<%BANNER%>

RAAV Mediated Modulation of Parkin in the Rat Basal Ganglia


PAGE 1

RAAV MEDIATED MODULATION OF PARKIN IN THE RODENT BASAL GANGLIA By FREDRIC PER MANFREDSSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Fredric Per Manfredsson

PAGE 3

Pro totus magister

PAGE 4

iv ACKNOWLEDGMENTS Work such as this would never be possi ble without the help and influence from numerous individuals. First and foremost I w ould like to thank my mentors, Dr. Ronald Mandel and Dr. Alfred Lewin, for their neve r-ending patience, support, and mentoring during my graduate school tenure under thei r care. From these two individuals I have learned the best of two worlds: molecular biol ogy and neuroscience. I would also like to thank my mentors Dr. Lucia Notterpek and Dr David Bloom for their input and advice. I would also like to thank Dr. Bloom for introducing me to the world of molecular biology and research, and for introducing me to the University of Florida. I also must extend my appreciation to all the members of the Lewin and Mandel laboratories, past and present. They have al l in one way or another been helpful in my accomplishment of this work. I also would like to extend special thanks to James Thomas Jr. and Isabelle “Izzie” Williams for being instrumental in allowing the laboratories to operate smoothly, and for always offering thei r assistance. I would also like to thank Layla Sullivan for her assistance in my cl oning work and HPLC analysis, Dr Corinna Burger and Dr. Nicolas Muzyczka for their ad vice and for providing me with some of my vectors, and Thomas Doyle for always be ing willing to supply me with cells. BJ Streetman for keeping a close watch on me, and for the assistance in doing all my official paperwork.

PAGE 5

v My work was also made much easier tha nks to Mark Potter and the vector core lab of the Powell Gene Therapy Center, a nd Vince Chiodo of the Hauswirth vector production group who provided me with all my viruses. Of course, this would never be possi ble without the support from friends and family. I would like to thank my grandparent s Karin and Arne Manf redsson, my mother Carina and sister Sarah, a nd my best friend Anders Eldh, for always being there, believing in me and doing whatever they could to make this happen. Thank you!

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES.............................................................................................................x ABSTRACT......................................................................................................................x ii CHAPTER 1 INTRODUCTION........................................................................................................1 Parkinson’s Disease......................................................................................................1 Background............................................................................................................1 Anatomy of PD......................................................................................................2 Dopamine..............................................................................................................5 Treatments for PD.........................................................................................................8 L-Dopa and Other Current Treatments..................................................................8 Gene-therapy Utilizing Trophic Factor Delivery for PD......................................9 Causes of PD...............................................................................................................10 Genetic Causes of PD..........................................................................................10 Synuclein.................................................................................................10 Parkin and UCHL1.......................................................................................11 PINK-1 and DJ-1..........................................................................................15 Idiopathic PD.......................................................................................................17 Animal Models of PD.................................................................................................18 MPTP...................................................................................................................18 Paraquat...............................................................................................................19 Rotenone..............................................................................................................19 6-OHDA..............................................................................................................20 Adeno-Associated Virus.............................................................................................21 AAV Production..................................................................................................22 AAV as a Gene Delivery Vector.........................................................................23 Ribozymes..................................................................................................................25 Project........................................................................................................................ .27

PAGE 7

vii 2 RAAV MEDIATED PARKIN MUTANT EXPRESSION AND RIBOZYME EXPRESSION TARGETING PARKIN IN THE SUBSTANTIA NIGRA DOES NOT CAUSE DOPAMIN ERGIC CELL LOSS.........................................................28 Introduction.................................................................................................................28 Background..........................................................................................................28 Parkin Animal Models.........................................................................................29 Project..................................................................................................................30 Ribozyme.....................................................................................................30 Parkin Mutants.............................................................................................32 Results........................................................................................................................ .33 Ribozyme In Vitro Kinetics.................................................................................33 In Vivo Expression...............................................................................................36 Ribozyme.....................................................................................................36 Mutant Parkin...............................................................................................37 Discussion...................................................................................................................37 3 RAAV MEDIATED NIGRAL PARKIN OVER-EXPRESSION PARTIALLY AMELIORATES MOTOR DEFICITS IN A RAT MODEL OF PARKINSON’S DISEASE....................................................................................................................43 Introduction.................................................................................................................43 Background..........................................................................................................43 Project..................................................................................................................45 Results........................................................................................................................ .45 Amphetamine Induced Rotations........................................................................46 Cylinder Testing..................................................................................................47 Stepping Test.......................................................................................................49 rAAV-Mediated Transduction.............................................................................50 Nigrostriatal DA Neurons....................................................................................51 Fos Expression.....................................................................................................55 Biochemical Evaluation.......................................................................................57 Dopamine.....................................................................................................57 Tyrosine hydroxylase...................................................................................59 Discussion...................................................................................................................60 4 DISCUSSION.............................................................................................................68 Summary.....................................................................................................................68 Dopamine and Behavior......................................................................................68 6-OHDA Lesion..................................................................................................69 Loss of Parkin......................................................................................................70 Parkin and Dopamine.................................................................................................72 Parkin Over-Expression and Therapeutic Potential....................................................73 Future Studies.............................................................................................................75 Concluding Remarks..................................................................................................76

PAGE 8

viii 5 MATERIALS AND METHODS...............................................................................78 Ribozyme i n Vitro Testing..........................................................................................78 Target Labeling...................................................................................................78 Time-Course........................................................................................................78 Multi-turnover Kinetic Analysis..........................................................................79 Virus Preparations......................................................................................................79 Parkin...................................................................................................................79 Ribozyme.............................................................................................................80 Surgical Procedures....................................................................................................81 Intracerebral Injections of AAV Vectors............................................................82 Double injection in the SNc.........................................................................82 Single injection in the SNc...........................................................................82 6-OHDA Lesions.................................................................................................82 Behavioral Analysis....................................................................................................83 Rotational Behavior.............................................................................................83 Cylinder Test.......................................................................................................83 Forelimb Akinesia (Stepping Test).....................................................................83 Histological Procedures..............................................................................................84 Perfusion and Tissue Processing.........................................................................84 Recovery of Fresh Tissue for Pa rkin Over-Expression Project...........................84 Recovery of Fresh Tissue for Ribozyme Project.................................................85 Immunohistochemistry........................................................................................85 In Situ Hybridization...........................................................................................86 Oligo Probe 3’OH Labeling.........................................................................86 Hybridization................................................................................................86 High Performance Liquid Chromatography........................................................87 Western Blotting..................................................................................................87 Estimation of Nigral TH+ Neuronal Survival.....................................................88 Fos Over-Expression...........................................................................................89 Statistical Methods......................................................................................................89 LIST OF REFERENCES...................................................................................................91 BIOGRAPHICAL SKETCH...........................................................................................106

PAGE 9

ix LIST OF TABLES Table page 1-1. Table of genes linked to PD.......................................................................................11 1-2. Proposed substrates of parkin.....................................................................................14 2-1. Comparison of parkin mouse models.........................................................................30

PAGE 10

x LIST OF FIGURES Figure page 1-1. Striatal PET scan......................................................................................................... .2 1-2. Gross midbrain sections showing SN loss....................................................................3 1-3. Basic schematic of the basal ganglia............................................................................5 1-4. Demonstration of Lewy bodies in the SNc...................................................................7 1-5. Schematic of parkin poly-ubiquitination....................................................................12 1-6. Convergent mechanisms of familial forms of PD......................................................16 1-7. Schematic of various toxi n induced models of PD.....................................................21 1-8. Midbrain transduction utilizing various pseudotyped rAAV vectors.........................25 1-9. Schematic of ribozyme binding..................................................................................26 2-1. Schematic of rAAV expressing ribozyme..................................................................31 2-2. rAAV expressing Q311Stop.......................................................................................32 2-3. Time-course experiment of ribozyme 131..................................................................34 2-4. Multi-turnover kinetic analysis...................................................................................35 2-5. Comparison of Vmax..................................................................................................35 2-6. Confocal imaging of substantia nigra treated with parkin ribozyme..........................37 2-7. In situ hybridization and western blot of parkin in the SN.........................................38 2-8. C-terminal parkin dominant negative.........................................................................39 2-9. N-terminal parkin.......................................................................................................40 3-1. Experimental design...................................................................................................44 3-2. Parkin plasmid............................................................................................................ 45

PAGE 11

xi 3-3. Image of rat undergoing rotational analysis...............................................................46 3-4. Amphetamine induced rotations for rAAV2 injected group......................................47 3-5. Cylinder test............................................................................................................. ...48 3-6. Results from cylinder testing of the rAAV2 injected group.......................................48 3-7. Stepping test............................................................................................................. ..49 3-8. Stepping test data........................................................................................................ 50 3-9. GFP transgene expression in the midbrain.................................................................50 3-10. Parkin transgene expr ession in the midbrain............................................................51 3-11. Striatal TH immunoreactivity...................................................................................52 3-12. Nigral TH staining....................................................................................................53 3-13. Result of TH stereology............................................................................................53 3-14. DAT expression in th e substantia nigra....................................................................54 3-15. AADC expression in the substantia nigra.................................................................54 3-16. Activity of basal ganglia output nuclei via Fos over-expression..............................56 3-17. Number of Fos expressing cells in the SNr..............................................................57 3-18. Rotational data from the rAAV5 group....................................................................58 3-19. Dopamine levels measured by HPLC.......................................................................58 3-20. Western blots of TH and the D2 receptor.................................................................59 3-21. D2 receptor protein levels measured by western blot...............................................60 3-22. Graph of striatal TH protein levels...........................................................................60 3-23. Characterization of rAAV2 mid-brain transduction.................................................65 3-24. DOPAC levels in the striatum..................................................................................66 4-1. Regression analysis.....................................................................................................74

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy RAAV MEDIATED MODULATION OF PARKIN IN THE RAT BASAL GANGLIA By Fredric Per Manfredsson August 2006 Chair: Ronald J. Mandel Major Department: Neuroscience Parkinson’s disease (PD) is a progressive neuro-degene rative disease with a strong prevalence in the aging population. Characteri zed by a loss of cell bodies in the midbrain nucleus substantia nigra pars compacta, PD leads to numerous motor dysfunctions which increase in severity with the disease progression. The cause of the sporadic fo rm of PD is largely unknown although seve ral hypotheses converge on in creased cellular oxidative stress, exposure to environmental toxins su ch as pesticides, and aberrant protein accumulation. In the last decades, several fam ilial forms of PD have been identified, several of which are due to mutations in genes involved in proteasomal processing and oxidative stress responses. One such gene encodes the E3 ligase parkin. Several mutations in various regions of parkin have been identified, and they cause a juvenile onset form of the disease termed autosomal r ecessive juvenile PD (ARJP). Interestingly, a vast majority of ARJP pa tients lack a distinguishing f eature of sporadic PD: Lewy bodies, proteinaceous intra-cellular inclusions. Thus, it has been suggested that parkin is intimately involved in the formation in thes e potentially neuro-prot ective structures.

