GAGACGCTGAGGCTGCACCCAGTTGCTGTGAGCTTGCAAAGGTATATAACTGAGGATATT GTGATCCAAAACTACCACATTCCATCAGGGACTCTGGTGCAGCTAGGGCTCTACGCTATG GGGCGGAATCCACAGATTTTCCCAAGACCTCTGCAATATAACCCGGCCCGCTGGCTCAAA GGGGAGAGCCACTATTTCAAAAGCCTTAGCTTTGGATTCGGTCCCCGGCAGTGTCTGGGC CGCAG H K Q I E R S G K G S W T A D L S H E L F R F A L E S V S H V L Y G E R L G L L Q D H I D P D T Q K F I D C I T L M F N T T S P M L Y I P P A L L R R V G A K V W R D H V E A W D A I F S H A D R C I Q N I Y R K L R Q S P E S E G K Y P G V L A S L L M L D K L S I E D I K A N V T E L M A G G V D T T S I T L L W T M Y E L A R Y P D L Q E Q L R A E V Q D A W A S S Q G D M I K M L K S I P L V K G A I K E T L R L H P V A V S L Q R Y I T E D I V I Q N Y H I P S G T L V Q L G L Y A M G R N P Q I F P R P L Q Y N P A R W L K G E S H Y F K S L S F G F G P R Q C L G R 60 120 180 240 300 360 420 480 540 600 660 720 780 840 845 20 40 60 80 100 120 140 160 180 200 220 240 260 280 281 Figure 5-2. Nucleotide and deduced amino acid sequences of Siberian sturgeon P450 SCC. Partial cDNA of P450 SCC was 845 base pairs encoding 281 amino acids. 89

PAGE 102

GAGCGTTCTAATTATCGCATTGTACGACACAGGCGTCTTTCTCAAGGCCAAGTGCAGCCC AGTAGTAAAGCCAGCAAAACCAATGAAAGTGGCTTACTGCAGACAAGGAGGATTCACTTC ACTTCTCTGAGCCCTGAAATGCTCATGTCTTCAGTAATAGAGGCTGAACCGCCTGAGATT TATTTGATGAGCTATCTCATGAAGCCATTCACTGAGGCCACCGTGATGACATCATTAACC ACCCTTGCAGACAAGGAACTCGTTTACATGGTCAGCTGGGCCAAAAAAATTCCAGGGTTT GTGGAGCTCGGTGTGTATGACCAGGTATGCCTATTGGAGTGTTGCTGGTTAGAGGTGCTG ATGGTAGGGCTGATGTGGAGATCTATTAATCATCCAGGGAATCTCGTCTTTGCATCTGAC CTTATTTTAAACAGGGACGACGGGAACTGCGTGGAAGGATTAGTGGAGGTTTTCGACATG CTTTTGGCTATAACTTCAAAGTTTCGAGAGCTGAATCTGCAGCGAGAGGAGTATCTCTGC CTCAAGGTCATGGTCCTCCTCAACTCCACTATGTTCCCCGGTCCCTCAGAGAAGCCAGAA AAAAGTGAAAGTAGAGATAATCTGCTTAAACTTCTGGATGCAATCACCGATGCTTTAGTC TGGGTTATTTCGAAGAAAGGACTCTCTTTACAGCAGCA E R S N Y R I V R H R R L S Q G Q V Q P S S K A S K T N E S G L L Q T R R I H F T S L S P E M L M S S V I E A E P P E I Y L M S Y L M K P F T E A T V M T S L T T L A D K E L V Y M V S W A K K I P G F V E L G V Y D Q V C L L E C C W L E V L M V G L M W R S I N H P G N L V F A S D L I L N R D D G N C V E G L V E V F D M L L A I T S K F R E L N L Q R E E Y L C L K V M V L L N S T M F P G P S E K P E K S E S R D N L L K L L D A I T D A L V W V I S K K G L S L Q Q 60 120 180 240 300 360 420 480 540 600 660 698 20 40 60 80 100 120 140 160 180 200 220 232 Figure 5-3. Nucleotide and deduced amino acid sequences of Siberian sturgeon ER Partial cDNA of ER was 698 base pairs encoding 232 amino acids. 90

PAGE 103

TGAACTTAGAAGCACGGAAAACAAAGAAGCTCAACAAATTGAAGGGAATTCAGGCGCCCG TTGAGCAAGCAACACCGCTACCAGATGAGCGGTCACAGGCGCTGGTCCCCAAATCGATGC CACAGCTAACGCCAACCATGCTGTCGCTCTTGGAGGCCATCGAGCCAGAAATTATCTACT CGGGATACGACAGCACCATACCTGACACGTCCACGCGCCTTATGAGCACACTGAACAGGC TAGGGGGAAGACAAGTGGTAGCTGCAGTAAAGTGGGCAAAGTCATTACCAGGGTTTAGAA GCCTGCACCTTGATGATCAGATGACCCTGCTGCAGTGTTCCTGGCTGTTTCTCATGTCTT TTAGTCTGGGTTGGAGATCCTACAAGCAGTCTAATGGAAGCATGTTGTGCTTTGCACCAG ACCTAGTCATAAACGACGAGAGAATGAAGCTCCCTTACATGTTTGAACAGTGTGAACAAA TGCTGAAGATTTCAAACGAGTTAGTACGACTTCAGCTTTCATATGATGAATACCTCTGCA TGAAGGTTCTGTTGCTGCTCAGTTCAGTTCCTAAAGAGGGTCTG N L E A R K T K K L N K L K G I Q A P V E Q A T P L P D E R S Q A L V P K S M P Q L T P T M L S L L E A I E P E I I Y S G Y D S T I P D T S T R L M S T L N R L G G R Q V V A A V K W A K S L P G F R S L H L D D Q M T L L Q C S W L F L M S F S L G W R S Y K Q S N G S M L C F A P D L V I N D E R M K L P Y M F E Q C E Q M L K I S N E L V R L Q L S Y D E Y L C M K V L L L L S S V P K E G L 60 120 180 240 300 360 420 480 540 584 20 40 60 80 100 120 140 160 180 194 Figure 5-4. Nucleotide and deduced amino acid se quences of Siberian sturgeon GR. Partial cDNA of GR was 584 base pairs encoding 194 amino acids. 91

PAGE 104

Figure 5-5. Sequence comparison of deduced am ino acid sequences for ribosomal protein L8 (RPL8). Asterisk indicates position, which has a single, fully conserved residue. Colon and period indicates position, which ar e fully conserved s trong and weaker groups. 92

PAGE 105

Figure 5-6. Sequence comparison of deduced amino acid sequences for P450 SCC Asterisk indicates position, which has a single, fully conserved residue. Colon and period indicates position, which are fully conserved strong and weaker groups. 93

PAGE 106

Figure 5-7. Sequence comparison of deduced amino acid sequences for GR. The open and filled box indicates the ligand and DNA binding dom ain of nuclear receptor subfamily, respectively. Asterisk indi cates position, which has a single, fully conserved residue. Colon and period indicates position, which are fully conserved s trong and weaker groups. 94

PAGE 107

Figure 5-8. Sequence comparison of deduced amino acid sequences for ER The open and filled box indicates the ligand and DNA binding domain of nuclear receptor subfamily, respectively. Asterisk indicat es position, which has a single, fully conserved residue. Colon and period indi cates position, which are fully conserved strong and weaker groups. 95

PAGE 108

0 0.005 0.01 0.015 0.02 0.025 0.03 0.035 1.5 mg/L 57.0 mg/L Nitrate-NP450SCC Relative Gene Expression Figure 5-9. Mean ( SE) expression of P450 SCC mRNA in 4.5 year-old Siberian sturgeon. 96

PAGE 109

0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 1.5 mg/L 57.0 mg/L Nitrate-NGR Relative Gene Expression Figure 5-10. Mean ( SE) expression of glucocorticoid (GR) receptor mRNA in 4.5 year-old Siberian sturgeon. 97

PAGE 110

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 1.5 mg/L 57.0 mg/L Nitrate-NER Relative Gene Expression Figure 5-11. Mean ( SE) expression of estrogen receptor(ER ) mRNA in 4.5 year-old Siberian sturgeon. 98

PAGE 111

2 2.5 3 3.5 4 4.5 5 5.5 6 6.5Glucose mmol/l .15 .2 .25 .3 .35 .4 .45 .5 .55 GR/l8*100 Y = 2.15 + 6.562 X; R^2 = .444 Figure 5-12. Linear regression of glucose (mmol/L ) vs GR mRNA (normalized to L8 expression) for fish exposed to 1.5 mg/L nitrate-N. 99

PAGE 112

0 .2 .4 .6 .8 1 1.2 1.4 1.6 1.8ERb/L8*100 .15 .2 .25 .3 .35 .4 .45 .5 .55 GR/l8*100 Y = -.49 + 3.142 X; R^2 = .471 Figure 5-13. Linear regression of ER mRNA and GR mRNA (normali zed to L8 expression) for fish exposed to 1.5 mg/L nitrate-N. 100

PAGE 113

0 .01 .02 .03 .04 .05 .06 .07 .08 .09 .1SCC/L8*100 0 10000 20000 30000 40000 50000 60000 70000 T Y = .002 + 1.178E-6 X; R^2 = .673 Figure 5-14. Linear regression of P450 SCC mRNA (normalized to L8 expression) and T for fish exposed to 57 mg/L nitrate-N. The signifi cance of this regression is driven primarily by the two extraneous points. 101

PAGE 114

0 .01 .02 .03 .04 .05 .06 .07 .08 .09 .1SCC/L8*100 0 5000 10000 15000 20000 25000 30000 35000 11-KT Y = -.002 + 2.59E-6 X; R^2 = .567 Figure 5-15. Linear regression of P450 SCC mRNA (normalized to L8 expression) and 11-KT for fish exposed to 57 mg/L nitrate-N. The significance of this regression is driven primarily by the extraneous point. 102

PAGE 115

CHAPTER 6 SUMMARY AND FUTURE DIRECTIONS Summary The role of pesticides in th e reproductive impairment of w ildlife was first made public in Rachel Carsons Silent Spring in 1962 (Carson, 1962), and since then a host of man-made chemicals ranging from surfactants to polychlorinated biphenyls (PCBs) have been implicated in countless developmental and reproductive a bnormalities (Colborn et al., 1993). Noticeably absent from most of these studies are the a ffects of naturally occu rring compounds, which can become elevated well beyond naturally occurri ng background concentrations from anthropogenic impact. The EPA drinking water limit for nitrate is 10 mg/L NO 3 -N, however, many rural drinking water wells exceed this standard. For example, in Iowa 18% of drinking wells above the EPA standard were recorded (Kross et al., 1993). Natural water bodi es can exceed 100 mg/L nitrate (Rouse et al., 1999) and al though elevated nitrat e is becoming a ubiqu itous component of aquatic ecosystems, only recently has it been consid ered for its role in altering reproductive and developmental physiology (Gu illette and Edwards, 2005). Results from Chapter 2 showed sturgeon to be especially sensitive to nitrate toxicosis, and unexpectedly, this sensitivity increases as the fish grows. This could have serious implications for mature and reproductively active animals that could be far more sensitive than the ontogenetic size classes tested in that study. This is espe cially alarming since nitrate concentrations in natural water bodies in Flor ida have been documented approaching the upper nitrate concentration of 57 ppm NO 3 -N, shown in Chapter 4 to significantly alter plasma concentrations of sex steroids in maturing fe male sturgeon (Katz et al., 1999; Katz, 2004). Although sturgeon were more sensitive to nitrate t oxicosis than many species reported to date, it should be noted that the toxic eff ects of nitrate have been examin ed in only a handful of aquatic 103

PAGE 116

species. Although sturgeon may be well suited to serve as sentinel spec ies for nitrate induced reproductive impairment, it is highly likely that other species will be co ncomitantly affected by elevated nitrate exposure. In Chapter 3 we observed a significant eleva tion in plasma T concentration under periods of greatest stress, defined by plasma cortisol. Pl asma T concentrations have been shown to be uniquely sensitive to environmental alterations (M ilnes et al., 2006). Unexpectedly, the positive correlation between T and cortisol was not apparent in studies outlined in Chapter 4. The reproduction system is characterized by cyclic changes, modulated by hypothalamic releasing hormones, pituitary gonadotropes and gonadal ster oids. These cycles can be influenced by environmental cues such as temperature, photope riod and other factors (Norris, 1997; Kim et al., 1998). Experiments in Chapter 4 were conducted at a different time of the year, in animals that were one year older and more reproductively matu re. It is possible c onditions present in the second series of experiments were not conducive to the stress induced alterations observed in Chapter 3. Consistent between these studies (i.e. Chapte rs 3 and 4), however, wa s that induced stress did not result in reductions in plasma sex steroi d concentrations. Chapter 4 examined the effects of nitrate on various steroid endpoints. These data describe nitrate-induced elevations in plasma concentrations of T, 11-KT and E 2 in animals exposed to 57 mg/L NO 3 -N. Although endocrine disrupting contaminants usually reduce plasma sex steroid concentrations, as opposed to the plasma sex steroid elevations obs erved in this study, other studies of aquatic animals have shown elevations in plasma sex ster oid concentrations following chem ical exposure. A study of American alligators showed significant elevatio ns in plasma T concen trations in alligators exposed to a little as 0.01 ppb toxaphene (Milnes, 2005). It is difficult to predict what the 104

PAGE 117

observed elevations in plasma concentrations of sex steroids would impose on reproductive performance. Altered circulati ng concentrations would likely a lter feedback mechanisms on the hypothalamo-pituitary axis as well as negative feedback on the gona d and other tissues responsive to sex steroids, such as the liver and fe male reproductive tract. Persistent elevation in hormones could be countered by adaptation but the long term implications of chronic elevation in hormones is not favorable. It is unclear if ni trate induced elevations in sex steroids observed in Chapter 4 are due to a genera lized stress response, as Chapte r 3 data suggest, but given that plasma cortisol concentrations remained unaffect ed by nitrate, renders this explanation suspect. In aquaculture altered repr oductive performance, of a species such as sturgeon whose economic viability relies almost entirely on th e successful culture of eggs (caviar), could significantly diminish profit margins and reduce th eir potential value. Even in warm captive environments, sturgeon can take 46 years to reach reproductive matu rity, and even slight delays in maturation can have significant financial impacts. From an ecological perspective, the cost of altered reproductive performance, in a wild stur geon that can take 10-20 y ears or more to reach sexual maturity (Detlaff et al., 1993), is that much greater. Fertilizers applied near wate r bodies coupled with spring rainstorms, contributes to an aquatic nitrate pulse that overlaps the breeding season of many sturgeon species (Detlaff et al., 1993; Barbeau, 2004). Although speculative, gi ven the global increases in aquatic concentrations of nitrate, and th e fact that pollution has been cited as a significant cause of reductions in sturgeon populations in the Caspia n, it is reasonable to hypothesize that nitrate could contribute to observed population declines. Although it is possible that the observed elevations in circulating con centrations of sex steroids se en in these studies imparts a 105

PAGE 118

physiological advantage, accelerati ng the reproductive process, data from Chapter 5 renders this conclusion unlikely. In Chapter 5, mRNA expression patterns of various enzyme and receptor proteins involved in the steroidogenic cascade were examined. These data showed no nitrate-induced alterations in mRNA expression patterns as would be expected given the elevations in hormone end products seen in Chapter 4. This was th e first study to clone and describe the mRNA expression patterns of key upstream and downstream constituents in the steroidogenic pathway. We observed significant correlations with ster oidogenic enzymes and hormone end products, which appeared to be nitrate dependent, notable between P450 SCC and both androgens in fish exposed to 57 mg/L NO 3 -N. I hypothesize that this association may be the result of sex steroids that were sufficiently elevated following exposure to the upper nitrate co ncentration, that they reached the threshold needed to induce feed back mechanisms and alter gene expression. Taken together, these data suggest that the observed elevations in plasma sex steroid concentrations are unlikely due to an up-regulation of gonadal synthe sis. Figure 6-1 revisits the summary figure first introduced in Chapter 1 (Figure 1-1), outlining hormone production and cycling. This updated figure reflects possible mechanisms of disruption based on the data collected for this dissertation. Elevated plasma concentrations of sex steroids could result from several physiological mechanisms, including an upre gulation of gonadal synthe sis, alterations in hepatic biotransformation and clearance, or a ltered plasma storage associated with steroid binding proteins. An upregulation of gonadal synthe sis was predicted to be associated with an upregulation in mRNA expression of various st eroidogenic endpoints, su ch as the enzymes essential for this process. An increase in mRNA concentration was not observed for P450scc, suggesting that our prediction was false. Althoug h this is only one enzyme in the steroidogenic 106

PAGE 119

pathway, it plays an initial role and is cons idered a rate-limiting step. Thus, alternative mechanisms to explain the elevated plasma sex steroid concentrations, such as hepatic biotransformation and clearance or altered concentr ations of steroid binding proteins, need to be examined in the future. As the fish used in this study were part of a commercial aquaculture facility, it was not possible in these series of studies to kill the fish to examine hepatic enzyme activity. The hypothesis that nitrate can influence vert ebrate reproduction by altering nitric oxide (NO) regulation has been propos ed by several authors (Vanvoorhi s et al., 1994; DelPunta, 1996; Panesar and Chan, 2000; Guillette and Edwards, 2005) It appears NO reduces the synthesis of steroid hormones by inhibiting steroidogenic enzymes, notably the P450 family of enzymes. Given that the liver relies heavily on P450 enzymes for proper function, it seems a likely possibility that alterations in hepatic function could explain the discord between elevations in concentrations of sex steroids and the unremarkable mRNA e xpression patterns observed in sturgeon cultured in high and low nitrate environments. Future Directions Determining the cause of nitrate induced incr eases in concentrations of circulating sex steroids will be critic al to understanding the effects of nitrate on reproductive physiology. Due to the pervasive role of P450 en zymes in hepatic function, nitrate induced hepatic alteration is proposed as the most likely cause of elevated se x steroid concentrations in sturgeon cultured in elevated nitrate environments. Therefore, future studies should focus on defining the livers role in sex steroid clearance in sturgeon exposed to ni trate. Since the liver is responsible for the production of vitellogenin, a protein necessary for oocyte growth and development, its production and possible alteration should also be examined. N itrate effects should also be 107

PAGE 120

examined in male sturgeon, as well as other comme rcially relevant species to determine if the results observed in this work can be observed in other species. Perhaps most importantly, understanding the biological significance of nitrate induced elevations in concentrations of sex steroids in terms of repr oductive performance, including time to maturation, egg size, fecundity and larval viab ility is critical to determining the ecological significance of nitrates effects. Conclusions In summary, these data suggest that steroids should not serve as th e exclusive endpoint for evidence of nitrate induced endocrine disrup tions. These endpoints should also include steroidogenic enzymes and steroid receptors, a nd possibly hepatic enzymes and receptors as well. Understanding the role of nitrate in sturgeon reproduction will be dependent upon future studies uncovering the biologica l and reproductive implications of hormonal and molecular effects uncovered in these studies. In aquaculture, nitrate has b een overlooked as a material water quality hazard, largely because most aquaculture facilities use larg e quantities of water, which keeps nitrate concentrations well below that which will elicit obs ervable effects, such as mortality. The data obtained in these studies suggest that indeed ni trate is a material wate r quality hazard, and that easily observable effects such as mortality can no longer be considered valid endpoints to define safe concentrations of nitrate in aquaculture. Sublethal effects of nitr ate exposure, such as endocrine disruption, must now be considered in the effective management of sturgeon populations in both natural and captive environments. 108

PAGE 121

Elevated nitrate results in increased concentrations of sex steroid concentrations + Figure 6-1. Possible alterations in nitrate induced elevations of sex steroid concentrations in Siberian sturgeon. (+) represents a possi ble up-regulation and (--) represents a possible mechanism of disruption. Studies of mRNA expression patterns suggest sex steroid elevations are not the result of incr eased gonadal synthesi s, but that another mechanism is involved. Based on nitrat es documented role in altering P450 enzymes and function, it is hypothesized here that the liver, which relies heavily on P450 enzymes for proper function, is altered. It is also possible, that serum binding proteins, are altered by nitrates effects. 109

PAGE 122

LIST OF REFERENCES Akimova, N.V., Ruban, G.I., 1995. A classification of reproductive disturbances in sturgeons (Acipenseridae) caused by an anthropoge nic impact. J. Ichthyol. 36, 61-76. Alonso, A., Camargo, J.A., 2003. Short-term toxici ty of ammonia, nitrite and nitrate to the aquatic snail Potamopyrgus antipodarum (Hydrobiidae, Mollusca). Bull. Environ. Contam. Toxicol. 70, 1006-1012. Aluru, N., Vijayan, M.M., 2006. Aryl hydrocarbon receptor activation impa irs cortisol response to stress in rainbow trout by disrupting th e rate-limiting steps in steroidogenesis. Endocrinology 147, 1895-1903. Attayde, J.L., Hansson, L.A., 1999. Effects of nutrient recycling by zooplankton and fish on phytoplankton communities. Oecologia 121, 47-54. Barannikova, I.A., Bayunova, L.V., Dyubin, V.P., Saenko, I.I., Semenkova, T.B., 2000. Serum cortisol levels and functi on of interregnal gland duri ng life cycle of sturgeon, Acipenser gueldenstaedti. Vopr. Ikhtyologii 40, 379-388. Barannikova, I.A., Bayunova, L.V., Semenkova, T.B ., 2004. Serum levels of testosterone, 11ketotestosterone and oestradiol-17 in three species of sturgeon during gonadal development and final maturation induced by hor monal treatment. J. Fish Biol. 64, 13301338. Barbeau, T.R., 2004. Influence of insulin-like growth factor-1, ster oids, and nitrate on reproduction in amphibians. PhD dissertation, University of Florida, Gainesville FL. Barden, N., 2004. Implications of the hypot halamic-pituitary-adr enal axis in the physiopathology of depression. J. Phychiatry Neurosci. 29, 185-193. Barton, B.A., 2002. Stress in fishes; a diversity of responses with pa rticular reference to changes in circulating corticosteroids. Integr. Comp. Biol., 42, 517-525. Barton, B.A., Iwama, G.K., 1991. Physiological cha nges in fish from stress in aquaculture with emphasis on the response and effects of cortic osteroids. Ann. Rev. Fish Dis. 1, 3-26. Barton, B.A., Rahn, A.B., Feist, G., Bollig, H., Schreck, C.B., 1998. Physiological stress responses of the freshwater chondrostean paddlefish (Polydon spathula ) to acute physical disturbances. Comp. Biochem. Physiol. A 120, 355-363. Barton, B.L., Schreck, C.B., 1987. Metabolic cost of acute physical stress in juvenile steelhead. Trans. Amer. Fish. Soc. 116, 257-263. 110

PAGE 123

Barton, B.A., Schreck, C.B., Sigismondi, L.A ., 1986. Multiple acute disturbances evoke cumulative physiological stress responses in ju venile Chinook salmon. Trans. Amer. Fish. Soc. 115, 245-251. Bayne, B.L., 1985. Responses to environmental stress: tolerance, resist ance and adaptation. In Marine Biology of Polar Regions and Effects of Stress on Marine Organisms, (ed. J.S. Gray and M.E. Christiansen), pp. 331-349. Wiley, New York. Bayunova, L., Barannikova, I., Semenkova, T., 2002. Sturgeon stress reactions in aquaculture. J. Appl. Ichthyol. 18, 397-404. Beamesderfer, R.C.P., Farr, R.A., 1997. Alternat ives for the protecti on and restoration of sturgeons and their habitat. Environ. Biol. Fishes 48, 407-417. Belanger, J.M., Son, J.H., Laugero, K.D., Mobe rg, G.P., Doroshov, S.I., Lankford, S.E., Cech, J.J., Jr., 2001. Effects of shor t-term management stress and ACTH injections on plasma cortisol levels in cultured white sturgeon, Acipenser transmontanous Aquaculture 1-2, 165-176. Bernier, N.J., Bedard, N., Peter, R.E., 2004. E ffects of cortisol on f ood intake, growth, and forebrain neuropeptide Y and cort icotropin-releasing factor gene expres sion in goldfish. Gen. Comp. Endocrinol. 135, 230-240. Birstein, V.J., 1993. Sturgeons a nd paddlefishes: threatened fish es in need of conservation. Conserv. Biol. 7, 773-787. Bodo, C., Rissman, E.F., 2006. New roles for estrogen receptor in behavior and neuroendocrinology. Front. Neuroendocrinol. 27, 217-232. Bodwell, J.E., Kingsley, L.A., Hamilton, J.W., 2004. Arsenic at very low concentrations alters glucocorticoid receptor (GR) -mediated gene activation but not GR-mediated gene repression: complex dose-response effects are closely correlated with levels of activated GR and require a functional GR DNA bi nding domain, Chem. Res. Toxicol. 17, 10641076. Bohl, M., 1977. Some initial aquaculture expe riments in recirculating water systems. Aquaculture 11, 323-328. Brion, F., Tyler, C.R., Palazzi, X., Laillet, B ., Porcher, J.M., Garric, J., Flammarion, P., 2004. Impacts of 17 -estradiol, including environmentally relevant concentrations, on reproduction after exposure during embryo-larv al-juvenile and adult-life stages in zebrafish ( Danio rerio ). Aquatic Toxicol. 68, 193-217. Bromage, N.R., Shepard, C.J, Roberts, J., 1988. Farming systems and husbandry practice. In Intensive Fish Farming, (ed. C.J. Shepard and N.R. Bromage), pp. 92-95. Oxford BSP Professional. 111

PAGE 124

Brownell, C.L., 1980. Water quality requirements for first-feeding in marine fish larvae. 1. Ammonia, nitrite and nitrate. J. Exp. Mar. Biol. Ecol. 44, 269-283. Buikema, A.L.Jr., Niederlehner, B.R., Cairns, J.Jr., 1982. Biological monitoring part IV-toxicity testing. Water Res. 16, 239-262. Bulger, W.H., Kupfer, D., 1985. Estrogenic activ ity of pesticides and other xenobiotics on the uterus and male reproductive tract. In Endocrine toxicology, (ed. J.A., Thomas, K.S., Korach, and J. A., McLachlan), pp 1-33. Raven Press, New York. Bury, N.R., Sturm, A., Le Rouzic, P., Lethim onier, C., Ducouret, B., Guiguen, Y., RobinsonRechavi, M., Laudet, V., Rafestin-Oblin, M.E ., Prunet, P., 2003. Evedence for two distinct functional glucocorticoid receptors in te leost fish. J. Mol. Endocrinol. 31, 141-156. Cadenas, E., Poderoso, J.J., Antunes, F., Boveris, A., 2000. Analysis of th e pathways of nitric oxide utilization in mitochondria Free Radical Res. 33, 747-756. Camargo, J.A., Ward, J.V., 1992. Short-term toxicity of sodium nitrate (NaNO 3 ) to non-target freshwater invertebrates. Chemosphere 24, 23-28. Campbell, P.M., Pottinger, T.G., Sumpter, J.P., 1994. Preliminary evidence that chronic confinement stress reduces the quality of gametes produced by brown trout and rainbow trout. Aquaculture 120, 151-169. Capriulo, G.M., Smith, G., Troy, R., Wikfors, G.H ., Pellet, J., Yarish, C., 2002. The planktonic food web structure of a temperate zone estu ary, and its alteration due to eutorphication. Hydorbiologia 475, 263-333. Carragher, J.F., Pankhurst, N.W., 1991. Stress and reproduction in a commercially important marine fish, Pagrus auratus (Sparidae). In Proceedings of the Fourth International Symposium on Reproductive Physiology of Fish (ed. A.P. Scott, J.P. Sumpter, D.E. Kime, M.S. Rolfe) pp. 253-255. FishSymp 91, Sheffield. Carragher, J.F., Sumpter, J.P., 1990. The effect of cortisol on the secretion of sex steroids from cultured ovarian follicles of rainbow trout. Gen. Comp. E ndocrinol. 77, 403-407. Carragher, J.F., Sumpter, J.P., Pottinger, T.G., Pickering, A.D., 1989. The deleterious effects of cortisol implantation on reproductive function in two species of trout, Salmo trutta L. and Salmo gairdneri Richardson. Gen. Comp. Endocrinol. 76, 310-321. Carson, R., 1962. Silent Spring The Riverside Press, Cambridge. Cavalli, R.O., Wasielesky, W., Franco, C.S., Mi randa, K., 1996. Evaluation of the short-term toxicity of ammonia, nitrite and nitrate to Penaeus paulensis (Crustacea, Decapoda) broodstock. Arch Biol. Tech. 39, 567-575. 112

