<%BANNER%>

ERK2 Is Required for Efficient Terminal Differentiation of Skeletal Myoblasts

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101219_AAAADI INGEST_TIME 2010-12-19T18:40:17Z PACKAGE UFE0018260_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 11497 DFID F20101219_AABTIE ORIGIN DEPOSITOR PATH li_j_Page_060.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
1fbcb07fdaf18aac6ed8676a607f35c6
SHA-1
b2fbf740a467b7119e6f9a23c49cc36db3e62354
30914 F20101219_AABTHQ li_j_Page_053.QC.jpg
b82ab55aae46c7e63859a33a9d0832bd
fb506cb681a3df29383029398cf6a0473e294803
3585 F20101219_AABTIF li_j_Page_060thm.jpg
0a501b06e58dc076a6631884d731ac91
185f6cf83e53ddf73f608a20abb80347eed64786
7422 F20101219_AABTHR li_j_Page_053thm.jpg
4d7faa88073a4a1214ec9be888ea5f91
5d6470fd5f75834c47dd9c7c84c105cf4a295017
10166 F20101219_AABTIG li_j_Page_061.QC.jpg
213b49928f5fb7a0acd35d9f656ce280
818fbed4d6614d87e7f25f00229805b0aef1ad9b
39020 F20101219_AABTHS li_j_Page_054.QC.jpg
00c9a2b510d94821ee2085156d9f2235
6a57234a8cfa94b438f04e390fadf7a5b18519c5
3162 F20101219_AABTIH li_j_Page_061thm.jpg
09f8c3520d1e2c9e5e78d7aada7d7184
8d95d4ab7e1a135e67278f56be761f03f11d44d4
9228 F20101219_AABTHT li_j_Page_054thm.jpg
38fe4a8d1e24c953ad1afb980247ae49
029b1c6dccfe15a3a77b4e5584451ddfe4fd2986
10463 F20101219_AABTII li_j_Page_062.QC.jpg
a5b4af2410167c1e75365253d7acbd2b
7d91db7e7f20324fa63bb4d5a70ee9e385a9bfa1
39862 F20101219_AABTHU li_j_Page_055.QC.jpg
ff757c65f077353022d907bdc99ca33a
d3a7678f15ca29ece68920224d935b382b2b96f1
2984 F20101219_AABTIJ li_j_Page_062thm.jpg
b4fc994d9df9fac97377863062e9a0ef
51f09c4d160f131cfc3a6198492fdd04cd6f7920
9313 F20101219_AABTHV li_j_Page_055thm.jpg
fe1feb78a5ec190d3bf9dcac5ecb8976
7d3d60235d7d9ed244f9cd359d48841acbaad14f
16990 F20101219_AABTIK li_j_Page_063.QC.jpg
808f9fda75d72fb93b5db61990454166
9f885b059267cb6f02db653ca8c7b95a5336a5bc
39609 F20101219_AABTHW li_j_Page_056.QC.jpg
5d55aa5aeb723679443e7e0de3c87a84
bcb821c4d39972e41c8f318c0da7bbebd8f914a1
5051 F20101219_AABTIL li_j_Page_063thm.jpg
a39050df1260059c9ae719b5b46b4c70
ad6235c0b8ddc6e877e311c93b70bb186caa84ef
9257 F20101219_AABTHX li_j_Page_056thm.jpg
87c7e8a35656dcae9f8b81b2aa2a1bb9
f06e75b464a468c13f6cf62d96dc0ee58fced12d
13593 F20101219_AABTJA li_j_Page_071.QC.jpg
12c8e28700a4ce567236cc96e9561e24
96dfda3ec35be621eb4e7b96e84453960372b079
10371 F20101219_AABTIM li_j_Page_064.QC.jpg
dcff74253d7005dc495b905a915f6ec5
1182fbbbde5eeee278eb46ee044459768ac6a6d0
38961 F20101219_AABTHY li_j_Page_057.QC.jpg
41b4c1aef2e9ef00dd1584a23c50d89b
3e3b4e10e88d433a5f013323c1944106965a6075
4081 F20101219_AABTJB li_j_Page_071thm.jpg
fc42af64eb14cc44533bcf0a934163f2
8c80392ec1d208c3d150358641e95144d7c4fa10
3148 F20101219_AABTIN li_j_Page_064thm.jpg
35e05ab53104f84f6e40dd2439601b8a
828b86813f88032a26137c879c337488992908e9
9041 F20101219_AABTHZ li_j_Page_057thm.jpg
da7fa3a67f2c41a3162837a418d80815
581e1cf25d22052729b0d2fb427ad911102bd8e4
19285 F20101219_AABTJC li_j_Page_072.QC.jpg
cd6ecd1f41ce9a97f77007a2dc98a351
59519bb75564a0262b89294c9a1f89b243a4c961
10137 F20101219_AABTIO li_j_Page_065.QC.jpg
72daadde0e7abf6047cbe2747d7020d9
ceaebc2b96b18f7c57b9bae11ae828a3fb6751cf
5334 F20101219_AABTJD li_j_Page_072thm.jpg
4d728d8f8b44c929a1bb567269e02bb1
8aed3a90eb0578b0be30ad1dd8f1c01b0f8c64e0
3117 F20101219_AABTIP li_j_Page_065thm.jpg
dac56333867e4fdf600f0771d05c4eb0
4fece7c56fc4df5dbf14a864a8cc577941a523e2
12135 F20101219_AABTIQ li_j_Page_066.QC.jpg
7200f38990306dd99802a42faeed1b0d
c03a8c85f893db277cbae1e224bb2a080aa60d2b
20024 F20101219_AABTJE li_j_Page_073.QC.jpg
8e7fadcc0baa251c773ccfe353f6fd8d
0d9e6bfa0f5242ef579f337ba01717b357e1b2e0
3698 F20101219_AABTIR li_j_Page_066thm.jpg
5dab04657796028615c492abc58bf272
c49a12b20360f72b924e89c401854ac770d10a90
5270 F20101219_AABTJF li_j_Page_073thm.jpg
ba6de21ac5f4c48e684911d09724d39f
630c922f39ff899d86fef2b145e26f877f747e14
16698 F20101219_AABTIS li_j_Page_067.QC.jpg
2b67628babe34def2bf50f9cf6a0296c
8c8d84c3f4c37036272cc5c4f7afe4a3d57e32c5
12113 F20101219_AABTJG li_j_Page_074.QC.jpg
e659dde11df141ce944029390f293a10
bf41fddc89fa3c3c8b32769c03a4d303d176f8e6
4656 F20101219_AABTIT li_j_Page_067thm.jpg
8bbbdd4f8fc1e9db9c42e79158194911
b8010e9f6d53c7adc87c6eb6f04253904c718e8e
3390 F20101219_AABTJH li_j_Page_074thm.jpg
3e4a52d7b7a05f6fd414d685cd71e8d1
d5b363b12a03824093d6f5cb34dcd1cd3d1586d7
12032 F20101219_AABTIU li_j_Page_068.QC.jpg
4782f44ac386f48aeca30a5752b2b0c9
256c4013752042f871d92d9745f84cd3db44b50a
13064 F20101219_AABTJI li_j_Page_075.QC.jpg
ed3f9a411acd118760e5265c95e313b9
93c0720674d23e0027344209d77afdd806701909
3450 F20101219_AABTIV li_j_Page_068thm.jpg
2e1bb951cec94a7512e115f0beee8e5c
6ce76179ce96279c698c4898f18c68de55486fc4
3703 F20101219_AABTJJ li_j_Page_075thm.jpg
86d59b339c30bdb0a18b735cdab67ae1
496b1fb9b42fce83f3b6389dfcec941a9f97b079
10748 F20101219_AABTIW li_j_Page_069.QC.jpg
2680f0f343ed14d61cb6a5ebfd07d0fd
4b0ffdb80b1daf4a7af3bc93e7762439826cafd1
12724 F20101219_AABTJK li_j_Page_076.QC.jpg
9c0e8ae285d7cf0a127062c20f31e583
cb02ddd6d9ecf7abb8096d5e054a6a564c76cb27
3358 F20101219_AABTIX li_j_Page_069thm.jpg
f0a47b3b77091da6ef50a91b1c32cbd7
39796bd183aea87600f4b5a65cf7b38da9dfa9db
27820 F20101219_AABTKA li_j_Page_084.QC.jpg
29bc5e4c73c758f249bdca23fe0fc8b1
b0c994f1782572d702bb97e656c7792121ccef26
3683 F20101219_AABTJL li_j_Page_076thm.jpg
ed277a66c1f528a8223e548b4015a752
0e9e1e80437feb134eb5b36230d4d7a4dc627782
6644 F20101219_AABTKB li_j_Page_084thm.jpg
33da5bfa6887a9caf0c6bd30e708258e
8e77fe3a54fec9d20db7deaab1b4eccccb4d1ccb
18898 F20101219_AABTJM li_j_Page_077.QC.jpg
33bb338ac33470f3000dc2070834c758
57a7c0f47dbf7c11b2ed21d33529d6cdb0a0bb29
12976 F20101219_AABTIY li_j_Page_070.QC.jpg
7765d0f7ff712d16ab810aaad79932c5
485cf82e99f80add0acd42024ea8fa5052a37c65
36074 F20101219_AABTKC li_j_Page_085.QC.jpg
1a148512946a933b6bea196d84ba0d34
84d6d20eae8dcb56e4f1df398ecd37d11047af9a
5231 F20101219_AABTJN li_j_Page_077thm.jpg
955f2ef727b4d048287e9f752bc10479
216580645d87d8d534c89ac0668e216b861fa143
3931 F20101219_AABTIZ li_j_Page_070thm.jpg
7a5cafeb456af07bb04012f3c02c9c96
021f5cc0a238ce62f9478b1f0b35e2096e566ed8
8457 F20101219_AABTKD li_j_Page_085thm.jpg
f45f0760540351c7a091acc162647ab8
80dcb5055bcda67896115bfaf0670918bf9fdce5
10357 F20101219_AABTJO li_j_Page_078.QC.jpg
6466cd3153e2a2996fdc09bb420502fa
9d96b7110b1ef8b54e7780151a9fda5e2bc089c4
37436 F20101219_AABTKE li_j_Page_086.QC.jpg
25cccb6149574c952722fc78b7836c87
5259002cbab05553f0a0fac40b4b5b9db6991ccc
3106 F20101219_AABTJP li_j_Page_078thm.jpg
4fa2b0aff96408098f6251f2690816aa
78fd7f2236ac26a4034c05c22e410f66fd2e5f92
12852 F20101219_AABTJQ li_j_Page_079.QC.jpg
5b921135403857b32422b972c8227219
b1471cde8506f0abc669e8612bf740c0df308ccf
8519 F20101219_AABTKF li_j_Page_086thm.jpg
d0941150467242375461f5e96cee62ff
dc8c8d11fb79e6a7212490b172143f374aa9918b
F20101219_AABTJR li_j_Page_079thm.jpg
2cdf8b7594cd41826f1b38525cc83d8f
e9f4ebe5ecb8e040af8dc0089fafa8216b144604
35982 F20101219_AABTKG li_j_Page_087.QC.jpg
ad0cfcc805e97120cffadc1da37edc3f
9c9dc7b720d79963e5571e05bd0116eacccf8b28
36386 F20101219_AABTJS li_j_Page_080.QC.jpg
e6f40f2838ea01fbcfc0a4e02627e9e1
c440ec10c7d4d2cbf811f5fd7a200de3808cc4a7
8668 F20101219_AABTKH li_j_Page_087thm.jpg
5ab3e546eb258adcf93a9c563a3ee3f5
7c6301734aa47201a3f3dfeca4d554e70bb40e0d
8830 F20101219_AABTJT li_j_Page_080thm.jpg
f8f2e90bd0deeecfde8466ed97f62a9a
db1f639420cc47a1255764c9af51037c9ce3ff43
39031 F20101219_AABTKI li_j_Page_088.QC.jpg
bcc17684352b2b3f41705f1ee0c5b636
8541a3d84b88323f1d8f5568febdb559bf0bb601
36940 F20101219_AABTJU li_j_Page_081.QC.jpg
2e0b72ee5b0f8a1937a25d43c28f611b
b31b0325c0f5a4e186ab72b5075f75f05d2841e2
8910 F20101219_AABTKJ li_j_Page_088thm.jpg
5b111f3d789e73335a3259dc76558380
935d9266fbd70975cccbfbebaf55a39ef6dea30f
8874 F20101219_AABTJV li_j_Page_081thm.jpg
a1d0dda75786c0872ddccaad97c951c6
115b4bac522443b9a1c9841864c5f6eb423856e3
35387 F20101219_AABTKK li_j_Page_089.QC.jpg
3b3fc225a534991bc21f86023e22d06e
98f9f7411715ec5160035db91db79311d726b59d
21684 F20101219_AABTJW li_j_Page_082.QC.jpg
e9981a68dab6b7234869557c8100a9b9
67bf3727892df5281db3f41bd61bf482baf33449
8503 F20101219_AABTKL li_j_Page_089thm.jpg
db7ab69a825a625d61fe32984f29ea40
c7fae4bc678e162da56add8f257b74c8aaf6e07e
5174 F20101219_AABTJX li_j_Page_082thm.jpg
5544e10d53a4636178d91e1444f4ac5a
7e19b40e5b312741e6a6e1b8d251eda91c82056d
37410 F20101219_AABTLA li_j_Page_097.QC.jpg
2d08780f51451bc1a5a92a716ab878f1
7c09b306fd01a76e9a2914102b5a9a5a659c1644
36302 F20101219_AABTKM li_j_Page_090.QC.jpg
8d26455dc9a9312b96b99594305f4942
4ffaa4aab8b653499a7d6a83d2703841db64fe13
29728 F20101219_AABTJY li_j_Page_083.QC.jpg
f9e490dec030e0e0e6658c9bdb4321e6
965f498321eb8b778452d201136267bf7226a422
8831 F20101219_AABTLB li_j_Page_097thm.jpg
4265f3513f2438355a131cb64ce12260
997b7ea915b5b49b20c6238dba73a71842fd623d
8922 F20101219_AABTKN li_j_Page_090thm.jpg
a8354fdb64f9c2b53e82dad686269757
024b9f8479ab37dd2e76287be3db216fbda64a91
7338 F20101219_AABTJZ li_j_Page_083thm.jpg
03481028519946ff630f825d08590e60
a8ffbcde8e15d5bd21dbfc3d1ed4feb1f53760b6
37987 F20101219_AABTLC li_j_Page_098.QC.jpg
5703e7eabe33630f6e3a0a1fd3907bbd
cc9db837c7c3bb85651e6836ac01ea753d3f2a1d
36294 F20101219_AABTKO li_j_Page_091.QC.jpg
dfaf2299dbccab28ddf1a52bac0c2a28
6203679488f410e2ed8a9490f478fe716322ea25
9074 F20101219_AABTLD li_j_Page_098thm.jpg
a463fa17c5ae2bb4b3864135a9c3e3d5
1264cc57caee3a7f2bc7a44e5c9b4fc91d40f15a
8642 F20101219_AABTKP li_j_Page_091thm.jpg
b44b702526c00719d4b8856ba7854388
dc3c41163d5cca1fd632bf97e6fa3101455dca13
38335 F20101219_AABTLE li_j_Page_099.QC.jpg
c90bdc7278859bc01fb5d62c52b7ee65
678644e9238ce4bc4de3b1269397388c4cb8835a
39076 F20101219_AABTKQ li_j_Page_092.QC.jpg
a17db247e0e70cc99747d8bbb7b635ec
2afb85b33cc9a1abc14979b75efea8746ba8ac8e
9187 F20101219_AABTLF li_j_Page_099thm.jpg
51cbe670c68a3b388c8670b00bfdf094
435332f9c2f3111e6652ad11b4948b0941ea47d7
9162 F20101219_AABTKR li_j_Page_092thm.jpg
d73e7fdafe5735787c19110817b85ec2
e610a4469795b28f3608836dae648aecd91723b3
37060 F20101219_AABTKS li_j_Page_093.QC.jpg
9e592a45081a9ccd6ed03cf796a2a3a3
f2aecc62a1b238466b7df04a55035602cd1e13ed
38591 F20101219_AABTLG li_j_Page_100.QC.jpg
22072f69b7069177f2a5827b0e3fe6b5
b31db4005ec7c243151fbccd39d50bc5412ad3cb
8553 F20101219_AABTKT li_j_Page_093thm.jpg
749466167c593aadfada188dfae3d6b6
80ba64c2cc60a2ffae4c4b0b023fbd2ccc81107b
8827 F20101219_AABTLH li_j_Page_100thm.jpg
e6511a9743a70125cb1cd5d6d6261ec8
a605f1c4cef62957f4d5cda33bb53f2b03c6905b
36832 F20101219_AABTKU li_j_Page_094.QC.jpg
f2fa586ebda9817c68515ff4644b1ceb
4c2f80332b4b33cec7483544cdbd85d7ebf292c8
38166 F20101219_AABTLI li_j_Page_101.QC.jpg
d34791a23070fbb413af1a461bc06821
0d7c24dcf467ac7c63fd3b30dae436a882d27a91
8916 F20101219_AABTKV li_j_Page_094thm.jpg
8378e12fe88f6f43adf2463de2cf5a45
b4ed6a7461edc1d3c2712c943926878878eae04d
9122 F20101219_AABTLJ li_j_Page_101thm.jpg
b288f1ce6c8801a6792aae010efc1ac9
df5864e13dc5bfec97a2e3b5c26a5271d6cca84f
35748 F20101219_AABTKW li_j_Page_095.QC.jpg
b744000511ca597b088b9ab491e65a99
c1bc9f477e3c77e5be4afff0d13886fbde03d1f4
23239 F20101219_AABTLK li_j_Page_102.QC.jpg
1017b856a304219c7a90b4c1f5113d06
c1f57ba286f993e6311cdace49885278a2a8481a
8578 F20101219_AABTKX li_j_Page_095thm.jpg
d6f64ce4bdd5c8312c1c8981c6f73ccc
7f9b9ce249d4bdd0128b7de7532a8d416d8a9f58
5746 F20101219_AABTLL li_j_Page_102thm.jpg
4af237703b176fc95ddf4b060f334f95
26abb58e3245c7313c5d728dc7cfe43e2fa700f0
37607 F20101219_AABTKY li_j_Page_096.QC.jpg
7c0fb5b0e32a7ef1f954fc22615ade94
b100a649103a15c0cd448abfde858faa13c7144c
10519 F20101219_AABTLM li_j_Page_103.QC.jpg
185c96bb22b75a7f620bccad8b01cc50
0613fc2d227c1f2d95356a41099d4334e4a3010a
8867 F20101219_AABTKZ li_j_Page_096thm.jpg
c79845135d36f09637570d73cee6b28f
083ea2028e2112045b1c876eca42f58815be766d
2616 F20101219_AABTLN li_j_Page_103thm.jpg
09f79f38c0504bb3d7a7bdac68fe8700
43fda6f400d341808b62ade8482eb634f3dc30dd
117643 F20101219_AABTLO UFE0018260_00001.mets FULL
26fce6773ad8b296078f11675cc4ebb9
92a301c84264f1debd1ca55b90e051e85e4cbaca
19593 F20101219_AABSKA li_j_Page_006.jpg
5b6c030987a89c1ae06e460411120f5d
b849a8f47695d952da2fbd5cbad862a6d51a8ad0
125613 F20101219_AABSKB li_j_Page_007.jpg
e17ce737f31a2dcb77bf7c384a312d41
b0be365e96e9e0f0af547e0158f3a96b4da22d07
21575 F20101219_AABSKC li_j_Page_008.jpg
7362c40ab04fce41b7980cc0a73c1e40
f116b6d37c62181ae9eaf6d359047e1c0867d082
42518 F20101219_AABSKD li_j_Page_009.jpg
1f9b6d1d387bfa30a4235229e967f031
279a7891996a22d497964a269f464cf8f8ffa66c
49716 F20101219_AABSKE li_j_Page_010.jpg
898e2358cb36e6d0d8e33519b23c0ca9
543ab8d7c29dc242b17d6f8d26137fa02e8dd382
17922 F20101219_AABSKF li_j_Page_011.jpg
31e3df6bd6904a0667569609805af9e6
886c87b7b17771e9c3d442783131d5c6f8f021ef
127915 F20101219_AABSJR li_j_Page_085.jpg
4d19b1a49ac4023501f776f13f749ecb
aeef28ad5ad05401b7ad2815ce82470c5958b8ff
96175 F20101219_AABSKG li_j_Page_012.jpg
e9f202790e087bb5d1983d48a0f09942
9ce5903d2821d683396ba0b57343fda989f87735
152222 F20101219_AABSJS UFE0018260_00001.xml
cb4910771960d8123515bd5e6fb6ce73
45e68647223e7ec445e72766b8a2781ba7582a26
15372 F20101219_AABSKH li_j_Page_013.jpg
3f52b8d2ab3f79a9d979a1b6d69656e7
0ba5286bce03d66ace5f7aa2b9a0b1ce7d6f5fe7
68045 F20101219_AABSKI li_j_Page_014.jpg
9b94a80820b515ac02815d1988e7d659
9cd0f89c9268227431d6b467f8c5c0414d069d7a
100420 F20101219_AABSKJ li_j_Page_015.jpg
e4ee8f96cec66777c7eeec814a93c365
e864c93f746472ca9c616a0ce25adfcc05a99f8d
24885 F20101219_AABSJV li_j_Page_001.jpg
83b468268e6aab7239fa9e0094b34612
1550fadecd6452307b0f11032d39454fda55c80f
4017 F20101219_AABSJW li_j_Page_002.jpg
1234b4cc0176c17c957f7a1e0720248a
ae4871ca6c16271009b724b2193356d9ffa68469
111816 F20101219_AABSKK li_j_Page_016.jpg
0f9536637fc985c03006a85f794d239d
7e883cf59f4f4e70823353b443a9421e72c23b04
61049 F20101219_AABSJX li_j_Page_003.jpg
71087dbe35f1c1ca2b96b0e763b8153f
cdd745ea2144e58a9daf83a341a527e78efc8764
110310 F20101219_AABSLA li_j_Page_032.jpg
3f681aa2e00b5dadaff1cb35379094cc
fc5a4db74f8b0d6bda66237cb117ee0e1b7f3692
111482 F20101219_AABSKL li_j_Page_017.jpg
7dd64177f443508761b75723ffe10788
5857a970c75ad9bda795b8bfae5c0959df38f69c
123133 F20101219_AABSJY li_j_Page_004.jpg
635aab7dad26ca978d253c5a1820d81d
c561051c5bb5b80f87fdff9153a67f13e593bc4c
110772 F20101219_AABSLB li_j_Page_033.jpg
d03567f9b2ba7d7a8450b92fa00d08e3
4f3c1428bf3cfd43d637b90e2c7c08885348b5b4
111633 F20101219_AABSKM li_j_Page_018.jpg
c25b63b81eec158aca96060f27f032e2
848c5830ca02d8fa7952a9b2e69649ca2ba9d5ef
101467 F20101219_AABSJZ li_j_Page_005.jpg
1a2b46cc8535380228db3f7fb8f58e95
a7e4a450f1337ec0264fecd2872734835b3c4f9e
104629 F20101219_AABSLC li_j_Page_034.jpg
dcbbbd16ba9fdc45ea0b4c369214e7fa
201cd27712401219adbf3e405c4d3980e6a07099
115529 F20101219_AABSKN li_j_Page_019.jpg
2af80e311db4784c3bdc206d6227824b
128d80885276d909f1ab4485b698e5a4c2616d61
109611 F20101219_AABSLD li_j_Page_035.jpg
5259974809c15a51ab7b66b7baa8c9cc
710c8e5eec4022cf664ab9e474231aa8b32fef8f
104762 F20101219_AABSKO li_j_Page_020.jpg
2511c62dd6943bf98c739a9e249d6d0c
bd900e32293d81f93e76b358c722e7a605896517
108692 F20101219_AABSLE li_j_Page_036.jpg
1b8b76b1a95c3b602e341ed3240b3ccc
b6ce048619d0b06d592e8975661c7bd76c597977
114290 F20101219_AABSKP li_j_Page_021.jpg
0576c4ebc89d1b9cdc7570d9e3190bfb
cc83886f5e9e33831bb048f10a90336c1ddf79ec
100700 F20101219_AABSLF li_j_Page_037.jpg
62c88c52235ae9bdb484b89c2b6e8038
b08d1cd35f07b9c43a9438e0fdead8264cd47666
109717 F20101219_AABSKQ li_j_Page_022.jpg
de86d5bf5433757e791e29cd2bc2d66a
4151777df1650c173325af80059c13409b653109
105303 F20101219_AABSLG li_j_Page_038.jpg
bedf216e49b703c2e08631760e77626b
76494259e3a5849670d752eb354609eb432d25c2
105084 F20101219_AABSKR li_j_Page_023.jpg
f02f87c3f0178577f5d59ab6e3e53f60
dc58342aad0c1d70b1eca5f5fd4ab8ae10d004e9
112985 F20101219_AABSKS li_j_Page_024.jpg
d335909a1207f906181508bd5557dc02
cb708e8f0a86e9d908f66749dd2cb0a8c7c64ac6
113216 F20101219_AABSLH li_j_Page_039.jpg
c705c83105c3f66e161cafee5c346cb4
4e99e76316637648622bc63f2f7417e00c2d7be2
102888 F20101219_AABSKT li_j_Page_025.jpg
8b07f6fda94c30a3e530e85ea35b0a0d
03ad26fc8a552be309f4198e97d297fc3dc9a283
106171 F20101219_AABSLI li_j_Page_040.jpg
4010a33f7818c697d274b1357cd7b6de
f177b8b14cfd06461113e3630a08a90ce2c87c40
110235 F20101219_AABSKU li_j_Page_026.jpg
620bc990c4df859c2c54f40e6c9c5b71
0ec740c779425ee11514d0558aeb02eb3abe5660
111809 F20101219_AABSLJ li_j_Page_041.jpg
61675ad390761726790fe533076c81ff
30c761e627c81078b07eb3119744b53c2b8b1391
109752 F20101219_AABSKV li_j_Page_027.jpg
6e62f0e442ad0532c383b66b48dcb86a
e5da244ff7f8a053357524abd86f740d7dcaf886
96817 F20101219_AABSLK li_j_Page_042.jpg
aa5723c781d1edba722e9469ce34ca34
76d11095f17840f5266d8c6f76aed4a602f659d2
104620 F20101219_AABSKW li_j_Page_028.jpg
0a69a0fe4fa91551e3e93b84c3f44e19
b3f38c7a0e562a4a063a4eea2389deca73e8bff8
110619 F20101219_AABSMA li_j_Page_058.jpg
104d38990a3d31022798cf7754c6f1d2
2c5aa20645ab7c56e75e62a592649af69cf5a315
67640 F20101219_AABSLL li_j_Page_043.jpg
a94d8429be2c3185a38603b0e3556d8b
0d82ddce3bae0e5488950bf1bc26f9173117ffc3
114895 F20101219_AABSKX li_j_Page_029.jpg
b5dc4324bad3a0777eb21c8991adfd70
8354f20b6b144faf81f9771b540e0a2817210b7a
50359 F20101219_AABSMB li_j_Page_059.jpg
acb8c3653e737cbb639408adb7de7c6e
03569d54f2848826053f72a0dc9d20b8ef3ae135
52877 F20101219_AABSLM li_j_Page_044.jpg
6eeac9cb7ee9c7f930dd754df2eeda4c
0750806aa84f5eafe9a41e4933eb071a1a1c771a
108909 F20101219_AABSKY li_j_Page_030.jpg
e4731ad291be68bac2e185055a90b7d2
6dd8561da0b46adfea3f46de060ed51aaeba1293
42838 F20101219_AABSMC li_j_Page_060.jpg
7cc5e42d79d541a04667801bf0fb4cf1
199c7418ff955ebb49b5ba5bc8049e202462f000
25658 F20101219_AABSLN li_j_Page_045.jpg
cb1ce8737301477d5c4d0c0b552e74ff
4b6b4ada11a8fa994257ad98da9659eb6d8259e8
119237 F20101219_AABSKZ li_j_Page_031.jpg
2a3b777e1b7719202c6367b5104a5739
bb7f5499f5e6f5fe60948ed15b847938de0c953b
37154 F20101219_AABSMD li_j_Page_061.jpg
5cc8f1c26e7e5dd43f86a49aabe80aaa
d376f4c1bfd4d22cea01d6abfc53947bc8fdf83d
53814 F20101219_AABSLO li_j_Page_046.jpg
5da1c61304ebfd6acc36b7ee0ebc57e5
3c25434a1ab3b0a69a3286564873ebd21ef861c0
35026 F20101219_AABSME li_j_Page_062.jpg
a2b3912a7a0751dc9773af24ae2b44fd
dc5df1b4440a004445648ed7d9cf5952cc364f45
28513 F20101219_AABSLP li_j_Page_047.jpg
2ed69f02ce212d55f12776a28a636ce4
30abdf6fb3728bcc1b58386b16fc1312c86f7755
55934 F20101219_AABSMF li_j_Page_063.jpg
8f073edc9d96ade0f049d0c4219f23ad
a3c97f806e3982c136c63173be381892858ab910
29536 F20101219_AABSLQ li_j_Page_048.jpg
9288c2048e62a16c5e8353d12cb3ae89
4d59efcd1b6bec2ad5697ec54939c6f25738fb48
35180 F20101219_AABSMG li_j_Page_064.jpg
c1e0f52e2dd073574b0ed9622285f981
9572a47f3e53edcb815a8e87d4f8ae641fecdd22
105116 F20101219_AABSLR li_j_Page_049.jpg
a66d700fd4e402840cc38b8c2f57e4be
93faea8fd12e47c6d7ecfb5d0f5a2b0a17a1e8b6
32970 F20101219_AABSMH li_j_Page_065.jpg
ea3e061b1924e1fbe4a08cca788bd7ed
b1a668e232245b2db9730a0534a2461f5a193a7c
98978 F20101219_AABSLS li_j_Page_050.jpg
2684b2b8ec30417f80b6275017130c1f
b75b3ec6ee0444b47b45772a827435d37a4083a5
111355 F20101219_AABSLT li_j_Page_051.jpg
3038eaf3a52a2d9eacc6931d11e122ba
148240549580d1bed8abcf6af4e08a2db3763bf3
40503 F20101219_AABSMI li_j_Page_066.jpg
47fc4b417dcf8c575357da446de0d4f5
9b6fd031cbf456c476bf842dcdbf19e9e752e509
25286 F20101219_AABSLU li_j_Page_052.jpg
31e3580ca3eac1e568923f01d7b774a1
4b4d7521348d199380749e850fd5478b1e086efd
51099 F20101219_AABSMJ li_j_Page_067.jpg
792e383e12f3f1737a0c8030771b1062
d82146c5098fce2e908a0a3a40418f2918f1acf6
94715 F20101219_AABSLV li_j_Page_053.jpg
551737b102b094d9ec573dbef70d3856
6fb8233be92160147bc8294fc8fe65e8a9ccad29
40543 F20101219_AABSMK li_j_Page_068.jpg
d69304530618a96cd92d1f2fef627972
4f161979517b345feb534161010039bb2201250b
118820 F20101219_AABSLW li_j_Page_054.jpg
a6ae46fa34fc076f18798d82aab36836
21948df8cdd070fbb9b8cc0c9560d536abe8295b
35964 F20101219_AABSML li_j_Page_069.jpg
a50b083e0496e1aaa0c8fc31df30f6dd
bf829802003cc212fa21d20b4b19515eea1413dc
119087 F20101219_AABSLX li_j_Page_055.jpg
a0b0e540ff9a6a0b0fe73a0f5dae4e72
0e7a53226249f36772744455da4cd980020be948
81914 F20101219_AABSNA li_j_Page_084.jpg
bd08dd0a42097048fbd952ae28f609e1
d9046beaf464b823679e865e6c6fd347fb94b74e
39009 F20101219_AABSMM li_j_Page_070.jpg
489c05011daa35d88c355dfbd0940425
19482ac0ae73fa89609060081df61ca255703893
119658 F20101219_AABSLY li_j_Page_056.jpg
aeace17888e60090c91f650853edac26
804f322219d9267d1b54fb79dc9d8baebbbde2c3
133216 F20101219_AABSNB li_j_Page_086.jpg
30c603043a527cddf87963fc58f96369
e2717b4ad8acf33af692a2564018c6fc6e0c97bb
41990 F20101219_AABSMN li_j_Page_071.jpg
c5fbfc2a3cf03e0d697330799023d8ab
4c97fb937b3f24b9444a29c908aacc2b04e74a03
117860 F20101219_AABSLZ li_j_Page_057.jpg
85c19ecb60958878d7b7f0eb20fbddde
adc45a36c8b69e3b47810914e792419674443b04
128124 F20101219_AABSNC li_j_Page_087.jpg
096685bff24407246f4190b8696e7970
2326e065a2c989c85d8e503f556c509d9f2a458b
61924 F20101219_AABSMO li_j_Page_072.jpg
5aafc203adf43200c1a97db340d1dfc7
9ffc8f60aac033ae880b27553a6d73e7c862e9ee
140159 F20101219_AABSND li_j_Page_088.jpg
75f675bc77541d47a4dafb73e253aa22
a78e710ac3da36275bd2cc0414f8f47b6141f26b
64417 F20101219_AABSMP li_j_Page_073.jpg
e40d3856c096d61da650b1dcffd76ec5
521f8ed8d9d296d537ccc4e431d37ffd1c8e2f3c
125145 F20101219_AABSNE li_j_Page_089.jpg
5ad007d4eb5d29dec8fda33ce097a3aa
db1b4e7aec2e7947384bedb2068ad5c69f1d597e
43599 F20101219_AABSMQ li_j_Page_074.jpg
2b065ebcc36ffe6d7f9b444e177f18e8
e011bec49d811b0f6d94929f30484180ab330740
130473 F20101219_AABSNF li_j_Page_090.jpg
54bf8cb82c640098d0bffbf6cca29c72
dfd2ea90a53c59dfc8dd55161da480a3b988321e
44715 F20101219_AABSMR li_j_Page_075.jpg
5d1b2dbc5c4ff4b8758fe052ce23dc28
d9ccdaa091724c6cc36bfe541ff90ebcc895f522
129344 F20101219_AABSNG li_j_Page_091.jpg
2abb92a0eea6fafed2d57c124d1a9e5a
015a48c7723f305414ad8aebccfd61a5037a76e3
41126 F20101219_AABSMS li_j_Page_076.jpg
5ae70cdaf06564183dc71248a3896368
63c6fe0ebaed982ae7507a4cd53edc45053e2370
141209 F20101219_AABSNH li_j_Page_092.jpg
908802a3592a639fe92a7309527cd8d0
ff710082d0c88574992e423ba554f724140fbce2
60321 F20101219_AABSMT li_j_Page_077.jpg
c7b1b18b3d47714333b9aab37bec7359
139ff5ed1a7ae0883d6972cdfa61c901f3fac78e
132928 F20101219_AABSNI li_j_Page_093.jpg
b689024fa62a2e3a6ac988b0c94f5fb2
198cb25db0a01ccbb9cdc57812bae3913ac5fcb8
34497 F20101219_AABSMU li_j_Page_078.jpg
357da0454f51ba151f063e6e5dbf1da4
927baaceb9c178330db9336c1bb9537a92fb7ebc
39215 F20101219_AABSMV li_j_Page_079.jpg
e4fec03b020338738508600954bd9b9c
0590e82f85f91e3c0ce2789f03f901bf40225693
131147 F20101219_AABSNJ li_j_Page_094.jpg
c73a42dbdaca3633e5a469f795b3691e
7d2688d0ed283271054dc241a675ac3313d93eaf
112469 F20101219_AABSMW li_j_Page_080.jpg
5e9494b6003975c282f0d369f5b94c59
71e5aa8827ff964d87806d9634470cfdfadbe7ff
122351 F20101219_AABSNK li_j_Page_095.jpg
3b8c9220b0eaeb2324cb394b147c22c5
8563206c9aa83b482ae5a0801f6956476a8cd39d
114084 F20101219_AABSMX li_j_Page_081.jpg
2f12cb00883a0b7cf676d900ac79623b
6a6829249753a746b8e28c9f1781b8c2c730cc71
351333 F20101219_AABSOA li_j_Page_008.jp2
9b3d29968dc96411432e9d5504daf94a
66c22d8a019cd9c777d4d6495c1cea992d17e6c0
134346 F20101219_AABSNL li_j_Page_096.jpg
7c5895561ea4a3e4306db13bfcf12951
3c4c0af972e056d2502981cd750e5c7c580ec2a8
65839 F20101219_AABSMY li_j_Page_082.jpg
a0fa69df80f8860f3098a319c0d4af5b
901d9ad7b42457c8c3ead430371035847528adf3
45619 F20101219_AABSOB li_j_Page_009.jp2
46eafb035cfb62d8409a13ea0bdc930b
3343915fe14b78c9ad51da6d044eb91b8598cd75
132661 F20101219_AABSNM li_j_Page_097.jpg
1af75b091b034a6b50ceac9f6da035f4
c83ccefc51f4ddb02740817087b259653d34f881
92984 F20101219_AABSMZ li_j_Page_083.jpg
cad107c65e5d5c4a95742ecd85b489fe
31a00f0b2521b1ccd496b1fc9a64018930684445
52505 F20101219_AABSOC li_j_Page_010.jp2
07d8394fa4d13d99a4642a85eb3a3860
7f31653f88bfe2edec39cd58d44fd3698b2a92b9
135844 F20101219_AABSNN li_j_Page_098.jpg
2152b3cc380aaa8b38c8116cf5337826
c48cf3f9659a9169ea79c6764ad6ac543df1f02f
20080 F20101219_AABSOD li_j_Page_011.jp2
d5099d80baa8942d359a6c5da0b1a840
2f38e44b2df9090dacb90740135ae1224d61107b
137125 F20101219_AABSNO li_j_Page_099.jpg
423774e75776440d0c2290af1fd5ba72
a6283e1cdee89d11a8be3b7bcd4cfaacf9c190a6
99314 F20101219_AABSOE li_j_Page_012.jp2
0eb6903a041c452381e46329904814af
8de0f76058085e047a414d8bdfc34eab6ed3ea93
138768 F20101219_AABSNP li_j_Page_100.jpg
1ca8cac32cf66a4d45ba4fdac55b31ce
409e93577562673676997e3afb41d9f28fd38654
16308 F20101219_AABSOF li_j_Page_013.jp2
0c21397081ff5205b94e1fdb23b8bc5a
7c99bbc895de29c0dcffd919509fe67c776d7286
133857 F20101219_AABSNQ li_j_Page_101.jpg
2b47b3a787d43d5d0a17c5e90fd144b3
048895537a034358c1f364d2c8b06541e9e4a5d3
70357 F20101219_AABSOG li_j_Page_014.jp2
ca4e3c77f26fa6aefee8989c62eba4f1
fc6a976b3ec1c545bad5d5e9a24146b70ae9760b
81950 F20101219_AABSNR li_j_Page_102.jpg
3d04491192cc42df9ff659e2e4e4cba0
fa3e699f0b16f8a71e370dafbc1a09cae770c315
106309 F20101219_AABSOH li_j_Page_015.jp2
1ba4ade9c0145bea10b48f7a01c954bb
384415486e2f54e9bbffd5071d4f8b2303a57172
31915 F20101219_AABSNS li_j_Page_103.jpg
e33612a2e22a36f6ddd6188530105a67
2f7544d5b3a1a3970fc2bf119606f61b3ca295e4
118499 F20101219_AABSOI li_j_Page_016.jp2
ee438ef2b2aecef4d23e40713768def1
2a5606ab2d31a899a25afab4381d3844279911d4
22605 F20101219_AABSNT li_j_Page_001.jp2
09c880b7babd517cf02740389cd55e71
525250c686ffe4a706da5f0a8eb5a4d6547121e6
117711 F20101219_AABSOJ li_j_Page_017.jp2
a0c842ab6f3ab4d8ae9122f58152cf3a
6c5ebaac172acd3b00be909bb09ffb3a3806b58a
5128 F20101219_AABSNU li_j_Page_002.jp2
2d1811d21529006bfdb18cc701da14eb
1735b1d0bad374d823dd022a5be59500d5cbb4f9
62864 F20101219_AABSNV li_j_Page_003.jp2
100f5f93828cc13701ce05a6ebef3f14
0722aa2dd22356770bfb15b6230978d33c2c7b79
118130 F20101219_AABSOK li_j_Page_018.jp2
a2d1b6883be5558dc7e327137b3468ae
d3b16c9de29169cea19782964a7b8e9f7e866213
1051962 F20101219_AABSNW li_j_Page_004.jp2
eccfa4a33a444f39d4014cf642ed5bb5
44268e7991a8eed5fede8c3c06d9d09c8933180c
108685 F20101219_AABSPA li_j_Page_034.jp2
eb68656e8b3bce0fc4393a56136e1359
f9d0a0d8801c160b33bfcda47903503d8582cdfa
119838 F20101219_AABSOL li_j_Page_019.jp2
3ba0d6681751a2b8df64aa50e4918ba4
f53ba6c39b5096e718cec137228bca6980b33bab
1051925 F20101219_AABSNX li_j_Page_005.jp2
6615abf695440aea3103fae3290e32a6
7494f2590c76c6111d371555c8ac0dcf7fcfa50b
114649 F20101219_AABSPB li_j_Page_035.jp2
44cc04ae5750b198b99691b399f3c79d
c29fd4990fcffb274227a09d2e6d7f0875144712
109357 F20101219_AABSOM li_j_Page_020.jp2
8ae14230838275808a45a5cf1ab455a0
72a0645b522f004a3e82c6fc0ef2aec3fbc4f796
294432 F20101219_AABSNY li_j_Page_006.jp2
36fde5f78af1f48ffaa06642d7dfffdf
1be7d8bb1bf58e5bbc045c0fadc4122a8fa3055a
113122 F20101219_AABSPC li_j_Page_036.jp2
e1b01425593495a27cf4cb08d46fff59
d918b115045ebf1ce9968961ba5d8e5fab5763a5
119774 F20101219_AABSON li_j_Page_021.jp2
52f71123a6bb847c9e16f2c8ffeac325
e78da3934b837633d98aa6c00168a564f6c6eeb7
1051983 F20101219_AABSNZ li_j_Page_007.jp2
d08905180e3163d2fbc156315380fe91
d83e79a5bc851925138e1d73bf57c97e58f9a8df
104551 F20101219_AABSPD li_j_Page_037.jp2
57ae616271525c53785dbed79825372f
de50e75bf16a3e7231c404f8cbe585ce030737db
116309 F20101219_AABSOO li_j_Page_022.jp2
8f10289e9e2a6c1e952c3ded837c67ed
e7c84216637a48c93ac5c9d72c1681278d8196be
110237 F20101219_AABSPE li_j_Page_038.jp2
c7344f64bfb358d91a4353d796d56689
d67daeac757ab48d139d488cb8bce45593b2fbf6
110757 F20101219_AABSOP li_j_Page_023.jp2
912f09d7e1b67ac539b5344893db6aae
6c53339b35d9ee83333987c7897576fe6b66cce2
116990 F20101219_AABSPF li_j_Page_039.jp2
616d9eaa15810636a91be9cae059dd0c
4bf8e2089887a82726a7540cf16591ec5d8e9aa4
119029 F20101219_AABSOQ li_j_Page_024.jp2
0625f7fcc76dad86332700e882e0e3d2
fbfafcebc236783f8a8d773fe177a34d4f541cbe
111905 F20101219_AABSPG li_j_Page_040.jp2
fe703e8666454105015c6fb905fbcb55
f135307880c93d5a913f28ced150e351e78a235f
108513 F20101219_AABSOR li_j_Page_025.jp2
4b9a76934da77e54efbeb7427b55e5a9
776bf5868daa94fe33b6e12f1afd0846bf20c2fe
116384 F20101219_AABSPH li_j_Page_041.jp2
b78b770d1dd58089d696c147e017191c
f4e83a55af485eff1b459ccd3e70c8a6f91fa346
114530 F20101219_AABSOS li_j_Page_026.jp2
4b10dd1f34e3127070088effcf7dde51
93d9715270f37a1cee59fe2f0ecd5a2ac50e8250
115253 F20101219_AABSOT li_j_Page_027.jp2
d7647fffbeedf84f525353571346b135
3351318cb88bd200578076bfe48e8d1cff59bddc
101491 F20101219_AABSPI li_j_Page_042.jp2
be24ec829aaa9e1c83dff0567ac2bf8c
4fdf0de1f4de30a272ca5d50aff9574c666783e7
108902 F20101219_AABSOU li_j_Page_028.jp2
bbb8f23cec922d025a9c554a07c2d632
7e6ca134490ff8c20a4133c9a609fb8c39740a76
70381 F20101219_AABSPJ li_j_Page_043.jp2
e98a20081f494750707a630454db0d58
536ce465b1fc025fba86c846f84690879b4f2b9b
120450 F20101219_AABSOV li_j_Page_029.jp2
00ef1f2c520b0c09dfe3930e0c7e758b
0b001d8017bec542373f4aa85afc9a40f6aa9f91
53502 F20101219_AABSPK li_j_Page_044.jp2
09c2ac07387f14144b595dc59c23eed5
25f3070c726fb88f7b6ac46224ab898ad720aeb3
114234 F20101219_AABSOW li_j_Page_030.jp2
a1fadf17558dafc071b1edd4335270b4
805e3ed3f8ebff933a10b8083cea6aa8ea82288b
123340 F20101219_AABSOX li_j_Page_031.jp2
92ce0402a297c40c87edeb00758cef9c
e78b36032c8fb699c3fc4766263ed435e18d9f4c
497013 F20101219_AABSQA li_j_Page_060.jp2
04823398b457e0509858ab6c9deb6422
96d40e133f6c6aaa9e632e564c8c94b13a928849
381592 F20101219_AABSPL li_j_Page_045.jp2
2a2d9fa9ec739e512b98a2ebe8fd1ef8
f25ea0ba6b647a317ff700726bb35ca68afd69d2
117016 F20101219_AABSOY li_j_Page_032.jp2
1c7d12aacba498f864b079fbb0e3db1e
aeab2523a4d566f04b289cfae82f3c68a2205ee4
367636 F20101219_AABSQB li_j_Page_061.jp2
acf2ef3ae000eac6accf1816eb7d4ae3
4712852c656a4bbfe9aec94eea003bb9434d11b7
52809 F20101219_AABSPM li_j_Page_046.jp2
d892db65a73a71229d64cd493a35287a
a289927faa256a5d0a7203b39cf6a630d12a82cf
115457 F20101219_AABSOZ li_j_Page_033.jp2
545432962089b61b2035c31cf0d91ef6
c3ee40e5c541cff4230602d76b8a4decb28600f9
340681 F20101219_AABSQC li_j_Page_062.jp2
aa1d8a50f62e4986fccf25d357d8f8f9
5e26751f5aa3ba108010a9e1914bf8f690535c52
28842 F20101219_AABSPN li_j_Page_047.jp2
6ac195d076efc87dfec86498e755754a
1e68d779f0ee8e668bf916f5a4bde92e8c1059a7
542053 F20101219_AABSQD li_j_Page_063.jp2
4906527dbcf57d032fc418032d56b3d2
61232e999f0a19bdcfabd86547810b933b986ebc
237677 F20101219_AABSPO li_j_Page_048.jp2
2a2d28a29864640cd7a0352d487879d4
8de439711ace10f29667286d8810b4a12ee43a97
323015 F20101219_AABSQE li_j_Page_064.jp2
5cec5d5a9e80193434531e5560a693bb
28148fde6900388d6edecbc5a3c6300774cb0a40
108840 F20101219_AABSPP li_j_Page_049.jp2
300b535692f4bea372d762cfecabf08a
885f9e4f94cc0c0dcfa1d89679c92eca8be2e7c1
305383 F20101219_AABSQF li_j_Page_065.jp2
33b6320c929cfc6ca9ec657b248eae31
7785ec7b771c042de5077efd8dfaf19c8426337c
104012 F20101219_AABSPQ li_j_Page_050.jp2
0eb01fc3b953be7642e99b8802d66b96
675b77ee532e27e253ed260d3313f50986c06f89
377090 F20101219_AABSQG li_j_Page_066.jp2
e838223f374ea455720808c2667a3278
8914a29a575f0aa442735d3fd4bc82adbba5cf07
117207 F20101219_AABSPR li_j_Page_051.jp2
56f52880dcc807488904a9c5acba5e17
763dd6e08a77653f0d6e16db37d2f1d510959061
568629 F20101219_AABSQH li_j_Page_067.jp2
c7232c020b99e759b8eef4c91b0764a3
e10fee2deed779c6e8da14590717fff076c263f0
26159 F20101219_AABSPS li_j_Page_052.jp2
3c97f3d81723e677efc1eff3a2daea36
0426024204e64580620ad041718465047ac7e380
388493 F20101219_AABSQI li_j_Page_068.jp2
2d58e897fa846008c5fd857dd9297d81
d5c33916e0b02e24b2f92f2aa7cbb02666e02c59
98675 F20101219_AABSPT li_j_Page_053.jp2
65485febd2e66643b7c63991b30d69b0
7f9d899f4e5512e5e8520dc921f01ec1d18efdf1
338029 F20101219_AABSQJ li_j_Page_069.jp2
01cfe58f5c5b4112b109f7b74a0e7b16
8f79b21c16833984a0ead4153925b8cf69ab98f9
123260 F20101219_AABSPU li_j_Page_054.jp2
d80955abbe28e6b6c41852b34df4cbe9
9f35386bcb09606f2582055f8d1ff2c75d3228b3
402597 F20101219_AABSQK li_j_Page_070.jp2
02aab60bc74932804094390de7279b68
5aaf51f662c8f595a16bfe10bf6b51d2fe504da1
123253 F20101219_AABSPV li_j_Page_055.jp2
a87311eefb7fbdf1e733e3de1ef47588
7886190e60eaa76c866072b35c914ef06c1df3a7
425008 F20101219_AABSQL li_j_Page_071.jp2
9cdf4762c764a26759bf0c4e5bb0e8c6
3788e38cb13dde78fa831619cc70c22c08996fb8
124475 F20101219_AABSPW li_j_Page_056.jp2
e26bfeceace9b9e6af6599f77fa683a3
4ae7a9ae1256b8120983b62c436e014300cdc321
133818 F20101219_AABSRA li_j_Page_086.jp2
4397a7870b03b726efbb6ff16c56fe2b
2a48027b724bbc7ce5e1f7d0a830f5f532504db9
121903 F20101219_AABSPX li_j_Page_057.jp2
cf2986ad04579140e01cc8b17e131af6
23d5cb9d3acc76e2f32aef4b8fb0f18f4619ebaa
133262 F20101219_AABSRB li_j_Page_087.jp2
04c6a7c0df7267bdef3be83622c11251
aa867691c523684b6b6bc4c2f83f6d889e01a2a2
601593 F20101219_AABSQM li_j_Page_072.jp2
0f5fb1eb5ec6404d5150b75df32c575f
019debcbb892577ee3265bb373def124c2fcadbf
113274 F20101219_AABSPY li_j_Page_058.jp2
f034749d7428e4652bebdbab50908c01
07e98951ed85ac8c1b36c57c259780b67bca41cb
143992 F20101219_AABSRC li_j_Page_088.jp2
794205647a3d956587043be27a80423f
c205caab05daedd5b15725371673e193ffba9ac4
706757 F20101219_AABSQN li_j_Page_073.jp2
ba329cc3792caeff883403b3b1bf81bb
50710589167bc692bffd8ca70bcdf9bc85b3e9a6
51813 F20101219_AABSPZ li_j_Page_059.jp2
9e5a06c84cc12ad40e8287eb2c74397c
b123725cc6235f364fe2bfeace8767c398e95441
125347 F20101219_AABSRD li_j_Page_089.jp2
011c3a2393ca2e9b20edc18e3ba574a0
4cee7bc609d1ac1b32c70c93a00006fdc452fafc
412471 F20101219_AABSQO li_j_Page_074.jp2
6faaf6099f9299c8691de1ab058dc9b3
e0ded79b3359748a06172cf1d1caaa4919752dc6
137357 F20101219_AABSRE li_j_Page_090.jp2
d935b8242e891420b871582832469d2d
e24bc903b70dbc1ff7979640b65b9a1f7b9eb14a
418014 F20101219_AABSQP li_j_Page_075.jp2
10cceb37ce1191ca11c964dc7d47dba9
ceb4502b2b5c24501f0b0a514c1d00d83b180bf2
132446 F20101219_AABSRF li_j_Page_091.jp2
23028d0419fffd8cba9a0adff27ace75
77926b358e23053c325b9a6f91d0ce0b06c18286
379830 F20101219_AABSQQ li_j_Page_076.jp2
5eb7f8ba35292df0f50b970b9c787599
a75f630ffbb10bf9aaeecf76c13fcc28f7b4cb69
136820 F20101219_AABSRG li_j_Page_092.jp2
42a00c946d39bfb0fa2be9e579d77081
c7de6c2be1dba27ad56481d6fc808697ce775ba7
633349 F20101219_AABSQR li_j_Page_077.jp2
2b9f052ef575ad16928f54373e250599
51d99fbc3093ff26b9d211082f9cb9ed7f949d53
135496 F20101219_AABSRH li_j_Page_093.jp2
51154a2651798af578107444ae58c3cd
928b192b2bc793e46d4cd269b1eba2dbe93dfd5d
323901 F20101219_AABSQS li_j_Page_078.jp2
14411d21bd0ed4bf4ed2769d2e86cffd
98d24c4a167d2554d625043ca0e890ff695519c3
132209 F20101219_AABSRI li_j_Page_094.jp2
d800c351481e3d7f8c9caafd59b2d5da
d6e46faada6f783849b17ead0c9a78df0ae7bb6e
360979 F20101219_AABSQT li_j_Page_079.jp2
bc422a15a2c0432d1ebfc0bb826d22a8
267b865306de2b88e384b4e776c1d5b1340f55fa
125445 F20101219_AABSRJ li_j_Page_095.jp2
59f748d2f5c40721a2a8fef7b854879f
5baeca58b7cadb303c308baddc50f9d4369da369
117481 F20101219_AABSQU li_j_Page_080.jp2
11caf9f21709e6ba95460313075ed5d8
1476d196629e523798c459cf8bb8970c0665de06
136971 F20101219_AABSRK li_j_Page_096.jp2
7eb871944d696cc3e6ab714e7fe1156a
dbae591650bb68a66cfd2e518d779db8994fd2c0
119969 F20101219_AABSQV li_j_Page_081.jp2
ec3dd57a6009662ad731d3c7885cb595
f46a51abeaee56347be0501623f83f667df97e80
134848 F20101219_AABSRL li_j_Page_097.jp2
3ac965c51c26592c4740c85e259a1af6
b47e8876f4708dccb6c20b06ee64ba1bcead637d
68497 F20101219_AABSQW li_j_Page_082.jp2
058d7d4d26c14b298dd155f98a7ad354
1a471136a2825b9dcd0e4ab85ceb9f3d20d902ed
137467 F20101219_AABSRM li_j_Page_098.jp2
4557187c4f904ae6c0ad622463ec0d8e
02961ac4c94f1966040c8c82918d762693ef7aa4
98726 F20101219_AABSQX li_j_Page_083.jp2
66bc8e688030359955da67f72bb314a8
d906c53a2f2584c6026bfbfde4f55162963e9dbd
1053954 F20101219_AABSSA li_j_Page_009.tif
98362e0ba4d394c09b3dc77c472f7181
deccb91c866bb0a22b1ce1dd3419a2221ad1fb88
87153 F20101219_AABSQY li_j_Page_084.jp2
64df83f193f93e4945c22a9ebde3e1d9
80aad5a50da586dd8c6f942ca65b103a96c0ba48
F20101219_AABSSB li_j_Page_010.tif
9fea024ae07dc7239477241077f6a785
94a1ada2cb0d719c4976171ba77fd346f7995a0f
145188 F20101219_AABSRN li_j_Page_099.jp2
e129ebd6d64c96c969ee19f6794a7e35
6e305ceb472ad7d46a9bca7f970d20be73974304
129326 F20101219_AABSQZ li_j_Page_085.jp2
60d45c9541281798ffba8788edf5fd5d
6cb50d711481e033c744149948dae1acb6100f31
F20101219_AABSSC li_j_Page_011.tif
c40034b7098c553425eb8ea56891e1cf
573372a6bc18dc5b0248673d056f75f8787b549b
139464 F20101219_AABSRO li_j_Page_100.jp2
969a426d43f53ef8554ca20a3341da84
2cfed42627aa8a4b33aed9359d26974a7d174ee9
F20101219_AABSSD li_j_Page_012.tif
34d18d283e0450ef41de5ae58ef00243
e49eb80855e441b9f336d55f4bfed9f410cb8962
137414 F20101219_AABSRP li_j_Page_101.jp2
5196bdf0bae50e1c941c52c8bc1c22b1
edfc21c0d6a3a2505b20291459de0bb5c72ec8b5
F20101219_AABSSE li_j_Page_013.tif
f45acab2f0151e6778875d8895524a39
9eb2631879d0e39d24c2a7124307cbac4f0df75a
83694 F20101219_AABSRQ li_j_Page_102.jp2
828acdf0c96da30919bd9eab960bf515
3296b50d8aa2f4c1cf8c586585d9ea63e82ed81a
F20101219_AABSSF li_j_Page_014.tif
3f162569109291839ad29285f5d71408
2deb583d4c7edbaf25303b2acaef2cd8408c97e1
32033 F20101219_AABSRR li_j_Page_103.jp2
c4b1fbdb0c6888c32f93ad1759316116
0301a6d9c4cb036a2b66f11133b08b748f494bf4
F20101219_AABSSG li_j_Page_015.tif
014dd5c66a1bba571c061a9b8f1f44f8
09818c5d90f541e727f2796b3b3efeeffbda4266
F20101219_AABSRS li_j_Page_001.tif
a7835757c30c5e0d40c039e6ef2231a1
2cec2877de18ac3ee374cd260747342e4e6d651a
F20101219_AABSSH li_j_Page_016.tif
cfe18bd7658b42319e95aac8bc511914
3473bf45a8f003b1c2ae60aa2b89f9c17d69e473
F20101219_AABSRT li_j_Page_002.tif
db6513f5a983111a3f54ebb3d97d2385
9377a546e372ea1446b5bb18045d8886f2ec83dc
F20101219_AABSSI li_j_Page_017.tif
f0e1ccf5742546ec1e004a0444a74abc
380dfb9e11e989a74c42fab8960384000e9b47f1
F20101219_AABSRU li_j_Page_003.tif
e26c38008308925ae8967fde8ce2c8b7
3d5ab749ecd700ad416b7269a3cd5aefd9890e5d
F20101219_AABSSJ li_j_Page_018.tif
ebb2451f3eb4a212d506350cd3041b58
c9ec2f782cf150d646032bbac112a47cb0f864c5
25271604 F20101219_AABSRV li_j_Page_004.tif
b1a9e642490e7d786bfc1639268bf19f
cd048f7e9c9e99a0c3f0482153162e06def0bdaa
F20101219_AABSSK li_j_Page_019.tif
c70d05f60ecb1974809c128f93aa4910
df37e869a80ac17361a2997ac65e41d85226a2fd
F20101219_AABSRW li_j_Page_005.tif
506d95259a95f0f7cf5b90400f91f262
440f7f3ba3151428c8eb33912a579169407cb57d
F20101219_AABSSL li_j_Page_020.tif
d3544f89bb6567cc9c52164732dbe96a
fa8a9b925fa4ec5f4d03fc11ab1ad470632d64ee
F20101219_AABSRX li_j_Page_006.tif
0e2b04afedadcd0f012c4f5bb333dbb4
458d167f39d4ba262d8a79f2d4f473f8bfffcdc5
F20101219_AABSTA li_j_Page_035.tif
2b3c1b31294b21993b3c3641f0d595c0
6108673e8fb197adaa9d6b1e717f9e14d82422a4
F20101219_AABSSM li_j_Page_021.tif
e2dbb379701fc19a30ede262db9ae9fc
9773ebf37637581b4bf5812026c6c75b307ca411
F20101219_AABSRY li_j_Page_007.tif
01e0ff7db3768c3447f9c59fe1f91ae8
98ecc11ebb75910afdd6207dc8788016c23ac47a
F20101219_AABSTB li_j_Page_036.tif
74fe0dc730b382c07efdefc2a2d76632
ec881573bd84b00a99d94bd7671d0e762436c02e
F20101219_AABSSN li_j_Page_022.tif
34512cc7840df221233b9007632b56e1
9a95f75c75ad8ab20872b4f89d4d22d454d74ce6
F20101219_AABSRZ li_j_Page_008.tif
ac21ff6836b6dd2585b313443d66ff7d
4d3aeaddc8c01aee4022945473cbd1676064c567
F20101219_AABSTC li_j_Page_037.tif
2bedb8e0901a5acada7ad9bb58eb6f52
eddaa137be2a82fd9061aefd98f2e13100637f8c
F20101219_AABSTD li_j_Page_038.tif
48ef08904d3a80db14a2f53d7959df12
7a67c23df52f6ce828aea47f5fe8aaac3e505dc4
F20101219_AABSSO li_j_Page_023.tif
1a94a614231df8f2d455b35aa4ff7adc
20a6616067809136dcc8010e913b6c64c1dcd3d4
F20101219_AABSTE li_j_Page_039.tif
21adc8f1b976d81fe7f64e6404ab56c7
394c7c618d98e893dfc5b18991173513fe55897a
F20101219_AABSSP li_j_Page_024.tif
332ddc02849a7fd371ac5b8d05c503ef
b3f5a4ec546643938d496cd8d6719a0b64b3e007
F20101219_AABSTF li_j_Page_040.tif
c8bd68dc022ca102457c59c33e39e6ec
7c59f142b0311158b51666e6c7361b6f9dc875ee
F20101219_AABSSQ li_j_Page_025.tif
7404224d7cc7b116e93c6889b7a512e8
2bcdd9cbf19b6ea070cfa6c422528ab84aa34234
F20101219_AABSTG li_j_Page_041.tif
682f15f4a2b17c11f2a21035124cb5b8
87f3fb2f9504f4610030b5ecb08598327f7f3196
F20101219_AABSSR li_j_Page_026.tif
5d40b7ef78c66de2d274c2e802c8e2f1
daebe84f7853014891c37512360e0f2ee9897ac7
F20101219_AABSTH li_j_Page_042.tif
c3cfce33a5d74ceab19927b8f5a49ca5
ca32637063f830b6c373ebfdacd6b682a46c81b0
F20101219_AABSSS li_j_Page_027.tif
d9d026ee32c5ed1f3f51d7797489e3e9
7f44773e7ad81afb2fa6c605bdc1c4fd689b2172
F20101219_AABSTI li_j_Page_043.tif
48c1ecb3551992b6348ff0f6de1b28ad
b89a7df0394c4a82a344601704334c97911f2554
F20101219_AABSST li_j_Page_028.tif
e23298e76316a1b4ef6de07cc6f2249d
b74d5deba72f70307f3a2931b285d9c333c3864a
F20101219_AABSTJ li_j_Page_044.tif
ed69121af95457c53b8707cd8725077b
5aceb96ff26a4ed68de3b661847770c25c526c7b
F20101219_AABSSU li_j_Page_029.tif
afc24f722c8c0a5a01f5136dfad4e443
e0ba167c10640d01ffe98e5d329d365af4cbb7f5
F20101219_AABSTK li_j_Page_045.tif
697f75c5a9a69ff11efe3ffa984944fa
73c5395ad7ed6578bc0617e7718cb1894fa9d090
F20101219_AABSSV li_j_Page_030.tif
b3487949dc424394216d7bc5687523e2
bb2bc0ef2269672bbe211c3fd443b40a5cb613ac
F20101219_AABSTL li_j_Page_046.tif
e10590e961ffe1dabed01b92097cbc6b
282510ec843959bc42d4ab129aea2e36b851c848
F20101219_AABSSW li_j_Page_031.tif
7697bb056c66df30cfe472c6f3a45592
f4d7158ad30b99d916437752ba40e1be1b1d86f3
F20101219_AABSUA li_j_Page_061.tif
46e1b13676b8efcdaac3020910992ca9
5495bfd945defa2dada40a17c57bfb4791fd749a
F20101219_AABSTM li_j_Page_047.tif
f8a21067e2269faf64c1b3256c60531e
e3364bdb8c24140cd13fbd2947251db06f9bd486
F20101219_AABSSX li_j_Page_032.tif
11c4fdbc3660510759091b8def91de44
295904b051e5cbf97eae6a1c1895a63a1d624f40
F20101219_AABSUB li_j_Page_062.tif
0076ba8dad5ece58f374c41fca814ddc
355ad0a6d3b656327a29ebbf79155c8f35c7e4aa
F20101219_AABSTN li_j_Page_048.tif
5cb5984f04bb585ae62c216b2cb5cdfb
9fba0cf7042e38a1d1bb68046ab736e9e4cf5c1b
F20101219_AABSSY li_j_Page_033.tif
9c9c9877ae42d37e71fc3c8e7b2306bb
6d7d18b5332ea97961889144cc167f129e2f12a0
F20101219_AABSUC li_j_Page_063.tif
0c600f09fc7f78d0a35b8a48b169f173
25e49341f3323235f264c437670416e574f592af
F20101219_AABSTO li_j_Page_049.tif
ce92be38ef1f08edac6beb4873687662
fd228ebb275443b2982806108c5b9c6a406dd63a
F20101219_AABSSZ li_j_Page_034.tif
5c9c0ce866a371d87ba09dc6d1579e0b
655451a4a478cf39a78cc126333c8792ae64e5b4
8423998 F20101219_AABSUD li_j_Page_064.tif
c61906e63e016e024500cc7517b97912
c4eac04baa9689cc9328a7312129f9d2bdc08c3a