PAGE 13

xiii In this work I present the results from manipulating parkin expression in the rat basal ganglia. Using rAAV to over-express park in during a toxic oxidative insult to the SN, we observed an improvement in behavior as compared to control. However, to our surprise, histological examination showed no increase in cell survival. Thus the benefit from parkin over-expression may not have been due to protection against increased levels of oxidative stress. Conversely, we utilized rAAV expressing ribozymes targeting parkin expression, as well as rAAV expr essing mutant alleles of pa rkin. In line with published data from parkin deficient animals; neither th e mutants nor reduced levels of parkin led to any histo-pathological effects in the substantia nigra, and neither did we see any accumulation of putative parkin substrates. The lack of detrimental effects suggests that parkin deficiency in human patients ma y be only a predisposing factor, and that additional insults may be required to develop PD.

PAGE 14

1 CHAPTER 1 INTRODUCTION Parkinson’s Disease Background Parkinson disease (PD) was first descri bed in 1817 by James Parkinson in his “Essay on the Shaking Palsy” (Parkinson, 2002) Today PD is recognized as one of the most common neurological disorders in the population, second only to Alzheimer’s disease, affecting approximat ely 1% of individuals over th e age of 65. The disease is distributed roughly equally amongst the sexe s and with no difference due to ethnic background. With an increasingly aged population, the disease is becoming more prevalent and imparts a great ec onomical impact onto society. Clinically, the disease is characterized by a number of cardinal motor dysfunctions that include a well defined 4-6 Hz resting tremor which is often described with a “pillrolling” quality when seen in the hands; rigi dity due to increase in muscle tone which is seen as increase in resistance to passive ma neuvers; postural instability as evidenced by shortened arm-swing, shortened stride and loss of postural reflexes and bradykinesia, which may be manifested as decreased f acial expression, slowness of movement, or clumsiness in an extremity. One example of bradykinesia often displayed in PD patients is micrographia in which the affected indivi dual’s handwriting decr eases in completeness and legibility from the beginning of a sent ence to the end (Fahn, 2003). Other symptoms include autonomic problems: severe cons tipation, urinary frequency/nocturia, and problems with thermo-regulation (Adler, 2005) Psychiatric and cognitive impairments

PAGE 15

2 (late-stage dementia (Adler and Thorpy, 2005), depression, hallucinations, and sleep disturbances) are also frequent (Weintraub and Stern, 2005). Figure 1-1. Striatal PET scan. IV-3 and IV-5 are scans from patients with familial PD. IV-6 is a healthy control, and the right scan shows a patient with sporadic PD (Kruger et al., 2001). A clinical diagnosis of PD is mainly based on observation of the previously described motor dysfunctions and responsiv eness to pharmaceutical treatment of L-3,4dihydroxyphenylalanine (L-DOPA). A more definitive diagnosis is accompanied by evaluating the patient with Positron Emi ssion Tomography (PET) (fig. 1-1) where a labeled amino-acid 3,4-Dihydr oxy-6-fluoro-DL-phenylananine (F-DOPA) is used as a tracer in the PET examination in order to de termine whether the brain has a deficiency in dopamine synthesis. If it does not, Parkins on's disease can be ruled out and possible tremors in the patient's muscles will be trea ted differently (Eckert and Eidelberg, 2005). Anatomy of PD Anatomically, PD is characterized by a progressive loss of the midbrain nucleus Substantia Nigra pars compact a (SNc) (fig. 1-2). The onset of the disease is usually observed after a 70% reduction in striatal dopamine (Bernheimer et al., 1973). These cells are part of the basal ganglia (B G) circuitry (fig. 1-3) and have their terminal fields in the striatum where they release dopamine. The basal ganglia are a large and complex sub-

PAGE 16

3 cortical structure comprised of several diffe rent nuclei: the striat um (caudate, putamen, nucleus accumbens), subthalamic nucleus (S TN), globus pallidus internal/external (GPi/GPe), ventral pallidum, substantia nigr a pars compacta and pars reticulata (SNr). Although the relationships between the various nuclei in the basal ganglia are by no means completely understood, many conn ections have been elucidated. Figure 1-2. Gross midbrain sec tions showing SN loss. Right brain is from a healthy individual, and the left brai n is from a PD affected individual, observe the loss of pigmented neurons in the SN (Hughes et al., 1993). The basal ganglia, via the striatum, receives its input from the cortex (corticostriate projections) as well as the intralaminar nucle i of the thalamus. The striatum, in turn, projects its efferents both to the GPi and GPe and the SNc/SNr. The STN has a central role in the BG, relaying input from the motor and pre-motor cortex to the GP. A majority of the output from the BG comes from the GP and the SNr communicating its output is to the frontal cortex through the thalamus, and the brain stem. The BG is further divided into a direct and indirect path way. The direct pathwa y projects its inhibitory circuits from

PAGE 17

4 the striatum to the GPi/SNr, leading to disi nhibition of the thalamus and is thought to facilitate motion by exciting the supplemental motor area of the cortex. Conversely, the indirect pathway is thought to inhibit movement by inhibi tory projections from the striatum to the GPe, which removes its inhi bition from the STN. The activation of the STN is excitatory to the GPi/SNr which in tu rn inhibits the thalam us and its cortical projections. The basal ganglia circuitry is involved in motor function, or more specifically, the control of moto r function, translation of info rmation from the neo-cortex to motor areas as well as automatic executi on of learned motor activity (Squire et al., 2002). The neurons of the SNc contain a by-product of dopamine metabolism, neuromelanin. This substance gives these neur ons their characteristic dark appearance (fig. 1-2) (Substantia Nigra = black substa nce) (Fedorow et al., 2005). The SNc receives inhibitory GABAergic (gamma-aminobutyric acid) input from the striatum, and SNc neurons terminate in the striatum where it stimulate various G protein coupled DA receptors (D1-D5), which reac t differently to dopamine. It is not entirely clear as to how the loss of the nigro-striatal circuitry in PD causes various motor problems. It is believed that the tremor is due to abnormal bursting of neurons in the thalamus which receives i nput from the basal ganglia. The slowness of movement is thought to be due to increase in activity of gl obus pallidus internal, and postural dysfunction is thought to be a result of an inability to suppr ess the transcortical stretch-reflex (Squire et al., 2002). In addition to nigral degeneration in PD, there is also some loss of dopaminergic neurons in the ventral tegmental area and nor epinephrine neurons in the locus coeruleus.

PAGE 18

5 Figure 1-3. Basic schematic of th e basal ganglia (Gerfen, 1992). Dopamine Dopamine belongs to a family of ne urotransmitters termed catecholamines. Catecholamines are organic compounds cons isting of a catechol nuc leus (benzene ring with two hydroxyl groups) and an amine group. In addition to dopamine, other members of this family are noradrenaline and epinephrine. All three neurotransmitters are part of the same biosynthesis pathway, and the presen ce of certain enzymes dictates what cells produce what transmitter. Phenylalanine and tyrosine are the amino-acid precursors for catecholamine synthesis. Dietar y phenylalanine is converted to tyrosine by phenylalanine hydroxylase. Tyrosine hydroxylase (TH) then converts L-tyrosine into 3,4dihydroxyphenylalanine (DOPA). TH mediated activity is highly re gulated through end

PAGE 19

6 product inhibition; where dopamine interf eres with the required co-factor 6( R )-l-erythro5,6,7,8-tetrahydrobiopterin (BH4) by binding to TH and inhi biting reduction of enzymebound iron by BH4 (Purdy et al., 1981) as well as through direct competition for a TH binding site (Cooper et al., 1996). TH is also regulated thro ugh phosphorylation of one of its four serine sites. DOPA is rapidly decarboxylated to dopamine by L-aromatic amino acid decarboxylase. In dopaminergic neurons dopamine is the end-product; however, in adrenergic cells, dopamine is further m odified (Nagatsu and Ichinose, 1999). DA is concentrated into vesicles by the monoamine transporter (VMAT) and these vesicles are localized mainly to the pr e-synaptic terminal. Dopamine is released into the synaptic cleft thr ough calcium dependent exocytosis DA can also be released through the reversal of the dopamine tran sporter which occurs as the result of amphetamine administration. Once release has been achieved, the stim ulus is regulated through the mechanisms of certain pre-synapt ic dopaminergic autoreceptors such as D2 receptors. Dopamine is quickly metabolized by the actions of monoamine oxidase and catechol-o-methyl-transferase (COM T) (extra-cellular) yielding 3,4dihydroxyphenylacetic acid (DOPAC) and homovani llic acid (HVA) via the intermediate 3-methoxytyramine (3-MT) metabolites. DOPAC is known to produce potentially cytotoxic compounds such as hydroxyl radical and superoxide. Extracellular dopamine is also subject to reuptake by the cell through the activity of the dopamine transporter (DAT). The onset of Parkinson’s disease is obse rved at the time when approximately 50% nigral neurons are lost, resulting in a 70-80% loss of striatal dopamine (Bernheimer et al., 1973). The onset is typically unilateral with a subsequent bilateral progression.

