<%BANNER%>

Initial Development of a Ribozyme Gene Therapy Against Herpes Simplex Virus Type I (HSV-1) Infection

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101209_AAAABG INGEST_TIME 2010-12-09T10:23:14Z PACKAGE UFE0017527_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 2505 DFID F20101209_AAAWNC ORIGIN DEPOSITOR PATH liu_j_Page_120.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
7ec0c1750a95e38f227fef1822735390
SHA-1
7f29e21333484a378debf491410e9d5a128e58a5
3669 F20101209_AAAVQJ liu_j_Page_006thm.jpg
3a3d800ab8fff19afc4c0fef1374dfa5
b35e66df60a13e73e2dd2d21d979001b64968139
37355 F20101209_AAAWND liu_j_Page_213.QC.jpg
8f95b609095bb4af43f1cd2adbd1f32e
5c16f30fced176854119cf328b825918edc3819a
1053954 F20101209_AAAVQK liu_j_Page_058.tif
56bfdd4dce7ad35a9083ecac84b8b35e
bc8b42b695b059afa8306897907e614df12ec7cf
51006 F20101209_AAAWNE liu_j_Page_039.pro
966daf7a74ccb5c6c5cbbd87033ab609
7a02f9294a43fbfb19d38087ece2a55e333c9af1
3286 F20101209_AAAVQL liu_j_Page_082thm.jpg
5b4e67b9b63dd78678e8ac1e97f418b6
ea1c461779d9b5a489bfca1c6410867fb11f8790
F20101209_AAAVQM liu_j_Page_177.tif
e462ced8e007366bf4a43318d29f17db
d02bd33f9d6bf1cd977547fcf6bd2fab22b6e042
34106 F20101209_AAAWNF liu_j_Page_090.QC.jpg
da88c2e7f1a4c8b345157962d3c941c5
06cf3caa51ff6516470aed4e8df30c3f3e8a37ae
9176 F20101209_AAAVQN liu_j_Page_189thm.jpg
fa73967a76616bf677585995234e8ad1
51bcde4c922a4d1648e7206e8bf80c7056b11ee3
61847 F20101209_AAAWNG liu_j_Page_190.pro
27773877432b844732429fe40766edee
4e6bd2416460a4c954c8302a5c2d499aa16f1829
64590 F20101209_AAAXKA liu_j_Page_191.pro
2b40d123ded083e3104cb4558e9885d8
2ff08764c99dc32e0450f5eed0a2c19d890fe873
90982 F20101209_AAAVQO liu_j_Page_068.jpg
9094cb9f9246880f8bdcb388c397cb86
6d04aa0298a24dad97d27ff86a7e78a6c2f63301
F20101209_AAAWNH liu_j_Page_028.tif
086d45679aec286abe33fb7709317604
f5687600d15e622cdd279cdad3cae97ca963c630
1051967 F20101209_AAAVQP liu_j_Page_116.jp2
e346f463751813a7037da3bb06127218
138aebc2114f054a2bdfe88f824d575ea89ff04f
37329 F20101209_AAAWNI liu_j_Page_202.QC.jpg
cd43978b31c0a903b62c1b4eb957bd44
e6297dbdcfdf0a1f95783975c1fa70b4c32b77a3
58208 F20101209_AAAXKB liu_j_Page_194.pro
dfaf3917a8d11cd0c24777ed4cd56e97
f685593276857dfc6e4f70e623272a9f116164aa
8013 F20101209_AAAVQQ liu_j_Page_187.QC.jpg
ab48dfdbe6399e1f468e1b0cef3d0c57
4a3d6111f64d16d928bd4245bd906db62098e42b
1088 F20101209_AAAWNJ liu_j_Page_065.txt
b13b58478af3b4c3dbba41e4ca9c1105
ac4fa46d8e4161042bc8dacfd04224f22216ba23
67184 F20101209_AAAXKC liu_j_Page_210.pro
bd53c989f95dc7763a83d1066b8badf3
3073ff4ff371eda253b190ec949e9b339b59aebd
48776 F20101209_AAAVQR liu_j_Page_049.pro
69ac6d40b70018133685e390655c58cf
1842faf6a85022d3539b09b151c2e0f0b970a7ef
34013 F20101209_AAAWNK liu_j_Page_139.QC.jpg
2b8642b6892a9d1b0cd636e201cc0197
ee8d84b7668584f1dbaaae69c2d4a1532bd2d6ff
62295 F20101209_AAAXKD liu_j_Page_217.pro
102ddb01f09045ea6da9cc7dfc5e62fa
07157f94f337d7004e86c8d541c665aba601fb2b
32319 F20101209_AAAWAA liu_j_Page_224.jp2
2f3d636669bdd68c2518e2a6ad837e06
00dc93b190eccc556e1800ff3aae21f3ddb7ae1f
6508 F20101209_AAAVQS liu_j_Page_088thm.jpg
b501c85450ead47d5d108d69f5abbc55
20f1019b0f3946e13eda05173ab7823913cd9cd8
2712 F20101209_AAAWNL liu_j_Page_189.txt
da60551a59efb8d286b079b1ad49bb39
36bed2ee9597c165e30f346f6dde2dfc4cf3f9ce
66656 F20101209_AAAXKE liu_j_Page_219.pro
19013dbd8b624fef544a3794dad94ad5
686fbb0241e0934270d879bff7dc4c5f1c5a0280
36578 F20101209_AAAWAB liu_j_Page_137.QC.jpg
849f4e1cda828139db942d55dfc0f013
df4cf491a323dbe24f74c62c00bdbb4dd0b669d0
36161 F20101209_AAAVQT liu_j_Page_074.QC.jpg
b7f89766a20dfc4c255fa93e00b0c522
31bb54406873dc6769fd1fb7dc967cf187c9cc49
96420 F20101209_AAAWNM liu_j_Page_042.jpg
7981a6d81ed7d2252dd4451faaea07db
f652b5f8a5dc5e13e9d8abfaab8cdc780929e6df
63654 F20101209_AAAXKF liu_j_Page_222.pro
2602550870a7de916348a7ab8ca8d5d9
2b853128b17f7d86117592f849ba64f86326004d
38862 F20101209_AAAWAC liu_j_Page_062.jpg
c427596586f804b8bca0fa2bb30aefbe
28a76d327d7c4aaf32322fce168bb603373bf6bf
44298 F20101209_AAAVQU liu_j_Page_021.pro
f0397abe35e26bddd3f613c5e911d956
b7df831e9a24acb99cf69ebd36f2b20a0e0ebbcc
3155 F20101209_AAAWNN liu_j_Page_157thm.jpg
7713f5ea8dc0d7efaea8ae0d4c7e4135
8c5ed4b71a4b5f4f75923494375aa0226d22e20a
554 F20101209_AAAXKG liu_j_Page_001.txt
c6d772fec5e3edcd907c529532042247
36a6ee367665cee3e110d432c358d40f058b9608
47563 F20101209_AAAWAD liu_j_Page_138.pro
0efe4063597017124123b50a7e728ac5
8810c4cd036cbafce5d961349c4c12638085a2a4
25265604 F20101209_AAAVQV liu_j_Page_185.tif
373bace74c0215356e317571c5114b34
ab1fb196be6c116c0dd9cc61559c5b35552abdfa
13675 F20101209_AAAWNO liu_j_Page_113.QC.jpg
60a7988fc2724915a71223ede9954c38
d297c1d9019f30b273696413ab0a9d72640d444c
1748 F20101209_AAAXKH liu_j_Page_004.txt
66ea997911eaf579ddcd9f6e22558acc
df2d3186e3636532b11501633fc1dfd82c0e0f60
2049 F20101209_AAAVQW liu_j_Page_167.txt
5a8049bd6da6cc15c0728a8765ec3fa8
f7e9967397bd42c5d3aa3c6130ceabd5bed86986
136579 F20101209_AAAWNP liu_j_Page_210.jpg
cf1a32ca55918c2a2ac06a2eca7e3267
88e6264caa82cb62425d57d80c639f12091993f6
3765 F20101209_AAAXKI liu_j_Page_008.txt
a0090208fd19ba8856481d4d6afce581
c2ce829c309ea5d0cee14487bd88d7f1b210c3ef
F20101209_AAAWAE liu_j_Page_184.tif
26c0edf3daa9cb543eb6a808976ef3a5
0b6ebdd3c6e691b370cb716d372dd265a299a065
4226 F20101209_AAAVQX liu_j_Page_161thm.jpg
adc35b04ebc222595e0370189b1894b2
89a391e6b472332a7a1a2d980905b2941ea63f18
25271604 F20101209_AAAWNQ liu_j_Page_046.tif
97567d904af03c56d8f83ea16d114dff
514b7a4f83468dc93c6c4894f464c29c092171f8
2095 F20101209_AAAXKJ liu_j_Page_014.txt
fbd83bae4e323fdbea65a2e9d1c2889b
cd2cec3a3dac7bf2e205ced2df6bd1fd2f63d707
2547 F20101209_AAAWAF liu_j_Page_207.txt
7d3a991f9b94b18eb6cd12afe0172d80
7217ddcb69bbea2eccb5700e4258e93b36dcee05
F20101209_AAAVQY liu_j_Page_049.tif
ef32646218aea6a44ec2b09485db88fc
1742560d658669a9628f2b36fbeb49138f2e5b6d
104726 F20101209_AAAWNR liu_j_Page_072.jp2
6fac481a684b285a91b090e77b1b8cb5
7e3801633d5522b2b75b4f4cb7347a45cec2b83a
1637 F20101209_AAAXKK liu_j_Page_016.txt
293c4a080a338e71d7645bfda603c510
5eee6945190ebe02d78000b3b7c3c1e29bbd9081
32743 F20101209_AAAWAG liu_j_Page_054.QC.jpg
472042ab5afa12a11f8eeb792a275041
e25ca573cad3bcd347b8dbabda2578301e71b3e2
33460 F20101209_AAAVQZ liu_j_Page_127.QC.jpg
bc2c6620e96f90e56515b6a9ce8c1f04
fe4638acfb17a7abc9f97332b43c1130d6a001a6
36054 F20101209_AAAWNS liu_j_Page_135.QC.jpg
b373aade5b8973a04103f14b261e2082
940f858d1baa1b3c17568b8d5d25ae224d5fdd59
2103 F20101209_AAAXKL liu_j_Page_025.txt
94590b9e7f5e26694d77f52bbd87600a
eedf0b1ac3b8ed59557531d1e207e3b52b13809e
51093 F20101209_AAAWAH liu_j_Page_108.pro
c32158d61ff757d56cb831da290b7c1c
ef71f8c93e1e6396f4f306d65718d3a7744f6817
51037 F20101209_AAAWNT liu_j_Page_024.pro
6e0d319cc35062d1d77e46d2a180f1f2
4f7582ba968398fdadea9498cc2fde7e56ea9710
2024 F20101209_AAAXKM liu_j_Page_030.txt
939a11d326155e4b3b95270da6095574
1d5c6cc411d78b545e0a74dc5d6b9cae3737c783
F20101209_AAAWAI liu_j_Page_223.tif
23d4219e1073f8215f1e2053fda47780
817d8f27a1224d857958a3a0d758fce6830fe04b
105119 F20101209_AAAWNU liu_j_Page_124.jpg
3f7363c4826c35c035310e03a3538608
8845a1ca09efcad03483bf8d72b0daf811d7db57
2002 F20101209_AAAXKN liu_j_Page_036.txt
ed6f701d1f04544f734b158093d7f021
5b7d11c3927d15f52b06d0701078b6e3ec52a64e
51869 F20101209_AAAWAJ liu_j_Page_057.pro
d506bb24bbce85d49eabfda59b6a276c
cb8266fc890eca23435b6b0bd73fa7dcf7ad7c23
8053 F20101209_AAAWNV liu_j_Page_018thm.jpg
4c35c73ae813a889a005ad5328f761a8
8d5d5f5d2ce158a1041d4426da352128213ec701
1891 F20101209_AAAXKO liu_j_Page_038.txt
6b6a90d1833574e6e39ea6fc4327abcf
4516677dc889fc8fcfad83c9f00f0c67f8b515a6
108488 F20101209_AAAWAK liu_j_Page_099.jp2
1afcd244212888a0fb51e6a1b857e72a
087dcf36b0756ecf662070ecd97ee53690a14c62
F20101209_AAAWNW liu_j_Page_034.tif
68cdd2cf8fcd692097fe200a05b4a32e
e88f71d3b2f0125ee0d8974aa4697685dc69351b
2011 F20101209_AAAXKP liu_j_Page_039.txt
99f6a6216d36438cea0742f5efa02523
87dba335deface6aca842fd78fba889d4b786fd7
102647 F20101209_AAAWAL liu_j_Page_050.jp2
a01b8311e1072e79eb32ffa9d65b4958
cd71d283483a5533b1b0fcd1041bcd1e474126b2
8488 F20101209_AAAWNX liu_j_Page_134thm.jpg
30d584a4016ea0effaf6eef4bf6b7d2e
a8683cedd8e794a0ceceadbc15529b21056b1d7e
1640 F20101209_AAAXKQ liu_j_Page_043.txt
71b673304391a15298bcca884f179b98
d286e218a346e2881d0e673d21bcc6cc5145adb5
7475 F20101209_AAAWAM liu_j_Page_188thm.jpg
c28996382ef6380675498cfd1eb848a5
fe44eee0d8252966fa611fc7f80656cc77251ce4
6769 F20101209_AAAWNY liu_j_Page_085thm.jpg
7e720a2e5b131c8ffb02246f15432214
89eabbfdd8436eecc4345a0bc1e0005dc568ca5b
1922 F20101209_AAAXKR liu_j_Page_051.txt
9b68cfb958289be6a797750aae4e30c3
57d44c09745734c9abfcea1ed26b07161fdf4634
110979 F20101209_AAAWAN liu_j_Page_073.jpg
1b29b04f81cbe2ccb52e21e82ceb9f8a
03a16d7d77bd2b61f945cc9c9238d7e02620cca6
8321 F20101209_AAAWNZ liu_j_Page_174thm.jpg
3ee4329eb46c47dd1ed7788f70284924
605d8d30a1f3ce2d9b14ff1d1976c4fe22a3effa
1945 F20101209_AAAXKS liu_j_Page_054.txt
436ee7b37d2ce26b8ef349a8f0e964e5
647a45cbb9a2bb6b7b7ae9176db234324da5afbf
53439 F20101209_AAAWAO liu_j_Page_125.pro
e0279a50cdfa4842c0ee081db3429bf3
85ce2a31150f9afd531580a1e8a0996a16cfc93c
1933 F20101209_AAAXKT liu_j_Page_055.txt
5305cb2e0ddbf7509e3b5628b70c68d4
eacd13d650ab3cebe0eadb4bd1186255dffd019c
1793 F20101209_AAAWAP liu_j_Page_052.txt
c5bb3e4e3cc6e26c960889ac9328677a
a72ff6ff74e6cfc2d9ae6ecf3387d76d7fd1d7e7
2071 F20101209_AAAXKU liu_j_Page_057.txt
a1ffa1e25fb6cc10fa264792450333fb
7e5743ae75eafe93614a1d32af2c008a2da81edb
F20101209_AAAVWA liu_j_Page_226.tif
80e55548584a60cd671358d47208126d
cfffec00df753617f15ea150fa738b12a305d8a1
102752 F20101209_AAAWAQ liu_j_Page_027.jpg
9b1a5eb6b7288fa7006581ecb82d3452
c50bc464ed6cc256b3ad970469bca241b6af23ab
176 F20101209_AAAXKV liu_j_Page_059.txt
b8ab095456489172d04aed8bafe9ccbb
12cfd868cd3133174d6f4e0ef87863217ddb4a7a
8103 F20101209_AAAVWB liu_j_Page_152thm.jpg
ffdb782f36137acc4e9622dab5d766ef
c965719190af893dc05efea0fa006aeab5f6e794
70334 F20101209_AAAWAR liu_j_Page_193.pro
4debfdd138eea323cfcbbf341726d7bb
8dff982f499574bfc57113409ca907b5cbcd2884
1890 F20101209_AAAXKW liu_j_Page_071.txt
c7fec7bb3160e3ea7135b9c5909c3a6e
43ed2a8a8e918fd5bdafaf3fd76e712e957ba4ab
8895 F20101209_AAAVWC liu_j_Page_215thm.jpg
2354ed34f185fada02ad6f4563ba3a40
4ed8b6a7662302c52ea4f07eac46b37134560e6d
34973 F20101209_AAAWAS liu_j_Page_160.jpg
66229c859733414e6959048dcfb7bc20
f64e46185b7d3ff9a84c6b274a22b985d4ece0cf
1909 F20101209_AAAXKX liu_j_Page_072.txt
ad9b69cdab71f264a040c354d6015836
6af6208c266e559875eb686ebb0e21857a0b0b86
F20101209_AAAVWD liu_j_Page_160.tif
7fe14e03ec391a22ff04a4528c3f1bb5
ff9a0431d7b692b20e580bf10830d62964bdc01e
35479 F20101209_AAAWAT liu_j_Page_207.QC.jpg
b2eb9edfa011e5846cbec8ede1e57a08
b0936251c11157e7b3300671177c38d480c5d7fd
2038 F20101209_AAAXKY liu_j_Page_073.txt
4887bbdec1be3fdda818876f32b435e9
f2817a1959e5f4d3887f0680f956ca0eee10ea72
6601 F20101209_AAAVWE liu_j_Page_159thm.jpg
dc450135c621677cde9e6a20038c7b16
4ae2ac4288b5369348ad63dc90f7f03013a8b493
111339 F20101209_AAAWAU liu_j_Page_130.jp2
6cc61292a518d7210c3cb28d6886150b
89611a1f5dabb8b548d34e022d1f8f117fd295ff
2063 F20101209_AAAXKZ liu_j_Page_074.txt
5e5e663a8ecd050996a658b69c6ee65a
19be08be08aa5206e6604764afcb24598f28fb92
53920 F20101209_AAAVWF liu_j_Page_126.pro
ac3f61092a7282c7e702a8458bb39022
2f5b8c6f64826513750b063cef6991458ddd5131
47331 F20101209_AAAWAV liu_j_Page_112.pro
bb902e5708ac7d499297b83e7c2dc316
cd9c913d68aae17c1feda2e7e75860799d88d398
109142 F20101209_AAAVWG liu_j_Page_139.jp2
267bb7dd4649caa614073255dccef9fa
32d63a89634a58985bf0e8817a1af330426f48aa
40937 F20101209_AAAWAW liu_j_Page_226.jp2
c22243f8d7f926fe18cd1f0f72e7d8b5
407376236861f10331dc56649cad2fb993972945
8491 F20101209_AAAWTA liu_j_Page_081thm.jpg
931d9c02008837db2e2e442c41a9379c
7cf668f943f334fbe89851cb70cfbed7f979b524
105166 F20101209_AAAVWH liu_j_Page_150.jpg
91f93ea667a299b3d3dec6239437ca19
d5574b13efceed039ba4266b1994904efb126333
110816 F20101209_AAAWAX liu_j_Page_087.jpg
86b4399bb60df74fe098081f1523fda1
ae17181b491a1049c1184b0423c271a48668a7dc
F20101209_AAAWTB liu_j_Page_024.tif
fbfce9da375539304fe391cfa4c81d59
125206f666a471808ace98779d149030f3f24c23
3733 F20101209_AAAVWI liu_j_Page_185thm.jpg
4a5ff2c3d110de57db8d3c3e258b8bbf
e84e3cc22228a8f72ac2b800a9bc03138df29d15
F20101209_AAAWTC liu_j_Page_134.tif
b442958b18e5d9cd46ade23bafe46fc6
27433945eee845d13acb4bae1d6cd9176414daa1
2599 F20101209_AAAVWJ liu_j_Page_201.txt
6feac2fc87027360cf7be5e57547c0cc
42b7739641c80cdb0fbe2b5dd94f320cb3a5902a
7077 F20101209_AAAWAY liu_j_Page_123thm.jpg
93a0b4670078a1a21878efd35593f420
2e0bf9d728879da16e94b8a340973bd02999c249
113795 F20101209_AAAWTD liu_j_Page_035.jp2
0bd8af858e2f4783ac30aa86d1bd512f
b8743febebbbdb7768015af77af7839e65ba4789
134879 F20101209_AAAVWK liu_j_Page_214.jp2
4def84f28611e70070043ca1b192ec36
229b4802e631829276355d8accf6b3623f9c229c
34177 F20101209_AAAWAZ liu_j_Page_091.QC.jpg
feb236bb5dac29781c96e59e666c0531
6d511472fbee8dedba8d2f6e95362897d321f53c
33652 F20101209_AAAWTE liu_j_Page_030.QC.jpg
4baf0ebbfc6d59f88b452734afa05f52
7f73e5938b90827c40b1279ae691d12e075c261c
8330 F20101209_AAAVWL liu_j_Page_097thm.jpg
fe0845d651572457d48c9e0504810cfd
19f1145b32d78c1bc3e7756f4643e10da374cd2b
41970 F20101209_AAAWTF liu_j_Page_123.pro
08b9f577a1e9084d86eb24e9884ae590
785ddb091a3cf825e87fe4673b81afbdf4272301
35356 F20101209_AAAVWM liu_j_Page_035.QC.jpg
fbffa946ff0a14939cfb32ddc3caf1d3
986676a7b214dfad82b1ed664d1b6b37c16fcac7
1901 F20101209_AAAWTG liu_j_Page_020.txt
b6dcb7221d20f23f3f87d91c9a2b866b
7f0cc2e662f4db677afff8a8b263b049227f3192
103407 F20101209_AAAVWN liu_j_Page_147.jpg
05d0d6858a6296fdbf43248227fc0bac
57ef86a6ee60ffc71e347829d40c03fb0842f10f
104703 F20101209_AAAWTH liu_j_Page_055.jpg
7c342a36544d112ed0759f18d170ff2b
2e153438caacd321c907688238d0850880deda3d
8347 F20101209_AAAXQA liu_j_Page_078thm.jpg
3c2d879e7b56ce64291d792bf160f7dc
1a9b2c328034b4be8cbb16e42aed26841822bcd7
6972 F20101209_AAAVWO liu_j_Page_089thm.jpg
929b0c80822fac75376b784a635baab6
8762c7e3f349d06ff86924c7df43c468b5ead769
52931 F20101209_AAAWTI liu_j_Page_135.pro
ae14111673b84b955397d765fa272822
0bc3c33b40f7608e21e4f7411b3e18152b9eda1b
8397 F20101209_AAAXQB liu_j_Page_080thm.jpg
4514787c5ba6fb7716fb3fe3059f3206
92c33a652bf3ff27358b0e1a7a56c59d81faba0a
112211 F20101209_AAAWTJ liu_j_Page_077.jp2
e7909d17af5104af8d0cfa441603fd93
3a5b2dc203057b45dfc5b96fbee6fa3a5bd64952
25943 F20101209_AAAXQC liu_j_Page_085.QC.jpg
7bbe2f310e771b482fd3b4339005e900
ef04b6fa8f4ad7f779d7a9fc7c582f18d13f788a
1443 F20101209_AAAVWP liu_j_Page_067.txt
f707c64baa59c0354bdafc40b772f731
df20e92b5cff400b99ed858e0eee29b6ad18ab61
19839 F20101209_AAAWTK liu_j_Page_063.pro
50712e563006968d112a95f4be0572bf
a1d0e83278b5634a69d89845d5005f55027966d4
27455 F20101209_AAAXQD liu_j_Page_089.QC.jpg
6d0a3d13132dd16c3d565e560f07b4cf
c68ac6c002c53361f7ef7c285dd9124daf3d013c
816827 F20101209_AAAVWQ liu_j_Page_156.jp2
c1a87fba42fa4e03b373b90c3957c054
3e80f58c244ea4fc4279c6287d9f848cbead76f1
8388 F20101209_AAAXQE liu_j_Page_095thm.jpg
022348adf706990d09f35ea5ebd72030
e324f4a79f66d0bdf8ef7c52846c5c66822475c0
1917 F20101209_AAAVWR liu_j_Page_076.txt
129750b37a8b7bf859d671d0946f0ba1
472df50531a4c97c7bb61cc1d9ddd4e2e046c3cf
16249 F20101209_AAAWTL liu_j_Page_181.pro
17061c23422e084c49a1ff70a2f67d10
05e1a979777282c636160cb6576babaa6734a56f
35346 F20101209_AAAXQF liu_j_Page_097.QC.jpg
f8c9e42b88536d74421d53e36ad4ad33
ff74944fdf0349a0ec84e75e580e2492776ac17a
102340 F20101209_AAAWGA liu_j_Page_131.jpg
52d3dc7d972c269ef04667986d7dab3b
d9ba459b147225e3e228d2d679fa490eb026c813
8234 F20101209_AAAVWS liu_j_Page_199thm.jpg
84ff0f47f699040c78a709d01895eb12
d5d77b2e549930b286d707cdcd9fc11a55a8de01
79976 F20101209_AAAWTM liu_j_Page_015.jp2
a0ac093b57b6e0789b2108667bf41160
c550a996237651869223c83fbb4411f93553631a
8676 F20101209_AAAXQG liu_j_Page_101thm.jpg
51637d993637de9bcef80afe6a48a667
6f5fb3de8bc6f8a564c4f46bcd5f9833f0b35e50
F20101209_AAAWGB liu_j_Page_110.tif
d977dc86b9af70d42bcb5779b1f6eadc
8d89b874998e957664e261170c4a8f533f0058e0
105839 F20101209_AAAVWT liu_j_Page_029.jpg
f4615167743ad4507b5bb0e2e379dcfa
f5ac21238d821c8e7373ed4527e4236682b8808e
F20101209_AAAWTN liu_j_Page_001.tif
a6c15469c86375f9a888b5bb98d41402
79d6150990c8dad0334d7d2f0b9229b9d490f857
106074 F20101209_AAAWGC liu_j_Page_094.jpg
b141d23aa506fcdaa8b15334eaf35221
b560ce79acae44eb8c13f71d2a31fa1dd5514bf4
131210 F20101209_AAAVWU liu_j_Page_215.jp2
03fbf896eb754f84c00242d89c01e46e
cc52e610180959ba1e2c7c6b8580035d68ba11ff
109007 F20101209_AAAWTO liu_j_Page_030.jp2
a195c8b34fa5ad0464009a1cd9ca370b
471674d4dc9a12c93919d6a8b8af50e563e1b53a
8305 F20101209_AAAXQH liu_j_Page_104thm.jpg
26a552991495245a6081846ac31c0ec5
613978afeb08bdfd3444e310ffcf2d21fece6bc7
1918 F20101209_AAAWGD liu_j_Page_139.txt
733f10f35766767b332e838373b05742
1245868ae43959437d4372dd14e59fc6ad4644ea
107821 F20101209_AAAVWV liu_j_Page_167.jpg
5e1073d13945edf3cc7518dcec84db3b
9db6b428af6bb9c272c65c9076d2b2800fe256fd
1206 F20101209_AAAWTP liu_j_Page_066.txt
16f0617ff816e68bcdfcbe9bfe416df9
032fe319d80a9714c14b383d45879fa1ecccf23e
8824 F20101209_AAAXQI liu_j_Page_105thm.jpg
cb030eef0941c6922010abc50a7fbf02
224b040a1b49b159b668d3478e30c7b4dd48bdc8
93397 F20101209_AAAVJL liu_j_Page_009.pro
57f33a63d7d4b0c1c8ae4addf07cfbdf
3854c9c0c3472c6bbbcf4537877e83e1cf231d8b
110950 F20101209_AAAWGE liu_j_Page_005.jp2
fd273945432158ec6ccfdbcc911520a7
af489c4ffb38f5ea3834868e846f183f9b484ebf
1958 F20101209_AAAVWW liu_j_Page_152.txt
3731c66fe723616e2f9fb8b1b4016ada
e4c0e7e1adf031335b0064387e30653f6d2201e5
34227 F20101209_AAAWTQ liu_j_Page_075.QC.jpg
98bd5d3cb25ab5545156e22ee750ff5f
11272036640c0a46b57480c1c26bf8e2b3aa4a86
32979 F20101209_AAAXQJ liu_j_Page_109.QC.jpg
6650415a834c668298e48d159ffc4e07
72badaad7c4a68d0c7aed77edb44fdb423360d44
52620 F20101209_AAAVJM liu_j_Page_074.pro
1102db1a92880800b06bb52234de2f58
b263af8cf4cc42c3367f629d5dee69b81f8286fd
6048 F20101209_AAAWGF liu_j_Page_156thm.jpg
b666bfdbf0f22584d8253a2dbf8aadad
ce8dea50a4e1cbb2aa1a2b86852bde01096d046e
8623 F20101209_AAAVWX liu_j_Page_100thm.jpg
f3086095fd81922bc4ed74a82ee767c0
5da602b5153edd4040ab4e57b1681c8b4cacefd4
1221 F20101209_AAAWTR liu_j_Page_002.QC.jpg
83376d28f437c728e63d55d16809227d
3097f6491a90d4a4c33f241644e5aed7c31fb8a3
6208 F20101209_AAAXQK liu_j_Page_114thm.jpg
2fe49b413324f5adb1540fe158185642
a6a86586970f249d30f3b35cce73c676b180aec1
F20101209_AAAVJN liu_j_Page_083.tif
fcf7f9040edd77d60ad610ce5bfc5d50
97fad9b6cd3bae10f0cdf59eb22fc966c22704e8
29437 F20101209_AAAWGG liu_j_Page_117.jpg
d84920458eaf3effba1ededd9576e9de
27e628a6d72fbed742001ec0bdc9b7f3f02d063a
37806 F20101209_AAAVWY liu_j_Page_219.QC.jpg
1317438140b4a2d4efb62406d05c467f
8ed2b3b9f24b48eb2081450265348f319b7ecd99
9721 F20101209_AAAXDA liu_j_Page_059.jp2
f4495237b672a0774fbbc96f14b5bb3c
ac1741533827af7dd3ae04b4e9fd2075cecafe99
51679 F20101209_AAAWTS liu_j_Page_128.pro
62d0b49a55106e9880463d38b0af2d02
5715eab8bd484d025f73cbd91ef564081573c9c3
4727 F20101209_AAAXQL liu_j_Page_115thm.jpg
7a5f3717b89edc454628e1c351b6f122
b5886d180087418d96e4861a2fc66ed20d008bd4
9328 F20101209_AAAVJO liu_j_Page_195thm.jpg
eb1798be61fc76171e5676556af0d74a
ed985d4df73916de68b0dcb1bcb4f0c207608c2e
F20101209_AAAWGH liu_j_Page_054.tif
2d3bdc098e76598062d5dfa80e0cbe5b
d1f60ac9b29268fc7b9794d31b755db2fd2a0dd3
F20101209_AAAVWZ liu_j_Page_002.tif
a66cbd1a60649b88d0d6bfd7765ce17b
89cc134e7a7322f291b4226bc4fe9d5d626ae193
454873 F20101209_AAAXDB liu_j_Page_062.jp2
b61aa146b3b1cec0dc7da7bdc91707a8
8b978cfb849f885dababe2a55d8299445a3a4fd0
F20101209_AAAWTT liu_j_Page_043.tif
f2918a3536909e5d7e2794a1515d4697
e9888a2719744ea04712e33a8024e07a889d221b
2786 F20101209_AAAXQM liu_j_Page_119thm.jpg
99a7d4dcfbcd2786466100a7648489d8
1b7865bb92eb7b21d58d9b54af84123e83532514
8327 F20101209_AAAVJP liu_j_Page_141thm.jpg
228141bf3336cf535e56097d759dc277
af0443eb66c7d15860dd53c30fa9f95528c2332c
34983 F20101209_AAAWGI liu_j_Page_022.QC.jpg
4f044c2a3828a3ab859c5c84245b7550
74f8968ba2d094c37b19a6c0de51c80b37ceb420
109354 F20101209_AAAXDC liu_j_Page_069.jp2
3b324a8007703524d6c8f9147cf263de
e0864c1bcbfc956799aabe4993fde3c86204d39c
F20101209_AAAWTU liu_j_Page_072.tif
14934e2e1726a6e778843448c0049614
7666f2d41aef54d3834b8cbf0ce2efb87ce8745f
10032 F20101209_AAAXQN liu_j_Page_119.QC.jpg
b206cb7b17f6ef0890b8ffe2ec07b21a
79bf8c16d8b6328ed54a3615982fd76c2d243a37
2015 F20101209_AAAVJQ liu_j_Page_056.txt
812132e4330b02c948985b69f4520167
5f9b9a11d526f254d15a285948ab91e523f1d058
1010 F20101209_AAAWGJ liu_j_Page_182.txt
93098ae5b3f283327b327be137568c65
12ea22205ae7be3030e63dd56500cdb209d83f17
105029 F20101209_AAAXDD liu_j_Page_071.jp2
296ea883e0f181c699e8f5594f3981ec
0c03f5fb648f1ae8ab405d0301c79e65f817695b
638 F20101209_AAAWTV liu_j_Page_045.txt
0bd8cf1d73c196145dab44dff3ba9785
be4e75c03979ee5e018465f9cb73449a3972bd51
35288 F20101209_AAAXQO liu_j_Page_125.QC.jpg
9e37d47cf3a330c3876b98ff3b84b94a
5276be779364684df2e5682f9f940ead9d2f10d3
22620 F20101209_AAAVJR liu_j_Page_084.jpg
85f28e6b43db8f6abda31ed34aaa9d79
935b34c515433231ef40a1b2787d7141ae995dfd
112750 F20101209_AAAWGK liu_j_Page_170.jp2
544b6f5dfcfbc4c1162a5c7eea4af5c7
058dbc2b0876d4f762d1115dab4203a41d2378f0
101016 F20101209_AAAXDE liu_j_Page_079.jp2
be79657fcfbe249b659069c61db75e55
e9f0df2cea9bd88f7369ad9d534a77236fbdc7eb
8624 F20101209_AAAWTW liu_j_Page_035thm.jpg
f5a337e07a76c54546c72eaa28be3b24
4c6decbb32e52bcda77e65c88c3fcb4e95a74e1b
8454 F20101209_AAAXQP liu_j_Page_127thm.jpg
cbb3604b3ddc45a33dedd3e8df78d331
46106baa8cd046f84495612d95e0c65a3f0b327d
33750 F20101209_AAAVJS liu_j_Page_124.QC.jpg
096f8e358cbee081cd37e1604e432469
a9fea8796d535cb4566e264f9cfd4be8bb38e1fd
105579 F20101209_AAAWGL liu_j_Page_132.jpg
985ae04b13fe9a9f98921d7717f3fdef
3f5f39693bb2ddb676a6a85f48f52acd5f7977b3
90107 F20101209_AAAXDF liu_j_Page_083.jp2
085060d6896cdd0b82931ae3ec351b6b
0d4ef9e2a3b329056e647442474620e68dc6bc63
105764 F20101209_AAAWTX liu_j_Page_077.jpg
fe4482cb9bb101575cb88324dbf821f0
8a38f2d871506ef28db8205a4db6269e6ecc1b4f
32534 F20101209_AAAXQQ liu_j_Page_129.QC.jpg
9561ad91bcb27a9fb16583fa45f4f2f2
d8ba509de921557dde8828fc55e6b9d0b4c6e062
2809 F20101209_AAAVJT liu_j_Page_204.txt
2fd3a28a13dc288db0684b93db470a5a
47886e0eaa89a39427961a4f1d1afed9efd21f00
F20101209_AAAWGM liu_j_Page_151.tif
06815a31856bcfde7933d23dce07c8d1
e942aa0dda46f910455536d2ccf289da27af08a5
F20101209_AAAWTY liu_j_Page_163.tif
35a321006cc86911ad1d006da86735dc
3bf7977a7c1183ce655990cbc847e2e3f0b0d2b6
8185 F20101209_AAAXQR liu_j_Page_131thm.jpg
291a36fb405ef96efee9315aa0d293e4
bd681c8be7704837c6486146799affda2edef17d
1051966 F20101209_AAAVJU liu_j_Page_087.jp2
e3ffb12e567f8e136ae77457512967e9
e67f0612da6756ec28ffb30c5f40e0db5183e970
34935 F20101209_AAAWGN liu_j_Page_055.QC.jpg
72b2a4baf8520dd0f06221957a1d4d25
22c6cd7127ce04a0b8e80003fdb4f42981802ef6
224912 F20101209_AAAXDG liu_j_Page_084.jp2
e7610da3b9e1e495a73e0ec43a0e656a
480f5887d6bbfffc1745029928741660cd3b89fc
63048 F20101209_AAAWTZ liu_j_Page_220.pro
e6f3422fd8a056b402f5b0da8a89be32
a7996470e124e62d97067d28478702f53e4958ef
33991 F20101209_AAAXQS liu_j_Page_131.QC.jpg
aba18d238825271c2959fc9102b2e54f
9bcfc698375fe6917e4036f2da6a26df4afa42e6
14379 F20101209_AAAVJV liu_j_Page_224.pro
69f89a9ad2f7933f4e0a71f018642976
4014ef73f47022b91c507b51aa69c079491bda22
17716 F20101209_AAAWGO liu_j_Page_226.pro
b8bab047709e97b03fadb7e3f7b239fb
75fe0d9bc91dfca5fcc2938c545f73be4d3d9c89
471514 F20101209_AAAXDH liu_j_Page_086.jp2
187d8f36294c24c5b78e237ba76c370d
4aba3a79f5e7a8ded54658230a618cd5c75c378d
8170 F20101209_AAAXQT liu_j_Page_133thm.jpg
a8841de74ec0ebd0d6b7fec5b98e7a6a
d0738f5515cb008612feef729ed2581a40f7b5ab
8609 F20101209_AAAVJW liu_j_Page_051thm.jpg
bd305af34dfadd4500db916090c39657
a2082e37db41629816b56e2ef431e0bc6be90b2b
25510 F20101209_AAAWGP liu_j_Page_154.QC.jpg
1cd72fac7028f7eb4bce053682800cb2
89df6cc75826a2f2ad2ee1529050e8d8cb4c9103
787286 F20101209_AAAXDI liu_j_Page_088.jp2
112fe2d51ec89ca0529c093b73c3b0ba
1d7b00e32a4793b45f2aeb7ad9623557cd40481d
33175 F20101209_AAAXQU liu_j_Page_133.QC.jpg
563e2e52be78069a03712fdaff14a30f
95ebfc3d51b55f84a23712e021ed24401f4923c6
98168 F20101209_AAAVJX liu_j_Page_037.jpg
2b16833e7891854dc388696eb890b0a6
80c031d254e91b7fca02b1992ac0897f74f9fb22
25004 F20101209_AAAWGQ liu_j_Page_061.QC.jpg
b7509e9f1deba1393c0105f689031afc
12502b862852c7a10a5a3b7d169cdb582bdb0429
89262 F20101209_AAAXDJ liu_j_Page_089.jp2
d43023119bbc3d42bb65e2c3fbaebba9
01d51b32d6ce1ed6326bb55cc7423546124af2ca
8699 F20101209_AAAXQV liu_j_Page_136thm.jpg
89ddad4d1a00aa97bece6ef44dc32812
e9984a2b7825e4c77f6dab76f24246aaf0eda7df
7820 F20101209_AAAVJY liu_j_Page_163thm.jpg
b4cc3ccc10cba9120105b7306840d530
b1eeafee7872382deb3be0070f73bbb4c6ff6177
40200 F20101209_AAAWGR liu_j_Page_043.pro
a3ddb6f76b6f633d4447321538e061c9
7c601bb109f4be72161b5958b676130f71ba0b0b
109999 F20101209_AAAXDK liu_j_Page_090.jp2
6c6bddf88b6b9c61c004d0d13462aa2c
498a47997c601063b0092243173c39726dcb3cc6
35709 F20101209_AAAXQW liu_j_Page_136.QC.jpg
dc3ee8ad01988ebf76d8bcd3276a978d
b8845839053ea00c3028ea24cdfeead446fff822
1954 F20101209_AAAVJZ liu_j_Page_075.txt
863c790886e0ef0a1999aeb8f62a3037
35dd539ebfd77bd01fbb72bee7cadbdc32d282eb
15350 F20101209_AAAWGS liu_j_Page_060.pro
a490b776e96044148d349c6730ce4274
990e8e7573b78b6f683d4e03b0c8a372d3ffbed0
118066 F20101209_AAAXDL liu_j_Page_097.jp2
de5ac4ccd23ad70c97f0c1dbe8f8942a
c5de3082aaef7f88fa38510fb4a247721c4131a0
8612 F20101209_AAAXQX liu_j_Page_137thm.jpg
94a144e962587005c78b2a27626e5855
c93816d822898993dac8b4561de0704f8d1ad740
101148 F20101209_AAAWGT liu_j_Page_058.jpg
42c113eab4789009a7def7fb084510a5
b86dd426809f35fc7bca9e961a201f60860a5e1d
104191 F20101209_AAAXDM liu_j_Page_101.jp2
fec5c69fedef4b7adfa2b6061e41e48f
acb8e0f468baf4a79d9aef70c79fb17cc8b22641
8430 F20101209_AAAXQY liu_j_Page_139thm.jpg
4cdb9a456eeb91737ce0303b122560cb
f8578b2a4547be7530730e019a9383b0ac5d507b
2039 F20101209_AAAWGU liu_j_Page_146.txt
94bd8ba6668dacc114c91ac42f4fb218
67e263f372b637c24e9f9dbc72e7c801b5ca4354
114203 F20101209_AAAXDN liu_j_Page_102.jp2
35075cc77b0218062a5c57fb1c32bffc
0bb21ed309d33832b234cd9ebdf377a209451e44
8312 F20101209_AAAXQZ liu_j_Page_140thm.jpg
503182208d1f4ad958d980c8291eba37
e8284679d9f6bb9d87c0f75c8a1f74b9a58ba30b
36921 F20101209_AAAWGV liu_j_Page_196.QC.jpg
7fbbe93e0b83f068b045e807769e2b2c
00d3367a66e15e1ed1cec9ca2134b7db93afc4fb
108412 F20101209_AAAXDO liu_j_Page_104.jp2
34948b2c99f95e815f5c849c008d7a66
c58511a7a7d2f8f2cca322e4e8818f0422ee4e57
94798 F20101209_AAAWGW liu_j_Page_050.jpg
96f774f2edeff12803058410e077a541
5103decc63e9d09b8539ceef2df6de82bb9b2fbc
111442 F20101209_AAAXDP liu_j_Page_107.jp2
016faf4acaaeb66dbbb5b44808f0164a
05be3ce9206c48172802f0211aac7065c2b699e5
23852 F20101209_AAAWGX liu_j_Page_060.jpg
5ee72bbc24a32b56f80cc5567639f7e3
c8d8974859ab28e056da58147e297a838f944b94
35192 F20101209_AAAWZA liu_j_Page_218.QC.jpg
41d7cdca6c6e58c69c7a1f179e392676
0bf887d9bf5ca66a9ab934d0742e584ef2c524c5
108764 F20101209_AAAXDQ liu_j_Page_109.jp2
7b21691616c853a488bdc137cf18a322
8a99724ef11b24e7542ba8e836b5f5b060b2928c
18438 F20101209_AAAWGY liu_j_Page_066.QC.jpg
8a881812317fe4f5a6bb894d57cadee4
2fe4f1ea015fcc67426ecce67a85141381127659
1191 F20101209_AAAWZB liu_j_Page_122.txt
643159cbfd75ebb3f124229a5b715792
2b30ccc763638f6ca5423a0088ae48f9bd22469e
672496 F20101209_AAAXDR liu_j_Page_115.jp2
59cc85473e6aec0227bb03bd967f7807
eae14b1ca34560ad98872d74eccb72a29dba7532
F20101209_AAAWGZ liu_j_Page_044.tif
3dbd316fc8a13f1bc3e1e970c4939381
52d6e60da8f172bf1699bcd8de16b0754e598703
105925 F20101209_AAAWZC liu_j_Page_080.jp2
81d61f9726e3ff23287abcdca2154ebc
9ee0177dec0d538fa2424061913b0871f731151a
1051936 F20101209_AAAXDS liu_j_Page_118.jp2
d1d0ced8c2bc038b6b8fe84b3b126d0a
da1c15afd07f1f0398a892934892724f9342189c
2572 F20101209_AAAWZD liu_j_Page_095.txt
1cee8588e6e51efea15cfcf71e16329c
4f3cf55cd138115664e58ac04d5b8f1cab37abbd
273004 F20101209_AAAXDT liu_j_Page_119.jp2
14a2ef18a5d5c6439f1146d8993586ad
33f607cb7cb5a682dcc3b3c165a7a24f73f636df
102282 F20101209_AAAVPA liu_j_Page_173.jpg
c08d4286b81bf3fa649910c9ea7d96dd
f21fb9b0362453152c0cb5aadc2b26da33815535
2675 F20101209_AAAWZE liu_j_Page_212.txt
88d1b92a70c428c1bbd19361ee95745b
7af5c986a05142b9a73c26daeb15bd70bbf66b11
1051952 F20101209_AAAXDU liu_j_Page_120.jp2
92db524be3b7f775961e3ac03d2517c9
127b9d599e30758f004294d40a073d30c61d3cd3
1087 F20101209_AAAVPB liu_j_Page_044.txt
c57650026a6143b8d8b813eb75df0a67
329bfd87ab4c6b9b2b374daf9c721b8020c305f5
48320 F20101209_AAAWZF liu_j_Page_080.pro
d19e3cb9e78bf4af7c5993e696a96c6d
8551126ea44532fa1b8d34b1667053ad84a004c6
110516 F20101209_AAAXDV liu_j_Page_128.jp2
da7c34ce9c5176d3dcd43ed51eebb2a3
c50fe2f5f0f69f125bb36391551e879248cc9bf2
35006 F20101209_AAAVPC liu_j_Page_167.QC.jpg
9a2fece5a2418ff87330161ba9a6088e
d15225d9e4ae33439435d2bc30f3b7e9e84ad78b
2766 F20101209_AAAWZG liu_j_Page_200.txt
f300553720566a19803aa76e163371b8
d7a02decbcfb828aeaed3ec52fd3b2aa464d91cf
109398 F20101209_AAAXDW liu_j_Page_131.jp2
cf1ef7982dde78f30086099f4b512e8f
0dfdbaa08fbc51958076ba83939265f041e4fd16
116501 F20101209_AAAVPD liu_j_Page_194.jpg
08271b9e681e0debcc9a53d765011325
d43584a3b36a0aaf0ab40428649105e6aa3e875f
107877 F20101209_AAAWZH liu_j_Page_102.jpg
c5e719a59a50e0d140a7e9bacc699bee
1f507f4353251ed87423a67164968ba8c8a6026c
108298 F20101209_AAAXDX liu_j_Page_133.jp2
350c99e53583d1ce1205c02ce8de05e0
df266077d40a0991a8b2bf76e2f4c2633776b584
103931 F20101209_AAAVPE liu_j_Page_130.jpg
3d87451bf4c87fc210c3593bc9f39d96
f06198d1d94cd8e271b931d9d5971012ea161633
139791 F20101209_AAAWZI liu_j_Page_193.jp2
fdf6b9a5eefa74aeed012eb53079ab7d
b3551b228bacc95d506d374815de9ce1773ffda7
113475 F20101209_AAAXDY liu_j_Page_135.jp2
4e3efc79ca757f7074d30478278a147d
9fe941d5738a3263f66cff9a0466a427f3803f6c
F20101209_AAAVPF liu_j_Page_207.tif
742188e20bdd267ab6539e3eb1f0df5a
d0c23b7bf548449a2980f4b571f721e3a5085aee
63055 F20101209_AAAWZJ liu_j_Page_197.pro
e98741be9648e1efe26447a8d5629e0b
28d819d8e0f71c82f09871a5966156cd17efa7a4
115201 F20101209_AAAXDZ liu_j_Page_137.jp2
920bfb8cd20fcdb25827863e887109c0
930cdc7307927e19e1d15b251783149000d19bac
8202 F20101209_AAAVPG liu_j_Page_109thm.jpg
fce278c0b722871c16a4ee88755afaba
9534e39ea455d7ed3af6af12caed6442920556b1
27376 F20101209_AAAWZK liu_j_Page_012.pro
37038d62d7376062585ba9a860c5ae1b
6ff56820241f9d70542b69e232bae479a23abdf5
F20101209_AAAVPH liu_j_Page_199.tif
190366e153be5da8df7ae2382f644ccf
ec762ee86ca283bee585eecce1b6a70303a24eb5
1955 F20101209_AAAWMA liu_j_Page_077.txt
502d2026f906308df58a4d080d5a7563
1110ee84b631626809c5e4dc24965f08693dddcc
8497 F20101209_AAAWZL liu_j_Page_054thm.jpg
563b6535bc9a244a268ec34275c13f47
deb38b3a7739c03aeb216f52267cc4460299d30e
1406 F20101209_AAAWMB liu_j_Page_083.txt
444f5455d1c94e298794c36ced449750
3d15d9ef7a7a9e3d7c9223751086f189376bbddf
F20101209_AAAWZM liu_j_Page_074.tif
42d22e22ae6bfb73f346e40ac466e02c
4013fb13d7a90b789be043f5566401f3c6646e77
106024 F20101209_AAAVPI liu_j_Page_028.jpg
8841c17ab9e5c0bf84b81f674e58a77d
9d31025d17dc65f5bdd56586f369c899ac08713e
1996 F20101209_AAAWMC liu_j_Page_106.txt
82b0d6c44133f7178ca3fa5f53f0fec8
f5d66a4002439d3bf7656250f614d65aaf5926ed
104975 F20101209_AAAWZN liu_j_Page_042.jp2
893aeeb6397d548f4853e74ff4e1607f
784be8421c260372ceedfba8e2457ea8a2d027dd
51308 F20101209_AAAVPJ liu_j_Page_136.pro
0608005b839cda425c05d31e033ab799
19e6006b16930b85d5d485d28968a262218913af
105592 F20101209_AAAWMD liu_j_Page_037.jp2
9c8d24a42e0f2a2f3563f0c6c6fa3107
1eeef527e111d76c5e26da0739dbb4ee9ab0ed87
114092 F20101209_AAAWZO liu_j_Page_097.jpg
4b49a3b97acbc74142e1084f8629f3e6
1be0a0c81216d99c055645becbe37410e413ba19
104 F20101209_AAAVPK liu_j_Page_161.txt
2b75e5b033a6ac64637560bbd76815a3
accb698f6d937928b28203d4b2bea549c039c95e
22286 F20101209_AAAWZP liu_j_Page_159.pro
9782931de07de6d51ef57531366b7856
64e777a8f9bceda8f939d7a1998715e0113f720c
101299 F20101209_AAAVPL liu_j_Page_054.jpg
f884dad3e2f3aa1a461c8801e992bdde
494c1c50414e63bd2cffc0198af94ac2f663e9e4
24864 F20101209_AAAWME liu_j_Page_187.jpg
569b560a2efa911228d9a7ce17574411
854b1b07712b5b6f2e78cba83e435f2b51203842
760197 F20101209_AAAWZQ liu_j_Page_158.jp2
778bbc833d936c8bd8d1a842e5c59e71
07e56b0f2fe13dfd96db0a6e50194fe39eeb58d5
51284 F20101209_AAAVPM liu_j_Page_086.jpg
2598b6e3033653905543b1a706c9b221
c2055abd72bedd5bf3f7acd05b3856c1523a7415
1979 F20101209_AAAWMF liu_j_Page_134.txt
4742543fe775dcd89110920d7ad36671
3d71272046dfd2ca47ef1d776ea12e09bf473834
8558 F20101209_AAAVPN liu_j_Page_168thm.jpg
8b03479f5486d9a5215543c56707bbd0
9fd82bd67e0e77ac87b60cb4776c68384ae84d90
97171 F20101209_AAAWMG liu_j_Page_101.jpg
3fd5917c6216aa3d4e8dcbdc8dd5a002
0630eb697fe1dd06715a7882f020658705aff6b6
255999 F20101209_AAAWZR UFE0017527_00001.mets FULL
6180c023508860e6fd6b5ab3f35fe0da
52d754765560b0dbd7087cb3b8ce90c4391113aa
F20101209_AAAVPO liu_j_Page_045.tif
ce532523d83a51e0b6caee814f054b21
ca61074505ca34fb54d4bdfbe78e11156fd7be5c
8791 F20101209_AAAWMH liu_j_Page_190thm.jpg
552148ebfa49c6ee9bf969cee1dd9134
e70805a738a37474fba0677a3610e1c0d626700c
53337 F20101209_AAAXJA liu_j_Page_102.pro
81ee30302d6492f952e8a9b4fcb39b02
8be5d7fb6048f8efcdd204586bffa50269c5e73b
29627 F20101209_AAAVPP liu_j_Page_013.QC.jpg
7e032b9d7a8671bd91c2d5434b2d32d4
ef38e86d8febee47f0cfc22dc39b93b34c1ee3f7
F20101209_AAAWMI liu_j_Page_178.tif
a21aa4eb47544b7654373d8cb60d4b26
857b7b24887435797ea3a4d19790c7ac2b775bfc
47459 F20101209_AAAXJB liu_j_Page_103.pro
e4d9eb5c0960ee6a046811d1d700df64
e407d6ff0eff62016846df2b7d31fb0cf2530167
2693 F20101209_AAAVPQ liu_j_Page_198.txt
42960c0672aff372795a45dd8c1aa4fb
587c4a93720bb8080cb97bc0c516ab7dccbd21c5
16818 F20101209_AAAWMJ liu_j_Page_064.QC.jpg
b9007b0839b16025c9cc48b5187f739b
fc6923217b43dea498c9bdb5521e18a418285aec
6009 F20101209_AAAXJC liu_j_Page_119.pro
6b67d6598f87ec9b7d8d347455989fb2
b478d713b972667f9140fbd091ecaf7b6a6a54f7
26509 F20101209_AAAWZU liu_j_Page_001.jpg
fc34310248da5144b1e9de80d77c872a
95e9c57d3ba202be8989ffa0fc4d07effbd5f519
8740 F20101209_AAAVPR liu_j_Page_106thm.jpg
7bfce1d2636c35fb3580be432b2ffcc7
b7f283254154239e7de72ce78b214450cd355ee6
16481 F20101209_AAAWMK liu_j_Page_062.pro
2465ce5897c1a407fb990a94c4b5bab8
dbf821cc8865e94e0acb0a4a2dc7dbcdbcf52f02
32705 F20101209_AAAXJD liu_j_Page_121.pro
eb2c6bf4d605254d78596e9c13133375
17d4c50349b313c739d18b7796d12faca3797c82
3913 F20101209_AAAWZV liu_j_Page_002.jpg
bc6e227add1eb6bf1ddcefe9e3a6bd0a
99bdf51ce4a433189c22f56d467c59cb1cf00fa7
27483 F20101209_AAAVPS liu_j_Page_123.QC.jpg
aa1cfe2e1ef5c2305c851346ec49b825
0b8eb110a978334d5bd5c41b22a616d754549177
51590 F20101209_AAAWML liu_j_Page_107.pro
65cd13ea8f22470346fe6bf03238504f
680691fa1ac56baba0c73f4c42602a5c51db77bf
24896 F20101209_AAAXJE liu_j_Page_122.pro
248c98afc84b0e22b1fa76120c8a2c3e
cf7a1429936c2fa5de0ef6f780709e9d12c83c28
27945 F20101209_AAAWZW liu_j_Page_003.jpg
124f50d95bced97854ea863348f16edf
496c6c6173914ad89b74d87c8f695b94019da77b
7662 F20101209_AAAVPT liu_j_Page_166thm.jpg
353a6857eea882868548bf09e8e8d25a
b396a964b5a0dbc1d7eea6459e206bc422652bc3
F20101209_AAAWMM liu_j_Page_029.tif
bda07f2725ca4915edd8f219333c0cf1
940dbd4b669c2e553bbccc7ede39556b75c4d8ad
51785 F20101209_AAAXJF liu_j_Page_124.pro
8d95e793fdcc3d5dc7262a958d15675d
f1deec7fb227172c3a9a356a9ffafc9cbe50a30e
88921 F20101209_AAAWZX liu_j_Page_004.jpg
d6df4bf31e63c7aa08b55bb0f982d514
cc59bd8a2d5f72200802a261ee327e1e2488615a
68448 F20101209_AAAVPU liu_j_Page_195.pro
c60cb921d20f7fffd4604537c8d8d683
4c8f406f138ae3e2d29d8fb490d938d8840fe1dd
2013 F20101209_AAAWMN liu_j_Page_035.txt
145927c5c2625a18b346add60bb9af8b
1cfa91d63ef406488f20608586b0b314f59ff95f
50504 F20101209_AAAXJG liu_j_Page_129.pro
c36f00b2054a71d4bc25d8e2a9bd5cfb
ce75572c9650bece51e6465c513818952ffe79ef
40894 F20101209_AAAWZY liu_j_Page_006.jpg
0c08c1a646b5cd9beea625f63a9192e0
1d8ff5eedc0439ec93b7d45c48ca7a78fa8a5fc8
69239 F20101209_AAAVPV liu_j_Page_221.pro
231c76ec0005413f19feeee56ac61a92
a668e88455608333ec27a721d9cf1f25a30889c9
F20101209_AAAWMO liu_j_Page_176.tif
062a2056ddd45defe5bf2e93f2cc048d
9ab02a808199cf16e01b3667555b9f2da6f9cdd6
47376 F20101209_AAAXJH liu_j_Page_133.pro
9aff63eab2671fe4ca783681b0be189d
9ee72ac4cc16157ff5fedaf46a49762c86829975
152097 F20101209_AAAWZZ liu_j_Page_008.jpg
d18b0367d84ec64bd7b947cdeb79f751
d275222b2753a4f7274342c393965a76b2f6a1f9
2001 F20101209_AAAVPW liu_j_Page_053.txt
7048c6e5eec310e861b96c3722eff09c
7ce97bbc081e77d9cfdd1332bbd74176a795f77c
230692 F20101209_AAAWMP liu_j_Page_011.jp2
e244111dcd8a9a36e80129a82ddfd00a
296cbf78f146c3dcb375bc518c037b68c4487904
50099 F20101209_AAAXJI liu_j_Page_134.pro
287b298e5a4f445b3723a6ba5b1eacd7
0252375f8d0611145773b6617f74e2e7ec44fe8c
7408 F20101209_AAAVPX liu_j_Page_048thm.jpg
6b408ac36a735ffda7ed22bcb56999e7
f63b25e7289aacfcd1aeb60cf09bab405ea6ee8d
8941 F20101209_AAAWMQ liu_j_Page_192thm.jpg
f3159b3f8b6d86c2d29a808cc39cfc46
67ff58aff57faac08dde2d59cdce05e7c3fbf1bb
51999 F20101209_AAAXJJ liu_j_Page_148.pro
dc4f03c04929876697138f772fa30a58
6b468acae198ef2d9d6ab6315be8d00d294849c7
F20101209_AAAVPY liu_j_Page_127.tif
da348ccd4ada4e6b70cc60f4065ace2e
d15275dc99686edd4551a1e7e7565112e5c26ae6
31431 F20101209_AAAWMR liu_j_Page_003.jp2
7e738791d2c790b0837c6f0cab8c1d34
00454f403a816037a6fc1421c3e9aa392cc2e475
52664 F20101209_AAAXJK liu_j_Page_149.pro
a07222bc4ae1dfc8b730dab72325d3ac
1b27239653ef6763841594d7526576e24909355b
66259 F20101209_AAAVPZ liu_j_Page_198.pro
fa665196b2d410a56509df3cdbbc8e94
cda2f5013e9cebde31fbaaaba8853d25b7010abf
1882 F20101209_AAAWMS liu_j_Page_172.txt
27c26a4d11c538045c4d970bfbe13441
0b3ce45688154f6fa5958c104957f52717388f66
51856 F20101209_AAAXJL liu_j_Page_150.pro
1894e5300c2a2f3559106f2d6061c4e0
d1025c8afb863532ed784b19863e26d7f2be7333
107415 F20101209_AAAWMT liu_j_Page_110.jpg
717b1049d0b1096a4680cdc54c468dc4
43efe8fd0874caa608b175245bbff34c92f069ce
15385 F20101209_AAAXJM liu_j_Page_155.pro
4263b63555dc4b46bdb370351709c035
eff1106f19641bc4bc852a6faf5b2f6c7b65be61
2772 F20101209_AAAWMU liu_j_Page_084thm.jpg
229ed0c1b447ebfb537f274e655b66fb
a536c60e5a3d88977f50293835b8b5ab5707c052
5313 F20101209_AAAXJN liu_j_Page_156.pro
dc111429fc037727d9cb64102e7574f3
cd63312e32c825abb4ffca5684eb04d857edc26b
31907 F20101209_AAAWMV liu_j_Page_112.QC.jpg
7b103ee616b802bc0946c88dd11ba07a
48f794b65ab5dc3cb031b92ba80a68bd2f34aa1b
14289 F20101209_AAAXJO liu_j_Page_157.pro
c221427cd16e754d850a05ffe4c4a1e8
c3e3d9a6f06aebc75022ccb6687e5976a3d326e0
135449 F20101209_AAAWMW liu_j_Page_213.jpg
7116ea5668bcf94bfd252ba483835396
d975f5c221469b441406e74abb8b4c9d2b64e2e3
16296 F20101209_AAAXJP liu_j_Page_158.pro
e7981bb95c40dd98f142f768b4f3e376
202ab9721d7ea82c10be3e8f175ad93f1b22899f
F20101209_AAAWMX liu_j_Page_123.tif
037f18a66934869b0ccc421139cd9ce1
7fd97a483482c84db41bb8e377686a340035b89e
4209 F20101209_AAAXJQ liu_j_Page_164.pro
831938a3dbda96ef8ddb2f2a11178426
27e7cc66c5a06af2a4252848440958deb47e130c
6538 F20101209_AAAWMY liu_j_Page_011.pro
045a8b1052b27304232abf50c83bab8b
2f6bfce7dc8ae3abb5e0954a32062cb70e2ac873
43278 F20101209_AAAXJR liu_j_Page_166.pro
6be5e114acb1aaf2a490f4b66eec3b04
f69be335ccdd038481d35e2ac2d7cdcf5957d993
2070 F20101209_AAAWMZ liu_j_Page_151.txt
d2c289aa0ea2969a7625bd7a01a2513d
262f3a71858d7d27d8e97cab2ce4c2da3b3cfe2e
49971 F20101209_AAAXJS liu_j_Page_169.pro
42f8793b1cb283dd08afbfae1810ac08
47cb331b42c2c37219e3a048f86096c0dda193a6
52111 F20101209_AAAXJT liu_j_Page_170.pro
812e520ff6f73510f079654d9ed6d545
50af2bd02db7d953710f2df5fa1be39d6b6f2635
50483 F20101209_AAAXJU liu_j_Page_171.pro
79c85af356d4cf67300f7e0ae2896b5b
412d9416f6772b8970e2f28aeb84055d6553388a
2416 F20101209_AAAVVA liu_j_Page_199.txt
a1bba6729b4e4253455f51f5ba0e418e
62784162d4f2e210e7839955129135fa4c02f8c9
51038 F20101209_AAAXJV liu_j_Page_176.pro
be6f46d0d83031776e77aa68067d7a30
32860ad66398f9a0407f8a36946582c2941c66c6
108515 F20101209_AAAVVB liu_j_Page_055.jp2
4e3eccba32b581a3a9353b0e984f1b97
91bf82698330e31e65f47edd5143cd070734d282
17118 F20101209_AAAXJW liu_j_Page_180.pro
1161d89e38fddd1a5236448bd251e370
7b879d855a874c03a2c2919be75d0730dfc5d81b
50993 F20101209_AAAVVC liu_j_Page_146.pro
9f049c6e911b7e8a3ed793623faa1514
8a54c8137607b56269e3eee2eb7972e8970ed24d
24532 F20101209_AAAXJX liu_j_Page_185.pro
5b8946fb7fe1a62627192d15dd568112
cfbcc938981273f3dc9a41641cd25c5d31cef3df
20023 F20101209_AAAVVD liu_j_Page_122.QC.jpg
096760e0083bfa3079f7cbf8cf806dc0
81f93e700433d11310f52b34103902674bb2f840
10161 F20101209_AAAXJY liu_j_Page_187.pro
b2a04d43aed4c9fe25577f87f1acd14d
a133e941b2d96535db8de291703d1bf993a10232
940 F20101209_AAAVVE liu_j_Page_161.pro
2e8dfaca2a3b45dfb8abdc70dc0b9229
82e804e0eb40ec4f818ad3e5e1e1446e70df8eab
67223 F20101209_AAAXJZ liu_j_Page_189.pro
952efe4b598db68141939e97ef3ff775
d9a3b6de594fa8435462170e9a01d10c49d43c49
105082 F20101209_AAAVVF liu_j_Page_078.jp2
83fa54569e1a35b11da3578d471b2e10
4d96513094fdc9e8f40c5f09ff5cc59361e196ae
60849 F20101209_AAAVVG liu_j_Page_203.pro
b558126964080599fc15201a51bad5e8
c8f059aa4858dabbd8ccc7e8a886c50e95cdaa4c
34990 F20101209_AAAWSA liu_j_Page_151.QC.jpg
c96fdbbe60042a6a58298701bc335ef3
7f8830f2ae2cd0774f589dfc8820045949252582
2072 F20101209_AAAVVH liu_j_Page_028.txt
b57bf015b0e09cc09c9a5594958a1a0b
ee82e091ab8af5bc8b20bcc6fdd6340249c1a84c
106577 F20101209_AAAWSB liu_j_Page_105.jpg
b9c39d98a06a651c7d0ba196d0509175
754187318b396ba6b821f42bc9698722491eedaa
F20101209_AAAVVI liu_j_Page_201.tif
98ad69cf0fb818e065d946aa2d423eaf
947d84425658727bcafaa7c595680d32e0970afa
1051978 F20101209_AAAWSC liu_j_Page_010.jp2
e53b0ecba7d1e2c4497186c504b52daf
695147a9221db4d1ff924cb833a38324de4b2d8f
F20101209_AAAVVJ liu_j_Page_047.tif
ab1d2747003410a99dfa5e236c60aa01
b29058850dd16ed593acaf49fca67311e305c829
F20101209_AAAWSD liu_j_Page_203.tif
b4d2169728a55d735ab42ad40bd06754
1b8852896d32ce7b594b06264f57dd6c620ba75b
7513 F20101209_AAAVVK liu_j_Page_068thm.jpg
a2f6f20af1896107f6b57f6d815ef139
b85a8c73e64f8246e1e2bb502a4c6e28df6cf7d2
24287 F20101209_AAAWSE liu_j_Page_007.QC.jpg
1a9614fee8ccec0b5870ca29941766c5
5c98d054c5d0f067abc87abd95b6f65aa05bc28b
35217 F20101209_AAAVVL liu_j_Page_019.QC.jpg
2aaee29b3471bf306fb7d98ca90bf78e
73cb504d487ef15cfe56ab05680fc9a7e0bbab75
8394 F20101209_AAAWSF liu_j_Page_057thm.jpg
470cd5ad5cc5ccb0a18d2013b6bf80a4
277f628d60a0ba618510b5051867314e1d32327a
8138 F20101209_AAAVVM liu_j_Page_055thm.jpg
b4f3aaae2420a82f4b09e03511820672
10afcf659ea0c0ecdcbcd576913ef4e50d6b2898
1921 F20101209_AAAWSG liu_j_Page_098.txt
809a45b81acd479509ad9398ab7eb325
60c9c4f3636700c0e3b98577a6a9417c9c125f72
83536 F20101209_AAAVVN liu_j_Page_154.jpg
febba9fb8126a95d7d6e4a1929989d9d
cbf35dc599c792e2bcab57f45c16ca7d9e748ab7
1050 F20101209_AAAWSH liu_j_Page_088.txt
3d9829b91042a2b028322868d7a9122e
408d95d99e2d4f448aa89e2dc4f86c4143c77211
31449 F20101209_AAAXPA liu_j_Page_020.QC.jpg
0faf66f140970d5c8c68e4793db4d21d
363fbc00c2a725a4db11209d4df3de0adcb654b3
52929 F20101209_AAAWSI liu_j_Page_175.pro
71640700c4f6dc177d72b0a14711dd9b
0bded393c99e1a8df85604d78c9e0197cd145e1d
29050 F20101209_AAAXPB liu_j_Page_021.QC.jpg
92f75c97e93e6ab2e325ff11f14414b5
e70fda5723ae499d2c13de758f22d785b43c5c0e
F20101209_AAAVVO liu_j_Page_055.tif
5ba62655864020ab44f6308ec811119e
f08fba084a4c85157d9e7804a84ffec0c44ce253
9515 F20101209_AAAWSJ liu_j_Page_193thm.jpg
7244cfae19cb2616527d1feb458dd71e
202686060755274d9e9e2d8022b096c55d52a75c
8550 F20101209_AAAXPC liu_j_Page_022thm.jpg
57d6030cf2b7e301f4a57ca9c183e280
6294ab51c328ed95c641673e9e4e2491bc7e3f91
8567 F20101209_AAAVVP liu_j_Page_171thm.jpg
d8d9ee0e75e7e9343832fa9f97fcab7f
1cab1c5c653e525539e34e06eb44004b9ab5a4a7
34297 F20101209_AAAXPD liu_j_Page_024.QC.jpg
21837dcd0229c13f46a7678d24150c06
14c2ac2f3e505796ca3ef5f90c23064ab566ad84
37070 F20101209_AAAVVQ liu_j_Page_154.pro
073264c1e65bde74a10d97b40a2d3e9b
83a1b4d5ba687921e28a2a248eaaace349e3f854
64848 F20101209_AAAWSK liu_j_Page_158.jpg
218e41183b632f273b70d25c10ec5421
e219466a2ac5b60b656e425926e4df44f53fe8f2
35124 F20101209_AAAXPE liu_j_Page_025.QC.jpg
306fc8482cad89adfe2d1b5b37ba2bf6
fd3d37b3aedac03717767cf64591b5ee7da63494
21933 F20101209_AAAVVR liu_j_Page_066.pro
c669bbdc3ddeeffe6c4a41908f468ecb
5829cc4ef4e86efb14e79feb8f82fffbadc4561f
32335 F20101209_AAAWSL liu_j_Page_144.QC.jpg
8b7b2f49d89b9e9b999560a216f142d4
84fc0260b0b5d5a0d04b41a03f051758449f10a4
8631 F20101209_AAAXPF liu_j_Page_031thm.jpg
6268075f27550e4e45d4dc57cfa9db4b
9418600a2fcda4bbcae270cbb6c386b9ac3187a6
2112 F20101209_AAAWFA liu_j_Page_126.txt
440766fa94e6dd2b534f3617a2bdcc1f
c7b272eb2ac159bb4dbbb7d647ac69f6fde52c8b
9410 F20101209_AAAVVS liu_j_Page_210thm.jpg
b3715b6af9a1743360b9b1f41b827583
d49b6e763273b539cbc3abcc279ce5c4b575b2c0
34840 F20101209_AAAWSM liu_j_Page_105.QC.jpg
9ed4eb841ba7cc07fd6bba3ca1f2ffd6
c346d2f232ed1adade0fc7c9bb525da7c05b7e9e
F20101209_AAAWFB liu_j_Page_120.tif
cf9663407d0e4021b5480e40a1e54cfd
511fe41edbc4f8193cb65d9eed8099f726857162
7874 F20101209_AAAVVT liu_j_Page_052thm.jpg
2fc5dcce70f1baaa4ea93bdfacae205c
3563b5a12a66fe87ffd94bc9e19ac46b0dd18977
47214 F20101209_AAAWSN liu_j_Page_144.pro
2e338026db354c78c4b4032ff149c7d5
c346eb1e1908148d2c46bf49ba9458ab8a06b6be
7811 F20101209_AAAXPG liu_j_Page_033thm.jpg
5df2fe8d45865583a27e5bc3e38c163b
6ea0c84e07cf485e2a7d4fee9bfce8dadef95bdf
66210 F20101209_AAAWFC liu_j_Page_223.pro
29558a204940aec42a063d884d5977f4
c466eb967b07c12b3a6f3b5278603f1ad128919f
106452 F20101209_AAAVVU liu_j_Page_175.jpg
1e2cd9073f58d33f7abeef7f17639140
89a5868fd1722a137316434fb99f4c90d8d32a89
132853 F20101209_AAAWSO liu_j_Page_208.jp2
ef1f1e9a93cdeb1ba0479188cb9f9fd7
6ea7d53c41026a050db683472554b737186befcb
34383 F20101209_AAAXPH liu_j_Page_036.QC.jpg
5333b53c4b8ca143daf253fe52974b74
db9f42f87bfdcf3583e10b6827ad2705c6f3570c
50516 F20101209_AAAWFD liu_j_Page_100.pro
41d07d292f2cccfa1572b07be034fbb9
d4f5b628b23b1a1dc4e0dcc1c796a64f8932bd79
33534 F20101209_AAAVVV liu_j_Page_093.QC.jpg
d20d8f992351597c4121d21d065a7316
9321389bdd598cfaf42912088d25ed66cd731651
1995 F20101209_AAAWSP liu_j_Page_040.txt
99e5611183dd242cd12187ac8703ed7e
12fc12aa38ded8af329083a3f9c239f6177fe7e2
31828 F20101209_AAAXPI liu_j_Page_038.QC.jpg
2273ec609645b6fe48087b2e25c6cd1f
f527820e97f4cc4653e32334bde1cddf3db0662d
879 F20101209_AAAWFE liu_j_Page_160.pro
bef52827190f31363a856005b17c806b
3830cac049cce118f684ea163d2b07280bc09256
F20101209_AAAVVW liu_j_Page_077.tif
0ab09dfe002ead90f185138896d53fcd
a829addd143ebaac0ea9ab19787a45605f825bfe
1051984 F20101209_AAAWSQ liu_j_Page_014.jp2
f3c7f5b5eb734da546a72a1e33a0d6a9
a84f48601154e640fee9c00f0290ca60f43fd7d0
7965 F20101209_AAAXPJ liu_j_Page_041thm.jpg
05a703c2720bd39548b938aeec9d01bf
1d3553245a5eed65ec17ee16d83faaeb479ce314
33837 F20101209_AAAWFF liu_j_Page_099.QC.jpg
108e690008c61294a8923cd363438da5
56152b2e2be69f3c6b8a83836a0c013b383c3918
35588 F20101209_AAAVVX liu_j_Page_165.pro
0e48c71022d2789061da5292ffc38bea
e042a326e327033f70bcad140318bd551592c351
F20101209_AAAWSR liu_j_Page_152.tif
357c309e866ec46df2cab89d252c0b91
045d6d404937ecf26f68ce56edd35464bf890085
9085 F20101209_AAAXPK liu_j_Page_045thm.jpg
f66eee06c765dfb0a22f01e42c5b6cf1
fb2b066ff8074502858f34473fb64e089af89ed0
108683 F20101209_AAAWFG liu_j_Page_049.jp2
4f3ae135a06e15f44156c9bbc1945af2
5ad3beb0701757e81623e5a3f5e3361fa271091c
685 F20101209_AAAVVY liu_j_Page_157.txt
d0c29ea533234550ad57f9e83c67d89d
744b46b70e5f2c39757fc88db4adac95e0f27de3
125252 F20101209_AAAXCA liu_j_Page_203.jpg
592387851bc42b19ec7e67f314d92d03
e0ee7ca7070cfd2532e8693d536730de6078c448
F20101209_AAAWSS liu_j_Page_008.tif
ecf60a8dd492c0dece6bd1adec58a822
0b8a16c0a5af8dca72f6f976543b461bce84719a
8959 F20101209_AAAXPL liu_j_Page_047.QC.jpg
bd39a09d82f6b673b6fc3703eabf9b6b
69ab0e4b7c277ba352c3f3b9b7ef078500963e4d
8354 F20101209_AAAWFH liu_j_Page_093thm.jpg
4ef490a4c33739ccb653fb45b652e504
8059cb107bc73bf3ece4cbc60b76cb2c89ad3430
F20101209_AAAVVZ liu_j_Page_182.tif
193a7ede899eb9230e5bd98f41d287a0
8546265f0c7cb66b2f0119265037fe913ed9f006
137974 F20101209_AAAXCB liu_j_Page_205.jpg
4814e863953374cdd0e476558eff6385
17e0609848afdea267dc70ade7949779cbb502f2
66379 F20101209_AAAWST liu_j_Page_155.jpg
b7192d58e5783c3f4311c66368030297
0e4dcc97e70cd2d94b44e2aec7d05c2e636de05e
33574 F20101209_AAAXPM liu_j_Page_049.QC.jpg
7eb7282735a79bc5ddc16a6a87ab0784
8500cc6df6ad050b1d8babd87849ce27b7a291d9
3529446 F20101209_AAAWFI liu_j.pdf
93b2295c967512b9b78dfaa9bd3ca7c3
8d991dcab5b6d845c034c6e1b8795a9fa3d3500f
123365 F20101209_AAAXCC liu_j_Page_206.jpg
30cfda7d35e0e5f6e3a12b362582065f
8bff350250fc44d8338b42ed0c1aa4486bfa6610
711 F20101209_AAAWSU liu_j_Page_158.txt
fbceaf0722cdd8b14d4ea1417d1d219e
af6f981eed5a692a1f4b6a31ba12d5113b15ed4f
30639 F20101209_AAAXPN liu_j_Page_050.QC.jpg
86bc559252fa15411cca2505bafb8d48
cc0cf0e035a067ee90d141a8e571818bbe74bf67
776965 F20101209_AAAWFJ liu_j_Page_122.jp2
44be024bdd8bed65bfd644c020fd3788
460aed619f4ff33bc2b32081ed4083bec5516019
125344 F20101209_AAAXCD liu_j_Page_207.jpg
5080b4cb23a985d0b53c064adb374eba
e5fdfb63222fb14839531ff3db9bfee9d6c8015f
835520 F20101209_AAAWSV liu_j_Page_066.jp2
c9436c854571cb0d1f049fe045b6faf8
144a31ba8573fc1f8625d4e6082480e7c1ca9ed2
34534 F20101209_AAAXPO liu_j_Page_051.QC.jpg
3f50bc5d2c5c38fa61b92aeac2eeb97d
4c1047732732eafef558cd42b190e6ccf9792932
49440 F20101209_AAAWFK liu_j_Page_177.pro
13d6738758eb6dea3585bd02dbf064c4
dcc1c103731dc507e79cd1fca7cf4a74f6139f95
129264 F20101209_AAAXCE liu_j_Page_209.jpg
77d0fa7297ed20f7eb903bd2ee9ff469
4b080010e40354132a8b5e73d13fc35d4ac60f32
F20101209_AAAWSW liu_j_Page_042.tif
bf249148fcd91041e44d8325b195602a
b9509236da205d0adc0f475add63a718bcc4f38c
29967 F20101209_AAAXPP liu_j_Page_052.QC.jpg
2a45994329e96bc5ffdc49a6c12a066c
409aab58e10de954bd80c1c4b6471dd232c20acb
7465 F20101209_AAAWFL liu_j_Page_092thm.jpg
192b3f5726870a0e8b7eba6968a1974a
c3e0f482af517d7fd8ff8337f0b41408cd8cb8e3
133666 F20101209_AAAXCF liu_j_Page_216.jpg
0a7b710fc5c7a6ed55429ffce9a7ab18
8f9088123d0db4273625f2675e1800c6e48bb75a
88 F20101209_AAAWSX liu_j_Page_002.txt
c6cfca631bb22448943300ee3af756de
448e45c11877a261ca35239593e1aa1f70496026
8074 F20101209_AAAXPQ liu_j_Page_058thm.jpg
ba6715b16bfa5031a4331071e9690e83
d28c27136301a0abd4c15a5fb946b9e7e68af737
880535 F20101209_AAAWFM liu_j_Page_114.jp2
57b6033d9999f687a05f499bdf61b371
99361d3fbcfe7ed8930f21654482b1997e301277
129219 F20101209_AAAXCG liu_j_Page_217.jpg
f2488ab8ca1d5acf73be6cf5b8e8d4aa
1bd1c5ec895e0adfa5617097efa5a9b74f9383be
48522 F20101209_AAAWSY liu_j_Page_104.pro
e7d34d27d23f19af0384c2aa407ace18
db530761dd2b6799fa0c2c49ae26d107a271ffca
32757 F20101209_AAAXPR liu_j_Page_058.QC.jpg
be441d96c1e9f732e429825199bc719a
f478c899ca1a668e8843a30f46f306aa4da879d0
53651 F20101209_AAAWFN liu_j_Page_019.pro
222051d563028816637615a1674e1a4a
849086c854c879283c839e7014c6c10e008e3816
136143 F20101209_AAAXCH liu_j_Page_221.jpg
14264468a369e9f18b8025e17a4d40b8
c227b8b5404e77bb468e9fd0abf756251248699c
5877 F20101209_AAAWSZ liu_j_Page_064.pro
5c11fa6fca2f476e8848c785d1aeb83d
43848c9bcdecfbbbc4b3fb53fff08a0e5678f0e7
939 F20101209_AAAXPS liu_j_Page_059thm.jpg
9fb147ed23761cef8722966ea4c2702f
80c6aa2b99745d6d4ddbd7c9c55c3ccd017fb1af
117465 F20101209_AAAWFO liu_j_Page_163.jpg
b15adcc946fb64b30fef443583c4d2e8
bd2a3913d693148f5e757b85584e374ee268e665
33953 F20101209_AAAXCI liu_j_Page_224.jpg
7dc5eea38f28d3d75d420dfad2a3a414
22e9706d926258c2fd169695dc6be8e377a68158
3080 F20101209_AAAXPT liu_j_Page_062thm.jpg
e0c16963b14f717022b1cbf56a4a0a35
38ff2582bf8e1db7f0079c996174f9c6f1afff24
38592 F20101209_AAAWFP liu_j_Page_210.QC.jpg
cc5b8fa393000eb8d77b390440009919
3f526146cb37ecf62dd75f628acffa05f729671b
39063 F20101209_AAAXCJ liu_j_Page_226.jpg
b64c19a4283b8efda3650984d8dfb331
7a90e6ec59f79acb0d739f32549221488c58e874
11052 F20101209_AAAXPU liu_j_Page_062.QC.jpg
5626b3aa370858ac3ba07fcc152e0787
a9c015c5feb07f5a743874aa0a269b92b2be2ddc
8765 F20101209_AAAWFQ liu_j_Page_126thm.jpg
d4c4c9b349a601c5d8abee60e2f72808
8866042d3e3ededef62b164979586feab2b1743a
4963 F20101209_AAAXCK liu_j_Page_002.jp2
759e9c1e33628c48f498a7050cf84278
92771c5c6c39196d0858e03c19f06c4e851bac60
5849 F20101209_AAAXPV liu_j_Page_064thm.jpg
5f85243a89fd1c5b028dfabd01057a10
f6fd6bee4c5e40afd8203292cd627c7e1ea4dbf1
109606 F20101209_AAAWFR liu_j_Page_074.jpg
9ba239c568c589f825ec9507028b5f4a
e1d8c34941df9dbf51e5eb9bae1b329794cd99da
1049514 F20101209_AAAXCL liu_j_Page_012.jp2
05519880eb67b7a760220b1e85ff4a3a
dd776234cfb4a4f447cf922f3f7f0237464dfcc2
4856 F20101209_AAAXPW liu_j_Page_066thm.jpg
eaf900af73736d7fb1d0ac24a4537a90
758006f8689c30e432848edaa1ad1614e83c16b1
51027 F20101209_AAAWFS liu_j_Page_053.pro
7e6fde80f82807df9e5e04c1f45c8b32
b0139751b6f1c5a477a444754d3a33d93ca31fda
1051986 F20101209_AAAXCM liu_j_Page_013.jp2
ecb13ff54b01e11994f28dc9d16c9676
f654249a4b1863565a6878df8e46386d67775db7
32323 F20101209_AAAXPX liu_j_Page_070.QC.jpg
0090e1ce94800bd2ae6a6a5d09b4e307
3de1a5bb3b6f686bd97dabc2e55f9c85fad137a9
1780 F20101209_AAAWFT liu_j_Page_017.txt
4b512eed1a116be58ae3b55d5d67414f
a40aa56f8685b4f09e06786414e45088479ddac6
93210 F20101209_AAAXCN liu_j_Page_017.jp2
0f8f51e289998db993ba90da0e594cdd
8f96593f20cff1f2db97b23dd90e80ec79a63a70
8573 F20101209_AAAXPY liu_j_Page_077thm.jpg
29bde416539a6f6a958fec762d764c68
28a274c7e994415dfb2bdcd7ac32842f324c5ac9
2032 F20101209_AAAWFU liu_j_Page_128.txt
16842cd0a075ced134c9a278b6e7864d
836ffe121ac12465658b26ed32dda3b484bb9372
1051971 F20101209_AAAXCO liu_j_Page_022.jp2
490911a84410afedef948047517301b5
c4e536fc8f3da0435e60fce3e192b1683b772e49
34623 F20101209_AAAXPZ liu_j_Page_077.QC.jpg
2922d4af1a53ec5ea26b9525f16a9eb8
cef06ff8e7f4f9aa7fdea5b126d0d71f57b45573
265 F20101209_AAAWFV liu_j_Page_003.txt
8ea937392412f2ed9be7a33ceb4c789c
71a0c051046bcd294fba4e587dee9e70d5c63f21
109899 F20101209_AAAXCP liu_j_Page_024.jp2
6c19a3faf0de9dbd1f9b1fc6f804ebb7
626cfd9791bdc6a703d70e1bcac0bdeaa0557183
29345 F20101209_AAAWFW liu_j_Page_004.QC.jpg
0aad52f411993b860e7864b3e8272265
f2c7e2c6eecc5a9a94db5741a9fc3d96757f2bf0
112520 F20101209_AAAXCQ liu_j_Page_028.jp2
17f0ee8fe66bb570dffc4c353ba5a145
69dffd377bf1ca22cc345a7a71beb521f589155d
124963 F20101209_AAAWFX liu_j_Page_220.jpg
89f5f635ff1afdf85ed21efdd513fc5f
6a5210cd1b0429bfd472d5e8937cb55e505b560a
102266 F20101209_AAAWYA liu_j_Page_014.jpg
a28705c7076b6830cbdc60ce8d8e588c
db0d2a1ec3cd3ac7cb5a9c21d5352f9a47e12b45
112327 F20101209_AAAXCR liu_j_Page_031.jp2
38afc6b681070951a36d5b0ca16b304e
ae1a9f26d70b2adf67280824ec85940a86844a10
47734 F20101209_AAAWFY liu_j_Page_172.pro
dec146f61363aaebfb2dc152c38e49ea
125f9961aec7d6db58f56497324696a6649e5f99
1671 F20101209_AAAWYB liu_j_Page_003thm.jpg
8cf15b8e5f4e7555348a3abf237a8626
e6dff87071075fdf76a849f2a7df3172d002f64c
109672 F20101209_AAAWFZ liu_j_Page_168.jp2
318a0e512922b879a0e8489e9af1eb89
2ce323dd4d7511af31ce6cb20610c8fe1cb388a0
F20101209_AAAWYC liu_j_Page_205.tif
6a01010382266b8447cc7a5839099d50
cc57d822e5c3ee993d6042d3404fb93d3307c7d6
111281 F20101209_AAAXCS liu_j_Page_032.jp2
2591d860176c01d5909faf11203f2078
685ad80f9fd0e03867b33bf6ea02d120ad0b7b5b
1963 F20101209_AAAWYD liu_j_Page_070.txt
6845ccf36201e36139a4ed4952e8e470
f3f5e28916903b555d217b01b0158052091e636b
104040 F20101209_AAAXCT liu_j_Page_033.jp2
1bc33c6a2f8998a5a4132329cdebfd62
8507f8a86ce9ae350fc6126fd102703f7b8f4f0e
2260 F20101209_AAAVOA liu_j_Page_187thm.jpg
486e031ac204e4ccc7f7272552f9f2c3
623a4d9bbbcc23bd52fd140793888492f8402a81
1296 F20101209_AAAWYE liu_j_Page_162.txt
269f68995a8c3268a0bdc42b2a715e27
ccfdcec64a027c661777aa34d2ffd2628cba6a71
104479 F20101209_AAAXCU liu_j_Page_038.jp2
c6358e7531e2204f5bc36bc2276744c1
f9687d5760990b4dcc87e68ba84d5324e7e17864
1967 F20101209_AAAVOB liu_j_Page_147.txt
92f7c8b66f8d904464cce8525b2e3b64
ea009b72d980b599a2066ce87b1ae3b6e2feaef2
113195 F20101209_AAAWYF liu_j_Page_029.jp2
d282c9553ac118523c6a19dc31970f04
a61a77a2f8e1a9fb649ba560b4c00fc9dd7283bf
105349 F20101209_AAAXCV liu_j_Page_041.jp2
7de048858f3ad0bf7d8ac9123fadb605
8455ebcb788b2c8784f14fe6f3c7534b123ae348
2718 F20101209_AAAVOC liu_j_Page_210.txt
90eb37d787323dd71b4b5ee414de0039
60af32056a72f68d271a8cef56feb26ce02bc34f
111 F20101209_AAAWYG liu_j_Page_183.txt
cbca4910411e7143a442cf9c331d1e6f
35d8f89c138342db1c6a008601151c7b7eb4d940
1051980 F20101209_AAAXCW liu_j_Page_051.jp2
d0f5596f8e960ec077ecbc7736db3a46
96bcf42d6467285227938a1738ba6994dce3691d
32414 F20101209_AAAVOD liu_j_Page_078.QC.jpg
992e41988bc1d193d241ce6845603bc9
4ab0ea820be4f6251707ea397d38ed9876baf549
107237 F20101209_AAAWYH liu_j_Page_025.jpg
2ce5304607929b073e3e5f541e62ba9d
36c51c8fcc74aebffa701360e3f7158dea2964d6
101336 F20101209_AAAXCX liu_j_Page_052.jp2
e1c3a59d35b103550b43baee57fa144e
8024d2420a56c91e473b57c36ed32261e8024747
26981 F20101209_AAAVOE liu_j_Page_043.QC.jpg
5de8ac7e399396a5ccf591d87e3d7b8b
3ed9faff1f0ffe24e8f052c2c20f350f93806cbd
14571 F20101209_AAAWYI liu_j_Page_180.QC.jpg
fade0adcd83abc67b5ce752f0b237778
840554aaebc5701d7a41fad0c93de66548d20fa2
112011 F20101209_AAAXCY liu_j_Page_056.jp2
0e253c0250ae5b0ad8448f71a77f35c5
41b06430365e0ad5035bd2b1fffd230be09e674f
7766 F20101209_AAAVOF liu_j_Page_165thm.jpg
3941abbbd77871138d8df264fc67bd3b
89069368e0e10e5dc52afe0f8206b11913ba5ad0
101725 F20101209_AAAWYJ liu_j_Page_026.jpg
726a0f30b534834bb83127324800945b
df1049e861e76dcd010b8152f05fd05e741ea394
50930 F20101209_AAAVOG liu_j_Page_174.pro
d5d4f109abd835cac9913a76f07c6afd
10c8d4c33301635ae3211fd053598a7adbd7c816
7956 F20101209_AAAWYK liu_j_Page_172thm.jpg
10b33fa79e4fe30f164a4567fe45cfdc
21ce671cac8c6150476a28eda7b95a5f0404352e
113879 F20101209_AAAXCZ liu_j_Page_057.jp2
20d608b3e2b550ee3d15300f599bd7d3
9edc3df610a5c49daf01a06230f658285d4e8aa7
37629 F20101209_AAAWLA liu_j_Page_179.jpg
5d783db8fa385c12fd907deb0434742d
26fea20207a9c94788d584726e9bf4d182481d38
131928 F20101209_AAAWYL liu_j_Page_208.jpg
53cd0d73ede0ca992882134386e151d1
9ea0f1bd711d2720cfe6d2fd39af2beca2674a64
121917 F20101209_AAAVOH liu_j_Page_203.jp2
6f38e02f11346d1d867d9be23839e12d
e08dbd56acaab8325c0c66c6814429cd28734cc7
52005 F20101209_AAAWLB liu_j_Page_029.pro
01ff716fc4864dfa2049d5c7122b03a7
011b1c07e80bcb44fa9f6d359582533226e51cac
F20101209_AAAWYM liu_j_Page_148.tif
30720f2bd71a8b2bb33a6eaf6747e22d
3f8a188837879da9d344c469636a4202be3a0291
F20101209_AAAVOI liu_j_Page_111.tif
433d1cbba5d1a10d64089eac58e6a1ab
30c298896ea262599795752efe7ae08da0c1a2a9
3242 F20101209_AAAWLC liu_j_Page_059.pro
43489f81b9b46d0fd14486ef872f1072
6ee146c8ffb2e1a5e15cd87619a524b3bfdb2194
23731 F20101209_AAAWYN liu_j_Page_067.pro
1201d4e13e9ff1d83d5b58e69eb52939
33056c526e8864e0bce6b87acbd59803d89e33be
46191 F20101209_AAAVOJ liu_j_Page_118.pro
7338c68427287dccd11695fba06c9306
c9b865dbbe7646fa549f96e3eff8117f716ac818
112833 F20101209_AAAWYO liu_j_Page_040.jp2
580613330920da295d90ae0950653ccd
0f39b1c4aefed59a19d1dfd55f8e961a0d8c03de
27305 F20101209_AAAVOK liu_j_Page_114.pro
6db272ec7adc020bc45782447e0e0c12
bdbfc5c4187646589a28e91f953f250a046d36c9
28308 F20101209_AAAWLD liu_j_Page_162.pro
11329c5fe494a66f6431c0130ee804ae
c5bf388858edcf28c24485de7fa3f08cf30435a1
34249 F20101209_AAAWYP liu_j_Page_171.QC.jpg
9ee6bc73d4267d2ec8cedeb60fe93ebd
9ce63cfc976f8a2cba23de189e74cb0fe937a50e
F20101209_AAAVOL liu_j_Page_108.txt
e0090ddbc424b6e0118dac416e2bee52
f0eab57a086966710c1f2921481a5039c09682e7
8176 F20101209_AAAWLE liu_j_Page_024thm.jpg
821ef9d504bf5c475c11e62944df5e26
101a078e45ee4df6cc1513f18eac9540005a4c1e
154500 F20101209_AAAVOM liu_j_Page_010.jpg
4768c409a5ea2c5499a4ddea3616aaea
2599d32a7f714c63b9491a5c8d4d0c80184fd1a1
1862 F20101209_AAAWLF liu_j_Page_101.txt
c7bc59b601aa2e374f1e8272c66c4f49
4ab1a81c5c7d1425280e9d9b63d7da367ccf63bf
58971 F20101209_AAAWYQ liu_j_Page_199.pro
4d31bfedf7426624421329bb03ba5694
691b0330f4c32bf9f35c87b30b2ea1e47243193c
1930 F20101209_AAAVON liu_j_Page_042.txt
67730e72252ec8e7c456318e8936dedf
569d7b8f1f1e576b336194d95c506df6e48f7d95
F20101209_AAAWLG liu_j_Page_128.tif
9ae2e8194180c1ebd7b2cccbe3882c86
14f03782e25ee4263377be97d0e07cf4a8bfeefc
104434 F20101209_AAAWYR liu_j_Page_168.jpg
35d54c9585e931981c9882c17b826bdb
d15d2681fb46b437fd2591c94fbf068600022ba9
109674 F20101209_AAAVOO liu_j_Page_134.jp2
bf426abcb779780020ad6de16e47e7e4
6632e61bc8150757794334a4efcc5b20c05d8a65
106227 F20101209_AAAWLH liu_j_Page_120.jpg
7f76ef929ad27884bad680dbe485e75f
6675f6c76678d55bb7eb03d05f90ece4c5ecfa07
F20101209_AAAXIA liu_j_Page_224.tif
6c920b120124ab4503137def6cc52808
31e9db345068d30d56ad580fd5fa10c831aba6e6
8303 F20101209_AAAWYS liu_j_Page_026thm.jpg
6a910ed90bc9d43ef537c4d0ef478d8b
6b7af33ef5678c3d240b08004851f60f6b60d80c
F20101209_AAAVOP liu_j_Page_157.tif
7ac91ef17bda03f6f4ac938c3522b7b2
0b0c76776a138c4b1a256da49ac25506c6c39f84
4023 F20101209_AAAWLI liu_j_Page_009.txt
06b1844c7b55abd72442875b431c6322
a81f2c11d884033013645fbb70fedc5d05431e0c
F20101209_AAAXIB liu_j_Page_225.tif
c6a77557f8ee65078f55211cdb63671c
41a06f600cbba8f7bff589adda953f7ea9c98330
F20101209_AAAWYT liu_j_Page_143.tif
1f111ad8906be9a8e235d6e872a51e9f
bf4a24e7233fdb347a0281785762ea2b8d69ba39
48503 F20101209_AAAVOQ liu_j_Page_093.pro
122b5a659df98834a57bc6a4ff276562
7c23c1929986ced252dff6e860ac2f19f6c7fdc0
120931 F20101209_AAAWLJ liu_j_Page_199.jp2
92b5e02944b44572fc116a367230ccb2
d909b6d7fc2be0bfe1149fda614f2d144e828d1b
8512 F20101209_AAAXIC liu_j_Page_001.pro
c99339b2ab81b428c490c763d2f361b0
282a5394472c04983346a7f464b6e94f0833c897
7763 F20101209_AAAWYU liu_j_Page_050thm.jpg
ee586a99647114770e136610d7936f66
7ff051275d6483c7df6a55a0e67c4044ed805be6
104227 F20101209_AAAVOR liu_j_Page_039.jpg
19ae7223a2288831654fe316e22c07ff
6cb87ac46af6da578bec67c5695357f3ab1a0b3c
50952 F20101209_AAAWLK liu_j_Page_091.pro
1f126efd2f3a741fc8949d1177d8b45b
a7523965a72835b17830b9439c98587c256be860
6069 F20101209_AAAXID liu_j_Page_003.pro
97eb7445874a40fe427ec0032eb5eec2
626d49d0fdd7ea0f79509bd8b9bfddd96eb16b74
1148 F20101209_AAAWYV liu_j_Page_012.txt
36f897f1d62943d54ae6ba4f82d1d515
9435b08eda2be432ab45adc1ce2171154c48fccf
34772 F20101209_AAAVOS liu_j_Page_029.QC.jpg
67ad6ba9d0143303bd81914240f1d777
4612ab089b8ac9901b1923c4c06cb5f84804f198
49556 F20101209_AAAWLL liu_j_Page_152.pro
539393e84bdc18e8e154dca0d63882db
e7831012ee553336e969fdf71c6e314affa6e355
52321 F20101209_AAAXIE liu_j_Page_005.pro
522251ccc94901958041d57e853151cf
89aeb007df1288ab11bcd947eae324dcbebfd56f
49074 F20101209_AAAWYW liu_j_Page_055.pro
531126741ed119842c8997769ac58492
1670a6222220e3a5e65a230c88940d06e94b1818
108594 F20101209_AAAVOT liu_j_Page_169.jp2
296b78006d988f5eff38eb1baeb51998
e4dbfee1f1e1ae78b7b47fb0b3dc2c992453d974
2077 F20101209_AAAWLM liu_j_Page_001thm.jpg
bf14728bcd7792994126d01e7da0a62b
d0a6090ab75c51c17e5afcd68f3a0f4b9f8677f5
52593 F20101209_AAAXIF liu_j_Page_013.pro
21980fe2e24b806ec8e828dc6f8e7cad
11247d7850feae9c05ada1be5456d79d37f95a74
F20101209_AAAWYX liu_j_Page_066.tif
c472d05c5db078a169dfe6215f2d5a95
9e8d8b6105fe3cc2cbeca97e9688e60d8a106480
110494 F20101209_AAAVOU liu_j_Page_132.jp2
5be31602829fb65138a379e0761d71c2
ad2136e555c1564996316fcb9db9d59ca45a7c6f
69079 F20101209_AAAWLN liu_j_Page_204.pro
d22b566167eecee513b272f87ef989ed
834d2c0d868bda0691f00fdad908a06fee256ad5
50822 F20101209_AAAXIG liu_j_Page_018.pro
673c337dd65ee7b9024b723123e2ee51
37cd0c8bed94229685ce24ac03312e0ca5330118
1051974 F20101209_AAAWYY liu_j_Page_008.jp2
3c4e416a75f4fa5a084090de7ecfed14
7de87c84f67cce21a2a53abc403bfdf169a48c16
52011 F20101209_AAAVOV liu_j_Page_110.pro
55af78203639d4793ddc41797bc14806
ae94417e3c6a9ab1db963caeef1fdb7c3322f041
F20101209_AAAWLO liu_j_Page_106.tif
bc96a58a70774673a538ddd41649171e
61ac5bf82e19e41d267b835a875ef2d88a8e23d8
48252 F20101209_AAAXIH liu_j_Page_020.pro
acb9d8975ef432a5191a80dd8e6fe4a5
80ce4598747dad9a481600c3b8ca99e2494e9aed
750 F20101209_AAAWYZ liu_j_Page_060.txt
9f7f2e014ee2e782f8c8f14a263be081
1f0eb2e1bf9b8598546bff14840c09f1b7d81fdb
60953 F20101209_AAAVOW liu_j_Page_192.pro
ffad692dd1a819ba83b7e3037830d7e2
8aa9ea0d8a0dbf98471de3c1a6bd36227d027596
7844 F20101209_AAAWLP liu_j_Page_183.jp2
de599cc17350356709da266711fb84ef
d65c2060ff69d4f021178b3e70c9c969addbc3a6
49218 F20101209_AAAXII liu_j_Page_023.pro
aa7cea17956eb2b4f4e8da1774c683e5
7b85a79a71dce59abd7734e7b0a976aa3b34678c
123771 F20101209_AAAVOX liu_j_Page_190.jpg
408f5be030b1ab3e4c8343e41c5e3a28
c5f4057bf8ed0dcaa023e24a24059dbb3f991f80
F20101209_AAAWLQ liu_j_Page_109.tif
e0e9888e51641fb2d3d70a6e71dce2ac
ae08fac616e9e3314304a647a3f44c01597b46fb
51378 F20101209_AAAXIJ liu_j_Page_027.pro
5057af48a0ddb128fce0577ebd58f603
068fb6794655af5787b71b0fa1987936b7a90277
101206 F20101209_AAAVOY liu_j_Page_070.jpg
c0bd727a59b53449a35ad6d6e9ccaff1
26d974b082689ab975a5635559d339ede5993e58
7524 F20101209_AAAWLR liu_j_Page_021thm.jpg
9bfa60d8188c1bc4b1335ca5fd67a059
534ec1449c1fedef4d757a6080e0ebaf6a6d6279
51140 F20101209_AAAXIK liu_j_Page_032.pro
a76e33fe2c922c4a56aa001189cf9e5f
1a0607a0f8d0d81f284e49ac6737d02aa310ef74
108460 F20101209_AAAVOZ liu_j_Page_027.jp2
039bd8e89142b1e6e37899f80121b00c
cb2e0d569ff98c1ac880452f7a6344763d516d9d
135873 F20101209_AAAWLS liu_j_Page_214.jpg
2207f215c72c92c61ad649856bd8adb7
939fdd8d03a0fe362c69343667768b647d5dda69
47854 F20101209_AAAXIL liu_j_Page_037.pro
524b5fd554482ff3ba8960f9cb0d64f2
fa65e27d3097353724d619c346a6aa8d7d9cbc14
2406 F20101209_AAAWLT liu_j_Page_183.QC.jpg
163977b76aaf0bca1a3cc1c6120d75dd
b754c5ae5315fab21672149787132ce93bd2361c
50796 F20101209_AAAXIM liu_j_Page_040.pro
83524b02fcb751e5cde2af79873f8318
c9a4466c5aa7c090797b5c189b5210f45dcef252
4188 F20101209_AAAWLU liu_j_Page_046thm.jpg
5c1543c09c2d86f4a97c73d587bcfee6
a7e0f82d1d8dcce383dcae5feed6a445a2c1ef30
13120 F20101209_AAAXIN liu_j_Page_045.pro
e52a85a20709d4d0fd736d7624c29696
1cb1d21c6100159d5c9fac57cb39ffde1dfcd3ba
16582 F20101209_AAAWLV liu_j_Page_011.jpg
76060f048a1e710ff5f1017edab5edc8
65711c9ebb04d9d4462abdea32ae789e3a468b11
14142 F20101209_AAAXIO liu_j_Page_046.pro
807eabebc769e5df7d32f24ccc0fc956
e4c35752231d8ec381d52945071b2cb11b3867cc
40647 F20101209_AAAWLW liu_j_Page_181.jp2
90825411a214f242f79a0ef81ac3287a
06933675369064aec47b3e0cf8b3eb74b77c45ed
50406 F20101209_AAAXIP liu_j_Page_056.pro
6657f17d48c87331fc02e3bcc212f0aa
6d4ee9d734db28d40b374d64954affd0bcd11498
8182 F20101209_AAAWLX liu_j_Page_042thm.jpg
9be18ed0d7de962f8e7c8634914260a6
7e5ec02d45469d2a6da50c30ecbd4f19256063e8
49623 F20101209_AAAXIQ liu_j_Page_058.pro
147d43c9654e7e3a10883c03dc0e04c2
f8961c75a3f7afdf791f599aed78e51d8a2599b2
8441 F20101209_AAAWLY liu_j_Page_027thm.jpg
7cec1672cd772ec2d6c29fb5c0f991a0
a73765fff410ad6d881bc6d444bfeadd3885f419
49766 F20101209_AAAXIR liu_j_Page_070.pro
c0962b7fbeadc75c213be2086f5369c6
24051f545f738efc7c6468d4a680fbfeb4375367
745 F20101209_AAAWLZ liu_j_Page_006.txt
ac71cb45d571ee6bf4af0b81f052effa
ee6e57f24b2bed9895d6425940e354c2c4a427c3
47929 F20101209_AAAXIS liu_j_Page_071.pro
ab6ede4c2e6405b013c1e131a27e54e7
673edaa661ee679604ac13a6eb7229b548b45ddd
48516 F20101209_AAAXIT liu_j_Page_076.pro
9f90fac197814dae87f845aece87f492
ff2c8b58102f2c0d8ac1c259ddae9454b8de4f71
50918 F20101209_AAAVUA liu_j_Page_140.pro
49d3fdf19f1cb0e0840efe216e35fe92
798a3f7136117499e2caea9318eb84af6d32bb70
45681 F20101209_AAAXIU liu_j_Page_079.pro
ec1069dff16969ef8db471e5794758cb
24ec218b7c5ddebedcf0242ff2f862c3af0f04b9
498 F20101209_AAAVUB liu_j_Page_002thm.jpg
2754e5dbb3f395bc4f4dda87a15a6435
6fabc462cff2f1fa9f596a19b7d0473d3e1ffa2a
4693 F20101209_AAAXIV liu_j_Page_084.pro
d51249e1d492a7b4195886b29df0fd31
3e950d176e8525b51f499eaa3c13334c4be5050b
102135 F20101209_AAAVUC liu_j_Page_032.jpg
7059810af07982b515323704db5a2033
2f99d1f6cadf9f7f1bec9087e37bc57a2e4a8dd7
44217 F20101209_AAAXIW liu_j_Page_085.pro
1b74c612e858d09557ff444fa4eab56c
f285088c9b8486424cd9124ae1e91f41699a9bb6
37685 F20101209_AAAVUD liu_j_Page_214.QC.jpg
d955f1a3a1e918a8768f03ad0215699b
8cf68d18072aea23532ab0eb77127a1af9fd32fd
22085 F20101209_AAAXIX liu_j_Page_088.pro
2a7a80815f5957e1b007df33e93a1c60
8104c7081ce42623ae807f3f9f291a0d2e6e9a1d
F20101209_AAAVUE liu_j_Page_011.tif
8567d3bc4e42b176578e2917da9ddb0b
1bf131558292b36c01fc3cbf6b335b46ee73de51
67280 F20101209_AAAXIY liu_j_Page_096.pro
2c7be562fcb10de14a33b32c04c095bf
f7dc60319dca003f5c5e98c92749b25f5d499ca8
1051985 F20101209_AAAVUF liu_j_Page_161.jp2
b4d0a86c03f95c8d8ad248b2365e380d
20091769db15c8cd5f19d22d47d2d1ca325af41a
48734 F20101209_AAAXIZ liu_j_Page_098.pro
75694e95a312518233ff22a59a2de38b
a85b1f3031d21dd0d32063c4bf41c5145c47ba44
31769 F20101209_AAAVUG liu_j_Page_037.QC.jpg
85a6bf241ebd8c363f1b0f83369911bb
947da123258415830309d08e04fcf04cd68ea4a4
7504 F20101209_AAAVUH liu_j_Page_013thm.jpg
2b9f8b389d830e88ce8cffda294b6fb3
34f14c54a265ef896df763f8440a4d12e9e02b50
35138 F20101209_AAAWRA liu_j_Page_186.pro
7c5597be49d05ad243dac5b2ffdc9e02
a3f99b789eaf313c7c95cdb48f0cf5d26a386cb2
8589 F20101209_AAAVUI liu_j_Page_162thm.jpg
4b8bf530e7add0cdcc498c1261997c69
d41e70d46ba5fb90aabf9e9f31f80551dd794b2f
8458 F20101209_AAAWRB liu_j_Page_028thm.jpg
715620bc0e51995c87d231f4976a012f
065a57fafc26a25018bd71a6370045b330fed60a
24258 F20101209_AAAVUJ liu_j_Page_115.pro
19d5d041830b8f6a395ba7df3840b445
20d347d54d2093f854cf52f1abb3ed5581e8840c
91218 F20101209_AAAWRC liu_j_Page_048.jpg
4dac0c5259822029acd0838365fdf554
96bc701d77f670b0dfd980f2fd076ad831135c04
36429 F20101209_AAAWRD liu_j_Page_073.QC.jpg
6263d5639a87114e913be4fbff4bc396
b54fb9562a9040437ab11f55ced56f28515aeab7
2003 F20101209_AAAVUK liu_j_Page_022.txt
74cb6df55fe0229c5dc2967dcb0d7905
9d0071c945e93120cd182dd83f493b11d731f6c3
50648 F20101209_AAAWRE liu_j_Page_094.pro
e7a1855ca7b8200ab552bd6cb426f1f5
b3f11d3b27a9a38a322ed46481689979352faaa4
424215 F20101209_AAAVUL liu_j_Page_046.jp2
c75f326e304b99ae4a7fa7604be6fbf5
7719031f07593c34447983f5c0b3cda4c8b67af8
7234 F20101209_AAAWRF liu_j_Page_063thm.jpg
cf5e6faa500657aab7e55b4815054d28
15391ef4bb9e6409240eb7fd93cd86dd609ac0fb
129706 F20101209_AAAVUM liu_j_Page_212.jpg
32638de7cad76c890362cc046fd29b13
d5877aadfafb9b64af7943741a9dff125ae065b0
8521 F20101209_AAAWRG liu_j_Page_175thm.jpg
a4a542600597c28d2cb4d301e5b6baf4
a20642fc543e0827ac19b7a4e9ebbcee5286f575
7946 F20101209_AAAWRH liu_j_Page_144thm.jpg
efed5ee83646adfed01e6633419d3960
b3b8c350b9d128c37704a5c2aae207fe9c4fbefc
20171 F20101209_AAAXOA liu_j_Page_158.QC.jpg
c518ea692c826ae4a97cbac3a915eff8
4910e18f457431ca8b7c41a649b77c0344883c88
F20101209_AAAVUN liu_j_Page_222.tif
b2344237c603155b203eb3783c503058
da3b97f52b9bf298a5d31fff60635108a0e76aff
2020 F20101209_AAAWRI liu_j_Page_141.txt
d3d6eefda5a2dbae4c5cadf465059f16
5e75e1a7cfaebb7601593722ed40630376488ed2
38829 F20101209_AAAXOB liu_j_Page_204.QC.jpg
dfb496c455674b323e39aeffbc3f7317
2b1e267e05b053555040a095644efecb8a0a94e1
9126 F20101209_AAAVUO liu_j_Page_212thm.jpg
490f83a6b66a0f87432e794e5f45e138
b922110b032cf8edb90a4a9b116f1f20b879f6e5
34129 F20101209_AAAXOC liu_j_Page_028.QC.jpg
4ba37fc75929744446a512da03baba31
b5f55194dc3c4d8ead806552bf001c9247b91a15
F20101209_AAAVUP liu_j_Page_214.tif
45925be5e04e0863b3b978a68318323d
b1f31f8df36dd4e29d0c5e2d6c45abb4565c7068
925 F20101209_AAAWRJ liu_j_Page_063.txt
e90726e064077e7ebeb0fc9391c34af7
ea986791eb5ea5d496237318098b219907d9c8ba
33427 F20101209_AAAXOD liu_j_Page_111.QC.jpg
74ebd999f00ad7692cf634e9f9d7a307
548d7fccf4f2c0ceb7e416076ef514fc9fd706ad
61431 F20101209_AAAVUQ liu_j_Page_218.pro
7d51ccea96e5741d6483bff371e3539c
f51c8ef0c25922667aff901ef027e0a1a5f78f22
51597 F20101209_AAAWRK liu_j_Page_081.pro
2302c8e2a7cd74e8e1560b62a8b548bc
fa2e36a9c7d58dafb9934a4df2489e1ebe620aaf
34971 F20101209_AAAXOE liu_j_Page_110.QC.jpg
c307262309e452e58030871c558a1471
f7d9bebef59c35da06391a8365bbceac86cf4080
8122 F20101209_AAAVUR liu_j_Page_138thm.jpg
745c7b20fd0a84ea994b1e37bb3cc206
bc3c6bff3f70125c427cdbde5a383d32cc59344f
7150 F20101209_AAAWRL liu_j_Page_014thm.jpg
3549c3c1495442abe07884eb9f8acf1f
6ecf49e28bc4a358df77d587101f79b2232ffa06
2602 F20101209_AAAWEA liu_j_Page_191.txt
df470e676a818abdd1030212e4093c8f
f518989723028e23a33c0a4a24db15480b04cc14
132771 F20101209_AAAVUS liu_j_Page_212.jp2
dbadaba64048aa9d65a186b77a8badc7
941dc34881bff90e930db56dc230ea0dde113cfb
29631 F20101209_AAAWRM liu_j_Page_165.QC.jpg
7615a1682dafad8ad1c0811ed8637280
051b4df24963f49134fc68be9122483d861276a1
8834 F20101209_AAAXOF liu_j_Page_073thm.jpg
1c5beec1a12d3db780c67c5d81476ece
7066536f11e25c7a18f5bf035a7f101925fcf519
23691 F20101209_AAAWEB liu_j_Page_047.jpg
b62e61edd8e4665996ee22aee7efc312
e7cb30997d621b8818b3852dd4f61f04d4925687
31350 F20101209_AAAVUT liu_j_Page_172.QC.jpg
da5e30d918021317efab176e8d0a92f7
943edd018f8207661bd443821596a97721405304
51186 F20101209_AAAWRN liu_j_Page_035.pro
272826fbbf276778457acd011fc3975d
8cdb7ea271bbd4ccc8b0d7b26c4d6f47420c8e1c
36067 F20101209_AAAXOG liu_j_Page_203.QC.jpg
b22e6e237e42cf30c241097e531f437a
5e6ac6f99a6665ef48e5a34250460eab351f5845
106557 F20101209_AAAWEC liu_j_Page_138.jp2
83ba1cdef4ffb3eba0c769201777c4f0
509a242537a8fac447151388bd8df2c0d6a35b04
F20101209_AAAVUU liu_j_Page_056.tif
24195f85bdc53d1a83fd930f5e2f146b
dae5aab99628cbbc183dc4103adf8e27f0035434
64082 F20101209_AAAWRO liu_j_Page_196.pro
c790b1d7d9b23f1468bc2a51030db952
3d08d80e8feaf3515cd9a65243c9bbe1a9410a6b
2874 F20101209_AAAXOH liu_j_Page_047thm.jpg
bfd16a8bcec9ea2714ff164fb2f9a3e7
75fe7e0a0295cd12100c6a03d442df6e2afba3d8
52003 F20101209_AAAWED liu_j_Page_073.pro
cd0bf82b25ad0f6045fbe6b9cfd7d313
e3bb43a2b152739ab6e409134f1e96351e88de12
2553 F20101209_AAAVUV liu_j_Page_197.txt
2587f7b809fa51851fe71e8017470b99
bde2cbbdb209db794c61f6ba42c16f96f864ff15
F20101209_AAAWRP liu_j_Page_195.tif
b99361d64b5e06ea529d47b87fadc53c
380e66ee85a378e6caeefbb28efcd95440a5403d
9140 F20101209_AAAXOI liu_j_Page_205thm.jpg
04235e31211b4e9b96ab93ed0eeba19e
dcb1f454143919862a8014adfc2b336d9ddd0b84
46774 F20101209_AAAWEE liu_j_Page_101.pro
f14e8dc5a35ce106cbcb2f37cc21df13
d6babfa625275c61e2185e9703fb2b38e1914db5
54727 F20101209_AAAVUW liu_j_Page_142.pro
41d477d8042dbbf43aaa1093a5f1d978
b9d2226771bd3a27868988d92191b15b3ce5cf07
107912 F20101209_AAAWRQ liu_j_Page_019.jpg
5dcbc374454fc218ce54ca40e7cefbb2
d0ccbeb41e8516c0fe609ca345333b1e60c71793
34868 F20101209_AAAXOJ liu_j_Page_095.QC.jpg
0196c60de84edd71e075f70662fd83cc
a84e6d1599a117bdd63c47a32b85c4f35a573152
52211 F20101209_AAAWEF liu_j_Page_167.pro
9ef25faa7e82bec5ef78bcf1db9421fa
6a62c4fe7d503065ff872120c27dbfcadbcbbcaa
39202 F20101209_AAAVUX liu_j_Page_193.QC.jpg
ac25459406a77bf4e8bf14300bef597f
e0be41b3645db3d27aafe2a41a0c3a02f831367c
6510 F20101209_AAAWRR liu_j_Page_116thm.jpg
b84b5ee5dd9c4990ec97005d24646f3b
d01a44ded7e03864c8a0b30de64a73f4cc852a09
38626 F20101209_AAAXOK liu_j_Page_195.QC.jpg
bd76d098c8928ac9becbb19a075ae7a4
80b08a20e4afc466674619bd8a7524d8a35d7060
111996 F20101209_AAAWEG liu_j_Page_036.jp2
dd363c768ac6dddba1f79bc38d051b3a
6b9829b819be802bb1e010d41f3e072edd9ec54f
76298 F20101209_AAAVUY liu_j_Page_186.jpg
08ba9db4a5f3345b4d165e96eb33cb46
d979b055a6d94cf74c9f7d602a396aeac65ecc8b
101281 F20101209_AAAXBA liu_j_Page_111.jpg
66ec2782ac914dcd660e4c61690b9217
05e00ed4cdd78b3a78d86498fa5cfedab514622c
F20101209_AAAWRS liu_j_Page_114.tif
22b22907bba49371662218a436822061
e49c46dc4019df8daab99b1d56e0b5dee9017a45
8100 F20101209_AAAXOL liu_j_Page_071thm.jpg
5a5e4f5ebfc95bdd1fdc91a626b753c9
47a94ad8c515bbef30d0719cd7fd46565d754ed2
112377 F20101209_AAAWEH liu_j_Page_105.jp2
a89eca76c72814ce6ea1de37d5a1d632
a7696574fe84fa7081bac2dc5fca0d9aa001d5f6
31876 F20101209_AAAVUZ liu_j_Page_138.QC.jpg
418d13cc40a3457929d615b211d3364f
0515f90a021e849cf0e76a57ca69bdcac94e8310
70797 F20101209_AAAXBB liu_j_Page_114.jpg
3ba7c9615bdad4fcbb7d15f8c0a3fada
655582959684142a5874f1b1b39573f11362aec8
101719 F20101209_AAAWRT liu_j_Page_133.jpg
2c25b63651edcec881d555fd2fad2405
29ed819100ca03bcdef19eb1ced59b9dab2f9f30
23158 F20101209_AAAXOM liu_j_Page_063.QC.jpg
b3ff61f6fec82458a7f0ddb9309025ef
9dda4bc962841ee39ca426ff6582f3f8571e942f
8229 F20101209_AAAWEI liu_j_Page_147thm.jpg
c0aa8e4d20e841f7fb3387cd823db397
f7d37a048b9a8071aacedf6afaa550ff5e95d6c0
62761 F20101209_AAAXBC liu_j_Page_115.jpg
ae0c520fce0729960c62d09ca585a66e
9f5c8f8dde6aea97fd1df149ec881f60c43ea4a3
18071 F20101209_AAAWRU liu_j_Page_182.pro
39cae44f0eeef488ad36efe22d11ad9b
76d0ac856722326b815a2fd0ba4550930849602b
37791 F20101209_AAAXON liu_j_Page_189.QC.jpg
98dafafaddb67e744a8c57651a5198c3
9d106c07d5200bc5af235449e8b89d84a82dcc07
24331 F20101209_AAAWEJ liu_j_Page_116.QC.jpg
fb787575e1aa2c8acecbe0ccc37953d1
5802c6ff266d02d171c4020a9baa4f2073a49e9a
71961 F20101209_AAAXBD liu_j_Page_122.jpg
b0a018d13c89f33a6fe6349847da0fa2
3984c761adc38c67e0f9d3abf4285bfae30b9ad8
5651 F20101209_AAAWRV liu_j_Page_164.QC.jpg
7b26516f44a5f1a6e2253324df866076
4a9ab5f8d4f555a871dd27652d2ece9d586e46d9
9455 F20101209_AAAXOO liu_j_Page_219thm.jpg
7dd56b0374f9ae97d6887c584fdc8312
cac6cac0e3b9880efffbf16c7972bb9c30d469a4
42414 F20101209_AAAWEK liu_j_Page_017.pro
7ec63a4263fbbe47cacf4c967a22e823
3e3c08e6e02113de9e41a9e861eb253a481e3459
109103 F20101209_AAAXBE liu_j_Page_125.jpg
0d61dfc808c6f654596d5748c0bf96df
e3eebe98c7e6725d1cc8fec8f83fe63c8346519c
105979 F20101209_AAAWRW liu_j_Page_107.jpg
882011e4fc4322677764acbe4144dfce
15b6a87782b0ff21367437713bbfc4193e2f9733
15375 F20101209_AAAXOP liu_j_Page_044.QC.jpg
26ef1d1a57967241a58089c6ef2871f2
6636b5fbfb33adae5a98ac77df8806e7c2e95347
4424 F20101209_AAAWEL liu_j_Page_086thm.jpg
c70db41519580e68e3a44f69ee3fa723
508e4e176c057cc40b4d7e279a84db4379334583
109753 F20101209_AAAXBF liu_j_Page_126.jpg
5b1cc7f43688b0c26b63594556dd6c78
3678b519f0aa7a5cc427e9d6fd349a98d5787291
55268 F20101209_AAAWRX liu_j_Page_097.pro
7343b937c1412d314f9de8b2b43d65f2
01b1859e603c9b5067829e2fc9eeb9815f887661
331325 F20101209_AAAXOQ UFE0017527_00001.xml
34d2463de78fa29ca355e4bb86eb1e09
656576507ac64a1c98a44b44897737e74c082c9c
484 F20101209_AAAWEM liu_j_Page_084.txt
76dee46ce039becbfe768089a221f38e
04069591cbac7ef84746bc07282fa2b9d6b56630
103403 F20101209_AAAXBG liu_j_Page_127.jpg
2b6ce0f339ce242dac5b0c85daa7b490
37be4e6b49f9a3a8752e9beb08931fda6177e742
F20101209_AAAWRY liu_j_Page_200.tif
de182862080b39ad2c4850d881842a75
f08f5f54f36f562ed6d6819f7ce13f537e223502
6926 F20101209_AAAXOR liu_j_Page_001.QC.jpg
1420c35d05331f6df3004a34b7095aaa
d4638ece77488dd21a90a244c1d7296dbacf351d
8621 F20101209_AAAWEN liu_j_Page_167thm.jpg
01e526fc8d460c94d43886320d51f1b7
ee7bf6b84dc3448c6b40276778693f376ce08de2
102791 F20101209_AAAXBH liu_j_Page_128.jpg
7f7df6c9a8ddac35e6ada97e39024f72
539f361f124837266349c0f4f3b9de0b0794f42a
134302 F20101209_AAAWRZ liu_j_Page_200.jpg
df52b0337514ded93fe1d1c053d7b83e
40f0a22a2d16a02656d123268b0177ce1fbc7e14
7220 F20101209_AAAXOS liu_j_Page_004thm.jpg
6e2fea101c30fc76447521309a9f9cb8
dc68698dcf1a89cfd8593670c5aa23b7593cfb0c
45331 F20101209_AAAWEO liu_j_Page_052.pro
ba6daa077942982c49fa28f13055567c
fe7cce4316e4903c1048229f45b9d6e7d53c1ec2
101412 F20101209_AAAXBI liu_j_Page_129.jpg
8e5fae5d2cb39e63ac485959a86ff7be
258b66a9072d9279dc7ec719c7caf23e2e18a284
5938 F20101209_AAAXOT liu_j_Page_007thm.jpg
31056e4605910c7bcc29b64ad418c38d
dfe18fac2ebeaaf8912b850fd1549a4331c8bd64
50851 F20101209_AAAWEP liu_j_Page_173.pro
8a90d492d760ebdf12328975b0798539
2d15adf248fe3f60fdcc89e1ba267df7d56348f8
F20101209_AAAXBJ liu_j_Page_139.jpg
f8be4c75ce7116b61aeff12d5e4a15c0
8214d6a48c017f206a3f12a4d37d12256f2e8955
9015 F20101209_AAAXOU liu_j_Page_009thm.jpg
993af05648029b16207e3aa5ab7ead88
1d361139f1c8e8d218df5bb698b613526c717258
1920 F20101209_AAAWEQ liu_j_Page_049.txt
6a9d5845227120f92d505d54bb1e4619
1b7c7d38cce746addbb70f267ec7f81f9d871431
112573 F20101209_AAAXBK liu_j_Page_142.jpg
de00d6a26ddf5112d9628f9ae071e3b9
69d07a96397e9aa2f7d18c1260b1e891f98494c6
40262 F20101209_AAAXOV liu_j_Page_009.QC.jpg
594c135fad41ad65fa983bf8dec9f26b
81902066e70eeb8f06190bf8e238913e11117d7f
132063 F20101209_AAAWER liu_j_Page_096.jpg
922196e74a589f420de3362f6b9549b7
af0b0a3d4873bdab11538b7bff2e6c6293894ad6
F20101209_AAAXBL liu_j_Page_146.jpg
cf23852735934af003c8ca1840cd0f07
6d26490b04783105083d51ffe2025cd558ab1f0c
37964 F20101209_AAAXOW liu_j_Page_010.QC.jpg
c668574ed0997cdb2f84728393bf319f
99ea5a179df7f068ffb59f91be52e121cc95e638
2023 F20101209_AAAWES liu_j_Page_027.txt
83d779ce2984a35bea2d0a352ec078e8
8302e0c0ddb2a84aec9bbf058883483e6b4f58f7
37149 F20101209_AAAXBM liu_j_Page_157.jpg
c14f65706491f4c79f0740af09462089
1135c132c4e11851cf97b98f5c578387196da496
4632 F20101209_AAAXOX liu_j_Page_011.QC.jpg
9e76bbca9aa4d6e109601e82af09d41c
efae78d449794498f1727f35c060615b92ce2d87
2437 F20101209_AAAWET liu_j_Page_206.txt
6fb0d8932d31eeacca8d34000cb5ddb6
6a0d7f70d726b51bae9a2421ea00a465781d3c12
40729 F20101209_AAAXBN liu_j_Page_161.jpg
d716f38e618b28104b36dff0432635d9
68aa0987e45f2a62f50238ee49ffd7c4503dbede
29103 F20101209_AAAXOY liu_j_Page_014.QC.jpg
d9bc55550e3135e38576358d57a98563
45da96f8ae60f100f3babce71c0b22936b8a3cce
42387 F20101209_AAAWEU liu_j_Page_182.jpg
398e5b1266c718c371b7ed77a3b3758a
ba196aa524e7ee5f95eebee5b4610b7e624a3a8b
15776 F20101209_AAAXBO liu_j_Page_164.jpg
a6e5b715979940c6ba3483bcfa22ad2b
54dc16b2ab67b4f190f5ee89227ab9a68e03a133
34226 F20101209_AAAXOZ liu_j_Page_018.QC.jpg
6fe5516c383083e9c3031ef7835302c0
cf25c3a877928ce1e1be4125dda6a63d4d2c9c13
108510 F20101209_AAAWEV liu_j_Page_129.jp2
5326c8e8c24acf83d6a9017cb95daf1c
e22af58cb830ebed190c11d086f9f8a9efbfa454
103287 F20101209_AAAXBP liu_j_Page_171.jpg
6ffef840eef2840f16dc1177a12a2597
180b9f8c7077814f31b03460f969289fa77bbfeb
51875 F20101209_AAAWEW liu_j_Page_143.pro
476e0a5c536a99fd2edb13878ba0343b
99c3450a64a17ea41b92b4063677ae5227dd1f1b
2041 F20101209_AAAWXA liu_j_Page_032.txt
def86530881550d2d927e7589fdc7156
f247d3f05871c10fab1306ec3c6613d5e0d9c498
97937 F20101209_AAAXBQ liu_j_Page_172.jpg
9e496bea2c7446a2bfd8f4e3f8354aec
92b0e0a6ccffc745002943814167468d9c0e8311
132757 F20101209_AAAWEX liu_j_Page_095.jp2
6ace565e59d2289a9429c224f93d3033
a9b58cde6f4d5fd1b17b972738238d28af437131
F20101209_AAAWXB liu_j_Page_133.tif
2d61009227fec1a8cfd9ad197ddd216b
d5ff4530ef9619def0ac45ca5de20a57540cee5a
102531 F20101209_AAAXBR liu_j_Page_174.jpg
fa3c916817b225e7067bec5672646e5d
7348e96b5c0fd5602090c0459db7f140dc652452
107405 F20101209_AAAWEY liu_j_Page_054.jp2
f49844b319042200a4054f6e2504c2a5
592cc654ceb938f6a8e9654085542f1dbeac6ab1
8642 F20101209_AAAWXC liu_j_Page_194thm.jpg
6723bc4ea437127e342977e010f68db5
585d29112704324d7cef8aa74b1ef6a8b6f5eacb
103448 F20101209_AAAXBS liu_j_Page_176.jpg
b9d665a0c7f9bed2464003225a4a7b1f
42b3c582aa6f054e027f1993d5f59afc7f2a1653
43459 F20101209_AAAWEZ liu_j_Page_044.jpg
0e070f443fbbf7266547dbeb140dc42d
8e2955a046618a1ccc9a862c7dd891500b6e8eef
49937 F20101209_AAAWXD liu_j_Page_014.pro
654d82fe9602630bdacef52359f77f26
9dfd9a3d736af58aaacb2780e8276435755858f9
98493 F20101209_AAAXBT liu_j_Page_177.jpg
e03883d92bb949c4be72d5374975e2f7
73d4c2b1ae6f0b3fd7aa5243cad30d389952dd84
96657 F20101209_AAAWXE liu_j_Page_112.jpg
b22bcc674e36c6c6030ab0a5bac4b768
efbc06619de070e5c1640b5395c6699602907f17
100008 F20101209_AAAXBU liu_j_Page_188.jpg
e0cca03e499c111fc74a4b0fcf311efa
6a98c86276b0ea033c7e3069f7213c1a96986a4a
6020 F20101209_AAAVNA liu_j_Page_061thm.jpg
d927530e12c7485f8f81829da27ef459
c92d5205cc33e8f5e3d9a0718f21dc43616235c5
81366 F20101209_AAAWXF liu_j_Page_010.pro
056a9cce930777787753f049a20c5bbd
270d9c902734ac27e5b0d0e9d3f2c1bc1f677346
142798 F20101209_AAAXBV liu_j_Page_193.jpg
01a670cf05bcf809d231bc4c04e37174
bfe1892c528880c653ddd7c06f8f8c6a50e7e22d
9417 F20101209_AAAVNB liu_j_Page_223thm.jpg
baad168d510c6051d3417bda2f87802b
aa30b700239f3d7dedd003756c363c0a111fb243
137754 F20101209_AAAWXG liu_j_Page_096.jp2
0a559732239ccff98adac66fb09ad24d
d4bc45575928e70281821ccd292579434d88e209
128749 F20101209_AAAXBW liu_j_Page_197.jpg
ecfd187899d6e5a9ce0997126f8cf11b
e64100adb7c9088ad3c682967baaa183f6586e59
723 F20101209_AAAVNC liu_j_Page_155.txt
3beb57b7694306f3b2fce8c16e19a5a6
482d593b567728d3a4805d7195e575b97506b603
1771 F20101209_AAAWXH liu_j_Page_048.txt
eb42d972c684fe868d79df9b3f1db0d7
c3d34c361d547649edf43147fa3bea2547f91a6c
135455 F20101209_AAAXBX liu_j_Page_198.jpg
a8590b11ff81c1f4b111545b09fefc88
b2c825f5b884a504056f401f8f8f945adb4c1124
9397 F20101209_AAAVND liu_j_Page_221thm.jpg
e7b0a7fb3b462836247c6dba4fdae331
38a5aa3d636ddec4e18a4c9619ff5154b236b6fc
9383 F20101209_AAAWXI liu_j_Page_209thm.jpg
9e53c5f5d4050650802f819f60d297a0
2d8f5dfd4bace86c4a4c0744edde10171b5a48b4
2124 F20101209_AAAVNE liu_j_Page_137.txt
7ce22cebceb679745edb2ffcb58aa851
902043747dd124b065ceb7410eea70fff22d32fd
123360 F20101209_AAAWXJ liu_j_Page_218.jp2
ab9d83bc80df1c6dca14023ab4b4ed42
d7be8794e8fe28759f1f77c3492779dea98c598f
123565 F20101209_AAAXBY liu_j_Page_199.jpg
d60a7a276890e374263e643e12b722c0
27ee77b8cf6c88591914fb3064f9b5c603fbfc68
8179 F20101209_AAAVNF liu_j_Page_032thm.jpg
23f9f63a848c97c9aada284a18c70dcf
dc7a65f3a45b0b73bacf63997cc9ad4acacad495
343 F20101209_AAAWXK liu_j_Page_064.txt
5dd3afaf98c5e0d40cca29816e0005d9
edd847b3a2196c494fb334edf524da4956416e6e
129311 F20101209_AAAXBZ liu_j_Page_202.jpg
ee149d2a587caff50c016863ebc0a0e2
535fcb3466cd8e3a59490c8d435b05a587ff9eac
F20101209_AAAWXL liu_j_Page_165.tif
ee9c5b77681d4c1ea8bdedb7bdb19fc1
5b6dcf7f6692ff71e02c59d8a107ddbce1860dff
1869 F20101209_AAAVNG liu_j_Page_133.txt
e3eb3ba19dd529cd0bb4b1b7029d06ca
8a81cf5b72223ae10cf6a73110587fa9f81d5242
F20101209_AAAWKA liu_j_Page_039.tif
9dc3565331ce6191c196f9dc7764b95a
cae165f6e4b7e75d566b1fcecf7cdb9cd2081b61
8535 F20101209_AAAVNH liu_j_Page_069thm.jpg
3ece4f95dea9121bc79c946f41438e5a
739b4470a21fbee9707c4c10ecfaf89f11b22b42
F20101209_AAAWKB liu_j_Page_190.tif
a0d9dbdb25c7f0c3821b06df533adfaa
7df4c2125d31cb7414233ec41d42374b3d0f9919
F20101209_AAAWXM liu_j_Page_069.tif
935146890c84e58ee33cd0e4d261ae0b
db620213d83bf5bd6c126e04dbe8e5abdc59ef70
1768 F20101209_AAAVNI liu_j_Page_021.txt
19e6fd353f29f4d971dbdd23791033f4
f19d34145b10ec458d97350c42146ada1bca234e
37828 F20101209_AAAWXN liu_j_Page_205.QC.jpg
d7fa063c1fb725c756aa8de5cefdb3ac
0c058e03e9e3f90944d4300126a5415eaa0d0b20
825 F20101209_AAAVNJ liu_j_Page_046.txt
81829cc4aedf981ea3be942d70a0f40d
3f8f83d4a9030bb8fc89e52b8098b2e6476cd83f
7675 F20101209_AAAWKC liu_j_Page_178thm.jpg
555c74b93067a452abfc0c89ce66c66d
708bcf750e6fee73af6993d9f77011e854bdc467
34063 F20101209_AAAWXO liu_j_Page_081.QC.jpg
6c898c956a4731a2d83c69ef51d044c3
f51b4dcd7ddaeb98886a05283e9b09ab7c25fd24
51815 F20101209_AAAVNK liu_j_Page_130.pro
a2e7ee19813d70c8f9796c4ed55688fe
f0b33d778ff32e664d46ba9c869b51151431a97e
8518 F20101209_AAAWKD liu_j_Page_132thm.jpg
3e357d2b3e6a711204c1ec645c678725
72d7f792f6b24533a786af3ee71a6f0a31f41c7a
107919 F20101209_AAAVNL liu_j_Page_035.jpg
0032f6b382fdba241b2a0c811c49d921
8f08a30efe0c2c67996edbac83fe809d66852830
F20101209_AAAWKE liu_j_Page_192.tif
5388b84d7f5215d88d7903918cb1e097
c5e98c926fe9cdcd17e82abf668f5401af3f59ad
104124 F20101209_AAAWXP liu_j_Page_141.jpg
050fa065868743e80bd61e950530964d
4e08e4984d3efb4a158b8c18ed92546a1741d7b7
115517 F20101209_AAAVNM liu_j_Page_126.jp2
fce22e28561101194f1d3637085d2ba5
aaaf8cf8b1088cb303aa0e5a8857a88dee687bf8
7867 F20101209_AAAWKF liu_j_Page_020thm.jpg
50779406d109dd5193cb442b7692fe86
20e8df13bba1a0e96ef9e45df32a47f2da15878d
34192 F20101209_AAAWXQ liu_j_Page_199.QC.jpg
d6faf332c0db9c698e1caf15ea5a7e73
1f6294c758e1671add0191bcc54655656bc79140
22377 F20101209_AAAVNN liu_j_Page_088.QC.jpg
94515cd04d89e2343c7a06fceb39f028
ca97bab8bf73d4def471fcc280c1b610ebb9aa0f
36582 F20101209_AAAWKG liu_j_Page_008.QC.jpg
582e1fae27a047f1f5c128378169feac
63134923d95eaa451924d8e79d2ecde0dedafcaf
47938 F20101209_AAAWXR liu_j_Page_051.pro
5b8966a99ef0c38503452bedeeed88f3
50fbd6763cfb384ce740cafd3546baa96a932734
8503 F20101209_AAAVNO liu_j_Page_030thm.jpg
5ec04cc6dc0c52b5ab2a3edb77334a27
1d889a8c8d1fef8e76483e0c6f5a8d3028f544fe
34339 F20101209_AAAWKH liu_j_Page_031.QC.jpg
f474b6a2f2c3449f1e2bd1f55409e281
dbf51d81444187783119321758c15b6e0777b7c3
F20101209_AAAXHA liu_j_Page_141.tif
2b493a2e0d3498b1116f97f17d8bac2f
d9eab0f108da7de21c745ff32688c69a54d47c14
103344 F20101209_AAAWXS liu_j_Page_034.jpg
52981bb8eb6cb686131c66c5c8cae857
5182672aa6edd4f78c2e67eb425bdb6fd989b4c9
8583 F20101209_AAAVNP liu_j_Page_143thm.jpg
b9b6172678717c0e5d77f3fa86f25370
3862e27fe2d9509cffa9d9129096edd7f5017901
28420 F20101209_AAAWKI liu_j_Page_017.QC.jpg
2e07b31deb2a5c69fc274cd285266351
e45b98aeb14548df8eb1c07d63ebffc0fb04fb89
F20101209_AAAXHB liu_j_Page_144.tif
fc65f5424ec047383eafe045654ccb08
2abd8ebc3d1a568bf977485476905c2ee9db8a63
47575 F20101209_AAAWXT liu_j_Page_072.pro
652f6265015fe639b9d04a50a0b3ab87
387ce89084c838e0593c5727a35a5830394886c0
5677 F20101209_AAAVNQ liu_j_Page_067thm.jpg
9bbdf413e839c29c6132e779d5cdfdac
1c6a022efb504ac7290d912a2a33d08467e14ab2
272 F20101209_AAAWKJ liu_j_Page_113.txt
77009831b8e8966641f7380ed6ad5938
df3c2363314f19c0650dae20be921aec0249f7b5
F20101209_AAAXHC liu_j_Page_145.tif
4aa20188b94ae6764e3e45425cb32b11
d03d43613cc2e4a9afa06e979dc30302a4e1019f
F20101209_AAAWXU liu_j_Page_022.tif
7bcd481b1681eda3d3336141cfdce27e
73417472807d32d2baf6626b73a97d4445c72fe3
1998 F20101209_AAAVNR liu_j_Page_018.txt
a291bbb2ed3923ecdc3083e1cfdfa812
e5114065b323af94637cdcf979a1e0226317e8f6
F20101209_AAAWKK liu_j_Page_174.tif
a435fca45c14fd77373d4b836d6d83c6
b3b84e61d8820db3a58f1ad9a9e023f8ebd10f2f
F20101209_AAAXHD liu_j_Page_146.tif
7bd0bf18887d1696cf7011fc15483623
bc2fea31984069c62768da14e812b8be2ff19af2
5289 F20101209_AAAWXV liu_j_Page_083thm.jpg
d9087b62cdf2ca541672f9c8052ee945
eb7cc8d6ec9d3fa5afac7e3645d2f01f22700cce
46763 F20101209_AAAVNS liu_j_Page_050.pro
e32fc3ab633354e5aea9f5e401c9ff27
3255f5c4e927ea877f3abcc6e7e5bc33656dc319
24131 F20101209_AAAWKL liu_j_Page_001.jp2
74c1ea7e22b8d185d2ed77e3bc18e1dd
dfbeecc3fbc26dc7216394e53bb81e30964ae998
F20101209_AAAXHE liu_j_Page_156.tif
a13da20d23d783bd212c5dd9239113df
46b4b06ae58fa64035ca64812a133eb4ba7061fc
8541 F20101209_AAAWXW liu_j_Page_025thm.jpg
b3ce0a487d40ff1636c01b99c24d315a
12476f8eaec9fbdf51d51525aa561f967c7c67da
32127 F20101209_AAAVNT liu_j_Page_163.QC.jpg
40e91ea1ccdf712e384b55b2e1d9d9b9
3e29990b25849751e1f4173653bd2dfe08c5aab6
49846 F20101209_AAAWKM liu_j_Page_147.pro
97d4de1bb1b4af51b3542d41f00e66d5
d4029eac99b82e9460806ddcb757874be1e18e91
F20101209_AAAXHF liu_j_Page_161.tif
89713e05f139c2b0940331083b1d00b7
59361a8fd7f0a5479eceeebc84afe2184c545b19
291101 F20101209_AAAWXX liu_j_Page_065.jp2
6af0f92a72a33eeaa0f9fb460b7974cf
4d6d75761fb36b945ee1392af426fc08e4505a21
1969 F20101209_AAAVNU liu_j_Page_132.txt
c0489b68033ee462173f35ac1b9051ec
3d37b6f9a356026e944afe21999e430471e826b4
14942 F20101209_AAAWKN liu_j_Page_065.pro
b2c4093496ae56838acfde7a2dd1c899
69ec466b6bf6b708fc65011f4aeda0d49514fa04
F20101209_AAAXHG liu_j_Page_164.tif
e7c3a43fcc13ef1d2fa050f71d18e025
6a2376251434a37fbcc4ebf96008a6e0d2f4ae26
F20101209_AAAWXY liu_j_Page_005.tif
6639ebc84fbb572a6ffa6078f97512ba
1593375dbd7e84ab10b134c0a89ab640f5d331f5
116451 F20101209_AAAVNV liu_j_Page_073.jp2
df8b0e8bcb97bacd6bbfe5c198b2c89d
157bf7387522d93963c61011f87f0fdbab118970
F20101209_AAAWKO liu_j_Page_150.tif
1b4406a020057cef9bf383f9ca8ec53d
981eb8e217c9c648411e4ed554d57bd06cfdd763
F20101209_AAAXHH liu_j_Page_166.tif
6aef09e273f0264a15faa1c4532c9dae
aefba291b922240335f89907e5b338188ee74f5b
88097 F20101209_AAAWXZ liu_j_Page_017.jpg
a53ce6e7265b9430b033058d2d1243e7
a5b4e4600a023e8e49bba347ea075d80b91d200a
126279 F20101209_AAAVNW liu_j_Page_211.jpg
40e50f0577d14720b1fe975fbd109c76
b7b2cbf1f35d157b59c1abdb47eee41b639f6992
F20101209_AAAWKP liu_j_Page_025.tif
c76c2fd3bf52e8cea353a0d4c9dd3962
44f3d3dee7a568b8a7210df879509630e59075bd
F20101209_AAAXHI liu_j_Page_167.tif
675a6fc0557ca5054548fead36d8b6e7
999c0d0425a45af4b543cfa3fe0b7f4defde36dd
15505 F20101209_AAAVNX liu_j_Page_086.QC.jpg
4db065d97c45efa10635730ec73d941d
60183c71423b2a812ba6687a1c7569d683e08660
65755 F20101209_AAAWKQ liu_j_Page_216.pro
9049eb55f8449bed13d89488661f3bcf
eaf005258d1fbc5064d50a0bedd09d9f487791ef
F20101209_AAAXHJ liu_j_Page_170.tif
3bbfa599130105b93d16c5ddfe1de7c7
8b8ff64899f38212f2725ad0d385449ba8f9283e
50511 F20101209_AAAVNY liu_j_Page_141.pro
9d383570448b9c170d5946c814746dce
0a3fac5107c322c56cade0eda79f6754b4738246
F20101209_AAAWKR liu_j_Page_193.tif
621ecbde6108cf97616d5bd7459ee4c0
ba31965fb226fe111d73b0b2759681e2dbf71d7d
F20101209_AAAXHK liu_j_Page_172.tif
381f4a7d90f6ba691e27eebd9fd3acb3
9b6b491a1ff1b5f6c54835a491b35d65e3702ceb
F20101209_AAAVNZ liu_j_Page_126.QC.jpg
36efe6cd863adfa171bc745379851806
140ae194a16010aedcb4f4e4c16b64c259861fb2
105891 F20101209_AAAWKS liu_j_Page_005.jpg
d606110cb73a7c04ce58ef2b07366b5c
4bdb630bf8e351b3aa268336167e56eed0191eda
F20101209_AAAXHL liu_j_Page_173.tif
3c6e7a6de98c6f53c40fba476b4975ed
8e348010acde7f3d71948cd6f0937b2e349071cb
F20101209_AAAWKT liu_j_Page_122.tif
477c6f47103cb9a85910dd172953b2df
7acdd127853a3fdf4a60f450c01d35aa63ded350
F20101209_AAAXHM liu_j_Page_175.tif
f87adc8584416aae4cf698fb51ff9634
8eebf86df0efa40ab5e5f76b795af6275127ed82