PAGE 125

Chebanov, M.S., Karnaukhov, G.I., Galich, E.V ., Chmir, Y.N., 2002. Hatchery stock enhancement and conservation of sturgeon, w ith an emphasis on the Azov Sea populations. J. Appl. Ichthyol. 18, 463-469. Chow, C.K., Hong, C.B., 2002. Dietary vitamin E and selenium and toxicity of nitrite and nitrate. Toxicology 180, 195-207. Colborn, T., Clement, C., 1992. Chemically-induced Alterations in Sexual and Functional Development: The Wild life/Human Connection Princeton Sci. Publ. Co. Inc., Princeton. Colborn, T., Vom Saal, F.S., Soto, A.M., 1993. De velopmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ. Health Perspec. 101, 378-384. Cole, T.J., Blendy J.S., Monaghan, A.P., Krieglstein, K., Schmid, W., Aguzzi, A., 1995. Targeted disruption of the glucocorticoid recep tor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9, 1608-1621. Colt, J., Tchobanoglous, G., 1976. Evaluation of the short-term toxicity of nitrogenous compounds to channel catfish, Ictalurus punctatus. Aquaculture 8, 209-224. Comly, H.H., 1945. Cyanosis in infants caused by nitrate in well water. J. Amer. Med. Assoc. 129, 112-116. Consten, D., Lambert, J.G.D., Komen, H., Goos H.J.Th., 2002. Corticosteroids affect the testicular androgen produc tion in male common carp ( Cyprinus carpio L.). Biol. Reprod. 66, 106-111. Conte, F.S., 2004. Stress and the welfare of cultured fish. Appl. Anim. Behav. Sci. 86, 205-223. Cooke, P.S., Holsberger, D.R., Witorsch, R.J., Sy lvester, P.W., Meredith, J.M., Treinen, K.A., Chapin, R.E., 2004. Thyroid hormone, glucocor ticoids, and prolactin at the nexus of physiology, reproduction, and toxicology. Toxicol. Appl. Pharmacol. 194, 309-335. Danielson, P.B., 2002. The cytochrome P450 s uperfamily: biochemistry, evolution and drug metabolism in humans. Curr. Drug and Metab. 3, 561-597. DelPunta, K., Charreau, E.H., Pignataro, O.P., 1996. Nitric oxide inhibits Leydig cell steroidogenesis. Endocrinology 137, 5337-5343. Denslow, N.D., Lee, S.H., Bowman, C.J., He mmer, M.J., Folmar, L.C., 2001. Multiple responses in gene expression in fish treated with estrogen. Comp. Biochem. Physiol. B. 129, 277-282. Dentin, R., Denechaud, P.D., Benhamed, F., Girard, J., Postic, C., 2006. Hepatic gene regulation by glucose and polyunsaturated fatty acids: a role for ChREBP. J. Nutr. 136, 1145-1149. 113

PAGE 126

Detlaff, T.A., Hinsvurg, A.S., Schmalhausen, O.I., 1993. Sturgeon Fishes. Developmental Biology and Aquaculture Springer-Verlag, Berlin. Di Marco, P., McKenzie, D.J., Mandich, A., Br onzi, P., Cataldi, E., Cataudella, S., 1999. Influence of sampling conditions on blood chemistry values of Adriatic sturgeon Acipenser naccarii ( Bonaparte, 1836). J. Appl. Ichthyol. 15, 73-77. Dowden, B.F., Bennet, H.J., 1965. Toxicity of sele cted chemicals to certain animals. J. Wat. Pollut. Control Fed. 37, 1308-1316. Dwyer, F.J., Mayer, F.L., Sappington, L.C., Buckler, D.R., Bridges, C.M., Greer, I.E., Hardesty, D.K., Henke, C.E., Ingersoll, C.G., Kunz, J.L., Whites, D.W., Augspurger, T., Mount, D.R., Hattala, K., Neuderfer, G.N., 2005. Assess ing contaminant sensitivity of endangered and threatened aquatic species: Part I. Acute toxicity of five chemicals. Arch. Environ. Contam. Toxicol. 48, 143-154. Edwards, T.M., 2006. Environmental influe nces on mosquitofish reproduction. PhD Dissertation, University of Florida, Gainesville, FL. Edwards, T.M., McCoy, K.A., Barbeau, T., McCoy, M.W., Thro, J.M., Guillette, L.J.Jr., 2006a. Environmental context determines nitrate toxicity in Southern toad ( Bufo terrestris ) tadpoles. Aquatic Toxicol. 78, 50-58. Edwards, T.M., Miller, H.D., Guillette, L.J.Jr., 2 006b. Water quality influences reproduction in female mosquitofish ( Gambusia holbrooki ) from eight Florida springs. Env. Health Perspect. 114, 69-75. Edwards, T.M., Moore, B.C., Guillette, L.J.Jr., 2006c. Reproductive dysgenesis in wildlife: a comparative view. Int. J. Androl. 29, 109-121. Environmental Protection Agency (US EPA), 1986. Quality criteria for water Washington, DC. Environmental Protection Agency (US EPA), 1996. Drinking Water Regulations and Health Advisories Washington, DC. Esch, G.W., Hazen, T.C., 1978. Thermal ecology and stress: a case history for red-sore disease in largemouth bass. DOE (U.S. Department of Energy) Symposium Series 48, 331-363. Food and Agriculture Organization of the Unite d Nations (FAO), 2004. The State of the World Fisheries and Oceans, Rome Italy. Filby, A.L., Tyler, C.R., 2005. Molecular charact erization of estrogen receptors 1, 2a, 2b, and their tissue and ontogenetic expression profiles in fathead minnow (Pimephales promales). Biol. Reprod. 73, 648-662. 114

PAGE 127

Flik, G., Klaren, P.H.M., Van den Burg, E.H., Metz, J.R., Huising, M.O., 2006. CRF and stress in fish. Gen. Comp. Endorinol. 146, 36-44. Folmar, L.C., Denslow, N.D., Kroll, K., Orla ndo, E.F., Enblom, J., Marcino, J., Metcalfe, C., Guillette, L.J. Jr., 2001. Altered serum sex ster oids and vitellogenin induction in walleye (Stizostedion vitreum) collected near a me tropolitan sewage treatment plant. Environ. Contam. Toxicol. 40, 392-398. Foo, T.W., Lam, T.J., 1993a. Retardation of ov arian growth and depression of serum steroid levels in the tilapia Oreochromis mossambicus, by cortisol implan tation. Aquaculture 115, 133-143. Foo, T.W., Lam, T.J., 1993b. Serum cortisol res ponse to handling stress and the effect of cortisol implantation on testoste rone levels in the tilapia Oreochromis mossambicus. Aquaculture 115, 145-158. Francis, K.T., 1981. The relationship between hi gh and low trait psychol ogical stress, serum testosterone, and serum cor tisol. Experientia 37, 1296-1297. Gisbert, E., Rodriquez, A., Cardona, L., Huer tas, M., Gallardo, M.A., Sarasquete, C., SalaRabanal, M., Ibarz, A., Sanchez, J., Castello-Orvay, F., 2004. R ecovery of Siberian sturgeon yearlings after an acute exposure to environmental nitrite: changes in the plasmatic ionic balance, Na+ K+ ATPase activity, and gill histology. Aquaculture 239, 141-154. Gisbert, E., Williot, P., 2002. Advances in the larv al rearing of Siberian sturgeon. J. Fish Biol. 60, 1071-1092. Goetz, FW., Norberg, B., McCauley, L.A.R., Iliev, DB., 2004. Characterization of the cod (Gadus morhua) steroidogenic acute regulator y protein (StAR) shed light on StAR gene structure in fish. Comp. Bi ochem. Physiol. 137, 351-362. Goto-Kazeto, R., Kight, K.E., Zohar, Y., Place, A.R., Trant, J.M., 2004. Localization and expression of aromatase mRNA in adu lt zebrafish. Gen. Comp. Endocrinol. 139, 72-84. Gray, G.D., Smith, E.R., Damassa, D.A., Ehrenkranz, J.R.L., Davidson, J.M., 1978. Neuroendocrine mechanisms mediating the suppr ession of circulating testosterone levels associated with chronic stress in male rats. Neuroendocrinol. 25, 247-256. Greenwood, A.K., Butler, P.C., White, R.B., De Marco, U., Pearce, D ., Fernald, R.D., 2003. Multiple corticosteroid receptors in a teleost fish: distinct sequences, expression patterns, and transcriptional activiti es. Endocrinology 144, 4226-4236. Guillette, L.J., 1999. Serum concentrations of various environmental contaminants and their relationship to sex steroid concentrations and phallus size in Juvenile American alligators. Arch. Environ. Contam. Toxicol. 36, 447-455. 115

PAGE 128

Guillette, L.J., 2000. Contaminant-induced endocrine disruption in wildlife. Growth Hormone & IGF Research, Supplement B, S45-S50. Guillette, L.J., Brock, J.W., Rooney, A.A., Wood ward, A.R., 1999. Serum concentrations of various environmental contaminants and their relationship to sex steroid concentrations and phallus size in juvenile American alligators. Arch. Environ. Contam. Toxicol. 36, 447-455. Guillette, L.J., Crain, D.A., 2000. Endocrine disrupting contam inants: An evolutionary perspective Francis and Taylor Inc., Philadelphia. Guillette, L.J., Crain, D.A., Gunderson, M.P., Kools, S.A.E., Milnes, M.R., Orlando, E.F., Rooney, A.A., Woodward, A.R., 2000. Alligators and endocrine disrupting contaminants: a current perspective. Amer. Zool. 40, 438-452. Guillette, L.J., Crain, D.A., Pickford, D.B., 1995. Organization versus activiation: the role of endocrine-disrupting contaminants (EDCs) during embryonic development in wildlife. Environ. Health Perspect. 103, 157-164. Guillette, L.J., Crain, D.A., Rooney, A.A., Wood ward, A.R., 1997. Effect of acute stress on plasma concentrations of sex and stress hormone s in juvenile alligators living in control and contaminated lakes. J. Herpetol. 31, 347-353. Guillette, L.J., Edwards, T.M., 2005. Is nitrate an ecologically relevant endocrine disruptor in vertebrates? Integr Comp. Biol. 45, 19-27. Guillette, L.J., Gunderson, M.P., 2001. Alteratio ns in development of reproductive and endocrine systems of wildlife populations exposed to endocrine-disrupting contaminants. Reproduction 122, 857-864. Hall, J.M., Couse, J.F., Korach, K.S., 2001. The multifaceted mechanis ms of estradiol and estrogen receptor signaling. J. Biol. Chem. 276, 36869-36872. Hamlin, 2006. Nitrate toxicity in Siberian sturgeon ( Acipenser baeri ). Aquaculture 253, 688693. Harris, J., Bird, D.J., 2000. Modulation of the fi sh immune system by hormones. Vet. Immunol. Immunopathol. 77, 163-176. Hartman, P.E., 1982. Nitrates and nitrites: i ngestion, pharmacodynamics, and toxicology. In Chemical Mutagens, Principles and Methods for Their Detection (ed. F.J. de Serres, A. Holleander), pp. 211-294, New York. Hellal-Levy, C., Fagart, J., Souque, A., Rafes tin-Oblin, M.E., 2000. Mechanistic aspects of mineralcorticoid receptor activ ation. Kidney Int. 57, 1250-1255. 116

PAGE 129

Heugens, E.H.W., Hendriks, A.J., Dekker, T., van Straalen, N.M., Admiral, W., 2001. A review of the effects of multiple stressors on aquatic organisms and analysis of uncertainty factors for use in risk assessment. Crit. Rev. Toxicol. 31, 247-284. Hill, M.J., 1999. Nitrate toxicity: myth or reality? Br. J. Nut. 81, 343-344. Hogasen, H.R., 1995. Changes in blood compos ition during sampling by caudal vein puncture or caudal transaction of the teleost Salvelinus alpinus Comp. Biochem. Physiol. 111, 99105. Hontela, A., 2005. Stress and the hypothalamo-p ituitary-interrenal axis : adrenal toxicologyeffects of environmental pollutants on th e structure and function of the HPI axis. In Biochemical and Molecular Biology of Fishes: Vol. 6 Environmental Toxicology (ed. T.W. Moon, T.P. Mommsen), pp. 331-363. Elsevier, Amsterdam. Hrubec, T.C., 1996. Nitrate toxicity : A potential problem of recirc ulating systems. Aquacul. Eng. Soc. Proc. 1, 41-48. Hsu, J.H., Hsu, N.C., Hu, M.C., Chung, B.C., 20 06. Steroidogenesis in zebrafish and mouse models. Mol. Cell. Endocrinol. 248, 160-163. Huertas, M., Gisbert, E., Rodriguez, A., Ca rdona, L., Williot, P., Castello-Orvay, F., 2002. Acute exposure of Siberian sturgeon ( Acipenser baeri Brandt) yearlings to nitrite: medianlethal concentration (LC 50 ) determination, haematological changes and nitrite accumulation in selected tissues. Aquat. Toxicol. 57, 257-266. Hurvitz, A., Degani, G., Goldberg, D., Yom Di n, Sl., Jackson, K., Levavi-Sivan, B., 2005. Cloning of FSH LH and glycoprotein subunits from the Russian sturgeon ( Acipenser gueldenstaedti), -subunit mRNA expression, gonad develo pment, and steroid levels in immature fish. Gen. Comp. Endocrinol. 140, 61-73. Idler, D.R., Sangalang, G.B., 1970. Steroids of a chondrostean: in-vitro steroidogenesis in yellow bodies isolated from kidneys and along the posterior cardinal veins of the American Atlantic sturgeon, Acipenser oxyrhynchus Mitchill. J. Endocrinol. 48, 627-637. Iguchi, T., Sato, T., 2000. Endocrine disrupt ion and developmental abnormalities of female reproduction. Amer. Zool. 40, 402-411. Inai, Y., Nagai, K., Ukena, K., Oishi, T., Tsut sui, K., 2003. Seasonal ch anges in neurosteroid concentrations in the amphibian brain and envi ronmental factors regulating their changes. Brain Res. 959, 214-225. Jardine, J.J., Van Der Kraak, G.J., Munkittrick, K.R., 1996. Capture and confinement stress in white sucker exposed to bleached kraft pulp m ill effluent. Ecotoxicol. Environ. Safety 33, 287-298. 117

PAGE 130

Jegou, B., Sots, A., Sundlof, S., Stephany, R., Meye r, H., Lefffers, H., 2001. Existing guidelines for the use of meat hormones and other f ood additives in Europe and USA. APMIS (Suppl.) 103, S551-S556. Jensen, F.P., 1995. Uptake and effects of nitrite and nitrate in animals. In Nitrate Metabolism and Excretion (ed. P.J. Walsh and P. Wright), pp. 289-303. CRC Press, Inc. Boca Raton, FL. Jensen, F.B., 1996. Uptake, elimination and effects of nitrite and nitrate in freshwater crayfish. Aquat. Toxicol. 34, 95-104. Jobling, S., Casey, D., Rodgers-Gray, T., Oehl mann, J., Schulte-Oehlamann, U., Pawlowski, S., Baunbeck, T., Turner, A.P., Tyler, C.R., 2003. Comparative responses of mulluscs and fish to environmental estrogens and an estr ogenic effluent. Aqua tic Toxicol. 65, 205-220. Jobling, S., Beresford, N., Nolan, M., Rodgers-Gray, T.P., Brighty, G., Sumpter, J., Tyler, C.R., 2002. Altered sexual maturation and ga mete production in wild roach ( Rutilus rutilus) living in rivers that receive treated sewage effluents. Biol. Repro. 66, 272-281. Jobling, S., Nolan, M., Tyler, C.R., Brighty, G., Sumpter, J.P., 1998. Widespread sexual disruption in wild fish. Environ. Sci. Technol. 32, 2498-2506. Jobling, S., Reynolds, T., White, R., Parker, M.G., Sumpter, J.P., 1995. A variety of environmentally persistent chemicals, includ ing some phthalate plasticizers, are weakly estrogenic. Environ. Health Perspec. 103, 582-587. Jobling, S., Sheahan, D., Osborne, J.A., Matthiess en, P., Sumpter, J.P., 1996. Inhibition of testicular growth in rainbow trout ( Oncorhynchus mykiss) exposed to estrogenic alkylphenolic chemicals. Envi ron. Toxicol. Chem. 15, 194-202. Johansson, M., Nilsson, S., Lund, B.O., 1998. Interactions between methylsulfonyl PCBs and the glucocorticoid receptor. Envi ron. Health Perspect. 106, 769-772. Katsu, Y., Bermudez, D.S., Braun, E.L., Helb ing, C., Miyagawa, S., Gunderson, M.P., Kohno, S., Bryan, T.A., Guillette, L.J.Jr., Iguchi, T., 2004. Molecular cloning of the estrogen and progesterone receptors of the American alligator. Gen. Comp. Endocrinol. 136, 122-133. Katz, B.G., 2004. Sources of nitrate contamination and age of water in large karstic springs of Florida. Environ. Geol. 46, 689-706. Katz, B.G., Hornsby, D., Bohlke, J.F., Mokra y, M.F., 1999. Sources and chronology of nitrate contamination in spring waters, Suwanee River basin, Florida. Water-Resources Investigations Report No. 99-4252. US Ge ological survey, Tallahassee, Florida. 118

PAGE 131

Kelce, W.R., Stone, C.R., Laws, S.C., Gra y, L.E., Kemppalnen, J.A., Wilson, E.M., 1995. Persistent DDT metabolite p,p-DDE is a poten t androgen receptor an tagonist. Nature 375, 581-585. Kentouri, M., Leon, L., Tort, L., Divanach, P ., 1994. Experimental methodology in aquaculture: modification of the feeding rate of the gilthead sea bream Sparus aurata at a self-feeder after weighing. Aquaculture 119, 191-200. Kim, J.W., Im, W.B, Choi, H.H., 1998. Seasonal fluctuations in pituitary gland and plasma levels of gonadotropic hormones in Rana. Gen. Comp. Endocrinol. 109, 13-23. Kime, D.E., 1997. The steroids. In Fundamental s of Comparative Vertebrate Endocrinology, (ed. I. Chester-Jones, P. Ingleton and J.G. Phillips), pp. 3-56. Plenum Press, New York Kime, D.E., 1999. A strategy for assessing the effects of xenobiotics on fish reproduction. Sci. Tot. Environ. 225, 3-11. Knepp, G.L., Arkin, G.F., 1973. Ammonia toxicity levels and nitrate tolerance of channel catfish. Prog. Fish-Cult. 35, 221-224. Knobil, E., Neill, J., 1994. The physiology of Reproduction (2 nd ed.) Raven, New York. Krulich, L., Hefco, E., Illner, P., Read, C.B., 1974. The effects of acute stress on the secretion of LH, FSH and GH in the normal male rat, with comments on their statistical evaluation. Neuroendocrinology 16, 293-311. Kross, B.C., Hallberg, G.R., Bruner, D.R., Cherryholmes, K., Johnson, J.K., 1993. The nitrate contamination of private well water in Iowa. Am. J. Public Health 83, 270-272. Lai, K.M., Scrimshaw, M.D., Lester, J.N., 2002. The effects of natural and synthetic steroid estrogens in relation to their environmenta l occurrence. Crit. Rev. Toxicol. 32, 113-132. Lankford, S.E., Adams, T.E., Cech, Jr., 2003. Time of day and water temperature modify the physiological stress response in green sturgeon, Acipenser medirostris. Comp. Biochem. Physiol., A 135, 291-302. Leatherland, J.F., 1999. Stress, cortisol and re productive dysfunction in salmonids: Fact or fallacy? Bull. Europ. Assoc. Fish Pathol. 19, 254-257. Lee, S.H., Pritchard, J.B., 1985. Bicarbonate-chlor ide exchange in gill plasma membranes of blue crab. Am. J. Physiol. 249, 544-550. Lepore, D.A., 2000. Nitric oxide synthase-indepe ndent generation of nitric oxide in muscle ischemia-reperfusion injury. N itric Oxide-Biol. Chem. 4, 541-545. 119

PAGE 132

Li, D.P., Sanchez, E.R., 2005. Glucorticoid receptor and heat shock factor 1: Novel mechanism of reciprocal regulati on. Vit. Hormones 71, 239. Lloyd, R., 1979. The use of concentration response relationship in assessing acute fish toxicity data. International Workshop on the Application of Hazard Evaluation Programs for Chemicals in the Aquatic Environment, Waterville valley, N.H.. Macek, K.J., Birge, W., Mayer, F.L., Buikema, A.L., Jr., Maki, A.W., 1978. Discussion session synopsis of the use of aquatic toxicity tests for evaluation of the effects of toxic substances. In Estimating the Hazard of Chemic al Substances to Aquatic Life (ed. J. Cairns, K.L. Dickson and A.W. Maki) pp. 27-32. Philadelphia, PA. Malik, A.N., Kafaji, G.A., 2007. Glucose regulation of -defensin-1 mRNA in human renal cells. Biochem. Biophys Res. Commun. 353, 318-323. Marchetti, B., Serra, P.A., Tirolo, C., LEpiscopo F., Caniglia, S., Gennuso, F., Testa, N., Miele, E., Desole, S., Barden, N., Morale, M.C., 2005. Glucocorticoid receptor-nitric oxide crosstalk and vulnerability to experimental parkinsonism: pivotal role for glia-neuron interations. Brain Res. Rev. 48, 302-321. Marco, A., Blaustein, A.R., 1999. The effects of nitrite on behavior and metamorphosis in Cascades frogs ( Rana cascadae). Environ. Toxicol. Chem. 18, 946-949. Marco, A., Quilchano, C., Blaustein, A.R., 1999. Sensitivity to nitrate and nitrite in pondbreeding amphibians from the Pacific Northw est, USA. Environ. Toxicol. Chem. 18, 2836-2839. Maxime, V., Nonnotte, G., Peyraud, C., Williot, P., Truchot, J.P., 1995. Circulatory and respiratory effects of an hypoxic stress in th e Siberian sturgeon. Resp. Physiol. 100, 203212. Meyer, D., 1995. Enzymatic/non-enzymatic fo rmation of nitric oxide. Nat. Med. 1, 1103 McKim, J.M., 1985. Early life st age toxicity tests. In Fundamentals of Aquatic toxicology Methods and Applications (ed. G.M. Rand and S.R. Petrocelli, S.R.), pp. 58-95. Hemisphere publishing. McLachlan, J.A., 2001. Environmental Signaling: What embryos and evolution teach us about endocrine disrupting chemi cals. Endocrine Rev. 22, 319-341. McMaster, 2001. A review of the evidence for endocrine disruption in Canadian aquatic ecosystems. Water Qual. Res. J. Canada 36, 215-231. Meade, J.W., 1985. Allowable ammonia for fi sh culture. Prog. Fish-Cult. 47, 135-145. Meade, M.E., Watts, S.A., 1995. Toxicity of ammoni a, nitrite, and nitrate to juvenile Australian crayfish, Cherax quadricarinatus J. Shellfish Res. 14, 341-346. 120

PAGE 133

Meyer, D., 1995. Enzymatic/non-enzy matic formation of nitric oxide. Nature Medicine 1, 1103. Miller, W.L., 2002. Androgen biosynthesis from c holesterol to DHEA. Mo l. Cell Endocrinol. 198, 7-14. Mills, L.J., Chichester, C., 2005. Review of evid ence: Are endocrine-disr upting chemicals in the aquatic environment impacting fish populations? Sci. Tot. Environ. 343, 1-34. Milnes, M.R., 2005. Effects of environmenta l contaminants on development, sexual differentiation, and steroidogenesis in Alligator mississippiensis PhD Dissertation, University of Florida, Gainesville, FL. Milnes, M.R., Allen, D., Bryan, T., Sedacca, C.D., Guillette, L.J. Jr., 2004. Developmental effects of embryonic expos ure to toxaphene in the American alligator ( Alligator mississippiensis). Comp. Biochem. Physiol. C 138, 81-87. Milnes, M.R., Bermudez, D.S., Bryan, T.A., Edwards, T.M., Gunderson, M.P., Larkin, I.L.V., Moore, B.C., Guillette, L.J., 2006. Contaminant-induced feminization and demasculinization of nonmammalian vertebrate males in aquatic environments. Environ. Res. 100, 3-17. Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish. 9, 211-268. Munkittrick, K.R., McMaster, M.E., Portt, C.B ., Van Der Kraak, G.J., Smith, I.R., Dixon, D.G., 1992. Changes in maturity, plasma sex ster oid levels, hepatic mi xed function oxygenase activity, and presence of external lesions in lake whitefish ( Coregonus clupeaformis) exposed to bleached kraft mill effluent. Can. J. Fish. Aquat. Sci. 49, 1560-1569. Munkittrick, K.R., Van Der Kraak, G.J., McMaster M.E., Portt, C.B., van den Heuval, M.R., Servos, M.R., 1994. Survey of receiving-wate r environmental impacts associated with discharges from pulp mills: 2. Gonad size, liver size, hepatic EROD activity and plasma sex steroid levels in white sucker. Environ. Toxicol. Chem. 13, 1089-1101. Norris, D.O., 1997. Vertebrate Endocrinology Academic Press, San Diego, CA. Odermatt, A., Gumy, C., Atanasov, A.G ., Dzyakanchuk, A.A., 2006. Disruption of glucocorticoid action by environmental chemicals: potential mechanisms and relevance. J. Ster. Biochem. Mol. Biol. 102, 222-231. Orlando, E.F., Binczik, G.A., Kroll, K.J., Guillett e, L.J., 2002. The contaminant-associated stress response and its relationship to plasma stress and sex steroid concentrations in the Florida gar, Lepisosteus platyrhincus Env. Sci. 9, 329-342. 121