F20101219_AABSUE li_j_Page_065.tif
2e22123ac563221aed7028b6df3842fa
c02069dcbf29de44710c8057c030813915743a13
F20101219_AABSTP li_j_Page_050.tif
f1f302f79d231e8531e3dcefa145dd85
0b75ca4e62700c6c13ee4183c0d5178bb0a6daba
F20101219_AABSTQ li_j_Page_051.tif
19bd78a4fb2d9e077fbca059978c075a
306cb7b1f5de8ac58c4ec9ddeaa984b5a313b7b4
F20101219_AABSUF li_j_Page_066.tif
bac61d156430f5f5125bc32460f9470e
7ad9c0f33817d3ab4fc64b7758b0a67ec8ddef03
F20101219_AABSTR li_j_Page_052.tif
978742f7d8e7a5cfdb002895adb8f6ba
ad44eebbdf7ddf401602b826b7a9e94d5ac7736f
389 F20101219_AABTAA li_j_Page_011.txt
5b9f604714802c85188888ca47239ec1
517b67918a879e8a9bee55c91d4da13c20ff03ed
F20101219_AABSUG li_j_Page_067.tif
9d074be47a8974fefb51b613d96a73ac
5400496e2ef2b1599a58f1d8374f3e068c316f8a
F20101219_AABSTS li_j_Page_053.tif
3221f0ef63bc853bdc90defc647b40e6
5dc803faf647eb5ed7929a7dc5c0c87eb4381272
1951 F20101219_AABTAB li_j_Page_012.txt
1455d300846589956bef69b628901926
5fa528b6bbedd10fd21cc61b5a28145563b822fd
F20101219_AABSUH li_j_Page_068.tif
25d9f7a000e6660c9f4be5cc13605904
183dc4d9b5c5e7e3937efae0c15f02826b4e7ac8
F20101219_AABSTT li_j_Page_054.tif
133b357c83991774201ed2d11886cdea
279b8b514324d6c9af38abc8382cb2f13c0aed85
236 F20101219_AABTAC li_j_Page_013.txt
047a3694466af9724f4e3ec7e1089eb7
4262ba87bb820c1137b22deb9c255bfc8c076d2d
F20101219_AABSUI li_j_Page_069.tif
8d4982084b36d1d45b720152260868a9
8479740f960dbae59c4a6ef72aac76d063bd9224
F20101219_AABSTU li_j_Page_055.tif
43d793dc6bcefd65b7a5e9d65e2c1d33
1bca7bc8fefb57cb74de8d8660f56125e38ffab3
1301 F20101219_AABTAD li_j_Page_014.txt
4eaaed249dd5f1a3b6d520f4f70979f8
ef1dab806d398f1fc62de19b20a92ad6da7bc3f2
F20101219_AABSUJ li_j_Page_070.tif
ba9e29e392cb7a221fc56ea94d636c61
25e3dfad29c9e1049f22cb5c9d0289535614a809
F20101219_AABSTV li_j_Page_056.tif
2e8b944c491791b32591b5188132c3d1
73ab0648fa712cdccc084b86f8cd1ba17ec13527
2033 F20101219_AABTAE li_j_Page_015.txt
ed22d1cb0ef75254c3cfb8b78b3451b3
c09d353dc1304f481eaf9ac5f3f8e5c53bd8f6f7
F20101219_AABSUK li_j_Page_071.tif
445883ee3ecf35d4a178fe67a8048ddd
904f85f570c30548cc6a9d4490322b4ad51a7547
F20101219_AABSTW li_j_Page_057.tif
bdd0b946e6cdda9342c6f01a6a244e52
cc7a9abe10b5f8cff84463488fe8ec276cfa5962
2126 F20101219_AABTAF li_j_Page_016.txt
b3edbef8ed31354e54a71f6fb29e6569
384d089b93bd24a95f79c442c2e30279a579315e
F20101219_AABSUL li_j_Page_072.tif
35c5cdc97f93b3502ddc4bb55d0740ea
bc35d5bb7f4de30c4372724667f3c91257e26bfc
F20101219_AABSTX li_j_Page_058.tif
28aba2737101bb17b37b3c5d668b4e5e
2bda9772804fb8b78eae04c41e4efde93605ca25
2138 F20101219_AABTAG li_j_Page_017.txt
ac178cf947f46ffbf4deacdb62d98ff1
b4de650ed5904a55e978296488608c36a3861bbc
F20101219_AABSVA li_j_Page_087.tif
251b30d8287c9bea584f723f47caf83f
3d75f534814deacaae07613820a05760bd1d96f3
F20101219_AABSUM li_j_Page_073.tif
9698e20097d166a71ddd1e0e4f58b099
8dd45789d8406e9d0c7b6a639d11d12b8d9e6c7b
F20101219_AABSTY li_j_Page_059.tif
7e51641f1590ce0512a264c8e9088408
e82394930a1f5786facc9cde184a512c1d4f0826
2121 F20101219_AABTAH li_j_Page_018.txt
42dd6eabbf3157a23d21c39457c9f5d0
3b0b1b71434a96ae74c549043e58f69c4ec5f070
F20101219_AABSVB li_j_Page_088.tif
f59c6bf4ac3e9d8b526bacecdd988f31
73a0062ec8263b8e140f81b3fe4f923f08111a67
F20101219_AABSUN li_j_Page_074.tif
b16279e1da27c72c554615e243761e21
aaec544c31ef0765defb63987e200dd35d2b4eba
F20101219_AABSTZ li_j_Page_060.tif
258bbd61f4be7827529e490888eb862c
a5707f5961acd02c0ecb1d9f44a2b174363578a4
2141 F20101219_AABTAI li_j_Page_019.txt
ad49d195fcab7e3a876e285eda9c50a5
8bbe32d1f0fdb8111eaf1275d8d29f65a06500cf
F20101219_AABSVC li_j_Page_089.tif
7245af14c9cbd689d740262a5c580abd
4a2dbf7da909ae548c1be5757c983d2e6bf19df4
F20101219_AABSUO li_j_Page_075.tif
6952a3a34d8d627036d9403d6355200a
8d39d6b84c6e5a017bd91ef41e8c0f854a7ec2d1
1999 F20101219_AABTAJ li_j_Page_020.txt
fd6781a5c9a447bc740f0ebdf8aedbbd
80a0afd8373c6b47da87cc7bebf579db122b5089
F20101219_AABSVD li_j_Page_090.tif
7bdf79d1aa21069412aa9fdd51336f19
c5a15ccc59b6099254afcf8bcdf35851e6f14057
F20101219_AABSUP li_j_Page_076.tif
9672938aae5d94659d276a0cda982fb3
e4230baad53f7d09cd5c49499c7d61f1fd50887f
2252 F20101219_AABTAK li_j_Page_021.txt
38f98310f5c7216d3ca4da08cfb2e7cf
6b2ef899faa5cffc49a2148af4a96ddea0f246d2
F20101219_AABSVE li_j_Page_091.tif
6360317ec2affb8587091c5b9b2653c2
5403b16b7b777b65c47a7d8d27bf8f5bae4ba653
2144 F20101219_AABTAL li_j_Page_022.txt
b6178cff7a1297cca58ef4939eeec7c4
14f0d01a81a3d090f2b31be94fab1b350055a71e
F20101219_AABSVF li_j_Page_092.tif
376c52ab068982bc4eb8aba1dc3eba76
62a9c1a1da94e8a5e4b7eabddc64bf0b9fecead3
F20101219_AABSUQ li_j_Page_077.tif
0bbed92edd5fdffc50b53a1f682d872b
10042bfceb6b555fa5f2024b1e66acc7fe19a9c1
1890 F20101219_AABTBA li_j_Page_037.txt
05dcd0a343d161686b2da20f38aa7d57
7c8d49cc59ae5d575e079d72a461c5325e3bbd61
1978 F20101219_AABTAM li_j_Page_023.txt
39ffaedcf840acfbdd40a2ea257b0f86
ee74907d892488803b9276750328538bbcb25adc
F20101219_AABSVG li_j_Page_093.tif
e711747b146e3f0b487ef58cdf116f09
e8aae5e773f33e8762a0c2c180785fbf48a3a794
F20101219_AABSUR li_j_Page_078.tif
aa05306359582105f9c088635175f082
818836d4997e7949d7ac12e1dcfe392667e5e039
1990 F20101219_AABTBB li_j_Page_038.txt
17a890f860b74b66a4209c3c4ff299a5
3a6b4bbc58b066e9967da6bd327f485f060c1c94
2124 F20101219_AABTAN li_j_Page_024.txt
4245e8df2656c7412c71b37b709b4a60
17df01163e3ba22553d1fdc4bf1a05d669a6c92a
F20101219_AABSVH li_j_Page_094.tif
1462b4d159a02486e90ece69faec0f4a
b75f48735a2e69f2e56bed633eaa2523e32ad701
F20101219_AABSUS li_j_Page_079.tif
4b6d615d2ffabf84ddbc77d1bfb81002
533ace6b8bc3aa2e92ad47aa13a82ece099c88a3
1967 F20101219_AABTAO li_j_Page_025.txt
e09e53cc7290e36cde2bbd0084d17d50
ecbf0472d9cb5ca0f2c3291a6be8bc8c71ea2a05
F20101219_AABSVI li_j_Page_095.tif
6c6383a9cae60faeffcd8d88d8e0e146
cb6a531632bd317373ccc1dab62c08a3ba54c070
F20101219_AABSUT li_j_Page_080.tif
61abe192df8cefa82bcaa6545bd42512
bc34e7b267ad3dc8bcceb5f656879b4565703b1a
2089 F20101219_AABTBC li_j_Page_039.txt
a0855a372fbcadcf6d1756033e00379d
1fbb9a174f3496b56719e7b84182525730c86796
2115 F20101219_AABTAP li_j_Page_026.txt
f8097868749e7b979d40785937c87a6c
89a0c5cec493271db7135da45464905f32b9d4bd
F20101219_AABSVJ li_j_Page_096.tif
41bca34c0da002501ebc33b948e54bad
6a8b2aa3ec015b217ba9c1f036a9d75621aa4a85
F20101219_AABSUU li_j_Page_081.tif
9f3f40781766e33f58b61481e1532ba9
430acff5d6f728e01f9e9924c0f0d0425f2a5dab
2049 F20101219_AABTBD li_j_Page_040.txt
f699e7ef2e780153776f3ff5cd5c089b
da564a6015fd426122dd402effd7f9259da449bd
2065 F20101219_AABTAQ li_j_Page_027.txt
1b316a87c1c37aeeafce0ae639afaff2
20b054d5f58535b11418976feeee325f4f7c86a8
F20101219_AABSVK li_j_Page_097.tif
12fbfdf8a20447726c88e7ad50378382
5aaaf24b52c747d5b30db547a90aee2891af6681
F20101219_AABSUV li_j_Page_082.tif
78eb5beb30d80e3eb49e71332e869413
a5dc89169e63d7736484dcf87a4cd3fff6538cf4
2103 F20101219_AABTBE li_j_Page_041.txt
94af2770a822959322d20890446bceb4
33da5528ebc339e6262e2393d5847dec12619918
1961 F20101219_AABTAR li_j_Page_028.txt
f8b63b54315bb68c4d8135fcc7e1d935
cece8cc7c79ba84249ecca099759d8802d776e1a
F20101219_AABSVL li_j_Page_098.tif
8d233ab133769fbe1a579e4049ccee7a
22f04203d69f91b6d9514b29e41f5d1ed5966a85
F20101219_AABSUW li_j_Page_083.tif
d6525206cd7c1057081727b20dd1e8ba
a87d189b5b36dcc9dcdccb91f7c72e9f4f719072
1829 F20101219_AABTBF li_j_Page_042.txt
be7fa1919f163db658b1730268e9c59d
0b2df57276dc4a5e8d0d5e47d5f97e69eb50464e
21574 F20101219_AABSWA li_j_Page_010.pro
08639b2775959e88bca1b625509a7b58
23aa0742a8d31520b2f10e12342441a208744b35
2192 F20101219_AABTAS li_j_Page_029.txt
e4b8f3ee1ea042ee5add813ce03d6151
a2f0b92e7be981aa624940db5377b0710aa9c1e5
F20101219_AABSVM li_j_Page_099.tif
16185c420897d0c55263733f0982a737
d3132076a88c5b1d958b7985ca882ebf6330453f
F20101219_AABSUX li_j_Page_084.tif
27ebf5d20527d357cd9c298bf8f69b58
7717a2b747725f636071d9e02af41692734185c5
1241 F20101219_AABTBG li_j_Page_043.txt
c4c39ce34b854b368523c321a1fd3e29
0887ea5029634fb846036f4e29718aa9c52d325e
8420 F20101219_AABSWB li_j_Page_011.pro
4140b2da3337e5a33b9b0a4d3d658638
92bf5f61de9844810c13aafb83926f9d45055dde
2032 F20101219_AABTAT li_j_Page_030.txt
d57dccc93e33bd774829e380644c3103
83d282cf4261a354f974dfe76ab424b2c19542dd
F20101219_AABSVN li_j_Page_100.tif
05a0544b11f29eb98356947dd44c8242
e5ba3d74844b8342ad953c0cdc5c2ef6ea880076
F20101219_AABSUY li_j_Page_085.tif
ea8f4cd7f02c99b9cd1d9e40ed1a4aa7
b4b4b8cc9ad28cc757689d6b3ff201fc646476e4
1002 F20101219_AABTBH li_j_Page_044.txt
d785c294eb00e9968abebb1d743a6622
0c2c9bb071c278c0c710a35c866a83125d4081d6
43991 F20101219_AABSWC li_j_Page_012.pro
efd094e8ee81eb6c68ab539a4e6ff37f
91c7f9f72d5c0aef8996f943dfe91d5804fda3b3
2198 F20101219_AABTAU li_j_Page_031.txt
a628756cc9c47210e01b399e215470bc
6609c1207fb578c8e17ab9b6cca94c31a3f8346f
F20101219_AABSVO li_j_Page_101.tif
75bae3da81ffe285e8a73fd56baab918
da2145f64453702f8119c0ea84e8eb50784f9760
F20101219_AABSUZ li_j_Page_086.tif
dff7840b5282b229d2ef250d77b9db72
0a2a979fd1da67414aacc813e7a96f7c63d0eaca
326 F20101219_AABTBI li_j_Page_045.txt
70de0dbe31bbdd40c4a6ae65051fc7b4
dc389f8e130548a84ab7f1f34c0b7dce53025441
5851 F20101219_AABSWD li_j_Page_013.pro
d5b4da1711c99d406b0cb0c78754c296
267381f1d20dce75f949cde52e6d759baedc5ad8
2072 F20101219_AABTAV li_j_Page_032.txt
d1537738f53e437bdbbca38d1609d546
c49ca72d5de60a3c56da9709267d8f346f8fc970
F20101219_AABSVP li_j_Page_102.tif
e2ff9003d742b4ce852982fb1e246f10
dee6bd8fd3bc341c15aff0cc48e96a923b32df45
1008 F20101219_AABTBJ li_j_Page_046.txt
f396b591107f04c2936e1b087319b773
ebe29abe03856805cae30cd241f2bbb1a3f5462f
30680 F20101219_AABSWE li_j_Page_014.pro
7ecf48186a722cbe27017cb12acdd0c2
5c1476bd7ee640233c4a1d0e18f3d648762f51b1
2052 F20101219_AABTAW li_j_Page_033.txt
9e1499eec1ee59dcb05b7c911959acb4
f23e2ce0103f650a6912799e1ecdcd07a570bba7
F20101219_AABSVQ li_j_Page_103.tif
7776bdbf2dad5606e16e9bf40a039db4
3f1804dc72c7830c49377d01d92774385dc3627c
700 F20101219_AABTBK li_j_Page_047.txt
b2d9b28dece9d6e207e9dacb367f5c1b
6b680657acd9363e7dd46a53b24d6f01284c69b9
48680 F20101219_AABSWF li_j_Page_015.pro
451f58471ba6076fcb3aad3bbe2bcdca
a6b11928d1e299bb0d898e4e301fd722b2e0afd3
1965 F20101219_AABTAX li_j_Page_034.txt
39ad4b4dfbca00de048ccab1e4c5ec4f
def9080d9b0fd51f3c7d84dd2e70afeb4cf5e4e1
534 F20101219_AABTBL li_j_Page_048.txt
438c8abf3aa64bf68967089bd9784386
07ee81933a50e8fd2eb794f1284d7e861dd15a30
54245 F20101219_AABSWG li_j_Page_016.pro
e0ad872f899c21f780838c93a0e382d1
24e03c7ace59004654dba8dae1abc42e5364da37
2123 F20101219_AABTAY li_j_Page_035.txt
c5c0a4813aaef9dd2b00f10728978fa2
09b00f68d200b7d766b109522e875e21a0b51a75
7395 F20101219_AABSVR li_j_Page_001.pro
79ed9337bd2caa2452efd81fac92508e
99df94ca65378cd07f7881142508fa1c2d75e1ac
776 F20101219_AABTCA li_j_Page_063.txt
54f4a713dd6cb8dd8af2c23724b70e61
99de040a32d8103a516361a0872e688f0661dd80
1942 F20101219_AABTBM li_j_Page_049.txt
795d262746b59614e382d72506440fd2
6dd7cb82211002bf1060c8ab0cfcfc1b016c40b9
54480 F20101219_AABSWH li_j_Page_017.pro
f3f3914e961a4ab6145fa8b4d07837ae
6b4daedd32d77f4ae5efa5abeb26b6d7191c18ef
2083 F20101219_AABTAZ li_j_Page_036.txt
c95e761f641eac2153b1ecb9ab7f9899
bb58ee588acec39a14954e88a36f3bab0b278aec
911 F20101219_AABSVS li_j_Page_002.pro
bad738adfd6ab6627af00fb27a7172a9
87e2d2a527aca2c7ddc5cc2b7b4e60200483f012
748 F20101219_AABTCB li_j_Page_064.txt
d657946d802030557bf3afaad57a8a9b
3f6ba22192b3554ce6f1605551d1b4b7c4452913
1873 F20101219_AABTBN li_j_Page_050.txt
0f85c6432d48b8f686f7f8c01b249132
b49d04a8579fba32eb13cde31d4bcd4f0a341605
54082 F20101219_AABSWI li_j_Page_018.pro
2e6cf9ea08d70d3fb9cc8cd5c975741a
d4e8811d2f88fc2fe091878938ee227668d871bc
28013 F20101219_AABSVT li_j_Page_003.pro
c877118f6b37043d11553fbe83e13ad7
01803de77c46af64804f460efc900d949e66e112
507 F20101219_AABTCC li_j_Page_065.txt
7630a49c044a4c33128924d2398a88ca
451536e7011d4c7a17315c411b2e789cd15720b1
2113 F20101219_AABTBO li_j_Page_051.txt
6e5096c26eda30645bc344ead8ab69b5
dd01d16912b5afa1ea56b63dc165f5018e0c5fc8
54358 F20101219_AABSWJ li_j_Page_019.pro
203e6ec5f97721e5331fa822ca4b80ba
e2598e772c7d4b6f18f5868fa9295537dba85687
96551 F20101219_AABSVU li_j_Page_004.pro
75ff8bfb7b6a9185b78ad2df1e302c36
80bed05e7519011f4db38a9cbffe49570e4242d7
644 F20101219_AABTCD li_j_Page_066.txt
d925b81ae7b6618596bb143bae23bfdc
9c578dcef1c9f61cfc2719a94808d07032198f22
424 F20101219_AABTBP li_j_Page_052.txt
95efb7465416a1d965f9aa15217184a1
b244d7bf0fad542929202f77264335c852abe568
50429 F20101219_AABSWK li_j_Page_020.pro
dca9a4950fbad07527dc0c441f1a8b4b
90be77e84ccd97c0a362ac96c6cefdfcaeed7748
70204 F20101219_AABSVV li_j_Page_005.pro
9dc548f3df7e9d39764e7c81b58c479f
3cd0d91922a8451363303b0bbc7a92955df0c8bd
536 F20101219_AABTCE li_j_Page_067.txt
27548aacae4be58e40d3ecb5256675a5
0f257b8df74b96a01d21af534a1ced78278cd0a2
1821 F20101219_AABTBQ li_j_Page_053.txt
632da5b926350f0513e290936feaf480
8656a70184465874af5d8316ac6e19a41cf4a127
57411 F20101219_AABSWL li_j_Page_021.pro
5158761a84ecc2d64e9da995f414bc2c
5c561a39e90940b6db729abbd0511aa10f5936fa
10865 F20101219_AABSVW li_j_Page_006.pro
c6b083e2226b56c35cd4c94e9a989f0d
d6a3cd3927499cd9b92dda1459692bcf6b18e72e
736 F20101219_AABTCF li_j_Page_068.txt
2586d6260fe2992095adbd1f59d8f54d
dc1f044d43507209c95e3fec1d9f6453658f07be
2205 F20101219_AABTBR li_j_Page_054.txt
655150dba7eac5954475cf549a0e6e84
684240508971efad13172c9cd6987bae0195a546
53717 F20101219_AABSWM li_j_Page_022.pro
bcbb18fa4e9ec36e08d32c431b797f61
bd4be37f53bda281516c93fe0643196b10cf7904
64609 F20101219_AABSVX li_j_Page_007.pro
60492e8ac6017e9d9117e9c8fc9c91fa
615a17d557dcff36f087534516c34ae0e7604ff4
531 F20101219_AABTCG li_j_Page_069.txt
be607540478af5be44ba7702aec4d8ba
7235ead421383c619d30e7d5de29b1b13df32479
52718 F20101219_AABSXA li_j_Page_036.pro
0b54dc642ea733d82573907ca5578eab
998654157e599a5f5489aa86725897912d3f21a5
2201 F20101219_AABTBS li_j_Page_055.txt
f0dbebd22dcf0f9a217104e531522174
9dd95418af85e4fa180f3f33e021447e5c820025
49719 F20101219_AABSWN li_j_Page_023.pro
ba86926c036eff00723f8c3549aaaef9
e58e88535ec7b8145b7aeef7d4e7176a82a9548b
8685 F20101219_AABSVY li_j_Page_008.pro
4dd7cf889b3be9f3f72cfa5c31fcfdb2
7f5a1036832a7118a2cfc6261a2e69bd3c6f50cf
516 F20101219_AABTCH li_j_Page_070.txt
8a1c1b337f8f1ad3646132e6a3c3a23d
74ed77ccde20e16f0ef199d5805a6ce422b3322f
47759 F20101219_AABSXB li_j_Page_037.pro
af56a61e5e7685f94a2098b392bee9db
e511a41dd54ba9829025ffce700d7865a2ba49b0
2232 F20101219_AABTBT li_j_Page_056.txt
35d9ab268f7010caf765feac4fc26264
1fa41dc8cfa7e640cbfa9e31b3b9fbae9a803211
54079 F20101219_AABSWO li_j_Page_024.pro
3befa7dabbcd02ec98d03a3efb85e737
cd021aebfeae6c2bc9de33ee7bdd0bcce97f20da
21221 F20101219_AABSVZ li_j_Page_009.pro
1864e6e649307ec867c65b03f932a8d1
9254a9f4ae2fba4b37f1be06328a340db00e0c28
532 F20101219_AABTCI li_j_Page_071.txt
02bcfeb624c6a463a5d46c4ea424b2c8
6f3683ad4977f79b5ae9352d9ea0d50d16335ac1
50183 F20101219_AABSXC li_j_Page_038.pro
17bd04ac865024c74496dc452cc24dcf
7fee51e1c2e9e0435bf5059baf132f89738d415a
2164 F20101219_AABTBU li_j_Page_057.txt
9efc5a364d87d04c83a436bc97163a1f
1568052e6e44d782e47b79abe2d4069a759c8d6e
49872 F20101219_AABSWP li_j_Page_025.pro
b18817499b447abf0df29e0abd5fde2b
743df0dd434d3c1c6ac9797d63d2073ca47a3ef1
1089 F20101219_AABTCJ li_j_Page_072.txt
f5158a2d5dffe58e5b08aef54014857b
162dcdae0c19909e782ced1ef7a8d36ab796cc6c
53108 F20101219_AABSXD li_j_Page_039.pro
63b2b4609212788b5a98aee0b2e54d6e
30ba13f9fe65dd1a69a5dd86abc3fa8956d94663
2074 F20101219_AABTBV li_j_Page_058.txt
4071e9b5edeced049158a982cf5b50ea
021c96df4460f4bce68a3ab4f75779c6c82c6c92
53543 F20101219_AABSWQ li_j_Page_026.pro
55bd58abf78c5add3aa5cb7b837334dc
7535b94b04e9efb0318e352769b21cfaa8fe4f83
693 F20101219_AABTCK li_j_Page_073.txt
3c3997687fb4bd42814165c0469cc680
0b9d9ae13185e7247d3132507480bb89b91005e0
52035 F20101219_AABSXE li_j_Page_040.pro
83a00e8351d4574535b38bfb60abebbd
bfcc9214eb9066c97e85451ad5effa54fc0d0ca4
885 F20101219_AABTBW li_j_Page_059.txt
f7ce45b7466442bdd3b89efa7fbbbd4c
ab31294e743bb2a69e33e79927111f85505e2d42
52495 F20101219_AABSWR li_j_Page_027.pro
38fe9c203c95463ba5f77dd2d7acdf1c
ed330ab6af27fd5d63216e1a3867141f813a1939
758 F20101219_AABTCL li_j_Page_074.txt
ad2da87d120815ce03972c2257f462ab
ef3d169f00367a6246bb7e3377b9e120799ffda5
53275 F20101219_AABSXF li_j_Page_041.pro
144f0dd2f31994542f384597f076c737
ed892381da5bf27d1cba428471f4ccdff85ea5e1
434 F20101219_AABTBX li_j_Page_060.txt
0e19752a9d6ceb7f8b2009c3718b2d44
6158d9d8e8bd5ce0c9ca1696ab26bc2140eff486
2354 F20101219_AABTDA li_j_Page_089.txt
8e848c3a49701170d780bcc8c081d43b
359e0e17c07d4a91f007c936c1f0eb136ab677e5
677 F20101219_AABTCM li_j_Page_075.txt
93aeeac930327587edf603ef33bc10c9
095cd13340ff8f355d541c192c40b316342a54da
46058 F20101219_AABSXG li_j_Page_042.pro
200e20dd7ffa0f95f976d9143010c1b2
32be451ab87271a325f1e962a53abec798a8eff3
590 F20101219_AABTBY li_j_Page_061.txt
f88f1cceb78a0d1adfec7afb33c5c14f
8bc7dcc99350992f630752152e235372f4133daa
49842 F20101219_AABSWS li_j_Page_028.pro
11a940890e971eb6746f568c86cb784b
087d2f35fad7f96688713b85b3961e4e2e965e20
2540 F20101219_AABTDB li_j_Page_090.txt
9742881ff65807d3b11f0b786ab69480
ad121e24fe5ba8357bf261151e2971caca75c1ed
740 F20101219_AABTCN li_j_Page_076.txt
ea080ae2d59785e1e82d0b4aa3ccd5a7
22b497d6abfa888c9a361ba1fd40fdd0ec186faa
30587 F20101219_AABSXH li_j_Page_043.pro
c361bfe04bb0202a8213921104ea2116
943c62930deb62133bd6e363b608e543f95705d8
717 F20101219_AABTBZ li_j_Page_062.txt
c304485f4723509f16461b12debd2cc3
04d207d0404a5b35fef276430b0f145d4c95a41f
55812 F20101219_AABSWT li_j_Page_029.pro
6c11ab5626293ae3901230c6343e718b
0cb035e0c7e3b88d87abd8eed5094e732059a9b4
2477 F20101219_AABTDC li_j_Page_091.txt
0cf7f208db53031ace5fa7758cc563b0
0c66b842a4046a950cf19efcc5c659218a4747c7
489 F20101219_AABTCO li_j_Page_077.txt
5ce24630d65eb11d9702b599ca305024
918f8fe5715ad1dda546e39bfa3793a153322e14
22729 F20101219_AABSXI li_j_Page_044.pro
56c81488628ea2a12b8928c023cfeaea
f95927dbbc0d267a0e742b05ada7dc1756877db8
51707 F20101219_AABSWU li_j_Page_030.pro
6a2fe19464cf9518a99210518ad6b6e2
64e91d57252ee255f2df5059dafdab6269c3b4a8
2569 F20101219_AABTDD li_j_Page_092.txt
ac50504b56350ee43116e029b320341d
3ff0565a2e16c2f98fc691fe0012819b54ea58ed
518 F20101219_AABTCP li_j_Page_078.txt
2b1516c8fc399ed5990c06031b17ce07
f22168feb94b6f89cc8ddfd77498d5d0908de349
6540 F20101219_AABSXJ li_j_Page_045.pro
9253bb4623d40604a5dae10136098d81
334b59b0543f3fd47259aad8b9cd79210d84e279
56122 F20101219_AABSWV li_j_Page_031.pro
e11b4b28d8a0d2dc5e7de98850d4bc40
d1525316d9325fe63b806f44b97459656150f142
2509 F20101219_AABTDE li_j_Page_093.txt
3e008bbeb2bcc4a01e119809ae60e291
5e9042ed7f133538d74eefc5cb328a73c2c22d94
701 F20101219_AABTCQ li_j_Page_079.txt
64b98fd6b1d3dde110ed52c376f55940
8faae9640b6fb7314ee3c71f414768692091918f
23509 F20101219_AABSXK li_j_Page_046.pro
332c4392d40c78774e39695c8e71abf5
9bc19e16c63d73a07bb8584fc4b321302de6122c
52482 F20101219_AABSWW li_j_Page_032.pro
5bf38196aa8d73f5f72aec815525f1aa
066a3704192f74d786daabb30b5e388734c038c7
2461 F20101219_AABTDF li_j_Page_094.txt
50959462e8448132ef416498bb165d35
8e1732540396e74697fc9d7e65b16c023335ad52
2219 F20101219_AABTCR li_j_Page_080.txt
d80b3db7f1c1ef3401a7563df35f30e4
23fa9076748d99f5fac1cf9fa201d6de21ae1aee
13534 F20101219_AABSXL li_j_Page_047.pro
61b30c2ab9a8a333a92eee3b8adfae07
cecc2bb61fb40665ea3664cf09270ddc685e0674
F20101219_AABSWX li_j_Page_033.pro
cb26791a9ec095ac3d7a940d260311a3
96eba0ac7def2059f228630ce9be02a676dd9bd7
2321 F20101219_AABTDG li_j_Page_095.txt
9df8f93650d70497beef751007b8adc9
c66b3e68393269ff0ac12b58dd7279d62a4bd759
13268 F20101219_AABSYA li_j_Page_062.pro
396264594c451ce71344055e8889f0f3
9b2ccfac6105094a66bc21ba68418b55af4ffe8b
2147 F20101219_AABTCS li_j_Page_081.txt
8920b72615e4fc8c626a7b926359ac19
cc340aa9b4eb044d1a71fecc21231af3d27cdded
6316 F20101219_AABSXM li_j_Page_048.pro
17f9e16ad1a1b100e0aa355e245b6773
932909c36b92a0ff7ead99417ec97c2773bdcec3
49515 F20101219_AABSWY li_j_Page_034.pro
a5e4e69762837f8fc209951d36e860bd
a0ad6c69cb2c24e8df9ae29034a58bbcee32d940
2545 F20101219_AABTDH li_j_Page_096.txt
3de78021d1ccd21832e28add80ee3513
3865a5dcd3f074f32b3a7240a770fd662ad988e2
17493 F20101219_AABSYB li_j_Page_063.pro
0a788ba3ae1eb56ea59506b105c9b528
7a1234d73ee2730d225c7bb500932bfc37c56c79
1188 F20101219_AABTCT li_j_Page_082.txt
b9279425f8789d24ac42cdcba34cb566
bde392d5d9098150f89f0255df5928c3d6bda9f0
46258 F20101219_AABSXN li_j_Page_049.pro
951469626a8cdfd3e69006e04dbec330
9102551f5718eae4604927f2197382b19b8cb7e3
F20101219_AABSWZ li_j_Page_035.pro
22a2daa7c520b8ab43e81a2857b24185
6a3acf4dcb941a6bbb3e05757d01f0cdc1f2cdf5
2494 F20101219_AABTDI li_j_Page_097.txt
f2f78441450ff30b698de4e8513bd723
e94bc8703ecb210c0fabfbeab64d75a101689467
13683 F20101219_AABSYC li_j_Page_064.pro
9af8404e77010cf96a0fb7acfa0727d0
b3ae7b48c8aea285610022a13f50ca30e5a5e790
1855 F20101219_AABTCU li_j_Page_083.txt
4f6ee1550962ac622eb75479d042ac2e
bbafcd466106c1e202f597c6ce63210efcbf5f01
45611 F20101219_AABSXO li_j_Page_050.pro
49d2c5cb46e68db8923ab97102a042ca
6f2906abf14feada71819d74013c3643bc53e3b2
2584 F20101219_AABTDJ li_j_Page_098.txt
e70e5eac404ae99cb4a4815a665076dd
621a311405296e1bacf28aedcc2f6116241e29cc
9753 F20101219_AABSYD li_j_Page_065.pro
9973a3b68cd99e9603252c48130f0431
fbdd1bbad54476618254d5bf4951da03c1a24772
1554 F20101219_AABTCV li_j_Page_084.txt
6b24633a23892d123be457ac620b5ab5
e989dd3aecffbff7a38c0386f1bd3f1437a3b252
52061 F20101219_AABSXP li_j_Page_051.pro
126b2cc3e2aa59989018e18d90ddd007
87968e5608d2f1f777e63d3878c77bbb70807d47
2715 F20101219_AABTDK li_j_Page_099.txt
222c48cda7f58c3d291cf46f1e846287
9e6b9636812fc6b137a1692bb246b08d2d71cf4f
14643 F20101219_AABSYE li_j_Page_066.pro
6f5d9b75d0032455c44b0ea0fb600e1a
e5dcf22ddf7808d49c7a367ca3200bae923fbcd7
2479 F20101219_AABTCW li_j_Page_085.txt
1963c6b6d8d3c6a57763a12e50aa9db2
4b35ef763361b403181e8ddee94db3a224352f75
10563 F20101219_AABSXQ li_j_Page_052.pro
b95ce407e061bfdd8ee51e3044fb4a96
12013f07abb7ef3fd965a464e6337e5e379d3252
2608 F20101219_AABTDL li_j_Page_100.txt
59b8adf2066624a6dfe309bcba29c253
2c6d682b25ec0c937e14212c2b562bcc948b95b2
8931 F20101219_AABSYF li_j_Page_067.pro
a2d935b0c50ba0de8edf116c51ef893b
a98fb842bbd2dda3c73af94ae3604a40f9427cf3
2541 F20101219_AABTCX li_j_Page_086.txt
e659baa01162bce32abca4ad62d2257e
fe8de57d9cab1058216acaed2f94e765cd46ab22
43200 F20101219_AABSXR li_j_Page_053.pro
26ef3875d0b80dcbde9162978c350b35
4bb68529265044955a1ded494c54953b13127d77
2553 F20101219_AABTDM li_j_Page_101.txt
710d7b18decae993c94264fd90656ed7
fd78641091cf052a2836a9778afc66df7c4800a8
16355 F20101219_AABSYG li_j_Page_068.pro
db0adfafed3e4d8e53ccb7b7388282b3
a112ae080a3915466e253346f3ab6b5d1c808b96
2476 F20101219_AABTCY li_j_Page_087.txt
32c1c6b8112c69e0d72c215aa7f340a9
4cb2bfc0e9e877a41854261e922d426b6646b7f7
55489 F20101219_AABSXS li_j_Page_054.pro
96e5c60c5e447093f6d7b95d2a0d5910
4d31d28f0a85e1726b5c2231038a56bbc53a5cba
6258 F20101219_AABTEA li_j_Page_006.QC.jpg
fc3afa66f534076beaed48d6f7e7ba94
d8ea0614dd0dd1e21134d0ec70ca45c312b9e4bc
1516 F20101219_AABTDN li_j_Page_102.txt
11ab237d56977da42d7a996a45bdfe28
bc6cd70fca170f2a4bcf9f489d3ea16bd92f5dc4
12015 F20101219_AABSYH li_j_Page_069.pro
75e2ef0c4a4507b77e301d7c3acd85a0
7073aa79f30c219d0499c119d593a8b42d9384b4
2655 F20101219_AABTCZ li_j_Page_088.txt
c6a3b781ef4286f82c9a76a5e12a29e4
62329fed1304109ffe3f85d06172a49f16d4c628
1777 F20101219_AABTEB li_j_Page_006thm.jpg
eb8343730e7868acad65e10da285d1d9
07a626b11d88d74e1578cb689f0cbe176f07c289
569 F20101219_AABTDO li_j_Page_103.txt
0543f514b3710777cb80e303ca9ab86d
f7cce4d14e32b21e70b19b45da7901e546f4d553
9524 F20101219_AABSYI li_j_Page_070.pro
ff11a6b031f85e1c9379eabc139ef727
ab85d15d4c202ceada6baf06806248b60df405f1
55746 F20101219_AABSXT li_j_Page_055.pro
d4dc43c767244f0919550d95de19502f
c73cad7b333d7f4929cadba1c152008ea9ae2140
36377 F20101219_AABTEC li_j_Page_007.QC.jpg
a1465e4697119f8e2d53970f20698d86
2a99a80af6bc991a5a5e441d21b1ec37a06a0785
1901747 F20101219_AABTDP li_j.pdf
95ce49ee8ef3e9cd85cb71b1497ff881
6fd8cd7c633ca4ef7998a75604be4def6d489f9c
11465 F20101219_AABSYJ li_j_Page_071.pro
702288f9e2468b1dfcffab3b82ea087a
fd50dfe291eeffcc9226fc559b5cda5e03e7b5a7
56629 F20101219_AABSXU li_j_Page_056.pro
6e8ff8714a5923df1b07ecbd0072fd7f
56b3e0da07a9dc85aaec867f563f65f3a0804e02
8563 F20101219_AABTED li_j_Page_007thm.jpg
e71bfa1a6c7f89ae63329d46341f4170
b8f04870ee09a3f6532207ef33239e58166e205d
8034 F20101219_AABTDQ li_j_Page_001.QC.jpg
6d74ac3e6495677c0213ed77d7fa6da8
c9bf6f2285c7035353a2c9cbe4f3400a9e15741b
23029 F20101219_AABSYK li_j_Page_072.pro
cb2973c769cd2cf6d613d44dc95ee5ab
343051ce97df7e4c40a2aa27167700441cbacadc
55272 F20101219_AABSXV li_j_Page_057.pro
ec20d7b340db49acbb0f963f29437b3a
8fb599cdf4768bcdf7231f43c4a606d2d6e4fd55
6469 F20101219_AABTEE li_j_Page_008.QC.jpg
3fee91eb5eb046b5ef90dd738275668f
a8da597d2c90949e34b2f7d4a70013d5aaf7b946
1919 F20101219_AABTDR li_j_Page_001thm.jpg
24320be9dd11daf16356960b48bccef2
46d2fe4ed84333c139cebadd1b3086d2f96850ce
9254 F20101219_AABSYL li_j_Page_073.pro
d52145ebf8e542bd1b3bcb31172b55a6
42940b7b6aedabd209da87b4dc81bbb9de92ebd8
51568 F20101219_AABSXW li_j_Page_058.pro
5b86107ba5636120862dd31e645ef61e
b9fa3b4986b3352e3cc87250883686798f603095
2006 F20101219_AABTEF li_j_Page_008thm.jpg
71a5513800f24a810a7a03d9ac18272d
1820954181cdaaa458e4e657085676f9bad2484b
68125 F20101219_AABSZA li_j_Page_088.pro
e1222693d63af6d5c9ee3c478eab31c0
5daddfa08d25016b031c64272dab41cd30a5ce84
1329 F20101219_AABTDS li_j_Page_002.QC.jpg
18a3bf79d46aa57327c3b3c7c42f49f0
8725d9b495bf3cb7d1631ce02cbdde78fa10ba1d
16941 F20101219_AABSYM li_j_Page_074.pro
106d3a0ca508f2ede84eaba904b95f48
250a0cb36c16ce39ba0844a338bbfab9cceaf763
22285 F20101219_AABSXX li_j_Page_059.pro
6ce17deca55c161ccff18a5966079fa7
97dcf8acb31d456824b484ee4c8e7cd22f7b99f6
14746 F20101219_AABTEG li_j_Page_009.QC.jpg
e12f4a773ce3d7a75cc1b4e75c0c0d1d
cffae6cc57cad267f8ba9a6b0dc258067788a4a6
60255 F20101219_AABSZB li_j_Page_089.pro
06265d42d6007a4b888faf9c19acc980
04ba10546c142f53dfe6afb0fe39498e6a0cb60f
F20101219_AABTDT li_j_Page_002thm.jpg
021929da0787247a1126b15af1dbd6dc
cf421502ea87b353202fd8b164caa4faae06ddea
15470 F20101219_AABSYN li_j_Page_075.pro
ae6d1e5e6c87c7ac5eae06b0a43709cc
e934148f251252d43d012c4248e01ebd71ad95cf
9885 F20101219_AABSXY li_j_Page_060.pro
b6c9a87ebe8df249d33c4e579338e0b9
00b65805eee3b07769ed8f7b072e3c6ac1714e60
4421 F20101219_AABTEH li_j_Page_009thm.jpg
cad2425592aa92edf21b561edee5582e
8812d1a3193e3e8cbce8ce422a67b427d56513a6
19729 F20101219_AABTDU li_j_Page_003.QC.jpg
07d933d45c7615b4ee0df03f64dcf9b7
e59b2878bc1513e11189e7316d7e8af1855df3bb
13819 F20101219_AABSYO li_j_Page_076.pro
b8c152b2ccbdde33842a437a0e4705ce
724de95381cf038ac7025671fa73178894776628
13521 F20101219_AABSXZ li_j_Page_061.pro
5621a21aa7fb2ad04b0ba23246ee4f63
d61aebe8938d475b0e5d7430396f8b9c13840c83
16555 F20101219_AABTEI li_j_Page_010.QC.jpg
8ba747684d5ad174f32316bb601daf8d
56c2311496c1c9eefb427f80c977cebfd2e2a300
65105 F20101219_AABSZC li_j_Page_090.pro
d9158e7e5a0c6749d9da9a438ba74e31
08bf3c78e5ac8cd1373811860c094fc6121efb2c
5099 F20101219_AABTDV li_j_Page_003thm.jpg
e3c26d2fc67cab193e4e650c53711dae
acddae6d795591e925dba238488a9d10d989e418
10067 F20101219_AABSYP li_j_Page_077.pro
5c80e21b0abecf31037b1906708ff9ec
43a04aacfc8a1134a22de96c03da71c6bbdaed92
4934 F20101219_AABTEJ li_j_Page_010thm.jpg
631ccdde9ebace3ea84011664363090a
96c5c329d9ef578db878c06444affb7e09fd5bdd
63466 F20101219_AABSZD li_j_Page_091.pro
71d67f3a522ff6e21deed3434c126a51
bf9d93a7aba9b2b1d615adcb8a4d9a388d28d8e1
27779 F20101219_AABTDW li_j_Page_004.QC.jpg
314b7fbafacf549ba997adf5ffb5c787
e42d917ea4cd0a5c337ea1618a7f64785ced7933
11798 F20101219_AABSYQ li_j_Page_078.pro
8c511551156894a6ef0b3a3194f7e37f
138b64391170c678625070a12d7b07b7f9a96949
6484 F20101219_AABTEK li_j_Page_011.QC.jpg
ab3ebcfe24b25659abef585357a8712f
6817cafa225cadb29d1278a0ed5643d198ef3755
65870 F20101219_AABSZE li_j_Page_092.pro
38c3f09b8fea54f2490cf300e94c3e95
dc3992955497837715197ac486fd3674f6adb150
6649 F20101219_AABTDX li_j_Page_004thm.jpg
6eec66bb2d4a4506b2b15f6268adc1d5
3028f7ac813bc2eb610e254a29e8c9f3b678f657
12579 F20101219_AABSYR li_j_Page_079.pro
8802fcdc63b1b5a8d0637d13f6de6a12
d69b63e2ca09e6972aa1210217cf0d78ce2e836f
1966 F20101219_AABTEL li_j_Page_011thm.jpg
40aa484fedb745ec38eda98b18ea8010
355e24cf337d1beb526de892a3231e2580cabf32
64400 F20101219_AABSZF li_j_Page_093.pro
87f1c57678e9fa4cafef556b8dadb4f9
d119592631004c20c2e56499390ad88e7919ab97
23882 F20101219_AABTDY li_j_Page_005.QC.jpg
497e4d2cb8b96cfb4e960d59a622bfba
dd1a913f8fe30a4a816ed9ec3e7431591209e156
54550 F20101219_AABSYS li_j_Page_080.pro
096a7d2379a1d0e2cdd8daea3b556307
08a186b376561837772aaf32f732f8105391cb8d
36923 F20101219_AABTFA li_j_Page_019.QC.jpg
3d5f612a30659de07d08921875f29ab6
8b25698c6bc098986c631077948468160d61e106
29594 F20101219_AABTEM li_j_Page_012.QC.jpg
15b204fc4fd2ebb459e4413954fc4115
3c9c9ff275676bd681f2d4cd1f3352c3e4786750
63122 F20101219_AABSZG li_j_Page_094.pro
bd09eb38d593d1409418005a39c543b6
386f1408c559b1667151a6efc5dec71cade047fa
5745 F20101219_AABTDZ li_j_Page_005thm.jpg
13c752a64e51979c98100667309f70d9
abbf23489477f1ce727b57e35014067624beed96
54665 F20101219_AABSYT li_j_Page_081.pro
82ba0437ffb553329bbd41e304df4f9e
cd2b8d8a80d2eeecb2700675268a255daa333aa2
9000 F20101219_AABTFB li_j_Page_019thm.jpg
b75d566fc1ee1dea338bd0d0a5c4670b
8805e8a86907e3c970ad5daad184e4776b955bdf
7497 F20101219_AABTEN li_j_Page_012thm.jpg
26e75f1f0ac3db46747df807edbf826c
526a2730f7f2e36cb88ae874d52fc3f0e93c980f
59388 F20101219_AABSZH li_j_Page_095.pro
3ea28fcf42238e6827ef0fec53e97e04
fa2119fb36a045a7ca841bacbc5812a7c6f0795c
35574 F20101219_AABTFC li_j_Page_020.QC.jpg
fe3fc602dddacff1a461391394225888
1d73843913dca2cf7a58f3da2824379598326d00
5655 F20101219_AABTEO li_j_Page_013.QC.jpg
ab727620816dcbe1f534efcb99ab0003
890c7c170b27197944319e231e8592e6a9a8529d
65185 F20101219_AABSZI li_j_Page_096.pro
850d9ae31fdd8b43bede0d1cba919efa
5c878fe3b7eb55d0d44431f20cdd1ed1513dd451
29974 F20101219_AABSYU li_j_Page_082.pro
e8401f48e8da39fd74dc519c3355d939
de090b90e8c8311a79c4c3938616c904ced079da
8692 F20101219_AABTFD li_j_Page_020thm.jpg
5776c3bc2566d0031e1ff4b13ee6c270
941105bd8cb3800844d9e5ad32f6319520e03b2b
1465 F20101219_AABTEP li_j_Page_013thm.jpg
47052be869a09d963b6db004cfb86bb8
e65307c62b700286718e6b48098078004e88dbef
63941 F20101219_AABSZJ li_j_Page_097.pro
246c9e80457ff3a9b7970b107488af6b
7c3373641559824239e79a9d001b009c064d7dd9
44629 F20101219_AABSYV li_j_Page_083.pro
f9431cf8cfcd8e6a6a43f5087325188f
03fc6740526d5dd824cebe59b43a06facfe8604f
36994 F20101219_AABTFE li_j_Page_021.QC.jpg
12793b8f7e58819ad4da1468281e3470
1995583920f600ebb41db053a8d3dca143a9f4db
21917 F20101219_AABTEQ li_j_Page_014.QC.jpg
a4f5d815bf996185ccb7d6133671063b
0e27d0dad148ca959cf3a9b7fd9e302279a4cbda
66549 F20101219_AABSZK li_j_Page_098.pro
558e6c276ff4bcc245d7fac3b74f070b
fc8fcc3c4db65c100302632c83cab918e9859d82
38978 F20101219_AABSYW li_j_Page_084.pro
fd4eee455b365b392210b1a40b49e6c5
52a5a64fa1097f04c24204aac093c6a9557b966a
9079 F20101219_AABTFF li_j_Page_021thm.jpg
96b1f4f25c0b17d19c2f6832d9963641
80bea18467ebfc48faddb368349d5dc50805ed19
5387 F20101219_AABTER li_j_Page_014thm.jpg
dcb32f314532f2a36d77e7fddf25cac0
c28a8343795e8b26179b965b8e27685c6d4d72d7
69758 F20101219_AABSZL li_j_Page_099.pro
0ed8807cac18434da0a810ce64ab1688
7a8cbc5074cbf3bd1220344fcd3b427bf755d581
63453 F20101219_AABSYX li_j_Page_085.pro
e82564543be42fd737165fcac337c888
842d7a07892d95bf67eec0c237492d40e79bf814
35413 F20101219_AABTFG li_j_Page_022.QC.jpg
78f6d1629d742e960786adc47284b15c
a46719ba8469ccef29d0b1bafd6689e63717bce1
33126 F20101219_AABTES li_j_Page_015.QC.jpg
61c28a64ff8d4ff7a34469e90e805efd
461ec4bf5461140f38e6304038904b27a05bab58
66954 F20101219_AABSZM li_j_Page_100.pro
cf8bd9a92bcd50c9721a53f0b66986ec
2205d69e94ae4314e8ef0c6228c76581b1689230
65149 F20101219_AABSYY li_j_Page_086.pro
1e4a5885d29081a6d0b8d0c0835c3829
eb5efaeacf7af3968a8fee8f6db7efbebb26f112
8736 F20101219_AABTFH li_j_Page_022thm.jpg
94fa42542e5d73eb5dd9fccf440db7d4
8ed39605ccc40be980d9b95407cacae6a37e2790
8112 F20101219_AABTET li_j_Page_015thm.jpg
495ece192944566a330b80a83ab6dd37
86bcf1d63e2330854e3f05307be4df42c8aa4d8f
65513 F20101219_AABSZN li_j_Page_101.pro
e7993da477d336caf47bd2e54ec2f772
dbd40a1c5780a2f7e94f0b6fd86cd1960b7dfd21
63350 F20101219_AABSYZ li_j_Page_087.pro
51eb4748ee629caffcaf1a524e97d0f1
7e1e3124671429ff7e17728b13b6994185a120e0
35396 F20101219_AABTFI li_j_Page_023.QC.jpg
fd1344b17b23f2fc203cc452cfd464c5
e61b533ff2d8d6a4a40bbe6bdc7706d9cb793635
37298 F20101219_AABTEU li_j_Page_016.QC.jpg
9b4def460967892d6109ff97077b1578
98df5d3133de41c2ea3f7ab742a162e7902110cf
38359 F20101219_AABSZO li_j_Page_102.pro
6b2089e2eade8a66257f9fd5b583a89b
d5877e1d3e5f4a95727ef496c4cb5913f867b987
8492 F20101219_AABTFJ li_j_Page_023thm.jpg
b6a2e09f98d3053a3870f9856ec4db4e
f34f3f89089b6187280eca8c3df56ae6891d9443
8749 F20101219_AABTEV li_j_Page_016thm.jpg
9ca13927f2bab90b53ef7961dba2cf58
84cb036029e248729c9a0fd6efa2faaf337da09a
13321 F20101219_AABSZP li_j_Page_103.pro
8b591edab04378e5ea0f621e8a694dcf
7e21b4f11286e27cb28217129441866bee6d8835
36781 F20101219_AABTFK li_j_Page_024.QC.jpg
9779fe5f8cdc92f77f27f20245b131b9
7354bead59bc7556df8a6976e162fc1ad663b7eb
36110 F20101219_AABTEW li_j_Page_017.QC.jpg
6d22ab5bca0402c73c3d8f981e86136c
cdb5b7831734240f3221971b81f452a3191d297b
511 F20101219_AABSZQ li_j_Page_001.txt
7ee20c74c633748aef8aeb6869cd4c23
a81434e8fbf93f9bcc9f882c1e053444a5adcd0a
8972 F20101219_AABTFL li_j_Page_024thm.jpg
aa6cea53c91c80a68a7b0a8c66075d64
e32b4e879f64c43057fb5eb0db1b9fbf066645e6
8950 F20101219_AABTEX li_j_Page_017thm.jpg
2e42f1181ee09d45736607f1c6681992
85091c5ce52e1de3fb488202f2b6409f813cc405
104 F20101219_AABSZR li_j_Page_002.txt
b98f4f7cae6f01e6948e405398f41359
42a1c6d9b4d19f7d142f6931063c36b13aec3e95
36256 F20101219_AABTGA li_j_Page_032.QC.jpg
ad2509d61a077758d60e07083f64caa8
f868b153272a4e876e8b42412e165915f8dcddfc
34250 F20101219_AABTFM li_j_Page_025.QC.jpg
ec47dbefed28fc74f4595197f3c374fb
52fbce9c3dcd6f2efac6fd958f34310b302dcd5b
35822 F20101219_AABTEY li_j_Page_018.QC.jpg
5e51f1e5a14d7de2f5d87aa7f47cba5c
fa0289cfea5aac6ff0fb6e459b6a8fb0b2ef39dd
1163 F20101219_AABSZS li_j_Page_003.txt
ae7422989fdc3ebaa52dad27146cb1aa
3999a3f9104dac53303b481ad3baecfb6ca30e89
8450 F20101219_AABTFN li_j_Page_025thm.jpg
9f6b36374797c191369102c483be69a7
0c763ce23b378f932ec494cf981fee605bca8ae1
9011 F20101219_AABTEZ li_j_Page_018thm.jpg
f7c13e29d6d87881386cd82e6feff3c0
249f590219a27e31d191881f9a81812b3c088e6d
4063 F20101219_AABSZT li_j_Page_004.txt
8e8efb2503145ed05ff3f89d6918d5fa
a4fd0a12113b583ecec88a96dc9e0fc57fa8d9c0
8617 F20101219_AABTGB li_j_Page_032thm.jpg
3884948278ce876dd58bce1f4118129c
18d0099771f0e58ee648b60220ef776758a804ad
35348 F20101219_AABTFO li_j_Page_026.QC.jpg
c8c235a62688702203e85cbc72c7ab60
1efb2ba151f9b95cff36661641dd21f2891cb0e1
2823 F20101219_AABSZU li_j_Page_005.txt
f03e96090751e641461341266daec14b
38df086d3e18cfe33b221083e1dec11a6cd65f8f
37219 F20101219_AABTGC li_j_Page_033.QC.jpg
6740c7b8d074182ab70edd0f962a2b42
a6bb2fd5cdeccddfe863ea91e8f2c8340d490636
8714 F20101219_AABTFP li_j_Page_026thm.jpg
80e4360f9159ef6566f8eb535d6d036b
34152343a3d6fdda4d37b7e23114bab56f067761
8688 F20101219_AABTGD li_j_Page_033thm.jpg
f57e061937926512da8158f6d4f4c8c8
604cc08a19ee586c07c4fa62a0433382797e09de
36596 F20101219_AABTFQ li_j_Page_027.QC.jpg
f2122934a0afee34cfda256dbcd16bc9
f027b2ef9b5f1ca70caf513ea0cb16c48cb5dbf9
496 F20101219_AABSZV li_j_Page_006.txt
9618041aabf64ba6f7f717b236948a61
0788fddbbda97fa67b3293ace28c80e5455bac5b
33792 F20101219_AABTGE li_j_Page_034.QC.jpg
43829cacaa55663c90597426e06f72df
4547afa661507b23d6cc7552249b3655cbb947b3
8661 F20101219_AABTFR li_j_Page_027thm.jpg
fb3cd1e5d9edee820e6812ca81e51423
1cb558ca4b0864eae60e5f9c2d73b3cdb364b3b3
2617 F20101219_AABSZW li_j_Page_007.txt
72427293304d1f89a035980ee26ff29e
91bdf1074551ac9283a935b59fd5696682fb407e
8559 F20101219_AABTGF li_j_Page_034thm.jpg
97a2150b870482d1af32cfbcb3096f4f
83989b33a8b528b5c1748ab6d1feadede4fd0c59
F20101219_AABTFS li_j_Page_028.QC.jpg
ae1c6befc4dcd80b97fdf8abfcd04bcc
9703bb367ac1d2573bf312eb19417f7eefea052b
348 F20101219_AABSZX li_j_Page_008.txt
15cd8aba15ade58e835e1e13db1e8215
01966620cf17fcb0b62aba42c0def262ae4ff90b
35177 F20101219_AABTGG li_j_Page_035.QC.jpg
0f4763aaadf32bad71d5eeeaddc0c330
16b13cc703aef2c2e280dde9c82e9ec63b48e021
8684 F20101219_AABTFT li_j_Page_028thm.jpg
c49afb4d8d0515def5aeb16f14f6bc6c
1bebf0dc7d48a9b1155774bc45de1395646c930b
1027 F20101219_AABSZY li_j_Page_009.txt
dd5a6998474c50cafb3ba9b8bd77093a
acdda71ac53ed07a243063e072e6e179b310afd2
8810 F20101219_AABTGH li_j_Page_035thm.jpg
483d4dba135e52d77ce86a91110e610c
1ff088ff5c40f2a90005478cd7d267f1d4ceb208
37652 F20101219_AABTFU li_j_Page_029.QC.jpg
931cb05d37c0dfbfbd493687f0434700
73358e338cf210f4c1cf1c49d62b6b9901a05e4a
932 F20101219_AABSZZ li_j_Page_010.txt
32ce71c5048ab36108772f0a08eed461
388c14becb846028e0a8c22114262c045d15c7df
34605 F20101219_AABTGI li_j_Page_036.QC.jpg
7711d549fdbbaf5f1688fe6e5d4e4bbd
1f96ffb825babe3e3be970fbf074b8f4434316d6
9034 F20101219_AABTFV li_j_Page_029thm.jpg
a34f7042fc573247dab0d8bb75eab5ff
06ca9731d8dd38c84aba3a1c94156aecad66d38c
8577 F20101219_AABTGJ li_j_Page_036thm.jpg
d26d8d8b4a0b58bbcdb7c45a9a97afd7
ddc21869ee00a1ad1b19fde10c22d59572e292ca
35979 F20101219_AABTFW li_j_Page_030.QC.jpg
9b0c7e5557d8a0e576564d10beed3cf5
2da71671c2fb30bd317bba0a27191967f55896d4
32111 F20101219_AABTGK li_j_Page_037.QC.jpg
124e1fed4283b13bbbcf32c12cb23ae7
1669593c718b95e69d0e83afdf51af744e2bb9d7
8937 F20101219_AABTFX li_j_Page_030thm.jpg
24c0638e679746554290184374eb54a6
f6e0011912d7860bc097d1b4f15c80dd4124e973
9047 F20101219_AABTHA li_j_Page_045.QC.jpg
ce9450350a0305001eeccc2a8356f4d3
40f8c263d52fda0cccb9fc5df81b24084e269460
8183 F20101219_AABTGL li_j_Page_037thm.jpg
bad90b2284f65a3d796aee58433475ab
fb631ddf0f035f3e00e4710e65fb5f2e8dbf0936
39816 F20101219_AABTFY li_j_Page_031.QC.jpg
dfc9de40fbfdf6b844c804e332a76435
29d968fc50c7e13af1932b0b364828dab5afe695
3046 F20101219_AABTHB li_j_Page_045thm.jpg
f132a2740cb2c3d5580658bffa5eef48
4a3fc0e70fbc6ac3bc2b1ebbe9c68f3dc8746a90
34915 F20101219_AABTGM li_j_Page_038.QC.jpg
a7b430e096ae3d7e3f3c8e68704d2e5a
16832e9694249e32ad3fa9e3c21d4c8b9969d3ed
9131 F20101219_AABTFZ li_j_Page_031thm.jpg
62ae3d83902417693ac4bc15608b28a3
d2e685129661e62cf77d0bfbaed305125fa72201
8506 F20101219_AABTGN li_j_Page_038thm.jpg
2cbfa23403f823977f55e809377e5168
9e82351b47ba83210c26b49b14f0726ea554d617
17464 F20101219_AABTHC li_j_Page_046.QC.jpg
2032bff66e513c6124292f4ea923966a
432acc6dd399e86c6c2073a060b1aa5f70f65aea
38037 F20101219_AABTGO li_j_Page_039.QC.jpg
15435118a0474c040ac1ca36b0b7981e
4ef9ec37f642a02a39cde0287c3276ed190be472
4975 F20101219_AABTHD li_j_Page_046thm.jpg
d3fe93e2573662863698750dbb61e32c
4afb3ae6493da58d1ff0b494efa9ce5d5bf38f36
8777 F20101219_AABTGP li_j_Page_039thm.jpg
f857313222947ef2ee9107a910fa2cde
3ea4f7804c768629f0efd8721e668dc5ece32347
9069 F20101219_AABTHE li_j_Page_047.QC.jpg
35b74a47a89279c883dc6495d8d53944
0d6dbf364220f2451ffcdbd804c861dbeca46d77
35017 F20101219_AABTGQ li_j_Page_040.QC.jpg
bea71472ed6f115c8e88997be3132c91
cd7a7938277d9946d7be42806f086b232009b522
2640 F20101219_AABTHF li_j_Page_047thm.jpg
0f770525472cfabb718e03f69ad243c1
8ac2eb2711903dfb8687563d3a08e1e0f8e61164
8411 F20101219_AABTGR li_j_Page_040thm.jpg
cf95d097790962b1ddb15c1618ddb6a5
43ae9b5cc0ffc2a2daa46840d7d30fa1b5ad54e6
10332 F20101219_AABTHG li_j_Page_048.QC.jpg
11d8210298f5d1ac517526970d1037cb
a6f7b718ad2ea6019a8142064a6f290b2c963592
37227 F20101219_AABTGS li_j_Page_041.QC.jpg
a7153a319ad216dea8203d861ffc94b4
1e73a642c6967a137f8a9b2cade8734586b70ae5
3295 F20101219_AABTHH li_j_Page_048thm.jpg
905c52ced338de823e0bf2b290a9a8b2
5fa962977e04daf9ad8f54ed789d8ed7efd1d606
8891 F20101219_AABTGT li_j_Page_041thm.jpg
1fc69c89102f7956b28b6fe91b5489c7
e97b28b5c1d8f55be3676264b7a30b995aeb6ab9
35224 F20101219_AABTHI li_j_Page_049.QC.jpg
b12477cb93de57e5ad686b52c601c6bd
e4150fb3418c8a8b7f50a84459488f5253383cb2
30770 F20101219_AABTGU li_j_Page_042.QC.jpg
227f4e40a179cf039ec288307bd59cfd
ac28839d585070e84267a5390385069c6d8e3622
F20101219_AABTHJ li_j_Page_049thm.jpg
c5b693d9ceacf9539c519065f5f5d68b
af6ceb799dc460dd30ff25b2ef9cd369f5aa5465
8242 F20101219_AABTGV li_j_Page_042thm.jpg
9f9e380811cd53792a2074cd9c90f386
9a8b242a5052fc6dc94db12b3634956d8470d08c
33416 F20101219_AABTHK li_j_Page_050.QC.jpg
6a301b9ff7f64e544f7053d43401b376
61fce494da36177022038f2718c0981c88503c29
22018 F20101219_AABTGW li_j_Page_043.QC.jpg
c6e32846f3dc88347c517d9b8f091c4a
663482e5c29914cb94b83e3296a4b20fce539f9f
35800 F20101219_AABTIA li_j_Page_058.QC.jpg
0a4d8fae046f3ff0f13123c7fb74e13f
b114bd8b11e99d9b97bcaf7132283ca28337f444
8039 F20101219_AABTHL li_j_Page_050thm.jpg
82f29d9f4b4b62dd9b1939be419c890f
3d0e6ea8c933edeb6039f4d137a5238abbbd3230
5479 F20101219_AABTGX li_j_Page_043thm.jpg
0ccb106fc2a7db7d262b19f62eb5b697
6cf58f79154c042add5cf7a7878e1d27a317a85b
8768 F20101219_AABTIB li_j_Page_058thm.jpg
470ce95613ad67281be87cd527bc15b9
d4567b53649167c168885346fc4795e1148fe9b7
36369 F20101219_AABTHM li_j_Page_051.QC.jpg
55fd9e4519956bb91bfc7cf6bde7d04c
4d85d21b09281e6c6ffbc795ca679baf57747ea9
16779 F20101219_AABTGY li_j_Page_044.QC.jpg
35cfa1c6bf535a46fa554a62fbc56dc8
64db62544349b7ed0dc5225a6eaa098983638bbd
16504 F20101219_AABTIC li_j_Page_059.QC.jpg
516b7e22cf3e7b5b4752c6def6f82512
57ab59d4d45ee42184ac65a7586f9e466cdecd8d
8624 F20101219_AABTHN li_j_Page_051thm.jpg
427d6bea245b2b74b9ed22409fa43ba4
a26d2473b78b0c0c6f46afda86c600a68586fab8
4969 F20101219_AABTGZ li_j_Page_044thm.jpg
5d2d233ee6861503024f90af13da8d7d
751fa7c8b089398357a760a528dd532daa98070a
8404 F20101219_AABTHO li_j_Page_052.QC.jpg
04bc1ae2f5b4fff1cd61b95447edae5d
8347c88f468ca1ce3f7370d9bff494ca1a0f6e7e
4097 F20101219_AABTID li_j_Page_059thm.jpg
85dd132748b73c2945fe4e82606cc28b
a6e80596e98116637fd54ab50a050c5673d249ad
2235 F20101219_AABTHP li_j_Page_052thm.jpg
8454b3fc26d1945299e4c33e2812af69
4abdcb83f8d0faf088eaca87da9600efaeabc3cb