1789 F20101209_AAAWKU liu_j_Page_166.txt
28d05c9bb84254eb4fc233c08e255c0d
873ef8f79e02f41c03c1ce9ea4421c2245ccac9f
F20101209_AAAXHN liu_j_Page_179.tif
aae9278a31e8f47d5ebc8bba35191cd8
c0ede1b9845796838c0f27591b39c437997da02f
35397 F20101209_AAAWKV liu_j_Page_061.pro
2d894fa8993e484e26bd760a458e40ab
32e6abf0451d7a78e16175052b6d49ec11654f57
F20101209_AAAXHO liu_j_Page_183.tif
b0671a86330dbffebdc4c097e2bdada6
ff3392df75a227682b52e62ca2a2675fe44f5cb1
8725 F20101209_AAAWKW liu_j_Page_074thm.jpg
914a84ee6baf8e89501802096590ce8e
bd9395fed0cf2c9f3ad140e8316685ff3dfa83c9
F20101209_AAAXHP liu_j_Page_186.tif
aad08e78bc5c1008970a615e569fef1f
94d95b65cdaf7d5052cb5cd5aa4b42ee4f8fd9e7
5425 F20101209_AAAWKX liu_j_Page_122thm.jpg
65ffd20b9f3d975bb1c05a77ec5bd9e4
e4ca5d541e9d2130c1179305b6b025ee6ab22c32
F20101209_AAAXHQ liu_j_Page_188.tif
2d21e292059390632e95fc38bae9f35a
23ac84da4ed9b097cc928d1b6c65343276fa5908
100795 F20101209_AAAWKY liu_j_Page_152.jpg
3d87d5d3155d50d491e0223a0ca8ca71
341a0de7bb0385e01b7db323e02d4cadefcaa4ce
F20101209_AAAXHR liu_j_Page_191.tif
a4d2791a0d014ecbf54d8113f39daf84
3cafcc03b7e60f9bddf613d24323edf16edbf74d
138262 F20101209_AAAWKZ liu_j_Page_204.jp2
6129ec336fafa4b1bb0419c9405a7494
e22f7aa0f2e0a56b5970c1f77b50b8dcbd037ff2
F20101209_AAAXHS liu_j_Page_194.tif
76e296cd7a16bea6dffffffc02e2288c
6d8ebbf6b635ce80c0a991cb83b059238c6ae798
F20101209_AAAXHT liu_j_Page_196.tif
d3dcf3276c7c4d7413aba557d27ca788
aa47b6fda2b1a392a02faa4949b04c7a8f3db361
F20101209_AAAVTA liu_j_Page_189.tif
94a840bb5797c5b0e7ac047368e6d646
4dbbbbbefd767d3839cfe01815969d57dfb8c660
F20101209_AAAXHU liu_j_Page_198.tif
2b4265cbfe81aa196aadfb712e6bb577
7daa04fa4516f0c1cd61e2e28d4dc44b6f6af3a2
8373 F20101209_AAAVTB liu_j_Page_111thm.jpg
c57e394eaf2dbbd7555a4879467b3385
e8053b0f0dcce5376c093e1bc9395da8659c5653
F20101209_AAAXHV liu_j_Page_206.tif
235b926878c6809ad59451f24690fe33
2357540f655e077afe3f4ef0270892ec087d1677
120747 F20101209_AAAVTC liu_j_Page_206.jp2
3edf1231a7966e67ac20f00b6426210b
3992a023893e69ba7642dc069fa21b0935f02230
F20101209_AAAXHW liu_j_Page_209.tif
61bd47a24b7fd18f25c9a8c2e316fec0
b33f47e43ced9c9133e06896c181d2dfe13b428d
8644 F20101209_AAAVTD liu_j_Page_151thm.jpg
6521d4772f342b155a50e5319b9dd6d5
ee615d584d0e22da68bd60c5b90bf33fa2db455a
F20101209_AAAXHX liu_j_Page_211.tif
edc9af146fbac57ab3ed470aac38b426
d122ecaf4112983204e650b13bd53d8c4db899bc
1825 F20101209_AAAVTE liu_j_Page_164thm.jpg
6f3c9f6e4603ed5bb47540693ffbbeb8
025a805a47e095a907cf929b1d31fa0349805600
F20101209_AAAXHY liu_j_Page_213.tif
a6cb12b843b4848b32984608bb544fbe
04b6b0a385934698a226e967ad0e82fb5f325f3b
94144 F20101209_AAAVTF liu_j_Page_079.jpg
8e352572105b2da64a4b4cda6df5b962
0bfe68cdb562b6171493d58e409dd416e66eacac
F20101209_AAAXHZ liu_j_Page_216.tif
b8f8b4f098a1cbce5a13058231b856b5
a06f711092a9794cb4d99ae30e551baac9e505bd
46197 F20101209_AAAVTG liu_j_Page_033.pro
4a7015cb1b4c80154242068e7251b722
e5e31ee8008488422a17d08ac1e78761eef35e90
9169 F20101209_AAAVTH liu_j_Page_201thm.jpg
6a679fcb6e4ae0ba8628026cd8efdded
85e521d01ecd61c52ed82d43ff90e2da15dd32ad
F20101209_AAAWQA liu_j_Page_121.tif
7b6d571392a506842d2ef016d6230c23
51403fe57c921931e355be4751af8abcde51bfc4
9409 F20101209_AAAVTI liu_j_Page_202thm.jpg
40cd1c62cf3872b1c804debdfda72a04
285996bdcbcb02b56a4999b3950a11439f44c89f
F20101209_AAAWQB liu_j_Page_097.tif
af8713dc4a9ae08a5483c97e0a4a94ec
65bcb86b60ce641f3e1fd4a568a2dd87c0c8b3d8
F20101209_AAAVTJ liu_j_Page_138.tif
eccf347a111c82c3702d4b9b5a2e1446
def1008eb6f1852d76ea686462cdded91859afa8
103803 F20101209_AAAWQC liu_j_Page_020.jp2
9d18adebc793489ed1d82a9c04089ebb
4d39c9d2ced4a9e6043ff7863178f4d6eecf48dc
8254 F20101209_AAAVTK liu_j_Page_129thm.jpg
357c65b9e7e620c27a426e6e59185d4c
0d81271c5ac1904d7c1cdd5d33d0e8917bc4d24f
2007 F20101209_AAAWQD liu_j_Page_140.txt
9dc71102d757639efebb3b6e39d6c45c
876011d53d2f16dedfbfa0ed36a0f3968287503c
44377 F20101209_AAAVTL liu_j_Page_092.pro
1c1e8629dd420e4adaa30e79c7f23b64
a830298b9f167f3854f1fc3334933bc7ab773d9a
92924 F20101209_AAAWQE liu_j_Page_004.jp2
1d3a4f93c6e4948b7a724d7dbcaf21e0
9fa3eb889821a1395c3c6d79f089c746222b95d2
F20101209_AAAWQF liu_j_Page_081.tif
f0f3de8c265fdd392571f8fad2c88369
766e4849923621a0a58f84ed98b3d99e54b47a22
97651 F20101209_AAAVTM liu_j_Page_021.jp2
f1513ca681a5df18764d96e50482b224
b9dedbec7dd2589b270b8ad4ff5bd9c930f7f547
33805 F20101209_AAAWQG liu_j_Page_069.QC.jpg
580e464f46aab1d2a2a0e161db895b98
6fd1ff145db259baf757eb3a8163bff42501571f
98902 F20101209_AAAVTN liu_j_Page_071.jpg
976acba01339d86272b507c290f46ee2
12efbd0d12f857c82051f4583579dbe1cc546d9e
F20101209_AAAWQH liu_j_Page_118.tif
7d87817c941aacafadac1f7fc165d80d
54f239a7c14df5080f8a154b08c07365ed5ec880
6071 F20101209_AAAXNA liu_j_Page_186thm.jpg
a3bf2a87f01173b7f484059a292350c5
59a38eae8ad6769e540557cb9d5a9de5abde4137
F20101209_AAAVTO liu_j_Page_014.tif
7c1417ff8652c02f817daf464cf70d41
a685f88f1d610078ffdf522065e50def52283c4b
3918 F20101209_AAAXNB liu_j_Page_181thm.jpg
fc6c16ec6eabc79c7cd0716e65a25479
08c2b0cad5463cf85a49594d40f2bf6b1c7bb7ee
F20101209_AAAVTP liu_j_Page_038.tif
350af7f2bbb56f0d16adfe203ee3e269
c8d1afcde3ca2a789ad079c2af1b7965ef199f4b
3293 F20101209_AAAWQI liu_j_Page_059.QC.jpg
d03c6222311943b13cf8f43d4802ded2
aec239da48d777a77cea3de7fb42c90c2457e58b
8634 F20101209_AAAXNC liu_j_Page_102thm.jpg
921fdb57de4dc9bc08137aed9b9ef027
bea249a03f1b8043837b4472153c5096a8fee2df
54229 F20101209_AAAVTQ liu_j_Page_137.pro
7afb799e606c561c4113a1b64d385b5b
c6357f87bab88f27529b8bdbfe030f112255666c
8777 F20101209_AAAWQJ liu_j_Page_142thm.jpg
d1466d139067facc29094f1561e2ad87
425402bee7601716cab4e36475c9bcb650759322
8319 F20101209_AAAXND liu_j_Page_098thm.jpg
5813f6b6110dfbc5fa14f76579441ea5
5ced6e7d13a00cd02000e579368bfc7ea681fc51
112794 F20101209_AAAVTR liu_j_Page_053.jp2
61f8cfee805cf204977ec4b52c2bfe4c
d61c761f4b3c0c570b5ae6435a10a8c79b4c12ca
34760 F20101209_AAAWQK liu_j_Page_005.QC.jpg
c151f21c69737d8e4f4bab8c88dd27bf
8f91badabca07e55349c7440f50935db702ef3ec
3634 F20101209_AAAVTS liu_j_Page_113thm.jpg
a1196dbc7c81e9a0acad373573143a67
5785a60083f38e6a93af4c20127a08fe32204b69
2098 F20101209_AAAWQL liu_j_Page_175.txt
9681a93f70820a9546251912e70f9526
8ae12d2b6088a1ddb9e2a5309f80939d747cf6b8
33456 F20101209_AAAXNE liu_j_Page_176.QC.jpg
30649dd70aa494dd42b56e9805cc4d53
f0c7ec9dbcdcd69d1aa5f79cfcc957d3e2097703
105497 F20101209_AAAWDA liu_j_Page_162.jpg
69a5d3d0bda25c8c62462035827e5ecd
e6db47d0bc5ff1750a31bf7e8769ccc5e498d7ad
44242 F20101209_AAAVTT liu_j_Page_113.jpg
1a61865113d3b6b7268daf4f00e413fb
ca25c4165e88c831a6138fe19c4478e34addcce2
98795 F20101209_AAAWQM liu_j_Page_144.jpg
35d9aae1b30452b3dc14b3863279d414
8e188c5142f5e0a7e5b1913f8db156e0ed8d5e1d
32965 F20101209_AAAXNF liu_j_Page_080.QC.jpg
3dcdde1e5f523e0a3e60ca68e56c54a1
901676c2ed2b8c13eabafc33d4cae919be89ee42
124791 F20101209_AAAWDB liu_j_Page_207.jp2
50d0ed6f378b6a8a5deaa17e68ba0b44
2a7724351e6d29be2cf9c7dadec6f5cb032de8fb
37037 F20101209_AAAVTU liu_j_Page_209.QC.jpg
f713516e3d394d2eb5eddcb44b3a7f3b
ef64264981a84df3afd89adcfd9cd941e812612b
8661 F20101209_AAAWQN liu_j_Page_010thm.jpg
452e655748b13b0c833d64cc57d02389
f7dc20d31a720f767bfe80c90df01aeb05a85344
3862 F20101209_AAAXNG liu_j_Page_160thm.jpg
f29afccde73ad6e232e8233624b83c75
77a27f8e0e7a1c909eb3abbda3ffdfe513164d57
109521 F20101209_AAAWDC liu_j_Page_076.jp2
b7f34c85c479478cfc7d0a8e20a5f167
a0d3fe0ea7126df5c10d8ea87f96f98e0b3903e5
2690 F20101209_AAAWQO liu_j_Page_223.txt
585e3b6ca98cc1579e5e1e02e671d7c6
1c87116d89d1847c6b3516d962457a3c801600a4
2473 F20101209_AAAXNH liu_j_Page_224thm.jpg
b1eba1d5308809f6f5b4c428d5bb250d
bad3765f5ff993bfbbfbcf071268033e7d438e8a
4923 F20101209_AAAWDD liu_j_Page_113.pro
03f11c68c5a9be291f93f382422f1dbc
f4e1444cf8fcf7f363661dcfffbce12cf85be605
1515 F20101209_AAAVTV liu_j_Page_061.txt
7c11442c7747113ebacc76b11a02393c
d4aa59ecd4be0e23e96dfc81ece18b2062f52896
8867 F20101209_AAAWQP liu_j_Page_211thm.jpg
b5388f5004ae0eeabf1ad26b8c277141
05b876771fe1bb2c340a6b5cb067142e3fd116da
7658 F20101209_AAAXNI liu_j_Page_112thm.jpg
8d9323d3956e0b81abcbdd90ff0bf0fa
f5a78c2d2b6aa1dbd25ff2bc117087a050ad05f7
85529 F20101209_AAAWDE liu_j_Page_089.jpg
2f0f898ec02babce80e94b4d8dc96367
0ed003270e971f36e53d8a87e55d35568ac26164
129249 F20101209_AAAVTW liu_j_Page_220.jp2
aa18dc7110a3f91f658dae53a6a8126d
5b0ad891960281903e901b79e3c19c763347085b
34345 F20101209_AAAWQQ liu_j_Page_149.QC.jpg
7fe10b7882b54625a17eaea2a937642d
488939d5de20e727c0aba6884a103ed065fcb907
36964 F20101209_AAAXNJ liu_j_Page_215.QC.jpg
2a2011288810557aa89b9595ce8510d4
e231dd3eef60ba076569ffba393401567e319b8f
45760 F20101209_AAAWDF liu_j_Page_185.jpg
77960fa411b1d7659a7a8d04cc712577
cdf8d1a7f88e51924057bb0ea786b493767e0c89
92184 F20101209_AAAVTX liu_j_Page_016.jp2
d1a900bf7e393abf7b9b68a2725996b0
f9d78f04ba0a14281d3250b471760b18d32a7205
F20101209_AAAWQR liu_j_Page_126.tif
45e2b2f3647cf3db4d42cac61e844cad
a37c1191cd9655cb2478b759e84c74635f50f262
7773 F20101209_AAAXNK liu_j_Page_225thm.jpg
28d0c83dbc0e655a9d247340475cceee
06a388a1648ecb70cac1b18c788e25fb4f094d67
8038 F20101209_AAAWDG liu_j_Page_084.QC.jpg
1d1a9c1bfdef4eaeb37354d2b7fa97cf
90c42370f639c6669779f0663374b1b82e8a24d2
13257 F20101209_AAAVTY liu_j_Page_153.QC.jpg
bfcc1c01cfea709f7e70d5c7317824c6
7da5190f373ab92a36c11f2627664feeadccb76d
168067 F20101209_AAAXAA liu_j_Page_009.jpg
91142a1e163292850f757e60d03cde13
a5d4b60483fa2adb2dc9316355a991784e137334
5878 F20101209_AAAWQS liu_j_Page_184.pro
f69e30a9fdcd23acace1c855cab29a4c
61c8a344d193537762d4a439fbd780de56c724ff
35398 F20101209_AAAXNL liu_j_Page_143.QC.jpg
d20c034aa1d187f12b837156a0c222e9
7d4730a61bf01652053b4898b3351a4c2034e3f8
47316 F20101209_AAAWDH liu_j_Page_044.jp2
a1e89f1c018542227233ca5515e2d6d9
13561699d8686c0cd48a397d8823899f4cdf0b9c
105028 F20101209_AAAVTZ liu_j_Page_140.jpg
c4e7365e1860e93bad5104881c4888b7
a607905d09698759246d00bf0464013fa7b31bec
108178 F20101209_AAAXAB liu_j_Page_013.jpg
cbcf20cf9a285c4d88abf6f1b122276d
519a6dbc6913af62a74ccf18138c814dbac4fff1
93556 F20101209_AAAWQT liu_j_Page_116.jpg
d4b1a0349f341aa1608cff0c986c1f53
5d4e32f3fcc94fedcb3e084051de4868c3921155
6944 F20101209_AAAXNM liu_j_Page_016thm.jpg
2dc2da756e4a98fd9dfea6a8e809665e
de257af0cb3a90f5db33fdf7e947ded294e084f1
587180 F20101209_AAAWDI liu_j_Page_064.jp2
2d03bbae362a0bd2dc3e9d402caf793d
580566238ed52541a43203bf10b6bbc9ad9e3d69
76267 F20101209_AAAXAC liu_j_Page_015.jpg
3b7c2a67519f3b7ec9294e8ea7ddf393
e3fc8f72660c38bd491011d434037fecae92f642
F20101209_AAAWQU liu_j_Page_036.tif
c317790655db6353a5cb36f55611a4a9
74c1da6cba978c0ebdd01a59c3243726cff7185b
34246 F20101209_AAAXNN liu_j_Page_148.QC.jpg
b7b2d8b631a551cc3b2ef95ba40a879b
44da876d9b52119b5a384192a8613eaa9b33262d
34728 F20101209_AAAWDJ liu_j_Page_128.QC.jpg
7b4f09601df9e43bfa264bff7c9d5978
750bb482eceee55faae68efd461fd9027eb8c380
102109 F20101209_AAAXAD liu_j_Page_024.jpg
8c289bc6d2cd09a07cb7e97850cc4fec
1e9915b1a30cb81e3b8c0852f19c9ab865f75c65
454 F20101209_AAAWQV liu_j_Page_187.txt
ba1aeca80b414e0d4673ae32ce279325
79eb8fc7bf0bdc0beb40224d2cb11d2f436a5d07
2727 F20101209_AAAXNO liu_j_Page_065thm.jpg
4f9eb3384cdf76e9e3a97146677ca29f
14b568f5798348cc1033a8b5ffae18f041230108
108241 F20101209_AAAWDK liu_j_Page_143.jpg
8e02e9dd5916aca763db9f64e30e8a1d
32afe52392e366771ec50b254a5e5816b850467d
97176 F20101209_AAAXAE liu_j_Page_038.jpg
b8297d2fe4361fa3c5d2021867101b39
e4e6c3c31f9ba90ccbd8b9eaa6636fe29144933e
7163 F20101209_AAAWQW liu_j_Page_121thm.jpg
2e4ffbeb9abe7e42495e4f913f92b539
3de3471d3c3c65a74e9f6e196e63af6e7eb73a31
8385 F20101209_AAAXNP liu_j_Page_065.QC.jpg
99655995aaab965f06c6c6404ba2d4cd
ddba7aff0dc3dd0abd6de6c73209e323a6b5383f
1609 F20101209_AAAWDL liu_j_Page_015.txt
b4fe6d9523e87f6756ccb3ff88e245e1
4a5f7e1329b735a05fba3e4f8a229285cfacc818
104581 F20101209_AAAXAF liu_j_Page_040.jpg
393ab596f87e25b3d50d678cde7cdae9
16f5208550b9f8a421a5220702df382cff936b94
107300 F20101209_AAAWQX liu_j_Page_136.jpg
2fe5d2cfb8bb9a2b2cf30534cfb3a26a
bafeb5fc8c4c6652faacc01a392a078228d4f31a
32664 F20101209_AAAXNQ liu_j_Page_152.QC.jpg
db1d1956b0f38667898f35855e3e0cbd
4ad96cbd0a35db6f042a606dba02c14787131767
225080 F20101209_AAAWDM liu_j_Page_117.jp2
62f8a2c93f69bf2598c0571ac712a26a
01fd2dcdf4db56748f684fed1fe5352fb3556e95
84276 F20101209_AAAXAG liu_j_Page_043.jpg
8093b1d2db6308c941376edb85373b44
6195cb15963531135997630c18b7b8f0cc772116
F20101209_AAAWQY liu_j_Page_036.pro
6e3ad010f1898667a8bfc8f770a02fa7
e04b6e41f4e8c5c35caa61d53bd9167ab9c41542
32049 F20101209_AAAXNR liu_j_Page_101.QC.jpg
28154b441f6547bada63031ee3cae993
e8072144a01520791f15da31eb8808440d7ffc95
2035 F20101209_AAAWDN liu_j_Page_148.txt
7387c64a53db7f8596780f115bcdc90b
d6792f46c18b81d8d831b7022b3405aec3d59317
101174 F20101209_AAAXAH liu_j_Page_045.jpg
6093fc332f5ff1f518213cb569f82a63
c3247cf7f09b8e1552008cbb74d3c3d019dde620
102228 F20101209_AAAWQZ liu_j_Page_007.jpg
1a028f79583e5bbb7bf44c71aeaa0b14
622e0df5679cadc677249ed482856b7058e0223c
30271 F20101209_AAAXNS liu_j_Page_092.QC.jpg
2f962c09defa57a43d1ba7c730b54ea1
1176daceda47f60afc6a5820ae47422173392bf5
35792 F20101209_AAAWDO liu_j_Page_057.QC.jpg
64de5b8e422e38153e178a2b87b23fc6
0e7fdf88d21519f4615580d6f5c9fa771413091c
95112 F20101209_AAAXAI liu_j_Page_052.jpg
8c12ffbfd73ee2b919201c652ea34ffe
996f693915414e3ab6d07ebebb023c4f388e4c3a
33635 F20101209_AAAXNT liu_j_Page_023.QC.jpg
2a4bd0bc3177cd1258981d7c124f3f46
0cdeaab4575ed88a9889e28c6942fbcc6b6283b2
F20101209_AAAWDP liu_j_Page_219.tif
7d32bcf4697597f28b595a65fa2b5a46
12bcab1ea4f1a6cfde1ac766fe8c89c8a2bd1df0
8405 F20101209_AAAXAJ liu_j_Page_059.jpg
b0b58d32e640b59f36875ae6ca98337c
4c5b811cdad59925f0d0a5f028dbd353199f00fa
8403 F20101209_AAAXNU liu_j_Page_072thm.jpg
0cf83d0e2de3e14ed0d02a3fc55f7352
8949fe55969c3b851681fd06a942107b0010bd31
16127 F20101209_AAAVZA liu_j_Page_012.QC.jpg
ab7f47b5c54cede74a7539f3db72d4f6
cb63e0230a89e1d9951caca99af6892b290ab09d
8933 F20101209_AAAWDQ liu_j_Page_222thm.jpg
c37a5f4bb51f5c4cbdc25822582f4ac5
63a58c9e55189ad039a00bff4a0556e9800d6190
81736 F20101209_AAAXAK liu_j_Page_061.jpg
f13278f8ba048e1afaeb3816fab5e28e
8bf61701b4b2879522f43e30b3754e5d73f4c412
33053 F20101209_AAAXNV liu_j_Page_034.QC.jpg
078ee3519f87a876bc1e86ec5817d7d1
694a5b9b4f0017a29bb05072bc11be97b973f57f
68062 F20101209_AAAVZB liu_j_Page_200.pro
baaf08a37166d6a7560cce094c558ca9
2e6ab383336a7f735b26e9c30909c8a789d5d8b6
2808 F20101209_AAAWDR liu_j_Page_221.txt
c8317089151f024997450951cb209112
25d7d760bf8e67ffc08ba281b466ab35f9d6ee83
103174 F20101209_AAAXAL liu_j_Page_069.jpg
10abc91f87e0ced606eb1974253ce80d
746ba4bf395523ba28f1095893fe2b9f3d97f13a
27559 F20101209_AAAXNW liu_j_Page_121.QC.jpg
bf23135a038ecae9a80de1ab73342f5c
b809842f5f5a13ab41b38bd2184e9d7398724f87
59435 F20101209_AAAVZC liu_j_Page_206.pro
db8f98a62f8c9dcbf278b3b5091a2236
18d58b83e6c1bdfe680c7cc30ea0c5d998426a38
F20101209_AAAWDS liu_j_Page_140.tif
6ef9cc60e24fe38dbbb3b7fa97e19ef7
c5f1bb8f2bb7f094d1c80b2a267e02d91c3af9c7
102110 F20101209_AAAXAM liu_j_Page_075.jpg
3a89972b63a164dc98340f46299a5073
5e3a098167d6f6668de1e6a766e1345f082412e1
10681 F20101209_AAAXNX liu_j_Page_117.QC.jpg
8cf633b88255934d7f7e2cfcba9bef34
92a0570b5d4a22ef45aaef34b4bf0eae98bba649
27228 F20101209_AAAVZD liu_j_Page_116.pro
94ffda8bce5f96cac9425cb1f7b67d8c
f909355e6e3476843dfa8c2e5e85adf78429bff7
8539 F20101209_AAAWDT liu_j_Page_096thm.jpg
bbf81b38564541c34bb2f4e2e1525d90
4c3d0773734e3c62c5539c4a8ad878eb0a0160f7
100887 F20101209_AAAXAN liu_j_Page_080.jpg
e09dd88201195e5402d12a6b4fe434ad
d0d217a40d7e1cfd88192d446f00704ee2e5d2f7
8409 F20101209_AAAXNY liu_j_Page_125thm.jpg
6dd8fd2a410f5a65cf902f70e23c9e2d
34423261a349bb5b6b51f03f8daf9e1a6b97be7e
94258 F20101209_AAAVZE liu_j_Page_166.jpg
3ed0d672f0eea47fbac30b53d67c1d4b
165ca911e63f2a05146354f11c1675c14d95488d
F20101209_AAAWDU liu_j_Page_217.tif
1ac2a41dd9b72e7fca49be569f5f9a2d
abed1d884dec416cd966d69ca873592d903f5ea2
105714 F20101209_AAAXAO liu_j_Page_081.jpg
92751ddbf33ff2289a8795ed51c048bb
de5cd56bb5f4bd98ce00a27e3971f85298f1ea18
20552 F20101209_AAAXNZ liu_j_Page_156.QC.jpg
23da552c5ed1eda2852cbee49a301695
1ac541dd4d2115ae5e2519d099770251ca93f8ac
128151 F20101209_AAAVZF liu_j_Page_201.jpg
7f4a2b096dd74d608acc12bbbd73b9fa
9d795131e9ab9ce17587b96e5bbf9d092acffd5f
8693 F20101209_AAAWDV liu_j_Page_005thm.jpg
73d182ef22fc4445200c414b9ff172f9
96e45bcd9561a371ea5ba6491badedb54af7a40e
38683 F20101209_AAAXAP liu_j_Page_082.jpg
5dc747b5b1eb622db4a800bf2de69ae1
c86f2935e9a5e3c1eb3c80b25b6af6f5ec113dc8
110347 F20101209_AAAVZG liu_j_Page_145.jpg
d24c6931488cb1909e6f68a09a438d29
e27ca565e889e3d6cc116d94e9e05bb390a50a8f
111169 F20101209_AAAWDW liu_j_Page_146.jp2
c672bf734c8bd97607ca4ab7dd8558e7
a5318bf262ed967044432bfdd0de5d2ea07e4d73
F20101209_AAAWWA liu_j_Page_051.tif
b00874a88c6c6114c773993a97d303c2
f86adda91e1a508883fc1f13705edb981ac0f7fa
86042 F20101209_AAAXAQ liu_j_Page_083.jpg
cf42391b70e4affee934491cbe41ecf0
1462772d34c0f3f45f6bf3c6ccbaf46210a50f6b
131722 F20101209_AAAVZH liu_j_Page_189.jpg
27e1a10fa3fc955830f7ecca2b241f28
a50f58d6899a4fbb8abb92738a81232ce0f6f8a8
F20101209_AAAWDX liu_j_Page_169.tif
4e069ae51a2e0dd433e89d3728deed43
fbc6fd21879b049aa4f03cc9531b876f21b3e5ab
1325 F20101209_AAAWWB liu_j_Page_116.txt
c40822ea2dc3b55ca97683f24f472d04
d196598251cc0c1e6b5186404d54bbb57f6fb818
91373 F20101209_AAAXAR liu_j_Page_085.jpg
7401b40bce085f4993e76ae484e35e75
3e3737b9a23f5e740ff81691af53ea343875ad06
112302 F20101209_AAAVZI liu_j_Page_094.jp2
ed36937eb828204d9142f1c7a66985de
5ea9ee72f77bbce43ff53220f49b2d8b0678e7fb
8076 F20101209_AAAWDY liu_j_Page_103thm.jpg
43a08f2dd11537b7a0174970b67806c7
23d0b9276fb03b449acb42c7577c4397839898eb
9323 F20101209_AAAWWC liu_j_Page_214thm.jpg
1085c494991f5baa587ccbf80ca5e06f
7288c41ebfefc044d70f80b46d451e5fdacaea3f
104791 F20101209_AAAXAS liu_j_Page_090.jpg
821637f67f66adcfaa74fb577d0f444e
e69f87f2dea87169103d2be92a5ad5be6ecdf3bb
32353 F20101209_AAAVZJ liu_j_Page_045.QC.jpg
d028fe5efb13df02e4933572f22a43fd
94392541087c218cb89226e42552e7b2f62c558a
2604 F20101209_AAAWDZ liu_j_Page_196.txt
7b5f76107917e05bb1df735166a56c08
10f9910c31d3664cc74fd1aa22c5c87a624be7d3
113001 F20101209_AAAWWD liu_j_Page_100.jp2
3cb6126a6b89968b71108bc7a64adf69
ca91ddbf3279530a524ceaaa1694b928163714c2
104267 F20101209_AAAXAT liu_j_Page_091.jpg
240c9e5d8d9d37e1f0889cb40aba0cd6
53d2e567e5eea2207df6a39b3620d34eca639d07
13407 F20101209_AAAVZK liu_j_Page_226.QC.jpg
af0441480c1271b2f86279d83389de98
18ccfaa7f90409fbc8fcb10b555561b9b6caf252
102495 F20101209_AAAWWE liu_j_Page_098.jpg
1edff45525a5326f21e65987929ed517
faadb4ae2e15abaac89c27a5cc5a7ee1f986dca8
102571 F20101209_AAAXAU liu_j_Page_093.jpg
e44cdcf5a7ad58be89fad78b25a5e406
167f4c0894d756e8d360a739840fcf74f9e1cfff
2069 F20101209_AAAVMA liu_j_Page_130.txt
8044b00b2e8238680553da9977991b76
084d412b7a66353f6cf72d41d96e12a175c93e05
106589 F20101209_AAAVZL liu_j_Page_056.jpg
3f2169033b676b245db6c358d4c4ef5d
bf4cd23b46e875a0d3e0fbafb523454270c9f398
F20101209_AAAWWF liu_j_Page_080.tif
2b521881ae3c608ff137b171c1c9cc50
c9c09bd1e2d90574330a81ef3a9ab0c189614c55
102435 F20101209_AAAXAV liu_j_Page_099.jpg
bd5e32fa1e02194f0ffcae9fa0608fb5
149fe8f35c8ed829072c019658fb157454191ca1
F20101209_AAAVMB liu_j_Page_113.tif
dd783b4eeb6e4be92ea1cacea1f26305
2ffa6c10f930f7100cffed744f0189306bb2b309
8483 F20101209_AAAVZM liu_j_Page_149thm.jpg
2d0cea93e7240017534fb79c57fa980d
6f102131462f4971fa666bfcc78f60e11f097cde
F20101209_AAAWWG liu_j_Page_136.tif
68e8454e93a3ffb3f1fc42f4e787b6a6
e5c26af23da35cbc7bc3763241bdbe5e2138a1b5
107283 F20101209_AAAXAW liu_j_Page_100.jpg
d052cdf2f0cf8fb723312fad84ba2875
698dacc2a8ef9156f8e39a60700776e92dbfe5cb
F20101209_AAAVMC liu_j_Page_110.txt
a34358f19cd95ac0b4a4bbba8f4143a1
20e615754c99b7a38062d11184ff38efebc3857e
2471 F20101209_AAAVZN liu_j_Page_203.txt
e64011339b9aab091478a3ddc68a3f44
be9b71c19f30ebf30dd865e3df7c85f158b808d7
8363 F20101209_AAAWWH liu_j_Page_135thm.jpg
8de7e27e72ef4974f27ad48cf2e535c0
33ec1abc0c6b1d2029906d05eb12b81b2e7dfc87
196810 F20101209_AAAVMD liu_j_Page_047.jp2
58259725992a6307d42b0e128e82bb9a
a34a3254d2c49d0d68888a0892984c7d041f292e
101777 F20101209_AAAVZO liu_j_Page_023.jpg
83f8a3c2e4da196ab3f92ea198133e21
e89d0265a5ebce33c59ba834d64d899635db0533
2059 F20101209_AAAWWI liu_j_Page_107.txt
4dcff62dd9e35693e010af77c44f18cd
69816f36ec72bb837f65afd985b3e875fc456877
98946 F20101209_AAAXAX liu_j_Page_103.jpg
3d5f21b0b304f54d382a7c275a0ae73e
d26f07eea0ed0121fc23241dc5779c56397b9442
1029 F20101209_AAAVME liu_j_Page_185.txt
74743c92b7bbbbe8c9148828c7bc750d
24b596c7dc6c5a3a7e6a671c38426fc01cab8038
F20101209_AAAVZP liu_j_Page_215.tif
97c5345e8716665eb7bcea9be01724d9
6d313efe25a6a658c24e0883675bba6c180d6c3c
3458 F20101209_AAAWWJ liu_j_Page_153thm.jpg
6c3ab5a9fdf15561179cd52df159ab85
407c86d0feb6f9142a3cd90eca843e47aeb0f60f
106785 F20101209_AAAXAY liu_j_Page_106.jpg
5fef78cd4bea2c0770df8a478d21d490
895d8d7a279c5c2633b3ef8935a5e359169e90ba
F20101209_AAAVZQ liu_j_Page_086.tif
bed2136dd6e55a3b3ee3c0ad6f9db61d
b34cb77d6f6017b0b195d32cfc93a8e70a308bb0
8519 F20101209_AAAWWK liu_j_Page_124thm.jpg
7f193c08de60e6c3ebf6be83022f421f
ab063dfef844240396c2d4e0b3ef47a57cc8f35f
103938 F20101209_AAAXAZ liu_j_Page_108.jpg
6a7e62cb0fb6ac0866ebdb4dbccff0f3
e7060b2df6674d277774505dcdb52b9a9cfdd2bf
12798 F20101209_AAAVMF liu_j_Page_161.QC.jpg
82e80038b70f11ec10a1ad74add2089e
6500d6f0b47a8d69368898d69beafc413494bb02
52550 F20101209_AAAVZR liu_j_Page_151.pro
8e3cd3da02ca22ed82c8c1eda01275eb
ac587bd0a43db436fc9dd9555921f2b941722e03
70570 F20101209_AAAWWL liu_j_Page_067.jpg
ebda4934787b1950ada05142c2c75eb4
5d16c38d6ddeab25825a2415f13be3ab23e3cdff
34334 F20101209_AAAVMG liu_j_Page_040.QC.jpg
c00bda503b59e15d68eadc48b332a9f9
94977bc3343b3ef0b8161635e27b3573a756c0f7
106305 F20101209_AAAWJA liu_j_Page_058.jp2
0287e5b100fdaa30034fd127186dbad3
a0653c8b2bc13786417b347dc41e89cfde46f8b3
65724 F20101209_AAAWWM liu_j_Page_212.pro
00bc87e9b11ecef3ff901e6811e397c9
4035072c667e281ac4427fd8f5da37cdf4b42782
106233 F20101209_AAAVMH liu_j_Page_148.jpg
1ac3fe0a9e04035c98e247807ba5e25f
08b08f33c8e773a5576c0abd21cb70fb3b8c86f1
17211 F20101209_AAAVZS liu_j_Page_086.pro
79405938e0f2cf4dae934f18b2c977f6
445d896665deca0312dc5116bb51e5d77fb6f2ba
1726 F20101209_AAAWWN liu_j_Page_089.txt
236343f01f1c64d8c43671fe6877c905
fa5bda48c668f43fc34f88a931e44164220978ce
100733 F20101209_AAAVMI liu_j_Page_072.jpg
3c605c2ceee4b3f0674c524bfbfe9caa
75c9bd04a40a62990265420ae88a3021e0aa915e
F20101209_AAAWJB liu_j_Page_112.tif
b649a22e67b6251f4bfc74f93e9323d1
d9d5da93e686615d45f37c10c43c1b2937ba6ffc
102607 F20101209_AAAVZT liu_j_Page_109.jpg
4111e09a02126c35d539f3c80d69a698
006f9452940fd4ddd512b2a056cf2bfc55d11ad1
63573 F20101209_AAAVMJ liu_j_Page_095.pro
a19d00dc6d72feda1700e8c2f7d53061
0c943acfd74ba974385687f6b8b545168eb7e82d
F20101209_AAAWJC liu_j_Page_020.tif
12eaa36e6c3164d4ef0e61b463ded4f1
a9bb847033b2839d783c7f230598299a8f3f8603
2453 F20101209_AAAVZU liu_j_Page_192.txt
884153d9734ce73443498ab82b1a98b0
143585e49cc936c984e0c7858a02d7f6f07162ba
782 F20101209_AAAWWO liu_j_Page_062.txt
f1ae69f2e5686943e9bfcd7e46664ae4
26063ebfd79ef4632c4daebff0f39ae271ef34cd
33699 F20101209_AAAVMK liu_j_Page_039.QC.jpg
fd55023ca5088fe2eb63a09a0bee766d
83bb6020ee0b0bbb2b8db787559571046bf9ef8e
3289 F20101209_AAAWJD liu_j_Page_226thm.jpg
6af678a7a89e4b15eb03197a3ecf34d5
4f10fd16dce2b03660a5573d7339f1658ca1a446
21421 F20101209_AAAVZV liu_j_Page_114.QC.jpg
074817f3c844860fa97d12d595a6d76b
1ea978423a68aa888da43c31e2a351554aed6f45
33349 F20101209_AAAWWP liu_j_Page_147.QC.jpg
109955d5ef3f98b667a91124a7480982
0bbb41b83ab828be2a78dcf0d434d5200d67dcbb
15090 F20101209_AAAVML liu_j_Page_179.pro
2aee44f795bafc69931c232b248c7bca
03c36d0dfd062f2a7b8964c938f211ad4918ce85
111142 F20101209_AAAWJE liu_j_Page_091.jp2
78fd373243fb9b8aac4dccfe9cfc34a2
782858563961ac768aa086fde9aea74accc42b8c
34315 F20101209_AAAVZW liu_j_Page_130.QC.jpg
c4e7d668514d99e1c729fa2f29f42223
f3901e940c2af25e837271e11c3dca9266179c44
F20101209_AAAWWQ liu_j_Page_096.tif
992ae38f3026174d9322eeb6207b332e
b35c069bc830a53520b2499aa98c8e386e74abb7
29891 F20101209_AAAVMM liu_j_Page_068.QC.jpg
01e7f486e11de3e9bda06ff10246a2bc
49a7098c42329ae83a7d8931780d5df401b18287
36848 F20101209_AAAWJF liu_j_Page_201.QC.jpg
91100bbcadb2a2130a17d442c2594906
5140c9a48fca8d2bb382afbf2293a4da72092a03
1934 F20101209_AAAVZX liu_j_Page_080.txt
e642620cd66f24a11ae8fe244a5effa9
bec0a6bab6c34834d4fe2276b9dfd9ed87a62ed8
107997 F20101209_AAAWWR liu_j_Page_173.jp2
1fefec015a9cc773007e5f58974208c9
e74dabc7318338d3c3c73eae07856f4677daf9b8
107748 F20101209_AAAVMN liu_j_Page_098.jp2
744fd0da3b78c065f29aea3ef891306e
8555b2e0acacb73200ff81474854c8892a39b17d
6975 F20101209_AAAWJG liu_j_Page_120thm.jpg
40ea606b1a13b1a3d5a9a0cb77c31489
1bdd52ff0dd4e7db83e39ce52309eccc83cdf05e
68171 F20101209_AAAVZY liu_j_Page_213.pro
5cf14760f532838785eee59e04e70dd7
c2397ca106199489551252b3d9d304b97f4b382e
92542 F20101209_AAAWWS liu_j_Page_092.jpg
3e3d6a1c37fdf219a8bff8d11ca6ed72
d809ce4a86e08c6a6b3c1656b2999de62887ca05
8429 F20101209_AAAVMO liu_j_Page_173thm.jpg
3add2b94a83e0897fe95765fd9c244cf
161365385a7519b39d913227147d6bebd1e82643
1993 F20101209_AAAWJH liu_j_Page_069.txt
315a74a49be89d36c14cc18a008580ec
501cde7432982327bef603ef33be18fda6bdfdba
F20101209_AAAVZZ liu_j_Page_168.txt
3a8ddd620dcba80a2695ebc5ccf1d619
66617a66309f5938bb01b05f26b2e2da598488a2
F20101209_AAAXGA liu_j_Page_065.tif
8960a7aaebdba80597db614ca79c2554
20531d5f1d01b5bfda870abab20b24230e50799a
1949 F20101209_AAAWWT liu_j_Page_023.txt
0768060f4a4326cde8ee90296c692e3c
46eb0b66dd6eb50ea5ba5933d46fb579c94da711
F20101209_AAAVMP liu_j_Page_007.jp2
ada251fe739b9cf10fbbb73969fed238
7ef378e8dc01a2813b854fa2583c6d7218671b45
112264 F20101209_AAAWJI liu_j_Page_124.jp2
c36e0f18ab2898d16307dd12f62fbe7c
15505adae95d372c4f9a4fa39de6eb9ae8e001d6
F20101209_AAAXGB liu_j_Page_068.tif
44e056710232c1a8be7390efe90c9435
e729d7c88d5a08139331cd2b2a5743f732994ccb
F20101209_AAAWWU liu_j_Page_048.tif
a0157bde194f5f2f2810f462fc255396
4f569ac6ed5a4bd7556f05baaba1e3ec5e744fb1
35981 F20101209_AAAVMQ liu_j_Page_060.jp2
7df54bd4d389806c66f748f380cf1df8
c7fe8fc69e466ea791282a571ed3316032a28f7b
31716 F20101209_AAAWJJ liu_j_Page_033.QC.jpg
f8b99e48afb807f7a6c13b26e8eab93d
0ac0560b0c57d4093d9dc01dd86e86b6409199fd
F20101209_AAAXGC liu_j_Page_073.tif
fdaa152edba33f8104cf075ff2b5c1b5
43a9ed85ef086cfc7f648ffcc3eb27f5be8d5ac3
47870 F20101209_AAAWWV liu_j_Page_038.pro
a50a3d9c4874fbd67c0b6c587ebb104a
76dec76c91e5138dcab406eee1fd331862f81997
F20101209_AAAVMR liu_j_Page_212.tif
96ebe396f839274c1293568d2a23df96
8fdab03fb65a984d3182aaebc6510c42e6266f2b
956381 F20101209_AAAWJK liu_j_Page_085.jp2
2faff197aedeaff884995c85f40c1aa8
1c15c38915b7b109a013a9ed398d561fe612f2f4
F20101209_AAAXGD liu_j_Page_075.tif
593bcb13aadb677ae58cc8ea55689cd3
dc1d07d8754c5d9a8b1fdd734cf2070c84cb0bde
141712 F20101209_AAAWWW liu_j_Page_204.jpg
5167b9e331d9983c6b1377031cf54ae4
705824821f6d13d1c13ad841b3b5a2259b953050
52776 F20101209_AAAVMS liu_j_Page_028.pro
a4e26bca03817391571e73ae4338690c
65ccda4a47bc8762eee62b60818ddff5e1f323fc
F20101209_AAAWJL liu_j_Page_124.tif
ab6f8fd300eb88ac54ca65aea64452a9
ad2bdbbfa0811526cce1703be5f27d97533c01f1
F20101209_AAAXGE liu_j_Page_076.tif
973dcc688aa530f0ab70738c3aa3c00b
1710d0b8124f60331348a7f54221e3a848193b81
36240 F20101209_AAAVMT liu_j_Page_197.QC.jpg
1e81f35fefe14ace48560779ef544a53
e00d21e4348a3d22528b30c81cf7dfc67d3657db
8311 F20101209_AAAWJM liu_j_Page_091thm.jpg
2f2fe74df62afbe9e004d86df513e769
d82eafc4ce3678a6afae4e54d00f1aa492ace609
F20101209_AAAXGF liu_j_Page_082.tif
05fe6090b8f1ebabde7f41d122eb7a1a
f05e105e973ff4dfe83c09ff0b94997457668593
114033 F20101209_AAAWWX liu_j_Page_019.jp2
dcccded6c58b46dca9c1f008520ff3fb
1dca8c1107624ddf4eb7fdfe493ec3bb03f4923d
1040098 F20101209_AAAVMU liu_j_Page_166.jp2
268cece33922405cafb87adc32452934
7b12d34a65a35668cb7b1c8ea00c0df032321af1
78671 F20101209_AAAWJN liu_j_Page_186.jp2
8581efed9932ee45bef2888909c6726d
51362336a9be57e5b513f2cd1aeb91f077d31557
F20101209_AAAXGG liu_j_Page_084.tif
27581f2cc4068a81b5b82de5d03cd88c
c0415ab32ff9561daa3b6ad1aad836c8dbb0385b
1051979 F20101209_AAAWWY liu_j_Page_045.jp2
c95433522c45d10b3e789ad321ae658e
a1f562bd7155d381879de358bdb1a067a65ff070
50107 F20101209_AAAVMV liu_j_Page_034.pro
9368684d87d1ea4f2981d3494681dfb2
377c76f1ecb2d0122eeb89ca28059bc0d31955b5
23448 F20101209_AAAWJO liu_j_Page_186.QC.jpg
d90b136f1c0f6804be11ad85f6e7ef1a
1f8cef1d048972152a82c1e64dde4ba3b301b7cd
F20101209_AAAXGH liu_j_Page_085.tif
0bbb7f843c5aa025a0f3c4ee7208048d
5f472e99ff978e89e698b606a80857678f80bd68
133421 F20101209_AAAWWZ liu_j_Page_219.jpg
f2aea8b0f48aa731a4e9c468ef8db3f1
de46603452466b5ac3cdf4d91b58bf9e4b5706df
8359 F20101209_AAAVMW liu_j_Page_108thm.jpg
697808eb6ed751126048885e6c368065
067dea845320bae8f9dd70d29b894d39eca72c41
43236 F20101209_AAAWJP liu_j_Page_006.jp2
c76e1f3b5dd4cd731dc4041ea23c7563
a08d3be729d6d24e928de2bff036c5e7195af09f
F20101209_AAAXGI liu_j_Page_088.tif
9a76e75383b614b605bdf77a4a3135b4
aa1394863888a13b12f5cce16c9ea0f6c8b7fc2c
22868 F20101209_AAAVMX liu_j_Page_015.QC.jpg
32cfeb7b0e7a37f77ba272d8bf84873d
a85d9a0008ac94e9cbb00df9ae1350beaa263f2f
86005 F20101209_AAAWJQ liu_j_Page_016.jpg
8b2b4217ebd6979909ed31ecc78b8c45
46120e84af5f2e3b469c612a69503c25a0e409af
F20101209_AAAXGJ liu_j_Page_089.tif
4270390814c9cb29fb0114f1b82899a3
0040e3edadafe3289147ecddc5d58ce27bf8dc1b
F20101209_AAAVMY liu_j_Page_004.tif
786372ae87d654bad8e256a1d6af5fd9
eb28191f0d220eb2328bc8319347884d93e3e5b5
25930 F20101209_AAAWJR liu_j_Page_187.jp2
81ea0b731105ba4ad0e2ede6a1fef162
4cf8ecd149d53bccbf63caff3fac9387c92efe08
F20101209_AAAXGK liu_j_Page_090.tif
937ccbb374d462ec635caf89c9bc9c57
1e8ffbc61e6cdef4d02665c7c78f5a77327c3237
F20101209_AAAVMZ liu_j_Page_187.tif
e48fe55d873c2e4a6a17dcc44371a917
526d72f7f127d516f9dd6d3977253294bd00cadc
92090 F20101209_AAAWJS liu_j_Page_123.jp2
8f56cc3ed65d081d0af9a0056b3f6f89
ac1c41dde8238ca0fb575255057bc172c7f7feb5
F20101209_AAAXGL liu_j_Page_091.tif
d1ccb7db30afdd4689cb3fa953902d67
ea9378c696f647c1cf106f5ffae499383d11a158
48549 F20101209_AAAWJT liu_j_Page_064.jpg
ac9f286c269cfd8745ca7e57f52a61e0
da76e55c91028f0bb58369f5bf9ff3fa4d6143f0
F20101209_AAAXGM liu_j_Page_092.tif
928c7413e5462dd3339aa12dbf78542f
136f82caaa98e005223ce87175ed62c82d11f5d1
635 F20101209_AAAWJU liu_j_Page_224.txt
101e6612c23b7a2b87fe3c5a7125be30
ae5337eb3194936810959b07c18ce9f025fb842e
F20101209_AAAXGN liu_j_Page_095.tif
7e202bd4429c581a9baf9f55f7161ebc
4d4eccab2601364a306fe42b449d8d4c36dd7c51
65838 F20101209_AAAWJV liu_j_Page_208.pro
0f771649954e1b0bf2fd235e23e36f2c
5f5cd2782f49c86b7ea047ccba30036ee7f7c209
F20101209_AAAXGO liu_j_Page_101.tif
eea787848f77b3ba93efe22b058f4244
af62821e412c901ed7b51f8591998273efabf38f
F20101209_AAAWJW liu_j_Page_070.tif
8aa2d94aa281eee6f31b3ba43334e7a3
8beacbfa7dd57633f6026075ff8c087108531c03
F20101209_AAAXGP liu_j_Page_102.tif
03457ea6f0f40f2ca208dd8a480560f7
30c7a04bcbaaf07664a6895e76f78f8f677e1fa4
F20101209_AAAWJX liu_j_Page_099.tif
d8064ba43cb84e0094a05a19bade3a09
5d2152341715e97aea8183a2c7308598e42b77f2
F20101209_AAAXGQ liu_j_Page_103.tif
d9f634cc68e7d7b99721518a676b41e8
c80ca824fd62cb27c8c7a01a8140e485904d03a3
1041 F20101209_AAAWJY liu_j_Page_159.txt
a5971f8f610a6e83fe468b00f67a7368
5f6a8ed204b24228a6eee0a816bac371b4f30518
F20101209_AAAXGR liu_j_Page_107.tif
ea8d327534ea36c719e1ebd49fa6313d
9d472ca66e0c505ec64d721c742c86be59a5c5f3
86249 F20101209_AAAWJZ liu_j_Page_159.jpg
b62fb9ffc08ddf1335c1df43adb812ad
0b4c1ece41c9aae87d96a7f4923872859a662a16
F20101209_AAAXGS liu_j_Page_117.tif
2a5b6b4cf6b48fcd6e74b13d721f8112
0e0824ae53705c78afc65f0270d2635db9a723a4
F20101209_AAAXGT liu_j_Page_119.tif
fd886bbeac6320bd2bf5fe328b0721a3
6f576010b3291d5cace813245bf30994472aba7b
130237 F20101209_AAAVSA liu_j_Page_222.jpg
099e540ed062e0f93c0d675ac58fef3f
93e736d7bfdd4b919e60dd88bf4ebfb8cd921316
F20101209_AAAXGU liu_j_Page_125.tif
d138eff4c9f58089ab2132b455787b2a
b552c7cca1218421ad2ef37668868475894ac997
36678 F20101209_AAAVSB liu_j_Page_096.QC.jpg
3bc5cb03c7bd8639d379bcae2003f13e
38c3f5b0fe8d37ee8ea862e93617d4c590c84cd8
F20101209_AAAXGV liu_j_Page_129.tif
c79acb5f1402d6e25c3086cbd9ca2002
59b910b7535c5918f07f7ec69f70f6e49c8fad23
F20101209_AAAVSC liu_j_Page_003.tif
cbcb3d505bc4b1457ee4ee45957db2b6
b2d876745af03079db517fd20a49987ffb4cd149
F20101209_AAAXGW liu_j_Page_130.tif
1d07b1d8f5fca1d8407e91faf047bdfb
92a752f3850ec0359e980768a74c0dce5aac3685
42535 F20101209_AAAVSD liu_j_Page_048.pro
e14882563affeaa6cff8bec1ac748284
8cf21a5f690554e19e473d79e8bfaf82c1158f22
F20101209_AAAXGX liu_j_Page_135.tif
452b401e9060307a41ac1cc284649960
582df958ce821836a9d492715b9266eb6788660b
2005 F20101209_AAAVSE liu_j_Page_131.txt
4f0cdbf23755d147557cd1b467143ff0
d1e361f0743dd68e8ca2666e98f8094dcaaeb490
F20101209_AAAXGY liu_j_Page_137.tif
0d4bf97a627232bcf4bc4c77bab697d7
adde873f3fea4d445743cd06dabedcef50245eae
1987 F20101209_AAAVSF liu_j_Page_026.txt
1c618d7882b786bc6cdc5d27bf4176d8
62e4f1ce069e5a80c0790091afb603345849c1c0
F20101209_AAAXGZ liu_j_Page_139.tif
4fcb88176e0412b107cd9086fe32ccc7
37861c93c4b4daa5ea72dacb4a3fd732d4150bd3
33157 F20101209_AAAVSG liu_j_Page_072.QC.jpg
2f2bf9f0f7fb0a1b0cc9cb70162939d1
d0b4a9daada68beee4db3d2bdf73e11667e39f1a
137940 F20101209_AAAVSH liu_j_Page_205.jp2
cd24a9bd191ec866939227e0ff1d7282
cd62594c0060c578ac23b44666b8c30879b4ad52
32924 F20101209_AAAWPA liu_j_Page_026.QC.jpg
a23b3ae12f2711b0329b5a551a519ad0
0082e814bf0892019374a6464f3ae0237cca9ba1
107467 F20101209_AAAVSI liu_j_Page_174.jp2
467c6c30d71048afc3924e0761539544
4ddbdcd9994fd9f6a5dfeea735ed26390b1bf04d
2694 F20101209_AAAWPB liu_j_Page_208.txt
d3087f790f3ffb20752a010f63ce8c58
fc5af9decf9a8fde7a1993e356efc40a3813726d
F20101209_AAAVSJ liu_j_Page_218.tif
9238f42cd135b4360e88536fcf9e81c6
930d7e6eeebd20850f1f33f58361d6797c95e427
25873 F20101209_AAAWPC liu_j_Page_065.jpg
a57b3226be7276447c8ebbed8d8cb9f0
dd818756a160b7e9c8fff8d844b55145b991b17c
110801 F20101209_AAAVSK liu_j_Page_141.jp2
61771653a17d8a5995fd6242b1e45d6e
98fbc9eb9c83ddea323d39026e0ade616480e16f
4495 F20101209_AAAWPD liu_j_Page_044thm.jpg
1a515e1c5d9f685a4466e60f9a4fc0c8
c1337d00d364ca371f80d8da8a2caee324d8a5bd
8324 F20101209_AAAWPE liu_j_Page_130thm.jpg
79873be9fdc677cd15a51d6391725795
bea83d168e299c3e24b542197d29f60cb9602b70
5521 F20101209_AAAVSL liu_j_Page_155thm.jpg
ce80efd442fe3bd00173afcf0ac94e0f
4d55f83ec3b1e016a9aec0f3390ae2d7281d9793
F20101209_AAAWPF liu_j_Page_024.txt
1ef725c20ab4c6d7f2727c4f4578f3c4
b83f3c3b31ed4e695dd3a57089e2d28491224cee
F20101209_AAAVSM liu_j_Page_171.tif
27c2ae0921942bf7c40cd4cb02713dd0
8931f75f5ddcbd654bf8a612f37e82e7ee5ca581
8982 F20101209_AAAWPG liu_j_Page_196thm.jpg
fddb61c5aab24d453c0df45c3b8c3a21
481ffb0305d662ae0eadfff9739bd0e140861c6c
F20101209_AAAVSN liu_j_Page_087.tif
cf39d2897a25605c90d54a626f80c79d
c902474df7eaea2ca0b87116a4ff17e6c1215e5b
1596 F20101209_AAAXMA liu_j_Page_165.txt
dd328c3a10137c4476cf878a3ce580bb
e2cb2b2d06b7273f3093a2a90051b701ee10cf0e
33905 F20101209_AAAVSO liu_j_Page_104.QC.jpg
65e335be0e1f701b9e3aa84e34f3b095
bff16f62c28564dfed1404c1f2a6dbaf847a5363
8734 F20101209_AAAWPH liu_j_Page_197thm.jpg
83ca3aad8e4737753ae5d8bbd6006692
083953b85e5b24eca166ae3dba821d4088acde72
2019 F20101209_AAAXMB liu_j_Page_171.txt
0ac90a67c2096b89ab74c2d9c025be5c
c2bc8aedfa5f85ceb3a8d45bc3410f605534855d
16488 F20101209_AAAVSP liu_j_Page_184.jp2
e1bddbfb84d89f8f361f763d1e432e6a
0901dce81dea10466a59536c1d92e9a308bbb283
98717 F20101209_AAAWPI liu_j_Page_138.jpg
9da04f71113710d44744c4b042329dd4
b543467be9a08f68b1e8c08afac26bded9565901
F20101209_AAAXMC liu_j_Page_173.txt
8e1066d9eaa2b8d7b59f80bac6ad0a26
7ec3ccf8d487da348fcf706dbd2bd93423b462c9
108730 F20101209_AAAVSQ liu_j_Page_053.jpg
a3dd8359abf9661967ab903c3f843c34
48822f4e1fa93884b452ef3b849a81f86eeb343d
36714 F20101209_AAAWPJ liu_j_Page_217.QC.jpg
dcfcda64266265cf8e3c4387d8aa999e
ff8efa72023fe633f45dd99e1a4a54474a81eec1
107544 F20101209_AAAVSR liu_j_Page_093.jp2
a8f77ac99476e8382e1a513e5bf05655
cf09f88ceb0b9c5b1156cc974e462a1b62877ddc
32331 F20101209_AAAWPK liu_j_Page_103.QC.jpg
5bd13bc7e5d2b6d5b150e48676aa8660
ce2ff8362bd08fccaa6a4095b0ba07c115646338
2006 F20101209_AAAXMD liu_j_Page_174.txt
9c47b7f397656b89f239b1a026d5fa2f
caa558a94e129b3c757b5b3979f045f7b1b54023
35544 F20101209_AAAVSS liu_j_Page_175.QC.jpg
c7cb0f138fc3d7136f85b50fc6c54eb5
58e6d74f13ef5101662c34072ddb8a19018db61d
47620 F20101209_AAAWPL liu_j_Page_178.pro
46f1e36dce956c4e357076276cdfb377
636af4335689073c76f4af1195ee0b271efe73c9
2012 F20101209_AAAXME liu_j_Page_176.txt
865ee4bce7777dc6a323ff69412fa538
171e6d5e60949d010baf950ec323485603b4f955
F20101209_AAAWCA liu_j_Page_105.tif
0b3f3a44da398808c8645993dfb3acb5
c5985a4dcde03b8cec16abd98061452fb87b9ed0
11599 F20101209_AAAVST liu_j_Page_160.QC.jpg
ff02d1e677721e25b13fc21e8b033efc
d9caef4f808b3abe47446ba0ef108eac14487583
F20101209_AAAWPM liu_j_Page_168.tif
c1ec7f5409f09761799c9c190ae74ef7
6c2f3b2bbcfeefcccdb2591c90dca89437e0573c
F20101209_AAAXMF liu_j_Page_177.txt
6ee7fc3449209e60dc6a6c37b6ecfb75
123cd41c94f7be7a44c648e339e8fa8776d0b345
705 F20101209_AAAWCB liu_j_Page_082.txt
d457ca529da22292551473d4f8a429f5
b3e6bd17750c9d6b484c811458bccf1d8b487f91
13000 F20101209_AAAVSU liu_j_Page_082.QC.jpg
f8dfcb829bfd632f98378985fca474b1
124e2b6516d785a2a5846d06cb41800dc2788e1e
33390 F20101209_AAAWPN liu_j_Page_173.QC.jpg
75540d9e49ce5f8d9a281aba27d954fb
ac881127ccaf458072d453377d679aeca71b33a0
682 F20101209_AAAXMG liu_j_Page_179.txt
855aad3349e1d28fe3638ce9a84fa795
33152db632e7f9ddfcb8c5886ad86c49e076db0e
F20101209_AAAWCC liu_j_Page_010.tif
d80ec2d24c1b3a9f484bcaeeb8c2196a
fc2b337ef728cdb30bd7822c7844202677e098b8
104926 F20101209_AAAVSV liu_j_Page_031.jpg
a5dca248934cc7ed94c192d228ca500a
67abcef22c6a2122a5857fc2b08832980107f7d0
256 F20101209_AAAWPO liu_j_Page_011.txt
70e4dd43ad9fc09c6aa3e8858254f426
b9b443c594ccd70b77a597a52e7a3b4e45be5292
731 F20101209_AAAXMH liu_j_Page_181.txt
b27cdb5594385a787bd62db47cb3b355
892bfc847e64fb984706d94828971e9c57faf2f8
104868 F20101209_AAAWCD liu_j_Page_134.jpg
cc8a1e82cb0524009504b2be65b4a909
93645acad7e12d97eef3e4222f3412d4c5ead787
108835 F20101209_AAAVSW liu_j_Page_135.jpg
a2a94ab4f847e09851cd2371ca3df7cf
d47c9fa1222a94397b09e6438146538c04f48ba5
63325 F20101209_AAAWPP liu_j_Page_066.jpg
916c0ef5b06a72f340fc267f68d1a483
ba23baeb9a23cf1dba8c97933e976d592e0e2ad9
308 F20101209_AAAXMI liu_j_Page_184.txt
5714d0c86b02b69faa3336786324c5d4
f7f8b78cc6f8ac26d1a82fbe7980f16936ed8dc3
28020 F20101209_AAAWCE liu_j_Page_016.QC.jpg
a2afae276b75c02a0fc1fbf01ae9de91
2c6ba496dd41aeabe9254a1ed1c546572965dbed
23001 F20101209_AAAVSX liu_j_Page_083.QC.jpg
c3a3e8c7ace01a55d0c2f48ac5188b28
2ea67b4f94dd7f0f293182f178459e36fb4b0a38
66562 F20101209_AAAWPQ liu_j_Page_156.jpg
26c9ea1e7067371d9bcbff27b261541e
f0c9eac4b234fed8c5c8ada940e157efd7b6a8a9
1510 F20101209_AAAXMJ liu_j_Page_186.txt
ebda1c66480dd06728d62a16b8f0ac7e
c810b391223b190d9fc0c5adcb6268d4dfae1a0c
99894 F20101209_AAAWCF liu_j_Page_078.jpg
5c21943b337762087022755d5ede6c4e
13a2f220407bf72d557a09a9f1fd7f2a733b9906
F20101209_AAAVSY liu_j_Page_094.tif
afc55c16df6cde549e22b1512190e711
24490b039f21c200da43ab1b45f70454789ad22f
F20101209_AAAWPR liu_j_Page_027.tif
218391ec815858f93ae0df0c6284c40f
7f277af7ec2b8a08fd12a16819ecd9a3d0001f6e
2493 F20101209_AAAXMK liu_j_Page_190.txt
9fc6945ea8ec00e5fd77148a6201d2d8
080bfb5dadd307cc22db1f6cb4bc128d6566bff9
36821 F20101209_AAAWCG liu_j_Page_208.QC.jpg
d78885438934c7f53c56c8a25a90cd7b
6d017fab6b4e4405c2d02bbb016e59c6366e0d23
2125 F20101209_AAAVSZ liu_j_Page_013.txt
9a399d1513b17ee91fe0eb1f1f057b0a
8f9f443400baff635b2767e2c136252e4b1f3984
37145 F20101209_AAAWPS liu_j_Page_212.QC.jpg
ec94269d534ea8911496a261947358fa
da03b3cf0c679b67a6c762c56f7fae57245d63f7
2837 F20101209_AAAXML liu_j_Page_193.txt
463b26feb8109f6ee5ebc04f7a514d64
099d0f16b160840fbc6158e3237f1185a04f4c43
9037 F20101209_AAAWCH liu_j_Page_191thm.jpg
e3555b03161c04eae9cca54492578d12
f9bc9c0968cfa51c68c1802e9e6ff6824b816fe7
90956 F20101209_AAAWPT liu_j_Page_021.jpg
8b5e25167bfb94d7676183f1623bb786
c3ed687a0747fb3acb184537e542a396f5f7e8f0
2350 F20101209_AAAXMM liu_j_Page_194.txt
2a9b2f6bd00b4dc43425b3920d367978
5e5b28523f1e04d1494c2f106305e697eb8d7f54
8479 F20101209_AAAWCI liu_j_Page_008thm.jpg
6a4dc5b48505a0083d5edb538754a24e
ab3b951d918c92e40db03de0e33f5f91d1114739
1813 F20101209_AAAWPU liu_j_Page_079.txt
efda932874ce10503d86b39bf92ff561
f0204437672bff47faeafc27abf0c8a640a35ed8
2742 F20101209_AAAXMN liu_j_Page_195.txt
5879c5cc5b5a8045c09ab243750b53f2
e4dd1ee8b58ad3779efd381872fd0310326046d2
133797 F20101209_AAAWCJ liu_j_Page_215.jpg
deb7b20c618bf3e7765fd856cd73beeb
a077450f2465a5a5f9b6354bb9ba97e13f6dcc54
F20101209_AAAWPV liu_j_Page_108.tif
8370b423d224cd59253b1d2f99f569eb
1fb4be804800624232dd3039f593d8c826193f39
2610 F20101209_AAAXMO liu_j_Page_202.txt
79045bd2ce714206a7456ad2c64a1ced
e2b9b3ff8c303ba527af732b2d04cf2359cbb431
1975 F20101209_AAAWCK liu_j_Page_109.txt
cf1e19f31423cdb3261705d4cf4607c3
8c96242500fd920f08ae41d740da78f3a21c9693
F20101209_AAAWPW liu_j_Page_041.tif
3376cf2b6a1413fddd869033266c692d
c9b4f6f0c9e10e7c831c11da7fbaae2152cb7084
2821 F20101209_AAAXMP liu_j_Page_205.txt
0c7a2222fb9a3b2e5ada7a5192df544f
e497596ec7b2709087916d3014f7e349e4ce18c9
51328 F20101209_AAAWCL liu_j_Page_127.pro
018b53f8622c7db67b5d048cb3b59ac1
bb3e8d5328ddda424d6db62b85ece7de758ec409
51404 F20101209_AAAWPX liu_j_Page_030.pro
2cf036ec33ea09d68dc3ea6cd4382f93
04267f35fe996b81cf6c88c040d4668d97c47f97
2586 F20101209_AAAXMQ liu_j_Page_211.txt
b650c5e61ccc53feb18373b8c1e4051e
524dc58c5e4df7ab134e6c8f75b6e650ddb0f111
1879 F20101209_AAAWCM liu_j_Page_178.txt
91ed5aa6dad8ba9f820869f23b00887d
0e1c97050e8c74d8d8cf0bdaa28f2b879fdb4797
8812 F20101209_AAAWPY liu_j_Page_207thm.jpg
e851d986f4c6e5828e85e74848a49153
c1b3f9f9b3bdcffee9f5c9172c44bdc8840f511a
2799 F20101209_AAAXMR liu_j_Page_213.txt
6dfa36ca4b02ec94214fd37bc437e62c
fd8de5b1d2fbdd7740eaf7353134b45f79e326dd
38098 F20101209_AAAWCN liu_j_Page_200.QC.jpg
159f196fcc59781c1e576e9001ac88bf
938f23df82684282f55665fa7b1f7f454da8c867
F20101209_AAAWPZ liu_j_Page_181.tif
fae193ddcfeac0330a94179b393d58e3
b9d5a5c02698a1e5dfc1c4486b43c761304d2e1c
2773 F20101209_AAAXMS liu_j_Page_214.txt
108549778c18402505dcbbceb59044d8
d7db84e242dfd32ec2746ae32fe4b61e0202b958
32001 F20101209_AAAWCO liu_j_Page_041.QC.jpg
e7693ababe1c131708782c22b911ae4d
5249fcb53ae0a1e67bddf86e20b1c30247f8dbde
2633 F20101209_AAAXMT liu_j_Page_215.txt
3b39d6bf7632b06b90d935028a7b24dd
158539c7d81c1d6758ddba50ca5819d41ef8487d
F20101209_AAAWCP liu_j_Page_204.tif
2489e2fb7d5f0fc94e4d70ad92775a4e
6373108eb08e81a136637a386c779bb160268fb7
F20101209_AAAXMU liu_j_Page_216.txt
6a9cf83c82bd28efe2ac557c29bc0efb
31788ed3682acab92f0d4821a03df9e8334be279
36037 F20101209_AAAVYA liu_j_Page_145.QC.jpg
6e5b35038655a9d823e6aef2c3975153
07d0acc601f1b322f8c79a407aa5c03d2b664c70
F20101209_AAAWCQ liu_j_Page_149.tif
032907ee517e82477954c989a7b93a69
52c9013e73cc4c0a68bf313b108288e00b4eb823
2557 F20101209_AAAXMV liu_j_Page_217.txt
2d7b2c619a6fc8c347ea586b5bdac61d
217cce112cb32c7e387108953b5251d6efc34c0b
6443 F20101209_AAAVYB liu_j_Page_154thm.jpg
c0cba94c7157fbf98e95d5058c0d5e93
0df92a8adc89c145d2b6b5127de757e96e2f164f
107225 F20101209_AAAWCR liu_j_Page_070.jp2
26bb46bb4b30554d4f3b5df8fa256095
e248001518f12bceca83cb2cb412a7cb160b4858
2697 F20101209_AAAXMW liu_j_Page_219.txt
da309304becb4f9997d384324a439b51
3d1a154bbf420678e70f374f8a9d70bf0c6a6884
50744 F20101209_AAAVYC liu_j_Page_069.pro
84a0b84ea0f1aba925111f783a32657a
4c2754b97c86bc465a6be1616ca73eb30b9e4282
6545 F20101209_AAAWCS liu_j_Page_043thm.jpg
f75c33e70b39525c14bcd64bb3e92ec3
bf89ee5a778fca63fe7f40e35a70fc7d0b58309e
2559 F20101209_AAAXMX liu_j_Page_220.txt
f3d8d2acb1abca357b86d0eec0ad7592
d805641a63fc8683fa6a577daeef162254949eaa
854528 F20101209_AAAVYD liu_j_Page_063.jp2
d13f8ca5d6759137d1bc250f21a4768d
1f931f110fa1c4c3141f2a40458fb7b03d09f3ef
F20101209_AAAWCT liu_j_Page_197.tif
2f083c93cfb3560eea9871ab7bcda2cb
3c54f9c98bedd80f8f759408e8b2b1924877b71d
1877 F20101209_AAAXMY liu_j_Page_225.txt
aae232d7ef1ed89d0e14f132989aaba3
b51c0ab681376edcd27b61215e67073856137dd7
96472 F20101209_AAAVYE liu_j_Page_178.jpg
68b9299dead872fb8fdbe23b62e16fe1
260eb081c2d281ffa1ce2aa3e5941d63a93aa0d9
F20101209_AAAWCU liu_j_Page_037.tif
71b9c51fb5c03821d26cd832c44f2b6a
301cf6b5774a0b2c5d83774711bb8fc36c34b7c5
30729 F20101209_AAAXMZ liu_j_Page_162.QC.jpg
d6dbb248837caf937f9bb5664d851026
b480fd71d438bdfd924c11d5516fad27c7e8906d
F20101209_AAAVYF liu_j_Page_208.tif
eb04a37c9ad4ff9ece4cd5f5a4259d8a
f74e430345736d3f47c48b27f2181058f94eae5f
111317 F20101209_AAAWCV liu_j_Page_150.jp2
fcacc94f90ff7bce983e03ae40565854
be6458b400ceb223a78841569b5768cb2ba40519
50802 F20101209_AAAVYG liu_j_Page_106.pro
9427f1246357c1e49a81a61a47598563
4e51582327e25a42cbfc30158ba6584464f913de
35964 F20101209_AAAWCW liu_j_Page_015.pro
16510ce9623e0ef6a3354d05f38d4299
1247f1129b6729c12b4b68fa35c956544bbb80b7
F20101209_AAAWVA liu_j_Page_078.tif
d1c6de41c1d5eb4dbac0ab9b327adfad
f457e8e37f753c295658c1ff718aa1f5d1ec9c34
32074 F20101209_AAAVYH liu_j_Page_071.QC.jpg
db482c5df562a42afc7af7e2669d2a21
ea27cec942d02ef82b670bc5baab75d9d018f1cd
3137 F20101209_AAAWCX liu_j_Page_117thm.jpg
d14187c2f24ed907e68eef592ff01888
667c188f5bbf57d902e98ceb9303eb4b1e889c7d
50061 F20101209_AAAWVB liu_j_Page_132.pro
e14b12c5cfecf78db77e8597a5d775f5
5e102740defe4f74b431783f8f56719a89a68249
46842 F20101209_AAAVYI liu_j_Page_225.pro
282c81bc0c52bfbfd4699b61bee9d668
4209b5c60236e939e6d8549da7e9c30a9dc1e30a
52319 F20101209_AAAWCY liu_j_Page_145.pro
68c8bf694591dadc7f09430519b144dc
28e26858fc06d7394df5488729e993c6cda14c80
33195 F20101209_AAAWVC liu_j_Page_027.QC.jpg
67704a77da6be1de2814c626c0f79077
121538b296f215609209a108e3291268fc6bc88b
16233 F20101209_AAAVYJ liu_j_Page_184.jpg
5329b6dbe4e68a639c7e4ec34cba6436
b71db876953b01de5cc5cc02f6f3add507f0cb6e
2017 F20101209_AAAWCZ liu_j_Page_136.txt
9974b046af11b1d682b23cc94f4a1027
88da63efc7f355d77cf4bfb99f10b59f41e2fd51
1051975 F20101209_AAAWVD liu_j_Page_162.jp2
66351cfd95c066945ae97b3682756cf9
8580645c31822bf91669e93675da57ce758319b8
135294 F20101209_AAAVYK liu_j_Page_210.jp2
167a573637ddf3cb9d309afe72011c8b
33fe1cabd2128625ef5020f8037178ab7415896d
8411 F20101209_AAAWVE liu_j_Page_169thm.jpg
358b7189b4471356cd529317a4e9c469
45bbf7520bc493f4b9eeeef40234558010107b71
17570 F20101209_AAAVLA liu_j_Page_082.pro
0723ecead7087d6ecbd5b20b61a3efbf
0401d5e425dead0e94a9ed3199782b6a02996858
49645 F20101209_AAAVYL liu_j_Page_075.pro
641018784101b41731d4f4031e749359
adeccf6f17295a87f1f800c8c41d784646994fde
7255 F20101209_AAAWVF liu_j_Page_003.QC.jpg
64041dd7f4fddc04517ba41b70dde17d
0b86e3c2cf3b38b2e65ec260099e1b47d5eb1cc2
1051964 F20101209_AAAVLB liu_j_Page_121.jp2
dfcf8d11cf5ed4c3f631e23f587ad8f5
a5f89db7098cc46ae708318c12971347f7c29dda
8369 F20101209_AAAVYM liu_j_Page_176thm.jpg
e2f3e06e7672c74e1a03e222bcb890d9
3ec7891a0e8ee6f5415ce91923c21d5b8842b4d8
49295 F20101209_AAAWVG liu_j_Page_111.pro
80372e2ae8e284eb64e2c14819bbe2a7
93f3f0dd9ef246bd6b46b23836dafe870d56329c
41105 F20101209_AAAVLC liu_j_Page_016.pro
60cc405ca8b469546943050649266f24
25fba40e436045136a726a273e2fa4c993b8ca07
1020 F20101209_AAAVYN liu_j_Page_180.txt
2ee85d5f4bf13048f2bb6d94b81d81ac
aada7b9fde21cd3fa0b6166dc129f5f22f333def
F20101209_AAAWVH liu_j_Page_104.tif
50b293b30007099ab46c06daa94f5f87
af5750401de5916bf35757ca6a80cce9778e6ad2
34640 F20101209_AAAXSA liu_j_Page_206.QC.jpg
8029e0daa6a1a25d1810614fa512edb7
25c268111f7dee59ce351f7613213b6f1d4e0977
101736 F20101209_AAAVLD liu_j_Page_178.jp2
2a1f92ced0cc6b3f73ed331f0c92cf0f
adf19f36b060b71957e19d33bfec2e5561c66448
127205 F20101209_AAAVYO liu_j_Page_222.jp2
3a6ee609a735c3843be6474e0814aec7
d7b45c33ffa965bb27710b95253fa06e634d6500
2754 F20101209_AAAWVI liu_j_Page_096.txt
2d79841724908da43effcc2934d11db1
7a1e8765ca7ae4829074f5fd46b1f02b2b8589ac
8902 F20101209_AAAXSB liu_j_Page_208thm.jpg
ccf16f7490dd091e57e7b4dcd1088a3e
731aaef65510304422d122fd07247aee980d4523
64153 F20101209_AAAVYP liu_j_Page_202.pro
b7faf5fcdb056bcc88e4e49621120f5e
7f1e0b48b9751d2da4e19d1afdb794042dfb96e6
122393 F20101209_AAAWVJ liu_j_Page_164.jp2
fc6e42199143d27de09b3d59751855c2
eac628660a86127c297d332729fb7d1613484751
9161 F20101209_AAAXSC liu_j_Page_216thm.jpg
b212843ac54721e76ce61d84da3f7652
738d7af0dc762e2b7e890c8083ae80974538c071
31591 F20101209_AAAVLE liu_j_Page_178.QC.jpg
9fb79c04306361a18000b222905e0ef0
3427d27508ed9823295598acf8f7c876a5bd303f
44132 F20101209_AAAVYQ liu_j_Page_068.pro
771c7e28ac71ff35dcfe9013752faae7
21911ad9801b29173f9abb2105c219946442eebb
28398 F20101209_AAAWVK liu_j_Page_119.jpg
a3aba31ed22247ea97277f232c116a7c
848216d88cf690ef424c59528a3d53b91ba59601
37319 F20101209_AAAXSD liu_j_Page_216.QC.jpg
3004477ea63afa991354bd4bd959236e
3ea9540e605db8c8dee8ee079f66c57f210079cc
34060 F20101209_AAAVLF liu_j_Page_098.QC.jpg
b405e76aae2aa17f95de23d5a1daddbe
0dc6b0fbff8ccb3bd3ec7a293f80ef46124ef839
7036 F20101209_AAAWVL liu_j_Page_060.QC.jpg
105bbbfc4373247e2ea2ab69761d0933
7ff74e6399353d4838d340d91ae4e64979cd6018
9072 F20101209_AAAXSE liu_j_Page_217thm.jpg
2fa475b72d5ad03e59cc59f89bc61752
84b4bf0e74d1566b8a39f46b1bc0dc8acf765f0b
13635 F20101209_AAAVLG liu_j_Page_006.QC.jpg
93611e99aa5811b4c5a9b6ad6158e9cf
401ce4b2765e3a023437a577a48d322f210c75ce
8294 F20101209_AAAVYR liu_j_Page_099thm.jpg
ee85cd4ed54a4add23e5608053026ebc
42cbde857992ff2ecc912c9f4c872bedfd90257a
40826 F20101209_AAAWVM liu_j_Page_082.jp2
0bad9ad6f4215eee7397219733336ed8
3a73400d39b65cf7488718a7edcfae6da79843da
8805 F20101209_AAAXSF liu_j_Page_218thm.jpg
9b945e922c293d5dc94cd106eb8977aa
30518b0169e930af02f9028e7f9ddf1a098f9603
8332 F20101209_AAAVLH liu_j_Page_023thm.jpg
105f110da2443fe8b4a62eb23a52e970
5d8e7a0748f67cf8dee300774f5dd8ccf5a94b55
67727 F20101209_AAAWIA liu_j_Page_214.pro
3430f9add06f88b4f0bd151262565ce3
08dd34754566205295c070cfa46775010ba743d1
1948 F20101209_AAAVYS liu_j_Page_078.txt
9eafb741d80ce7083004f93b917ceede
2c7b33567593889c745bb5530209791c70180028
F20101209_AAAXSG liu_j_Page_220thm.jpg
bacf78059bf51ea3be116362252bd2d8
45bc9101e7c28a8a078e8edafb2d4e67e8a1c9cc
131088 F20101209_AAAVLI liu_j_Page_196.jpg
b525e5db0e842fb0199dc9c8c6cab31f
e1ef8e9df6d361339925e7bf18ee222df66ba062
8569 F20101209_AAAWIB liu_j_Page_036thm.jpg
08ff35e88c5df8668ad889ac48eb848c
e9c6026fab4f3c09ccdbac935e7999f08e89858f
1871 F20101209_AAAVYT liu_j_Page_112.txt
564fb165fe189c3077dfe73f10e98985
0552cd780dfaa1c953d84ad77c62ca970950496a
326 F20101209_AAAWVN liu_j_Page_119.txt
71d90b41e9335d7f1b9a2bf61dfc79bf
956de3dc00a794de66e9393735d205bb2a27045a
36439 F20101209_AAAXSH liu_j_Page_220.QC.jpg
3f5181a612295b07a5273057137b39a9
d625ee78c0d29cbc40175e89e73457bd2231ab12
6483 F20101209_AAAVLJ liu_j_Page_118thm.jpg
c4c9c4f43bff4d13b167575e6b59317c
698e74c2f6e4421ff7f54af1a558d806c39a203c
1992 F20101209_AAAWIC liu_j_Page_183.pro
451e1bb9505047e00813cc205665c578
a8b2f328cd41906066a0b1743c7c244fd02ce77e
F20101209_AAAVYU liu_j_Page_067.tif
e36ede22c835068e45b8c0c3b77f9480
8babd486bf34631e6ac48e06a18c30e7512ac7b0
106156 F20101209_AAAWVO liu_j_Page_057.jpg
f20224baa2b05759ea8db2a4de53c99d
8892e88b7a5d4810b2d52fa56d68ad2a7b2292b6
35966 F20101209_AAAXSI liu_j_Page_222.QC.jpg
b650bc0a591cf94482819b67cfc6d0e6
ced6f48a47dd3ed6d87fb9d271e93ef4504a34d3
112650 F20101209_AAAVLK liu_j_Page_110.jp2
4c4dfc7404c7e8187daf86c7a90e22ac
9a495c5d49031195fc49a69aa16a0c20efcba05b
110984 F20101209_AAAWID liu_j_Page_018.jp2
ee790283d07fcf5bdbe62f961882fa4b
3dd357b994a49b82ac466f63cae16810f341ad4f
96035 F20101209_AAAVYV liu_j_Page_225.jpg
8ddd07b3a5e798c0337988158c5a68ea
cc714c9dac12f28f8c40749ce64aebe15da7966c
F20101209_AAAWVP liu_j_Page_159.tif
cf887f65d5958bda6804795f7bd5bdf4
5d8068ffe3a82e12db56cf0ce6609ca9ba51765b
F20101209_AAAVLL liu_j_Page_100.tif
276ebf15b39ba3b89062b78f43925dd2
ef915c1ea6944f5e20e0491534a25d40443442bd
33572 F20101209_AAAWIE liu_j_Page_108.QC.jpg
4d60f59181f994fdda7b7df1b160c861
33cc1b183da562de289754feff4d87a246eab14c
2036 F20101209_AAAVYW liu_j_Page_031.txt
e752f0ec4db1c4477357165cedca30ec
faf40290f8c4369f7bfc9bed5491b0c5c9fcd493
701 F20101209_AAAWVQ liu_j_Page_226.txt
ac73dfe2bb9df99efc33b9c501eb1503
a52dc9de6a06e6aea507b377769b8c4d0384b379
37305 F20101209_AAAXSJ liu_j_Page_223.QC.jpg
90aa5c4753b9c83dcf47eef18c591dd2
fcfc0d52b6d4b166405418e862180f527d516793
8551 F20101209_AAAVLM liu_j_Page_090thm.jpg
610ae9e6b4375ab7b32d080f9fda55d4
009f9006fcf53bb971b7234fe4853ac0b6297a6f
36182 F20101209_AAAWIF liu_j_Page_053.QC.jpg
1d1782b8140337f18135d9dd2d5c4707
4dfda2c944efc13a7bbb0883fb24f7643272090a
F20101209_AAAVYX liu_j_Page_021.tif
19aefc1e290d29b2b36f97197cd11eac
cf901c7720c03ef53b33d861c0743218a3b6a6a8
129647 F20101209_AAAWVR liu_j_Page_191.jp2
5eea9c799c36ba324202bc9c510c31b7
b1fc8ad7395f25582802a3510a2836dc1554b62c
9845 F20101209_AAAXSK liu_j_Page_224.QC.jpg
081eb9a5cab7723da2de7ccb013fcf82
9fffb589b338b54e1a5a3211b3e3cc5b6d8bfdb7
1855 F20101209_AAAVLN liu_j_Page_068.txt
fe3903737bc8cdecb7051476706708a3
c077c16b686858763bc0a614744f661855594be6
73332 F20101209_AAAWIG liu_j_Page_063.jpg
4c3398f8dbbe04fa40b8cd6fcecb8b3c
c447d0eaaa497625be68a1dbdc5734b1cfea360f
7474 F20101209_AAAVYY liu_j_Page_079thm.jpg
068aa623b064eb16bb247c6af250c364
53bb0b9616a8f19d9bb6a5a3eebebf61d3d70e56
51810 F20101209_AAAWVS liu_j_Page_168.pro
30375e3488a68ceaffb37f0469d49d5a
1aec258750ca0f2d8b373215c1d917abeb85f795
31162 F20101209_AAAXSL liu_j_Page_225.QC.jpg
41e34410280c568b28f98c2e1ee593a1
d2a4edc6cafc4e686834132d2ef7069ca801f4ef
101761 F20101209_AAAVLO liu_j_Page_049.jpg
db362fe903f5e3035df7ec8586befdbd
70d2e2d01b536c25731acf2df0b86922a015d6c5
F20101209_AAAWIH liu_j_Page_116.tif
9e7bb9c7f63e2b0654d7a8d9f2a63c23
184c07da0bdfeea2e8e40a50d4bee3c7cdbc07e9
40897 F20101209_AAAVYZ liu_j_Page_089.pro
e9ae97c4905d7ec99a9d607e8f0b17e0
f55b6d115febddf9a581c42f2426e12fda9300ac
135785 F20101209_AAAXFA liu_j_Page_200.jp2
d0a95f6d038f8f3eb3005d0c5170e2fc
cd4457129dfb5b8fb1690c8457211c9b853f94a8
131375 F20101209_AAAWVT liu_j_Page_223.jpg
354b08044cb58f88fdfb12864a003efb
d750ee87adea22fefffb4fe64bd1f24dc41ba0c4
38740 F20101209_AAAVLP liu_j_Page_181.jpg
8f00ca83a82853642a8017897d17ed80
0a867ad8fa4e6a61b4e3c38218b95f712e7cb369
2345 F20101209_AAAWII liu_j_Page_060thm.jpg
ee12061d78c257cac3316179bd5e5fa7
d9539117276a5e1eee08da4555dccfd9102eddcf
128537 F20101209_AAAXFB liu_j_Page_201.jp2
224e28f9ca15848e38c309d811f7a41b
7e045e2e4130bafcefacd18422a5ddad7c265e6a
2144 F20101209_AAAWVU liu_j_Page_142.txt
8fd077b272a2a29462ba74fc57a640cc
c1f219d428350573439591353006c1bf0dc1e37f
48678 F20101209_AAAVLQ liu_j_Page_139.pro
2e7c88a6d1e6ce686e9a86bfdb3f4be0
1d852ec06c5571854c970ff1c517e86d862f847e
F20101209_AAAWIJ liu_j_Page_210.tif
4f85d8916b400961470f1bdf4ef89004
003b756969d05da750e4665dd01d8b5b354737c6
128691 F20101209_AAAXFC liu_j_Page_202.jp2
409caaf607a2cd517f5f1b4b432a1eb9
c1d4007f6fe38c5d1292a7814bd4cc1d916cb3b2
95678 F20101209_AAAWVV liu_j_Page_048.jp2
8da1e9fd4b0801259705cef93ed4d2f5
e3306ddd99cc823d6ea22ea4a4fc6d37a14838cc
F20101209_AAAVLR liu_j_Page_017.tif
27b83aaabdbeee10b962bc38cca8593e
eec4fa7ed5df21aa7e3dff32687c5b0bdc899092
88008 F20101209_AAAWIK liu_j_Page_123.jpg
57630bf4d2151cdc73329b0d91896260
159e7a5fdf5db1db5a1d9969b3033462bc2de724
135375 F20101209_AAAXFD liu_j_Page_209.jp2
a62ffef8314877579a8ef6a2f2d21980
4f65c321bbad7a5a6a0f0ed6b06fe568cddf4b6e
97799 F20101209_AAAWVW liu_j_Page_020.jpg
2c123ac56e343d98f62e7533d8b739e7
e0743b0da253269ec9a2dad4573f1525849d6dc0
38619 F20101209_AAAVLS liu_j_Page_221.QC.jpg
8ad2f00a0077e0ce9f4a5d21cc8bab33
8684f9811333eab499d4089842716b0aebe230dd
50394 F20101209_AAAWIL liu_j_Page_090.pro
1642a730923309e8f4dd9180d2f425cb
fd7aa1a345e24c651806a73a3470d2ec370166c4
128348 F20101209_AAAXFE liu_j_Page_211.jp2
4d2957f59b2a6fd9933a8c98541753d2
2bd9b0dbaa25e130fba08a4bdc86ff63c4a44866
48705 F20101209_AAAWVX liu_j_Page_041.pro
2573f8d129e530b94987d5fe311d3a0f
ab8c0ded8e12fa5e64eb7bed25118c2712ed93e1
F20101209_AAAVLT liu_j_Page_147.tif
2aa01088790f60f4d3d1009750edf6e9
4d90c786ec7acd21bc33ca7ba1a052f71a82bb22
108690 F20101209_AAAWIM liu_j_Page_108.jp2
367bef86a109b6e779db09bab931897b
4aea6c1b0c66c1a813f151ba4e37ed1affddb12a
137489 F20101209_AAAXFF liu_j_Page_213.jp2
5998c1608445410a9f8c7c9fa16e86f6
585277fb65b4331779d679b1875dc3bea3298b81
934677 F20101209_AAAWVY liu_j_Page_155.jp2
de8830f1e959967b249d0d2b57118aa2
bacaeac2eb0aacd2f9fd6d50333ccf47c7ea642c
7028 F20101209_AAAVLU liu_j_Page_017thm.jpg
415b74bbd4b1d771195f1fb549c5ab0f
a91a53b5467224381e3f20825323dd258f197cb3
8425 F20101209_AAAWIN liu_j_Page_107thm.jpg
b5c814d76b2c4ab310418d6264fafcce
bca7e2ae7666129848de9fd56dd180f42589d498
131604 F20101209_AAAXFG liu_j_Page_216.jp2
845440c16e925dee3744de873517218b
e7bc820fc8c78d4b582c3f8d96c196ceda43480a
114806 F20101209_AAAWVZ liu_j_Page_125.jp2
01bdcd78a359cc52f110898bc0b93d65
3c987afe6f1bd094691f54e1a2bc02cb993c0c6a
35362 F20101209_AAAVLV liu_j_Page_107.QC.jpg
c5e137fe46da998c66da9b7ef8384400
3b004466de5f87b083a6d108cf99a28306c46952
2700 F20101209_AAAWIO liu_j_Page_209.txt
51b033df1cca28996d8eb22f43a4cc3f
13bd965f57dd7bf8331fdd9d1dfe578fb5fcec18
F20101209_AAAXFH liu_j_Page_009.tif
1adfd44b22e22efc55fa8670e2eddead
40b84e7d967db54a78bd328d78295c92fa2dd43d
95612 F20101209_AAAVLW liu_j_Page_068.jp2
e1637e3ddbfc4d91058fd3df09fb1b33
621876a9b65f80ef99005ca4fa15e7f7f8ebab4e
34398 F20101209_AAAWIP liu_j_Page_146.QC.jpg
6fa92335f24fef6f593473973958868b
f29e2c81c45b7fbb2c3b15a8337f15fabfd90450
F20101209_AAAXFI liu_j_Page_012.tif
7f5bddc7e68e32c431221bdf4fd8977e
f11e8359f97065a94e73500ca03e70988d1ad5ac
2503 F20101209_AAAVLX liu_j_Page_218.txt
590137f7bb0613e3efeafdb07e2e4c64
488819acb41b05f2c601ce44b69b5f2143843c82
53675 F20101209_AAAWIQ liu_j_Page_025.pro
59d45202bca0d66d6e3294d944b65f7d
f16bcbd6c6735bb23a243554af6599ca2ce953a9
F20101209_AAAXFJ liu_j_Page_013.tif
3b270a1cc706c7f596acca8f6e76c2d7
c3b48790d769834748759bc3d6aac2b9e7447648
46002 F20101209_AAAVLY liu_j_Page_120.pro
3a9f0af826560251640329297a0b78df
6876cf14a396ec2a3ccd14cb2577bfa144806656
69240 F20101209_AAAWIR liu_j_Page_205.pro
6bd530abb3a23846912e2e9c0c651316
a1b847bf03ed07f47d02e47cf6ae890443b8da30
F20101209_AAAXFK liu_j_Page_018.tif
b9fbe31fdd180cc3e1fb6cfb391b9a98
97144ae7fccf7b6051d7be44a640c83f57e73e7b
477211 F20101209_AAAVLZ liu_j_Page_113.jp2
13d1886ed1c7ca96c156b9acf4814e18
5919a84d05da96138036be6db1d941bd275582c3
109902 F20101209_AAAWIS liu_j_Page_106.jp2
e5b250c81415da10bfb5b9aa6c9b8634
e463e812d3198f7139fb06b3116901626f02a07c
F20101209_AAAXFL liu_j_Page_019.tif
bd4ff5dbef31f8fac1c6506e562b20bb
bd8b08b5c59a1c660bb1187191c4bbbf62b354a5
8406 F20101209_AAAWIT liu_j_Page_094thm.jpg
4dbe7d33ca9c8088ce84f421a3a3ed14
b367becc1887aa548fe9d02aa3f7be4e321c3f5c
F20101209_AAAXFM liu_j_Page_023.tif
3161caa0a84de313af02cbf81c645662
94652096537bf30da0b13181afdb63643c115bcf
109089 F20101209_AAAWIU liu_j_Page_171.jp2
28dac6761e0b4ccad5a0b27db3878411
62af144b982e3bfa62d131375e82d8164b18b6a7
F20101209_AAAXFN liu_j_Page_031.tif
a54a7d9062f6c7035a0518f574c98bf0
4442dbc2399f2a83f7a4714a9766f84ba4377829
36253 F20101209_AAAWIV liu_j_Page_102.QC.jpg
f08d179ab85bbc2dddd00b4e7febdfd9
ecc8ff38a711884ad626de097d643ae170586f38
F20101209_AAAXFO liu_j_Page_032.tif
c551cf97dc949af15be75b0bc0d7fa6b
c4969ab5ce7472e6caadf6766f490798a92b3a8b
103991 F20101209_AAAWIW liu_j_Page_030.jpg
a0aed2e9e7840ebc5c787fa56968296f
c21e7a3780fa6201edb140b11da3add3392d0369
F20101209_AAAXFP liu_j_Page_033.tif
c8ce50d3b3c75be5aac543f2d00c17eb
b0ce92a147ab8b9b2c27e12fb4f40b6ab6a827f8
F20101209_AAAWIX liu_j_Page_221.tif
2074615ce06ffc5a0525e604e495c642
89857b3f8ccdcb23ab2b10321843bea3d510dc6a
F20101209_AAAXFQ liu_j_Page_035.tif
a3c62ea8bd2080ca5d0a287440a03b47
a082c2719e8dbe80c0b7b27c7214b0a786a28746
97880 F20101209_AAAWIY liu_j_Page_041.jpg
df5bbcf7a71ae244cd402fb3b8fd1870
bcb21b9cdacabec60649dcb9817aa968b2ba9c18
F20101209_AAAXFR liu_j_Page_040.tif
ad6086f04483688c3208498e5c6a517a
bee66d629d30162e7d5f3e5c9fad510517f91782
F20101209_AAAWIZ liu_j_Page_154.tif
ba25432bad45e3daf73042eab81f2444
9cc0f79266cd8fcfe472bf960edbc597ac362de6
F20101209_AAAXFS liu_j_Page_052.tif
e4af02e544ce82f7be45933ad1e97b94
750f3cbdf380cb7faea1200ede6ff959b735c4bc
F20101209_AAAXFT liu_j_Page_053.tif
1bc5f7a54048570e6d6ac61c5145e7a0
81ab07eb73f975c1c9a465f532341b2236fa059d
105268 F20101209_AAAVRA liu_j_Page_051.jpg
bcb3648690fc566d5e304f6239a0d68e
eb48b3b5edcd416abb905873e2706ed0d9cbfded
F20101209_AAAXFU liu_j_Page_059.tif
14585e02733f46a79ae6c2a3bab13b66
541df515165349eac58ad3d74dc00e82f9a9b566
107099 F20101209_AAAVRB liu_j_Page_026.jp2
4e494cfa9ccd86ff16b9820e036679c5
8667f9345bc1a9f3f72632400bde805bce10cb30
1054428 F20101209_AAAXFV liu_j_Page_060.tif
0f3d4ff6ebcccd6be582f5b77645699d
294bd1abb777249179c43bf17e881100ce03d2bc
F20101209_AAAVRC liu_j_Page_057.tif
e084a5d53ff85577112f35a489b9230b
ecee07a85c2d5c4e72ea81c303733ec7915f57c3
F20101209_AAAXFW liu_j_Page_061.tif
81d7b01f90f42636c209d6602f0a2a0d
bf0c37d17b2a564742106638b71754091b90e016
104408 F20101209_AAAVRD liu_j_Page_144.jp2
822464ee0e785007ebaf350ddd4531cf
f40405ea31a9b7c228e49fd6ca52a8bf3dbdf8fd
F20101209_AAAXFX liu_j_Page_062.tif
5ee941e09182f345b06420725fa8c90c
7a186147f9a1c655146b45d8ec584d877bb61f10
1959 F20101209_AAAVRE liu_j_Page_058.txt
24394ad807709094e5205f2b08ff4613
f78e78e072b39b7a21a91fa8a0f00a6cd7fc0fd1
F20101209_AAAXFY liu_j_Page_063.tif
50b264bb7cfe6ba2aea67b78f55d65a3
fc60882613bfdf9b0fc4859966c8a4816c01bcbe
128504 F20101209_AAAVRF liu_j_Page_217.jp2
b45c08776dd31313e7438b900ef71f3d
2695003d66a76eea36cacd2bbbc70f1b833e04c2
F20101209_AAAXFZ liu_j_Page_064.tif
254ce610932c1d352057089ad068e554
247256ba1dc4f0a0279f764a42e766c394885c3d
51854 F20101209_AAAVRG liu_j_Page_031.pro
e0ee954fb2e8d90e80c4d95c2eb661e3
a3751dc9ee48476dcf2d83aa078c93092c81623c
2214 F20101209_AAAVRH liu_j_Page_097.txt
9ca901ec920cbb78db7637693bef15c7
9a4527e84009c009f1bd33f2ff2a33f28f9fd84b
35858 F20101209_AAAWOA liu_j_Page_211.QC.jpg
f64dda1b71556cc4ebcff3951cdec395
aaa11ca504fd0c419ffdad8e3b166741c69bf6f4
755 F20101209_AAAVRI liu_j_Page_153.txt
35b132f28b82fc41e83d88fd95e958b8
b1df59b1766fb846a59e26b2087c3546b435bd7b
107707 F20101209_AAAWOB liu_j_Page_165.jpg
638d8b5c5faf85e9122a2e114515dfcd
6f7e1320b1ad6d91b2529e6a5de8ecdc15a35f19
107799 F20101209_AAAVRJ liu_j_Page_075.jp2
3117003c3bca46be7df399e599248738
864098a1f919239b5ecca3bbc80448f6234d8bf1
8495 F20101209_AAAWOC liu_j_Page_053thm.jpg
cf6e399780be378126eabca2454528fd
817a661d1e3c7a80e7f78d0ed5e7fdf012ec9b6e
2057 F20101209_AAAWOD liu_j_Page_005.txt
9a985e636a3efaefaf484ef0c54e0cb6
9ba589b7d1b9759c37ee7ee8331726125dee0e77
112156 F20101209_AAAVRK liu_j_Page_143.jp2
e5535f1a9fbc0da3059f5633b57aa3aa
d3521ea0af0372fbe0a5822fa0e9acffe5444c0f
115687 F20101209_AAAWOE liu_j_Page_074.jp2
d381d3d78663304a7dc7c3c6ae3e67b3
4e305831f7c93570c6bb7173d709ae504fc6eef5
1860 F20101209_AAAVRL liu_j_Page_144.txt
7c6b24f32c066ee3802876fe06d82752
9eeb718ad9386e0979062c17a6e4dec075d9fcb8
133006 F20101209_AAAWOF liu_j_Page_219.jp2
410bcd818b25875442a8c6ceb3673f4d
606c11c97d0fd2b41f1c688547f402a26a35ff7c
33576 F20101209_AAAVRM liu_j_Page_083.pro
cbd7337e569ffc513f453e3f2542e3d0
753607d85c4049f95fb080a499e6cf670546ab21
138355 F20101209_AAAVRN liu_j_Page_221.jp2
46d8cf20c0ce9c76a04f14fb2ae0a3fb
5748b7c58dad7d34d3d69a62e54de9cef7e216b9
F20101209_AAAWOG liu_j_Page_153.tif
2f15157dbdf7a4ad6bcc0f7730329996
cbf58f0864d41d9ac56af3ac1ad15bba9c9d1bf9
2241 F20101209_AAAXLA liu_j_Page_085.txt
2ce885106149773451ebf002d13297bd
446bc2887a04dce59f41b9fe9dea50d3f79f051a
119733 F20101209_AAAVRO liu_j_Page_194.jp2
365a8d80ac6db1147feb3a2533658260
996616dd66d6193a594a11f13e7540206f681897
34550 F20101209_AAAWOH liu_j_Page_032.QC.jpg
d54a8ce1f38fcbce5dbf14bb74d145d4
a85f933eb7fcd261506cbe818dd5db56bb4c9928
1309 F20101209_AAAXLB liu_j_Page_087.txt
de04a51bf5f05a3ee92eeab737ad4692
3354b79cddb4ea96254a34bdfbb42f5c0e08b4bf
50794 F20101209_AAAVRP liu_j_Page_188.pro
0de997661615ed0e3246f95d5d7c245b
f7f9c41745a46df97a01f981cbb61273235fdbb5
7804 F20101209_AAAWOI liu_j_Page_038thm.jpg
29d1fcdc71dfaa1a85c7cf0dc00e1e17
14c524395a43800c7091c13c7be662e384b71996
64283 F20101209_AAAVRQ liu_j_Page_201.pro
2360fd26a61d41d05ad723978203d596
7c86b9e90b178d26cf74303208bf87349bb9eed2
130440 F20101209_AAAWOJ liu_j_Page_191.jpg
26feea6e79e671fda4f257cfdd736be7
d47762def62c94855bf2ce9319e866515fcc4adf
F20101209_AAAXLC liu_j_Page_091.txt
56689b85c84c4e51b4aaf779b3dced4f
77c6495a6912c792b39282c67d2fef02b7f7c8a6
48412 F20101209_AAAVRR liu_j_Page_078.pro
dd31d1bd9f0515293f180aebc8b5e07c
dc9d826031eb58c39ee5c010671df681b83bd53f
8297 F20101209_AAAWOK liu_j_Page_075thm.jpg
3d5ba8ce4898aeb4f0258e0116757e06
a497ad44f4acaa828f1e3b3225183ddc84ea2367
1763 F20101209_AAAXLD liu_j_Page_092.txt
5383da56f356a357061d528bc34de843
d98498559eb189f64724b68d4818b16a8ebede07
F20101209_AAAVRS liu_j_Page_142.tif
56bf194a3e7832fd03bba8c5afa00241
70998b5fa8f3868ed2bcf5bd66c353e1fa61f9ac
F20101209_AAAWOL liu_j_Page_049thm.jpg
2073795555008ce08ed1ec50ded2cdb2
51a228885b1cde2c8e652dadcec18f86d6b9852c
1943 F20101209_AAAXLE liu_j_Page_093.txt
48769e9ff46bee604c4d9080df9a0d30
e0ddf849a1f19692d31375cdbde64861b72acdde
110188 F20101209_AAAWBA liu_j_Page_127.jp2
393b008ac2b014e5f5d4b695d7a1825c
ac72da77523fe7287d4beda59e24ccc3efad5d1e
2026 F20101209_AAAVRT liu_j_Page_081.txt
f4fae5d16fb6166ffb45e75833cfa31d
b229a5bc22d29419ee6154e3e40cd70e48ef57a2
122562 F20101209_AAAWOM liu_j_Page_095.jpg
2180b3f5a41ac435448e4897638ade4d
aa4b3cded9a47bb50ed95b12b5497917bbdc9c94
F20101209_AAAXLF liu_j_Page_100.txt
933ffdc3ef27830203c942f4edf76048
c74c69e5e0936f1279ed47c5be4eb25e8f18d8b0
111239 F20101209_AAAWBB liu_j_Page_039.jp2
8f807680c57a405bb10d0302de32b6fb
a6e5e6f537b16b45c5a9efd6c2cdb43a0f3f1ac2
1051961 F20101209_AAAVRU liu_j_Page_009.jp2
1ee44b009ecc50c800749d889adbf594
5b5ddce16604195d3e72301386a4ae983334aed2
34666 F20101209_AAAWON liu_j_Page_076.QC.jpg
3b0bc4472ee0ce367e7247b99a754f18
5ecdb1d39ef4660f7f4460d2a589a4c72f154c01
2094 F20101209_AAAXLG liu_j_Page_102.txt
33be28a388e67f83d29a66b60f34d0be
b7dd84207e941f90105773e2bcb9fef82fd60c47
41401 F20101209_AAAWBC liu_j_Page_180.jpg
4d33b64915f8d39d76806ee52d6b4e5c
72e611a10dd133881137c17bb1e1851d0b12af56
108047 F20101209_AAAVRV liu_j_Page_151.jpg
62ec4000c08d63cd32bd1c72e3a9bc8a
ec434884e39a61e4eb076f50c7171c713b1e3b22
961 F20101209_AAAWOO liu_j_Page_002.pro
246b9bcca0142d5338323ad41bfeff4b
ce3e5ffea3b3b47acbaf7cf3dc0d341a8aa484d0
1912 F20101209_AAAXLH liu_j_Page_103.txt
88a8a46ae1bde4a2433f7814fc2e3113
6df1b8942262b3ed471f55f406e3b331ebedcd85
4509 F20101209_AAAWBD liu_j_Page_182thm.jpg
c450636ef1ea50c81f7b2e74eeae8d79
022f200881b91abd322183bea51b359029798b01
34724 F20101209_AAAVRW liu_j_Page_141.QC.jpg
ef391ff7c0a13e6986778ce9497271bf
1e07498c4d196be5acd6001ae9857133b0946c51
104977 F20101209_AAAWOP liu_j_Page_076.jpg
331d19cba624749cc189e107f17e0218
da2fd02413c923aeb557df67234dc7724b185066
2027 F20101209_AAAXLI liu_j_Page_105.txt
8d7cc0ae64ef5a9e0d1c6e6cf23b76e2
155b2c324c4f32ac43a12c7aa8ca5e60c1f61a2e
50378 F20101209_AAAWBE liu_j_Page_026.pro
03c669c5915857db20a0d3442d71e5c3
b4ab889a0435631c0ca5bac1b3066d0e1883da52
F20101209_AAAVRX liu_j_Page_030.tif
c648843585f90f9bfcc28724ed76e18f
4d69c3292e6c0df8e9ff7749075f51dc6c74be16
9435 F20101209_AAAWOQ liu_j_Page_213thm.jpg
e03cf44ed38c60684c627e1ec991d4a7
c1567f0bf4d5e825991d511170190db45c4a72f3
1942 F20101209_AAAXLJ liu_j_Page_111.txt
9e20f73ec7391afea13edd0ca6a43807
5311fe9d6d9755459baddd22539d7a7f5679c257
30861 F20101209_AAAWBF liu_j_Page_079.QC.jpg
d1d9ce194ffc7e441fa88d169acffd9d
6df1b4cc433b61e981a5b886c608e6bd7f760444
F20101209_AAAVRY liu_j_Page_093.tif
358d774c80f9e11a5eea4c10125ca11e
605932e459d64772a9d8eabe81cbd6ae93bdf4cf
96722 F20101209_AAAWOR liu_j_Page_033.jpg
897d73dcdeb16e5fde3e87b86937b336
adc5628564e377e5d3956277eecb07e211a02438
1316 F20101209_AAAXLK liu_j_Page_115.txt
d102dd081080c2d5ae19625a70deb8db
e4296d0c9bd30efea88e8a3140073eaa992a12e7
2046 F20101209_AAAWBG liu_j_Page_029.txt
fe7d2e95191463064796d3f1863db55d
42171f9dfeb3e94721c880de941cb85a181e1f1a
107337 F20101209_AAAVRZ liu_j_Page_022.jpg
aa9d117a108153190f42e786afc26326
73f9aba16c11c3f732de35ae3e37061b2a6a737e
109779 F20101209_AAAWOS liu_j_Page_111.jp2
bbd20d493dfb35fc3f954d430f100019
f27c6135310b2ddffa5afd5db527d595ecd16c4e
1423 F20101209_AAAXLL liu_j_Page_121.txt
62f305862d44da139c9c3ef31b643884
970ff61700ab0ea3ad44ce91b8c33f94015af0da
F20101209_AAAWBH liu_j_Page_034.txt
b20e18f7067ecfb113142bcb90268293
1b014ff0c01f3be8646fb53d18fa565b53fe41bc
51545 F20101209_AAAWOT liu_j_Page_163.pro
ed98f7ba13d00d285f9006faa225fa06
e5009093daa44d82ea0f5bbad21575df18d567bb
1757 F20101209_AAAXLM liu_j_Page_123.txt
50a6c3d6567f01eff7409c657f84ce70
15e796a6fd52da3e807a8e2d19359c8c84e93e7f
6331 F20101209_AAAWBI liu_j_Page_183.jpg
50944804db04516848584d585697ed82
6ff2f431c9f7772285a87aaf51cef3a29022557f
64364 F20101209_AAAWOU liu_j_Page_215.pro
44440adfca21a3735e337d0e6be50452
66b6d3061c79adddddb53e48554259c8300053cb
2033 F20101209_AAAXLN liu_j_Page_124.txt
699acea20fe18a6667933367a1ec88a2
f93e21da4f71da7fa3df3e2c96a5641ca8833838
82180 F20101209_AAAWBJ liu_j_Page_061.jp2
8814fde9f2d13360ad73d09305fab7ec
e2601f853395029bb365dc15ac133f52758a73d6
F20101209_AAAWOV liu_j_Page_007.tif
c8781ff525b7aef2473fa265297d75cb
49a9d9835ebfa8e92e60cf2ef2789d441c38f0c4
2096 F20101209_AAAXLO liu_j_Page_125.txt
d56511e5f00a7068d070d098d7d15b0c
9bfb6ceb5a6d004725d37b846e9921c96334293f
8439 F20101209_AAAWBK liu_j_Page_056thm.jpg
3ac1f663d40b48e466f5614c98e88de9
7227723b621e87e14535eb758b8afdbfae7dede7
7992 F20101209_AAAWOW liu_j_Page_034thm.jpg
0eff5e558f7c3912c2d8e36a3ddf38a7
361349854b4351280be8ee9dbfaf6d79faced901
F20101209_AAAXLP liu_j_Page_127.txt
7dee601befa2eeaa4f1ef261b03ec118
36cc0b5126a089ba3d2571b67165002d3d0fbb31
49741 F20101209_AAAWBL liu_j_Page_077.pro
0d14ce38ca8ae8f8df353eb923f202f0
6949e171f499f98ad38b11cf6f9518cbec20892b
123053 F20101209_AAAWOX liu_j_Page_218.jpg
66bab4e6623b6f591e574239a26455d0
38d1e6efd635fdc1e0d059cc9a2060999c33cc20
F20101209_AAAXLQ liu_j_Page_129.txt
ccdc4a38ab421e932e04801933830723
7b942f8b007de6aaa46f0a4e7c2130f8df98d4fe
F20101209_AAAWBM liu_j_Page_169.txt
7adbd5dece902dbc0e88bcaa082b42df
3aea73eaac28df32354efd4f297c3f6b28ffc56e
62065 F20101209_AAAWOY liu_j_Page_207.pro
dc73bbb9ec131b26349ca2e5a8856def
6bde582bcddcd1922047ce4ef81eaf730f4d46b5
2074 F20101209_AAAXLR liu_j_Page_135.txt
654aa5f7e22125d7a0d77081bb032885
25b00da8c290ec5a3ac0d7de542158e5d0aea511
110158 F20101209_AAAWBN liu_j_Page_137.jpg
427443246539d727e89d8bc53c7c7a03
f8ae584ca67f0bb897eecc84db2dec8297f3aec7
2045 F20101209_AAAWOZ liu_j_Page_170.txt
148f539cc54ad5ff2691db5a98119710
68f0defa10a617b452733c9de6d060bd59bbc538
1881 F20101209_AAAXLS liu_j_Page_138.txt
37fca0798c5fb6c5784f2955e2bb008e
6d826f1d76a131f5524ed530437656550a5dd0ea
8400 F20101209_AAAWBO liu_j_Page_128thm.jpg
944ec04f0543aec5ca45faf3307ade90
2d498a89d13a901d241ea3fa042ba698a319140f
F20101209_AAAXLT liu_j_Page_143.txt
94019b9925d06c3bf676fe98ebdb074f
a341e46d196e1768194819132bed735189e66143
54959 F20101209_AAAWBP liu_j_Page_012.jpg
6168359ee3bfb99b2d16f699c54a586a
fde29a3e63cba6bad3bc03e2052218316398c579
F20101209_AAAXLU liu_j_Page_145.txt
1c359958a1687565c2ec66129c95c8b9
c35b6e9055f2f959589943706cdb29b2d84c6b29
58755 F20101209_AAAVXA liu_j_Page_007.pro
7ea6946244c99a31bcfb8d22574c3876
2a93a99335a93ab546133eb200040b08e822a436
F20101209_AAAWBQ liu_j_Page_079.tif
277cb70ac2756a7cb027ac521e8836ab
b9326fbe2c75a686545052b105435dfb2a749092
2065 F20101209_AAAXLV liu_j_Page_149.txt
c2a841cd81d68062bdcf4c5058144cfe
b4e656aba3723f9bfccf5325168a6643fab54e4f
6223 F20101209_AAAVXB liu_j_Page_015thm.jpg
6ae1b0448cf97c2f83d993294ae87667
1c51a3c67dbfb3b30b3b898e13bed6c258fed688
298 F20101209_AAAWBR liu_j_Page_164.txt
a62078024170e8a07b84acec5b6e36e9
f2440e4816f70f9e1f23201f0a9e0037cca2b7fd
2042 F20101209_AAAXLW liu_j_Page_150.txt
854d7d6d22fd63ac5ced6d07031b16ed
20a7753dfa6fec436681f8f4fe8dbba13fc040a2
102605 F20101209_AAAVXC liu_j_Page_104.jpg
6834db9f91e77d1f991e19828c9b0ed1
cfc2c3adb6d0a9ac68396fd29ab540e39cc2fdf0
34932 F20101209_AAAWBS liu_j_Page_094.QC.jpg
a9937a16eb2d08790f405c51888ebfb4
300f969bfbaacd4b0fb4881e392ec9dc1a97e671
1629 F20101209_AAAXLX liu_j_Page_154.txt
125f4f500e7b1d0c673052ba2025bdd8
331194849e159d49ce8cb3e14d4fd44a772706b7
131961 F20101209_AAAVXD liu_j_Page_189.jp2
3958d7039c965f72d2e701fdd1e14209
774219cb04fed61328688052a513d91d82715954
13728 F20101209_AAAWBT liu_j_Page_046.QC.jpg
0f3dbf6c2717f1a727ee869fdd359dad
b9859249e299660299c1811fe8a1ccb90693e654
341 F20101209_AAAXLY liu_j_Page_156.txt
dabf54b5891d2e484a6bf8bd7009ad6d
577683a197bb88029c68313a2d7e853195ebf9c8
50915 F20101209_AAAVXE liu_j_Page_022.pro
aa991743885b7d6cb131a67582fc1e3b
93ca79c560f890d6b605d3bb0f92de4d7352f0b9
27751 F20101209_AAAWBU liu_j_Page_118.QC.jpg
d5d4f328056925d433786024611f579b
75edc719d32b8a26d7d0e37647e2758868bc8e52
2340 F20101209_AAAXLZ liu_j_Page_163.txt
d37d6f5f430867e9e742324099ed0b52
232cf210255c659ca45a26c39b8862b4bf9155f7
104589 F20101209_AAAVXF liu_j_Page_018.jpg
ded614b62a1ec1047cd59c388e31463c
e4a50cf274daa0517304c42ebf6a895d10dc930e
111540 F20101209_AAAWBV liu_j_Page_136.jp2
107a825c50eeea8db37e70c4b44e9c5c
297f1aca5a1d704b8763e5a92ce775ef14d8c819
2596 F20101209_AAAVXG liu_j_Page_222.txt
e6ab9c4e0e5315590f19e7b81f68a4b1
a6c6a94aad20439a72e80ff98bbe6892d316aefe
F20101209_AAAWBW liu_j_Page_026.tif
2ac4fabd2bd3bc002d4cd1ed02a73ff5
cf6f358660a9164f1375a589a061805a72bc7074
43266 F20101209_AAAWUA liu_j_Page_004.pro
b42f400572df3f888f2beb26b80cb635
60adc3966f09e665b6230e096720f42de74f16dc
33997 F20101209_AAAVXH liu_j_Page_150.QC.jpg
2121c50afdd1e9eced00e9a25f979d9c
9f309a758e045fc4eb98f11abda0b0dd05520836
2161 F20101209_AAAWBX liu_j_Page_118.txt
68288c9bebc87e619dd62e43c1565ad2
29ae95683470f9163e4bdf6b44e62b3eed8ff3ab
32465 F20101209_AAAWUB liu_j_Page_087.QC.jpg
67084445e6467363578a5c3350b6c582
5e7edcb8747e606fc6f437d031274795c4bbb77e
F20101209_AAAVXI liu_j_Page_180.tif
643cc85f4ab8876554a75b23c9ace7c6
da9c9448235f5b4a8a113123b7e1e841fa6b020e
3526 F20101209_AAAWBY liu_j_Page_010.txt
951e433e4c9ce6d152c780c84ce1f568
a0119a6f36201e6077ff01f0bcc1a7b4f68d0b9c
110064 F20101209_AAAWUC liu_j_Page_034.jp2
a24153dc9f13b659d628ce32d55112e5
d69c692cc3fe001d2075dcab552bdba29ed2b23b
137016 F20101209_AAAVXJ liu_j_Page_195.jpg
d5605443baa4935a21d063c179fec67c
e1ec8b718e5546a7587e7ff938bc61ae78f102a8
34418 F20101209_AAAWUD liu_j_Page_132.QC.jpg
f03c0330a15602955dd9323c35f1f998
52ab43575fbee4cd3a999a76ad94d999ec6e5d2b
29088 F20101209_AAAVXK liu_j_Page_048.QC.jpg
e2d0138c1a259247f262e2063d8ba0f1
427972fefcdeaa7ea01759e8d6a37b7d7f0cd728
100969 F20101209_AAAWBZ liu_j_Page_121.jpg
cfc2db446c87af84ad4266c230821800
c8867ab52abc9a9bdde885ed948491fafbe5d5bb
F20101209_AAAWUE liu_j_Page_016.tif
5c6c4d2a996dceb4cc82ecefcb75c4d3
bcbfe0431f23876e60882e7be8b95bd8eb238ed8
8664 F20101209_AAAVKA liu_j_Page_076thm.jpg
58f0f391ef4b7a26e145a24e606ae204
25e177bae8a96b0b1774c477e6c4ebc6653e688e
8199 F20101209_AAAVXL liu_j_Page_146thm.jpg
669d60977e6120f3cacf8c13e930ec3c
fa67cb4c23f0276868e7bd2482c4c5e7f2dcb851
753 F20101209_AAAWUF liu_j_Page_086.txt
9e3d2a4b5f61f59d4783b7bbc552a8d1
d3029919cdfa63580b35122dc2981e19a3350109
F20101209_AAAVKB liu_j_Page_050.tif
e1dfa6f56b77956cb615ab6c6291e904
a3a87b2021e53678e7eb67329a45d0d099664c93
F20101209_AAAVXM liu_j_Page_132.tif
d5859a0ee7423612e904ffaf8548bddc
8c3a3ab46c22ec610d0c68935fb54cd291767bb0
1924 F20101209_AAAWUG liu_j_Page_041.txt
4e318d25f1d09cc1a808e0b350fb8089
ef27e209751df799f5d9346bf05a9fa4d6d5663b
F20101209_AAAVKC liu_j_Page_155.tif
c5612bd373f423a38b83b0d8908f0c1a
9404163d18b47265ab8951a7eaceddde4e956f56
50974 F20101209_AAAVXN liu_j_Page_131.pro
075d2363c083ceb00da85884e7a8af41
ae63d29fc366e6ddf8f00d828c3e6071042b274d
8529 F20101209_AAAWUH liu_j_Page_039thm.jpg
730965116a2cb99a2832a514f685a0e1
b601d4034ce507f54bb7a6b326fc9918116d83d7
34162 F20101209_AAAXRA liu_j_Page_140.QC.jpg
711ce400e96f759292428c18fbfee997
a8451c7878adaebe3f1cbafa0269e634e7479385
125827 F20101209_AAAVXO liu_j_Page_192.jpg
5f102c9ddbc10577d0662b6b5c669032
9a01447f81c554263b5ad5b9334055e2ee6d9605
35167 F20101209_AAAWUI liu_j_Page_190.QC.jpg
c1fb01384ea3b5fa4f7f0c894290d91e
ddd33884e51ded2c2252b9e0b135aa21935fc506
36545 F20101209_AAAXRB liu_j_Page_142.QC.jpg
33ea3aa0d7ffe4f05f0a1859feef8c8f
e47bdf208a2a5bb64854602d8781f5456b316b90
1051942 F20101209_AAAVKD liu_j_Page_159.jp2
d297abe78deb85e1133e84e606b98854
c7db716661576df9facd20e83108d0824b914d77
1618 F20101209_AAAVXP liu_j_Page_114.txt
ac8100f4fe2b0fcca5f613c0d4e10f3e
5783a41d3bbfcfc212f09657472f7fc80a2c6946
8640 F20101209_AAAWUJ liu_j_Page_145thm.jpg
8b12c155fd25387ae396aa9fbe1ff9e6
54fd00da5d7dc205df465065b6890b4762c6eea5
8443 F20101209_AAAXRC liu_j_Page_148thm.jpg
79866b8c6d80d8ba3760fefdc41dd1b2
811849d247c5df85b1470fd7da5b68089a4c2c31
F20101209_AAAVKE liu_j_Page_220.tif
cbee0ea7fb21178fa204a9debd7221be
dabfb145b27b913e9e0d20d6bba8b29f77613a9f
1434 F20101209_AAAWUK liu_j_Page_184thm.jpg
56401f4cf031aa95033cfb96d6f49886
e41190b5c969dfad3544e6435ab85a03196855b0
10906 F20101209_AAAXRD liu_j_Page_157.QC.jpg
980b7db6dc155b60c8c53b9b1e977668
ccbe9953b233162a4cb9cb971a2ec001967ca1cd
1853 F20101209_AAAVKF liu_j_Page_050.txt
613fe070f4f76a8dbd95eba2fa0f132d
2eaf14c04b034667cd2c53abeb934b09bd17adac
34916 F20101209_AAAVXQ liu_j_Page_100.QC.jpg
a500440e1df16c6724ef03bf6fa60b86
3a8f2574e256b2f9fcd72f5e40ae64d96c59c6df
133688 F20101209_AAAWUL liu_j_Page_223.jp2
e8da4da066ef676284c31766cfde41c9
bdbf0f18b51144a7fd71972126aa07f4d5adad6a
5830 F20101209_AAAXRE liu_j_Page_158thm.jpg
87dd55c0abece7701d436a1150e13d49
3aea560597279b8ee211b36c1cdb4f20f19981c9
49380 F20101209_AAAVKG liu_j_Page_054.pro
9866298ed5d94d47d40194a95b544441
9b4f64d12d403941cb802416fc48fb5c2cf77123
1983 F20101209_AAAVXR liu_j_Page_090.txt
4ef0272c7a9f289f2ce94b868cd02c8a
3e73998aaf8ed70f8067d8211ac55ee489e8ffd5
24476 F20101209_AAAXRF liu_j_Page_159.QC.jpg
4bd893b5902a3edcb059b0ca87b5274a
e92f4e1c46d6c14cd7e273081b6c507469959955
20174 F20101209_AAAVKH liu_j_Page_067.QC.jpg
c19a1002714e2ff2003084e855e0944b
f97e9c6f879ccfbbac56af5faa71b3bf48c28874
F20101209_AAAWHA liu_j_Page_019.txt
6936be06ebfffb8caf2fc7f012df8ba7
c67a875ce36fbdf117e5eb3665a5f60d9dcbe1c9
101549 F20101209_AAAVXS liu_j_Page_169.jpg
9b73b433a7ff5a97ea2224fe3387cd8e
c480cf65fe6dd17506a6891b42ae64d326ab8284
4252 F20101209_AAAWUM liu_j_Page_012thm.jpg
ec5c2a46f1e29a8fd8d6d4d18aaa73c7
5ba3609cc971f3ca5a3bf490d99cb19fa3a605e1
29532 F20101209_AAAXRG liu_j_Page_166.QC.jpg
0621b9ba7b0af787e906520f18f9fa08
bd4fbb93e662b68e49611b6233f46dc0a406c47f
F20101209_AAAVKI liu_j_Page_158.tif
87e62c35eb67e3694271d91def5706ad
0756648a472cac8f107e3a096a954b208d520799
97033 F20101209_AAAWHB liu_j_Page_092.jp2
b7a414e6cdcc8e9970e6ef69ba49fd82
8c7a951f34bb265c29cee78037f7269f8b629505
8707 F20101209_AAAVXT liu_j_Page_110thm.jpg
abadb0db23ac087d514de481f4164911
c346307bcb1c6c07302c5a7af54fe663558380f0
125642 F20101209_AAAWUN liu_j_Page_197.jp2
4d6fbc3d33d70c4fd03ce211b4967385
c4bf1bfea35f3576476150e05e81f24b946ef771
34261 F20101209_AAAXRH liu_j_Page_168.QC.jpg
56600ccec8548e4cc41b18f85b516f88
d34c077f6b347f2c66a1750a1b5f0de1cd00b8eb
89162 F20101209_AAAVKJ liu_j_Page_043.jp2
c722122a9399feb94d5e730a917c0175
358232f7dedfb48fb547eafe257ffe503ec5c57b
28260 F20101209_AAAWHC liu_j_Page_120.QC.jpg
1da98c96f7632f888685239841ba2f80
28b26fc23ae2676873fab3af4aed4757db671011
F20101209_AAAVXU liu_j_Page_015.tif
3f69b1ec2598d7d850fd52eda0b06b7b
8823053be7ca4a09723cf3094b29e1386fe167e1
8460 F20101209_AAAWUO liu_j_Page_150thm.jpg
ff1fcf922fb1501013dc73eb89503aac
ca11ffab061921d1903e3b744a0b966d8580be32
50324 F20101209_AAAVKK liu_j_Page_109.pro
6e4a63545e5f26a95c87bc01c766b3e5
7c85fa7804b28bc9bd5400183d2134f6c81e3989
105540 F20101209_AAAWHD liu_j_Page_118.jpg
3b7d33bcca25e61758bc1afb6671df6c
a729af2e24ae1ba801f8924d78ca433259a98866
7991 F20101209_AAAVXV liu_j_Page_037thm.jpg
2e316f729f97616a3905ac1f706a1f40
0b43a3d3ff950d4432dc037a898db2cdaabd19de
771 F20101209_AAAWUP liu_j_Page_183thm.jpg
813d82e443d0b60430cd48427addba5c
05e61580d7fcdf1c177a86132aef84b7305e07f4
33455 F20101209_AAAXRI liu_j_Page_169.QC.jpg
04b9c7b352c318d8d6606c22ba1ac05a
aaf26a57f4afdb54fb1812d8761ce9d4dc77012d
248 F20101209_AAAVKL liu_j_Page_047.txt
1ab738032409f3473f95e85f12a03c9e
c805a5f6ded9974e7659058f02b853041cd87aee
1883 F20101209_AAAWHE liu_j_Page_037.txt
4279cc276dd28741ed53f246a6e88540
1bbf583966cffef209518de0295351fb08551335
8249 F20101209_AAAVXW liu_j_Page_029thm.jpg
b48729b3ee829f0495a524bda6dd127e
1e30915489f3db3760ea737ae3348de1be9b2983
F20101209_AAAWUQ liu_j_Page_094.txt
a74aec5cd409a64905860931936d5e43
e5249ffa47b7e9c8efb1925f8059cdab145ef596
34828 F20101209_AAAXRJ liu_j_Page_170.QC.jpg
eaaa5565cbe23220f1a3fa9e444cddfb
4ff0c23da0d16474f53f194e8237069ab1845338
8594 F20101209_AAAVKM liu_j_Page_170thm.jpg
c26164a918616d7636f9fd04d52a177e
66b8d846771f35f7e5a87bbc6b74db2a44b358f6
28727 F20101209_AAAWHF liu_j_Page_188.QC.jpg
4d10c0f417ec3496bb0cd13129084eac
ab012b7d7085930d15a095bd4d8351387b66bb68
49519 F20101209_AAAVXX liu_j_Page_099.pro
b54d47299e8f516cf323dccb87c758bf
9299b225a72cbb3e9dd53107f31e07dd66626499
14012 F20101209_AAAWUR liu_j_Page_182.QC.jpg
74f3cfdb21fe715aa6bd7f5b19722d1b
c2b4d10200174cff7d59c8d9eb03d039dd0beb67
33350 F20101209_AAAXRK liu_j_Page_174.QC.jpg
983c19346b16a800bf7eba9208662fb4
426a253356a5632e455485ab4b26ed0804ba26c1
F20101209_AAAVKN liu_j_Page_006.tif
3eafbc6cdef987068b12a73a285792a5
97dc7735fe1a21bbc1437be7cf42a36a59b8218b
41165 F20101209_AAAWHG liu_j_Page_153.jpg
d5c4ccbad69ac3268cdd95f639f2b951
8a19765bd44fe3ee9f26c09b6b872bfbcb5fa116
18804 F20101209_AAAVXY liu_j_Page_153.pro
01f536008bd27ddd57d3aa5ab93ff588
2049822a7f42ac3ad506ca3fcf4b9c6f2be196d4
107570 F20101209_AAAWUS liu_j_Page_023.jp2
094e035c711e03735f01efa2cab8a976
caff123fee1a5d8f3dd9376727747e9bc5774f74
7963 F20101209_AAAXRL liu_j_Page_177thm.jpg
3d4a9c284b1c62c03651ebb74b83a3d7
1396ee47855c60d02a1c6697d4b9a259e6b5990f
18545 F20101209_AAAVKO liu_j_Page_006.pro
ec706b2be216075cf0d50690ac1bfde3
efaeaf59138140cde5537fc951a9cd5fd4fe8a21
73150 F20101209_AAAWHH liu_j_Page_088.jpg
64059cb9e8d817b4d9fc0cd660920fa0
a7f0235be2b7ed2e99950e00c62bbcc37ea190f7
748080 F20101209_AAAVXZ liu_j_Page_067.jp2
8ed7834ddb03d2c9177f1f6877f9c466
47981ee425d2ff4dce962991b0816f9fd40904dd
109876 F20101209_AAAXEA liu_j_Page_140.jp2
90fce14d5e35c7ec6db7e1ed5b2599db
364e315eb3fd65b7b0d9a4dbaec45c883f8f6e76
8675 F20101209_AAAWUT liu_j_Page_019thm.jpg
9c4beecde677547321c92a455513b0d9
d816b96ca30b390d2bcf5dff7d891368266efd50
32197 F20101209_AAAXRM liu_j_Page_177.QC.jpg
3c07b5c5947a407db022e63feddd947a
b408ab742b46d6aaca65e8151a69e6a4fc645669
111240 F20101209_AAAVKP liu_j_Page_148.jp2
d20830c275054bb1406a6ddf1bba9614
9046ce9e1361c586829035af4173a3ba0348aa7a
48849 F20101209_AAAWHI liu_j_Page_042.pro
7cff1835db5b02c4c59d4d09a06ad4e1
2788083361e1fac9bf1e3969e1f831c8dfc97ecf
114693 F20101209_AAAXEB liu_j_Page_145.jp2
1d4031d6c244ed1070619efc3bf0d85c
36894a995d6204c1e00b4f0ea3b37c31e4ad6f8c
17905 F20101209_AAAWUU liu_j_Page_115.QC.jpg
c473f05500415613566d2d9da1f52075
074db446d661e297dbf150fc6a5404125d4f65a7
3558 F20101209_AAAXRN liu_j_Page_179thm.jpg
75705be1e989edc40fb972397f1872ba
be382b7265f1ed16f96417a92b57d683ea7f58c0
8235 F20101209_AAAVKQ liu_j_Page_087thm.jpg
c4d40c44dec585cc0a968fa2bcf8df76
50e62e9d82474d9b9d3bdd1623193c7b1348c53d
101728 F20101209_AAAWHJ liu_j_Page_112.jp2
ac5be0b2ece64873c4d465e3bf68b010
c781a983792c699257684087282f9fbd02551765
107312 F20101209_AAAXEC liu_j_Page_147.jp2
3b8ef7e96f8561ef5742b434a0b64505
792f79a61cb62229bccaafc3e16cfe48305a73e2
F20101209_AAAWUV liu_j_Page_115.tif
18f83e997c236e902e3fa97fcae23715
f4dc7df4f4c2b48418189d83a89f1705fe75fd19
13125 F20101209_AAAXRO liu_j_Page_179.QC.jpg
3699886ba3a44013425180c9e78e3788
7162877cfc56334f7be11cbf006ca8429c160471
33144 F20101209_AAAVKR liu_j_Page_042.QC.jpg
5b92ccf02985c15518658d874bf4363a
7f69d00e5d04df7f81b4fc7993a96ec3c296f1d0
111742 F20101209_AAAWHK liu_j_Page_081.jp2
8cdb08e1e16daa342223a7a93a0f1ef9
9ada938918c024e4cfe5b0bd12ee18c28a209aff
113063 F20101209_AAAXED liu_j_Page_149.jp2
6d0dcc25808e90653329b2f9e369b1c3
1d1b8c6c1462c061f5ff5168fc283617bd62538a
8346 F20101209_AAAWUW liu_j_Page_040thm.jpg
8ef24316809d0ca0a5658b6202ec0322
a749117400129f30d97919e36eaf4412486accf7
4036 F20101209_AAAXRP liu_j_Page_180thm.jpg
f8f6d5367fc00a8e4212248856ad9f03
95f2d2758a418532d6b3bf2539d9a966873ed6a7
66050 F20101209_AAAVKS liu_j_Page_209.pro
ddcce7bf13edc4ef1087081fcc7f9b0f
a0a6d1e851d044a7fa97b22df8f5e2862977ec22
19085 F20101209_AAAWHL liu_j_Page_155.QC.jpg
3e317b9ee47d8e57245bfe2c4588903f
d7e5145aba1e53e101e9a7554763a716547c8023
112330 F20101209_AAAXEE liu_j_Page_151.jp2
8faa33abf5519452fe49925b5ae9687d
129f5d57e63138c56c794cfae4610aecbc5ef726
105363 F20101209_AAAWUX liu_j_Page_036.jpg
a7eafc3b7ddbe634c65a44b580c31dea
9684c858b98d7a536a75fa134b80d563d654f4ed
13161 F20101209_AAAXRQ liu_j_Page_181.QC.jpg
aafebb21378f4604898bba085116152a
30d5851069acea47d323f4d26cfa813d91d9fb51
33535 F20101209_AAAVKT liu_j_Page_194.QC.jpg
45611ac000750dac966c68c27104966d
edc6bbce9d49476f721a2ca12fa15bb17efa3175
106526 F20101209_AAAWHM liu_j_Page_170.jpg
74d134a818ea69bce9229bb22bd82147
1931d8f43740caad42b04c64d20beefa5d998bf4
106127 F20101209_AAAXEF liu_j_Page_152.jp2
41d7aca81b8bf3236af6c49c13192ff3
68188f1c2526337f26c457cf035096ddc130390e
104997 F20101209_AAAWUY liu_j_Page_103.jp2
88db4f8c459e7cfbcd7f637a8f7bab8a
af76035a338f354f95b0b732f0a3ccfb546d464e
5318 F20101209_AAAXRR liu_j_Page_184.QC.jpg
bf91d08d5396d5cc95756d962a37ecf3
642d5fe7697f26cacd9c51d3a9d8e1d2ad2af1eb
F20101209_AAAVKU liu_j_Page_071.tif
3a6a9f559401aea295e700ffb5eb0da1
bcb1d39f42f367ceb34eb1da14cbba2244e9afd6
104404 F20101209_AAAWHN liu_j_Page_149.jpg
7ce24d0faef61bc66a6aa53cc08e9979
32f5c2c35f3793f78de133085208fc15a530eaf5
43269 F20101209_AAAXEG liu_j_Page_153.jp2
9fb0262a28b00966ba0e78f20cc4be21
a80c1fd8c12dde52fcdccdbb0ecdb832a78217e0
113131 F20101209_AAAWUZ liu_j_Page_025.jp2
1368d9044a3c951c1c22ee2ed55a9af0
7942f948b558522d9efda321944c903992c0fa4b
13949 F20101209_AAAXRS liu_j_Page_185.QC.jpg
c3f0cbd07583b4581c50c243588244ea
cb0b1d94be79240e5194575083af5556c7beb56e
117444 F20101209_AAAVKV liu_j_Page_142.jp2
395d0b8ff7cf42edd1c1174559476930
295fa081b8a9f11390a3cacf378cdb4a993c0ca9
F20101209_AAAWHO liu_j_Page_098.tif
86156c3c87733252f9cc77fecf9ecf6e
cebba6fa880bd94bb961760ba1ea68053a3c3cee
81970 F20101209_AAAXEH liu_j_Page_154.jp2
fb48f6a32a8a5f99d25140e43fbe3e17
59f5607102913795764388d9a63b68cf6fb1e879
36943 F20101209_AAAXRT liu_j_Page_191.QC.jpg
bc9d258cf902e7b09ef93a9ccc2b62c0
23d5c9281be9d69eb336210eaa1970854e0997f5
44177 F20101209_AAAVKW liu_j_Page_046.jpg
78996e0a030f8aa3fdc9b3eddc06567b
d769431be03793a215d321490f8bae98fc219a99
63204 F20101209_AAAWHP liu_j_Page_211.pro
03982aa4e5f32f46dec92fb66c38188c
4ca64c0e59fedebd021ae492e414a7fdfa3338a6
387149 F20101209_AAAXEI liu_j_Page_157.jp2
d4ba48363d6ee09d39d8e2659c09193c
b3ae6d9b77d8947367f737c7d7994c2835579cd6
35993 F20101209_AAAXRU liu_j_Page_192.QC.jpg
30e9389dc629a37865a33c4ced77db18
becfde19b7a06e98e2d128e7b1f70dcd769dba84
2568 F20101209_AAAVKX liu_j_Page_007.txt
6f99adafe75d9abc8a90e5cac521dc11
e89dfcfccb0982389c3fda29c4a2ef1e4106c0b7
9192 F20101209_AAAWHQ liu_j_Page_198thm.jpg
80547e6b0a19b987153e51082c8d98cc
0d990e83e30fdc6e9058bfd360f1bdbde703246c
825312 F20101209_AAAXEJ liu_j_Page_160.jp2
09684dddf488055683eeff8aa2dd019a
c0398d1d4c7f7e1536bcc824b55f1c548c605021
37731 F20101209_AAAXRV liu_j_Page_198.QC.jpg
81ce131ebc330034fd85ec54c96642dc
f891c761bef3dccb942ca2acc919a681eb61aaf3
1913 F20101209_AAAVKY liu_j_Page_104.txt
3f712de930383192fb10df6ff70c2fa3
f3b3449bbe1081ae86962a54fc84d2950c1fd4e3
29852 F20101209_AAAWHR liu_j_Page_087.pro
46b71b6dd72592f87d60c2dc8c6d321c
d938011809bbf4d8f399fa3f4d1b0489802aebc0
1051976 F20101209_AAAXEK liu_j_Page_163.jp2
340f50e00e0408a202a029f090b45c19
9e91c557838f62b36e99d260a56641c2fc03871d
9427 F20101209_AAAXRW liu_j_Page_200thm.jpg
269ddf956793806c6bec5ad24daad00b
4b56c4b64db425d2e8b7b181d9da29dd024d31d0
51484 F20101209_AAAVKZ liu_j_Page_105.pro
058d65483778cfe8051ac0cfddf6b930
f397a2e020e917c5933c18b364772bba61b43dbd
F20101209_AAAWHS liu_j_Page_162.tif
33ac9af6c215e5f8f9a31b932c50eec3
47a4b9e6d6ae4c94babc187409afdfc722e31fb2
1051907 F20101209_AAAXEL liu_j_Page_165.jp2
8aaf9871a3278b1a9e90358bd4fecc1d
3c5758883176029b83e846f29decf925bd32bc7b
9011 F20101209_AAAXRX liu_j_Page_203thm.jpg
1104deee06109d0fa2c16d1ea1de0179
2801a8a3efa3942b1fdd5fefab10adb4516018da
F20101209_AAAWHT liu_j_Page_033.txt
fe95b3cba01632a89a7e5e920d11b1f9
74e356ec7896b50435d7c6a5c783b3cdffc13caa
112962 F20101209_AAAXEM liu_j_Page_167.jp2
524a740208c05d581850562e6268f594
9b8751ae51d4a56cb06be8d3f4075ed8b5d572c8
9136 F20101209_AAAXRY liu_j_Page_204thm.jpg
68763476165fa9b9423bce3003a70bb2
b13ba6c0eed299e6c9d43ba2c0112a9dc3190ef4
F20101209_AAAWHU liu_j_Page_099.txt
f0f1cd3d1a861df820e6f0524e7e2cbe
54346d92674886c5eea664ebd2ad163c24a444df
104152 F20101209_AAAXEN liu_j_Page_172.jp2
950fe90f7007ab1859bf4040cf96f55f
7adeb6b42da48e889af806c391ebbdd1f8cdda32
8743 F20101209_AAAXRZ liu_j_Page_206thm.jpg
fcaebada559f2c80b7edc984217657f1
98551bf92a601cdcf9129009a8841aecb5e10a0f
3468 F20101209_AAAWHV liu_j_Page_117.pro
acb0fe9ec523c1de29444757f258704c
ac0b70e2fcfc31bddc625513ce2af8f3b2c70452
112699 F20101209_AAAXEO liu_j_Page_175.jp2
b8fb4ba6a568985a98b404b44591acd9
e8f2f9fd2d0b2d5b209ecfb678b51656e008b9ff
85544 F20101209_AAAWHW liu_j_Page_008.pro
11efeccab5e7c8dbae5a25dbc93fc358
6ab2282371506e076378bbc7da304e1a250b527a
110448 F20101209_AAAXEP liu_j_Page_176.jp2
85170dc1afc5d87de758b88904775879
29ed1e6b98f8dda064c0fd14fb5da0df27eae309
F20101209_AAAWHX liu_j_Page_188.txt
44ffcd16de9ed5a42bf5917c5e4cac90
d317d6e477dcbec85195e53562c9bbccd7c9c31c
106668 F20101209_AAAXEQ liu_j_Page_177.jp2
3ff6ac10bdabb45439c225bf9fce0610
a85abc7124da5be3f7ee6e5bddea88ba00fc384d
F20101209_AAAWHY liu_j_Page_202.tif
4008a8ad22bcfe2c760ae69e2ecce557
da9cfef88b8acb3b91b8d481f3d1ec94a3d9b249
41269 F20101209_AAAXER liu_j_Page_179.jp2
8c57729ac67a289ef401a239171c6d12
9ab2c15abcad4c74300297bcf1c09b97e4373ae4
1480 F20101209_AAAWHZ liu_j_Page_011thm.jpg
695e05b32779a5d6bc638b66f6532bc7
09bf5176db87a482cc8099f4386e1f6505c45f1a
43118 F20101209_AAAXES liu_j_Page_180.jp2
2b6e559d5d0ac10d2e023b41e006c04e
d0c3e3928b49a6d5214a43da04b898927253af37
684048 F20101209_AAAXET liu_j_Page_185.jp2
d40ce8dbb91dd61ef9d4927bdd3779f9
023064cecde71449604788b0053d5090d6c7b027
F20101209_AAAVQA liu_j_Page_134.QC.jpg
be492c5844e97005f32c3820e734c8bc
43d453e9f24113df06dadb1efad75a4c04bc548b
103080 F20101209_AAAXEU liu_j_Page_188.jp2
afb71a2965616ec888d1add9eb8e46d3
b87c60b1b1323309b642f30979672bc75e365b18
4165 F20101209_AAAVQB liu_j_Page_047.pro
d01a03a1521b4e59f42092529f34d1ac
8e8e8d11564928cd0c3595ce2ae98d276fbf699d
124525 F20101209_AAAXEV liu_j_Page_190.jp2
2dc67f51f5f82fff6c4235320b403188
24ba3b54e4891af541949faaa820ed862333b147
99952 F20101209_AAAVQC liu_j_Page_225.jp2
9cfdd9cd695ba1ea0b7c0ddd89916054
5d977e33417cc99a21839c19587449854ad1580b
123247 F20101209_AAAXEW liu_j_Page_192.jp2
577f646247d6c90ee38f82721c04e9c4
57226cad059aa7d471e7c574247b0623468f92dc
45595 F20101209_AAAVQD liu_j_Page_182.jp2
7297a90990c58eeed8062c45a951e970
1a3ee10e9a4d8474d39ce313732e0408ab838dcf
135676 F20101209_AAAXEX liu_j_Page_195.jp2
d306e29c857ea6522219e4e828b5408a
5068098316dfedbe7d2fcdcfc3de268bf667f35f
F20101209_AAAVQE liu_j_Page_131.tif
87a42d10636ffdb2bd220c148ab51473
6d779701b90fd9f3af6e6d7fb412ded83b0d4b33
130647 F20101209_AAAXEY liu_j_Page_196.jp2
59c1dd5a43cdf426fd78af7fbfe1c612
c8cb3a2441a15dbbd88225e5e3a95ff17bf250cb
8196 F20101209_AAAVQF liu_j_Page_070thm.jpg
c8eac8b46ba5453d66d6eee5edb5c5b8
bc2dd070de84db9972b478bc6be7519792910769
132407 F20101209_AAAXEZ liu_j_Page_198.jp2
8bd460af20752f353e90a2ca72ddf2c7
02006c1689dfebaf0a48b95766df75d22296d5cf
34890 F20101209_AAAVQG liu_j_Page_056.QC.jpg
33b21d107d5abe8325b34bc8a71a0118
b6121c7ed66c5ed1e6dd503462bf17242ec53bda
232 F20101209_AAAVQH liu_j_Page_117.txt
1f634d2353ff60e17103a72a958d61f2
97246ea6752018dddd60bb101b84f67940e57dde
92 F20101209_AAAWNA liu_j_Page_160.txt
242ff977030716b827195a6ca41476de
c908b95eee25fa35cdce6d99224263dd0ae6c4a9
35197 F20101209_AAAVQI liu_j_Page_106.QC.jpg
5fddf1165e182ae7c1eca4717b06b78a
62ef72cce4dc451b11700da3ed50a6fc6d9dc314
22619 F20101209_AAAWNB liu_j_Page_044.pro
6aad2361f383b36e940344d37babcd1b
7c8344214bad16ec1ba9ec26aca619b377edda70



