<%BANNER%>

Changes in Characteristics of the Canine Myocilin Gene and Myocilin Protein in Glaucomatous and Normal Dogs

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101209_AAAABI INGEST_TIME 2010-12-09T10:57:38Z PACKAGE UFE0017529_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1054428 DFID F20101209_AAAYFU ORIGIN DEPOSITOR PATH mackay_e_Page_068.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
180c8bf25f6dc3e78293e6b93d457d2e
SHA-1
96845ac3b77ba8713291ed04f9e5a9842d414505
9248 F20101209_AAAXZZ mackay_e_Page_051thm.jpg
a5157f7171165e1e9e4a3812511223b2
fd86ca25a7e4b01d13a7e9b29f12e9cb225e1c1b
49911 F20101209_AAAYGI mackay_e_Page_098.pro
b7104916de5817faee4c4a1161fc6590
a477dd38b83fd6e8701be28b06e33e7bde84ebc2
230 F20101209_AAAYFV mackay_e_Page_003.txt
750c5274ba02c2fa1f6dd3220011d377
254b52dfb5ab1a6fe8f78eae006f2e66a282b54b
25271604 F20101209_AAAYGJ mackay_e_Page_057.tif
0854f89c853ca278497379ae4f55c6c6
8d68d85450dab2c24349353b89e005e17269ebd5
2031 F20101209_AAAYFW mackay_e_Page_103.txt
60b5bcfda1ede5b0aa664b5a063b126d
ed9e3c4d90d6f34c5677da302b46acc72e82e2f1
2172 F20101209_AAAYGK mackay_e_Page_045.txt
1a0bc774001e793da35ceadc7e9d97f9
fe52a85d33dcc7bd21c61e21e2cd4fe729aed982
52309 F20101209_AAAYFX mackay_e_Page_062.pro
cab8c68a4a7b4749d50b2ed5cf362960
898edf2a0c26493e6786f1caeb6474df6decea4b
8937 F20101209_AAAYGL mackay_e_Page_059thm.jpg
f67686a9dda6c31d6cc7937eb9c99f8b
96c5260ce3b54f520fe54eb816bafbcb5bef34e6
16604 F20101209_AAAYFY mackay_e_Page_012.QC.jpg
79e2e34139a409201dfdf4fc986e42d9
f40e74c5f12b759bcd61a7bcc4337960c0623a92
104810 F20101209_AAAYHA mackay_e_Page_104.jpg
9be3fee90ca3d50a24a1c9bdd58cef2c
6608f00b713de8449e8c81be2281affd73311c47
128535 F20101209_AAAYGM mackay_e_Page_118.jp2
119aa6f82aa0204b2c533db55bfd74a6
d56c2f37740f20f2bffbb4549c72296bcefa601b
F20101209_AAAYFZ mackay_e_Page_107thm.jpg
b49f7ae963cd3c4a9bc279242f344e10
d4fbc6f2cf66a0ea07f8665edf3de2f205a743fb
2140 F20101209_AAAYHB mackay_e_Page_062.txt
eac15e6b007fee5446ce51d9310f56dc
f7703bec13dcdeeae67a3532d7d962235527be77
33264 F20101209_AAAYGN mackay_e_Page_027.QC.jpg
61a954312d5eaa14802cee1b91049ace
20927cc8468d4443d31d3defdf0315933c787534
112937 F20101209_AAAYHC mackay_e_Page_103.jp2
e558ac22194cd2aaaff1bacfda6f6941
a16cae63ae250014a56b43fd7b6976a2d6a54f28
147389 F20101209_AAAYGO mackay_e_Page_117.jpg
75e64dcac231f46d2fb54eaec7b849d0
865305d996bf27a074e821125fbe22fc7d7bf67e
111525 F20101209_AAAYHD mackay_e_Page_022.jp2
88dd3c4b7a3c56c1ea52980dd49b9356
e75d670b72697ee956bb99940f3fe404fd639111
1053954 F20101209_AAAYGP mackay_e_Page_003.tif
da7f6e77c8468b9d6d1e9d23bb5c56af
9cf001255cfe7a7f304f022e6b8f4e960a6857ce
37413 F20101209_AAAYHE mackay_e_Page_059.QC.jpg
5630928a0571ef86e0fc77545a8835f2
e1ffb3f3241934492e244bd8a3835e327af31735
120226 F20101209_AAAYGQ mackay_e_Page_111.jpg
045a763f75709103f3f2395877b2c31c
50754b470e4e5575f943bf2462f4222005fd14e9
733 F20101209_AAAYHF mackay_e_Page_055.txt
8b5d166daaeda0084d75c3f2e1ce2aa7
95129a0d8511dd325f8d662bdeeb729a2b0ca273
345 F20101209_AAAYGR mackay_e_Page_042.txt
ebfcb6e350a909a71fe274d720e8b4c6
a7e73ccf5b191c8b56cdea5ccfc26dd76a0a7efc
2153 F20101209_AAAYHG mackay_e_Page_051.txt
7826dc880d21d27a80ff0ecf2702b1ac
a5b48028037771cf49cb66bfe1113256373a99bc
F20101209_AAAYGS mackay_e_Page_080.tif
a68244912bcacb40729a120dfce51812
7b568db91a7f70c5b2e074878ade8ad9f0ab6986
F20101209_AAAYHH mackay_e_Page_016.tif
8f75a3a0b2b7a478edc18c57fdf6d7fc
184d82645966033ceb68ec07d2241700a715567f
1925 F20101209_AAAYGT mackay_e_Page_011.txt
e270869c69dc02813cd06793a832edd4
701fa726cd7dde96d93e7bb10cce16ce42642775
50152 F20101209_AAAYHI mackay_e_Page_024.pro
049e8389fb9fd24bd15f72b39903fb66
3dbb619a64842190d9d1c1dd6d4d0b060a3d1028
35952 F20101209_AAAYGU mackay_e_Page_048.QC.jpg
b03270640d50afaea90111dafb6b333f
5ac865f819b2da903e0dfee4d974d71c6ba73c34
108779 F20101209_AAAYHJ mackay_e_Page_052.jp2
ea44ffb411b116c55d332a47fffd2e9f
5be8278365b1405bbb29a4a24939fdcaed7d9f6b
2082 F20101209_AAAYGV mackay_e_Page_029.txt
67607b7e85736fa99a77ed29d0560a6e
0b3f9e15f8ca434e6de42d15e0d550e13001f4e8
37434 F20101209_AAAYHK mackay_e_Page_082.jpg
6a3617ca7e9eaa1c72ad3a1551e05752
f95e3c25dd65c31e1e116c378ac7d7be62e73920
143391 F20101209_AAAYGW mackay_e_Page_105.jp2
9be35ad88f02fdbe459f6ec03506ca56
0639e5f25def621980d7cb2d24fdfd5b02317784
1051982 F20101209_AAAYHL mackay_e_Page_037.jp2
525228217515a6b7080de9314f7f1863
c80c4a311201bbbc6b29c52a3e27ad1a8426a40d
52007 F20101209_AAAYGX mackay_e_Page_075.jpg
3d1580ff0a2c5d820f3ee064e6c7ee12
dd047e79f6b941d752799ee6160905416b18c6dc
F20101209_AAAYIA mackay_e_Page_116.tif
f7bf40a3f228ca5227a60d107b31f7ed
47edf1b3e8ab8e5546dcbefb964189dd7c434340
14883 F20101209_AAAYHM mackay_e_Page_032.QC.jpg
07cb3df78e2398df204f8be4af7d8353
cbdf0f1d08a2b4b42b2b1bc68038d20799d348ff
8138 F20101209_AAAYGY mackay_e_Page_004thm.jpg
6bfe0ccce35efd08b20267d04202d8ed
54bd83d84064b665f998541d6888c1d1980b082b
5072 F20101209_AAAYIB mackay_e_Page_034thm.jpg
9393df6af6e4be9473a78e95eff624e1
6780d7ad15f77be448ffcf6d7df0e9372c043a7c
120121 F20101209_AAAYHN mackay_e_Page_112.jpg
5d07231f5c0fb57a8364484386b12c45
5c54ac5a9a895606da01f0668c0676dcb584cb87
F20101209_AAAYGZ mackay_e_Page_071.tif
d22628a096ec6bf68a08dc05cbf839fd
ed46944b7df384667a19f1fc933bb275d2df9e47
133003 F20101209_AAAYIC mackay_e_Page_067.jp2
78de30446515540a6856138958fefea2
bd12e1f4797ef47e2060b4ae9ab5d04ba3c7da2b
5331 F20101209_AAAYHO mackay_e_Page_053thm.jpg
87e10b774b8af8a755c2d48c8a8fa6b4
f884824f0f5330e546298b55b75a73aa2371417c
94474 F20101209_AAAYID mackay_e_Page_011.jpg
e83ac158e8860faac782f9d208ecfc91
adc259f47b80277f41e825b21069bcec87077c10
111810 F20101209_AAAYHP mackay_e_Page_026.jpg
0bfffe75a89f444bf7937546178dd9b2
2f23d0b28d576b8ba8dd7d35935125d0ec9a1e97
608 F20101209_AAAYIE mackay_e_Page_073.txt
d9ce5e6b04d45d5e66ae3f042bd9ebed
0c5d2e7b4ae814bf4353c054e8a58ba49c17af8c
F20101209_AAAYHQ mackay_e_Page_090.tif
76187efbeb9624a626ef968a0db586f3
cf1583e9f6e6676e77f11f881a5a02ebf4ec4061
5040 F20101209_AAAYIF mackay_e_Page_068thm.jpg
8632734090d42192ad2a81d4f9504b13
cd49b3c96d54e01c82cbae5116fcc62ddc2495c7
726337 F20101209_AAAYHR mackay_e_Page_085.jp2
cb63890e45c6f165e44522d79fbc5b5b
8d7c887d1729fe16fde9ad9f50474caa385de4a7
F20101209_AAAYIG mackay_e_Page_104.tif
c5fb6f7e4946af6963d2c5ba892e9bcb
da69e9ae0d48b8288a064e3cacf04d37b6b7a6c0
2832 F20101209_AAAYHS mackay_e_Page_070.txt
7c8e8c5a1f5d357c631ecfb5f417337f
8014d326a9571709bc2496d98c949d7439e14659
F20101209_AAAYIH mackay_e_Page_093.tif
c5049aca13632f4c34bb92479741445d
6149196db84c8d797b3d7a337e45119ff308f45f
37017 F20101209_AAAYHT mackay_e_Page_118.QC.jpg
ac69e7bafbe30378477639a91de72097
3a38257ba36fc71eeffe03e51d6aa0cabe7d017e
3926 F20101209_AAAYII mackay_e_Page_007thm.jpg
3e418504339f9ade470ea61fded878db
f49075a324b996a73127bbaa3d9ff485ac53f42a
F20101209_AAAYHU mackay_e_Page_072.tif
5c1e65395f4756b4467e91d6578bc6ae
7b0f450ff8ab07172061c878193b76ed5bc5b513
7239 F20101209_AAAYIJ mackay_e_Page_042.pro
35c10d5ab85827c1a21d936edf475326
01916ec7bd6c6b711a75876311b2b35ee7976fc4
41196 F20101209_AAAYHV mackay_e_Page_009.QC.jpg
beb43564ff3492747d44db826ca8df3d
73b4424bf7d7f0bb936d9e125db55d5c707413f8
108055 F20101209_AAAYIK mackay_e_Page_099.jp2
d767c6094a7c7a50a81f97b47a4fac57
c177e9b68126238c126eec6797d9b3f367b4db8e
16928 F20101209_AAAYHW mackay_e_Page_079.QC.jpg
f1807808a3d657f401f4f765daf157f6
4ada84f58b5d85b42a7fba5cc398096e1b25599d
9435 F20101209_AAAYIL mackay_e_Page_063.QC.jpg
b0f63cb3448411ad5c71cca343983d16
52e60461f20cb29c2cc7512443643f9a114338d0
7446 F20101209_AAAYHX mackay_e_Page_071thm.jpg
bc1f1d44d73899acadf3b9a5062868a1
a6496e427feead44fc278562a67bdacea50888eb
1058 F20101209_AAAYIM mackay_e_Page_007.txt
90bbc7929b656418648dbeb15f956418
bc1c3718965e48139c4f378ee2e02b3e215712d1
5392 F20101209_AAAYHY mackay_e_Page_097thm.jpg
99d4a1f0d8c388910dec6b90e41c96fc
ec15469d9da3d309edb740b6c40c3cb92414e081
4382 F20101209_AAAYJA mackay_e_Page_077thm.jpg
f6aed765035b78e72b354c267694288b
253f425512bda811e88bd4d16c2ec017a2f021e6
23846 F20101209_AAAYIN mackay_e_Page_012.pro
2381950c38e363adde35cfae69bc0377
0eaf0f432760ba422733604078f8a4541b3974b3
108564 F20101209_AAAYHZ mackay_e_Page_014.jpg
077084269fab1dec1919da88fd8a1560
b1d1e54035f669345f97f3ae7fa595bfdb05576e
F20101209_AAAYJB mackay_e_Page_037.tif
cd4a541acf0f06c94f0cfe9b3f610b7e
ea6e1ed7ef095a173f02d1c52eba74e62152fcdd
47778 F20101209_AAAYIO mackay_e_Page_092.jpg
630917bccfa1e14b644d8431ee9b42d4
06ea20602280d83daaada0b46337e7a2c0cdded2
2657 F20101209_AAAYJC mackay_e_Page_115.txt
b97faafa676d778a13551cbd31be3e78
da19d2f7ab9309b81a3e59c8bba8e282e630354e
8219 F20101209_AAAYIP mackay_e_Page_024thm.jpg
821551f5209542eda24e3b5a61122a77
a74ff7cade43d4dbcb087a1bc9bc88de28864651
2641 F20101209_AAAYJD mackay_e_Page_055thm.jpg
fbdc13205e33d54debb5c4bd87c244b7
d1d400134a23068160be42b12b251df041ec9433
139970 F20101209_AAAYIQ mackay_e_Page_107.jpg
15f9faa7e240a7dd5d62993d66e19e89
29818573e6b2bc128a59e7e2daea13966efa9d7d
2071 F20101209_AAAYJE mackay_e_Page_046.txt
5b3eb7e075295e0f16a82be7ab47b9f2
d1f4e0b6a08d55862c8294d2478beb0987569471
31410 F20101209_AAAYIR mackay_e_Page_004.QC.jpg
cbef96aa87d69b20c55a040c2671fb31
fc2ee962594688606e76170f5c36d9c9967cefde
14698 F20101209_AAAYJF mackay_e_Page_085.QC.jpg
5b4971dc55e3378566abe8c68cb5f239
12ba23b3962138e429354d820f4e4d121aefa015
4788 F20101209_AAAYIS mackay_e_Page_066thm.jpg
a381dc059b2f83ae72644c6af9fc2e18
bd22de7a1959a3604b0685aea3c62b71b93e0865
5001 F20101209_AAAYJG mackay_e_Page_086thm.jpg
57ea811e7977feb70267286e5fcbfea3
ab58bd1fe9aebfec6dd545c722ec6805284ea30a
16973 F20101209_AAAYIT mackay_e_Page_066.QC.jpg
56477d71ccff2fb842cad22772cdcac6
37de7ec6a0dce78eb4076701c8b7cee3f15b98a5
60802 F20101209_AAAYJH mackay_e_Page_109.pro
c7bbcbb24eba2742853f0fbaea93e22d
298743939730c78148aa77f87de220645d0b75fa
37629 F20101209_AAAYIU mackay_e_Page_108.QC.jpg
eed46ff74af7373ad0be78ccf906debc
4c9091bac334cde929a8596d7e33371f68b2cd78
8725 F20101209_AAAYJI mackay_e_Page_001.pro
f3c04e69fd68bda39601de54ab4aa2b8
4b8c6f059913b9e9931e486aaba80feaef83988c
9022 F20101209_AAAYIV mackay_e_Page_101thm.jpg
63fbd986a2459cba9ee16c1a6aeb333e
a77a5b7e3ca648e855c6b68b6f979ba1a5d1eaf1
36126 F20101209_AAAYJJ mackay_e_Page_101.QC.jpg
825720daa4c130e4be3947150f0a7b50
317a0aaa3ab883c1fa0f68931b8402183c3f434c
38457 F20101209_AAAYIW mackay_e_Page_122.jpg
3fbab5ed9439a99decb9f771c32ff119
f979dfd9d8624275fb4f11ea64acd5d120e0548c
1497 F20101209_AAAYJK mackay_e_Page_005.txt
869cacdc0781fa7d04bc55b71e41b5e0
e8746ddb9f7f0f39438c87658f58d04e1ab5a805
1416 F20101209_AAAYIX mackay_e_Page_064.txt
91a80269f56bdb9b4e8bd4633940f781
85497f23658cae067ae00d0f1819c2545e5a4ad1
F20101209_AAAYJL mackay_e_Page_099.tif
fb17e170404762860986c4c861e0d224
86eb8326660afed8f909c85b5845509cf2a00bfe
130821 F20101209_AAAYIY mackay_e_Page_112.jp2
a306184af8aa7565373b84e3614c0461
9a57df6ff9de078ecad4f157feb65f9e717889dd
1110 F20101209_AAAYKA mackay_e_Page_031.txt
64da9e0c0ed9f5a431a008ae422d26db
e76acd8ab5f819576028fca39ef4b7b7989d886d
30071 F20101209_AAAYJM mackay_e_Page_071.QC.jpg
004bf75bb94293791381a2e4324e92e4
2e40edc5e4d51fe81cd6589bfd6e9d202a806820
F20101209_AAAYIZ mackay_e_Page_115.tif
c507a3d171dd830dbae113aae6e63b07
37a95246b77ee1952e6ff9a4fd6bfecb63b02030
14547 F20101209_AAAYKB mackay_e_Page_057.QC.jpg
13553cec8d6cc3fba99b4652482a6762
2cc4245a243593e516c0b37680dad197fc12d904
1893 F20101209_AAAYJN mackay_e_Page_035.txt
ef44c3914b405f5d7befad4775ccebf3
6b966ceef01db73c6f22bae56c054ddc598042fd
12182 F20101209_AAAYKC mackay_e_Page_042.QC.jpg
db5d9ce41f2ee03f497ca95ff5592c30
f71f4dc9461e6c4f026d23afee41922733c26a91
3601 F20101209_AAAYJO mackay_e_Page_084.pro
4c87f99ef7afb788b9d368750a66b4af
06e2780c8252bee3d8de1e84050c4a4f99963cf1
78808 F20101209_AAAYKD mackay_e_Page_037.jpg
4cccc43f92229c1f9dbd788205ea13e2
1a10c13a71e28a98820a2c658d0e775351e83ae9
5915 F20101209_AAAYJP mackay_e_Page_081.pro
bf743a500dfd15464bcdd2ba440fcb80
2ee59e6aaba2029bb5da1eb31ef649e5d3d525c1
55189 F20101209_AAAYKE mackay_e_Page_102.pro
144c10110ced031521581682c6784c74
47a2b9e051b9d3e30478870a89940b938eadb498
F20101209_AAAYJQ mackay_e_Page_005.tif
aae7d990e097ed8cca7d9c315d3fb365
05cb89aa1d4c9f4b959058f74285e18d0dbaebd3
587315 F20101209_AAAYKF mackay_e_Page_076.jp2
ae225f5b60d91b6cbdf50013138aa730
dbe219591c34b085ce29cb901797269aaa825602
20773 F20101209_AAAYJR mackay_e_Page_083.QC.jpg
1f09bb42b80c1be00e45bd4cd5d2f652
be8ab1e1e88c1e9af07d0d7b2793e084c00f9f6a
100649 F20101209_AAAYKG mackay_e_Page_035.jp2
b7d312737d53a2c2899f9851171bfaba
f0701b2915bcd5cf54e2d3293083da8e80560508
8358 F20101209_AAAYJS mackay_e_Page_033thm.jpg
99adcf8b39325b123029ee29c64abe73
f50920043f20cb2deefce38254439a08f692c88d
F20101209_AAAYKH mackay_e_Page_062.tif
59f72fa01982a5347bca0bfb8a04a76e
8e77d2bef766ca2ac69956cab59c6962798c9225
4335 F20101209_AAAYJT mackay_e_Page_089thm.jpg
f9195ce360a1932eb04a41300896a269
4da6fd3d51c06f67638eeb2745a4549b23ac39ac
1620 F20101209_AAAYKI mackay_e_Page_032.txt
53ba644469f8da43734729e4c0b63d86
5bfab5d93fd5b3654d54d5587e3e3402fbd33177
35707 F20101209_AAAYJU mackay_e_Page_042.jpg
59560c2747952a2019dff7d999727234
17e3e834c4f71ad65c37c0eff7e49c33800f4184
2169 F20101209_AAAYKJ mackay_e_Page_102.txt
3d62250cf54440eceb0a88835db4f95c
53c18b16dcaa59a0e56c07911f78b06d6d9a7c14
8692 F20101209_AAAYJV mackay_e_Page_014thm.jpg
7d043b69b89941d074e8a5644335115c
1777ff2343c58074c8e99a5a8207662b7117d26b
F20101209_AAAYKK mackay_e_Page_007.tif
e49e40b270979a07fc9bb6d375800195
4c5d549aea13409d19785effdfb1bc9dd0ee934b
6619179 F20101209_AAAYJW mackay_e.pdf
8d9a25f7dcbc4a28a4433ce254947999
1f5aa36cf190a87cc43c26ca5fcd85cbba58c322
17813 F20101209_AAAYLA mackay_e_Page_096.QC.jpg
546bb741312577fe3108fd9ebfa44926
bc07c4c04acdb289ae3d3607edcad3c62ea9dc58
859 F20101209_AAAYKL mackay_e_Page_097.txt
8fb6eac72495745bcb0680f27362dee3
5165c9ed22545fc29dc24efcfe0cbfb6f8eebef1
114057 F20101209_AAAYJX mackay_e_Page_049.jp2
072e0fe13fc5ff2bf9117437dd9fa90b
881b007d739639be4bdb09f59ac04934234072c6
712495 F20101209_AAAYKM mackay_e_Page_057.jp2
c8726ec96e37eb034755e5f3c3d2ae98
e1a03721065c0d7ace599893701c933eeaa39d3e
F20101209_AAAYJY mackay_e_Page_105.tif
0705ebf85ed96ae4236c2fb3e5d9e912
e83f7eec8a016d7f31cb247d64af4ed5b1ab46d3
8722 F20101209_AAAYLB mackay_e_Page_060thm.jpg
0f59f2dcdf1fbff1181b977363956c3e
9afc7a93a40bf8c77902d9b12a2bb047480dbc0c
30321 F20101209_AAAYKN mackay_e_Page_063.jp2
608603be851590f345da9b848acf44c4
9ce548bf8000b960ea77221711758508054c48ad
687004 F20101209_AAAYJZ mackay_e_Page_091.jp2
6bf1d8d26078c3e63a48decbd8787b5a
b18ba60fa6d7fa71aab56c6e6d0c7af5f2d4a9db
184 F20101209_AAAYLC mackay_e_Page_036.txt
a0d1ab827dc963e04973543a5cf039ed
93f9ff8732cee7eb616c804493ac800ce6664456
4850 F20101209_AAAYKO mackay_e_Page_086.pro
9539d01ed75fe2af028ae7c6e393fd57
b3f60cd407be2853e95b0031f738a930bab524a6
F20101209_AAAYLD mackay_e_Page_019.tif
0a2af141f318557f325f31d4613c6f07
e8248c2bd3b4050ed0db492dfc2a4aa0628d78ac
113387 F20101209_AAAYKP mackay_e_Page_023.jpg
c60949e4846ecd81e619899a91dbdc79
7fa5dd0c4d3e3fd2ceb3cb7d43d576cf9644328b
108348 F20101209_AAAYKQ mackay_e_Page_050.jp2
f39e013d946ddf0d6dd50dc620947139
3c8075732642bdea1812e6560d780eb2e55b23d5
184615 F20101209_AAAYLE UFE0017529_00001.xml FULL
89c5f1a38bb4cdb613a9433ed8f4e9d6
a3fe5fa5a8d6e2f0e568bfed8159b1a00087a863
36624 F20101209_AAAYKR mackay_e_Page_047.QC.jpg
fc32e174ab3bdeab6a8492550c9d904b
a3f6dbbd119c97f77a56c5d214bf4fb38d2b658f
F20101209_AAAYKS mackay_e_Page_028.tif
2c52198c2b5fadb2c16f5caf9c5a83de
fae7eba15afefbacedcb8d442a1374e40fe80288
7946 F20101209_AAAYKT mackay_e_Page_076.pro
aa128aea37c3605d2765ae1077c48054
1bfa2d204c8ec6fc062d9d476685f23816bf68c7
5175 F20101209_AAAYLH mackay_e_Page_002.jpg
99773851e2a60ab2d9c93dcd4fc4823e
adea882d531d1cbfff571e8eb971e4df15b78aca
8907 F20101209_AAAYKU mackay_e_Page_112thm.jpg
0034623cbab8658fdb9bdf6da32630f2
202645184d204071625e1aeb0c806e64ceaca701
10000 F20101209_AAAYLI mackay_e_Page_003.jpg
670c551fd770714199d477adee402b0f
8cad103cb2c45b86447a0e955ec6cb96c52cba49
500 F20101209_AAAYKV mackay_e_Page_063.txt
38201ba59912d0537ad8b215f4c3281d
ed0659dd1ec4a2814e0cf50550d2078c36e1aeb0
75902 F20101209_AAAYLJ mackay_e_Page_005.jpg
686090307f6d0328d4bd58f9f6df9a35
e4a2b37cbc03e9f6d714e45cccbfd88258000fbc
48204 F20101209_AAAYKW mackay_e_Page_013.pro
590ff98d32099878605065f81beb105c
ed1f53b499b3c5ada37479ead92410f9307ec698
104889 F20101209_AAAYLK mackay_e_Page_006.jpg
523e8a6f8efc1ad82d2e9102a472b917
0c55a2358008887ea8179b18ae02c50bd1b68450
25843 F20101209_AAAYKX mackay_e_Page_054.QC.jpg
b0109faf74c26cd609f8ce1cb5fc229b
2d15f77546870e3caf10898809bdbb09f7b0a603
110918 F20101209_AAAYMA mackay_e_Page_045.jpg
8abb60a750ce45b0e6b24ccabcaf20b1
d6ac636dc517ca57e4b65cb81609872575e4d933
146304 F20101209_AAAYLL mackay_e_Page_008.jpg
e68867e8e9e201063fb6792b7793880e
b223bf5b4f16bf5d1ae3a955cee3187d4dba19bb
35708 F20101209_AAAYKY mackay_e_Page_070.pro
9fae967d03a15383ad8623d66b60e0a6
e6a5072cf52eae876222ebb0b49aa3f651a99090
110396 F20101209_AAAYMB mackay_e_Page_047.jpg
549de5df4f7db6deafcd75affeecfce4
97f57e1869dff850545a9ff2ae417e849ff1941e
51075 F20101209_AAAYLM mackay_e_Page_012.jpg
bb5b8c99093acb0b2cc9a1bc78b02098
7ba46c2b13243b85a20c30a769abcd877a387edf
8961 F20101209_AAAYKZ mackay_e_Page_023thm.jpg
83e2ebcbfcf74aa33f0ac6be1b740e13
6e40726dc5b2cdaee52cead56d90678a61328735
99944 F20101209_AAAYLN mackay_e_Page_016.jpg
23e5019766552c7593f99a1d55a3f0e3
97800c5014ecd14ee6843121fd56ed0fb840655f
107699 F20101209_AAAYMC mackay_e_Page_049.jpg
048cbe6bcaee7ee580a3c3300e02fdc2
e2bceeb191ffdd7d0c683abfcf349e290b7997ea
105381 F20101209_AAAYLO mackay_e_Page_017.jpg
75126f4996e9aaf433d6ed0fbc918933
1000fdc65764ee8eebd04fe3807769707454af64
113237 F20101209_AAAYMD mackay_e_Page_051.jpg
a1fcd12624f81ef0d36dff01d28608be
f641f454639fff538dae6740df9f0c4f56c2e924
112768 F20101209_AAAYLP mackay_e_Page_021.jpg
c6aaa5bcee0bea741fb523b75fed9afc
fc5aa2c63b25111fb06e7220b7769ce1f59a7160
101671 F20101209_AAAYME mackay_e_Page_052.jpg
b59b2e88c3646343f2b0e1278c8592a9
714a600b00e72ff0da1a4306f21216cf79417897
103093 F20101209_AAAYLQ mackay_e_Page_024.jpg
c71163c91735d98411e318c350fc4c66
753fb11130ef7459ce85b469964dcb787c8a90b2
42323 F20101209_AAAYMF mackay_e_Page_055.jpg
5b0230fed1f6c8224a0f5a75ae9ee7a8
73bbfef223363409da471b5b8e1f97c6a57b2fb2
110613 F20101209_AAAYLR mackay_e_Page_025.jpg
1037750d2cfdc7cab971a2f91111d98f
1c1572fd35cdae08f2fc766d00a36237f21bbbe3
37949 F20101209_AAAYMG mackay_e_Page_056.jpg
82b823dbd3ff39bdec80c98aed4e9320
ef98783ea0c37df462016f8fcb568912ebb92dbd
108380 F20101209_AAAYLS mackay_e_Page_028.jpg
dfec0b91262489b42cf1186d016e6cf4
5d58369066b55156a8acd0b63c21861146b23300
87591 F20101209_AAAYMH mackay_e_Page_058.jpg
1ab1a391844ac41f1f93a5c87f1ceb4e
f86a52712cf9cad00ccfebcf8d0b0ef92b37f90b
109021 F20101209_AAAYLT mackay_e_Page_029.jpg
9b73ac179a9d22279e6b5c85318803ae
219c683a87270cdda4979684a3edefc5c737a626
111128 F20101209_AAAYMI mackay_e_Page_059.jpg
db5df6ed005d80763b9883a7b15f0237
d4f3e1c7e9fd80dddf5a53015ec0baa797059b5c
37246 F20101209_AAAYLU mackay_e_Page_031.jpg
4575bfc82a4c00455c93930d641189d6
74b9e71d272ffdc48b47ad8977cea66692b7f386
111116 F20101209_AAAYMJ mackay_e_Page_060.jpg
43a678294812caa41eef53907b6de521
db3992232c6d82bfdea12c8dc3d945c2c408be42
56976 F20101209_AAAYLV mackay_e_Page_034.jpg
7b8fe6bd8fde4c6eff0e7836c56e0aff
180759689699e3909eb851cf9ae0a85dedf667c7
103083 F20101209_AAAYMK mackay_e_Page_061.jpg
07a2a4bce140e14a3d27f4b39709adb7
ddb0812193913767b39a8351f7690f714ed29c00
58374 F20101209_AAAYLW mackay_e_Page_036.jpg
dd8f7b2803750d967fb14dde146a9f33
e24bdfd8d62dfa0ab4811fbc820edb3a76674093
63264 F20101209_AAAYNA mackay_e_Page_096.jpg
5c8f6002fc155f151d2f903007f0dc02
82b2c6e4b10cc555e2df21aee56b543a9d0e9613
27414 F20101209_AAAYML mackay_e_Page_063.jpg
f12230c419a2779b1f378308a7ab44fe
f7c862d5ccb212e325344334b36699ab0b98f91e
90916 F20101209_AAAYLX mackay_e_Page_038.jpg
e95623ff764b6caee985c9f87980bdf1
b0cbad80f22e1d6af9586afb54bc981f372dfb28
101191 F20101209_AAAYNB mackay_e_Page_098.jpg
885fabe1e01be4126a647022da779bc5
f76b801b048ac6024cb2cbcb6d2053ba456313b9
73364 F20101209_AAAYMM mackay_e_Page_065.jpg
bff52d10d8a76b4a2630cd68a80f4756
ac74da79d1401bffd14f1f322af8f696b937ac81
25979 F20101209_AAAYLY mackay_e_Page_039.jpg
12e27e23c528df89fbf05a153ded6259
cf0a3761670facec9e9164f752d175c7515547f6
101714 F20101209_AAAYNC mackay_e_Page_099.jpg
9e9bcdaf077afd736d78990cd8d42cbf
546b992ac4401febd8cdd45d138bb192e01cd3cd
27867 F20101209_AAAYMN mackay_e_Page_070.jpg
6692b0d6c45d75dff932274c52c81c31
dcc0ec55117f1d56229b2e9ee41e09783e28cd7d
97495 F20101209_AAAYLZ mackay_e_Page_043.jpg
7b19c3b88ea39bda569c00f9b64a57ce
607fafef42e69a84519a026f7afe76e2f64794b3
126143 F20101209_AAAYMO mackay_e_Page_071.jpg
ca1e907a17c210900bf46e07ecb487f3
fe4065ef6339b1aa1c49281e80b2dd3770982d9e
107375 F20101209_AAAYND mackay_e_Page_100.jpg
da1ab476875b4ae439c815f91931e649
62f03926a2219a8510e9b2bde1addff490369527
65192 F20101209_AAAYMP mackay_e_Page_073.jpg
8fdba5b685828c3ddc80d9d706873285
49756be27552eaed5560ca21d2ae4517725de208
109982 F20101209_AAAYNE mackay_e_Page_101.jpg
efb33cd50c6c743277c3652ecaab3929
8dd74f51b30aeaf2d1c1bcdf971010d098259652
82080 F20101209_AAAYMQ mackay_e_Page_074.jpg
5f014b883aa3e6b15d9dcb219f471b92
79379b027c3be6f37f9a6d3197c2c988a4c011eb
111661 F20101209_AAAYNF mackay_e_Page_102.jpg
d840044b1050850c1374a5ecf737dd60
bc0026174d70d1f0bbfda787d88b53a5b0dc2a99
47261 F20101209_AAAYMR mackay_e_Page_076.jpg
16043311fe1ae0dd4bc8538b49697617
74fd539fb5bcfcf3e03a5c0cbedeaf0c57783db5
105317 F20101209_AAAYNG mackay_e_Page_103.jpg
1e094c08df1949d71b53c92b7609310a
7a1f07eb8afb415f46765090f5ef698a62718b55
57669 F20101209_AAAYMS mackay_e_Page_078.jpg
fc068b5d0d65e76cf87e6d24daedc583
08be05000fa820bec27fd28e4759bd9f5eeb3dd7
127670 F20101209_AAAYNH mackay_e_Page_109.jpg
90a00ac6afc499cbe23d521c3a4d14f3
e7e07eb880dce3ba8467a302513332f17c79a69a
63936 F20101209_AAAYMT mackay_e_Page_083.jpg
26a6a61ec7c57c29a9cf42f203f7219b
4bdd88ec6b0b9230658629a9044e8c7269bf0ac9
136986 F20101209_AAAYNI mackay_e_Page_110.jpg
517021d8167103ef19ad939573271e0b
e527d20abf705fc5adc4196bee9bdcf41dbcc15e
61299 F20101209_AAAYMU mackay_e_Page_084.jpg
247b89ab3988743cc1b892d09e3f042f
50e499542c0ed2b0f8649058484306642cd5c491
133327 F20101209_AAAYNJ mackay_e_Page_113.jpg
c46b9fcc677faf0fb7c974df7996b3e9
d259b1db47d68cfc590d85d0205fd600e2d5c269
48296 F20101209_AAAYMV mackay_e_Page_085.jpg
120620ec5da8f3d59ebb84f1023c4334
8f4e0a0060543deda2e27da7c7565270dbb41bbb
136170 F20101209_AAAYNK mackay_e_Page_114.jpg
fb9569f854237694611a576006019f7f
fe421a0563d2a5e09427d4054aef6de59209ed75
47293 F20101209_AAAYMW mackay_e_Page_087.jpg
71de388e93baf3317715bf5dc86de1ac
d9f666cc4a8f2f2537c044132b01c3074f08ce7b
135015 F20101209_AAAYNL mackay_e_Page_115.jpg
990405460e5d2e1a579cbce6f1ba09cd
e7eaa36ad9acc832c4e2d69a34a5270dd1be5f6b
44393 F20101209_AAAYMX mackay_e_Page_089.jpg
5c50cb39aa436ba7a6dd13cde606125c
63ad4e389e992c60e391fac66710fe7f35ad3d69
117573 F20101209_AAAYOA mackay_e_Page_025.jp2
01a0302ff2e104e8ba001e4c88957816
e0eabd049fdd64fbde05a0896200cb112082aa32
137028 F20101209_AAAYNM mackay_e_Page_116.jpg
0ea09b9b843249e890c8592417d7fe8f
af2862b0e26a831416978dc40e47bc911ceced59
72702 F20101209_AAAYMY mackay_e_Page_093.jpg
1c1b045d469fd1f58db205012a3dead9
3deaafbd5c5557e1d923fab689fd8145ec36aad4
119000 F20101209_AAAYOB mackay_e_Page_026.jp2
b5467a99d3b60b685d4968a6ea262f9f
0caed1807913c498fc85ee5b19d27d96856b7de4
140843 F20101209_AAAYNN mackay_e_Page_119.jpg
27203d0e132919a62b22baee10a26812
5d75d8fd7a81d46639af4a9c9378423ded67c2da
72087 F20101209_AAAYMZ mackay_e_Page_095.jpg
f04dcd6a0fcead0e99548fa58855bee8
1c20f3604301b76e90ec78bcf77899b059d9b6c3
114929 F20101209_AAAYOC mackay_e_Page_028.jp2
15300952d6efe20c17599553120242b9
151e64aae6c90288fcf2bfdd721b9276b1c061e5
27949 F20101209_AAAYNO mackay_e_Page_001.jp2
fb97520b8b855b92b949590af0373d93
f6fc046761c12f02706b440c2b389669a92802fd
115485 F20101209_AAAYOD mackay_e_Page_029.jp2
54f12537436e2d88bb6b65e32b7f29c6
dcef1ce9659268b148f7cadea5ac17592d40e88f
10759 F20101209_AAAYNP mackay_e_Page_003.jp2
97b8731207f5439063aae0585bc35eed
510130a63d74a76cf46720eddde358890baad23f
102725 F20101209_AAAYNQ mackay_e_Page_004.jp2
80a36d531e0a34bdd74101d99b20a2aa
a4e43c6a67cfee79d0bd0c60f705175974b257cf
94561 F20101209_AAAYOE mackay_e_Page_030.jp2
f5b0e52715d23f77d766c6e46c2edc93
c80632ec5b33569010341378572b73ecef6039ec
1023682 F20101209_AAAYNR mackay_e_Page_007.jp2
4afef2e6446ebbda757d5e2a26f5eacf
b248bdf77190245ac0a6f14195f7a30a2ff7958e
677661 F20101209_AAAYOF mackay_e_Page_040.jp2
7530d7da8fe2a81d63bb4ae1dfd0110e
860cb069f0898c6f5f16aef9a4172c303708f009
1051971 F20101209_AAAYNS mackay_e_Page_008.jp2
11ad47461e4f299a876312caa5568901
953606caee1fd8695be3892fd89c1fa12bb9ba73
1051980 F20101209_AAAYOG mackay_e_Page_041.jp2
1278694ade14d25c23b568e153dcfa73
a1ad6e79837c695581631bea5c9270de0a5e210d
1051888 F20101209_AAAYNT mackay_e_Page_010.jp2
f90aa757f2ee2b4fc50dde013a97f37c
9e8106850375b368e06354753b60bb72a2b0cf97
489692 F20101209_AAAYOH mackay_e_Page_042.jp2
5b29e736ff4bce89c95d1918bf4909ed
94c2194a4adf6a9045fe8c68a41fe6dfee269d11
112604 F20101209_AAAYNU mackay_e_Page_014.jp2
e6001fc7b1c2e13b9d991bbf16835d00
254e6efc89adce08cdd553601b2fbb80fcd221a6
101773 F20101209_AAAYOI mackay_e_Page_043.jp2
ebf6988661af7e1b148ab52d06c513ae
7f42b2ad1d291c9e6344c42d5a3c5609341665f4
105737 F20101209_AAAYNV mackay_e_Page_016.jp2
54d421ccd65ba43826f2b7abb2345f30
126d20c8d134321e2f9c20db262291e29c005013
115759 F20101209_AAAYOJ mackay_e_Page_047.jp2
77b1c6bfcde30ee151a3da5294795953
78e4f3764682b39a12862f457fdbb6ddf4cc995a
112397 F20101209_AAAYNW mackay_e_Page_017.jp2
ac87c80a1fef0e714eaf719c1bb2c734
845c4dd6c937fd7d2b43dcbb8ff0fd3d87bae249
118793 F20101209_AAAYOK mackay_e_Page_051.jp2
b2f75b64f62c82b5d897ce8bc326666f
0e11eb1cb5716b998a3ad7fd374abd921f1482e8
1051972 F20101209_AAAYNX mackay_e_Page_018.jp2
11c57217958fda04e4a325d55e2f9840
933def8e83195a2939f5f2fcb3a73a201071cf41
523296 F20101209_AAAYPA mackay_e_Page_082.jp2
cdc231bd3f8fb8226ec64c6afcd335d5
3c0315b3488c02b4f0870b8922528b16f9d882dd
70677 F20101209_AAAYOL mackay_e_Page_053.jp2
5f20439e7f1b2b914f77073038c58c63
42042d5e8f8e178a5c527bcc74eac6e8a6636622
119376 F20101209_AAAYNY mackay_e_Page_021.jp2
e007004305827e10ada286ecb90c54d7
574429e2a72fa97d22edf1db8a631e5909a2c0a7
988635 F20101209_AAAYPB mackay_e_Page_084.jp2
c2e613260fc3ec8b726186e573b23ab9
0dda47f50850ed406ba9c373c0c499f8e7078627
38528 F20101209_AAAYOM mackay_e_Page_055.jp2
1eff03f5ecafbde7ac2d6827be4513b1
725d773f3776f798a625c126f1c6939e07c13df4
108920 F20101209_AAAYNZ mackay_e_Page_024.jp2
d15fb94df7fe1bcff101864b6ad72277
6f6113a616827d31af53d86fc706facaed0a25e5
647457 F20101209_AAAYPC mackay_e_Page_087.jp2
7b3c43dcd040cf1fa9cd2dc674b08514
1495bd8b032338f9d0f6c14837a90b8239c73f8b
117409 F20101209_AAAYON mackay_e_Page_060.jp2
8a75b693c03209617e5f41babfa61ad1
644674554aef1549e017b31c222e34425427edeb
715868 F20101209_AAAYPD mackay_e_Page_090.jp2
5aa728da5d5b4522ea8d0386e3f26574
60b995c879bd969ae2122d567523795e2645f79a
114415 F20101209_AAAYOO mackay_e_Page_062.jp2
84342b8bdf641faacb05d76d6de5f0c4
672a52b09debe963b614002976c4671fa775eb2e
F20101209_AAAYPE mackay_e_Page_093.jp2
2befc92f38aa1f699fccfad5035d6514
081d69201034065fc149f86d75243d05d3c99a17
86235 F20101209_AAAYOP mackay_e_Page_064.jp2
80f950930cf577116804e8f518aad31c
53388bbeea3d6671cb85790411f3a10ff1c70712
93422 F20101209_AAAYOQ mackay_e_Page_065.jp2
0a275d85cef3bc981dcf556ebcbf4391
9a5d4faec5f1b6b123e7be59e9e2ebda8a16e9e5
1051956 F20101209_AAAYPF mackay_e_Page_094.jp2
e28579e47bae6914cfbeb2750f573d0b
99810df1f8652eef03c507e8a2a4daefeaee449e
66529 F20101209_AAAYOR mackay_e_Page_066.jp2
c6346eb0982d69bdf00a522a0965e6b0
376462177ec32005cb6c78eb104bd9f567e3a2dc
1051984 F20101209_AAAYPG mackay_e_Page_096.jp2
43a522ff9cdec58f692beec2752538ab
bd93f21d775ece0c520e8d0bd6a1341343eab8d5
124643 F20101209_AAAYOS mackay_e_Page_068.jp2
014c99f4622342e26eca03c5e64593b6
28d6c91342139af30148872d23522b9a138179af
1051838 F20101209_AAAYPH mackay_e_Page_097.jp2
b21f323a06b1d02a9ac5df89ce62ffcf
1fc99be36d15439aeb88ecbc438bdddd38c90864
128184 F20101209_AAAYOT mackay_e_Page_069.jp2
b225d3347d70e5a18a9a734a118ab79a
f66326b1bf6d487ab21bf849641bde79fd49f0a7
106539 F20101209_AAAYPI mackay_e_Page_098.jp2
bd92951a4e8f6e113b7e3f38d8c4d38d
17810427a37f9997e1ae2314fe5b7a6d566881e5
51013 F20101209_AAAYOU mackay_e_Page_070.jp2
69a33c4f6280e7920c833e536e72b34d
98e02991a73b15ded5fcebc0a2f23e9617ad895a
F20101209_AAAYPJ mackay_e_Page_100.jp2
7d3b76a57fa7240431d7aaf662cf2c85
e33c1e2c72ae48da19ea93b6b8c812d0c2153e2e
1051940 F20101209_AAAYOV mackay_e_Page_071.jp2
c24f711c63268aae491446608341f8fa
660dc2f47cf1214df0e52e1e90c22dd165ccf035
120785 F20101209_AAAYPK mackay_e_Page_102.jp2
03dff6e3da8c37daaf37470e68b19081
85c44645c908b8e8be0645f9f0b1dce41e363044
847530 F20101209_AAAYOW mackay_e_Page_072.jp2
44bafefc30077ed3c2edb8ad4ceca7e0
9792f859554a17d7009104dbd512ec910e05b2c0
F20101209_AAAYQA mackay_e_Page_014.tif
a269d00690bf911bd0e1b929d8dc1469
127fe1c4304e6c9de5429f9e25237b13af80db35
151225 F20101209_AAAYPL mackay_e_Page_106.jp2
1f1d68f9d4092d86f351a0ec63ca9d80
51b394b38d0cff28834d833db0ed111bfbbc5fde
872615 F20101209_AAAYOX mackay_e_Page_074.jp2
1f523e6c1f95e69cb250a24c0b966f8c
865a525d26251d6bbdd3cfe22d712e19580493c6
F20101209_AAAYQB mackay_e_Page_015.tif
e655b7243be71f8d163bf253d3a8987a
1e60e0e17692eadcb1429958ef591b85d86030c3
148660 F20101209_AAAYPM mackay_e_Page_107.jp2
9f377f4bbea5060a38e9bfdc7920c370
e24be72f4cf2c17d5f15f68987361237f96eb157
734104 F20101209_AAAYOY mackay_e_Page_075.jp2
141f2c66320d3971cfffa207c58c4067
fc71c89fd9a03b2efd8dfcee1a75b527209a1763
129780 F20101209_AAAYPN mackay_e_Page_111.jp2
003c4c94cca490c7ca20ddeb69b1a85b
f46c1f52e4214e6c0561e9683e1382aa5ce5f8fc
289424 F20101209_AAAYOZ mackay_e_Page_080.jp2
ecc150308e033f67ba362a6c8b4b6d78
3f670486a9ebdf10163b7b05b6699e78ad5d37e7
F20101209_AAAYQC mackay_e_Page_017.tif
8205dc864df0a144c9f5b37a7af05176
df49aaa636ded528b0f4a9098012290f65dfba7f
137937 F20101209_AAAYPO mackay_e_Page_113.jp2
b545dfa06f5587188223314a00429721
a239c022ddaa34660efb620ef39852d705c500fb
F20101209_AAAYQD mackay_e_Page_018.tif
f1ffb7452cb043d72e61f7bfaedb8e21
a77a76726dd29af15cd646d8efe39ec30874e6e5
142276 F20101209_AAAYPP mackay_e_Page_116.jp2
68d0a0aed261af67d06d391d44e56b08
16190513019219740191db8e1983de75cf084d81
F20101209_AAAYQE mackay_e_Page_020.tif
60884b632e62198ba537a23692cceab6
08c6b6b33a0bbb0f8c5463b8f9f80a20a5a6f4c2
150567 F20101209_AAAYPQ mackay_e_Page_117.jp2
323eee9cc965b80ed4a32da634f18d61
13bfc4df3381107a35817e6b8c040e9f3fb1596e
F20101209_AAAYQF mackay_e_Page_024.tif
3bf556985cb9f7efdc2fe8363d41a62b
579eeff9af240154084f84a1d60e9fd5f325acee
38019 F20101209_AAAYPR mackay_e_Page_122.jp2
8f326483d52ffd204482f9828e858d77
d894a2d4bdbdca86a48f0d3c1a5ac152f83fc6da
F20101209_AAAYPS mackay_e_Page_001.tif
bdead4d20d85a513c8a56a8d10bf4eee
9f1273f9d84db79b4f52e4db1998f7b889904a87
F20101209_AAAYQG mackay_e_Page_026.tif
bafdc368045ff1f84d008fc7643b4e84
b9624f4bdf00cf6594b438d7f5ddd222bb0cf25c
F20101209_AAAYPT mackay_e_Page_002.tif
7eceea37191df37b142dc75b51c434b2
fd7cf2d4e910e399e28157c9120b4e2bb7420886
F20101209_AAAYQH mackay_e_Page_029.tif
89201229293a272bd441c14db7994849
66d7653ade2fd7be9d8f88a015e84e5519e35be0
F20101209_AAAYPU mackay_e_Page_004.tif
16adb605de27c75eb1584dcbc723f820
24285adfb5d694c21e7e2b950103a5d3e04f7f7b
F20101209_AAAYQI mackay_e_Page_031.tif
db5511096a143721ebebcd0c1d1a0872
f6a983c3e969b982e293d05bd3102976b7d94189
F20101209_AAAYPV mackay_e_Page_006.tif
ecc5cda91a94c2963a1a548839e2e47b
aae62c4397ddf17600dd5d9343e5c5c75b5a06a8
F20101209_AAAYQJ mackay_e_Page_032.tif
73e6ef4f993241f1b0f0304a5f6f6879
535a3c9faa9ecbc98510e829d3da517a51718dc9
F20101209_AAAYPW mackay_e_Page_008.tif
0eaa3773afe58a429f96d6c50139aabb
64ba15e6b69a5fd3e798da7f32f734f72f2c176a
F20101209_AAAYQK mackay_e_Page_033.tif
7f7a1a7050dbca0f9e8428f6d0d04b00
4008853d8e4d072256034271d4a2570e06bb115a
F20101209_AAAYPX mackay_e_Page_010.tif
6c1d223a9fb547c822722149e55a580b
f8a0ce566ad31715d90715a983f84ed9cc2c50b3
F20101209_AAAYRA mackay_e_Page_079.tif
8f5b1c4f655256745092aed0ce65f7b9
c142349d91456a55ee5dc933cd7bced984c16f60
F20101209_AAAYQL mackay_e_Page_035.tif
90e3ef428b377041bd99aadc86e08b48
c4ce38ab89342dacdd3ed9f8f3be7dd110195078
F20101209_AAAYPY mackay_e_Page_011.tif
dc08b4b099411dd9b4469f4338047398
6cb29e017a3aa9d3b8bac010860c7923e7e05491
F20101209_AAAYRB mackay_e_Page_081.tif
b81cb2371e93b1d6bb168175e9540d61
26e86e6520a127ae5d594ecbba3c52826313af29
F20101209_AAAYQM mackay_e_Page_038.tif
b71eb44f446e66573a71ccddde02a0f8
c21d8b3f07c398107ff8d8176034dc3a297d9365
F20101209_AAAYPZ mackay_e_Page_013.tif
50d9cbcd5c03c94ad687c5147b5b24ec
9bf9c1914c90e7bc99c83bd4ed2a0c1ba324d210
F20101209_AAAYRC mackay_e_Page_089.tif
1941eb7ee69afe2cf9f7e4ad5f6a0462
9e4adbfe93c2663e119e0f41c670365a9bba64ac
F20101209_AAAYQN mackay_e_Page_039.tif
5504e73cb1cc17a0d6770b33e5230382
e90e86dc7475526113f8aa75152f87ff9506ec12
F20101209_AAAYRD mackay_e_Page_092.tif
b676420cf6c3c0f2d71c7f47846248b7
7b6d24e95790f376f20a819963e0b5c2191a9377
F20101209_AAAYQO mackay_e_Page_040.tif
d0716c00a3ef57d684901e360e70b8bd
8f4ef522526c871628215a2fd87a913306b315b7
F20101209_AAAYRE mackay_e_Page_094.tif
6c1559151ccfdd5d236a7757f84575b5
6c420515cc4a6db460fdbbe608679aeda39573ae
F20101209_AAAYQP mackay_e_Page_041.tif
07aa59dca38983f352e99d6a8722b771
05b7f8bccd490c53cdedf865b6f7ed696eaf219a
F20101209_AAAYRF mackay_e_Page_097.tif
9b14faab030c61e742d5404d054632eb
939f9d5f210e7b2bbeb1ce9420e16ed3b2b94e3d
F20101209_AAAYQQ mackay_e_Page_044.tif
82e000f6d16d2a4181af97747af85827
339c807682361ab8cf6584760f07e91e864731c4
F20101209_AAAYRG mackay_e_Page_100.tif
01484508ccb67e64c49ebd4edc7dea51
2511ae2ab12a004c3fb7b2808c67f58c542074af
F20101209_AAAYQR mackay_e_Page_047.tif
9eedf74168377a0584e2c853cbeef08d
0604d7060b8deaee601de59bfbd75bb6542cdd65
F20101209_AAAYQS mackay_e_Page_050.tif
540297236776f00fd1ab7e60a625a22e
fbe3f115e142e265f28dcdc13ad8abb9194b895c
F20101209_AAAYRH mackay_e_Page_103.tif
c069d75f253e39105f15101faf8bd807
f28af6aa5b1d1184ee03ede368170d8e591b4397
F20101209_AAAYQT mackay_e_Page_051.tif
ed62429b27e24def86569a2f16be8ce6
31ad5f965482b194fd60a2c459a6c5054ea53748
F20101209_AAAYRI mackay_e_Page_106.tif
81d7eca7cce61d89d1d900a1f7bdefe9
fff39a31d1f9af5dd22795abf85ff756ec7ae75d
F20101209_AAAYQU mackay_e_Page_058.tif
6c8266797ae93086a74f1d0a678b6c00
1d560b1dca7bead7ce16d12bf0e877b5c9861d48
F20101209_AAAYRJ mackay_e_Page_108.tif
f6ddfa00cfc767273137214b5cff69cb
ae30951105f8e7e8fa24bb9a38bedeaa19f68415
F20101209_AAAYQV mackay_e_Page_060.tif
c918e4645e47554f63df1fc1ea41e4cc
0726e068551293a497557584cd8736e045c90f66
F20101209_AAAYRK mackay_e_Page_109.tif
505a19291a2370a01955b16425d1707c
b2c492920737c25d082b8222618a891ffd76904e
F20101209_AAAYQW mackay_e_Page_061.tif
4f54de7f6a26842c12b2f88c211be0ed
442660c694bec6e1af83db132e349fbfa4ea1995
54246 F20101209_AAAYSA mackay_e_Page_021.pro
64d97342bcf709deea4da65d31e59dd3
990b6ec84c09acefabefb2d6b99f57a49700969b
F20101209_AAAYRL mackay_e_Page_112.tif
0d34ff0ee4572d61f4ccf59358ebfe74
815047e1beeff4c4f6f52da02793451440757949
F20101209_AAAYQX mackay_e_Page_067.tif
13a9963f3e04b13fc1d5b27e4989117c
2bf9f6634a6cccbee4355563f8bbbeb152b0e4c0
54609 F20101209_AAAYSB mackay_e_Page_023.pro
3a256d1f447756d1438b9268437e38c8
1e952f0bb7ddbe46235dbe93ba3019596f2e4a4e
F20101209_AAAYRM mackay_e_Page_117.tif
8d4a7f72ac68840bee47d291b499ae91
a84451675376a2a8a2f9c6f89bf898a270c287b4
F20101209_AAAYQY mackay_e_Page_069.tif
88e5ad6306f02b4fba6b67651835049f
0c1776990e147cc7bedeb356e876163d77546a31
50330 F20101209_AAAYSC mackay_e_Page_027.pro
736721e1c4777e6e2fdfeab1029ac146
62da905b14e5850bd859f4d6b096cae3b433cdd3
F20101209_AAAYRN mackay_e_Page_119.tif
775bd20765f8720768cb7e6c6f5fcdf2
8b8d274eb3d9479c4875bd94b6fcee24ad2ca004
F20101209_AAAYQZ mackay_e_Page_073.tif
887c3bd7ed450fe1e0611878b633e73b
678d9659748206ac9a96003ae0206439a4300a48
42986 F20101209_AAAYSD mackay_e_Page_030.pro
3a666e9a1b8d33566604c087297279e7
152f7afe4b3918c982d97c9c3f576b6db22c9269
F20101209_AAAYRO mackay_e_Page_120.tif
4762ed6d92fc26d04a098f57f85de186
2fadfc097fed374e62c535b43b5269b293eff633
47576 F20101209_AAAYSE mackay_e_Page_033.pro
f8e3bc43128579348ec2a98297c20e99
4fade1df077ad6f7be2af9f2d6b2683ddff9d516
F20101209_AAAYRP mackay_e_Page_121.tif
385546815ef89ccf5ccaf1cb0224f4e3
05e531020fd8c44bb54bb0f72a1481687290b86f
22838 F20101209_AAAYSF mackay_e_Page_034.pro
1e53b43644a62ddf8e3afd212efb846f
224a86a2bb853fe2afb696520f36cbefe4e0e8bd
F20101209_AAAYRQ mackay_e_Page_123.tif
7c2c65d7c8550413570c895798dedd41
b637a4f2bfe938b09a3b479e4d42c8c6774b76b2
3902 F20101209_AAAYSG mackay_e_Page_036.pro
cc062b3361a0bbaa3a145951c1519290
fc8acb619565f323867a1a26958cafd2962c0015
1250 F20101209_AAAYRR mackay_e_Page_002.pro
684cd5568d0d514f2e0fce36a5808ee6
6bdc069b4f8d5c1f137eeab8e1e573589f14f3aa
2676 F20101209_AAAYSH mackay_e_Page_039.pro
6c83dcee7807e27273c320bef8f9c740
103d78e5fe2d761e4090a55d59c62f6c0eaba4f6
3709 F20101209_AAAYRS mackay_e_Page_003.pro
7a255ddbc1aee3ac2ef022041651496a
4ba9545aad42d8a066ea6d48d1e33a64a656a2c0
47721 F20101209_AAAYRT mackay_e_Page_004.pro
8df06baf98afbe2620e4feca60eba9b6
a684ca73a43e6897ef52b8ee0b9bcead62715a21
99095 F20101209_AAAYSI mackay_e_Page_041.pro
30e83df9dea938958d4d27ab36a54e03
cdd7df6402bf095f43c0d97a4799182aeb0f99e5
26306 F20101209_AAAYRU mackay_e_Page_007.pro
06642de3113b336e98122b5dec134a00
adc84b5ec41594b1a2ce4bacdb606c022a4b87b8
56119 F20101209_AAAYSJ mackay_e_Page_044.pro
8a0e1ac90b6f67e3792a8f829281f4a5
e11f953f75247d414672568547dce9613bf8a05b
68272 F20101209_AAAYRV mackay_e_Page_008.pro
c341bfd611314280218d4085892b8cab
f59c3c1eae8015b89678143171355e9a9d89eefa
52274 F20101209_AAAYSK mackay_e_Page_046.pro
39ef4992bf7f8f2b1b0248261cf320e8
895410434d71656f1e22daad3592ed3e42cc723a
45491 F20101209_AAAYRW mackay_e_Page_010.pro
33751e45d583dfaf562fab1402ad20be
ad179e04dfe342623dc5a7dffb53b65a867bcf0c
54389 F20101209_AAAYSL mackay_e_Page_047.pro
b6d779a34701ec2a60d1257a14708530
d1820df52c1fbe91ab95964253f3ef3408136d8c
44369 F20101209_AAAYRX mackay_e_Page_011.pro
31d3694129213b5bb5bc18d258e99439
919bd45b0d24501d75c5c65f8bfe917b262e9580
9815 F20101209_AAAYTA mackay_e_Page_073.pro
75cf859d29042d1fd347f0974541e4e1
e671bee27bae5059681689f8866a27af0649db82
53107 F20101209_AAAYSM mackay_e_Page_049.pro
427e691d89eae1d43bf29749cc379321
bf64b3ae14accb2cfc9af9707fe080c6c371140c
49928 F20101209_AAAYRY mackay_e_Page_016.pro
2b9f4f46088654ad17e370aa83bd20a9
383248c5f0a41fdee78e3caf20f63f5f721ef65d
11939 F20101209_AAAYTB mackay_e_Page_074.pro
a4ff53139d294df8722f987af09d277f
1dc1a63c63c79194b0f00cae74f4204851260e4b
54778 F20101209_AAAYSN mackay_e_Page_051.pro
f00490b8eee4bda3f14c6c68e62fec49
5ad2472cbf4ab64f925c4700a85cd2c9cabf809d
51230 F20101209_AAAYRZ mackay_e_Page_019.pro
72d8500c402aa8c30cce95089b09a467
eccf0ab910b31c256162a116951c1e00dbdbac9c
5358 F20101209_AAAYTC mackay_e_Page_077.pro
c154be414e58826c1f5c945cd4d00305
ebdb2ec8a1309baaaa3c407bfc7ff701277a4a90
48965 F20101209_AAAYSO mackay_e_Page_052.pro
3486b315bee2f2dc8b544b76d892e58d
6c0195f9812c0f16cfd1cadcaaf39a1d135726e7
6987 F20101209_AAAYTD mackay_e_Page_078.pro
e686bfa5bb7ba9b43d420c1d844b5892
6f7da4d2c33a6a2dd6e2976fa496f040bc2447c1
30922 F20101209_AAAYSP mackay_e_Page_053.pro
387191a3c377972d5c1ee4c0bb6ee23c
4985baf553591faea9318133af56319008e0432b
3325 F20101209_AAAYTE mackay_e_Page_079.pro
bb39e9630b88ca8ba4120b9d03a6bbce
4ef50f961ddebff89fb8cbbcc072ddf780a2cadd
17302 F20101209_AAAYSQ mackay_e_Page_055.pro
3fe7772a661a288f4f5ceb4943dfb1e2
ee10ed0a0f9de3e7457c9d0fc0e0921468cc1540
3512 F20101209_AAAYTF mackay_e_Page_082.pro
29da3ddbafbe2fb206d0eff1527205a4
dd9f20016467239f64d4d8219d1af96ac729a3f5
40668 F20101209_AAAYSR mackay_e_Page_058.pro
be280839000362dd88707a6dd19f463b
bcb59d16580372d925ab3faf63f308fc66d47cb2
7079 F20101209_AAAYTG mackay_e_Page_083.pro
c55b1b7ebf12194101696f60050c670c
c0d30d9f072d2edf22371ed291c1190df4941f2e
53445 F20101209_AAAYSS mackay_e_Page_060.pro
a57c9be86d0ebca233ee47ca23b788c8
f8dbb3fed41a1c434011b38819befc65c1400695
4703 F20101209_AAAYTH mackay_e_Page_087.pro
70b3afca2014dcd67edaa863289c18d3
93e04fc8d8e469b1647d77c7715c9881727834ce
12380 F20101209_AAAYST mackay_e_Page_063.pro
869bff689bcde408d37a9ad40bf1e052
092bf1d6726171c18f64173c5df14ba57e466d0b
7388 F20101209_AAAYTI mackay_e_Page_089.pro
a0bac0cbd0a4f38b520017266dad771b
f31e5fbf35cb103da53a3cd3ac27e8d3568ddf8c
34990 F20101209_AAAYSU mackay_e_Page_064.pro
a67414855e649461524c30d9e80f76b8
3064e510f3bf65dd0e8a8a0630a508d38967a0ea
41561 F20101209_AAAYSV mackay_e_Page_066.pro
6e33c2515e2a0fcef46cf7035745c00a
60ddacd370014818439469cf59dd707a9098c36c
5618 F20101209_AAAYTJ mackay_e_Page_090.pro
c0e4ef61d852c1e01fd61555c6f1c650
6097ca592a888ec9519f6b8ef74c9910834086a1
92560 F20101209_AAAYSW mackay_e_Page_067.pro
d445c5191de7f9c36e3a6f7a0cd7d2cb
5a773861618837f8f7f5605af8cdea173c7f7266
7238 F20101209_AAAYTK mackay_e_Page_092.pro
cc9e2e3c649ddc789be7e8ba47f7c8a1
f1a3f22fe69c0a7249742176988885e58071baeb
88206 F20101209_AAAYSX mackay_e_Page_068.pro
24ebfdf3826c679ca30c8a0664d33e8f
4e1a5b699e8e08c8828ae293421b0b05f17aec46
1942 F20101209_AAAYUA mackay_e_Page_004.txt
84ece705067766d0eeca2aade3dc9d7a
6deb2e9a2da7ae58051a02ca60846c4599c10703
5167 F20101209_AAAYTL mackay_e_Page_096.pro
98ace55d0f6a621b4d94301b979e22c2
5326d6a417d441237ef3a50239987859b73a8038
90108 F20101209_AAAYSY mackay_e_Page_069.pro
063c524cee60ce21a53ad1ad32978f84
b7891e46b0409bf02d67f5c79d1fe3bb9401a50c
3177 F20101209_AAAYUB mackay_e_Page_009.txt
2372cc97b6af3f62d8cac2bb4a575ff5
5e1377ba2988a56f67367405a1c3bec492347a99
9111 F20101209_AAAYTM mackay_e_Page_097.pro
a6dbd2d703ed701469ad2a7072d2d4fa
c7ceccd925163e4edab5e5c2ec6d85b991d10647
115097 F20101209_AAAYSZ mackay_e_Page_071.pro
060e9da291915c51e1675f2179431e66
063cda6c8c402266da7783d17905451d3fcb765c
2104 F20101209_AAAYUC mackay_e_Page_014.txt
b76d234cbf2c4eabfebc946508858d17
5cb3b30d46ad2ff621e1c7326c55d27fb95cafbc
50320 F20101209_AAAYTN mackay_e_Page_099.pro
d0c9f18127aeeb658bf65b3c0e30792a
839403fa90fe57a3d2bf7144caf718edf6e8fd70
2182 F20101209_AAAYUD mackay_e_Page_015.txt
9d33c86025fb39b6d9de123445490907
0d3e7dd5fa75f0166539edfd82eaa02a54c2b70e
51518 F20101209_AAAYTO mackay_e_Page_103.pro
36fe9b2ff39fee0d1404dc752357212c
34b19db586e4561cb009d97427df2859a5cb3df1
2026 F20101209_AAAYUE mackay_e_Page_019.txt
04d9edd4908467cbdbbfe6b106488e9b
157119b1cdb23178796d2216492d04e663a73eea
68790 F20101209_AAAYTP mackay_e_Page_105.pro
94fd622f336e9dfe5d4fa8c31065f306
1eca8650db45f4bdd6178097f91720ab99241298
2147 F20101209_AAAYUF mackay_e_Page_023.txt
223f65ce6b9ab1b2b9a63d868470d7d1
f8f3d06165deeeb3e76764ac18fa4f6f3af273c5
71470 F20101209_AAAYTQ mackay_e_Page_106.pro
30c1213b004e6835951a1b966c83304d
be41021c0c55f7e4c1f99de07a4f76ec4f3677a1
9384 F20101209_AAAZAA mackay_e_Page_117thm.jpg
0825051cddf943d82be1ce63c00cfa2c
6637d181f340c7cabf094369d34ce2b68a2a6d40
1993 F20101209_AAAYUG mackay_e_Page_024.txt
a5c2b17ae5f4c9d8a13611a09de3fb1a
3db2a571b52953c8082d655e3215a7d516c27b94
69149 F20101209_AAAYTR mackay_e_Page_107.pro
f8c849f983cda75e9188d6b5ea3dd7b6
cf2b9c221b4bae01f1e22d53e3e6880c068c55a8
36834 F20101209_AAAZAB mackay_e_Page_120.QC.jpg
a08a0e3802c278c979f9a4ac29ccd220
431e3935f6f8aa0e7bd68b9df8f0aa2955f297cb
1995 F20101209_AAAYUH mackay_e_Page_027.txt
58bbd0c25841e8775ea2038a022b1bdf
ca4b7e80f91f1e3086cd2807e4702f731ad02e4c
61692 F20101209_AAAYTS mackay_e_Page_114.pro
294633b50af6bff37bcc5317361fe5cd
f4fd891147778b06c5fd74622c0b7062328e45fb
35856 F20101209_AAAZAC mackay_e_Page_121.QC.jpg
60f85904e92b4270fdfe6c295a3e15b7
89b906c2c71c439984f30d83af8e5ace7c58fa79
2100 F20101209_AAAYUI mackay_e_Page_028.txt
7e6ec828e5fa211fa00066098116fc3e
b1c874789be19eefd46dd3b571ceb1af0c705ea9
66681 F20101209_AAAYTT mackay_e_Page_116.pro
3bd3116ff74e608f4bb19886b2f7296c
7c2201329e7a80f080660d484fe0f5de3a87ad00
11152 F20101209_AAAZAD mackay_e_Page_122.QC.jpg
f202d332d548d086d9db436457311de9
87add284c0a86599416e79d6b2682c6bd2cfdf43
1713 F20101209_AAAYUJ mackay_e_Page_030.txt
f6677ed3b2c630c634158af67e4f431b
a9e4d194b2d25e33405b60630383b5dc36b803bd
71144 F20101209_AAAYTU mackay_e_Page_117.pro
cfb66cb2bf04ebc677b92e3b1697d9c7
2e4124c9aa54007e24ebe814f28b4aa7a547395d
14095 F20101209_AAAZAE mackay_e_Page_123.QC.jpg
4aa4765d673cfad4d6a989efff3dedc3
6ace527f8467eb01409d61dd4bceb01a60ebd48b
59959 F20101209_AAAYTV mackay_e_Page_118.pro
f40445674f70aab2b9cb351b016c213e
402cb0cf8246d8687e01ddda65aea31f6e8ed97e
142638 F20101209_AAAZAF UFE0017529_00001.mets
593746a7be6e3dcc49e20521001ca88f
daf5e371da75e5cd40d8a770905270f2439ea135
266 F20101209_AAAYUK mackay_e_Page_037.txt
b97923cc9ed54af7d0c632a62d2121ec
8f0ac8b4f464a0ee6ec14d0df7110685bc120f1e
67615 F20101209_AAAYTW mackay_e_Page_119.pro
29393e0d2ec973783f233f66134bd1aa
4a89116999491cde246244bd7ac4f3eec4ea63e4
4245 F20101209_AAAYUL mackay_e_Page_041.txt
99c1d55a479f2e7da8d00831071a1f14
5c7209068cb6712b46e2252cb5fcb7548d92964f
61884 F20101209_AAAYTX mackay_e_Page_120.pro
eda8f7e6bbf5f9162dc8e21bcac1f9a5
832d94a6ac4d62234365a69e1ffc58372f8492e3
297 F20101209_AAAYVA mackay_e_Page_075.txt
2e8ed99e8151c4f52a9c0d74d07ecde4
ddf99c969c5eec6d4c3c7a01c05d370c08c4bda5
1959 F20101209_AAAYUM mackay_e_Page_043.txt
18dccf0ad27495b7af20220043eb8570
0d98425640d94aad95da675f1feecfbc1271f4a0
60693 F20101209_AAAYTY mackay_e_Page_121.pro
a8c2797f52aa25dae7dbe7cbf044c430
5e9188fe336a3c0a1e918d1f5195857803283e09
359 F20101209_AAAYVB mackay_e_Page_076.txt
1cc57fc64c6315ba891b74e730b435af
2bbaa346bf8a9fc0045027a4b65e72336d0b44c2
2207 F20101209_AAAYUN mackay_e_Page_044.txt
e2dd5a6b614f1775141a90786c351370
b8515fc62fa4aa30d464b27dcd77a4b7073ee82b
505 F20101209_AAAYTZ mackay_e_Page_001.txt
413fc1c7cd45988a29fbe9fc4dc13630
add8e9a01da6c12c80de28e93b8985e470231a00
332 F20101209_AAAYVC mackay_e_Page_078.txt
973253e7053f4510fc52f2f5ca8358e5
68d2d9a818ad283705f2d46f966686e2e463feae
2136 F20101209_AAAYUO mackay_e_Page_047.txt
1f868232400caf968db1d75985ec2406
8186d55618d8a41b3bdd5b19788f5d5bf1248a45
176 F20101209_AAAYVD mackay_e_Page_079.txt
c5df00d01ca76cd95566465cd3ebaf7a
d2a6e3e1b490018cca6ded5b07cbd0af7d64f49e
2088 F20101209_AAAYUP mackay_e_Page_049.txt
e0b6197ba5d157b6e77d4d7c76c27fc6
4516c6fb8b74103d561e1ad9535fd14ea71c7971
197 F20101209_AAAYVE mackay_e_Page_080.txt
8999f58d743331b7d6a4cb057e2ba86e
0147e475efa5b1b1ba7a8ab0d952559e45103546
1264 F20101209_AAAYUQ mackay_e_Page_053.txt
27d29c79b9b6e8d08b5e000f6efea494
c607071f33908a117a014533a0f46ee5cae21ee6
438 F20101209_AAAYVF mackay_e_Page_081.txt
2442a0f40648454f2ddbbb21b7257072
b080bc0917d7250b36257a9e20a4e12dedcbf3f4
817 F20101209_AAAYUR mackay_e_Page_056.txt
f4bbda82b466c19be3f7d36654908dc6
2cbb5a1b49de02eca850d8cecf531fffa229bf13
203 F20101209_AAAYVG mackay_e_Page_082.txt
e534eb9f96b307c626b7ed21f06bd16b
b914fab0fcfcc9fd2079a01d2d697ea58f62d785
200 F20101209_AAAYUS mackay_e_Page_057.txt
202b54f923282027427b0faa3aea4d32
66f4e102f5894a836bd2b2abd4d146cb736194c5
628 F20101209_AAAYVH mackay_e_Page_083.txt
940f63f5bc4d4782b3d5c397c8a38285
f4d7bebd65f6087a68a878f17389ea3a9117df84
2102 F20101209_AAAYUT mackay_e_Page_059.txt
56977ce8c6f8f7c1e0fe046f9d176e68
3101b5d2aa912e3253e5cb80c9b48d68da6027fa
206 F20101209_AAAYVI mackay_e_Page_086.txt
1f566e3223f35ead1058babfe6b6b601
d4b10fd64ca45d76f3e93780e9b9b072746ce495
2093 F20101209_AAAYUU mackay_e_Page_060.txt
9dac3bf48daca828ea4a9792e794ab6c
8a8ada9543dd07da3394d890264d4555f7c3e9e1
350 F20101209_AAAYVJ mackay_e_Page_087.txt
9bb10c7c5b76804235885ec1802ae999
c250e9e643db5ceec24c61ff04942a7e0ed8262e
2063 F20101209_AAAYUV mackay_e_Page_061.txt
7c717a65bd21fa8639b4b490a992c859
f4838e7545a6a32418030a81d926a22647188103
459 F20101209_AAAYVK mackay_e_Page_089.txt
f2b82727b9b83199f1fade796d0f2fb6
08006e5e86d77efb86985ae87540569417a2315e
2021 F20101209_AAAYUW mackay_e_Page_066.txt
3df70659a9091a78407a907a1ecd35ad
c3ca95756266572b5a8c1875bf9e435794cd5c15
4009 F20101209_AAAYUX mackay_e_Page_067.txt
b5821cb85c570a0a1a60b43cd9af943e
0ce5e7cc6847531ff9f70003f40534ce0b5e18e2
2186 F20101209_AAAYWA mackay_e_Page_001thm.jpg
aaeaf1fcdf8abc2e671dd0e643148f32
1fa17173411f0c0cf1def61d3e7cc12b991b6728
291 F20101209_AAAYVL mackay_e_Page_090.txt
eef4c4cd6f9e3e4dc48298bd8b831e19
af39bdf7a90a9948659b4ffde246f65c1faa1118
4887 F20101209_AAAYUY mackay_e_Page_071.txt
e65613bd8f2b8634578595846b4125cf
67f0899cfd752a90a18e9f700279b5ad9d4ec292
1790 F20101209_AAAYWB mackay_e_Page_002.QC.jpg
47b09a6cc50775224fae8e8908346510
2d3398f35d131f508bc2766956f8e82f2f855baa
824 F20101209_AAAYVM mackay_e_Page_093.txt
f5c8c7b6b7d509c05edeb816587f2e9c
e6eca585771469d106e70686127df132061ecc6e
679 F20101209_AAAYUZ mackay_e_Page_072.txt
e8e0b2f037aa564640c59f749f2e8e10
7ca8dffdc235e0d98f646b153992ba813717843a
36028 F20101209_AAAXTA mackay_e_Page_014.QC.jpg
9ce87533d577855da4b1c472943ddfb2
87584561efafcaa0800d02416d51a806d6f3d043
1091 F20101209_AAAYWC mackay_e_Page_003thm.jpg
79997edb38fc56df215bbd6f0c5aac54
38f92cf59550957230d2882cf42d181c89612f15
276 F20101209_AAAYVN mackay_e_Page_096.txt
9a0c17797d591c84ea5ba36813b7cf18
18e685420c1e1f3cadd8bcd3d5eaf95caf7a65cf
36546 F20101209_AAAXTB mackay_e_Page_023.QC.jpg
a4301104eb3c62054da481ea39b7fc26
897cbacb681597e3f6f1f37b39f9a768d9fef1c0
5924 F20101209_AAAYWD mackay_e_Page_006thm.jpg
9350978548be30fd05ef3018048e48f9
6c1edb78e56ec19ec92d720264c2bd2c4936564f
1985 F20101209_AAAYVO mackay_e_Page_099.txt
fe0ac5db8d13abfd7591662653ca2aba
86e52cd263bf3c95925b7a997c3db7b5d22692a2
8789 F20101209_AAAXTC mackay_e_Page_018thm.jpg
f4b9f8de65cfd04b4a4ffe337c62e00f
65e75e05eb1d7cfefc179f40e40a869e5a415bf2
23009 F20101209_AAAYWE mackay_e_Page_006.QC.jpg
0aa3a29006aa2e19d2026fae840dff65
315ce97d8cdc3bd59ff223518af67cc9346bbfcc
2094 F20101209_AAAYVP mackay_e_Page_100.txt
3d7cc2d3e42155ee19d23705dc08f2c0
6f975f948c806bcd37b63671f8b4d463b68e0865
F20101209_AAAXTD mackay_e_Page_078.tif
c1f7942aab2a316281752be905ec0621
0f6f7d3de1ad0c137d7792c1f0fa1dcbcc8890ad
15704 F20101209_AAAYWF mackay_e_Page_007.QC.jpg
147e366d98b17558d4b5c584580a4759
17a5ecd41e3e6fe52c640bbeb22fd56e71c1743b
2041 F20101209_AAAYVQ mackay_e_Page_104.txt
e5b1794673a421abbf6fdf786f31432f
91b7dfd151c866041b3d4e0aa2ee39d146ca915c
608185 F20101209_AAAXTE mackay_e_Page_073.jp2
4471c232371bb6339929e2579a00c9c1
50c0a7b98889f5feeb30db1631c7f0a971bb2a1f
38344 F20101209_AAAYWG mackay_e_Page_008.QC.jpg
124de368db2a9a2e3791430d21f328ce
cc94615c4e7db8c0f0845e52c14a1f40a407f699
2766 F20101209_AAAYVR mackay_e_Page_105.txt
d7048fd5342dfdef3512e45a5c871222
ae9a771a2382c63b4ab2cf746f8985ae909d23e8
37627 F20101209_AAAXTF mackay_e_Page_018.QC.jpg
a6b0f9af7d05325eda585e77f9acaf4d
33a7862d854cb39cbded0c39f6d23dcbce1192ab
9903 F20101209_AAAYWH mackay_e_Page_009thm.jpg
457e61d34c676fc727572214bdf70ed6
80c61bc3d9ea64397960650a50845b0924530b59
2883 F20101209_AAAYVS mackay_e_Page_106.txt
36e7cab5d6d1580d1b67929bfd7780b7
229a8df57184bd6fd9b51359443afaf81cf37c1e
117460 F20101209_AAAXTG mackay_e_Page_048.jp2
f658fe9c549e6506cd84ee3dd938438c
c1d20cacb1148329201753ada772ef8e63d6c9f0
26628 F20101209_AAAYWI mackay_e_Page_010.QC.jpg
c8e4c5f6b5f268c36695b0b46a7b7e15
5b30f240242c01f32f0be5bee4cbca665c734ebf
2457 F20101209_AAAYVT mackay_e_Page_109.txt
df10371cecac8b9d25dc0aab1ca782e0
8dfd55f4d6cea9c81ecb3e526c0ec738031e0512
953 F20101209_AAAXTH mackay_e_Page_088.txt
b4a9a0674c4e2afa19a3f5505e7265c1
1a1bbac9b770655d9c193427ada3a11082a04f8a
7461 F20101209_AAAYWJ mackay_e_Page_011thm.jpg
a5ae32e9778d2592baedcb67f5d86f23
e6025eee613e24182a48bfef4db47f1a9ff8f4e4
2808 F20101209_AAAYVU mackay_e_Page_110.txt
a1f424a99e5d61d97e7cd3e86098a956
e294e9d5dbc415583c4f752dd462dc69d8e5f3b8