PAGE 1

1 ERK2 IS REQUIRED FOR EFFICIENT TERMINAL DIFFE RENTIATION OF SKELETAL MYOBLASTS By JU LI A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2007

PAGE 2

2 Copyright 2007 by Ju Li

PAGE 3

3 ACKNOWLEDGMENTS Many great people provide their ge nerous help to support me to complete this thesis. First of all, I would like to thank my advisor, Dr. Sally Johnson, who supported me all the way. Since I got the opportunity to study in her lab, her guidance, trust, and understanding helped me to complete my degree. I would also like to thank my committee me mbers, Dr. Alan Ealy and Dr. Joel Yelich. I thank them for their time and assi stance for my graduate program. Your advice help me complete my masters project and will be a great benefit for my future research. I would specially thank all of my lab mate s. Xu Wang has been helping me with my research since the very first da y I enter the lab. She is my best teacher and friend. I also thank Dane Winner, Sarah Reed, Jenelle McQuown, Sa ra Ouellette, and Shige Tsuda. I could not complete my research without their help. I thank my dear Mom and Dad who always be lieve that I am the best. Last but most importantly, I thank my husband Bi, who support my work and go with me through all the hard times.

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................3 LIST OF TABLES................................................................................................................. ..........6 LIST OF FIGURES................................................................................................................ .........7 LIST OF ABBREVIATIONS. 9 ABSTRACT....................................................................................................................... ............12 CHAPTER 1 INTRODUCTION................................................................................................................. .14 2 LITERATURE REVIEW.......................................................................................................15 2.1 Sketal Muscle System...................................................................................................... 15 2.1.1 Skeletal Muscle Development..............................................................................15 2.1.2 Myogenic Regulatory Factors (MRFs).................................................................16 2.1.3 Myocyte Enhancer Factor-2 (MEF2)...................................................................19 2.1.4 E-Protein...............................................................................................................20 2.1.5 Satellite Cells........................................................................................................ 20 2.2 MAPK Signaling Pathway...............................................................................................22 2.2.1 ERK1/2 Pathway..................................................................................................23 2.2.1.1 Ras..............................................................................................................23 2.2.1.2 Raf..............................................................................................................25 2.2.1.3 MEK1/2......................................................................................................27 2.2.1.4 ERK1/2.......................................................................................................28 2.2.2 c-Jun N-terminal Kinases (JNK)..........................................................................31 2.2.3 Stress-activated Kinase of 38 kDa (p38 MAPK).................................................32 2.2.4 Extracellular Signal-regu lated Kinase 5 (ERK5).................................................33 2.3 Skeletal Muscle Growth and Hypertrophy: A Brief Overview......................................33 2.3.1 Introduction of Skeletal Muscle Hypertrophy......................................................33 2.3.2 Factors Regulate Skeletal Muscle Hypertrophy...................................................34 2.3.3 Growth Factors and Signal Molecules that Promote Muscle Hypertrophy..........34 2.3.3.1 Growth Hormone (GH)..............................................................................34 2.3.3.2 IGF-1..........................................................................................................36 2.3.3.3 PI3K...........................................................................................................37 2.3.3.4 Akt..............................................................................................................38 2.3.3.5 mTOR and GSK3 .....................................................................................38 2.3.3.6 MAPK........................................................................................................39 2.3.3.7 Fibroblast Growth Factor 2 (FGF2)...........................................................40 2.3.3.8 Hepatocyte Growth Factor (HGF)..............................................................40

PAGE 5

5 2.3.4 Growth Factors and Cytokines th at Inhibit Muscle Hypertrophy........................41 2.3.4.1 Transforming Growth Factor (TGF)....................................................41 2.3.4.2 Tumor Necrosis Factor-alpha (TNF)......................................................42 2.3.4.3 Interleukin-6 (IL-6)....................................................................................42 2.4 Summary of ERK1/2 Effects on Skeletal Myogenesis...................................................43 3 MATERIALS AND METHODS...........................................................................................49 3.1 Cell Culture, Plasmids, and Transfection.......................................................................49 3.2 RNA Interference......................................................................................................... ...49 3.3 Luciferase Reporter Assay..............................................................................................50 3.4 BrdU Incorporation....................................................................................................... ..50 3.5 Western Blot............................................................................................................. ......51 3.6 Immunocytochemistry....................................................................................................51 4 RESULTS...................................................................................................................... .........53 4.1 Preliminary Experiment..................................................................................................5 3 4.2 Creation and Validation of ERK1 and ERK2 siRNA.....................................................54 4.3 Optimal Myoblast Proliferation Re quires One Functional ERK Enzyme......................54 4.4 ERK2 is Necessary for Efficient Myofiber Formation...................................................55 4.5 ERK2 Knockdown Inhibits Myogenin Protein Expression............................................56 4.6 IGF-I Signaling Partially Restores Myoge nin Expression and Myofiber Formation.....57 4.7 FGF2 Does Not Signal Exclusively th rough Either ERK1 or ERK2 to Inhibit Myogenesis.....................................................................................................................58 5 DISCUSSION................................................................................................................... ......80 6 IMPLICATIONS................................................................................................................. ...83 LIST OF REFERENCES............................................................................................................. ..85 BIOGRAPHICAL SKETCH.......................................................................................................103

PAGE 6

6 LIST OF TABLES Table page 2-1 MRF null phenotypes...................................................................................................... .44 2-2 Summary of MAPK knockout mice phenotypes...............................................................46 2-3 Regulatory factors of sk eletal muscle hypertrophy..........................................................47

PAGE 7

7 LIST OF FIGURES Figure page 2-1 MAPK signaling cascade...................................................................................................45 2-2 Signaling pathway involved in IGF-I induced skeletal muscle hypertrophy.....................48 4-1 C2C12 myoblasts transduced with pSIRENsiERK1 and pSIRENsiERK2.......................60 4-2 C2C12 myoblasts transduced with pS IRENsiERK1 or pSIRENsiERK2 does not inhibit ERK1/2 expression.................................................................................................61 4-3 C2C12 myoblasts stable expressing si ngle siERK1 or siERK2 does not inhibit ERK1/2 expressio..............................................................................................................6 2 4-4 Stable expression of siRNA directed agai nst ERK1 or ERK2 reduces ERK1/2 protein levels......................................................................................................................... .........63 4-5 Knockdown of ERK1 or ERK2 af fects AP1 luciferase activity........................................64 4-6 Knockdown of ERK1 or ERK2 does not prevent myoblas t proliferation.........................65 4-7 Knockdown of ERK1 or ERK2 does not affect the mitogenic response...........................66 4-8 ERK2 deficiency lead s to myogenic arrest........................................................................67 4-9 ERK2 deficiency leads to repression of differentiation and fusion of myoblasts..............68 4-10 Treatment with PD98059 inhibits acti vation of ERK1/2 and active ERK1/2...................69 4-11 Treatment with PD98059 does not a ffect C2C12siERK2 differentiation.........................70 4-12 ERK2 deficiency causes a reducti on in myogenin protein expression..............................71 4-13 ERK2 deficiency causes reducted myoge nin expression in C2C12siERK2 myoblasts is partially restored by IGF-I treatment.............................................................................72 4-14 IGF-I treatment improves the differe ntiation capabilities of C2C12siERK2 myoblasts...................................................................................................................... .....73 4-15 Myotube fusion index of IGF-I treated myoblasts.............................................................74 4-16 Differentiation index of IGF-I treated myoblasts..............................................................75 4-17 ERK2 insufficiency does not disr upt IGF-I induced Akt phosphorylation.......................76

PAGE 8

8 4-18 FGF2 requires one functional ERK isof orm to inhibit myogenic differentiation..............77 4-19 Differentiation index of FGF2 treated myoblasts..............................................................78 4-20 FGF2 inhibits myogenic differentiation through either ERK isoform...............................79

PAGE 9

9 LIST OF ABBREVIATIONS AP-1 activator protein 1 bHLH basic helix-loop-helix BMK big mitogen-activated kinase BMP bone morphogenetic protein Cdk cyclin D-dependent kinase CR conserved region DAPI 4,6-diamidino-2-phenylindole ED embryonic day eIF eukaryotic initiation factor ERK extracellular signal-regulated kinase FBS fetal bovine serum FGF fibroblast growth factor GDF growth and differentiation factor GFP green fluorescent protein GH growth hormone GHR growth hormone receptor GSK glycogen synthase kinase HGF hepatocyte growth factor HS horse serum Id inhibitor of differentiation/DNA binding IGF insulin-like growth factor IGFBP IGF binding protein

PAGE 10

10 IL interleukin JNK c-Jun N-terminal kinase LIF leukemia inhibitory factor MADS MCM1, agamous, deficiens, serum response factor MAPK mitogen-activated protein kinase MEF2 myocyte enhancer factor-2 MKK mitogen-activated kinase kinase MRF myogenic regulatory factor mTOR mammalian target of rapamycin MyHC myosin heavy chain NFAT nuclear factor of activated T cells NFB nuclear factor kappa beta PBS phosphate-buffered saline PHAS phosphorylated heatand acid-stable protein PI3K phosphatidylinositol 3-kinase PKB protein kinase B PKC protein kinase C PTKR protein tyrosine kinase receptor RT reverse transcription PCR polymerase chain reaction PSK p21-activated protein kinase PTB domian phosphotyros ine-binding domain PtdIns(3,4,5)P3 phosphatidylinositol (3,4,5)-trisphosphate

PAGE 11

11 RSRF related to serum response factor SAPK stress activated protein kinase SH src homology region SOS son of sevenless STAT signal transducers and activators of transcription TGF transforming growth factor TnI-Luc troponin I luciferase TNF tumor necrosis factor

PAGE 12

12 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ERK2 IS REQUIRED FOR EFFICIENT TERMINAL DIFFE RENTIATION OF SKELETAL MYOBLASTS By Ju Li May 2007 Chair: Sally Johnson Major: Animal Sciences Terminal differentiation of skeletal myoblas ts involves alignment of the mononucleated cells, fusion into multinucleated syncitia, and tran scription of muscle-specific genes. Myogenesis in vivo is regulated partially by IGF-I initiated signaling that results in activation of an intracellular phosphatidylinositol 3 kinase (PI3 K) signaling cascade. Downstream signaling through the Raf/MEK/ERK axis, a pathway initia ted by IGF-I, also is implicated in the regulation of muscle formation. The involveme nt of ERK1 and ERK2 during myogenesis was examined in C2C12 myoblasts. C2C12 myoblasts stably expressing a small interfering RNA (siRNA) directed against ERK1 or ERK2 were creat ed. Both of the kinases were reduced to trace levels as measured by Western blot for total ERK and retained the capacity to become phosphorylated. The C2C12siERK2 knockdown myoblas ts failed to fuse into multinucleated myofibers. By contrast, cells expressing a scrambled siRNA or ERK1 siRNA fused into large multinucleated structures. The block to muscle formation did not involve continued cell cycle progression or apoptosis. The C2C1 2siERK1 myoblasts expressed an increased amount of ERK2 protein and formed larger myofibers in res ponse to IGF-I treatment Interestingly, IGF-I treatment of C2C12 ERK2 knockdown myoblasts did not reinstate the myogenic program

PAGE 13

13 arguing that ERK2 is required for differentiation. These results provide evidence for ERK2 as a positive regulator of myogenesis and suggest that ERK1 is dispensable for myoblast proliferation and differentiation.

PAGE 14

14 CHAPTER 1 INTRODUCTION The ERK1/2 MAPK signaling pathway is involved in multiple cellular processes including cell growth, proliferation, differentiation and su rvival. In skeletal muscle, Raf/MEK/ERK and PI3K/Akt cascade are downstream pathways of IGF-I-mediated skeletal muscle hypertrophy. Activation of ERK1/2 has a dual function in myoge nesis. Low levels of Raf activity stimulates myoblast differentiation, and high levels of Raf activity inhibits myoblast differentiation [193]. Importantly, sufficient Raf activity to evoke ER K2 phosphorylation is coorelated with improved myocyte formation, while activation of ERK1 is associated with inhibition of myogenesis. The separable function of ERK1 and ERK2 during myogenesis was examined in C2C12 myoblasts. C2C12 myoblasts stably expressing small interfer ing RNAs direct against ERK1 and ERK2 were created, and their ability to form ma ture muscle cells was examined. The objectives of this work were to (1) iden tify the distinct effects of ERK1 and ERK2 during myogenesis, (2) characterize the involvem ent of ERK1/2 in IG F-I induced myogenesis and (3) test the necessity of ERK1 /2 in FGF2 stimulated mitosis.

PAGE 15

15 CHAPTER 2 LITERATURE REVIEW 2.1 Sketal Muscle System Skeletal muscle is the most abundant ti ssue in the human body and accounts for more than 50% of the total mass. This tissue serves as a major site of metabolic activity and as a protein reservoir. Skeletal muscle cells are cy lindrical shaped, striat ed muscle, facilitating movement via contraction to appl y force to bones and joints. Skel etal muscle maturation can be subdivided into myogenic determination, myoblast proliferation and terminal differentiation. A number of growth factors, signa ling molecules and transcription f actors are involved in skeletal muscle maturation. Thus, skeletal muscle presents a perfect model system to study cellular signal transduction. 2.1.1 Skeletal Muscle Development All vertebrate skeletal muscles (except head muscles) are derived from progenitor cells contained within somites which arise by segmenta tion of paraxial mesoderm on either side of neural tube and notochord (review ed in [18]). Somites also give rise to other tissues, including skeletal and connective tissue. During embryoni c development, some pluripotent mesodermal cells are committed to the myogenic lineage, whic h is regulated by the cell fate determinants Hedgehog and Wnt family members [98]. These m yogenic cells proliferat e and in some cases migrate until there are extracellular signals fr om surrounding tissues including the neural tube and the lateral ectoderm, which make them wit hdraw from the cell cycl e and undergo terminal differentiation. Subsequently, muscle-specific ge nes are expressed and mononucleated myoblasts fuse to each other to form the multinucleated syncytium. The onset of muscle formation in the mouse embryo is called primary myogenesis. After embryonic day (ED) 14 in the mouse, secondary muscle fiber formation occurs [216]. As a

PAGE 16

16 result, adult skeletal muscles are composed of a mixture of myof ibers with different physiological characteristics, from a slow-contracting type to a fast-contracting type, and the proportion of each fiber type within a muscle dete rmines its overall contra ctile properties. There are several signaling pathways involved in these later stages of muscle development, but the molecular control mechanisms are still unclear. 2.1.2 Myogenic Regulatory Factors (MRFs) During development of skeletal muscle, a group of myogenic transcription factors (myogenic regulatory factors, MRFs), play a si gnificant role in lin eage determination and differentiation [194]. MRFs (MyoD myf5, myogenin and MRF4) are basic helix-loop-helix (bHLH) transcription factors. The HLH domain of the MRFs is responsible for dimerization with E-proteins. These heterodimers bind to the co nsensus CANNTG recogni zation site, which is found in the promoters and enhancer s of many muscle-specific genes, leading to transcription of these genes. MyoD was the first MRF isolated and initially was regarded as a master regulatory gene due to its ability to convert nonmuscle cells to the myogenic lineage [194]. The gene product is expressed early during development and likely part icipates in establishment of the skeletal muscle lineage [163]. Gene ablati on studies indicate that loss of MyoD does not cause striking developmental abnormalities or functional deficits in the musculature [157]. Examination of the MRF gene expression patterns in the MyoD(-/-) mice reveals an increase in myf-5 mRNA levels. Thus, myf-5 may compensate for MyoD and provi de normal myogenesis. Indeed, mice null for both MyoD and Myf 5 are completely devoid of myoblasts hence demonstrating the importance of these early MRFs for commitment of multipot ent somitic cells to the myogenic lineage [158]. However, not all of the effects of MyoD can be replaced by Myf-5. MyoD(-/-) mice display deficiencies in muscle regenera tion following injury [118]. Satell ite cells isolated from these

PAGE 17

17 animals proliferate in culture at rates comparable to wildtype myoblasts but MyoD(-/-) myoblasts demonstrate abnormalities in the differentiation pr ogram [33]. A delay in myofiber formation is detected which may be attributed to maintenance of the myoblasts in a pr oliferative state [198]. Alternatively, satellite cells in vitro fail to express the late myogenic marker, MRF4 which participates in activation of the myocyte gene program [33]. Myf-5 is recognized as an early marker of the myoblast lineage, similar to MyoD Myf-5 mRNA is first detected in the dermamyotome co mpartment of the somite at ED8.5 in the mouse and maintained into adulthood [135]. Interestingl y, Myf-5 mRNA also is detected in distinct regions of the brain suggesting th at the bHLH factor is not musc le-restricted [37]. However, no measurable amounts of Myf-5 protein are obser ved in the developing neural areas possibly accounting for the lack of myogenic convers ion in these tissues. Expression of Myf-5 is regulated in part by Pax3, a tran scription factor that directs mi gration of myobl asts into the developing limbs [11]. Targeted deletion of the gene does not compromise embryonic viability. Mice are born with apparently normal musculat ure but die within minutes of birth as a consequence of rib malformities [20]. Due to its early expression pattern, Myf-5 typically is thought of as a lineage determination factor. Th e protein is often associated with putative quiescent satellite cells in mice and may play an important regulatory role in maintaining the myogenic lineage of these musc le stem cells [31]. MRF4 exhibits a biphasic expression pattern with transcripts initially detected at ED9.0 in the somite followed by a second peak during fetal development at ED16.0 [16]. Early detection of mRNA transcripts for MRF4 is coincident with Myf-5 with speculation that MRF4 may regulate transcription of Myf-5 [175]. The closely linked MRF genes also share a common regulatory element that contributes to their s ynchronous expression [175]. Because the two genes

PAGE 18

18 are positioned near one another on mouse ch romosome 10, early homologous recombination experiments deleting MRF4 were confounded with Myf-5 defects leading to variable phenotypes [133]. The initial MRF4 null mouse demonstrated no obvious muscle defects but rib deformities were apparent [93]. However, a second knockout mouse died immediately at birth with a severely truncated lower rib pair [19]. And, a third MRF4 null allele results in an intermediate phenotypic rib defect [139]. The rib malformatio ns are reminiscent of those found in the Myf-5 knockout mouse. Closer examination of the de leted regulatory regi ons revealed that a cis element necessary for Myf-5 expression was disrupted to varying degrees in the MRF4 knockouts. Those animals with severe rib abnormalities and suffering pe rinatal lethality failed to direct the correct spatio-temporal expression of Myf-5 [212]. The final member of the MRF family is myogenin. Myogenin is expressed later than Myf5 MyoD or MRF4 with transcripts detected in the m yotomal myoblasts at ED10.5 in the mouse [25]. Unlike mice devoid of th e other MRFs, deletion of myogenin produces an animal with severe muscle defects. Myogenin null animals die within moment s of birth due to insufficient diaphragm musculature [73;129]. Hi stological examination of the mice demonstrates virtually no skeletal muscle exists in these mice. Expression of MyoD and myf-5 is unaffected and the animals contain the normal complement of myoblasts. Thus, myogenin is requisite for fusion of the myoblast precursors into the multinucleated cont ractile-competent structures. The necessity for myogenin does not extend into adulthood. Deletion of myogenin after completion of embryonic muscle formation causes a generali zed reduction in body size [92]. However, the mice contained a proportional amount of skeletal mu scle and the muscle was able to increase in size. This leads to the speculation that myogenin and perhaps the entire family of MRFs, have very little to do with pos tnatal muscle growth.

PAGE 19

19 2.1.3 Myocyte Enhancer Factor-2 (MEF2) Along with the MRFs, the myocyte enhancer fact or-2 (MEF2) family also plays a role in skeletal, cardiac and smooth muscle myogenesis. The MEF2 family, also called Related to Serum Response Factor (RSRF), has four me mbers (MEF2A, MEF2B, MEF2C and MEF2D), which are expressed in all develo ping muscle cell types [65]. MEF2 proteins have an identical Cterminal activation domain and N-terminal MC M1 agamous defeciens serum response factor (MADS) domain. The MADS domain serves fo r DNA binding and dimerization with accessory factors. MEF2 proteins bind a conserved A/T-rich DNA sequence in the control regions of a majority of muscle-specific genes an d activate their expression during embr yogenesis [45]. Previous studies indicated that muscle-spe cific gene expression and myogenesis are regulated by a combination of MRFs and MEF2 s, and the DNA-binding domains of these factors mediate their interactions. MEF2 factors can cooperate with heterodimers of MRFs and E protein, and this interaction play s an important role in promo ting myogenesis [123]. In addition to interacting with MRFs, MEF2s are shown to es tablish protein-protein association with several other transcription factors. This is important for MEF2 to transmit signals from cell membrane to downstream early genes and stressresponse genes [45]. For exampl e, transcriptional activation of the myoglobin promoter in striated muscle requires interaction with MEF2 and Sp1 [66]. MEF2s and MRFs can synergistically activate gene expression, which is important for MEF2s regulation of terminal differen tiation. In flies, deletion of single MEF2 gene results in an inability of muscle cells to differentiate [106]. In mice, targ eted inactivation of MEF2C gene is embryonic lethal due to severe defects in cardi ac development [107]. Howeve r, there is no defect in skeletal muscle in these MEF2 deficient animals, possibly because different subtypes of MEF2s are expressed in skeletal muscle and co mpensate for lack of each other. In addition,

PAGE 20

20 transgenic mice expressing a MEF2 regulated lacZ reporter gene show that MEF2 activity is high during embryonic development but it is undetectable after birth [130]. 2.1.4 E-Protein The E-protein family (E12, E47, HEB and ITF-2) is another bHLH tr anscription factor family [97]. E-protein has a bHLH domain to form homodime r or heterodimer with MRFs family and two conserved transcriptiona l activation domains in the N-terminus. E12 and E47 are alterna tive splice products of E2A gene, which is ubiquitously expressed in many mammalian cells including skeletal musc le [10]. Lassar (1997) provided evidence that E12/E47 interact with myogenic HLH prot eins to regulate m yogenic program [97]. Cotransfection of E47 with MyoD enhances MyoD -activated genes transc ription, and inhibition of E2A expression with antisense E2A transcripts displays low le vel of terminal differentiation. In addition, MyoD or myogenin can form complexes with E12/E 47-like proteins, and E47 can change the phosphorylation state of MyoD [97]. E2A (-/-) mice are viable but defective in T-cell proliferation and B-cell diffe rentiation [9;10]. HEB is found in L6 myoblasts, C2C12 myosatellite cells and postnatal hindlimb muscles, which suggest s HEB may have a general role in the skeletal muscle development [28]. 2.1.5 Satellite Cells After maturity, most myoblasts form stable pos tmitotic muscle fibers that are incapable of proliferation. However, these fibers are associated with a pool of cells still capable of replication and regeneration of muscle tissue. In adult muscle s, this subpopulation of cells is termed muscle satellite cells. Muscle satellite cells are undifferentiated monon uclear myogenic cells located between the basal lamina and sarcolemma [214]. They are th e primary stem cell in adult skeletal muscle, responsible for postnatal muscle growth, hype rtrophy and regeneration. Satellite cells are

PAGE 21

21 mitotically and metabolically quiescent and transcriptiona lly less active than myonuclei [167;172]. In mature muscle, most sa tellite cells are in a quiescent state. In response to exercise, muscle damage or degenerative muscle disease, satellite cells awaken and begin proliferating [126]. Following proliferation, some cells differentia te and fuse into the pre-existing myofibers, and some return to the qu iescent state during the pro cess of self-renewal [166]. The classical identification and definition of satellite cells was performed by electron microscopy [115]. This remains the indisputable method of detection of quiescent muscle stem cells. However, the method is costly, cumbersome and unavailable for most laboratories. This led to the quest for alternative means of satellite cell identifica tion. In the late-1980s, reports of immunocytochemical localiza tion of satellite cells in vitro and in vivo began to emerge. Desmin, a cytoskeletal protein unique to muscle, is expressed by rodent sa tellite cells during the initial culture period prior to entry into the proliferative phase [89] Following trauma, many desmin immunopositive cells are present in the reforming muscle bed at a time of maximal satellite cell proliferation [5]. Over the years, additional methods of sate llite cell identification have evolved. Cell surface molecules including a splice variant of CD34 and a muscle-specific integrin have been used to demarcate satellite cells [13]. M-cadherin, an adhesion molecule, is expressed in skeletal and cardiac muscle and neural tissue. The protein localizes to satellite cells in normal and regenerating skeletal muscle [77]. Syndecan-3 and -4, heparan sulfate proteoglycans found on the surface of multiple ce ll types, are abundant matrix components on satellite cells and may be useful tools fo r identification of these cells [32;34]. A subtractive library screen comparing cDNAs present in satellite cells and embryonic fibroblasts identified Pax7 as one of several gene s unique to the putative muscle stem cell [168]. Pax7, a paired box transcripti on factor, is present in G0 satellite cells and absent in differentiating

PAGE 22

22 myoblasts. Gene ablation results in a mouse compromised in muscle growth owing to an absence of satellite cells. Based on this work, Pax7 is a true marker protein for satellite cells and expression of the transcriptional regulator is necessary for satelli te cell form and function. The definition of Pax7 as a lineage marker for satellite cells remains unclear. Examination of tissues of Pax7(-/-) pups indicates numerous satellite cells ar e present [136]. The ab solute numbers of these cells declines as the animal matures bu t a minor population, substantially fewer than normal, is present in the adult. The presence of these cells may be attributed to a shared function with the paralogous gene, Pax3 Pax3 and Pax7 are co-expressed in many putative satellite cells in the postnatal musculature [151;152]. Pax3 pos itive satellite cells undergo apoptosis in the Pax7 knockout animal suggesting that Pax7 is necessary for cell surv ival but dispensible for lineage specification [151]. Conti nued expression of Pax7 in sate llite cells is necessary for survival of the G0 population but does not affect the m yogenic gene program[215]. Pax7 is coexpressed with MyoD in proliferating satellite ce lls. Down-regulation of the gene coincides with differentiation. Interestingly, overe xpression of Pax7 delays the onset of terminal differentiation but does not prevent the eventual formation of myof ibers [215]. This is in contrast to Olguin and Olwin (2004) who reported th at ectopic expression of Pax7 in satellite cells prevents MyoD and myogenin expression and induces cell cycle arre st. The presence of Pax7(+):MyoD(+) myoblasts that incorporate BrdU in the regenerating bed of skelet al muscle argues that Pax7 does not alter either MyoD ex pression or proliferation in vivo [132]. 2.2 MAPK Signaling Pathway Mitogenic signal transduction is medi ated by a protein phosphorylation and dephosphorylation cascade. One of the most impor tant mitogen-induced signaling pathways is the mitogen-activated protein kinase (MAPK) cascade.

PAGE 23

23 Many growth factors activate re ceptor tyrosine kinases that tr ansduce extracellular signals through the small G protein, Ras. Ras protein ph osphorylates and activates MAP kinase kinase kinase (MAPKKK), which in turn activates MAP kinase kinase. Subsequently, MAPKK phosphorylates MAPKs on threonine and tyrosine re sidues in a conserved motif (Thr-X-Tyr) in the kinase domain, which is requ ired for MAPK ac tivation [21]. The MAPK pathway is very sensitive and an efficient transducer of signals due to two characteristics of MAPK cascade. First, the MA PK cascade can amplify signals, which means as the signals pass down. Downstream targets are more abundant than their upstream regulator. As an example, MEK1 is much more abundant than Raf-1 [47]. Another characteristics of the MAPK pathway is switch-like outpu t, which allows the MAPK cascade to convert graded inputs into different outputs [51]. For example, high an d low levels of Raf-1 have opposite effects in skeletal muscle differentiation [41]. This mechanis m enables cells to filter noise and still respond to stimuli over threshold. The MAPK signaling pathway is conserved from unicellular organisms such as bacteria to multicellular organisms such as humans, and it regulates diverse cellular functions including cell growth, proliferation, differentia tion and apoptosis. In mammals, more than four groups of MAPKs are recognized that include two extracellul ar signal-regulated kinases (ERK1/2), three cJun N-terminal kinases (JNK1/2/3), four p38 protein kinases (p38 / / / ) and ERK5. Figure 2-1 shows the different MAPK signaling cascades, and Table 2-2 summarizes MAPK knockout mice phenotypes. 2.2.1 ERK1/2 Pathway 2.2.1.1 Ras Mamalian genomes encode three ras genes that give rise to four protein products, N-Ras, H-Ras, K-Ras4A and K-Ras4B. These Ras isofor ms are ubiquitously ex pressed, though ratios

PAGE 24

24 change from tissue to tissue [211]. Ras protei ns can induce cell transformation through a number of effectors. Constitutive activation of Ras causes a large number of human cancers [49]. Ras family members are membrane localized small GTPase, which are associated with multiple signal transduction pathways that regulate di fferent cellular functions. The best characterized signaling pathway regul ated by Ras is the ERK1/2 MAPK pathway. The pathway is activated following growth factor docking to protein tyro sine kinase receptors (PTKRs). PTKRs dimerize and autophosphorylate, which in turn allow cross phosphorylation of tyrosine residues in their cytosolic domain. Th ese intrinsic phosphotyrosine domains serve as docking sites for Src homology region 2 (SH2) and the phosphotyrosine-binding (PTB) domain, which causes recruitment of son of sevenless (SOS) in the plasma membrane and subsequent binding to Ras. Once Ras is activated at the membrane, it recruits Raf-1 and activates the downstream Raf-MEK-ERK pathway [124]. The mechanism underlying the Ras-imposed bl ock to differentiation remains unclear. A series of Ras mutants were examined for thei r ability to invoke specific downstream signaling pathways to suppress myogenesis [146]. Ras allele s that initiate exclusive signaling through Raf, Rac or Rho all efficiently inhibit muscle gene transcription indicating th at no single downstream effector pathway mediates the negative effects of Ras. Importantly, morphological transformation and inhibition of differentia tion are mutually exclusive events [195]. Overexpression of RasG12V in muscle cells causes growth in soft agar that can be reverted by treatment with a chemical MEK inhibitor. However, these cells remain unable to express the myogenic gene program. Ras invoked signaling th rough protein kinase C may be a primary downstream pathway leading to inhibition of my ocyte formation [49]. Treatment of myoblasts constitutively expressing RasG12V with a chemical inhibitor to a class of atypical protein kinase

PAGE 25

25 C molecules restores biochemi cal differentiation. However, the specific PKC isoform and its downstream effectors remain unknown. Secretion of soluble proteins by Ras-transfor med myoblasts may contribute to the block to muscle formation. Weyman and Wolfman (1997) collected spent medium from Ras-expressing muscle cells and demonstrated the presence of an acid-sensitive factor capable of inhibiting differentiation. The secreted protein does not induce ERK1/2 phosphorylation and does not signal through a TGFreceptor. No detectable FGF2, a potent inhibitor of myoblast differentiation, was present in the spent medium [196]. By contrast, Ras-expressing MM14 myoblasts proliferate faster and control myoblasts due to their ab ility to release more membranebound FGF2 [49]. Sequestering FGF2 suppre sses proliferation but does not reinstate myogenesis. Thus, Ras inhibits muscle fo rmation independent of continued cell cycle progression. 2.2.1.2 Raf Raf is an oncogene first discovered as a re trovirus in 1983 [147]. Raf family members are cytosolic serine/threonine kinases that are activ ated by Ras. The Raf family (A-Raf, B-Raf, Raf1) share three c onserved r egions, CR1, CR2, CR3. The kinase domain is localized in CR3, and CR1 and CR2 are regulatory domai ns [69]. Raf-1 is ubiquitously expressed, while B-Raf is predominate in neuronal tissues and testis, and A-Raf is abundant in urogenital tissue [122]. Raf-1 is a well-established Raf isoform. Raf-1 can promote invasive cell growth and induce cell transformation as well as Ras proteins [101]. However, regulation of Raf-1 is very complex, including protein-protein interaction, phosphorylation of ty rosine, threonine and serine residues and subcellular localiza tion [125]. Raf-1 phosphorylation is affected by different protein kinases, such as Src, PKC, PKB, and PSK (p21-activated protein kinase) [125].