PAGE 1

INITIAL DEVELOPMENT OF A RIBOZYME GENE THERAPY AGAINST HERPES SIMPLEX VIRUS TYPE I (HSV-1) INFECTION By JIA LIU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Jia Liu

PAGE 4

iv ACKNOWLEDGMENTS I would like to acknowledge my mentors, Dr. Alfred Lewin and Dr. Gregory Schultz, and the other two supervisors of mine, Dr. David Bloom and Dr. Sonal Tuli; without them this work could not be possible. I could not be more grateful for all the care, guidance, and patience Dr. Lewin has o ffered throughout my graduate career. His enthusiasm for science, dedication to his student s, and wisdom in life, all have influenced me profoundly. I want to th ank Dr. Gregory Schultz for allowing me to work on this project, for his constant suppor t and his avid encouragement in the last four years and a half. Dr. David Bloom has provided me invalu able training in the fi eld of virology, and I greatly appreciated his profession and expertis e in science. Dr. S onal Tuli has tirelessly served on my supervisory committee, who has enriched my knowledge by providing her invaluable input from the clinic al aspect; I truly appreciated her kind help in every aspect in the past years. Finally I wish to tha nk Dr. W. Clay Smith, as my committee member, his insightful critiques were critical for the completion of this work. I want to describe my deepest gratitude to my parents, Mr. Yuji Liu and Mrs. Hong Zhang. Their unconditional love and endle ss care have always followed me no matter how far I am away. Even when we are apar t across the planet, my family has always been my resources for encouragement, support and comfort. These have inspired me to fully use my intelligence and talent and he ld me on through every up and down. Out of all their effort, I had a chance to see the world and become who I am today.

PAGE 5

v I have been very fortunate to have worked with so many great people. I want to express my sincere gratitude to each previous and current member of Dr. Lewins lab. Mr. James Thomas Jr. has been a great lab mana ger; with his effort we had an enjoyable working environment; Dr. Marina Gorbatyuk ha s offered her kindly help and advice; all the students in the past and pres ent have been far more than labmates, a family I shall say: Alan, Mary Ann, Jen, Lourdes, Verline, Fredri c, and Lee all shared with me the most memorable times; in addition, to the new people, Alison, Soo Jung, Aaron, and Lance, it has been great to have you. Ms. Angle Simp son, previous member of Dr. Schultzs lab, has been such a great friend, and I cannot forget at the most difficult time, the great comfort she provided and the unbelievable relief from her magic hug. Dr. Steve Ghivizzani has offered a great deal of support and sincere advice which I could not forget, and working in his lab has been such a great experience. I also want to describe my thanks to every previous and current members of Dr. David Blooms lab. I want to describe my appreciation to a ll my friends, and their friendships have been the greatest gift I have ever received in my life. Although being independent was the best achievement from my graduate educa tion, my friends have always been there for me which have helped me grow in every aspe ct. I want to thank Dr. Mary Ann Checkley for her guidance, encouragement and consider ateness which always find me comfort and motivation. I will not forget the genuine help from Dr. Biyan Duan, his selflessness and kindness have been such a great model for me. I also want to thank Ms. Yuan Yuan, not only for all the great times we have shared, but also for her invaluable critiques and inputs which always urge me to work harder an d to be better. After all, a great friend is not only about giving out praises. Finally and most importantly, I want to thank Mr.

PAGE 6

vi Jason Liem for his thoughtfulness, patience, and encouragement throughout these years. In addition, Jason has offered excellent tec hnique supports which helped me demonstrate scientific ideas from a whole new perspective. With all of his effort, this journey has been much more enjoyable and exciting. I wish to acknowledge Ms. Joyce Conners; with her hard work, the experience in the graduate school has been much more pleas ant for all of us. I want to thank Susan Gardener for her dedication and help. An acknowledgement would be incomplete without mentioning all the staffs working in the international student center; they have made the study experience in this country so much easier for us.