PAGE 134

Orlando, E.F., Davis, W.P., Guillette, L.J.Jr., 2002. Aromatase activity in the ovary and brain of the eastern mosquitofish (Gambusia holbrooki ) exposed to paper mill effluent. Environ. Health Perspect. 110, 429-433. Orlando, E.F., Katsu, Y., Miyagawa, S., Iguchi, T., 2006. Cloning and defferential expression of estrogen receptor and aromatase genes in th e self-fertilizing hermaphrodite and male mangrove rivulus, Kryptolebias marmoratus J. Mol. Endocrinol. 37, 353-365. Overli, O., Winberg, S., Pottinger, T.G., 2005. Be havioral and neuroendoc rine correlates of selection for stress resposiveness in rainbow trouta review. Integr. Comp. Biol. 45, 463474. Panesar, N.S., 2000. Is steroid deficiency the cause of tolerance in nitrate therapy? Med. Hypotheses 55, 310-313. Panesar, N.S., Chan, K.W., 2000. Decreased ster oid hormone synthesis from inorganic nitrite and nitrate: Studies in vitro and in vivo Toxicol. Appl. Pharmacol. 169, 222-230. Pankhurst, N.W., Dedual, M., 1994. E ffects of capture and recovery on plasma levels of cortisol, lactate and gonadal steroids in a natural popu lation of rainbow trout. J. Fish Biol. 45, 1013-1025. Pankhurst, N.W., Van Der Kr aak, G., 1997. Effects of stress on reproduction and growth of fish. In Fish Stress and Health in Aquaculture (ed. G.K. Iwama, A.D. Pickering, J.P. Sumpter and C.B. Schreck), pp. 73-95. Cambridge University Press, Campbridge. Pankhurst, N.W., Van Der Kr aak, G.J., Peter, R.E., 1995. Evidence that the inhibitory effects of stress on reproduction in teleost fish are not mediated by the action of cortisol on ovarian steroidogenesis. Gen. Co mp. Endocrinol. 99, 249-257. Parish, P.R., 1985. Acute toxicity tests. In Fundamentals of Aquatic toxicology Methods and Applications (ed. G.M. Rand and S.R. Petrocel li), pp. 31-56. Hemisphere publishing. Parks, L.G., Lambright, C.S., Orlando, E.F., Guillette, L.J., Ankley, G.T., Gray, L.E., 2001. Masculinization of female mosquitofish in kraft mill effluent-contaminated fenholloway river water is associated with androgen r eceptor agonist activity. Toxicol. Sci. 62, 257267. Parrott, J.L., Wood, C.S., Boutot, P., Dunn, S ., 2004. Changes in growth, secondary sex characteristics, and reproduction of fathead mi nnows exposed for a lif e cycle to bleached sulfite mill effluent. J. T oxicol. Environ. Health 67, 1755-1764. Pickering, A.D., Pottinger, T.G., 1985. Factors infl uencing blood cortisol levels of brown trout under intensive culture conditions. In Current Trends in Compar ative Endocrinology, vol. 2, (ed. B. Lofts and W.N. Holmes), pp. 1239-1242. Hong Kong Univ. Press, Hong Kong. 122

PAGE 135

Pickering, A.D., Pottinger, T.G., Carragher, J., Sumpter, J.P., 1987. The effects of acute and chronic stress on the levels of reproductive ho rmones in the plasma of mature brown trout, Salmo trutta L.. Gen. Comp. Endocrinol. 68, 249-259. Pierce, R.H., Weeks, J.M., Prappas, J.M., 1993. Nitrat e toxicity to five species of marine fish. J. World. Aquacult. Soc. 24, 105-107. Pottinger, T.G., Carrick, T.R., Hughes, S.E., Balm, P.H.M., 1996. Testosterone, 11ketotestosterone, and estradiol-17 modify baseline and stress-induced interrinal and corticotrope activity in trout. Gen. Comp. Endocrinol. 104, 284-295. Pottinger, T.G., Yeomans, W.E., Carric k, T.R., 1999. Plasma cortisol and 17 -oestradiol levels in roach exposed to acute and chroni c stress. J. Fish Biol. 54, 525-532. Pozzi, AG., Lantos, CP., Ceballos, NR., 2002. Effect of salt acclimatization on 3 hydroxysteroid dehydrogenase/isomerase activity in the interrenal of Bufo arenarum Gen. Comp. Endocrinol. 126, 68-74. Prunet, P., Sturm, A., Milla, S., 2006. Multiple cort icosteroid receptors in fish: From old ideas to new concepts. Gen. Comp. Endocrinol. 147, 17-23. Pucket, L.J., 1995. Identifying the major sources of nutrient water pollution. Environ. Sci. Technol. 29, 408-414. Querat, B., Sellouk, A., Salmon, C., 2000. Phylogeneti c analysis of the vertebrate glycoprotein hormone family including new sequences of sturgeon ( Acipenser baeri ) beta subunits of the two gonadotropins and the thyroid-s timulating hormone. Biol. Reprod. 63, 222-228. Rooney, A.A., Guillette, L.J.Jr., 2000. Contamin ant interactions with steroid receptors: Evidence for receptor binding. In Environmental Endocrine Di sruptors: An Evolutionary Perspective (ed. L.J. Guillette and A.D. Crai n), pp. 82-125. Taylor and Francis, New York. Rosenberger, D.R., Long, E., Bogardus, R., Farbenbloom, E., Hitch, R., Hitch, S., 1978. Considerations in conducting bioassays. Dredged Material Research Program, Technical report D-78-23, Charleston, Illinois. Rottlant, J., Balm, P.H.M., Ruane, N.M., PerezSanchez, J., Wendelaar Bonga, S.E., Tort, L., 2000. Pituitary proopiomelanocortin-derive d peptides and hypot halamus-pituitaryinterrenal axis activity in gilthead sea bream (Sparus aurata) during prolonged crowding stress: differential regulation of adrenocorticotropin hormone and -melanocytestimulating hormone release by corticotropi n-releasing hormone. Gen. Comp. Endocrinol. 119, 152-163. Rottlant, J., Tort, L., 1997. Cortisol and glucos e responses after acute stress by net handling in the sparid red porgy previously subjected to crowding stress. J. Fish Biol. 51, 21-28. 123

PAGE 136

Rouse, J.D., Bishop, C.A., Struger, J., 1999. Nitrogen pollution: an assessment of its threat to amphibian survival. Environ. Health Perspect. 107, 799-803. Ruane, N.M., Carballo, E.C., Komen, J., 2002. Incr eased stocking density influences the acute physiological stress response of common carp Cyprinus carpio (L.). Aquacult. Res. 33, 777-784 Rubin, A.J., Elmaraghy, G.A., 1977. Studies on the toxicity of ammonia, nitrate and their mixtures to guppy fry. Water Res. 11, 927-935. Russo, R.C., 1985. Ammonia, nitr ite, and nitrate. In Fundamentals of Aquatic toxicology Methods and Applications (ed. G.M. Rand and S.R. Petrocelli), pp. 455-471. Hemisphere publishing. Sabo-Attwood, T., Kroll, K.J., Denslow, N.D., 2004. Differential expression of largemouth bass ( Micropterus salmoides ) estrogen receptor isotypes alpha beta, and gamma by estradiol. Mol. Cell. Endocrinol. 218, 107-118. Saez, J.M., Morera, A.M., Haour, F., Evain, D., 1977. Effects of in vivo administration of dexamethasone, corticotrophin and human c horionic gonadotropin on steroidogenesis and protein and DNA synthesis of test icular interstitial cells in prepubertal rats. Endocrinol. 101, 1256-1263. Sampat, P., 2000. Deep Trouble: The Hidden Threat of Groundwater Pollution Worldwatch Institute, Washington, DC. Sapolsky, R.M., 1985. Stress-induced suppression of testicular function in the wild baboon: role of glucocorticoids. Endocrinol. 116, 2273-2278. Sapolsky, R.M., Romero, L.M., Munck, A.U., 200 0. How do glucocorticoids influence stress responses? Integrating permissive, suppressi ve, stimulatory and preparative actions. Endocrinol. Rev. 21, 55-89. Schreck, C.B., Contreras-Sanchez, W., Fitzpa trick, M.S., 2001. Effects of stress on fish reproduction, gamete quality, and progeny. Aquaculture 197, 3-24. Selye, H., 1936. A syndrome produced by diverse nocuous agents. Nature 138, 32. Selye, H., 1956. The stress of life McGraw-Hill, New York. Semenkova, T., Barannikova, I., Kime, D.E., McA llister, B.G., Bayunova, L., Dyubin, V., 2002. Sex steroid profiles in female and male stellate sturgeon ( Acipenser stellatus Pallas) during final maturation induced by hormonal tr eatment. J. Appl. Ichthyol. 18, 375-381. 124

PAGE 137

Semenkova, T.B., Bayunova, L.V., Boev, A.A., D yubin, V.P., 1999. Effects of stress on serum cortisol levels of sturgeon in aqu aculture. J. Appl. Ichthyol. 15, 270-272. Seo, J.S., Lee, Y.M., Jung, S.O., Kim, I.C., Yoon, Y.D., Lee J.S., 2006. Nonylphenol modulates expression of androgen receptor and estrogen rece ptor genes differently in gender types of the hermaphroditic fish Rivulus marmoratus. Biochem. Biophysic. Res. Comm. 346, 213223. Schreck, C.B., 1990. Physiological, behavioral and performance indi cators of stress. Am. Fish. Soc. 8, 29-37. Schreck, C.B., Lorz, H.H., 1978. Stress response of coho salmon, ( Onchorynchus kisutch) elicited by cadmium and copper and potential use of cortisol as an indicator of stress. J. Fish. Res. Board Can. 35, 1124-1129. Schulz, R.W., Miura, T., 2002. Spermatogenesis and its endocrine regulat ion. Fish Physiol. Biochem. 26, 43-56. Schuytema, G.S., Nebeker, A.V., 1999. Compar ative toxicity of ammonium and nitrate compounds to Pacific treefrog and African cl awed frog tadpoles. Environ. Toxicol. Chem. 18, 2251-2257. Scott, G., Crunkilton, R.L., 2000. Acute and chroni c toxicity of nitrat e to fathead minnows ( Pimephales promelas), Ceriodaphnia dubia and Daphnia magna. Environ. Toxicol. Chem. 19, 2918-2922. Sharma, B., Ahlert, R.C., 1977. Nitrification and nitrogen removal. Water Res. 11, 897-925. Shimura, R., Ijiri, K., Mizuno, R., Nagoaka, S., 2002. Aquatic animal res earch in space station and its issues focus on support t echnology on nitrate toxicity. In Space Life Sciences: Biological Research and Space Radiation, Vol. 30, pp. 803-808. Pergamon-Elsevier Science, Lt. Oxford, England. Sprague, J.B, 1985. Factors that modify toxicity. In Fundamentals of Aquatic toxicology Methods and Applications (ed. G.M. Rand and S.R. Petrocelli), pp. 124-163. Hemisphere publishing, Washington. Stacey, N.E., MacKenzie, D.S., Marchant, T.A., Kyle, A.L., Peter, R.E., 1984. Endocrine changes during natural spawning in the white sucker Catostomus commersoni I. Gonadotropin, growth hormone, and thyroid hormones. Gen. Comp. Endocrinol. 56, 333348. Stocco, D.M., 1999. Steroidogenic ac ute regulatory (StAR) protei n: whats new? BioEssays 21, 768-775. 125

PAGE 138

Stocco, DM., 2001. Tracking the role of StAR in the sky of the new millennium. Mol. Endocrinol. 15, 1245-1254. Stocco, D.M, Wang X., Jo, Y., Manna, R.R., 2005. Multiple signaling pathways regularing steroidogenesis and steroidogenic acute regulatory protein e xpression: more complicated that we thought. Mol. Endocrinol. 19, 2647-269. Stoker, C., Rey, F., Rodriguez, H., Ramos, J.G. Sirosky, P., Larriera, A., Luque, E.H., Munozde-toro, M., 2003. Sex reversal effects on Caim an latirostris exposed to exvironmentally relevant doses of the xenoestrogen bis phenol A. Gen. Comp. Endocrinol. 133, 287-296. Stone, R., 2002. Caspian ecology teet ers on the brink. Science 295, 393-572. Sumpter, J.P., 1997. The endocrinology of stress. In Fish Stress and Health in Aquaculture (ed. G.K. Iwata, A.D. Pickering, J.P. Sumpter and C.B. Schreck), pp. 278 Cambridge University Press, New York. Sumpter, J.P., 2005. Endocrine Disrupters in the aquatic environment: An overview. Acta Hydrochim. Hydrobiol. 33, 9-16. Sumpter, J.P., Carragher, J.F., Pottinger, T.G., Pickering, A.D., 1987. Interaction of stress and reproduction in trout. In Reproductive Physiology of Fish (ed. D.R. Idler, L.W. Crim and J.M. Walsh), pp. 299-302. Memorial Univ. of Newfoundland, St. Johns. Sumpter, J.P., Dye, H.M., Benfey, T.J., 1986. The effects of stress on plasma ACTH, -MSH, and cortisol levels in salmonid fi shes. Gen. Comp. Endocrinol. 62, 377-385. Suzuki, Y., Maruyama, T., Numata, H., Sato, H., Asakawa, M., 2003. Performance of a closed recirculating system with foam separation, nitrification and den itrification untis for intensive culture of eel: towards zero emission. Aquacul. Eng. 29, 165-182. Takase, M., Ukena, K., Yamazaki, T., Komi nami, S., Tsutsui, K., 1999. Pregnenolone, pregnenolone sulfate, and cytochrome P450 si de-chain cleavage enzyme in the amphibian brain and their seasonal cha nges. Endocrinology 140, 1936-1944. Terova, G., Gornati, R., Rimoldi, S., Bernardi ni, G., Saroglia, M., 2005. Quantification of a glucocorticoid receptor in sea bass ( Dicentrarchus labrax L.) reared at high stocking density. Gene 357, 144-151. Thibaut, R., Porte, C., 2002. Effects of endoc rine disrupters on sex steroid synthesis and metabolism pathways in fish. J. St eroid Biochem. Mol. Biol. 92, 485-494. Thomas, P., 1990. Molecular and biochemical respons es of fish to stressors and their potential use in environmental monitoring. Amer. Fish. Soc. Symp. 8, 9-28. 126

PAGE 139

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. 1997. The ClustalX windows interface: flexible strategi es for multiple sequence alignment aided by quality analysis tools. Nuc. Acids Res. 2s4, 4876-4882. Tilak, K.S., Lakshmi, S.J., Susan, T.A., 2002. The t oxicity of ammonia, nitr ite and nitrate to the fish, Catla catla (Hamilton). J. Environ. Biol. 23, 147-149. Timmons, M.B., Ebeling, J.M., Wheaton, F.W ., Summerfelt, S.T., Vinci, B.J., 2001. Recirculating Aquaculture Systems. Cayuga Aqua Ventur es, Ithaca NY. Toft, G., Baatrup, E., Guillette, L.J., 2004. Altered social behavior and sexual characteristics in mosquitofish ( Gambusia holbrooki ) living downstream of a paper mill. Aquat. Toxicol. 70, 213-222. Toft, G., Edwards, T.M., Baatrup, E., Guillette, L. J., 2003. Disturbed sexual characteristics in male mosquitofish ( Gambusia holbrooki ) from a lake contaminated with endocrine disruptors. Environ. H ealth Perspect. 111, 695-701. Toft, G., Guillette, L.J., Jr., 2005. Decreased sperm count and sexua l behavior in mosquitofish exposed to water from a pesticide-contamin ated lake. Ecotox. Environ. Safe 50, 15-20. Tomasso, J.R., Carmichael, G.J., 1986. Acute Toxicity of ammonia, nitrit e, and nitrate to the Guadalupe bass, Micropterus treculi Bull. Environ. Contam. Toxicol. 36, 866-870. Tort, L., Sunyer, J.O., Gomez, E., Molinero, A., 1996. Crowding stress induces changes in serum haemolytic and agglutinating activity in the gilthead sea bream Sparus aurata. Vet. Immunol. Immunopathol. 51, 179-188. Trama, F.B., 1954. The acute toxicity of some common salts of sodium, potassium and calcium to the common bluegill ( Lepomis machrochirus Raninesque ). Proceedings of the Academy of Natural Sciences of Philadelphia 106, 185-205. Tsai, S.J., Chen, J.C., 2002. Acute toxicity of nitrate on Penaeus monodon juveniles at different salinity levels. Aquaculture 213, 163-170. Tyler, C.R., Jobling, S., Sumpter, J.P., 1998. Endocrine disruption in wildlife: A critical review of the evidence. Crit. Rev. Toxicol. 28, 319-361. Tyler, C.R., Routledge, E.J., 1998. Oestrogenic effect s in fish in English rivers with evidence of their causation. Pure. Appl. Chem. 70, 1795-1804. Tyler, C.R., van Aerle, R., Hutchinson, T.H., Maddix, S., Trip, H., 1999. An in vivo testing system for endocrine disruptors in fish early life stages using induc tion of vitellogenin. Environ. Toxicol. Chem. 18, 337-347. Van Der Kraak, G., Chang, J.P., Janz, D.M., 1998. In The Physiology of Fishes (ed. D.H. Evans) pp. 465-488. CRC Press, Boca Raton, FL. 127

PAGE 140

Van Rijn, J., Tal, Y., Schreier, H.J., 2006. Denitr ification in recirculati ng systems; theory and applications. Aquacul. Eng. 34, 364-376. Vanvoorhis, B.J., Dunn, M.S., Snyder, G.D., Wein er, C.P., 1994. Nitric-oxide an autocrine regulator of human granulos a-luteal cell steroidogene sis. Endocrinology 135, 1799-1806. Vasudevan, N., Ogawa, S., Pfaff, D., 2002. Estrog en and thyroid hormone receptor interactions: physiological flexibility by molecular specificity. Physiol. Rev. 82, 923-944. Vijayan, M.M., Leatherland, J.F., 1990. High stoc king density affects cortisol secretion and tissue distribution in brook char, ( Salvelinus fontinalis ). J. Endocrinol. 124, 311-318. vom Saal, F.S., Nagel, S.C., Palanza, P., Bo echler, M., Parmigiani, S., Welshons, W.V., 1995. Estrogenic pesticides: binding relative to estrad iol in MCF-7 cells and effects of exposure during fetal life on subsequent te rritorial behaviour in male mice. Toxicol. Lett. 77, 343350. von Hofsten, J., Karlsson, J., Jones, I., Olsson, P., 2002. Expression and regulation of Fushi Tarasu factor-1 and steroidogenic gene s during reproduction in Arctic Char ( Salvelinus alpinus ). Biol. Reprod. 67, 1297-1304. Waldman, J.R., Wirgin, I.I., 1997. Status and restoration options for Atlantic sturgeon in North America. Conserv. Biol. 12, 631-638. Walker, R., 1996. The metabolism of dietary nitrites and nitrates. Biochem. Soc. Trans. 24, 780-785. Walsh, L.P., Stocco, D.M., 2000. Effects of lindane on steroidogenesis and steroidogenic acute regulatory protein expre ssion. Biol. Repro. 63, 1024-1033. Waring, C.P., Poxton, M.G., Stagg, M.R., 1997. Th e physiological response of the turbot to multiple net confinement. Aquacult. Internat. 5, 1-12. Wedemeyer, G.A., McLeay, D.J., 1991. In Methods for determining the tolerance of fishes to environmental stressors (ed. A.D. Pickering), pp. 247-275. Academic Press, New York. Wendelaar Bonga, S.E., 1997. The stress re sponse in fish. Physiol. Rev. 77, 591-625. Westin, D.T., 1974. Nitrate and nitr ite toxicity to salmonoid fishes. Prog. Fish-Cult. 36, 86-89. Weitzberg, E., Lundberg, J.O.N., 1998. Non-enzymatic nitric oxide production in humans. Nitric Oxide-Biol. Chem. 2, 17. White, P.C., New, M.I., Dupont, B., 1987. Congenita l adrenal hyperplasia. N. Engl. J. Med. 316, 1519-1524. 128

PAGE 141

White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds ar e estrogenic. Endocrinology 135, 175-182. Williot, P., Arlati, G., Chebanov, M., Gulyas, T., Kasimov, R., Kirschbaum, F., Patriche, N., Pavlovskaya, L.P., Poliakova, L., Pourkazemi, M., Kim, Y., Zhuang, P., Zholdasova, I., 2002. Status and management of Eurasian sturgeon: an overview. Internat. Rev. Hydrobiol. 87, 483-506. Wilson, J.M., Vijayan, M.M., Kennedy, C.J., Iwama, G.K., Moon, T.W., 1998. Naphthoflavone abolishes interrenal sensitivity to ACTH stimulation in rainbow trout. J. Endocrinol. 157, 63-70. Wilson, V.S., Lambright, C, Ostby, J., Gray, L.E., Jr., 2002. In vitro and in vivo effects of 17 trenbolone: A feedlot effluent cont aminant. Toxicol. Sci. 70, 202-211. Yin, J.L., Shackel, N.S., Zekry, A., McGuinness P.H., Richards, C., van der Putten, K., McCaughan, G.W., Eris, J.M., Bishop, G.A., 2001. Real-time reverse transcriptasepolymerase chain reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol. Cell Biol. 79, 213-221. Young, E., Abelson, J., Lightman, S.L., 2004. Cortisol pulsatility and its role in stress regulation and health. Front. Neuroendocrinol. 25, 69-76. Young, G., Thorarensen, H., Davie, P.S., 1996. 11-Ketotestosterone suppresses interregnal activity in rainbow trout (Oncorhynchus mykiss). Gen Comp. Endocrinol. 103, 301-307. Zweier, J.L., Samouilov, A., Kuppusamy, P., 1999. Non-enzymatic nitric oxide synthesis in biological systems. Biochem. Biophy. Acta. 1411, 250-262. Zraly, Z., Bendova, J., Svecova, D., Faldikova, L ., Veznik, Z., Zajicova, A., 1997. Effects of oral intake of nitrates on reproductive f unctions of bulls. Vet. Med. Czech. 42, 345-354. 129

PAGE 142

BIOGRAPHICAL SKETCH Heather J. Hamlin was born on November 22, 1972 in Bangor, Maine. She spent much of her childhood by the ocean, pawing through clumps of seaweed in search of ocean life that was unfortunate enough to be stranded by the outgo ing tide. Heather graduated from Hampden Academy High School in 1991, and then began an associates degree in legal technology, followed by a bachelors degree in biology from the University of Maine at Orono. In 1996 she was accepted to the graduate program in Marine Bio-Resources at the University of Maine, where she completed her masters degree examin ing the culture and histology of haddocks early development. After graduating in 1998, she worked as a biologist with the National Oceanic and Atmospheric Administration for a year before being hired as a senior biologist with Mote Marine Laboratory in Sarasota, FL, where she has worked since 1999. 130


Permanent Link: http://ufdc.ufl.edu/UFE0019384/00001

Material Information

Title: Nitrate as an Endocrine Disrupting Contaminant in Captive Siberian Sturgeon, Acipenser baeri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0019384:00001

Permanent Link: http://ufdc.ufl.edu/UFE0019384/00001

Material Information

Title: Nitrate as an Endocrine Disrupting Contaminant in Captive Siberian Sturgeon, Acipenser baeri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0019384:00001


This item has the following downloads:


Full Text











NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN
STURGEON, Acipenser baeri














By

HEATHER J. HAMLIN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2007

































Copyright 2007

by

Heather J. Hamlin

































To my family









ACKNOWLEDGMENTS

First and foremost I thank Lou Guillette for his tremendous mentorship, for sharing with

me his wealth of knowledge and experience and for having more faith in me than I did at times.

I am a better person for having worked with him. I thank my advisor and other members of my

committee for their encouragement and support: Ruth Francis-Floyd was graciously supportive

and gave me the freedom to do what I love; Kevan Main gave me the opportunity and

encouragement to fulfill my dream; Daryl Parkyn read my manuscripts and gave me valuable

comments; Roy Yanong gave me valuable opinions and comments on my manuscripts and I'll

always appreciate his enthusiasm for disease. I'd also like to thank Jim Michaels for allowing

me access to my research animals and supporting my research.

This j ourney would not have been nearly as fulfilling were it not for the comradery of my

fellow lab mates: Thea Edwards, who taught me EIAs and introduced me to the lab experience.

I'll always treasure our late night conversations about everything from egg cups to egg

development; Brandon Moore, who took the time to mentor me and with whom I'll always enjoy

scientific discussions; Satomi Kohno, whose patience in teaching lab techniques deserves an

award; Iske Larkin, for teaching me the wonders of RIAs. Lori Albergotti, Ashley Boggs and

Nicole Botteri, who made me wish I could spend more time in the lab. I'd also like to thank all

the undergraduate students who assisted me with collections and lab analyses.

Finally, I' d like to thank my friends and family, without whom the j ourney wouldn't be

worth it: my Mother, Holly Paulsen, who let me have every creature known to man as a child,

and spent countless hours with me as an adult collecting data and analyzing samples in this work.

It wouldn't have been the same without her help; my Father, Greg Hamlin, who bought me my

first aquarium; my best friend Maria Piccioni, who supported me tremendously in this journey;









I'd love to be half the person she thinks I am; Dave Jenkins, who supported me more than he

knows; and Amy Leighton, who made my childhood something to treasure.












TABLE OF CONTENTS


page

ACKNOWLEDGMENT S ................. ................. iv.............


TABLE OF CONTENTS............... ................vi


LI ST OF T ABLE S ................. ................. viii............


LI ST OF FIGURE S .............. .................... ix


AB STRAC T ................ .............. xi


1 INTRODUCTION ................. ...............1.......... ......


Background ............... ... .. .......... .. .......... ....... .........
Overview of Reproductive Endocrinology in Fishes ................. .......... ................1
Stress in Fish and Its Effects on Reproduction............... ..............
Endocrine Disruption in Aquatic Vertebrates .............. ...............6.....
Nitrate in Natural Water Systems............... ............ ........
Nitrate in Aquaculture and Its Implications as an EDC .............. .....................
Sturgeon as a Model Species ................. ...............12........... ...
Research Obj ectives and Hypotheses ...._ ......_____ .......___ ...........1


2 NITRATE TOXICITY IN SIBERIAN STURGEON .............. ...............18....


Introduction............... ..............1
M ethods ............... .. .. ............ .. ...........2

Study Animals and Pre-Testing Conditions .............. ...............20....
Range-Finding Studies .............. ...............20....
Test Procedures .............. ...............21....
Statistical Analyses............... ...............22
Re sults.........____....... ___ ...............22.....
Discussion............... ...............2


3 STRESS AND ITS RELATION TO ENDOCRINE FUNCTION IN CAPTIVE
FEMALE SIBERIAN STURGEON............... ...............30


Introduction............... ..............3
M ethods .............. .. ...............33...

Fish and Sampling .............. ...............33....
Surgical Sexing............... ...............34.
Treatm ents .............. ...............3 4....
Hormone Evaluations .............. ...............3 5....

Statistical Analyses............... ...............36
Re sults................ .. ....... .. ...............36.......

Morphology and Chemistry............... ...............3












Horm ones .............. ...............37....
Discussion............... ...............3


4 NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT INT CAPTIVE
S BERIAN S TURGEON. ............. ...... ...............46...


Introduction............... ..............4
M ethods .............. .. ... .... .... ..........4

Fish and Sampling Procedures .............. ...............49....

Surgical Sexing............... ...............50.
Experim ent 1 .............. ...............51....
Experim ent 2 .............. ...............52....
Hormone Evaluations .............. ...............53....

Statistical Analyses ............. ...... ._ ...............54...
Re sults............. .. ... ._ ...............54...

Experim ent 1 .............. ...............54....
Experim ent 2 .............. ...............56....
Discussion............... ...............5


5 EFFECTS OF NITRATE ON STEROIDOGENIC GENE EXPRESSION INT CAPTIVE
FEMALE SIBERIAN STURGEON............... ...............69


Introduction............... ..............6
M ethods .............. .... .... ........ .........7

Fish and Experimental Systems............... ...............73
Surgical Sexing and Tissue Collection............... ...............7
Treatments and Experimental Conditions .............. ...............74....
RNA Isolation and Primer Design ................. ...............74........... ...
Quantitative Real-Time PCR............... ...............75..
Sequence Data .............. ...............76....
Statistical Analyses............... ...............76
Re sults ................ ........... ...............77.......

