<%BANNER%>

Cytokine Profiles and Viral Replication within the Thymuses of Neonatally Feline Immunodeficiency Virus-Infected Cats

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101210_AAAABS INGEST_TIME 2010-12-10T08:27:26Z PACKAGE UFE0017502_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 219 DFID F20101210_AAAMJI ORIGIN DEPOSITOR PATH kolendaroberts_h_Page_113.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
b168fd3562e58a085af4a444cdba5899
SHA-1
54d808291650f079437df7948d1a0cbde4cb363f
7781 F20101210_AAAMIU kolendaroberts_h_Page_068thm.jpg
4891dc32a079113c985cb86eed4a0242
3f0090aa0bde192ac3dec1292d6051713ad03045
32271 F20101210_AAAMJJ kolendaroberts_h_Page_112.QC.jpg
ea750410dc1eed1b346e265fdd47ba79
42b2f8e7698120b0cf3d8434421bd6130953e529
72080 F20101210_AAAMIV kolendaroberts_h_Page_093.jp2
d5c2b3612947174b191ebe0fdd15bbd1
3bbfea9fcca8b006a17522c6738b3c93f311c024
91728 F20101210_AAAMJK kolendaroberts_h_Page_063.jpg
a4222a49ea2ac629f64745769032552b
7e303f10eb1e400c3302d08c566a8433d9ff8c8e
1000 F20101210_AAAMIW kolendaroberts_h_Page_054.txt
92cc25d1f73eeec68b2a1677710f0025
00ea31bfe0ca238be5d63812d1d407eb34acb049
6695 F20101210_AAAMJL kolendaroberts_h_Page_033thm.jpg
78e9b61d0ed576edc66acdf2011290d1
fa6568f293376f01fe62a424b5e68e608f456ece
1051978 F20101210_AAAMIX kolendaroberts_h_Page_011.jp2
1a276702b30a436f6f2fb912c31d397e
57d7c0db731702c9d0cc860a3a0b122fe2e92490
5743 F20101210_AAAMKA kolendaroberts_h_Page_002.jpg
a83e451e1f0fa42530969d6e55ef76af
7db17d73546922f89b90861f7e5978a97efe6d54
34732 F20101210_AAAMJM kolendaroberts_h_Page_017.QC.jpg
7d758f3451600d617051b7b9cc64fc6d
d5d4ba5aedc3dd2dc6e22fa32da3191be7589361
1919 F20101210_AAAMIY kolendaroberts_h_Page_046.txt
df483a231cf3e76878f034ed53ba4565
88ec3802f79cc9f1cc91b96db549011cbc742e8f
63994 F20101210_AAAMKB kolendaroberts_h_Page_003.jpg
fa9f8f53ecbb3bcd878a1f0453ab63a8
7e09b91fa2682b36a92406a0a275af4b63cb68f0
3114 F20101210_AAAMJN kolendaroberts_h_Page_011.txt
8725cc7ffce378030fee3d95b7f6c0b1
846a52fab69512a3a7a310e6327aebfdea8a85b7
93472 F20101210_AAAMIZ kolendaroberts_h_Page_081.jp2
49b53f6084a2393b0b0edf432ad88489
64e432ab8d9ec5e4a17b64cae3b0e02a17019bce
49885 F20101210_AAAMJO kolendaroberts_h_Page_106.pro
fc31c6c87a87717c17a9799285092b6e
c967ecb678d9725801060c7c8126a6e6da556039
144914 F20101210_AAAMKC kolendaroberts_h_Page_005.jpg
5d89d3e9b0321694fb49d0b93dd9d209
3d91681b195d90ef441c8ff223d406359ddbb431
43028 F20101210_AAAMJP kolendaroberts_h_Page_086.pro
919e168a9bf686085cd43db85d6ce348
c1c587e7eaf7e591fd7ac634405646e469d920b6
35982 F20101210_AAAMKD kolendaroberts_h_Page_006.jpg
59e37824032cb1facce3fb105f195bb7
8c2d5b0c40da4bc4db2612cb319023aa5d43c868
1051870 F20101210_AAAMJQ kolendaroberts_h_Page_086.jp2
76277d7ecb5cb195b91ac205dc36779b
787e914dfd3792cc92fec040cc93fa3d5eb9a6c0
107270 F20101210_AAAMKE kolendaroberts_h_Page_007.jpg
dc9bd6ad6ae56076f58a593fbd0365fe
1fa5d1dcaa0f2c865e97670882b170c63c28d7bc
46850 F20101210_AAAMJR kolendaroberts_h_Page_101.pro
500cb1a594db2a36838d7070b8a6c957
75d690f578783f71c54c6e1a28b9ddc5590ea5f8
116739 F20101210_AAAMKF kolendaroberts_h_Page_009.jpg
e4241682a511fb4c3c100182a3d72cab
7b8b0e21ae6a6da5ffdb9fc0792ce5fd34faaed6
32840 F20101210_AAAMJS kolendaroberts_h_Page_108.QC.jpg
74c43d0d97366a34211c6c15ab38a013
146691b287319fe6f347543cb24d75f36ddf13c7
172788 F20101210_AAAMKG kolendaroberts_h_Page_010.jpg
4e6c7622aeca3d30a78bf32b2858163a
fa74f9e02b832bdf2bae55e392b2035c3ec36493
52818 F20101210_AAAMJT kolendaroberts_h_Page_019.pro
8b73d9b85daaec6b69a7fa78c9ba6cad
21d30866f6c2f57de0b826ea4c05b5d8068dd436
163916 F20101210_AAAMKH kolendaroberts_h_Page_011.jpg
a7bde6841a984388f173da267c8abf04
93e152c55535c44def132fc24f0ad966647cd30f
1973 F20101210_AAAMJU kolendaroberts_h_Page_026.txt
1e1c7084a25e3e2bdbd0483a33d973f7
4824fe98b04a973f938966164c9a01eef27d0b20
80964 F20101210_AAAMKI kolendaroberts_h_Page_013.jpg
7b938e2f1404905334eaaec16c0d8bf6
2d1db509488ab0f55beab6eeeb97dfe8014da899
1053954 F20101210_AAAMJV kolendaroberts_h_Page_013.tif
ca7b42898382c8314c3f3f3bb8d56d68
1fd7cd43c928846dfd36e08475a6d1c8a7112c49
104365 F20101210_AAAMKJ kolendaroberts_h_Page_016.jpg
1788f1e55c96dc59b1d94f909b0a2494
1b3cdbf177a810af542e3d484b412744d6326224
6598 F20101210_AAAMJW kolendaroberts_h_Page_013thm.jpg
eec1e4dbf3610cd6692af88f4cdca3fe
4f659716053753a7e586fc165111a376d79ddc12
107310 F20101210_AAAMKK kolendaroberts_h_Page_019.jpg
7b87bda811b2273bb3e52b1c7296ee28
684ce47a3537cbd2aa3f810c8227642ea7f1e9fc
149965 F20101210_AAAMJX UFE0017502_00001.mets FULL
4f281cd1c6c6dcc2f80bff146a9dd674
96d5a0bed3fd6b9bb79837a0cc3055af9d6e1fa5
47646 F20101210_AAAMLA kolendaroberts_h_Page_041.jpg
8dd9386d8a856d2f25212a8ef3f62281
7f03586a34cab8277613616638eec77633db85de
36184 F20101210_AAAMKL kolendaroberts_h_Page_021.jpg
8cf249588e331d6405d52e12e2ce8fdc
db5fd219aee95bb436dcfd54f5b7f43a77f1491a
95304 F20101210_AAAMLB kolendaroberts_h_Page_044.jpg
e59b5d3a16ac35e944e46a8a3f54631a
6e66b7936fd92a6c8b6068988e73ac55cc8149f4
88566 F20101210_AAAMKM kolendaroberts_h_Page_022.jpg
1d540a772cd37e71cc139ba229927286
0afe0f9952d33626530b9846a4a85d90f84231f1
108456 F20101210_AAAMLC kolendaroberts_h_Page_048.jpg
db3d0593e12911a3ee135925beb281e8
a35e4a6254281a56c26af05597c8f02dea756935
97993 F20101210_AAAMKN kolendaroberts_h_Page_023.jpg
673bfeee799b13abd6f3b95e51ceacda
f29a357de6b89ba6737c4a1554a9f2f111869a19
104245 F20101210_AAAMKO kolendaroberts_h_Page_024.jpg
3bdcf7cf50fa6e3902a04b6a903195dc
47547b82bcad3ba7091d52b760d5d0df3f4d480c
82375 F20101210_AAAMLD kolendaroberts_h_Page_051.jpg
a914ceeabb79a2288c00b99f4a3948b6
f3c89849e6afe175d75e2f492706adacec9b0883
105930 F20101210_AAAMKP kolendaroberts_h_Page_025.jpg
3a1d2cc23c13c301b183d67bf8fbebeb
5a0e37bc8ce08c3524ae179b7abb1577d6e41ba5
50972 F20101210_AAAMLE kolendaroberts_h_Page_052.jpg
76f955e9f735b8e22f8455e6a5499e56
774ba46193e5e58eb397604adf6fb638beaeb3a9
103544 F20101210_AAAMKQ kolendaroberts_h_Page_026.jpg
c60eaaaecc122906bf6bc7cb82cec1e6
7c9d16453ce25523a32a6ce38110a3189c980890
87098 F20101210_AAAMLF kolendaroberts_h_Page_053.jpg
17747632b85010ee6c2f9e4910df61de
c226106a93f97398caeb4dc9c5a8fdde83aeaa78
95459 F20101210_AAAMKR kolendaroberts_h_Page_028.jpg
878ba76dd002f8c2c64e4f074b6d4993
9c94ebfe717662d89f1dd7ec8269c1700b2e3311
81353 F20101210_AAAMLG kolendaroberts_h_Page_055.jpg
5c9aac732887d9e557524f34ca206416
acdd1022179edb2d8faa583c358aa8671c881203
104194 F20101210_AAAMKS kolendaroberts_h_Page_029.jpg
718f339f10578ad87551bf0627922cea
a1779af68a5a33b3f42735870d4d6b3fae93986a
50457 F20101210_AAAMLH kolendaroberts_h_Page_056.jpg
11d21e8a25eaf3a8ce1e86d16228e022
f1e9b634f4b2e3ac570ee8aec24f95cf07a3cc11
102372 F20101210_AAAMKT kolendaroberts_h_Page_030.jpg
e744565873c3f553e77e208ca3545fba
34f46c508e4f0aaf938c796d248a231161b2adad
79825 F20101210_AAAMLI kolendaroberts_h_Page_057.jpg
d5b4587e0b5cedbec95c0b35dba64fca
6c7f64b40325730da44b2ac06562a52362ce35ef
59577 F20101210_AAAMKU kolendaroberts_h_Page_031.jpg
a59a9106fdacb6cef131daaa02ccd2fa
755ec64bee5ed529eb9d991ce74a73e7115d2600
56836 F20101210_AAAMLJ kolendaroberts_h_Page_058.jpg
a6c59f9936fa47ec4a890405acb2d6e5
e2a6101b2a0d7d2b39a7e8b50b296a0474807a87
98716 F20101210_AAAMKV kolendaroberts_h_Page_033.jpg
218bbc44d8fbd8214a8507d60f5b0e5e
2f59d51807c4bbf3d55224a61996fd8a8185c576
85308 F20101210_AAAMLK kolendaroberts_h_Page_059.jpg
f7cb84321e400a9d795d554b7ffde601
9a48a25afbdc70ff7e4b9d44d038fbba05512413
104084 F20101210_AAAMKW kolendaroberts_h_Page_034.jpg
afc4d6c385d96666815e46eca5a56ef7
1b777e0b0362ec6584250cf70bd346238ee1b7a8
106951 F20101210_AAAMMA kolendaroberts_h_Page_085.jpg
83cb993822a58f7bad94c3f4999f23dd
72bacf01acdec80c614f004507dd865121b10322
61270 F20101210_AAAMLL kolendaroberts_h_Page_060.jpg
86c23ed7294877586a98be61d79cd8b0
8cf1940f8f629797b176cf69fea0828a5d274401
94283 F20101210_AAAMKX kolendaroberts_h_Page_035.jpg
8ff73f2ace1d5398ab5b95bd609c6805
e41037da92e703787273295e5217a2f998981a8f
94838 F20101210_AAAMMB kolendaroberts_h_Page_086.jpg
a105366abf50b7ef8251bc2095b65432
03b46fc719a2a08b6ae13f151e9959d5c4508e26
97859 F20101210_AAAMLM kolendaroberts_h_Page_064.jpg
64dbb4667eaf4eae93630e14ba9af77e
3d8a90b655b49cc3abfe074ebe4b37b9d97cacf6
69481 F20101210_AAAMKY kolendaroberts_h_Page_037.jpg
0391b8c3e29b7afbce844d3ba3f3d73d
dafa7316c4088634764875b80690b4d098c09330
99865 F20101210_AAAMMC kolendaroberts_h_Page_087.jpg
d1f97f29359b6c470da8b4383d27e0fb
76f895ffbfe0922a338be6dd236564111e504b69
58726 F20101210_AAAMLN kolendaroberts_h_Page_067.jpg
ca0b1140575b7bd4e3a1319b17d3cd23
e156a0c0a532619e5c7069a03d4f79398261af25
76605 F20101210_AAAMKZ kolendaroberts_h_Page_038.jpg
350096b9fd5e9b13279f52e569fa6d80
1ef6883b27a58e700fd7d6645ab884da8757b6d5
117702 F20101210_AAAMMD kolendaroberts_h_Page_088.jpg
747bae784ea6891f2f0280d8078c6658
b991e173865f340fbc180fbe5b63a5da4698cd35
108823 F20101210_AAAMLO kolendaroberts_h_Page_068.jpg
cce3379ab332f3488cdbc7e41ee33e98
3500b0ea736aa079b0635311922f93017b229ec3
91681 F20101210_AAAMLP kolendaroberts_h_Page_069.jpg
b52a7270d1f322ca8cb210a005c407f8
31a6ccab14008638aad33dd59d2e34effb5bb4b8
79581 F20101210_AAAMME kolendaroberts_h_Page_090.jpg
0450dbbf7093328d637f156fd0d7c4c4
e4e58b6c81cc885d76d741afc3815de167c20ac2
90339 F20101210_AAAMLQ kolendaroberts_h_Page_071.jpg
6fb8a74de2c4022ea6c9056486d01a06
1cd60c6d3f892c6d255b74d8abfef23abf73307a
97672 F20101210_AAAMMF kolendaroberts_h_Page_092.jpg
83877d9fbf5611128abaac320709889d
f824675b354dd33576497e03e194c59e00e10cfb
78800 F20101210_AAAMLR kolendaroberts_h_Page_072.jpg
904e6d66130868dbbd965d16aedc772d
b0e9de5917cf2d38a71c47cdd5f40c64fd3bca90
84871 F20101210_AAAMMG kolendaroberts_h_Page_094.jpg
3277929c4488638dd938bf11a2872885
64191a8e705ac6b0f73cfdd32d69b0374128db46
84725 F20101210_AAAMLS kolendaroberts_h_Page_073.jpg
da4aab64d4392153f659fb73f4cb67ff
477259354c7139a0781739a475ce04ecb3b93501
73437 F20101210_AAAMMH kolendaroberts_h_Page_097.jpg
b172c635dde28432be0bb714b4d6eba1
1c8e6805f4464b6d49281e1635cf4348a21ec05b
91832 F20101210_AAAMLT kolendaroberts_h_Page_074.jpg
6363afe16cf9f819058d77aacd33629a
e8e6a08306fccec3e253d6c34d1b234b815e2434
73371 F20101210_AAAMMI kolendaroberts_h_Page_098.jpg
7a8dae3cbab7f40c91f6176d10a51534
30a9f007466a342cbf8ec046abbed4e4ed9f283b
68585 F20101210_AAAMLU kolendaroberts_h_Page_075.jpg
b828ee59f25a45b1562063f35f4f6104
e1c591109dc1f5b1dfa72372c332b3e774418a7e
93217 F20101210_AAAMMJ kolendaroberts_h_Page_100.jpg
fd5a992b6983eadb8720ebdd4c8ee610
c420397fff71dd99766426c4c481f12cda1c3220
96747 F20101210_AAAMLV kolendaroberts_h_Page_076.jpg
9a7aa71f94f377ad1a0737b414b7161f
9eb268dde2dbee7a964d25513986fb38ffb1aaae
91913 F20101210_AAAMMK kolendaroberts_h_Page_103.jpg
c1cd6e5fb2c6999edf8f7c9cc4ce76f6
65d626204eef74ed366818a3f0be000d87867927
97209 F20101210_AAAMLW kolendaroberts_h_Page_079.jpg
287a9bcf2c5fe5922c7e36d4111eb371
0af154d3415dfa3d7f2af3e6770a45e86de9b9e7
12310 F20101210_AAAMLX kolendaroberts_h_Page_080.jpg
08171b032d387697fd479ad1a5334ab9
0c0292a00af26f298c4c19ddd2149350a9e8452f
1051983 F20101210_AAAMNA kolendaroberts_h_Page_005.jp2
9cdda024eef5fee0d5fb49dbcce3d47a
73a02774ff3f077b246f6e16a1207b263905b660
99135 F20101210_AAAMML kolendaroberts_h_Page_104.jpg
fa9261ffcbcaaa7c6a2b4615be3955e4
fdc365edd1c63a3884f42670e245d7dce4a43353
90431 F20101210_AAAMLY kolendaroberts_h_Page_081.jpg
5cce385cb26a3be41da0d86cd15b578a
fb2bb1015496c482bf4959cf6960ff9f7b042816
625134 F20101210_AAAMNB kolendaroberts_h_Page_006.jp2
6ea25c8640a0af7ac6a091654d5ff2e2
7224a78865a91c842eb7e8df089895e682608a26
101606 F20101210_AAAMMM kolendaroberts_h_Page_106.jpg
1f4d83cac5fd8134e615ae73c21b395e
682170c1923e516f6b06590ec678a98a6c789c46
107825 F20101210_AAAMLZ kolendaroberts_h_Page_083.jpg
b9a6f20c8c5d3072ed9be08889d445e6
e8705e5eb2f4e61780b623cccf633789c9f81006
F20101210_AAAMNC kolendaroberts_h_Page_007.jp2
5022e1231724f4c6067cdb52fa12a6a4
22eab7bec3b04d85cb283f082be18c1242baa546
99821 F20101210_AAAMMN kolendaroberts_h_Page_108.jpg
fae5d68374da5c8c888e996d64d07006
70e2de4d5c9cb1e2ebceb8bb0da31b8347c67c91
84195 F20101210_AAAMND kolendaroberts_h_Page_013.jp2
93a7a3012f56a47a48d66836c1a5d24f
2ba332cfca08d31e5b74e5a327e27b890b6ca82e
98221 F20101210_AAAMMO kolendaroberts_h_Page_110.jpg
ad4dde81fc30d754e749f3f759d2b7d8
041c1c759a3bf2c5690d3220b724ca58b0c870c4
89046 F20101210_AAAMNE kolendaroberts_h_Page_015.jp2
de5b8f4f293588a8a152e39cb82b402b
e66ed9c10ec5be3e13ab289c597968e2dfa641da
100712 F20101210_AAAMMP kolendaroberts_h_Page_112.jpg
4c3aedf2f0c1145ff8ed8ec5d2bb5577
156a9c68d444032310cc55b45b28e6a32a1d94c0
13861 F20101210_AAAMMQ kolendaroberts_h_Page_113.jpg
bd457186ea23a111fb2fa0b247f3604e
9fdefddba2fe923463066ff70fcbb83843732a9f
110087 F20101210_AAAMNF kolendaroberts_h_Page_016.jp2
717e91721f412bf1bd92bdf118d6e4fa
5109c13fae8346d44317a5810dad2d1ec6fc5410
139733 F20101210_AAAMMR kolendaroberts_h_Page_116.jpg
c219c6a2f2c0cfa42c1c8ccc161f1478
892ad849362ab4b5c6c8598362f23c4adb90d301
115193 F20101210_AAAMNG kolendaroberts_h_Page_019.jp2
2d40c232ad97e509e2db61d0cccd43e8
7fc1b014ef7f49b523a1b9c68f89924c42deeaaa
115964 F20101210_AAAMMS kolendaroberts_h_Page_117.jpg
d95f7b86fb226e4f3c5512a2fa9ff5f6
60e92ce38fab73792298f55c7fa16711a2028f67
104920 F20101210_AAAMNH kolendaroberts_h_Page_020.jp2
e1be5ac7adad1a265f40baaac5b44450
9b22126edee2f5eee97c78929af921be77a48c9a
122875 F20101210_AAAMMT kolendaroberts_h_Page_118.jpg
b0267f20dcc1b6dc727fb5185b756390
317f432f500b40ac805f4c1a300e266deba719ed
38729 F20101210_AAAMNI kolendaroberts_h_Page_021.jp2
f380f1c72137a5222103309948c672ed
d1dbd1d92924d48bbb6808162f047ee34697f662
130212 F20101210_AAAMMU kolendaroberts_h_Page_119.jpg
eb6f7f2f2020623bef00f9ada9e9c297
d25f555366df1fa161e119ef8119498f7e2b782e
106935 F20101210_AAAMNJ kolendaroberts_h_Page_024.jp2
48508f5e5a7f4f42e1026e07c1b47ad5
0112055738dd83bedf420b44f12028982e09cd05
137464 F20101210_AAAMMV kolendaroberts_h_Page_120.jpg
6d85843a6a314b5973ff17022226be5f
d0fb386888413ed8b43ebc1256d68c87757caaa1
103528 F20101210_AAAMNK kolendaroberts_h_Page_027.jp2
465c29982a335b9c1380fbfc36bb5c87
10bc8f1247d3649c6ca2d2b017090b2495f1dad7
128920 F20101210_AAAMMW kolendaroberts_h_Page_121.jpg
34b9c8604cb0b1bd35d5008b43d93a85
7a8d76cfccaee77cd39155e40b8cc2d33f85e847
773085 F20101210_AAAMOA kolendaroberts_h_Page_055.jp2
acd040975731010965d1ef913a7888a0
775f7aa1db958ffb9b2fc5d741f33dba91631037
100775 F20101210_AAAMNL kolendaroberts_h_Page_028.jp2
335155c8f394e5381635f51eae4357ad
aab57e1ac61954e652b8065cdd8ce984ce0eea28
128446 F20101210_AAAMMX kolendaroberts_h_Page_123.jpg
5cfccecc468d05b6839751e8a6dc79d6
d3c0cdb97b51a561fcefbc3d650f63dae324107d
789230 F20101210_AAAMOB kolendaroberts_h_Page_057.jp2
7b06c7b66f498d41ef0444c115c56964
07de88601d4e170f0e1f9d6448e6f02ac23f8b25
107588 F20101210_AAAMNM kolendaroberts_h_Page_029.jp2
a470514847274517e6d65ccbec57288d
a967ae4f29e824618cbcca8e88d4c77913e0796d
6678 F20101210_AAAMMY kolendaroberts_h_Page_002.jp2
f99aa443ce64b4f5f97bbdc83d8e6e07
47110ff397bf5af57c103fe14d5daa969a92bc46
866065 F20101210_AAAMOC kolendaroberts_h_Page_059.jp2
9aae76450e64dac20eaee49d1d90ae88
6ad836e008a9b4a0d588501fac82e6a97b917beb
107725 F20101210_AAAMNN kolendaroberts_h_Page_030.jp2
32b6707b02dfac354836837bfc9c6117
eff62fba1a8613ad85eac6b8f85692c8c15d9474
66952 F20101210_AAAMMZ kolendaroberts_h_Page_003.jp2
f61308f046101711ce5303177fb4bdc3
04c2fac56a4609bea7a7645462b151abab8d0501
724714 F20101210_AAAMOD kolendaroberts_h_Page_061.jp2
1eaef2730a404c3b403480998dd152f3
130847c3549db8fa103afd7a3762758dadd5b6e1
63162 F20101210_AAAMNO kolendaroberts_h_Page_031.jp2
049dd7eae7270bb06b0733070ade4b88
8f4eede53473bb59117c38bb78fca20328e5a597
94597 F20101210_AAAMOE kolendaroberts_h_Page_063.jp2
d4d7b4f4a6c575eec0f9812bfb8cacde
f17dc79420db4625d0381c6023f61b1ebe5eb995
89565 F20101210_AAAMNP kolendaroberts_h_Page_032.jp2
0ca374337783c90ab82271f5047d5a70
a7f28c9c708305ba978c12f05d05425ba03ea255
104476 F20101210_AAAMOF kolendaroberts_h_Page_064.jp2
dbbed62d623a2b92e62752754a855bf0
f9dbb7e83308b9acdf1f7ea4e1f85a2c089227b2
622168 F20101210_AAAMNQ kolendaroberts_h_Page_036.jp2
2dc0961417e2131ff1d1541a15afc6d5
232b3a3bcf7f7b6422eb58d082fe8826ce31dfb8
432779 F20101210_AAAMNR kolendaroberts_h_Page_040.jp2
ca0b4fd42abe24cc50a228b561c089b3
c1f2a85ec10a74f802e3306200b92cdc2c336f40
106908 F20101210_AAAMOG kolendaroberts_h_Page_065.jp2
c1d1c49f030beaca855a7d05eff071b3
0446b28790978b45f65965882109e5f0098b23a9
485481 F20101210_AAAMNS kolendaroberts_h_Page_041.jp2
e54dd5768bac1eec53178634ac3e7287
561142fafa6f6a6b8724319e0ad6fdc38273b630
57412 F20101210_AAAMOH kolendaroberts_h_Page_066.jp2
392e6b2829edc8cc773ed52f20db10a4
fa4f7dfd734b9aa57ec66008ef4add3bfecd0736
1020919 F20101210_AAAMNT kolendaroberts_h_Page_042.jp2
fcd84a38a2d4229593aaf164462b6686
48a8fc2d030c5e70eeac63c16e95e63902ad5143
60880 F20101210_AAAMOI kolendaroberts_h_Page_067.jp2
0bc5a39b3aaa4b1ffa96009945eaab3d
e3018c86017e7bf37771f761c763390d97daca66
107473 F20101210_AAAMNU kolendaroberts_h_Page_045.jp2
898dd438156d1a4eaa4876358fe849fd
bb15211c14d657407dbc0ac244a7cb9399ba48c4
113395 F20101210_AAAMOJ kolendaroberts_h_Page_068.jp2
3f9c5a21467d6fdd90b0e1945ccbdc63
2fdff08adfe4efa6e32abd856339854ae033391c
59559 F20101210_AAAMNV kolendaroberts_h_Page_047.jp2
c153b917db6bb8f443c1b05b17975c0e
464ab0b3ec3b819ab352894311952ba262adec4b
791917 F20101210_AAAMOK kolendaroberts_h_Page_073.jp2
d5117ced0a2a4760ab62e4a3d6289049
be76a358d450c9cda37ef2997acbf0ecbc187c02
58560 F20101210_AAAMNW kolendaroberts_h_Page_049.jp2
2cb4b5b5b031ad78e4bddfddcad8e830
ef93b94df6e72692f4552ed40497deb8e6bcfaa1
96361 F20101210_AAAMOL kolendaroberts_h_Page_074.jp2
04963e4b7172345ad1fb356b9360913c
34cee564c698702381404fe4d4a2ffb3ba7807c1
814582 F20101210_AAAMNX kolendaroberts_h_Page_051.jp2
c75776419c37b41ff4e71ed81700c394
92f710de5fc94d0b43bf00ad73c9f90e73f16235
107182 F20101210_AAAMPA kolendaroberts_h_Page_104.jp2
7033defe8208d89f9994f41b8ea1c5b4
59d3371cb45dbc029531104275d9ba34797cb994
963079 F20101210_AAAMOM kolendaroberts_h_Page_076.jp2
b8507b67603e0a2b3afb5556151a47ea
1ed6640ba7a4a2da2f006cd1ca25dc658a243909
860754 F20101210_AAAMNY kolendaroberts_h_Page_053.jp2
c8ce1473103546e5e670ff20d8703bc6
03a0c95f06d66d4723a61d97ef0ca191056f0f75
107708 F20101210_AAAMPB kolendaroberts_h_Page_105.jp2
85ed6cfcf42bbaac712a26cd66ca20c9
342fadc3d7783d4917cf1aea83ce8e6945997d0c
12735 F20101210_AAAMON kolendaroberts_h_Page_080.jp2
1cdaf5594f38ccae17a1c0f6554e4bc6
18bfbb564927233098e57565d48f593d724da5a9
46157 F20101210_AAAMNZ kolendaroberts_h_Page_054.jp2
6c9aa9bcf097ecd0f577c668be20c27b
3caf9086afeb5dcda3ff3fc76b60b0e4da125dc7
105360 F20101210_AAAMPC kolendaroberts_h_Page_106.jp2
9cd17403582dbc15372190b52941fc9d
503338ad749e6b34d964f0958540c3dedef31662
109677 F20101210_AAAMOO kolendaroberts_h_Page_082.jp2
65c23ad501652b8ffa568b057886d12b
7ee5e72cc96196a2004844962d643fa973ee859f
109732 F20101210_AAAMPD kolendaroberts_h_Page_107.jp2
b6469e1c63a8052332bbc4f3518a36a9
b0b0a3513d49b32958fa6077866d29e58658f761
1051968 F20101210_AAAMOP kolendaroberts_h_Page_083.jp2
2ee00aaa8ca444734cc8b018e5277b3a
ea620dca6384d2e67535ae85b6659d8b141ca24b
105557 F20101210_AAAMPE kolendaroberts_h_Page_108.jp2
6c12b48ee71c6939d1f18fd87d635b8f
77da38d6af549519909adb4ba590cf0b3c1314e1
100441 F20101210_AAAMOQ kolendaroberts_h_Page_084.jp2
002e2b0d6996bcfbfbe20108e74c81fc
7525bacf11873c36e1ee72e912760e8b25a252db
109586 F20101210_AAAMPF kolendaroberts_h_Page_111.jp2
f835521bc1601ad06c0ef2678f8c5d60
e775ea63e7f0bbf01f7810c2803d21d1332d0489
1051926 F20101210_AAAMOR kolendaroberts_h_Page_087.jp2
29b2e38466076399c9f233ff9e5684ad
4aad11ed639290c449b25ba1dfe4dd6f342f9cba
107033 F20101210_AAAMPG kolendaroberts_h_Page_112.jp2
e666f90a2b2b6fec7542148ac07173bd
80d2cc8d3be8a05b53526b41f799dffd60d8daf2
83039 F20101210_AAAMOS kolendaroberts_h_Page_090.jp2
53b8875a196f2672681a6b5a55576b0d
1b587b74d7cdf913ebb479a5d6c2dd874d7b204e
1051967 F20101210_AAAMOT kolendaroberts_h_Page_092.jp2
285f92412bb5e3bf2a56d739e1e4c999
bd1532d5f6bc33504f0f5bfa8a88f282b47da72c
132294 F20101210_AAAMPH kolendaroberts_h_Page_115.jp2
6035d101631d9fdcc70af16e840de9c7
7060f4915ec1a56930094e6d56c0c85e1b10cc5a
88877 F20101210_AAAMOU kolendaroberts_h_Page_094.jp2
7fcda2b5bdbed15c8f1f4dbcc0ac6897
e528092d729578d1cd7f2d9b6f8a686f8168d349
140382 F20101210_AAAMPI kolendaroberts_h_Page_116.jp2
f0b659789602452c9b511cdd1299dbcd
2e0dc9705f1047dba4158081f943faba88cc059d
666362 F20101210_AAAMOV kolendaroberts_h_Page_097.jp2
30721678fbbea736b518331ff3dbc77e
85e2f3218fe07750266482a36a0c706b03cbb9c2
123116 F20101210_AAAMPJ kolendaroberts_h_Page_117.jp2
6cbd064140ee87f60e30906b6f05d8f8
50063d5a87a5e815a625554ca601f0dfbf2d4e30
1051920 F20101210_AAAMOW kolendaroberts_h_Page_098.jp2
19786a8c30c241ab23d8b9db13687039
90ee56c0e1b26e5a4f6bd8f57742eed84f8702d3
131674 F20101210_AAAMPK kolendaroberts_h_Page_119.jp2
0debd9a6f05bb7d41d4a24566350bcc6
dad4ee87364e76f22e14ac778e4a4a5d29c6b25b
1051971 F20101210_AAAMOX kolendaroberts_h_Page_100.jp2
c244e631ac21cd1b8aeb7efd2ad41cef
c2d25ea38fb4a805620ecdf3afe9ebb3d1032fb4
F20101210_AAAMQA kolendaroberts_h_Page_025.tif
295deea021a7a4ec0a9ad3b6968bdb10
ca8157ce8770790103168d5cb9b8866afe6ad5b4
139553 F20101210_AAAMPL kolendaroberts_h_Page_120.jp2
48bb80250630138e468b6489741ac44c
606afdbbf6e31d2728408f014b0fa859d15ba169
27292 F20101210_AAAMOY kolendaroberts_h_Page_102.jp2
110f76d95555fa060fa20c6c5705d1c3
916675b402eb5348bc262192b37f6cdd85e5b5f6
F20101210_AAAMQB kolendaroberts_h_Page_026.tif
383856706bf8566e3e49113c3a674bef
45d884077e1fbbe041cbb4b803f2092d6267fe3d
133961 F20101210_AAAMPM kolendaroberts_h_Page_121.jp2
c900bd0d0bd07f178c0cf4e886059b1a
cc586ecb6df61f05cadc9d0f22d03999ce30f143
96345 F20101210_AAAMOZ kolendaroberts_h_Page_103.jp2
6728513d1f64d3d16afba17c7fae88fa
71d02eee34f525a6c473531af1127a4afd75fcb2
F20101210_AAAMQC kolendaroberts_h_Page_029.tif
7091c5b926c1ca3c7fb6dfd249122480
19507b3d321c15525f45f2d33e996e3a71d907f4
134594 F20101210_AAAMPN kolendaroberts_h_Page_123.jp2
d0186b9c62bbc9c99d4d4606b46ec398
ce59c258b81fcf2aa84ad01c5c73d0d5cd30339f
F20101210_AAAMQD kolendaroberts_h_Page_034.tif
33454807d0870c11cbb73a3aa910fd2c
c4ce0c629f38f71f281b05339ff5d6b14ff514c1
13082 F20101210_AAAMPO kolendaroberts_h_Page_124.jp2
87a67f398d0adae063c41f7969b84649
b79c104f915de6ced840114e20530c13ad695799
25271604 F20101210_AAAMQE kolendaroberts_h_Page_036.tif
03fe9cbfcda2b5d5f80a6f142902b397
bcd41d78f896cbe17811161fe625ac4c0d15141f
43616 F20101210_AAAMPP kolendaroberts_h_Page_125.jp2
58157f0c0c4d524c4d79d113595279b1
2f2b344e0aa98afd2269a48327c91d5cc66a2c21
F20101210_AAAMQF kolendaroberts_h_Page_037.tif
8592c838a0a76d21ff3ad1bb19d3cb5b
15825a94cff3264c8f34e82496a31a16e2c4954f
F20101210_AAAMPQ kolendaroberts_h_Page_003.tif
a4f4fd72f7df4a782e70971060d49504
deff6eb7d034a2c0cd71211ac0355cc48cbe9b6d
F20101210_AAAMQG kolendaroberts_h_Page_039.tif
165af09a5f76e12ed51a1cf35737b437
789e66190555848028a54b81bb6f23c43f2cb395
F20101210_AAAMPR kolendaroberts_h_Page_004.tif
5f30c297158077f4622af37d48ed7544
bec1500f0e0b5698d496cc2a9b7a5dd27b62bb0c
F20101210_AAAMQH kolendaroberts_h_Page_040.tif
d91dbb1668cd7ebaf074e27cb1c0ed69
2b8da6ab77e64e8afff590f3fc53bae55fd685fb
F20101210_AAAMPS kolendaroberts_h_Page_007.tif
2eb0451608d9656e47faaa206504b4d2
7821186837d8d6793657567b539c571971cfd386
F20101210_AAAMPT kolendaroberts_h_Page_011.tif
649a73c50dd5f14244850bd18c1ded74
e04f8e0bd7f68cbf58b4fb87fee1fed127751833
F20101210_AAAMQI kolendaroberts_h_Page_041.tif
3f7f122b115e977914fba87ddbce3892
256f3a349d8eddd3076da574103e12ef34593b3a
F20101210_AAAMPU kolendaroberts_h_Page_015.tif
20cc2d3e8d649fbcb734b925aaa4bbda
57d36f5e3c6f4de353037a44e05a74003f401bcd
F20101210_AAAMQJ kolendaroberts_h_Page_042.tif
e8b7d89f24dff937e85da91ffa104efb
749e80083acc4ecb46efcdf7c628b871277de1e0
F20101210_AAAMPV kolendaroberts_h_Page_016.tif
8675716b7eabf0f8908be1bb2290741d
8ce7b56521a77fee64ea9ed267f35f3a5d26aaa3
F20101210_AAAMQK kolendaroberts_h_Page_043.tif
d664ffea283374dacbadee4b6f7973a8
66399b98b2ec683ed77fb340e2b41979073cdd1b
F20101210_AAAMPW kolendaroberts_h_Page_020.tif
0541bff6274d45024ef6d2507e891725
441920251a423f9b73472f82e81d2b532d672cd2
F20101210_AAAMRA kolendaroberts_h_Page_072.tif
646ce0b8edcdb56c2693f53dc9e18098
ca412dc555c054a4d855a1a13bf5357811157d23
F20101210_AAAMQL kolendaroberts_h_Page_044.tif
aa1fc8cbbdb10788ce7f9f4d4e0e9155
9bb2a63a458d93d59f5d34ea6f62af79bb975f8d
F20101210_AAAMPX kolendaroberts_h_Page_021.tif
772299eb6f947410ead14f4681b0fe2e
b5ab1ec9d1b92fbd4184dc1596fcfd852e246fca
F20101210_AAAMRB kolendaroberts_h_Page_073.tif
fa8aa97148159f59bd1f0292a96722fa
25b08e3a9ba82c84c830ea156bbfb3322650296d
F20101210_AAAMQM kolendaroberts_h_Page_045.tif
d884257675dc592855bde56efc9422b8
44e5dea8bcfacee70516747b01c01783939a1f54
F20101210_AAAMPY kolendaroberts_h_Page_022.tif
eb1992fd4d95791646fcf9a1de7e029d
22e4c248aa00f91de7c6ee6a5c572d9dcb09f772
F20101210_AAAMRC kolendaroberts_h_Page_075.tif
3e6e15723055188b09139aa97f6ae336
285aebf0c2845fb03e187f7efb721e8f016386f5
F20101210_AAAMQN kolendaroberts_h_Page_048.tif
8d2d8d24b622f95ee80e7e47cef01e8c
0635a11c8038a9b012d3c66ea173303ef7ce4deb
F20101210_AAAMPZ kolendaroberts_h_Page_024.tif
084de8f957e3c0097eebae9474b27f89
ae06e26058f9cd3f9ee45b7c8642bd6160493c86
F20101210_AAAMRD kolendaroberts_h_Page_076.tif
191058296ad99e138e337d981a24bd87
3009116e2fd3d72423b5c056a447d4760ec54d5d
F20101210_AAAMQO kolendaroberts_h_Page_049.tif
5f78854461a6186340223f10ef63f695
dc38466b5a4636b19efe6472016643df4a2fc8e7
F20101210_AAAMRE kolendaroberts_h_Page_082.tif
73c67fa9940a3805cea6ed2d7716fad3
722eb1783d34b6ec26ca4ee5b3db6d17209144a7
F20101210_AAAMQP kolendaroberts_h_Page_050.tif
d8f4c56e77f5a7edf55ac4f1f0745a07
8444a54aa71eea18d256b98b738fe91509f5fac2
F20101210_AAAMRF kolendaroberts_h_Page_083.tif
a2f99e17d0d31213425f8d56dfc457dd
c064f6c348329be253caac43a28b520e3b6a560f
F20101210_AAAMQQ kolendaroberts_h_Page_054.tif
ca8e7947653e965e493bcaae9a2780d1
b11f54f740acc60c2524c5661d9b6e8ac13d7ce5
F20101210_AAAMRG kolendaroberts_h_Page_084.tif
58297dd8aa92f8ce6a5a5e109b190283
63355ee0bd378dd0f5deccd0ba510bb42a1bd8fd
F20101210_AAAMQR kolendaroberts_h_Page_055.tif
e30f0af7d51c5c38514c8d81979ced69
a06db913991656e4feacc71d8d80721d354c0714
F20101210_AAAMRH kolendaroberts_h_Page_085.tif
d1a6eedec268803d004f06b4cfce58bf
15ec491c3baba557c498ffbedfa87b34bb251061
F20101210_AAAMQS kolendaroberts_h_Page_058.tif
f5b63bc812bb62b6efbe2f88b2876a94
7278bf6de3970bce1346bb29d653213d4be8e6b9
F20101210_AAAMRI kolendaroberts_h_Page_086.tif
de2abcb8aac52d6cb54ac1ff3e7c6ed5
49429d38118f1971471ddf5b25b32c21370d015b
F20101210_AAAMQT kolendaroberts_h_Page_059.tif
064c385178dbbeaac77a4d910564aa37
bdb75c90689f767aadaf1464665ff171b3232615
F20101210_AAAMQU kolendaroberts_h_Page_061.tif
c3daa202330fe76c32d14a6e851ecf50
0ca269751d9416e40a4fe4ec59f0f4f34deab0f0
F20101210_AAAMQV kolendaroberts_h_Page_062.tif
43c55e080e0fe5b37e3b7b4d755690ef
c321e65ff69c35645640f6f095c28375be59ccc3
F20101210_AAAMRJ kolendaroberts_h_Page_087.tif
ee31522d5ddc833c2df2cec6f9cecbb8
2666dc08b06468c8021b2b7a30258f9b7b760ed7
F20101210_AAAMQW kolendaroberts_h_Page_063.tif
1cb57da310b57c442c26fcbf563f0cdd
7d71f431dd5253baf487d4f798cf03196004eec3
F20101210_AAAMRK kolendaroberts_h_Page_088.tif
c1b9018d4cc8c5454f33673ee2d288d6
f4a75a96778f856862801d9708298279215fa2bd
F20101210_AAAMQX kolendaroberts_h_Page_064.tif
e90373b9912da8c87a4a2ee237dd4b74
0eeb3d6ab240445901af9163c1898599e8d73c23
F20101210_AAAMSA kolendaroberts_h_Page_116.tif
bb5a637829ffb2ef4abc1fbcc6a2009a
366e0ff5d727f06490872312225e5ed2afb989ff
F20101210_AAAMRL kolendaroberts_h_Page_091.tif
664e7e4c0c30ade111740aa671fe09c5
65b4ed0cc4fc4a9e9967ce89fc00021e63df311a
F20101210_AAAMQY kolendaroberts_h_Page_070.tif
dc7757f38266d7b89de3a28060a75dd4
dd80125ec6443ff61b74fbea679d1423ff4184a8
F20101210_AAAMSB kolendaroberts_h_Page_117.tif
927db529150a8eda11f5349357012931
825334403d246fc3aa2fd5c4331eb8d763ec6fa0
F20101210_AAAMRM kolendaroberts_h_Page_094.tif
765add1eabc3ea61967c27931ca14b3c
3e0fea68d965d627630c6b6e677865683b1200da
F20101210_AAAMQZ kolendaroberts_h_Page_071.tif
01ab1a2a7dd59ab1d05ad7c12afda82d
dc10f717e81dd09eb4285f9739dd574e40357337
F20101210_AAAMSC kolendaroberts_h_Page_118.tif
76f7ee5f9f831f9db42270db6911db8b
e0b082a7115a44201ab5e9b6f13da3891e264559
F20101210_AAAMRN kolendaroberts_h_Page_095.tif
21af2b74bebdbde802fd5cc26bc00d56
31bdeb3e8984dc323fc1e0ccfd154fb6ee320f4a
F20101210_AAAMSD kolendaroberts_h_Page_119.tif
2007bb438aefa6cea039e70a95bc6015
9cc0e8a8e78828e7286de54a28df0032bf0c8de4
F20101210_AAAMRO kolendaroberts_h_Page_096.tif
82b6d5781bf680a1abd535930dc0f444
ebae291b49bcf7391d003376df7f24fa7cb0ebea
F20101210_AAAMSE kolendaroberts_h_Page_121.tif
fb304243de9a5b98b8fd23fb2a946d2a
ceb9087d4bbc7d0e09871cc5e8d3e0d8afb7ea5f
F20101210_AAAMRP kolendaroberts_h_Page_097.tif
e633b236a9277fa821c4a31443dd269e
4efae7763344c21e17d4df15155eb3139bf3cee8
F20101210_AAAMSF kolendaroberts_h_Page_124.tif
531d93d65df16b10c9d2a3cca374b8e8
84ecf6f72a857bf3d6826f844a8f1b5a40477c29
F20101210_AAAMRQ kolendaroberts_h_Page_098.tif
9aa4523b2d811f764d4fa3333962b2f6
98aadeb2559f5953cd44ad6f87b9490f3e5564ed
F20101210_AAAMSG kolendaroberts_h_Page_125.tif
e98f11a4e2e86cd67d69d32bea376a19
324a8bfecab3559c63f892419952cd6e35f3f5b8
F20101210_AAAMRR kolendaroberts_h_Page_100.tif
ef78188af6ced0fb8d0a4472832ba8ea
0e7f735fa8ac7adf76a6fee440b19a5b9d17a260
9680 F20101210_AAAMSH kolendaroberts_h_Page_001.pro
cf2e5e93722a34bc3c86e0b2d1988932
5f642ea63e673485f290113ae07353fa61c40c84
F20101210_AAAMRS kolendaroberts_h_Page_101.tif
48fdbc5ed75b10349d702a9503e216f2
92a4f1759ac8c175735883cdd1f58f07dc3f3167
1570 F20101210_AAAMSI kolendaroberts_h_Page_002.pro
69b69ec84459efe3d68b2bd9edc2c442
4561b491b6201f529bb6e2a811147b3537430583
F20101210_AAAMRT kolendaroberts_h_Page_102.tif
c50c6191d1584d485e2fc764b8391b4c
bee395e19ca9d02b1df040044236559f1d91862e
29144 F20101210_AAAMSJ kolendaroberts_h_Page_003.pro
999ac81321ef915c62ba88253492d58e
c2f9df19516720c148dbea1ba9949a1d30ec84dd
F20101210_AAAMRU kolendaroberts_h_Page_104.tif
0cbb0f7d843f4b554cf07ea4d464ddfe
a255f894603b2fa2c4479692fdf61e264a63fb34
F20101210_AAAMRV kolendaroberts_h_Page_107.tif
35d268b3262aaa05e718fed7382b2fe5
985b13d47855ff4f397d3981d46dda771c2ee628
78180 F20101210_AAAMSK kolendaroberts_h_Page_005.pro
71b0226dba28191e7037e016e130b58a
ab0d33229b06c3ce5982a5385682494471629ffb
F20101210_AAAMRW kolendaroberts_h_Page_109.tif
eecc045edfb12c42f5b1ccc4b7b6acf9
7598c2287225fb3f09772cdfc7370f6020c172eb
40757 F20101210_AAAMTA kolendaroberts_h_Page_032.pro
60dad1a1d48ec7c6fe69bca8246beae0
4bccc8d28cd4d3001fbdc0a8300fb8b9c83fa1cb
20208 F20101210_AAAMSL kolendaroberts_h_Page_006.pro
91917c3033749b52824fd12c77859e71
36b3dd7b78aa6b9a4d194c3d9b9119e8beaa5f07
F20101210_AAAMRX kolendaroberts_h_Page_111.tif
74062e32b336c3bc6dc7ecdb5cbb25e0
d856d0afcaf5745825cf25b57982abad389e90d3
44412 F20101210_AAAMTB kolendaroberts_h_Page_033.pro
e61969577972867c860ee79470d676b7
b9195f8e3db4ceeb27680d98059584de5c29b12c
52662 F20101210_AAAMSM kolendaroberts_h_Page_007.pro
8aac8b2217b8f83f4d1d460b4a1f00b0
b5a1382af70eea8c1ed7510b456a5f44d2d37bb4
F20101210_AAAMRY kolendaroberts_h_Page_113.tif
46e3c178b1e5d34a90af7e42aa3589d6
e5ad8958de77a316aecaad5d6f411e88f1234557
49562 F20101210_AAAMTC kolendaroberts_h_Page_034.pro
793a9f9c443d77030454f685b8a52063
df81d326eec4bc20e7cea03e8be95798e7d1605a
11754 F20101210_AAAMSN kolendaroberts_h_Page_012.pro
9879c7d4b0f3f7b3991febf528e43347
ce59b5f4c12a8050a5d2869ee3b7ce492d84a01d
F20101210_AAAMRZ kolendaroberts_h_Page_114.tif
18f96196a383a271b79fab625096c4e4
78e3a90c294897075d3149ccf2ef58e1bad4ba0f
44591 F20101210_AAAMTD kolendaroberts_h_Page_035.pro
51e1d7043bc64f7f598907526d15f254
839540a6758f982e1fc7e4d6ff8e2573bb2a11a7
35275 F20101210_AAAMSO kolendaroberts_h_Page_014.pro
712ac2bc0d22f18f95c633812d073ab0
34c016374da77d0c5ebe609289b529603c33c617
32806 F20101210_AAAMTE kolendaroberts_h_Page_038.pro
14544fffa07a23ab304d237dbf980232
09c5893a97b4c4e046384a40d279a69a3a2d50fa
51381 F20101210_AAAMSP kolendaroberts_h_Page_016.pro
44694547d3b30498b134ddb88146be45
b3d05a08505d2ef10fed9f126f077a9432369138
17511 F20101210_AAAMTF kolendaroberts_h_Page_040.pro
63e8e0f823dc9398cbc5742aa9b748f0
4a843f99a696a1cbc076dd210b6c78ab0a11227f
50788 F20101210_AAAMSQ kolendaroberts_h_Page_017.pro
51667711acf4601975e6675d5ba15e79
6b607ff0d616ad115da047cae3ffcb1874d7b75b
19910 F20101210_AAAMTG kolendaroberts_h_Page_041.pro
053cd254b1a594c28b613a61ae238251
d44aafe4fd670a276342147dfd5efc8dfa340d86
16541 F20101210_AAAMSR kolendaroberts_h_Page_021.pro
3310f1559476b67f6170e3395bc1ce88
985b2f25d382bbd92b7853f2ce267d948953ca4d
43859 F20101210_AAAMTH kolendaroberts_h_Page_044.pro
370a0bfaa0064129f4945479ae898738
5db78206ae8ac1828b67d481451c7c15082a0359
43323 F20101210_AAAMSS kolendaroberts_h_Page_022.pro
3f04ff7f94f837b84f60d539a7c23ae0
ea4f7baed51404c5cbf228be5e1c1e9e859fd222
48716 F20101210_AAAMTI kolendaroberts_h_Page_046.pro
e39fe1120596c4eb7206a668e5238a0f
a2260ac8edaf50caae7bb537365644c13dd59dd1
47963 F20101210_AAAMST kolendaroberts_h_Page_023.pro
db876d3913acf16f180ac4ebd7124b58
c43a969dae96131210e002916996252c11c68eda
25618 F20101210_AAAMTJ kolendaroberts_h_Page_047.pro
5f90fcfd42dc7c8ba3826e237592788d
c3b8c9afe4710242e8075daad8bd49144426bfaf
49872 F20101210_AAAMSU kolendaroberts_h_Page_024.pro
3f0a466924d976fcb49c1ee35b9b939d
09bf877ce1e34f0696d8886754042bb4dce1141b
44609 F20101210_AAAMTK kolendaroberts_h_Page_048.pro
8534f62da87e3b928863831b6709704b
eb76177e4c8dc4e7aff48330a6adcf4f75a82345
51618 F20101210_AAAMSV kolendaroberts_h_Page_025.pro
bf2b3f82887fb9d629d37c09a611f7d6
ee8b0c839f22a174f21b7a1d77d732574a364065
50259 F20101210_AAAMSW kolendaroberts_h_Page_026.pro
e67bd975136d8e1a012f2458ef557438
164a4bba5d25eed90373c25a4377f0c99121a719
22699 F20101210_AAAMTL kolendaroberts_h_Page_052.pro
33a60fda8ca5bc4ab959d4399f486c38
100a220f016c2ca9b74b62c3d688dc086b62d3d5
50300 F20101210_AAAMSX kolendaroberts_h_Page_029.pro
cfd34ceb0a34fe628c404db3c8058229
5dab22a54d20ff66e1e86f1d8cb9e42a78058a45
50257 F20101210_AAAMUA kolendaroberts_h_Page_083.pro
e499c37ac0f09dbaf11dbce02a1811a6
6dfdc8d10433d883da3d9a062b777506dc4186b8
35896 F20101210_AAAMTM kolendaroberts_h_Page_053.pro
14ffd706a876129cbac6888f0bc32c17
8886caf165a3f9ca65c719ed5ad7ed60e812afb2
49737 F20101210_AAAMSY kolendaroberts_h_Page_030.pro
88088b08eb580d2fcaa23ac580052824
8e540638cb349ac025fa0ddc9a9e07687953adcb
47627 F20101210_AAAMUB kolendaroberts_h_Page_085.pro
2315aff210d6ec1699da3ffe8691b54d
1763ae42303ed75be74cc1fbab418a4f72c7b0b1
20783 F20101210_AAAMTN kolendaroberts_h_Page_054.pro
b243711a0317a154fc5cdbc02a33cabc
2360ee104c56bb4396a83814d24be554363086d9
27953 F20101210_AAAMSZ kolendaroberts_h_Page_031.pro
233446b20480f14fe0c492aaa78caa2a
c254de84725a9513522fb39d7ed7947dc3c159d9
9944 F20101210_AAAMUC kolendaroberts_h_Page_087.pro
788101f81e7510329d27053ef0672216
2f1c4b82b7b1d3ea32444c25a9e3d9acdc8952ed
32008 F20101210_AAAMTO kolendaroberts_h_Page_055.pro
460cf0b3cd04bf96f617dba41a194549
77b725e11f5d970366c3cd8f140d672680664fbb
25136 F20101210_AAAMUD kolendaroberts_h_Page_088.pro
3d79b1850cd5598e508ab5b06b4d67af
c3f8585a428d10b49cd09935c3ed7271e37ffed9
22665 F20101210_AAAMTP kolendaroberts_h_Page_056.pro
f955210ac83d75a435d2cdd302451548
6e51e0df452da7a902c6e3c973a4706efdadd2bf
13070 F20101210_AAAMUE kolendaroberts_h_Page_089.pro
2b85f0b3bcf3c99872c49acb55424e1e
e0a89616d971e4c47e642873a513f83ed4ceae11
32212 F20101210_AAAMTQ kolendaroberts_h_Page_057.pro
3a1c4fd0a13ca7736f3f0fb374671480
669fdf839b0dde6d7d7a96a9d43f6d287ccc7bde
23397 F20101210_AAAMUF kolendaroberts_h_Page_092.pro
21e31727e20c7ff5747fc369b90472b6
05a6c52be005ef288343f2c9d993779eff519823
30932 F20101210_AAANAA kolendaroberts_h_Page_062.QC.jpg
9018a06bfb9b0f698ef4192d4321a98c
2dbb7e8298b327eb5ad41ae238ded2ce1a0cbc64
26525 F20101210_AAAMTR kolendaroberts_h_Page_058.pro
0d8e3152d0325fd4ba7143a2849672bb
fc1839f0512f95d4791b84ce98578ec1d72fa3ea
32810 F20101210_AAAMUG kolendaroberts_h_Page_093.pro
3099cb487e8ac4dffa428b71a06c6661
16c1a085221b678c0c65a3810461defc372f3303
15297 F20101210_AAANAB kolendaroberts_h_Page_054.QC.jpg
01cf9dbe672d08d1bb7ac0d159075b29
1957f00b9580f55627468412d4618db942c7535b
47412 F20101210_AAAMTS kolendaroberts_h_Page_064.pro
b73a9fef1dd2f6cbefe0e66f3235b496
a5b734f5c944e53889b96803c07886a57f03744b
39765 F20101210_AAAMUH kolendaroberts_h_Page_094.pro
8231edee0a664ae45030233aab77cd6a
0d022e64ccbb381f642f3abff38e96a6d8037963
35752 F20101210_AAANAC kolendaroberts_h_Page_123.QC.jpg
e63774e05bd49373f32376e9b3eebf8d
3946ccf221388ff3ebf0b6c0c7086af8b6d3bb8e
27814 F20101210_AAAMTT kolendaroberts_h_Page_067.pro
3c169712b990c6b59688b48c0469362c
ed6adbeb489257ff7eeb90d6d8ad94e18daf07f1
50915 F20101210_AAAMUI kolendaroberts_h_Page_095.pro
112dfd99b8a4806d222adefe150be1a7
201a99da68760492bb3c610aaf077f2e1074d168
2345 F20101210_AAANAD kolendaroberts_h_Page_012thm.jpg
00079543ea04e1047aa69b6e3754fcd9
b80134a69db1a991fd7e94038fc329b8493d45fe
56970 F20101210_AAAMTU kolendaroberts_h_Page_068.pro
4cf9f2720b547887cb98de66899e484f
47a7fd77d299d7ce830032d0f63cabe8f6c4a7fb
29703 F20101210_AAAMUJ kolendaroberts_h_Page_096.pro
444fb6a6d6d0e4b4e447ade312dbf98b
b5d6c4112cab8195b06bbce42d5ad1c9fdf76a17
17430 F20101210_AAANAE kolendaroberts_h_Page_067.QC.jpg
f21c7c206439c400a62776b486d1dcff
a2c004209355d232037fb3bbe90d26f8adb2bfd4
28022 F20101210_AAAMTV kolendaroberts_h_Page_070.pro