5408 F20101209_AAAXTI mackay_e_Page_095.pro
922af845fd6075dbc407c38f500d6d59
3947260e2d2fa8946d6b76ea19c7ff73b42b69fb
4283 F20101209_AAAYWK mackay_e_Page_012thm.jpg
814dce555ea2de63f1072ec09d4047cd
cc276a9c1adccb0c89586bdc411e8b8699ce9491
2491 F20101209_AAAYVV mackay_e_Page_114.txt
446ad59946af20e59a01e68c5f6f9060
29372cadf083c2c8460d5f41752b5e62e0c2dc26
2416 F20101209_AAAXTJ mackay_e_Page_118.txt
231caa8601ea4ebaad19cb5f8a19fcbb
c253ccc5d7751dafce856aeddfeb66a5aed62814
7642 F20101209_AAAYWL mackay_e_Page_013thm.jpg
d4267379b7c694b2b842ec594996b038
0e1776f0aa31edc465eed37feb93861cfcf02ab8
2867 F20101209_AAAYVW mackay_e_Page_117.txt
b6f7e60f731b51adc26612ff2f4aef99
dd25967cbff4223e97b7c816c8724df3fbb4964b
18954 F20101209_AAAYXA mackay_e_Page_034.QC.jpg
ee0caad506b02ee9c613f46826eb3ca5
d890b498d03c89fcfa8cfcf0d3a1509731dae2bf
2722 F20101209_AAAYVX mackay_e_Page_119.txt
e7b81db607fbbcc28e32fbe9fc0b88b0
656021f7593ac79f2b9857910d1609a3b949d26f
7966 F20101209_AAAYXB mackay_e_Page_035thm.jpg
233682e7d91b504789b6c8cf8b5a6cd3
bc155aa9ef4652155ff0ebfa7b6d58854ea82d65
8987 F20101209_AAAXTK mackay_e_Page_102thm.jpg
ceee810624ffa93e269e816d9aaeeb9d
dc762911c26665ce699f6792b41afada8e8efb59
31934 F20101209_AAAYWM mackay_e_Page_013.QC.jpg
74e4f6eff92dcef3778c0455711e968a
ab14a98f5af3e9f11ce8ba19055ed17aa8b57db4
2460 F20101209_AAAYVY mackay_e_Page_121.txt
3259b55792784184606ba505022027e9
6a5d9a4c336d3dc40fcdb2a9508263a56154aea6
40956 F20101209_AAAXUA mackay_e_Page_117.QC.jpg
f9f12773c7bc1ee69a3d623e9a7f6e0c
2939e7fe35ca946f266af2539a7d3522251386fc
18497 F20101209_AAAYXC mackay_e_Page_036.QC.jpg
a5e378a2eda44e0cb3e96e259bbb4a52
bb5d02eae81c244f07292944abeccd8c43ce0704
81131 F20101209_AAAXTL mackay_e_Page_005.jp2
7675598efbe73746b638fda00b3ed045
ceec6a30594b4dcceb3a7e11c9034e8a9dab18d0
35580 F20101209_AAAYWN mackay_e_Page_015.QC.jpg
119d53daf819093e49b3416ad3f6b6a6
8d147744b456b9146bcacdc1f12db67d76402382
808 F20101209_AAAYVZ mackay_e_Page_123.txt
947fc5fa7dbd833e19ea6339223a9fb8
24a7d2baef53c015350d69fc3327b1e28e9713b3
38123 F20101209_AAAXUB mackay_e_Page_115.QC.jpg
1bad0a9866f9665ff1ec33aa14f735cc
1ba3e8e3718ea4836d0f8630f663ad4c247b7dc3
24239 F20101209_AAAYXD mackay_e_Page_037.QC.jpg
ec4f19efc6c50db2103a4d9e5054dc8c
90209647089b4ebc73bd83f21f71726ba9c51ec9
119494 F20101209_AAAXTM mackay_e_Page_044.jp2
92aaf349d8f7ba9b0a683cb67e61ecd6
9c50488699558fe182d1cc31768a44cabf6befe8
8140 F20101209_AAAYWO mackay_e_Page_016thm.jpg
d84b6875afab4b6303cf07f9d08d1acb
73e450dd387b5681b840212df14eb919e3f6f252
9267 F20101209_AAAXSY mackay_e_Page_108thm.jpg
3c6114989ea5edd56b6374e79c8f95b4
a15c238679220f8680680191282cf1c9562cad45
24683 F20101209_AAAYXE mackay_e_Page_038.QC.jpg
5697bb0a65b0c3579e139d26fea0910d
4cdefc2d37b574c2e2cd968395ec2c7c6ae39592
1026874 F20101209_AAAXUC mackay_e_Page_083.jp2
9817548085f5dced6a989c0425af2987
7d47b4cc63c7d586aa366d83aa65ce3ccd0fd9ab
F20101209_AAAXTN mackay_e_Page_122.tif
913997a3469efa68c94896956db4ba74
88eccd4582ce34620b7c27460b833b99bb15018c
34392 F20101209_AAAYWP mackay_e_Page_017.QC.jpg
0cd43268fc6372c7e97b4ed442f6b932
815002740f77026001f38017469feb5897139773
17651 F20101209_AAAXSZ mackay_e_Page_031.pro
b74ff937f4a8229f4f0c9e25f8141719
630f3d0c7f39cf517ae4c282ae0aad442c8076ed
3526 F20101209_AAAYXF mackay_e_Page_039thm.jpg
273e3cf8492e8d72afe14194b30e1841
6fd0c377aca8a4d7742c63436fa1e2691e29cf11
2589 F20101209_AAAXUD mackay_e_Page_113.txt
cf5064c7fbbdeceeeb55307c48ab0832
efdce15012f01dd80a1d8507f15e9528edd76775
60217 F20101209_AAAXTO mackay_e_Page_065.pro
e5bd08386fd8631f3c8e03e5886fc7a3
0e54c9a2d57f26e9be4138299777b4c95c5fb087
9175 F20101209_AAAYWQ mackay_e_Page_020thm.jpg
5856aa951a1b6cd44db9a7204d7dc773
8dca4f0dd249b88904020f5b296ba20a6d700c98
5216 F20101209_AAAYXG mackay_e_Page_040thm.jpg
354f52e44dcca9b4ad7a43a877c30546
d2d585200396ef48b4dd00d3cda5e77403ddf06e
118281 F20101209_AAAXUE mackay_e_Page_101.jp2
94a43abf93c7140d36466e7f55a2e62b
34bab67b43d1c9fee1636bec50ad9557d023ba12
67342 F20101209_AAAXTP mackay_e_Page_053.jpg
d546e8e58433e4ec5d2a18acf74904f2
339ab31cd31101f077c0a67a0fe254ac7b17c03d
37722 F20101209_AAAYWR mackay_e_Page_020.QC.jpg
c06e20042517acbd7c6dda79e8ac6311
36498986c0525188ef8776cd5da089d37b0d0991
17983 F20101209_AAAYXH mackay_e_Page_040.QC.jpg
5143d8c0cb89b1dd7cb0db9c01206f3f
ee8965a38b7478db0b65ccf36a63a07f40c9d13b
F20101209_AAAXUF mackay_e_Page_102.tif
2260aff7203d8ef100d05cc33cbb5b41
c2826bd40f093a5ff1d6ac7228a0e4f8e02bda19
54590 F20101209_AAAXTQ mackay_e_Page_040.jpg
ad63ddb20828af219922be2f4bc4ca86
bfd0f6ff193660b9843d91669e497279f1c8b8ad
8771 F20101209_AAAYWS mackay_e_Page_022thm.jpg
f2b734132f1dc2bfa2e018e1370a9c24
118776d094c5c31f6d629faa024ee795b583366c
7196 F20101209_AAAYXI mackay_e_Page_041thm.jpg
32b35b1dc74e5ef227c0bae1f9b7dcb2
dce5a941929bdf76585b461bdc5e1fba6431a1a7
64087 F20101209_AAAXUG mackay_e_Page_113.pro
3b8a90034d82db1b626a5e12dc682bb8
ea4095adf1712a2e855360e06f37abc0d77b1784
1766 F20101209_AAAXTR mackay_e_Page_058.txt
9f24a5975eda6af14b78dfbe3dd09e11
01c8272eaa417d1cae5d3dc8ef78390dff833af1
33663 F20101209_AAAYWT mackay_e_Page_024.QC.jpg
c7f0ceeade4097382745b59935a8255c
5935b41c6d9621f1fcb3fc40715c55cc90010d65
53497 F20101209_AAAYAA mackay_e_Page_014.pro
79eca6fffdd0934e259bdbb8585dfd1f
2826742285955236b99fe943247c8b4084272c29
36189 F20101209_AAAYXJ mackay_e_Page_041.QC.jpg
6b5f383ff18909bdf7cdf8531a2f2725
e9d3241dfb747bdb0e0c79d63db8228a1166e5b5
140777 F20101209_AAAXUH mackay_e_Page_105.jpg
11657f6fad4679b54405a8a8c05e88c2
52ad5ff4e1ba01c632badea341ce573d94e494c0
4793 F20101209_AAAXTS mackay_e_Page_094thm.jpg
917eafe7dcdd112e422c25ac7e3d2fb7
7d031d76c626cae9cb8a321410f467a5829b10df
8533 F20101209_AAAYWU mackay_e_Page_027thm.jpg
77cf90aa5e600fba28868a2466ea9fef
53ed039068018f8b941a010a93f78859c1f5db0b
F20101209_AAAYAB mackay_e_Page_053.tif
ae475f956f88c3353052eed9dad67cb9
d1c43e2d5f5e04422dae7bbf64e7f985d7ef38b5
7988 F20101209_AAAYXK mackay_e_Page_043thm.jpg
0882de65b5f3ab330b74362d9b91f1fd
dcb68cbd16408bd169d683e99d94134718ce4dd0
44577 F20101209_AAAXUI mackay_e_Page_057.jpg
e11979cf9531b6a5ebdc64eb5a6cc10a
9f263452b3b78e1c784cd8baa61b5cd1c3a24cd7
F20101209_AAAXTT mackay_e_Page_027.tif
0e19370bf4fd7ad3a0ee6a7059ccc3c9
38a4538b6249dbcac4bbc2bb8c75833dc2388860
8822 F20101209_AAAYWV mackay_e_Page_028thm.jpg
2c0b31c58113bcbbbc5ec2b9ab2f5adc
1216d511325b61b8ddd85e0e8ea26c17b42ff6de
3023 F20101209_AAAYAC mackay_e_Page_031thm.jpg
e72f7db9ed474cd5e4a558dcbcb58910
550aaab4dc8fd5a89e311427eaa48cf5a0ba86b4
32488 F20101209_AAAYXL mackay_e_Page_043.QC.jpg
311450862211e449138968fa1fe50b08
62d81b8472719e225a5f4ee0645b20023aa02562
130477 F20101209_AAAXUJ mackay_e_Page_120.jpg
6655755466fb6d8103758bced684e3e7
a41a0b2e2d2bb8ff49ac8dfb6a8b8873d92199a4
8978 F20101209_AAAXTU mackay_e_Page_026thm.jpg
0e68b69dbe6e5bbabf8bfce1c1b0f056
2f1a4c2b2589645252fb2b3e51d9889bf63b5e6c
9207 F20101209_AAAYWW mackay_e_Page_029thm.jpg
f32d219ce717db2d3eb01f190708ac7e
1999666824023b604ebeb7f8140513cbed1b43a1
2125 F20101209_AAAYAD mackay_e_Page_048.txt
a8a14b70b0c6ec7e38bac3cbff5d07c2
096c5d3366042455763c04534ab73a892eba91ea
6058 F20101209_AAAYYA mackay_e_Page_064thm.jpg
5721ceb7697b0aaa6b54bc2806db9d16
1ad0cf56d50dbf5b96c489d976c2cdf47cdff049
9202 F20101209_AAAYXM mackay_e_Page_044thm.jpg
a786365dc30b3077399d71a0516f22a4
871116549ab61dc9d82aa38be7217148e960a261
5084 F20101209_AAAXUK mackay_e_Page_069thm.jpg
62f9715f6e6ea8bfc8101a25153e06c2
a37223dec51f0086282761dcf9c92a900d6c52b8
6274 F20101209_AAAXTV mackay_e_Page_010thm.jpg
3a5507bdf2386ee865597f780c35767a
ec73331eab18cd5229af07592ce7723d16e944ad
35965 F20101209_AAAYWX mackay_e_Page_029.QC.jpg
077f432d6a2059ed49bacf804c0085b0
2e88dc5f3abe0cf55bbe6d652650ae6d81879079
142892 F20101209_AAAYAE mackay_e_Page_119.jp2
6794bccbcee7c1b00171cd9879b35cfe
50a7021bd3699ce1cec62fbf377162aa515fb3b4
6440 F20101209_AAAYYB mackay_e_Page_065thm.jpg
f61376bd09b143f9ba91014445bc1145
921766767df26fa04449ca331d166845465174db
38957 F20101209_AAAXTW mackay_e_Page_119.QC.jpg
5c339789134e9937196083b9ae274e9c
5ade100451add22e45057e4df6645d101aa2bffe
11618 F20101209_AAAYWY mackay_e_Page_031.QC.jpg
0ac376222c6da56a620935726a224a69
a17d7a77c9475cb8aace25f12a57def316471f5c
104908 F20101209_AAAYAF mackay_e_Page_054.jp2
c9e27c4107fa6249ad48261291b1ff21
44383bca04047e756bebab2a4fb4cbb2d7724b65
23869 F20101209_AAAYYC mackay_e_Page_065.QC.jpg
98449a673f0532461586f13730d047ee
7c7073b13a3ce19768247528d068c2bd7a20b4c9
34940 F20101209_AAAYXN mackay_e_Page_045.QC.jpg
628b47e003eee0ffcf3629291456075e
aead7ecfa4216dfb70b55356f9b18d912fa482df
2505 F20101209_AAAXUL mackay_e_Page_120.txt
2df3fa7820ff9cd52a24c27ede76d493
38899751e3cc09c4a15ee2be6add7fe29e3aa075
F20101209_AAAXTX mackay_e_Page_098.tif
84a05d34b3b70dc8647070dd236ef9e2
01c2c10cffd4df14959f831fcf9ade3739c6a697
32219 F20101209_AAAYWZ mackay_e_Page_033.QC.jpg
043eaf32eb4bc3d6615859f81916c8ee
450c8d7efade09cab0ae665c887e4be0c4712701
2183 F20101209_AAAYAG mackay_e_Page_018.txt
8953d1592f434fea1852f9f673ca49a5
d178e89c0b85224618e3f05cf2b7fe76061e8608
F20101209_AAAXVA mackay_e_Page_096.tif
77adff64012c805b972d720650f1802f
89c3d79c6ac2c7640064417c441e5d99d285316d
20166 F20101209_AAAYYD mackay_e_Page_069.QC.jpg
c8df18458303c15595dbb5f2250a42e7
474d75a9d8039cd16cd4d9d72419df87c3fbbe56
8456 F20101209_AAAYXO mackay_e_Page_046thm.jpg
06f52d0b307d98d760c640e4f57215c1
0932eea1108d8d03ecfd15f12229f67fe545d607
F20101209_AAAXTY mackay_e_Page_064.tif
6cd7c6d0e7f22254c03de44a522f9ce9
dc1a1af681aaa43a06b26bca3773e76b192371e5
19087 F20101209_AAAYAH mackay_e_Page_123.pro
a50853db866b22c53acd3eba6f526c8c
bf023a0aa9a057a676744c3f1ae23d40ca4d2786
F20101209_AAAXVB mackay_e_Page_084.tif
b4f97fecefb6d9deb6751edb0f018933
071b2b4cc9d152e489944843729b93805979afee
5386 F20101209_AAAXUM mackay_e_Page_094.pro
568832480275e94f42cea36de40f3e37
1545555a59d3bf5d698b433da14a407e20f26463
2560 F20101209_AAAYYE mackay_e_Page_070thm.jpg
9ba8e80b796f0968869ac45c1bbfc289
ef236829068135c0ea04e36b0a7636cfa0b1924b
8847 F20101209_AAAYXP mackay_e_Page_049thm.jpg
797e388bae80b3d3aadac87ad3b86287
19fc68f11f1ecc6454150f39dc029568dca2e24d
F20101209_AAAXTZ mackay_e_Page_114.tif
88f975a07474a438d0328ef61aaec8ee
cf174cf59a4770ec7c9067905e09634a37b281ca
26714 F20101209_AAAYAI mackay_e_Page_080.jpg
0333687e990796b38700e454265210a2
3dc531fe5c147828e1e4cdab694d66248b32bd33
26642 F20101209_AAAXVC mackay_e_Page_072.QC.jpg
cf11685b50c678fdd647406def6eb2d6
364c3a3c52899d702de55b16b6b77597c7aae750
32330 F20101209_AAAXUN mackay_e_Page_050.QC.jpg
8d227dcbb2e8069b12cde664deec0d5c
9646218529b27abcc7f891da18de5ca94ca850b2
9503 F20101209_AAAYYF mackay_e_Page_070.QC.jpg
f309f8588b6722be5683b789972c24e3
ac40f519f2c371a57acb5434e6271ba1a5684a8a
8308 F20101209_AAAYXQ mackay_e_Page_050thm.jpg
d49e954d4bbe79d1c45b603517dbd3cf
a7347add7305748c58aaeedd6077a15809aaf451
28788 F20101209_AAAYAJ mackay_e_Page_030.QC.jpg
17bd9125a75b5155e6360cf255be3f13
de0d274bc5b86de258831adb262441f59627082c
F20101209_AAAXVD mackay_e_Page_059.tif
46c4744feac058dc5f4990db0d41449f
da89aa67525baaea2cb2826d5d6b3d455ab9d2bb
F20101209_AAAXUO mackay_e_Page_038.jp2
3008cebed9b3d1e997502b165121e960
ad471e33610b063b4e99c41bc45f5b7796c4f233
23318 F20101209_AAAYYG mackay_e_Page_073.QC.jpg
4439044fed001c0ca681903c2fd6072f
ad29ba03175b9ded53fb73599be9142c6967d039
36875 F20101209_AAAYXR mackay_e_Page_051.QC.jpg
51b248aee075244477ce820d16a30f58
4b80ff894d795ccb0877e51eca9516970472369c
4956 F20101209_AAAYAK mackay_e_Page_093thm.jpg
610b76498a3737ad0ce34745b54099dd
a5e2dd35e781f3f010122263014984fbda756a3f
947 F20101209_AAAXVE mackay_e_Page_012.txt
5f072d3b6908f78c8ee2f4895ebff678
b20e515191a5b043ea9c738120eabdb89771287e
148386 F20101209_AAAXUP mackay_e_Page_110.jp2
8f35e4a32f85e8f423dd7837d6d6d853
823f9b6c0fb360155345031a534cd14be78bed39
31087 F20101209_AAAYYH mackay_e_Page_074.QC.jpg
a9ae7aab6020f7bea1d31ae340dd26ac
cc98c72c609412dd83c73dd01241627caacb6319
11472 F20101209_AAAYXS mackay_e_Page_055.QC.jpg
087b87ec124696e29800a2f48cd36d9e
bfb561f4c605287953843a41349453ad05ae9a7b
69459 F20101209_AAAYAL mackay_e_Page_068.jpg
9a072588d917cac8581276aeb27f2535
f2969e188dbc1a233761784bdc3c82e34ce9bddc
3850 F20101209_AAAXVF mackay_e_Page_042thm.jpg
2f9c00269a759aa00ad8bf6cc74ab3f8
d704b04d0729750a11d085bbbf2894f8a0421fd8
161 F20101209_AAAXUQ mackay_e_Page_039.txt
2579b4d9af0f60745df5c8c58b905907
b8e47cf746158da654f9f8238b534b87e88d0237
F20101209_AAAYYI mackay_e_Page_075thm.jpg
2d0cbf4be1b8403c164fb9671a9ed13a
24a62926119d334378883b8a909da200be6ecb1b
4615 F20101209_AAAYXT mackay_e_Page_057thm.jpg
c007767d86079382b4bc9541bd2e62eb
a968724fcd1e03569a8f28a6170fdf1952fd5b12
104028 F20101209_AAAYBA mackay_e_Page_013.jp2
47d5d1fa417c5e725f72769cd1322c33
8aba2f12237cfed04c0aa70af29985c5a82c661b
F20101209_AAAYAM mackay_e_Page_022.tif
3ae29697e67b51cecae9038d9b6e6485
dc394ab746f9295103b0baf43a7c5b04d1f45b11
102938 F20101209_AAAXVG mackay_e_Page_033.jpg
2e92d74c874826f00c1105e9cf1270a0
496c1dd39b1964f8dac985dfc3b4d69c1be7f8ce
F20101209_AAAXUR mackay_e_Page_049.tif
f4c73e227e45df76a6549cdd141846d2
270168709facdd46cc8ba4e8579be713dd159dcb
16121 F20101209_AAAYYJ mackay_e_Page_075.QC.jpg
907fb853cf676aa828de69e61b83fc28
5e1e00f9cedac0fb45ccc3a2ae82ec030b3fad24
7193 F20101209_AAAYXU mackay_e_Page_058thm.jpg
fe34a9a0e706636801819238b5ea19d9
04ad7b091c3559483e37a587375696d7ee5ada62
113976 F20101209_AAAYBB mackay_e_Page_015.jp2
fac7fbedb31b4d38f7c6de7431d2c1f0
7028adb20a6a0a3080bc5d4a4f525deb42957a9f
88782 F20101209_AAAYAN mackay_e_Page_030.jpg
b9f67aab538da52402a4f78c5f0794f4
e29ee2d0f25ebbf6cd39c7a0124aea36e94f9e84
42096 F20101209_AAAXVH mackay_e_Page_054.pro
b384795ee701a9236fc5787a393c8560
40ce9891d88d47d3f5db34c6e9b6d2490b4be2f8
8497 F20101209_AAAXUS mackay_e_Page_100thm.jpg
717b971d8671f33d97d1d867efc6afea
1e54710c8e60fb198bea3e72a89d486dcceb4705
4231 F20101209_AAAYYK mackay_e_Page_076thm.jpg
3159a422d027afbf1671c33f74323771
bcf1d5c4cfa6cb629ff630646699ea9a9be12d5d
28643 F20101209_AAAYXV mackay_e_Page_058.QC.jpg
39d730628a5d9f4055bd67005cadf4ff
768f42136657e8e577dbed6802bc25dd94b3b175
950372 F20101209_AAAYBC mackay_e_Page_092.jp2
e18f230e25d37056623c72ee7d1a5594
1d776cc00d923bb77038f322179e314cc9f36098
60126 F20101209_AAAYAO mackay_e_Page_112.pro
913c6bc1c9a41be9a64ece83de5b4b04
c434cea24c09145d17a5c7391609a4611ac19ecd
3252 F20101209_AAAXVI mackay_e_Page_080.pro
174008ca90a05484f8f5b8d233b0b737
9016ddcbad4e77bcd8bde24da891bc6e2d74f675
722292 F20101209_AAAXUT mackay_e_Page_086.jp2
039f5a58b2a397901ac7a3745c311be4
59202212185608728115156d834b26cdde969833
14732 F20101209_AAAYYL mackay_e_Page_076.QC.jpg
24034fdb4645fde27a6474b425fe4a1b
a826a89e27e8e6a0fafad0eb8c4de8526ff75594
36010 F20101209_AAAYXW mackay_e_Page_060.QC.jpg
04c645d372a913d1aa120a412081d8fe
66e1d7ae7249705ee69bc426ba6084d12063320d
8903 F20101209_AAAYBD mackay_e_Page_120thm.jpg
84fd12b083117034871289ccde904b22
a86fab51d3de56fce4dec892a2470ee767d0e11a
24354 F20101209_AAAYAP mackay_e_Page_064.QC.jpg
3be46994c73a62d400c5abcdce86b24b
8b77a6ef7f938228cedd9d5bc63ee8281b9d08e7
36208 F20101209_AAAXVJ mackay_e_Page_049.QC.jpg
eee8f852478a3ad9ffb43a957f882931
7a95635a0be7cd7ddf383a519ab3f060464b8da3
53202 F20101209_AAAXUU mackay_e_Page_048.pro
717006a15315953ae02b825a69942c36
9047865093afc8e9972f7d8eeaaea526c35401d2
4270 F20101209_AAAYZA mackay_e_Page_091thm.jpg
e2ce9f865fbf1592b518a29b5aa13e9d
c3089bbad6d98159d5df674f155c1510ba9a1644
14744 F20101209_AAAYYM mackay_e_Page_077.QC.jpg
66f81e2f060eef9f6730822b9062e9c1
5353f64da7b61ba71d9eeaa79d8b1992dff36dbf
8520 F20101209_AAAYXX mackay_e_Page_061thm.jpg
ef4c858f6379aed4b71895c68dea6b2d
f858eea14871deca8534c46d14dd3377bc1b1cd1
2680 F20101209_AAAYBE mackay_e_Page_116.txt
613cb345c4adcb04719d287c24e4a99c
2ea30f0710c06f6ada3e6970bd4fa9148846a0b2
9219 F20101209_AAAYAQ mackay_e_Page_008thm.jpg
d841a32a30e54d7db9513bdb91efa4d2
2597a8c564a00db34a478b090e26e752bcf19aba
34574 F20101209_AAAXVK mackay_e_Page_028.QC.jpg
640663e41d73676e63a2e827cbc62418
362c559910fad9538fe7677ee72a4a6604f21c24
132197 F20101209_AAAXUV mackay_e_Page_120.jp2
dd937f98b998f6401b847c3ad1b37952
07c178bf1032b3376d195a53b10fff6db1c88992
4134 F20101209_AAAYZB mackay_e_Page_092thm.jpg
75e194b6e7b534d82dfa9f4e0a0474cb
92fa48b1fa92d7160bf1552c5bd62044d14a42b7
4690 F20101209_AAAYYN mackay_e_Page_078thm.jpg
3b40eb4a8c2e2acfcfa09f75eea679c4
9dd900dd628ab4ef8c9f9feee5df05ce461a0bb0
8593 F20101209_AAAYXY mackay_e_Page_062thm.jpg
53b64ec247018275e94ad510cc2a5c9f
6b5a96bba07624dbda8fe07874bfc975d345cc20
223 F20101209_AAAYBF mackay_e_Page_077.txt
0a2b9cb87b388f703fdf23987d018739
0e736599f9c82245efd262a11b319532155ece84
8740 F20101209_AAAYAR mackay_e_Page_048thm.jpg
500d0e6828ac3507122d8d266633ef20
954e6b60fa4b875d5d04e2cee489358f620d11fd
110788 F20101209_AAAXVL mackay_e_Page_046.jp2
55df349dbcb3a8fd0f35c8faed05f3a8
285c797ce139bef0894927a7b24b340a6eb31ad4
6795 F20101209_AAAXUW mackay_e_Page_073thm.jpg
5e765d1bf7df24ab468947fa342dab25
326cf62dc16e26f8180308f7be5379783c509fde
17155 F20101209_AAAYZC mackay_e_Page_094.QC.jpg
e837c000d5c4377d258fcbb2feba780b
4b8fa7972cb7fe9a53a2fa3023bffd63ff74c27c
35449 F20101209_AAAYXZ mackay_e_Page_062.QC.jpg
ea08ef06bf69566bac895065b5c1e8e6
316b18afec0947abc82f7528020228e2a540da58
2215 F20101209_AAAYBG mackay_e_Page_020.txt
06dc3f3f0aff2f2f0d2c2990f598ee24
2528fc438ebee9cde53600f3d486db1a18c89347
32412 F20101209_AAAXWA mackay_e_Page_098.QC.jpg
c0b231df7a2b2fde68749b65695f3c3f
be3ded7268cef654da7eb515585ff65cccd54bf3
42877 F20101209_AAAYAS mackay_e_Page_123.jpg
248aef40a2d66a626c6ff7d91a8efe72
a7fbcaf945243104dffe961ce7d40bd2789ffe8b
F20101209_AAAXUX mackay_e_Page_034.tif
7a3e8577802447defb21c4c3711b1be7
a30e759b5c1c28c7cc31d0b8e521fd8ccd48ff5e
5970 F20101209_AAAYZD mackay_e_Page_095thm.jpg
0fbad71104c1fb3e5f22a95d6a3c821f
9dd5f0efea07e7e76916dd57a374800960326af5
17199 F20101209_AAAYYO mackay_e_Page_078.QC.jpg
51f2eb05172b0d7d3dd4343246354c4a
3cbfb60944157665bcde5412f8babf1ca5b5ea40
54317 F20101209_AAAYBH mackay_e_Page_045.pro
75c46e2273bd995c751f58986cb3b049
8b55ebe4dbffd9c0ce31c08e0b64a0de91e419da
F20101209_AAAXWB mackay_e_Page_042.tif
e9b7cbde1c7aec9dc7a315172a42bba4
d420fa38469a0a5d7bcc1eadda60be5d38877658
12967 F20101209_AAAYAT mackay_e_Page_092.QC.jpg
1cb0dce7fc46f71e1cacd605da348ac6
44e1b29861f388f97fdfede5ee433d041a81a523
34852 F20101209_AAAXVM mackay_e_Page_022.QC.jpg
02e2f5725df75623533f3cb3031af140
7eb0bbc9ca81c3507eb68f7a86d3419aa457ff5c
32142 F20101209_AAAXUY mackay_e_Page_016.QC.jpg
371dc506e5445c04587ef65bb3f7bf66
0e03757700f874c164fd9c5f6bacd5b20007429c
4858 F20101209_AAAYZE mackay_e_Page_096thm.jpg
4178b46379c607cd61103a0833b6cb18
ab8a79e4a0d910d8c5a1a56f6fde5295ff9c5059
5191 F20101209_AAAYYP mackay_e_Page_079thm.jpg
298a6e09514445f85cdaf203bc5f624b
2514106f1b12ecec2d864c2e1ef0b44e274d5676
48826 F20101209_AAAYBI mackay_e_Page_086.jpg
8ee8d3fc12c5c8fc991726d9707d29e3
308de12433242c62e5854bcb05b9a7b050890541
99075 F20101209_AAAXWC mackay_e_Page_013.jpg
7d9d7e09baeaad65dfe50614ecd41131
74591bcd498d623970bcb37b7e10d3cde1f751f9
F20101209_AAAYAU mackay_e_Page_101.tif
58dcb6370565b2d0dc6a050acbb5b7b9
4aa91458c23af1164393f1c1017afbb421dbab9b
F20101209_AAAXVN mackay_e_Page_088.tif
aa7937813ddd6ddf33943919b93a7478
2b7172ff5da0df98c6207b98b4590f704dce8bee
2777 F20101209_AAAXUZ mackay_e_Page_008.txt
73b200ac47ec363f138ce4496666b861
09b12ddf2cb8db3b080b71f7d3690992163ebdae
21202 F20101209_AAAYZF mackay_e_Page_097.QC.jpg
956602147cacbfa4d31cae2d3ef6b72c
c2d59e49d4d5eac9768f115383512044a42d2e6d
3757 F20101209_AAAYYQ mackay_e_Page_081thm.jpg
6aec9dac7499b8f9f19a5cf1a6522290
2e05f8e53c1d62eeea240999fb10ad3af9ceb989
196 F20101209_AAAYBJ mackay_e_Page_085.txt
80317f29aeaf560f3a79ddb0488f3662
8b8b3771d1b4550c6106e16536169593276d96f1
2400 F20101209_AAAXWD mackay_e_Page_038.pro
e6c98a7f2b7e4d396ff313bd91c42149
b3b92cde71a6f20b32e2640f68d961485061af06
103009 F20101209_AAAYAV mackay_e_Page_019.jpg
2c7210dc7fc715dfdb1227d4dde5ab5c
ba3b6838b0cfab4c47dee84705706668a10c8492
3487 F20101209_AAAXVO mackay_e_Page_003.QC.jpg
732578a17d5f30ccacd83604c8c9d00f
62c1a0eccb64496042794ad34df8dce1d13ec833
7954 F20101209_AAAYZG mackay_e_Page_098thm.jpg
d8bc629dc5bb14f5478b19bb096ebd00
8b21ff748154d876ec0348346b48b12bff63474c
12867 F20101209_AAAYYR mackay_e_Page_081.QC.jpg
6fc58d49b751fcd0fa02930495b8bca2
7e80a235243f25271a906fd81b41d9094e49cf68
51109 F20101209_AAAXWE mackay_e_Page_032.jpg
07a5498506b0a780e06b200d2b6a79c9
c5c270ee2f1b403cbf3e9f61e7fe0c8491e0ec05
162353 F20101209_AAAXVP mackay_e_Page_041.jpg
929fe08310aad33878eca5bf072e8247
60fecb2163ccbbd1530f6a2b63f95da82a5e82e7
78817 F20101209_AAAYBK mackay_e_Page_072.jpg
71fecebd7def48d6efbee98b836c656f
901b13a4a4face6d928d148367192379ccd188d6
8530 F20101209_AAAYZH mackay_e_Page_099thm.jpg
d1c72ffa1e2eeaeb67ac949c2a9b941d
68dbb2a12b828311e22725b4774a08248d20aee5
3035 F20101209_AAAYYS mackay_e_Page_082thm.jpg
866a73ac7fb0f2a929d0c49feaed55f8
a2fca77811283f45fa0ae9465f7e31c14a03753e
1647 F20101209_AAAXWF mackay_e_Page_054.txt
d90f63db47e1e7ed49b62b2986cbb746
d9325cb159146e0e193e7e61fdfb7e48e50af089
114776 F20101209_AAAYAW mackay_e_Page_044.jpg
ece5713fc0a8f9acdd56f3fe76d377a8
a4152d05352105b0db4f1f6c0802ab868d11d120
28587 F20101209_AAAXVQ mackay_e_Page_001.jpg
67b416cd183dac94f945ec224c9651e2
d07446896e28d6a5994d4ae3f6ede6dc3a8774d0
110580 F20101209_AAAYBL mackay_e_Page_061.jp2
ccc1e2355ac01932d68a8545b266f71b
8abdf15d054f89232944ba3f8aaea58f49a6c663
8586 F20101209_AAAYZI mackay_e_Page_103thm.jpg
f0395064558aae5ddee454581612e8ce
656f18174728976cb248a101276e092a537fca68
6026 F20101209_AAAYYT mackay_e_Page_084thm.jpg
1be29ecf123b19eb9f005f15ecef7a4e
8ce448ad1a874985d55a3a3be8c054f74fac6e58
16023 F20101209_AAAXWG mackay_e_Page_090.QC.jpg
c42c0d4be4e3dcab2ca618eb961292de
e00318ff89f193bfe6c7e7fbb168a5e9c0605479
2633 F20101209_AAAYAX mackay_e_Page_122thm.jpg
c1409d05723603e4e138121b84366296
14d1480c20d7a5614729e13d2c64de2431e0c5de
53390 F20101209_AAAXVR mackay_e_Page_028.pro
a0f9a4950eca744cd57b272369724844
26ab7f6828f6c23c633ea5a984038dda63175f45
117173 F20101209_AAAYCA mackay_e_Page_059.jp2
0b65a8c78ac332fc42ed23861801b45f
525b5d878f26c86469b70e49f7352ffb06dcc034
51738 F20101209_AAAYBM mackay_e_Page_104.pro
3501f3099587698005863804e2edcea1
3fe5a7e721bcfc1a957ecc8d403fec34d7f98962
34426 F20101209_AAAYZJ mackay_e_Page_103.QC.jpg
adc174aa9467d3cd0f36bfa67c674504
ea2e057284a38fd97444e89add4fe55db95dea3b
20487 F20101209_AAAYYU mackay_e_Page_084.QC.jpg
13c01c65e9ebafe05899349f4c58ba9b
aee7ec95b708a52d549d82f431633486dc6512d1
53618 F20101209_AAAXWH mackay_e_Page_012.jp2
275affc586bf22b2f1055b6615726c94
890c4e2241137e60020bda498b7cb81bc30e02c9
9153 F20101209_AAAYAY mackay_e_Page_047thm.jpg
4e587853f35797de21cc5f75c5efd6e3
84d66c30d28867ffd95a1a3cc66c2e492fb98f24
7969 F20101209_AAAXVS mackay_e_Page_072thm.jpg
0a3eb57204d6cbbe7daef3de89a696f4
d28763bd0f503608eb6542242f5e884ed649f635
4063 F20101209_AAAYCB mackay_e_Page_068.txt
da66b50e414b7fc0f85427b1d16dc590
ae4408d87e0ccf1bda89cb138985fd768d3a4472
99878 F20101209_AAAYBN mackay_e_Page_011.jp2
637f1a35bd0071e9c255f7581fe96bf1
912d307a6928ae01acea0eb4538e62932c8988f6
8512 F20101209_AAAYZK mackay_e_Page_104thm.jpg
e601de322b8e322a641f3ae5ac79bb81
d7c152b924551a2a9bcec1e1cb8eeeb45f99f2fa
4330 F20101209_AAAYYV mackay_e_Page_085thm.jpg
78a510ff61a6edaf54e65e4c64679c19
a2ba8c972929923976b23d92a16d36ebd6187ffc
47886 F20101209_AAAXWI mackay_e_Page_091.jpg
23b902c6e41221d36f5f1a9839bd0e8e
894228869ef8b42ff2fa35282c880006aca30444
60743 F20101209_AAAYAZ mackay_e_Page_111.pro
e2889d4a0713fbf0f15042ce115bffa0
b84cf8bc94bf2c6fd987dd89d7957242c5bdb479
4986 F20101209_AAAXVT mackay_e_Page_087thm.jpg
448a7cbc3e634996647b8d478e2f9007
6cedf39d07fc71487751354ee920e0dce73cc5b4
55042 F20101209_AAAYCC mackay_e_Page_025.pro
ac1962b8e8831782dce8e759266641ca
a3ba5192c8d10d9bf4966d64e8c75708d0d653a0
6302 F20101209_AAAYBO mackay_e_Page_002.jp2
2bb71b9ef410fd6064c4e415b3eca187
99c35a7044814bc6df5dde4909b90b86e55c224f
33318 F20101209_AAAYZL mackay_e_Page_104.QC.jpg
2a721eef92897286217fda49e38237c7
70ea7fe19b74885e620aef968efe6abb36a9b836
16595 F20101209_AAAYYW mackay_e_Page_086.QC.jpg
66f486b1541f37ca23131793141e2ccc
06f53f5be2b21e1ded5b44e3c6d945851cb166e7
F20101209_AAAXWJ mackay_e_Page_113.tif
0653c089e81957050876e5962ef71202
3220b031075e7207207e156920d8f2d04a4e77b1
6018 F20101209_AAAXVU mackay_e_Page_038thm.jpg
05fc441219ba47c38d215d6a4c77ce75
8b808a5e47fd6fba1a803217bae1315e1f91fc34
33422 F20101209_AAAYCD mackay_e_Page_099.QC.jpg
168bfeb4ef6f91ee39a5f129f1c1dbbe
d4771eaa2ca2a5cda13a96a4cc7db069ce41c5ab
240 F20101209_AAAYBP mackay_e_Page_091.txt
0c4ce428892a1dcabc24d43aa260acc6
99129560b43021da9a93be4d114f67fcc105d33d
9632 F20101209_AAAYZM mackay_e_Page_106thm.jpg
f49fd595082a8b2349c1212418303d81
c7bdcbc2f69d5894e01314a005361ada2a140ed2
15858 F20101209_AAAYYX mackay_e_Page_087.QC.jpg
98cde82d21d69251992604d9e0d86aca
025b221e80da54e99d3cdf4093645a2c26df4737
22072 F20101209_AAAXWK mackay_e_Page_095.QC.jpg
90e9619d01d47badd3eede6b264d5fd1
cf179f18223f6543be9cdf6b7df740900e1b333e
35633 F20101209_AAAXVV mackay_e_Page_025.QC.jpg
bb16a2d523a86649c31a28df54660a93
b2d85433c95b18201ab6eed38fe88c33b660ce93
F20101209_AAAYCE mackay_e_Page_087.tif
a588d6762c2b342e4f868d83a4b3c5ac
f0c69ab1c6bcbc2b202427806b27cf842b7099ac
1980 F20101209_AAAYBQ mackay_e_Page_016.txt
1c9da888fcb86aa29a9571e37c3ef5bf
4d4f7efc657a696f203a3b9d079523752018d22d
39555 F20101209_AAAYZN mackay_e_Page_107.QC.jpg
cb39d9238875c73cf82eab55e433a929
49d278339ed86b9da6909465ffae64e13d4fbe9b
4535 F20101209_AAAYYY mackay_e_Page_088thm.jpg
1b9b0b63269c9ba7d66d44a8ee7c8ad5
1d7d583281e50879ba0204dde00599e7697d8f2c
11240 F20101209_AAAXWL mackay_e_Page_056.QC.jpg
48257d9b03550fda16f2c33effd2260f
a1f52b532640f75b755f9bce4376e1224f4feffd
380 F20101209_AAAXVW mackay_e_Page_040.txt
a131fa134d217e37d936c7151f9dade5
cffd35b3c4f04e5ae86ff6012e107e14b6688506
F20101209_AAAYCF mackay_e_Page_009.tif
a3a75202946af74673ee68ef371e0356
2fd89f18ea48bc74eedea8deb48a07251325fb80
49684 F20101209_AAAYBR mackay_e_Page_031.jp2
99f429aa8dba4c38171271a322909653
5138bc6ff994a5dfe559e015a2ee05874ba5d09f
9009 F20101209_AAAYZO mackay_e_Page_109thm.jpg
38a92f77ea08c7d2414e5649b6f62ee8
3e4351d7f7588972002a0442046d62d3a7906ca2
16749 F20101209_AAAYYZ mackay_e_Page_088.QC.jpg
e7081dac57527f36c6fc7d97d54e49e8
0a767ba8917acc96ade41fd119c1190381f6df49
47048 F20101209_AAAXWM mackay_e_Page_043.pro
ee1f9a8f8ff42319264065eab3debd3f
e7a8beace5938e547c6eaa5a829068c06a5d4420
F20101209_AAAXVX mackay_e_Page_095.tif
9799b4d9fe4a8a7230d1fdac7cbef970
5d0ce0774359351c3f2c985c79fc1c70e8f4153c
53466 F20101209_AAAYCG mackay_e_Page_066.jpg
fa0611498a058b0a3a689728f7f4b304
a9ce3a58cf506fcc5f4008df5cc6289b7884b9f6
8959 F20101209_AAAXXA mackay_e_Page_021thm.jpg
18b007aa686f399d599939b756548498
7daa5b6b948145bf299fb83b09089fee8197f75f
35395 F20101209_AAAYBS mackay_e_Page_100.QC.jpg
663a8541fbfc3bd12202d4bbd181ac24
921d308775d2ff447f0450f9786128b72b93357f
2352 F20101209_AAAXVY mackay_e_Page_063thm.jpg
8c48e1e5aee159ef579f06e6e87f7806
011e9faf6754cb85a927705c8dfb2ef9e01b11cc
2157 F20101209_AAAYCH mackay_e_Page_025.txt
e166bdd01f3d15034d9181fe7b6a8b73
0bc75ffd891ba146694dd60401077894b375936f
9172 F20101209_AAAXXB mackay_e_Page_093.pro
797ba4d2f50b7dc8c68d091c9f07acef
279f3740e264132f4c8d7016c4f875dbf11a4e4c
55559 F20101209_AAAYBT mackay_e_Page_020.pro
82ebc95ad7752b959a7e219e50730786
df228fc74d7630cb30794f5e390ad8e0e08669dd
36908 F20101209_AAAYZP mackay_e_Page_109.QC.jpg
7815d68ed5825dd47666be395087c201
f1678a7929067e69359b0448a9d07bc242ce5f48
2120 F20101209_AAAXWN mackay_e_Page_017.txt
f01dd7e260b2a7c6b0ebdbff2f76906e
0374905980928ffed40ad6211869ad59123300b1
21676 F20101209_AAAXVZ mackay_e_Page_053.QC.jpg
f0ff076216956668d3b0526c0bb99566
993fc397826462215b7bda0ac30cf8a728c85813
133406 F20101209_AAAYCI mackay_e_Page_114.jp2
2471fb9330d9e6dac0d659e4094f38b5
0dcd14ceb56dfce859b6ed5e92fa22508867e8c0
1025334 F20101209_AAAXXC mackay_e_Page_036.jp2
cc20a96f9da3b835e64e586c0e0460db
0a7bef03d9f1837e8ab5fa10ec36c8a97ae84d2b
2133 F20101209_AAAYBU mackay_e_Page_021.txt
31fada9a5b90cad528591c7d3ad41808
abcdaa2ea15c616d5ce2a8a7d58334d778468843
9575 F20101209_AAAYZQ mackay_e_Page_110thm.jpg
b48578188b4084dfc2ae6c1b2b80a2a4
e5fb6d3b70ec332cd0b44844cfafda5c127019f9
62397 F20101209_AAAXWO mackay_e_Page_006.pro
7e6727eabb5481ca2beecdf05147d86b
53ecc191584ae727132c810c0db5a3f0f5463a8a
160260 F20101209_AAAYCJ mackay_e_Page_009.jpg
bcb593d3772b064ec453eabd0b817a86
49a814a3ed14277b6c7462950cbaf95a487e4e5e
1910 F20101209_AAAXXD mackay_e_Page_010.txt
d1f8cea66fcbee0d793baea1fdb64d38
cdd040887cc175fb3a973ac66166bf2051053b5a
102999 F20101209_AAAYBV mackay_e_Page_027.jpg
8b00af1bb0527dfa2f03595d238c05bc
6238d8d3eb776fa8bd7683dad6df6999e9400da1
8966 F20101209_AAAYZR mackay_e_Page_111thm.jpg
cb74295e76b32ec211e8a5d67c05fb8a
935bc1976f419a07e5449b88f106df74d895a4e7
45435 F20101209_AAAXWP mackay_e_Page_123.jp2
ec348f64a2925e415da918469cd5a472
bab7fd246173fb658f559eeeb206329e3b324a8b
8853 F20101209_AAAYCK mackay_e_Page_001.QC.jpg
eaf12335acaf5a9a56aa2592e4f5a1c9
45fc67680684f2ee629a2d6c8e48cf2901aca7ab
54613 F20101209_AAAXXE mackay_e_Page_101.pro
9acaeff66b544ed03df53928b531709f
7874de4176c46c7cfdf8186734c0e3f592b71453
F20101209_AAAYBW mackay_e_Page_023.tif
8246befe39eaa6d2ceeefb6289b88117
a8fda059c624d04113a0032ecc3bd42b5f902e4b
36187 F20101209_AAAYZS mackay_e_Page_111.QC.jpg
513d59095889e619d447aabef42a42d9
432cb8e9212cfc6135bb07b8645469418ae7073e
69588 F20101209_AAAXWQ mackay_e_Page_110.pro
f7b06aa169a206297bc86589ac045d0e
ed4d12e56692a7b80096bef10974a77d138b2ebb
108837 F20101209_AAAYCL mackay_e_Page_015.jpg
350904d1bc2d8419ba44ef09809cc165
33d9e5b1e21e44ddf29a52cb984ea213e387c441
15678 F20101209_AAAXXF mackay_e_Page_056.pro
13ec764ec819f69f79d73f5519b15baa
e16857e71fdf46099e33e50eb99216d71bdbb3da
35377 F20101209_AAAYZT mackay_e_Page_112.QC.jpg
15cf13dcc024c9b9b47f3500e436f667
0e1e098fb16a2c1a41a777fe33d824a8fe40b766
1131 F20101209_AAAXWR mackay_e_Page_034.txt
a6d2c6fe257b929566adec8f9a9348b8
0129c697d92dbf0f495bec9c5f6ac3560770c7e0
100625 F20101209_AAAYDA mackay_e_Page_050.jpg
10d3a5186ca325b6fc20faf657e7fa5a
bb9d6ad9cdd72bb4c60d8dcd989f531a84f5731e
47817 F20101209_AAAYCM mackay_e_Page_077.jpg
234a4bcbeafa057e1b80528ddc35d8c2
8003aa8d950c4368701ac5cfa0c62341ef21cce2
5676 F20101209_AAAXXG mackay_e_Page_036thm.jpg
ff2744fd6ef357c1a125e44fdeac603b
1bb3a19e10ad0267dc98c676b0134b300c97a5a3
6093 F20101209_AAAYBX mackay_e_Page_083thm.jpg
6fb678764cca5e43b784f8563b769e18
77a72b0e2a52035a23f65b9bb113dea92b724c24
9018 F20101209_AAAYZU mackay_e_Page_113thm.jpg
7772c229d6b8be30811ab469da4e7eda
8751cc507c64ef7c0f36d4eeef75ab4ac20508f7
8751 F20101209_AAAXWS mackay_e_Page_019thm.jpg
8f6d1be2c4bd8c6b60d2cd82f7533082
bbd1bda82b37f42631d61bdb2923143704fb9fd1
133749 F20101209_AAAYDB mackay_e_Page_109.jp2
660c75ee65298784297b9ea727e061fc
85c871369d13027147b5288c834dd53df4816896
109016 F20101209_AAAYCN mackay_e_Page_048.jpg
9ff06ad5b9dd1e006fd582e0ca927945
b20a20df4bb393237e277ca9dfda94fa3b1bd4a9
F20101209_AAAXXH mackay_e_Page_065.tif
348c730b341d91b05c09d78d825cca7d
cfa0d6af557ea179abf41345e111239dfec36d38
8232 F20101209_AAAYBY mackay_e_Page_052thm.jpg
51bcf718e0d57534035bf4db8018f5b4
112828ae7c63fba4eef8fe9fa46c77dc533b6271
37142 F20101209_AAAYZV mackay_e_Page_113.QC.jpg
6b222eb6100869c5c93cab36015b668d
811f7fdd5a58a1d3bb9fe6a429b33ab710ac9cf8
78784 F20101209_AAAXWT mackay_e_Page_067.jpg
43f1beac3c6b34bbb05f7da1e5951cc9
727b5b8251ae2904a1eb2f13fdcae51238c3c4d4
80712 F20101209_AAAYDC mackay_e_Page_032.jp2
55cb863bb2c782398aab2c5c5af1f2c8
302f50a04029779c435522709ae25453f7e859cc
F20101209_AAAYCO mackay_e_Page_021.tif
a76b9bdcd058bb71ee8a92f643cb8214
36f22ad60e4bca58a44d3be3b166c5061af2f09f
2006 F20101209_AAAXXI mackay_e_Page_022.txt
1747059177d44f0272aee426017f04d7
0773de0e7281a5fc978028bcc55b07beaec23299
2793 F20101209_AAAYBZ mackay_e_Page_107.txt
165bdb691d437d8d2fb1a51e680b5394
bbe407e971aca48e967014d8d22cd2a02ebf44b9
9149 F20101209_AAAYZW mackay_e_Page_114thm.jpg
92407d79aea0f993643a5f0eeadcde35
88a7ac1727c5fe3dee99c421e02ac3ea0c490209
116 F20101209_AAAXWU mackay_e_Page_002.txt
fbc50a6c6a5df2226e359f24b35fff5c
b0a45350c330532a148aadf8b1dfd5228d720f2d
54858 F20101209_AAAYDD mackay_e_Page_088.jpg
6c2525dd9a2c64f495d1fd2a34e2fb27
d52de5987e702deb284d185704a2bae17370d4d1
92859 F20101209_AAAYCP mackay_e_Page_058.jp2
4cbf9495b0ae872b9a9cb5e48176e9ba
59621d56e96927806d66cca5e959ec96ba63947b
2146 F20101209_AAAXXJ mackay_e_Page_101.txt
3966c92a9c2831085c96d486b78befef
85f9aa105acf0cba92b27c7f3a7df935f05cf124
37994 F20101209_AAAYZX mackay_e_Page_114.QC.jpg
e92d9407e3556c14c4a05da6a622aab0
5398fefd52db1c0731ebfd5091a847a90f86fce4
39233 F20101209_AAAXWV mackay_e_Page_056.jp2
4fd3ff812acffb7db50f1fb93ee31284
c6bee8562a9885d1259957726e3c23d021437f6a
612347 F20101209_AAAYDE mackay_e_Page_077.jp2
490b5d90b07b4adbdf57357fbd9e2dd8
e966bee57d48b4113792b89f83d5d02396d86e7d
40144 F20101209_AAAYCQ mackay_e_Page_106.QC.jpg
1e445859ecdfdadd97feee215d655269
d60b45c32f7eae2f7760b8a975f4b7456bebfd3e
9079 F20101209_AAAXXK mackay_e_Page_121thm.jpg
dcd85f56fad98eb42dda716fdc5512ef
0835884a00eaf43a6d1c24ff84aad438c5135bd2
9241 F20101209_AAAYZY mackay_e_Page_115thm.jpg
8c7e5b01da71bd42a4b4a30e14e9b854
89220eb9d9694333434d905ad2bcdf25b749ead3
F20101209_AAAXWW mackay_e_Page_063.tif
c6b05887ae1d992c73ee70388a570dc9
7c67598f6611fe940350818a26fa488ca6606799
F20101209_AAAYDF mackay_e_Page_012.tif
c71a9c969c7d8b45f2751491a72e0c8c
f18cef75aa986f344c7c253cacff1d75572e2b42
F20101209_AAAYCR mackay_e_Page_076.tif
aaf81a9037c7573941e66f28fdea3359
88a668165d9663314a6ed94e62e10538430ad71c
36265 F20101209_AAAXXL mackay_e_Page_021.QC.jpg
58b19d997b131ca87bc86806981e22d2
95fb7a054888a3afa2ed1a2d4a95fe2e6d2a932b
9534 F20101209_AAAYZZ mackay_e_Page_116thm.jpg
69f13b1b307218d130e2584154611e19
7d7a8dbc2815c32fab75fc7b4035e1b039432ea1
F20101209_AAAXWX mackay_e_Page_026.txt
73e47e832cb2ecd0acdc29cee9f3e298
37900177b14d4f0625c6902174b5c7d705a4af9f
53954 F20101209_AAAYDG mackay_e_Page_079.jpg
f240be4cd01a3c66f2162b5eb4eb1643
0f04f3a9451d5de2576baf50774c645efe871f95
F20101209_AAAXYA mackay_e_Page_009.jp2
028467e6632fbd72b5a10a4538788865
00225eb5a8686e3e943f6dc9a750770ae3832a32
37747 F20101209_AAAYCS mackay_e_Page_044.QC.jpg
8721341a36e7160d0af25a0e1f0282fa
6f8b0bbcfba5c781dfffac708814d52d37b1e28e
128465 F20101209_AAAXXM mackay_e_Page_118.jpg
08a6540160353c1728270e6c9f83e027
a857af30da76e899c625791644be7583385f88af
F20101209_AAAXWY mackay_e_Page_066.tif
887a0f38a7450ee839016198125d19a2
79c9f3b2e69cc43c0cee8f311ae42643e04ff430
11369 F20101209_AAAYDH mackay_e_Page_088.pro
7ccca5bb1cc6783e2a3d97a6c4c90abf
af94de0b7b89f6491288c31ec93aa7ff9e3fcf0e
106202 F20101209_AAAXYB mackay_e_Page_046.jpg
0ccd71726964318fcc1251ecd257ff7c
8e9d9d630f10fd48af17600640b50e9ed1638e52
F20101209_AAAYCT mackay_e_Page_098.txt
7dd5f7f483452b1bee93c21f8fd05036
44ec24c7f985e7fe07beb1903ddfcf73d69663e9
804408 F20101209_AAAXXN mackay_e_Page_079.jp2
71557bc60cfed41b2cac57ef1827e7ab
521e6c688c59d5fea8ef0bbe130100884daf6c9c
2708 F20101209_AAAXWZ mackay_e_Page_006.txt
399ac6a343590d56cb91d61a92f71f8b
75b18522f9138f57ba5afcf0557d3b8086bc2ec9
108074 F20101209_AAAYDI mackay_e_Page_027.jp2
f259573d4af9b13853aef02eacb785f9
34996c832f81361a3b4c13d968a89f0af669eea4
F20101209_AAAXYC mackay_e_Page_086.tif
1e1ce81a61bffda1d4cd51a42a043dd6
223bd3d8d3ccee86bdfd275e97954af67266e0ad
67330 F20101209_AAAYCU mackay_e_Page_094.jpg
36c9eb937d8dce626dcdfdd8f2af81f1
62ed13a612e5a8510e64806afefa26fc0791b7a5
112035 F20101209_AAAYDJ mackay_e_Page_018.jpg
4ff070ee180376085f6f9314e8312020
52d568487f605b754767a47167a6b478ea01150a
305784 F20101209_AAAXYD mackay_e_Page_039.jp2
3c72a756f915ab9becf957a4a264e935
91944d4018f1d4a8fa41ef5928f67689843c7dc0
4059 F20101209_AAAYCV mackay_e_Page_069.txt
8b055397762bbaf71dc975baef38e81b
d67297020905557b223bf75c8a6b715a2cfa3260
9613 F20101209_AAAXXO mackay_e_Page_119thm.jpg
37142b65f64b028449c67cf7fdca903c
f015e15d99ccb7b135095a771e3fb21cecc7390e
130112 F20101209_AAAYDK mackay_e_Page_121.jp2
33d0976d47edf17087483e4aea3118fe
27de355405b6c0772408a98674c178533226fb73
8995 F20101209_AAAXYE mackay_e_Page_015thm.jpg
7a081048d5f1bb024f4280192ba8c287
c13bbafd8ef9291e613798e96cfce3e0fdd2f60e
2716 F20101209_AAAYCW mackay_e_Page_108.txt
9346c7cb26212ce2ec96bad27e66b507
8d4a631a6073137c69a4a100bc1788ce2fc93a73
616858 F20101209_AAAXXP mackay_e_Page_089.jp2
ba3ea6ad45cadb1ed8535be4c3d03f34
f8244218a204c922048a7c04945b488778c5b9a7
33080 F20101209_AAAYDL mackay_e_Page_052.QC.jpg
5483eb6bf98bd96d08788078f84f1a59
213db56f1ac35f74de356d12062e8b30b0e35d5d
5297 F20101209_AAAXYF mackay_e_Page_075.pro
f504fb0ac9dcdf0ab399f087a7c29c19
0bb0ddfcd42a4ca7b987ba8ee30c6b3fa14d94b0
1969 F20101209_AAAYCX mackay_e_Page_050.txt
625d2af60b846ff1e74905050418adae
e49fd1af8b15cf1af4bf9821d62d1486efc0c1bd
33842 F20101209_AAAXXQ mackay_e_Page_061.QC.jpg
fc13d01ed01d40ed5fd8f90662ac1f06
46728269c6b5ecef14ec59a2ac3952c3f0029ea1
65734 F20101209_AAAYDM mackay_e_Page_115.pro
f6dd1b0749b506ff643b5d3cedebbff2
3abca806c37ee18a92023ce93cda4c6b439983f1
F20101209_AAAXYG mackay_e_Page_056.tif
3e04a1cc59503601375943cd3788c7aa
ed75a2899e78b7bc3a083d4f38b11b3b4b22bc50
394 F20101209_AAAXXR mackay_e_Page_092.txt
cccfd4195ba1ef884bf8e67a397afc0e
6f63e2da338e24623f10b4b9d6907c9c6c6535d7
F20101209_AAAYEA mackay_e_Page_036.tif
9714ccb51d4e6ace5c8624f315324224
4387aef7e9177f71583c1cf9bb83983b0ad1fabd
36591 F20101209_AAAYDN mackay_e_Page_005.pro
a8096f186966b84a75211b16689f180d
5c70f55555a088be30838059156182386c4b2adc
29999 F20101209_AAAXYH mackay_e_Page_035.QC.jpg
b43e7e6442db1d65c1b487d3b0cecba0
1e8e65645f9d5cd977201ccd780ad353242ae684
119393 F20101209_AAAYCY mackay_e_Page_023.jp2
9678cfe272b2904191f653f4fc46afb5
f6158543bf67b7f7a191a8c3283b911e6f0696b3
120527 F20101209_AAAXXS mackay_e_Page_020.jp2
002429c7cade3a3c2dca62f12b6443b4
f409077fa1c2db2941232c62c8459f4e05439008
2809 F20101209_AAAYEB mackay_e_Page_056thm.jpg
bd20807fdd5502d7b79c0e5855401088
18cc011affe27f8507555b5168d14087f1f3ac40
140653 F20101209_AAAYDO mackay_e_Page_115.jp2
dd1cc90bf887034923d96843964b4869
fea06fe5179e5fe975406eaaf241e61cfefa8a41
F20101209_AAAXYI mackay_e_Page_085.tif
6eb28687bf87c8be7216a22c0df63e0b
704ed0d89d2b32aa2be731f9dfb82b92c70beea0
123122 F20101209_AAAYCZ mackay_e_Page_121.jpg
28d51ecb2041825979cbeffa262c6931
0e7e37f8523b4946f02d08a60521afaead3a24a2
107376 F20101209_AAAXXT mackay_e_Page_062.jpg
a4c91d5d9a142a3e0e55bc6907ed4dec
789a458d11ef1c07ed7daa05791261dea2d20124
143208 F20101209_AAAYEC mackay_e_Page_106.jpg
c270a5e276083f16e01f91ea0cf4c649
eb4a7ab511060ae679921b27f837283232f4ae55
66989 F20101209_AAAYDP mackay_e_Page_108.pro
3ba56ad6b89d4068ada02019511427d2
a0d7b7c2ac8c1b9b27fa174a86098c916cf69c29
F20101209_AAAXYJ mackay_e_Page_077.tif
4d3a7ce515bf15a15d4427784d481313
5f43c8d534b3afbdd0f253819bfbe147c0b8177a
25138 F20101209_AAAXXU mackay_e_Page_005.QC.jpg
7bcad21d87c44b4d4f078b19b3578e5b
7d1cdf49ebcaa6482fd001c02c15fdc6fdcb14e5
F20101209_AAAYED mackay_e_Page_048.tif
26ae720f3fc8fa37783ea93e70b17e88
279d8cb84fb85f371642306e7c346958dde55492
50957 F20101209_AAAYDQ mackay_e_Page_022.pro
91c917b7e08d3dacdeb71b40c5d1c24c
9be1cd48ee32a55b268f4ffd14ffa69a5416fd16
29856 F20101209_AAAXYK mackay_e_Page_011.QC.jpg
a7bb371a8b2c14a0d8155245b9e81bc5
8bafc2cc4486fba92850381d5c48abbeac356255
F20101209_AAAXXV mackay_e_Page_083.tif
2d6f72fc197eb84645d0d1fbc8a73bd6
32c3674bec44269af5f4557258e982fcc70a54a9
72235 F20101209_AAAYEE mackay_e_Page_069.jpg
1d4d9dc12c10eb1a21443585418cc116
f95f5ea2e13f808539ae63baa9726a38c3896ddc
4613 F20101209_AAAYDR mackay_e_Page_090thm.jpg
5e1ac89cb52709ed70e7f08b2d030184
1c5c9dbbc76e21324620a28b22363b5f48e40f21
54048 F20101209_AAAXYL mackay_e_Page_007.jpg
d026d706e1c79112a3aa142703682a94
58dfcd03ddfabd6c34e5b198d21611226590ade2
12621 F20101209_AAAXXW mackay_e_Page_072.pro
46431bdd2bcf61a0dd70b77cd8d10f61
62629844ff6bd45146cb370362332dcc2f5b043b
113034 F20101209_AAAYEF mackay_e_Page_104.jp2
10305867c561a96b0acc41d9304d6ca9
7c7b65c3c28a1de32062a5fe3dfafa2a4f00830f
F20101209_AAAXZA mackay_e_Page_054.tif
611671f9f02f7277fcac82fa0039e90a
e8b7366fde7a445139f6477734fa5c66ebfe6cf3
2898 F20101209_AAAYDS mackay_e_Page_057.pro
9d88d5a5322110f0a7872335e7410bc6
cd03586c7d68952f507156a62363c4f0d9542815
82488 F20101209_AAAXYM mackay_e_Page_097.jpg
5fd2ae33a09574f14c3fb43cea34e2fb
c07472e08ecf6f2004fa19937388f2124e1c5825
201 F20101209_AAAXXX mackay_e_Page_084.txt
fd94dca8af8b23578e3cf8535c605c49
1a096c02ff72d0b19ab4b334984fcfd528603c49
666 F20101209_AAAYEG mackay_e_Page_002thm.jpg
31ea4353e17c18f3b16fbce635baaf7e
39f5fff3c410e43ddf9af6f1692080eece86d2de
7173 F20101209_AAAXZB mackay_e_Page_030thm.jpg
81786e4b16ecb68d84bd12289b82fef3
48026250776d2727ed0d29760840e61a7a9503f7
7434 F20101209_AAAYDT mackay_e_Page_037thm.jpg
a50490b07895080a7164bea634a7d3be
abe07b97afbd4b5a89b51779b80a3fd4e8ff94a5
F20101209_AAAXYN mackay_e_Page_110.tif
2debb2f181f32b96e411234c4d35ffda
5f0213d29227f6e32dd9d20c04567beca932f413
135414 F20101209_AAAXXY mackay_e_Page_108.jpg
a9750174ce3102e4b8c2b0ecfbc8048a
9c56b167b7f937b9120c6a908d9c77e86743b6a7
50975 F20101209_AAAYEH mackay_e_Page_061.pro
928d27543bc6f0322a8af196e5db3b9c
d47dbcc53ca47ed0c7d97f3659aee90311a29380
54952 F20101209_AAAXZC mackay_e_Page_015.pro
f2d17e06bd11fd6953edf5d5cffa8f96
c57e253461a8bfed11fa0b34da6b54ea4d1f9a1e
16117 F20101209_AAAYDU mackay_e_Page_122.pro
68d87e28f01a8a93030b7da02d698f3f
f3d7cf9894d098ce514dbb6b7feae0a58ae6aa94
658 F20101209_AAAXYO mackay_e_Page_122.txt
be73ec7c984117e79b150050e6d68f01
f52e80dbfb400e417aa762a2fd24af4cd5232269
310 F20101209_AAAXXZ mackay_e_Page_094.txt
9022ad1046fc7b9b8f5854eebf6fea33
7cf498106cbf5497d598b457b3afc86c2a3c85b6
F20101209_AAAYEI mackay_e_Page_075.tif
8657f5fd158ac22a66f0014708e3ee8d
0d272d08d1f1aa54c91fcda01363ad032a4f3fa0
100286 F20101209_AAAXZD mackay_e_Page_035.jpg
fcfed1aee1a3f48c4a9e43879786fdd3
026a7c9707a8a8da0eb6793fa130bc096404a705
49630 F20101209_AAAYDV mackay_e_Page_050.pro
14b7a4ca4ab671165933a675583444ea
2e2111e109c04d2b8e1d442cfb428f6fd4c0088a
1937 F20101209_AAAYEJ mackay_e_Page_052.txt
6794c6369e30ebc7c9fd129f11ca3e94
8d262e33dfea67e33beb73829805729b1619ba1b
2212 F20101209_AAAXZE mackay_e_Page_033.txt
f75858543620c6a867de05c2233cb13f
8768e8cc29e10a057e16540d3236f35a3e7795a9
142143 F20101209_AAAYDW mackay_e_Page_108.jp2
e7ddd700b3f559ab35fae0cf65897f30
db8c0d4bf9996019fb286f781af7aace682bcfae
105267 F20101209_AAAXYP mackay_e_Page_054.jpg
69db092b4cd77c22322270de7baa29d1
1200c8bb9ddf5ddaef630d769d4ac9207a3951cc
97672 F20101209_AAAYEK mackay_e_Page_004.jpg
0972a84a59373da2570408c270d2adaf
29de927d96ea91a9620869aff19eec75fd8f1c1e
33643 F20101209_AAAXZF mackay_e_Page_019.QC.jpg
114e64f20e2d0545fd49d10e5b346ec8
2e1c663fe0540c656e3f545cc88bb78d8f997006
38828 F20101209_AAAYDX mackay_e_Page_032.pro
aeb27e21b1c8e19d2f6edad58c03d1c0
82c941802e374a593df1e5cffea364badfd11134
53024 F20101209_AAAXYQ mackay_e_Page_029.pro
19de7ef107611aea18fc0c75a8f2cb97
60d3bfb614da441914a89235e696eb886fe04647
557 F20101209_AAAYEL mackay_e_Page_074.txt
272d0fab0e4ad33a6b2b4f5bf775b100
0d9d19ecf933a700a7cd27442edf204989e6a694
F20101209_AAAXZG mackay_e_Page_074.tif
973adbffefabc5482a0f97175bd11afd
b19e24c200b72410b31850645057a241d8138009
53119 F20101209_AAAYDY mackay_e_Page_100.pro
0e81107f72991a4d15b85c7aad31eded
e0a7c54161f4e0b54cde92636e887009bce82c09
8830 F20101209_AAAXYR mackay_e_Page_025thm.jpg
97f43827ef7a3220b07c675383a86e75
fc924408db67c345e906c64a5992b37bfbc23d95
F20101209_AAAYFA mackay_e_Page_030.tif
709ffc5287ed51177fac505efd25c6c1
1493197122b6e16835a2fff674a331c03287781d
894361 F20101209_AAAYEM mackay_e_Page_088.jp2
556b4b0589322398e99d54f2cacb32b3
e9ea38ab9ba6aae682afdbbce7de89ffca12231a
1986 F20101209_AAAXZH mackay_e_Page_013.txt
044016516f54a18487c4f43966b8931b
4d7cded368905cdd73b107d0e10ca63fd4d77bd2
F20101209_AAAXYS mackay_e_Page_045.tif
8958e5598588c4dc11bb393082543c8a
3685ec2e61eba1216e524103e6c20be6936c0764
F20101209_AAAYFB mackay_e_Page_095.jp2
e912e44b3884135491605446421cb610
d6bdb4bee03680f71b26205e82f18e13eb47b1c9
117723 F20101209_AAAYEN mackay_e_Page_045.jp2
c99c85a286c4f14a46d30fd16cec10fa
e78b1d28de2df78e7d59d25e9f4953d4778153fd
36754 F20101209_AAAXZI mackay_e_Page_026.QC.jpg
92919ef057adbe3fd09a76a2dba811c6
616990134639fe56a6416a7e8652c4112444c1fb
F20101209_AAAYDZ mackay_e_Page_091.tif
8987d0daf9f3c75f035c694fb9dbc7f7
27a802ddfa81b0bd60b6589ec2ac369685917265
43027 F20101209_AAAXYT mackay_e_Page_035.pro
516113823888f37ef04e95a0836fe0d4
6f51c4432da21afc87b53b912ea8fb3a8fd023e3
8745 F20101209_AAAYFC mackay_e_Page_118thm.jpg
b4aa72ebbed7441831971171d30a7f1c
235a488703f9d4813a271425bf1d7e65af9ee966
14593 F20101209_AAAYEO mackay_e_Page_091.QC.jpg
3c71ff335c8f76edefb2920ccde066ac
031a7001d631e69c348cdb4169867fe9bc915c5a
55556 F20101209_AAAXZJ mackay_e_Page_026.pro
62c590215cff7ac494de698b97c1d1c3
478e24dea6d7732fb42bcb65ea918880a9803601
F20101209_AAAXYU mackay_e_Page_046.tif
97d844319eebbec3a61515768a75cd14
4098a235a995e4b5156f027b4f497771822f5256
104800 F20101209_AAAYFD mackay_e_Page_022.jpg
11ddc8c8cfa9ab528487b854ce0f96d9
6bbf60827c1d2443a022d87ab613471514f7f095
F20101209_AAAYEP mackay_e_Page_055.tif
6b085e6f6d375d04220e23a51ab877bb
0419f0f1813c8f180261f7a22b6f68158f265cff
2456 F20101209_AAAXYV mackay_e_Page_111.txt
2d16398d7c0a562ae6d526e373efd7c3
495a61b199ecf27233bdbc0dac269872f9089cdb
39222 F20101209_AAAYFE mackay_e_Page_110.QC.jpg
fb9b54b94c03b7d040f8abcdf44e3087
248710add49290a157f9344438a8752d4c0218d8
10559 F20101209_AAAYEQ mackay_e_Page_082.QC.jpg
cc74e253882c46e22c61668c901f0d07
f0b3b8a63566e5720a4923db788b2850d85add71
938454 F20101209_AAAXZK mackay_e_Page_078.jp2
72c62f31b8b7d7a1d33b979e8bbfa484
5a97bb0457e6f66bf9868acd2b61899fb22f280a
F20101209_AAAXYW mackay_e_Page_082.tif
e9c896a1cee2228806113913a7555119
539dde660dcc0f77ded13d3e797d43611e2c76e6
9096 F20101209_AAAYFF mackay_e_Page_105thm.jpg
dc2df4e1dbeea69c7ef1e524b18a0a7b
3ee898a2db1192e256782ed75cb6e8995391bcd7
F20101209_AAAYER mackay_e_Page_045thm.jpg
51b963b51e8d3854e7a1217be906d82d
3a3c77e438e903ebca8fa9255d3e300770bea3ff
3739 F20101209_AAAXZL mackay_e_Page_123thm.jpg
cc0c7630945a0da91c01e549c8474fdd
0a1dd0715eaa27d9b01948f2875d5946bd1f6cd4
2805 F20101209_AAAXYX mackay_e_Page_065.txt
17fc469f75d19a1cbf781ad36b068b6f
44c29e0746e7549e738f624081cb58178c793b6b
4253 F20101209_AAAYFG mackay_e_Page_037.pro
1c87ae5ed15b04d316aff746a1e4c2d3
78d932bf82a24fb2e1b1078ecd396d711b33a497
59170 F20101209_AAAYES mackay_e_Page_034.jp2
eab3de2eee14b02de42b4f4e82e6a1d1
fabc6987a9bd994529d88f36211321c4093eb68d
5182 F20101209_AAAXZM mackay_e_Page_067thm.jpg
1d06b8b1ce02f84c09db503067075432
8353dd920ced7b3b24d4431d57ddb0f43628c9ee
101415 F20101209_AAAXYY mackay_e_Page_010.jpg
f222ef9a33fcb022de85c8eec019c1d0
bf0c31cf85e4cdf8c19747de4ab1588d67e460dd
109591 F20101209_AAAYFH mackay_e_Page_033.jp2
e6853b1ca18e4ed79f5d11acd935ed91
bbd7f84a9078e452ceaa98733e1b8b9848169f78
4563 F20101209_AAAYET mackay_e_Page_091.pro
e1a9af6e6cc833784a33b1da1cab184a
b0a8b748e689b6dc9f4dc7ded87c2a656e11ce31
13994 F20101209_AAAXZN mackay_e_Page_089.QC.jpg
b8567616fae5764942473f88468bcfd1
15af6b7f859f9a4c450940baf306177ec5c535a5
283 F20101209_AAAXYZ mackay_e_Page_095.txt
86f942a1e0656fab3e3ba877f73f08dc
67083ca3040fa6fbf1763a3f265648f4ec9caa0e
53666 F20101209_AAAYFI mackay_e_Page_017.pro
eb9628e6ada8aff403d1abe1abf8fbdc
7b59870454f84c637876e50b6b59abba1d33f2f6
F20101209_AAAYEU mackay_e_Page_043.tif
fb9a55d4c69527b6ac91d71f2fa6ef11
8ec73750d16a1e7d7a3ca3e981c6ec447f349016
F20101209_AAAXZO mackay_e_Page_111.tif
60a248f250c214f81f9f852c6adb25cd
5688c2e361a6646910f393faa0933d828410aae3
F20101209_AAAYFJ mackay_e_Page_025.tif
8404e26582dcd6cf83249f0e4cfa1fbd
8f2a71c0317e3d630ffed30d4e50687d29345023
42116 F20101209_AAAYEV mackay_e_Page_081.jpg
e07aafb436115a4b7c32537dd1133e52
803b260895f47a231e76bb6c9b1e73cd51d1194d
36569 F20101209_AAAXZP mackay_e_Page_102.QC.jpg
9ca5700301084dd8bcfcf7ee7cd4c07a
1dfdcee270b52e665a2828ccc9472340d7302244
3782 F20101209_AAAYFK mackay_e_Page_032thm.jpg
8755c92d3f738a425a264f49004ab609
f54cd7157e20358c36566bb8619039fe83f8b313
4282 F20101209_AAAYEW mackay_e_Page_085.pro
e25078fb58441dee6d36fab3c4149327
591cfc8463e98c4c118ec3d023324ef7056c0ea8
9634 F20101209_AAAYFL mackay_e_Page_074thm.jpg
2b7566cf64cde505c1cc687532bf77bb
f516715d4fad0b8384320ac153e59b438a645db5
115929 F20101209_AAAYEX mackay_e_Page_020.jpg
7297fe4fca3ceb90053bfdc683978165
46049335437fc9fbfcb40ab582ca74a0a00bd7ca
19563 F20101209_AAAXZQ mackay_e_Page_093.QC.jpg
efa001dd990080ee56dcef31a2d22e6f
b4cf6814ee82ee23e3f2af3a61809377766886ff
F20101209_AAAYGA mackay_e_Page_052.tif
c80faf9a8bb5016aba2826f7fc18e785
220b0814be9bf4b44707a01f82eaa7707cb58571
9463 F20101209_AAAYFM mackay_e_Page_039.QC.jpg
cecd50d792ba115ab1eba49b23b65480
cbf3b1c8ddf9246d890b705cac5bbb9f74d6e48b
21110 F20101209_AAAYEY mackay_e_Page_067.QC.jpg
0cc9dbf644cd8f2bfe116ca7fefdb135
5881efee89f737047bb4b7ab8421912f7073d698
5468 F20101209_AAAXZR mackay_e_Page_054thm.jpg
392bf7861ca59b2a91b0eb4955e1f4e7
08929b12c41ed409570ec3f8f54fd4d3b176fda8
237 F20101209_AAAYGB mackay_e_Page_038.txt
ed8b946c58ee3b5f19ecc552b1f5f760
474d051697ac64cf7fde7f94b4dbe1dbb007c780
38758 F20101209_AAAYFN mackay_e_Page_105.QC.jpg
caf0f497126f9a49cddd1fc46156f454
0cc35652191bc92c837d9c8a2f529233f494b289
F20101209_AAAYEZ mackay_e_Page_107.tif
4cfdc7c32566f1fe6cc4aa159e095d5c
10793d5b0903742df0ee64282646f51ec097bc9f
110098 F20101209_AAAXZS mackay_e_Page_019.jp2
bd4b6e75fd632c85e6f688f47ea2cc5d
1f4042c49544e17e83b0d455a36e61bacff882b9
20216 F20101209_AAAYGC mackay_e_Page_068.QC.jpg
58a5526ecf69ea111b47c71db3358a5e
5354b4855631df364bf133d9e8e122a075dcc59a
82249 F20101209_AAAYFO mackay_e_Page_064.jpg
b9126b8af46aeebd65d7343ec89c45ba
d0d41c1f78a6079c852e974e20988d0646d6e97a
8759 F20101209_AAAXZT mackay_e_Page_017thm.jpg
b7591f3a72bff73c4d78159cfc33344f
27c04a74c78ea7dfecb001a10d473783a6bc0312
55490 F20101209_AAAYGD mackay_e_Page_018.pro
ff7dc4a8d107886e65cec598d70fd8b9
8498da2f4b4938ad0695d954e1f83f1d63ec0ea2
640046 F20101209_AAAYFP mackay_e_Page_081.jp2
e573f6c2fe977b480f0dc088ac7a278c
80cd52e77cb261e299fb649e80a120001b506d02
F20101209_AAAXZU mackay_e_Page_070.tif
fffe0ff43c366c3d736ccbe69f02b35c
b8e71e9a02f8fba4bb86d15909540b37a16db543
2700 F20101209_AAAYGE mackay_e_Page_080thm.jpg
ce061b40906a00b2708a4c2fa7550aa5
de91a293cb8a98b2210b4c949195624d043c72c8
39749 F20101209_AAAYFQ mackay_e_Page_116.QC.jpg
d433b485e5f2c6d7ca84d652e699cc3d
258a2071129aae0c954dc351a5654a8ff4f0ddd7
F20101209_AAAXZV mackay_e_Page_118.tif
edb05843d71b3e34e32a8b8f584087ba
0d5b2056aeef31e3f58fd41e61c7c88d143c4469
1051970 F20101209_AAAYGF mackay_e_Page_006.jp2
0edce6e8339b9153e0b474df679537f0
7ec004d8e266e1034382925f8e3fd2261f1bb75b
53623 F20101209_AAAYFR mackay_e_Page_059.pro
45c6fbb47e2110c7d92a52a387f12445
9d890ce4102a9544e9abd6261f5bec47e9e41306
8342 F20101209_AAAXZW mackay_e_Page_080.QC.jpg
1cfe3e2742c1a4f9986e1ef49c85c66d
cd09d8bed006184abbc2a6489007110dfbd43d5e
6591 F20101209_AAAYGG mackay_e_Page_005thm.jpg
4258f331afe14db4e447fa7849ecc84e
7cb05b374bc9ade29d2a6c4915087b3f99d9535f
2423 F20101209_AAAYFS mackay_e_Page_112.txt
b13b5757a9e7b297236341fb87967b4d
92f6c3722da5141b4614755aa2f1720ba08db16a
34375 F20101209_AAAXZX mackay_e_Page_046.QC.jpg
48bb2fb0d0a1ab56870341ceaa16d7ac
e3dc0ed1a05fd6141f29e2bb51f60a6fbcc83873
50483 F20101209_AAAYFT mackay_e_Page_090.jpg
903134b51fbbc350450c71250f8b442d
e63491cb128ab7278a64f904691267de1f89273b
75150 F20101209_AAAXZY mackay_e_Page_009.pro
226af0d94a864b2c1075bdccbcdd23e3
19c64a5d49dac9d948406e84bc61e50734e6065b
7764 F20101209_AAAYGH mackay_e_Page_040.pro
fb0445e01038ad914a7748070644c03e
d672d19a924b7f141e0e845abdc6aaeb7d7971db