PAGE 20

7 Figure 1-4. Demonstration of Lewy bodies in SNc dopaminergic neurons in sporadic PD. Conventional haematoxylin (b lue) and eosin (pink) histological staining (A) reveals a spherical Lewy body (arrow) in SNc dopamine neurons with a distinct central core and a peripheral halo. Electr on micrograph of a Lewy body (B) reveals that the co re (C) contains granular material and the outer halo (h) is composed of radiating fi laments. A standard immunohistochemical protocol shows two Lewy bodies (arrow ) with ubiquitin concentrated in the core (C) and two Lewy bodies (arrow) with synuclein concentrated in the halo (D) (Olanow et al., 2004). Furthermore, postmortem evaluation reveals the hallmark histological feature of the disease, the presence of Lewy Bodies (L B) (fig. 1-4), intrac ytoplasmic eosinophillic inclusions, and Lewy neurites in the SNc and Locus coreul eus. These structures are intracellular aggregations of proteins and lipids, and i mmunostaining has revealed that they contain several proteins involved in proteasomal processing, which has led to the formulation of the hypothesis that these inclusions are an activ e localization of potentially damaging mis(un-) folded proteins to one cellular compartment for degradation

PAGE 21

8 (Sherman and Goldberg, 2001). In addition th ese structures also are highly immunoreactive to -synuclein (Spillantini et al., 1997). However, the inclusion formation may simply be the result of aberrant prot ein aggregation (McNaught and Olanow, 2003). Nonetheless, it is still unclear whether or not th ese Lewy structures are toxic, or, in fact, protective (Olanow et al., 2004). Treatments for PD L-Dopa and Other Current Treatments Current treatments for the disease are limited. The main stream intervention is L3,4-dihydroxyphenylalanine (L-dopa) administra tion. TH is the rate -limiting step in DA synthesis converting tyrosine in to DOPA. Thus, administra tion of L-dopa effectively bypasses this rate-limiting step, resulting in in creased levels of DA. However, treatment is only temporarily efficacious and leads to side-effects such as the development of motor fluctuations (‘wearing-off’ a nd ‘on–off’ phenomena) and dyskinesias. More importantly, treatment does not stop neural degenera tion (Mercuri and Bernardi, 2005). Other pharmaceutical options include dopamine agonists such as pergolide, piribedil, pramipexole, and ropinirole, and mono-amin e oxidase inhibitors such as selegiline (Youdim et al., 2006). Another therapeutic op tion, deep brain stimulation (DBS) is a surgical option to alleviate symptoms by electrically stimulating the thalamus, subthalamic nucleus or the globus pallidus. Th is high frequency stimulation inactivates its target nuclei, thus eff ectively creating a functional le sion without actually removing the nucleus. DBS is an alternative to physical lesions which have shown to produce sideeffects like hemiballismus, a condition resulting in ballistic and choreiform movements of limbs (Moro et al., 1999).

PAGE 22

9 In addition, there have been several other experimental tr eatments aimed at halting degeneration and/or inducing stri atal reinnervation, such as intrastriatal transplants of fetal mesencephalic tissue. However, such treatments are limited by the lack of donor cells, variability in efficacy, as well as ethical concerns (Lindvall and Bjorklund, 2004a, 2004b). One promising potential therapeutic agent for PD may be glial cell derived neurotrophic factor (GDNF ) (Mandel et al., 2006). Gene-therapy Utilizing Trophic Factor Delivery for PD GDNF has been the focus of a large numb er of gene therapy studies. GDNF has proven to be a potent trophic factor for the dopaminergic neurons in the regions affected in PD (Kirik et al., 2004). In rodent models where parkin sonian conditions are induced utilizing various toxins such as 6-hydr oxy dopamine (6-OHDA) or 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine (MPTP), adeno asso ciated virus (AAV) mediated GDNF expression has been shown to be both protec tive and restorative (M andel et al., 1999). Nigral GDNF expression protects the cell bod ies against retrograde toxicity due to a striatal lesion, but the loss of striatal innerva tion is critical to rec overy of motor function (Bjorklund et al., 2000). Protec tion against terminal withdraw al was observed if the virus was expressed directly at the lesion site leading to recove ry of function. When similar experiments were done in non-human primates, striatal injections of rAAV expressing GDNF were performed prior to a 6-OHDA le sion, the treated animals displayed an improvement in motor function, and histologic al evaluation showed a significant increase in surviving cells (Eslambo li et al., 2005). There are c oncerns, however, with GDNF transgene expression. It has been demonstrated, using lenti-vira l vectors, that high levels of GDNF results in decreased expression of TH in the striatum of both intact and lesioned animals, as well as aberrant fiber sprou ting in the SN (Georgievska et al., 2002).

PAGE 23

10 However, this down-regulation effect was not seen using similar rAAV mediated GDNF doses in marmosets (Eslamboli et al., 2005) which may indicate a differential GDNF response between rodent and primat e nigrostriatal dopamine neurons. In humans, GDNF has been delivered in 3 cl inical trials either intraventricularly (Kordower et al., 1999; Nutt et al ., 2003) or intrastriatally (Gi ll et al., 2003; Patel et al., 2005). The results of these studies indicated that there was very little or no improvement of the parkinsonian symptoms, although increases in dopamine levels were seen. In addition, especially after intraventricular GDNF infusion, psychiatric and other hyperdopaminergic side effects su ch as anorexia were observed. Causes of PD The cause of the idiopathic form of PD is not yet known, although numerous hypotheses have been put forth including in creased oxidative stre ss or exposures to environmental toxins such as pesticides, possibly leading to m itochondrial dysfunction (Sherer et al., 2002). Clues to the pathological mechanisms of PD have come from the identification of several familial forms of PD and the genes involved (table 1-1). Genetic Causes of PD Synuclein The first gene to be associated with PD was identified by Polymeropoulos and colleagues and was named synuclein (Polymeropoulos et al., 1997). synuclein is expressed in the synaptic te rminals and has been suggest ed to be involved in the maintenance of synaptic terminals (Bonini and Giasson, 2005; Chandra et al., 2005). The mutant proteins identified in the genetic fo rm of the disease displayed an increased propensity to aggregate (Gia sson et al., 1999; Conway et al., 2000) and subsequent

PAGE 24

11 Table 1-1. Table of genes linked to PD (Moore et al., 2005). Locus Chromosome location Gene Inheritance pattern Typical phenotype PARK1 & PARK4 4q21–q23 synuclein AD Earlier onset, features of DLB common PARK2 6q25.2–q27 parkin usually AR Earlier onset with slow progression PARK3 2p13 unknown AD, IP Classic PD, sometimes dementia PARK5 4p14 UCH-L1 Unclear Classic PD PARK6 1p35–p36 PINK1 AR Earlier onset with slow progression PARK7 1p36 DJ-1 AR Earlier onset with slow progression PARK8 12p11.2–q13.1 LRRK2 AD Classic PD PARK10 1p32 unknown Unclear Classic PD PARK11 2q36–q37 unknown Unclear Classic PD NA 5q23.1–q23.3 Synphilin1 Unclear Classic PD NA 2q22–q23 NR4A2 Unclear Classic PD studies also showed that LBs stained heavily for synuclein suggesting a role in idiopathic PD as well (Spillantini et al., 1997). The identification of synuclein was an early suggestion that protein folding may be im portant to the disease, and this notion was further intensified with the identification of additional familial forms that were both shown to play a role in the cellular proteasomal machinery. Parkin and UCHL1 The first ubiquitin-proteosome gene to be identified was ubiquitin carboxylterminal hydrolase-1 (UCHL1) (Leroy et al., 1998). The second gene was parkin (Kitada et al., 1998), which was identified to be a E3 ubiquitin ligase (Shimura et al., 2000). Parkin serves its function by linking certain substrate proteins to degradation by the 26S proteasome (fig. 1-5). This is achieved by linking a E2-ubiquitin conjugating enzyme

PAGE 25

12 through parkin’s two carboxy terminal RING finger motifs to a substrate recognition domain in the amino-terminus, facilitating s ubsequent poly-ubiquitina tion of the target substrate, tagging it for degr adation (Tanaka et al., 2001). Parkin-associated PD is characterized by a juvenile -onset (before 40 years of age, average 26 years) of symptoms, and this form of the disease has b een termed autosomal recessive juvenile PD (AR-JP) (Ishikawa and Tsuji, 1996). Figure 1-5. Schematic of parkin polyubiquitination (Tanaka et al., 2001). Interestingly, a vast majority of indi viduals do not have LBs (Mori et al., 1998) further implicating parkin’s importance in pr otein clearance and/or maintenance of these structures (Ardle y et al., 2003).

PAGE 26

13 The identification of these familial forms of PD, including synuclein, put forth the idea that aberrant protein folding a nd a hampering of subsequent proteasomal processing may be a common pathological proc ess in PD. Consequently, when LBs were examined it was shown that they contained many components of the proteasomal machinery, including ubiquitin and subunits of the proteasome (Sherman and Goldberg, 2001). Following the identification of parkin as a causative gene in PD, a number of putative substrates have been identified (tab le 1-2): CDC-rel1 which is thought to be involved in dopamine storage (Zhang et al ., 2000), parkin-associa ted endothelin-like receptor (Pael-r) (also called GPR37) (Imai et al., 2001), synphillin-1 (Chung et al., 2001), a rare O-glycosylated form of synuclein (Shimura et al., 2001), -tubulin (Ren et al., 2003), the p38 subunit of aminoacyl-tRNA synthase complex (Corti et al., 2003), and synaptotagmin XI (Huynh et al., 2003). Parkin also facilitates po ly-ubiquitination of cyclin E when parkin is part of a larger complex including cullin-1 (Staropoli et al., 2003). In addition, parkin has been genera lly implicated in the elimination of aggregation-prone cytosolic proteins, includi ng poly-glutamine polypeptides (Tsai et al., 2003). Many of these parkin substrates have later been identified as components of the LBs (Murakami et al., 2004). It is not clear why the lack of functional parkin is detr imental. It may be through a general accumulation of substrates leading to apoptosis through an unfolded protein response (Mori, 2000) or endoplasmic reticulu m (ER) associated degradation (ERAD) and an ER stress response (Forman et al., 2003; Takahashi and Imai, 2003). It may also be a toxic gain-of-function through the accumu lation of a specific protein substrate. Cyclin E for instance, is involved in the G1 /S cell-cycle transiti on. When activated in

PAGE 27

14 dividing cells, division ensues However, when expressed in post-mitotic cells (e.g. neurons) the aberrant activa tion leads to cell-death thr ough apoptosis (Copani et al., 2001; Liu and Greene, 2001), and data suggest s that proteasomal processing plays an integral part in regulating cell-cycle events in post-mitotic neurons (Staropoli and Abeliovich, 2005). Table 1-2. Proposed substrates of parkin (Hattori and Mizuno, 2004). Cyclin E has been shown to accumulate in cells due to pro-apoptotic excitotoxic stimulus such as kainite, but parkin over-exp ression in conjunction with a kainite regimen has been shown to reduce apoptotic activity (Staropoli et al., 2003). In contrast, pael-R over-expression in transgenic flies has been shown to result in accumulation and associated cell death (Yang et al., 2003).