42a3073915dc07a7422b93b99a1256d7
94698ae8d9ed3532378f651420a021b493a15934
23271 F20101210_AAAMUK kolendaroberts_h_Page_097.pro
85fa8856758283ce0e1e39a113e8eb41
7cedac302791f9d0391dceb9084a3a49b887fe5b
8574 F20101210_AAANAF kolendaroberts_h_Page_026thm.jpg
089a6cb9ba048e20a30b56401b6c35c7
b76061ff1cb202129be1deea35e8838f34edf2f3
40584 F20101210_AAAMTW kolendaroberts_h_Page_076.pro
8d445ada1b30f1ec0cb89885c21bcefb
d307cdac8c942a6269b5e50a1bb4884afcb7cd73
8982 F20101210_AAAMUL kolendaroberts_h_Page_099.pro
18a7a63bd315f397628ca06ff3c43baf
ec07c1dceefbd116d268a4c80c092cbfdd964d42
8046 F20101210_AAANAG kolendaroberts_h_Page_024thm.jpg
63192db947964e15d7270642fdd9fa5f
4ec76a8a2d51e9773a13616cd4426581773705ae
46483 F20101210_AAAMTX kolendaroberts_h_Page_079.pro
e3620ed185959e4c2456edc988719e0a
733e35d7186013252b99bff8e9a38ecbdeea3007
137 F20101210_AAAMVA kolendaroberts_h_Page_002.txt
a086949eb85e6a9ca48c0335a462595f
808f39370185c9977520527fa26ec01eeeed4223
33792 F20101210_AAANAH kolendaroberts_h_Page_016.QC.jpg
5814a6799845d0774175a1bc5b7f119e
4aa69b3e647eaae5d4a31e78028f9647ce8dabda
4604 F20101210_AAAMTY kolendaroberts_h_Page_080.pro
c7e54fa9af99e710d00e112f07edde2a
3d2c5335dd1dee22340285ffe316723db6b4a145
1225 F20101210_AAAMVB kolendaroberts_h_Page_003.txt
8b62178246764c69312663689492ab41
7b34f26f6b4e27769f254be0e92c7a71fda231ca
11425 F20101210_AAAMUM kolendaroberts_h_Page_102.pro
2939cb0fe53e4574590c72af0da9c2b8
d0e59da9c887bfae7d031c8a530aacda42722a7a
8568 F20101210_AAANAI kolendaroberts_h_Page_029thm.jpg
df29c24298e8c9bbfdb13ca62753d7ad
0ebf4c674512526114dc3e01275636b7faf96795
49816 F20101210_AAAMTZ kolendaroberts_h_Page_082.pro
fda82be1e5033ebccda70e9dfbceef1b
7e714d4b4802223c03e1dd37238faf2628ba867f
2414 F20101210_AAAMVC kolendaroberts_h_Page_004.txt
0c1561c2c6abc9fd3ed278bdc3b3fedc
4dd1f9fd57f9c130fd858cf45dc888d193cde576
45108 F20101210_AAAMUN kolendaroberts_h_Page_103.pro
8520bc8bc3d2f2e51dc938be220352b7
5bcae6023d203294eff8df56f39cd9b8c4bab4ee
7689 F20101210_AAANAJ kolendaroberts_h_Page_005thm.jpg
acd64ae901772aecb12a1db0f5d797f5
321552c9f2f46990ce0f2b251a2559c7be09dafc
3300 F20101210_AAAMVD kolendaroberts_h_Page_005.txt
f151e8c4242fe9d6a2c7d351c23f087d
13f2b8e24e3601bbba8b6dc5783c2231557451c8
50274 F20101210_AAAMUO kolendaroberts_h_Page_105.pro
f90c2046054dbf9179596e3a92f0e65e
87744d1fb671fdba968942e064ac117c65776751
33431 F20101210_AAANAK kolendaroberts_h_Page_030.QC.jpg
da81ad4e4dda2795c47ee9178f96e421
98066940a2e11f74a5aa12e5f0a21b71fd6a2896
2281 F20101210_AAAMVE kolendaroberts_h_Page_007.txt
4c6ff0a3aa0416e20221d4231ae81fb5
42eb55221687ffd69ff8401552ad2154406812d3
49625 F20101210_AAAMUP kolendaroberts_h_Page_108.pro
51c72748fa6c1964eec2ee42e09e5bdf
5bfdd071280022c22472a28e950e838a74e9ee35
7345 F20101210_AAANAL kolendaroberts_h_Page_042thm.jpg
67dbd5f39f5838f8d436da6c6edc1470
2608ea64a174843d466d7acaf0f14cb3a3c3ff44
2131 F20101210_AAAMVF kolendaroberts_h_Page_008.txt
e34d8fe3b216487f4bf3a20eec277afc
0b88940fce51d3381a7c74aa0a3bd6c7c2e6d7f1
47603 F20101210_AAAMUQ kolendaroberts_h_Page_110.pro
2e2291cf4ae88f21861952ea151458fb
dc9f08dab63eae67517999822a2c67940298c168
17143 F20101210_AAANBA kolendaroberts_h_Page_039.QC.jpg
7af3d91f162a3d51fc80bf2e50cb081e
dd889a445530ed924d71bd885c70ded4e7f5e4bd
4508 F20101210_AAANAM kolendaroberts_h_Page_066thm.jpg
5200093817332d82009e38cbf3d93f49
62a0d88f552eb9e74c668a3333bf3cd884be3cd8
3314 F20101210_AAAMVG kolendaroberts_h_Page_010.txt
23b8340609bc29ab818a369132f9a9c8
dc3242376fbfb4a720d68adfd8021acd9c2b8701
49867 F20101210_AAAMUR kolendaroberts_h_Page_112.pro
02d78033005b5524f096924d4eca94a9
bad6b8eec93e5a2607f09a614140979709c02f6b
8186 F20101210_AAANBB kolendaroberts_h_Page_012.QC.jpg
75abe9d3475ebf5da928e7120ee30357
95ac8478075a0f16cd98c5841f52a6d7219e5c2a
7401 F20101210_AAANAN kolendaroberts_h_Page_059thm.jpg
5e78eb07fe42ee549bb3e200a179d499
57c9afc8a5a707a44bb12477e7feede81d93a00b
493 F20101210_AAAMVH kolendaroberts_h_Page_012.txt
f25d473ed85139d7f06e9024ed327f3c
9c16ebcc336c56e70bb2cff3f034c29aac8e51bd
5417 F20101210_AAAMUS kolendaroberts_h_Page_113.pro
0dea71835e60ccfa2683b1f5112e2075
722c1695839c5fe79d244c99f03633743a9663fc
8548 F20101210_AAANBC kolendaroberts_h_Page_083thm.jpg
402033828383356167c9ec8709511ab3
d0b956c18eee2b716ae968062f66a34720f61898
7517 F20101210_AAANAO kolendaroberts_h_Page_069thm.jpg
e29565627050ceff50272a5922a7eb64
bbef4bb450ef07f625155c6d7365c5ac7ef4fa4e
1411 F20101210_AAAMVI kolendaroberts_h_Page_014.txt
9958a167b07729b97779d34245495b56
89e7c38ddb42c38421d65d01ffda19a626ea5826
63009 F20101210_AAAMUT kolendaroberts_h_Page_115.pro
029dff981cd1f023b9033ee6e14afd0d
3ae4e339f9a9cc4cb862af46cfed8cf43f19983a
26655 F20101210_AAANBD kolendaroberts_h_Page_091.QC.jpg
f90b36d70c85574d2df767049bfad32a
5b68cc43b5abc54ea545267c001b8009dcb45960
19712 F20101210_AAANAP kolendaroberts_h_Page_031.QC.jpg
600633b1b9e0f100bd64d82b6b06a2b7
0614a135a0d471795a9515b6246ef365952a5ce6
2019 F20101210_AAAMVJ kolendaroberts_h_Page_016.txt
e4d29c5a652d150875b3a93151a05d5d
b89750edad5943a9f06ba22b7389c0032f4ce0c8
57371 F20101210_AAAMUU kolendaroberts_h_Page_117.pro
3caa2ffd828853470158b7e898e8e0bb
9d86cb5ea921d67b9a33b3ed064c6cbb4a976bb3
25028 F20101210_AAANBE kolendaroberts_h_Page_100.QC.jpg
a8061e1aa808060a966293da70f4db2c
1424409479849ed17055b7e6562c5ffdd315db4f
33456 F20101210_AAANAQ kolendaroberts_h_Page_029.QC.jpg
a6980d52bfb6f5e48d630db347708bf6
62fa3ba1f619a1c6ed426bd492e653fff3b90fa1
2026 F20101210_AAAMVK kolendaroberts_h_Page_017.txt
b5b940df472ade73566eed3784b2b0c5
19ea7a781747bcd8e32cc04fb39446b1499ee44c
59107 F20101210_AAAMUV kolendaroberts_h_Page_118.pro
c1fff544e47ee3a8c917083f7c344a43
b24aec856fd46f996e856ef4931285290d878a23
6881 F20101210_AAANBF kolendaroberts_h_Page_088thm.jpg
d2aa9df539d70d72627c2f4eab7f71a7
b24f73f02904f60b79cb06989a115abbf5d4e6bf
7300 F20101210_AAANAR kolendaroberts_h_Page_044thm.jpg
3a7992ac979e52bce412839de7e5d61d
af092fb45a203496d6c18a71f738f9cbee5fc3b2
1983 F20101210_AAAMVL kolendaroberts_h_Page_018.txt
fb472acb3da87f7ed4be44062c6bf033
f8df556aead91f8e3267ecf3dcbff864d685da18
63433 F20101210_AAAMUW kolendaroberts_h_Page_121.pro
03bbb645e18dcb5cb471e15ca8df38c0
4fc3eaeca137eb2679384ce1a1cecbedd374400a
8385 F20101210_AAANBG kolendaroberts_h_Page_102.QC.jpg
e58221012f751b00888acc542110d627
8a060d1ffaf735676b26280fa9e52b314248ea9c
6738 F20101210_AAANAS kolendaroberts_h_Page_015thm.jpg
20c0e96815432dfc0adf8771c11ebecb
062bcad570d4cd416fad7809e3867a265b3a2708
1880 F20101210_AAAMWA kolendaroberts_h_Page_048.txt
ba35548ec5dd4bcfe9e9918ce5e36649
de34a64bc79bbc8a8742ab1bc888c36efdce51aa
2107 F20101210_AAAMVM kolendaroberts_h_Page_019.txt
c6de1827246584a27cc26269597365fb
4d051c8d133d235f5d507429b0c9343cd0e85e03
62886 F20101210_AAAMUX kolendaroberts_h_Page_122.pro
ea5cb176d09b42729491ea116a4da869
960807388ff2fab94189b029ffb47cd3e8f9ad97
27735 F20101210_AAANBH kolendaroberts_h_Page_059.QC.jpg
4854e522446a0e2b8bff5c07303a74ac
42d255a8f9407da5b43af97e963f145e96a4fabd
7177 F20101210_AAANAT kolendaroberts_h_Page_032thm.jpg
840a7051e425e40601d2c04f41c81c8f
c468693df2a635741bfc34973344afaea1f55a01
1082 F20101210_AAAMWB kolendaroberts_h_Page_049.txt
0016aec874cc7b9c96e4d670b066dc35
06edfc0d936b3f3982cf63be1cdb232ef47f1c78
64487 F20101210_AAAMUY kolendaroberts_h_Page_123.pro
8008d814824624b659460c74b5d54e21
ba4f2ed5b83ed0e401e6b710b0aed0596eb8ee25
8538 F20101210_AAANBI kolendaroberts_h_Page_119thm.jpg
d7b22aa0c26463994a6324d81a38e4b1
a155cacc565f52fce1c48677bc328ad8019c9a40
24669 F20101210_AAANAU kolendaroberts_h_Page_014.QC.jpg
62c84d3f015dd26d49a8aa61ecaf5f79
f6650820b03fc2bff6b4acd5c2138d6a069a35c5
1255 F20101210_AAAMWC kolendaroberts_h_Page_050.txt
6fc13a7e3cfd30ab57d5ee309457f4ec
1a5e3202d5ab028d7518e09d6ff3b1a6eccce83c
1818 F20101210_AAAMVN kolendaroberts_h_Page_022.txt
f2b6a98e42448f2ffc9d6cd7e557e114
171aa0ac3fbd67b423700bf5a6ef11656adf46ec
18118 F20101210_AAAMUZ kolendaroberts_h_Page_125.pro
f9ff694f66b8794570891fc9f936aed0
4e52cffa1afea4370955bf779fc7a6b05c6f8dc2
8453 F20101210_AAANBJ kolendaroberts_h_Page_091thm.jpg
1ddb24953186336e43af46122591fa41
d4f4e0808b68716f01771c6354fe268ec378fe2e
19178 F20101210_AAANAV kolendaroberts_h_Page_047.QC.jpg
862903ad042e4552fdd29e519fe9afd9
b3e217c9c78f31589f4b69b51a12bc3ce2385023
1545 F20101210_AAAMWD kolendaroberts_h_Page_051.txt
416dd2c4c239d3f2ea5331dd0983cb21
f6db0695c03a050239fc89f95bfabef922c2dcc5
1897 F20101210_AAAMVO kolendaroberts_h_Page_023.txt
a22262ca8273148ddc25ff6b55383309
6c7ae8b1fef9287507b2539e9257f6833e886c17
8439 F20101210_AAANBK kolendaroberts_h_Page_025thm.jpg
a66a5b0d0fb91dda555ecdb49ef828e0
2df34b917a5ef01fbdcbe84929fa1c12b2572351
8293 F20101210_AAANAW kolendaroberts_h_Page_017thm.jpg
6c1e3ac4a8407b17f8d023c6cd0476eb
b5900063132dad4bf8fe58407a8c96a0deddfa1b
1419 F20101210_AAAMWE kolendaroberts_h_Page_055.txt
2832fe82a4caed4dca1bc5e51f7167fe
0cc7b6ca0d2cab5f29f18049cc5e511b9ef0d312
1998 F20101210_AAAMVP kolendaroberts_h_Page_024.txt
f3993777bb0a9986c12585c9ca3ce154
5fdb702cac0604966745cd2e10be68b48cef7172
36679 F20101210_AAANBL kolendaroberts_h_Page_121.QC.jpg
7aa9110fdaa70544993b21b10233b394
284cbb3a6cd45f438fcff972717963dddbdc3f38
1099 F20101210_AAAMWF kolendaroberts_h_Page_056.txt
875995a06a64496512aacb3e3215c061
b8df47c837d8ff22c8493a5b69c985469e4545b6
2057 F20101210_AAAMVQ kolendaroberts_h_Page_025.txt
e1bc9f3a35cb3f0181946231fa6a7bdc
b9248493dd8b827065eb34761c0944e760bc594d
12895 F20101210_AAANCA kolendaroberts_h_Page_040.QC.jpg
085983933bd68d1a5ef6ff825700b7aa
a5910988e8f0b7f2cb30e05d3629fd9b9833718d
5464 F20101210_AAANBM kolendaroberts_h_Page_043thm.jpg
d0b2a6fc824c05e28d439bd340e73bed
5c09579334cf6e840da21b96bde08a87e45a10c4
6532 F20101210_AAANAX kolendaroberts_h_Page_099thm.jpg
f7890079016caa86d1814cae5146e5cf
ea9bd810450929edf6c2d0b744fc594213ea5bc4
1819 F20101210_AAAMVR kolendaroberts_h_Page_028.txt
51373da63a74589a47a349bb576ab6a9
9aa2d671405b869add386fd39e21c08e309596a2
1428 F20101210_AAAMWG kolendaroberts_h_Page_057.txt
6c79acad9cb1e79c0f1a662668f170e7
f0911dd818cd9865c1bf14620d7dac5323217ac8
31110 F20101210_AAANCB kolendaroberts_h_Page_035.QC.jpg
eb77ef0da7b5e310141e9d101cd74a4b
8156a4e9a04ddfe056c5ecaf1d3475d8df10b64e
7469 F20101210_AAANBN kolendaroberts_h_Page_103thm.jpg
07e9ad05c8a37786fc0ef9bdecc025be
d8da409952f38ae40a9fde8a8c8fe320f64c6587
7399 F20101210_AAANAY kolendaroberts_h_Page_051thm.jpg
a4a5f095210c066d6be0765424adc14d
333fd64799138f8d81ff17e94d47df588dfe2a3b
1112 F20101210_AAAMVS kolendaroberts_h_Page_031.txt
f89050f66108239487ccfee99c1e13ec
356fa08a5b6f943c94225be9b12cf56fdf7a1953
1273 F20101210_AAAMWH kolendaroberts_h_Page_058.txt
6b7f446a607ddd1c4625399a3044c82e
b8ce78f2f19ab04d49f5813d8352c0d3e68d1d9e
8399 F20101210_AAANCC kolendaroberts_h_Page_111thm.jpg
665d25e4129a5b4ad9df8480b8ef46e7
dc3a41bca6c502ad3bd4fd067acc1819174be693
8074 F20101210_AAANBO kolendaroberts_h_Page_112thm.jpg
07537a75536a1483f7a88b8b3c88ebf6
90f53fb52231201cd7558042fe4e99bc19615262
7261 F20101210_AAANAZ kolendaroberts_h_Page_071thm.jpg
4c29762bf530a01b18a5780826b463bd
1bfe5be646ec847c6b7b2a0db223a22daf13cf50
1732 F20101210_AAAMVT kolendaroberts_h_Page_032.txt
607875e65f6319725ee255e963928271
95d95fd07ef205b7b01529ff5ab84012bf0bc283
1557 F20101210_AAAMWI kolendaroberts_h_Page_059.txt
b94484c9084e9aebcdf449a295734edf
f81b6374685139642285046a36ea9a4b8167d8c2
7844 F20101210_AAANCD kolendaroberts_h_Page_048thm.jpg
aac35fcc2ed5c866a6f18e380e90a9a2
e5c0c9d252b7aeaf83791430b553b0a26a8f4af1
26501 F20101210_AAANBP kolendaroberts_h_Page_051.QC.jpg
b1ec1430867d917d590a80fcfea7c973
a3808360a712b2a85152dc459418e13cc49766b6
1754 F20101210_AAAMVU kolendaroberts_h_Page_033.txt
db05c962d17455462eb0c2f2c2497df9
28d99a4b8d5999393ed7d881fe240a28e6655837
1124 F20101210_AAAMWJ kolendaroberts_h_Page_060.txt
04a0261a19e515f4a0dd985e59d94500
227a15eec40bbe3d3e737ac14e3eb07a68d15a59
30639 F20101210_AAANCE kolendaroberts_h_Page_044.QC.jpg
f6245189dec9d58a1c99feee373c15bb
62ab696359525b5c1e326f3c6f588a91d7a487b4
21909 F20101210_AAANBQ kolendaroberts_h_Page_075.QC.jpg
8f5dc27a0c61635c4539fb1e298506fc
28ef8e6cacac23ca6f655d86d230b15b7c727bcb
899 F20101210_AAAMVV kolendaroberts_h_Page_036.txt
81ecea4be227e4487a15fad95e01f412
f8c84dc40386fbbdd3b77672f4dc9c800bd36138
1316 F20101210_AAAMWK kolendaroberts_h_Page_061.txt
844f4bbb14d0975e70769359aefa19f3
dd74a3bc07cedaa9c2d7371db7a54769ad408d59
5834 F20101210_AAANCF kolendaroberts_h_Page_060thm.jpg
8d650449873e57504e49c068ed64de81
ef5d2a5afc59f0ad91332d6cec27083fbf75ad11
33677 F20101210_AAANBR kolendaroberts_h_Page_045.QC.jpg
32c8bec88cd6c75481dee64312bbe002
b70b948a8233e2952cbe69018787a4db8962e32a
938 F20101210_AAAMVW kolendaroberts_h_Page_037.txt
6c75f5f23e931a20edf4383a09c1f7cb
131682461a2b180d6c76e1e13820672f89bddca8
1856 F20101210_AAAMWL kolendaroberts_h_Page_062.txt
f40f56940f8d83aeff115f9133afa8e8
a01b6a837a4f2f345ef6468ca0c0ff6a8fc1f93f
5512 F20101210_AAANCG kolendaroberts_h_Page_003thm.jpg
adf42693ebe586fe6be7d873fd43dd17
f85983aca54e5dcad92d112b4bdeb7cd4d8698d7
6426 F20101210_AAANBS kolendaroberts_h_Page_087thm.jpg
accfece74381617394f486d1cb2833b2
34462488ba8cd316d709b0b0291b31c05a4d3a0e
1427 F20101210_AAAMVX kolendaroberts_h_Page_038.txt
84acdc4d36675866c83c56eda185a25f
3f49bd45acdd4d7d56f9d3a39932c00c55fc5248
607 F20101210_AAAMXA kolendaroberts_h_Page_089.txt
e4804e2081b06e1e546ac8fcd9aa6589
b45e9a87aa821cae22e27f8fb5a532862e7abfc4
1813 F20101210_AAAMWM kolendaroberts_h_Page_063.txt
2608017e97e72cd4e7ee473c7aecb703
1f673efd0cba233ff26e7c67dc4464e334244571
2011 F20101210_AAANCH kolendaroberts_h_Page_002.QC.jpg
659b57e1e982b5890937a9430359fdfb
6aa48e03107535332a3a4d5700cd5bb2141135c4
27758 F20101210_AAANBT kolendaroberts_h_Page_069.QC.jpg
4e64a51475126065741a0dcfdf54289a
d906fde1866e886832d703511e2f56d7287f4e71
1243 F20101210_AAAMVY kolendaroberts_h_Page_043.txt
dc161d5dbf88b21a548c59f977a10020
f4edf2f04ecc8500a428dc5d280137b6f0c4f451
1981 F20101210_AAAMXB kolendaroberts_h_Page_090.txt
977aeb5fe98936b6263aba2da31cd7a2
eda52cfa1b89b97658cd66889c8adce939d785ab
1911 F20101210_AAAMWN kolendaroberts_h_Page_064.txt
2841d6c2eeaa8dced36c89c988dabb9a
21188981fb4bb094c544278de2bbbcf2047a894d
194607 F20101210_AAANCI UFE0017502_00001.xml
7876d42d02ea6b4c5d0b3a31b7d080be
1ce06d338dbf3fde57223627fe4493bb43c645b9
33293 F20101210_AAANBU kolendaroberts_h_Page_020.QC.jpg
0d737ca722f047712dc76de7fd8e5111
2186df3683a9b22126fb1b05681eb53bf13b7a3e
1910 F20101210_AAAMVZ kolendaroberts_h_Page_045.txt
a6604e569e20248920911cc3f1ae9f24
6aeae8049df6830e68af217ad05bd4d13c847060
519 F20101210_AAAMXC kolendaroberts_h_Page_091.txt
ba773ffe37cf1a16ed35357a1defd80d
ab7ee6243cc8dac41e2e0aba4cdf3d918ca299ca
9104 F20101210_AAANCJ kolendaroberts_h_Page_001.QC.jpg
e5e6f38beed350339c6ddbc30195c560
a561cd8fb73f7d6fa18f300d788022785b26b1b2
31221 F20101210_AAANBV kolendaroberts_h_Page_076.QC.jpg
19b969055a595012ce37da181dbf893e
b5c507347b5ac791a8c4d23c07f59eac96db7f4c
998 F20101210_AAAMXD kolendaroberts_h_Page_092.txt
a7e90019f2f6e28f92aaf5aa8e665b7b
5a8dbecc11df2d3bb190d668c97df1ef511dc2d6
1988 F20101210_AAAMWO kolendaroberts_h_Page_065.txt
cd9b056f4f838e0b753dccbfd8ef0a9f
8ce6e3627464ca4882f489df99a185cf4be91029
9637 F20101210_AAANCK kolendaroberts_h_Page_010thm.jpg
ca0962681e9d9929cf2abd9dd0d67332
0293c19e2ea1bc79e34450b9fe2a2a06a448089e
28215 F20101210_AAANBW kolendaroberts_h_Page_053.QC.jpg
672f778ac0d6d94c01c9869ca126726c
b0bac380c42589da5c424453641448d527fa2bc8
1322 F20101210_AAAMXE kolendaroberts_h_Page_093.txt
2f277ff530e3e0bfa2dd97dd6aafd087
3c252fb437e354072160eb1b8c36980ede402eea
1327 F20101210_AAAMWP kolendaroberts_h_Page_067.txt
37f3a97c26f1c21cd827c6d484b18dee
495e543b1104abd63b83d509439d14784e3941ba
42358 F20101210_AAANCL kolendaroberts_h_Page_011.QC.jpg
732adc8480717c21026ea39252df1b10
dcaa134220380fa3719027c4de7b92fa0b4db09c
26603 F20101210_AAANBX kolendaroberts_h_Page_055.QC.jpg
fabb3d16716c631d0766ad539baf903f
cd3fabd608a47029bd0b7767b25720c2ee88edae
1697 F20101210_AAAMXF kolendaroberts_h_Page_094.txt
094a46249f846eddeb26fc592c81c4e0
549ec8683fd740c46c15a6f13395133dbb5c3f31
2802 F20101210_AAAMWQ kolendaroberts_h_Page_068.txt
4a78b0c4de77bcfa61e9187ada6fe505
b00addfd30b9ad249af644dd9978f169fae4d11a
31201 F20101210_AAANDA kolendaroberts_h_Page_084.QC.jpg
f1a7b5b312aa85500f0f8f11372ae182
06d2fd6961f342213313f62faff6879cf5d27ca0
24892 F20101210_AAANCM kolendaroberts_h_Page_013.QC.jpg
432c6ddfa9b6848ee45c780abdc3993e
6f7a1424f30bea7b009118460a80b67393bff315
1357 F20101210_AAAMXG kolendaroberts_h_Page_096.txt
198398938281bdbe8ec751ff94be36a6
3071f51813ce3f0a4f1660696d0b7df423473944
1479 F20101210_AAAMWR kolendaroberts_h_Page_070.txt
78064c86b38798ddadbb99fa142033fd
2f4ddfa8f39ee7526c9babfd86e01ed05e101d8a
28441 F20101210_AAANDB kolendaroberts_h_Page_088.QC.jpg
c20fd8fae9a87fa04a03524100e8ea29
b7c210e4a7bf3191389d47afce66b19e233f6eb7
8089 F20101210_AAANCN kolendaroberts_h_Page_020thm.jpg
f90ac1e6f879af41152a2bab6bf3b19a
916363fa9abd586a81c1a88b79e6e6de5b670045
4737 F20101210_AAANBY kolendaroberts_h_Page_031thm.jpg
1a70b8f434e3b24841c28d138dc23827
09e27c3ab16fb03d12d382adab042d60e7758d15
636 F20101210_AAAMXH kolendaroberts_h_Page_098.txt
79694f2fb74d129a465adcc079d5db27
79965f2b38904c3d3d83027ee01d622276f1d123
1684 F20101210_AAAMWS kolendaroberts_h_Page_073.txt
5c2dfeb182f295c6cea3e3c4d3ab5fee
9eded02ebb4002c3e2b66eee4321828d63af4930
6706 F20101210_AAANDC kolendaroberts_h_Page_090thm.jpg
a4fa1b0a247faa6bce8f8f263a67fbc4
b289ed36ce5f2cace07bc9ce4742170f7dbd57b0
8034 F20101210_AAANCO kolendaroberts_h_Page_023thm.jpg
8a5c982f51abc95d335ef57749a2251a
0664f8c4fb2aab9b457827b3772981bf5be2de5b
25375 F20101210_AAANBZ kolendaroberts_h_Page_057.QC.jpg
239b49fefc41db1c3cb8f176e02374bc
7fdc7e7015dfbf1361e511ce023bbfd6919af108
1898 F20101210_AAAMXI kolendaroberts_h_Page_101.txt
b19e93079cd26c2febc6c5dbfa70f5a9
13c11dbd7c045f0e64dcd9f9a9a72b767a9c0312
2048 F20101210_AAAMWT kolendaroberts_h_Page_074.txt
5cb92642722a322771de82f1ab78f5c8
5dec4d375ff34bc29cfe5eb5e2a8a0e1a02b3d94
F20101210_AAAMAA kolendaroberts_h_Page_001.tif
6a17222274aeabf9995e206571160e38
dc6a9a06750eede214bec5575406c45555df841b
9099 F20101210_AAANDD kolendaroberts_h_Page_092thm.jpg
842a241d8596c6944ab9b162fc09c343
b97d07f7c4709f9ea7e418b92166b1cbace887f6
7802 F20101210_AAANCP kolendaroberts_h_Page_028thm.jpg
5cbfd1abdbc8db0f07208187800e738e
0e85ecc62fc01c69465212e8b9fb86f33c21b4b3
1857 F20101210_AAAMXJ kolendaroberts_h_Page_103.txt
2a26704f00205b0799ba6549a6e12a2c
2a30b3654419f065a4845b7fe929fc899f17154b
1236 F20101210_AAAMWU kolendaroberts_h_Page_078.txt
c6624aaf4bc71172199dc551a5d589aa
ae4ab717b93673957a7bf168db66e38ae90e55ae
F20101210_AAAMAB kolendaroberts_h_Page_067.tif
b64a830c75e1fe46aae1430f073775a9
66b35a6d921a9ad83533427c056980a0d012ab55
8340 F20101210_AAANDE kolendaroberts_h_Page_095thm.jpg
4f83d89b86db28657ffc791195771d8d
d5624d812ced52261e1f9f57a700c200b7e4e9d8
F20101210_AAANCQ kolendaroberts_h_Page_034thm.jpg
99a0ab0cad0d67c40d05c3d1ad07e384
0a5556c532b0ccb59c67d2c2fe36cc03efad940b
F20101210_AAAMXK kolendaroberts_h_Page_104.txt
c40a515b4329fe4f0e9094c8dc3835cc
4a78e51860ff02d7cfd0085c485a09416af6f2c0
225 F20101210_AAAMWV kolendaroberts_h_Page_080.txt
ab7b8126b48d86a838702cfc4ee70d89
6ec2e7e6f9b97eb62f8a86ad29426189f46ce625
1018 F20101210_AAAMAC kolendaroberts_h_Page_047.txt
c08f7931f90218d3eb06e8e05e770fb4
470021d6f36c7df360fdbce2ac71f8659d89f507
6510 F20101210_AAANDF kolendaroberts_h_Page_097thm.jpg
501bf26cc6149ef24e06cc5864c8490e
e6a9cb21f70990c6588a4f56ced7ff3ae244f771
7543 F20101210_AAANCR kolendaroberts_h_Page_035thm.jpg
410b6edc70f9f9f516893082ba300d52
9308d036c87829dd6bec3cf689cbac39047a80dc
1972 F20101210_AAAMXL kolendaroberts_h_Page_106.txt
ff27ba97bcf3b9eb9f75a4c963086813
9c02b860f43dd6804108c4d570a8a3f8a122b2a4
1752 F20101210_AAAMWW kolendaroberts_h_Page_081.txt
4c547c230d0112485cc6c3dfade383d6
891a16537933311458de959b2128f53ea9415efc
32502 F20101210_AAAMAD kolendaroberts_h_Page_104.QC.jpg
18d2a2824d640b7f9fadf8190b8faba1
1fb8d6dc05d90488f86a737373eb900169b4a48e
8137 F20101210_AAANDG kolendaroberts_h_Page_106thm.jpg
f2b5f45eb0c0c42afb22f91a3b95e085
9ee51b44cfa6dce90d667e779600d08ef9439479
3760 F20101210_AAANCS kolendaroberts_h_Page_039thm.jpg
9df3496f4509476cef0121c9794cd141
c71064e9c020655c55b965611e7dbfd20858a77d
238 F20101210_AAAMYA kolendaroberts_h_Page_124.txt
79699d4dd062d9187b9779c7e5f68581
70f4a1051db07ba4e7cfa145d2b408fe02c3f768
2017 F20101210_AAAMXM kolendaroberts_h_Page_107.txt
b717d08073147d88f591b8df6d65d383
cdc49ec98daf15ede5461c8ff68c59f3179999af
1829 F20101210_AAAMWX kolendaroberts_h_Page_084.txt
40d3c80b38b76819e7b4a29150bc3490
77e0a7948d0962a9cc3d78d539d1f4bddb696852
1051933 F20101210_AAAMAE kolendaroberts_h_Page_089.jp2
66f36b61913455fbfcaa1fcdfb12dc59
bae6103638ade78a7ac51df8067992126740a871
33552 F20101210_AAANDH kolendaroberts_h_Page_107.QC.jpg
e65a87746516dbcc0662ea2e1493d5ee
052f8fc561c3731e5c522567544f15cb42deeede
29343 F20101210_AAANCT kolendaroberts_h_Page_042.QC.jpg
a9a477b2913703da04652cbbde1558c5
083677fa85ec535d52a688814685eeb620f3af0e
769 F20101210_AAAMYB kolendaroberts_h_Page_125.txt
d8831afb20d3f42e754887bba7a51481
c938aea0d26ce9fc8821e43c5afc16987487fd4d
1960 F20101210_AAAMXN kolendaroberts_h_Page_108.txt
e130bf64a0c906e99ffa2f84088551ba
2180e4d8f85c966b11fd7261387c5181f0fcd7f9
3903 F20101210_AAAMWY kolendaroberts_h_Page_085.txt
628bcca6dd8474143fcfe6419e0add1d
b26f1ca96b42ffc1de98dc4864a04f8cb91cecbe
457 F20101210_AAAMAF kolendaroberts_h_Page_102.txt
d8c32c369e0687f7a148094c67d8a90a
b6208a591a64e95a190f0268e8dd554ab9d3cb25
8053 F20101210_AAANDI kolendaroberts_h_Page_110thm.jpg
0c46c9e6243de1979bd84558b244073b
b9520e126adfca804e4a1d96de23f2f8076a1390
4631 F20101210_AAANCU kolendaroberts_h_Page_047thm.jpg
e303a88c27d8b34912b5589f0dac843e
bd61a4c82b66dcaa7f8c666b34508a00a35e85e7
2459 F20101210_AAAMYC kolendaroberts_h_Page_001thm.jpg
8ae6b8769098a701e596058b08bcbe4c
940667c9483c839e7bdecbf0579e7581f722d6e2
1935 F20101210_AAAMXO kolendaroberts_h_Page_109.txt
838b6f50be3247a62ecf52e9d00182e0
0eed2a707e6fca6f9629aa911db08fa3b12b01d0
1093 F20101210_AAAMWZ kolendaroberts_h_Page_088.txt
50342d48504e97533258109e787326fc
6a6ca7c965e48f1f9801cb9f1126ac52e3ca0a62
F20101210_AAAMAG kolendaroberts_h_Page_051.tif
35973a804042037e1860993765f470d2
1b0ced915134bdfb9b56f18c472221d07bbe49d7
8440 F20101210_AAANDJ kolendaroberts_h_Page_115thm.jpg
f254366636d131e88914040ead661854
891dbde6b51c035fd27a9eec5a14a70b743d89b7
7279 F20101210_AAANCV kolendaroberts_h_Page_055thm.jpg
cda29b5913cb4747a6ed19d67b9f62c3
510acbee8982b8507b258934c6a1b6ca25785a9d
3251505 F20101210_AAAMYD kolendaroberts_h.pdf
ee962eab32025f0a02510c0b89bc823e
b9deda0751786171e50fad77afff07da08a572f1
571315 F20101210_AAAMAH kolendaroberts_h_Page_060.jp2
35c4bb612ee50b436972678056454265
5a4023ba16a6963e779c2bc09deee378e2f8f44b
3498 F20101210_AAANDK kolendaroberts_h_Page_125thm.jpg
295217f1c542d51b87b56b090dc9abd9
77fb517eb6ab6d6178003d2be99021ca42aa31b4
24773 F20101210_AAANCW kolendaroberts_h_Page_061.QC.jpg
4271cecbed57d1312143f56172128046
4dd63bf56cde2f0a7fa3fa9e15316b13962d1349
2477 F20101210_AAAMYE kolendaroberts_h_Page_006thm.jpg
027df605695ced05cc33da38e876fb1b
7e9ee20f3292b3d2f85c736b7dab2681b491781d
1881 F20101210_AAAMXP kolendaroberts_h_Page_110.txt
b9e766aa33c73a34eb1b21531d785849
7e87e1aaa55ba816aa148e045a7628619424cd6b
F20101210_AAAMAI kolendaroberts_h_Page_065.tif
9d523ec59e250145e7f2ccbb7f9cce08
3cd49ef9496d3001217bf8512f3bb95c57dc0ccb
31427 F20101210_AAANCX kolendaroberts_h_Page_068.QC.jpg
a1b1cad6ec2fcb244e970dcb8cf97691
8945a367fb9effde209680b3d56546dde4cab1cd
6298 F20101210_AAAMYF kolendaroberts_h_Page_075thm.jpg
a932b9d2801ab13b04f797e5c1659ba3
79c3c32a595eadd5fdd19d9edf89c2e401c119e2
1964 F20101210_AAAMXQ kolendaroberts_h_Page_112.txt
45e9bcca9fd873f86f86a66200e83cef
77ff780495b0303827250faa1c06e98f3d9ffb8d
844792 F20101210_AAAMAJ kolendaroberts_h_Page_071.jp2
5e5c3ba59da47f4e2b4a697654f8ecc3
3f6af07edf86145ec9052a9f96b1111574040a36
4674 F20101210_AAANCY kolendaroberts_h_Page_080.QC.jpg
127084e891e6bc98a6b89f11fcb012c7
9f28940b6f4e84994d68c65431e39c2be0bcd270
8192 F20101210_AAAMYG kolendaroberts_h_Page_045thm.jpg
43080ba31dc7086eae9b54e90e77b2bd
cd189080f977d9968c011abf284cd5432decf80b
2218 F20101210_AAAMXR kolendaroberts_h_Page_114.txt
f2cd3306f2d857f4399842d00953b3ca
a32becd3e1f054a462ce2e7978ef47ba479d4efb
4696 F20101210_AAAMAK kolendaroberts_h_Page_056thm.jpg
be15836be3c590b1e805915bc005127f
08e1428ef7f229f57b339bdc0fc6b6cc5754ff8b
27504 F20101210_AAAMYH kolendaroberts_h_Page_094.QC.jpg
f379fdbb802ff9c4442b0296d8546407
9809a1e6ed0caf62d5ba97ee0467fb4e7340c4f4
2560 F20101210_AAAMXS kolendaroberts_h_Page_115.txt
1972c724c53cf71c166e45e2363e8f97
4f9055cd5370bbbd943174e8ba6c459c35a0826d
28568 F20101210_AAAMAL kolendaroberts_h_Page_077.pro
880c5c633be0a9fdbba372b593fdfd1b
677563c07af898fa41303c210c0e2ff09e8621eb
29006 F20101210_AAANCZ kolendaroberts_h_Page_081.QC.jpg
74951f559cf3031660915faef6edf3e2
2df2766b5bfe60ea76078f22663777a328f5e804
35108 F20101210_AAAMYI kolendaroberts_h_Page_025.QC.jpg
e6ed610d070d961d81a01b23a41ca4da
6b5848d821adf3c9c1fb1b0bd8646fee4b08e6ec
2738 F20101210_AAAMXT kolendaroberts_h_Page_116.txt
fa6261d8786bdac772780338cbec690c
1646ae94b65ce8ac5fa173c45175627d3fe38807
1993 F20101210_AAAMBA kolendaroberts_h_Page_082.txt
591cf9ada71ee0f41340b52a49ee7b59
444ed8e95f537df21b82364c0e0ca9068da4ac24
F20101210_AAAMAM kolendaroberts_h_Page_122.tif
6c2a1187cd0a599607c7e9f69010850a
fcad02b84043b1570fb2ddeee5cac9fb77496276
33338 F20101210_AAAMYJ kolendaroberts_h_Page_005.QC.jpg
5e67a6db63a195b46a740007d16353dc
da8e632c514b4735691d3759df869e88b0dc0ab4
2342 F20101210_AAAMXU kolendaroberts_h_Page_117.txt
0bfdf02b476d1ce793b85277cf05d4e4
4c3d891f3f18af269b59b849a79baf5e9c622070
2028 F20101210_AAAMBB kolendaroberts_h_Page_069.txt
e3f330756aef904b2670f759e25f6386
45877f39d4344a14e4c1086a08d592198d4a4d9a
1051956 F20101210_AAAMAN kolendaroberts_h_Page_004.jp2
06cbf3c26dd048abba8ed3aeffba8aec
14f3d1543e6ee1eee42b462de4d4965f8bfa044d
18204 F20101210_AAAMYK kolendaroberts_h_Page_066.QC.jpg
e4634485c0a149c171a4f0eefb31d26e
c1c931eaade09064caaaf10a0b43cba8e7061176
2411 F20101210_AAAMXV kolendaroberts_h_Page_118.txt
905de090d981bf6d6a6f1649ac9d4749
2b18740f7514dd1a650a68096bf6b393af1f1af7
56068 F20101210_AAAMBC kolendaroberts_h_Page_004.pro
92e7a9e2bd2f0ce98cb46f0585b33df7
1448106df77eb7ace46e5fdb549772c85ef3c667
1658 F20101210_AAAMAO kolendaroberts_h_Page_076.txt
30f11b3ed07a5cf63e84d8d09b90ace6
5cec2e792509114a845b58c068a650438ebfe4f3
4693 F20101210_AAAMYL kolendaroberts_h_Page_049thm.jpg
d097216f74f9be217c46b149433da8f9
79000bfef3927f0e638f931f4d46dac46640dad7
2559 F20101210_AAAMXW kolendaroberts_h_Page_119.txt
210cf91fa32507ca14ea67eb29bffdef
8038a2e5d7530634c4c39512a3bba646d157f69f
90286 F20101210_AAAMBD kolendaroberts_h_Page_004.jpg
297ea1c833446d1254db7a053d148129
c8c5bbdccb5a3463c9dd3c1685925ad6d5120755
F20101210_AAAMAP kolendaroberts_h_Page_099.tif
a7f85779e784df74067699d068f2a3d0
f04ac688b0cd49fdf5a4b65152075aeb70c0683c
7344 F20101210_AAAMYM kolendaroberts_h_Page_084thm.jpg
3c9bdff704261deb05f9d8484025b394
564748df849e8b0cf75f689e2421aefd4b07f782
2673 F20101210_AAAMXX kolendaroberts_h_Page_120.txt
7c8742ab158ee27f5444e65e9cbb3a13
ee3f710fd52c0dd093982bc8073925ed72faaf41
109032 F20101210_AAAMBE kolendaroberts_h_Page_034.jp2
34f6057b5ada9b746008b1e3d297c0bc
83fd07839c00f4dd2da7a2aeda7e1649c619858b
F20101210_AAAMAQ kolendaroberts_h_Page_093.tif
6d2dfd826e88847d689d9d42e3431e4f
270ac0f8ce736dda132cd2b376b12c4a3fcf05d8
24030 F20101210_AAAMZA kolendaroberts_h_Page_097.QC.jpg
167be90a7b1012ad675dce41cf6c1658
9c429cb567063b8937627f0b27b87f1c87a79578
5625 F20101210_AAAMYN kolendaroberts_h_Page_078thm.jpg
d59e3a48e1020c501aefb56ff8b11a8e
97617159371a9a14aa0769083f629520983a7907
2543 F20101210_AAAMXY kolendaroberts_h_Page_122.txt
55aa29f24b75a922f08a61ea8da33de4
83f3d4c57c271a1231fe6122f910a2f779e3a8b0
32313 F20101210_AAAMBF kolendaroberts_h_Page_071.pro
58b6ece6adfbff1b1baece52a2a1acc4
84a525d33f3c502be5611c962c1031488af28ca8
7217 F20101210_AAAMAR kolendaroberts_h_Page_073thm.jpg
c6f0d9c7dff2510b5228af5750e09053
87cc162288fbf944eac5fea52f52ca0dce9057d1
33961 F20101210_AAAMZB kolendaroberts_h_Page_095.QC.jpg
86012c2f0368752ced4c4c173298c82b
07acdc65a16d40778344a55bfe46113ba027810e
19796 F20101210_AAAMYO kolendaroberts_h_Page_078.QC.jpg
0e84772af49f019a93fbc29efabeffa7
8103ffca76767808c8e431fac41088c333aa890a
2623 F20101210_AAAMXZ kolendaroberts_h_Page_123.txt
7f975b0ff76c2b550592e7332e57368d
c68064cc399ba00e3bb2fad5accd9ad85b145b85
F20101210_AAAMBG kolendaroberts_h_Page_031.tif
baf1ce57f371fb46a1a428fc0c86b492
d402ff2465a815c91e4d47b37b7d1b22cc3ce21c
46540 F20101210_AAALWA kolendaroberts_h_Page_054.jpg
f59bc54802b1b30b7841595b75eddf4b
9b8ef9079b47755c5015df8b67a1ab5e950a9e3a
43164 F20101210_AAAMAS kolendaroberts_h_Page_063.pro
5b528814f97166a65d54662e3cabb696
486cc9f7a5610a711ea77111f36bc9e2b3b0458f
6098 F20101210_AAAMZC kolendaroberts_h_Page_014thm.jpg
13223456c897e0f7d7b220e729bac5f1
3262490a0c57bda4b611653b0237a7c7d627431d
4969 F20101210_AAAMYP kolendaroberts_h_Page_058thm.jpg
f1fdbae9ee60ea20b928f4053f5150d5
d4686ac551ac799e6ddaf379995dcbe40282fc0c
54154 F20101210_AAAMBH kolendaroberts_h_Page_039.jpg
8f9819f95f00c8cdee3478451dfb662d
a1e74840d1edb541af3dd7a5dc62d34520c6c695
F20101210_AAALWB kolendaroberts_h_Page_029.txt
3a3cd1642467a16fa322b24cee04bc1a
6161876a9530f05963639db04ced4ba4e8cbda36
33543 F20101210_AAAMAT kolendaroberts_h_Page_065.QC.jpg
eebf7ff9616e9c34cb0f7b8cb9023ee9
c7f45a7beb587015a1947131cfb311dd0b44d969
28997 F20101210_AAAMZD kolendaroberts_h_Page_008.QC.jpg
a76ea4bb4d7d69656e47a7906c4d6e9d
e604b9112a93bd7e2d9a41e0da8ecd008165960f
44614 F20101210_AAAMBI kolendaroberts_h_Page_074.pro
e8012c2c7a016a27e45cf122a9d7f13a
17a20905babe6429a53f999624a3bfb713e12ae8
1051958 F20101210_AAALWC kolendaroberts_h_Page_099.jp2
e686e464a8b622ddcf03943aef3078cc
4b1e632effe37fa37729673668533bcbf0267792
6191 F20101210_AAAMAU kolendaroberts_h_Page_038thm.jpg
3961280ce82c1db4c36b392960189f22
94668d511f97ef74eafb56b131797fe48d80199e
17281 F20101210_AAAMZE kolendaroberts_h_Page_050.QC.jpg
2dcd072fc7db0c610ff8b8f0d3760cee
9ed61f7738613071f665186fbf555f6fe22398e2
8488 F20101210_AAAMYQ kolendaroberts_h_Page_121thm.jpg
0971e39c2047d9a8438fe28141f5313d
fca3803816bfe6cf37e9d40ca18ea5e2828bf7b0
27772 F20101210_AAAMBJ kolendaroberts_h_Page_096.QC.jpg
60eb154df2f560f42e69058ea909a125
cf00ae0669314eb13f1f080400e38e6bbef29827
103708 F20101210_AAALWD kolendaroberts_h_Page_023.jp2
0935e76fbf4a5415ff37ae6d83807a2c
935bec4e51616b4c051335b9ab7fb6ee68ea7a39
F20101210_AAAMAV kolendaroberts_h_Page_120.tif
f483720a5509b828f972d2ef6baaf6d6
65835db35086fab68768ac399e0a3b70262b9400
17514 F20101210_AAAMZF kolendaroberts_h_Page_036.QC.jpg
ac44dd98d0610cb62ed1cd04261045d7
3e23d6e7492f4c7af32b2e683fe30b6a048ae727
31366 F20101210_AAALVP kolendaroberts_h_Page_048.QC.jpg
059b5ce928547319c802ee6af3f01627
d533881bea553e60f5cab31d30e2b46b8a336a40
7766 F20101210_AAAMYR kolendaroberts_h_Page_064thm.jpg
a60014fdc5d78eede1ec7c1d772d019b
7e7c6bb2f22a9a5fc5e07006192f8262e023d9c1
9777 F20101210_AAAMBK kolendaroberts_h_Page_011thm.jpg
9a8c0c617c53d0ae330e9f673fc69944
deddd3965fe870aba0eeea057008eca0f43e61fb
8840 F20101210_AAALWE kolendaroberts_h_Page_123thm.jpg
3039395eb279bd392b7399ea8f6158cc
a3a04b927b31c5329e5688b2c4139f51fd520665
45105 F20101210_AAAMAW kolendaroberts_h_Page_084.pro
c3599d1ff69aec5a0096ae79fa9ae088
63397f73275e588688c37f2c23151699b316866b
26905 F20101210_AAAMZG kolendaroberts_h_Page_071.QC.jpg
5045a8991c3e07d0d7f7364e7cc452ca
99ecc591e7212d9305868b1bd056d25844385480
102416 F20101210_AAALVQ kolendaroberts_h_Page_045.jpg
b19dadc983a4cb0c22e8adc342002767
0a1e8c4d99d292e86f89f08e883f1528b313a802
24149 F20101210_AAAMYS kolendaroberts_h_Page_038.QC.jpg
05a1e749713a65a8d451d16ea13c9c5d
649cc998c011b18bdae382ad452c36791424af8a
2573 F20101210_AAAMBL kolendaroberts_h_Page_121.txt
238229609b0bcd3d267260165e8d9ee7
04fdeb75c4e2c9cbc2407c065a54fb6dde0ea32f
1986 F20101210_AAALWF kolendaroberts_h_Page_100.txt
4f1cf24af03d3ba9fc49d0795c880258
3379326016a5e4dd417e436bc72f858cba8b3e75
7328 F20101210_AAAMAX kolendaroberts_h_Page_085thm.jpg
287e006eea8cbd04190e07831214a139
7ee832aac9911a5d0f3b16cfab47ff8868a90238
34830 F20101210_AAAMZH kolendaroberts_h_Page_083.QC.jpg
a805b117a12214a452b301764b776bd8
cb622a60cecb24f3df7f8d1a456d2c0c2e4d5738
112396 F20101210_AAALVR kolendaroberts_h_Page_008.jpg
a260e96b449de48db1dfc5a703e56ac3
91f4c53c9f1ae41601371b4afdb9f639469ba794
702 F20101210_AAAMYT kolendaroberts_h_Page_002thm.jpg
bf311e49c7734a0de26877ed7ba7b8ca
c76e3df218078fcd4e7604b49575cf24b0f9c318
67307 F20101210_AAAMCA kolendaroberts_h_Page_116.pro
79d217d5a93b903e43ce4fc9aa519598
f500d6f92ab02237da72ca981406af944bde6485
27804 F20101210_AAAMBM kolendaroberts_h_Page_032.QC.jpg
e76ab55eb7360ecc1618eedba939f4d6
e55009160ace5c6451cc9548f8f66e6337ec8e0a
11964 F20101210_AAALWG kolendaroberts_h_Page_091.pro
190a04cde60e029e044462b27b18bfc7
4769df3552f5588edf3d8e7646e22ac5f4b94b24
4216 F20101210_AAAMZI kolendaroberts_h_Page_124.QC.jpg
4b8a61bfc4b8051ccf2083793613f577
1a5e1dc774e56942d3b1e097a0cd30398075b1be
930 F20101210_AAALVS kolendaroberts_h_Page_041.txt
940c01625637b2cc9d2e41239a1cd250
800dc7ad980223284ba0199d6cc477c8d2f260d7
7092 F20101210_AAAMYU kolendaroberts_h_Page_022thm.jpg
7461635472992fe949a30dc937af84d3
76107b7aac975b319ee337563d6de87bf49d2727
37407 F20101210_AAAMCB kolendaroberts_h_Page_013.pro
b8a9bf8775a601382b5fcedb9b8e8a13
1c44112ea35f0070abad0d32666bdc5d0d1cfd5e
39410 F20101210_AAAMBN kolendaroberts_h_Page_090.pro
b0048d8f691dfaa99ae0117cdb0686c4
c15b47751639b08566ed64225ee1e75c0003c3a4
1051982 F20101210_AAALWH kolendaroberts_h_Page_085.jp2
f9598d96afabc1a590f4613f388b0df6
02888870af91b519931914724bc93e78e613fea9
28993 F20101210_AAAMAY kolendaroberts_h_Page_072.pro
fde37c108eb2bdd77cf00f9dc7cd275c
dcfeb1a8a42ac3ae0143817f1b545c98f070d979
7577 F20101210_AAAMZJ kolendaroberts_h_Page_062thm.jpg
a5f8cf43a67f8b20c5163ddfda806164
88da7a9df6f3f6d471e97cd95f484b2145aca8f0
33671 F20101210_AAAMYV kolendaroberts_h_Page_018.QC.jpg
f98752e04fa8bb27cf34ece33beb6ba1
811f18cdd335add539daa73a96212c9bbe37ac67
54465 F20101210_AAAMCC kolendaroberts_h_Page_114.pro
f137136d1ba0aa7f36fd5f39f01ee272
dffe7e6b9a0349fdc54a2d0ed7fb559b977a6a95
7653 F20101210_AAAMBO kolendaroberts_h_Page_009thm.jpg
a81dc83177a342fd201857c5f04aa378
43d948b232bf6bd7cfc3b9ed4db105a919b114f6
1051794 F20101210_AAALWI kolendaroberts_h_Page_088.jp2
c43b7246d76712bbed4aff53318d7525
c163dd9c86e3da95b3a73a2d2f7b8a13ee3638c5
64841 F20101210_AAAMAZ kolendaroberts_h_Page_077.jpg
5bd86ee5279760e97b86946bae5e9604
9ab02eda8bff17067054b7c3d8a94385741a0ea1
7360 F20101210_AAAMZK kolendaroberts_h_Page_101thm.jpg
51129c530ba6f42c081a593ffe2a2f9a
456ca04c658c4fe3e8253e0e766de4a41b6f38aa
54368 F20101210_AAALVT kolendaroberts_h_Page_009.pro
a9092f9f6c742a8ebad9b1b311c1feb4
ac296d854bf79efcd7f140a5f49ccf32920ed254
25610 F20101210_AAAMYW kolendaroberts_h_Page_073.QC.jpg
4874f608495de6a3f44bdd4715203586
6c2aa68f5c9a1f5fc8c3348fc156fe77cd7f277a
34987 F20101210_AAAMCD kolendaroberts_h_Page_115.QC.jpg
44aa218735092a6ee94ded99c4c90769
47ce223ff5f0a407c5ed5effaa9eedb27ec748a6
F20101210_AAAMBP kolendaroberts_h_Page_014.tif
f9e23304dca0552bc36d4070bf21e7cd
b709db377d33a6827a30268834970450cc57fc8c
101068 F20101210_AAALWJ kolendaroberts_h_Page_065.jpg
08f2496efd6efbe623be2b02b17a0543
abb8424950ec815c58999b538082791e0c623f24
4726 F20101210_AAAMZL kolendaroberts_h_Page_052thm.jpg
1474943e9419c9934dd537f59be62e76
c3ff678a73a0e95a6cc4a260068f266e22999b67
F20101210_AAALVU kolendaroberts_h_Page_068.tif
123cf86fd735ef71b124aa346dad2158
8bf760eb95c3beaa368f095dea559e858363b4f4
23917 F20101210_AAAMYX kolendaroberts_h_Page_070.QC.jpg
f7cf18602111efb8a355433da2c17e1c
e928941d2231e92b325a30d9cea5ef62c80d816d
F20101210_AAAMCE kolendaroberts_h_Page_033.tif
8b44169297cdeee021688a5f2c4dba54
7d8be9d56788f8d801cb18d01678ee33b1c25d80
51360 F20101210_AAAMBQ kolendaroberts_h_Page_052.jp2
1fe4d9a7dbfaa1e3a1a25844f8717ea7
a5ee90a94c549ffefba99b8a8708d7444117d132
124276 F20101210_AAALWK kolendaroberts_h_Page_115.jpg
a87bbf07ce8bf23e4bfeba77cb73bcec
0dee1196ca36b9b01bc67a7ddff97d3528b98867
31492 F20101210_AAAMZM kolendaroberts_h_Page_027.QC.jpg
776073b25c69f8e14cbbaa5345b5e3ce
acba3dffb0eef873e738a4daddb685a6dae36e07
33169 F20101210_AAALVV kolendaroberts_h_Page_111.QC.jpg
bb1a2bce1e50ffcf287f6e1bda0987ab
d4d10d11b56357e6d5f6018ccaff6e367528adc7
37154 F20101210_AAAMYY kolendaroberts_h_Page_122.QC.jpg
dd5b516d359d6ec194b8f8d55c78dd50
3adcf8f340f124be0edbaa333c95899635c4396e
125935 F20101210_AAAMCF kolendaroberts_h_Page_118.jp2
2394587693edcfebe14b83bd482bd7b0
4d801ece6350c3c8dc9cfc5c77aa76e4778b3766
22292 F20101210_AAAMBR kolendaroberts_h_Page_098.QC.jpg
1438b55eb263a3e91fe9d69252d79db4
f8ae3cc9ac77541105835cd64b516bff5930bf50
F20101210_AAALWL kolendaroberts_h_Page_046.tif
c0fb56652f384383255cc09368ccf830
7814088d15f947524ce93bc17171f6056e3ba5bb
23162 F20101210_AAAMZN kolendaroberts_h_Page_093.QC.jpg
3c975f86baf5be5e1a3f2b23546b5d62
d1f1d634fbd5e865655c1602dffba41ddc59e5b0
8119 F20101210_AAALVW kolendaroberts_h_Page_117thm.jpg
82ac4a17421fe557d8e0f3b8e5a0498d
7522320e2b40e08c3eb2866ab999f84e94044f9a
7273 F20101210_AAAMYZ kolendaroberts_h_Page_072thm.jpg
0af9c17c523c18ef13515bb2ac36f02c