PAGE 26

26 Raf-1 is important in regulating cell growth and mitosis. High level of Raf kinase is sufficient to inhibit DNA synthe sis and cell division, which conve rts mitotic cell cycling into cellular growth [90]. Raf-1 causes ce ll cycle arrest th rough induction of p21Cip1, which in turn leads to inhibition of cyclin Dand cyc lin E-dependent kinases and accumulation of hypophosphorylated Rb [169].In skelet al muscle satellite cells, a dominant negative Raf-1 mutant can block FGF-mediated stimulation of ERK1/2 as well as block cell proliferation. In these cells, Raf-1 is necessary for G1 progression but dispensable for S phase [83]. In skeletal muscle, Raf-1 re gulates myoblast differentiati on in a dose dependent manner [41;193]. At a low level Raf activity, there is an increase in differentiati on, contractile protein expression and myocyte fusion. However, high level of Raf activity induces transformed morphology and inhibits myocyte formation, musc le-specific reporter expression and apoptosis [41;193]. Raf-1 also is involved in FGF-induced repression of differentiation [83]. Constitutive expression of Raf-1 suppress MyoD expression [67]. And persistent activation of Raf-1 inhibits MEF2 accumulation in nuclei. This results in decreased myogenin activity, reduced muscle protein expression and inhibiti on of myoblast fusion [82;199]. Evidence suggests Raf-1 has other functions independent of ac tivating MEK and ERK kinases, such as regulating cell survival, cell apoptosis, and cell cycle [12]. For example, Raf-1 can inhibit apoptosis signaling by binding w ith proapoptotic kinase MST2 and forming MST2/Raf-1 complex [131]. The necessity of Raf signaling in skeletal muscle in vivo is unclear due to lethality issues. A-Raf knockout mice are born alive and of normal si ze, but stop growing after 2-3 days and die between day7 and day 21 due to neurological and gastrointestinal abnormalities [145]. B-Raf null mice die from vascular def ects during mid-gestation, and B-Raf (-/-) embryos have increased

PAGE 27

27 apoptosis in differentiated endot helial cells [202]. Ablation of Raf-1 results in embryonic lethality of mice, with placental defects as well as abnormal tissue development. In these mutant mice, most organs appeare norma l, however, the eyelids fail to fuse properly, dermis and epidermis are abnormally thin and poorly differe ntiated, and the lungs are smaller and fail to inflate at birth. The time of embryonic death of Raf-1 deficient mice varies depending on the genetic background [201]. Fi broblasts isolated from Raf-1 knockout embryos had reduced proliferation in response to serum [201]. Inte restingly, ERK1/2 phosphoryl ation in response to mitogens is not impaired, which indicates ER K1/2 can be activated in a Raf-independent mechanism [201]. 2.2.1.3 MEK1/2 Genetic studies show two MEK homologs, MEK1 and MEK2 are present in mammals, which share 80% homology except at the amino terminus [218]. They activate ERK1/2 by phosphorylating the TEY domain with equal competency. MEK1 null mice are recessive lethal at day 10.5 due to a failure to establish a functional placenta. These mice are small and show signs of necrosis in some tissues [62]. The placenta defects also are found in Raf-1 knockout mice, which suggests that the Raf-MEK axis is necessary for proper placenta development [201]. However, MEK2 knockout mice are viable with no obvious deficiencies [ 14]. Comparing the phenotype of ERK1/2 and MEK1/2 knockout mice, the results show there ar e possible relationships between MEK1 and ERK2 in embryonic development[62;74]. A scaffold protein MEK part ner 1 was identified as a protein that binds specifically with MEK1 and ERK1, and facilitates their activation [164]. To further determine the effects of MEK activation in vivo tissue-specific transgenic mice were created. When active MEK1 is over-exp ressed in cardiac muscle under the control of cardiac specific -myosin heavy chain promoter, the transg enic animals show a 50% increase in

PAGE 28

28 heart size and the cardiocytes are resistance to apoptosis [23]. Constitutive expression of the MEK1 in the lens or skin cause increases in cell numbers and cell size re lated to tissue growth and hypertrophy [64;165]. In skeletal muscle, MEK is required for m yoblast and satellite cel l proliferation [83]. Treatment of MM14 myoblast with MEK i nhibitor, PD98059, or expression a dominant negative MEK mutant blocks FGF-mediated stimulation of ERK1/2 and prevents G1 to S phase transition [83]. MEK1 has a strong negative e ffect on myogenesis. Myoblasts over-expressing constitutively active MEK1 fail to fuse and tran scribe muscle gene [143]. MEK1 translocate to the nucleus, where it may bind the transcriptiona l activation domain of MyoD to repress its action. MEK1 also is involved in IGF-I and FGF2 induced repression of differentiation [197]. Treatment with PD98059, can par tially reverse the negative e ffects of FGF2 and IGF-I. However, enthusiasm for these results is temper ed due to the validity of the myoblast model. IGF-I inhibits differentiation of 23A2 myoblasts, a phenomena uni que to these cells [179;197]. On the other hand, ERK is activated in myogeni c cells [67]. A MEK1 inhibitor can block the MyoD induced myogenic program in fibroblasts, wh ich suggest MEK is activated in the process of differentiation. Constitutive expression of MEK1 enhances the transcriptional activity of MyoD in fibroblasts. The importance of ME K1 during myogenesis requires further experimentation. 2.2.1.4 ERK1/2 ERK1 and ERK2 are two MAPK proteins 75% identical in amino acid sequence and similar in structure [174]. They have two phosphoryl ated sites, tyrosine and threonine, which can be activated by MEK1 or MEK2 [3]. ERK1/2 are ubiquitously expressed, but their relative abundance in different species or tissues are variable. ERK1/2 respond to different stimulus and

PAGE 29

29 induce different responses. In fibroblasts, ERK1 can be activated by se rum, growth factors, cytokines, certain stresses, ligands for cell memb rane receptors and transforming agents [104]. When ERK1 and ERK2 are activated, they tran slocate from the cytoplasm to the nucleus. This stimulus-dependent nuclear localization appears to be crucial for multiple cell functions, such as morphological transformation and cell diffe rentiation in PC12 cells [35]. The interaction between MEK1/2 and ERK1/2 plays a prominent role in ERK1/2 tran slocation and nuclear accumulation. MEK1/2 N-terminus acts as a cytoplasmic anchor. When ERK1/2 are activated, MEK1/2 and ERK1/2 disassociate, and ERK1/2 are transported to the nucleus [59;60]. The ERK1/2 signal pathway is essential fo r cell growth. ERK1/2 increases nucleotide synthesis, affects the transcription of many ge nes through transcription factor activation and chromatin phosphorylation, stimulates protein synt hesis and controls the cell cycle. Mitogenic stimulation of cells causes ERK1/2 phosphorylati on and translocation from cytoplasm to the nucleus. This process is necessary for ini tiation of DNA synthesi s and progression from G0 to S phase [22]. Phosphorylation of transcription factors by ERK1/ 2, such as Elk1, regulate the expression of cyclin D1 and facilitates cell cycle re-ent ry [99;184]. Interestingly, MEK1 activation results in transient ERK activity that promotes cell cycle transition from G1 to S phase, while MEK2 produces sustained ERK activ ity causing cells to arrest in G1 phase [156;184]. Besides the G1 checkpoint, ERK1/2 also regulates S phase progression. ERK1/2 can activate elonglation factor, E2F, whic h promotes expression of cyclin A and in turn stimulates DNA synthesis [203]. Furthermore, ERK1/2 participates in G2 phase chromosome condensation. ERK and p38 can phosphorylate mitogenand stress-activated protei n kinase, which phosphorylates histone H3 to promote chromosome condens ation [40]. The ERK 1/ 2 also promote cell differentiation in multiple cell lineages, such as fibroblasts, neuronal cells, myoblasts,

PAGE 30

30 adipocytes, oocytes, T cells, photo receptor cells [112]. And ERK1/2 play an important role in cell apoptosis. High level of ER K1/2 activation protects cells from apoptosis induced by anchorage-independence and serum removal. Howe ver, low level of ERK1/2 activity can force the cells to apoptose [100]. The ERK1/2 pathway is an important pa thway involved in both mitogenesis and myogenesis. Growth factors, such as leukemia inhibitory factor (LIF ), IGF-I, FGF2 and transforming growth factor (TGF) regulate skeletal muscle through ERK1/2 signaling cascades [2;81;179;193;209]. However, the precise mechanisms invoking ERK1/2 phosphorylation are not clear. Mo st reports support that activ ation of ERK1/2 pathway is responsible for the negative regu lation of skeletal myogenesis [2;2;2;42;44;81;82;143;146;179;194; 195;200;209], but others indica te the ERK1/2 pathway is used for positive skeletal myogenesis [67]. The c ontrasting results may be due to ERK signaling intensity and temporal activati on during myogenesis [41;193]. ERK1 and ERK2 share 90% identity at the mRNA level and 75% identity at the amino acid level. They have similar activation proces s and nearly identical downstream substrates [174]. However, recent work demonstrates that ERK1 and ERK2 have different functions. ERK1 knockout mice are viable and fertile, with only a minor defect in thymocyte development. Fibroblasts from these animals proliferate normally in response to serum, while thymocytes from these animal shows reduced prolif eration and slow rate of matu ration into single positive (CD8+ or CD4+) thymocytes [137]. In these mice, ERK2 can compensate for most of the functions of ERK1 except for the thymocyte development. The ERK1(-/-) mice also have an enhanced longterm memory, suggesting a function for ERK1 in th e brain self-adaptation system [116]. On the other hand, ERK2 knockout embryos are deficient in mes oderm formation. BrdU incorporation

PAGE 31

31 shows ERK2 affects differentiation in stead of proliferation. The ERK2 knockout embryos have an increased level of ERK1 phosphorylation, but ERK1 can not compensate for loss of ERK2 in vivo as it does in vitro [210]. Also ERK2 mutant embryos die early (E8.5) in mouse development due to a failure to form the ectoplacental cone and extra-embryonic ectoderm, which give rise to mature trophoblasts [159]. ERK2 knockout mice also are embryoni c lethal at day 6.5 due to abnormal placenta development [74]. These results suggests ERK2 is necessary for placenta development, trophoblast proliferation and mesoderm differ entiation[74;159;210] 2.2.2 c-Jun N-terminal Kinases (JNK) JNKs are an important MAPK family that are involved in th e regulation of cell proliferation, oncogene transformation and pr ogrammed cell death. JNKs are phosphorylated and activated by the JNK kinase 1 (JNKK1; MKK4) and JNK kinase 2 (JNKK2; MKK7), which are activated by a variety of up-st ream MAPKKKs. JNKs have si milar MAPK cascade as ERKs, however, unlike ERK1/2, the JNKs are activ ated by stress stimuli. Activated JNKs phosphorylate downstream transcription fact ors, such as c-Jun and ATF-2 [121]. The JNK family has three members: JNK1, JN K2 and JNK3. The three JNK isoforms must have overlapping functions in embryoni c development because all individual JNK gene knockout mice and JNK1/JNK3 or JNK2/JNK3 double mutants are viable and develop normal [94]. JNK3(/-) adult mice develop neuronal apoptosis, which indicates the JNK3-media ted signaling pathway is involved in neuroprotec tion [208]. Mice lacking both JNK1 and JNK2 are embryonic lethal at day 11 and display an open neural tube [94;161]. Embryonic fibroblasts devoid of JNK1 and JNK2 are resistant to UV-stimulated apoptosis [ 180]. These results indicate JNK1/2 play an essential role in regulati ng stress-induced apoptosis. Furthermore, loss of both JNK1 alleles and one JNK2 allele results in an exencephalic phenot ype that suggests JNK gene dosage might be critical for its function [161]. Together, these re sults show JNK3 plays a pro-apoptotic role in

PAGE 32

32 response to stress, while JNK1 and JNK2 are essential in both proapoptotic and anti-apoptotic process during neuron morphogenesis. During skeletal muscle differe ntiation, JNK activity is up-re gulated, and inhibition of JNK activity dramatically inhibits myoblast diffe rentiation [91]. Differe nt from ERK1/2, JNK inhibitors repress myogenesis through induction of apoptosis, and activation of c-Jun and p53 transcription factors [91]. Overe xpression of JNK in skeletal mu scle results in a significant increase in the basal phosphorylation state of se veral signaling molecules, such as ERK1/2 and PKB [58]. 2.2.3 Stress-activated Kinase of 38 kDa (p38 MAPK) p38 MAPK also is referred to as a stress activat ed protein kinase [213]. p38 is activated by various stresses, hormones and inflammatory cy tokines that are induced by MKK3 and MKK6 phosphorylation. MEK3 favors phosphorylation of p38 and p38 while MEK6 phosphorylates all p38 members. MEK3/6 also can phosphorylate JNK isoforms with lower affinity [46]. p38 MAPKs have four isoforms, p38 p38 p38 and p38 Of these four subtypes, p38 is the best characterized and it is expressed in most cell types. p38 knockout mice are embryonic lethal due to defective placenta l angiogenesis [1;127]. Compared to p38 -deficient mice, both p38 and p38 knockout mice are viable with a normal life span and show no obvious phenotype [95]. Thus, p38 has a specific function in plac ental development, and it can compensate for the lack of p38 p38 and p38 isoforms. p38 MAPK is a potent activator of myoblas t differentiation and treatment with p38 inhibitors prevents myoblast fusion into myotube s as well as muscle specific gene expression [105] There are many potential explanations for the positive effect p38 MAPK in skeletal myogenesis. p38 can phosphorylate E47 to induc e MyoD/E47 association and subsequent muscle-specific gene transcription [110]. p38 activity also phosphorylates MEF2 activation

PAGE 33

33 domain and facilitates MEF2 and MyoD binding to a series of late muscle-specific gene promoters, and the expression of these genes can activate the p38 to move the cells to the early differentiation stage [142;204]. In mammalian myobl asts, there is crosstalk between p38 MAPK and the NFB signaling pathway coordinately promote myogenesis [8]. p38 MAPK acitivity is required for the quiescent state of skeletal mu scle satellite cells. Inhibition of p38 MAPK promotes myogenic cell cycle ex it and inhibits differentiation [84]. p38 MAPK pathway also increases MEF2 transcriptional regulation du ring early mammalian somite development [39]. 2.2.4 Extracellular Signal-regulated Kinase 5 (ERK5) ERK5, also called big mitogen-activated kinase (BMK), is a special member of the MAPK family. ERK5 expresses in a wide range of tissues, es pecially in the cardiovascular system. ERK5 is phosphorylated by MEK5, which is activated by MEKK2 and MEKK3. ERK5 has a catalytic domain similar to ERK1/2, but a unique C-terminus that can interact with the MEF2 transcription factor family [87;207]. ERK5 can affect cellu lar activity through phosphorylation of the MADS box transcription factors and m yocyte enhancer factor 2A and 2C (MEF2A, MEF2C) [88]. Although the ERK5 C-terminus func tions as a MEF2 coactivator, its role in myogenesis is unknown [87]. ERK5 gene deletion mice are embryoni c lethal due to defective blood vessel and myocardium [150;173;206]. 2.3 Skeletal Muscle Growth an d Hypertrophy: A Brief Overview 2.3.1 Introduction of Skeletal Muscle Hypertrophy Skeletal muscle hypertrophy is defined as an increase in muscle mass. On the other hand, decrease of muscle mass is called atrophy, which is a response to numerous diseases, such as diabetes, cancer, renal failure and AIDS [63]. In the adult animal, skelet al muscle hypertrophy is a result of an increase in the size of existing mu scle fibers instead of an increase in numbers of fibers.

PAGE 34

34 2.3.2 Factors Regulate Skelet al Muscle Hypertrophy Several intrinsic and extrinsic growth fact ors and stimuli promote or inhibit skeletal muscle hypertrophy (Table 1-3). The most common stimulus of muscle hypertrophy is exercise, which includes strength training and resistance exercise as a positive factor [48]. Nutritional factors including energy balan ce and dietary protein supplemen tation also are necessary for skeletal muscle hypertrophy [48]. Muscle injury and muscle aging are associated with muscle atrophy [48]. However, the most important factor s that regulate skeletal muscle hypertrophy are hormones and growth factors, which initiate in tracellular signaling pa thways and stimulate myoblast proliferation, myocyte differentiation and muscle-speci fic protein synthesis. For example, testosterone, insulin and growth hormo ne are the main reasons for postnatal muscle hypertrophy [54]. 2.3.3 Growth Factors and Signal Molecule s that Promote Muscle Hypertrophy 2.3.3.1 Growth Hormone (GH) Growth hormone (GH) is a major regulator of body size and metabolism. Failure to synthesis or secret GH leads to short stature. On the other hand, hypersecretion of GH induces gigantism, if hormone is overproduced early in the life, or acromegaly, if oversecretion occurs in adulthood [54]. Growth hormone is associated with postnatal growth instea d of prenatal growth. Although growth hormone receptor (GHR) exists in embryos growth hormone does not play a necessary role in embryonic development. GH gene mutati on in mice or ablation of the pituitary does not affect prenatal growth [56]. The somatomedin hypothesis demonstrates th at pituitary GH (somatotropin) stimulates postnatal growth indirectly th rough stimulating the hepatic pr oduction of circulating peptide hormones (somatomedin), which then mediat es the hormonal effects on target tissue.

PAGE 35

35 Somatomedin has an insulin-like action and promotes the incorporation of sulfate into cartilage [113]. Currently, somatomedin is referred to as insulin-like growth factor (IGF-I). The somatomedin hypothesis has been referred to the dualeffector theory. This theory proposes that GH directly stimulates the differentiation of pr ecursor cells to certain cell types. The newly differentiated cells are more sensitive to the IGFI than the precursor cells. Thus, initial direct action of GH leads to later IGF-I action in the target cells [78]. IGF-mediated actions of GH exist in different tissues, including fat cells, chondrocytes and skeletal muscle. Hypophysectomy causes a decrease in muscle mass and the level of myosin heavy chain mRNA decreases as well. Also GH treatment of hypophysectomized animals can partially restore these situations, such as in creasing muscle mass and strength and decreasing body fat [111]. There is a loss in GH secreti on as human aging, which is associated with decrease in muscle mass and stre ngth. Injection of rhGH for men older than 60 can improve lean body mass and bone density [54]. However, GH can not be used as a general performance intensifier because GH injection can not incr ease muscle growth and strength for normal exercising people [54]. GH and IGF-I system constitute the major dete rminant of body size, and GH and IGF have independent functions in regula ting the postnatal growth. The Igf1 gene mutant and Ghr gene mutant mice both show retarded bone and musc le growth. GH can stimulate production of hepatic IGF-I, which is a principal source of ci rculation IGF-I. Loss of liver-specific IGF-I production lowers the concentrati on of IGF-I in blood reduces by 75%, with no effect on muscle mass [171]. In the absence of GH, blood IGF-I levels are diminish ed, but the local IGF-I content (such as IGF-I produced by skeletal mucle) is unaffected. GH receptor and IGF-I double mutant mice are only 17% of normal size, which is more se vere than either of th e single mutants [113].

PAGE 36

36 2.3.3.2 IGF-1 Insulin-like growth factor system incl udes two hormones (IGF-I and IGF-II), three receptors and six IGF specific binding proteins (IGFBP-1 to -6). Knockout experiment of different parts of IGF system indicates all compon ents are very important in muscle growth and development [54]. Compared to IGF-II and insulin, IGF-I has a primary role in regulating skeletal muscle growth. Mice lacking IGF-I exhibit growth deficiency. Depe nding on genetic background, some IGF (-/-) mice die immediately after birth, while others survive and reach adulthood [109]. In contrast, transgenic mice over expressing human IGF-I have a 30 percent increase in body weight due to apparent increases in skeletal muscle and bone [114]. On the other hand, null mutation of igf1r all die at birth of respir atory failure and exhibit a severe growth deficiency [109]. Expression of a dominant ne gative IGF-I receptor sp ecifically in skeletal muscle induced muscle hypoplasia from birth to 3 weeks old, with decreased leve l of MyoD and myogenin. After grew to adulthood, these mice showed compen satory hyperplasia, with increased MyoD, myogenin, p38 and p21 levels [50]. IGF-I stimulates myoblast proliferati on, myogenic differentiation and myotube hypertrophy in both cultured cells and in intact animals [54]. To balance the mitogenic and myogenic action on skeletal muscle cells, IGF-1 ha s a biphasic effect. Ini tially, IGF-1 inhibits expression of myogenin a myogenic regulatory factor, which re sults in a proliferation response. Subsequently, IGF-1 sw itches to stimulate myogenin expression, which up-regulates differentiation as well as down-re gulates proliferation [177]. It also is re ported that a high concentration of IGF-I can i nhibit myoblast differentiation as well as proliferation [197]. IGF-I is sufficient to induce skeletal muscle hypertrophy. IGF-I can induce myofiber hypertrophy in vitro by stimulating myoblast pr oliferation and fusion to established myofibers

PAGE 37

37 [186]. It also has been reported that an increase in muscle load can stimulate muscle hypertrophy with simultaneous incr eased expression of IGF-1 [43]. Expression of IGF-I in myoblasts can increase the expression of MRFs, such as MyoD and myogenin, and also stimulate contractile protein expression and myotube formation [27]. Mice overexpressing IGF-I in muscle, have at least twofold greater muscle mass compared w ith wild type mice. Thus indicates IGF-I stimulates skeletal muscle hypertrophy in vivo [27]. The mechanism for IGF-I signaling in myoblast proliferati on is mediated primarily by ERK1/2 pathway, whereas myoblast differentiation prefers the PI3K pathway [29]. Figure 2-2 shows the signaling pathways involved in IGF-I induced skeletal muscle hypertrophy. 2.3.3.3 PI3K Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase, which phosphorylates the membrane phospholipids phosphatidylinositol -4 ,5-bisphosphate, produ cing phosphatidylinositol (3,4,5)-trisphosphate [PtdIns(3,4,5)P3]. PtdIns(3,4,5)P3 is a lipid binding site for the serine/threonine kinase, Akt1 ( al so known as protein kinase B) [96]. Once Akt1 is activated, it phosphorylates downstream substrates, which induces gene transcription and protein synthesis to promote cell proliferation a nd inhibit apoptosis [190]. PI3K activity is required fo r IGF-I mediated skeletal mu scle hypertrophy. It has been reported that IGF-1 induces hypertrophy by activ ating the PI3K-Akt pathway, which causes activation of proteins that are required fo r protein synthesis [17;154]. Furthermore, pharmacological inhibition of PI3K activity prevents muscle hype rtrophy induced by IGF-1 [85]. Therefore, PI3K activation is su fficient to induce skeletal musc le hypertrophy, and its activity is necessary for the IGF-1 induced hypertrophy.

PAGE 38

38 2.3.3.4 Akt The Akt family, also called protein kinase B (PKB), is composed of three members, Akt1, Akt2 and Akt3 [96]. These three members share 80% homology but have distinct functions [96]. Akt1 (-/-) mice are viable and smaller than wild type littermates, which suggests Akt1 is required for muscle growth and other ti ssue development [24]. Mice deficient in Akt2 are impaired in the ability of insulin to adjust the blood glucose and the animals have diabetes. Thus Akt2 is involved in glucose transport and main tenance of glucose homeostasis [26]. Akt1 and Akt2 are expressed in skeletal muscle and c ooperate to promote muscle hypertrophy [96]. During work-induced muscle hypertrophy, there is an in crease in endogenous Akt1 activity, as well as mTOR, which is a downstream target of Akt1 [17]. Expression of a dominant negative Akt1 blocks IGF-I induced muscle hypertrophy in vivo [154]. Transgenic mice with constitutively active Akt in adult skeletal muscle exist. In th ese mice, activation of Akt is sufficient to induce rapid and significant skeletal muscle hypertroph y, accompanied by activation of the downstream Akt/mTOR/p70S6 kinase protein synthesis pathway [96]. 2.3.3.5 mTOR and GSK3 Akt1 is a key molecule in the IGF-I indu ced hypertrophy, because it can activate multiple downstream signaling, including the mammalian ta rget of rapamycin (mTOR), p70S6 kinase (p70S6K), phosphorylated heatand acid-stable protein 1 (PHAS-1, also known as 4E-BP1) and glycogen synthase kinase 3 [154]. mTOR is a downstream substrat e that has a central function in integrating growth factor stimulation with intracellular pr otein synthesis. Rapamycin, a mTOR inhibitor, blocks activation of downstream p70S6K stimulation by Akt1 and IGF-I [138;154;155]. Treatment of muscle cells with rapamycin can either i nhibit the cell growth or d ecrease the mucle hypertrophy in vitro

PAGE 39

39 [138;154]. In vivo treating the mice with rapamycin inhibits skeletal muscle hypertrophy induced by over expression of Akt1 [17]. In thes e mice, p70S6K activity decreases, while Akt1 activity does not change. These results indicate a linear si gnaling pathway during hypertrophy: Akt1-mTOR-p70S6K. On the other hand, activation of mTOR also inhibits PHAS-1, which is a negative regulator of the translation initiation factor eIF-4E [71]. Thus, mTOR is the signal molecule downstream of PI3K-Akt pathway in the IGF-I mediated hypertrophy. Active mTOR promotes protein synthesis through two distin ct mechanisms, positively regulating the p70S6K pathway and negatively regulating PHAS-1 pathway. GSK3 is a different substrate of Akt1, which also is involved in regulating skeletal muscle hypertrophy. Phosphorylation of Akt 1 inhibits GSK3 activity [36]. Expression of a dominant-negative form of GSK3 induces hypertrophy in skel etal myotubes [154]. GSK3 inhibits protein translation in itiation through eIF-2B protein [ 72]. Therefore, PI3K-AktGSK3 eTF-2B is another pathway that stimulate pr otein synthesis in skel etal muscle hypertrophy. 2.3.3.6 MAPK The MAPK pathway is an important pathway in volved in IGF-I induced skeletal muscle hypertrophy. The detail of functi on of MAPK pathway in both myogenesis and mitogenesis has been mentioned before. Compared to the PI3K pathway, the function of the MAPK pathway in skeletal muscle hypertrophy is less clear. An interaction between Raf-MEK-ERK pathway and PI3K-Akt pathway plays a role in the process of musc le hypertrophy [122;155;219]. PI 3 kinase activity is essential for induction of Raf/MEK/ERK activity [177]. ERK1/2 pathway and PI3K pathway are both activated when upstream Ras is activated. Transfection of Ras can promote activation of PI3K as well as Raf-1, and a dominant negative Ras mutant inhibits growth factor induced activation of PI3K [153]. Activat ed Akt phosphorylates Raf at a hi ghly conserved serine residue

PAGE 40

40 in its regulatory domain and i nhibits activation of Raf/MEK/ ERK signaling pathway [219]. The Akt-Raf interaction is dependent upon cellular context and dose of stimulus Activation of Akt inhibits Raf activity in differe ntiated myotubes, but not in myoblast precursors [155]. High concentrations of IGF-I activates Akt strongly enough to inhibit Raf kinase activity, whereas low concentration of IGF-I retains mitogenic function that is insufficient to suppress Raf activity [122]. 2.3.3.7 Fibroblast Growth Factor 2 (FGF2) Among all the growth factors th at regulate skeletal muscle hypertrophy, IGF-I, FGF2 and TGFare the most extensively studied. There are more than 20 FGF family members, and FGF1, 2, 4, 5, 6, 8 and 10 are expressed in muscle. FGF2 stimulates myoblast proliferation. De letion of FGF2 signal through overexpression of a dominant negative FGF receptor 1 results in cell cycle withdrawal and suppression of myotube formation [53]. In vitro FGF2 negatively regulates myoge nesis. FGF2 blocks musclespecific gene expression and myot ube fusion [55]. FGF2 localizes in the extracellular matrix of skeletal muscle fiber, and FGF2 accumulation augments muscle hypertr ophy [205]. Inhibition of FGF receptor decreases muscle mass during embr yonic development due to decreases in number of myoblasts, which suggests FGF2 is a posit ive regulator of muscle hypertrophy [53]. The possible mechanism for FGF2 stimulation of skel etal muscle hypertrophy may involve satellite cell activation and proliferation. 2.3.3.8 Hepatocyte Growth Factor (HGF) Muscle satellite cells play a crucial role in muscle growth and injury repair. Normally satellite cells are in a quiescent state, until muscle growth or in jury signals activate them. During the regeneration process, satellite cells proliferate, differentiate and express muscle specific proteins. Both in vivo and in vitro HGF activates satellite cells [6 ]. HGF and its receptor, c-Met,

PAGE 41

41 are localized to satellite cells and adjacent myofibers, and their expression is induced by muscle injury [75]. HGF and c-Met are e xpressed in developing limb buds, and c-Met null mouse embryos fail to form limb skeletal muscle [ 15]. HGF promotes proliferation and inhibits differentiation of satellite cells, and fetal and adult myoblasts [ 61]. HGF inhibits by repressing MyoD and myogenin transcription [61] HGF also causes th e up regulation of tw ist, an inhibitor of differentiation and p2 7, a CDK inhibitor [103]. The actions of HGF are mediated by downstr eam induction of PI3K and ERK1/2 [102]. Grb2 is essential for phosphorylation of ERK1 /2 and repression of myogenesis by HGF. Grb2 binds to PI3K in muscle cells and pr ompts elevated ERK1/2 activity [70]. 2.3.4 Growth Factors and Cytokines that Inhibit Muscle Hypertrophy 2.3.4.1 Transforming Growth Factor (TGF) TGFfamily is an important negative regul ator of skeletal muscle hypertrophy. TGFsignals classically through Smad2 and Smad3 to di srupt all measures of muscle formation [108]. However, ERK1/2 phosphorylation can be induced by TGFin some cell types [128]. The importance of ERK1/2 and TGFsignaling is underscored in myoblasts expressing constitutive Raf [193]. Strong sustained ERK1/2 signaling induces TGFand GDF-8 which may act as autocrine inhibitors of myogenesis. TGFinhibits myogenin-induced myoge nesis in 10T1/2 fibroblasts. TGFtreatment for 30 minutes reversibly induces MEF2 transloca tion to the cytoplasm of myogenic cells, which prevents MEF2 from participating in the transc riptional activation complex at muscle specific promoters [38]. Using truncated type II TGFreceptor as a dominant negative can inhibit myofiber formation and expression of MyoD myogenin and other differentiation markers [52]. Growth and differentiation factor 8 (GDF-8, al so called myostatin), a member of TGF-beta family, is expressed in embryoni c and adult skeletal muscle. GDF-8 null mice are significantly

PAGE 42

42 larger than wild type animals with a 20-35% in crease in muscle mass, wh ich is result of both hyperplasia and hypertrophy [117]. Myos tatin is a negative regulator of satellite cells. Myostatin inhibits myoblast proliferation through increasing p21 expression and decrease Cdk2 expression leading to an accumulation of Rb protein, which in turn arrests myoblasts in G1 phase of cell cycle [176]. 2.3.4.2 Tumor Necrosis Factor-alpha (TNF) TNF, IL-1 and IL-6 are inflammatory cytoki nes released by immune cells in response to foreign stimuli [187]. They are a ssociated with the skeletal musc le catabolic response and have been shown to induce muscle wasting [187]. TNF, also called cachectin, is expressed in diaphragm tissue, and anti-TNFantibody can prevent the deterioration of diaphragm muscle contractile properties [170]. TNFmediates skeletal muscle wasting through activation of NFB and AP-1 [192]. In C2C12 myoblasts, TNF induced NFB inhibits skeletal muscle differentia tion by suppressing MyoD mRNA translation [68]. 2.3.4.3 Interleukin-6 (IL-6) IL-6 is a multifunctional cytokine that plays a major role in the inflammatory response and B-lymphocytes maturation [178]. Skeletal muscle produces IL-6, which is secreted into the plasma and increased during ex ercise [141]. IL-6 expression increases in myofibers after eccentric exercises, which indicates IL-6 may be related to muscle damage and regeneration caused by strenuous exercises [178]. Transgenic mice overexpressing IL-6 show muscle atrophy due to increased catheptic enzyme activity [181] In addition, treatment with IL-6 receptor antibody can block the muscle atrophy and is effec tive against muscle wasting from sepsis and cancer cachexia [182].

PAGE 43

43 The actions of IL-6 are mediated through ST AT3 and ERK1/2 [4]. Human muscle cells treated with IL-6 demonstrate rapid phosphoryla tion of ERK1/2. LIF, a member of the IL-6 family, inhibits muscle gene transcript and myoblast fusion via MEK-de pendent phosphorylation of ERK1/2 [81]. Thus, ERK1/2 signals may cont ribute to interleukin-mediated muscle atrophy. 2.4 Summary of ERK1/2 Effects on Skeletal Myogenesis Muscle hypertrophy is promoted by IGF-I medi ated signaling. IGF -I provokes two major intracellular signaling pathways; th e ERK1/2 signaling cascade and the PI3K pathway. Initiation of ERK1/2 activity in response to IGF-I typically results in mitogenesis, although significant crosstalk exists between the ERK and PI3K sy stems. ERK1/2 activity inhibits myocyte formation independent of conti nued cell cycle progression. Importa ntly, the absolute levels of ERK1/2 signaling appear to affect myogenic deci sions. Low-level ERK2 activity is associated with differentiation while sustai ned ERK1 and ERK2 activity is correlated with inhibition of myogenesis. Thus, signal transmission through ER K1/2 may have divergen t effects on muscle form and function.

PAGE 44

44 Table 2-1. MRF null phenotypes Genotype Viability Phenotype Reference MyoD[101] Viable No obvious def ects in skeletal muscle; with increase myf5 expression [19;157] myf5[101] Perinatal death With normal muscle, defects in rib development [20] myogenin[101] Perinatal death Severe defects in differentiated muscle fiber, but with normal numbers of myonuclei [73;129] MRF4[101] viable Defective rib cage; high level of myogenin expression [139;217] MyoD[101] myf5[101] Dead right after borth Complete absence of myoblas ts and muscle fiber [158] myogenin[101] MyoD/myf5 /MRF4[101] Perinatal death Same phenotype as myogenin[101] mice [148;149] myogenin[101] MyoD[101] MRF4[101] Perinatal death Same phenotype as myogenin[101] mice [185] MyoD[101] MRF4[101] Perinatal death Same phenotype as myogenin[101] mice [149]

PAGE 45

45 Figure 2-1. MAPK signaling cascade

PAGE 46

46 Table 2-2. Summary of MAPK knockout mice phenotypes Genotype Viability Phenotype Reference ERK1[101] Viable Defects in th ymocyte development, enhanced long-term memory [116;137] ERK2[101] Embryonic lethal Defective in placenta development [74] JNK1[101] Viable Defective in T cell activation and apoptosis of thymocytes [162] JNK2[101] Viable Defective in T cell activation and apoptosis of thymocytes [160] JNK1[101] JNK2[101] Embryonic lethal Defective in neural tube closure, UV-induced apoptosis [94;161;180] JNK3[101] Viable Defective in neuroprotection and stress-induced neuronal apoptosis [208] p38 [101] Embryonic lethal Defective placental angiogenesis [1;127] p38 [101] p38 [101] Viable No obvious phenotype [95] ERK5[101] Embryonic lethal Defective blood vessel and myocardium [150;173;206]

PAGE 47

47 Table 2-3. Regulatory factors of skeletal muscle hypertrophy Regulatory factors Positive Negative Exercise Strength training [48] Resistance exercise [48] Nutrition Dietary protein supplement [48] Hormones Testosterone [189] Growth hormone [57] Cortisol [79] Growth factors IGFs [114] FGFs [205] HGF [75] IL-1 [30] IL-6 [181] TNF[154] TGF[220] Others Muscle satellite cells [75] Muscle damage Aging [48]

PAGE 48

48 Figure 2-2. Signaling pathway involved in IG F-I induced skeletal muscle hypertrophy.

PAGE 49

49 CHAPTER 3 MATERIALS AND METHODS 3.1 Cell Culture, Plasmids, and Transfection C2C12 myoblasts were cultivated on gelati n-coated tissue culture plasticware in high glucose Dulbeccos modified Eagles medium su pplemented with 15% fetal bovine serum, 1% penicillinstreptomycin, and 0.5% gentamycin (I nvitrogen, Carlsbad, CA). Differentiation was induced by culture in low glucose DMEM supplem ented with 2% horse serum, 1% penicillin streptomycin, and 0.5% gentamyc in. Where appropriate, FGF2 wa s supplied at 5ng/mL and IGFI was supplemented at 250 ng/mL levels (R&D Systems, Minneapolis, MN). Inhibition of MEK1/2 activity was accomplished by supplem entation of culture medium with 25 M PD98059 (Cell Signaling, Beverly, MA). 3.2 RNA Interference Small interfering RNAs were constructed us ing an artificial neur al network [76]. The double-stranded oligonucleotides coding for siR NA directed against mo use ERK1 mRNA were 5 -AATGTTATAGGCATCCGAGAC, target ing a region spanning 312 and 5 AAGCCTTCCAATCTGCTTATC, targeting the region spanning 519. Oligonucleotide sequences of the DNA coding for siRNA against ERK2 were 5 AAAGTTCGAGTTGCTATCAAG and 5 -AAGAGGATTGAAGTTGAACAG, complimentary to nucleotide sequences 355 and 1111 of mouse ERK2 mRNA. The double-stranded DNAs were cloned first in to RNAi-Ready pS IREN-RetroQ-ZsGreen Retroviral Vector (BD Biosciences Clontech). Single pSIREN-RetroQZsGreen plasmid coding for ERK1 or ERK2 siRNA was transfected into PT67 packaging cell line by calcium phosphate precipitation [82]. The growth medium with viru s was collecting between 24 hour s and 72 hours after transfection. Add polybrene to the medium to a final concentration of 4 g/mL and then filter the medium

PAGE 50

50 through 0.45 m filter. Then the retrovirus was us ed to infected C2C12 myoblasts for 48 hours. The double-strand nucleotides were also cloned in to the pSilencer vect or (Ambion, Woodlands, TX). Single or pairs of pSilencer plasmids codi ng for ERK1 or ERK2 siRNAs were transiently transfected into C2C12 myoblasts by calcium phosphate precipitate formation. The myoblasts were selected in growth medium containing 400 g/mL G418 (Invitrogen, Carlsbad, CA) for 10 days to create the stable cell lines, C2C12s iERK1 and C2C12siERK2. C2C12siCon myoblasts stably express pSilencer containing a randomized 21 base pair cDNA insert. 3.3 Luciferase Reporter Assay C2C12siCon, C2C12siERK1, and C2C12s iERK2 myoblasts (1 105) were cotransfected with 1 g of a multimerized AP1 DN A binding site driving expression of luciferase (AP1-Luc), 50 ng pRLtk, a Renilla luciferase expr ession plasmid as an efficiency monitor, and 0.5 g of pCS2 + MT or pCS2 + MT-RafBXB [82] After 48 h in growth medium, the cells were lysed and luciferase activities measured (Dual-Lu ciferase Reporter kit, Promega, Madison, WI). Transfection efficiency was normalized by pRLtk ac tivity. The assay was repeated three times. 3.4 BrdU Incorporation A BrdU incorporation assay was performed to measure DNA synthesis. C2C12siCon, C2C12siERK1, and C2C12siERK2 m yofibers were incubated with fresh medium containing 10 M BrdU for 30 min, and then BrdU immunocyt ochemistry staining and label index counting were performed. The BrdU labeling index was assessed by point counti ng a total of 400 to 1000 nuclei in 6-8 representative fields. The labeling index was counted as the number of positively labeled nuclei divided by total number of nuclei times 100%.

PAGE 51

51 3.5 Western Blot C2C12siCon, C2C12siERK1, and C2C12siERK 2 myofibers were lysed in 4 sample buffer (250 mM Tris, pH 6.8, 8% SDS, 40% glycerol, and 0.4% -mercaptoethanol) and heated at 95 C for 5 min. Proteins were separated through 10% polyacrylamide gels under denaturing conditions and transferred to nitrocellulose me mbrane. The membranes were incubated with 5% nonfat dried milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, and 0.1% Tween 20) to block non-specific binding sites. Blots were incubate d overnight at 4 C with anti-ERK1/2, antiphosphoERK1/2, anti-Akt or anti-ph osphoAkt (Cell Signaling, Danvers, MA) or for 1 h at room temperature with anti-myosin heavy chain (MF20), anti-myogenin (F5D), anti-desmin (D3,Developmental Studies Hybridoma Bank, Univer sity of Iowa, Ames, IA ) or anti-troponin T [188]. After extensive wash es with TBST, the blots were incu bated with appropriate peroxidaseconjugated secondary antibody for 1 h, follo wing by chemiluminescent detection (ECL, Amersham, Piscataway, NJ) and exposure to X-ray film. 3.6 Immunocytochemistry C2C12siERK1, C2C12siERK2, and C2C12siCon cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature. Nonspecific antigen sites were blocked with PB S containing 5% horse serum and 0.1% Tween 20. Cultures were incubated with anti-myosin hea vy chain (MF20, 1:10 hybridoma supernatant) for 1 h. After exhaustive rinses with PBS, the fixed cultures were incubated with donkey antimouse-AlexaFluor488 antibodies. Cultures were counterstained with Hoescht 33325 for the visualization of nuclei. Immunofluorescence wa s detected with a Nikon TE2000 inverted phase microscope equipped with epifluorescence. Re presentative images were captured with a DMF1200 digital camera and compiled with Lucia Im aging software. For the detection of BrdU incorporation, myoblasts were fi xed with 70% ethanol for 1 h at 4 C. DNA was denatured with

PAGE 52

52 2 N HCl for 1 h in 37 C. Fixed cultures were neutralized and incubated with anti-BrdU (1:50, Invitrogen-Molecular Probes, Carlsbad, CA) for 1 h at room temperature. Subsequently, cells were incubated with goat anti-mouse-biotin and streptavidinperoxidase (ABC kit, Vector Labs, Burlingame, CA). Labeled nuclei were vi sualized colorimetrically using 3,3 -diaminobenzidine and nickel chloride.

PAGE 53

53 CHAPTER 4 RESULTS 4.1 Preliminary Experiment To test the discrete functions of ERK1 and ERK2, a cDNA coding for one siRNA for each ERK isoform was synthesized and cloned into RNAi-Ready pSIREN-RetroQ-ZsGreen Retroviral Vector. This vector contains a cDNA coding for Green Fluorescence Protein (GFP) that allows for identification of transduced cells. pSIRENsiERK1 or pSIRENsiERK2 were transfected into the packaging ce ll line PT67, and replication defec tive retrovirus were harvested. C2C12 myoblasts were transduced with the retrov irus and infection efficiency was monitored by fluorescent GFP detection. Results indicate less than 10% of C2 C12 myoblasts were infected (Figure 4-1). To evaluate siRNA knockdown, total cellular protein lysates were prepared from C2C12 infected by ERK1 or ERK2 siRNA a nd uninfected control C2C12 myoblasts, and analyzed by Western blot for ERK1 and ERK2 proteins (Figure 4-2). The C2C12 myoblasts infected with ERK1 or ERK2 siRNA had no signi ficant reduction in ERK1 and ERK2 protein by comparison with control cells. Due to low inf ection rates and poor knockdown of ERK1 and ERK2, this method was discontinued. To increase the proportion of cells incorpor ating ERK1 or ERK2 siRNA, two stable myogenic cell lines constitutively expressing a single siRNA we re synthesized. siRNAs were cloned into pSilencer vector and selected for neomyosin resistance after tranfection of C2C12 myoblasts. The protein expres sion level was analyzed by Western blot for ERK1/2 and -tubulin. Compared to control cells, C2C12 with single siRNA of ERK1 or ERK2 had no reduction in ERK kinase expressi on (Figure 4-3).

PAGE 54

54 4.2 Creation and Validation of ERK1 and ERK2 siRNA Stable myogenic cell lines incorporating a si ngle siRNA is inefficient, therefore, two siRNAs for each target kinase were synthesized using an artificial neural network program [76]. C2C12 myoblasts were transfected with plas mids coding for the ERK siRNAs followed by selection for neomycin resistance. To evalua te the level of message knockdown, total cellular protein lysates were prepared from C2C 12siCon, C2C12siERK1, and C2C12siERK2, and analyzed by Western for ERK1/2 protein expres sion (Figure 4-4A). Control myoblasts readily synthesize the two kinases. C2C12siERK1 a nd C2C12siERK2 both produce severely reduced amounts of the ERK proteins. The siRNAs are specifi c for the targets of interest as no alterations in protein size or concentration of the reciprocal kinases were observed. Residual kinase activity was measured by Western using an antibody ag ainst phospho-ERK1/2. C2C12siERK1 contained a higher relative amount of phosphoERK2 than controls (C2C12siCon). C2C12siERK2 contained a severe reduction in both total and phosphoERK2. To quantify the reduction of the various forms of ERK1/2, rep licate blots were analyzed by scanning densitometry. Results indicate that ERK1 protein expression is 80% lower than the amount synthesized by control myoblasts (Figure 4-4B). ERK2 and phosphoERK2 proteins are reduced 85% by comparison to controls. To verify that loss of ERK1/2 causes a biological response, C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were transfected with plasmids coding for activated Raf and an AP1-Luc reporter. As s hown in Figure 4-5, C2C12siCon myoblasts contain ERK1/2 proteins that promote the efficient tran scription from AP1-Luc. A reduction in ERK1 or ERK2 protein results in a d ecrease in Raf/ERK directed reporter gene expression. 4.3 Optimal Myoblast Proliferation Re quires One Functional ERK Enzyme ERK1/2 are involved in mitosis and cell prol iferation [140]. Inhibiti on of their activation leads to growth arrest in many cells includi ng myoblasts [83]. The necessity for each ERK

PAGE 55

55 during myoblast proliferation was measured in C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts. Equal numbers of myoblasts were cu ltured for 4 days in mitogen poor medium. Cell numbers were measured daily. A representa tive growth curve is shown in Figure 4-6. Knockdown of ERK1 mRNA did not elicit an eff ect on myoblast proliferation. C2C12siCon and C2C12siERK1 expanded at comparable rates. M yoblasts synthesizing redu ced levels of ERK2 tend to grow slower than either controls or si ERK1 myoblasts, although this is not statistically significant. To confirm variable growth rates, the myoblast popul ations were cultured for 48 h under similar conditions and pulse labeled with BrdU for 30 min prior to fixation. Results indicate that 34%, 34%, and 28% of the cells are present in Sphase for cultures of C2C12siCon, C2C12siERK1, and C2C12siERK2, respectivel y, (Figure 4-7). The reduction in BrdU incorporation supports a tendency toward depressed growth rates of ERK2 deficient myoblasts. To determine if both ERK proteins are necessary for the mitogenic response to FGF2 or IGF-I, cultures of C2C12siCon, C2C12siERK1, and C2 C12siERK2 were treated for 48 h with the growth factors. BrdU incorporation was m easured during the final 30 min of treatment. Treatment of control myoblasts with 5 ng/mL FGF2 causes a 2-fold increase in the numbers of actively dividing cells (Figure 4-7). A simila r response was found in C2C12siERK1 myoblasts treated with the mitogen. The increased cell di vision was somewhat tempered in C2C12siERK2 myoblasts treated with FGF2, though not signi ficant. In a similar manner, C2C12siCon, C2C12siERK1, and C2C12siERK2 m yoblasts proliferate in respons e to IGF-I treatment. Thus, efficient myoblast proliferation necessitates a single functional ERK allele. 4.4 ERK2 is Necessary for Efficient Myofiber Formation The effects of differential ERK1 and ERK2 function on myofiber formation and muscle gene expression were examined in C2C 12 myoblasts. C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were induced to differe ntiate by culture in 2% horse serum for 48 h.

PAGE 56

56 Cultures were fixed and immunostained for myosin heavy chain (MyHC), a marker of terminal differentiation. The scrambled siRNA did not interf ere with the ability of C2C12 myoblasts to differentiate (Figure 4-8). Large multinucleated myofibers were a pparent that readily expressed the contractile protein. A similar result was evident in cultures of C2C12siERK1 cells. By contrast, C2C12siERK2 myoblasts failed to fuse into large sync itia. A portion of the myoblasts expressed MyHC but these cells were mononuc leated with a spi ndlelike morphology. A differentiation index was calculated as the numbe rs of nuclei in MyHC expressing myofibers divided by the total number of nuclei. By co mparison to control and C2C12siERK1 cells, C2C12siERK2 myoblasts formed 50% fewer myosin -expressing cells (Figure 4-9). Coincident with the reduced differentiation cap abilities is a severe impairme nt in myoblast fusion. A fusion index was calculated as the number of MyHC immunopositive fibers with two or more nuclei divided by the total number of nuclei. C2C 12siERK2 myoblasts possess fewer than 5% multinucleated MyHC expressing fibers. These resu lts argue that ERK2 signaling is needed for optimal differentiation and m yoblast fusion. Alternatively, myofiber formation may require elimination of an ERK1 signal. To clarify the role of ERK2 as a positive effector of myogenesis, confluent cultures of C2C12s iERK2 myoblasts were trea ted with 25 M PD98059 under differentiation-permissive conditions. The concen tration of PD98059 is sufficient to inhibit the phosphorylation of ERK1 (Figure 4-10). After 48 h, the cells were fixed and immunostained for MyHC expression. As shown in Figure 4-11, no in crease in the numbers or size of MyHC expressing myofibers is apparent. Because inhi bition of ERK1 function does not restore the myogenic program, ERK2 must play an essential role during myogenesis. 4.5 ERK2 Knockdown Inhibits Myogenin Protein Expression Myogenin expression is a requi site for efficient myofibers formation and muscle gene expression [73]. The reduction in fiber number and contractile protein expr ession suggested that

PAGE 57

57 myogenin expression was compromised. Therefore, equal amounts of protein were analyzed by Western blot using antibodies sp ecific for myogenin and a-tubu lin (Figure 4-12). C2C12siERK2 myoblasts synthesize significantly less myogenin protein. To determine if restoration of myogenin protein expression can alleviate the block to optimal muscle formation in ERK2 deficient myoblasts, the cells were treated with IGF-I [183]. In brief, C2C12siERK2 myoblasts were grown for 48 h in differentiation medium supplemented with 250 ng/mL IGF-I. Total cellular lysates were isolated and analy zed for myogenin protein expression. IGF-I supplementation increased relative myogenin protein levels in C2C 12siERK2 myoblasts to levels comparable to untreated C2C12siCon myobl asts. The amount of myogenin protein was quantified and corrected for a-tubulin expres sion. As shown in Figure 4-13, C2C12siERK2 myoblasts synthesize myogenin at concentrations less than 60 % of wildtype. Treatment of C2C12siCon, C2C12siERK1, and C2C12siERK2 myobl asts with IGF-I increased the amount of myogenin protein, as expected [183]. 4.6 IGF-I Signaling Partially Restores Myoge nin Expression and Myofiber Formation To determine if increased myogenin expressi on can restore differentiation and fusion to ERK2 deficient myoblasts, C2C12siCon, C2C1 2siERK1, and C2C12siERK2 myoblasts were cultured with IGF-I for 48 h prior to fi xation and assessment of differentiation. Immunocytochemical staining for MyHC in IGF -I treated C2C12siERK2 myoblasts noted the appearance of larger myofibers containing three or more nucle i (Figure 4-14). Approximately 10% of the total nuclei were present in MyHC immunopositive myofibers that contained two or more nuclei (Figure 4-15). Interestingly, C2C 12siERK1 myoblasts contai n no detectable ERK1 protein and are more responsive to IGF-I treatment. The number s of nuclei found in myofibers doubles in C2C12siERK1 cultures receiving ectopic IGF-I. Treatment with IGF-I for 48 h did not significantly increase the total number of nuclei (one or more) contained within myosin

PAGE 58

58 expressing cells (Figure 4-16). These results suggest that ERK2 is necessary for myogenin expression, which promotes myoblast fusion. A major intracellular signaling cascade invoked by IGF-I involves the sequential activation of PI3-kinase and Akt [80;105]. Inhibition of PI3-kinase signaling leads to a complete loss of myofiber formation in avian and rode nt myoblasts [80;85;144] To ensure that the preferred IGF-I signa ling system is intact in the ERK defi cient myoblasts, confluent cultures of C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were treat ed with IGF-I for 48 h. Total cellular lysates were prepared a nd analyzed by Western for Akt and phosphoAkt (Figure 4-17). As predicted, IGF-I treatment caused a significant incr ease in the amounts of active Akt in all instances. Thus, the inability of IGF-I to more fully restore the differentiation program to ERK2 deficient myoblasts is not due to a faulty PI3 kinase-mediated intracellular signaling system. 4.7 FGF2 Does Not Signal Exclusively through Either ERK1 or ERK2 to Inhibit Myogenesis FGF2 is an extremely potent antagonist to muscle formation in vitro [134]. The growth factor stimulates ERK1/2 phos phorylation in C2C12 myoblasts and inhibition of ERK1/2 function leads to an increase in myogenin and MyHC protein expression [120]. Becaue C2C12siERK1 myoblasts readily form large myofibers; we examined the possibility that biased ERK2 function could deter the inhibitory acti ons of FGF2 on myogene sis. To this end, C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblas ts were induced to differentiate in the presence or absence of 5 ng/mL FGF2. Myobl ast cultures were fixed and immunostained for MyHC expression and a differentiation index was constructed. Parallel cultures were lysed for Western blot analysis. As shown in Figure 4-18, treatment with FGF2 effectively eliminated myofiber formation in all myoblast cell ty pes. Fewer than 5% of the C2C12siCon,

PAGE 59

59 C2C12siERK1 or C2C12siERK2 myoblasts fuse d into multinucleate fibers (Figure 4-19). Western blot analysis using anti-MyHC and anti-myogenin rev ealed that neither of the aforementioned proteins is synthesized in FG F2 treated myoblasts (Figure 4-20). Thus, all measures of morphological and biochemical differentiation are ablated by FGF2 treatment of wildtype, ERK1 or ERK2 deficien t myoblasts. Previous reports in dicate that inhibition of the upstream kinase, MEK1/2, reverses the suppressi on actions of FGF2 [120 ;179]. A similar result is found in the ERK1 and ERK2 deficient m yoblasts (Figure 4-20). Treatment with 25 M PD98059, a concentration that prevents efficien t phosphorylation of ERK1 /2 resulted in an increase in muscle protein expression. However, myogenic protein levels remained lower than those found in nontreated controls.