PAGE 1

CHANGES IN CHARACTERISTICS OF THE CANINE MYOCILIN GENE AND MYOCILIN PROTEIN IN GLAUCOMATOUS AND NORMAL DOGS By EDWARD OWEN MACKAY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 1

PAGE 2

Copyright 2007 by Edward Owen MacKay 2

PAGE 3

This work is dedicated to Dr. Kirk Gelatt for teaching me to love research and Audrey, Liam and my mother for making me finish it. 3

PAGE 4

ACKNOWLEDGMENTS My special thanks to all who helped me to get to this point, especially everyone who helped with the lab work. Ive been here too long. I have met so many amazing people, each whove helped me not only move my projects along, but helped me grow as a person. Id like to thank Dr. Kirk Gelatt for all of his support, guidance, and kicks-in-the-pants over these last 12 years. Kirk is one of the most amazing people Ive ever met, and the main reason I was never in a hurry to move on. He has done so much for his specialty, and I cant imagine anyone ever doing more. He helped bring the science of Veterinary Ophthalmology to the modern day. He has more papers, and books, and presentations than even God, I think. Drs William Dawson and Don Samuelson. They proved to me that there is still a need for pure science. It sounds pretentious, but I dont believe that every project researched needs to be for a major pharmaceutical company or a big business R&D. They proved that while grants are great, choosing what to research is ultimately up to the researcher. Dr Brooks has always been running around in the background while Ive been here. So busy with the UF veterinary clinic, that Im lucky to ever see him. It was he, however, that got me sucked into primate research and pattern ERGs and the business side of research. And Dr Peggy Wallace for teaching me genomics, and how research works in a medical school. And I thought I was busy On the technician side, I must thank Pat Lewis. She has taught me more about not only histochemistry, but about how to survive in a academic laboratory environment. Even on her worst days, she always had at least one nice thing to say to me. Not to mention, shes probably the best instructor in histo Ive ever known. 4

PAGE 5

To Tommy Rinkoski, for putting me in a good mood, writing really creatively, and putting up with all my absences as I put this all together. Linda Lee-Ambrose and Marc Salute for teaching me Western Blotting, and cursing. Beth Fisher, for holding my hand as I learned PCR reactions. Thanks to everyone in Dr. Peggy Wallaces lab for teaching me genomic and good bench top techniques. To Butch Sapp and Delena McTeer for teaching me how to talk back to doctors. Ive got to thank the million students that Ive gotten to help, and been helped by. Each one of them taught me something, not always goodbut something. A special thanks to Hillary Hart, a very successful student. She did more with the protein localizations in this project than anyone. She was the moving force behind a lot of the project. Shes also a great poster designer. Id also like to take a moment and thank the other graduate students Ive worked with, Maria Kallberg, Andras Komaromy, Franck Ollivier. You guys gave me help and hope all the time. It was fun to work with you. Id like to thank my wife, Audrey, for all of her time and patience as Ive finished this project. I know youve been buried under housework and baby-sitting, I love you. And finally, to my mother, who never let me doubt myself. Who always knew I could be great. Thanks! And to all the rest Ive neglected. Thanks for everything!!! 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT ...................................................................................................................................11 CHAPTER 1 INTRODUCTION..................................................................................................................13 Anatomy and Physiology of Aqueous Humor and Outflow...................................................15 Aqueous Humor...............................................................................................................18 Description of Myocilin..........................................................................................................20 Functions of Myocilin.....................................................................................................25 Causes and Risks of Myocilin Related Glaucoma..........................................................27 Causes and Risks of Myocilin Driven Glaucoma...................................................................27 2 MATERIALS AND METHODS...........................................................................................43 Gene Analysis.........................................................................................................................43 Protein Analysis......................................................................................................................48 Comassie Stain................................................................................................................49 Western Blot....................................................................................................................50 Myocilin Protein Localization.........................................................................................52 Microarray Gene Chips...........................................................................................................53 3 RESULTS...............................................................................................................................58 Genomic Findings...................................................................................................................58 Protein Analysis......................................................................................................................58 Inherited Model Glaucomatous Dogs..............................................................................59 Clinical Samples..............................................................................................................59 Immunohistochemistry...........................................................................................................61 Immunocytochemistry............................................................................................................62 Microarray..............................................................................................................................62 4 DISCUSSION.........................................................................................................................98 LIST OF REFERENCES.............................................................................................................105 BIOGRAPHICAL SKETCH.......................................................................................................123 6

PAGE 7

LIST OF TABLES Table page 1-1: Loci and Genes Associated with Glaucoma...........................................................................31 1-2: Composition of aqueous humor..............................................................................................32 1-3. Human myocilin mutations detected in population................................................................33 1-4: Human myocilin mutations detected in glaucoma pedigrees.................................................35 2-1: Original canine myocilin primers...........................................................................................54 2-3 : Dogs used for microarray analysis with short history...........................................................56 3-1: Relative myocilin protein levels in inherited glaucomatous dogs..........................................64 3-2: Aqueous humor myocilin levels from major breeds of dogs.................................................65 3-3 : Selected DNA chip microarray results. Ratio and probability show major differences between glaucoma and normal mRNA results. Items that may be of interest in bold.......67 7

PAGE 8

LIST OF FIGURES Figure page 1-1: Basic structures of the eye......................................................................................................36 1-2: The Canine iris controls the amount of light entering the eye...............................................36 1-3: Example of a horizontal pupil................................................................................................37 1-4: Rear of the Iris (I), Ciliary Body (CB), Ciliary Processes (CP), and Pars Plicata (PP).........37 1-5: Zonules over the ciliary processes..........................................................................................38 1-6: Pillars of the pectinate ligament from the base of the iris to the inner cornea.......................39 1-7: Pigmented and non-pigmented epithelium of the ciliary body. Cellular junctions between the two layers of epithelium of the ciliary process are very important. The lateral intercellular junctions of the nonpigmented epithelium consist of desmosomes, except at the apical end................................................................................40 1-8: Human myocilin mRNA overlaid on human complete DNA for the region, showing exons and areas removed by post processing. ATGs show two possible start points. Blue underlined = Exon 1. Green underlined = Exon 2. Red underlined = Exon 3..........41 1-9: Myocilin consists of 3 exons and a 5-kilobase promoter region............................................42 1-10: Basic leucine zipper motif....................................................................................................42 2-1: Boxer made famous for providing the DNA for the first shot-gun DNA sequence for canines................................................................................................................................57 3-1: Region of Canine Chromosome 7 containing MYOC. The 1451 bp dog MYOC cDNA sequence is shown underlined. Red Exon 1, Green Exon 2, Blue Exon3. Green highlighting represents start primers used to piece the gene together. Blue highlighting represents end primers...............................................................................71 3-2: Western blot of aqueous humor samples from beagles with primary open angle glaucoma with human myocilin control. Box shows typical primary band......................72 3-3: Comassie gel strips from aqueous humor of mildly affected glaucoma beagles over time. The darkest band is approximately 57 kDa..............................................................72 3-4: Comassie gel strips from aqueous humor of moderately affected glaucoma beagles over time. The darkest/ largest band centers at approximately 57 kDa.....................................73 3-5: Comassie gel strips from aqueous humor of advanced glaucoma beagles over time. The darkest/ largest band centers at approximately 57 kDa.....................................................74 8

PAGE 9

3-6 : Samples 193 through 206, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control..........................................................................................75 3-7 : Samples 260 through 272, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control..........................................................................................76 3-8 : Samples 312 through 325, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control..........................................................................................77 3-9: Overall view of iridocorneal angle (ICA) of a normal 1.5 yr. old (X100) beagle. Normal myocilin localization is observed in the Irido-Corneal Angle (ICA). Iris (I)...................78 3-10: Overall view of irideocorneal angle (ICA) of a glaucomatous 6 yr. old beagle (X200). Increased myocilin localization is observed in the ICA (arrow) of the glaucomatous canine.................................................................................................................................79 3-11: Positive staining in the corneal epithelium (solid arrows) and stroma of a normal beagle (X200).....................................................................................................................80 3-12: Positive staining in the corneal epithelium (arrow) and stroma of a glaucomatous cocker spaniel (X200)........................................................................................................81 3-13: Positive myocilin localization in corneal endothelium (arrow) of a preglaucomatous 3 mo. old beagle (X200).......................................................................................................82 3-14: Localization in the sphincter (S) and dilator (D) muscles of the iris of a normal 1.5 yr. old beagle (X200)..............................................................................................................83 3-15: Localization in the sphincter (S) and dilator (D) muscles of the iris of a 10 year old glaucomatous beagle (X200).............................................................................................84 3-16: Myocilin localization along the cell membranes of the ciliary body musculature of a 3 mo. old normal beagle (X200)...........................................................................................85 3-17: Myocilin localization along the cell membranes of the ciliary body musculature of a 1.5 yr. old normal beagle (X1000).....................................................................................86 3-18: Positive myocilin localization in the trabecular meshwork cells of a 7 yr. old glaucomatous beagle (X1000)...........................................................................................87 3-19: Positive myocilin localization in the outer sclera of a 13 yr. old glaucomatous cocker spaniel (X400)....................................................................................................................88 3-20: Positive myocilin localization in the vascular smooth muscle cells (arrows) within the sclera (S) of an 8 yr. old glaucomatous cocker spaniel (X400).........................................89 9

PAGE 10

3-21: Intense myocilin labeling within the nonpigmented epithelium (Blue arrow) of the ciliary processes, and vitreal membrane-like material (Green arrow) of a 6 yr. old glaucomatous beagle (X200).............................................................................................90 3-22: Detail of Figure 3-13. Intense myocilin labeling within the nonpigmented epithelium of the ciliary processes of a 6 yr. old glaucomatous beagle (X400)..................................91 3-23: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)...................92 3-24: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)...................93 3-25: Trabecular meshwork cell of a 1.5 year old normal walker hound. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)........................................94 3-26: Extracellular matrix (ECM) or the trabecular meshwork of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)......................................................................................................95 3-27: Nonpigmented epithelium of the ciliary body of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)...............................................................................................................................96 3-28: Vitreal membrane-like material within the posterior chamber of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows)......................................................................................................97 10

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHANGES IN CHARACTERISTICS OF THE CANINE MYOCILIN GENE AND MYOCILIN PROTEIN IN GLAUCOMATOUS AND NORMAL DOGS By Edward Owen MacKay May 2007 Chair: Kirk N. Gelatt Major Department: Veterinary Medicine The glaucomas are a group of diseases causing blindness in millions of people every year. The causes of glaucoma are numerous, but in recent years, more attention has been paid to genetic causes of the inherited forms of this disease. Myocilin has been attributed to be involved in over 6% of inherited types of human glaucoma, the highest correlation to date. We have attempted to characterize this gene and protein in the anterior eye tissues, aqueous humor (AH), and irido-corneal angle of a colony of beagles with hereditary glaucoma; and aqueous humor samples from both normal and glaucomatous dogs of other breeds using protein characterization, histochemical localization and micro-array RNA analysis. Genomic myoc (coding regions and untranslated regions) differences were not seen in the DNA analysis of normal (n=1) and glaucomatous (n=1) beagles. Comparisons of AH myocilin levels between differing glaucoma severity beagle dogs showed relative differences with the early, moderate, and advanced forms (1.95, 7.66, 13.31 units respectively). Clinical samples showed differences between normal and glaucomatous dogs as well. Normal (cataractous) dogs had the lowest level of myocilin in the aqueous humor at 4140.27 674.12 g/ml. Primary glaucoma dogs were found to have an 11

PAGE 12

aqueous humor myocilin protein level of 29404.18 7449.11 g/ml. Secondary glaucomas had the highest level of myocilin in the aqueous humor with 44797.03 11659.83 g/ml. Myocilin localization in the eye tissues showed an increase in the amount of myocilin in different tissue. The microarray chip study showed very little change in levels of mRNA for myocilin in glaucomatous dogs versus normal dogs. This study shows a strong correlation between amounts of myocilin protein and the presence and severity of glaucoma, but a mutation in the myocilin gene may not be the only myocilin mediated cause of glaucoma in diseased dogs. A mutation in the myocilin promoter or other genes involved with processing myocilin may also be at fault. Further, the increase in production or decrease in turnover of myocilin in all ocular tissues may be the result of the ocular hypertension rather than a cause. 12

PAGE 13

CHAPTER 1 INTRODUCTION Since the 1950s, glaucoma has been used to describe a number of ocular diseases involving optic nerve damage, a major risk factor of elevated intraocular pressure, and an eventual loss of vision. Glaucoma affects 66.8 million people around the world, with 6.8 million of those suffering bilateral blindness (Quigley, 1993; Quigley, 1996). In the United States, 12,000 are blinded yearly by glaucoma and up to 2% of the human population over 40 is affected by the disease (Kahn et al., 1980; Tielsch et al., 1991). African Americans are affected five times more by POAG than Caucasians, leading to the belief that there is a significant genetic component to the disease (Tielsch et al., 1991). Individuals are eight times more likely to develop glaucoma than the general population if they have a first degree relative with the disease (Johnson et al., 1996; Armaly et al., 1968; Demenais, 1983; Lowe, 1972). Other signs indicating that POAG could have inheritable factors include the fact that as the disease appears to run in families, and some families show direct Mendelian inheritance (usually autosomal dominant) (Broughton et al., 1983; Budde, 2000; Francois, 1980; Francois, 1981; Francois, 1985; Merin et al., 1972). The first eye disease linked to a chromosomal location was the X-linked color blindness gene (Deeb et al., 2003). Currently there are over 90 genes (or gene locations) that cause known inherited eye disorders (Cohen et al, 2004). There are several forms of glaucoma linked with specific genes and susceptibility loci (Table 1-1) (Cohen et al., 2004; Duggal et al., 2005). Many have inferred from the lack of simple Mendelian inheritance that POAG is a more complex disease with a convoluted etiology (Fingert et al., 2002; Avramopoulos et al., 1996; 13

PAGE 14

Francois, 1980; Francois, 1981; Francois, 1985). In humans, chromosome 1 was the first autosome implicated in the heredity of glaucoma. (Cotton, 1993). Further analysis was able to link it specifically to the Q arm of the chromosome (Johnson et al., 1996). In humans, six different genes and chromosomal points have been implicated in glaucoma to some extent. These were initially mapped to GLC1A, GLC1B, GLC1C, GLC1D, GLC1E, and GLC1F (Sheffield et al., 1993; Stoilova et al., 1996; Wirtz et al., 1997; Wirtz et al., 1998; Trifan et al., 1998; Sarfarazi et al., 1998; Lichter, 2001; Alward et al., 2003; Alward, 2000; Alward, 2003; Andersen et al., 1997; Andersen et al., 1996; Andersen et al., 2002; Aung et al., 2002; Baird et al., 2005; Belmouden et al., 1997; Booth et al., 1997; Borges et al., 2002; Brinkman et al., 2005; Brooks et al., 2004; Broughton et al., 1983; Clepet et al., 1996; Datson et al., 1996; Ikezoe et al., 2003; Lichter et al., 1996; Lichter et al., 1997; Mardin et al., 1999; Meyer et al., 1996; Morissette et al., 1995; Rozsa et al., 1998; Stoilova et al., 1996; Sunden et al., 1996; Wirtz et al., 1999). Myocilin is the only gene and protein that can be directly linked to an inheritable glaucoma in humans (Stone et al., 1997). Analyzing the same gene family in other species may help determine the effects of mutations and on this disorder. Myocilin has been reported in some form in humans, mice, rats, bovine, rabbits, pigs and non-human primates. Recently, research has been reported in cats as well (Fautsch et al., 2006). In this study we concentrated on the dog as our animal of choice. The dog has long been a stable, accurate animal model for ophthalmologic studies (Gelatt et al., 1981; Gelatt et al., 1998; Gelatt et al., 1998; Weinreb et al., 2005; Fingert et al., 2001; Knepper et al., 1997; Obazawa et al., 2004). Any results gathered from this analysis would not only improve our knowledge of glaucomas in humans, but perhaps lead to tests for glaucoma in the canine as well. 14

PAGE 15

Anatomy and Physiology of Aqueous Humor and Outflow The eye in the canine breeds is usually a nearly spherical globe approximately 21 mm in diameter and very similar in size compared to man. As one of the most complex of sensory organs, it has many different regions with specific functions. In the dog, the eye is composed of three basic layers. The outer layer is fibrous tunic, which is further divided into the cornea and sclera. The fibrous tunic gives the eye a constant shape and form, which are imperative for a functional visual system. In addition, the most anterior portion of the fibrous tunic, the cornea, is transparent, thus enabling light to pass through, and is shaped in a manner that makes it a powerful lens that refracts light rays centrally, toward the visual axis of the eye. The second and middle layer is the uvea (meaning grape). The uvea, which is further divided into the choroid, the ciliary body, and the iris, is heavily pigmented and vascularized. It functions to modify both external and internal light, including reflection and scatter, as well as to provide nourishment and remove wastes for most of the eyes components. The choroid and ciliary body are both attached to the internal surface of the sclera (Figure 1-1). Parts of the eye involved with aqueous outflow and glaucoma include the iris, ciliary body, cornea, and the iridocorneal angle. The iris originates from the anterior portion of the ciliary body, and it extends centrally to form a diaphragm in front of the lens. The iris of the eye is a round, flat diaphragm with its base in the ciliary body. It completely covers the anterior lens, except for a small hole (pupil) in the center (Figure 1-2). It is used to control the amount of light striking the retina as well as the focal depth of the projected image. It divides the eye into the anterior and posterior segments (chambers). The only communication of aqueous humor fluids in the eye occur through the iriss pupil. In the dog the pupil is nearly perfectly circular. Other species may have horizontally 15

PAGE 16

oriented pupils (horses, cows, goats and other ungulates), slit type pupils (cats), or even double pupils as seen in some fish (Anableps) (Figure 1-3). The posterior surface of the iris faces the posterior chamber and has numerous surface projections. The posterior surface of the iris contains radial folds that extend to the base of the ciliary processes. The ciliary body is an anterior continuation of the choroid, and it joins with the iris. The ciliary body removes wastes and provides nourishment for the cornea and lens. Nutrients for the refractive structures are primarily supplied by the aqueous humor of the eye. Aqueous humor is an optically clear fluid originating from vascular sinuses within the folds and processes of the ciliary body and later drains into the iridocorneal (or anterior chamber angle), which forms the anterior boundary of the ciliary body. In the continuous process of aqueous humor formation and drainage, intraocular pressure (IOP) is created, which is responsible for providing the eye most of its rigidity. Topographically, the ciliary body is divided into an anterior pars plicata and a posterior pars plana. The pars plicata consists of a ring of 70 to 100 ciliary processes, depending on the species, with their intervening valleys (Figure 1-4) (Prince et al., 1960). There are usually 74-76 processes in carnivores and primates, which greatly increases the surface area for the production of aqueous humor. In addition to aqueous production, ciliary processes play variable roles in lenticular accommodation, because these structures are intimately associated with the crystalline lens. In anurans, birds, and some reptiles, the ciliary processes are attached to the lens and participate directly in accommodation. By comparison, the processes in mammals primarily serve as a region for attachment of the lenticular zonules, which 16

PAGE 17

connect the lens with the ciliary body and its musculature, which in turn is responsible for accommodation. The appearance of individual ciliary processes are thin and blade-like, with rounded tips that are invested with zonular fibers in canines. Between the major ciliary folds, wide valleys with smaller, secondary folds are present. Many of the smaller secondary folds originating near the pars plana merge with the major processes at their base. The surface has numerous convolutions, but most of it is obscured by the zonular fibers (Figure 1-5) (Troncoso, 1942). The zonular fibers pass down into the valleys, and many fibers pass posteriorly to their origin on the pars plana. The pars plana is the first flat, posterior portion extending from the posterior termination of the processes to the peripheral termination of the retina (Figure 1-4). The width of the pars plana varies, because the retina extends more anteriorly in the inferior and medial quadrant in most species, enhancing peripheral vision. Therefore, the pars plana is wider superiorly and laterally. In the dog, the ora ciliaris retinae, the seam between pars plana and the retina, is 8 mm behind the limbus dorsally and laterally but only 4 mm ventrally and medially (Donovan et al., 1974). The main mass of the ciliary body consists of the smooth muscles. Contraction of these muscles draws the ciliary processes and body both forward and inward, thus relaxing the lenticular zonules (suspensory ligament of the lens) and changing the shape and refraction of the lens. This muscle is not as well developed as that of most non-primate species, and offers variably weakened accommodative ability. Both regions of the ciliary body are heavily pigmented. The iridocorneal angle (ICA, or filtration angle or anterior chamber angle) is the anterior-most component of the ciliary body in nonprimates. The ICA is formed by the junction of the corneoscleral tunic at the limbus, base of the iris, and an anterior recession of the ciliary body, 17

PAGE 18

which is known as the cilioscleral sinus or cleft (Figure 1-1). The pectinate ligament spans the opening of the cilioscleral sinus from the pigmented corneoscleral junction to the root of the iris (Figure 1-6) (Baulmann et al., 2002; Bhattacharya et al., 2005). Beneath the pectinate ligament and within the cilioscleral sinus is a matrix of loose tissue strands, the trabecular meshwork, which is divided into two regions: the uveal trabecular meshwork (UTM) and the uveoscleral trabecular meshwork (CSTM). The trabecular meshwork consists of a mesh of collagen cords that are covered by cells (Booth et al., 1999; Samuelson et al., 1983; Samuelson et al., 1984). In the cilioscleral sinus, the inner CSTM appears to be anterior tendinous extensions of ciliary body musculature (Gum et al., 1992). At the expense of the ciliary body musculature, a proportionally larger sinus is found in most domestic animals than in humans. Adjacent to the meshwork are aqueous collecting channels, which in turn empty into the intrascleral venous plexus and then the vortex veins. Aqueous Humor Aqueous humor flows from the posterior chamber, in which it is produced by ciliary body epithelial cells and vasculature, and through the pupil, into the anterior chamber, and to the filtration angle. Aqueous flows between the pillars of the pectinate ligament and into the trabecular meshwork. Aqueous humor then leaves the eye either through the corneoscleral trabecular meshwork and associated outflow channels or through the ciliary body and anterior uvea (i.e., uveoscleral outflow). Most forms of increased IOP may be associated with increased resistance to aqueous outflow in both of these areas. The balance between production of aqueous humor and its exit through the iridocorneal angle are essential for maintaining the shape of the eye, its rigidity, and the close adherence of the retina to the choroid. Production of the aqueous humor occurs in the ciliary processes. Each ciliary process is covered by a double layer of epithelium; an inner, nonpigmented, cuboidal epithelium, which 18