7c752110bf12d788b65f307fc803077ff35f1e7c
859 F20101210_AAAMCG kolendaroberts_h_Page_006.txt
d2b52d48876f9e37a1ad130b66e29ec6
a795502b17dfa20a90a097b9528cc0168bbc79c4
24442 F20101210_AAALXA kolendaroberts_h_Page_066.pro
2e3a31fa05c517f695fe490db1ae0b7d
5d93385122b20e2eca2d754075df866823c47ef3
4730 F20101210_AAAMBS kolendaroberts_h_Page_050thm.jpg
f29d10f635ed39167cfce5855b88b18c
4ac3b31a65ebf735ee8f24af3937bf61418a094c
20554 F20101210_AAALWM kolendaroberts_h_Page_036.pro
b410075f265a0c27fe7cf30dfed9b1b2
c5bea85e44ed82bc1fe5322016aec057e38cd6ad
7500 F20101210_AAAMZO kolendaroberts_h_Page_053thm.jpg
a818e37c3cfe3833dc1782d018da29b4
d6e9920aea6e7dd256bbd68eb5ef2e9e24692d7a
34382 F20101210_AAALVX kolendaroberts_h_Page_024.QC.jpg
518c1326b2477cb449c264b2dc69a875
8c98953fe315b858b2f02b706fd1e56d7ebe32df
9740 F20101210_AAAMCH kolendaroberts_h_Page_098.pro
5059890d4a57dfe2dac8b58b29932bba
e7381c667534d2d40bd3dc194578acd85d14b6da
34170 F20101210_AAALXB kolendaroberts_h_Page_034.QC.jpg
426eb217d6e02e7111854f2fe223c8a1
f4a5f08455b76a2526669f10e9ee5e1b6c72576e
29305 F20101210_AAAMBT kolendaroberts_h_Page_086.QC.jpg
7ceae57f3d9425a986103f1435fe3f01
d96c36c62a31c5542364a005234c02bbf62d3cc0
16040 F20101210_AAALWN kolendaroberts_h_Page_052.QC.jpg
d6c15a4c0c74fe8df80310325df78858
226b64d5d112f9aa47c474d97a899b3878c54a3e
32059 F20101210_AAAMZP kolendaroberts_h_Page_023.QC.jpg
8448f51951f677e5eee695e3887dbf35
b4022af3d4506545867c7848087972d7bc94ac07
65865 F20101210_AAALVY kolendaroberts_h_Page_120.pro
205f987ad69c9a90974ebc1b214bb22f
3b5bd1bd268725b6bbdedc8187fb9957f7a8a50d
22251 F20101210_AAAMCI kolendaroberts_h_Page_039.pro
5aad6072bb465b35f9210b748d57b4a2
1681e5fc8fd9fc354678a38f8e1fce36c0bdaa02
85927 F20101210_AAALXC kolendaroberts_h_Page_032.jpg
f54d3de57faddb87d8fc21a5730a1b47
2cbb8d65fbb432913d630ed42c314b530048826d
F20101210_AAAMBU kolendaroberts_h_Page_089.tif
29fbaebdfa8ff3239da0f1a0d8c99f76
e718d1d0add09301f8c78451a6a4571231de8200
8082 F20101210_AAALWO kolendaroberts_h_Page_065thm.jpg
4b2e714b1982a0acf96642739bc05e73
ca447e92f705a2dd64d3b0b514738acacc296110
22409 F20101210_AAAMZQ kolendaroberts_h_Page_043.QC.jpg
54583f53c428ccb7b79a71e3af1dfed0
ef806c54a113885d13f7d01ef3bef038faf46411
8503 F20101210_AAALVZ kolendaroberts_h_Page_118thm.jpg
48f39907345f0d817b1d506687f54042
7e8c1f629ea384552a6962bcc27669dbd1801663
34383 F20101210_AAAMCJ kolendaroberts_h_Page_118.QC.jpg
76fae0f7bd4d4a285b240d15a942c9d7
3624e0ed4859edbee9200627bd2bab4068d35461
F20101210_AAALXD kolendaroberts_h_Page_106.tif
4142c626ed400af827e11c1245eb718a
4c8c9ec13fd3da2d0711d9846ff57f2282664163
8392 F20101210_AAAMBV kolendaroberts_h_Page_105thm.jpg
ab587ef3832850a9a8f27a75a0765082
0e116faf9f209ef628612a85be0505975c32aff5
1772 F20101210_AAAMCK kolendaroberts_h_Page_035.txt
e2754b4a19a58e2b10fb5280ef60e2b5
13047b1b926cece069744d2c4c544a8231bb1a31
20503 F20101210_AAALXE kolendaroberts_h_Page_077.QC.jpg
c2aa94df1c5b85ac993e782a8bf96170
747cfaef032b2dc8058bec51113f90f6f6019089
F20101210_AAAMBW kolendaroberts_h_Page_047.tif
2d6ff0f9d2aecd0e2eed081a0233c7f3
c015067362e14bc99c04bc811e393b93c179a7bb
8355 F20101210_AAALWP kolendaroberts_h_Page_030thm.jpg
3946fca3230717dbc86fb50d69e2862b
ae897ccfd6aad5e03a2dc364d3485d6093aeb977
9110 F20101210_AAAMZR kolendaroberts_h_Page_006.QC.jpg
5549123b238d08f30a68b064ff6844ca
b0cbb1c9595fe46b7e5ab7c7d1f1cf35d7cb327b
F20101210_AAAMCL kolendaroberts_h_Page_020.pro
55edb439ed0329b4ef52a821b89f2854
009a1be02b7003bc3bb208f2da9ea5902549515f
F20101210_AAALXF kolendaroberts_h_Page_110.tif
e07e664e3ba139c11e337993d80cdc86
b39a31231056dd2e2642c7af3f131602da06ff7f
25805 F20101210_AAAMBX kolendaroberts_h_Page_090.QC.jpg
22b48c160ebda65fa9623e2adeba67f7
980799aad89926522a527ff63d8b980c484bf5f2
21377 F20101210_AAALWQ kolendaroberts_h_Page_089.QC.jpg
e163bc48ff96a061f4da2aaafbfb984f
76b4c0a7774cab56bdb136cd8c243f489f9fa967
27541 F20101210_AAAMZS kolendaroberts_h_Page_015.QC.jpg
21f104779691ab4cdc675805ebf2ec3b
bc71a7c4dbf3c65cfea51824444a835e185efee5
95424 F20101210_AAAMCM kolendaroberts_h_Page_101.jpg
e1b495a33c4c1c99deca856c4b08af82
ba268ba90ab8cad2d7fa1d27ab1919cbc65865d3
1907 F20101210_AAALXG kolendaroberts_h_Page_027.txt
cddda5d42aa10136794345757dc0418d
b3e054d3ecf2482fb2af3ed855d33d695aaa3bf6
490 F20101210_AAAMBY kolendaroberts_h_Page_087.txt
c7ffd20c6d06fe210c5e7b651559a728
e2d44f69e6ec1ddddf929ef1357c3ceef956d7bd
29660 F20101210_AAALWR kolendaroberts_h_Page_043.pro
7db0fbdf49ba7c78f897da9d6a4ebe71
a0445c1a2c4ca6ded23bafb2451f19e4f9c8c443
5095 F20101210_AAAMZT kolendaroberts_h_Page_004thm.jpg
7ee57f213ac83fd63c0386095abea1a9
bc02506307b38bf2e54563f8c1c216737765689c
101774 F20101210_AAAMDA kolendaroberts_h_Page_110.jp2
1b1f3ded00b67c6aa29fc0f2d003eccd
fdca3e7bcf867eb0bfa5d190f5db5e99a4652624
101946 F20101210_AAAMCN kolendaroberts_h_Page_099.jpg
8d24518970d36d3b240e7e2e1a357443
876a7c6964aa3cc2cfa35684304c728cb385013f
1979 F20101210_AAALXH kolendaroberts_h_Page_105.txt
131d658408c0e661a061277b57e46638
2bbbae9c648c3dec8e84566c1fd8c0539d049682
93519 F20101210_AAALWS kolendaroberts_h_Page_042.jpg
5ba6010c6dd89a6974ecf24d6b414bfc
92c1b684a96c86ee9f1b5b1119e54391bd091044
28583 F20101210_AAAMZU kolendaroberts_h_Page_022.QC.jpg
0c580df766c4bdc80f13c9d2c57e040d
f0b706377de60b6ede07f9d4c5c09b247b3e5980
15960 F20101210_AAAMDB kolendaroberts_h_Page_056.QC.jpg
c98d080d6c0286b4f57594fcbeb2cad3
56d6d15778c6e011d8eb502801e04abd8cdaf762
7454 F20101210_AAAMZV kolendaroberts_h_Page_074thm.jpg
8b1b308828f9bf5e86368c13beb814da
dee075a90e62ef7eab620ede5d334109411f3ba6
F20101210_AAAMCO kolendaroberts_h_Page_009.tif
52890c8c7ffebe38eb72453a88a702e3
9b7b4346992ab303e30a7a8be5223a0019143b94
49565 F20101210_AAALXI kolendaroberts_h_Page_065.pro
58bb24f314a655ff50999b6337ec0c2b
f4b4d7460267cabc0be6d71841fb7195864cc95f
8101 F20101210_AAAMBZ kolendaroberts_h_Page_108thm.jpg
29de301977ee66ad8db64adb825f623f
fc45b44e430d3ca6dbd2541459d1a22641b5310d
819 F20101210_AAALWT kolendaroberts_h_Page_040.txt
ac221733c3a403adb8e14cc2cdb2ffa2
58e0d7b6fd0a56cc936d5cd2bbd1a88ab79352b6
29853 F20101210_AAAMDC kolendaroberts_h_Page_063.QC.jpg
9f9f2a4536853d74c9dbbee2e3acaa33
9b08b3b72bffc8023a58d704c20a7ac32095e72a
33240 F20101210_AAAMZW kolendaroberts_h_Page_105.QC.jpg
da76e45859ae55b29b1c2cbd2e0dca8e
89e8f012ae2d09707339d1b0596c7e74f8d79221
109988 F20101210_AAAMCP kolendaroberts_h_Page_025.jp2
8248221fe7b092df9ab5defcf8d2ad36
d2e4b820e0222d22072b4bdb97fdc2860d903411
1847 F20101210_AAALXJ kolendaroberts_h_Page_042.txt
e8a0256722bb57d80615376b0a916710
03422783ac280c24edd9e4e12188db9b7fc55828
7728 F20101210_AAALWU kolendaroberts_h_Page_114thm.jpg
8b58079dd8c89d1a1173bd0f15114b4e
05ea31e6251f7e84724bf6a2446161129adc192b
8384 F20101210_AAAMDD kolendaroberts_h_Page_082thm.jpg
846e388149052ef924bcaa45ea11a63f
fe2291a7633e4ac01f07d72b7db91b89bc71009c
1014 F20101210_AAAMZX kolendaroberts_h_Page_124thm.jpg
c20b01417d164aa96efcee91c6193b71
fab168ee27fb3b5f3b34b75c5eb1e2e4a0f20b9c
6619 F20101210_AAAMCQ kolendaroberts_h_Page_008thm.jpg
c4253ac9cdcd9ae247c77a0e10f8219c
5c5fa748b34f8a37568d25b15d2bd4da31376d5f
33589 F20101210_AAALXK kolendaroberts_h_Page_026.QC.jpg
ab1f5137f5a07797536bb35a68016f39
eec69916aad7e428c0eb6c2622f6bae13d55ff65
27679 F20101210_AAALWV kolendaroberts_h_Page_001.jp2
64e8c17f56c23cb808d5dd599b8de4c8
7543e648c2c95ad977596f54307073851eb632c7
92496 F20101210_AAAMDE kolendaroberts_h_Page_022.jp2
2f3f54c471ee166702e2862d140ef08d
2976c34449bb47ee8f5930cf50f9bb7057b423c9
31312 F20101210_AAAMZY kolendaroberts_h_Page_114.QC.jpg
64ad8d1c14c132bf004083632b259ad2
9f8601bca0ea95fe0e214eccb3520cdbf7679181
31354 F20101210_AAALXL kolendaroberts_h_Page_110.QC.jpg
ffca298a77044fbaa975f6699ea805dd
4439bf40a99534de2608ebe20336351ef983733e
87985 F20101210_AAALWW kolendaroberts_h_Page_096.jpg
d8c6d1e59ddcefb26f56e0fbad0d5014
b9f6473a91a8d9ece4483489b3744ae0688647ad
103104 F20101210_AAAMDF kolendaroberts_h_Page_018.jpg
4b3423be9d065d1788c11cf0b761ca20
05d2d4e2a96766571fe0514baa9a0703b25ea673
12571 F20101210_AAAMCR kolendaroberts_h_Page_021.QC.jpg
00858bd83c09429dd7e366d2b9517e00
fc995351d8e466b5762a8658a3190090cf5b9ac0
7066 F20101210_AAAMZZ kolendaroberts_h_Page_086thm.jpg
c7508de1f82207700ef104f188fe34e1
ef2c22639727d19b20ad2cad45a7e293c1bb7073
65298 F20101210_AAALXM kolendaroberts_h_Page_078.jp2
13cb4acaaa9c7e61b82c787ea080e8ed
56c7ddd0c02516f30252ee42db8da483b811c550
1958 F20101210_AAALWX kolendaroberts_h_Page_020.txt
de9a7374f6273a5a3bc521669f55d20d
af69c74b4e9ca8423efedeb058ae3db2b03b2644
51237 F20101210_AAAMDG kolendaroberts_h_Page_107.pro
1769c03764f6d295ee55bbe348ff19c5
41dfeeab172d480746feff3dab120f4c9775cc15
F20101210_AAALYA kolendaroberts_h_Page_069.tif
00c4133dda3a9ad743339cb3c1577d46
c10b3fc41475fdb3fb0a0b27c57a7eb06cfea9d4
1702 F20101210_AAAMCS kolendaroberts_h_Page_015.txt
8f524433327c270a653875cc581ac598
7438dcc5f732ecf5ce430e051ff5621814a7a5a5
101015 F20101210_AAALXN kolendaroberts_h_Page_101.jp2
955f626636034923e9cfc095db057234
8b858d7ecd2dc69e714818f90896c233728831cd
8292 F20101210_AAALWY kolendaroberts_h_Page_104thm.jpg
494df912e49659a653aec5b6d1f6d506
cf12cc91d6c726087f509c0da359b63acb76eb42
F20101210_AAAMDH kolendaroberts_h_Page_005.tif
83d1bc8a098b0f1d1aff9571874880d5
c62eaeea6f8ab9f3dec1ec54406330251f9e7e66
5098 F20101210_AAALYB kolendaroberts_h_Page_113.QC.jpg
ae3a8c0d28d760e2b511aaeb1a3bc174
13c7255576f2773f8dccc048d22313f91e3d0e32
40999 F20101210_AAAMCT kolendaroberts_h_Page_040.jpg
80cb00c21c27474157a921d9226f2ea4
0d0c3faac53dfaa1ba3d828e8f8683d32b434548
4127 F20101210_AAALXO kolendaroberts_h_Page_054thm.jpg
defca065a61329bb1c5a6e13404004e9
6977e2cbe687a36d695f2c6edcfb86bfaf0e73c7
113542 F20101210_AAALWZ kolendaroberts_h_Page_114.jpg
4df9888732461fa01687f8208336d0b8
780f0e9260659212522a5dc72ebb352bd399c6b3
8306 F20101210_AAAMDI kolendaroberts_h_Page_018thm.jpg
be4d6d2a9f092a03a632e33409b5ca89
f388e095d0547402eacf7399194453a3ef22524d
42532 F20101210_AAALYC kolendaroberts_h_Page_010.QC.jpg
ea91190dafb8d08f330039aec7edb29f
dcd0694e3b8b468de4caddd880440cd3972c867e
132472 F20101210_AAAMCU kolendaroberts_h_Page_122.jp2
30d2aab2ca815cb808ae7f9123b694f4
4c93628be9ff85676f7d9e3d33df242532a6e4b4
12961 F20101210_AAALXP kolendaroberts_h_Page_124.jpg
3281780f27a14051e80bef6926761108
f533b2ab03381e21e327706973fa464ebbdfdd77
3039 F20101210_AAAMDJ kolendaroberts_h_Page_040thm.jpg
ff414390153a7138cbb734b4db2f2f0c
03c732e90ce09d2d9b2527a29a97bc35b80f9bd8
F20101210_AAALYD kolendaroberts_h_Page_090.tif
fe5c649fe0d120b374f394501223411c
b71ada09504aa1e9f9f3b24ddd6b30742072a266
26419 F20101210_AAAMCV kolendaroberts_h_Page_099.QC.jpg
0355a7e6b778c18adbe64a9ac83e8f9b
3a52c327b6cfc5af3ebecce7933164905c478d65
131199 F20101210_AAAMDK kolendaroberts_h_Page_122.jpg
9d2f509d719866cb4dff36178a74b1c5
4b08d97be730faf725b88878901bdc2684c1dc4a
20140 F20101210_AAALYE kolendaroberts_h_Page_060.QC.jpg
5ea590ea42ee293104c2f9f5c8dfd5e5
630f19561eee3e1d2044cd353ab1b3a0578360f5
F20101210_AAAMCW kolendaroberts_h_Page_018.tif
2bceb5eb67af420666310baca91adecd
d3b11171834b2441ff02cf1a78796ecd0a9b8889
110427 F20101210_AAALXQ kolendaroberts_h_Page_046.jp2
2bad5b1f9e7fcdc7bc36e1066f9a643f
b159890e3e124113582ffa4fa70aec01902e03d7
F20101210_AAAMDL kolendaroberts_h_Page_017.tif
2e833b118271bd8e4c08832600dd5fbd
eb0c7289893e070c3197bf8c817890694c7038e9
55900 F20101210_AAALYF kolendaroberts_h_Page_049.jpg
15120dc300f035386e8ca8c469492108
d4e8ffe212bc15ae08a3e10e10529e734cbb17ee
31487 F20101210_AAAMCX kolendaroberts_h_Page_101.QC.jpg
f4db6306f479331ed7f8478cdc4077a8
7e856a2e6e54a7e1c17105f0abcd02f7421bfb72
1956 F20101210_AAALXR kolendaroberts_h_Page_034.txt
f9c19ae37030af0094c121772573bc04
95c8ece7da39239f6a8b6c75d781bdc94c912029
30341 F20101210_AAAMEA kolendaroberts_h_Page_001.jpg
4e159d5a16e92e52846937e035b6f221
2584125f3a32fc80d1afd41144e1343b591d0e18
27608 F20101210_AAAMDM kolendaroberts_h_Page_012.jpg
bb34dad4864c475c64bf991f63a05af7
300645a9096948f7ed961cd0f385c75dad7f09a1
659 F20101210_AAALYG kolendaroberts_h_Page_021.txt
0fa14846651f77cffed80817f5f8ac23
f95d3a8e72303df0fcbd928e8ef4dccc7be6e3b4
50578 F20101210_AAAMCY kolendaroberts_h_Page_056.jp2
c6c22d37cd4ec4c07650f166acb6e48a
9d1247115063b4fb7cd50d63e935e62ed2a354e8
32570 F20101210_AAALXS kolendaroberts_h_Page_092.QC.jpg
a6ee3f7facbbecf51e63133542415652
e8252d8f9382e4fa1bb8387ed03d8c9f2cce61e1
5382 F20101210_AAAMEB kolendaroberts_h_Page_089thm.jpg
728defa031e9e95bb7f20bfea7bc50f1
ae78b11e02127c9ea4c1783f63a8e3c2d8b2ed9d
F20101210_AAAMDN kolendaroberts_h_Page_053.tif
e865f6399f460851a929334fc9be5e68
29fc6cf90b723e97687bd8147362e3d28fc5a1fa
69206 F20101210_AAALYH kolendaroberts_h_Page_093.jpg
208fa150b1342a67de32dd326e3e9dad
5391589a23bc17ad82cb3de9d42bffa47ad02c3f
28829 F20101210_AAAMCZ kolendaroberts_h_Page_033.QC.jpg
5aa8354eab02bca1bdc9470fcd10a881
05361250a89b3e97882736484ab553463e47af85
34307 F20101210_AAALXT kolendaroberts_h_Page_082.QC.jpg
5bd0037e9fe7eae66394c19a5e348627
cb9bdae14819fe77a9af5aa8f38a21ca8c921de5
22248 F20101210_AAAMEC kolendaroberts_h_Page_060.pro
d6ab690df81658ef4becab0a993b8b85
8f7b1bb9d874b9de10e39aad0eca2bd13ea379e7
31208 F20101210_AAAMDO kolendaroberts_h_Page_079.QC.jpg
34e1b0208adeb0aafe351ee6ac147236
fbc2037216ee69a0648afea797278fce5363d4b9
7554 F20101210_AAALYI kolendaroberts_h_Page_096thm.jpg
761f236d4aacbe31c454712c75f3474b
0e51355f6ec53f92654de8f2a08869404453bf58
29612 F20101210_AAALXU kolendaroberts_h_Page_087.QC.jpg
ee883be36edf7ca50179f6fc95660aa8
2db0db3c5c4468aa78f6687dfb08b0e2f8eba555
25858 F20101210_AAAMED kolendaroberts_h_Page_049.pro
49d701a1a68ed7e186d47a2f2f93ce71
ce33edd977bb04447696e5bcb15ad107acdc837d
6052 F20101210_AAAMDP kolendaroberts_h_Page_077thm.jpg
368b0788eede396a61e2898254415fad
0f7450d65eb8364ba65b764c4c56450edaa6088e
F20101210_AAALYJ kolendaroberts_h_Page_035.tif
a9fe5f52b7359425719a11b4271997f5
0c017939cda578c48004d2a405bc52428d4c3a6f
877302 F20101210_AAALXV kolendaroberts_h_Page_038.jp2
fdb2c8a137fb909f9a0acd93b7cab2b0
ed6467d822f4823324d900a7e0f39bca40a05294
F20101210_AAAMEE kolendaroberts_h_Page_012.tif
c5e9c62dcc2f2a9fc30cffaf58678638
1d78304c3649e3e77179c8adc36d2868f959ed59
F20101210_AAAMDQ kolendaroberts_h_Page_112.tif
95567356b8289f38c9a45d356299e953
d41560f35b3aaaaf5a4174755489a0633ca5ea28
98280 F20101210_AAALYK kolendaroberts_h_Page_027.jpg
26b02decc20944ee1b5dc75c07e898b5
0d1c6cfd10b0fc629aa1fee79add63f2b4a3e2e1
31377 F20101210_AAALXW kolendaroberts_h_Page_028.QC.jpg
27801eccc74c22ae223c9292bcb05ec7
9ee7e1cf83d551f709233da1717108d1f43f355c
32583 F20101210_AAAMEF kolendaroberts_h_Page_009.QC.jpg
9071ee496dd2a0de139b0af409217d9a
fdda04deea4501a6be753b1ab93c198f441ae3f4
844826 F20101210_AAAMDR kolendaroberts_h_Page_096.jp2
a7b117475903bcecb6d6d8807c304176
b446f99134f9b5aea8ea8e851c7f876ab676c9c0
978 F20101210_AAALYL kolendaroberts_h_Page_066.txt
2069e186b082369be65114e0cd1dde18
24632dcdfde78e948cdaaad8b96bd4d7e73e076d
97094 F20101210_AAALXX kolendaroberts_h_Page_033.jp2
b3d3a23f98bfd7fa22fe2151a915be23
5ba70f9214ac0d35df187d80c59178130a1c7220
35077 F20101210_AAAMEG kolendaroberts_h_Page_119.QC.jpg
aabba524fc715294b043ddce321ca599
5a10f67b088efb38d517d482dd158ad773e3db4c
3669 F20101210_AAALZA kolendaroberts_h_Page_086.txt
8cb1bdad29029342747de330a213621d
ca556b75399147e842fb30e9e5a137a45de04914
6067 F20101210_AAAMDS kolendaroberts_h_Page_100thm.jpg
5ddd8321b245e617198496c94c14c6fd
e7242fdb56b3412405c6f264e1142dbf4e76b0ac
5164 F20101210_AAALYM kolendaroberts_h_Page_098thm.jpg
99393aa97c83f66b2381d57c0b9107f0
b124c97babfddeb939433acd93b2aea4b9850a55
77140 F20101210_AAALXY kolendaroberts_h_Page_091.jpg
ea0e83ee96030f537974107af6b9c877
47cca6395130dde732f9ea9bafacc9c21a510c34
1815 F20101210_AAAMEH kolendaroberts_h_Page_044.txt
a81c610d5fbf83914fd275dd7706cdf7
82c8f62364b7ee108b1216cf3c59500299cd3e95
69131 F20101210_AAALZB kolendaroberts_h_Page_077.jp2
034b4919f4068aed1a9ad12f530e08ee
3f2d20428f364b21ef43ba150a678116fe45e5e0
29476 F20101210_AAAMDT kolendaroberts_h_Page_007.QC.jpg
6a6f1c9cd3190f424cf996f0e2c6ea87
897cff4d8bc70d72652c961865a5717015618bff
56083 F20101210_AAALYN kolendaroberts_h_Page_050.jpg
5a31afeae9ea1da7d10966d6a46de066
fd6e76ab1b5ea21d7c7a335f0ffe38c42e874212
106914 F20101210_AAALXZ kolendaroberts_h_Page_109.jp2
be5bb40064f7a914def455b5409ee3a7
e9697b5d8763b6da5cd2d40fe8472dc50d773c91
100771 F20101210_AAAMEI kolendaroberts_h_Page_062.jp2
7939b3c9d289d345428f16555d23e87b
249f3b0cf5070e051149fd08af60242bbaf31bee
62799 F20101210_AAALZC kolendaroberts_h_Page_119.pro
b72d61d16158ff10c42913694d4071d0
aeca06807cf5441f2d36811c4d61c8131841c821
50908 F20101210_AAAMDU kolendaroberts_h_Page_111.pro
348784578e3f5bdc43fd6b349934790a
7d0faf8b6da2d5303f1f09adcb17af80016ca04d
42143 F20101210_AAALYO kolendaroberts_h_Page_081.pro
58906178607ef65f4e6a3ce22ebaa701
94c45873194d89af2a86349f739ead8de51eef2e
1394 F20101210_AAAMEJ kolendaroberts_h_Page_072.txt
04b3d1523e39dcb0c541f28b122e29dd
b38b5bb7caae6b78ecaa1ac97d5beb4f4bd350bc
8405 F20101210_AAALZD kolendaroberts_h_Page_046thm.jpg
69860a9fbcf1051143d45b6f26003185
33b2391748afe3a5f65c370c7a5bd1d4ce65cbf9
105346 F20101210_AAAMDV kolendaroberts_h_Page_017.jpg
540d4ae5392076237ab14414fb6ae7c4
374c6cf8a24ebdd01875d57357bc455e7eb8c688
F20101210_AAALYP kolendaroberts_h_Page_052.tif
4755696e2280c48b560118f1f6840e5d
e72c7adf1dbbc8a80309872f9607f0c99e64e72d
1005012 F20101210_AAAMEK kolendaroberts_h_Page_037.jp2
9887d61ee90d77c5a6f9b241d53a2279
55e532cc3bd3c576d66a4931f405614c221d0346
F20101210_AAALZE kolendaroberts_h_Page_083.txt
74ce2d410c9189f3375cbb6a2034f8dd
f402b4110696a7fd7c4e92c089a0068f340baf5f
1051913 F20101210_AAAMDW kolendaroberts_h_Page_091.jp2
f17d6835d59f2a4fb14ae2226895d691
54cbfd0898eac43fff50ecbfdd4524e7f1822d9d
F20101210_AAALYQ kolendaroberts_h_Page_019.tif
2d8746a1e4ea7d8c4011fed432642aa2
acf89c14aaa351e2b9835b427b5eea9b61d8e2ba
919469 F20101210_AAAMEL kolendaroberts_h_Page_069.jp2
75604decbeff1f2415d1ec823e06a4bc
8007bd12660ef5f62abf1a16cb3cb2f696518cbe
103744 F20101210_AAALZF kolendaroberts_h_Page_107.jpg
5724bc2b6fb3277a5e9b08b9d4180171
935fbe194d4743c18844b13526352f4f2727428c
18220 F20101210_AAAMDX kolendaroberts_h_Page_049.QC.jpg
2f2139f5898afa0b2483ef0e484e370d
3c3ebf41bfc368bdff5ef926244d88823e24eec5
1994 F20101210_AAAMEM kolendaroberts_h_Page_030.txt
2dacd4547725e72daf20b33164485509
501b25e7ca3faee4d8a62b5809e478099e5a58e8
50410 F20101210_AAALZG kolendaroberts_h_Page_018.pro
d639554f0771215246afecf2c66b1edf
1b953d54deb4beb8fc58997b0905951bd95d702d
5209 F20101210_AAAMDY kolendaroberts_h_Page_036thm.jpg
9a96717ba3b38934c813183660e45887
bae8d3877ed56723fefdc8068b0538a732b8e590
8105 F20101210_AAALYR kolendaroberts_h_Page_016thm.jpg
32df5d75b30b7ee3f0ff8b81a829c114
09cb7e253107f3e063e281565ae4f17468a8f151
14684 F20101210_AAAMFA kolendaroberts_h_Page_041.QC.jpg
3cc783f715cb8abcf991cfd961ae6a73
ea88766cff2f110c3a53d1f536164c45012b3d9c
73940 F20101210_AAAMEN kolendaroberts_h_Page_014.jpg
26c32c942949d26a071c463f3f50b3c6
23d819f8ac80543314e59dbdef1fd30d90907142
F20101210_AAALZH kolendaroberts_h_Page_123.tif
344d34bbaa2fb2e5b2f0ba89cf4739ad
51012d5756f485896f27a5d3e0a99603da312d88
33080 F20101210_AAAMDZ kolendaroberts_h_Page_117.QC.jpg
d53d7953aeb2fda0e0de3b9c3a69c653
d16fcf8f43ff95848306fa74939c307471b85d56
3580 F20101210_AAALYS kolendaroberts_h_Page_041thm.jpg
d104ed38641ec727dbd25e1419d7cfb9
24b47a25fe5750682e5cc2aca1ba0cf625ba914f
81084 F20101210_AAAMFB kolendaroberts_h_Page_010.pro
1af2df9b689415f9fd7b578b7e3f58a3
9ee44fa4753ad4cd8ed4422c1dfbb831f4870f00
7551 F20101210_AAAMEO kolendaroberts_h_Page_081thm.jpg
a0c02b2df5bc37f5d0049269ea04f9da
6c07b9fef8ef161d23082fa60479cd8513f08c70
65403 F20101210_AAALZI kolendaroberts_h_Page_043.jpg
51ce4f232a28937be5ecfd74abfc1f37
3f115aaaa0e630671016e401cc09e6f387e99f9b
41799 F20101210_AAALYT kolendaroberts_h_Page_069.pro
ee7ca98c9244be8a1b90dd6be904ac1d
c8893687fd9e7868e1a850061af0a018786b1172
F20101210_AAAMFC kolendaroberts_h_Page_066.tif
4b253a89172478d6a72cd9ee42f6bc59
91f9bb48d36d1650e597c1c07d667f9477b28ed4
25110 F20101210_AAAMEP kolendaroberts_h_Page_072.QC.jpg
1c60edbc87bd82c4da611321c600147b
e98f8e3ec7dbdc81dc6f317cbe4286c1bf2ab415
7874 F20101210_AAALZJ kolendaroberts_h_Page_027thm.jpg
b4fbe8eb476b877bdbc24938247997fc
607bd1d7459a125c957f2ae3ba1e10573dd38fbe
20186 F20101210_AAALYU kolendaroberts_h_Page_004.QC.jpg
61a01e474614978df83b2b0c00eb8784
a81b25be601c0042662fc299ee23c09f42450a3b
1197 F20101210_AAAMFD kolendaroberts_h_Page_080thm.jpg
80baefa9b657318006bf7aeb2eeea518
0b443b9d542a233ce2d486ecd4a4e6e95d10548a
F20101210_AAAMEQ kolendaroberts_h_Page_002.tif
ceb95dfe3d3c80298c286a432eb6ef01
18ad2c3839a32af0dd91d71d3489f0a58359b7b4
29520 F20101210_AAALZK kolendaroberts_h_Page_103.QC.jpg
c03678b2bfd5bec34f53f39bd77b1782
a433de3dffebebd8587929ef37c00d9e41e45026
77341 F20101210_AAALYV kolendaroberts_h_Page_014.jp2
d7c52356b03bd4b24f15c377233d2ae1
9dabe7ab4d6dc03c0a74e11867ae0fca9acaea04
115135 F20101210_AAAMFE kolendaroberts_h_Page_114.jp2
98b2b40205d89e8d01bafb305d176012
8d2b26fe47fb45606a87e1013233a83cfdbdc238
46809 F20101210_AAAMER kolendaroberts_h_Page_062.pro
a8a0a9aa3e18285645d0182b571917b3
7a99ebaf2b491d2bdc4731efa1a28cf6ed276667
45807 F20101210_AAALZL kolendaroberts_h_Page_028.pro
f92d40fb6ad4a15096413b347b8ab96c
5206d9bc995bb306d0d6fb4de3383266ab09f4f5
103632 F20101210_AAALYW kolendaroberts_h_Page_095.jpg
0c480684853a98a40fa7cfd6dbb0f64b
274ddb5930e57bdf3ba458efa259ea0848e6b319
1051985 F20101210_AAAMFF kolendaroberts_h_Page_010.jp2
d79af320d6c904a2c57da47c801c901d
96a50f472e12d65d2a10dc0e3696d7cc8695d009
20392 F20101210_AAAMES kolendaroberts_h_Page_100.pro
7a9c1f554b009bd62748af7a68017b20
01337c94a6b558ef7ff50fcc7f8f65b6b1c2f8e6
47845 F20101210_AAALZM kolendaroberts_h_Page_045.pro
8eceb92ce6913be86be378018bbbd999
50447188f4ad5472493de00a7d612b82fc9a2096
1710 F20101210_AAALYX kolendaroberts_h_Page_071.txt
95900c106ea445d4c82ca592732462e4
62ee1ff09c2eba4a8fc7bcc4c6398bf255414fe9
30909 F20101210_AAAMFG kolendaroberts_h_Page_073.pro
6779ed6f03d1c486d9e738ef59123824
6c2ff89a981d15176a9f391a08b72ebc16a9fa65
1030 F20101210_AAAMET kolendaroberts_h_Page_097.txt
725410449be2aac8393d2e329cf36c75
e12caa62cb064d664f0d494e3fa2bce9cf28cf4f
106998 F20101210_AAALZN kolendaroberts_h_Page_026.jp2
a84a62eef23dece90628613760df753b
f66ebc691652e519177fca13862b5bd568e26a31
24735 F20101210_AAALYY kolendaroberts_h_Page_075.pro
e2516e545fb2e08f54aa7ac0986bfd60
8e01d6b2de6bf0207c6132f8fcc71670cfc80275
21067 F20101210_AAAMFH kolendaroberts_h_Page_003.QC.jpg
1c93e5c8826b0a11beef7745fb694515
3eee5362eab7cea655869ce0b7f9acf54144abdc
1420 F20101210_AAAMEU kolendaroberts_h_Page_077.txt
5839f94a6427d923695e1a370741e47c
8df33d506e9712d60901d8b9c9fc9131e72c5ceb
F20101210_AAALZO kolendaroberts_h_Page_092.tif
5fa0e08d03176a0b43f2651da628120a
d54c2e7a54fa271b2ccbfc1dbcdc176cb94ed2d8
F20101210_AAALYZ kolendaroberts_h_Page_035.jp2
649555739243f51e21e539db4982bca6
20fa9f7a4dc0911bdd17a6596924f9e20c7aa3f2
28400 F20101210_AAAMFI kolendaroberts_h_Page_074.QC.jpg
21e89af6a819a92fa6b0540cd5450eb3
09b5d1c864fa05cd44346ad16fd1e7590b39f04c
33065 F20101210_AAAMEV kolendaroberts_h_Page_109.QC.jpg
0604cd466ced71d56eaedaecc646b5db
e797681e49d01cd1f23d741db5701a8a20d8e32f
F20101210_AAALZP kolendaroberts_h_Page_077.tif
b6caa6476c27d0dd2e4fe4e80520b1c0
44fbfb160e2c0d545d065007345afb3c58dc12ac
F20101210_AAAMFJ kolendaroberts_h_Page_105.tif
34a7d9cc8c3b282ac040d5f4e17b48af
881b78a1b2f601684d859bb6a30a3cf82b5f9d81
1106 F20101210_AAAMEW kolendaroberts_h_Page_052.txt
64a216e63909d17bc4d23081fbd59200
b65590eeb7e474fa0ed24ee0c243ab695ac8aa87
7474 F20101210_AAALZQ kolendaroberts_h_Page_063thm.jpg
d217ccbc7a60ebc8f0028fbeb506fa43
47ba78802f8a04afba2f71fe0cd570c9052894f4
F20101210_AAAMFK kolendaroberts_h_Page_081.tif
301ba594e399cc893ad67978450873c9
9e85d9beab9e88501e618dd0852e6495eef9942f
102764 F20101210_AAAMEX kolendaroberts_h_Page_105.jpg
3e0b9a80c3c2a4fe815d3eeb09846f2e
5fe614892e08804861100cf93d8e6cfaa8edfa3d
55223 F20101210_AAALZR kolendaroberts_h_Page_036.jpg
bae9edf5eaea3e60bff04f6e02b3ac49
18d68bf54d816fb6521d9a6f2e990c90178d0a93
461986 F20101210_AAAMFL kolendaroberts_h_Page_012.jp2
eeb94e0fc959330a8bcec6f285b42096
ff556ea2156e95e71fda2aff3c58e23bfdc11efd
93231 F20101210_AAAMEY kolendaroberts_h_Page_084.jpg
5b735658a618fcb486e64f2860b6d80c
b4d7ccdabe1117fe60f7145dd6426d8f505d58b4
27638 F20101210_AAAMGA kolendaroberts_h_Page_078.pro
c22abf0b4ee5f48e119a6bdc1eac4f49
d4e70f19d0fd2ec3d8f9d9e68190da80ca77fa68
634019 F20101210_AAAMFM kolendaroberts_h_Page_075.jp2
f0d54c88108a91c8cc229518688287f8
06b7f5997647e36bed346abb2b9d5fec83989a5f
77090 F20101210_AAAMEZ kolendaroberts_h_Page_011.pro
e7165595a6ba3ab7a16be6dbc9a17db3
2b75309eba9e680b41923d5a8af7fd566c6ed0cc
6735 F20101210_AAALZS kolendaroberts_h_Page_070thm.jpg
4e9fea80219af6cd71579f7c73ec6b91
7b990fd3fd49cbb1e21806da2fdc40c874d3336c
30208 F20101210_AAAMGB kolendaroberts_h_Page_061.pro
2e91d8b905060471b7fddd96471f5bde
d05ab84124aaf29cc8c64ee1b120d6310269b38f
6838 F20101210_AAAMFN kolendaroberts_h_Page_061thm.jpg
a238cf3c8d627b04c7570be51c96fbc0
51e24acdc6d22d46b36b70cd0752d6b936d88a84
32509 F20101210_AAALZT kolendaroberts_h_Page_085.QC.jpg
18e82d2549100123c9e561a6ffa2470f
99837b2ae9d30237413798f6ea0eee646de37160
1677 F20101210_AAAMGC kolendaroberts_h_Page_013.txt
cbf383bb5568bc52c8da87ce3c8f1f6f
33406ffb4bcb0fe415eba13dacf52fe85ab15070
F20101210_AAAMFO kolendaroberts_h_Page_079.tif
c38b937de7c20e21c2185bd4d0bcb64c
e9a1e44614580cd0eaafd55c0244857b581970d9
97235 F20101210_AAALZU kolendaroberts_h_Page_044.jp2
d8dbed81b4fa7840cfc58f09ab98056c
4cfd017f8dd668daf63f0dab8240f17f6368c442
4936 F20101210_AAAMGD kolendaroberts_h_Page_067thm.jpg
1227cbdd6c05c4a5e713aeec9805b3fd
af0be7cec0dd807be8ecc309d7bdd5ee0693d149
37996 F20101210_AAAMFP kolendaroberts_h_Page_116.QC.jpg
be9e76ee1fb9fcf6b2f1e508d3ba69f3
5db5ea3716df2b30c7747f3f1b97e9ef826da0ca
40865 F20101210_AAALZV kolendaroberts_h_Page_125.jpg
d53bf8413bd93e5185e45aac16e9b9fe
be153d952ad7a94828de92d1e2d4c3406e849c91
F20101210_AAAMGE kolendaroberts_h_Page_010.tif
05c36e4622ec9a1b80073c0f6fafc6df
90a6cb612a31f82a9eaf7bcd43cb5e2743e6dc50
F20101210_AAAMFQ kolendaroberts_h_Page_057.tif
1f3bfc21ab5e9ecf4f07956df0752d22
af7f911d37e954cedc80262892dda57e7d62cf65
F20101210_AAALZW kolendaroberts_h_Page_027.tif
408eab7cdef424b03a4ccf545f809683
469943fa1bfb5d81ec03bceec1c0cf7082b361e7
54530 F20101210_AAAMGF kolendaroberts_h_Page_066.jpg
bb665053dd23e9a38ed256fa61a7b217
60cc88ca0f13f50068b04f1221f3dda7995a581a
8661 F20101210_AAAMFR kolendaroberts_h_Page_116thm.jpg
5c4cbbfe03a27e9c9990b0ec3c5be921
e344925172be09dcedd878402c930a970eb86d3d
F20101210_AAALZX kolendaroberts_h_Page_080.tif
aa63922bf28cc8cac89cb22cee246d95
5db1987c79cf67c013bb87b24ea03b25a6f61f71
1838 F20101210_AAAMGG kolendaroberts_h_Page_079.txt
2734aa02a3bd6ecdad627a81b2c37fe1
3056ee46f12df76e204e944596a4f11b937b272f
8329 F20101210_AAAMFS kolendaroberts_h_Page_107thm.jpg
e6cb8899694d443b34354cb1aa1e6b52
49acbc1819bbe4be2e36ed6f2b110ffd2ae2d3f9
13112 F20101210_AAALZY kolendaroberts_h_Page_125.QC.jpg
df62b8334d64894d6d24ffdf595fc251
1d32b439cfdf697979fb45c63c049e6b367ae43f
14718 F20101210_AAAMGH kolendaroberts_h_Page_113.jp2
ab886b6c45a8698bb6cbc226d5dc5bb7
dcd23cf7c3e4821058792c1bb9c299612a3d66e5
102576 F20101210_AAAMFT kolendaroberts_h_Page_111.jpg
74f5387d90f34b36005ec17f1f570b2d
f458b389e149503d840be0454b939f7f0d519a26
1580 F20101210_AAALZZ kolendaroberts_h_Page_053.txt
e4e649d7b17757b0f48d8ea44fba84d6
0a2d4cb040b902e5cb98bbb5db964c1ac5236c10
8728 F20101210_AAAMGI kolendaroberts_h_Page_122thm.jpg
98684a7426f3da6bd66896b6f2537e44
b011d5a401fb51fb1b294deffe22a161e2bb3dd2
F20101210_AAAMFU kolendaroberts_h_Page_008.jp2
77ee460211f5bcf6e6e2faba1bd7e6ec
799c0fd08ab97bb49a368bba94da8277b2482a8d
99900 F20101210_AAAMGJ kolendaroberts_h_Page_020.jpg
a8e9397d88ebde9e8ff396cb3e7b3148
9eaf173bde526b76937917751bb674877fc96e2b
36207 F20101210_AAAMFV kolendaroberts_h_Page_019.QC.jpg
e6d21626b7eacb42f88cf8818aa889ea
6b94693adbcad7c59ffd24fde77d2519e679ff8e
40441 F20101210_AAAMGK kolendaroberts_h_Page_015.pro
027ff9aa87cd2e7c8214fd038f49f052
fa75d888aac3c52aa5373064398a4d3fdde1843e
F20101210_AAAMFW kolendaroberts_h_Page_023.tif
d6b594cfd0dbfaec2720e86a6afb7eb1
855f30417059b80147b6fbb18498a1803c1f22ca
78352 F20101210_AAAMGL kolendaroberts_h_Page_070.jpg
57a028173d6c8544c4526e675a325732
f5befc375feda09b565dc084e2c81d2a4cdb8be5
8615 F20101210_AAAMFX kolendaroberts_h_Page_019thm.jpg
2e05d745003493e49af7061a2d9ea8d9
a7c6b5dbee0bc9d818c92763531ba9b81893240d
F20101210_AAAMHA kolendaroberts_h_Page_074.tif
045e2fb1e8e012b53ec8e68adf574fcd
80e8f8919fb1b5bf6c1e101257266cdf42b011bf
1022 F20101210_AAAMGM kolendaroberts_h_Page_039.txt
22dfa19b64fedb690a985f3b2a53689e
3e3a75348af567d0a93dbf73317f472f2737619b
108869 F20101210_AAAMFY kolendaroberts_h_Page_095.jp2
5e2b04051c4ba230ee2fc491bbef88e5
f11ab1f6376f3df0dbaef6ee74621740eb4d8cb2
F20101210_AAAMHB kolendaroberts_h_Page_056.tif
34effa904410b323769fc9d7093a7e9c
4232f4919745d1c5238162372714ac989610f5f1
5639 F20101210_AAAMGN kolendaroberts_h_Page_093thm.jpg
2ca89c886bb540bf7137cc81cb4670cf
d677bca9abdc03809fb24ee5fadaded0b09b4f83
7561 F20101210_AAAMFZ kolendaroberts_h_Page_007thm.jpg
9e49f9c2915c777af1f945dc90970444
675d5416533fdeb3a125d802aa007ed7dc1e73a5
18105 F20101210_AAAMHC kolendaroberts_h_Page_058.QC.jpg
b43df6151809d27e4df03e46dc8042c4
34188e9e55389d9a4a414fb3ff00c720219e0b72
43143 F20101210_AAAMGO kolendaroberts_h_Page_042.pro
5b942322201962fa57b06b9e2a58bac9
83ebf76e81e2cc9f603d45aa32aeb45b643eb4e4
8660 F20101210_AAAMHD kolendaroberts_h_Page_120thm.jpg
52c2648292fcd5585a73f70faa9c6a5a
f473ea226be16a09ea43a7f2521ac677b047c8a3
21911 F20101210_AAAMGP kolendaroberts_h_Page_037.pro
2c92669a37e717a33aec332c582849b3
ed3d11fc6e75dfced080b918b206ea97ebd22d3f
F20101210_AAAMHE kolendaroberts_h_Page_038.tif
5ccbaf819b414b06ba563e27a851f035
8d53eb44250d901e9e93f6c5930c40f6f2d23fed
56785 F20101210_AAAMGQ kolendaroberts_h_Page_050.jp2
460b106a44000bd2518c784a6a32afef
22f316117c7f6987211b57367c08ec9669b11cf9
57753 F20101210_AAAMHF kolendaroberts_h_Page_047.jpg
28c777f4c59057eb0b1701da704d8bf0
299e3fd13be63b7489d35a35615b0e05b04abaf5
101307 F20101210_AAAMGR kolendaroberts_h_Page_109.jpg
0480118095332a420c9543b2e3f1d6eb
4372531f905ca4085ef78f1872cd8fcde9dc0805
104645 F20101210_AAAMHG kolendaroberts_h_Page_082.jpg
3825afe03a375e28bdd1422647a2ef46
d8196a988fa0bc631ed93f934c2372ce320ffd60
719972 F20101210_AAAMGS kolendaroberts_h_Page_070.jp2
eff3448dc44286bf870f64645c57b1a1
1f1cc2726de7a98c349d8b6c92e5efc6b719fd3d
32435 F20101210_AAAMHH kolendaroberts_h_Page_064.QC.jpg
9cde88c310a948dda946d1294fe3da3e
763fe99c788c7211c130dcf18af0a8a9a47c444e
F20101210_AAAMGT kolendaroberts_h_Page_006.tif
5fcffa529f20493cf2a06f65f69c9de6
ffc48b0566ff2238b9dc7477d517b729c44b6164
85326 F20101210_AAAMHI kolendaroberts_h_Page_015.jpg
ca6f87ed581c959dc847f3be1f3abedd
0d86d101255115c3e9e5fd6b4bf4af39dccd36eb
F20101210_AAAMGU kolendaroberts_h_Page_032.tif
324808305a0dc7d938b90cd7ef164f56
fc38b1b90133b1219ff75c092aa22e3fca42da0c
F20101210_AAAMHJ kolendaroberts_h_Page_115.tif
25b21ef13af994ebca67e37b70e0041f
41759906729397a7b8fd1ca3268a56b76d455263
60020 F20101210_AAAMGV kolendaroberts_h_Page_078.jpg
abd9ddf7fbb43d5fa71fc8541f26a890
605866d3684658b7421dc36d5b148586e1a4e55a
104901 F20101210_AAAMHK kolendaroberts_h_Page_046.jpg
804d761fa35e884135230166917c44da
31a2d14638a37e24ef293e550e914960ac2f8fb1
1372 F20101210_AAAMGW kolendaroberts_h_Page_113thm.jpg
468b7a96552d6bb12476db359db867af
a2f0578e3a3247c314a7e1de352f1c067f3d2c2b
47501 F20101210_AAAMHL kolendaroberts_h_Page_027.pro
a989b028dbddb707c220086970b5cff2
822364a61f93f1049273a59d087646b9136c14e3
2146 F20101210_AAAMGX kolendaroberts_h_Page_102thm.jpg
88c95d201f0b179c8996b7e908a24f9a
bf5709933b66063195842085229827741ef5dd00
34425 F20101210_AAAMHM kolendaroberts_h_Page_051.pro
69552d8f923f05b281f7c82ca4858b0f
cba58563aa29fa6a33f6f25966b4cd4e53458f19
7174 F20101210_AAAMGY kolendaroberts_h_Page_057thm.jpg
a3b9a9d9dd22afb178368c64e9ab0717
4f12cc898820b698150bdaf88d847cc0a3bc626d
37359 F20101210_AAAMIA kolendaroberts_h_Page_120.QC.jpg
a198ccb9c931c04ed049eba9632dd3e2
a250fcbf3e52947b6f91900ddd7681bb1942b338
36800 F20101210_AAAMHN kolendaroberts_h_Page_059.pro
d9af98f68891cfd82d6904880370d563
ddf19b7cb30c6abfb49ca5f9bd47bf82c0d748df
F20101210_AAAMGZ kolendaroberts_h_Page_060.tif
c1f18e0e28df766920a5eb0eb3238333
d1c098addfed1990c05544d39c49ee47a0fd6c73
48696 F20101210_AAAMIB kolendaroberts_h_Page_104.pro
f34a95619274e1125c885057230da8b2
c8fa30d10677a3e2964e968b623d4b857bb109c6
F20101210_AAAMIC kolendaroberts_h_Page_008.tif
a4299bfa0b61d91638252bfbe118fc01
d5c0ddfc4f9f7bebaaca3515e19e030ff252a931
4748 F20101210_AAAMHO kolendaroberts_h_Page_124.pro
2c18697bdd1b9f16873f9c18b4904264
578a1e63fc9857ca5e5bea10f0d47b1aa143ed60
483 F20101210_AAAMID kolendaroberts_h_Page_001.txt
664a2d2cd8576ab9ba3bc0d29ff1e2ab
9869b8e0687a97327a3fb19f6fbbe8460d54e11e
8093 F20101210_AAAMHP kolendaroberts_h_Page_109thm.jpg
7b05a075cb3b3ec943a72eb87482f2b7
3ad30618665a13a5501ebf776fabd5015c514095
59386 F20101210_AAAMIE kolendaroberts_h_Page_058.jp2
2346b7d5791446f2f8995776f6ec9911
c345c207204c0e0820d708816e6aae6cfddb96eb
F20101210_AAAMHQ kolendaroberts_h_Page_078.tif
f781ab352730dff7334a2e23c28db42a
e7b1dc308385abc6af779e0deae2556d4fb541f3
33039 F20101210_AAAMIF kolendaroberts_h_Page_106.QC.jpg
f5ef884d2e440f8928157f9b1ea1d1a6
d9e7790603313b6569faef7528682905d7c6d9d6
6131 F20101210_AAAMHR kolendaroberts_h_Page_037thm.jpg
979ad99c51137a94b6492481eb4cef8d
e91af4a80a678a7a5f2ebe6c122760c82f81c4aa
552462 F20101210_AAAMIG kolendaroberts_h_Page_039.jp2
5412f8a9ec68f5a46ec34b14b8da9363
0c3f8276a53976be1c78a92eb6e72d7abdb1fb02
52067 F20101210_AAAMHS kolendaroberts_h_Page_008.pro
f6b0e31c94fa27ac35c2a063ffbeec2c
a55b426c4e05e31dfb90bf5c17e307ba72b29b0f
48986 F20101210_AAAMIH kolendaroberts_h_Page_109.pro
50582ab8144c59c6307fbce1b5524500
f441bde42b7a3dce097ce68cd92e929fadd44c17
25567 F20101210_AAAMHT kolendaroberts_h_Page_050.pro
d327b3a66b3e22bb5c0c9ba9cca9aa2e
f5d7008b1c4af565c8eaec657a01a350ffd8c9d7
106968 F20101210_AAAMII kolendaroberts_h_Page_048.jp2
5a9318e26d9aa8e3aa5f549a4b88f3c7
0038d5969c58fbe5c6abba4c186bbb6075252f2f
75473 F20101210_AAAMHU kolendaroberts_h_Page_061.jpg
e8bcdbc00c7eee0405eb20675fb6ebf4
d3f23333376bc0d225af384332676ccb4ec029d7
87685 F20101210_AAAMIJ kolendaroberts_h_Page_089.jpg
b1d8ac58aabb0ff254b03166f2585092
6d87490ec86ecfe308d851c7787d7858da9f2246
F20101210_AAAMHV kolendaroberts_h_Page_030.tif
a0ff55146ae9636af89835dd392a79bb
e48d7399ea1ca03b366ed2152ee5a1f9136c58de
6977 F20101210_AAAMIK kolendaroberts_h_Page_094thm.jpg
06c22d8a637b568e95bca114905fc595
bcceb2f78a97e4dca6485502f92add139df1bedd
2034 F20101210_AAAMHW kolendaroberts_h_Page_095.txt
9f1ae02a36b114467ed595a3b5a8f028
32fe5032009daadec4eb53f056d2a1993b20a6db
110341 F20101210_AAAMJA kolendaroberts_h_Page_017.jp2
ca6378310f326b6fe6e3b3f7a72f3fed
515fbb5808f4768df95dd0bc6665aaf90333d8ca
F20101210_AAAMIL kolendaroberts_h_Page_103.tif
76523f12c48a047af9791e6606b8fbcf
81bb9aa42bdc6e532291dfc3f14f12da59090feb
7936 F20101210_AAAMHX kolendaroberts_h_Page_079thm.jpg
bb080c8c0531295d185f44e5de0caea1
2ae051e110dbf2c96cd604e2e025fd529dc99aa2
2188 F20101210_AAAMIM kolendaroberts_h_Page_009.txt
dd62d36b6da522c7e26ee476f9644794
d7651d824d9685b4742da3181629e538845f54f2
747985 F20101210_AAAMHY kolendaroberts_h_Page_072.jp2
ac2afb5cedc3c4c2abe9ea883472e567
5703c381215166bdb973598433ef27122e11bee0
102518 F20101210_AAAMJB kolendaroberts_h_Page_079.jp2
493b4c2e762e5252cddea88673d842a5
64fbe65b0a1e065f319a0b37a9fa7e3d575dc96a
F20101210_AAAMIN kolendaroberts_h_Page_099.txt
b4b957cddd0f262128e284459a88b661
35b3fda27f931625f7da8c72240b435a026062b1
109514 F20101210_AAAMHZ kolendaroberts_h_Page_018.jp2
44f13899e15485d82652a5ac4c6f611f
ce6e4c5210dd2d193ce2015acad1ef53bab469a7
3048 F20101210_AAAMJC kolendaroberts_h_Page_021thm.jpg
356ce39041d79783004e1cec84b4a3ef
8ab708b656cf1377b5558c8bed581990f9c2f5ac
1051976 F20101210_AAAMIO kolendaroberts_h_Page_009.jp2
e11728a5274d9f8a29fd3c5c0b5c4003
32d1c451cce75e4841999eb20db3585425c29ea8
F20101210_AAAMJD kolendaroberts_h_Page_108.tif
e92790562515fb2b860f27f1d9bb6107
2892912de99dbadddbf63505b908eb8d502604e3
F20101210_AAAMIP kolendaroberts_h_Page_111.txt
311e1b08d0882d666a5e011212fef200
2d83e3f92dd51d6dd19e4d32871e708cd1bc8d77
19769 F20101210_AAAMJE kolendaroberts_h_Page_037.QC.jpg
1c6d301f27ae3670628eaf5e5a28ad80
8a04a3ea99e9895e51592b1ee5507b23310cdcfc
25079 F20101210_AAAMIQ kolendaroberts_h_Page_102.jpg
4a7fa362aaacd1da475cbe8baa1cca7c
01bea41ffa5316696651cde675fab165743adeba
7934 F20101210_AAAMJF kolendaroberts_h_Page_076thm.jpg
4b214b6096a164a9236955179e42ed3a
c9b499202823b2ff3d375e23f0024ef4156d91ce
1227 F20101210_AAAMIR kolendaroberts_h_Page_075.txt
8422ca64f7edcd0c23de423f1a5d64b2
176abf499d28f84dd4bea31ae4cabce4f5932b67
F20101210_AAAMJG kolendaroberts_h_Page_062.jpg
1cb52789eec8d62ba36dd4c53822dc12
beb34e6edd011cc6eb89a859b62d5c12a81fedb3
71237 F20101210_AAAMIS kolendaroberts_h_Page_043.jp2
3754696deb8b129a5d01080c8095218f
992894abef61de187087f3004fd1261c3ed4fd40
34445 F20101210_AAAMJH kolendaroberts_h_Page_046.QC.jpg
022679c4acc570a0ffe10e8fc7f3e34f
e75b2b3173b725162f6559c4dbca69a4b710f505
F20101210_AAAMIT kolendaroberts_h_Page_028.tif
37f83851c2d39c1f89a2df2bf104b05b
bac5ecaeff167bc903bc599323335768509d40ff