W ater Chemistry ................. ............. ........... .. .. .........7
Steroidogenic Gene Expression and Hormone Regressions from Previous Studies.......78

Sequence Data .............. ...............77....
Discussion............... ...............7


6 SUMMARY AND FUTURE DIRECTIONS ...._ ......_____ .......___ ............0


Sum m ary ............. ...... ._ ...............103....
Future Directions .............. ...............107....
Conclusions............... ..............10


LIST OF REFERENCES ............. ......___ ...............110...


BIOGRAPHICAL SKETCH ............. ......___ ...............130...











LIST OF TABLES
Table page

1-1 LCso results and test conditions for three size classes of Siberian sturgeon exposed to
sodium nitrate............... ...............27

1-2 Representative acute toxicity data for nitrate .............. ...............28....

5-1 Forward and reverse primers used for quantitative real-time PCR ................. ................85

5-2 Regression data mRNA expression patterns for P450 side chain cleavage enzyme
(P450sec), estrogen receptor P (ERP), glucocorticoid receptor (GR), testosterone (T),
11-ketotestosterone (11KT), 17P-estradiol (E2) COrtisol and glucose in sturgeon
exposed to 1.5 and 57 mg/L NO3-N ................. ...............86........... .

5-3 Regression data for testosterone (T), 11-ketotestosterone (11KT), 17P-estradiol (E2)
cortisol and glucose in sturgeon exposed to 1.5 and 57 mg/L NO3-N from Chapter 4 .....87










LIST OF FIGURES
Figure page

1-1 Overview of the hypothalamic-pituitary-gonadal axis in sturgeon ................. ................15

1-2 A representative steroidogenic pathway of steroid hormones in gonadal cells..................16

1-3 A representative steroidogenic pathway of cortisol production in an interrenal cell .........17

2-1 Linear regression of loglo transformed nitrate-N (mg/L) lethal concentration values
versus log transformed fish weight (g). ............. ...............29.....

3-1 Blood sampling times for treatments 1-4 of fish held under confinement stress for 4-h ...43

3-2 Plasma cortisol (A) and plasma glucose (B) concentrations (mean f S.E.M.) during a
4-h capture and confinement period .............. ...............44....

3-3 Sex steroid data for treatment 2. Plasma 17P-Estradiol (A), testosterone (B), and 11-
ketotestosterone (C) taken from serial bleeds of cultured female Siberian sturgeon
throughout the 4-h period of confinement stress .............. ...............45....

4-1 Blood sampling times for treatments 1 and 2 of fish held under confinement stress for
6-h. ............. ...............62.....

4-2 Plasma cortisol (A) and glucose (B) concentrations (mean f 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
11.5 or 57 mg/L nitrate-N ................. ...............63........... ..

4-3 Plasma testosterone (A), 11-ketotestosterone (B) and estradiol (C) concentrations
(mean f 1 S.E.M.) in cultured female Siberian sturgeon (Acipenser baeri) exposed
for 30 days to concentrations of 11.5 or 57 mg/L nitrate-N ............... ...................6

4-4 Plasma cortisol (A) and glucose (B) concentrations (mean f 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
11.5 or 57 mg/L nitrate-N ................. ...............65........... ..

4-5 Plasma cortisol (A), glucose (B) testosterone concentrations (mean f 1 S.E.M.) in
cultured female Siberian sturgeon (Acipenser baeri) exposed for 30 days to
concentrations of 1.5 or 57 mg/L nitrate-N .............. ...............66....

4-6 Plasma cortisol testosterone (A), 11-ketotestosterone (B) and estradiol-17P (C)
concentrations (mean f 1 S.E.M.) in cultured female Siberian sturgeon (Acipenser
baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N .......................67










4-7 Plasma cortisol (A) and glucose (B) concentrations (mean f 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
1.5 or 57 mg/L nitrate-N ................. ...............68........... ..

5-1 Nucleotide and deduced amino acid sequences of Siberian sturgeon ribosomal protein
L8 (RPL8) .............. ...............88....

5-2 Nucleotide and deduced amino acid sequences of Siberian sturgeon P450scec.................. 89

5-3 Nucleotide and deduced amino acid sequences of Siberian sturgeon ERP ......................90

5-4 Nucleotide and deduced amino acid sequences of Siberian sturgeon GR..........................91

5-5 Sequence comparison of deduced amino acid sequences for ribosomal protein L8
(RPL 8) ................ ...............92................

5-6 Sequence comparison of deduced amino acid sequences for P450scec............... .... ...........93

5-8 Sequence comparison of deduced amino acid sequences for ERP ........._._. ............_.....95

5-9 Mean (f SE) expression of P450sce mRNA in 4.5 year-old Siberian sturgeon. ................96

5-10 Mean (f SE) expression of glucocorticoid (GR) receptor mRNA in 4.5 year-old
Siberian sturgeon. ............. ...............97.....

5-11 Mean (f SE) expression of estrogen receptor-P (ERP) mRNA in 4.5 year-old
Siberian sturgeon. ............. ...............98.....

5-12 Linear regression of glucose (mmol/L) vs GR mRNA (normalized to L8 expression)
for fish exposed to 1.5 mg/L nitrate-N ................. ...............99........... .

5-13 Linear regression of ERP mRNA and GR mRNA (normalized to L8 expression) for
fish exposed to 1.5 mg/L nitrate-N. ............. ...............100....

5-14 Linear regression of P450sce mRNA (normalized to L8 expression) and T for fish
exposed to 57 mg/L nitrate-N ................. ...............101.......... ...

5-15 Linear regression of P450sce mRNA (normalized to L8 expression) and 1 1-KT for
fish exposed to 57 mg/L nitrate-N ................ ...............102..............

6-1 Possible alterations in nitrate induced elevations of sex steroid concentrations in
Siberian sturgeon .............. ...............109....










Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN
STURGEON, Acipenser baeri

By

Heather J. Hamlin

May 2007

Chair: Ruth Francis-Floyd
Major: Fisheries and Aquatic Sciences

Numerous environmental contaminants have been shown to alter reproductive endocrine

function. Such compounds have been termed endocrine-disrupting contaminants (EDCs). EDCs

exert their effects through numerous physiological mechanisms, including alterations in

steroidogenesis. Although a global pollutant of most aquatic systems, nitrate has only recently

begun to receive attention for its ability to alter endocrine function in wildlife. We examined

nitrate-induced endocrine disruption using the Siberian sturgeon (Acipenser baeri) as a model

species. Comparisons of captive populations of sturgeon cultured in nitrate concentrations of

1.5, 11.5 and 57.5 mg/L nitrate-N revealed nitrate induced elevations in plasma concentrations of

sex steroids including testosterone, 11l-ketotestosterone and 17P-estradiol. Alterations in

circulating concentrations of sex steroids can be a response to several physiological mechanisms,

including an up-regulation of gonadal steroid synthesis, altered biotransformation and clearance

by the liver or alterations in plasma storage by steroid binding proteins.

To gain a better mechanistic understanding of the observed sex steroid elevations we

examined mRNA expression patterns of steroidogenic enzymes (P450sec) and receptor proteins

(ERP and GR). We found no significant differences in mRNA expression patterns, indicating










that the observed sex steroid increases were not likely due to an up-regulation of gonadal

synthesis.

Cortisol and glucose, commonly examined as indicators of perceived stress, were not

found to vary among groups exposed to any of the nitrate concentrations. Because responses to

stress can be cumulative, endocrine responses to stress events in fish residing in the various

nitrate concentrations were also investigated. Results showed that nitrate does alter the

associated stress response, defined by plasma glucose concentrations.

These data suggest that long-term exposure to nitrate is associated with altered endocrine

parameters (e.g., plasma hormone concentrations) in Siberian sturgeon. Future work must begin

to examine the underlying causes of these changes. Although the data of gene expression

suggest that mRNA concentrations of at least one steroidogenic enzyme were not altered, other

enzymes in the pathway need to be examined. These data indicated that nitrate concentrations

must now be considered in the effective management of sturgeon populations in both natural and

captive environments.









CHAPTER 1
INTRODUCTION

Background

Overview of Reproductive Endocrinology in Fishes

The production of circulating hormones is the result of numerous physiological

reactions spanning many levels of biological organization. The regulation of hormone

production is controlled by mechanisms that both create and destroy these chemical

messengers, and is Eine-tuned by various stimulatory and feedback mechanisms (Norris,

1997). Tropic hormones regulate many of the activities of the thyroid gland, adrenal gland

and the gonads (Norris, 1997). The endocrine regulation of reproduction is initiated in

resp on se to envi ronmental cue s, whi ch sti mulate the rel eas e of gonad otropi n-rel easi ng

hormone (GnRH) from the hypothalamus (Detlaff et al., 1993; Norris, 1997) (Figure 1-1).

In response to GnRH, the anterior pituitary releases gonadotropins, which circulate

throughout the body, targeting various organs, such as the gonads.

Two chemically distinct gonadotropins have been characterized in fish, GTH-I and

GTH-II, which are purportedly analogous to follicle stimulating hormone (FSH) and

luteinizing hormone (LH), respectively, in terrestrial animals (Norris, 1997). Because few

Hish species have defined chemical hormone structures to date, much of the research

literature employs heterologous hormones (Van Der Kraak et al., 1998). FSH stimulates

oogenesis and spermatogenesis, and LH stimulates Einal gamete maturation and release.

Like FSH and LH, GTH-I and GTH-II consist of an a and P subunit; the a subunit is the

same for both gonadotropins, with only the P subunit conferring biological specificity

(Norris, 1997; Vasudevan et al., 2002). The P subunits of both gonadotropins have been

cloned in Siberian sturgeon (A. baeri) and Russian sturgeon (A. gueldenstaedti), and based









on their function and position in the phylogenetic tree, it was suggested these compounds

be termed FSH and LH, respectively (Querat et al., 2000; Hurvitz et al., 2005).

FSH and LH stimulate gonadal steroidogenesis, and the three steroid hormones

relevant to this study are estradiol-17P (E2), testosterone (T) and 11l-ketotestosterone (11-

KT). In females, E2 Stimulates gonadal growth, sexual maturation, vitellogenesis by the

liver and oogenesis (Knobil and Neill, 1994; Norris, 1997; Denslow et al., 2001). In males,

T stimulates sexual maturation, spermatogenesis and spawning, and is implicated in sexual

behavior for both males and females (Norris, 1997; Toft et al., 2003). In addition to

inducing spermatogonial proliferation, 11-KT likely also participates in the former

processes (Schultz and Miura, 2002).

Circulating hormones can be detected by receptors at the periphery of the cell, and

through a cAMP mediated process ultimately leads to increased levels of intracellular

cholesterol (Stocco, 1999). This cholesterol is mobilized to the outer mitochondrial

membrane and is the precursor for steroid biosynthesis. A protein inserted in the

mitochondrial membrane, steroidogenic acute regulatory (StAR) protein, functions to

transport cholesterol from the outer mitochondrial membrane to the inner mitochondrial

membrane, and this process is now thought to be the rate limiting step in steroidogenesis

(Stocco, 1999). Its function has received considerable attention in recent studies of

vertebrates (Stocco, 2001), including fish (Goetz et al., 2004). The inner mitochondrial

membrane is the site of activity for the P450 side chain cleavage enzyme (P450sec) that

cleaves cholesterol to form the first steroid in the pathway, pregnenolone. Pregnenolone is

then converted to progesterone by 3P-hydroxysteroid dehydrogenase (3P-HSD). Both

P450sec and 3 P-HSD are often evaluated in studies of steroidogenesis and related










physiological mechanisms (Takase et al., 1999; Pozzi et al., 2002; Inai et al., 2003).

Further pathways of steroid production are shown in Figures 1-2 and 1-3. Quantifying

compounds in the biosynthetic pathways will assist in developing a mechanistic

understanding of which pathways can be disrupted.

Stress in Fish and Its Effects on Reproduction

Stress has been defined in the literature in a number of ways, encompassing such

definitions as diversions of metabolic energy, adaptive changes resulting in modifications

to normal physiological states, and any change that impacts long term survival (Selye,

1956; Esch and Hazen, 1978; Wedemeyer and McLeay, 1991; Bayne, 1985; Barton and

Schreck, 1987). Ultimately our interest in stress is attendant upon the causative factors

mitigating the deleterious response. Once these causative factors are determined, we can

then begin the process of remediation. In this sense, understanding stress is a means to an

end and becomes a useful tool to predict if negative outcomes are likely to ensue. We can

use this diagnostic tool to understand environmental impact and determine at what point

action is necessary to effectuate relief.

As in other vertebrates, concentrations of coricosteroid hormones are sensitive

indicators of acute stress in fish, and circulating concentrations generally reflect synthesis

rates since little hormone is stored in the adrenal (mammals) or interrenal tissue (fish)

(Norris, 1997). The production of corticosteroids is initiated by perceived stress events,

triggering the release of corticotropin releasing hormone (CRH) from the hypothalamus,

which then triggers the release of ACTH from the pituitary (Figure 1-2) (Flik et al., 2006).

Circulating ACTH triggers the release of corticosteroids from the interrenal cells of the

head kidney in most fish species; in sturgeon cortisol releasing adrenocortical cells are

present in small clusters throughout the kidney (Norris, 1997).









The principal corticosteroid in most Hish species is cortisol (Kime, 1997; Barton,

2002; Overli et al., 2005), which has been implicated as a causal factor in many of the

deleterious effects of stress (Barton and Iwama, 1991; Harris and Bird, 2000; Schreck,

2001; Bernier et al., 2004). Cortisol shows two primary actions in fish, regulation of water

and mineral balance and energy metabolism (Wendelaar Bonga, 1997). The effects of

corticosteroid hormones are mediated through intracellular receptors, which act as ligand

binding transcription factors (Norris, 1997). Fish possess both a glucocorticoid receptor

(GR) and a mineralcorticoid receptor (MR) with GR possessing various isoforms (Bury et

al., 2003). While cortisol is the predominant physiological ligand for GR, it is still unclear

what is the primary ligand for MR in fish, which shows a high affinity for both

deoxycorticosterone and aldosterone (Prunet et al., 2006). This is particularly interesting

since there is no reliable evidence for the presence of aldosterone in teleosts, and it is

becoming accepted that aldosterone is likely absent in most or potentially all Eish groups

(Prunet et al., 2006).

The molecular characterization of corticosteroid receptors (CR) in the last 10 years

has modified the initial consensus of a unique high affinity binding site for cortisol, and

now depicts a multiple CR family with two classes of receptors (GR and MR) with splicing

isoforms and duplicated genes (GR1 and GR2) (Prunet et al., 2006). Functional analyses in

trout show that GR2 has a higher sensitivity to cortisol when compared to GR1, and that

these isoforms show different patterns of expression sensitivity depending on the tissues

targeted (Greenwood et al., 2003). It has also been shown that GR can be less sensitive to

corticosteroids than MR, suggesting that the latter could serve as a high affinity cortisol

receptor in fishes, a condition already described in humans (Hellal-Levy et al., 2000).









The significance of cortisol in assessments of stress may be limited when examining

chronic stressors, due in part to the acclimation of the interrenal tissues during chronic

stre ss, whi ch i s miti gated by negative feedb ack m ech ani sm s on th e hyp othal amo-pituitary -

interrenal (HPI) axis (Rotllant et al., 2000). Other bio-markers, such as expression levels

of GR, have been shown to be more sensitive indicators of chronic stress. Quantification of

GR in seabass (Dicentrarchus labrax) showed significantly reduced GR concentrations

after a 3-month exposure to elevated stocking densities (Terova et al, 2005).

Environmental contaminants have been shown to alter the stress response by altering

GR activation. Organotins, compounds used as industrial stabilizers in paints now present

in aquatic environments, have been shown to block GR activation (Odermatt et al., 2006).

Other ubiquitous pollutants such as PCBs and arsenic have also been shown to alter GR

receptor functioning (Johansson et al., 1998; Bodwell et al., 2004).

The effects of stress can be manifest at multiple levels of the reproductive endocrine

axis (Guillette et al., 1995; Pankhurst and Van Der Kraak, 1997). Although there is limited

information on the effects of stress on the release of GnRH on aquatic inhabitants, several

studies have been conducted identifying stress impacts on circulating concentrations of

GTH-I and GTH-II. For some species of fish such as brown trout (Salmo trutta),

confinement stress results in an increase in circulating concentrations of GTHs (Pickering

et al., 1987; Sumpter et al., 1987). For other species, such as the white sucker (Catostonaus

conanersoni), capture and transport stress results in depression of GTHs to undetectable

concentrations within 24 h of capture (Stacey et al., 1984).

The effects of stress on concentrations of gonadal steroids in both terrestrial and

aquatic animals is well documented, resulting in a depression in plasma concentrations of









both androgens and estrogens in most species studied to date (Francis, 1981; Pickering et

al., 1987; Carragher and Pankhurst, 1991). These reductions can be attributed to altered

secretion of gonadotropins (Gray et al., 1978) as well as by direct inhibition of gonadal

steroid synthesis (Saez et al., 1977; Sapolsky, 1985).

Cortisol has also been implicated in altering endocrine function. Cortisol's negative

effects on reproduction includes depressed plasma concentrations of sex steroids

(Pankhurst and Dedual, 1994; Pottinger et al, 1999). However, this response is dependent

upon the hormones involved and the species investigated. Elevated plasma concentrations

of cortisol in Stellate sturgeon (A. stellatus) females have been shown to result in

correspondingly lower concentrations of circulating plasma T and 1 1-KT, however, E2 and

progesterone (P) remain constant (Semenkova et al., 2002). Similarly, Bayunova (2002)

observed an inverse relationship between cortisol and T after a 9-h period of confinement

stress for both male and female stellate sturgeon. Consten et al. (2002) investigated

whether the decrease in plasma 1 1-KT of male carp was caused by a direct effect of

cortisol, or by an indirect effect (such as a decrease in plasma LH). Experimental animals

were fed cortisol-containing food pellets over a prolonged period, and the results indicated

that cortisol had a direct inhibitory effect on testicular androgen secretion that was

independent of LH secretion. Reductions in reproductive hormones can lead to a myriad of

deleterious reproductive effects such as decreased gamete quality, embryo mortality, and

behavioral changes (Pankhurst and Van Der Kraak, 1997; Pankhurst, et al., 1995).

Endocrine Disruption in Aquatic Vertebrates

Xenobiotics, or man-made chemicals, have been shown to disrupt normal hormone

function, and have received considerable attention over the last decade (Colborn and

Clement, 1992; Guillette, 2000; McLachlan 2001). Compounds evaluated as endocrine









disrupting contaminants have generally included common environmental pollutants which

have demonstrated abilities to mimic hormones, alter hormone production, or act as anti-

hormones (Guillette, 2000). Molecularly, xenobiotics have the ability to bind directly to

steroid hormone receptors or other proteins that initiate or facilitate the transcription of

genes (Thomas, 1990; Rooney and Guillette, 2000). Compounds such as polychlorinated

hydrocarbon pesticides (e.g., DDT derivatives), polychlorinated biphenyls (PCBs) and

others have been shown to bind to estrogen receptors manifesting estrogenic or anti-

estrogenic actions in mammals and birds (Bulger and Kupfer, 1985; Rooney and Guillette,

2000). Extensive work has been conducted in fishes, and evidence indicates similar

mechanisms occur (Thomas, 1990; White et al., 1994; Tyler et al., 1998a; 1998b; 1999;

Jobling et al., 1995; 1996; 1998; 2002).

Numerous studies document a vast array of endocrine disruptive effects in fish

located in polluted aquatic systems and areas downstream of sewage or other industrial

treatment plants (Jobling et al., 2003; Toft et al., 2004). Male walleye (Stizostedion

vitreum) collected near a metropolitan sewage treatment plant exhibited depressed serum T

concentrations and elevated serum E2 COncentrations compared to reference males (Folmar

et al., 2001). Reduced plasma concentrations of T have also been documented in lake

whitefish (Coregonus clupeaformis) and white sucker (Catostomus commersonii) exposed

to bleached Kraft mill and pulp mill effluent respectively (Munkittrick et al., 1992; 1994).

Female mosquitofish downstream from Kraft paper-mill effluent in Florida demonstrated

masculinization of the anal fins, which is an androgen-dependent trait (Parks, et al., 2001).

Male mosquitofish from a Florida lake contaminated with known endocrine disruptors

displayed shorter gonopodium, significantly reduced whole body T concentrations, reduced









liver weights and had reduced sperm counts versus those of a reference population (Toft et

al., 2003).

Compounds such as the natural steroid E2 have been measured in both industrial

and municipal sewage treatment effluents, which represent the principle sources of natural

estrogens in the aquatic environment (Lai et al., 2002). Exposure to E2 CauSed disruptions

in sexual differentiation in young zebrafish and altered egg production patterns in adults

(Brion et al., 2004). Exposure of the riverine species the roach (Rutilus rutilus) to a host of

chemicals persistent in typical British waters, revealed significantly increased incidences of

intersexuality and plasma vitellogenin concentrations and attributed these alterations to

estrogenic constituents of sewage effluents (Jobling et al., 1998).

Considerable work also has been conducted on abnormalities of the reproductive

system of Florida' s alligators in relation to environmental contamination, notably in Lake

Apopka, located northwest of Orlando. These studies report reductions in circulating

concentrations of sex steroids, alterations in gonadal morphology, phallus size, enzyme

activity and steroidogenesis (Guillette, et al., 1999; 2000). These modifications were

attributed to both embryonic and post-hatching exposure to a complex mixture of

chemicals from agricultural activities and stormwater runoff, including PCBs, p,p'-DDE,

dieldrin, endrin, mirex, and oxychlordane. Excess nitrate has also been shown to alter

steroidogenesis and endocrine function in several aquatic species (Guillette and Edwards,

2005; Barbaeu, 2004). Detailed lists of known endocrine disrupting contaminants and

their documented effects are readily available (Edwards, 2006), and will be discussed in

further detail in Chapters 3, 4 and 5.









Nitrate in Natural Water Systems

In nature, organic and inorganic nitrogen is cycled through various environmental

processes such as nitrifieation, denitrifieation, Eixation and decay. Nitrifieation and

denitrifieation processes are essential to the health of aquatic ecosystems. These processes

generally begin with ammonia, which is broken down to nitrite by aerobic nitrifying

bacteria (usually Nitrosomona~s sp.), which is then converted by another group of bacteria

to nitrate (usually by Nitrobacter sp.). Nitrate is often then fixed by plants as a nutrient, or

undergoes denitrification (Sharma and Ahlert, 1977). Complete denitrification converts

nitrate to either nitrogen gas or organic nitrogen. Incomplete denitrification, resulting from

inadequate sources of carbon or environmental conditions, results in nitrate's conversion

back to nitrite, or even ammonia, by anaerobic denitrifying bacteria (Van Rijn et al. 2006).

Over the last several decades, concentrations of nitrate in natural water bodies from

anthropogenic impact has increased significantly (Pucket, 1995), which has resulted in

nitrate concentrations in many water sources far in excess of the EPA drinking standard of

10 mg/L nitrate-N (Kross et al., 1993; U.S. EPA, 1996). In northern Florida,

concentrations as high as 38 mg/L nitrate-N were recorded in the Suwannee River (Katz et

al., 1999). In addition to its direct effects, nitrate can encourage excessive algal and plant

growth, adversely impacting the ecology of the affected area (Attayde and Hansson, 1999;

Capriulo et al., 2002).

Nitrate in Aquaculture and Its Implications as an EDC

As discussed previously, elevated concentrations of stress hormones have been

shown to result in decreased concentrations of circulating sex steroids. Environmental

contaminants have been shown to elicit a stress response, thereby decreasing circulating

concentrations of sex steroids. In fact, some of the earliest reports of vertebrate stress










responses were induced by chemical exposure (Selye, 1936). While it is clear many man-

made chemicals have considerable impact on hormone function in aquatic animals, it is less

clear if naturally occurring compounds could also have the same effect. Contaminated

aquatic ecosystems such as Lake Apopka, Florida provide ample opportunity to observe

severe abnormalities of the reproductive system, and are decidedly "unhealthy" for aquatic

life. In aquaculture, aquatic animals are exposed to xenobiotic and natural compounds

often far in excess of those experienced in nature, but resultant abnormalities are often

overlooked since aquaculture fish are not necessarily expected to mimic wild fish. After

all, they are held at higher densities, eat dramatically different diets, and are often held

under unnatural temperature and light regimes. Additionally, definitions of acceptable

water quality standards of natural water environments (generally under EPA regulation)

versus those of intensive aquaculture systems (under the regulation of the farm manager)

are usually dramatically different. Commercial aquaculture operations have limited

budgets (if any) for in-depth research into the factors that are contributing to the success or

failure of husbandry practices and protocols. Therefore, water quality estimates of "safe"

operating levels in aquaculture are often the result of trial and error practices based on

growth or mortality events. For species such as sturgeon, which take many years to reach

reproductive maturity, and whose economic viability relies heavily on proper egg

production, it may be important to investigate more thoroughly the sublethal effects a

potential hazard may impose.

Nitrate has been overlooked as a material water quality hazard in both natural and

aquaculture settings. Emerging information implicates nitrate as a hazard at concentrations

once thought to be innocuous for both reptile and amphibian species (see Guillette and









Edwards, 2005). It has been shown that vertebrate mitochondria are capable of nitric oxide

(NO) synthesis via non nitric oxide synthase (NOS) activity (Zweier et al., 1999) using

nitrite as a precursor. Nitrate can be converted to nitrite in-vivo (Panesar and Chan, 2000),

and it is thought other enzymes can generate NO directly from nitrate (Meyer, 1995).

Nitric oxide is a gas that plays diverse roles in cellular signaling, vasodilation, immunity

and has been documented to inhibit steroid hormone synthesis (DelPunta et al., 1996;

Panesar and Chan, 2000; Weitzberg and Lundberg, 1998). As discussed previously in this

chapter, StAR and P450sce are key factors regulating steroidogenesis. NO has been shown

to alter the activity of StAR and may also alter P450sce by binding to the heme group

which is present in all enzymes of the P450 family (White et al., 1987). Bulls fed nitrate

showed reduced sperm motility and degenerative lesions of the germ layers of the testes

(Zraly et al., 1997). Medaka exposed for 2-months to no more than 75 mg/L NO3-N

showed reduced fertilization and hatching rates (Shimura et al., 2002). A study of female

mosquitofish (Gamnbusia holbrooki) in Florida showed reduced reproductive activity and

embryo number in fish exposed to 5.06 mg/L NO3-N (Edwards et al., 2006b).

Reproductive hormone concentrations have been shown to be especially vulnerable

to chemical and physical strain (Pickering, 1987), which as discussed can cause numerous

reproductive complications. Since nitrate has been shown to negatively impact the

reproductive physiology of a number of aquatic species (Edwards et al. 2006a; Edwards et

al., 2006b) and sturgeon have been shown to be unusually susceptible to environmental

impact (Akimova and Ruban; Dwyer et al., 2005), it stands to reason that nitrate could be

an endocrine disrupting contaminant for Siberian sturgeon, and is worthy of investigation.









In the United States and elsewhere, water is becoming a valuable and limited

commodity, and its use is tightly regulated. New aquaculture operations will not be

afforded the vast quantities of water established facilities have been permitted to use, and

will therefore need to use recirculating technologies which enable these facilities to reuse a

significant portion of their water. In most of these recirculating facilities, the limiting

factor for water exchange is nitrate concentration.

Sturgeon as a Model Species

Sturgeons belong to one of the most ancient groups of Owridukes ~ and are

naturally distributed above the 30th parallel. Although they can be found almost

everywhere along the Pacific and Atlantic coasts, the Mediterranean and Black Seas, as

well as rivers, lakes and inland seas, most sturgeon populations are sparse and occur in

significant numbers in only a few regions (Detlaff et al., 1993). The Caspian Sea

represents a unique reservoir, producing the bulk of the world' s sturgeon capture fisheries.

