<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2008-02-29.

Permanent Link: http://ufdc.ufl.edu/UFE0017561/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2008-02-29.
Physical Description: Book
Language: english
Creator: Chang, Frances La
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Frances La Chang.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Benner, Steven A.
Electronic Access: INACCESSIBLE UNTIL 2008-02-29

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0017561:00001

Permanent Link: http://ufdc.ufl.edu/UFE0017561/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2008-02-29.
Physical Description: Book
Language: english
Creator: Chang, Frances La
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2007

Subjects

Subjects / Keywords: Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Frances La Chang.
Thesis: Thesis (Ph.D.)--University of Florida, 2007.
Local: Adviser: Benner, Steven A.
Electronic Access: INACCESSIBLE UNTIL 2008-02-29

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2007
System ID: UFE0017561:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENTS OF BIOANALYTIC AL TOOLS FOR DNA DETECTION By FRANCES L. CHANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007

PAGE 2

2 2007 Frances La Chang

PAGE 3

3 To my parents who have been my constant suppo rt my entire lifethis do ctoral degree belongs to them.

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I want to thank Dr. St even Benner for taking a chance on me, and for all the support and kindness he has shown me. His mentorship has been invaluable to my development as a student and scientist. I also want to acknowledge Drs. William Dolbier and Ronald Castellano for sharing with me their know ledge and experience. I would not be where I am today without their advice and counsel these past 4 years. I would like to thank Dr. Daniel Hutter for his vast expertise in synthesis techni ques that have allowed me to complete my research. Dr. Nilesh Karalkan has been a wonde rful source of advice wh enever I encountered a difficult problem. I thank Dr. Nicole Leal for her help with DNA analysis. I would like to give a special thanks to Romaine Hughes for all of her administrative work. Without her, the lab would not be able to function. Finally, I would like to thank my family. Without my husbands encouragement during stressful times, I would not have been able to make it to the end, and without my son, I would not have the joy in my life that I have today.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 LIST OF ABBREVIATIONS........................................................................................................12 ABSTRACT....................................................................................................................... ............16 CHAPTER 1 DEVELOPMENT OF MOLECULAR IMAGING TOOL: MOLECULAR DETECTION USING LIFE INITIA TED FLUORESCENT SYSTEMS..............................18 Introduction................................................................................................................... ..........18 Background..................................................................................................................... .19 Molecular Imaging Probes..............................................................................................19 Research Objective..........................................................................................................24 2 LIGHT ACTIVATION FLUORESC ENT EMISSION SYSTEMS.......................................30 Introduction................................................................................................................... ..........30 Photoenolization of O-Methylbenzophenone..................................................................30 Model Studies: Photoenoliza tion of O-Methylacetophenone..........................................31 Model Compound: Photo-Diels-Alder of Substituted Triphenylnaphthalene.................33 Synthesis of DNA Modified Probes (P1 & P2)......................................................................33 Synthesis of 5 Labeled Probe (P2).................................................................................33 Synthesis of diphenyl acetylene substrate................................................................34 Direct incorporation if acetyl ene by solution phase approach.................................35 Attachment of diphenylacetylene is ocyanate via solid phase method.....................36 The Preparation of 3 Labeled DNA Probe (P1).............................................................36 Preparation of aminomethyl benzophenone derivative............................................38 Chemical synthesis of morpholidate nucleoside......................................................40 Model compound: Synthesis of 3-benzymorpholidate...........................................42 Synthesis of probe 1: Incorporation of substituted benzophenone derivative by direct modification of the 3 termin al uridine to "morpholinouridine"................43 Synthesis of 4 substituted benzophe none-morphorlino nucleoside and its phosphoramidite...................................................................................................44 Incorporation of phosphoramidite into DNA synthesis...........................................47 Synthesis of substituted benzophenone morphorlidate via alternate route C and D...........................................................................................................................47 DNA Synthesis and Purification.....................................................................................50 Concluding Remark.............................................................................................................. ..51

PAGE 6

6 Photo Initiated Ligation Experiment......................................................................................53 Experiment 1: Photolysis Reaction.................................................................................53 Experiment 2: Repetition of the P hotolysis Experiment with Filters.............................55 Experiment 3: Repetition of the Photol ysis Experiment: Evaluation of Chemical versus Optical Filters...................................................................................................59 Mass Spectrometry of the Oligonucleo tide for Structure Identification.........................64 Fluorescent Emission of 1,2,3-Triphenylnaphthalene.....................................................80 Experiment 4: Using fluorescent studie s to detect the ligation reaction and product..................................................................................................................86 Fluorescent analysis of experiment 4.......................................................................87 Fluorescent analysis of experiment 5.......................................................................92 Conclusion and Future Direction............................................................................................92 3 PSEUDOCYTIDINE..............................................................................................................95 Background..................................................................................................................... ........95 Isocytosine and 5-Methyl 2-deoxyisocytidine...............................................................97 Synthesis of C -Nucleoside...........................................................................................102 Results and Discussion.........................................................................................................104 Synthesis of Pseudocytidine Via Heck Coupling..........................................................104 Conclusion.....................................................................................................................107 4 CHEMICAL MODIFICATION OF 2-DI MENSIONAL MICROARRAY SURFACE USING CLICK CHEMISTRY.........................................................................................108 Background..................................................................................................................... ......108 DNA Microarray Technology...............................................................................................108 Understanding The Principle of Microarray Technology.............................................109 Fabrication of The DNA Chip.......................................................................................111 Slide coating chemistry..........................................................................................112 DNA immobilization chemistry.............................................................................113 Research Objective........................................................................................................116 Results and discussion......................................................................................................... .117 Click Chemistry.............................................................................................................117 Functionalizing the glass surface with aryl amine.................................................118 Synthesis of the modified oligonucleotide.............................................................119 Conclusion..................................................................................................................... .......121 APPENDIX EXPERIMENTAL SECTION............................................................................123 LIST OF REFERENCES.............................................................................................................151 BIOGRAPHICAL SKETCH.......................................................................................................162

PAGE 7

7 LIST OF TABLES Table page 2-1 Summary of the reaction conditions used to optimize the synthesis of 4-benzyl morpholidate in Scheme 7.................................................................................................43 2-2 Optimization conditions for s ynthetic route B and yields.................................................46 2-3 The layout of the 32P labeling experiment. Three se parate reaction were ran in parallel under different filtering system.............................................................................62 2-4 Analysis of 42-mer MS......................................................................................................66 2-5 Mass spec analysis of 19-mer primer ( P1 )........................................................................67 2-6 Mass spec analysis of re action 1 at 2h time point..............................................................68 2-7 Experiment 5. Reactions 1-4 consisted of P1 + P2 +T where the concentration of P2[B] changes.................................................................................................................. ..91

PAGE 8

8 LIST OF FIGURES Figure page 1-1 Jablonski Diagram.......................................................................................................... ...21 1-2 Mechanism of operation of molecular beacon...................................................................23 1-3 This depicts a design and concept of the Light Initiated Fluorescent Emission Systems (LIFES) as a catalytic cycle.................................................................................25 1-4 Light Initiated Fluorescent Emission Systems (LIFES) where the two modified DNA probes are joined together to generate a fluorescent species by photo induced DielsAlder reaction................................................................................................................. ....26 1-5 Mechanism of photo Di els-Ader reaction: .......................................................................29 2-1 Mechanism of photoenolization of o -methyl benzophenone.............................................31 2-2 Model system: Photoenolization which le ads to deuterium exchange and trapping of enol via the Diel s-Alders reaction......................................................................................32 2-3 Intermolecular trapping of photoenol adduct via Diels-Alder reaction.............................33 2-4 Synthesis of 1-isocyanatophenyl-4-phenylacetylene.........................................................34 2-5 Attachment of isocyanate derivative to 5amino oligonucleotide in solution phase reaction....................................................................................................................... ........35 2-6 Solid phase reaction: Attachment of di phenylacetylene isocyana te deriviative onto DNA oligonucleotide.........................................................................................................37 2-7 The two targets shown above are th e two potential approaches which the benzophenone derivatives can be at tached to the oligonucleoside....................................38 2-8 Retro-synthesis of the 3 labeled probe.............................................................................39 2-9 Synthesis of substitu ted o-methylbenzylphenone..............................................................40 2-10 Morpholidate synthesis by Summerton.............................................................................41 2-11 Synthesis of benzyl morpholidate......................................................................................42 2-12 Synthesis of the 3 label probe via route-A by direct modi fication of uridine at the 3 terminal of the oligonucleotide..........................................................................................44 2-13 Evaluating protection at the 4 OH pos ition to improve synthesis of morpholinouridine derivative............................................................................................................. ..46

PAGE 9

9 2-14 Synthesis of substitute d benzophenone phosphoramidite..................................................47 2-16 Synthesis of benzophenone via synthetic Route C ............................................................49 2-17 Instead of the Friedel-Crafts acylation, treatment with Lewis acid leads to the lost of TBDMS and resulting in acylation of 6 OH.....................................................................50 2-18 Solid phase DNA synthesis cycle......................................................................................52 2-19 Two 19-mers were annealed on a 42-mer template and was mixture was subjected to photo-irradiation.............................................................................................................. ..53 2-20 PAGE gel (10%) of primer/template photochemistry.......................................................56 2-21 Transmission of some commercial gla ss filter useful for the 100-300 nm region.............57 2-22 Repetition of the phot o Diels-Alder reaction.....................................................................58 2-23 PAGE gel (10%) of Primer/Template Photochemistry......................................................58 2-24 UV spectrum of two compounds, thym idine and methylanisole which are superimposed into a single image......................................................................................60 2-25 Long pass filter described by the cuton wavelength at 100 percent of peak transmission. Type A filter is in UV re gion and type B filter is in IR region...................61 2-26 A PAGE gel (10%) of Primer/Template Photochemistry..................................................62 2-27 PAGE gel (10%) of Primer/Template Photochemistry......................................................63 2-28 42-mer : Scan 1........................................................................................................... .......69 2-29 42-mer template : Scan 2.................................................................................................. .70 2-30 42-mer template: Scan 3................................................................................................... .71 2-31 Mass spectrometry of P2 ...................................................................................................72 2-32 Mass spectrometry of P1................................................................................................... .73 2-33 Reaction mixture at a 2-hour time point............................................................................74 2-34 (Scan 2) Reaction mixture at a 2-hour tim e point. The aliquot was from the repeat reaction C The mixture consisted of P1 & P2 and no template ( P1 : P2 1:1 ratio)...........75 2-35 (Scan 3) Reaction mixture at a 2 hour tim e point. The aliquot was from the repeat reaction C The mixture consisted of P1 & P2 and no template ( P1 : P2 1:1 ratio)...........76

PAGE 10

10 2-36 (Scan 1) Reaction mixtures of reaction 2 which contained P1 + P2 + T at 2-hour timepoint...................................................................................................................... ......77 2-37 (Scan 2) Reaction mixtures of reaction 2 which contained P1 + P2 + T at 2-hour timepoint...................................................................................................................... ......78 2-38 (Scan 3) Reaction mixtures of reaction 2 which contained P1 + P2 + T at 2-hour time point.......................................................................................................................... .........79 2-39 Emission spectrum of compound 3 (substituted 1,2,3-triphenylnaphthalene) in dichloromethane................................................................................................................ .82 2-40 Emission spectrum of compound 3 (substitu ted 1,2,3triphenylnaphthalene) in dichloromethane................................................................................................................ .82 2-41 Excitation spectrum of compound 3 (substituted 1,2,3-triphenyl-naphthalene) in dichloromethane................................................................................................................ .83 2-42 Emission spectrum of 3 (substituted 1,2,3triphenylna phthalene) in methanol................84 2-43 Excitation spectrum of = 3 (substituted 1,2,3triphenylna phthalene) in methanol...........84 2-44 Excitation spectrum of 3 (substituted 1,2,3-triphenyl naphthalene) in water.....................85 2-45 Emission spectrum of DNA photo Diel s-Alder reaction wh ere the excitation monochromator was fixed at 355 nm.................................................................................85 2-46 Emission scan spectrum of 3 (substituted 1,2,3-triphenylna phthalene) in water..............86 2-47 Reaction 1 ( P1 + P2 + T 1:1:1 ratio): the curve re presents the reaction mixture after 2 hours of irradiation......................................................................................................... .88 2-48 Reaction 2 ( P1 + P2 + T 1:5:1 ratio): the curve repr esents the reaction mixture after 2 hours of irradiation......................................................................................................... .89 2-49 Reaction 3 ( P1 + P2 1:1 ratio and no T): the curve represents the reaction mixture after 2 hours of irradiation.................................................................................................89 2-50 Reaction 4 ( P1 + P2 + T): the curve repr esents the reaction mi xture after 2 hours of irradiation.................................................................................................................... .......90 2-51 Summary of experiment 4: the linea r black line in the graph represent the fluorescence of a templated reaction ( 1 & 2 ) at different concentration of P2 [1B]..........90 2-52 Fluorescent studies summary of experiment 5 Each data point represents the maximum emission of the fluorescent product formed.....................................................92 3-1 Generic representation of Watson-Crick m odel: small pyrimidines pairs with large purine. X represents a heteroatom....................................................................................96

PAGE 11

11 3-2 The Artificial Expanded Genetic Information System......................................................96 3-3 Hydrogen bonding pattern of C:G is denoted as pyDAA:puADD respectively...............97 3-4 Synthesis of the isocytidine derivative from uracil/thymidine via the formation of anhydrous uracil............................................................................................................... ..98 3-5 General mechanism of acid driven depyrimidination of isocytidine.................................99 3-6 Mechanism of hydrolytic deamination of isocytidine under basic ammonia condition..100 3-7 Synthesis of isocytidine phosphoramidite derivatives with various protecting group....101 3-8 Two non-natural nucleobases (isoC and pseudoC) share the same exact hydrogen bonding pattern................................................................................................................102 3-9 First C-nucleoside synthetic method by Da vid and Lubineau. Features condensation of 2,5-dilithio-2,4-bis(trimethylsilyl)-c ytosine with 2,4:3,5-di-O-benzylidene-Dribose......................................................................................................................... .......103 3-10 General synthetic method of C-nucleoside. The key termediate 49 can be cyclilized to vairous products...........................................................................................................104 3-11 Synthesis and formamidine pr otection of 4-exocyclic amine..........................................105 3-12 Synthesis of 1,2 deoxy-1,2dihydro-3-O-TBDPS furanose.............................................105 3-14 Heck coupling reaction of glycal and 5-iodocytisine to give a C-nucleoside..................106 4-1 DNA microarray schema.................................................................................................110 4-2 List of various covalent attachment methods of 5'm odified oligonucleotides to the glass surface.................................................................................................................. ...115 4-3 Synthesis of diazonium captures species on a 2-D surfaces............................................117 4-4 Diazotization of arylamine to form the diazo nium salt. MX indicates a generic salt.....118 4-5 p-amino styrene co-polymerized with butadiene to generate amino polystyrene polymer........................................................................................................................ ....119 4-6 The 2-cyanoethyl 2-(e thyl(phenyl)amino)ethyl d iisopropyl-phosphoramidite was synthesized and incorportated into the oli gonucleotide as an appendage at the 5end....120

PAGE 12

12 LIST OF ABBREVIATIONS A adenine or adenosine Ac acetyl ADA N-(2-Acetamido)iminodiacetic Acid AEGIS Artificially Expanded Genetic Information System AIBN 2,2-azobisisobutyronitrile anh. anhydrous APS aminopropyl silane aq. aqueous Ar aryl B generic letter for natural DNA base Bu butyl Bn benzyl BzCl benzoyl chloride C degrees Celsius C cytosine or cytidine cat. catalytic amount CH3CN acetonitrile CN cyano conc. concentration CPG controlled pore glass DBU 1,8-diazabicyclo[5.4.0]undec-7-ene DCE dichloroethane DCM dichloromethane

PAGE 13

13 DIPEA N,N-diisopropylethylamine DMAP N N -dimethyl-4-aminopyridine DMF N N -dimethylformamide DMP 2,2-dimethoxypropane DMSO dimethylsulfoxide DNA deoxyribonucleic acid EDTA ethylenediaminetetraacetate EI electro ionization ESI electrospray ionization eq. equivalent Et ethyl EtOH ethanol Fluo fluorescent G guanine or guanosine h hour(s) HIV human immunodeficiency virus HOAc acetic acid HPLC high performance liquid chromatography Hx hexanes h light isoCM 5-methylisocytosine isoG iso guanine or iso guanosine L liter

PAGE 14

14 LIFES light initiated fluorescent emission systems M molar MALDI TOF matrix assisted laser desorption ionization time of flight Me methyl MeOH methanol mg milligram min. minute(s) mL milliliter MS mass spectroscopy NaOEt sodium ethoxide NIS N -iodosuccinimide NMR nuclear magnetic resonance PAGE polyacrylamide gel electrophoresis Ph phenyl ppm parts per million pr propyl prep. Preperative pu purine Py pyridine py pyrimidine Rf retension factor RNA ribonucleic acid RT room temperature

PAGE 15

15 SARS severe acute respiratory syndrome T thymine or thymidine TBAF tetran -butylammonium fluoride TBDMS t -butyldimethylsilyl TBDPS t -butyldiphenylsilyl TEA triethylamine TEAA triethylammomium acetate TEAB trethylammonium bicarbonate TFA trifluoroacetic acid THF tetrahydrofuran TMS trimethylsilyl or tetramethylsilane Tol toluoyl TMS trimethylsilyl Tris tris(hydroxylmethyl)aminomethane U uracil or uridine UV ultraviolet VIS visible L microliter M micromolar

PAGE 16

16 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENTS OF BIOANALYTICAL TOOLS FOR DNA DETECTION By Frances L. Chang August 2007 Chair: Steven A. Benner Major: Chemistry This dissertation describes 3 separate projects: 1) to develop a probe for a detection system called Light Initiated Fluores cent Emission System (LIFES) fo r the detection of DNA and RNA sequences, 2) the synthesis of a novel non-natural nucleotide called pseudo-cytidine, and 3) the development the microarray chip for improved signal detection. In the first project, LIFES uses a molecula r probe strategically designed to generate a fluorescent species once the probe is bound to a nucleic acid target and ultraviolet (UV) light is applied. Synthesis of the probe involved using two DNA and RNA standard nucleobases, thymidine and uridine, that had been structurally modified by the attachment of a small organic molecule. Succesful binding of the synthesized probe to a known target was then demonstrated by the generation of a fluorescent signa l upon irradiation with UV light. In the second project, synt hesis of the novel non-natural nuc leotide, pseudo-cytidine, was performed as part of an effort to improve the stab ility of standard cytidine and add to the existing library of non-natural nucleotides called the Ar tificial Expanded Genetic Information System (AEGIS). The key step of the synthesis invo lved the Heck coupling reaction linking together the cytosine heterocycle and the gl ycal forming a new carbon-carbon bond.

PAGE 17

17 In the third project, Click chemistry was developed for the attachment of a DNA probe to a 2-dimensional microarray chip. The attachment chemistry required two steps. The first step involved chemical modification of a borosilicat ed surface by generating a diazonium species on the glass surface for use in capturing the oli gonucleotide probe. The second part involved synthesis of the reactive partner to the diazo nium species, a N,N-dialkyl substituted aniline phosphoramidite, and incorporati ng it into the oligonuc leotide probe. The Click reaction was then carried out, and the results were analy zed by imaging using a confocal fluorescent microscope.

PAGE 18

18 CHAPTER 1 DEVELOPMENT OF MOLECULAR IMAGING TOOL: MOLECULAR DETECTION USING LIFE INITIATED FLUORESCENT SYSTEMS Introduction The discovery of the double-helix structure of DNA first elucidated by Watson and Crick13 in 1958 opened a new era during which biologist s and physical scientis ts have strived to unravel the genetic code and its regulated expression in order to determine the genotypic basis for all cellular life. There is a growing belief th at most diseases result from altered patterns of gene expression that transition cel ls to the phenotypes of disease4 Therefore, an intensive exploration is taking place in the biological sciences to determine the patterns of gene expression that encode for normal biological processes, such as replicatio n, migration, signal transduction for cell communication, and the many other functions that cells perform in order to understand various pathological pathways. The research cha llenge at this moment is to pinpoint the exact genetic mutations responsible for human dis eases and deriving meaningful knowledge from these DNA sequences to determine the function of these genes. With the completion of the Human Genome Project, the reality of identifying th e genetic basis of all human diseases is now possible. Paralleling these developments in molecula r biology, significant advances in medical imaging over the past 25 years have also been made in areas such as magnetic resonance imaging, computed tomography, nuclear medici ne, ultrasound, and optical imaging. Up until recently, these technologies have focused solely on structural and/or anatomical imaging at the organ or tissue level rather than identifying specific molecular even ts (e.g., gene expression). Genomics, however, offers the unique opportuni ty to develop and integrate novel imaging techniques that exploit current and emerging knowledge of the ge netic and molecular basis of a specific disease. This change in emphasis from nonspecific, anatomical data to a specific sub-

PAGE 19

19 cellular detail represents a signifi cant paradigm shift. Intergra tive imaging can now provide the potential for discovering genomic and transc riptomic changes that have diagnostic and prognosticative value, as well as allow therapy that ta rgets specific changes at the subcellular level. This creates the possibility of achieving several important goals in biomedical research, namely: 1) to develop noninvasive in vivo imaging methods that re flect specific cellular and molecular processes (for example: gene expression or more complex molecular interactions such as protein-protein interactions); 2) to monitor multiple molecular events near-simultaneously; 3) to follow trafficking and targeting of cells; 4) to assess disease progression at a molecular level; and 5) to create the possibility of achieving al l of the above goals of imaging in a rapid, reproducible and quantitative manner, so as to be able to monitor time-dependent experimental, developmental and therapeutic influences on gene products in the same animal or patient. The development, validation and application of these novel imaging techniques should further enhance our understanding of dis ease mechanisms and go hand in hand with the development of molecular medicine.5 The next few paragraphs will discuss in more details the molecular imaging probes using both radiolabel and optical imaging techniques. In this dissertation, my research focuses on developing molecular im aging probe using fluorescence as a signaling device. The next chapter will focus on the synthesis of the DNA molecular probe as an in vitro imaging tool and provides a conceptual fram ework of the probe designs and synthesis: Background Molecular Imaging Probes Molecular imaging has its roots in nuclear medicine. The term molecular imaging implies the convergence of multiple image-captu re techniques, basic cell/molecular biology, chemistry, medicine, pharmacology, medical physics, biomathematics, and bioinformatics into a new imaging paradigm. Molecular imaging pr obes are referred to by many different names

PAGE 20

20 including but are not limited to: 1) molecular pr obes, 2) molecular beacons, 3) nanoparticles, 4) tracers and 5) smart probes. Molecular imaging provides a visual representation, characterization and quantificati on of biological processes at th e cellular and subcellular level within a living organism. Molecu lar imaging probes typically are composed of 1) an affinity component that interacts with th e target and 2) a signaling compone nt that is useful for imaging. Molecular imaging techniques can be tailored to multiple imaging modalities and optical imaging technique will be th e focus in this dissertation. Molecular imaging has two basi c applications. The first is for diagnostic imaging to determine the location and extent of targeted molecules specific to the disease being assessed. The second is for applying the therapy to diseasespecific targeted molecules. An example of the latter is DNA anti-sense therapy,6 in which a synthetic oligonuc leotide binds to the mRNA of a particular gene responsible for a disease by complementary or anti-sense binding, thereby disrupting its genetic replication process. Molecular imaging probes can be small molecules, such as receptor ligands or enzyme substrates, or higher molecular weight affinity ligands, such as monoclonal antibodies or recombinant proteins They can be categorized in many different ways. One particularly useful way is to describe them as either radiolabeled or activated probes utilizing fluorescence. In radiolabeled probes (e.g., 18fluorodeoxyglucose for PET imaging7-9), a signal is produce constantly throughout the decay of the radioisotope. The signaling component can be a small isotopic substitu tion (e.g., replacing 12C for 11C), a nonisotopic substitution (e.g.. replacing 1H with 18F), or larger chelating approaches using larger isotopes (e.g., 64Cu, 99mTc). In optical approaches, the signaling com ponent can be a fluorochrome wherein the fluorescent signal is initiated by an incident light absorbed by a fluorophore and the electrons are

PAGE 21

21 activeated to an excited singlet state. When the electrons return to the ground state, a photon will typically be emitted. When this occurs, this emis sion of light is known as the fluorescence. The singlet ground, first, and second elec tronic states are represented by S0, S1, and S2 respectively. The excited electrons will typically go into either the S1 or S2 electronic state. Electrons in the S2 state rapidly relax to the lo west vibrational level of S1 by a process known as internal conversion and then returns to the ground state. The emitted photon from this process is lower in energy or longer in wavelength than the absorbed exci tation photon. This phenomenon is termed the Stokes shift. As a result, fluorescence based de tection methods can be highly sensitive due to the detection of emission photons that are spectrally separate d from the excitation photons.10 The mechanism of fluorescent emission is depi cted by the Jablonski diagram (Figure 1-1.)11 Figure 1-1.Jablonski Diagram Molecular imaging probes can also be specifi c or nonspecific. Nonspecific probes do not have a distinct set of targets, as do specific probes, but instead produce a signal based on complex set(s) of biological events. Conversel y, specific molecular imaging probes have greater specificity and targeting potential. They can be made from DNA oli gonucleotides, antibodies, ligands or substrates that can specifically interact with targets in particular cells or subcellular compartments. Specific targeted probes incl ude those used in most of the conventional

PAGE 22

22 radiotracer imaging methods, where the emphasis is on imaging the protein product of a gene with radiolabeled substrates that interact with that specific pr otein. These interactions are based on either receptorradio-ligand binding12 (e.g., binding of 11C-carfentanil to the mu opiate receptor;) or enzyme-mediated trapping of a radiolabeled substrate (e.g., 18F-2-fluoro-2deoxyglucose [18F-FDG] phosphorylation by hexokinase). The fundamental limitation of the majority of these conventional approaches using these types of targeted probes is that a new substrate must be discovered in order to be radiolabeled to yield a different probe for each new target protein.13 Because of the difficulty, cost, and effort of radiolabeling new substrates and the requirement for in vivo characterization of every such substrate under investigation, alte rnative methods to develop new a ssays that are more applicable to imaging of a wide variety of gene product targ ets arising from the expr ession of any gene of interest would be desirable. Because of these limitations, there have been concerted efforts in the recent years by several research groups to de velop molecular imaging reporte r gene/reporter probe systems.14-18 In these systems, the molecular probe is an o ligonucleotide that binds to a specific known DNA sequence. The advantages are that they carry a hi gh degree of specificity for their target, are less costly and labor-intensive to produce and can easily be synthesized to ta rget any portion of the DNA in which the sequence is known. The disadvantage with this approach, however, is that there can be substantial background noise because the scanner cannot dist inguish the parent tr acer from the bound or metabolized tracer. As such, time is required to allow the parent tracer to clear. To circumvent this drawback, another category of specific imag ing probes consists of activatable or smart probes, also referred to as sensors or molecular beacons (MBs) (Figure 1-2).