PAGE 60

60 siERK1siERK2A C B D Figure 4-1. C2C12 myoblasts tr ansduced with pSIRENsiERK1 and pSIRENsiERK2. C2C12 myoblasts were infected with retrovirus containing single siRNA specific against ERK1 and ERK2. Cells were cultured in growth medium for 48 h. Representation phase as 200x showing GFP transduced cells (A, B) and corresponding phase contrast microscopic field (C, D).

PAGE 61

61 Figure 4-2. C2C12 myoblasts tr ansduced with pSIRENsiERK1 or pSIRENsiERK2 does not inhibit ERK1/2 expression. C2C12 myoblasts were infected with retrovirus containing single siRNA specific agains t ERK1, ERK2 or scambled control oligonucleotide. Cells were cu ltured in growth medium for 24 h. Then total protein isolates were harvested and analyzed by Western blot for total ERK1 and ERK2 protein, or tubulin protein expression. siERK1 siERK2 Control -ERK1 ERK2 -tubulin

PAGE 62

62 Figure 4-3. C2C12 myoblasts stable expressing single siERK1 or siERK2 does not inhibit ERK1/2 expressio. C2C12 myoblasts were transfected with single siRNA specific against ERK1, ERK2 or scambled control o ligonucleotide. Cells were cultured in growth medium for 24 h. Then total protei n isolates were harvested and analyzed by Western blot for total ERK1 and ERK2 protein, or tubulin protein expression. -ERK1 ERK2 -tubulin siERK1 siERK2 Control

PAGE 63

63 0 0.5 1 1.5 2 2.5 3 ERK1ERK2pERK1pERK2Relative Unit siCon siERK1 siERK2 Figure 4-4. Stable expression of siRNA directed against ERK1 or ERK2 reduces ERK1/2 protein levels. A) C2C12 myoblasts were selected for stable expression of a siRNA against ERK1, ERK2 or scambled control oligonuc leotide. Total protein isolates were harvested and analyzed by Western blot for total ERK1 and ERK2 protein, active ERK1/2 or tubulin protein expression. B) Scanning densitometry was used to qualify the reduction in protein pr oduction. Data represent means and standard errors for three impendent experiments. -ERK2 -pERK1 C2C12 -tubulin -ERK1 -pERK2 siCon siERK1 siERK2 B A

PAGE 64

64 0 2 4 6 8 10 12 14 siConsiERK1siERK2AP1 Luc Activity pCS2MT p CS2MT-RafBXB Figure 4-5. Knockdown of ERK1 or ERK2 affect s AP1 luciferase activity. C2C12siCon, C2C12 siERK1 and C2C12siERK2 myoblasts were transiently transfected with AP1-Luc, pRLtk, and pCS2+MT or pCS2+MT-RafBXB. Luciferase activities were measures after 48 h in culture. Relative AP1-Luc was calculated as AP1-Luc/pRLtk. Data represent means and standard errors for three impendent experiments.

PAGE 65

65 3.0 3.5 4.0 4.5 5.0 5.5 0.0024.0048.0072.0096.00108.00TimeLog cell numbe r siCon siERK1 siERK2 Figure 4-6. Knockdown of ERK1 or ERK2 does not prevent myobl ast proliferation. C2C12siCon, C2C12siERK1 and C2C12siERK 2 myoblasts were seeded at equal density and cultures in reduced serum medium for 5 days, cell numbers were measured daily.

PAGE 66

66 0 25 50 75 100siConsiERK1siERK2Mitotic Index Control FGF2 IGF-I Figure 4-7. Knockdown of ERK1 or ERK2 does not affect the mitogenic response. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts we re cultured as described for 48 h in the presence or absence of 5 ng/mL FGF2 or 250 ng/mL IGF-I. Thirty minutes prior to fixation, cekks were pulsed with Br dU. Immunopositive BrdU nuclei and total nuclei were counted. Mitotic index was calculated as [BrdU(+)/total]*100. Means and standard errors of three inde pendent experiments are shown.

PAGE 67

67 C2C12siCon C2C12siERK1 C2C12siERK2 -MyHC Hoescht Figure 4-8. ERK2 deficiency leads to m yogenic arrest. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were cultured in differentiation-permissive medium for 48 h prior to fixation and immunostaining for myosin heavy chain. Total nuclei were visualized by Hoechst stain.

PAGE 68

68 0 10 20 30 40 50 60DifferentiationFusion Index siCon siERK1 siERK2 Figure 4-9. ERK2 deficiency leads to repressi on of differentiation and fusion of myoblasts. C2C12siCon, C2C12siERK1 and C2C12s iERK2 myoblasts were cultured in differentiation-permissive medium for 48 h prior to fixation a nd immunostaining for myosin heavy chain. Total nuclei were visu alized by Hoechst st ain. A differentiation index was calculated as the number of nuc lei in MyHC(+) fibers/total nuclei*100. A fusion index was calculated as the number of fibers containing a minimum of two nuclei divided by total nuclei.

PAGE 69

69 Figure 4-10. Treatment with PD98059 inhibits activation of ERK1/2 and active ERK1/2. C2C12siERK2 myoblasts were differentiated for 48 h in the presence or absence of 25 M PD98059. Cultures were lysed lyse d and equal amounts of protein were analysed by Western for total ERK1/2 pr otein, active ERK1/2 protein or tubulin protein expression. ERK1 pERK1 -tubulin PD98059 +PD98059 C2C12 siERK2 ERK2 pERK2

PAGE 70

70 0% -PD98059+PD98059 -PD98059 +PD98059 -MyHC Hoescht Figure 4-11. Treatment with PD98059 does not affect C2C12siERK2 differentiation. C2C12siERK2 myoblasts were differentiated for 48 h in the presence or absence of 25 M PD98059. Myoblasts were fixed and immunostained for MyHC. Total nuclei were visualized by Hoechst stain.

PAGE 71

71 Figure 4-12. ERK2 deficiency causes a reducti on in myogenin protein expression. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were maintained in differentiation medium for 48 h. Cultures were lysed and e qual amounts of protein were analyzed by Western for myosin heavy chain, myoge nin, troponin, desmin and tubulin. -myogenin -desmin -tubulin siCon siERK1 siERK2 C2C12 -troponin -MyHC

PAGE 72

72 0 40 80 120 160siConsiERK1siERK2Relative [Mgn] IGF-I + IGF-I Figure 4-13. ERK2 deficiency causes reduc ted myogenin expression in C2C12siERK2 myoblasts is partially restored by IG F-I treatment. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were maintain ed in differentiation medium for 48 h in presence or absence of 250 ng/mL IG F-I. Cultures were lysed and equal amounts of protein were an alyzed by Western for myogenin, desmin and tubulin (A). The relative amounts of myogeni n protein were measured by scanning densitometry and ImageQuant software analysis. Myogenin content was normalized to -tubulin (B). Results are means and standard errors of three independent analyses. -myogenin -desmin -tubulin siCon siERK1 siERK2 siCon siERK1 siERK2 IGF-I + IGF-I A B

PAGE 73

73 C2C12siCon C2C12siERK1 C2C12siERK2 (-) IGF-I (+) IGF-I -MyHC -MyHC Hoescht Hoescht Figure 4-14. IGF-I treatment improves the di fferentiation capabilities of C2C12siERK2 myoblasts. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were differentiated in the pres ence or absence of 250 ng/mL IGF-I for 48 h. The cells were fixed and immunostained fo r myosin heavy chain expression.

PAGE 74

74 0 10 20 30 40 50 60siConsiERK1siERK2Fusion Index IGF-I + IGF-I Figure 4-15. Myotube fusion index of IGF-I treated myoblasts. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were differen tiated in the presence or absence of 250 ng/mL IGF-I for 48 h. The cells were fixed and immunostained for myosin heavy chain expression. The numbers of myofiber nuclei and total nuclei were counted in 10 random microscope fields under 200x. Fusion index was calculated as the number of MyHC(+) fibers containing two or more nuclei/total number of nuclei (x100). Means and st andard errors of means from three independent experiments are shown.

PAGE 75

75 0 10 20 30 40 50 60 70siConsiERK1siERK2Differentiation Index IGF-I + IGFI Figure 4-16. Differentiation i ndex of IGF-I treated myoblas ts. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were differen tiated in the presen ce or absence of 250 ng/mL IGF-I for 48 h. The cells were fixed and immunostained for myosin heavy chain expression. The numbers of my ofiber nuclei were and total nuclei were counted in 10 random microscope fields under 200x. Differentiation index was calculated as MyHC(+) nuc lei/total nucleix100. Means and standard errors of means from three independe nt experiments are shown.

PAGE 76

76 Figure 4-17. ERK2 insufficiency does not disrupt IGF-I induced Akt phosphorylation. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were differentiated in the presence or absence of 250 ng/mL IGF-I for 48 h prior to lysi s. Equal amounts of protein were analyzed by Western blot for total and phosphorylat ed Akt and tubulin. IGF-I stimulates phosphorylati on of Akt in all cell types. -Akt -tubulin -phosphoAkt siCon siERK1 siERK2 siCon siERK1 siERK2 IGF-I + IGF-I

PAGE 77

77 C2C12siCon C2C12siERK1 C2C12siERK2 (-) FGF2 (+) FGF2 -MyHC -MyHC Hoescht Hoescht Figure 4-18. FGF2 requires one functional ERK isoform to inhibit myogenic differentiation. C2C12siCon, C2C12siERK1 and C2C12siERK 2 myoblasts were treated for 48 h differentiation permissive medium supplem ented with 5 ng/mL FGF2. Cultures were fixed and immunostained for m yosin heavy chain expression.

PAGE 78

78 0 10 20 30 40siConsiERK1siERK2Differentiation Index FGF2 + FGF2 Figure 4-19. Differentiation inde x of FGF2 treated myoblasts. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were treated for 48 h in differentiationpermissive medium supplemented with 5 ng/mL FGF2. Culture s were fixed and immunostained for myosin heavy chain expression. A differentia tion index was calculated as the number of nuclei in MyHC(+) fiber/ total number of nuclei x100.

PAGE 79

79 Figure 4-20. FGF2 inhibits myogenic differentiation through either ERK isof orm. Parallel cultures of C2C12siCon, C2C12siERK1 and C2C12siE RK2 were treated with 25 M PD98059 or DMSO. Lysates were analyzed by West ern for myosin heavy chain, myogenin and tubulin. + + + + + + + + + -myogenin -tubulin -MyHC PD98059 FGF2 siCon siERK1 siERK2 siCon siERK1 siERK2 siCon siERK1 siERK2

PAGE 80

80 CHAPTER 5 DISCUSSION ERK2 is obligatory for trophoblast proliferati on, mesoderm differentiation, and protection from apoptosis, in vivo [74;119;159;210;210]. A dual role as a modulator of both proliferation and differentiation is reflected in myobl asts that are deficient in ERK2. With regards to cell division, C2C12siERK2 myobl asts divide at a slower rate than ERK1 knockdown or control muscle cells. The reduced rate of proliferati on by these cells is evident at low density whereby, the myoblasts have an extended doubling time of 2 h by comparison to controls. Interestingly, as the ce lls increase in density, a critical number is reached such that growth rates are comparable to control cells. This would argue that low-density C2C12siERK2 myoblasts are unable to produce, s ecrete, and/or respond to a fact or needed for optimal growth. Alternatively, ERK2 deficient myoblasts may be more susceptible to apoptosis. ERK2 null embryos display elevated numbers of apoptotic ce lls that may be attributed to a failure to generate mesoderm [210]. We did not measure apoptosis directly, howev er, no striking increases in pycnotic nuclei or detached cells were obs erved in C2C12siERK2 myoblasts. The slower growth rate of myoblasts devoid of ERK2 also ar gues that ERK1 is unable to compensate for the proliferative effects of the ERK2 isoform. In myoblasts that contai n adequate to elevated levels of functional ERK1, no detectable increase in growth rate or nu mbers of cells in S-phase was observed. These results are similar to those found in the ERK2 null embryo; pulse labeling studies demonstrated that wild-type and ERK2( / ) embryos incorporated BrdU at equivalent rates and levels [210]. The mitogenic actions of ERK2 are further substa ntiated by reports that ERK1( / ) mice are viable, fertile, and of normal size [116]. Our results demonstrate that loss of ERK2 causes a reduction in growth rate wit hout altering the levels of phosphorylated or activated ERK1. Therefore, ERK1 cannot substitute for ERK2 as a modulator of cell division.

PAGE 81

81 The most prominent feature of ERK2 deficient myoblasts is their inability to form large multinucleated myofibers. C2C12siERK2 myoblas ts undergo suboptimal differentiation that is characterized by a 50% reduction in the numbers of myosin expressing cells. Western blot analysis indicates that these myoblasts retain their myogenic identity as measured by their unperturbed expression of desmi n. C2C12siERK2 muscle fibers are stunted and typified by a single myonuclei. The differentiation-defective phenotype is accredited to compromised ERK2 expression as treatment with a chemical inhibito r to prevent ERK1 activity does not re-establish muscle gene expression and mo rphological differentiation. Myogeni n is required for terminal differentiation of myoblasts and myogenin ( / ) mice contain no myofib ers [7;129;191]. ERK2 knockdown myoblasts produce limited amounts of myogenin protein and as predicted, the myoblasts are differentiation def ective. The block to myofiber formation may be partially attributed to reduced myogenin expression. S upplementation of the culture medium with recombinant IGF-I restores myogenin protein s ynthesis to levels comparable to controls. However, the C2C12siERK2 myoblasts remain di fferentiation defective. An increase in the numbers of myofibers (>3 myonuclei) is obser ved but these numbers are 60% lower than controls. Interestingly, C2C12siERK1 myoblasts that synthesize abundant amounts of ERK2 are more responsive to the actions of IGF-I. A 2-fold increase in the number of myonuclei found within mature fibers is noted. These results ar gue that ERK2 is necessary for myoblast fusion; loss of ERK2 inhibits fusion and overpr oduction of ERK2 promotes myogenesis. Multiple reports detail growth factor induction of ERK1/2 activity that leads to an inhibition of myogenesis. Myostatin stimulat es ERK1/2 phosphorylation that suppresses myogenin expression in a MEKdependent manner [209]. Leukemia inhibitory factor (LIF) utilizes the Raf/MEK/ERK signaling cascade to i nhibit C2C12 differentia tion and repression is

PAGE 82

82 relieved upon treatment with a ME K inhibitor [81]. FGF2, an ERK1/2 agonist, is regarded as a potent inhibitor of myogenes is [134]. FGF2 initiated ERK1/2 phosphorylation in C2C12 myoblasts and 23A2 myoblasts se verely impairs biochemical a nd morphological measures of muscle differentiation; inhibition of ERK1/2 act ivation reinstates the muscle gene program [179;197]. Our myoblast cell lines th at are deficient in either ER K1 or ERK2 are responsive to the repressive actions of FGF2. Both C2C 12siERK1 and C2C12siERK2 myoblasts fail to express markers of the terminal differentiation program in the presence of FGF2. The ability of FGF2 to severely restrict myogenesis in the ER K deficient myoblasts indi cates that the growth factor indiscriminately utilizes either kinase isoform. Furt her support for this premise is demonstrated by restoration of myosin heavy ch ain and myogenin synthesis upon treatment with PD98059, a chemical MEK inhibitor. The restora tion of myosin and myogenin expression does not reproduce wild-type levels thereby, sugge sting that FGF2 uses additional signaling mechanism to impede myoge nesis in its entirety.

PAGE 83

83 CHAPTER 6 IMPLICATIONS Skeletal muscle is the largest tissue in the body representing 70% of the body mass. It is responsible for the stability of body posture and body movement. Skeletal muscle cell differentiation is a complex system that is hi ghly regulated. Many growth factors and hormones can control this process through activation of various intracellular signaling pathways. Among these signaling cascades, the ERK1/2 pathway is a key regulator of skeletal myogenesis. The ERK1/2 signaling pathway plays an important role in skeletal muscle development, and is involved in the postnatal muscle grow th, muscle repair and hypertrophy. This research focuses on the mechanism of how ERK1/2 work in vitro which has potential use in human health and the meat industry. Skeletal muscle hypertrophy and hyperplasia are tw o mechanisms that lead to an increase in muscle mass. Many signaling pathways are invo lved in this process. Naturally or induced mutations in some signal molecules can promote this process to increase muscle mass. For example, myostatin, a member of TGFfamily, is an inhibitor of muscle differentiation. Mutation of myostatin can result in a herita ble double muscle phenotyp e in cattle. Compared with normal cattle, myostatin-null cattle have an in creased proficiency to convert feed into lean muscle and produce high quality meat with le ss bone, less fat and 20% more lean muscle on average [86]. From this study, ERK2 is requ ired for myoblast differentiation. The ERK1deficient myoblast can fuse into fibers twice th e size as control myoblast in response to IGF-I. This may be due to the ability of these cells to produce highe r amount of ERK2. Thus, ERK2

PAGE 84

84 overexpression may be associated with muscle hypertrophy. When ERK2 is over-produced or has a higher level of phosphoryl ation, animals may have th e similar muscle-hypertrophy phenotype. The advantage of the ERK2-induced hype rtrophy is no extra hormone supplement is needed. This may bring a big benefit for the animal science an d meat production. Advanced age is associated with skeletal mu scle atrophy. As people ge t older, there is a decrease in muscle mass as well as muscle func tion. There are age-rela ted impairments in the muscle responsiveness to overload and injury. Ge netic researchers suggest muscle-derived IGF-I instead of hepatic IGF-I is an important factor in maintaining muscle mass and repairing muscle damage in old age. As muscle gets older, there is an age-related decrea se in the IGF-I response [55]. Based on this work, IGF-I can induce a higher level of myoblast differentiation in the ERK2 overexpressed myoblast. When ERK2 activity is higher in the aged muscle, there may be an increase in muscle mass and re pair capability. As a result, ag e-associated muscle atrophy may be reduced through increasing ERK2 activity in skeletal muscle. However, this work only focuses on the function of ERK2 in the cultured myoblast. It is crucial to build an in vivo model to verify the data from the in vitro experiments. An animal model with ERK2 protein knockdow n or overexpression in skeletal muscle is a more powerful tool for examination of ERK2 function in vivo.

PAGE 85

85 LIST OF REFERENCES [1] Adams RH, Porras A, Alonso G, Jones M, Vintersten K, Panelli S, Valladares A, Perez L, Klein R, Nebreda AR. Essential role of p38alpha MAP kinase in placental but not embryonic cardiovascular developm ent. Mol Cell. 2000; 6(1):109-16. [2] Adi S, Bin-Abbas B, Wu NY, Rosentha l SM. Early stimulation and late inhibition of extracellular signal -regulated kinase 1/2 phosphoryl ation by IGF-I: a potential mechanism mediating the switch in IGF-I ac tion on skeletal muscle cell differentiation. Endocrinology 2002; 143: 511-516. [3] Adjei AA. Blocking oncogenic Ras signa ling for cancer therapy. J. Natl. Cancer Inst. 2001; 93: 1062-1074. [4] Al Khalili L, Bouzakri K, Gl und S, Lonnqvist F, Koistinen HA, Krook A. Signaling specificity of interl eukin-6 action on glucose and lipid metabolism in skeletal muscle. Mol. Endocrinol. 2006. [5] Allen RE, Rankin LL, Greene EA, Boxhorn LK, Johnson SE, Taylor RG, Pierce PR. Desmin is present in proliferating rat musc le satellite cells but not in bovine muscle satellite cells. J. Ce ll Physiol 1991; 149: 525-535. [6] Allen RE, Sheehan SM, Taylor RG Kendall TL, Rice GM. Hepatocyte growth factor activates quiescent skelet al muscle satellite cells in vitro. J. Cell Ph ysiol 1995; 165: 307-312. [7] Arnold HH, Braun T. Targeted inactiva tion of myogenic factor genes reveals their role during mouse myogenes is: a review. Int. J. Dev. Biol. 1996; 40: 345-353. [8] Baeza-Raja B, Munoz-Canoves P. p38 MAPK-induced nuclear factor-kappaB activity is required for skeletal muscle differentiation: role of interleukin-6. Mol. Biol. Cell 2004; 15: 2013-2026. [9] Bain G, Engel I, Robanus Maandag EC, te Riele HP, Voland JR, Sharp LL, Chun J, Huey B, Pinkel D, Murre C. E2A deficien cy leads to abnormalities in alphabeta T-cell development and to rapid development of T-cell lymphomas. Mol. Cell Biol. 1997; 17: 4782-4791. [10] Bain G, Maandag EC, Izon DJ, Amse n D, Kruisbeek AM, Weintraub BC, Krop I, Schlissel MS, Feeney AJ, van Roon M, E2 A proteins are require d for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 1994; 79: 885892. [11] Bajard L, Relaix F, Lagha M, Rocancourt D, Daubas P, Buckingham ME. A novel genetic hierarchy functions during hypaxi al myogenesis: Pax3 directly activates Myf5 in muscle progenitor cells in the limb. Genes Dev. 2006; 20: 2450-2464.

PAGE 86

86 [12] Baumann B, Weber CK, Troppmair J, Whiteside S, Israel A, Rapp UR, Wirth T. Raf induces NF-kappaB by membrane shuttle kinase MEKK1, a signaling pathway critical for transformation. Proc. Natl. Acad. Sci. U. S. A 2000; 97: 4615-4620. [13] Beauchamp JR, Heslop L, Yu DS Tajbakhsh S, Kelly RG, Wernig A, Buckingham ME, Partridge TA, Zammit PS. Ex pression of CD34 and Myf5 defines the majority of quiescent adult sk eletal muscle satellite cells J. Cell Biol. 2000; 151: 12211234. [14] Belanger LF, Roy S, Tremblay M, Brott B, Steff AM, Mourad W, Hugo P, Erikson R, Charron J. Mek2 is dispensable fo r mouse growth and development. Mol. Cell Biol. 2003; 23: 4778-4787. [15] Bladt F, Riethmacher D, Isenmann S, Aguzzi A, Birchmeier C. Essential role for the c-met receptor in the migration of myogeni c precursor cells into the limb bud. Nature 1995; 376: 768-771. [16] Bober E, Lyons GE, Braun T, Cossu G, Buckingham M, Arnold HH. The muscle regulatory gene, Myf-6, has a biphasic pa ttern of expression during early mouse development. J. Cell Biol. 1991; 113: 1255-1265. [17] Bodine SC, Stit t TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R, Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, Yancopoulos GD. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001; 3: 1014-1019. [18] Brand-Saberi B, Christ B. Genetic and epigenetic control of muscle development in vertebrates. Cell Tissue Res. 1999; 296: 199-212. [19] Braun T, Arnold HH. Inactivation of Myf-6 and Myf-5 genes in mice leads to alterations in skeletal muscle development. EMBO J. 1995; 14: 1176-1186. [20] Braun T, Rudnicki MA, Arnold HH, J aenisch R. Targeted inactivation of the muscle regulatory gene Myf-5 results in abnormal rib development and perinatal death. Cell 1992; 71: 369-382. [21] Brunet A, Brondello JM, L'Allemain G, Lenormand P, McKenzie F, Pages G, Pouyssegur J. [MAP kinase module: role in the control of cell prolifer ation]. C. R. Seances Soc. Biol. Fil. 1995; 189: 43-57. [22] Brunet A, Roux D, Lenormand P, Do wd S, Keyse S, Pouyssegur J. Nuclear translocation of p42/p44 mitogenactivated protein kinase is required for growth factorinduced gene expression and cell cy cle entry. EMBO J. 1999; 18: 664-674. [23] Bueno OF, Molkentin JD. Involvement of extracellular si gnal-regulated kinases 1/2 in cardiac hypertrophy and cel l death. Circ. Res. 2002; 91: 776-781.

PAGE 87

87 [24] Chen WS, Xu PZ, Gottlob K, Chen ML, Sokol K, Shiyanova T, Roninson I, Weng W, Suzuki R, Tobe K, Kadowaki T, Hay N. Growth retardation and increased apoptosis in mice with homozygous disrupti on of the Akt1 gene. Genes Dev. 2001; 15: 2203-2208. [25] Cheng TC, Tseng BS, Merlie JP Klein WH, Olson EN. Activation of the myogenin promoter during mouse embryogenesis in the absence of pos itive autoregulation. Proc. Natl. Acad. Sci. U. S. A 1995; 92: 561-565. [26] Cho H, Mu J, Kim JK, Thorvaldsen JL, Chu Q, Cr enshaw EB, III, Kaestner KH, Bartolomei MS, Shulman GI, Birnbaum MJ. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Sc ience. 2001; 292(5522): 1728-31 [27] Coleman ME, DeMayo F, Yin KC, L ee HM, Geske R, Montgomery C, Schwartz RJ. Myogenic vector expression of insulin-like growth factor I stimulates muscle cell differentiation and myofiber hypertrophy in tr ansgenic mice. J. Biol. Chem. 1995; 270: 12109-12116. [28] Conway K, Pin C, Ki ernan JA, Merrifield P. The E protein HEB is preferentially expressed in developing muscle. Differentiation 2004; 72: 327-340. [29] Coolican SA, Samuel DS, Ewton DZ McWade FJ, Florini JR. The mitogenic and myogenic actions of insulin-like growth factors utilize distinct signaling pathways. J. Biol. Chem. 1997; 272: 6653-6662. [30] Cooney RN, Maish GO, III, Gilp in T, Shumate ML, Lang CH, Vary TC. Mechanism of IL-1 induced inhibition of prot ein synthesis in skelet al muscle. Shock 1999; 11: 235-241. [31] Cooper RN, Tajbakhsh S, Mouly V, Cossu G, Buckingham M, Butler-Browne GS. In vivo satellite cell activation via Myf5 and MyoD in regenerating mouse skeletal muscle. J. Cell Sci.1999; 112(17): 2895-2901. [32] Cornelison DD, Filla MS, Stanley HM, Rapraeger AC, Olwin BB. Syndecan-3 and syndecan-4 specifically mark skeletal mu scle satellite cells and are implicated in satellite cell maintenance and muscle regeneration. Dev. Biol. 2001; 239: 79-94. [33] Cornelison DD, Olwin BB, Rudnicki MA, Wold BJ. MyoD(-/-) satellite cells in single-fiber culture are differe ntiation defective and MRF4 de ficient. Dev. Biol. 2000; 224: 122-137. [34] Cornelison DD, Wilcox-Adelman SA Goetinck PF, Rauvala H, Rapraeger AC, Olwin BB. Essential and separable roles for S yndecan-3 and Syndecan-4 in skeletal muscle development and regeneration. Genes Dev. 2004; 18: 2231-2236.

PAGE 88

88 [35] Cowley S, Paterson H, Kemp P, Mars hall CJ. Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiat ion and for transformation of NIH 3T3 cells. Cell 1994; 77: 841-852. [36] Cross DA, Alessi DR, Cohen P, A ndjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediat ed by protein kinase B. Nature 1995; 378: 785-789. [37] Daubas P, Tajbakhsh S, Hadchouel J, Primig M, Buckingham M. Myf5 is a novel early axonal marker in the mouse brain and is subjected to post-tra nscriptional regulation in neurons. Devel opment 2000; 127: 319-331. [38] De Angelis L, Borghi S, Melchionna R, Berghella L, Baccarani-Contri M, Parise F, Ferrari S, Cossu G. Inhibition of myogene sis by transforming grow th factor beta is density-dependent and related to the translocation of transc ription factor MEF2 to the cytoplasm. Proc. Natl. Acad. Sci. U. S. A 1998; 95: 12358-12363. [39] De Angelis L, Zhao J, Andreu cci JJ, Olson EN, Cossu G, McDermott JC. Regulation of vertebrate myotome devel opment by the p38 MAP kinase-MEF2 signaling pathway. Dev. Biol. 2005; 283: 171-179. [40] Deak M, Clifton AD, Lucocq LM, Alessi DR. Mitogenand stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. EMBO J. 1998; 17: 4426-4441. [41] DeChant AK, Dee K, Weyman CM. Ra f-induced effects on the differentiation and apoptosis of skeletal myoblasts are determined by the level of Raf signaling: abrogation of apoptosis by Raf is downstream of caspa se 3 activation. Onco gene 2002; 21: 5268-5279. [42] Dee K, Freer M, Mei Y, Weym an CM. Apoptosis coincident with the differentiation of skeletal myoblasts is dela yed by caspase 3 inhibi tion and abrogated by MEK-independent constitutive Ras si gnaling. Cell Death. Differ. 2002; 9: 209-218. [43] DeVol DL, Rotwein P, Sadow JL, Novakofski J, Bechtel PJ. Activation of insulin-like growth factor ge ne expression during work-induced skeletal muscle growth. Am. J. Physiol 1990; 259: E89-E95. [44] Dorman CM, Johnson SE. Activated Raf inhibits avian myogenesis through a MAPK-dependent mechanism. Oncogene 1999; 18: 5167-5176. [45] Edmondson DG, Cheng TC, Cserjesi P, Chakraborty T, Olson EN. Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Mol. Cell Biol. 1992; 12: 3665-3677. [46] Enslen H, Brancho DM, Davis RJ. Mo lecular determinants that mediate selective activation of p38 MAP kinase is oforms. EMBO J. 2000; 19: 1301-1311.

PAGE 89

89 [47] Errede B, Cade RM, Yashar BM, Kamada Y, Levin DE, Irie K, Matsumoto K. Dynamics and organization of MAP kinase signal pathways. Mol. Reprod. Dev. 1995; 42: 477-485. [48] Evans WJ. Protein nutrition, exerci se and aging. J. Am. Coll. Nutr. 2004; 23: 601S-609S. [49] Fedorov YV, Rosenthal RS, Olwin BB. Oncogenic Ras-induced proliferation requires autocrine fibroblast grow th factor 2 signaling in skelet al muscle cells. J. Cell Biol. 2001; 152: 1301-1305. [50] Fernandez AM, Dupont J, Farrar RP, Lee S, Stannard B, Le Roith D. Musclespecific inactivation of the IG F-I receptor induces compensa tory hyperplasia in skeletal muscle. J. Clin. Invest 2002; 109: 347-355. [51] Ferrell JE, Jr. Tripping the switch fantastic: how a protein kinase cascade can convert graded inputs into switch-like outputs. Trends Biochem. Sci. 1996; 21: 460-466. [52] Filvaroff EH, Ebner R, Derynck R. Inhibition of myogenic differentiation in myoblasts expressing a truncated type II TGF-beta receptor. Development 1994; 120: 1085-1095. [53] Flanagan-Steet H, Hannon K, McA voy MJ, Hullinger R, Olwin BB. Loss of FGF receptor 1 signaling reduces skeletal muscle mass and disrupts myofiber organization in the developing limb. Dev. Biol. 2000; 218: 21-37. [54] Florini JR, Ewton DZ Coolican SA. Growth hormone and the insulin-like growth factor system in myogenesis. Endocr. Rev. 1996; 17: 481-517. [55] Florini JR, Ewton DZ, Magri KA. Hormones, growth factors, and myogenic differentiation. Annu. Rev. Physiol 1991; 53: 201-216. [56] Fowden AL. Endocrine regulation of fetal growth. Reprod. Fertil. Dev. 1995; 7: 351-363. [57] Frisch H. Growth hormone and body composition in athletes. J. Endocrinol. Invest 1999; 22: 106-109. [58] Fujii N, Boppart MD, Dufresne SD, Crowley PF, Jozsi AC, Sakamoto K, Yu H, Aschenbach WG, Kim S, Miyazaki H, Rui L, White MF, Hirshman MF, Goodyear LJ. Overexpression or ablation of JNK in skeletal muscle has no effect on glycogen synthase activity. Am. J. Physiol Ce ll Physiol 2004; 287: C200-C208. [59] Fukuda M, Gotoh I, Adachi M, Gotoh Y, Nishida E. A novel regulatory mechanism in the mitogen-activated protein (M AP) kinase cascade. Role of nuclear export signal of MAP kinase kinase. J. Biol. Chem. 1997; 272: 32642-32648.

PAGE 90

90 [60] Fukuda M, Gotoh Y, Nishida E. In teraction of MAP kinase with MAP kinase kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase. EMBO J. 1997; 16: 1901-1908. [61] Gal-Levi R, Leshem Y, Aoki S, Nakamura T, Halevy O. Hepatocyte growth factor plays a dual role in regulating skeletal muscle sa tellite cell proliferation and differentiation. Biochim. Bi ophys. Acta 1998; 1402: 39-51. [62] Giroux S, Tremblay M, Bernard D, Cardin-Girard JF, Aubry S, Larouche L, Rousseau S, Huot J, Landry J, Jeannotte L, Charron J. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angi ogenesis in the labyrinthine region of the placenta. Curr. Biol. 1999; 9: 369-372. [63] Glass DJ. Molecular mechanisms modulating muscle mass. Trends Mol. Med. 2003; 9: 344-350. [64] Gong X, Wang X, Han J, Niesman I, Huang Q, Horwitz J. Development of cataractous macrophthalmia in mice expressi ng an active MEK1 in the lens. Invest Ophthalmol. Vis. Sci. 2001; 42: 539-548. [65] Gossett LA, Kelvin DJ, Sternberg EA, Olson EN. A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mo l. Cell Biol. 1989; 9: 5022-5033. [66] Grayson J, Bassel-Duby R, Williams RS. Collaborative interactions between MEF-2 and Sp1 in muscle-specific gene re gulation. J. Cell Biochem. 1998; 70: 366-375. [67] Gredinger E, Gerber AN, Tamir Y, Tapscott SJ, Bengal E. Mitogen-activated protein kinase pathway is invol ved in the differentiation of muscle cells. J. Biol. Chem. 1998; 273: 10436-10444. [68] Guttridge DC, Mayo MW, Madrid LV, Wang CY, Baldwin AS, Jr. NF-kappaBinduced loss of MyoD messenger RNA: possi ble role in muscle decay and cachexia. Science 2000; 289: 2363-2366. [69] Hagemann C, Rapp UR. Isotype-specifi c functions of Raf kinases. Exp. Cell Res. 1999; 253: 34-46. [70] Halevy O, Cantley LC. Differentia l regulation of the phosphoinositide 3-kinase and MAP kinase pathways by hepatocyte growth factor vs. insulin-like growth factor-I in myogenic cells. Exp. Cell Res. 2004; 297: 224-234. [71] Hara K, Yonezawa K, Kozlowsk i MT, Sugimoto T, Andrabi K, Weng QP, Kasuga M, Nishimoto I, Avruch J. Regul ation of eIF-4E BP1 phosphorylation by mTOR. J. Biol. Chem. 1997; 272: 26457-26463. [72] Hardt SE, Sadoshima J. Glycogen sy nthase kinase-3beta: a novel regulator of cardiac hypertrophy and development. Circ. Res. 2002; 90: 1055-1063.

PAGE 91

91 [73] Hasty P, Bradley A, Morris JH Edmondson DG, Venuti JM, Olson EN, Klein WH. Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature 1993; 364: 501-506. [74] Hatano N, Mori Y, Oh-hora M, Ko sugi A, Fujikawa T, Nakai N, Niwa H, Miyazaki J, Hamaoka T, Ogata M. Essentia l role for ERK2 mitogen-activated protein kinase in placental developmen t. Genes Cells. 2003; 8(11):847-56 [75] Hawke TJ, Garry DJ. Myogenic satellite ce lls: physiology to molecular biology. J. Appl. Physiol 2001; 91: 534-551. [76] Huesken D, Lange J, Mickanin C, We iler J, Asselbergs F, Warner J, Meloon B, Engel S, Rosenberg A, Cohen D, Labow M, Reinhardt M, Natt F, Hall J. Design of a genome-wide siRNA library usi ng an artificial neural netw ork. Nat. Biotechnol. 2005; 23: 995-1001. [77] Irintchev A, Zeschnigk M, Starzinski-Powitz A, Wern ig A. Expression pattern of M-cadherin in normal, denervated, and rege nerating mouse muscles. Dev. Dyn. 1994; 199: 326-337. [78] Isaksson OG, Lindahl A, Nilsson A, Isgaard J. Action of growth hormone: current views. Acta Paediatr. Sc and. Suppl 1988; 343: 12-18. [79] Izquierdo M, Hakkinen K, Anton A, Garrues M, Ibanez J, Ruesta M, Gorostiaga EM. Maximal strength and power, endurance performance, and serum hormones in middle-aged and elderly men. Med Sc i Sports Exerc. 2001; 33(9):1577-87. [80] Jiang BH, Aoki M, Zheng JZ, Li J, Vogt PK. Myogenic signaling of phosphatidylinositol 3-kinase re quires the serine-threonine ki nase Akt/protein kinase B. Proc. Natl. Acad. Sci. U. S. A 1999; 96: 2077-2081. [81] Jo C, Kim H, Jo I, Choi I, Jung SC, Kim J, Kim SS, Jo SA. Leukemia inhibitory factor blocks early differentia tion of skeletal muscle cells by activating ERK. Biochim. Biophys. Acta 2005; 1743: 187-197. [82] Johnson SE, Dorman CM, Bolanowsk i SA. Inhibition of myogenin expression by activated Raf is not responsible for the bloc k to avian myogenesis. J. Biol. Chem. 2002; 277: 28742-28748. [83] Jones NC, Fedorov YV, Rosenthal RS, Olwin BB. ERK1/2 is required for myoblast proliferation but is dispensable fo r muscle gene expression and cell fusion. J. Cell Physiol 2001; 186: 104-115. [84] Jones NC, Tyner KJ, Nibarger L, Stanley HM, Cornelison DD, Fedorov YV, Olwin BB. The p38{alpha}/{beta} MAPK functions as a molecu lar switch to activate the quiescent satellite cell. J. Cell Biol. 2005; 169: 105-116.

PAGE 92

92 [85] Kaliman P, Vinals F, Testar X, Palacin M, Zorzano A. Phosphatidylinositol 3kinase inhibitors block differe ntiation of skeletal muscle cells. J. Biol. Chem. 1996; 271: 19146-19151. [86] Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontes e cattle. Genome Res. 1997; 7: 910-916. [87] Kasler HG, Victoria J, Duramad O, Winoto A. ERK5 is a novel type of mitogenactivated protein kinase cont aining a transcriptional activation domain. Mol. Cell Biol. 2000; 20: 8382-8389. [88] Kato Y, Kravchenko VV, Tapping RI Han J, Ulevitch RJ, Lee JD. BMK1/ERK5 regulates serum-induced early gene expression through tran scription factor MEF2C. EMBO J. 1997; 16: 7054-7066. [89] Kaufman SJ, Foster RF. Replica ting myoblasts express a muscle-specific phenotype. Proc. Natl. Acad. Sc i. U. S. A 1988; 85: 9606-9610. [90] Kerkhoff E, Rapp UR. High-intensity Raf signals conve rt mitotic cell cycling into cellular growth. Cancer Res. 1998; 58: 1636-1640. [91] Khurana A, Dey CS. I nvolvement of c-Jun N-terminal kinase activities in skeletal muscle differentiation. J. Muscle Res. Cell Motil. 2004; 25: 645-655. [92] Knapp JR, Davie JK, Myer A, Me adows E, Olson EN, Klein WH. Loss of myogenin in postnatal life l eads to normal skeletal muscle but reduced body size. Development 2006; 133: 601-610. [93] Kontaridis MI, Liu X, Zhang L, Bennett AM. SHP-2 complex formation with the SHP-2 substrate-1 during C2C12 myogene sis. J. Cell Sci. 2001; 114: 2187-2198. [94] Kuan CY, Yang DD, Samanta Roy DR Davis RJ, Rakic P, Flavell RA. The Jnk1 and Jnk2 protein kinases are required for regi onal specific apoptos is during early brain development. Neuron 1999; 22: 667-676. [95] Kuida K, Boucher DM. Functions of MAP kinases: insights from gene-targeting studies. J. Biochem. (Tokyo) 2004; 135: 653-656. [96] Lai KM, Gonzalez M, Poueymirou WT Kline WO, Na E, Zlotchenko E, Stitt TN, Economides AN, Yancopoulos GD, Glass DJ. Conditional activation of akt in adult skeletal muscle induces rapid hypert rophy. Mol. Cell Biol. 2004; 24: 9295-9304. [97] Lassar AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova A, Baltimore D, Weintraub H. Functiona l activity of myogenic HLH proteins requires heterooligomerization with E12/E47-like pr oteins in vivo. Cell 1991; 66: 305-315. [98] Lassar AB, Munsterberg AE. The role of positive and negative signals in somite patterning. Curr. Opin. Ne urobiol. 1996; 6: 57-63.

PAGE 93

93 [99] Lavoie JN, L'Allemain G, Brunet A, Muller R, Pouyssegur J. Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway. J. Biol. Chem. 1996; 271: 20608-20616. [100] Le Gall M, Chambard JC, Breittmay er JP, Grall D, Pouyssegur J, ObberghenSchilling E. The p42/p44 MAP kinase pathwa y prevents apoptosis induced by anchorage and serum removal. Mol Biol Cell. 2000; 11(3):1103-12. [101] Lehmann K, Janda E, Pierreux CE, Rytomaa M, Schulze A, McMahon M, Hill CS, Beug H, Downward J. Raf induces TGFb eta production while blocking its apoptotic but not invasive responses: a mechanism lead ing to increased malignancy in epithelial cells. Genes Dev. 2000; 14: 2610-2622. [102] Leshem Y, Gitelman I, Ponzetto C, Halevy O. Pr eferential binding of Grb2 or phosphatidylinositol 3-kinase to the met receptor has opposite effects on HGF-induced myoblast proliferation. Exp. Cell Res. 2002; 274: 288-298. [103] Leshem Y, Spicer DB, Gal-Levi R, Halevy O. Hepatocyte growth factor (HGF) inhibits skeletal muscle cell differentiation: a role for the bHLH protein twist and the cdk inhibitor p27. J. Cell Physiol 2000; 184: 101-109. [104] Lewis TS, Shapiro PS, Ahn NG. Signal transduction through MAP kinase cascades. Adv. Cancer Res. 1998; 74: 49-139. [105] Li Y, Jiang B, Ensign WY, Vogt PK, Han J. Myogenic differentiation requires signalling through both phosphatidylinositol 3kinase and p38 MAP kinase. Cell Signal. 2000; 12: 751-757. [106] Lilly B, Zhao B, Ranganayakul u G, Paterson BM, Schulz RA, Olson EN. Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila. Science 1995; 267: 688-693. [107] Lin Q, Schwarz J, Bucana C, Ols on EN. Control of mouse cardiac morphogenesis and myogenesis by transcription factor MEF2C. Science 1997; 276: 1404-1407. [108] Liu D, Black BL, Derynck R. TGFbeta inhibits muscle differentiation through functional repression of myoge nic transcription factors by Smad3. Genes Dev. 2001; 15: 2950-2966. [109] Liu JP, Baker J, Perkins AS, Robe rtson EJ, Efstratiadis A. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 1993; 75: 59-72. [110] Lluis F, Ballestar E, Suelve s M, Esteller M, Munoz-Canoves P. E47 phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific gene transcription. EMBO J. 2005; 24: 974-984.

PAGE 94

94 [111] Loughna PT, Bates PC. Interactions between growth hormone and nutrition in hypophysectomised rats: skeletal muscle myos in heavy chain mRNA levels. Biochem. Biophys. Res. Commun. 1994; 198: 97-102. [112] Lowy DR, Willumsen BM. Function and regulation of ras. Annu. Rev. Biochem. 1993; 62: 851-891. [113] Lupu F, Terwilliger JD, Lee K, Se gre GV, Efstratiadis A. Roles of growth hormone and insulin-like growth factor 1 in mouse postnatal grow th. Dev. Biol. 2001; 229: 141-162. [114] Mathews LS, Hammer RE, Behringe r RR, D'Ercole AJ, Be ll GI, Brinster RL, Palmiter RD. Growth enhancement of tran sgenic mice expressing human insulin-like growth factor I. Endoc rinology 1988; 123: 2827-2833. [115] MAURO A. Satellite ce ll of skeletal muscle fibers J. Biophys. Biochem. Cytol. 1961; 9: 493-495. [116] Mazzucchelli C, Vantaggiato C, Ci amei A, Fasano S, Pakhotin P, Krezel W, Welzl H, Wolfer DP, Pages G, Valverde O, Marowsky A, Porrazzo A, Orban PC, Maldonado R, Ehrengruber MU, Cestari V, Lipp HP, Chapman PF, Pouyssegur J, Brambilla R. Knockout of ERK1 MAP kinase e nhances synaptic plasticity in the striatum and facilitates striatal-mediated le arning and memory. Neuron 2002; 34: 807-820. [117] McPherron AC, Lawler AM, Lee SJ. Re gulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997; 387: 83-90. [118] Megeney LA, Kablar B, Garrett K, Anderson JE, Rudnicki MA. MyoD is required for myogenic stem cell function in adult skeletal muscle. Genes Dev. 1996; 10: 1173-1183. [119] Meloche S, Vella FD, Voisin L, Ang SL, Saba-El-Leil M. Erk2 signaling and early embryo stem cell self-rene wal. Cell Cycle 2004; 3: 241-243. [120] Milasincic DJ, Calera MR, Farmer SR, Pilch PF. Stimulation of C2C12 myoblast growth by basic fibroblast growth factor a nd insulin-like growth factor 1 can occur via mitogen-activated protein kinase-dependent and -independent pathways. Mol. Cell Biol. 1996; 16: 5964-5973. [121] Minden A, Karin M. Regulation and function of the JNK subgroup of MAP kinases. Biochim. Biophys Acta 1997; 1333: F85-104. [122] Moelling K, Schad K, Bosse M, Zi mmermann S, Schweneker M. Regulation of Raf-Akt Cross-talk. J. Bi ol. Chem. 2002; 277: 31099-31106. [123] Molkentin JD, Black BL, Martin JF Olson EN. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 1995; 83: 1125-1136.

PAGE 95

95 [124] Mor A, Philips MR. Compartm entalized Ras/MAPK signaling. Annu. Rev. Immunol. 2006; 24: 771-800. [125] Morrison DK, Cutler RE. The comple xity of Raf-1 regulation. Curr. Opin. Cell Biol. 1997; 9: 174-179. [126] Moss FP, Leblond CP. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 1971; 170: 421-435. [127] Mudgett JS, Ding J, Guh-Siesel L, Chartrain NA, Yang L, Gopal S, Shen MM. Essential role for p38alpha mitogen-activated protein kinase in pl acental angiogenesis. Proc. Natl. Acad. Sci. U. S. A 2000; 97: 10454-10459. [128] Mulder KM. Role of Ras and Ma pks in TGFbeta signali ng. Cytokine Growth Factor Rev. 2000; 11: 23-35. [129] Nabeshima Y, Hanaoka K, Hayasaka M, Esumi E, Li S, Nonaka I, Nabeshima Y. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 1993; 364: 532-535. [130] Naya FJ, Wu C, Richardson JA, Over beek P, Olson EN. Tr anscriptional activity of MEF2 during mouse embryogenesis monito red with a MEF2-dependent transgene. Development 1999; 126: 2045-2052. [131] O'Neill E, Kolch W. Taming the Hi ppo: Raf-1 Controls Apoptosis by Suppressing MST2/Hippo. Cell Cycle 2005; 4. [132] Olguin HC, Olwin BB. Pax-7 up-regul ation inhibits myogenesis and cell cycle progression in satellite cells: a potential m echanism for self-renewal. Dev. Biol. 2004; 275: 375-388. [133] Olson EN, Arnold HH, Rigby PW, Wold BJ. Know your neighbors: three phenotypes in null mutants of the myogeni c bHLH gene MRF4. Cell 1996; 85: 1-4. [134] Olwin BB, Hannon K, Kudla AJ. Are fibroblast growth fact ors regulators of myogenesis in vivo? Prog. Growth Factor Res. 1994; 5: 145-158. [135] Ott MO, Bober E, Lyons G, Arnold H, Buckingham M. Early expression of the myogenic regulatory gene, myf-5, in precursor cells of skeletal muscle in the mouse embryo. Development 1991; 111: 1097-1107. [136] Oustanina S, Hause G, Braun T. Pa x7 directs postnatal renewal and propagation of myogenic satellite cells but not thei r specification. EMBO J. 2004; 23: 3430-3439. [137] Pages G, Guerin S, Grall D, B onino F, Smith A, Anjuere F, Auberger P, Pouyssegur J. Defective thymocyte maturati on in p44 MAP kinase (Erk 1) knockout mice. Science 1999; 286: 1374-1377.

PAGE 96

96 [138] Pallafacchina G, Calabria E, Serra no AL, Kalhovde JM, Sc hiaffino S. A protein kinase B-dependent and rapamycin-sensitive pa thway controls skeletal muscle growth but not fiber type specification. Proc. Natl. Acad. Sci. U. S. A 2002; 99: 9213-9218. [139] Patapoutian A, Yoon JK Miner JH, Wang S, Stark K, Wold B. Disruption of the mouse MRF4 gene identifies multiple waves of myogenesis in the myotome. Development 1995; 121: 3347-3358. [140] Pearson G, Robinson F, Beers GT, Xu BE, Karandikar M, Berman K, Cobb MH. Mitogen-activated protein (MAP) kinase path ways: regulation and physiological functions. Endocr. Rev. 2001; 22: 153-183. [141] Pedersen BK, Steensberg A, Schjerli ng P. Muscle-derived interleukin-6: possible biological effects. J. Physiol 2001; 536: 329-337. [142] Penn BH, Bergstrom DA Dilworth FJ, Bengal E, Tapscott SJ. A MyoD-generated feed-forward circuit tempor ally patterns gene expre ssion during skeletal muscle differentiation. Genes Dev. 2004; 18: 2348-2353. [143] Perry RL, Parker MH, Rudnicki MA Activated MEK1 binds the nuclear MyoD transcriptional complex to repress tran sactivation. Mol. Cell 2001; 8: 291-301. [144] Pinset C, Garcia A, Rousse S, D ubois C, Montarras D. Wortmannin inhibits IGFdependent differentiation in the mouse myogeni c cell line C2. C. R. Acad. Sci. III 1997; 320: 367-374. [145] Pritchard CA, Bolin L, Slattery R, Murray R, McMahon M. Post-natal lethality and neurological and gastrointe stinal defects in mice with targeted disruption of the A-Raf protein kinase gene. Cu rr. Biol. 1996; 6: 614-617. [146] Ramocki MB, Johnson SE, White MA, Ashendel CL, Konieczny SF, Taparowsky EJ. Signaling through mitogen-activated protei n kinase and Rac/Rho does not duplicate the effects of activated Ras on skeletal myogenesis. Mol. Cell Biol. 1997; 17: 3547-3555. [147] Rapp UR, Goldsborough MD, Mark GE Bonner TI, Groffen J, Reynolds FH, Jr., Stephenson JR. Structure and bi ological activity of v-raf, a unique oncogene transduced by a retrovirus. Proc. Natl. Acad. Sci. U. S. A 1983; 80: 4218-4222. [148] Rawls A, Morris JH, Rudnicki M, Braun T, Arnold HH, Klein WH, Olson EN. Myogenin's functions do not overlap with those of MyoD or Myf-5 during mouse embryogenesis. Dev. Biol. 1995; 172: 37-50. [149] Rawls A, Valdez MR, Zhang W, Richardson J, Klein WH, Olson EN. Overlapping functions of the myogenic bHLH genes MRF4 and MyoD revealed in double mutant mice. Development 1998; 125: 2349-2358.

PAGE 97

97 [150] Regan CP, Li W, Boucher DM, Spat z S, Su MS, Kuida K. Erk5 null mice display multiple extraembryonic vascular and embryonic cardiovascular defects. Proc Natl Acad Sci U S A. 2002; 99(14): 9248-53 [151] Relaix F, Montarras D, Zaffran S, Gayraud-Morel B, Rocancourt D, Tajbakhsh S, Mansouri A, Cumano A, Buckingham M. Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenito r cells. J. Cell Biol. 2006; 172: 91-102. [152] Relaix F, Rocancourt D, Mansour i A, Buckingham M. A Pax3/Pax7-dependent population of skeletal muscle prog enitor cells. Nature 2005; 435: 948-953. [153] Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ, Waterfield MD, Downward J. Phosphatidylinosito l-3-OH kinase as a direct target of Ras. Nature 1994; 370: 527-532. [154] Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, Glass DJ. Mediation of IGF-1-i nduced skeletal myotube hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 path ways. Nat. Cell Biol. 2001; 3: 1009-1013. [155] Rommel C, Clarke BA, Zimmermann S, Nunez L, Ro ssman R, Reid K, Moelling K, Yancopoulos GD, Glass DJ. Di fferentiation stage-specific inhibition of the Raf-MEKERK pathway by Akt. Science 1999; 286: 1738-1741. [156] Roovers K, Assoian RK Integrating the MAP kinase signal into the G1 phase cell cycle machinery. Bioessays 2000; 22: 818-826. [157] Rudnicki MA, Braun T, Hinuma S, J aenisch R. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH ge ne Myf-5 and results in apparently normal muscle development. Cell 1992; 71: 383-390. [158] Rudnicki MA, Schnegelsberg PN, St ead RH, Braun T, Arnold HH, Jaenisch R. MyoD or Myf-5 is required for the formati on of skeletal muscle. Cell 1993; 75: 13511359. [159] Saba-El-Leil MK, Vella FD, Vernay B, Voisin L, Chen L, Labrecque N, Ang SL, Meloche S. An essential function of the mit ogen-activated protein kinase Erk2 in mouse trophoblast development. EMBO Rep. 2003; 4: 964-968. [160] Sabapathy K, Hu Y, Kallunki T, Sc hreiber M, David JP, Jochum W, Wagner EF, Karin M. JNK2 is required for efficient T-ce ll activation and apoptos is but not for normal lymphocyte development. Curr. Biol. 1999; 9: 116-125. [161] Sabapathy K, Jochum W, Hoched linger K, Chang L, Karin M, Wagner EF. Defective neural tube morphoge nesis and altered apoptosis in the absence of both JNK1 and JNK2. Mech. Dev. 1999; 89: 115-124.