PAGE 1

CYTOKINE PROFILES AND VI RAL REPLICATION WITHIN THE THYMUSES OF NEONATALLY FELINE IMMUNODEFICIENCY VIRUS-INFECTED CATS By HOLLY MEREDITH KOLENDA-ROBERTS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Holly Meredith Kolenda-Roberts

PAGE 3

ACKNOWLEDGMENTS I would like to thank Dr. Calvin Johnson for creating a wonderful working and learning environment, and for all of his ongoing support and wisdom. I would like to thank Dr Ayalew Mergia for agreeing to supervise my research and act as my committee chairman after Dr. Johnsons transfer to Auburn University. He helped smooth the transition and provided a supportive environment for the completion of this project. My deepest appreciation goes to my supervisory committee comprising Dr. Pamela Ginn, Dr. Maureen Goodenow and Dr. Steeve Giguere for their valuable time, interest in the project, professionalism and advice. My sincerest appreciation also goes to Debbie Couch and Sally OConnell, who have helped me with countless day-to-day issues with a smile and without whom I couldnt have even registered for classes. I would like to thank George Papadi, Abigail Carreo and Peter Nadeau for their support in the lab, advice and technical assistance. And I would like to thank Janelle Novak, my Siamese twin, for making coming to work fun. My project benefited from our discourse. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iii LIST OF TABLES ............................................................................................................vii LIST OF FIGURES ...........................................................................................................ix ABSTRACT .....................................................................................................................xiii CHAPTER 1 INTRODUCTION........................................................................................................1 Human Immunodeficiency Virus.................................................................................1 Animal Models for HIV Infection.........................................................................2 Neonatal FIV Infection..........................................................................................2 The Thymus..................................................................................................................3 Cytokines......................................................................................................................5 Goals of Study..............................................................................................................6 2 LITERATURE REVIEW.............................................................................................8 Interleukin-7.................................................................................................................8 Interleukin-4...............................................................................................................10 Interleukin-15.............................................................................................................11 Interferon-.................................................................................................................13 3 DETERMINATION OF FELINE CYTOKINE SEQUENCES.................................18 Introduction.................................................................................................................18 Materials and Methods...............................................................................................18 Primer Design......................................................................................................18 Synthesis of cDNA..............................................................................................19 Construction and Use of a Plasmid Containing Cytokine Sequence Inserts.......20 Results.........................................................................................................................22 Plasmid Construction...........................................................................................22 Feline Cytokine cDNA Sequences......................................................................24 Discussion...................................................................................................................29 iv

PAGE 5

4 MEASUREMENT OF FIV GAG MESSENGER RNA AND DNA, AND IL-4, IL-7, IL-15, IFN-ALPHA AND INTERFERON-GAMMA MESSENGER RNA LEVELS IN THE THYMUSES OF CATS NEONATALLY INFECTED WITH FIV..............................................................................................................................30 Introduction.................................................................................................................30 Materials And Methods..............................................................................................31 Quantitative Real-Time PCR for Feline Cytokine mRNA..................................31 Quantitative Real-Time PCR for FIV Provirus..................................................32 Quantitative Real-Time PCR for FIV Transcription..........................................32 Statistical Analysis..............................................................................................34 Results.........................................................................................................................35 Interleukin-4........................................................................................................35 Interleukin-7........................................................................................................37 Interleukin-15......................................................................................................39 Interferon-..........................................................................................................41 Interferon-..........................................................................................................43 Viral Transcription (FIV gag RNA) and Proviral Load (FIV gag DNA)...........45 Discussion...................................................................................................................47 5 IMPACT OF CYTOKINE CHANGES ON FIV REPLICATION AND THYMIC CELLULAR COMPOSITION...................................................................................49 Introduction.................................................................................................................49 Materials and Methods...............................................................................................50 Results.........................................................................................................................51 Profile of Thymocyte Subpopulations.................................................................51 Peripheral Blood Counts......................................................................................60 Pairwise Correlations of Lymphocyte Subsets to Viral and Cytokine Parameters........................................................................................................62 Discussion...................................................................................................................64 6 DETECTION OF FIV-INFECTED CELLS AND IFN-PRODUCING CELLS WITHIN THE THYMUS OF NORMAL AND FIV-INFECTED CATS..................67 Introduction.................................................................................................................67 Materials and Methods...............................................................................................68 Single-Label Immunohistochemistry..................................................................68 Double-Label Immunohistochemistry.................................................................69 Statistical Analysis..............................................................................................70 Results.........................................................................................................................70 Single-Label Immunohistochemistry..................................................................71 Double-Label Immunohistochemistry................................................................76 7 SUSCEPTIBILITY OF THYMOCYTES TO FIV CHALLENGE IN VITRO.........80 Introduction.................................................................................................................80 v

PAGE 6

Materials And Methods..............................................................................................80 Results.........................................................................................................................81 Viral Replication in Thymocyte and CD4E Cell Culture Systems.....................81 Viability of Thymocytes In Vitro........................................................................82 Cytopathic Viral Effects on Thymocyte Cultures...............................................83 Discussion...................................................................................................................87 8 CONCLUSIONS........................................................................................................89 LIST OF REFERENCES.................................................................................................100 BIOGRAPHICAL SKETCH...........................................................................................111 vi

PAGE 7

LIST OF TABLES Table page 3-1 Oligonucleotide primers and probes used for nested PCR protocols.......................19 4-1 Primers and probes used for real-time RT-PCR.......................................................34 4-2 Relative IL-4 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample..............................................................................36 4-3 P values from pairwise comparison of IL-4 levels, animal groups 1-6 from Table 4-2.............................................................................................................................36 4-4 Relative IL-7 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample..............................................................................38 4-5 P values from pairwise comparison of IL-7 levels, animal groups 1-6 from Table 4-4.............................................................................................................................38 4-6 Relative IL-15 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample..............................................................................40 4-7 P values from pairwise comparison of IL-15 levels, animal groups 1-6 from Table 4-6..................................................................................................................40 4-8 Relative IFNmRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample..............................................................................42 4-9 P values from pairwise comparison of IFNlevels, animal groups 1-6 from Table 4-8..................................................................................................................42 4-10 Relative IFNmRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample..............................................................................44 4-11 P values from pairwise comparison of IFNlevels, animal groups 1-6 from Table 4-10................................................................................................................44 4-12 Relative viral gag RNA expression and viral DNA loads within feline thymic samples as measured with real time RT-PCR..........................................................46 vii

PAGE 8

5-1 Historical data for absolute total thymocyte counts and absolute number of total thymocytes, double-negative thymocytes and IgG+ cells (B cells) in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points..............................53 5-2 Historical data for absolute number of double-positive CD4+CD8+ thymocytes and the percentage of total thymocytes exhibiting the CD4+CD8+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points..................54 5-3 Historical data for absolute number of CD4+ thymic cells and the percentage of total thymic cells exhibiting the CD4+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................54 5-4 Historical data for absolute number of CD8+ thymic cells and the percentage of total thymic cells exhibiting the CD8+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................55 5-5 Historical data for absolute number of total white blood cells, CD4+ T cells and CD8+ T cells within peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.................................................................................................60 5-6 Summary of Pearsons pairwise correlations of historical necropsy data, measured cytokine values and viral parameters.......................................................63 6-1 Number of DLEC+ cells per unit of thymic area.....................................................76 6-2 Number of IFN+ cells per unit of thymic area.........................................................76 viii

PAGE 9

LIST OF FIGURES Figure page 3-1 Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IFNinsert...............22 3-2 Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IFNinsert..............23 3-3 Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing feline IL-4 and IL-15 inserts.23 3-4 Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IL-7 insert.................24 3-5 Full length nucleotide sequence of the feline IFNcDNA.....................................24 3-6 Full length nucleotide sequence of the feline IFNcDNA.....................................25 3-7 Full length nucleotide sequence of the feline IL-4 cDNA.......................................26 3-8 Full length nucleotide sequence of the feline IL-7 cDNA.......................................27 3-9 Full length nucleotide sequence of the feline IL-15 cDNA.....................................28 4-1 Measurement of relative IL-4 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls....................37 4-2 Measurement of relative IL-7 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls....................39 4-3 Measurement of relative IL-15 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls....................41 4-4 Measurement of relative IFNmRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls....................43 4-5 Measurement of relative IFNmRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls....................45 ix

PAGE 10

4-6 Measurement of relative viral gag RNA expression by real time RT-PCR in thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time points after neonatal infection..................................................................................46 4-7 Measurement of relative viral gag DNA content by real time RT-PCR in thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time points after neonatal infection.....................................................................................................47 5-1 Historical flow cytometry results from previous published experiments: absolute numbers of total thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.......................................................................55 5-2 Historical flow cytometry results from previous published experiments: absolute numbers of double-negative (DN) CD4-CD8cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................56 5-3 Historical flow cytometry results from previous published experiments: absolute numbers of IgG+ cells (B cells) present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time point............................................................56 5-4 Historical flow cytometry results from previous published experiments: absolute numbers of CD4+CD8+ thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points...........................................................57 5-5 Historical flow cytometry results from previous published experiments: percentage of CD4+CD8+ thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points...........................................................57 5-6 Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD4+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................58 5-7 Historical flow cytometry results from previous published experiments: percentage of single-positive (SP) CD4+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................58 5-8 Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................59 x

PAGE 11

5-9 Historical flow cytometry results from previous published experiments: percentage of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................59 5-10 Historical flow cytometry results from previous published experiments: absolute numbers of white blood cells present in peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points...........................................................61 5-11 Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD4+ cells present in peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................61 5-12 Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points............................................62 6-1 40X. Single-label immunohistochemistry with a polyclonal antibody against human BDCA-2 (DLEC) performed on thymic sections from a 16-week-old, uninfected kitten.......................................................................................................71 6-2 60X. Single-label immunohistochemistry with a polyclonal antibody against human BDCA-2 (DLEC) performed on thymic sections from an 8-week-old kitten infected with FIV...........................................................................................72 6-3 40X. Single-label immunohistochemistry with an antibody against IFNperformed on thymic sections from a 16-week-old, uninfected kitten.....................73 6-4 10X. Single-label immunohistochemistry with an antibody against IFNperformed on thymic sections from an 8-week-old kitten infected with FIV..........74 6-5 10X. Single-label immunohistochemistry with mAb against FIV p24 performed on thymic sections from an 8-week-old kitten infected with FIV............................75 6-6 40X. Double-label immunohistochemistry for DLEC and IFNperformed on thymic sections from an 8-week-old kitten infected with FIV.................................77 6-7 40X. Double-label immunohistochemistry for DLEC and FIV p24 performed on thymic sections from an 8-week-old kitten infected with FIV.................................78 7-1 Summary of reverse transcriptase (RT) activity in cell cultures of CD4E cells and fetal thymocytes in one of three series of experiments.....................................82 7-2 Number of viable cells on day 9 of cell culture in one of three attempted experiments..............................................................................................................83 xi

PAGE 12

7-3 Appearance of freshly thawed CD4E cells at the outset of the cell culture experiments..............................................................................................................84 7-4 Appearance of freshly thawed thymocytes at the outset of cell culture...................84 7-5 CD4E cells at Day 9 of culture experiments............................................................85 7-6 Fetal thymocyte cells at Day 9 of culture experiments............................................86 xii

PAGE 13

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CYTOKINE PROFILES AND VIRAL REPLICATION WITHIN THE THYMUSES OF NEONATALLY FELINE IMMUNODEFICIENCY VIRUS-INFECTED CATS By Holly Meredith Kolenda-Roberts December 2006 Chair: Ayalew Mergia Major: Veterinary Medical Sciences Reported in these studies are immunological, virological and cytological changes within the thymuses of cats infected with feline immunodeficiency virus (FIV) at birth, an important animal model for human immunodeficiency virus infection. The objective of the first study was to identify the genetic sequences encoding the cytokine mRNAs of interest. Elucidation of the five investigated cytokine sequences was successful, and results were verified against known sequences in other species. Cytokine sequences were used to design primers and probes for use in the next experiment. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was used to assess changes in mRNA expression that occurs in vivo at acute, intermediary and chronic stages of neonatal FIV infection when compared to age-matched controls. The concurrent proviral load and viral gene expression were measured. Compiled cytokine and viral data were analyzed with the corresponding necropsy data from the experimental xiii

PAGE 14

animals to find correlations between pathological changes to the immune system and the relative levels of cytokines. A loss of mRNA expression of interleukin (IL)-4, IL-7, interferon (IFN)and IFNwas observed in chronic infection, and the decreases in IL-7, IFNand IFNwere positively correlated with the loss of thymocytes observed with FIV infection. Levels of IFNwere positively correlated with viral gene expression. The loss of IFNexpression, a molecule with antiviral properties, was further investigated. A major cell producer of IFN is the plasmacytoid dendritic cell (PDC), so immunohistochemistry (IHC) was performed in order to detect this cell in thymus samples. It was determined that this cell type is present in inflammatory germinal centers of the infected thymuses, and that they harbor FIV gag RNA, which may result in lytic infection, functional loss and decreased IFNmRNA expression. Attempts to productively infect fetal thymocytes with FIV in order to evaluate potential protective effects of IFNtreatment were unsuccessful. This supported our IHC analysis of thymuses for viral protein, which showed that only mature cells within germinal centers and the thymic medulla were infected. This study indicates that further FIV research regarding thymic PDC, IL-7 and IFN expression is warranted. xiv

PAGE 15

CHAPTER 1 INTRODUCTION Human Immunodeficiency Virus In 2005, it was estimated that over 40 million people globally were infected with human immunodeficiency virus (HIV), including 2 million children (UNAIDS/WHO, 2005). There were approximately 700,000 new infections and 570,000 deaths in children in 2005. The rates of infection, disease spread and mortality continue to exceed predictions. While the introduction of highly active retroviral therapy (HAART) has improved individual disease progression, overall mortality has leveled off after improvements noted in 1996-1997. The production of a successful vaccine for HIV remains elusive, and further investigation of the pathogenesis of the disease is being used to further elucidate potential therapeutic targets. Most pediatric HIV cases are a result of vertical transmission from infected women, and can occur in utero, during birth or after the ingestion of infected milk, with the greatest number occurring during the peripartum/neonatal period (Khoury, 2001). Pediatric infection occurs at a time of immunological immaturity, with a third of cases having rapidly progressive disease. Children have a higher incidence of neurologic abnormalities, cardiomyopathy, and pulmonary complications including lymphoid interstitial pneumonia. As the course of infection is related to degree of immunological development and the resulting host response to infection, a greater understanding is needed of the age-related factors impacting lentiviral pathogenesis. 1

PAGE 16

2 Animal Models for HIV Infection One of the preeminent goals in HIV research is to develop a suitable animal model for infection, where infection can be controlled and tissues can be obtained for study throughout the course of infection. HIV, feline immunodeficiency virus (FIV) and simian immunodeficiency virus (SIV) all belong to the lentivirus genus of retroviruses. Clinical disease associated with these agents is characterized by progressive deterioration of the host immune function, ultimately leading to acquired immunodeficiency syndrome (AIDS) (Levy, 2006). The similarities between the viruses and their clinical courses have prompted the use of SIV (Haigwood, 2004; Kimata, 2006) and FIV (Willett BJ, 1997; Burkhard, 2003) as animal models of AIDS pathogenesis. Both viruses exhibit tropism for many cells of the immune system, including the CD4 + subset of T lymphocytes which are responsible for much of the cell signaling and initiation of the acquired immune response. As the number of CD4 + cells dwindles within the course of infection, the host becomes susceptible to opportunistic infections and degenerative disorders, ultimately leading to the death of the host. As the use of the primate model can be cost prohibitive, and primate experiments are generally limited in the number of animals available for study, FIV therefore offers an attractive alternative. Neonatal FIV Infection In an experimental animal model such as the cat, tissue is available for examination, timing of inoculation is known in relation to the disease course, the effects of the virus in relation to stage of parturition are identifiable and uninfected littermates are available as a control for environmental and maternal effects. In experiments with the Petaluma strain of FIV, neonatally infected animals exhibited a persistent generalized lymphadenopathy, a more profound neutropenia, a persistent decrease in CD4+/CD8+ T

PAGE 17

3 lymphocyte ratio, and decreased CD4+ T cell count when compared to cats infected as adults (George, 1993). When compared to age-matched controls, other experiments using the Petaluma stain appear to produce variable effects. In one study infection caused decreases in CD4+ cells and increases in CD8+ T cells, but weight gain in kittens was not impaired (Power, 1998). However, Johnston et al. did not measure significant decreases in CD4+ T cell counts though the same strain was used (2002). The highly pathogenic molecular clone JSY3 (derived from the NCSU-1 strain) produces a reduction in CD4+ T cell numbers and CD4+/CD8+ T cell ratio (Orandle, 2000; Norway, 2001) that is partially abrogated with an inactivating mutation of the ORF-A gene (Norway, 2001). Similar changes in CD4+ T cells and CD4+/CD8+ T cell ratios were observed with pFIV-PPR (Phipps, 2000). The Thymus The thymus is the major site of production for the mammalian immune systems T lymphocytes, which are the major cellular target for the lentiviruses. Replacement of these cells as they are lost in the course of infection is by cell division within the periphery and de novo production by the thymus. As recent thymic emigrants (RTEs) display novel genetic rearrangements for the T cell receptors (TCRs), these cells maintain the repertoire by which the immune system can respond to diverse foreign antigens. Therefore one of the major factors in the progression of disease is the loss of the thymuss ability to replace lymphocytes during immunosuppression. The thymus and the impact of HIV infection has been extensively reviewed, and it has been shown that the thymus is directly infected by the lentivirus, resulting in thymocyte depletion and varying degrees of inflammation (Ye, 2004; Hazra, 2005; Meissner, 2003; de la Rosa, 2003; Robertson, 2003; al Harthi, 2002). Treatment of HIV infection with highly active

PAGE 18

4 antiretroviral therapy (HAART) does not fully restore thymic function and normal numbers of circulating T cells. Recovery of circulating CD4+ T cells in response to successful viral suppression with HAART appears dependent on thymic function (Fernandez, 2006). The pathogenesis of the thymic infection is an important component to consider when intending to promote immune reconstitution. At birth, the human thymus is active, generating the cohort of T cells for the developing immune system. The thymus continues to increase in size until puberty, after which it undergoes progressive involution (Aspinall, 2000). Newly produced T cells contain excised loops of DNA (TCR rearrangement excision circles, TRECs) that are generated during the genetic rearrangements necessary for surface T cell receptor (TCR) expression (Steffens, 2000). Compared to uninfected children, vertically infected HIV-positive children were shown to have lower levels of TRECs in peripheral blood mononuclear cells (PBMC), indicating impaired thymic output, and this decrease was not directly related to viral load (Correa, 2002). As children tend to have higher viral loads and faster disease progression, it has been suggested that these trends may be related to thymic dysfunction and early involution (Ye, 2004). As overall direct viral infection of thymocytes is low, the pathogenetic mechanisms behind thymic infection need to be better understood. Thymic FIV Infection As in its overall immune pathophysiology, FIV exhibits similar effects within the thymus of neonatal cats as HIV has been shown to cause in the thymus of children, and adequately models this disease process. Neonatal thymus infection with FIV results in a reduction of thymus-body weight ratio, selective depletion of CD4+CD8+ thymocytes, cortical atrophy, infiltrations of B cells, formation of lymphoid follicles and deformation

PAGE 19

5 of the thymic architecture (Orandle, 1997; Orandle, 2000; Norway, 2001; Johnson, 2001). Interestingly, these changes were not ameliorated with effective antiretroviral therapy in juvenile cats (Hayes, 2000) or with a mutation of the ORF-A gene that yielded lower viral replication and a lower thymic proviral load (Norway, 2001), suggesting that host factors and inflammatory processes may be significant factors in the disease process and thymic disruption. Thymic infection was associated with the emergence of CD8+ T cells expressing CD8 + low and CD8 + neg phenotypes (Orandle, 2000; Crawford, 2001), but these cells were not found to correlate with reduction in viral load (Crawford, 2001). Immunohistochemistry of thymic samples showed significant staining for IgG outside of lymphoid follicles that did not correlate with positive staining for a B cell marker, suggesting that thymocytes are coated with antibody (Orandle, 1997). Infection was associated with a 10-fold increase in the expression of interferon (IFN)mRNA within PBMC and within thymic samples in perivascular areas, along the corticomedullary junction and adjacent to lymphoid follicles (Orandle, 2000). As with HIV, the overall number of FIV expressing cells within the thymus was low, and the lowest incidence of productive infection correlated with the most severe histologic lesions (Johnson, 2001). Cytokines Cytokines are chemical mediators that are released by cells that result in altered cell function in the target population. A highly regulated combination of cytokines is elaborated by cells of the immune system and used to coordinate the overall response to foreign antigen. HIV infection has been shown to cause a significant impact on host cytokine profiles. These changes are believed to be associated with the increased programmed cell death (apoptosis) within uninfected T cells (Badley, 1997), chronic immune system stimulation (McCune, 2001), defective cell-mediated immunity, and

PAGE 20

6 impairment of the immune systems regenerative capacity (Neben, 1999) that have been observed in HIV infected people. Modified cytokine production is likely involved in all of the aforementioned pathologic features, whether secondary to the disease process or acting as an inciting mechanism. Thymopoiesis is dependent on a sensitive microenvironment and is regulated by direct cellular interactions and paracrine cytokine production. Many cytokines used in the immune response by mature cells are used for alternate functions within the thymus, such as thymocyte selection and to promote cell survival. The thymus is a primary lymphoid organ that normally contains relatively few mature lymphocyte populations and active germinal centers, and the introduction of inflammatory processes impacts the cytokine milieu, thymopoiesis and viral replication. Goals of Study The purpose of this research was to identify immunological factors that impact FIV infection within the neonatal thymus. A greater understanding of FIV thymic immunopathogenesis would allow for potential manipulation of cytokines in a way that would promote thymopoiesis and immune reconstitution, while not contributing to increased viral replication. In the following chapters, thymic cytokines will be discussed in detail (Chapter 2). Several objectives were developed for this research project and are addressed in the following chapters: 1. Discovery of mRNA sequences for interleukin (IL)-7, IL-4, IL-15, interferon (IFN)-, and IFN(Chapter 3); 2. Measurement of interleukin (IL)-7, IL-4, IL-15, interferon (IFN)-, and IFNmRNA expression levels within the thymus of neonatally FIV-infected animals and age-matched controls at 3 time points correlating with acute and chronic infection (Chapter 4); 3. Determination of cytokine alterations

PAGE 21

7 which correlate with changes in viral load and replication, influx of inflammatory cells and thymocyte depletion (Chapter 5); 4. Demonstration of changes in inflammatory cell populations, interferon production and viral distribution using immunohistochemistry (Chapter 6); 5. Assessment of FIV infection of cultured thymocytes (Chapter 7). The hypothesis of this study is that alterations in cytokine mRNA expression occur as a result of FIV infection of the pediatric thymus, and that these changes correlate with changes in FIV viral replication, local inflammatory cell populations and T cell production by the thymus.

PAGE 22

CHAPTER 2 LITERATURE REVIEW Cytokines are chemical mediators used to influence cell survival and function. Many of the cytokines used by the thymus have alternate functions when elaborated in the periphery and within secondary lymphoid organs. Changes in the local production of these molecules have a potential impact on further T cell production, the ability of the immune systems inflammatory cell populations to successfully combat the viral infection, and viral replication itself. Interleukin-7 Interleukin (IL)-7 has been proven to have multiple effects on immune system cells. In peripheral lymph nodes of mice, increased IL-7 production has been shown to cause marked increases in the numbers of immature B cells (B220 + Ig which differentiate into antibody-secreting cells) and T cells (particularly cytotoxic CD8 + cells, which are responsible for direct cellular killing in target cells such as virus-infected cells) (Mertsching, 1995). In addition to cytotoxic T cells, IL-7 causes proliferation of natural killer cells, which are also responsible for direct cell killing of virus-infected cells (Or, 1998). Within the thymus (the site of development and selection of immature T cells) IL-7 appears to have multiple effects on maturing T cells. If added very early in T cell development (CD3 CD4 CD8 cells), IL-7 causes an increased expression of a high-affinity receptor for another cytokine, IL-2, an inducer of T-cell proliferation (Morrissey, 1994). Within the thymus IL-7 has also been shown in mice to cause expansion of newly differentiated and selected CD4 + and CD8 + thymocytes (Hare, 2000). 8

PAGE 23

9 Studies of HIV patients have revealed that as the circulating CD4 + cell count drops, the concentration of plasma IL-7 increases in proportion to the cell loss (Napolitano, 2001). In children infected with HIV, IL-7 levels were higher in HIV-infected children, and higher IL-7 levels were associated with lower CD4+ T cell counts and lower TREC values (Resino, 2005). In addition, increased plasma IL-7 levels in pediatric infection appeared to correlate with the emergence of more virulent strains of HIV (Resino, 2005; Kopka, 2005). Immunohistochemistry of patient lymph nodes revealed strong expression of IL-7 by dendritic cells of depleted parafollicular T cell areas (Napolitano, 2001). The authors proposed that cells such as these sensed a drop in the lymphocyte population within the periphery, and that IL-7 was produced to stimulate thymopoiesis in a compensatory feedback loop. However, it has also been shown that the receptor for IL-7 (IL-7R) is downregulated on T cells with HIV infection, and loss of the receptor was associated with increased plasma IL-7 concentrations and decreased numbers of CD4+ T cells (Rethi, 2005). In vitro, reduced receptor expression correlated with decreased Bcl-2 expression and decreased cell survival in these cells. IL-7 has also been shown to augment Fas-mediated apoptosis in HIV-infected CD4+ and CD8+ T cells (Lelievre, 2005). Ongoing studies are investigating the utility of IL-7 as a treatment modality. Preliminary studies using SIV-infected macaques undergoing antiviral therapy have shown increases numbers of memory and newly generated T cells in response to injection with IL-7 without a corresponding increase in viral load (Beq, 2006). However, conflicting data would suggest IL-7 may promote viral replication. Napolitano, et al.

PAGE 24

10 showed increased viral load associated with increased plasma IL-7. In support of this finding, others that have found IL-7 actually augments infection of thymocytes and fetal thymic organ culture in vitro (Pedroza-Martins, 2002; Uittenbogaart, 2000). IL-7 was shown to be a potent reactivator of HIV replication in latently HIV-infected CD4+ T lymphocytes (Wang, 2005). In addition, with thymocyte depletion, it is likely that IL-7 is relatively increased in the thymic microenvironment. As an excess of IL-7 has been shown to expand double negative (DN) CD4-CD8populations while inhibiting the production of double positive (DP) CD4+CD8+ thymocytes (DeLuca, 2002). Overabundance of this cytokine may be contributing to the decrease in the DP thymocytes seen in lentivirus infection. Further study is necessary to determine the overall impact and efficacy of IL-7 in the treatment of HIV. Interleukin-4 IL-4 is another multifunctional cytokine utilized by the immune system, and it exhibits varying effects within the peripheral immune system and the thymus. Within the thymus, IL-4 exposure causes direct changes in the phenotype of responsive cells, inducing expression of CD45RA on a variety of thymocyte subpopulations (Uittenbogaart, 1990). IL-4 was shown to be as effective as IL-7 in promoting conversion of intermediate CD4 + 8 thymocytes into CD4 8 + cells, and IL-2, -4, and -15 were as effective as IL-7 in promoting functional competence as measured by proliferative responses to CD3 + CD28 stimulation (Yu, 2003). Within the periphery, IL-4 is one of the major cytokines responsible for polarizing the immune system in response to antigen toward humoral or cellular immunity. Production of IL-4 causes CD4+ T-cell differentiation to the Th2 phenotype (as opposed to the Th1, involved in cellular immune responses), and these cells in turn produce more

PAGE 25

11 IL-4 (Santana, 2003). One of the key immunological observations in HIV infections is the shift from a Th1 response to a Th2 response, characterized by increased numbers of IL-4-secreting cells (Klein, 1997), which is clearly unsuitable for ongoing viral infection and the maintenance of the critically important cell-mediated immunity. IL-4 was found to be produced by CD8+ T cells in HIV-infected patients undergoing HAART with high viremia, and levels were increased with the presence of opportunistic infections (Sindhu, 2006; Rodrigues, 2005). And, as mentioned previously, studies on viral replication in thymocyte cultures and fetal thymic organ culture showed that IL-4, by itself or particularly in conjunction with IL-7, increased HIV viral replication (Pedroza-Martins, 2002; Uittenbogaart, 2000). Using thymic and liver implants in mice with severe combined immunodeficiency (SCID-hu model), infection with HIV was not associated with changes in IL-4 mRNA production (Koka, 2003). Interference with IL-4 production using anti-sense IL-4 DNA suppressed viral replication of simian-human immunodeficiency virus (SHIV, hybridized viral strain) in CD4+ T cells, macrophages and in vivo in macaques (Dhillon, 2005). Interleukin-15 Interleukin-15 is a cytokine closely related to IL-2, which is commonly used in laboratories for preservation and proliferation of lymphocytes in culture systems. IL-2 and IL-15 are structurally similar, share two receptor subunits (IL-2R and the common chain) and has been shown to share many immune system functions. IL-15 is believed to act as a regulator of CD8+ T cell homeostasis, and studies have shown IL-15 deficiency can result in a decreased magnitude of CD8+ T cell expansion with stimulation, resulting in fewer memory cells (Prlic, 2002). IL-15 is also believed to be responsible for basal proliferation of CD8+ memory cells necessary for maintenance of these cells within the

PAGE 26

12 host. IL-15 has been shown to be important for expression of the antiapoptotic protein Bcl-2 in CD8 T cells, suggesting IL-15 may also help with CD8+ T cell survival. So while IL-2 is involved in elimination of T cells through activation-induced cell death (AICD), IL-15 serves to prevent apoptosis (Waldmann, 2002). Where IL-15 stimulates the persistence of memory CD8+ T cells, IL-2 inhibits their expression. As further research such as this emerges regarding IL-15, it will potentially be considered a more suitable cytokine to stimulate immune reconstitution in AIDS patients. As cell-mediated immune responses (largely CD8+ T cell-mediated) are critical in the long-term control of HIV, understanding the role of IL-15 in the immunopathology of AIDS will need to be elucidated. In vitro studies with human peripheral blood mononuclear cells has shown that treatment with the Nef protein of HIV causes early up-regulation of IL-15 by monocytes in response to an infectious agent, and this production of IL-15 inhibited subsequent antibody production (Giordani, 2000). In contrast to these findings, blood levels of IL-15 were decreased in HIV-infected people (Ahmad, 2003). Stimulated PBMCs from untreated HIV patients and patients with HAART failure showed significantly impaired IL-15 production when compared to healthy donors or HAART-responsive patients (dEttorre, 2002). While there was not increased viral replication in PBMCs treated with IL-15, the combination of IL-15 and IL-2 together did result in significant increases in viral production. In HIV patients with pulmonary infiltration by CD8+ T cells (lymphocytic alveolitis), IL-15 was implicated in up-regulation of interferonand tumor necrosis factor(inflammatory cytokines), infiltration and proliferation of T cells within the lung and up-regulation of accessory, co-stimulatory B7 molecules CD80 and CD86

PAGE 27

13 on alveolar macrophages (Agostini, 1999). In addition, compartmentalization of CD8+ T cells within the enlarged lymph nodes of SIV-infected monkeys corresponded to increased RNA expression of IL-7 and IL-15 within these tissues (Caufour, 2001). Treatment of SIV-infected macaques with IL-15 resulted in 3-fold expansion of NK cells and a 2-fold increase in CD8+ T cells, particularly the effector memory subset, with no concurrent increase in plasma viremia (Mueller, 2005). InterferonBacteria, protozoa and perhaps viruses trigger monocytes/macrophages to produce IL-12, which in turn promotes T cell activation and IFNproduction. IFNis considered a pro-inflammatory cytokine that is produced by activated T lymphocytes (CD4+ and CD8+) and natural killer cells (Young, 2006). It is considered important to both the innate and adaptive immune systems, and plays a particularly important role in activating macrophages and neutrophils. IFNpromotes T and B cell proliferation, MHC I and II expression, causes augmentation of NK cell lytic function and suppresses IL-4 responses. IFNis one of the cytokines measured to identify a Th1 response (cell-mediated immunity), in contrast to IL-4 and a Th2 response (Corthay, 2006). IFNplays a role in expression of NF-B, and is considered a necessary component of several inflammatory and autoimmune conditions. However, IFNcan also cause apoptosis in certain populations of cells (hepatocytes, B lymphocytes, monocytes/macrophages, activated T cells, tumor cells) and inhibit production of other pro-inflammatory cytokines, IL-1 and IL-8, conferring it anti-inflammatory and regulatory functions as well (Muhl, 2003). In this way, IFNmay down-regulate the activated immune system and aid in resolving inflammation.

PAGE 28

14 Initial infection by lentiviruses induces an expansion of virus-specific, IFN-producing CD8+ T cells that corresponds to a decline in plasma viremia. However, in chronic infection HIV-specific CD8+ T cells were shown to have decreased ability to generate IFN, even though CTL numbers remained adequate, and this dysfunction was not corrected when HAART therapy was instituted (Onlamoon, 2004). Serum IFNlevels were found to be reduced in chronically HIV-infected individuals as compared to controls, though values tended to be higher if concurrent opportunistic infections were present (Sindhu, 2006). NK cells from patients with progressive HIV infection demonstrated lower IFNproduction in response to a CpG oligodeoxynucleotide (Saez, 2005). HIV-specific IFNproduction by CD 4+ T cells was associated with lower plasma viral RNA and proviral load in peripheral blood mononuclear cells (PBMCs), and this response, in combination with IgG2 antibody production, was the best predictor for longterm nonprogressors to disease (Martinez, 2005). It has been suggested that HIV-infected children have decreased IFN-producing CD8 T cell responses, and that this may contribute to persistent high levels of viral replication after neonatal infection (Buseyne, 2005). Macrophages in HIV patients exhibit deficiencies in oxidative burst activity and phagocytosis. In vitro these effects can be counteracted by treatment with IFN-, and treatment of HIV-infected patients with IFNresults in decreased incidence of opportunistic infections (Murphy, 1988; Reed, 1992; Kedzierska, 2003). IFNis currently being investigated as a treatment modality for opportunistic infections in HIV patients. Interferon

PAGE 29

15 Type I interferons, such as IFN-, are produced when cells are exposed to viral products, particularly dsRNA. The interferons are secreted, and binding to the IFN receptor triggers the Jak/STAT pathway of intracellular signaling (Cebulla, 1999). This, in turn, induces the transcription of IFN-stimulated genes (ISG). Interferons as a group can induce more than 300 cellular proteins, which depends on the IFN signal and the target cell type. Through IFN-triggered 2-5(A) synthetase activity, RNaseL produces antiviral and anticellular effects, often influencing apoptosis (Samuel, 2001). Activation of ISG56, which encodes for P56, results in the binding of translation initiation factor eIF-3, blocking protein synthesis. PKR has been shown to have many functions, which ultimately affect cell functions, cell growth and apoptosis. Induction of the P200 family of genes causes decreased transcription of rRNA and impairs cell proliferation. So, many of the effects of interferons are directly aimed at viral replication (Sen, 2001). Type I interferons (IFN-/) work in conjunction with IL-12 and Type II interferons (IFN-) to suppress Th2 cells (Durbin, 2000). IFNhas also been shown to support the differentiation of cytotoxic T lymphocytes and induce CTL responses (von Hoegen, 1995). IFNis produced during HIV infection, and increased IFN levels correlate with diminished levels of virus and rises in CD4+ T cell count (Poli, 1991). In culture systems, type I interferons have been shown to inhibit different stages of the HIV life cycle, and IFNstrongly inhibits FIV replication in feline PBMC (Tanabe, 2001). HIV-1 has been shown to be able to block IFN-induced function through the Tat protein, which competitively binds PKR, and TAR RNA can block PKR activation (Sen, 2001). In HIV infection, the progressive loss of IFNhighly correlates with disease progression

PAGE 30

16 and the onset of opportunistic infections. Observations of HIV in the natural course of disease showed loss of interferon generation and low CD4+ T cell counts are required for opportunistic infections to occur. Preclinical and early clinical trials are underway using IFNto treat HIV (Jablonowski, 2003). Also, IFNis being investigated for use as a multiple cytokine therapeutic modality, particularly to counteract the increases in replication seen with use of proliferation-inducing cytokines. In vitro, combination treatment of IFNand IL-7 strongly inhibited HIV replication while preserving T cell numbers, increasing T cell proliferation and IFNproduction (Audige, 2005). Interferon-Producing Cells Recently, it was determined that the professional Type I IFN-producing cell type (IPC) is the previously identified plasmacytoid dendritic cell (Siegal, 1999). The hematological origin of these cells has been controversial, and it was determined that these cells express CD4 and MHC class II, and are negative for other lineage markers such as CD3 (T cells), CD19 (B cells), CD14 (monocytes), CD56 (NK cells) and CD11c (monocyte-derived type 1 dendritic cells). Manipulation and isolation of these cells was made difficult by their rarity (0.01% to 0.05% of PBMC) and rapid apoptosis in culture. These cells were found to be recruited in significant numbers to inflamed lymph nodes, and can be found in T cell areas and within germinal centers (Cella, 1999). IPCs are triggered by viruses and other pathogens, more specifically by CpG oligonucleotide binding to toll-like receptor (TLR) 9 (Colonna, 2002). In vitro, IPCs have been shown to become directly and productively infected with the HIV virus, and HIV infection triggers IFNsecretion and decreases viable cell numbers (Yonezawa, 2003; Lor, 2005; Schmitt, 2006). Interaction with HIV viral

PAGE 31

17 components triggers immature IPCs to mature, exhibit more cytoplasm with dendritic processes and express CD80 and CD86 (Yonezawa, 2003). IPC are induced to replicate the HIV virus upon ligation of CD40L, and can infect nave T cells in trans (Fong, 2002; Lor, 2005). Chronically HIV-infected patients have decreased numbers of IPCs in the peripheral blood, and lower CD4+ T cell counts correlated with decreased numbers of IPCs (Feldman, 2001). The progressive loss of functional IPCs in the circulation is correlated with increased viral load and the development of opportunistic infections and disease (Feldman, 2001; Siegal, 2003). Long-term survivors (at least ten years without signs of disease) were shown to have increased IPC number and function when compared to HIV-infected subjects with progressive disease or AIDS (Soumelis, 2001). Given the very recent developments characterizing this cell type, data concerning IPC infection with SIV or FIV is currently unavailable, since species-specific reagents remain to be generated.

PAGE 32

CHAPTER 3 DETERMINATION OF FELINE CYTOKINE SEQUENCES Introduction The ultimate objective of the study was identify significant changes in cytokine profiles within thymic tissue, therefore, identification of the sequences for the relevant cytokine mRNA was essential for future work. Most of the cytokines of interest in this study did not have published sequences in a review of GenBank at the onset of this project, so primers and probes for the cytokine sequences could not be developed for real time reverse transcription-polymerase chain reaction (RT-PCR) experiments. In the present experiment, we report the full length complementary DNA (cDNA) sequences for feline IL-4, IL-7, IL-15, IFNand IFN-. Materials and Methods Primer Design Oligonucleotide primers were designed based on consensus DNA sequences that were currently available for other species in order to amplify the cytokine sequences using the polymerase chain reaction (PCR). When possible, a nested PCR reaction was desired in order to reduce nonspecific sequence amplification. So, for IFN-, IL-4 and IL-15, a set of primers (forward 1/reverse 1) was designed at a distance outside the coding region for a first round of PCR, then followed by a second reaction using forward 2/reverse 2 primers that included start and stop codon sequences. IL-7 and IFNwere amplified using a single set of primers. Desired amplification products would include the entire coding region that was present in the mRNA. In addition, an oligonucleotide probe 18

PAGE 33

19 was designed that would anneal within the coding region. Expected product lengths were also predicted: IFN(538 base pairs, bp), IFN(515 bp), IL-4 (406 bp), IL-15 (499 bp), and IL-7 (835 bp). Table 3-1. Oligonucleotide primers and probes used for nested PCR protocols. IFNforward ATG GCG CTG CCC TCT TCC TTC TTG GTG GCC IFNprobe CTG GGA CAA ATG AGG AGA CTC IFNreverse TCA TTT CTC GCT CCT TAA TCT TTT CTG CAA IFNforward 1 CTA CTG ATT TCA ACT TCT IFNforward 2 GAA ACG ATG AAT TAC ACA AGT TTT IFNprobe CAT TTT GAA GAA CTG GAA A IFNreverse 1 CAA ATA TTG CAG GCA GGA IFNreverse 2 CAA CCA TTA TTT CGA TGC TCT ACG IL-4 forward 1 TGC ATC GTT AGC KTC TCC T IL-4 forward 2 TTA ATG GGT CTC ACC TCC CAA CTG ATT CC IL-4 probe ACT TCT TGG AAA GGC TAA A IL-4 reverse 1 TTA GAK TCT ATA TAT AYT WTA T IL-4 reverse 2 GCT TCA ATG CCT GTA GTA TTT CTT CTG CAT IL-7 forward AAC TCC GCG GAA GAC CAG GGT IL-7 probe ATT TTA TTC CAA CAA GTT TT IL-7 reverse TTC AGT AAC TTC CAG GAG GCA TTC IL-15 forward 1 TGG ATG GAT GGC WGC TGG AA IL-15 forward 2 GAG TAA TGA GAA TTT CGA AAC CAC ATT TGA IL-15 probe GGC ATT CAT GTC TTC ATT TTG G IL-15 reverse 1 CTT CAT TTC YAA GAG TTC AT IL-15 reverse 2 TGC AAT CAA GAA GTG TTG ATG AAC ATT TGG Synthesis of cDNA Total RNA was extracted from frozen thymic tissue from a SPF kitten using a RNeasy Mini kit (QIAGEN, Valencia, CA, USA). RNA yield was quantified by spectrophotometry at an absorbance of 260nm. One microgram samples of extracted RNA were used to generate complementary DNA (cDNA) in a 20 l synthesis reaction using random hexamer primers (First Strand cDNA Synthesis Kit, Roche, Indianapolis, IN, USA).

PAGE 34

20 Amplification of Cytokine Sequences PCR amplification of each cytokine was performed in 50 l reaction mixtures containing 0.1 g of cDNA, 0.2 M of deoxynucleotide mixture, 5 l reaction buffer (1.5 mM MgCl 2 ), 0.2 M of each oligonucleotide primer and 2.5 U of Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA). After an initial denaturation cycle at 94C for 1 minute, PCR amplification was carried out at 92C for 30 seconds, 55C for 30 seconds, and 72C for 90 seconds for 30 cycles. A final elongation step was performed at 72C for 5 minutes, then the samples were cooled to 4C. Construction and Use of a Plasmid Containing Cytokine Sequence Inserts The commercially available pCR-Blunt II-TOPO plasmid (Invitrogen, Carlsbad, CA, USA) was selected for its suitability for accepting blunt ended PCR products. The 6l cloning reaction was performed according to manufacturers instructions and contained 1 l salt solution (1.2 M NaCl, 0.06 M MgCl 2 ), 1l TOPO vector and 4 l of fresh PCR product. The reaction mixture was gently mixed, incubated at room temperate for 5 minutes and then cooled on ice. A vial of One Shot Chemically Competent E. coli cells (Invitrogen, Carlsbad, CA, USA) was thawed on ice, 4 l of the plasmid reaction mixture was added and allowed to incubate on ice for 5 minutes. Cells were then heat-shocked in a 42C water bath for 30 seconds, then the tubes were returned to the ice. A 250 l aliquot of room temperature SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2 10 mM MgSO 4 20 mM glucose) was added, and the tubes were then incubated at 37C for one hour. A 125 l sample of this solution was spread on a pre-warmed selective Luria-Bertani (LB) plates (with kanamycin, 50 g/ml). Plates were incubated at 37C overnight then screened for bacterial colonies.

PAGE 35

21 To screen colonies for the plasmids which contained cytokine sequences, direct inoculation of PCR reaction mixtures with bacteria was performed using a sterile toothpick. Two PCR reactions were prepared using the forward and reverse primers, and using the probe oligonucleotide as a forward primer in conjunction with the reverse primer. PCR was performed in 50 l reaction mixtures containing 0.2 M of deoxynucleotide mixture, 5 l reaction buffer (1.5 mM MgCl 2 ), 0.2 M of each oligonucleotide primer and 2.5 U of Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA). After an initial denaturation cycle at 94C for 1 minute, PCR amplification was carried out at 92C for 30 seconds, 55C for 30 seconds, and 72C for 90 seconds for 30 cycles. A final elongation step was performed at 72C for 5 minutes, then the samples were cooled to 4C. PCR products were visualized by electrophoresis in 1% agarose gel stained with ethidium bromide. Colonies were considered positive for the appropriate cytokine sequence if two PCR reactions gave bands of the expected size when amplified. Positive colonies were used to inoculate 10 ml of LB broth. After incubation of the broth overnight at 37C, bacteria were harvested by centrifugation at 6000 x g and 4C for15 minutes. Plasmid DNA was isolated and purified using the QIAGEN Plasmid Mini kit (Qiagen, Santa Clarita, CA, USA). Plasmid DNA samples were sent to the Genome Sequencing Service Laboratory, University of Florida. Sequence data was used to perform a nucleotide-nucleotide search through the Basic Local Alignment Search Tool (BLAST), available from the National Center for Biotechnology Information (NCBI).

PAGE 36

22 Results Plasmid Construction Amplified DNA was cloned into the pCR-Blunt II-TOPO plasmid. Transformation reactions produced a very low yield of number of colonies produced (0-3 colonies per plate). PCR screening reactions using direct inoculation from bacterial colonies gave ample amplification, and positive colonies were identified containing inserts for IFN-, IFN-, IL-4, IL-7 and IL-15 as shown in Figures 3-1, 3-2, 3-3 and 3-4. Figure 3-1. Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IFNinsert. Lanes 3-5: Vector-specific M13 primers. Lane 6, IFNforward/reverse primers. Lane 7, IFNprobe/reverse primers.

PAGE 37

23 Figure 3-2. Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IFNinsert. Lane 8, IFNforward/reverse primers. Lane 9, IFNprobe/reverse primers. Figure 3-3. Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing feline IL-4 and IL-15 inserts. Row 1: Lanes 3-4: Vector-specific M13 primers. Lane 6, IL-4 forward/reverse primers. Lane 7, IL-4 probe/reverse primers. Row 2: Lanes 3-4: Vector-specific M13 primers. Lane 6, IL-15 forward/reverse primers. Lane 7, IL-15 probe/reverse primers.

PAGE 38

24 Figure 3-4. Ethidium bromide-stained agarose gel of polymerase chain reaction products from colonies transformed with plasmid containing a feline IL-7 insert. Lane 5, IL-7 forward/reverse primers. Lane 6, IL-7 probe/reverse primers. Feline Cytokine cDNA sequences Sequences were obtained for all 5 of the investigated cytokines, as shown in Figures 3-5, 3-6, 3-7, 3-8 and 3-9. 1 CAGAATTCGC CCTTGAAACG ATGAATTACA CAAGTTTTAT TTTCGCTTTC 51 CAGCTTTGCA TAATTTTGTG TTCTTCTGGT TATTACTGTC AGGCCATGTT 101 TTTTAAAGAA ATAGAAGAGC TAAAGGGATA TTTTAATGCA AGTAATCCAG 151 ATGTAGCAGA TGGTGGGTCG CTTTTCGTAG ACATTTTGAA GAACTGGAAA 201 GAGGAGAGTG ATAAAACAAT AATTCAAAGC CAAATTGTCT CCTTCTACCT 251 GAAAATGTTT GAAAACCTGA AAGATGATGA CCAGCGCATT CAAAGGAGCA 301 TGGACACCAT CAAGGAAGAC ATGCTTGATA AGTTGTTAAA TACCAGCTCC 351 AGTAAACGGG ATGACTTCCT CAAGCTGATT CAAATCCCTG TGAATGATCT 401 GCAGGTCCAG CGCAAAGCAA TAAATGAACT CTTCAAAGTG ATGAATGATC 451 TCTCACCAAG ATCTAACCTG AGGAAGCGGA AAAGGAGCCA GAATCTGTTT 501 CGAGGCCGTA GAGCATCGAA ATAATGGTTG AAGGGCGAAT TCCAGCACA Figure 3-5. Full length nucleotide sequence of the feline IFNcDNA. The start and stop codons of the open reading frame are highlighted in bold/red.

PAGE 39

25 1 GTGTGCTGGA ATTCGCCCTT ATGGCGCTGC CCTCTTCCTT CTTGGTGGCC 51 CTGGTGGCGC TGGGCCGCAA CTCCGTCTGC TCTCTGGGCT GTGACCTGCC 101 TCAGACCCAC GGCCTGCTGA ACAGGAGGGC CTTGACGCTC CTGGGACAAA 151 TGAGGAGACT CCCTGCCAGC TCCTGTCAGA AGGACAGGAA TGACTTCGCC 201 TTCCCCCAGG ACGTGTTCGG TGGAGACCAG TCCCACAAGG CCCAAGCCCT 251 CTCGGTGGTG CACGTGACGA ACCAGAAGAT CTTCCACTTC TTCTGCACAG 301 AGGCGTCCTC GTCTGCTGCT TGGAACACCA CCCTCCTGGA GGAATTCTGC 351 ACGGGACTTG ATCGGCAGCT GACCCGCCTG GAAGCCTGTG TCGTGCAGGA 401 GGTGGGGGAG GGAGAGGCTC CCCTCACGAA CGAGGACTCC CTCCTGAGGA 451 ACTACTTCCA AAGACTCTCC CTCTACCTGC AAGAGAAGAA ATACAGCCCT 501 TGTGCCTGGG AGATCGTCAG AGCAGAAATC ATGAGATCCT TGTATTCGTC 551 AACAGCCTTG CAGAAAAGAT TAAGGAGCGA GAAATGAAAG GGCGAATTCT 601 GCAGATAT Figure 3-6. Full length nucleotide sequence of the feline IFNcDNA. The start and stop codons of the open reading frame are highlighted in bold/red.

PAGE 40

26 1 CTTCCGGCTC CGCCCTTTTA ATGGGTCTCA CCTCCCAACT GATTCCAGCT 51 CTGGTCTGCT TACTAGCATT TACCAGCACC TTCGTCACGG CCAGAACTTC 101 AATAATACGT TGAAAGAGAT CATCAAAACG TTGAACATCC TCACAGCGAG 151 AAACGACTCG TGCATGGAGC TGGCCGTCAT GGACGTCTTG GCAGCCCCTA 201 AGAACACAAG TGACAAGGAA ATCTTCTGCA GAGCCACAAC CGTGCTCCGG 251 CAGATCTATA CACATCACAA CTGCTCCACC AAATTCCTCA AAGGACTCGA 301 CAGGAACCTC AGCAGCATGG CAAACAGGAC CTGTTCCGTG AATGAAGACA 351 AGAAGTGTAC ACTGAAAGAC TTCTTGGAAA GGCTAAAAGC GATCATGCAG 401 AAGAAATACT ACAGGTATTG AAGCAAGGGC GAATTCTGCA GATAT Figure 3-7. Full length nucleotide sequence of the feline IL-4 cDNA. The start and stop codons of the open reading frame are highlighted in bold/red.

PAGE 41

27 1 CAGTGTGCTG GAATTCGCCC TTGCCCATGT TCCATGTTTC TTTTAGGTAT 51 ATCTTTGGAA TTCCTCCCCT GATCCTTGTT CTGTTGCCAG TAGCATCATC 101 TGATTGTGAT ATTGAAGGTA AAGACGGAAG AGAATATCAG CACATTCTAA 151 TGATCAGCAT CAATTACTTG GACACCATGA TAAAAAATCG TACCAATTGC 201 CCGAATAATG AACCTAACGT TTTTAAAAAA CATGCATGTG ATGATAATAA 251 GGAAGCTGTG TTTTTATATC GTGCTGCTCA CAAGTTGAAG CACTTTGTCA 301 AAGTGAATAA CAGTGAGGAA TTCAATCTCC ACTTATCAAG AGTTTCACAG 351 GGCATGTTAC AGTTGTTGAA CTGTACCCCC AAGGAAGACA GCAAATCTTT 401 AAAGGAACAG AGAAAACAGA AGAGCTTGTG TTTTCTAGGG ATACTACTAC 451 AAAAGATAAA AACTTGTTGG AATAAAATTT TGAGGGGCAC TAAAGAACAC 501 TGAAAAATAT GGAGAAGGGC GAATTCT Figure 3-8. Full length nucleotide sequence of the feline IL-7 cDNA. The start and stop codons of the open reading frame are highlighted in bold/red.

PAGE 42

28 1 AGTGTGCTGG AATTCGCCCT TGAGTAATGA GAATTTCGAA ACCACATTTG 51 AGAAGTACTT CCATCCAGTG CTACTTGTGT TTACTTCTGA ACAGCCATTT 101 TTTAACTGAA GCTTGCATTC CTGTCTTCAT TTTGAGCTGT ATCAGTGCAG 151 GTCTTCCTAA AACAGAGGCA AACTGGCAGG ATGTAATAAG TGATTTGAAA 201 ATAATTGACA AGATTATTCA ATCCTTACAT ATCGATGCCA CTTTATATAC 251 TGAAAGTGAT GTTCATCCCA ATTGCAAAGT AACAGCGATG AAGTGCTTTC 301 TCCTGGAGTT ACATGTTATT TCGCTTGAGT CCAAAAATGA GACCATTCAT 351 CAAACAGTAG AAAACATTAT TATCCTGGCA AACAGTGGTT TATCTTCTAA 401 CAGGAATATA ACTGAAACAG GATGCAAAGA ATGTGAGGAA CTGGAGGAAA 451 AGAACATTAA AGAATTTCTG CAGAGTTTTG TACATATTGT ACAAATGTTC 501 ATCAACACTT CTTGATTGCA AAGGGCGAAT TCTGCAGATAT Figure 3-9. Full length nucleotide sequence of the feline IL-15 cDNA. The start and stop codons of the open reading frame are highlighted in bold/red. Basic Local Alignment Search Tool (BLAST) comparisons were made for the sequenced cytokines. The nucleotide sequence obtained for feline IFNis 100% identical to reported sequences for the feline cytokine (Argyle, 1995). The feline sequence exhibits 89% homology to that of the dog (Canis familiaris), 88% homology to the Eurasian badger (Meles meles), and 83-84% homology to horse (Equus caballus), the steer (Bos taurus), the Bactrian camel (Camelus bactrianus) and the sheep (Ovis aries), and 80% homology to the pig (Sus scrofa). The idenitifed IFNnucleotide sequence exhibited 96-99% similarity to several different reported feline IFNsequences (Nagai, 2004). The feline sequence also has 81-87% homology to that of the horse IFN-, 78% homology to the dog, and 82-91% homology to various fragments of human interferon sequences.

PAGE 43

29 The feline IL-4 nucleotide sequence demonstrates 98% homology to reported feline IL-4 sequences (Schijns, 1995, direct PubMed submission). Feline IL-4 cDNA exhibits 88% homology to canine IL-4, 84% homology to the bovine sequence, 82% homology to the pig and the horse, and 80% to the Bactrian camel. The nucleotide sequence for feline IL-7 cDNA has not been previously reported. The feline IL-7 sequence was most homologous to that of the pig and the sheep (87%), followed by the steer (86%), the rhesus monkey (Macaca mulatta) (85%), and humans (84%). The sequence for feline IL-15 cDNA exhibits 98% homology to sequences from a recent report (Dean, 2005). It also demonstrates homology to the IL-15 sequences of the horse (89%), human (88%), the steer (87%) and the dog (87%). Discussion The cDNA sequences for feline cytokines were successfully amplified by PCR, cloned using a bacterial plasmid system and confirmed by DNA sequencing. The full length transcripts are isolated in plasmid-containing bacteria for rapid access in any future experiments by our laboratories that require expression of the feline protein.

PAGE 44

CHAPTER 4 MEASUREMENT OF FIV GAG MESSENGER RNA AND DNA, AND IL-4, IL-7, IL-15, IFN-ALPHA AND INTERFERON-GAMMA MESSENGER RNA LEVELS IN THE THYMUSES OF CATS NEONATALLY INFECTED WITH FIV Introduction Cytokine expression tends to be low in tissues and cell samples under investigation, and real-time reverse-transcription (RT)-PCR has proven to be the most sensitive, reproducible, rapid and accurate technique available for mRNA quantitation. As tissue samples are often too small to evaluate cytokines at the protein level, real-time RT-PCR using fluorogenic probes has become the standard method of choice in investigating tissue cytokine profiles (Blaschke, 2000; Giulietti, 2001; Rajeevan, 2001; Yin, 2001; Overbergh, 2003). While mRNA expression in the tissues may not definitively reflect the ultimate cytokine protein levels, analyses comparing mRNA expression relative to tissue protein content have demonstrated good correlation (Blaschke, 2000; Hein, 2001). Using the previously derived cDNA sequences for the feline cytokines (Chapter 3) and sequence map for JSY3 (the molecular clone of FIV used in the infected animal groups), primers and probes were generated for use in a real-time RT-PCR protocol. Real-time RT-PCR was used to determine the RNA levels for IL-4, IL-7, IL-15, IFN-, IFNand FIV gag, and the proviral load of FIV gag DNA. The current chapter describes cytokine changes that exist for the different age groups and as a result of FIV infection; Chapter 5 discusses the statistical correlations between the cytokine changes and the changes that were observed in thymus cell subpopulations and viral levels. 30

PAGE 45

31 Materials and Methods Quantitative Real-Time PCR for Feline Cytokine mRNA. Cats with acute (6-8 weeks), 12 week, and chronic (>16 weeks) neonatal FIV infection (infected at birth) were identified from previous studies. Total RNA was extracted from thymic samples, which had been frozen at -80C (RNeasy Midi Kit, Qiagen Inc., Valencia, CA). RNA concentration and purity was determined by UV spectrophotometer (A 260 /A 280 ). RNA samples were treated with DNase I (Sigma, St. Louis, MO, USA). One microgram samples of extracted RNA were used to generate complementary DNA (cDNA) in a 20 l synthesis reaction using random hexamer primers (First Strand cDNA Synthesis Kit, Roche, Indianapolis, IN, USA). Feline G3PDH was selected as the housekeeping gene for normalization of cytokine mRNA content. The cytokine primers, feline G3PDH primers, and corresponding Taqman probes were designed using Primer Express software (PE Applied Biosystems, Foster City, CA) (Table 4-1). Real-time RT-PCR analyses were conducted using the PRISM 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA), utilizing a 25-l reaction volume of PCR Universal Master Mix (PE Applied Biosystems, Foster City, CA) containing ~ 100-200 ng of cDNA 900 nM of each gag and G3PDH primer, and 125 nM of the TaqMan probes. The standard curve was generated by PCR on serial dilutions of a thymic cDNA sample from a selected 6 week-old, FIV-infected animal. All samples and the serial dilutions of the standards were assayed in triplicate. For all samples, target quantity was determined from the standard curve and divided by the target quantity of a calibrator, a 1sample. All other quantities were expressed as an n-fold difference relative to the calibrator, and the same calibrator thymic sample was used

PAGE 46

32 for all cytokine experiments. The relative feline cytokine gene transcription products were expressed as the ratio of cytokine mRNA to G3PDH mRNA content. Quantitative Real-Time PCR for FIV Provirus. Genomic DNA was extracted (QIAamp DNA Mini Kit, Qiagen Inc., Valencia, CA) from thymic samples. Resulting DNA concentration and purity was determined by UV spectrophotometer (A 260 /A 280 ). The gag primers, feline G3PDH primers, and corresponding Taqman probes were designed using Primer Express software (PE Applied Biosystems, Foster City, CA) (Table 4-1). PCR analyses were conducted using the PRISM 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA), utilizing a 25-l reaction volume of PCR Universal Master Mix (PE Applied Biosystems) containing ~ 100-200 ng of DNA, 900 nM of each gag and G3PDH primer, and 125 nM of the TaqMan probes. The standard curve was generated by PCR on serial dilutions of a cDNA containing the JSY3 gag sequence and feline G3PDH. All samples and the serial dilutions of the standards were assayed in triplicate. For all samples, the target quantity was determined from the standard curve and divided by the target quantity of a calibrator, a 1sample. All other quantities were expressed as an n-fold difference relative to the calibrator. The relative FIV provirus content was expressed as the ratio of FIV gag DNA to G3PDH DNA content. Quantitative Real-Time PCR for FIV Transcription. Total RNA was extracted (RNeasy Midi Kit, Qiagen Inc., Valencia, CA) from thymic samples. RNA concentration and purity was determined by UV spectrophotometer (A 260 /A 280 ). Reverse transcription was performed by use of the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, Foster City, CA) utilizing ~ 0.5 g RNA and 3 reverse gag specific primer with the following cycling

PAGE 47

33 conditions: 75C for 5 min, 42C for 1 hour, 95C for 5 minutes, and 4C for 5 minutes. Real-time RT-PCR analyses were conducted using the PRISM 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA), utilizing a 25-l reaction volume of PCR Universal Master Mix (PE Applied Biosystems, Foster City, CA) containing ~ 100-200 ng of cDNA 900 nM of each gag and G3PDH primer, and 125 nM of the TaqMan probes. The standard curve was generated by PCR on serial dilutions of a cDNA containing the JSY3 gag sequences and feline G3PDH. All samples and the serial dilutions of the standards were assayed in triplicate. For all samples, target quantity was determined from the standard curve and divided by the target quantity of a calibrator, a 1sample. All other quantities were expressed as an n-fold difference relative to the calibrator. The relative FIV gag gene transcription products were expressed as the ratio of FIV gag RNA to G3PDH mRNA content.