PAGE 23

23 DNA/RNAtargetMolecularBeacon HairPinstructure Hybridized Figure 1-2. Mechanism of operation of molecu lar beacon. On their own, these molecules are nonfluorescent because the stem hybrids keep the fluorophores close to the quenchers. Molecular beacons emit intense fluorescence only when the stems are apart through hybridization of DNA molecu les with sequences complementary to their loop sequences. Structurally, MB is a single stranded DNA th at takes shape of a hairpin. At one end, a fluorophor is attached, and at the other end, a quenc her. Prior to hybridiza tion to its target, the system is closed or off due to the clos e proximity of the fluorophor and the quencher, preventing the fluorophor from emitting a signa l during resonance energy transfer (RET).19-21 Binding of the MB to its target induces a c onformational change that opens the hairpin, separating the fluorophor from the quencher and tu rning it on allowing the fluorescence to be detected. These molecules eliminate the proble ms with background noise because they can only be detected once they have interacted with their target while they are almo st undetectable prior to the interaction with their target.22 Underlying the principle of optical molecular imaging, MBs combine the exquisite sensitivity of fluorescence t echniques and the specificity of nucleic acid sequence recognition and thus are suitable for detecting and analyz ing very small quantities of the target in vitro and in vivo ,23-25 facilitating specific target ing in cells and subsequent visualization by sensitive micros copic and spectroscopic technique s. Molecular beacons are now a reasonably well-accepted means of seeing nucle ic acid hybridization in living cells under

PAGE 24

24 microscopy. They are also being used for in vitr o studies, especially in PCR, and for nonspecific protein DNA binding studies.26 They have been adapted re cently as activatable smart probes for molecular imaging in living subjects. Unfortunately, MBs have been shown to have some disadvantages. First, they are known to be susceptible to nuclease de gradation, resulting in separati on of the fluorescent species and the RNA. As a result, the signa l would not represent the presence of the target. Secondly, there is evidence obtained from the previous finding th at there are abundant non-target complementary sequences outside the nucleus, such as DNA bindi ng proteins, that would bind to MB, generating a false positive signal.27-30 Thirdly, several investigators ha ve observed that nucleotides can quench the fluorescence of fluorophores.31-33 Finally, the quenching e fficiency significantly affects the signal-to-noise rati o so that if a quencher does not completely quench the fluorophor, noise fluorescence will result. This quenching efficiency is depende nt on several factors. The current designs of MB use various lengths of spacers (C6, C12, C18 etc.) between the quencher and the fluorescent dye, which can significantly aff ect the probability of the two coming in close proximity of each other to allow for RET. En ergy transfer rates depend upon the extent of spectral overlap of the emission spectrum of the donor with the abso rption spectrum of the acceptor, the quantum yield of the donor, the re lative orientation of the donor and acceptor molecules, and the distance betw een the donor and the acceptor. If quenching does not occur, noise is generated. In a recent cellular study, molecular beacons showed no advantage over standard linear probes.34 Research Objective Molecular imaging methods pose specific require ments. They may need to be optimized for a molecular probe or probes as well as anat omical imaging. The integration of molecular

PAGE 25

25 imaging methods into multi-modality systems will affect data acquisition, processing, reduction, display, and archiving. To ci rcumvent this relative drawback another category of specific imaging probes consists of activatable or L IFES probes (Figure 1-3). These can only be detected once they have interacted with their ta rget, and have been developed mainly for optical imaging applications. They are relatively undete ctable prior to interaction with their target.35 Analytes A B AB U T DNAprobes DNA DNA U T AB U T 3' 5' 3' 5' h AB U T n FluorescentReporter AB U T AB U T AB U T AB U T AB U T AB U T AB U T signal amplifiedovertime enzymes Figure 1-3. This depicts a de sign and concept of the Light Initiated Fluorescent Emission Systems (LIFES) as a cata lytic cycle. Two synthesized DNA/RNA probes where each probe is attached to a small organic non fluorescent molecule, A and B. When the probes are binding of the target, A and B will be brought to close proximity together. The A and B portion will react via photo induction to join the two probes and generate a product that is a fluorescent substrate. Due to the bulky fluorescent substrate, the product is expected to dest abilize on the template and come off to regenerate the DNA. In the pr esence of an excess probe, the fluorescent can be generated over time and offer a mechanism of signal amplification. Figure 1-4 shows the design of a Light Ini tiated Fluorescent Emission Systems (LIFES) which features a classic [4 + 2] Diels-Alder reaction, where the contro lled light switch is by

PAGE 26

26 photo-induction. The DNA-probe consists of two fragments of oligonucleotides, probe 1 and probe 2 which will bind adjacent to the endogenous RNA target. T T G G G A A A A G T G T G A T G G T T G A G G T C G G T T T A G A T G T A T T A A A A C C C T Um T T A C A Cl A G T A A C A C T C C A G C C A A A T A G C A C G NH O O O T T G G G A A A A G T G T G A T G G T T G A G G T C G G T T T A G A T G T A T T A A A A C C C T Um T T A C A C A G T A A C A C T C C A G C C A A A T A G C A C G O HN O 5'3' 3'5'5' 3' 3'5' hv bufferT T G G G A A A A G T G T G A T G G T T G A G G T C G G T T T A G A T G T A T T A A 5'3' Probe1 Probe2 Template Figure 1-4: Light Initiated Fl uorescent Emission Systems (LIFES) where the two modified DNA probes are joined together to generate a fluorescent species by photo induced DielsAlder reaction. The objective of this research is to develop a novel imagi ng technology for early detection, screening, diagnosis, or image-guided treatment of cancer. It introduces a new kind of probe,

PAGE 27

27 one that responds by creating a fluor escent species only if a targeted feature of a transcriptome is present in a tissue. This will be us eful for many of the goals including. (a) Assisting in the integration of microsc opic imaging systems and microscopic implanted devices with molecular genetic markers useful in early diseas e detection, but also applicable in many other areas. (b) Disease Screening: The tool proposed here would be most applicab le for excreted cells (e.g, in the urine or feces, or also in breast ductal lavage). (c) Novel molecular imaging methods that i nvolve spectroscopy. As the number of genomic and transcriptomic changes associated with pr ognosis and therapeutic outcome increases, it will be possible to better monitor the effects of therapy on those changes. This dissertation include s the development and the synthesi s of the 5'-labelled probe, the synthesis of the 3'-labelled probe (Figure 1-4) and the demonstration of the light-initiated (>320 nm) generation of the triphenylnaphthalene deri vative with an emission maximum of ca. 440 nm. It is clear that the imag ing would be more useful in vivo if the emission of the fluorochrome was shifted towards the green, to perhaps 520 nm. This can be done conceptually by appending conjugated groups to the chrom ophore without preventing the phot oenolization from occurring. The following milestones will be discussed: 1. Synthesizing diphenylacetylen e derivatives with electron d onating and withdrawing groups that are predicted to shift the emission wavelength to the green. 2. Synthesizing benzophenone derivatives w ith electron donating and withdrawing groups that are predicted to shift the emission wavelength to the green. 3. Demonstrating the photoenolization-Diels-Al der-elimination sequen ces with the above compounds. 4. Determining the fluorescence emission spectrum of the products of these sequences. 5. Synthesizing oligonucleotide probes having an optimized dienophile attached to its 5'-end. 6. Synthesizing probes having an optimized photoenolizable benzophenone unit attached to its 3'-end. 7. Perform experiments to identify combinations of sugar backbones that will support the LIFES strategy in solution phase.

PAGE 28

28 A specific chemistry (Figure 1-5) has been chosen for development. First, the query photon causes a photoenolization reaction in the first sp ecies, which is attach ed to the 3'-end of a DNA probe, creating a 1,3-dienol. This dienol is then trapped by the second species acetylene dienophile, which is attached to the 5'-end of a second DNA probe. The two species are strategically placed so that they are in close proximity when bot h probes are attached to adjacent segments of an mRNA molecule. This ensures th at the Diels-Alder reaction will be efficient if the target analyte is pr esent to hold the acetylene in the appropriate place. Upon the Diels-Alder reaction followed immediately by the elimina tion of water, the product is a fluorescent triphenylnaphthalene derivative th at signals the presence of a messa ge. Even if the acetylene is not present, the dienol simply tautomerizes b ack to give the benzophenone starting material, which has another chance to detect the target mRNA.

PAGE 29

29 N O O P O O OH N NH O O H N O H N N N N N NH2 O O P O OOOH N O O P O O OH N NH O O H N O H N N N N N NH2 O O P O OOHO H H H N O H N N N N N H2N O O P O OON O N NH O O O P O OH O R DNA DNA DNA DNA DNA DNA R R -H2O Figure 1-5. Mechanism of photo Di els-Ader reaction: The first step involved photo induction to generate the dienol species at the appendage attached to the terminal end of the 3 labeled probe. The dienols will be trapped by the dienophile of the adjacent probe, in this case would be the acetyl ene species attached at the te rminal end of the 5 labeled probe, to give a [4+2] Diels-Alder produc t. This is followed by spontaneous elimination of water to give triphenylnapthalene derivative.

PAGE 30

30 CHAPTER 2 LIGHT ACTIVATION FLUORE SCENT EMISSION SYSTEMS Introduction Photoenolization of O-Methylbenzophenone Many decades after the first re port of the photoenolization of o-alkyl-benzylphenone to oxylyenol (also known as photoenol or phot odienols) by Yang and coworkers in 197536 the photoenolized o -alkyl-benzylphenone remains a substrate of fascination. The enol and enolate ions are essential intermedia tes in many important chemical reactions and biological transformations. Synthetic chemis ts, therefore are still capitalizi ng on the utility of photodienols as one of the key steps in tota l synthesis of diverse cyclic ri ng systems and complex natural products.37-38 Currently, the accepted mechanism of the photo-enolization even t is shown in Figure 2-1. The reaction first reaches the n* transition state forming the anti and the syn triplet ketones.3940 The syn -triplet o-alkylbenzophenone then engages in an intramolecular abstraction of the hydrogen while the anti -triplet o-alkylbenzophenone returns to ground state. The initial adduct, the syn -triplet, then forms a bi-radical, triplet stat e enol, which engages in intersystem crossing before decaying to the ground state e nol, resulting in two isomers, the E and Z configurations. Based on various studies, the Zenol usually rapidly undergoes a 1,5sigmatropic shift to return to the ground state ketone, and is thus significantly shorter lived (10-9 s). The E -enol on the other hand, requires acid or base catalysis to re-ketonize and therefore, is sufficiently longer lived (10-3 s) to provide an intermediate that can efficiently participate in other reactions.41-43 The vast thermal cyclization and bi molecular cycloaddition chemistry known to date is only plausible with the Eenol. For instance, E -enol undergoes thermal conrot atory cyclization to form

PAGE 31

31 synthetically useful benzocyclobutenols. E -enol also reacts with dienophiles in a Diels-Alder cycloaddition fashion to afford a six-membered ring product.44-46 PhOMe O H PhOMe O H PhOMe OH H H OH PhOMe H H PhOMe OH H H OH PhOMe H H hIntersystemcrossing Z -Enol E -Enol O PhOMe *3 *3 Syn Anti Figure 2-1. Mechanism of photoenolization of o -methyl benzophenone. Depending on the substituent next to the ketone, the lifetim e of the Z-dienol can be as short as 10-6 s whereas that of the E-dienol is significantly longer (3 s). The Z-dienol has a short lifetime because its orientati on allows re-ketonization a nd re-aromatization to occur easily through a 1,5-hydrogen shift; the re -ketonization process for the E-dienol, on the other hand, requires acid or base catalysis to proceed. Therefore, the longer-lived E-dienol provides an intermediate that can be efficiently trapped by the DielsAlder dienophiles. Model Studies: Photoenolization of O-Methylacetophenone To investigate the efficiency of the photoenolization process, we initially used a commercially available 2-methyl acetophenone subs trate in our model studies to look at the possible deuterium exchange of -hydrogen position (Figure 2-2). 2-Methylaceto-phenone was

PAGE 32

32 dissolved in 2 separate solvents, deuterated methanol and deuterated chloroform. The 2methylacetophenone was irradiated with an ultraviolet lamp, which emits lights in a wide range of wavelengths (220 nm nm). The rate of deuterium exchange was analyzed with 1HNMR by evaluating the disappearance of 1H at the 2-methyl position. Three possible products were expected to be observed, 1a-c. However, no exchange in either solvent system was observed. O O D D hvH O D D D O D H H CD3OD 1a1b1c 2 Figure 2-2. Model system: Photoenolization whic h leads to deuterium exchange and trapping of enol via the Diels-Alders reaction. Trapping of the dienols with diphenylacetylene to form the DielsAlder product was also examined in methanol and in toluene. The synthesis of 1methyl-2,3-diphenyl naphthalene 2 was accomplished by reacting an equal molar of 2-methylacetophenone with diphenylacetylene and irradiating the mixture under a Hanovia la mp emitting UV light at a wide range of wavelengths (300 nm nm) over an extended period of time (~60 hrs). Although no product was isolated in this reaction, a minor amount of product was present as suggested by a weakly

PAGE 33

33 fluorescent glow in the reaction under the UV lamp. Due to the similarity in polarity of the product and starting materials and th e large amount of unreacted star ting material left, efforts to separate the product was unsu ccessful. Wagner and coworkers suggest that success of bimolecular trapping reactions may be determined by the lifetimes of the photoenols, which is influenced by its substituents.47 Based on th ese studies, we believe that methylbenzophenone rather than methylacetophenone should provide be tter stability to the dienol and allow a DielsAlder reaction to take place. Hence, we examined the photoenolization of benzophenone in the next studies. Model Compound: Photo-Diels-Alder of Substituted Triphenylnaphthalene Compound 5A and compound 11a were used in their salt form to help with their solubility in polar solvent. Therefore, an equal mixture of 2-methylbenzophenone hydrochloride salt 11a and diphenylacetylene sodium acetate 5a was irradiated in metha nol under UV light (300 nm 1100 nm) for 48 hours. 2,3-subst ituted triphenyl naphthalene 3 was isolated as a yellow solid (Figure 2-3). Fluores cent studies of compound 3 will be discussed in the next section. CO2Na O O NCl O NH2 CO2H MeOH h v 11a 5a 3 Figure 2-3. Intermolecular trapping of photoenol adduct via Diels-Alder reaction. Synthesis of DNA Modified Probes (P1 & P2) Synthesis of 5 Labeled Probe (P2) In this study, diphenylacetylene derivative was synthesized first, followed by the attachment of the organic portion to the 5 ami no modified oligonucleotide to ensure the quality

PAGE 34

34 of the oligonucleotides as well as the efficiency of the attachment chemistry. The synthesis of 1isocyanato-4-(phenylethynyl)benze ne was carried out in four simple steps (Figure 2-4). Synthesis of diphenyl acetylene substrate An efficient and high-yielding Sonogas hira palladium mediated coupling49-52 of ethyl 4iodobenzoate and phenyl acetylene (1:1 ratio) a fforded ethyl 4-(2-phenylethynyl)benzoate ( 4 ) with 95% yield.48-49 Hydrolysis of compound 4 under basic conditi on (e.g.,, sodium hydroxide) in ethanol with mild heating gave pure salt form of sodium 4-(2phenylethynyl)benzoate ( 5 ), which was then neutralized and isolated by filtration to give quantitative yield of compound 5 as a free base. Compound 5 has a UV/VIS maximum absorption at 308 nm, which will be used as a reference to monitor the DNA incorporation reaction. The conversion of Compound 5 to diphenylacetylene isocyanate analog 7 was achieved in two sequential steps. First, treatment of compound 5 with diphenylphosphoazi de (1 equiv.) in the presence of Et3N in DMF produced the azido substrate ( 6 ), which was isolated by extraction I O O O O O OH O N3 N C O Pd3(Oac)6Ph3P Et3N,CuI THF,rt 4NNaOH Ethanol (PhO)2PN3, DMF,Et3N Toluene D 4 56 7 Figure 2-4. Synthesis of 1-is ocyanatophenyl-4-phenylacetylene: The key steps here are the Sonogashira coupling of terminal alkynes with aryl or vinyl halides and the Curtius rearrangement of azide to isocyanate prior to the Curtius rearrangement transformation.50-53 The intermediate ( 6 ) was then heated to reflux in anhydrous toluene under argon for 30 minutes to achieve 1-isocyanato-4-(2-

PAGE 35

35 phenylethynyl)benzene ( 7 ) in quantitative yield. Compound 7 was used immediately without purification. Direct incorporation if acetylene by solution phase approach We have examined both the solution and the so lid phase approaches for the incorporation of compound 6 onto the 5 end of the oligonucleotides. Synthesis of natu ral nucleotides is described in the next few paragraphs. By the solution phase approach, 100-fold excess of compound 7 in DMF was used to react with short oligonucleotide, MS a 5 terminal primary amine of the modified o ligonucleotide (3 CAAACCCT-NH2 5), which was custom-synthesized in-house by Dr. Sukeda at the Univer sity of Florida (Figure 2-5). 3'CAAACCCT-NH25' NCO N H 3'CAAACCCT O NH DMF ddH2O+7 MS-1 MS Figure 2-5. Attachment of isocyanate derivativ e to 5amino oligonucleo tide in solution phase reaction. Despite the fact th at the oligonucleotid e was unprotected,compound 7 was expected to preferentially react with the primary amine at the 5 terminal end with a 100 times better selectivity compared to water to give MS-1 HPLC analysis of the progress of the reaction was difficult, because upon dissolution of the oligonucle otides in aqueous solution, the isocyanate was quickly hydrolyzed to form ur ea byproduct.

PAGE 36

36 Attachment of diphenylacetylene is ocyanate via solid phase method The second method was to incorporate the diphenylacetylene derivative onto the 5 terminal end of the oligonucleotide at the e nd of DNA synthesis while the DNA was still on the solid support (see below for DNA synthesis proce dure) (Figure 2-6). In that method, a 19-mer DNA oligonucleotide in a 3 5 direction containing th e FMRAmide sequence, (3 CCAAATACTCCAAACCCT-NH2 5) was synthesized while the 5 terminal amine was protected with 4-monomethoxytr ityl (4-MMP) during th e DNA synthesis. In the solid support approach, it was possible to perform th e attachment chemistry of compound 7 to the oligonucleotide in organic solvent. The final pr oduct was removed from the solid support at the end by acid cleavage. The CPG was treated with 5% dichloroacetic ac id THF via a syringe and then neutralized using pyridine. The solid support was then tr eated with a solution of compound 7 in 1:1 (v/v) dichloromethane:N,N-dimethylformamide mixtur e. The incorporation of diphenylacetylene was monitored by HPLC, which showed 50% successful attachment of compound 7 to the olignucleotide. Cleavage and deprotecti on of the oligonucleotide was accomplished by treatment of the solid support w ith 40% methyl amine in water at room temperature for 4 hours. The 5 labeled probe ( P2 ) was isolated and desalted under sta ndard protocol and was purified by anion exchange column chromatography. The product ( P2 ) was confirmed by MALDI-TOF mass spectrometry. The Preparation of 3 Labeled DNA Probe (P1) Two different ways to attach the substituted benzophenone onto the 3-amino-morpholino position were explored. The po ssible synthetic targets are sh own in Figure 2-7. The first strategy involves attaching a subs tituted benzophenone to the 3 te rminal of the oligonucleotide by replacing the 3 hydroxy of the last nucleosid e with the aminomethylbenzophenone derivative

PAGE 37

37 P-1 The second strategy involves completely modi fying the sugar portion of the nucleotide at the 3 end to morpholidate nucleoside, then sy nthesizing the modified phosphoramidite give the labeled P1 oligonucleotide. GCCAAATACTCCAAACCCT-NH-MMP NH O N H GCCAAATACTCCAAACCCT CPGGCCAAATACTCCAAACCCT-NH2 CPG Dichloroaceticacid 7, CH2Cl2,DMF CPG NH O N H GCCAAATACTCCAAACCCT 40%MeNH2inWater P1 Figure 2-6. Solid phase reaction: Attachment of diphenylacetylen e isocyanate deriviative onto DNA oligonucleotide The chemical synthesis of 3 la beled probe has proven the most ch allenging part of this project. Several approaches to synthe size the morpholidate derivative were considered. The retrosynthetic approaches are shown in Figure 2-8. Route A and B would be the most direct approaches to incorporate the substituted be nzophenone derivative into the oligonucleotide. Route A simply involves the synthesis of the FMRfamide sequence from the 5 3 direction with uridine as the last base at the 3 termin al followed by direct modification of the sugar

PAGE 38

38 NH N O O N O P O O '5DNA-O NH O O N O O P 5'DNA-O OO O O NH P'3-2 P2 O O Figure 2-7. The two targets shown above ar e the two potential approaches which the benzophenone derivatives can be at tached to the oligonucleoside. portion of the uridine to give the subs tituted benzophenone morphorlidate. Route B involves the synthesis of the 4-substituted benzophenone morphorlidate phosphoramidite followed by the incorporation of the phos phoramidite during the 5 3 DNA synthesis. Routes C and D are alternate approaches to synthe size the morpholidate phosphoramidite and will be discussed as part of the back up work due to the initial unsuccessful attempts in route A and B Preparation of aminomethy l benzophenone derivative 2-methyl-4-methoxy-(4-chloromethyl) benzophenone ( 11 ) was prepared by Friedel-Craft acylation54-57 of the commercially available 3-methyl anisole with 4-chloromethyl benzoyl chloride ( 8 ) in the presence of the aluminum chloride in anhydrous dichloroethane (Figure 2-9). This reaction gave exclusively para -acylated product 10 which was used without further purification. The transformati on of the chloro derivative, 10 to a primary amine 11 was achieved in a telescopic two-step reaction. First, compound 10 underwent nucleophilic displacement by NaN3 in DMF at 60oC overnight to give compound 9 Then, the azide 9 was reduced by PPh3/H2O to give compound 11 Due to the similar polarities of compound 9 and the triphenylphosphine oxide byproduct, they were difficult to separate by regular column

PAGE 39

39 chromatography. Therefore, compound 11 was isolated as an HCl salt ( 11a ) by acidifying the crude residue ( 11 ) with 1 equivalent of 1M HCl in methanol. Product 11a was extracted into the aqueous layer, leaving the undesired byproduct in the organic phase. Compound 11a was NH O O N O N H HO O O Cl NH O O N O O P ACATCACCATCTACACTTO OO NH O O N O OH OH O P ACATCACCATCTACACTTO OO N O O A B C D O O NH3 Cl O OH OH HO N NH O O NH O O N O O N Cl O O 16 8 14 11a1510 Figure 2-8. Retro-synthesis of the 3 labeled probe. then isolated by lyophilization to give an 85% isolated yield. Because the separation of compound 11 from the triphenylphosphine oxide was difficult, catalytic hydrogenation was attempted. In that experiment, the azide 9 was reduced to amine 11 with hydrogen in the presence of palladium unde r atmospheric pressure. Although the isolation of the product under this approach was feasib le, the reaction stopped at 80% conversion and required further purification. Therefore, this method was abandoned.

PAGE 40

40 The third method used was Gabriel synthesis58 to convert chloro derivative 10 to amine 11 in a two-step process. Potassium phthalimid e underwent nucleophilic subs titution of the chloro derivative 10 at 60oC in DMF to give substituted benzophe none phthalimide derivative, which was isolated by extraction with diethyl ether a nd dried to give a pale yellow solid. Compound 11 was attained by the Ing-Manske procedure59 which involved the reaction of benzophenone phthalimide with ethanolic hydrazine at refl ux temperature. This approach produced a precipitate of phthalhydrazide along with the primary amine. The solids were re-dissolved in a large volume of dichloromethane. Since the amine 11 was soluble in DCM, but not the phthalhydrazide byproduct, the latter was removed by filtration, leaving compound 10 in the organic phase. Upon rotary evaporation, compound 10 was isolated with a 68% overall yield in 2 steps. Chemical synthesis of morpholidate nucleoside The chemical synthesis of the morpholidate nuc leoside was originally inspired by the method disclosed by Erlager and Beiser.60 Later, Read and Brown61 developed a two-step procedure Cl O Cl O O Cl O O NH2 1)NaN3/DMF60oC A=PPh3/H2O10 11 8 O O O N3 9 NK O O AlCl3,ClCH2CH2Cl 1) 2)NH2-NH2B=Pd/H211a=prod+HClsalt HO O Cl OxalylChloride cat'DMF CH2Cl20oC Figure 2-9. Synthesis of subs tituted o-methylbenzylphenone.

PAGE 41

41 for the preparation of morpho line nucleoside based upon their studies in ribonucleoside cleavage with sodium periodate and trea tment of the resulting 2',3'-secodialdehyde with methylamine under reductive conditions to afford the N-4' -methylmorpholine derivative. Summerton and coworkers developed this chemistry to a commer cial process during their work with antisense oligonucleotides.62 Summertons synthetic procedure for the mo rpholidate compound however involved a one step process to convert the s ugar portion of the nucleoside in to an unsubstituted morpholine derivative under a mixture of aqueous/methanol condition. (Figure 2-10). The other modified bases, which were synthesized directly from th e sugar backbone, were the methyl and ethyl 4substituted morpholidate. Ammonium biborate wa s originally employed as the amine source for the morpholine ring because of the chelating capab ility of the biborate salt and the concern for epimerization of the dialdehyde 12 However, the use of either ammonium carbonate or ammonium bicarbonate as the amine source also afforded a single di astereomer of the morpholine nucleoside in good yield. Summertons work has been a success with non substituted amine and using substitutions with small alkyl groups such as methyl or ethyl but larger, more hydrophobi c substitutions at the 3 amino position have not been fully explored. O N H HO O OH OH HO B B NaIO4/MeOH NH2(BO2)4NaCNBH414 O O O HO B O N H HO B 13 HO OH 12 Figure 2-10. Morpholidat e synthesis by Summerton

PAGE 42

42 Model compound: Synthesis of 3-benzymorpholidate To optimize the chemistry of the morpholid ate reaction, a benzyl-substituted morpholine uridine nucleoside 16 was synthesized as a model compound (Figure 2-11 ) Table 2-1 summarizes all of the reaction conditions for the benzyl-sub stituted morpholino uridine 16 Reaction a followed the original prot ocol developed by Summerton.63-64 In a one-pot reaction, uridine, 1.5 equivalent of NaIO4 and 1 equivalent benzylamin e were added together. The reaction follows the following se quence: the 2,3-dio ls of uridine first underwent oxidative cleavage to give dialdehydes 15 which then followed by benzylamine captured of the dialdehydes in situ to form a postulated intermediate,63 2,3-dihydroxyl morpholidate similar to compound 13 shown previously in Figure 15. Reducti on of dihydroxyl morpholidate via sodium cyanoborohydride afforded the 4-ben zyl 2-uridylmorpholine derivative 16 Reaction 1 resulted in multiple polar products, but none of which were successfully isolated. Reaction b was carried out in similar reaction conditions as reaction 1 except that a 50% methanol/water mixture was used rather than 100% methanol. Due to the major difference in NH O O N O O O HO NH O O N O N HO BzNH2,NaCNBH3NH O O N O OH OH HO NaIO4 15 16 Methanol or H2O Figure 2-11. Synthesis of benzyl morpholidate polarities between the pr oduct and water, compound 16 crashed out of solution during the reductive-amination step, leaving all of the ot her by-products in the aqueous phase. Compound 16 was isolated by extraction with dichlorometh ane. Concentration of the organic solvent

PAGE 43

43 afforded a yellow solid with high purity. Compound 16a was confirmed by LCMS and 1-HNMR. Table 2-1. Summary of the reaction conditions us ed to optimize the synthesis of 4-benzyl morpholidate in Scheme 7. Reaction Solvent Reaction concentration Isolated yields of compound 16 (%) A MeOH 0.1 M 0 B MeOH:H2O (50:50 v/v) 0.1 M 10 C H2O 0.1 M 25 D H2O 0.05 M 56 Carrying out reaction c in aqueous phase improved the yield slightly. The yield was further improved to 56% under more diluted aqueous conditions in reaction d Synthesis of probe 1: Incorporation of subs tituted benzophenone derivative by direct modification of the 3 terminal uridine to "morpholinouridine". Route A was the most direct approa ch to incorporate compound 11 into the oligonucleotide shown in Figure 2-12. The 2,3-dio ls at the 3 end of the ur idine on the 19-mer oligonucleotide (5 ACATCACCATCTACATTU 3) was oxidatively cleaved by treating it with excess sodium periodate in 100mM N-(2acetamido)iminodiacetic acid ( ADA) buffer at pH 6.0.65 Di-aldehyde intermediate similar to compound 15 was made, which was detected by analytical HPLC. The oxidative cleavage reaction was slow as HPLC an alysis suggested only 40% dialdehyde product was formed. Due to the short-term stability of the dialdehydes, a reductive amination reaction with aminomethyl benzophenone 11 was carried out in situ without removing the excess NaIO4. 20 equivalents of the aminomethylbenzophenone 11 in DMF were added to the oligonucleotide followed by addition of NaCNBH3 reducing agent. After the firs t 24 hours, only a small trace of a new peak formed. When the reaction was allo wed to go for 48 hours, the other side reaction took place and multiple peaks were detected on the HPLC. It was inconclusive as to whether the formation of new HPLC peaks was due to side reactions or to the decomposition of the DNA.