PAGE 28

15 Interestingly, several mouse knock-out lines of parkin have been constructed in order to model PD but display no significan t alteration in phenotype relative to control animals, and the model does not recapitulate the disease progress (G oldberg et al., 2003; Itier et al., 2003; Von Coelln et al., 2004; Perez and Palmiter, 2005). In addition, localized knock-down of park in in the SNc using rAAV me diated ribozyme expression indicated no cellular pathol ogy or substrate accumulation (Manfredsson et al., 2006). In vitro experiments however, have shown that mutant parkin expression results in an increase in markers for oxidative stress (Hyun et al., 2002). PINK-1 and DJ-1 Additional genes have also been identifie d implicating oxidative stress in some forms of the disease. PTEN-induced kinase 1 (PINK-1), a putative mitochondrial kinase proposed to be involved in the regulation of a mitochondrial response to oxidative stress (Valente et al., 2004), and DJ-1, a protein thought to be involved the oxidative stress response by acting as a cellular sensor a nd SUMOylation (a process similar to ubiquitination) (Bonifati et al., 2003 ). Interestingly, data suggests that parkin may interact with DJ-1 during oxidative stress conditions, pr omoting its stability (Moore et al., 2005). The most recent gene to have been associat ed with PD is leucine-rich-repeat kinase 2 (LRRK2), a protein whose normal function is largely unknown (Zimprich et al., 2004). It has been shown that dopaminergic neur ons are exposed to higher basal levels of oxidative stress due to the metabolism on dopamine itself (Jenner and Olanow, 1996), possibly making these cells more sensitive to a break-down in the cellular machinery which normally protects the cell against stresses.

PAGE 29

16 Figure 1-6. Convergent mechanisms of familia l forms of PD (Greenamyre and Hastings, 2004). Excess oxidative stress will, in turn, lead to increased protein damage exacerbating the need for functioning protein clearance mach inery. Furthermore, protein damage to the proteasomal machinery itself may be an im portant factor. It has been shown that Snitrosylation of parkin occurs during nitrosative stress, impa iring its function (Yao et al., 2004). Thus, although the familial forms are of distinct cellular components, the

PAGE 30

17 molecular pathways may be interloc ked and they may converge upon a common downstream fate (fig. 1-6) (Greenamyre and Hastings, 2004). Idiopathic PD Despite insight gained from studying the familial forms of PD, researchers still have not defined or pinpointed the cause of idiopathic PD. However, there is a common theme amongst the familial models which is aberrant protein folding/aggregation and oxidative stress. One robust indicator of the involvement of oxidative stress in PD is the detection of oxidative damage to lipids (D exter et al., 1989), DNA (Alam et al., 1997b), and proteins (Alam et al., 1997a). Furtherm ore, increased activity of superoxide dismutase (SOD) has been reported, which may indicate as a response to increased formation of ROS (Poirier et al., 1994) One significant unknown in PD disease progression is the relatively specific degenera tion of the nigral neurons. One answer may be the highly reactive byproducts of DA me tabolism leading to high basal levels of oxidative stress (Jenner and Olanow, 1996), l eaving the cell much more vulnerable to only slight increases in cellular stress, pe rhaps mediated by exposure to pesticides, increased levels of misfolded proteins due to mutations and so on. Furthermore, discovery of the 6-OHDA model precipitated the finding that this toxin occurs naturally in dopaminergic neurons as a by-product in the hydroxylation of dopamine in the presence of iron (Blum et al., 2001). These findings are further s upported by the finding of 6-OHDA in urine of PD patients (Andrew et al., 1993). Epidemiological studies of sporadic PD have shown increased incidence in areas with high use of pesticides and herbicides, or the consumption of well water in industrialized countri es. However, despite intense research a common causative agent ha s not been found, and these studies do not

PAGE 31

18 fully explain the high occurrence of the disease in other areas as well (Kanthasamy et al., 2005). Animal Models of PD The lack of a true model that recapitulat es all facets of PD has plagued the field. Nigral degeneration has been achieved using various toxins such as 6-OHDA (Ungerstedt, 1968; Sauer and Oertel, 1994), MPTP (Langst on et al., 1983), rotenone (Betarbet et al., 2000), and paraquat (Brooks et al., 1999) (fig. 1-7). MPTP MPTP was accidentally discovered when several drug users in northern California developed acute akinesia following intravenous injection of the street drug 1-methyl-4phenyl-4-propionpiperidine (MPPP), an analog of the narcotic meperidine. MPTP was discovered to be a byproduct of production a nd the causative agent behind the symptoms (Langston et al., 1983). When ad ministered systemically MPTP is converted to 1-methyl4-phenylpyridinium (MPP+) through the action of monoamine oxidase-B in glial cells or endothelial cells in the bl ood brain barrier (BBB). MPP+ is a polar compound and can freely exit glial and endothelial cells and is taken up by dopaminergic cells through the dopamine transporter (DAT). Once inside the cell MPP+ enters the mitochondria through diffusion and blocks the electron transpor t enzyme NADH:ubiquinone oxidoreductase (complex I) (Blum et al., 2001). Although inhib ition of complex I is thought to be a major action of MPP+, it has also been shown to di rectly inhibit complexes III (ubiquinol:ferrocytochrome c oxidore ductase) and IV (ferrocytochrome c :oxygen oxidoreductase or cytochrome c oxidase) of the electron tran sport chain. Interfering with these complexes leads to a reduction of cellular ATP, a nd to the generation of oxygen free radicals and subsequent formation of hydrogen peroxide and hydroxyl radicals

PAGE 32

19 (Smeyne and Jackson-Lewis, 2005). MPTP has b een shown to be an effective inducer of the degeneration of dopaminergic neurons wh en delivered systemically to non-human primates and mice. MPTP intoxication in humans and non-human primates leads to a display of many of the cardinal symptoms normally found in PD (Bove et al., 2005). Paraquat Paraquat ( N N -dimethyl-4-4 -bipiridinium) is an agricultural herbicide with a structure very similar to that of MPP+, and when it is injected systemically it causes reduction in dopaminergic neurons and striatal innervation. The deleterious effects come from oxidative stress due to redox cycling mediated by a cellular diaphorase such as nitric oxide synthase yielding reactive oxyge n species (ROS) (Brooks et al., 1999; Bove et al., 2005). Combined administra tion of paraquat with manganese ethylenebisdithiocarbamate (Maneb), another herbicide often used in conjunction with paraquat, resulted in a greater effect than e ither of the chemicals alone (Thiruchelvam et al., 2000). Rotenone Similarly to paraquat, rotenone also can be found in the environment, and is used as a pesticide. Rotenone is a complex I inhi bitor and chronic admini stration lead to the selective degeneration of the SN dopamine ne urons, beginning in the nerve terminals and progressing retrogradely to the cell bodies. Unlike MPP+ which specifically targets dopaminergic neurons, rotenone administration cr eates systemic inhibition of complex I. Subsequent findings indicated increase in oxidative protei n damage (carbonyls). It has been postulated that rotenone binding to comple x I leads to the leakag e of electrons from the respiratory chain, binding to molecular oxyg en leading to ROS. Furthermore, animals

PAGE 33

20 treated with rotenone accumulat e cytoplasmic inclusions remi niscent of LBs containing ubiquitin and -synuclein (Betarbet et al ., 2000; Panov et al., 2005). 6-OHDA 6-OHDA has to be injected directly into the nigro-striatal circu it to create a lesion. The ability to do a unilateral injection is adva ntageous in the aspect that it creates a behavioral asymmetry which allows the research er to evaluate the extent of the lesion by measuring side-differences in various motor functions. 6-OHDA is an analog of dopamine and undergoes uptake into the neuron through the dopamine transporter. When inside the cell, 6-OHDA generates hydrogen pe roxide through auto-o xidation or through the action of monoamine oxidase with the subsequent production of toxic oxygen radicals which are damaging to proteins, lipids and DNA and toxic to the mitochondria (Ungerstedt, 1968; Faull and Laverty, 1969; Blum et al., 2001; Be tarbet et al., 2002). Furthermore, peroxynitrite (ONOO-) is produced from the reaction of NO and superoxide (Ferger et al., 2001). This compound also lead s to protein damage. Recent data suggest that accumulation of ubiquitin increases in th e lesioned striatum, indicating that the lesion has an effect on ubiquitin depende nt protein handling either dir ectly or indirectly (Pierson et al., 2005). The extent of the lesion is dependent on the site of injection and the volume of chemical injected. Striatal injection provide s a more progressive re trograde degeneration of the neurons in the SN o ccurring over several weeks. A four-site striatal lesion has been sh own to create a significant lesion with significant behavioral impairment when meas ured in amphetamine induced rotations and spontaneous paw use. This type of lesion is thought to better represent symptomatic stages of PD, as the pathology is analogous to that of those pa tients (Kirik et al., 1998). In

PAGE 34

21 contrast, injections directly into the SN and the medial fo rebrain bundle (MFB) creates an acute degeneration within 24 hours with a s ubsequent depletion of striatal dopamine within 2-3 days and a complete denervation of the nigro-striatal trac t and is defined as a complete lesion (Kirik et al., 1998; Betarbet et al., 2002). Figure 1-7. Schematic of various toxin induced models of PD (Schober, 2004). Although these toxin induced models r ecapitulate a common end-stage of PD, loss of nigral neurons, the time-course is re latively acute, and the disease progression is not representative of that of PD. Adeno-Associated Virus Adeno-associated viruses (AAV) belong to the family of human parvoviruses and contain a 4.7kb linear singlestranded DNA genome. The non-enveloped icosahedral virion is small, with a diameter of only 22 nm. The genome consists of two genes; Rep (replication associated proteins ) and Cap (capsid associated proteins). The cap proteins