Sturgeon include anadromous, semi-anadromous and river-resident (freshwater) forms.

The Siberian sturgeon have both semi-anadromous and river resident populations (Detlaff

et al., 1993).

Sturgeon have preserved primitive structural features relating them to

chondrosteans, while at the same time the structure of their eggs is more similar to

amphibians than either chondrosteans or teleosts, since the inclusions of yolk are

distributed throughout the cytoplasm. Although sturgeon produce great numbers of large

eggs, affording them great ecological advantage in hostile environments, ironically this

production is at the nexus of their dwindling population. Sturgeon eggs, termed caviar

when processed, are a prized delicacy and commands very high prices. This has lead to

over fishing on a grand scale (Birstein, 1993; Williot et al., 2002). This over fishing, in









concert with other anthropogenic impacts, such as river damming and pollution, has

resulted in the reduction, or in some cases decimation, of sturgeon stocks worldwide

(Williot et al., 2002). Aquaculture has been proposed as a mechanism to help save wild

populations, either by reducing fishing pressures or by providing animals for stock

enhancement. Due to the high value of caviar, sturgeon aquaculture has great promise.

As discussed above, nitrate is the limiting factor for water exchange in recirculating

aquaculture systems. The less water a facility uses, the greater the possible concentrations

of nitrate, and although research is underway to develop technologies to reduce nitrate

concentrations, it is unclear what affects nitrate has on fish residing in these systems.

Additionally, environmental nitrate from anthropogenic sources is increasing at an

alarming rate worldwide (Rouse et al., 1999), and with pollution implicated in reductions in

wild sturgeon populations in the Caspian Sea, the world's largest sturgeon reservoir, the

need to understand the affects of nitrate on sturgeon is becoming more and more apparent.

That egg production is paramount to the viability of sturgeon as an aquaculture species, and

is of obvious ecological importance, necessitates an understanding of the affects of nitrate

on the reproductive system in particular.

Research Objectives and Hypotheses

The goal of this study was to gain a better mechanistic understanding of the

potential for nitrate-induced disruptions in reproductive function, using Siberian sturgeon

as a model. Based on previous studies reviewed in this Chapter, I hypothesize that given

nitrate's ability to alter steroidogenic activity, notably through NO induced alterations in

P450 enzyme activities, that the fish exposed to elevated nitrate will demonstrate reduced

concentrations of plasma sex steroid concentrations, and these reductions will be mirrored

in gonadal mRNA expression patterns of P450sc, ERP and GR. I theorize that these










alterations would not be caused by a generalized stress response, but by disruptions in

steroidogenic mechanisms directed at the production of sex steroids, notably T, 11-KT and

E2.

Compensatory mechanisms required to combat physiological challenges consumes

energy and physiological resources that could otherwise be used to carry out other essential

functions. Therefore, an animal experiencing simultaneous stressors, such as nitrate

exposure in combination with an induced stressor such as confinement, may not be as adept

at responding to the stress events as an animal experiencing a single stressor. I therefore

hypothesize that long-term exposure to elevated nitrate will alter the associated stress

response. In addition, given that GR has been shown to parallel chronic stress, I predict

GR mRNA expression will be significantly reduced in animals exposed for 30 days to

elevated nitrate.
























ACTIONt


a~i~P
~~CmlTC~


PBRODUTID


pR~oDUnrlDN


I I~D


Figure 1-1.


Overview of the hypothalamic-pituitary-gonadal axis in sturgeon. The
hypothalamic-pituitary-gonadal axis in sturgeon is similar to that of other
vertebrates. Gonadotropic releasing hormone (GnRH) from the hypothalamus
controls the release of gonadotropins (GTHs) from the pituitary that then enter
circulation. The gonad responds by producing various sex steroids including
17P-estradiol, which stimulates hepatic vitellogenin production. These
processes are essential for normal ovarian follicle development. Similar to
other fish species, the hypothalamic release of corticotropin-releasing
hormone (CRH) controls the release of adreno-corticotropin hormone (ACTH)
from the pituitary, which controls the release of glucocorticoids from the
interrenal cells of the head kidney.



















































Figure 1-2. Representative steroidogenic pathway of steroid hormones in gonadal cells. In
response to ligand binding of the receptor, the transfer of free cholesterol into
the mitochondria facilitated by steroidogenic acute regulatory (StAR) protein, is
considered the acute rate limiting step in steroidogenesis. The enzymatic
conversion of cholesterol to pregeneolone by P450sec is considered the chronic
regulatory step in steroidogenesis. Pregnenolone or progesterone is released
into the cytoplasm/smooth endoplasmic reticulum to be converted to
androstenedione, which is in turn converted into testosterone and 17P-estradiol
by 17P-HSD or aromatase respectively.

















































Figure 1-3. Representative steroidogenic pathway of cortisol production in an interrenal
cell. In response to ligand binding of the receptor, the transfer of free
cholesterol into the mitochondria facilitated by steroidogenic acute regulatory
(StAR) protein, is considered the acute rate limiting step in steroidogenesis.
The enzymatic conversion of cholesterol to pregeneolone by P450se is
considered the chronic regulatory step in steroidogenesis. 1700-
hydroxyprogesterone is released into the smooth endoplasmic reticulum for
further processing and eventual conversion 11l-deoxycortisol and cortisol.











CHAPTER 2
NITRATE TOXICITY INT SIBERIAN STURGEON

Introduction

Ammonia is a product of the biological degradation of proteins and nucleic acids.

Nitrifying bacteria convert ammonia to nitrite, which is in turn converted to nitrate, the end

product of nitrification (Sharma and Ahlert, 1977). Ammonia, and to a less extent nitrite,

are ecologically relevant compounds and the toxicity of these compounds, both in terms of

tolerable thresholds and physiologic mechanism to aquatic animal health, has been well

documented (Rubin and Elmaraghy, 1977; Meade, 1985; Huertas et al., 2002). Nitrate,

however, does not normally reach toxic concentrations in natural environments or in

recirculating systems with high water exchange, and has therefore received comparatively

less attention as a material water quality hazard (Knepp and Arkin, 1973; Russo, 1985;

Bromage et al., 1988; Meade and Watts, 1995). The absence of obvious patho-

physiological effects in most aquatic species at ecologically relevant concentrations of

nitrate, rationalizes the belief that nitrate is relatively non-toxic (Jensen, 1996). While

nitrate is indeed much less toxic than ammonia or nitrite on a mg/L basis, nitrate commonly

rises to levels far in excess of those of the other compounds in intensive aquaculture

environments with limited water exchange (Knepp and Arkin, 1973; Hrubec, 1996), and

warrants more detailed investigations into the effects these levels may have.

Excess nitrate in aquaculture has traditionally been reduced by water exchange or the

operation of denitrification filters (Timmons et al., 2001). Current trends in environmental

regulation are limiting the amount of water which may be consumed or discharged,

reducing the feasibility of using large influxes of water to remove excess nitrate.









Denitrification filters can be technically challenging and costly, and as aquaculture

operations become water limited, nitrate will become a considerable concern.

The levels of nitrate that are likely to cause concern are unknown for many aquatic

species, as are how susceptibilities to nitrate change ontogenetically. For large species

such as sturgeon, it is logistically difficult and costly to conduct acute toxicity evaluations

on broodstock size animals. However, evaluations using smaller animals may not mimic

responses of larger fish. New evidence implicates nitrate as a material water quality hazard

at levels much lower than previously suspected for other aquatic species (Guillette and

Edwards, 2005) and recommended levels of nitrate for warm-water fishes (90 mg NO3-N)

(U. S. E.P.A., 1986) has been shown to be highly toxic to amphibians (Marco et al., 1999).

Although a great deal of research needs to be conducted to elucidate the effects of

sublethal exposures, acute testing will assist researchers in understanding how sensitive a

particular species is to nitrate, and can be used as a tool to predict if susceptibilities may

change over time. The most common analytical method for evaluating acute toxicity in

fish is the LCso (Parish, 1985). An LCso describes a lethal concentration (LC) at which 50%

of the experimental population dies in a specified period of time. LCso data allows us to

determine if a substance is toxic, how toxic it is, and allows for multi-species comparisons

of sensitivity. The obj ectives of this study were to determine the acute toxicity of three

ontogenetic size classes of Siberian sturgeon (Acipenser baeri) to nitrate, using the LCso

criterion, to determine how life stage influences this response.









Methods

Study Animals and Pre-Testing Conditions

Siberian sturgeon were reared from eggs in 250 L troughs in a recirculating system

containing well water. Fish were initially fed Artemia and a soft moist formulated feed

(Silver CupTM, Nelson and Sons Inc., Murray, UT). When the fish reached 1.5 g they were

transferred to 1300 L tanks and were fed only formulated feeds by this time. Dissolved

oxygen was monitored daily and rarely went below 90% saturation (Oxyguard Handy Beta,

Point Four Systems Inc., Richmond, BC, Canada). Temperatures were slowly increased

throughout the fish's development, and ranged from 150C (at hatch) to 23.50C. Other water

quality parameters prior to the toxicity trials were evaluated weekly (ammonia-N and

nitrite-N, Lamotte Smart Colorimeter, Chestertown, MD; nitrate, lon 6 Acorn Series,

Oakton InstrumentsTM, Vernon Hills, IL; pH, Acorn 6 Series, Oakton InstrumentsTM, Vernon

Hills, IL). In addition to the above parameters, alkalinity, chloride, total hardness and

calcium hardness (Hach CompanyTM, Loveland, CO) were tested at the beginning and end

of each 96-h toxicity trial.

Range-Finding Studies

Small-scale range Einding studies using at least three nitrate concentrations with five

fish/concentration were conducted prior to each test until a suitable test range was

determined. Suitability was defined by total mortality in the highest concentration and no

mortality in the lowest concentration in 96 hours within a narrow test range. Tests

generally required 2-3 range finding studies per toxicity trial. Tanks were evaluated for

mortalities every 3-4 hours from 08:00 to 20:00, and dead fish were immediately removed

and inspected for condition.









Test Procedures

Three partial exchange 96-h toxicity tests were conducted in triplicate using three

weight classes of Siberian sturgeon spanning 3 orders of magnitude, with 10 Hish per test

container. Experiments were conducted over time using Eish from the same cohort to

eliminate cohort variability. New experimental animals were used for each trial. Water

for each of the evaluations consisted of degassed well water (nitrate-N 1.4 & 0.3 mg/L)

from which nitrate solutions were created from food-grade sodium nitrate (JLM Marketing,

Tampa, FL). Initial concentrations were confirmed with an Auto AnalyzerTM, and were

periodically spot-checked with an ion specific probe (lon 6 Acorn Series, Oakton

InstrumentsTM, Vernon Hills, IL) throughout the trials to ensure concentrations matched

initial target values. Each trial evaluated four geometrically constant concentrations of

nitrate, as well as triplicate well water and sodium controls. Sodium controls were

achieved with NaCl (Morton SaltTM, Chicago, 1L) with concentrations adjusted to match

the sodium in the highest nitrate concentration in the trial. Tanks were randomly assigned

to each treatment. Tanks were evaluated for mortalities every 3-4 hours from 08:00 to

20:00 and dead fish were immediately removed and inspected for condition.

The first trial evaluated concentrations of 555, 888, 1420, and 2273 mg/L nitrate-N

using 6.9 & 0.31Ig fish. This trial was conducted in glass aquaria filled with 32.4 L of test

solution, submersed in a water bath to maintain a temperature of 210C. A 50% water

exchange with the appropriate nitrate concentration was conducted half way through the

trial to eliminate collateral effects from elevated ammonia or nitrite. Fish were not fed two

days prior to and throughout the trial, and fecal debris was siphoned twice daily.









At least twice daily, observations were made of fish behavior (orientation, gill

ventilation rate, swimming speed) and appearance throughout the trial. The second trial

evaluated concentrations of 216, 323, 485, and 727 mg/L nitrate-N using 66.9 & 3.4 g fish.

This trial was conducted in fiberglass tanks filled to 670 L. The water was maintained at

23.50C. The third trial evaluated concentrations of 234, 421, 758 and 1364 mg/L using

673.8 & 18.6 g fish. This trial was conducted in fiberglass tanks filled to 587 L, and the

temperature was maintained at 23.50C.

Statistical Analyses

Data from replicates were pooled prior to calculating the median lethal concentration.

Median lethal concentrations and 95% confidence intervals were evaluated by the trimmed

Spearman-Karber method for 24, 48, 72, and 96-hr time periods. Testing ranges,

determined by range finding studies, were designed to evaluate a 96-hr time period.

Therefore, shorter time periods did not always result in enough mortality to compute the

LC5o values. Normal distribution was evaluated with the Shapiro-Wilk' s test. A linear

regression of loglo transformed data was conducted to predict susceptibilities of larger

sturgeon using StatView@ statistical software package (SAS@ Institute, Cary, NC).

Results

No animals died in either the well water or sodium controls for any of the size classes

tested, and appeared healthy throughout the trial. The 96-h LC5o of nitrate to 6.9 & 0.3 1 g

Siberian sturgeon was 1028 mg/L nitrate-N (Table 2-1). Moribund fish in this size class

tended to gill rapidly, but most showed few outward signs of toxicity except a stiffening of

the musculature and lethargy (decreased swimming speed, frequent resting periods). The

96-h LCso of nitrate to the 66.9 & 3.4 g and 673.8 & 18.6 g sturgeon was 601 mg/L and 397










mg/L nitrate-N respectively. Moribund fish in these treatments tended to exhibit additional

evidence of the toxicity such as reddening around the mouth, and red specks and/or patches

along the length of the body, most notably at the base of the pectoral fins. Log transformed

nitrate vs. log transformed LCso values are shown in Fig. 2-1. Water chemistry parameters

were as follows: unionized ammonia-N (NH3)<; 0.04 f 0.02 mg/L; nitrite-N
pH 7.9 f 0.2; alkalinity 208 f 12 mg/L; chloride 90 f 5 mg/L (exclusive of the NaCl

control); total hardness 260 f 10 mg/L; calcium hardness 160 f 10 mg/L. Dissolved

oxygen levels were maintained at >95% saturation throughout the trials. The Shapiro-

Wilk's test indicated normal distribution for all treatments. The 6.9 + 0.31 g sturgeon were

maintained at 21.00C while the latter two size classes were maintained at 23.50C, which are

typical temperatures for these size stages. Placing all three size classes at the same

temperature would not represent a realistic rearing condition, and previous toxicity tests

with this species has not demonstrated a significant difference in LC50 values for

temperatures ranging from 200C-250C for 6.0 g to 1 kg Siberian sturgeon (H. Hamlin,

unpublished data).

Discussion

The United States is now recognizing water as a valuable and limited commodity,

and its tight regulation is forcing aquaculture technology to shift toward more sustainable

and ecologically responsible practices. Therefore, as the land-based aquaculture industry

continues to grow, management strategies are shifting to recirculating systems with lower

water exchange. This trend is creating new husbandry concerns as less clean water is

available to flush out nitrate. In systems with limited water exchange, nitrate can build to

levels of 150 mg/L nitrate-N or more (personal observation), and it is unclear the impact









these elevated levels may have. Critical for the design of any aquaculture operation are the

water quality standards to be maintained, and it is important to know what levels of

substances are likely to cause concern (Bohl, 1977). The etiology and effects of nitrate

toxicity are relatively unknown in fishes, leaving open future opportunities for research in

this area. This information can then be used to understand toxicity thresholds and

physiologic impact, as well as appropriately engineer remediation systems and

technologies.

Results of this study demonstrated the 96-h LCso for fish of 7-700 g to range between

397-1028 mg/L nitrate-N. These numbers are appreciably lower than those reported for

most aquatic species tested to date. Comparative nitrate data from representative toxicity

studies suggests that the maj ority of test populations can handle nitrate-N levels of 1000

mg/L nitrate-N or more (4426 mg/L total nitrate) without reaching 50% mortality, when

sodium nitrate is used as the source of nitrate (Table 2). Some fish, such as the

beaugregory (Stegastes leucostictus), exhibit LCso values of over 3000 mg/L NO3-N

(13,280 mg/L total nitrate), substantially above the tolerance of most freshwater fish

including Siberian sturgeon (Peirce et al., 1993). Although diet may affect the relative

toxicity of nitrate (Chow and Hong, 2002), a pervasive theory in the etiology of nitrate

toxicity is that it is endogenously converted to nitrite (Hill, 1999), and it is in fact nitrite

that is the biotoxic agent. In terrestrial animals this theory has been the source of numerous

debates (Hartman, 1982), and the mechanism of nitrate toxicity in fishes is still unclear.

Anecdotal evidence at Mote Marine Laboratory's Aquaculture Park (Sturgeon

Commercial Demonstration Proj ect) has shown Siberian sturgeon to be especially sensitive

to nitrate, with larger animals exhibiting increased incidence of toxicity and mortality









starting at levels as low as 90 mg/L nitrate-N (398 mg/L total nitrate, see Guillette and

Edwards (2005) for an explanation of the reporting of nitrate concentrations) (H. Hamlin,

unpublished data). Susceptibilities have been strongly affected by cohort variability, with

certain cohorts being more sensitive to elevated nitrate than others. Although the results in

this study demonstrate a strong correlation between size and LCso values, caution must be

taken in predicting susceptibilities of varying cohorts of Eish, or even fish within the same

cohort, since LCso values have been shown to be highly variable (Buikema et al., 1982).

Regression analysis of the current data yield a predicted LCso of 247 mg/L nitrate-N (1093

mg/L total nitrate) for 6 kg fish (Fig. 2-1). Regardless of the high variability of

toxicological responses to nitrate, it is clear from this study that young Siberian sturgeon

are far more tolerant to elevated nitrate than their adult counterparts, and this is the first

study to demonstrate this finding.

Often, the dose-response relationship is a scaled association between the

concentration of chemical tested and the severity of the elicited response (Lloyd, 1979). In

general, younger or immature animals tend to be more susceptible to chemical insult or

perturbation than are adults (Macek et al., 1978; Sprague, 1985). In fact, a common

chronic toxicity test is the early life stage test, because although this test does not provide

total life cycle exposure, it is purported to include exposure during the most sensitive life

stages (McKim, 1985). This study found an increased tolerance of Siberian sturgeon to

nitrate at younger stages. Although this opposes general convention, this phenomenon has

been reported for other fish species with other toxic compounds (Rosenberger et al., 1978).

Acute toxicity tests are an effective tool to establish baseline toxicity thresholds in

terms of responses to nitrate over time, and to compare the toxicity of nitrate to other










species. Given the increased sensitivity of Siberian sturgeon to nitrate as compared to

other species, it is clear much more work is needed to elucidate the sublethal effects of

elevated nitrate exposure. The sensitive nature of sturgeon to nitrate renders them suitable

candidates for further investigation of the etiology and nature of nitrate exposure and

toxicosis.














Table 1-1. LCso results and test conditions for three size classes of Siberian sturgeon
exposed to sodium nitrate
Average weight 6.9f0.31 g 66.9f3.4 g 673.8f18.6 g
24-h LCso (mg/L NO3-N) 1510 n/a 803
95% confidence interval (1826-2631) (720-897)

48-h LCso (mg/L NO3-N) 1443 n/a 522
95% confidence interval (1309-1590) (486-562)

72-h LCso (mg/L NO3-N) 1195 n/a 438
95% confidence interval (1086-1316) (394-487)

96-h LCso (mg/L NO3-N) 1028 601 397
95% confidence interval (941-1124) (557-649) (3 57-441)
* Not enough partial kill responses to obtain a valid lethal concentration estimate.












Table 1-2. Representative acute toxicity data for nitrate


NO3
Source
NaNO3


NO3-N
mg/L
5081


Species
Cape sole
(Hr. capensisl
Common bluegill
(L. nzacrochirus)
Goldfish
(C. carassius)
Tiger shrimp

Catla
(C. catla)
Channel catfish
(I. punctatus)
Chinook salmon
(0. tshaw/tscha)
Fathead Minnows
(P. pronzela~s)
Guadalupe Bass
(M~ treculi)
African clawed frog
(X. laevis)
Aquatic Snail
(P. antipod arunt) d~~~dd~~~dd
Florida pompano
(T. carolinus)
Sao Paulo shrimp
(P. paulensis)
Pacific treefrog
(P. regilla)
Guppy fry
(P. reticulatus)
Caddi sflies
(C. pettiti)


LCso
24-h LCso


Reference
Brownell 1980


NaNO3 2909*

NaNO3 2761*


24-h LC5o Dowden and Bennett
1965
24-h LC5o Dowden and Bennett
1965
96-h LC5o Tsali and Chen 2002

96-h LC5o Tilalk et al. 2002

96-h LC5o Colt and
Tchobanoglous 1976
96-h LC5o Westin 1974

96-h LC5o Scott and Crunkilton
2000
96-h LCso Tomasso and
Carmichael 1986
240-h LCso Schuytema and
Nebeker 1999
96-h LCso Alonso and Camargo
2003
96-h LCso Pierce et al. 1993

96-h LCso Cavalli et al. 1996

240-h LCso Schuytema and
Nebeker 1999
72-h LCso Rubin and Elmarachy
1977
96-h LCso Comargo and Ward
1992


NaNO3

NaNO3

NaNO3

NaNO3

NaNO3

NaNO3

NaNO3

NaNO3

NaNO3

NaNO3


1575

1565

1409

1318

1349

1269

1236

1042

1006

494


NaNO3 266


KNO3

NaNO3


200

114


* Publication did not specify whether results were values for NO3 Or NO3-N














Y=3.177 .208*X; R^`2 = .994


2.5
0.5 1 1.5 2 2.5 3 3.5

Log fish weight (g)


Figure 2-1. Linear regression of loglo transformed nitrate-N (mg/L) lethal concentration
values versus log transformed fish weight (g).











CHAPTER 3
STRESS AND ITS RELATION TO ENDOCRINE FUNCTION IN CAPTIVE FEMALE
SIBERIAN STURGEON

Introduction

The central focus of comparative physiology and endocrinology involves understanding

how various organisms respond to environmental influences. Fish are affected by stress in both

their natural and captive environments. It is well recognized that common fishery and

aquaculture practices, including crowding, transport and confinement are stressful to Hish and can

negatively affect reproduction (Pankhurst and Van Der Kraak, 1997). The effects of stress can

be manifested at many levels of the reproductive endocrine axis, and measuring the

concentration of circulating hormones is a useful endpoint to understand if a stressor affects

endocrine function. Numerous environmental stressors, including capture and confinement

(Pankhurst and Dedual, 1994), time of day (Lankford et al., 2003), hypoxia (Maxime et al.,

1995), and environmental contaminants (Orlando et al., 2002; Guillette and Edwards, 2005) have

been shown to induce stress in fish. For most Hish, including the Siberian sturgeon and other

freshwater chondrosteans, cortisol is the predominant stress hormone (Maxime et al., 1995;

Barton et al., 1998; Mommsen et al., 1999). Plasma glucose concentration has also been shown

to be an indicator of secondary stress responses (Bayunova et al., 2002).

Sex steroids can have an inverse relationship with plasma concentrations of stress steroids,

an effect evident in fish and some other animals (Carragher and Sumpter, 1990; Cooke et al.,

2004). Negative effects of stress on reproduction have been attributed to the suppression of LH

and FSH secretion from the pituitary gland, disruptions in steroidogenesis pathways, or alteration

of hormone degradation by the liver and/or kidney (Krulich et al., 1974). Although plasma

concentrations of corticosteroids often parallel acute stress, there is evidence in teleosts that the









estrogenic inhibitory effects of stress are not necessarily mediated by cortisol, and that these

effects arise higher in the endocrine pathway than at the level of ovarian steroidogenesis

(Pankhurst et al., 1995).

Contradictory evidence has shown that the addition of cortisol to the culture medium

reduces the secretions of 17P-estradiol (E2) and testosterone (T) from cultured ovarian follicles

of rainbow trout (Oncorhynchus mykiss) (Carragher and Sumpter, 1989). Likewise, carp fed

with cortisol-containing food pellets showed reduced androgenic production, independent of LH

secretion (Consten et al., 2002). Acute confinement stress in male brown trout (Salmo trutta L.)

resulted in low concentrations of plasma T and 1 1-KT in sexually mature animals (Pickering et

al., 1987). White sturgeon (Acipenser transmontanus) injected with an ACTH analog exhibited a

dose-dependent increase in cortisol concentration more than the cortisol concentrations induced

by stress events such as transport and handling (Belanger et al., 2001). A few studies, including

one examining the effects of stress on serum cortisol concentration in cultured stellate sturgeon,

actually demonstrated significantly increased gamete quality in fish with elevated cortisol

concentration, speculating that cortisol could be a normal endocrine component of the

reproductive system, even though later studies of the same species showed reduced plasma

concentrations of sex steroids during stress (Semenkova et al., 1999; Bayunova et al., 2002). It

has also been shown that fish require prolonged periods to recover from an acute stress event

(Jardine et al., 1996). Other studies have shown that blood removal, a practice often necessary

for evaluating endocrine endpoints, can alter blood hemoglobin concentration (Hogasen, 1995).

Stress studies typically focus on the causative factors mitigating the deleterious response,

but defining these relationships often requires sampling and research measures that themselves

contribute to enhancing the stress response. Understanding the effects of potential stressors is









critical to properly manage wild fisheries or successfully culture endangered or economically

important fishes. It is important to know which stressors are naturally present in the fish's

environment, which are caused by typical aquaculture practices, and which are induced by the

testing procedures themselves (Conte, 2004).

Sturgeons (Acipenseriformes) are among the most ancient fishes on earth, originating

over 200 million years ago (see review by Birstein, 1993). Twenty-five extant sturgeon species

occupy the Northern Hemisphere; however, excessive fishing, loss of spawning grounds and

other environmental pressures have contributed to the reduction of sturgeon stocks worldwide,

particularly Caspian Sea varieties (Williot et al., 2002). Today, all 25 species of sturgeon are

listed as endangered or threatened in some regard (Birstein, 1993). Aquaculture has been

proposed as a means to conserve sturgeon, and generating commercial stocks has the dual benefit

of providing fish for stock enhancement, as well as for food production, thus conserving wild

populations (Beamesderfer and Farr, 1997; Waldman and Wirgin, 1997; Chebanov et al., 2002;

Stone, 2002). The Siberian sturgeon is rapidly becoming a species of great economic interest in

the United States, and is currently the most widespread sturgeon species utilized for commercial

aquaculture in Europe (Gisbert and Williot, 2002). Despite this, very few studies have been

conducted to clarify the physiological effects of stress on this species. Understanding the

endocrine disruptive effects of induced stress will serve as a baseline for understanding the

effects of other environmental stressors, such as contaminants commonly found in both natural

and constructed environments. Nitrate, for example, has recently been shown to be highly toxic

to Siberian sturgeon in aquaculture environments with limited water exchange (Hamlin, 2006),

and is predicted to be of considerable concern for commercial aquaculture operations, which are

already being forced to significantly reduce their water usage. Nitrates and other ions have also









been established as ecologically relevant endocrine disruptors in natural environments for

numerous other vertebrates (see review by Guillette and Edwards, 2005). For late maturing

species such as sturgeons, whose economic viability relies heavily on successful egg production

(caviar), it is of particular importance to understand the relationships between stress and

reproductive health.

The purpose of this study is to define the relationship between induced stress and

circulating concentrations of steroid hormones in cultured Siberian sturgeon, and to identify

mitigating stress factors in typical testing procedures, most notably the techniques of blood

withdrawal and surgical sexing, to understand what factors contribute significantly to the stress

response.