PAGE 44

44 The oligonucleotide was lyophili zed and further purified by se mi-preparative scale anion exchange HPLC. Purification failed and th is reaction resulted in no product. Synthesis of 4 substituted benzophenone-mo rphorlino nucleoside and its phosphoramidite Since the direct incorporation of compound 11 onto the 3 terminal of the oligonucleotide was unsuccessful, synthesis of the benzophenone-morpholidate 17 via O NH2 O NH O O N O O P ACATCACCATCTACACTTO OO NH O O N O OH OH O P ACATCACCATCTACACTTO OO N O O NaBH3CN NaIO4ADAbufferpH6.0 DMF 11 P2 Figure 2-12. Synthesis of the 3 label probe via route-A by direct modifica tion of uridine at the 3 terminal of the oligonucleotide. route B was studied. Previously, the synthesis of benzyl-morpholidate 16 was optimized under aqueous phase. However, water is not a suitab le solvent system for the benzophenone substrate because compound 11 was far more hydrophobic compared to benzyl amine. Therefore, the synthesis of compound 17 using the method developed by Stirchak et al.63 was reconsidered and further optimized. Table 2-2 summarized the reaction conditions that were examined for synthetic route B (Figure 2-13). The morphorlidate reactions B1-B6 were carried in similar manners In the presence of compound 11 uridine was treated with 1 equivalent of NaIO4 in a 0.1 M mixture of water:methanol solution at room temperature. Th e oxidative cleavage of 2 and 3diols afforded

PAGE 45

45 the dialdehyde 15 (previously shown in Figure 2-16), which reductively aminated the shift-base formed in situ by the treatment of NaBH(OAc)3 to afford the morphorlidate compound 17 In reaction B1-B3 the solvent system was gradually changed from water to water/ methanol mixtures, to 100% methanol. Generally, th e morpholidate product can be detected in 1H-NMR by a distinct anomeric proton at approximately 5.66 ppm. However, no product was observed for reactions B1-B3 The failed reactions are possibly due to the poor sol ubility of compound 11 in alcoholic solvents. Note that the solvent ch oices for this reaction are limited, partly because DNA nucleotides are insoluble in most organic solvent, whereas compound 11 is poorly soluble in polar solvents such as me thanol, ethanol and isopropanol. The reaction to convert compound 18 to 5-TBDMS-protected morpholidate 19 was carried out in methanol. In a similar manner, the oxidati ve cleavage of uridine was achieved by treating it with sodium periodate, followe d by the addition of compound 11 to capture the dialdehyde intermediate and form 2dihydroxyl morpholid ate. The dihydroxy of the 2, 4-dihydroxy morpholidate was subsequently reduced by sodiumcyanoborohydride to afford compound 17 However, TLC revealed that this reaction resulted in a complex mixture of polar products. Although the crude was purified by flash column chromatography, the separation of the mixture remained unsuccessful. 1H-NMR did not detect the formation of the anomeric proton from the morphorlidate. The reaction was discarded. The poor solubility of compound 11 in aqueous and alcoholic solv ents still remains to be addressed. Therefore, compound 11 was converted into a hydrochloride salt, 11a by treating the free base (compound 11 ) with 1 equivalent of hydrochloric acid. The reaction was repeated in methanol. Once compound 11a was made soluble in methanol, dramatically improved results were observed in reaction B4-B6 The yields are reported in Table 2-2 The product was

PAGE 46

46 confirmed by LC/MS and 1H-NMR. The signature anomer ic proton was obs erved at 5.90 ppm as double of doublets (dd). NH O O N O N HO O O NH O O N O OH OH HO 1) 11 ,NaIO42)NaHB(OAc)3/HOAc NH O O N O OH OH O TBDMS NH O O N O N O O O TBDMS 17 18 19 1) 11, NaIO4,MeOH 2)NaHB(OAc)3/HOAc TBDMS-Cl pyridine,imidazole TBAF RouteB Figure 2-13. Evaluating protec tion at the 4 OH position to im prove synthesis of morpholinouridine derivative Table 2-2. Optimization conditions fo r synthetic route B and yields. Reaction AminomethylbenzoPhenone Reducing Agent Solvent Concentration (Molar) Isolated Yield 1 11 NaBH(OAc)3MeOH:H2O (50:50v/v) 0.05 0 B2 11 NaBH3CN MeOH:H2O (80:20 v/v) 0.05 0 B3 11 NaBH3CN MeOH 0.05 0 B4 11a NaBH3CN MeOH 0.05 10% B5 11a NaBH3CN MeOH 0.01 25% B6 11a NaBH3CN MeOH 0.005 66%

PAGE 47

47 To complete the phosphoramite synthesis, compound 17 was treated with 2-cyanoethyl N,N-diisopropylchlorophosphor amidite in the presence of Huni g's base in freshly distilled dichloromethane at 0C (Figure 2-14). The reaction wa s washed with saturated NaHCO3 and the crude product was extracted with additional dichloromethane, and was passed through flash column chromatography to afford compound 20 as a yellow solid in 78% yield. NH O O N O N HO O O NH O O N O N O O O P O N CN 2-CyanoethylN,N'diisopropylchlorophosphor amidite DIEAP,DCM0oC 20 17 Figure 2-14. Synthesis of substituted benzophenone phosphoramidite. Incorporation of phosphora midite into DNA synthesis An 18-mer oligonucleotide was synthesized from a 5 3 direction by the DNA synthesizer using standard manufacturing pr otocol as discussed in the DNA synthesis section below. Compound 20 was coupled onto the oligonucleot ide separately as the last step following the phosphoramidite method desc ribed in Figure 2-16. The coupling time of compound 17 was allowed for 30 minutes. Synthesis of substituted benzophenone mo rphorlidate via alternate route C and D After many failed attempts to synthesize subs tituted benzophenone mo rphorlino nucleoside 17 via direct incorpor ation of compound 11 other synthesis routes were examined. In the synthetic

PAGE 48

48 Route C shown in Figure 2-16, compound 16 originally was synthesized as a model compound, hich can be used as a precursor to co mplete the synthesis of the benzophone NH O O N O N O O O P O 16Tetrazole 1 )detritylation Cl2CCO2H 2 P O O O OH P O O O ODMTr PO O NC NH O O N O N O O O P O P O O O O oxidationI2/H2O O O O ACATCACCATCTACACT-OH ACATCACCATCTACACT-O ACATCACCATCTACACT-OH ACATCACCATCTACACT-O CPG CPG CPG CPG Figure 2-15. Adaptation of the 2-cyanoe thyl phosphoramidite synthesis method. morpholidate 17 in two additional steps. The first st ep was the protection at the 6-OH position, which was achieved by treatment of compound 16 with 1 equivalent of TBDMS-Cl in the presence of imidazole in anhydrous dichlorome nthane. The crude product was purified by flash column chromatography to afford compound 18 in 90% yield. Compound 18 was carefully dried under high vacuum prior to subjecting it to Friedel-Craft acylation using AlCl3. The reaction was quenched with water and neutralized by 1 N NaOH to pH 8.0. Although para -acylated product 19 was expected, the 1H-NMR suggested otherwise. The complex aromatic split pattern in the 1H-NMR spectrum suggested ortho -substituted product and loss of the TBDMS protecting group as Compound 17 The phosphoramidite synthesis of 20 from compound 17 was then

PAGE 49

49 carried out by treating compound 17 with 1 equivalent of 2cyanoethyl N, N-diisopropylchlorophosphoramidite and Hunig's base in a nhydrous dichloromethane. After 24 hours, however, no reaction was observed. All starti ng material was recovered after workup. After having confirmed the quality of the recovered morpolidate compound to be 21 which was synthesized from compound 16 (Figure 2-17), was re-evaluated. A possible explanation for the unsuccessful phosphor ylation of the 6 OH position of compound 17 is that the AlCl3 used in the Friedel-Craft acylation reacti on led to the wrong produc t. If the TBDMS protecting group was lost prio r to the addition of compound 8 the result would be simple acylation of 6 OH to give compound 22 (Figure 2-18) instead of th e Friedel-Craft acylation at the para-position of benzene to give the intended product compound 17 This hypothesis was confirmed by treating compound 22 with 2 M NaOH. TLC analysis showed the hydrolysis of compound 22 and resulted in two spots: one spot had the same polarity as compound 16 and the NH O O N O N HO NH O O N O N HO O O NH O O N O N O O O AlCl3,DCE 8 O O NH O O N O N O TBDMS NH O O N O N O O O TBDMS AlCl3,DCE 8 TBDMS-Cl DCM,Imidazole1617c21 1819 TBAF NH O O N O N HO O O 17 Figure 2-16. Synthesis of benzophenone via synthetic Route C

PAGE 50

50 N H O O N O N O A l C l 3 D C E 8 1 6 N H O O N O N O O O N a O H M e O H 2 2 T B D M S 1 8 Figure 2-17 Instead of the Friedel-Crafts acylation, tr eatment with Lewis acid leads to the lost of TBDMS and resulting in acylation of 6 OH. other was slightly less polar than the starting material. The tw o spots were separated by flash column chromatography and the starting material, compound 16 was isolated. DNA Synthesis and Purification Three oligonucleotides were prepared for th e ligation experiment. The template was a 42-mer, FRMF-amide sequence (referring to th e amino acid sequence that appears in this protein) that is unique to th e neuron cell of the Aplysia, which was purchased from IDT DNA Technologies (Coralville, IA) and was purified by Dr. Daniel Hutter. The sequences of the two short 19-mer oligonucleotide probes complement the FRMF-amide sequence. Both of the 19mer DNA oligonucleotides listed below were custom synthesized. The oligonucleotide 1 used for 5 labeled probe was synthesized from a 3 5 direction. A modifi ed 4-mono-methoxytrityl protected 5-amino thymidine was chosen to be in corporated at the 5 end to serve as a handle that links together the oligonuc leotide with the organic molecu le, namely the 1-isocyanate 4-

PAGE 51

51 phenylacetylene. Preparation of 5labeled probe (oligonucleotide 2 ) requires DNA synthesis from a 5 3 direction and uridine wa s incorporated at the last nucleobase of the 3 end. Oligonucleotide 1 3 U TTCACATCTACCACTACA 5 Oligonucleotide 2 3' GCCAAATACTCCAAACCC T-NH2 5 Both 19-mers were synthesized on solid support by the standard -cyanoethyl phosphoramidite method (Figure 2-18). The standard coupling time for each phosphoramidite was 5 minutes by manufacturing protocol. The successive inco rporation of phosphoramidite was measured by trityl yield. Each coupling step re leased an average of ~90% of the trityl group, indicating successful incorpora tion of the nucleoside. The only exception was the coupling condition for the modified based which was coupled separately at the last step and was allowed 30 minutes for coupling. Oligonucleotide 1 was cleaved from the solid support and deprotected by standard treatment with concentrated ammonium hydroxide at room temperature or 40% methyl amine in water. The deprotection of oligonucleotide 2 on the other hand, required heating at 55oC overnight. The deprotected ol igonucleotides were purified by preparative anion-exchange HPLC. The total yield of the purified products was determined by UV absorption. Analytical HPLC confirmed that the pur ity of the products was 100%. Concluding Remark This dissertation reports the successful synthe sis of the two organic substrates for the attachment of probe 1 ( P1 ) and probe 2 ( P2 ). The synthesis of the 1-isocyanato-4-(2phenylethynyl)benzene ( Compound 4) involved two key transformati ons. The first reaction was the Sonogashira coupling of the phenyl acetylene and 4-iodobenzoate ethy l, and the second was the Curtius rearrangement to give the isocya nate derivative. The attachment of compound 4 to oligonucleotide 1 was examined by 2 methods: one used the solution phase and the other used

PAGE 52

52 Tetrazole 1)detritylation 2)coupling O B1 O O DMTrO B1 O HO B1 O O B1 O DMTrO B2 P O P N( i -Pr)2 OCH2CH2CN dichloroacetcacid DMTrO B2 P O P OCH2CH2CN O B1 O DMTrO B2 P O P OCH2CH2CN O 3)oxidation I2/H2O Ac2O methylimidazole 4)capping O B1 OH HO BnP O P OH O NH3OH cleavage and deprotection Starthere CPG Figure 2-18. Solid phase DNA synthesis cycle a solid support. In solution phase chemis try, despite the 5-terminal amine having the preferential reactivity with isocyanate 6 over water, the isocyanate 6 was too unstable and quickly hydrolyzed in aqueous solvent. The so lid support method provided successful coupling of compound 6 onto the oligonucleotide and was perfor med while the DNA was still protected on the controlled-pore glass (CPG). After deprotection and HPLC pr eparative purification, P2 was obtained with a 28% yield. The 4-am inomethyl-(2-methyl-4-methoxy)-benzophenone hydrochloride salt (compound 6 ) was successfully prepared for P1 We have also prepared morpholidated nucleoside containing the benzyl appendage followed by Friedel-Craft acylation to achieve compound 7. SummertonStirchaks one-pot method for the synthesis of 4substituted morpholidate-uridine was challenging and unsuccessful at first, which led to

PAGE 53

53 exploration of several other approaches to attach compound 10 to the oligonucleotide. However, it was reevaluated and upon furt her reaction optimization, compound 13 was successfully synthesized with a 65% yield. Compound 13 was used to prepare the phosphoramidite and was successfully coupled on to the DNA. Photo Initiated Ligation Experiment Experiment 1: Photolysis Reaction In this preliminary experiment, we wanted to demonstrate that this dual probe ligation experiment could be used to detect DNA sequen ces. The layout of the experiment were as followed: Reaction 1 : P1 + P2 (1:1 ratio no T) Reaction 2 : P1 + P2 + T (1:1:1 ratio) Reaction 2 : *P1 + P2 + T (1:1:1 ratio) Template 5 GGTTTATGAG G TTTGGGAAAAGTGTAGATGGTGATGTATTA 3' P1 19-mer 3' BzPM -UTTCACATCTACCACTACA 5' P2 -RNCO 3' GCCAAATACTCCAAACCCT-NHCODPA 5' 5'CGGTTTATGAGGTTTGGGA|AAAGTGTAGATGGTGATGTATTA3' 3'GCCAAATACTCCAAACCCT|UTTCACATCTACCACTACA5'BzPM DPA 5'CGGTTTATGAGGTTTGGGAAAAGTGTAGATGGTGATGTATTA3' 3'GCCAAATACTCCAAACCCTUTTCACATCTACCACTACA5'TPNh Figure 2-19. Two 19-mers were annealed on a 42 -mer template and was mixture was subjected to photo-irradiation. The two substituents attached to P1 & P2 will reaction under UV induction to form a new substrate call TPN. The vertical line in the middle indicates where each primer meet. Two 19-mer probes were annealed to the comp lementary 42-mer template. The ligation of the two relatively short primers produced a full 38-mer via photo-induction. We chose a longer template for the convenience of differentiati ng the ligated 38-mer product from the starting

PAGE 54

54 template. Two reactions were set up to run in parallel (Figure 2-19). Reaction 1 contained a mixture of two primers ( P1 and P2 -RNCO) without the template. Reaction 2 contained two primers ( P1 and P2 -RNCO) with the complementarytemplate. Photoreactions were performed in PBS buffer with added EDTA. To form the duplex structure, an equal mixture of 1 nmole of P1 and P2 and a 42-mer were dissolved in 100 mM NaCl, 10 mM phosphate buffer (K2HPO4/KH2PO4 pH 7.0) and 0.1 mM EDTA to a final volume of 1 mL solution of pH 7.0. An Eppendorf tube containing the mixture was incubated at 90o C and then slowly cooled to room temperature. The tubes were each placed into a Pyrex test tube filled with water. The samples were placed into a Hanovia photo reactor box and irradiated with continuous UV light (110 1100 nm) for 40 hours. The reading te mperature was maintained at 28o C. An aliquot (50 L) was drawn from the reaction every 10 hours for analys is. In this experiment, Pyrex glass served as a filter system. Since the DNA has a str ong absorption maximum at 260 nm and Pyrex has a UV absorption cut-off at <300 nm, the latter wa s considered a reasonab le filter to provide protection for the DNA in the reaction from UV damage 32P Analysis of experiment 1: One way to detect the form ation of the ligation product was by radioactive labeling. Radiol abeling is considered one of th e most sensitive techniques in detecting low concentrati on substrates. Dr. Nicole Leal performed the 32P labeling at the 5 terminal of DNA oligonucleotides for the aliquo t samples from the photo Diels-Alder reaction. The amount of ligation product was assumed 100% for the convenience of labeling purposes. An equal amount of 32P ATP was used to label DNA primers and template. The DNA was suspended in 10 mM Tris at pH 8.5, and a solution containing 32P ATP was applied. The mixture was then incubated at 37oC for 30 minutes. The product was analyzed by PAGE analysis (Figure 2-20).

PAGE 55

55 After the PAGE gel was exposed for 10 hours to UV irradiation, it showed only a very faint and undefined band at approximat ely 38-mer nucleotides for both reaction 1 and reaction 2 However, significant DNA degradation was due to prolonged continuous exposure to the UV lamp. It became more apparent after the 42-hour time point that all of the primer and template had degraded. Due to the significant amount of degradation, the gel image needed to be oversaturated in order to make vi sualization of the 38-mer product possible. There were also products that were much larger than the 48-me r template which could potentially be due to UV irradiation which caused thymidine dimerization. The result of the phot o Diels-Alder reaction can be viewed by the radioactive gel. There was also a contamination band similar to a 38-mer oligonucleotide observed on the P1 control lane. The significa nt amount of DNA degradation and the contamination in the control led to inconclusive data. Experiment 2: Repetition of the Ph otolysis Experiment with Filters In the initial photo-ligation experiment from reactions 1 & 2 discussed above, the used of Pyrex alone to filter out UV light has proved insufficien t to protect DNA from UV damage. In order to preserve the photo-ligation produc t, the photo Diels-Alder reacti on was repeated with several modifications made to address the DNA degradation issue. First, it should be noted th at the 19-mer primer cont aining the 4-methoxy-2-methyl benzophenone substituent ( P1 ) was re-purified by PAGE purif ication prior to repeating the experiment. DNA degradation was due to long -term exposure to the UV light, and therefore, one necessary modification to be made was by reducing DNA from the UV exposure by allowing shorter reaction time. The second approach to prevent DNA degradation was by implementing a better light filtering system. Here, we introduced the use of a combination of chemical and glass filter systems for the isolatio n of monochromatic light (Figure 2-21). Pyrex glass is generally known to have light cut-off at <300 nm; however, the percent transmission

PAGE 56

56 Figure 2-20. PAGE gel (10%) of primer/template photochemistry. Each lane contains 0.4 pmol of 32P-labeled primer template complex. La ne 1, Template 48-mer; Lane 2, Primer 19-mer (P1); Lane 3, Primer RNCO 19-mer (P2); Lanes 4-6 were exposed to UV for 10 hours. Lane 4, P1 & P2; Lane 5, P1, P2 a nd T; Lane 6, P1 *P2 (same as P2 primer but from a different purification) and T. Lanes 7-9 were exposed to UV for 22 hours. Lane 7, P1 & P2; Lane 8, P1, P2 and T; La ne 9, P1 *P2 and T. Lanes 10-12 were exposed to UV for 32 hours. Lane 10, P1 & P2; Lane 11, P1, P2 and T; Lane 12, P1 *P2 and T. Lanes 13-15 were exposed to UV for 42 hours. Lane 13, P1 & P2; Lane 14, P1, P2 and T; Lane 15, P1 *P2 and T.

PAGE 57

57 Figure 2-21. Transmission of some commercial glass filter useful for the 100 nm region. From the web site of Rolyn Optics Company, 706 Arrowgrand Circle, Covina, California 91722. of light varied linearly by the thickness of the glass. Figure 2-21 also showed that a significant amount of light in between 250 nm to 300 nm re gions can still be transmitted through. Since DNA absorbance maximum is typically at 260 nm UV light transmitted through Pyrex at this region can be detrimental to the experiment. In order to sufficiently protect DNA from UV damage, additional filtering is required. Therefore, in reaction 3 the photo Diels-Alder reaction was repeated while implementing a combination ch emical filter and doubling the thickness of the Pyrex glass from 1 mm to 2 mm to prevent DNA degradation. Reactions 3 and reaction 4 were carried out in similar concentration as reaction 1 and reaction 2 (figure 2-22). Reaction 3 contained two primers ( P1 and P2 -RNCO) without the complementary template, while in reaction 4 the primers ( P1 and P2 ) were annealed to the 42-mer template. Photoreactions were performed in PBS buffer with added EDTA in side 2 layers in a Pyre x test tube (16x100 mm, 25x150 mm) to provide better UV protection. The i nner test-tube was fille d with a uridine (0.1 M aqueous) solution, which has a absorbance maximu m at 260 nm, to be used as a cooling bath and also as a filter for UV light at 260 nm wh ich potentially causes damage to the DNA. The

PAGE 58

58 samples were irradiated with a Hanovia medium pressure mercury arc lamp with continuous UV light for 2 hours. An aliquot (30 L) was drawn from the reaction ev ery half hour for analysis. M DPA TPN h 42mer 19merP219merP1 19merP219merP1 42mer 3'5' 3'5' 3'5' 3'5' 42 mer 5 CGGTTTATGAGGTTTG GGAAAAGTGTAGATGGTGATGTATTA 3' P1 19-mer 3' BzPM-UTTCACATCTACCACTACA 5' P2 -RNCO 3' GCCAAATACTCCAAACCCT-NHCO-DPA 5' Figure 2-22. Repetition of th e photo Diels-Alder reaction Figure 2-23. A PAGE gel (10%) of Primer/Templ ate Photochemistry. Each lane contains 0.4 pmol of 32P-labeled primer template complex. Lane 1, Template 48-mer; Lane 2, Primer 19-mer ( P1 ); Lane 3, Primer RNCO 19-mer ( P2 ); Lanes 4-5 were exposed to UV for 30 minutes. Lane 4, P1 & P2 ; Lane 5, P1 P2 and T;. Lanes 6-7 were exposed to UV for 1 hour

PAGE 59

59 The aliquots drawn from reaction 3 were analyzed by 32P labeling. The results are shown Figure 2-23. It should be noted that the controls used in the PAGE gel were from the previous experiment. Therefore, the contamination in lane 2 ( P1 ) was irrelevant to th is experiment since P1 was previously purified before repeating the e xperiment. A better indication of the purities of the two primers is lane 4, which consisted of just P1 & P2 without template. W ithin the first half hour of irradiation, no product was observed in la ne 4 when the two primers were irradiated without the template. However when the template was present, there was a faint band of product formed in lane 5. At the next three time poi nts (e.g., at 1 hour, 1.5 hour and 2 hours) of irradiation, the band intensities of the starting materials at lane 6, 9, and 11 steadily decreased, indicating that the reaction occu rred. However, no corresponding increase in the product band was seen. We hypothesize that this was due to degradation. One striking observation was that after 2 hours of continuous irradiation, an unexpe cted product band was observed in lane 10 even though the primers were used without the template. Even though we were able to detect th e 38-mer product in the second repeat photoreaction, quantification of the product was difficult due to si gnificant DNA degradation. The use of a combination of uridine and Pyrex glas s filter to isolate light >300 nm still proved insufficient to prevent this problem. Howeve r, under careful consider ation, uridine has an absorbance maximum at 260 nm and its UV trace tail s off at ~280 nm. It was not surprising that uridine was not able to block out a broad range of light. Hence, we continue to explore other filtering systems which can block light in the 250 nm nm region. Experiment 3: Repetition of the Photolysis Experiment: Evaluation of Chemical versus Optical Filters After evaluation of various UV/Vis spectra of different chemicals, t hymidine and 3-methyl anisole were selected as chemi cal filters for the next photolysis experiment. Figure 2-24 shows a

PAGE 60

60 superimposed spectrum of thymidine and methyl an isole. Thymidine is represented by the black curve and has a broader absorbance maximum display from 260 nm and 270 nm, while methylanisole has a doublet with the absorbance maximum at 273 nm and 283 nm and the UV trace drops off sharply at 300 nm. Together these two chemicals might serve as a better UV filter for the particular regions which can be critical to the success of pres ervation of the product once it is formed. Another alternative to chemical filtration is the commercial optical filter, which can selectively transmit light having ce rtain properties (often, a particul ar range of wavelengths, that is, range of colors of light), while blocking the remainder. There are numerous types of optical Figure 2-24. UV spectrum of two compounds, thymidine and methylanisole which are superimposed into a single image. Verti cal scales are not normalized. Images are from NIST Chemistry WebBook. filters available such as absorptiv e filters, reflective filters, m onochromatic filters, interference filters, long pass and short pass filters, and band pass f ilters. Each type of filter filters light at a certain wavelengths by absorption, reflection, or interference, while transmitting others (Figure 2-25). Long pass is an optical interference glass filter that attenuates shorter wavelength light and transmits longer wavelengths light. Because it is designed to have a sharp transition at each cut-on point and has a wide range of the filtration (ult raviolet, visible, or IR), it is an ideal choice Methyl anisole Thymidine

PAGE 61

61 to explore for our experiment. In the next expe riment to be discussed, a 325 nm long pass filter was used to remove undesirable light. Finally, 3 photo Diels Alder react ions were carried out, reaction 1 reaction 2 and reaction C to explore the efficiency of th e two UV filter systems. Reaction 1 and C were performed with the combination of chemical filters (satuated th ymidine solution and 3-met hyl anisol in ethanol) and Pyrex glass. These reactions were perfor med with 3 layers of Pyrex glass tubes and a combination of thymidine and methylanisole solution to provide additional filter to absorb light in the 250 nm nm regions. Reaction 2 was performed using a long pass optical filter with a cut-on at 325 nm. The reactions were carried ou t in similar reaction conditions as the previous experiment in phosphate buffer at pH 7.0 and EDTA Reactions 1 and 2 consisted of the Figure 2-25. Long pass filter described by th e cut-on wavelength at 100 percent of peak transmission. Type A filter is in UV re gion and type B filter is in IR region 2 primers annealed to a template ( P1 + P2 + T) at a 1:1:1 ration while reaction C is the control with just the primers ( P1 + P1 ) at a 1:1 ratio and without te mplate. The reactions were irradiated for a total of 2.5 hours and the al iquots were drawn at 30-minute time points for 32Plabeling and PAGE analysis. 32P ATP was labeled at the 5 end of the Primer/Template, and the results were examine by PAGE gel (Figure 2-26 and Figure 2-27).

PAGE 62

62 Table 2-3. The layout of the 32P labeling experiment. Three separate reaction were ran in parallel under different filtering system. Reactio n-1 performed under the combination of pyrex and chemical filter while Reaction-2 was with the used of just the long pass optical filter. A 50 mL aliquot was draw n from the reaction at every 30 minutes interval. Reaction-1 ( P1+P2+ ) (5-time points) Reaction -2 (1+P2+ T) (5-time points) Reaction-C ( P1+P2) no template (5-time points) Rxn (30 min) Rxn (30 min) RxnC (30 min) Rxn (1hr) Rxn (1hr) RxnC (1hr) Rxn (1.5 hr) Rxn (1.5 hr) RxnC (1.5 hr) Rxn ( 2hr) Rxn ( 2hr) RxnC (2. hr) Rxn (2.5 hr) Rxn (2.5 hr) RxnC (2.5 hr) Figure 2-26. A PAGE gel (10%) of Primer/Template Phot ochemistry. Each lane contains 0.4 pmol of 32P-labeled primer template complex. Reaction C = P1 + P2 Reaction 1 = P1 + P2 + T. Reaction 1 was performed using a combination of the chemical and glass filter system)

PAGE 63

63 Figure 2-27. PAGE gel (10%) of Primer/Template Photochemistry. Each lane contains 0.4 pmol of 32P-labeled primer template complex. Reaction C = P1 + P2 Reaction 2 = P1 + P2 + T (Reaction 2 was performed using the 325 nm long pass optical filter) According to the PAGE gel shown in figures 2-26 & 2-27, neither the optical filtering system nor the combination of chemical and glass filtering systems provided much improvement in degradation in the DNA. However, the intensity of the product in reaction 1 seems to have slightly more product than reaction 2 which merely suggested that the use of both the chemical filters with pyrex glass made a slightly better filter system. However, because there were so much degradation, quantification of the relati ve intensities of the product bands was very difficult. In order to view a good amount of the 38-mer product the image was over-saturated. Once again not only a 38-mer product observed even when the template was not present, the band intensities formed are darker than the reaction that is template d. There are also products at ~ 80-mer in size which begins to show after the 1-hour treatment with UV light. This could be attributed to UV irradiation which causes t hymine dimers. There also seems to be some degradation of the template (see P1 + P2 + T) in the control reacti on which was not exposed to UV light.