PAGE 48

34 Table 4-1. Primers and probes used for real-time RT-PCR. IL-4 forward primer TTC ACG GAA CAG GTC CTG TTT IL-4 reverse primer TGC TCC ACC AAA TTC CTC AAA IL-4 probe 6FAM-CCA TGC TGC TGA GGT TCC TGT CGA-TAMRA IL-7 forward primer GCC CTG TGA AAC TCT TGA TAA GTG IL-7 reverse primer TCG TGC TGC TCA CAA GTT GAA IL-7 probe 6FAM-AGA TTG AAT TCC TCA CTG TTA TTC ACT TTG ACA AAG TG-TAMRA IL-15 forward primer AAC TGA AGC TTG CAT TCC TGT CT IL-15 reverse primer TCC TGC CAG TTT GCC TCT GT IL-15 probe 6FAM-CAT TTT GAG CTG TAT CAG TGC AGG TCT TCC TAA-TAMRA IFN-alpha forward primer TCC GGT GGA GAC CAG TCC C IFN-alpha reverse primer TTC TGG TTC GTC ACG TGC A IFN-alpha probe 6FAM-CAA GGC CCA AGC CCT CTC GGT G-TAMRA IFN-gamma forward primer ATG ATG ACC AGC GCA TTC AA IFN-gamma reverse primer TTT ACT GGA GCT GGT ATT TAA CAA CTT ATC IFN-gamma probe 6FAM-AGC ATG GAC ACC ATC AAG GAA GAC ATG C-TAMRA FIV gag forward primer AGCCCTCCACAGGCATCTC FIV gag reverse primer TGGACACCATTTTTGGGTCAA FIV gag probe 6FAM-ATT CAA ACA GCA AAT GGA GCA CCA CAA TAT G-TAMRA G3PDH forward primer CCATCAATGACCCCTTCATTG G3PDH reverse primer TGACTGTGCCGTGGAATTTG G3PDH probe 6FAM-CTC AAC TAC ATG GTC TAC ATG TTC CAG TAT GAT TCC-TAMRA Statistical Analysis Cytokine mRNA expression was analyzed for differences between the different age groups, and between infected animals as compared to the age matched controls. SAS PROC GLM was used to conduct the one-way ANOVA analysis; the least squares means were calculated and pair-wise group comparisons were conducted using SAS 9.1 (SAS Institute, Inc., Cary, NC). Values were considered statistically significant for analyses where P< 0.05.

PAGE 49

35 Results Interleukin (IL)-4 IL-4 mRNA levels were measured at three time points after neonatal infection with a pathogenic molecular clone of FIV (JSY3) (Table 4-2). Cytokine expression values were compared over time and against age-matched controls. P values from the comparisons are summarized in Table 4-3. Arithmetic means with the corresponding standard deviations are graphically represented in Figure 4-1. The only group of animals demonstrating statistically significant differences in IL-4 expression was the uninfected >16-week-old control group. Uninfected >16-week-old cats had higher IL-4 mRNA expression than the infected animals (P = 0.01), but also expressed IL-4 at a higher level than younger animals that werent infected. This suggests that IL-4 becomes more active within the thymus as the animal matures to the subadult age group, and that this activity level is suppressed by pathogenic FIV infection (3.8-fold less IL-4 expression in infected animals).

PAGE 50

36 Table 4-2. Relative IL-4 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample. Animal group Arithmetic mean with standard deviation 1 6-8-week-old cats, uninfected (n=5) 0.77 0.37 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 0.7 0.26 3 12-week-old cats, uninfected (n=2) 1.94 0.91 4 12-week-old cats, FIV-infected (JSY3) (n=5) 2.53 0.97 5 >16-week-old cats, uninfected (n=3) 6.59 8.08 a 6 >16-week-old cats, FIV-infected (JSY3) (n=8) 1.74 1.23 a: Statistically significant difference from infected and uninfected 6-8week-old groups, 12-week-old infected cats, and >16-week-old infected cats (P < 0.05). Table 4-3. P values from pairwise comparison of IL-4 levels, animal groups 1-6 from Table 4-2. 1 2 3 4 5 6 1 0.96 0.59 0.29 0.005 0.44 2 .96 0.57 0.27 0.005 0.41 3 .59 0.57 0.79 0.06 0.99 4 .29 0.27 0.79 0.04 0.29 5 0.005 0.06 0.04 0.01 6 .44 0.41 0.99 0.68 0.01 0 0 0 0.005 0

PAGE 51

37 Interleukin-4JSY3>16 wksUninfected>16 wksJSY312 wksUninfected 12 wksJSY36-8 wksUninfected 6-8 wks0246810121416Relative gene expression Figure 4-1. Measurement of relative IL-4 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*) denotes statistically significant from infected and uninfected 6-8-week-old groups, 12-week-old infected cats, and >16-week-old infected cats (P < 0.05). Interleukin-7 IL-7 mRNA levels were measured at three time points after neonatal infection with a pathogenic molecular clone of FIV (JSY3) (Table 4-4). Cytokine expression values were compared over time and against age-matched controls. P values from the comparisons are summarized in Table 4-5. Arithmetic means with the corresponding standard deviations are graphically represented in Figure 4-2. IL-7 mRNA exhibited a similar pattern of expression as IL-4 in the animal groups examined. Older (>16 weeks) uninfected animals showed a higher level of expression of IL-7 than younger animals and cats infected with FIV (6.3-fold more IL-7 is present in uninfected controls). This findings suggest that IL-7 is upregulated within that thymus as the animals mature, but that this effect is suppressed with FIV infection (P = 0.003).

PAGE 52

38 Table 4-4. Relative IL-7 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample. Animal group Arithmetic mean 1 6-8-week-old cats, uninfected (n=5) 2.24 2.88 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 0.79 0.54 3 12-week-old cats, uninfected (n=2) 1.09 0.4 4 12-week-old cats, FIV-infected (JSY3) (n=5) 2.52 1.93 5 >16-week-old cats, uninfected (n=3) 8.02 8.42 a 6 >16-week-old cats, FIV-infected (JSY3) (n=8) 1.27 1.17 a: statistically significant difference from all other animal groups in study (P < 0.05) Table 4-5. P values from pairwise comparison of IL-7 levels, animal groups 1-6 from Table 4-4. 1 2 3 4 5 6 1 0.4 0.66 0.88 0.02 0.59 2 0.84 0.32 0.003 0.68 3 .66 0.84 0.58 0.02 0.92 4 .88 0.32 0.58 0.02 0.49 5 0.02 0.003 0.02 0.02 0.003 6 .59 0.68 0.93 0.49 0.003 0.4 0 0 0

PAGE 53

39 Interleukin-7JSY3>16 wksUninfected>16 wksJSY312 wksUninfected 12 wksJSY36-8 wksUninfected6-8 wks024681012141618Relative gene expression Figure 4-2. Measurement of relative IL-7 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). Interleukin-15 IL-15 mRNA levels were measured at three time points after neonatal infection with a pathogenic molecular clone of FIV (JSY3) (Table 4-6). Cytokine expression values were compared over time and against age-matched controls. P values from the comparisons are summarized in Table 4-7. Arithmetic means with the corresponding standard deviations are graphically represented in Figure 4-3. IL-15 was slightly upregulated in FIV-infected animals at 12 weeks of age as compared to infected 6-8-week-old infected animals (P = 0.004) and >16-week-old infected animals (P = 0.06). However, this appears to be due to a physiological trend for IL-15 upregulation at this age, as IL-15 levels are not statistically different from 12-week-old age-matched control cats (P = 0.36). IL-15 mRNA expression in infected animals also does not differ significantly from age-matched controls at other time points (6-8 weeks, P = 0.59; >16 weeks, P = 0.12).

PAGE 54

40 Table 4-6. Relative IL-15 mRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample. Animal group Arithmetic mean 1 6-8-week-old cats, uninfected (n=5) 1.26 0.74 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 1.56 0.78 3 12-week-old cats, uninfected (n=2) 2.93 0.51 4 12-week-old cats, FIV-infected (JSY3) (n=5) 3.77 1.95 5 >16-week-old cats, uninfected (n=3) 1.4 0.43 6 >16-week-old cats, FIV-infected (JSY3) (n=8) 2.33 0.96 Table 4-7. P values from pairwise comparison of IL-15 levels, animal groups 1-6 from Table 4-6. 1 2 3 4 5 6 1 0.59 0.07 0.001 0.87 0.04 2 .59 0.15 0.004 0.77 0.13 3 .07 0.15 0.36 0.12 0.66 4 0.001 0.004 0.36 0.006 0.06 5 0.87 0.77 0.12 0.006 0.12 6 .04 0.13 0.66 0.06 0.12 0 0 0

PAGE 55

41 Interleukin-15JSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks01234567Relative gene expression Figure 4-3. Measurement of relative IL-15 mRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). Interferon (IFN)IFNmRNA levels were measured at three time points after neonatal infection with a pathogenic molecular clone of FIV (JSY3) (Table 4-8). Cytokine expression values were compared over time and against age-matched controls. P values from the comparisons are summarized in Table 4-9. Arithmetic means with the corresponding standard deviations are graphically represented in Figure 4-4. Again, mRNA levels for IFNdemonstrates a physiological upregulation at the >16 week time point similar to the trends observed for IL-4 and IL-7. IFNvalues are statistically higher in >16-week-old animals than all other animal groups (Tables 4-9). This heightened expression level is abrogated by infection with FIV (P = 0.01), and infected animals express IFNat a level 4.5 times less than uninfected controls.

PAGE 56

42 Table 4-8. Relative IFNmRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample. Animal group Arithmetic mean 1 6-8-week-old cats, uninfected (n=5) 3.22 5.89 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 2.12 2.08 3 12-week-old cats, uninfected (n=2) 1.14 1.38 4 12-week-old cats, FIV-infected (JSY3) (n=5) 4.11 1.78 5 >16-week-old cats, uninfected (n=3) 13.07 15.14 a 6 >16-week-old cats, FIV-infected (JSY3) (n=8) 2.9 1.91 a: statistically significant difference from all other animal groups in study (P < 0.05) Table 4-9. P values from pairwise comparison of IFNlevels, animal groups 1-6 from Table 4-8. 1 2 3 4 5 6 1 0.7 0.66 0.8 0.02 0.94 2 0.88 0.52 0.01 0.72 3 .66 0.88 0.52 0.03 0.68 4 0.8 0.52 0.52 0.04 0.72 5 0.01 6 .94 0.72 0.68 0.72 0.01 0.7 0 0.02 0.01 0.03 0.04 0

PAGE 57

43 Interferon-gammaJSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks051015202530Relative gene expression Figure 4-4. Measurement of relative IFNmRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). InterferonIFNmRNA levels were measured at three time points after neonatal infection with a pathogenic molecular clone of FIV (JSY3) (Table 4-10). Cytokine expression values were compared over time and against age-matched controls. P values from the comparisons are summarized in Table 4-11. Arithmetic means with the corresponding standard deviations are graphically represented in Figure 4-5. The pattern of mRNA expression observed for IFNwas similar to that of IL-4, IL-7 and IFN-, both over time and in response to infection. Uninfected animals greater than 16 weeks of age demonstrated a higher cytokine expression level than all other animal groups (Tables 4-10 and 4-11). Chronically infected animals (>16-week-old cats) exhibited 148.7-fold less thymic IFNmRNA expression than uninfected age-matched

PAGE 58

44 controls (P = 0.0003). Pair-wise comparisons of all others groups were not statistically significant. Table 4-10. Relative IFNmRNA concentration in thymic samples, as expressed as n-fold difference to a calibrator sample. Animal group Arithmetic mean 1 6-8-week-old cats, uninfected (n=5) 306.24 608.32 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 2.74 1.99 3 12-week-old cats, uninfected (n=2) 35.04 31.08 4 12-week-old cats, FIV-infected (JSY3) (n=5) 302.12 641.95 5 >16-week-old cats, uninfected (n=3) 1773.81 1533.36 a 6 >16-week-old cats, FIV-infected (JSY3) (n=8) 11.93 31.94 a: statistically significant difference from all other animal groups in study (P < 0.05) Table 4-11. P values from pairwise comparison of IFNlevels, animal groups 1-6 from Table 4-10. 1 2 3 4 5 6 1 0.43 0.59 0.99 0.003 0.4 2 0.43 0.95 0.44 0.0005 0.98 3 0.59 0.95 0.6 0.004 0.96 4 0.99 0.44 0.6 0.003 0.41 5 0.003 0.0005 0.004 0.003 0.00036 0.4 0.98 0.96 0.41 0.0003

PAGE 59

45 Interferon-alphaJSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks0500100015002000250030003500Relative gene expression Figure 4-5. Measurement of relative IFNmRNA expression in thymic samples of FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). Viral Transcription (FIV gag RNA) and Proviral Load (FIV gag DNA) FIV gag RNA and DNA levels were measured for all thymus samples from the previous cytokine studies, using the same real time RT-PCR protocol. Arithmetic means with standard deviations are tabulated in Table 4-12 and graphically represented in Figures 4-6 (RNA) and 4-7 (DNA). All cats from age-matched control groups had undetectable levels of gag RNA and DNA, as expected for uninfected animals. There was a great deal of variability for levels of FIV gag RNA between cats of the same age group, exemplified by large standard deviation values. The trend of higher viral gene expression levels over time was present but not statistically significant (one-way ANOVA, P = 0.64). While overall the variability in proviral load in cats of older age groups was lower than viral gene expression, statistically significant changes in thymic gag content were not observed (one-way ANOVA, P = 0.85).

PAGE 60

46 Table 4-12. Relative viral gag RNA expression and viral DNA loads within feline thymic samples as measured with real time RT-PCR. Animal group Arithmetic mean gag RNA Arithmetic mean gag DNA 1 6-8-week-old cats, uninfected (n=2) ND ND 2 6-8-week-old cats, FIV-infected (JSY3) (n=5) 5.19 6.27 0.21 0.44 3 12-week-old cats, uninfected (n=2) ND ND 4 12-week-old cats, FIV-infected (JSY3) (n=2) 9.15 12.94 0.005 0.005 5 >16-week-old cats, uninfected (n=3) ND ND 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 11.57 13.31 0.02 0.03 ND = Not detected, value of 0 Thymic Gag RNA>16 wks12 wks6-8 wks051015202530Relative gene expression Figure 4-6. Measurement of relative viral gag RNA expression by real time RT-PCR in thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time points after neonatal infection.

PAGE 61

47 Thymic Gag DNA>16 wks12 wks6-8 wks00.10.20.30.40.50.60.7Relative DNA content Figure 4-7. Measurement of relative viral gag DNA content by real time RT-PCR in thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time points after neonatal infection. Discussion Of the cytokines evaluated in the present study, four of the five (IL-4, IL-7, IFNand IFN-) demonstrated a physiologic upregulation by 16 weeks of age as compared to the 6-8-week and 12-week age groups. This peak in normal cytokine activity was depressed in the course of FIV infection, and for IL-4, IL-7 and IFNthere was a 4-6 fold difference in mRNA expression between the uninfected and infected animals. A similar but much more pronounced pattern also existed for IFN, with uninfected animals exhibiting a 149-fold greater expression of IFNtranscripts than FIV-infected animals. For the fifth cytokine, IL-15, there was a slight, non-statistically significant physiologic increase in expression levels around 12 weeks of age when compared to the 6-8-week and >16-week-old uninfected animal groups. While the values for IL-15 were

PAGE 62

48 higher for infected animals at every time point, none of the groups reached statistical significance for the virally-induced increases. The cytokines of this study are known to be elaborated by a diverse host of immune system cells. While IL-4 and IFNare generally synthesized by activated T cells in the process of the immune response, IL-7 is generated by dendritic cells/stromal cells, IFNby virus-infected cells and at much higher levels by plasmacytoid dendritic cells (PDC; also referred to as interferon-producing cells, IPC) and IL-15 is produced by monocyte/macrophages, dendritic cells and stromal cells. Therefore, the observed increases in most cytokine activity do not appear to be as a result of a change in a single thymic cellular subpopulation, and these findings may reflect a generalized increase in thymopoietic activity in this age group. The particularly robust increase in IFNexpression after 16 weeks of age could potentially reflect an expansion in the thymic subpopulation of Type II dendritic cells (PDC) and a rise in intrathymic innate immunity. As mentioned previously, four of the five cytokines were decreased in infected animals over 16 weeks of age, reflecting a suppression of the peak in physiological cytokine activity that was observed in the age-matched control animals. This may reflect a viral influence on overall mRNA expression in multiple cell types, and the lack of IL-15 inhibition could indicate that the monocyte/macrophage cell lineage is not as susceptible to this virally-induced mRNA suppression at this stage in thymic FIV infection. The correlations between cytokine levels and thymic cellular subpopulations, and the ramifications of cytokine changes on viral replication, are examined in Chapter 5.

PAGE 63

CHAPTER 5 IMPACT OF CYTOKINE CHANGES ON FIV REPLICATION AND THYMIC CELLULAR COMPOSITION Introduction As published previously, neonatal infection of the thymus with FIV results in a reduction of thymus-body weight ratio, selective depletion of CD4+CD8+ thymocytes, cortical atrophy, infiltrations of B cells, formation of lymphoid follicles and deformation of the thymic architecture (Orandle, 1997; Orandle, 2000; Norway, 2001; Johnson, 2001). Archival tissue from these experiments was selected for pursuit of the present study. At the time of tissue collection, flow cytometry had been performed with antibodies against the cell markers CD4 and CD8, which vary in surface expression on thymocytes depending on their level of T cell maturation. Double-negative (CD4-CD8-) thymocytes represent the most immature cell population, are present within the superficial cortex, and represent recent emigrants from the bone marrow into the thymus. Double-positive (DP) ,or CD4+CD8+, thymocytes comprise the bulk of the normal developing thymocyte pool, move progressively throughout the thymic cortex to the medulla, and have not yet been restricted to a more mature lineage of single-positive (SP) CD4+ or CD8+ cells. SP CD4+ and CD8+ T cells are the population of cells ready to emigrate from the thymus after thymopoiesis is complete, or can indicate an influx of inflammatory cells from an ongoing infectious disease such as FIV infection. Several pathogenic indicators have been shown to reflect the impact of FIV on the thymus. FIV infection induces cortical atrophy largely through the depletion of the main 49

PAGE 64

50 thymocyte subpopulation, DP thymocytes. The mechanism for this cell loss is unclear. Previous studies have indicated a low incidence of direct infection of thymocytes by FIV (Woo, 1997; Hayes, 2000; Norway; 2001), so it appears that the unknown cause of cell death is due to alterations in the thymic microenvironment or indirect viral effects, such as apoptosis triggered by the viral envelope (Sutton, 2005). A relative increase in SP CD8+ cells and cells staining with a B cell marker correlates with the inflammatory infiltration of the tissue and the formation of germinal centers that are apparent upon histological evaluation. As these tissues were available from experiments that had been used to characterize the thymic pathogenesis of FIV infection, they were a good choice for regression analysis. Changes in cell populations already identified in infected tissue could be potentially correlated to alterations found in the cytokine profile and lead to a better understanding of the impact of cytokines and viral replication on thymopoiesis. Materials and Methods Profile of Thymocyte Subpopulations. The feline thymic tissue used for this cytokine research had been evaluated in previous studies investigating FIV pathogenesis in the thymus (Orandle, 1997; Crawford, 2001; Norway, 2001). Necropsy data and the results from flow cytometry experiments were compiled in order to establish larger groups than previously published, and to compare the changes in cell populations to the cytokine levels. Statistical Analysis Absolute cell counts and percentages of total thymocytes were used to identify the subpopulations of thymocytes. Comparisons between animal groups for cell numbers were conducted using Sigma Stat 3.0 (SPSS Inc., Chicago, IL). Changes in cytokine

PAGE 65

51 levels and viral loads and replication were subjected to regression analysis. Pairwise Pearsons correlations of the cellular data with cytokine levels and viral parameters were performed with SAS 9.1 (SAS Institute, Inc., Cary, NC). Tables were generated for values when P < 0.1, and correlations were considered statistically significant for analyses where P < 0.05. Results Enumeration of Thymocyte Subpopulations. The cell populations present in thymic tissue for infected animals and age-matched controls at 6-8 week, 12 week and >16 week age time points are summarized in Tables 5-1 through 5-4, and graphically represented in Figures 5-1 through 5-9. At 6-8 weeks of age, reductions in the total thymocyte number (P = 0.11) and increase in IgG+ cells (P = 0.06) due to FIV infection were not statistically significant. However, when looking at the individual cellular subsets within the tissue, a reduction in the major thymocyte population, double-positive (DP) CD4+CD8+ cells, is observed both as a percentage of total thymocytes (P = 0.04) and in absolute cell numbers (P = 0.05). The absolute number of immature DN thymocytes was unaffected with infection (P = 0.86). As an overall percentage of total thymocytes, single-positive (SP) CD4+ cells is unaffected (P = 0.37); but absolute numbers of CD4+ cells are in fact decreased (P = 0.03). An increase in SP CD8+ cells is observed as a percentage of total thymocytes (P = 0.04), but not when actual absolute numbers of CD8+ cells is calculated (P = 0.64). For 12-week-old animals, total thymocyte numbers (P = 0.095) and DP thymocytes (P = 0.095) were decreased, but this trend did not reach statistical significance. This was also true when the decrease in DP thymocytes (P = 0.095) and increase in SP CD4+ thymocytes (P = 0.1) were examined as a percentage of total thymocytes, but the

PAGE 66

52 percentage of SP CD8+ cells was significantly higher in infected animals (P = 0.003). Again, changes in DN thymocytes (P = 0.71) and IgG+ cells (P = 0.38) were not observed. There were no observed differences in the numbers of SP CD4+ thymocytes (P = 0.90), and change in the absolute numbers of SP CD8+ thymocytes were not statistically significant (P = 0.095). In animals >16 weeks of age, the loss of the absolute number of total thymocytes (P = 0.06), DP thymocytes (P = 0.06) and DN thymocytes (P = 0.09) approaches but did not achieve statistical significance. The absolute numbers of SP CD4+ thymocytes (P = 0.94), SP CD8+ thymocytes (P = 0.89), and numbers of IgG+ cells (P = 0.22) were unchanged. When evaluated as a percentage of total thymocytes, DP CD4+CD8+ thymocytes were decreased (P = 0.04), SP CD4+ thymocytes were increased (P = 0.07) and the increase in SP CD8+ thymocytes was not significant (P = 0.12).

PAGE 67

53 Table 5-1. Historical data for absolute total thymocyte counts and absolute number of total thymocytes, double-negative thymocytes and IgG+ cells (B cells) in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Animal group Total thymocytes (x10 9 ) (arithmetic mean with standard deviation) Absolute number of DN thymocytes (x10 9 ) (arithmetic mean with standard deviation) Absolute number of IgG+ cells (x10 9 ) (arithmetic mean with standard deviation) 1 6-8-week-old cats, uninfected (n=5) 8.64 4.24 0.772 0.441 0.05 0.03 2 6-8-week-old cats, FIV-infected (JSY3) (n=4) 3.51 3.01 0.724 0.334 1.16 1.44 3 12-week-old cats, uninfected (n=2) 17.75 7.04 1.21 0.414 0.3 0.05 4 12-week-old cats, FIV-infected (JSY3) (n=5) 8.52 1.7 1.1 0.309 1.14 0.81 5 >16-week-old cats, uninfected (n=2) 37.59 18.97 4.47 2.74 0.16 0.12 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 10.5 6.02 1.99 1.26 0.96 0.8

PAGE 68

54 Table 5-2. Historical data for absolute number of double-positive CD4+CD8+ thymocytes and the percentage of total thymocytes exhibiting the CD4+CD8+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Animal group Absolute number of CD4+CD8+ thymocytes (x10 9 ) (arithmetic mean with standard deviation) % of total thymocytes CD4+CD8+ (arithmetic mean with standard deviation) 1 6-8-week-old cats, uninfected (n=5) 6.63 3.4 0.764 0.055 2 6-8-week-old cats, FIV-infected (JSY3) (n=4) 1.92 2.2 a 0.448 0.278 a 3 12-week-old cats, uninfected (n=2) 15.6 6.22 0.876 0.003 4 12-week-old cats, FIV-infected (JSY3) (n=5) 5.06 1.21 0.594 0.093 5 >16-week-old cats, uninfected (n=2) 2.96 1.42 0.793 0.023 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 5.15 4.17 0.395 0.233 a a: animal groups with statistically significant cell counts from age-matched control groups (P<0.05) Table 5-3. Historical data for absolute number of CD4+ thymic cells and the percentage of total thymic cells exhibiting the CD4+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Animal group Absolute number of CD4+ cells (x10 9 ) (arithmetic mean with standard deviation) % of total thymic cells CD4+ (arithmetic mean with standard deviation) 1 6-8-week-old cats, uninfected (n=5) 0.285 0.108 0.04 0.02 2 6-8-week-old cats, FIV-infected (JSY3) (n=4) 0.138 0.023 a 0.06 0.04 3 12-week-old cats, uninfected (n=2) 0.501 0.407 0.03 0.01 4 12-week-old cats, FIV-infected (JSY3) (n=5) 0.472 0.214 0.05 0.02 5 >16-week-old cats, uninfected (n=2) 0.647 0.549 0.02 0.01 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 0.671 0.361 0.07 0.04 a: animal groups with statistically significant cell counts from age-matched control groups (P<0.05)

PAGE 69

55 Table 5-4. Historical data for absolute number of CD8+ thymic cells and the percentage of total thymic cells exhibiting the CD8+ phenotype in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Animal group Absolute number of CD8+ cells (x10 9 ) (arithmetic mean with standard deviation) % of total thymic cells CD8+ (arithmetic mean with standard deviation) 1 6-8-week-old cats, uninfected (n=5) 0.95 0.7 0.099 0.03 2 6-8-week-old cats, FIV-infected (JSY3) (n=4) 0.73 0.62 0.225 0.105 a 3 12-week-old cats, uninfected (n=2) 0.48 0.01 0.029 0.012 4 12-week-old cats, FIV-infected (JSY3) (n=5) 1.89 0.71 0.219 0.048 a 5 >16-week-old cats, uninfected (n=2) 2.87 1.49 0.076 0.001 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 2.68 1.73 0.296 0.169 a: animal groups with statistically significant cell counts from age-matched control groups (P<0.05) Absolute number of Total thymocytesJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks0100000000002000000000030000000000400000000005000000000060000000000Number of cells/thymus Figure 5-1. Historical flow cytometry results from previous published experiments: absolute numbers of total thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.

PAGE 70

56 Absolute number of DN CD4-CD8thymic cellsJSY3>16wksUninfected>16 wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks010000000002000000000300000000040000000005000000000600000000070000000008000000000Number of CD4-CD8cells/thymus Figure 5-2. Historical flow cytometry results from previous published experiments: absolute numbers of double-negative (DN) CD4-CD8cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Absolute number of IgG+ CellsJSY3>16 wksUninfected>16 wksJSY3 12 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks050000000010000000001500000000200000000025000000003000000000Number of cells/thymus Figure 5-3. Historical flow cytometry results from previous published experiments: absolute numbers of IgG+ cells (B cells) present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.

PAGE 71

57 Absolute number of CD4+CD8+ thymocytesJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks05000000000100000000001500000000020000000000250000000003000000000035000000000400000000004500000000050000000000Number of CD4+CD8+ cells/thymus Figure 5-4. Historical flow cytometry results from previous published experiments: absolute numbers of CD4+CD8+ thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). Thymocytes: %CD4+CD8+ cellsJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks00.10.20.30.40.50.60.70.80.91% of Total thymocytes ** Figure 5-5. Historical flow cytometry results from previous published experiments: percentage of CD4+CD8+ thymocytes present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05).

PAGE 72

58 Absolute number of CD4+ thymic cellsJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks0200000000400000000600000000800000000100000000012000000001400000000Number of CD4+ cells/thymus Figure 5-6. Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD4+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05). Thymocytes: % SP CD4+ cells JSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks00.020.040.060.080.10.12% of Total thymocytes Figure 5-7. Historical flow cytometry results from previous published experiments: percentage of single-positive (SP) CD4+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.

PAGE 73

59 Absolute number of CD8+ thymic cellsJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks0500000000100000000015000000002000000000250000000030000000003500000000400000000045000000005000000000Number of CD8+ cell/thymus Figure 5-8. Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Thymocytes: % SP CD8+ cellsJSY3>16wksUninfected>16wksJSY312wksUninfected12wksJSY36-8wksUninfected6-8wks00.050.10.150.20.250.30.350.40.450.5% of Total thymocytes ** Figure 5-9. Historical flow cytometry results from previous published experiments: percentage of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. (*) denotes statistically significant differences from all other animal groups in study (P < 0.05).

PAGE 74

60 Peripheral Blood Counts Total white blood cell counts (total WBC) and numbers of CD4+ and CD8+ T cells in the peripheral blood are compiled in Table 5-5. Cell count data is graphically represented in Figures 5-10 through 5-12. At 6-8 weeks of age, the WBC (P = 0.91) and CD4+ T cell count (P = 0.41) are unchanged, and the increase in circulating CD8+ T cells is not statistically significant (P = 0.08). By the 12-week time point, WBC are statistically unchanged (P = 0.2), as is the CD4+ cell count (P = 0.57) and the numbers of CD8+ cells (P = 0.3). At >16 weeks of age, again the WBC (P = 0.97) and CD8+ T cell number (P = 0.95) remains unaffected, and the changes in CD4+ T cells are not statistically significant (P = 0.08). Table 5-5. Historical data for absolute number of total white blood cells, CD4+ T cells and CD8+ T cells within peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Animal group Total WBC (arithmetic mean with standard deviation) CD4+ cells (x10 9 ) (arithmetic mean with standard deviation) CD8+ cells (x10 9 ) (arithmetic mean with standard deviation) 1 6-8-week-old cats, uninfected (n=5) 8718 1157 619 696 266 236 2 6-8-week-old cats, FIV-infected (JSY3) (n=4) 9800 4761 1096 835 670 353 3 12-week-old cats, uninfected (n=2) 6915 1478 1214 567 487 201 4 12-week-old cats, FIV-infected (JSY3) (n=5) 13788 6186 879 682 953 528 5 >16-week-old cats, uninfected (n=2) 9050 4596 1441 1062 500 228 6 >16-week-old cats, FIV-infected (JSY3) (n=7) 8919 3668 586 411 517 325

PAGE 75

61 Total WBCJSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks0500010000150002000025000Cells/microliter Figure 5-10. Historical flow cytometry results from previous published experiments: absolute numbers of white blood cells present in peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Peripheral CD4+ T cellsJSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks050010001500200025003000Cells/microliter Figure 5-11. Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD4+ cells present in peripheral blood samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points.

PAGE 76

62 Peripheral CD8+ T cellsJSY3>16 wksUninfected>16 wksJSY312 wksUninfected12 wksJSY36-8 wksUninfected6-8 wks02004006008001000120014001600Cells/microliter Figure 5-12. Historical flow cytometry results from previous published experiments: absolute numbers of single-positive (SP) CD8+ cells present in thymus samples from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-matched control animals at three different time points. Pairwise Correlations of Lymphocyte Subsets to Viral and Cytokine Parameters A summary of Pearsons pairwise correlations with a P value less than 0.1 are compiled in Table 5-6. In Chapter 4, it was determined that IL-4, IL-7, IFNand IFNexhibited similar expression patterns. The regression analysis confirms a strong positive correlation between the expression levels of IL-7, IFNand IFN(P < 0.001). Expression of these cytokines was associated with increased absolute numbers of thymocytes, DP CD4+CD8+ thymocytes and DN CD4-CD8thymocytes. IL-4 was correlated with increased numbers of SP CD4+ cells within the thymus (P = 0.002) and SP CD8+ T cells within the peripheral circulation (P = 0.03). Expression of IL-15 weakly associated with percentage of CD8+ cells within the thymus ( = 0.363, P = 0.068), and highly correlated with numbers of CD8+ T cells circulating within the peripheral blood (P = 0.005). No cytokine or cellular data appeared to correlate with proviral load/gag DNA levels. However, gag RNA/viral gene expression was increased

PAGE 77

63 with elevated numbers of SP CD8+ cells within the thymus (P = 0.001) and IFNexpression (P =0.012). Gag RNA was less strongly but positively associated with the presence of IgG+ cells within the thymus ( = 0.525, P = 0.08) and IL-15 expression ( = 0.513, P = 0.07). Table 5-6. Summary of Pearsons pairwise correlations of historical necropsy data, measured cytokine values and viral parameters. All comparisons with P<0.1 are listed. Variable 1 Variable 2 Rho () P value %CD4+CD8+ thymocytes IFN0.335 0.095 %CD4+ thymocytes IL-7 -0.362 0.069 %CD4+ thymocytes IFN-0.438 0.025 %CD8+ thymocytes IL-15 0.363 0.068 Absolute # total thymocytes IL-7 0.792 <0.001 Absolute # total thymocytes IFN0.766 <0.001 Absolute # total thymocytes IFN0.769 <0.001 Absolute # CD4+CD8+ thymocytes IL-7 0.8 <0.001 Absolute # CD4+CD8+ thymocytes IFN0.74 <0.001 Absolute # CD4+CD8+ thymocytes IFN0.789 <0.001 Absolute # of CD4+ thymocytes IL-4 0.586 0.002 Absolute # of CD8+ thymocytes IFN0.434 0.03 Absolute # of CD8+ thymocytes gag RNA 0.812 0.001

PAGE 78

64 Absolute # of CD4-CD8thymocytes IL-7 0.652 <0.001 Absolute # of CD4-CD8thymocytes IFN0.699 <0.001 Absolute # of CD4-CD8thymocytes IFN0.602 0.001 IgG+ cells IL-15 0.367 0.072 IgG+ cells gag RNA 0.525 0.08 Total WBC (peripheral blood) IL-15 0.55 0.004 CD8+ T cells (peripheral blood) IL-4 0.43 0.03 CD8+ T cells (peripheral blood) IL-15 0.537 0.005 IL-7 IFN0.952 <0.001 IL-7 IFN0.949 <0.001 IL-15 gag RNA 0.513 0.07 IFNIFN0.892 <0.001 IFNgag RNA 0.671 0.012 Discussion This compiled data represents a greater number of overall animals than previous reports and is broken down into distinct age brackets/phases of infection for analysis. The earlier studies reported a reduction of DP CD4+CD8+ thymocytes and in increase in the percentage of SP CD8+ cells in thymuses of infected animals (Orandle, 1997; Orandle 2000; Johnson, 2001; Norway, 2001). Similar findings were found in the current investigation: specifically, statistically significant changes were observed in decreased

PAGE 79

65 absolute numbers of DP thymocytes at weeks 6-8, the decreased percentages of DP thymocytes at weeks 6-8 and >16 weeks, and in the increased percentage of total thymic cells that are CD8+ at weeks 6-8 and 12. Significant changes in total thymocyte number, absolute numbers of DN thymocytes and IgG+ cells were not observed. The correlation in expression levels of IL-7, IFNand IFNwas observed in Chapter 4 and confirmed here with regression analysis. Expression of these cytokines appeared to be associated with improved indicators of thymus composition, namely increased overall number of thymocytes, and, more specifically, increased numbers of the immature DP thymocytes and DN thymocytes. Levels of IL-15 were not significantly associated with increased inflammatory infiltrates, germinal center formation, the percentage of CD8+ cells and numbers of IgG+ (B cells) within the thymus. No cytokine influences on proviral load were observed, but viral gag gene expression was positively associated with inflammatory infiltrates (CD8+ cells) and IFNexpression. It is not clear, however, whether increased viral expression induces more pronounced inflammation, or if the influx of inflammatory cells is responsible for the increase in viral activity. Decreases in endogenous thymic production of IFNproved to be the most pronounced cytokine change observed. As there was a marked peak in IFNmRNA production in the older animals that was abrogated by infection with FIV, further experiments were undertaken to determine a potential source of the IFN production (Chapter 6) and the effects of IFNon viral replication in thymocytes (Chapter 7). It was proposed that an interferon-producing cell type such as the Type II/plasmacytoid

PAGE 80

66 dendritic cell might exist in the thymus of cats that could potentially be infected directly by FIV or undergo viral-induced impairment of IFN-producing function.

PAGE 81

CHAPTER 6 DETECTION OF FIV-INFECTED CELLS AND IFN-PRODUCING CELLS WITHIN THE THYMUS OF NORMAL AND FIV-INFECTED CATS Introduction Historically, one limitation in the manipulation and study of plasmacytoid dendritic cells (PDCs)/interferon-producing cells (IPCs) was the lack of a specific cellular surface expression marker. Isolation of IPCs required depleting peripheral blood mononuclear cells (PBMCs) of cells bearing lineage specific molecules, including CD3 (T cells), CD19 (B cells), CD14 (monocytes) and CD56 (NK cells). Remaining cells were enriched for IPCs by selecting for CD11c-negative/CD123-bright cells, to remove the monocyte-derived type 1 dendritic cells (Siegal, 1999). A PDC-specific marker was eventually discovered, blood dendritic cell antigen-2 (BDCA-2) (Dzionek, 2000). Characterization of this molecule revealed it as a novel type II C-type surface lectin (Dzionek, 2001). A recombinant human dendritic cell lectin (rhDLEC) was developed and commercially developed antibodies recently became available, facilitating the study of this rare cell type. The thymus has been shown to harbor a subset of resident PDC, however, their function within the normal thymus remains unclear (Fohrer, 2004). While most of these cells were observed to be of an immature phenotype, some PDC expressed markers indicative of activation and may contribute to a late stage of negative thymocyte selection. In the context of HIV infection, in vitro experiments using a thymic culture system have shown that thymic PDCs respond to viral infection with IFNproduction 67

PAGE 82

68 (Gurney, 2004). The amount of interferon produced suppressed viral production, but at a suboptimal level and could be enhanced by the addition of CpG oligonucleotides to the culture system. While PDCs only comprised 0.2% of the lymphoid cells of the thymus, depletion of these cells from the thymic culture enhanced viral replication 2-110 fold. Previous reports indicated that anti-human DLEC antibodies did not cross-react with PDC from the peripheral blood of the rhesus macaque (Chung, 2005). The current study sought to test the binding capacity of a polyclonal anti-human DLEC-derived antibody against feline thymic PDCs using a peroxidase-based immunohistochemistry protocol and provide preliminary data to characterize this cell type. Materials and Methods Single-Label Immunohistochemistry Archival tissue selected from seven 6-8-week-old kittens (acute FIV infection) and six >16-week-old kittens (chronic FIV infection) that had been inoculated at birth with JSY3, a FIV molecular clone that exhibits thymic pathogenicity (Orandle, 1997; Norway, 2001; Johnson, 2001). Uninfected thymus samples from two 6-8-week-old kittens and four >16-week-old kittens served as age-matched controls. 5 m frozen sections of thymic tissue were removed from -80C and immediately fixed in ice cold ethanol for 5 minutes and rinsed in room temperature PBS buffer. Sections were incubated at room temperature for 30 minutes with blocking solution of 1% normal horse serum and blotted, followed by a 30 minute incubation with10g/mL of either anti-rhDLEC polyclonal antibody (R&D Systems, Minneapolis, MN, USA), a polyclonal anti-human IFNantibody (PBL Biomedical Laboratories, Piscataway, NJ, USA) or a monoclonal antibody against FIV p24 gag protein (clone PAK3-2C1; Custom Monoclonals International, West Sacramento, CA.). Negative control slides from infected and

PAGE 83

69 uninfected thymus sections underwent an additional blocking step and did not receive primary antibody. All slides were developed and stained using the Vectastain Universal Elite ABC Kit (Vector Laboratories Inc., Burlingame, CA) and visualized with diaminobenzidine chromagen enhanced with nickel. Sections were then rinsed in water and counterstained with Harriss hematoxylin. Slides were examined microscopically, and measurements of total visualized thymic area were made at a 40X objective magnification using the Image J NIH software program ( http://rsb.info.nih.gov/ij/download.html ). The results were reported as the number of positively-staining cells identified per unit of designated area. Double-Label Immunohistochemistry Tissue sections from several acutely and chronically infected kittens were chosen based on the quality of the tissue sections during previous single-label immunohistochemistry experiments. 5 m thymic samples were removed from -80C and immediately fixed in ice cold ethanol for 5 minutes and rinsed in room temperature PBS buffer. Sections were incubated at room temperature for 30 minutes with blocking solution of 1% normal horse serum and blotted, followed by a 30 minute incubation with10g/mL of anti-rhDLEC polyclonal antibody (R&D Systems, Minneapolis, MN, USA). Negative control slides did not receive an incubation with the primary antibody and underwent an additional 30 minute blocking step. All slides were developed and stained using the Vectastain Universal Elite ABC Kit (Vector Laboratories Inc., Burlingame, CA) and visualized with diaminobenzidine chromagen enhanced with nickel. Slides were incubated again with blocking solution for 30 minutes, then incubated with a second primary antibody, either polyclonal anti-human IFNantibody (PBL Biomedical Laboratories, Piscataway, NJ, USA) or a monoclonal antibody against

PAGE 84

70 FIV p24 gag protein (clone PAK3-2C1; Custom Monoclonals International, West Sacramento, CA.). Negative slides remained in blocking solution and did not receive primary antibody. Slides were developed and stained using the Vectastain Universal Elite ABC Kit (Vector Laboratories Inc., Burlingame, CA) and visualized with Vector VIP Substrate (Vector Laboratories Inc., Burlingame, CA). Slides were examined via light microscopy for positively-staining cells. Statistical Analysis The numbers of cells present per unit area were analyzed for differences between the groups of FIV-infected animals and the age-matched control cats. SAS PROC GLM was used to conduct the one-way ANOVA analysis, and the least squares means were calculated and pair-wise group comparisons were conducted using SAS 9.1 (SAS Institute, Inc., Cary, NC). Results Initial immunohistochemical slides exhibited mild homogenous brown extracellular background staining within the germinal centers/lymphoid follicles, particularly in test samples using lymph nodes. However, attempts to incorporate a step to quench endogenous peroxidase activity resulted in abrogation of antibody staining and were discontinued. The low level of brown background stain did not impair the evaluation of the dark black cellular staining in antigen-positive cells. Pathologic changes in thymic sections from infected animals included variable loss of cortical thymocytes, but overall the cortices were well populated and the corticomedullary junctions were clearly visible. Formation of germinal centers was a prominent feature within the infected tissues, and formed either within the medullary areas or abutting the cortical surface.

PAGE 85

71 Single-Label Immunohistochemistry Single-label immunohistochemistry experiments using the anti-rhDLEC antibody in uninfected thymuses stained a very small number of medium-sized to large, ovoid cells scattered along the corticomedullary junction, as shown in Figure 6-1. In samples from infected animals, these cells were still present, but the majority of DLEC+ cells were found to be present within the inflammatory germinal centers that developed as a result of viral infection (Figure 6-2). Figure 6-1. 40X. Single-label immunohistochemistry with a polyclonal antibody against human BDCA-2 (DLEC) performed on thymic sections from a 16-week-old, uninfected kitten. Scattered, black-staining DLEC+ cells are present along the junction between the cortex (more densely cellular area along the top and left of the figure) and the medulla.

PAGE 86

72 Figure 6-2. 60X. Single-label immunohistochemistry with a polyclonal antibody against human BDCA-2 (DLEC) performed on thymic sections from an 8-week-old kitten infected with FIV. DLEC+ cells are clustered within a germinal center that formed along the thymic corticomedullary junction. Single-label immunohistochemistry experiments using the anti-human IFNantibody resulted in a similar number and distribution of positively staining cells when compared to those using the anti-rhDLEC antibody. In uninfected animals, small numbers of positive cells were present along the corticomedullary junction, but in addition, there was faint positive staining of endothelial cells (Figure 6-3). In infected animals, cells were present in qualitatively higher numbers and were present along the corticomedullary junction and within germinal centers (Figure 6-4).

PAGE 87

73 Figure 6-3. 40X. Single-label immunohistochemistry with an antibody against IFNperformed on thymic sections from a 16-week-old, uninfected kitten. Scattered, black-staining IFN+ cells are present along the junction between the cortex (more densely cellular area along the bottom of the figure) and the medulla. Endothelial cells also exhibit faint positive staining.

PAGE 88

74 Figure 6-4. 10X. Single-label immunohistochemistry with an antibody against IFNperformed on thymic sections from an 8-week-old kitten infected with FIV. Black IFN+ cells are clustered within germinal centers and along the thymic corticomedullary junction. The fainter homogenous brown staining was typical of germinal centers and was not considered positive when counting for IFN+ cells. Single-label immunohistochemistry using an antibody against the p24 antigen of FIV did not stain cells within uninfected tissues. Again, the distribution of positively staining cells within the thymic sections was largely limited to lymphoid follicles with smaller numbers of cells scattered throughout the medulla. p24 staining cells were distributed evenly throughout the follicles, and the number of positive cells seemed to exceed that observed with the DLEC and IFN antibodies (Figure 6-5). p24+ cells were rare within the thymic cortex.

PAGE 89

75 Figure 6-5. 10X. Single-label immunohistochemistry with mAb against FIV p24 performed on thymic sections from an 8-week-old kitten infected with FIV. Black p24+ cells are clustered within germinal centers and throughout the medulla. As the tissue sections from the different animals varied in size, the area of thymus being assessed for positive staining was measured in order to standardize the data. The number of DLEC+ and IFN+ cells per unit area are summarized in Tables 6-1 and 6-2.

PAGE 90

76 Table 6-1. Number of DLEC+ cells per unit of thymic area. Animal group Mean # positive cells/unit area 6-8-week-old cats, uninfected (n=2) 2.27 x 10 -6 6-8-week-old cats, FIV-infected (n=6) 14.49 x 10 -6 >16-week-old cats, uninfected (n=4) 2.3 x 10 -6 >16-week-old cats, FIV-infected (n=6) 5.28 x 10 -6 Table 6-2. Number of IFN+ cells per unit of thymic area. Animal group Mean # positive cells/unit area 6-8-week-old cats, uninfected (n=2) 1.55 x 10 -6 6-8-week-old cats, FIV-infected (n=5) 10.26 x 10 -6 >16-week-old cats, uninfected (n=2) 2.4 x 10 -6 >16-week-old cats, FIV-infected (n=5) 7.24 10 -6 Statistical analysis of the data showed that there was no significant differences among the groups for number of cells per unit area that stain positively for IFN. For tissues stained with anti-rhDLEC, 6-8-week-old FIV-infected samples contained significantly more positively staining cells than >16-week-old uninfected animals (p=0.021) and >16-week-old kittens infected with FIV (p=0.0497). Double-Label Immunohistochemistry In thymic tissues stained for DLEC and p24 or DLEC and IFN, the histological appearance of the positively staining cells was similar. Cells staining positively for DLEC (black) also appeared to stain positively for p24 and IFN (purple) in the respective sections (Figures 6-6 and 6-7). There were occasional cells that stained purple (FIV+ or IFN+) in the absence of co-localizing black stain. These results suggest that many

PAGE 91

77 DLEC+ cells within these sections were associated with virus antigen and are producing IFN-. Figure 6-6. 40X. Double-label immunohistochemistry for DLEC and IFNperformed on thymic sections from an 8-week-old kitten infected with FIV. Black staining (DLEC+) co-localizes with purple stain for IFNin germinal centers(open arrow). Occasional cells stain positively for IFN in the absence of DLEC expression (black arrows).

PAGE 92

78 Figure 6-7. 40X. Double-label immunohistochemistry for DLEC and FIV p24 performed on thymic sections from an 8-week-old kitten infected with FIV. Black staining (DLEC+) co-localizes with purple stain for the p24 antigen of FIV in the germinal centers (open arrows). Occasional cells stain positively for p24 in the absence of DLEC expression (black arrows). Discussion The series of immunohistochemistry experiments in this study show that polyclonal antibody raised against rhDLEC cross-reacts with a resident subset of feline thymic cells. As the polyclonal antibody against IFNgave a similar histological distribution of cells within the thymus, double-label immunohistochemistry was performed on infected thymus samples to demonstrate that the same cells are staining positively for both dendritic cell antigen and are producing IFN-. The signals did appear to co-localize, suggesting DLEC+ cells are in fact IPCs. Some IFN+ cells were not expressing DLEC, suggesting that another cell type is contributing to interferon production, or that DLEC expression within some IPCs was too low to detect by this method.

PAGE 93

79 DLEC+ cells appear increased in numbers in infected thymus samples, but this proved to be only statistically significant for samples from FIV-infected 6-8-week-old kittens when compared to those of infected and uninfected 16-week-old animals. In normal animals, the distribution of these cells is limited to the corticomedullary junction, while in FIV-infected animals, DLEC+ cells are a prominent cell type within germinal centers. The distribution of IFN+ cells was similar to that of DLEC+ cells, but statistical significance was not observed between any of the animal groups. FIV-infected p24+ cells were observed within germinal centers and scattered in smaller numbers within the thymic medulla. Given the similar distribution of infected cells to the IPCs in previous sections, dual-label immunohistochemistry for p24 and DLEC was performed. Again, there was co-localization of the p24 signal to DLEC+cells, suggesting that IPCs within the feline thymus harbor FIV. This preliminary investigation shows that DLEC+ cells are present in the feline thymus, and appear to produce IFNand become infected with FIV. Isolation of this cell type and in vitro infection studies are necessary for definitive confirmation of these observations.

PAGE 94

CHAPTER 7 SUSCEPTIBILITY OF THYMOCYTES TO FIV CHALLENGE IN VITRO Introduction Thymopoiesis and the ongoing output of viable thymocytes are crucial to the pathogenesis of lentivirus infection and are necessary for the replacement of the virally targeted T cells that are lost in the course of infection. Direct infection of the thymus by FIV is known to occur and results in a partial loss of the primary subpopulation of thymocytes, the double-positive (DP) CD4+CD8+ cells (Orandle, 1997; Orandle, 2000; Norway, 2001; Johnson, 2001). As our experiments showed that IFNwas normally expressed in the thymus, had suppressed expression with FIV infection (Chapter 4), and that increased levels of IFN correlated with increased absolute numbers of DP thymocytes and total numbers of thymocytes (Chapter 5), we hypothesized that IFNmay confer protective effects in thymuses against FIV infection and the loss of IFN contributes to increases thymic pathogenesis. Cell culture experiments with fetal thymocytes were undertaken to produce viral infection in thymocytes and observe the impact of IFN treatment on viral replication in thymocyte cultures. The previously characterized, pathogenic FIV molecular clone JSY3 and the open reading frame (ORF)-A-deficient clone were used in these studies. Materials and Methods Cell Culture Frozen thymocytes cells were retrieved from storage in liquid nitrogen, thawed, rinsed in wash media (complete RPMI 1640 medium supplemented with 2% fetal bovine 80

PAGE 95

81 serum), pelleted and resuspended in culture medium [cRPMI 1640 medium supplemented with 10% fetal bovine serum, 2mM L-glutamine, 10 mM HEPES, 0.075% sodium bicarbonate, 2 mM sodium pyruvate, 2-mecaptoethanol, and 100U/mL of recombinant human interleukin-2 (rhIL-2)]. Cells were plated at 2 X 10 6 viable cells per milliliter and incubated at 37C for the nine days of the experiment. Viral stocks of JSY3 and JSY3ORF-A (viral strain containing a mutation in the open reading frame A [ORF-A] gene) were used in multiple experiments at various dilutions of 50% tissue culture infectious doses (TCID 50 ), which ranged from 5 X 10 4 to 3 X 10 5 TCID 50 Samples of cell culture supernatant were taken at days 3, 6 and 9 for the reverse transcriptase activity assay. When viral infection was not observed, subsequent experiments included CD4E cells as a positive control cell type for viral replication. At day 9 samples of remaining cells were stained with trypan blue and viable cell counts were determined. Supernatant samples were submitted and evaluated for viral replication using an assay for reverse transcriptase (RT) activity (Johnson, 1990). Results Viral Replication in Thymocyte and CD4E Cell Culture Systems. Three cell culture experiments were performed with thymocytes with multiple animal sources in an attempt to observe viral replication in this cell type. The first two experiments yielded no significant RT activity in any treatment wells at any time point regardless of infectious dose, leading to the conclusion that infection studies in this cell type were not feasible. A final cell culture experiment was undertaken in conjunction with CD4E cells as a positive cell type control, in order to confirm that the input virus strains were infectious. This third run yielded a single small peak in RT activity in thymocyte cultures infected with the JSY3 strain of FIV at day 9 and significant

PAGE 96

82 replication was observed at days 6 and 9 in CD4E cells (Figure 7-2), confirming the viability of the infecting virus. The ORF-A-deficient mutant strain of FIV did not show significant replication in either cell type. Cell culture RT assay0.00200.00400.00600.00800.001000.001200.001400.00CD4eCD4e + IFNCD4e + JSY3CD4e+ JSY3 + IFNCD4 + ORFaCD4 + ORFa +IFNThTh + IFNTh + JSY3Th + JSY3 + IFNTh + ORFa Th + ORFa + IFNAve + controlCounts per minute Day 3 Day 6 Day 9 Figure 7-1. Summary of reverse transcriptase (RT) activity in cell cultures of CD4E cells and fetal thymocytes in one of three series of experiments. Viability of Thymocytes In Vitro The overall viability of thymocytes in culture was low by day 9 in all experiments (~10% of original numbers of plated thymocytes permeable to typan blue), and there were no determined statistical differences between wells, regardless of virus inoculation or treatment with IFN(Figure 7-1). The experiments using thymocytes were done in conjunction with cultures of CD4E cells for a third and final series of cell culture experiments, and wells of CD4E cells contained ten times as many viable cells at the end of the studies. Wells of uninfected CD4E cells that were treated with IFNhad half as

PAGE 97

83 many surviving cells as untreated, uninfected CD4E cells (P = 0.01), indicating that IFNmay exhibit a considerable toxic effect on this cell type. Cell viability, Day 90500000100000015000002000000250000030000003500000CD4eCD4e + IFNCD4e +WTCD4e+ WT + IFNCD4 + ORFaCD4 + ORFa +IFNThTh + IFNTh + WTTh + WT + IFNTh + ORFa Th + ORFa + IFNNumber of viable cells Figure 7-2. Number of viable cells on day 9 of cell culture in one of three attempted experiments. (*) denotes statistically significant differences from control wells without treatment without IFN-. Cytopathic Viral Effects on Thymocyte Cultures. Photomicrographs of the cells in cell culture experiments are shown in Figures 7-3 through 7-6. Nonviable cells that have died over the course of the experiment appear dark and opaque. Treatment with IFNdid not have any observed effects on cell morphology in CD4E cells or in thymocytes.

PAGE 98

84 Figure 7-3. Appearance of freshly thawed CD4E cells at the outset of the cell culture experiments (20X magnification). Figure 7-4. Appearance of freshly thawed thymocytes at the outset of cell culture (20X magnification).