PAGE 98

98 [162] Sabapathy K, Kallunki T, David JP, Graef I, Kari n M, Wagner EF. c-Jun NH2terminal kinase (JNK)1 and JNK2 have simila r and stage-dependent ro les in regulating T cell apoptosis and proliferat ion. J. Exp. Med. 2001; 193: 317-328. [163] Sassoon D, Lyons G, Wright WE, Li n V, Lassar A, Weintraub H, Buckingham M. Expression of two myogenic regulatory factors myogeni n and MyoD1 during mouse embryogenesis. Nature 1989; 341: 303-307. [164] Schaeffer HJ, Catling AD, Eblen ST Collier LS, Krauss A, Weber MJ. MP1: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade. Science 1998; 281: 1668-1671. [165] Scholl FA, Dumesic PA, Khavari PA. Mek1 alters epidermal growth and differentiation. Cancer Res. 2004; 64: 6035-6040. [166] Schultz E. Satellite cell proliferative compartments in growing skeletal muscles. Dev. Biol. 1996; 175: 84-94. [167] Schultz E, Gibson MC, Champion T. Sa tellite cells are mito tically quiescent in mature mouse muscle: an EM and radioaut ographic study. J. Exp. Zool. 1978; 206: 451456. [168] Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA. Pax7 is required for the speci fication of myogenic satellite cells. Cell 2000; 102: 777-786. [169] Sewing A, Wiseman B, Lloyd AC, La nd H. High-intensity Raf signal causes cell cycle arrest mediated by p21Cip1. Mol. Cell Biol. 1997; 17: 5588-5597. [170] Shindoh C, Hida W, Oh kawara Y, Yamauchi K, Ohno I, Takishima T, Shirato K. TNF-alpha mRNA expression in diaphragm musc le after endotoxin administration. Am. J. Respir. Crit Care Med. 1995; 152: 1690-1696. [171] Sjogren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, LeRoith D, Tornell J, Isaksson OG, Jansson JO, Ohlsson C. Liver-deriv ed insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postn atal body growth in mice. Proc. Natl. Acad. Sci. U. S. A 1999; 96: 7088-7092. [172] Snow MH. A qua ntitative ultrastructural analysis of satellite cells in denervated fast and slow muscles of the m ouse. Anat. Rec. 1983; 207: 593-604. [173] Sohn SJ, Sarvis BK, Cado D, Wi noto A. ERK5 MAPK regulates embryonic angiogenesis and acts as a hypoxia-sensitive re pressor of vascular endothelial growth factor expression. J. Biol Chem. 2002; 277: 43344-43351. [174] Sugiura N, Suga T, Ozeki Y, Mami ya G, Takishima K. The mouse extracellular signal-regulated kinase 2 gene Gene structure and characte rization of the promoter. J. Biol. Chem. 1997; 272: 21575-21581.

PAGE 99

99 [175] Summerbell D, Halai C, Rigby PW. E xpression of the myogen ic regulatory factor Mrf4 precedes or is contemporaneous with that of Myf5 in the somitic bud. Mech. Dev. 2002; 117: 331-335. [176] Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, Kambadur R. Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J. Biol. Chem. 2000; 275: 40235-40243. [177] Tiffin N, Adi S, Stokoe D, Wu NY, Rosenthal SM. Akt phosphorylation is not sufficient for insulin-like growth factor-s timulated myogenin expression but must be accompanied by down-regulation of mitogen-activ ated protein kinase/extracellular signalregulated kinase phosphorylati on. Endocrinology 2004; 145: 4991-4996. [178] Tomiya A, Aizawa T, Nagatomi R, Sensui H, Kokubun S. Myofibers express IL-6 after eccentric exercise. Am. J. Sports Med. 2004; 32: 503-508. [179] Tortorella LL, Milasincic DJ, Pilc h PF. Critical proliferation-independent window for basic fibroblast growth factor repression of myoge nesis via the p42/p44 MAPK signaling pathway. J. Biol Chem. 2001; 276: 13709-13717. [180] Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell RA, Davis RJ. Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway. Science 2000; 288: 870-874. [181] Tsujinaka T, Ebisui C, Fujita J, Ki shibuchi M, Morimoto T, Ogawa A, Katsume A, Ohsugi Y, Kominami E, Monden M. Musc le undergoes atrophy in association with increase of lysosomal cathepsin activity in interleukin-6 transgenic mouse. Biochem. Biophys. Res. Commun. 1995; 207: 168-174. [182] Tsujinaka T, Fujita J, Ebisui C, Yano M, Kominami E, Suzuki K, Tanaka K, Katsume A, Ohsugi Y, Shiozaki H, Monden M. Interleukin 6 recept or antibody inhibits muscle atrophy and modulates proteolytic systems in interleukin 6 transgenic mice. J. Clin. Invest 1996; 97: 244-249. [183] Tureckova J, Wilson EM, Cappalonga JL, Rotwein P. Insulin-like growth factormediated muscle differentiation: collaborati on between phosphatidylinositol 3-kinase-Aktsignaling pathways and myogenin. J. Biol. Chem. 2001; 276: 39264-39270. [184] Ussar S, Voss T. MEK1 and MEK2, diffe rent regulators of the G1/S transition. J. Biol. Chem. 2004; 279: 43861-43869. [185] Valdez MR, Richardson JA, Klein WH Olson EN. Failure of Myf5 to support myogenic differentiation without myogeni n, MyoD, and MRF4. Dev. Biol. 2000; 219: 287-298. [186] Vandenburgh HH, Karlisch P, Shansky J, Feldstein R. Insulin and IGF-I induce pronounced hypertrophy of skeletal myofibers in tissue cultur e. Am. J. Physiol 1991; 260: C475-C484.

PAGE 100

100 [187] Vary TC. Regulation of skeletal muscle protein turnover during sepsis. Curr. Opin. Clin. Nutr. Meta b Care 1998; 1: 217-224. [188] Vercoutter-Edouart AS, Lemoine J, Le B, X, Louis H, Boilly B, Nurcombe V, Revillion F, Peyrat JP, Hondermarck H. Prot eomic analysis reveals that 14-3-3sigma is down-regulated in human breast cancer cells. Cancer Res. 2001; 61: 76-80. [189] Vermeulen A, Goemaere S, Kaufman JM. Testosterone, body composition and aging. J. Endocrinol. Invest 1999; 22: 110-116. [190] Vivanco I, Sawyers CL. The phos phatidylinositol 3-Kinase AKT pathway in human cancer. Nat. Rev. Cancer 2002; 2: 489-501. [191] Vivian JL, Gan L, Olson EN, Klei n WH. A hypomorphic myogenin allele reveals distinct myogenin expression levels required fo r viability, skeletal muscle development, and sternum formation. Dev. Biol. 1999; 208: 44-55. [192] von Haehling S, Genth-Zotz S, A nker SD, Volk HD. Cachexia: a therapeutic approach beyond cytokine antagonism. Int. J. Cardiol. 2002; 85: 173-183. [193] Wang X, Thomson SR, Starkey JD, Page JL, Ealy AD, Johnson SE. Transforming growth factor beta1 is up-regulated by activ ated Raf in skeletal myoblasts but does not contribute to the differentia tion-defective phenotype. J. Biol. Chem. 2004; 279: 2528-2534. [194] Weintraub H, Davis R, Tapscott S, Thayer M, Krause M, Benezra R, Blackwell TK, Turner D, Rupp R, Hollenberg S, The myoD gene family: nodal point during specification of the muscle cell li neage. Science 1991; 251: 761-766. [195] Weyman CM, Ramocki MB, Taparo wsky EJ, Wolfman A. Distinct signaling pathways regulate transformati on and inhibition of skeletal muscle differentiation by oncogenic Ras. Oncogene 1997; 14: 697-704. [196] Weyman CM, Wolfman A. Oncogenic Ras-induced secretion of a novel inhibitor of skeletal myoblast differen tiation. Oncogene 1997; 15: 2521-2528. [197] Weyman CM, Wolfman A. Mitogenactivated protein ki nase kinase (MEK) activity is required for inhibiti on of skeletal muscle differentiation by insulin-like growth factor 1 or fibroblast growth f actor 2. Endocrinology 1998; 139: 1794-1800. [198] White JD, Scaffidi A, Davies M, McGeachie J, Rudnicki MA, Grounds MD. Myotube formation is delayed but not preven ted in MyoD-deficient skeletal muscle: studies in regenerating whole mu scle grafts of adult mice. J. Histochem. Cytochem. 2000; 48: 1531-1544. [199] Winter B, Arnold HH. Activated raf kinase inhibits musc le cell differentiation through a MEF2-dependent mechanism. J. Cell Sci. 2000; 113 Pt 23: 4211-4220.

PAGE 101

101 [200] Winter B, Arnold HH. Activated raf kinase inhibits musc le cell differentiation through a MEF2-dependent mechanism. J. Cell Sci. 2000; 113 Pt 23: 4211-4220. [201] Wojnowski L, Stancato LF, Zimmer AM, Hahn H, Beck TW, Larner AC, Rapp UR, Zimmer A. Craf-1 protein kinase is essential for mouse development. Mech. Dev. 1998; 76: 141-149. [202] Wojnowski L, Zimmer AM, Beck TW Hahn H, Bernal R, Rapp UR, Zimmer A. Endothelial apoptosis in Braf-defic ient mice. Nat Genet 1997;16(3):293-7. [203] Woo RA, Poon RY. Cy clin-dependent kinases and S phase control in mammalian cells. Cell Cycle 2003; 2: 316-324. [204] Wu Z, Woodring PJ, Bhakta KS, Ta mura K, Wen F, Feramisco JR, Karin M, Wang JY, Puri PL. p38 and extracellular signalregulated kinases regulate the myogenic program at multiple steps. Mo l. Cell Biol. 2000; 20: 3951-3964. [205] Yamada S, Buffinger N, DiMario J, Strohman RC. Fibroblas t growth factor is stored in fiber extracellular ma trix and plays a role in re gulating muscle hypertrophy. Med. Sci. Sports Exerc. 1989; 21: S173-S180. [206] Yan L, Carr J, Ashby PR, Murry-Tai t V, Thompson C, Arthur JS. Knockout of ERK5 causes multiple defects in placental and embryonic development. BMC. Dev. Biol. 2003; 3: 11. [207] Yang CC, Ornatsky OI, McDermott JC, Cruz TF, Prody CA. Interaction of myocyte enhancer factor 2 (MEF2) with a mitogen-activated protein kinase, ERK5/BMK1. Nucleic Acids Res. 1998; 26: 4771-4777. [208] Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell RA. Absence of excitotoxicity-indu ced apoptosis in the hippocampus of mice lacking the Jnk3 gene. Nature 1997; 389: 865-870. [209] Yang W, Chen Y, Zhang Y, Wang X, Yang N, Zhu D. Extracellular signalregulated kinase 1/2 mitogen-activated protei n kinase pathway is involved in myostatinregulated differentiation repressi on. Cancer Res. 2006; 66: 1320-1326. [210] Yao Y, Li W, Wu J, Germann UA Su MS, Kuida K, Boucher DM. Extracellular signal-regulated kinase 2 is necessary for me soderm differentiation. Proc. Natl. Acad. Sci. U. S. A 2003; 100: 12759-12764. [211] Yoo J, Robinson RA, Lee JY. H-ras and K-ras gene mutations in primary human soft tissue sarcoma: concomitant mutations of the ras genes. Mod. Pathol. 1999; 12: 775780. [212] Yoon JK, Olson EN, Arnold HH, Wo ld BJ. Different MRF4 knockout alleles differentially disrupt Myf-5 e xpression: cis-regulatory inte ractions at the MRF4/Myf-5 locus. Dev. Biol. 1997; 188: 349-362.

PAGE 102

102 [213] Yue J, Sun B, Liu G, Mulder KM. Requirement of TGF-beta receptor-dependent activation of c-Jun N-terminal kinases (JNKs)/ stress-activated protei n kinases (Sapks) for TGF-beta up-regulation of the urokinase-typ e plasminogen activator receptor. J. Cell Physiol 2004; 199: 284-292. [214] Zammit P, Beauchamp J. The skeletal muscle satel lite cell: stem cell or son of stem cell? Differentiation 2001; 68: 193-204. [215] Zammit PS, Relaix F, Nagata Y, Ruiz AP, Collins CA, Partridge TA, Beauchamp JR. Pax7 and myogenic progression in skeletal muscle satellite cells. J. Cell Sci. 2006; 119: 1824-1832. [216] Zhang M, McLennan IS. Primary myotube s preferentially matu re into either the fastest or slowest muscle fi bers. Dev. Dyn. 1998; 213: 147-157. [217] Zhang W, Behringer RR, Olson EN. Inactivation of the myogenic bHLH gene MRF4 results in up-regulation of myogenin and rib anomalies. Genes Dev. 1995; 9: 13881399. [218] Zheng CF, Guan KL. Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J. Biol. Chem. 1993; 268: 11435-11439. [219] Zimmermann S, Moelling K. P hosphorylation and regul ation of Raf by Akt (protein kinase B). Science 1999; 286: 1741-1744. [220] Zimmers TA, Davies MV, Koniaris LG, Haynes P, Esquela AF, Tomkinson KN, McPherron AC, Wolfman NM, Lee SJ. Induction of cachexia in mice by systemically administered myostatin. Science 2002; 296(5572):1486-8.

PAGE 103

103 BIOGRAPHICAL SKETCH Ju Li was born in Harbin, Peoples Republic of China. She graduated from Nankai University (Tianjin, P.R.China) with her B. S. in life science in September 2003. After graduation, Ju Li worked as a research assistant for Dr. Chen in the Centers for Disease Control of China. In January 2005, Ju Li was accepted as a masters student in Dr. Sally E. Johnsons laboratory at the University of Florida. Ju Li curr ently resides in Gainesvi lle, Florida, with her husband, Changhao Bi.


Permanent Link: http://ufdc.ufl.edu/UFE0018260/00001

Material Information

Title: ERK2 Is Required for Efficient Terminal Differentiation of Skeletal Myoblasts
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0018260:00001

Permanent Link: http://ufdc.ufl.edu/UFE0018260/00001

Material Information

Title: ERK2 Is Required for Efficient Terminal Differentiation of Skeletal Myoblasts
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0018260:00001


This item has the following downloads:


Full Text





ERK2 IS REQUIRED FOR EFFICIENT TERMINAL DIFFERENTIATION OF SKELETAL
MYOBLASTS




















By

JU LI













A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE


UNIVERSITY OF FLORIDA

2007

































Copyright 2007

by

Ju Li









ACKNOWLEDGMENTS

Many great people provide their generous help to support me to complete this thesis. First

of all, I would like to thank my advisor, Dr. Sally Johnson, who supported me all the way. Since

I got the opportunity to study in her lab, her guidance, trust, and understanding helped me to

complete my degree. I would also like to thank my committee members, Dr. Alan Ealy and Dr.

Joel Yelich. I thank them for their time and assistance for my graduate program. Your advice

help me complete my master's project and will be a great benefit for my future research.

I would specially thank all of my lab mates. Xu Wang has been helping me with my

research since the very first day I enter the lab. She is my best teacher and friend. I also thank

Dane Winner, Sarah Reed, Jenelle McQuown, Sara Ouellette, and Shige Tsuda. I could not

complete my research without their help.

I thank my dear Mom and Dad who always believe that I am the best. Last but most

importantly, I thank my husband Bi, who support my work and go with me through all the hard

times.









TABLE OF CONTENTS

page

A CK N O W LED G M EN TS ................................................................. ........... ............. 3

L IS T O F T A B L E S .............................................................................. ............... 6

LIST O F FIG U RE S ................................................................. 7

LIST OF ABBREV IA TION S ................ ....... ............................... .......... 9

ABSTRAC T ................................................... ............... 12

CHAPTER

1 INTRODUCTION ............... ............................ .............................. 14

2 L IT E R A TU R E R E V IE W ......................................................................... ........................ 15

2.1 Sketal M uscle System .................................... ............... .............. ......... 15
2.1.1 Skeletal M uscle D evelopm ent........................................................... ... .......... 15
2.1.2 Myogenic Regulatory Factors (MRFs)...................................... ............... 16
2.1.3 Myocyte Enhancer Factor-2 (MEF2) ....................................... ............... 19
2 .1 .4 E -P ro te in ......................................................................................................... 2 0
2.1.5 Satellite C ells........................................................ 20
2.2 M A PK Signaling P athw ay ...................................................................... ...................22
2.2.1 ERK 1/2 Pathway ................................ .. ........... ..... ...... ..............23
2 .2 .1 .1 R a s ...................... .. ............. .. .................................................2 3
2 .2 .1 .2 R a f ...................... .. ............. .. .................................................2 5
2.2.1.3 M EK 1/2 .................................................................. ......... 27
2.2.1.4 ERK 1/2 ....................................................................... ......... .....................28
2.2.2 c-Jun N -term inal K inases (JN K ) .................................................................... 31
2.2.3 Stress-activated Kinase of 38 kDa (p38 MAPK) ..............................................32
2.2.4 Extracellular Signal-regulated Kinase 5 (ERK5) ..................................... 33
2.3 Skeletal Muscle Growth and Hypertrophy: A Brief Overview .............. ............... 33
2.3.1 Introduction of Skeletal Muscle Hypertrophy ...................................................33
2.3.2 Factors Regulate Skeletal Muscle Hypertrophy ............................................34
2.3.3 Growth Factors and Signal Molecules that Promote Muscle Hypertrophy ..........34
2.3.3.1 Growth Hormone (GH) ................................... ...... ..............34
2 .3 .3 .2 IG F -1 ...................................................................................... 3 6
2 .3 .3 .3 P I3K ............................................................. ...... 3 7
2.3.3.4 A kt............................................................3... ..... 38
2.3.3.5 m TOR and GSK3 .................................................... ............... 38
2.3.3.6 M A PK ...................... .............. ........................ ............... 39
2.3.3.7 Fibroblast Growth Factor 2 (FGF2) .................................................40
2.3.3.8 Hepatocyte Growth Factor (HGF) ................................ ................ 40



4












2.3.4 Growth Factors and Cytokines that Inhibit Muscle Hypertrophy ......................41
2.3.4.1 Transforming Growth Factor 1 (TGF-P) ................ ...............41
2.3.4.2 Tumor Necrosis Factor-alpha (TNF-a) ............................................... 42
2.3.4.3 Interleukin-6 (IL-6) ................... ...... .................42
2.4 Summary of ERK1/2 Effects on Skeletal Myogenesis.......................................43

3 M A TER IA L S A N D M ETH O D S ........................................ .............................................49

3.1 Cell Culture, Plasm ids, and Transfection ............................................ ............... 49
3.2 RNA Interference................... ......... .. ... .... ..................49
3.3 Luciferase R reporter A ssay...................... ..................................... ............... 50
3.4 B rdU Incorporation ....... ......................................................................... ........ .. ... 50
3 .5 W e stern B lo t ...................... .. ............. .. ....................................................5 1
3.6 Im m unocytochem istry ........................................................................... ...................5 1

4 R E SU L T S .............. ... ................................................................53

4.1 Prelim inary E xperim ent......................................... .................................... ..............53
4.2 Creation and Validation of ERK1 and ERK2 siRNA.............................................54
4.3 Optimal Myoblast Proliferation Requires One Functional ERK Enzyme...................54
4.4 ERK2 is Necessary for Efficient Myofiber Formation...............................................55
4.5 ERK2 Knockdown Inhibits Myogenin Protein Expression..............................56
4.6 IGF-I Signaling Partially Restores Myogenin Expression and Myofiber Formation.....57
4.7 FGF2 Does Not Signal Exclusively through Either ERK1 or ERK2 to Inhibit
M y o g e n e sis ........................................................................... 5 8

5 D ISC U S SIO N ............................................................................................. 80

6 IM PLICA TION S ......................................................... .. ...... ....... .... .... .. 83

L IST O F R E F E R E N C E S ...................................................................................... ...................85

B IO G R A PH IC A L SK E T C H ......................................................................... ... ..................... 103









LIST OF TABLES

Table page

2-1 M R F null phenotypes............................................................................. ....................44

2-2 Summary of MAPK knockout mice phenotypes .................... .......................46

2-3 Regulatory factors of skeletal muscle hypertrophy .................................. ............... 47









LIST OF FIGURES


Figure page

2-1 M APK signaling cascade............................................................................. 45

2-2 Signaling pathway involved in IGF-I induced skeletal muscle hypertrophy.....................48

4-1 C2C12 myoblasts transduced with pSIRENsiERK1 and pSIRENsiERK2 ......................60

4-2 C2C12 myoblasts transduced with pSIRENsiERK1 or pSIRENsiERK2 does not
inhibit E R K 1/2 expression ........................................................................ ...................6 1

4-3 C2C12 myoblasts stable expressing single siERK1 or siERK2 does not inhibit
E R K 1/2 expression ..............................................................................62

4-4 Stable expression of siRNA directed against ERK1 or ERK2 reduces ERK1/2 protein
lev els ............................................................................................. 63

4-5 Knockdown of ERK1 or ERK2 affects API luciferase activity......................................64

4-6 Knockdown of ERK1 or ERK2 does not prevent myoblast proliferation......................65

4-7 Knockdown of ERK1 or ERK2 does not affect the mitogenic response ........................66

4-8 ERK2 deficiency leads to myogenic arrest...................... ........................ ............. 67

4-9 ERK2 deficiency leads to repression of differentiation and fusion of myoblasts .............68

4-10 Treatment with PD98059 inhibits activation of ERK1/2 and active ERK1/2 .................69

4-11 Treatment with PD98059 does not affect C2C12siERK2 differentiation ......................70

4-12 ERK2 deficiency causes a reduction in myogenin protein expression............................71

4-13 ERK2 deficiency causes reduced myogenin expression in C2C12siERK2 myoblasts
is partially restored by IGF-I treatm ent. ........................................ ........................ 72

4-14 IGF-I treatment improves the differentiation capabilities of C2C12siERK2
m yoblasts .................................................................................73

4-15 Myotube fusion index of IGF-I treated myoblasts...... ............................74

4-16 Differentiation index of IGF-I treated myoblasts. .................................. .................75

4-17 ERK2 insufficiency does not disrupt IGF-I induced Akt phosphorylation .....................76









4-18 FGF2 requires one functional ERK isoform to inhibit myogenic differentiation..............77

4-19 Differentiation index of FGF2 treated myoblasts.. ........................................ ................78

4-20 FGF2 inhibits myogenic differentiation through either ERK isoform .............................79









LIST OF ABBREVIATIONS

AP-1 activator protein 1

bHLH basic helix-loop-helix

BMK big mitogen-activated kinase

BMP bone morphogenetic protein

Cdk cyclin D-dependent kinase

CR conserved region

DAPI 4,6-diamidino-2-phenylindole

ED embryonic day

elF eukaryotic initiation factor

ERK extracellular signal-regulated kinase

FBS fetal bovine serum

FGF fibroblast growth factor

GDF growth and differentiation factor

GFP green fluorescent protein

GH growth hormone

GHR growth hormone receptor

GSK glycogen synthase kinase

HGF hepatocyte growth factor

HS horse serum

Id inhibitor of differentiation/DNA binding

IGF insulin-like growth factor

IGFBP IGF binding protein









IL

JNK

LIF

MADS

MAPK

MEF2

MKK

MRF

mTOR

MyHC

NFAT

NF-KB

PBS

PHAS

PI3K

PKB

PKC

PTKR

RT

PCR

PSK

PTB domian

PtdIns(3,4,5)P3


interleukin

c-Jun N-terminal kinase

leukemia inhibitory factor

MCM1, agamous, deficiens, serum response factor

mitogen-activated protein kinase

myocyte enhancer factor-2

mitogen-activated kinase kinase

myogenic regulatory factor

mammalian target of rapamycin

myosin heavy chain

nuclear factor of activated T cells

nuclear factor kappa beta

phosphate-buffered saline

phosphorylated heat- and acid-stable protein

phosphatidylinositol 3-kinase

protein kinase B

protein kinase C

protein tyrosine kinase receptor

reverse transcription

polymerase chain reaction

p21-activated protein kinase

phosphotyrosine-binding domain

phosphatidylinositol (3,4,5)-trisphosphate









RSRF related to serum response factor

SAPK stress activated protein kinase

SH src homology region

SOS son of sevenless

STAT signal transducers and activators of transcription

TGF transforming growth factor

TnI-Luc troponin I luciferase

TNF tumor necrosis factor









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

ERK2 IS REQUIRED FOR EFFICIENT TERMINAL DIFFERENTIATION OF SKELETAL
MYOBLASTS

By

Ju Li

May 2007

Chair: Sally Johnson
Major: Animal Sciences

Terminal differentiation of skeletal myoblasts involves alignment of the mononucleated

cells, fusion into multinucleated syncitia, and transcription of muscle-specific genes. Myogenesis

in vivo is regulated partially by IGF-I initiated signaling that results in activation of an

intracellular phosphatidylinositol 3 kinase (PI3K) signaling cascade. Downstream signaling

through the Raf/MEK/ERK axis, a pathway initiated by IGF-I, also is implicated in the

regulation of muscle formation. The involvement of ERK1 and ERK2 during myogenesis was

examined in C2C12 myoblasts. C2C12 myoblasts stably expressing a small interfering RNA

(siRNA) directed against ERK1 or ERK2 were created. Both of the kinases were reduced to trace

levels as measured by Western blot for total ERK and retained the capacity to become

phosphorylated. The C2C12siERK2 knockdown myoblasts failed to fuse into multinucleated

myofibers. By contrast, cells expressing a scrambled siRNA or ERK1 siRNA fused into large

multinucleated structures. The block to muscle formation did not involve continued cell cycle

progression or apoptosis. The C2C12siERK1 myoblasts expressed an increased amount of ERK2

protein and formed larger myofibers in response to IGF-I treatment. Interestingly, IGF-I

treatment of C2C12 ERK2 knockdown myoblasts did not reinstate the myogenic program









arguing that ERK2 is required for differentiation. These results provide evidence for ERK2 as a

positive regulator of myogenesis and suggest that ERK1 is dispensable for myoblast proliferation

and differentiation.









CHAPTER 1
INTRODUCTION

The ERK1/2 MAPK signaling pathway is involved in multiple cellular processes including

cell growth, proliferation, differentiation and survival. In skeletal muscle, Raf/MEK/ERK and

PI3K/Akt cascade are downstream pathways of IGF-I-mediated skeletal muscle hypertrophy.

Activation of ERK1/2 has a dual function in myogenesis. Low levels of Raf activity stimulates

myoblast differentiation, and high levels of Raf activity inhibits myoblast differentiation [193].

Importantly, sufficient Raf activity to evoke ERK2 phosphorylation is coorelated with improved

myocyte formation, while activation of ERK1 is associated with inhibition of myogenesis. The

separable function of ERK1 and ERK2 during myogenesis was examined in C2C12 myoblasts.

C2C12 myoblasts stably expressing small interfering RNAs direct against ERK1 and ERK2 were

created, and their ability to form mature muscle cells was examined.

The objectives of this work were to (1) identify the distinct effects of ERK1 and ERK2

during myogenesis, (2) characterize the involvement of ERK1/2 in IGF-I induced myogenesis

and (3) test the necessity of ERK1/2 in FGF2 stimulated mitosis.









CHAPTER 2
LITERATURE REVIEW

2.1 Sketal Muscle System

Skeletal muscle is the most abundant tissue in the human body and accounts for more

than 50% of the total mass. This tissue serves as a major site of metabolic activity and as a

protein reservoir. Skeletal muscle cells are cylindrical shaped, striated muscle, facilitating

movement via contraction to apply force to bones and joints. Skeletal muscle maturation can be

subdivided into myogenic determination, myoblast proliferation and terminal differentiation. A

number of growth factors, signaling molecules and transcription factors are involved in skeletal

muscle maturation. Thus, skeletal muscle presents a perfect model system to study cellular signal

transduction.

2.1.1 Skeletal Muscle Development

All vertebrate skeletal muscles (except head muscles) are derived from progenitor cells

contained within somites which arise by segmentation of paraxial mesoderm on either side of

neural tube and notochord (reviewed in [18]). Somites also give rise to other tissues, including

skeletal and connective tissue. During embryonic development, some pluripotent mesodermal

cells are committed to the myogenic lineage, which is regulated by the cell fate determinants

Hedgehog and Wnt family members [98]. These myogenic cells proliferate and in some cases

migrate until there are extracellular signals from surrounding tissues including the neural tube

and the lateral ectoderm, which make them withdraw from the cell cycle and undergo terminal

differentiation. Subsequently, muscle-specific genes are expressed and mononucleated myoblasts

fuse to each other to form the multinucleated syncytium.

The onset of muscle formation in the mouse embryo is called primary myogenesis. After

embryonic day (ED) 14 in the mouse, secondary muscle fiber formation occurs [216]. As a









result, adult skeletal muscles are composed of a mixture of myofibers with different

physiological characteristics, from a slow-contracting type to a fast-contracting type, and the

proportion of each fiber type within a muscle determines its overall contractile properties. There

are several signaling pathways involved in these later stages of muscle development, but the

molecular control mechanisms are still unclear.

2.1.2 Myogenic Regulatory Factors (MRFs)

During development of skeletal muscle, a group of myogenic transcription factors

(myogenic regulatory factors, MRFs), play a significant role in lineage determination and

differentiation [194]. MRFs (MyoD, myf5, myogenin and MRF4) are basic helix-loop-helix

(bHLH) transcription factors. The HLH domain of the MRFs is responsible for dimerization with

E-proteins. These heterodimers bind to the consensus CANNTG recognization site, which is

found in the promoters and enhancers of many muscle-specific genes, leading to transcription of

these genes.

MyoD was the first MRF isolated and initially was regarded as a master regulatory gene

due to its ability to convert non-muscle cells to the myogenic lineage [194]. The gene product is

expressed early during development and likely participates in establishment of the skeletal

muscle lineage [163]. Gene ablation studies indicate that loss of MyoD does not cause striking

developmental abnormalities or functional deficits in the musculature [157]. Examination of the

MRF gene expression patterns in the MyoD--) mice reveals an increase in myf-5 mRNA levels.

Thus, myf-5 may compensate for MyoD and provide normal myogenesis. Indeed, mice null for

both MyoD and Myf-5 are completely devoid of myoblasts, hence demonstrating the importance

of these early MRFs for commitment of multipotent somitic cells to the myogenic lineage [158].

However, not all of the effects of MyoD can be replaced by Myf-5. MyoD--) mice display

deficiencies in muscle regeneration following injury [118]. Satellite cells isolated from these









animals proliferate in culture at rates comparable to wildtype myoblasts but MyoD- myoblasts

demonstrate abnormalities in the differentiation program [33]. A delay in myofiber formation is

detected which may be attributed to maintenance of the myoblasts in a proliferative state [198].

Alternatively, satellite cells in vitro fail to express the late myogenic marker, MRF4, which

participates in activation of the myocyte gene program [33].

Myf-5 is recognized as an early marker of the myoblast lineage, similar to MyoD. Myf-5

mRNA is first detected in the dermamyotome compartment of the somite at ED8.5 in the mouse

and maintained into adulthood [135]. Interestingly, Myf-5 mRNA also is detected in distinct

regions of the brain suggesting that the bHLH factor is not muscle-restricted [37]. However, no

measurable amounts of Myf-5 protein are observed in the developing neural areas possibly

accounting for the lack of myogenic conversion in these tissues. Expression of Myf-5 is

regulated in part by Pax3, a transcription factor that directs migration of myoblasts into the

developing limbs [11]. Targeted deletion of the gene does not compromise embryonic viability.

Mice are born with apparently normal musculature but die within minutes of birth as a

consequence of rib malformities [20]. Due to its early expression pattern, Myf-5 typically is

thought of as a lineage determination factor. The protein is often associated with putative

quiescent satellite cells in mice and may play an important regulatory role in maintaining the

myogenic lineage of these muscle stem cells [31].

MRF4 exhibits a biphasic expression pattern with transcripts initially detected at ED9.0 in

the somite followed by a second peak during fetal development at ED16.0 [16]. Early detection

of mRNA transcripts for MRF4 is coincident with Myf-5 with speculation that MRF4 may

regulate transcription of Myf-5 [175]. The closely linked MRF genes also share a common

regulatory element that contributes to their synchronous expression [175]. Because the two genes









are positioned near one another on mouse chromosome 10, early homologous recombination

experiments deleting MRF4 were confounded with Myf-5 defects leading to variable phenotypes

[133]. The initial MRF4 null mouse demonstrated no obvious muscle defects but rib deformities

were apparent [93]. However, a second knockout mouse died immediately at birth with a

severely truncated lower rib pair [19]. And, a third MRF4 null allele results in an intermediate

phenotypic rib defect [139]. The rib malformations are reminiscent of those found in the Myf-5

knockout mouse. Closer examination of the deleted regulatory regions revealed that a cis element

necessary for Myf-5 expression was disrupted to varying degrees in the MRF4 knockouts. Those

animals with severe rib abnormalities and suffering perinatal lethality failed to direct the correct

spatio-temporal expression of Myf-5 [212].

The final member of the MRF family is myogenin. Myogenin is expressed later than Myf-

5, MyoD or MRF4 with transcripts detected in the myotomal myoblasts at ED 10.5 in the mouse

[25]. Unlike mice devoid of the other MRFs, deletion of myogenin produces an animal with

severe muscle defects. Myogenin null animals die within moments of birth due to insufficient

diaphragm musculature [73;129]. Histological examination of the mice demonstrates virtually no

skeletal muscle exists in these mice. Expression of MyoD and myf-5 is unaffected and the

animals contain the normal complement of myoblasts. Thus, myogenin is requisite for fusion of

the myoblast precursors into the multinucleated contractile-competent structures. The necessity

for myogenin does not extend into adulthood. Deletion of myogenin after completion of

embryonic muscle formation causes a generalized reduction in body size [92]. However, the

mice contained a proportional amount of skeletal muscle and the muscle was able to increase in

size. This leads to the speculation that myogenin, and perhaps the entire family of MRFs, have

very little to do with postnatal muscle growth.









2.1.3 Myocyte Enhancer Factor-2 (MEF2)

Along with the MRFs, the myocyte enhancer factor-2 (MEF2) family also plays a role in

skeletal, cardiac and smooth muscle myogenesis. The MEF2 family, also called Related to

Serum Response Factor (RSRF), has four members (MEF2A, MEF2B, MEF2C and MEF2D),

which are expressed in all developing muscle cell types [65]. MEF2 proteins have an identical C-

terminal activation domain and N-terminal MCM1 agamous defeciens serum response factor

(MADS) domain. The MADS domain serves for DNA binding and dimerization with accessory

factors. MEF2 proteins bind a conserved A/T-rich DNA sequence in the control regions of a

majority of muscle-specific genes and activate their expression during embryogenesis [45].

Previous studies indicated that muscle-specific gene expression and myogenesis are

regulated by a combination of MRFs and MEF2s, and the DNA-binding domains of these factors

mediate their interactions. MEF2 factors can cooperate with heterodimers of MRFs and E

protein, and this interaction plays an important role in promoting myogenesis [123]. In addition

to interacting with MRFs, MEF2s are shown to establish protein-protein association with several

other transcription factors. This is important for MEF2 to transmit signals from cell membrane to

downstream early genes and stress-response genes [45]. For example, transcriptional activation

of the myoglobin promoter in striated muscle requires interaction with MEF2 and Spl [66].

MEF2s and MRFs can synergistically activate gene expression, which is important for

MEF2s regulation of terminal differentiation. In flies, deletion of single MEF2 gene results in an

inability of muscle cells to differentiate [106]. In mice, targeted inactivation of MEF2C gene is

embryonic lethal due to severe defects in cardiac development [107]. However, there is no defect

in skeletal muscle in these MEF2 deficient animals, possibly because different subtypes of

MEF2s are expressed in skeletal muscle and compensate for lack of each other. In addition,









transgenic mice expressing a MEF2 regulated lacZ reporter gene show that MEF2 activity is high

during embryonic development but it is undetectable after birth [130].

2.1.4 E-Protein

The E-protein family (E12, E47, HEB and ITF-2) is another bHLH transcription factor

family [97]. E-protein has a bHLH domain to form homodimer or heterodimer with MRFs

family and two conserved transcriptional activation domains in the N-terminus.

E12 and E47 are alternative splice products of E2A gene, which is ubiquitously expressed

in many mammalian cells including skeletal muscle [10]. Lassar (1997) provided evidence that

E12/E47 interact with myogenic HLH proteins to regulate myogenic program [97].

Cotransfection of E47 with MyoD enhances MyoD-activated genes transcription, and inhibition

of E2A expression with antisense E2A transcripts displays low level of terminal differentiation.

In addition, MyoD or myogenin can form complexes with E12/E47-like proteins, and E47 can

change the phosphorylation state of MyoD [97]. E2A (-/-) mice are viable but defective in T-cell

proliferation and B-cell differentiation [9; 10]. HEB is found in L6 myoblasts, C2C12

myosatellite cells and postnatal hindlimb muscles, which suggests HEB may have a general role

in the skeletal muscle development [28].

2.1.5 Satellite Cells

After maturity, most myoblasts form stable postmitotic muscle fibers that are incapable of

proliferation. However, these fibers are associated with a pool of cells still capable of replication

and regeneration of muscle tissue. In adult muscles, this subpopulation of cells is termed muscle

satellite cells.

Muscle satellite cells are undifferentiated mononuclear myogenic cells located between the

basal lamina and sarcolemma [214]. They are the primary stem cell in adult skeletal muscle,

responsible for postnatal muscle growth, hypertrophy and regeneration. Satellite cells are









mitotically and metabolically quiescent and transcriptionally less active than myonuclei

[167; 172]. In mature muscle, most satellite cells are in a quiescent state. In response to exercise,

muscle damage or degenerative muscle disease, satellite cells awaken and begin proliferating

[126]. Following proliferation, some cells differentiate and fuse into the pre-existing myofibers,

and some return to the quiescent state during the process of self-renewal [166].

The classical identification and definition of satellite cells was performed by electron

microscopy [115]. This remains the indisputable method of detection of quiescent muscle stem

cells. However, the method is costly, cumbersome, and unavailable for most laboratories. This

led to the quest for alternative means of satellite cell identification. In the late-1980s, reports of

immunocytochemical localization of satellite cells in vitro and in vivo began to emerge.

Desmin, a cytoskeletal protein unique to muscle, is expressed by rodent satellite cells during the

initial culture period prior to entry into the proliferative phase [89]. Following trauma, many

desmin immunopositive cells are present in the reforming muscle bed at a time of maximal

satellite cell proliferation [5]. Over the years, additional methods of satellite cell identification

have evolved. Cell surface molecules including a splice variant of CD34 and a muscle-specific

integrin have been used to demarcate satellite cells [13]. M-cadherin, an adhesion molecule, is

expressed in skeletal and cardiac muscle and neural tissue. The protein localizes to satellite cells

in normal and regenerating skeletal muscle [77]. Syndecan-3 and -4, heparan sulfate

proteoglycans found on the surface of multiple cell types, are abundant matrix components on

satellite cells and may be useful tools for identification of these cells [32;34].

A subtractive library screen comparing cDNAs present in satellite cells and embryonic

fibroblasts identified Pax7 as one of several genes unique to the putative muscle stem cell [168].

Pax7, a paired box transcription factor, is present in Go satellite cells and absent in differentiating









myoblasts. Gene ablation results in a mouse compromised in muscle growth owing to an absence

of satellite cells. Based on this work, Pax7 is a true marker protein for satellite cells and

expression of the transcriptional regulator is necessary for satellite cell form and function. The

definition of Pax7 as a lineage marker for satellite cells remains unclear. Examination of tissues

of Pax7(-/- pups indicates numerous satellite cells are present [136]. The absolute numbers of

these cells declines as the animal matures but a minor population, substantially fewer than

normal, is present in the adult. The presence of these cells may be attributed to a shared function

with the paralogous gene, Pax3. Pax3 and Pax7 are co-expressed in many putative satellite cells

in the postnatal musculature [151;152]. Pax3 positive satellite cells undergo apoptosis in the

Pax7 knockout animal suggesting that Pax7 is necessary for cell survival but dispensible for

lineage specification [151]. Continued expression of Pax7 in satellite cells is necessary for

survival of the Go population but does not affect the myogenic gene program[215]. Pax7 is co-

expressed with MyoD in proliferating satellite cells. Down-regulation of the gene coincides with

differentiation. Interestingly, overexpression of Pax7 delays the onset of terminal differentiation

but does not prevent the eventual formation of myofibers [215]. This is in contrast to Olguin

and Olwin (2004) who reported that ectopic expression of Pax7 in satellite cells prevents MyoD

and myogenin expression and induces cell cycle arrest. The presence of Pax7(+):MyoD(+)

myoblasts that incorporate BrdU in the regenerating bed of skeletal muscle argues that Pax7 does

not alter either MyoD expression or proliferation in vivo [132].

2.2 MAPK Signaling Pathway

Mitogenic signal transduction is mediated by a protein phosphorylation and

dephosphorylation cascade. One of the most important mitogen-induced signaling pathways is

the mitogen-activated protein kinase (MAPK) cascade.









Many growth factors activate receptor tyrosine kinases that transduce extracellular signals

through the small G protein, Ras. Ras protein phosphorylates and activates MAP kinase kinase

kinase (MAPKKK), which in turn activates MAP kinase kinase. Subsequently, MAPKK

phosphorylates MAPKs on threonine and tyrosine residues in a conserved motif (Thr-X-Tyr) in

the kinase domain, which is required for MAPK activation [21].

The MAPK pathway is very sensitive and an efficient transducer of signals due to two

characteristics of MAPK cascade. First, the MAPK cascade can amplify signals, which means as

the signals pass down. Downstream targets are more abundant than their upstream regulator. As

an example, MEK1 is much more abundant than Raf-1 [47]. Another characteristics of the

MAPK pathway is switch-like output, which allows the MAPK cascade to convert graded inputs

into different outputs [51]. For example, high and low levels of Raf-1 have opposite effects in

skeletal muscle differentiation [41]. This mechanism enables cells to filter noise and still respond

to stimuli over threshold.

The MAPK signaling pathway is conserved from unicellular organisms such as bacteria to

multicellular organisms such as humans, and it regulates diverse cellular functions including cell

growth, proliferation, differentiation and apoptosis. In mammals, more than four groups of

MAPKs are recognized that include two extracellular signal-regulated kinases (ERK1/2), three c-

Jun N-terminal kinases (JNK1/2/3), four p38 protein kinases (p38a/3/y/6) and ERK5. Figure 2-1

shows the different MAPK signaling cascades, and Table 2-2 summarizes MAPK knockout mice

phenotypes.

2.2.1 ERK1/2 Pathway

2.2.1.1 Ras

Mamalian genomes encode three ras genes that give rise to four protein products, N-Ras,

H-Ras, K-Ras4A and K-Ras4B. These Ras isoforms are ubiquitously expressed, though ratios









change from tissue to tissue [211]. Ras proteins can induce cell transformation through a number

of effectors. Constitutive activation of Ras causes a large number of human cancers [49]. Ras

family members are membrane localized small GTPase, which are associated with multiple

signal transduction pathways that regulate different cellular functions.

The best characterized signaling pathway regulated by Ras is the ERK1/2 MAPK pathway.

The pathway is activated following growth factor docking to protein tyrosine kinase receptors

(PTKRs). PTKRs dimerize and autophosphorylate, which in turn allow cross phosphorylation of

tyrosine residues in their cytosolic domain. These intrinsic phosphotyrosine domains serve as

docking sites for Src homology region 2 (SH2) and the phosphotyrosine-binding (PTB) domain,

which causes recruitment of son of sevenless (SOS) in the plasma membrane and subsequent

binding to Ras. Once Ras is activated at the membrane, it recruits Raf-1 and activates the

downstream Raf-MEK-ERK pathway [124].

The mechanism underlying the Ras-imposed block to differentiation remains unclear. A

series of Ras mutants were examined for their ability to invoke specific downstream signaling

pathways to suppress myogenesis [146]. Ras alleles that initiate exclusive signaling through Raf,

Rac or Rho all efficiently inhibit muscle gene transcription indicating that no single downstream

effector pathway mediates the negative effects of Ras. Importantly, morphological

transformation and inhibition of differentiation are mutually exclusive events [195].

Overexpression of RasG12V in muscle cells causes growth in soft agar that can be reverted by

treatment with a chemical MEK inhibitor. However, these cells remain unable to express the

myogenic gene program. Ras invoked signaling through protein kinase C may be a primary

downstream pathway leading to inhibition of myocyte formation [49]. Treatment of myoblasts

constitutively expressing RasG12V with a chemical inhibitor to a class of atypical protein kinase









C molecules restores biochemical differentiation. However, the specific PKC isoform and its

downstream effectors remain unknown.

Secretion of soluble proteins by Ras-transformed myoblasts may contribute to the block to

muscle formation. Weyman and Wolfman (1997) collected spent medium from Ras-expressing

muscle cells and demonstrated the presence of an acid-sensitive factor capable of inhibiting

differentiation. The secreted protein does not induce ERK1/2 phosphorylation and does not

signal through a TGF-3 receptor. No detectable FGF2, a potent inhibitor of myoblast

differentiation, was present in the spent medium [196]. By contrast, Ras-expressing MM14

myoblasts proliferate faster and control myoblasts due to their ability to release more membrane-

bound FGF2 [49]. Sequestering FGF2 suppresses proliferation but does not reinstate

myogenesis. Thus, Ras inhibits muscle formation independent of continued cell cycle

progression.

2.2.1.2 Raf

Rafis an oncogene first discovered as a retrovirus in 1983 [147]. Raf family members are

cytosolic serine/threonine kinases that are activated by Ras. The Raf family (A-Raf, B-Raf, Raf-

1) share three conserved regions, CR1, CR2, CR3. The kinase domain is localized in CR3, and

CR1 and CR2 are regulatory domains [69]. Raf-1 is ubiquitously expressed, while B-Raf is

predominate in neuronal tissues and testis, and A-Raf is abundant in urogenital tissue [122].

Raf-1 is a well-established Raf isoform. Raf-1 can promote invasive cell growth and

induce cell transformation as well as Ras proteins [101]. However, regulation of Raf-1 is very

complex, including protein-protein interaction, phosphorylation of tyrosine, threonine and serine

residues and subcellular localization [125]. Raf-1 phosphorylation is affected by different protein

kinases, such as Src, PKC, PKB, and PSK (p21-activated protein kinase) [125].









Raf-1 is important in regulating cell growth and mitosis. High level of Raf kinase is

sufficient to inhibit DNA synthesis and cell division, which converts mitotic cell cycling into

cellular growth [90]. Raf-1 causes cell cycle arrest through induction of p21Cipl, which in turn

leads to inhibition of cyclin D- and cyclin E-dependent kinases and accumulation of

hypophosphorylated Rb [169].In skeletal muscle satellite cells, a dominant negative Raf-1

mutant can block FGF-mediated stimulation of ERK1/2 as well as block cell proliferation. In

these cells, Raf-1 is necessary for G1 progression but dispensable for S phase [83].

In skeletal muscle, Raf-1 regulates myoblast differentiation in a dose dependent manner

[41;193]. At a low level Raf activity, there is an increase in differentiation, contractile protein

expression and myocyte fusion. However, high level of Raf activity induces transformed

morphology and inhibits myocyte formation, muscle-specific reporter expression and apoptosis

[41;193]. Raf-1 also is involved in FGF-induced repression of differentiation [83]. Constitutive

expression of Raf-1 suppress MyoD expression [67]. And persistent activation of Raf-1 inhibits

MEF2 accumulation in nuclei. This results in decreased myogenin activity, reduced muscle

protein expression and inhibition of myoblast fusion [82; 199].

Evidence suggests Raf-1 has other functions independent of activating MEK and ERK

kinases, such as regulating cell survival, cell apoptosis, and cell cycle [12]. For example, Raf-1

can inhibit apoptosis signaling by binding with proapoptotic kinase MST2 and forming

MST2/Raf-1 complex [131].

The necessity of Raf signaling in skeletal muscle in vivo is unclear due to lethality issues.

A-Rafknockout mice are born alive and of normal size, but stop growing after 2-3 days and die

between day7 and day 21 due to neurological and gastrointestinal abnormalities [145]. B-Rafnull

mice die from vascular defects during mid-gestation, and B-Raf -/- embryos have increased









apoptosis in differentiated endothelial cells [202]. Ablation of Raf-1 results in embryonic

lethality of mice, with placental defects as well as abnormal tissue development. In these mutant

mice, most organs appeared normal, however, the eyelids fail to fuse properly, dermis and

epidermis are abnormally thin and poorly differentiated, and the lungs are smaller and fail to

inflate at birth. The time of embryonic death of Raf-1 deficient mice varies depending on the

genetic background [201]. Fibroblasts isolated from Raf-1 knockout embryos had reduced

proliferation in response to serum [201]. Interestingly, ERK1/2 phosphorylation in response to

mitogens is not impaired, which indicates ERK1/2 can be activated in a Raf-independent

mechanism [201].

2.2.1.3 MEK1/2

Genetic studies show two MEK homologs, MEK1 and MEK2 are present in mammals,

which share 80% homology except at the amino terminus [218]. They activate ERK1/2 by

phosphorylating the TEY domain with equal competency.

MEK1 null mice are recessive lethal at day 10.5 due to a failure to establish a functional

placenta. These mice are small and show signs of necrosis in some tissues [62]. The placenta

defects also are found in Raf-1 knockout mice, which suggests that the Raf-MEK axis is

necessary for proper placenta development [201]. However, MEK2 knockout mice are viable

with no obvious deficiencies [14]. Comparing the phenotype of ERK1/2 and MEK1/2 knockout

mice, the results show there are possible relationships between MEK1 and ERK2 in embryonic

development[62;74]. A scaffold protein MEK partner 1 was identified as a protein that binds

specifically with MEK1 and ERK1, and facilitates their activation [164].

To further determine the effects of MEK activation in vivo, tissue-specific transgenic mice

were created. When active MEK1 is over-expressed in cardiac muscle under the control of

cardiac specific a-myosin heavy chain promoter, the transgenic animals show a 50% increase in









heart size and the cardiocytes are resistance to apoptosis [23]. Constitutive expression of the

MEK1 in the lens or skin cause increases in cell numbers and cell size related to tissue growth

and hypertrophy [64;165].

In skeletal muscle, MEK is required for myoblast and satellite cell proliferation [83].

Treatment of MM14 myoblast with MEK inhibitor, PD98059, or expression a dominant

negative MEK mutant blocks FGF-mediated stimulation of ERK1/2 and prevents G1 to S phase

transition [83]. MEK1 has a strong negative effect on myogenesis. Myoblasts over-expressing

constitutively active MEK1 fail to fuse and transcribe muscle gene [143]. MEK1 translocate to

the nucleus, where it may bind the transcriptional activation domain of MyoD to repress its

action. MEK1 also is involved in IGF-I and FGF2 induced repression of differentiation [197].

Treatment with PD98059, can partially reverse the negative effects of FGF2 and IGF-I.

However, enthusiasm for these results is tempered due to the validity of the myoblast model.

IGF-I inhibits differentiation of 23A2 myoblasts, a phenomena unique to these cells [179;197].

On the other hand, ERK is activated in myogenic cells [67]. A MEK1 inhibitor can block the

MyoD induced myogenic program in fibroblasts, which suggest MEK is activated in the process

of differentiation. Constitutive expression of MEK1 enhances the transcriptional activity of

MyoD in fibroblasts. The importance of MEK1 during myogenesis requires further

experimentation.

2.2.1.4 ERK1/2

ERK1 and ERK2 are two MAPK proteins 75% identical in amino acid sequence and

similar in structure [174]. They have two phosphorylated sites, tyrosine and threonine, which can

be activated by MEK1 or MEK2 [3]. ERK1/2 are ubiquitously expressed, but their relative

abundance in different species or tissues are variable. ERK1/2 respond to different stimulus and









induce different responses. In fibroblasts, ERK1 can be activated by serum, growth factors,

cytokines, certain stresses, ligands for cell membrane receptors and transforming agents [104].

When ERK1 and ERK2 are activated, they translocate from the cytoplasm to the nucleus.

This stimulus-dependent nuclear localization appears to be crucial for multiple cell functions,

such as morphological transformation and cell differentiation in PC12 cells [35]. The interaction

between MEK1/2 and ERK1/2 plays a prominent role in ERK1/2 translocation and nuclear

accumulation. MEK1/2 N-terminus acts as a cytoplasmic anchor. When ERK1/2 are activated,

MEK1/2 and ERK1/2 disassociate, and ERK1/2 are transported to the nucleus [59;60].

The ERK1/2 signal pathway is essential for cell growth. ERK1/2 increases nucleotide

synthesis, affects the transcription of many genes through transcription factor activation and

chromatin phosphorylation, stimulates protein synthesis and controls the cell cycle. Mitogenic

stimulation of cells causes ERK1/2 phosphorylation and translocation from cytoplasm to the

nucleus. This process is necessary for initiation of DNA synthesis and progression from Go to S

phase [22]. Phosphorylation of transcription factors by ERK1/2, such as Elkl, regulate the

expression of cycling D and facilitates cell cycle re-entry [99; 184]. Interestingly, MEK1

activation results in transient ERK activity that promotes cell cycle transition from G1 to S phase,

while MEK2 produces sustained ERK activity causing cells to arrest in G1 phase [156;184].

Besides the Gi checkpoint, ERK1/2 also regulates S phase progression. ERK1/2 can activate

elonglation factor, E2F, which promotes expression of cycling A and in turn stimulates DNA

synthesis [203]. Furthermore, ERK1/2 participates in G2 phase chromosome condensation. ERK

and p38 can phosphorylate mitogen- and stress-activated protein kinase, which phosphorylates

histone H3 to promote chromosome condensation [40]. The ERK 1/2 also promote cell

differentiation in multiple cell lineages, such as fibroblasts, neuronal cells, myoblasts,









adipocytes, oocytes, T cells, photoreceptor cells [112]. And ERK1/2 play an important role in

cell apoptosis. High level of ERK1/2 activation protects cells from apoptosis induced by

anchorage-independence and serum removal. However, low level of ERK1/2 activity can force

the cells to apoptose [100].

The ERK1/2 pathway is an important pathway involved in both mitogenesis and

myogenesis. Growth factors, such as leukemia inhibitory factor (LIF), IGF-I, FGF2 and

transforming growth factor 0 (TGF-P) regulate skeletal muscle through ERK1/2 signaling

cascades [2;81;179;193;209]. However, the precise mechanisms invoking ERK1/2

phosphorylation are not clear. Most reports support that activation of ERK1/2 pathway is

responsible for the negative regulation of skeletal myogenesis

[2;2;2;42;44;81;82;143;146;179;194;195;200;209], but others indicate the ERK1/2 pathway is

used for positive skeletal myogenesis [67]. The contrasting results may be due to ERK signaling

intensity and temporal activation during myogenesis [41;193].

ERK1 and ERK2 share 90% identity at the mRNA level and 75% identity at the amino

acid level. They have similar activation process and nearly identical downstream substrates

[174]. However, recent work demonstrates that ERK1 and ERK2 have different functions. ERK1

knockout mice are viable and fertile, with only a minor defect in thymocyte development.