PAGE 64

64 It appears that a product is being formed over time that has the approximate mobility of that expected for the covalently linked material in that it requires the absence of the template, it does not co-migrate with any of the template UV-induced degradation products, and it goes away upon longer irradiation. If the linker that hold s the two pieces together is the Diels Alder product of the photoenol and the acetylene, we consider the experiment su ccessful. It is conceivable that the template holds the two species in a way that is not conducive to the reaction, which means that the underlying chemistry is good. We need merely tw eak the linkers to allow the photoenol to be near the acetylene, and this is progress. Mass Spectrometry of the Oligonucleot ide for Structure Identification Another alternative to provi de structural proof of th e photoenol product is by mass spectrometry. Matrix Assisted Laser Desorpti on/Ionization Time-of-Fli ght (MALDI-TOF) Mass Spectrometry is one technique offering promise for the fast and accurate determination of a number of large samples such as biomolecules proteins digest, pr eptides, glycoproteins, oligosaccharides, and oligonucleotides. Hence, mass spect ra were obtained for the lanes without and without template. Multiple runs were perfor med. The goal is to find the fragments and the Diels Alder adduct The MALDI technique is based upon an ultr aviolet absorbing ma trix pioneered by Hillenkamp and Karas.66 It bombards the sample molecules with a laser light to bring about sample ionization. The sample is premixed with a highly absorbing matrix compound, which transforms the laser energy into ex citation energy for the sample, le ading to sputtering of analyte and matrix ions from the surface of the mixture. The matrix serves as a vehicle to efficiently transfer energy so the analyte molecules are spar ed excessive direct energy that may otherwise cause decomposition. The laser is fired, energy arriving at the sample/matrix surface is

PAGE 65

65 optimized, and data are accumulated until a spectrum having acceptable signal is collected. The time-of-flight analyzer separates ions according to their mass-to-charge (m/z) ratios by measuring the time it takes for ions to travel th rough a field free region k nown as the flight, or drift, tube. The heavier ions are slower than the lighter ones. Sample preparation Typically, the DNA does not ionize well in a sample with a hi gh concentration of salt. Therefore, the samples remaining from the radiol abeling experiments retrieved from Dr. Nicole Leal required desalting. This was done by tw o consecutive processes, ethanol precipitation followed by microscale C18 ziptip fractionation. On ce samples were eluted from the C18 ziptip column with 50% CH3CN/H2O, they were mixed (1:1 v/v) with the matrix (3-hydroxypicolinic acid:diammonium citrate, 9:1), a matrix used fo r oligonucleotides larger than 3000 daltons. The goal is a molar ratio of matrix:DNA of approxima tely 10:1; it remained an open question as to whether enough DNA is generated in thes e experiments to meet that goal. The sample/matrix mixture was spotted onto an ionization metal plat e, with the goal of homogeneously dispersing the DNA within the ma trix molecules in a "co-crystallization" process. The frequency of the pulsed laser beam was played with to optimize the signal assigned tentatively to the DNA. According to theory, this is a frequency that is optimal to transfer energy to the matrix, which is partially vaporized, carrying intact DNA into the vapor phase and creating a DNA backbone that gives a signal. Mul tiple laser shots are used to improve the signal-to-noise ratio and the peak shapes, which increases the accuracy of the molar mass determination. The only mass spectrometer suitable for this wo rk available at University of Florida was within the ICBR facility. Due to th e nature of their core operation, this was set up for peptide and proteins studies, however, and ca librated only for low molecular weight peptides. Therefore, an

PAGE 66

66 external calibration was perf ormed with known commercial samp les (external calibration) as well as our starting materials. All the mass spect ra were obtained usi ng linear negative mode. As controls, mass spectra were taken of the template 42-mer, 11-mer, and the two primers, P1 and P2 The same sample was scanned multiple times. Unfortunately, each repeat mass spectra provided a slightly different masse s for the same compound, and often no ions of the appropriate mass was seen at all. Figur e 2-28 shows a mass spectrum of the 42-mer template. The peak detected at 13189.2080 [M+15] was assigned as the parent peak, while the molecular weight of the 42-mer should be 13173.6. There was also an exact half mass of the parent peak detected at m/z (z = 2) = 6593.2808 a nd an m/z (z = 3) = 4396.0786. In another scan of the exactly same 42-mer samples, (Figure 2-29) the parent peak was detected at 13081.7900, which is also assigned as the parent peak of the 42-mer is = [M-85], m/z (z=2) is 6556.7537, and m/z (z=3) is 4370.3931. One notable detail about this 42-mer template is that the signal for the half mass is significantly stronger than that of the parent peak. Indeed, most of the time, only the doubly charged ion was detected. Thus, Figure 2-30 was obtained from scanning the same 42-mer. This time, however, only the doubly charged 42-mer template was detect ed (m/z (z=2) is 6560.7). Thus, with these 3 measurements, the uncertainty of the expected mass was set at mass units. Table 2-4. Analysis of 42-mer MS. DNA Mass mass mass mass mass Molecule PO-OH PO-ONa all PO-O1 PO-O1 PO-O= M 17 PO-OH 16 PO-OH 1 PO-ONa P2 5922 6318 5904 (18-) 5921 5943 The P2 primer was also used as a control (Fi gure 2-31). The expected molecular weight of P2 primer is 5922 (fully protonated, uncha rged), 5921 (with one phosphate not having a proton, therefore generating the molecule with one negative charge overall), 5920 (the same

PAGE 67

67 molecule with two negative charges, which w ould therefore give a m/z = 2960), 5919 (the same molecule with three negative charges, which would therefore give a m/z = 5919/3 = 1973), ions were detected where was putatively z=1 having: m/z = 5892.0 (less than the theoretical ma ss of the protonated monoanion by 29 daltons), m/z = 5911.24 (less than the theoretical mass of the prot onated monoanion by 10 daltons, perhaps one Na+ this would give a theoreti cal mass of 5943, making the ion with an m/z of 5911.24 lower by 33), m/z = 5775.1318 (less than the theoretical mass of the protonated monoanion by 146 daltons). Table 2-5. Mass spec analysis of 19-mer primer ( P1 ). DNA mass mass mass mass mass Molecule PO-OH PO-ONa all PO-O1 PO-O1 PO-O= M 17 PO-OH 16 PO-OH 1 PO-ONa P1 5892 6288 5874.4 (18-) 5891 5913 A mass spectrum of P1 was difficult to obtain. Similar laser intensity was applied to the sample, but the sample generated only one sm all peak slightly above the noise at 5879.4 [theoretical for the protonated monoani on is 5891, higher by 12 daltons, well within experimental error] was assigned as the parent peak of P1 (Figure 2-32). Figure 2-33, 2-34 and 2-35 are the spectra of the aliquot from the photochemical experiment with just two primers at a two hour time point (Figure 2-26). In Figure 2-34, the only detectable mass is 5897; in Figure 2-35, more th an one peak was detect ed. The ions having a measured m/z of 5911 and an ion having a slightly higher m/z (not read by the computer, but perhaps + 11 +22) could arise from either of th e primers (z=1, in their non-sodiated versions, m/z=5891 or m/z=5921) or the product having z=2 (non-sodiated m/z = 5898.5) suggest that one of them belongs to the half mass of the product or the other primer. Because none of the other peaks in the higher molecular were detected, it is difficult to determine whether the mass was

PAGE 68

68 from ionization of the primers or the half mass of the product which is 5881. Both of these masses fall within the range of uncertainty of mu. However, Figure 37 the peak where m/z = 5583.592 could not be assigned, alt hough it could be associated with P2 Table 2-6. Mass spec analysis of reaction 1 at 2h time point. DNA Mass Mass Mass Mass Mass Mass Molecule PO-OH PO-ONa all PO -O1 PO-O1 PO-O2 PO-O= M 35 PO-OH 34 PO-OH 34 PO-OH 1 PO-ONa Product 11798 11762 (36) 11797 5898.5 Figure 2-36, 2-37 and 2-38 are th e spectra arising from the reaction mixtures that contain both the primers and the template ( P1 + P2 + T). In these spectra, we did not detect the parent ion of the template. Rather, the largest p eaks detected were 4362.5849 and 4596.65, the latter of which was tentatively assigned as the m/z (z=3) of the 42-mer templa te. It is not uncommon that in MALDI mass spectrometry one predominant ion from a species in a mixture of compounds is observed only. It is believed that when one compound ionizes better than the other molecules in a mixture, it suppresses the signals of other compound. Other peaks detected in the 5000-6000 mass unit range were found in similar pa ttern (5963, 5834, 5619, and 5491). There were numerous peaks detected in this mass range, whic h provided us a reason to believe that one of the peaks could be the doubly ch arged ion of the product (5881).

PAGE 69

69 Figure 2-28. 42-mer : Scan 1

PAGE 70

70 Figure 2-29. 42-mer template : Scan 2

PAGE 71

71 Figure 2-30. 42-mer template: Scan 3

PAGE 72

72 Figure 2-31. Mass spectrometry of P2

PAGE 73

73 Figure 2-32. Mass spectrometry of P1.

PAGE 74

74 Figure 2-33. Reaction mixture at a 2-hour time poi nt. The aliquot was from the repeat reaction C The mixture consisted of P1 & P2 and no template ( P1 : P2 1:1 ratio)

PAGE 75

75 Figure 2-34. (Scan 2) Reaction mixture at a 2-hour time point. The aliquot was from the repeat reaction C The mixture consisted of P1 & P2 and no template ( P1 : P2 1:1 ratio)

PAGE 76

76 Figure 2-35. (Scan 3) Reaction mixture at a 2 hour time point. The aliquot was from the repeat reaction C The mixture consisted of P1 & P2 and no template ( P1 : P2 1:1 ratio)

PAGE 77

77 Figure 2-36. (Scan 1) Reaction mixtures of reaction 2 which contained P1 + P2 + T at 2-hour timepoint.

PAGE 78

78 Figure 2-37. (Scan 2) Reaction mixtures of reaction 2 which contained P1 + P2 + T at 2-hour timepoint.

PAGE 79

79 Figure 2-38. (Scan 3) Reac tion mixtures of reaction 2 which contained P1 + P2 + T at 2-hour time point.

PAGE 80

80 Fluorescent Emission of 1,2,3-Triphenylnaphthalene Another way to detect the ligation of the tw o primers is to monitor the formation of the photo-Diels-Alder product, 1,2,3-substituted triphenylnaphthalene that joins the DNA primers. 1,2,3-substituted-triphenylnaphtha lene is a highly co njugated aromatic compound and processes a blue fluorescent colo r visible under a hand-held UV lamp. It was previously synthesized in the model st udies for the photo-Diel s-Alder reaction. The 1,2,3-substituted triphenylnaphthalene should have the same fluorescence absorbance and emission maxima regardless of whether its is attached to DNA or not. The next few paragraphs will discus s the fluorescent studies of compound 3 in comparison with the DNA photo-Diels-Alder pr oduct. A spectrofluorometer (Jobin Yvon-Spex Fluorolog, Edison, New Jersey) wa s used to characterize the fluorescent emission of 1,2,3-substituted-triphenylnaphthalene. Fluorescence is generally acquired by setting the excitation and emission monochromators to the appropriate wavelengt hs for the fluorophor. However, because 1,2,3-substituted-triphenylnaphthalene is a novel compound, its maximum excitation and emission wavelength is not known. Modified 1,2,3-triphenylnapht halene has a broad absorbance spectrum at between 280 nm with a maximum at 298 nm. Thus, the general fluorescent emission of compound 3 was acquired by setting the excitation monochromator at 290 nm and the sc anning wavelength with the emission monochromator. To determine the emi ssion maximum, the optimal excitation wavelength must be determined first. Thus the excitation wavelengt h can be determined by fixing the emission monochromator and al lowing the excitation monochromator to scan at a range of wavelengths. Since we are comparing the fluorescent emission of 1,2,3-substituted

PAGE 81

81 triphenylnaphthalene as an organic molecule measured in organic solvent versus in aqueous solvent, we are expecting observation of a spectral shift resulting from the general effect of solvent polarity. To make an adequate comparison of emission spectrum of 1,2,3-substituted triphenylnaphtha lene with the product formed in the DNA, photo Diel-Alder reaction of 1,2,3substituted triphenylnaphthalene was examined in three different solvents, methylene chloride methanol, and water. To determine the wavelength at which compound 3 fluoresces, the excitation monochromator was set at max =296 nm absorption and scanned for em ission signals. Figure 2-39 shows an excitation at 296 nm resulting in a weak em ission at 390 nm. The signal is close to background. Then, 390 nm was set as the next excitation wavelength to determine whether and absorption was present. This resu lted in a strong emission at 440 nm (Figure 2-40). As 436 nm light is violet-blue, and this color could be seen when compound 3 was optically viewed under the UV lamp. Fina lly, the excitation wavelength for maximum emission was determined at 392 nm by se tting the emission monochromator at a wavelength of 433 nm (Figure 2-41). As we expected with the solvent shift from a relatively non-polar to a more polar system, the emission of 1,2,3-substituted triphe nylnaphthalene slightly shifted left from 433 nm to 437 nm (Figure 2 42) using the excitation wavelength as observed in Figure 243. Signal intensity decreased in methanol as compared to methylene chloride. This could be due to the fact that 1,2,3-substitu ted triphenylnaphthalene contained mostly aromatic rings and is highly hydrophobic. Th erefore, it is very soluble in methylene chloride and poorly soluble in methanol, t hus leading to slight decrease in signal intensity. Similarly, the emission continues to shift slightly to the left from 436 nm to

PAGE 82

82 0 500 1000 1500 2000 2500 3000 3500 300350400450500550600 Emission wavelength nmFluorescent Intensity Figure 2-39. Emission spectrum of compound 3 (substituted 1,2,3-triphenylnaphthalene) in dichloromethane. Excitation at 290 nm; the emission monochromator scaned wavelengths between 320 nm 600 nm, at a 1 nm s-1. 0.E+00 5.E+04 1.E+05 2.E+05 2.E+05 3.E+05 3.E+05 4.E+05 4.E+05 5.E+05 5.E+05 300350400450500550600650 Emission Wavelength (nm)Fluorescent Intensit y Figure 2-40. Emission spectrum of compound 3 (substituted 1,2,3triphenylnaphthalene) in dichloromethane. Excitation at 392 nm; the emission monochromator was allowed to scan from 400 nm 650 nm, at 1 nm s-1.

PAGE 83

83 0.E+00 1.E+06 2.E+06 3.E+06 4.E+06 5.E+06 6.E+06 7.E+06 250275300325350375400425 Excitation Wavelengths (nm)Fluorescent Intensity Figure 2-41. Excitation spectrum of compound 3 (substituted 1,2,3-triphenylnaphthalene) in dichloromethane. Em ission monochromator was set at 433 nm and excitation monochromator was allowed to scan wavelengths from 200 nm, at 1 nm s-1. 443 nm (Figure 2-44) as the solvent changed fr om methanol to water. Overall, it was somewhat surprising that the change in so lvent system from methylene chloride to methanol to water resulted in a relatively small 10 nm shift in emission spectra. Perhaps this result is attributed to the large hydrophobic ity of compound 3 Because fluorophores are polar and often display speci fic interaction with its local environment, they generally have a large sensitivity to solvent polarity. On the ot her hand, nonpolar molecules are much less sensitive to solvent polarity. Thus, spectral shifts from solvent polarity can be explained by the fluorophor-solvent interacti on. Solvent effects shift the emission to a lower energy due to stabilization of the ex cited state by polar solvent molecules. Typically fluorophores have a larger dipole mo ment in the excited state than the ground state. When the fluorophor is excited, the solvent dipole can reorient or relax, which lowers the energy of the excited state. As the solvent polarity is increased, this effect becomes more prominent, resulting in emission at a lower wavelength.

PAGE 84

84 0.E+00 1.E+04 2.E+04 3.E+04 4.E+04 5.E+04 6.E+04 7.E+04 350400450500550600Emission_wavelengths (nm)Fluorescent intensity Figure 2-42. Emission spectrum of 3 (substituted 1,2,3triphenylnaphthalene) in methanol. The excitation monochromat or was set at 392 nm, and the emission monochromator was allowed to s can from 350 nm, at 1 nm s-1. 0.E+00 2.E+06 4.E+06 6.E+06 8.E+06 1.E+07 1.E+07 1.E+07 250300350400450excitation wavelengths nmfluorescent intensitiy Figure 2-43. Excitation spectrum of = 3 (substituted 1,2,3tri phenylnaphthalene) in methanol. The emission monochromator was set at 433 nm and excitation monochromator was allowed to s can from 250 nm, at a 1 nm s-1.

PAGE 85

85 0.E+00 1.E+05 2.E+05 3.E+05 4.E+05 5.E+05 6.E+05 7.E+05 250270290310330350370390410430 excitation wavelengths (nm)Fluorescent Intensity Figure 2-44. Excitation spectrum of 3 (substituted 1,2,3-triphenylna phthalene) in water. The emission monochromator was set at 437 nm and excitation monochromator was allowed to s can from 250 nm, at a 1 nm s-1 0.E+00 5.E+04 1.E+05 2.E+05 2.E+05 3.E+05 3.E+05 4.E+05 4.E+05 5.E+05 5.E+05 350400450500550600 Emission wavelengths (nm)Fluorescent Intensity Figure 2-45: Emission spectrum of DNA photo Diels-Alder reaction where the excitation monochromator was fixed at 355 nm.

PAGE 86

86 0.E+00 1.E+05 2.E+05 3.E+05 4.E+05 5.E+05 6.E+05 350400450500550600 emission wavelengths (nm)fluorescent Intensity Figure 2-46: Emission scan spectrum of 3 (substituted 1,2,3-triphenylnaphthalene) in water. These excitation monochromat or was set at 355 nm and emission monochromator was allowed to s can from 350 nm, at a 1nm s-1. The DNA photo-Diels-Alder emission spectrum was acquired by using a 10 L aliquot drawn from a 1 mM reaction and diluted to a 100 L total volume. The emission of the photo Diels-Alder reaction was determ ined to be 442 nm by setting the excitation monochromator at 355 nm and scanning for emi ssions (Figure 2-45). This result is in excellent agreement with the emission of the substituted 1,2,3-triphenylnaphthalene shown in Figure 2-46. The emission at 442 nm indicated the formation of 1,2,3substituted triphenylnaphtha lene due to ligation of the two primers. Experiment 4: Using fluorescent studies to detect the ligation reaction and product The unexpected results from experiment 2 and 3 of the photochemistry raised an interesting question: does the presence of the template inhibit ligation of the two primers? UV-induced degradation of the DNA made it very difficult to quantify the product through radio-labeling and PAGE gel analys is. However, one undeniable item of

PAGE 87

87 evidence implying the formation of product is the observation of fluorescence. Therefore, a set of 4 simple reactions was done to address to this question. Reactions 1 and 2 sought to detect photoproduct in the pres ence of template at a concentration equal to the concentration of P1 [A], which was held fixed while the concentration of primer P2 [B] was varied. Assuming that the ove rwhelming majority of the benzophenone bound to P1 is bound to template together with P2 the photoproduct generated when [A] = [B] = [T] should predominantly arise from the intra-complex Diels-Alder reaction. Additional product should arise when more P2 is added only if unbound acetylene competes with the bound acetylene for the short lived photodiene. Reactions 3 and 4 sought to detect photopr oduct in the absence of template, where reaction 4 had acetylene at a concentration fi ve times higher than reaction 3. We expect that the relaxation of the transi ently generated photo-dienol to give the parent ketone is in competition with the Diels-Alder trapping reac tion; therefore, under some kinetic models, Reaction 4 should give five times more fluorescent product than Reaction 3. Reaction 1 P1 [A] = 1, P2 [B] = 1 [template] = 1 if template inhibits, fluorescence = 0 Reaction 2 P1 [A] = 1, P2 [B] = 5 [template] = 1 Fluorescence should be the sa me for a templated process Reaction 3 [A] = 1, [B] = 1 [template] = 0 Reaction 4. [A] = 1, [B] = 5 [template] = 0 fluorescent should be 5x more Fluorescent analysis of experiment 4 The obvious feature of the plot of the reac tions without template is the fact that adding five times more acetylene trap generate s more, but not five times more,fluorescent product. One explanation for this is that th e benzophenone is all consumed. Estimates of the molar fluorescence of the 1,2,3-triphenylnaphth alene derivative sugg ests that this is

PAGE 88

88 not the case. Typical phenylnapthalenes ha ve an emission of xxx lumens/molar. The amount of fluorescence seen is less than 1% of what is expected. The reactions were carried at 1 M concentration of each DNA species (5 M for the 5x) in potassium phosphate buffer (pH 7.0, 100 mM, with 0.1 mM EDTA). Mixtures were irradiated for 2 hours (Pyrex filter with chemical solutions) and then analyzed by fluorescent studies. Figures 2-47 show the relative amount of fluorescent product in each reaction, and the over all summary of these studies is shown in Figure 2-52. The results of these experiments are consis tent with the radio-labeled PAGE gel. The fluorescence formed from the non-templa ted reactions were more intense than reactions that were templated. However, there was still a low level of fluorescence detected in the templated reac tions, indicating that the presen ce of template only hindered the rate of reaction but not co mpletely inhibited it. (P1+P2+T 1:1:1)723250 0.E+00 1.E+05 2.E+05 3.E+05 4.E+05 5.E+05 6.E+05 7.E+05 8.E+05 9.E+05 33037041045049053057 0 Emission wavelength nmIntensity Figure 2-47. Reaction 1 ( P1 + P2 + T 1:1:1 ratio): the cu rve represents the reaction mixture after 2 hours of irradiation.

PAGE 89

89 (P1:P2:T, 5:1:1 ratio)924010 0.E+00 2.E+05 4.E+05 6.E+05 8.E+05 1.E+06 1.E+06 33037041045049053057 0 emission wavelength n m Intensit y Figure 2-48. Reaction 2 ( P1 + P2 + T 1:5:1 ratio): the cu rve represents the reaction mixture after 2 hours of irradiation. (P1+P2 no T 1:1 ratio)1019330 3.3E+02 2.0E+05 4.0E+05 6.0E+05 8.0E+05 1.0E+06 1.2E+06 330370410450490530570 Emission Wavelength nmIntensity Figure 2-49. Reaction 3 (P1 + P2 1:1 ratio a nd no T): the curve re presents the reaction mixture after 2 hours of irradiation.

PAGE 90

90 (P1+P2 5:1) 1556981 0.0E+00 2.0E+05 4.0E+05 6.0E+05 8.0E+05 1.0E+06 1.2E+06 1.4E+06 1.6E+06 1.8E+06 330370410450490530 Emission Wavelength nmIntensi t Figure 2-50. Reaction 4 (P1 + P2 + T): the cu rve represents the re action mixture after 2 hours of irradiation. 0.E+00 2.E+05 4.E+05 6.E+05 8.E+05 1.E+06 1.E+06 1.E+06 2.E+06 2.E+06 0246 concentration P2[B]Intensit y Templated not templated Figure 2-51. Summary of experi ment 4: the linear black line in the graph represent the fluorescence of a templated reaction (1 & 2) at different concentration of P2[1B]. The linear blue line is re lative fluorescent intensity in a nontemplated reaction (3 & 4)

PAGE 91

91 Therefore, one might expect fluorescence intensity of reaction 1 & 2 (templated) remained approximately the same while the fluorescent intensity of the reaction 3 & 4 (not templated) increased. The fact that the fluorescence intensity in reaction 4 was merely double the intensity of reaction 3 and not 5 times stronger as exp ected suggests that the rate of product formation is non-linear. Experiment 5: Concentration Dependent St udies of the Photo Diels Alder Reaction Lastly, we wanted to determine whet her the photo Diels-Alder reaction is concentration-dependent of th e reagent. In experiment 5 3 different sets of reactions were carried to further expl ore the photo Diels-Alder reac tion, and fluorescence was used as an indication of product formation (Table 2-7). Table 2-7. Experiment 5. Reactions 14 consisted of P1 + P2 +T where the concentration of P2[B] changes. Reacti ons 5-8; consisted of P1 + P2 +T Reaction dP1[A] [(substituted o-methylbenzophenone) dP2[B] (di-Phenylacetylene) dT [C] 1 1 1 1 2 1 2 1 3 1 7 1 4 1 9 1 5 1 1 2 6 1 1 4 7 1 1 6 8 1 1 8 9 1 2 0 10 1 4 0 11 1 6 0 12 1 8 0 13 1 10 0 KEY: Reaction 1-4 consisted of P1 + P2 + T and we varied the concentration P2 Reaction 5-8 consisted of P1 + P2 + T while we varied the concentration of T Reaction 9-13 consisted of P1 + P2 and zero T while we varied the concentration of P2

PAGE 92

92 Fluorescent analysis of experiment 5 The fluorescent studies of experiment 5 are summarized in Figure 2-52. Reaction 14 showed a steady linear increa se as the concentration of P2 increases. However, in the absence of the template (reaction 9-14 ), the fluorescent product initially increased linearly at a much higher rate as the concentration of P2 increased from 2 to 4 equivalents but then reached a plateau. In the presence of excess template, there is not a significant increase in the rate of the product formation. 0.E+00 5.E+05 1.E+06 2.E+06 2.E+06 3.E+06 3.E+06 4.E+06 4.E+06 0 2 4 6 8 10 12 concencention d(P2, 7)[B, C] int nes ity P1 +dP2[B] + T dT[C] + P1 +P2 P1 + dP2[B] T=0 buffer Figure 2-52. Fluorescent studi es summary of experiment 5 Each data point represents the maximum emission of the fluorescent product formed Conclusion and Future Direction This chapter describes the first exam ple of LIFES developed for molecular detection. The development of these molecular probes involved two parts. The first part

PAGE 93

93 involved the syntheses of the oligonucleoti de probe, and the second part was the demonstration of the LIFES in solution phase detection. The milestones of this work can be summarized as followed: 1. 4-(1-(4-(aminomethyl)phenyl)-6-methoxy-3phenylnaphthalen-2-yl)benzoic acid was successfully synthesized by photo indu ced Diels-Alder reaction of o-methylbenzophenone derivative and diphenylacety lene. This triphenylnaphthalene derivative is a novel fluore scent compound and has an emission at a wavelength of ~440 nm. 2. We reported the successful syntheses of bot h the 3 labeled and 5 labeled probes. The notable challenges involved the s ynthesis of benzophenone morpholidate nucleoside, compound 17 Multiple synthetic routes were investigated for the incorporation of the benzophenone deri vative onto the nucleotide. Compound 17 was successfully synthesized by re-optimizing of Summerton and co-workers procedure to afford an over all yield of 65%. 3. Photo Diels-Alder reaction of the DNA prim ers were carried out to validate the concept of LIFES in solution phase de tection. Evidence provided from the radioactive labeling and fluorescent studi es detected the 38-mer product band and that the preliminary ligation experi ment was a success. However, product formation was also detected in the reactions where the primers ( P1 & P2 ) were not templated. 4. Further experiments were carried out to confirm that the ligation reaction is concentration dependent and template inhibited. 5. Fluorescent studies further confirmed that the ligation of the primers is better without template and suggested that the presence of the template hinders to DielsAlder process. This was confirmed by th e amount of fluorescent signal detected describe in experiment 3 6. A fluorescence study was done to confir m the fluorescence of the triphenyl naphthylene derivative is c onsistent with the fluore scence formed in the DNA photo Diels-alder reaction. Emission signa l at 437 nm from the DNA reaction indicates the subsequent triphenylnaphthal ene derivative formation driven by the photo Diels-Alder reaction between the dienol of o -methyl-benzophenone moiety and diphenylacetylene moiety on the two oligonucleotides ( P2 & P1 ). This also further confirms that the 38-mer band obser ved in the PAGE analysis is indeed the ligation product. However, due to significant degradation in the DNA, we were not able to qua ntify the product yield.

PAGE 94

94 Therefore, the remaining work in the near future involves determining for product yield for the DNA photo Diels-alder r eaction and quantum yield of the triphenylnaphthalene substrate. However, pres ent data suggest two fundamental issues in the photo Diels-Alder reaction, which were th e degradation of the DNA and the ligation product of the primer even when the template was not present. These issues need to be resolved before product yields can be accurate ly quantified. Hence, our future work will be changing the linker that is attached to the DNA oligonucleotide and the organic substrate (benzophenone and the acetylene mo ieties) to improve the rate of the photo Diels-Alder reaction from that of the non-templated reaction.

PAGE 95

95 CHAPTER 3 PSEUDOCYTIDINE Background The Watson and Crick model of the double-he lical structure for deoxyribonucleic acid (DNA)1-3 follows 2 simple rules of complementarity : 1) size complementarity of purines and pyrimidines and 2) hydrogen bonding complementar ity between the two mol ecules.(Figure 3-1) Using these simple rules of A pairs with T, and C pairs with G, early molecular biologists were able to design a molecular recognition system whereby artificial molecule s could be synthesized that would bind to DNA while synthe tic organic chemists were able to explore these remarkable features of DNA67 without complete understanding of the DNA double helical properties. Many years ago Dr. Benners group noted that the Watson-Crick nucleobase pair geometry is not limited to the four standard nu cleotides in natural DNA, A, T, G and C.67-68 Rather, twelve nucleobases forming six base pairs joined by mutually exclusive hydrogen bonding patterns are conceivable within the geometry of the Watson-Crick base pair (Figure 3-2). The Benner group has shown that these form extended nucleobase an alogs with the carbon/n itrogen ring systems that are isosteric to natural purines or pyrim idines and can be used to implement hydrogen bonding functionality, producing a DNA-like ru le-based molecula r recognition system69 using an array of patterns which are not found in natura l DNA. Nonstandard purines (puAAD, puDAA, puADA, and puDDA) were synthesized to co mplement the pyDAD, pyDDA, pyADD, and pyAAD nucleobases (nomenclature: D = hydr ogen bond donor, A = hydrogen bond acceptor). This artificial chemical system supports molecula r recognition using simple rules, like DNA, but orthogonal to natural DNA. Orthogonality implies that DNA and the artificial genetic system would not cross-react. These constitute the Artificial Expanded Genetic Information System (AEGIS)

PAGE 96

96 N X X ribose X X N N N X X H H H ribose X=heteroatom N-glycoside pyrimidinepyrine Figure 3-1. Generic representati on of Watson-Crick model: small pyrimidines pairs with large purine. X represents a heteroatom. Th e two base pairs bind together by hydrogen bonding of the heteroatom between the 2 nucleobases. The dotted lines indicate double bonds filled in to complete the va lence to make aromaticity of the heterocycles. N N N R r O H H N N N N O N r H H H py D AADonor Acceptor Acceptor Acceptor Donor Donorpu A DDN N O R r O N N N N N N r H H py A D AAcceptor Donor Acceptor Donor Acceptor Donorpu D A DH H H N N O R r N N N N N N O r py AA DAcceptor Acceptor Donor Donor Donor Acceptorpu DD AH H H H H N N N r N H H N N N N O O r H py D A DDonor Acceptor Donor Acceptor Donor Acceptorpu A D AN N N R r O N N N N O N r H H py DD ADonor Donor Acceptor Acceptor Acceptor Donorpu AA DH H H H H N N O R r N N N N N N O r py A DDAcceptor Donor Donor Donor Acceptor Acceptorpu D AAH H H H H r r=ribose Figure 3-2. The Artificial Expa nded Genetic Information System As shown is the hydrogenbonding patterns joining 12 different nucle obases with Watson-Crick specificity. Nomenclature is as follows: pu) a 5-6 fu sed ring system; py) a six-membered ring with the hydrogen-bonding pattern of acceptor (A) and donor (D) groups.