PAGE 35

22 VP-1 and VP-2 are products of alternative splicing, and VP-3 a result of proteolytic cleavage. In the viral capsid these prot eins are present at a ratio of 1:1:20 (VP1:VP2:VP3). The rep gene, through the use of two promoters and alternative splicing, encodes four regulatory proteins th at are dubbed Rep78, Rep68, Rep52 and Rep40. The virus does not encode any DNA polymerase, and is fully dependent on cellular polymerases for genome replication (Berns 1996). The genome also is flanked by two 145 bp inverted terminal repeats, and these pa lindromic structures are thought to act as primers for replication and are required for viral packaging (McLa ughlin et al., 1988). AAV belongs to a separate genus of par voviruses termed dependoviruses. It is completely dependent of co-infection of other viruses including adenoviruses (Ad), herpes simplex virus type I and II, cytome galovirus or pseudorabies in order for replication to take place. For instance, th e Ad early gene E1A is required for AAV transcription. In addition, the E4 and E2A genes are required for AAV gene regulation and DNA synthesis respectively. In the absen ce of helper virus AAV establishes a latent infection by entering the nucleus where the DNA is uncoated and integrated into the cellar DNA preferentially at a s ite in the long arm of chromosome 19 (Kotin et al., 1990). Upon super-infection of a helper viru s the AAV genome is excised from the chromosome, and replication and packagi ng of the AAV genome ensues. Viral release occurs from helper mediated cellular lysis (Berns, 1996). AAV Production To render rAAV completely re plication deficient, the rep and cap ORFs are replaced with a gene expression cassette of interest, and during v ector production these proteins and helper virus elements are supplied in trans. Plasmids encoding the transgene and Rep and Cap genes, as well as Ad helper gene s are co-transfected into HEK 293

PAGE 36

23 cells, allowing replication onl y to occur during vector pr oduction. Utilizing plasmids expressing helper genes also ensures that th e viral prep does not become contaminated with helper viruses such as Adenovirus. Ce ll lysates are thereafter fractionated using a density gradient using compounds such as Iodi xanol or CsCl. The vira l fraction is further purified using column chromatography. Recent improvements in vector production through the use of large scal e cell factories and improved purification protocols has significantly improved titers and efficiency of production, and has allowed for the development of scalable producti on systems (Zolotukhin et al., 2002). AAV as a Gene Delivery Vector The fact that AAV is not associated w ith disease and that transgene expression ensues quickly has made AAV an attractive tool as a gene transfer ve ctor (Flotte, 2005). Integration occurs at rather low frequency in rAAV lacking rep, and the genome is maintained as an extra-chromosomal episome (Schnepp et al., 2005). Nonetheless, integration is not an immediate concern since the preferential site does not cause a geneinteruption as have been seen with randoml y integrating gene-therapy vectors such as retro-viruses (Sinn et al., 2005). However, a large fraction of the population are seropositive (~80%) and this issue has raised a serious concern about a immune response, possibly rendering infections with a potenti al therapeutic AAV ine ffective. Depending on the route of administration some cell mediat ed immunity has been demonstrated. Studies looking at levels of transgene expression in th e brain of animals pre-immunized with wild type AAV showed that transgene levels were reduced. However, transgene levels were maintained by injecting the animal with a diffe rent serotype from that of the immunizing agent. Furthermore, repeat administration in the brain resulted in an activation of a cellmediated immune response and cytotoxicity (Peden et al., 2004). Although studies like

PAGE 37

24 these may not entirely mimic the levels of neutralizing antibodi es in the general population, it does pose potential problems when undertaking clin ical trials using rAAV. Recombinant adeno-associated virus (rAAV) has been us ed to transfer various transgenes to different tissues in a wide variety of animals (including humans), and has demonstrated an ability to infect a wide variety of cell types (Grimm and Kay, 2003). The first AAV to be identified was AAV type 2 with a specific tissue tropism, AAV2 attachment is primary mediated by heparan su lphate proteoglycans, while internalization is aided by the co-receptors, such as v 5 integrin and fibroblast growth factor receptor 1 (FGFR1) (Lu, 2004). Subsequently, several othe r serotypes of AAV were identified, all with distinct tropisms due to different capsid receptors. In the brain, certain rAAV serotypes and pseudotypes (matching the genome of one serotype with the capsid of a different serot ype) have proven to be particularly effective in transducing certain cell types. For mid-brai n injections to areas such as the SN rAAV utilizing the genome from rAAV-2 and the cap sid of serotype 1 (rAAV 2/1) or 5 (rAAV 2/5) has shown to be most efficient. On the other hand rAAV2/2, although less efficient, is relatively specific for the pars compacta when targeting the SN (Burger et al., 2004) (fig. 1-8). However, one of the drawbacks of rAAV is the size limitation, expression cassettes larger than 4.7 kbs have proven to signifi cantly inhibit vector production (dong frizzell 1996). Complete genes and/or endogenous promoters often en compass larger sequences, and as such researchers often have to resort to cDNA only transgenes and other ubiquitous promoters. However, it has been sh own that superinfecti on of viral particles with different payloads allow for intermol ecular recombination, an approach that may

PAGE 38

25 allow the researcher to potentially overco me the limited carrying capability of AAV (Duan et al., 2001). Figure 1-8. Midbrain transduc tion utilizing various pseudotyped rAAV vectors. A,F,K shows the transduction pattern of the various GFP expressing vectors. C-E, and M-O shows the transduction (GFP) of several non-dopaminergic neurons (shown as red TH+ cells) using AAV1 and 5 respectively. Conversely, AAV2 transduces dopaminergic neurons almost exclusively (H-J). The total number of cells transduced (P) as well as the total trasnsduction area (Q), is significantly higher in AAV1 (Burger et al., 2004). Ribozymes Ribozymes (fig. 1-9) are enzymatic RNA mo lecules that are involved in a number of cellular processes. The family of riboz ymes includes the ribosome and spliceosome. Other ribozymes such as the hammerhead a nd hairpin ribozymes, which are derived from

PAGE 39

26 plant virus satellite RNAs, are much sma ller and can be engineered to cleave RNA molecules in trans destining the molecule for degradation. Figure 1-9. Schematic of ribozyme binding. A) 3D rendering of the hammerhead ribozyme (purple strand) binding to the target RNA (yellow strand), and the location of the divalent ion (red ball ). B) Letter diagram of ribozyme and target, substitution of G to C in th e catalytic core re nders the ribozyme inactive. Courtesy Dr. Lynn Shaw. These ribozymes can be designed in the la boratory to target specific genes of interest, and, due to highly specific hybridizati on dynamics, ribozymes can be created to specifically target transcripts with singl e point mutations, while leaving wild-type transcripts relatively untouched (Lewin and Hauswirth, 2001). This specificity has allowed researchers to co-express a certain ribozyme targeting a dominant mutation together with a “hardened target”, a therap eutic gene-replacement carrying a single silent mutation rendering it invisible to the ri bozyme (Zern et al., 1999). The hammerhead ribozyme cleaves preferentially after a NUX sequence, where X can be any ribonucleotide except guanosine, and N any nuc leotide. Flanking this cleavage sequence, the ribozyme is designed to base-pair with the target mRNA (5-7 nucleotides). The

PAGE 40

27 hammerhead ribozyme requires a divalent ion such s Mg2+ as a co-factor for cleavage to occur. Once the correct three-dimensiona l conformation of the ribozyme has been achieved and it has base-paired with the target sequences the enzyme hydrolyzes the 5’3’ phosphodiester bond at the cleavage site. The re sultant products are two RNA fragments carrying either a 5’ hydroxyl, or 2’3’ cyclic phosphate groups (Doudna and Cech, 2002). The cleavage rate is relatively fast and the rate-limiting step is the release of the mRNA from the ribozyme hybridization arms (Her tel et al., 1994). When designing a ribozyme to target a gene (mRNA) of interest one also has to consider the local secondary structure of the RNA, where a highly stable and fo lded RNA molecule can interfere with the binding of the ribozyme. There are several st ructure predicting programs available such as MFOLD (Zuker, 2003), but the ultimate e fficacy of a ribozyme must be determined experimentally (Lewin and Hauswirth, 2001). Project The following chapters illustrate two inde pendent projects where expression levels of parkin in the rat basal ga nglia have been modified. I will discuss the findings of a preliminary study where endogenous parkin wa s knocked down utilizing rAAV mediated ribozyme expression, aiming to model the hum an disease. Second, I will describe the findings of a project where animals were pr e-injected with a rAAV expressing parkin prior to being subjected to a strong acute lesion of the nigro-striatal tract. Interestingly, our results indicated a positive effect. However, our a priori working hypothesis did not hold true as we did not rescue cells per se, but still showed behavioral improvement in the treated animals.

PAGE 41

28 CHAPTER 2 RAAV MEDIATED PARKIN MUTANT EXPRESSION AND RIBOZYME EXPRESSION TARGETING PARKIN IN THE SUBSTANTIA NIGRA DOES NOT CAUSE DOPAMINERGIC CELL LOSS Introduction Background Parkinson’s disease (PD) is a very co mmon neurodegenerative disease affecting approximately 2% of the population over the ag e of 65. The disease is manifested as a progressive loss of dopaminergic neurons in the Substantia Nigra pars compacta leading to motor deficits such as muscular rigidit y, resting tremor, and slowness of, or lack of movement. The cause of PD is yet to be determined and is probably multifactoral. Numerous hypotheses have been put forth de scribing environmental toxins, oxidative stress, and aberrant proteasomal processi ng, all leading to the ablation of the SN. Recently, several familiar forms of PD have been linked to two genes involved in proteasomal processing: Parkin and ubi quitin carboxy-terminal-hydroxylase-L1 (UCHL1), as well as -synuclein ( -syn) whose mutant version may accumulate as a result of oligomerization and/or aberrant removal (Jain et al., 2005). The lack of a true animal model has long plagued PD research. Several toxin models exist, however, alt hough causing selective degeneratio n of the SN, these models may not fully recapitulate the true molecular events leading to degeneration. In addition to toxin models (Bove et al., 2005), several knock-out and transgenic mouse lines have been created (Hashimoto et al., 2003).