Fibroblasts from these animals proliferate normally in response to serum, while thymocytes from

these animal shows reduced proliferation and slow rate of maturation into single positive (CD8+

or CD4+) thymocytes [137]. In these mice, ERK2 can compensate for most of the functions of

ERK1 except for the thymocyte development. The ERKI(-/-) mice also have an enhanced long-

term memory, suggesting a function for ERK1 in the brain self-adaptation system [116]. On the

other hand, ERK2 knockout embryos are deficient in mesoderm formation. BrdU incorporation









shows ERK2 affects differentiation instead of proliferation. The ERK2 knockout embryos have

an increased level of ERK1 phosphorylation, but ERK] can not compensate for loss of ERK2 in

vivo as it does in vitro [210]. Also ERK2 mutant embryos die early (E8.5) in mouse development

due to a failure to form the ectoplacental cone and extra-embryonic ectoderm, which give rise to

mature trophoblasts [159]. ERK2 knockout mice also are embryonic lethal at day 6.5 due to

abnormal placenta development [74]. These results suggests ERK2 is necessary for placenta

development, trophoblast proliferation and mesoderm differentiation[74; 159;210]

2.2.2 c-Jun N-terminal Kinases (JNK)

JNKs are an important MAPK family that are involved in the regulation of cell

proliferation, oncogene transformation and programmed cell death. JNKs are phosphorylated and

activated by the JNK kinase 1 (JNKK1; MKK4) and JNK kinase 2 (JNKK2; MKK7), which are

activated by a variety of up-stream MAPKKKs. JNKs have similar MAPK cascade as ERKs,

however, unlike ERK1/2, the JNKs are activated by stress stimuli. Activated JNKs

phosphorylate downstream transcription factors, such as c-Jun and ATF-2 [121].

The JNK family has three members: JNK1, JNK2 and JNK3. The three JNK isoforms must

have overlapping functions in embryonic development because all individual JNK gene knockout

mice and JNK1/JNK3 or JNK2/JNK3 double mutants are viable and develop normal [94]. JNK3(-

/-) adult mice develop neuronal apoptosis, which indicates the JNK3-mediated signaling pathway

is involved in neuroprotection [208]. Mice lacking both JNK1 and JNK2 are embryonic lethal at

day 11 and display an open neural tube [94; 161]. Embryonic fibroblasts devoid of JNK1 and

JNK2 are resistant to UV-stimulated apoptosis [180]. These results indicate JNK1/2 play an

essential role in regulating stress-induced apoptosis. Furthermore, loss of both JNK] alleles and

one JNK2 allele results in an exencephalic phenotype that suggests JNK gene dosage might be

critical for its function [161]. Together, these results show JNK3 plays a pro-apoptotic role in









response to stress, while JNK1 and JNK2 are essential in both pro-apoptotic and anti-apoptotic

process during neuron morphogenesis.

During skeletal muscle differentiation, JNK activity is up-regulated, and inhibition of JNK

activity dramatically inhibits myoblast differentiation [91]. Different from ERK1/2, JNK

inhibitors repress myogenesis through induction of apoptosis, and activation of c-Jun and p53

transcription factors [91]. Overexpression of JNK in skeletal muscle results in a significant

increase in the basal phosphorylation state of several signaling molecules, such as ERK1/2 and

PKB [58].

2.2.3 Stress-activated Kinase of 38 kDa (p38 MAPK)

p38 MAPK also is referred to as a stress activated protein kinase [213]. p38 is activated by

various stresses, hormones and inflammatory cytokines that are induced by MKK3 and MKK6

phosphorylation. MEK3 favors phosphorylation of p38a and p3 8, while MEK6 phosphorylates

all p38 members. MEK3/6 also can phosphorylate JNK isoforms with lower affinity [46].

p38 MAPKs have four isoforms, p38a, p380, p38y and p386. Of these four subtypes, p38a

is the best characterized and it is expressed in most cell types. p38a knockout mice are

embryonic lethal due to defective placental angiogenesis [1;127]. Compared to p38a-deficient

mice, both p38/f and p38y knockout mice are viable with a normal life span and show no obvious

phenotype [95]. Thus, p38a has a specific function in placental development, and it can

compensate for the lack of p3880, p38y and p386 isoforms.

p38 MAPK is a potent activator of myoblast differentiation and treatment with p38

inhibitors prevents myoblast fusion into myotubes as well as muscle specific gene expression

[105] There are many potential explanations for the positive effect p38 MAPK in skeletal

myogenesis. p38 can phosphorylate E47 to induce MyoD/E47 association and subsequent

muscle-specific gene transcription [110]. p38 activity also phosphorylates MEF2 activation









domain and facilitates MEF2 and MyoD binding to a series of late muscle-specific gene

promoters, and the expression of these genes can activate the p38 to move the cells to the early

differentiation stage [142;204]. In mammalian myoblasts, there is crosstalk between p38 MAPK

and the NF-xB signaling pathway coordinately promote myogenesis [8]. p38 MAPK activity is

required for the quiescent state of skeletal muscle satellite cells. Inhibition of p38 MAPK

promotes myogenic cell cycle exit and inhibits differentiation [84]. p38 MAPK pathway also

increases MEF2 transcriptional regulation during early mammalian somite development [39].

2.2.4 Extracellular Signal-regulated Kinase 5 (ERK5)

ERK5, also called big mitogen-activated kinase (BMK), is a special member of the MAPK

family. ERK5 expresses in a wide range of tissues, especially in the cardiovascular system.

ERK5 is phosphorylated by MEK5, which is activated by MEKK2 and MEKK3. ERK5 has a

catalytic domain similar to ERK1/2, but a unique C-terminus that can interact with the MEF2

transcription factor family [87;207]. ERK5 can affect cellular activity through phosphorylation

of the MADS box transcription factors and myocyte enhancer factor 2A and 2C (MEF2A,

MEF2C) [88]. Although the ERK5 C-terminus functions as a MEF2 coactivator, its role in

myogenesis is unknown [87]. ERK5 gene deletion mice are embryonic lethal due to defective

blood vessel and myocardium [150;173;206].

2.3 Skeletal Muscle Growth and Hypertrophy: A Brief Overview

2.3.1 Introduction of Skeletal Muscle Hypertrophy

Skeletal muscle hypertrophy is defined as an increase in muscle mass. On the other hand,

decrease of muscle mass is called atrophy, which is a response to numerous diseases, such as

diabetes, cancer, renal failure and AIDS [63]. In the adult animal, skeletal muscle hypertrophy is

a result of an increase in the size of existing muscle fibers instead of an increase in numbers of

fibers.









2.3.2 Factors Regulate Skeletal Muscle Hypertrophy

Several intrinsic and extrinsic growth factors and stimuli promote or inhibit skeletal

muscle hypertrophy (Table 1-3). The most common stimulus of muscle hypertrophy is exercise,

which includes strength training and resistance exercise as a positive factor [48]. Nutritional

factors including energy balance and dietary protein supplementation also are necessary for

skeletal muscle hypertrophy [48]. Muscle injury and muscle aging are associated with muscle

atrophy [48]. However, the most important factors that regulate skeletal muscle hypertrophy are

hormones and growth factors, which initiate intracellular signaling pathways and stimulate

myoblast proliferation, myocyte differentiation and muscle-specific protein synthesis. For

example, testosterone, insulin and growth hormone are the main reasons for postnatal muscle

hypertrophy [54].

2.3.3 Growth Factors and Signal Molecules that Promote Muscle Hypertrophy

2.3.3.1 Growth Hormone (GH)

Growth hormone (GH) is a major regulator of body size and metabolism. Failure to

synthesis or secret GH leads to short stature. On the other hand, hypersecretion of GH induces

gigantism, if hormone is overproduced early in the life, or acromegaly, if oversecretion occurs in

adulthood [54].

Growth hormone is associated with postnatal growth instead of prenatal growth. Although

growth hormone receptor (GHR) exists in embryos, growth hormone does not play a necessary

role in embryonic development. GH gene mutation in mice or ablation of the pituitary does not

affect prenatal growth [56].

The "somatomedin hypothesis" demonstrates that pituitary GH (somatotropin) stimulates

postnatal growth indirectly through stimulating the hepatic production of circulating peptide

hormones (somatomedin), which then mediates the hormonal effects on target tissue.









Somatomedin has an insulin-like action and promotes the incorporation of sulfate into cartilage

[113]. Currently, somatomedin is referred to as insulin-like growth factor (IGF-I). The

somatomedin hypothesis has been referred to the dual-effector theory. This theory proposes that

GH directly stimulates the differentiation of precursor cells to certain cell types. The newly

differentiated cells are more sensitive to the IGF-I than the precursor cells. Thus, initial direct

action of GH leads to later IGF-I action in the target cells [78].

IGF-mediated actions of GH exist in different tissues, including fat cells, chondrocytes and

skeletal muscle. Hypophysectomy causes a decrease in muscle mass and the level of myosin

heavy chain mRNA decreases as well. Also GH treatment of hypophysectomized animals can

partially restore these situations, such as increasing muscle mass and strength and decreasing

body fat [111]. There is a loss in GH secretion as human aging, which is associated with

decrease in muscle mass and strength. Injection of rhGH for men older than 60 can improve lean

body mass and bone density [54]. However, GH can not be used as a general performance

intensifier because GH injection can not increase muscle growth and strength for normal

exercising people [54].

GH and IGF-I system constitute the major determinant of body size, and GH and IGF have

independent functions in regulating the postnatal growth. The Igfl gene mutant and Ghr gene

mutant mice both show retarded bone and muscle growth. GH can stimulate production of

hepatic IGF-I, which is a principal source of circulation IGF-I. Loss of liver-specific IGF-I

production lowers the concentration of IGF-I in blood reduces by 75%, with no effect on muscle

mass [171]. In the absence of GH, blood IGF-I levels are diminished, but the local IGF-I content

(such as IGF-I produced by skeletal mucle) is unaffected. GH receptor and IGF-I double mutant

mice are only 17% of normal size, which is more severe than either of the single mutants [113].









2.3.3.2 IGF-1

Insulin-like growth factor system includes two hormones (IGF-I and IGF-II), three

receptors and six IGF specific binding proteins (IGFBP-1 to -6). Knockout experiment of

different parts of IGF system indicates all components are very important in muscle growth and

development [54].

Compared to IGF-II and insulin, IGF-I has a primary role in regulating skeletal muscle

growth. Mice lacking IGF-I exhibit growth deficiency. Depending on genetic background, some

IGF (-/-) mice die immediately after birth, while others survive and reach adulthood [109]. In

contrast, transgenic mice over expressing human IGF-I have a 30 percent increase in body

weight due to apparent increases in skeletal muscle and bone [114]. On the other hand, null

mutation of igflr all die at birth of respiratory failure and exhibit a severe growth deficiency

[109]. Expression of a dominant negative IGF-I receptor specifically in skeletal muscle induced

muscle hypoplasia from birth to 3 weeks old, with decreased level of MyoD and myogenin. After

grew to adulthood, these mice showed compensatory hyperplasia, with increased MyoD,

myogenin, p38 and p21 levels [50].

IGF-I stimulates myoblast proliferation, myogenic differentiation and myotube

hypertrophy in both cultured cells and in intact animals [54]. To balance the mitogenic and

myogenic action on skeletal muscle cells, IGF-1 has a biphasic effect. Initially, IGF-1 inhibits

expression of myogenin, a myogenic regulatory factor, which results in a proliferation response.

Subsequently, IGF-1 switches to stimulate myogenin expression, which up-regulates

differentiation as well as down-regulates proliferation [177]. It also is reported that a high

concentration of IGF-I can inhibit myoblast differentiation as well as proliferation [197].

IGF-I is sufficient to induce skeletal muscle hypertrophy. IGF-I can induce myofiber

hypertrophy in vitro by stimulating myoblast proliferation and fusion to established myofibers









[186]. It also has been reported that an increase in muscle load can stimulate muscle hypertrophy

with simultaneous increased expression of IGF-1 [43]. Expression of IGF-I in myoblasts can

increase the expression of MRFs, such as MyoD and myogenin, and also stimulate contractile

protein expression and myotube formation [27]. Mice overexpressing IGF-I in muscle, have at

least twofold greater muscle mass compared with wild type mice. Thus indicates IGF-I

stimulates skeletal muscle hypertrophy in vivo [27]. The mechanism for IGF-I signaling in

myoblast proliferation is mediated primarily by ERK1/2 pathway, whereas myoblast

differentiation prefers the PI3K pathway [29]. Figure 2-2 shows the signaling pathways involved

in IGF-I induced skeletal muscle hypertrophy.

2.3.3.3 PI3K

Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase, which phosphorylates the

membrane phospholipids phosphatidylinositol -4,5-bisphosphate, producing phosphatidylinositol

(3,4,5)-trisphosphate [PtdIns(3,4,5)P3]. PtdIns(3,4,5)P3 is a lipid binding site for the

serine/threonine kinase, Aktl ( also known as protein kinase B) [96]. Once Aktl is activated, it

phosphorylates downstream substrates, which induces gene transcription and protein synthesis to

promote cell proliferation and inhibit apoptosis [190].

PI3K activity is required for IGF-I mediated skeletal muscle hypertrophy. It has been

reported that IGF-1 induces hypertrophy by activating the PI3K-Akt pathway, which causes

activation of proteins that are required for protein synthesis [17; 154]. Furthermore,

pharmacological inhibition of PI3K activity prevents muscle hypertrophy induced by IGF-1 [85].

Therefore, PI3K activation is sufficient to induce skeletal muscle hypertrophy, and its activity is

necessary for the IGF-1 induced hypertrophy.









2.3.3.4 Akt

The Akt family, also called protein kinase B (PKB), is composed of three members,

Aktl, Akt2 and Akt3 [96]. These three members share 80% homology but have distinct functions

[96].

Akt] (-/-) mice are viable and smaller than wild type littermates, which suggests Aktl is

required for muscle growth and other tissue development [24]. Mice deficient in Akt2 are

impaired in the ability of insulin to adjust the blood glucose and the animals have diabetes. Thus

Akt2 is involved in glucose transport and maintenance of glucose homeostasis [26]. Aktl and

Akt2 are expressed in skeletal muscle and cooperate to promote muscle hypertrophy [96]. During

work-induced muscle hypertrophy, there is an increase in endogenous Aktl activity, as well as

mTOR, which is a downstream target of Aktl [17]. Expression of a dominant negative Aktl

blocks IGF-I induced muscle hypertrophy in vivo [154]. Transgenic mice with constitutively

active Akt in adult skeletal muscle exist. In these mice, activation of Akt is sufficient to induce

rapid and significant skeletal muscle hypertrophy, accompanied by activation of the downstream

Akt/mTOR/p70S6 kinase protein synthesis pathway [96].

2.3.3.5 mTOR and GSK3P

Aktl is a key molecule in the IGF-I induced hypertrophy, because it can activate multiple

downstream signaling, including the mammalian target of rapamycin (mTOR), p70S6 kinase

(p70S6K), phosphorylated heat- and acid-stable protein 1 (PHAS-1, also known as 4E-BP1) and

glycogen synthase kinase 30 [154].

mTOR is a downstream substrate that has a central function in integrating growth factor

stimulation with intracellular protein synthesis. Rapamycin, a mTOR inhibitor, blocks activation

of downstream p70S6K stimulation by Aktl and IGF-I [138;154;155]. Treatment of muscle cells

with rapamycin can either inhibit the cell growth or decrease the mucle hypertrophy in vitro









[13 8;154]. In vivo, treating the mice with rapamycin inhibits skeletal muscle hypertrophy

induced by over expression of Aktl [17]. In these mice, p70S6K activity decreases, while Aktl

activity does not change. These results indicate a linear signaling pathway during hypertrophy:

Aktl-mTOR-p70S6K. On the other hand, activation of mTOR also inhibits PHAS-1, which is a

negative regulator of the translation initiation factor eIF-4E [71]. Thus, mTOR is the signal

molecule downstream of PI3K-Akt pathway in the IGF-I mediated hypertrophy. Active mTOR

promotes protein synthesis through two distinct mechanisms, positively regulating the p70S6K

pathway and negatively regulating PHAS-1 pathway.

GSK30 is a different substrate of Aktl, which also is involved in regulating skeletal

muscle hypertrophy. Phosphorylation of Akt 1 inhibits GSK30 activity [36]. Expression of a

dominant-negative form of GSK30 induces hypertrophy in skeletal myotubes [154]. GSK30

inhibits protein translation initiation through eIF-2B protein [72]. Therefore, PI3K-Akt- GSK33-

eTF-2B is another pathway that stimulate protein synthesis in skeletal muscle hypertrophy.

2.3.3.6 MAPK

The MAPK pathway is an important pathway involved in IGF-I induced skeletal muscle

hypertrophy. The detail of function of MAPK pathway in both myogenesis and mitogenesis has

been mentioned before.

Compared to the PI3K pathway, the function of the MAPK pathway in skeletal muscle

hypertrophy is less clear. An interaction between Raf-MEK-ERK pathway and PI3K-Akt

pathway plays a role in the process of muscle hypertrophy [122;155;219]. PI3 kinase activity is

essential for induction of Raf/MEK/ERK activity [177]. ERK1/2 pathway and PI3K pathway are

both activated when upstream Ras is activated. Transfection of Ras can promote activation of

PI3K as well as Raf-1, and a dominant negative Ras mutant inhibits growth factor induced

activation of PI3K [153]. Activated Akt phosphorylates Raf at a highly conserved serine residue









in its regulatory domain and inhibits activation of Raf/MEK/ERK signaling pathway [219]. The

Akt-Raf interaction is dependent upon cellular context and dose of stimulus. Activation of Akt

inhibits Raf activity in differentiated myotubes, but not in myoblast precursors [155]. High

concentrations of IGF-I activates Akt strongly enough to inhibit Raf kinase activity, whereas low

concentration of IGF-I retains mitogenic function that is insufficient to suppress Raf activity

[122].

2.3.3.7 Fibroblast Growth Factor 2 (FGF2)

Among all the growth factors that regulate skeletal muscle hypertrophy, IGF-I, FGF2 and

TGF-P are the most extensively studied. There are more than 20 FGF family members, and

FGF1, 2, 4, 5, 6, 8 and 10 are expressed in muscle.

FGF2 stimulates myoblast proliferation. Deletion of FGF2 signal through overexpression

of a dominant negative FGF receptor 1 results in cell cycle withdrawal and suppression of

myotube formation [53]. In vitro, FGF2 negatively regulates myogenesis. FGF2 blocks muscle-

specific gene expression and myotube fusion [55]. FGF2 localizes in the extracellular matrix of

skeletal muscle fiber, and FGF2 accumulation augments muscle hypertrophy [205]. Inhibition of

FGF receptor decreases muscle mass during embryonic development due to decreases in number

of myoblasts, which suggests FGF2 is a positive regulator of muscle hypertrophy [53]. The

possible mechanism for FGF2 stimulation of skeletal muscle hypertrophy may involve satellite

cell activation and proliferation.

2.3.3.8 Hepatocyte Growth Factor (HGF)

Muscle satellite cells play a crucial role in muscle growth and injury repair. Normally

satellite cells are in a quiescent state, until muscle growth or injury signals activate them. During

the regeneration process, satellite cells proliferate, differentiate and express muscle specific

proteins. Both in vivo and in vitro, HGF activates satellite cells [6]. HGF and its receptor, c-Met,









are localized to satellite cells and adjacent myofibers, and their expression is induced by muscle

injury [75]. HGF and c-Met are expressed in developing limb buds, and c-Met null mouse

embryos fail to form limb skeletal muscle [15]. HGF promotes proliferation and inhibits

differentiation of satellite cells, and fetal and adult myoblasts [61]. HGF inhibits by repressing

MyoD and myogenin transcription [61] HGF also causes the up regulation of twist, an inhibitor

of differentiation and p27, a CDK inhibitor [103].

The actions of HGF are mediated by downstream induction of PI3K and ERK1/2 [102].

Grb2 is essential for phosphorylation of ERK1/2 and repression of myogenesis by HGF. Grb2

binds to PI3K in muscle cells and prompts elevated ERK1/2 activity [70].

2.3.4 Growth Factors and Cytokines that Inhibit Muscle Hypertrophy

2.3.4.1 Transforming Growth Factor P (TGF-P)

TGF-P family is an important negative regulator of skeletal muscle hypertrophy. TGF-P

signals classically through Smad2 and Smad3 to disrupt all measures of muscle formation [108].

However, ERK1/2 phosphorylation can be induced by TGF-P in some cell types [128]. The

importance of ERK1/2 and TGF-P signaling is underscored in myoblasts expressing constitutive

Raf [193]. Strong sustained ERK1/2 signaling induces TGF-P and GDF-8 which may act as

autocrine inhibitors of myogenesis.

TGF-P inhibits myogenin-induced myogenesis in 10T1/2 fibroblasts. TGF-P treatment for

30 minutes reversibly induces MEF2 translocation to the cytoplasm of myogenic cells, which

prevents MEF2 from participating in the transcriptional activation complex at muscle specific

promoters [38]. Using truncated type II TGF-P receptor as a dominant negative can inhibit

myofiber formation and expression of MyoD, myogenin and other differentiation markers [52].

Growth and differentiation factor 8 (GDF-8, also called myostatin), a member of TGF-beta

family, is expressed in embryonic and adult skeletal muscle. GDF-8 null mice are significantly









larger than wild type animals with a 20-35% increase in muscle mass, which is result of both

hyperplasia and hypertrophy [117]. Myostatin is a negative regulator of satellite cells. Myostatin

inhibits myoblast proliferation through increasingp2l expression and decrease Cdk2 expression

leading to an accumulation of Rb protein, which in turn arrests myoblasts in G1 phase of cell

cycle [176].

2.3.4.2 Tumor Necrosis Factor-alpha (TNF-a)

TNF, IL-1 and IL-6 are inflammatory cytokines released by immune cells in response to

foreign stimuli [187]. They are associated with the skeletal muscle catabolic response and have

been shown to induce muscle wasting [187].

TNF-a, also called cachectin, is expressed in diaphragm tissue, and anti-TNF-a antibody

can prevent the deterioration of diaphragm muscle contractile properties [170]. TNF- a mediates

skeletal muscle wasting through activation of NF-xB and AP-1 [192]. In C2C12 myoblasts, TNF

induced NF-KB inhibits skeletal muscle differentiation by suppressing MyoD mRNA translation

[68].

2.3.4.3 Interleukin-6 (IL-6)

IL-6 is a multifunctional cytokine that plays a major role in the inflammatory response and

B-lymphocytes maturation [178]. Skeletal muscle produces IL-6, which is secreted into the

plasma and increased during exercise [141]. IL-6 expression increases in myofibers after

eccentric exercises, which indicates IL-6 may be related to muscle damage and regeneration

caused by strenuous exercises [178]. Transgenic mice overexpressing IL-6 show muscle atrophy

due to increased catheptic enzyme activity [181]. In addition, treatment with IL-6 receptor

antibody can block the muscle atrophy and is effective against muscle wasting from sepsis and

cancer cachexia [182].









The actions of IL-6 are mediated through STAT3 and ERK1/2 [4]. Human muscle cells

treated with IL-6 demonstrate rapid phosphorylation of ERK1/2. LIF, a member of the IL-6

family, inhibits muscle gene transcript and myoblast fusion via MEK-dependent phosphorylation

of ERK1/2 [81]. Thus, ERK1/2 signals may contribute to interleukin-mediated muscle atrophy.

2.4 Summary of ERK1/2 Effects on Skeletal Myogenesis

Muscle hypertrophy is promoted by IGF-I mediated signaling. IGF-I provokes two major

intracellular signaling pathways; the ERK1/2 signaling cascade and the PI3K pathway. Initiation

of ERK1/2 activity in response to IGF-I typically results in mitogenesis, although significant

crosstalk exists between the ERK and PI3K systems. ERK1/2 activity inhibits myocyte

formation independent of continued cell cycle progression. Importantly, the absolute levels of

ERK1/2 signaling appear to affect myogenic decisions. Low-level ERK2 activity is associated

with differentiation while sustained ERK1 and ERK2 activity is correlated with inhibition of

myogenesis. Thus, signal transmission through ERK1/2 may have divergent effects on muscle

form and function.









Table 2-1. MRF null phenotypes


Genotype
MyoD[101]


myf5[101]


myogenin[101]


MRF4[101]


MyoD[101]
myf5[101]


myogenin[101]
MyoD/myf5
/MRF4[101]

myogenin[101]
MyoD[101]
MRF4[101]

MyoD[101]
MRF4[101]


Viability
Viable


Perinatal
death

Perinatal
death

viable


Dead right
after borth


Perinatal
death


Perinatal
death


Perinatal
death


Phenotype
No obvious defects in skeletal muscle; with
increase myf5 expression

With normal muscle, defects in rib development


Severe defects in differentiated muscle fiber, but
with normal numbers of myonuclei

Defective rib cage; high level of myogenin
expression

Complete absence of myoblasts and muscle fiber


Same phenotype as myogenin[101] mice



Same phenotype as myogenin[101] mice



Same phenotype as myogenin[101] mice


Reference
[19;157]


[20]


[73;129]


[139;217]


[158]


[148;149]



[185]



[149]









Signal

1
MAPKKK



1


IPK
MAPK


-Mtogen

1
MEKK3
Raf


MEKI
MEK_2


Stres.s/Cytokines


MEKK 1-4
other :LAPKKKs


MEK4
MEK7

i


ERK1./2


Figure 2-1. MAPK signaling cascade


MEKK2
_I-', _K3


MEK5


MIEK3
MEK6

4,


p38


ERK5









Table 2-2. Summary of MAPK knockout mice phenotypes


Genotype
ERK1[101]


ERK2[101]


JNK1[101]


JNK2[101]


JNK1[101]
JNK2[101]

JNK3[101]


p38a[101]


p380[101]
p38y[101]

ERK5[101]


Viability
Viable


Embryonic
lethal


Viable


Viable


Embryonic
lethal


Viable


Embryonic
lethal


Viable


Embryonic
lethal


Phenotype
Defects in thymocyte development, enhanced
long-term memory


Defective in placenta development


Defective in T cell activation and apoptosis of
thymocytes

Defective in T cell activation and apoptosis of
thymocytes


Defective in neural tube closure,
UV-induced apoptosis


Defective in neuroprotection and stress-induced
neuronal apoptosis


Defective placental angiogenesis


No obvious phenotype


Defective blood vessel and myocardium


Reference
[116;137]


[74]


[162]


[160]


[94;161;180]


[208]


[1;127]


[95]


[150;173;206]









Table 2-3. Regulatory factors of skeletal muscle hypertrophy
Regulatory factors Positive Negative

Exercise Strength training [48]
Resistance exercise [48]

Nutrition Dietary protein supplement [48]

Hormones Testosterone [189] Cortisol
Growth hormone [57]

Growth factors IGFs [114] IL-1 [30]
FGFs [205] IL-6 [181
HGF [75] TNF-a [1


Others


Muscle satellite cells [75]


[79]


1]
54]


TGF-P [220]

Muscle damage
Aging [481


V VL ~















PI3K Aktl



Ras//
mTOR

Raf 0

i --* / IGSK3P p70S6K PHAS-1


ERK1/2 eIF-2B eIF-4E


?Promote protein synthesis
Figure 2-2. Signaling pathway involved in IGF-I induced skeletal muscle hypertrophy.









CHAPTER 3
MATERIALS AND METHODS

3.1 Cell Culture, Plasmids, and Transfection

C2C12 myoblasts were cultivated on gelatin-coated tissue culture plasticware in high

glucose Dulbecco's modified Eagle's medium supplemented with 15% fetal bovine serum, 1%

penicillin-streptomycin, and 0.5% gentamycin (Invitrogen, Carlsbad, CA). Differentiation was

induced by culture in low glucose DMEM supplemented with 2% horse serum, 1% penicillin-

streptomycin, and 0.5% gentamycin. Where appropriate, FGF2 was supplied at 5ng/mL and IGF-

I was supplemented at 250 ng/mL levels (R&D Systems, Minneapolis, MN). Inhibition of

MEK1/2 activity was accomplished by supplementation of culture medium with 25 PM

PD98059 (Cell Signaling, Beverly, MA).

3.2 RNA Interference

Small interfering RNAs were constructed using an artificial neural network [76]. The

double-stranded oligonucleotides coding for siRNA directed against mouse ERK1 mRNA were

5'-AATGTTATAGGCATCCGAGAC, targeting a region spanning 312-333 and 5'-

AAGCCTTCCAATCTGCTTATC, targeting the region spanning 519-540. Oligonucleotide

sequences of the DNA coding for siRNA against ERK2 were 5'-

AAAGTTCGAGTTGCTATCAAG and 5'-AAGAGGATTGAAGTTGAACAG, complimentary

to nucleotide sequences 355-376 and 1111-1132 of mouse ERK2 mRNA. The double-stranded

DNAs were cloned first in to RNAi-Ready pSIREN-RetroQ-ZsGreen Retroviral Vector (BD

Biosciences Clontech). Single pSIREN-RetroQ-ZsGreen plasmid coding for ERK1 or ERK2

siRNA was transfected into PT67 packaging cell line by calcium phosphate precipitation [82].

The growth medium with virus was collecting between 24 hours and 72 hours after transfection.

Add polybrene to the medium to a final concentration of 4 ptg/mL and then filter the medium









through 0.45 tm filter. Then the retrovirus was used to infected C2C12 myoblasts for 48 hours.

The double-strand nucleotides were also cloned into the pSilencer vector (Ambion, Woodlands,

TX). Single or pairs of pSilencer plasmids coding for ERK1 or ERK2 siRNAs were transiently

transfected into C2C12 myoblasts by calcium phosphate precipitate formation. The myoblasts

were selected in growth medium containing 400 [tg/mL G418 (Invitrogen, Carlsbad, CA) for 10

days to create the stable cell lines, C2C12siERK1 and C2C12siERK2. C2C12siCon myoblasts

stably express pSilencer containing a randomized 21 base pair cDNA insert.

3.3 Luciferase Reporter Assay

C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts (1 x 105) were co-

transfected with 1 tg of a multimerized AP 1 DNA binding site driving expression of luciferase

(APl-Luc), 50 ng pRLtk, a Renilla luciferase expression plasmid as an efficiency monitor, and

0.5 tg of pCS2 + MT or pCS2 + MT-RafBXB [82]. After 48 h in growth medium, the cells were

lysed and luciferase activities measured (Dual-Luciferase Reporter kit, Promega, Madison, WI).

Transfection efficiency was normalized by pRLtk activity. The assay was repeated three times.

3.4 BrdU Incorporation

A BrdU incorporation assay was performed to measure DNA synthesis. C2C12siCon,

C2C 12siERK1, and C2C 12siERK2 myofibers were incubated with fresh medium containing 10

tM BrdU for 30 min, and then BrdU immunocytochemistry staining and label index counting

were performed. The BrdU labeling index was assessed by point counting a total of 400 to 1000

nuclei in 6-8 representative fields. The labeling index was counted as the number of positively

labeled nuclei divided by total number of nuclei times 100%.









3.5 Western Blot

C2C12siCon, C2C12siERK1, and C2C12siERK2 myofibers were lysed in 4x sample

buffer (250 mM Tris, pH 6.8, 8% SDS, 40% glycerol, and 0.4% P-mercaptoethanol) and heated

at 95 C for 5 min. Proteins were separated through 10% polyacrylamide gels under denaturing

conditions and transferred to nitrocellulose membrane. The membranes were incubated with 5%

nonfat dried milk in TBST (10 mM Tris, pH 8.0, 150 mM NaC1, and 0.1% Tween 20) to block

non-specific binding sites. Blots were incubated overnight at 4 OC with anti-ERK1/2, anti-

phosphoERKl/2, anti-Akt or anti-phosphoAkt (Cell Signaling, Danvers, MA) or for 1 h at room

temperature with anti-myosin heavy chain (MF20), anti-myogenin (F5D), anti-desmin

(D3,Developmental Studies Hybridoma Bank, University of Iowa, Ames, IA) or anti-troponin T

[188]. After extensive washes with TBST, the blots were incubated with appropriate peroxidase-

conjugated secondary antibody for 1 h, following by chemiluminescent detection (ECL,

Amersham, Piscataway, NJ) and exposure to X-ray film.

3.6 Immunocytochemistry

C2C12siERK1, C2C12siERK2, and C2C12siCon cells were fixed with 4%

paraformaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature. Non-

specific antigen sites were blocked with PBS containing 5% horse serum and 0.1% Tween 20.

Cultures were incubated with anti-myosin heavy chain (MF20, 1:10 hybridoma supernatant) for

1 h. After exhaustive rinses with PBS, the fixed cultures were incubated with donkey anti-

mouse-AlexaFluor488 antibodies. Cultures were counterstained with Hoescht 33325 for the

visualization of nuclei. Immunofluorescence was detected with a Nikon TE2000 inverted phase

microscope equipped with epifluorescence. Representative images were captured with a

DMF1200 digital camera and compiled with Lucia Imaging software. For the detection of BrdU

incorporation, myoblasts were fixed with 70% ethanol for 1 h at 4 OC. DNA was denatured with









2 N HC1 for 1 h in 37 C. Fixed cultures were neutralized and incubated with anti-BrdU (1:50,

Invitrogen-Molecular Probes, Carlsbad, CA) for 1 h at room temperature. Subsequently, cells

were incubated with goat anti-mouse-biotin and streptavidin-peroxidase (ABC kit, Vector Labs,

Burlingame, CA). Labeled nuclei were visualized colorimetrically using 3,3'-diaminobenzidine

and nickel chloride.









CHAPTER 4
RESULTS

4.1 Preliminary Experiment

To test the discrete functions of ERK1 and ERK2, a cDNA coding for one siRNA for each

ERK isoform was synthesized and cloned into RNAi-Ready pSIREN-RetroQ-ZsGreen

Retroviral Vector. This vector contains a cDNA coding for Green Fluorescence Protein (GFP)

that allows for identification of transduced cells. pSIRENsiERK1 or pSIRENsiERK2 were

transfected into the packaging cell line PT67, and replication defective retrovirus were harvested.

C2C12 myoblasts were transduced with the retrovirus and infection efficiency was monitored by

fluorescent GFP detection. Results indicate less than 10% of C2C12 myoblasts were infected

(Figure 4-1). To evaluate siRNA knockdown, total cellular protein lysates were prepared from

C2C12 infected by ERK1 or ERK2 siRNA and uninfected control C2C12 myoblasts, and

analyzed by Western blot for ERK1 and ERK2 proteins (Figure 4-2). The C2C12 myoblasts

infected with ERK1 or ERK2 siRNA had no significant reduction in ERK1 and ERK2 protein by

comparison with control cells. Due to low infection rates and poor knockdown of ERK1 and

ERK2, this method was discontinued.

To increase the proportion of cells incorporating ERK1 or ERK2 siRNA, two stable

myogenic cell lines constitutively expressing a single siRNA were synthesized. siRNAs were

cloned into pSilencer vector and selected for neomyosin resistance after tranfection of C2C 12

myoblasts. The protein expression level was analyzed by Western blot for ERK1/2 and a-tubulin.

Compared to control cells, C2C12 with single siRNA of ERK1 or ERK2 had no reduction in

ERK kinase expression (Figure 4-3).









4.2 Creation and Validation of ERK1 and ERK2 siRNA

Stable myogenic cell lines incorporating a single siRNA is inefficient, therefore, two

siRNAs for each target kinase were synthesized using an artificial neural network program [76].

C2C 12 myoblasts were transfected with plasmids coding for the ERK siRNAs followed by

selection for neomycin resistance. To evaluate the level of message knockdown, total cellular

protein lysates were prepared from C2C12siCon, C2C12siERK1, and C2C12siERK2, and

analyzed by Western for ERK1/2 protein expression (Figure 4-4A). Control myoblasts readily

synthesize the two kinases. C2C12siERK1 and C2C12siERK2 both produce severely reduced

amounts of the ERK proteins. The siRNAs are specific for the targets of interest as no alterations

in protein size or concentration of the reciprocal kinases were observed. Residual kinase activity

was measured by Western using an antibody against phospho-ERK1/2. C2C12siERK1 contained

a higher relative amount of phosphoERK2 than controls (C2C12siCon). C2C12siERK2

contained a severe reduction in both total and phosphoERK2. To quantify the reduction of the

various forms of ERK1/2, replicate blots were analyzed by scanning densitometry. Results

indicate that ERK1 protein expression is 80% lower than the amount synthesized by control

myoblasts (Figure 4-4B). ERK2 and phosphoERK2 proteins are reduced 85% by comparison to

controls. To verify that loss of ERK1/2 causes a biological response, C2C12siCon,

C2C12siERK1, and C2C12siERK2 myoblasts were transfected with plasmids coding for

activated Raf and an APl-Luc reporter. As shown in Figure 4-5, C2C12siCon myoblasts contain

ERK1/2 proteins that promote the efficient transcription from APl-Luc. A reduction in ERK1 or

ERK2 protein results in a decrease in Raf/ERK directed reporter gene expression.

4.3 Optimal Myoblast Proliferation Requires One Functional ERK Enzyme

ERK1/2 are involved in mitosis and cell proliferation [140]. Inhibition of their activation

leads to growth arrest in many cells including myoblasts [83]. The necessity for each ERK









during myoblast proliferation was measured in C2C12siCon, C2C12siERK1, and C2C12siERK2

myoblasts. Equal numbers of myoblasts were cultured for 4 days in mitogen poor medium. Cell

numbers were measured daily. A representative growth curve is shown in Figure 4-6.

Knockdown of ERK1 mRNA did not elicit an effect on myoblast proliferation. C2C12siCon and

C2C12siERK1 expanded at comparable rates. Myoblasts synthesizing reduced levels of ERK2

tend to grow slower than either controls or siERK1 myoblasts, although this is not statistically

significant. To confirm variable growth rates, the myoblast populations were cultured for 48 h

under similar conditions and pulse labeled with BrdU for 30 min prior to fixation. Results

indicate that 34%, 34%, and 28% of the cells are present in S-phase for cultures of C2C12siCon,

C2C12siERK1, and C2C12siERK2, respectively, (Figure 4-7). The reduction in BrdU

incorporation supports a tendency toward depressed growth rates of ERK2 deficient myoblasts.

To determine if both ERK proteins are necessary for the mitogenic response to FGF2 or IGF-I,

cultures of C2C12siCon, C2C12siERK1, and C2C12siERK2 were treated for 48 h with the

growth factors. BrdU incorporation was measured during the final 30 min of treatment.

Treatment of control myoblasts with 5 ng/mL FGF2 causes a 2-fold increase in the numbers of

actively dividing cells (Figure 4-7). A similar response was found in C2C12siERK1 myoblasts

treated with the mitogen. The increased cell division was somewhat tempered in C2C12siERK2

myoblasts treated with FGF2, though not significant. In a similar manner, C2C12siCon,

C2C12siERK1, and C2C12siERK2 myoblasts proliferate in response to IGF-I treatment. Thus,

efficient myoblast proliferation necessitates a single functional ERK allele.

4.4 ERK2 is Necessary for Efficient Myofiber Formation

The effects of differential ERK1 and ERK2 function on myofiber formation and muscle

gene expression were examined in C2C12 myoblasts. C2C12siCon, C2C12siERK1, and

C2C12siERK2 myoblasts were induced to differentiate by culture in 2% horse serum for 48 h.









Cultures were fixed and immunostained for myosin heavy chain (MyHC), a marker of terminal

differentiation. The scrambled siRNA did not interfere with the ability of C2C12 myoblasts to

differentiate (Figure 4-8). Large multinucleated myofibers were apparent that readily expressed

the contractile protein. A similar result was evident in cultures of C2C12siERK1 cells. By

contrast, C2C12siERK2 myoblasts failed to fuse into large syncitia. A portion of the myoblasts

expressed MyHC but these cells were mononucleated with a spindle- like morphology. A

differentiation index was calculated as the numbers of nuclei in MyHC expressing myofibers

divided by the total number of nuclei. By comparison to control and C2C12siERK1 cells,

C2C12siERK2 myoblasts formed 50% fewer myosin-expressing cells (Figure 4-9). Coincident

with the reduced differentiation capabilities is a severe impairment in myoblast fusion. A fusion

index was calculated as the number of MyHC immunopositive fibers with two or more nuclei

divided by the total number of nuclei. C2C12siERK2 myoblasts possess fewer than 5%

multinucleated MyHC expressing fibers. These results argue that ERK2 signaling is needed for

optimal differentiation and myoblast fusion. Alternatively, myofiber formation may require

elimination of an ERK1 signal. To clarify the role of ERK2 as a positive effector of myogenesis,

confluent cultures of C2C12siERK2 myoblasts were treated with 25 tM PD98059 under

differentiation-permissive conditions. The concentration of PD98059 is sufficient to inhibit the

phosphorylation of ERK1 (Figure 4-10). After 48 h, the cells were fixed and immunostained for

MyHC expression. As shown in Figure 4-11, no increase in the numbers or size of MyHC

expressing myofibers is apparent. Because inhibition of ERK1 function does not restore the

myogenic program, ERK2 must play an essential role during myogenesis.

4.5 ERK2 Knockdown Inhibits Myogenin Protein Expression

Myogenin expression is a requisite for efficient myofibers formation and muscle gene

expression [73]. The reduction in fiber number and contractile protein expression suggested that









myogenin expression was compromised. Therefore, equal amounts of protein were analyzed by

Western blot using antibodies specific for myogenin and a-tubulin (Figure 4-12). C2C12siERK2

myoblasts synthesize significantly less myogenin protein. To determine if restoration of

myogenin protein expression can alleviate the block to optimal muscle formation in ERK2

deficient myoblasts, the cells were treated with IGF-I [183]. In brief, C2C12siERK2 myoblasts

were grown for 48 h in differentiation medium supplemented with 250 ng/mL IGF-I. Total

cellular lysates were isolated and analyzed for myogenin protein expression. IGF-I

supplementation increased relative myogenin protein levels in C2C12siERK2 myoblasts to levels

comparable to untreated C2C12siCon myoblasts. The amount of myogenin protein was

quantified and corrected for a-tubulin expression. As shown in Figure 4-13, C2C12siERK2

myoblasts synthesize myogenin at concentrations less than 60% of wildtype. Treatment of

C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts with IGF-I increased the amount of

myogenin protein, as expected [183].

4.6 IGF-I Signaling Partially Restores Myogenin Expression and Myofiber Formation

To determine if increased myogenin expression can restore differentiation and fusion to

ERK2 deficient myoblasts, C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were

cultured with IGF-I for 48 h prior to fixation and assessment of differentiation.

Immunocytochemical staining for MyHC in IGF-I treated C2C12siERK2 myoblasts noted the

appearance of larger myofibers containing three or more nuclei (Figure 4-14). Approximately

10% of the total nuclei were present in MyHC immunopositive myofibers that contained two or

more nuclei (Figure 4-15). Interestingly, C2C12siERK1 myoblasts contain no detectable ERK1

protein and are more responsive to IGF-I treatment. The numbers of nuclei found in myofibers

doubles in C2C12siERK1 cultures receiving ectopic IGF-I. Treatment with IGF-I for 48 h did

not significantly increase the total number of nuclei (one or more) contained within myosin









expressing cells (Figure 4-16). These results suggest that ERK2 is necessary for myogenin

expression, which promotes myoblast fusion.

A major intracellular signaling cascade invoked by IGF-I involves the sequential

activation of PI3-kinase and Akt [80; 105]. Inhibition of PI3-kinase signaling leads to a complete

loss of myofiber formation in avian and rodent myoblasts [80;85;144] To ensure that the

preferred IGF-I signaling system is intact in the ERK deficient myoblasts, confluent cultures of

C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were treated with IGF-I for

48 h. Total cellular lysates were prepared and analyzed by Western for Akt and phosphoAkt

(Figure 4-17). As predicted, IGF-I treatment caused a significant increase in the amounts of

active Akt in all instances. Thus, the inability of IGF-I to more fully restore the differentiation

program to ERK2 deficient myoblasts is not due to a faulty PI3 kinase-mediated intracellular

signaling system.

4.7 FGF2 Does Not Signal Exclusively through Either ERK1 or ERK2 to Inhibit
Myogenesis

FGF2 is an extremely potent antagonist to muscle formation in vitro [134]. The growth

factor stimulates ERK1/2 phosphorylation in C2C12 myoblasts and inhibition of ERK1/2

function leads to an increase in myogenin and MyHC protein expression [120]. Because

C2C12siERK1 myoblasts readily form large myofibers; we examined the possibility that biased

ERK2 function could deter the inhibitory actions of FGF2 on myogenesis. To this end,

C2C12siCon, C2C12siERK1, and C2C12siERK2 myoblasts were induced to differentiate in the

presence or absence of 5 ng/mL FGF2. Myoblast cultures were fixed and immunostained for

MyHC expression and a differentiation index was constructed. Parallel cultures were lysed for

Western blot analysis. As shown in Figure 4-18, treatment with FGF2 effectively eliminated

myofiber formation in all myoblast cell types. Fewer than 5% of the C2C12siCon,









C2C12siERK1 or C2C12siERK2 myoblasts fused into multinucleate fibers (Figure 4-19).

Western blot analysis using anti-MyHC and anti-myogenin revealed that neither of the

aforementioned proteins is synthesized in FGF2 treated myoblasts (Figure 4-20). Thus, all

measures of morphological and biochemical differentiation are ablated by FGF2 treatment of

wildtype, ERK1 or ERK2 deficient myoblasts. Previous reports indicate that inhibition of the

upstream kinase, MEK1/2, reverses the suppression actions of FGF2 [120; 179]. A similar result

is found in the ERK1 and ERK2 deficient myoblasts (Figure 4-20). Treatment with 25 tM

PD98059, a concentration that prevents efficient phosphorylation of ERK1/2 resulted in an

increase in muscle protein expression. However, myogenic protein levels remained lower than

those found in nontreated controls.










siERK1


Figure 4-1. C2C12 myoblasts transduced with pSIRENsiERK1 and pSIRENsiERK2. C2C12
myoblasts were infected with retrovirus containing single siRNA specific against
ERK1 and ERK2. Cells were cultured in growth medium for 48 h. Representation
phase as 200x showing GFP transduced cells (A, B) and corresponding phase contrast
microscopic field (C, D).


siERK2









siERK2 Control

en- qqm


a m a


a-tubulin


Figure 4-2. C2C12 myoblasts transduced with pSIRENsiERK1 or pSIRENsiERK2 does not
inhibit ERK1/2 expression. C2C12 myoblasts were infected with retrovirus
containing single siRNA specific against ERK1, ERK2 or scambled control
oligonucleotide. Cells were cultured in growth medium for 24 h. Then total protein
isolates were harvested and analyzed by Western blot for total ERK1 and ERK2
protein, or tubulin protein expression.


siERK1


-ERK1
-ERK2










siERK1 siERK2 Control


-ERK1
-ERK2



~l ~Ic a-tubulin
... ... .,


Figure 4-3. C2C12 myoblasts stable expressing single siERK1 or siERK2 does not inhibit
ERK1/2 expression. C2C12 myoblasts were transfected with single siRNA specific
against ERK1, ERK2 or scambled control oligonucleotide. Cells were cultured in
growth medium for 24 h. Then total protein isolates were harvested and analyzed by
Western blot for total ERK1 and ERK2 protein, or tubulin protein expression.









C2C12
si on siERK1 siERK2


-ERK1
-ERK2

-pERKI
-pERK2


a-tubulin


o siCon
* siERK1
m siERK2


ERK1 ERK2 pERK1 pERK2


Figure 4-4. Stable expression of siRNA directed against ERK1 or ERK2 reduces ERK1/2 protein
levels. A) C2C12 myoblasts were selected for stable expression of a siRNA against
ERK1, ERK2 or scambled control oligonucleotide. Total protein isolates were
harvested and analyzed by Western blot for total ERK1 and ERK2 protein, active
ERK1/2 or tubulin protein expression. B) Scanning densitometry was used to qualify
the reduction in protein production. Data represent means and standard errors for
three impendent experiments.












S12 OpCS2MT

.. 10 OpCS2MT-RafBXB

s
<; 8-

6 6

o 4

2

0 -
siCon siERK 1 siERK2


Figure 4-5. Knockdown of ERK1 or ERK2 affects API luciferase activity. C2C12siCon, C2C12
siERK and C2C12siERK2 myoblasts were transiently transfected with APl-Luc,
pRLtk, and pCS2+MT or pCS2+MT-RafBXB. Luciferase activities were measures
after 48 h in culture. Relative AP1-Luc was calculated as AP1-Luc/pRLtk. Data
represent means and standard errors for three impendent experiments.










5.5 -


5.0 -


4.5 -


4.0 -


3.5 -


-0- siCon


-- siERKI

-- siERK2


0.00 24.00 48.00 72.00 96.00 108.00
Time


Figure 4-6. Knockdown of ERK1 or ERK2 does not prevent myoblast proliferation.
C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were seeded at equal
density and cultures in reduced serum medium for 5 days, cell numbers were
measured daily.











D Control
D FGF2
* IGF-I


siCon


siERKI


- T


siERK2


Figure 4-7. Knockdown of ERK1 or ERK2 does not affect the mitogenic response. C2C12siCon,
C2C12siERK1 and C2C12siERK2 myoblasts were cultured as described for 48 h in
the presence or absence of 5 ng/mL FGF2 or 250 ng/mL IGF-I. Thirty minutes prior
to fixation, cekks were pulsed with BrdU. Immunopositive BrdU nuclei and total
nuclei were counted. Mitotic index was calculated as [BrdU(+)/total]*100. Means and
standard errors of three independent experiments are shown.


100


T










C2C12siERK1 C2C12siERK2


-MyHC






Hoescht






Figure 4-8. ERK2 deficiency leads to myogenic arrest. C2C12siCon, C2C12siERK1 and
C2C12siERK2 myoblasts were cultured in differentiation-permissive medium for 48
h prior to fixation and immunostaining for myosin heavy chain. Total nuclei were
visualized by Hoechst stain.


C2C 12siCon
























Differentiation


E siCon
D siERK1
* siERK2


T


__ _ I ___ .


Fusion


Figure 4-9. ERK2 deficiency leads to repression of differentiation and fusion of myoblasts.
C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were cultured in
differentiation-permissive medium for 48 h prior to fixation and immunostaining for
myosin heavy chain. Total nuclei were visualized by Hoechst stain. A differentiation
index was calculated as the number of nuclei in MyHC(+) fibers/total nuclei*100. A
fusion index was calculated as the number of fibers containing a minimum of two
nuclei divided by total nuclei.









C2C12 siERK2

- PD98059 +PD98059


ERK1
ERK2

pERK1
pERK2


km Ict-tubulin
9:0 P750 = ...........


Figure 4-10. Treatment with PD98059 inhibits activation of ERK1/2 and active ERK1/2.
C2C12siERK2 myoblasts were differentiated for 48 h in the presence or absence of
25 pM PD98059. Cultures were lysed lysed and equal amounts of protein were
analysed by Western for total ERK1/2 protein, active ERK1/2 protein or tubulin
protein expression.











10

Ilk








-PD\8059 +PD98059











-PD98059 +PD98059


Figure 4-11. Treatment with PD98059 does not affect C2C12siERK2 differentiation.
C2C12siERK2 myoblasts were differentiated for 48 h in the presence or absence of
25 pM PD98059. Myoblasts were fixed and immunostained for MyHC. Total nuclei
were visualized by Hoechst stain.


ca-MyHC











Hoescht








C2C12


siERKI siERK2


a(-MyHC

a-myogenin

a-troponin


- i,,~rrC


1a-desmin

a -tubulin

Figure 4-12. ERK2 deficiency causes a reduction in myogenin protein expression. C2C12siCon,
C2C12siERK1 and C2C12siERK2 myoblasts were maintained in differentiation
medium for 48 h. Cultures were lysed and equal amounts of protein were analyzed by
Western for myosin heavy chain, myogenin, troponin, desmin and tubulin.


I
siCon












- IGF-I


+ IGF-I


I I
siERK1 siERK2 siCon siERK1 siERK2


e o


e -. I -myogenin


---- -


o-desmin


mm. u n:. IS -tubulin


160

120

80

" 40


l IGF-I
U + IGF-I


siCon siERKI siERK2


Figure 4-13. ERK2 deficiency causes reduced myogenin expression in C2C12siERK2
myoblasts is partially restored by IGF-I treatment. C2C12siCon, C2C12siERK1
and C2C12siERK2 myoblasts were maintained in differentiation medium for 48 h
in presence or absence of 250 ng/mL IGF-I. Cultures were lysed and equal
amounts of protein were analyzed by Western for myogenin, desmin and tubulin
(A). The relative amounts of myogenin protein were measured by scanning
densitometry and ImageQuant software analysis. Myogenin content was
normalized to a-tubulin (B). Results are means and standard errors of three
independent analyses.


I
siCon
















a-MyHC


(-) IGF-I


Hoescht





a-MyHC


(+) IGF-I





Figure 4-14. IGF-I treatment improves the differentiation capabilities of C2C12siERK2
myoblasts. C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were
differentiated in the presence or absence of 250 ng/mL IGF-I for 48 h. The cells
were fixed and immunostained for myosin heavy chain expression.














40 -

30

20


Ol- IGF-I
* + IGF-I


siCon siERKI


siERK2


Figure 4-15. Myotube fusion index of IGF-I treated myoblasts. C2C12siCon, C2C12siERK1
and C2C12siERK2 myoblasts were differentiated in the presence or absence of
250 ng/mL IGF-I for 48 h. The cells were fixed and immunostained for myosin
heavy chain expression. The numbers of myofiber nuclei and total nuclei were
counted in 10 random microscope fields under 200x. Fusion index was calculated
as the number of MyHC(+) fibers containing two or more nuclei/total number of
nuclei (x100). Means and standard errors of means from three independent
experiments are shown.










O IGF-I

* + IGF-I


T


siERK1 siERK2


Figure 4-16. Differentiation index of IGF-I treated myoblasts. C2C12siCon, C2C12siERK1
and C2C12siERK2 myoblasts were differentiated in the presence or absence of
250 ng/mL IGF-I for 48 h. The cells were fixed and immunostained for myosin
heavy chain expression. The numbers of myofiber nuclei were and total nuclei
were counted in 10 random microscope fields under 200x. Differentiation index
was calculated as MyHC(+) nuclei/total nucleix100. Means and standard errors of
means from three independent experiments are shown.


siCon









IGF-I + IGF-I
siCon siERK1 siERK2 siCon siERK1 siERK2
-4 s Mm v~~ (-Akt


o X-phosphoAkt

q im a -tubulin

Figure 4-17. ERK2 insufficiency does not disrupt IGF-I induced Akt phosphorylation.
C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were differentiated in the
presence or absence of 250 ng/mL IGF-I for 48 h prior to lysis. Equal amounts of
protein were analyzed by Western blot for total and phosphorylated Akt and tubulin.
IGF-I stimulates phosphorylation of Akt in all cell types.













a-MyHC





Hoescht





a-MyHC





Hoescht


(-)FGF2











(+) FGF2


Figure 4-18. FGF2 requires one functional ERK isoform to inhibit myogenic differentiation.
C2C12siCon, C2C12siERK1 and C2C12siERK2 myoblasts were treated for 48 h
differentiation -permissive medium supplemented with 5 ng/mL FGF2. Cultures were
fixed and immunostained for myosin heavy chain expression.