PAGE 97

97 The most thoroughly studied of these non-na tural pairs is pyAAD:puDDA (isoC-isoG or 5meisoC-isoG) joined by thr ee hydrogen bonds in duplex nuc leic acids (Figure 3-3).70-76 The meisoCisoG pair has established technol ogical value in reducing background signal 73 in widely used commercial diagnostic nucleic acid hybridization assays7779 approved by the U.S. Food and Drug Administration and othe r global regulatory authorities. AEGI S now is used in the clinic to monitor the viral load in ove r 400 000 patients, annually inf ected by human immunodeficiency virus (HIV) and hepatitis C virus.78 Another clinical and research application in development is real-time quantitative PCR assay.79 Non-natural isoCisoG or MeisoCisoG pairs have also been used as mechanistic probes of the fundamental biological processes of te mplate-directed nucleic acid synthesis,80 translation,82 protein-mediated st rand exchange of DNA 83 and excision repair 84 etc. N N N N O N N N N O H H H H H R R N N N N N O N N O N R R H H H H H p y A A D:puDD A p y D A A :pu A DD C:GisoC:isoG Figure 3-3. Hydrogen bonding patt ern of C:G is denoted as pyDAA:puADD respectively. Nomenclature is as follows: pu is purine ring and py is a six-member pyrimidine ring with the hydrogen-bonding pattern of accepto r (A) and donor (D) groups. Isocytosine and isoguanine can form a Watson-Crick base pair with standard geometry but with a hydrogen-bonding pattern unlike those found in the natural base pairs A-T and G-C. Isocytosine and 5-Methyl 2-deoxyisocytidine It was suggested over three decades ago by Rich85 that the isoC-isoG base pair might have been a component of primitive nucle ic acids early in the developmen t of life. In the late 1980s,

PAGE 98

98 the first experimental work was done to expl ore the oligonucleotide chemistry of this nonstandard base pair, including its ability to be incorporated by enzymatic template-directed polymerization. Since then, several other labor atories have made ma jor contributions to developing the chemistry and enzymology of the is oC-isoG base pair, including those of Tor and Dervan,86 Horn et al.,87 and Switzer et al.,88 A variety of RNA and DNA polymerases have been found that catalyze template-dir ected incorporation of this base pair into DNA and RNA.71 This work has shown that these bases can pair in both an antiparallel duplex as well as a parallel duplex, with similar stability to a guanine and cytosine base pair.89-90, 71-72 isoC was originally developed by Christopher Switzer (Figure 3-4).88 The synthesis involves formation of anhydrouridine 26 through Mitsunobu coupling of 5 OH of 2',3'-Oisopropylideneuridine with the 2-ketone of the heterocycle giving 2',3'-isopropylidcne-2,5'cyclouridine.90 Subsequently, the tr eatment of anhydrouridine 26 with ammonia afforded isocytidine 27 Uracil base is converted into 2-de oxyisocytosine by removal the 2 OH function via standard Barton-McCombie reaction. However, isoC was rather unstable. Two modes of degradation, deamination and depyrimidination,95-96 have often been observed for isoC derivatives. NH O O N O O OH N O O N O O N O NH2 N O O OH R R R DBU NH3/MeOH 252627 24aR=H 24bR=Me PPh3/DEAD O O O NH O O N O OH OH R OH DMP Figure 3-4. Synthesis of the isocytidine deriva tive from uracil/thymidine via the formation of anhydrous uracil.

PAGE 99

99 Tor and Dervan 85 introduced 2'-deoxy-5-methylisocy tidine as a substitute for its 5unsubstituted counterpart. The preparation of 5methyl 2-deoxyisocytidine simply involved the use of thymidine as a starting substrate instead of uracil.94 Despite the significant structural similarities that isoC and isoG share with natural nucleosides, it has not been triv ial to convert procedures and protecting groups used for the automated solid-phase synthesis of standard o ligonucleotides to be su itable for preparing oligonucleotides containing isoC and isoG. While isoC has been re ported as relatively sensitive to treatment with either acid or base, 5meisoC, with a methyl group at the 5 position, renders the molecule much less sensitive.91 The benzoyl protecting group for the exocyclic 2 amino group of the isoC derivative prepared for solid pha se synthesis reportedly underwent hydrolytic deamination under basic oligonucleotidedeprotection conditions (Figure 3-5).87 Another mode of degradation is the depyrimidination, or cleava ge of the glycosylic bond of the isocytidine derivative, which has been repo rted to occur during acidic de tritylation in oligonucleotide synthesis (Figure 3-5). O OR" O N N O N H R' H O OR" O H N N O N H R' N H N O O OR" O R' H2O O OR" O R' OH 5-methyl-2-(2-oxo-2phenylethyl)pyrimidin-4(1 H )-one 29 31 H2O O Ph O Ph O Ph 28 30 Figure 3-5. General mechanism of acid driven depyrimidination of isocytidine

PAGE 100

100 NH O O N O OH OH HO N O NH2 N O OH OH HO H O H H2O NH O NH2 N O OH OH HO OH2 NH O NH3 N O OH OH HO OH -NH3/H2O Figure 3-6. Mechanism of hydrolytic deamin ation of isocytidine under basic ammonia condition. The 5-methyl isocytidine intr oduced by Tor and Dervan, was supposed to be more resistant towards both deamination 95-96 and acid depyrimidination96 However, incorporation of protected isocytidine phosphoramidite into the oligonucleo tide using standard solid phase synthesis presented the same problems. Monomer phosph oramidite was synthesized with the benzoyl protecting group at the exocyclic amine as shown in scheme 25. Strobel et al.97 however reported that benzoyl protection of the 2-amino of 5-methylisocytidine also deaminated when subjected to acidic condition during solid phase synthesis Horn et al.,98 however, reported no deamination upon basic deprotection of the s ynthetic oligonucleotides using formamidineprotected 2-deoxy-5-methylisocytidine phosphoramidites, although they did report depyrimidination when the disoMeC (= me5isoCd) nucleobase was protec ted as a benzoate. It was also found that N2-benzoyl -2'-deoxy-5-methylisocytidine99 is too acid-labile for practical use; it was even labile under non-protic detritylation conditions. Another suitable protecting group besides the benzoyl was considered for the phosphoramidite synthesis. Formamidine protecti on was chosen for the exocyclic N-atom of me5isoCd ( 33 ) because 2'-deoxy-N2-[(dimethylamino) methylidene]-5-methylisocytidine ( 39 ) is considerably more stable to acid conditions than the corresponding N-benzoyl-protected compound ( 36 )98 Figure 3-7. However, following depyrimidination, dMeisoC monomers are still susceptible under acidic89, 96-98 and alkaline conditions.96-98

PAGE 101

101 N O NH2 N O OH OH R 33 N O N N O OH OH R N O N N O OH ODMTr R N O N N O O ODMTr R (Me)2N OMe OMe Pyridine DMTrCl Pyridine P Cl O ( i Pr)2N CN i Pr2NEt2,CH2Cl2 N(Me)2 N(Me)2 N(Me)2 P N( i Pr)2 O CN 37 38 39 N O O N O OH R 32 MeOH/NH3N O N H N O OH ODMTr R N O N H N O O ODMTr R P Cl O ( i Pr)2N CN i Pr2NEt2,CH2Cl2 Ph Ph P N( i Pr)2 O CN 3536 N O N H N O OH OH R Ph O O O Benzoylchloride DMTrCl Pyridine 34 Figure 3-7. Synthesis of isocytidine phosphoramid ite derivatives with various protecting group. In this work we report a new the synthesis of 5-( -D-Ribofuranosyl) cytosine (pseudocytidine). As part of the effort to impr ove the chemical instabil ity of isocytidine and 5methyl 2deoxycytidine, pseudocytidine, whic h implements the same hydrogen bonding pattern as isocytidine, was produced. Since it has been determined that the N-glycosidic bond of isocytosine is susceptible to depyrimidinati on under acidic condition, we proposed a novel pyrimidine analog, 2-deoxy-pseudo cytidine, which replaces the Nitrogen in the ring with a carbon. The resulting 2-deoxy-pseudo-cytidine is a C-nucleoside. It uses the same hydrogen bonding pattern with 2-deoxyisocytidine pyAAD (F igure 3-8). One useful feature pseudo-

PAGE 102

102 cytidine offers structurally, besides the considerably mo re stable C-C bond linking the pyrimindine ring and sugar, is the easily accessible nitrogen at the 6 position which will allows attachment of useful appendages. N N O NH2 NN O NH2 R O OH HO O OH HO pu:AAD isoC pseudoC R=H,Me Figure 3-8. Two non-natural nucleobases (isoC and pseudoC) share the same exact hydrogen bonding pattern. Synthesis of CNucleoside Pseudouridine was the first C nucleoside found in nature discovery in 1957.101 Other C nucleosides have also been isolated as nucleoside antibiotics from the cult ure filtrates of various Streptomycetes.102 The unique structural ch aracteristic of C nucleosides, which distinguishes them from the ordinary nucleosides, is th e presence of a carbon-carbon linkage instead of carbon-nitrogen bond between the aglycone and suga r moieties. This structural feature renders traditional approaches103 for nucleoside synthesis of limited value. Pseudoisocytidine has the potential clinical importance as an anti-leukemic agent. In 1973, S. David and A. Lubineau102 reported the first synthesi s of C-nucleosides, namely the pseudouridine103and pseudocytidine derivatives.104-105 Their method involved the condensation of a suitably protect ed sugar with a preformed pyr imidine-5-yllithium derivative 41

PAGE 103

103 Figure 3-9. However, these proce dures provided low yields, are di fficult to perform, and are not suitable for large-scale preparations. More im portantly these methods are specific for each C nucleoside, i.e., for the synthesis of each modifi ed base analogue, preparation of a particular pyrimidine 5-lithio derivativ e is required individually. NH N NH2 O BuLi/Ether -400C N N N H OTMS I TMS CHO HC HC HC H2C Ph Ph COH HC HC HC H2C O O O O Ph Ph NH N NH2 O COH HC HC HC H2C OH OH OH OH NNH O O N O OH OH HO cyclilization deamination Deprotection 41 42 434445 Figure 3-9. First C-nucleoside sy nthetic method by David and Lubi neau. Features condensation of 2,5-dilithio-2,4-bis(trimethylsilyl)-c ytosine with 2,4:3,5-di-O-benzylidene-Dribose. In 1976, Watanabe developed a general method th at can apply to the syntheses of other C nucleosides and demonstrated the synthesis of 2-thiopseudouridine (52) ,106-107 pseudouridine (51), and pseudoisocytidine ( 50a,b ) in a four-step synthesis from 2,3-O-isopropylidene-5-Otrityl-D-ribofuranose ( 46) Condensation of the common inte rmediates acrylate derivative 48 49 with urea followed by deblocking of the product afforded 51.106 Deprotection of 51 yields pseudouridine Figure 3-9. The extensions of th ese syntheses to other pyrimidine C nucleosides with modifications in the aglycone further de veloped. Watanabe reported the synthesis of pseudocytidine in 1984 by modifying pseudouridine.107 The synthesis was accomplished in seven steps starting from pseudouridine (Figure 3-10). Thus far, most of the synthetic procedur e for C-nucleosides has focused in the RNA

PAGE 104

104 O DMTO O O OH O DMTO O O O DMTO OH OH CO2Et CO2Et H ONa O HO OH OH N H N NH2 O O HO OH OH HN N O NH2 O DMTO OH OH NH HN O O HCl Ph3P CO2Et 2)RONa EtOCHO/NaH EtOH guanidine Ethanol or 464748 49 O DMTO OH OH CO2Et H O MeI DMF urea NaOEt thiourea NaOEt O DMTO OH OH HN S O 5050a50b 51 52 O DMTO OH OH NH HN O O NH Figure 3-10. General synthetic method of Cnucleoside. The key termediate 49 can be cyclilized to vairous products. nucleosides. 2-deoxypseudocytid ine has never been reported. Here we describe the synthesis of 2-deoxypseudo-cytidine and its us e in DNA synthesis, which is based on Heckcoupling of a N-protected pse udo-cytosine base with a corr esponding furanoid glycal. Heck chemistry has successfully been applied in the past for the synthesis of C-nucleosides with configuration at the pseudoanom eric center using a variety of natural and nonnatural bases.108-111 Results and Discussion Synthesis of Pseudocytidine via Heck Coupling The key step involved in synthe sis of the pseudo-cytosine is the palladium-mediated Heckcoupling of the 5-iodocytosine heterocycl e and the furanose glycal derivative.108 These two key substrates were prepared in several steps. Figure 3-11 shows that the preparation of the heterocycle was achieved in two steps.

PAGE 105

105 HNN O NH2 N O O I HNN O NH2 I DMF NN O N I N Bu Bu N Bu Bu O O 60oC MeOH 5 3 54 55 Figure 3-11. Synthesis and formamidin e protection of 4-exocyclic amine. Cytosine was treated with N-iodosuc cinamide (1.2 equiv.) in DMF at 50oC overnight to give 5-iodocytosine ( 53 ) in 75% yield without purification required. Methylation of the of compound 53 at the 1-position and protection of the 4-amino was achieved in a one-pot reaction by using N,N-dibutylformamide dimet hylacetal (2 equiv.) in meth anol to give the shift-base product 54 This reaction has been well documented by Hosmane and Leonard.109 N,Ndibutylformamide dimethylacetal (compound 55 ) was prepared by condensing N,NDimethylformamide dimethylacetal with di-n-but ylamine and isolated by vacuum distillation. DMTr-Cl Pyridine DMAP TBDPS-Cl imidazole CH2Cl2HMDS/ NH4SO3 59 58 57 56 O N NH O O HO OH O N NH O O DMTrO OH O N NH O O DMTrO OTBDPS O N NH O O HO TBDPS O HO TBDPS Sat'dHClinMeOH Figure 3-12. Synthesis of 1,2 de oxy-1,2-dihydro-3-O-TBDPS furanose.

PAGE 106

106 1,2 deoxy-1,2-dihydro-3-OTBDPS furanose (compound 59 ) was synthesized in 4 steps following the procedure describe d by Lan & McLaughlin (2001)110113 (Figure 3-12). The first step involved the protection of the thymidines 5 OH position. The treatment of thymidine with 4,4-dimethoxytrityl chloride (1.2 equi v) in anhydrous pyridine at 0oC and a catalytic amount of DMAP afforded compound 56 in excellent yield 95%. This followed with 3 OH protection which was successfully achieved by reacting 57 with t-butyldiphenylsilyl chloride in the presence of imidazole (2 equiv.) to give compound 58 Deprotection of the dimethoxytrityl at the 5hydroxy position was easily accomplished by treating 58 in a saturated methanolic HCl solution. Compound 58 was isolated by column purification in 95% yield. Finally, hydrolytic cleavage of the N-glycoside bond was achieved by treatment of compound 58 with ammonium sulfate in hexamethyldisilisane (HMDS) at refluxing temperature to produce compound 59 in 67% yield. 54 [Pd(Oac)3]33mol% AsPPh3Et3N,DMF 60oC NaBH(Oac)3HOAc CH2Cl2TBAF O HO OTBDPS O HO OTBDPS N N O N O HO N N O N O N Bu Bu O HO OH N N O NH2 N nBu nBu + 59 6061 62 Figure 3-14. Heck coupling reaction of glycal and 5-iodocytisine to give a C-nucleoside. The general procedure to make C-nucleoside via palladium-med iated coupling is described by Zhang108 Figure 3-14. Heck coupli ng of 5-iodocytosine (compound 54 ) and the glycal

PAGE 107

107 substrate (compound 59 ) was accomplished by using tris-palladium acetate (2% mol) and triphenyl arsine as ligand, yielding two products, compound 60 and 61 In situ deprotection of the 3O-tBDPS was accomplished by the treatment of tetrabutylammonium fluoride (TBAF) (1M) solution. Compound 61 was isolated in 60% yield af ter column chromatography. Subsequent reduction of ketone 61 using NaBH(OAc)3 afforded the final pseudo-C-nucleoside 62 The shiff-base protecting group at the 2amino position was also lost during NaBH(OAc)3 reduction. Compound 62 was isolated by silica gel purifi cation in 28% isomeric purity. However, some residual of the N,N-dibutyl formaldehyde was difficult to remove. Conclusion In the third project, we have successfully s ynthesized a novel pseudonucleoside via Heck coupling of the iodo heterocycle 54 and the glycal 59 The future work remaining is the scaling up of this C-nucleoside and perfor ming enzymology studies of compound 62

PAGE 108

108 CHAPTER 4 CHEMICAL MODIFICATION OF 2-DI MENSIONAL MICROARRAY SURFACE USING CLICK CHEMISTRY Background DNA Microarray Technology Identification of genes at the nucleic acid level involves assaying gene expression by monitoring mRNA transcription.113-114 Historically, these methods had limitations because they could only use a single oligonuc leotide for detection each time, greatly reducing efficiency and in creasing cost. Transcript abundance is assayed by immobilizing mRNA or total RNA (electr ophoretically separated or in bulk) on membranes and then incubating with a radio actively labeled, gene-s pecific target. Today, there are various methods available for dete cting and quantifying ge ne expression levels, including northern blots,115 S1 nuclease protection,116 differential display,117 sequencing of cDNA libraries,118-119 and serial analysis of gene expression120 (SAGE). To overcome this problem, microarray technology, which provides a high throughput for global characterization of gene expression pr ofiling, has greatly increased speed and efficiency.121-123 It is commonly known as biochi p, DNA microarray, gene chip, or gene array. The technology was developed by Brow n and co-workers using RNA expression on a biochip to identify different gene expressi on relevant to different biological states.124 This technology allows the ab ility to monitor the whole ge nome on a single chip so that researchers can have a better picture of th e interactions among thousands of genes simultaneously. The use of microarrays for ge ne expression profiling was first reported by Schena et. al.125 DNA microchip technology offers an enormous potential for rapid multiplex analysis of nucleic acid samples, in cluding the diagnosis of genetic diseases,

PAGE 109

109 detection of infectious agents, measuremen ts of differential gene expression, and drug screening for forensic analysis.126-127 Understanding The Principle of Microarray Technology The ability to identify gene function through hybridization between nucleic acids provides a core capabilit y of molecular biology.128 Microarray technology provides high sensitivity and specificity for detection of th is function as a consequence of the exquisite mutual selectivity between complementary st rands of nucleic acids due to the WatsonCrick base-pairing principle. It consists of a high-density matrix containing thousands of immobilized DNA fragments or oligonucleotides that repr esent specific gene coding regions. These oligonucleotides are hybrid ized in a manner very similar to the northern129 and Southern blot,130 whereby fragmented DNA is attached to a substrate and then probed with a known gene or gene fragment. The detection technique can either be based on radioact ive-labeled or fluorescentlabeled probes.131-132 For radioactive detection, 33P dCTP is preferred to more energetic emitters, as array elements are physically close to each other and strong hybridization with a radioactive target can easily interfer e with detection of weak hybridization in surrounding labeled targets. As for fluorescent detection,133 Cye3-dUTP and Cye5-dUTP are frequently paired and th e differential gene expression is being measured through competitive hybridization of two mRNA sets isol ated from normal and diseased samples and labeled with different-color ed fluorescent tags. The strengt h of this approach resides in the ability to label RNA from control and treated samples with different fluorescent markers. This method allows for the simultaneous hybridization and detection of both populations on one microarray and eliminates the need to control for hybridization between arrays.

PAGE 110

110 Figure 4-1. DNA microarray sche ma (Nature Genetics 1999). Templates for genes of interest are obtained and amplified by PCR. Following purification and quality control, aliquots (~5 nL) are prin ted on coated glass microscope slides using a computer-controlled, high -peed robot. Total RNA from both the test and reference sample is fluorescently labeled using a single round of reverse transcription. The fluorescent targets are pooled and allowed to hybridize and the incorporated targets yield an emissi on with a characteristic spectra, which is measured using a scanning confocal laser microscope. In an array experiment, many gene-specifi c polynucleotides derived from the 3 end of RNA transcripts are individually arraye d on a single matrix. This matrix is then simultaneously probed with fluorescently-tag ged cDNA allowing one to determine the relative amount of transcript present in the pool by the type of fluorescent signal generated. In some cases, hybridization is done simultaneously with reference RNA to facilitate comparison of data across multiple experiments. The scheme is similar when

PAGE 111

111 using radiolabelled probe, but it is not possi ble to carry out simultaneous hybridization of test and reference samples (Figure 4-1). Fabrication of The DNA Chip There are two major formats of DNA microarray technology: 1) cDNA array format125 and 2) in situ synthesized oligonucleotide array format.134 Format I: probe cDNA (500~5,000 bases long ) is immobilized to a solid surface such as glass using robot spotting and exposed to a set of target s either separately or in a mixture. Format II : an array of oligonucleotide (20~80mer oligos) or peptide nucleic acid (PNA) probes is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. This method, "historically" called DNA chips, was developed at Affymetrix, Inc. The commercial production of arrays begins w ith the selection of the probes to be printed on the array. cDNA microarrays are generated by high-speed robotic deposition of PCR-amplified product.135 These are usually generated from purified templates, so that cellular contaminants do not find their wa y onto the array. The purified DNA/RNA is then fluorescentlyor radioact ively labeled and hybridized to the slide/membrane. Once the DNA samples are arrayed onto slides, they are air-dried. The samples are cross-linked to the matrix by ultraviolet irradiation. A similar protoc ol is used for attaching DNA samples onto nylon membranes.136 After fixation, residual amines on the slide surface are reacted with succinic anhydride to reduce the positive charge at the surface. The design and implementation of a DNA microarray experiment depends on a number of parameters. These include: i ) the chemical and physical properties of the support surface; ii ) Chip fabrication; the nature a nd length of linkers tethering the oligonucleotide probes to the solid surface; iii ) the attachment density of the probes on the surface; iv ) the sequence and length of th e DNA oligonucleotide probes; and v ) the

PAGE 112

112 washing conditions. The focus of my work in this chapter primarily focuses on the technical aspects of cDNA microarrays, specifically chip fabrication and DNA immobilization. Because surface immobilization chemistry is c onsidered one of the most important parameters that directly affects the performance of DNA microarrays, the next few paragraphs will focus on the various types of interfacial designs that will permit the attachment of pre-synthesized oligonucleotides, along with th e basic research issues and technical obstacles that remain to be addr essed before benefiting from the outstanding bioanalytical potential of this rapidly evolving technology. Slide coating chemistry The platforms commonly used for spottedarray are nitrocellulose and charged nylon, or glass slides. Thus far glass slides have been considered an ideal support used for making microarrays. It offers several un ique advantages. First, DNA samples can be covalently attached onto a treated glass surface. Second, glass is a durable material that sustains high temperatures and exposure to washes of high ionic strength without changing its physical properties. Third, it is non-porous so the hybr idization volume can be kept to a minimum, thus enhancing the annealing kinetics of probe to target. Typically, the fist step to immobilizat ion of DNA probes on solid support requires activation of the glass surface. The two methods of coating generally applied to glass are adsorptively with poly-lysine and co valently with functionalized silanes.121 The most common non-covalent method binds nucleic acids to aminopropylsilane or polylysines,125, 137 where poly-lysine binds to the surface via means of hydrogen-bonding, coulombic interaction, and van der Waal forces. As for c ovalent coating of glass, functionalized silanes are used to introduce a variety of functional groups to the glass slides with epoxy-silane and am inosaline being the most common,138-139 as well as

PAGE 113

113 (mercaptopropyl)trimethoxysilane via silyl ether linkage. The resulting silane glass slide can be used directly to bind nucleic acid or be further reacted w ith another linker to introduce a variety of surface chemistry. DNA immobilization chemistry Once the glass slide is coat ed, the next step is DNA im mobilization onto the glass slide. The most prevalant process for noncovalent DNA immobilization is printing on a polycationic surface such as aminosilane and poly-lysine by Belosludtsev et al.140 Typically, the DNA polyanionic b ackbone will interact with the polycationic surface via coulombic attraction. Once the DNA samples are arrayed onto slides, they are air-dried. The samples are cross-linked to the matrix by ultraviolet irradiation to form covalent bonds between the thymidine residues in the DNA and the positively charged amine groups on the silane slides.141 A similar protocol is used for attaching DNA samples onto nylon membranes.136 After fixation, residual amines on the slide surface are reacted with succinic anhydride to reduce the positive charge at the surface. However, it is commonly observed that the non-covalent charge inte ractions between the negatively charged phosphodiester groups of the cDNAs and the positively charged amino groups of the surface-bound lysine side-chains do not form an irreversible attachme nt of the cDNAs to the glass plate, resulting in decreased sensitivity due to loss of cDNAs from the glass surface. In addition, electrosta tic interactions between the cDNAs and the glass slide reduce the conformational freedom of the bound cDNAs and, hence, their affinity and specificity for complementary molecules in solution. While non-covalent attachment is pr esently the predominant method, there are 2 disadvantages: 1) the polycationic surface offe rs a competing binding site to the target oligonucleotides, reducing the sp ecificity of the array and 2) the probe is rigidly fixed to

PAGE 114

114 the glass plate, limiting the degrees of freed om for the oligonucleotide target to bind. Covalent coupling chemistry overcomes these limitations. First, it does not require coating with a cationic surface. Secondly, cova lent attachment allow chemists to steer the orientation of the oli gonucleotides strategically by a introducing spacer in the immobilization tether which places the o ligonucleotide further away from the glass surface and allowing more conformational orie ntations to bind because they are not restricted in 3-dimensional space. Figure 42 describes the various chemistries involved with immobilizing DNA on slide surfaces. 1a) In the first example, the glass slide is derivatized with aminopropyltrimethoxysilane, allowing several ways to attach the DNA probes onto the surface. Generally amide bond linkage is formed w ith succinylated-DNA is coupled to the primary amine surface via carbodiimide coupling. It was demonstrated that the coupling of oligonucleotides to the glass surface was 3to 10-fold more efficient at pH 3.6 than at pH 6.8.142 1b) Another means of immobilization is by further reacting the primary amine with 1,4-(phenylene)-diisothiocyanate to generate the activated glass surfaces that allow attachment using 5'-aminoalkylated oligonucleot ide. However, it was reported that a 23atom linker between the surface and the DNA oligonucleotide was not sufficient for adequate hybridization.143 It has additionally been demonstrated that the amino functional group of DNA nucleobases can compet itively react with the activated glass surfaces and interfere with the subsequent hybrid ization reaction.144 2) Amino-modified DNA can be immob ilized to the aldehyde-functionalized surface via reductive an amina tion reaction. However, this immobilization chemistry is

PAGE 115

115 Si Si Si O O O Si Si Si OH OH OH Si Si Si O O O Si Si Si O O O Si NH2 Si O O Si Si Si O O O Si SH Si NH2 Si Si Si O O O Si H N Si Si Si O O O Si S S O P O DNA O O Si Si Si O O O Si O HO N H OH Si Si Si O O O Si H N Si Si Si O O O Si H N H N O P O O O O O DNA Si Si Si O O O Si HN N H O P O O O O O DNA Si Si Si O O O Si H N H N N H O P S O O O DNA N H O n O P O O O P O O O DNA O O 3' 5' DNAprobe EDCcoupling NH2-DNAprobe NaCNBH3reductiveamination DNAprobe EDCcoupling R-S-S-DNA disulfideexchanged 1,4-phenyldiisocyanate NH2--DNA NH2(Et-glycol)-DNA 2 5 1 2 3 4 5 O H O O N H O P O O O DNA Figure 4-2. List of various covalent attachment methods of 5'modified oligonucleotides to the glass surface. Silane chemistry can derivatize the surface with various functional groups which allow different attachment chemistry to be applied: For example, the glass surface derivatized with an amino functional group can be acyla ted with reactive isocyante or carbodiimide coupling (1, 5). 2-Attach ment of DNA probe to aldehyde via reductive amination reaction. Other a lternative attachment chemistries are also used such as nucleophilic substit ution 3 and disulfide-a thiol/disulfide exchange reaction 4.

PAGE 116

116 difficult to monitor, due to limitations on discriminating between the amine modified oligonucleotide and the unmodified o ligonucleotide on the aldehyde surface. 3) The DNA probe was linked to the surf ace with a triethylene glycol phosphoryl spacer to provide a variable distance between the glass surface and the oligonucleotides. This method generally demonstrated good di scrimination between mismatched bases when using a short tether between the oli gonucleotide and the glass surface. However, efficient hybridization of the longest targets requires increased spacer length between the glass surface and the oligonucleotide probes.145, 146 4) Another approach to covalent attach ment to the glass surface is by using a derivatized glass slide with 3-mercaptopropyl trimethoxys ilane, 95%. DNA attachment via 5-disulfide-modified oligonucleotides to the glass surface was effected according to a thiol/disulfide exchange reaction at pH 9.0. Although this method provides efficient hybridization, the array chip ca nnot be exposed to high humid ity, a reducing reagent, or extreme highor low-pH conditions147 since the disulfide bond is susceptible to reduction. Research Objective So far, we have discussed various m eans of covalent immobilization of DNA probes. Most of this work primarily fo cused on improving the hybridization by adding tethers to place distances between oli gonucletides and the surface in order to reducesurface interference. Here we report a chip design featuring the attachment of DNA via diazonium coupling which exploits the efficiency of Click chemistry.148-149 The coupling product results in an internal built-in dark quencher DABCYL on the surface (Figure 4-3). Because this DABCYL mo iety has a light quenching property, it an potentially reduce background noise and improve signal detection at low concentration.

PAGE 117

117 Si Si Si O O O Si N N N O P O O O DNA Si Si Si O O O Si N N N O P O O O DNA DABCYLderivative Figure 4-3. Synthesis of diazonium captures species on a 2-D surfaces. Results and discussion Click Chemistry Typically a Click reaction is a reaction that generates substances by joining small units together with heteroatom links (CNXN C). Click Chemistry is defined by a particular set of powerful chemical tran sformation processes which meet stringent criteria. These criteria can be described by the type of reacti ons that are wide in scope, give very high yields, generate only ino ffensive byproducts that can be removed by nonchromatographic methods, and be stereospecific (but not necessarily enantioselective). Carbon heteroatom bond forming reactions comprise the most common examples, including the following classes of chemical transformations: cycloadditions of unsaturated species especially 1,3-dipolar cycloaddition reactions, but also the Diels Alder family of transformations; nucleophilic substitution chemistry, particul arly ring-opening reac tions of strained heterocyclic electr ophiles such as epoxides, azir idines, aziridiniumions, and episulfoniumions; carbonyl chemistry of the non-aldol type, such as formation of ureas, thioureas, aromatic heterocycles, oxime ethers, hydrazones, and amides.