PAGE 42

29 Parkin Animal Models A number of groups have reported parkin knockout and parkin mutant transgenic mice (Goldberg et al., 2003; Itier et al ., 2003; Von Coelln et al., 2004; Perez and Palmiter, 2005) with varying results (table 2-1) Most striking is th e lack of a distinct phenotype that one would predict in terms of modeling a human disease gene. One parkin knock-out line describes a slig ht increase in extra-cellular dopamine in the striatum, but with no pathology or accumulation of parkin substrates. However, when measuring the synaptic response of striatal medium-sized spiny neurons (target of nigral dopaminergic projections), the current required to evoke action poten tials synaptically in parkin –/– neurons was significantly higher (Goldberg et al., 2003). A parkin knockout by Itier et al., again showed no pathology. However, DAT and VMAT2 levels were significantly reduced in the striatum of mutant mice when measured by western blots. Again, dopamine levels were slightly higher in cer tain regions of these animals (Itier et al., 2003). Another parkin deficient strain create d by Dawson and colleagues displayed a loss of neurons in the locus coeruleus (another region that display some cell loss in PD). There was, however, no alteration in dopamine le vels in these animals (Von Coelln et al., 2004). A fourth knock-out line has been evalua ted in great depth, and the investigators found very little differences when evaluating parkin knock-out in two different backgrounds (Perez and Palmiter, 2005). Although the results of the various parkin KO’s are varied, 3 of the groups report some form of alteration in dopamine or dopamine metabolism. Increase in DOPAC formation by MAO (an enzyme considered main ly intraneuronal) as opposed to 3-MT formation by COMT (this enzyme is mainly extraneuronal) s uggests that parkin

PAGE 43

30 dysfunction maybe demonstrated in impairme nt of release of dopamine and increased intraneuronal metabolism (G oldberg et al., 2003). Table 2-1. Comparison of parkin mouse models. (Perez and Palmiter, 2005). One concern raised by the variability in th ese knock-out models is that the observed differences are due to artifacts due to technical difficulties in gene targeting in mice. For instance, one group used a Pgk neor cassette which can effect regulation in neighboring genes. Furthermore, parkin deficien t mice were tested on a B6;129 genetic background which can lead to false positives depending of the segregation of genes in which strain differences can account for differences in behavior (Perez and Palmiter, 2005). Project Ribozyme In this project we evaluated whether or not spatio-temporal k nockdown of parkin in the SN would result in TH down-regulation or loss of cells. By using a rAAV mediated ribozyme expression (fig. 2-1) injected dire ctly into the SNC we hypothesized that we

PAGE 44

31 would avoid any confounding effects due to gene tic variation in the strain background of the parkin deficient strains. Figure 2-1. Schematic of rAAV expressing ribozyme. The hammerhead ribozyme is a catalytic RNA molecule which can function in the cleavage of particular RNA molecules, in this case, parkin mRNA. When designing a hammerhead ribozyme to target a certain mR NA, one must find a region in the target containing NUX, where N represen ts any nucleotide, U stands for Uridine, and X may be any nucleotide other than guanosine. The 68 basepairs flanking the X (which does not base-pair with the ribozyme) on either side ar e then included in the ribozyme sequence to confer specificity for the gene (Lewin a nd Hauswirth, 2001). Since the occurrence of the NUX sequence will be high in any given mRNA further analysis may be done, utilizing various algorithms, finding the RNA regions with the least am ount of secondary structure (Jacobson and Zuker, 1993; Amarzguioui et al., 2000). pTR-UF12 PARKIN RZ131 HP6875 bp ApR ColE1 ori f1(+) origin TR TR IRES GFP (F64L, S65T) CMV ie enhancer Intron Parkin Ribozyme 13 Hairpin Rz SV40 poly(A) Chiken b-actin promoter Exon1

PAGE 45

32 Parkin Mutants In addition to the ribozyme injections we also treated some animals with rAAV expressing two different mutant parkin genes (supplied by Dr. Corinna Burger). Q311Stop (fig. 2-2) caused the transla tion of a truncated protein, terminating immediately upstream of the IBR domain (Hattori et al., 1998). We hypothesized that this construct would potentially take on a dominant negative fo rm by binding to a specific substrate but being unable to perform polyubiquitination. The second mutant was not a disease mutant per se but a version of parkin wh ere the start-codon was moved downstream from that of the normal star t site (named C-terminal parkin). Figure 2-2. rAAV expressing Q311Stop. Again, we rationalized that over-expressi ng this mutant form would potentially bind to, and sequester, compone nts of the proteasomal mach inery, overall reducing the level of proteasomal processing.

PAGE 46

33 We successfully designed a ribozyme targe ting human parkin that showed strong kinetics in vitro as well as robust knockdown in vivo However, we did not see any accumulation of substrate due to technical difficulties discussed below. This was the result of an inherent difficulty with studying certain bio-molecule levels such as RNA in the SN which became evident in our study. Pr oteins such as parkin are ubiquitously expressed in the brain, but the rAAV trans duction pattern that we observed was highly specific for the SNc (Burger et al., 2004), thus it became difficult to isolate these nigral neurons, and to analyze their content without background from surrounding tissue. Furthermore, the substrates that we analyzed showed no accumulation using immunohistochemistry, but it was difficult to obtain a positive control for this since expression levels of cyclin E for instan ce, in normal brain tissue is very low. Furthermore, there are no commercially availa ble antibodies for severa l of the substrates, thus we were not able to study those. Ove r-expression of the mutant forms of parkin showed similar results, using human spec ific antibodies we we re able to show transduction, but we did not observe any pathology, nor did we see any significant accumulation of substrates. Results Ribozyme In Vitro Kinetics The published parkin mRNA sequence was scanned for GUC or CUC sites. The immediate sequence surrounding the putative cleaving sites where thereafter analyzed using MFOLD (Zuker, 2003) to find those re gions most favorable to ribozyme access. The first in vitro step was then to evaluate whether or not the ribozyme would cleave the target (time-course experiment).

PAGE 47

34 Figure 2-3. Time-course experiment of riboz yme 131. Left Image: Upper band shows the end-labeled target RNA, and the bo ttom band is the product of ribozyme cleavage. The target is almost fully de pleted after ~90 minutes of incubation (time-axis left right). Right graph shows quantification of ribozyme cleavage. In the time-course experiment the ribozyme is incubated with a small radioactively endlabeled RNA molecule. The ribozyme reacti on was allowed to carry on for different periods of time ranging from seconds to a c ouple of hours. The amount of cleavage is thereafter quantified to evaluate how much of target is cleaved over time (fig. 2-3). The second step in the in vitro analysis was to evaluate the ribozymes under substrate excess for a period of time (multiple turnover kinetic analysis ) established in the time-course where the cleavage rate is linear and no more than 10% of substrate has been converted. The reaction conditions were the same as for the time-course analysis, but with increasing amounts of target (3-300pm ta rget, 0.3pm ribozyme). Values for Vmax and Km where obtained using Lineveawer-burke plots, and kcat was determined by the calculation: kcat= Vmax/[Rbz] (figs. 2-4, 2-5). From these assa ys we chose a ribozymes cleaving parkin mRNA at position 131 for in vivo testing.

PAGE 48

35 Figure 2-4. Multi-turnover kinetic analysis. Left graph is showing a Lineveawer-burke plot illustrating the results from the multi-turnover kinetic analysis of ribozyme 131. Right graph shows the sa turation kinetics for the same ribozyme. The results for target 131 was: Vmax=1 m/min; Km=4.0M; Kcat=6.7 min-1. Figure 2-5. Comparison of Vmax between th e various ribozymes tested. From these results the ribozyme targeting bp. 13 1 was selected for further study. DNA oligos encoding the ribozyme we re then cloned into a rAAV cloning plasmid, pTRUF-12. This plasmid contains an enhanced CBA/CMV promoter hybrid driving the expression of the ribozyme follo wed by a self-cleaving hairpin ribozyme. There is also an internal ribozyme entry si te (IRES) facilitating the expression of the transduction marker GFP (fig. 2-1).

PAGE 49

36 In Vivo Expression Ribozyme The virus was subsequently injected unilaterally into the SNc of adult female Sprague-Dawley rats. Five weeks post-injecti on the animals were euthanized and their brains were recovered for hi stological examination. Laser scanning confocal microscopy of the SNc indicate that we achieved a r obust knock-down of park in using ribozyme 131 in cells that also carry the marker of transduction. There was, however, gr eat variability in the reduction levels in these cells. This variation in reduction is probably due to a variation in the copy number of the ribozyme cDNA, a feature of the use of rAAV which cannot be controlled (fig. 2-6). Furthermore, due to the nature of th e SNc it is virtually impossible to dissect out only the dopaminerg ic cells of this region using conventional methods and the surrounding tissue does expr ess equally high levels of parkin. We also recovered fresh tissue from f our animals expressing ribozyme 131, and this tissue was analyzed for parkin expression using in situ hybridization as well as western blotting. Since there are several splice va riants of parkin we used three different probes when looking at the expression, figur e 2-7 (top panel) show s the result of two probes, indicating a significan t reduction in parkin mRNA levels. The results from the in situ hybridization indicate a shar p reduction in parkin levels in the SNc, however, when the SN was dissected out in serial secti ons and parkin protein levels analyzed electrophoretically, we were not able to detect any difference between the treated and untreated sides (fig. 2-7 bottom panel). Furtherm ore, there seems to be no decrease in TH expressing cell numbers in the injected SNc, indicating that although we achieved parkin knockdown, that there was no resu ltant pathological effect.