PAGE 19

forms a complete, internal monocellular lining of the ciliary body; and an outer, pigmented, cuboidal epithelium, which also is one cell layer thick. The sides of the nonpigmented epithelium have numerous villous processes along the bottom two-thirds. The intercellular spaces in this region and in the pars plana are filled with intercellular material that have the staining characteristics of glycosaminoglycans (GAGs) (Samuelson, 2007). The base of the cells also react positively for the same material. The ciliary body nonpigmented epithelium may produce the GAGs of the vitreous humor. These cells secrete the GAGs, which mostly consist of hyaluronans, laterally into the cystic intercellular spaces, which then communicate both with the vitreous base and basally (Fine et al., 1979; Huang et al., 2000). These chemical factories not only nourish the lens, iris and cornea, but also help regulate intraocular pressure (Coca-Prados et al., 1999). Cellular junctions between the two layers of epithelium (nonpigmented and pigmented) of the ciliary process are very important (Abe et al., 1999). The lateral intercellular junctions of the nonpigmented epithelium consist of desmosomes, except at the apical end (Figure 1-7). The apical ends possess gap junctions, zonula adherens, and zonula occludens, which probably represent the anatomic bloodaqueous humor barrier (Shabo et al., 1976; Smith, 1971; Smith et al., 1973; Smith et al., 1983; Streeten, 1988). The protein composition of aqueous humor was first analysed in 1948 by von Sallmann and Moore, who attempted to separate aqueous humor proteins with basic free electrophoresis (von Sallmann et al., 1948). The method they used required a relatively large amount of aqueous humor (2 ml) and was performed by pooling samples from 80 rabbits. The advent of paper electrophoresis allowed not only smaller samples to be used, but better overall separation of the 19

PAGE 20

aqueous humor proteins and in 1951 Witmer published the first analyses using this technique on pathological human samples (Witmer, 1951). The first true protein identification occurred in the early 1950s with Wunderly and Cagianut (1952) and Esser (1954) identifying albumin, alfaglobulin, betaglobulin, gammaglobulin, and pre-globulin in the aqueous humor. They were able to show minor changes between normal and pathologic samples (Wunderly et al., 1952; Esser et al., 1954). In 1967, Hemmingsen and ther were able to show no significant changes between intraocular protein and total systemic protein when total protein was increased (Hemmingsen et al., 1967). More significant analyses were done in the 1970s (Table 1-2). Major components of aqueous humor were shown to be: potassium, anions (chloride and bicarbonate), ascorbic acid, amino acids (free and protein), and sugars (glucose) (Cole, 1974). Description of Myocilin The causes of glaucoma are numerous, but in recent years, more attention has been paid to genetic causes of the inherited forms of this disease. Most notably a mutation in the myocilin gene has been linked to juvenile onset open angle glaucoma (JOAG) as well as other forms of adult early onset primary open angle glaucoma (POAG) (Rozsa et al., 1998; Fingert et al., 2002; Francois, 1980; Kaur et al., 2005; Johnson, 2000). Myocilin was discovered initially in a course of studies performed by Stone and 14 colleagues from seven other laboratories that analyzed proteins inducible by dexamethasone in a long-term treatment of cultured human trabecular meshwork cells (Stone et al., 1997; Polansky et al.,1997; Johnson, 2000; Ishibashi et al., 2002). Using this model of a steroid induced glaucoma, research demonstrated an increase in the production of myocilin (originally named Trabecular Meshwork Inducible Glucocorticoid Response protein [TIGR]) similar to that of in vivo dexamethasone glaucoma studies (Polansky et al., 1997; Huang et al., 2000). A cDNA sequence for TIGR was then found by using mRNA from cultured human trabecular meshwork 20

PAGE 21

cells treated with dexamethasone for 10 days (Stone et al., 1997; Nguyen et al., 1998; Ishibashi et al., 2002). In a completely unrelated set of experiments, another laboratory cloned cDNA with the same sequence from mRNA from a human retina library and studied its effects on human and pig retinas. Kubota named this novel protein Myocilin (MYOC) which was the final name issued by the Human Genome Organization Genome Database Nomenclature Committee in 1998 (Kubota et al., 1997). The gene symbol is MYOC. Kubota initially reported the open reading frame for MYOC coded for a protein of 490 amino acids, but later reported a correct 504 amino acids (Kubota 1998). The approximate molecular weight of MYOC is between 55 and 57 kilodaltons (kDa). By western blot multiple bands appear, most likely due to translational and post-translational processing since only a single gene copy is found in Southern and Northern blot analysis (Nguyen et al., 1998; Kubota et al., 1998; Ortego et al., 1997; Adam et al., 1997; Tamm et al., 1999). In humans, there are two possible start (ATG) sites reported in the open reading frame of MYOC separated by 42 nucleotides (Figure 1-8) (Kubota et al., 1997). After the second start signal is a hydrophobic leucine-rich signal sequence with a cleavage site at amino acids 32 and 33 (Ala-Arg) (Nguyen et al., 1998; Kubota et al., 1997; Ortego et al., 1997). The first start signal site and cleavage site of the signaling sequences were later confirmed by amino terminal sequencing of immunoprecipitated MYOC (Nguyen et al., 1998). MYOC Genomic organization consists of three exons and a 5-kilobase promoter region (Figure 1-9). All exon-intron boundaries conform to the GT/AG consensus for intronic donor and acceptor splice signals (Nguyen et al., 1998; Kubota et al., 1998; Adam et al., 1997). The promoter region contains 13 predicted hormone response elements, including several glucocorticoid regulatory elements (Nguyen et al.,1998). mRNA size as determined by Northern Blot in humans is 2.37 to 2.5 21

PAGE 22

kilobases (Nguyen et al., 1998; Kubota et al., 1997; Ortego et al., 1997; Tamm et al., 1999; Fingert et al., 1998). Two major domains have been determined by sequence alignment and BLAST analysis. The first is a myosin-like domain near the N-terminal, similar to the non-muscle myosin of Dictyostelium discoideum, a soil-living amoeba. The myosin homology at the N-terminal is relatively low and has been reported to show a 25% to 29% amino acid identity with the heavy chain of myosin of different species, now including canines (Kubota et al., 1997; Ortego et al., 1997). The second domain is similar to bullfrog olfactomedin (Kubota et al., 1997). This region is almost completely encoded by the third exon and is highly conserved across species. Olfactomedin was originally identified as the major component of the mucus layer that surrounds the chemosensory dendrites of olfactory neurons in frogs (Snyder et al., 1991; Yokoe et al.,1993). Soon after, a homologous olfactomedin-related glycoprotein was identified in the neurons of the rat, mouse, and human brain (Danielsonet al., 1994; Nagano et al., 1998; Karavanich et al., 1998; Karavanich et al., 1998). Frog olfactomedin had 31% to 40% amino acid residues in common with MYOC, whereas the rat and human olfactomedin-related glycoprotein shared 45% to 50% amino acid residues with MYOC/TIGR (Kubota et al., 1997; Ortego et al., 1997; Adam et al., 1997). Human myocilin may have evolved from the fusion of two different earlier genes (Mukhopadhyay et al., 2002; Challoner et al., 1985). These include the Noelin family of genes, consisting of Noelin 1, Noelin 2, and Noelin 3. Noelin 1 and 2 have been found expressed in ocular tissues, although all three can be found in brain/nerve tissues. It is hypothesized that myocilin may have evolved from a gene duplication/fusion event involving Noelin 2 (Mukhopadhyay et al., 2004; Chapman et al., 1996). 22

PAGE 23

Trabecular meshwork cells in monolayer cultures and perfused anterior segment organ cultures secrete MYOC into the culture medium on treatment with dexamethasone. Under these conditions, a modified MYOC form with a molecular weight of 66 kDa is observed in addition to the 52to 56kDa forms (Nguyen et al., 1998). To date, myocilin has been located in the cornea, trabecular meshwork, lamina cribrosa, optic nerve, retina, iris, ciliary body, vitreous humor, corneal epithelium, corneal endothelium, the corneal stroma, sclera, uveal and corneoscleral meshwork, ciliary epithelium, ciliary muscle, lens epithelium, stromal and smooth muscles of the iris, throughout the vitreous body as fine filamentous fibers, surface of rods and cones, neurons of the inner and outer nuclear layer, and optic nerve ganglion cells (Karali et al., 2000; Aung et al., 2003). The 66 kDa form is most likely caused by N-glycosylation at amino acids 57 to 59 (Asn-Glu-Ser) since treatment with tunicamycin reduces significantly its formation in human trabecular meshwork cells (Nguyen et al., 1998; Raymond, 2000). Use of this site has been recently confirmed by Raymond,who reported at the Glaucoma Research Foundation meeting that COS-7 cells transfected with human MYOC/TIGR cDNA secrete two isoforms that migrate at approximately 57 and 63 kDas (Raymond, 2000). Treatment with tunicamycin and PNGaseF (but not O-glycosidase) cleaved the 63-kDa form, leaving the 57-kDa form. Furthermore, cells transfected with cDNA mutated at Asn-57 did not secrete the 63-kDa form. Structural analyses of the MYOC cDNA sequence also predicted several potential O-glycosylation sites and phosphorylation sites, a hyaluronan-binding site, putative glycosaminoglycan initiation sites and a tripeptide C-terminal targeting signal for microbodies, a group of small, single-membraned organelles such as peroxisomes, glyoxysomes, and glycosomes (Polansky et al., 1997; Nguyen et al., 1998; Adam et al., 1997; Fingert et al., 1998). No functional role for these sites has been found as yet. 23

PAGE 24

Myocilin has a leucine zipper motif defined by eight leucine residues evenly spaced among seven residues between amino acids 117 and 166 (Figure 1-10). This is consistent with many protein-protein interactions as well as characteristic for many DNA binding transcription factors. Many documented mutations that cause JOAG/POAG seem to have their roots in disrupting the secondary structure of the olfactomedin region (Nagy et al., 2003). Myocilin in the mouse was first described by Abderrahim, et al. in 1998. The basic genomic structure of the murine myocilin is very similar to the human form. It has three distinct exons with highly conserved intron-exon boundaries. The first intron is approximately 7kb while the second is about 1.5kb, very similar to the human second intron (Abderrahim et al., 1998). In developing murine eyes, myocilin cannot be immunostained before embryonic day 17.5. The nerve fiber layer of the retina was observed to contain myocilin. By postnatal day 12, the cells of the trabecular meshwork and iris stroma began to immunolabel for myocilin, as well as the epithelial layers of the ciliary body and iris (Knaupp et al., 2003). Coding DNA sequence comparisons between the mouse and human show a 82% sequence identity. There are no gaps in the alignment, although comparisons from the stop codon into the 3' untranslated region show similarity doesnt extend beyond the first 100 base pairs (Abderrahim et al., 1998). Predicted translation of the murine sequence shows a 490 amino acid protein that is 81% identical (90% similar) to human. The third exon is highly conserved between mouse and human and is still comparable to nematode (Adam et al., 1997). A potential glycosaminoglycan extension site is not conserved between species, and may suggest that this putative signal has no relevance to myocilin function (Abderrahim et al., 1998; Baird et al., 2001). 24

PAGE 25

Functions of Myocilin Myocilin was first described after exposing trabecular meshwork (TM) cells to dexamethasone (Stone et al., 1997). Later research showed this to be a trabecular meshwork specific response, and further exposure to dexamethasone only induced myocilin production in the TM and not in any other ocular tissue (Lo et al., 2003; Fautsch et al., 2000). Myocilin expression was investigated in the rat eye after three different stresses were applied. In one experiment, four male Brown Norway rats had their intraocular pressure increased by injection of 50l of a 1.75M hypertonic saline solution through the episcleral vein. After six weeks of daily pressure readings, the rats were killed and graded on the degree of optic nerve damage (a scale of 1 [normal] to 5 [total degeneration]) by several observers. Subsequent quantitative analysis of myocilin mRNA levels in the rat eye showed a decrease in mRNA production in the rat retinas (as much as 33 fold) (Ahmed et al., 2001). In a second experiment, 62 adult female albino Wistar rats had their left (OS) eye IOP raised by cautery of 2 or 3 episcleral veins. Myocilin mRNA levels dropped significantly (2-2.5 times) in the irido-corneal angle and ciliary body tissues for the first 3 weeks, but then returned to normal. In the last experiment performed by Ahmed, et al., four rats had the optic nerve of their left eye surgically transected. After performing a sham operation in the right eye as a control, mRNA myocilin levels were again measured within two days. In the retina, myocilin levels increased (nearly doubled). Messenger RNA levels did not change significantly in the angle tissues of sham and transected eyes (Ahmedet al., 2001). In total, 74 different mRNAs in the retina increased in production after an increase in IOP. Seven mRNA levels decreased. (Ahmed et al., 2004) Interestingly enough, in a later paper by Ahmed et al., very little myocilin was found in the eye angle tissues of rats at all, although several analogues were seen (Ahmed et al., 2004; Alvarado et al., 2005). 25

PAGE 26

It has also been shown that an increase in myocilin production in transgenic Drosophila eyes also leads to changes in the expression in other protein products (Borras et al., 2003). High-density oligonucleotide microarrays have identified changes in the expression of at least 50 transcripts. Among these are the Drosophila homologs of aquaporin-4 and cytochrome-P450, previously linked to some forms of glaucoma (Borras et al., 2003). Myocilin is secreted into the aqueous humor as both a single protein and as two separate parts. Intracellularly, myocilin is found in vesicles and processed by the endoplasmic reticulum. It is often secreted into the aqueous humor of various species as a doublet of 55-57 kDa. This doublet is caused by glycosylated and nonglycosylated versions of the protein being present (Aroca-Aguilar et al., 2005; Stamer et al., 1998; Zimmerman et al., 1999; Caballero et al., 2000; Rao et al., 2000; Jacobson et al., 2001; Nguyen et al., 1998). A segment of the myocilin protein containing only the olfactomedin segment perfused directly into human cadaver or porcine eyes has shown no effect on outflow facility (Goldwich et al., 2003). It has also been shown that misfolding of the mutant myocilin in the endoplasmic reticulum can lead to ER stress and cytotoxicity (Zimmerman et al., 1999; Joe et al., 2003). It has recently been proposed that a mutation in myocilin (such as mutation P370L) could cause the endoproteolytic processing within the endoplasmic reticulum to malfunction causing a regulation problem for the normal activity for myocilin (Aroca-Aguilar et al., 2005). Myocilin has also been linked to other tissues with transendothelial fluid flow (Goldwich et al., 2005). Myocilin has been found in the podocytes of the kidney of the rat and induced in the mesangial cells during glomerulonephritis. This knowledge helps support the possibility that myocilin functions in cell-cell adhesion and/or signaling processes (Goldwich et al., 2005). Myocilin has also been found in gliotic tissue of injured cerebral cortex, leading to the concept of 26

PAGE 27

myocilin as an inhibitor to neuronal regeneration (Jurynec et al., 2003). It is also present normally in the paranodal terminal loops of the nodes of Ranvier, and outer mesaxons and basal/abaxonal regions of the myelin sheath of the peripheral nerves (Ohlmann et al., 2003). It has been found in the sciatic nerve of rats as early as the 15 th postnatal day (Ohlmann et al., 2003). Recently, et al, transgenic mice were created that would either express myocilin in the eye at up to 15 times the normal level, or have it be completely absent (Gould et al., 2004). These mice were able to demonstrate almost no clinically identifiable changes in the eye. Pathogenic signs of glaucoma were absent (Gould et al., 2004). Similar results have been found in human patients with the Arg46Stop mutation, which almost completely removes the entire myocilin coding sequence, with no overt disease symptoms present (Gong et al., 2004). It is also proposed that complexes may form between myocilin proteins in the aqueous humor. It has been shown that hetero-oligomers formed by wild type myocilin and some mutant types of myocilin can actually form larger complexes than wildtype alone, on the range of 150kDa (Gobeil et al., 2004). Myocilin has also been implicated in blocking the functions mediated by the Heparin II domain of fibronectin. This activity also limits the number and type of focal adhesions that can form in a human fibroblast plate (Peters et al., 2005). Reciprocally, it has also been demonstrated that a mutation in the myocilin gene could be a gain of function, actually causing the over production on myocilin or mis-regulating other functions (Kim et al., 2001). Causes and Risks of Myocilin Related Glaucoma Glaucoma has been defined in many ways. Its simplest definition had been merely an increase in intraocular pressure. In recent years the best definition has been as a group of 27

PAGE 28

diseases of the optic nerve involving loss of retinal ganglion cells in a characteristic pattern of optic neuropathy, often due to an increase in intraocular pressure. Juvenile open angle glaucoma and adult onset open angle glaucoma have been linked to mutations in the 3 rd exon of the human myocilin gene (Adam et al., 1997; de Vasconcellos et al., 2003). Most of the mutations are missense (Table 1-3 and 1-4) (Adam et al., 1997; Bunce et al., 2003; Mackey et al., 2003). In 2000, Angius et al. found a Gln368stop MYOC mutation and analyzed it in all living members of a 5 generation family. The Gln368stop defect was found in 19 patients with primary open angle glaucoma, 5 with ocular hypertension, and 22 healthy carriers. They found that the presence of the mutation did not signify POAG at a later age and there must be other risk factors involved (Angius et al., 2000; Chen, 2004). Two Italian families were found to carry a mutation in myocilin, p.K423E or p.C25R, out of 26 families tested (an 8% incidence). The evidence shows that a molecular genetic exam should be included in the management of glaucoma cases (Bruttini et al., 2003; Angius et al., 1998). French patients were shown to have significant association between mutations in MYOC and raised IOP (Melki et al., 2003; Brezin et al., 1997; Brezin et al., 1998). In Chinese patients, however, no link in myocilin mutations could be found in a phenotypically similar form of glaucoma called chronic primary angle-closure glaucoma (PACG). Although there were a number of mutations found in the 106 chinese patients tested, many of the mutations were also found in the normal control group with no adverse effects (Aung et al., 2005). However, it is possible that the normal controls could later develop glaucoma. Similarly, in studies of 91 and 492 Chinese patients, no link could be found between POAG and myocilin mutations (Lam et al., 2000; Pang et al., 2002). In fact, a negative association was seen in the case of a Gly12Arg in 28

PAGE 29

that it may have protective effects against POAG (Pang et al., 2002). In the United Kingdom, a lower than average number of linked mutations were found in the myocilin of the people in that region. Of 426 people tested, only six had any mutations in their myocilin (1.4%), much lower than the average in other countries (Aldred et al., 2004). Challa et al., showed there was an overall 4.4% prevalence of myocilin mutations in the POAG population in Ghana, West Africa (Challa et al., 2002). Finnish glaucoma families were found not to have any major mutations, just a few polymorphisms in the Myoc gene and OPTN gene (Forsman et al., 2003). Indian populations with POAG were found to have a 2% prevalence of myocilin mutations including novel myocilin mutations (Kanagavalli et al., 2003; Mukhopadhay et al., 2002; Acharya et al., 2002; Chakrabarti et al., 2005). Some research has led to the conclusion that although a mutation in the myocilin gene is not necessary for POAG or even JOAG, those individuals that develop glaucoma and have a mutation in the myocilin gene generally have a earlier onset or higher peak intraocular pressure in the disease (Craig et al., 2001; Abecia et al., 1996). But in other research, when cases of glaucoma containing the myocilin Gln368Stop mutation were compared to cases without the mutation, no significant differences were seen. Both IOP peak and age of onset were similar (Graul et al., 2002). The myocilin promoter MYOC.mt1 was screened for mutations as a cause of glaucoma by using a series of 779 unrelated human patients, 652 with open-angle glaucoma and 127 glaucoma suspects. When analyzed, plausible disease causing mutations were found in 3% of the entire group. No link was made between polymorphisms in the MYOC.mt1 region and disease state, except by Polansky, et al. who found it to be a strong marker for the progression of glaucoma (Alward et al., 2002; Fan et al., 2004; Fan et al., 2004; Polansky et al., 2003; Ozgul et al., 2005; 29

PAGE 30

30 Kirstein et al., 2000; Klei n et al., 2004). It has also been de monstrated that a polymorphism in the gene promoter may affect the severity or age of onset of glaucoma (Colomb et al., 2001). One of the newest proposals for myocilin cau sative glaucoma is the mis-processing of myocilin in the endoplasmic reticulum. The ER endopr oteolytically processes the myocilin into a 35 kDa portion containing the C-terminal olfactomedin-like domain, and a 20 kDa portion containing the N-terminal leucine zipper-like do main (Aroca-Aguilar et al., 2005; Ahmed et al., 2004; Caballero et al., 2001; Ca relli et al., 2004; Kong, 2001; OBr ien et al., 2000). It has been shown the mis-processing of the myocilin may lead to an insoluble aggregate in the cells of the ciliary body and accumulation in th e irido-corneal angle of the eye, leading to a cascade of cellular toxicity and mechanical blockage of the angle (Caballero et al., 2000; Caballero et al., 2001; Jacobson et al., 2001). I hypothesized the myocilin gene would be mutated in a hereditary glaucomatous dog colony versus a group of normal healthy animals; myocilin protein content in the aqueous humor would be higher in advanced glaucomatous animal s than in mildly affected and normal animals; and myocilin protein content would be greater in cells of the ciliary body, iris and trabecular meshwork in glaucomatous animals than in norm al animals. The goals of this study were to demonstrate the possibilities of these three hypo theses, using an inherited glaucoma beagle primary open angle glaucoma model, as well as other normal and spontaneous glaucomatous dogs of different breeds.

PAGE 31

Table 1-1: Loci and Genes Associated with Glaucoma 31 Gene Loci Chromosome Protein Phenotype Inheritance MYOC GLC1A 1q23-24 Myocilin JOAG, POAG Autosomal Dominant GLC1B 2cen-q13 POAG GLC1C 3q21-24 POAG GLC1D 8q23 POAG OPTN GLC1E 10p14-15 Optineurin POAG GLC1F 7q35-36 POAG CYP1B1 GLC3A 2p21 Cytochrome P1B1 Congenital glaucoma Autosomal Recessive GLC3B 1p36 Congenital glaucoma PITX2 RIEG1, IRID2 4q25-27 Homeobox transcription factor Rieger syndrome FOXC1 6p25 Forkhead transcription factor Congenital glaucoma; Rieger/Axenfeld anomaly LMX1B ABO adenylate kinase 9q34 Lim homeodomain Nail patella syndrome Autosomal Dominant

PAGE 32

32 Table 1-2: Composition of aqueous humor Property or constituent Value Remarks Reference Volume 350 l Mestrezat and Magitot, 1921 Ascorbate 1.06 0.31 M/g H 2 O Plasma = 0.042 0.023 M/g H 2 O de Bernardinis et al., 1965 B12 29.9 pg/ml Plasma = 271.9 pg/ml Phillips et al., 1968 Bicarbonate 19.64 1.4 M/g H 2 O Plasma = 26.47 2.64 M/g H 2 O de Bernardinis et al., 1965 Carbon dioxide Pco2 = 38.6 mm Hg 16 cataract patients Thiel, 1967 Chloride 134 22.4 M/g H 2 O Plasma = 109 18.4 M/g H 2 O de Bernardinis et al., 1965 Glucose 3.00 2.04 M/g H 2 O Plasma = 6.33 2.45 M/g H 2 O de Bernardinis et al., 1965 3.70 4.78 M/g H 2 O Plasma = 4.72 6.55 M /ml Pohjola, 1966 Glycoprotein 63-75 g/ml Cardia and Coriglione, 1962 Hexosamine 14.9-18.3 g/g Meyer et al., 1938 Lactate 4.28 1.30 M/g H 2 O Plasma = 1.78 0.80 M/g H 2 O de Bernardinis et al., 1965 Oxygen PO2 = 59.7 mm Hg Cataract patients, 64-90 yrs Thiel, 1967 pH 7.21 Becker. 1957 7.38 (7.31 7.42) Cataract patients, 60-94 yrs Thiel, 1967 Protein Total protein: 31-1000 mg/100 g Kronfield et al., 1941 Fractions as % of total : Prealbumin 1 = 4.1 Prealbumin 2 = 8.2 Albumin = 31.0 1 -globulin = 10.6 2 -globulin = 11.2 -globulin = 20.1 -globulin = 12.7 -fraction = 2.1 Results on one case with secondary Cataract Total protein = 55 mg/100 mg Praus, 1961 Sodium 162.9 4.3 M/g H 2 O Serum = 176.4 M/g H 2 O Cagainut, 1957

PAGE 33

Table 1-3. Human myocilin mutations detected in population Mutation POAG Controls p-value Protein Solubility References Year 17 bp DUP 56-72bp 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 ARG82CYS 2/1703 (0.12%) 0/793 N/A N/A Fingert et al. 1999 ARG91STOP 1/91 (1.1%) 0/113 N/A N/A Lam et al. 2000 GLY252ARG 1/74 (1.4%) 0/43 N/A N/A Shimizu et al. 2000 GLU261LYS 3/79 (3.8%) 0/90 N/A N/A Vzquez et al. 2000 ARG272GLY 1/74 (1.4%) 0/60 N/A N/A Shimizu et al. 2000 TRP286ARG 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 THR293LYS 2/1703 (0.12%) 0/793 N/A N/A Fingert et al. 1999 GLY323LYS 1/74 (1.4%) 0/43 N/A N/A Shimizu et al. 2000 GLN337GLU 1/79 (1.3%) 0/90 N/A N/A Vzquez et al. 2000 GLU352LYS 5/1703 (0.29%) 1/793 0.13%) N/A Insoluble Fingert et al. 1999 PRO361SER 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 GLY364VAL 2/1703 (0.12%) 0/793 N/A Insoluble Fingert et al. 1999 GLY367ARG 1/50 (2.0%) 0/5 N/A N/A Suzuki et al. 1997 GLN368STOP 27/1703 (1.6%) 1/793 0.13%) P=0.0025 Insoluble Fingert et al. 1999 3/152 (2.0%) 0/104 N/A Wiggs et al. 1998 2/74 (2.7%) 0/60 N/A Shimizu et al. 2000 1/79 (1.3%) 0/90 N/A Vzquez et al. 2000 PRO370LEU 1/50 (2.0%) 0/5 N/A Insoluble Suzuki et al. 1997 1/74 (1.4%) 0/43 N/A Shimizu et al. 2000 1/152 (0.66%) 0/104 N/A Wiggs et al. 1998 1/25 (4%) 0/130 N/A Vasconcellos et al. 2000 THR377MET 2/1703 (0.12%) 0/793 N/A Insoluble Fingert et al. 1999 1/74 (1.4%) 0/60 N/A Shimizu et al. 2000 1/152 (0.66%) 0/104 N/A Wiggs et al. 1998 SER393ARG 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 VAL426PHE 2/74 (2.7%) 0/60 N/A N/A Shimizu et al. 2000 CYS433ARG 7/25 (28%) 0/130 N/A N/A Vasconcellos et al. 2000 33

PAGE 34

Table 1-3. Continued Mutation POAG Controls p-value Protein Solubility References Year TYR437HIS 4/1703 (0.23%) 0/793 N/A Insoluble Fingert et al. 1999 1/152 (0.66%) 0/104 N/A Wiggs et al. 1998 ALA445VAL 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 lbp DEL codon 453 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 ILE465MET 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 ARG470CYS 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 ILE477ASN 1/1703 (0.058%) 0/793 N/A Insoluble Fingert et al. 1999 1/74 (1.4%) 0/43 N/A Shimizu et al. 2000 PRO481THR 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 PRO481LEU 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 GLU483STOP 1/1703 (0.058%) 0/793 N/A N/A Fingert et al. 1999 1544ins489STOP 1/79 (1.3%) 0/90 N/A N/A Vzques et al. 2000 ILE499SER 1/74 (1.4%) 0/60 N/A N/A Shimizu et al. 2000 34

PAGE 35

Table 1-4: Human myocilin mutations detected in glaucoma pedigrees Mutation Pedigrees Affected Members with the Mutation Z max Protein Solubility References Year GLY246ARG 1 7 N/A N/A Adam et al. 1997 GLY252ARG 1 5 N/A N/A Booth et al. 2000 ARG272GLY 1 4 N/A N/A Shimizu et al. 2000 GLU323LYS 1 11 N/A Insoluble Shimizu et al. 2000 PRO334SER 2 3 N/A N/A Kee et al. 1997 GLN337ARG 1 5 N/A N/A Stoilova et al. 1997 GLY364VAL 2 20 3.5 Insoluble Alward et al. 1998 GLY367ARG 1 5 N/A N/A Mansergh et al. 1998 1 2 N/A Michels-Rautenstrauss 1998 1177GACA->T 4 20 6.6 Insoluble Angius et al. 1998 GLN368STOP 15 25 N/A Insoluble Stone et al. 1997 3 8 N/A Allingham et al. 1998 2 8 N/A Shimizu et al. 2000 1 19 N/A Angius et al. 2000 PRO370LEU 2 14 N/A Insoluble Adam et al. 1997 1 15 N/A Shimizu 2000 1 2 N/A Suzuki et al. 1997 1 4 N/A Stoilova et al. 1998 1 7 N/A Michels-Rautenstrauss 1998 THR377MET 2 15 1.3 Insoluble Alward et al. 1998 1 3 N/A Shimizu et al. 2000 ASP380ALA 1 14 N/A Insoluble Kennan et al. 1998 1 3 N/A Stoilova et al. 1998 396INS397 1 6 N/A N/A Alward et al. 1998 LYS423GLU 1 79 N/A Insoluble Morissette et al. 1998 VAL426PHE 1 10 N/A Insoluble Mansergh et al. 1998 1 12 N/A Shimizu et al. 2000 TYR437HIS 2 34 13.8 Insoluble Alward et al. 1998 THR448PRO 1 2 N/A N/A Yokoyama et al. 1999 ILE477ASN 1 19 11.6 Insoluble Alward et al. 1998 1 15 N/A Insoluble Richards et al. 1998 1 16 N/A Shimizu et al. 2000 ILE477SER 1 20 N/A Insoluble Adam et al. 1997 ASN480LYS 3 52 N/A Insoluble Adam et al. 1997 ILE499PHE 1 7 N/A Insoluble Adam et al. 1997 ILE499SER 1 2 N/A N/A Shimizu et al. 2000 SER502PRO 1 7 N/A N/A Stoilova et al. 1998 35

PAGE 36

Figure 1-1: Basic structures of the eye. Figure 1-2: The Canine iris controls the amount of light entering the eye. 36

PAGE 37

Figure 1-3: Example of a horizontal pupil. Figure 1-4: Rear of the Iris (I), Ciliary Body (CB), Ciliary Processes (CP), and Pars Plicata (PP). 37

PAGE 38

Figure 1-5: Zonules over the ciliary processes. 38

PAGE 39

Figure 1-6: Pillars of the pectinate ligament from the base of the iris to the inner cornea. 39

PAGE 40

Figure 1-7: Pigmented and non-pigmented epithelium of the ciliary body. Cellular junctions between the two layers of epithelium of the ciliary process are very important. The lateral intercellular junctions of the nonpigmented epithelium consist of desmosomes, except at the apical end. 40

PAGE 41

1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 GATCTCCAGT TCCTAGCATA GTGCCTGGCA CAGTGCAGGT TCTCAATGAG TTTGCAGAGT GAATGGAAAT ATAAACTAGA AATATATCCT TGTTGAAATC AGCACACCAG TAGTCCTGGT GTAAGTGTGT GTACGTGTGT GTGTGTGTGT GTGTGTGTGT AAAACCAGGT GGAGATATAG GAACTATTAT TGGGGTATGG GTGCATAAAT TGGGATGTTC TTTTTAAAAA GAAACTCCAA ACAGACTTCC GGAAGGTTAT TTTCTAAGAA TCTTGCTGGC AGCGTGAAGG CAACCCCCCT GTGCACAGCC CCACCCAGCC TCACGTGGCC ACCTCTGTCT TCCCCCATGA AGGGCTGGCT CCCCAGTATA TATAAACCTC TCTGGAGCTC GGGCATGAGC CAGCAAGGCC ACC CATCCAG GCACCTCTCA GCACAGCAGA GCTTTCCAGA GGAAGCCTCA CCAAGCCTCT GCAATGAGGT TCTTCTGTGC ACGTTGCTGC AGCTTTGGGC CTGAGATGCC AGCTGTCCAG CTGCTGCTTC TGGCCTGCCT GGTGTGGGAT GTGGGGGCCA GGACAGCTCA GCTCAGGAAG GCCAATGACC AGAGTGGCCG ATGCCAGTAT ACCTTCAGTG TGGCCAGTCC CAATGAATCC AGCTGCCCAG AGCAGAGCCA GGCCATGTCA GTCATCCATA ACTTACAGAG AGACAGCAGC ACCCAACGCT TAGACCTGGA GGCCACCAAA GCTCGACTCA GCTCCCTGGA GAGCCTCCTC CACCAATTGA CCTTGGACCA GGCTGCCAGG CCCCAGGAGA CCCAGGAGGG GCTGCAGAGG GAGCTGGGCA CCCTGAGGCG GGAGCGGGAC CAGCTGGAAA CCCAAACCAG AGAGTTGGAG ACTGCCTACA GCAACCTCCT CCGAGACAAG TCAGTTCTGG AGGAAGAGAA GAAGCGACTA AGGCAAGAAA ATGAGAATCT GGCCAGGAGG TTGGAAAGCA GCAGCCAGGA GGTAGCAAGG CTGAGAAGGG GCCAGTGTCC CCAGACCCGA GACACTGCTC GGGCTGTGCC ACCAGGCTCC AGAGAAG GTA AGAATGCAGA GTGGGGGGAC TCTGAGTTCA GCAGGTGATA TGGCTCGTAG TGACCTGCTA CAGGCGCTCC AGGCCTCCCT GCCTGCCCTT TCTCCTAGAG ACTGCACAGC TAGCACAAGA CAGATGAATT AAGGAAAGCA CAGCGATCGA TCCGCCTGCC TCGGCCTCCC AAAGTGCTGG GATTACAGGC ATGAGCCACC ACGCCTGGCC GGCAGCCTAT TTAAATGTCA TCCTCAACAT AGTCAATCCT TGGGCCATTT TTTCTTACAG TAAAATTTTG TCTCTTTCTT TTAATGCAG T TTCTACGTGG AATTTGGACA CTTTGGCCTT CCAGGAACTG AAGTCCGAGC TAACTGAAGT TCCTGCTTCC CGAATTTTGA AGGAGAGCCC ATCTGGCTAT CTCAGGAGTG GAGAGGGAGA CACCGG TATG AAGTTAAGTT TCTTCCCTTT TGTGCCCACA TGGTCTTTAT TCATGTCTAG TGCTGTGTTC AGAGAATCAG TATAGGGTAA ATGCCCACCC AAGGGGGAAA TTAACTTCCC TGGGAGCAGA GGGAGGGGAG GAGAAGAGGA ACAGAACTCT CTCTCTCTCT CTGTTCCCTT GTCAGAGCAG GTCTGCAGGA GTCAGCCTGA TCATTGTCTG TGTTTGGAAA GATTATGGAT TAAGTGGTGC TTCGTTTTCT TTTCTGAATT TACCAGG ATG TGGAGAACTA GTTTGGGTAG GAGAGCCTCT CACGCTGAGA ACAGCAGAAA CAATTACTGG CAAGTATGGT GTGTGGATGC GAGACCCCAA GCCCACCTAC CCCTACACCC AGGAGACCAC GTGGAGAATC GACACAGTTG GCACGGATGT CCGCCAGGTT TTTGAGTATG ACCTCATCAG CCAGTTTATG CAGGGCTACC CTTCTAAGGT TCACATACTG CCTAGGCCAC TGGAAAGCAC GGGTGCTGTG GTGTACTCGG GGAGCCTCTA TTTCCAGGGC GCTGAGTCCA GAACTGTCAT AAGATATGAG CTGAATACCG AGACAGTGAA GGCTGAGAAG GAAATCCCTG GAGCTGGCTA CCACGGACAG TTCCCGTATT CTTGGGGTGG CTACACGGAC ATTGACTTGG CTGTGGATGA AGCAGGCCTC TGGGTCATTT ACAGCACCGA TGAGGCCAAA GGTGCCATTG TCCTCTCCAA ACTGAACCCA GAGAATCTGG AACTCGAACA AACCTGGGAG ACAAACATCC GTAAGCAGTC AGTCGCCAAT GCCTTCATCA TCTGTGGCAC CTTGTACACC GTCAGCAGCT ACACCTCAGC AGATGCTACC GTCAACTTTG CTTATGACAC AGGCACAGGT ATCAGCAAGA CCCTGACCAT CCCATTCAAG AACCGCTATA AGTACAGCAG CATGATTGAC TACAACCCCC TGGAGAAGAA GCTCTTTGCC TGGGACAACT TGAACATGGT CACTTATGAC ATCAAGCTCT CCAAGATGTG AAAAGCCTCC AAGCTGTACA GGCAATGGCA GAAGGAGATG CTCAGGGCTC CTGGGGGGAG CAGGCTGAAG GGAGAGCCAG CCAGCCAGGG CCCAGGCAGC TTTGACTGCT TTCCAAGTTT TCATTAATCC AGAAGGATGA ACATGGTCAC CATCTAACTA TTCAGGAATT GTAGTCTGAG GGCGTAGACA ATTTCATATA ATAAATATCC TTTATCTTCT GTCAGCATTT ATGGGATGTT TAATGACATA GTTCAAGTTT TCTTGTGATT TGGGGCAAAA GCTGTAAGGC ATAATAGTTT CTTCCTGAAA ACCATTGCTC TTGCATGTTA CATGGTTACC ACAAGCCACA ATAAAAAGCA TAACTTCTAA AGGAAGCAGA ATAGCTCCTC TGGCCAGCAT CGA ATATAAG TAAGATGCAT TTACTACAGT TGGCTTCTAA TGCTTCAGAT AGAATACAGT TGGGTCTCAC ATAACCCTTT ACATTGTGAA ATAAAATTTT CTTACCCAAA AAAAAAAAAA AAAAAAAAAA AAAAAAA Figure 1-8: Human myocilin mRNA overlaid on human complete DNA for the region, showing exons and areas removed by post processing. ATGs show two possible start points. Blue underlined = Exon 1. Green underlined = Exon 2. Red underlined = Exon 3. 41

PAGE 42

Figure 1-9: Myocilin consists of 3 exons and a 5-kilobase promoter region. Figure 1-10: Basic leucine zipper motif. 42

PAGE 43

CHAPTER 2 MATERIALS AND METHODS To analyze the myocilin gene, blood samples and/or buccal swabs were taken from both normal and glaucomatous dogs. Dr. Gelatts glaucoma beagle colony at the University of Florida was used as a known, inherited glaucoma model, to compare later with primary, secondary glaucomatous samples as well as non-glaucoma aqueous humor samples collected from around the nation (Gelatt et al., 1998; Gelatt et al., 1998; Demenais et al., 1979; Gelatt et al., 1981; Gelatt et al., 2004). The glaucomatous dogs were further divided into mild, moderate and severe glaucoma (See protein analysis). Gene Analysis The confirmation of the structure of the myocilin gene in the canine was the first phase of this study. To obtain DNA samples, two milliliters of blood were collected from one primary open angle glaucomatous beagle and one normal dog in EDTA treated vacuum tubes. The blood sample was then mixed with enough red blood cell lysis solution (Madisen et al., 1987) to bring the total volume to 45 ml. This solution was heated in a water bath at 37 for 15 minutes. The solution was then placed in a centrifuge at 2000 rpm for 10 minutes to pellet the white blood cells containing the DNA. The pellet was then broken up by tapping and 200l of Gentra cell lysis solution (Gentra PureGene Systems, Minneapolis, MN) was then added. The solution was then transferred to a sterile 2 ml eppendorf tube using a sterile pipette. It was then vortexed for 10-40 seconds. The solution was quite thick. Two hundred and fifty microliters of Gentra Protein Precipitation solution was then added and vortex mixed as little as possible (to avoid mechanical shearing of the DNA). It was then centrifuged at 6000 g for 10 minutes to precipitate the 43

PAGE 44

proteins. The pellet that formed was fairly tight and tannish brown. No strings of protein were still visible. If the pellet didnt form well after the first centrifuging, the sample was placed on ice for 5 minutes, and then re-centrifuged. The supernatant, containing the DNA, was carefully removed with a wide bore pipette tip into a new 2 ml eppendorf tube. We were careful to avoid disturbing the protein pellet. 200 l of chloroform was then added to the solution in the new tube and mixed vigorously by inversion several times. The solution was then centrifuged at 10,000 rpm for 5 minutes. The top layer of the resulting solution was then transferred to a new sterile eppendorf tube, carefully avoiding the interphase. The final DNA sample needs to be completely protein-free or the DNA will degrade with time. The tube was then inverted gently with 1 ml isopropanol (2-propanol) until the DNA completely precipitated (Schleren lines disappeared). This final solution was then centrifuged at 2000 g for 2 minutes to cause the DNA to pellet. The supernatant was then poured off, and the DNA pellet was washed with 300 l of genomic quality 70% ethanol (ETOH). It was then centrifuged for 2 minutes at 2000 g to re-pellet the DNA. The ethanol was then carefully poured off and the DNA left to air dry for a few minutes (careful not to let it completely dry). The pellet was then resuspended in 200-500 l of sterile 1X TE (40 mM TRIS, 1 mM EDTA, pH 8.0) and inverted for a few days to allow the DNA to dissolve. When our study first began, the canine genome had not yet been released. We extrapolated a possible best guess set of primers by aligning known myocilin sequences from other species. These included: human, mouse, rat, cow, rhesus, pig, and rabbit. Once an alignment of these seven species was made, the most conserved areas of the gene were used to make primers for PCR replication and amplification (Table 2-1). Later (summer 2004), new primers were made based on the newly released canine genome from a team led by Kerstin Lindblad-Toh, Ph.D., of the Broad Institute of MIT and Harvard, 44

PAGE 45

(Cambridge, MA), and Agencourt Bioscience Corp., (Beverly, MA) based on a 6-fold shotgun sequence of a common canine (canis familiaris) Boxer dog (Figure 2-1). The known sequences for human, mouse, rat, cow, rhesus, pig, and rabbit were aligned against the new canine genome, and the sequence for myocilin was extrapolated in the dog. Primers were based on this sequence in the dog. Eleven primers were designed following common primer design guidelines from Dr. Margaret Wallace at the University of Florida: Design primers only from areas with unambiguous sequences. Choose a priming site that is 30-50 bases from where new sequence is required. Primers with one or more G or C residues at the 3'-end will increase binding efficiency. Primers with long runs of a single base (i.e., more than three or four, especially G or C) should be avoided. Use of primers longer than 18 bases minimizes the chances of encountering problems with non-specific hybridization. For cycle sequencing, primers with melting temperatures (Tm) above 45C generally produce better results than primers with lower melting temperatures. Tm's in the range of 55C to 65 work well. Avoid using primers with Tm's above 65C-70C. For primers with a GC content of less than 50% (GC content of 55% is ideal), it may be necessary to extend the primer sequence beyond 18 bases to keep the melting temperature above the recommended lower limit of 45C. Avoid primers which could form secondary structures (i.e., inverted repeats). Avoid primers that can hybridize to each other to form dimers (complementary regions 4 bp). And finally, do not confuse "picomoles" with "picomolar" when calculating primer quantities. These primers are listed in table 2-2. Primer pairs were then used to sequence the entire open reading frame and untranslated regions of the gene. To sequence a complete copy of the myocilin gene, we first ran PCR on multiple matched pairs of our final primers. One quarter microliter of purified DNA sample was combined with 2.5 45

PAGE 46

l 10x PCR buffer solution, 2.0 l dNTP solution, 0.5 l of each 5' and 3' primers, 0.25 l Taq polymerase, and water to bring the volume to 25 total microliters. This recipe would shift slightly depending on the concentration of the purified DNA, and the strength of the Taq. The solution would then be placed in a PCR reactor for 25-35 cycles. The cycle would include a 45 second denaturing phase at 94 C, a 45 second annealing phase at 45-66 C (depending on the primers used), and an extension phase of 45 seconds at 72 C. A final extension phase at the end of the cycles would lat at least 20 minutes at 72 C. The PCR products were then direct sequenced. Direct sequencing involves sequencing double stranded PCR products. Both alleles are present in the sequencing reaction resulting in one double peak in the case of a base pair change (for a heterozygote) and a more complicated pattern of double peaks in cases of insertions, deletions, alternate splicing, etc. While it is important to align the sequence against the known normal or published sequence, careful perusal of the sequence chromatogram is essential to detect mutations when using Direct Sequencing. The first step in direct sequencing is PCR product filtering to remove all foreign / non-DNA material. Millipore microcon-PCR centrifugal filtration devices were used for this step by inserting a filter into one of the eppendorf tubes provided in the kit with the purple side up. We then added as much of our PCR product as possible (usually 20-22 l) and added sterile water to bring the total volume up to 400 l. We then closed the cap and centrifuged in the adjustable-speed microfuge at 1300 x g for 15 minutes. Next, we removed the filter device and placed purple side up into a fresh Millipore eppendorf tube, and added 20 l of sterile distilled water, being careful not to touch the membrane. Finally, we inverted the filtration device so that the white part was sticking out of 46

PAGE 47

the tube. The cap did not close in this position. After spinning at 1300 x g for 2 minutes in the adjustable-speed microfuge, our filtered product was recovered in the bottom of the tube. To check our purified results, and confirm that we still had present DNA, we ran a basic check gel on agarose. We then ran a Big Dye 3 Sequencing Reaction (ABI Applied Biosystems, Foster City, CA). Starting with 3 l purified PCR product, we added 2 l Big Dye 3 Reaction Mixture, 2 l 5x sequencing buffer, 0.2 l primer, and 2.8 l sterile distilled water. One drop of oil was placed on top of reaction to minimize evaporation during the PCR reaction. A PCR reaction programmed at 96 C for 30 seconds, 50 C for 15 seconds, and 60 C for 4 minutes for 25 cycles was used. An Edge Biosystem column was prepared by spinning in the adjustable-speed centrifuge for 3 minutes at 850 g. The column was transferred to a clean 1.5 ml eppendorf tube. Using a pipette set for just under 10 l, the PCR reaction was removed from its tube and transferred to the center of the now dry column in the clean eppendorf tube. We carefully avoided transferring any of the oil used in the PCR reaction. The cap was closed and centrifuged for 3 minutes at 850 g. After the sequencing sample had been run through the column, we dried the volume collected down in the speed-vac (caps open) until sample was completely dry. Approximately 30 minutes with full vacuum and medium temperature to dry. We finally stored the dry sample in the freezer, after it colled to room temperature until we were ready to sequence. To the thawed dry samples from before, we added 17ul of TSR ( ABI Prism Template Suppression Reagent) and vortexed the sample for several seconds. The tubes were then centrifuged for a few moments to recollect the samples in the tubes. The tubes were then heated to 94C for 2-3 minutes and then placed on ice for 5 minutes. This final solution was then vortexed for 15-20 seconds and then centrifuged to re-collect in the tube. Approximately 16l of 47

PAGE 48

the samples was now removed from the tube, careful to avoid air bubbles, and placed in a Perkin Elmer 0.5 ml sequencing tube and capped with Perkin Elmer Septa gray rubber stoppers. The samples were finally run on the Applied Biosystems (ABI 310) Sequencer. All results were analysed using SeqEd v.1.0.3. Protein Analysis Myocilin protein levels were analyzed in the aqueous humor of glaucomatous and normal dogs. Dr. Gelatts glaucomatous beagle colony was used initially as a source of inherited glaucoma dogs. Sixteen dogs were used and classified as either having mild, moderate or advanced glaucoma as diagnosed by Dr. Gelatt. Mild glaucoma was defined as little or no visible changes to the eye, with only low intraocular pressure increase. Moderate glaucoma was classified as a spike in intraocular pressure and still little or no externally visible problems. Advanced glaucoma was defined as a large spike in IOP, and visual eye problems (ie, enlarged globe, corneal edema, lens luxation and ocular irritation). Clinical samples were also collected from around the nation. To compare to the beagle POAG model, aqueous humor samples were collected from a number of veterinary ophthalmology specialty clinics of several different breeds affected with spontaneous glaucoma. Those with suspected inherited glaucoma included both POAG as well as PCAG types. A total of 353 samples (141 Male, 194 Female, 18 unreported) with average ages of 107 months for the males, 104 months for the females and 105 months for the unreported genders were analyzed. These were classified by the attending veterinary ophthalmologist as either primary glaucoma (1), secondary glaucoma (2), cataractous, diabetic cataractous or other. Primary glaucoma has no other signs of ocular disease except a spontaneous ocular hypertension and occurs in several purebred dog breeds. Secondary glaucoma is described as secondary to a primary disease (such as a uveitis) or trauma. Cataractous aqueous humor samples 48

PAGE 49

were used as a non-glaucoma control, as the samples are relatively easy to collect during a cataract surgery without any additional trauma to the dog. Diabetic cataracts were separated from the cataractous group, to check for any diabetic changes that may affect this study. A 0.1 ml sample of aqueous humor was drawn from the anterior chamber each dog in the study. This was done by anesthetizing the dog with 3-5 ml propofol IV, and maintaining with 2-3% isoflurane gas anesthetic. The eye was sterilized with a small amount of iodine wash and rinsed with sterile water. The eye was held with a small single toothed forcep while a 1cc tuberculin syringe with a 0.75 inch 30 gauge needle was carefully inserted just center of the limbus. Careful not to make contact with the iris, the 0.1 l sample was drawn. A sterile gauze applicator stick was placed at the point of entry as the needle was withdrawn to stop aqueous outflow. The sample was then either kept cold on ice, frozen on dry ice, or placed in a vial with 100 l protease inhibitor (Mini-Complete, Roche Scientific), and then transferred to a -80 ultra-freezer for storage. A Western blot or Comassie stain was run on each sample to compare these myocilin levels. A polyclonal anti-body was used from either Alcon Pharmaceuticals (from human trabecular cell culture) or Santa Cruz Biotechnologies (from mouse anti-human myocilin). Comassie Stain To analyze the total proteins in the aqueous humor we used a modified SimplyBlue SafeStain Microwave Protocol from Invitrogen. An SDS reducing buffer (Cell Signaling Technology) was prepared by combining 1 part reducing agent, 10 parts buffer, and 20 parts sterile deionized water. Two l of each sample was then combined with 38 l of the SDS reducing buffer. The samples were then heated at 100C for 5 minutes in a boiling water bath. They were then moved to an ice bath for a further 5 minutes. The samples were then placed in a centrifuge for 5 minutes at 14,000 rpm. 49

PAGE 50

12% Bis-Tris gels were loaded into our electrophoresis apparatus with 1x running buffer (Invitrogen). Each gel was then loaded with sample and controls. The first lane of the gel was loaded with 8 l of a control ladder (SeeBlue Plus 2, Invitrogen). Lane two contained 8 l of a human myocilin control (Alcon Labs), prepared similarly to the samples. Lanes 3 and higher were inoculated with 4 l of each sample/buffer solution. The gel was then placed in an electric current for 3 hours at 60V. At the end of 3 hours, the gel was removed from its cassette and trimmed down. The gel was placed in 100 ml of sterile deionized water and heated in a 1000w microwave oven for one minute and 25 seconds. It was then placed on a clinical rotator for 1 minute. This was repeated 2 more times. After the final wash, 30 ml of Simply Blue Safe Stain (Invitrogen) was added and the gel heated for 35 seconds and then placed on the rotator for 10 minutes. The stain was decanted from the gel dishes and a single water wash was performed, followed by a 20 ml 20% sodium chloride wash for 10 minutes. The gels were then taken to a Biorad ChemiDoc XRS imager for scanning and densitometry. Western Blot Western blotting with a human anti-myocilin antibody was begun exactly the same way as our Comassie protocol. After the samples were run for 3 hours at 60V, the gels were removed and the cassettes discarded. Two pieces of filter paper and 4 sponges were liberally soaked with 1x Transfer buffer (Invitrogen). A sandwich was made with two sponges, 1 filter paper, the gel, one piece of 0.2m nitrocellulose membrane, another filter paper, and the last two sponges careful to minimize air bubbles. The sandwich was placed in a western blotting press with the gel towards the cathode and the membrane towards the anode. The western blot transfer was run at 30V for 1.5 hours. 50

PAGE 51

When the transfer to the nitrocellulose membrane was complete, the membrane was removed to a dish and a small amount of 1% Ponceau S was added. Gently shaking for 1 minute reveals any protein bands in the membrane, and shows that the transfer was successful. The Ponceau S was gently rinsed from the dish with deionized water. The ladder was marked with a permanent marker for later measurements. A Block solution was made with 1x TBA, 0.5% Tween 20, and 1% BSA. The membrane was then covered with the block solution for 30 minutes at room temperature and gently shaken. While the blocking was being performed, the primary antibody was prepared, in this case rabbit anti-human myocilin (Santa Cruz Biotechnologies). An antibody dilution buffer was prepared by using a 1:10 dilution of the block solution. Using 2.5ml of the antibody dilution buffer, a 1:500 antibody dilution is made by adding 5 l of primary antibody. The blocked membrane was then placed in a small bag with the diluted primary antibody and gently rocked overnight at 4C. The next morning, the nitrocellulose membrane was then washed in a solution containing 0.05% Tween 20 in 1% TBS (USB Corporation) four times for 5 minutes each. During final wash, a new bag was prepared with a1:500 dilution of donkey serum (5 l) in 2.5 ml antibody dilution buffer. The sealed bag with the membrane and the serum dilution was then placed on a nutator for 30 minutes. A secondary anti-body 1:2000 dilution was then prepared using 5ml of the antibody dilution buffer and 2.5 l donkey anti-rabbit antibody (Santa Cruz Biotechnology). A new bag was prepared and the membrane moved into it with 2.5 ml of the secondary antibody dilution and gently agitated for 90 minutes at room temperature. Eighty minutes into the agitation, our Avidin/Biotin conjugate (ABC) solution was prepared (Pierce Biotechnology). The membrane was then washed 4 times for 5 minutes each, as before. At the end of the final wash, the membrane was placed in a new bag with 3 ml of the ABC solution and rocked on the nutator 51

PAGE 52

for 30 minutes at room temperature. The membrane was then removed and washed four times as before. During the final wash we prepared 6 ml of Supersignal West Pico Chemiluminescent Substrate (Pierce Biotechnology). The membrane was covered by the chemiluminescent substrate in a small dish for 1 minute and then sealed in plastic wrap and taken for imaging on a Biorad ChemiDoc XRS. The membrane was exposed to the digital imager for 10 minutes and the image used for analysis. Myocilin Protein Localization Specimens from the anterior uveas of 10 beagles, five with inherited glaucoma (3-mosto 13-yrs-of age) and five age-matched normals, 1 normal walker hound, 1 normal schnauzer, and 2 cocker spaniels with spontaneous glaucoma were used in this study. The presence and localization of myocilin in the normal and glaucomatous canine anterior eye were studied by the use of immunohistochemical and immunocytochemical techniques. For immunohistochemistry, the samples were incubated sequentially, first in peroxidase block, followed by goat serum, and then with the rabbit polyclonal primary antibody for human myocilin. The samples were then incubated with an anti-rabbit donkey antibody with a biotinylated link followed by peroxidase-labeled streptavidin and then by substrate-chromogen AEC. Normal, mild, moderate, and severe glaucoma samples were compared, and examined for similarities and differences using light microscopy. With immunocytochemistry, samples were embedded in L.R. white resin. Sections were cut at 90 nm and mounted on nickel grids. These grids were incubated with bovine serum albumin followed by goat serum. The samples were then incubated with primary antibody and then the secondary antibody, 18 nm colloidal gold labeled goat anti-rabbit IgG. Grids were then examined using transmission electron microscopy. 52

PAGE 53

Microarray Gene Chips Microarrays, often called DNA chips, usually consist of a piece of glass or nylon on which hundreds of pieces of DNA strands, known as probes, are arranged in a regular pattern. Analysis of those strands provides a picture of gene expression that takes place in a cell during a given moment. New microarray gene chips, developed with our help, were used to screen for RNA transcription in the eye. Tissue samples from both glaucomatous and normal dogs were collected (Table 2-3). These included ciliary body, iris and trabecular meshwork / irido-corneal angles. The samples were fast frozen, or stored in RNA-later (Qiagen). The samples were then ground down and the cells lysed. The mRNA was extracted using University of Florida ICBR protocols. The mRNA was then reverse transcribed into cDNA and hybridized with a biotin transcript. The samples were heated in the presence of Mg 2+ and fragmented into biotinylated cRNA segments. These segments were then hybridized on the DNA chip for 16 hours and scanned in the ICBR core laboratories. The results were analyzed with proprietary software and normalized using canine GAPDH as a housekeeping gene. 53

PAGE 54

Table 2-1: Original canine myocilin primers Primers Sequence 5' to 3' CMYOCA01F CAGGGAGGGCTCTCCAGTAT CMYOCA01R GCTGGCCACACTGAAAATATAC CMYOCA02F CTGCTACTTCTGGCCTGTCTCT CMYOCA02R CTTGGGTTTCCAGCTGTTCT CMYOCA03F GAGACCTGGAGTCCACCAAA CMYOCA03R CTCTTCTCAGCCTTGCTACCTC CMYOCA04F CAAGTCAGCTCTGGAAGAAGAA CMYOCA04R CTTGGCCCTCCTTAATTCATCT CMYOCB01F GCCTATTAAATACCATCCTCAGCA CMYOCB01R CTCTTGCCAGGCTGACCTGT CMYOC01F CCTTCATATCTTTCTTGATCTTAGGG CMYOC01R TTTTTCAATTTACTCTCAGAAGCTG CMYOC02F TTTTCAGAAACTGTGACAATCTG CMYOC02R AAAAATGAAACAAAAATCAAGTCA CMYOC03F CCGCTAAATCTAAGTTTTCAATCA CMYOC03R TTGTTTATTCATGAGAGACACACAGAG CMYOC04F GTGGCTCAGTGGTTGCTTAAC CMYOC04R ACCCAGGTGGTTCAGTCAGTTA CMYOC05F TTAGAGAGAGAGAGCATGAGCA CMYOC05R TGATCGATGTGTCATATGAATTG CMYOC06F AAAATGAAGTAAATCAGATATGGAAGT CMYOC06R AGACACAGAGCGTCCAGGTTTA CMYOC07F GGCATTTACCCTCTACCCAGTA CMYOC07R CTCATCCACACCCCGTACTT CMYOC08F TGTCCTTAATTCTCCAGGATGC CMYOC08R GTCTCAGCGGTCAGCTCGTAG CMYOC09F AGACCACGTGGAGAATCGAC CMYOC09R ACTGCTTCCGGATGTTAGTCTC CMYOC10F GCTACACGGACATCGACCTG CMYOC10R CTTCTCCAGGGGGTTGTAGTC CMYOC11F CCACCTGTACACCATCAGCAG CMYOC11R CTTAAAAAGCCGAGAAAAGCTG CMYOC12F GACAACTTCAACATGGTCACCT CMYOC12R GAAGAGACTACTATGCATGACAGCTT CMYOC13F GTCTGACCGTGTGGAAACAG CMYOC13R CCCCTCCTCTAATTATGGCTTG CMYOC14F AAAAGGCCCTTACTGGCTAAAG CMYOC14R CAACCCCAAGAGATGACCTG CMYOC15F TAGTGGGCTTCTAAGGCTTCAC CMYOC15R AGAGAGGGGAAGTTGAGGAAAG CMYOC16F GGAGCATTACTGGTGTGTGTGT CMYOC16R GCAGGTTCAGTTACCAAAAAGTC 54

PAGE 55

Table 2-2: Final canine myocilin primers Name Sequence 5 to 3 DMYOC1 GARGA ARCCT CACCM AGCCT C DMYOC2 TTCTG GCCKG CYTGG TGTGG G DMYOC3 TCCCT GGAGA GYCTC CTCCA C DMYOC4 ACCTC CTSGC TGCTG CTYTC DMYOC5 TGGAA TTTGG ACACK TTGGC C DMYOC6 CTCBG ACTTC ARYTC CTGGA AG DMYOC7 GCAAG TATGG HGTGT GGATG DMYOC8 GTGGG CTTGG GGTCT CKCAT DMYOC9 GTGAA GGCHG AGAAG GAAAT YC DMYOC10 GTCAA TGTCY GTGTA GCCAC DMYOC11 TTGAT RTCAT ARGTG ACCAT GTT Key: R=A or G, Y=C or T, M=A or C, K=G or T, S=C or G, W=A or T, B=C or G or T, D=A or G or T, H=A or C or T, V=A or C or G, N=A or C or G or T 55

PAGE 56

Table 2-3 : Dogs used for microarray analysis with short history. Dog Age Gender Glaucoma Previous treatments: Samson 14 yr Male Advanced 1992 Dexamethasone, 1995 Timolol, Pilocarpine, 1996 Trusopt, Betagan, Methazolamide, Humersol, 2001 Travaprost, Latanoprost, Bimatoprost, Rescula, Brimonidine Victoria 11 yr Female Advanced 1996 Trusopt, Betagan, Methazolamide, Humersol, 2001 Travaprost, Latanoprost, Bimatoprost, Rescula, Brimonidine Hunter 6 m Male Normal None. XPX2 1 yr Male Normal None. AZG2 1 yr Female Normal None. XKX2 1 yr Male Normal None. 1DG2 1 yr Female Normal None. 56

PAGE 57

Figure 2-1: Boxer made famous for providing the DNA for the first shot-gun DNA sequence for canines. 57