PAGE 118

118 Here we report a novel surface immobilizati on of DNA that exploits the features of Click chemistry. The synthesis of DAB CYL derivative generally involves diazo coupling reactions of an electrophilic ar omatic substitution of activated benzene derivatives by diazonized electrophiles. Azo compounds may exist as cis/trans isomer pairs, but most of the well-cha racterized and stable compounds are trans (Figure 4-4). To implement this synthesis onto the surface, th e construction of the DNA microarray chip involved a 2-step process. The first step requires modification of the glass surface to facilitate DNA attachment. Because diazotiz ation of amine generally requires strong acidic condition, it is logical to attached aryl amine to the glass surface. The second is the synthesis of the modified DNA probe wh ich can be readily captured by the glass surface. ArNH2 ArN 2 MX ArN N Ar Figure 4-4. Diazotization of arylamine to fo rm the diazonium salt. MX indicates a generic salt. The diazonium salt is th e reaction with another electron rich substrate, generally some aromatic compound, to give diaryl-diazolene compound. Functionalizing the glass surface with aryl amine To this end, we have explored two met hods to derivatizing the glass surface with aryl amine. The first method was absortive co ating of glass slide with amino polystyrene polymers. The second method was covalent attachment of aryl amine by silanization using 1,2,3-triethoxyl anilino silane. Amino polystyrene was synthesized by radical polymerization process. p -amino styrene with 5% copolymer butadiene initia ted 1% AIBN and afforded a pale yellow tinted polymer (Figure 4-5). The resulting amino polymer ( 63) was re-dissolved in toluene and spin coated onto a borosilicated mi croslip glass slide. The amino polystyrene

PAGE 119

119 NH2 NH2 NH2 NH2 AIBN Toluene n NH2 63 Figure 4-5. Para-amino styrene co-polymeri zed with butadiene to generate amino polystyrene polymer. The product drawn is one possible randomized polymer structure form from the polymerization. surface was reacted with a dilution of fl uorescence isocyanate. The surface was examined under a confocal microscope using 480 nm excitation wavelength. However, at a 10X magnification, the polymer surf ace was fluorescent under the view of the microscope. Therefore we concluded that am ino functionalized polystyrene was unfit for the construction of DNA chip due to a hi gh fluorescent background. The work involving the polymer was abandoned. The second method was by covalent attachment of aryl amine to the borosilicated glass surface. This was accomplished by the tr eatment of a 2% commercial available (trimethoxysilane) aniline solution to allow surface binding. The glass slide was then rinsed extensively with water and etha nol. The glass slide was dried under N2 and incubated at 90oC for 24 hours to allow covalent formation of silanol on the surface. Synthesis of the modified oligonucleotide N-ethylaniline-ethyl pho sphoramidite (compound 64) was synthesized by Nethylaniline-ethyl alcohol treated with 2-cyanoet hyl N,N-diisopropylchlorophosphoramidite in the presence of DIPEA at 0oC for 30 minutes (Figure 4-6). The

PAGE 120

120 reaction was poured into i ce cold saturated NaHCO3 and extracted with methylene chloride. Compound 64 was purified by a simple silica gel column chromatography and the product was isolated as a clear gel with 89% yield. 1H NMR and 31P NMR confirmed the structure and quality of the product. N OH N O P N O NC Cl P N O CN Anh.CH2Cl2DIPEA0oCtoRT 3fifteenmersweresynthesizedontheExperditesystem.(1 Meach) 5'Anilino-phosphate-ATTGCCTGGCTAACG 3'TAACGGACCGATTCG-Fluo5' 5'anilinophosphate-ATTGCCTGGCTAACG-Fluo3' 64 Figure 4-6. the 2-cyanoethyl 2-(ethyl(phe nyl)amino)ethyl diisopropyl-phosphoramidite was synthesized and incorportated into th e oligonucleotide as an appendage at the 5end. Oligonucleotide synthesis was carried out from a 3' to 5' direction, to which a fluorescent-G dye at the fi rst nucleobase at the 3-e nd was attached, and compound 64 was incorporated as the last nucleobase at the 5 end (5' anilino phosphateATT GCC TGG CTA ACG-[Fluor] 3'-(oligo1). This was accomplished using the Expedite DNA synthesizer. The fluorescently labeled modified nucleotid e was cleaved off the support and purified by preparativ e anion-exchange HPLC. To demonstrate the feasibility of th e diazonium-DNA capture chemistry, the derivatized anilino surface was treated with a solution of isoamyl nitrite in BF3 etherate at 0oC to give the diazonium BF4 salt to facilitate the capture of the DNA (Figure 4-7). The

PAGE 121

121 DNA oligonucleotide (compound 1 ) was spotted on diazotized glass slide with the following concentrati on (1uL 1mM, 0.1 M, 10 nM, 1 nM, 0.1 nM, 0.01 nM). The DNA spots were allowed to react with the activated surface for 30 minutes. To verify the successful capture of the DNA, the glass slide was analyzed using a confocal fluorescent microscope using 480nm excitation wavelength. O Si O Si O NH2 O Si O Si O N2 BF4 O Si O Si O N N N N O P O O O ATT GCC TGG CTA ACG-fluo 3' O P O O O DN A Figure 4-7. DNA immobilization on gla ss surface via Click Chemistry Conclusion In brief summary, we are able detect the presence of the olig onucleotide attachment to the glass surface. However we were unabl e to quantify the relative concentration of oligonucleotide based on signal intensity. At any particular magni fication setting, the setting for the depth of fiel d and the depth of focus wh ich maintained the sharpness within the image plane allow the dynamic ra nge that is limited by a factor of 2 (102). DNA samples spotted on the glass slide containe d a wide range of dilutions. In order to detect all the samples on the spotted slide th e signal gain was reset each time the signal intensity changed by a factor of 2. Because the measured signal level values do not

PAGE 122

122 directly represent the number of photons emitted or scattered by the specimen, we are unable to determine to efficiency of the surface capture chemistry.

PAGE 123

123 APPENDIX EXPERIMENTAL SECTION General Experimental Procedures. The glassware was pre-dried at 140oC for at least 24 hr for all moisture sensitive reactions. All nonaqueous reactions were performed using standard techniques except for air sensit ive reactions. Tetrahydrofuran was distilled from sodium or potassium benzophenone under nitrogen. Water was dionized using th e Millipore Milli-Q purification system. All solvents and reagents were degassed via the freeze-pump-thaw technique for oxygen sensitive reactions. The reagen ts used were purchased from Sigma-Aldrich or Fisher Scientific at the highest quality, unless mentioned otherwise. Thin layer chromatography (TLC) was perfor med on Whatman 60 plates with fluorescent indicator and flash column chromatography wa s performed using Whatman 230-400 Mesh silica gel. Purification of oligonucleotides was pe rformed by preparative high performance liquid chromatography (HPLC) Waters PrepLC 400 system with a Waters 486 Tunable Absorbance detector and a Waters PrepLC 25 mm module equipped with eith er Waters NovaPak HR C18 60 cartridge and guard in set or a Dionex DNAPacTM 100 column (9 x 250 mm) semi-preparative size column. Analytical HPLC was performed using a Water Alliance 2690 Separation Module with a Waters 996 Photodiode Array detector and a Water NovaPak HR C18 (3.9 x 150 mm) column or Dionex DNAPacTM 100 (9 mm) column (4 x 250 mm). Qualitative analysis on the purity of the oligonucleotides was performed by MALDI-TOF mass spectro metry analysis using Voyager Spectrometer (Perseptive Biosystem). Nuclear Magnetic Resonance (NMR) analysis. 1H NMR analyses were done on the following instruments: Va rian Gemini 300 (300 MHz ), Varian VXR (300 MHz ), and Varian Mercury (300 MHz ). The spectra were measured in so lvents noted with trimethylsilane as

PAGE 124

124 internal standards (CDCl3, DMSO-d6 and D2O, THF-d4), 31P-NMR spectra were recorded on the Mercury (300 MHz ) and phosphoric acid was used as internal standard. I O O O O O OH O N3 N C O Pd3(Oac)6Ph3P Et3N,CuI THF,rt 4NNaOH Ethanol (PhO)2PN3, DMF,Et3N Toluene D 4 56 7 The generic dienophile core is prepared by Heck coupling of an aromatic ester to provide a facile attachment to th e 5'-end of a DNA probe and an aroma tic acetylene. Furthermore, the coupling is widely adaptable to include substituents on the arom atic ring. (Agrologlio, L. A., Gillaizeau, I., Saito, Y. ( 2003) Palladium-assisted routes to nucleosides Chem. Rev. 103, 18751916.) Ethyl 4-(2-phenylethynyl)benzoate (4) : A mixture of ethyl-4-iodobenzoate (4 g, 14.69 mmol), Pd(OAc)2 (0.19 g, 0.02 mmol), Ph3P (0.096 g, 0.36 7 mmol), and CuI (0.07 g, 0.367 mmol) in anhydrous THF (75 mL) was purged un der argon and degassed. Phenylacetylene (1.5 g, 15 mmol) and Et3N (2.23 g, 22 mmol) were added, and th e solution was stirred at room temperature overnight. The reaction was dilu ted with EtOAc (300 mL) and filtered through celite. The crude residue was purified by fl ash column chromatography to give compound 4 as a yellow solid (3.27 g, 13.1 mmol, 88.6% yield). GC/MS = EI [m/z]+ = 250; Rf = 0.5 (1:1 Et2O/Hexanes); Rf = 0.8 (7:3 EtOAc/hexanes). 1H NMR (CDCl3, 300 MHz ) (ppm) = 8.03 (d, J = 8.7 Hz 2H), 7.60 (d, J = 8.7 Hz 2H), 7.55 (dd, 2H), 7.44 (m, 3H), 4.4 (q, J =7.2 Hz 2H CH2), 1.4 (t, J = 7.2 Hz 3H CH3).

PAGE 125

125 4-(2-Phenylethynyl)benzoic acid (5). Ethyl 4-(2-phenylethyn yl)benzoate (compound 4 ) (3 g, 12 mmol) was suspended in ethanol (60 mL) and the mixture was warmed until dissolved. Aqueous NaOH (20 mL, 2 N) was added. The mixture was stirred for 1 hour at 45o C. The solvent was removed by rotary evaporation. The crude residue was acidified using aqueous HCl (1 N) to pH 4, and extracted with CH2Cl2 (80 mL). The organic was washed with brine (40 mL) and dried over MgSO4. The organic solvent was removed by rotary evaporation to give compound 5 as a yellow solid (2 g, 9 mmol, 75% yield). TLC: Rf = 0.2 (3:7 EtOAc/hexane). 1H NMR (CDCl3, 300 MHz ) (ppm) = 8.09 (d, J = 8.7 Hz 2H), 7.63 (d, J = 8.7 Hz 2H), 7.55 (dd, 2H, -CH2-Bz), 7.44 (m, 3H), 4.4 (q, J = 7.2 Hz 2H CH2), 1.4 (t, J = 7.2 Hz 3H CH3). 4-(2-Phenylethynyl)benzoyl azide (6). A solution of 4-(2-phenylethynyl)benzoic acid (compound 5 ) in DMF (10 mL) was treated with anhydrous diphenylphosphoryl azide (DPPA) (0.583 g, 2.25 mmol) and Et3N (0.45 g, 4.5 mmol). The mixture was allowed to stir at room temperature for 1 hour. The mixture was diluted with EtOAc (200 mL), washed with saturated NaCl solution (80 mL), and water (80 mL, 2x), and dried over MgSO4. The organic layer was concentrated by rotary eva poration to give compound 6 as a light yellow solid, which was used immediately without purification. 1-Isocyanato-4-(2-phenylethynyl)benzene (compound 7): The crude residue (compound 6 ) was dissolved in anhydrous to luene (20 mL). The solution was heated to reflux temperature until no more N2 evolved from the reaction. The reac tion was allowed to cool to room temperature. The solvent was removed by rotary evaporation to give compound 7 as a yellow solid (0.367 g, 1.67 mmol, 91% yield). The material was used immediately to react with the amino-modified DNA in the next step. The preparation of probe 1 ( P1 ) involved the synthesis of substituted-morpholinouridine

PAGE 126

126 Preparation of the photoenolizable species. NH O O N O N HO O O NH O O N O OH OH HO 17 Cl O Cl AlCl3DCE O Cl O O NH2 O NH O O N O O O HO NaIO4NaN3/DMF PPh3/H2O NaCNBH3/HOAC 1011 8 3-methylanisole OH O Cl 4-(chloromethyl)benzoic acid 15 monomer and its phosphoramidite for the inco rporation into the oligonucleotide during solid-phase DNA synthesis. 4-Methoxy-2-methyl-benzoyl chloride (compound 8). To a 100 mL round bottom flask, 4'-methoxy-2'methyl-benzoic acid (0.50 g, 3.00 mmo l) was suspended in anhydrous methylene chloride (30mL) at 0oC ice bath. Oxalyl chloride (0.382 g, 3.01 mmol) and a catalytic drop of DMF was added to the suspension Immediately, the suspended solid was completely dissolved, and the reaction reacted vigorously giving off HCl gas. The reaction mixture was stirred at 0o C until the evolution of gas stopped. The reac tion mixture was slowly warmed to room temperature. The solvent was removed by rotary evaporator under high vacuum to give a clear oil. The product 8 was assumed to be 100% conversion and used immediately.

PAGE 127

127 (4-(Chloromethyl)(4'-methoxy-2'-met hyl)benzophenone) (compound 10): A 3-neck flask (100 mL) was equipped with a stir bar, a condenser and a dropping funnel attached to a CaCl2 drying tube. All glassware was dried for at least 24 hours prior to set-up. To this was added 3-methyl anisole (2 g, 16 mmol) and AlCl3 (2.18 g, 16.37 mmol) and 1,2-dichloroethane (anhydrous, 20 mL). The solution was purge d with a continuous stream of N2, and cooled to 0 C in an ice water bath. A solution of 4-chloro methyl benzoyl chloride (3.095 g, 16.37 mmol) in anhydrous 1,2-dichloroethane (20 mL) was then a dded dropwise to the starting material via the dropping funnel. As the reagent was added, the react ion immediately turned bright red; the color became darker within minutes. The reaction was allo wed to warm to room temperature, and then heated at 50o C overnight. The mixture was cooled to room temperature and diluted with CH2Cl2 (20 mL). The reaction was quenched with ice wate r and then neutralized with aqueous NaOH (20 mL, 2 M). The organic layer was washed with brine (50 mL), H2O (40 mL, 2x), and dried over MgSO4. The solvents were then removed under vac uum to yield a red crystalline solid (4.33 g, 15.8 mmol), which was then purified by silica gel column chromatography (silica gel, gradient hexane/Et2O at 4:6 ratio) to give compound 10 as a white solid (3.99g, 14 mmol, 89% yield). NMR showed ~90% purity. GC/MS: Rf = 12.11 min; EI: (m/z)+-274, 276, (M/z+-Cl) 239. TLC rf = 0.8 (2:8 EtOAc/hexane). Rf = 0.4 (4:6 hexane/ Et2O). 1H NMR: (CDCl3, 300 MHz ) (ppm) = 7.75 (d, J = 8.1 Hz 2H), 7.75 (d, J = 8.1 Hz 2H), 7.73 (d, J = 9 Hz 1H), 6.83 (d, J = 2.4 Hz 1H), 6.74 (dd, J = 8.7 Hz J = 2.4 Hz 1H), 4.64 (s, CH2), 3.86 (s, 3H, -OCH3), 2.42 (s, 3H, -CH3) ppm. (4-(Aminomethyl)(4'-methoxy-2'-methyl phenyl)benzophenone) (compound 11). A solution of (4-(chloromethyl)(4'-methoxy-2'-methyl)benzophenone (compound 10 ) (1.5 g, 5.5 mmol) in DMF (25 mL) was placed in a round bo ttom flask (100 mL). The mixture was treated

PAGE 128

128 with NaN3 (0.7 g, 11 mmol). This mixture was stirre d at 60 C overnight. The reaction was monitored by TLC (80:20hexane:EtOAc). Upon co mpletion of the reaction, the remaining solid was removed by filtration. Triphenylphosphine (1.53g, 5.5 mmol) and water (1 mL) was added to the filtrate, and the mixture was stirred at room temperature for an additional 30 minutes. The mixture was then diluted with Et2O (80 mL), and washed water (80 mL, 3x) followed by brine (60 mL). The ether layer was separated and dried over MgSO4. The solvent was removed by rotary evaporation to give a brown solid, whic h was re-dissolved in methanol (15 mL) and aqueous HCl (10 mL, 1 M). The solvents were then removed under reduce pressured. The solid was again re-dissolved in water, and the aqueous solution was extracted with CH2Cl2. The aqueous phase was concentrated using th e rotary evaporator to give compound 11 as a light yellow solid (1.3 g, 4.46 mmol), with an estimated purity of 85%. TLC: Rf = 0.15 (1:20 MeOH:CH2Cl2). NMR: (CD3OD, 300 MHz ) (ppm) = 8.05 (s, NH2), 7.77 (d, J = 8.1 Hz 2H), 7.76 (d, J = 8.1 Hz 2H), 7.73 (d, J = 9 Hz 1H), 6.91 (d, J = 2.4 Hz 1H), 6.83 (dd, J = 8.7 Hz J = 2.4 Hz 1H), 4.23 (s, -CH2), 3.86 (s, 3H, -OCH3), 2.37 (s, 3H, -CH3). NH O O N O N HO O O 17

PAGE 129

129 1-((2R,6S)-4-(4-(4-Methoxy-2-methylbenzoyl )benzyl)-6-(hydroxymethyl)morpholin-2yl)pyrimidine-2,4(1H,3H )-dione (compound 17). A solution of uridine (1 g, 4 mmol) and NaIO4 (1.75 g, 8.1 mmol) in water (40 mL) was added to compound 11 (1.2 g, 4 mmol). The reaction mixture was stirred at room temperatur e. The progress of the reaction was monitored by TLC (1:9 MeOH:CH2Cl2). After 15 minutes, the reaction wa s quenched with glycerol (0.38 g, 4 mmol). NaHB(OAc)3 (1.7 g, 8.2 mmol) was added portion wise over 10 minutes. The reaction mixture turned dark brown. This mixture was stirred for an additional 4 hours. The reaction was quenched with saturated NaHCO3 solution (20 mL), and then extracted with CH2Cl2 (50 mL). The organic layer was washed with brin e (2x), then water and dried over MgSO4. Rotary evaporation gave compound 7 as a dark brown oil, which was then purified by silica gel flash column chromatography, eluting with a gradient starting with 100% CH2Cl2 and increasing to 5% MeOH in CH2Cl2. TLC: Rf value = 0.3 (1:20 MeOH:CH2Cl2). LC/MS: A = 0.5% HCOOH + 0.2mM NH4O2CH in H2O; B = 0.5% HCOOH in MeOH. Rt = 33 minutes (10% product: m/z+ 466). NH O O N O N HO 16c

PAGE 130

130 1-((2R,6S)-4-Benzyl-6-(hydr oxymethyl)morpholin-2-yl)-p yrimidine-2,4(1H,3H)-dione (compound 16c). A solution of uridine (0.5 g, 2 mmol), NaIO4 (0.44 g, 2 mmol) in water (0 mL) in a round bottom flask (100 mL) was treated w ith benzylamine (0.020 g, 2 mmol). The reaction mixture was stirred at room temperature and monitored by TLC (1:9 MeOH:CH2Cl2). After 15 minutes, NaHB(OAc)3 (1.7 g, 8.2 mmol) was added portionwise over 10 minutes time, in which the reaction turned dark brown. This reaction mi xture was stirred for an additional 4 hours at room temperature, then quenche d with saturated aqueous NaHCO3 (20 mL) and extracted with CH2Cl2 (50 mL). The organic layer was washed with brine (2x), then H2O, and dried over MgSO4. Rotary evapor ation gave compound 7 as a dark-brown oil, which was purified by silica gel flash column chromatography, eluting with a gradient st arting with 100% CH2Cl2 and increasing to 5% MeOH in CH2Cl2. A yellow solid was obtained (0.25 g, 0.75 mmol, 25% yield). Rf value = 0.45, LC/MS: A = 0.5% HCOOH + 0.2 mM NH4OCH in H2O; B = 0.5% HCOOH in MeOH. RT = 18 minutes (95% product: m/z+ 317). 1H-NMR (DMSO, 300 MHz ) (ppm) = 11.37 (s, 1H,); 7.66 (d, J = 8.1 Hz 1H), 7.35 (m, 5H), 5.61 (dd, J = 8.1 Hz 2H), 4.79 (m, 1H), 3.72 (m, 1H), 3.42 (dd, 6.3 Hz 2H), 3.09 (m, 2H), 2.83 (dd, J = 10 Hz 2H), 2.09 (dd, J =6.3 Hz 1H), 1.91 (dd, J = 6.3 Hz 1H). NH O O N O N HO 16d

PAGE 131

131 1-((2R,6S)-4-Benzyl-6-(hyd roxymethyl)morpholin-2-yl)-uridine-2,4(1H,3H)-dione (compound 16d). A solution of uridine (5 g, 20 mmol), NaIO4 (4.00 g, 20.0 mmol) in water (500 mL) in a round bottom flask (1 L) was trea ted with benzylamine (2.09 g, 20.5 mmol). The reaction was stirred at room temperature. The reaction was monitored by TLC (1:9 MeOH:CH2Cl2). After 15 minutes, NaHB(OAc)3 (9.00 g, 42.00 mmol) was added portion wise over 10 minutes time. The reaction turned dark brow n, and was allowed to stir for an additional 4 hours at room temperature. The reaction wa s quenched with saturated aqueous NaHCO3 (200 mL) then extracted with CH2Cl2. The organic layer was washed with brine (2x), then H2O, and dried over MgSO4. Rotary evapor ation gave compound 8a as a dark brown oil, which was purified by silica gel flash column chromatography, eluting with a gradient starting with 100% CH2Cl2 and increasing to 5% MeOH in CH2Cl2. A yellow solid was obtained (3.7 g, 11.75 mmol, 57% yield). This solid was dried under hi gh vacuum for several days and stored under argon at room temperature. LC /MS: A = 0.5% HCOOH + 0.2 mM NH4OCH in H2O; B = 0.5% HCOOH in MeOH. RT = 18 minut es (95% product: m/z+ 317). 1H-NMR (DMSO, 300 MHz ) (ppm) = 11.37 (s, 1H,); 7.66 (d, J = 8.1 Hz 1H), 7.35 (m, 5H), 5.61 (dd, J = 8.1 Hz 2H), 4.79 (m, 1H), 3.72 (m, 1H), 3.42 (dd, 6.3 Hz 2H), 3.09 (m, 2H), 2.83 (dd, J = 10 Hz 2H), 2.09 (dd, J = 6.3 Hz 1H), 1.91 (dd, J = 6.3 Hz 1H). 1H-NMR (CDCl3, 300 MHz ). (ppm) = 8.002 (s, 1H, NH), 7.443-7.417 (d, 1H, H5, J = 7.8 Hz ), 7.310 (m, 5H, Ar), 5.837-5.805 (dd, 1H, 1H, J = 3, 9.6 Hz ), 5.724-5.696 (d, 1H, H6, J = 7.8 Hz ), 3.886 (m, 1H, 5H), 3.706-3.700 (dd, 2H, 2Ha, 4Ha, J = 4.8, ), 3.580-3.497 (dd, 2H, 2Ha, 4H J = 6 Hz ), 3.024-2.980 (m, 1H, 6Ha,), 2.810-2.770 (m, 1H, 6Hb), 2.059-1.976 (dt, 2H, 3H ab J = 4.8, 10.5. 21 Hz ).

PAGE 132

132 NH O O N O N O Si 18 1-((2R,6S)-4-Benzyl-6-(tert-butyldimethyl silyloxymethyl)morpholin-2-yl)-uridine2,4(1H,3H)-dione (compound 18) Compound 16b (1.g, 3.15 mmol) dissolved in methylene chlorides (50mL) was cooled to 0o C, immidazole (0.25g, 1.17 mmol) was added, following TBDMS-Cl (0.52g, 3.47 mmol). The reaction mixture was allowed to stir for several minutes, then the ice bath was removed. The reaction was warmed to room temperature and stirred for 4 hours. TLC was used to monitor the reaction. The reaction was stopped and diluted with an additional CH2Cl2 (150 mL) extracted over saturated NaHCO3. The organic layer was separated and concentrated under vacuum to give a light yellow oil. The crude was purified (eluting gradient: 100% CH2Cl2 to 2% CH3OH in CH2Cl2) to give a light yellow foam. m/z+ 432 amu. 1H-NMR ( CDCl3, 300 MHz ). (ppm)= 8.209 (s, 1H, NH), 7.443-7.417 (d, 1H, H5, J = 7.8 Hz ), 7.310 (m, 5H, Ar), 5.837-5.805 (dd, 1H, 1H, J = 3, 9.6 Hz ), 5.724-5.696 (d, 1H, H6, J = 7.8 Hz ), 3.886 (m, 1H, 5H), 3.736-3.700 (dd, 2H, 2Ha, 4Ha, J = 4.8, ), 3.641-3.605 (dd, 2H, 2Ha, 4H J = 6 Hz ), 3.018-2.980 (m, 1H, 6Ha,), 2.890-2.856 (m, 1H, 6Hb), 2.01-2.916 ( m, 2H, 3H), 0.923 (s, 3H, CH3Si), 0.867 ( s, 3H, CH3Si-), 0.0 ( s, 9H, t -bu)

PAGE 133

133 NH O O N O N O Si 8, AlCl3, anh.DCE NH O O N O N O 18 O O 22 ((2S,6S)-4-benzyl-6-(2,4-di oxo-3,4-dihydropyrimidin-1(2H )-yl)morpholin-2 -yl)methyl 4-methoxy-2-methylbenzoate (compound 22) Friedel-Craft methods. A 2-neck flask equipped with a condenser and connected to a CaCl2 drying tube and a 50 mL dropping funnel, 6'-TBDMS-protected 4-ben zylmorpholinouridine (compound 18 ) (0.5g, 1.2 mmol) and AlCl3 (0.155 g, 1.158 mmlo) was dissolved in anhydrous 1,2dichloroethane ( 20mL) and cooled to 0o C. The solution mixture immediately turned deep red. Compound 18 (0.22 g, 1.158 mmol) in 15 mL of anhydrous CH2Cl2 was added via a dropping funnel. The reaction mixture turned bright red and then eventually brown. The reaction mixture was allowed to stir at room temperature overnight. TLC was used to monitor for the reaction. Rf value = 0.66. Upon completion, the reaction was quenched in an ice water bath and neutralized with NaOH aqueous (1 N). It was then extracted with additional CH2Cl2 and NaHCO3. The organic layer was washed with brine and dried over Na2SO4. Rotary evaporation was used to removed solvent to give a yellow gel (0.77 g) crude material which was further puri fied by silica gel flash column chromatography (eluting with 5% CH3OH: CH2Cl2) to give an overall yiel d of 78% ( 0.310 g, 0.55 mmol ) LCMS analysis m/z+ [465M+1]. A = H2O, B = CH3OH @15 mL/min, (A:B) 95:5 =>0:100 @40-70 minutes. 254nm, Rt = 44 minutes. NMR analysis. (ppm) = 8.401 (s, 1H, NH), 7.941 (d, 1H, H-5, J = 7 Hz ), 7.478 (d, 1H, ArH-5 J = 8.2 Hz ), 7.357 (m, 5H, BnzH), 6.789 (d, 1H,

PAGE 134

134 ArH-6, J = 8.2), 6.780 (s 1H, ArH-3), 5.845(dd, 1H, 1H, J = 3, 10 Hz ), 5.710 (d, 1H, H-6, J = 8.0 ), 4.354 ( d, 2H, H-3, J = 6 Hz ), 4.201 (m, 1H, H-5), 3.874 (s, 3H, OCH3), 3.123(m, 2H, H4), 2.890 (m, 2H, H-2), 2.595 (s, 3H, CH3Ar), 2.155-2.051 (m, 2H, H-6). 1-((2R,4S)-3-Benzyl-6-(phosphoramidi te-methyl)morpholin-2-yl)-uridine2,4(1H,3H)-dione (compound 20). To a 50 mL round bottom flash, compound 17b (0.05g,0.11 mmol) was dissolved in anhydrous met hylene chloride and cooled to 0o C in an ice bath. N,Ndiisopropylethyl amine 0.03g, 0.23 mmol) a nd N,N-diisopropylaminocyanoethylchlorophosphoramidite (0.028g, 0.12 mmol) was adde d dropwise. The reaction mixture was allowed to stir at 0o C, slowly warmed to room temperature, and then stirred for 4 hours. TLC showed no progress, so the reaction was stoppe d. The reaction was poured into saturated NaHCO3 and extracted over CH2Cl2 (100 mL). The organic layer was dried over MgSOc and concentrated under vacuum. The reaction failed and the mixture was discarded. NH O O N O N HO O O NH O O N O N O O O P O N CN 2-CyanoethylN,N'diisopropylchlorophosphor amidite DIEAP,DCM0oC 20 17 1-((2R,4S)-3-Benzyl-6-(phosphoramidi te-methyl)morpholin-2-yl)-uridine2,4(1H,3H)-dione (compound20)The benzophenone morpholidate nucleoside was dried over phosphorus pentoxide prior to used. In a r ound bottom (50 mL) flask equipped with a magnetic stir bar and purged with argon, the morpholidate nucleoside ( 17 ) (0.5 g, 1.07 mmol) was dissolved in freshly distilled CH2Cl2 (distilled over CaH2, 10 mL) and the solution was cooled to 0o C in an icebath. N,N'-diisopropyl ethyl amine (0.21g, 1.61 mmol) and N,N'-diisopropyl-2-