PAGE 7

vii TABLE OF CONTENTS PAGE ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................xii LIST OF FIGURES.........................................................................................................xiii ABSTRACT.......................................................................................................................xv CHAPTER 1 INTRODUCTION........................................................................................................1 Herpes Simplex Virus...................................................................................................1 Herpes Simplex Virus Biology..............................................................................2 Herpes Simplex Virus Pathogenesis......................................................................5 Herpes Simplex Virus Infection an d Herpes Simplex Virus Keratitis.........................7 Herpes Simplex Virus Keratitis.............................................................................8 Human Corneal Anatomy and Contribu tions to Herpes Simplex Virus Keratitis..............................................................................................................9 Herpes Simplex Virus Keratitis Pathogenesis.....................................................10 Treatments and Emerging Therapies...................................................................13 Gene Therapy of Herpes Simplex Virus Infection.....................................................16 Gene Targeting....................................................................................................16 Antisense oligodeoxynucleotides.................................................................17 Ribozymes....................................................................................................18 RNAi and si/shRNA.....................................................................................19 Delivery Systems.................................................................................................21 Adenovirus vectors.......................................................................................21 Adeno-associate virus vector.......................................................................22 Herpes simplex virus vectors.......................................................................24 Other methods of gene transfer....................................................................26 Summary.....................................................................................................................27 2 DESIGN AND IN VITRO KINE TIC STUDY OF HAMMERHEAD RIBOZYMES TARGETING MRNA OF HSV-1 ESSENTIAL GENES..................32 Introduction.................................................................................................................32 Materials and Methods...............................................................................................35

PAGE 8

viii Target Gene Selection and Determini ng Target Sequences of Hammerhead Ribozyme.........................................................................................................35 In Vitro Kinetic Studies.......................................................................................36 Kinase of RNA oligonucleotides..................................................................36 Time-course studies of hammerhead ribozyme cleavage............................37 In vitro multi-turnove r studies......................................................................38 Ribozyme Cloning...............................................................................................39 Results........................................................................................................................ .40 Discussions.................................................................................................................41 3 STUDIES OF RNA GENE THERAPY TA RGETING ICP4 MRNA OF HERPES SIMPLEX VIRUS......................................................................................................52 Introduction.................................................................................................................52 Materials and Methods...............................................................................................56 In Vitro Test of Hammerhead Ribozyme IC P4-885 Targeting ICP4 mRNA of HSV-1..............................................................................................................56 Transient transfection of E5 cells with ribozyme ICP4-885 to detect ICP4 mRNA Level.................................................................................56 Construction of a stable cell lin e expressing ribozyme ICP4-885...............57 Herpes simplex virus type 1 infection..........................................................58 Herpes simplex virus type 1 viral stock preparation....................................59 Plaque reduction assay to determine viral titer............................................59 Transient transfection of pTRUF 21-New Hairpin containing ribozyme ICP4-885.................................................................................................60 In Vitro Test of a siRNA ICP4-19 Targeti ng ICP4 mRNA of Herpes Simplex Virus Type 2....................................................................................................60 Results........................................................................................................................ .62 Ribozyme ICP4-885 In Vitro Test against HSV-1 Target...................................62 Effect of transient tran sfection of ribozyme ICP4-885 to ICP4 expression level in E5 cells.......................................................................................62 Transient transfection of pTRUF 21-New Hairpin containing ribozyme ICP4-885 in E5 cell line to test against KD6 (ICP4HSV-1) viral replication...............................................................................................62 Cell Line stably expressing ribozyme ICP4-885 tested against wild-type herpes simplex virus type 1 (17 syn +).....................................................63 Transient Transfection of siRNA Targe ting ICP4 mRNA of Herpes Simplex Virus Type 2 in HeLa Cells.............................................................................64 Conclusions and Discussion.......................................................................................64 4 RNA GENE THERAPY FOR HERPES SIMPLEX VIRUS KERATITIS; TARGETING A HSV-1 LATE GENE......................................................................73 Introduction.................................................................................................................73 Herpes Simplex Virus Keratitis...........................................................................73 UL20 Gene and Function of Its Gene Product.....................................................74 Materials and Methods...............................................................................................77

PAGE 9

ix Hammerhead Ribozyme Cloning........................................................................77 Test of Transient Transfection of Ribozyme Containing Plasmids against Wild-type Herpes Simplex Virus Type 1.........................................................77 Adenovirus Vector Packaging.............................................................................78 Preparation of Adenoviral DNA..........................................................................81 Herpes Simplex Virus Type 1 Vira l Strains and Viral Production.....................82 Cell Culture Tests of the Accumulative Effects of Ribozymes Packaged in Adenoviral Vector against Wild-typ e Herpes Simplex Virus type 1...............82 Real time Polymerase Chain Reaction to Compare Target Levels after the Ribozyme Treatment........................................................................................83 Testing Hammerhead Ribozyme agains t Drug Resistant Herpes Simplex Virus type 1 Strains..........................................................................................85 Growth rate study of drug resistance HSV-1 strains and wild-type HSV-1 with or without adenovirus p ackaged ribozyme treatments...................85 Acyclovir solution........................................................................................85 Acyclovir inhibition threshold fo r drug resistant HSV-1 strains.................85 Testing the hammerhead ribozyme agains t drug resistant HSV-1 strains....86 Results........................................................................................................................ .87 Transient Transfection of the Plasmi d Expressing Hammerhead Ribozyme Followed by HSV-1 Infection (17 syn +)..........................................................87 Dose-response Assay of Adenovirus Packaged UL20 Ribozyme-154 against wild-type HSV-1 Viral Replication.................................................................87 Inhibitory effect of UL20 ribozyme-154 on Wild-type Herpes Simplex Virus Type 1 Viral Replication..................................................................................88 Ribozyme Effect on Viral Target RNA and Wild-type Herpes Simplex Virus Type 1 DNA Replication.................................................................................89 Ribozyme Effect on Viral Replication of Herpes Simplex Virus Type 1 Drug Resistant Strains...............................................................................................89 Inhibitory Effect of a Hammerhead Ribozyme Targeting UL30 mRNA in Viral Replication..............................................................................................90 Discussion...................................................................................................................91 5 STUDIES OF DELIVERY VECTOR S FOR HSK GENE THERAPY...................107 Introduction...............................................................................................................107 Adeno-associated Virus Vectors.......................................................................107 Herpes Simplex Virus Vectors..........................................................................109 Adenoviral Vectors............................................................................................110 Iontophoresis Delivery of Oligonucleotides......................................................112 Materials and Methods.............................................................................................114 Establishing a Rabbit Model for HSV Ocular Infection...................................114 Study of Corneal Tropi sm of AAV Vectors......................................................115 Delivery of adeno-associated vi rus vectors to rabbit cornea......................115 Immunohistochemistry analysis of ade no-associated virus vector tropism in the cornea..........................................................................................116 Progress in Testing HSV Vector for Delivery in Cornea and Trigeminal Ganglion.........................................................................................................118

PAGE 10

x Delivery of non-replicating herpes simp lex virus type 1 vector in rabbit cornea....................................................................................................118 Protection from previous ocular infection against subsequent herpes simplex virus type 1 super-infection.....................................................118 Antibody neutralization assay....................................................................119 Proof of Principal Experiment: Te sting Adenoviral Vector Packaged Ribozyme in an HSV-1 Acute Infection Model in Mice...............................120 Ribozyme inoculation and HSV-1 inf ections in HSV-1 mouse footpad model....................................................................................................120 Quantitative real-time polymerase ch ain reaction to estimate viral replication level.....................................................................................121 Iontophoresis of Chemical Protected S ynthetic RNA Molecules in an Acute Ocular HSV-1 Infection Model in Rabbits....................................................124 Design of chemical modificati ons in hammerhead ribozyme RNA molecule................................................................................................124 Iontophoresis of synthetic chemical pr otected ribozyme for treatment of herpes simplex virus type 1 infection in rabbit.....................................124 Results.......................................................................................................................125 Adeno-associated Virus V ector Tropism in Cornea..........................................125 Herpes Simplex Virus Vector Delivery to Cornea and Trigeminal Ganglion...126 Adenovirus Vector Delivery of a Ribozyme targeting HSV-1 UL20 mRNA in a Mouse Footpad HSV-1 Infection Model.....................................................127 Analysis of the Effect of Iontophoresis of Chemically Protected Hammerhead Ribozymes in Rabbit Corneas in Limiting HSV-1 Infections.......................129 Discussion.................................................................................................................130 Adeno-associated Virus Vect or Tropism in the Cornea....................................130 Herpes Simplex Virus Vector for Ri bozyme Delivery into the Cornea and Trigeminal Ganglion......................................................................................131 Adenovirus Vector Study..................................................................................133 Effect of Iontophoresis of Chemically Protected Hammerhead Ribozymes in Rabbit Cornea in Limiting Herpes Simplex Virus Type I Infection..............135 6 CONCLUSIONS AND FUTURE DIRECTIONS...................................................150 Hammerhead Ribozyme Targeting ICP4..................................................................150 Ribozyme Targeting mRNA of Herpes Simple x Virus Type 1 Early/Late Essential Genes....................................................................................................................153 The Establishment of an Ocular Delivery System Using Herpes Simplex Virus Type 1 Vector......................................................................................................155 Viral Vectors for Corneal Gene Transfer.................................................................159 APPENDIX A ABBREVIATIONS..................................................................................................163 B REAL-TIME PCR PRIMERS AND PROBES........................................................168

PAGE 11

xi C RECIPE OF SOLUTIONS.......................................................................................170 LIST OF REFERENCES.................................................................................................172 BIOGRAPHICAL SKETCH...........................................................................................209

PAGE 12

xii LIST OF TABLES Table page 1-1 Ribozyme activity in nature and therapy..................................................................28 2-1 Experiment design of in vitro multi-turnover analysis.............................................44 2-2 Preparation of calibration curve fo r multi-turnover kinetics analysis......................45 2-3 Summary of in vitro kinetic analysis of all th e hammerhead ribozymes designed against HSV-1..........................................................................................................45 3-1 Ribozyme sequences and sequences of their resp ective targets...............................67 3-2 Conventional polymerase chain reaction primers....................................................67 3-3 siRNA duplex sequences and target sequences........................................................67 5-1 Treatment code for AAV tropism study.................................................................138 5-2 Antibody neutralization assay to de tect systemic antibody against HSV-1 following non-replicating HS V-1 (KD6) infection................................................138

PAGE 13

xiii LIST OF FIGURES Figure page 1-1 Herpes simplex virus type 1 genetic map.................................................................29 1-2 Regulation of viral gene e xpression during lytic infection......................................30 1-3 Human cornea anatomy............................................................................................31 2-1 Structure of a hammerhead ribozyme......................................................................46 2-2 The composition of G+C in HSV-1 genes using Vector NTI..................................47 2-3 Predicted folding pattern for ribozyme UL54-825 using MFOLD...........................48 2-4 The map of plasmid pTR-UF21NewHairpin for ribozyme cloning.......................48 2-5 Ribozyme sequences and their respective target sequences.....................................49 2-6 Gene targets for hammerhead ribo zymes in HSV-1 lytic life cycle.........................50 2-7 In vitro kinetic study of hammerhead ribozyme UL20-154......................................51 3-1 Map of plasmid pTR-UF11 generated by Vector NTI.............................................68 3-2 Reduction of ICP4 expression level in E5 cells by transient Transfection with ICP4rz-885...............................................................................................................69 3-3 Effect of ribozyme ICP4-885 on KD6 viral replication in E5 cell line....................70 3-4 Inhibition of wild-type HSV-1 viral replication rendered by ICP4 ribozyme-885 function.....................................................................................................................71 3-5 Effect of siRNA19 targeting ICP4 mRNA on viral replicat ion of wild-type HSV-2 (HG-52) in HeLa cells.................................................................................72 4-1 Membrane topology of UL20 protein predicted by the TMPred and SOSUI algorithms.................................................................................................................97 4-2 Maps of cloning constructs......................................................................................98 4-3 Transient transfection of UL20 ribozyme-154 significantly reduced wild-type herpes simplex virus type 1 (17 syn+ ) viral replication............................................99

PAGE 14

xiv 4-4 Dose-response of adenovirus delivered ribozyme treatments to herpes simplex virus type 1 viral yield............................................................................................100 4-5 Inhibitory effect of UL20 ribozyme-154 on wild-type herpes simplex virus type 1 viral replication...................................................................................................102 4-6 Real-time polymerase chain react ion results show the effect of UL20 ribozyme154 on viral mRNA and DNA................................................................................104 4-7 UL20 ribozyme-154 tested against series of herpes simplex virus type 1 strains for inhibitory effects...............................................................................................105 4-8 Inhibitory effect of UL30 ribozyme-933 on herpes simplex virus type 1 (17 syn +) viral replication......................................................................................................106 5-1 Trigeminal ganglia transduced by LacZ packaged herpes simplex virus vector...139 5-2 Iontophoresis treatment in rabbits..........................................................................140 5-3 Design of chemically modified hammerhead ribozyme targeting UL20 mRNA of herpes simplex virus type 1....................................................................................141 5-4 Immunostaining of rabbit cornea for green fluorescent protein expression delivered by different serotypes of adeno-associated virus vectors.......................142 5-5 Confocal microscope ob servation of green fluorescen t protein using alkaline phosphatase detection system.................................................................................143 5-6 Delivery of LacZ gene expression us ing HSV vector in the cornea of New Zealand white rabbits.............................................................................................146 5-7 Survival assay to obser ve protection effect of UL20 ribozyme..............................147 5-8 Delivery of chemically modified ribo zyme reduced dendrite formation in rabbit cornea caused by herpes simplex virus type 1 infection........................................149

PAGE 15

xv Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INITIAL DEVELOPMENT OF A RIBOZYME GENE THERAPY AGAINST HERPES SIMPLEX VIRUS TYPE I (HSV-1) INFECTION By Jia Liu December 2006 Chair: Gregory Schultz Cochair: Alfred Lewin Department: Molecular Genetics and Microbiology Herpes simplex virus keratitis is the mo st common infectious cause of corneal blindness in the western world. Although primar y ocular or oral in fection of herpes simplex virus type 1 (HSV-1) usually resolves within weeks, it leads to a latent infection of the trigeminal ganglia. The recurrent in fection causes immunoinflammatory effects in the cornea which leads to bli ndness. Currently antiviral drugs (oral or topical) can effectively reduce acute infec tion, but they cannot inhibit the recurrent infection. The toxicity of current drugs as well as the emergence of drug re sistant viruses leads to the need for an alternative ther apy that can prevent cornea l blindness caused by recurrent HSV-1 infection. Ribozymes have been extensively studied and broadly applied for gene therapy. Several hammerhead ribozymes were designe d to target messenger RNAs (mRNAs) of essential HSV-1 genes, and they were tested in vitro and in vivo for their therapeutic

PAGE 16

xvi effect against HSV-1 infection. A riboz yme targeting a late essential gene, UL20, showed a significant inhibitory effect to HSV-1 viral replication in vitro and in vivo UL20 ribozyme was packaged in an adenoviral v ector and the treatment significantly reduced the viral replication by sequen ce-specific cleavage of target mRNA in the cell culture. Even at a very high dose, no morphological di fference was observed between cells with or without adenoviral inf ection. By knocking down UL20 mRNA, this ribozyme greatly reduced the progeny viral DNA level consistent with the reduction of viral yield. The adenovirus packaged UL20 ribozyme-154 inhibited HSV-1 infections caused by drug resistant strains, while no effect was detected in acyclovir treatment of these strains. In vivo testing of UL20 ribozyme-154 was conducted in two animal models of HSV-1 infection: a rabbit ocular model and a mouse footpad model. By using iontophoresis to deliver chemically modified ribozyme RNAs to rabbit corneas, a significant reduction in the severity of lesions was observed. In the mouse footpad model, adenovirus packaged UL20 ribozyme-154 protected mice from death due to spread of the HSV-1 infection to the central nervous system (CNS). Overall, our studies showed promise for the application of a ribozyme based gene therapy approach to prevent HSV infection. By exploring differe nt delivery methods, this therapeutic reagent targeting HSV-1 la te gene mRNA can potentially be applied against recurrent infection at different tissues to ach ieve therapeutic effects.

PAGE 17

1 CHAPTER 1 INTRODUCTION Herpes Simplex Virus Herpes simplex viruses (HSVs) belong to the Herpesviridae family, subfamily Alphaherpesvirinae according to the Inte rnational Committee on Taxonomy of Viruses descriptions (ICTVD). These viruses were the first among th e human herpesviruses to be discovered and have been extensively studied. The word "herpes" comes from the ancient Greek word "herpein", meaning to creep or crawl in the writings of Hippocrates some 25 centuries ago.281 This reflects the ability of this virus to spread from initial infection sites (skin or mucosal surfaces), b ecome latent in various human tissues, and reactivate themselves later. HSVs are evol utionary successful DNA viruses with a high level of host specificity. There are two se rotypes of HSV, HSV-1 and HSV-2 (formal designations under ICTV description are human herpesviruses 1 and 2).297 HSV-1 and 2 infect the human body in a very similar wa y; however, they have evolved not only anatomic tropism115,142,367,368, but site-dependent inci dences of reactivations.203,286 HSV-1 causes orofacial and ocular inf ections in most cases and establishes latency in trigeminal ganglia, while HSV-2 prefers sacral ga nglia and causes genital infections.203,286 The seroprevelence of HSV-1 increases with age and reaches around 88% of the population at 40 years of age, while HSV-2 has an average seropervelence of 12-15%.396 HSV transmits by direct contact with infected secretions and enters the human body through lesions or mucous membranes. Epithelial cells represent the primary targets of HSV infection.

PAGE 18

2 Herpes Simplex Virus Biology The herpesvirus virion comprises an enve lop, an amorphorus pr otein layer called tegument, the icosahedral capsid, and an inne r core containing viral genomic DNA. The genome of herpes simplex virus type 1 (HSV-1) is 152kb linear double-stranded DNA duplex with a G+C (guanosine+cytosine) ba se composition of 67%. HSV-1 encodes more than 80 open translational reading fram es (ORFs) and most ORFs are transcribed into single transcripts (shown in Figure 11.). Reiterated HSV DNA sequences divide the genome into two unique sequen ces: designated unique long (UL) and unique short (US) sequences. During viral DNA rep lication, two or four different isomers can be generated by inverting reiterated sequences and/ or inverting the orientations of UL and US. Furthermore, intragenomic and interg enomic recombination events create polymorphisms. HSV infection is initiated by interactions of viral membrane proteins with cell surface components, and five out of twelve HSV membrane proteins have defined roles in viral entry. They are glycoprotein B (g B), gC, gD, gH and gL, and entry events involve interactions includi ng binding and fusion of viral envelope proteins with the cellular membrane. HSV recognizes glycosam inoglycan (GAG) chains of cell surface proteoglycans, preferentially heparin sulfate, which is considered as the binding receptor. Two viral glycoproteins, desi gnated gB and gC, mediate th e binding to heparin sulfate and substitute each other during the binding event.143 Following binding of virions to cells, fusion event takes place essentially by gD to trigger cell entry. Other viral envelop glycoproteins, gB and a heterodimer of gH-g L, are required to f acilitate successful fusion.329,330 In addition to heparin sulfate, ther e are two other cellu lar surface receptors participating in the fusion event. One was originally called HVEM (herpesvirus entry

PAGE 19

3 mediator)254 and later designated as HveA (Herpesvirus entry protein A)379, which is a human member of the tumor necrosis factor (TNF) receptor family. Second human entry receptors were identified as related memb ers of immunoglobulin superfamily including CD155239, which is poliovirus receptor, nectin-2 (originally HveB), and nectin-1 (HveC) which are homophilic cell adhesion molecules localizing to sites of cadherin-based cell junctions.6,307 A newly discovered HSV-1 entry receptor is generated in heparin sulfate by specific glucosaminyl-3-O-sulfotransferases.321 In summary, HSV entry of cells can be separated as two different events, bindi ng and fusion. Viral membrane proteins can interact with each other and comp ensate in the absence of others to facilitate entry. The abundant existence of cellular surface recepto rs also contributes to HSV viral entry, which determines the broad host range of HSV infection. Taking thes e into consideration, it is difficult to inhibit HSV infection by only preventing viral entry, since the entry is such a complex event and multiple factors from virus and host have to be considered. Herpes simplex virus can cause both lytic a nd latent infections, and persist in the host life-long. During lytic infection, HSV expression is tightly regulated. There are three kinetic classes of genes transcribed in strictly ordered sequence by the cellular RNA polymerase II: immediate early (IE or ), early (E or ), and late (L or ) gene. Transcription of genes (ICP0, ICP4, ICP22, ICP27, and ICP47) start once viral DNA enters the nucleus. These genes are regulated by promoters that are responsive to VP16, a tegument protein functioning as trans-activator by associating with cellular transcription factors. Immediate early gene products initia te later viral gene expr ession, and early gene products are mostly responsible for viral DNA re plication, while late proteins are mainly structural proteins for virion assembly (shown in Figure 1-2.). Afte r primary infection,

PAGE 20

4 HSV is capable of establishing latency in host sensory ganglia but may periodically reactivate and cause outbreaks. During latency HSV genomic DNA exists as an episome in the nucleus and no viral protein is detecte d. However, certain stimuli to host immune surveillance, which might be triggered by trauma, stress UV-light or any kind of immunosuppression, initiate a brie f viral replication in sensor y neurons and transport the virus back to the peripheral epithelium wh ere HSV propagates causing the next episode of HSV infection. Herpes simplex virus enters neuron endings during primary infection and undergoes retrograde transport throu gh direct interaction of viral UL34 protein with the intermediate chain of cytoplasmic dynein.276,401 Once reaching the nucleus, the viral capsid docks at the nuclear pore comple x (NPC) to inject viral DNA into the nucleoplasm.238 During latency, expression of al l viral genes except the latencyassociated transcripts (LATs) is shut off, a nd HSV-1 persists as a stable episomal element in the neuronal cell nucleus.238 During reactivation, it is presumed that the lytic replication cycle ensues within the nucleus, and viral genomes are packaged in capsids, which then bud through the inner and outer nuclear membranes. At this stage, the virus travels by anterograde transport along the axons251,295 through the interac tion of the viral RNA-binding protein US11300 with the ubiquitous kinesi n heavy chain. Upon reaching the axon terminal, the virus exits the termin al and infects neighboring cells. These special mechanisms of intraneuronal transp ort give HSV-1-based vectors an advantage for non-invasive inoculation targeting the peripheral nervous system (PNS)119,232,273, for example, in chronic pain therapy120,123,133 and preventing periphery neuropathy.54,55,306

PAGE 21

5 HSV-1 vector can also be used for CNS deliv ery, e.g., for therapy of neurodegenerative diseases.64,156,220 Herpes Simplex Virus Pathogenesis Herpes simplex virus type 1 infection affects 70-90% of people in most populations1,218, and it has been recognized as a human pathogen with significant morbidity, commonly causing lesions on skin or mucosal surfaces. Primary infection of HSV-1 usually takes place early in life in humans and very often has subclinical indications which heal within weeks without scarring. R eactivations from latent HSV infection often cause asymptotic shedding of viral particles which promotes the transmission of the virus. Occasionally, HSV infection can cause severe diseases, including sporadic encephalitis neonatal HSV-1, ocular in fections, and even lethal infections. Individuals with inherited or acquired immune de ficiencies (organ transplant recipients, patients under chemotherapy, or HIV patients) have a higher risk of developing serious conditions. Humans are the only natural reservoir of HSV. During its evolution, HSV has developed multiple strategies to escape from immune invasion and modulate intracellular as well as intercellu lar environments. After HSV in fection, the host innate defense mechanism is turned on to prevent viral en try of cells, viral pr opagation, and spreading between cells. Soon after, host-acquired immune response is activated to clear viral infections effectively. In response, HSV has developed three strategies for immune evasion. First, HSV can modulate cellular apoptoti c conditions to induce pro-apoptotic or anti-apoptotic effects on defender cells. HSV-1 Us12 gene product affects immune

PAGE 22

6 invasion by inhibiting cytot oxic T-lymphocyte recognition107,145; Us5 and Us3 gene products function to delay ce llular apoptosis to allow co mplete viral replication by inhibiting Fas-mediated pathway as well as caspase activation.165-167 HSV-2 ribonucleotide reductase (ICP10) blocks a poptosis in neurons by activating the MEK/MAPK survival pathway.283,284 There are also other HSV genes (HSV-1 genes 134.5, ICP27, LAT, and gene encoding gD9,65,235,285) involved in these modulation events. Herpes Simplex Virus can counterattack dendritic cells (DC) by inhibiting DC maturation as well as by inducing apoptosis. DC populations exist throughout the human body, particularly in th e interface to the environment (e .g. airways, skin and gut) where they capture antigens to pr esent and activate nave CD4+ T cells. HSV infection of DCs cause down-regulation of co-stimulatory molecules, including CD1a, CD40, CD80, CD86, the adhesion molecule CD54 (ICAM-1)249, and major histocompatibility class (MHC) I molecules. Infected DCs also ha ve lower IL-12 production. Together, this down-regulation leads to a weaker st imulatory capacity toward T cells.288 Although there is much that remains unknown in the mechanism of how HSV infection regulates DC maturation, it is clear that MHC class I molecu le expression is inhibited by formation of HSV ICP47 with TAP (transporte r associated with antigen presentation) to ICP47-TAP complex which blocks the translocation of the MHC class I peptide complex to the cell surface in vivo .145,169,352 Herpes simplex virus interr upts DC mediated T helper cell responses and antibody production by interfering with MHC II antigen processing. One example is that HSV glycoprotein B (gB) interacts with HLA-DR and HLA-DM polypeptides.263 As another effective defense strategy, HSV induces apoptosis of attacking DC which can be separated in tw o phases: anti-apoptot ic and pro-apoptotic

PAGE 23

7 phase. In the early stages, HSV infects DC to prevent apoptosis which allows sufficient viral replication. For example, HSV glycoprotei n D induces NFB activation which thereby protects against Fas-i nduced apoptosis by the reduct ion of caspase-8 activity and up-regulation of intr acellular anti-apo ptotic molecules.235 In the second phase, HSV induces apoptosis in immature DC by inducti on of caspase-8 path way, up-regulation of tumor necrosis factor (TNF), TNF-related apoptosis-i nducing ligand (TRAIL) and p53 in combination with a down -regulation of the cellular FL ICE-inhibitory protein (cFLIP).258 HSV also impairs mature DC migr ation and function to induce antiviral immune responses.290 Finally, the most significant f eature of HSV is the ability to establish latency in sensory ganglia where viral protein expressi on becomes quiescent. By these means HSV hides from host immune system with episodes of periodic reactivation. Herpes Simplex Virus Infection and Herpes Simplex Virus Keratitis Along with the development of human soci ety and lifestyles, HSV has become a very common pathogen worldwide. Currently, it is believed that more than 70% of the population worldwide is affected by HSV in fection. HSV-1, a widespread neurotropic virus, is one of the best-cha racterized human pathogens. In fection with HSV-1 is very common and associated with various di seases: oral-facial infections (e.g., gingivostomatitis, pharyngitis, and recurrent herpes labialis), skin infections (e.g., eczema herpeticum, and erythema multiform), and geni tal infections. HSV-1 infection can cause encephalitis, called herpes simplex ence phalitis (HSE), which causes pronounced mortality and morbidity despite of antiviral treatments.323,324 HSE is the most common cause of non-epidemic, acute fatal encephalitis in the western world.322 Herpes simplex

PAGE 24

8 virus can also cause severe ocular diseases. In humans, HSV ocular infection generally begins as conjunctivitis, and it can proceed to corneal epithelial keratitis or damage deeper layers.218 Herpes Simplex Virus Keratitis Herpes simplex virus keratitis (HSK) is the most common cause of corneal blindness in the United States218, and around 300,000 cases of HSV eye infections are diagnosed yearly in the U.S.388 HSK is caused by HSV-1 inf ection on the cornea in most cases (in very rare cases it is caused by HS V-2), and it is initiat ed by a low dose of infectious virus that causes primary infection in corneal epithelial cells. Replication of the virus causes loss of epithelial cells leadi ng to corneal lesions indicated by branching shapes which can be detected usi ng calcein or Rose Bengal staining.102 These branching lesions are termed dendritic keratitis and mo re extensive lesions are called geographic ulcers. Herpes simplex virus type 1 viral proteins that are involved in intracellular spreading and host immune res ponses are believed to be resp onsible for different ulcer formations that occur in some individuals Following the initial infection, HSV-1 establishes latency in trigeminal ganglia through neurons innervating the corneal epithelium and stroma. The reactivation of HSV-1 happens spontaneously when individuals are under various conditions of stress. Th e reactivation often causes asymptotic viral shedding, and attendant cl inical symptoms may appear depending on patients immune status. Herp es simplex virus type 1 reactiv ations in the cornea caused by latent infections from the trigeminal ganglia or other sites46,46,122,122,229,229,266,266,267,267,301,301 lead to recrudescent keratitis. During each episode of reactivation, elevated corneal damage can result in stromal scarring and corneal neovascularization which are caused by increasi ng level of host immunity against the

PAGE 25

9 virus. Theses lead to th e loss of clarity of the corn ea and, eventually, to corneal blindness. Human Corneal Anatomy and Contributions to Herpes Simplex Virus Keratitis The human cornea has unique features and these contribute to th e pathogenesis and disease progress of Herpes simplex virus kerati tis (HSK). The cornea is the transparent tissue in the front of the eye and is prim arily responsible for transmitting light on the retina. Therefore the clarity of the cornea is extremely important to the vision. There are five cell layers comprising human cornea (show n in Figure 1-3), from front (facing light) to back they are epithelium, bowmans laye r, stroma, the Descemets membrane, and endothelium. The epithelium is a stratified squamous, non-keratinizing cell layer about 5 cell-layers thick. Epithelial basal cells have the stem-cell like feature in that they are able to regenerate epithelial layer in 2 to 4 days. Corneal epithelial stem cells are believed to reside in the basal cell layer of limbal epit helium at the transitional zone between the cornea and conjunctiva.408 Bowmans layer is a thin acellular tissue considered to have no regenerative capacity, and it is believed that epithelial wounds heal quickly over an intact Bowmans layer. The next layer is the stroma which constitutes about 90% of the cornea. The stroma consists mainly of colla gen fibrils, ground substa nce, and keratocyte which is the predominant cell of the stroma but only accounts for about 5% of the dry weight of the cornea. Distur bing the regular, uniform array of collagen will cause loss of clarity, and the ground substance plays a majo r role in maintaining regular array of collagen fibrils. In response to stromal in jury, the keratocytes migrate into the wound area and undergo transformation into myofibroblasts which contribute to the scar formation by proliferation and collagen pr oduction. The layer between endothelium and stroma is called Descemets membrane wh ich is produced by the endothelium. The

PAGE 26

10 endothelium is a monolayer of regularly sh aped hexagonal cells which lie posterior on Descemets membrane. The main function of endothelium is to control stromal hydration which is essential for corneal transparenc y, and they do not exhibit mitotic activity. The cornea is believed to contain highes t amount of neuron innervations among all the human tissues, and sensory innervations of the cornea are supp lied by the ophthalmic branch of the trigeminal nerve. The nerve fi bers of the cornea, radially oriented nerve bundles, enter the cornea from the sclera at the middle one third of its thickness. These nerves lose their myelin sheath after trav ersing 0.5-2.0mm into the cornea and then continue as transparent axon cylinders whic h contribute to the ma intenance of corneal clarity. After passing Bowmans layer, they ramify (send out branches) an d end within the epithelium as free nerve endings. The ne rve bundles in the sub-basal plexus of the human cornea form a regular dense meshwork w ith equal density over a large central and mid-peripheral area. These neuron innervat ions open the gate for HSV transport to trigeminal ganglia where it establishes latency. Herpes Simplex Virus Keratitis Pathogenesis Ocular herpes simplex virus (HSV) infections involve direct vira l cytopathic effects and the immune response, which both contribut e to ocular damage. Primary or acute ocular infection begins with a small amount of HSV infectious viral particles. Although infectious viral load might be higher when c onjunctivitis is present, and viral replication is required for herpes simplex virus keratitis (HSK) pathogenesis.11 It is believed that once HSV infection is initiate d, a threshold level of viral replication is required to develop HSK.36,182 This phenomenon implies that it is not necessary to completely eliminate the viral replication in or der to achieve a therapeutic effect.

PAGE 27

11 Host immune response plays a major role in the next stage of HSK. Responding to viral replication, corneal a nd surrounding cells produce seri es of pro-inflammatory cytokines as well as chemoki nes. These include IL-1 IL-1 IL-8, IL-6, IFN, TNF, MIP-2, MCP-1, IL-12, and MIP1.80,138,175,270,338,339,364,400 Interferon (IFN, ) are also released to inhibit viral replication dir ectly, and this effect can be enhanced by IFN.373 These pro-inflammatory molecules draw neutrophils to the infection sites. Neutrophils attack infected cells through numbers of eff ector mechanisms including phagocytosis of antibody coated virus particles and release of cytokines.243,252,350 Langerhans cells are also recruited to the site of infection, particul arly the center cornea, where they acquire antigens and travel back to draining lymph nodes to activate T-cells. Eventually, all these events activate and attract T-cells to the infection site.50,240,335 The T-cell response appears to be a Type IV hypersensitivity response mediated primarily by TH1 CD4+ cells.89,100,118,335,406 During these events HSV in fection is gradually cleared from the cornea. However, scar tissue also forms in the stroma. The damage in the stroma causes the cloudiness of cornea, eventual ly resulting in blindness if this happens repeatedly. There are three factors that have an impact on HSK pathogenesis: the genetic background of the host, the host immune respons e, and the strain of HSV. The hosts genetics make-up, although poorly understood, a ffects the course of infection through a number of physical factors. These genetic factors consequently a ffect the severity of corneal infection, given the fact that reducing viral titer even slightly could prevent HSK disease progress. Studies of HSV corneal infection in mi ce indicated that strains of inbred mice have different su sceptibilities to HSK (C57BL/6 mice being most resistant,

PAGE 28

12 DBA/2 mice being most susceptible, and BALB/C mice being intermediate).240,337 The pattern of resistance parallels with the severity of acute infection and susceptibility of encephalitis.172,223 While a preponderance of HSK cases occur in males according to series of studies219, female patients are more likely to have more severe forms of the disease. These suggest a host genetic f actor which contributes to HSK disease progression. The presence of a mucin layer on the outer surface of cornea, the secretion level as well as the effectiveness of antivir al molecules (e.g., lactoferrin) in the tear film109, and the production level of numbers of cellular molecules (e.g., interferon, TNF, NO) all contribute to immune resistance, indicating an impo rtant role of host genetics to the outcome of corneal in fection. There are also ot her unknown host gene products involved in the progress.223,394 A recent study indicated that an autosomal dominant resistance locus Hrl (herpes resistance locus) mapped to chromosome 6 of mice224 affects reactivations and viral replication in the corn ea as well as in neurona l cells. It has been suggested that the igh locu s on chromosome 12, loci on chromosomes 4, 5, 13 and 14 affect the susceptibility/resistance to HSV, and loci on chromosomes 10 and 17 seem to be specific for ocular disease.265 Although functions of these ge ne products as well as the mechanisms of these host genes still remain to be studied, these host factors provide a new perspective for prevention of HSK. Targ eting interactions of host factors and HSV for HSK therapies can help to reduce the risk of this blind-causing disease. Host innate and acquired immunity plays a very important ro le in the disease progress of ocular HSV infection. On th e other hand genetic differences among HSV strains also alter the clinical indications and severity.125,376,391 Different composition of viral genes involved in DNA replicati on, e.g., the origin binding protein (UL9)35,

PAGE 29

13 processivity factor (UL42)35, ribonucleotide reductase (encoded by UL39 and UL40)34 and thymidine kinase121, all can affect virulence in corn ea. Genes encoding viral structure proteins can also be corneal vi rulence factors, e.g., the gene encoding a host shutoff (vhs) protein (UL41 gene)35,336, the gene encoding 1 34.5 protein387 which also has neurovirulence function, and UL3335 encoding a protein essential for the cleavage and packaging of concatameric herpesvirus DNA into preformed capsids. HSV viral gene products also serve as targets for immune response, e.g., UL21, UL49, and the gene encoding gK can induce antibody-dependent cell-mediated cytotoxicity (ADCC).118,189 The identification of more immune target gene s will be beneficial in modifying treatment strategies for this immun opathological disease. Overall, HSK pathogenesis involves a co mplex interaction between host genetic background, host immunity and th e constellation of viral ge nes. A better understanding of these interactions will facilitate the treatment of this disease more efficiently. Treatments and Emerging Therapies HSV infection is a significant cause of oc ular morbidity. Currently there is no drug or any form of therapy available that will eliminate the causative agent. Detailed classification of various clini cal manifestations of ocular HSV infection has facilitated improving treatment strategies.154,217 According to Herpetic Eye Disease Study (HEDS)389, appropriate steroid usag e should be applied to su ppress immune response. Corticosteroid usage has been an important part of successful management of HSK. However, because they are immunosuppressive, the use of corticosteroids is counterindicated early in the in fection. In the early stage of HSK, when infection takes place in epithelium and in stroma, active HSV infection can be controlled by topical or systemic antiviral treatments. There are a limited number of antiviral agents available to

PAGE 30

14 treat HSV infection, including idoxuridine (I DU), Vidarabine (Ara-A), trifluridine (Triflurothymidine-TFT), acycl ovir, ganciclovir, and Cidof ovir. These are nucleoside analogues, and there are also metabol ite analogues with antiviral effects.247 Idoxuridine (IDU), a thymidine analogue, was the first agent found to be effective in the treatment of HSV keratitis.173 Although IDU is useful in inhibiting viral replication in epithelial infection, it can cause an allergic reaction. Idoxuridine has poor solubility and low penetration rate, and is rapidly inactivated As with other antiviral drugs, IDU treatment leads to the emergence of viral resistance. The mechanism of IDU toxicity is that it is incorpor ated into host DNA, and is the sa me cause of toxicity as other antiviral drugs (e.g., Vidarabine, trifluridi ne) which often affect the regenerating epithelium.210 Adverse effects often cause seve re problems in patients (punctate keratopathy277) which complicate the antiv iral treatment. Idoxuridine, Vidarabine, and trifluridine are mostly used as topical antiviral drugs for HSK. Because of their limitations in solubility, short half-life, and penetration when treating deep stromal diseases and uveitis, they are often found to be inefficient. Acyclovir (ACV), a purine analog, has ma de the significant contribution in antiviral therapy of HSV and Varicella-Zoster Virus (VZV) infection. It can be activated by the viral thymidine kinase followed by phosphorylation by two cellular kinases to form an active form with triphosphate. The triphosphate form of ACV is recognized more readily by the viral DNA polymerase than by cellular polymerases. Therefore, it inhibits viral DNA replication specifically210 and has low toxicity. An oral ACV dose of 400mg, five times daily can provide therapeutic levels in the tears, serum, and aqueous humor.71 Topical treatment of ACV can be at a dose of 3% ophthalmic ointment five

PAGE 31

15 times daily applied for 10 to 14 days in th e case of denditic ulceration. Patients might have to be on ACV for a longer period if geographic ulceration is diagnosed, and often for months in the case of stromal diseases.70,157 Acyclovir can have side effects of neurotoxicity131, caused by crystallizati on of ACV and intratubular obstruction, which are presented as confusion, hallucinations, seiz ures, and coma. Alt hough rarely encountered, they can often be mis-interpreted as indications of he rpes encephalitis.141 HSV develops resistance to ACV predominantly by alternati ons in thymidine kinase (TK) and mutations in viral DNA polymerase181, although polymerase mutations are less frequent. However, problems due to ACV resistant HSV strain s almost exclusively affect immunecompromised patients.14,104,320 The bioavailability of oral ACV is relatively low, only 1020%, while Valacyclovir and L-Valine ester of ACV has higher absorption rate (50%) which can rapidly convert to ACV in liver.365 Ganciclovir (Brovinyl Deoxyuridine) acts in a very similar manner as ACV by compe titively inhibiting vi ral DNA polymerase. Cidofovir (3-Hydroxy-2-phosphonyl-methoxypropyl cyto sine, an acyclic nucleoside 5monophosphate) is a very promising broad-spectr um antiviral agent with longer half-life permitting once a week dosing. However, Cidof ovir is available only as intravenous (IV) preparation which has s ubstantial nephrotoxicity.63,255 In summary, current antiviral treatment s of HSK with nucleoside analogues can control symptoms of disease but cannot cure or prevent the infections The isolation of drug resistant HSV strains, particularly in immune-compromised pa tients, has attracted more clinical attention. It ha s been estimated that about 4-7%61,62,66,374 of patients experience infection caused by drug resistan t HSVs after antiviral treatment with nucleotide analogues. Although in immune-compete nt patients the incidence of infection

PAGE 32

16 with drug resistant HSV is much lower (about 0.3%)13,31,69, alternative therapies will be beneficial to overcome limitations of current antiviral drugs for general public health. Since HSV infections continue to be prev alent, it is importa nt to explore new treatments to improve the management of drug resistant HSV infections, suppress recurrent infections, and ideal ly eliminate reactivations. There is also a need for treatments that require less frequent dosing. Very often when lesions are more advanced, current medications are no longer efficient. Furthermore, alternative therapies that lack the toxicities of existing medi cations will be beneficial. Immunomodulating agents, such as resiquimod, can act on the viruses indire ctly by inducing host production of cytokines and thereby reduce recurrences of herpes. The new helicase primase inhibitors are the first non-nucleoside antiviral compounds and ar e being investigated for the treatment of HSV disease. Along with the above progress, development of gene therapy methods may contribute significantly in HSV disease management. Gene Therapy of Herpes Simplex Virus Infection The concept of gene therapy arose during the 1970s, along with the development of recombinant DNA technology. Gene therapy has been used to deliver foreign genes to cells for correction of genetic deficits. Furthe rmore, with the improvement of viral vector delivery, gene transfer can be conducted in a tissue-specific manner. A significant number of studies indicate that gene th erapy can provide corrections of phenotypes in vitro and in vivo now making it a broadly accepted approach to therapy.106,369,380 Gene Targeting Disease-causing genes can be down-regulated at the post-transcriptional level. Therefore, by reducing or i nhibiting gene expres sions, disease progress can be suppressed or even reversed. Currently, agents for sequence-specific mRNA i nhibition are antisense

PAGE 33

17 oligodeoxynucleotides (ODNs), ribozymes and their DNA counterparts (DNAzymes), and RNA interference (RNAi). These technique s been extensively studied in order to improve the therapeutic effect for these met hods, to achieve an efficient delivery, avoid off-target effect, and to locate target sequence. Antisense oligodeoxynucleotides As early as 1978, it was demonstrated that an oligodeoxynucleotide (ODN) containing 13 nucleotides complementary to long terminal repeat (LTR) of Rous Sarcoma virus (RSV) could inhibit RSV tr anslation as well as viral replication.333,403 This initiated the study of m echanism of antisense mediated inhibition. Large scale ODN synthesis and the development of backbone modifications to incr ease stability as well as effectiveness have permitted antisense ODNs to be developed as drugs and to undergo clinical trials. Vitravene (ISIS pharmaceuti cal, Carlsbad, CA, USA) is approved by FDA (Food and Drug Administration) fo r treatment of cytomegalovi rus-associated retinitis by targeting IE2 mRNA of cytomegalovirus (CMV). Another ODN, Genasense (Genta, Berkerly Heights, NJ, USA) has finished its phase III clinical trial for metastatic melanoma in conjunction with chemotherapy. The mechanism of antisense ODNs varies depending on the backbone modification.33,90,332 Generally nega tively charged ODNs (e.g., phosphodiesters and phosphorothioates) at tract RNase H to cl eave mRNA at the DNA-RNA helix. Other backbone modifications (2-O-methyls, 2-O-allyls, and peptide nucleic acid) are classified as steric hindrance ODNs, whic h do not recruit RNase H but block translation, splicing, and nuclear transpor t. However, the delivery of antisense ODNs is the major limitation for their applicatio n in therapy.

PAGE 34

18 Ribozymes Ribozymes are catalytic RNA molecules w ith the ability of breaking or forming phosphodiester bonds even in the co mplete absence of protein. In the ribozyme catalysis event, a 2' oxygen nucleophile attacks the adjacent phosphate in the RNA backbone resulting in cleavag e products with 2 ,3 -cyclic phosphate and 5 hydroxyl termini. Ribozymes exist naturally, and they were di scovered in group I intron in the large ribosomal RNA of many si ngle-celled eukaryotes and fungal mitochondria, the RNA component of RNase P, group II introns (from fungal and pl ant mitochondria as well as chloroplasts), plant viroid a nd virusoid RNAs, hepatitis delta virus, and a satellite RNA from Neurospora crassa mitochondria. Ribozymes can be modified to contain a simple catalytic core and guide sequen ces to locate target RNA (as summarized in Table 1-1). Furthermore, they can be delivered in trans by cloning in plasmid or viral vectors for sequence-specific gene knock-down. The bioche mical aspect of ribozymes is discussed in Chapter 2. Hammerhead and hairpin ribozymes, discove red from different plant viroids and virusoids, have been tested as gene therapy agents extensivel y. Two phase I clinical trials using ribozymes for gene ther apy against human immunodeficiency virus 1 (HIV-1) were conducted5,393 in the U.S. The potential of thes e ribozymes in antiviral therapy of hepatitis C virus and chronic hepatitis B vi rus infections has also been recognized. Additional studies have indicated that RNase P also has significant potential for antiviral and cancer therapy.67,354-360 Moreover, tissue-specific delivery provides promise for ribozymes in gene therapy of diseases caused by dominant genetics mutations. Chemically modified synthetic ribozym es display improved nuclease resistance compared to RNA. These stabilized synthe tic ribozymes, maintaining their catalytic

PAGE 35

19 ability, have shown promising results in ta rgeting RNAs associat ed with induction or progression of cancer in vitro and in vivo .225,278 Direct delivery of stabilized ribozyme RNAs has several advantages (e.g., it can be appropriately dosed and can be stopped, if necessary) and has been eval uated in clinical trials.366 Another catalytic nucleic acid is DNAzyme, a small DNA molecule with the ability of site-specific cleavag e of RNA target. DNAzymes do not exist in nature and have been developed through in vitro selection. Because DNAzymes are inexpensive to synthesize and can be modified chemically which increase their stability, they ar e useful alternatives to antisense ODN and ribozymes. However, th ey can only be delivered exogenously and have the same limitation as antise nse ODNs with respect to delivery. RNAi and si/shRNA RNA interference (RNAi) repr esents an active organism -defense response against foreign RNA, which demands cellular machin ery to initiate the process. In many organisms (such as C. elegans D. melanogaster and vascular plants) the silencing signals can be amplified using an RNA-dependent R NA polymerase. In eukaryotic cells, the RNAi pathway also regulates gene expre ssion that determines cell fate such as differentiation stages and cell survival. The physiological in ducer of RNAi in cells is double-stranded RNA (dsRNA), which is 21-23n t long and processed by Dicer (a cellular endonulease) from longer dsRNA. This 2123nt dsRNA contains 3 overhang, and is called siRNA (small interfering RNA). The term inal effector molecule is the antisense strand separated from siRNA which is then in corporated into the RNA-induced silencing complex (RISC complex) and serves as a guide to the complementary sequence in target mRNA. RISC conducts the endonucleolytic cleavage of mRNA within the target sequence which leads to the de gradation of mRNA, and then the antisense recycles for

PAGE 36

20 additional mRNA targeting.27 For gene therapy applicati ons, siRNA can be delivered in the form of hairpin structure with a single st em loop, referred to as short hairpin RNA or shRNA. Short hairpin RNAs are processed by Dicer into siRNAs. RNAi pathway provides a very powerfu l gene silencing approach by mRNA degradation, which can be used in gene therapy. Experience from antisense ODN and ribozyme therapies have led to the developm ent of chemically modified siRNA with resistance to endonuclease degradation. In th e case that disease-ca using gene expression localizes in easily accessed tis sue, siRNA can be delivered without transfection reagents or delivery vehicles, e.g., intranasal or intr atracheal administration of siRNA in lung gene silencing.28,405 However, to improve the tissue specific uptake of siRNA and provide long-term effect in mammalian cells, sh RNA can be delivered in a DNA vector. Different promoter complexes can be used for conditional regulaton of shRNA function. A major concern for gene therapy is that siRNA, and other antisense molecules such as ribozymes an oligodeoxynucleotide ( ODN), can have off target effects caused by partial homology between the inte nded target RNA and another RNA.161,310 This problem is worse for siRNA delivered as shR NA, since they can block translation of an RNA by binding to the 3 UTR of an mR NA and acting as a microRNA (miRNA).57 This inhibition requires as few as 7 base pairs between the siRNA and the 3 UTR. In addition, introducing excess amounts of siRNA could cause saturation of cellular RNAi machinery, consequently interfering with normal cellular functions. Finally unintentional toxicity of si /shRNA might come from induc tion of interferon response particularly in specialized sensitive cell lines. When they are used at high concentrations of siRNAs38,93, inflammatory effects can be induc ed. These can be avoided by using

PAGE 37

21 siRNAs of high potency so that they are not needed in high concentration. In summary si/shRNA provides a very efficient approach for gene silencing a nd has been exploited extensively in gene therapy. However, t oxicity and off-target effect may cause significant side-effects in clinical applications. Delivery Systems Adenovirus vectors Adenovirus is a 36kb double-stranded DNA viru s, originally isolated from adenoid tissue.302 Many features of adenoviruses make them well-suited for gene therapy. Adenovirus is capable of in fecting both actively dividi ng and quiescent cells, and its genome does not integrate into the host ge nome, therefore, av oiding the risk of mutagenesis. The high capacity of adenovirus allows insertion of large foreign genes, as the most advanced adenovirus vector can accommodate up to 37kb of transgene. High titers of adenovirus pr eparations can be obtained easil y by propagating virus in 293 cells (human kidney embryonic cells), and the high e fficiency of adenovirus transduction also makes it a very attractive vector for gene tr ansfer. The first generation of adenovirus vector (containing E1 gene de letion) triggers an immune-res ponse which leads to the loss of transgene expression within weeks in vivo The second generation of adenovirus vectors incorporates a deletion of the E2 and/or E4 gene in addition to the E1 gene, and the resulting vector is therefore less imm unogenic; however, the immune response still exists. Recently, the third generation of adenovirus vectors has been constructed by removal of the entire viral genome except for tw o ITRs (internal terminal repeats) and the packaging signal, and they are referred to as helper-dependent or gutless vectors. Although many problems remain to be resolved for large-scale prep aration of helper

PAGE 38

22 dependent adenovirus, the third generation ve ctors have shown promise for gene therapy applications.86,96,244,260 Recombinant adenovirus vectors have been tested extensivel y in the cornea for gene therapy. Although transgen e expression turns on early a nd lasts for a fairly long time in corneal epithelial cells in vitro and in conjunctival epithelium362 ex vivo a serotype 5 vector failed to transduce cornea l epithelial cell ex vivo183,208 and in vivo .362 These results suggested the re sistance of corneal epitheliu m to the adenovirus vector delivery. However, adenovirus vectors are capable of transducing corneal endothelium208 and keratocytes49, which showed the promise of using Ad vectors for ocular gene therapy. Since donor corneas are routinely maintained ex vivo for an extensive period of time before transplantation, tr eatment with Ad vectors ex vivo offers a selective gene delivery method to the cornea. Adeno-associate virus vector Adeno-associated virus is a Depend ovirus in the family Parvoviridae.188 The genome of AAV is a 4.7Kb linear, single-strand ed DNA molecule and encodes two large open reading frames (ORFs) flanked by invert terminal repeats (ITRs). The viral capsid is non-enveloped with icosahedral symmetry and a diamet er approximately 25nm. This small diameter makes AAV better at diffusing th rough tissue structures than adenovirus. A characteristic feature of AAV is that infectio n of a cell in the absence of a helper virus cannot lead to a lytic infection. No known human disease has been associated with AAV infection. Hence, AAV is classified as a defective and non-pathogenic human parvovirus. An adenovirus (Ad), a herpesvi rus (HSV-1, HSV-2 and CMV), or a vaccinia virus can supply complete helper functi ons for fully permissive AAV infection.40,153,311

PAGE 39

23 Adeno-associated virus is a human non-pa thogenic virus with a broad host range among mammals. AAV latent in fection in humans appears to be common, as antibody to AAV2 can be detected in between 50% and 96% of the normal population.53 However, no human diseases are associ ated with wild type AAV29, and there is no immunologic evidence for AAV re-activation upon challenge by a helper virus.188 In the absence of a helper virus, AAV establishes latency by inte grating into the host genome or by forming an episome. In human cells, AAV prefers to integrate in a site-specific manner on human chromosome 19q13.3-qter.190 In recombinant AAV vectors (rAAV) the rep protein is absent, and there is no integr ation between inverted term inal repeats (ITRs) and the human chromosome 19 locus, however the vi rus may integrate in a non-site specific manner. Another advantage of using AAV as a gene transfer vehi cle is the long-term transgene expression in non-dividing cells.2,130,280 The maximal transgene expression can be detected in weeks and typically persists for the lifetime of the animal.170,212,327,328,399 In dividing cells, such as rege nerating liver, however, episomally maintained virus could be diluted, and gene expression might decrease over time.245,380 There are a number of AAV serotype s and over 100 variants isolated today.112,113,256,312 Based on the current understand ing of AAV serology, AAV1-5 and AAV7-9 are defined as true serotypes. Some serotypes preferentially transduce certain tissues: AAV8 transduces liver with high e fficiency; AAV1 works very well in muscle transduction; and AAV7 demonstrates effici ency in transducing skeletal muscles equivalent to that observed with AAV1.112 AAV1, AAV2 and 5 all ca n be used to target murine retina, however, AAV1 has earlier onset of transgene expression and has specificity to the retinal pigment epithelium (RPE).10 In the brain, AAV5 transduces only

PAGE 40

24 neurons as does AAV283; in the CNS, recombinant AAV1 and 5 (rAAV1 and rAAV5) can be used to target th e entire hippocampus (HPC)41, in contrast, transduction by rAAV2 is limited in the hilar region of HPC.171,184,234 Currently there are at least 20 clinical trials that have been either completed or initi ated to evaluate 15 different AAV2-based vectors.52 A cross-packaging system has been developed to produce hybrid AAV vector packaging AAV2 genome wh ile containing capsid proteins of a different serotype (a pseudotype). This provides an unbiased comparison of transduction efficiency of different AAV capsids containing the same transgene expression cassette.127,292 The development of hybrid AAV vector engineerin g, (including peptid e ligand insertation261, production of mosaic AAV136,291 and chimeric AAV32, and combinatorial AAV vector libraries230,282) enables constructions of vectors with improved tropism and increased tissue specificity. Although cr oss-reactivity of different AAV serotypes appears to be tissue/specie specific and delivery method dependent398, it is often recognized that in vivo administration of one serotype is not affect ed by pre-existing neut ralizing antibodies of the other.279,398 Alternative gene transfer vector s of different AAV serotypes can be applied when patients have high titers of antibody against one serotype, for example AAV2. Moreover, multiple vectors deliver ing various genes simultaneously can be applied.294,316 Herpes simplex virus vectors Herpes Simplex Virus (HSV), a neurot ropic double-stranded DNA virus, is a promising vector for gene transfer applica tions. HSV contains a large genome which provides significant capacity to accommodate multiple or large transgene cassettes by replacing dispensable and pathogenic genes. The toxicity of HSV vector can be minimized by eliminating genes necessary for viral replication (IE gene deletions).

PAGE 41

25 These replication-defective HSV vectors can be propagated in cell lines complementarily expressing these gene products. Because HSV-1 has a broad host range and is able to infect dividing as well as quiescent cells, it can deliver transgenes to a variety of tissues or cell types. By exploiting the ability of HSV-1 to infect neuronal cells and establish latency, HSV-1 viral vector is particularly suitabl e for long-term transgene expre ssion in the nervous system. As recombinant HSV vector maintains the natural HSV-1 axonal transport mechanism, it can be used to deliver foreign genes to inaccessible tissues. Delivery method can be simplified by noninvasive procedures, e.g., subcut aneous vector inocul ation. This allows transgene expression within the nucleus of th e inaccessible trigeminal ganglion as well as dorsal root ganglion. As the nervous system is the natural target for HSV-1 latency, latency promoter complex can be used to achieve long-term tran sgene expression in neurons. The unique mechanisms of HSV-1 viral entry and transport (retrograde or anterograde transport) have led to the ex tensive vector develo pment in neurological applications. The natural existence of HSV-1 entry receptors obviates the need to modify viral surface for a broad cell-t ype targeting, as HSV viral entr y has been described in the section of Herpes Simplex Virus (HSV) Bi ology earlier. In the sensory neurons of periphery nervous system, HveC, a major mediator for HSV entry, is abundantly expressed233, and thereby HSV vector can be applie d to target these cells. However, efficient transduction of peripheral motor ne urons cannot be achieved due to low levels of HSV receptor expression, targeting thes e cells requires alterations of viral glycoprotein(s). Very similar to other vira l vector applications, HSV-1 vectors can be

PAGE 42

26 modified to retarget specific cell types. Two criteria must be met for this purpose: first, the natural receptor-ligand inte ractions of the virus need to be diminished; second, the virus must be redirected to preferred recep tors by either alterations of viral surface206,407 or the addition of adaptors.8,124 Herpes simplex virus vectors have also been evaluated to trans duce ocular tissues. It has been shown that HSV vector could transduce corneal epithelium in vivo after topical application of HSV vector to the mouse cornea.331 However, corneal scarification on the superficial epithelium before inoculati on of viral vector was necessary to induce efficient transgene expression, and transgen e expression was limited surrounding the site of scarification. It was also suggested in the same study that by using the topical application, HSV vector could only transduce a few cells of the iris pigmented, trabecular meshwork, and ciliary body. This limited th e application of using HSV vector for corneal gene transfer. Overall, various aspects of HSV basic bi ology have been exploited to expand the utility of HSV vector as therapeutic vector for diseases in periphery nervous system and central nervous system. Other methods of gene transfer A number of delivery methods for gene tr ansfer have been studied extensively, including iontophoresis, elec troporation, nanoparticles, cat ionic lipid-mediated gene transfer, etc. Each of these can be made efficient, but all lead to transient gene expression and, therefore, may not be suited fo r the long term effect of a chronic disease or recurrent disease. Efficien t delivery is one of the keys leading to the success of gene therapy. Different approaches can be chosen depending on factors such as the delivery tissue, the disease mechanism, and the therapeutic effect pursued.

PAGE 43

27 Summary The ultimate goal of HSV infection therapy is prevention: preventing recurrent herpes simplex virus (HSV) infection and c onsequent tissue damage. In spite of the development of current antiviral drugs, no av ailable therapy can reach this goal. HSV infection triggers host immune response, downs tream events of the disease are affected by the interaction of host and HSV. Herp es simplex virus infection on cornea has significant impact on patients lif e. Considering the prevalence of HSV infection among the population, it is a major concern for genera l public health. Inhi biting HSV replication at the post-transcription level by down-regul ating HSV essential gene expression shows promise for antiviral therapy. By establis hing surveillance agains t each episode of reactivation either at the corn eal epithelium or in the trigeminal ganglia, HSV viral load can be significantly reduced, therefore preventing subsequent damage to the stroma and corneal blindness. The goal of this study is to test ther apeutic ribozymes/siRNAs for their potential in inhibi ting viral replication. By testing a proof-of-principal concept, this study provides a guide for future applications using ribozymes/siRNAs in anti-HSV gene therapy, especially in the cornea. Furthermore, this study also provides experience in corneal transgene delivery. Fi nally while testing antiviral reagents targeting genes from different kinetic classes of HSV-1, a better understa nding of HSV-1 biology and interaction of HSV-1 pr oteins can be achieved.

PAGE 44

28 Table 1-1. Ribozyme activity in nature and therapy.213 Ribozyme Catalytic activity Relevant role in nature Therapeutic applications Hammerhead Sequence specific ribonuclease Self-cleaving RNA Digestion of viral, oncogene or mutant mRNA Hairpin Sequence specific ribonuclease Self-cleaving RNA Digestion of viral, oncogene or mutant mRNA RNase P Structure specific ribonuclease tRNA processing Digestion of viral mRNA Group I intron RNA cleavage and ligation Splicing RNA repair of mutant mRNA or ocogenes Group II intron RNA and DNA cleavage and ligation Splicing and transposition Gene disruption of viruses and mutant mRNA Spliceosome RNA cleavage and ligation Splicing Repair of mutant mRNA DNA enzymes Sequence specific ribonuclease None Digestion of viral, oncogene or mutant mRNA (Lewin, A.S. and Hauswirth, W.W., 2001)

PAGE 45

29 Figure 1-1. Herpes simplex virus ty pe 1 genetic map. (Modified from http://www.dbc.uci.edu/~faculty/wagner/hsvimg04z.jpg ) HSV-1 is doublestranded DNA virus. In the virion, viral DNA is packaged in the form that the ends of the genome are in close proximity which appears to be circular. The HSV genome was estimated to be ap proximately 150 kilobase pairs, and complete sequencing of HSV-1 strain 17 genome describes the genome as 152260 base pairs (accession number X14112).

PAGE 46

30 Figure 1-2. Regulation of viral gene expr ession during lytic in fection. Flow chart illustrating the regulation of viral gene expression indicates the important roles of immediate early genes, especi ally ICP4 and ICP27, in turning on the expression of downstream classes of genes.43

PAGE 47

31 Figure 1-3. Human cornea anatomy.

PAGE 48

32 CHAPTER 2 DESIGN AND IN VITRO KINETIC ST UDY OF HAMMERHEAD RIBOZYMES TARGETING MRNA OF HSV-1 ESSENTIAL GENES Introduction Ribozymes are catalytic RNA molecules that promote a variety of reactions, often involving splicing of RNA.347 Naturally occurring ribozymes fall into several classes, including group I introns (from ribosomal R NA of protists and bacteria, and from mitochondrial DNA of fungi), group II self-splic ing introns (from yeast, fungal and plant mitochondria as well as chloroplasts73), the tRNA processing enzyme RNaseP129, hepatitis delta virus (HDV) ribozymes200, the VS ribozyme from Neurospora crassa mitochondria308, and the hammerhead and hairpin ri bozymes from single-stranded plant viroid and virusoid RNAs.44,158,390 The reactions catalyzed by natural ribozymes usually involve breakage and formation of phos phodiester bonds between nucleotides, although they can conduct other bioche mical transformations includin g reactions analogous to the reverse of splicing.204,313 From the evolutionary perspective, it has been suggested that self-cleaving ribozymes reflect remnants of the RNA worl d. The RNA world theory hypothesizes that far before the genetic information flow (fro m DNA to RNA to protein) formed, functions for life were conducted by RNA.116 Recent discoveries that self-cleaving ribozymes can associate with protein-coding genes20,392, raise the question wh ether self-cleaving ribozymes regulating gene expression may be predated and have been the ancestors of RNA replicons.22 Salehi-Ashtiani et al304 identified a self-cleaving ribozyme in the first

PAGE 49

33 intron of the cytoplasmic polyadenylation el ement binding protein 3 (CPEB3), and the association of CPEB3 and CPEB3 ribozyme is actively present in all the mammals but not in other vertebrates.22 The striking resemblance of the CPEB3 ribozyme to ribozymes in HDV, a pathogenic subviral sate llite naturally found only in humans. The fact that HDV has been isolated only from hu man tissue led to the speculation that this HDV self-cleaving ribozyme may have evol ved from modern protein-dominated organisms. Therefore, this may exclude the possibility that HDV ribozyme is a descendant of the RNA world. The hammerhead ribozyme catalytic motif wa s first reported in small satellite and viroid RNAs two decades ago37,345, and it is one of the smallest catalytic RNAs containing around 30 nucleotides active under ph ysiological conditions. The potential of hammerhead ribozymes to catalyze seque nce-specific down-regulation of gene expression was realized followi ng the definition of simplified ribozyme catalytic motifs in the late 1980s and early 1990s. With th e development of othe r oligonucleotide-based regulation methods (antisense, DNAzymes, a nd siRNAs), ribozymes have significant advantages for gene therapy applications. Because of its simplicity and flexibility, the hammerhead ribozyme can be designed to cl eave any target RNA independently from cellular pathways and even in the absen ce of protein, which are different from siRNA/shRNA. The hammerhead ribozyme (and other ribozymes) can be designed against introns and nuclear-specific sequences248, and this selectivity in intracellular compartmentalization provides it advant ages over antisense oligonucleotides, DNAzymes, and siRNAs. In terms of off-ta rget effects, in a comparative study in neurons using an adenoviral delivery, the hammerhead ribozyme showed increased

PAGE 50

34 specificity compared to siRNA19; ribozymes are much more sensitive to nucleotide changes at the cleavage site than other methods and therefore can be used to discriminate between single nucleotide polymorphisms.94,212 The essential structural elements of hammerhead ribozyme contain three WatsonCrick base-paired helices; helix I and III are connected by conserved sequences with catalytic potential.144 In trans the hammerhead ribozyme an neals to its substrate by complementary hybridizing to form helix I a nd III, and a loop links helix II (shown in Figure 2-1). Because ribozymes (hammerhead, hairpin ribozymes and RNase P) can downregulate gene expression by c onducting sequence-specific cleavage of target mRNA, they have been extensively used to dow n-regulate cellular and viral gene expression.76,177,179,180,355 The hammerhead ribozyme has been used to down-regulate undesirable gene expression: in the dominant-negative gene disorders, where the gene product of mutant allele jeopardizes th e normal function (e.g., autosomal dominant retinitis pigmentosa (ADRP); in cancer therapies, e.g., using ribozyme to reduce oncogene expressions (ras178, bcrabl201); in antiviral therapies, particular anti-HIV.342,343 The availability of various viral vectors (adenoviral, adeno-associated viral, retroviral, and herpes simplex virus vectors) provides options for tissue specific and long-term delivery. The concept of using ribozymes as antiviral agents has also been tested. The RNase P ribozyme has been tested in vitro against HIV, hepatitis B409, and hepatitis C virus216 and herpes viruses.179,357,358 However, there has been no successful in vivo delivery of ribozymes to target herpes viru ses for therapy. Recently a liposome mediated

PAGE 51

35 delivery of an siRNA has been used to treat an HSV-2 infection in mice. In this study, I designed hammerhead ribozymes targeting He rpes Simplex Virus type I (HSV-1) to explore a gene therapy appro ach to inhibit HSV infection. Herpes simplex virus type 1, a member of Herpesviridae family, is a neurotropic DNA virus with the ability of conducting lytic inf ection and establishing latency. From the perspective of HSV infection induced pathogenesis, it is the productive viral replication, either from acute infection or reactivation, directly or indirectly causing damage to the host. Thus essential gene s of HSV-1 become good targets for antiviral agents, since knocking down an essential gene expression may have significant impact on viral replication cycle, which can limit infe ctious disease progre ssing in the host. Materials and Methods Target Gene Selection and Determinin g Target Sequences of Hammerhead Ribozyme Potential ribozyme target genes were se lected from HSV-1 essential genes (the complete HSV-1 genome is in NCBI data base with a nucleotide access number of NC_001806) based on their base composition of guanine plus cytosine using software called Vector NTI 8 (1994-2002 InforMax, Inc) and examples are shown in Figure 2-2. GUC, CUC and GUU are the cleavage sites of hammerhead ribozymes that were searched in the potential targ et gene in order to design corresponding ribozymes. Once the cleavage sites were d ecided, two hybridizing arms of the hammerhead ribozyme would be developed by using complementary sequences surrounding the cleavage site. A program called MFOLD by Dr. Michael Zuker ( http://www.bioinfo.rpi.edu/applic ations/mfold/old/rna/form1.cgi ) was used to predict the secondary structure of each designed ribozyme to determine whether they can proceed to

PAGE 52

36 further study. An example of predicted sec ondary structure is shown in Figure 2-3. The ones with correct secondary fo lding patterns (catalytic core conservative stem and free hybridizing arms) will be carried on to in vitro kinetic studies to determine their catalytic parameters. In Vitro Kinetic Studies In vitro kinetic analysis (including time-c ourse and multi-turnover studies) of hammerhead ribozymes were conducted usi ng commercially synthesized short RNA oligonucletides. Hammerhead ribozymes and corresponding targets were purchased from Dharmacon, Inc (Lafayette, CO) in 0.05 mol scale following the procedure described previously315. RNA oligonucleotides were synthesized in a protected fo rm including silyl ethers to protect 5hydroxyl (5-SIL) in combination with an aci d-labile orthoester protecting group on the 2hydroxyl (2-ACE). The de protection procedure was conducted following the manufacturers manual. In general, oligoes were resuspended to a concentration of 300pmole/ L in RNasefree water as the stock solution, while concentrations of 10pmole/ L and 2pmole/ L were used as working solution of target RNA and ribozyme, respectively. Ribozyme in vitro tests started at a reaction condition at 20mM MgCl2, and ribozymes with high catalytic activities were studied under lower magnesium concentration (5mM). Kinase of RNA oligonucleotides 5 ends of target RNA oligonuc leotides were labeled with [ 32P] ATP (MP Biomedicals, Irvine, CA) (10 Ci in 1 L) in a solution with 10 L total volume containing 2 L of RNA oligo (10 pmole/ l; 20 pmole total), 1 L of 10x Polynucleotide Kinase Buffer (Promega, Madison, WI), 1 L of RNasin (Prome ga, Madison, WI), 1 L of

PAGE 53

37 0.1M Dithiothreitol (DTT) (Sigma, St. Louis, MO), 3 L of RNase-free water, and 1 L of polynucleotide kinase (5 units) (Sigma, St. L ouis, MO). The reaction was incubated in 37C for 30 minutes and 65 L of RNasefree water was added before extracting using 100 L of phenol/chloroform/isoamyl alcohol. The aqueous layer was purified on a prepacked Spin-50 Mini-column (USA Scie ntific, Inc., Ocala, FL) according to manufacturers instruct ions. Radioactive labeled RNA oli gonucleotide can be stored in 20C for 1 week. Time-course studies of ha mmerhead ribozyme cleavage Time-course reaction was set up as following: 13 L of 400mM Tris-HCl (pH 7.47.5) (Fisher, Swanee, GA), 1 L of ribozyme (2pmole), and 70 L RNase-free water were incubated at 65oC for 2 minutes followed by incubating at room temperature for 10 minutes. Meanwhile, a mixture of RNasin and 0.1M DTT in a ratio of 1 to 10 and 200mM MgCl2 were prepared. At the end of the incubation, 13 L of RNasin/0.1M DTT mixture and 13 L of 200mM MgCl2 (final concentration is 20 mM and it can be adjusted to final concentration of 5mM as well) we re added followed by 30 minutes of incubation at 37C. 2 L of 32P-ATP labeled target and 2 L of unlabeled target (20pmole) were added to the reaction. At 0,1,2,4,8,16,32,64, and 128 minutes, 10 L of volume was taken out, and 20 L of formamide dye mix (90% formamide (super pure grade) (Sigma, St. Louis, MO), 50 mM diaminoethanetetraacetic acid disodium salt (EDTA) (pH 8) (Fisher, Swanee, GA), 0.05% bromophenol blue (Sigma, St. Louis, MO), 0.05% xylene cyanol (Sigma, St. Louis, MO)) was added before placed on ice. Samples were denatured at 90C for 2 minutes before chilled on ice and 6 L of each sample was loaded on 8% polyacrylamide-8M urea gel. The gel was pre-run for 30 minutes before samples were loaded. Wells were rinsed to remove urea before loading the sample. After samples

PAGE 54

38 were run about 2/3 length of the gel, the gel was placed in fixa tive containing 10% V/V of Methanol (Fisher Scientific, Fair Law n, NJ), 10% V/V of Acetic Acid (Fisher Scientific, Fair Lawn, NJ), and water for 30 mi nutes. Dried gels were exposed overnight in storage phosphor screen cassettes and scanned in Storm Phosphorimager (GE Healthcare, Piscataway, NJ) for image quantif ication. At each time point, the percentage of cut target from total target (the sum of cut and uncut target) was calculated, and a linear range was determined w ithin which the percentage an d time form a linear relation. The time it takes to reach 10-20% cleavage of the full length target was decided and was used for multi-turnover kinetic analysis. In vitro multi-turnover studies A ribozyme solution of 0.3pmole/ L was prepared and target solutions of 30, 3 and 0.3pmole/ L were prepared as following: to make 150 L of 30pmole/ L solution of target, 15 L of 32P-labeled RNA oligo, 15 L of 300 pmole/ L stock, and 120 L of RNase-free water were mixed together; 1:10 dilution was conducted to make 150 L of 3 pmole/ L solution, and 100 L of 0.3 pmole/ L was made. The experiment set-up is described in Table 2-1, and the concentrati on of target can be changed depending on the amount of target required to reach saturation in time-course reactions. Target solution was warmed up at 37oC for at least 5 minutes be fore addition to reactions. After adding hammerhead ribozyme, tubes were held at 65oC for 2 minutes then at room temperature for 10 minutes. Then they were held at 37oC for 10 to 30 seconds once magnesium was added. Following the additi on of target solution, reactions were incubated at 37oC for the time to reach 10-20% cleavag e of full-length target (based on the time course experiment) be fore stopping the reaction with 20 L of formamide dye

PAGE 55

39 mix. Samples were run on polyacrylamide-ur ea gel which was fixed and dried before exposed in storage phosphor screen cassette for phosphoimager scanning as described in Time-Course Studies of Hammerhead Ribozyme Cleavage. A calibration curve was set up by prep aring target dilution following the description in Table 2-2. These dilu tions were filter ed through Hybond N+ (Positively Charged Nylon Transfer Membrane) (Amersha m Pharmacia Biotech, Piscataway, NJ) set in a dot-blot or slotblot apparatus (BIORA D Life Science Research, Hercules, CA). The calibration curve analysis gave an equa tion which related target concentration to pixel reading of radioactive in tensity of target bands. This led to a quantification of cleavage products in multi-turnover kinetic an alysis. By graphing 1/V and 1/S following Lineweaver-Burke kinetics, parameters (VMAX, KM, and kcat) of respective ribozyme was determined. Ribozyme Cloning To proceed to in vitro evaluation in cell culture of each chosen hammerhead ribozyme, ribozymes were cloned in the plasmid, pTRUF21-New Hairpin (called p21NewHP in short), within HindIII and SpeI site s. The map of this plasmid is shown in Figure 2-4. All the ribozyme sequences are listed in Figure 2-5, and single stranded (sense and anti-sense) DNA oligoes (Invitr ogen, Carlsbad, CA) were purified using 8% polyacrylamide gel and oligonucleotide bands were cut to elute DNAs in elution buffer (recipe of elution buffer is described in A ppendix C). For each ribozyme, sense and antisense oligonucleotides were annealed, diluted and ligated in HindIII and SpeI (New England Biolabs, Ipswich, MA) digested p21-NewHP plasmid. SURE Competent Cells for Unstable Clones (STRATAGENE, La Jolla, CA) were used for transformation of ligation products and plasmid DNA extrac ted from single colonies were sent for

PAGE 56

40 sequencing (ICBR DNA sequencing core, University of Florida). Plasmids containing correct sequences of respec tive ribozymes were amplified and DNA extractions were conducted using CsCl gradient purificati on protocol or Max imum DNA Extraction Kit (Sigma, St. Louis, MO). Results Four HSV-1 essential genes (ICP4, ICP27, UL20, and UL30 genes) were chosen as targets of hammerhead ribozymes because of their important roles in HSV-1 lytic life cycle (e.g. ICP4 gene) or their low G+C base composition (ICP27, UL20, and UL30 genes) (Figure 2-2 ) ICP4 gene and ICP27 gene (also called UL54) are immediate early genes, UL30 gene is an early gene, and UL20 gene is a late gene sh own. Their expression in HSV-1 lytic life cycle is shown in Figure 2-6. For each target gene, among all the potential candidates, at least two hammerhead ribozymes were designed and they were tested in vitro for their kinetic parameters using synthesized RNA oligonucleotides (12nucleotide long target and 39nucleo tide ribozyme). One example of an in vitro study including time course cleavage and multiple-t urnover analysis is shown in Figure 2-7. Ribozyme 885 targeting ICP4, which has r easonable catalytic activity, is the only functional ribozyme designed for ICP 4, and it was cloned in p21NewHP for in vitro test (discussed in Chapter 3). Two ribozymes were designed targeting UL20 gene: although UL20rz-135 was predicted with id eal secondary structure, it has very low catalytic activity at 20mM MgCl2 concentration, as shown by its kcat/Km (0.1uM-1 min-1) (Table 23). The second UL20 ribozyme, UL20rz-154, indicated excellent in vitro catalytic activity, with a kcat/Km of 15.9uM-1 min-1 at a low MgCl2 concentration of 5mM. This ribozyme was tested in vitro and in vivo described in the Chapter 4 and Chapter 5. Two ribozymes were designed for UL30 which encodes HSV-1 DNA polymerase. They all showed

PAGE 57

41 reasonable catalytic activity: UL30rz-933 has a kcat/Km of 3.6uM-1 min-1 at 20mM MgCl2 concentration, and UL30rz-1092 has a kcat/Km of 1.0uM-1 min-1 at 5mM MgCl2. UL30rz993 was chosen for further test due to its cleav age site located closer to the beginning of the transcript, and it was tested in vitro as described in Chapter 4. Ribozyme-825 targeting UL54 (ICP27 gene) was chosen for further study due to its high in vitro catalytic efficiency (a kcat/Km of 11.7uM-1 min-1 at 5mM MgCl2), and the other ribozyme targeting UL54 was discarded due to its low cleavage activity. Discussions To design hammerhead ribozymes for gene ta rgeting, there are several criteria that need to be considered: the accessibility of the target sequence, cleavage sites and flanking sequences, and the secondary stru cture of designed ribozyme. Sequencespecific binding of hammerhead ribozyme to ta rget RNA is the first step for efficient cleavage, thus a good estimate of the accessibility of target site is necessary. Experience with antisense-oligodeoxynucle otide (antisense-ODN) methods has been beneficial, and it has showed that the accessibility of the mRNA to oligonucleotides is restricted by the secondary structure of the mRNA. Although experi mental approaches are more reliable in identifying oligonucle otide-accessible sites95,151,250, computational methods using MFOLD software sometimes give reasonabl e prediction without time-consuming bench work and high cost. In this study, I eliminated a lot of candidate target genes based on their G+C composition. The rationale is that high level of G+C content very often gives complex tertiary structure which is in accessible to ribozyme binding. The sequence requirement of the cleavage triplet is a ny triplet sequence of the NUH type (N: any nucleotide; H: A,U, or C); the catalytic e fficiency of hammerhead ribozyme to different cleavage triplets decrease in the following order, GUC>CUC>UUC>GUU, AUA,

PAGE 58

42 AUC>GUA, UUU, UUA, CUA>AUU, CUU.318 After choosing the target, to decide the ribozyme design, the folding pattern of the ribozyme was estimated using MFOLD. A ribozyme with correct structure of hybridiz ing arms and helix II without disturbing the catalytic core was tested in vitro There are no general rules for the optimal length of ribozyme hybridizing arm. However, in vitro study indicated that short arms, i.e., less than 7 base pairs in each binding sequence, can provide fast dissociation from the cleaved product therefore efficient multiple turnover catalysis.351 In this study, the length of hybridizing arm is 5 base pairs at the 5 end and 6 at the 3 end. In order to achieve a successful therap eutic effect using hammerhead ribozyme, target genes need to be carefully selected. To inhibit HSV-1 vira l replication, the knockdown of target gene expression should have si gnificant impact on viral life cycle, since HSV-1 genome contains a large number of non-essential genes that have minor influences in initiating and maintaining viral lytic infection in vitro In this study, I chose target gene candidates that were known to be essential for HSV-1 lytic infection. After designing a hammerhead ri bozyme, determination of kcat, Km, particularly kcat/Km provide useful descriptions of how efficiently a ribozyme conducts the transesterification of phosphodiester bonds at different substrate concentrations in vitro This may reflect the in vivo activity of the ribozyme in which mRNA substrate will exceed ribozyme concentration. However, in vitro kinetic studies do not necessarily represent the situation in cells and animals, because cellular proteins can influence RNA conformation and consequently ribozyme catalytic efficiency by forming complexes with ribozyme.363 The strategy in this study is to cl one selected ribozymes into plasmids and

PAGE 59

43 viral vectors to test their biological effects in vitro and in vivo This will be described in later chapters.

PAGE 60

44Table 2-1. Experiment design of in vitro multi-turnover analysis. Tube(dupes) water 400mM Tris HCL,pH7.4 Ribozyme1:10 RNasin: 0.1M DTT 200mM MgCl2 Target Target solution used Molar ratio Rz:target 1,11 14 2 0 1 2 1 3pm/ul 2,12 10 2 1 1 2 4 3pm/ul 1:40 3,13 8 2 1 1 2 6 3pm/ul 1:60 4,14 6 2 1 1 2 8 3pm/ul 1:80 5,15 13 2 1 1 2 1 30pm/ul 1:100 6,16 12 2 1 1 2 2 30pm/ul 1:200 7,17 10 2 1 1 2 4 30pm/ul 1:400 8,18 8 2 1 1 2 6 30pm/ul 1:600 9,19 6 2 1 1 2 8 30pm/ul 1:800 10,20 4 2 1 1 2 10 30pm/ul 1:1000 All volumes are in microliters. Ribozyme concentration is 15nM.

PAGE 61

45 Table 2-2. Preparation of calibration curv e for multi-turnover kinetics analysis. Tube (dupes) water microliters Target Target solution used pmole of target 1,13 100 0 0 2,14 99 1 0.3pm/microcliter 0.3 3,15 98 2 0.3pm/microcliter 0.6 4,16 96 4 0.3pm/microcliter 1.2 5,17 94 6 0.3pm/microcliter 1.8 6,18 92 8 0.3pm/microcliter 2.4 7,19 99 1 3 pm/microliter 3 8,20 98 2 3 pm/microliter 6 9,21 96 4 3 pm/microliter 12 10,22 94 6 3 pm/microliter 18 11,23 92 8 3 pm/microliter 24 12,24 90 10 3 pm/microliter 30 Table 2-3. Summary of in vitro kinetic analysis of all the hammerhead ribozymes designed against HSV-1. Kinetic Properties Of Hammerhead Ribozym es With Synthetic HSV RNA Substrates HSV Target Gene Mg+2 mM kcat (min-1)Km (uM)kcat/Km (uM-1 min-1) Development Status ICP4-885 20 15.87 52.83 0.3 Ongoing ICP4-533 5 & 20 NA NA NA Discarded UL20-135 20 0.08 5.64 0.01 Discarded UL20-154 5 27.78 1.75 15.9 Ongoing UL30-933 20 9.26 2.57 3.6 Ongoing UL30-1092 5 22.99 23.59 1.0 Pending UL54-233 5 0.91 8.58 0.1 Discarded UL54-825 5 51.28 4.44 11.7 Ongoing NA: No activity. Ribozymes that are labele d as ongoing were cloned in plasmid vector pTRUF21NewHairpin as well as packaged in an adenovirus vector for cell culture and in vivo studies; the ones labeled as P ending will be used as an alternative for future study.

PAGE 62

46 Figure 2-1. Structure of a hammerhead ri bozyme. Substrate binding domains of the hammerhead ribozyme bind to target sequence to form Helix I and III (stem I and III), and the length of each hybridiz ing arm may varies without affecting cleavage efficiency. The catalytic co re, the loop area, which is highly conservative, is essential for ribozyme activity (modified from http://www.rwg-bayreuth.de/chemie/chime/rna/frames/hambtx.htm).

PAGE 63

47 A. B. C. Figure 2-2. The composition of G+C in HSV1 genes using Vector NTI. Blue area indicates the percentage of G+C content in each sequence investigated; yellow area is the gene sequence flanking the gene of interest; the scale of Y axis in each panel is 100% maximum, and 20% minimum in the composition of G+C; X axis represent the base number of each sequence in HSV-1 genome. Figure A shows a representative sequence from ICP4 gene coding sequence, in which high G+C composition is generally observ ed, and sequences contain relatively low G+C are labeled as 75% and 67.5% respectively. B: a representative sequence from ICP27 gene coding se quence; C: coding sequence of UL20 gene; D: a representative sequence from UL30 gene coding sequence.

PAGE 64

48 D. Figure 2-2. (continued.) Figure 2-3. Predicted foldi ng pattern for ribozyme UL54-825 using MFOLD. Figure 2-4. The map of plasmid pTRUF21-NewHairpin for ribozyme cloning.

PAGE 65

49 Figure 2-5. Ribozyme sequences and th eir respective target sequences.

PAGE 66

50 Figure 2-6. Gene targets for hammerhead ribo zymes in HSV-1 lytic life cycle. Four HSV-1 essential genes were chosen as targets of hammerhead ribozymes. ICP4 and ICP27 genes are immediate early genes; they have been suggested to be essential to HSV-1 lytic infection in vitro especially ICP4 which is a major transcriptional regulator to basically all the HSV-1 genes. UL30 gene is an essential early gene which enc odes the viral DNA polymerase, and UL20 gene is a late essential gene. By knocking down the expression of these HSV1 essential genes, it is expected that a corresponding event (immediate early transcription, early, or late transcription) can be stoped leading to an inhibition viral infection.

PAGE 67

51 A. B. C. Figure 2-7. In vitro kinetic study of hammerhead ribozyme UL20-154. A) Autoradiogram of the time course of cleavage of an RNA target (end labeled with -32P-ATP) by ribozyme UL20-154 at a magnesium concentration of 5mM. B) The percentage of target RNA cleavage in each time point can be calculated from quantificati on of cut and uncut target bands in Figure 2-7-A. C) Lineweaver-Burke Plot of Ribozyme UL20-154 Cleavage of Synthetic HSV RNA Target. Least squares regressi on analysis generated a best fit line y = 4.213x + 0.0024 with correlation coefficient R2 = 0.978. After setting up multiple-turnover analysis of UL20-154 ribozyme in 5mM Mg2+ concentration, the quantitation data was fit in the Lineweaver-Burke plot.

PAGE 68

52 CHAPTER 3 STUDIES OF RNA GENE THERAPY TA RGETING ICP4 MRNA OF HERPES SIMPLEX VIRUS Introduction Genes of herpes simplex virus (HSV) can be categorized into th ree kinetic classes: immediate-early (IE or ), early (E or ), and late (L or ) genes.155 During the lytic infection, HSV gene product synthesis is regulat ed in a highly organized cascade manner. Genes from each class contain different compon ents of regulatory elements which define the dynamics of its transcription by cellular RNA polymerase II (pol II) transcriptional machinery.4,74 The complexity of promoter structur es of genes from each class decreases from IE to E to L.375,384 Five immediate early (IE) gene s, ICP4, ICP0, ICP22, ICP27, and ICP47, constitute the first set of genes to be transcribed upon HSV-1 infection and are maximally expressed at approxi mately 2-4 hours post-infection.155 These IE genes are expressed with the help of VP1621,45, a viral transactivator wh ich is contained in the tegument. VP16 associates with cellular Oct-1 and host cell f actor (HCF) to bind TAATGARAT elements (where R repr esents A or G) which are found exclusively in IE gene promoters to activate transcription from them.110,268 SP1 sites as well as other sites for binding of cellular cis -acting factors also contribute to the enhanced transcription of viral IE genes.114 As a key transcriptional regulator, ICP4 gene of HSV is essential for the expression of virtually all the genes of viral productive life cycle.187,382 As an immediate early gene, ICP4 is e xpressed about 2-4 hours post-infection in the absence of other de novo synthesized viral proteins.299 The same as other genes,

PAGE 69

53 ICP4 promoter contains consensus se quence 5-GyATGnTAATGArATTCyTTGnGGG3 upstream of the cap site226-228 which binds Oct-1. By binding to a complex of the viral proteins VP16, HCF, cellular Oct-1, and othe r transcriptional fact ors, the consensus sequence acts as a response element to promote the expression of genes.192-195,246 ICP4 is a large and structurally complex protei n: its mobility on sodium dodecyl sulfatepolyacrylamide gel electrophores is (SDS-PAGE) responds to a molecular weight of 175KDa75 and it exists in the cells as a hom odimer with a strokes radius of 89.242,317 Considering its hydrodynamic properties, th is elongated protein can bind to DNA and function as a transactivator of transcription over a long distance. However, ICP4 does not require specific DNA binding sites for its ac tivation, it can activat e transcription from a variety of promoters. Of all the gene products, ICP4 protein, functioning in a poly(ADPribosyl)ated form, is absolutely essential for and gene expression beyond phase of a ly tic infection.72,87,88,91,101 As a transactivator, ICP4 increases the rate of transcription complex assembly on promoters.126 ICP4 protein also down-regulates gene expression, including its own, by bindi ng to cognate DNA binding sites located across the transcription initiation sites a nd interacting with basal transcriptional factors.128,198 ICP4 protein functions by in teracting with basal transcriptional machinery of RNA polymerase II (RNA Pol II). In the eukaryotic system, structural gene transcription requires the assembly of pre-initiation comp lex on the core promoter including RNA Pol II and general transcription factors (GTFs) (T FII A, B, D, E, F, H). Although there are different element requirements for a full activity of HSV early and la te gene promoters, interactions of TATA box and GTFs are esse ntial for initiating transcription of both

PAGE 70

54 kinetic classes of genes. Binding of Transc ription Factor II D (TFIID) to the TATA box via TATA-box binding protein (TBP) is criti cal for pre-initiation complex assembly. However, efficient responses to cellular and viral trans-activators (SP1 and ICP4) require TBP-associated factors (TAFs). Their interact ions with each other, with other GTFs, and with specific DNA sequences (e.g., the initiato r element which overlaps the transcription sites) contribute to promoter selectivity.174 It was suggested that ICP4 interacted with TAF250 of TFIID via its C-terminal domain.51 Herpes simplex virus early and late genes have distinct promoter structures which have different requirements in terms of IC P4-specific transcription activation. A study using non-fusion forms of ICP4 linked to either an early gene ( tk ) promoter or a late gene (gD) promoter revealed that ICP4 residues 97 to 109 are required for induction of gD promoter but not for tk promoter.397 It has been suggested th at GTF TFIIA is essential for ICP4 activation of HSV early gene transc ription but is not requ ired for late gene transcription402, indicating the elegant regulation of HSV gene expression cascade through ICP4. Because of the critical role in HSV lytic infection, ICP4 ha s attracted significant attention as a target for antiv iral therapy. Antisense oligonu cleotides were explored in cell culture for antiviral effect by targeti ng the acceptor splice j unction of ICP4 premRNA.176,325 Although they were also tested in BALB/c mice and showed certain inhibitory effect199, the delivery approach and surv ival rate of those antisense oligonucleotides were limiting f actors for antiviral therapy a pplication. A chemical that can block Sp1 binding (e.g., tetramethyl-O-NGDA (M4N), a synthetic derivative of the naturally occurring nordihydrogua iaretic acid (NDGA)), which consequently interrupts

PAGE 71

55 ICP4 expression, was demonstrated for its an tiviral effect but w ith limited therapeutic effects.56 A ribozyme derived from Escherichia coli ( E.coli ) RNase P was engineered targeting HSV-1 ICP4 mRNA and in vitro it significantly reduced ICP4 expression with certain inhibitory effect against viral replication in cell culture.355,358 Zinc finger proteins274 (engineered three or six-finger protei n) are very potent suppressors for initiation of transcription. Recently, they have been designed and tested in vitro against ICP4 gene promoter. These zinc finger proteins led to certain levels of reduction of ICP4 expression and early/late gene expression level.274 It was suggested from these studies that targeting only the ICP4 ge ne might not provide significan t effect in inhibiting viral replication. In summary, in these studies in vitro systems that were not permissive for HSV-1 viral replication were used to test these antiviral reagents. None of the in vivo data obtained indicated a th erapeutic effect by knocking down ICP4 expression. No delivery method was suggested or tested for ge ne therapy purposes. They also suggested that a threshold leve l of ICP4 gene expression, which may be very low, can provide sufficient function for viral growth. Therefor e, it might be very di fficult to significantly knock-down ICP4 level to affect HSV-1 lytic infection. However, a therapeutic effect may be achieved from a synergistic effect by targeting multiple targets including ICP4 gene. In this study, I designed and tested ha mmerhead ribozymes targeting ICP4 mRNA of HSV-1. These studies were conducted in a permissive in vitro system for HSV-1 infection using HSV-1 strains with high infec tivity. The application of using siRNA for anti-HSV-2 effect was also explored by targeting ICP4 mR NA of HSV-2.

PAGE 72

56 Materials and Methods In Vitro Test of Hammerhead Ribozyme ICP4 -885 Targeting ICP4 mRNA of HSV-1 Ribozyme ICP4-885 and other ribozymes (m entioned in Chapter 2) were cloned into a plasmid called pTRUF21-New Hairpin between restriction sites of HindIII and SpeI following protocol of ribozyme cloni ng (Chapter 2) and plasmid construct containing ICP4 ribozyme is called pTR 21NewHP-ICP4rz-885 (abbreviation as p21ICP4rz). The sequences of all the ribozyme s and their respective targets are shown in Table 3-1. Transient transfection of E5 cells with ri bozyme ICP4-885 to detect ICP4 mRNA Level The E5 cell line, African green monkey kidney cell which was constructed to express the ICP4 gene, was used for this study (a generous gift of Dr Priscilla Schaffer). A transient transfection of pTR-UF11 (GFP containing plasmid, map see Figure 3-1) was conducted using Lipofectamine 2000TM (Invitrogen, Carlsbad, CA) at various ratios of plasmid DNA amount ( g) to Lipofectamine 2000TM reagent ( L) and following the manual of Lipofectamin 2000TM. Ratios of DNA to Lipofectamine 2000TM reagent were: 4 g to 4 L, 4 g to 8 L, 4 g to 12 L, 5 g to 10 L, and 5 g to 15 L. At one day posttransfection, cells were examined for their GFP expression level by fluorescence microscopic observation as well as flow cyto metry analysis (FACScan, BD Biosciences, San Jose, CA) to determine the transfecti on efficiency. The optimal transfection condition was used to conduct further tests. Each well of a 6-well-plate was seeded with 3x105 cells one day before transfection, and for each group, the transfection was conducted in triplicate. There were four groups in this test: mock transfection, pTRUF21 transfection, pTRUF21-ICP4rz, and pTRUF 11 (GFP containing plasmid). At 48 hours

PAGE 73

57 post-transfection, two wells of GFP-transfected cells and a we ll of mock transfected cells were analyzed by flow cytometry analysis to detect transfection efficiency; the remaining cells were harvested using TRIZOL Reagen t (Invitrogen, Carlsbad, CA). Total RNA extraction was performed followi ng TRIZOL protocol and DNA-freeTM (Ambion, Austin, TX) was used to remove DNA contam ination. Total RNAs were inspected via the spectrometry (Gene Spec III, MiraiBio Division, Alamed a, CA) at a wavelength of 260nm and the quality of RNA was assessed us ing a ratio of the absorption at 260nm divided by that at 280nm ranging from 1.8 to 2.0. Reverse transcription was conducted using First-Strand cDNA Synthesis Kit (Ame rsham Biosciences, Buckinghamshire, UK) with 1 g total RNA in each reaction. Conve ntional PCR was conducted using cDNA (1/5 of total reverse transc ription reaction for each PCR). HotStarTaq DNA polymerase (QIAGEN, Valencia,CA) was used in PCR at 95C for 15 minutes (1 cycle); 94C for 3 minutes, 55C for 3 minutes, 72C for 3 minutes (1 cycle); 94C for 1 minute, 55C for 1 minute, 72C for 1 minute (30 cycles); 72C for 10 minutes. PCR products were separated on 8% acrylamide gel and stained with SYBR Green I nucleic acid gel stain (Molecular Probes, Eugene, OR). Images were obtained using Storm Phosphorimager (GE Healthcare, Piscataway, NJ) and quantif ication was conducted using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Construction of a stable cell lin e expressing ribozyme ICP4-885 RS cells (rabbit skin cells), maintained in Eagles minimal essential medium (MEM, Life Technologies) supplemented with 5% calf serum, 250U of penicillin/mL, 250 g of streptomycin/mL, and 292 g of L-glutamine/mL (Life Technologies), were used to construct the stable cell line expressing ribozyme ICP4-885. Each well of a 24-well-plate was seeded with 8x104 of RS cells the day before transfection; Lipofectamine and

PAGE 74

58 Plus reagents (Invitrogen, Carlsbad, CA ) were used for transfection using the recommended conditions (DNA: Plus: Lipofectamine of 0.8 g: 1 L: 3 L). On the second day of the transfection, transfected cells were dilute d 5-10 fold and selected in medium containing G418 disulfate (Research Products International Corp., Mt. Prospect, Illinois). The concentration of G418 disulfate began at 600 g/mL and was gradually reduced to 500 g/mL, 400 g/mL, 300 g/mL, and eventually 250 g/mL. After 3 weeks of selection, single colonies were picked to grow in 96-well-plates, and then amplified in 24-well-plates, 6-well-plates and finally 10cm2 dishes. Ribozyme expression levels of all the colonies were compared using reverse tr anscription of total RNA harvested from the same amount of cells followed by conventional PCR. PCR was conducted with an addition of radioactive 32P-dATP (MP Biomedicals, Irv ine, CA), and PCR products amplified by ICP4 primers as well as -actin primers (Table 32) were detected on 8% acrylamide gels. Dried gels were exposed ove rnight in a storage phosphor screen cassette and scanned in Storm Phosphorimager (GE H ealthcare, Piscataway, NJ) to detect the radioactive labeled PCR product. ImageQua nt software (GE Healthcare, Piscataway, NJ) was used to quantify the intensity of PC R product. The colony w ith highest ratio of ribozyme level to -actin level was selected to test against HSV-1 infection. Herpes simplex virus type 1 infection 17 syn + (considered a wild-type HSV-1 strain ) was used to conduct infection. A series of dilutions of HSV1 viral stock were prepared in Eagle's minimal essential medium containing 5% calf serum, 250U of penicillin/mL, 250 g of streptomycin/mL, and 292 g of L-glutamine/mL (Life Technologies Inc., Gaithersburg, MD). One hour incubation at 37C in 5% CO2 was allowed for the virus to absorb in a minimal amount (200 L) of medium covered on a monolayer of cells. Infection medium was replaced

PAGE 75

59 with regular serum-containing medium af ter the incubation. Different times of incubations were allowed before cells were harvested or stained with dye (plaque reduction assay). Herpes simplex virus type 1 viral stock preparation The virus was amplified and titrated on ra bbit skin cells by using Eagle's minimal essential medium (Invitrogen-Life Technologi es, Carlsbad, CA.) supplemented with 5% calf serum (Life Technologies, Inc., Gaithersb urg, MD), 292 g of L-glutamine/ml, and antibiotics (250 U of penicillin/ml and 250 g of streptomycin/ml). The infection of a monolayer RS cells at an MOI of 10-2 was performed when the cells reached 80% confluency. Complete cytopathic effect (CPE) was observed before cells and medium were harvested to pellet the cells at 1 0,000xg at 4C in a Sorvall GSA rotor (Thermo Electron Corporation, Asheville, NC) for 40 mi nutes. The cell pellet was resuspended in MEM complete medium containing 5% calf serum and frozen-thawed twice using a 80C freezer and a 37C water-bath before the ce ll lysate was distributed in aliquots. Virus stocks were maintained in 20-100 L aliquots (depending on the purpose) using 2.0mL screw-cap tubes and stor ed in -80C freezer. One vial of viral stock was thawed out and titrated before use in animals or cell cultures. Plaque reduction assay to determine viral titer RS cells were used for plaque reduction assay (PRA), seeding 1x105 cells per well in each 24-well-plate. 10 L of viral stock was resuspended in 990 L of MEM to make 10-2 dilution of infectio n solution, and from 10-2 dilution 1mL of each 10-3 to 10-9 dilutions were made. For each dilution, in fection was conducted in triplicate and 200 L of each dilution were added to each well of cells. One hour incubation was allowed for viral attachment and viral entry. Cells we re rinsed by PBS then covered by 2mL of

PAGE 76

60 regular medium containing 0.3% human IgG (Purified Immunoglobulin Technical Grade) (Sigma, St. Louis, MO). For 17syn+ strains, 2 days were required for plaques to develop and for KOS strains plaques show in 3 days. Transient transfection of pTRUF21-New Ha irpin containing ribozyme ICP4-885 E5 cells were seeded in 3.5c m dishes at a density of 2x105 cells per plate one day before transfection. Three gr oups of transfections were included: mock transfection (MT), control plasmid transfection usi ng pTRUF21NewHairpin (Con), and ribozyme transfection using pTRUF21NewHairpin-ICP4 rz-885 (ICP4rz). Transfection of each group was conducted in triplic ate using Lipofectamine 2000TM (Invitrogen, Carlsbad, CA) at a DNA to Lipofectamine 2000TM ratio of 10 g to 10 L. The transfection procedure followed Invitrogen Lipofectamine 2000TM protocol. E5 cells were maintained in Eagles minimal essential medium (MEM Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS, GIBCO/ Invitrogen, Carlsbad, CA), 250U of penicillin/mL, 250 g of streptomycin/mL, and 292 g of L-glutamine/mL (Life Technologies, Inc., Gaithersburg, MD). Two days after transfection, E5 cells were infected with KD6 (ICP4 defective HSV-1 strain)92 at an MOI of 3 for 24 hours before cell lysates were harvested for plaque reduction assay. In Vitro Test of a siRNA ICP4-19 Targeting ICP4 mRNA of Herpes Simplex Virus Type 2 siRNA ICP4-19 was originally designed by Suresha Rajiguru, a Master student at the University of Florida. The siRNA duplex sequences as well as the target sequence are shown in Table 3-3. HeLa cells were cultured in 10%FBS containing Dulbecco's Modification of Eagle's Medium (DMEM) (Cellgro, Mediatech, Inc., Herndon, VA) supplemented with 250U of penicillin/mL, 250 g of streptomycin/mL (Life

PAGE 77

61 Technologies, Inc., Gaithersburg, MD). Tr ansfection of siRNA duplex was conducted using Oligofectamine Transfection Reagent (Invitrogen, Carlsbad, CA). A scrambled siRNA, kindly provided by Dr. Ma rina Gorbatyuk, served as the transfection control. Each well of the 12-well-plate was seeded with 1x105 cells one day before the transfection. Transf ection was conducted in the presence of serum but no serum was added until duplex-oligofectamin e complex formed. OPTI-MEM I Reduced Serum Medium (GIBCO, Invitrogen Corporation, Carlsbad, CA) was used during transfection process. 100pmole of siRNA duplex and 2 L of oligofectamine reagent were used for transfecting each well of cells. A four-hour incubation was allowed while in the presence of serum for transfection and the tran sfection medium was replaced by 10%FBS containing DMEM supplemented w ith 250U of penicillin/mL, 250 g of streptomycin/mL. After the ove rnight culture, cells were te sted for transgene function. Infection using HSV-2 (strain HG52) was conducted at an MOI of 3 after transfection of HeLa cells with siRNA duplex es. To evaluate the siRNA effect on HSV2 ICP4 gene expression level, reverse transc riptions (RT) followed by real-time PCR was conducted to detect the ICP4 expression. Copy DNA (cDNA) from each RTreaction was diluted 10-fold before the real time P CR assay. Specific primers and a fluorescent probe for either ICP4 (sequences are shown in Appendix B) or RNase P (sequences of primers and probe are not available) were designed and synthesized by ABI system (Applied Biosystems, Foster City, CA) (Assays by Design part no. 4331348) with concentrations recommended by the supplie r. Real-time PCR was performed using TaqMan Universal PCR Master Mix, No AmpErase uracil N-glycolase (Applied Biosystems, Foster City, CA). All real-time PCR reactions were performed and analyzed

PAGE 78

62 using ABI Prism 7700 or 7900 sequence detection systems (Applied Biosystems) (ICBR Protein Chemistry Core Facility, University of Florida). Cycle conditions used were as follows: 50C for 2 min (1 cycle); 95C fo r 10 min (1 cycle); and then 95C for 15 s followed by 60C for 1 min (45 cycles). Threshold values used for PCR analysis were set within the linear range of PCR target amplification. Results Ribozyme ICP4-885 In Vitro Test against HSV-1 Target Effect of transient transfection of ribozyme ICP4-885 to ICP4 expression level in E5 cells Transient transfection of ribozyme IC P4-885 in E5 cells caused significant reduction in ICP4 expres sion levels (Figure 3-2A ) A semi-quantitative reversetranscription PCR was conducted to compare IC P4 mRNA level after ribozyme treatment. As shown in Figure 3-2B, ribozyme ICP4 885 reduced the level of ICP4 expression by 42% (compared with a contro l transfected group). Howeve r, the difference in ICP4 levels between ribozyme and control groups of E5 cells was not statisti cally significant. This is probably because ICP4 expression levels in the cell are already extremely low without HSV-1 infection, since the cell line was constructed to express ICP4 from the original viral promoter. Transient transfection of pTRUF21-New Ha irpin containing ribozyme ICP4-885 in E5 cell line to test against KD6 (ICP4HSV-1) viral replication To further investigate ribozyme effect on ICP4 expression level, the ribozyme ICP4-885 was used to transfect E5 cells foll owed by KD6 infection at an MOI of 3. The rationale for this experiment was that KD6 vi ral infection is turned on by constitutive expression of ICP4 provided by E5 cells, so the reduction of ICP4 expression will be indicated by a lower level of infectious viral particles in the ribozyme treatment group

PAGE 79

63 than those in control groups. However, transfection efficiency in E5 cells was very low (7% in the optimal condition) and transfected cells could not be enriched by antibiotic selection. (E5 cells were cons tructed using neomycin resistant gene as selection marker which is the same as ribozyme expressing pl asmid.) Although it did not reach statistical significance, there was a mild reduction (20%) of viral yiel d in the ribozyme treatment group as shown in Figure 3-3. Cell Line stably expressing ribozyme IC P4-885 tested against wild-type herpes simplex virus type 1 (17 syn +) RS cells were stably tr ansfected with ribozyme IC P4-885 and one single colony with highest ribozyme expression level was sele cted. In Figure 3-4-A, an example of ribozyme expression is shown. Cells from this colony were used to te st against wild-type HSV-1 (17 syn +) infection at an MOI of 10-3. At different time points, cell lysates were used to conduct plaque reduction assay to observe ribozyme effect on multiple rounds of viral replication. A separate group of cells were stained with crystal violet at each time point to observe the plaque forming phenotype s. At an early tim e point (24 hours postinfection), a significant reduction of vira l production level (88%) was observed in ribozyme expressing cells by pl aque reduction assay (data not shown). At three days post-infection, significantly reduced plaque pr oduction as well as smaller plaque size was observed when cells were stained with crystal violet as shown in Figure 3-4-B. However, when plaque reduction assay was employed to qua ntify viral yields from cells paralleled to those from Figure 3-4-B, no differen ce was observed between control cells and ribozyme expressing cells.