PAGE 99

85 A B C D E F Figure 7-5. CD4E cells at Day 9 of culture experiments. A) Uninfected cells. B) Uninfected cells treated with IFN-. C) Cells infected with JSY3 clone of FIV. D) Cells infected with JSY3 and treated with IFN-. E) Cells infected with ORF-A deficient FIV clone. F) Cells infected with ORF-A deficient FIV clone and treated with IFN-. (20X)

PAGE 100

86 A B C D E F Figure 7-6. Fetal thymocyte cells at Day 9 of culture experiments. A) Uninfected cells. B) Uninfected cells treated with IFN-. C) Cells infected with JSY3 clone of FIV. D) Cells infected with JSY3 and treated with IFN-. E) Cells infected with ORF-A deficient FIV clone. F) Cells infected with ORF-A deficient FIV clone and treated with IFN-. (20X)

PAGE 101

87 Discussion These attempts to infect cryopreserved fetal thymocytes with the JSY3 molecular clone of FIV were largely unsuccessful, and only a single small peak of viral RT activity was observed over the course of the experiments. Cell viability was low by the end of the cell culture trial period, making evaluation protective effects of IFN more difficult to assess. Cell death in culture precludes observations of the protective effects of IFNin cryopreserved thymocytes. A recent report on optimization of cell culture recommends the usage of fresh thymocytes and co-culture with allogenic or autologous thymic epithelial cells in order to maintain thymocyte viability, function and subset distribution (Young, 2006). Preservation at -4C was recommended if extra time was needed to procure a source of TEC. Treatment of cultures with IL-7 caused downregulation of the IL-7 receptor, CD127. The dosage of IFN treatment in this experiment was chosen based on previous experiments that used Type I IFN in feline cells lines in order to maximize antiviral activity without producing profound cytotoxicity (Pontzer, 1997). This goal was achieved, as the only statistically significant decrease in viable cells were seen in control CD4E cells. While we observed no apparent major cytotoxic effects of IFN in thymocytes, the overall poor viability of these cryopreserved cells precluded a definitive judgement. Very few thymocytes stained positively for FIV p24 via immunohistochemistry (Chapter 6), instead, the viral protein was found more in the germinal centers and in the medulla, perhaps representing mature thymocytes or inflammatory cells that would not be present these under cell culture conditions. Taken together, the cell culture and IHC

PAGE 102

88 experiments support the hypothesis that viral replication is largely limited to mature immune system cells that traffic the thymus in the course of viral infection, particularly interferon-producing cells. These findings indicate a need to further investigate this cell type in a future series of separate culture experiments as the cell-specific reagents become available and the cells are better accessible for manipulation.

PAGE 103

CHAPTER 8 CONCLUSIONS The main goal of these experiments was to determine the local changes in cytokine expression and effects of cytokines on the pathogenesis of FIV within the thymus of neonatally-infected cats. Our hypothesis was that alterations in cytokine mRNA expression occur as a result of FIV infection of the pediatric thymus, and that these changes correlate with changes in FIV viral replication, local inflammatory cell populations and T cell production by the thymus. Several experiments were executed in order to achieve this goal: 1. Discover the full-length cDNA/mRNA sequences for interleukin (IL)-7, IL-4, IL-15, interferon (IFN)-, and IFN-; 2. Measure the mRNA expression levels of interleukin (IL)-7, IL-4, IL-15, interferon (IFN)-, and IFNwithin neonatally FIV-infected animals and age-matched controls at 3 time points correlating with acute and chronic infection, and measure corresponding levels of viral RNA expression and assess proviral load; 3. Determine cytokine alterations which correlate with changes in viral load and replication, influx of inflammatory cells and thymocyte depletion; 4. Demonstrate changes in inflammatory cell populations, IFNexpression and viral protein distribution using immunohistochemistry; 5. Assess the antiviral activity of IFNin vitro. The results of the preceding chapters demonstrate the accomplishment of all of these objectives, except for the low level and inconsistent infection rate of FIV in fetal thymocyte culture experiments. Currently feline-specific cytokine reagents are in short supply, including the feline recombinant proteins and monoclonal/polyclonal anti-cytokine antibodies. In addition, 89

PAGE 104

90 measurement of the cytokine proteins directly is limited due to the low levels of protein expression within the tissue and therefore the large amount of tissue that would be necessary to perform these experiments. Fortunately, cytokine mRNA expression has been found to adequately reflect protein production (Blaschke, 2000; Hein, 2001), so real time RT-PCR was chosen as the protocol of choice in investigating the thymus cytokine levels. In order to launch the subsequent experiments regarding cytokine production in the cat thymus, the full-length sequences of the feline mRNA/cDNA had to be determined. All of the sequences were successfully amplified using PCR and oligonucleotide primers and probes, which designed using consensus sequences from the available data from other species. PCR products were inserted into plasmids and used to transform bacteria in order to purify and amplify single amplicons. All the sequences were confirmed as the desired amplification product by full-length DNA sequencing and comparison to previously published cytokine data, and the homology of the feline sequences are herein reported. The full-length cDNA sequences were amplified as plasmid DNA inserts and stored for any future desired experiments where in-house cytokine protein expression would be necessary. Cytokine levels within the thymus of FIV-infected cats and age-matched controls were successfully measured at three time points post-infection in order to represent acute (6-8 weeks), chronic (>16 weeks) and intermediate (12 weeks) infection time points, but also provide developmental immunological data for cytokine expression in the cat. For four of the five measured cytokines (IL-4, IL-7, IFN-, IFN-), there was an observed peak in mRNA expression that naturally occurred after 16 weeks of age, which paralleled

PAGE 105

91 absolute numbers of total thymocytes, immature double-negative CD4-CD8thymocytes, and double-positive CD4+CD8+ thymocytes present in these subadult thymus samples. These findings taken together may suggest that this is a particularly active time point for thymopoiesis and perhaps represents a threshold for immune system maturity and competence in the cat. The most significant impact of neonatal FIV infection was also found at the same chronic time point. For IL-4, IL-7, IFN-, and IFN-, the naturally-occurring developmental peak in these cytokines was abrogated and there was a statistically significant reduction in the mRNA production of all four. In infected animals, cytokine levels were reduced 3.8-fold for IL-4, 6.3-fold for IL-7, and 4.5-fold for IFN-. The most profound impact of FIV infection on cytokine elaboration in the thymus was found for IFN-, which exhibited a 149-fold reduction in expression. The decrease in IL-7 mRNA expression came as a surprise, as it was expected to be increased in infected animals in order to stimulate thymopoiesis in the face of T cell loss. Again, interestingly, while the reduction in thymocyte parameters in this age group was not found to be statistically significant, there is a similar trend of decreases in the absolute numbers of total thymocytes, DN and DP thymocytes that can be seen in the graphical representations of the necropsy data. Regression analysis of this data was able to confirm that expression IL-7, IFNand IFNwere positively correlated, and that levels of these cytokines also had a strong positive correlation with the absolute numbers of total thymocytes, DP and DN thymocytes. Taken together, this suggests that the infection of the thymus with FIV directly or indirectly negatively influences the function of cells that elaborate these cytokines, and that expression levels of these agents is

PAGE 106

92 associated with a reduction in thymopoiesis. It remains to be determined whether the loss of thymocytes is due to the loss of a survival/proliferative cytokine signal such as IL-7, or if the reduction in cytokine levels results from the loss of certain cells in the thymus due to direct viral infection and therefore measurement of the cytokine expression merely represents another pathological indicator of infection. However, given the importance of IL-7 to T cell development, the reduction in levels of this cytokine could be responsible for the loss of thymocytes seen in these animals. IL-7 has been determined to have critical roles in thymopoiesis at multiple stages of T cell development. It has been reported that regulation of local IL-7 production is tissue-specific. Bone marrow stroma has shown to increase IL-7 synthesis with stimulation by IL-1 and tumor necrosis factor (TNF)(Weitzmann, 2000), while human intestinal epithelial cells failed to respond to similar cytokine treatment (Oshima, 2004). Epidermal keratinocytes were shown to produce more IL-7 in response to treatment with IFN(Ariizumi, 1995), and intestinal epithelial cells increased IL-7 synthesis in the presence of IFNor its inducible proteins interferon regulatory factor (IRF)-1 and IRF-2 (Oshima, 2004). IFNcan also trigger the production of IRF-1 (Lehtonen, 2003) and IRF-2 (Zhou, 2000), so it is likely that it can produce similar IL-7 production in sensitive cell types. The known link between IFN and IL-7 production may explain the strong correlations between IFN-, IFNand IL-7 found in the current study, however, the lack of data regarding other cytokine levels such as TNF or IL-1 preclude a definitive conclusion. The high levels of endogenous IFNmRNA expression and a potential link between IFN production and IL-7, a known thymopoietic cytokine, are unexpected.

PAGE 107

93 While IFNdemonstrates remarkable antiviral properties and is being investigated as a treatment for a number of disorders and cancers, side effects with this cytokine can be an issue. IFNexhibits a dose-dependent toxicity in developing B and T cells (Lin, 1998), and the most prevalent clinical contraindication for use of IFNis its well-known hematotoxicity and immunosuppressive effects (reviewed in Sleijfer, 2005). Therefore, the presence of IFN expression is unexpected and raises questions of its role in thymopoiesis and the innate immune protection of the thymus. Our finding of a reduction of IFNmRNA expression in the thymus of chronically FIV-infected cats is not consistent with previously published data. Liang et al. (2000) found increased thymic IFNexpression via reverse transcription-quantitative competitive PCR, however, the cats in the study were infected as adults with a different FIV strain from the current study (NCSU-1) and were sacrificed after 6-12 weeks. Dean et al. (1998) used a similar technique and found an increase in IFNthymic expression after 8 weeks of infection, but study animals were 3-4 months of age at the time of inoculation with FIV-Petaluma. Orandle et al. (2000) determined that infected cats demonstrated a 10-fold increase in IFNmRNA in thymus samples using reverse transcription-quantitative competitive PCR. The animal age for necropsy in this study was between 12 and 16 weeks, but contained a similar number of JSY3-infected cats for these time points. The causes for these differences in values is unclear. IFNdemonstrated the only observed statistically significant positive correlation to viral replication in this study. As IFNexpression is generally considered indicative of an indication of a strong CD8+ T cell response to lentiviral infection and corresponding viral suppression, this finding is somewhat counterintuitive. Recombinant

PAGE 108

94 feline IFNwas previously shown to have no effect on FIV viral replication in vitro (Tanabe, 2001), and the positive correlation may reflect a secondary IFN response to increased viral replication and an appropriate T cell response. Another possibility is that the increased numbers of activated IFN-producing T cells present within the infected thymus act as one of the primary sources of FIV replication, and that increased viral replication occurs secondary to a stronger inflammatory response. This latter hypothesis is supported by our immunohistochemistry findings, where viral replication was mainly observed within germinal centers. The results for IL-15 did not lend themselves for definitive conclusions regarding the cytokines role in lentiviral infection of the thymus. Little of the data achieved statistical significance, so only a guarded observation of the trends is reasonable based on the current analysis. Changes were limited to a slight physiologic increase in IL-15 expression at 12 weeks of age, and very mild increases as a result of FIV infection that were not significant. Regression analysis showed weak correlations between IL-15 expression and the percentage of CD8+ thymic cells, the presence of IgG+ cells and increases in viral gag RNA. This partially supports our hypothesis that IL-15 in the thymus is related to the inflammatory response to FIV within the thymus. IL-15 levels in the thymus did positively correlate with total white blood cells and CD8+ T cells in the peripheral blood at statistically significant levels, which may indicate that an IL-15 response within the thymus could have an ultimate beneficial effect on the peripheral immune system. While IL-4 demonstrated a similar expression pattern as seen for IL-7, IFNand IFN-, regression analysis did not support an association between this cytokine and total

PAGE 109

95 thymocytes numbers or the DN or SP thymocyte subpopulations. Expression of IL-4 showed a positive correlation to the absolute numbers of single-positive CD4+ thymic cells and a weak positive relationship to the numbers of CD8+ T cells in the peripheral blood. A positive correlation between IL-4 expression, viral replication and proviral burden was not observed as it has been seen in vitro with HIV (Pedroza-Martins, 2002). This may be due to the unexpected suppression of both IL-4 and IL-7 within the thymus of chronically infected animals, and increases in viral replication may need higher levels of these cytokines in vivo in order to occur. After establishing the relevant changes in cytokine expression in the FIV-infected thymus, particular interest in the marked reduction of IFNprompted further investigation. Immunohistochemistry (IHC) was undertaken to provide information regarding the presence of an interferon-producing cell type (IPC) in the cat thymus. IPCs have been described in the thymus of humans and mice (Okada, 2003), and are often referred to as plasmacytoid dendritic cells (PDC) or Type II dendritic cells. PDC are considered to be the professional Type I interferon-producing cell type, and PDC are capable of producing large amounts of IFN in response to exposure to viral nucleotide sequences. PDC research has recently been facilitated by the identification of a cell-specific surface lectin BDCA-2 (Dzionek, 2000) and the subsequent development of a polyclonal antibody against this antigen (anti-human DLEC antibody, R&D Systems, Minneapolis, MN, USA). Our IHC experiment was designed to first test the efficacy of this antibody for cat samples, so a single-label and a dual-label IHC protocol was developed to determine if BDCA-2/DLEC+ cells were present and also stained positively for IFN-. The

PAGE 110

96 conclusion was that staining for IFN and DLEC antigens produced a similar distribution within the sections in single-label experiments, and the signals co-localized in specific cells with the dual-label protocol. Therefore it was concluded that the antibody cross-reacted with a feline PDC lectin and appeared to identify a thymic IPC. In dual-label IHC sections, occasional cells stained for IFN but not DLEC, which may represent a PDC with low surface expression of DLEC or another cell type within the thymus that is contributing to Type I IFN production. These data remain to be confirmed in future studies, where conjugated antibody can be used for cell sorting and subsequent intracellular flow cytometry for IFN protein expression in this cell type. DLEC+ cells within the thymus samples were predominantly located in small numbers along the corticomedullary junction of uninfected animals. This cell type appeared to be increased in numbers in infected cats at all time points, but cell counts that were corrected for unit area of thymic tissue did not reach statistical significance. In infected animals, small numbers of DLEC+ positive cells were present along the corticomedually junction, but also represented a prominent subpopulation within the inflammatory germinal centers. IHC experiments were also performed using an antibody against the FIV p24 portion of the gag protein. Staining for p24 co-localized with staining for DLEC, which was interpreted as direct infection of PDC by FIV. Infection of this cell type and subsequent reduced function may be the primary cause of the reduced IFNmRNA expression observed in the cytokine analysis. Cell culture techniques for the derivation of PDC from CD34+ stem cells and the maintenance of this cell type in vitro need to be

PAGE 111

97 developed in order to draw definitive conclusions regarding the impact of FIV infection on IPC function. The distribution of the FIV p24 protein in our thymic samples was different than previously published reports. Using our single-label protocol, p24 staining primarily occurred in numerous cells within germinal centers, with a few scattered virally-infected cells present within the medulla. Woo (1997) showed virus present in cells enriched for CD1 via quantitative competitive PCR, and concluded that cortical thymocytes were infected with FIV. However, this sorted population would also contain various dendritic cell populations (Dzionek, 2000), which we have shown to harbor FIV. Orandle (1997) performed in situ hybridization for FIV RNA in JSY3-infected thymuses and found viral replication exclusively within the thymic cortex, which would indicate infection of immature thymocytes and not more mature thymocytes or infiltrating cells with FIV. Norway (2000) used the same anti-FIV antibody in IHC experiments, but tissue sections exhibited a similar distribution of positive cells in the thymic cortex as Orandle et al. A marked difference in our IHC protocol may account for some of this disparity. An extensive series of fixation experiments was performed at the outset of our IHC studies in order to maximize our fixation protocol and best preserve tissue architecture and antigen signal. In the course of these troubleshooting experiments, it became evident that the standard drying steps resulted in tissue damage and that the endogenous peroxidase quenching step caused a severe loss of antigen in the sections with weak or absent subsequent cellular staining, even when performed with the most mild concentrations of hydrogen peroxide and methanol. Fortunately, it was also apparent from negative control slides that background staining was not an issue, so this step was discarded for the

PAGE 112

98 remainder of the experiments and confirmed by the inclusion of a negative control slide in each run. Also, we used frozen tissue sections rather than paraffin-embedded tissue, which also likely contributed to better antigen preservation. While these differences in technique can account for some of the differences in antigen staining, the reasons for a lack of positive cortical cells in our study compared to previous accounts are unexplained. Experiments that were performed to infect fetal thymocytes with FIV were largely unsuccessful. While this was somewhat disappointing and precluded our ability to definitively confirm a protective effect of IFNon thymocytes, these findings ultimately supported our IHC experiments. In vivo thymocytes were not found to express FIV gag, and the absent to low levels of viral replication observed in the cell culture experiments support the conclusion that FIV largely infects the more mature and activated inflammatory cells in the thymus of neonatally infected animals. Overall, the preceding research confirms our hypothesis and shows that several important cytokine alterations occur as a result of neonatal FIV infection within the thymus, particularly during the most physiologically active time periods for the thymus after 16 weeks of age. Changes in cytokine expression were associated with decreased numbers of certain key thymocyte subpopulations. The decrease in IL-7 expression was found to correlate with the loss of IFN mRNA, which may indicate a role for Type I and/or Type II IFN production in thymopoiesis that requires further investigation. This reduction in IFNproved to be the most significant cytokine alteration, and prompted IHC experiments to establish a potential cellular source for the protein that may be influenced by FIV. The IHC results supported the conclusion that an IPC exists in the

PAGE 113

99 feline thymus that appears to become infected with FIV. It is suggested that future studies involving FIV in the thymus should focus on further characterization of viral effects on this cell type.

PAGE 114

LIST OF REFERENCES Agostini C, Zambello R, Facco M, Perin A, Piazza F, Siviero M, Basso U, Bortolin M, Trentin L, Semenzato G. CD8 T cell infiltration in extravascular tissues of patients with human immunodeficiency virus infection. Interleukin-15 upmodulates costimulatory pathways involved in the antigen-presenting cells-T cell interaction. Blood. 1999. 93(4): 1277-1286. Ahmad R, Sindhu ST, Toma E, Morisset R, Ahmad A. Studies on the production of IL-15 in HIV-infected/AIDS patients. JClinImmunol. 2003. 23(2): 81-90. Al-Harthi L and Landay A. Immune recovery in HIV disease: role of the thymus and T cell expansion in immune reconstitution strategies. JHematotherStemCellRes. 2002. 11(5): 777-786. Argyle DJ, Smith K, McBride K, Fulton R, Onions DE. Nucleotide and predicted peptide sequence of feline interferon-gamma. DNASeq. 1995. 5(3): 169-171. Ariizumi K, Meng Y, Bergstresser PR, Takashima A. IFN-gamma-dependent IL-7 regulation in keratinocytes. JImmunol. 1995. 154(11): 6031-6039. Aspinall R and Andrew D. Thymic involution in aging. JClinImmunol. 2000. 20(4): 250-256. Audige A, Schlaepfer E, Joller H, Speck RF. Uncoupled anti-HIV and immune-enhancing effects when combining IFN-alpha and IL-7. JImmunol. 2005. 175(6): 3724-3736. Badley AD, Dockrell, Simpson M, Schut R, Lynch DH, Leibson P and Paya CV. Macrophage-dependent apoptosis of CD4 + T Lymphocytes from HIV-infected individuals is mediated by FasL and tumor necrosis factor. JExpMed. 1997. 185(1): 55-64. Beq S, Nugeyre MT, Fang RH, Gautier D, Legrand R, Schmitt N, Estaquier J, Barre-Sinoussi F, Hurtrel B, Cheynier R, Israel N. IL-7 induces immunological improvement in SIV-infected macaques under antiviral therapy. JImmunol. 2006. 176(2): 914-922. Blaschke V, Reich K, Blaschke S, Zipprich S, Neumann C. Rapid quantitation of proinflammatory and chemoattractant cytokine expression in small tissue samples and monocyte-derived dendritic cells: validation of a new real-time RT-PCR technology. JImmunolMethods. 2000. 246(1-2): 79-90. 100

PAGE 115

101 Burkhard MJ and Dean GA. Transmission and immunopathogenesis of FIV in cats as a model for HIV. CurrHIVRes. 2003. 1(1): 15-29. Buseyne F, Scott-Algara D, Bellal N, Burgard M, Rouzioux C, Blanche S, Riviere Y. The frequency of HIV-specific interferon-gamma-producing CD8 T cells is associated with both age and level of antigenic stimulation in HIV-1-infected children. JInfectDis. 2005. 192(10): 1781-1786. Caufour P, Le Grand R, Cheret A, Neildez O, Thiebot H, Theodoro F, Boson B, Vaslin B, Venet A, Dormont D. Longitudinal analysis of CD8+ T cell phenotype and IL-7, IL-15 and IL-16 mRNA expression in different tissues during primary simian immunodeficiency virus infection. Microbes and Infection. 2001. 3: 181-191. Cebulla CM, Miller DM, Sedmak DD. Viral inhibition of interferon signal transduction. Intervirology. 1999. 42(5-6): 325-330. Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima J, Lanzavecchia A, Colonna M. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. NatMed. 1999. 5(8): 919-923. Chung E, Amrute SB, Abel K, Gupta G, Wang Y, Miller CJ, Fitzgerald-Bocarsly P. Characterization of virus-responsive plasmacytoid dendritic cells in the rhesus macaque. ClinDiagnLabImmunol. 2005. 12(3): 426-435. Colonna M, Krug A and Cella M. Interferon-producing cells: on the front line in immune responses against pathogens. CurrOpinImmunol. 2002. 14: 373-379. Correa R and Munoz-Fernandez MA. Production of new T cells by thymus in children: effect of HIV infection and antiretroviral therapy. PediatrRes. 2002. 52(2): 207-212. Corthay A. A three-cell model for activation of nave T helper cells. ScandJImmunol. 2006. 64(2): 93-96. Crawford PC, Papadi GP, Levy JK, Benson NA, Mergia A and Johnson CM. Tissue dynamics of CD8 lymphocytes that suppress viral replication in cats infected neonatally with feline immunodeficiency virus. JInfectDis. 2001. 184(6):671-81. dEttorre G, Forcina G, Lichtner M, Mengoni F, DAgonstino C, Massetti AP, Mastroianni CM, Vullo V. Interleukin-15 in HIV infection: immunological and virological interactions in anti-retroviral-nave and treated patients. AIDS. 2002. 16: 181-188. de la Rosa R and Leal M. Thymic involvement in recovery of immunity among HIV-infected adults on highly active antiretroviral therapy. JAntimicrobChemother. 2003. 52(2): 155-158.

PAGE 116

102 Dean G, Pedersen N. Cytokine response in multiple lymphoid tissues during the primary phase of feline immunodeficiency virus infection. JVirol. 1998. 72(12): 9436-9440. Dean GA, Barger A, Lavoy A. Cloning and expression of feline interleukin 15. Cytokine. 2005. 29(2): 77-83. DeLuca D and Clark DR. Interleukin-7 negatively regulates the development of mature T cells in fetal thymus organ cultures. DevCompImmunol. 2002. 26: 365-384. Dhillon NK, Sui Y, Potula R, Dhillon S, Adany I, Li Z, Villinger F, Pinson D, Narayan O, Buch S. Inhibition of pathogenic SHIV replication in macaques treated with antisense DNA of interleukin-4. Blood. 2005. 105(8): 3094-3099. Durbin JE, Fernandez-Sesma A, Lee C, Rao TD, Frey AB, Moran TM, Vukmanovic S, Garcia-Sastre A and Levy DE. Type I IFN modulates innate and specific antiviral immunity. JImmunol. 2000. 164: 4220-4228. Dzionek A, Fuchs A, Schmidt P, Cremer S, Zysk M, Miltenyi S, Buck DW, Schmitz J. BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. JImmunol. 2000. 165(11): 6037-6046. Dzionek A, Sohma Y, Nagafune J, Cella M, Colonna M, Facchetti F, Gunther G, Johnston I, Lanzavecchia A, Nagasaka T, Okada T, Vermi W, Winkels G, Yamamoto T, Zysk M, Yamaguchi Y, Schmitz J. BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. JExpMed. 2001. 194(12): 1823-1834. Feldman S, Stein D, Amrute S, Denny T, Garcia Z, Kloser P, Sun Y, Megjugorae N, Fitzgerald-Bocarsly P. Decreased interferon-alpha production in HIV-infected patients correlates with numerical and functional deficiencies in circulating type 2 dendritic cell recursors. Clin Immunol. 2001. 101(2): 201-210. Fernandez S, Nolan RC, Price P, Krueger R, Wood C, Cameron D, Solomon A, Lewin SR, French MA. Thymic function in severely immunodeficient HIV Type 1-infected patients receiving stable and effective antiretroviral therapy. AIDSResHumRetroviruses. 2006. 22(2): 163-170. Fohrer H, Audit IM, Sainz A, Schmitt C, Dezutter-Dambuyant C, Dalloul AH. Analysis of transcription factors in thymic and CD34+ progenitor-derived plasmacytoid and myeloid dendritic cells: evidence for distinct expression profiles. ExpHemat. 2004. 32(1): 104-112. Fong L, Mengozzi M, Abbey M, Herndier BG, Engleman EG. Productive infection of plasmacytoid dendritic cells with human immunodeficiency virus type 1 is triggered by CD40 ligation. JVirol. 2002. 76(21): 11033-11041.

PAGE 117

103 George JW, Pedersen NC and Higgins J. The effect of age on the course of experimental feline immunodeficiency virus infection in cats. AIDS Research and Human Retroviruses. 1993. 9(9): 897-905. Giordani L, Giacomini, E, Quarenta MG, Viora M. HIV-1 Nef protein inhibits the in vitro induction of a specific antibody response to Candida albicans by an early up-regulation of IL-15 production. ClinExpImmunol. 2000. 122(3): 358-363. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods. 2001. 25(4): 386-401. Gurney KB, Colantonio AD, Blom B, Spits H, Uittenbogaart CH. Endogenous IFN-alpha production by plasmacytoid dendritic cells exerts an antiviral effect on thymic HIV-1 infection. JImmunol. 2004. 173(12): 7269-7276. Haigwood NL. Predictive value of primate models of AIDS. AIDSRev. 2004. 6(4): 187-198. Hare KJ, Jenkinson EJ and Anderson G. An essential role for the IL-7 receptor during intrathymic expansion of the positively selected neonatal T cell repertoire. JImmunol. 2000. 165: 2410-2414. Hayes KA, Phipps AJ, Francke S and Mathes LE. Antiviral therapy reduces viral burden but does not prevent thymic involution in young cats infected with feline immunodeficiency virus. AntimicrobAgentsChemother. 2000. 44(9): 2399-2405. Hazra R and Mackall C. Thymic function in HIV infection. CurrHIV/AIDS Rep. 2005. 2(1): 24-28. Hein J, Schellenberg U, Bein G, Hackstein H. Quantification of murine IFN-gamma mRNA and protein expression: impact of real-time kinetic RT-PCR using SYBR green I dye. ScandJImmunol. 2001. 54(3): 285-291. Jablonowski H. IFN-alpha: therapeutic options in HIV and HIV/HCV, HIV/HBV dual infection. Infection. 2003. 31(2):131-3. Johnson CM, Bortnick SJ, Crawford PC and Papadi G. Unique susceptibility of the fetal thymus to feline immunodeficiency virus infection: an animal model for HIV infection in utero. AmJReprodImmunol. 2001. 45(5): 273-288. Johnson V, Byington R, Walker B. Reverse transcriptase (RT) activity assay. 1990. In AA Aldovini and BD Walker Techniques in HIV Reasearch. Stockton Press, NY, NY.

PAGE 118

104 Kedzierska K, Azzam R, Ellery P, Mak J, Jaworowski A, and Crowe SM. Defective phagocytosis by human monocyte/macrophages following HIV-1 infection: underlying mechanisms and modulation by adjunctive cytokine therapy. JClinVirol. 2003. 26(2):247-63. Khoury M and A Kovacs. Pediatric HIV infection. Clin Obstet Gynecol. 2001. 44(2): 243-275. Kimata JT. HIV-1 fitness and disease progress: insights from the SIV-macaque model. CurrHIVRes. 2006. 4(1): 65-77. Klein SA, Dobmeyer JM, Dobmeyer TS, Pape M, Ottmann OG, Helm EB, Hoelzer D and Rossol R. Demonstration of the Th1 to Th2 cytokine shift during the course of HIV-1 infection using cytoplasmic cytokine detection on single cell level by flow cytometry. AIDS. 1997. 11(9): 1111-1118. Koka PS, Brooks DG, Razai A, Kitchen CM, Zack JA. HIV type 1 infection alter cytokine mRNA expression in thymus. AIDSResHumRetroviruses. 2003. 19(1): 1-12. Kopka J, Mecikovsky D, Aulicino PC, Mangano AM, Rocco CA, Bologna R, Sen L. High IL-7 plasma levels may induce and predict the emergence of HIV-1 virulent strains in pediatric infection. JClinVirol. 2005. 33(3): 237-242. Lehtonen A, Lund R, Lahesmaa R, Julkunen I, Sareneva T, Matikainen S. IFN-alpha and IL-12 activate IFN regulatory factor 1 (IRF-1), IRF-4, and IRF-8 gene expression in human NK and T cells. Cytokine. 2003. 24(3): 81-90. Lelievre JD, Petit F, Arnoult D, Ameisen JC, Estaquier J. Interleukin 7 increases human immunodefiency virus type 1 LAI-mediated Fas-induced T-cell death. JVirol. 2005. 79(5): 3195-3199. Levy JA. HIV pathogenesis: knowledge gained after two decades of research. AdvDentRes. 2006. 19(1): 10-16. Liang Y, Hudson, Levy J, Ritchey J, Tompkins W, Tompkins M. T cell overexpressing interferon-gamma and interleukin-10 are found in both the thymus and secondary lymphoid tissues of feline immunodeficiency virus-infected cats. JInfectDis. 2000. 181: 564-575. Lin Q, Dong C, Cooper M. Impairment of T and B cell development by treatment with a Type I interferon. JExpMed. 1998. 187(1): 79-87. Lor K, Smed-Sorensen A, Vasudevan J, Mascola JR, Koup RA. Myeloid and plasmacytoid dendritic cells transfer HIV-1 preferentially to antigen-specific CD4+ T cells. JExpMed. 2005. 201(12): 2023-2033.

PAGE 119

105 Martinez V, Costagliola D, Bonduelle O, Ngo N, Schnuriger A, Theodorou I, Clauvel JP, Sicard D, Agut H, Debre P, Rouzioux C, Autran B. Combination of HIV-1-specific CD4 Th1 cell responses and IgG2 antibodies is the best predictor for persistence of long-term nonprogression. JInfectDis. 2005. 191(12): 2053-2063. McCune JM. The dynamics of CD4 + T-cell depletion in HIV disease. Nature. 2001. 410: 974-979. Meissner EG, Duus KM, Loomis R, DAgostin R and Su L. HIV-1 replication and pathogenesis in the human thymus. CurrHIVRes. 2003. 1(3):275-285. Mertsching E, Burdet C and Ceredig R. IL-7 transgenic mice: analysis of the role of IL-7 in the differentiation of thymocytes in vivo and in vitro. IntImmunol. 1995. 7(3): 401-414. Morrissey PJ, McKenna H, Widmer MB, Braddy S, Voice R, Charrier K, Williams DE and Watson JD. Steel factor (c-kit ligand) stimulates the in vitro growth of immature CD3 CD4 CD8 thymocytes: synergy with IL-7. CellImmunol. 1994. 157(1): 118-131. Mueller YM, Petrovas C, Bojczuk PM, Dimitriou ID, Beer B, Silvera P, Villinger F, Cairns JS, Gracely EJ, Lewis MG, Katsikis PD. IL-15 increases effector memory CD8+ T cells and NK cells in simian immunodeficiency virus-infected macaques. JVirol. 2005. 79(8): 4877-4885. Muhl H and Pfeilschifter J. Anti-inflammatory properties of pro-inflammatory interferon-gamma. IntImmunopharmacol. 2003. 3(9): 1247-55. Murphy PM, Lane CH, Gallin JI and Fauci AS. Marked disparity in incidence in bacterial infections in patients with the acquired immunodeficiency syndrome receiving interleukin-2 and interferon-gamma. AnnInternMed. 1988. :36. 108 Nagai A, Taira O, Ishikawa M, Hiramatsu K, Hohdatsu T, Koyama H, Arai S, Sato H, Nakano K, Maehara N. Cloning of cDNAs encoding multiple subtypes of feline interferon-alpha from the feline epithelial cell line. JVetMedSci. 2004. 66(6): 725-728. Napolitano LA, Grant RM, Deeks SG, Schmidt D, De Rosa SC, Herzenberg LA, Herndier BG, Andersson J and McCune JM. Increased production of IL-7 accompanies HIV-1-mediated depletion: implications for T-cell homeostasis. NatureMedicine. 2001. 7(1): 73-79. Neben K, Heidbreder M, Mller J, Marxer A, Petry J, Didier A, Schimpl A, Hnig T and Kerkau T. Impaired thymopoietic potential of immature CD3 CD4 + CD8 T cell precursors from SIV-infected rhesus monkeys. IntImmunol. 1999. 11(9): 1509-1518.

PAGE 120

106 Norway RM, Crawford PC, Johnson CM and Mergia A. Thymic lesions in cats infected with a pathogenic molecular clone or and ORF-A/2-deficient molecular clone of feline immunodeficiency virus. JVirol. 2001. 75(13): 5833-5841. Okada T, Lian ZX, Naiki M, Ansari A, Ikehara S, Gershwin M. Murine thymic plasmacytoid dendritic cells. EurJImmunol. 2003. 33: 1012-1019. Onlamoon N, Pattanapanyasat K, Ansari AA. Impaired IFN-gamma production by viral immunodominant peptide-specific tetramer+ CD8+ T cells in HIV-1 infected patients is not secondary to HAART. ClinDevImmunol. 2004. 11(3-4): 287-298. Or R, Abdul-Hai A, and Ben-Yehuda A. Reviewing the potential utility of interleukin-7 as a promoter of thymopoiesis and immune recovery. CytokinesCellMolTher. 1998. 4(4): 287-294. Orandle MS, Crawford PC, Levy JK, Udoji R, Papadi GP, Ciccarone T, Mergia A and Johnson CM. CD8+ thymic lymphocytes express reduced levels of CD8 and increased interferonin cats perinatally infected with the JSY3 molecular clone of feline immunodeficiency virus. AIDSResHumRetroviruses. 2000. 16(15): 1559-1571. Orandle MS, Papadi GP, Bubenik LJ, Dailey CI and Johnson CM. Selective thymocyte depletion and immunoglobulin coating in the thymus of cats infected with feline immunodeficiency virus. AIDSResHumRetroviruses. 1997. 13(7): 611-620. Oshima S, Nakamura T, Namiki S, Okada E, Tsuchiya K, Okamoto R, Yamazaki M, Yokota T, Aida M, Yamaquchi Y, Kanai T, Handa H, Watanabe M. Interferon regulatory factor 1 (IRF-1) and IRF-2 distinctively up-regulate gene expression and production of interleukin-7 in human intestinal epithelial cells. MolCellBiol. 2004. 24(14): 6298-6310. Overbergh L, Giulietti A, Valckx D, Decallonne R, Bouillon R, Mathieu C. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. JBiomolTech. 2003. 14(1): 33-43. Pedroza-Martins L, Boscardin WJ, Anisman-Posner DJ, Schols D, Bryson YJ, and Uittenbogaart CH. Impact of cytokines on replication in the thymus of primary human immunodeficiency virus type 1 isolates from infants. JVirol. 2002. 76(14): 6929-6943. Phipps AJ, Hayes KA, Buck WR, Podell, and Mathes LE. Neurophysiologic and immunologic abnormalities associated with feline immunodeficiency virus molecular clone FIV-PPR DNA inoculation. JAIDS. 2000. 23: 8-16. Poli G, Biswas P and Fauci AS. Interferons in the pathogenesis and treatment of human immunodeficiency virus infection. AntiviralRes. 1991. 24: 221-233.

PAGE 121

107 Pontzer CH, Yamamoto JK, Bazer FW, Ott TL, Johnson HM. Potent anti-feline immunodeficiency virus and anti-human immunodeficiency virus effect of IFN-tau. JImmnol. 1997. 158(9): 4351-4357. Power C, Buist R, Johnston JB, Del Bigio MR, Ni W, Dawood MR and Peeling J. Neurovirulence in feline immunodefiency-infected neonatal cats is viral strain specific and dependent on systemic immune suppression. JVirol. 1998. 72(11): 9109-9115. Prlic M, Lefrancois, L, Jameson SC. Multiple choices: Regulation of memory CD8 T cell generation and homeostasis by Interleukin (IL)-7 and IL-15. JExpMed. 2002. 195(12): F49-52. Rajeevan M, Ranamukhaarachchi D, Vernon S, Unger E. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods. 2001. 25(4): 443-451. Reed SG, Da Silva JS, Ho JL, Koehler, Russo DM, Pihl DL and Coombs RW. Cytokine activation of human macrophages infected with HIV-1 to inhibit intracellular protozoa. JAcquirImmunDefi Syndr. 1992. 5 : 666. Resino S, Galan I, Correa R, Pajuelo L, Bellon JM, Munoz-Fernandez MA. Homeostatic role of IL-7 in HIV-1 infected children on HAART: association with immunological and virological parameters. ActaPaediatr. 2005. 94(2): 170-177. Rethi B, Fluur C, Atlas A, Krzyzowska M, Mowafi F, Grutzmeier S, De Milito A, Bellocco R, Falk KI, Rajnavolgyi E, Chiodi F. Loss of IL-7Ralpha is associated with CD4 T-cell depletion, high interleukin-7 levels and CD28 down-regulation in HIV infected patients. AIDS. 2005. 19(18): 2077-2086. Robertson P and Poznansky MC. T-lymphocyte development and models of thymopoietic reconstitution. TransplInfectDis. 2003. 5(1): 38-42. Rodrigues DB, Correia D, Marra MD, Giraldo LE, Lages-Silva E, Silva-Vergara ML, Barata CH, Rodrigues Jr V. Cytokine serum levels in patients infected by HIV with and without Trypanosoma cruzi coinfection. RevSocBrasMedTrop. 2005. 38(6): 483-487. Saez R, Echaniz P, de Juan MD, Iribarren JA, Cuadrado E. HIV-infected progressors and long-term non-progressors differ in their capacity to respond to an A-class CpG oligodeoxynucleotide. AIDS. 2005. 19(16): 1924-1925. Samuel CE. Antiviral actions of interferons. ClinMicrobiolRev. 2001. 14(4): 778-809. Santana MA and Rosenstein Y. What it takes to become an effector T cell: the process, the cells involved, and the mechanisms. JCellPhys. 2003. 195: 392-401.

PAGE 122

108 Schmitt N, Nugeyre M, Scott-Algara, D, Cumont M, Barre-Sinoussi F, Pancino G, Israel N. Differential susceptibility of human thymic dendritic cell subsets to X4 and R5 HIV-1 infection. AIDS. 2006. 20: 533-542. Sen GC. Viruses and interferons. AnnuRevMicrobiol. 2001. 55: 255-81. Siegal F. Interferon-producing plasmacytoid dendritic cells and the pathogenesis of AIDS. ResInitiatTreatAction. 2003. 8(2): 10-3. Siegal FP, Kadowski N, Shodell M, Fitzgerald-Bocarsly PA, Shah K, Ho S, Antonenko S, Liu YJ. The nature of the principal type 1 interferon-producing cells in human blood. Science. 1999. 284(5421): 1835-1837. Sindhu S, Toma E, Cordeiro P, Ahmad R, Morisset R, Menezes J. Relationship of in vivo and ex vivo levels of Th1 and Th2 cytokines with viremia in HAART patients with and without opportunistic infections. JMedVirol. 2006. 78(4): 431-439. Sleijfer S, Bannink M, Van Gool A, Kruit W, Stoter G. Side effects of interferon-alpha therapy. PharmWorldSci. 2005. 27(6): 423-431. Soumelis V, Scott I, Gheyas F, Bouhour D, Cozon G, Cotte L, Huang L, Levy J, Liu L-J. Depletion of circulating natural type 1 interferon-producing cells in HIV-infected AIDS patients. Blood. 2001. 98(4): 906-912. Steffens CM, Al-Harthi L, Shott S, Yogev R, Landay A. Evaluation of thymopoiesis using T cell receptor excision circles (TRECs): differential correlation between adult and pediatric TRECs and nave phenotypes. ClinImmunol. 2000. 97(2): 95-101. Sutton C, Gordnier P, Avery R, Casey J. Comparative replication kinetics of cytopathic feline lentiviruses ex vivo. Virology. 2005. 332(2): 519-528. Tanabe T and Yamamoto JK. Feline immunodeficiency virus lacks sensitivity to the antiviral activity of feline IFN-. JInterferonCytokineRes. 2001. 21(12): 1039-46. Uittenbogaart CH, Boscardin WJ, Anisman-Posner DJ, Koka PS, Bristol G and Zack JA. Effect of cytokines on HIV-induced depletion of thymocytes in vivo. AIDS. 2000. 14: 1317-1325. Uittenbogaart CH, Higashitani S, Schmid I, Vollger LW, Boone T and Clement LT. Interleukin-4 induces expression of the CD45RA antigen on human thymocyte subpopulations. IntImmunol. 1990. 2(12): 1179-1187. UNAIDS/WHO: Global summary of the HIV and AIDS epidemic, December 2005. von Hoegen P. Synergistic role of type I interferons in the induction of protective cytotoxic T lymphocytes. ImmunolLett. 1995. 47(3): 157-162.

PAGE 123

109 Waldmann T. The contrasting roles of IL-2 and IL-15 in the life and death of lymphocytes: implications for the immunotherapy of rheumatological diseases. ArthritisRes. 2002. 4 Suppl 3: S161-167. Wang FX, Xu Y, Sullivan J, Souder E, Argyris EG, Acheampong EA, Fisher J, Sierra M, Thomson MM, Najera R, Frank I, Kulkosky J, Pomerantz RJ, Nunnari G. IL-7 is a potent and proviral strain-specific inducer of latent HIV-1 cellular reservoirs of infected individuals of virally suppressive HAART. JClinInvest. 2005. 115(1): 128-137. Weitzmann MN, Cenci S, Rifas L, Brown C, Pacifici R. Interleukin-7 stimulates osteoclast formation by up-regulating the T-cell production of soluble osteoclastogenic cytokines. Blood. 2000. 96(5): 1873-1878. Willett BJ, Flynn JN, Hosie MJ. FIV infection of the domestic cat: an animal model for AIDS. ImmunolToday. 1997. 18(4): 182-189. Woo J, Dean G, Pedersen N, Moore P. Immunopathologic changes in the thymus during the acute stage of experimentally induced feline immunodeficiency virus infection of juvenile cats. JVirol. 1997. 71(11): 8632-8641. Wu L, Shortman K. Heterogeneity of thymic dendritic cells. SemImmunol. 2005. 17(4): 304-312. Ye P, Kirschner DE and Kourtis AP. The thymus during HIV disease: role in pathogenesis and in immune recovery. CurrHIVRes. 2004. 2: 177-183. Yin J, Shackel N, Zekry A McGuinness P, Richards C Putten KV, McCaughan GW, Eris J, Bishop G. Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. ImmunolCellBiol. 2001. 79(3): 213-221. Yonezawa A, Morita R, Takaori-Kondo A, Kadowaki N, Kitawaki T, Hori T, Uchiyama T. Natural alpha interferon-producing cells respond to human immunodeficiency virus type 1 with alpha interferon production and maturation into dendritic cells. JVirol. 2003. 77(6): 3777-3784. Young CD and JB Angel. Optimization of culture and storage conditions for an in vitro system to evaluate thymocyte phenotype and function. JImmunolMethods. 2006. 312(1-2): 157-166. Young HA. Unraveling the pros and cons of interferon-gamma gene regulation. Immunity. 2006. 24(5): 506-507. Yu Q, Erman B, Bhandoola A, Sharrow SO, and Singer A. In vitro evidence that cytokine receptor signals are required for differentiation of double positive thymocytes into functionally mature CD8+ T cells. JExpMed. 2003. 197(4): 475-87.

PAGE 124

110 Zhou Y, Wang S, Gobl A, Oberg K. The interferon-alpha regulation of IRF-1 and IRF-2 has therapeutic implications of carcinoid tumors. AnnOncol. 2000. 11(6): 707-714.

PAGE 125

BIOGRAPHICAL SKETCH Holly Meredith Kolenda-Roberts was born on July 6, 1973 in Cary, North Carolina. She attended Florida State University, graduating with a Bachelor of Science in Biological Sciences. She then attended the University of Florida, College of Veterinary Medicine and graduated with a Doctorate of Veterinary Medicine in 2000. She continued on at the University of Florida, pursuing a combined program for a residency in anatomic pathology and a doctoral degree in the laboratories of Drs. Calvin Johnson and Ayalew Mergia in the Department of Pathobiology, College of Veterinary Medicine. After graduation, she intends to pursue a career as a veterinary pathologist. 111


Permanent Link: http://ufdc.ufl.edu/UFE0017502/00001

Material Information

Title: Cytokine Profiles and Viral Replication within the Thymuses of Neonatally Feline Immunodeficiency Virus-Infected Cats
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017502:00001

Permanent Link: http://ufdc.ufl.edu/UFE0017502/00001

Material Information

Title: Cytokine Profiles and Viral Replication within the Thymuses of Neonatally Feline Immunodeficiency Virus-Infected Cats
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0017502:00001


This item has the following downloads:


Full Text











CYTOKINE PROFILES AND VIRAL REPLICATION WITHIN
THE THYMUSES OF NEONATALLY FELINE
IMMU7NODEFICIENCY VIRUS-INFECTED CATS













By

HOLLY MEREDITH KOLENDA-ROBERTS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006
































Copyright 2006

by

Holly Meredith Kolenda-Roberts
















ACKNOWLEDGMENTS

I would like to thank Dr. Calvin Johnson for creating a wonderful working and

learning environment, and for all of his ongoing support and wisdom.

I would like to thank Dr Ayalew Mergia for agreeing to supervise my research and

act as my committee chairman after Dr. Johnson's transfer to Auburn University. He

helped smooth the transition and provided a supportive environment for the completion

of this proj ect.

My deepest appreciation goes to my supervisory committee comprising Dr. Pamela

Ginn, Dr. Maureen Goodenow and Dr. Steeve Giguere for their valuable time, interest in

the project, professionalism and advice. My sincerest appreciation also goes to Debbie

Couch and Sally O'Connell, who have helped me with countless day-to-day issues with a

smile and without whom I couldn't have even registered for classes. I would like to

thank George Papadi, Abigail Carrefio and Peter Nadeau for their support in the lab,

advice and technical assistance.

And I would like to thank Janelle Novak, my Siamese twin, for making coming to

work fun. My project benefited from our discourse.





















TABLE OF CONTENTS


page


ACKNOWLEDGMENT S ................. ................. iii........ ....


LIST OF TABLES ................ ..............vii .......... ....


LI ST OF FIGURE S .............. .................... ix


AB S TRAC T ......_ ................. ..........._..._ xiii..


CHAPTER


1 INTRODUCTION ................. ...............1.......... ......


Human Immunodeficiency Virus .............. ...............1.....
Animal Models for HIV Infection............... ...............2
Neonatal FIV Infection............... ...............2
The Thymus ................ ...............3.................

Cytokines ................ ...............5.................
Goals of Study .............. ...............6.....


2 LITERATURE REVIEW .............. ...............8.....


Interleukin-7 .............. ...............8.....
Interleukin-4 .............. ...............10....
Interleukin-15 ............. ..... __ ...............11...

Interferon-y .............. ...............13....


3 DETERMINATION OF FELINE CYTOKINE SEQUENCES .............. ........._.....18


Introducti on ................. ...............18.................
Materials and Methods .............. ...............18....

Prim er Design ................. ...............18........ ......
Synthesis of cDNA ............... ... ... ....__ .............. .. ..........1
Construction and Use of a Plasmid Containing Cytokine Sequence Inserts.......20
Re sults................ .. ..... ...............22....
Plasmid Construction................ .............2
Feline Cytokine cDNA Sequences .............. ...............24....
Discussion ................. ...............29.................












4 MEASUREMENT OF FIV GAG MESSENGER RNA AND DNA, AND IL-4,
IL-7, IL-15, IFN-ALPHA AND INTERFERON-GAMMA MES SENGER RNA
LEVELS IN THE THYMUSES OF CATS NEONATALLY INFECTED WITH
F IV ................ ...............3.. 0...._ _.....


Introducti on .................. ...............30._ ___.......
M material s And M ethod s ............... ..... ...... ........... .............

Quantitative Real-Time PCR for Feline Cytokine mRNA ................. ...............31
Quantitative Real-Time PCR for FIV Provirus. ............. .....................3
Quantitative Real-Time PCR for FIV Transcription. ............. .....................3
Statistical Analy si s............... ...............3
Re sults ................. ...............35.................
Interl eukin-4 .............. ...............3 5....
Interleukin-7 .............. ...............37....
Interleukin-15 ............ _...... ._ ...............39...
Interferon-y ............._ ....._.. ...............41.....
Interferon-a..................... .. ... .... .. .. .. .... ...........4
Viral Transcription (FIV gag RNA) and Proviral Load (FIV gag DNA)...........45
Discussion ................. ...............47.................


5 IMPACT OF CYTOKINE CHANGES ON FIV REPLICATION AND THYMIC
CELLULAR COMPO SITION ................. ......... ...............49......


Introducti on ................. ...............49.................
M materials and M ethods .............. ...............50....
R e sults................ ... ............ ............ .............5
Profile of Thymocyte Subpopulations ................. ............. ......... .......51
Peripheral Blood Counts............ ...... ...... ............ ...............6
Pairwise Correlations of Lymphocyte Subsets to Viral and Cytokine
Parameters ................. ...............62.................
Discussion ................. ...............64.................


6 DETECTION OF FIV-INFECTED CELLS AND IFN-PRODUCING CELLS
WITHIN THE THYMUS OF NORMAL AND FIV-INFECTED CATS..................67


Introducti on ............ _. .... ._ ...............67...
Materials and Methods ................ ...............68.

Single-Label Immunohistochemistry .............. ...............68....
Double-Label Immunohistochemistry ................. ........... ....___........69
Statistical Analysis .............. ...............70....
Re sults........._...... ......._._........ .... ............7

Single-Label Immunohistochemistry .............. ...............71....
Double-Label Immunohistochemistry .............. ...............76....


7 SUSCEPTIBILITY OF THYMOCYTES TO FIV CHALLENGE IN VITRO.........80


Introducti on ........._.. ..... ._ ...............80.....












Materials And Methods .............. ...............80....
R e sults................... ..... .. ............ ............... ....... .............8

Viral Replication in Thymocyte and CD4E Cell Culture Systems. ....................81
Viability of Thymocytes In Vitro ............................. ............... 82.....

Cytopathic Viral Effects on Thymocyte Cultures. ............. .....................8
Discussion ................. ...............87.................


8 CONCLUSIONS .............. ...............89....


LIST OF REFERENCES ................. ...............100................


BIOGRAPHICAL SKETCH ................. ...............111......... ......


















LIST OF TABLES


Table pg

3-1 Oligonucleotide primers and probes used for nested PCR protocols.............._.._. ...19

4-1 Primers and probes used for real-time RT-PCR. ........._.._. ......_. ........._.....34

4-2 Relative IL-4 mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample. ............. ...............36.....

4-3 P values from pairwise comparison of IL-4 levels, animal groups 1-6 from Table
4-2............... ...............36..

4-4 Relative IL-7 mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample. ............. ...............38.....

4-5 P values from pairwise comparison of IL-7 levels, animal groups 1-6 from Table
4-4............... ...............38..

4-6 Relative IL-15 mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample. ............. ...............40.....

4-7 P values from pairwise comparison of IL-15 levels, animal groups 1-6 from
Table 4-6. ............. ...............40.....

4-8 Relative IFN-y mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample. ............. ...............42.....

4-9 P values from pairwise comparison of IFN-y levels, animal groups 1-6 from
Table 4-8. ............. ...............42.....

4-10 Relative IFN-a mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample. ............. ...............44.....

4-11 P values from pairwise comparison of IFN-a levels, animal groups 1-6 from
Table 4-10. ............. ...............44.....

4-12 Relative viral gag RNA expression and viral DNA loads within feline thymic
samples as measured with real time RT-PCR. ............. ...............46.....










5-1 Historical data for absolute total thymocyte counts and absolute number of total
thymocytes, double-negative thymocytes and IgG+ cells (B cells) in thymus
samples from animals infected with JSY3, a pathogenic molecular clone of FIV,
and age-matched control animals at three different time points. ............. ................53

5-2 Historical data for absolute number of double-positive CD4+CD8+ thymocytes
and the percentage of total thymocytes exhibiting the CD4+CD8+ phenotype in
thymus samples from animals infected with JSY3, a pathogenic molecular clone
of FIV, and age-matched control animals at three different time points. .................54

5-3 Historical data for absolute number of CD4+ thymic cells and the percentage of
total thymic cells exhibiting the CD4+ phenotype in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. ............. .....................5

5-4 Historical data for absolute number of CD8+ thymic cells and the percentage of
total thymic cells exhibiting the CD8+ phenotype in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. ............. .....................5

5-5 Historical data for absolute number of total white blood cells, CD4+ T cells and
CD8+ T cells within peripheral blood samples from animals infected with JSY3,
a pathogenic molecular clone of FIV, and age-matched control animals at three
different time points. ............. ...............60.....

5-6 Summary of Pearson' s pairwise correlations of historical necropsy data,
measured cytokine values and viral parameters .......................__ ...............63

6-1 Number of DLEC+ cells per unit of thymic area ................. ................ ...._..76

6-2 Number of IFN+ cells per unit of thymic area. ................. ........ ................. 76

















LIST OF FIGURES


Figure pg

3-1 Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IFN-y insert. ..............22

3-2 Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IFN-a insert ..............23

3-3 Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing feline IL-4 and IL-15 inserts .23

3-4 Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IL-7 insert ...............24

3-5 Full length nucleotide sequence of the feline IFN-y cDNA ................. ................. 24

3-6 Full length nucleotide sequence of the feline IFN-a cDNA ................. .................2 5

3-7 Full length nucleotide sequence of the feline IL-4 cDNA ................. ................. 26

3-8 Full length nucleotide sequence of the feline IL-7 cDNA ................. ................. 27

3-9 Full length nucleotide sequence of the feline IL-15 cDNA ................. ................. 28

4-1 Measurement of relative IL-4 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls ................... .37

4-2 Measurement of relative IL-7 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls ................... .39

4-3 Measurement of relative IL-15 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls ................... .41

4-4 Measurement of relative IFN- y mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls ................... .43

4-5 Measurement of relative IFN-a mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls ................... .45










4-6 Measurement of relative viral gag RNA expression by real time RT-PCR in
thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time
points after neonatal infection. .............. ...............46....

4-7 Measurement of relative viral gag DNA content by real time RT-PCR in thymic
samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time points after
neonatal infection. ............. ...............47.....

5-1 Historical flow cytometry results from previous published experiments: absolute
numbers of total thymocytes present in thymus samples from animals infected
with JSY3, a pathogenic molecular clone of FIV, and age-matched control
animals at three different time points ................. ...............55...............

5-2 Historical flow cytometry results from previous published experiments: absolute
numbers of double-negative (DN) CD4-CD8- cells present in thymus samples
from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points ................ .....................56

5-3 Historical flow cytometry results from previous published experiments: absolute
numbers of IgG+ cells (B cells) present in thymus samples from animals
infected with JSY3, a pathogenic molecular clone of FIV, and age-matched
control animals at three different time point ................ ............... ......... ...56

5-4 Historical flow cytometry results from previous published experiments: absolute
numbers of CD4+CD8+ thymocytes present in thymus samples from animals
infected with JSY3, a pathogenic molecular clone of FIV, and age-matched
control animals at three different time points ................. ................ ......... .57

5-5 Historical flow cytometry results from previous published experiments:
percentage of CD4+CD8+ thymocytes present in thymus samples from animals
infected with JSY3, a pathogenic molecular clone of FIV, and age-matched
control animals at three different time points............... ...............57.

5-6 Historical flow cytometry results from previous published experiments: absolute
numbers of single-positive (SP) CD4+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points ................ .....................58

5-7 Historical flow cytometry results from previous published experiments:
percentage of single-positive (SP) CD4+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points ................ .....................58

5-8 Historical flow cytometry results from previous published experiments: absolute
numbers of single-positive (SP) CD8+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. ............. .....................5










5-9 Historical flow cytometry results from previous published experiments:
percentage of single-positive (SP) CD8+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points............__ .........__ ......59

5-10 Historical flow cytometry results from previous published experiments: absolute
numbers of white blood cells present in peripheral blood samples from animals
infected with JSY3, a pathogenic molecular clone of FIV, and age-matched
control animals at three different time points............... ...............61.

5-11 Historical flow cytometry results from previous published experiments: absolute
numbers of single-positive (SP) CD4+ cells present in peripheral blood samples
from animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points............___ .........__ ......61

5-12 Historical flow cytometry results from previous published experiments: absolute
numbers of single-positive (SP) CD8+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. ............. .....................6

6-1 40X. Single-label immunohistochemistry with a polyclonal antibody against
human BDCA-2 (DLEC) performed on thymic sections from a 16-week-old,
uninfected kitten ................. ...............71.................

6-2 60X. Single-label immunohistochemistry with a polyclonal antibody against
human BDCA-2 (DLEC) performed on thymic sections from an 8-week-old
kitten infected with FIV .............. ...............72....

6-3 40X. Single-label immunohistochemistry with an antibody against IFN-a
performed on thymic sections from a 16-week-old, uninfected kitten...................73

6-4 10X. Single-label immunohistochemistry with an antibody against IFN-a
performed on thymic sections from an 8-week-old kitten infected with FIV..........74

6-5 10X. Single-label immunohistochemistry with mAb against FIV p24 performed
on thymic sections from an 8-week-old kitten infected with FIV. ................... ........75

6-6 40X. Double-label immunohistochemistry for DLEC and IFN-a performed on
thymic sections from an 8-week-old kitten infected with FIV. .............. .... ........._..77

6-7 40X. Double-label immunohistochemistry for DLEC and FIV p24 performed on
thymic sections from an 8-week-old kitten infected with FIV............... ................78

7-1 Summary of reverse transcriptase (RT) activity in cell cultures of CD4E cells
and fetal thymocytes in one of three series of experiments. ................ ................82

7-2 Number of viable cells on day 9 of cell culture in one of three attempted
exp eri ments .......... ................ ...............83......











7-3 Appearance of freshly thawed CD4E cells at the outset of the cell culture
experim ents. ............. ...............84.....

7-4 Appearance of freshly thawed thymocytes at the outset of cell culture ................... 84

7-5 CD4E cells at Day 9 of culture experiments ................ ...............85........... .

7-6 Fetal thymocyte cells at Day 9 of culture experiments .............. ....................8
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CYTOKINE PROFILES AND VIRAL REPLICATION WITHIN
THE THYMUSES OF NEONATALLY FELINE
IMMU7NODEFICIENCY VIRUS-INFECTED CATS

By

Holly Meredith Kolenda-Roberts

December 2006

Chair: Ayalew Mergia
Major: Veterinary Medical Sciences

Reported in these studies are immunological, virological and cytological changes

within the thymuses of cats infected with feline immunodeficiency virus (FIV) at birth,

an important animal model for human immunodeficiency virus infection.