Methods

Fish and Sampling

Three-year-old Siberian sturgeon were collected from two 30,000 L tanks, each from

separate commercial recirculating aquaculture systems at Mote Marine Laboratory's Aquaculture

Park (Commercial Sturgeon Demonstration Project) in Sarasota, Florida. Experiments were

started at approximately 10:30 a.m. in May of 2004. Water chemistry in each of these systems

was analyzed weekly for the levels of ammonia-N, nitrite-N, nitrate, and pH prior to the start of

experiments. Dissolved oxygen and temperature were monitored continuously using stationary

probes, which were spot-checked biweekly for calibration using portable probes. Hardness,

alkalinity, and chloride concentration was analyzed the day prior to the start of experiments.

The sturgeon were pulled from the water by hand at the side of the tank and immediately

held down on a padded V-shaped surgical table. Pulling the sturgeon from the tank by hand

(versus netting) decreased the likelihood of stressing the remaining fish in the tank and allowed

immediate access to the fish for blood sampling. Blood was extracted from the caudal vein (5










ml) using a 10 ml syringe (20 gauge needle) within 1 min of capture; most captures took 30 sec

for the full blood sample to be drawn. The blood sample was placed into lithium heparin

VacutainerTM tubes, and stored on ice for less than 30 minutes before centrifugation. Plasma was

separated via centrifugation (5-10 min at 2000 g), placed into cryovials, rapidly frozen in liquid

nitrogen and stored at -80 oC for 2-3 weeks prior to analysis.

Surgical Sexing

For surgical sexing, the sturgeon were anesthetized in a 5 OC water bath containing carbon

dioxide. Carbon dioxide was used because it is a low regulatory priority anesthetic for fish that

are grown for food production and requires no withdrawal period; the sturgeon used in this study

were part of a commercial food production program. Pure oxygen gas administered through a

fine air stone was used to maintain dissolved oxygen concentrations in the range of 8.0 12.0

mg/L in the anesthetic bath, and sodium bicarbonate was added to maintain pH in the range of

6.8 7.5 throughout the procedure. The sturgeon generally took 3 5 min for full

anesthetization. A 2.5 3.8 cm incision was made on the ventral side of each fish, approximately

7.5 cm anterior to the vent, along the median axis to allow inspection of the gonads on either side

of the fish for sex determination. The incision in each fish was closed by suturing with coated

vicryl absorbable suture (Ethicon IncTM., Somerville, New Jersey), and the fish was allowed to

recover in a confinement tank. Once anesthetized, the surgical procedure took approximately 1

min/fish, and the fish recovered fully from the anesthesia in 5 10 min.

Treatments

Six fish (3 fish/tank) were used for each treatment. All fish were sexed immediately after

initial bleedings/sham bleedings; if the fish was male, the sample was discarded, and another fish

was extracted until 3 females had been sampled from each tank for each treatment. In this study,









we focused on female sturgeon because they are part of a larger set of studies examining various

environmental factors and ovarian development leading to commercial caviar production. The

female sturgeon were then weighed and measured just after sexing while they were still under

anesthesia. The fish were then placed into a square 0.64 m3 inSulated plastic tote filled with 530

liters of system water for a 4-h period of confinement stress. A numbered cable tie placed

around the caudle peduncle identified individual Eish. The time at which the fish was removed

from the tank for initial bleeding/sham bleeding was considered 0-h.

In all treatments, fish were sexed immediately after initial blood drawing/sham drawing

prior to placement in the confinement tank. In treatment 1, fish were bled at 0-h only and placed

into an insulated tote as described previously. In treatment 2, fish were bled at 0-h, 1-h and 4-h.

In treatment 3, fish were bled at time 1-h and 4-h only, and in treatment 4, fish were bled at 4-h

only. For treatments 3 and 4, during the sampling periods when the fish were not bled, the fish

were held down on the surgical table momentarily to mimic the bleeding procedure but were not

pricked with the needle. Blood sampling times for all treatments during the 4-h period of

confinement stress are shown in Fig. 3-1.

Hormone Evaluations

Plasma samples for steroid evaluations were thawed on ice, and the steroid fraction was

extracted with diethyl ether. Extraction was repeated twice to enhance extraction efficiency.

Plasma cortisol, E2, T and 11-KT concentrations were analyzed according to the instructions

provided with the commercial competitive enzyme immunoassay kits (Cayman Chemical Co.,

Ann Arbor, MI), specific to each hormone. Each hormone was previously validated for Siberian

sturgeon plasma by verifying that serial dilutions were parallel to the standard curve. Samples

were run in duplicate and each plate contained duplicate wells for interassay variance and a

blank. Individual hormones were all run with plates from the same kit lot # and were completed










in the same testing session to reduce testing variance. Sample plates were analyzed using a

microplate reader (BioRad, Hercules, CA). Intra-assay and interassay variances, respectively,

were as follows: estradiol, 3.5% and 7.0%; cortisol, 2.0% and 9.1%; testosterone, 3.7% and

12.8%; 11-KT, 4.9% and 11.9%.

Plasma samples for glucose concentration determination were thawed on ice and

evaluated according to the instructions provided with the commercial glucose oxidase assay kit

(Invitrogen, Amplex@ Red, Eugene OR). The sample plate was analyzed using a microplate

reader (BioRad, Hercules, CA).

Statistical Analyses

Statistical analyses were performed using StatView for Windows (SAS Institute, Cary,

NC, USA). Initial comparisons were made to determine if there was a significant tank effect

within treatments. F-tests were conducted to test variances among treatment groups for

homogeneity. If variance was heterogenous, data were loglo transformed to achieve

homogeneity of variance; however, all reported means (+ 1 SE) are from nontransformed data.

Analyses of variance (ANOVA) of weight, length and hormone concentration was used to

compare differences among treatment groups. If significance was determined (P < 0.05),

Fisher' s protected least-significant difference was used to determine differences among treatment

means.

Results

Morphology and Chemistry

The average fish weights in this experiment ranged from 4.13 to 4.55 kg, and the average

fish length ranged from 88.8 to 92.2 cm. Neither weight nor length was significantly different

among treatments, and there was no significant tank effect for any tested parameter. Water









chemistry parameters were tested on the day of the experiment and were as follows: un-ionized

ammonia (NH3), < 4.55 Clg/1; nitrite, < 0.2 mg/L; pH, 7.5; alkalinity, 200 mg/L; chloride

concentration, 85 mg/L; total hardness, 230 mg/L; and calcium hardness, 130 mg/L. Dissolved

oxygen concentrations were maintained at > 95% saturation throughout the trial and the

temperature was 240C.

Hormones

The 0-h plasma cortisol concentrations for treatments 1 and 2 averaged 6.65 f 3.58 and

4.63 f 1.02 ng/ml, respectively (Fig. 3-2A), and were statistically similar. The 0-h plasma

glucose concentrations were statistically similar and averaged 2. 13 f 0. 12 and 2.21 f 0. 11

mmol/L for treatments 1 and 2, respectively (Fig. 3-2B). The plasma concentrations of T, 1 1-

KT, and E2 WeTO Statistically similar at 0-h for treatments 1 and 2 and averaged 25.53 f 2.9, and

10.2 f 0.8 ng/ml and 672.4 f 45.9 pg/ml, respectively.

Plasma cortisol concentrations increased significantly (P < 0.05) in the Siberian sturgeon

from 0-h to the 1-h sampling period averaging 70.9 f 18.7 ng/ml at 1-h, and were not

significantly different between treatments 2 and 3 (Fig. 3-2A). Plasma glucose concentrations

increased significantly from 0-h to the 1-h sampling period and averaged 4.67 f 0.40 mmol/L at

1-h, and there were no significant differences among treatments 2 and 3 (Fig. 3-2B). At 4-h,

plasma cortisol concentrations were similar for Hish in treatments 2 (46.2 f 15.4 ng/ml) and 3

(36.27 f 14.0 ng/ml), but were significantly elevated compared with those observed for fish in

the treatment 4 group (10.44 f 2.53 pg/ml) (Fig. 3-2A). Plasma glucose concentrations at the 4-h

sampling period were similar for treatment 2 (4.70 f 0.27 mmol/L) and treatment 4 (4.14 f 0.38










mmol/L), but were significantly lower than plasma glucose concentration in treatment 3 (5.65 f

0.41 mmol/L) (Fig. 3-2B).

The evaluation of treatment 2, in which the same group of Eish at 0-h, 1-h and 4-h were

sampled, demonstrated that plasma T concentrations increased significantly from time 0 to 1-h

(20.3 f 1.76 and 31.45 f 4. 19 ng/ml respectively), with a subsequent decrease at 4-h to a

concentration similar to that observed at 0-h (Fig. 3-3A). In the same fish, we observed no

differences between bleeding times for E2 Or 11-KT (Fig. 3-3 B,C).

Discussion

The Siberian sturgeon that were exposed to capture and confinement stress exhibited

significantly elevated plasma cortisol concentrations 1-h after the initiation of stress, which

persisted throughout the 4-h sampling period. This response is similar to the reactions of other

fish species exposed to acute stressors (Thomas et. al., 1990). Cortisol and glucose have been

shown to be more sensitive to stress than most other plasma constituents except catecholamines,

and respond rapidly to a wide range of environmental stressors. Stress in Hish and the

concomitant increase in cortisol have been implicated in numerous physiological conditions

including impaired immune function (Tort et al., 1996), altered feeding behavior (Kentouri et al.,

1994), oxygen radical production (Ruane et al., 2002), and reproductive impairment (Pankhurst

and Van Der Kraak, 1997). Responses to stress are largely dependent on the severity and type of

environmental stressor. Previous studies with Siberian sturgeon exposed to acute and severe

hypoxia have shown significantly elevated plasma cortisol concentrations, with a peak

concentration of 35,000 pg/ml (Maxime et al., 1995). The basal cortisol concentration in that

study was approximately 5000 pg/ml, which is comparable to the basal cortisol concentration

obtained in this study. However, the peak concentration of cortisol in our study increased to









nearly 75,000 pg/ml, demonstrating the plasticity of the physiological stress response in this

species. In some species, plasma cortisol concentrations can persist for days if the stressor is

chronic or severe (Sumpter, 1997).

This study is distinct from other studies in several regards. This is the first study to

define the relationship between stress and potential reproductive function, as indicated by the

plasma concentrations of various sex steroids, in Caspian Sea sturgeon, habituated to a warm

environment and reared under commercial culture conditions from the egg stage. This is also the

first study to show the endocrine effects of surgical sexing, a procedure often necessary for

sturgeon and other species that do not exhibit sexually dimorphic characteristics. The induced

stressors in this study, caused by capture and confinement, bleeding, and surgical sexing are

common stressors in a laboratory or fishery environment, and it is important to understand what

effects these stressors can have on mitigating experimental responses.

In this experiment, fish underwent capture and confinement stress, with multiple

disturbances at 1-h and 4-h. It has been shown that serial stressors evoke cumulative

physiological stress responses in other fish species (Waring et al., 1997; Di Marco et al., 1999)

and multiple stress events cause fish to be more sensitive to additional acute stress (Ruane et al.,

2002). The multiple disturbances in this study likely mitigated the expected decreases in plasma

cortisol concentrations after 4-h, because in treatment 4, where fish were captured but not bled

until the fourth hour of capture, fish exhibited lower plasma cortisol concentrations than fish in

treatment 2 or 3. These lower concentrations could result from a more rapid return toward basal

concentrations, due to the lack of repeated stressors, or a reduced stress effect as they were not

bled initially, adding additional handling and blood loss to the stress. Our data indicate that

serial bleedings intensify the associated stress response, as evidenced by significantly lower









concentrations ofF in fish in which a blood sample was not drawn at 0-h or 1-h. This is an

important consideration for future studies of this species involving multiple blood samples.

Whether elevations in cortisol concentration for the serially bled fish are due to blood volume

loss or its associated stressors such as pricking of the fish with a needle, or longer handling times

to ensure that a fish is still for actual blood drawing versus sham drawing, is uncertain. It is

likely, however, that it is a combination of events, and not solely blood loss that leads to elevated

stress in serially bled fish. Note that surgical sexing, an invasive procedure that is often

necessary in aquaculture or fishery practice, did not induce a prolonged stress reaction, because

fish in treatment 4, which were similarly sexed at 0-h, exhibited plasma cortisol concentrations

similar to basal concentrations less than 4-h after the procedure.

The 0-h blood sampling period was started in the morning and the experiment was

concluded in the early afternoon. Cortisol concentrations in sturgeon (Belanger et al., 2001;

Lankford et al., 2003) and other animals (Young et al., 2004) have been shown to be highly

sensitive to diurnal variation, so care was taken in this study to ensure that all samples were

collected within a relatively short period to reduce the possibility of daily hormone fluctuations

as confounding variables. In addition to the concentrations of sex steroids, it has been shown

that plasma cortisol concentration can be altered depending on the reproductive stage in sturgeon

(Barannikova et al., 2000) and other species (Pickering and Pottinger, 1985). The female

sturgeon in this study were 3 years old, and although all female sturgeon had formed clearly

visible ovigerous lamellae or ovarian folds, none of them exhibited vitellogenic oocytes, and

they appeared to be in a similar reproductive stage. However, the plasma concentrations of sex

steroids in this study were similar to those of fish possessing fully vitellogenic oocytes in

subsequent studies.









Interestingly, the concentrations of sex steroids evaluated in this study did not demonstrate

an inverse relationship with stress as defined by plasma cortisol concentrations; in fact, plasma T

concentration was significantly elevated during periods of peak plasma cortisol concentration

(Fig. 3-3A). Although there have been no studies of this kind, in which stress and reproductive

function in Siberian sturgeon reared in commercial culture conditions are evaluated, this

response is distinct from that in published data with other fish species, including other sturgeon

species. Of the reproductive hormones, testosterone has been shown to be highly responsive to

stress-induced alterations in sturgeons and other species (Pickering et al., 1987; Bayunova et al.,

2002). Plasma E2 and 11-KT concentrations were not significantly affected by stress within the

timeframe of this study. In American alligators, certain environmental toxicants were found to

increase plasma T concentrations in juveniles, but did not affect the plasma concentrations of

other circulating hormones (Milnes et al., 2004). Our findings do not necessarily indicate,

however, that stress is not detrimental to the reproduction of this species. Circulating

concentrations of sex steroids are only one endpoint in the reproductive endocrine axis, and

stress can manifest itself at many levels of the steroidogenic pathway. For example, sex steroids

are generally removed from circulation via clearance by the liver. Reductions in sex steroid

production would not necessarily be reflected in circulating concentrations if clearance is

concomitantly affected. Other possible mechanisms that would result in the alteration of the

reproductive biology of this species include alterations in hypothalamic-pituitary stimulation or

alterations in transport mechanics (i.e., transport proteins).

Finally, the elevation in plasma T concentrations described here could be due to a technical

problem; that is, although commercial antibodies are screened for cross reactivity and specificity

to a wide range of steroids, little is known about the steroid milieu released during stress in










sturgeon. Although unlikely, it is possible that a unique androgen of adrenal origin is released

during stress in this species that cross reacts with the antibody used in the testosterone but not in

the 11-KT kits. Studies using advanced analytical chemistry could determine the steroids

released from stressed Siberian sturgeon. The data presented here indicate that the

concentrations of sex steroids in Siberian sturgeon do not show an inverse relationship with

elevated plasma cortisol concentration following acute stress, as has been observed for most fish.

This altered response needs further study, as this study differed from previous studies of sturgeon

in that it coupled sturgeon habituated to warm temperature with a specific stress response. This

is the first study to define the relationship between stress and endocrine function in cultured

Siberian sturgeon, a threatened and commercially important species. Future studies need to

address various aspects of the aquaculture environment (e.g., temperature and water quality),

reproductive stage (e.g., juvenile versus adult) and seasonality to determine which variables

modify the stress response and thus potentially alter growth and reproductive potential. This

work will also serve as a baseline to evaluate the effects of material water quality hazards, such

as nitrate, present in both natural and constructed environments.














~ Treatment 1


Treatment 2

Treatment 3

Treatment 4


To T1-h


Figure 3-1. Blood sampling times for Treatments 1 to 4 of fish held under confinement stress for
4 hours. Six female Siberian sturgeon were used for each treatment.











100-
A. 90bb

80
70 b
S 60
50
40
O 30
20 aa

10 -

0-hr 1-hr 4-hr
B.



bb b
5b




3 a a






0-hr 1-hr 4-hr

Blood sampling time



Figure 3-2. Plasma cortisol (A) and plasma glucose (B) concentrations (mean + S.E.M.) during a
4-h capture and confinement period. Means with the same superscript are not
significantly different (P > 0.05).














40b
S35
S30
25
S20
59 15



0-hr 1-hr 4-hr

B.

14
S12
10





0
n 0-hr 1-hr 4-hr

C.
900
800
700
~~600




100

0-hr 1-hr 4-hr

Blood sampling time


Figure. 3-3. Sex steroid data for treatment 2. Plasma 17P-Estradiol (A), testosterone (B), and
11l-ketotestosterone (C) taken from serial bleeds of cultured female Siberian sturgeon
throughout the 4-h period of confinement stress (mean + 1 S.E.M.). Fish were
serially bled at 0-h, 1-h and 4-h (see Fig. 3-1 legend for a description of treatment 2
bleeding times). Means with the same superscript or no superscript are not
significantly different (P > 0.05).









CHAPTER 4
NITRATE AS AN ENDOCRINE DISRUPTING CONTAMINANT IN CAPTIVE SIBERIAN
STURGEON

Introduction

The endocrine disrupting actions of various chemical contaminants have become a

significant concern for comparative endocrinologists (Colborn et al., 1993; Guillette and Crain,

2000). A growing literature describes the effects of endocrine disrupting contaminants (EDCs)

for both terrestrial (Iguchi and Sato, 2000) and aquatic (Sumpter, 2005; Milnes et al., 2006)

species. These effects include altered reproductive morphology, endocrine physiology and

behavior, and involves such endpoints as reduced phallus size, decreased sperm count, depressed

reproductive behaviors and altered circulating concentrations of sex steroids (e.g., Guillette et al.,

1999; Orlando et al., 2002; Toft and Guillette, 2005). EDCs exert their effects by mimicking

hormones, acting as hormone antagonists, altering the function or concentration of serum-

binding proteins, or altering the synthesis or degradation of hormones. Aquatic organisms can

receive continuous exposure to environmental contaminants throughout their lives, as the aquatic

environment receives most of the intentionally released environmental pollutants. Thus, the

effects of EDC exposure on aquatic life have received considerable attention (Kime, 1999;

McMaster, 2001; Sumpter, 2005; Milnes et al., 2006).

Although nitrate is a ubiquitous component of aquatic environments, and has become a

global pollutant in a variety of aquatic systems (Sampat, 2000), it has only recently begun to

receive attention for its ability to alter endocrine function (Guillette and Edwards, 2005). The

toxicological effects of nitrate have long been known. As early as 1945, nitrate induced

methemoglobinemia (Blue Baby Syndrome) in humans was associated with drinking well water

contaminated with nitrate (Comly, 1945). Fish are also vulnerable to methemoglobinemia

(Brown Blood Disease), and in Siberian sturgeon methemoglobinemia has been associated with a










significant chloride imbalance (Gisbert et al., 2004). Toxicity studies with fish (LCso) have

shown lethal concentrations of nitrate to range an order of magnitude or more (Brownell, 1980;

Pierce et al., 1993; Hamlin, 2006), demonstrating significant plasticity in response to elevated

nitrate among fish species.

Sublethal effects of nitrate include endocrine alterations which have been shown to alter

metabolism, reproductive function and development. Frogs (Rana ca~scadae) exposed to 3.5

mg/L nitrate-N metamorphosed more slowly, and emerged from the water in a less developed

state than control animals (Marco and Blaustein, 1999). Rodents exposed to nitrate (50 mg/L

NaNO3) in their drinking water had significantly lower circulating testosterone (T)

concentrations than control animals (Panesar and Chan, 2000). Bulls given oral administration

of nitrate (100 250 g/day/animal) showed reduced sperm motility, depressed Leydig cell

function, and degenerative lesions in the germ layers of the testes (Zraly et al., 1997). Studies in

Southern toad tadpoles showed nitrate induced alterations in growth and thyroxine

concentrations were mitigated by the source of culture water used, indicating that environmental

context plays a significant role in mitigating the effects of nitrate (Edwards et al., 2006a).

Mosquitofish (Gamnbusia holbrooki) experienced significant reproductive alterations, such as

reduced gonopodium length and fecundity (number of females per unit of female size), in nitrate

concentrations as low as 5 mg/L NO3-N (Toft et al., 2004; Edwards et al., 2006b). Proposed

mechanisms for nitrate induced steroidogenic disturbances include mitochondrial conversion to

nitric oxide (NO), altered chloride ion concentrations and altered enzymatic action by binding to

the heme region of P450 enzymes associated with steroidogenesis (Guillette and Edwards, 2005).

Stress effects on reproduction can be manifest at various levels of the reproductive

endocrine axis, and stress has been shown to have inhibitory effects on reproduction for most










aquatic species studied to date (Pickering et al., 1987; Carragher and Sumpter, 1990; Pankhurst

and Van Der Kraak, 1997; Consten et al., 2002). For many species of fish, including sturgeon

and other chondrosteans, cortisol is the primary stress hormone (Idler and Sangalang, 1970;

Barton et al., 1998) and cortisol has been implicated in mediating the inhibitory reproductive

effects induced by stress (Pankhurst and Van Der Kraak, 1997; Semenkova et al., 1999;

Bayunova et al., 2002). There is evidence in teleosts, however, that the estrogenic inhibitory

effects of stress are not mediated by cortisol and that the effects arise higher in the reproductive

endocrine pathway (Pankhurst et al., 1995). Tilapia (Oreochromis mossamnbicus) fed pellets

containing cortisol to achieve plasma cortisol concentrations typical of acutely stress fish,

resulted in decreased plasma concentrations of T and 17P-estradiol (E2), reduced oocyte diameter

and gonad size in females, and reduced plasma T concentrations in males (Foo and Lam,

1993a,b). Female brown trout (Salmo trutta) exposed to 2 weeks of confinement stress had

significantly reduced plasma T concentrations compared to unstressed fish (Campbell et al.,

1994). Plasma glucose concentrations have also been shown to be reliable indicators of

secondary stress responses. An animal under chronic stress can demonstrate a reduced capacity

to handle subsequent stress events, and studies have shown responses of fish to multiple stressors

are cumulative (Barton et al., 1986). Fish residing in laboratories or fish farms are often

subj ected to chronic stress (sub-optimal water chemistry, crowding, confinement) followed by

acute stress events (sampling, netting), which can lead to dramatic and prolonged stress

responses (Rotllant and Tort, 1997; Heugens et al., 2001).

Sturgeon are among the most ancient groups of Osteichthyes, and twenty-five extant

species occupy the Northern Hemisphere (Birstein, 1993). The dramatic decline in sturgeon

populations due to overfishing, pollution, and habitat degradation have led to the necessity of









commercial aquaculture as a means to provide animals for stock enhancement, as well as food

production, reducing pressures on wild populations (Beamesderfer and Farr, 1997; Waldman and

Wirgin, 1997; Williot et al., 2002; Chebanov et al., 2002). The Siberian sturgeon is one of the

leading species of sturgeon adapted to aquaculture (reviewed by Gisbert and Williot, 2002). It

was recently discovered that Siberian sturgeon are more sensitive to nitrate toxicosis than most

fish species reported to date (Hamlin, 2006). Further, Siberian sturgeon juveniles become less

tolerant to nitrate as they grow, a finding of considerable importance for the commercial culture

of this species, since adult populations reared in recirculation systems often experience higher

nitrate concentrations than their juvenile counterparts. Although understanding what

concentrations of nitrate are necessary to avert mortality is generally understood in commercial

aquaculture, mortality is not an effective endpoint for producers interested in optimizing growth

and reproductive function. Understanding nitrate's effects on reproductive function is especially

critical to sturgeon, whose economic viability relies heavily on proper endocrine function,

notably the production of eggs (caviar).

The purpose of this study is to begin to determine the potential effects of elevated

environmental nitrate on endocrine function, and investigate whether elevated nitrate alters the

stress response in captive female Siberian sturgeon.

Methods

Fish and Sampling Procedures

Siberian sturgeon were collected from four 30,000 liter tanks, from separate commercial

recirculating aquaculture systems at Mote Marine Laboratory's Aquaculture Park (Commercial

Sturgeon Demonstration Project) in Sarasota, FL. Water chemistry in each of these systems was

analyzed weekly for ammonia, nitrite, nitrate, and pH prior to commencement of the

experiments. Dissolved oxygen and temperature were monitored continuously with stationary










probes, which were spot-checked bi-weekly for calibration with portable probes. Hardness,

alkalinity and chloride were analyzed the day prior to commencement of the experiment.

The sturgeon were pulled by hand at the side of the tank and immediately held down on a

padded V-shaped surgical table. Pulling the fish from the tank by hand (versus netting)

decreased the likelihood of stressing Eish remaining in the tank and allowed for more immediate

access to the fish for blood sampling. Blood was extracted from the caudal vein (5 ml) with a 10

ml syringe (20 gauge needle) within 1 minute of capture; most captures took 30 seconds for the

full sample to be drawn. The blood was placed into lithium heparin VacutainerTM tubes, and

stored on ice for no more than 30 minutes before centrifugation. The plasma was separated via

centrifugation (5 10 min at 2000 g), transferred to cryovials, flash frozen in liquid nitrogen and

stored at -800 C for 1 3 weeks prior to analysis.

Surgical Sexing

For surgical sexing, the fish were anesthetized in a 5 80 C water bath containing carbon

dioxide (CO2) gaS; CO2 WAS used because it is a low regulatory priority anesthetic for fish that

are grown for food production and requires no withdrawal period; the sturgeon used in this study

were part of a commercial food production program. Pure oxygen gas administered through a

fine air stone was used to maintain a dissolved oxygen concentration of 9.0 13.0 mg/L, and

sodium bicarbonate was added to maintain a pH of 6.8 7.6 in the bath throughout the procedure.

Fish generally took 3 5 minutes for full anesthetization. A 2.5 3.5 cm incision was made on

the ventral side of the fish, approximately 8 cm anterior to the vent, along the median axis to

allow inspection of the gonads on either side of the fish for sex determination. The fish was

sutured closed with coated vicryl absorbable suture (Ethicon Inc., Somerville, New Jersey).












Experiment 1

Experiment 1 was conducted in July of 2004 and consisted of two treatments, which

sampled fish from each of four commercial culture tanks (30,000 1 each) located in separate

recirculating systems at Mote Marine Laboratory' s Aquaculture Park. Two of the culture tanks

were held at a nitrate concentration of 11.5 mg/L nitrate-N (50 mg/L total nitrate) for one month,

and the other two tanks were held at 57 mg/L nitrate-N (250 mg/L total nitrate) for the same time

period (two replicates each). Nitrate concentrations were achieved by adjusting the freshwater

input to each system, typical of commercial culture practices. Prior to the 1-month exposure,

nitrate concentrations in the four study tanks oscillated between 20 60 mg/L nitrate-N routinely.

A nitrate concentration of 57 mg/L nitrate-N was chosen as the upper limit in this study, as this is

the maximum concentration deemed safe, defined by feeding behavior and mortality, at Mote' s

Commercial Sturgeon Demonstration Project. The lower concentration of 11.5 mg/L nitrate-N~

was chosen as this was considered extremely safe, yet realistically achievable under normal

aquaculture practices. Although these concentrations may be typical of commercial recirculating

aquaculture facilities, these levels are elevated relative to environmental levels or approved

drinking water limits of 10 mg/L nitrate-N (U.S EPA, 1996).