PAGE 80

64 Transient Transfection of siRNA Targetin g ICP4 mRNA of Herpes Simplex Virus Type 2 in HeLa Cells An siRNA designed targeting HSV-2 ICP4 mRNA and transfection controls were used to transiently transfect HeLa cell s followed by wild-type HSV-2 (strain HG52) infection at an MOI of 10-3. Viral replications at a seri es of time points (15, 24, 50, and 75 hours post-infection) were compared using a plaque reduction assay to estimate the siRNA effect. Compared with control si RNA treatment, transfection of siRNA-19 significantly reduced HSV-2 viral yield by 63% 63%, 70%, and 49% respectively at 15, 24, 50, and 75 hours post-infection. Howeve r, when HSV-2 ICP4 mRNA level was compared among three groups using reverse tr anscription and real-t ime PCR, there was no significant difference observed (dat a not shown) among three groups (Mock transfection, control siRNA, and siRNA19 transfected groups). ICP4 mRNA was observed following a very high level of infection (MOI of 3), while siRNA-19 transfection reduced HSV-2 yields at a mu ltiplicity of infecti on 3000 times lower (an MOI of 10-3). Conclusions and Discussion Although HSV-1 and 2 both belong to alpha-her pes family, they are different in a lot of aspects, indicating the difference in virion release. Howe ver, the ICP4 gene product for both HSV type 1 and 2 shares not only sequence but functional similarity. They are immediate early genes and function to initiate downstream events. ICP4 has been a very popular target for gene knockdow n in the past, but no success was observed from the therapeutic aspect. In this study, ri bozyme and siRNA targeting ICP4 were used against wild-type HSVs under rigorous high multip licity infection conditions that is more extreme than those conditions used in previous studies in the literature in order to select

PAGE 81

65 for candidates for therapeutic purposes. It has been suggested that HSV requires an extremely low threshold level of ICP4 ge ne product to initiate lytic infection.3 Therefore, it could be very difficult to block viral replic ation by reducing expressi on of this protein. After scanning all the possible cleavage sites in ICP4 mR NA of HSV-1, one hammerhead ribozyme with good kinetic parameters was chosen to test in tissue culture. Although this ribozyme significantly reduced ICP4 gene e xpression in an ICP4 expressing cell line, when tested against HSV-1 viral replication (either wild-type HSV-1 or ICP4 defective virus in permissive cell line), it did not block infectious vi ral particle production to a statistically significant level. However, this ribozyme caused some reduction at the very early stage of HSV-1 replication as shown in the ribozyme expressing cells which had the phenotype of smaller plaque size and fewer pl aques than control cells infected by HSV-1 (shown in Figure 3-3B ) At the later time point, this effect was overcome by active viral replication induced by the accumulation of ICP 4. This may explain the phenomenon that no difference was observed in the infectious viral particle pro duction level between control and ribozyme expressing cells. RNA interference (RNAi) is a conserve d biologic response to double-stranded RNA that results in the sequence-specific si lencing of target gene expression. Although the siRNA designed against HSV-2 ICP4 mRNA was able to delay viral replication and reduce infectious particle production level, it did not reduce the ICP4 mRNA level implying a complex effect caused by siRNA19 in the cells: The high level of viral infection might overwhelm the siRNA effect by providing high level of ICP4 expression which implied the limitation of this siRNA effect. On the other hand, siRNA-19 might also function as microRNA targeting either ICP4 mRNA or other gene transcripts,

PAGE 82

66 causing a reduction in viral yield but not leading to a dramatic change in RNA level. The inhibition of viral replication may be both specific and non-specific. In conclusion, because of the important ro le of ICP4 in HSV lytic infection life cycle, it is a good target for inhibiting HSV infection if a significant reduction of ICP4 mRNA can be achieved. However, consider ing that the functiona l threshold level of ICP4 is extremely low, ICP4 gene by itself mi ght not be an ideal target to eliminate HSV1 infection. It can be expected that a syne rgistic effect can be achieved by combining ribozymes/siRNAs targeting other esse ntial genes in addition to ICP4.

PAGE 83

67 Table 3-1. Ribozyme sequences and seque nces of their re spective targets. Ribozyme Label Ribozyme Sequence Respective Target Sequence ICP4-885 acgaactgatgagcgcttcggcgcgaaaggatg catcctcttcgt ICP4-533 tcgatctgatgagcgcttcggcgcgaaacgccg cggcgtcatcga UL20-135 gaactctgatgagcgcttcggcgcgaaacaaaa ttttgtcagttc UL20-154 cggaactcatgagcgcttcggcgcgaaacgcga tcgcgtcttccg UL30-933 aaggtctgatgagcgcttcggcgcgaaacgaac gttcgtcacctt UL30-1092 cacatctgatgagcgcttcggcgcgaaagcttg caagctcatgtg UL54-233 ttctgctgatgagcgcttcggcgcgaaacgaga tctcgtccagaa UL54-825 tgcatctgatgagcgcttcggcgcgaaacctgt acaggtcatgca Table 3-2. Conventional PCR primers. Primer Label Primer Sequence HSV ICP4 sense 5-CTGATCACGCGGCTGCTGTACACC3 HSV ICP4 anti-sense 5-GGTGATGAAGGAGCTGCTGTTGCG-3 Rabbit -actin sense 5AAG ATC TGG CAC CAC ACC TT3 Rabbit -actin anti-sense 5CGA ACA TGA TCT GGG TCA TC3 Table 3-3. siRNA duplex sequen ces and target sequences. Name Sequence siRNA ICP4-19 Target Sequen ce 5AAGAAGAAGAAGACGACGACG-3 siRNA ICP4-19 Duplex Sequence 5GAAGAAGAAGACGACGACGUU-3 3UUCUUCUUCUUCUGCUGCUGC-5 Scramble siRNA Target Se quence CUUCCUCACGCUCUACGUC Scramble siRNA Duplex Sequen ce 5-AACUUCCUCACGCUCUACGUC-3 3-GAAGGAGU GCGAGAUGCAGUU-5

PAGE 84

68 Figure 3-1. Map of plasmid pTR-UF 11 generated by Vector NTI.

PAGE 85

69 A. B. Detection of ICP4 Gene Expression in Ribozyme Transfected E5 Cells0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4Ratio of ICP4 vs. beta-actin MT pTRUF21-NewHp Ribozyme ICP4-885 Figure 3-2. Reduction of ICP4 e xpression level in E5 cells by transient Transfection with ICP4rz-885. A) PCR amplification of reverse-transcribed ICP4 RNA isolated from E5 cells separated on 1.5% agarose gel. Transient transfection of the plasmid containing ICP4rz-855 as well as controls (mock transfection and transfection of plasmid w ithout the ribozyme) was conducted, and total RNAs were harvested at day 2 and day 3 posttransfection for reve rse-transcription and PCR. Primers for ICP4 and -actin were used for PCR. B) Quantification of the PCR product amplif ied from cDNAs resulted from ICP4 ribozyme treated and control treated E5 cells. Total RNA was harvested from E5 cells treated with ribozyme ICP4-885 or with control tr eatments at the time point of 2 day post-infection of HSV1. Reverse-transcription followed by PCR was conducted, and PCR products were separated on 8% acrylamide gel and stained by SYBR Green nucleic acid dye for quantifications.

PAGE 86

70 Effect of ICP4 Ribozyme 885 on KD6 Viral Replication 5.8 5.85 5.9 5.95 6 6.05 6.1 6.15 6.2 6.25 6.3Log(viral yield pfu ) Mock Transfection pTRUF21NHp ICP4rz-885 Figure 3-3. Effect of ribozyme ICP4-885 on KD6 viral replica tion in E5 cell line. E5 cells, constructed to express ICP4 constitutively, were transfected with a plasmid expressing ribozyme ICP-885 fo llowed by infection of HSV-1 strain KD6 which is non-replicating HSV-1 with ICP4 deletion. Mock transfection and transfection using plasmid without ri bozyme were used as controls. In this experiment an MOI of 3 was used for KD6 infection. Twenty four hours after HSV-1 infection, cell lysates were harvested for plaque reduction assay on RS cells.

PAGE 87

71 A Expression Level of ICP4 ribozyme in Single Clones (radiactive RT-PCR)0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45ratio of ICP4ribo vs. acti n Pool D1 D2 D4 D5 B4 B5 B7 B Figure 3-4. Inhibition of wild -type HSV-1 viral replicati on rendered by ICP4 ribozyme885 function. A) After selection und er G418, 7 single colonies (D1, D2, D4, D5, B4, B5, and B7) were isolated and reverse transcription followed by radioactive labeled PCRs was conduc ted to compare ICP4 ribozyme-885 expression level. One of the single colony named as B5 has the highest ribozyme expression level, and it was chosen for HSV-1 infection study. ICP4rz-885 expression from the pool of all the positively selected cells was included as a ribozyme expression control (labeled as pool). B) RS cells stably expressing ICP4rz-885 had re sistance against wild-type HSV-1 infection indicating a phenotype of sm aller plaque size and fewer plaques after infection. The infecti on was conducted at a MOI of 10-3 using wild-type HSV-1, and cells were stai ned using crystal violet at 72 hours post-infection for observation.

PAGE 88

72 Time Course of HSV-2 (HG52) Viral Yield after siRNA Transfection 0.0E+00 1.0E+06 2.0E+06 3.0E+06 4.0E+06 5.0E+06 6.0E+06 15245075Time Point (hours)pfu/mL Mock Transfection siRNAControl siRNA-19 Figure 3-5. Effect of siRNA19 targeting ICP4 mR NA on viral replicat ion of wild-type HSV-2 (HG-52) in HeLa cells. The siRNA targeting mRNA of HSV-2 ICP4 was transfected in HeLa cells followe d by HSV-2 infection at an MOI of 10-3. At various time points, vi ral yields were quantified by plaque reduction assay. Two control groups were mock transfec tion and scramble siRNA transfection groups. The reduction level of siRNA-19 co mpared with that of the scramble siRNA control at 15 hours post-infecti on of HSV-2 is 63%, at 24hours is 63%, at 50hours is 70%, and at 75 hours post -infection of HSV-2 is 49%.

PAGE 89

73 CHAPTER 4 RNA GENE THERAPY FOR HERPES SIMP LEX VIRUS KERATI TIS; TARGETING A HSV-1 LATE GENE Introduction Herpes simplex virus type 1 (HSV-1), a double-stranded DNA virus, is one of the most wellcharacterized human pathogens. Infection with HSV-1 is very common and associated with various diseases: or al-facial infections (e.g. gingivostomatitis, pharyngitis, and recurrent herpes labialis), sk in infections (e.g. eczema, herpeticum, and erythema multiform), central neural system infection (encephalitis), and disseminated diseases. Herpes simplex virus keratitis (HSK) caused by HSV-1 is the most common infectious cause of cornea l blindness in the U.S. The consequence of repeated reactivations lead to cumulative damage; pa rticularly in the case of HSK, patients experience loss of corneal transparency caused by each episode of reactivation which eventually leads to blindness. Herpes Simplex Virus Keratitis Currently there is no viable therapy to prevent the recurrent infection despite the availability of systemic and topical antiviral medications, which can shorten the length of infection and reduce the severity of infection. The toxicity of antiviral drugs causes rejection and the failure of clinical treatment s. Patents often suffe r from both allergic damage and lesions caused by HSV-1 inf ections which are consistent with in vitro toxicity studies.160,210,211,390 Among all the antiviral chemot herapeutic agents, nucleoside analogs are the most successfully used in clinic, particular ly acyclovir (9-(2-

PAGE 90

74 hydroxyethoxymethyl) guanine; ACV). ACV has been commonly used in the systemic treatment of HSV-1 infection with low toxi city. ACV functions by interrupting HSV-1 viral DNA synthesis via HSV-1 thymidine kinase activity.149,150 The specificity of ACV against HSV is the phosphorylation of AC V to a monophosphate (ACV-MP) which is conducted by HSV thymidine kinase. The large amounts of ACV-MP are then transformed to the diphosphate (ACV-DP) by ce llular guanylate kinase. The triphosphate form of ACV, transformed by other cellular enzymes, is th e actual inhibitor of viral DNA replication. It functions th rough its specific binding to viral DNA polymerase. By incorporating into viral DNA, ACV triphosphate leads to premature termination of DNA synthesis. However, in high risk populations, indivi duals with compromised immune systems such as AIDS (Aquried Immune Deficiency Symdrome) patients, cancer patients, and patients undergoing organ transplantation, elev ated severe recurren ce and the generation of drug resistant HSV-1 strains can lead to failure in treatment and even death. ACVresistant and other nucleoside analogueresi stant strains have been isolated from immune-compromised patients.77,78 This ability of HSV to readily mutate in response to conventional chemical agents underscores a n eed to develop novel anti-HSV agents that will substitute for and/or complement ACV and other nucleoside analogues. UL20 Gene and Function of Its Gene Product Although the mechanism of HSV-1 virus matu ration and egress to the extra-cellular space has not been fully understood, it has been shown that UL20 protein, an essential gene product, plays an important role in viral replicati on in cell culture.17 HSV-1 UL20 gene is highly conserved in alphaherpesvi ruses, e.g., varicella-zoster virus (VZV)84, bovine herpesvirus-1 (BHV-1)370 and pseudorabies virus (PRV)185, as well as in a

PAGE 91

75 gammaherpesvirus MDV-2 (Marek s disease virus type 2)135, and the UL20 open reading frame (ORF) is positionally conserved in genom es of different alphaherpesviruses. The UL20 gene of HSV-1 encodes a 222amino acid nonglycosylated membrane protein, which is regulated as a 1 gene and present in the envelope of purified virions.378 Computer-assisted programs (TMPred152 and SOSUI148) predict that UL20 protein is a four-time membrane-spanning protein, placing both the amino and carboxyl terminal portions within the cytoplasm of cellular membrane as well as internal to the virion envelope (as shown in Fig. 4-1).236 Multiple membrane-associated events are involved in morphogenesis and egress of infectious herpes virions into the extrac ellular space: Primary envelopment by budding of capsids from the nuclei to the inner nucl ear leaflets, de-envelopm ent by fusion of viral envelopes with the outer nuclear leaflet, re-envelopment of cyt oplasmic capsids into Golgi or TGN (trans-Golgi network) derived vesicles, and finally transport of enveloped virus within cytoplasmic transport vesicles to extracellular spaces.168,241,353 UL20 protein functions at the step of vi rion egress from perinuclear space to cytoplasm and to extracellular space by dominantly distributing in nuclear membrane and cytoplasm (the endoplasmic reticulum and the Golgi apparatus). In the absence of UL20 protein, virions are trapped in perinuclear space as well as in cytoplasmic vesicles. Therefore, no infectious virions are released to extracellular space. It has been shown that deletions of the HSV-1 UL20 and the PrV UL20 genes resulted in a redu ction of infectious virus production by up to 100 folds compared with their parental wild type viruses.17,105,108 Although it has been recognized as a membrane protein, UL20 protein is involved in Golgi dependent glycosylation and cell surfac e expression of glycopr otein K (gK). gK

PAGE 92

76 and UL20 gene are required for a phenotype calle d syncytium during HSV-1 infection. Therefore, UL20 is also involved in virus-i nduced cell fusion. However, UL20 defective HSV-1 is impaired in viral re lease in a cell-type dependent manner, indicating that certain cellular functions can compensate for UL20 protein. It has been shown that the integrity of Golgi apparatus is one of the cell factors that have this function. Furthermore, it was suggested that expressing of UL20 is regulated as a 1 gene, and impairment in viral DNA synthesis diminished but did not abolish UL20 production.378 It is not known whether UL20 can directly or indirectly regulate viral DNA replication. Considering the important role of UL20 protein in intracellular virion morphogenesis and virus-induced cell fusion, it is intriguing to know whether de fective expression of this gene can affect the pathogenesis phenotype in animals. Gene targeting of HSV-1 has classically relied on in inhibiting immediate early gene expressions, especially ICP4. The impact of knocking down expression of an essential late gene on the HSV-1 viral life cycl e has not been addressed. In this chapter, a hammerhead ribozyme targeting UL20 mRNA was tested in cell culture against wild-type HSV-1s as well as drug resistant vira l strains. As shown from previous in vitro kinectic study (Chapter 2), this ribozyme has shown a si gnificant cleavage activity. Further tests of the inhibitory effect at RNA level as well as at viral DNA le vel were conducted to address the ribozyme effect. Meanwhile, sim ilar approach was used to test another hammerhead ribozyme targeting HSV-1 UL30 mRNA which encodes viral DNA polymerase.

PAGE 93

77 Materials and Methods Hammerhead Ribozyme Cloning Ribozymes with high kcat/Km (higher than 1 M-1 min-1) were selected for cell culture studies (see Chapter 2) Ribozyme sequences along with target sequences are listed in Figure 2-5, and two ribozym es are tested which were named UL20Rz135 and UL20Rz154, respectively. UL20Rz154 was chosen for the cell culture test due to its active catalytic activity (Table 2-3). Riboz ymes were cloned in a plasmid (pTR-UF21New Hairpin) for cell culture transfecti on experiment. In pTR-UF21-New Hairpin plasmid, ribozyme expression is driven by chicken -actin promoter and a CMV ie enhancer upstream (shown in Fig. 4-2A). A neomycin gene was included as a selection marker. The ribozyme was also cloned in to an adenovirus packaging plasmid, pAdlox, (accession number RVU62024 in NCBI nucleotide database). In this plasmid there are the 3 inverted terminal repeat of adenovirus, a viral packaging signal ( ), a cDNA expression cassette driven by the cytomega lovirus (CMV) promot er/enhancer, and a lox P Cre recombinase recognition sequence. Th e ribozyme expression was followed by an IRES (internal ribosome entry site)-GFP (gr een fluorescent protein) element (shown in Fig. 4-2B) for localization purposes. In the ribozyme expression cassette of both pTRUF21-New Hairpin and pAdlox, an internal hairpin ribozyme was located between the hammerhead ribozyme and IRES-GFP elem ent. The hairpin ribozyme conducts selfcleavage in order to free the 3-end of th e ribozyme by releasing downstream sequence. Test of Transient Transfectio n of Ribozyme Containing Plasmids against Wild-type Herpes Simplex Virus Type 1 Ribozymes with reasonable catalytic activit ies were tested in cell culture against wild-type herpes simplex virus type 1 (HSV-1) strain 17 syn +. Transient transfection of

PAGE 94

78 hammerhead ribozyme was conducted on rabbi t skin cell (RSC) using LipofectamineTM and PlusTM reagent (Invitrogen, Carlsbad, CA). A G418 selection was conducted for 6 to 8 days to enrich transf ected cells. An HSV-1 infection using strain 17 syn + was performed either at an MOI of 1 for 15 hours or at an MOI of 10-3 for 24 hours. Control transfections were conducted using the plasmid without the ribozyme. Viral yields from different transfections were compared usi ng the plaque reduction assay. Ribozymes showing effects in reducing viral yields we re packaged in the adenoviral vector for further testing in cell culture. Adenovirus Vector Packaging A serotype 5 recombinant adenoviral vect or using Cre-lox re combination system, described by Hardy et al134, was used for ribozyme pack aging. The protocols of recombination process and recombinant vi rus preparation were described by Glyn et al .272 Recombinant adenovirus was generated by co-transfection of linerarized pAdlox packaging plasmid with 5 adenoviral genomic DNA, which has its packaging sequence flanked by lox P sites. The transfection is performed in a 293 cell line called Cre8 cultured in Eagles minimal essential medi um (MEM) 10% Fetal Bovine Serum (FBS), 100 I.U. penicillin/mL, and 100 g/mL streptomycin (Cellgro Mediatech, Inc., Herndon, VA). Cre8 cells constitutively express Cr e recombinase. These cells generate recombinants between the lox P sites in the packaging plasmid and the 3 lox P site in the 5 adenoviral backbone (accession numb er RVU62024). Propagation of nonrecombined 5 is negatively selected by deletion of the packaging signal by the Cre recombinase. Plaques isolated from the co transfected plates were almost exclusively recombinants. Subsequent propagations of th e adenovirus in Cre8 cells can eliminate the contaminating 5 virus. Two Adenovirus purification me thods were used in this study: a

PAGE 95

79 kit called Vivapure AdenoPACKTM 100 (Vivascience AG, Hannover, Germany) was used to purify the recombinant adenovirus for cell culture study and animal experiments, and another method called Cesium Chloride (C sCl) step gradient purification was also adopted. A detailed procedure of generating reco mbination adenovirus is recorded as following: 1. Plate a T75 flask of Cre8 cells to 60% confluence in Eagles minimal essential medium (MEM) supplemented with 10% FBS, 100 I.U. penicillin/mL, and 100 g/mL streptomycin (Cellgro, Mediatech, Inc., Herndon, VA). 2. Digest 4.510 g of pAdlox plasmid DNA containi ng ribozyme expression cassette with SfiI (New England Biolabs, Inc., Ipswich, MA). The DNA was extracted once with phenol: chloroform: isoamyl alc ohol followed by ethanol precipitation of the aqueous phase. The DNA was recove red and resuspended in TE (pH8). 3. Cre8 cells were transfected with linear DNA along with 5 viral DNA using LipofectamineTM 2000 (Invitrogen, Carlsbad, CA) following product manual. Transfected cells were incubated at 37 C for 7 to 10 days for plaque formation. Medium (MEM with 10%FBS, 100 I.U. penicillin/mL, and 100 g/mL streptomycin) was refilled depending on cell condition. 4. Two T75 flasks were seeded with Cre8 cells : One was used to prepare a viral stock and the second one was used to extract vira l DNA to verify that the virus generated was indeed a recombinant. 5. When prominent cytopathic effect s (CPE) were observed throughout the transfected cells (approximately 810 days ), the cells and media were harvested from the dishes using a cell scraper. The mixture was transfered to a 50-mL cornical tube. To verify recombinant virus, viral DNA extr action protocol was used followed by appropriat e restriction digestions. 6. The harvested cell/ media mixture was frozen and thawed for three times to lyse the cells and release viral particles. 7. To amplify and purify the adenoviral stock, the viral lysate was used to re-infect cells. 0.5 mL of cell lysate and 5 mL of medium were mixed to cover a monolayer of Cre8 cells in a T75 flask. 24 hours were allowed for infection. 8. After the incubation, medium containing cel l lysate was replaced by fresh medium. Cells were cultured until prominent cyt opathic effects (CPEs) were observed throughout the monolayer (appr ox 1-2 days). Cells and media were harvested, as in

PAGE 96

80 step , and they can be st ored at -80 C. After 3 rounds of infection in Cre8 cells, the majority viral population was recombinant virus. A detailed procedure of CsCl step gradie nt purification of Adenovirus preparation is following: 1. 293 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% FBS and 100 I.U. penicillin/mL, and 100 g/mL streptomycin (Mediatech, Inc., Herndon, VA). Six 75cm2 tissue culture flasks of 293 cells were prepared to reach confluence. 2. To infect the cells, typically, 5x107plaque forming units (PFUs) of virus was added to 5mL of Opti-MEM I Reduced-Serum Medium (I nvitrogen, Carlsbad, CA) for each 75cm2 flask. Three to four hours of incubation was allowed at 37C in a 5% CO2 incubator. 3. Viral solution was removed at the end of the incubation and replaced by 15mL of DMEM containing 10% FBS and 1% penici llin-streptomycin (Mediatech, Inc., Herndon, VA). Cell lysates were harvested when prominent cytopathic effects were observed. Typically cell lysa tes were ready after 2 days. 4. Cells were harvested using a cell scraper and cell lysate was centrifuged at 2000xg at 4C for 10 minutes. The supernatant ca n be saved to resuspend the pellet. Usually cell pellets were resuspended in 5m L of media. Cell lysate was frozen and thawed for three times, alternating with a 37C water bath and -80C freezer. 5. Cell lysate was treated with Benzonase (S igma-Aldrich, St. Louis, MO) at 50U/mL at 37C for 30 minutes. Cell lysate wa s centrifuged at 2000xg, 4C for 10 minutes, and the supernatant was saved for CsCl step gradient purification. 6. Polyallomer tubes (Beckman Coulter, Inc., Fullerton, CA) were chilled on ice and a CsCl step gradient cont ained following components: a. 1.4g/mL of CsCl (bottom layer); b. 1.2g/mL of CsCl (middle layer); c. Viral cell lysate (top layer). 7. The tubes were centrifuged at 40,000xg, 4 C for 1 hour using a swinging bucket rotor (Beckman SW41 Ti Rotor, Beckman Coulter, Inc., Fullerton, CA). Typically, there were two white bands seen near the interface of the 1.2and 1.4g/mL CsCl layers. The lower band contained the in fectious viral particles which were collected using a 20-gauge needle and 3mL syringe. The harvested viral particles were diluted by at least two folds in 10mM Tris Hydrochloride (Tris-HCl) (pH8.0) and mixed well for recentrifugation. 8. The procedure in step 6-7 was repeated for two more times. The purified adenovirus was transferred to dialysis ba gs and was dialyzed against 500mL of

PAGE 97

81 chilled dialysis buffer for at least 6 hours at 4C. Two more times of dialysis were conducted. The dialysis buffe r was made fresh the same day and stored in 4C. The recipe of the dialysis buffer can be found in Appendix C. The Adenovirus stock was stored in aliquots at -80C. 9. The virus particle concentration of ad enovirus stock was measured by mixing 15 L of the stock with 285 L of water. The absorption at 260nm (A260) was determined by spectrophotometry. One A260 is approximately equal to 1012 viral particles per mL. The percentage of infectious virions typically ranges from 1 to 10% of the total number of vi ral particles. Preparation of Adenoviral DNA This procedure was conducted to either amplify 5 adenovirus for viral DNA extraction or isolate recombinant viral DNA for restriction digestion analysis. Culture media were removed from T75 fl ask of confluent culture (293 cells for 5 isolation or Cre8 cells for recombinant viral DNA extraction). Viral lysate (50 L) was mixed with 5mL of serum-free medium (Opti-MEM I Reduced-Serum Medium, Invitrogen, Carlsbad, CA) and plated on the ce lls. Two to four hours are allowed for infection. Following incubation, media are supplemented with 10% FBS and 100 I.U. penicillin/mL, and 100 g/mL streptomycin (Cellgro, Mediatech, Inc., Herndon, VA). Cells and media were harvested using a cell scraper when complete cytopathic effect (CPE) was observed (typically when monolayer cells are round-up a nd begin to detach) which might take 2-5 days before harves ting the cells. Cells were pelleted by centrifugation at 900 rpm at 4C for 10minutes and resuspended in 400 L of TE pH9 (10 mM Tris-Cl pH9, 1 mM EDTA). The supernatant was discarded and a large volume of undiluted bleach was used to treat the supernat ant. DOC lysis buffer (recipe listed in Appendix C) (400 L) was added to the cell resu spension and mixed well by passing through a pipette tip repeat edly. Spermine-HCl (8 L at a concentration of 500mM) was added and mixed well for incubation on ice fo r 10 minutes. The mixture was centrifuged

PAGE 98

82 at a maximum speed for 4 minutes at 4C, a nd the supernatant was tr ansferred to a fresh tube. Ten minutes of incubati on was allowed at 37C after 4 L of RNaseA (10mg/mL) was added. Incubation at 40C for one hour was followed after adding 60 L of 10% Sodium Dodecyl Sulfate (10% SDS), 20 L of 0.5M EDTA, and 40 L of 50mg/mL pronase (CALBIOCHEM, San Diego, CA) (see Appendix C for recipe). Phenol/chloroform/isoamyl alcohol (25:24:1) was used to extract viral DNA and the aqueous layer was collected to precipitate DNA. In less than 900 L of collected aqueous solution, 30 L of 5M sodium chloride (NaCl) was added followed by 600 L of Isopropanol (Fisher BioReagents, Fair Lawn, NJ). The DNA pellet was rinsed with 70% ethanol and dried in room temperatur e. Viral DNA was resuspended in 25 L of TE and BsaB I digestion was conducted to ch eck recombinant Adenoviral DNA. In 5 viral DNA, there are three BsaB I sites pr oducing a series of bands: 11648, 10536, 7723, and 2249 base pairs (bp). When a recombination happened successfully in Cre-loxp system, the 2249bp band would be replaced by anot her band depending on the insert in recombinant virus. Herpes Simplex Virus Type 1 Viral Strains and Viral Production Rabbit skin cells (RSC) were used to propagate wild-type HSV-1 (17 syn +). Protocols for viral production, purification and plaque reduc tion assay to estimate viral titer were previous described in Chapter 3. Cell Culture Tests of the Accumulative Effects of Ribozymes Packaged in Adenoviral Vector against Wild-type Herpes Simplex Virus type 1 To evaluate the viral yields after ribozy me treatment, after 15 hours of delivery of ribozyme as well as control treatments, Herp es simplex virus type 1 (HSV-1) infection was conducted at an MOI of 10-3 for either 24 hours or for 6 days. The experiment was

PAGE 99

83 set up in triplicate for each treatment each time point. A plaque reduction assay was performed to compare HSV-1 viral yields. In these early experiments, adenovirus stock was purified using CsCl step gradient pur ification method, and th e infective dose was 800-1000 viral particles pe r cell. When the ribozyme f unction was confirmed by at least two independent assays, further evalua tion was conducted. Another adenovirus purification method usi ng Vivapure AdenoPACKTM 100 (Vivascience AG, Hannover, Germany) was also adopted. A dose-response test was performed to obser ve the ribozyme effect to inhibit viral replication. In this assay, adenoviru s was purified using Vivapure AdenoPACKTM 100 (Vivascience AG, Hannover, Germany). RSC were seeded at a density of 2x105 cells per well one day before adenovirus inoculations (c ontrol virus was Ad-GFP containing GFP gene instead of ribozyme cassett e). A serial of dilutions of recombinant adenovirus (1, 10, 102, 103, 104, 105, 106 viral particles per cell) were us ed to conduct infections. Forty eight hours were allowed for accumulation of ribozyme expression followed by HSV-1 (17 syn +) infection at an MOI of 10-3. 24 hours were allowed before cell lysates were harvested for plaque reduction assay. At each dilution of the recombinant virus the infection was performed in triplicate and the plaque re duction assay was conducted on RSC. An effective dose was used for further observation of either th erapeutic effect in cell culture or target mRNA level after treatment. Real time Polymerase Chain Reaction to Compare Target Levels after the Ribozyme Treatment To investigate the ribozyme effect in knocking down the target mRNA level, reverse transcriptions were carried out using total RNA ex tracted from RSC containing ribozyme followed by HSV-1 infection. The r eal time PCR was carried out to compare

PAGE 100

84 target mRNA levels. Recombinant ad enovirus infections were conducted in quadruplicate for 48 hours follo wed by the infection of 17 syn + at an MOI of 3 for 8 hours. Total RNA extraction was performed using TriZol (Invitrogen, Carlsbad, CA). Contaminated DNAs were cleaned using DNAfreeTM kit (Ambion, Austin, TX) which is RNase free DNase. Reverse transcription (RT) was conducted using First-Strand cDNA Synthesis Kit (Amersham Biosciences, Buckinghamshire, UK). Total RNA (1 g) and random hexamer primers were used in each reaction. Total RNA was quantified by the spectrometry using a photodiode array detect or called Gene Spec III (MiraiBio Division, Alameda, CA) at a wavelength of 260nm and the quality of RNA was controlled with ratio of the absorption at 260nm divided by that at 280nm ranging from 1.8 to 2.0. cDNA from each RTreaction was diluted in 10 fold before real time PCR assay. Specific primers and a fluorescent probe for either the target or GAPDH (Glyseraldehyde-3phosphate dehydrogenase) were designed and synthesized by AB I system (Applied Biosystems, Foster City, CA). For each RTreaction, real time PCR assays were set up in triplicate for both sets of primers and probes. Standard curves for corresponding primers and probes using either RSC genomic DNA or HSV-1 viral genomic DNA (or, as an alternative, using cDNA from infected RSC) as reference DNA were carried out in triplicate. In order to obtain the correla tion between the template amount and the cycle threshold (Ct), serial diluti ons of reference DNAs (or cDNA) were used to generate standard curves. An absolute template am ount resulted from the standard curves based on the Ct was used to compare treatment a nd control groups. The ratio of target RNA level to GAPDH level was used to comp are between ribozyme treatment group and control groups. Meanwhile from the same TRIZOL extracted samples, DNA

PAGE 101

85 extractions were also conducted following manufacturers protocol. DNA samples were diluted to 1:10 and used as template for R eal-time PCR. Primers and probes for both HSV-1 DNA polymerase and cellular GAPDH were used and their ratio of each sample was compared. Testing Hammerhead Ribozyme against Drug Resistant Herpes Simplex Virus type 1 Strains HSV-1 drug resistant strains PAAr568,162, tkLTRZ182,163 and ACGr468 as well as their parental strain KOS were kindly provided by Martha Kramer. Growth rate study of drug resistance HS V-1 strains and wild-type HSV-1 with or without adenovirus packaged ribozyme treatments Rabbit skin cells (RSC) were seeded at a density of 105 cell per well of each 24well-plate one day before adenoviral infecti on. At the second day, Adenovirus infection was conducted at a dose of 5x105 viral particles per cell which was ED50 dose (effective dose to reduce viral replication by 50%) fr om dose response study. On day 3, HSV-1 infection was conducted at an MOI of 10-3; and at time points of 6, 12, 24, 48, 72 hours post-infection, cells were harvested for plaque reduction assay as describe before. Each group at each time point, the experime nt was conducted in triplicate. Acyclovir solution A 5mM stock of acyclovir (Sigma, St. L ouis, Missouri) (ACV) was prepared by resuspending 100mg ACV in 88.8mL H2O and 200uL HCl. The solution was filter sterilized and aliquoted. When preparing the ACV it was important to allow for complete suspension (by warming the sample and vortex mixing). Acyclovir inhibition threshold fo r drug resistant HSV-1 strains RSC was seeded at a density of 1x105 cells per well of 24-well-plates on the first day. On the second day, medium was repla ced by ACV-containing medium at various

PAGE 102

86 doses. For each dose, 3 wells of cells were included and HSV-1 (dr ug resistant strain or wild-type strain) infectio n was conducted on the third day at an MOI of 10-3. On the fifth day (or at the second day post-infection) infe cted cells were harvested and cell lysates were stored in -80C for the plaque reduction assay. The viral yields at each acyclovir dose treatment were plotted against the respective acyclovir dose. For 17 syn+ (wild-type HSV-1) and PAAr5, acyclovir doses of 0.1, 0.5, 1, 10, 20, 50,100 M were used to test drug sensitive range. As for tkLTRZ1 and ACGr4 dose range of 0.01, 0.1, 0.2, 0.5, 1, 5, 10 M were tested. A series of acyclovir doses (0.01, 0.05, 0.1, 0.2, 0.5, 1, 5 M) were used to test HSV-1 KOS strain. Cells were seeded at a density of 1x105 per well one day before pretreatme nt, and acyclovir was added the next day at the doses shown above. On the thir d day, HSV-1 infection was conducted at an MOI of 10-3 for two days before cell lysates we re harvested for the plaque reduction assay. Plaque reduction assay was conducte d on RSC. Drug inhibition curves corresponding to each strain were plotted by relating ACV doses and corresponding viral yields. The drug inhibition th reshold was set at the point that it could distinguish the wild-type HSV-1 (drug sensitive st rains) from drug resistant ones. Testing the hammerhead ribozyme agai nst drug resistant HSV-1 strains Rabbit skin cells (RSC) were seeded in each well of 24-well-plates at a density of 1x105 cells per well one day before treatment s. The next day adenovirus packaged ribozyme or GFP was used at a dose of 106 viral particles per cell (viral stock was purified using the Vivascience kit) to infect the cells in 200 L Opti-MEM (GIBCO, Invitrogen Corporation) per well. After 3 hour s the media were replaced with 5% bovine serum containing MEM. The same time a noadenovirus control and an ACV treatments (at a threshold level of 0.1 M) were included using the same media. At 24 hours post-

PAGE 103

87 infection of adenovirus, an HSV-1 (drug resist ant strains as well as drug sensitive strain controls) infection was c onducted at an MOI of 10-3 following HSV-1 infection protocol. Forty eight hours were allowed for HSV-1 inf ection to develop and cell lysates were harvested for plaque reduction assay at the end. Each treatm ent was set up in triplicate for all the HSV-1 strains. Results Transient Transfection of the Plasmid Ex pressing Hammerhead Ribozyme Followed by HSV-1 Infection (17 syn +) A transient transfection assay in RS C was conducted using pTRUF21 plasmid containing either ICP4 ribozyme-885 or UL20 ribozyme-154 as well as control transfections (mock transfec tion and backbone plasmid pTRUF21 transfection). A brief selection using G418-containing medium wa s followed. HSV-1 infection was conducted using 17 syn + strain at a low MOI of 10-3 for 24 hours. Cell lysates were harvested for a plaque reduction assay. As shown in Figure 4-3, a nearly two-log reduction in viral production was observed by transient tran sfection of a plasmid containing UL20 ribozyme-154. Transfection of a plasmid expr essing ICP4 ribozyme did not have any effect on viral production. Dose-response Assay of Adenovirus Packaged UL20 Ribozyme-154 against wild-type HSV-1 Viral Replication Sequences of UL20 ribozyme-154 and its target are listed in Table 3-1. UL20 ribozyme-154 was packaged in Adenoviral vector and the ribozyme expression is driven by a CMV promoter. The ribozyme expres sing cassette was cloned from pTRUF12 backbone containing hammerhead ribozyme and a downstream hairpin ribozyme. Between the promoter and ribozyme expressi ng cassette there is a small intron cloned by combining SV40 viral splicing donor and acceptor s ites (gta agt tta gtc ttt ttg tct ttt att tca

PAGE 104

88 ggt ccc gga tcc ggt ggt ggt gca aa t caa aga act gct cct cag tgg at g ttg cct tta ctt cta g). An IRES-GFP fragment, which was adopted from pTRUF12 backbone, was located downstream from the ribozyme expressing ca ssette and followed by poly (A) signals. The control for UL20 ribozyme-154 treatment was an Ad-GFP virus treatment and it contains the GFP coding sequence (CDS) betw een CMV promoter and poly (A) signals instead. A series of dilutions of Adenovirus (Ad) viral particle numbers were used to treat RSC followed by wild-type HSV-1 (17 syn +) infection. HSV-1 vi ral yields from Ad mock infection, Ad-GFP, and Ad-Rz (Ad-UL20rz) treatment were compared. In this assay, Adenovirus preparations were from a commercial adenovirus purification kit. Adenovirus transductions at each dose were observed using a fluores cent microscope for GFP expression as shown in Figure 4-4-A. There was a correlation between increasing levels of Ad-UL20Rz and decreasing HSV-1 viral produc tion as seen in Figure 4-4-B: when the Ad-UL20Rz was higher than 1000 viral part icles per cell (vp/cell), a >10% reduction was observed, while 105vp/cell led to a 56% reducti on in HSV-1 viral yield and 106vp/cell led to a 93% reduction. Inhibitory effect of UL20 ribozyme-154 on Wild-type Herpes Simplex Virus Type 1 Viral Replication Adenovirus packaged UL20 ribozyme-154, mock infecti on and control vector (AdGFP) were used to treat RSC. Wild -type HSV-1 infection at an MOI of 10-3 was followed for various times (1 to 6 days). The HSV-1 viral yields were compared by plaque reduction assay. As shown in Figure 4-5-A at one day post-HSV-1-infection UL20 ribozyme-154 treatment significantly re duced HSV viral replication by 83% (compared with Ad vector treated cells p<0.001 ) and this inhibitory effect lasted for 6 days as shown in Figure 4-5-B.

PAGE 105

89 Ribozyme Effect on Viral Target RNA and Wild-type Herpes Simplex Virus Type 1 DNA Replication In order to evaluate UL20 ribozyme-154 for its ability to inhibit viral target mRNA expression, RSC were infected with wild -type HSV-1 at an MOI of 3 for 8 hours following ribozyme treatment or control treatments (mock infection and Ad-GFP infection). Data are shown in Figure 4-6. After reverse-tr anscription followed by realtime PCR, a significant reduction in UL20 mRNA level by 68% was observed in ribozyme treated cells comp ared with Ad-GFP treatment (p<0.0005). However, a significant reduction in the mRNA level of HSV-1 DNA polymerase (the gene product of UL30) was also observed (70% re duction). DNA was also collected from the same cell lysate and viral DNA levels were compared to correlate the result came from plaque reduction assay. A significant reduction in viral DNA levels was observed only in ribozyme treated samples which was a reduction of 54% (p<0.004). Ribozyme Effect on Viral Replication of Herpes Simplex Virus Type 1 Drug Resistant Strains UL20 Ribozyme-154 was also tested agains t HSV-1 drug (ACV) resistant viral strains (PAAr568,162, tkLTRZ182,163 and ACGr468), and their parental strain, KOS, as well as 17 syn + were used as controls. To evaluate th e therapeutic effect of this ribozyme, a drug control using acyclovir (ACV) was incl uded. A dose response of ACV was tested against wild-type HSV-1 strains and drug resist ant strains for their sensitive ranges. A standard concentration of 0.1 M of ACV was chosen, since according to a recent study, at this dose wild-t ype viruses and drug resistant viruses can be distinguished.349 However, even at a dose of 1 M, ACV did not have any inhibitory effect on the replications of mutant strains tkLTRZ1 and ACGr4. As shown in Figure 4-7, UL20 Ribozyme-154 was tested for its ability to inhibit HSV-1 viral replication of not only wild-type strains but

PAGE 106

90 also a series of drug resistant strains that ha ve been well characterized for their resistance mechanisms. PAAr5 has mutation in viral DNA polymerase; tkLTRZ1 has been mutated in thymidine kinase, while ACGr4 contains muta tions in both genes. Therefore they are no longer sensitive to ACV treatment. The inhibitory effect caused by ribozyme was compared with that of acyc lovir (ACV). When tested against wild-type HSV-1 (both 17syn+ and KOS), ribozyme and ACV showed ve ry similar inhibito ry effect on viral replication (shown in Figure 4-7-A B). As expected, ACV di d not show any effect on viral replication of drug resistant HSV1 strains. However, treatment of UL20 ribozyme154 led to consistent inhibition in viral rep lication among all the stra ins tested (as shown in Figure 4-7-C D E). Inhibitory Effect of a Hamme rhead Ribozyme Targeting UL30 mRNA in Viral Replication A ribozyme targeting UL30 mRNA, UL30 ribozyme-933, was also packaged in Adenovirus vector to test its ability to knoc kdown viral replication. Sequences of this ribozyme and its target are listed in Tabl e3-1. A time course test comparing Ad-UL20rz, Ad-UL30rz, and the mixture of both ribozymes, was conducted using an adenovirus dose of 106vp/cell for 24 hours. It was followed by HSV-1 infection at an MOI of 10-3 for 24 to 72 hours, and cell lysates were harvested fo r plaque reduction assay. The viral yields were graphed in Figure 4-8-A. Wi thout ribozyme treatment, HSV-1 (17 syn +) viral production increased from 2.8x105pfu/mL at day 1 post-infection to 1.1x108pfu/mL at the third day; Ad-UL20rz treatment is a positive control that at day 1 post-infection viral yield was 9x103pfu/mL and 6.2x105pfu/mL on the third day; Ad-UL30rz treatment led to 6.2x103pfu/mL HSV-1 yield on day 1 and 4.4x105pfu/mL on day 3; the treatment using a mixture of Ad-UL20rz and Ad-UL30rz (ratio of 1:1) also le d to significant reduction (a

PAGE 107

91 viral yield of 3.9x103pfu/mL on day 1,which was a 99% reduction). Although the reduction caused by the mixture of ribozymes le d to a slightly highe r reduction in HSV-1 production, it was not significan tly different from treatment by either ribozyme alone. However, a synergic effect cannot be comp letely ruled out. Reverse transcription followed by real-time PCR was conducted to study the effect of ribozyme UL30rz-933 on the target mRNA level. As shown in Figure 4-8-B, a 24% reduction in UL30 mRNA (encoding HSV-1 DNA polymerase) was de tected from ribozyme treated group compared with that from Ad-GFP treatment (p=0.05). Discussion When considering inhibiting HSV-1 viral re plication, very ofte n either immediate early genes, especially ICP4 gene, or ear ly genes such as DNA polymerase (including any DNA synthesis related viral proteins) are the targets for drug development. However, HSV-1 has a relative low expression level of immediate early genes as well as viral DNA polymerase (real-time PCR result showing UL30 mRNA level), suggesting that their functional thre sholds are very low. This makes it difficult to efficiently inhibit viral acute infection by simply knocking down eith er of these genes alone. On the other hand, at the late stage of HSV1 replication, a mass of late pr oteins is expressed for virion packaging, transport and maturation. It can be expected that reduc tion of an essential protein production at this st age will lead to dysfunctiona l or decreased release of infectious progeny virions. Therefore the vira l infection can be dramatically limited. In this study a hammerhead ribozyme targeting mRNA of HSV-1 UL20, a 1 gene, was tested for its inhibitory eff ect in viral replication. It has been suggested that UL20 gene encoding a membrane protein is essential for viral intraand extracellular egression as well as intracellular transport of viral glyc oproteins. There is a cell type dependent

PAGE 108

92 phenotype caused by impaired UL20 expression, indicating that certain cellular function compensates to this viral protein. However, the observation that UL20 gene is highly conserved among alphaherpesviruses leads to th e speculation that this gene may have an important role in vivo As mentioned earlier, a therapeu tic effect against HSV-1 infection can be reached in vivo without completely restraining the viral replica tion; thereby a significant reduction in virion pr oduction can lead to completely abolishing the clinical indication of infection. UL20 protein functions for virion intracellular transport, extracellular release, and intracellular transport of vi ral glycoproteins. A hammerhead ribozyme targeting UL20 mRNA significantly inhibited HSV-1 viral re plication by sequence-specific cleavage. The ribozyme maintained its inhibitory effect when tested against other HSV-1 strains: it not only reduced wild-type HSV-1 replication (17syn+, KOS) but could also inhibit those of drug resistant HSV-1 strains (PAAr5, tkLTRZ 1, and ACGr4). It can be concluded that UL20 gene product of HSV-1 is e ssential for viral life cycle in vitro (in RSC), and knocking down this gene expression leads to reduction of vira l production. This inhibitory effect is probably caused by jeopa rdizing the egress of virion as well as the transport of glycoproteins whic h implies a new strategy to inhi bit HSV-1 viral replication, to prevent a late event or essentia l late protein pro ductions of HSV-1. Although ACV treatment can dramatica lly prevent wild-type HSV-1 viral replication in vitro it cannot inhibit that of drug resistant viruses (PAAr5, tkLTRZ1, and ACGr4). Even at the dose of 1 M, ACV did not show any e ffect in viral production of tkLTRZ1 and ACGr4. When patients are infect ed with drug resistant HSV-1, it will lead to a detrimental result in spite of the availa bility of drugs. The reason these three drug

PAGE 109

93 resistant HSV-1 strains were chosen is that they repr esent general drug resistance mechanisms: mutation in thymidine kinase (TK) and in DNA polymerase. Current antiviral drugs for HSV-1 infection are mostly nucleotide analogs. They can either be substrates of TK, indirectly disrupting vira l DNA synthesis, or be incorporated in elongated DNA strand leading to pre-mature term ination. Because of antiviral treatments in patients especially in immune-deficient patients, drug resistant virus is selected in vivo leading to uncontrolled spreading HSV-1 inf ection, in some cases, this is lethal to patients. It is encouraging that a ribozyme targeting mRNA of HSV-1 UL20 can overcome this issue. Although nucleotide cha nges can cause the emergence of resistant escape mutants for UL20 ribozyme, ribozymes targeting different essential genes of HSV1 can be combined to guarantee the inhi bition, e.g., by combining ribozymes targeting immediate early genes, early and la te essential genes. Therefore in viv o tests will provide further information concerning the applica tion using the ribozyme as a therapeutic reagent. Two control adenoviruses were used to indi cate the effect of adenoviral vector in the cell during the process of testing adenoviral delivered UL20 ribozyme; they are adenoviral vector without any transgene insertion (backbone vector or called 5 virus) and an adenoviral vector including GFP ge ne. These two adenoviral vectors showed different effects on HSV-1 lytic viral infec tion in the cell. Very often there was significant variation when 5 virus was used as control. For example, in the experiment shown in Fig 4-5-A, the treatment using 5 virus (Ad vector) led to a 79% reduction in HSV-1 viral replication (at 24 hours post-infec tion of HSV-1) compared with the viral yield from cells that were only infected with HSV-1 (No Ad). In a separate experiment

PAGE 110

94 (shown in Fig 4-5-B), a similar experiment showed a reduction by 23% in HSV-1 viral yield from cells treated with 5 virus (Ad vector) compared with that of cells only infected with HSV-1 (No Ad). In addition, the efficiency of HSV1 viral infection in these two experiments varied significantly, i ndicating the experimental error. It was speculated that 5 virus might cause a non-specific eff ect which interrupted with cellular machinery; therefore, it indirectly affected HSV-1 viral replicati on. On the other hand, when the adenoviral vector including GFP gene was used as control, a consistent effect was observed in HSV-1 viral replication leve l, therefore, the ad enovirus packaged GFP vector was chosen as control for the rest of experiments. Another reason to use Ad-GFP as vector control was that an IRES-GFP el ement was included in the construct of adenovirus packaged ribozyme. Therefore, it is appropriate to use the Ad-GFP to control the effect caused by GFP expression. Ho wever, when viral gene expressions (UL20 and UL30 mRNA level) were investigated for the ribozyme effect, Ad-GFP treatment led to approximately 50% reduction in viral mRNA level of both UL20 and DNA polymerase (as shown in Fig4-6-A and B). It is possibl e that Ad-GFP competed with HSV-1 for the usage of cellular machinery, e.g., RNA polymeras e II; therefore it indirectly led to a lower level of viral gene expression in the Ad-GFP treatment group. However, in another experiment (Fig4-8-B), Ad-GFP did not interrupt viral DNA polymerase expression, indicating that there might have been a non-specific effect dur ing the course of experiment. Overall, in spite of ab ove variations, the ribozyme treatment (UL20 or UL30 ribozymes) reduced viral target gene e xpression and inhibite d viral replication significantly compared with Ad-GFP treatmen t. Another observation derived from ribozyme test against drug resistant HSV-1 strains was that although Ad-GFP treatment

PAGE 111

95 did not affect 17syn+, KOS, PAAr5 and tkLTR Z1 viral replicati on, it significantly interrupted ACGr4 viral repl ication. ACGr4 is a doublemutant in both TK and DNA polymerase genes generated from a KOS parental strain. This observa tion suggested that virus with mutations leading to the same drug resistant phenotype may have different behaviors in other aspects. However, when treated with UL20rz, ACGr4 viral replication was reduced consistent with te sts of other HSV-1 strains. An interaction between DNA polymerase and UL20 gene expression was observed previously. It was known that when HS V-1 DNA polymerase activity was affected, UL20 expression would be diminished but not a bolished. In this study, when cells were treated with a UL30 ribozyme to inhibit DNA polymerase expression during HSV-1 infection, a delayed reduction in UL20 expression was observed by reverse-transcription and real-time PCR (data not shown), a lthough the reduction was not statistically significant compared with those of cont rol treatments. However, when a UL20 ribozyme was used to treat cells against HSV-1 in fection, a synchronized down-regulation in DNA replication level was detected which was stat istically significant compared with control treatments. These imply that coordination between UL20 and UL30 gene expression exists during lytic infection, and UL20 expression can provide a feedback signal to viral DNA synthesis. During the process of packaging ribozymes into the adenoviral vector, a small intron (the sequence is 5ggg aag tta act ggt aag ttt ag t ctt ttt gtc ttt tat ttc agg tcc cgg atc cgg tgg tgg tgc aaa tca aag aac tgc tcc tca gtg gat gtt gcc ttt act tc t agg cct gta ccc 3) derived from SV40 SD/SA (splicing donor/acc eptor sites) was cloned in between the CMV promoter and the ribozyme expression cas sette. The original construct did not

PAGE 112

96 include any intron due to the consideration that an intron would have no effect on the ribozyme level in the cytoplasm after HSV in fection. Because HSV-1 infection will shut down the host splicing mechanism, an intron should not provide an advantage for ribozyme transport in the cytoplasm. Ho wever, the ribozyme expression from the construct with the intron was significantly higher than the one without it after HSV-1 infection (data not shown). It suggested that the intron led to elevated ribozyme expressions. When the UL20 ribozyme was tested, the cons truct containing the intron showed higher inhibition (96% reduction) against HSV-1 re plication than that of the construct without the intron ( 36% reduction). This effect was observed after 6 days of HSV-1 infection in the cell cu lture (data not shown), although at 1 day post-infection the inhibition levels from both groups were very similar (data not shown). It confirmed that including the intron in the ribozyme cassette can make the expression more efficient. This effect was maintained throughout HS V-1 infection (even with a high moi). Therefore, all the studies rela ted to adenoviral packaged UL20 ribozyme in this chapter were conducted using the construct w ith the intron. However, when UL30 ribozyme was packaged in the adenoviral vector, the intr on was not included. It was shown that the UL30 ribozyme can reduce viral replication in vitro and it can be expected that by inserting the intron in this construct, a more significant inhibition would be observed. Overall, in vitro a hammerhead ribozyme targeting mRNA of UL20 gene significantly inhibited HSV-1 vi ral replication of wild-type and drug resistant strains by sequence-specific degradation; it is intriguing to see the therapeutic effect in animal models.

PAGE 113

97 Figure 4-1. Membrane topology of UL20 protein predicted by the TMPred and SOSUI algorithms.236

PAGE 114

98 AMP-R p21NewHp 6568 bp CMV ieenhancer PYF441 enhancer Intron exon neoR SV40poly(A) Chicken -actinpromoter HSVtkpromoter TR TR Hairpin Rz Spe I (1931) Hin dIII(1921)AAMP-R p21NewHp 6568 bp CMV ieenhancer PYF441 enhancer Intron exon neoR SV40poly(A) Chicken -actinpromoter HSVtkpromoter TR TR Hairpin Rz Spe I (1931) Hin dIII(1921)A p21NewHp 6568 bp CMV ieenhancer PYF441 enhancer Intron exon neoR SV40poly(A) Chicken -actinpromoter HSVtkpromoter TR TR Hairpin Rz Spe I (1931) Hin dIII(1921) p21NewHp 6568 bp CMV ieenhancer PYF441 enhancer Intron exon neoR SV40poly(A) Chicken -actinpromoter HSVtkpromoter TR TR Hairpin Rz Spe I (1931) Hin dIII(1921)A pAdloxP-RVU62024 4224bp AMP-R polyAsignal-1 polyAsignal-2 polyAsignal-3 CMV Promoter Packaging Site (sci) loxPsite Repeat Region-2 inverted Repeat Region-1 inverted Hin dIII(1164) Sal I (1182)B pAdloxP-RVU62024 4224bp AMP-R polyAsignal-1 polyAsignal-2 polyAsignal-3 CMV Promoter Packaging Site (sci) loxPsite Repeat Region-2 inverted Repeat Region-1 inverted Hin dIII(1164) Sal I (1182) pAdloxP-RVU62024 4224bp AMP-R polyAsignal-1 polyAsignal-2 polyAsignal-3 CMV Promoter Packaging Site (sci) loxPsite Repeat Region-2 inverted Repeat Region-1 inverted Hin dIII(1164) Sal I (1182)B Figure 4-2. Maps of cloning c onstructs. A) The map of plasmid used for delivery of hammerhead ribozyme by transient transf ection. Ribozymes were cloned in between HindIII and SpeI sites. Ribozyme expression is driven by chicken actin promoter; and a self-cleavage hairpin ribozyme following hammerhead ribozyme can release down-stream fragment to increase the activity of the hammerhead ribozyme. B) The ma p of pAdlox designed for adenoviral vector packaging. Hammerhead ribozym e expression cassette was cloned in HindIII and SalI site, and the loxP site was constructed for recombination event.

PAGE 115

99 Effect of RZs on 17 syn+ Viral Replication at MOI=0.001 24hrPI0 1 2 3 4 5 6LOG(total pfu) RSC-con p21NewHP-con p21NewHP-ICP4rz p21NewHP-UL20rz *P=0.0001 Figure 4-3. Transient transfection of UL20 ribozyme-154 significantly reduced wild-type herpes simplex virus type 1 (17 syn+ ) viral replication. RSC was transiently transfected with a plasmid containing UL20 ribozyme and the control transfections were a ribozyme targeti ng ICP4 and a backbone vector without any ribozyme. After brief selection to enrich the transfected cells, cells from each treatment including an untreated RSC group were equally seeded and infected with wild-type HSV-1 (17 syn +) at a moi of 10-3. Viral production at 24 hours post-infection from each group wa s compared using plaque reduction assay. There was a 100 fold reduc tion of viral replication in UL20 ribozyme treatment group compared with vector only (p21NewHP-con) (with a p value of 0.0001).

PAGE 116

100 A. Figure 4-4. Dose-response of adenovirus de livered ribozyme treatments to herpes simplex virus type 1 viral yield. A) Ad-GFP transduction of RS cells at various doses observed through fluores cent microscope. Bright field observations of cells by light micros cope were shown on the left, while corresponding doses were labeled under each group of pictures. Pictures were taken at 2 days after ad enoviral infection. B) Do se-response indicating an association of increasing le vel of Ad-Rz (X axis) w ith a decrease in HSV-1 viral yield (Y axis). Vectored-ri bozyme was delivered at various doses showed in X axis, and at 2 days afte r ribozyme delivery, HSV-1 infection was conducted at a MOI of 10-3 for 24 hours before cell lysates were harvested for plaque reduction assay. The infection at each dose of vectored-ribozyme was conducted in triplicate. 10 viral particles per cell 100 viral particles per cell 1x103 viral particles per cell 1x105 viral particles per cell 1x104 viral particles per cell 1x106 viral particles per cell

PAGE 117

101 B. Figure 4-4. (continued)

PAGE 118

102 A. UL20rz Treatment Reduces HSV-1 Viral Yield in RS Cells0.0E+00 1.0E+06 2.0E+06 3.0E+06 4.0E+06 5.0E+06 6.0E+06 7.0E+06 8.0E+06Viral Yield (pfu) -Ad +HSV-1 +Ad Vector +HSV-1 +Ad-UL20rz +HSV-1 Figure 4-5. Inhibitory effect of UL20 ribozyme-154 on wild-type herpes simplex virus type 1 viral replication. A) At day one post-infection of HSV-1, UL20 ribozyme-154 inhibited wild-type HSV-1 viral replication by 83% compared with adenovirus vector (without ribozy me) control treatment (p<0.001). Viral yields from -Ad+HSV-1, +Ad vect or+HSV-1, and +Ad-Rz+HSV-1 are 5.44x106+ (S.D.)3.24x106pfu/mL, 4.78x106+ (S.D.)6.94x105pfu/mL, and 7.89x105+ (S.D.)1.90x105pfu/mL, respectively. B) A time course study was conducted to address the ribozyme effect on multiple steps of viral replications during longer incubati on periods. A comparison of viral productions at day one and six post-HSV infection from ribozyme treatment is shown. Each infection was conducted in tr iplicate: At 1 day post-infection of HSV-1, viral yield of No Ad treatment was 1.01x106 + (Standard deviation, S.D.)1.26x105pfu/mL, viral yields of Ad v ector and Ad-Rz treatments were 7.72x105+ (S.D.)1.98x105pfu/mL and 6.89x105+ (S.D.)6.11x104pfu/mL, respectively. A 10% reduction in vi ral replication level was observed in ribozyme treated group (Ad-Rz) compar ed with vector control group (Ad vector) at this time point. At 6 days post-infection of HSV1, viral yields of No Ad, Ad vector, and Ad-Rz were 2.20x107+ (S.D.)1.46x106pfu/mL, 1.52x107+ (S.D.)8.33x105pfu/mL, and 5.42x105+ (S.D.)3.63x104pfu/mL, respectively. At this time point, a 96% reduction in viral replication was observed in ribozyme treatment group (AdRz) compared with vector control (Ad vector) (p<0.00006).

PAGE 119

103 B. 1 6 No Ad Sci-5 (Ad Vector) Ad-Rz 0.0E+00 5.0E+06 1.0E+07 1.5E+07 2.0E+07 2.5E+07 Days Post-HSV infection Viral Yield (pfu/mL)Rz Effect on wtHSV-1 Viral ReplicationTime Course No Ad Sci-5 (Ad Vector) Ad-Rz Figure 4-5. (continued)

PAGE 120

104 A. B. UL20 mRNA Level after Ribozyme Treatment0 0.2 0.4 0.6 0.8 1 1.2UL20/GAPD H No Treatment AdGFP AdSUL20rz mRNA Level of Viral DNA Polymerase after UL20 Ribozyme Treatment0 0.1 0.2 0.3 0.4 0.5 0.6 0.7Ratio of Pol/GAPDH No Ad AdGFP AdSUL20rz C. HSV-1 Viral DNA Level after Rz Treatment 0 0.05 0.1 0.15 0.2 0.25pol/GAPDH No Ad Ad-GFP Ad-UL20rz Figure 4-6. Real-time polymerase chain re action results show the effect of UL20 ribozyme-154 on viral mRNA and DNA. A) Reverse transcription followed by real-time PCR was conducted to study UL20 mRNA level. A ratio of viral UL20 mRNA level to the cellular GAPDH level was used to indicate the abundance of UL20 mRNA. A 50% reduction in viral UL20 mRNA level was observed by the Ad-GFP treatment co mpared with that of the No Ad control (p<0.0004). UL20 ribozyme-154 treatment (AdUL20rz) led to a significant reduction in UL20 mRNA level compared with Ad-GFP treatment. The reduction is by 68% comparing w ith Ad-GFP treatment (p<0.0005). B) The same set of cDNA was used to studied viral DNA polymerase expression level in each treatment group. A 52% reduction in the expression level of viral DNA polymerase was detected by Ad-GFP treatment compared with No Ad control treatment (p<0.006). Ri bozyme treatment led to a significant reduction of 70% in HSV-1 UL30 expression level, which encodes viral DNA polymerase, compared with Ad-GFP treatment (p<0.0005). C) A ratio of viral polymerase DNA level to cellular GAPDH level was used to indicate the abundance of viral DNA. There was no significant difference between viral DNA levels from No Ad and Ad-GFP treatments. The ribozyme treatment (Ad-UL20rz) led to a 54% reduction in viral DNA level compared with that of the GFP treatment (Ad-GFP) (p<0.004).

PAGE 121

105 A. B. Ribozyme Effect on wtHSV-1 (17 syn +) Viral Replication0.0E+00 5.0E+06 1.0E+07 1.5E+07 2.0E+07 2.5E+07 3.0E+07 3.5E+07 4.0E+07 4.5E+07HSV-1 Viral Yield (pfu) No Treatment 0.1uM ACV Ad-GFP Ad-S-UL20rz Ribozyme Effect on wt HSV-1(KOS Strain) Viral Replication0.0E+00 2.0E+06 4.0E+06 6.0E+06 8.0E+06 1.0E+07 1.2E+07 1.4E+07 1.6E+07Viral Yield (pfu/mL No Treatment 0.1uM ACV Ad-GFP Ad-S-UL20rz C. D. Ribozyme Effect on Drug Resistant Virus (PAAr5) Viral Replication0.0E+00 1.0E+06 2.0E+06 3.0E+06 4.0E+06 5.0E+06 6.0E+06Viral Yield (pfu/mL) No Treatment 0.1uM ACV Ad-GFP Ad-S-UL20rz Rz Effect on Drug Resistant HSV-1 (tkLTRZ1) Viral Replication0.0E+00 5.0E+05 1.0E+06 1.5E+06 2.0E+06 2.5E+06 3.0E+06 3.5E+06 4.0E+06Viral Yield (pfu/mL) NT 0.1uM ACV Ad-GFP Ad-Rz E. Rz Effect on Dru g Resistant HSV-1 (ACGr4) Viral Replication0.0E+00 1.0E+06 2.0E+06 3.0E+06 4.0E+06 5.0E+06 6.0E+06 7.0E+06Viral Yield (pfu/m L NT 0.1uM ACV Ad-GFP Ad-Rz Figure 4-7. UL20 ribozyme-154 tested against series of herpes simplex virus type 1 strains for inhibitory effects. A) Ribozyme treatment led to a significant reduction (by 98%) in 17 syn + viral replication comparing with Ad-GFP treatment (p<0.002), while acyclovir trea tment had very similar inhibitory effect (99% reduction, p<0.02) B) Ribozyme had inhibitory effect on viral replication of HSV-1 strain KOS: 95% reduction was achieved comparing with Ad-GFP treatment (p<0.05), while ACV inhibited it by 80% (p<0.02). C) HSV-1 drug resistant strain PAAr5 can be inhibited by ribozyme (99% reduction, p<0.005) but not by ACV. D) Drug resistant strain tkLTRZ1 viral replication was inhibited by ribozyme by 76% (p<0.05), while no effect from ACV. E) Double-mutant ACGr4 viral replication was i nhibited by ribozyme by 70% (p<0.006), while ACV di dnt show any effect.

PAGE 122

106 A. 1 3 0.0E+00 2.0E+07 4.0E+07 6.0E+07 8.0E+07 1.0E+08 1.2E+08 Days PostHSV-1 InfectionUL20rz and UL30rz Effects on HSV-1 (17syn+) Viral Replication No Ad Ad-UL20rz Ad-UL30rz Mix-UL20rz&polrz B. Real-time PCR to Detect HSV-1 Polymerase Expression Level0.0E+00 1.0E-03 2.0E-03 3.0E-03 4.0E-03 5.0E-03 6.0E-03 7.0E-03 POL/GAPDH No Treatment Ad-GFP Ad-UL30rz Figure 4-8. Inhibitory effect of UL30 ribozyme-933 on herpes simplex virus type 1 (17 syn +) viral replication. A) UL30 ribozyme-933 treatment led to significant reduction in HSV-1 viral production by 98% (p<0.01) at day 1 post-infection and this effect maintained until day 3. UL30rz-933 has very similar effect as UL20rz-154, since UL20rz-154 treatment is a positive control in this assay. Furthermore, a synergistic effect was achieved by combining both ribozymes. B) UL30rz-933 treatment led to a 24% reduction in UL30 mRNA level (p=0.05).

PAGE 123

107 CHAPTER 5 STUDIES OF DELIVERY VECTORS FOR HSK GENE THERAPY Introduction Herpes simplex virus keratitis (HSK) is a chronic infection of the cornea by Herpes simplex virus (HSV), which continues to be an important cause of unilateral blindness. Despite considerable progress in the understand ing of the virus at cellular and molecular levels, the prospect of prevention still appears to be a long way off.344 Although it would be ideal to inhibit recurrent infections, proba bly by selectively targe ting latent infected ganglion, or, by establishing surveillance against active viral replication during reactivation, it is difficult to deliver therapeu tic agents to neurons and maintain long term protection. However, a therap eutic agent can provide a prot ection effect at the corneal epithelium to prevent HSV replication. The development of non-toxi c topical antiviral agents has been an important step forw ard in HSK management. Different from traditional antiviral drugs, a gene therapy approach may provide better controlled therapeutic effects. Viruses that can be considered as gene therapy vectors for HSK are adenoassociated virus (AAV), herpes simplex vi rus (HSV), adenovirus (Ad). In addition, direct delivery of small molecules usi ng electroporation/iontophor esis is an option. Adeno-associated Virus Vectors Adeno-associated virus (AAV) has signi ficant advantages in gene transfer application: It is non-pathoge nic, able to transduce divi ding and non-dividing cells, and establishes long-term gene transfer in nondividing cells. However, the small genome

PAGE 124

108 size (approximately 4.7kb) limits packaging capacity. AAV vectors containing capsids from different serotypes can be app lied for tissue-specific gene transfer. Herpes simplex virus (HSV) infection of th e cornea, either from primary infection or reactivation, initiates in co rneal epithelium. An antiviral agent can be delivered to corneal epithelium to ameliorate active viral replication in order to prevent following damage. Because human epithelium regenerates itself in 10-14 days, a long term gene transfer effect can be achieved by transduc ing epithelial stem-cells. AAV vectors have the ability to transduce dividing and non-di viding cells which provi des an advantage for corneal gene transfer. A gene therapy study using AAV-2 vectors in skin, where cell regeneration has a very similar pattern as to the corneal epithelium, indicates the promise in developing gene transfer in cornea using AAV.2 However, there are very limited studies to compare the gene transfer e fficacy of AAV vectors in cornea. Until 2003, a study of in vivo gene delivery to corneal stro ma using AAV vector was conducted by Mohan et al .253 This study provided informati on that AAV can transduce stromal keratocytes, and later unpublished data suggest ed that AAV5 has better efficacy of gene delivery in stroma than AAV2 (Mohan RR, Schultz GS). For the purpose of a corneal gene therapy, it is important to evaluate the ability of different AAV serotypes to transduce each cell layer of cornea. In this study, a comparison of different serotypes of AAV (AAV1,2,5,7, and 8) was conducted. It sh owed that AAV vectors could transduce the corneal epithelium, stroma, and endothelium in a very short period of time (7 days). This result indicates that in additi on to treating the cornea in patients in situ it might be possible to pre-treat corneal allografts with AAV vectors en coding therapeutic agents in order to prevent disease deve lopment after transplantation.

PAGE 125

109 Herpes Simplex Virus Vectors Herpes Simplex Virus (HSV) is a promising ve ctor for gene transf er applications in nervous system. HSV contains a genome at a size of 152kb which provides an extremely high capacity to accommodate large transgene insertions. Replicating HSV vectors are not suitable for gene therapy due to the toxi city of massive viral gene expression. By eliminating genes necessary for viral replica tion, the toxicity of the vector can be minimized. Replication defective HSV-1 vector can transduce neuronal cells, and maintain the similar transport behavior as wild -type HSV. When inoculated in peripheral tissues (using subcutaneous inoculation or mi croinjection in corneal stroma), replicatingdefective HSV-1 vectors can underg o retrograde transport to ente r the nuclei of neurons. Viral DNA can be maintained as a latency-like episome. By this means, a HSV-1 viral vector can persist and provide long-term transgene expression. As shown in unpublished data from Dr. Blooms laborator y in Fig. 5-1, an HSV-1 vector containing the LacZ gene was delivered by intrastromal injection in rabbits. At 72 hours post-injection, blue reaction product can be observe d in numerous cell bodies (Fi g. 5-1-A) and axons in the trigeminal ganglion (Fig. 5-1C red arrow). In addition to the ability to transduce ganglion cells, HSV-1 vectors can also transd uce cells that appear to be corneal limbal cells as shown in Fig. 5-1-B and D. Because of these special characteristics of the HSV-1 vector, it has been employed extensively in ge ne therapy for neuronal disorders. It may be also applied in preventing HSK by de livering an HSV vector containing the therapeutic transgene to latently infected neurons. It was speculated that by constitutively expressing the therapeutic ge ne, a protection function might be established to prevent reactivation. Howe ver, this hypothesis remains to be tested, given that the mechanism of how previous HSV infection re duced the efficiency of super-infection of

PAGE 126

110 neuronal cells is still unknown. This selective targeting of neuronal cells by HSV vector also requires the bypa ss of existent immune surveillan ce from previous HSV infection. Adenoviral Vectors Adenoviruses were first isolated from pr imary cells derived from human adenoid tissue.147,302 These viruses belong to Adenoviridae family which is divided in to two genera, Aviadenovirus (limited to bird viru ses) and Mastadenovirus (including viruses infecting human, simian, etc).188 Adenoviruses contain a protein capsid surrounding a DNA core, which is composed of the linear do uble-stranded DNA and f our viral proteins. The carboxyl-terminal domain of adenoviral fibe r protein is responsible for the binding of the cellular receptor for the step of adso rption. The coxsackievirus and adenovirus receptor (CAR), a member of immunoglobin fam ily, is a high-affinity receptor for human adenoviruses (except for subgroup B).296 Cellular integrins serv e as binding paterners of penton base proteins of ade noviruses which mediate the inte rnalization of virions. The cellular receptors of vi ral fiber and penton proteins determ ine the tropism of adenoviruses. Adenoviral genomes contain early and late viral genes: Activation of early gene expressions leads to the S phase entry of hos t cells, the protection against host antiviral responses, and the preparation for viral DNA re plication. These functions are achieved majorly by E1A gene product which is the first gene expressed after the viral genome enters the nucleus. At the onset of adenoviral DNA replica tion, late genes are expressed efficiently which is controlled by the major la te promoter through a strong activation of E1A proteins. Late gene products block th e cellular mRNA trans port and lead to the preferential translation of viral mRNA; meanwh ile they set the stage for virion assembly. Studies of adenoviral infection have le d to the molecular understanding of many fundamental cellular events, including transcription12 and splicing26, and they also led to

PAGE 127

111 identifications of regulatory pr oteins for cell cycles. In a ddition, adenoviruses have been developed as vectors for gene therapy applications. The first generation adenoviral (Ad) vect or contains E1-deletion. Although it is replication defective, it still expresses viral genes in the infected cells. Transduction of tissues with the first generation vectors lead to a rapid development of immune response which drastically limits the transduction e fficiency and the duration of transgene expression. The pre-existing immunity agains t adenovirus vectors in majority of human population also has impeded their clinical application. In animal studies using E1-deleted adenovirus vectors, it has been shown th at high systemic dose induced acute inflammatory responses. The cornea is an immune-privileged tissue, but transduction of corneal cells using adenovirus vector ma y not be an ideal approach due to high immunogenicity of the first ge neration Ad vector. Corneal epithelium cells cannot be transduced by adenovirus without physical damage of superficial cell layer, while intrastromal injection of adenovirus vect ors may induce a severe immune response. To test the in vivo effect of UL20 ribozyme, a mouse foot-pad model for HSV-1 infection was adopted for this study. Ad enovirus vector was used to deliver UL20 ribozyme expression in footpad by both subepide rmal injection and topical application. A minimal inflammatory response was expected due to the low density of blood vesicle in mouse foot-pad. Wild-type HSV-1 foot-p ad infection in outbred Swiss ND4 mice leads to the transport of rep licating virus through nerve termin i to dorsal root ganglia and to central nervous system (CNS). When a LD50 dose of wild-type HSV-1 is applied, in 8 to 14 days post-infection indication of HSV1 replication with CNS involvement can be observed. Clinical syndromes including hi nd-limb paralysis, huddled behavior, lethargy

PAGE 128

112 and ruffled fur can also be detected. Mice need to be euthanized when theses symptoms are more pronounced. If HSV-1 viral repli cation can be reduced by ribozyme, mice will show reduced clinical indi cations of CNS involvement. Iontophoresis Delivery of Oligonucleotides Iontophoresis is a non-invasive delivery method in which ionized drug molecules penetrate in tissue enhanced by a small electric current A low voltage (typically 10 V or less) or continuous constant current (typically 0.5mA/cm2 or less) is applied to push a charged drug into tissue. This technique ha s been used clinically to facilitate drug penetration. A very similar technique, cal led electroporation, a pplies a higher voltage pulse (typically higher than 100V) for a very short ( s-ms) period of time to permeate the tissue, very often skin, a nd it is under intense study for clinical applications.18 Iontophoresis in the ocular field was extens ively studied and used during the first 60 years of the twentieth centur y. However, ocular iontophores is was not initially accepted as a standard procedure for drug delivery due to the paucity of toxic ity data and the lack of carefully controlled tria ls. Recently the development and optimization of the technology has led to the safe delivery of high drug concentrations by ocular iontophoresis.262 The transport mechanism of iontophor iesis includes three parts: Nernst-Planck effect , electroosmotic flow , and damage effect . The Nernst-Planck effect represents the central tenet of iontophoresis that charged s ubstances are driven into the tissue by electrorepulsion. At the anode, posit ively charged drug is repelled while at the cathode, negatively charged molecules are pushed into tissue. Electroosmotic flow, first demonstrated by Gangarosa and Burnatte42,111, is the bulk fluid flow which can deliver neutral species when a voltage difference is imposed across a charged membrane.

PAGE 129

113 damage effect , the third mechanism, is the effect caused by electric current to the tissue which increases the permeability, indirectly enhancing drug penetration.287 The iontophoresis device contains a direct current power and tw o electrodes, and there are two approaches for drug retaining. The most common approach is to use an eye cup continuously infused with drug solution, while another component holds the electrode and aspirates air bubbles that disrupt the cu rrent. The ground electrode is attached to patient body, in animal very often to the ear, as close to the former electrode as possible to reduce the resistance. There have b een various devices developed in this matter.23,137,371 The second approach is the use of a drug saturate d gel in direct contact with the cornea; however, this approach wa s abandoned due to side effects caused by agar-gel residue. In the last a few years, the development of drug-loaded hydrogel for ocular iontophoresis leads to applications of novel applicat ors using drug-saturated gel approach, e.g., OcuPhorTM hydrogel (Iomed Inc., Salt Lake City, UT) for transscleral iontophoresis275,372, VisulexTM (Aciont Inc., U.S.A), and a poly acrylic-porous hydrogel designed by Eljarrat-Bin-stock and Frucht-P ery for transcorneal and transscleral iontophoresis.97-99,293 In vivo delivery of oligonucleot ides represents the frontier in drug development with the elevated therapeutic applications using antisense, ribozyme or siRNA. Stability is always the major concern when consideri ng delivery of oligonucleo tides in tissue as a routine treatment. The industrialization of oligonucleotide production allows the generation of synthetic oligonucleotides with chemical modifications which lead to improved stability against cellular degradat ion. In this study, chemical modified ribozyme RNA molecules were applied for the in vivo study.

PAGE 130

114 Hammerhead ribozymes have a catalytic motif containing 15 conserved nucleotides from which three helices with variable length ra diate. Mutations in this motif will impair the catalytic function of the ri bozyme. Certain chemical m odifications have deleterious effect on ribozyme function by disturbing th e structures (noncanonical base pairs, hydrogen bonds, tertiary struct ures, and aromatic stacking interactions) essential for cleavage action.30 A large collection of data has been generated to provide references for modified nucleotide substitutions, which can be categorized in three groups: modifications on base group, on the 2-hydr oxyl, and phosphate oxygen. Although there have been detailed systemic studies defining relation be tween function and modifications30, most of the chemical modifications and positions of the modification in this study came from experiment al experience. According to data of Beigelman et al, 199524, ribose residues essential for ribozyme catal ytic activity are located at the purine sites G5, A6, G8, G12, and A15.1 (as shown in Fig. 5-3). Therefore, no 2-ribose modification was recommended at those sites. It was reported that substitution of U4 and U7 by 2-amino nucleotides can maintain th e wild-type catalytic level while improving the nuclease resistance.139 Finally, the addition of an abas ic nucleoside at the 3-end and phosphorothiaotes in the 5-end in conjunction with 2-sugar modifications served as stabilizing elements without s ubstantial effect on catalysis.139,140 Materials and Methods Establishing a Rabbit Model for HSV Ocular Infection New Zealand white rabbits were used to esta blish HSV-1 acute or latent infections. The animals were anesthetized by isofluoran e inhalation; the corneas were numbed with topical proparacaine drops and were scarified with a needle tip to make breaks in the epithelium. The cornea was then inoculated with 25 L of the 17 Syn + strain of HSV-1.

PAGE 131

115 At various time points during the study, the ra bbits were examined at the slit lamp to detect the infection of the cornea during the primary inf ection or the reactivation. For this purpose, the rabbits were placed in a standard rabbit re straint box. Their eyes were anesthetized with 2 drops of proparacaine (0.5%, Alc on, Ft. Worth, TX) and a lid speculum was used to retract the eyelids. A st andard clinical slit lamp that is used to examine human eyes was used to examine rabbit corneas. Conjunctival cultures were also obtained by swabbing with cotton tippe d applicator to de tect viral shedding. After the acute infection subsided, the ab ility to reactivate th e latent virus was tested by induction of shedding by iontophores is using dilute epinephrine (1:1000). Rabbits were sedated with isofluorane inhala tion. The iontophoresis was done by placing electrodes on the cornea and ear of the rabbi t and passing a low voltage electric current of 0.8mA for 8 to 10 minutes (as shown in Fig. 5-2). Once the iontophoresis procedure was finished, the animals were given oxygen to re cover from sedation and returned to their cages. Two to three days after iontophor esis, recurrent HSV-1 infection could be observed. Study of Corneal Tropism of AAV Vectors Delivery of adeno-associated vi rus vectors to rabbit cornea New Zealand white rabbits were anesthet ized by isofluorane inhalation, and rabbit corneas were treated with topical proparacaine drops followed by an excimer ablation (superficial circular or crossh atched abrasion) of the epit helium (partial thickness to about 25 microns). 2x1011 AAV particles were applied on the surface of cornea through an eye cup (as shown in Fig. 5-2B) for 10 minutes. This preliminary study was conducted on 6 rabbits with one serotype per animal including one untreated control, and the treatments are listed in Table 5-1. Rabbits were returned to their cages after they

PAGE 132

116 woke up. Seven days were allowed for transg ene expression, and rabbi ts were sacrificed to collect corneas. Ra bbit corneas were fixed in 4% paraformaldehyde then embedded in Tissue Tek OCT Compound Embe dding medium (Sakura Finetek, Torrance, CA) and frozen by dipping into isopentane cooled by liquid nitrogen. Tissue sectioning was performed with a Microm H550 cryostat (Microm, Wall dorf, Germany) and 10-12m sections were mounted on Superfrost/Plu s microscope slides (Fisher Scientific, Pittsburgh, PA) for immunohistochemistry in OCT for cryostat (frozen sectioning). Tissue sectioning was conducte d at a thickness of 10-12 m and prepared for immunohistochemistry studies. Immunohistochemistry analys is of adeno-associated vi rus vector tropism in the cornea Frozen sections were dried at the room temperature before fixation for 1 minute in fixative containing a 1:1 ratio of acetone and meth anol (Fisher Scientific, Fair Lawn, NJ). After rinsing 3 times with Phosphate-buffere d Saline (PBS, the recipe see Appendix C), slides were pretreated with 0.3% hydrogen peroxide (dilute d from 3% hydrogen peroxide in methanol) for 30 minutes followed by PBS ri nse for 4 times. Sections were treated using R.T.U. Vectastan Universal Elite ABC Kit (Vector Laboratories, Burlingame, CA) following manufacturers protocol Sections were circled us ing a Liquid-repellent Slide Marker Pen to reduce the area exposed to antibodies. Afte r treated with serum for 20 minutes at room temperature, sections were rinsed with PBS for one time meanwhile the primary antibody was prepared. The primary antibody, Chk X GFP (Chemicon International, Inc., Temecula, CA), was dilute d to 2000 fold using PBS in the presence of 0.1% BSA (LabScientific, Inc., Livingston, NJ), 0.05% Triton. A control solution without first antibody was prepared as well. S lides were placed in slide mount and with

PAGE 133

117 extra water in the chamber to keep them moist; the primary antibody dilution was added to cover each section as well as contro l treatment groups (no AAV and no primary antibody groups), and 30 minutes to 2 hour s were allowed for the primary antibody binding. Slides were washed with PBS th ree times, while the secondary antibody was diluted. Anti-chicken IgY (Promega, Madison, WI) was diluted 1000 fold in PBS. Secondary antibody was added to cover each s ection and incubated for 2 hours at room temperature before rinsing three times with PB S. Sections were treated with stabilized Elite ABC reagent (Vector Laboratories, Burlingame, CA) for 30 minutes at room temperature before another PBS rinse. Nova Red staining (Vector NovaRed SUBSTRATE Kit for Peroxidase, Vector La boratories, Burlingame, CA) was conducted following product instructions, and sections were dehydrated in an ethanol series of 75%, 80%, 90% and absolute ethanol then air dried. At the end, sections were mounted using mounting medium (Vectashield Hard+setTM Mounting Medium with DAPI, Vector Laboratories, Burlingame, CA). Sections were observed under Zeiss Axioplan2 Fluorescence microscope or Morphometric microscope (MCID). Because endogenous hydrogen peroxidase was detected even after the treatment of 0.3% hydrogen, an alternative immunostaining protocol, which uses alkaline phosphatase system, was also conducted. Vectastain ABCAP Kit, Alkaline Phosphatase Substrate Kit, Vector RED, and Levamisole solution (Vector Laboratories, Burlingame, CA) were used for immunostaining. A confocal mi croscope (Leica TCS SP2 AOBS Spectral Confocal Microscope, Leica Microsystems, Inc., Bannockburn, IL) was used to observe the fluorescence, and images were proce ssed using software LCS Version 2.61 Build 1537.

PAGE 134

118 Progress in Testing HSV Vector for Deliv ery in Cornea and Trigeminal Ganglion Delivery of non-replicating herpes simplex virus type 1 vector in rabbit cornea New Zealand white rabbits were anesthet ized by isofluorane inhalation, and rabbit corneas were treated with topical 1% propara caine drops. Scarification was done with a sterile needle, and a doublehatch on the epithelium was made with care to avoid wounding the stroma. 2x105 pfu of wild-type HSV-1 (17 syn +) was applied directly on the corneal surfaces of both eyes while the rabbit eyes were held open by pulling on the eyelids. Then the eye were closed and gently rubbed. Corneal infection could be observed by slit lamp biomicroscopic exam ination on the second day and ocular inflammation was observed on third day post-in fection. Establishment of latency was confirmed by epinephrine iont ophoresis as described above. At 4-month post-infection, a second HSV-1 infection was conducted usi ng a non-replicating HSV-1 vector and intrastromal injection in the right eye. This HSV-1 vector, called 8117/4392, was constructed by removing ICP4 genes and inse rting a LAT/LTR promoter driven LacZ gene fragment into the original ICP4 regi on. Four days post-infection, rabbits were euthanized and corneas were harvested and fixed in 4% paraformaldehyde for galactosidase staining. In this experiment, the left eye of each animal was the negative control for -galactosidase staining. Blue color formation following incubation with XGal (5-bromo-4-chloro-3-indolyl-b-D-galacto side) indicated a successful delivery of transgene expression by HS V-1 vector (8117/43). Protection from previous ocular infectio n against subsequent herpes simplex virus type 1 super-infection To study the effect of previous HSV-1 ocular infection on following herpes simplex virus type 1 (HSV-1) superinfecti on, another set of assays were conducted.

PAGE 135

119 Instead of infecting the animal with wild -type HSV-1, a replication-defective HSV-1 vector, KD692,314, constructed by ICP4 deletion, was us ed for the first infection. A group of four rabbits were included in this experiment. KD6 was delivered to the left eye by intrastromal injection into the rabbit cornea. The existence of KD6 in trigeminal ganglia can be proved by PCR using primers compleme ntary to ICP4 deletion junction. After 2.5 months of inoculation of KD6, the s econd infection of replicating HSV-1, dUTPase/LAT164, was applied to both eyes by simp ly applying virus solution to the scarified rabbit cornea. The dUTP ase/LAT was constructed based on 17 syn + parental strain by substitutional insertion of the dUTPase promoter and LacZ reporter construct into the region of LAT promoter and 5 regi on of LAT. Rabbits were terminated on the fourth day of post-infection a nd corneas were harvested for -galactosidase staining. The purpose of this assay was to study the effect of HSV-1 vector on s ubsequent infections. Antibody neutralization assay This assay was developed to detect anti bodies directed against HSV-1 in serum samples. One day before the assay, Rabbit Skin Cells (RSC) were plated in 24-wellplates to reach ~90% confluency on the day of usage. Blood samples were drawn from nave (negative control) and HSV-1 infected rabbits, and blood samples were clotted followed by serum removal and complement i nactivation by hea ting at 56C for 30 minutes in a water bath. These serum samples can be stored indefini tely at -80C. A HSV-1 virus stock was diluted to a concentration of 1x106pfu/mL, and 0.1mL of the dilution was used in the neut ralization mixture. Neutrali zation dilutions were set up according to the anticipated range of HSV-1 ne utralizing titers. There were three groups of rabbits: nave (negative c ontrol), rabbit ocularly inf ected with wild-type HSV-1 (17 syn +) as a positive control, and rabbits ocul arly infected with KD6 (non-replicating

PAGE 136

120 HSV-1 vector). Serum samples were d iluted as 1:5, 1:10, 1:100, and 1:1000 in MEM supplemented with 5% Calf Serum and antibio tics, and the final volume of all dilutions of serum was 0.9mL. 0.1mL of the HSV-1 stoc k dilution was added to each of the serum dilutions, which were incubated at 37C for 1 hour after mixing well. At the same time a 4.95mL of cold regular medium (5% Calf Serum containing MEM) was prepared for each sample and placed on ice. At the end of the incubation, 50 L of each reaction was diluted in corresponding 4.95mL of cold medium and mixed thoroughly to end the neutralizing reaction. Th e rest of reactions were stored at -80C. After removing the culture media from the RSC in the 24-wellplates, 0.2mL of each diluted neutralizing reaction was plated in each well and for all the samples this was done in triplicate for each of the samples. One hour at 37C wa s allowed for absorption as in a standard plaque reduction assay, and plates were ge ntly rocked at ever y 30 minutes. After discarding the infection solution, RSCs were overlaid with 2mL of warm media (5% Calf Serum MEM with antibiotic and 0.3% Huma n Gamma Globulin). Two to three days were allowed for plaque development and cells were stained w ith crystal violet. Proof of Principal Experiment: Testing Adenoviral Vector Pa ckaged Ribozyme in an HSV-1 Acute Infection Model in Mice Ribozyme inoculation and HSV-1 infect ions in HSV-1 mouse footpad model Four to six-week-old female Swiss mice (ND4) were used for footpad experiments. Three groups of 10 mice each were treated w ith either PBS (mock), Adenovirus-control (an adenovirus packaged GFP control treatment), or adenovirus packagedUL20 ribozyme. Mice were first anesthetized w ith Halothane or is ofluorane by inhalation and Flunixin meglumine (1.1 mg/kg IM) was administered to alleviate any pain associated with the procedure. To mini mize the amount of abrasion and facilitate

PAGE 137

121 efficient uptake of HSV-1 infection, both footpads of each mouse were injected subepidermally with 25-50L of 10% saline 4 hours prior to HSV-1 infection. For adenoviral vector-treated groups (Ad-GFP or Ad-ribozyme), each saline injection contained 1.4x1010viral particles. The saline pre-trea tment was necessary to establish an efficient and uniform infection of the sensor y ganglia. In addition, it reduced the amount of abrasion that was needed to be performed on the foot prior to infection. It is also believed that saline pre-treatment reduces di scomfort. At the time of HSV-1 infection, the mice were anesthetized by intramuscu lar (IM) injection of 0.010 0.020 mL of a cocktail of acepromazine (2.5 3.75 mg/kg), xylazine (7.5 11.5 mg/kg), and ketamine (30 45 mg/kg). The ketamine/xylazine/acep romazine cocktail treatment was important for the success of HSV-1 infection, as it pr ovided enough time for virus to absorb (30 minutes for 80 90% efficiency) before mi ce recovered and moved around. Both rear footpads of the anesthetized mice were lightly abraded with an emery board to scratch the keratinized layer of the skin to allow the vi rus to adsorb efficiently while a same volume of each treatment was applied to the dorsal surface of the footpad (10L of PBS, AdGFP, or Ad-ribozyme solution respectively were used, if adenoviral vector was applied, 1.4x1010viral particles were include d). Then the anesthetized mice were rested on their backs, and 50L of the virus dilution containing 104pfu of HSV-1 strain 17 syn + was placed on the footpad using a pipette. Af ter 4560 minutes mice recovered from anesthesia and were returned to cage for observations. For a survival study, mice were checked for illness and death everyday up to 12 days. Quantitative real-time polymerase chain rea ction to estimate viral replication level To evaluate the protection effect of th e ribozyme, a time-course study was set up. By sacrificing 4 mice per treatment (ribozyme or GFP treatment) per time point (2, 4, and

PAGE 138

122 6 days postHSV infection), tissues were co llected from spinal cord (SC), dorsal root ganglia (DRG) and feet. Tissues were ground for homogenization usi ng different tools. For large tissue (e.g., both feet, average weight is 0.7mg), a mortar was used, while different sizes of glass homogenizers were used for neuron or brain tissues, e.g., 1mL glass homogenizer was used for DRG, and SC. Total RNA was extracted using Trizol Reagent (InvitrogenTM, Carlsbad, CA) and was prepared for reverse-transcription (see Material and Method in Chapter 4) followed by real-time PCR to compare viral gene expres sion as well as viral DNA level. Real-time PCR primers were designed by ABI system (Applied Biosystems, Foster City, CA). HSV-1 UL20 expression, UL30 (viral polymerase) DNA levels, and UL54 DNA levels were compared between the ribozyme treatm ent group and the controls at each time point. Taqman primers and probe were desi gned by ABI system for mouse GAPDH gene expression which can also be used for quantification of genomic DNA. The DNA was also isolated from the same samples from Trizol extraction after taking away the aqueous layer which contained total RNA. 150L of solution containing 0.1M Tris-Cl (pH7.5) and 0.1% of sodium Nlauroyl sarcosine (Sigma, St. Louis, MO) was added to the tube which contained th e interphase and organic layer of Trizol reagent. The tube was vortexed for 30 second followed by centrifugation at 9000xg for 1 minute. The supernatant was collected in a fr esh tube, and this step was repeated for two more time. The supernatant from these st eps was combined and treated with 5L of proteinase K (20mg/mL) at 37C overni ght. The next day, 3 times of PCI (Phenol/Chloroform/iso-amyl alcohol at a ra tio of 25:24:1) extract ions were conducted

PAGE 139

123 followed by ethanol extraction to pellet DNA. The DNA pellet was rinsed using 70% ethanol and air-dried before resuspending in de-ionized wa ter. A conventional PCR was conducted for these DNA sample using a set of PCR primers designed for mouse -actin (Primer sequences are: Sense prim er: 5-TGAGACCTTCAACACCCCAGCC-3; antisense primer: 5-TGGCCATCTCCTGCTCGAAG TC-3.). The PCR was conducted as following condition: 94C for 5 minutes; 25 cycles of 30 seconds of 94C, 30 seconds of 55C, and 30 seconds of 72C; 72C for 10 minut es; finally 25C infinitely. This step was to confirm the quality of DNA sample. The DNA samples were used for real-time PCR to detect viral DNA level (using Taqman primers and probe designed for HSV-1 polymerase) and the DNA level of Xist gene (X inactive specific transcript) or GAPDH was also detected as internal control (all the mice in this study were female). Standard curves for each set of primers a nd probe were plotted by using a series of dilutions (10ng, 1ng, 10-1ng, and 10-2ng, etc) of the reference DNA sample. The reference DNA was extracted from the spinal cords of 6 Swiss ND4 mice which had been infected with wild-type HSV-1 strain 17 syn +. Mouse spinal cords were dissected and each was ground in 0.2mL of ice cold TES (10mM Tris, pH 7.4; 0.1M NaCl; and 1mM EDTA). Homogenized tissue then was trea ted at 50C overnight with sodium dodecyl sulfate (SDS) to a final concentration of 1% and Proteinase K to 1 mg/ml. The next day, samples were extracted using PCI for thr ee times followed by ethanol extraction to precipitate the DNA from the aqueous fracti on. DNAs were resuspended and combined in de-ionized water, DNA concentration was es timated by spectrometry of the absorbance at 260nm wavelength. Serial dilutions of the reference DNA were stored in -80C in aliquots.

PAGE 140

124 Iontophoresis of Chemical Protected Synt hetic RNA Molecules in an Acute Ocular HSV-1 Infection Model in Rabbits Design of chemical modifications in hammerhead ribozyme RNA molecule Natural ribozyme RNA molecules are not stable in vivo. In order to achieve a successful delivery of ribozyme molecule inde pendent of delivery vehicles, chemical modifications can be applied to synthetic ribozyme to increase the stability while retaining its catalytic activ ity. The design of chemical modifications in hammerhead ribozyme needs to maintain the integrity of th e catalytic core. Not only mutations in this motif will impair the catalytic function of the ribozyme, but certain chemical modifications have deleterious effect on ribozyme function.30 According to references from a large collection of data generated for modified nucleotide substitutions, the chemical modifications and positions of the modification in this study were determined. As shown in Fig. 5-4, most of nucleotides ha ve 2-O-methyl modifi cations except for G5, A6, G8, G12, and A15.1, while U4 and U7 have 2-amino residues. An abasic nucleoside was added to the 3-end and the 5 -end contained series of phosphorothiaotes. By replacing G5 to C5, an inactive hammerh ead ribozyme was generated as a control for catalytic activity. Iontophoresis of synthetic chemical prot ected ribozyme for treatment of herpes simplex virus type 1 infection in rabbit Chemically modified active and in active hammerhead ribozymes for UL20 were synthesized by Dharmacon RNA Technologies (Lafayette, CO) at a scale of 0.2 mol. Sequences of ribozymes and the design of modifications are shown in Fig. 5-4. A superficial crosshatched abrasion of the epithelium (partial thickness was about 25 microns with a pattern of three lines vert ically and three lines horizontally) was conducted followed by iontophoresis of the riboz ymes into the cornea. Each rabbit was

PAGE 141

125 treated with active ribozyme in right eye a nd inactive control in the left with a total amount of 100 g of oligonucleotides in 1mL of solu tion per eye. Oligonucleotides were de-protected according to the manufacturers protocol and were resuspended in deionized water (DI water). A small current of 0.8 mA was applied for 8 minutes to deliver chemical modified RNA into corneal tissue, and the set up of iont ophoresis apparatus is shown as in Fig 5-2-A and B. Since the oligonucleotide used in this study was negatively charged, the cathode was placed in the eye cup. 105pfu of HSV-1 replicating virus containing the LacZ gene (dUTPase/LAT164) was applied on rabbit eyes half an hour later. 4 days were allowed for HSV-1 in fection to develop be fore harvesting rabbit corneas for X-gal staining. Images were analyzed using SigmaScan Pro (Systat Software, Inc., Point Richmond, CA) to quantify the areas of blue staining. Results Adeno-associated Virus Vector Tropism in Cornea All serotypes (type 1,2,5,7, and 8) of adenoassociated virus led to GFP expressions in the rabbit cornea at 7 days post-inoculation as indicate d by the immunostaining using GFP antibody. Images were taken from each section using morphometric microscope. The intensity of GFP staini ng in each section was compared using MCID program. Representative images of GFP staining fr om rabbits eyes treated with different AAV serotypes as well as control eyes are shown in Fig. 5-4 A to F. Fig.5-4-G shows the intensity comparison of GFP staining on corneal epithelium from different AAV serotypes treated rabbits. In this assay, no GFP expression could be visualized directly under a fluorescent microscope from any AAV treated eyes, indicating a low level of transgene expression at day 7. AAV1, followed by AAV8, had a slightly higher transduction level on corneal epithelium comp ared with the others. Although AAV5 did

PAGE 142

126 not show strong staining of the epitheliu m, when observed for GFP staining across a corneal section, it showed strong penetration of GFP expression even in the monolayer of endothelial cells (as shown in Fig. 5-5-D). However, the small sample number (one rabbit two eyes) in each trea tment may limit the representati on of the observation. Future experiments to observe AAV transgene expressi on at a longer period will provide more information. A time course study will be recommended to follow the transgene expression. In addition, since self-complemen tary AAV has been show to lead to earlier expression of passenger genes; it might be useful to test these vectors in the cornea. Herpes Simplex Virus Vector Delivery to Cornea and Trigeminal Ganglion Four months following bilateral infection of rabbit corneas using wild-type HSV-1 (17 syn +), re-infection of the right eye using a non-replicating HSV-1 expressing LacZ (strain 8117/4392) did not lead to formation of dendr ites when they were stained for galactosidase activity, as shown in Fig. 5-6-A (negative control) and B. Although one or two dots of blue staining were observed in s uper-infected (the righ t) cornea (Fig. 5-6-B ) at the infection dose of 2x105pfu per eye, it was obvious that the second infection did not lead to efficient transduction, compared to th e positive control of a nave rabbit using the same virus (shown in Fig. 5-1-B ) The second experiment was set up using an opposite sequence of infection: Primary infection was conducted in the left eyes by intrastromal infection using a non-re plicating HSV-1 strain KD6, and tw o and half months later, the second infection of replicating HSV-1 cont aining LacZ (dUTPase/LAT) was performed bilaterally. Four days were allowed for viral replication be fore corneas were processed. X-gal staining results for detection of -galactosidase activity in this experiment are shown in Fig. 5-6-C and D. The left ey e which was treated previously with KD6 followed by dUTPase/LAT had dramatically re duced blue staining compared with the

PAGE 143

127 right eye which was infected only with dUTPas e/LAT. This indicated a protection effect against the later infection of a different viral strain rendere d by the previous infection of HSV-1 vector. However, this protection was not systemic: First, as shown in Fig. 5-6-C and D, previous infection in the left ey e only protected the same eye from second infection, while the right eye had massive de ndrite forming caused by second infection. Second, an antibody neutralization assay was con ducted to detect the level of systemic antibody against HSV-1 after the first infecti on of KD6. This was to confirm whether this ocular protection was related to ci rculating antibody. The antibody neutralization assay showed (Table 5-2) that the ocular inoculation of non-re plicating HSV-1 (KD6) only led to mild production of antibody less than 10 fold higher than a nave rabbit, while a wild-type HSV-1 (17 syn +) ocular-infected rabbit had 100 fold higher level of antibodies to HSV than that of the nave one. Adenovirus Vector Delivery of a Ribozyme targeting HSV-1 UL20 mRNA in a Mouse Footpad HSV-1 Infection Model A survival assay was conducted to ev aluate the ribozyme effect on HSV-1 replications in the mouse footpad model. Three treatments with 10 mice per group were set up for footpad infection of wild-type HSV-1 (17 syn +). Mice received treatments (PBS, or adenovirus packaged GFP, or adenovirus packaged UL20 ribozyme) followed by wild-type HSV-1 (17 syn +) infection. The HSV-1 infection dose was 104pfu per footpad, and it should be addressed that a LD50 dose of 500pfu had been previously determined in this mouse strain using HSV-1 17 syn + (data not shown). The infections and treatments were performed in a blinded manner so that investigators had no knowledge of the type of injection (Ad-ribozyme, Ad -GFP or PBS), and two independent studies were performed. Videos were taken to analyze beha vior indications of encephalitis. In Fig. 5-

PAGE 144

128 7A where a combined survival rate from two experiments is shown, UL20 ribozyme delivered by adenovirus vector in mouse footpad protected mice from lethal HSV-1 infection by 90%. Mice in Ad-GFP treatment group had a 40% survival rate, and compared with ribozyme treatment group, a chisquare statistic was 8.25 with associated P-value of 0.0041 using Kaplan-Meier survival analysis; PBS control groups had 45% survival rate with a chi-square statistic of 10.11 which associated with P-value of 0.0015, when it was compared with the ribozyme treated animal group. These indicated a significant protection eff ect provided by the UL20 ribozyme treatment in mice against the lethal dose of HSV-1 infection. On the 6th day after HSV-1 infection, mice from control groups (GFP and PBS treatments) showed si gns of encephalitis, including hind-limb paralysis, hunched posture, ruffled fur, at axia, and weakness. Mice were euthanized when severe CNS involvement of infecti on was observed. At this stage pronounced anorexia, lethargy, and ruffled fur were detected. However, mice from ribozyme treatment group maintained h ealthy and active at the 6th day post-infection of HSV-1, although two deaths were observed and one m ouse showed mild paralysis in one hind limb in a much later time-point. Mouse deat h at each day was r ecorded to plot the survival curve. Interestingly, in the riboz yme treatment group the first death was delayed by one day compared with Ad-GFP treated gr oup, and by two days delay compared with PBS treatment. Mice in the ribozyme trea tment group showed a phenotype of milder HSV-1 infection than those from control groups, although a HSV-1 infection dose of 20 times higher than the LD50 dose was used in this study, in dicating a protective effect by UL20 ribozyme.