PAGE 58

CHAPTER 3 RESULTS Genomic Findings The newly designed primers were successful in amplifying sequences from the canine genome on the canine chromosome 7. Fragments were amplified from normal and glaucomatous beagle DNAs and sequenced. These were then aligned using SeqEd (ABI). Comparisons between our normal control dog and the reported canine genome were extremely similar although there were a few insignificant differences. Comparisons between the glaucoma dogs and the reported canine genome DNA were near identical. The glaucoma dog genomic sequence (all 3 exons, untranslated regions, and flanking intronic sequences) was identical to normal beagle sequence. No structural or mutational differences were seen between the glaucoma dog and the published normal canine genome. The 1451 bp dog MYOC cDNA sequence is shown in figure 3-1. Expected differences with other known species sequences of the myocilin gene were present, which were not expected to be pathogenic. None of the published known mutations of myocilin were present in any of the samples tested. RT-PCR analysis of trace amounts of RNA from the trabecular meshwork failed to amplify any fragments, so we could not rule out a deep intronic mutation that could affect splicing. Protein Analysis Using Western blot with human polyclonal antibodies made by Santa Cruz Biotechnologies, we were able to demonstrate the presence of myocilin in the aqueous humor of the dog. Its banding appearance was very similar to reported findings at approximately 55kDa, 58

PAGE 59

with two other expected bands nearby (Figure 3-2). Immunohistochemistry also showed this (see sections below). Inherited Model Glaucomatous Dogs The myocilin protein was shown to be present in the Gelatt glaucoma beagle colony using Comassie staining and Western blot techniques (Table: 3-1, Figures 3-2, 3-3, 3-4, 3-5). A human trabecular meshwork derived myocilin protein control (Alcon) was used on every gel for relative comparisons, and given a rank of 1 unit on each gel. In the younger, nearly normal (mild glaucoma) beagle eyes (n= 4 dogs) a relatively low level of myocilin was detected. It was characterized as a single band approximately 53-57 kDa. In the youngest dogs (1.5 yrs of age), two faintly visible bands above and below the main band can be seen. The level of myocilin for the mild glaucoma dogs was approximately 1 to 2 versus the human myocilin protein control. The intensity of the myocilin bands increased as the glaucoma severity classification increased. The moderately affected dogs showed a marked increase in the presence of myocilin protein (five to six-fold versus the human control). The highest levels of myocilin were found in the most severe cases of inherited glaucoma, with levels up to 15 times the human control amount. Clinical Samples A total of 353 samples (141 Male, 194 Female, 18 unreported gender) with average ages of 107 months for the males, 104 months for the females and 105 months for the unknown gender dogs were analyzed. Breeds seen included: Airedale (1), Akita (1), Alaskan Malamute (2), Australian Shepherd (5), Australian Cattle Dog (1), Basset Hound (16), Bearded Collie (1), Bichon Frise (10), Border Collie (2), Boston Terrier (5), Boykin Spaniel (2), Cairn Terrier (2), Cavalier King Charles Spaniel (1), Chihuahua (3), Chow Chow (8), American Cocker Spaniel (62), Dachshund (3), Miniature Dachshund (1), Dalmatian (2), English Cocker Spaniel (1), Golden Retriever (3), Gordon Setter (1), Great Dane (1), Great Pyrenees (1), Italian Greyhound 59

PAGE 60

(4), Jack Russell Terrier (4), Japanese Chin (1), Keeshond (2), Labrador Retriever (10), Lhasa Apso (9), Maltese (6), Manchester Terrier (1), Mixed Breeds (68), Newfoundland (1), Papillon (1), Pembroke Welsh Corgi (2), Miniature Pinscher (3), Pomeranian (4), Miniature Poodle (19), Standard Poodle (6), Pug (5), Rhodesian Ridgeback (1), Saint Bernard (1), Samoyed (2), Schipperke (1), Miniature Schnauzer (12), Standard Schnauzer (2), Scottish Terrier (2), Shar Pei (2), Shiba Inu (4), Shih Tzu (21), Siberian Husky (5), Welsh Terrier (1), West Highland White Terrier (4), Wheaten Terrier (2), and Yorkshire Terrier (12). Cataractous dog aqueous humor, used as non-glaucomatous controls, was shown to have little or no myocilin present at the dilutions used to visualize the glaucoma animals. With few exceptions, myocilin protein levels were found to be increased in animals with primary spontaneous glaucoma and secondary glaucomas (Figures 3-6, 3-7, 3-8). The level of the myocilin present could be correlated to the severity of the disease with the most advanced cases having the greatest apparent amounts of myocilin. Comparisons between differing glaucoma groups showed significant differences. Normal (Cataractous) dogs had the lowest level of myocilin at 4140.27 674.12 g/ml (average std dev). Diabetic cataractous dogs were found to have similar levels at 3339.37 774.71 g/ml. Primary spontaneous glaucoma dogs were found to have an aqueous humor myocilin protein level of 29404.18 7449.11 g/ml. Secondary glaucomas had the highest level of myocilin in the aqueous humor with 44797.03 11659.83 g/ml. Severe cases of glaucoma also had extra banding and a more globular appearance on the Western blot and Comassie gels (Figure 3-6). No obvious correlation could be made between myocilin levels and age or sex. Different breeds showed some but no statistical significant differences in severity, only in number of samples received (Table 3-2). This may show a predominance of spontaneous 60

PAGE 61

glaucomatous cases in certain breeds or may be bias of ascertainment based on frequency of those breeds in the United States. Immunohistochemistry Specimens from the anterior uveas of 10 beagles, five with inherited glaucoma (3-mosto 13-yrs-of age) and five age-matched normals, 1 normal walker hound, 1 normal schnauzer, and 2 cocker spaniels with spontaneous glaucoma were used in this study. Within normal, mild and moderately glaucomatous canine specimens from age groups three months to thirteen years of age, identical immunolabeling of myocilin was observed by light microscopy. Immunolabeling in these specimens showed that myocilin was homogeneously distributed in ocular tissues (Figure 3-9). Immunolabeling of specimens from dogs with advanced glaucoma, however, exhibited an increased aggregation in areas surrounding the ICA, nonpigmented epithelium of the ciliary processes, and anterior cornea (Figure 3-10). Within the cornea, intense staining for myocilin was seen throughout the cytoplasm of cells within the corneal epithelium (Figure 3-11 and 3-12) and endothelium (Figure 3-13). Within the corneal stroma, mild labeling was evident as thin extracellular lines running parallel to collagen bundles. There was no staining of Descemets membrane. Within the iris, cell membranes of smooth muscle cells of the sphincter and dilator muscles stained positive, as well as most resident cells of the iris stroma (Figures 3-14 and 3-15). Positive staining of vascular endothelial cells within the iris vessels was observed. Within the ciliary body, the cell membrane of ciliary smooth muscle cells stained intensely. Vascular smooth muscle cells surrounding the ciliary body arteries and arterioles stained intensely. The cytoplasm of cells within the nonpigmented layer of the ciliary epithelium of the ciliary body and processes stained intensely (Figure 3-16 and 3-17). Labeling in the ciliary 61

PAGE 62

epithelial cells of the pars plana was weaker than in the pars plicata. There was localized labeling in stroma of the ciliary processes. Trabecular meshwork cells were homogenously labeled (Figure 3-18). The sclera adjacent to the angular aqueous plexus as well as other parts of the sclera stained positive. Scleral staining was observed extracellularly between collagen bundles (Figure 3-19). Vascular smooth muscle cells of arterioles and arteries within the sclera labeled intensely (Figure 3-20). In samples with advanced glaucoma, greater intensity of staining was observed within the sclera adjacent to the ICA; trabecular meshwork cells of the ICA; and the nonpigmented epithelium of the ciliary processes in tissues surrounding the collapsed irideocorneal angle (Figure 3-10). In addition, vitreal membrane-like material labeled intensely within the posterior chamber (Figure 3-21 and 3-22) and corneal epithelium (Figure 3-12). Immunocytochemistry Myocilin was identified in the trabecular meshwork cells of older glaucomatous dogs as well as normal dogs (Figure 3-23, 3-24, and 3-25). It was also found extracellularly in the extracellular matrix around the trabecular meshwork (Figure 3-26). Lastly, it was also observed in the non-pigmented epithelium of the ciliary body and vitreal-like material within the posterior chamber of a 10 year old glaucomatous beagle (Figure 3-27 and 3-28). Microarray In comparisons of 6 dogs (4 normal and 2 glaucomatous), there were some differences noted in the mRNA levels of certain genes. The analysis of the final microarray run showed a signaling ratio of 1:0.4 in normal beagle dogs versus glaucomatous beagle dogs when hybridized with the human myocilin cDNA probe and 1:1.9 increase in MYOC mRNA signaling in normal beagle dogs versus glaucomatous beagle dogs when hybridized with the bovine myocilin cDNA probe. Two of the normal dogs had higher values, more similar to the glaucomatous dogs, based 62

PAGE 63

on hybridization to the bovine myocilin cDNA probe. The overall difference between normal and glaucoma dogs was barely significant with the bovine myocilin probe (p=0.05). All the dogs, glaucomatous included, had very similar low results on the human myocilin pattern (p=0.31). There are many other genes showing greater signaling differences. A signaling ratio greater than 1:2 is generally significant. A selection of significant genes can be seen in table 3-3. 63

PAGE 64

Table 3-1: Relative myocilin protein levels in inherited glaucomatous dogs. Relative to control myocilin level on: Beagle Initial Glaucoma State Eye 05/06/04 09/03/04 11/03/04 05/09/05 11/21/05 Vanessa Advanced OD 10.56 15.65 Vanessa Advanced OS 11.14 18.08 Vanna Advanced OD 7.43 11.48 Vanna Advanced OS 9.65 10.99 Vick Advanced OD 10.46 13.30 Vick Advanced OS 11.79 14.90 Victoria Advanced OD 7.60 12.44 13.05 13.86 Victoria Advanced OS 11.07 15.12 15.85 14.77 Whoopie Moderate OD 8.46 7.15 8.33 7.40 Whoopie Moderate OS 8.84 9.30 10.20 9.97 Woody Moderate OD 11.37 11.94 10.84 11.28 Woody Moderate OS 12.49 11.89 12.32 10.71 Wrigley Moderate OD 7.86 9.19 9.75 9.91 Wrigley Moderate OS 7.52 10.09 9.57 9.37 Xmas Moderate OD 8.57 10.31 10.16 Xmas Moderate OS 6.98 7.55 8.79 Yoyo Moderate OD 7.91 3.70 9.12 9.65 Yoyo Moderate OS 6.63 4.57 8.05 8.04 Zag Moderate OD 8.90 4.50 3.70 4.13 Zag Moderate OS 7.93 3.63 4.70 4.96 Zig Moderate OD 5.79 4.16 5.46 5.95 Zig Moderate OS 7.71 2.66 5.49 8.80 America Moderate OD 7.10 2.34 3.33 5.16 America Moderate OS 7.32 6.02 4.52 3.57 Bridgette Mild OD 2.14 2.86 3.09 Bridgette Mild OS 2.51 1.64 2.28 Brooke Mild OD 2.44 2.39 1.25 Brooke Mild OS 2.25 1.89 0.93 Candy Mild OD 1.61 2.05 2.36 Candy Mild OS 0.89 1.20 2.09 Daisy Mild OD 2.41 1.53 1.18 Daisy Mild OS 1.75 2.29 1.76 64

PAGE 65

Table 3-2: Aqueous humor myocilin levels from major breeds of dogs Breeds Number of M/F/U Average Age M/F/U 1 Glaucoma 2 Glaucoma Cataract Diabetic Cataract Unknown Airedale 0/0/1 0/0/122 17689.14 0.00 Akita 0/1/0 0/146/0 6143.82 0.00 Alaskan Malamute 0/2/0 0/95/0 17958.50 4134.91 Australian Shepherd 0/5/0 0/120/0 10096.35 0.00 2318.06 902.70 Australian Cattle Dog 0/1/0 0/195/0 78348.52 0.00 Basset Houndv 7/9/0 104/93/0 20069.07 8034.04 2072.23 498.38 18647.65 0.00 Bearded Collie 0/0/1 0/0/72 Bichon Frise* 6/4/0 114/53/0 30689.94 0.00 16742.35 0.00 3565.69 1188.51 2318.80 0.00 1560.73 0.00 Border Collie 2/0/0 37/0/0 10004.99 1903.02 Boston Terrier 1/4/0 120/114/0 13104.03 1733.02 2125.77 478.34 Boykin Spaniel 0/2/0 0/168/0 3168.39 1337.77 Cairn Terrier 1/1/0 140/148/0 21456.58 2035.90 Cavalier King Charles Spaniel 0/1/0 0/60/0 1303.11 0.00 Chihuahua 0/3/0 0/98/0 48243.20 0.00 28969.56 6919.48 Chow Chow* 2/6/0 120/121/0 30487.78 9050.08 Cocker Spaniel, American* 19/33/10 110/111/130 36590.07 10246.25 34478.16 8303.43 4073.40 872.38 6458.55 2088.85 Dachshund 2/1/0 102/141/0 5183.85 0.00 6031.20 288.59 Dachshund, Miniature 0/1/0 0/22/0 94535.50 0.00 Dalmatian 1/1/0 100/U/0 187287.31 0.00 9396.99 0.00 English Cocker Spaniel 0/1/0 0/108/0 2249.88 0.00 Golden Retriever 0/3/0 0/109/0 51884.36 30387.85 Gordon Setter 1/0/0 132/0/0 3526.84 0.00 Great Dane 0/1/0 0/132/0 4492.88 0.00 Great Pyrenees 1/0/0 88/0/0 2972.81 0.00 Italian Greyhound 0/4/0 0/101/0 6596.57 4428.47 4732.02 797.41 Jack Russell Terrier* 2/2/0 98/93/0 17993.97 9138.39 Japanese Chin 0/1/0 0/120/0 7692.16 0.00 Keeshond 2/0/0 96/0/0 1062.52 552.89 Labrador Retriever* 2/8/0 111/72/0 54973.09 42329.15 23476.86 6217.79 458.13 458.13 2354.47 1177.23 Lhasa Apso* 3/6/0 164/98/0 34781.93 0.00 80265.99 0.00 2043.81 2043.81 8139.65 3887.96 Maltese* 5/1/0 118/163/0 66452.89 53788.70 2696.47 1569.93 2313.07 205.07 Manchester Terrier 0/1/0 0/108/0 21909.08 0.00 Mixed Breed* 34/30/4 106/112/139 47030.84 35453.88 25499.47 8187.94 5401.32 2112.58 5681.94 1904.40 2513.38 0.00 Newfoundland 0/1/0 0/44/0 15857.43 0.00 Papillon 0/1/0 0/48/0 7830.83 0.00 65

PAGE 66

66 Table 3-2: Continued Breeds Number of M/F/U Average Age M/F/U 1 Glaucoma 2 Glaucoma Cataract Diabetic Cataract Unknown Pembroke Welsh Corgi 1/0/1 120/0/120 1463.97 0.00 2990.30 0.00 Pinscher, Miniature 3/0/0 112/0/0 4401.68 0.00 629.53 629.53 Pomeranian 4/0/0 72/0/0 18684.91 10844.96 Poodle, Miniature* 7/12/0 114/117/0 3254.03 3254.03 5790.49 4060.35 10314.82 6637.16 Poodle, Standard* 2/4/ 0 156/1 16/0 4984.69 1399.11 547.26 0.00 Pug 2/3/0 69/96/0 284436.83 277425.09 1635. 71 195.54 Rhodesian Ridgeback 0/1/0 0/67/0 77590.46 0.00 Saint Bernard 1/0/0 94/0/0 33208.09 0.00 Samoyed 2/0/0 108/0/0 3157.13 588.61 Schipperke 0/1/0 0/120/0 2189.07 0.00 Schnauzer, Miniature* 3/9/0 68/88/0 38042.73 0.00 8688.65 5472.76 549.76 549.76 Schnauzer, Standard 0/2/0 0/120/0 4595.14 188.38 Scottish Terrier 2/0/0 84/0/0 3264.79 79.62 Shar Pei 0/2/0 0/91/0 2497.16 1426.95 Shiba Inu 0/4/0 0/68/0 19802.13 7674.53 Shih Tzu* 11/9/1 123/123/51 10115.54 2122.09 139317.16 119087.88 8419.50 5915.79 4124.78 1449.25 Siberian Husky* 3/2/0 70/14/0 16918.81 9366.35 3236.53 0.00 13562.18 0.00 Welsh Terrier 1/0/0 84/0/0 3326. 34 0.00 West Highland White Terrier 4/0/0 156/0/ 0 1424.43 338.64 2423.12 0.00 Wheaten Terrier 1/1/0 73/149/0 12586.31 0.00 54163.23 0.00 Yorkshire Terrier 3/9/0 168/118/0 13134.43 0.00 4303. 14 970.56 3646.07 1512.08 Totals/Averages 141/1 94/ 18 107/1 04/105 29404.18 7449.11 44797.03 11659.83 4140.27 674.12 3339.37 774.71 7008.45 2479.97 Generally thought to have inher ited glaucoma (Gelatt et. al, 2004)

PAGE 67

Table 3-3 : Selected DNA chip microarray results. Ratio and probability show major differences between glaucoma and normal mRNA results. Items that may be of interest in bold. Normal Beagle Dogs Glaucoma Beagle Dogs UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson Avg Glau Avg Non Ratio Probability Hit Definitions / Active Genes UF_Cf_11404 -4.96 -4.63 -1.05 -0.53 1.31 -4.12 -3.42 -3.77 -1.97 1.91 0.05 myocilin [Bos taurus] UF_Cf_15108 0.52 -0.75 -0.39 0.33 0.90 0.35 -0.45 -0.05 0.12 -0.41 0.31 myocilin; trabecular meshwork-induced glucocorticoid response protein [Homo sapiens] UF_Cf_15247 0.49 0.03 -0.18 -0.46 -0.36 0.95 0.62 0.79 -0.10 -8.18 0.02 ABC transporter [Homo sapiens] UF_Cf_17624 -2.07 -1.08 0.08 0.89 0.89 1.72 1.41 1.57 -0.26 -6.07 0.05 ABC transporter subunit [Naegleria gruberi UF_Cf_13238 -0.29 0.28 0.00 0.13 0.15 0.52 0.63 0.58 0.05 10.65 0.02 ABC transporter, permease protein, putative UF_Cf_16780 -0.48 -0.24 -0.29 -0.09 -0.11 0.52 0.72 0.62 -0.24 -2.56 0.02 asparaginyl-tRNA synthetase [Homo sapiens] UF_Cf_15485 -0.25 1.54 1.40 -0.32 -0.15 1.51 0.88 1.20 0.44 2.69 0.05 aspartic protease family member (5T521) [Caenorhabditis elegans] UF_Cf_12820 0.41 0.95 0.44 -0.46 -0.20 0.84 0.71 0.78 0.23 3.40 0.02 ASPN protein [Homo sapiens] UF_Cf_11698 -0.37 0.08 -0.71 0.53 0.32 1.13 1.26 1.20 -0.03 -39.83 0.02 ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit UF_Cf_17024 -0.19 0.55 0.23 0.06 0.08 -0.61 -0.66 -0.64 0.15 -4.35 0.00 ATP/GTP-binding protein; homolog of yeast CFIA subunit Clp1p [Homo sapiens]] UF_Cf_12948 0.36 0.13 0.19 -0.44 -0.37 -0.18 -0.17 -0.18 -0.03 6.73 0.02 atrium potassium channel IRK [Canis familiaris] UF_Cf_18223 -0.64 0.28 2.27 0.11 0.55 -1.62 -1.52 -1.57 0.51 -3.05 0.01 B. burgdorferi predicted coding region BBG21 [Borrelia burgdorferi] UF_Cf_19717 0.10 -2.59 0.70 1.17 1.13 0.79 0.81 0.80 0.10 7.84 0.00 B9 protein; likely ortholog of mouse endothelial precursor protein B9 [Homo sapiens] UF_Cf_19320 0.92 -0.34 0.43 -1.02 -0.76 0.26 0.85 0.56 -0.15 -3.60 0.05 Bardet-Biedl syndrome 7 [Mus musculus UF_Cf_15882 0.34 -0.62 0.06 0.09 0.24 0.56 0.68 0.62 0.02 28.18 0.04 basic fibroblast growth factor [Canis familiaris] UF_Cf_12228 1.12 0.33 -0.70 -0.22 0.03 1.17 0.90 1.04 0.11 9.24 0.03 calcium-activated potassium channel beta 4 subunit [Meriones unguiculatus] UF_Cf_19290 -0.49 0.34 -0.94 -0.83 -0.61 1.40 2.43 1.92 -0.51 -3.78 0.04 Calcyphosine (Thyroid protein P24) (TPP) (Protein 5 [Canis familiaris] UF_Cf_15631 -0.42 -0.09 -0.04 0.07 0.11 0.47 0.60 0.54 -0.07 -7.23 0.02 calpain 1, large subunit; calpain, large polypeptide L1; calcium-activated neutral proteinase [Homo sapiens UF_Cf_14128 0.50 0.22 0.90 0.27 -0.05 -0.74 -0.79 -0.77 0.37 -2.08 0.03 calponin like transmembrane domain protein [Homo sapiens] UF_Cf_13871 -1.37 -1.05 -0.96 1.00 1.27 0.52 0.40 0.46 -0.22 -2.07 0.04 Canis familiaris vascular anastomotic upregulated protein mRNA, partial cds UF_Cf_16999 -0.09 -0.24 -0.04 -0.01 -0.08 -0.54 -0.37 -0.46 -0.09 4.95 0.05 CD44 antigen precursor (Phagocytic glycoprotein I) (PGP-1) [Canis familiaris] UF_Cf_15216 0.22 0.49 -0.23 0.03 0.13 -0.26 -0.38 -0.32 0.13 -2.50 0.04 cell adhesion molecule, neural [Bos taurus] UF_Cf_18695 -1.21 -0.31 -0.59 -0.10 0.48 -2.31 -2.29 -2.30 -0.35 6.65 0.01 chondroitin sulfate proteoglycan 4 [Mus musculus] UF_Cf_13051 -0.50 -0.15 1.10 0.60 -0.29 -2.50 -2.25 -2.38 0.15 -15.63 0.03 CocoaCrisp [Homo sapiens] UF_Cf_10845 0.84 1.00 0.11 0.00 -0.20 1.22 1.10 1.16 0.35 3.31 0.01 COG0587: DNA polymerase III, alpha subunit [Burkholderia fungorum] 67

PAGE 68

Table 3-3 : Continued Normal Beagle Dogs Glaucoma Beagle Dogs UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson Avg Glau Avg Non Ratio Probability Hit Definitions / Active Genes UF_Cf_13181 -0.62 0.39 0.99 0.01 0.32 -1.21 -0.84 -1.03 0.22 -4.70 0.04 COG0845: Membrane-fusion protein [Nostoc punctiforme] UF_Cf_12407 0.73 0.69 0.46 0.45 0.05 1.15 1.21 1.18 0.48 2.48 0.04 COG1033: Predicted exporters of the RND superfamily [Burkholderia fungorum] UF_Cf_17066 -0.21 -0.16 1.22 0.39 0.31 -1.17 -1.00 -1.09 0.31 -3.50 0.00 COG1305: Transglutaminase-like enzymes, putative cysteine proteases [Microbulbifer degradans 2-40] UF_Cf_14766 -0.18 -0.22 0.01 0.27 0.29 0.48 0.48 0.48 0.03 14.12 0.00 COG2219: Eukaryotic-type DNA primase, large subunit [Methanosarcina barkeri] UF_Cf_10276 -0.62 -0.30 0.10 -0.01 -0.09 0.44 0.57 0.51 -0.18 -2.74 0.02 Component of oligomeric golgi complex 1 [Mus musculus] UF_Cf_15801 0.05 -0.79 -0.20 0.41 0.40 -0.47 -0.53 -0.50 -0.03 19.23 0.00 DNA polymerase III, tau subunit, putative [Chlamydia muridarum] UF_Cf_12504 -0.30 0.13 -0.16 -0.03 -0.14 0.35 0.37 0.36 -0.10 -3.60 0.02 DNA-DIRECTED RNA POLYMERASE BETA' CHAIN [Plasmodium falciparum] UF_Cf_12161 0.00 -0.17 -0.46 -0.12 -0.18 -0.60 -0.48 -0.54 -0.19 2.90 0.03 DNA-directed RNA polymerase subunit A' [Methanosarcina mazei Goe1] UF_Cf_10209 -0.09 0.03 0.09 -0.04 -0.08 0.47 0.37 0.42 -0.02 -23.33 0.01 envelope glycoprotein [Simian-Human immunodeficiency virus] UF_Cf_14307 0.78 0.60 -0.39 0.02 -0.17 0.40 0.50 0.45 0.17 2.68 0.04 glycoprotein 150 [murid herpesvirus 4] UF_Cf_13331 0.08 -0.34 -1.15 0.07 0.17 0.93 0.93 0.93 -0.23 -3.97 0.00 glycoprotein Ib [Canis familiaris] UF_Cf_15935 -0.02 0.21 -1.22 -0.20 -0.21 0.54 0.64 0.59 -0.29 -2.05 0.00 glycoprotein precursor [Lassa virus] UF_Cf_15817 -2.53 -0.76 0.41 -0.09 -0.53 1.74 1.13 1.44 -0.70 -2.05 0.04 golgi membrane protein GP73 [Homo sapiens UF_Cf_11878 -0.58 -0.80 0.19 0.09 0.21 0.53 0.63 0.58 -0.18 -3.26 0.03 human immunodeficiency virus type I enhancer binding protein 2; human immunodeficiency virus type I enhancer-binding protein 2 [Homo sapiens]] UF_Cf_10393 0.18 0.00 0.36 -0.26 -0.36 0.19 0.05 0.12 -0.02 -7.50 0.04 hyaluronoglucosaminidase 4; hyaluronidase 4 [Homo sapiens] UF_Cf_15731 -0.55 -2.01 -0.69 1.17 1.11 0.47 0.33 0.40 -0.19 -2.06 0.01 lipoprotein lipase [Canis familiaris] UF_Cf_10095 -0.54 0.39 0.37 -0.02 0.32 -0.67 -0.93 -0.80 0.10 -7.69 0.05 low density lipoprotein B; low density lipoprotein receptor defect B complementing; conserved oligomeric Golgi complex protein 1 [Homo sapiens] UF_Cf_10185 0.38 0.46 0.37 -0.04 0.14 -0.66 -0.49 -0.58 0.26 -2.19 0.04 low molecular mass ubiquinone-binding protein (9.5kD) [Bos taurus] UF_Cf_11745 -0.58 -0.63 -2.03 0.21 -0.56 -2.86 -2.45 -2.66 -0.72 3.70 0.03 L-type calcium channel alpha-1c subunit [Rattus norvegicus] UF_Cf_11046 -0.44 -0.15 -0.06 0.01 0.03 0.27 0.26 0.27 -0.12 -2.17 0.00 mitochondrial carrier protein MGC4399 [Homo sapiens] UF_Cf_11708 1.02 0.43 0.11 0.24 0.01 0.89 0.69 0.79 0.36 2.18 0.05 mitochondrial NADH:ubiquinone oxidoreductase B14.7 [Bos taurus] UF_Cf_13315 -0.47 0.13 0.19 0.15 0.24 0.45 0.43 0.44 0.05 9.17 0.03 mitochondrial ribosomal protein S14 [Mus musculus] UF_Cf_15730 0.06 -0.09 -0.02 -0.15 -0.11 0.21 0.14 0.18 -0.06 -2.82 0.02 mitochondrial ribosomal protein S18C; mitochondrial ribosomal protein S18-1 [Homo sapiens] 68

PAGE 69

Table 3-3 : Continued Normal Beagle Dogs Glaucoma Beagle Dogs UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson Avg Glau Avg Non Ratio Probability Hit Definitions / Active Genes UF_Cf_11954 -1.11 0.80 0.54 0.32 -0.03 1.38 1.23 1.31 0.10 12.55 0.03 mucin glycoprotein [Homo sapiens] UF_Cf_12399 -0.08 0.13 -0.38 -0.08 -0.11 -0.33 -0.37 -0.35 -0.10 3.37 0.01 Myosin Ib (Myosin I alpha) (MMI-alpha) (MMIa) (MIH-L) UF_Cf_16152 -1.36 -1.80 -0.56 0.60 0.48 1.29 1.27 1.28 -0.53 -2.42 0.01 myosin regulatory light chain 2 human UF_Cf_11710 -0.35 0.13 -0.24 0.00 -0.10 -0.43 -0.43 -0.43 -0.11 3.84 0.02 nuclear receptor co-repressor [Homo sapiens] UF_Mm_19983 -0.25 0.05 0.02 0.13 -0.04 0.50 0.56 0.53 -0.02 -29.44 0.03 nuclear RNA export factor 1; tip associating protein; nuclear RNA export factor 1 (Mex67, yeast, homolog) [Homo sapiens] UF_Cf_11546 -0.27 0.24 -0.80 0.04 0.02 -0.82 -0.89 -0.86 -0.15 5.55 0.00 nucleolar phosphoprotein Nopp34 [Homo sapiens] UF_Cf_19677 0.04 0.33 0.34 0.24 0.25 0.66 0.73 0.70 0.24 2.90 0.01 orf 19 [Staphylococcus aureus prophage phiPV83] UF_Cf_15414 -0.83 -2.31 0.54 -0.25 -0.11 1.47 0.91 1.19 -0.59 -2.01 0.04 orf; hypothetical protein [Salmonella typhi] UF_Cf_15265 -0.66 0.76 -0.69 0.16 0.50 -0.46 -0.65 -0.56 0.01 -39.64 0.05 ORF2 [Canis familiaris] UF_Cf_10109 -0.29 -0.28 -0.18 0.00 0.25 -0.52 -0.55 -0.54 -0.10 5.35 0.03 ORF24 [Alcelaphine herpesvirus 1] UF_Cf_13593 0.40 0.43 0.26 0.20 0.05 -0.68 -0.69 -0.69 0.27 -2.56 0.01 orf274 [Euglena gracilis] UF_Cf_17364 0.82 -2.31 -0.64 0.97 1.01 0.04 0.22 0.13 -0.03 -4.33 0.01 orf296 [Podospora anserina] UF_Cf_18948 -1.16 -0.93 -0.81 -0.07 0.14 -1.50 -1.67 -1.59 -0.57 2.80 0.01 orf98 [Tetrahymena pyriformis] UF_Cf_14836 -0.21 0.02 1.94 -0.03 0.39 -1.06 -1.43 -1.25 0.42 -2.95 0.04 prostaglandin E2 receptor EP3A subtype [Canis familiaris] UF_Cf_13620 0.14 0.10 0.06 0.30 0.03 1.35 1.06 1.21 0.13 9.56 0.03 prostaglandin E2 receptor EP3B subtype [Canis familiaris] UF_Cf_13325 -1.31 -0.57 -0.11 0.37 -0.04 -1.61 -1.27 -1.44 -0.33 4.34 0.03 retinaldehyde binding protein 1; retinaldehyde-binding protein 1 [Mus musculus] UF_Cf_10691 -0.61 -0.57 0.37 0.02 0.21 -0.67 -0.55 -0.61 -0.12 5.26 0.02 stem-loop binding protein [Mus musculus] UF_Cf_18898 -1.10 -0.62 0.48 -0.16 0.13 -1.33 -1.38 -1.36 -0.25 5.33 0.01 sterol regulatory element binding protein-1 [Canis familiaris] UF_Cf_12694 -0.01 -0.10 -0.02 -0.01 0.03 0.51 0.56 0.54 -0.02 -24.32 0.00 stromal cell derived factor 4 [Rattus norvegicus] UF_Cf_14149 -0.27 -0.81 -0.29 0.52 0.31 -0.40 -0.32 -0.36 -0.11 3.33 0.02 succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa [Bos taurus] UF_Cf_10619 1.36 0.73 -0.93 -0.56 -0.44 0.96 0.80 0.88 0.03 27.50 0.01 T cell receptor beta chain hcvb4 [Canis familiaris] UF_Cf_15898 -0.27 0.00 -0.04 0.18 0.11 0.44 0.43 0.44 -0.00 -108.75 0.01 T-cell leukemia translocation altered gene [Homo sapiens] UF_Cf_14027 0.55 0.05 -0.03 0.03 0.03 -0.37 -0.50 -0.44 0.13 -3.45 0.02 uronyl-2-sulfotransferase; dermatan/chondroitin sulfate 2-sulfotransferase; uronyl 2-sulfotransferase [Homo sapiens] UF_Cf_14046 -0.02 0.09 0.64 0.00 -0.06 -0.80 -0.81 -0.81 0.13 -6.19 0.00 vascular endothelial growth factor B [Homo sapiens] UF_Cf_11361 -0.92 -0.32 -0.64 0.61 0.31 -0.55 -0.89 -0.72 -0.19 3.75 0.03 vir12 [Plasmodium vivax] UF_Cf_17158 0.69 -0.95 -0.36 -0.02 0.19 -0.54 -0.68 -0.61 -0.09 6.78 0.03 WD repeat-containing protein 3 [Homo sapiens] UF_Cf_11438 0.44 0.31 -0.18 0.12 0.08 0.51 0.38 0.45 0.15 2.89 0.04 Wim protein [Mus musculus] 69

PAGE 70

70 Table 3-3 : Continued Normal Beagle Dogs Glaucoma Beagle Dogs UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson Avg Glau Avg Non Ratio Probability Hit Definitions / Active Genes UF_Cf_13297 0.33 0.19 -0.24 0.14 0.14 1.49 1.51 1.50 0.11 13.39 0.00 Wolfram syndrome 1; Wolfram syndrome 1 (wolframin) [Rattus norvegicus] UF_Cf_14834 0.48 -0.42 -0.06 -0.25 -0.21 0.50 0.33 0.42 -0.09 -4.51 0.02 X-ray repair cross complementing protein 2; X-ray repair, complementing defective, repair in Chinese hamster; DNA repair protein XRCC2 [Homo sapiens] UF_Cf_18469 -1.02 0.89 0.68 0.66 0.86 1.62 1.54 1.58 0.41 3.82 0.02 zinc finger protein 140 (clone pHZ-39) [Homo sapiens] UF_Mm_20096 0.59 0.80 0.00 -0.22 -0.20 -0.42 -0.45 -0.44 0.19 -2.24 0.01 Zinc finger protein 397 >gi|28901622|gb|AAM95991.2| zinc finger protein [Homo sapiens] UF_Cf_15064 -0.45 -0.67 -0.51 0.04 0.14 -0.61 -0.66 -0.64 -0.29 2.19 0.01 zinc finger protein 445; zinc finger protein 168 [Homo sapiens] UF_Cf_13933 0.03 0.75 1.01 0.04 0.00 1.01 1.43 1.22 0.37 3.33 0.03 zinc finger, DHHC domain containing 4 [Homo sapiens] UF_Cf_15249 -0.78 0.88 0.58 -0.17 -0.03 -1.05 -1.01 -1.03 0.10 -10.73 0.01 ZONA PELLUCIDA SPERM-BINDING PROTEIN 3 PRECURSOR

PAGE 71

Figure 3-1: Region of Canine Chromosome 7 containing MYOC. The 1451 bp dog MYOC cDNA sequence is shown underlined. Red Exon 1, Green Exon 2, Blue Exon3. Green highlighting represents start primers used to piece the gene together. Blue highlighting represents end primers. 71

PAGE 72

Figure 3-2: Western blot of aqueous humor samples from beagles with primary open angle glaucoma with human myocilin control. Box shows typical primary band. Figure 3-3: Comassie gel strips from aqueous humor of mildly affected glaucoma beagles over time. The darkest band is approximately 57 kDa. 72

PAGE 73

Figure 3-4: Comassie gel strips from aqueous humor of moderately affected glaucoma beagles over time. The darkest/ largest band centers at approximately 57 kDa. 73

PAGE 74

Figure 3-5: Comassie gel strips from aqueous humor of advanced glaucoma beagles over time. The darkest/ largest band centers at approximately 57 kDa. 74

PAGE 75

Figure 3-6 : Samples 193 through 206, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control. 75

PAGE 76

Figure 3-7 : Samples 260 through 272, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control. 76

PAGE 77

Figure 3-8 : Samples 312 through 325, examples of Comassie staining of aqueous humor. 1=primary glaucoma, 2=secondary glaucoma, C=cataract, D=diabetic cataract, L=ladder, M=myocilin control. 77

PAGE 78

Figure 3-9: Overall view of iridocorneal angle (ICA) of a normal 1.5 yr. old (X100) beagle. Normal myocilin localization is observed in the Irido-Corneal Angle (ICA). Iris (I). 78

PAGE 79

Figure 3-10: Overall view of irideocorneal angle (ICA) of a glaucomatous 6 yr. old beagle (X200). Increased myocilin localization is observed in the ICA (arrow) of the glaucomatous canine. 79

PAGE 80

Figure 3-11: Positive staining in the corneal epithelium (solid arrows) and stroma of a normal beagle (X200). 80

PAGE 81

Figure 3-12: Positive staining in the corneal epithelium (arrow) and stroma of a glaucomatous cocker spaniel (X200). 81

PAGE 82

Figure 3-13: Positive myocilin localization in corneal endothelium (arrow) of a preglaucomatous 3 mo. old beagle (X200). 82

PAGE 83

Figure 3-14: Localization in the sphincter (S) and dilator (D) muscles of the iris of a normal 1.5 yr. old beagle (X200). 83

PAGE 84

Figure 3-15: Localization in the sphincter (S) and dilator (D) muscles of the iris of a 10 year old glaucomatous beagle (X200). 84

PAGE 85

Figure 3-16: Myocilin localization along the cell membranes of the ciliary body musculature of a 3 mo. old normal beagle (X200). 85

PAGE 86

Figure 3-17: Myocilin localization along the cell membranes of the ciliary body musculature of a 1.5 yr. old normal beagle (X1000). 86

PAGE 87

Figure 3-18: Positive myocilin localization in the trabecular meshwork cells of a 7 yr. old glaucomatous beagle (X1000). 87

PAGE 88

Figure 3-19: Positive myocilin localization in the outer sclera of a 13 yr. old glaucomatous cocker spaniel (X400). 88

PAGE 89

Figure 3-20: Positive myocilin localization in the vascular smooth muscle cells (arrows) within the sclera (S) of an 8 yr. old glaucomatous cocker spaniel (X400). 89

PAGE 90

Figure 3-21: Intense myocilin labeling within the nonpigmented epithelium (Blue arrow) of the ciliary processes, and vitreal membrane-like material (Green arrow) of a 6 yr. old glaucomatous beagle (X200). 90

PAGE 91

Figure 3-22: Detail of Figure 3-13. Intense myocilin labeling within the nonpigmented epithelium of the ciliary processes of a 6 yr. old glaucomatous beagle (X400). 91

PAGE 92

Figure 3-23: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 92

PAGE 93

Figure 3-24: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 93

PAGE 94

Figure 3-25: Trabecular meshwork cell of a 1.5 year old normal walker hound. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 94

PAGE 95

Figure 3-26: Extracellular matrix (ECM) or the trabecular meshwork of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 95

PAGE 96

Figure 3-27: Nonpigmented epithelium of the ciliary body of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 96

PAGE 97

Figure 3-28: Vitreal membrane-like material within the posterior chamber of a 10 year old beagle with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black arrows). 97

PAGE 98

CHAPTER 4 DISCUSSION The inherited glaucomas certainly have many causes. Myocilin is still one of the only gene/protein products clearly linked to glaucoma. The exact role of the myocilin protein is still not well defined and probably involves multiple functions (Gould et al., 2004). The association of the gene and its mutations to several different forms of early and late onset POAG in man continues to be strengthened (Tamm et al., 2001; Clark et al., 2001). New views of the trabecular meshwork encourage us to look increasingly at myocilin for regulatory problems in addition to typical mutations (Alvarado et al., 2005). Like many forms of POAG in man, POAG in the beagle is also demonstrated to have elevated myocilin within the aqueous humor and ocular tissues. A definite correlation can be made between the severity of glaucoma in both the human and canine eye and the amount of myocilin in the aqueous humor, and increase of myocilin found in the iridocorneal angle (Alward et al., 1998; Colomb et al., 2001; Fan et al., 2004). The presence of such a great amount of free myocilin in the aqueous humor could be indicative of an increase in the production of myocilin, from a change in mechanical or oxidative stress, or the lack of sufficient outflow of the myocilin (Aroca-Aguilar et al., 2005). Myocilin exists both intraand extra-cellularly, and has both glycosylated and nonoglycosylated forms (with molecular weights of approximately 66 kd and 55 kd respectively) (Caballero et al., 2001). In addition to its leucine zipper region, myocilin has multiple sites for glycosylation and phosphorylation, presumed binding sites for hyaluronic acid and heparin (which has been reported in the dog trabecular meshwork), and a signal sequence of 32 amino acids usually found in molecules secreted extracellularly. When extracellular, myocilin may bind 98

PAGE 99

to other extracellular molecules or to the cell membrane of the trabecular cells and influence aqueous outflow resistance. As a sticky molecule, myocilin has binding sites for several components of the basement membrane. The low amount of visible myocilin in the normal and mildly affected beagles demonstrates that myocilin is a normal aqueous humor protein in the dog. No differences between either age or gender were observed in these normal dogs. Obtaining a baseline, normal level of myocilin may be a step towards a future early test for glaucoma. The advanced glaucoma beagles showed a large increase in the amount of free myocilin. Although no mutation was found in the myocilin gene in the dogs from the colony tested, this higher level still links myocilin to glaucoma. The significant increase in myocilin may be related to errors in the post-transcriptional or post-translational processing of the myocilin in these dogs, or errors in the trabecular meshwork in the removal of aqueous humor and myocilin. These alterations could impair dynamics of the removal of myocilin, possibly having a binding effect to extracellular components such as hyaluronic acid or the basal laminae of trabecular meshwork cells. The inability of the myocilin-bound components to degrade properly would result in its accumulation the eye of individuals with POAG causing a rise in intraocular pressure and further development of the disease. This study supports the hypothesis that changes in the level or activity of myocilin within the aqueous humor outflow pathway of beagles with POAG are associated with the rise of intraocular pressure and subsequent development of the disease. This is the first study in which the analysis of the myocilin gene, the myocilin protein and the localization of myocilin in the normal and glaucomatous canine eye was successful and observed by multiple techniques. 99

PAGE 100

Myocilin has been localized in human normal and POAG trabecular meshwork (Lutjen-Drecoll et al., 1998; Tawara et al., 2000; Ueda et al., 2003; Clark et al., 2001). Myocilin appeared to be localized to the long-spacing collagens and the surrounding sheath of elastic-like fibers, interacting with microfibril-associated elements and codistributed with fibronectin, fibrillin-1, MAGP-1, decorin, and type VI collagen (Ueda et al., 2003). Myocilin, as a protein, occurs not only in the ocular tissues, but has also been reported in heart, skeletal muscle, bone marrow, lung, stomach, thyroid, prostate, pancreas, kidney, intestine, and lymph node (Tamm et al., 2001; Shepard et al., 2003). Previous myocilin immunolocalization studies have been reported in humans (Karali et al., 2000, Lutgen-Drescoll et al., 1998; Tavara et al., 2000). In this study, myocilin localization in the normal, moderately glaucomatous, and advanced glaucomatous canine eye, was nearly identical to localization previously reported in the normal human eye. The localization of myocilin in the trabecular meshwork of the iridocorneal angle of the glaucomatous dog was much greater than that of a normal animal. In the nonpigmented epithelium of the ciliary processes localization of myocilin was unevenly distributed and stained with significantly greater intensity than that of normal ocular tissue. There was strong localization in the stroma of the ciliary processes in severe POAG, which is absent in normal and less severe POAG ocular tissue. This leads us to believe the non-pigmented epithelium of the ciliary body may be highly underrated in its importance in function for regulation of IOP. Generalized staining was observed in the stratified corneal epithelium of the normal eye, while in the severe glaucomatous eye, basal corneal cells stained most intensely. It was interesting to note the higher free myocilin levels in the aqueous humor coincided well to the changes noted in the intracellular myocilin in the 100

PAGE 101

immunolocalization study. Further work on the post-transcriptional and post-translational processing of the myocilin may allow more insight into this relationship. The data gathered from the DNA chip microarrays is potentially exciting. The relatively low amount of myocilin in both normal and advanced glaucomatous dogs (compared to protein increase) reported by the chip analysis make us wonder about the hybridization efficiency of the probes on the chip. Is there just enough evolutionary change between dog and the human and bovine probes on the chip that perhaps they dont hybridize robustly? A small increase in the production of mRNA for the myocilin protein was still observed based on the bovine myocilin probe. A nearly two-fold increase in mRNA would not be expected to cause the large increase in protein. However, there is increased protein stability or decreased protein turnover. The significance of this is unknown, but could support a theory that a promoter mutation could increase MYOC RNA and this increase in protein alone overwhelms the protein turnover system, or there are other factors involved. Certainly the protein data are more convincing than the RNA data, which could be wrong given lack of a canine probe. More important to future research is the large number of other genes and markers that were significantly different between the normal and glaucomatous beagles at least in the advanced stages of the disease (Table 3-3). These could be validated by real-time PCR, and legitimate results followed with protein studies or analysis of gene sequences. When looking at differences in clinical samples and multiple breeds of dogs, myocilin again seems to be significant. Of the 353 dogs analyzed there was no significant difference between ages, genders or breeds. We chose to utilize cataractous dogs as our non-glaucomatous controls for multiple reasons: ease of collection during scheduled cataract surgeries, the large number of available samples, and the avoidance of procedures on otherwise healthy dogs. Later, 101

PAGE 102

we decided to separate diabetic cataract cases from primary cataract cases in case of other diabetes-related changes. In advanced cases of primary (spontaneous) and secondary canine glaucomas, some dramatic differences were observed. Of greatest significance was a substantial increase in levels of secreted myocilin in the aqueous humor. Up to a ten-fold increase in myocilin is of clinical and research interest. In this study 118 primary glaucoma and 64 secondary glaucoma dogs were analyzed. Most of these dogs had higher than normal levels of free myocilin, similar to the POAG beagles. This may indicate aqueous humor myocilin levels are elevated in response rather than causing the initial ocular hypertension. Later analysis of other proteins in these dogs indicated that there was also an increased amount of CD-44 protein in these aqueous samples (Kallberg et al., 2006). The alignment of Western blot bands of myocilin and CD-44 indicated there may be a strong correlation for a complex between the two proteins. This could be tested using immunoprecipitation approaches. Levels in cataractous dogs were much lower for the myocilin and CD-44 (Kallberg et al., 2006). This study also supports the original hypothesis that there is an increase of myocilin in both accumulation and localization in glaucomatous canine eyes. With further study, improved therapeutic strategies may be developed to treat glaucoma by altering the trabecular meshwork cells and decreasing aqueous outflow resistance (Borras et al., 2002; Borras 2003). The presentation of advanced POAG in clinical patients is very similar to advanced primary angle closure glaucoma (PACG) (Aung et al., 2005). This may prove to have some effect on changes in the myocilin levels between some of the primary glaucoma groups. With the knowledge collected here, screening and genetic testing may soon be a reality for both dogs and man (Harasymowycz et al., 2005; Mackey et al., 2003). A simple way to check for the onset of glaucoma, before any damage or loss of vision takes place would be desirable. A 102

PAGE 103

genetic pre-disposition would be interesting to test for with a blood sample or buccal swab. Or perhaps a slightly more invasive test to check for free myocilin in the aqueous humor or a fast test of corneal anterior epithelium may be of help some day. Dexamethasone treatment, oxidative stress, stretching, and treatment with a transforming growth factor in culture human anterior segments and monolayer culture trabecular cells increase myocilin levels. Dexamethasone treatment on beagles can increase IOP in under a week (Gelatt et al., 1998). Perfusion studies have been performed in man recently, but further study into these areas with animal models and POAG beagles are needed (Goldwich et al., 2003; Fautsch et al., 2006; Sakai et al., 2006). We reported myocilin in the aqueous humor of normal dogs and elevations of aqueous myocilin in the beagles with POAG in 2004 (MacKay et al., 2004). In that same report normal and glaucoma eye tissues were immunolabeled with the same rabbit anti-myocilin polyclonal antibody and the myocilin tissue levels paralleled the aqueous humor levels with the glaucomatous trabecular meshwork and ciliary body nonpigmented epithelium demonstrating the highest levels in the glaucoma eyes. Subsequent light, confocal and electron microscopy studies in 2004-05 of both normal and glaucomatous beagle eyes at different stages of the disease have confirmed these initial observations (Samuelson et al., 2005; Kallberg et al., 2006; MacKay et al., 2004). In the normal, mild, and moderate glaucomatous beagle eye, immunolabeling of myocilin occurred and the protein was homogeneously distributed within the ocular tissues. Immunolabelling of advanced glaucoma eyes revealed increased aggregation and staining in the iridocorneal angle, nonpigmented epithelium of the ciliary body processes, and anterior cornea. The confocal and electron microscopy results demonstrated the myocilin was in the apically 103

PAGE 104

positioned vesicles in the nonpigmented epithelium, in melanocytes and adhering to the surface of individual melanosomes. In summary, aqueous myocilin levels in POAG beagles were significantly increased in moderate and severe glaucomatous eyes with three discreet bands often seen. Mild and normal beagles demonstrated myocilin present at much lower levels. Myocilin was found intracellularly in greater amounts and in more tissues in glaucomatous beagles versus normal beagles, including the non-pigmented epithelium of the ciliary body. In other breeds, myocilin levels were shown to be higher in primary and secondary glaucomatous dogs versus non-glaucomatous (cataractous and diabetic cataractous) dogs. No significant differences were seen between genders or ages. The only breed differences seen were related to the number of samples received for each breed, which may be related to incidence in the population. My hypothesis for the presence of a mutation in the myocilin region of the inherited glaucomatous beagle DNA has been proven false thus far. Typical mutations were ruled out. The idea that myocilin protein would be found in greater quantities in glaucomatous dogs has been proven true. Both the advanced glaucomatous beagles and the glaucomatous clinical aqueous humor samples were shown to have greater concentrations of myocilin than mild glaucomatous and normal animal samples. The hypothesis of a greater presence of myocilin intracellularly was also proven true. Additionally, other cell groups were shown to exhibit the presence of myocilin as well. These studies suggest similar pathways may be involved in the canine primary or breed-related glaucomas, and additional studies need to focus on the promoter regions of the myocilin gene that may be 'upstream' from the protein encoding DNA sequence, perfusion studies to link cause and effect issues, and other proteins and their interactions in the aqueous humor. 104

PAGE 105

LIST OF REFERENCES Abderrahim H, Jaramillo-Babb VL, Zhou Z, Vollrath D. Characterization of the murine TIGR/myocilin gene. Mamm Genome. 1998 Aug;9(8):673-5. Abe T, Tomita H, Ohashi T, Yamada K, Takeda Y, Akaishi K, Yoshida M, Sato M, Tamai M. Characterization of iris pigment epithelial cell for auto cell transplantation. Cell Transplant. 1999 Sep-Oct;8(5):501-10. Abecia E, Martinez-Jarreta B, Casalod Y, Bell B, Pinilla I, Honrubia FM. Genetic markers in primary open-angle glaucoma. Int Ophthalmol. 1996-1997;20(1-3):79-82. Acharya M, Mitra S, Mukhopadhyay A, Khan M, Roychoudhury S, Ray K. Distribution of p53 codon 72 polymorphism in Indian primary open angle glaucoma patients. Mol Vis. 2002 Sep 30;8:367-71. Adam MF, Belmouden A, Binisti P, Brezin AP, Valtot F, Bechetoille A, Dascotte JC, Copin B, Gomez L, Chaventre A, Bach JF, Garchon HJ. Recurrent mutations in a single exon encoding the evolutionarily conserved olfactomedin-homology domain of TIGR in familial open-angle glaucoma. Hum Mol Genet. 1997 Nov;6(12):2091-7. Ahmed F, Brown KM, Stephan DA, Morrison JC, Johnson EC, Tomarev SI. Microarray analysis of changes in mRNA levels in the rat retina after experimental elevation of intraocular pressure. Invest Ophthalmol Vis Sci. 2004 Apr;45(4):1247-58. Ahmed F, Torrado M, Johnson E, Morrison J, Tomarev SI. Changes in mRNA levels of the Myoc/Tigr gene in the rat eye after experimental elevation of intraocular pressure or optic nerve transection. Invest Ophthalmol Vis Sci. 2001 Dec;42(13):3165-72. Ahmed F, Torrado M, Zinovieva RD, Senatorov VV, Wistow G, Tomarev SI. Gene expression profile of the rat eye iridocorneal angle: NEIBank expressed sequence tag analysis. Invest Ophthalmol Vis Sci. 2004 Sep;45(9):3081-90. Aldred MA, Baumber L, Hill A, Schwalbe EC, Goh K, Karwatowski W, Trembath RC. Low prevalence of MYOC mutations in UK primary open-angle glaucoma patients limits the utility of genetic testing. Hum Genet. 2004 Oct;115(5):428-31. Allingham RR, Wiggs JL, De La Paz MA, Vollrath D, Tallett DA, Broomer B, Jones KH, Del Bono EA, Kern J, Patterson K, Haines JL, Pericak-Vance MA. Gln368STOP myocilin mutation in families with late-onset primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 1998 Nov;39(12):2288-95. Alvarado JA, Alvarado RG, Yeh RF, Franse-Carman L, Marcellino GR, Brownstein MJ. A new insight into the cellular regulation of aqueous outflow: how trabecular meshwork endothelial cells drive a mechanism that regulates the permeability of Schlemm's canal endothelial cells. Br J Ophthalmol. 2005 Nov;89(11):1500-5. 105

PAGE 106

Alward WL, Fingert JH, Coote MA, Johnson AT, Lerner SF, Junqua D, Durcan FJ, McCartney PJ, Mackey DA, Sheffield VC, Stone EM. Clinical features associated with mutations in the chromosome 1 open-angle glaucoma gene (GLC1A) N Engl J Med. 1998 Apr 9;338(15):1022-7. Alward WL, Kwon YH, Kawase K, Craig JE, Hayreh SS, Johnson AT, Khanna CL, Yamamoto T, Mackey DA, Roos BR, Affatigato LM, Sheffield VC, Stone EM. Evaluation of optineurin sequence variations in 1,048 patients with open-angle glaucoma. Am J Ophthalmol. 2003 Nov;136(5):904-10. Alward WL, Kwon YH, Khanna CL, Johnson AT, Hayreh SS, Zimmerman MB, Narkiewicz J, Andorf JL, Moore PA, Fingert JH, Sheffield VC, Stone EM. Variations in the myocilin gene in patients with open-angle glaucoma. Arch Ophthalmol. 2002 Sep;120(9):1189-97. Alward WL. The genetics of open-angle glaucoma: the story of GLC1A and myocilin. Eye. 2000 Jun;14 ( Pt 3B):429-36. Alward WL. The OPA1 gene and optic neuropathy. Br J Ophthalmol. 2003 Jan;87(1):2-3. Andersen JS, Pralea AM, DelBono EA, Haines JL, Gorin MB, Schuman JS, Mattox CG, Wiggs JL. A gene responsible for the pigment dispersion syndrome maps to chromosome 7q35-q36. Arch Ophthalmol. 1997 Mar;115(3):384-8. Anderson KL, Lewis RA, Bejjani BA, Baird L, Otterud B, Tomey KF, Astle WF, Dueker DK, Leppert M, Lupski JR. A gene for primary congenital glaucoma is not linked to the locus on chromosome 1q for autosomal dominant juvenile-onset open angle glaucoma. J Glaucoma. 1996 Dec;5(6):416-21. Anderson MG, Smith RS, Hawes NL, Zabaleta A, Chang B, Wiggs JL, John SW. Mutations in genes encoding melanosomal proteins cause pigmentary glaucoma in DBA/2J mice. Nat Genet. 2002 Jan;30(1):81-5. Angius A, De Gioia E, Loi A, Fossarello M, Sole G, Orzalesi N, Grignolo F, Cao A, Pirastu M. A novel mutation in the GLC1A gene causes juvenile open-angle glaucoma in 4 families from the Italian region of Puglia. Arch Ophthalmol. 1998 Jun;116(6):793-7. Angius A, Pisano M, Sanca A, Casu G, Persico I, Pitzalis S, De Gioia E, Grignolo FM, Loi A, Sole G, Cao A, Spinelli P, Ghillotti G, Bonomi L, Fossarello M, Serra A, Gandolfi S, Alberti G, Maraini G, Serru A, Orzalesi N, Pirastu M. Molecular basis of open-angle glaucoma in Italy. Acta Ophthalmol Scand Suppl. 1998;(227):16-7. Angius A, Spinelli P, Ghilotti G, Casu G, Sole G, Loi A, Totaro A, Zelante L, Gasparini P, Orzalesi N, Pirastu M, Bonomi L. Myocilin Gln368stop mutation and advanced age as risk factors for late-onset primary open-angle glaucoma. Arch Ophthalmol. 2000 May;118(5):674-9. Armaly MF, Monstavicius BF, Sayegh RE. Ocular pressure and aqueous outflow facility in siblings. Arch Ophthalmol. 1968 Sep;80(3):354-60. 106

PAGE 107

Aroca-Aguilar JD, Sanchez-Sanchez F, Ghosh S, Coca-Prados M, Escribano J. Myocilin mutations causing glaucoma inhibit the intracellular endoproteolytic cleavage of myocilin between amino acids Arg226 and Ile227. J Biol Chem. 2005 Jun 3;280(22):21043-51. Aung T, Ocaka L, Ebenezer ND, Morris AG, Krawczak M, Thiselton DL, Alexander C, Votruba M, Brice G, Child AH, Francis PJ, Hitchings RA, Lehmann OJ, Bhattacharya SS. A major marker for normal tension glaucoma: association with polymorphisms in the OPA1 gene. Hum Genet. 2002 Jan;110(1):52-6. Aung T, Okada K, Poinoosawmy D, Membrey L, Brice G, Child AH, Bhattacharya SS, Lehmann OJ, Garway-Heath DF, Hitchings RA. The phenotype of normal tension glaucoma patients with and without OPA1 polymorphisms. Br J Ophthalmol. 2003 Feb;87(2):149-52. Aung T, Yong VH, Chew PT, Seah SK, Gazzard G, Foster PJ, Vithana EN. Molecular analysis of the myocilin gene in Chinese subjects with chronic primary-angle closure glaucoma. Invest Ophthalmol Vis Sci. 2005 Apr;46(4):1303-6. Avramopoulos D, Kitsos G, Economou-Petersen E, Grigoriadou M, Vassilopoulos D, Papageorgiou C, Psilas K, Petersen MB. Exclusion of one pedigree affected by adult onset primary open angle glaucoma from linkage to the juvenile glaucoma locus on chromosome 1q21-q31. J Med Genet. 1996 Dec;33(12):1043-4. Baird PN, Dickinson J, Craig JE, Mackey DA. The Taa1 restriction enzyme provides a simple means to identify the Q368STOP mutation of the myocilin gene in primary open angle glaucoma. Am J Ophthalmol. 2001 Apr;131(4):510-1. Baird PN, Foote SJ, Mackey DA, Craig J, Speed TP, Bureau A. Evidence for a novel glaucoma locus at chromosome 3p21-22. Hum Genet. 2005 Jul;117(2-3):249-57. Baulmann DC, Ohlmann A, Flugel-Koch C, Goswami S, Cvekl A, Tamm ER. Pax6 heterozygous eyes show defects in chamber angle differentiation that are associated with a wide spectrum of other anterior eye segment abnormalities. Mech Dev. 2002 Oct;118(1-2):3-17. Becker B. Chemical composition of human aqueous humor; effects of acetazoleamide. AMA Arch Ophthalmol. 1957 Jun;57(6):793-800. Belmouden A, Adam MF, Dupont de Dinechin S, Brezin AP, Rigault P, Chumakov I, Bach JF, Garchon HJ. Recombinational and physical mapping of the locus for primary open-angle glaucoma (GLC1A) on chromosome 1q23-q25. Genomics. 1997 Feb 1;39(3):348-58. Booth A, Churchill A, Anwar R, Menage M, Markham A. The genetics of primary open angle glaucoma. Br J Ophthalmol. 1997 May;81(5):409-14. Booth A, Nguyen T, Polansky J. TIGR and stretch in the trabecular meshwork. Invest Ophthalmol Vis Sci. 1999 Jul;40(8):1888-9. 107

PAGE 108

Booth AP, Anwar R, Chen H, Churchill AJ, Jay J, Polansky J, Nguyen T, Markham AF. Genetic screening in a large family with juvenile onset primary open angle glaucoma. Br J Ophthalmol. 2000 Jul;84(7):722-6. Borges AS, Susanna R Jr, Carani JC, Betinjane AJ, Alward WL, Stone EM, Sheffield VC, Nishimura DY. Genetic analysis of PITX2 and FOXC1 in Rieger Syndrome patients from Brazil. J Glaucoma. 2002 Feb;11(1):51-6. Borras T, Morozova TV, Heinsohn SL, Lyman RF, Mackay TF, Anholt RR. Transcription profiling in Drosophila eyes that overexpress the human glaucoma-associated trabecular meshwork-inducible glucocorticoid response protein/myocilin (TIGR/MYOC). Genetics. 2003 Feb;163(2):637-45. Borras T, Rowlette LL, Tamm ER, Gottanka J, Epstein DL. Effects of elevated intraocular pressure on outflow facility and TIGR/MYOC expression in perfused human anterior segments. Invest Ophthalmol Vis Sci. 2002 Jan;43(1):33-40. Borras T. Gene expression in the trabecular meshwork and the influence of intraocular pressure. Prog Retin Eye Res. 2003 Jul;22(4):435-63. Brezin AP, Adam MF, Belmouden A, Lureau MA, Chaventre A, Copin B, Gomez L, De Dinechin SD, Berkani M, Valtot F, Rouland JF, Dascotte JC, Bach JF, Garchon HJ. Founder effect in GLC1A-linked familial open-angle glaucoma in Northern France. Am J Med Genet. 1998 Apr 13;76(5):438-45. Brezin AP, Bechetoille A, Hamard P, Valtot F, Berkani M, Belmouden A, Adam MF, Dupont de Dinechin S, Bach JF, Garchon HJ. Genetic heterogeneity of primary open angle glaucoma and ocular hypertension: linkage to GLC1A associated with an increased risk of severe glaucomatous optic neuropathy. J Med Genet. 1997 Jul;34(7):546-52. Brinkman JF, Ottenheim CP, de Jong LA, Zegers RH, de Smet MD, de Jong PT, Bergen AA. VAMP5 and VAMP8 are most likely not involved in primary open-angle glaucoma. Mol Vis. 2005 Aug 4;11:582-6. Brooks BP, Moroi SE, Downs CA, Wiltse S, Othman MI, Semina EV, Richards JE. A novel mutation in the PITX2 gene in a family with Axenfeld-Rieger syndrome. Ophthalmic Genet. 2004 Mar;25(1):57-62. Broughton WL, Rosenbaum KN, Beauchamp GR. Congenital glaucoma and other ocular abnormalities associated with pericentric inversion of chromosome 11. Arch Ophthalmol. 1983 Apr;101(4):594-7. Bruttini M, Longo I, Frezzotti P, Ciappetta R, Randazzo A, Orzalesi N, Fumagalli E, Caporossi A, Frezzotti R, Renieri A. Mutations in the myocilin gene in families with primary open-angle glaucoma and juvenile open-angle glaucoma. Arch Ophthalmol. 2003 Jul;121(7):1034-8. 108