Treatment 1 sampled 15 Eish from each of the four commercial recirculating culture tanks

(two tanks/nitrate concentration; N = 30 per nitrate treatment). Each Hish was sampled at time 0

and was surgically sexed immediately after the blood sample was drawn. Only blood samples

from female fish were used in the analyses for this study. Each Hish was weighed and placed

into a holding tank until treatment 2 Eish were removed, to avoid stressing fish remaining in the

tank.









Treatment 2 sampled 18 Eish from each of the four commercial recirculating culture tanks

(N = 36 per nitrate treatment). Fish were sampled at time 0, and were then placed into square

0.64 m3 inSulated plastic totes (one tote per nitrate concentration) Eilled with 530 L of system

water for a 6-h period of confinement stress. A numbered tag (DuffexTM, St. Paul, MN) was

placed on the pectoral fin of each Hish for identification. Fish were bled at 1 and 6 h during the

confinement period (Fig. 4-1). After the 6-h sampling period, the fish were surgically sexed as

previously described.

Experiment 2

Experiment 2 was conducted in May of 2005 and was procedurally identical to

experiment 1 with the following exceptions. Two of the culture tanks were held at a nitrate

concentration of 1.5 mg/L nitrate-N (6.5 mg/L total nitrate) for one month, and two tanks were

held at 57 mg/L (250 mg/L total nitrate) for the same time period. It should be noted that

although the same tanks and population (different individuals) of animals was used in this second

experiment, the tanks that previously held the low nitrate concentrations in experiment 1, now

held the elevated nitrate concentration and vice versa, to reduce the possibility of tank affect

among treatment groups. The exposure in the first experiment should not affect the fish in either

nitrate group in the second experiment, since nitrate concentrations typically oscillate in the

range of the upper limit (57 mg/L nitrate-N) and the lower limit (1 1.5 mg/L nitrate-N) routinely

in recirculating aquaculture settings, including our facility. Although 11.5 mg/L nitrate-N is

considered low in commercial aquaculture, this concentration exceeds that which would occur in

unpolluted natural environments. Therefore 1.5 mg/L nitrate-N was chosen in this experiment as

it would be more reflective of ecologically relevant exposures. Treatment 1 sampled 15 fish

from each of the four commercial recirculating culture tanks (N = 30 per nitrate treatment) and

treatment 2 sampled 25 fish from each of the four tanks (N = 50 per nitrate treatment).









Hormone Evaluations

Plasma samples were thawed on ice, and the steroid fraction was extracted twice with

diethyl ether. Plasma cortisol (F), E2 (experiment 1), T and 11-KT were analyzed according to

instructions provided with the commercial competitive enzyme immunoassay kits (Cayman

Chemical, Ann Arbor, MI), specific to each hormone. Each hormone was previously validated

for Siberian sturgeon by verifying that serial dilutions were parallel to the standard curve.

Samples were run in duplicate and each plate contained duplicate wells for interassay variance

and a blank. Individual hormones were all run with plates from the same kit lot number and

were completed in the same testing session to reduce testing variance. Sample plates were

analyzed with a plate reader (BioRadTM, Hercules CA). Glucose was evaluated with an

AmplexTM Red glucose/glucose oxidation kit (InvitrogenTM, CaTISbad, CA).

Radioimmunoassays for E2 (validated for Siberian sturgeon) in experiment 2 were

conducted as described previously by this lab (Milnes et al., 2004). Briefly, extracted samples

were reconstituted in Borate Buffer (50 ul, 0.05 M, pH 8.0). Antibody (Endocrine Sciences,

Tarazana, CA, USA) and radiolabeled steroid (2, 4,6,7, 16,17-3H) were added at 12,000 cpm per

100 C1l. Interassay variance tubes were similarly prepared from pooled Siberian sturgeon plasma.

Standards were prepared in duplicate at 0, 1.56, 3.13, 6.25, 12.5, 25, 50, 100, 200, 400 and 800

pg per tube. Assay tubes were incubated at 40C overnight. Bound free separation was

performed by adding charcoal and centrifuging for 30-min. The supernatant was then drawn off

and diluted with scintillation cocktail and counted on a Beckman LS 5801 scintillation counter.










Statistical Analyses

Statistical analyses were performed using StatView for Windows (SAS Institute, Cary,

NC, USA). Initial comparisons were made to determine significance within treatments. F-tests

were conducted to test variances among treatment groups for homogeneity. If variance was

heterogenous, data were loglo transformed to achieve homogeneity of variance, however, all

reported mean (f 1 SE) values are from non-transformed data. Analyses of variance (ANOVA)

of weights and hormone concentrations were used to compare differences among treatment

groups. If significance was determined (p < 0.05), Fisher' s protected least-signifieant difference

was used to determine differences among treatment means.

Results

Experiment 1

In treatment 1, of the 30 fish sampled and sexed in each nitrate concentration, 19 were

females in the 11.5 mg/L nitrate-N group, and 18 were females in the 57 mg/L nitrate-N group.

Of the 36 Eish sampled and sexed in each nitrate concentration for treatment 2, 16 were females

in the low nitrate group, whereas 13 were females in the high nitrate group. The average weight

for females in treatment 1 was 4.16 f 0.53 kg whereas females sampled in treatment 2 was 4.29

f 0.36 kg. There were no significant differences among the tanks within each nitrate group for

any tested parameter.

Water chemistry parameters were tested the day of experimentation and were as follows:

unionized ammonia (NH3) < 4.35 Clg/L, nitrite <; 0. 15 mg/L; pH 7.4, alkalinity 230 mg/L,

chloride 94 mg/L, total hardness 240 mg/L and calcium hardness 140 mg/L. Dissolved oxygen

concentrations were maintained at > 95% saturation throughout the trial and temperature was

23.3 oC.









Time 0 females in treatment 1 were combined with time 0 females from treatment 2 to

evaluate the effects of nitrate exposure for each experiment. Fig. 4-2 and 4-3 illustrates time 0

data for each hormone for experiment 1. Initial concentrations of plasma F or glucose were not

different between females in the 11.5 and the 57 mg/L nitrate-N groups, averaging 5.95 f 1.08

ng/ml and 255.9 f 6.8 pg/ml respectively. Plasma T, 11-KT and E2 COncentrations were

significantly elevated in the 57 mg/L nitrate-N group when compared to concentrations observed

in females exposed to 11.5 mg/L nitrate-N (p < 0.05).

Data for plasma F and glucose concentrations in treatment 2 are shown in Fig. 4-4. There

was no significant difference in the stress response, defined by plasma F concentrations, when

the females exposed to the two nitrate concentrations were compared. The females in both the

11.5 mg/L and 57 mg/L nitrate-N concentration groups demonstrated a dramatic increase in

plasma F concentrations at the 1-h sampling period averaging 42.0 f 5.7 ng/ml, followed by a

significant decrease at the 6-h sampling period. The 6-h plasma F concentrations were still

significantly elevated when compared to time 0 concentrations (11.5 f 1.7 ng/ml). Plasma

glucose concentrations were similar for both nitrate groups at time 0 and 1-h, averaging 227.5 f

12.2 pg/ml at time 0, and rising significantly to an average of 428 f 17.5 pg/ml by 1-h. The 1 1.5

mg/L nitrate-N concentration group females demonstrated a significant increase in plasma

glucose from time 1-h to 6-h (517.6 f 19 pg/ml at 6-h), whereas the 57 mg/L nitrate-N

concentration group females exhibited no increase in plasma glucose between the 1-h and 6-h

sampling period (427.9 f 25.1 pg/ml). During the six hour captive stress period, we observed no

significant changes in plasma T, 11-KT or E2 COncentrations with plasma concentrations within

each respective nitrate concentration averaging 10.9 f 0.8 ng/ml, 4.4 f 0.4 ng/ml and 784 f 16.6

pg/ml respectively.










Experiment 2

In treatment 1, of the 30 fish sampled and sexed in each nitrate concentration, 14 were

females in the 1.5 mg/L nitrate-N group, and 12 were females in the 57 mg/L nitrate-N group.

Of the 50 fish sampled and sexed in each nitrate concentration for treatment 2, 22 were females

in the 1.5 mg/L nitrate-N group, and 24 were females in the 57 mg/L nitrate-N group. The

average weight for females in treatment 1 was 5.84 f 0.89 kg and the average weight for females

sampled in treatment two was 6.14 f 1.10 kg. There were no significant differences among the

tanks within each nitrate group for any tested water parameter.

Water chemistry parameters were tested the day of experimentation and were as follows:

unionized ammonia (NH3) < 5.35 Clg/L, nitrite <; 0.20 mg/L; pH 7.6, alkalinity 240 mg/L,

chloride 90 mg/L, total hardness 240 mg/L and calcium hardness 135 mg/L. Dissolved oxygen

concentrations were maintained at > 95% saturation throughout the trial and temperature was

23.5 oC.

Time 0 females in treatment 1 were combined with time 0 females from treatment 2 to

evaluate the effects of nitrate exposure for each experiment. Fig. 4-5 and 4-6 illustrates time 0

data for each hormone for experiment 2. Plasma F concentrations were not significantly

different among females when the 1.5 mg/L or the 57 mg/L nitrate-N groups were compared at

time 0. Plasma T concentrations were significantly elevated in the 57 mg/L nitrate-N

concentration group (p = 0.010), with an average of 17.28 f 4.57 ng/ml for the 1.5 mg/L nitrate-

N group, and 31.17 f 4.57 for the 57 mg/L nitrate-N group. Plasma 11-KT concentrations were

not significantly different for either nitrate group at time 0 (p = 0.091) with an average of 8.5 f

2.1 ng/ml for the 1.5 mg/L nitrate-N group, and 13.3 f 2.9 ng/ml for the 57 mg/L nitrate-N

group.









Data for treatment 2 is shown in Fig. 4-7. There was no significant difference in plasma F

concentrations between nitrate groups. Initial plasma F concentrations averaged 6.9 f 1.1 ng/ml,

rose to an average of 68.1 f 6.2 ng/ml at the 1-h sampling period and dropped to an average of

26.8 f 2.6 ng/ml by 6-h. Plasma F concentrations were significantly different for each sampling

period. There was no significant difference in stress response for plasma T or 11-KT for

treatment 2 with plasma concentrations averaging 26.4 f 1.9 ng/ml and 11.7 f 1.4 ng/ml

respectively, across all sampling periods.

Discussion

Absent from most investigations assessing the endocrine disrupting effects of

environmental pollutants on aquatic inhabitants, have been studies examining the effects of ions,

such as nitrate and nitrite, which are ubiquitous components of most aquatic ecosystems.

Anthropogenic activities have dramatically impacted the amount of nitrogenous compounds

entering freshwater systems, and recent reports have identified agricultural non-point source

pollution, often caused by nitrate laden fertilizers, as the leading cause of water quality

deterioration to freshwater systems (Sampat, 2000).

This paper describes the effects of a chronic 30 day exposure of Siberian sturgeon to

elevated nitrate on circulating concentrations of plasma glucocorticoids (F and glucose) and sex

steroids (T, 11-KT, and E2). Results of the first experiment, in which animals were exposed to

concentrations of 11.5 and 57 mg/L nitrate-N (50 mg/L and 250 mg/L total nitrate respectively),

revealed significantly elevated concentrations of plasma T, 1 1-KT and E2 in animalS exposed to

the higher nitrate concentration. Experiment 2, which evaluated the effects of animals exposed

to 1.5 and 57 mg/L nitrate-N (6.6 and 250 mg/L total nitrate respectively), also demonstrated an

elevated concentration of plasma T and E2 in animalS exposed to the higher nitrate concentration.









Although the results of Experiment 2 did not demonstrate a significant elevation in plasma 1 1-

KT concentration (p = 0.09) as shown in Experiment 1 (p = 0.05), it should be noted that the

second experiment was conducted at a slightly different time of the year, and in animals which

were almost 1-yr older. Seasonal variation and stage of reproductive development can have

significant impacts on steroid profiles of most fish species (Stacey et al., 1984).

This is the first study to demonstrate a nitrate-induced elevation in concentrations of

plasma sex steroids, using a Caspian Sea sturgeon species habituated to a warm environment,

typical of commercial culture. Since small-scale trials do not always reflect the scale-up

challenges of commercial culture environments, or mimic similar effects on physiologic

response, this experiment is unique in that it was conducted at a commercial farm under typical

culture conditions. This study is also distinct in that it used naturally occurring nitrate produced

by nitrification, to achieve desired nitrate concentrations, versus altering the nitrate environment

by chemical addition (e.g. sodium nitrate).

It has been proposed that nitrates and nitrites disrupt endocrine function by entering

steroidogenic tissues, where they are metabolized to nitric oxide (NO). NO possesses the ability

to bind to the heme moiety of the cytochrome P450 enzymes, which are present at multiple

locations along the steroidogenic pathway. The mechanism by which nitrate has led to the

elevated concentrations of plasma sex steroids seen in this study is unclear, and more work is

necessary to understand the mechanisms involved. Nitrate induced elevations in plasma

concentrations of sex steroids does not necessarily imply that nitrate is not detrimental to the

reproductive health of this species. Concentrations of circulating plasma sex steroids are only

one endpoint in the reproductive-endocrine axis, and disruptions can occur which will not be

manifest at the level of circulating steroids. I offer three potential explanations for the elevations










in plasma concentrations of sex steroids seen in this study. First, nitrate triggered an up-

regulation of steroidogenic function resulting in increased gonadal synthesis of sex steroids.

Second, nitrate induced alterations to transport proteins hamper transport to the liver and

concomitantly affect clearance. And lastly, elevated nitrate may impair liver function, thereby

reducing its ability to clear these steroids from the blood.

The female fish in this study demonstrated increased plasma concentrations of androgens,

as well as E2. COnsiderable attention in the literature evaluating the effects of endocrine

disrupting contaminants on aquatic animals has been directed at the estrogenic effects of

compounds, because many effects reported in wildlife populations are a consequence of the

feminization of males (Stoker et al., 2003; Sumpter 2005; Milnes et al., 2006). However, a

growing literature recognizes that populations of female fish exposed to environmental

contaminants exhibit masculinized features (Parrott et al., 2004). Toft et al. (2004) found that

female mosquitofish (Gamnbusia holbrooki) exposed to paper mill effluent exhibited

masculinized anal fins, and exhibited lower fecundity (number of embryos per unit of female

size) than reference fish. 17P-trenbolone is an anabolic steroid used to promote growth in beef

cattle and has shown strong androgenic activity, and is thought to be the cause of reproductive

alterations in fish living downstream from animal feedlot operations (Jegou et al., 2001; Wilson

et al., 2002; Orlando et al., 2002). It is unclear what effects elevated androgens, or estrogens for

that matter, have on Siberian sturgeon reproduction, and this lab is currently investigating the

mechanisms involved.

In aquaculture systems, nitrate has been neglected as a material water quality hazard.

Commercial aquaculture operations have traditionally used large influxes of water to maintain

water chemistry, and it is not uncommon to have water exchanges of 100% or more per day.









Consequently, nitrate has not traditionally been a concern in commercial aquaculture since this

flush rate is sufficient to maintain relatively low nitrate concentrations. Water is rapidly

becoming recognized as a valuable and limited resource, and legislative mandate is becoming

more stringent in its limits of the amount of water which may be consumed or discharged. As

aquaculture attempts to keep pace with global demand, the growing number of aquaculture

operations will be forced to utilize recirculating aquaculture technology, and significantly reduce

the heavy water usage in current practice. Nitrification systems are well understood in

aquaculture, and are decidedly effective at reducing ammonia and nitrite to nitrate (Timmons,

2001). In recirculating aquaculture systems with limited water exchange, nitrate can rise to

concentrations far in excess of those of natural environments, and it is unclear what impact these

concentrations can have on species residing in these environments. Understanding the sublethal

effects of exposure to nitrate is especially critical to sturgeon, whose economic viability relies

heavily on proper egg production and reproductive performance.

Fish are highly sensitive to the chemical influences in their environment, and negative

influences are often reflected in an acute stress response, indicated by elevations in

concentrations of glucocorticoids (Guillette et al., 1997). Stress in fish, and the concomitant

increase in plasma F concentrations, has been implicated in numerous physiological maladies,

including reproductive impairment (Pankhurst and Van Der Kraak, 1997). Stress induced effects

on reproduction include decreased plasma concentrations of sex steroids, depressed vitellogenin

production and decreased gamete quality (Pankhurst and Van Der Kraak, 1997). Although

plasma concentrations of sex steroids were significantly elevated in the groups of fish exposed to

57 mg/L nitrate-N, time 0 plasma F and glucose concentrations were not affected by nitrate









concentration in this study, indicating that the alterations to concentrations of plasma sex steroids

were unlikely to be mediated by glucocorticoid action.

Induced stress in both experiments in this study, caused by confinement and associated

blood sampling stressors, caused a dramatic increase in plasma F concentrations after 1-h, with a

significant decrease by the 6-h sampling period; this response was not influenced by nitrate

concentration in this study. Previous studies with gilthead sea bream (Sparus aurata) have

shown a decreased acute stress response in chronically stressed fish, speculating that the reduced

plasma F response likely resulted from negative feedback of mild but chronically elevated F

caused by the confinement stressor on the hypothalamic-pituitary-interrenal axis (Barton et al.,

2005). Since the initial blood samples (time 0) were taken generally within 30 s of capture, it is

likely initial concentrations of plasma F seen in this study (= 6 ng/ml) are representative of basal

plasma F concentrations of captive sturgeon in our facility. Previous studies with Siberian

sturgeon exposed to severe hypoxic stress, demonstrated peak plasma F concentrations of 35

ng/ml (Maxime et al., 1995). Peak concentrations of plasma F in our study rose to over 40 ng/ml

in one experiment, and nearly 70 ng/ml in the second experiment, demonstrating the plasticity of

physiological response for this species. Nitrate in this study was shown to alter at least one

component of the stress response, defined by plasma glucose concentrations, during a 6-h period

of confinement stress.

In conclusion, elevated nitrate is capable of altering the steroid profiles of cultured female

Siberian sturgeon, and is able to alter the secondary stress response, defined by plasma glucose

concentrations. We also show that responses to nitrate can change over time, and more work is

necessary to uncover the mechanisms involved in steroid alterations seen in this study, as well as

understand the impact these effects may have on reproductive performance.












Y Treatment 1

Treatment 2
To T1-hr T6-hr


Figure 4-1. Blood sampling times for treatments 1 and 2 of fish held under confinement stress for
6-h.













8

6
-
-4
o

-,
05~


11.5 mg/1 57 mg/1


11.5 mg/L 57 mg/L


Figure 4-2. Plasma cortisol (A) and glucose (B) concentrations (mean + 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
11.5 or 57 mg/L nitrate-N (n = 35 and n = 31 respectively). Means with no
superscript are not significantly different (p > 0.05).














14 b 6-b
S12 a5 a




10 a,0
115m / 7 g11 m / 7m /

C.
900B -
800 I
a 700- -y
600 -




0
11.5 mg/1 57 mg/1 15m/ 7m/


Nirt-Ncnenrto


Figur 4-.Pam etseoe() 1kttsoteoe()adetail()cnetain
(ma ... ncutrdfml ieia tren(cpnerbei xoe o
30 0 dy ocnetain f1. r5 gLntaeN( 5adn=3
repcivl) Suesrpsdsgae infcnl ifretvle p<00)










601 b o Time 0
A. b I Time 1-hr
J- 50 m Time 6-hrs
~5 40
.w 30
0 20a
10


11.5 57 mg/L


B.


a 12 bb b
B 10
E8a

o 4
O3 2

11.5 mg/L 57
mm II
Nitrate-N concentration



Figure 4-4. Plasma cortisol (A) and glucose (B) concentrations (mean + 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
11.5 or 57 mg/L nitrate-N (n = 16 and n = 13 respectively). The fish were bled at
time 0, 1-h and 6-h during a 6-h period of confinement stress. Means with the same
superscript are not significantly different (p > 0.05).













10

E 8-

O
.w4

S2-


1.5 mg/1 57 mg/1

B.
7.2
S7.0
0 6.8 -
E~ 6.6
8 6.4
o 6.2
O3 6.0
5.8
1.5 mg/L 57 mg/L

Nitrate-N concentration




Figure 4-5. Plasma cortisol (A), glucose (B) testosterone concentrations (mean + 1 S.E.M.) in
cultured female Siberian sturgeon (Acipenser baeri) exposed for 30 days to
concentrations of 1.5 or 57 mg/L nitrate-N (n = 36 for both nitrate groups). Means
with no superscript are not significantly different (p > 0.05).




















1.5 mg/L 57 mg/L


1.5 mg/L 57 mg/L


600
500
400
300
200
100


1.5 57 mg/L
m es I
Nitrate-N concentration


Figure 4-6. Plasma cortisol testosterone (A), 11-ketotestosterone (B) and estradiol-17P (C)
concentrations (mean + 1 S.E.M.) in cultured female Siberian sturgeon (Acipenser
baeri) exposed for 30 days to concentrations of 1.5 or 57 mg/L nitrate-N (n = 36 for
both nitrate groups). Superscripts designate significantly different values (p < 0.05).










o Time 0
I Time 1-hr
90 b I Time 6-hrs
80 -1 b
70
j~ 60
r 50
S40 c

20 -
10 -
20


1.5 mg/1 57 mg/1


12- c c

10

28



04-




1.5 57
mg/L mg/L

Figure 4-7. Plasma cortisol (A) and glucose (B) concentrations (mean + 1 S.E.M.) in cultured
female Siberian sturgeon (Acipenser baeri) exposed for 30 days to concentrations of
1.5 or 57 mg/L nitrate-N (n = 22 and n = 24 respectively). The Hish were bled at time
0, 1-h and 6-h during a 6-h period of confinement stress. Means with the same
superscript are not significantly different (p > 0.05).










CHAPTER 5
EFFECTS OF NITRATE ON STEROIDOGENIC GENE EXPRESSION IN CAPTIVE
FEMALE SIBERIAN STURGEON

Introduction

Environmental contaminants capable of altering steroidogenic regulation and function are

well documented in the literature for both terrestrial and aquatic inhabitants (Guillette and

Gunderson, 2001; Mills and Chichester, 2005; Sumpter, 2005; Edwards et al., 2006c). These

endocrine disrupting contaminants (EDCs) can exert their effects through numerous

physiological mechanisms including mimicking naturally occurring steroids, altering hormone

synthesis and degradation and interacting directly with steroid receptors (vom Saal et al., 1995;

Rooney and Guillette, 2000). In the latter case, EDCs can either stimulate (Parks et al., 2001) or

inhibit (Kelce et al., 1995) the expression of the target genes for that receptor. The endocrine

system is responsible for numerous physiological processes, and as such, perturbations to this

system have the potential to deleteriously affect reproductive and developmental performance of

the affected organism.

Stress has also been shown to alter endocrine function, and is generally negatively

correlated with concentrations of sex steroids (Pankhurst and Van Der Kraak, 1997; Orlando et

al., 2002). Cortisol, a predominant glucocorticoid, is the most commonly accepted plasma

indicator of the degree to which an animal is stressed and has been associated with inhibitory

effects on reproduction (Pankhurst and Van Der Kraak, 1997). Commonly studied stressors in

fishes include capture and confinement or handling and alterations to various environmental

parameters such as temperature, pH or salinity (Pankhurst and Dedual, 1994). Certain

contaminants, however, have also been shown to increase plasma glucocorticoid concentrations,

further contributing to the suppression of circulating sex steroids (Schreck and Lorz, 1978).









In the United States, the input of nitrogen from terrestrial agriculture has increased 20-

fold in the past 50 years (Pucket, 1995). Aquatic nitrate concentrations of over 100 mg/L have

been reported in some locations (Kross et al., 1993; Rouse et al., 1999), a ten-fold increase over

the U.S. drinking water standards of 10 mg/L NO3-N (EPA, 1996). A growing body of literature

implicates agricultural non-point source pollution as the leading cause of these elevations in

freshwater systems, posing a direct health risk to both humans and wildlife (Sampat, 2000). A

global pollutant of aquatic habitats, the ubiquitous presence of nitrate has only recently begun to

receive attention for its ability to alter endocrine function, and now j oins the list of

environmental contaminants implicated in reproductive dysgenesis (see review by Guillette and

Edwards, 2005). Unlike most environmental endocrine disrupting contaminants, nitrate is

unique in that it exists naturally at low concentrations in the aquatic environment as the

degradative end product of nitrification. Therefore, the physiological disruptive actions of nitrate

stem from its relative concentration, as well as its interactions within the environment in which it

persists (Edwards et al., 2006a).

The seafood trade deficit in the United States is exceeding eight billion dollars annually,

a natural resource deficit second only to oil and natural gas in magnitude. With the oceans at or

exceeding their maximum sustainable yields for 75% of commercially relevant species,

aquaculture, or the culture of fish and other aquatic organisms, has been proposed as the only

viable alternative to keep pace with global demand (FAO, 2004). Like seafood, water is also

becoming a limited and increasingly valuable resource, and the necessary increase in aquaculture

operations will not be afforded the liberal quantities of water permitted to established facilities.

Although recirculating aquaculture facilities, which recycle and reuse a significant

portion of their water, are becoming increasingly common, the limiting factor for water exchange









for most of these facilities is nitrate. Work is ongoing to develop technologies to reduce nitrate

in commercial aquaculture, but it is still unclear what concentrations of nitrate are safe,

especially for sensitive physiological systems such as the endocrine system which have been

shown to be vulnerable to the effects of nitrate (Suzuki et al., 2003; van Rijn et al., 2006).

Sturgeon species are ideally suited to serve as models to study the endocrine disruptive

effects of elevated nitrate exposure. Many species are commercially viable, highly endangered

and have documented sensitivities to environmental contaminants, including nitrate (Akimova

and Ruban, 1995; Dwyer et al., 2005; Hamlin, 2006). The Caspian Sea, which houses some of

the most endangered sturgeon species, is becoming increasingly affected by contaminants

(Birstein, 1993; Stone, 2002) many of which are implicated in the disruption of reproduction in

sturgeon species (Akimova and Ruban, 1995).

It has been proposed that aquaculture, incorporating the development of captive broodstock

programs, could be the best solution to reduce Hishing pressures, facilitating recovery of wild

populations (Williot et al., 2002). The economic viability of sturgeon culture rests squarely with

the successful production of eggs, or caviar, the commercial hallmark of this family of Eishes.

Therefore, environmental contaminants, that have the potential to alter reproductive endpoints

such as egg production, are critical areas of investigation for threatened species whose promise

in aquaculture relies almost entirely on proper egg development.

In many aquatic animals, including most fish, nitrate enters the bloodstream by crossing

the gill epithelia, either by diffusion or against a concentration gradient by substituting for

chloride, and accumulating in extracellular fluid (Lee and Prichard, 1985; Jensen, 1995).

Ingested nitrate is readily absorbed by the proximal small intestine in mammals (Walker, 1996),

or can also be converted to nitrite, although the degree and mechanism of the latter has been a










significant point of debate (Hartman, 1982). Concentrations of excess nitrite can cause the

potentially fatal methemoglobinemia, or brown blood disease in fishes, caused by an inability to

reversibly carry oxygen in the blood (Scott and Crunkilton, 2000). Both nitrate and nitrite are

capable of generating nitric oxide (NO) (Meyer, 1995; Cadenas et al., 2000; Lepore, 2000).

Nitric oxide has been shown to inhibit steroidogenesis through its interactions with steroidogenic

acute regulatory protein (StAR) or the enzyme cytochrome P450 side chain cleavage (P450sec)

(White et al., 1987).