The obj ective of the first study was to identify the genetic sequences encoding the

cytokine mRNAs of interest. Elucidation of the five investigated cytokine sequences was

successful, and results were verified against known sequences in other species.

Cytokine sequences were used to design primers and probes for use in the next

experiment. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was

used to assess changes in mRNA expression that occurs in vivo at acute, intermediary and

chronic stages of neonatal FIV infection when compared to age-matched controls. The

concurrent proviral load and viral gene expression were measured. Compiled cytokine

and viral data were analyzed with the corresponding necropsy data from the experimental









animals to find correlations between pathological changes to the immune system and the

relative levels of cytokines. A loss of mRNA expression of interleukin (IL)-4, IL-7,

interferon (IFN)-a and IFN-y was observed in chronic infection, and the decreases in IL-

7, IFN-a and IFN-y were positively correlated with the loss of thymocytes observed with

FIV infection. Levels of IFN-y were positively correlated with viral gene expression.

The loss of IFN-a expression, a molecule with antiviral properties, was further

investigated. A major cell producer of IFN is the plasmacytoid dendritic cell (PDC), so

immunohistochemistry (IHC) was performed in order to detect this cell in thymus

samples. It was determined that this cell type is present in inflammatory germinal centers

of the infected thymuses, and that they harbor FIV gag RNA, which may result in lytic

infection, functional loss and decreased IFN-a mRNA expression.

Attempts to productively infect fetal thymocytes with FIV in order to evaluate

potential protective effects of IFN-a treatment were unsuccessful. This supported our

IHC analysis of thymuses for viral protein, which showed that only mature cells within

germinal centers and the thymic medulla were infected. This study indicates that further

FIV research regarding thymic PDC, IL-7 and IFN expression is warranted.















CHAPTER 1
INTTRODUCTION

Human Immunodeficiency Virus

In 2005, it was estimated that over 40 million people globally were infected with

human immunodeficiency virus (HIV), including 2 million children (UNAIDS/WHO,

2005). There were approximately 700,000 new infections and 570,000 deaths in children

in 2005. The rates of infection, disease spread and mortality continue to exceed

predictions. While the introduction of highly active retroviral therapy (HAART) has

improved individual disease progression, overall mortality has leveled off after

improvements noted in 1996-1997. The production of a successful vaccine for HIV

remains elusive, and further investigation of the pathogenesis of the disease is being used

to further elucidate potential therapeutic targets.

Most pediatric HIV cases are a result of vertical transmission from infected women,

and can occur in utero, during birth or after the ingestion of infected milk, with the

greatest number occurring during the peripartum/neonatal period (Khoury, 2001).

Pediatric infection occurs at a time of immunological immaturity, with a third of cases

having rapidly progressive disease. Children have a higher incidence of neurologic

abnormalities, cardiomyopathy, and pulmonary complications including lymphoid

interstitial pneumonia. As the course of infection is related to degree of immunological

development and the resulting host response to infection, a greater understanding is

needed of the age-related factors impacting lentiviral pathogenesis.









Animal Models for HIV Infection

One of the preeminent goals in HIV research is to develop a suitable animal model

for infection, where infection can be controlled and tissues can be obtained for study

throughout the course of infection. HIV, feline immunodeficiency virus (FIV) and

simian immunodeficiency virus (SIV) all belong to the lentivirus genus of retroviruses.

Clinical disease associated with these agents is characterized by progressive deterioration

of the host immune function, ultimately leading to acquired immunodeficiency syndrome

(AIDS) (Levy, 2006). The similarities between the viruses and their clinical courses have

prompted the use of SIV (Haigwood, 2004; Kimata, 2006) and FIV (Willett BJ, 1997;

Burkhard, 2003) as animal models of AIDS pathogenesis. Both viruses exhibit tropism

for many cells of the immune system, including the CD4+ subset of T lymphocytes which

are responsible for much of the cell signaling and initiation of the acquired immune

response. As the number of CD4+ cells dwindles within the course of infection, the host

becomes susceptible to opportunistic infections and degenerative disorders, ultimately

leading to the death of the host. As the use of the primate model can be cost prohibitive,

and primate experiments are generally limited in the number of animals available for

study, FIV therefore offers an attractive alternative.

Neonatal FIV Infection

In an experimental animal model such as the cat, tissue is available for

examination, timing of inoculation is known in relation to the disease course, the effects

of the virus in relation to stage of parturition are identifiable and uninfected littermates

are available as a control for environmental and maternal effects. In experiments with the

Petaluma strain of FIV, neonatally infected animals exhibited a persistent generalized

lymphadenopathy, a more profound neutropenia, a persistent decrease in CD4+/CD8+ T









lymphocyte ratio, and decreased CD4+ T cell count when compared to cats infected as

adults (George, 1993). When compared to age-matched controls, other experiments

using the Petaluma stain appear to produce variable effects. In one study infection

caused decreases in CD4+ cells and increases in CD8+ T cells, but weight gain in kittens

was not impaired (Power, 1998). However, Johnston et al. did not measure significant

decreases in CD4+ T cell counts though the same strain was used (2002). The highly

pathogenic molecular clone JSY3 (derived from the NCSU-1 strain) produces a reduction

in CD4+ T cell numbers and CD4+/CD8+ T cell ratio (Orandle, 2000; Norway, 2001)

that is partially abrogated with an inactivating mutation of the ORF-A gene (Norway,

2001). Similar changes in CD4+ T cells and CD4+/CD8+ T cell ratios were observed

with pFIV-PPR (Phipps, 2000).

The Thymus

The thymus is the maj or site of production for the mammalian immune system' s T

lymphocytes, which are the maj or cellular target for the lentiviruses. Replacement of

these cells as they are lost in the course of infection is by cell division within the

periphery and de novo production by the thymus. As recent thymic emigrants (RTEs)

display novel genetic rearrangements for the T cell receptors (TCRs), these cells maintain

the repertoire by which the immune system can respond to diverse foreign antigens.

Therefore one of the maj or factors in the progression of disease is the loss of the

thymus's ability to replace lymphocytes during immunosuppression. The thymus and the

impact of HIV infection has been extensively reviewed, and it has been shown that the

thymus is directly infected by the lentivirus, resulting in thymocyte depletion and varying

degrees of inflammation (Ye, 2004; Hazra, 2005; Meissner, 2003; de la Rosa, 2003;

Robertson, 2003; al Harthi, 2002). Treatment of HIV infection with highly active









antiretroviral therapy (HAART) does not fully restore thymic function and normal

numbers of circulating T cells. Recovery of circulating CD4+ T cells in response to

successful viral suppression with HAART appears dependent on thymic function

(Fernandez, 2006). The pathogenesis of the thymic infection is an important component

to consider when intending to promote immune reconstitution.

At birth, the human thymus is active, generating the cohort of T cells for the

developing immune system. The thymus continues to increase in size until puberty, after

which it undergoes progressive involution (Aspinall, 2000). Newly produced T cells

contain excised loops of DNA (TCR rearrangement excision circles, TRECs) that are

generated during the genetic rearrangements necessary for surface T cell receptor (TCR)

expression (Steffens, 2000). Compared to uninfected children, vertically infected HIV-

positive children were shown to have lower levels of TRECs in peripheral blood

mononuclear cells (PBMC), indicating impaired thymic output, and this decrease was not

directly related to viral load (Correa, 2002). As children tend to have higher viral loads

and faster disease progression, it has been suggested that these trends may be related to

thymic dysfunction and early involution (Ye, 2004). As overall direct viral infection of

thymocytes is low, the pathogenetic mechanisms behind thymic infection need to be

better understood.

Thymic FIV Infection

As in its overall immune pathophysiology, FIV exhibits similar effects within the

thymus of neonatal cats as HIV has been shown to cause in the thymus of children, and

adequately models this disease process. Neonatal thymus infection with FIV results in a

reduction of thymus-body weight ratio, selective depletion of CD4+CD8+ thymocytes,

cortical atrophy, infiltrations of B cells, formation of lymphoid follicles and deformation









of the thymic architecture (Orandle, 1997; Orandle, 2000; Norway, 2001; Johnson, 2001).

Interestingly, these changes were not ameliorated with effective antiretroviral therapy in

juvenile cats (Hayes, 2000) or with a mutation of the ORF-A gene that yielded lower

viral replication and a lower thymic proviral load (Norway, 2001), suggesting that host

factors and inflammatory processes may be significant factors in the disease process and

thymic disruption. Thymic infection was associated with the emergence of CD8+ T cells

expressing CD8a P'o" and CD8a ineg phenotypes (Orandle, 2000; Crawford, 2001), but

these cells were not found to correlate with reduction in viral load (Crawford, 2001).

Immunohistochemistry of thymic samples showed significant staining for IgG outside of

lymphoid follicles that did not correlate with positive staining for a B cell marker,

suggesting that thymocytes are coated with antibody (Orandle, 1997). Infection was

associated with a 10-fold increase in the expression of interferon (IFN)-y mRNA within

PBMC and within thymic samples in perivascular areas, along the corticomedullary

junction and adj acent to lymphoid follicles (Orandle, 2000). As with HIV, the overall

number of FIV expressing cells within the thymus was low, and the lowest incidence of

productive infection correlated with the most severe histologic lesions (Johnson, 2001).

Cytokines

Cytokines are chemical mediators that are released by cells that result in altered cell

function in the target population. A highly regulated combination of cytokines is

elaborated by cells of the immune system and used to coordinate the overall response to

foreign antigen. HIV infection has been shown to cause a significant impact on host

cytokine profiles. These changes are believed to be associated with the increased

programmed cell death (apoptosis) within uninfected T cells (Badley, 1997), chronic

immune system stimulation (McCune, 2001), defective cell-mediated immunity, and









impairment of the immune system's regenerative capacity (Neben, 1999) that have been

observed in HIV infected people. Modified cytokine production is likely involved in all

of the aforementioned pathologic features, whether secondary to the disease process or

acting as an inciting mechanism.

Thymopoiesis is dependent on a sensitive microenvironment and is regulated by

direct cellular interactions and paracrine cytokine production. Many cytokines used in

the immune response by mature cells are used for alternate functions within the thymus,

such as thymocyte selection and to promote cell survival. The thymus is a primary

lymphoid organ that normally contains relatively few mature lymphocyte populations and

active germinal centers, and the introduction of inflammatory processes impacts the

cytokine milieu, thymopoiesis and viral replication.

Goals of Study

The purpose of this research was to identify immunological factors that impact FIV

infection within the neonatal thymus. A greater understanding of FIV thymic

immunopathogenesis would allow for potential manipulation of cytokines in a way that

would promote thymopoiesis and immune reconstitution, while not contributing to

increased viral replication.

In the following chapters, thymic cytokines will be discussed in detail (Chapter 2).

Several objectives were developed for this research proj ect and are addressed in the

following chapters: 1. Discovery of mRNA sequences for interleukin (IL)-7, IL-4, IL-15,

interferon (IFN)-a, and IFN-y (Chapter 3); 2. Measurement of interleukin (IL)-7, IL-4,

IL-15, interferon (IFN)-a, and IFN-y mRNA expression levels within the thymus of

neonatally FIV-infected animals and age-matched controls at 3 time points correlating

with acute and chronic infection (Chapter 4); 3. Determination of cytokine alterations









which correlate with changes in viral load and replication, influx of inflammatory cells

and thymocyte depletion (Chapter 5); 4. Demonstration of changes in inflammatory cell

populations, interferon production and viral distribution using immunohistochemistry

(Chapter 6); 5. Assessment of FIV infection of cultured thymocytes (Chapter 7). The

hypothesis of this study is that alterations in cytokine mRNA expression occur as a result

of FIV infection of the pediatric thymus, and that these changes correlate with changes in

FIV viral replication, local inflammatory cell populations and T cell production by the

thymus.















CHAPTER 2
LITERATURE REVIEW

Cytokines are chemical mediators used to influence cell survival and function.

Many of the cytokines used by the thymus have alternate functions when elaborated in

the periphery and within secondary lymphoid organs. Changes in the local production of

these molecules have a potential impact on further T cell production, the ability of the

immune system's inflammatory cell populations to successfully combat the viral

infection, and viral replication itself.

Interleukin-7

Interleukin (IL)-7 has been proven to have multiple effects on immune system

cells. In peripheral lymph nodes of mice, increased IL-7 production has been shown to

cause marked increases in the numbers of immature B cells (B220 Ig-, which

differentiate into antibody-secreting cells) and T cells (particularly cytotoxic CD8' cells,

which are responsible for direct cellular killing in target cells such as virus-infected cells)

(Mertsching, 1995). In addition to cytotoxic T cells, IL-7 causes proliferation of natural

killer cells, which are also responsible for direct cell killing of virus-infected cells (Or,

1998). Within the thymus (the site of development and selection of immature T cells) EL-

7 appears to have multiple effects on maturing T cells. If added very early in T cell

development (CD3-CD4-CD8- cells), IL-7 causes an increased expression of a high-

affinity receptor for another cytokine, IL-2, an inducer of T-cell proliferation (Morrissey,

1994). Within the thymus IL-7 has also been shown in mice to cause expansion of newly

differentiated and selected CD4+ and CD8+ thymocytes (Hare, 2000).









Studies of HIV patients have revealed that as the circulating CD4+ cell count drops,

the concentration of plasma IL-7 increases in proportion to the cell loss (Napolitano,

2001). In children infected with HIV, IL-7 levels were higher in HIV-infected children,

and higher IL-7 levels were associated with lower CD4+ T cell counts and lower TREC

values (Resino, 2005). In addition, increased plasma IL-7 levels in pediatric infection

appeared to correlate with the emergence of more virulent strains of HIV (Resino, 2005;

Kopka, 2005).

Immunohistochemistry of patient lymph nodes revealed strong expression of IL-7

by dendritic cells of depleted parafollicular T cell areas (Napolitano, 2001). The authors

proposed that cells such as these "sensed" a drop in the lymphocyte population within the

periphery, and that IL-7 was produced to stimulate thymopoiesis in a compensatory

feedback loop. However, it has also been shown that the receptor for IL-7 (IL-7Ra) is

downregulated on T cells with HIV infection, and loss of the receptor was associated

with increased plasma IL-7 concentrations and decreased numbers of CD4+ T cells

(Rethi, 2005). In vitro, reduced receptor expression correlated with decreased Bcl-2

expression and decreased cell survival in these cells. IL-7 has also been shown to

augment Fas-mediated apoptosis in HIV-infected CD4+ and CD8+ T cells (Lelievre,

2005).

Ongoing studies are investigating the utility of IL-7 as a treatment modality.

Preliminary studies using SIV-infected macaques undergoing antiviral therapy have

shown increases numbers of memory and newly generated T cells in response to inj section

with IL-7 without a corresponding increase in viral load (Beq, 2006). However,

conflicting data would suggest IL-7 may promote viral replication. Napolitano, et al.









showed increased viral load associated with increased plasma IL-7. In support of this

finding, others that have found IL-7 actually augments infection of thymocytes and fetal

thymic organ culture in vitro (Pedroza-Martins, 2002; Uittenbogaart, 2000). IL-7 was

shown to be a potent reactivator of HIV replication in latently HIV-infected CD4+ T

lymphocytes (Wang, 2005). In addition, with thymocyte depletion, it is likely that IL-7 is

relatively increased in the thymic microenvironment. As an excess of IL-7 has been

shown to expand double negative (DN) CD4-CD8- populations while inhibiting the

production of double positive (DP) CD4+CD8+ thymocytes (DeLuca, 2002).

Overabundance of this cytokine may be contributing to the decrease in the DP

thymocytes seen in lentivirus infection. Further study is necessary to determine the

overall impact and efficacy of IL-7 in the treatment of HIV.

Interleukin-4

IL-4 is another multifunctional cytokine utilized by the immune system, and it

exhibits varying effects within the peripheral immune system and the thymus. Within the

thymus, IL-4 exposure causes direct changes in the phenotype of responsive cells,

inducing expression of CD45RA on a variety of thymocyte subpopulations

(Uittenbogaart, 1990). IL-4 was shown to be as effective as IL-7 in promoting

conversion of intermediate CD4 8- thymocytes into CD4-8' cells, and IL-2, -4, and -15

were as effective as 1L-7 in promoting functional competence as measured by

proliferative responses to CD3 + CD28 stimulation (Yu, 2003).

Within the periphery, IL-4 is one of the maj or cytokines responsible for polarizing

the immune system in response to antigen toward humoral or cellular immunity.

Production of IL-4 causes CD4+ T-cell differentiation to the Th2 phenotype (as opposed

to the Thl, involved in cellular immune responses), and these cells in turn produce more









IL-4 (Santana, 2003). One of the key immunological observations in HIV infections is

the shift from a Thl response to a Th2 response, characterized by increased numbers of

IL-4-secreting cells (Klein, 1997), which is clearly unsuitable for ongoing viral infection

and the maintenance of the critically important cell-mediated immunity. IL-4 was found

to be produced by CD8+ T cells in HIV-infected patients undergoing HAART with high

viremia, and levels were increased with the presence of opportunistic infections (Sindhu,

2006; Rodrigues, 2005). And, as mentioned previously, studies on viral replication in

thymocyte cultures and fetal thymic organ culture showed that IL-4, by itself or

particularly in conjunction with IL-7, increased HIV viral replication (Pedroza-Martins,

2002; Uittenbogaart, 2000). Using thymic and liver implants in mice with severe

combined immunodeficiency (SCID-hu model), infection with HIV was not associated

with changes in IL-4 mRNA production (Koka, 2003). Interference with IL-4 production

using anti-sense IL-4 DNA suppressed viral replication of simian-human

immunodeficiency virus (SHIV, hybridized viral strain) in CD4+ T cells, macrophages

and in vivo in macaques (Dhillon, 2005).

Interleukin-15

Interleukin-15 is a cytokine closely related to IL-2, which is commonly used in

laboratories for preservation and proliferation of lymphocytes in culture systems. IL-2

and IL-15 are structurally similar, share two receptor subunits (IL-2RP and the common y

chain) and has been shown to share many immune system functions. IL-15 is believed to

act as a regulator of CD8+ T cell homeostasis, and studies have shown IL-15 deficiency

can result in a decreased magnitude of CD8+ T cell expansion with stimulation, resulting

in fewer memory cells (Prlic, 2002). IL-15 is also believed to be responsible for basal

proliferation of CD8+ memory cells necessary for maintenance of these cells within the









host. IL-15 has been shown to be important for expression of the antiapoptotic protein

Bcl-2 in CD8 T cells, suggesting IL-15 may also help with CD8+ T cell survival. So

while IL-2 is involved in elimination of T cells through activation-induced cell death

(AICD), IL-15 serves to prevent apoptosis (Waldmann, 2002). Where IL-15 stimulates

the persistence of memory CD8+ T cells, IL-2 inhibits their expression. As further

research such as this emerges regarding IL-15, it will potentially be considered a more

suitable cytokine to stimulate immune reconstitution in AIDS patients. As cell-mediated

immune responses (largely CD8+ T cell-mediated) are critical in the long-term control of

HIV, understanding the role of IL-15 in the immunopathology of AIDS will need to be

elucidated.

In vitro studies with human peripheral blood mononuclear cells has shown that

treatment with the Nef protein of HIV causes early up-regulation of IL-15 by monocytes

in response to an infectious agent, and this production of IL-15 inhibited subsequent

antibody production (Giordani, 2000). In contrast to these findings, blood levels oflIL-15

were decreased in HIV-infected people (Ahmad, 2003). Stimulated PBMCs from

untreated HIV patients and patients with HAART failure showed significantly impaired

IL-15 production when compared to healthy donors or HAART-responsive patients

(d'Ettorre, 2002). While there was not increased viral replication in PBMCs treated with

IL-15, the combination of I-15 and IL-2 together did result in significant increases in

viral production. In HIV patients with pulmonary infiltration by CD8+ T cells

(lymphocytic alveolitis), IL-15 was implicated in up-regulation of interferon-y and tumor

necrosis factor-a (inflammatory cytokines), infiltration and proliferation of T cells within

the lung and up-regulation of accessory, co-stimulatory B7 molecules CD80 and CD86









on alveolar macrophages (Agostini, 1999). In addition, compartmentalization of CD8+ T

cells within the enlarged lymph nodes of SIV-infected monkeys corresponded to

increased RNA expression of IL-7 and IL-15 within these tissues (Caufour, 2001).

Treatment of SIV-infected macaques with IL-15 resulted in 3 -fold expansion of NK cells

and a 2-fold increase in CD8+ T cells, particularly the effector memory subset, with no

concurrent increase in plasma viremia (Mueller, 2005).

Interferon-y

Bacteria, protozoa and perhaps viruses trigger monocytes/macrophages to produce

IL-12, which in turn promotes T cell activation and IFN-y production. IFN-y is

considered a "pro-inflammatory" cytokine that is produced by activated T lymphocytes

(CD4+ and CD8+) and natural killer cells (Young, 2006). It is considered important to

both the innate and adaptive immune systems, and plays a particularly important role in

activating macrophages and neutrophils. IFN-y promotes T and B cell proliferation, MHC

I and II expression, causes augmentation of NK cell lytic function and suppresses IL-4

responses. IFN-y is one of the cytokines measured to identify a Thl response (cell-

mediated immunity), in contrast to IL-4 and a Th2 response (Corthay, 2006). IFN-y

plays a role in expression of NF-KB, and is considered a necessary component of several

inflammatory and autoimmune conditions. However, IFN-y can also cause apoptosis in

certain populations of cells hepatocytess, B lymphocytes, monocytes/macrophages,

activated T cells, tumor cells) and inhibit production of other pro-inflammatory

cytokines, IL-1 and IL-8, conferring it anti-inflammatory and regulatory functions as well

(Muhl, 2003). In this way, IFN-y may down-regulate the activated immune system and

aid in resolving inflammation.









Initial infection by lentiviruses induces an expansion of virus-specific, IFN- y-

producing CD8+ T cells that corresponds to a decline in plasma viremia. However, in

chronic infection HIV-specific CD8+ T cells were shown to have decreased ability to

generate IFN- y, even though CTL numbers remained adequate, and this dysfunction was

not corrected when HAART therapy was instituted (Onlamoon, 2004). Serum IFN- y

levels were found to be reduced in chronically HIV-infected individuals as compared to

controls, though values tended to be higher if concurrent opportunistic infections were

present (Sindhu, 2006). NK cells from patients with progressive HIV infection

demonstrated lower IFN- y production in response to a CpG oligodeoxynucleotide (Saez,

2005). HIV-specific IFN- y production by CD 4+ T cells was associated with lower

plasma viral RNA and proviral load in peripheral blood mononuclear cells (PBMCs), and

this response, in combination with IgG2 antibody production, was the best predictor for

longterm nonprogressors to disease (Martinez, 2005). It has been suggested that HIV-

infected children have decreased IFN- y-producing CD8 T cell responses, and that this

may contribute to persistent high levels of viral replication after neonatal infection

(Buseyne, 2005).

Macrophages in HIV patients exhibit deficiencies in oxidative burst activity and

phagocytosis. hz vitro these effects can be counteracted by treatment with IFN-y, and

treatment of HIV-infected patients with IFN-y results in decreased incidence of

opportunistic infections (Murphy, 1988; Reed, 1992; Kedzierska, 2003). IFN-y is

currently being investigated as a treatment modality for opportunistic infections in HIV

pati ents.


Interferon-a









Type I interferons, such as IFN-a, are produced when cells are exposed to viral

products, particularly dsRNA. The interferons are secreted, and binding to the IFN

receptor triggers the Jak/STAT pathway of intracellular signaling (Cebulla, 1999). This,

in turn, induces the transcription of IFN-stimulated genes (ISG). Interferons as a group

can induce more than 300 cellular proteins, which depends on the IFN signal and the

target cell type. Through IFN-triggered 2-5(A) synthetase activity, RNaseL produces

antiviral and anticellular effects, often influencing apoptosis (Samuel, 2001). Activation

of ISG56, which encodes for P56, results in the binding of translation initiation factor

elF-3, blocking protein synthesis. PKR has been shown to have many functions, which

ultimately affect cell functions, cell growth and apoptosis. Induction of the P200 family

of genes causes decreased transcription of rRNA and impairs cell proliferation. So, many

of the effects of interferons are directly aimed at viral replication (Sen, 2001). Type I

interferons (IFN-a/P) work in conjunction with IL-12 and Type II interferons (IFN-y) to

suppress Th2 cells (Durbin, 2000). IFN-a has also been shown to support the

differentiation of cytotoxic T lymphocytes and induce CTL responses (von Hoegen,

1995).

IFN-a is produced during HIV infection, and increased IFN levels correlate with

diminished levels of virus and rises in CD4+ T cell count (Poli, 1991). In culture

systems, type I interferons have been shown to inhibit different stages of the HIV life

cycle, and IFN-a strongly inhibits FIV replication in feline PBMC (Tanabe, 2001). HIV-

1 has been shown to be able to block IFN-induced function through the Tat protein,

which competitively binds PKR, and TAR RNA can block PKR activation (Sen, 2001).

In HIV infection, the progressive loss of IFN-a highly correlates with disease progression









and the onset of opportunistic infections. Observations of HIV in the natural course of

disease showed loss of interferon generation and low CD4+ T cell counts are required for

opportunistic infections to occur. Preclinical and early clinical trials are underway using

IFN-a to treat HIV (Jablonowski, 2003). Also, IFN-a is being investigated for use as a

multiple cytokine therapeutic modality, particularly to counteract the increases in

replication seen with use of proliferation-inducing cytokines. hz vitro, combination

treatment of IFN-a and IL-7 strongly inhibited HIV replication while preserving T cell

numbers, increasing T cell proliferation and IFN-y production (Audige, 2005).

Interferon-Producing Cells

Recently, it was determined that the professional Type I IFN-producing cell type

(IPC) is the previously identified plasmacytoid dendritic cell (Siegal, 1999). The

hematological origin of these cells has been controversial, and it was determined that

these cells express CD4 and MHC class II, and are negative for other lineage markers

such as CD3 (T cells), CD19 (B cells), CD14 monocytess), CD56 (NK cells) and CD11c

(monocyte-derived type 1 dendritic cells). Manipulation and isolation of these cells was

made difficult by their rarity (0.01% to 0.05% of PBMC) and rapid apoptosis in culture.

These cells were found to be recruited in significant numbers to inflamed lymph nodes,

and can be found in T cell areas and within germinal centers (Cella, 1999). IPCs are

triggered by viruses and other pathogens, more specifically by CpG oligonucleotide

binding to toll-like receptor (TLR) 9 (Colonna, 2002).

In vitro, IPCs have been shown to become directly and productively infected with

the HIV virus, and HIV infection triggers IFN-a secretion and decreases viable cell

numbers (Yonezawa, 2003; Lore, 2005; Schmitt, 2006). Interaction with HIV viral










components triggers immature IPCs to mature, exhibit more cytoplasm with dendritic

processes and express CD80 and CD86 (Yonezawa, 2003). IPC are induced to replicate

the HIV virus upon ligation of CD40L, and can infect naive T cells in transrt~t~rt~t~rt~t~rt~ (Fong, 2002;

Lore, 2005). Chronically HIV-infected patients have decreased numbers of IPCs in the

peripheral blood, and lower CD4+ T cell counts correlated with decreased numbers of

IPCs (Feldman, 2001). The progressive loss of functional IPCs in the circulation is

correlated with increased viral load and the development of opportunistic infections and

disease (Feldman, 2001; Siegal, 2003). Long-term survivors (at least ten years without

signs of disease) were shown to have increased IPC number and function when compared

to HIV-infected subj ects with progressive disease or AIDS (Soumelis, 2001). Given the

very recent developments characterizing this cell type, data concerning IPC infection

with SIV or FIV is currently unavailable, since species-specific reagents remain to be

generated.















CHAPTER 3
DETERMINATION OF FELINE CYTOKINE SEQUENCES

Introduction

The ultimate obj ective of the study was identify significant changes in cytokine

profiles within thymic tissue, therefore, identification of the sequences for the relevant

cytokine mRNA was essential for future work. Most of the cytokines of interest in this

study did not have published sequences in a review of GenBank at the onset of this

proj ect, so primers and probes for the cytokine sequences could not be developed for real

time reverse transcription-polymerase chain reaction (RT-PCR) experiments. In the

present experiment, we report the full length complementary DNA (cDNA) sequences for

feline IL-4, IL-7, IL-15, IFN-y and IFN-a.

Materials and Methods

Primer Design

Oligonucleotide primers were designed based on consensus DNA sequences that

were currently available for other species in order to amplify the cytokine sequences

using the polymerase chain reaction (PCR). When possible, a nested PCR reaction was

desired in order to reduce nonspecific sequence amplification. So, for IFN-y, IL-4 and

IL-15, a set of primers (forward 1/reverse 1) was designed at a distance outside the

coding region for a first round of PCR, then followed by a second reaction using forward

2/reverse 2 primers that included start and stop codon sequences. IL-7 and IFN-a were

amplified using a single set of primers. Desired amplification products would include the

entire coding region that was present in the mRNA. In addition, an oligonucleotide probe










was designed that would anneal within the coding region. Expected product lengths were

also predicted: IFN-a (538 base pairs, bp), IFN-y (515 bp), IL-4 (406 bp), IL-15 (499

bp), and IL-7 (835 bp).

Table 3-1. Oligonucleotide primers and probes used for nested PCR protocols.
IFN-a forward ATG GCG CTG CCC TCT TCC TTC TTG GTG GCC
IFN-a probe CTG GGA CAA ATG AGG AGA CTC
IFN-a reverse TCA TTT CTC GCT CCT TAA TCT TTT CTG CAA
IFN-y forward 1 CTA CTG ATT TCA ACT TCT
IFN-yI forward 2 GAA ACG ATG AAT TAC ACA AGT TTT
IFN-y probe CAT TTT GAA GAA CTG GAA A
IFN-y reverse 1 CAA ATA TTG CAG GCA GGA
IFN- y reverse 2 CAA CCA TTA TTT CGA TGC TCT ACG
IL-4 forward 1 TGC ATC GTT AGC KTC TCC T
IL-4 forward 2 TTA ATG GGT CTC ACC TCC CAA CTG ATT CC


IL-4 probe
IL-4 reverse 1
IL-4 reverse 2
IL-7 forward
IL-7 probe
IL-7 reverse
IL-15 forward 1
IL-15 forward 2
IL-15 probe
IL-15 reverse 1
IL-15 reverse 2


ACT TCT TGG AAA GGC TAA A
TTA GAK TCT ATA TAT AYT WTA T
GCT TCA ATG CCT GTA GTA TTT CTT CTG CAT
AAC TCC GCG GAA GAC CAG GGT
ATT TTA TTC CAA CAA GTT TT
TTC AGT AAC TTC CAG GAG GCA TTC
TGG ATG GAT GGC WGC TGG AA
GAG TAA TGA GAA TTT CGA AAC CAC ATT TGA
GGC ATT CAT GTC TTC ATT TTG G
CTT CAT TTC YAA GAG TTC AT
TGC AAT CAA GAA GTG TTG ATG AAC ATT TGG


Synthesis of cDNA

Total RNA was extracted from frozen thymic tissue from a SPF kitten using a

RNeasy Mini kit (QIAGEN, Valencia, CA, USA). RNA yield was quantified by

spectrophotometry at an absorbance of 260nm. One microgram samples of extracted

RNA were used to generate complementary DNA (cDNA) in a 20 Cll synthesis reaction

using random hexamer primers (First Strand cDNA Synthesis Kit, Roche, Indianapolis,


IN, USA).










Amplification of Cytokine Sequences

PCR amplification of each cytokine was performed in 50 Cll reaction mixtures

containing 0. 1 Clg of cDNA, 0.2 CIM of deoxynucleotide mixture, 5 Cll reaction buffer (1.5

mM MgCl2), 0.2 CIM of each oligonucleotide primer and 2.5 U of Taq DNA polymerase

(Roche Applied Science, Indianapolis, IN, USA). After an initial denaturation cycle at

94oC for 1 minute, PCR amplification was carried out at 92oC for 30 seconds, 55oC for 30

seconds, and 72oC for 90 seconds for 30 cycles. A final elongation step was performed at

72oC for 5 minutes, then the samples were cooled to 4oC.

Construction and Use of a Plasmid Containing Cytokine Sequence Inserts

The commercially available pCR-Blunt II-TOPO plasmid (Invitrogen, Carlsbad,

CA, USA) was selected for its suitability for accepting blunt ended PCR products. The

6C1l cloning reaction was performed according to manufacturer's instructions and

contained 1 Cll salt solution (1.2 M NaC1, 0.06 M MgCl2), 1Cl1 TOPO vector and 4 Cll of

fresh PCR product. The reaction mixture was gently mixed, incubated at room temperate

for 5 minutes and then cooled on ice. A vial of One Shot Chemically Competent E. coli

cells (Invitrogen, Carlsbad, CA, USA) was thawed on ice, 4 Cll of the plasmid reaction

mixture was added and allowed to incubate on ice for 5 minutes. Cells were then heat-

shocked in a 42oC water bath for 30 seconds, then the tubes were returned to the ice. A

250 Cll aliquot of room temperature SOC medium (2% tryptone, 0.5% yeast extract, 10

mM NaC1, 2.5 mM KC1, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose) was added,

and the tubes were then incubated at 37oC for one hour. A 125 Cll sample of this solution

was spread on a pre-warmed selective Luria-Bertani (LB) plates (with kanamycin, 50

Clg/ml). Plates were incubated at 37oC overnight then screened for bacterial colonies.









To screen colonies for the plasmids which contained cytokine sequences, direct

inoculation of PCR reaction mixtures with bacteria was performed using a sterile

toothpick. Two PCR reactions were prepared using the forward and reverse primers, and

using the probe oligonucleotide as a forward primer in conjunction with the reverse

primer. PCR was performed in 50 Cll reaction mixtures containing 0.2 CIM of

deoxynucleotide mixture, 5 Cll reaction buffer (1.5 mM MgCl2), 0.2 CIM of each

oligonucleotide primer and 2.5 U of Taq DNA polymerase (Roche Applied Science,

Indianapolis, IN, USA). After an initial denaturation cycle at 94oC for 1 minute, PCR

amplification was carried out at 92oC for 30 seconds, 55oC for 30 seconds, and 72oC for

90 seconds for 30 cycles. A final elongation step was performed at 72oC for 5 minutes,

then the samples were cooled to 4oC. PCR products were visualized by electrophoresis in

1% agarose gel stained with ethidium bromide.

Colonies were considered positive for the appropriate cytokine sequence if two

PCR reactions gave bands of the expected size when amplified. Positive colonies were

used to inoculate 10 ml of LB broth. After incubation of the broth overnight at 37oC,

bacteria were harvested by centrifugation at 6000 x g and 4oC forl5 minutes. Plasmid

DNA was isolated and purified using the QIAGEN Plasmid Mini kit (Qiagen, Santa

Clarita, CA, USA). Plasmid DNA samples were sent to the Genome Sequencing Service

Laboratory, University of Florida. Sequence data was used to perform a nucleotide-

nucleotide search through the Basic Local Alignment Search Tool (BLAST), available

from the National Center for Biotechnology Information (NCBI).









Results

Plasmid Construction

Amplified DNA was cloned into the pCR-Blunt II-TOPO plasmid. Transformation

reactions produced a very low yield of number of colonies produced (0-3 colonies per

plate). PCR screening reactions using direct inoculation from bacterial colonies gave

ample amplification, and positive colonies were identified containing inserts for IFN-y,

IFN-a, IL-4, IL-7 and IL-15 as shown in Figures 3-1, 3-2, 3-3 and 3-4.


DNA


PCR
Pro ducts


500 bp


Lanes


1 2 3 4 5 6 7


Figure 3-1. Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IFN-y insert.
Lanes 3-5: Vector-specific M13 primers. Lane 6, IFN-y forward/reverse
primers. Lane 7, IFN-y probe/reverse primers.










PCR
Pro ducts


DNA
Ladder


500 bp


Lanes


1 2 3 4 5 6 7 8 9


Figure 3-2. Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IFN-a insert.
Lane 8, IFN-a forward/reverse primers. Lane 9, IFN-a probe/reverse primers.


DNA
Ladder


PCR
Pro ducts


500 bp










500 bp


Lanes


1 2 3 4 5 6 7


Figure 3-3. Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing feline IL-4 and IL-15
inserts. Row 1: Lanes 3-4: Vector-specific M13 primers. Lane 6, IL-4
forward/reverse primers. Lane 7, IL-4 probe/reverse primers. Row 2: Lanes
3-4: Vector-specific M13 primers. Lane 6, IL-15 forward/reverse primers.
Lane 7, IL-15 probe/reverse primers.












PCR
Pro ductS


500 bp


Lanes 1 2 3 4 5 6

Figure 3-4. Ethidium bromide-stained agarose gel of polymerase chain reaction products
from colonies transformed with plasmid containing a feline IL-7 insert. Lane
5, IL-7 forward/reverse primers. Lane 6, IL-7 probe/reverse primers.



Feline Cytokine cDNA sequences

Sequences were obtained for all 5 of the investigated cytokines, as shown in

Figures 3-5, 3-6, 3-7, 3-8 and 3-9.

1 CAGAATTCGC CCTTGAAACG ATGAATTACA CAAGTTTTAT TTTCGCTTTC

51 CAGCTTTGCA TAATTTTGTG TTCTTCTGGT TATTACTGTC AGGCCATGTT

101 TTTTAAAGAA ATAGAAGAGC TAAAGGGATA TTTTAATGCA AGTAATCCAG


151 ATGTAGCAGA TGGTGGGTCG CTTTTCGTAG

201 GAGGAGAGTG ATAAAACAAT AATTCAAAGC

251 GAAAATGTTT GAAAACCTGA AAGATGATGA

301 TGGACACCAT CAAGGAAGAC ATGCTTGATA

351 AGTAAACGGG ATGACTTCCT CAAGCTGATT

401 GCAGGTCCAG CGCAAAGCAA TAAATGAACT

451 TCTCACCAAG ATCTAACCTG AGGAAGCGGA

501 CGAGGCCGTA GAGCATCGAA ATAATGGTTG


ACATTTTGAA GAACTGGAAA

CAAATTGTCT CCTTCTACCT

CCAGCGCATT CAAAGGAGCA

AGTTGTTAAA TACCAGCTCC

CAAATCCCTG TGAATGATCT

CTTCAAAGTG ATGAATGATC

AAAGGAGCCA GAATCTGTTT

AAGGGCGAAT TCCAGCACA


DNA
Ladder


Figure 3-5. Full length nucleotide sequence of the feline IFN-y cDNA. The start and
stop codons of the open reading frame are highlighted in bold/red.











1 GTGTGCTGGA ATTCGCCCTT ATGGCGCTGC CCTCTTCCTT CTTGGTGGCC

51 CTGGTGGCGC TGGGCCGCAA CTCCGTCTGC TCTCTGGGCT GTGACCTGCC


TCAGACCCAC

TGAGGAGACT

TTCCCCCAGG

CTCGGTGGTG

AGGCGTCCTC

ACGGGACTTG

GGTGGGGGAG

ACTACTTCCA

TGTGCCTGGG

AACAGCCTTG

GCAGATAT


GGCCTGCTGA

CCCTGCCAGC

ACGTGTTCGG

CACGTGACGA

GTCTGCTGCT

ATCGGCAGCT

GGAGAGGCTC

AAGACTCTCC

AGATCGTCAG

CAGAAAAGAT


ACAGGAGGGC CTTGACGCTC CTGGGACAAA


TCCTGTCAGA

TGGAGACCAG

ACCAGAAGAT

TGGAACACCA

GACCCGCCTG

CCCTCACGAA

CTCTACCTGC

AGCAGAAATC

TAAGGAGCGA


AGGACAGGAA

TCCCACAAGG

CTTCCACTTC

CCCTCCTGGA

GAAGCCTGTG

CGAGGACTCC

AAGAGAAGAA

ATGAGATCCT

GAAATGAAAG


TGACTTCGCC

CCCAAGCCCT

TTCTGCACAG

GGAATTCTGC

TCGTGCAGGA

CTCCTGAGGA

ATACAGCCCT

TGTATTCGTC

GGCGAATTCT


Figure 3-6. Full length nucleotide sequence of the feline IFN-a cDNA. The start and stop
codons of the open reading frame are highlighted in bold/red.











CTTCCGGCTC

CTGGTCTGCT

AATAATACGT

AAACGACTCG

AGAACACAAG

CAGATCTATA

CAGGAACCTC

AGAAGTGTAC

AAGAAATACT


CGCCCTTTTA

TACTAGCATT

TGAAAGAGAT

TGCATGGAGC

TGACAAGGAA

CACATCACAA

AGCAGCATGG

ACT GAAAGAC

ACAGGTATTG


ATGGGTCTCA

TACCAGCACC

CATCAAAACG

TGGCCGTCAT

ATCTTCTGCA

CTGCTCCACC

CAAACAGGAC

TTCTTGGAAA

AAGCAAGGGC


CCTCCCAACT

TTCGTCACGG

TTGAACATCC

GGACGTCTTG

GAGCCACAAC

AAATTCCTCA

CTGTTCCGTG

GGCTAAAAGC

GAATTCTGCA


GATTCCAGCT

CCAGAACTTC

TCACAGCGAG

GCAGCCCCTA

CGTGCTCCGG

AAGGACTCGA

AAT GAAGACA

GAT CAT GCAG

GATAT


Figure 3-7. Full length nucleotide sequence of the feline IL-4 cDNA. The start and stop
codons of the open reading frame are highlighted in bold/red.














1 CAGTGTGCTG GAATTCGCCC TTGCCCATGT TCCATGTTTC TTTTAGGTAT


ATCTTTGGAA

TGATTGTGAT

TGATCAGCAT

CCGAATAATG

GGAAGCTGTG

AAGT GAATAA

GGCATGTTAC

AAAGGAACAG

AAAAGATAAA

TGAAAAATAT


TTCCTCCCCT

ATTGAAGGTA

CAATTACTTG

AACCTAACGT

TTTTTATATC

CAGTGAGGAA

AGTTGTTGAA

AGAAAACAGA

AACTTGTTGG

GGAGAAGGGC


GATCCTTGTT

AAGACGGAAG

GACACCATGA

TTTTAAAAAA

GTGCTGCTCA

TTCAATCTCC

CTGTACCCCC

AGAGCTTGTG

AATAAAATTT

GAATTCT


CTGTTGCCAG

AGAATATCAG

TAAAAAATCG

CATGCATGTG

CAAGTTGAAG

ACTTATCAAG

AAGGAAGACA

TTTTCTAGGG

TGAGGGGCAC


TAG CAT CATC

CACATTCTAA

TACCAATTGC

ATGATAATAA

CACTTTGTCA

AGTTTCACAG

GCAAATCTTT

ATACTACTAC

TAAAGAACAC


Figure 3-8. Full length nucleotide sequence of the feline IL-7 cDNA. The start and stop
codons of the open reading frame are highlighted in bold/red.











1 AGTGTGCTGG AATTCGCCCT TGAGTAATGA GAATTTCGAA ACCACATTTG

51 AGAAGTACTT CCATCCAGTG CTACTTGTGT TTACTTCTGA ACAGCCATTT


TTTAACTGAA

GTCTTCCTAA

ATAATTGACA

TGAAAGTGAT

TCCTGGAGTT

CAAACAGTAG

CAGGAATATA

AGAACAT TAA

ATCAACACTT


GCTTGCATTC

AACAGAGGCA

AGATTATTCA

GTTCATCCCA

ACATGTTATT

AAAACATTAT

ACT GAAACAG

AGAAT TTCT G

CTTGATTGCA


CTGTCTTCAT

AACTGGCAGG

ATCCTTACAT

ATTGCAAAGT

TCGCTTGAGT

TATCCTGGCA

GATGCAAAGA

CAGAG TTTT G

AAGGGCGAAT


TTTGAGCTGT

ATGTAATAAG

ATCGATGCCA

AACAGCGATG

CCAAAAATGA

AACAGTGGTT

ATGTGAGGAA

TACATAT TGT

TCTGCAGATA?


ATCAGTGCAG

TGATTTGAAA

CTTTATATAC

AAGTGCTTTC

GACCATTCAT

TATCTTCTAA

CTGGAGGAAA

ACAAAT GTTC


Figure 3-9. Full length nucleotide sequence of the feline IL-15 cDNA. The start and stop
codons of the open reading frame are highlighted in bold/red.

Basic Local Alignment Search Tool (BLAST) comparisons were made for the


sequenced cytokines. The nucleotide sequence obtained for feline IFN-y is 100%

identical to reported sequences for the feline cytokine (Argyle, 1995). The feline


sequence exhibits 89% homology to that of the dog (Canis familia~ris), 88% homology to

the Eurasian badger (M~eles meles), and 83-84% homology to horse (Equus caballus), the


steer (Bos taurus), the Bactrian camel (Camelus bactrianus) and the sheep (Ovis aries),


and 80% homology to the pig (Sus scrofa).


The idenitifed IFN-a nucleotide sequence exhibited 96-99% similarity to several


different reported feline IFN-a sequences (Nagai, 2004). The feline sequence also has


81-87% homology to that of the horse IFN-a, 78% homology to the dog, and 82-91%


homology to various fragments of human interferon sequences.









The feline IL-4 nucleotide sequence demonstrates 98% homology to reported feline

IL-4 sequences (Schijns, 1995, direct PubMed submission). Feline IL-4 cDNA exhibits

88% homology to canine IL-4, 84% homology to the bovine sequence, 82% homology to

the pig and the horse, and 80% to the Bactrian camel.

The nucleotide sequence for feline IL-7 cDNA has not been previously reported.

The feline IL-7 sequence was most homologous to that of the pig and the sheep (87%),

followed by the steer (86%), the rhesus monkey (Macaca mulatta) (85%), and humans

(84%).

The sequence for feline IL-15 cDNA exhibits 98% homology to sequences from a

recent report (Dean, 2005). It also demonstrates homology to the IL-15 sequences of the

horse (89%), human (88%), the steer (87%) and the dog (87%).

Discussion

The cDNA sequences for feline cytokines were successfully amplified by PCR,

cloned using a bacterial plasmid system and confirmed by DNA sequencing. The full

length transcripts are isolated in plasmid-containing bacteria for rapid access in any

future experiments by our laboratories that require expression of the feline protein.















CHAPTER 4
IVEASURE1VENT OF FIV GAG MESSENGER RNA AND DNA, AND IL-4, IL-7, IL-
15, IFN-ALPHA AND INTERFERON-GA1V1VA1VIESSENGER RNA LEVELS INT THE
THY1VUSES OF CATS NEONATALLY INFECTED WITH FIV

Introduction

Cytokine expression tends to be low in tissues and cell samples under investigation,

and real-time reverse-transcription (RT)-PCR has proven to be the most sensitive,

reproducible, rapid and accurate technique available for mRNA quantitation. As tissue

samples are often too small to evaluate cytokines at the protein level, real-time RT-PCR

using fluorogenic probes has become the standard method of choice in investigating

tissue cytokine profiles (Blaschke, 2000; Giulietti, 2001; Rajeevan, 2001; Yin, 2001;

Overbergh, 2003). While mRNA expression in the tissues may not definitively reflect

the ultimate cytokine protein levels, analyses comparing mRNA expression relative to

tissue protein content have demonstrated good correlation (Blaschke, 2000; Hein, 2001).

Using the previously derived cDNA sequences for the feline cytokines (Chapter 3)

and sequence map for JSY3 (the molecular clone of FIV used in the infected animal

groups), primers and probes were generated for use in a real-time RT-PCR protocol.

Real-time RT-PCR was used to determine the RNA levels for IL-4, IL-7, IL-15, IFN-a,

IFN-y and FIV gag, and the proviral load of FIV gag DNA. The current chapter

describes cytokine changes that exist for the different age groups and as a result of FIV

infection; Chapter 5 discusses the statistical correlations between the cytokine changes

and the changes that were observed in thymus cell subpopulations and viral levels.









Materials and Methods

Quantitative Real-Time PCR for Feline Cytokine mRNA.

Cats with acute (6-8 weeks), 12 week, and chronic (>16 weeks) neonatal FIV

infection (infected at birth) were identified from previous studies. Total RNA was

extracted from thymic samples, which had been frozen at -80.C (RNeasy Midi Kit,

Qiagen Inc., Valencia, CA). RNA concentration and purity was determined by UV

spectrophotometer (A260/A280). RNA samples were treated with DNase I (Sigma, St.

Louis, MO, USA). One microgram samples of extracted RNA were used to generate

complementary DNA (cDNA) in a 20 Cll synthesis reaction using random hexamer

primers (First Strand cDNA Synthesis Kit, Roche, Indianapolis, INT, USA). Feline

G3PDH was selected as the housekeeping gene for normalization of cytokine mRNA

content. The cytokine primers, feline G3PDH primers, and corresponding Taqman

probes were designed using Primer Express software (PE Applied Biosystems, Foster

City, CA) (Table 4-1). Real-time RT-PCR analyses were conducted using the PRISM

7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA), utilizing a

25-C1l reaction volume of PCR Universal Master Mix (PE Applied Biosystems, Foster

City, CA) containing -100-200 ng of cDNA 900 nM of each gag and G3PDH primer,

and 125 nM of the TaqMan probes. The standard curve was generated by PCR on serial

dilutions of a thymic cDNA sample from a selected 6 week-old, FIV-infected animal. All

samples and the serial dilutions of the standards were assayed in triplicate. For all

samples, target quantity was determined from the standard curve and divided by the

target quantity of a calibrator, a lxsample. All other quantities were expressed as an n-

fold difference relative to the calibrator, and the same calibrator thymic sample was used









for all cytokine experiments. The relative feline cytokine gene transcription products

were expressed as the ratio of cytokine mRNA to G3PDH mRNA content.

Quantitative Real-Time PCR for FIV Provirus.

Genomic DNA was extracted (QIAamp DNA Mini Kit, Qiagen Inc., Valencia, CA)

from thymic samples. Resulting DNA concentration and purity was determined by UV

spectrophotometer (A260/A280). The gag primers, feline G3PDH primers, and

corresponding Taqman probes were designed using Primer Express software (PE Applied

Biosystems, Foster City, CA) (Table 4-1). PCR analyses were conducted using the

PRISM 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA),

utilizing a 25-C1l reaction volume of PCR Universal Master Mix (PE Applied Biosystems)

containing -100-200 ng of DNA, 900 nM of each gag and G3PDH primer, and 125 nM of

the TaqMan probes. The standard curve was generated by PCR on serial dilutions of a

cDNA containing the JSY3 gag sequence and feline G3PDH. All samples and the serial

dilutions of the standards were assayed in triplicate. For all samples, the target quantity

was determined from the standard curve and divided by the target quantity of a calibrator,

al sample. All other quantities were expressed as an n-fold difference relative to the

calibrator. The relative FIV provirus content was expressed as the ratio of FIV gag DNA

to G3PDH DNA content.

Quantitative Real-Time PCR for FIV Transcription.

Total RNA was extracted (RNeasy Midi Kit, Qiagen Inc., Valencia, CA) from

thymic samples. RNA concentration and purity was determined by UV

spectrophotometer (A260/A280). Reverse transcription was performed by use of the

TaqMan Reverse Transcription Reagents (PE Applied Biosystems, Foster City, CA)

utilizing -0.5 Clg RNA and 3' reverse gag specific primer with the following cycling









conditions: 750C for 5 min, 420C for 1 hour, 950C for 5 minutes, and 40C for 5 minutes.

Real-time RT-PCR analyses were conducted using the PRISM 7700 Sequence Detection

System (PE Applied Biosystems, Foster City, CA), utilizing a 25-C1l reaction volume of

PCR Universal Master Mix (PE Applied Biosystems, Foster City, CA) containing -100-

200 ng of cDNA 900 nM of each gag and G3PDH primer, and 125 nM of the TaqMan

probes. The standard curve was generated by PCR on serial dilutions of a cDNA

containing the JSY3 gag sequences and feline G3PDH. All samples and the serial

dilutions of the standards were assayed in triplicate. For all samples, target quantity was

determined from the standard curve and divided by the target quantity of a calibrator, a

l sample. All other quantities were expressed as an n-fold difference relative to the

calibrator. The relative FIV gag gene transcription products were expressed as the ratio

of FIV gag RNA to G3PDH mRNA content.









Table 4-1. Primers and probes used for real-time RT-PCR.
IL-4 forward primer TTC ACG GAA CAG GTC CTG TTT
IL-4 reverse primer TGC TCC ACC AAA TTC CTC AAA
IL-4 probe 6FAM-CCA TGC TGC TGA GGT TCC
TGT CGA-TAMRA
IL-7 forward primer GCC CTG TGA AAC TCT TGA TAA GTG
IL-7 reverse primer TCG TGC TGC TCA CAA GTT GAA
IL-7 probe 6FAM-AGA TTG AAT TCC TCA CTG
TTA TTC ACT TTG ACA AAG TG-
TAMRA
IL-15 forward primer AAC TGA AGC TTG CAT TCC TGT CT
IL-15 reverse primer TCC TGC CAG TTT GCC TCT GT
IL-15 probe 6FAM-CAT TTT GAG CTG TAT CAG
TGC AGG TCT TCC TAA-TAMRA
IFN-alpha forward primer TCC GGT GGA GAC CAG TCC C
IFN-alpha reverse primer TTC TGG TTC GTC ACG TGC A


IFN-alpha probe

IFN-gamma forward primer
IFN-gamma reverse primer

IFN-gamma probe

FIV gag forward primer
FIV gag reverse primer
FIV gag probe

G3PDH forward primer
G3PDH reverse primer
G3PDH probe


6FAM-CAA GGC CCA AGC CCT CTC
GGT G-TAMRA
ATG ATG ACC AGC GCA TTC AA
TTT ACT GGA GCT GGT ATT TAA CAA
CTT ATC
6FAM-AGC ATG GAC ACC ATC AAG
GAA GAC ATG C-TAMRA
AGCCCTCCACAGGCATCTC
TGGACACCATTTTTGGGTCAA
6FAM-ATT CAA ACA GCA AAT GGA
GCA CCA CAA TAT G-TAMRA
CCATCAATGACCCCTTCATTG
TGACTGTGCCGTGGAATTTG
6FAM-CTC AAC TAC ATG GTC TAC
ATG TTC CAG TAT GAT TCC-TAMRA


Statistical Analysis

Cytokine mRNA expression was analyzed for differences between the different age

groups, and between infected animals as compared to the age matched controls. SAS

PROC GLM was used to conduct the one-way ANOVA analysis; the least squares means

were calculated and pair-wise group comparisons were conducted using SAS 9.1 (SAS

Institute, Inc., Cary, NC). Values were considered statistically significant for analyses


where P< 0.05.









Results

Interleukin (IL)-4

IL-4 mRNA levels were measured at three time points after neonatal infection with

a pathogenic molecular clone of FIV (JSY3) (Table 4-2). Cytokine expression values

were compared over time and against age-matched controls. P values from the

comparisons are summarized in Table 4-3. Arithmetic means with the corresponding

standard deviations are graphically represented in Figure 4-1.

The only group of animals demonstrating statistically significant differences in IL-

4 expression was the uninfected >16-week-old control group. Uninfected >16-week-old

cats had higher IL-4 mRNA expression than the infected animals (P = 0.01), but also

expressed IL-4 at a higher level than younger animals that weren't infected. This

suggests that IL-4 becomes more active within the thymus as the animal matures to the

subadult age group, and that this activity level is suppressed by pathogenic FIV infection

(3.8-fold less IL-4 expression in infected animals).










Table 4-2. Relative IL-4 mRNA concentration in thymic samples, as expressed as n-fold
difference to a calibrator sample.


Arithmetic mean with
standard deviation

0.77 & 0.37

0.7 & 0.26

1.94 & 0.91

2.53 & 0.97

6.59 & 8.08a


Amimal group

6-8-week-old cats, uninfected
(n= 5)
6-8-week-old cats, FIV-infected
(JSY3) (n=5)
12-week-old cats, uninfected
(n= 2)
12-week-old cats, FIV-infected
(JSY3) (n=5)
>16-week-old cats, uninfected
(n= 3)


>16-week-old cats, FIV-infected
6 1.74 & 1.23
(JSY3) (n=8)
a: Statistically significant difference from infected and uninfected 6-8-
week-old groups, 12-week-old infected cats, and >16-week-old infected
cats (P < 0.05).

Table 4-3. P values from pairwise comparison of IL-4 levels, animal groups 1-6 from
Table 4-2.
1 2 3 4 5 6


0.96

0.57
0.27
0.005
0.41


0.005
0.005
0.06
0.04


0.44
0.41
0.99
0.29
0.01


0.59
0.57

0.79
0.06
0.99


0.29
0.27
0.79

0.04
0.68


0.96
0.59
0.29
0.005
0.44


0.01











Interleukin-4
16

14-

o 12-

10 -0



C~6






Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 wks 6-8 wks 12wks 12wks >16wks >16wks


Figure 4-1. Measurement of relative IL-4 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls. (*)
denotes statistically significant from infected and uninfected 6-8-week-old
groups, 12-week-old infected cats, and >16-week-old infected cats (P < 0.05).

Interleukin-7

IL-7 mRNA levels were measured at three time points after neonatal infection with

a pathogenic molecular clone of FIV (JSY3) (Table 4-4). Cytokine expression values

were compared over time and against age-matched controls. P values from the

comparisons are summarized in Table 4-5. Arithmetic means with the corresponding

standard deviations are graphically represented in Figure 4-2.

IL-7 mRNA exhibited a similar pattern of expression as IL-4 in the animal groups

examined. Older (>16 weeks) uninfected animals showed a higher level of expression of

IL-7 than younger animals and cats infected with FIV (6.3-fold more IL-7 is present in

uninfected controls). This findings suggest that IL-7 is upregulated within that thymus as

the animals mature, but that this effect is suppressed with FIV infection (P = 0.003).