PAGE 109

Budde WM. Heredity in primary open-angle glaucoma. Curr Opin Ophthalmol. 2000 Apr;11(2):101-6. Bunce C, Hitchings RA, Bhattacharya SS, Lehmann OJ. Single-nucleotide polymorphisms and glaucoma severity. Am J Hum Genet. 2003 Jun;72(6):1593-4; author reply 1594-5. Caballero M, Borras T. Inefficient processing of an olfactomedin-deficient myocilin mutant: potential physiological relevance to glaucoma. Biochem Biophys Res Commun. 2001 Apr 6;282(3):662-70. Caballero M, Rowlette LL, Borras T. Altered secretion of a TIGR/MYOC mutant lacking the olfactomedin domain. Biochim Biophys Acta. 2000 Nov 15;1502(3):447-60. Cagainut B. Zum Na-gehalt der vorderkammer beim menschen. Documenta Ophthal. 1957 11:173-181. Cardia L, Coriglione G. Le glicoproteine dell umore acqueo umano in condizioni normali e patologiche. G Ital Oftal. 1962 15:24-28. Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial dysfunction as a cause of optic neuropathies. Prog Retin Eye Res. 2004 Jan;23(1):53-89. Chakrabarti S, Kaur K, Komatireddy S, Acharya M, Devi KR, Mukhopadhyay A, Mandal AK, Hasnain SE, Chandrasekhar G, Thomas R, Ray K. Gln48His is the prevalent myocilin mutation in primary open angle and primary congenital glaucoma phenotypes in India. Mol Vis. 2005 Feb 4;11:111-3. Challa P, Herndon LW, Hauser MA, Broomer BW, Pericak-Vance MA, Ababio-Danso B, Allingham RR. Prevalence of myocilin mutations in adults with primary open-angle glaucoma in Ghana, West Africa. J Glaucoma. 2002 Oct;11(5):416-20. Challoner PB, Amin AA, Pearlman RE, Blackburn EH. Conserved arrangements of repeated DNA sequences in nontranscribed spacers of ciliate ribosomal RNA genes: evidence for molecular coevolution. Nucleic Acids Res. 1985 Apr 11;13(7):2661-80. Chapman SA, Bonshek RE, Stoddart RW, O'Donoghue E, Goodall K, McLeod D. Glycans of the trabecular meshwork in primary open angle glaucoma. Br J Ophthalmol. 1996 May;80(5):435-44. Chen PP. Risk and risk factors for blindness from glaucoma. Curr Opin Ophthalmol. 2004 Apr;15(2):107-11. Clark AF, Kawase K, English-Wright S, Lane D, Steely HT, Yamamoto T, Kitazawa Y, Kwon YH, Fingert JH, Swiderski RE, Mullins RF, Hageman GS, Alward WL, Sheffield VC, Stone EM. Expression of the glaucoma gene myocilin (MYOC) in the human optic nerve head. FASEB J. 2001 May;15(7):1251-3. 109

PAGE 110

Clark AF, Steely HT, Dickerson JE Jr, English-Wright S, Stropki K, McCartney MD, Jacobson N, Shepard AR, Clark JI, Matsushima H, Peskind ER, Leverenz JB, Wilkinson CW, Swiderski RE, Fingert JH, Sheffield VC, Stone EM. Glucocorticoid induction of the glaucoma gene MYOC in human and monkey trabecular meshwork cells and tissues. Invest Ophthalmol Vis Sci. 2001 Jul;42(8):1769-80. Clepet C, Dauwerse HJ, Desmaze C, van Ommen GJ, Weissenbach J, Morissette J. A 10-cM YAC contig spanning GLC1A, the primary open-angle glaucoma locus at 1q23-q25. Eur J Hum Genet. 1996;4(5):250-9. Coca-Prados M, Escribano J, Ortego J. Differential gene expression in the human ciliary epithelium. Prog Retin Eye Res. 1999 May;18(3):403-29. Cole DF. Chapter 2: Comparative aspects of the intraocular fluids. The Eye ed. Hugh Davson. 1974. Colomb E, Nguyen TD, Bechetoille A, Dascotte JC, Valtot F, Brezin AP, Berkani M, Copin B, Gomez L, Polansky JR, Garchon HJ. Association of a single nucleotide polymorphism in the TIGR/MYOCILIN gene promoter with the severity of primary open-angle glaucoma. Clin Genet. 2001 Sep;60(3):220-5. Cotton P. Glaucoma gene mapped to chromosome 1. JAMA. 1993 Jun 2;269(21):2715. Craig JE, Baird PN, Healey DL, McNaught AI, McCartney PJ, Rait JL, Dickinson JL, Roe L, Fingert JH, Stone EM, Mackey DA. Evidence for genetic heterogeneity within eight glaucoma families, with the GLC1A Gln368STOP mutation being an important phenotypic modifier. Ophthalmology. 2001 Sep;108(9):1607-20. Danielson PE, Forss-Petter S, Battenberg EL, deLecea L, Bloom FE, Sutcliffe JG. Four structurally distinct neuron-specific olfactomedin-related glycoproteins produced by differential promoter utilization and alternative mRNA splicing from a single gene. J Neurosci Res. 1994 Jul 1;38(4):468-78. Datson NA, Semina E, van Staalduinen AA, Dauwerse HG, Meershoek EJ, Heus JJ, Frants RR, den Dunnen JT, Murray JC, van Ommen GJ. Closing in on the Rieger syndrome gene on 4q25: mapping translocation breakpoints within a 50-kb region. Am J Hum Genet. 1996 Dec;59(6):1297-305. Dawson WW, Brooks DE, Dawson JC, Sherwood MB, Kessler MJ, Garcia A. Signs of glaucoma in rhesus monkeys from a restricted gene pool. J Glaucoma. 1998 Oct;7(5):343-8. De Bernardinis E, de Tieri O, Polzella A, Iuglio N. The chemical composition of the human aqueous humour in normal and pathological conditions. Expl Eye Res. 1965 4:179-186. de Vasconcellos JP, de Melo MB, Schimiti R, Costa FF, Costa VP. Penetrance and phenotype of the Cys433Arg myocilin mutation in a family pedigree with primary open-angle glaucoma. J Glaucoma. 2003 Apr;12(2):104-7. 110

PAGE 111

Deeb SS, Kohl S. Genetics of color vision deficiencies. Dev Ophthalmol. 2003;37:170-87. Demenais F, Bonaiti C, Briard ML, Feingold J, Frezal J. Congenital glaucoma: genetic models. Hum Genet. 1979 Feb 15;46(3):305-17. Demenais F. Further analysis of familial transmission of congenital glaucoma. Am J Hum Genet. 1983 Nov;35(6):1156-60. Donovan RH, et al. Histology of the normal collie eye. II. Uvea Ann Ophthalmol 1974;6:1175-1189. Duggal P, Klein AP, Lee KE, Iyengar SK, Klein R, Bailey-Wilson JE, Klein BE. A genetic contribution to intraocular pressure: the beaver dam eye study. Invest Ophthalmol Vis Sci. 2005 Feb;46(2):555-60. Esser H, Heinzler F, Pau H. Electrophoresis of protein fractions in human aqueous humor. Albrecht Von Graefes Arch Ophthalmol. 1954;155(1):11-6. Fan BJ, Leung YF, Pang CP, Fan DS, Wang DY, Tong WC, Tam PO, Chua JK, Lau TC, Lam DS. Polymorphisms in the myocilin promoter unrelated to the risk and severity of primary open-angle glaucoma. J Glaucoma. 2004 Oct;13(5):377-84. Fan BJ, Leung YF, Wang N, Lam SC, Liu Y, Tam OS, Pang CP. Genetic and environmental risk factors for primary open-angle glaucoma. Chin Med J (Engl). 2004 May;117(5):706-10. Fautsch MP, Bahler CK, Jewison DJ, Johnson DH. Recombinant TIGR/MYOC increases outflow resistance in the human anterior segment. Invest Ophthalmol Vis Sci. 2000 Dec;41(13):4163-8. Fautsch MP, Johnson DH. Characterization of myocilin-myocilin interactions. Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2324-31. Fautsch MP, Vrabel AM, Peterson SL, Johnson DH. In vitro and in vivo characterization of disulfide bond use in myocilin complex formation. Mol Vis. 2004 Jun 27;10:417-25. Fautsch MP, Bahler CK, Vrabel AM, Howell KG, Loewen N, Teo WL, Poeschla EM, Johnson DH. Perfusion of his-tagged eukaryotic myocilin increases outflow resistance in human anterior segments in the presence of aqueous humor. Invest Ophthalmol Vis Sci. 2006 Jan;47(1):213-21. Fine BS, Yanoff M. Ocular histology. 2nd ed. New York: Harper & Row, 1979. Fingert JH, Clark AF, Craig JE, Alward WL, Snibson GR, McLaughlin M, Tuttle L, Mackey DA, Sheffield VC, Stone EM. Evaluation of the myocilin (MYOC) glaucoma gene in monkey and human steroid-induced ocular hypertension. Invest Ophthalmol Vis Sci. 2001 Jan;42(1):145-52. 111

PAGE 112

Fingert JH, Heon E, Liebmann JM, Yamamoto T, Craig JE, Rait J, Kawase K, Hoh ST, Buys YM, Dickinson J, Hockey RR, Williams-Lyn D, Trope G, Kitazawa Y, Ritch R, Mackey DA, Alward WL, Sheffield VC, Stone EM. Analysis of myocilin mutations in 1703 glaucoma patients from five different populations. Hum Mol Genet. 1999 May;8(5):899-905. Fingert JH, Stone EM, Sheffield VC, Alward WL. Myocilin glaucoma. Surv Ophthalmol. 2002 Nov-Dec;47(6):547-61. Fingert JH, Ying L, Swiderski RE, Nystuen AM, Arbour NC, Alward WL, Sheffield VC, Stone EM. Characterization and comparison of the human and mouse GLC1A glaucoma genes. Genome Res. 1998 Apr;8(4):377-84. Forsman E, Lemmela S, Varilo T, Kristo P, Forsius H, Sankila EM, Jarvela I. The role of TIGR and OPTN in Finnish glaucoma families: a clinical and molecular genetic study. Mol Vis. 2003 May 30;9:217-22. Francois J. Congenital glaucoma and its inheritance. Ophthalmologica. 1980;181(2):61-73. Francois J. Genetic predisposition to glaucoma. Dev Ophthalmol. 1981;3:1-45. Francois J. Multifactorial or polygenic inheritance in ophthalmology. Dev Ophthalmol. 1985;10:1-39. Gelatt KN, Brooks DE, Samuelson DA. Comparative glaucomatology. I: The spontaneous glaucomas.J Glaucoma. 1998 Jun;7(3):187-201. Gelatt KN, Brooks DE, Samuelson DA. Comparative glaucomatology. II: The experimental glaucomas. J Glaucoma. 1998 Aug;7(4):282-94. Gelatt KN, Gum GG. Inheritance of primary glaucoma in the beagle. Am J Vet Res. 1981 Oct;42(10):1691-3. Gelatt KN, Mackay EO. The ocular hypertensive effects of topical 0.1% dexamethasone in beagles with inherited glaucoma. J Ocul Pharmacol Ther. 1998 Feb;14(1):57-66. Gelatt KN, MacKay EO. Prevalence of the breed-related glaucomas in pure-bred dogs in North America. Vet Ophthalmol. 2004 Mar-Apr;7(2):97-111. Gobeil S, Rodrigue MA, Moisan S, Nguyen TD, Polansky JR, Morissette J, Raymond V. Intracellular sequestration of hetero-oligomers formed by wild-type and glaucoma-causing myocilin mutants. Invest Ophthalmol Vis Sci. 2004 Oct;45(10):3560-7. Goldwich A, Baulmann DC, Ohlmann A, Flugel-Koch C, Schocklmann H, Tamm ER. Myocilin is expressed in the glomerulus of the kidney and induced in mesangioproliferative glomerulonephritis. Kidney Int. 2005 Jan;67(1):140-51. 112

PAGE 113

Goldwich A, Ethier CR, Chan DW, Tamm ER. Perfusion with the olfactomedin domain of myocilin does not affect outflow facility. Invest Ophthalmol Vis Sci. 2003 May;44(5):1953-61. Gong G, Kosoko-Lasaki O, Haynatzki GR, Wilson MR. Genetic dissection of myocilin glaucoma. Hum Mol Genet. 2004 Apr 1;13 Spec No 1:R91-102. Gould DB, Miceli-Libby L, Savinova OV, Torrado M, Tomarev SI, Smith RS, John SW. Genetically increasing Myoc expression supports a necessary pathologic role of abnormal proteins in glaucoma. Mol Cell Biol. 2004 Oct;24(20):9019-25. Graul TA, Kwon YH, Zimmerman MB, Kim CS, Sheffield VC, Stone EM, Alward WL. A case-control comparison of the clinical characteristics of glaucoma and ocular hypertensive patients with and without the myocilin Gln368Stop mutation. Am J Ophthalmol. 2002 Dec;134(6):884-90. Gum GG, Samuelson DA, Gelatt KN. Effect of hyaluronidase on aqueous outflow resistance in normotensive and glaucomatous eyes of dogs. Am J Vet Res. 1992 May;53(5):767-70. Harasymowycz P, Kamdeu Fansi A, Papamatheakis D. Screening for primary open-angle glaucoma in the developed world: are we there yet? Can J Ophthalmol. 2005 Aug;40(4):477-86. Hart H, Lewis P, Tajwar H, MacKay EO, Gelatt KN, Samuelson DA. Myocilin Localization in the Normal and Glaucomatous Canine Eye. ACVO Poster. 2005. Hemmingsen L, Other A. Disc electrophoresis of aqueous humour. Acta Ophthalmol (Copenh). 1967;45(3):359-70. Huang W, Jaroszewski J, Ortego J, Escribano J, Coca-Prados M. Expression of the TIGR gene in the iris, ciliary body, and trabecular meshwork of the human eye. Ophthalmic Genet. 2000 Sep;21(3):155-69. Ikezoe T, Takeuchit S, Komatsu N, Okada M, Fukushima A, Ueno H, Koeffler HP, Taguchi H. Identification of a new GLC1A mutation in a sporadic, primary open-angle glaucoma in Japan. Int J Mol Med. 2003 Aug;12(2):259-61. Ishibashi T, Takagi Y, Mori K, Naruse S, Nishino H, Yue BY, Kinoshita S. cDNA microarray analysis of gene expression changes induced by dexamethasone in cultured human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2002 Dec;43(12):3691-7. Jacobson N, Andrews M, Shepard AR, Nishimura D, Searby C, Fingert JH, Hageman G, Mullins R, Davidson BL, Kwon YH, Alward WL, Stone EM, Clark AF, Sheffield VC. Non-secretion of mutant proteins of the glaucoma gene myocilin in cultured trabecular meshwork cells and in aqueous humor. Hum Mol Genet. 2001 Jan 15;10(2):117-25. 113

PAGE 114

Joe MK, Sohn S, Hur W, Moon Y, Choi YR, Kee C. Accumulation of mutant myocilins in ER leads to ER stress and potential cytotoxicity in human trabecular meshwork cells. Biochem Biophys Res Commun. 2003 Dec 19;312(3):592-600. Johnson AT, Richards JE, Boehnke M, Stringham HM, Herman SB, Wong DJ, Lichter PR. Clinical phenotype of juvenile-onset primary open-angle glaucoma linked to chromosome 1q. Ophthalmology. 1996 May;103(5):808-14. Johnson DH. Myocilin and glaucoma: A TIGR by the tail? Arch Ophthalmol. 2000 Jul;118(7):974-8. Jurynec MJ, Riley CP, Gupta DK, Nguyen TD, McKeon RJ, Buck CR. TIGR is upregulated in the chronic glial scar in response to central nervous system injury and inhibits neurite outgrowth. Mol Cell Neurosci. 2003 May;23(1):69-80. Kahn HA, Milton RC. Alternative definitions of open-angle glaucoma. Effect on prevalence and associations in the Framingham eye study. Arch Ophthalmol. 1980 Dec;98(12):2172-7. Kallberg ME, MacKay EO, Rinkoski TA, Samuelson DA, Gelatt KN. Aqueous Humor Myocilin and CD44 in Dogs with Glaucoma and Cataracts. ARVO 2006. Kanagavalli J, Krishnadas SR, Pandaranayaka E, Krishnaswamy S, Sundaresan P. Evaluation and understanding of myocilin mutations in Indian primary open angle glaucoma patients. Mol Vis. 2003 Nov 14;9:606-14. Karali A, Russell P, Stefani FH, Tamm ER. Localization of myocilin/trabecular meshwork--inducible glucocorticoid response protein in the human eye. Invest Ophthalmol Vis Sci. 2000 Mar;41(3):729-40. Karavanich C, Anholt RR. Evolution of olfactomedin. Structural constraints and conservation of primary sequence motifs. Ann N Y Acad Sci. 1998 Nov 30;855:294-300. Karavanich CA, Anholt RR. Molecular evolution of olfactomedin. Mol Biol Evol. 1998 Jun;15(6):718-26. Kaur K, Reddy AB, Mukhopadhyay A, Mandal AK, Hasnain SE, Ray K, Thomas R, Balasubramanian D, Chakrabarti S. Myocilin gene implicated in primary congenital glaucoma. Clin Genet. 2005 Apr;67(4):335-40. Kee C, Ahn BH. TIGR gene in primary open-angle glaucoma and steroid-induced glaucoma. Korean J Ophthalmol. 1997 Dec;11(2):75-8. Kennan AM, Mansergh FC, Fingert JH, Clark T, Ayuso C, Kenna PF, Humphries P, Farrar GJ. A novel Asp380Ala mutation in the GLC1A/myocilin gene in a family with juvenile onset primary open angle glaucoma. J Med Genet. 1998 Nov;35(11):957-60. 114

PAGE 115

Kim BS, Savinova OV, Reedy MV, Martin J, Lun Y, Gan L, Smith RS, Tomarev SI, John SW, Johnson RL. Targeted Disruption of the Myocilin Gene (Myoc) Suggests that Human Glaucoma-Causing Mutations Are Gain of Function. Mol Cell Biol. 2001 Nov;21(22):7707-13. Kirstein L, Cvekl A, Chauhan BK, Tamm ER. Regulation of human myocilin/TIGR gene transcription in trabecular meshwork cells and astrocytes: role of upstream stimulatory factor. Genes Cells. 2000 Aug;5(8):661-76. Klein BE, Klein R, Lee KE. Heritability of risk factors for primary open-angle glaucoma: the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci. 2004 Jan;45(1):59-62. Knaupp C, Flugel-Koch C, Goldwich A, Ohlmann A, Tamm ER. The expression of myocilin during murine eye development. Graefes Arch Clin Exp Ophthalmol. 2004 Apr;242(4):339-45. Knepper PA, Goossens W, McLone DG. Ultrastructural studies of primary congenital glaucoma in rabbits. J Pediatr Ophthalmol Strabismus. 1997 Nov-Dec;34(6):365-71. Kong TH. Post-transcriptional modification of the gene genetically linked to juvenile open-angle glaucoma; novel transcripts in human ocular tissues. Gene. 2001 Dec 12;280(1-2):115-22. Kronfield PC, Lin CK, Luo TH. The protein content of the re-formed aqueous humour in man. Am J Ophthal. 1941 24:264-276. Kubota R, Kudoh J, Mashima Y, Asakawa S, Minoshima S, Hejtmancik JF, Oguchi Y, Shimizu N. Genomic organization of the human myocilin gene (MYOC) responsible for primary open angle glaucoma (GLC1A). Biochem Biophys Res Commun. 1998 Jan 14;242(2):396-400. Kubota R, Noda S, Wang Y, Minoshima S, Asakawa S, Kudoh J, Mashima Y, Oguchi Y, Shimizu N. A novel myosin-like protein (myocilin) expressed in the connecting cilium of the photoreceptor: molecular cloning, tissue expression, and chromosomal mapping. Genomics. 1997 May 1;41(3):360-9. Lam DS, Leung YF, Chua JK, Baum L, Fan DS, Choy KW, Pang CP. Truncations in the TIGR gene in individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2000 May;41(6):1386-91. Lichter PR, Richards JE, Boehnke M, Othman M, Cameron BD, Stringham HM, Downs CA, Lewis SB, Boyd BF. Juvenile glaucoma linked to GLCIA in a Panamanian family. Trans Am Ophthalmol Soc. 1996;94:335-46; discussion 347-51. Lichter PR, Richards JE, Boehnke M, Othman M, Cameron BD, Stringham HM, Downs CA, Lewis SB, Boyd BF. Juvenile glaucoma linked to the GLC1A gene on chromosome 1q in a Panamanian family. Am J Ophthalmol. 1997 Mar;123(3):413-6. 115

PAGE 116

Lo WR, Rowlette LL, Caballero M, Yang P, Hernandez MR, Borras T. Tissue differential microarray analysis of dexamethasone induction reveals potential mechanisms of steroid glaucoma. Invest Ophthalmol Vis Sci. 2003 Feb;44(2):473-85. Lowe RF. Primary angle-closure glaucoma. Inheritance and environment. Br J Ophthalmol. 1972 Jan;56(1):13-20. Lutjen-Drecoll E, May CA, Polansky JR, Johnson DH, Bloemendal H, Nguyen TD. Localization of the stress proteins alpha B-crystallin and trabecular meshwork inducible glucocorticoid response protein in normal and glaucomatous trabecular meshwork. Invest Ophthalmol Vis Sci. 1998 Mar;39(3):517-25. MacKay EO, Hart H, Gelatt KN, Samuelson DA, Esson DW, Sherwood MB. Aqueous Humor and Trabecular Meshwork Myocilin in Normaland Primary Open Angle Glaucomatous Beagles. ACVO Poster. 2004. Mackey DA, Craig JE. Predictive DNA testing for glaucoma: reality in 2003. Ophthalmol Clin North Am. 2003 Dec;16(4):639-45. Mackey DA, Healey DL, Fingert JH, Coote MA, Wong TL, Wilkinson CH, McCartney PJ, Rait JL, de Graaf AP, Stone EM, Craig JE. Glaucoma phenotype in pedigrees with the myocilin Thr377Met mutation. Arch Ophthalmol. 2003 Aug;121(8):1172-80. Madisen L, Hoar DI, Holroyd CD, Crisp M, Hodes ME. DNA banking: the effects of storage of blood and isolated DNA on the integrity of DNA. Am J Med Genet. 1987 Jun;27(2):379-90. Mansergh FC, Kenna PF, Ayuso C, Kiang AS, Humphries P, Farrar GJ. Novel mutations in the TIGR gene in early and late onset open angle glaucoma. Hum Mutat. 1998;11(3):244-51. Mardin CY, Velten I, Ozbey S, Rautenstrauss B, Michels-Rautenstrauss K. A GLC1A gene Gln368Stop mutation in a patient with normal-tension open-angle glaucoma. J Glaucoma. 1999 Apr;8(2):154-6. Melki R, Belmouden A, Brezin A, Garchon HJ. Myocilin analysis by DHPLC in French POAG patients: increased prevalence of Q368X mutation. Hum Mutat. 2003 Aug;22(2):179. Merin S, Morin D. Heredity of congenital glaucoma. Br J Ophthalmol. 1972 May;56(5):414-7. Mestrezat W, Magitot A. Lhumeur aqueuse normale. C.R. Soc. Biol. 1921 84:185-187. Meyer A, Bechetoille A, Valtot F, Dupont de Dinechin S, Adam MF, Belmouden A, Brezin AP, Gomez L, Bach JF, Garchon HJ. Age-dependent penetrance and mapping of the locus for juvenile and early-onset open-angle glaucoma on chromosome 1q (GLC1A) in a French family. Hum Genet. 1996 Nov;98(5):567-71. Meyer K, Smyth EM, Gallardo E. On the nature of the ocular fluids. II. The hexosamine content. Am J Ophthal. 1938 21:1083-1090. 116

PAGE 117

Michels-Rautenstrauss KG, Mardin CY, Budde WM, Liehr T, Polansky J, Nguyen T, Timmerman V, Van Broeckhoven C, Naumann GO, Pfeiffer RA, Rautenstrauss BW. Juvenile open angle glaucoma: fine mapping of the TIGR gene to 1q24.3-q25.2 and mutation analysis. Hum Genet. 1998 Jan;102(1):103-6. Morissette J, Clepet C, Moisan S, Dubois S, Winstall E, Vermeeren D, Nguyen TD, Polansky JR, Cote G, Anctil JL, Amyot M, Plante M, Falardeau P, Raymond V. Homozygotes carrying an autosomal dominant TIGR mutation do not manifest glaucoma. Nat Genet. 1998 Aug;19(4):319-21. Morissette J, Cote G, Anctil JL, Plante M, Amyot M, Heon E, Trope GE, Weissenbach J, Raymond V. A common gene for juvenile and adult-onset primary open-angle glaucomas confined on chromosome 1q. Am J Hum Genet. 1995 Jun;56(6):1431-42. Mukhopadhyay A, Gupta A, Mukherjee S, Chaudhuri K, Ray K. Did myocilin evolve from two different primordial proteins? Mol Vis. 2002 Jul 22;8:271-9. Mukhopadhyay A, Talukdar S, Bhattacharjee A, Ray K. Bioinformatic approaches for identification and characterization of olfactomedin related genes with a potential role in pathogenesis of ocular disorders. Mol Vis. 2004 Apr 20;10:304-14. Nagano T, Nakamura A, Mori Y, Maeda M, Takami T, Shiosaka S, Takagi H, Sato M. Differentially expressed olfactomedin-related glycoproteins (Pancortins) in the brain. Brain Res Mol Brain Res. 1998 Jan;53(1-2):13-23. Nagy I, Trexler M, Patthy L. Expression and characterization of the olfactomedin domain of human myocilin. Biochem Biophys Res Commun. 2003 Mar 14;302(3):554-61. Nguyen TD, Chen P, Huang WD, Chen H, Johnson D, Polansky JR. Gene structure and properties of TIGR, an olfactomedin-related glycoprotein cloned from glucocorticoid-induced trabecular meshwork cells. J Biol Chem. 1998 Mar 13;273(11):6341-50. Obazawa M, Mashima Y, Sanuki N, Noda S, Kudoh J, Shimizu N, Oguchi Y, Tanaka Y, Iwata T. Analysis of porcine optineurin and myocilin expression in trabecular meshwork cells and astrocytes from optic nerve head. Invest Ophthalmol Vis Sci. 2004 Aug;45(8):2652-9. O'Brien ET, Ren X, Wang Y. Localization of myocilin to the golgi apparatus in Schlemm's canal cells. Invest Ophthalmol Vis Sci. 2000 Nov;41(12):3842-9. Ohlmann A, Goldwich A, Flugel-Koch C, Fuchs AV, Schwager K, Tamm ER. Secreted glycoprotein myocilin is a component of the myelin sheath in peripheral nerves. Glia. 2003 Aug;43(2):128-40. Ortego J, Escribano J, Coca-Prados M. Cloning and characterization of subtracted cDNAs from a human ciliary body library encoding TIGR, a protein involved in juvenile open angle glaucoma with homology to myosin and olfactomedin. FEBS Lett. 1997 Aug 18;413(2):349-53. 117

PAGE 118

Ozgul RK, Bozkurt B, Orcan S, Bulur B, Bagiyeva S, Irkec M, Ogus A. Myocilin mt1 promoter polymorphism in Turkish patients with primary open angle glaucoma. Mol Vis. 2005 Nov 2;11:916-21. Pang CP, Lam DS. Differential occurrence of mutations causative of eye diseases in the Chinese population. Hum Mutat. 2002 Mar;19(3):189-208. Peters DM, Herbert K, Biddick B, Peterson JA. Myocilin binding to Hep II domain of fibronectin inhibits cell spreading and incorporation of paxillin into focal adhesions. Exp Cell Res. 2005 Feb 15;303(2):218-28. Phillips CI, Ainley RG, Van Peborgh P, Watson-Williams EJ, Bottomley AC. Vitamin B12 content of aqueous humour. Nature. 1968 Jan 6;217(5123):67-8. Pohjola S. The glucose content of the aqueous humour in man. Acta Ophthalmol (Copenh). 1966;Suppl 88:1-80. Polansky JR, Fauss DJ, Chen P, Chen H, Lutjen-Drecoll E, Johnson D, Kurtz RM, Ma ZD, Bloom E, Nguyen TD. Cellular pharmacology and molecular biology of the trabecular meshwork inducible glucocorticoid response gene product. Ophthalmologica. 1997;211(3):126-39. Polansky JR, Juster RP, Spaeth GL. Association of the myocilin mt.1 promoter variant with the worsening of glaucomatous disease over time. Clin Genet. 2003 Jul;64(1):18-27. Praus R. Paper electrophoresis of aqueous humour proteins labelled with radioactive iodine 131-I. Exp Eye Res. 1961 Sep;1:67-73. Prince JH, Diesen CD, Eglitis I, et al. Anatomy and histology of the eye and orbit in domestic animals. Springfield, Il: Charles C. Thomas, 1960. Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996 May;80(5):389-93. Quigley HA. Open-angle glaucoma. N Engl J Med. 1993 Apr 15;328(15):1097-106. Rao PV, Allingham RR, Epstein DL. TIGR/myocilin in human aqueous humor. Exp Eye Res. 2000 Dec;71(6):637-41. Raymond V. Glaucoma Research Foundation. 2000. Richards JE, Ritch R, Lichter PR, Rozsa FW, Stringham HM, Caronia RM, Johnson D, Abundo GP, Willcockson J, Downs CA, Thompson DA, Musarella MA, Gupta N, Othman MI, Torrez DM, Herman SB, Wong DJ, Higashi M, Boehnke M. Novel trabecular meshwork inducible glucocorticoid response mutation in an eight-generation juvenile-onset primary open-angle glaucoma pedigree. Ophthalmology. 1998 Sep;105(9):1698-707. 118

PAGE 119

Rozsa FW, Shimizu S, Lichter PR, Johnson AT, Othman MI, Scott K, Downs CA, Nguyen TD, Polansky J, Richards JE. GLC1A mutations point to regions of potential functional importance on the TIGR/MYOC protein. Mol Vis. 1998 Oct 06;4:20. Sakai H, Park BC, Shen X, Yue BY. Transduction of TAT fusion proteins into the human and bovine trabecular meshwork. Invest Ophthalmol Vis Sci. 2006 Oct;47(10):4427-34. Samuelson DA, Gelatt KN. Aqueous outflow in the beagle. I. Postnatal morphologic development of the iridocorneal angle: pectinate ligament and uveal trabecular meshwork. Curr Eye Res. 1984 Jun;3(6):783-94. Samuelson DA, Gelatt KN. Aqueous outflow in the beagle. II. Postnatal morphologic development of the iridocorneal angle: corneoscleral trabecular meshwork and angular aqueous plexus. Curr Eye Res. 1984 Jun;3(6):795-807. Samuelson DA, Tajwar H, Desai S, Hart H, Barrie KP, Lewis PA, Kallberg ME, Gelatt KN. Confocal Co-Localization of MYOC and CD44 Along the Aqueous Pathway of Normal and Primary Open-Angle Glaucomatous Dogs. ARVO 2006, poster 1850. Samuelson DA. Chapter 2: Ophthalmic Anatomy. Veterinary Ophthalmology 4 th edition ed. Kirk Gelatt. 2007. Shabo AL, Maxwell DS, Kreiger AD. Structural alterations in the ciliary process and the blood-aqueous barrier of the monkey after systemic urea injections. Am J Ophthalmol 1976;81:162-172. Sheffield VC, Stone EM, Alward WL, Drack AV, Johnson AT, Streb LM, Nichols BE. Genetic linkage of familial open angle glaucoma to chromosome 1q21-q31. Nat Genet. 1993 May;4(1):47-50. Shepard AR, Jacobson N, Sui R, Steely HT, Lotery AJ, Stone EM, Clark AF. Characterization of rabbit myocilin: Implications for human myocilin glycosylation and signal peptide usage. BMC Genet. 2003 Apr 02;4(1):5. Shimizu S, Lichter PR, Johnson AT, Zhou Z, Higashi M, Gottfredsdottir M, Othman M, Moroi SE, Rozsa FW, Schertzer RM, Clarke MS, Schwartz AL, Downs CA, Vollrath D, Richards JE. Age-dependent prevalence of mutations at the GLC1A locus in primary open-angle glaucoma. Am J Ophthalmol. 2000 Aug;130(2):165-77. Smith RL, Raviola G. The structural basis of the blood-aqueous barrier in the chicken eye. Invest Ophthalmol Vis Sci 1983;24:326-338. Smith RS, Rudt LA. Ultrastructural studies of the blood-aqueous barrier. II. The barrier to horseradish peroxidase in primates. Am J Ophthalmol 1973;76:937-947. Smith RS. Ultrastructural studies of the blood-aqueous barrier. I. Transport of an electron-dense tracer in the iris and ciliary body of the mouse. Am J Ophthalmol 1971;71:1066-1077. 119

PAGE 120

Snyder DA, Rivers AM, Yokoe H, Menco BP, Anholt RR. Olfactomedin: purification, characterization, and localization of a novel olfactory glycoprotein. Biochemistry. 1991 Sep 24;30(38):9143-53. Stamer WD, Roberts BC, Howell DN, Epstein DL. Isolation, culture, and characterization of endothelial cells from Schlemm's canal. Invest Ophthalmol Vis Sci. 1998 Sep;39(10):1804-12. Stoilova D, Child A, Brice G, Crick RP, Fleck BW, Sarfarazi M. Identification of a new 'TIGR' mutation in a family with juvenile-onset primary open angle glaucoma. Ophthalmic Genet. 1997 Sep;18(3):109-18. Stoilova D, Child A, Trifan OC, Crick RP, Coakes RL, Sarfarazi M. Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma to the 2cen-q13 region. Genomics. 1996 Aug 15;36(1):142-50. Stone EM, Fingert JH, Alward WL, Nguyen TD, Polansky JR, Sunden SL, Nishimura D, Clark AF, Nystuen A, Nichols BE, Mackey DA, Ritch R, Kalenak JW, Craven ER, Sheffield VC. Identification of a gene that causes primary open angle glaucoma. Science. 1997 Jan 31;275(5300):668-70. Streeten B. Cilary body. In: Duane TD, Jaeger EA, eds. Biomedical foundations of ophthalmology. Vol. 1. Philadelphia: JB. Lippincott, 1988:1-38. Sunden SL, Alward WL, Nichols BE, Rokhlina TR, Nystuen A, Stone EM, Sheffield VC. Fine mapping of the autosomal dominant juvenile open angle glaucoma (GLC1A) region and evaluation of candidate genes. Genome Res. 1996 Sep;6(9):862-9. Suzuki Y, Shirato S, Taniguchi F, Ohara K, Nishimaki K, Ohta S. Mutations in the TIGR gene in familial primary open-angle glaucoma in Japan. Am J Hum Genet. 1997 Nov;61(5):1202-4. Tamm ER, Polansky JR. The TIGR/MYOC gene and glaucoma: opportunities for new understandings. J Glaucoma. 2001 Oct;10(5 Suppl 1):S9-12. Tamm ER, Russell P, Epstein DL, Johnson DH, Piatigorsky J. Modulation of myocilin/TIGR expression in human trabecular meshwork. Invest Ophthalmol Vis Sci. 1999 Oct;40(11):2577-82. Tawara A, Okada Y, Kubota T, Suzuki Y, Taniguchi F, Shirato S, Nguyen TD, Ohnishi Y. Immunohistochemical localization of MYOC/TIGR protein in the trabecular tissue of normal and glaucomatous eyes. Curr Eye Res. 2000 Dec;21(6):934-43. Thiel HJ. The simultaneous determination of pH, pCO2 and PO2 in the human aqueous humor. Albrecht Von Graefes Arch Klin Exp Ophthalmol. 1967;174(2):127-33. 120

PAGE 121

Tielsch JM, Katz J, Singh K, Quigley HA, Gottsch JD, Javitt J, Sommer A. A population-based evaluation of glaucoma screening: the Baltimore Eye Survey. Am J Epidemiol. 1991 Nov 15;134(10):1102-10. Troncoso MU. Microanatomy of the eye with the slit lamp microscope. II. Comparative anatomy of the ciliary body, zonula and related structures in mammalia. Am J Ophthalmol 1942;25:1-30 Ueda J, Yue BY. Distribution of myocilin and extracellular matrix components in the corneoscleral meshwork of human eyes. Invest Ophthalmol Vis Sci. 2003 Nov;44(11):4772-9. Vasconcellos JP, Melo MB, Costa VP, Tsukumo DM, Basseres DS, Bordin S, Saad ST, Costa FF. Novel mutation in the MYOC gene in primary open glaucoma patients. J Med Genet. 2000 Apr;37(4):301-3. Vazquez CM, Herrero OM, Bastus BM, Perez VD. Mutations in the third exon of the MYOC gene in spanish patients with primary open angle glaucoma. Ophthalmic Genet. 2000 Jun;21(2):109-15. Von Sallmann L, Moore DH. Electrophoretic patterns of concentrated aqueous humor of rabbit, cattle and horse. Arch Ophthalmol. 1948 40: 279. Weinreb RN, Lindsey JD. The importance of models in glaucoma research.J Glaucoma. 2005 Aug;14(4):302-4. Wiggs JL, Allingham RR, Vollrath D, Jones KH, De La Paz M, Kern J, Patterson K, Babb VL, Del Bono EA, Broomer BW, Pericak-Vance MA, Haines JL. Prevalence of mutations in TIGR/Myocilin in patients with adult and juvenile primary open-angle glaucoma. Am J Hum Genet. 1998 Nov;63(5):1549-52. Wirtz MK, Acott TS, Samples JR, Morrison JC. Prospects for genetic intervention in primary open-angle glaucoma. Drugs Aging. 1998 Nov;13(5):333-40. Wirtz MK, Samples JR, Kramer PL, Rust K, Topinka JR, Yount J, Koler RD, Acott TS. Mapping a gene for adult-onset primary open-angle glaucoma to chromosome 3q. Am J Hum Genet. 1997 Feb;60(2):296-304. Wirtz MK, Samples JR, Rust K, Lie J, Nordling L, Schilling K, Acott TS, Kramer PL. GLC1F, a new primary open-angle glaucoma locus, maps to 7q35-q36. Arch Ophthalmol. 1999 Feb;117(2):237-41. Witmer R. Electrophoresis of the pathologic human aqueous. Experientia. 1951 Sep 15;7(9):347-8. Wunderly C, De Poorter Da. Paper electrophoresis, a valuable method for protein determination in serum and other fluids. Belg Tijdschr Geneesk. 1952 Jun 1;8(11):481-97. 121

PAGE 122

Yokoe H, Anholt RR. Molecular cloning of olfactomedin, an extracellular matrix protein specific to olfactory neuroepithelium. Proc Natl Acad Sci U S A. 1993 May 15;90(10):4655-9. Yokoyama A, Nao-i N, Date Y, Nakazato M, Chumann H, Chihara E, Sawada A, Matsukura S. Detection of a new TIGR gene mutation in a Japanese family with primary open angle glaucoma. Jpn J Ophthalmol. 1999 Mar-Apr;43(2):85-8. Zimmerman CC, Lingappa VR, Richards JE, Rozsa FW, Lichter PR, Polansky JR. A trabecular meshwork glucocorticoid response (TIGR) gene mutation affects translocational processing. Mol Vis. 1999 Aug 23;5:19. 122

PAGE 123

BIOGRAPHICAL SKETCH Ed MacKay was born in 1972 in North Carolina to an Air Force family. He traveled extensively living in Okinawa, Japan; Las Vegas, Nevada; and Fort Walton Beach, Florida; before settling down in Gainesville to go to school. Ed attended the University of Florida from 1989-1993, graduating with a Bachelor of Science from the College of Animal Sciences. He was soon after hired to help Dr. Kirk Gelatt as both a statistical analyst and research technician. Upon discovering his love of the field, Ed decided to pursue a PhD in the field of Veterinary Ophthalmology, and began slowly in 1997. Hes now married and has one son, with a second baby on the way. All else is prone to change without notice. 123


Permanent Link: http://ufdc.ufl.edu/UFE0017529/00001

Material Information

Title: Changes in Characteristics of the Canine Myocilin Gene and Myocilin Protein in Glaucomatous and Normal Dogs
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017529:00001

Permanent Link: http://ufdc.ufl.edu/UFE0017529/00001

Material Information

Title: Changes in Characteristics of the Canine Myocilin Gene and Myocilin Protein in Glaucomatous and Normal Dogs
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017529:00001


This item has the following downloads:


Full Text





CHANGES IN CHARACTERISTICS OF THE CANINE MYOCILIN GENE AND MYOCILIN
PROTEIN IN GLAUCOMATOUS AND NORMAL DOGS



















By

EDWARD OWEN MACKAY


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2007
































Copyright 2007

by

Edward Owen MacKay






























This work is dedicated to
Dr. Kirk Gelatt for teaching me to love research
and
Audrey, Liam and my mother for making me finish it.









ACKNOWLEDGMENTS

My special thanks to all who helped me to get to this point, especially everyone who

helped with the lab work.

I've been here too long. I have met so many amazing people, each who've helped me not

only move my proj ects along, but helped me grow as a person.

I'd like to thank

Dr. Kirk Gelatt for all of his support, guidance, and kicks-in-the-pants over these last 12

years. Kirk is one of the most amazing people I've ever met, and the main reason I was never in

a hurry to move on. He has done so much for his specialty, and I can't imagine anyone ever

doing more. He helped bring the science of Veterinary Ophthalmology to the modern day. He

has more papers, and books, and presentations than even God, I think.

Drs William Dawson and Don Samuelson. They proved to me that there is still a need for

pure science. It sounds pretentious, but I don't believe that every proj ect researched needs to be

for a maj or pharmaceutical company or a big business R&D. They proved that while grants are

great, choosing what to research is ultimately up to the researcher.

Dr Brooks has always been running around in the background while I've been here. So

busy with the UF veterinary clinic, that I'm lucky to ever see him. It was he, however, that got

me sucked into primate research and pattern ERG' s and the business side of research.

And Dr Peggy Wallace for teaching me genomics, and how research works in a medical

school. And I thought I was busy...

On the technician side, I must thank Pat Lewis. She has taught me more about not only

histochemistry, but about how to survive in a academic laboratory environment. Even on her

worst days, she always had at least one nice thing to say to me. Not to mention, she's probably

the best instructor in histo I've ever known.









To Tommy Rinkoski, for putting me in a good mood, writing really creatively, and putting

up with all my absences as I put this all together.

Linda Lee-Ambrose and Marc Salute for teaching me Western Blotting, and cursing. Beth

Fisher, for holding my hand as I learned PCR reactions. Thanks to everyone in Dr. Peggy

Wallace's lab for teaching me genomic and good bench top techniques. To Butch Sapp and

Delena McTeer for teaching me how to talk back to doctors.

I've got to thank the million students that I've gotten to help, and been helped by. Each one

of them taught me something, not always good...but something.

A special thanks to Hillary Hart, a very successful student. She did more with the protein

localizations in this proj ect than anyone. She was the moving force behind a lot of the proj ect.

She's also a great poster designer.

I'd also like to take a moment and thank the other graduate students I've worked with,

Maria Kallberg, Andras Komaromy, Franck Ollivier. You guys gave me help and hope all the

time. It was fun to work with you.

I'd like to thank my wife, Audrey, for all of her time and patience as I've finished this

proj ect. I know you've been buried under housework and baby-sitting, I love you.

And finally, to my mother, who never let me doubt myself. Who always knew I could be

great. Thanks!

And to all the rest I've neglected. Thanks for everything!!!












TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .........__.. ..... .__. ...............4....


LIST OF TABLES ........._.___..... .__. ...............7....


LI ST OF FIGURE S .............. ...............8.....


AB S TRAC T ............._. .......... ..............._ 1 1..


CHAPTER


1 INTRODUCTION ................. ...............13.......... ......


Anatomy and Physiology of Aqueous Humor and Outflow. ................ ................. ...._15
Aqueous Humor............... ...............18.
Description of Myocilin............... ...............2
Functions of M yocilin ................... ........ ...... ...............25......
Causes and Risks of Myocilin Related Glaucoma ................. ................ ......... .27
Causes and Risks of Myocilin Driven Glaucoma ................. ........... ........ ...........27


2 MATERIALS AND METHODS .............. ...............43....


Gene Analysis............... ...............43
Protein Analysis............... ...............48
Comassie Stain .............. ...............49....
Western Blot................. ... ...............5

Myocilin Protein Localization................ .............5
Microarray Gene Chips............... ...............53.


3 RE SULT S .............. ...............58....


Genomic Findings............... ...............58
Protein Analysis............... ........... ........5
Inherited Model Glaucomatous Dogs ................. ...............59................
Clinical Samples ................. ...............59.................
Immunohistochemistry .............. ...............61....
Immunocytochemistry .............. ...............62....
M icroarray .............. ...............62....


4 DI SCUS SSION ................. ...............9.. 8......... ....


LIST OF REFERENCES ................. ...............105................


BIOGRAPHICAL SKETCH ................. ...............123......... ......










LIST OF TABLES


Table page

1-1: Loci and Genes Associated with Glaucoma ................. ...............31.............

1-2: Composition of aqueous humor ................. ...............32........... ..

1-3. Human myocilin mutations detected in population ................. ...............33........... .

1-4: Human myocilin mutations detected in glaucoma pedigrees ................. ........... ...........35

2-1: Original canine myocilin primers ................. ...............54........... ..

2-3 : Dogs used for microarray analysis with short history. ............. ...............56.....

3-1: Relative myocilin protein levels in inherited glaucomatous dogs............... ..................6

3-2: Aqueous humor myocilin levels from maj or breeds of dogs ................. ........... ...........65

3-3 : Selected DNA chip microarray results. Ratio and probability show major differences
between glaucoma and normal mRNA results. Items that may be of interest in bold.......67










LIST OF FIGURES


Figure page

1-1: Basic structures of the eye ................. ...............36........... .

1-2: The Canine iris controls the amount of light entering the eye. ............. .....................3

1-3: Example of a horizontal pupil. ................ ...............37........... ..

1-4: Rear of the Iris (I), Ciliary Body (CB), Ciliary Processes (CP), and Pars Plicata (PP). ........37

1-5: Zonules over the ciliary processes ................. ...............38..............

1-6: Pillars of the pectinate ligament from the base of the iris to the inner cornea. ................... ...39

1-7: Pigmented and non-pigmented epithelium of the ciliary body. Cellular junctions
between the two layers of epithelium of the ciliary process are very important. The
lateral intercellular junctions of the nonpigmented epithelium consist of
desmosomes, except at the apical end............... ...............40..

1-8: Human myocilin mRNA overlaid on human complete DNA for the region, showing
exons and areas removed by post processing. ATG's show two possible start points.
Blue underlined = Exon 1. Green underlined = Exon 2. Red underlined = Exon 3. .........41

1-9: Myocilin consists of 3 exons and a 5-kilobase promoter region. .............. .....................4

1-10: Basic leucine zipper motif. .............. ...............42....

2-1: Boxer made famous for providing the DNA for the first shot-gun DNA sequence for
canines............... ...............57

3-1: Region of Canine Chromosome 7 containing MYOC. The 1451 bp dog MYOC cDNA
sequence is shown underlined. Red Exon 1, Green Exon 2, Blue Exon3. Green
highlighting represents "start" primers used to piece the gene together. Blue
highlighting represents "end" primers. ............. ...............71.....

3-2: Western blot of aqueous humor samples from beagles with primary open angle
glaucoma with human myocilin control. Box shows typical primary band. .....................72

3-3: Comassie gel strips from aqueous humor of mildly affected glaucoma beagles over
time. The darkest band is approximately 57 kDa. ............. ...............72.....

3-4: Comassie gel strips from aqueous humor of moderately affected glaucoma beagles over
time. The darkest/ largest band centers at approximately 57 kDa. ............. ...................73

3-5: Comassie gel strips from aqueous humor of advanced glaucoma beagles over time. The
darkest/ largest band centers at approximately 57 kDa. ............. .....................7










3-6 : Samples 193 through 206, examples of Comassie staining of aqueous humor.
lo=primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control. ............. ...............75.....

3-7 : Samples 260 through 272, examples of Comassie staining of aqueous humor.
lo-primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control. ............. ...............76.....

3-8 : Samples 312 through 325, examples of Comassie staining of aqueous humor.
lo-primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control. ............. ...............77.....

3-9: Overall view of iridocorneal angle (ICA) of a normal 1.5 yr. old (X100) beagle. Normal
myocilin localization is observed in the Irido-Corneal Angle (ICA). Iris (I). ..................78

3-10: Overall view of irideocorneal angle (ICA) of a glaucomatous 6 yr. old beagle (X200).
Increased myocilin localization is observed in the ICA (arrow) of the glaucomatous
canine. ............. ...............79.....

3-11: Positive staining in the corneal epithelium (solid arrows) and stroma of a normal
beagle (X200)............... ...............80.

3-12: Positive staining in the corneal epithelium (arrow) and stroma of a glaucomatous
cocker spaniel (X 200). .............. ...............8 1....

3-13: Positive myocilin localization in corneal endothelium (arrow) of a preglaucomatous 3
mo. old beagle (X200). ............. ...............82.....

3-14: Localization in the sphincter (S) and dilator (D) muscles of the iris of a normal 1.5 yr.
old beagle (X200). ............. ...............83.....

3-15: Localization in the sphincter (S) and dilator (D) muscles of the iris of a 10 year old
glaucomatous beagle (X200). ............. ...............84.....

3-16: Myocilin localization along the cell membranes of the ciliary body musculature of a 3
mo. old normal beagle (X200). .............. ...............85....

3-17: Myocilin localization along the cell membranes of the ciliary body musculature of a
1.5 yr. old normal beagle (X1000) ................. ...............86........... .

3-18: Positive myocilin localization in the trabecular meshwork cells of a 7 yr. old
glaucomatous beagle (X 1000). ............. ...............87.....

3-19: Positive myocilin localization in the outer sclera of a 13 yr. old glaucomatous cocker
spaniel (X400)............... ...............88.

3-20: Positive myocilin localization in the vascular smooth muscle cells (arrows) within the
sclera (S) of an 8 yr. old glaucomatous cocker spaniel (X400). ............. ....................89










3-21: Intense myocilin labeling within the nonpigmented epithelium (Blue arrow) of the
ciliary processes, and vitreal membrane-like material (Green arrow) of a 6 yr. old
glaucomatous beagle (X200). ............. ...............90.....

3-22: Detail of Figure 3-13. Intense myocilin labeling within the nonpigmented epithelium
of the ciliary processes of a 6 yr. old glaucomatous beagle (X400). ................ ...............91

3-23: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM:
Localization of myocilin with 18 nm colloidal gold particles (black arrows). ................. .92

3-24: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM:
Localization of myocilin with 18 nm colloidal gold particles (black arrows). ................. .93

3-25: Trabecular meshwork cell of a 1.5 year old normal walker hound. TEM: Localization
of myocilin with 18 nm colloidal gold particles (black arrows). ................ ............... ...94

3-26: Extracellular matrix (ECM) or the trabecular meshwork of a 10 year old beagle with
moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold
particles (black arrows) ................. ...............95......_.._ ....

3-27: Nonpigmented epithelium of the ciliary body of a 10 year old beagle with moderate
glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black
arrow s). ............. ...............96.....

3-28: Vitreal membrane-like material within the posterior chamber of a 10 year old beagle
with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold
particles (black arrows) ................. ...............97......_.._ ....













Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHANGES IN CHARACTERISTICS OF THE CANINE MYOCILIN GENE AND MYOCILIN
PROTEIN IN GLAUCOMATOUS AND NORMAL DOGS

By

Edward Owen MacKay

May 2007

Chair: Kirk N. Gelatt
Major Department: Veterinary Medicine

The glaucomas are a group of diseases causing blindness in millions of people every year.

The causes of glaucoma are numerous, but in recent years, more attention has been paid to

genetic causes of the inherited forms of this disease. Myocilin has been attributed to be involved

in over 6% of inherited types of human glaucoma, the highest correlation to date. We have

attempted to characterize this gene and protein in the anterior eye tissues, aqueous humor (AH),

and irido-corneal angle of a colony of beagles with hereditary glaucoma; and aqueous humor

samples from both normal and glaucomatous dogs of other breeds using protein characterization,

histochemical localization and micro-array RNA analysis. Genomic myoc (coding regions and

untranslated regions) differences were not seen in the DNA analysis of normal (n=1) and

glaucomatous (n=1) beagles. Comparisons of AH myocilin levels between differing glaucoma

severity beagle dogs showed relative differences with the early, moderate, and advanced forms

(1.95, 7.66, 13.31 units respectively). Clinical samples showed differences between normal and

glaucomatous dogs as well. Normal (cataractous) dogs had the lowest level of myocilin in the

aqueous humor at 4140.27 + 674.12 Clg/ml. Primary glaucoma dogs were found to have an










aqueous humor myocilin protein level of 29404. 18 & 7449. 11 Clg/ml. Secondary glaucomas had

the highest level of myocilin in the aqueous humor with 44797.03 A 11659.83 Clg/ml. Myocilin

localization in the eye tissues showed an increase in the amount of myocilin in different tissue.

The microarray chip study showed very little change in levels of mRNA for myocilin in

glaucomatous dogs versus normal dogs. This study shows a strong correlation between amounts

of myocilin protein and the presence and severity of glaucoma, but a mutation in the myocilin

gene may not be the only myocilin mediated cause of glaucoma in diseased dogs. A mutation in

the myocilin promoter or other genes involved with processing myocilin may also be at fault.

Further, the increase in production or decrease in turnover of myocilin in all ocular tissues may

be the result of the ocular hypertension rather than a cause.















CHAPTER 1
INTTRODUCTION

Since the 1950s, glaucoma has been used to describe a number of ocular diseases involving

optic nerve damage, a maj or risk factor of elevated intraocular pressure, and an eventual loss of

vision. Glaucoma affects 66.8 million people around the world, with 6.8 million of those

suffering bilateral blindness (Quigley, 1993; Quigley, 1996). In the United States, 12,000 are

blinded yearly by glaucoma and up to 2% of the human population over 40 is affected by the

disease (Kahn et al., 1980; Tielsch et al., 1991). African Americans are affected five times more

by POAG than Caucasians, leading to the belief that there is a significant genetic component to

the disease (Tielsch et al., 1991).

Individuals are eight times more likely to develop glaucoma than the general population if

they have a first degree relative with the disease (Johnson et al., 1996; Armaly et al., 1968;

Demenais, 1983; Lowe, 1972). Other signs indicating that POAG could have inheritable factors

include the fact that as the disease appears to run in families, and some families show direct

Mendelian inheritance (usually autosomal dominant) (Broughton et al., 1983; Budde, 2000;

Francois, 1980; Francois, 1981; Francois, 1985; Merin et al., 1972).

The first eye disease linked to a chromosomal location was the X-linked color blindness

gene (Deeb et al., 2003). Currently there are over 90 genes (or gene locations) that cause known

inherited eye disorders (Cohen et al, 2004). There are several forms of glaucoma linked with

specific genes and susceptibility loci (Table 1-1) (Cohen et al., 2004; Duggal et al., 2005).

Many have inferred from the lack of simple Mendelian inheritance that POAG is a more

complex disease with a convoluted etiology (Fingert et al., 2002; Avramopoulos et al., 1996;









Francois, 1980; Francois, 1981; Francois, 1985). In humans, chromosome I was the first

autosome implicated in the heredity of glaucoma. (Cotton, 1993). Further analysis was able to

link it specifically to the Q arm of the chromosome (Johnson et al., 1996). In humans, six

different genes and chromosomal points have been implicated in glaucoma to some extent. These

were initially mapped to GLCIA, GLC1B, GLCIC, GLC1D, GLCIE, and GLC1F (Sheffield et

al., 1993; Stoilova et al., 1996; Wirtz et al., 1997; Wirtz et al., 1998; Trifan et al., 1998; Sarfarazi

et al., 1998; Lichter, 2001; Alward et al., 2003; Alward, 2000; Alward, 2003; Andersen et al.,

1997; Andersen et al., 1996; Andersen et al., 2002; Aung et al., 2002; Baird et al., 2005;

Belmouden et al., 1997; Booth et al., 1997; Borges et al., 2002; Brinkman et al., 2005; Brooks et

al., 2004; Broughton et al., 1983; Clepet et al., 1996; Datson et al., 1996; Ikezoe et al., 2003;

Lichter et al., 1996; Lichter et al., 1997; Mardin et al., 1999; Meyer et al., 1996; Morissette et al.,

1995; Rozsa et al., 1998; Stoilova et al., 1996; Sunden et al., 1996; Wirtz et al., 1999).

Myocilin is the only gene and protein that can be directly linked to an inheritable glaucoma

in humans (Stone et al., 1997). Analyzing the same gene family in other species may help

determine the effects of mutations and on this disorder. Myocilin has been reported in some form

in humans, mice, rats, bovine, rabbits, pigs and non-human primates. Recently, research has been

reported in cats as well (Fautsch et al., 2006). In this study we concentrated on the dog as our

animal of choice. The dog has long been a stable, accurate animal model for ophthalmologic

studies (Gelatt et al., 1981; Gelatt et al., 1998; Gelatt et al., 1998; Weinreb et al., 2005; Fingert et

al., 2001; Knepper et al., 1997; Obazawa et al., 2004). Any results gathered from this analysis

would not only improve our knowledge of glaucomas in humans, but perhaps lead to tests for

glaucoma in the canine as well.









Anatomy and Physiology of Aqueous Humor and Outflow

The eye in the canine breeds is usually a nearly spherical globe approximately 21 mm in

diameter and very similar in size compared to man. As one of the most complex of sensory

organs, it has many different regions with specific functions.

In the dog, the eye is composed of three basic layers. The outer layer is fibrous tunic,

which is further divided into the cornea and sclera. The fibrous tunic gives the eye a constant

shape and form, which are imperative for a functional visual system. In addition, the most

anterior portion of the fibrous tunic, the cornea, is transparent, thus enabling light to pass

through, and is shaped in a manner that makes it a powerful lens that refracts light rays centrally,

toward the visual axis of the eye. The second and middle layer is the uvea (meaning "grape").

The uvea, which is further divided into the choroid, the ciliary body, and the iris, is heavily

pigmented and vascularized. It functions to modify both external and internal light, including

reflection and scatter, as well as to provide nourishment and remove wastes for most of the eye' s

components. The choroid and ciliary body are both attached to the internal surface of the sclera

(Figure 1-1). Parts of the eye involved with aqueous outflow and glaucoma include the iris,

ciliary body, cornea, and the iridocomeal angle.

The iris originates from the anterior portion of the ciliary body, and it extends centrally to

form a diaphragm in front of the lens. The iris of the eye is a round, flat diaphragm with its base

in the ciliary body. It completely covers the anterior lens, except for a small hole (pupil) in the

center (Figure 1-2). It is used to control the amount of light striking the retina as well as the focal

depth of the proj ected image. It divides the eye into the anterior and posterior segments

(chambers). The only communication of aqueous humor fluids in the eye occur through the iris's

pupil. In the dog the pupil is nearly perfectly circular. Other species may have horizontally









oriented pupils (horses, cows, goats and other ungulates), slit type pupils (cats), or even double

pupils as seen in some fish (Anableps) (Figure 1-3).

The posterior surface of the iris faces the posterior chamber and has numerous surface

proj sections. The posterior surface of the iris contains radial folds that extend to the base of the

ciliary processes.

The ciliary body is an anterior continuation of the choroid, and it j oins with the iris. The

ciliary body removes wastes and provides nourishment for the cornea and lens. Nutrients for the

refractive structures are primarily supplied by the aqueous humor of the eye. Aqueous humor is

an optically clear fluid originating from vascular sinuses within the folds and processes of the

ciliary body and later drains into the iridocorneal (or anterior chamber angle), which forms the

anterior boundary of the ciliary body. In the continuous process of aqueous humor formation and

drainage, intraocular pressure (IOP) is created, which is responsible for providing the eye most

of its rigidity.

Topographically, the ciliary body is divided into an anterior pars plicata and a posterior

pars plana. The pars plicata consists of a ring of 70 to 100 ciliary processes, depending on the

species, with their intervening valleys (Figure 1-4) (Prince et al., 1960).

There are usually 74-76 processes in carnivores and primates, which greatly increases the

surface area for the production of aqueous humor. In addition to aqueous production, ciliary

processes play variable roles in lenticular accommodation, because these structures are

intimately associated with the crystalline lens. In anurans, birds, and some reptiles, the ciliary

processes are attached to the lens and participate directly in accommodation. By comparison, the

processes in mammals primarily serve as a region for attachment of the lenticular zonules, which









connect the lens with the ciliary body and its musculature, which in turn is responsible for

accommodation.