1/AOO13o6JUDV












_L


siCon


D FGF2
O + FGF2


siERK1


siERK2


Figure 4-19. Differentiation index of FGF2 treated myoblasts. C2C12siCon, C2C12siERK1 and
C2C12siERK2 myoblasts were treated for 48 h in differentiation-permissive medium
supplemented with 5 ng/mL FGF2. Cultures were fixed and immunostained for
myosin heavy chain expression. A differentiation index was calculated as the number
of nuclei in MyHC(+) fiber/total number of nuclei x100.









+ + + PD98059


+ + + + + + FGF2
siCon siERK1 siERK2 siCon siERK1 siERK2 siCon siERK1 siERK2
ar I w ": -I ,^ 1 a-MyHC

a-myogenin

S- a-tubulin

Figure 4-20. FGF2 inhibits myogenic differentiation through either ERK isoform. Parallel cultures
of C2C12siCon, C2C12siERK1 and C2C12siERK2 were treated with 25 PM PD98059
or DMSO. Lysates were analyzed by Western for myosin heavy chain, myogenin and
tubulin.









CHAPTER 5
DISCUSSION

ERK2 is obligatory for trophoblast proliferation, mesoderm differentiation, and protection

from apoptosis, in vivo [74; 119;159;210;210]. A dual role as a modulator of both proliferation

and differentiation is reflected in myoblasts that are deficient in ERK2.

With regards to cell division, C2C12siERK2 myoblasts divide at a slower rate than ERK1

knockdown or control muscle cells. The reduced rate of proliferation by these cells is evident at

low density whereby, the myoblasts have an extended doubling time of 2 h by comparison to

controls. Interestingly, as the cells increase in density, a critical number is reached such that

growth rates are comparable to control cells. This would argue that low-density C2C12siERK2

myoblasts are unable to produce, secrete, and/or respond to a factor needed for optimal growth.

Alternatively, ERK2 deficient myoblasts may be more susceptible to apoptosis. ERK2 null

embryos display elevated numbers of apoptotic cells that may be attributed to a failure to

generate mesoderm [210]. We did not measure apoptosis directly, however, no striking increases

in pycnotic nuclei or detached cells were observed in C2C12siERK2 myoblasts. The slower

growth rate of myoblasts devoid of ERK2 also argues that ERK1 is unable to compensate for the

proliferative effects of the ERK2 isoform. In myoblasts that contain adequate to elevated levels

of functional ERK 1, no detectable increase in growth rate or numbers of cells in S-phase was

observed. These results are similar to those found in the ERK2 null embryo; pulse labeling

studies demonstrated that wild-type and ERK2(-/-) embryos incorporated BrdU at equivalent

rates and levels [210]. The mitogenic actions of ERK2 are further substantiated by reports that

ERKI(-/-) mice are viable, fertile, and of normal size [116]. Our results demonstrate that loss of

ERK2 causes a reduction in growth rate without altering the levels of phosphorylated or

activated ERK1. Therefore, ERK1 cannot substitute for ERK2 as a modulator of cell division.









The most prominent feature of ERK2 deficient myoblasts is their inability to form large

multinucleated myofibers. C2C12siERK2 myoblasts undergo suboptimal differentiation that is

characterized by a 50% reduction in the numbers of myosin expressing cells. Western blot

analysis indicates that these myoblasts retain their myogenic identity as measured by their

unperturbed expression of desmin. C2C12siERK2 muscle fibers are stunted and typified by a

single myonuclei. The differentiation-defective phenotype is accredited to compromised ERK2

expression as treatment with a chemical inhibitor to prevent ERK1 activity does not re-establish

muscle gene expression and morphological differentiation. Myogenin is required for terminal

differentiation of myoblasts and myogenin (-/-) mice contain no myofibers [7; 129; 191]. ERK2

knockdown myoblasts produce limited amounts of myogenin protein and as predicted, the

myoblasts are differentiation defective. The block to myofiber formation may be partially

attributed to reduced myogenin expression. Supplementation of the culture medium with

recombinant IGF-I restores myogenin protein synthesis to levels comparable to controls.

However, the C2C12siERK2 myoblasts remain differentiation defective. An increase in the

numbers of myofibers (>3 myonuclei) is observed but these numbers are 60% lower than

controls. Interestingly, C2C12siERK1 myoblasts that synthesize abundant amounts of ERK2 are

more responsive to the actions of IGF-I. A 2-fold increase in the number of myonuclei found

within mature fibers is noted. These results argue that ERK2 is necessary for myoblast fusion;

loss of ERK2 inhibits fusion and overproduction of ERK2 promotes myogenesis.

Multiple reports detail growth factor induction of ERK1/2 activity that leads to an

inhibition of myogenesis. Myostatin stimulates ERK1/2 phosphorylation that suppresses

myogenin expression in a MEK-dependent manner [209]. Leukemia inhibitory factor (LIF)

utilizes the Raf/MEK/ERK signaling cascade to inhibit C2C12 differentiation and repression is









relieved upon treatment with a MEK inhibitor [81]. FGF2, an ERK1/2 agonist, is regarded as a

potent inhibitor of myogenesis [134]. FGF2 initiated ERK1/2 phosphorylation in C2C12

myoblasts and 23A2 myoblasts severely impairs biochemical and morphological measures of

muscle differentiation; inhibition of ERK1/2 activation reinstates the muscle gene program

[179; 197]. Our myoblast cell lines that are deficient in either ERK1 or ERK2 are responsive to

the repressive actions of FGF2. Both C2C12siERK1 and C2C12siERK2 myoblasts fail to

express markers of the terminal differentiation program in the presence of FGF2. The ability of

FGF2 to severely restrict myogenesis in the ERK deficient myoblasts indicates that the growth

factor indiscriminately utilizes either kinase isoform. Further support for this premise is

demonstrated by restoration of myosin heavy chain and myogenin synthesis upon treatment with

PD98059, a chemical MEK inhibitor. The restoration of myosin and myogenin expression does

not reproduce wild-type levels thereby, suggesting that FGF2 uses additional signaling

mechanism to impede myogenesis in its entirety.









CHAPTER 6
IMPLICATIONS

Skeletal muscle is the largest tissue in the body representing 70% of the body mass. It is

responsible for the stability of body posture and body movement. Skeletal muscle cell

differentiation is a complex system that is highly regulated. Many growth factors and hormones

can control this process through activation of various intracellular signaling pathways. Among

these signaling cascades, the ERK1/2 pathway is a key regulator of skeletal myogenesis.

The ERK1/2 signaling pathway plays an important role in skeletal muscle development,

and is involved in the postnatal muscle growth, muscle repair and hypertrophy. This research

focuses on the mechanism of how ERK1/2 work in vitro, which has potential use in human

health and the meat industry.

Skeletal muscle hypertrophy and hyperplasia are two mechanisms that lead to an increase

in muscle mass. Many signaling pathways are involved in this process. Naturally or induced

mutations in some signal molecules can promote this process to increase muscle mass. For

example, myostatin, a member of TGF-3 family, is an inhibitor of muscle differentiation.

Mutation of myostatin can result in a heritable "double muscle" phenotype in cattle. Compared

with normal cattle, myostatin-null cattle have an increased proficiency to convert feed into lean

muscle and produce high quality meat with less bone, less fat and 20% more lean muscle on

average [86]. From this study, ERK2 is required for myoblast differentiation. The ERK1-

deficient myoblast can fuse into fibers twice the size as control myoblast in response to IGF-I.

This may be due to the ability of these cells to produce higher amount of ERK2. Thus, ERK2









overexpression may be associated with muscle hypertrophy. When ERK2 is over-produced or

has a higher level of phosphorylation, animals may have the similar muscle-hypertrophy

phenotype. The advantage of the ERK2-induced hypertrophy is no extra hormone supplement is

needed. This may bring a big benefit for the animal science and meat production.

Advanced age is associated with skeletal muscle atrophy. As people get older, there is a

decrease in muscle mass as well as muscle function. There are age-related impairments in the

muscle responsiveness to overload and injury. Genetic researchers suggest muscle-derived IGF-I

instead of hepatic IGF-I is an important factor in maintaining muscle mass and repairing muscle

damage in old age. As muscle gets older, there is an age-related decrease in the IGF-I response

[55]. Based on this work, IGF-I can induce a higher level of myoblast differentiation in the

ERK2 overexpressed myoblast. When ERK2 activity is higher in the aged muscle, there may be

an increase in muscle mass and repair capability. As a result, age-associated muscle atrophy may

be reduced through increasing ERK2 activity in skeletal muscle.

However, this work only focuses on the function of ERK2 in the cultured myoblast. It is

crucial to build an in vivo model to verify the data from the in vitro experiments. An animal

model with ERK2 protein knockdown or overexpression in skeletal muscle is a more powerful

tool for examination of ERK2 function in vivo.









LIST OF REFERENCES


[1] Adams RH, Porras A, Alonso G, Jones M, Vintersten K, Panelli S, Valladares A,
Perez L, Klein R, Nebreda AR. Essential role of p38alpha MAP kinase in placental but not
embryonic cardiovascular development. Mol Cell. 2000; 6(1):109-16.

[2] Adi S, Bin-Abbas B, Wu NY, Rosenthal SM. Early stimulation and late inhibition
of extracellular signal-regulated kinase 1/2 phosphorylation by IGF-I: a potential
mechanism mediating the switch in IGF-I action on skeletal muscle cell differentiation.
Endocrinology 2002; 143: 511-516.

[3] Adjei AA. Blocking oncogenic Ras signaling for cancer therapy. J. Natl. Cancer
Inst. 2001; 93: 1062-1074.

[4] Al Khalili L, Bouzakri K, Glund S, Lonnqvist F, Koistinen HA, Krook A.
Signaling specificity of interleukin-6 action on glucose and lipid metabolism in skeletal
muscle. Mol. Endocrinol. 2006.

[5] Allen RE, Rankin LL, Greene EA, Boxhorn LK, Johnson SE, Taylor RG, Pierce
PR. Desmin is present in proliferating rat muscle satellite cells but not in bovine muscle
satellite cells. J. Cell Physiol 1991; 149: 525-535.

[6] Allen RE, Sheehan SM, Taylor RG, Kendall TL, Rice GM. Hepatocyte growth
factor activates quiescent skeletal muscle satellite cells in vitro. J. Cell Physiol 1995; 165:
307-312.

[7] Arnold HH, Braun T. Targeted inactivation of myogenic factor genes reveals their
role during mouse myogenesis: a review. Int. J. Dev. Biol. 1996; 40: 345-353.

[8] Baeza-Raja B, Munoz-Canoves P. p38 MAPK-induced nuclear factor-kappaB
activity is required for skeletal muscle differentiation: role of interleukin-6. Mol. Biol. Cell
2004; 15: 2013-2026.

[9] Bain G, Engel I, Robanus Maandag EC, te Riele HP, Voland JR, Sharp LL, Chun
J, Huey B, Pinkel D, Murre C. E2A deficiency leads to abnormalities in alphabeta T-cell
development and to rapid development of T-cell lymphomas. Mol. Cell Biol. 1997; 17:
4782-4791.

[10] Bain G, Maandag EC, Izon DJ, Amsen D, Kruisbeek AM, Weintraub BC, Krop I,
Schlissel MS, Feeney AJ, van Roon M, E2A proteins are required for proper B cell
development and initiation of immunoglobulin gene rearrangements. Cell 1994; 79: 885-
892.

[11] Bajard L, Relaix F, Lagha M, Rocancourt D, Daubas P, Buckingham ME. A
novel genetic hierarchy functions during hypaxial myogenesis: Pax3 directly activates
Myf5 in muscle progenitor cells in the limb. Genes Dev. 2006; 20: 2450-2464.









[12] Baumann B, Weber CK, Troppmair J, Whiteside S, Israel A, Rapp UR, Wirth T.
Raf induces NF-kappaB by membrane shuttle kinase MEKK1, a signaling pathway critical
for transformation. Proc. Natl. Acad. Sci. U. S. A 2000; 97: 4615-4620.

[13] Beauchamp JR, Heslop L, Yu DS, Tajbakhsh S, Kelly RG, Wernig A,
Buckingham ME, Partridge TA, Zammit PS. Expression of CD34 and Myf5 defines the
majority of quiescent adult skeletal muscle satellite cells. J. Cell Biol. 2000; 151: 1221-
1234.

[14] Belanger LF, Roy S, Tremblay M, Brott B, Steff AM, Mourad W, Hugo P,
Erikson R, Charron J. Mek2 is dispensable for mouse growth and development. Mol. Cell
Biol. 2003; 23: 4778-4787.

[15] Bladt F, Riethmacher D, Isenmann S, Aguzzi A, Birchmeier C. Essential role for
the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature
1995; 376: 768-771.

[16] Bober E, Lyons GE, Braun T, Cossu G, Buckingham M, Arnold HH. The muscle
regulatory gene, Myf-6, has a biphasic pattern of expression during early mouse
development. J. Cell Biol. 1991; 113: 1255-1265.

[17] Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R,
Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, Yancopoulos GD. Akt/mTOR
pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle
atrophy in vivo. Nat. Cell Biol. 2001; 3: 1014-1019.

[18] Brand-Saberi B, Christ B. Genetic and epigenetic control of muscle development
in vertebrates. Cell Tissue Res. 1999; 296: 199-212.

[19] Braun T, Arnold HH. Inactivation of Myf-6 and Myf-5 genes in mice leads to
alterations in skeletal muscle development. EMBO J. 1995; 14: 1176-1186.

[20] Braun T, Rudnicki MA, Arnold HH, Jaenisch R. Targeted inactivation of the
muscle regulatory gene Myf-5 results in abnormal rib development and perinatal death.
Cell 1992; 71: 369-382.

[21] Brunet A, Brondello JM, L'Allemain G, Lenormand P, McKenzie F, Pages G,
Pouyssegur J. [MAP kinase module: role in the control of cell proliferation]. C. R. Seances
Soc. Biol. Fil. 1995; 189: 43-57.

[22] Brunet A, Roux D, Lenormand P, Dowd S, Keyse S, Pouyssegur J. Nuclear
translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-
induced gene expression and cell cycle entry. EMBO J. 1999; 18: 664-674.

[23] Bueno OF, Molkentin JD. Involvement of extracellular signal-regulated kinases
1/2 in cardiac hypertrophy and cell death. Circ. Res. 2002; 91: 776-781.









[24] Chen WS, Xu PZ, Gottlob K, Chen ML, Sokol K, Shiyanova T, Roninson I,
Weng W, Suzuki R, Tobe K, Kadowaki T, Hay N. Growth retardation and increased
apoptosis in mice with homozygous disruption of the Aktl gene. Genes Dev. 2001; 15:
2203-2208.

[25] Cheng TC, Tseng BS, Merlie JP, Klein WH, Olson EN. Activation of the
myogenin promoter during mouse embryogenesis in the absence of positive autoregulation.
Proc. Natl. Acad. Sci. U. S. A 1995; 92: 561-565.

[26] Cho H, Mu J, Kim JK, Thorvaldsen JL, Chu Q, Crenshaw EB, III, Kaestner KH,
Bartolomei MS, Shulman GI, Bimbaum MJ. Insulin resistance and a diabetes mellitus-like
syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science. 2001; 292(5522):
1728-31

[27] Coleman ME, DeMayo F, Yin KC, Lee HM, Geske R, Montgomery C, Schwartz
RJ. Myogenic vector expression of insulin-like growth factor I stimulates muscle cell
differentiation and myofiber hypertrophy in transgenic mice. J. Biol. Chem. 1995; 270:
12109-12116.

[28] Conway K, Pin C, Kiernan JA, Merrifield P. The E protein HEB is preferentially
expressed in developing muscle. Differentiation 2004; 72: 327-340.

[29] Coolican SA, Samuel DS, Ewton DZ, McWade FJ, Florini JR. The mitogenic and
myogenic actions of insulin-like growth factors utilize distinct signaling pathways. J. Biol.
Chem. 1997; 272: 6653-6662.

[30] Cooney RN, Maish GO, III, Gilpin T, Shumate ML, Lang CH, Vary TC.
Mechanism of IL-1 induced inhibition of protein synthesis in skeletal muscle. Shock 1999;
11:235-241.

[31] Cooper RN, Tajbakhsh S, Mouly V, Cossu G, Buckingham M, Butler-Browne
GS. In vivo satellite cell activation via Myf5 and MyoD in regenerating mouse skeletal
muscle. J. Cell Sci.1999; 112(17): 2895-2901.

[32] Cornelison DD, Filla MS, Stanley HM, Rapraeger AC, Olwin BB. Syndecan-3
and syndecan-4 specifically mark skeletal muscle satellite cells and are implicated in
satellite cell maintenance and muscle regeneration. Dev. Biol. 2001; 239: 79-94.

[33] Cornelison DD, Olwin BB, Rudnicki MA, Wold BJ. MyoD(-/-) satellite cells in
single-fiber culture are differentiation defective and MRF4 deficient. Dev. Biol. 2000; 224:
122-137.

[34] Cornelison DD, Wilcox-Adelman SA, Goetinck PF, Rauvala H, Rapraeger AC,
Olwin BB. Essential and separable roles for Syndecan-3 and Syndecan-4 in skeletal muscle
development and regeneration. Genes Dev. 2004; 18: 2231-2236.









[35] Cowley S, Paterson H, Kemp P, Marshall CJ. Activation of MAP kinase kinase is
necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells.
Cell 1994; 77: 841-852.

[36] Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of
glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 1995; 378:
785-789.

[37] Daubas P, Tajbakhsh S, Hadchouel J, Primig M, Buckingham M. Myf5 is a novel
early axonal marker in the mouse brain and is subjected to post-transcriptional regulation
in neurons. Development 2000; 127: 319-331.

[38] De Angelis L, Borghi S, Melchionna R, Berghella L, Baccarani-Contri M, Parise
F, Ferrari S, Cossu G. Inhibition of myogenesis by transforming growth factor beta is
density-dependent and related to the translocation of transcription factor MEF2 to the
cytoplasm. Proc. Natl. Acad. Sci. U. S. A 1998; 95: 12358-12363.

[39] De Angelis L, Zhao J, Andreucci JJ, Olson EN, Cossu G, McDermott JC.
Regulation of vertebrate myotome development by the p38 MAP kinase-MEF2 signaling
pathway. Dev. Biol. 2005; 283: 171-179.

[40] Deak M, Clifton AD, Lucocq LM, Alessi DR. Mitogen- and stress-activated
protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may
mediate activation of CREB. EMBO J. 1998; 17: 4426-4441.

[41] DeChant AK, Dee K, Weyman CM. Raf-induced effects on the differentiation and
apoptosis of skeletal myoblasts are determined by the level of Raf signaling: abrogation of
apoptosis by Raf is downstream of caspase 3 activation. Oncogene 2002; 21: 5268-5279.

[42] Dee K, Freer M, Mei Y, Weyman CM. Apoptosis coincident with the
differentiation of skeletal myoblasts is delayed by caspase 3 inhibition and abrogated by
MEK-independent constitutive Ras signaling. Cell Death. Differ. 2002; 9: 209-218.

[43] DeVol DL, Rotwein P, Sadow JL, Novakofski J, Bechtel PJ. Activation of
insulin-like growth factor gene expression during work-induced skeletal muscle growth.
Am. J. Physiol 1990; 259: E89-E95.

[44] Dorman CM, Johnson SE. Activated Raf inhibits avian myogenesis through a
MAPK-dependent mechanism. Oncogene 1999; 18: 5167-5176.

[45] Edmondson DG, Cheng TC, Cserjesi P, Chakraborty T, Olson EN. Analysis of
the myogenin promoter reveals an indirect pathway for positive autoregulation mediated
by the muscle-specific enhancer factor MEF-2. Mol. Cell Biol. 1992; 12: 3665-3677.

[46] Enslen H, Brancho DM, Davis RJ. Molecular determinants that mediate selective
activation of p38 MAP kinase isoforms. EMBO J. 2000; 19: 1301-1311.









[47] Errede B, Cade RM, Yashar BM, Kamada Y, Levin DE, Irie K, Matsumoto K.
Dynamics and organization of MAP kinase signal pathways. Mol. Reprod. Dev. 1995; 42:
477-485.

[48] Evans WJ. Protein nutrition, exercise and aging. J. Am. Coll. Nutr. 2004; 23:
601S-609S.

[49] Fedorov YV, Rosenthal RS, Olwin BB. Oncogenic Ras-induced proliferation
requires autocrine fibroblast growth factor 2 signaling in skeletal muscle cells. J. Cell Biol.
2001; 152: 1301-1305.

[50] Fernandez AM, Dupont J, Farrar RP, Lee S, Stannard B, Le Roith D. Muscle-
specific inactivation of the IGF-I receptor induces compensatory hyperplasia in skeletal
muscle. J. Clin. Invest 2002; 109: 347-355.

[51] Ferrell JE, Jr. Tripping the switch fantastic: how a protein kinase cascade can
convert graded inputs into switch-like outputs. Trends Biochem. Sci. 1996; 21: 460-466.

[52] Filvaroff EH, Ebner R, Derynck R. Inhibition of myogenic differentiation in
myoblasts expressing a truncated type II TGF-beta receptor. Development 1994; 120:
1085-1095.

[53] Flanagan-Steet H, Hannon K, McAvoy MJ, Hullinger R, Olwin BB. Loss of FGF
receptor 1 signaling reduces skeletal muscle mass and disrupts myofiber organization in
the developing limb. Dev. Biol. 2000; 218: 21-37.

[54] Florini JR, Ewton DZ, Coolican SA. Growth hormone and the insulin-like growth
factor system in myogenesis. Endocr. Rev. 1996; 17: 481-517.

[55] Florini JR, Ewton DZ, Magri KA. Hormones, growth factors, and myogenic
differentiation. Annu. Rev. Physiol 1991; 53: 201-216.

[56] Fowden AL. Endocrine regulation of fetal growth. Reprod. Fertil. Dev. 1995; 7:
351-363.

[57] Frisch H. Growth hormone and body composition in athletes. J. Endocrinol.
Invest 1999; 22: 106-109.

[58] Fujii N, Boppart MD, Dufresne SD, Crowley PF, Jozsi AC, Sakamoto K, Yu H,
Aschenbach WG, Kim S, Miyazaki H, Rui L, White MF, Hirshman MF, Goodyear LJ.
Overexpression or ablation of JNK in skeletal muscle has no effect on glycogen synthase
activity. Am. J. Physiol Cell Physiol 2004; 287: C200-C208.

[59] Fukuda M, Gotoh I, Adachi M, Gotoh Y, Nishida E. A novel regulatory
mechanism in the mitogen-activated protein (MAP) kinase cascade. Role of nuclear export
signal of MAP kinase kinase. J. Biol. Chem. 1997; 272: 32642-32648.









[60] Fukuda M, Gotoh Y, Nishida E. Interaction of MAP kinase with MAP kinase
kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase.
EMBO J. 1997; 16: 1901-1908.

[61] Gal-Levi R, Leshem Y, Aoki S, Nakamura T, Halevy O. Hepatocyte growth
factor plays a dual role in regulating skeletal muscle satellite cell proliferation and
differentiation. Biochim. Biophys. Acta 1998; 1402: 39-51.

[62] Giroux S, Tremblay M, Bernard D, Cardin-Girard JF, Aubry S, Larouche L,
Rousseau S, Huot J, Landry J, Jeannotte L, Charron J. Embryonic death of Mekl-deficient
mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the
placenta. Curr. Biol. 1999; 9: 369-372.

[63] Glass DJ. Molecular mechanisms modulating muscle mass. Trends Mol. Med.
2003; 9: 344-350.

[64] Gong X, Wang X, Han J, Niesman I, Huang Q, Horwitz J. Development of
cataractous macrophthalmia in mice expressing an active MEK1 in the lens. Invest
Ophthalmol. Vis. Sci. 2001; 42: 539-548.

[65] Gossett LA, Kelvin DJ, Sternberg EA, Olson EN. A new myocyte-specific
enhancer-binding factor that recognizes a conserved element associated with multiple
muscle-specific genes. Mol. Cell Biol. 1989; 9: 5022-5033.

[66] Grayson J, Bassel-Duby R, Williams RS. Collaborative interactions between
MEF-2 and Spl in muscle-specific gene regulation. J. Cell Biochem. 1998; 70: 366-375.

[67] Gredinger E, Gerber AN, Tamir Y, Tapscott SJ, Bengal E. Mitogen-activated
protein kinase pathway is involved in the differentiation of muscle cells. J. Biol. Chem.
1998; 273: 10436-10444.

[68] Guttridge DC, Mayo MW, Madrid LV, Wang CY, Baldwin AS, Jr. NF-kappaB-
induced loss of MyoD messenger RNA: possible role in muscle decay and cachexia.
Science 2000; 289: 2363-2366.

[69] Hagemann C, Rapp UR. Isotype-specific functions ofRaf kinases. Exp. Cell Res.
1999; 253: 34-46.

[70] Halevy O, Cantley LC. Differential regulation of the phosphoinositide 3-kinase
and MAP kinase pathways by hepatocyte growth factor vs. insulin-like growth factor-I in
myogenic cells. Exp. Cell Res. 2004; 297: 224-234.

[71] Hara K, Yonezawa K, Kozlowski MT, Sugimoto T, Andrabi K, Weng QP,
Kasuga M, Nishimoto I, Avruch J. Regulation of eIF-4E BP1 phosphorylation by mTOR.
J. Biol. Chem. 1997; 272: 26457-26463.

[72] Hardt SE, Sadoshima J. Glycogen synthase kinase-3beta: a novel regulator of
cardiac hypertrophy and development. Circ. Res. 2002; 90: 1055-1063.









[73] Hasty P, Bradley A, Morris JH, Edmondson DG, Venuti JM, Olson EN, Klein
WH. Muscle deficiency and neonatal death in mice with a targeted mutation in the
myogenin gene. Nature 1993; 364: 501-506.

[74] Hatano N, Mori Y, Oh-hora M, Kosugi A, Fujikawa T, Nakai N, Niwa H,
Miyazaki J, Hamaoka T, Ogata M. Essential role for ERK2 mitogen-activated protein
kinase in placental development. Genes Cells. 2003; 8(11):847-56

[75] Hawke TJ, Garry DJ. Myogenic satellite cells: physiology to molecular biology. J.
Appl. Physiol 2001; 91: 534-551.

[76] Huesken D, Lange J, Mickanin C, Weiler J, Asselbergs F, Warner J, Meloon B,
Engel S, Rosenberg A, Cohen D, Labow M, Reinhardt M, Natt F, Hall J. Design of a
genome-wide siRNA library using an artificial neural network. Nat. Biotechnol. 2005; 23:
995-1001.

[77] Irintchev A, Zeschnigk M, Starzinski-Powitz A, Wemig A. Expression pattern of
M-cadherin in normal, denervated, and regenerating mouse muscles. Dev. Dyn. 1994; 199:
326-337.

[78] Isaksson OG, Lindahl A, Nilsson A, Isgaard J. Action of growth hormone: current
views. Acta Paediatr. Scand. Suppl 1988; 343: 12-18.

[79] Izquierdo M, Hakkinen K, Anton A, Garrues M, Ibanez J, Ruesta M, Gorostiaga
EM. Maximal strength and power, endurance performance, and serum hormones in
middle-aged and elderly men. Med Sci Sports Exerc. 2001; 33(9):1577-87.

[80] Jiang BH, Aoki M, Zheng JZ, Li J, Vogt PK. Myogenic signaling of
phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B.
Proc. Natl. Acad. Sci. U. S. A 1999; 96: 2077-2081.

[81] Jo C, Kim H, Jo I, Choi I, Jung SC, Kim J, Kim SS, Jo SA. Leukemia inhibitory
factor blocks early differentiation of skeletal muscle cells by activating ERK. Biochim.
Biophys. Acta 2005; 1743: 187-197.

[82] Johnson SE, Dorman CM, Bolanowski SA. Inhibition of myogenin expression by
activated Raf is not responsible for the block to avian myogenesis. J. Biol. Chem. 2002;
277: 28742-28748.

[83] Jones NC, Fedorov YV, Rosenthal RS, Olwin BB. ERK1/2 is required for
myoblast proliferation but is dispensable for muscle gene expression and cell fusion. J.
Cell Physiol 2001; 186: 104-115.

[84] Jones NC, Tyner KJ, Nibarger L, Stanley HM, Comelison DD, Fedorov YV,
Olwin BB. The p38{alpha}/{beta} MAPK functions as a molecular switch to activate the
quiescent satellite cell. J. Cell Biol. 2005; 169: 105-116.









[85] Kaliman P, Vinals F, Testar X, Palacin M, Zorzano A. Phosphatidylinositol 3-
kinase inhibitors block differentiation of skeletal muscle cells. J. Biol. Chem. 1996; 271:
19146-19151.

[86] Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in myostatin (GDF8) in
double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 1997; 7: 910-916.

[87] Kasler HG, Victoria J, Duramad O, Winoto A. ERK5 is a novel type of mitogen-
activated protein kinase containing a transcriptional activation domain. Mol. Cell Biol.
2000; 20: 8382-8389.

[88] Kato Y, Kravchenko VV, Tapping RI, Han J, Ulevitch RJ, Lee JD. BMK1/ERK5
regulates serum-induced early gene expression through transcription factor MEF2C.
EMBO J. 1997; 16: 7054-7066.

[89] Kaufman SJ, Foster RF. Replicating myoblasts express a muscle-specific
phenotype. Proc. Natl. Acad. Sci. U. S. A 1988; 85: 9606-9610.

[90] Kerkhoff E, Rapp UR. High-intensity Raf signals convert mitotic cell cycling into
cellular growth. Cancer Res. 1998; 58: 1636-1640.

[91] Khurana A, Dey CS. Involvement of c-Jun N-terminal kinase activities in skeletal
muscle differentiation. J. Muscle Res. Cell Motil. 2004; 25: 645-655.

[92] Knapp JR, Davie JK, Myer A, Meadows E, Olson EN, Klein WH. Loss of
myogenin in postnatal life leads to normal skeletal muscle but reduced body size.
Development 2006; 133: 601-610.

[93] Kontaridis MI, Liu X, Zhang L, Bennett AM. SHP-2 complex formation with the
SHP-2 substrate-1 during C2C12 myogenesis. J. Cell Sci. 2001; 114: 2187-2198.

[94] Kuan CY, Yang DD, Samanta Roy DR, Davis RJ, Rakic P, Flavell RA. The Jnkl
and Jnk2 protein kinases are required for regional specific apoptosis during early brain
development. Neuron 1999; 22: 667-676.

[95] Kuida K, Boucher DM. Functions of MAP kinases: insights from gene-targeting
studies. J. Biochem. (Tokyo) 2004; 135: 653-656.

[96] Lai KM, Gonzalez M, Poueymirou WT, Kline WO, Na E, Zlotchenko E, Stitt TN,
Economides AN, Yancopoulos GD, Glass DJ. Conditional activation of akt in adult
skeletal muscle induces rapid hypertrophy. Mol. Cell Biol. 2004; 24: 9295-9304.

[97] Lassar AB, Davis RL, Wright WE, Kadesch T, Murre C, Voronova A, Baltimore
D, Weintraub H. Functional activity of myogenic HLH proteins requires hetero-
oligomerization with E12/E47-like proteins in vivo. Cell 1991; 66: 305-315.

[98] Lassar AB, Munsterberg AE. The role of positive and negative signals in somite
patterning. Curr. Opin. Neurobiol. 1996; 6: 57-63.









[99] Lavoie JN, L'Allemain G, Brunet A, Muller R, Pouyssegur J. Cyclin Dl
expression is regulated positively by the p42/p44MAPK and negatively by the
p38/HOGMAPK pathway. J. Biol. Chem. 1996; 271: 20608-20616.

[100] Le Gall M, Chambard JC, Breittmayer JP, Grall D, Pouyssegur J, Obberghen-
Schilling E. The p42/p44 MAP kinase pathway prevents apoptosis induced by anchorage
and serum removal. Mol Biol Cell. 2000; 11(3):1103-12.

[101] Lehmann K, Janda E, Pierreux CE, Rytomaa M, Schulze A, McMahon M, Hill
CS, Beug H, Downward J. Raf induces TGFbeta production while blocking its apoptotic
but not invasive responses: a mechanism leading to increased malignancy in epithelial
cells. Genes Dev. 2000; 14: 2610-2622.

[102] Leshem Y, Gitelman I, Ponzetto C, Halevy O. Preferential binding of Grb2 or
phosphatidylinositol 3-kinase to the met receptor has opposite effects on HGF-induced
myoblast proliferation. Exp. Cell Res. 2002; 274: 288-298.

[103] Leshem Y, Spicer DB, Gal-Levi R, Halevy O. Hepatocyte growth factor (HGF)
inhibits skeletal muscle cell differentiation: a role for the bHLH protein twist and the cdk
inhibitor p27. J. Cell Physiol 2000; 184: 101-109.

[104] Lewis TS, Shapiro PS, Ahn NG. Signal transduction through MAP kinase
cascades. Adv. Cancer Res. 1998; 74: 49-139.

[105] Li Y, Jiang B, Ensign WY, Vogt PK, Han J. Myogenic differentiation requires
signalling through both phosphatidylinositol 3-kinase and p38 MAP kinase. Cell Signal.
2000; 12: 751-757.

[106] Lilly B, Zhao B, Ranganayakulu G, Paterson BM, Schulz RA, Olson EN.
Requirement of MADS domain transcription factor D-MEF2 for muscle formation in
Drosophila. Science 1995; 267: 688-693.

[107] Lin Q, Schwarz J, Bucana C, Olson EN. Control of mouse cardiac morphogenesis
and myogenesis by transcription factor MEF2C. Science 1997; 276: 1404-1407.

[108] Liu D, Black BL, Derynck R. TGF-beta inhibits muscle differentiation through
functional repression of myogenic transcription factors by Smad3. Genes Dev. 2001; 15:
2950-2966.

[109] Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A. Mice carrying null
mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF
receptor (Igflr). Cell 1993; 75: 59-72.

[110] Lluis F, Ballestar E, Suelves M, Esteller M, Munoz-Canoves P. E47
phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific gene
transcription. EMBO J. 2005; 24: 974-984.









[111] Loughna PT, Bates PC. Interactions between growth hormone and nutrition in
hypophysectomised rats: skeletal muscle myosin heavy chain mRNA levels. Biochem.
Biophys. Res. Commun. 1994; 198: 97-102.

[112] Lowy DR, Willumsen BM. Function and regulation of ras. Annu. Rev. Biochem.
1993; 62: 851-891.

[113] Lupu F, Terwilliger JD, Lee K, Segre GV, Efstratiadis A. Roles of growth
hormone and insulin-like growth factor 1 in mouse postnatal growth. Dev. Biol. 2001; 229:
141-162.

[114] Mathews LS, Hammer RE, Behringer RR, D'Ercole AJ, Bell GI, Brinster RL,
Palmiter RD. Growth enhancement of transgenic mice expressing human insulin-like
growth factor I. Endocrinology 1988; 123: 2827-2833.

[115] MAURO A. Satellite cell of skeletal muscle fibers. J. Biophys. Biochem. Cytol.
1961; 9: 493-495.

[116] Mazzucchelli C, Vantaggiato C, Ciamei A, Fasano S, Pakhotin P, Krezel W,
Welzl H, Wolfer DP, Pages G, Valverde O, Marowsky A, Porrazzo A, Orban PC,
Maldonado R, Ehrengruber MU, Cestari V, Lipp HP, Chapman PF, Pouyssegur J,
Brambilla R. Knockout of ERK1 MAP kinase enhances synaptic plasticity in the striatum
and facilitates striatal-mediated learning and memory. Neuron 2002; 34: 807-820.

[117] McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice
by a new TGF-beta superfamily member. Nature 1997; 387: 83-90.

[118] Megeney LA, Kablar B, Garrett K, Anderson JE, Rudnicki MA. MyoD is
required for myogenic stem cell function in adult skeletal muscle. Genes Dev. 1996; 10:
1173-1183.

[119] Meloche S, Vella FD, Voisin L, Ang SL, Saba-El-Leil M. Erk2 signaling and
early embryo stem cell self-renewal. Cell Cycle 2004; 3: 241-243.

[120] Milasincic DJ, Calera MR, Farmer SR, Pilch PF. Stimulation of C2C12 myoblast
growth by basic fibroblast growth factor and insulin-like growth factor 1 can occur via
mitogen-activated protein kinase-dependent and -independent pathways. Mol. Cell Biol.
1996; 16: 5964-5973.

[121] Minden A, Karin M. Regulation and function of the JNK subgroup of MAP
kinases. Biochim. Biophys. Acta 1997; 1333: F85-104.

[122] Moelling K, Schad K, Bosse M, Zimmermann S, Schweneker M. Regulation of
Raf-Akt Cross-talk. J. Biol. Chem. 2002; 277: 31099-31106.

[123] Molkentin JD, Black BL, Martin JF, Olson EN. Cooperative activation of muscle
gene expression by MEF2 and myogenic bHLH proteins. Cell 1995; 83: 1125-1136.









[124] Mor A, Philips MR. Compartmentalized Ras/MAPK signaling. Annu. Rev.
Immunol. 2006; 24: 771-800.

[125] Morrison DK, Cutler RE. The complexity of Raf-1 regulation. Curr. Opin. Cell
Biol. 1997; 9: 174-179.

[126] Moss FP, Leblond CP. Satellite cells as the source of nuclei in muscles of
growing rats. Anat. Rec. 1971; 170: 421-435.

[127] Mudgett JS, Ding J, Guh-Siesel L, Chartrain NA, Yang L, Gopal S, Shen MM.
Essential role for p38alpha mitogen-activated protein kinase in placental angiogenesis.
Proc. Natl. Acad. Sci. U. S. A 2000; 97: 10454-10459.

[128] Mulder KM. Role of Ras and Mapks in TGFbeta signaling. Cytokine Growth
Factor Rev. 2000; 11: 23-35.

[129] Nabeshima Y, Hanaoka K, Hayasaka M, Esumi E, Li S, Nonaka I, Nabeshima Y.
Myogenin gene disruption results in perinatal lethality because of severe muscle defect.
Nature 1993; 364: 532-535.

[130] Naya FJ, Wu C, Richardson JA, Overbeek P, Olson EN. Transcriptional activity
of MEF2 during mouse embryogenesis monitored with a MEF2-dependent transgene.
Development 1999; 126: 2045-2052.

[131] O'Neill E, Kolch W. Taming the Hippo: Raf-1 Controls Apoptosis by Suppressing
MST2/Hippo. Cell Cycle 2005; 4.

[132] Olguin HC, Olwin BB. Pax-7 up-regulation inhibits myogenesis and cell cycle
progression in satellite cells: a potential mechanism for self-renewal. Dev. Biol. 2004; 275:
375-388.

[133] Olson EN, Arnold HH, Rigby PW, Wold BJ. Know your neighbors: three
phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell 1996; 85: 1-4.

[134] Olwin BB, Hannon K, Kudla AJ. Are fibroblast growth factors regulators of
myogenesis in vivo? Prog. Growth Factor Res. 1994; 5: 145-158.

[135] Ott MO, Bober E, Lyons G, Arnold H, Buckingham M. Early expression of the
myogenic regulatory gene, myf-5, in precursor cells of skeletal muscle in the mouse
embryo. Development 1991; 111: 1097-1107.

[136] Oustanina S, Hause G, Braun T. Pax7 directs postnatal renewal and propagation
of myogenic satellite cells but not their specification. EMBO J. 2004; 23: 3430-3439.

[137] Pages G, Guerin S, Grall D, Bonino F, Smith A, Anjuere F, Auberger P,
Pouyssegur J. Defective thymocyte maturation in p44 MAP kinase (Erk 1) knockout mice.
Science 1999; 286: 1374-1377.









[138] Pallafacchina G, Calabria E, Serrano AL, Kalhovde JM, Schiaffino S. A protein
kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but
not fiber type specification. Proc. Natl. Acad. Sci. U. S. A 2002; 99: 9213-9218.

[139] Patapoutian A, Yoon JK, Miner JH, Wang S, Stark K, Wold B. Disruption of the
mouse MRF4 gene identifies multiple waves of myogenesis in the myotome. Development
1995; 121: 3347-3358.

[140] Pearson G, Robinson F, Beers GT, Xu BE, Karandikar M, Berman K, Cobb MH.
Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions.
Endocr. Rev. 2001; 22: 153-183.

[141] Pedersen BK, Steensberg A, Schjerling P. Muscle-derived interleukin-6: possible
biological effects. J. Physiol 2001; 536: 329-337.

[142] Penn BH, Bergstrom DA, Dilworth FJ, Bengal E, Tapscott SJ. A MyoD-generated
feed-forward circuit temporally patterns gene expression during skeletal muscle
differentiation. Genes Dev. 2004; 18: 2348-2353.

[143] Perry RL, Parker MH, Rudnicki MA. Activated MEK1 binds the nuclear MyoD
transcriptional complex to repress transactivation. Mol. Cell 2001; 8: 291-301.

[144] Pinset C, Garcia A, Rousse S, Dubois C, Montarras D. Wortmannin inhibits IGF-
dependent differentiation in the mouse myogenic cell line C2. C. R. Acad. Sci. III 1997;
320: 367-374.

[145] Pritchard CA, Bolin L, Slattery R, Murray R, McMahon M. Post-natal lethality
and neurological and gastrointestinal defects in mice with targeted disruption of the A-Raf
protein kinase gene. Curr. Biol. 1996; 6: 614-617.

[146] Ramocki MB, Johnson SE, White MA, Ashendel CL, Konieczny SF, Taparowsky
EJ. Signaling through mitogen-activated protein kinase and Rac/Rho does not duplicate the
effects of activated Ras on skeletal myogenesis. Mol. Cell Biol. 1997; 17: 3547-3555.

[147] Rapp UR, Goldsborough MD, Mark GE, Bonner TI, Groffen J, Reynolds FH, Jr.,
Stephenson JR. Structure and biological activity of v-raf, a unique oncogene transduced by
a retrovirus. Proc. Natl. Acad. Sci. U. S. A 1983; 80: 4218-4222.

[148] Rawls A, Morris JH, Rudnicki M, Braun T, Arnold HH, Klein WH, Olson EN.
Myogenin's functions do not overlap with those of MyoD or Myf-5 during mouse
embryogenesis. Dev. Biol. 1995; 172: 37-50.

[149] Rawls A, Valdez MR, Zhang W, Richardson J, Klein WH, Olson EN.
Overlapping functions of the myogenic bHLH genes MRF4 and MyoD revealed in double
mutant mice. Development 1998; 125: 2349-2358.









[150] Regan CP, Li W, Boucher DM, Spatz S, Su MS, Kuida K. Erk5 null mice display
multiple extraembryonic vascular and embryonic cardiovascular defects. Proc Natl Acad
Sci U S A. 2002; 99(14): 9248-53

[151] Relaix F, Montarras D, Zaffran S, Gayraud-Morel B, Rocancourt D, Tajbakhsh S,
Mansouri A, Cumano A, Buckingham M. Pax3 and Pax7 have distinct and overlapping
functions in adult muscle progenitor cells. J. Cell Biol. 2006; 172: 91-102.

[152] Relaix F, Rocancourt D, Mansouri A, Buckingham M. A Pax3/Pax7-dependent
population of skeletal muscle progenitor cells. Nature 2005; 435: 948-953.

[153] Rodriguez-Viciana P, Warne PH, Dhand R, Vanhaesebroeck B, Gout I, Fry MJ,
Waterfield MD, Downward J. Phosphatidylinositol-3-OH kinase as a direct target of Ras.
Nature 1994; 370: 527-532.

[154] Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos
GD, Glass DJ. Mediation of IGF-1-induced skeletal myotube hypertrophy by
PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways. Nat. Cell Biol. 2001; 3: 1009-1013.

[155] Rommel C, Clarke BA, Zimmermann S, Nunez L, Rossman R, Reid K, Moelling
K, Yancopoulos GD, Glass DJ. Differentiation stage-specific inhibition of the Raf-MEK-
ERK pathway by Akt. Science 1999; 286: 1738-1741.

[156] Roovers K, Assoian RK. Integrating the MAP kinase signal into the G1 phase cell
cycle machinery. Bioessays 2000; 22: 818-826.

[157] Rudnicki MA, Braun T, Hinuma S, Jaenisch R. Inactivation of MyoD in mice
leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal
muscle development. Cell 1992; 71: 383-390.

[158] Rudnicki MA, Schnegelsberg PN, Stead RH, Braun T, Arnold HH, Jaenisch R.
MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 1993; 75: 1351-
1359.

[159] Saba-El-Leil MK, Vella FD, Vernay B, Voisin L, Chen L, Labrecque N, Ang SL,
Meloche S. An essential function of the mitogen-activated protein kinase Erk2 in mouse
trophoblast development. EMBO Rep. 2003; 4: 964-968.

[160] Sabapathy K, Hu Y, Kallunki T, Schreiber M, David JP, Jochum W, Wagner EF,
Karin M. JNK2 is required for efficient T-cell activation and apoptosis but not for normal
lymphocyte development. Curr. Biol. 1999; 9: 116-125.

[161] Sabapathy K, Jochum W, Hochedlinger K, Chang L, Karin M, Wagner EF.
Defective neural tube morphogenesis and altered apoptosis in the absence of both JNK1
and JNK2. Mech. Dev. 1999; 89: 115-124.









[162] Sabapathy K, Kallunki T, David JP, Graef I, Karin M, Wagner EF. c-Jun NH2-
terminal kinase (JNK)1 and JNK2 have similar and stage-dependent roles in regulating T
cell apoptosis and proliferation. J. Exp. Med. 2001; 193: 317-328.

[163] Sassoon D, Lyons G, Wright WE, Lin V, Lassar A, Weintraub H, Buckingham M.
Expression of two myogenic regulatory factors myogenin and MyoDI during mouse
embryogenesis. Nature 1989; 341: 303-307.

[164] Schaeffer HJ, Catling AD, Eblen ST, Collier LS, Krauss A, Weber MJ. MP1: a
MEK binding partner that enhances enzymatic activation of the MAP kinase cascade.
Science 1998; 281: 1668-1671.

[165] Scholl FA, Dumesic PA, Khavari PA. Mekl alters epidermal growth and
differentiation. Cancer Res. 2004; 64: 6035-6040.

[166] Schultz E. Satellite cell proliferative compartments in growing skeletal muscles.
Dev. Biol. 1996; 175: 84-94.

[167] Schultz E, Gibson MC, Champion T. Satellite cells are mitotically quiescent in
mature mouse muscle: an EM and radioautographic study. J. Exp. Zool. 1978; 206: 451-
456.

[168] Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA.
Pax7 is required for the specification of myogenic satellite cells. Cell 2000; 102: 777-786.

[169] Sewing A, Wiseman B, Lloyd AC, Land H. High-intensity Raf signal causes cell
cycle arrest mediated by p21Cipl. Mol. Cell Biol. 1997; 17: 5588-5597.

[170] Shindoh C, Hida W, Ohkawara Y, Yamauchi K, Ohno I, Takishima T, Shirato K.
TNF-alpha mRNA expression in diaphragm muscle after endotoxin administration. Am. J.
Respir. Crit Care Med. 1995; 152: 1690-1696.

[171] Sjogren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, LeRoith D, Tornell J,
Isaksson OG, Jansson JO, Ohlsson C. Liver-derived insulin-like growth factor I (IGF-I) is
the principal source of IGF-I in blood but is not required for postnatal body growth in
mice. Proc. Natl. Acad. Sci. U. S. A 1999; 96: 7088-7092.

[172] Snow MH. A quantitative ultrastructural analysis of satellite cells in denervated
fast and slow muscles of the mouse. Anat. Rec. 1983; 207: 593-604.

[173] Sohn SJ, Sarvis BK, Cado D, Winoto A. ERK5 MAPK regulates embryonic
angiogenesis and acts as a hypoxia-sensitive repressor of vascular endothelial growth
factor expression. J. Biol. Chem. 2002; 277: 43344-43351.

[174] Sugiura N, Suga T, Ozeki Y, Mamiya G, Takishima K. The mouse extracellular
signal-regulated kinase 2 gene. Gene structure and characterization of the promoter. J.
Biol. Chem. 1997; 272: 21575-21581.









[175] Summerbell D, Halai C, Rigby PW. Expression of the myogenic regulatory factor
Mrf4 precedes or is contemporaneous with that of Myf5 in the somitic bud. Mech. Dev.
2002; 117: 331-335.

[176] Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, Kambadur R.
Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast
proliferation. J. Biol. Chem. 2000; 275: 40235-40243.

[177] Tiffin N, Adi S, Stokoe D, Wu NY, Rosenthal SM. Akt phosphorylation is not
sufficient for insulin-like growth factor-stimulated myogenin expression but must be
accompanied by down-regulation of mitogen-activated protein kinase/extracellular signal-
regulated kinase phosphorylation. Endocrinology 2004; 145: 4991-4996.

[178] Tomiya A, Aizawa T, Nagatomi R, Sensui H, Kokubun S. Myofibers express IL-6
after eccentric exercise. Am. J. Sports Med. 2004; 32: 503-508.

[179] Tortorella LL, Milasincic DJ, Pilch PF. Critical proliferation-independent window
for basic fibroblast growth factor repression of myogenesis via the p42/p44 MAPK
signaling pathway. J. Biol. Chem. 2001; 276: 13709-13717.

[180] Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones
SN, Flavell RA, Davis RJ. Requirement of JNK for stress-induced activation of the
cytochrome c-mediated death pathway. Science 2000; 288: 870-874.

[181] Tsujinaka T, Ebisui C, Fujita J, Kishibuchi M, Morimoto T, Ogawa A, Katsume
A, Ohsugi Y, Kominami E, Monden M. Muscle undergoes atrophy in association with
increase of lysosomal cathepsin activity in interleukin-6 transgenic mouse. Biochem.
Biophys. Res. Commun. 1995; 207: 168-174.

[182] Tsujinaka T, Fujita J, Ebisui C, Yano M, Kominami E, Suzuki K, Tanaka K,
Katsume A, Ohsugi Y, Shiozaki H, Monden M. Interleukin 6 receptor antibody inhibits
muscle atrophy and modulates proteolytic systems in interleukin 6 transgenic mice. J. Clin.
Invest 1996; 97: 244-249.

[183] Tureckova J, Wilson EM, Cappalonga JL, Rotwein P. Insulin-like growth factor-
mediated muscle differentiation: collaboration between phosphatidylinositol 3-kinase-Akt-
signaling pathways and myogenin. J. Biol. Chem. 2001; 276: 39264-39270.

[184] Ussar S, Voss T. MEK1 and MEK2, different regulators of the G1/S transition. J.
Biol. Chem. 2004; 279: 43861-43869.

[185] Valdez MR, Richardson JA, Klein WH, Olson EN. Failure of Myf5 to support
myogenic differentiation without myogenin, MyoD, and MRF4. Dev. Biol. 2000; 219:
287-298.

[186] Vandenburgh HH, Karlisch P, Shansky J, Feldstein R. Insulin and IGF-I induce
pronounced hypertrophy of skeletal myofibers in tissue culture. Am. J. Physiol 1991; 260:
C475-C484.









[187] Vary TC. Regulation of skeletal muscle protein turnover during sepsis. Curr.
Opin. Clin. Nutr. Metab Care 1998; 1: 217-224.

[188] Vercoutter-Edouart AS, Lemoine J, Le B, X, Louis H, Boilly B, Nurcombe V,
Revillion F, Peyrat JP, Hondermarck H. Proteomic analysis reveals that 14-3-3sigma is
down-regulated in human breast cancer cells. Cancer Res. 2001; 61: 76-80.

[189] Vermeulen A, Goemaere S, Kaufman JM. Testosterone, body composition and
aging. J. Endocrinol. Invest 1999; 22: 110-116.

[190] Vivanco I, Sawyers CL. The phosphatidylinositol 3-Kinase AKT pathway in
human cancer. Nat. Rev. Cancer 2002; 2: 489-501.

[191] Vivian JL, Gan L, Olson EN, Klein WH. A hypomorphic myogenin allele reveals
distinct myogenin expression levels required for viability, skeletal muscle development,
and sternum formation. Dev. Biol. 1999; 208: 44-55.

[192] von Haehling S, Genth-Zotz S, Anker SD, Volk HD. Cachexia: a therapeutic
approach beyond cytokine antagonism. Int. J. Cardiol. 2002; 85: 173-183.

[193] Wang X, Thomson SR, Starkey JD, Page JL, Ealy AD, Johnson SE. Transforming
growth factor betal is up-regulated by activated Raf in skeletal myoblasts but does not
contribute to the differentiation-defective phenotype. J. Biol. Chem. 2004; 279: 2528-2534.

[194] Weintraub H, Davis R, Tapscott S, Thayer M, Krause M, Benezra R, Blackwell
TK, Turner D, Rupp R, Hollenberg S, The myoD gene family: nodal point during
specification of the muscle cell lineage. Science 1991; 251: 761-766.

[195] Weyman CM, Ramocki MB, Taparowsky EJ, Wolfman A. Distinct signaling
pathways regulate transformation and inhibition of skeletal muscle differentiation by
oncogenic Ras. Oncogene 1997; 14: 697-704.

[196] Weyman CM, Wolfman A. Oncogenic Ras-induced secretion of a novel inhibitor
of skeletal myoblast differentiation. Oncogene 1997; 15: 2521-2528.

[197] Weyman CM, Wolfman A. Mitogen-activated protein kinase kinase (MEK)
activity is required for inhibition of skeletal muscle differentiation by insulin-like growth
factor 1 or fibroblast growth factor 2. Endocrinology 1998; 139: 1794-1800.

[198] White JD, Scaffidi A, Davies M, McGeachie J, Rudnicki MA, Grounds MD.
Myotube formation is delayed but not prevented in MyoD-deficient skeletal muscle:
studies in regenerating whole muscle grafts of adult mice. J. Histochem. Cytochem. 2000;
48: 1531-1544.

[199] Winter B, Arnold HH. Activated raf kinase inhibits muscle cell differentiation
through a MEF2-dependent mechanism. J. Cell Sci. 2000; 113 Pt 23: 4211-4220.