PAGE 145

129 To evaluate the ribozyme effect in reduc ing viral replication, a time-course study was conducted. At day 2, 4, and 6 post-infe ction of HSV-1, four mice per group (AdGFP or Ad-Rz) were sacrificed to collect ti ssues (footpads, dorsal r oot ganglia, and spinal cord). Viral DNA level was estimated by normalizing against the DNA of endogenous glyceraldehyde-3-phosphate dehydrogenase (G APDH). At day 4 post-infection of HSV1, in ribozyme treated animals a 44% reducti on in viral DNA levels in the mouse footpad (data not shown), a 78% reducti on of viral DNA levels in th e DRG (shown in Fig 5-7B), and a 44% reduction of viral DNA levels in the spinal cord (data not shown) were observed. At day 6 post-infection, viral DNA level in the ribozyme treatment group was reduced by 86% in the spinal cord. However, the differences in viral DNA levels of treatments from footpad, DRG or spinal cord did not reach statistical significance using a nonparametric test for independent samples. Analysis of the Effect of Iontophore sis of Chemically Protected Hammerhead Ribozymes in Rabbit Corneas in Limiting HSV-1 Infections An in vitro kinetic analysis of riboz ymes, including unmodified UL20 ribozyme, modified active and inactive ribozymes, was conduc ted to evaluate their catalytic abilities. There was no detectable activity observed for modified inactive ribozyme even in high magnesium concentration (20mM Mg2+). At 5mMMg2+the modified active UL20 ribozyme exhibited a kcat of 2.2min-1, a KM of 6.0 M, and kcat/KM of 0.37min-1 M-1. As shown before, when the unmodified UL20 ribozyme 154 was tested at 5mMMg2+ it had a kcat of 27.8 min-1, a KM of 1.8 M, and kcat/KM of 15.9 min-1 M-1. Therefore, a 40 fold reduction in kcat/KM was observed in modified ribozyme compared with that of its unmodified counterpart, indicati ng a reduction in the catalytic efficiency. However, this modified ribozyme targeting UL20 mRNA provided significant protection against HSV-1

PAGE 146

130 replication resulting in fewer dendritic lesions forming (as shown in Fig. 5-8-A), particularly in the central cornea than those treated with the control (inactive) ribozyme (shown in Fig. 5-8-B). Fewer lesions were observed around the scarified area in the active ribozyme treated eyes compared with control ribozyme treated eyes. The blue staining on each eye, indicating the active viral expression of -galactosidase, was quantified using software (SigmaScan Pro) and a significant reducti on of 57% (p<0.02) in dendrite forming was detected (as shown in Fig. 5-8-C). Discussion Adeno-associated Virus Vector Tropism in the Cornea This preliminary study was done in a small set-up with one rabbit (two eyes) per serotype treatment. The purpose was to sel ect one or several candidates to test the corneal tropism of AAV in a large scale. Because the ra bbit corneal epithelium has a turnover half-life very similar to that of th e human cornea, probably 7 to 14 days, 7 days were allowed for transgene expression. This was a very challenging task, since AAV delivered transgene expression often takes a long time. AAV is a single stranded DNA virus, and transcription of th e transgene requires the synt hesis of the second DNA strand. As expected, GFP expression was not detect able directly under the fluorescence microscope. Because the original AAV trans duction in the corneal epithelium is diluted while time passes, a more sensitive assay is required for transgene detection. Although immunostaining using the biotin-avidin de tection system (Vect or Laboratories, Burlingame, CA) can amplify the signal exte nsively, it very often has background that interferes the result from histochemistry staining depending on the enzymatic detection system used, e.g., peroxidase system. As shown in Fig. 5-4-G, even in the presence of pretreatment to inactivate the endogenous peroxidase, a significant background was

PAGE 147

131 detected using microscope. The alkaline phosphatase system (Vector Laboratories, Burlingame, CA) was proved to have a lowe r background level than using peroxidase system. Therefore, in the future it is reco mmended for this purpose. A larger sample number is also important. Considering the experimental error, a group of 3 or more rabbits per treatment per time point is recommended. The other issue raised by this study is whet her AAV is able to exist in the corneal epithelium for extensive period of time. To persist, AAV mu st transduce corneal stem cells predicted to be resident in corneal limb al area. This can be tested by delivery of AAV1 or AAV8 to rabbit cornea for a time-c ourse study. If GFP expression can persist for months in the cornea, AAV would have to have transduced corneal stem cells. This will lead to a future application using AAV vector in the cornea, particularly in ex vivo culture of corneal allograft before corneal tr ansplantation. If AAV ca n be used to deliver therapeutic genes in donor corneas, it w ill provide a broader application for disease prevention in transplantation recipients. Herpes Simplex Virus Vector for Ribo zyme Delivery into the Cornea and Trigeminal Ganglion The original purpose of this study was to establish a delivery m odel for therapeutic ribozyme in a recurrent HSV-1 ocular m odel. A well-documented HSV-1 ocular infection model in rabbit146 was employed. A HSV-1 strain 17 syn +, which is a neuroinvasive and neurovirulent strain, was used for primar y infection. The reactivation of HSV-1 infection can be induced by ep inephrine iontophoresis and can reach >90% success among experiment animals. However, when a non-replicating HSV-1 vector containing LacZ gene (strain 8117/4392) was delivered, no tran sgene expression was observed, which led to a failure in our attemp t to use HSV-1 vector for therapy against

PAGE 148

132 recurrent HSV-1 infection. The second e xperiment was set up to confirm this phenomenon. A non-replicating HSV-1 vector (KD6) was inoculated in left eyes 2.5 months before the second infection. The second infection was conducted by infecting rabbits bilaterally with a replicating HS V-1 containing LacZ (a recombinant HSV-1 called dUTPase/LAT. Interestingly, ther e was unilateral protection rendered by the previous single-eye infection of KD6. This result confirmed observation that previous HSV-1 infection can inhibit later infection ca used by the same virus but not necessary the same strain. However, this local (ocular) immune protection agai nst super-infection of HSV is very intriguing. First of all, it has been known that vaccination is not beneficial in preventing HSV infection. A systemic immunization cannot provide full protection against future HSV-1 infection. The anti body neutralization assa y (Table 5-2) to compare KD6 infected rabbits with wild-type HSV-1 infected showed that an ocular inoculation with either replication-defective or wild-type virus did not induce significant level of antibody production. Therefore, a non-systemic mechanism was driving this protective effect in cornea, which is an imm une privileged tissue. Second, in both assays the primary HSV-1 infection (either with wild-type HSV-1 or with KD6) was conducted a long period of time before the second infec tion, 4 months and 2.5 months, respectively. One can speculate that without a boost of immunization, cellular immune response could not standby for such long times if a T cell resp onse would be the explanation for the viral resistance in the cornea. There may be other immune mechanisms leading to this phenomenon. However, to test the importa nce of cytokines, chemokines and other cellular immune response involvements, a diffe rent animal model needs to be adopted due to the short supply for antibodies agai nst cellular factors in the rabbit and the

PAGE 149

133 diversity of the rabbit gene tic background. Another expl anation for resistance to replication by the second virus is the existe nce of corneal latency that might modulate the cellular environment leading to non-permissive ness for later HSV-1 super-infection in the cornea. However, this hypothesis remains to be tested. Adenovirus Vector Study Adenoviral vectors have been shown to possess significant advantages for gene delivery, and in this study a first generation adenoviral vector was used. A high vector production could be achieved, as in this study the Adenovirus vector was generated using a Cre-lox recombination system.134 Adenoviral vectors can provide high transduction efficiency in quiescent and divi ding cells, which leads to significant therapeutic benefits. However, first-generation adenoviral vector is highly immunogenic due to the expression of massive viral proteins, which causes the shor t-term transgene expression. It has been shown that the transgene expression delivered by an adenoviral vector was not detectable after 2 weeks.159 Furthermore, it has been shown that adenoviral vector has a cellspecific transduction pattern in cornea according to a series of studies ex vivo and in vivo49,183,208,362 related to corneal tropism: Adenoviral vector transduced corneal endothelium, conjunctival epit helium and keratocytes, but it was not efficient in transducing corneal epithelium. A prelim inary study in rabbit cornea was conducted during the time of this dissert ation research to study the efficacy of epithelial gene transfer. The result suggested that after topical application of an adenoviral vector on the cornea, transgene expression was only limite d within areas containing the physical damage in corneal epithelium, e.g., needle scarification or cro sshatched abrasion of 25micron of the thickness (data not shown). Therefore, for the purpose of long-term gene transfer in corneal epithelium, ade noviral vector is not an ideal option.

PAGE 150

134 An in vivo study was designed to test the UL20 ribozyme delivered by the adenovirus vector, and a mouse footpad mode l of HSV-1 acute infection was used to evaluate the efficacy of this ribozyme. Mous e footpad model offers an efficient approach to study HSV-1 viral neuroinvasion, neurovirule nce and latency. In this study, ribozyme effect to the initial replica tion in the footpad epithelium was monitored. HSV-1 viruses applied on the abraded keratinized epitheliu m initiated viral re plication, meanwhile, viruses undergo retrograde transport to the DRG.334 At an inoculum dose of 104pfu of wild-type HSV-1 (20 fold of a LD50 dose), without ribozyme treatment, the viral replication in the footpad epith elium leads to severe damage in CNS which causes death. In this study, pre-treating th e mouse footpad with adenoviru s packaged ribozyme led to a significant protection (90% surv ival rate) against the lethal dose of HSV-1 infection. Eighty percent of animals in this group remained healthy throughout the study; one mouse showed mild paralysis in the rear lim b, but remained active after the ending point. In contrast, in both of the control groups, d eath and indications of severe damage in CNS were observed. An independent repeat of the survival assay was conducted, and showed similar result in the ribozyme treatment gr oup (90% survival rate); however, a higher survival rate was observed in GFP treatment group than that of PBS group, which was different from the observation in the first test. It is specula ted that GFP and PBS treatment will give similar response when a larger amount of repeats are conducted, assuming that the sample number (N=10) in each group is representative. To answer the question whether this pr otection effect of ribozyme was from inhibiting viral replication, viral DNA level wa s quantitated using re al-time PCR. Four animals per group at each time point were sacr ificed to collect tis sues, and quantitative

PAGE 151

135 real-time PCR was conducted using DNA samp les from each individual animal. Although there was a 78% reducti on of mean level of viral DNA in the DRG since day 4 post-infection of HSV-1, the va riation within each group did not lead to a statistically significant difference between the ribozyme and GFP control treatment. The same result was observed in the viral DNA level from the spinal cord: An 87% reduction in viral DNA level from the ribozyme treatment was dete cted without statistical significance. Notice that the viral DNA detected among anim als in one group the same time point fell in a very wide range (as much as 2000 fold di fference), a sample size of 4 might not be sufficient to demonstrate a normal distri bution of the data. The viral DNA amount present in the tissue might ha ve been below the limits of detection threshold of this method, thus optimizing the procedure to in crease the DNA recovery from the sample may lead to a better result. Finally the viral DNA and mRNA levels in the footpad may give a clearer answer since the footpad harbored the initial viral replication. Effect of Iontophoresis of Chemically Protected Hammerhead Ribozymes in Rabbit Cornea in Limiting Herpes Simplex Virus Type I Infection Iontophoresis has been broadly applied in cl inical applications for transdermal drug delivery. However, it has not been devel oped as a standard procedure for ocular applications due to toxicity and the lack of car efully controlled trials The efficient drug penetration provided by this technology has enc ouraged numerous studies to exploit and optimize this application in the last several years. In this study, the ability of chemically modified ribozymes to degrade mRNA of an essential gene (UL20) of herpes simplex virus type 1 (HSV-1) was tested for its therapeutic effect by i ontophoretic treatment. The advantage of this approach is to avoid the usage of topical antiviral drugs, since th e toxicity of current drugs often leads to

PAGE 152

136 allergy effect which is detrimental for patients. At the same time, switching to other antiviral drugs may resolve the problem tempor arily, but patients develop allergy to other drugs eventually. On the other hand, it has been suggested that transcorneal iontophoresis has very few complications ev en when frequent treatment is required.25 The corneal epithelium is the target lo cation for ribozyme delivery in this study, since HSV-1 viral replication in epithelium is an early event that leads to clinical indications of severe HSV-1 infection. By ribozyme delivery to anterior cornea which prevents the active viral amp lification and spreading, furthe r damage in stroma can be avoided. From previous in vivo studies using adenovirus packaged UL20 ribozyme a significant anti-HSV-1 effect was confirmed. To take advantage of this therapeutic ribozyme for future application, this study was designed to evaluate the iontophoretic approach in delivering this ribozyme as a potential treatment to prevent HSV-1 ocular infection. It is very promising that a single dose of riboz yme delivery rendered significant reduction in HSV-1 vira l replication (shown in Fig. 58). It is noticeable that an HSV-1 infection of 105pfu was employed on the rabbit cornea in this study. The inhibitory effect from the chemically m odified ribozyme seemed very impressive considering that HSV-1 ocular infection in human begins with very low dose of virus load. Although the exact amount of HSV-1 has not been revealed to be efficient to initiate ocular damage, it is known that at the peak of HSV-1 ocular infection 105pfu can be detected. However, chemical modifications in the ribozyme significantly reduced the catalytic efficiency as indicated from in vitro kinetic comparison of modified and unmodified ribozyme. A nearly 40 fold reduc tion in catalytic activity was observed. It

PAGE 153

137 could be expected that a highe r level of inhibition can be achieved by vector delivery of ribozyme through exogenous expression. In this study the iontophor esis was conducted by applyi ng a current of 0.8mA for 8 minutes. Another experiment was conducted us ing the same condition but led to damage in rabbit eyes. Therefore, further optimizati on of the protocol is necessary for future application to provide consis tent delivery. A better ev aluation of the iontophoretic approach is to induce reactivation in latently infected rabbits followed by UL20 ribozyme delivery, since recurrent infecti on from latent virus is more relevant to human clinical onset of the disease th an the model tested in this study.

PAGE 154

138 Table 5-1. Treatment code for the tropism study of adeno-associated virus vector. Rabbit Tattoo# Treatment FL32 Iontophoresis with UF11 plasmid (35ug/ml in a total of 2ml dH2O, 8min at 8mA); both eyes; no abrasionintact corneal epithelium. FL33 Untreated rabbit FL28 Partially abraded the corneal epithelium; AAV UF11 (Type 1); stock ref: C458; 2.0x1011 p per eye. FL27 Partially abraded the corneal epithelium; AAV UF11 (Type 2); stock ref: 448; 2.0x1011 particle per eye. FL23 Partially abraded the corneal epithelium; AAV UF11 (Type 5); stock ref: C339; 2.0x1011 particle per eye. FL29 Partially abraded the corneal epithelium; AAV UF11 (Type 7); stock ref: C414; 2.0x1011 particle per eye. FL30 Partially abraded the corneal epithelium; AAV UF11 (Type 8); stock ref: C512; 2.2x1011 particle per eye. Note: FL32 was harvested approximately 36hrs post-iotophoresis. Table 5-2. Antibody neutralization assay to detect systemic antibody against herpes simplex virus type 1 (HSV-1) following non-replicating HSV-1 (KD6) infection. Each rabbit serum dilution was incubated with 105pfu of 17 syn + ( wt HSV-1) Rabbit label Treatment Serum dilution VTS Nave <1/5 J69 17 syn + inoculated 1/100 J89 KD6 ( ICP4 defective virus) injected 1/10 J90 KD6 ( ICP4 defective virus) injected 1/10 J91 KD6 ( ICP4 defective virus) injected 1/10 J92 KD6 ( ICP4 defective virus) injected 1/5

PAGE 155

139 Figure 5-1. Trigeminal ganglia transduced by LacZ packaged herpes simplex virus vector. -Galactosidase staining of trigemin al neurons (panels A and C) and corneas (panels B and D) in rabbits following HSV-LacZ Infection. Low power photographs (panels A and B) show extensive labeling of ganglia in trigeminal nerve track (blue arrows) a nd in the limbal region of the cornea (black arrows). Nomarski contrast in terference micrographs (panels C and D) show labeled axons (red arrows) and nerve bodies in trigeminal neurons (yellow arrows) and corneal fibroblasts (green arrows). A B D C

PAGE 156

140 Figure 5-2. Iontophoresis treatm ent in rabbits. A and B show the apparatus set-up for iontophoresis in this study, the anode was connected to ra bbit ear while the cathode was placed in the eye cup which held solution. Rabbits were under anesthesia by isofluorane inhalation and rabbit corneas were treated with topical 1% proparacaine drops before iontophoresis. C shows a diagram of the overall set-up97: when drug molecule is positively charged, the anode is placed in the eye-cup which contains drug solution, while the cathode is connected to the ear.

PAGE 157

141 Figure 5-3. Design of chemically modi fied hammerhead ribozyme targeting UL20 mRNA of herpes simplex virus type 1. G5, A6, G8, G12 and A15.1: ribonucleotide; b: 3'-Inverted abasic; U : 2'-Amino-uridine; *: Phos phorothioate; remaining nucleotides: 2-O-Methyl nucleotides.

PAGE 158

142 Figure 5-4. Immunostaining of rabbit cornea for green fluorescent protein expression delivered by different serotypes of ade no-associated virus vectors. A) No AAV control; B) AAV1; C) AAV2; D) AAV5; E) AAV7; F) AAV8. G) Quantification of the intensity of staining in corneal epithelium. FL33-L1R1:Untreate d A FL27-L2-R2: AAV2C FL28-L1-R2: AAV1B FL23-R1-R3: AAV5D FL29-L2-L4: AAV7E F FL30-L2-L4: AAV8G Transgene Expression by Different AAV Serotype Vectors in Rabbit Corneal Epithelium0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16 0.18 AAV1AAV2AAV5AAV7AAV8Net Relative Intensity

PAGE 159

143 Figure 5-5. Confocal microscope observation of green fluorescent protein using alkaline phosphatase detection system. Red fl uorescence: immune staining of GFP expression; blue staining: DAPI staini ng showing nuclei. A and B: show rabbit FL27 section L1 which was treated with AAV2 packaged GFP; A) (picture taken at 63X magnification) ti ssue layers from the top to bottom are stroma and epithelium; B) (63X) ti ssue layers from top to bottom are endothelium and stroma; C, D: pictures were taken at 63X magnification from rabbit FL23 treated with AAV5 and section R1; C) from the top are stroma and epithelium; D) from the top are e ndothelium and stroma; E, F: pictures were taken at 63X from rabbit FL33 wh ich is untreated and section R1; E: from top to bottom are stroma and epithelium; F: from the top to bottom are endothelium and stroma A B

PAGE 160

144 Figure 5-5. (continued) C D

PAGE 161

145 Figure 5-5. (continued) F E

PAGE 162

146 Figure 5-6. Delivery of LacZ gene expressi on using HSV vector in the cornea of New Zealand white rabbits. Rabbits from gr oup I were ocular inoculated in both eyes with wild-type HSV1 (17syn+) at a dose of 2x105pfu/eye to establish latency for 4 months before non-repl icating HSV-1 vector (8117/43) was delivered in only right eyes. Both eyes of each rabbit were harvested at 4 days after second HSV-1 infection and eyes were fixed for -Galactosidase staining. A and B are repr esentative pictures of both eyes from rabbit-FL69 taken at low power: A is an image of left eye, and B is right eye. Group II rabbits were first inoculated with a non-replicating HSV-1 vector, KD6, only in the left eye for 2.5 months. A seco nd infection was conducted in both eyes using dUTPase/LAT, which is a replic ating HSV-1 vector containing LacZ gene. 4 days after second infecti on, rabbit eyes were collected for Galactosidase staining. C is a low powe r photograph taken from the left eye of rabbit FL68, and D is taken from the right eye of FL68. FL69-Left eye A FL69-Right eye B FL68-Left C FL68-Right D

PAGE 163

147 A. 0 20 40 60 80 100 120 123456789101112131415Days post infectionpercent surviving PBS % GFP% Rz% Figure 5-7. Survival assay to obs erve protection effect of UL20 ribozyme. A) UL20 ribozyme effect on lethal infection of HSV-1 in mouse footpad. Ten Swiss ND4 mice were used per group in this study. Pretreatment (using PBS, AdGFP, or Ad-UL20rz) was conducted by subdermal injection in mouse rear footpad. Four hours after pretreat ment, abrasion was introduced on the footpad followed by another topical tr eatment (using PBS, Ad-GFP, and AdUL20rz, respectively). Twenty minutes later, HSV-1 infection was conducted at a dose of 104pfu per footpad. Mice were returned to their cage when they recovered from anesthesia. Observati on of behavior was conducted twice a day. The number of mice survived from lethal HSV-1 infection was recorded everyday in order to plot in the survival curve. The percentage of surviving animals from each treatment group was an overall effect calculated by combining two experiments. B) The comparison of viral DNA levels in dorsal root ganglion from Ad-GFP or Ad-UL20Rz treatment group after 4 days post-infection of HSV-1 in mouse f ootpad. At day 4 post-infection, four animals per group were sacrificed to collect dorsal root ganglion, and DNA was extracted for quantitative real-tim e PCR, and a 78% reduction of mean viral DNA level was observed in ribo zyme treated mice. The y-axis represents the ratio of viral DNA to mouse glyseraldehyde-3-phosphate dehydrogenase (GAPDH). C) The compar ison of viral DNA level in spinal cord from Ad-GFP and Ad-UL20Rz treatments at 6 days post-infection in mouse footpads. Four mice per group were sacrificed to collect spinal cord for DNA extraction. Quantitative real -time was conducted to compare viral DNA levels. An 86% reduction of mean viral DNA level was observed in ribozyme treated animal. The Y-axis represents the ratio of viral DNA to mouse GAPDH.

PAGE 164

148 B. C. 0 150 300 450 600 750Ratio of Viral DNA to mGAPD H Ad-GFP Ad-Rz 0 25 50 75 100Ratio of vPol vs. mGAPD H Ad-GFP Ad-Rz Figure 5-7. (continued)

PAGE 165

149 Figure 5-8. Delivery of chemi cally modified ribozyme reduced dendrite formation in rabbit cornea caused by herpes simplex virus type 1 infection. Three New Zealand white rabbits were used in this study. Chemi cally modified ribozyme RNA molecules were designed and synthe sized from Dharmacon (as shown in Fig 5-3). 100g of oligonucleotide we re used for iontophoresis of each eye and the right eye was treated with active ribozymes while the left eye of each rabbit was treated with the inactive ri bozymes. A replicaing HSV-1 strain (8117/43) containing LacZ gene was used for infection in both eyes following iontophoresis. Four days after infecti on, rabbits were sacr ificed and corneas were harvested for -galactosidase staining to look for viral replication patterns on the cornea. Figure A is a re presentative picture of a rabbit right cornea which had been treated with the active ribozyme (UL20 ribozyme154); B is the control eye fr om the same rabbit in A, which had been treated with the inactive ribozyme. The area with positive staining indicating the galactosidase activity, which showed the viral replication level in each eye, was measured using software called Si gmaScan. The staining levels from ribozyme treated eyes and control eyes were compared in Figure C. C 0 2000 4000 6000 8000 10000 12000 14000 16000 Right Eyes Left EyesDendrites Area (pixels) * P<0.02N=3 Left e y e: treated with inactive riboz y me right eye: treated with act i ve ri bo z y m e A B

PAGE 166

150 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS The original design for this study was to use a nucleic acid-based gene therapy approach to inhibit Herpes Simplex Virus type 1 (HSV-1) infection in the cornea. Hammerhead ribozymes and siRNA were design ed particularly for targeting the ICP4 gene, since it is the major transcriptional regu lator for the expression of all the other viral proteins. An ICP4 defective HSV-1 vect or, was designed for ribozyme (or siRNA) delivery. The hypothesis of using HSV vector for delivery was that the HSV vector, although defective, still maintains the behavior for neuronal transport, which can deliver therapeutic agents into sensory neurons.106 By these means, when latently infected HSV1 initiates its reactivation, a hammerhead ribozyme functions to inhibit viral lytic infection. Therefore, HSV-1 reactivation co uld be blocked. The assumptions for this hypothesis were that a therapeutic agent can prevent HSV-1 replication, and the HSV-1 vector can transduce the same neurons which have already been late ntly infected with HSV-1. Hammerhead Ribozyme Targeting ICP4 The rationale of targeting ICP4 mRNA to inhibit HSV-1 was that the ICP4 protein is the key activator of HSV-1 lytic infection188; therefore, knocking down ICP4 transcripts might eliminate vi ral replication. After scanni ng ribozyme cleavage sites in the ICP4 coding sequence (CDS) (nucleotide accessi on number NC_001806), secondary structures of potential ribozymes were pr edicted using a computational tool, MFOLD by Dr. Michael Zuker (http://www.bioinfo.rpi.edu/applica tions/mfold/old/rna/form1.cgi ). At

PAGE 167

151 the same time, other HSV-1 essent ial genes were studied, including UL20, UL30, and UL54. Only two hammerhead ribozymes (riboz yme-885 and ribozyme-533) were chosen against ICP4 mRNA. However, ribo zyme-533 was inactive according to in vitro analysis of kinetic parameters. Ribozyme-885 was te sted in the cell culture for ICP4 mRNA knock-down. Interestingly, this ribozyme re duced target gene expression by 42% in ICP4 expressing cells, but it could not inhib it wild-type HSV-1 viral replication. We speculated that although the ribozyme efficien tly cleaved ICP4 mRNA, a threshold level of ICP4 protein can still be reached in orde r to turn on HSV-1 lytic infection. However, it is possible that a more efficient ribozyme may provide a better inhibition effect. Therefore, an optimized selecti on approach is required, and an in vivo mapping approach (e.g., using dimethyl sulfate or DMS) is r ecommended to determine the accessibility of mRNA and RNA structure7,221,404 in addition to co mputational methods. There have been a series of ribozyme st udies targeting mRNA of HSV-1 ICP4. Although they showed impressive reductions by ribozyme treatment (close to 1000 fold), a non-permissive HSV-1 infection system was applied.355,358 The tests in this dissertation were conducted in rabbit skin cell (RSC) using17 syn + (wild-type HSV-1) that permits a 200-400 times higher viral replication than the cells used in the ear lier papers. On the other hand, ICP4 gene is an immediate early ge ne which is turned on right after viral lytic infections, and at 2 hours postinfection, ICP4 expression leve l drops to a baseline level.3 It was also suggested that th e abundance of ICP4 expression is very low even at the early time point of HSV-1 lytic infection.3 Another study using siRNA to inhibit ICP4 expression of HSV-2 was conducted, as HSV-2 IC P4 has a very similar role in lytic life cycle to HSV-1 ICP4. Although an efficient reduction in viral re plication was observed

PAGE 168

152 in the cells treated with ICP4 siRNA, no effect was detected at the ICP4 mRNA level. It is possible that the siRNA target ing ICP4 has off-target effect161, which interrupts not only ICP4 but cellular gene expression. Theref ore, an siRNA has to be evaluated very carefully before being used for gene-specific knock-down. Overall, it is a very difficult task to knockdown HSV-1 ICP4 gene expression, since it seems to only be important at the very firs t round of viral replic ation, and the baseline level later on is sufficient to support subseque nt rounds of replicati ons. Therefore, ICP4 gene might not be an ideal target for gene therapy purposes unless a complete inhibition of ICP4 expression can be achieved as ear ly as viral entry to the cell nucleus. Another immediate early gene, UL54 (or ICP27 gene), was also targeted for in order to inhibit HSV-1 replication. One ha mmerhead ribozyme designed for this gene had excellent in vitro kinetic activity (as shown in Ch apter 2), and was tested against wild-type HSV-1 (17 syn +) replication. No significant e ffect in reducing viral production was detected (data not shown). HSV-1 UL54 is an essential immediate early gene with a distinct role in post-transl ational modulations in viral and cellular transcriptional regulators.161,186 Its functions include the impairment of host splicing305, promoting viral transcription81, and the enhancement of viral mRNA translation.209 In addition, UL54 protein also counteracts the ear ly innate immune response.237 However, there is a definite tolerance of the delay of UL54 expression. It is speculated that an early time window of UL54 expression is preferred in the HSV1 lytic life cycle. In addition, a prolonged expression of UL54 protein maintains the favorable condition for viral replication. The observation in this study was consistent with the finding that UL54 (ICP27 gene) expression is not cri tical to HSV-1 viral replication in vitro and in

PAGE 169

153 vivo .326,340,341 The UL54 gene might not be a good target for anti-HSV-1 therapy, since UL54 expression is essential for immediate early gene expres sion at the early time point, but has no effect on the efficiency of viral replication at the later stage.341 Knocking down immediate early genes of HS V-1 did not provide a satisfying result in inhibiting viral replication, base d on our experience of ICP4 and UL54. These data supported the argument that HSV-1 immediate early genes are important within a limited set of physiological conditions. A different strategy is needed to eliminate HSV-1 infection in vitro and in vivo Ribozyme Targeting mRNA of Herpes Simp lex Virus Type 1 Early/Late Essential Genes The second stage of this study focused on testing ribozymes targeting genes from kinetic classes other than immediate ear ly genes. Two ribozymes, targeting UL20 and UL30, respectively, were chosen for the gene therapy study, due to their high in vitro kinetic activities. An adenovi ral vector system was adopted to deliver ribozymes in tissue culture because of its high transduction efficient. Interestingly, the ribozyme targeting a late essential gene, UL20, achieved the most significant therapeutic effect against HSV-1 infection in vitro and in vivo It was suggested from a recent study that suppressing early or late gene expression of HSV could achieve therapeutic effect in vivo .271 In the same study, siRNAs were designed against HSV-2 UL27 and UL29, which encodes an envel ope glycoprotein and a DNA binding protein, respectively.298 The study by Palliser et al.271 further supported my observation that knocking down early/late gene s of HSV might have a greater impact on the viral lytic life cycle than inhibiting th e expression of immediate early genes. Therefore, significantly inhibiti ng viral protein production in a la ter kinetic class (early or

PAGE 170

154 late genes encoding structural proteins, func tional proteins in DNA replication and virion maturation) might give a more profound inhibitory effect in vivo The ribozyme test was extended to study the antiviral effect ag ainst HSV-1 strains with drug resistant phenotypes. This study was the first to show that a nucleic based therapeutic agent (UL20 ribozyme-154 particularly targeting late gene mRNA) could inhibit viral replication of drug resistant HSV-1 strains consistently a nd reduce the severity of wild-type HSV-1 ocular infection in rabbits (Chapter 5). Although iontophoret ic delivery of chemically modified ribozymes is still under evaluation to determine the preventative effect against recurrent HSV-1 infection, this study pointed to wards a future directi on of the therapeutic application using nucleic-based ag ents. A topical drug form of UL20 ribozyme-154 could be very helpful in preventing ocular herpes, and a standard clinical treatment could be developed. Currently patients with ocular he rpes often suffer side-effects caused by the toxicity of anti-HSV nucleotide analogs. A different approach using ribozymes provides an alternative for those patients. In add ition, since multiple ribozymes targeting mRNAs of different HSV essential genes can be co mbined to prevent the generation of escape mutant viruses, ribozyme therapy has a great potential for infectious diseases caused by HSV, especially in immune-compromised patients. Another observation in this ribozyme st udy was that there might be a regulation between expression of HSV1 viral DNA polymerase and UL20. The important role of UL20 protein in HSV-1 life cycle has been a ddressed previously (Chapter 4), and it functions not only for intracellular transport of virions and glycopr oteins, but also for extracellular release of virions It was suggested by Ward et al378 that UL20 expression can be down-regulated by abolishing DNA re plication of HSV-1. During the study of

PAGE 171

155 ribozyme targeting UL20 mRNA, a significant reduction in UL20 mRNA level was detected, which led to an equivalent knock-down in the mRNA level of UL30 which encodes HSV-1 DNA polymerase. Meanwhile, when the ribozyme targeting UL30 mRNA was tested in cell culture, a delay of UL20 expression at the transcriptional level was observed, correlating with a significan t reduction in DNA polym erase expression. Therefore, a question was raised whether a feedback between UL20 and HSV-1 DNA polymerase exists. If this rela tion does exist, what could be its significance in viral lytic infection? It would also be interesting to see whether disrupting this interaction can lead to any change in viral pathogenesis. For th is purpose, a recombin ant HSV-1 virus can be constructed by switching the promoter of UL20 from its original leaky late class to the strict late class. Th erefore, a delay in UL20 expression can be established. If any essential interaction exists between UL20 and viral DNA polymerase, a phenotype can be expected compared with the wild-type parental strain. A growth rate comparison of the recombinant virus and its parental strain can be conducted in cell culture. The modification in pathogenesis of the recombinant virus, if any, can be tested in the acute infection model of HSV-1, a mouse footpad infe ction model. Since the viral replication is required for its pathogenesis in vivo the inefficiency of lytic infection may lead to a phenotype. The Establishment of an Ocular Delivery System Using Herpes Simplex Virus Type 1 Vector A question was raised during the study wh ether HSV-1 vector could be used for ribozyme delivery in the host that had been la tently infected with HSV-1. It is known that the maximum amount of virus present in the trigeminal ganglia is independent of the inoculum dose, during not only acute but also recurrent infections.269 Therefore, only a

PAGE 172

156 fraction of trigeminal ganglia can be infect ed during a primary infection or during reinfection, and the percentage of infected neurons may be different among individuals depending on their genetic backgrounds and physical conditions (immune status). How to selectively target neurons that had been latently infected with HSV-1 was the major barrier for an efficient delivery using an HSV-1 vector carrying ribozymes. Currently this issue cannot be resolved, and because of the restricted transduction efficiency in neurons, increasing HSV-1 vector dose woul d not promote a higher delivery level. However, modifications of e nvelop proteins of recombinant HSV vectors in order to conduct receptor-specific binding can potentially lead to a sele ctive targeting of infected cells. Regions within gC(glycoprotein C) a nd gB (glycoprotein B) are known to contribute to 80% of hepa rin sulfate (HS) binding.207 In addition, domains within gD that specifically interact with Hv eA (Herpes virus entry protei n A) or HveC (nectin-1, a nomophilic cell adhesion molecule) have been defined.48,196,197,231,264,385,386 The understanding of HSV-1 bindi ng and entry led to the de velopment of HSV vectors engineered with the ability to target distinct cell populations.206 Although it has been generally accepted that in latency, the HSV genome is quiescent in protein expression, allowing latent viruses to hide from host immune system, recent studies have provided evidence against this concep t. By employing more sensitive detection methods, the expression of HSV IE (immediat e early), E (early), and L (l ate) genes was observed in latently infected neurons in mice.59,60,103,191 In vivo data also supported HSV antigen expression in trigeminal ganglia (TG) in latently infected mice.103,309 Together, these

PAGE 173

157 results indicated that HSV vectors may be e ngineered to target HSV infected cells by recognizing HSV viral antig ens on the cell surface. The study of HSV vector ocular delivery also led to a very inte resting finding that not only did the previous HSV-1 infection protect the cornea from a sequential superinfection, but that this protection was unila teral and not related to systemic immune response. This study was conducted in a rabb it model of ocular infection. The acute infection in rabbit cornea imitates clinical i ndications of human ocul ar herpes infection; the reactivation of HSV-1 can be induced efficiently by epinephrine iontophoresis202, and the indication of infection also resemble s the recurrent HSV-1 infection in human patients. The protective effect was detected two and a half months after the inoculation of replicating-defectiv e HSV-1, and the same effect was obs erved at four months after the primary infection of wild-type HSV-1. If the replication-competent virus reactivated spontaneously during the four-month period, this might repeatedly boost the acquired immunity, and eventually protect rabbits from the super-infection. The protection effect on the cornea from a primary infection of a replication-defective HSV-1 (KD6) cannot be explained since the virus could not under go lytic infection, al though it could enter a latency-like stage in the trigeminal ganglia. T-lymphocytes, especially CD8+ T cell, have been recognized to play a very important role in control of HSV-1 acute infection205 and latency.85,289 It was suggested that both CD4+ and CD8+ T cells were enriched and reta ined in the mouse ganglion for life, and this effect was observe d after HSV-1 corneal infection.222,319 In human trigeminal ganglia (TG), CD8+ T cells were localized in the neuron body of patients with a history of recurrent HSV-1 infections.348 In addition, studies have shown that T cell-

PAGE 174

158 derived anti-viral cytokines (e.g., IFN TNF and RANTES, a T cell chemoatractant) can be detected more than 180 days afte r HSV-1 corneal infection in mouse TG.47,58,132,222 These facts suggested that an immune surveillance was established to control HSV-1 latency and reactivation. However, they also led to a speculation that the existence of T lymphocytes (particularly CD8+ T cells) and T cell-derived effectors may re-shape neuronal immunity to prevent a future inva sion from another HSV-1 strain. It still remains for further investigation whether this immune surveillance ex ists for a prolonged period of time in the cornea, which can provide answers to the ocular protection rendered by the previous infection of replication incompetent HSV-1. The HSV-1 vector study led to a conclusi on that HSV-1 vector might need future modifications before it can be used for ri bozyme delivery in gene therapy of HSV-1 infections. Further inves tigation of the interestin g phenomenon of local immune protection elicited by a non-re plicating HSV vector is cu rrently on the way. A mouse ocular HSV-1 model is being used to study the mechanism since various cellular factors related to the immune response can be probed in the mouse system. In mice, modifications in cellular environment caused by HSV-1 infection can be studied, because antibodies are available to cytokines and to proteins involved in intracellular signal transduction. In addition, corneal infection of nude mice will indicate whether a T cell response is important in the loca lized immunity we have observed. The effect in the cornea is especially in teresting in that it will provide a better understanding that could lead to new vaccine -based approaches to prevent recurrent ocular HSV infection. CD8+ T cell and IFNcan be studied for their roles in this phenomenon. If T cells or T cell-derived f actors can be attracted by infection of non-

PAGE 175

159 replicating HSV-1, it will be in triguing to see how long they are retained in the eye. Because the protective effect was induced by infection of replication-incompetent HSV-1, a very sensitive immune response must have been triggered. Therefore, HSV-1 antigens (especially gB and gD) may have an essential role in initiating this process. To avoid complications in the study, cell-free HSV-1 viral stocks79,381 should be used, since a regular HSV-1 viral preparati on often contains excessive am ounts of viral proteins and cellular debris which could induce inflam mation. Although an ICP4 defective HSV-1 vector was used in the preliminary study, it ma y be more informative to include another replication incompetent HSV-1 vector with disruptions in other essential genes (e.g., ICP8 or ICP27). A previous study by Morrison et al257 indicated that after subcutaneous immunization of an HSV-1 capable of partially completing replication (ICP8virus can still express and gene, while ICP27virus can express , and 1 genes) provided a better protection effect than a complete replication defective virus (ICP4HSV-1). The protection effect led to a low clinical score of herpes keratitis in mice when they were super-infected with replicating HSV-1. Although systemic immune response is not a major consideration in the study of this diss ertation, using different replication-defective HSV-1 viruses can help to define HSV-1 antig ens that have the most potential to induce a persistent immune surveillance. Viral Vectors for Corneal Gene Transfer In this study, the potential uses of different viral vect ors were explored for gene transfer in the cornea. As discussed in Ch apter 5, adeno-associat ed virus, adenovirus, and herpes simplex virus vectors have th eir unique advantages. Iontophoresis of chemically modified ribozyme RNAs could be an alternative approach, although further evaluation is required. Another group of viral vectors which have not been studied in this

PAGE 176

160 dissertation research are derive d from retroviruses. The ad vantage of using retroviral vector for corneal gene delivery is to provide long-term transgene expression. The retrovirus family, the Retroviridae, re presents a unique group of viruses that contain a genomic RNA which is a dimer of lin ear, positive-sense, single-stranded RNA. The genomic RNA monomer is 7 to 13kb in si ze. After virion internalization and uncoating of viral envelop, the genomic RNA is reverse transcribed into double-stranded DNA. The unique feature that re troviruses share is that th ey can permanently integrate the viral genome into the host chromosomal DNA, and the integrated form of the virus (provirus) functions as the template for viral gene expression and production of viral progeny. This reverse flow of genetic information from RNA to DNA defines the hallmark of retroviruses. The genomic RNA of retrovirus virions is associated with the viral nucleocapsid protein and this complex is contained in a capsid (or nucleoid) which is surrounded by a spherical layer of protein ma trix. Outside of the matrix is envelop consisting of a lipid membrane bilayer, whose surface is studded by projections of an envelop glycoprotein. The gene ra of the family Retroviridae have formalized by the International Committee on Taxonomy of Viru ses (ICTV): The alpha-, beta-, and gamma-retroviruses are considered simple re troviruses, meanwhile the delta-, epsilonretroviruses, lentiviruses, a nd spumaviruses are considered complex. Simple viruses encode the Gag, Pro, Pol, and Env protei ns, whereas the complex viruses encode additional regulatory proteins. The entry of different retroviru ses relies on their distinct receptors located on th e surface of host cells. Replication-defective vectors derived from retroviruses have been studied for the delivery of therapeutic genes and offer advant ages of long-term expression, large package

PAGE 177

161 capacity, and tissue specif ic tropism. The long-term expr ession of transgene by retroviral vector can be achieved by permanently integrating into host chromosomal DNA. One key step for the integration is the entry of viral DNA into th e nucleus. Lentiviruses have an active nuclear transport mechanism39,214,303,383, thus they can infect dividing and nondividing cells efficiently, which made them very attractive gene delivery vectors. Although all current integrating gene-transfe r vectors carry the ri sk of insertional mutagenesis215, lentiviral vectors have the adva ntage in safety concern over their oncoretroviral counterparts.361,395 For corneal gene therapy, le ntiviral vectors have great potential that they can provide prolonged transgene e xpression efficiently. Wang et al377 tested a lentiviral vector encoding enhanced green fluorescen t protein (eGFP) in human keratocytes in vitro as well as corneal epith elium and endothelium ex vivo The GFP expression in corneal epithelium was visualized under fluorescent mi croscope at 3 days post-infection and up until 60 days. In this study, however, a requi rement of virus-cell contact was observed for efficient transduction which might limit th e application in corn eal delivery. Another study by Bainbridge et al16 suggested that in mice lentiv iral vector could transduce corneal endothelium by anterior chamber in jection and transduce retinal pigmental epithelium (RPE) by sub-retinal injection, and transgene expression was observed up to 6 weeks. A similar effect was also observed by Takahashi et al346 using a different lentiviral vector, and up to 20 weeks after transduction th e transgene expression still could be detected. During the study of this dissertation rese arch, an antiviral therapy was under development to deliver the transgene (therape utic ribozymes) to the corneal epithelium.

PAGE 178

162 Lentiviral vectors have signifi cant advantages for this purpose. Corneal epithelial cells are highly differentiated and th e cell layer regenerates within a relatively short period of time. With the ability of transducing the non-dividing cells the lentiviral vector may transduce epithelial cells to express antiHSV ribozymes. Therefore, a temporary protection against HSV infection can be exp ected. Considering th e transgene expression can be turned on fairly quickly after lentiviral delivery (as early as 3 days), a therapeutic effect could be observed within the half-life of corneal epith elium, which is 10-14 days. In addition, lentiviral vectors may transduce limbal stem ce lls which are responsible for the renewal of the epithelial cell layer. HIV-1 based lentiviral vectors have led to long term expression of marker genes in the outer layers of the skin, suggesting that epidermal stem cells had been transduced.15,117 Transduction of stem cells will render the expression of therapeutic ribozymes in the progenitor cell population. Consequently a long-term protection against HSV lytic infect ion would be provided. Lentiviral vectors may be delivered through topi cal application. However, si milarly to AAV, HSV, and adenoviral vectors, a superfic ial abrasion on the corneal ep ithelium may be required for efficient transduction. As the intrastromal injection of lentiviral vectors only provided the transgene expression at the injection si tes (unpublished data by Mohan, Schultz, and Wilson, 2003), the area of gene delivery c ould be very limited. A more efficient application of transgene delivery us ing lentiviral vector may be the ex vivo treatment of allogeneic corneas for transplantations259, although the virus-cell contact is still the major factor for efficient transduction.377

PAGE 179

163 APPENDIX A ABBREVIATIONS AAV Adeno-associated virus ACV Acyclovir Ad Adenovirus ADCC Antibody-dependent cell-mediated cytotoxicity Ara-A Vidarabine ASLV Avian sarcoma leucosis virus CAR Coxsakievirus and adenovirus receptor cDNA Copy DNA CDS Coding sequence c-FLIP cellular FLICE-inhibitory protein CMV cytomegalovirus CNS Central nervous system CPE Cytopathic effect CS Calf serum DC Dendritic cell DI water Deionized water DMEM Dulbecco's Modification of Eagle's Medium DRG Dorsal root ganglion dsRNA Double-stranded RNA E.coli Escherichia coli

PAGE 180

164 EDTA Et hylenediaminetetraacetic acid eGFP Enhanced green fluorescent protein FADD Fas associated dead domain FBS Fetal Bovine Serum FDA Food and Drug Administration FLICE FADD-like ICE gB Glycoprotein B gC Glycoprotein C gD Glycoprotein D GTF General transcription factors HCF Host cell factor HEDS Herpetic Eye Disease Study HIV Human immunodeficiency virus HLA Human leukocyte antigen (or Human lymphocyte antigen) HPC Hippocampus Hrl Herpes resistance locus HSE Herpes Simplex Encephalitis HSV Herpes Simplex Virus HSK Herpes Simplex Keratitis IDU Idoxuridine IE gene Immediate early gene IL-12 Interleukin 12

PAGE 181

165 IM Intramuscular INF Interferon ITR Internal terminal repeat IV Intravenous kb kilo bases LAT Latency-associated transcript LTR Long terminal repeat MEM Eagles minimal essential medium MHC major histocompatibility class MOI Multiplicity of Infection MT Mocking Transfection MuLV Murine Leukemia Virus ms milli-second NaCl Sodium Chloride NO Nitric oxide NPC Nuclear Pore Complex ODN Oligodeoxynucleotide ORF Open Reading Frame PCR Polymerase chain reaction PNS Periphery nervous system RISC the RNA-induced silencing complex RNAi RNA interference RNA Pol II RNA polymerase II

PAGE 182

166 RPE the retina pigment epithelium RSC Rabbit Skin Cell RSV rous sarcoma virus SDS-PAGE Sodium Dodecyl Sulfatepolyacrylamide gel electrophoresis shRNA Small hairpin RNA siRNA Small interference RNA SC Spinal cord TAP Transporter associated with antigen presentation TBP TATA-box Binding Protein TFIID Transcription Factor II D TG Trigeminal ganglion TGN Trans-Golgi network TK Thymidine Kinase TNFTumor Necrosis Factor TRAIL TNF-re lated apoptosis-inducing ligand Tris-HCl Tris Hydrochloride or 2-Amino-2(hydroxymethyl)-1,3-propane diol, hydrochloride UL Unique Long region US Unique Short region s micro-second VSV the vesicular stomatitis virus

PAGE 183

167 Xist X (chromosome) inactive specific transcript wt Wild-type

PAGE 184

APPENDIX B REAL-TIME PCR PRIMERS AND PROBES The following appendix provides a comp rehensive summary of design and sequences of primers and probes of real-tim e polymerase chain reaction used in this dissertation.

PAGE 185

169Table B-1. Real-time PCR primers and probes DNA Target Sequence Accession Number. (Nucleotide Number.) HSV ICP4 5 CAC GGG CCG CTT CAC 3 (forward) X14112 (130208-130292)(147941-148025) 5 GCG ATA GCG CGC GTA GA 3 (reverse) 5 CCG ACG CGA CCT CC 3 (probe) HSV-1 UL20 5 CCA TCG TCG GCT ACT ACG TTA C 3 (forward) X14112 (41118..41187) 5 CGA TCC CTC TTG ATG TT A ACG TAC A 3 (reverse) 5 CCC GCA CCG CCC AC 3 (probe) HSV DNA Pol (UL30) 5' AGA GGG ACA TCC AGG ACT TTG T 3' (forward) X14112 (65880-65953) 5' CAG GCG CTT GTT GGT GTA C 3' (reverse) 5' ACC GCC GAA CTG AGC A 3' (probe) UL54 (ICP27) 5' GCC CGT CTC GTC C AG AAG 3' (forward) X14112 (113945-114034) 5' GCG CTG GTT GAG GAT CGT T 3' (reverse) 5' CAG CAC CCA GA C GCC 3' (probe) Mouse Xist 5 GCTCTTAAACTGAGTGGGTGTTCA 3 (forward) NR001570 (857-925) 5 GTATCACGCAGAAGCCATAATGG 3 (reverse) 5 ACGCGGGCTCTCCA 3 (probe)

PAGE 186

170 APPENDIX C RECIPE OF SOLUTIONS 1. Dialysis Buffer for Adenovirus Purification: It contained 10mM Tris-HCl (pH7.5), 200mM Sodium Chloride (NaCl), 1mM Ethylenediaminetetraacetic acid (EDTA), and 4% (weight/volume) sucrose. To make 2L of the dialysis buffer, 20mL of 1M Tris-H Cl (pH7.5), 80mL of 5M NaCl, 4mL of 0.5M EDTA, and 80g of sucrose were mixed a nd brought up to the final volume with autoclaved de-ionized water. This soluti on should be made fresh and cooled at 4C before use. 2. Elution buffer for the ribozyme cloning protocol: (a total volume of 6mL) a. 5M Ammonium acetate 600 L b. 1M Magnesium acetate 60 L c. 0.5M Ethylenediaminetet raacetic acid (EDTA) 120 L d. 10% Sodium Dodecyl Sulfate (SDS) 60 L e. Sterile water 5,160 L 3. DOC Lysis Buffer for Adenovirus DNA Mini-prep: 20% of total volume of absolute ethanol 100mM Tris-HCl, pH9.0 0.4% solium deoxycholate 4. PBS (Phosphate-buffered Saline) 137mM NaCl 2.7mM KCl 10mM Na2HPO4 2mM KH2PO4 Dissolve 8g of NaCl, 0.2g of KCl, 1.44g of Na2HPO4, and 0.24g of KH2PO4 in 800mL of distilled H2O. Adjust the pH to 7.4 with HCl. Add H2O to 1L. Dispense the solution into aliquots and sterilize them by autoclav ing for 20 minutes at 15psi (1.05kg/cm2) on liquid cycle or by filter steriliz ation. Store the buffer at room temperature.

PAGE 187

171 Note that the recipe presented here does not include divalent ca tions. If necessary, 1mM CaCl2 and 0.5M MgCl2 may be supplemented. 5. 50mg/mL Pronase Pronase was purchased from CALBIOCHEM (San Diego, CA) and resuspended in sterile de-ironed water to a final concentrati on of 50mg/mL. The solution was incubated at 37C for 30 minutes to inactivat e other enzymes before use.

PAGE 188

172 LIST OF REFERENCES 1. Adelson, M. E., M. Feola, J. Trama, R. C. Tilton, and E. Mordechai 2005. Simultaneous detection of herpes simple x virus types 1 and 2 by real-time PCR and pyrosequencing. J Clin Virol. 33 :25-34. 2. Agrawal, N., Y. Liu, J. L. Meht a, H. You, and P. L. Hermonat 2004. Generation of recombinant skin in vitro by adeno-associated virus type 2 vector transduction. Mol Ther. 9 :S303. 3. Aguilar, J. S., G. V. Devi-Rao, M. K. Rice, J. Sunabe, P. Ghazal, and E. K. Wagner 2006. Quantitative comparison of the HSV-1 and HSV-2 transcriptomes using DNA microarray analysis. Virology 348 :233-241. 4. Alwine, J. C., W. L. Steinhart, and C. W. Hill 1974. Transcription of herpes simplex type 1 DNA in nuclei isolated from infected HEp-2 and KB cells. Virology 60 :302-307. 5. Amado, R. G., R. T. Mitsuyasu, G. Symonds, J. D. Rosenblatt, J. Zack, L. O. Sun, M. Miller, J. Ely, and W. Gerlach 1999. A phase I trial of autologous CD34(+) hematopoietic progenitor cells tr ansduced with an anti-HIV ribozyme. Hum Gene Ther 10 :2255-2270. 6. Aoki, K., T. Yoshida, N. Matsumoto, H. Ide, K. Hosokawa, T. Sugimura, and M. Terada 1997. Gene therapy for peritoneal di ssemination of pancreatic cancer by liposome-mediated transfer of herpes simplex virus thymidine kinase gene. Hum Gene Ther 8 :1105-1113. 7. Ares, M. and A. H. Igel 1990. Lethal and temperature-sensitive mutations and their suppressors identify an essential structural elemen t in U2 small nuclear-RNA. Genes Dev. 4 :2132-2145. 8. Argnani, R., L. Boccafogli, P. C. Marconi, and R. Manservigi 2004. Specific targeted binding of herpes simplex viru s type 1 to hepatocytes via the human hepatitis B virus preS1 peptide. Gene Ther. 11 :1087-1098. 9. Aubert, M. and J. A. Blaho 1999. The herpes simplex virus type 1 regulatory protein ICP27 is required for the preventi on of apoptosis in infected human cells. J Virol. 73 :2803-2813.

PAGE 189

173 10. Auricchio, A., G. Kobinger, V. Anand, M. Hildinger, E. O'Connor, A. M. Maguire, J. M. Wilson, and J. Bennett 2001. Exchange of surface proteins impacts on viral vector cellular specificity and transduction ch aracteristics: the retina as a model. Hum Mol Genet. 10 :3075-3081. 11. Babu, J. S., J. Thomas, S. Kanangat, L. A. Morrison, D. M. Knipe, and B. T. Rouse 1996. Viral replication is requir ed for induction of ocular immunopathology by herpes simplex virus. J. Virol. 70 :101-107. 12. Bachenheimer, S. and J. E. Darnell 1975. Adenovirus-2 mRNA is transcribed as part of a high-molecular-weight precursor RNA. Proc. Natl. Acad. Sci. U. S. A. 72 :4445-4449. 13. Bacon, T. H., R. J. Boon, M. Schultz, and C. Hodges-Savola 2002. Surveillance for antiviral-agent-resistan t herpes simplex virus in the general population with recurrent herpes labi alis. Antimicrob Agents Chemother. 46 :3042-3044. 14. Bacon, T. H., M. J. Levin, J. J. Leary, R. T. Sarisky, and D. Sutton 2003. Herpes simplex virus resistance to acyclovi r and penciclovir af ter two decades of antiviral therapy. Clin Microbiol Rev. 16 :114-128. 15. Baek, S. C., Q. Lin, P. B. Robbins, H. Fan, and P. A. Khavari 2001. Sustainable systemic delivery via a single injection of lentivirus into human skin tissue. Hum. Gene Ther. 12 :1551-1558. 16. Bainbridge, J. W., C. Stephens, K. Pars ley, C. Demaison, A. Halfyard, A. J. Thrasher, and R. R. Ali 2001. In vivo gene transfer to the mouse eye using an HIV-based lentiviral vect or; efficient long-term transduction of corneal endothelium and retinal pigment epithelium. Gene Ther. 8 :1665-1668. 17. Baines, J. D., P. L. Ward, G. Campadelli-Fiume, and B. Roizman 1991. The UL20 gene of herpes simple x virus 1 encodes a function necessary for viral egress. J. Virol. 65 :6414-6424. 18. Banga, A. K., S. Bose, and T. K. Ghosh 1999. Iontophoresis and electroporation: comparisons and contrasts. Int J Pharm. 179 :1-19. 19. Bantounas, I., C. P. Glover, S. Kelly, S. Iseki, L. A. Phylactou, and J. B. Uney 2005. Assessing adenoviral hammerhead ribozyme and small hairpin RNA cassettes in neurons: inhibition of e ndogenous caspase-3 activity and protection from apoptotic cell death. J Neurosci Res 79 :661-669. 20. Barrick, J. E., K. A. Corbino, W. C. Winkler, A. Nahvi, M. Mandal, J. Collins, M. Lee, A. Roth, N. Sudarsan, I. Jona, J. K. Wickiser, and R. R. Breaker 2004. New RNA motifs suggest an ex panded scope for riboswitches in bacterial genetic control. Proc Natl. Acad. Sci. U. S. A. 101 :6421-6426.

PAGE 190

174 21. Batterson, W. and B. Roizman 1983. Characterization of the herpes simplex virion-associated factor responsible fo r the induction of alpha genes. J Virol. 46 :371-377. 22. Been, M. D. 2006. Molecular biology. Versatility of self-cleaving ribozymes. Science 313 :1745-1747. 23. Behar-Cohen, F. F., A. El Aouni, S. Ga utier, G. David, J. Davis, P. Chapon, and J. M. Parel 2002. Transscleral Coulomb-c ontrolled iontophoresis of methylprednisolone into the rabbit eye: in fluence of duration of treatment, current intensity and drug concentr ation on ocular tissue and fluid levels. Exp. Eye Res. 74 :51-59. 24. Beigelman, L., J. A. Mcswiggen, K. G. Draper, C. Gonzalez, K. Jensen, A. M. Karpeisky, A. S. Modak, J. Matulicadamic, A. B. Direnzo, P. Haeberli, D. Sweedler, D. Tracz, S. Grimm, F. E. Wincott, V. G. Thackray, and N. Usman 1995. Chemical Modification of Hammerhead Ribozymes Catalytic Activity and Nuclease Resistance. J Biol Chem. 270 :25702-25708. 25. Berdugo, M., F. Valamanesh, C. Andrieu, C. Klein, D. Benezra, Y. Courtois, and F. Behar-Cohen 2003. Delivery of antisense o ligonucleotide to the cornea by iontophoresis. Antisens e Nucleic Acid Drug Dev. 13 :107-114. 26. Berget, S. M., C. Moore, and P. A. Sharp 1977. Spliced segments at the 5' terminus of adenovirus 2 late mRNA Proc. Natl. Acad. Sci. U. S. A 74 :31713175. 27. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon 2001. Role for a bidentate ribonuclease in the initia tion step of RNA interference. Nature 409 :363-366. 28. Bitko, V., A. Musiyenko, O. Shulyayeva, and S. Barik 2005. Inhibition of respiratory viruses by nasally administered siRNA. Nat Med. 11 :50-55. 29. Blacklow, N. R., M. D. Hoggan, M. S. S ereno, C. D. Brandt, H. W. Kim, R. H. Parrott, and R. M. Chanock 1971. Seroepidemiologic study of adenovirusassociated virus infection in infants and children. Am J Epidemiol. 94 :359-366. 30. Blount, K. F. and O. C. Uhlenbeck 2005. The structure-function dilemma of the hammer head ribozyme. Annu Rev of Biophys and Biomol Struct. 34 :415-440. 31. Boon, R. J., T. H. Bacon, H. L. Robey, T. J. Coleman, A. Connolly, P. Crosson, and S. L. Sacks 2000. Antiviral susceptibilitie s of herpes simplex virus from immunocompetent subjects with recurrent herpes labialis: a UK-based survey. J Antimicrob Chemother. 46 (6):1051.

PAGE 191

175 32. Bowles, D. E., J. E. Rabi nowitz, and R. J. Samulski 2003. Marker rescue of adeno-associated virus (AAV) capsid mu tants: a novel approach for chimeric AAV production. J Virol. 77 :423-432. 33. Branch, A. D. 1996. A hitchhiker's guide to antisense and nonantisense biochemical pathways. Hepatology 24 :1517-1529. 34. Brandt, C. R., R. L. Kintner, A. M. Pumfery, R. J. Visalli, and D. R. Grau 1991. The herpes simplex virus ribonucleot ide reductase is required for ocular virulence. J. Gen. Virol. 72 ( Pt 9) :2043-2049. 35. Brandt, C. R., A. W. Kolb, D. D. Shah A. M. Pumfery, R. L. Kintner, E. Jaehnig, and J. J. Van Gompel 2003. Multiple determinants contribute to the virulence of HSV ocular and CNS infection and identification of serine 34 of the US1 gene as an ocular disease determinant. Invest Ophthalmol. Vis. Sci. 44 :26572668. 36. Brandt, C. R., B. Spencer, P. Im esch, M. Garneau, and R. Deziel 1996. Evaluation of a peptidomimetic ribonucleot ide reductase inhibitor with a murine model of herpes simplex virus type 1 ocular disease. Antimicrob. Agents Chemother. 40 :1078-1084. 37. Bratty, J., P. Chartrand, G. Ferbeyre, and R. Cedergren 1993. The hammerhead RNA domain, a model ribozyme. Biochim. Biophys Acta 1216 :345359. 38. Bridge, A. J., S. Pebernard, A. Du craux, A. L. Nicoulaz, and R. Iggo 2003. Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34 :263-264. 39. Bukrinsky, M. I., N. Sharova, M. P. Dempsey, T. L. Stanwick, A. G. Bukrinskaya, S. Haggerty, and M. Stevenson 1992. Active nuclear import of human immunodeficiency virus type 1 prei ntegration complexes. Proc. Natl. Acad. Sci. U. S. A. 89 :6580-6584. 40. Buller, R. M., J. E. Janik, E. D. Sebring, and J. A. Rose 1981. Herpes simplex virus types 1 and 2 completely help ad enovirus-associated virus replication. J Virol. 40 :241-247. 41. Burger, C., O. S. Gorbatyuk, M. J. Ve lardo, C. S. Peden, P. Williams, S. Zolotukhin, P. J. Reier, R. J. Mandel, and N. Muzyczka 2004. Recombinant AAV viral vectors pseudotyped with vira l capsids from serotypes 1, 2, and 5 display differential efficiency and cell tr opism after delivery to different regions of the central nervous system. Mol Ther. 10 :302-317. 42. Burnette, R. R. and D. Marrero 1986. Comparison betwee n the iontophoretic and passive transport of t hyrotropin releasing hormone across excised nude mouse skin. J. Pharm. Sci. 75 :738-743.

PAGE 192

176 43. Burton, E. A., D. J. Fink, and J. C. Glorioso 2002. Gene delivery using herpes simplex virus vectors. DNA Cell Biol. 21 :915-936. 44. Buzayan, J. M., J. S. McNinch, I. R. Schneider, and G. Bruening 1987. A nucleotide sequence rearrangement distinguis hes two isolates of satellite tobacco ringspot virus RNA. Virology 160 :95-99. 45. Campbell, M. E., J. W. Palfreyman, and C. M. Preston 1984. Identification of herpes simplex virus DNA sequences wh ich encode a tran s-acting polypeptide responsible for stimulation of imme diate early transcription. J Mol Biol 180 :1-19. 46. Cantin, E., J. Chen, D. E. Willey, J. L. Taylor, and W. J. O'Brien 1992. Persistence of herpes simplex viru s DNA in rabbit corneal cells. Invest Ophthalmol. Vis. Sci. 33 :2470-2475. 47. Cantin, E. M., D. R. Hinton, J. Chen, and H. Openshaw 1995. GammaInterferon Expression During Acute and Latent Nervous-System Infection by Herpes-Simplex Virus Type-1. J Virol. 69 :4898-4905. 48. Carfi, A., S. H. Willis, J. C. Whitbeck, C. Krummenacher, G. H. Cohen, R. J. Eisenberg, and D. C. Wiley 2001. Herpes simplex virus glycoprotein D bound to the human receptor HveA. Mol Cell. 8 :169-179. 49. Carlson, E. C., C. Y. Liu, X. Yang, M. Gregory, B. Ksander, J. Drazba, and V. L. Perez 2004. In vivo gene delivery and visu alization of corn eal stromal cells using an adenoviral vector and keratocyte -specific promoter. Invest Ophthalmol. Vis. Sci. 45 :2194-2200. 50. Carr, D. J., P. Harle, and B. M. Gebhardt 2001. The immune response to ocular herpes simplex virus type 1 infection. Exp. Biol. Med. (Maywood.) 226 :353-366. 51. Carrozza, M. J. and N. A. DeLuca 1996. Interaction of the viral activator protein ICP4 with TFIID through TAF250. Mol Cell Biol 16 :3085-3093. 52. Carter, B. J. 2005. Adeno-associated virus vector s in clinical trials. Hum Gene Ther. 16 :541-550. 53. Chao, H., Y. Liu, J. Rabinowitz, C. Li, R. J. Samulski, and C. E. Walsh 2000. Several log increase in therapeutic transgen e delivery by distinct adeno-associated viral serotype vectors. Mol Ther. 2 :619-623. 54. Chattopadhyay, M., J. Goss, D. Wolfe, W. C. Goins, S. Huang, J. C. Glorioso, M. Mata, and D. J. Fink 2004. Protective effect of herpes simplex virusmediated neurotrophin gene transf er in cisplatin neuropathy. Brain 127 :929-939.

PAGE 193

177 55. Chattopadhyay, M., D. Wolfe, S. H. Huang, J. Goss, J. C. Glorioso, M. Mata, and D. J. Fink 2002. In vivo gene therapy for pyridoxine-induced neuropathy by herpes simplex virus-mediated gene tran sfer of neurotrophin-3. Ann of Neurol. 51 :19-27. 56. Chen, H., L. Teng, J. N. Li, R. Park, D. E. Mold, J. Gnabre, J. R. Hwu, W. N. Tseng, and R. C. Huang 1998. Antiviral activit ies of methylated nordihydroguaiaretic acids. 2. Targeting he rpes simplex virus replication by the mutation insensitive transc ription inhibitor tetraO-methyl-NDGA. J Med Chem 41 :3001-3007. 57. Chen, P. Y. and G. Meister 2005. MicroRNA-guided posttr anscriptional gene regulation. Biol Chem. 386 :1205-1218. 58. Chen, S. H., D. A. Garber, P. A. Sc haffer, D. M. Knipe, and D. M. Coen 2000. Persistent elevated expressi on of cytokine transcripts in ganglia latently infected with herpes simplex virus in the absence of ganglionic replication or reactivation. Virology 278 :207-216. 59. Chen, S. H., M. F. Kramer, P. A. Schaffer, and D. M. Coen 1997. A viral function represses accumulation of transc ripts from productive-cycle genes in mouse ganglia latently infected with herpes simplex virus. J Virol. 71 :5878-5884. 60. Chen, S. H., L. Y. Lee, D. A. Garber, P. A. Schaffer, D. M. Knipe, and D. M. Coen 2002. Neither LAT nor open reading frame P mutations increase expression of spliced or intron-containing ICP0 tran scripts in mouse ganglia latently infected with herpes simplex virus. J Virol. 76 :4764-4772. 61. Chen, Y., C. Scieux, V. Garrait, G. Socie, V. Rocha, J. M. Molina, D. Thouvenot, F. Morfin, L. Hocqueloux, L. Garderet, H. Esperou, F. Selimi, A. Devergie, G. Leleu, M. Aymard, F. Morinet, E. Gluckman, and P. Ribaud 1999. Acyclovir (ACV)and/or foscarnet (PFA)-resistant herpes simplex virus type 1 (HSV-1) infection: An emergi ng concern after allogeneic stem cell transplantation (SCT). Blood 94 :335A. 62. Chen, Y., C. Scieux, V. Garrait, G. Socie, V. Rocha, J. M. Molina, D. Thouvenot, F. Morfin, L. Hocqueloux, L. Garderet, H. Esperou, F. Selimi, A. Devergie, G. Leleu, M. Aymard, F. Morinet, E. Gluckman, and P. Ribaud 2000. Resistant herpes simplex virus type 1 infection: An emerging concern after allogeneic stem cell transp lantation. Clin Infect Dis. 31 :927-935. 63. Chilukuri, S. and T. Rosen 2003. Management of acyclovir-resistant herpes simplex virus. Dermatol Clin. 21 :311-320. 64. Chiocca, E. A., B. B. Choi, W. Z. Cai, N. A. DeLuca, P. A. Schaffer, M. DiFiglia, X. O. Breakefield, and R. L. Martuza 1990. Transfer and expression of the lacZ gene in rat brain neurons me diated by herpes simplex virus mutants. New Biol 2:739-746.

PAGE 194

178 65. Chou, J. and B. Roizman 1992. The gamma-134.5 gene of herpes-simplex virus-1 precludes neuroblastoma-cells fr om triggering total shutoff of proteinsynthesis characteristic of programmed cell-death in neuronal cells. Proc. Natl. Acad. Sci. U. S. A. 89 :3266-3270. 66. Christophers, J., J. Clayton, J. Craske, R. Ward, P. Collins, M. Trowbridge, and G. Darby 1998. Survey of resistance of herp es simplex virus to acyclovir in northwest England. Antimicrob Agents and Chemother. 42 :868-872. 67. Cobaleda, C. and I. Sanchez-Garcia 2000. In vivo inhibiti on by a site-specific catalytic RNA subunit of RNase P designed against the BCR-ABL oncogenic products: a novel approach for cancer treatment. Blood 95 :731-737. 68. Coen, D. M. and P. A. Schaffer 1980. Two distinct loci confer resistance to acycloguanosine in herpes simplex virus type 1. Proc. Natl. Acad. Sci. U. S. A 77 :2265-2269. 69. Collins, P. and M. N. Ellis 1993. Sensitivity monitoring of clinical isolates of herpes-simplex virus to acy clovir. J Med Virol. 58-66. 70. Collum, L. M. T. 1989. Acyclovir Therapy for Herpesvirus Infection of the Eye In D. A. Baker (ed.), Acyclovir therapy fo r herpesvirus infections. New York : M. Dekker, New York. 71. Collum, L. M. T., P. Mcgettrick, J. Akhtar, J. Lavin, and P. J. Rees 1986. Oral acyclovir (Zovirax) in herpes-simplex dendritic corneal ulceration. Br J Ophthalmol. 70 :435-438. 72. Compel, P. and N. A. DeLuca 2003. Temperature-dependent conformational changes in herpes simplex virus ICP4 that affect transcripti on activation. J. Virol. 77 :3257-3268. 73. Costa, M. and F. Michel 1995. Frequent use of the same tertiary motif by selffolding RNAs. EMBO J 14 :1276-1285. 74. Costanzo, F., G. Campadelli-Fiume L. Foa-Tomasi, and E. Cassai 1977. Evidence that herpes simplex viru s DNA is transcribed by cellular RNA polymerase B. J. Virol. 21 :996-1001. 75. Courtney, R. J. and M. Benyesh-Melnick 1974. Isolation and characterization of a large molecular-weight polypeptide of herpes simplex virus type 1. Virology 62 :539-551. 76. Couture, L. A. and D. T. Stinchcomb 1996. Anti-gene therapy: the use of ribozymes to inhibit gene function. Trends Genet 12 :510-515.

PAGE 195

179 77. Crumpacker, C. 2001. Antiviral agents, p. 393-433. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, and B. Roizman (eds.), Fields Virology. Lippincott Williams a nd Wilkins, Philadelphia. 78. Crumpacker, C. S., L. E. Schnipper, S. I. Marlowe, P. N. Kowalsky, B. J. Hershey, and M. J. Levin 1982. Resistance to antiviral drugs of herpes simplex virus isolated from a patient treate d with acyclovir. N. Engl. J. Med. 306 :343-346. 79. Da, C., X, M. F. Kramer, J. Zhu, M. A. Brockman, and D. M. Knipe 2000. Construction, phenotypic analysis, a nd immunogenicity of a UL5/UL29 double deletion mutant of herpes simplex virus 2. J. Virol. 74 :7963-7971. 80. Daheshia, M., S. Kanangat, and B. T. Rouse 1998. Production of key molecules by ocular neutrophils early afte r herpetic infection of the cornea. Exp. Eye Res. 67 :619-624. 81. Dai-Ju, J. Q., L. Li, L. A. Jo hnson, and R. M. Sandri-Goldin 2006. ICP27 interacts with the C-terminal domain of RNA polymerase II and facilitates its recruitment to herpes simplex virus 1 transcription sites, where it undergoes proteasomal degradation during infection. J. Virol. 80 :3567-3581. 82. Davar, G., M. F. Kramer, D. Garber, A. L. Roca, J. K. Andersen, W. Bebrin, D. M. Coen, M. Kosz-Vnenchak, D. M. Knipe, X. O. Breakefield, et al. 1994. Comparative efficacy of expression of ge nes delivered to mouse sensory neurons with herpes virus vectors. J. Comp Neurol. 339 :3-11. 83. Davidson, B. L., C. S. Stein, J. A. He th, I. Martins, R. M. Kotin, T. A. Derksen, J. Zabner, A. Ghodsi, and J. A. Chiorini 2000. Recombinant adenoassociated virus type 2, 4, and 5 vectors: Transduction of variant cell types and regions in the mammalian central nervous sy stem. Proc. Natl. Acad. Sci. U. S. A. 97 :3428-3432. 84. Davison, A. J. and J. E. Scott 1986. The Complete Dna-Sequence of VaricellaZoster Virus. J Gen Virol. 67 :1759-1816. 85. Decman, V., M. L. Freeman, P. R. Kinchington, and R. L. Hendricks 2005. Immune control of HSV-1 latency. Viral Immunol. 18 :466-473. 86. DelloRusso, C., J. M. Scott, D. Hartigan-O'Connor, G. Salvatori, C. Barjot, A. S. Robinson, R. W. Crawford, S. V. Brooks, and J. S. Chamberlain 2002. Functional correction of a dult mdx mouse muscle using gutted adenoviral vectors expressing full-length dystrophin. Pr oc. Natl. Acad. Sci. U. S. A. 99 :12979-12984. 87. DeLuca, N. A., A. M. McCarthy, and P. A. Schaffer 1985. Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulat ory protein ICP4. J. Virol. 56 :558-570.

PAGE 196

180 88. DeLuca, N. A. and P. A. Schaffer 1985. Activation of i mmediate-early, early, and late promoters by temperature-sens itive and wild-type forms of herpes simplex virus type 1 protein ICP4. Mol. Cell Biol. 5 :1997-2008. 89. Deshpande, S. P., S. Lee, M. Zheng, B. Song, D. Knipe, J. A. Kapp, and B. T. Rouse 2001. Herpes simplex virus-induced ke ratitis: evaluation of the role of molecular mimicry in lesion pathogenesis. J. Virol. 75 :3077-3088. 90. Dias, N. and C. A. Stein 2002. Antisense oligonucleot ides: Basic concepts and mechanisms. Mol Cancer Ther. 1 :347-355. 91. Dixon, R. A. and P. A. Schaffer 1980. Fine-structure mapping and functional analysis of temperature-sensitive mutants in the gene encoding the herpes simplex virus type 1 immediate ear ly protein VP175. J. Virol. 36 :189-203. 92. Dobson, A. T., T. P. Margolis, F. Sedarati, J. G. Stevens, and L. T. Feldman 1990. A latent, nonpathogenic HSV-1-derive d vector stably expresses betagalactosidase in mouse neurons. Neuron 5 :353-360. 93. Dorsett, Y. and T. Tuschl 2004. siRNAs: applications in functional genomics and potential as therapeutics. Nat Rev Drug Discov. 3 :318-329. 94. Drenser, K. A., A. M. Timmers, W. W. Hauswirth, and A. S. Lewin 1998. Ribozyme-targeted destruction of RNA associated with autosomal-dominant retinitis pigmentosa. I nvest Ophthalmol Vis Sci 39 :681-689. 95. Eckstein, F. 1998. Searching for the ideal partner. Nat Biotechnol 16 :24. 96. Ehrhardt, A. and M. A. Kay 2002. A new adenoviral helper-dependent vector results in long-term therapeutic levels of human coagulation factor IX at low doses in vivo. Blood 99 :3923-3930. 97. Eljarrat-Binstock, E., F. Raisk up, J. Frucht-Pery, and A. J. Domb 2004. Hydrogel probe for iontophoresis drug deliv ery to the eye. J. Biomater. Sci. Polym. Ed 15 :397-413. 98. Eljarrat-Binstock, E., F. Raisk up, J. Frucht-Pery, and A. J. Domb 2005. Transcorneal and transscleral iontophor esis of dexamethasone phosphate using drug loaded hydrogel. J. Control Release 106 :386-390. 99. Eljarrat-Binstock, E., F. Raiskup, D. Stepensky, A. J. Domb, and J. FruchtPery 2004. Delivery of gentamicin to th e rabbit eye by drug-loaded hydrogel iontophoresis. Invest Ophthalmol. Vis. Sci. 45 :2543-2548. 100. Ellison, A. R., L. Yang, A. V. Cevallos, and T. P. Margolis 2003. Analysis of the herpes simplex virus type 1 UL6 ge ne in patients with stromal keratitis. Virology 310 :24-28.

PAGE 197

181 101. Everett, R. D. 1984. Trans activation of transcription by herpes virus products: requirement for two HSV-1 immediate-ear ly polypeptides for maximum activity. EMBO J. 3 :3135-3141. 102. Feenstra, R. P. G. and S. C. G. Tseng 1992. Comparison of Fluorescein and Rose-Bengal Staining. Ophthalmology 99 :605-617. 103. Feldman, L. T., A. R. Ellison, C. C. Voytek, L. Yang, P. Krause, and T. P. Margolis 2002. Spontaneous molecular reactiva tion of herpes simplex virus type 1 latency in mice. Proc. Natl. Acad. Sci. U. S. A. 99 :978-983. 104. Field, H. J. 2001. Herpes simplex virus antivira l drug resistance current trends and future prospects. J Clin Virol. 21 :261-269. 105. Foster, T. P., J. M. Melancon, J. D. Baines, and K. G. Kousoulas 2004. The herpes simplex virus type 1 UL20 prot ein modulates membrane fusion events during cytoplasmic virion morphogenesis and virus-induced cell fusion. J. Virol. 78 :5347-5357. 106. Frampton, A. R., W. F. Goins, K. Naka no, E. A. Burton, and J. C. Glorioso 2005. HSV trafficking and development of ge ne therapy vectors with applications in the nervous system. Gene Ther. 12 :891-901. 107. Fruh, K., K. Ahn, H. Djaballah, P. Sempe, P. M. van Endert, R. Tampe, P. A. Peterson, and Y. Yang 1995. A viral inhibitor of pep tide transporters for antigen presentation. Nature 375 :415-418. 108. Fuchs, W., B. G. Klupp, H. Granzow, and T. C. Mettenleiter 1997. The UL20 gene product of pseudorabies virus f unctions in virus egress. J. Virol. 71 :56395646. 109. Fujihara, T. and K. Hayashi 1995. Lactoferrin Inhibits Herpes-Simplex Virus Type-1 (Hsv-1) Infection to Mouse Cornea. Arch Virol. 140 :1469-1472. 110. Gaffney, D. F., J. Mclauchlan, J. L. Whitton, and J. B. Clements 1985. A modular system for the assay of transcri ption regulatory si gnals: the sequence TAATGARAT is required for herpes si mplex virus immediate early gene activation. Nucleic Acids Res. 13 :7847-7863. 111. Gangarosa, L. P., N. H. Park, C. A. Wiggins, and J. M. Hill 1980. Increased penetration of nonelectrolytes into m ouse skin during iontophoretic water transport (iontohydrokinesis). J. Pharmacol. Exp. Ther. 212 :377-381. 112. Gao, G. P., M. R. Alvira, L. L. Wang, R. Calcedo, J. Johnston, and J. M. Wilson 2002. Novel adeno-associated viruse s from rhesus monkeys as vectors for human gene therapy. Proc. Natl Acad Sci U. S. A. 99 :11854-11859.

PAGE 198

182 113. Gao, G. P., L. H. Vandenberghe, M. R. Al vira, Y. Lu, R. Calcedo, X. Y. Zhou, and J. A. Wilson 2004. Clades of adeno-associated viruses are widely disseminated in human tissues. J Virol. 78 :6381-6388. 114. Gelman, I. H. and S. Silverstein 1987. Dissection of i mmediate-early gene promoters from herpes simplex virus: sequences that respond to the virus transcriptional activators. J Virol. 61 :3167-3172. 115. Gerber, S. I., B. J. Belval, and B. C. Herold 1995. Differences in the role of glycoprotein C of HSV-1 and HSV-2 in vira l binding may contribute to serotype differences in cell tropism. Virology 214 :29-39. 116. Gesteland, R. F., T. R. Cech, and J. F. J. F. Atkins 2006. The RNA World: the nature of modern RNA suggests a prebiotic RNA world. Cold Spring Harbor, N.Y. : Cold Spring Harbor Laborator y Press, c2006., Cold Spring Harbor. 117. Ghazizadeh, S., A. B. Katz, R. Harrington, and L. B. Taichman 2004. Lentivirus-mediated gene transfer to hu man epidermis. J. Investig. Dermatol. Symp. Proc. 9 :269-275. 118. Ghiasi, H., S. Cai, S. Slanina, A. B. Nesburn, and S. L. Wechsler 1997. Nonneutralizing antibody against the glycopr otein K of herpes simplex virus type1 exacerbates herpes simplex virus type -1-induced corneal sc arring in various virus-mouse strain combinations. Invest Ophthalmol. Vis. Sci. 38 :1213-1221. 119. Goins, W. F., K. A. Lee, J. D. Cavalcoli, M. E. O'Malley, S. T. DeKosky, D. J. Fink, and J. C. Glorioso 1999. Herpes simplex virus type 1 vector-mediated expression of nerve growth factor prot ects dorsal root ganglion neurons from peroxide toxicity. J Virol. 73 :519-532. 120. Goins, W. F., N. Yoshimura, M. W. Phel an, T. Yokoyama, M. O. Fraser, H. Ozawa, N. Bennett, W. C. de Groat, J. C. Glorioso, and M. B. Chancellor 2001. Herpes simplex virus mediated nerve growth factor expression in bladder and afferent neurons: Potential treatment for diabetic bladder dysfunction. J Urol. 165 :1748-1754. 121. Gordon, Y. J., D. M. Gilden, and Y. Becker 1983. HSV-1 thymidine kinase promotes virulence and latency in the mouse. Invest Ophthalmol. Vis. Sci. 24 :599-602. 122. Gordon, Y. J., E. Romanowski, T. Araullo-Cruz, and J. L. McKnight 1991. HSV-1 corneal latency. Invest Ophthalmol Vis Sci 32 :663-665. 123. Goss, J. R., M. Mata, W. F. Goins, H. H. Wu, J. C. Glorioso, and D. J. Fink 2001. Antinociceptive effect of a genomic herpes simplex virus-based vector expressing human proenkephalin in ra t dorsal roof ganglion. Gene Ther. 8 :551556.

PAGE 199

183 124. Grandi, P., S. Wang, D. Schuback, V. Kr asnykh, M. Spear, D. T. Curiel, R. Manservigi, and X. O. Breakefield 2004. HSV-1 virions engineered for specific binding to cell surface receptors. Mol Ther. 9 :419-427. 125. Grau, D. R., R. J. Visalli, and C. R. Brandt 1989. Herpes simplex virus stromal keratitis is not titer-dependent a nd does not correlate with neurovirulence. Invest Ophthalmol. Vis. Sci. 30 :2474-2480. 126. Green, M. R. 2000. TBP-associated factors (TAFIIs): multiple, selective transcriptional mediators in comm on complexes. Trends Biochem Sci 25 :59-63. 127. Grimm, D., M. A. Kay, and J. A. Kleinschmidt 2003. Helper virus-free, optically controllable, and two-plasmi d-based production of adeno-associated virus vectors of serotypes 1 to 6. Mol Ther. 7 :839-850. 128. Gu, B., R. Rivera-Gonzalez, C. A. Smith, and N. A. DeLuca 1993. Herpes simplex virus infected cell polypeptide 4 preferentially represses Sp1-activated over basal transcription from its own prom oter. Proc. Natl. Acad. Sci. U. S. A 90 :9528-9532. 129. Guerrier-Takada, C., K. Gardiner, T. Marsh, N. Pace, and S. Altman 1983. The RNA moiety of ribonuclease P is th e catalytic subunit of the enzyme. Cell 35 :849-857. 130. Hadaczek, P., H. Mirek, J. Bringas, and K. Bankiewicz 2003. Basic fibroblast growth factor enhances transduction, di stribution and axonal transport of adenoassociated virus (AAV-2) vector in the rat brain. Mol Ther. 7 :S44-S45. 131. Haefeli, W. E., R. A. Schoenenberger, P. Weiss, and R. F. Ritz 1993. Acyclovir-induced neurotoxicity: concen tration-side effect relationship in acyclovir overdose. Am. J. Med. 94 :212-215. 132. Halford, W. P., B. M. Gebhardt, and D. J. Carr 1996. Persistent cytokine expression in trigeminal ganglion latently infected with herpes simplex virus type 1. J Immunol. 157 :3542-3549. 133. Hao, S. L., M. Mata, D. Wolfe, S. H. Huang, J. C. Glorioso, and D. J. Fink 2003. HSV-mediated gene transfer of the glial cell-derived ne urotrophic factor provides an antiallodynic effect on neuropathic pain. Mol Ther. 8 :367-375. 134. Hardy, S., M. Kitamura, T. Harris-Stansil, Y. Dai, and M. L. Phipps 1997. Construction of adenovirus vectors th rough Cre-lox recombination. J. Virol. 71 :1842-1849.

PAGE 200

184 135. Hatama, S., H. K. Jang, Y. Izumiya, J. S. Cai, Y. Tsushima, K. Kato, T. Miyazawa, C. Kai, E. Takahashi, and T. Mikami 1999. Identification and DNA sequence analysis of the Marek' s disease virus serotype 2 genes homologous to the herpes simplex virus type 1 UL20 and UL21. J. Vet. Med. Sci. 61 :587-593. 136. Hauck, B., L. Chen, and W. D. Xiao 2003. Generation and characterization of chimeric recombinant AAV vectors. Mol Ther. 7 :419-425. 137. Hayden, B. C., M. E. Jockovich, T. G. Murray, M. Voigt, P. Milne, M. Kralinger, W. J. Feuer, E. Hernandez, and J. M. Parel 2004. Pharmacokinetics of systemic versus focal Carboplatin chemotherapy in the rabbit eye: possible implication in the treatmen t of retinoblastoma. Invest Ophthalmol. Vis. Sci. 45 :3644-3649. 138. He, J., H. Ichimura, T. Iida, M. Minami K. Kobayashi, M. Kita, C. Sotozono, Y. I. Tagawa, Y. Iwakura, and J. Imanishi 1999. Kinetics of cytokine production in the cornea and trigeminal ganglion of C57BL/6 mice after corneal HSV-1 infection. J. Interferon Cytokine Res. 19 :609-615. 139. Heidenreich, O., F. Benseler, A. Fahrenholz, and F. Eckstein 1994. HighActivity and Stability of Hammerhead Ribozymes Containing 2'-Modified Pyrimidine Nucleosides and P hosphorothioates. J Biol Chem. 269 :2131-2138. 140. Heidenreich, O., S. H. Kang, D. A. Br own, X. Xu, P. Swiderski, J. J. Rossi, F. Eckstein, and M. Nerenberg 1995. Ribozyme-Mediated Rna Degradation in Nuclei Suspension. Nucleic Acids Res. 23 :2223-2228. 141. Hellden, A., I. Odar-Cederlof, P. Diener, L. Barkholt, C. Medin, J. O. Svensson, J. Sawe, and L. Stahle 2003. High serum concentrations of the acyclovir main metabolite 9-carboxyme thoxymethylguanine in renal failure patients with acyclovir-related neuropsyc hiatric side effects: an observational study. Nephrol. Dial. Transplant. 18 :1135-1141. 142. Herold, B. C., S. I. Gerber, B. J. Belval, A. M. Siston, and N. Shulman 1996. Differences in the susceptibility of herpes simplex virus types 1 and 2 to modified heparin compounds suggest serotype di fferences in viral entry. J Virol. 70 :34613469. 143. Herold, B. C., R. J. Visalli, N. Susmarski, C. R. Brandt, and P. G. Spear 1994. Glycoprotein C-independe nt binding of herpes si mplex virus to cells requires cell surface heparan sulphate and glycoprotein B. J. Gen. Virol. 75 ( Pt 6) :1211-1222. 144. Hertel, K. J., A. Pardi, O. C. Uhlenb eck, M. Koizumi, E. Ohtsuka, S. Uesugi, R. Cedergren, F. Eckstein, W. L. Gerlach, R. Hodgson, et al. 1992. Numbering system for the ha mmerhead. Nucleic Acids Res 20 :3252.

PAGE 201

185 145. Hill, A., P. Jugovic, I. York, G. Russ, J. Bennink, J. Yewdell, H. Ploegh, and D. Johnson 1995. Herpes simplex virus turns off the TAP to evade host immunity. Nature 375 :411-415. 146. Hill, J. M., R. Wen, and W. P. Halford 1998. Pathogenesis and molecular biology of HSV latency and ocular re activation in the rabbit, p. 291-315. In S. M. Brown and A. R. Maclean (eds.), Herpes simplex virus protocols. Totowa, N.J. : Humana Press, c1998.. 147. Hilleman, M. R. and J. H. Werner 1954. Recovery of New Agent from Patients with Acute Respiratory Illne ss. Proc Soc Exp Biol Med. 85 :183-188. 148. Hirokawa, T., S. Boon-Chieng, and S. Mitaku 1998. SOSUI: classification and secondary structure prediction system for membrane protei ns. Bioinformatics 14 :378-379. 149. Hirsch, M. S. and J. C. Kaplan 1987. Antiviral therapy. Sci. Am. 256 :76-85. 150. Hirsch, M. S., J. C. Kaplan, and R. T. D'Aquila 1996. Antiviral agents, p. 431466. In B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. C. Melnick, and T. P. e. al. Monath (eds.), Fiel ds Virology. Raven Pr ess, Philadelphia. 151. Ho, S. P., Y. Bao, T. Lesher, R. Malhotra, L. Y. Ma, S. J. Fluharty, and R. R. Sakai 1998. Mapping of RNA accessible sites for antisense experiments with oligonucleotide libraries. Nat Biotechnol 16 :59-63. 152. Hofmann, K. and W. Stoffel 1993. TMbase-database of membrane spanning segments. Biol. Chem. Hoppe-Seyler166. 153. Hoggan, M. D., N. R. Blacklow, and W. P. Rowe 1966. Studies of small DNA viruses found in various adenovirus preparations: physical, biological, and immunological characteristics. Proc Natl Acad Sci U. S A. 55 :1467-1474. 154. Holland, E. J. and G. S. Schwartz 1999. Classification of herpes simplex virus keratitis. Cornea 18 :144-154. 155. Honess, R. W. and B. Roizman 1974. Regulation of herpesvirus macromolecular synthesis. I. Cascade regul ation of the synthesis of three groups of viral proteins. J. Virol. 14 :8-19. 156. Huang, Q., J. P. Vonsattel, P. A. Schaffer, R. L. Martuza, X. O. Breakefield, and M. DiFiglia 1992. Introduction of a foreign ge ne (Escherichia-Coli-Lacz) into rat neostriatal neurons using herp es-simplex virus mutants a light and electron-microscopic study. Exp Neurol. 115 :303-316. 157. Hung, S. O., A. Patterson, D. I. Clark, and P. J. Rees 1984. Oral acyclovir in the management of dendritic herpetic corneal ulceration. Br J Ophthalmol. 68 :398-400.

PAGE 202

186 158. Hutchins, C. J., P. D. Rathjen, A. C. Forster, and R. H. Symons 1986. Selfcleavage of plus and minus RNA transcript s of avocado sunblotch viroid. Nucleic Acids Res 14 :3627-3640. 159. Igarashi, T., K. Miyake, N. Suzuki, K. Kato, H. Takahashi, K. Ohara, and T. Shimada 2002. New strategy for in vivo tr ansgene expression in corneal epithelial progenitor cells. Curr. Eye Res. 24 :46-50. 160. Imperia, P. S., H. M. Lazarus, E. C. D unkel, D. Pavan-Langston, P. A. Geary, and J. H. Lass 1988. An in vitro study of ophthalm ic antiviral agent toxicity on rabbit corneal epithelium. Antiviral Res. 9 :263-272. 161. Jackson, A. L., S. R. Bartz, J. Schelter, S. V. Kobayashi, J. Burchard, M. Mao, B. Li, G. Cavet, and P. S. Linsley 2003. Expression profiling reveals offtarget gene regulation by RNAi. Nat Biotechnol 21 :635-637. 162. Jacobson, J., M. Kramer, F. Rozenberg, A. Hu, and D. M. Coen 1995. Synergistic effects on ganglionic herpes si mplex virus infections by mutations or drugs that inhibit the viral polymer ase and thymidine kinase. Virology 206 :263268. 163. Jacobson, J. G., S. H. Chen, W. J. Cook, M. F. Kramer, and D. M. Coen 1998. Importance of the herpes simplex virus UL24 gene for productive ganglionic infection in mice. Virology 242 :161-169. 164. Jarman, R. G., E. K. Wagner, and D. C. Bloom 1999. LAT expression during an acute HSV infection in the mouse. Virology 262 :384-397. 165. Jerome, K. R., Z. Chen, R. Lang, M. R. Torres, J. Hofmeister, S. Smith, R. Fox, C. J. Froelich, and L. Corey 2001. HSV and glycoprotein J inhibit caspase activation and apoptosis induced by granzyme B or Fas. J. Immunol. 167 :39283935. 166. Jerome, K. R., R. Fox, Z. Chen, A. E. Sears, H. Y. Lee, and L. Corey 1999. Herpes simplex virus inhibits apoptosis through the action of two genes, Us5 and Us3. J Virol. 73 :8950-8957. 167. Jerome, K. R., J. F. Tait, D. M. Koelle, and L. Corey 1998. Herpes simplex virus type 1 renders infected cells resi stant to cytotoxic T-lymphocyte-induced apoptosis. J. Virol. 72 :436-441. 168. Johnson, D. C. and M. T. Huber 2002. Directed egress of animal viruses promotes cell-to-cell spread. J. Virol. 76 :1-8. 169. Jugovic, P., A. M. Hill, R. Tomazin, H. Ploegh, and D. C. Johnson 1998. Inhibition of major histocompatibility comp lex class I antigen presentation in pig and primate cells by herpes simplex virus type 1 and 2 ICP47. J Virol. 72 :50765084.

PAGE 203

187 170. Kaplitt, M. G., P. Leone, R. J. Samuls ki, X. Xiao, D. W. Pfaff, K. L. Omalley, and M. J. During 1994. Long-Term Gene-Expression and Phenotypic Correction Using Adenoassociated Viru s Vectors in the Mammalian Brain. Nat Genet. 8 :148-154. 171. Kaspar, B. K., D. Erickson, D. Schaffer, L. Hinh, F. H. Gage, and D. A. Peterson 2002. Targeted retrograde gene de livery for neuronal protection. Mol Ther. 5 :50-56. 172. Kastrukoff, L. F., A. S. Lau, and M. L. Puterman 1986. Genetics of natural resistance to herpes simplex virus type 1 latent infection of the peripheral nervous system in mice. J. Gen. Virol. 67 ( Pt 4) :613-621. 173. Kaufman, H. E., A. B. Nesburn, and E. D. Maloney 1962. Idu Therapy of Herpes Simplex. Arch Ophthalmol. 67 :583-&. 174. Kaufmann, J., K. Ahrens, R. Koop, S. T. Smale, and R. Muller 1998. CIF150, a human cofactor for transcription factor IID-dependent init iator function. Mol Cell Biol 18 :233-239. 175. Keadle, T. L., N. Usui, K. A. Laycock, J. K. Miller, J. S. Pepose, and P. M. Stuart 2000. IL-1 and TNF-alpha are importa nt factors in th e pathogenesis of murine recurrent herpetic stromal kera titis. Invest Ophthalmol. Vis. Sci. 41 :96102. 176. Kean, J. M., S. A. Kipp, P. S. Miller, M. Kulka, and L. Aurelian 1995. Inhibition of herpes simplex virus replication by antisense oligo-2'-Omethylribonucleoside methylphosphonates. Biochemistry 34 :14617-14620. 177. Kiehntopf, M., E. L. Esquivel, M. A. Brach, and F. Herrmann 1995. Clinical applications of ribozymes. Lancet 345 :1027-1031. 178. Kijima, H. and K. J. Scanlon 2000. Ribozyme as an approach for growth suppression of human pancrea tic cancer. Mol Biotechnol. 14 :59-72. 179. Kim, K., P. Trang, S. Umam oto, R. Hai, and F. Liu 2004. RNase P ribozyme inhibits cytomegalovirus re plication by blocking the e xpression of viral capsid proteins. Nucleic Acids Res. 32 :3427-3434. 180. Kim, K., S. Umamoto, P. Tr ang, R. Hai, and F. Liu 2004. Intracellular expression of engineered RNase P ribozym es effectively blocks gene expression and replication of human cytomegalovirus. RNA. 10 :438-447. 181. Kimberlin, D. W., D. M. Coen, K. K. Biron, J. I. Cohen, R. A. Lamb, M. Mckinlay, E. A. Emini, and R. J. Whitley 1995. Molecular mechanisms of antiviral resistance. Antiviral Res. 26 :369-401.

PAGE 204

188 182. Kintner, R. L. and C. R. Brandt 1995. The effect of viral inoculum level and host age on disease incidence, disease seve rity, and mortality in a murine model of ocular HSV-1 infection. Curr Eye Res 14 :145-152. 183. Klebe, S., P. J. Sykes, D. J. Coster, R. Krishnan, and K. A. Williams 2001. Prolongation of sheep corneal allograft su rvival by ex vivo transfer of the gene encoding interleukin-10. Transplantation 71 :1214-1220. 184. Klein, R. L., E. M. Meyer, A. L. Peel, S. Zolotukhin, C. Meyers, N. Muzyczka, and M. A. King 1998. Neuron-specific transducti on in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp Neurol. 150 :183-194. 185. Klupp, B. G., H. Kern, and T. C. Mettenleiter 1992. The virulencedetermining genomic BamHI fragment 4 of pseudorabies virus contains genes corresponding to the UL15 (partial), UL18, UL19, UL20, and UL21 genes of herpes simplex virus and a putative origin of replication. Virology 191 :900-908. 186. Knipe, D. M. 1989. The role of viral and cellula r nuclear proteins in herpessimplex virus-replication. Adv Virus Res. 37 :85-123. 187. Knipe, D. M., W. T. Ruyechan, B. Roizman, and I. W. Halliburton 1978. Molecular genetics of herpes simplex virus: demonstration of regions of obligatory and nonobligatory identity with in diploid regions of the genome by sequence replacement and insertion. Proc. Natl. Acad. Sci. U. S. A 75 :3896-3900. 188. Knipe, D. M. D. M. 1., P. M. Howley, and D. E. Griffin 2001. Fundamental virology / editors-in-chief, David M. Knip e, Peter M. Howley ; associate editors, Diane E. Griffin ... [et al.]. Philadelphia : Lippincott Williams & Wilkins, Philadelphia. 189. Koelle, D. M., S. N. Reymond, H. B. Chen, W. W. Kwok, C. McClurkan, T. Gyaltsong, E. W. Petersdorf, W. Rotkis, A. R. Talley, and D. A. Harrison 2000. Tegument-specific, virus-reactive CD4 T cells localize to the cornea in herpes simplex virus interstitial keratitis in humans. J Virol. 74 :10930-10938. 190. Kotin, R. M., R. M. Linden, and K. I. Berns 1992. Characterization of a preferred site on human chromosome-19q for integration of adenoassociated virus-DNA by nonhomologous recombination. EMBO J. 11 :5071-5078. 191. Kramer, M. F. and D. M. Coen 1995. Quantification of Transcripts from the Icp4 and Thymidine Kinase Genes in M ouse Ganglia Latently Infected with Herpes-Simplex Virus. J Virol. 69 :1389-1399. 192. Kristie, T. M., J. H. LeBowitz, and P. A. Sharp 1989. The octamer-binding proteins form multi-protein--DNA comple xes with the HSV alpha TIF regulatory protein. EMBO J. 8 :4229-4238.

PAGE 205

189 193. Kristie, T. M. and B. Roizman 1986. DNA-binding site of major regulatory protein alpha 4 specifically associated w ith promoter-regulatory domains of alpha genes of herpes simplex virus type 1. Proc. Natl. Acad. Sci. U. S. A 83 :4700-4704. 194. Kristie, T. M. and B. Roizman 1987. Host cell proteins bind to the cis-acting site required for virion-mediated induction of herpes simplex virus 1 alpha genes. Proc. Natl. Acad. Sci. U. S. A 84 :71-75. 195. Kristie, T. M. and B. Roizman 1988. Differentiation and DNA contact points of host proteins binding at the cis site for virion-mediated induc tion of alpha genes of herpes simplex virus 1. J. Virol. 62 :1145-1157. 196. Krummenacher, C., A. V. Nicola, J. C. Whitbeck, H. Lou, W. F. Hou, J. D. Lambris, R. J. Geraghty, P. G. Spear, G. H. Cohen, and R. J. Eisenberg 1998. Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrel ated mediators of virus entry. J Virol. 72 :7064-7074. 197. Krummenacher, C., A. H. Rux, J. C. Whit beck, M. Ponce-De-Leon, H. Lou, I. Baribaud, W. F. Hou, C. H. Zou, R. J. G eraghty, P. G. Spear, R. J. Eisenberg, and G. H. Cohen 1999. The first immunoglobulinlike domain of HveC is sufficient to bind herpes simplex virus gD with full affinity, while the third domain is involved in oligom erization of HveC. J Virol. 73 :8127-8137. 198. Kuddus, R., B. Gu, and N. A. DeLuca 1995. Relationship between TATAbinding protein and herpes simplex viru s type 1 ICP4 DNA-binding sites in complex formation and repression of transcription. J. Virol. 69 :5568-5575. 199. Kulka, M., M. Wachsman, S. Miura, R. Fish elevich, P. S. Miller, P. O. P. Tso, and L. Aurelian 1993. Antiviral effect of olig o(nucleoside methylphosphonates) complementary to the herpes-simplex virus type-1 immediate early messenger RNA-4 and messenger RNA-5. Antiviral Res. 20 :115-130. 200. Kumar, P. K., Y. A. Suh, H. Miyashir o, F. Nishikawa, J. Kawakami, K. Taira, and S. Nishikawa 1992. Random mutations to evaluate the role of bases at two important single-stranded regions of ge nomic HDV ribozyme. Nucleic Acids Res 20 :3919-3924. 201. Kuwabara, T., M. Warashina, T. Tanabe, K. Tani, S. Asano, and K. Taira 1998. A novel allosterically trans-activat ed ribozyme, the maxizyme, with exceptional specificity in vitro and in vivo. Mol Cell 2 :617-627. 202. Kwon, B. S., L. P. Gangarosa, K. D. Burch, J. Deback, and J. M. Hill 1981. Induction of Ocular Herpes-Simplex Virus Shedding by Iontophoresis of Epinephrine Into Rabbit Cornea. Invest Ophthalmol. Vis. Sci. 21 :442-449.