In the mitochondria of steroidogenic cells, free cholesterol, the precursor for

steroidogenesis, is transported across the mitochondrial membrane by StAR. This cholesterol is

then converted to pregnenolone by the P450sce enzyme (Stocco, 1999). Pregnenolone is

subsequently converted to progesterone by mitochondrial 3 P hydroxysteroid dehydrogenase (3 P-

HSD) (Stocco, 1999). Progesterone then exits the mitochondria and depending on the tissue,

will be converted to either mineralcorticoids, glucocorticoids, progestins, androgens or estrogens

in the smooth endoplasmic reticulum (Norris, 1997). Noticeably absent from nitrate studies

describing the mechanisms of altered steroid concentrations, are studies of enzymes and

receptors involved in regulating the earliest stages of steroidogenesis. In fact, the maj ority of

steroidogenic research has focused on enzymes and receptors further downstream from the

conversions of cholesterol to pregnenolone (Goto-Kazeto et al., 2004).

The goal of this study is to examine nitrate-induced alterations in endocrine function and

identify mechanisms through which environmental exposure to nitrate alters steroidogenesis at

the molecular level. These mechanisms will be investigated by comparing the mRNA expression

of a regulatory enzyme functioning at an early stage of steroidogenesis (P450sec) as well as

receptor proteins at the end of the steroidogenic cascade for both sex steroids and










glucocorticoids, estrogen receptor P (ERP) and glucocorticoid receptor (GR), the mRNA

expression patterns of which have not been previously characterized in sturgeon.

Methods

Fish and Experimental Systems

Siberian sturgeon were collected from four 30,000 liter tanks, from separate commercial

recirculating aquaculture systems at Mote Marine Laboratory's Aquaculture Park (Commercial

Sturgeon Demonstration Proj ect) in Sarasota, FL. The fish were 4.5 years old and weighed an

average of 6. 14 + 1.10 kg. Water chemistry in each of these systems was analyzed weekly for

ammonia, nitrite, nitrate, and pH prior to commencement of the experiments. Dissolved oxygen

and temperature were monitored continuously with stationary probes, which were spot-checked

bi-weekly for calibration with portable probes. Hardness, alkalinity and chloride were analyzed

the day prior to commencement of the experiment.

Surgical Sexing and Tissue Collection

The sturgeon were pulled by hand at the side of the tank and immediately held down on a

padded V-shaped surgical table. Pulling the fish from the tank by hand (versus netting)

decreased the likelihood of stressing Eish remaining in the tank and allowed for more immediate

access to the fish for sampling.

For surgical sexing, the fish were anesthetized in a 5 80 C water bath containing carbon

dioxide (CO2) gaS; CO2 WAS used because it is a low regulatory priority anesthetic for Hish that

are grown for food production and requires no withdrawal period; the sturgeon used in this study

were part of a commercial food production program. Pure oxygen gas administered through a

Eine air stone was used to maintain a dissolved oxygen concentration of 9.0 13.0 mg/L, and

sodium bicarbonate was added to maintain a pH of 6.8 7.6 in the bath throughout the procedure.









Fish generally took 3 5 minutes for full anesthetization. A 2.5 3.5 cm incision was made on

the ventral side of the fish, approximately 8 cm anterior to the vent, along the median axis to

allow inspection of the gonads on either side of the fish for sex determination and tissue

collection. A piece of gonad approximately 5 mm3 was removed with a biopsy force (Ethicon

Inc., Somerville, New Jersey), flash frozen in liquid nitrogen and stored at -800C. The fish was

sutured closed with coated vicryl absorbable suture (Ethicon Inc., Somerville, New Jersey).

Treatments and Experimental Conditions

Two treatments were established which sampled fish from each of four commercial

culture tanks (30,000 L each) located in separate recirculating systems at Mote Marine

Laboratory's Aquaculture Park in Sarasota, FL. Two of the culture tanks were held at a nitrate

concentration of 1.5 mg/L nitrate-N (6.5 mg/L total nitrate) for one month, and two tanks were

held at 57 mg/L (250 mg/L total nitrate). Nitrate concentrations were achieved by adjusting the

freshwater input to each system, typical of commercial aquaculture practices. A nitrate

concentration of 57 mg/L nitrate-N was chosen as the upper limit in this study, as this is the

maximum concentration deemed safe, defined by feeding behavior and mortality, at Mote's

Commercial Sturgeon Demonstration Project. The lower concentration of 1.5 mg/L nitrate-N

was chosen because it reflects ecologically relevant exposures. Eight fish were sampled from

each of the four commercial recirculating culture tanks (N = 16 per nitrate treatment).

RNA Isolation and Primer Design

Frozen gonadal tissues were weighed and immediately homogenized in TRIzol reagent

(Invitrogen, Carlsbad, CA) at a ratio of 1 ml TRIzol / 100 mg tissue. Total RNA was isolated by

collecting the aqueous phase of a chloroform/phenol extraction and precipitated in isopropanol.

The pellet was washed in 80% ethanol and then dissolved in DEPC treated water. An SV Total

RNA Isolation System kit (Promega, Madison, WI) was used to purify the samples and perform









a DNase treatment The quality and concentration of the total RNA was determined with

agarose gel electrophoresis and spectrophotometer, respectively. First strand cDNA was

synthesized with 2 Clg total RNA with Oligo (dT)12-18 Primer (Invitrogen) and SuperScript III

RNase H- Reverse Transcriptase.

Degenerate primers for L8 (a ribosomal protein used for normalization of mRNA levels),

glucocorticoid receptor (GR), P450sec, and ERP were designed from conserved regions of the

respective genes from other species. The PCR primers were used to amplify fragments of the

sturgeon cDNA. Amplified cDNA were purified by Wizard SV Gel and PCR Clean-up System

(Promega) and cloned by pGEM-T Vector System (Promega). Cloned plasmids were isolated by

Wizard Plus SV Miniprep DNA Purification System (Promega). We used the BigDye

Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) to sequence the

amplifed fragments which were analyzed with an ABI PRISM 3100. BLAST

(http://www.ncbi .nlm.nih.gov/BLAST/) was used to check for nucleotide and amino acid

homology. Primer Express (Applied Biosystems, Foster City, CA) was used to design the real-

time PCR primers (Table 5-1).

Quantitative Real-Time PCR

Quantitative real-time PCR (Q-PCR) was conduced using SYBR Green PCR Master Mix

using a MyiQ Single Color Real-Time PCR Detection System (Bio-Rad) in a reaction volume of

15C1l following the manufacturer' s protocol as previously described by this lab (Katsu et al.,

2004). Conditions for Q-PCR for all genes were 3 min at 950C and 40 cycles of 950C for 10

seconds and 1 min. at the best annealing temperature for each gene. The best annealing

temperature for P450se was 60.60C, with L8, ERP and GR running at an annealing temperature

of 650C. Starting quantities of cDNA (copies/ml) for each gene were calculated according to









(Yin, 2001), based on optical density and molecular weight values. The expression of mRNA of

the samples was calculated from a standard curve created from a serially diluted sample.

Samples were run in triplicate and were normalized for ribosomal L8 expression.

Sequence Data

The sequence data were analyzed using CLC Free Workbench (CLC Bio A/S, Cambridge,

MA), and homologous sequences of their deduced amino acid sequences were searched by

BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). The amino acid sequences were aligned using

ClustalX (Thompson et al., 1997). Genebank accession numbers for the amino acid sequences of

RPL8 are Q6POV6 (zebrafish), P41116 (X. leaves), XP_416772 (Chicken), P62918 (Mouse) and

P62917 (Human); those of GR are BAE92737 (zebrafish), P49844 (X. laevis), XP_420437

(chicken), NP_032199 (mouse) and PO4150 (human); those of ER-beta are NP_85 1297

(zebrafish), NP_001035101 (X. tropicalis), NP_990125 (chicken), NP_034287 (mouse) and

NP_001428 (human); those ofP450 SCC are XP_691817 (zebrafish), NP_001001756 (chicken),

Q9QZ82 (mouse) and AAH32329 (human). The Conserved Domains in amino acid sequences

were searched by CD-search (http://www.ncbi_ nlm. nih.gov/Structure/cdd/wrpsb .cgi).

Statistical Analyses

Statistical analyses were performed using StatView for Windows (SAS Institute, Cary,

NC, USA). Initial comparisons were made to determine significance within treatments. F-tests

were conducted to test variances among treatment groups for homogeneity. If variance was

heterogenous, data were loglo transformed to achieve homogeneity of variance, however, all

reported mean (+ 1 SE) values are from non-transformed data. The relative expression of each

gene was computed as a ratio with L8 and then multiplied by a consistent multiplier of 10 to

ensure all values were greater than one prior to analyses of variance (ANOVA). Figures,










however, display original values. If significance was determined (p < 0.05). Fisher' s protected

least-significant difference was used to determine differences among treatment means.

Results

Sequence Data

Nucleotide and deduced amino acid sequences of RPL8 (L8), P450sec, ERP and GR are

shown in Figures 5-1 to 5-4. Cloned cDNAs are 309, 584, 698 and 845 base pairs encoding 102,

194, 232 and 281 amino acids, and are similar to L8, GR, ERP and P450sec, respectively (Figs.

5-1 to 5-8). These are partial cDNA sequences and it is 40, 26, 42 and 55% of the length of the

zebrafish coding region for L8, GR, ER-P and P450sec, respectively. Cloned L8 included a

partial conserved domain of ribosomal protein L2 C-terminal domain, and revealed higher than

97% of sequence identity among the vertebrates (Fig. 5-5). Cloned P450sce encoded a part of

conserved region for cytochrome P450s, and revealed 77, 67, 49 and 51% of sequence identity

compared with zebrafish, chicken, mouse and human, respectively (Fig. 5-6).

Partially cloned GR included a complete hinge region, and a partial DNA- and ligand-

binding domain (Fig. 5-7). Sturgeon GR showed 74, 67, 59, 67 and 65% of sequence identity

with GR cloned from zebrafish, Xenopus leavis, chicken, mouse and human, respectively (Fig. 5-

7). Cloned partial cDNA for ERP included a partial hinge region and ligand binding domain,

and revealed 71, 58, 57, 59 and 57% of sequence identity with ERP of zebrafish, Xenopus

tropicalis, chicken, mouse and human, respectively (Fig. 5-8).

Water Chemistry

Water chemistry parameters were tested the day of experimentation and were as follows:

unionized ammonia (NH3) < 5.35 Clg/L, nitrite <; 0.20 mg/L; pH 7.6, alkalinity 240 mg/L,

chloride 90 mg/L, total hardness 240 mg/L and calcium hardness 135 mg/L. Dissolved oxygen










concentrations were maintained at > 95% saturation throughout the trial and temperature was

23.5 oC.

Steroidogenic Gene Expression and Hormone Regressions from Previous Studies

Expression levels, normalized to L8 expression, of all genes evaluated were statistically

similar between the fish residing in the 1.5 or 57 mg/L nitrate-N (Figs. 5-9 to 5-11). As

expected, the expression of L8 was not significant for either treatment. Additionally, there was

no tank effect among treatments. Mean expression levels for P450se were 0.027 (f 0.007) and

0.026 (f 0.006) for the 1.5 and 57 mg/L nitrate-N treatments respectively (Fig. 5-8). Mean

expression levels for GR averaged 0.359 (f 0.056) and 0.341 (f 0.035) for the 1.5 and 57 mg/L

nitrate-N treatments respectively (Fig. 5-9). Mean expression level for ERP was 0.440 (f0. 109)

and 0.583 (f 0. 160) for the 1.5 and 57 mg/L nitrate-N concentrations respectively (Fig. 5-10).

Simple regression analyses of mRNA expression levels (normalized to L8) of P450sec,

ERP and GR, as well as sex steroid and stress hormone plasma concentrations from Chapter 4

are summarized in Tables 5-2 and 5-3 as well as Figs. 5-12 to 5-15. Fish exposed to 1.5 mg/L

NO3-N demonstrated significant regressions (p < 0.05) for the following comparisons: GR vs.

ERP; GR vs. glucose; and T vs. 11-KT. Fish exposed to 57 mg/L NO3-N demonstrated

significant regressions for the following comparisons: ERP vs. P450sec; ERP vs. 11-KT;

P450sce vs. T; P450sce vs. 11-KT.

Discussion

This is the first study to successfully clone and describe the mRNA expression patterns of

sturgeon P450sec, ERP and GR, key constituents in steroidogenic and stress receptor

functioning. These genes represent both early (P450sec) and late (ERP and GR) steroidogenic

endpoints, with their expressions offering insight into several steroidogenic pathways.









In mammals, two ERs have been identified, in contrast to teleosts in which there are three

known ERs, ERa and two isoforms of ERP (Filby and Tyler, 2005). Although both ERa and

ERP are found in the gonads of fish and mammals, there is currently no agreement regarding the

relative importance of one form over the other (Hall et al., 2001). ERP has been shown to

attenuate the ligand stimulated transcriptional activity of ERu, and has been shown to

heterodimerize with ERa in vitro, suggesting that relative expression levels of the receptors

could dictate cellular sensitivities to estrogens (Hall et al., 2001).

ERP is most strongly expressed in the gonad in most fishes. In a study of largemouth bass

(M~icropterus salmoides) the gonadal mRNA expression of ERP was many fold greater than

ERu, however its relative expression was strongly dependent upon time of the year (Sabo-

Attwood et al., 2004). This study also showed that ERa was more strongly expressed in the

liver, but only for certain periods of the year. In rivulus (Rivulus marmoratus) the greatest

expression of ERP is found in the gonad and it has been shown that environmental pollutants can

dramatically alter ER expression in this species (Seo et al., 2006). Rivulus has both

hermaphroditic and primary male forms, and it has been shown that expression levels of ERP can

vary dramatically depending on the form (Orlando et. al., 2006). ERP has been shown to be

preferentially sensitive to synthetic antiestrogens and phytoestrogens versus ERa (Bodo and

Rissman, 2006). Taken together, these data demonstrate the plasticity of ERP mRNA expression

and its capacity to be altered by environmental variables.

The fish in this study were part of a larger body of work examining several endocrine

endpoints associated with nitrate exposure. In Chapter 4, we documented a significant rise in

plasma concentrations of sex steroids under conditions of elevated nitrate. In that study, I

offered three possible explanations for the observed rise in plasma sex steroid concentrations,









which included increased steroidogenesis and a concomitant increase in gonadal synthesis of sex

steroid hormones, alterations in transport proteins or reductions in liver clearance. The enzyme

P450sce is regarded as the chronically regulated rate-limiting step in steroidogenesis (Miller,

2002) and functions at the early stages of steroidogenesis. The P450sce enzyme is expressed

very early in development; in mice expression begins at embryonic day 11 (Hsu et al., 2006).

During these early embryonic stages, mice with targeted disruption of the P450sce gene produce

no steroids and have severe adrenal defects, and die shortly after birth; zebrafish with blocked

P450sce function do not survive as well (Hsu et al., 2006).

In general, gonadotropins regulate P450sce expression, however, sex steroids have been

found to alter its expression in several tissues (Von Hofsten et al., 2002). In Arctic char

(Salvelinus alpinus) 11-KT has been shown to up-regulate P450sce expression in the gonads

(Von Hofsten et al., 2002). Although nitrate exposure did not appear to alter the mRNA

expression of P450sce in sturgeon in this study, there was a significantly positive correlation

with P450sce and both androgens (Chapter 4) in fish exposed to 57 mg/L NO3-N, that was not

apparent in fish exposed to 1.5 mg/L NO3-N. Given this difference, I hypothesize that the sex

steroids at the upper nitrate concentration, that were significantly elevated compared to the

population of fish exposed to low nitrate, approached a threshold for feed back; that is, the

binding of a critical number of receptors sufficient to trigger a response, and this elevated gene

expression. It is logical to suggest, that although the fish in this study possessed vitellogenic

oocytes, they were nonetheless early in their development, and it is possible that the fish in the

1.5 mg/L NO3-N concentration would experience an elevation in sex steroid hormones

concomitant with progressive egg development, and once these sex steroids reached a critical

concentration, they too would demonstrate similar correlations. It is also possible that nitrate is









affecting an unknown mechanism, that itself regulates both P450sce and sex steroid expression,

and that their correlation is not necessarily directly causative.

Interestingly, there was a positive correlation between ERP and 11-KT in the fish exposed

to 57 mg/L NO3-N that was not evident in fish exposed to 1.5 mg/L NO3-N. It has been shown

in female sturgeon that both T and 11-KT rise significantly during vitellogenesis, and often peak

just prior to Einal maturation (Barannikova et al., 2004). It is possible that under a normal

reproductive cycle, that during a key period of development in Siberian sturgeon, androgens of

ovarian origin rise, providing a precursor for estrogen synthesis, and thus, serving as a signal for

the production of aromatase to facilitate the conversion of androgens to estrogens.

The estrogen receptor protein expression examined in this study represents an endpoint

regulated far downstream, via negative feedback, in the steroidogenic pathway. That we did not

observe an increase in mRNA expression for a chronically regulated upstream enzyme, nor for

downstream estrogenic receptors, suggests that sex steroid elevations were not likely due to

increased gonadal output. It is more likely then, that the discord between plasma sex steroid

concentrations and mRNA expression patterns could be explained by altered hepatic metabolism,

either via alterations in transport proteins to the liver, or by direct action on the liver itself.

Although these results do not provide a mechanism for hepatic or transport protein failure,

they do support the need for future studies clarifying liver performance under high nitrate

conditions. Thibaut and Porte (2004) found significantly reduced metabolic liver clearance when

carp (C. carpio) were exposed to estrogenic nonylphenol and androgenic fenarimol at

concentrations as low as 10 CIM and 50 CIM, respectively. Several other studies have shown that

altered plasma sex steroid concentrations, induced by xenobiotics, could be caused by altered

hydroxylase enzyme activity in the liver (see review by Guillette and Gunderson, 2001).










NO, derived from nitrate or nitrite, has been shown to have inhibitory effects on

steroidogenesis via its actions on StAR or P450sce by binding to the heme groups of these

compounds (White et al., 1987). Heme groups characterize all enzymes of the P450 family, and

have been shown to be susceptible to chemical perturbation (White et al., 1987; Walsh and

Stocco, 2000; Danielson, 2002). These studies provide a possible mechanism for nitrate induced

hepatic alterations by inhibiting enzymatic action of the various P450s in the liver responsible for

clearance (Guillette and Edwards, 2005).

This study is unique in several regards. It is the first study to evaluate the steroidogenic

effects of nitrate exposure in a commercially viable and ecologically threatened species,

habituated to a warm environment under commercial culture conditions. Of significant

importance is the fact that this study used nitrate produced through nitrifieation as its source.

Most studies examining nitrate exposure use a purified aquatic medium dosed with various

nitrate salts (e.g. NaNO3, KNO3). Nitrate produced through nitrification brings with it a host of

metabolites and oxidative end products not present in a purified medium, and is more relevant to

ecological exposure. This is of particular importance because it has been shown that the nitrate

medium itself can significantly alter its toxic effects, even if the same source of nitrate (i.e.

NaNO3) is used. Edwards et al. (2006a), found that Southern Toad (Bufo terrestris) tadpoles

exposed to various concentrations of nitrate responded differently depending on the source of

freshwater used, and this difference could not be attributed to differential electrolyte balances

since both sources were equivalent.

Although we did not observe nitrate induced alterations in mRNA gene expression patterns

of P450sec, ERP or GR in this experiment, it is important to note that these animals were

exposed to the nitrate concentrations for 30 days, and it is probable that the fish were adapted to









the nitrate concentrations in terms of gene expression, since most alterations in gene expression

are observable hours or days after a disrupting event. However, a goal of this study was to

understand the implications of long-term exposure to elevated nitrate, and these adaptive and

persistent mRNA expression patterns are relevant to aquaculture environments.

It is now known that a maj or function of glucocorticoids (GCs), including cortisol, is to

protect against over stimulation by host defenses in a stress event (Li and Sanchez, 2005). GCs

regulate numerous biological processes and play diverse roles in growth, development and

maintenance of stress related homeostasis (Sapolsky et al., 2000). GCs effectuate their responses

by their association with glucocorticoid receptors (GRs), and altered GRs have been implicated

as a causative factor in several pathologic states (Barden, 2004; Marchetti et al., 2005). That

GR-deficient mice die within a few hours after birth clearly shows that proper GR function is

essential for survival (Cole et al., 1995).

Although nitrate did not alter the mRNA expression of GR in this study, there was a

positive correlation between GR and both ERP and glucose. There is no evidence in the

literature of an overt regulatory mechanism for GR induction of either ERP or glucose, or a

mechanism by which glucose alters GR or ERP expression, and it is possible this relationship is

the result of an unknown or unapparent factor that is co-regulating these genes. However, it has

been shown recently that glucose has the ability to regulate hepatic gene expression in a

transcriptional manner, through the carbohydrate responsive element binding protein (ChREBP)

(Dentin et al., 2006). In addition, glucose has been shown to directly up-regulate the mRNA

expression of P-defensin-1, an immune system peptide, in cultured human renal cells (Malik and

Al-Kafaji, 2006). Therefore, although the relationship between glucose and GR mRNA










expression is not yet clear, given that glucose has been shown to regulate gene expression in

other systems, it is possible that glucose could regulate the expression patterns of these receptors.

Cortisol bio-synthesis commences with the stimulation of interrenal tissues by

adrenocorticotropic hormone, resulting in an enzymatic conversion of cholesterol which

progresses through the steroidogenic cascade through a series of enzymatic steps, including the

cytochrome P450 family of proteins. It was recently shown in rainbow trout (0. mykiss) that

xenobiotic stressors that activate aryl hydrocarbon signaling, impair the corticosteroid response

to stress by inhibiting both StAR and P450sec (Aluru and Vijayan, 2006). Other studies have

also documented the impairment of the adaptive stress response by decreasing the capacity for

interrenal cortisol production (Wilson et al., 1998; Hontela, 2005). In Chapter 4 it was shown

that basal cortisol production was not increased in animals exposed to elevated nitrate for 30

days. Expectedly, we did not observe a change in mRNA expression for GR in animals exposed

to elevated nitrate, indicating nitrate may not alter the enzymes involved in the adaptive stress

response long term as these animals are likely adapted to the elevated nitrate at the tissue

(interrenal) level, although the question of hepatic alteration and clearance still remains a

concern.

This study contributes a better mechanistic understanding of the endocrine disruptive

effects of nitrate exposure. Future studies of the endocrinological effects of nitrate should focus

on mechanisms of hepatic alteration including examining enzymes involved in clearance,

expression of gonadal and hepatic StAR protein and vitellogenin production, as well as transport

protein kinetics.










Table 5-1. Forward and reverse primers used for quantitative real-time PCR

Forward Primer (5' 3') Product
Gene
Reverse Primer (3' 5') Size (bp)
CCGGTGACCGTGGTAAACTG
L8 67
TCAGGGTTGTGGGAGATGACA
AGCCTCAGCGTCTCCTTTAT
P450sc 159
ccCCCTGTTGTGGACCATGTT
TGGTCAGCTGGGCCAAA
ERP 69
CCAATAGGCATACCTGGTCATACA
CAAGCAACACCGCTACCAGAT
GR 66
CGTTAGCTGTGGCATCGATTT












Table 5-2. Regression data mRNA expression patterns for P450 side chain cleavage enzyme
(P450sec), estrogen receptor P (ERP), glucocorticoid receptor (GR), testosterone (T),
11-k~etotestosterone (11KT), 17P-estradiol (E2) COrtisol and glucose in sturgeon
exposed to 1.5 and 57 mg/L NO3-N. Bold numbers represent significant, positive
correlations.

1.5


mg/L
NO3-N

ERP

GR

T

11-KT


P450sce E
p = 0.4821
r2 = 0.064
p = 0.3927 p = 0.02
r2 = 0.093 r2 = 0.471
p = 0.2849 p = 0.3249
r2 = 0.161 r2 = 0.121
p = 0.3640 p = 0.9435
r2 = 0. 119 r2 = 0.001
p = 0.0704 p = 0.7351


GR





p = 0.3923
r2 = 0.093
p = 0.1477
r2 = 0.243
p = 0.6785
r2 = 0.031

rp = 0.5109= .4

p = 0.035
r2 = 0.444


r2 = 0.021
p = 0.8008
r2 = 0.007

p = 02263


r2 = 0.512
p = 0.7455
r2 = 0.014


Corti sol

Glucose


57.0
mg/L
NO3-N
P450scec
ERP p = 0.0278


GR

T

11-KT


ERP GR



,p = 0.48330.3

p = 0.0827 p = 0.9835
r2 = 0.214 r2 = 0.000
p = 0.0193 p: = 0.4818
r2 = 0.378 r2= 0.042
p = 0.0678 p = 0.2330
r2 = 0.324 r2 = 0.060
rp = 0.8467 ,p = 0.7247
r2= 0.004 r2= 0.013
p = 0.6392 p = 0.7834
r2 = 0.019 r2 = 0.007


r2 = 0.320
p = 0.3069
r2 = 0.080
p = 0.0002
r2 = 0.673
p = 0.0019
r2 = 0.567


p = 0.9510
r2 = 0.000
p = 0. 1735
r2 = 0.149


Cortisol

Glucose
























11-KT p =0.58

E2 p = 0.9919 p = 0.8984
r2 = 0.000 r2 = 0.003
Corti sol p: = 0.5528 p: = 7108 p: = 0.4648
r2= 0.046 r2= 0.018 r2= 0.092
Glucose p = 0.6245 p = 0.4601 p = 0.5398 p = 0.4326
r2 = 0.031 r2 = 0.070 r2 = 0.066 r2 = 0.079


57.0
mg/L
NO3-N
T 1 1-KT E2 COrti sol
11-KT p = 0.0001
r2 = 0.819
E2 p = 0.9221 p = 0.4658
r2 = 0.001 r2 = 0.061
Cortisol p = 0.5190 p = 0.4652 p = 0.1247
r2 = 0.043 r2 = 0.061 r2 = 0.347
Glucose p = 0.0563 p = 0. 1029 p = 0.3525 p = 0.3397
r2 = 0.271 r2 = 0.223 r2 = 0.109 r2 = 0.091


Table 5-3. Regression data for testosterone (T), 11l-ketotestosterone (11KT), 17P-estradiol (E2)
cortisol and glucose in sturgeon exposed to 1.5 and 57 mg/L NO3-N from Chapter 4.
Bold numbers represent significant, positive correlations.


1.5
mg/L
NO3-N


11-KT


Corti sol














CTCAGCTGAATATTGGCAATGTTCTCCCAGTTGGCACCATCTGATCATTT 60
QLNIGNVLPVGTMPEGTIIC 20
GCTGCCTGGAAGAGAAGCCCGGTGACCGTGGTAAAACTGGCCGGCCGGATC 120
CLEEKPGDRGKLARASGNYA 40
CCACTGTCATCTCCCACAACCCTGAA~ACTAAGAA~ATCCCGGGACGCACGG 180
TVISHNPETKKSRVKLPSGS 60
CCAAGAAAGTAATCTCCTCTGCCAACAGAGCCGTAGTCGGTTGGCGGTGC 240
KKVI SSANRAVVGVVAGGGR 80
GTATTGACAA~ACCAATCCTGAAGGCGGGTCGAGCCTATCACATCAGCAAA 300
IDKPILKAGRAYHKYKAKRN 100
ACTGCTGGC 309
C W 102




Figure 5-1. Nucleotide and deduced amino acid sequences of Siberian sturgeon ribosomal
protein L8 (RPL8). Partial cDNA of RPL8 was 309 base pairs encoding 102 amino
acids.