PAGE 50

37 Figure 2-6. Confocal imaging of substantia ni gra treated with parkin 131 ribozyme. Panel A shows the transduction resulting in GFP expression. Panel B & C shows TH and parkin expression in the ribozyme injected side respectively. Panel D shows a merged image of all stains. Yello w arrows indicate cells that are GFP and TH positive, but lack parkin expression. White arrows indicate TH positive cells that express GFP, but are parkin positive. Panels E-G shows the same stains in the uninjected hemisphe re white white arrows indicating cells expressing both parkin and TH (Manfredsson et al., 2006). Mutant Parkin rAAV expressing mutant parkin was inject ed unilaterally into the SNc of adult female Sprague-Dawley rats. Six weeks following the injections the animals were sacrificed by perfusion. I mmunohistological evaluation indi cate strong transduction for the C-terminal parkin (fig. 28), and a large number of tran sgene expressing cells in the case of Q311stop (fig. 2-9). However, as w ith the ribozyme inject ions, no loss of TH expressing cells or substrate accumulation was observed. Discussion In this study we utilized rAAV medi ated ribozyme expression to knock down parkin expression in the rat SNc. Despite apparent robust knockdown in dopaminergic

PAGE 51

38 neurons, no pathology or accumulation of subs trate was observed. These findings support the findings that no cellular pathology is obser ved in the parkin de ficient mouse strains (Fleming et al., 2005). Figure 2-7. In situ hybridization and western blot of parkin in the SN. Top image shows the result of in situ hybridization using two different probes for parkin. White arrow indicates the injected SN and black arrow the un-injected SN. Bottom panel shows the protein levels of parkin in the dissected SN by western blot. The two lanes on the right are from the left and right hemisphere of a nave animal. There were no observable differenc es in protein levels in any animal. The fact that loss of parkin in the rodent does not cause the same symptoms that are observed in AR-JP may be due to the simple fact that there are essential differences between rodent and human parkin. Additiona lly, there may be redundancy in the rodent polyubiquitination system, making it less susceptibl e to parkin loss (Kikkert et al., 2005). This would explain the lack of substrate accumulation. Finally, one attractive hypothesis would be that loss of parkin or expression of mutantparkin sens itizes the affected individual to a second insult, for instance environmental stress such as pesticides. However, when one strain of parkin de ficient mice was challenged with 6-OHDA, no increased pathology was seen (Perez et al., 2005). Obviously more common

PAGE 52

39 environmental toxins such as rotenone and paraqu at should be tested in order to test this hypothesis. In vitro data suggests that exposing me sencephalic primary cultures to rotenone was more toxic in cells taken from parkin deficient animals (Casarejos et al., 2006), but this has not been tested in vivo Figure 2-8. C-terminal parkin dominant negative. Animals that received unilateral nigral injections of rAAV-C-terminal parkin 4 weeks previously were stained using a human specific C-terminal an tibody kindly provided by Michael Schlossmacher (Harvard University). The top two panels show the nigral staining for the C-terminal parkin prot ein. No staining is visible on the other side of the brain. Arrows point to a landmark present in all the panels. The bottom panels show TH staining of seri al sections. This figure shows that TH+ neurons in the substantia nigra proba bly received the vector but there is no loss of nigral TH+ neurons.

PAGE 53

40 Figure 2-9. N-terminal parkin. This construct was intended to be a dominant negative by virtue of binding to a parkin substrat e but not allowing binding to the polyubiquitinating complex. The vector transduction is shown by immunostaining with an antibody raised against an epitope in the N-terminal region of parkin. As can be seen in the TH panels, there was no cell loss in these animals which lived 6 weeks post-transduction. There was also no obvious accumulation of cyclin E.

PAGE 54

41 The lack of pathology when over-expr essing the disease mutant and the Cterminal form of parkin could also be e xpected when one considers the human disease which is a genetically recessive disease. Although we were able to show strong transduction, especially for C-terminal parkin, it is not likely that these alleles confer a toxic gain of function. This study also demonstrated the diffic ulties associated with quantitatively demonstrating the knock-down of certain messa ges in the brain when the target is ubiquitously expressed throughout the brain. It is well established that rAAV does not readily infect non-neuronal cells in the brain, but parkin is ub iquitously expressed in glial cells as well (D'Agata et al., 2002). In such instances, alternativ e vectors such as lentivirus vectors, which lack neuronal sp ecificity, may be of be tter use, allowing for knockdown in all cells of a distinct region (Trono, 2000). The rAAV transduction pattern that we obs erved was highly specific for the SNc (Burger et al., 2004), thus the parkin knock-dow n was isolated to these nigral neurons. Thus it became impractical to analyze th e cell-specific effects by using sampling procedures such as tissue punches due to the dilution effect fr om surrounding tissue. Furthermore, the substrates that we analyzed showed no accumulation using immunohistochemistry, but it was difficult to obtain a positive control for this since expression levels of cyclin E for instan ce, in normal brain tissue is very low. Furthermore, there are no commercially availa ble antibodies for severa l of the substrates, thus we were not able to study those. Our results do strengthen the indications from studying the animal models, that parkin knockdown alone will not be a good mode l for PD, at least not in the rodent.

PAGE 55

42 Furthermore, evaluation of parkin knockdow n does not provide many clues of how loss of parkin actually does cause PD. One common indicator in many in vivo and in vitro models indicates an involvement of parkin in dopamine production and/or metabolism. Parkin has been shown to enhance DAT function (Jiang et al., 2004) as well as modulating dopamine metabolism in a neurona l cell-line by suppres sing expression of endogenous MAO. This effect was not due to enhanced poly-ubiquitination of MAO, but rather a reduction in MAO mRNA levels, sugge sting that parkin may either act on some regulatory element in transcription or have an alternative func tion. Parc (parkin-like cytoplasmic E3 ligase), another E3 ligase with similar motifs to that of parkin has been shown to silence p53, not by poly-ubiqui tination, but by sequestering p53 in the cytoplasm, keeping it away from the nucle us. Interestingly, parkin expression had no effect on exogenously expressed MAO, when co-t ransfected into a non-neuronal cell line, indicating that parkin function may be cell spec ific (Jiang et al., 2006).

PAGE 56

43 CHAPTER 3 RAAV MEDIATED NIGRAL PARKIN OVER-EXPRESSION PARTIALLY AMELIORATES MOTOR DEFICITS IN A RAT MODEL OF PARKINSON’S DISEASE. Introduction Background Parkin is an E3-ligase that functions to poly-ubiquinate proteins that are destined for degradation by the proteasome (Shimura et al., 2000). Mutations in the parkin gene causes Autosomal Recessive Juvenile Parkinsoni sm (ARJP) which is an early onset form of familial Parkinson’s disease (PD) (Kitada et al., 1998). The idiopathic form of PD is a common neurodegenerative disease that is clinically characte rized by a number of motor dysfunctions such as a well defined resting tr emor, rigidity and slowness of movement. Neuropathologically, PD is characterized by a progressive loss of the midbrain dopamine (DA) neurons residing in the substant ia nigra pars compacta (SNc). These cells are part of the basal ganglia circuitry and ha ve their terminal fields in the striatum. Furthermore, a hallmark feature of the dis ease is the presence of Lewy Bodies (LB) which are intracytoplasmic eosi nophilic inclusions. LBs are thought to be the result of an active accumulation of potentially damaging misfolded proteins (Shimura et al., 2000; Olanow et al., 2004). Early in the course of PD, the disease can be successfully treated by peripheral L-dihydroxyphenyl alanine (L-dopa) but the effectiveness of this pharmacotherapy inevitably wanes as the dis ease progresses. Therapies that affect the ongoing neurodegeneration via interfering with the disease process would be advantageous.

PAGE 57

44 However, since the etiology of the idiopathic form of PD is not yet known, the effort to find disease-alteri ng therapies has been slowed. Several hypotheses to explain the causes of PD have been put forth in cluding: impaired proteasomal processing, increased oxidative stress, or exposure to environmental toxins such as pesticides, possibly leading to mitochondrial dysfuncti on (Sherer et al., 2002). In addition, the discovery of parkin’s causative role in ARJP, the accumulation of another familial PD gene product, synuclein in LB, as well as mutati ons in another proteasomal enzyme, C-terminal hydrolase isozyme 1 causing fam ilial PD (Leroy et al., 1998), have supported the idea that aberrant proteasomal proce ssing may lead to PD (Betarbet et al., 2005; Cookson, 2005a). Moreover, oxidative stress, whic h has been reported to be exaggerated in DA neurons may interact with abnormal protein accumulation to damage nigral DA neurons (McNaught et al., 2002). Furthermore, pa rkin has been shown to directly interact with DA (LaVoie et al., 2005), and some of park in’s putative substrates may be directly toxic to DA neurons (Staropoli et al., 2003; Yang et al., 2003). Therefore, it is reasonable to hypothesize that enhancing the function of parkin might make proteasomal processing in DA neurons more efficient thereby protecting these neurons against multifactorial insults (Cookson, 2005b). Figure 3-1. Experimental design.

PAGE 58

45 Project In this study, we sought to evaluate whet her enhanced levels of parkin expression during the course of a 6-hydroxydopamine (6 -OHDA) lesion would alleviate the effects from oxidative stress and resc ue the cells from cell-death. We utilized rAAV2 to deliver a human form of parkin to the SN c of the rat 6 weeks prior to a 4-site striatal 6-OHDA lesion. Th is lesion-model was chosen because it provides a progressive (Kirik et al., 1998), yet complete le sion. Following the lesion, the animals were subjected to a battery of behavioral tests which have been well characterized for this type of lesion (fig. 3-1). Preliminary data using a weaker 2 site lesion indicated that there was functional improvement in parkin treated animals: however, the weaker lesion yields a wide range of damage, and the variation in behavior was too large. Figure 3-2. Parkin plasmid. Parkin expr ession is driven by a hybrid CMVie/CBA promoter. Downstream of the park in cDNA is a cis-acting woodchuck postregulatory regulatory element (WPRE). Results In order to evaluate the effects of nigral parkin over-exp ression, we injected 2 l of either rAAV2human parkin (hparkin) (fi g. 3-2) or rAAV2-GFP in 2 sites in the substantia nigra in nave rats. Six weeks la ter, we performed a four-site 28 g 6-OHDA lesion that results in a near complete DA depl etion of the striatum but leaves the nucleus

PAGE 59

46 accumbens intact.(Kirik et al., 1998). These an imals were tested monthly on a series of behavioral tests sensitive to striatal DA-mediated motor behaviors (fig. 3-1). This experimental layout was also duplicated for a group of animals r eceiving rAAV5-hparkin or rAAV5-GFP. The rAAV5 groups, however were evaluated only for rotational behavior in order to valid ate functional improvement. A unilateral 6-OHDA lesion leads to the depl etion of dopaminergic terminals in the ipsilateral striatum. Subsequent systemic ad ministration of amphetamine results in the release of DA from storage vesicles in th e presynaptic terminals, and due to the imbalance between the lesioned and non-lesione d side, rotational behavior is observed (fig. 3-3). Amphetamine Induced Rotations Figure 3-3. Image of rat undergoi ng rotational analysis This animal has been lesioned on the left side and has been injected with amphetamine. Note the counterclockwise (ipsiversive) turning. Measurable turning behavior requires the deple tion of a significa nt portion of the nigrostriatal neurons (>60%). Since the non-le sioned side contain more terminals and thus more DA, turning behavior is ipsive rsive (towards the side of the lesion) (Ungerstedt, 1968). Fewer rotations in this test usually indicate less striatal DA depletion (Zetterstrom et al., 1986; Hudson et al., 1993).