The appearance of individual ciliary processes are thin and blade-like, with rounded tips

that are invested with zonular fibers in canines. Between the major ciliary folds, wide valleys

with smaller, secondary folds are present. Many of the smaller secondary folds originating near

the pars plana merge with the maj or processes at their base. The surface has numerous

convolutions, but most of it is obscured by the zonular fibers (Figure 1-5) (Troncoso, 1942).

The zonular fibers pass down into the valleys, and many fibers pass posteriorly to their

origin on the pars plana.

The pars plana is the first flat, posterior portion extending from the posterior termination of

the processes to the peripheral termination of the retina (Figure 1-4). The width of the pars plana

varies, because the retina extends more anteriorly in the inferior and medial quadrant in most

species, enhancing peripheral vision. Therefore, the pars plana is wider superiorly and laterally.

In the dog, the ora ciliaris retinae, the seam between pars plana and the retina, is 8 mm behind

the limbus dorsally and laterally but only 4 mm ventrally and medially (Donovan et al., 1974).

The main mass of the ciliary body consists of the smooth muscles. Contraction of these muscles

draws the ciliary processes and body both forward and inward, thus relaxing the lenticular

zonules suspensoryy ligament of the lens) and changing the shape and refraction of the lens. This

muscle is not as well developed as that of most non-primate species, and offers variably

weakened accommodative ability. Both regions of the ciliary body are heavily pigmented.

The iridocorneal angle (ICA, or filtration angle or anterior chamber angle) is the anterior-

most component of the ciliary body in nonprimates. The ICA is formed by the junction of the

corneoscleral tunic at the limbus, base of the iris, and an anterior recession of the ciliary body,









which is known as the cilioscleral sinus or cleft (Figure 1-1). The pectinate ligament spans the

opening of the cilioscleral sinus from the pigmented corneoscleral junction to the root of the iris

(Figure 1-6) (Baulmann et al., 2002; Bhattacharya et al., 2005).

Beneath the pectinate ligament and within the cilioscleral sinus is a matrix of loose tissue

strands, the trabecular meshwork, which is divided into two regions: the uveal trabecular

meshwork (UTM) and the uveoscleral trabecular meshwork (CSTM). The trabecular meshwork

consists of a mesh of collagen cords that are covered by cells (Booth et al., 1999; Samuelson et

al., 1983; Samuelson et al., 1984). In the cilioscleral sinus, the inner CSTM appears to be

anterior tendinous extensions of ciliary body musculature (Gum et al., 1992). At the expense of

the ciliary body musculature, a proportionally larger sinus is found in most domestic animals

than in humans. Adj acent to the meshwork are aqueous collecting channels, which in turn empty

into the intrascleral venous plexus and then the vortex veins.

Aqueous Humor

Aqueous humor flows from the posterior chamber, in which it is produced by ciliary body

epithelial cells and vasculature, and through the pupil, into the anterior chamber, and to the

filtration angle. Aqueous flows between the pillars of the pectinate ligament and into the

trabecular meshwork. Aqueous humor then leaves the eye either through the corneoscleral

trabecular meshwork and associated outflow channels or through the ciliary body and anterior

uvea (i.e., uveoscleral outflow). Most forms of increased IOP may be associated with increased

resistance to aqueous outflow in both of these areas. The balance between production of aqueous

humor and its exit through the iridocorneal angle are essential for maintaining the shape of the

eye, its rigidity, and the close adherence of the retina to the choroid.

Production of the aqueous humor occurs in the ciliary processes. Each ciliary process is

covered by a double layer of epithelium; an inner, nonpigmented, cuboidal epithelium, which









forms a complete, internal monocellular lining of the ciliary body; and an outer, pigmented,

cuboidal epithelium, which also is one cell layer thick.

The sides of the nonpigmented epithelium have numerous villous processes along the

bottom two-thirds. The intercellular spaces in this region and in the pars plana are filled with

intercellular material that have the staining characteristics of glycosaminoglycans (GAGs)

(Samuelson, 2007). The base of the cells also react positively for the same material. The ciliary

body nonpigmented epithelium may produce the GAGs of the vitreous humor. These cells

secrete the GAGs, which mostly consist of hyaluronans, laterally into the cystic intercellular

spaces, which then communicate both with the vitreous base and basally (Fine et al., 1979;

Huang et al., 2000).

These chemical factories not only nourish the lens, iris and cornea, but also help regulate

intraocular pressure (Coca-Prados et al., 1999).

Cellular junctions between the two layers of epithelium (nonpigmented and pigmented) of

the ciliary process are very important (Abe et al., 1999). The lateral intercellular junctions of the

nonpigmented epithelium consist of desmosomes, except at the apical end (Figure 1-7). The

apical ends possess gap junctions, zonula adherens, and zonula occludens, which probably

represent the anatomic blood-aqueous humor barrier (Shabo et al., 1976; Smith, 1971; Smith et

al., 1973; Smith et al., 1983; Streeten, 1988).

The protein composition of aqueous humor was first analysed in 1948 by von Sallmann

and Moore, who attempted to separate aqueous humor proteins with basic free electrophoresis

(von Sallmann et al., 1948). The method they used required a relatively large amount of aqueous

humor (2 ml) and was performed by pooling samples from 80 rabbits. The advent of paper

electrophoresis allowed not only smaller samples to be used, but better overall separation of the










aqueous humor proteins and in 1951 Witmer published the first analyses using this technique on

pathological human samples (Witmer, 1951). The first true protein identification occurred in the

early 1950's with Wunderly and Cagianut (1952) and Esser (1954) identifying albumin,

alfaglobulin, betaglobulin, gammaglobulin, and pre-globulin in the aqueous humor. They were

able to show minor changes between normal and pathologic samples (Wunderly et al., 1952;

Esser et al., 1954). In 1967, Hemmingsen and OZther were able to show no significant changes

between intraocular protein and total systemic protein when total protein was increased

(Hemmingsen et al., 1967). More significant analyses were done in the 1970's (Table 1-2).

Maj or components of aqueous humor were shown to be: potassium, anions (chloride and

bicarbonate), ascorbic acid, amino acids (free and protein), and sugars (glucose) (Cole, 1974).

Description of Myocilin

The causes of glaucoma are numerous, but in recent years, more attention has been paid to

genetic causes of the inherited forms of this disease. Most notably a mutation in the myocilin

gene has been linked to juvenile onset open angle glaucoma (JOAG) as well as other forms of

adult early onset primary open angle glaucoma (POAG) (Rozsa et al., 1998; Fingert et al., 2002;

Francois, 1980; Kaur et al., 2005; Johnson, 2000).

Myocilin was discovered initially in a course of studies performed by Stone and 14

colleagues from seven other laboratories that analyzed proteins inducible by dexamethasone in a

long-term treatment of cultured human trabecular meshwork cells (Stone et al., 1997; Polansky

et al., 1997; Johnson, 2000; Ishibashi et al., 2002). Using this model of a steroid induced

glaucoma, research demonstrated an increase in the production of myocilin (originally named

Trabecular Meshwork Inducible Glucocorticoid Response protein [TIGR]) similar to that of in

vivo dexamethasone glaucoma studies (Polansky et al., 1997; Huang et al., 2000). A cDNA

sequence for TIGR was then found by using mRNA from cultured human trabecular meshwork









cells treated with dexamethasone for 10 days (Stone et al., 1997; Nguyen et al., 1998; Ishibashi

et al., 2002). In a completely unrelated set of experiments, another laboratory cloned cDNA with

the same sequence from mRNA from a human retina library and studied its effects on human and

pig retinas. Kubota named this novel protein Myocilin (MYOC) which was the final name issued

by the Human Genome Organization Genome Database Nomenclature Committee in 1998

(Kubota et al., 1997). The gene symbol is MYOC.

Kubota initially reported the open reading frame for MYOC coded for a protein of 490

amino acids, but later reported a correct 504 amino acids (Kubota 1998). The approximate

molecular weight ofMYOC is between 55 and 57 kilodaltons (kDa). By western blot multiple

bands appear, most likely due to translational and post-translational processing since only a

single gene copy is found in Southern and Northern blot analysis (Nguyen et al., 1998; Kubota et

al., 1998; Ortego et al., 1997; Adam et al., 1997; Tamm et al., 1999).

In humans, there are two possible start (ATG) sites reported in the open reading frame of

MYOC separated by 42 nucleotides (Figure 1-8) (Kubota et al., 1997). After the second start

signal is a hydrophobic leucine-rich signal sequence with a cleavage site at amino acids 32 and

33 (Ala-Arg) (Nguyen et al., 1998; Kubota et al., 1997; Ortego et al., 1997). The first start signal

site and cleavage site of the signaling sequences were later confirmed by amino terminal

sequencing of immunoprecipitated MYOC (Nguyen et al., 1998). MYOC Genomic organization

consists of three exons and a 5-kilobase promoter region (Figure 1-9). All exon-intron

boundaries conform to the GT/AG consensus for intronic donor and acceptor splice signals

(Nguyen et al., 1998; Kubota et al., 1998; Adam et al., 1997). The promoter region contains 13

predicted hormone response elements, including several glucocorticoid regulatory elements

(Nguyen et al.,1998). mRNA size as determined by Northern Blot in humans is 2.37 to 2.5









kilobases (Nguyen et al., 1998; Kubota et al., 1997; Ortego et al., 1997; Tamm et al., 1999;

Fingert et al., 1998). Two maj or domains have been determined by sequence alignment and

BLAST analysis. The first is a myosin-like domain near the N-terminal, similar to the non-

muscle myosin of Dictyostelium discoideum, a soil-living amoeba. The myosin homology at the

N-terminal is relatively low and has been reported to show a 25% to 29% amino acid identity

with the heavy chain of myosin of different species, now including canines (Kubota et al., 1997;

Ortego et al., 1997). The second domain is similar to bullfrog olfactomedin (Kubota et al., 1997).

This region is almost completely encoded by the third exon and is highly conserved across

species.

Olfactomedin was originally identified as the maj or component of the mucus layer that

surrounds the chemosensory dendrites of olfactory neurons in frogs (Snyder et al., 1991; Yokoe

et al., 1993). Soon after, a homologous olfactomedin-related glycoprotein was identified in the

neurons of the rat, mouse, and human brain (Danielsonet al., 1994; Nagano et al., 1998;

Karavanich et al., 1998; Karavanich et al., 1998). Frog olfactomedin had 31% to 40% amino acid

residues in common with MYOC, whereas the rat and human olfactomedin-related glycoprotein

shared 45% to 50% amino acid residues with MYOC/TIGR (Kubota et al., 1997; Ortego et al.,

1997; Adam et al., 1997).

Human myocilin may have evolved from the fusion of two different earlier genes

(Mukhopadhyay et al., 2002; Challoner et al., 1985). These include the Noelin family of genes,

consisting of Noelin 1, Noelin 2, and Noelin 3. Noelin 1 and 2 have been found expressed in

ocular tissues, although all three can be found in brain/nerve tissues. It is hypothesized that

myocilin may have evolved from a gene duplication/fusion event involving Noelin 2

(Mukhopadhyay et al., 2004; Chapman et al., 1996).










Trabecular meshwork cells in monolayer cultures and perfused anterior segment organ

cultures secrete MYOC into the culture medium on treatment with dexamethasone. Under these

conditions, a modified MYOC form with a molecular weight of 66 kDa is observed in addition to

the 52- to 56- kDa forms (Nguyen et al., 1998). To date, myocilin has been located in the cornea,

trabecular meshwork, lamina cribrosa, optic nerve, retina, iris, ciliary body, vitreous humor,

corneal epithelium, corneal endothelium, the corneal stroma, sclera, uveal and corneoscleral

meshwork, ciliary epithelium, ciliary muscle, lens epithelium, stromal and smooth muscles of the

iris, throughout the vitreous body as fine filamentous fibers, surface of rods and cones, neurons

of the inner and outer nuclear layer, and optic nerve ganglion cells (Karali et al., 2000; Aung et

al., 2003). The 66 kDa form is most likely caused by N-glycosylation at amino acids 57 to 59

(Asn-Glu-Ser) since treatment with tunicamycin reduces significantly its formation in human

trabecular meshwork cells (Nguyen et al., 1998; Raymond, 2000). Use of this site has been

recently confirmed by Raymond,who reported at the Glaucoma Research Foundation meeting

that COS-7 cells transfected with human MYOC/TIGR cDNA secrete two isoforms that migrate

at approximately 57 and 63 kDa's (Raymond, 2000). Treatment with tunicamycin and PNGaseF

(but not O-glycosidase) cleaved the 63-kDa form, leaving the 57-kDa form. Furthermore, cells

transfected with cDNA mutated at Asn-57 did not secrete the 63-kDa form. Structural analyses

of the MYOC cDNA sequence also predicted several potential O-glycosylation sites and

phosphorylation sites, a hyaluronan-binding site, putative glycosaminoglycan initiation sites and

a tripeptide C-terminal targeting signal for microbodies, a group of small, single-membraned

organelles such as peroxisomes, glyoxysomes, and glycosomes (Polansky et al., 1997; Nguyen et

al., 1998; Adam et al., 1997; Fingert et al., 1998). No functional role for these sites has been

found as yet.









Myocilin has a leucine zipper motif defined by eight leucine residues evenly spaced

among seven residues between amino acids 117 and 166 (Figure 1-10). This is consistent with

many protein-protein interactions as well as characteristic for many DNA binding transcription

factors. Many documented mutations that cause JOAG/POAG seem to have their roots in

disrupting the secondary structure of the olfactomedin region (Nagy et al., 2003).

Myocilin in the mouse was first described by Abderrahim, et al. in 1998. The basic

genomic structure of the murine myocilin is very similar to the human form. It has three distinct

exons with highly conserved intron-exon boundaries. The first intron is approximately 7kb while

the second is about 1.5kb, very similar to the human second intron (Abderrahim et al., 1998). In

developing murine eyes, myocilin cannot be immunostained before embryonic day 17.5. The

nerve fiber layer of the retina was observed to contain myocilin. By postnatal day 12, the cells of

the trabecular meshwork and iris stroma began to immunolabel for myocilin, as well as the

epithelial layers of the ciliary body and iris (Knaupp et al., 2003).

Coding DNA sequence comparisons between the mouse and human show a 82%

sequence identity. There are no gaps in the alignment, although comparisons from the stop codon

into the 3' untranslated region show similarity doesn't extend beyond the first 100 base pairs

(Abderrahim et al., 1998). Predicted translation of the murine sequence shows a 490 amino acid

protein that is 81% identical (90% similar) to human. The third exon is highly conserved

between mouse and human and is still comparable to nematode (Adam et al., 1997). A potential

glycosaminoglycan extension site is not conserved between species, and may suggest that this

putative signal has no relevance to myocilin function (Abderrahim et al., 1998; Baird et al.,

2001).









Functions of Myocilin

Myocilin was first described after exposing trabecular meshwork (TM) cells to

dexamethasone (Stone et al., 1997). Later research showed this to be a trabecular meshwork

specific response, and further exposure to dexamethasone only induced myocilin production in

the TM and not in any other ocular tissue (Lo et al., 2003; Fautsch et al., 2000). Myocilin

expression was investigated in the rat eye after three different stresses were applied. In one

experiment, four male Brown Norway rats had their intraocular pressure increased by inj section

of 50Cl1 of a 1.75M hypertonic saline solution through the episcleral vein. After six weeks of

daily pressure readings, the rats were killed and graded on the degree of optic nerve damage (a

scale of 1 [normal] to 5 [total degeneration]) by several observers. Subsequent quantitative

analysis of myocilin mRNA levels in the rat eye showed a decrease in mRNA production in the

rat retinas (as much as 33 fold) (Ahmed et al., 2001). In a second experiment, 62 adult female

albino Wistar rats had their left (OS) eye IOP raised by cautery of 2 or 3 episcleral veins.

Myocilin mRNA levels dropped significantly (2-2.5 times) in the irido-corneal angle and ciliary

body tissues for the first 3 weeks, but then returned to normal. In the last experiment performed

by Ahmed, et al., four rats had the optic nerve of their left eye surgically transected. After

performing a sham operation in the right eye as a control, mRNA myocilin levels were again

measured within two days. In the retina, myocilin levels increased (nearly doubled). Messenger

RNA levels did not change significantly in the angle tissues of sham and transected eyes

(Ahmedet al., 2001). In total, 74 different mRNAs in the retina increased in production after an

increase in IOP. Seven mRNA levels decreased. (Ahmed et al., 2004) Interestingly enough, in a

later paper by Ahmed et al., very little myocilin was found in the eye angle tissues of rats at all,

although several analogues were seen (Ahmed et al., 2004; Alvarado et al., 2005).









It has also been shown that an increase in myocilin production in transgenic Drosophila

eyes also leads to changes in the expression in other protein products (Borras et al., 2003). High-

density oligonucleotide microarrays have identified changes in the expression of at least 50

transcripts. Among these are the Drosophila homologs of aquaporin-4 and cytochrome-P450,

previously linked to some forms of glaucoma (Borras et al., 2003).

Myocilin is secreted into the aqueous humor as both a single protein and as two separate

parts. Intracellularly, myocilin is found in vesicles and processed by the endoplasmic reticulum.

It is often secreted into the aqueous humor of various species as a doublet of 55-57 kDa. This

doublet is caused by glycosylated and nonglycosylated versions of the protein being present

(Aroca-Aguilar et al., 2005; Stamer et al., 1998; Zimmerman et al., 1999; Caballero et al., 2000;

Rao et al., 2000; Jacobson et al., 2001; Nguyen et al., 1998). A segment of the myocilin protein

containing only the olfactomedin segment perfused directly into human cadaver or porcine eyes

has shown no effect on outflow facility (Goldwich et al., 2003). It has also been shown that

misfolding of the mutant myocilin in the endoplasmic reticulum can lead to ER stress and

cytotoxicity (Zimmerman et al., 1999; Joe et al., 2003). It has recently been proposed that a

mutation in myocilin (such as mutation P370L) could cause the endoproteolytic processing

within the endoplasmic reticulum to malfunction causing a regulation problem for the normal

activity for myocilin (Aroca-Aguilar et al., 2005).

Myocilin has also been linked to other tissues with transendothelial fluid flow (Goldwich

et al., 2005). Myocilin has been found in the podocytes of the kidney of the rat and induced in

the mesangial cells during glomerulonephritis. This knowledge helps support the possibility that

myocilin functions in cell-cell adhesion and/or signaling processes (Goldwich et al., 2005).

Myocilin has also been found in gliotic tissue of injured cerebral cortex, leading to the concept of









myocilin as an inhibitor to neuronal regeneration (Jurynec et al., 2003). It is also present

normally in the paranodal terminal loops of the nodes of Ranvier, and outer mesaxons and

basal/abaxonal regions of the myelin sheath of the peripheral nerves (Ohlmann et al., 2003). It

has been found in the sciatic nerve of rats as early as the 15th pOStnatal day (Ohlmann et al.,

2003).

Recently, et al, transgenic mice were created that would either express myocilin in the eye

at up to 15 times the normal level, or have it be completely absent (Gould et al., 2004). These

mice were able to demonstrate almost no clinically identifiable changes in the eye. Pathogenic

signs of glaucoma were absent (Gould et al., 2004). Similar results have been found in human

patients with the Arg46Stop mutation, which almost completely removes the entire myocilin

coding sequence, with no overt disease symptoms present (Gong et al., 2004).

It is also proposed that complexes may form between myocilin proteins in the aqueous

humor. It has been shown that hetero-oligomers formed by wild type myocilin and some mutant

types of myocilin can actually form larger complexes than wildtype alone, on the range of

150kDa (Gobeil et al., 2004). Myocilin has also been implicated in blocking the functions

mediated by the Heparin II domain of fibronectin. This activity also limits the number and type

of focal adhesions that can form in a human fibroblast plate (Peters et al., 2005). Reciprocally, it

has also been demonstrated that a mutation in the myocilin gene could be a gain of function,

actually causing the over production on myocilin or mis-regulating other functions (Kim et al.,

2001).

Causes and Risks of Myocilin Related Glaucoma

Glaucoma has been defined in many ways. Its simplest definition had been merely an

increase in intraocular pressure. In recent years the best definition has been as a group of









diseases of the optic nerve involving loss of retinal ganglion cells in a characteristic pattern of

optic neuropathy, often due to an increase in intraocular pressure.

Juvenile open angle glaucoma and adult onset open angle glaucoma have been linked to

mutations in the 3rd OXOn of the human myocilin gene (Adam et al., 1997; de Vasconcellos et al.,

2003). Most of the mutations are missense (Table 1-3 and 1-4) (Adam et al., 1997; Bunce et al.,

2003; Mackey et al., 2003).

In 2000, Angius et al. found a Gln368stop MYOC mutation and analyzed it in all living

members of a 5 generation family. The Gln368stop defect was found in 19 patients with primary

open angle glaucoma, 5 with ocular hypertension, and 22 healthy carriers. They found that the

presence of the mutation did not signify POAG at a later age and there must be other risk factors

involved (Angius et al., 2000; Chen, 2004).

Two Italian families were found to carry a mutation in myocilin, p.K423E or p.C25R, out

of 26 families tested (an 8% incidence). The evidence shows that a molecular genetic exam

should be included in the management of glaucoma cases (Bruttini et al., 2003; Angius et al.,

1998). French patients were shown to have significant association between mutations in MYOC

and raised IOP (Melki et al., 2003; Brezin et al., 1997; Brezin et al., 1998). In Chinese patients,

however, no link in myocilin mutations could be found in a phenotypically similar form of

glaucoma called chronic primary angle-closure glaucoma (PACG). Although there were a

number of mutations found in the 106 chinese patients tested, many of the mutations were also

found in the normal control group with no adverse effects (Aung et al., 2005). However, it is

possible that the normal controls could later develop glaucoma. Similarly, in studies of 91 and

492 Chinese patients, no link could be found between POAG and myocilin mutations (Lam et al.,

2000; Pang et al., 2002). In fact, a negative association was seen in the case of a Glyl2Arg in









that it may have protective effects against POAG (Pang et al., 2002). In the United Kingdom, a

lower than average number of linked mutations were found in the myocilin of the people in that

region. Of 426 people tested, only six had any mutations in their myocilin (1.4%), much lower

than the average in other countries (Aldred et al., 2004). Challa et al., showed there was an

overall 4.4% prevalence of myocilin mutations in the POAG population in Ghana, West Africa

(Challa et al., 2002). Finnish glaucoma families were found not to have any major mutations, just

a few polymorphisms in the Myoc gene and OPTN gene (Forsman et al., 2003). Indian

populations with POAG were found to have a 2% prevalence of myocilin mutations including

novel myocilin mutations (Kanagavalli et al., 2003; Mukhopadhay et al., 2002; Acharya et al.,

2002; Chakrabarti et al., 2005).

Some research has led to the conclusion that although a mutation in the myocilin gene is

not necessary for POAG or even JOAG, those individuals that develop glaucoma and have a

mutation in the myocilin gene generally have a earlier onset or higher peak intraocular pressure

in the disease (Craig et al., 2001; Abecia et al., 1996). But in other research, when cases of

glaucoma containing the myocilin Gln368Stop mutation were compared to cases without the

mutation, no significant differences were seen. Both IOP peak and age of onset were similar

(Graul et al., 2002).

The myocilin promoter MYOC.mt1 was screened for mutations as a cause of glaucoma by

using a series of 779 unrelated human patients, 652 with open-angle glaucoma and 127 glaucoma

suspects. When analyzed, plausible disease causing mutations were found in 3% of the entire

group. No link was made between polymorphisms in the MYOC.mt1 region and disease state,

except by Polansky, et al. who found it to be a strong marker for the progression of glaucoma

(Alward et al., 2002; Fan et al., 2004; Fan et al., 2004; Polansky et al., 2003; Ozgul et al., 2005;









Kirstein et al., 2000; Klein et al., 2004). It has also been demonstrated that a polymorphism in

the gene promoter may affect the severity or age of onset of glaucoma (Colomb et al., 2001).

One of the newest proposals for myocilin causative glaucoma is the mis-processing of

myocilin in the endoplasmic reticulum. The ER endoproteolytically processes the myocilin into a

35 kDa portion containing the C-terminal olfactomedin-like domain, and a 20 kDa portion

containing the N-terminal leucine zipper-like domain (Aroca-Aguilar et al., 2005; Ahmed et al.,

2004; Caballero et al., 2001; Carelli et al., 2004; Kong, 2001; O'Brien et al., 2000). It has been

shown the mis-processing of the myocilin may lead to an insoluble aggregate in the cells of the

ciliary body and accumulation in the irido-corneal angle of the eye, leading to a cascade of

cellular toxicity and mechanical blockage of the angle (Caballero et al., 2000; Caballero et al.,

2001; Jacobson et al., 2001).

I hypothesized the myocilin gene would be mutated in a hereditary glaucomatous dog

colony versus a group of normal healthy animals; myocilin protein content in the aqueous humor

would be higher in advanced glaucomatous animals than in mildly affected and normal animals;

and myocilin protein content would be greater in cells of the ciliary body, iris and trabecular

meshwork in glaucomatous animals than in normal animals. The goals of this study were to

demonstrate the possibilities of these three hypotheses, using an inherited glaucoma beagle

primary open angle glaucoma model, as well as other normal and spontaneous glaucomatous

dogs of different breeds.










Table 1-1: Loci and Genes Associated with Glaucoma
Gene Loci Chromosome Protein Phenotp Inheritance
MYOC GLCIA 1 q23 -24 Myocilin JOAG, POAG Autosomal Dominant
GLC1B 2cen- l3 POAG
GLCIC 3q21-24 POAG
GLC1D 8q3 POAG
OPTN GLCIE 10pl4-15 Otineurin POAG
GLC1F 7q35-36 POAG
CYPlB1 GLC3A 2p21 Cytochrome PlB1 Congenital Autosomal Recessive
glaucoma
GLC3B 1p36 Congenital
lacoma
PITX2 RIEGl, IRID2 4q25-27 Homeobox transcription factor Rieger
sndrome
FOXC 1 6p25 Forkhead transcription factor Congenital glaucoma;
Rieger/Axenfeld
anomaly
LMX 1B ABO adenylate kinase 934 Lim homeodomain Nail patella sndrome Autosomal Dominant















PrpetyorValue Remarks Reference
constituent


Table 1-2: Composition of aqueous humor


Volume
Ascorbate
Bl2
Bicarbonate
Carbon dioxide
Chloride
Glucose

Glycoprotein
Hexosamine
Lactate
Oxygen
pH

Protein


350 Cl
1.06 & 0.31 CIM/g H20
29.9 pg/ml
19.64 & 1.4 CIM/g H20
Pco2 = 38.6 mm Hg
134 & 22.4 CIM/g H20
3.00 & 2.04 CIM/g H20
3.70 4.78 CIM/g H20
63-75 Clg/ml
14.9-18.3 Cig/g
4.28 & 1.30 CIM/g H20
PO2 = 59.7 mm Hg
7.21
7.38 (7.31 -7.42)
Total protein:
31-1000 mg/100 g
Fractions as % of total :
Prealbumin 1 = 4.1
Prealbumin 2 = 8.2
Albumin 31.0
ai-globulin = 10.6
a2-glObulin = 11.2
P-globulin = 20.1
y-globulin = 12.7
z-fraction = 2. 1
162.9 & 4.3 gM/g H20


Mestrezat and Magitot, 1921
de Bernardinis et al., 1965
Phillips et al., 1968
de Bernardinis et al., 1965
Thiel, 1967
de Bernardinis et al., 1965
de Bernardinis et al., 1965
Pohjola, 1966
Cardia and Coriglione, 1962
Meyer et al., 1938
de Bernardinis et al., 1965
Thiel, 1967
Becker. 1957
Thiel, 1967
Kronfield et al., 1941





Praus, 1961


Plasma
Plasma
Plasma


0.042 & 0.023 CIM/g H20
271.9 pg/ml
26.47 & 2.64 CIM/g H20


16 cataract patients
Plasma = 109 & 18.4 CIM/g H20
Plasma = 6.33 & 2.45 CIM/g H20
Plasma = 4.72 6.55 CIM /ml


Plasma = 1.78 & 0.80 CIM/g H20
Cataract patients, 64-90 yrs

Cataract patients, 60-94 yrs





Results on one case
with secondary Cataract

Total protein = 55 mg/100 mg


Sodium


Serum = 176.4 gM/g H20


Cagainut, 1957









Table 1-3. Human myocilin mutations detected in population
Mutation POAG Controls p-value Protein References Year
Solubility


N/A


17 bp DUP 56-
72bp
ARG82CYS

ARG91 STOP
GLY252ARG
GLU261LYS
ARG272GLY
TRP286ARG

THR293LYS

GLY323LYS
GLN3 37GLU
GLU3 52LYS

PRO3 61 SER

GLY3 64VAL

GLY3 67ARG
GLN3 68 STOP





PRO370LEU





THR3771VET




SER3 93 ARG

VAL426PHE
CYS43 3ARG


1/1703
(0.058%)>
2/1703
(0.12%)

1/74 (1.4%)
3/79 (3.8%)
1/74 (1.4%)
1/1703
(0.058%)>
2/1703
(0.12%)
1/74 (1.4%)
1/79 (1.3%)
5/1703
(0.29%)
1/1703
(0.058%)>
2/1703
(0.12%)
1/50 (2.0%)
27/1703
(1.6%)
3/152
(2.0%)
2/74 (2.7%)
1/79 (1.3%)
1/50 (2.0%)
1/74 (1.4%)
1/152
(0.66%)
1/25 (4%)

2/1703
(0.12%)
1/74 (1.4%)
1/152
(0.66%)
1/1703
(0.058%)>
2/74 (2.7%)
7/25 (28%)


0/793

0/793

0/113
0/43
0/90
0/60
0/793

0/793

0/43
0/90
1/793
0.13%)
0/793

0/793

0/5
1/793
0.13%)
0/104

0/60
0/90
0/5
0/43
0/104

0/130

0/793

0/60
0/104

0/793

0/60
0/130


N/A

N/A

N/A
N/A
N/A
N/A
N/A

N/A

N/A
N/A
N/A

N/A

N/A


Fingert et al.


1999

1999

2000
2000
2000
2000
1999

1999

2000
2000
1999

1999

1999

1997
1999

1998

2000
2000
1997
2000
1998

2000

1999

2000
1998

1999

2000
2000


N/A Fingert et al.

N/A Lam et al.
N/A Shimizu et al.
N/A Vazquez et al.
N/A Shimizu et al.
N/A Fingert et al.

N/A Fingert et al.

N/A Shimizu et al.
N/A Vazquez et al.
Insoluble Fingert et al.

N/A Fingert et al.

Insoluble Fingert et al.


N/A N/A Suzuki et al.
P=0.0025 Insoluble Fingert et al.


N/A

N/A
N/A
N/A
N/A
N/A

N/A

N/A

N/A
N/A

N/A

N/A
N/A


Wiggs et al.

Shimizu et al.
Vazquez et al.
Insoluble Suzuki et al.
Shimizu et al.
Wiggs et al.

Vasconcellos
et al.
Insoluble Fingert et al.

Shimizu et al.
Wiggs et al.


N/A

N/A
N/A


Fingert et al.

Shimizu et al.
Vasconcellos
et al.









Table 1-3. Continued
Protein
Mutation POAG Controls p-value Solubility References Year
TYR43 7HIS 4/1703 0/793 N/A Insoluble Fingert et al. 1999
(0.23%)
1/152 0/104 N/A Wiggs et al. 1998
(0.66%)
ALA445VAL 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
lbp DEL codon 1/1703 0/793 N/A N/A Fingert et al. 1999
453 (0.058%)>
ILE465MET 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
ARG470CYS 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
ILE477ASN 1/1703 0/793 N/A Insoluble Fingert et al. 1999
(0.058%)>
1/74 (1.4%) 0/43 N/A Shimizu et al. 2000
PRO481THR 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
PRO481LEU 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
GLU483STOP 1/1703 0/793 N/A N/A Fingert et al. 1999
(0.058%)>
1544ins489STOP 1/79 (1.3%) 0/90 N/A N/A Vazques et al. 2000
ILE499SER 1/74 (1.4%) 0/60 N/A N/A Shimizu et al. 2000












Table 1-4: Human myocilin mutations detected in glaucoma pedigrees
Affected
Members,


References
Adam et al.
Booth et al.
Shimizu et al.
Shimizu et al.
Kee et al.
Stoilova et al.
Alward et al.
Mansergh et al.
Michels-
Rautenstrauss
Angius et al.
Stone et al.
Allingham et al.
Shimizu et al.
Angius et al.
Adam et al.
Shimizu
Suzuki et al.
Stoilova et al.
Michels-
Rautenstrauss
Alward et al.
Shimizu et al.
Kennan et al.
Stoilova et al.
Alward et al.
Morissette et al.
Mansergh et al.
Shimizu et al.
Alward et al.
Yokoyama et al.
Alward et al.
Richards et al.
Shimizu et al.
Adam et al.
Adam et al.
Adam et al.
Shimizu et al.
Stoilova et al.


with the Z
Mutation Pedigrees Mutation max


N/A
N/A
N/A
N/A
N/A
N/A
3.5
N/A

N/A
6.6
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A

N/A
1.3
N/A
N/A
N/A
N/A
N/A
N/A
N/A
13.8
N/A
11.6
N/A
N/A
N/A
N/A
N/A
N/A
N/A


Protein
Solubility
N/A
N/A
N/A
Insoluble
N/A
N/A
Insoluble
N/A


Insoluble
Insoluble



Insoluble






Insoluble

Insoluble

N/A
Insoluble
Insoluble

Insoluble
N/A
Insoluble
Insoluble

Insoluble
Insoluble
Insoluble
N/A
N/A


GLY246ARG
GLY252ARG
ARG272GLY
GLU323LYS
PRO334SER
GLN3 37ARG
GLY3 64VAL
GLY3 67ARG


1177GACA->T
GLN3 68 STOP



PRO370LEU






THR377MET

ASP3 80ALA

396INS397
LYS423 GLU
VAL426PHE

TYR437HIS
THR448PRO
ILE477ASN


ILE477SER
ASN480LYS
ILE499PHE
ILE499SER
SER5 02PRO


1
1
1
1
2
1
2
1


Year
1997
2000
2000
2000
1997
1997
1998
1998

1998
1998
1997
1998
2000
2000
1997
2000
1997
1998

1998
1998
2000
1998
1998
1998
1998
1998
2000
1998
1999
1998
1998
2000
1997
1997
1997
2000
1998




















Ir
r


C7P


Figure 1-1: Basic structures of the eye.


Figure 1-2: The Canine iris controls the amount of light entering the eye.




























































Figure 1-4: Rear of the Iris (I), Ciliary Body (CB), Ciliary Processes (CP), and Pars Plicata (PP).


Figure 1-3: Example of a horizontal pupil.




























































Figure 1-5: Zonules over the ciliary processes.


~1"~ :~: E



~a~re~- ~


r
~h -



































Figure 1-6: Pillars of the pectinate ligament from the base of the iris to the inner cornea.































Figure 1-7: Pigmented and non-pigmented epithelium of the ciliary body. Cellular junctions
between the two layers of epithelium of the ciliary process are very important. The
lateral intercellular junctions of the nonpigmented epithelium consist of desmosomes,
except at the apical end.










































































Figure 1-8: Human myocilin mRNA overlaid on human complete DNA for the region, showing
exons and areas removed by post processing. ATG's show two possible start points.
Blue underlined = Exon 1. Green underlined = Exon 2. Red underlined = Exon 3.


1234567890
GATCTCCAGT
ATAAACTAGA
GTGTGTGTGT
TGGGATGTTC
AGCGTGAAGG
AGGGCTGGCT
GCACCTCTCA
ACGTTGCTGC
GTGGGGGCCA
TGGCCAGTCC
AGACAGCAGC
CACCAATTGA
CCCTGAGGCG
CCGAGACAAG
TTGGAAAGCA
GGGCTGTGCC
TGGCTCGTAG
TAGCACAAGA
GATTACAGGC
TGGGCCATTT
CTTTGGCCTT
ATCTGGCTAT
TGGTCTTTAT
TTAACTTCCC
GTCAGAGCAG
TTCGTTTTCT
ACAGCAGAAA
AGGAGACCAC
CCAGTTTATG
GTGTACTCGG
AGACAGTGAA
CTACACGGAC
GGTGCCATTG
GTAAGCAGTC
AGATGCTACC
AACCGCTATA
TGAACATGGT
GAAGGAGATG
TTTGACTGCT
GTAGTCTGAG
TAATGACATA
ACCATTGCTC
ATAGCTCCTC
AGAATACAGT
AAAAAAAAAA


1234567890
TCCTAGCATA
AATATATCCT
GTGTGTGTGT
TTTTTAAAAA
CAACCCCCCT
CCCCAGTATA
GCACAGCAGA
AGCTTTGGGC
GGACAGCTCA
CAATGAATCC
ACCCAACGCT
CCTTGGACCA
GGAGCGGGAC
TCAGTTCTGG
GCAGCCAGGA
ACCAGGCTCC
TGACCTGCTA
CAGATGAATT
ATGAGCCACC
TTTCTTACAG
CCAGGAACTG
CTCAGGAGTG
TCATGTCTAG
TGGGAGCAGA
GTCTGCAGGA
TTTCTGAATT
CAATTACTGG
GTGGAGAATC
CAGGGCTACC
GGAGCCTCTA
GGCTGAGAAG
ATTGACTTGG
TCCTCTCCAA
AGTCGCCAAT
GTCAACTTTG
AGTACAGCAG
CACTTATGAC
CTCAGGGCTC
TTCCAAGTTT
GGCGTAGACA
GTTCAAGTTT
TTGCATGTTA
TGGCCAGCAT
TGGGTCTCAC
AAAAAAA


1234567890
GTGCCTGGCA
TGTTGAAATC
AAAACCAGGT
GAAACTCCAA
GTGCACAGCC
TATAAACCTC
GCTTTCCAGA
CTGAGATGCC
GCTCAGGAAG
AGCTGCCCAG
TAGACCTGGA
GGCTGCCAGG
CAGCTGGAAA
AGGAAGAGAA
GGTAGCAAGG
AGAGAAGGTA
CAGGCGCTCC
AAGGAAAGCA
ACGCCTGGCC
TAAAATTTTG
AAGTCCGAGC
GAGAGGGAGA
TGCTGTGTTC
GGGAGGGGAG
GTCAGCCTGA
TACCAGGATG
CAAGTATGGT
GACACAGTTG
CTTCTAAGGT
TTTCCAGGGC
GAAATCCCTG
CTGTGGATGA
ACTGAACCCA
GCCTTCATCA
CTTATGACAC
CATGATTGAC
ATCAAGCTCT
CTGGGGGGAG
TCATTAATCC
ATTTCATATA
TCTTGTGATT
CATGGTTACC
CGAATATAAG
ATAACCCTTT


1234567890
CAGTGCAGGT
AGCACACCAG
GGAGATATAG
ACAGACTTCC
CCACCCAGCC
TCTGGAGCTC
GGAAGCCTCA
AGCTGTCCAG
GCCAATGACC
AGCAGAGCCA
GGCCACCAAA
CCCCAGGAGA
CCCAAACCAG
GAAGCGACTA
CTGAGAAGGG
AGAATGCAGA
AGGCCTCCCT
CAGCGATCGA
GGCAGCCTAT
TCTCTTTCTT
TAACTGAAGT
CACCGGTATG
AGAGAATCAG
GAGAAGAGGA
TCATTGTCTG
TGGAGAACTA
GTGTGGATGC
GCACGGATGT
TCACATACTG
GCTGAGTCCA
GAGCTGGCTA
AGCAGGCCTC
GAGAATCTGG
TCTGTGGCAC
AGGCACAGGT
TACAACCCCC
CCAAGATGTG
CAGGCTGAAG
AGAAGGATGA
ATAAATATCC
TGGGGCAAAA
ACAAGCCACA
TAAGATGCAT
ACATTGTGAA


1234567890
TCTCAATGAG
TAGTCCTGGT
GAACTATTAT
GGAAGGTTAT
TCACGTGGCC
GGGCATGAGC
CCAAGCCTCT
CTGCTGCTTC
AGAGTGGCCG
GGCCATGTCA
GCTCGACTCA
CCCAGGAGGG
AGAGTTGGAG
AGGCAAGAAA
GCCAGTGTCC
GTGGGGGGAC
GCCTGCCCTT
TCCGCCTGCC
TTAAATGTCA
TTAATGCAGT
TCCTGCTTCC
AAGTTAAGTT
TATAGGGTAA
ACAGAACTCT
TGTTTGGAAA
GTTTGGGTAG
GAGACCCCAA
CCGCCAGGTT
CCTAGGCCAC
GAACTGTCAT
CCACGGACAG
TGGGTCATTT
AACTCGAACA
CTTGTACACC
ATCAGCAAGA
TGGAGAAGAA
AAAAGCCTCC
GGAGAGCCAG
ACATGGTCAC
TTTATCTTCT
GCTGTAAGGC
ATAAAAAGCA
TTACTACAGT
ATAAAATTTT


1234567890
TTTGCAGAGT
GTAAGTGTGT
TGGGGTATGG
TTTCTAAGAA
ACCTCTGTCT
CAGCAAGGCC
GCAATGAGGT
TGGCCTGCCT
ATGCCAGTAT
GTCATCCATA
GCTCCCTGGA
GCTGCAGAGG
ACTGCCTACA
ATGAGAATCT
CCAGACCCGA
TCTGAGTTCA
TCTCCTAGAG
TCGGCCTCCC
TCCTCAACAT
TTCTACGTGG
CGAATTTTGA
TCTTCCCTTT
ATGCCCACCC
CTCTCTCTCT
GATTATGGAT
GAGAGCCTCT
GCCCACCTAC
TTTGAGTATG
TGGAAAGCAC
AAGATATGAG
TTCCCGTATT
ACAGCACCGA
AACCTGGGAG
GTCAGCAGCT
CCCTGACCAT
GCTCTTTGCC
AAGCTGTACA
CCAGCCAGGG
CATCTAACTA
GTCAGCATTT
ATAATAGTTT
TAACTTCTAA
TGGCTTCTAA
CTTACCCAAA


1234567890
GAATGGAAAT
GTACGTGTGT
GTGCATAAAT
TCTTGCTGGC
TCCCCCATGA
ACCCATCCAG
TCTTCTGTGC
GGTGTGGGAT
ACCTTCAGTG
ACT TACAGAG
GAGCCTCCTC
GAGCTGGGCA
GCAACCTCCT
GGCCAGGAGG
GACACTGCTC
GCAGGTGATA
ACTGCACAGC
AAAGTGCTGG
AGTCAATCCT
AATTTGGACA
AGGAGAGCCC
TGTGCCCACA
AAGGGGGAAA
CTGTTCCCTT
TAAGTGGTGC
CACGCTGAGA
CCCTACACCC
ACCTCATCAG
GGGTGCTGTG
CTGAATACCG
CTTGGGGTGG
TGAGGCCAAA
ACAAACATCC
ACACCTCAGC
CCCATTCAAG
TGGGACAACT
GGCAATGGCA
CCCAGGCAGC
TTCAGGAATT
ATGGGATGTT
CTTCCTGAAA
AGGAAGCAGA
TGCTTCAGAT
PPPPPPPPAA
















~b ~
~i,~o~


~
n


~~cr~-_n~Ttr
~c~ w r. F oN


Figure 1-9: Myocilin consists of 3 exons and a 5-kilobase promoter region.


Basic region
(DNA contact
surface)


XBK-R R-A





Leucine ripper
(cilmrit;ation motif)


C C


Figure 1-10: Basic leucine zipper motif.














CHAPTER 2
MATERIALS AND METHODS

To analyze the myocilin gene, blood samples and/or buccal swabs were taken from both

normal and glaucomatous dogs. Dr. Gelatt' s glaucoma beagle colony at the University of Florida

was used as a known, inherited glaucoma model, to compare later with primary, secondary

glaucomatous samples as well as non-glaucoma aqueous humor samples collected from around

the nation (Gelatt et al., 1998; Gelatt et al., 1998; Demenais et al., 1979; Gelatt et al., 1981;

Gelatt et al., 2004). The glaucomatous dogs were further divided into mild, moderate and severe

glaucoma (See protein analysis).

Gene Analysis

The confirmation of the structure of the myocilin gene in the canine was the first phase of

this study. To obtain DNA samples, two milliliters of blood were collected from one primary

open angle glaucomatous beagle and one normal dog in EDTA treated vacuum tubes. The blood

sample was then mixed with enough red blood cell lysis solution (Madisen et al., 1987) to bring

the total volume to 45 ml. This solution was heated in a water bath at 370 for 15 minutes. The

solution was then placed in a centrifuge at 2000 rpm for 10 minutes to pellet the white blood

cells containing the DNA. The pellet was then broken up by tapping and 200Cl of Gentra cell

lysis solution (Gentra PureGene Systems, Minneapolis, MN) was then added. The solution was

then transferred to a sterile 2 ml eppendorf tube using a sterile pipette. It was then vortexed for

10-40 seconds. The solution was quite thick. Two hundred and fifty microliters of Gentra Protein

Precipitation solution was then added and vortex mixed as little as possible (to avoid mechanical

shearing of the DNA). It was then centrifuged at 6000 g for 10 minutes to precipitate the










proteins. The pellet that formed was fairly tight and tannish brown. No strings of protein were

still visible. If the pellet didn't form well after the first centrifuging, the sample was placed on

ice for 5 minutes, and then re-centrifuged. The supernatant, containing the DNA, was carefully

removed with a wide bore pipette tip into a new 2 ml eppendorf tube. We were careful to avoid

disturbing the protein pellet. 200 Cl1 of chloroform was then added to the solution in the new tube

and mixed vigorously by inversion several times. The solution was then centrifuged at 10,000

rpm for 5 minutes. The top layer of the resulting solution was then transferred to a new sterile

eppendorf tube, carefully avoiding the interphase. The Einal DNA sample needs to be completely

protein-free or the DNA will degrade with time. The tube was then inverted gently with 1 ml

isopropanol (2-propanol) until the DNA completely precipitated (Schleren lines disappeared).

This Einal solution was then centrifuged at 2000 g for 2 minutes to cause the DNA to pellet. The

supernatant was then poured off, and the DNA pellet was washed with 300 Cll of genomic quality

70% ethanol (ETOH). It was then centrifuged for 2 minutes at 2000 g to re-pellet the DNA. The

ethanol was then carefully poured off and the DNA left to air dry for a few minutes (careful not

to let it completely dry). The pellet was then resuspended in 200-500 Cll of sterile lX TE (40 mM

TRIS, 1 mM EDTA, pH 8.0) and inverted for a few days to allow the DNA to dissolve.

When our study first began, the canine genome had not yet been released. We

extrapolated a possible "best guess" set of primers by aligning known myocilin sequences from

other species. These included: human, mouse, rat, cow, rhesus, pig, and rabbit. Once an

alignment of these seven species was made, the most conserved areas of the gene were used to

make primers for PCR replication and amplification (Table 2-1).

Later (summer 2004), new primers were made based on the newly released canine genome

from a team led by Kerstin Lindblad-Toh, Ph.D., of the Broad Institute of MIT and Harvard,










(Cambridge, MA), and Agencourt Bioscience Corp., (Beverly, MA) based on a 6-fold shotgun

sequence of a common canine (canis familiaris) Boxer dog (Figure 2-1). The known sequences

for human, mouse, rat, cow, rhesus, pig, and rabbit were aligned against the new canine genome,

and the sequence for myocilin was extrapolated in the dog. Primers were based on this sequence

in the dog. Eleven primers were designed following common primer design guidelines from Dr.

Margaret Wallace at the University of Florida:

* Design primers only from areas with unambiguous sequences.

* Choose a priming site that is 30-50 bases from where new sequence is required.

* Primers with one or more G or C residues at the 3'-end will increase binding efficiency.

* Primers with long runs of a single base (i.e., more than three or four, especially G or C)
should be avoided.

* Use of primers longer than 18 bases minimizes the chances of encountering problems with
non-specific hybridization.

* For cycle sequencing, primers with melting temperatures (Tm) above 450C generally
produce better results than primers with lower melting temperatures. Tm's in the range of
550C to 650 work well. Avoid using primers with Tm's above 650C-700C.

* For primers with a GC content of less than 50% (GC content of 55% is ideal), it may be
necessary to extend the primer sequence beyond 18 bases to keep the melting temperature
above the recommended lower limit of 450C.

* Avoid primers which could form secondary structures (i.e., inverted repeats).

* Avoid primers that can hybridize to each other to form dimers (complementary regions < 4
bp).

* And finally, do not confuse "picomoles" with "picomolar" when calculating primer
quantities.

These primers are listed in table 2-2. Primer pairs were then used to sequence the entire

open reading frame and untranslated regions of the gene.

To sequence a complete copy of the myocilin gene, we first ran PCR on multiple matched

pairs of our final primers. One quarter microliter of purified DNA sample was combined with 2.5









Cll 10x PCR buffer solution, 2.0 Cll dNTP solution, 0.5 Cll of each 5' and 3' primers, 0.25 Cll Taq

polymerase, and water to bring the volume to 25 total microliters. This recipe would shift

slightly depending on the concentration of the purified DNA, and the strength of the Taq.

The solution would then be placed in a PCR reactor for 25-35 cycles. The cycle would

include a 45 second denaturing phase at 940 C, a 45 second annealing phase at 45-660 C

(depending on the primers used), and an extension phase of45 seconds at 720 C. A final

extension phase at the end of the cycles would lat at least 20 minutes at 720 C.

The PCR products were then direct sequenced. Direct sequencing involves sequencing

double stranded PCR products. Both alleles are present in the sequencing reaction resulting in

one double peak in the case of a base pair change (for a heterozygote) and a more complicated

pattern of double peaks in cases of insertions, deletions, alternate splicing, etc. While it is

important to align the sequence against the known normal or published sequence, careful perusal

of the sequence chromatogram is essential to detect mutations when using Direct Sequencing.

The first step in direct sequencing is PCR product filtering to remove all foreign / non-

DNA material. Millipore microcon-PCR centrifugal filtration devices were used for this step by

inserting a filter into one of the eppendorf tubes provided in the kit with the purple side up. We

then added as much of our PCR product as possible (usually 20-22 CIl) and added sterile water to

bring the total volume up to 400 Cl. We then closed the cap and centrifuged in the adjustable-

speed microfuge at 1300 x g for 15 minutes.

Next, we removed the filter device and placed purple side up into a fresh Millipore

eppendorf tube, and added 20 Cll of sterile distilled water, being careful not to touch the

membrane. Finally, we inverted the filtration device so that the white part was sticking out of









the tube. The cap did not close in this position. After spinning at 1300 x g for 2 minutes in the

adjustable-speed microfuge, our filtered product was recovered in the bottom of the tube.

To check our purified results, and confirm that we still had present DNA, we ran a basic

check gel on agarose. We then ran a Big Dye 3 Sequencing Reaction (ABI Applied

Biosystems, Foster City, CA). Starting with 3 Cll purified PCR product, we added 2 Cll Big Dye 3

Reaction Mixture, 2 Cll 5x sequencing buffer, 0.2 Cll primer, and 2.8 Cll sterile distilled water. One

drop of oil was placed on top of reaction to minimize evaporation during the PCR reaction. A

PCR reaction programmed at 960 C for 30 seconds, 500 C for 15 seconds, and 600 C for 4

minutes for 25 cycles was used. An Edge Biosystem column was prepared by spinning in the

adjustable-speed centrifuge for 3 minutes at 850 g. The column was transferred to a clean 1.5 ml

eppendorf tube. Using a pipette set for just under 10 Cll, the PCR reaction was removed from its

tube and transferred to the center of the now dry column in the clean eppendorf tube. We

carefully avoided transferring any of the oil used in the PCR reaction. The cap was closed and

centrifuged for 3 minutes at 850 g. After the sequencing sample had been run through the

column, we dried the volume collected down in the speed-vac (caps open) until sample was

completely dry. Approximately 30 minutes with full vacuum and medium temperature to dry.

We finally stored the dry sample in the freezer, after it called to room temperature until we were

ready to sequence.

To the thawed dry samples from before, we added 17ul of TSR ( ABI Prism Template

Suppression Reagent) and vortexed the sample for several seconds. The tubes were then

centrifuged for a few moments to recollect the samples in the tubes. The tubes were then heated

to 940C for 2-3 minutes and then placed on ice for 5 minutes. This final solution was then

vortexed for 15-20 seconds and then centrifuged to re-collect in the tube. Approximately 16C1l of









the samples was now removed from the tube, careful to avoid air bubbles, and placed in a Perkin

Elmer 0.5 ml sequencing tube and capped with Perkin Elmer Septa gray rubber stoppers. The

samples were finally run on the Applied Biosystems (ABI 310) Sequencer. All results were

analysed using SeqEd v. 1.0.3.

Protein Analysis

Myocilin protein levels were analyzed in the aqueous humor of glaucomatous and normal

dogs. Dr. Gelatt's glaucomatous beagle colony was used initially as a source of inherited

glaucoma dogs. Sixteen dogs were used and classified as either having mild, moderate or

advanced glaucoma as diagnosed by Dr. Gelatt. Mild glaucoma was defined as little or no visible

changes to the eye, with only low intraocular pressure increase. Moderate glaucoma was

classified as a spike in intraocular pressure and still little or no externally visible problems.

Advanced glaucoma was defined as a large spike in IOP, and visual eye problems (ie, enlarged

globe, corneal edema, lens luxation and ocular irritation). Clinical samples were also collected

from around the nation.

To compare to the beagle POAG model, aqueous humor samples were collected from a

number of veterinary ophthalmology specialty clinics of several different breeds affected with

spontaneous glaucoma. Those with suspected inherited glaucoma included both POAG as well as

PCAG types. A total of 353 samples (141 Male, 194 Female, 18 unreported) with average ages

of 107 months for the males, 104 months for the females and 105 months for the unreported

genders were analyzed. These were classified by the attending veterinary ophthalmologist as

either primary glaucoma (10), secondary glaucoma (20), cataractous, diabetic cataractous or

other. Primary glaucoma has no other signs of ocular disease except a spontaneous ocular

hypertension and occurs in several purebred dog breeds. Secondary glaucoma is described as

secondary to a primary disease (such as a uveitis) or trauma. Cataractous aqueous humor samples









were used as a non-glaucoma control, as the samples are relatively easy to collect during a

cataract surgery without any additional trauma to the dog. Diabetic cataracts were separated from

the cataractous group, to check for any diabetic changes that may affect this study.

A 0. 1 ml sample of aqueous humor was drawn from the anterior chamber each dog in the

study. This was done by anesthetizing the dog with 3-5 ml propofol IV, and maintaining with 2-

3% isoflurane gas anesthetic. The eye was sterilized with a small amount of iodine wash and

rinsed with sterile water. The eye was held with a small single toothed force while a 1cc

tuberculin syringe with a 0.75 inch 30 gauge needle was carefully inserted just center of the

limbus. Careful not to make contact with the iris, the 0.1 Cll sample was drawn. A sterile gauze

applicator stick was placed at the point of entry as the needle was withdrawn to stop aqueous

outflow. The sample was then either kept cold on ice, frozen on dry ice, or placed in a vial with

100 Cl~ protease inhibitor (Mini-Complete, Roche Scientific), and then transferred to a -800 ultra-

freezer for storage. A Western blot or Comassie stain was run on each sample to compare these

myocilin levels. A polyclonal anti-body was used from either Alcon Pharmaceuticals (from

human trabecular cell culture) or Santa Cruz Biotechnologies (from mouse anti-human

myocilin).

Comassie Stain

To analyze the total proteins in the aqueous humor we used a modified SimplyBhte

SafeStain M~icrowave Protocol from Invitrogen. An SDS reducing buffer (Cell Signaling

Technology) was prepared by combining 1 part reducing agent, 10 parts buffer, and 20 parts

sterile deionized water. Two Cll of each sample was then combined with 3 8 Cl~ of the SDS

reducing buffer. The samples were then heated at 1000C for 5 minutes in a boiling water bath.

They were then moved to an ice bath for a further 5 minutes. The samples were then placed in a

centrifuge for 5 minutes at 14,000 rpm.










12% Bis-Tris gels were loaded into our electrophoresis apparatus with lx running buffer

(Invitrogen). Each gel was then loaded with sample and controls. The first lane of the gel was

loaded with 8 Cll of a control ladder (SeeBlue Plus 2, Invitrogen@). Lane two contained 8 Cl1 of a

human myocilin control (Alcon Labs), prepared similarly to the samples. Lanes 3 and higher

were inoculated with 4 Cll of each sample/buffer solution. The gel was then placed in an electric

current for 3 hours at 60V.

At the end of 3 hours, the gel was removed from its cassette and trimmed down. The gel

was placed in 100 ml of sterile deionized water and heated in a 1000w microwave oven for one

minute and 25 seconds. It was then placed on a clinical rotator for 1 minute. This was repeated 2

more times. After the Einal wash, 30 ml of Simply Blue Safe Stain (Invitrogen@) was added and

the gel heated for 35 seconds and then placed on the rotator for 10 minutes. The stain was

decanted from the gel dishes and a single water wash was performed, followed by a 20 ml 20%

sodium chloride wash for 10 minutes. The gels were then taken to a Biorad ChemiDoc XRS

imager for scanning and densitometry.

Western Blot

Western blotting with a human anti-myocilin antibody was begun exactly the same way as

our Comassie protocol. After the samples were run for 3 hours at 60V, the gels were removed

and the cassettes discarded. Two pieces of filter paper and 4 sponges were liberally soaked with

lx Transfer buffer (Invitrogen). A sandwich was made with two sponges, 1 fi1ter paper, the gel,

one piece of 0.2Cpm nitrocellulose membrane, another filter paper, and the last two sponges

careful to minimize air bubbles. The sandwich was placed in a western blotting press with the gel

towards the cathode and the membrane towards the anode. The western blot transfer was run at

30V for 1.5 hours.









When the transfer to the nitrocellulose membrane was complete, the membrane was

removed to a dish and a small amount of 1% Ponceau S was added. Gently shaking for 1 minute

reveals any protein bands in the membrane, and shows that the transfer was successful. The

Ponceau S was gently rinsed from the dish with deionized water. The ladder was marked with a

permanent marker for later measurements. A Block solution was made with lx TBA, 0.5%

Tween 20, and 1% BSA. The membrane was then covered with the block solution for 30 minutes

at room temperature and gently shaken. While the blocking was being performed, the primary

antibody was prepared, in this case rabbit anti-human myocilin (Santa Cruz Biotechnologies). An

antibody dilution buffer was prepared by using a 1:10 dilution of the block solution. Using 2.5ml

of the antibody dilution buffer, a 1:500 antibody dilution is made by adding 5 Cll of primary

antibody. The blocked membrane was then placed in a small bag with the diluted primary

antibody and gently rocked overnight at 40C.

The next morning, the nitrocellulose membrane was then washed in a solution containing

0.05% Tween 20 in 1% TBS (USB Corporation) four times for 5 minutes each. During final

wash, a new bag was prepared with al:500 dilution of donkey serum (5 CIl) in 2.5 ml antibody

dilution buffer. The sealed bag with the membrane and the serum dilution was then placed on a

nutator for 30 minutes. A secondary anti-body 1:2000 dilution was then prepared using 5ml of

the antibody dilution buffer and 2.5 Cl~ donkey anti-rabbit antibody (Santa Cruz Biotechnology).

A new bag was prepared and the membrane moved into it with 2.5 ml of the secondary antibody

dilution and gently agitated for 90 minutes at room temperature. Eighty minutes into the

agitation, our Avidin/Biotin conjugate (ABC) solution was prepared (Pierce Biotechnology). The

membrane was then washed 4 times for 5 minutes each, as before. At the end of the final wash,

the membrane was placed in a new bag with 3 ml of the ABC solution and rocked on the nutator









for 30 minutes at room temperature. The membrane was then removed and washed four times as

before. During the final wash we prepared 6 ml of Supersignal West Pico Chemiluminescent

Substrate (Pierce Biotechnology). The membrane was covered by the chemiluminescent

substrate in a small dish for 1 minute and then sealed in plastic wrap and taken for imaging on a

Biorad ChemiDoc XRS. The membrane was exposed to the digital imager for 10 minutes and the

image used for analysis.

Myocilin Protein Localization

Specimens from the anterior uveas of 10 beagles, five with inherited glaucoma (3-mos- to

13-yrs-of age) and five age-matched normals, 1 normal walker hound, 1 normal schnauzer, and 2

cocker spaniels with spontaneous glaucoma were used in this study. The presence and

localization of myocilin in the normal and glaucomatous canine anterior eye were studied by the

use of immunohistochemical and immunocytochemical techniques.

For immunohistochemistry, the samples were incubated sequentially, first in peroxidase

block, followed by goat serum, and then with the rabbit polyclonal primary antibody for human

myocilin. The samples were then incubated with an anti-rabbit donkey antibody with a

biotinylated link followed by peroxidase-labeled streptavidin and then by substrate-chromogen

AEC. Normal, mild, moderate, and severe glaucoma samples were compared, and examined for

similarities and differences using light microscopy.

With immunocytochemistry, samples were embedded in L.R. white resin. Sections were

cut at 90 nm and mounted on nickel grids. These grids were incubated with bovine serum

albumin followed by goat serum. The samples were then incubated with primary antibody and

then the secondary antibody, 18 nm colloidal gold labeled goat anti-rabbit IgG. Grids were then

examined using transmission electron microscopy.









Microarray Gene Chips

Microarrays, often called DNA chips, usually consist of a piece of glass or nylon on which

hundreds of pieces of DNA strands, known as probes, are arranged in a regular pattern. Analysis

of those strands provides a picture of gene expression that takes place in a cell during a given

moment. New microarray gene chips, developed with our help, were used to screen for RNA

transcription in the eye. Tissue samples from both glaucomatous and normal dogs were collected

(Table 2-3). These included ciliary body, iris and trabecular meshwork / irido-corneal angles.