PAGE 135

135 cyanoethylchlorophosphoramidite ( 0.28g, 1.2 mmol) was added dropwise. The solution mixture was stirred at 0o C and slowly warmed to room temperatur e. Stirring was continued for 3 hours. The reaction was monitored by TLC (1:4:5 ration CH2Cl2:EtOAc:Hx respectively). Rf value = 0.65. Upon the disappearance of the starting mate rial, the reaction was stopped. The reaction was then diluted with additional CH2Cl2 (100 mL total volume) and extracted over saturated NaHCO3. The organic layer was separated and dried over Na2SO4 followed with evaporation using the rotary evaporator.to give a yellow oil. The crude was further purified by silica gel chromatography (gradient: eluding with 95:5 hexa nes methylene chloride, 1.5 column volume, followed with 1:3:6 mixtures of CH2Cl2:EtOAc:Hx respectively. This resulted in 80% yield of a yellow foamy solid (0.576 g, 0.86 mmol). The so lid was pumped under high vacuum and dried over P2O for two days and stored at 2o C in a freezer. The struct ure elucidation was done by 1H NMR and 31P NMR analysis. 1H NMR:(CDCl3, 300 MHz ) (ppm) = 7.757-7.730 (d, 2H, ArH1,1 J = 8.1 Hz ), 7.493 -7.486, 7.466-7.460 (dd, J = 2.1 Hz J = 8.1 Hz ), 7.420-7.393 (d, 2H. ArH22 J = 8.1), 7.353-7.325 (d, 1H, ArH, J = 8.1 Hz ), 6.840-6.831 (d, 1H, ArH, J = 2.7 Hz ), 6.769-6.760, 6.741-6.732 (dd, 1H, ArH, J = 2.7, 8.4 Hz ), 5.869-5.860, 5.834-5.825 (dd, 1H, CH6, J = 10.5, 2.7 Hz ), 5.749-5.738, 5.723-5.710 ( dd, 1H, TH6, J = 3.3, 7.8 Hz ), 4.0 (m, 1H, CH(iPr), 3.989 (m, 1H, 5H), 3.871 ( s, OCH3), 3.727-3.654 (m, 4H, 2Ha, 2Hb, 4Ha, 4Hb), 3.585 (m, 2H, CH2OP), 3.057-3.023 (d, 1H, T6'a1, J 8.1 Hz ), 2.890-2.854 ( d, 1H, 6H'b), 2.621 (m, 2H, CH2CN), 2.425 (s, O-Ar-CH3) 2.052 (m, 2H, Ar-3H,) 1.29-1.121 (m, 12H, 3-CH3(dii Pr), 32P (CDCl3, 300 MHz ) H2PO4 external standard = (s) 150.384, (s) 150.504 ppm

PAGE 136

136 NH O O N O N O O O O O NH3 Cl NH O O N O OH OH '5ACATCACCATCTACACT-O 1)NaIO4/ADApH6.0 2)NaHB(OAc)3/HOAc 11a Probe2(P2) '5ACATCACCATCTACACT Synthesis of probe 2 (P2) via method A: Direct incorporation onto oligonucleotide. Note: 19mer (1mmol) (5 ACATCACCATCTACAC TU 3) was purchased from Integrated DNA Technologies (Coralville, IA). The comme rcial 38-mer was purified via anion exchange purification prior to use. (120 nmole) oligonucleotide was dissolved in 1 mL to make a 120 M solution. 200 L (24 nmole) was pipetted to a 1.5 mL screwed-cap eppendorf tubeof NaIO4 (, (100 L), 0.0022g, 0.35 mmol dissolved in 1 mL ADA buffer of ( 100 mM, pH 6.0 ) solution was added, the mixture was diluted to a total of 1 mL ADA bu ffer (100 mM, pH 6.0). The eppendorf tube was placed in the shaker. The reaction was monitore d by analytical HPLC every 2 hours. After 24 hour, 40% of starting material had reacted to form the dialdehyde. An analytical anion exchange HPLC showed 2 peaks: 1) star ting material at 21.13 minutes, and 2) new peaks at 20.25 minutes assigned assigned to the forma tion of the dialdehydes. 4-Me thoxyl-4'-(methylamino)-2-methylbenzophenone (compound 11 ) (0.0018 g, 7 mol) was first dissolved in DMF (100 L) to make 70 mM solution, and excess compound 11 (50 L, 35 mM) was then added to the DNA reaction mixture followed by an addition of excess NaHB(OAc)3 (15 L, 2 M) The reaction was

PAGE 137

137 allowed to sit on a shaker overnight. The reac tion was monitored by analytical anion exchange HPLC: New HPLC peaks detected at: a large so lvent front peaks at rt = 2-5 minutesr is the major peak indicating 99% of the materials. The other minor peaks eluted at rt = =19.37 minutes with shouldering peaks which are not separable. Peak 2 eluted as a board doublet rt = 20.25. The reaction mixture was extracted with CH2Cl2 (1 mL 2x). The aqueous phase was lyophilized and re-dissolved for preparative purification. Ho wever, when a sample was re-injected into the HPLC for purification, it had undergone significa nt decomposition. The preparative scale HPLC was not able to resolve any peak s, so the sample was discarded. NH2 O OH O 3 4-(7-(aminomethyl)-4-(4-methoxyphenyl)-3-p henylnaphthalen-2-yl)benzoic acid (compound 3). To a polypropylene eppendorf test tube an equal mixture of 4-methoxy-2methylbenzyl phenone 4'-methylamine hydrochloride salt (compound 11) (0.05 g, 0.171 mmol) and sodium-1,4-diphenylacetylene acetate (compound 5a ) was dissolved in methanol (1.5 mL). The solution was bubbled with argon for 5 minutes and capped and sealed with teflon tape. The eppendorf was placed into a pyrex test tube fi lled with water. Th e solution mixture was irradiated with a UV lamp for 48 hours. The re action was stopped, and the solvent was removed by a rotary evaporator. EI m/z+ = 459 am u. UV Abs max = 296 nm Em max = 450 nm.

PAGE 138

138 NH2 NH2 NH2 n NH2 63 4-Amino-polystyrene polymer (compound 63). To a 25 mL pair-shaped flask, a mixture of 4-vinylaniline (5 g, 41.96 mmole) and isomeric mixture of butadiene (3%, 1.25 mmole, 69 mg) and AIBN (1%, 0.42 mmole, 68.9 mg) was added and purged with argon. The flask was shielded with a rubber stopper and freeze-pump-thawing performed and repeated 3 times for the removal of oxygen. The mixture was al lowed to stir at room temperature overnight. The starting material was completely polymerized after ~8 hours to give a clear pale yellow polymer. The polymer used without further analysis. N O P N O NC 64 2-Cyanoethyl 2-(ethyl(phenyl)amino)ethy l diisopropylphosphoramidite (compound 64) N,N-ethylaniline 2-ethanol (0.5 g, 3.0 mmol) dissolved in dist illed dichloromethane (6 mL) was cooled in a 0o C ice bath. Diisopropyl ethyl amin e (0.63 mL, 3.63 mmol) and 2-cyanoethyl N,N-diisopropylphosphoramidite ( 0.72 g, 3.03 mmol) was added. The reaction mixture was

PAGE 139

139 allowed to stir at 0o C for 30 minutes. The reaction was dissolved with dichloromethane (40 mL) and washed with saturated aqueous sodium bicarbonate (30 mL). The organic phase was separated and dried over Na2SO4 and concentrated by rotary evaporation. The residue was purified by silica gel chroma tography (3:7 hexanes:CH2Cl2) and afforded a clear oil. The product was purged under argon and stored at -23o C. Analytical analysis 31P-NMR: 148.48 (s), 1H-NMR: (CDCl3, 300 MHz ) d(ppm) (5H, m, Ar-H), Functionalizing glass slide The borosilicated glass slid es were cleaned by immersion into a basic aqueous solution NaOH for 30 minut es. They were then washed with doubledistilled water, then ethanol ( 200 proof) and then dried under n itrogen. The pre-cleaned glass slides were immersed into a 5% solution of trim ethoxyaniline in toluene (v/v) for 30 minutes at room temperature and then washed with d-distill ed water, followed by ethanol (2x). The glass slides were dried under a st ream of nitrogen, then baked in an oven at 100o C for 24 hours. Afterwards, they were stored in a desiccator. The functionalized glass slides were immersed into a solution of isoamyl nitrite (0.5 M) in anhydrous trifluoro borate diethyl ether at -10o C for 30 minutes. They were quickly washed with cold ether, dried under a stream of nitroge n, and used immediately with the aniline cross linked DNA oligo, which was prepared at vari ous concentrations (1.0 mM, 0.5 mM, 0.1 mM, 50 M, 10 M) in dd-H2O. They were allowed to sit for 1 hour, then washed with d-distilled water. The slides were then placed into a solution of TEAB buffer for 5 minutes and then rinsed again with water. They were finally dried over a stream of N2 and examined under a confocal fluorescent microscope.

PAGE 140

140 Synthesis of C-nucleoside: 1-Methyl Pseudo-Cytidine N Bu Bu O O 55 N,N-Dibutylformamide dime thoxy acetal (compound 55) The N,N-dibutyl amine was dried over KOH pallets and distilled (80o C high vacuum) before use. To a round bottom (250 mL) flask, a 1:1 ratio mixtures of dibutyl am ine and N,N-dimethylformamide dimethoxy acetal was added and heated to refluxi ng temperature for 4 days. The reaction mixture was cooled to room temperature. The low boiling by-product wa s removed by rotary evaporation. The product was isolated by vacuum dist illation. Yield: 88%. 1H NMR: (ppm) = 3.55 (m, 4H); 3.35 (s, 6H, 2 OCH3); 4.48 (s, 1H), 1.58 ( m, 4H), 1.35 (m, 4H); 0.90 (t, J = 6H, CH3) HNN O NH2 I 53 5-Idocytosine (compound 53) N-iodosuccinamide (Sigma-Aldrich, 4.9 g, 22 mmol) was added to a suspension of cytosine (Sigma-A ldrich,,2 g, 18 mmol) in DMF (40 mL). The suspension was allowed to stir at 50o C overnight. Upon completi on, the solid was filtered, washed with water, and drie d under vacuum. A yellow solid was obtained (3.2 g, 14 mmol, 75%

PAGE 141

141 yield). Product was used without purification. TLC: Rf = 0.25 (MeOH: CH2Cl2 1:9) 1H NMR: (DMSO) d (ppm) 7.8 (s, 1H H-6) NN O N I N Bu Bu 54 1-Methyl-4-N-(N,N-dibutylformam idine)-5-idocytosine(compound 54) 5-Iodocytosine was suspended in methanol (15 mL). N,Ndi-nbutyl formamide dimethoxy acetal (compound 55) (2.1 g, 11 mmol) was added to the suspension. The reaction mixture wa s allowed to stir at room temperature for 2 hours and monitored by TLC (Rf = 0.45, silica: 2% MeOH in CH2Cl2). The reaction was concentrated via rotary evapor ation to give a brown oil which was purified by column chromatography (silica gel:eluting: 100% CH2Cl2 increased to 5%CH2Cl2: MeOH, with a drop of Et3N). A yellow solid was obtained (1.2 g, 3.1 mmol, 72% yield) TLC: Rf = 0.45 10% MeOH in CH2Cl2; 1H-NMR: (ppm) = 8.73 (s, 1H, H-6); 7.71 (s, 1H, H-6); 3.60-3.55 (t, J = 7.5 Hz 2H); 3.44 (s, 3H, -CH3-1); 3.45-3.30 ( t, J =, 7.5 Hz 2H); 1.68-1.59 (m, 4H); 1.40-1.26 (m, 4H): 1.0 (tt, J = 7.5 Hz 6H). 56O N NH O O DMTrO OH 5O -(Dimethoxytrityl)-thymidine (compound 56) A solution of thymidine (SigmaAldrich 10 g, 41 mmol) dissolved in anhydr ous pyridine (200 mL) was cooled to 0o C in an ice bath. DMTr Cl (Sigma-Aldrich 16.65 g, 49 mmol), triethylamine ( 5.6 mL, 41 mmol), and

PAGE 142

142 DMAP (0.5 g, 4.1 mmol) were added to the thym idine solution. The reaction was allowed to warm to room temperature overnight. Upon completion, the pyridiniu m chloride salt was filtered off. The filtrate was concentrated via rota ry evaporator to give a dark brown solid. The crude residue was re-dissolved in CH2Cl2 (250mL) and washed with NaHCO3 (150 mL) 2x. The organic layer was separated and dried over Na2SO4. Solvent was removed by rotary evaporation. Silica gel flash column chromatography, eluting with a gradient of 100% CH2Cl2 increasing to 5% methanol in CH2Cl2 afforded a light yellow foam ( 19 g, 34 mmol, 85% yield). TLC: Rf = 0.25 (MeOH:CH2Cl2 1:9) 1H NMR: (CDCl3, 300 MHz ) (ppm) = 7.58 (s, 1H), 7.37-742 (m, 2H, DMTr), 7.25 ( m, 7H, DMTr), 6.84 ( m, 4H, DMTr), 6.41 (dd, J = 6.5, 6.5 Hz 1H, H-1'), 5 ppm. 57 O N NH O O DMTrO OTBDPS 5-(Dimethoxytrity)-3-O-tert-butyldi phenylsilyl thymidine (compound 57) A mixture of 5'-DMTr-thymidine (compound 56 ) (10 g, 18 mmol) and imidazole (4 g, 37 mmol) in anhydrous dichloromethane (40mL) was cooled to 0o C; TBDPS-Cl (6 g, 22 mmol) was added dropwise over 15 minutes. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was monitored by TLC (silica: CH2Cl2:MeOH: 20:1 ratio), Rf= 0.65. Upon completion, the reaction was quenched with aqueous HCl (1 M). The mixture was diluted with CH2Cl2 (200 mL) and extracted with saturated NaHCO3, the organic layer was washed additionally with brine then water. The or ganic layer was separated and dried over MgSO4 and

PAGE 143

143 concentrated under reduced pressured. The crude residue was purified by column chromatography (silica: CH2Cl2 to 5% MeOH in CH2Cl2) to afford a light yellow solid ( 12.7 g, 16.22 mmol, 88.22% yield) 1H-NMR: (CDCl3, 300 MHz ): (ppm) = 8.14 (1H, s, N-H 3); 7.757.71 (17H, m, Ar-H), 7.49-7.37 (6H, m, Ar-H); 6.45 (1H, dd, J = 6.0, 7.8 Hz H-1'); 4.63 (1H, dt, J = 3.0, 6.0 Hz H-4'); 4.16 (1H, dt, J = 3, 3 Hz H-3'); 3.82 ( 6H, 2xs, OMe); 3.25 ( 1H, dd, J = 14, 3 Hz H-5'a), 2.92 (1H, dd, J = 14, 3 Hz, H-5'b); 2.41 (1H, ddd, J = 3, 10 Hz H-2'a); 2.17 (1H, 2xddd, J = 3, 10 Hz ), H-2'b, 1.65 ( 3H, s, T-H-5); 1.15 (9H, s, tBu-H). 58 O N NH O O HO TBDPS 3-O-(tert-Butyldipheylsily l) thymidine (compound 58) 5'-O-Dimethoxytrityl-3'-O-(tbutyldiphenylsilane)-thymidine (compound 57 ) (12.00 g, 15 mmol) was dissolved in a solution of saturated methanolic HCl. The reaction immedi ately turned deep red and then became clear. The reaction was monitored by TLC (CH2Cl2: MeOH= 1:9). After 30 minutes, the reaction solution was concentrated under vacuum, and the crude residue was purified by column chromatography (silica gel: CH2Cl2: MeOH 20:1 ratio). A white solid was obtained (7.366 g, 14.6 mmol, 95% yield). TLC : Rf = 0.40 (MeOH: CH2Cl2 1:9); 1H NMR: (CDCl3, 300 MHz ): (ppm) = 8.14 (1H, s, N-H 3); 7.66 (4H, m, Ar-H ), 7.49-7.37 (6H, m, Ar-H); 7.29 ( s, 1H, T-H6); 6.22 (1H, dd, J = 6.0, 7.8 Hz H-1'); 4.43 (1H, dt, J = 3.0, 6.0 Hz H-4'); 3.98 (1H, dt, J = 3, 3

PAGE 144

144 Hz H-3'); 3.63 ( 1H, dd, J = 14, 3 Hz H-5'a), 3.23 (1H, dd, J = 14, 3 Hz, H-5'b); 2.30-2.15 (2H, 2xddd, J = 3, 10 Hz ), 1.85 ( 3H, s, T-H-5); 1.15 (9H, s, tBu-H) 59 O HO TBDPS 1,2-Dideoxy1,2-dihydro-3-O -(t-butyldiphenylsilyl)-rib ofuranose (compound 59) t -BDPS-thymidine (compound 58 ) (2.14 g, 7.5 mmol) was suspended in 1,1,1,3,3,3hexamethydisilazane (HMDS)(anhydrous, 25 mL) and ammonium sulfate (0.158 g, 1.2 mmol) was added. The mixture was refluxed under argon fo r 2 h. After evaporation of the solvent, the residue was dissolved in dichloromethane (80 mL ) and washed with brin e. The organic layer was collected and evaporated to give a brown oil. The residue was re-dis solved in methanol (50 ml) and treated with K2CO3 (0.66 g, 4.8 mmol). The mixture wa s stirred on ice for 30 minutes and then concentrate under reduced pressure. It was then re-dissolved in dichloromethane (300 mL) and washed with saturated NaHCO3 solution. The organic layer was separated, the solvent was evaporated, and the residue was purified by column chromatography on silica gel eluting with methanol in dichloromethane (5: 95) to give light yellow oil (compound 59 ) (67%, 1.79 g). Rf : 0.36 [CH3OH:CH2Cl2(5:95)]; 1H NMR (CDCl3): (ppm) = 7.73 (4H, m, ArH), 7.44 (6H, m, ArH), 6.47(1H, d, H-1), 4.95 (1H, d, H2), 4.77 (1H, t, H3),4.46 (1H, dt, H4), 3.38 ( 1H, dd, H5a); 3.22 (2H, dd, H5b); 1.12 (9H, s, t -butyl).

PAGE 145

145 O HO N N O N O N nBu nBu 61 3-(keto)-deoxyribose1-methyl-4-N-(N,N-dibutylform amidine)-psuedo-cytidine (compound 61) To a 50 mL round bottom flask, 5iodo-cytidine (0.3gram, 0.8 mmol), palladium acetate (0.021 g, 0.031 mmol), triphenyl arsine (0.05 g, 0.2 mmol), triethylamine (0.24 mL, 1.69 mmol) were added in anhydrous DMF ( 15 mL). The solution mixture was purged under argon and degassed. A solution of 1,2dihydro-3-O-(t-butyl diphenylsilyl)-5hydroxymethylfuran (0.27g, 0.77 mmol) in DMF (2 mL) was also degassed prior to adding it to the solution mixture. The mixture kept under argon was stirred at 55o C overnight. The reaction was monitored by TLC (7% MeOH in CH2Cl2). Rf = 0.6 (compound 6 ). The reaction was complete after 24 hrs, cooled to room temper ature, and then diluted with EtOAc (150 mL) filtered through a plug of celite. The filtrate was extracted with water and the organic phase was concentrated by rotary evaporation. The crude substrate was re-dissolved with CH2Cl2 and tetrabutylamonium fluoride (0.20 g, 0.77 mmol) was added. The reac tion was allowed to stir for an additional 1 hour. The reaction was monitored by TLC (7% MeOH in CH2Cl2), diluted with ethyl acetate (120mL), and filtered through celite. The plug of celite was washed with an additional 100 mL of solvent. The filtrates we re combined and washed with brine (80 mL) and water (2x). The organic layer was separated and dried over Na2SO4. Evaporation of the solvent afforded a brown oil which was purified by column chromatography to give a yellow solid (0.165 g. 0.44 mmole, 56% yield)

PAGE 146

146 O HO OH N N O NH2 62 4-Amino-5-((2S,4R,5R)-4-hydroxy-5-(hyd roxymethyl)tetrahyd rofuran-2-yl)-1methylpyrimidin-2(1H)-one (compound 62) In a round bottom flask (25 mL), the mixture of compound 60 and 61 (0.165 g, 0.44 mmole) was treated w ith 2 equivalents of NaBH(OAc)3 ( 0.18 g, 0.85 mmole,) and a catalytic amount of acidic acid in CH2Cl2. The reaction was allowed to stir at room temperature overnight. TLC (10% MeOH in CH2Cl2) Rf = 0.56. The crude material was purified using gel silic a chromatography. TLC (10% MeOH in CH2Cl2), Rf = 0.45. The and isomer was carefully separated. The product was isolated as a yellow solid (0.045 g, 28% yield) after flash co lumn purification (2x). 1H NMR (CDCl3, 300 MHz ): (ppm) = 7.68 (1H, m, Ar-H, H-6), 4.41 (1H, d. J = 14 Hz 4H), 3.95(1H, dd. 1H), 3.75 (2H, m, 5H), 3.39 (3H, s, N-CH3), 3.05 ( 1H, m, 3H), 2.25(1H, m, 2a) 2.00(1H, m, 2b) Chemical Synthesis of Oligonucleotides. Syntheis of the oligonucleotides was done by the ABI 3400 DNA synthesizer following the standa rd manufacturer protoc ol. All standard phosphoramidites and other reagents used in so lid phase DNA synthesis were purchased from Glen Research (Sterling, VA). The water used to handle DNA was of nanopure quality except for HPLC purification, in which case HPLC grad e water from Fisher Scientific was used. Solid phase DNA synthesis of 3 labeled probes (Method 1) : The synthesis of P1 was performed in a 5--> 3 direction. Substituted benzophenone morphorlidate phosphoramidites used for incorporation into DNA were dried under vacuum over phospho rus pentoxide for two days prior to use. The phorsphoramidite (compound 20 ) (0.135 g, 0.2 mmole) was dissolved in

PAGE 147

147 acetonitrile anhydrous (2 mL) to make a 0.2 M solution. The 19-mer was synthesized at a 1 nmole scale. The coupling time for each standard phosphoramidite incoorporation (A, T, C, G) was 20 seconds according to manufacturer protocol, except for the modified phosphoramidite (compound 20 ), which had a coupling time of 15 minutes. Each successive coupling of the phosphoramidite to the CPG measured by the trityl yi eld was reported to be an average of ~90% yield. The oligonucleotides were cleave d from the CPG using concentrated NH4OH at 55o C overnight. The oligonucleotides were desalted using a C-18 seppak cartridge, then purified by anion exchange preparative HPLC. The flow ra te was 2.20 mL per minute. Buffer A = 20 mM NaOH pH 12.0, buffer B = 1N NaCl in 20mN Na OH, pH 12.0. Gradient (A:B) 90:10 to 40:60 @ 40minutes. RT = 23 min @ 67% B. Modification of 5'-amino DNA with 1isocyanato-4-(2-phenylethynyl)benzene (compound 7): The DNA to serve as the 3'-probe, carrying a 2'-deoxy-5'-amino nucleoside, was prepared by standard solid phase synthesi s using a 3400 ABIDNA synthesizer according to standard protocol. The standard coupling time for the incorpor tation of each nucleoside was 20 seconds, so the 2deoxy-5-amino phosphoramidites were allowed 30 seconds to ensure successful incorporation. Successive incorporation of each phosphoramidite was monitored by the trityl yield released, which was re ported to be an average of 90%. DNA 5 Probe (P2): attachment of 1-Isocyan ato-4-(2-phenylethynyl)benzene to 5 amino oligonucleotide. After the DNA synthesis, the CPG containing the 19-mer was manually treated with 2% dichloroacetic acid by flushing 2% dichloroacetic acid (5 mL, 5x) through the CPG column via a syringe until the wash was clear-colored. The column was neutralized by pyridine and dried by N2. CPG resins were placed into a polypropylene eppendorf tube and treated with a freshly prepared compound 7 solution (150 L of 1 M of compound 7 in equal

PAGE 148

148 mixture of CH2Cl2 and DMF). The suspension was allowed to sit at room temperature for 4 hours and then placed inside a -20o C freezer overnight. The resin was removed from the organic solvent and washed additionally w ith milli-Q water (1 mL x 3x). The beads were separated by centrifugation. Oligonucleotide wa s cleaved off the CPG resin by using 40% MeNH2 in water (1 mL). The CPG beads once again were re moved by centrifugation and washed additionally with 2 mL of water. The washes were combined, and methylamine was removed by bubbling argon into the solution for 40 minutes. The samp le was desalted using a C-18 sepak cartridge and then lyophilized. The oligonucleotide was purified by anion exchange preparative HPLC. Buffer A = 20 mM NaOH pH 12.0, buffer B = 1 NaCl in 20 mM NaOH pH 12.0, flow rate 2.20 mL/ min. A:B @ 0 min 90:10, 40:60 @40 min to 80:20 @ 50 min. RT = 34 minutes, 69% B. The product was purified by HPLC after th e 5'-monomethoxytrityl group was removed. Synthesis of nucleotides: 5' anilino phosphateATT GCC TGG CTA ACG-Fluor 3' The synthesis of a 3-fluores cently labeled oligon ucleotide with the attached anilino phosphoramidite (compound 64 ) at the 5 end was done on the ExpediteTM 8909 Nucleic Acid Synthesis System from PerSeptive Biosystems. The synthesis followed the -cyanoethyl phosphoramidite method. The oligonucle otide was synthesized using a 1 mole scale. The successful incorporation of the nucleosides was m onitored by trityl-yield detector (90%). The oligonucleotide was deprotected from the CP G column by suspension of the resin in concentrated ammonia (0.5 mL) at room temperature overnight. The resins isolated to the bottom of the eppendorf by centrifuga tion and the aqueous layer was pipetted out. The resin was additionally rinsed with milli-Q water (1 mL, 2x) The aqueous solution was combined together, bubbled with N2, and then lyophilized.

PAGE 149

149 Chemical Ligation of DNA probes. To a screwed cap eppendorf, an equal amount of 1 nmole of P1 and P2 and the commercial 42-mer were mixed together. Probes A & B were allowed to anneal to the 42-mer temp late in 100 mM NaCl, 10 mM, and K2PO3/KH2PO4, 0.1 EDTA buffer at pH 7.0. The eppendorf was sealed with teflon tape and irradiated with a UV lamp for 40 hours. An aliquot was taken out at every 10-hour time point. The reaction was analyzed by 32P labeling and fluorescent scan. Analytical analysis MALDI-TOf f Mass Spectrometry was used for characterization of the oligonucleotide. The oligonucleotide (10 M) was mixed with cation exchange beads (dianion PK212, NH4 +) and was withdrawn and expelled about 20 times by a pipette. For measurements of oligonucleotides with molecular weight higher than 3500 amu, the matrix used was as follows: Solution A: 3-HPA (3-Hydroxypicolinic acid ) was dissolved in 50% CH3CN aq. (50 mg/mL). Solution B: Diammonium citrate solution (50 mg/mL in H2O) Solution A and B were mixed (A:B = 9:1). The oligonucleotide solu tion is diluted by equal volume of the matrix mixture. The samp le solution was spotted on the sample plate and dried to make crystal. UV/VIS Spectrometer : Measurement of concentration of oligonucleotides was done by the Varian Cary 1 Bio UV/VIS spectrometer. Fluorescence measurements. Fluorescence measurements were done on a Fluorolog-3 spectrofluorometer (Jobin Yvon Inc., Edison, NJ). All measurements were carried out in a 100 L cuvette. Standard Desalting. The C-18 seppak cartridge was equilibrated with acetonitrile/water (75/25, v/v 5 mL), then H2O (5 mL). The oligonucleotide was loaded onto the cartridge and the

PAGE 150

150 salt was washed out with TEAA buffer (25 mM. pH 7.0, 5 mL). The oligonucleotide was eluted out with acetonitrile/water (75/25, v/v 5 mL). The sample was lyophilized. Deprotection of the oligonucleotide was accomp lished at room temperature by treating the solid resin with concentrated ammonium hydroxide (1 mL) at room temperature overnight. In the case of P1 the oligonucleotide was cleaved off th e resin by treatment with 40% methyl amine in water (1mL) for 4 hours. As for P2 which was benzyl-protect ed, heating the resin at 55o C for 13 hours was required. The resin was se parated by centrifugation, and the aqueous layer was pipetted out and then lyophilized

PAGE 151

151 LIST OF REFERENCES 1. Watson, J. D.; Crick, F. H. C. Molecular st ructure of nucleic acidsa structure for deoxyribose nucleic acid. Nature 1953 171, (4356), 737 738. 2. Watson, J. D.; Crick, F. H. C. The structure of DNA. Cold Spring Harb. Sym. 1953 18, 123 131. 3. Watson, J. D.; Crick, F. H. C. Genetical imp lications of the structure of deoxyribonucleic acid. Nature 1953 171, (4361), 964 967. 4. Phelp, M. E. PET: The merging of biol ogy and imaging into molecular imaging. J. Nucl. Med. 2000 41: 661 681. 5. Phelp, M. E. Nuclear medicine, molecular imaging, and molecular medicine. J. Nucl. Med. 2002 43: 13N 14N 6. De Mesmaeker, A.; Haener, R.; Martin, P.; Moser, H. E. Antisense oligonucleotides, Acc. Chem. Res. 1995 28, 366 374. b. Rosenthal, M.S., Cullom, J., Hawkins, W., Moore, S.C., Tsui, B.M., and Yester, M. Quanti tative SPECT imaging: A review and recommendations by the Focus Committee of th e Society of Nuclear Medicine Computer and Instrumentation Council. J. Nucl. Med. 1995 .36: 1489 1513. 7. Gambhir, S.S. Molecular imaging of cancer with positron emission tomography. Nat. Rev. Cancer 2002 2: 683 693. 8. Gambhir, S.S. Quantiative assay developm ent for positron emission tomography. In Molecular imaging with positron emission tomography (ed. M.E. Phelps). SpringerVerlag, New York. 2003 9. Zhang, P.; Tan, W. Direct observation of single molecule generation at a solidliquid interface Chemistry, A European Journal 2000 6, 1087 1092. 10. Lakowicz, J. R. Principles of Fluorescence Spectroscopy, 2nd Edition; Kluwer Academic/Plenum Publishers: NY, 1999 11. Frost, J. J.; Mayberg, H. S.; Sadzot, B.; Da nnals, R. F.; Lever, J.R.; Ravert, H. T.; Wilson, A. A.; Wagner Jr. H. N.; Links, J. M. Comparison of [11C]diprenorphine and [11C]carfentanil binding to opi ate receptors in humans by positron emission tomography. J. Cereb. Blood. Flow Metab 1990 10: 484 492. 12. Gambhir, S.S. Imaging gene expression: Concepts and future outlook. In Diagnostic nuclear medicine (ed. C. Schiepers), pp. 253 272. Springer Verlag, Berlin 2000 13. Gambhir, S.S. Barrio, J.R.; Herschman, H. R.; Phelps, M.E., Assays for noninvasive imaging of reporter gene expression. Nucl. Med. Biol 1999 26: 481 490.