Table 4-4. Relative IL-7 mRNA concentration in thymic
difference to a calibrator sample.


samples, as expressed as n-fold


Animal group

1 6-8-week-old cats, uninfected (n=5)

6-8-week-old cats, FIV-infected
(JSY3) (n=5)
3 12-week-old cats, uninfected (n=2)
12-week-old cats, FIV-infected
(JSY3) (n=5)
5 >16-week-old cats, uninfected (n=3)

>16-week-old cats, FIV-infected
(JSY3) (n=8)
a: statistically significant difference from all
study (P < 0.05)


Arithmetic mean

2.24 & 2.88

0.79 & 0.54

1.09 & 0.4

2.52 & 1.93


8.02 & 8.42,

1.27 & 1.17

other animal groups in


Table 4-5. P values from pairwise comparison of IL-7 levels, animal groups 1-6 from


Table 4-4.
1


5
0.02
0.003
0.02
0.02

0.003


6
0.59
0.68
0.92
0.49
0.003


0.66
0.84

0.58
0.02
0.93


0.88
0.32
0.58

0.02
0.49


0.66
0.88
0.02
0.59


0.84
0.32
0.003
0.68











Interleu kin-7
18
16-


S12-
S10-







Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 wks 6-8 wks 12 wks 12 wks >16 wks >16 wks


Figure 4-2. Measurement of relative IL-7 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls. (*)
denotes statistically significant differences from all other animal groups in
study (P < 0.05).

Interleukin-15

IL-15 mRNA levels were measured at three time points after neonatal infection

with a pathogenic molecular clone of FIV (JSY3) (Table 4-6). Cytokine expression

values were compared over time and against age-matched controls. P values from the

comparisons are summarized in Table 4-7. Arithmetic means with the corresponding

standard deviations are graphically represented in Figure 4-3.

IL-15 was slightly upregulated in FIV-infected animals at 12 weeks of age as

compared to infected 6-8-week-old infected animals (P = 0.004) and >16-week-old

infected animals (P = 0.06). However, this appears to be due to a physiological trend for

IL-15 upregulation at this age, as 1L-15 levels are not statistically different from 12-

week-old age-matched control cats (P = 0.36). IL-15 mRNA expression in infected

animals also does not differ significantly from age-matched controls at other time points

(6-8 weeks, P = 0.59; >16 weeks, P = 0.12).










Table 4-6. Relative IL-15 mRNA concentration in thymic samples, as expressed as n-
fold difference to a calibrator sample.


Animal group

1 6-8-week-old cats, uninfected (n=5)

6-8-week-old cats, FIV-infected
(JSY3) (n=5)
3 12-week-old cats, uninfected (n=2)
12-week-old cats, FIV-infected
(JSY3) (n=5)
5 >16-week-old cats, uninfected (n=3)

>16-week-old cats, FIV-infected
(JSY3) (n=8)


Arithmetic mean

1.26 & 0.74

1.56 & 0.78

2.93 & 0.51

3.77 & 1.95


1.4 & 0.43

2.33 & 0.96


Table 4-7. P values from pairwise comparison of IL-15 levels, animal groups 1-6 from
Table 4-6.
1 2 3 4 5 6


0.59

0.15
0.004
0.77
0.13


0.07
0.15

0.36
0.12
0.66


0.001
0.004
0.36

0.006
0.06


0.87
0.77
0.12
0.006


0.04
0.13
0.66
0.06
0.12


0.59
0.07
0.001
0.87
0.04


0.12











Interleukin-1 5




~5-









Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 w ks 6-8 w ks 12 wks 12 wks >16 wks >16 wks

Figure 4-3. Measurement of relative IL-15 mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls. (*)
denotes statistically significant differences from all other animal groups in
study (P < 0.05).

Interferon (IFN)-y

IFN-y mRNA levels were measured at three time points after neonatal infection

with a pathogenic molecular clone of FIV (JSY3) (Table 4-8). Cytokine expression

values were compared over time and against age-matched controls. P values from the

comparisons are summarized in Table 4-9. Arithmetic means with the corresponding

standard deviations are graphically represented in Figure 4-4.

Again, mRNA levels for IFN-y demonstrates a physiological upregulation at the

>16 week time point similar to the trends observed for IL-4 and IL-7. IFN-y values are

statistically higher in >16-week-old animals than all other animal groups (Tables 4-9).

This heightened expression level is abrogated by infection with FIV (P = 0.01), and

infected animals express IFN-y at a level 4.5 times less than uninfected controls.










Table 4-8. Relative IFN-y mRNA concentration in thymic samples, as expressed as n-
fold difference to a calibrator sample.


Animal group

1 6-8-week-old cats, uninfected (n=5)

6-8-week-old cats, FIV-infected
(JSY3) (n=5)
3 12-week-old cats, uninfected (n=2)
12-week-old cats, FIV-infected
(JSY3) (n=5)
5 >16-week-old cats, uninfected (n=3)

>16-week-old cats, FIV-infected
(JSY3) (n=8)
a: statistically significant difference from all
study (P < 0.05)


Arithmetic mean

3.22 & 5.89

2.12 & 2.08

1.14 &1.38

4.11 +1.78

13.07 & 15.14,

2.9 & 1.91

other animal groups in


Table 4-9. P values from pairwise comparison of IFN-y levels, animal groups 1-6 from
Table 4-8.
1 2 3 4 5 6


0.94
0.72
0.68
0.72
0.01


0.66
0.88

0.52
0.03
0.68


0.8
0.52
0.52

0.04
0.72


0.02
0.01
0.03
0.04

0.01


0.7
0.66
0.8
0.02
0.94


0.88
0.52
0.01
0.72











Interferon-gamma
30

= 25






~ 0




Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 w ks 6-8 wks 12 wks 12 wks >16 wks >16 wks


Figure 4-4. Measurement of relative IFN- y mRNA expression in thymic samples of
FIV-infected (viral molecular clone, JSY3) cats and age matched controls. (*)
denotes statistically significant differences from all other animal groups in
study (P < 0.05).

Interferon-a

IFN-a mRNA levels were measured at three time points after neonatal infection

with a pathogenic molecular clone of FIV (JSY3) (Table 4-10). Cytokine expression

values were compared over time and against age-matched controls. P values from the

comparisons are summarized in Table 4-11. Arithmetic means with the corresponding

standard deviations are graphically represented in Figure 4-5.

The pattern of mRNA expression observed for IFN-a was similar to that of IL-4,

IL-7 and IFN-y, both over time and in response to infection. Uninfected animals greater

than 16 weeks of age demonstrated a higher cytokine expression level than all other

animal groups (Tables 4-10 and 4-11). Chronically infected animals (>16-week-old cats)

exhibited 148.7-fold less thymic IFN-a mRNA expression than uninfected age-matched










controls (P = 0.0003). Pair-wise comparisons of all others groups were not statistically

significant.

Table 4-10. Relative IFN-a mRNA concentration in thymic samples, as expressed as n-
fold difference to a calibrator sample.


Animal group

1 6-8-week-old cats, uninfected (n=5)
6-8-week-old cats, FIV-infected
(JSY3) (n=5)
3 12-week-old cats, uninfected (n=2)
12-week-old cats, FIV-infected
(JSY3) (n=5)
5 >16-week-old cats, uninfected (n=3)

>16-week-old cats, FIV-infected
(JSY3) (n=8)
a: statistically significant difference from all
study (P < 0.05)


Arithmetic mean

306.24 & 608.32

2.74 & 1.99

35.04 & 31.08

302.12 & 641.95

1773.81 1 1533.36,

11.93 & 31.94

other animal groups in


Table 4-11. P values from pairwise comparison of IFN-a levels, animal groups 1-6 from
Table 4-10.
1 2 3 4 5 6


0.43


0.4
0.98
0.96
0.41
0.0003


0.59
0.95

0.6
0.004
0.96


0.99
0.44
0.6


0.003
0.0005
0.004
0.003

0.0003


0.43
0.59
0.99
0.003
0.4


0.95
0.44
0.0005
0.98


0.003
0.41











Interferon-alpha


3500

3000

(n2500

S2000

S1500

~1000

500

0


Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 w ks 6-8 w ks 12 wks 12 wks >16 wks >16 wks


Figure 4-5. Measurement of relative IFN-ct mRNA expression in thymic samples of FIV-
infected (viral molecular clone, JSY3) cats and age matched controls. (*)
denotes statistically significant differences from all other animal groups in
study (P < 0.05).

Viral Transcription (FIV gag RNA) and Proviral Load (FIV gag DNA)

FIV gag RNA and DNA levels were measured for all thymus samples from the

previous cytokine studies, using the same real time RT-PCR protocol. Arithmetic means

with standard deviations are tabulated in Table 4-12 and graphically represented in

Figures 4-6 (RNA) and 4-7 (DNA). All cats from age-matched control groups had

undetectable levels of gag RNA and DNA, as expected for uninfected animals.

There was a great deal of variability for levels of FIV gag RNA between cats of the

same age group, exemplified by large standard deviation values. The trend of higher

viral gene expression levels over time was present but not statistically significant (one-

way ANOVA, P = 0.64). While overall the variability in proviral load in cats of older

age groups was lower than viral gene expression, statistically significant changes in

thymic gag content were not observed (one-way ANOVA, P = 0.85).










Table 4-12. Relative viral gag RNA expression and viral DNA loads within feline
thymic samples as measured with real time RT-PCR.


Arithmetic mean
gag RNA
ND


Arithmetic mean
gag DNA
ND


Amimal group

1 6-8-week-old cats, uninfected (n=2)
6-8-week-old cats, FIV-infected
(JSY3) (n=5)
3 12-week-old cats, uninfected (n=2)
12-week-old cats, FIV-infected
(JSY3) (n=2)
>16-week-old cats, uninfected
(n= 3)
>16-week-old cats, FIV-infected
(JSY3) (n=7)
ND = Not detected, value of 0


5.19 & 6.27

ND

9.15 A12.94


0.21 & 0.44


0.005 & 0.005


11.57 & 13.31


0.02 & 0.03


Thymic Gag RNA
30

8 25-

e! 20-





100


6-8 wks 12 wks >16 wks


Figure 4-6. Measurement of relative viral gag RNA expression by real time RT-PCR in
thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time
points after neonatal infection.











Thymic Gag DNA
0.7

0.6-


O 0.4-

o 0.3-


S0.1
0.

6-8 wks 12 wks >16 wks


Figure 4-7. Measurement of relative viral gag DNA content by real time RT-PCR in
thymic samples of FIV-infected (viral molecular clone, JSY3) cats at 3 time
points after neonatal infection.

Discussion

Of the cytokines evaluated in the present study, four of the five (IL-4, IL-7, IFN-y

and IFN-a) demonstrated a physiologic upregulation by 16 weeks of age as compared to

the 6-8-week and 12-week age groups. This peak in normal cytokine activity was

depressed in the course of FIV infection, and for IL-4, IL-7 and IFN- y there was a 4-6

fold difference in mRNA expression between the uninfected and infected animals. A

similar but much more pronounced pattern also existed for IFN- a, with uninfected

animals exhibiting a 149-fold greater expression of IFN-a transcripts than FIV-infected

animals.

For the fifth cytokine, IL-15, there was a slight, non-statistically significant

physiologic increase in expression levels around 12 weeks of age when compared to the

6-8-week and >16-week-old uninfected animal groups. While the values for IL-15 were










higher for infected animals at every time point, none of the groups reached statistical

significance for the virally-induced increases.

The cytokines of this study are known to be elaborated by a diverse host of immune

system cells. While IL-4 and IFN-y are generally synthesized by activated T cells in the

process of the immune response, IL-7 is generated by dendritic cells/stromal cells, IFN-a

by virus-infected cells and at much higher levels by plasmacytoid dendritic cells (PDC;

also referred to as interferon-producing cells, IPC) and IL-15 is produced by

monocyte/macrophages, dendritic cells and stromal cells. Therefore, the observed

increases in most cytokine activity do not appear to be as a result of a change in a single

thymic cellular subpopulation, and these Eindings may reflect a generalized increase in

thymopoietic activity in this age group. The particularly robust increase in IFN-a

expression after 16 weeks of age could potentially reflect an expansion in the thymic

subpopulation of Type II dendritic cells (PDC) and a rise in intrathymic innate immunity.

As mentioned previously, four of the Hyve cytokines were decreased in infected

animals over 16 weeks of age, reflecting a suppression of the peak in physiological

cytokine activity that was observed in the age-matched control animals. This may reflect

a viral influence on overall mRNA expression in multiple cell types, and the lack of IL-

15 inhibition could indicate that the monocyte/macrophage cell lineage is not as

susceptible to this virally-induced mRNA suppression at this stage in thymic FIV

infection. The correlations between cytokine levels and thymic cellular subpopulations,

and the ramifications of cytokine changes on viral replication, are examined in Chapter 5.















CHAPTER 5
IMPACT OF CYTOKINE CHANGES ON FIV REPLICATION AND THYMIC
CELLULAR COMPOSITION

Introduction

As published previously, neonatal infection of the thymus with FIV results in a

reduction of thymus-body weight ratio, selective depletion of CD4+CD8+ thymocytes,

cortical atrophy, infiltrations of B cells, formation of lymphoid follicles and deformation

of the thymic architecture (Orandle, 1997; Orandle, 2000; Norway, 2001; Johnson, 2001).

Archival tissue from these experiments was selected for pursuit of the present study. At

the time of tissue collection, flow cytometry had been performed with antibodies against

the cell markers CD4 and CD8, which vary in surface expression on thymocytes

depending on their level of T cell maturation. "Double-negative" (CD4-CD8-)

thymocytes represent the most immature cell population, are present within the

superficial cortex, and represent recent emigrants from the bone marrow into the thymus.

"Double-positive" (DP) ,or CD4+CD8+, thymocytes comprise the bulk of the normal

developing thymocyte pool, move progressively throughout the thymic cortex to the

medulla, and have not yet been restricted to a more mature lineage of single-positive

(SP) CD4+ or CD8+ cells. SP CD4+ and CD8+ T cells are the population of cells ready

to emigrate from the thymus after thymopoiesis is complete, or can indicate an influx of

inflammatory cells from an ongoing infectious disease such as FIV infection.

Several pathogenic indicators have been shown to reflect the impact of FIV on the

thymus. FIV infection induces cortical atrophy largely through the depletion of the main









thymocyte subpopulation, DP thymocytes. The mechanism for this cell loss is unclear.

Previous studies have indicated a low incidence of direct infection of thymocytes by FIV

(Woo, 1997; Hayes, 2000; Norway; 2001), so it appears that the unknown cause of cell

death is due to alterations in the thymic microenvironment or indirect viral effects, such

as apoptosis triggered by the viral envelope (Sutton, 2005). A relative increase in SP

CD8+ cells and cells staining with a B cell marker correlates with the inflammatory

infiltration of the tissue and the formation of germinal centers that are apparent upon

histological evaluation.

As these tissues were available from experiments that had been used to

characterize the thymic pathogenesis of FIV infection, they were a good choice for

regression analysis. Changes in cell populations already identified in infected tissue

could be potentially correlated to alterations found in the cytokine profile and lead to a

better understanding of the impact of cytokines and viral replication on thymopoiesis.

Materials and Methods

Profile of Thymocyte Subpopulations.

The feline thymic tissue used for this cytokine research had been evaluated in

previous studies investigating FIV pathogenesis in the thymus (Orandle, 1997; Crawford,

2001; Norway, 2001). Necropsy data and the results from flow cytometry experiments

were compiled in order to establish larger groups than previously published, and to

compare the changes in cell populations to the cytokine levels.

Statistical Analysis

Absolute cell counts and percentages of total thymocytes were used to identify the

subpopulations of thymocytes. Comparisons between animal groups for cell numbers

were conducted using Sigma Stat 3.0 (SPSS Inc., Chicago, IL). Changes in cytokine









levels and viral loads and replication were subjected to regression analysis. Pairwise

Pearson' s correlations of the cellular data with cytokine levels and viral parameters were

performed with SAS 9.1 (SAS Institute, Inc., Cary, NC). Tables were generated for

values when P < 0.1, and correlations were considered statistically significant for

analyses where P < 0.05.

Results

Enumeration of Thymocyte Subpopulations.

The cell populations present in thymic tissue for infected animals and age-matched

controls at 6-8 week, 12 week and >16 week age time points are summarized in Tables 5-

1 through 5-4, and graphically represented in Figures 5-1 through 5-9. At 6-8 weeks of

age, reductions in the total thymocyte number (P = 0. 11) and increase in IgG+ cells (P =

0.06) due to FIV infection were not statistically significant. However, when looking at

the individual cellular subsets within the tissue, a reduction in the maj or thymocyte

population, double-positive (DP) CD4+CD8+ cells, is observed both as a percentage of

total thymocytes (P = 0.04) and in absolute cell numbers (P = 0.05). The absolute

number of immature DN thymocytes was unaffected with infection (P = 0.86). As an

overall percentage of total thymocytes, single-positive (SP) CD4+ cells is unaffected (P =

0.37); but absolute numbers of CD4+ cells are in fact decreased (P = 0.03). An increase

in SP CD8+ cells is observed as a percentage of total thymocytes (P = 0.04), but not

when actual absolute numbers of CD8+ cells is calculated (P = 0.64).

For 12-week-old animals, total thymocyte numbers (P = 0.095) and DP thymocytes

(P = 0.095) were decreased, but this trend did not reach statistical significance. This was

also true when the decrease in DP thymocytes (P = 0.095) and increase in SP CD4+

thymocytes (P = 0. 1) were examined as a percentage of total thymocytes, but the









percentage of SP CD8+ cells was significantly higher in infected animals (P = 0.003).

Again, changes in DN thymocytes (P = 0.71) and IgG+ cells (P = 0.38) were not

observed. There were no observed differences in the numbers of SP CD4+ thymocytes

(P = 0.90), and change in the absolute numbers of SP CD8+ thymocytes were not

statistically significant (P = 0.095).

In animals >16 weeks of age, the loss of the absolute number of total thymocytes

(P = 0.06), DP thymocytes (P = 0.06) and DN thymocytes (P = 0.09) approaches but did

not achieve statistical significance. The absolute numbers of SP CD4+ thymocytes (P =

0.94), SP CD8+ thymocytes (P = 0.89), and numbers of IgG+ cells (P = 0.22) were

unchanged. When evaluated as a percentage of total thymocytes, DP CD4+CD8+

thymocytes were decreased (P = 0.04), SP CD4+ thymocytes were increased (P = 0.07)

and the increase in SP CD8+ thymocytes was not significant (P = 0.12).










Table 5-1. Historical data for absolute total thymocyte counts and absolute number of
total thymocytes, double-negative thymocytes and IgG+ cells (B cells) in
thymus samples from animals infected with JSY3, a pathogenic molecular
clone of FIV, and age-matched control animals at three different time points.


Absolute number
of DN thymocytes
(x10 )
(arithmetic mean
with standard
deviation)



0.772 & 0.441


Absolute
number of
IgG+ cells
(x109>
arithmeticc
mean with
standard
deviation)

0.05 & 0.03


1.16 &1.44


0.3 & 0.05


1.14 & 0.81


0.16 & 0.12


0.96 & 0.8


Total thymocytes
(x109
(arithmetic mean
with standard
deviation)


8.64 & 4.24


3.51 & 3.01


17.75 & 7.04


8.52 & 1.7


37.59 & 18.97


10.5 & 6.02


Amimal group




6-8-week-old cats,
uminfected (n=5)
6-8-week-old cats,
2 FIV-infected (JSY3)
(n= 4)
12-week-old cats,
uminfected (n=2)
12-week-old cats,
4 FIV-infected (JSY3)
(n= 5)
>16-week-old cats,
uminfected (n=2)
>16-week-old cats,
6 FIV-infected
(JSY3) (n=7)


0.724 & 0.334


1.21 & 0.414


1.1 & 0.309


4.47 & 2.74


1.99 & 1.26










Table 5-2. Historical data for absolute number of double-positive CD4+CD8+
thymocytes and the percentage of total thymocytes exhibiting the CD4+CD8+
phenotype in thymus samples from animals infected with JSY3, a pathogenic
molecular clone of FIV, and age-matched control animals at three different
time points.
Absolute number of % of total thymocytes
CD4+CD8+ thymocytes CD4+CD8+ (arithmetic
Animalgroup(x 10 ) arithmeticc mean mean with standard
with standard deviation) deviation)


6-8-week-old cats,
1 .'6.63 & 3.4 0.764 & 0.05
uminfected (n=5)
6-8-week-old cats, FIV-
2 .1.92 & 2.2a 0.448 & 0.27
infected (JSY3) (n=4)
12-week-old cats,
3 .'15.6 & 6.22 0.876 & 0.0(
uminfected (n=2)
12-week-old cats, FIV-
4 .5.06 & 1.21 0.594 & 0.0S
infected (JSY3) (n=5)
>16-week-old cats,
5 .'2.96 & 1.42 0.793 & 0.02
uminfected (n=2)
>16-week-old cats, FIV-
6 .5.15 & 4.17 0.395 & 0.23
infected (JSY3) (n=7)
a: animal groups with statistically significant cell counts from age-matched control
groups (P<0.05)


5g

'8a

03

93


!3


3a


Table 5-3. Historical data for absolute number of CD4+ thymic cells and the percentage
of total thymic cells exhibiting the CD4+ phenotype in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points.
Absolute number of % of total thymic cells
CD4+ cells (x109) CD4+ (arithmetic mean
Amimal group .it da
(arithmetic mean withwthsadr
standard deviation) deviation)


6-8-week-old cats,
1 .'0.285 & 0.108 0.04 & 0.02
uminfected (n=5)
6-8-week-old cats, FIV-
2 .0.138 & 0.023a 0.06 & 0.04
infected (JSY3) (n=4)
12-week-old cats,
3 .'0.501 & 0.407 0.03 & 0.01
uminfected (n=2)
12-week-old cats, FIV-
4 .0.472 & 0.214 0.05 & 0.02
infected (JSY3) (n=5)
>16-week-old cats,
5 .'0.647 & 0.549 0.02 & 0.01
uminfected (n=2)
>16-week-old cats, FIV-
6 .0.671 & 0.361 0.07 & 0.04
infected (JSY3) (n=7)
a: animal groups with statistically significant cell counts from age-matched control
groups (P<0.05)


1


1


1











Table 5-4. Historical data for absolute number of CD8+ thymic cells and the percentage
of total thymic cells exhibiting the CD8+ phenotype in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points.
Absolute number of % of total thymic cells
CD8+ cells (x109) CD8+ (arithmetic mean
Amimal group .it da
(arithmetic mean withwthsadr
standard deviation) deviation)


3


6-8-week-old cats, 0.099 ~ .
1 .'0.95 & 0.7
uminfected (n=5)
6-8-week-old cats, FIV- 0.225 & 0.10
2 0.73 & 0.62
infected (JSY3) (n=4)
12-week-old cats, 0.029 & 0.01
3 .'0.48 & 0.01
uminfected (n=2)
12-week-old cats, FIV- 0.219 & 0.04
4 1.89 & 0.71
infected (JSY3) (n=5)
>16-week-old cats, 0.076 & 0.0(
5 .'2.87 & 1.49
uminfected (n=2)
>16-week-old cats, FIV- 0.296 & 0.1~
6 2.68 & 1.73
infected (JSY3) (n=7)
a: animal groups with statistically significant cell counts from age-matched control
groups (P<0.05)


15a

12

8a

01

69


Absolute number of Total thymocytes
60000000000

0 50000000000-

5 40000000000-

8 30000000000-

S20000000000-

E 10000000000-
2
Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-1. Historical flow cytometry results from previous published experiments:
absolute numbers of total thymocytes present in thymus samples from animals
infected with JSY3, a pathogenic molecular clone of FIV, and age-matched
control animals at three different time points.












Absolute number of DN C D4-C D8- thymic cells
8000000000
> 7000000000-
2 6000000000-
S5000000000-

O 4000000000-
o 3000000000-
'B 2000000000-
S1000000000

2 Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16 wks >16w ks


Figure 5-2. Historical flow cytometry results from previous published experiments:
absolute numbers of double-negative (DN) CD4-CD8- cells present in thymus
samples from animals infected with JSY3, a pathogenic molecular clone of
FIV, and age-matched control animals at three different time points.


Absolute number of IgG+ Cells
3000000000

2500000000-

C 2000000000-

S 1500000000-

S 1000000000-

E 500000000-
z0
Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 wks 6-8 wks 12 wks 12 wks >16 wks >16 wks


Figure 5-3. Historical flow cytometry results from previous published experiments:
absolute numbers of IgG+ cells (B cells) present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points.







57



Absolute number of CD4+CD8+ thymocytes

g 50000000000
E 45000000000
S40000000000-
3ii 50000
+ 350000000000

2 0000000000-
1 5000000000-

0 5000000000-


2 Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-4. Historical flow cytometry results from previous published experiments:
absolute numbers of CD4+CD8+ thymocytes present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. (*) denotes statistically
significant differences from all other animal groups in study (P < 0.05).


Thymocytes: % CD4+CD8+ cells

0.9-
0.8-
0 0.7-
E 0.6-
5 0.5
3 0.4-
S0.3-
0.2-
0.1-

Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-5. Historical flow cytometry results from previous published experiments:
percentage of CD4+CD8+ thymocytes present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. (*) denotes statistically
significant differences from all other animal groups in study (P < 0.05).













1200000000
10000000-

1000000000
6000000-
800000000


200000000


Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-6. Historical flow cytometry results from previous published experiments:
absolute numbers of single-positive (SP) CD4+ cells present in thymus
samples from animals infected with JSY3, a pathogenic molecular clone of
FIV, and age-matched control animals at three different time points. (*)
denotes statistically significant differences from all other animal groups in
study (P < 0.05).


Thymocytes: % SP CD4+ cells
0.12

en 0.1 --

o 0.08

5 0.06-

S0.04-


S0.020
Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-7. Historical flow cytometry results from previous published experiments:
percentage of single-positive (SP) CD4+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points.


Absolute number of CD4+ thymic cells
1400000000


111


31







59



Absolute number of CD8+ thymic cells
5000000000
S4500000000-
S4000000000-
S3500000000-
S3000000000-
S2500000000-
S2000000000-
S1500000000-
.0 1000000000-
S500000000-
2
Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-8. Historical flow cytometry results from previous published experiments:
absolute numbers of single-positive (SP) CD8+ cells present in thymus
samples from animals infected with JSY3, a pathogenic molecular clone of
FIV, and age-matched control animals at three different time points.


Thymocytes: % SP CD8+ cells
0.5
0.45-
0.4-
0 0.35-
E 0.3-*
c5 0.25-
d 0.2-
S0.15-

0 5-


Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8w ks 6-8w ks 12w ks 12w ks >16w ks >16w ks


Figure 5-9. Historical flow cytometry results from previous published experiments:
percentage of single-positive (SP) CD8+ cells present in thymus samples from
animals infected with JSY3, a pathogenic molecular clone of FIV, and age-
matched control animals at three different time points. (*) denotes statistically
significant differences from all other animal groups in study (P < 0.05).









Peripheral Blood Counts

Total white blood cell counts (total WBC) and numbers of CD4+ and CD8+ T cells

in the peripheral blood are compiled in Table 5-5. Cell count data is graphically

represented in Figures 5-10 through 5-12. At 6-8 weeks of age, the WBC (P = 0.91) and

CD4+ T cell count (P = 0.41) are unchanged, and the increase in circulating CD8+ T

cells is not statistically significant (P = 0.08). By the 12-week time point, WBC are

statistically unchanged (P = 0.2), as is the CD4+ cell count (P = 0.57) and the numbers of

CD8+ cells (P = 0.3). At >16 weeks of age, again the WBC (P = 0.97) and CD8+ T cell

number (P = 0.95) remains unaffected, and the changes in CD4+ T cells are not

statistically significant (P = 0.08).

Table 5-5. Historical data for absolute number of total white blood cells, CD4+ T cells
and CD8+ T cells within peripheral blood samples from animals infected with
JSY3, a pathogenic molecular clone of FIV, and age-matched control animals
at three different time points.
Total WBC C4clsxO CD8+ cells (x109)
(arithmetic .(arithmetic mean
Amimal group mean with .aihei wen Mith standard
with standard
standard deviation)
deviaion)deviation)
6-8-week-old cats,
1 .'8718 1 1157 619 1696 266 1236
uminfected (n=5)
6-8-week-old cats,
2 FIV-infected (JSY3) 9800 & 4761 1096 & 835 670 & 353
(n= 4)
12-week-old cats,
3 .' 6915 A 1478 1214 & 567 487 & 201
uminfected (n=2)
12-week-old cats,
4 FIV-infected (JSY3) 13788 & 6186 879 & 682 953 & 528
(n= 5)
>16-week-old cats,
5 .'9050 14596 1441 1 1062 500 1228
uminfected (n=2)
>16-week-old cats,
6 FIV-infected 8919 & 3668 586 & 411 517 & 325
(JSY3) (n=7)







































Peripheral CD4+ T cells
3000

2500 -

.t2000

.2 1500

=1000


500

Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8 wks 6-8 wks 12wks 12wks >16wks >16wks


Figure 5-10. Historical flow cytometry results from previous published experiments:
absolute numbers of white blood cells present in peripheral blood samples
from animals infected with JSY3, a pathogenic molecular clone of FIV, and
age-matched control animals at three different time points.


Figure 5-11. Historical flow cytometry results from previous published experiments:
absolute numbers of single-positive (SP) CD4+ cells present in peripheral
blood samples from animals infected with JSY3, a pathogenic molecular clone
of FIV, and age-matched control animals at three different time points.


Total WBC
25000

20000--


S15000-

3r10000-



5000

Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8wks 6-8wks 12wks 12wks >16wks >16wks











Peripheral CD8+ T cells
1600
1400-
S1200-
1000-
800-
S600-




Uninfected JSY3 Uninfected JSY3 Uninfected JSY3
6-8wks 6-8wks 12wks 12wks >16wks >16wks


Figure 5-12. Historical flow cytometry results from previous published experiments:
absolute numbers of single-positive (SP) CD8+ cells present in thymus
samples from animals infected with JSY3, a pathogenic molecular clone of
FIV, and age-matched control animals at three different time points.

Pairwise Correlations of Lymphocyte Subsets to Viral and Cytokine Parameters

A summary of Pearson' s pairwise correlations with a P value less than 0. 1 are

compiled in Table 5-6. In Chapter 4, it was determined that IL-4, IL-7, IFN-a and IFN-y

exhibited similar expression patterns. The regression analysis confirms a strong positive

correlation between the expression levels of IL-7, IFN-a and IFN-y (P < 0.001).

Expression of these cytokines was associated with increased absolute numbers of

thymocytes, DP CD4+CD8+ thymocytes and DN CD4-CD8- thymocytes. IL-4 was

correlated with increased numbers of SP CD4+ cells within the thymus (P = 0.002) and

SP CD8+ T cells within the peripheral circulation (P = 0.03). Expression of I-15

weakly associated with percentage of CD8+ cells within the thymus (p = 0.363, P =

0.068), and highly correlated with numbers of CD8+ T cells circulating within the

peripheral blood (P = 0.005). No cytokine or cellular data appeared to correlate with

proviral load/gag DNA levels. However, gag RNA/viral gene expression was increased










with elevated numbers of SP CD8+ cells within the thymus (P = 0.001) and IFN-y

expression (P =0.012). Gag RNA was less strongly but positively associated with the

presence of IgG+ cells within the thymus (p = 0.525, P = 0.08) and IL-15 expression (p:

0.513, P = 0.07).

Table 5-6. Summary of Pearson' s pairwise correlations of historical necropsy data,
measured cytokine values and viral parameters. All comparisons with P<0. 1
are listed.

Variable 1 Variable 2 Rho (p) P value

%CD4+CD8+
IFN-a 0.335 0.095
thymocytes
%CD4+
IL-7 -0.362 0.069
thymocytes
%CD4+
IFN-a -0.438 0.025
thymocytes
%CD8+
IL-15 0.363 0.068
thymocytes
Absolute # total
IL-7 0.792 <0.001
thymocytes
Absolute # total
IFN-y 0.766 <0.001
thymocytes
Absolute # total
IFN-a 0.769 <0.001
thymocytes
Absolute #
CD4+CD8+ IL-7 0.8 <0.001
thymocytes
Absolute #
CD4+CD8+ IFN-y 0.74 <0.001
thymocytes
Absolute #
CD4+CD8+ IFN-a 0.789 <0.001
thymocytes
Absolute # of
CD4+ IL-4 0.586 0.002
thymocytes
Absolute # of
CD8+ IFN-y 0.434 0.03
thymocytes
Absolute # of
CD8+ gag RNA 0.812 0.001
thymocytes









Absolute # of
CD4-CD8- IL-7 0.652 <0.001
thymocytes
Absolute # of
CD4-CD8- IFN-y 0.699 <0.001
thymocytes
Absolute # of
CD4-CD8- IFN-a 0.602 0.001
thymocytes
IgG+ cells IL-15 0.367 0.072

IgG+ cells gag RNA 0.525 0.08
Total WBC
(peripheral IL-15 0.55 0.004
blood)
CD8+ T cells
(peripheral IL-4 0.43 0.03
blood)
CD8+ T cells
(peripheral IL-15 0.537 0.005
blood)
IL-7 IFN-y 0.952 <0.001

IL-7 IFN-a 0.949 <0.001

IL-15 gag RNA 0.513 0.07

IFN-y IFN-a 0.892 <0.001

IFN-y gag RNA 0.671 0.012




Discussion

This compiled data represents a greater number of overall animals than previous

reports and is broken down into distinct age brackets/phases of infection for analysis.

The earlier studies reported a reduction of DP CD4+CD8+ thymocytes and in increase in

the percentage of SP CD8+ cells in thymuses of infected animals (Orandle, 1997;

Orandle 2000; Johnson, 2001; Norway, 2001). Similar findings were found in the current

investigation: specifically, statistically significant changes were observed in decreased









absolute numbers of DP thymocytes at weeks 6-8, the decreased percentages of DP

thymocytes at weeks 6-8 and >16 weeks, and in the increased percentage of total thymic

cells that are CD8+ at weeks 6-8 and 12. Significant changes in total thymocyte number,

absolute numbers of DN thymocytes and IgG+ cells were not observed.

The correlation in expression levels of IL-7, IFN-a and IFN-y was observed in

Chapter 4 and confirmed here with regression analysis. Expression of these cytokines

appeared to be associated with improved indicators of thymus composition, namely

increased overall number of thymocytes, and, more specifically, increased numbers of the

immature DP thymocytes and DN thymocytes. Levels of IL-15 were not significantly

associated with increased inflammatory inHiltrates, germinal center formation, the

percentage of CD8+ cells and numbers of IgG+ (B cells) within the thymus. No cytokine

influences on proviral load were observed, but viral gag gene expression was positively

associated with inflammatory inHiltrates (CD8+ cells) and IFN-y expression. It is not

clear, however, whether increased viral expression induces more pronounced

inflammation, or if the influx of inflammatory cells is responsible for the increase in viral

activity.

Decreases in endogenous thymic production of IFN-a proved to be the most

pronounced cytokine change observed. As there was a marked peak in IFN-a mRNA

production in the older animals that was abrogated by infection with FIV, further

experiments were undertaken to determine a potential source of the IFN production

(Chapter 6) and the effects of IFN-a on viral replication in thymocytes (Chapter 7). It

was proposed that an interferon-producing cell type such as the Type II/plasmacytoid






66


dendritic cell might exist in the thymus of cats that could potentially be infected directly

by FIV or undergo viral-induced impairment of IFN-producing function.















CHAPTER 6
DETECTION OF FIV-INFECTED CELLS AND IFN-PRODUCING CELLS WITHIN
THE THYMUS OF NORMAL AND FIV-INFECTED CATS

Introduction

Historically, one limitation in the manipulation and study of plasmacytoid dendritic

cells (PDCs)/interferon-producing cells (IPCs) was the lack of a specific cellular surface

expression marker. Isolation of IPCs required depleting peripheral blood mononuclear

cells (PBMCs) of cells bearing lineage specific molecules, including CD3 (T cells),

CD19 (B cells), CD14 monocytess) and CD56 (NK cells). Remaining cells were

enriched for IPCs by selecting for CD11c-negative/CD1 23-bright cells, to remove the

monocyte-derived type 1 dendritic cells (Siegal, 1999). A PDC-specific marker was

eventually discovered, blood dendritic cell antigen-2 (BDCA-2) (Dzionek, 2000).

Characterization of this molecule revealed it as a novel type II C-type surface lectin

(Dzionek, 2001). A recombinant human dendritic cell lectin (rhDLEC) was developed

and commercially developed antibodies recently became available, facilitating the study

of this rare cell type.

The thymus has been shown to harbor a subset of resident PDC, however, their

function within the normal thymus remains unclear (Fohrer, 2004). While most of these

cells were observed to be of an immature phenotype, some PDC expressed markers

indicative of activation and may contribute to a late stage of negative thymocyte

selection. In the context of HIV infection, in vitro experiments using a thymic culture

system have shown that thymic PDCs respond to viral infection with IFN-a production









(Gurney, 2004). The amount of interferon produced suppressed viral production, but at a

suboptimal level and could be enhanced by the addition of CpG oligonucleotides to the

culture system. While PDCs only comprised 0.2% of the lymphoid cells of the thymus,

depletion of these cells from the thymic culture enhanced viral replication 2-1 10 fold.

Previous reports indicated that anti-human DLEC antibodies did not cross-react

with PDC from the peripheral blood of the rhesus macaque (Chung, 2005). The current

study sought to test the binding capacity of a polyclonal anti-human DLEC-derived

antibody against feline thymic PDCs using a peroxidase-based immunohistochemistry

protocol and provide preliminary data to characterize this cell type.

Materials and Methods

Single-Label Immunohistochemistry

Archival tissue selected from seven 6-8-week-old kittens (acute FIV infection) and

six >16-week-old kittens (chronic FIV infection) that had been inoculated at birth with

JSY3, a FIV molecular clone that exhibits thymic pathogenicity (Orandle, 1997; Norway,

2001; Johnson, 2001). Uninfected thymus samples from two 6-8-week-old kittens and

four >16-week-old kittens served as age-matched controls. 5 Clm frozen sections of

thymic tissue were removed from -80oC and immediately fixed in ice cold ethanol for 5

minutes and rinsed in room temperature PBS buffer. Sections were incubated at room

temperature for 30 minutes with blocking solution of 1% normal horse serum and blotted,

followed by a 30 minute incubation withl0Clg/mL of either anti-rhDLEC polyclonal

antibody (R&D Systems, Minneapolis, MN, USA), a polyclonal anti-human IFN-a

antibody (PBL Biomedical Laboratories, Piscataway, NJ, USA) or a monoclonal

antibody against FIV p24 gag protein (clone PAK3-2C1; Custom Monoclonals

International, West Sacramento, CA.). Negative control slides from infected and









uninfected thymus sections underwent an additional blocking step and did not receive

primary antibody. All slides were developed and stained using the Vectastain Universal

Elite@ ABC Kit (Vector Laboratories Inc., Burlingame, CA) and visualized with

diaminobenzidine chromagen enhanced with nickel. Sections were then rinsed in water

and counterstained with Harris's hematoxylin. Slides were examined microscopically,

and measurements of total visualized thymic area were made at a 40X obj ective

magnification using the Image J NIH software program

(http://rsb .info.nih.gov/ij/download.html). The results were reported as the number of

positively-staining cells identified per unit of designated area.

Double-Label Immunohistochemistry

Tissue sections from several acutely and chronically infected kittens were chosen

based on the quality of the tissue sections during previous single-label

immunohistochemistry experiments. 5 Clm thymic samples were removed from -80oC

and immediately fixed in ice cold ethanol for 5 minutes and rinsed in room temperature

PBS buffer. Sections were incubated at room temperature for 30 minutes with blocking

solution of 1% normal horse serum and blotted, followed by a 30 minute incubation

withl0Clg/mL of anti-rhDLEC polyclonal antibody (R&D Systems, Minneapolis, MN,

USA). Negative control slides did not receive an incubation with the primary antibody

and underwent an additional 30 minute blocking step. All slides were developed and

stained using the Vectastain Universal Elite ABC Kit (Vector Laboratories Inc.,

Burlingame, CA) and visualized with diaminobenzidine chromagen enhanced with

nickel. Slides were incubated again with blocking solution for 30 minutes, then

incubated with a second primary antibody, either polyclonal anti-human IFN-a antibody

(PBL Biomedical Laboratories, Piscataway, NJ, USA) or a monoclonal antibody against










FIV p24 gag protein (clone PAK3-2C 1; Custom Monoclonals International, West

Sacramento, CA.). Negative slides remained in blocking solution and did not receive

primary antibody. Slides were developed and stained using the Vectastain Universal

Elite ABC Kit (Vector Laboratories Inc., Burlingame, CA) and visualized with Vector

VIP Substrate (Vector Laboratories Inc., Burlingame, CA). Slides were examined via

light microscopy for positively-staining cells.

Statistical Analysis

The numbers of cells present per unit area were analyzed for differences between

the groups of FIV-infected animals and the age-matched control cats. SAS PROC GLM

was used to conduct the one-way ANOVA analysis, and the least squares means were

calculated and pair-wise group comparisons were conducted using SAS 9.1 (SAS

Institute, Inc., Cary, NC).

Results

Initial immunohistochemical slides exhibited mild homogenous brown extracellular

background staining within the germinal centers/lymphoid follicles, particularly in test

samples using lymph nodes. However, attempts to incorporate a step to quench

endogenous peroxidase activity resulted in abrogation of antibody staining and were

discontinued. The low level of brown background stain did not impair the evaluation of

the dark black cellular staining in antigen-positive cells.

Pathologic changes in thymic sections from infected animals included variable loss

of cortical thymocytes, but overall the cortices were well populated and the

corticomedullary junctions were clearly visible. Formation of germinal centers was a

prominent feature within the infected tissues, and formed either within the medullary

areas or abutting the cortical surface.












Single-Label Immunohistochemistry

Single-label immunohistochemistry experiments using the anti-rhDLEC antibody


in uninfected thymuses stained a very small number of medium-sized to large, ovoid cells


scattered along the corticomedullary junction, as shown in Figure 6-1. In samples from


infected animals, these cells were still present, but the maj ority of DLEC+ cells were


found to be present within the inflammatory germinal centers that developed as a result of


viral infection (Figure 6-2).


I ii
i~ L F

'07r ;ik'
r),I II
I*,iS r, cr I
~ki it
,2
=~r~r lu; I
,
1_...p~cI-~ i,
~:~c~!71-..e-re r trr
I,~Y~li
I;S, ., 'I Il?
.rI._I I' c'rC;:Y1r r,l If~
~C I--
~*: r _u r llJ~f,~l~;7' S~i~
~"I :.~.rr:2~ '(

.'L~~ C '~'lC

1, ~F

r. r ''' r, .II,.-r". (I cr

,iT1C~t~i~ Y I
Ir 'CL I~llLl CI I C
*~~~\tr r'. Il r~ C
r
r' ,''' L LL Illr ~~
rSC~I ..~. ~Ci'* '
.* L~.~ I
) 'II I,,, 5~.~~
1'C r*
(L.~=Lrlt~~~;S:~:l~I L?:Cli~~ .. f rl .~ ... I :
rr,.a C:cl~~ QL ,. ,TC~1 ~ .I
rr-c_ ~ II 1.. r
r, n
.i,
CTI~I~~ 'I
rrrII I r*l r. r .
.r,
**. 1. llb== .~I tl ~ i -~
25 1P
Ilrlr rIr .
,rr

;r~El k' 1~P~* ., ;+ 4 rr~
Z11~r CE :'5 dCI:=: ~' \P r C ,r 12i'Z'r r I')
IC~'~ ,;lr~
~~C~i~ulrl ~ r .I
..
5 r Irt' ~~ r
.CIr
ri
: WI
1.,r'i h I .~
'" ~t~ s~c
~'.*~ I';I t
.I C I~
.*.; =~ ;I f~ 1 ri II
.. 121: Ir
I' ~I i I;.-1 ,
,_. -CC JIL.'' I b d L t,
rll ~-


Figure 6-1. 40X. Single-label immunohistochemistry with a polyclonal antibody against
human BDCA-2 (DLEC) performed on thymic sections from a 16-week-old,
uninfected kitten. Scattered, black-staining DLEC+ cells are present along the
junction between the cortex (more densely cellular area along the top and left
of the figure) and the medulla.











I
r "- "J
,C rl Ii
~t; .;lr ,r
i C I"
Si'
.? h ~ rC
~' ,,,
*L IIIFr~l I
CY ?1 ,. r,
''' rF
Cirl~r *.* E rr I~ Y J
~T r
C' t'c
S ;'AE ILSI rlCI li~i; ;s
~ -~i \(. J
., ~+ r' ?I C
k;L51: jr ,I .
` (IZQ 2
L r .I ,; I
E I.y j. tr I
"cr 1'~Sr*
'r i ~s '
I C ''" I rf:: .. *t=
J rC' .
;r Y *
,r;~a~ 1~' ~" '!' -
I. r .I
r -r Y~
rl~ *'I .C
~ r1
ii
II r
''' '~ u~ =!f? r. '
L C~t ~~. .
I JI r
";: ..,~t~ir-~~ .' LRI

..
X *~r~b
,:, ~,I ,, e ..,.
r ~E
,. ..
.. ~;~ a
I'r~ r ~3u ri r u r +r- rar-*
,
*. ~Z
., 1, 1..~i~jt;rC~i e.
I re .riJ
~'rlF''
7_11 1 .~
r
L 1Cl ~L !`5 ~)
'r ~jlyl 5
I Ict
; ~al ~ .I
i 1~ r, I?,.I .
: II ..p E r r. .r
''
L~ t
.- 1IF ~-- I" ~


Figure 6-2. 60X. Single-label immunohistochemistry with a polyclonal antibody against
human BDCA-2 (DLEC) performed on thymic sections from an 8-week-old
kitten infected with FIV. DLEC+ cells are clustered within a germinal center
that formed along the thymic corticomedullary junction.

Single-label immunohistochemistry experiments using the anti-human IFN-a


antibody resulted in a similar number and distribution of positively staining cells when


compared to those using the anti-rhDLEC antibody. In uninfected animals, small


numbers of positive cells were present along the corticomedullary junction, but in


addition, there was faint positive staining of endothelial cells (Figure 6-3). In infected


animals, cells were present in qualitatively higher numbers and were present along the


corticomedullary junction and within germinal centers (Figure 6-4).





































Figure 6-3. 40X. Single-label immunohistochemistry with an antibody against IFN-a
performed on thymic sections from a 16-week-old, uninfected kitten.
Scattered, black-staining IFN+ cells are present along the junction between
the cortex (more densely cellular area along the bottom of the figure) and the
medulla. Endothelial cells also exhibit faint positive staining.





































Figure 6-4. 10X. Single-label immunohistochemistry with an antibody against IFN-a
performed on thymic sections from an 8-week-old kitten infected with FIV.
Black IFN+ cells are clustered within germinal centers and along the thymic
corticomedullary junction. The fainter homogenous brown staining was
typical of germinal centers and was not considered positive when counting for
IFN+ cells.

Single-label immunohistochemistry using an antibody against the p24 antigen of

FIV did not stain cells within uninfected tissues. Again, the distribution of positively

staining cells within the thymic sections was largely limited to lymphoid follicles with

smaller numbers of cells scattered throughout the medulla. p24 staining cells were

distributed evenly throughout the follicles, and the number of positive cells seemed to

exceed that observed with the DLEC and IFN antibodies (Figure 6-5). p24+ cells were

rare within the thymic cortex.




































Figure 6-5. 10X. Single-label immunohistochemistry with mAb against FIV p24
performed on thymic sections from an 8-week-old kitten infected with FIV.
Black p24+ cells are clustered within germinal centers and throughout the
medulla.

As the tissue sections from the different animals varied in size, the area of thymus

being assessed for positive staining was measured in order to standardize the data. The

number of DLEC+ and IFN+ cells per unit area are summarized in Tables 6-1 and 6-2.










Table 6-1. Number of DLEC+ cells per unit of thymic area.
Mean # positive cells/unit
Amimal group
area
6-8-week-old cats, uninfected 2.27 x 10-6
(n= 2)
6-8-week-old cats, FIV-infected 14.49 x 10-6
(n= 6)
>16-week-old cats, uninfected 2.3 x 10-6
(n= 4)
>16-week-old cats, FIV-infected 5.28 x 10-6
(n= 6)


Table 6-2. Number of IFN+ cells per unit of thymic area.
Mean # positive cells/unit
Amimal group
area
6-8-week-old cats, uninfected 1.55 x 10-6
(n= 2)
6-8-week-old cats, FIV-infected 10.26 x 10-6
(n= 5)
>16-week-old cats, uninfected 2.4 x 10-6
(n= 2)
>16-week-old cats, FIV- 7.24 10-6
infected (n=5)

Statistical analysis of the data showed that there was no significant differences

among the groups for number of cells per unit area that stain positively for IFN-a For

tissues stained with anti-rhDLEC, 6-8-week-old FIV-infected samples contained

significantly more positively staining cells than >16-week-old uninfected animals

(p=0.021) and >16-week-old kittens infected with FIV (p=0.0497).

Double-Label Immunohistochemistry

In thymic tissues stained for DLEC and p24 or DLEC and IFN, the histological

appearance of the positively staining cells was similar. Cells staining positively for

DLEC (black) also appeared to stain positively for p24 and IFN (purple) in the respective

sections (Figures 6-6 and 6-7). There were occasional cells that stained purple (FIV+ or

IFN+) in the absence of co-localizing black stain. These results suggest that many









DLEC+ cells within these sections were associated with virus antigen and are producing

IFN-a.


Figure 6-6. 40X. Double-label immunohistochemistry for DLEC and IFN-a performed on
thymic sections from an 8-week-old kitten infected with FIV. Black staining
(DLEC+) co-localizes with purple stain for IFN-a in germinal centers(open
arrow). Occasional cells stain positively for IFN in the absence of DLEC
expression (black arrows).


;~$p It. *7,





















Fiue -.40.Dubel bel imuohsoceistyfrDE n I 2 efre
onii tyisetosfoan8we-lkittnifce ihFV lc













Thgue series0X Dofbela immunohistochemistry exermetsi this study show that perolycona

antibody aise ginst rhDLEC cros-reacti s with a rpe stidn frth subset ig of felin ty icels





As the polyclonal antibody against IFN-a gave a similar histological distribution of cells

within the thymus, double-label immunohistochemistry was performed on infected

thymus samples to demonstrate that the same cells are staining positively for both

dendritic cell antigen and are producing IFN-a. The signals did appear to co-localize,

suggesting DLEC+ cells are in fact IPCs. Some IFN+ cells were not expressing DLEC,

suggesting that another cell type is contributing to interferon production, or that DLEC

expression within some IPCs was too low to detect by this method.









DLEC+ cells appear increased in numbers in infected thymus samples, but this

proved to be only statistically significant for samples from FIV-infected 6-8-week-old

kittens when compared to those of infected and uninfected 16-week-old animals. In

normal animals, the distribution of these cells is limited to the corticomedullary junction,

while in FIV-infected animals, DLEC+ cells are a prominent cell type within germinal

centers. The distribution of IFN+ cells was similar to that of DLEC+ cells, but statistical

significance was not observed between any of the animal groups.

FIV-infected p24+ cells were observed within germinal centers and scattered in

smaller numbers within the thymic medulla. Given the similar distribution of infected

cells to the IPCs in previous sections, dual-label immunohistochemistry for p24 and

DLEC was performed. Again, there was co-localization of the p24 signal to DLEC+cells,

suggesting that IPCs within the feline thymus harbor FIV.

This preliminary investigation shows that DLEC+ cells are present in the feline

thymus, and appear to produce IFN-a and become infected with FIV. Isolation of this

cell type and in vitro infection studies are necessary for definitive confirmation of these

observations.















CHAPTER 7
SUSCEPTIBLITY OF THYMOCYTES TO FIV CHALLENGE IN VITRO

Introduction

Thymopoiesis and the ongoing output of viable thymocytes are crucial to the

pathogenesis of lentivirus infection and are necessary for the replacement of the virally

targeted T cells that are lost in the course of infection. Direct infection of the thymus by

FIV is known to occur and results in a partial loss of the primary subpopulation of

thymocytes, the double-positive (DP) CD4+CD8+ cells (Orandle, 1997; Orandle, 2000;

Norway, 2001; Johnson, 2001). As our experiments showed that IFN-a was normally

expressed in the thymus, had suppressed expression with FIV infection (Chapter 4), and

that increased levels of IFN correlated with increased absolute numbers of DP

thymocytes and total numbers of thymocytes (Chapter 5), we hypothesized that IFN-a

may confer protective effects in thymuses against FIV infection and the loss of IFN

contributes to increases thymic pathogenesis. Cell culture experiments with fetal

thymocytes were undertaken to produce viral infection in thymocytes and observe the

impact of IFN treatment on viral replication in thymocyte cultures. The previously

characterized, pathogenic FIV molecular clone JSY3 and the open reading frame (ORF)-

A-deficient clone were used in these studies.

Materials and Methods

Cell Culture

Frozen thymocytes cells were retrieved from storage in liquid nitrogen, thawed,

rinsed in wash media (complete RPMI 1640 medium supplemented with 2% fetal bovine









serum), pelleted and resuspended in culture medium [cRPMI 1640 medium supplemented

with 10% fetal bovine serum, 2mM L-glutamine, 10 mM HEPES, 0.075% sodium

bicarbonate, 2 mM sodium pyruvate, 2-mecaptoethanol, and 100U/mL of recombinant

human interleukin-2 (rhIL-2)]. Cells were plated at 2 X 106 viable cells per milliliter and

incubated at 37oC for the nine days of the experiment. Viral stocks of JSY3 and

JSY3AORF-A (viral strain containing a mutation in the open reading frame A [ORF-A]

gene) were used in multiple experiments at various dilutions of 50% tissue culture

infectious doses (TCIDSO), which ranged from 5 X 104 to 3 X 105 TCIDSO. Samples of

cell culture supernatant were taken at days 3, 6 and 9 for the reverse transcriptase activity

assay. When viral infection was not observed, subsequent experiments included CD4E

cells as a positive control cell type for viral replication. At day 9 samples of remaining

cells were stained with trypan blue and viable cell counts were determined. Supernatant

samples were submitted and evaluated for viral replication using an assay for reverse

transcriptase (RT) activity (Johnson, 1990).

Results

Viral Replication in Thymocyte and CD4E Cell Culture Systems.

Three cell culture experiments were performed with thymocytes with multiple

animal sources in an attempt to observe viral replication in this cell type. The first two

experiments yielded no significant RT activity in any treatment wells at any time point

regardless of infectious dose, leading to the conclusion that infection studies in this cell

type were not feasible. A Einal cell culture experiment was undertaken in conjunction

with CD4E cells as a positive cell type control, in order to confirm that the input virus

strains were infectious. This third run yielded a single small peak in RT activity in

thymocyte cultures infected with the JSY3 strain of FIV at day 9 and significant










replication was observed at days 6 and 9 in CD4E cells (Figure 7-2), confirming the

viability of the infecting virus. The ORF-A-deficient mutant strain of FIV did not show

significant replication in either cell type.


Cell culture RT assay

1400.00
e 1200.00
c 1000.00
s..800.00 -Dy
m600.00 ay
ODay9
400.00
200.00










Figure 7-1. Summary of reverse transcriptase (RT) activity in cell cultures of CD4E cells
and fetal thymocytes in one of three series of experiments.

Viability of Thymocytes In Vitro

The overall viability of thymocytes in culture was low by day 9 in all experiments

(~10% of original numbers of plated thymocytes permeable to typan blue), and there

were no determined statistical differences between wells, regardless of virus inoculation

or treatment with IFN-a (Figure 7-1). The experiments using thymocytes were done in

conjunction with cultures of CD4E cells for a third and final series of cell culture

experiments, and wells of CD4E cells contained ten times as many viable cells at the end

of the studies. Wells of uninfected CD4E cells that were treated with IFN-a had half as









many surviving cells as untreated, uninfected CD4E cells (P = 0.01), indicating that IFN-

a may exhibit a considerable toxic effect on this cell type.


Cell viability, Day 9


153500000
S3000000
2 2500000
5~ 2000000
c3 1500000 *
b 1000000
500000
E 0
z0
za oz Z o Z
S U.. U.. U.- U..


m k m -C-
L 2 2 z
1- U U .


Figure 7-2. Number of viable cells on day 9 of cell culture in one of three attempted
experiments. (*) denotes statistically significant differences from control
wells without treatment without IFN-a.

Cytopathic Viral Effects on Thymocyte Cultures.

Photomicrographs of the cells in cell culture experiments are shown in Figures 7-3

through 7-6. Nonviable cells that have died over the course of the experiment appear

dark and opaque. Treatment with IFN-a did not have any observed effects on cell

morphology in CD4E cells or in thymocytes.

















































Figure 7-3. Appearance of freshly thawed CD4E cells at the outset of the cell culture

experiments (20X magnification).


f r r
r
'' r r r
Ir
~"
r
C
r*.
yr



C*r
~ ";;r),;ir,;r:~'Jii


'r C'
i'
"f
r T~ *;ic
^"t+z~
rr
r" :* c~914r

i. *r
r a*
I,


Figure 7-4. Appearance of freshly thawed thymocytes at the outset of cell culture (20X

magnification).

































C ~di ~i"~p,~I'





E 6 F~:'?-$
Figre7-. D4 celsatDa 9ofculur epeimnt A)Uine tecls.B
Uninfectedc cel rae it F -.C elsifce it S3coeo
FIV.~~~~~ ~~~ D)" Cel ifcedwt JY adteae ithIN-.E)Cll nfce



Figure with ORF-A deie nts a y FI culonre xein. F) Cels infected withs OR- dfcin

FIV clone and treated with IFN-a. (20X)







86


:J '. '- '~Y3 I ._ C~Q~B~t.i';":~'~"' _r- ;; ~- I "': t.16
~ `I
Y ~"
?' J ~ -f,
o .
fl- .

;. -1
~F~j .~ ~
; 3a, b
s e~r'e '' :u~'~ r~
1;;;9 ,r J 1'
..q~'J-" ,i
~1~ r...
~F :,* P
,-
(E~c; 3 Clr I* ....... r
~i~J v '~';;3
,
Zi ,~p 4~i~b JI
yl ~ r~ti~~
Y
..- I
'
~f~n'L~'
:r "' ~* 1.
/ ;, i,

r

I~i~i

















Figure 7-6. Fetal thymocyte cells at Day 9 of culture experiments. A) Uninfected cells.
B) Uninfected cells treated with IFN-a. C) Cells infected with JSY3 clone of
FIV. D) Cells infected with JSY3 and treated with IFN-a. E) Cells infected
with ORF-A deficient FIV clone. Fl Cells infected with ORF-A deficient
FIV clone and treated with IFN-a. (20X)