The samples were fast frozen, or stored in RNA-later (Qiagen). The samples were then ground

down and the cells lysed. The mRNA was extracted using University of Florida ICBR protocols.

The mRNA was then reverse transcribed into cDNA and hybridized with a biotin transcript. The

samples were heated in the presence of Mg2+ and fragmented into biotinylated cRNA segments.

These segments were then hybridized on the DNA chip for 16 hours and scanned in the ICBR

core laboratories. The results were analyzed with proprietary software and normalized using

canine GAPDH as a housekeeping gene.











Table 2-1: Original canine myocilin primers


Primers
CADODCAO lF
CMYfOCAO1R
CATOOCAO2F
CMYfOCAO2R
CMYODCAO3F
CMYfOCAO3R
CATOOCAO4F
CMYfOCAO4R
CAOLOCB01F
CNTOOCB01R
CMYOCOC1F
CMYOCOC1R
CAOLOCO2F
CAOLOCO2R
CATOOCO3F
CAOLOCO3]R
CATOOCO4F
CATOOCO4R
CMYOCOCF
CATOOCO5]R
CATOOCO6F
CAOLOCO6]R
CAOLOCO7F
CAOLOCO7]R
CATOOCO8F
CATOOCO8]R
CATOOCO9F
CAOLOCO9]R
CMYfOC 10F
CMffOC 1OR
CMYfOC 11F
CATOOC 11]R
CMffOC 12F
ChfYOC 12R
CMYfOC 13F
CMYfOC 13]R
CMYfOC 14F
ChfYOC 14R
CMYfOC 15F
CATOOC 15]R
CMYfOC 16F
CMYfOC 16]R


Sequence 5' to 3'
CAGGGAGGGCTCTCCAGTAT
GCTGGCCACACTGAAAFATATAC
CTGCTACTTCTGGCCTGTCTCT
CTTGGGTTTCCAGCTGTTCT
GAGACCTGGAGTCCACCAFAA
CTCTTCTCAGCCTTGCTACCTC
CAAGTCAGCTCTGGAAGAAGAA
CTTGGCCCTCCTTAATTCATCT
GCCTATTAFAATACCATCCTCAGCA
CTCTTGCCAGGCTGACCTGT
CCTTCATATCTTTCTTGATCTTAGGG
TTTTTCAATTTACTCTCAGAAGCTG
TTTTCAGAA1ACTGTGACAATCTG
AAAA1FAT GAAACAAAA1FAT CAAG TCA
CCGCTAA1ATCTAAGTTTTCAATCA
TTGTTTATTCATGAGAGACACACAGAG
GTGGCTCAGTGGTTGCTTAAC
ACCCAGGTGGTTCAGTCAGTTA
TTAGAGAGAGAGAGCATGAGCA
TGATCGATGTGTCATATGAATTG
AAAFAT GAAG TAA1ATCAGATAT GGAAG T
AGACACAGAGCGTCCAGGTTTA
GGCATTTACCCTCTACCCAGTA
CTCATCCACACCCCGTACTT
TGTCCTTAATTCTCCAGGATGC
GTCTCAGCGGTCAGCTCGTAG
AGACCACGTGGAGAATCGAC
ACTGCTTCCGGATGTTAGTCTC
GCTACACGGACATCGACCTG
CTTCTCCAGGGGGTTGTAGTC
CCACCTGTACACCATCAGCAG
CTTAAAA1FAGCCGAGAAAFAGCTG
GACAACTTCAA.CATGGTCACCT
GAA.GAGACTACTATGCATGACAGCTT
GTCTGACCGTGTGGAFAACAG
CCCCTCCTCTAATTATGGCTTG
AAAFAGG CC C TTAC TG G CTAA1AG
CAACCCCAAGAGATGACCTG
TAGTGGGCTTCTAAGGCTTCAC
AGAGAGGGGAAGTTGAGGAA1AG
GGAGCATTACTGGTGTGTGTGT
GCAGGTTCAGTTACCAAAA1FAGTC











Table 2-2: Final canine myocilin primers


G or T, H= A or C or T, V= A or C or G, N= A
or C or G or T


Name
DMYOC 1
DMYOC2
DMYOC3
DMYOC4
DMYOC5
DMYOC6
DMYOC7
DMYOC8
DMYOC9
DMYOC 10
DMYOC 11
Key:


Sequence 5' to 3'


GARGA
TTCTG
TCCCT
ACCTC
TGGAA
CTCBG
GCAAG
GTGGG
GTGAA
GTCAA
TTGAT
R= A or
S= C or I


ARCCT
GCCKG
GGAGA
CTSGC
TTTGG
ACT TC
TATGG
CTTGG
GGCHG
TGTCY
RTCAT


CACCM
CYTGG
GYCTC
TGCTG
ACACK
ARYTC
HGTGT
GGTCT
AGAAG
GTGTA
ARGTG


AGCCT
TGTGG
CTCCA
CTYTC
TTGGC
CTGGA
GGATG
CKCAT
GAA1AT
GCCAC
ACCAT


C
G
C

C
AG


YC

GTT


G, Y= C or T, M=
G, W= A or T, B=


= A or C, K= G or T,
C or G or T, D= A or











Table 2-3 : Dogs used for microarray analysis with short history.
Dog Age Gender Glaucoma Previous treatments:
Samson 14 yr Male Advanced 1992 Dexamethasone, 1995 Timolol,
Pilocarpine, 1996 Trusopt, Betagan,
Methazolamide, Humersol, 2001 Travaprost,
Latanoprost, Bimatoprost, Rescula,
Brimonidine
Victoria 11 yr Female Advanced 1996 Trusopt, Betagan, Methazolamide,
Humersol, 2001 Travaprost, Latanoprost,
Bimatoprost, Rescula, Brimonidine
Hunter 6 m Male Normal None.
XPX2 1 yr Male Normal None.
AZG2 1 yr Female Normal None.
XKX2 1 yr Male Normal None.
1DG2 1 yr Female Normal None.













































Figure 2-1: Boxer made famous for providing the DNA for the first shot-gun DNA sequence for
camines.














CHAPTER 3
RESULTS

Genomic Findings

The newly designed primers were successful in amplifying sequences from the canine

genome on the canine chromosome 7. Fragments were amplified from normal and glaucomatous

beagle DNAs and sequenced. These were then aligned using SeqEd (ABI). Comparisons

between our normal control dog and the reported canine genome were extremely similar

although there were a few insignificant differences. Comparisons between the glaucoma dogs

and the reported canine genome DNA were near identical. The glaucoma dog genomic sequence

(all 3 exons, untranslated regions, and flanking intronic sequences) was identical to normal

beagle sequence. No structural or mutational differences were seen between the glaucoma dog

and the published normal canine genome. The 1451 bp dog MYOC cDNA sequence is shown in

figure 3-1.

Expected differences with other known species sequences of the myocilin gene were

present, which were not expected to be pathogenic. None of the published known mutations of

myocilin were present in any of the samples tested. RT-PCR analysis of trace amounts of RNA

from the trabecular meshwork failed to amplify any fragments, so we could not rule out a deep

intronic mutation that could affect splicing.

Protein Analysis

Using Western blot with human polyclonal antibodies made by Santa Cruz

Biotechnologies, we were able to demonstrate the presence of myocilin in the aqueous humor of

the dog. Its banding appearance was very similar to reported findings at approximately 55kDa,









with two other expected bands nearby (Figure 3-2). Immunohistochemistry also showed this (see

sections below).

Inherited Model Glaucomatous Dogs

The myocilin protein was shown to be present in the Gelatt glaucoma beagle colony using

Comassie staining and Western blot techniques (Table: 3-1, Figures 3-2, 3-3, 3-4, 3-5). A human

trabecular meshwork derived myocilin protein control (Alcon) was used on every gel for relative

comparisons, and given a rank of 1 unit on each gel. In the younger, nearly normal (mild

glaucoma) beagle eyes (n= 4 dogs) a relatively low level of myocilin was detected. It was

characterized as a single band approximately 53-57 kDa. In the youngest dogs (1.5 yrs of age),

two faintly visible bands above and below the main band can be seen. The level of myocilin for

the mild glaucoma dogs was approximately 1 to 2 versus the human myocilin protein control.

The intensity of the myocilin bands increased as the glaucoma severity classification increased.

The moderately affected dogs showed a marked increase in the presence of myocilin protein

(five to six-fold versus the human control). The highest levels of myocilin were found in the

most severe cases of inherited glaucoma, with levels up to 15 times the human control amount.

Clinical Samples

A total of 353 samples (141 Male, 194 Female, 18 unreported gender) with average ages

of 107 months for the males, 104 months for the females and 105 months for the unknown

gender dogs were analyzed. Breeds seen included: Airedale (1), Akita (1), Alaskan Malamute

(2), Australian Shepherd (5), Australian Cattle Dog (1), Basset Hound (16), Bearded Collie (1),

Bichon Frise (10), Border Collie (2), Boston Terrier (5), Boykin Spaniel (2), Cairn Terrier (2),

Cavalier King Charles Spaniel (1), Chihuahua (3), Chow Chow (8), American Cocker Spaniel

(62), Dachshund (3), Miniature Dachshund (1), Dalmatian (2), English Cocker Spaniel (1),

Golden Retriever (3), Gordon Setter (1), Great Dane (1), Great Pyrenees (1), Italian Greyhound









(4), Jack Russell Terrier (4), Japanese Chin (1), Keeshond (2), Labrador Retriever (10), Lhasa

Apso (9), Maltese (6), Manchester Terrier (1), Mixed Breeds (68), Newfoundland (1), Papillon

(1), Pembroke Welsh Corgi (2), Miniature Pinscher (3), Pomeranian (4), Miniature Poodle (19),

Standard Poodle (6), Pug (5), Rhodesian Ridgeback (1), Saint Bernard (1), Samoved (2),

Schipperke (1), Miniature Schnauzer (12), Standard Schnauzer (2), Scottish Terrier (2), Shar Pei

(2), Shiba Inu (4), Shih Tzu (21), Siberian Husky (5), Welsh Terrier (1), West Highland White

Terrier (4), Wheaten Terrier (2), and Yorkshire Terrier (12). Cataractous dog aqueous humor,

used as non-glaucomatous controls, was shown to have little or no myocilin present at the

dilutions used to visualize the glaucoma animals. With few exceptions, myocilin protein levels

were found to be increased in animals with primary spontaneous glaucoma and secondary

glaucomas (Figures 3-6, 3-7, 3-8). The level of the myocilin present could be correlated to the

severity of the disease with the most advanced cases having the greatest apparent amounts of

myocilin. Comparisons between differing glaucoma groups showed significant differences.

Normal (Cataractous) dogs had the lowest level of myocilin at 4140.27 & 674. 12 Cpg/ml (average

Sstd dev). Diabetic cataractous dogs were found to have similar levels at 3339.37 & 774.71

Cpg/ml. Primary spontaneous glaucoma dogs were found to have an aqueous humor myocilin

protein level of 29404. 18 & 7449. 11 Cpg/ml. Secondary glaucomas had the highest level of

myocilin in the aqueous humor with 44797.03 A 11659.83 Cpg/ml. Severe cases of glaucoma also

had extra banding and a more globular appearance on the Western blot and Comassie gels

(Figure 3-6). No obvious correlation could be made between myocilin levels and age or sex.

Different breeds showed some but no statistical significant differences in severity, only in

number of samples received (Table 3-2). This may show a predominance of spontaneous










glaucomatous cases in certain breeds or may be bias of ascertainment based on frequency of

those breeds in the United States.

Immunohistochemistry

Specimens from the anterior uveas of 10 beagles, five with inherited glaucoma (3-mos- to

13-yrs-of age) and five age-matched normals, 1 normal walker hound, 1 normal schnauzer, and 2

cocker spaniels with spontaneous glaucoma were used in this study.

Within normal, mild and moderately glaucomatous canine specimens from age groups

three months to thirteen years of age, identical immunolabeling of myocilin was observed by

light microscopy. Immunolabeling in these specimens showed that myocilin was homogeneously

distributed in ocular tissues (Figure 3-9). Immunolabeling of specimens from dogs with

advanced glaucoma, however, exhibited an increased aggregation in areas surrounding the ICA,

nonpigmented epithelium of the ciliary processes, and anterior cornea (Figure 3-10).

Within the cornea, intense staining for myocilin was seen throughout the cytoplasm of

cells within the corneal epithelium (Figure 3-11 and 3-12) and endothelium (Figure 3-13).

Within the corneal stroma, mild labeling was evident as thin extracellular lines running parallel

to collagen bundles. There was no staining of Descemet' s membrane.

Within the iris, cell membranes of smooth muscle cells of the sphincter and dilator

muscles stained positive, as well as most resident cells of the iris stroma (Figures 3-14 and 3-15).

Positive staining of vascular endothelial cells within the iris vessels was observed.

Within the ciliary body, the cell membrane of ciliary smooth muscle cells stained

intensely. Vascular smooth muscle cells surrounding the ciliary body arteries and arterioles

stained intensely. The cytoplasm of cells within the nonpigmented layer of the ciliary epithelium

of the ciliary body and processes stained intensely (Figure 3-16 and 3-17). Labeling in the ciliary









epithelial cells of the pars plana was weaker than in the pars plicata. There was localized labeling

in stroma of the ciliary processes.

Trabecular meshwork cells were homogenously labeled (Figure 3-18). The sclera

adj acent to the angular aqueous plexus as well as other parts of the sclera stained positive.

Scleral staining was observed extracellularly between collagen bundles (Figure 3-19). Vascular

smooth muscle cells of arterioles and arteries within the sclera labeled intensely (Figure 3-20).

In samples with advanced glaucoma, greater intensity of staining was observed within the

sclera adj acent to the ICA; trabecular meshwork cells of the ICA; and the nonpigmented

epithelium of the ciliary processes in tissues surrounding the collapsed irideocorneal angle

(Figure 3-10). In addition, vitreal membrane-like material labeled intensely within the posterior

chamber (Figure 3-21 and 3-22) and corneal epithelium (Figure 3-12).

Immunocytochemistry

Myocilin was identified in the trabecular meshwork cells of older glaucomatous dogs as

well as normal dogs (Figure 3-23, 3-24, and 3-25). It was also found extracellularly in the

extracellular matrix around the trabecular meshwork (Figure 3-26). Lastly, it was also observed

in the non-pigmented epithelium of the ciliary body and vitreal-like material within the posterior

chamber of a 10 year old glaucomatous beagle (Figure 3-27 and 3-28).

Microarray

In comparisons of 6 dogs (4 normal and 2 glaucomatous), there were some differences

noted in the mRNA levels of certain genes. The analysis of the final microarray run showed a

signaling ratio of 1:0.4 in normal beagle dogs versus glaucomatous beagle dogs when hybridized

with the human myocilin cDNA probe and 1:1.9 increase in MYOC mRNA signaling in normal

beagle dogs versus glaucomatous beagle dogs when hybridized with the bovine myocilin cDNA

probe. Two of the normal dogs had higher values, more similar to the glaucomatous dogs, based










on hybridization to the bovine myocilin cDNA probe. The overall difference between normal and

glaucoma dogs was barely significant with the bovine myocilin probe (p=0.05). All the dogs,

glaucomatous included, had very similar low results on the human myocilin pattern (p=0.31).

There are many other genes showing greater signaling differences. A signaling ratio

greater than 1:2 is generally significant. A selection of significant genes can be seen in table 3-3.











Table 3-1: Relative myocilin protein levels in inherited glaucomatous dogs.

Relative to control myocilin level on:
Initial Glaucoma
Beagle Eye 05/06/04 09/03/04 11/03/04 05/09/05 11/21/05
State
Vanessa Advanced OD 10.56 15.65
Vanessa Advanced OS 11.14 18.08
Vanna Advanced OD 7.43 11.48
Vanna Advanced OS 9.65 10.99
Vick Advanced OD 10.46 13.30
Vick Advanced OS 11.79 14.90
Victoria Advanced OD 7.60 12.44 13.05 13.86
Victoria Advanced OS 11.07 15.12 15.85 14.77
Whoopie Moderate OD 8.46 7.15 8.33 7.40
Whoopie Moderate OS 8.84 9.30 10.20 9.97
Woody Moderate OD 11.37 11.94 10.84 11.28
Woody Moderate OS 12.49 11.89 12.32 10.71
Wrigley Moderate OD 7.86 9.19 9.75 9.91
Wrigley Moderate OS 7.52 10.09 9.57 9.37
Xmas Moderate OD 8.57 10.31 10.16
Xmas Moderate OS 6.98 7.55 8.79
Yoyo Moderate OD 7.91 3.70 9.12 9.65
Yoyo Moderate OS 6.63 4.57 8.05 8.04
Zag Moderate OD 8.90 4.50 3.70 4.13
Zag Moderate OS 7.93 3.63 4.70 4.96
Zig Moderate OD 5.79 4.16 5.46 5.95
Zig Moderate OS 7.71 2.66 5.49 8.80
America Moderate OD 7.10 2.34 3.33 5.16
America Moderate OS 7.32 6.02 4.52 3.57
Bridgette Mild OD 2.14 2.86 3.09
Bridgette Mild OS 2.51 1.64 2.28
Brooke Mild OD 2.44 2.39 1.25
Brooke Mild OS 2.25 1.89 0.93
Candy Mild OD 1.61 2.05 2.36
Candy Mild OS 0.89 1.20 2.09
Daisy Mild OD 2.41 1.53 1.18
Daisy Mild OS 1.75 2.29 1.76















Table 3-2: Aqueous humor myocilin levels from maj or breeds of dogs


Number of Average Age 10 f
M/F/IT M/F/IT Glaucoma Glaucoma


Diabetic
Cataract


Breeds
Airedale
Akita

Alaskan Malamute

Australian Shepherd

Australian Cattle
Dog
Basset Houndy

Bearded Collie
Bichon Frise*

Border Collie

Boston Terrier

Boykin Spaniel

Cairn Terrier

Cavalier King
Charles Spaniel
Chihuahua

Chow Chow*

Cocker Spaniel,
American*
Dachshund

Dachshund,
Miniature
Dalmatian

English Cocker
Spaniel
Golden Retriever

Gordon Setter
Great Dane
Great Pyrenees

Italian Greyhound

Jack Russell
Terrier*
Japanese Chin

Keeshond

Labrador Retriever*

Lhasa Apso*

Maltese*

Manchester Terrier
Mixed Breed*

Newfoundland

Papillon


Cataract


Unknown


0/0/1
0/1/0

0/2/0

0/5/0

0/1/0

7/9/0

0/0/1
6/4/0

2/0/0

1/4/0

0/2/0


1/1/0

0/1/0


2/6/0

19/33/10

2/1/0

0/1/0


1/1/0

0/1/0


1/0/0
0/1/0
1/0/0

0/4/0

2/2/0

0/1/0

2/0/0

2/8/0

3/6/0

5/1/0

0/1/0
34/30/4

0/1/0

0/1/0


0/0/122
0/146/0

0/95/0

0/120/0

0/195/0

104/93/0

0/0/72
114/53/0

37/0/0

120/114/0

0/168/0

140/148/0

0/60/0

0/98/0

120/121/0

110/111/130

102/141/0

0/22/0

100/U/0

0/108/0

0/109/0

132/0/0
0/132/0
88/0/0

0/101/0

98/93/0

0/120/0

96/0/0

111/72/0

164/98/0

118/163/0

0/108/0
106/112/139

0/44/0

0/48/0


17689.14 + 0.00


6143.82 +
0.00
17958.50 &
4134.91





20069.07 &
8034.04

30689.94 &
0.00












48243.20 +
0.00
30487.78 &
9050.08
36590.07+
10246.25
5183.85 +
0.00


187287.31
0.00







2972.81
0.00
6596.57 +
4428.47


7692.16
0.00


54973.09 &
42329.15
34781.93 +
0.00
66452.89 4
53788.70

47030.844
35453.88
15857.43 +
0.00
7830.83 +
0.00


10096.35:

78348.52:





16742.35:

10004.99:
1903.02
13104.03:
1733.02


2318.06:
902.70


2072.23 + 18647.65
498.38 0.00

2318.80 +0.00 1560.73
0.00


3565.69:
1188.51


2125.77:
478.34
3168.39:
1337.77


21456.58 +
2035.90
1303.11 +0.00

28969.56
6919.48


34478.16+
8303.43
6031.20 +288.59

94535.50 + 0.00

9396.99 + 0.00


4073.40:
872.38


6458.55:
2088.85


2249. 88 +0.00




3526. 84+ 0.00
4492.88 + 0.00


51884.36:
30387.85


4732.02 + 797.41

17993.97+
9138.39


1062.52:
552.89
458.13 +
458.13
2043.81 :
2043.81
2696.47:
1569.93

5401.32:
2112.58


23476.86:
6217.79
80265.99




21909.08:
25499.47:
8187.94


2354.47
1177.23
8139.65
3887.96
2313.07
205.07

5681.94
1904.40


2513.38:
0.00














Table 3-2: Continued
Number of Average Age 10


Diabetic
Cataract


629. 53 +
629.53


Breeds
Pembroke Welsh
Corgi
Pinscher, Miniature

Pomeranian

Poodle, Miniature*

Poodle, Standard*

Pug

Rhodesian
Ridgeback
Saint Bernard

Samoved

Schipperke
Schnauzer,
Miniature*
Schnauzer, Standard

Scottish Terrier

Shar Pei

Shiba Inu

Shih Tzu*

Siberian Husky*

Welsh Terrier

West Highland
White Terrier
Wheaten Terrier

Yorkshire Terrier *

Totals Averages


11 F/U


1 F/U Glaucoma Glaucoma


Unknown
2990.30 +
0.00


Cataract
1463.97 +

4401.68 +

18684.91
10844.96
5790.49+
4060.35
4984.69 +
1399.11


1 0 1 120 0 120

3 0 0 112 0 0

4 0 0 72 0 0

7 12 0 114 117 0

2 4 0 156 116 0

2 3 0 69 96 0

0 1 0 0 67 0

1 0 0 94 0 0

2 0 0 108 0 0

0 1 0 0 120 0
3 9 0 68 88 0

0 2 0 0 120 0

2 0 0 84 0 0

0 2 0 0 91 0

0 4 0 0 68 0

11 9 1123 123 51

3 2 0 70 14 0

1 0 0 84 0 0

4 0 0 156 0 0

1 1 0 73 149 0

3 9 0 168 118 0

141 194 18 107 104 105


3254.03:
3254.03


10314.82+
6637.16
547.26 + 0.00

1635.71
195.54








549.76 +
549.76


284436.83 +
277425.09
77590.46 + 0.00


33208.09
0.00


3157.13
588.61
2189.071
8688.65
5472.76
4595.14
188.38
3264.791
79.62





8419.50
5915.79
3236.53




1424.43
338.64


4303.14
970.56
4140.27
674.12


38042.73 + 0.00


2497.16 +
1426.95
19802.13
7674.53
10115.54
2122.09
16918.81
9366.35





12586.31
0.00
13134.43
0.00
29404.18


139317.16 +
119087.88







54163.23 + 0.00




44797.03 +


4124.78
1449.25





2423.12 + 0.00




3646.07
1512.08
3339.37 +
774.71


13562.181
0.00
3326.34
0.00







7008.45
2479.97


7449.11 11659.83
* Generally thought to have inherited glaucoma (Gelatt et. al, 2004)





UF Cf 16999 -0.09 -0.24 -0.04 -0.01 -0.08 -0.54

UF Cf 15216 0.22 0.49 -0.23 0.03 0.13 -0.26
UF Cf 18695 -1.21 -0.31 -0.59 -0.10 0.48 -2.31
UF Cf 13051 -0. 50 -0.15 1.10 0.60 -0.29 -2.50

UF Cf 10845 0.84 1.00 0.11 0.00 -0.20 1.22


-0.46 -0.09 4.95

-0.32 0.13 -2.50
-2.30 -0.35 6.65
-2.38 0.15 -15.63

1.16 0.35 3.31


Table 3-3 : Selected DNA chip microarray results. Ratio and probability show major differences between glaucoma and normal mRNA


results. Items that may be of interest in bold.
Normal Beagle Dogs Glaucoma Beagle Dogs

UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson

ITF Cf 11404 -4.96 -4.63 -1.05 -0.53 1.31 -4.12 -3.42


-0.45


Ratio

-3.77 -1.97 1.91

-0.05 0.12 -0.41

0.79 -0.10 -8.18
1.57 -0.26 -6.07
0.58 0.05 10.65
0.62 -0.24 -2.56

1.20 0.44 2.69

0.78 0.23 3.40

1.20 -0.03 -39.83


Probability


Hit Definitions Active Genes


0.05 myocilin [Bos taunts]

0.1mvocilin; trabecular meshivork-induced
glucocorticoid response protein [Homo sapiens]
0.02 ABC transporter [Homo sapiens]
0.05 ABC transporter subunit [Naegleria gruberi
0.02 ABC transporter, permease protein, putative
0.02 asparaginyl-tRNA synthetase [Homo sapiens]

0.5 aspartic protease family member (5T521)
[Caenorhabditis elegans]
0.02 ASPN protein [Homo sapiens]

0.2 ATP synthase, H+ transporting mitochondrial F1
complex, beta subunit
0.0 ATP GTP-binding protein; homolog of yeast CFIA
subunit Clplp [Homo sapiens]]
0.02 atrium potassium channel IRK [Canis familiaris]

0.1 B. burgdorferi predicted coding region BBG21
[Borrelia burgdorferi]
0.0 B9 protein; likely ortholog of mouse endothelial
precursor protein B9 [Homo sapiens]
0.05 Bardet-Biedl syndrome 7 [Mus musculus
0.04 basic fibroblast growth factor [Canis familiaris]

0.3 calcium-activated potassium channel beta 4 subunit
[Meriones unguiculatus]
0.4 Calcyphosine (Thyroid protein P24) (TPP) (Protein
5 [Camis famihiaris]
calpain 1, large subunit; calpain, large polypeptide
0.02 Ll: calcium-activated neutral proteinase [Homo
sapiens
0.3 calponin like transmembrane domain protein [Homo
sapiens]
0.4 Canis familiaris vascular anastomotic upregulated
protein mRNA, partial eds
0.5 CD44 antigen precursor (Phagoevtic glycoprotein I)
(PGP-1) [Camis familiaris]
0.04 cell adhesion molecule, neural [Bos taunts]
0.01 chondroitin sulfate proteoglycan 4 [hfus musculus]
0.03 CocoaCrisp [Homo sapiens]

0.1 COGO587: DNA polymerase III, alpha subunit
[Burkholderia fungonxm]


ITF Cf 15108 0.52 -0.75 -0.39 0.33 0.90


0.35


UF Cf 15247 0.49 0.03 -0.18 -0.46 -0.36 0.95
UF Cf 17624 -2.07 -1.08 0.08 0.89 0.89 1.72
UF Cf 13238 -0.29 0.28 0.00 0.13 0.15 0.52
UF Cf 16780 -0.48 -0.24 -0.29 -0.09 -0.11 0.52

UF Cf 15485 -0.25 1.54 1.40 -0.32 -0.15 1.51

UF Cf 12820 0.41 0.95 0.44 -0.46 -0.20 0.84

UF Cf 11698 -0.37 0.08 -0.71 0.53 0.32 1.13

UF Cf 17024 -0.19 0.55 0.23 0.06 0.08 -0.61

UF Cf 12948 0.36 0.13 0.19 -0.44 -0.37 -0.18

UF Cf 18223 -0.64 0.28 2.27 0.11 0.55 -1.62

UF Cf 19717 0.10 -2.59 0.70 1.17 1.13 0.79

UF Cf 19320 0.92 -0.34 0.43 -1.02 -0.76 0.26
UF Cf 15882 0.34 -0.62 0.06 0.09 0.24 0.56

UF Cf 12228 1.12 0.33 -0.70 -0.22 0.03 1.17

UF Cf 19290 -0.49 0.34 -0.94 -0.83 -0.61 1.40


UF Cf_15631 -0.42 -0.09 -0.04 0.07 0.11 0.47


-0.66 -0.64 0.15 -4.35

-0.17 -0.18 -0.03 6.73

-1.52 -1.57 0.51 -3.05

0.81 0.80 0.10 7.84

0.85 0.56 -0.15 -3.60
0.68 0.62 0.02 28.18

0.90 1.04 0.11 9.24

2.43 1.92 -0.51 -3.78


0.60 0.54 -0.07 -7.23


-0.79 -0.77 0.37 -2.08

0.40 0.46 -0.22 -2.07


0.52


UF Cf 14128 0.50 0.22 0.90 0.27 -0.05 -0.74


UF Cf 13871 -1.37 -1.05 -0.96 1.00 1.27














Table 3-3 : Continued


Normal Beagle Dogs


Glaucoma Beagle Dogs


Sampson Ratio

-0.84 -1.03 0.22 -4.70

1.21 1.18 0.48 2.48

-1.00 -1.09 0.31 -3.50

0.48 0.48 0.03 14.12

0.57 0.51 -0.18 -2.74

-0.53 -0.50 -0.03 19.23

0.37 0.36 -0.10 -3.60

-0.48 -0.54 -0.19 2.90

0.37 0.42 -0.02 -23.33

0.50 0.45 0.17 2.68
0.93 0.93 -0.23 -3.97
0.64 0.59 -0.29 -2.05
1.13 1.44 -0.70 -2.05

0.63 0.58 -0.18 -3.26


0.05 0.12 -0.02 -7.50

0.33 0.40 -0.19 -2.06

-0.93 -0.80 0.10 -7.69


-0.49 -0.58 0.26 -2.19

-2.45 -2.66 -0.72 3.70

0.26 0.27 -0.12 -2.17

0.69 0.79 0.36 2.18

0.43 0.44 0.05 9.17


UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria

UF Cf 13181 -0.62 0.39 0.99 0.01 0.32 -1.21

UF Cf 12407 0.73 0.69 0.46 0.45 0.05 1.15

UF Cf 17066 -0.21 -0.16 1.22 0.39 0.31 -1.17

UF Cf 14766 -0.18 -0.22 0.01 0.27 0.29 0.48

UF Cf 10276 -0.62 -0.30 0.10 -0.01 -0.09 0.44

UF Cf 15801 0.05 -0.79 -0.20 0.41 0.40 -0.47

UF Cf 12504 -0.30 0.13 -0.16 -0.03 -0.14 0.35

UF Cf 12161 0.00 -0.17 -0.46 -0.12 -0.18 -0.60

UF Cf 10209 -0.09 0.03 0.09 -0.04 -0.08 0.47

UF Cf 14307 0.78 0.60 -0.39 0.02 -0.17 0.40
UF Cf 13331 0.08 -0.34 -1.15 0.07 0.17 0.93
UF Cf 15935 -0.02 0.21 -1.22 -0.20 -0.21 0.54
UF Cf 15817 -2. 53 -0.76 0.41 -0.09 -0.53 1.74

UF Cf_11878 -0.58 -0.80 0.19 0.09 0.21 0.53


UF Cf 10393 0.18 0.00 0.36 -0.26 -0.36 0.19

UF Cf 15731 -0.55 -2.01 -0.69 1.17 1.11 0.47

UF Cf_10095 -0. 54 0.39 0.37 -0.02 0.32 -0.67


UF Cf 10185 0.38 0.46 0.37 -0.04 0.14 -0.66

UF Cf 11745 -0.58 -0.63 -2.03 0.21 -0.56 -2.86

UF Cf 11046 -0.44 -0.15 -0.06 0.01 0.03 0.27

UF Cf 11708 1.02 0.43 0.11 0.24 0.01 0.89

UF Cfl13315 -0.47 0.13 0.19 0.15 0.24 0.45


Probability Hit Definitions Active Genes

0.4 COGO845: Membrane-fusion protein [Nostoc
punctiforme]
0.4 COG1033: Predicted exporters of the RND
superfamily [Burkholderia fungonxm]
0.0 COGl305: Transglutaminase-like enzymes, putative
cysteine proteases [Microbulbifer degradans 2-40]
0.0 COG2219: Eukarvotic-type DNA primase, large
subunit [Methanosarcina barkeri]
0.2 Component of oligomeric golgi complex 1 [Mus
musculus]
0.0 DNA polymerase III, tau subunit, putative
[Chlamydia muridanim]
DNA-DIRECTED RNA POLYMERASE BETA'
0.02.
CHAIN [Plasmodium falcipanim]
0.3 DNA-directed RNA polymerase subunit A'
[Methanosarcina mazei Goel]
0.1 envelope glycoprotein [Simian-Human
immunodeficiency vints]
0.04 glycoprotein 150 [murid herpesvints 4]
0.00 glycoprotein Ib [Canis familiaris]
0.00 glycoprotein precursor [Lassa vints]
0.04 golgi membrane protein GP73 [Homo sapiens
human immunodeficiency vints type I enhancer
0.03 binding protein 2; human immunodeficiency vints
type I enhancer-binding protein 2 [Homo sapiens]]
0.4 hyaluronoglucosaminidase 4: hyaluronidase 4
[Homo sapiens]
0.01 lipoprotein lipase [Canis familiaris]
low density lipoprotein B; low density lipoprotein
0.05 receptor defect B complementing; conserved
oligomeric Golgi complex protein 1 [Homo sapiens]
0.4 low molecular mass ubiquinone-binding protein
(9. 5kD) [Bos taunts]
0.3 L-type calcium channel alpha-1c subunit [Rattus
norvegicus]
0.0 mitochondrial carrier protein MGC4399 [Homo
sapiens]
0.5 mitochondrial NADH:ubiquinone oxidoreductase
B14.7 [Bos taunts]
0.3mitochondrial ribosomal protein S14 [hus
musculus]
mitochondrial ribosomal protein S18C;
0.02 mitochondrial ribosomal protein S18-1 [Homo
sapiens]


UF Cf 15730 0.06 -0.09 -0.02 -0.15 -0.11


0.21 0.14 0.18 -0.06 -2.82














Table 3-3 : Continued
Nonnal Beagle Dogs

UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2

UF Cf 11954 -1.11 0.80 0.54 0.32 -0.03

UF Cf 12399 -0.08 0.13 -0.38 -0.08 -0.11

UF Cf 16152 -1.36 -1.80 -0.56 0.60 0.48
UF Cf 11710 -0.35 0.13 -0.24 0.00 -0.10


Glaucoma Beagle Dogs

Victoria Sampson Ratio N

1.38 1.23 1.31 0.10 12.55

-0.33 -0.37 -0.35 -0.10 3.37

1.29 1.27 1.28 -0.53 -2.42
-0.43 -0.43 -0.43 -0.11 3.84


Probability Hit Definitions Active Genes

0.03 mucin glycoprotein [Homo sapiens]

0.1 Myosin Ib (Myosin I alpha) (MINI-alpha) (MINIa)
(MIH-L)
0.01 myosin regulatory light chain 2 human
0.02 nuclear receptor co-repressor [Homo sapiens]
nuclear RNA export factor 1: tip associating protein;
0.03 nuclear RNA export factor 1 (Mex67, yeast,
homolog) [Homo sapiens]
0.00 nucleolar phosphoprotein Nopp34 [Homo sapiens]
0.01 orf 19 [Staphylococcus aureus prophage phiPV83]
0.04 orf; hypothetical protein [Salmonella typhi]
0.05 ORF2 [Canis familiaris]
0.03 ORF24 [Alcelaphine herpesvints 1]
0.01 orf274 [Euglena gracilis]
0.01 orf296 [Podospora anserina]
0.01 orf98 [Tetrahymena pyrifonnis]

0.4 prostaglandin E2 receptor EP3A subtype [Canis
famihiaris]
0.3 prostaglandin E2 receptor EP3B subtype [Canis
famihiaris]
retinaldehyde binding protein 1; retinaldehyde-
0.03
binding protein 1 [Mus musculus]
0.02 stem-loop binding protein [Mus musculus]

0.1 sterol regulatory element binding protein-1 [Canis
famihiaris]
0.00 stromal cell derived factor 4 [Rattus norvegicus]

0.2 succinate dehydrogenase complex, subunit C,
integral membrane protein, 15kDa [Bos taunts]
0.01 T cell receptor beta chain herb4 [Canis familiaris]

0.1 T-cell leukemia translocation altered gene [Homo
sapiens]
uronyl-2-sulfotransferase; dennatan chondroitin
0.02 sulfate 2-sulfotransferase; urondl 2-sulfotransferase
[Homo sapiens]
0.0 vascular endothelial growth factor B [Homo
sapiens]
0.03 virl2 [Plasmodium vivax]
0.03 H'D repeat-containing protein 3 [Homo sapiens]
0.04 H'im protein [Mus musculus]


UF him 19983 -0.25 0.05


0.02 0.13 -0.04


0.50

-0.82
0.66
1.47
-0.46
-0.52
-0.68
0.04
-1.50

-1.06


0.56 0.53 -0.02 -29.44


UF Cf 11546 -0.27 0.24 -0.80 0.04 0.02
UF Cf 19677 0.04 0.33 0.34 0.24 0.25
UF Cf 15414 -0. 83 -2.31 0.54 -0.25 -0.11
UF Cf 15265 -0.66 0.76 -0.69 0.16 0.50
UF Cf 10109 -0.29 -0.28 -0.18 0.00 0.25
UF Cf 13593 0.40 0.43 0.26 0.20 0.05
UF Cf 17364 0.82 -2.31 -0.64 0.97 1.01
UF Cf 18948 -1.16 -0.93 -0.81 -0.07 0.14

UF Cf 14836 -0.21 0.02 1.94 -0.03 0.39

UF Cf 13620 0.14 0.10 0.06 0.30 0.03

UF Cf 13325 -1.31 -0.57 -0.11 0.37 -0.04

UF Cf 10691 -0.61 -0.57 0.37 0.02 0.21

UF Cf 18898 -1.10 -0.62 0.48 -0.16 0.13

UF Cf 12694 -0.01 -0.10 -0.02 -0.01 0.03

UF Cf 14149 -0.27 -0.81 -0.29 0.52 0.31

UF Cf 10619 1.36 0.73 -0.93 -0.56 -0.44

UF Cf 15898 -0.27 0.00 -0.04 0.18 0.11


UF Cf 14027 0.55 0.05 -0.03 0.03 0.03


UF Cf 14046 -0.02 0.09 0.64 0.00 -0.06

UF Cf 11361 -0.92 -0.32 -0.64 0.61 0.31
UF Cf 17158 0.69 -0.95 -0.36 -0.02 0.19
UF Cf 11438 0.44 0.31 -0.18 0.12 0.08


-0.86 -0.15 5.55
0.70 0.24 2.90
1.19 -0.59 -2.01
-0.56 0.01 -39.64
-0.54 -0.10 5.35
-0.69 0.27 -2.56
0.13 -0.03 -4.33
-1.59 -0.57 2.80

-1.25 0.42 -2.95


1.35 1.06 1.21 0.13 9.56


-1.61

-0.67

-1.33

0.51

-0.40

0.96

0.44


-0.37


-0.80

-0.55
-0.54
0.51


-1.44 -0.33 4.34

-0.61 -0.12 5.26

-1.36 -0.25 5.33

0.54 -0.02 -24.32

-0.36 -0.11 3.33

0.88 0.03 27.50

0.44 -0.00 -108.75


-0.50 -0.44 0.13 -3.45


-0.81 0.13 -6.19

-0.72 -0.19 3.75
-0.61 -0.09 6.78
0.45 0.15 2.89













Table 3-3 : Continued
Normal Beagle Dogs Glaucoma Beagle Dogs

UF Probe AZG2 IDG2 Hunter 1-XX2 XKX2 Victoria Sampson Ag Ag Ratio Probability Hit Definitions Active Genes
Glau Non

UFCf1397 0.33 0.19 -0.24 0.14 0.14 1.49 1.51 1.50 0.11 13.39 0.00 Wlrmsnrm :Wlrmsnrm
(wolframmn) [Rattus norvegicus]
X-ray repair cross complementing protein 2; X-ray
UF Cf 14834 0.48 -0.42 -0.06 -0.25 -0.21 0.50 0.33 0.42 -0.09 -4.51 0.02 rpicmlmnigdfcie eari hns
hamster; DNA repair protein XRCC2 [Homo
sapiens]
UF Cf 18469 -10 0.9 06 0.6 08 1.2 15 1.8 04 382.2 zinc finger protein 140 (clone pHZ-39) [Homo
sapiens]
Zine finger protein 397
UF him 20096 0.59 0.80 0.00 -0.22 -0.20 -0.42 -0.45 -0.44 0.19 -2.24 0.01 .. 2 ** I~ '' .I. .' 195991.2| zinc finger protein
[Homo sapiens]
UFCf1564 -0.45 -0.67 -0.51 0.04 0.14 -0.61 -0.66 -0.64 -0.29 2.19 0.01 zn igrpoen45 icfne rti 6
[Homo sapiens]
UF Cf 13933 0.3 07 .1 00 .0 10 .3 12 .7 33 .3 zinc finger, DHHC domain containing 4 [Homo
sapiens]
ZONA PELLUCIDA SPERM-BINDING PROTEIN
UF Cf 15249 -0.78 0.88 0.58 -0.17 -0.03 -1.05 -1.01 -1.03 0.10 -10.73 0.01
3 PRECURSOR




















1~11--1_-~~~1~-1--- il~-------I


1234567890
TTTCTGGCCG
TRAACCCCTG
ACTGAGGGCT


1234567890 1234567890 1234567890 123456?890 1234
TGTGAAAACA AT`TCCCCTCT GCATGISC1CC AC"CCAG(ICTC3 ACGT!
TGAAGCCATG GCATGAGCCA GCA.GGGClfAC CCATCCAGA.C ACCTI
TCCGTGCACA. TSACTGCACGC TGCArGGCCTA ACATGCllrAC TG'Ir


567890 1234567890 1234567890 1234567990 1224567890
GGCOGC CTCCTTCTCC .-1.DAG GGAGGGCTCT CCAQTAT-1
CACAGA GTAGGAGAGC TTTTCOGGGG AAGOTTTOCC CAGGCTCTGC
CAG ATSGGGTTTA GAGGP"AGGA


nAU-rCAGC CTCC'2GAAG AGAA-_
_CAGGAGG'A St"AAGGC""GA G;AAGAGGECA GTGTCCCCAG GCCCACAGCT
AGGAGCCCCT GAGTCCAGAA GGTSACATGG CTCATAGAGG CCTATTACAG
ATCCAGCACC AGGCAGA"'GA ATTAAGGAGG GCCAA4GUAT CAGrTCT

ATCTTTGAAA GeCC"ATTAA TAecCCATCT AGCAT .I TITGGGCC`GCT


CCTCTCRGGA CGTGCCAGCA GGCTCCAGGG AAGGTRAAGA TGTGGGGT~A
GTGGCCCCAG CTTGCCTCTC CTGCCCTTTC CTTTCTCCCA GGGACTGTAC


TTTCalLCATG GTACAAGTTT GTCTCTTTCTI TTTAATACAG i t;

ATGGTCTT~TA TCTGTGCCTG GTTGTGTTCA GiAGTTGGTCC GUCCCACTTTG
GGAGAGAGC CCCITCTCG CTCCCTTTCC AGGGCATGCT GGCAGGGAGT
SGCTCAGCTG CGCTGiCCTC GGGGAAGAGG AGAGATGAGT TTATTTCACC
ATC`TITTCTT ATCTTAGGG CAGATGACAC CATGCACCAT CTCAGCACAT
AGTGCAATCA 2fCCTiTCCA RAATFTTCCC TGARAACCTG ACTTTAAGGT
CCAGCAAAAG AGCAATGCAT GGCTATOGGGF ACATTCTGAA GTATTTRAAA
AATTGAAA AGCACAGAGA TCTGTTATGT ~i. illCCGC TAAATCTAAG
AAIAATGATGC CTGAAiCTATG TGGTCCATTG GTTTGGGCTT GAAGAAiC~TTT
GAATATTTAT TAGGGATGCC T *.BTGGCTC AGTGGTTGCCT TAAC
GCTCCCCGCA GGGAGCCTGC TTCTCCCTCT GCCTGTGTCT CTGCCCTCTT
ST--TTrAGAA AGAGGCATG AGCA. --Tr. CAiCACAGGT GGGGGTGGGG
AGATCATAAC: CTGAGCCGAAI GGCAGATGCT TAACTGACTG AACCACCTGG
AAAGASGTAGT GTAACGAACT CGGGAGTTCC TGCCAGGCTT CAATCAAAiTA
TACCGAGAAG AAIGTTCAATT CATATGACAC ATCGATCACA i' :- i GG
CAACATCCCT ACTACCCAAA9 ACACTATCCC CTTTIACAAA TAATGACAGA.
CTGTGTGTCT GGCCTTCTGG CTCTTAGTGG CTCTGCCACA TGGCCACGTG
CAIGGATGC* ` AGPACTFGTT TGGGTA.GGAG AGCCGCTCAC CCTGAGGACA


_i;-'i;"_ _.--TAT AAASCTAAAT GTC'CTCCCTT TTtCACATAC
GGGGC;GAAGG CGGACCACAG GTCAGCCTGG CAAGAGGCAG GGG-AGGGGGA
CCGCCTTTCC TAGCACACCC CTFTGTCTCA CCACCCACTC AGGGATCGGG
CACTGGATTC; CCATATA'"AG TTAGFTTACAT TTTTTTAGTA~ ~- OCTTAT
AGTATATACT CAGAAAAGGT ATCTTTTGTG AACTTTOGGT ACTGAGGGAA
i` ~ ITTTCAGAAA0C TTGCAATC TGT T- i. A CAATTATTC
TGCAATTCCC TG;AGACACGA GGA9GCAAAGA CTTCCCAGCT TCTGAGAGTA
7fTTUTCAATC TCTTTACATT TTAXAAATTAi TGTTCAGGTT TTACTGTATT
GTTTTATTGA GTTTCTTATA ATGACTTGAT TTTTGTTTCA TTTTTATTAA
CTTTGTCTCC GGGCATGATC CCGGGGTCCT GGGATCGAGT CCCACATCAG
GTGTGTCTCT ICATGAATAAAf CAAATTAAAT ASTTTTTITAA AAAGAITTATT
GAGAGGGAGA GGGAGAAGCA GACTCCCCAC TGAGCAGGGA GCCCCACGAC
GTGCTCCTGT TTCATTTTTT AAA~ATGAGT AAATT'AGATA TEGGA.Gi -
TTAGAAAITAU GGTTTGAAGC CCTCTGTGTA, GCCTTCATCT ATACACCTGA
CATTTAICCCT CTACCCAG7AA CCTAACACG'T GTAGTC.ACAT TTAACATTTA
G;CCA.AGGTTG AGGGACCTGC AAGTCACCCG CCCGGA4TTTA. AACCTGGACG
GCGG63AAGGT GGTGGC4AAG CGATCGGGGT `: iT 'TGTC CIITTAA'CTC


~ ~~~~~~ CA


I


'GGCATC GACC"TD..


S.-.*-. .CCACtt GCTACACCTC ACCAG- -
ii :: 'I i : 7 -
khCAoGTcC CT.-i 1 -1 i .- T --T AGCCCCACAT
AGCCGGCCTG TGCCCGTGCA GCTTTTCTCG GCTTTTTAAG CTTTCATTAT
AGTTSGGATT TAGACAGTGT CACAATCAAT GGTCTTITTT TTGGTCAGCT
GISCRGAAGCT GTCATGCATA GTAGtTCTCTT CATGGAAACC ACAAAGCTTT
GGCAGAACAG CTTACTCCAC ACGGCACCCA GGGTCGTCCC CTGCCTGTGC
GCG'CTGAACA "7--TAGT OGGGCTTCTA GGCTT~CAC- AGCATC7AGT
TCCTCCTCGA CCTTTCITGAA ATACTTTG;CT CAGAAGAAIGA GTACTGAATC
CTGGTGTGTG TGT--~~ i; GGGTGGGGGGC CTGGAGATCT GCACCTGGTT
CCCTGGTGTT `r3TGGTrlCTT CCCAAACCAT ClTTATCTTTC CTCRAACTCC
GAACTTCAITA AACTACAACC TCASC;CGAGr A.GACCTTCCA CCATGACTTT
AGCACACTTT ATCTTGCCAG TTSAGCTCAG ACTCTGTCCC ATCACATATT


STC3AGGAAAG
TAA.TC1CGGAA
TTTAA.AGGGC
E -TAAAGG
CTGGTTACCA
SGGGCCATCAC
TGACCAGCAG
TGGAGGTGCT
CCTCTCTTCA
TTGGTAACTG
PTTAATCAAT


.__


CACC


i -I i


- ..: i i- GAICAACTCA
CTGGTGGTGA CGGCTCCTGA GGGCAGAGCC
S-G TCTGACCGTIG TGGAAACAG
AAAAACAGTG CAAGTTTCGT GGTGATTTGG
CTAAAG C3ATATTTGGA GGAGA.GTTGG
TTAGAGGAGG GGT;AGCAGCT CTTCTGGCCA
CCCTTGTAAA TPAAAGCAATG PTTCCrACTA
GGGGTTGGGA GCTGTGATCG "GGAGCATTA
ACACCAGGCC CCCCGTGGARA TCCAGCCCTC
GTGTTGGTTC TTACTGGCTS TCATGAGCAT
CTATCCTCAG GT'r3CGTCG? ACCTAACAGT
CCTCT


c. -
GSCAACAGGAG
GAATGTGC-T
GGTTTAAiCCA
CCC~ATTACGG
CAAGCCATAA
ATACCenTG
GTCATCTCTT
GCCCARGGAAG
CCC3TGG3TCC
AACCTGCTTA
TL`AGGTCGTT


Figure 3-1: Region of Canine Chromosome 7 containing MYOC. The 1451 bp dog MYOC cDNA

sequence is shown underlined. Red Exon 1, Green Exon 2, Blue Exon3. Green

highlighting represents "start" primers used to piece the gene together. Blue

highlighting represents "end" primers.











64 kDam -
51 kDa





Figure 3-2: Western blot of aqueous humor samples from beagles with primary open angle
glaucoma with human myocilin control. Box shows typical primary band.


Bridgette




Brooke -lr *r l l~


C m mT m11






Daisy I I I I-


Figure 3-3: Comassie gel strips from aqueous humor of mildly affected glaucoma beagles over
time. The darkest band is approximately 57 kDa.


Right ]Eye


Left ]Eye



























Yoyo ~fII I
















America -ll w


Figure 3-4: Comassie gel strips from aqueot s humor of moderately affected glaucoma beagles
over time. The da kest/ largest band centers at approximately 57 kDa.


Irl I It, I OIrl OIt,
O O O O
010101010101016
yv)TU r\J C) rc-,`i Ir
In, PU ~
;j~
F\1 ~iO
-i
rq rq
OI c~ IOI-IOI--i~IOI --r


Right Eye


Left ]Eye








o" I o" I o" I o" I o~ ~cl- I ~ VI I Lr,
olololololololQlolo
-C1 N ~C1
C'I ;Si rcr1 Cc) Y
-F~,O
O O r 110101 -- IO


Victoria l lli ( I1)



WJhoopie 4 illl )rI



Woody (()~l



Wrigley I

Figure 3-5: Comassie gel stril s from aqueous humor of advanced glaucoma beat les over time.
The darkes / large: t band centers at approximately 57 kDa.


Right Eye


Left Eye










































Figure 3-6 : Samples 193 through 206, examples of Comassie staining of aqueous humor.
lo=primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control.





Figure 3-7 : Samples 260 through 272, examples of Comassie staining of aqueous humor.
lo=primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control.


C L_


r



3


Z


C





t


.I: I I- 1 l 1 4 1 .


Ill. 1.. _1.:


_1r I _. r





Figure 3-8 : Samples 312 through 325, examples of Comassie staining of aqueous humor.
lo=primary glaucoma, 20=secondary glaucoma, C=cataract, D=diabetic cataract,
L=1adder, M=myocilin control.














ICA


r
i


/ '-"~,2,
L -.


4


i


I


L


I* : ~


I
- ,-- --


Figure 3-9: Overall view of iridocorneal angle (ICA) of a normal 1.5 yr. old (X100) beagle.
Normal myocilin localization is observed in the Irido-Corneal Angle (ICA). Iris (I).





















Figure 3-0 vrl iwo rdoona nl (C )o luo aos6y.odbal
(X200). Inrae myclnlclztoni bevdi heIA(ro)o h
glacomtou caie















St


Figure 3-11:. Positive staining in the corneal epithelium (solid arrows) and stroma of a normal
beagle (X200).














.r


Blt~cl;:i)^
j


.i.-. ~b~-
i "
r
'd
'( Li"
r 1,


I I
r r
.~Lr Pli L~


Figure 3-12: Positive staining in the corneal epithelium (arrow) and stroma of a glaucomatous
cocker spaniel (X200).





























81


St-












St






Figure 3-13: Positive myocilin localization in corneal endothelium (arrow) of a preglaucomatous
3 mo. old beagle (X200).












~ I ~1c,1~5~3~
-f i r 1:
I
u" i `fl
%+
\r. ~t!a r
K
I; "t r
`1)

rr
t;V

,t~~ ~i 4 C IIC~

s41' e ~I tJY ~-~
h
:~ rF
~ ~~

~lrL;
Figure 3-14. Localization in the sphincter (S) and dilator (D) muscles of the iris of a normal 1.5
yr. old beagle (X200).
































Figure 3-15: Localization in the sphincter (S) and dilator (D) muscles of the iris of a 10 year old
glaucomatous beagle (X200).













lil"ccl
O


CI- 1C


Figure 3-16: Myocilin localization along the cell membranes of the ciliary body musculature of a

3 mo. old normal beagle (X200).





k
r


~u -


I


L ~II


~iL


Figure 3-17: Myocilin localization along the cell membranes of the ciliary body musculature of a
1.5 yr. old normal beagle (X1000).











































~: U....

'1
L


Figure 3-18: Positive myocilin localization in the trabecular meshwork cells of a 7 yr. old

glaucomatous beagle (X1000).


I
I
L


lbr \
Y*
--











~ 3~i~u7
u~~
~4L~ 4 r:.,.,.
Iff **~ I
IJk~ Y~sJ;i
*"~
'Ir
-~.4 yb~P ?i~


r*'L


~ .C
r L 1
L
*'


rFdi~-
CI-*r~d~.:~L P1 *
r


"': "~'
~;~

g cT-~i j 511\ I
*-r ~ i.C 3
I~ ~~~C~~ ?!
~t .


r* *
L;



'" ';~


'S


~re~


i,


*1~""''' s;.

.r
~


J


.*
ri~-


Figure 3-19: Positive myocilin localization in the outer sclera of a 13 yr. old glaucomatous
cocker spaniel (X400).



































88


















r"~";~;~: """.:~FI~
f .C*E'








~~i*

& *';


Figure 3-20: Positive myocilin localization in the vascular smooth muscle cells (arrows) within
the sclera (S) of an 8 yr. old glaucomatous cocker spaniel (X400).


i" *' ~E~l~'';~


I
i~3~ .* "':I:::"' .: 'IUIu


,

































Figure 3-21: Intense myocilin labeling within the nonpigmented epithelium (Blue arrow) of the
ciliary processes, and vitreal membrane-like material (Green arrow) of a 6 yr. old
glaucomatous beagle (X200).

































Figure 3-22: Detail of Figure 3-13. Intense myocilin labeling within the nonpigmented
epithelium of the ciliary processes of a 6 yr. old glaucomatous beagle (X400).





:n


:~. i~t-


~''~SS~FL~' p

rll
1


3Ef~
`Bi
b jl



CI

*j;i~


~



~Cro.~_~
*. i.
~


Figure 3-23: Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM:

Localization of myocilin with 18 nm colloidal gold particles (black arrows).











~ .~r"i~ ~1~9-~c~(t3~L~&kr iv
~RIP' R:
~Eis r" '~E;~~ -; -:~L~PP :i
rt ~if~l~
~u~~i~LI~f~L;I~l j ~ ~~s~
~~ --~a~ ;glr
-q --r~ ~
I

r~
'"3
p-g~C';~;








;T~-: -..,
~s~P!





Figure 3-24. Trabecular meshwork cell of a 10 year old beagle with moderate glaucoma. TEM:
Localization of myocilin with 18 nm colloidal gold particles (black arrows).














~pgp;-~-P;
'' ~
''
8:

"cr


"-


Figure 3-25: Trabecular meshwork cell of a 1.5 year old normal walker hound. TEM:

Localization of myocilin with 18 nm colloidal gold particles (black arrows).

































Figure 3-26: Extracellular matrix (ECM) or the trabecular meshwork of a 10 year old beagle with
moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold
particles (black arrows).


































Figure 3-27: Nonpigmented epithelium of the ciliary body of a 10 year old beagle with moderate
glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold particles (black
arrows) .


























"9is ~;bc-. J I~k; !~;
"frii ~~4i~a~~ ti ,-
1 (

L~ ~~
r 2. "" .
,'4


t
''C
: c '
:,:
~:': ;i



Figure 3-28. Vitreal membrane-like material within the posterior chamber of a 10 year old beagle
with moderate glaucoma. TEM: Localization of myocilin with 18 nm colloidal gold
particles (black arrows).















CHAPTER 4
DISCUSSION

The inherited glaucomas certainly have many causes. Myocilin is still one of the only

gene/protein products clearly linked to glaucoma. The exact role of the myocilin protein is still

not well defined and probably involves multiple functions (Gould et al., 2004). The association

of the gene and its mutations to several different forms of early and late onset POAG in man

continues to be strengthened (Tamm et al., 2001; Clark et al., 2001). New views of the trabecular

meshwork encourage us to look increasingly at myocilin for regulatory problems in addition to

typical mutations (Alvarado et al., 2005). Like many forms of POAG in man, POAG in the

beagle is also demonstrated to have elevated myocilin within the aqueous humor and ocular

tissues. A definite correlation can be made between the severity of glaucoma in both the human

and canine eye and the amount of myocilin in the aqueous humor, and increase of myocilin

found in the iridocorneal angle (Alward et al., 1998; Colomb et al., 2001; Fan et al., 2004). The

presence of such a great amount of "free" myocilin in the aqueous humor could be indicative of

an increase in the production of myocilin, from a change in mechanical or oxidative stress, or the

lack of sufficient outflow of the myocilin (Aroca-Aguilar et al., 2005).

Myocilin exists both intra- and extra-cellularly, and has both glycosylated and

nonoglycosylated forms (with molecular weights of approximately 66 kd and 55 kd respectively)

(Caballero et al., 2001). In addition to its leucine zipper region, myocilin has multiple sites for

glycosylation and phosphorylation, presumed binding sites for hyaluronic acid and heparin

(which has been reported in the dog trabecular meshwork), and a signal sequence of 32 amino

acids usually found in molecules secreted extracellularly. When extracellular, myocilin may bind









to other extracellular molecules or to the cell membrane of the trabecular cells and influence

aqueous outflow resistance. As a sticky molecule, myocilin has binding sites for several

components of the basement membrane.

The low amount of visible myocilin in the normal and mildly affected beagles

demonstrates that myocilin is a normal aqueous humor protein in the dog. No differences

between either age or gender were observed in these normal dogs. Obtaining a baseline, normal

level of myocilin may be a step towards a future early test for glaucoma. The advanced glaucoma

beagles showed a large increase in the amount of free myocilin. Although no mutation was found

in the myocilin gene in the dogs from the colony tested, this higher level still links myocilin to

glaucoma. The significant increase in myocilin may be related to errors in the post-

transcriptional or post-translational processing of the myocilin in these dogs, or errors in the

trabecular meshwork in the removal of aqueous humor and myocilin. These alterations could

impair dynamics of the removal of myocilin, possibly having a binding effect to extracellular

components such as hyaluronic acid or the basal laminae of trabecular meshwork cells. The

inability of the myocilin-bound components to degrade properly would result in its accumulation

the eye of individuals with POAG causing a rise in intraocular pressure and further development

of the disease.

This study supports the hypothesis that changes in the level or activity of myocilin within

the aqueous humor outflow pathway of beagles with POAG are associated with the rise of

intraocular pressure and subsequent development of the disease. This is the first study in which

the analysis of the myocilin gene, the myocilin protein and the localization of myocilin in the

normal and glaucomatous canine eye was successful and observed by multiple techniques.










Myocilin has been localized in human normal and POAG trabecular meshwork (Lutj en-

Drecoll et al., 1998; Tawara et al., 2000; Ueda et al., 2003; Clark et al., 2001). Myocilin

appeared to be localized to the long-spacing collagens and the surrounding sheath of elastic-like

fibers, interacting with microfibril-associated elements and codistributed with fibronectin,

fibrillin-1, MAGP-1, decorin, and type VI collagen (Ueda et al., 2003). Myocilin, as a protein,

occurs not only in the ocular tissues, but has also been reported in heart, skeletal muscle, bone

marrow, lung, stomach, thyroid, prostate, pancreas, kidney, intestine, and lymph node (Tamm et

al., 2001; Shepard et al., 2003).

Previous myocilin immunolocalization studies have been reported in humans (Karali et al.,

2000, Lutgen-Drescoll et al., 1998; Tavara et al., 2000). In this study, myocilin localization in the

normal, moderately glaucomatous, and advanced glaucomatous canine eye, was nearly identical

to localization previously reported in the normal human eye. The localization of myocilin in the

trabecular meshwork of the iridocorneal angle of the glaucomatous dog was much greater than

that of a normal animal. In the nonpigmented epithelium of the ciliary processes localization of

myocilin was unevenly distributed and stained with significantly greater intensity than that of

normal ocular tissue. There was strong localization in the stroma of the ciliary processes in

severe POAG, which is absent in normal and less severe POAG ocular tissue. This leads us to

believe the non-pigmented epithelium of the ciliary body may be highly underrated in its

importance in function for regulation of IOP. Generalized staining was observed in the stratified

corneal epithelium of the normal eye, while in the severe glaucomatous eye, basal corneal cells

stained most intensely. It was interesting to note the higher free myocilin levels in the aqueous

humor coincided well to the changes noted in the intracellular myocilin in the