PAGE 206

190 203. Lafferty, W. E., R. W. Coombs, J. Bene detti, C. Critchlow, and L. Corey 1987. Recurrences after oral a nd genital herpes simplex virus infection. Influence of site of infection and viral type. N Engl J Med 316 :1444-1449. 204. Lambowitz, A. M. and M. Belfort 1993. Introns as mobile genetic elements. Annu Rev Biochem 62 :587-622. 205. Lang, A. and J. Nikolich-Zugich 2005. Dcvelopment and migration of protective CD8(+) T cells into the ne rvous system following ocular herpes simplex virus-1 infection. J Immunol. 174 :2919-2925. 206. Laquerre, S., D. B. Anderson, D. B. Stolz, and J. C. Glorioso 1998. Recombinant herpes simplex virus type 1 engineered for targeted binding to erythropoietin recepto r-bearing cells. J Virol. 72 :9683-9697. 207. Laquerre, S., R. Argnani, D. B. Anderson, S. Zucchini, R. Manservigi, and J. C. Glorioso 1998. Heparan sulfate proteoglycan binding by herpes simplex virus type 1 glycoproteins B and C, which di ffer in their contributions to virus attachment, penetration, and cell-to-cell sp read. J Virol. 72 :6119-6130. 208. Larkin, D. F., H. B. Oral, C. J. Ring, N. R. Lemoine, and A. J. George 1996. Adenovirus-mediated gene delivery to th e corneal endothelium. Transplantation 61 :363-370. 209. Larralde, O., R. W. P. Smith, G. S. Wilkie, P. Malik, N. K. Gray, and J. B. Clements 2006. Direct stimulation of translation by the multifunctional herpesvirus ICP27 protein. J Virol. 80 :1588-1591. 210. Lass, J. H., R. H. Langston, C. S. Foster, and D. Pavan-Langston 1984. Antiviral medications and corn eal wound healing. Antiviral Res. 4 :143-157. 211. Lass, J. H., D. Pavan-Langston, and N. H. Park 1979. Acyclovir and corneal wound healing. Am. J. Ophthalmol. 88 :102-108. 212. Lewin, A. S., K. A. Drenser, W. W. Haus wirth, S. Nishikaw a, D. Yasumura, J. G. Flannery, and M. M. LaVail 1998. Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosoma l dominant retinitis pigmentosa. Nat Med 4 :967-971. 213. Lewin, A. S. and W. W. Hauswirth 2001. Ribozyme gene therapy: applications for molecular medicine. Trends Mol. Med. 7 :221-228. 214. Lewis, P., M. Hensel, and M. Emerman 1992. Human immunodeficiency virus infection of cells arrested in the cell cycle. EMBO J. 11:3053-3058.

PAGE 207

191 215. Li, Z., J. Dullmann, B. Schiedlmeier, M. Schmidt, C. von Kalle, J. Meyer, M. Forster, C. Stocking, A. Wahlers, O. Fr ank, W. Ostertag, K. Kuhlcke, H. G. Eckert, B. Fehse, and C. Baum 2002. Murine leukemia induced by retroviral gene marking. Science 296 :497. 216. Lieber, A., C. Y. He, S. J. Polyak, D. R. Gretch, D. Ba rr, and M. A. Kay 1996. Elimination of hepatitis C virus RNA in infected human hepatocytes by adenovirus-mediated expression of ribozymes. J Virol. 70 :8782-8791. 217. Liesegang, T. J. 1999. Classification of herpes simplex virus keratitis and anterior uveitis. Cornea 18 :127-143. 218. Liesegang, T. J. 2001. Herpes simplex virus epidemiology and ocular importance. Cornea 20 :1-13. 219. Liesegang, T. J., L. J. Melton, P. J. Daly, and D. M. Ilstrup 1989. Epidemiology of ocular herpes-simplex incidence in Rochester, Minn, 1950 through 1982. Arch Ophthalmol. 107 :1155-1159. 220. Lilley, C. E., F. Groutsi, Z. Q. Han, J. A. Palmer, P. N. Anderson, D. S. Latchman, and R. S. Coffin 2001. Multiple immediateearly gene-deficient herpes simplex virus vectors allowing effi cient gene delivery to neurons in culture and widespread gene delivery to the central nervous system in vivo. J Virol. 75 :4343-4356. 221. Liu, F. Y. and S. Altman 1995. Inhibition of viral gene-expression by the catalytic RNA subunit of RNase-P fr om Escherichia-Coli. Genes Dev. 9 :471-480. 222. Liu, T., Q. H. Tang, and R. L. Hendricks 1996. Inflammatory infiltration of the trigeminal ganglion after herpes simplex virus type 1 corneal infection. J Virol. 70 :264-271. 223. Lopez, C. 1975. Genetics of Natural Resistance to Herpesvirus Infections in Mice. Nature 258 :152-153. 224. Lundberg, P., P. Welander, H. Openshaw C. Nalbandian, C. Edwards, L. Moldawer, and E. Cantin 2003. A locus on mouse chromosome 6 that determines resistance to herpes simplex virus also influences reactivation, while an unlinked locus augments resistance of female mice. J. Virol. 77 :11661-11673. 225. Macejak, D. G., K. L. Jensen, S. F. Jam ison, K. Domenico, E. C. Roberts, N. Chaudhary, I. von Carlowitz, L. Bellon, M. J. Tong, A. Conrad, P. A. Pavco, and L. M. Blatt 2000. Inhibition of hepatitis C virus (HCV)-RNA-dependent translation and replication of a chimeric HCV poliovirus using synthetic stabilized ribozymes. Hepatology 31 :769-776.

PAGE 208

192 226. Mackem, S. and B. Roizman 1980. Regulation of herpesvirus macromolecular synthesis: transcription-initiation sites and domains of alpha genes. Proc. Natl. Acad. Sci. U. S. A 77 :7122-7126. 227. Mackem, S. and B. Roizman 1982. Differentiation betw een alpha promoter and regulator regions of herpes simplex viru s 1: the functional domains and sequence of a movable alpha regulator. Pr oc. Natl. Acad. Sci. U. S. A 79 :4917-4921. 228. Mackem, S. and B. Roizman 1982. Structural features of the herpes simplex virus alpha gene 4, 0, and 27 promoter-re gulatory sequences which confer alpha regulation on chimeric thymidine kinase genes. J. Virol. 44 :939-949. 229. Maggs, D. J., E. Chang, M. P. Nasisse, and W. J. Mitchell 1998. Persistence of herpes simplex virus type 1 DNA in chr onic conjunctival and eyelid lesions of mice. J Virol. 72 :9166-9172. 230. Maheshri, N., J. T. Koerber, B. K. Kaspar, and D. V. Schaffer 2006. Directed evolution of adeno-associated virus yiel ds enhanced gene de livery vectors. Nat Biotechnol. 24 :198-204. 231. Manoj, S., C. R. Jogger, D. Myscofski, M. Yoon, and P. G. Spear 2004. Mutations in herpes simplex virus glyc oprotein D that prevent cell entry via nectins and alter cell tropism. Proc. Natl. Acad. Sci. U. S. A. 101 :12414-12421. 232. Marshall, K. R., R. H. Lachmann, S. Efstathiou, A. Rinaldi, and C. M. Preston 2000. Long-term transgene expression in mice infected with a herpes simplex virus type 1 mutant severely impaired for immediate-early gene expression. J Virol. 74 :956-964. 233. Mata, M., M. D. Zhang, X. P. Hu, and D. J. Fink 2001. HveC (nectin-1) is expressed at high levels in sensory neur ons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7 :476-480. 234. Mccown, T. J., X. Xiao, J. Li, G. R. Breese, and R. J. Samulski 1996. Differential and persistent expression pa tterns of CNS gene transfer by an adenoassociated virus (AAV) vector. Brain Res. 713 :99-107. 235. Medici, M. A., M. T. Sciortino, D. Perri, C. Amici, E. Avitabile, M. Ciotti, E. Balestrieri, E. De Smaele, G. Franzoso, and A. Mastino 2003. Protection by herpes simplex virus glycoprotein D agai nst Fas-mediated apoptosis Role of nuclear factor kappa B. J Biol Chem. 278 :36059-36067. 236. Melancon, J. M., T. P. Foster, and K. G. Kousoulas 2004. Genetic analysis of the herpes simplex virus type 1 UL20 pr otein domains involved in cytoplasmic virion envelopment and virus-induced cell fusion. J. Virol. 78 :7329-7343.

PAGE 209

193 237. Melchjorsen, J., J. Siren, K. Julkunen, S. R. Paludan, and S. Matikainen 2006. Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendr itic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-kappa B and IRF-3. J Gen Virol. 87 :1099-1108. 238. Mellerick, D. M. and N. W. Fraser 1987. Physical state of the latent herpes simplex virus genome in a mouse model sy stem: evidence suggesting an episomal state. Virology 158 :265-275. 239. Mendelsohn, C. L., E. Wimme r, and V. R. Racaniello 1989. Cellular Receptor for Poliovirus Molecular-Cloning, Nucl eotide-Sequence, and Expression of A New Member of the Immunoglobulin Superfamily. Cell 56 :855-865. 240. Metcalf, J. F. and B. A. Michaelis 1984. Herpetic keratitis in inbred mice. Invest Ophthalmol. Vis. Sci. 25 :1222-1225. 241. Mettenleiter, T. C. 2002. Herpesvirus assembly and egress. J. Virol. 76 :15371547. 242. Metzler, D. W. and K. W. Wilcox 1985. Isolation of herpes simplex virus regulatory protein ICP4 as a homodimeric complex. J Virol. 55 :329-337. 243. Meyers-Elliott, R. H. and P. A. Chitjian 1981. Immunopathogenesis of corneal inflammation in herpes simplex virus stromal keratitis: role of the polymorphonuclear leukocyte. In vest Ophthalmol. Vis. Sci. 20 :784-798. 244. Mian, A., M. McCormack, V. Mane, S. Kleppe, P. Ng, M. Finegold, W. E. O'Brien, J. R. Rodgers, A. L. Beaudet, and B. Lee 2004. Long-term correction of ornithine Transcarbamylase defi ciency by WPRE-mediated overexpression using a helper-dependent adenovirus. Mol Ther. 10 :492-499. 245. Miao, C. H., H. Nakai, A. R. Thompson, T. A. Storm, W. Chiu, R. O. Snyder, and M. A. Kay 2000. Nonrandom transduction of recombinant adeno-associated virus vectors in mouse hepatocytes in vivo: Cell cycling does not influence hepatocyte transduction. J Virol. 74 :3793-3803. 246. Michael, N., D. Spector, P. Mavromara-Nazos, T. M. Kristie, and B. Roizman 1988. The DNA-binding properties of the ma jor regulatory protein alpha 4 of herpes simplex viruses. Science 239 :1531-1534. 247. Michelini, F. M., J. A. Ramirez, A. Berra, L. R. Galagovsky, and L. E. Alche 2004. In vitro and in vivo antiherpetic activity of three new synthetic brassinosteroid analogues. Steroids 69 :713-720. 248. Michienzi, A., L. Cagnon, I. Bahner, and J. J. Rossi 2000. Ribozyme-mediated inhibition of HIV 1 suggests nucleolar tra fficking of HIV-1 RNA. Proc Natl Acad Sci U. S A. 97 :8955-8960.

PAGE 210

194 249. Mikloska, Z., L. Bosnjak, and A. L. Cunningham 2001. Immature monocytederived dendritic cells are productively infected with he rpes simplex virus type 1. J Virol. 75 :5958-5964. 250. Milner, N., K. U. Mir, and E. M. Southern 1997. Selecting effective antisense reagents on combinatorial oli gonucleotide arrays. Nat Biotechnol 15 :537-541. 251. Miranda-Saksena, M., P. Armati, R. A. Boadle, D. J. Holland, and A. L. Cunningham 2000. Anterograde transport of herpes simplex virus type 1 in cultured, dissociated human and rat dor sal root ganglion neurons. J Virol. 74 :1827-1839. 252. Miyazaki, D., Y. Inoue, K. Araki-Sa saki, Y. Shimomura, Y. Tano, and K. Hayashi 1998. Neutrophil chemotaxis induced by corneal epithe lial cells after herpes simplex virus type 1 infection. Curr. Eye Res. 17 :687-693. 253. Mohan, R. R., G. S. Schultz, J. W. Hong, R. R. Mohan, and S. E. Wilson 2003. Gene transfer into rabbit kera tocytes using AAV and lipid-mediated plasmid DNA vectors with a lamellar flap for stromal access. Exp Eye Res. 76 :373-383. 254. Montgomery, R. I., M. S. Warner, B. J. Lum, and P. G. Spear 1996. Herpes simplex virus-1 entry into cells mediat ed by a novel member of the TNF/NGF receptor family. Cell 87 :427-436. 255. Morfin, F. and D. Thouvenot 2003. Herpes simplex virus resistance to antiviral drugs. J Clin Virol. 26 :29-37. 256. Mori, S., L. Wang, T. Takeuchi, and T. Kanda 2004. Two novel adenoassociated viruses from cynomolgus m onkey: pseudotyping characterization of capsid protein. Virology 330 :375-383. 257. Morrison, L. A. and D. M. Knipe 1994. Immunization with ReplicationDefective Mutants of Herpes-Simplex Virus Type-1 Sites of Immune Intervention in Pathogenesis of Challenge Virus-Infection. J Virol. 68 :689-696. 258. Muller, D. B., M. J. Raftery, A. Ka ther, T. Giese, and G. SchOnrich 2004. Induction of apoptosis and modulation of c-FLIPL and p53 in immature dendritic cells infected with herpes simplex virus. Eur J Immunol. 34 :941-951. 259. Murthy, R. C., T. J. McFarland, J. Yoken, S. Chen, C. Barone, D. Burke, Y. Zhang, B. Appukuttan, and J. T. Stout 2003. Corneal transduction to inhibit angiogenesis and graft failure. Invest Ophthalmol. Vis. Sci. 44 :1837-1842. 260. Muruve, D. A., M. J. Cotter, A. K. Zaiss, L. R. White, Q. Liu, T. Chan, S. A. Clark, P. J. Ross, R. A. Meulenbroek, G. M. Maelandsmo, and R. J. Parks 2004. Helper-dependent adenovirus vectors elicit intact innate but attenuated adaptive host immune responses in vivo. J Virol. 78 :5966-5972.

PAGE 211

195 261. Muzyczka, N. and K. H. Warrington 2005. Custom adeno-associated virus capsids: The next generation of recombin ant vectors with novel tropism. Human Gene Ther. 16 :408-416. 262. Myles, M. E., J. M. Loutsch, and S. Higaki 2003. p. 365-408. In A. K. Mitra (ed.), Ophthalmic drug delivery systems. New York : Dekker, c2003., New York. 263. Neumann, J., A. M. Eis-Hubinger, and N. Koch 2003. Herpes simplex virus type 1 targets the MHC class II pro cessing pathway for immune evasion. J Immunol. 171 :3075-3083. 264. Nicola, A. V., M. P. de Leon, R. L. Xu, W. F. Hou, J. C. Whitbeck, C. Krummenacher, R. I. Montgomery, P. G. Spear, R. J. Eisenberg, and G. H. Cohen 1998. Monoclonal antibodies to distin ct sites on herpes simplex virus (HSV) glycoprotein D block HSV binding to HVEM. J Virol. 72 :3595-3601. 265. Norose, K., A. Yano, X. M. Zhang, E. Blankenhorn, and E. Heber-Katz 2002. Mapping of genes involved in murine herp es simplex virus keratitis: identification of genes and their modifiers. J. Virol. 76 :3502-3510. 266. O'Brien, W. J. and J. L. Taylor 1989. The isolation of herpes simplex virus from rabbit corneas during latenc y. Invest Ophthalmol Vis Sci 30 :357-364. 267. O'Brien, W. J., L. S. Tsao, and J. L. Taylor 1998. Tissue-specific accumulation of latency-associated transcri pts in herpes virus-infected rabbits. Invest Ophthalmol Vis Sci 39 :1847-1853. 268. O'Hare, P. and C. R. Goding 1988. Herpes simplex virus regulatory elements and the immunoglobulin octamer domain bind a common factor and are both targets for virion transactivation. Cell 52 :435-445. 269. O'Neil, J. E., J. M. Loutsch, J. S. Aguilar, J. M. Hill, E. K. Wagner, and D. C. Bloom 2004. Wide variations in herpes simp lex virus type 1 inoculum dose and latency-associated transcript expressi on phenotype do not alte r the establishment of latency in the rabbit eye model. J Virol. 78 :5038-5044. 270. Oakes, J. E., C. A. Monteiro, C. L. Cubitt, and R. N. Lausch 1993. Induction of interleukin-8 gene expre ssion is associated with herp es simplex virus infection of human corneal keratocy tes but not human corneal epithelial cells. J. Virol. 67 :4777-4784. 271. Palliser, D., D. Chowdhury, Q. Y. Wang, S. J. Lee, R. T. Bronson, D. M. Knipe, and J. Lieberman 2006. An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection. Nature 439 :89-94.

PAGE 212

196 272. Palmer, G. D., E. Gouze, J. N. Gouze, O. B. Betz, C. H. Evans, and S. C. Ghivizzani 2003. Gene transfer to articular chondrocytes with recombinant adenovirus. Methods Mol. Biol. 215 :235-246. 273. Palmer, J. A., R. H. Branston, C. E. Lilley, M. J. Robinson, F. Groutsi, J. Smith, D. S. Latchman, and R. S. Coffin 2000. Development and optimization of herpes simplex virus vectors for mu ltiple long-term gene delivery to the peripheral nervous system. J Virol. 74 :5604-5618. 274. Papworth, M., M. Moore, M. Isalan, M. Minczuk, Y. Choo, and A. Klug 2003. Inhibition of herpes simplex virus 1 gene expression by designer zinc-finger transcription factors. Proc. Natl. Acad. Sci. U. S. A 100 :1621-1626. 275. Parkinson, T. M., E. Ferguson, S. Fe bbraro, A. Bakhtyari, M. King, and M. Mundasad 2003. Tolerance of ocular iontophoresis in health y volunteers. J. Ocul. Pharmacol. Ther. 19 :145-151. 276. Paschal, B. M. and R. B. Vallee 1987. Retrograde Transport by the Microtubule-Associated Protein Map-1C. Nature 330 :181-183. 277. Pavan-Langston, D. and R. Buchanan 1976. Vidarabine therapy of simple and IDU-complicated herpetic keratitis. Trans. Sect. Ophthalmol. Am. Acad. Ophthalmol. Otolaryngol. 81 :813-825. 278. Pavco, P. A., K. S. Bouhana, A. M. Galle gos, A. Agrawal, K. S. Blanchard, S. L. Grimm, K. L. Jensen, L. E. Andrews, F. E. Wincott, P. A. Pitot, R. J. Tressler, C. Cushman, M. A. Reynolds, and T. J. Parry 2000. Antitumor and antimetastatic activity of ribozymes ta rgeting the messenger RNA of vascular endothelial growth factor re ceptors. Clin Cancer Res. 6 :2094-2103. 279. Peden, C. S., C. Burger, N. Muzyczka, and R. J. Mandel 2004. Circulating anti-wild-type adeno-associated virus type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)-mediated, but not rAAV5-mediated, gene transfer in the brain. J Virol. 78 :6344-6359. 280. Peel, A. L. and R. L. Klein 2000. Adeno-associated viru s vectors: activity and applications in the CNS. J Neurosci Methods 98 :95-104. 281. Pepose, J. S., D. A. Leib, P. M. Stuart, and D. L. Easty 1996. Herpes simplex virus diseases anterior se gment of the eye., p. 905-932. In J. S. Pepose, G. R. Holland, and K. R. Wilhelmus (eds.), Ocular infection and immunity, MosbyYear Book. St. Louis : Mosby. 282. Perabo, L., J. Endell, S. King, K. Lux, D. Goldnau, M. Hallek, and H. Buning 2006. Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated vi rus. J Gene Med. 8:155-162.

PAGE 213

197 283. Perkins, D., E. F. Pereira, and L. Aurelian 2003. The herpes simplex virus type 2 R1 protein kinase (ICP10 PK) functions as a dominant regulator of apoptosis in hippocampal neurons invol ving activation of the ERK survival pathway and upregulation of the anti apoptotic protein Bag-1. J. Virol. 77 :12921305. 284. Perkins, D., E. F. Pereira, M. Gober, P. J. Yarowsky, and L. Aurelian 2002. The herpes simplex virus type 2 R1 prot ein kinase (ICP10 PK) blocks apoptosis in hippocampal neurons, involving activ ation of the MEK/MAPK survival pathway. J. Virol. 76 :1435-1449. 285. Perng, G. C., C. Jones, J. Ciacci-Zanella, M. Stone, G. Henderson, A. Yukht, S. M. Slanina, F. M. Hofman, H. Ghiasi A. B. Nesburn, and S. L. Wechsler 2000. Virus-induced neuronal apoptosis bl ocked by the herpes simplex virus latency-associated transcript. Science 287 :1500-1503. 286. Pevenstein, S. R., R. K. Williams, D. McChesney, E. K. Mont, J. E. Smialek, and S. E. Straus 1999. Quantitation of latent varicella-zoster virus and herpes simplex virus genomes in human trigeminal ganglia. J Virol. 73 :10514-10518. 287. Pikal, M. J. 2001. The role of electroosmotic flow in transdermal iontophoresis. Adv. Drug Deliv. Rev. 46 :281-305. 288. Pollara, G., K. Speidel, L. Samady, M. Rajpopat, Y. McGrath, J. Ledermann, R. S. Coffin, D. R. Katz, and B. Chain 2003. Herpes simplex virus infection of dendritic cells: Balance among activation, inhibition, and immunity. J Infect Dis. 187 :165-178. 289. Prabhakaran, K., B. S. Sheridan, P. R. Kinchington, K. M. Khanna, V. Decman, K. Lathrop, and R. L. Hendricks 2005. Sensory neurons regulate the effector functions of CD8(+) T cells in controlling HSV-1 latency ex vivo. Immunity. 23 :515-525. 290. Prechtel, A. T., N. M. Turza, D. J. Kobelt, J. I. Eisemann, R. S. Coffin, Y. McGrath, C. Hacker, X. S. Ju, M. Zenke, and A. Steinkasserer 2005. Infection of mature dendritic cells with herpes simplex virus type 1 dramatically reduces lymphoid chemokine-mediated migration. J Gen Virol. 86 :1645-1657. 291. Rabinowitz, J. E., D. E. Bowles, S. M. Faust, J. G. Ledford, S. E. Cunningham, and R. J. Samulski 2004. Cross-dressing the virion: the transcapsidation of adeno-associated virus serotypes functionally defines subgroups. J Virol. 78 :4421-4432. 292. Rabinowitz, J. E., F. Rolling, C. W. Li, H. Conrath, W. D. Xiao, X. Xiao, and R. J. Samulski 2002. Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J Virol. 76 :791-801.

PAGE 214

198 293. Raiskup-Wolf, F., E. Eljarrat-Binstock M. Rehak, A. Domb, and J. FruchtPery 2006. Delivery of gentamicin to the rabbit eye using hydrogel and iontophoresis. Cesk. Slov. Oftalmol. 62 :175-182. 294. Rendahl, K. G., S. E. Leff, G. R. Otten, S. K. Spratt, D. Bohl, M. Van Roey, B. A. Donahue, L. K. Cohen, R. J. Mandel, O. Danos, and R. O. Snyder 1998. Regulation of gene expression in vivo following transduction by two separate rAAV vectors. Nat Biotechnol. 16 :757-761. 295. Rivera, L., R. W. Beuerman, and J. M. Hill 1988. Corneal nerves contain intra-axonal HSV-1 after virus reactivation by epin ephrine iontophoresis. Curr Eye Res. 7 :1001-1008. 296. Roelvink, P. W., A. Lizonova, J. G. Lee, Y. Li, J. M. Bergelson, R. W. Finberg, D. E. Brough, I. Kovesdi, and T. J. Wickham 1998. The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from s ubgroups A, C, D, E, and F2. J. Virol. 72 :7909-7915. 297. Roizman, B., L. E. Carmichael, F. Deinhardt, G. de The, A. J. Nahmias, W. Plowright, F. Rapp, P. Sheldrick, M. Takahashi, and K. Wolf 1981. Herpesviridae. Definition, provisional nomenclature, and taxonomy. The Herpesvirus Study Group, the Internationa l Committee on Taxonomy of Viruses. Intervirology 16 :201-217. 298. Roizman, B. and D. M. Knipe 2001., p. 2399-2440. In D. M. Knipe and P. M. Howley (eds.), Field's Virology. Lippinco tt, Williams and Wilkins, Philadelphia. 299. Roizman, B. and D. M. Knipe 2001. Herpes Simplex Viruses and Their Replication, p. 1123-1183. In D. M. K. P. M. H. Editors-in-chief and D. E. G. e. al. associate editors (eds.), Fundamental Virology/ editors-in-chief, David M. Knipe, Peter M. Howley ; associate editors Diane E. Griffin ... [et al.]. Lippincott Williams & Wilkins, c2001., Philadelphia. 300. Roller, R. J. and B. Roizman 1992. The herpes-simplex virus-1 RNA-binding protein U(S)11 is a virion component and associates with ribosomal 60s subunits. J Virol. 66 :3624-3632. 301. Rong, B. L., D. Pavan-Langston, Q. P. Weng, R. Martinez, J. M. Cherry, and E. C. Dunkel 1991. Detection of herpes simple x virus thymidine kinase and latency-associated transcript gene se quences in human herpetic corneas by polymerase chain reaction amplifica tion. Invest Ophthalmol. Vis. Sci. 32 :18081815. 302. Rowe, W. P., R. J. Huebner, L. K. Gilmore, R. H. Parrott, and T. G. Ward 1953. Isolation of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proc Soc Exp Biol Med. 84 :570-573.

PAGE 215

199 303. Saib, A., F. Puvion-Dutilleul, M. Schmid, J. Peries, and H. de The 1997. Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step. J. Virol. 71 :1155-1161. 304. Salehi-Ashtiani, K., A. Luptak, A. Litovchick, and J. W. Szostak 2006. A genomewide search for ribozymes reveals an HDV-like sequence in the human CPEB3 gene. Science 313 :1788-1792. 305. Sandri-goldin, R. M. 1994. Properties of an HSV1 regulatory protein that appears to impair host-cell splici ng. Infect Agents Dis Apr-June; 3 (2-3) :59-67. Review. 306. Sasaki, K., M. B. Chancellor, W. F. Goins, M. W. Phelan, J. C. Glorioso, W. C. de Groat, and N. Yoshimura 2004. Gene therapy using replication-defective herpes simplex virus vectors expressing ne rve growth factor in a rat model of diabetic cystopathy. Diabetes 53 :2723-2730. 307. Satoh-Horikawa, K., H. Nakanishi, K. Takahashi, M. Miyahara, M. Nishimura, K. Tachibana, A. Mizoguchi, and Y. Takai 2000. Nectin-3, a new member of immunoglobulin-like cell adhe sion molecules that shows homophilic and heterophilic cell-cell adhe sion activities. J Biol Chem. 275 :10291-10299. 308. Saville, B. J. and R. A. Collins 1990. A site-specific self-cleavage reaction performed by a novel RNA in Neurospora mitochondria. Cell 61 :685-696. 309. Sawtell, N. M. 2003. Quantitative analysis of herp es simplex virus reactivation in vivo demonstrates that reactivation in the nervous system is not inhibited at early times postinoculation. J Virol. 77 :4127-4138. 310. Saxena, S., Z. O. Jonsson, and A. Dutta 2003. Small RNAs with imperfect match to endogenous mRNA repress translation. Implications for off-target activity of small inhibitory R NA in mammalian cells. J Biol Chem 278 :4431244319. 311. Schlehofer, J. R., M. Ehrbar, and H. H. zur 1986. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervi rus dependent parvovirus. Virology 152 :110117. 312. Schmidt, M., E. Grot, P. Cervenka, S. Wainer, C. Buck, and J. A. Chiorini 2006. Identification and characterization of novel adeno-associated virus isolates in ATCC virus stocks. J Virol. 80 :5082-5085. 313. Schmidt, W. M., R. J. Schweyen, K. Wolf, and M. W. Mueller 1994. Transposable group II introns in fission and budding yeast. Site-specific genomic instabilities and formation of group II IVS plDNAs. J Mol Biol 243 :157-166.

PAGE 216

200 314. Sedarati, F., T. P. Margolis, and J. G. Stevens 1993. Latent infection can be established with drastically restricted tr anscription and replication of the HSV-1 genome. Virology 192 :687-691. 315. Shaw, L. C., A. Skold, F. Wong, R. Petters, W. W. Hauswirth, and A. S. Lewin 2001. An allele-specific hammerhead ri bozyme gene therapy for a porcine model of autosomal dominant re tinitis pigmentosa. Mol. Vis. 7 :6-13. 316. Shen, Y., S. I. Muramatsu, K. Ikeguchi, K. I. Fujimoto, D. S. Fan, M. Ogawa, H. Mizukami, M. Urabe, A. Kume, I. Nagatsu, F. Urano, T. Suzuki, H. Ichinose, T. Nagatsu, J. Monahan, I. Nakano, and K. Ozawa 2000. Triple transduction with adeno-associated virus vectors expressing tyrosine hydroxylase, aromatic-L-amino-acid decarboxylase, and GTP cyclohydrolase I for gene therapy of Parkinson's disease. Hum Gene Ther. 11 :1509-1519. 317. Shepard, A. A., P. Tolentino, and N. A. DeLuca 1990. Trans-dominant inhibition of herpes simplex virus tran scriptional regulator y protein ICP4 by heterodimer formation. J Virol. 64 :3916-3926. 318. Shimayama, T., S. Nishikawa, and K. Taira 1995. Generality of the NUX rule: kinetic analysis of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes. Biochemistry 34 :3649-3654. 319. Shimeld, C., J. L. Whiteland, S. M. Nichol ls, E. Grinfeld, D. L. Easty, H. Gao, and T. J. Hill 1995. Immune cell infiltration and persistence in the mouse trigeminal ganglion after infection of the cornea with herpes-s implex virus type-1. J Neuroimmunol. 61 :7-16. 320. Shin, Y. K., G. Y. Cai, A. Weinberg, J. J. Leary, and M. J. Levin 2001. Frequency of acyclovir-resistant herpes si mplex virus in clinical specimens and laboratory isolates. J Clin Microbiol. 39 :913-917. 321. Shukla, D., J. Liu, P. Blaiklock, N. W. Shworak, X. Bai, J. D. Esko, G. H. Cohen, R. J. Eisenberg, R. D. Rosenberg, and P. G. Spear 1999. A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry. Cell 99 :13-22. 322. Skoldenberg, B. 1991. Herpes simplex encephalitis. Scand. J Infect. Dis. Suppl 80 :40-46. 323. Skoldenberg, B. 1996. Herpes simplex encephalitis. Scand. J Infect. Dis. Suppl 100 :8-13. 324. Skoldenberg, B., E. Aurelius, A. Hjalma rsson, F. Sabri, M. Forsgren, B. Andersson, A. Linde, O. Strannegard, M. Studahl, L. Hagberg, and L. Rosengren 2006. Incidence and pathogenesis of clinical relaps e after herpes simplex encephalitis in adults. J Neurol 253 :163-170.

PAGE 217

201 325. Smith, C. C., L. Aurelian, M. P. Reddy, P. S. Miller, and P. O. Ts'o 1986. Antiviral effect of an oligo(nucleosid e methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5. Proc Natl Acad Sci U. S. A. 83 :2787-2791. 326. Smith, I. L., M. A. Hardwi cke, and R. M. Sandrigoldin 1992. Evidence That the Herpes-Simplex Virus Immediate Early Protein-Icp27 Acts Posttranscriptionally Du ring Infection to Regulat e Gene-Expression. Virology 186 :74-86. 327. Snyder, R. O., C. H. Miao, G. A. Patijn, S. K. Spratt, O. Danos, D. Nagy, A. M. Gown, B. Winther, L. Meuse, L. K. Cohen, A. R. Thompson, and M. A. Kay 1997. Persistent and therapeu tic concentrations of hu man factor IX in mice after hepatic gene tran sfer of recombinant AAV vectors. Nat Genet. 16 :270-276. 328. Song, S., M. Morgan, T. Ellis, A. Poirier, K. Chesnut, J. M. Wang, M. Brantly, N. Muzyczka, B. J. Byrne, M. Atkinson, and T. R. Flotte 1998. Sustained secretion of human alpha-1-antitr ypsin from murine muscle transduced with adeno-associated virus vectors. Proc Natl Acad Sci U. S. A. 95 :14384-14388. 329. Spear, P. G. 1993. Entry of Alphaherpesviruses into cells. Seminars in Virology 4 :167-180. 330. Spear, P. G., R. J. Eisenberg, and G. H. Cohen 2000. Three classes of cell surface receptors for alphaherpesvirus entry. Virology 275 :1-8. 331. Spencer, B., S. Agarwala, M. Miskulin, M. Smith, and C. R. Brandt 2000. Herpes simplex virus-mediated gene deliver y to the rodent visual system. Invest Ophthalmol. Vis. Sci. 41 :1392-1401. 332. Stein, C. A. and J. S. Cohen 1988. Oligodeoxynucleotides as inhibitors of geneexpression a review. Cancer Res. 48 :2659-2668. 333. Stephenson, M. L. and P. C. Zamecnik 1978. Inhibition of Rous sarcoma viral RNA translation by a specif ic oligodeoxyribonucleotide. Proc Natl Acad Sci U. S A. 75 :285-288. 334. Stevens, J. G. and M. L. Cook 1973. Latent infections induced by herpes simplex viruses. Cancer Res. 33 :1399-1401. 335. Streilein, J. W., M. R. Dana, and B. R. Ksander 1997. Immunity causing blindness: five different paths to herp es stromal keratitis. Immunol. Today 18 :443-449. 336. Strelow, L. I. and D. A. Leib 1996. Analysis of conserved domains of UL41 of herpes simplex virus type 1 in virion host shutoff and pathogenesis. J. Virol. 70 :5665-5667.

PAGE 218

202 337. Stulting, R. D., J. C. Kindle, and A. J. Nahmias 1985. Patterns of herpes simplex keratitis in inbred mice. Invest Ophthalmol. Vis. Sci. 26 :1360-1367. 338. Stumpf, T. H., C. Shimeld, D. L. Easty, and T. J. Hill 2001. Cytokine production in a murine model of recurrent herpetic stromal keratitis. Invest Ophthalmol. Vis. Sci. 42 :372-378. 339. Su, Y. H., X. T. Yan, J. E. Oakes, and R. N. Lausch 1996. Protective antibody therapy is associated with reduced chemoki ne transcripts in herpes simplex virus type 1 corneal infection. J. Virol. 70 :1277-1281. 340. Sun, A., G. V. Devi-Rao, M. K. Rice, L. W. Gary, D. C. Bloom, R. M. SandriGoldin, P. Ghazal, and E. K. Wagner 2004. Immediate-early expression of the herpes simplex virus type 1 ICP27 transcript is not critical for efficient replication in vitro or in vivo. J. Virol. 78 :10470-10478. 341. Sun, A., G. V. Devi-Rao, M. K. Rice, L. W. Gary, D. C. Bloom, R. M. SandriGoldin, P. Wagner, and E. K. Wager 2004. The TATGARAT box of the HSV1 ICP27 gene is essential for immediat e early expression but not critical for efficient replication in vitr o or in vivo. Virus Genes 29 :335-343. 342. Sun, L. Q., J. Pyati, J. Smythe, L. Wan g, J. Macpherson, W. Gerlach, and G. Symonds 1995. Resistance to human immunodeficiency virus type 1 infection conferred by transduction of human peripheral blood ly mphocytes with ribozyme, antisense, or polymeric trans-activation response element constructs. Proc Natl Acad Sci U. S. A. 92 :7272-7276. 343. Sun, L. Q., D. Warrilow, L. Wang, C. Witherington, J. Macpherson, and G. Symonds 1994. Ribozyme-mediated suppression of moloney murine leukemia virus and human immunodeficiency virus type I replication in permissive cell lines. Proc Natl Acad Sci U. S. A. 91 :9715-9719. 344. Suresh, P. S. and A. B. Tullo 1999. Herpes simplex keratitis. Indian J Ophthalmol. 47 :155-165. 345. Symons, R. H. 1992. Small catalytic RNAs. Annu Rev Biochem 61 :641-671. 346. Takahashi, K., T. Luo, Y. Saishin, Y. Saishin, J. Sung, S. Hackett, R. K. Brazzell, M. Kaleko, and P. A. Campochiaro 2002. Sustained transduction of ocular cells with a bovine immunodefici ency viral vector. Hum. Gene Ther. 13 :1305-1316. 347. Tanner, N. K. 1999. Ribozymes: the characteristic s and properties of catalytic RNAs. FEMS Microbiol Rev. 23 :257-275.

PAGE 219

203 348. Theil, D., T. Derfuss, I. Paripovic, S. Herberger, E. Meinl, O. Schueler, M. Strupp, V. Arbusow, and T. Brandt 2003. Latent herpesvirus infection in human trigeminal ganglia causes chr onic immune response. Am J Pathol. 163 :2179-2184. 349. Thi, T. N., C. Deback, I. Malet, P. Bonnafous, Z. Ait-Arkoub, and H. Agut 2006. Rapid determination of antiviral drug susceptibility of herpes simplex virus types 1 and 2 by real-tim e PCR. Antiviral Res. 69 (3):152-157. 350. Thomas, J. and B. T. Rouse 1997. Immunopathogenesis of herpetic ocular disease. Immunol. Res. 16 :375-386. 351. Thomson, J. B., T. Tuschl, and F. Eckstein 1996. The Hammerhead Ribozyme, p. 173-196. In F. Eckstein and D. M. J. Lilley (eds.), Catalytic RNA. Springer, Berlin. 352. Tomazin, R., N. E. G. van Schoot, K. Goldsmith, P. Jugovic, P. Sempe, K. Fruh, and D. C. Johnson 1998. Herpes simplex virus type 2 ICP47 inhibits human TAP but not mouse TAP. J Virol. 72 :2560-2563. 353. Tomishima, M. J., G. A. Smith, and L. W. Enquist 2001. Sorting and transport of alpha herpesviruses in axons. Traffic. 2 :429-436. 354. Trang, P., A. Hsu, T. Zhou, J. Lee, A. F. Kilani, E. Nepomuceno, and F. Liu 2002. Engineered RNase P ribozymes inhibi t gene expression and growth of cytomegalovirus by increasing rate of cleav age and substrate binding. J. Mol. Biol. 315 :573-586. 355. Trang, P., A. Kilani, J. Kim, and F. Liu 2000. A ribozyme derived from the catalytic subunit of RNase P from Escheric hia coli is highly eff ective in inhibiting replication of herpes simplex virus 1. J. Mol. Biol. 301 :817-826. 356. Trang, P., A. Kilani, J. Lee, A. Hsu, K. Liou, J. Kim, A. Nassi, K. Kim, and F. Liu 2002. RNase P ribozymes for the st udies and treatment of human cytomegalovirus infections. J. Clin. Virol. 25 Suppl 2 :S63-S74. 357. Trang, P., K. Kim, J. Zhu, and F. Liu 2003. Expression of an RNase P ribozyme against the mRNA encoding human cytomegalovirus protease inhibits viral capsid protein processing and growth. J. Mol. Biol. 328 :1123-1135. 358. Trang, P., J. Lee, A. F. Kilani, J. Kim, and F. Liu 2001. Effective inhibition of herpes simplex virus 1 gene expressi on and growth by engineered RNase P ribozyme. Nucleic Acids Res. 29 :5071-5078. 359. Trang, P., M. Lee, E. Nepomuceno, J. Kim, H. Zhu, and F. Liu 2000. Effective inhibition of human cytomegal ovirus gene expression and replication by a ribozyme derived from the catalytic RNA subunit of RNase P from Escherichia coli. Proc. Natl. Acad. Sci. U. S. A 97:5812-5817.

PAGE 220

204 360. Trang, P. and F. Liu 2004. RNase P ribozyme as an antiviral agent against human cytomegalovirus. Methods Mol. Biol. 252 :437-450. 361. Trono, D. 2003. Virology. Picking the right spot. Science 300 :1670-1671. 362. Tsubota, K., H. Inoue, K. Ando, M. Ono, K. Yoshino, and I. Saito 1998. Adenovirus-mediated gene transfer to th e ocular surface epithelium. Exp Eye Res. 67 :531-538. 363. Tsuchihashi, Z., M. Khosla, and D. Herschlag 1993. Protein enhancement of hammerhead ribozyme catalysis. Science 262 :99-102. 364. Tumpey, T. M., H. Cheng, D. N. Cook, O. Smithies, J. E. Oakes, and R. N. Lausch 1998. Absence of macrophage inflammato ry protein-1alpha prevents the development of blinding herpes stromal keratitis. J. Virol. 72 :3705-3710. 365. Tyring, S. K., D. Baker, and W. Snowden 2002. Valacyclovir for herpes simplex virus infection: Long-term safety and sustained efficacy after 20 years' experience with acyclovir. J Infect Dis. 186 :S40-S46. 366. Usman, N. and L. R. M. Blatt 2000. Nuclease-resistant synthetic ribozymes: developing a new class of th erapeutics. J Clin Invest. 106 :1197-1202. 367. Vahlne, A., B. Svennerholm, and E. Lycke 1979. Evidence for herpes simplex virus type-selective recept ors on cellular plasma membranes. J Gen. Virol. 44 :217-225. 368. Vahlne, A., B. Svennerholm, M. Sa ndberg, A. Hamberger, and E. Lycke 1980. Differences in attachment between herp es simplex type 1 and type 2 viruses to neurons and glial cells. Infect. Immun. 28 :675-680. 369. Verma, I. M. and M. D. Weitzman 2005. Gene therapy: Twenty-first century medicine. Annu Rev Biochem. 74 :711-738. 370. Vlcek, C., V. Benes, Z. Lu, G. F. Kuti sh, V. Paces, D. Rock, G. J. Letchworth, and M. Schwyzer 1995. Nucleotide sequence analys is of a 30-kb region of the bovine herpesvirus 1 genome which exhibits a colinear gene a rrangement with the UL21 to UL4 genes of herpes simplex virus. Virology 210 :100-108. 371. Voigt, M., M. Kralinger, G. Kieselbach P. Chapon, S. Anagnoste, B. Hayden, and J. M. Parel 2002. Ocular aspirin distribution: a comparison of intravenous, topical, and coulomb-controlled iontophores is administration. Invest Ophthalmol. Vis. Sci. 43 :3299-3306. 372. Vollmer, D. L., M. A. Szlek, K. Kolb, L. B. Lloyd, and T. M. Parkinson 2002. In vivo transscleral iontophor esis of amikacin to rabbit eyes. J. Ocul. Pharmacol. Ther. 18 :549-558.

PAGE 221

205 373. Vollstedt, S., S. Arnold, C. Schwerdel, M. Franchini, G. Alber, J. P. Di Santo, M. Ackermann, and M. Suter 2004. Interplay between alpha/beta and gamma Interferons with B, T, and natural kille r cells in the defense against herpes simplex virus type 1. J Virol. 78 :3846-3850. 374. Wade, J. C., C. Mclaren, and J. D. Meyers 1983. Frequency and significance of acyclovir-resistant herp es-simplex virus isolated from marrow transplant patients receiving multiple courses of treatment with acyclovir. J Infect Dis. 148 :1077-1082. 375. Wagner, E. K., J. F. Guzowski, and J. Singh 1995. Transcription of the herpes simplex virus genome during productive a nd latent infection. Prog. Nucleic Acid Res. Mol. Biol. 51 :123-165. 376. Wander, A. H., Y. M. Centifanto, and H. E. Kaufman 1980. Strain specificity of clinical isolates of herpes simplex virus. Arch. Ophthalmol. 98 :1458-1461. 377. Wang, X., B. Appukuttan, S. Ott, R. Pa tel, J. Irvine, J. Song, J. H. Park, R. Smith, and J. T. Stout 2000. Efficient and sustained transgene expression in human corneal cells mediated by a lentiviral vector. Gene Ther. 7 :196-200. 378. Ward, P. L., G. Campadelli-Fiume, E. Avitabile, and B. Roizman 1994. Localization and putative function of the UL20 membrane protein in cells infected with herpes simplex virus 1. J. Virol. 68 :7406-7417. 379. Warner, M. S., R. J. Geraghty, W. M. Martinez, R. I. Montgomery, J. C. Whitbeck, R. L. Xu, R. J. Eisenberg, G. H. Cohen, and P. G. Spear 1998. A cell surface protein with herpesvirus entr y activity (HveB) confers susceptibility to infection by mutants of herpes simplex virus type 1, herpes simplex virus type 2, and pseudorabies virus. Virology 246 :179-189. 380. Warrington, K. H. and R. W. Herzog 2006. Treatment of human disease by adeno-associated viral gene transfer. Hum Genet. 119 :571-603. 381. Watanabe, D., M. A. Brockman, T. Ndung'u, L. Mathews, W. T. Lucas, C. G. Murphy, B. K. Felber, G. N. Pavlak is, N. A. DeLuca, and D. M. Knipe 2006. Properties of a herpes simplex virus multiple immediate-early gene-deleted recombinant as a vaccine vector. Vi rology Sep 20. [Epub ahead of print]. 382. Watson, R. J. and J. B. Clements 1980. A herpes simplex virus type 1 function continuously required for early and late virus RNA synthesis. Nature 285 :329-330. 383. Weinberg, J. B., T. J. Matthews, B. R. Cullen, and M. H. Malim 1991. Productive human immunodeficiency viru s type 1 (HIV-1) infection of nonproliferating human monocytes. J. Exp. Med. 174 :1477-1482. 384. Weir, J. P. 2001. Regulation of herpes simp lex virus gene expression. Gene 271 :117-130.

PAGE 222

206 385. Whitbeck, J. C., S. A. Connolly, S. H. Willis, W. Hou, C. Krummenacher, M. P. de Leon, H. Lou, I. Baribaud, R. J. Eisenberg, and G. H. Cohen 2001. Localization of the gD-bindi ng region of the human herp es simplex virus receptor, HveA. J Virol. 75 :171-180. 386. Whitbeck, J. C., C. Peng, H. Lou, R. L. Xu, S. H. Willis, M. P. Deleon, T. Peng, A. V. Nicola, R. I. Montgomery, M. S. Warner, A. M. Soulika, L. A. Spruce, W. T. Moore, J. D. Lambris, P. G. Spear, G. H. Cohen, and R. J. Eisenberg 1997. Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry. J Virol. 71 :6083-6093. 387. Whitley, R. J., E. R. Kern, S. Chatterjee, J. Chou, and B. Roizman 1993. Replication, establishment of latency, a nd induced reactivation of herpes simplex virus gamma 1 34.5 deletion mutants in rodent models. J. Clin. Invest 91 :28372843. 388. Whitley, R. J. and B. Roizman 2001. Herpes simplex virus infections. Lancet 357 :1513-1518. 389. Wilhelmus, K. R., L. Gee, W. W. Hauck, N. Kurinij, C. R. Dawson, D. B. Jones, B. A. Barron, H. E. Kaufman, J. Sugar, R. A. Hyndiuk, P. R. Laibson, R. D. Stulting, and P. A. Asbell 1994. Herpetic Eye Disease Study a controlled trial of topical corticosteroids for herpes-simplex stromal keratitis. Ophthalmology 101 :1883-1895. 390. Wilkinson, D. E. and S. K. Weller 2005. Inhibition of the herpes simplex virus type 1 DNA polymerase induces hyperphos phorylation of replication protein a and its accumulation at S-pha se-specific sites of DNA da mage during infection. J Virol. 79 :7162-7171. 391. WILLIAMS, L. E., A. B. Nesburn, and H. E. Kaufman 1965. Experimental induction of disciform keratitis. Arch. Ophthalmol. 73 :112-114. 392. Winkler, W. C., A. Nahvi, A. Roth, J. A. Collins, and R. R. Breaker 2004. Control of gene expression by a natura l metabolite-responsive ribozyme. Nature 428 :281-286. 393. Wong-Staal, F., E. M. Poeschla, and D. J. Looney 1998. A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV-1 RNA. Hum. Gene Ther. 9 :2407-2425. 394. Wu, L. and P. S. Morahan 1992. Macrophages and other nonspecific defenses: role in modulating resistance against herp es simplex virus. Curr. Top. Microbiol. Immunol. 179 :89-110.

PAGE 223

207 395. Wu, X., Y. Li, B. Crise, and S. M. Burgess 2003. Transcription start regions in the human genome are favored targets for MLV integration. Science 300 :17491751. 396. Wutzler, P., H. W. Doerr, I. Farber, U. Eichhorn, B. Helbig, A. Sauerbrei, A. Brandstadt, and H. F. Rabenau 2000. Seroprevalence of herpes simplex virus type 1 and type 2 in selected German populations-relevance for the incidence of genital herpes. J. Med. Virol. 61 :201-207. 397. Xiao, W., L. I. Pizer, and K. W. Wilcox 1997. Identification of a promoterspecific transactivation domain in the he rpes simplex virus regulatory protein ICP4. J Virol. 71 :1757-1765. 398. Xiao, W. D., N. Chirmule, S. C. Berta, B. McCullough, G. P. Gao, and J. M. Wilson 1999. Gene therapy vectors based on adeno-associated virus type 1. J Virol. 73 :3994-4003. 399. Xiao, X. A., J. A. Li, and R. J. Samulski 1996. Efficient long-term gene transfer into muscle tissue of immuno competent mice by adeno-associated virus vector. J Virol. 70 :8098-8108. 400. Yan, X. T., T. M. Tumpey, S. L. K unkel, J. E. Oakes, and R. N. Lausch 1998. Role of MIP-2 in neutrophil migration a nd tissue injury in the herpes simplex virus-1-infected cornea. I nvest Ophthalmol Vis Sci. 39 :1854-1862. 401. Ye, G. J., K. T. Vaughan, R. B. Vallee, and B. Roizman 2000. The herpes simplex virus 1 U(L)34 protein interacts with a cytoplasmic dynein intermediate chain and targets nuclear membrane. J Virol. 74 :1355-1363. 402. Zabierowski, S. and N. A. DeLuca 2004. Differential cellula r requirements for activation of herpes simplex virus type 1 early (tk) and late (gC) promoters by ICP4. J Virol. 78 :6162-6170. 403. Zamecnik, P. C. and M. L. Stephenson 1978. Inhibition of Rous sarcoma virus replication and cell transf ormation by a specific oligodeoxynucleotide. Proc Natl Acad Sci U. S A. 75 :280-284. 404. Zaug, A. J. and T. R. Cech 1995. Analysis of the structure of tetrahymena nuclear RNAs in-vivo telomerase RNA, the self-splicing ribosomal-RNA intron, and U2 snRNA. RNA-A Publication of the RNA Society 1 :363-374. 405. Zhang, X., P. Shan, D. Jiang, P. W. Noble, N. G. Abraham, A. Kappas, and P. J. Lee 2004. Small interfering RNA targe ting heme oxygenase-1 enhances ischemia-reperfusion-induced lung apoptosis. J Biol Chem 279 :10677-10684. 406. Zhao, Z. S., F. Granucci, L. Yeh, P. A. Schaffer, and H. Cantor 1998. Molecular mimicry by herpes simplex viru s-type 1: autoimmune disease after viral infection. Science 279:1344-1347.

PAGE 224

208 407. Zhou, G., G. J. Yet, W. Debinski, and B. Roizman 2002. Engineered herpes simplex virus 1 is dependent on IL13R alpha 2 receptor for cell entry and independent of glycoprotein D receptor interaction. Proc Natl Acad Sci U. S. A. 99 :15124-15129. 408. Zieske, J. D. 1994. Perpetuation of stem cells in the eye. Eye 8 ( Pt 2) :163-169. 409. Zu, P. J., Q. Yu, J. M. Burke, and J. R. Wands 1999. Combinatorial screening and intracellular antiviral act ivity of hairpin ribozymes directed against hepatitis B virus. J Virol. 73 :5381-5387.

PAGE 225

209 BIOGRAPHICAL SKETCH Ms. Jia Liu was born in December 23rd, 1977 in one of the four municipalities, Tianjin, the third largest city in China. As the only chil d of Mr. Yuji Liu and Mrs. Hong Zhang, Ms. Jia Liu grew up in a very loving and caring family surrounding with Chinese traditional virtues. They instilled the virtues in her philosophy for life: diligence, honesty, integrity, courage, and passion. She is very talented in various ways: Ms. Jia Liu was always fascinated by science, especially in mathematics. At the age of 13, she won the No. one prize in mathematics competition in the city of Tianjin. She was also simultaneously engaged in art and Chinese liter ature. At the age of 16, Ms. Jia Liu was admitted in Yaohua High School, the top high school in Tianjin. Out of more than 2000 applicants, Ms. Jia Liu ranked the top 49th in the open entry examination of Yaohua High School. With highly accomplished scores in the national entry examination and an excellent scholastic background, Ms. Jia Liu was admitted to Nankai University in 1996. Nankai University is considered one of the most prestigious universities in China, and there she majored in biochemistry. Due to her passion in science, she wanted to continue working on a project related to biomedical sc iences. Ms. Jia Liu was then recruited and trained by Dr. Chunzheng Yang, a highly respecte d and productive scholar in the field of pharmacology. When she finished her colleg e education with a bachelor degree in biochemistry, Ms. Jia Liu continued worki ng on a project of antibody engineering for cancer therapy in the state key laboratory in Chinese Academy of Medical Sciences. Becoming an academic scholar with extensive contributions to society has always been

PAGE 226

210 her ultimate goal for life. In 2001, Ms. Jia Li u decided to travel oversea to the United States of America, to continue her dream of science education. She was accepted in the interdisciplinary program (IDP) in Universi ty of Florida, College of Medicine, and pursued a Ph.D. degree major in genetics in the department of molecular genetics and microbiology. After nearly five years of d iligent work, Ms. Jia Liu was awarded degree of Doctor of Philosophy in the fall 2006. In her tradition Chinese family, Ms. Jia Liu was the first female to achieve the Ph.D. degree in her generation. She is going to pursue a post-doctorate training in the field of virology.


Permanent Link: http://ufdc.ufl.edu/UFE0017527/00001

Material Information

Title: Initial Development of a Ribozyme Gene Therapy Against Herpes Simplex Virus Type I (HSV-1) Infection
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017527:00001

Permanent Link: http://ufdc.ufl.edu/UFE0017527/00001

Material Information

Title: Initial Development of a Ribozyme Gene Therapy Against Herpes Simplex Virus Type I (HSV-1) Infection
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017527:00001


This item has the following downloads:


Full Text









INITIAL DEVELOPMENT OF A RIBOZYME GENE THERAPY AGAINST HERPES
SIMPLEX VIRUS TYPE I (HSV-1) INFECTION















By
JIA LIU



















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2006


























Copyright 2006
by
Jia Liu















RMitAtWittWEAREM8929AUTERAYWERRAi. R306
898WAfflMMFR892889RO, MP ut#. AfflfWRTMW6AFR898
, AfflitWR&&TRATWR, EE BHitaSWANWMit: WEFR
A, MFRA. AfflitE R, fli4A, ARMHitAMMW. Affl AW
910, RSTERERR, Afflit MS, FUNEGril #RM@hRM RTM@89
















ACKNOWLEDGMENTS

I would like to acknowledge my mentors, Dr. Alfred Lewin and Dr. Gregory

Schultz, and the other two supervisors of mine, Dr. David Bloom and Dr. Sonal Tuli;

without them this work could not be possible. I could not be more grateful for all the

care, guidance, and patience Dr. Lewin has offered throughout my graduate career. His

enthusiasm for science, dedication to his students, and wisdom in life, all have influenced

me profoundly. I want to thank Dr. Gregory Schultz for allowing me to work on this

proj ect, for his constant support and his avid encouragement in the last four years and a

half. Dr. David Bloom has provided me invaluable training in the field of virology, and I

greatly appreciated his profession and expertise in science. Dr. Sonal Tuli has tirelessly

served on my supervisory committee, who has enriched my knowledge by providing her

invaluable input from the clinical aspect; I truly appreciated her kind help in every aspect

in the past years. Finally I wish to thank Dr. W. Clay Smith, as my committee member,

his insightful critiques were critical for the completion of this work.

I want to describe my deepest gratitude to my parents, Mr. Yuji Liu and Mrs. Hong

Zhang. Their unconditional love and endless care have always followed me no matter

how far I am away. Even when we are apart across the planet, my family has always

been my resources for encouragement, support and comfort. These have inspired me to

fully use my intelligence and talent and held me on through every up and down. Out of

all their effort, I had a chance to see the world and become who I am today.









I have been very fortunate to have worked with so many great people. I want to

express my sincere gratitude to each previous and current member of Dr. Lewin' s lab.

Mr. James Thomas Jr. has been a great lab manager; with his effort we had an enj oyable

working environment; Dr. Marina Gorbatyuk has offered her kindly help and advice; all

the students in the past and present have been far more than labmates, a family I shall say:

Alan, Mary Ann, Jen, Lourdes, Verline, Fredric, and Lee all shared with me the most

memorable times; in addition, to the new people, Alison, Soo Jung, Aaron, and Lance, it

has been great to have you. Ms. Angle Simpson, previous member of Dr. Schultz's lab,

has been such a great friend, and I cannot forget at the most difficult time, the great

comfort she provided and the unbelievable relief from her magic hug. Dr. Steve

Ghivizzani has offered a great deal of support and sincere advice which I could not forget,

and working in his lab has been such a great experience. I also want to describe my

thanks to every previous and current members of Dr. David Bloom's lab.

I want to describe my appreciation to all my friends, and their friendships have

been the greatest gift I have ever received in my life. Although being independent was

the best achievement from my graduate education, my friends have always been there for

me which have helped me grow in every aspect. I want to thank Dr. Mary Ann Checkley

for her guidance, encouragement and considerateness which always find me comfort and

motivation. I will not forget the genuine help from Dr. Biyan Duan, his selflessness and

kindness have been such a great model for me. I also want to thank Ms. Yuan Yuan, not

only for all the great times we have shared, but also for her invaluable critiques and

inputs which always urge me to work harder and to be better. After all, a great friend is

not only about giving out praises. Finally and most importantly, I want to thank Mr.









Jason Liem for his thoughtfulness, patience, and encouragement throughout these years.

In addition, Jason has offered excellent technique supports which helped me demonstrate

scientific ideas from a whole new perspective. With all of his effort, this j ourney has

been much more enj oyable and exciting.

I wish to acknowledge Ms. Joyce Conners; with her hard work, the experience in

the graduate school has been much more pleasant for all of us. I want to thank Susan

Gardener for her dedication and help. An acknowledgement would be incomplete

without mentioning all the staffs working in the international student center; they have

made the study experience in this country so much easier for us.




















TABLE OF CONTENTS
PAGE


ACKNOWLEDGMENT S .............. .................... iv


LIST OF TABLES ........._... ...... .___ ..............xii....


LIST OF FIGURES ........._... ...... .___ ..............xiii....


AB S TRAC T ......_ ................. ............_........x


CHAPTER


1 INTRODUCTION ................. ...............1.......... ......


Herpes Simplex Virus................ ...............1.
Herpes Simplex Virus Biology ................. ...............2................
Herpes Simplex Virus Pathogenesis................ ..... .... ..........5
Herpes Simplex Virus Infection and Herpes Simplex Virus Keratitis .........................7
Herpes Simplex Virus Keratitis............... ..... ... .. .. .. .........
Human Corneal Anatomy and Contributions to Herpes Simplex Virus
K eratiti s................ ... ........ ..... .. ......... .............

Herpes Simplex Virus Keratitis Pathogenesis ........................... ...............10
Treatments and Emerging Therapies............... ...............1
Gene Therapy of Herpes Simplex Virus Infection .......... ................ ...............16
Gene Targeting ................. ................ ...............16.......
Anti sense oligodeoxynucleotides ................. ................................17
Ribozymes ................. ...............18.................
RNAi and si/shRNA............... ...............19
Delivery Systems ................. ...............21.................
Adenovirus vectors............... ...............21
Adeno-associate virus vector .............. ...............22....

Herpes simplex virus vectors .............. ...............24....
Other methods of gene transfer ......___ ..... ... __ .... .._._..........2
Summary ........._..... ...._... ...............27.....

2 DESIGN AND IN VITRO KINETIC STUDY OF HAMMERHEAD
RIB OZYMES TARGETING MRNA OF HSV- 1 E ESSENTIAL GENE S..................3 2


Introducti on ................. ...............32.................
M materials and M ethods .............. ...............35....












Target Gene Selection and Determining Target Sequences of Hammerhead
Ribozyme ................ ...............35.................
In Vitro Kinetic Studies .................. ...............36................
Kinase of RNA oligonucleotides. ................ .......... ........... ..........36
Time-course studies of hammerhead ribozyme cleavage ................... .........37
In vitro multi-turnover shtdies............... ...............38
Ribozyme Cloning............... ...............39
Re sults............ ..... .. ...............40...
D discussions .............. ...............41....

3 STUDIES OF RNA GENE THERAPY TARGETING ICP4 MRNA OF HERPES
SIMPLEX VIRUS .............. ...............52....

Introducti on ................. ...............52.................
M materials and M ethods .............. .. ......... ............... ..... ........5
In Vitro Test of Hammerhead Ribozyme ICP4-885 Targeting ICP4 mRNA of
H SV -1 .............. .... .. ... .. .... .. .......... ... .... ..... ............5
Transient transfection of E5 cells with ribozyme ICP4-885 to detect
ICP4 mRNA Level .............. ........ ... ..................5
Construction of a stable cell line expressing ribozyme ICP4-885 ..............57
Herpes simplex virus type 1 infection................. ..............5
Herpes simplex virus type 1 viral stock preparation .............. ................59
Plaque reduction assay to determine viral titer ............... .... ................5
Transient transfection of pTRUF21-New Hairpin containing ribozyme
ICP4-885 ................... .... .. ....... .. ........ ...... ..... ..............6
In Vitro Test of a siRNA ICP4-19 Targeting ICP4 mRNA of Herpes Simplex
Virus Type 2 .............. ...............60....
R e sults................... ... ..... ...... ............ ....... .. .........6
Ribozyme ICP4-885 In Vitro Test against HSV-1 Target................ ................6
Effect of transient transfection of ribozyme ICP4-885 to ICP4 expression
level in E 5 cells...................... .. ................6
Transient transfection of pTRUF21-New Hairpin containing ribozyme
ICP4-885 in E5 cell line to test against KD6 (ICP4- HSV-1) viral
replication ............... .. ....... ................ .......6
Cell Line stably expressing ribozyme ICP4-885 tested against wild-type
herpes simplex virus type 1 (17syn+) ................... ... ... ...............6
Transient Transfection of siRNA Targeting ICP4 mRNA of Herpes Simplex
Virus Type 2 in HeLa Cells .............. ...............64....
Conclusions and Discussion .............. ...............64....


4 RNA GENE THERAPY FOR HERPES SIMPLEX VIRUS KERATITIS;
TARGETING A HSV-1 LATE GENE ................. ...............73...............

Introducti on .................. ........... ...... ....................7
Herpes Simplex Virus Keratitis...................... ............7
UL20 Gene and Function of Its Gene Product ........................... ...............74
M materials and M ethods .............. ...............77....











Hammerhead Ribozyme Cloning .............. ... .. ........ ... ........7
Test of Transient Transfection of Ribozyme Containing Plasmids against
Wild-type Herpes Simplex Virus Type 1............... ...............77...
Adenovirus Vector Packaging .........._._ .. ....._. ...._.._ ............7
Preparation of Adenoviral DNA.. ........._.._.. .. .... ._ ... ......... ._ .................8 1
Herpes Simplex Virus Type 1 Viral Strains and Viral Production .....................82
Cell Culture Tests of the Accumulative Effects of Ribozymes Packaged in
Adenoviral Vector against Wild-type Herpes Simplex Virus type 1...............82
Real time Polymerase Chain Reaction to Compare Target Levels after the
Ribozyme Treatment............... ... .. ...... .................8
Testing Hammerhead Ribozyme against Drug Resistant Herpes Simplex
V irus type 1 Strains............... ........ ..... ...............8
Growth rate study of drug resistance HSV-1 strains and wild-type HSV-1
with or without adenovirus packaged ribozyme treatments ...................85
Acyclovir solution ................... .. ......... ...... ............ .. ... .......8
Acyclovir inhibition threshold for drug resistant HSV-1 strains ................85
Testing the hammerhead ribozyme against drug resistant HSV-1 strains....86
R e sults........._..... ...... .._._ ...... ..._ .. .. .. .. ... ........8
Transient Transfection of the Plasmid Expressing Hammerhead Ribozyme
Followed by HSV-1 Infection (17syn+) .................. ..... ....... ... ................ 87
Dose-response Assay of Adenovirus Packaged UL20 Ribozyme-154 against
wild-type HSV-1 Viral Replication ..........._..._..... ... .._ ........__ .........8
Inhibitory effect of UL20 ribozyme-154 on Wild-type Herpes Simplex Virus
Type 1 Viral Replication................... ......... .. .. .. .......8
Ribozyme Effect on Viral Target RNA and Wild-type Herpes Simplex Virus
Type 1 DNA Replication .............. .. ........ .. ... .. ............8
Ribozyme Effect on Viral Replication of Herpes Simplex Virus Type 1 Drug
R esistant Strains............ .. ...... ..............................8
Inhibitory Effect of a Hammerhead Ribozyme Targeting UL30O mRNA in
Viral Replication............... ..............9
Discussion ................. ...............91.................

5 STUDIES OF DELIVERY VECTORS FOR HSK GENE THERAPY ................... 107

Introducti on .................. .... ......... .. ...............107......
Adeno-associated Virus Vectors .............. ...............107....
Herpes Simplex Virus Vectors ......___ ........_.._......_. ...........10
Adenoviral Vectors ........._. .......... _._ .. ...............110...
lontophoresis Delivery of Oligonucleotides ................. .......... ...............1 12
Materials and Methods ............... .... ........ ........ ............... ............11
Establishing a Rabbit Model for HSV Ocular Infection ................. ................114
Study of Corneal Tropism of AAV Vectors ................... .......... ................115
Delivery of adeno-associated virus vectors to rabbit cornea....................1 15
Immunohistochemistry analysis of adeno-associated virus vector tropism
in the cornea ........._...... .... ....._.._ ....._._ ................11
Progress in Testing HSV Vector for Delivery in Cornea and Trigeminal
Gangli on ........._._. ._......_.. ...............118....











Delivery of non-replicating herpes simplex virus type 1 vector in rabbit
cornea .........._..._.. ..._.._ ...... .. ..._ .. .. ......... 1
Protection from previous ocular infection against subsequent herpes
simplex virus type 1 super-infection............... ............11
Antibody neutralization assay ..........._.._. ... ......_..._ ........ ._...__............1
Proof of Principal Experiment: Testing Adenoviral Vector Packaged
Ribozyme in an HSV-1 Acute Infection Model in Mice ........._..... ..............120
Ribozyme inoculation and HSV-1 infections in HSV-1 mouse footpad
m odel .............. ......... .. .. .........2
Quantitative real-time polymerase chain reaction to estimate viral
replication level...................... .................... .......12
Iontophoresis of Chemical Protected Synthetic RNA Molecules in an Acute
Ocular HSV-1 Infection Model in Rabbits ............. ............. ...... ..............124
Design of chemical modifications in hammerhead ribozyme RNA
m olecule.................. .. .. .......... ..................12
Iontophoresis of synthetic chemical protected ribozyme for treatment of
herpes simplex virus type 1 infection in rabbit............... .................2
R e sults ................ .............. .... ... .. .... ..... ..........12
Adeno-associated Virus Vector Tropism in Cornea .............. ..........._ ....125
Herpes Simplex Virus Vector Delivery to Cornea and Trigeminal Ganglion...126
Adenovirus Vector Delivery of a Ribozyme targeting HSV-1 UL20 mRNA in
a Mouse Footpad HSV-1 Infection Model............... ............... ............2
Analysis of the Effect of lontophoresis of Chemically Protected Hammerhead
Ribozymes in Rabbit Corneas in Limiting HSV-1 Infections ................... ....129
Discussion ................... .... ........... .. ......... ..... ... ........3
Adeno-associated Virus Vector Tropism in the Cornea ............... ................1 30
Herpes Simplex Virus Vector for Ribozyme Delivery into the Cornea and
Trigeminal Ganglion ............ .. ......... ...............131.....
Adenovirus Vector Study .............. .... ............... .... .. .. ........3
Effect of lontophoresis of Chemically Protected Hammerhead Ribozymes in
Rabbit Cornea in Limiting Herpes Simplex Virus Type I Infection..............135

6 CONCLUSIONS AND FUTURE DIRECTIONS .............. .....................5

Hammerhead Ribozyme Targeting ICP4 ................ .. .. ......... ..........._.... .........15
Ribozyme Targeting mRNA of Herpes Simplex Virus Type 1 Early/Late Essential
G enes............... ..... ........ .. ... .... ... .... .......15
The Establishment of an Ocular Delivery System Using Herpes Simplex Virus
Type 1 Vector ................ ...... .. ............15
Viral Vectors for Corneal Gene Transfer .............. ...............159....

APPENDIX

A ABBREVIATIONS ................. ...............163......... ......

B REAL-TIME PCR PRIMERS AND PROBES .............. ...............168....












C RECIPE OF SOLUTIONS .............. ...............170....


LIST OF REFERENCES ................. ...............172................


BIOGRAPHICAL SKETCH .............. ...............209....

















LIST OF TABLES


Table pg
1-1 Ribozyme activity in nature and therapy. ....._.._.. .... ....... ......_.._ ........2

2-1 Experiment design of in vitro multi-turnover analysis. ........._..... ......._.._........44

2-2 Preparation of calibration curve for multi-turnover kinetics analysis. .....................45

2-3 Summary of in vitro kinetic analysis of all the hammerhead ribozymes designed
against H SV-1 .......... ................ ...............45......

3-1 Ribozyme sequences and sequences of their respective targets. ........._..... .............67

3-2 Conventional polymerase chain reaction primers. ............. .....................6

3-3 siRNA duplex sequences and target sequences............... ...............6

5-1 Treatment code for AAV tropism study ................. ...............138.............

5-2 Antibody neutralization assay to detect systemic antibody against HSV-1
following non-replicating HSV-1 (KD6) infection ................. ............ .........138


















LIST OF FIGURES


Figure pg
1-1 Herpes simplex virus type 1 genetic map............... ...............29..

1-2 Regulation of viral gene expression during lytic infection. ............. ...............30

1-3 Human cornea anatomy............... ...............3 1

2-1 Structure of a hammerhead ribozyme.. ............ ...............46.....

2-2 The composition of G+C in HSV-1 genes using Vector NTI. ................ ...............47

2-3 Predicted folding pattern for ribozyme UL54-825 using MFOLD. ..........................48

2-4 The map of plasmid pTR-UF21-NewHairpin for ribozyme cloning. ................... ...48

2-5 Ribozyme sequences and their respective target sequences ................. ................49

2-6 Gene targets for hammerhead ribozymes in HSV-1 lytic life cycle. ................... .....50

2-7 In vitro kinetic study of hammerhead ribozyme UL20-154 ................. ................. 51

3-1 Map of plasmid pTR-UF 11 generated by Vector NTI ................. .....................68

3-2 Reduction of ICP4 expression level in E5 cells by transient Transfection with
ICP4rz-88 5.. ............ .....................6

3-3 Effect of ribozyme ICP4-885 on KD6 viral replication in E5 cell line. ..................70

3-4 Inhibition of wild-type HSV-1 viral replication rendered by ICP4 ribozyme-885
functi on ................. ...............71.................

3-5 Effect of siRNAl9 targeting ICP4 mRNA on viral replication of wild-type
HSV-2 (HG-52) in HeLa cells.. ............ ...............72.....

4-1 Membrane topology of UL20 protein predicted by the TMPred and SOSUI
algorithm s. ........... ..... .._ ...............97....

4-2 Maps of cloning constructs. ............. ...............98.....

4-3 Transient transfection of UL20 ribozyme-154 significantly reduced wild-type
herpes simplex virus type 1 (17syn ) viral replication..........._.._.._ ......_.._.. .....99










4-4 Dose-response of adenovirus delivered ribozyme treatments to herpes simplex
virus type 1 viral yield ................. ...............100........... ...

4-5 Inhibitory effect of UL20 ribozyme-154 on wild-type herpes simplex virus type
1 viral replication. ............. ...............102....

4-6 Real-time polymerase chain reaction results show the effect of UL20 ribozyme-
154 on viral mRNA and DNA ................. ...............104........... ..

4-7 UL20 ribozyme-154 tested against series of herpes simplex virus type 1 strains
for inhibitory effects. ................. ...............105....... .....

4-8 Inhibitory effect of UL30 ribozyme-933 on herpes simplex virus type 1 (17syn+)
viral replication.. ............ ...............106.....

5-1 Trigeminal ganglia transduced by LacZ packaged herpes simplex virus vector. ..139

5-2 Iontophoresis treatment in rabbits. ............. ...............140....

5-3 Design of chemically modified hammerhead ribozyme targeting UL20 mRNA of
herpes simplex virus type 1. ............. ...............141....

5-4 Immunostaining of rabbit cornea for green fluorescent protein expression
delivered by different serotypes of adeno-associated virus vectors. ...................... 142

5-5 Confocal microscope observation of green fluorescent protein using alkaline
phosphatase detection system. ................ ....__ ....___ .............4

5-6 Delivery of LacZ gene expression using HSV vector in the cornea of New
Zealand white rabbits. ............. ...............146....

5-7 Survival assay to observe protection effect of UL20 ribozyme.............._.._.. ..........147

5-8 Delivery of chemically modified ribozyme reduced dendrite formation in rabbit
cornea caused by herpes simplex virus type 1 infection. ............. ....................14
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

INITIAL DEVELOPMENT OF A RIBOZYME GENE THERAPY AGAINST HERPES
SIMPLEX VIRUS TYPE I (HSV-1) INFECTION

By

Jia Liu

December 2006

Chair: Gregory Schultz
Cochair: Alfred Lewin
Department: Molecular Genetics and Microbiology

Herpes simplex virus keratitis is the most common infectious cause of corneal

blindness in the western world. Although primary ocular or oral infection of herpes

simplex virus type 1 (HSV-1) usually resolves within weeks, it leads to a latent infection

of the trigeminal ganglia. The recurrent infection causes immunoinflammatory effects in

the cornea which leads to blindness. Currently antiviral drugs (oral or topical) can

effectively reduce acute infection, but they cannot inhibit the recurrent infection. The

toxicity of current drugs as well as the emergence of drug resistant viruses leads to the

need for an alternative therapy that can prevent corneal blindness caused by recurrent

HSV-1 infection.

Ribozymes have been extensively studied and broadly applied for gene therapy.

Several hammerhead ribozymes were designed to target messenger RNAs (mRNAs) of

essential HSV-1 genes, and they were tested in vitro and in vivo for their therapeutic









effect against HSV-1 infection. A ribozyme targeting a late essential gene, UL20, showed

a significant inhibitory effect to HSV-1 viral replication in vitro and in vivo. UL20

ribozyme was packaged in an adenoviral vector and the treatment significantly reduced

the viral replication by sequence-specific cleavage of target mRNA in the cell culture.

Even at a very high dose, no morphological difference was observed between cells with

or without adenoviral infection. By knocking down UL20 mRNA, this ribozyme greatly

reduced the progeny viral DNA level consistent with the reduction of viral yield. The

adenovirus packaged UL20 ribozyme-154 inhibited HSV-1 infections caused by drug

resistant strains, while no effect was detected in acyclovir treatment of these strains. In

vivo testing of UL20 ribozyme-154 was conducted in two animal models of HSV-1

infection: a rabbit ocular model and a mouse footpad model. By using iontophoresis to

deliver chemically modified ribozyme RNAs to rabbit corneas, a significant reduction in

the severity of lesions was observed. In the mouse footpad model, adenovirus packaged

UL20 ribozyme-154 protected mice from death due to spread of the HSV-1 infection to

the central nervous system (CNS).

Overall, our studies showed promise for the application of a ribozyme based gene

therapy approach to prevent HSV infection. By exploring different delivery methods,

this therapeutic reagent targeting HSV-1 late gene mRNA can potentially be applied

against recurrent infection at different tissues to achieve therapeutic effects.















CHAPTER 1
INTTRODUCTION

Herpes Simplex Virus

Herpes simplex viruses (HSVs) belong to the Herpesviridae family, subfamily

Alphaherpesvirinae according to the International Committee on Taxonomy of Viruses

descriptions (ICTVD). These viruses were the first among the human herpesviruses to be

discovered and have been extensively studied. The word "herpes" comes from the

ancient Greek word "herpein", meaning "to creep or crawl" in the writings of Hippocrates

some 25 centuries ago.281 This reflects the ability of this virus to spread from initial

infection sites (skin or mucosal surfaces), become latent in various human tissues, and

reactivate themselves later. HSVs are evolutionary successful DNA viruses with a high

level of host specificity. There are two serotypes of HSV, HSV-1 and HSV-2 (formal

designations under ICTV description are human herpesviruses 1 and 2).297 HSV-1 and 2

infect the human body in a very similar way; however, they have evolved not only

anatomic tropisml 15,142,367,368, but site-dependent incidences of reactivations.203,286 HSV-1

causes orofacial and ocular infections in most cases and establishes latency in trigeminal

ganglia, while HSV-2 prefers sacral ganglia and causes genital infections.203,286 The

seroprevelence of HSV-1 increases with age and reaches around 88% of the population at

40 years of age, while HSV-2 has an average seropervelence of 12-15%.396 HSV

transmits by direct contact with infected secretions and enters the human body through

lesions or mucous membranes. Epithelial cells represent the primary targets of HSV

infection.









Herpes Simplex Virus Biology

The herpesvirus virion comprises an envelop, an amorphorus protein layer called

tegument, the icosahedral capsid, and an inner core containing viral genomic DNA. The

genome of herpes simplex virus type 1 (HSV-1) is 152kb linear double-stranded DNA

duplex with a G+C (guanosine+cytosine) base composition of 67%. HSV-1 encodes

more than 80 open translational reading frames (ORFs) and most ORFs are transcribed

into single transcripts (shown in Figure 1-1.). Reiterated HSV DNA sequences divide the

genome into two unique sequences: designated unique long (UL) and unique short (Us)

sequences. During viral DNA replication, two or four different isomers can be generated

by inverting reiterated sequences and/or inverting the orientations of UL and Us.

Furthermore, intragenomic and intergenomic recombination events create

polymorphisms.

HSV infection is initiated by interactions of viral membrane proteins with cell

surface components, and five out of twelve HSV membrane proteins have defined roles

in viral entry. They are glycoprotein B (gB), gC, gD, gH and gL, and entry events

involve interactions including binding and fusion of viral envelope proteins with the

cellular membrane. HSV recognizes glycosaminoglycan (GAG) chains of cell surface

proteoglycans, preferentially heparin sulfate, which is considered as the binding receptor.

Two viral glycoproteins, designated gB and gC, mediate the binding to heparin sulfate

and substitute each other during the binding event.143 Following binding of virions to

cells, fusion event takes place essentially by gD to trigger cell entry. Other viral envelop

glycoproteins, gB and a heterodimer of gH-gL, are required to facilitate successful

fusion.329,330 In addition to heparin sulfate, there are two other cellular surface receptors

participating in the fusion event. One was originally called HVEM (herpesvirus entry









mediator)254 and later designated as HyeA (Herpesvirus entry protein A)379, which is a

human member of the tumor necrosis factor (TNF) receptor family. Second human entry

receptors were identified as related members of immunoglobulin superfamily including

CD155239, which is poliovirus receptor, nectin-2 (originally HyeB), and nectin-1 (HyeC)

which are homophilic cell adhesion molecules localizing to sites of cadherin-based cell

junctions.6,307 A newly discovered HSV-1 entry receptor is generated in heparin sulfate

by specific glucosaminyl-3-O-sulfotransferases.321 In Summary, HSV entry of cells can

be separated as two different events, binding and fusion. Viral membrane proteins can

interact with each other and compensate in the absence of others to facilitate entry. The

abundant existence of cellular surface receptors also contributes to HSV viral entry,

which determines the broad host range of HSV infection. Taking these into consideration,

it is difficult to inhibit HSV infection by only preventing viral entry, since the entry is

such a complex event and multiple factors from virus and host have to be considered.

Herpes simplex virus can cause both lytic and latent infections, and persist in the

host life-long. During lytic infection, HSV expression is tightly regulated. There are

three kinetic classes of genes transcribed in strictly ordered sequence by the cellular RNA

polymerase II: immediate early (IE or a), early (E or P), and late (L or y) gene.

Transcription of a genes (ICPO, ICP4, ICP22, ICP27, and ICP47) start once viral DNA

enters the nucleus. These genes are regulated by promoters that are responsive to VPl6,

a tegument protein functioning as trans-activator by associating with cellular transcription

factors. Immediate early gene products initiate later viral gene expression, and early gene

products are mostly responsible for viral DNA replication, while late proteins are mainly

structural proteins for virion assembly (shown in Figure 1-2.). After primary infection,









HSV is capable of establishing latency in host sensory ganglia but may periodically

reactivate and cause outbreaks. During latency HSV genomic DNA exists as an episome

in the nucleus and no viral protein is detected. However, certain stimuli to host immune

surveillance, which might be triggered by trauma, stress, UV-light or any kind of

immunosuppression, initiate a brief viral replication in sensory neurons and transport the

virus back to the peripheral epithelium where HSV propagates causing the next episode

of HSV infection.

Herpes simplex virus enters neuron endings during primary infection and

undergoes retrograde transport through direct interaction of viral UL34 protein with the

intermediate chain of cytoplasmic dynein.276,401 Once reaching the nucleus, the viral

capsid docks at the nuclear pore complex (NPC) to inj ect viral DNA into the

nucleoplasm.238 During latency, expression of all viral genes except the latency-

associated transcripts (LATs) is shut off, and HSV-1 persists as a stable episomal element

in the neuronal cell nucleus.238 During reactivation, it is presumed that the lytic

replication cycle ensues within the nucleus, and viral genomes are packaged in capsids,

which then bud through the inner and outer nuclear membranes. At this stage, the virus

travels by anterograde transport along the axons251,295 through the interaction of the viral

RNA-binding protein Us11300 with the ubiquitous kinesin heavy chain. Upon reaching

the axon terminal, the virus exits the terminal and infects neighboring cells. These

special mechanisms of intraneuronal transport give HSV-1-based vectors an advantage

for non-invasive inoculation targeting the peripheral nervous system (PNS)119,232,273, foT

example, in chromec pain therapyl20,123,133 and preventing periphery neuropathy.54,55,306










HSV-1 vector can also be used for CNS delivery, e.g., for therapy of neurodegenerative

diseases.61520

Herpes Simplex Virus Pathogenesis

Herpes simplex virus type 1 infection affects 70-90% of people in most

populations1,218, and it has been recognized as a human pathogen with significant

morbidity, commonly causing lesions on skin or mucosal surfaces. Primary infection of

HSV-1 usually takes place early in life in humans and very often has subclinical

indications which heal within weeks without scarring. Reactivations from latent HSV

infection often cause asymptotic shedding of viral particles which promotes the

transmission of the virus. Occasionally, HSV infection can cause severe diseases,

including sporadic encephalitis, neonatal HSV-1, ocular infections, and even lethal

infections. Individuals with inherited or acquired immune deficiencies (organ transplant

recipients, patients under chemotherapy, or HIV patients) have a higher risk of

developing serious conditions.


Humans are the only natural reservoir of HSV. During its evolution, HSV has

developed multiple strategies to escape from immune invasion and modulate intracellular

as well as intercellular environments. After HSV infection, the host innate defense

mechanism is turned on to prevent viral entry of cells, viral propagation, and spreading

between cells. Soon after, host-acquired immune response is activated to clear viral

infections effectively. In response, HSV has developed three strategies for immune

evasion.


First, HSV can modulate cellular apoptotic conditions to induce pro-apoptotic or

anti-apoptotic effects on defender cells. HSV-1 Usl2 gene product affects immune









invasion by inhibiting cytotoxic T-lymphocyte recognitionl07,145; Us5 and Us3 gene

products function to delay cellular apoptosis to allow complete viral replication by

inhibiting Fas-mediated pathway as well as caspase activation.165-167 HSV-2

ribonucleotide reductase (ICP10) blocks apoptosis in neurons by activating the

MEK/MAPK survival pathway.283,284 There are also other HSV genes (HSV-1 genes 7

134.5, ICP27, LAT, and gene encoding gD9,65,235,285) inVOlVed in these modulation events.


Herpes Simplex Virus can counterattack dendritic cells (DC) by inhibiting DC

maturation as well as by inducing apoptosis. DC populations exist throughout the human

body, particularly in the interface to the environment (e.g. airways, skin and gut) where

they capture antigens to present and activate naive CD4' T cells. HSV infection of DCs

cause down-regulation of co-stimulatory molecules, including CDla, CD40, CD80,

CD86, the adhesion molecule CD54 (ICAM-1)249, and maj or histocompatibility class

(MHC) I molecules. Infected DCs also have lower IL-12 production. Together, this

down-regulation leads to a weaker stimulatory capacity toward T cells.288 Although there

is much that remains unknown in the mechanism of how HSV infection regulates DC

maturation, it is clear that MHC class I molecule expression is inhibited by formation of

HSV ICP47 with TAP (transporter associated with antigen presentation) to ICP47-TAP

complex which blocks the translocation of the MHC class I peptide complex to the cell

surface in vivo.145,169,352 Herpes simplex virus interrupts DC mediated T helper cell

responses and antibody production by interfering with MHC II antigen processing. One

example is that HSV glycoprotein B (gB) interacts with HLA-DR and HLA-DM

polypeptides.263 As another effective defense strategy, HSV induces apoptosis of

attacking DC which can be separated in two phases: anti-apoptotic and pro-apoptotic









phase. In the early stages, HSV infects DC to prevent apoptosis which allows sufficient

viral replication. For example, HSV glycoprotein D induces NF-icB activation which

thereby protects against Fas-induced apoptosis by the reduction of caspase-8 activity and

up-regulation of intracellular anti-apoptotic molecules.235 In the second phase, HSV

induces apoptosis in immature DC by induction of caspase-8 pathway, up-regulation of

tumor necrosis factor (TNF)-a, TNF-related apoptosis-inducing ligand (TRAIL) and p53

in combination with a down-regulation of the cellular FLICE-inhibitory protein (c-

FLIP) .258 HSV also impairs mature DC migration and function to induce antiviral

immune responses."


Finally, the most significant feature of HSV is the ability to establish latency in

sensory ganglia where viral protein expression becomes quiescent. By these means HSV

hides from host immune system with episodes of periodic reactivation.

Herpes Simplex Virus Infection and Herpes Simplex Virus Keratitis

Along with the development of human society and lifestyles, HSV has become a

very common pathogen worldwide. Currently, it is believed that more than 70% of the

population worldwide is affected by HSV infection. HSV-1, a widespread neurotropic

virus, is one of the best-characterized human pathogens. Infection with HSV-1 is very

common and associated with various diseases: Oral-facial infections (e.g.,

gingivostomatitis, pharyngitis, and recurrent herpes labialis), skin infections (e.g., eczema

herpeticum, and erythema multiform), and genital infections. HSV-1 infection can cause

encephalitis, called herpes simplex encephalitis (HSE), which causes pronounced

mortality and morbidity despite of antiviral treatments.323,324 HSE is the most common

cause of non-epidemic, acute fatal encephalitis in the western world.322 Herpes simplex









virus can also cause severe ocular diseases. In humans, HSV ocular infection generally

begins as conjunctivitis, and it can proceed to corneal epithelial keratitis or damage

deeper layers.218

Herpes Simplex Virus Keratitis

Herpes simplex virus keratitis (HSK) is the most common cause of corneal

blindness in the United StateS218, and around 300,000 cases of HSV eye infections are

diagnosed yearly in the U.S.388 HSK is caused by HSV-1 infection on the cornea in most

cases (in very rare cases it is caused by HSV-2), and it is initiated by a low dose of

infectious virus that causes primary infection in corneal epithelial cells. Replication of

the virus causes loss of epithelial cells leading to corneal lesions indicated by branching

shapes which can be detected using calcein or Rose Bengal staining.10 These branching

lesions are termed dendritic keratitis and more extensive lesions are called geographic

ulcers. Herpes simplex virus type 1 viral proteins that are involved in intracellular

spreading and host immune responses are believed to be responsible for different ulcer

formations that occur in some individuals. Following the initial infection, HSV-1

establishes latency in trigeminal ganglia through neurons innervating the corneal

epithelium and stroma. The reactivation of HSV-1 happens spontaneously when

individuals are under various conditions of stress. The reactivation often causes

asymptotic viral shedding, and attendant clinical symptoms may appear depending on

patient' s immune status. Herpes simplex virus type 1 reactivations in the cornea caused

by latent infections from the trigeminal ganglia or other

sites46,46,122, 122,229,229,266,266,267,267,301,301 lead to recrudescent keratitis. During each episode

of reactivation, elevated corneal damage can result in stromal scarring and corneal

neovascularization which are caused by increasing level of host immunity against the









virus. Theses lead to the loss of clarity of the cornea and, eventually, to corneal

blindness.

Human Corneal Anatomy and Contributions to Herpes Simplex Virus Keratitis

The human cornea has unique features and these contribute to the pathogenesis and

disease progress of Herpes simplex virus keratitis (HSK). The cornea is the transparent

tissue in the front of the eye and is primarily responsible for transmitting light on the

retina. Therefore the clarity of the cornea is extremely important to the vision. There are

Hyve cell layers comprising human cornea (shown in Figure 1-3), from front (facing light)

to back they are epithelium, bowman's layer, stroma, the Descemet's membrane, and

endothelium. The epithelium is a stratified squamous, non-keratinizing cell layer about 5

cell-layers thick. Epithelial basal cells have the stem-cell like feature in that they are able

to regenerate epithelial layer in 2 to 4 days. Corneal epithelial stem cells are believed to

reside in the basal cell layer of limbal epithelium at the transitional zone between the

cornea and conjunctiva.408 Bowman's layer is a thin acellular tissue considered to have

no regenerative capacity, and it is believed that epithelial wounds heal quickly over an

intact Bowman's layer. The next layer is the stroma which constitutes about 90% of the

cornea. The stroma consists mainly of collagen fibrils, ground substance, and keratocyte

which is the predominant cell of the stroma but only accounts for about 5% of the dry

weight of the cornea. Disturbing the regular, uniform array of collagen will cause loss of

clarity, and the ground substance plays a maj or role in maintaining regular array of

collagen fibrils. In response to stromal injury, the keratocytes migrate into the wound

area and undergo transformation into myofibroblasts which contribute to the scar

formation by proliferation and collagen production. The layer between endothelium and

stroma is called Descemet' s membrane which is produced by the endothelium. The









endothelium is a monolayer of regularly shaped hexagonal cells which lie posterior on

Descemet' s membrane. The main function of endothelium is to control stromal hydration

which is essential for corneal transparency, and they do not exhibit mitotic activity.

The cornea is believed to contain highest amount of neuron innervations among all

the human tissues, and sensory innervations of the cornea are supplied by the ophthalmic

branch of the trigeminal nerve. The nerve fibers of the cornea, radially oriented nerve

bundles, enter the cornea from the sclera at the middle one third of its thickness. These

nerves lose their myelin sheath after traversing 0.5-2.0mm into the cornea and then

continue as transparent axon cylinders which contribute to the maintenance of corneal

clarity. After passing Bowman's layer, they ramify (send out branches) and end within

the epithelium as free nerve endings. The nerve bundles in the sub-basal plexus of the

human cornea form a regular dense meshwork with equal density over a large central and

mid-peripheral area. These neuron innervations open the gate for HSV transport to

trigeminal ganglia where it establishes latency.

Herpes Simplex Virus Keratitis Pathogenesis

Ocular herpes simplex virus (HSV) infections involve direct viral cytopathic effects

and the immune response, which both contribute to ocular damage. Primary or acute

ocular infection begins with a small amount of HSV infectious viral particles. Although

infectious viral load might be higher when conjunctivitis is present, and viral replication

is required for herpes simplex virus keratitis (HSK) pathogenesis.ll It is believed that

once HSV infection is initiated, a threshold level of viral replication is required to

develop HSK.36,182 This phenomenon implies that it is not necessary to completely

eliminate the viral replication in order to achieve a therapeutic effect.









Host immune response plays a maj or role in the next stage of HSK. Responding to

viral replication, corneal and surrounding cells produce series of pro-inflammatory

cytokines as well as chemokines. These include IL-la, IL-1P, IL-8, IL-6, IFN-y, TNF-a,

MIP-2, MCP-1, IL-12, and MIPl-U.80,138,175,270,338,339,364,400 Interferon a, P (IFN- a, P) are

also released to inhibit viral replication directly, and this effect can be enhanced by IFN-

y.373 These pro-inflammatory molecules draw neutrophils to the infection sites.

Neutrophils attack infected cells through numbers of effector mechanisms including

phagocytosis of antibody coated virus particles and release of cytokines.243,252,350

Langerhans cells are also recruited to the site of infection, particularly the center cornea,

where they acquire antigens and travel back to draining lymph nodes to activate T-cells.

Eventually, all these events activate and attract T-cells to the infection site.50,240,335 The

T-cell response appears to be a Type IV hypersensitivity response mediated primarily by

TH1 CD4+ cells.89,100,1 18,335,406 During these events HSV infection is gradually cleared

from the cornea. However, scar tissue also forms in the stroma. The damage in the

stroma causes the cloudiness of cornea, eventually resulting in blindness if this happens

repeatedly .

There are three factors that have an impact on HSK pathogenesis: the genetic

background of the host, the host immune response, and the strain of HSV. The host' s

genetics make-up, although poorly understood, affects the course of infection through a

number of physical factors. These genetic factors consequently affect the severity of

corneal infection, given the fact that reducing viral titer even slightly could prevent HSK

disease progress. Studies of HSV corneal infection in mice indicated that strains of

inbred mice have different susceptibilities to HSK (C57BL/6 mice being most resistant,









DBA/2 mice being most susceptible, and BALB/C mice being intermediate).240,337 The

pattern of resistance parallels with the severity of acute infection and susceptibility of

encephalitis.172,223 While a preponderance of HSK cases occur in males according to

series of studieS219, female patients are more likely to have more severe forms of the

disease. These suggest a host genetic factor which contributes to HSK disease

progression. The presence of a mucin layer on the outer surface of cornea, the secretion

level as well as the effectiveness of antiviral molecules (e.g., lactoferrin) in the tear

filml09, and the production level of numbers of cellular molecules (e.g., interferon, TNF-

a, NO) all contribute to immune resistance, indicating an important role of host genetics

to the outcome of corneal infection. There are also other unknown host gene products

involved in the progress.223,394 A recent study indicated that an autosomal dominant

resistance locus Hrl (herpes resistance locus) mapped to chromosome 6 of mice224 affects

reactivations and viral replication in the cornea as well as in neuronal cells. It has been

suggested that the igh locus on chromosome 12, loci on chromosomes 4, 5, 13 and 14

affect the susceptibility/resi stance to HSV, and loci on chromosomes 10 and 17 seem to

be specific for ocular disease.265 Although functions of these gene products as well as the

mechanisms of these host genes still remain to be studied, these host factors provide a

new perspective for prevention of HSK. Targeting interactions of host factors and HSV

for HSK therapies can help to reduce the risk of this blind-causing disease.

Host innate and acquired immunity plays a very important role in the disease

progress of ocular HSV infection. On the other hand genetic differences among HSV

strains also alter the clinical indications and severity.125,376,391 Different composition of

viral genes involved in DNA replication, e.g., the origin binding protein (UL9)35,









processivity factor (UL42)35, ribonucleotide reductase (encoded by UL39 and UL40)34 and

thymidine kinasel21, all can affect virulence in cornea. Genes encoding viral structure

proteins can also be corneal virulence factors, e.g., the gene encoding a host shutoff (vhs)

protein (UL41 gene)35,336, the gene encoding yl 34.5 protein387 which also has

neurovirulence function, and UL3335 CHCOding a protein essential for the cleavage and

packaging of concatameric herpesvirus DNA into preformed capsids. HSV viral gene

products also serve as targets for immune response, e.g., UL21, UL49, and the gene

encoding gK can induce antibody-dependent cell-mediated cytotoxicity (ADCC).118,189

The identification of more immune target genes will be beneficial in modifying treatment

strategies for this immunopathological disease.

Overall, HSK pathogenesis involves a complex interaction between host genetic

background, host immunity and the constellation of viral genes. A better understanding

of these interactions will facilitate the treatment of this disease more efficiently.

Treatments and Emerging Therapies

HSV infection is a significant cause of ocular morbidity. Currently there is no drug

or any form of therapy available that will eliminate the causative agent. Detailed

classification of various clinical manifestations of ocular HSV infection has facilitated

improving treatment strategies.154,217 According to Herpetic Eye Disease Study

(HEDS)389, appropriate steroid usage should be applied to suppress immune response.

Corticosteroid usage has been an important part of successful management of HSK.

However, because they are immunosuppressive, the use of corticosteroids is

counterindicated early in the infection. In the early stage of HSK, when infection takes

place in epithelium and in stroma, active HSV infection can be controlled by topical or

systemic antiviral treatments. There are a limited number of antiviral agents available to









treat HSV infection, including idoxuridine (IDU), Vidarabine (Ara-A), trifluridine

(Triflurothymidine-TFT), acyclovir, ganciclovir, and Cidofovir. These are nucleoside

analogues, and there are also metabolite analogues with antiviral effects.247

Idoxuridine (IDU), a thymidine analogue, was the first agent found to be effective

in the treatment of HSV keratitis.173 Although IDU is useful in inhibiting viral

replication in epithelial infection, it can cause an allergic reaction. Idoxuridine has poor

solubility and low penetration rate, and is rapidly inactivated. As with other antiviral

drugs, IDU treatment leads to the emergence of viral resistance. The mechanism of IDU

toxicity is that it is incorporated into host DNA, and is the same cause of toxicity as other

antiviral drugs (e.g., Vidarabine, trifluridine) which often affect the regenerating

epithelium.210 Adverse effects often cause severe problems in patients (punctate

keratopathy277) which complicate the antiviral treatment. Idoxuridine, Vidarabine, and

trifluridine are mostly used as topical antiviral drugs for HSK. Because of their

limitations in solubility, short half-life, and penetration when treating deep stromal

diseases and uveitis, they are often found to be inefficient.

Acyclovir (ACV), a purine analog, has made the significant contribution in

antiviral therapy of HSV and Varicella-Zoster Virus (VZV) infection. It can be activated

by the viral thymidine kinase followed by phosphorylation by two cellular kinases to

form an active form with triphosphate. The triphosphate form of ACV is recognized

more readily by the viral DNA polymerase than by cellular polymerases. Therefore, it

inhibits viral DNA replication specifieally210 and has low toxicity. An oral ACV dose of

400mg, five times daily can provide therapeutic levels in the tears, serum, and aqueous

humor." Topical treatment of ACV can be at a dose of 3% ophthalmic ointment Hyve









times daily applied for 10 to 14 days in the case of denditic ulceration. Patients might

have to be on ACV for a longer period if geographic ulceration is diagnosed, and often

for months in the case of stromal diseases.70,in7 Acyclovir can have side effects of

neurotoxicityl31, caused by crystallization of ACV and intratubular obstruction, which are

presented as confusion, hallucinations, seizures, and coma. Although rarely encountered,

they can often be mis-interpreted as indications of herpes encephalitis.141 HSV develops

resistance to ACV predominantly by alternations in thymidine kinase (TK) and mutations

in viral DNA polymerase "l, although polymerase mutations are less frequent. However,

problems due to ACV resistant HSV strains almost exclusively affect immune-

compromised patients.14,104,320 The bioavailability of oral ACV is relatively low, only 10-

20%, while Valacyclovir and L-Valine ester of ACV has higher absorption rate (50%)

which can rapidly convert to ACV in liver.365 Ganciclovir (Brovinyl Deoxyuridine) acts

in a very similar manner as ACV by competitively inhibiting viral DNA polymerase.

Cidofovir (3-Hydroxy-2-phosphonyl-methoxypropyl cytosine, an acyclic nucleoside 5'-

monophosphate) is a very promising broad-spectrum antiviral agent with longer half-life

permitting once a week dosing. However, Cidofovir is available only as intravenous (IV)

preparation which has substantial nephrotoxicity.63,255

In summary, current antiviral treatments of HSK with nucleoside analogues can

control symptoms of disease but cannot cure or prevent the infections. The isolation of

drug resistant HSV strains, particularly in immune-compromised patients, has attracted

more clinical attention. It has been estimated that about 4-7%61,62,66,374 Of patients

experience infection caused by drug resistant HSVs after antiviral treatment with

nucleotide analogues. Although in immune-competent patients the incidence of infection









with drug resistant HSV is much lower (about 0.3%)13,31,69, alternative therapies will be

beneficial to overcome limitations of current antiviral drugs for general public health.