PAGE 152

152 14. Herschman, H.R.; MacLaren, D.C.; Iyer, M., Namavari, M., Bobinski, K., Green, L.A., Wu, L., Berk, A.J., Toyokuni, T., Barrio, J.R., et al. Seeing is believ ing: Non-invasive, quantitative and repetitiv e imaging of reporter gene expres sion in living animals, using positron emission tomography. J. Neurosci. Res 2000 59: 699 705. 15. Iyer, M., Berenji, M., Templeton, N.S., a nd Gambhir, S.S. Noninvasive imaging of cationic lipid mediated delivery of optical and PET reporter genes in living mice. Mol. Ther 2002 6: 555 562. 16. Liang, Q., Nguyen, K., Satyamurthy, N., Barrio, J.R., Phelps, M.E., Gambhir, S.S., and Herschman, H.R. Monitoring adenoviral DNA delivery, using a mutant herpes simplexvirus type 1 thymidine kina se gene as a PET reporter gene. Gene Ther. 2002 9: 1659 1666. 17. Adams, J.Y.; Johnson, M.; Sato, M.; Berger F.; Gambhir, S.S.; Carey, M.; Iruela Arispe, M.L.; Wu, L. Visualization of advanced hum an prostate cancer lesions in living mice by a targeted gene transfer vector and optical imaging. Nat. Med 2002 8: 891 897. 18. Tyagi, S.; Bratu, D.P.; Kramer, F.R. Mu lticolor molecular beacons for allele discrimination. Biotechnology, 1998 16: 49-53. 19. Weissleder, R.; Mahmood, U. Mole cular Imaging. Radiology, 2001, 219: 316 333. 20. Mitchell, P. Turning the spotlight on cellular imaging. Nat. Biotechnol 2001 19: 1013 1017. 21. Weissleder, R. Scaling down imaging: Molecular mapping of cancer in mice. Nat. Rev. Cancer 2002 2: 11 18. 22. Matsuo, T. In situ visualization of mRNA fo r basic fibroblast growth factor in living cells. Biochim Biophys Acta 1998 1379, 178 184. 23. Giesendorf, B.A.; Vet, J.A.; Tyagi, S.; Mensi nk, E.J.; Trijbels, F.J.; Blom, H.J. Molecular beacons: a new approach for se miautomated mutation analysis. Clin Chem., 1998 44, 482 486. 24. Bratu, D.P.; Cha, B.J.; Mhlanga, M.M.; Kramer, F.R.; Tyagi, S. Visualizing the distribution and transport of mRNAs in living cells. Proc. Natl. Acad. Sci. USA 2003 100, 13308 13313. 25. Li, J.J.; Fang, X.; and Tan, W. Molecular aptamer beacons for real time protein recognition Biochem. Biophys. Res. Commun. 2002 292: 31 40. 26. Fang, X.; Li, J.J.; Tan, W. Using molecular beacons to probe molecular interactions between lactate dehydrogenase and single stranded DNA. Anal. Chem ., 2000 72, 3280. 27. Mitchell, P. Turning the spo tlight on the cellular imaging. Nat. Biotechnol ., 2001 19, 1013 1017

PAGE 153

153 28. Li, J. J.; Geyer, R.; Tan, W. Using molecular beacons as a sensitive fluorescence assay for enzymatic cleavage of single-stranded DNA. Nucleic Acids Res., 2000 28, e52 29. Dirks, R. W.; Molenaar, C.; Tanke, H. J. Methods for visuallizing RNA processing and transport pathways in living cells. Histochem. Cell Biol 2001 115, 3 11 30. Molenaar, C, Marras, S. A., Slats, J. C. M.; Truffert, J. C. ; Lemaitre M. ; Raap, A. K. ; Dirks, R. W.; Tanke, H. J et al. Linear 2 O Methyl RNA probes for the visuallizatio of RNA in living cells. Nucleic Acids Res 2001 29, e98. 31. Marras, S. A. E.; Kramer, F. R.; Tyagi, S. Efficiencies of fluorescence resonance energy transfer and contact mediated quenching in oligonucleotide probes. Nucl.Acids Res 2002 30, art e122. 32. Crockett, A. O.; Wittwer, C. T. Fluorescei n-Labeled Oligonucleotides for Real-Time PCR: Using the Inherent Quenchi ng of Deoxyguanosine Nucleotides. Anal. Biochem 2001 290, 89 97. 33. Seidel, C. A. M.; Schulz, A.; Sauer, M. H. M. Nucleobase-specific quenching of fluorescent dyes: Nucleobase one-electron re dox potentials and their correlation with static and dynamic quenching efficiencies. J. Phys. Chem 1996 100, 5541 5553. 34. Molenaar, C.; Marras, S. A.; Slats, J. C. M.;Truffert, J.-C, Lemaitre M., Raap, A. K., Dirks, R. W., Tanke, H. J. Monitoring gene expression. Nucleic Acids Res ., 2000 29, E89. 35. Weissleder, R. Scaling down imaging: Molecular mapping of cancer in mice. Nat. Rev. Cancer 2002 2: 11 18. 36. Yang, N. C.; Rivas, C. A new photochemi cal primary process, the photochemical enolozation of o-substituted benzophenones. J. Am. Chem. Soc 1961, 83, 2213. 37. Wagner, P. J.; Chen, C.P. A rotationcontrolled excited-state reaction. The photoenolization of ortho alkyl phenyl ketones. J. Am. Chem. Soc 1976 98, 239 38. Wagner, P. J., Misleading sigmas and negl ected geometries: the effects of methyl substitution on rates of triplet state hydrogen abstraction by the benzoyl group. Pure Appl. Chem. 1977 49, 259. 39. Small, R. D.; Jr.; Scaiano, J. C. Role of bi radical intermediates in the photochemistry of o-methylacetophenone. J. Am. Chem. Soc 1977 99, 7713. 40. Haag, R.; Wirz, J.; Wagner, P. The Phot oenolization of 2-Methylacetophenone and Related Compounds. J. Helv. Chim. Acta 1977 60, 2595. 41. Das, P. K.; Encinas, M. V.; Small, R. D. Jr .; Scaiano, J. C. Photoenolization of o-alkylsubstituted carbonyl compounds. Use of elect ron transfer proce sses to characterize transient intermediates. J. Am.Chem. Soc 1979 101, 6965.

PAGE 154

154 42. Sammes, P. G. Photoenolisation. Tetrahedron, 1976 32, 405. 43. Findlay, D. M.; Tchir, M. F. Chem. Soc. Chem. Commun. 1974, 514. b. Connors, R.; Durst, T. Tetrahedron lett. 1992 33, 7277. 44. Griesbeck, A. G.; Stadtmuller, S. The P hotoelectron Spectra of Dimethoxysulfane (CH3O)2S and Dimethoxydisulfane (CH3O)2S2. Chem. Ber 1993 126, 2149. 45. Nicolaou, K. C.; Gray, D. L. F.; Tae, J. Total Synthesis of Hamigerans and Analogues Thereof. Photochemical Generation and Diels-Alder Trapping of Hydroxy-oquinodimethanes. J. Am. Chem. Soc 2004 126, 613. 46. Wagner, P. J.; Sobczak, M.; Park, B. Segura, J. L.; Mart n, N. o-Quinodimethanes: Efficient Intermediates in Organic Synthesis. Chem. Rev. 1999 99, 3199. 47. Mehta, G.; Kotha, S. Recent chemistry of benzocyclobutenes. Tetrahedron 2001 57, 625. 48. Novak, Z.; Nemes, P.; Kotschy, A., Tandem so nogashira coupling: An efficient tool for the synthesis of diarylalkynes, J. Org. Chem ., 2004 4917-4920 49. Sonogashira, K.; Tohda, Y.; Hagihara, N. A c onvenient synthesis of acetylenes: catalytic substitutions of acetylenic hydrogen with br omoalkenes, iodoarenes and bromopyridines. Tetrahedron lett 1975 16, 4467. 50. Giesa, R.; Schulz, R. C., Makromol Soluble poly(1,4-phenylenethynylene)s. Chem. 1990 191, 857. 51. Curtius, T. Curtius Rearrangement. Ber 1890 23, 3023. 52. Curtius, T. J. Prakt. Curtius Rearrangement. Chem.Rev 1894 50, 275. 53. Smith, P. A. S. Curtius Rearrangement reaction. Org. React 1946, 3, 337-449. 54. Scriven, E. F.; Turnbull, K.; Chem. Rev 1988 88, 297-368. 55. Friedel, C.; Crafts, J. M., Friedel-Craft acylation. Compt. Rend 1877 84, 1392 & 1450. 56. Price, C. C. Friedel-Craft reaction Org. React 1946 3, 1. 57. Groves, J. K. The Friedel-Crafts acylation of alkenes, Chem. Soc. Rev ., 1972 1, 73. 58. Gabriel, S. Gabriel synthesis., Ber 1887, 20, 2224. 59. Osby, J. O.; Martin, M. G.; Ganem, B. "An Exceptionally Mild Deprotection of Phthalimides. Tetrahedron Lett. 1984 25 (20): 2093.

PAGE 155

155 60. Erlanger, B. F. & Beiser, S. M. Anti bodies specific for ribonucleosides and ribonucleotides and their reaction with DNA. Proc. Nat. Acad. Sci. USA ., 1964 52, 6874. 61. Brown, D. M.; Read, A. P. Nucleotides. Pa rt XLIX. The reduction of the adduct of periodate-oxidised adenosine-5 phosphate and methylamine. J. Chem. Soc 1965 5072. 62. Eguchi, Y.; Itoh, T.; Tomizawa, J. Antisense RNA. Annal Rev of Biochem ., 1991 60, 631652. 63. Summerton, J.; Weller D. Morpholino Antisen se Oligomers: Desi gn, Preparation and Properties Antisense & Nucleic Acid Drug Development 1997 7, 187-95. 64. Stirchak, E. P.; Summerton J. E.; Weller, D. D. Uncharged stereoregular nucleic acid analogs: 2. Morpholino nucleoade otigomers w ith carbamate internucleoside linkages. Nucleic Acids Research 1989 17 (15), 6129-6141. 65. Azhar, A.; Mohammad N. K.; Lai C. L.; Fan, Y. M.; Chien, S. Y. Syn Comm ., 2004 34(24), 4439 4445. 66. Karas, M.; Hillencamp, F., Laser desorption of proteins with molecular masses exceeding 10k Da., Anal. Chem. 1988 60, 2299-2301. 67. Raddatz, S.; Mueller-Ibeler, J.; Kluge, J.; Wa L.; Burdinski, G.; Havens1, J. R.; Onofrey1, T. J.; Wang, D.; Schweitzer, M. Hy drazide oligonucleotides: new chemical modification for chip array attachment and conjugation. Nucleic Acids Research 2002 30, 4793-4802 68. Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Enzymatic incorporation of a new base pair into DNA and RNA. J. Am. Chem. Soc 1989 111, 8322-832. 69. Piccirilli, J. A.; Krauch, T.; Moroney, S. E.; Benner, S. A. Extending the genetic alphabet. Enzymatic incorporation of a new base pair into DNA and RNA., Nature 1990 343, 33-37. 70. Benner S. A. Understanding Nuclei c Acids Using Synthetic Chemistry, Acc. Chem. Res. 2004 37, 784-797 71. Roberts, C.; Bandrau, R.; Switzer, C. Theore tical and Experimental Study of Isoguanine and Isocytosine: Base Pairing in an Expanded Genetic System. J. Am. Chem. Soc 1997 119, 4640. 72. Roberts, C.; Bandrau, R.; Switzer, C. Synt hesis of oligonucleotides bearing the nonstandard bases iso-C and iso-G. Comparis on of iso-C-iso-G, C-G and U-A base-pair stabilities in RNA/DNA duplexes. Tetrahedron Lett. 1995 36, 3601. 73. Sugiyama, H.; Ikeda, S.; Saito, I. Remarkably Stable Parallel-Stranded Oligonucleotides Containing 5-Methylisoc ytosine and Isoguanine. J. Am. Chem. Soc 1996 118, 9994.

PAGE 156

156 74. Horn,T.; Chang,C.-A.; Collins,M.L. Hybr idization properties of the 5-methylisocytidine/isoguanosine base pair in synthetic oligonucleotides. Tetrahedron lett ., 1995 36, 2033-2036. 75. Seela, F; Wei, C. The base-pairing propert ies of 7-deaza-20deoxyisoguanosine and 20deoxyisoguanosine in oligonucleotide duplexes with parallel and antiparallel chain orientation. Helv. Chim. Acta, 1999 82, 726-745. 76. Chen, X.; Kierzek, R.; Turner, D. H. Stability and structure of R NA duplexes containing isoguanosine and isocytidine. J. Am. Chem. Soc ., 2001 123, 1267-1274. 77. Collins, M. L.; Irvine, B.; Tyner, D.; Fine, E.; Zayati, C.; Chang, C.-A.; Horn, T.; Ahle, D.; Detmer, J.; Shen, L.-P. et al. A br anched DNAsignal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic Acids Res ., 1997 25, 2979-2984. 78. Gleaves, C. A.; Welle, J.; Campbell, M.; Elbei k, T., Ng, V.; Taylor, P. E.; Kuramoto, K.; Aceituno, S.; Lewalski, E.; Joppa, B. Multi center evaluation of the Bayer VERSANT HIV-1 RNA 3.0 assay: analytical and clinical performance. J. Clin. Virol ., 2002 25, 205216. 79. Elbeik, T.; Surtihadi, J.; Dest ree, M.; Gorlin, J.; Holodniy, M. ; Jortani, S. A.; Kuramoto, K.; Ng,V.; Valdes, R. Jr.; Valsamakis, A.; Terrault, N. A. Multicenter evaluation of the performance characteristics of the Bayer VERSANT HCV RNA 3.0 assay (bDNA). J. Clin. Microbiol ., 2004 42, 563-569. 80. Sherrill, C. B.; Marshall, D. J., Moser, M. J.; Larsen,C.A.; Daude-Snow, L. Prudent, J. R. Nucleic acid analysis using an expa nded genetic alphabet to quench fluorescence. J. Am. Chem. Soc ., 2003 ,126, 4550-4556. 81. Switzer, C. Y., Moroney, S. E. and Benner, S. A. Enzymatic recognition of the base pair between isocytidine and isoguanosine. Biochemistry 1993 32, 10489-10496. 82. Bain, J. D.; Switzer, C.; Chamberlin, A. R; Benner, S. A. Ribosome-mediated incorporation of a non-standard amino acid into a peptide through expansion of the genetic code. Nature 1992 356, 537-539. 83. Rice, K. P.; Chaput, J. C.; Cox, M. M.; Switzer, C. RecA protein promotes strand exchange with substrates containing isoguanine and 5-methyl isocytosine. Biochemistry 2000 39, 10177-10188. 84. Moser, M. J.; Prudent, J. R. Enzymatic repair of an expanded genetic information system. Nucleic Acids Res. 2003 31, 5048-5053. 85. Rich, Horizons in Biochemistry. Eds. M. Ka sha, and B. Pullman, Academic Press, New York, 1962 pp. 103-126.

PAGE 157

157 86. Tor, Y.; Dervan, P. B. Site-specific enzymic incorporation of an unnatural base, N6-(6aminohexyl)isoguanosine, into RNA J. Am. Chem. Soc 1993 115, 4461. 87. Horn, T.; Chang, C.-A.; Collins, M. L.H ybridization properties of the 5-methylisocytidine/isoguanosine base pair in synthetic oligodeoxynucleotides., Tetrahedron Lett. 1995 36, 2033. 88. Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Enzymic recognition of the base pair between isocytidine and isoguanosine. Biochemistry 1993 32, 10489. 89. Moroney, S. E.; Piccirilli, A. J.; Weinhold, Cold Harbor E. Symp Quant. Biol 1987 52, 53,103-126. 90. Sugiyama, H.; Ikeda, S.; Saito, I.Remarkably Stable Parallel-Stranded Oligonucleotides Containing 5-Methylisoc ytosine and Isoguanine. J. Am. Chem. Soc 1996 ; 118(41); 99949995. 91. Wada M.; Mitsunobu, Intermolecular dehydrat ion between alcohols and active hydrogen compounds by means of diethyl azodi carboxylate and triphenylphosphine. Tetrahedron lett ., 1972 1279. 92. Chu, C. K.; Reichman U.; Watanabe, K. A.; Fox J. J. Nucleosides. Synthesis of 5(.beta.-D-arabinofuranosyl)isocyto sine and related C-nucleosides., J. Med. Chem .; 1978 ; 21(1); 96-100. 93. Bukowska, M.; Kusmierek, J. T. Miscoding pr operties of isogua nine (2-oxoadenine) studied in an AMV reverse transcriptase in vitro system. Acta Biochim. Pol. 1996 43, 247-54. 94. Jurczyka, J. Kodrah, T.; Rozzella, J. D.; Benner, S. A.; Battersby T. R. Helv. Chim. Acta 1998 81 793. 95. Strobel, S.A.; Cech, T.R.; Usman, N.; Be igelman, L. The 2,6-Diaminopurine Riboside-5Methylisocytidine Wobble Base Pair: An Is oenergetic Substitution for the Study of G-U Pairs in RNA. Biochemistry. 1994 33, 13824-13835. 96. Horn, T.; Chang, C. A.; Collins, M.L. H ybridization Properties of the 5-MethylIsocytidine=Isoguanosine Base Pair in Synthetic Oligodeoxynucleotides. Tetrahedron lett. 1995 36, 2033-2036 97. Horn, T.; Chang, C. A.; Collins, M.L. H ybridization Properties of the 5-MethylIsocytidine-Isoguanosine Base Pair in Synthetic Oligodeoxynucleotides. Tetrahedron lett. 1995 36, 2033-2036 98. Matteucci, M. D.; Caruthers, M. H.; Th e use of zinc bromide for removal of dimethoxytrityl ethers from deoxynucleosides., Tetrahedron lett. 1980 21, 3243. 99. Cohen, W. E. Fed. Proc., Fed. Am. Soc Exp. Biol., 1957 16, 166.

PAGE 158

158 100. Suhadonik, R. J. Nucleoside Antibiotics 1970. Wiiey-lnterscience, New York, N.Y. 101. Davis F. F.; Ailen, F. W. Ribonucleic Acids fr om Yeast which contain a fifth nucleotide., J. Biol. Chem 1957 227, 907. 102. David S. ; Lubineau, A. Synthse de la 5-ribofuranosylcytosine (p seudo-cytidine) et de son anomre Carbohydr 1973 Res., 29, 15. 103. Shapiro R.; Chambers, R. W. Synthesis of Pseudouridine. J. Am. Chem. Soc ., 1961 83, 3920. 104. Brown, D.M.; Burdon, M. G.; Slatdrer. R. P. J. Chem. Soc 1968 1051. 105. Asbun W. A.; Binkiey, S. B. Synthesi s of 5-Substituted Pyrimidines. J. Org. Chem ., 1966 31, 2215 106. Chu, C. K.; Wempen, I.; Watanabe, K. A.; F ox, J. J. Nucleosides. 100. General synthesis of pyrimidine C-5 nucleosides related to pseudouridine. Synthesis of 5-(.beta.-Dribofuranosyl)isocytosine (p seudoisocytidine), 5-(beta-D-ri bofuranosyl)-2-thiouracil (2thiopseudouridine), and 5-(beta.-D-ri bofuranosyl)uracil (pseudouridine) J. Org. Chem 1976 41, 17,(2793-2797) 107. Daves, G.D.; C-glycoside synthesis by pa lladium-mediated glycal-aglycon coupling reactions. Acc. Chem. Res. 1990 23, 201-206. 108. Zhang, H-C.; Doyle Daves, G., Jr. Syntheses of 20-deoxypseudouridine, 20deoxyformycin B, and 20,30-dideoxyformyci n B by palladium-mediated glycal-aglycon coupling. J. Org. Chem 1992 57, 4690-4696. 109. Hosmane, S. R.; Loenard, N. J. Simple Convenient Synthesis of 1-Methylcytosine. Synthesis 1981 2, 118-119 110. Lan T.; McLaughlin L.W. Synthesis of a dA-d T Base Pair Analogue and Its Effects on DNA-Ligand Binding, Bioorganic Chem 2001, 29(4), 198-210 111. Hsieh, H. P.; McLaughlin, L.W. Syntheses of two pyridine C-nucleosides as deletionmodified analogues of dT and dC. J. Org. Chem 1995 60, 5356-5359. 112. Chen, D. L.; McLaughlin, L.W. Use of pKa diff erences to enhance the formation of base triplets involving C-G and G-C base pairs. J. Org. Chem 2000 65, 7468-7474 113. Southern, E.; Mir, K.; Shchepinov, M. Molecular interactions on microarrays. Nature Genet 1999 21, 5-9.. 114. Alwine, J. C.; Kemp, D. J.; Stark, G.R. Met hod for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-p aper and hybridization with DNA probes. Proc. Natl Acad. Sci. USA 1977 74, 5350-5354.

PAGE 159

159 115. Berk, A. J. & Sharp, P. A. Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S1 endonuc lease-digested hybrids. Cell 1977 12, 721-732. 116. Liang, P. & Pardee, A.B. Differential displa y of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992 257, 967-971. 117. Adams, M.D. et al. Complementary DNA se quencing: expressed sequence tags and human genome project. Science 1991 252, 1651-1656.. 118. Okubo, K. et al. Large-scale cDNA sequenc ing for analysis of quantitative and qualitative aspects of gene expression. Nature Genet 1992 2, 173-179. 119. Velculescu, V.E.; Zhang, L.; Vogelstein, B.; Kinzler, K.W. Serial analysis of gene expression. Science 1995 270, 484-487. 120. Schena, M. et al. Parallel human genom e analysis: microarray-based expression monitoring of 1000 genes. Proc. Natl Acad. Sci. USA 1996 93, 10614-10619. 121. Lockhart, D. J. et al. Expression mon itoring by hybridization to high-density oligonucleotide arrays. Nature Biotechnol 1996 14, 1675-1680. 122. Lipshutz, R. J.; Fodor, S. P. A.; Gingeras, T. R.; Lockhart, D.J. High density synthetic oligonucleotide arrays. Nature Genet. 1999 21, 20-24. 123. Lashkari, D. A.; DeRisi, J. L.; McCusker, J. H.; Namath, A. F.; Gentile, C.; Hwang, S.; Brown, P.O.; Davis, RW.. Yeast genome mi croarrays for parallel genetic and gene expression analysis of the yeast genome. Proc. Natl. Acad. Sci. USA 1997 94: 13057-13062. 124. Schena M.; Shalon D.; Davis R. W.; Brown P. O. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 1995 20(270), 5235 125. Ramsey, G. DNA chips: state-of-the art., Nat. biotechnol ., 1998 16, 40-45. 126. Service, R. DNA ANALYSIS: Microc hip Arrays Put DNA on the Spot. Science 1998 282, 396-399. 127. Southern, E. Mir, K. & Shchepinov, M. Molecular interactio ns on microarrays. Nature Genet 1999 21, 5-9. 128. Alwine J. C.; Kemp D.J.; Stark G. R. Met hod for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-p aper and hybridization with DNA probes, Proc Natl Acad Sci U S A. 1977 74(12):5350-5354 129. Southern, E.M. Detection of specific seque nces among DNA fragme nts separated by gel electrophoresis J Mol Biol ., 1975 98:503-517

PAGE 160

160 130. DeRisi, J. L.; Iyer, V. R.; Brown, P. O. E xploring the metabolic a nd genetic control of gene expression on a genomic scale. Science 1997 278,680. 131. Shalon, D.; Smith, S. J.; Brown, P. O. A DNA micro-array system for analyzing complex DNA samples using two-color fl uorescent prob e hybridization. Genome Res. 1996 6, 639-645. 132. Pease, A.C. Light-generated oligonucleoti de arrays for rapid DNA sequenceanalysis. Proc. Natl Acad. Sci. USA 1994 91, 5022-5026 133. Caviani Pease, A.; Solas, D.; Sullivan, E. J.; Cronin, M. T.; Holmes, C. P.; Fodor, S. P. A. Proc. Natl. Acad. Sci.USA 1994 91, 5022. 134. Cheung, V.G. et al. Making and reading microarrays. Nature Genet. 1999 21, 15-19. 135. Vollrath, D.; Davis, R.W. Re solution of DNA molecules greater than 5 megabases by contour-clamped homogeneous electric fields. Nucl. Acid Res ., 1987 15, 7865-7876, 136. Duggan D.J.; Bittner M.; Chen Y.; Meltzer P.; Trent J. M. Expression profiling using cDNA microarrays. Nat Genet 1999 21, 10-14 137. V Schena, M.. Parallel huma n genome analysis: microarray-based expression monitoring of 1000 genes. Proc. Natl Acad. Sci. USA 1996 93, 10614-10619. 138. Shalon, D.; Smith, S. J.; Brown, P. O. A DNA microarray system for analyzing complex DNA samples using two-color fluo rescent probe hybridization. Genome Res. 1996 6, 639. 139. Church, G.M; Gilbert, W. Genomic sequencing. Proc. Natl Acad. Sci. USA 1983 81, 1a, 1991-1995. 140. Belosludtsev, Y.; Iverson, B.; Lemeshko, S.; Egge rs, R.; Wiese, R.; Lee, S.; Powdrill, T.; Hogan, M. DNA microarrays based on noncovale nt oligonucleotide attachment and hybridization in two dimensions. Anal. Biochem. 2001 292: 250-256 141. Leonard, N. J.; McCredie, R. S.; Logue, M. W.; Cundall, R. L. Synthetic spectroscopic models related to coenzymes and base pairs. XI. Solid state ultraviolet irradiation of 1,1'trimethylenebisthymine and photosensitized irradiation of 1,1'polymethylenebisthymines. J. Am. Chem. Soc 1973 95(7):2320-2324. 142. Joos, B.; Kuster, H.; Cone, R. Covalent Attach ment of Hybridizable Oligonucleotides to Glass Supports. Anal. Biochem 1997 247, 96-101 143. Guo, Z.; Guilfoyle, R. A.; Thiel, A. J.; Wang, R.; Smith, L. Direct fluorescence analysis of genetic polymorphisms by hybridizati on with oligonucleotide arrays on glass supports., Nucl. Acids Res. 1994 22, 5456.

PAGE 161

161 144. Yang, M.; Kong, R. Y. C.; Kazmi, N.; Leung, A. K. C. Covalent immobilization of oligonucleotides on modified glass/silicon surfaces for solidphase DNA hybridization and amplification. Chem. Lett 1998 257. 145. Beattie, W. G.; Meng, L.; Turner, S. L.; Varm a, R. S.; Dao, D. D.; Beattie, K. L. DNA microarrays principles and applicat ions in molecular diagnostics. Molec. Biotech 1995 4, 213. 146. Beattie, K. L.; Beattie, W. G; Meng, L.; Turn er, S. L.; Coral-Vazquez, R.; Smith, D. D.; McIntyre, P. M.; Dao, D. D. A dvances in genosensor research. Clin. Chem 1995 41, 700. 147. Rogers, Y. H.; Jiang-Baucom, P.; Huang, Z. J.; Bogdanov, V.; Anderson, S.; BoyceJacino, M. T. Immobilization of Oligonucle otides onto a Glass Support via Disulfide Bonds: A Method for Preparation of DNA Microarrays. Anal. Biochem 1999 266, 23. 148. Kolb, H. C.; Sharpless, K. B. The growing impact of Click chemistry. Drug Discovery Today 2003 8, 1128. 149. Kolb, H. C; Finn, M. G.; Sharpless, K. B. Click Chemistry: Diverse Chemical Function from a Few Good Reactions Angew. Chem. Int. Ed 2001 40, 2004.

PAGE 162

162 BIOGRAPHICAL SKETCH Frances La Chang was born in 1974 in Saigon, Vietnam. She and her family immigrated to the United States in 1987. At age fourtee n, she started to receive formal education at John Kane Junior High School in La wrence, Massachusetts. France s attended Lawrence High School between 1989 1993, and from there she continued her education at Mount Holyoke College, a small liberal arts college for women. She was awar ded a Bachelor of Arts degree in chemistry in 1997. Following the fall of 1997, she took on an internship position working in the chemistry department with Warner Lambert Parked-Davis in Ann Arbor, Michigan. She was hired as a full-time colleague six months later. She worked with the same company for six years before she and her husband move to Florida in June of 2003. She enrolled in the University of Florida graduate school in the fall of 2003 and receiv ed her Doctor of Philosophy in the summer of 2007.