Since HSV infections continue to be prevalent, it is important to explore new

treatments to improve the management of drug resistant HSV infections, suppress

recurrent infections, and ideally eliminate reactivations. There is also a need for

treatments that require less frequent dosing. Very often when lesions are more advanced,

current medications are no longer efficient. Furthermore, alternative therapies that lack

the toxicities of existing medications will be beneficial. Immunomodulating agents, such

as resiquimod, can act on the viruses indirectly by inducing host production of cytokines

and thereby reduce recurrences of herpes. The new helicase primase inhibitors are the

first non-nucleoside antiviral compounds and are being investigated for the treatment of

HSV disease. Along with the above progress, development of gene therapy methods may

contribute significantly in HSV disease management.

Gene Therapy of Herpes Simplex Virus Infection

The concept of gene therapy arose during the 1970s, along with the development of

recombinant DNA technology. Gene therapy has been used to deliver foreign genes to

cells for correction of genetic deficits. Furthermore, with the improvement of viral vector

delivery, gene transfer can be conducted in a tissue-specific manner. A significant

number of studies indicate that gene therapy can provide corrections of phenotypes in

vitro and in vivo, now making it a broadly accepted approach to therapy.106,369,380

Gene Targeting

Disease-causing genes can be down-regulated at the post-transcriptional level.

Therefore, by reducing or inhibiting gene expressions, disease progress can be suppressed

or even reversed. Currently, agents for sequence-specific mRNA inhibition are antisense









oligodeoxynucleotides (ODNs), ribozymes and their DNA counterparts (DNAzymes),

and RNA interference (RNAi). These techniques been extensively studied in order to

improve the therapeutic effect for these methods, to achieve an efficient delivery, avoid

off-target effect, and to locate target sequence.

Antisense oligodeoxynucleotides

As early as 1978, it was demonstrated that an oligodeoxynucleotide (ODN)

containing 13 nucleotides complementary to long terminal repeat (LTR) of Rous

Sarcoma virus (RSV) could inhibit RSV translation as well as viral replication.333'403

This initiated the study of mechanism of antisense mediated inhibition. Large scale ODN

synthesis and the development of backbone modifications to increase stability as well as

effectiveness have permitted antisense ODNs to be developed as drugs and to undergo

clinical trials. Vitravene (ISIS pharmaceutical, Carlsbad, CA, USA) is approved by FDA

(Food and Drug Administration) for treatment of cytomegalovirus-associated retinitis by

targeting IE2 mRNA of cytomegalovirus (CMV). Another ODN, Genasense (Genta,

Berkerly Heights, NJ, USA) has Einished its phase III clinical trial for metastatic

melanoma in conjunction with chemotherapy. The mechanism of antisense ODNs varies

depending on the backbone modification.33'90'332 Generally negatively charged ODNs

(e.g., phosphodiesters and phosphorothioates) attract RNase H to cleave mRNA at the

DNA-RNA helix. Other backbone modifications (2'-O-methyls, 2'-O-allyls, and peptide

nucleic acid) are classified as steric hindrance ODNs, which do not recruit RNase H but

block translation, splicing, and nuclear transport. However, the delivery of antisense

ODNs is the maj or limitation for their application in therapy.









Ribozymes

Ribozymes are catalytic RNA molecules with the ability of breaking or forming

phosphodiester bonds even in the complete absence of protein. In the ribozyme catalysis

event, a 2' oxygen nucleophile attacks the adj acent phosphate in the RNA backbone

resulting in cleavage products with 2',3'-cyclic phosphate and 5' hydroxyl termini.

Ribozymes exist naturally, and they were discovered in group I intron in the large

ribosomal RNA of many single-celled eukaryotes and fungal mitochondria, the RNA

component of RNase P, group II introns (from fungal and plant mitochondria as well as

chloroplasts), plant viroid and virusoid RNAs, hepatitis delta virus, and a satellite RNA

from Neurospora cra~ssa mitochondria. Ribozymes can be modified to contain a simple

catalytic core and guide sequences to locate target RNA (as summarized in Table 1-1).

Furthermore, they can be delivered in trans by cloning in plasmid or viral vectors for

sequence-specific gene knock-down. The biochemical aspect of ribozymes is discussed

in Chapter 2.

Hammerhead and hairpin ribozymes, discovered from different plant viroids and

virusoids, have been tested as gene therapy agents extensively. Two phase I clinical trials

using ribozymes for gene therapy against human immunodeficiency virus 1 (HIV-1) were

conducted5,393 in the U.S. The potential of these ribozymes in antiviral therapy of

hepatitis C virus and chronic hepatitis B virus infections has also been recognized.

Additional studies have indicated that RNase P also has significant potential for antiviral

and cancer therapy.67,354-360 Moreover, tissue-specific delivery provides promise for

ribozymes in gene therapy of diseases caused by dominant genetics mutations.

Chemically modified synthetic ribozymes display improved nuclease resistance

compared to RNA. These stabilized synthetic ribozymes, maintaining their catalytic









ability, have shown promising results in targeting RNAs associated with induction or

progression of cancer in vitro and in vivo.225,278 Direct delivery of stabilized ribozyme

RNAs has several advantages (e.g., it can be appropriately dosed and can be stopped, if

necessary) and has been evaluated in clinical trials.366

Another catalytic nucleic acid is DNAzyme, a small DNA molecule with the ability

of site-specific cleavage of RNA target. DNAzymes do not exist in nature and have been

developed through in vitro selection. Because DNAzymes are inexpensive to synthesize

and can be modified chemically which increase their stability, they are useful alternatives

to antisense ODN and ribozymes. However, they can only be delivered exogenously and

have the same limitation as antisense ODNs with respect to delivery.

RNAi and si/shRNA

RNA interference (RNAi) represents an active organism-defense response against

foreign RNA, which demands cellular machinery to initiate the process. In many

organisms (such as C. elegan2s, D. melan2oga~ster and vascular plants) the silencing signals

can be amplified using an RNA-dependent RNA polymerase. In eukaryotic cells, the

RNAi pathway also regulates gene expression that determines cell fate such as

differentiation stages and cell survival. The physiological inducer of RNAi in cells is

double-stranded RNA (dsRNA), which is 21-23nt long and processed by Dicer (a cellular

endonulease) from longer dsRNA. This 21-23nt dsRNA contains 3' overhang, and is

called siRNA (small interfering RNA). The terminal effector molecule is the antisense

strand separated from siRNA which is then incorporated into the RNA-induced silencing

complex (RISC complex) and serves as a guide to the complementary sequence in target

mRNA. RISC conducts the endonucleolytic cleavage of mRNA within the target

sequence which leads to the degradation of mRNA, and then the antisense recycles for









additional mRNA targeting.27 For gene therapy applications, siRNA can be delivered in

the form of hairpin structure with a single stem loop, referred to as short hairpin RNA or

shRNA. Short hairpin RNAs are processed by Dicer into siRNAs.

RNAi pathway provides a very powerful gene silencing approach by mRNA

degradation, which can be used in gene therapy. Experience from antisense ODN and

ribozyme therapies have led to the development of chemically modified siRNA with

resistance to endonuclease degradation. In the case that disease-causing gene expression

localizes in easily accessed tissue, siRNA can be delivered without transfection reagents

or delivery vehicles, e.g., intranasal or intratracheal administration of siRNA in lung gene

silencing.28,405 However, to improve the tissue specific uptake of siRNA and provide

long-term effect in mammalian cells, shRNA can be delivered in a DNA vector.

Different promoter complexes can be used for conditional regulation of shRNA function.

A maj or concern for gene therapy is that siRNA, and other antisense molecules

such as ribozymes an oligodeoxynucleotide (ODN), can have "off target" effects caused

by partial homology between the intended target RNA and another RNA.161,310 This

problem is worse for siRNA delivered as shRNA, since they can block translation of an

RNA by binding to the 3' UTR of an mRNA and acting as a microRNA (miRNA).5

This inhibition requires as few as 7 base pairs between the siRNA and the 3' UTR. In

addition, introducing excess amounts of siRNA could cause saturation of cellular RNAi

machinery, consequently interfering with normal cellular functions. Finally un-

intentional toxicity of si/shRNA might come from induction of interferon response

particularly in specialized sensitive cell lines. When they are used at high concentrations

of siRNAs38,93, inflammatory effects can be induced. These can be avoided by using









siRNAs of high potency so that they are not needed in high concentration. In summary

si/shRNA provides a very efficient approach for gene silencing and has been exploited

extensively in gene therapy. However, toxicity and off-target effect may cause

significant side-effects in clinical applications.

Delivery Systems

Adenovirus vectors

Adenovirus is a 36kb double-stranded DNA virus, originally isolated from adenoid

tissue.302 Many features of adenoviruses make them well-suited for gene therapy.

Adenovirus is capable of infecting both actively dividing and quiescent cells, and its

genome does not integrate into the host genome, therefore, avoiding the risk of

mutagenesis. The high capacity of adenovirus allows insertion of large foreign genes, as

the most advanced adenovirus vector can accommodate up to 37kb of transgene. High

titers of adenovirus preparations can be obtained easily by propagating virus in 293 cells

(human kidney embryonic cells), and the high efficiency of adenovirus transduction also

makes it a very attractive vector for gene transfer. The first generation of adenovirus

vector (containing El gene deletion) triggers an immune-response which leads to the loss

of transgene expression within weeks in vivo. The second generation of adenovirus

vectors incorporates a deletion of the E2 and/or E4 gene in addition to the El gene, and

the resulting vector is therefore less immunogenic; however, the immune response still

exists. Recently, the third generation of adenovirus vectors has been constructed by

removal of the entire viral genome except for two ITRs (internal terminal repeats) and the

packaging signal, and they are referred to as helper-dependent or "gutless" vectors.

Although many problems remain to be resolved for large-scale preparation of helper









dependent adenovirus, the third generation vectors have shown promise for gene therapy

appli cati ons. 86,96,244,260

Recombinant adenovirus vectors have been tested extensively in the cornea for

gene therapy. Although transgene expression turns on early and lasts for a fairly long

time in corneal epithelial cells in vitro and in conjunctival epithelium362e BXvivO, a

serotype 5 vector failed to transduce corneal epithelial cell ex vivOl83,208 and in vivo.362

These results suggested the resistance of corneal epithelium to the adenovirus vector

delivery. However, adenovirus vectors are capable of transducing corneal endothelium208

and keratocytes49, which showed the promise of using Ad vectors for ocular gene therapy.

Since donor corneas are routinely maintained ex vivo for an extensive period of time

before transplantation, treatment with Ad vectors ex vivo offers a selective gene delivery

method to the cornea.

Adeno-associate virus vector

Adeno-associated virus is a Dependovirus in the family Parvoviridae.ls The

genome of AAV is a 4.7Kb linear, single-stranded DNA molecule and encodes two large

open reading frames (ORFs) flanked by invert terminal repeats (ITRs). The viral capsid

is non-enveloped with icosahedral symmetry and a diameter approximately 25nm. This

small diameter makes AAV better at diffusing through tissue structures than adenovirus.

A characteristic feature of AAV is that infection of a cell in the absence of a helper virus

cannot lead to a lytic infection. No known human disease has been associated with AAV

infection. Hence, AAV is classified as a defective and non-pathogenic human

parvovirus. An adenovirus (Ad), a herpesvirus (HSV-1, HSV-2 and CMV), or a vaccinia

virus can supply complete helper functions for fully permissive AAV infection.40,153,311









Adeno-associated virus is a human non-pathogenic virus with a broad host range

among mammals. AAV latent infection in humans appears to be common, as antibody to

AAV2 can be detected in between 50% and 96% of the normal population.53 However,

no human diseases are associated with wild type AAV29, and there is no immunologic

evidence for AAV re-activation upon challenge by a helper virus.'" In the absence of a

helper virus, AAV establishes latency by integrating into the host genome or by forming

an episome. In human cells, AAV prefers to integrate in a site-specific manner on human

chromosome 19ql3.3-qter.190 In TOCOmbinant AAV vectors (rAAV) the rep protein is

absent, and there is no integration between inverted terminal repeats (ITRs) and the

human chromosome 19 locus, however the virus may integrate in a non-site specific

manner. Another advantage of using AAV as a gene transfer vehicle is the long-term

transgene expression in non-dividing cells.2,130,280 The maximal transgene expression can

be detected in weeks and typically persists for the lifetime of the animal. 170,212,327,328,399

In dividing cells, such as regenerating liver, however, episomally maintained virus could

be diluted, and gene expression might decrease over time.245,380

There are a number of AAV serotypes and over 100 variants isolated

today.112,1 13,256,312 Based on the current understanding of AAV serology, AAV1-5 and

AAV7-9 are defined as true serotypes. Some serotypes preferentially transduce certain

tissues: AAV8 transduces liver with high efficiency; AAV1 works very well in muscle

transduction; and AAV7 demonstrates efficiency in transducing skeletal muscles

equivalent to that observed with AAV1.112 AAV1, AAV2 and 5 all can be used to target

murine retina, however, AAV1 has earlier onset of transgene expression and has

specificity to the retinal pigment epithelium (RPE).10 In the brain, AAV5 transduces only









neurons as does AAV283; in the CNS, recombinant AAV1 and 5 (rAAV1 and rAAV5)

can be used to target the entire hippocampus (HPC)41, in COntrast, transduction by rAAV2

is limited in the hilar region of HPC.171,184,234 Currently there are at least 20 clinical trials

that have been either completed or initiated to evaluate 15 different AAV2-based

vectors.52 A "cross-packaging" system has been developed to produce hybrid AAV

vector packaging AAV2 genome while containing capsid proteins of a different serotype

(a pseudotype). This provides an unbiased comparison of transduction efficiency of

different AAV capsids containing the same transgene expression cassette.127,292 The

development of hybrid AAV vector engineering, (including peptide ligand insertation261,

production of mosaic AAV136,291 and chimeric AAV32, and combinatorial AAV vector

libraries230,282) enables constructions of vectors with improved tropism and increased

tissue specifieity. Although cross-reactivity of different AAV serotypes appears to be

tissue/specie specific and delivery method dependent398, it is often recognized that in vivo

administration of one serotype is not affected by pre-existing neutralizing antibodies of

the other.279,398 Alternative gene transfer vectors of different AAV serotypes can be

applied when patients have high titers of antibody against one serotype, for example

AAV2. Moreover, multiple vectors delivering various genes simultaneously can be

applied.294,316

Herpes simplex virus vectors

Herpes Simplex Virus (HSV), a neurotropic double-stranded DNA virus, is a

promising vector for gene transfer applications. HSV contains a large genome which

provides significant capacity to accommodate multiple or large transgene cassettes by

replacing dispensable and pathogenic genes. The toxicity of HSV vector can be

minimized by eliminating genes necessary for viral replication (IE gene deletions).










These replication-defective HSV vectors can be propagated in cell lines complementarily

expressing these gene products.

Because HSV-1 has a broad host range and is able to infect dividing as well as

quiescent cells, it can deliver transgenes to a variety of tissues or cell types. By

exploiting the ability of HSV-1 to infect neuronal cells and establish latency, HSV-1 viral

vector is particularly suitable for long-term transgene expression in the nervous system.

As recombinant HSV vector maintains the natural HSV-1 axonal transport mechanism, it

can be used to deliver foreign genes to inaccessible tissues. Delivery method can be

simplified by noninvasive procedures, e.g., subcutaneous vector inoculation. This allows

transgene expression within the nucleus of the inaccessible trigeminal ganglion as well as

dorsal root ganglion. As the nervous system is the natural target for HSV-1 latency,

latency promoter complex can be used to achieve long-term transgene expression in

neurons.

The unique mechanisms of HSV-1 viral entry and transport (retrograde or

anterograde transport) have led to the extensive vector development in neurological

applications. The natural existence of HSV-1 entry receptors obviates the need to modify

viral surface for a broad cell-type targeting, as HSV viral entry has been described in the

section of Herpes Simplex Virus (HSV) Biology earlier. In the sensory neurons of

periphery nervous system, HyeC, a maj or mediator for HSV entry, is abundantly

expressed233, and thereby HSV vector can be applied to target these cells. However,

efficient transduction of peripheral motor neurons cannot be achieved due to low levels

of HSV receptor expression, targeting these cells requires alterations of viral

glycoprotein(s). Very similar to other viral vector applications, HSV-1 vectors can be









modified to retarget specific cell types. Two criteria must be met for this purpose: first,

the natural receptor-ligand interactions of the virus need to be diminished; second, the

virus must be redirected to preferred receptors by either alterations of viral surface206,407

or the addition of adaptors.8,124

Herpes simplex virus vectors have also been evaluated to transduce ocular tissues.

It has been shown that HSV vector could transduce corneal epithelium in vivo after

topical application ofHSV vector to the mouse cornea.331 However, corneal scarification

on the superficial epithelium before inoculation of viral vector was necessary to induce

efficient transgene expression, and transgene expression was limited surrounding the site

of scarification. It was also suggested in the same study that by using the topical

application, HSV vector could only transduce a few cells of the iris pigmented, trabecular

meshwork, and ciliary body. This limited the application of using HSV vector for

corneal gene transfer.

Overall, various aspects of HSV basic biology have been exploited to expand the

utility of HSV vector as therapeutic vector for diseases in periphery nervous system and

central nervous system.

Other methods of gene transfer

A number of delivery methods for gene transfer have been studied extensively,

including iontophoresis, electroporation, nanoparticles, cationic lipid-mediated gene

transfer, etc. Each of these can be made efficient, but all lead to transient gene

expression and, therefore, may not be suited for the long term effect of a chronic disease

or recurrent disease. Efficient delivery is one of the keys leading to the success of gene

therapy. Different approaches can be chosen depending on factors such as the delivery

tissue, the disease mechanism, and the therapeutic effect pursued.









Summary

The ultimate goal of HSV infection therapy is prevention: preventing recurrent

herpes simplex virus (HSV) infection and consequent tissue damage. In spite of the

development of current antiviral drugs, no available therapy can reach this goal. HSV

infection triggers host immune response, downstream events of the disease are affected

by the interaction of host and HSV. Herpes simplex virus infection on cornea has

significant impact on patients' life. Considering the prevalence of HSV infection among

the population, it is a maj or concern for general public health. Inhibiting HSV replication

at the post-transcription level by down-regulating HSV essential gene expression shows

promise for antiviral therapy. By establishing surveillance against each episode of

reactivation either at the corneal epithelium or in the trigeminal ganglia, HSV viral load

can be significantly reduced, therefore preventing subsequent damage to the stroma and

corneal blindness. The goal of this study is to test therapeutic ribozymes/siRNAs for

their potential in inhibiting viral replication. By testing a proof-of-principal concept, this

study provides a guide for future applications using ribozymes/siRNAs in anti-HSV gene

therapy, especially in the cornea. Furthermore, this study also provides experience in

corneal transgene delivery. Finally while testing antiviral reagents targeting genes from

different kinetic classes of HSV-1, a better understanding of HSV-1 biology and

interaction of HSV-1 proteins can be achieved.












Table 1-1. Ribozyme activity in nature and therapy.213


Ribozyme

Hammerhead



Hairpin



RNase P



Group I intron



Group II intron



Spliceosome

DNA enzymes


Catalytic activity

Sequence specific

ribonuclease

Sequence specific

ribonuclease

Structure specific

ribonuclease

RNA cleavage and ligation



RNA and DNA cleavage

and ligation

RNA cleavage and ligation

Sequence specific

ribonuclease


Relevant role in nature

Self-cleaving RNA



Self-cleaving RNA



tRNA processing


Therapeutic applications

Digestion of viral,

oncogene or mutant mRNA

Digestion of viral,

oncogene or mutant mRNA

Digestion of viral mRNA


Splicing RNA repair of mutant

mRNA or ocogenes

Splicing and transposition Gene disruption of viruses

and mutant mRNA

Splicing Repair of mutant mRNA

None Digestion of viral,

oncogene or mutant mRNA

(Lewin, A.S. and Hauswirth, W.W., 2001)








































Figure 1-1. Herpes simplex virus type 1 genetic map. (Modified from
http://www.dbc.uci_ edu/~faculty/wagner/hsvimg04z.j pg) HSV-1 is double-
stranded DNA virus. In the virion, viral DNA is packaged in the form that the
ends of the genome are in close proximity which appears to be circular. The
HSV genome was estimated to be approximately 150 kilobase pairs, and
complete sequencing of HSV-1 strain 17 genome describes the genome as
152260 base pairs (accession number X14112).


~~ta IJLI

























Pssentfal NVan-ssential
kvr~ vi ICP4 I 1 CP ca IP2 lC4Io4 nrfr


Immune evasion
Both ICP4 AND ICP27
MUST be eyesse~d in I ErTlygene Wrot~DNA repiCatiOn
order for the Iyte I~fe expression
cycle to proceed
Valnon synthess




Figure 1-2. Regulation of viral gene expression during lytic infection. Flow chart
illustrating the regulation of viral gene expression indicates the important
roles of immediate early genes, especially ICP4 and ICP27, in turning on the
expression of downstream classes of genes.43














C *D


e e


**


e


*


e


*


e


*


Epitheium


BowNman's Layer






~Descemet's Membrane

SEndothelium

iea


Com


Figure 1-3. Human cornea anatomy.














CHAPTER 2
DESIGN AND INT VITRO KINETIC STUDY OF HAMMERHEAD RIBOZYMES
TARGETING MRNA OF HSV-1 ESSENTIAL GENES

Introduction

Ribozymes are catalytic RNA molecules that promote a variety of reactions, often

involving splicing of RNA.347 Naturally occurring ribozymes fall into several classes,

including group I introns (from ribosomal RNA of protests and bacteria, and from

mitochondrial DNA of fungi), group II self-splicing introns (from yeast, fungal and plant

mitochondria as well as chloroplasts73), the tRNA processing enzyme RNaseP129,

hepatitis delta virus (HDV) ribozymeS200, the VS ribozyme from Neurospora crassa

mitochondria308, and the hammerhead and hairpin ribozymes from single-stranded plant

viroid and virusoid RNAs.44,158,390 The reactions catalyzed by natural ribozymes usually

involve breakage and formation of phosphodiester bonds between nucleotides, although

they can conduct other biochemical transformations including reactions analogous to the

reverse of splicing.204,313

From the evolutionary perspective, it has been suggested that self-cleaving

ribozymes reflect remnants of the RNA world. The RNA world theory hypothesizes that

far before the genetic information flow (from DNA to RNA to protein) formed, functions

for life were conducted by RNA.116 Recent discoveries that self-cleaving ribozymes can

associate with protein-coding genes20,392, raise the question whether self-cleaving

ribozymes regulating gene expression may be predated and have been the ancestors of

RNA replicons.22 Salehi-Ashtiani et al304 identified a self-cleaving ribozyme in the first









intron of the cytoplasmic polyadenylation element binding protein 3 (CPEB3), and the

association of CPEB3 and CPEB3 ribozyme is actively present in all the mammals but

not in other vertebrates.22 The striking resemblance of the CPEB3 ribozyme to

ribozymes in HDV, a pathogenic subviral satellite naturally found only in humans. The

fact that HDV has been isolated only from human tissue led to the speculation that this

HDV self-cleaving ribozyme may have evolved from modern protein-dominated

organisms. Therefore, this may exclude the possibility that HDV ribozyme is a

descendant of the RNA world.

The hammerhead ribozyme catalytic motif was first reported in small satellite and

viroid RNAs two decades ago37,345, and it is one of the smallest catalytic RNAs

containing around 30 nucleotides active under physiological conditions. The potential of

hammerhead ribozymes to catalyze sequence-specifie down-regulation of gene

expression was realized following the definition of simplified ribozyme catalytic motifs

in the late 1980s and early 1990s. With the development of other oligonucleotide-based

regulation methods (antisense, DNAzymes, and siRNAs), ribozymes have significant

advantages for gene therapy applications. Because of its simplicity and flexibility, the

hammerhead ribozyme can be designed to cleave any target RNA independently from

cellular pathways and even in the absence of protein, which are different from

siRNA/shRNA. The hammerhead ribozyme (and other ribozymes) can be designed

against introns and nuclear-specific sequenceS248, and this selectivity in intracellular

compartmentalization provides it advantages over antisense oligonucleotides,

DNAzymes, and siRNAs. In terms of off-target effects, in a comparative study in

neurons using an adenoviral delivery, the hammerhead ribozyme showed increased









specifieity compared to siRNAl9; ribozymes are much more sensitive to nucleotide

changes at the cleavage site than other methods, and therefore can be used to discriminate

between single nucleotide polymorphisms.94,212

The essential structural elements of hammerhead ribozyme contain three Watson-

Crick base-paired helices; helix I and III are connected by conserved sequences with

catalytic potential.144 In tranZs, the hammerhead ribozyme anneals to its substrate by

complementary hybridizing to form helix I and III, and a loop links helix II (shown in

Figure 2-1).

Because ribozymes (hammerhead, hairpin ribozymes and RNase P) can down-

regulate gene expression by conducting sequence-specific cleavage of target mRNA, they

have been extensively used to down-regulate cellular and viral gene

expression.76,177,179, 180,355 The hammerhead ribozyme has been used to down-regulate

undesirable gene expression: in the dominant-negative gene disorders, where the gene

product of mutant allele jeopardizes the normal function (e.g., autosomal dominant

retinitis pigmentosa (ADRP); in cancer therapies, e.g., using ribozyme to reduce

oncogene expressions (ras""8, bcr-abl201); in antiviral therapies, particular anti-HIV.342,343

The availability of various viral vectors (adenoviral, adeno-associated viral, retroviral,

and herpes simplex virus vectors) provides options for tissue specific and long-term

delivery .

The concept of using ribozymes as antiviral agents has also been tested. The

RNase P ribozyme has been tested in vitro against HIV, hepatitis B409, and hepatitis C

viruS216 and herpes viruses.179,357,358 However, there has been no successful in vivo

delivery of ribozymes to target herpes viruses for therapy. Recently a liposome mediated









delivery of an siRNA has been used to treat an HSV-2 infection in mice. In this study, I

designed hammerhead ribozymes targeting Herpes Simplex Virus type I (HSV-1) to

explore a gene therapy approach to inhibit HSV infection.

Herpes simplex virus type 1, a member of Herpesviridae family, is a neurotropic

DNA virus with the ability of conducting lytic infection and establishing latency. From

the perspective of HSV infection induced pathogenesis, it is the productive viral

replication, either from acute infection or reactivation, directly or indirectly causing

damage to the host. Thus essential genes of HSV-1 become good targets for antiviral

agents, since knocking down an essential gene expression may have significant impact on

viral replication cycle, which can limit infectious disease progressing in the host.

Materials and Methods

Target Gene Selection and Determining Target Sequences of Hammerhead
Ribozyme

Potential ribozyme target genes were selected from HSV-1 essential genes (the

complete HSV-1 genome is in NCBI database with a nucleotide access number of

NC_00 1806) based on their base composition of guanine plus cytosine using software

called Vector NTI 8 (1994-2002 InforMax, Inc) and examples are shown in Figure 2-2.

GUC, CUC and GUU are the cleavage sites of hammerhead ribozymes that were

searched in the potential target gene in order to design corresponding ribozymes. Once

the cleavage sites were decided, two hybridizing arms of the hammerhead ribozyme

would be developed by using complementary sequences surrounding the cleavage site. A

program called MFOLD by Dr. Michael Zuker

(http://www.bi oinfo.rpi .edu/applicati ons/mfol d/old/rna/forml1.cgi) was used to predi ct the

secondary structure of each designed ribozyme to determine whether they can proceed to









further study. An example of predicted secondary structure is shown in Figure 2-3. The

ones with correct secondary folding patterns (catalytic core, conservative stem and free

hybridizing arms) will be carried on to in vitro kinetic studies to determine their catalytic

parameters.

In Vitro Kinetic Studies

In vitro kinetic analysis (including time-course and multi-turnover studies) of

hammerhead ribozymes were conducted using commercially synthesized short RNA

oligonucletides. Hammerhead ribozymes and corresponding targets were purchased from

Dharmacon, Inc (Lafayette, CO) in 0.05p~mol scale following the procedure described

previously315. RNA oligonucleotides were synthesized in a protected form including silyl

ethers to protect 5'- hydroxyl (5'-SIL) in combination with an acid-labile orthoester

protecting group on the 2'-hydroxyl (2'-ACE). The deprotection procedure was

conducted following the manufacturer's manual. In general, oligoes were resuspended to

a concentration of 300pmole/pIL in RNase- free water as the stock solution, while

concentrations of 10pmole/CLL and 2pmole/pIL were used as working solution of target

RNA and ribozyme, respectively. Ribozyme in vitro tests started at a reaction condition

at 20mM MgCl2, and ribozymes with high catalytic activities were studied under lower

magnesium concentration (5mM).

Kinase of RNA oligonucleotides

5' ends of target RNA oligonucleotides were labeled with [y32P] ATP (MP

Biomedicals, Irvine, CA) (10 CICi in 1CLL) in a solution with 10pIL total volume

containing 2pIL of RNA oligo (10 pmole/CIl; 20 pmole total), 1pIL of 10x Polynucleotide

Kinase Buffer (Promega, Madison, WI), 1CLL of RNasin (Promega, Madison, WI), 1pIL of









0. 1M Dithiothreitol (DTT) (Sigma, St. Louis, MO), 3CLL of RNase-free water, and 1CLL of

polynucleotide kinase (5 units) (Sigma, St. Louis, MO). The reaction was incubated in

370C for 30 minutes and 65CLL of RNase- free water was added before extracting using

100CLL of phenol/chloroform/i soamyl alcohol. The aqueous layer was purified on a pre-

packed Spin-50 Mini-column (USA Scientifie, Inc., Ocala, FL) according to

manufacturer' s instructions. Radioactive labeled RNA oligonucleotide can be stored in -

200C for 1 week.

Time-course studies of hammerhead ribozyme cleavage

Time-course reaction was set up as following: 13CIL of 400mM Tris-HCI (pH 7.4-

7.5) (Fisher, Swanee, GA), 1CIL of ribozyme (2pmole), and 70CLL RNase-free water were

incubated at 65oC for 2 minutes followed by incubating at room temperature for 10

minutes. Meanwhile, a mixture of RNasin and 0. 1M DTT in a ratio of 1 to 10 and

200mM MgCl2 were prepared. At the end of the incubation, 13CLL of RNasin/0. 1M DTT

mixture and 13CLL of 200mM MgCl2 (final COncentration is 20mM and it can be adjusted

to Einal concentration of 5mM as well) were added followed by 30 minutes of incubation

at 370C. 2CIL of y32P-ATP labeled target and 2CLL of unlabeled target (20pmole) were

added to the reaction. At 0,1,2,4,8,16,32,64, and 128 minutes, 10CLL of volume was taken

out, and 20CLL of formamide dye mix (90% formamide (super pure grade) (Sigma, St.

Louis, MO), 50 mM diaminoethanetetraacetic acid disodium salt (EDTA) (pH 8) (Fisher,

Swanee, GA), 0.05% bromophenol blue (Sigma, St. Louis, MO), 0.05% xylene cyanol

(Sigma, St. Louis, MO)) was added before placed on ice. Samples were denatured at

900C for 2 minutes before chilled on ice and 6CLL of each sample was loaded on 8%

polyacrylamide-8M urea gel. The gel was pre-run for 30 minutes before samples were

loaded. Wells were rinsed to remove urea before loading the sample. After samples









were run about 2/3 length of the gel, the gel was placed in Eixative containing 10% V/V

of Methanol (Fisher Scientifie, Fair Lawn, NJ), 10% V/V of Acetic Acid (Fisher

Scientific, Fair Lawn, NJ), and water for 30 minutes. Dried gels were exposed overnight

in storage phosphor screen cassettes and scanned in Storm Phosphorimager (GE

Healthcare, Piscataway, NJ) for image quantifieation. At each time point, the percentage

of cut target from total target (the sum of cut and uncut target) was calculated, and a

linear range was determined within which the percentage and time form a linear relation.

The time it takes to reach 10-20% cleavage of the full length target was decided and was

used for multi-turnover kinetic analysis.

Inz vitro multi-turnover studies

A ribozyme solution of 0.3pmole/CIL was prepared and target solutions of 30, 3 and

0.3pmole/C1L were prepared as following: to make 150CLL of 30pmole/CIL solution of

target, 15CLL of 32P-labeled RNA oligo, 15CLL of 300 pmole/CLL stock, and 120CLL of

RNase-free water were mixed together; 1:10 dilution was conducted to make 150CLL of 3

pmole/CLL solution, and 100CIL of 0.3 pmole/CIL was made. The experiment set-up is

described in Table 2-1, and the concentration of target can be changed depending on the

amount of target required to reach saturation in time-course reactions. Target solution

was warmed up at 37oC for at least 5 minutes before addition to reactions.

After adding hammerhead ribozyme, tubes were held at 65oC for 2 minutes then at

room temperature for 10 minutes. Then they were held at 37oC for 10 to 30 seconds once

magnesium was added. Following the addition of target solution, reactions were

incubated at 37oC for the time to reach 10-20% cleavage of full-length target (based on

the time course experiment) before stopping the reaction with 20CLL of formamide dye









mix. Samples were run on polyacrylamide-urea gel which was fixed and dried before

exposed in storage phosphor screen cassette for phosphoimager scanning as described in

"Time-Course Studies of Hammerhead Ribozyme Cleavage".

A calibration curve was set up by preparing target dilution following the

description in Table 2-2. These dilutions were filtered through Hybond N+ (Positively

Charged Nylon Transfer Membrane) (Amersham Pharmacia Biotech, Piscataway, NJ) set

in a dot-blot or slot- blot apparatus (BIORAD Life Science Research, Hercules, CA).

The calibration curve analysis gave an equation which related target concentration to

pixel reading of radioactive intensity of target bands. This led to a quantification of

cleavage products in multi-turnover kinetic analysis. By graphing 1/V and 1/S following

Lineweaver-Burke kinetics, parameters (VhAX, Khl, and keat) of respective ribozyme was

determined.

Ribozyme Cloning

To proceed to in vitro evaluation in cell culture of each chosen hammerhead

ribozyme, ribozymes were cloned in the plasmid, pTRUF21-New Hairpin (called p21-

NewHP in short), within HindIII and Spel sites. The map of this plasmid is shown in

Figure 2-4. All the ribozyme sequences are listed in Figure 2-5, and single stranded

(sense and anti-sense) DNA oligoes (Invitrogen, Carlsbad, CA) were purified using 8%

polyacrylamide gel and oligonucleotide bands were cut to elute DNAs in elution buffer

(recipe of elution buffer is described in Appendix C). For each ribozyme, sense and anti-

sense oligonucleotides were annealed, diluted and ligated in HindIII and Spel (New

England Biolabs, Ipswich, MA) digested p21-NewHP plasmid. SURE@ Competent

Cells for Unstable Clones (STRATAGENE, La Jolla, CA) were used for transformation

of ligation products and plasmid DNA extracted from single colonies were sent for









sequencing (ICBR DNA sequencing core, University of Florida). Plasmids containing

correct sequences of respective ribozymes were amplified and DNA extractions were

conducted using CsCl gradient purification protocol or Maximum DNA Extraction Kit

(Sigma, St. Louis, MO).

Results

Four HSV-1 essential genes (ICP4, ICP27, UL20, and UL30 genes) were chosen as

targets of hammerhead ribozymes because of their important roles in HSV-1 lytic life

cycle (e.g. ICP4 gene) or their low G+C base composition (ICP27, UL20, and UL30 genes)

(Figure 2-2). ICP4 gene and ICP27 gene (also called UL54) are immediate early genes,

UL30 gene is an early gene, and UL20 gene is a late gene shown. Their expression in

HSV-1 lytic life cycle is shown in Figure 2-6. For each target gene, among all the

potential candidates, at least two hammerhead ribozymes were designed and they were

tested in vitro for their kinetic parameters using synthesized RNA oligonucleotides (12-

nucleotide long target and 39- nucleotide ribozyme). One example of an in vitro study

including time course cleavage and multiple-turnover analysis is shown in Figure 2-7.

Ribozyme 885 targeting ICP4, which has reasonable catalytic activity, is the only

functional ribozyme designed for ICP4, and it was cloned in p21NewHP for in vitro test

(discussed in Chapter 3). Two ribozymes were designed targeting UL20 gene: although

UL20rz-13 5 was predicted with ideal secondary structure, it has very low catalytic

activity at 20mM MgCl2 COncentration, as shown by its keat/Km (0.1uM^1 min- ) (Table 2-

3). The second UL20 ribozyme, UL20rz-154, indicated excellent in vitro catalytic activity,

with a keat/Km of 15.9uM^1 min' at a low MgCl2 COncentration of 5mM. This ribozyme

was tested in vitro and in vivo described in the Chapter 4 and Chapter 5. Two ribozymes

were designed for UL30 which encodes HSV-1 DNA polymerase. They all showed









reasonable catalytic activity: UL30rz-933 has a keet/m of 3.6uM^1 min' at 20mM MgCl2

concentration, and UL30rz-1092 has a keat/Km of 1.0uM^1 min-l at 5mM MgCl2. UL30rz-

993 was chosen for further test due to its cleavage site located closer to the beginning of

the transcript, and it was tested in vitro as described in Chapter 4. Ribozyme-825

targeting UL54 (ICP27 gene) was chosen for further study due to its high in vitro catalytic

efficiency (a keet/m of 11.7uM^1 min' at 5mM MgCl2), and the other ribozyme targeting

UL54 was discarded due to its low cleavage activity.

Discussions

To design hammerhead ribozymes for gene targeting, there are several criteria that

need to be considered: the accessibility of the target sequence, cleavage sites and

flanking sequences, and the secondary structure of designed ribozyme. Sequence-

specific binding of hammerhead ribozyme to target RNA is the first step for efficient

cleavage, thus a good estimate of the accessibility of target site is necessary. Experience

with antisense-oligodeoxynucleotide (antisense-ODN) methods has been beneficial, and

it has showed that the accessibility of the mRNA to oligonucleotides is restricted by the

secondary structure of the mRNA. Although experimental approaches are more reliable

in identifying oligonucleotide-accessible siteS95,151,250, COmputational methods using

MFOLD software sometimes give reasonable prediction without time-consuming bench

work and high cost. In this study, I eliminated a lot of candidate target genes based on

their G+C composition. The rationale is that high level of G+C content very often gives

complex tertiary structure which is inaccessible to ribozyme binding. The sequence

requirement of the cleavage triplet is any triplet sequence of the NUH type (N: any

nucleotide; H: A,U, or C); the catalytic efficiency of hammerhead ribozyme to different

cleavage triplets decrease in the following order, GUC>CUC>UUC>GUU, AUA,









AUC>GUA, U7UU, UUA, CUA>AUU, CUU.318 After choosing the target, to decide the

ribozyme design, the folding pattern of the ribozyme was estimated using 1VFOLD. A

ribozyme with correct structure of hybridizing arms and helix II without disturbing the

catalytic core was tested in vitro. There are no general rules for the optimal length of

ribozyme hybridizing arm. However, in vitro study indicated that short arms, i.e., less

than 7 base pairs in each binding sequence, can provide fast dissociation from the cleaved

product therefore efficient multiple turnover catalysis.351 In this study, the length of

hybridizing arm is 5 base pairs at the 5' end and 6 at the 3' end.

In order to achieve a successful therapeutic effect using hammerhead ribozyme,

target genes need to be carefully selected. To inhibit HSV-1 viral replication, the knock-

down of target gene expression should have significant impact on viral life cycle, since

HSV-1 genome contains a large number of non-essential genes that have minor

influences in initiating and maintaining viral lytic infection in vitro. In this study, I chose

target gene candidates that were known to be essential for HSV-1 lytic infection.

After designing a hammerhead ribozyme, determination of keat, Km, particularly

keat/Km provide useful descriptions of how efficiently a ribozyme conducts the

transesterifieation of phosphodiester bonds at different substrate concentrations in vitro.

This may reflect the in vivo activity of the ribozyme in which mRNA substrate will

exceed ribozyme concentration. However, in vitro kinetic studies do not necessarily

represent the situation in cells and animals, because cellular proteins can influence RNA

conformation and consequently ribozyme catalytic efficiency by forming complexes with

ribozyme.363 The strategy in this study is to clone selected ribozymes into plasmids and






43


viral vectors to test their biological effects in vitro and in vivo. This will be described in

later chapters.












Table 2-1. Experiment design of in vitro multi-turnover analysis.
Tube(dupes) water 400mM Tris Ribozyme 1:10 RNasin:
HCL,pH7.4 0. 1M DTT

1,11 14 2 0 1
2,12 10 2 1 1
3,13 8 2 1 1
4,14 6 2 1 1
5,15 13 2 1 1
6,16 12 2 1 1
7,17 10 2 1 1
8,18 8 2 1 1
9,19 6 2 1 1
10,20 4 2 1 1
All volumes are in microliters. Ribozyme concentration is 15nM.


200mM
MgCl2


Target


1
4
6
8
1
2
4
6
8
10


Target solution used
Molar ratio Rz:target

3 pm/ul
3pm/ul 1:40
3pm/ul 1:60
3pm/ul 1:80
30pm/ul 1:100
30pm/ul 1:200
30pm/ul 1:400
30pm/ul 1:600
30pm/ul 1:800
30pm/ul 1:1000









Table 2-2. Preparation of calibration curve for multi-turnover kinetics analysis.
Tube water microliters Target Target solution used pmole of target
(dupes)
1,13 100 0 0
2,14 99 1 0. 3pm/mi crocliter 0.3
3,15 98 2 0. 3pm/mi crocliter 0.6
4,16 96 4 0. 3pm/mi crocliter 1 .2
5,17 94 6 0. 3pm/mi crocliter 1.8
6,18 92 8 0. 3pm/mi crocliter 2.4
7,19 99 1 3 pm/microliter 3
8,20 98 2 3 pm/microliter 6
9,21 96 4 3 pm/microliter 12
10,22 94 6 3 pm/microliter 18
11,23 92 8 3 pm/microliter 24
12,24 90 10 3 pm/microliter 30




Table 2-3. Summary of in vitro kinetic analysis of all the hammerhead ribozymes
designed against HSV-1.
Kinetic Properties Of Hammerhead Ribozymes With Synthetic HSV RNA Substrates

Genearet M~g mM keat (min ) Km(uMl) keat/Km (uM- lmin ') Development Status
ICP4-885 20 15.87 52.83 0.3 Ongoing
ICP4-533 5 & 20 NA NA NA Discarded
UL20-135 20 0.08 5.64 0.01 Discarded
UL20-154 5 27.78 1.75 15.9 Ongoing
UL3 0-93 3 20 9.26 2.57 3.6 Ongoing
UL30-1092 5 22.99 23.59 1.0 Pending
UL54-233 5 0.91 8.58 0.1 Discarded
UL54-825 5 51.28 4.44 11.7 Ongoing

NA: No activity. Ribozymes that are labeled as ongoing were cloned in plasmid vector
pTRUF21NewHairpin as well as packaged in an adenovirus vector for cell culture and in
vivo studies; the ones labeled as "Pending" will be used as an alternative for future study.























UU-turn


Figure 2-1. Structure of a hammerhead ribozyme. Substrate binding domains of the
hammerhead ribozyme bind to target sequence to form Helix I and III (stem I
and III), and the length of each hybridizing arm may varies without affecting
cleavage efficiency. The catalytic core, the loop area, which is highly
conservative, is essential for ribozyme activity (modified from
http://www.rwvg-b ayreuth. de/chemi e/chim e/rna/fram es/hambtx. htm) .


Stem III U -- A
G-C
iiRibozyL~ me"r C -- G "cSubstrate"
C-6 8 leva


A G G UC GC;C 3'

CCAGCGGs'
g- Stem I
A1 g


e site


~Stem II
A
GGCC

, CC G 8












































Figure 2-2. The composition of G+C in HSV-1 genes using Vector NTI. Blue area
indicates the percentage of G+C content in each sequence investigated; yellow
area is the gene sequence flanking the gene of interest; the scale of Y axis in
each panel is 100% maximum, and 20% minimum in the composition of G+C;
X axis represent the base number of each sequence in HSV-1 genome. Figure
A shows a representative sequence from ICP4 gene coding sequence, in which
high G+C composition is generally observed, and sequences contain relatively
low G+C are labeled as 75% and 67.5% respectively. B: a representative
sequence from ICP27 gene coding sequence; C: coding sequence of UL20
gene; D: a representative sequence from UL30 gene coding sequence.











ccconmlx


Figure 2-2. (continued.)










SI


d =-10! 3 [iiily 1.) ULt ic

Figure 2-3. Prdicted foldin pattern for iboyeU5-25uigMOD


none


Figure 2-4. The map of plasmid pTR-UF21-NewHairpin for ribozyme cloning.















UL20 R2154

SUCOCOUCUUCCQ
"AGCGCA AAGGC
A CU


A U
G AG
C-G
G-C
C-G
G-C
G U
CU




SCAUCCUCUUCOU3
'GUAGGA, AAGGA"
A CU


A U
G AG
C-G
G-C
C-G
G-C
GUV
CU

ICP4 R2588


UL30 R2933

GQUUCOUCACCUU'
CGAAGCA UGGAA'
A CU

A U
G AG
C-G
G-C
C-G
G-0
G U
CU




IUGUCOUCCAGAA'
'AGAFGA GUCUU
A CU

A V
G AG
C-G
G-C
C-G
G-C
G U
CU

UL54 Rr2533


UL20 R2135

'UUUUGUCAGUUCr
AAAACA UCAAG
A CU

A U
G AG
C-G
G-C
C-0
G-C
G U
CU




A~CAGOUCAUGCA
ZUGUCCA UACOU
A CU

A U
G AG
C-G
G-C
C-G
G-C
G U
CU

UL54 RrZ825


Figure 2-5. Ribozyme sequences and their respective target sequences.










RELEASE


I\TTC~ENT PENERIRATION











DNA REPLICATION -




TRaNscRIPTON


IMMEDIATE EARLY EARLY ~LAE
PROTEINS PROTEINS PROTEINS


Figure 2-6. Gene targets for hammerhead ribozymes in HSV-1 lytic life cycle. Four
HSV-1 essential genes were chosen as targets of hammerhead ribozymes.
ICP4 and ICP27 genes are immediate early genes; they have been suggested
to be essential to HSV-1 lytic infection in vitro, especially ICP4 which is a
maj or transcriptional regulator to basically all the HSV-1 genes. UL30 gene is
an essential early gene which encodes the viral DNA polymerase, and UL20
gene is a late essential gene. By knocking down the expression of these HSV-
1 essential genes, it is expected that a corresponding event (immediate early
transcription, early, or late transcription) can be stopped leading to an inhibition
viral infection.







51


A. B.
RearctionTme Milnutes) 0 90

l~bp 70
a60

g 40
cleauale a 30



0 SO 100 150
a ~Time ( minutes)
C.
0.010

o.one

o.oos +






401006 48002Z 00002 0 .0006 0.0010 00014 0.0018

1/S
Figure 2-7. hz vitro kinetic study of hammerhead ribozyme UL20-154. A)
Autoradiogram of the time course of cleavage of an RNA target (end labeled
with y-32P-ATP) by ribozyme UL20-154 at a magnesium concentration of
5mM. B) The percentage of target RNA cleavage in each time point can be
calculated from quantification of cut and uncut target bands in Figure 2-7-A.
C) Lineweaver-Burke Plot ofRibozyme UL20-154 Cleavage of Synthetic
HSV RNA Target. Least squares regression analysis generated a best fit line
y 4.213x + 0.0024 with correlation coefficient R2 0.978. After setting up
multiple-turnover analysis of UL20-154 ribozyme in 5mM Mg2+ COncentration,
the quantitation data was fit in the Lineweaver-Burke plot.














CHAPTER 3
STUDIES OF RNA GENE THERAPY TARGETING ICP4 MRNA OF HERPES
SIMPLEX VIRUS

Introduction

Genes of herpes simplex virus (HSV) can be categorized into three kinetic classes:

immediate-early (IE or a), early (E or P), and late (L or y) genes.l5 During the lytic

infection, HSV gene product synthesis is regulated in a highly organized cascade manner.

Genes from each class contain different components of regulatory elements which define

the dynamics of its transcription by cellular RNA polymerase II (pol II) transcriptional

machinery.4,74 The complexity of promoter structures of genes from each class decreases

from IE to E to L.375,384 Five immediate early (IE) genes, ICP4, ICPO, ICP22, ICP27, and

ICP47, constitute the first set of genes to be transcribed upon HSV-1 infection and are

maximally expressed at approximately 2-4 hours post-infection. "' These IE genes are

expressed with the help of VPl1621,45, a viral transactivator which is contained in the

tegument. VPl6 associates with cellular Oct-1 and host cell factor (HCF) to bind

TAATGARAT elements (where R represents A or G) which are found exclusively in IE

gene promoters to activate transcription from them.110,268 SP1 sites as well as other sites

for binding of cellular cis-acting factors also contribute to the enhanced transcription of

viral IE genes.114 As a key transcriptional regulator, ICP4 gene of HSV is essential for

the expression of virtually all the genes of viral productive life cycle.187,382

As an immediate early gene, ICP4 is expressed about 2-4 hours post-infection in

the absence of other de novo synthesized viral proteins.299 The same as other a genes,









ICP4 promoter contains consensus sequence 5' -GyATGnTAATGArATTCyTTGnGGG-

3' upstream of the cap site226-228 which binds Oct-1. By binding to a complex of the viral

proteins VPl6, HCF, cellular Oct-1, and other transcriptional factors, the consensus

sequence acts as a response element to promote the expression of a genes.192-195,246 ICP4

is a large and structurally complex protein: its mobility on sodium dodecyl sulfate-

polyacrylamide gel electrophoresis (SDS-PAGE) responds to a molecular weight of

175KDa7 and it exists in the cells as a homodimer with a strokes radius of 89A+.242,317

Considering its hydrodynamic properties, this elongated protein can bind to DNA and

function as a transactivator of transcription over a long distance. However, ICP4 does

not require specific DNA binding sites for its activation, it can activate transcription from

a variety of promoters. Of all the a gene products, ICP4 protein, functioning in a

poly(ADP- ribosyl)ated form, is absolutely essential for P and y gene expression beyond

a phase of a lytic infection.72,87,88,91,101 As a transactivator, ICP4 increases the rate of

transcription complex assembly on promoters.126 ICP4 protein also down-regulates a

gene expression, including its own, by binding to cognate DNA binding sites located

across the transcription initiation sites and interacting with basal transcriptional

factors. 128,198

ICP4 protein functions by interacting with basal transcriptional machinery of RNA

polymerase II (RNA Pol II). In the eukaryotic system, structural gene transcription

requires the assembly of pre-initiation complex on the core promoter including RNA Pol

II and general transcription factors (GTFs) (TFII A, B, D, E, F, H). Although there are

different element requirements for a full activity of HSV early and late gene promoters,

interactions of TATA box and GTFs are essential for initiating transcription of both









kinetic classes of genes. Binding of Transcription Factor II D (TFIID) to the TATA box

via TATA-box binding protein (TBP) is critical for pre-initiation complex assembly.

However, efficient responses to cellular and viral trans-activators (SP1 and ICP4) require

TBP-associated factors (TAFs). Their interactions with each other, with other GTFs, and

with specific DNA sequences (e.g., the initiator element which overlaps the transcription

sites) contribute to promoter selectivity.174 It was suggested that ICP4 interacted with

TAF250 of TFIID via its C-terminal domain.5

Herpes simplex virus early and late genes have distinct promoter structures which

have different requirements in terms of ICP4-specific transcription activation. A study

using non-fusion forms of ICP4 linked to either an early gene (tk) promoter or a late gene

(gD) promoter revealed that ICP4 residues 97 to 109 are required for induction of gD

promoter but not for tk promoter.39 It has been suggested that GTF TFIIA is essential

for ICP4 activation of HSV early gene transcription but is not required for late gene

transcription402, indicating the elegant regulation of HSV gene expression cascade

through ICP4.

Because of the critical role in HSV lytic infection, ICP4 has attracted significant

attention as a target for antiviral therapy. Antisense oligonucleotides were explored in

cell culture for antiviral effect by targeting the acceptor splice junction of ICP4 pre-

mRNA.176,325 Although they were also tested in BALB/c mice and showed certain

inhibitory effectl99, the delivery approach and survival rate of those antisense

oligonucleotides were limiting factors for antiviral therapy application. A chemical that

can block Spl binding (e.g., tetramethyl-O-NGDA (M4N), a synthetic derivative of the

naturally occurring nordihydroguaiaretic acid (NDGA)), which consequently interrupts









ICP4 expression, was demonstrated for its antiviral effect but with limited therapeutic

effects.56 A ribozyme derived from Escherichia coli (E.coli) RNase P was engineered

targeting HSV-1 ICP4 mRNA and in vitro it significantly reduced ICP4 expression with

certain inhibitory effect against viral replication in cell culture.355,358 Zinc finger

proteins274 (engineered three or six-finger protein) are very potent suppressors for

initiation of transcription. Recently, they have been designed and tested in vitro against

ICP4 gene promoter. These zinc finger proteins led to certain levels of reduction of ICP4

expression and early/late gene expression level.274 It was suggested from these studies

that targeting only the ICP4 gene might not provide significant effect in inhibiting viral

replication. In summary, in these studies in vitro systems that were not permissive for

HSV-1 viral replication were used to test these antiviral reagents. None of the in vivo

data obtained indicated a therapeutic effect by knocking down ICP4 expression. No

delivery method was suggested or tested for gene therapy purposes. They also suggested

that a threshold level of ICP4 gene expression, which may be very low, can provide

sufficient function for viral growth. Therefore, it might be very difficult to significantly

knock-down ICP4 level to affect HSV-1 lytic infection. However, a therapeutic effect

may be achieved from a synergistic effect by targeting multiple targets including ICP4

gene.

In this study, I designed and tested hammerhead ribozymes targeting ICP4 mRNA

of HSV-1. These studies were conducted in a permissive in vitro system for HSV-1

infection using HSV-1 strains with high infectivity. The application of using siRNA for

anti-HSV-2 effect was also explored by targeting ICP4 mRNA of HSV-2.









Materials and Methods

Inz Vitro Test of Hammerhead Ribozyme ICP4-885 Targeting ICP4 mRNA of HSV-1

Ribozyme ICP4-885 and other ribozymes (mentioned in Chapter 2) were cloned

into a plasmid called pTRUF21-New Hairpin between restriction sites of HindIII and

Spell following protocol of ribozyme cloning (Chapter 2) and plasmid construct

containing ICP4 ribozyme is called pTR2 1NewHP-ICP4rz-885 (abbreviation as p21-

ICP4rz). The sequences of all the ribozymes and their respective targets are shown in

Table 3-1.

Transient transfection of E5 cells with ribozyme ICP4-885 to detect ICP4 mRNA
Level

The E5 cell line, African green monkey kidney cell which was constructed to

express the ICP4 gene, was used for this study (a generous gift of Dr. Priscilla Schaffer).

A transient transfection of pTR-UF 11 (GFP containing plasmid, map see Figure 3-1) was

conducted using Lipofectamine 2000TM (Invitrogen, Carlsbad, CA) at various ratios of

plasmid DNA amount (Cpg) to Lipofectamine 2000TM reagent (CLL) and following the

manual of Lipofectamin 2000TM. Ratios of DNA to Lipofectamine 2000TM reagent were:

4Cpg to 4CLL, 4Cpg to 8CLL, 4Cpg to 12CLL, 5Cpg to 10CLL, and 5Cpg to 15CIL. At one day post-

transfection, cells were examined for their GFP expression level by fluorescence

microscopic observation as well as flow cytometry analysis (FACScan, BD Biosciences,

San Jose, CA) to determine the transfection efficiency. The optimal transfection

condition was used to conduct further tests. Each well of a 6-well-plate was seeded with

3x105 cells one day before transfection, and for each group, the transfection was

conducted in triplicate. There were four groups in this test: mock transfection, pTRUF21

transfection, pTRUF21-ICP4rz, and pTRUF11 (GFP containing plasmid). At 48 hours









post-transfection, two wells of GFP-transfected cells and a well of mock transfected cells

were analyzed by flow cytometry analysis to detect transfection efficiency; the remaining

cells were harvested using TRIZOL@ Reagent (Invitrogen, Carlsbad, CA). Total RNA

extraction was performed following TRIZOL@ protocol and DNA-freeThl (Ambion,

Austin, TX) was used to remove DNA contamination. Total RNAs were inspected via

the spectrometry (Gene Spec III, MiraiBio Division, Alameda, CA) at a wavelength of

260nm and the quality of RNA was assessed using a ratio of the absorption at 260nm

divided by that at 280nm ranging from 1.8 to 2.0. Reverse transcription was conducted

using First-Strand cDNA Synthesis Kit (Amersham Biosciences, Buckinghamshire, UK)

with l Cyg total RNA in each reaction. Conventional PCR was conducted using cDNA

(1/5 of total reverse transcription reaction for each PCR). HotStarTaq DNA polymerase

(QIAGEN, Valencia,CA) was used in PCR at 950C for 15 minutes (1 cycle); 940C for 3

minutes, 550C for 3 minutes, 720C for 3 minutes (1 cycle); 940C for 1 minute, 550C for 1

minute, 720C for 1 minute (30 cycles); 720C for 10 minutes. PCR products were

separated on 8% acrylamide gel and stained with SYBR Green I nucleic acid gel stain

(Molecular Probes, Eugene, OR). Images were obtained using Storm Phosphorimager

(GE Healthcare, Piscataway, NJ) and quantification was conducted using ImageQuant

software (Molecular Dynamics, Sunnyvale, CA).

Construction of a stable cell line expressing ribozyme ICP4-885

RS cells (rabbit skin cells), maintained in Eagle's minimal essential medium (MEM,

Life Technologies) supplemented with 5% calf serum, 250U of penicillin/mL, 250Cpg of

streptomycin/mL, and 292Cpg of L-glutamine/mL (Life Technologies), were used to

construct the stable cell line expressing ribozyme ICP4-885. Each well of a 24-well-plate

was seeded with 8x104 Of RS cells the day before transfection; LipofectamineTM and









PlusTM reagents (Invitrogen, Carlsbad, CA) were used for transfection using the

recommended conditions (DNA: PlusTM: LipofectamineTM of 0.8Cpg: 1CLL: 3CLL). On the

second day of the transfection, transfected cells were diluted 5-10 fold and selected in

medium containing G418 disulfate (Research Products International Corp., Mt. Prospect,

Illinois). The concentration of G418 disulfate began at 600p~g/mL and was gradually

reduced to 500p~g/mL, 400Cpg/mL, 300Cpg/mL, and eventually 250Cpg/mL. After 3 weeks

of selection, single colonies were picked to grow in 96-well-plates, and then amplified in

24-well-plates, 6-well-plates and finally 10cm2 dishes. Ribozyme expression levels of all

the colonies were compared using reverse transcription of total RNA harvested from the

same amount of cells followed by conventional PCR. PCR was conducted with an

addition of radioactive a32P-dATP (MP Biomedicals, Irvine, CA), and PCR products

amplified by ICP4 primers as well as p-actin primers (Table 3-2) were detected on 8%

acrylamide gels. Dried gels were exposed overnight in a storage phosphor screen cassette

and scanned in Storm Phosphorimager (GE Healthcare, Piscataway, NJ) to detect the

radioactive labeled PCR product. ImageQuantTM software (GE Healthcare, Piscataway,

NJ) was used to quantify the intensity of PCR product. The colony with highest ratio of

ribozyme level to p-actin level was selected to test against HSV-1 infection.

Herpes simplex virus type 1 infection

17syn+ (considered a wild-type HSV-1 strain) was used to conduct infection. A

series of dilutions of HSV-1 viral stock were prepared in Eagle's minimal essential

medium containing 5% calf serum, 250U of penicillin/mL, 250Cpg of streptomycin/mL,

and 292Cpg of L-glutamine/mL (Life Technologies, Inc., Gaithersburg, MD). One hour

incubation at 370C in 5% CO2 WAS allowed for the virus to absorb in a minimal amount

(200CLL) of medium covered on a monolayer of cells. Infection medium was replaced









with regular serum-containing medium after the incubation. Different times of

incubations were allowed before cells were harvested or stained with dye (plaque

reduction assay).

Herpes simplex virus type 1 viral stock preparation

The virus was amplified and titrated on rabbit skin cells by using Eagle's minimal

essential medium (Invitrogen-Life Technologies, Carlsbad, CA.) supplemented with 5%

calf serum (Life Technologies, Inc., Gaithersburg, MD), 292 Clg of L-glutamine/ml, and

antibiotics (250 U of penicillin/ml and 250 Clg of streptomycin/ml). The infection of a

monolayer RS cells at an MOI of 10-2 was performed when the cells reached 80%

confluency. Complete cytopathic effect (CPE) was observed before cells and medium

were harvested to pellet the cells at 10,000xg at 40C in a SorvallTM GSA rotor (Thermo

Electron Corporation, Asheville, NC) for 40 minutes. The cell pellet was resuspended in

MEM complete medium containing 5% calf serum and frozen-thawed twice using a -

800C freezer and a 370C water-bath before the cell lysate was distributed in aliquots.

Virus stocks were maintained in 20-100CLL aliquots (depending on the purpose) using

2.0mL screw-cap tubes and stored in -800C freezer. One vial of viral stock was thawed

out and titrated before use in animals or cell cultures.

Plaque reduction assay to determine viral titer

RS cells were used for plaque reduction assay (PRA), seeding lx105 cells per well

in each 24-well-plate. 10pIL of viral stock was resuspended in 990CLL of MEM to make

10-2 dilution of infection solution, and from 10-2 dilution 1mL of each 10-3 to 10-9

dilutions were made. For each dilution, infection was conducted in triplicate and 200pIL

of each dilution were added to each well of cells. One hour incubation was allowed for

viral attachment and viral entry. Cells were rinsed by PBS then covered by 2mL of









regular medium containing 0.3% human IgG (Purified Immunoglobulin Technical Grade)

(Sigma, St. Louis, MO). For 17syn+ strains, 2 days were required for plaques to develop

and for KOS strains plaques show in 3 days.

Transient transfection of pTRUF21-New Hairpin containing ribozyme ICP4-885

E5 cells were seeded in 3.5cm dishes at a density of 2x105 cells per plate one day

before transfection. Three groups of transfections were included: mock transfection

(MT), control plasmid transfection using pTRUF21NewHairpin (Con), and ribozyme

transfection using pTRUF2 1NewHairpin-ICP4rz-885 (ICP4rz). Transfection of each

group was conducted in triplicate using Lipofectamine 2000TM (Invitrogen, Carlsbad,

CA) at a DNA to Lipofectamine 2000TM ratio of 10Cpg to 10CIL. The transfection

procedure followed Invitrogen Lipofectamine 2000TM prOtocol. E5 cells were maintained

in Eagle's minimal essential medium (MEM, Life Technologies, Inc., Gaithersburg, MD)

supplemented with 10% fetal bovine serum (FBS, GIBCO/ Invitrogen, Carlsbad, CA),

250U of penicillin/mL, 250Cpg of streptomycin/mL, and 292Cpg of L-glutamine/mL (Life

Technologies, Inc., Gaithersburg, MD). Two days after transfection, E5 cells were

infected with KD6 (ICP4 defective HSV-1 strain)92 at an MOI of 3 for 24 hours before

cell lysates were harvested for plaque reduction assay.

Inz Vitro Test of a siRNA ICP4-19 Targeting ICP4 mRNA of Herpes Simplex Virus
Type 2

siRNA ICP4-19 was originally designed by Suresha Rajiguru, a Master student at

the University of Florida. The siRNA duplex sequences as well as the target sequence

are shown in Table 3-3. HeLa cells were cultured in 10%FBS containing Dulbecco's

Modification ofEagle's Medium (DMEM) (Cellgro, Mediatech, Inc., Herndon, VA)

supplemented with 250U of penicillin/mL, 250Cpg of streptomycin/mL (Life









Technologies, Inc., Gaithersburg, MD). Transfection of siRNA duplex was conducted

using OligofectaminewM Transfection Reagent (Invitrogen, Carlsbad, CA). A scrambled

siRNA, kindly provided by Dr. Marina Gorbatyuk, served as the transfection control.

Each well of the 12-well-plate was seeded with 1x105 cells one day before the

transfection. Transfection was conducted in the presence of serum but no serum was

added until duplex-oligofectamine complex formed. OPTI-MEM" I Reduced Serum

Medium (GIBCO", Invitrogen Corporation, Carlsbad, CA) was used during transfection

process. 100pmole of siRNA duplex and 2CLL of oligofectamine reagent were used for

transfecting each well of cells. A four-hour incubation was allowed while in the presence

of serum for transfection and the transfection medium was replaced by 10O%FB S

containing DMEM supplemented with 250U of penicillin/mL, 250Cpg of

streptomycin/mL. After the overnight culture, cells were tested for transgene function.

Infection using HSV-2 (strain HG52) was conducted at an MOI of 3 after

transfection of HeLa cells with siRNA duplexes. To evaluate the siRNA effect on HSV-

2 ICP4 gene expression level, reverse transcriptions (RT) followed by real-time PCR was

conducted to detect the ICP4 expression. Copy DNA (cDNA) from each RT- reaction

was diluted 10-fold before the real time PCR assay. Specific primers and a fluorescent

probe for either ICP4 (sequences are shown in Appendix B) or RNase P (sequences of

primers and probe are not available) were designed and synthesized by ABI system

(Applied Biosystems, Foster City, CA) (Assays by Design part no. 4331348) with

concentrations recommended by the supplier. Real-time PCR was performed using

TaqMan Universal PCR Master Mix, No AmpErase uracil N-glycolase (Applied

Biosystems, Foster City, CA). All real-time PCR reactions were performed and analyzed









using ABI Prism 7700 or 7900 sequence detection systems (Applied Biosystems) (ICBR

Protein Chemistry Core Facility, University of Florida). Cycle conditions used were as

follows: 500C for 2 min (1 cycle); 950C for 10 min (1 cycle); and then 950C for 15 s

followed by 600C for 1 min (45 cycles). Threshold values used for PCR analysis were

set within the linear range of PCR target amplification.

Results

Ribozyme ICP4-885 Inz Vitro Test against HSV-1 Target

Effect of transient transfection of ribozyme ICP4-885 to ICP4 expression level in E5
cells

Transient transfection of ribozyme ICP4-885 in E5 cells caused significant

reduction in ICP4 expression levels (Figure 3-2A). A semi-quantitative reverse-

transcription PCR was conducted to compare ICP4 mRNA level after ribozyme treatment.

As shown in Figure 3-2B, ribozyme ICP4 885 reduced the level of ICP4 expression by

42% (compared with a control transfected group). However, the difference in ICP4

levels between ribozyme and control groups of E5 cells was not statistically significant.

This is probably because ICP4 expression levels in the cell are already extremely low

without HSV-1 infection, since the cell line was constructed to express ICP4 from the

original viral promoter.

Transient transfection of pTRUF21-New Hairpin containing ribozyme ICP4-885 in
E5 cell line to test against KD6 (ICP4- HSV-1) viral replication

To further investigate ribozyme effect on ICP4 expression level, the ribozyme

ICP4-885 was used to transfect E5 cells followed by KD6 infection at an MOI of 3. The

rationale for this experiment was that KD6 viral infection is turned on by constitutive

expression of ICP4 provided by E5 cells, so the reduction of ICP4 expression will be

indicated by a lower level of infectious viral particles in the ribozyme treatment group









than those in control groups. However, transfection efficiency in E5 cells was very low

(7% in the optimal condition) and transfected cells could not be enriched by antibiotic

selection. (E5 cells were constructed using neomycin resistant gene as selection marker

which is the same as ribozyme expressing plasmid.) Although it did not reach statistical

significance, there was a mild reduction (20%) of viral yield in the ribozyme treatment

group as shown in Figure 3-3.

Cell Line stably expressing ribozyme ICP4-885 tested against wild-type herpes
simplex virus type 1 (17syn+)

RS cells were stably transfected with ribozyme ICP4-885 and one single colony

with highest ribozyme expression level was selected. In Figure 3-4-A, an example of

ribozyme expression is shown. Cells from this colony were used to test against wild-type

HSV-1 (17syn+) infection at an MOI of 10-3. At different time points, cell lysates were

used to conduct plaque reduction assay to observe ribozyme effect on multiple rounds of

viral replication. A separate group of cells were stained with crystal violet at each time

point to observe the plaque forming phenotypes. At an early time point (24 hours post-

infection), a significant reduction of viral production level (88%) was observed in

ribozyme expressing cells by plaque reduction assay (data not shown). At three days

post-infection, significantly reduced plaque production as well as smaller plaque size was

observed when cells were stained with crystal violet as shown in Figure 3-4-B. However,

when plaque reduction assay was employed to quantify viral yields from cells paralleled

to those from Figure 3-4-B, no difference was observed between control cells and

ribozyme expressing cells.









Transient Transfection of siRNA Targeting ICP4 mRNA of Herpes Simplex Virus
Type 2 in HeLa Cells

An siRNA designed targeting HSV-2 ICP4 mRNA and transfection controls were

used to transiently transfect HeLa cells followed by wild-type HSV-2 (strain HG52)

infection at an MOI of 10-3. Viral replications at a series of time points (15, 24, 50, and

75 hours post-infection) were compared using a plaque reduction assay to estimate the

siRNA effect. Compared with control siRNA treatment, transfection of siRNA-19

significantly reduced HSV-2 viral yield by 63%, 63%, 70%, and 49% respectively at 15,

24, 50, and 75 hours post-infection. However, when HSV-2 ICP4 mRNA level was

compared among three groups using reverse transcription and real-time PCR, there was

no significant difference observed (data not shown) among three groups (Mock

transfection, control siRNA, and siRNA-19 transfected groups). ICP4 mRNA was

observed following a very high level of infection (MOI of 3), while siRNA-19

transfection reduced HSV-2 yields at a multiplicity of infection 3000 times lower (an

MOI of 10-3.

Conclusions and Discussion

Although HSV-1 and 2 both belong to alpha-herpes family, they are different in a

lot of aspects, indicating the difference in virion release. However, the ICP4 gene

product for both HSV type 1 and 2 shares not only sequence but functional similarity.

They are immediate early genes and function to initiate downstream events. ICP4 has

been a very popular target for gene knockdown in the past, but no success was observed

from the therapeutic aspect. In this study, ribozyme and siRNA targeting ICP4 were used

against wild-type HSVs under rigorous high multiplicity infection conditions that is more

extreme than those conditions used in previous studies in the literature in order to select









for candidates for therapeutic purposes. It has been suggested that HSV requires an

extremely low threshold level of ICP4 gene product to initiate lytic infection.3 Therefore,

it could be very difficult to block viral replication by reducing expression of this protein.

After scanning all the possible cleavage sites in ICP4 mRNA of HSV-1, one hammerhead

ribozyme with good kinetic parameters was chosen to test in tissue culture. Although this

ribozyme significantly reduced ICP4 gene expression in an ICP4 expressing cell line,

when tested against HSV-1 viral replication (either wild-type HSV-1 or ICP4 defective

virus in permissive cell line), it did not block infectious viral particle production to a

statistically significant level. However, this ribozyme caused some reduction at the very

early stage of HSV-1 replication as shown in the ribozyme expressing cells which had the

phenotype of smaller plaque size and fewer plaques than control cells infected by HSV-1

(shown in Figure 3-3B). At the later time point, this effect was overcome by active viral

replication induced by the accumulation of ICP4. This may explain the phenomenon that

no difference was observed in the infectious viral particle production level between

control and ribozyme expressing cells.

RNA interference (RNAi) is a conserved biologic response to double-stranded

RNA that results in the sequence-specific silencing of target gene expression. Although

the siRNA designed against HSV-2 ICP4 mRNA was able to delay viral replication and

reduce infectious particle production level, it did not reduce the ICP4 mRNA level

implying a complex effect caused by siRNA-19 in the cells: The high level of viral

infection might overwhelm the siRNA effect by providing high level of ICP4 expression

which implied the limitation of this siRNA effect. On the other hand, siRNA-19 might

also function as microRNA targeting either ICP4 mRNA or other gene transcripts,









causing a reduction in viral yield but not leading to a dramatic change in RNA level. The

inhibition of viral replication may be both specific and non-specific.

In conclusion, because of the important role of ICP4 in HSV lytic infection life

cycle, it is a good target for inhibiting HSV infection if a significant reduction of ICP4

mRNA can be achieved. However, considering that the functional threshold level of

ICP4 is extremely low, ICP4 gene by itself might not be an ideal target to eliminate HSV-

1 infection. It can be expected that a synergistic effect can be achieved by combining

ribozymes/siRNAs targeting other essential genes in addition to ICP4.












Table 3-1. Riboye seuences and suences of their respetve trets.
Ribozye Label Ribozyme Seunce Resetive Targ~et Seqence
ICP4-885 acaactgtacg~cttcggcgcgaagt catcctcttcg~t
ICP4-533 tcgatctgatacg~cttcgccgaacccg cgcg~tcateg
UL20-135 gaactctgatgagcgcttcggcgcgaaacaaaa ttttgtcagttc
UL20-154 cggaactcagacgcttcgcgcaagg tcgcgcttccg
UL30-933 agttaacgtcgggcaaacgaac gtctcacctt
UL30-1092 cacatctgatgagcgcttcggcgcgaaagcttg cacctt
UL54-233 ttctgctgatgagcgcttcggcgcgaaacgaga tctcgtecagaa
UL54-825 tgcatctgatgagcgcttcggcgcgaaacctgt acaggtcatgca





Table 3-2. Conventional PCR primers.
Primer Label Primer Sequence
HSV ICP4 sense 5' -CTGATCACGCGGCTGCTGTACACC- 3'
HSV ICP4 anti-sense 5' -GGTGATGAAGGAGCTGCTGTTGCG-3 '
Rabbit p3-actin sense 5'- AAG ATC TGG CAC CAC ACC TT- 3'
Rabbit 13-actin anti-sense 5'- CGA ACA TGA TCT GGG TCA TC- 3'





Table 3-3. siRNA duplex sequences and target sequences.
Name Sequence
siRNA ICP4- 19 Target Sequence 5'- AAGAAGAAGAAGACGAC GACG-3'
siRNA ICP4- 19 Duplex Sequence 5'- GAAGAAGAAGAC GAC GAC GUU-3'
3'- UUCUUCUUCUUCUGCUGCUGC-5'
Scramble siRNA Target Sequence CUUC CUCAC GCUCUAC GUC
Scramble siRNA Duplex Sequence 5' -AACUUCCUCACGCUCUAC GUC-3'
3 '-GAAGGAGUGC GAGAUGC AGUU-5 '







68






b-ach~rt promoter




pTR-UF11


CelE1 ort 70 bGF~h

8V40pogA)
TR~ PYF41mhehncer
bGH poMA) IlBV-tk
neen~

Figure 3-1. Map of plasmid pTR-UF 11 generated by Vector NTI.










A.
ICP4 Expession
I 2 3 4 5 6 7 8



100bp
Beta-actin Exanrssion


g~IrrT1


2006p

100bp


1: Moelar ize market
2: Positive ~ontrol for ICP4 (or beta-acta)
3: Mockd trans~fected cellsE at 2-day posr-transfecaou
4C: pTRUF1Z NewHp turanfctd cells at 2-day post-trasfcction
5: ICP4 ribozyme 885 t~ansfcered cell at ?-day post-ran~sfection
r6: Mock transfected clls at 3-day post-t~rasfectiPon
7: pTRUF2 TNewHpH trnsfectd cells at 3-dayr potst-trnsfect8ion
8: ICP4W nbozyme 885 Iransfcstedl clls at 3-day post-tranLsfKctIo


B.

Detection of ICP4 Gene Expression in Ribozyme
Transfected E5 Cells

0 35



0 25-
S02-


0 35

H MT 0 pTRUF21-NewHp H 16bozyme ICP4-885

Figure 3-2. Reduction of ICP4 expression level in E5 cells by transient Transfection with
ICP4rz-885. A) PCR amplification of reverse-transcribed ICP4 RNA isolated
from E5 cells separated on 1.5% agarose gel. Transient transfection of the
plasmid containing ICP4rz-855 as well as controls (mock transfection and
transfection of plasmid without the ribozyme) was conducted, and total RNAs
were harvested at day 2 and day 3 post-transfection for reverse-transcripti on
and PCR. Primers for ICP4 and p-actin were used for PCR. B)
Quantification of the PCR product amplified from cDNAs resulted from ICP4
ribozyme treated and control treated E5 cells. Total RNA was harvested from
E5 cells treated with ribozyme ICP4-885 or with control treatments at the time
point of 2 day post-infection of HSV-1. Reverse-transcription followed by
PCR was conducted, and PCR products were separated on 8% acrylamide gel
and stained by SYBR" Green nucleic acid dye for quantifications.











Effect of ICP4 Ribozyme 885 on KD6 Viral Replication


SMock Transfection B pTRUF21NHp ICP4rz-885


Figure 3-3. Effect of ribozyme ICP4-885 on KD6 viral replication in E5 cell line. E5
cells, constructed to express ICP4 constitutively, were transfected with a
plasmid expressing ribozyme ICP-885 followed by infection of HSV-1 strain
KD6 which is non-replicating HSV-1 with ICP4 deletion. Mock transfection
and transfection using plasmid without ribozyme were used as controls. In
this experiment an MOI of 3 was used for KD6 infection. Twenty four hours
after HSV-1 infection, cell lysates were harvested for plaque reduction assay
on RS cells.






























0 Pool D1 0 D2 H D4 H D5 B4 O B5 O B7


Expression Level of ICP4 ribozyme in Single Clones
radioactivee RT-PCR)


0.45
0.4
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0


Figure 3-4. Inhibition of wild-type HSV-1 viral replication rendered by ICP4 ribozyme-
885 function. A) After selection under G418, 7 single colonies (DI, D2, D4,
DS, B4, B5, and B7) were isolated and reverse transcription followed by
radioactive labeled PCRs was conducted to compare ICP4 ribozyme-885
expression level. One of the single colony named as B5 has the highest
ribozyme expression level, and it was chosen for HSV-1 infection study.
ICP4rz-885 expression from the pool of all the positively selected cells was
included as a ribozyme expression control (labeled as "pool"). B) RS cells
stably expressing ICP4rz-885 had resistance against wild-type HSV-1
infection indicating a phenotype of smaller plaque size and fewer plaques
after infection. The infection was conducted at a MOI of 10-3 USing wild-type
HSV-1, and cells were stained using crystal violet at 72 hours post-infection
for observation.













Time Course of HSV-2 (HG52) Viral Yield after siRNA
Transfection




-* Mock Transfection

-m- siRNA- Control

-A- siRNA-19


6.0E+06




5.0E+06









2.0E+06









1.0E+06




0.0E+00


15 24 50 75

Time Point (hours)


Figure 3-5. Effect of siRNAl9 targeting ICP4 mRNA on viral replication of wild-type
HSV-2 (HG-52) in HeLa cells. The siRNA targeting mRNA of HSV-2 ICP4
was transfected in HeLa cells followed by HSV-2 infection at an MOI of 10-3
At various time points, viral yields were quantified by plaque reduction assay.
Two control groups were mock transfection and scramble siRNA transfection
groups. The reduction level of siRNA-19 compared with that of the scramble
siRNA control at 15 hours post-infection of HSV-2 is 63%, at 24hours is 63%,
at 50hours is 70%, and at 75 hours post-infection of HSV-2 is 49%.















CHAPTER 4
RNA GENE THERAPY FOR HERPES SIMPLEX VIRUS KERATITIS; TARGETING
A HSV-1 LATE GENE

Introduction

Herpes simplex virus type 1 (HSV-1), a double-stranded DNA virus, is one of the

most well- characterized human pathogens. Infection with HSV-1 is very common and

associated with various diseases: Oral-facial infections (e.g. gingivostomatitis,

pharyngitis, and recurrent herpes labialis), skin infections (e.g. eczema, herpeticum, and

erythema multiform), central neural system infection (encephalitis), and disseminated

diseases. Herpes simplex virus keratitis (HSK) caused by HSV-1 is the most common

infectious cause of corneal blindness in the U.S. The consequence of repeated

reactivations lead to cumulative damage; particularly in the case of HSK, patients

experience loss of corneal transparency caused by each episode of reactivation which

eventually leads to blindness.

Herpes Simplex Virus Keratitis

Currently there is no viable therapy to prevent the recurrent infection despite the

availability of systemic and topical antiviral medications, which can shorten the length of

infection and reduce the severity of infection. The toxicity of antiviral drugs causes

rej section and the failure of clinical treatments. Patents often suffer from both allergic

damage and lesions caused by HSV-1 infections which are consistent with in vitro

toxicity studies. 160,210,211,390 Among all the antiviral chemotherapeutic agents, nucleoside

analogs are the most successfully used in clinic, particularly acyclovir (9-(2-









hydroxyethoxymethyl) guanine; ACV). ACV has been commonly used in the systemic

treatment of HSV-1 infection with low toxicity. ACV functions by interrupting HSV-1

viral DNA synthesis via HSV-1 thymidine kinase activity.149,150 The specifieity of ACV

against HSV is the phosphorylation of ACV to a monophosphate (ACV-MP) which is

conducted by HSV thymidine kinase. The large amounts of ACV-MP are then

transformed to the diphosphate (ACV-DP) by cellular guanylate kinase. The triphosphate

form of ACV, transformed by other cellular enzymes, is the actual inhibitor of viral DNA

replication. It functions through its specific binding to viral DNA polymerase. By

incorporating into viral DNA, ACV triphosphate leads to premature termination of DNA

synthesis.

However, in high risk populations, individuals with compromised immune systems

such as AIDS (Aquried Immune Deficiency Symdrome) patients, cancer patients, and

patients undergoing organ transplantation, elevated severe recurrence and the generation

of drug resistant HSV-1 strains can lead to failure in treatment and even death. ACV-

resistant and other nucleoside analogue- resistant strains have been isolated from

immune-compromised patients.77"" This ability of HSV to readily mutate in response to

conventional chemical agents underscores a need to develop novel anti-HSV agents that

will substitute for and/or complement ACV and other nucleoside analogues.

UL20 Gene and Function of Its Gene Product

Although the mechanism of HSV-1 virus maturation and egress to the extra-cellular

space has not been fully understood, it has been shown that UL20 protein, an essential

gene product, plays an important role in viral replication in cell culture." HSV-1 UL20

gene is highly conserved in alphaherpesviruses, e.g., varicella-zoster virus (VZV)84,

bovine herpesvirus-1 (BHV-1)370 and pseudorabies virus (PRV) s, as well as in a









gammaherpesvirus MDV-2 (Marek' s disease virus type 2)135, and the UL20 open reading

frame (ORF) is positionally conserved in genomes of different alphaherpesviruses. The

UL20 gene of HSV-1 encodes a 222- amino acid nonglycosylated membrane protein,

which is regulated as a yl gene and present in the envelope of purified virions.378

Computer-assisted programs (TMPredl52 and SOSUll48) predict that UL20 protein is a

four-time membrane-spanning protein, placing both the amino and carboxyl terminal

portions within the cytoplasm of cellular membrane as well as internal to the virion

envelope (as shown in Fig. 4-1).236

Multiple membrane-associated events are involved in morphogenesis and egress of

infectious herpes virions into the extracellular space: Primary envelopment by budding

of capsids from the nuclei to the inner nuclear leaflets, de-envelopment by fusion of viral

envelopes with the outer nuclear leaflet, re-envelopment of cytoplasmic capsids into

Golgi or TGN (trans-Golgi network) derived vesicles, and finally transport of enveloped

virus within cytoplasmic transport vesicles to extracellular spaces.168,241,353 UL20 protein

functions at the step of virion egress from perinuclear space to cytoplasm and to

extracellular space by dominantly distributing in nuclear membrane and cytoplasm (the

endoplasmic reticulum and the Golgi apparatus). In the absence of UL20 protein, virions

are trapped in perinuclear space as well as in cytoplasmic vesicles. Therefore, no

infectious virions are released to extracellular space. It has been shown that deletions of

the HSV-1 UL20 and the PrV UL20 genes resulted in a reduction of infectious virus

production by up to 100 folds compared with their parental wild type viruses.17~1os~1os

Although it has been recognized as a membrane protein, UL20 protein is involved in

Golgi dependent glycosylation and cell surface expression of glycoprotein K (gK). gK









and UL20 gene are required for a phenotype called syncytium during HSV-1 infection.

Therefore, UL20 is also involved in virus-induced cell fusion. However, UL20 defective

HSV-1 is impaired in viral release in a cell-type dependent manner, indicating that certain

cellular functions can compensate for UL20 protein. It has been shown that the integrity

of Golgi apparatus is one of the cell factors that have this function. Furthermore, it was

suggested that expressing of UL20 is regulated as a yl gene, and impairment in viral

DNA synthesis diminished but did not abolish UL20 production.378 It is not known

whether UL20 can directly or indirectly regulate viral DNA replication. Considering the

important role of UL20 protein in intracellular virion morphogenesis and virus-induced

cell fusion, it is intriguing to know whether defective expression of this gene can affect

the pathogenesis phenotype in animals.

Gene targeting of HSV-1 has classically relied on in inhibiting immediate early

gene expressions, especially ICP4. The impact of knocking down expression of an

essential late gene on the HSV-1 viral life cycle has not been addressed. In this chapter, a

hammerhead ribozyme targeting UL20 mRNA was tested in cell culture against wild-type

HSV-1s as well as drug resistant viral strains. As shown from previous in vitro kinectic

study (Chapter 2), this ribozyme has shown a significant cleavage activity. Further tests

of the inhibitory effect at RNA level as well as at viral DNA level were conducted to

address the ribozyme effect. Meanwhile, similar approach was used to test another

hammerhead ribozyme targeting HSV-1 UL30 mRNA which encodes viral DNA

polymerase.









Materials and Methods

Hammerhead Ribozyme Cloning

Ribozymes with high kcat/Km (higher than 1CLM1 min ) were selected for cell

culture studies (see Chapter 2). Ribozyme sequences along with target sequences are

listed in Figure 2-5, and two ribozymes are tested which were named UL20Rzl35 and

UL20Rzl54, respectively. UL20Rzl54 was chosen for the cell culture test due to its

active catalytic activity (Table 2-3). Ribozymes were cloned in a plasmid (pTR-UF21-

New Hairpin) for cell culture transfection experiment. In pTR-UF21-New Hairpin

plasmid, ribozyme expression is driven by chicken p-actin promoter and a CMV ie

enhancer upstream (shown in Fig. 4-2A). A neomycin gene was included as a selection

marker. The ribozyme was also cloned into an adenovirus packaging plasmid, pAdlox,

(accession number RVU62024 in NCBI nucleotide database). In this plasmid there are

the 3' inverted terminal repeat of adenovirus, a viral packaging signal (uy), a cDNA

expression cassette driven by the cytomegalovirus (CMV) promoter/enhancer, and a loxP

Cre recombinase recognition sequence. The ribozyme expression was followed by an

IRES (internal ribosome entry site)-GFP (green fluorescent protein) element (shown in

Fig. 4-2B) for localization purposes. In the ribozyme expression cassette of both

pTRUF21-New Hairpin and pAdlox, an internal hairpin ribozyme was located between

the hammerhead ribozyme and IRES-GFP element. The hairpin ribozyme conducts self-

cleavage in order to free the 3'-end of the ribozyme by releasing downstream sequence.

Test of Transient Transfection of Ribozyme Containing Plasmids against Wild-type
Herpes Simplex Virus Type 1

Ribozymes with reasonable catalytic activities were tested in cell culture against

wild-type herpes simplex virus type 1 (HSV-1) strain 17syn+. Transient transfection of









hammerhead ribozyme was conducted on rabbit skin cell (RSC) using LipofectamineTM

and PlusTAI reagent (Invitrogen, Carlsbad, CA). A G418 selection was conducted for 6 to

8 days to enrich transfected cells. An HSV-1 infection using strain 17syn+ was

performed either at an MOI of 1 for 15 hours or at an MOI of 10-3 for 24 hours. Control

transfections were conducted using the plasmid without the ribozyme. Viral yields from

different transfections were compared using the plaque reduction assay. Ribozymes

showing effects in reducing viral yields were packaged in the adenoviral vector for

further testing in cell culture.

Adenovirus Vector Packaging

A serotype 5 recombinant adenoviral vector using Cre-lox recombination system,

described by Hardy et all34, was used for ribozyme packaging. The protocols of

recombination process and recombinant virus preparation were described by Glyn et

al.272 Recombinant adenovirus was generated by co-transfection of linerarized pAdlox

packaging plasmid with uy5 adenoviral genomic DNA, which has its packaging sequence

flanked by loxP sites. The transfection is performed in a 293 cell line called Cre8

cultured in Eagle's minimal essential medium (MEM) 10% Fetal Bovine Serum (FBS),

100 I.U. penicillin/mL, and 100Cpg/mL streptomycin (Cellgro, Mediatech, Inc., Herndon,

VA). Cre8 cells constitutively express Cre recombinase. These cells generate

recombinants between the loxP sites in the packaging plasmid and the 3' loxP site in the

uy5 adenoviral backbone (accession number RVU62024). Propagation of non-

recombined uy5 is negatively selected by deletion of the packaging signal by the Cre

recombinase. Plaques isolated from the cotransfected plates were almost exclusively

recombinants. Subsequent propagations of the adenovirus in Cre8 cells can eliminate the

contaminating uy5 virus. Two Adenovirus purification methods were used in this study: a









kit called Vivapure AdenoPACKThl 100 (Vivascience AG, Hannover, Germany) was

used to purify the recombinant adenovirus for cell culture study and animal experiments,

and another method called Cesium Chloride (CsC1) step gradient purification was also

adopted.

A detailed procedure of generating recombination adenovirus is recorded as

following:

1. Plate a T75 flask of Cre8 cells to 60% confluence in Eagle's minimal essential
medium (MEM) supplemented with 10% FBS, 100 I.U. penicillin/mL, and
100Cpg/mL streptomycin (Cellgro, Mediatech, Inc., Herndon, VA).

2. Digest 4.5- 10 Cpg of pAdlox plasmid DNA containing ribozyme expression cassette
with Sfil (New England Biolabs Inc., Ipswich, MA). The DNA was extracted
once with phenol: chloroform: isoamyl alcohol followed by ethanol precipitation of
the aqueous phase. The DNA was recovered and resuspended in TE (pH8).

3. Cre8 cells were transfected with linear DNA along with uy5 viral DNA using
LipofectamineThl 2000 (Invitrogen, Carlsbad, CA) following product manual.
Transfected cells were incubated at 37 OC for 7 to 10 days for plaque formation.
Medium (MEM with 10%FBS, 100 I.U. penicillin/mL, and 100Cpg/mL
streptomycin) was refilled depending on cell condition.

4. Two T75 flasks were seeded with Cre8 cells: One was used to prepare a viral stock
and the second one was used to extract viral DNA to verify that the virus generated
was indeed a recombinant.

5. When prominent cytopathic effects (CPE) were observed throughout the
transfected cells (approximately 8- 10 days), the cells and media were harvested
from the dishes using a cell scraper. The mixture was transferred to a 50-mL
cornical tube. To verify recombinant virus, viral DNA extraction protocol was
used followed by appropriate restriction digestions.

6. The harvested cell/ media mixture was frozen and thawed for three times to lyse the
cells and release viral particles.

7. To amplify and purify the adenoviral stock, the viral lysate was used to re-infect
cells. 0.5 mL of cell lysate and 5 mL of medium were mixed to cover a monolayer
of Cre8 cells in a T75 flask. 2-4 hours were allowed for infection.

8. After the incubation, medium containing cell lysate was replaced by fresh medium.
Cells were cultured until prominent cytopathic effects (CPEs) were observed
throughout the monolayer (approx 1-2 days). Cells and media were harvested, as in









step "4", and they can be stored at -80 OC. After 3 rounds of infection in Cre8 cells,
the maj ority viral population was recombinant virus.

A detailed procedure of CsCl step gradient purification of Adenovirus preparation

is following:

1. 293 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM)
containing 10% FBS and 100 I.U. penicillin/mL, and 100Cpg/mL streptomycin
(Mediatech, Inc., Herndon, VA). Six 75cm2 tissue culture flasks of 293 cells were
prepared to reach confluence.

2. To infect the cells, typically, 5x10 plaque forming units (PFUs) of virus was added
to 5mL of Opti-MEM" I Reduced-Serum Medium (Invitrogen, Carlsbad, CA) for
each 75cm2 flask. Three to four hours of incubation was allowed at 370C in a 5%
CO2 incubator.

3. Viral solution was removed at the end of the incubation and replaced by 15mL of
DMEM containing 10% FBS and 1% penicillin-streptomycin (Mediatech, Inc.,
Herndon, VA). Cell lysates were harvested when prominent cytopathic effects
were observed. Typically cell lysates were ready after 2 days.

4. Cells were harvested using a cell scraper and cell lysate was centrifuged at 2000xg
at 40C for 10 minutes. The supernatant can be saved to resuspend the pellet.
Usually cell pellets were resuspended in 5mL of media. Cell lysate was frozen and
thawed for three times, alternating with a 370C water bath and -800C freezer.

5. Cell lysate was treated with Benzonase (Sigma-Aldrich, St. Louis, MO) at 50U/mL
at 370C for 30 minutes. Cell lysate was centrifuged at 2000xg, 40C for 10 minutes,
and the supernatant was saved for CsCl step gradient purification.

6. Polyallomer tubes (Beckman Coulter, Inc., Fullerton, CA) were chilled on ice and a
CsCl step gradient contained following components:
a. 1.4g/mL of CsCl (bottom layer);
b. 1.2g/mL of CsCl (middle layer);
c. Viral cell lysate (top layer).

7. The tubes were centrifuged at 40,000xg, 40C for 1 hour using a swinging bucket
rotor (Beckman SW41 Ti Rotor, Beckman Coulter, Inc., Fullerton, CA). Typically,
there were two white bands seen near the interface of the 1.2- and 1.4g/mL CsCl
layers. The lower band contained the infectious viral particles which were
collected using a 20-gauge needle and 3mL syringe. The harvested viral particles
were diluted by at least two folds in 10mM Tris Hydrochloride (Tris-HC1) (pH8.0)
and mixed well for recentrifugation.

8. The procedure in step 6-7 was repeated for two more times. The purified
adenovirus was transferred to dialysis bags and was dialyzed against 500mL of









chilled dialysis buffer for at least 6 hours at 40C. Two more times of dialysis were
conducted. The dialysis buffer was made fresh the same day and stored in 40C.
The recipe of the dialysis buffer can be found in Appendix C. The Adenovirus
stock was stored in aliquots at -800C.

9. The virus particle concentration of adenovirus stock was measured by mixing 15CLL
of the stock with 285CLL of water. The absorption at 260nm (A260) WAS determined
by spectrophotometry. One A260 iS approximately equal to 1012 viral particles per
mL. The percentage of infectious virions typically ranges from 1 to 10% of the
total number of viral particles.


Preparation of Adenoviral DNA

This procedure was conducted to either amplify uy5 adenovirus for viral DNA

extraction or isolate recombinant viral DNA for restriction digestion analysis.

Culture media were removed from T75 flask of confluent culture (293 cells for uy5

isolation or Cre8 cells for recombinant viral DNA extraction). Viral lysate (50CLL) was

mixed with 5mL of serum-free medium (Opti-MEM" I Reduced-Serum Medium,

Invitrogen, Carlsbad, CA) and plated on the cells. Two to four hours are allowed for

infection. Following incubation, media are supplemented with 10% FBS and 100 I.U.

penicillin/mL, and 100Cpg/mL streptomycin (Cellgro, Mediatech, Inc., Herndon, VA).

Cells and media were harvested using a cell scraper when complete cytopathic effect

(CPE) was observed (typically when monolayer cells are round-up and begin to detach)

which might take 2-5 days before harvesting the cells. Cells were pelleted by

centrifugation at 900 rpm at 40C for 10minutes and resuspended in 400CLL of TE pH9 (10

mM Tris-Cl pH9, 1 mM EDTA). The supernatant was discarded and a large volume of

undiluted bleach was used to treat the supernatant. DOC lysis buffer (recipe listed in

Appendix C) (400CLL) was added to the cell resuspension and mixed well by passing

through a pipette tip repeatedly. Spermine-HCI (8CLL at a concentration of 500mM) was

added and mixed well for incubation on ice for 10 minutes. The mixture was centrifuged









at a maximum speed for 4 minutes at 40C, and the supernatant was transferred to a fresh

tube. Ten minutes of incubation was allowed at 370C after 4CLL of RNaseA (10mg/mL)

was added. Incubation at 400C for one hour was followed after adding 60CLL of 10%

Sodium Dodecyl Sulfate (10% SDS), 20CIL of 0.5M EDTA, and 40CLL of 50mg/mL

pronase (CALBIOCHEM San Diego, CA) (see Appendix C for recipe).

Phenol/chloroform/i soamyl alcohol (25:24: 1) was used to extract viral DNA and the

aqueous layer was collected to precipitate DNA. In less than 900CLL of collected aqueous

solution, 30CLL of SM sodium chloride (NaC1) was added followed by 600CIL of

Isopropanol (Fisher BioReagents, Fair Lawn, NJ). The DNA pellet was rinsed with 70%

ethanol and dried in room temperature. Viral DNA was resuspended in 25CIL of TE and

BsaB I digestion was conducted to check recombinant Adenoviral DNA. In 'P5 viral

DNA, there are three BsaB I sites producing a series of bands: 11648, 10536, 7723, and

2249 base pairs (bp). When a recombination happened successfully in Cre-loxp system,

the 2249bp band would be replaced by another band depending on the insert in

recombinant virus.

Herpes Simplex Virus Type 1 Viral Strains and Viral Production

Rabbit skin cells (RSC) were used to propagate wild-type HSV-1 (17syn+).

Protocols for viral production, purification and plaque reduction assay to estimate viral

titer were previous described in Chapter 3.

Cell Culture Tests of the Accumulative Effects of Ribozymes Packaged in
Adenoviral Vector against Wild-type Herpes Simplex Virus type 1

To evaluate the viral yields after ribozyme treatment, after 15 hours of delivery of

ribozyme as well as control treatments, Herpes simplex virus type 1 (HSV-1) infection

was conducted at an MOI of 10-3 for either 24 hours or for 6 days. The experiment was









set up in triplicate for each treatment each time point. A plaque reduction assay was

performed to compare HSV-1 viral yields. In these early experiments, adenovirus stock

was purified using CsCl step gradient purification method, and the infective dose was

800-1000 viral particles per cell. When the ribozyme function was confirmed by at least

two independent assays, further evaluation was conducted. Another adenovirus

purification method using Vivapure AdenoPACKThl 100 (Vivascience AG, Hannover,

Germany) was also adopted.

A dose-response test was performed to observe the ribozyme effect to inhibit viral

replication. In this assay, adenovirus was purified using Vivapure AdenoPACKTMl100

(Vivascience AG, Hannover, Germany). RSC were seeded at a density of 2x105 cells per

well one day before adenovirus inoculations (control virus was Ad-GFP containing GFP

gene instead of ribozyme cassette). A serial of dilutions of recombinant adenovirus (1,

10, 102, 103, 104, 10 106 viral particles per cell) were used to conduct infections. Forty

eight hours were allowed for accumulation of ribozyme expression followed by HSV-1

(17syn+) infection at an MOI of 10-3. 24 hours were allowed before cell lysates were

harvested for plaque reduction assay. At each dilution of the recombinant virus the

infection was performed in triplicate and the plaque reduction assay was conducted on

RSC. An effective dose was used for further observation of either therapeutic effect in

cell culture or target mRNA level after treatment.

Real time Polymerase Chain Reaction to Compare Target Levels after the
Ribozyme Treatment

To investigate the ribozyme effect in knocking down the target mRNA level,

reverse transcriptions were carried out using total RNA extracted from RSC containing

ribozyme followed by HSV-1 infection. The real time PCR was carried out to compare









target mRNA levels. Recombinant adenovirus infections were conducted in

quadruplicate for 48 hours followed by the infection of 17syn+ at an MOI of 3 for 8

hours. Total RNA extraction was performed using TriZol" (Invitrogen, Carlsbad, CA).

Contaminated DNAs were cleaned using DNA-fr~eeThl kit (Ambion, Austin, TX) which is

RNase free DNase. Reverse transcription (RT) was conducted using First-Strand cDNA

Synthesis Kit (Amersham Biosciences, Buckinghamshire, UK). Total RNA (1Cpg) and

random hexamer primers were used in each reaction. Total RNA was quantified by the

spectrometry using a photodiode array detector called Gene Spec III (MiraiBio Division,

Alameda, CA) at a wavelength of 260nm and the quality of RNA was controlled with

ratio of the absorption at 260nm divided by that at 280nm ranging from 1.8 to 2.0. cDNA

from each RT- reaction was diluted in 10 fold before real time PCR assay. Specific

primers and a fluorescent probe for either the target or GAPDH (Glyseraldehyde-3-

phosphate dehydrogenase) were designed and synthesized by ABI system (Applied

Biosystems, Foster City, CA). For each RT- reaction, real time PCR assays were set up

in triplicate for both sets of primers and probes. Standard curves for corresponding

primers and probes using either RSC genomic DNA or HSV-1 viral genomic DNA (or, as

an alternative, using cDNA from infected RSC) as reference DNA were carried out in

triplicate. In order to obtain the correlation between the template amount and the cycle

threshold (Ct), serial dilutions of reference DNAs (or cDNA) were used to generate

standard curves. An absolute template amount resulted from the standard curves based

on the Ct was used to compare treatment and control groups. The ratio of target RNA

level to GAPDH level was used to compare between ribozyme treatment group and

control groups. Meanwhile from the same TRIZOL" extracted samples, DNA