PAGE 60

47 Figure 3-4. Amphetamine induced rotations for rAAV2 injected group (p = 0.0015). At 4, 8, and 12 weeks following the 6-OHDA lesion the animals were subjected to this motor test, and at all time-points the parkin-treated group di splayed a significant improvement over the control group, suggesting increased levels of DA in the parkin treated nigrostriatal terminals (fig. 3-4) However, although there was a significant reduction in turning behavior (6 7%), this still does not represent a complete rescue of behavior as a non-lesioned an imal would be expected to have no net rotations in one direction (Kirik et al., 2000a). Cylinder Testing Unilateral striatal DA depletions also induce a significant asymmetry in contralateral front limb use during vertical expl oration in a spontaneous motor test that is carried out in a clear cylinder. During the test the animal is allowed to explore the sides of a clear plexiglas cylinder using its fr ont paws for support as it ambulates around the cylinder walls (Moroz et al., 2004) (fig. 3-5).

PAGE 61

48 Figure 3-5. Cylinder test. This image illustra tes the cylinder test. During actual testing conditions the animal activity is videotaped in the dark. Figure 3-6. Results from cylinder testing of the rAAV2 injected group. The rAAV2parkin treated group displaye d a higher use of their contralateral paw (left bar) as opposed to the rAAV2-GFP treated group (right bar) (p = 0.012).

PAGE 62

49 At all time points in the cylinder test, the parkin treated animals displayed a significant improvement over the GFP treated an imals (fig. 3-6), but again, the parkintreated rats only used their affected paw approximately 20% of the time whereas normal animals would use both paws equally to expl ore the cylinder walls (Choi-Lundberg et al., 1998). Stepping Test Figure 3-7. Stepping test. Ex ample of fore-hand (dragging the palm) stepping. The lesioned animal (bottom images) disp lay a significant impairment of the contralateral paw. Back-hand (dragging the back of the paw) (not pictured) stepping is generally not impa ired in the lesioned animal. The stepping test is used to evaluate forelimb akinesia that is most likely due to rigidity of the affected limb (Olsson et al., 1995). 6-OHDA-lesi oned rats display a significant impairment of the contralateral paw (f ig. 3-7), and a slight but transient effect in the ipsilateral paw. Eight and 12 week s following the lesion, forehand (dragging the paw of the hand) stepping was unimproved in the parkin-treated group as compared to controls. However, there was a slight but si gnificant improvement in backhand (dragging

PAGE 63

50 the back of the hand) stepping in the parkin treated animals. (fig. 3-8). However, we only observed a slight impairment in backhand step ping in the control gr oup which is a typical finding after a nigr o-striatal lesion. Figure 3-8. Stepping test data. There was no improvement in forehand stepping (left), but slight improvement in backhand (right) stepping. rAAV-Mediated Transduction The rAAV vectors successfully transduced the DA neurons in the SNc showing positive human parkin staining (figs. 3-10, 323) and GFP staining (fig. 3-9). Regions that might be related to basa l ganglia function that were al so transduced included the SNr (fig. 3-23,D-E), the subthalamic nucleus (S TN, fig. 3-23,A & B), and the entopeduncular nucleus (EN, fig 3-23,A & C). Figure 3-9. GFP transgene expression in the midbrain. Using immunohistochemistry transgene expression is observed in th e right hemisphere but not the left.

PAGE 64

51 Figure 3-10. Parkin transgene expression in the midbrain. Using a transgene specific antibody, expression is observed in the right hemisphere only. Because histological examination took place after the 6-OHDA lesion there is no detectable parkin or GFP staining in the SNc. In addition, this extensive midbrain transduction we observed for the rAAV2 group is in contrast to that reported previously for rAAV2 which has been shown to specifica lly transduce the SNc (Klein et al., 1999; Valente et al., 2004; Mandel et al., 2006). However, in this st udy, we injected 2 injections of 2 l of high titer rAAV2 which may have le ad to this extensive but atypical midbrain transduction pattern. Nigrostriatal DA Neurons DA-mediated behavior is cr itically dependent on the in tegrity of striatal DA innervation (Rosenblad et al., 1999; Kiri k et al., 2000b). There was no difference in striatal DA innervation between the parkin-treat ed animals and the GFP-treated rats in the striatum (fig 3-11) or apparent differences of TH expressing cells in the SN (fig. 3-12). In addition, all lesioned animals were ev aluated for the number of TH expressing neurons as a marker for DA neurons. The num ber of TH positive neurons in the SNc was estimated using unbiased st ereological estimation. Surp risingly, the number of TH positive neurons did not differ between the two groups (fig 3-13).

PAGE 65

52 Figure 3-11. Striatal TH imm unoreactivity. Top panel shows st riatal TH staining from a representative rAAV2-GFP treated rat. Bo ttom panel is from a representative rAAV2-parkin treated rat. There is no si gnificant detectable TH staining in the lesioned striatum with either treatment. The scale bar = 1mm.

PAGE 66

53 Figure 3-12. Nigral TH staining. Top panel s hows TH staining from a representative parkin treated animal at the level of th e SNc. The right hemisphere is almost completely devoid of TH+ neurons. Bottom panel shows nigral TH expression in a GFP-treated contro l (scalebar = 1mm). Figure 3-13. Result of TH stereology. Unbias ed estimation of percent survival of TH positive neurons indicate no benefit to survival of neurons in the rAAV2parkin treated group (left bar) versus the control (rAAV2-GFP) group. Data is displayed as percent survival in the le sioned (right) hemisphere as compared to the unlesioned (left) hemisphere.

PAGE 67

54 Figure 3-14. DAT expression in the substantia nigra. Immunoreactivity can be seen in the left SNc, but not in the right hemisphere (lesioned side), Figure 3-15. AADC expression in the substantia nigra. AADC expression is observed in the left SNc, but not in the lesioned (right) SNc. Thus, the behavioral recovery was not re lated to the number of surviving neurons. To verify that the neurons had not simply down-regulated TH, we also looked at the expression of DA transporter (DAT) in the SN c as well as the expr ession of L-aromatic amino acid decarboxylase (AADC), anothe r enzyme involved in the DA production pathway. Again, these immunohistological results verified the results seen with TH in that there was no nigral DAT (fig. 3-14)or AADC (fig 3-15) staining on the lesioned side.

PAGE 68

55 Fos Expression Three to 6 hours after the last amphetami ne administration (fig. 3-1), all animals were perfused with fixative for histologi cal examination. This post-amphetamine time interval allows the immunohist ochemical examination of DA-mediated Fos expression in striatum and striatal efferent structures (G raybiel et al., 1990). Fos expression in the basal ganglia in normal animals is almo st non-existent (Robertson et al., 1989). However, after amphetamine-treatment, nuc lear Fos staining is increased in the striatum and basal ganglia nuclei in the out put circuit for motor behavior (Hebb and Robertson, 1999). Fos staining is interpreted as increased neuronal activity but its exact function is unknown (Curran and Morgan, 1985). Little or no striatal Fos expression was f ound in either experimental group (data not shown). However, there was robust Fos expr ession in the GP in both treatment groups (fig. 3-16,A-H) but no difference in the magnit ude or intensity of pallidal Fos staining between the groups could be detected. In contrast to pallidal Fos expression, Fos expression in the parkin-transduced SNr appear ed greater when compared to most of the GFP-treated animals (fig. 3-16, I-P). Of the 9 transduced animals in the 2 e xperimental groups, 2 animals from each group could not be evaluated due to torn or missing SNr. Of the remaining animals 6/7 parkin-treated animals and 5/7 GFP-treated animals followed the pattern shown in figure 3-16. One GFP-treated rat in particular show ed strong Fos staining in the SNr of the treated hemisphere similar to the parkin-t ransduced animals and this animal also displayed amphetamine-induced rotational behavi or within the range of parkin-treated rats’ rotational behavior.

PAGE 69

56 Figure 3-16. Activity of basal ganglia output nuclei via Fos over-expression. Fos staining from left GP ( A & E ) and the right GP ( B & F treated hemisphere) from a representative parkin-tr eated rat. There was no apparent difference either between hemispheres or between expe rimental groups (representative GFP treated rat C & G [left] and D & H [right]) in the intens ity or frequency of Fos staining in the GP. In contrast, parkin-t reated rats tended to have greater Fos over-expression in the SNr of the treated hemisphere ( J & N ) as compared to the untreated hemisphere ( I & M ). This pattern of greater Fos expression in the treated hemisphere of parkin-t ransduced rats was not found in GFPtransduced rats. Thus, both the left (GFP-untreated) SNr ( K & O ) and the right (GFP-treated) SNr ( L & P ) displayed approximately equivalent Fos expression. The stars in lo wer magnification panels ( A D & I -L) indicate the area of magnification in the higher magnification panels ( E H & M P ). Scale bars in A and I equal 500 m and apply to A-D and I L Scale bars in E and M = 100 m and apply to E H and M P Nevertheless, stereological evaluation of Fos expression in th e SNr counting total Fos positive cells as well as cells with rela tively high intensity of Fos expression was

PAGE 70

57 performed. The cell counts indi cated that there was no difference in the number of Fos expressing cells in-between the groups (fig 3-17). Figure 3-17. Number of Fos e xpressing cells in the SNr. Stereological estimation of Fos expressing cells did not show any diff erence between the two groups. Data is expressed as ratio of Fos expressing cells in the right versus left hemisphere. Biochemical Evaluation Dopamine The rAAV5 treated animals were evaluated for amphetamine induced rotations at 4, 8, and 12 weeks following the lesion. Similarl y to the rAAV2 treated group there was a significant behavioral improvement in the pa rkin treated group (f ig 3-18). The animals were sacrificed 13 weeks after the 6-OHD A lesion and the striatum from each hemisphere was dissected and divided up in samples to be used for biochemical evaluation. Using high performance liquid chromat ography (HPLC) we measured dopamine and DOPAC content of the striatum. There was a trend toward increased dopamine levels in the parkin treated animals. However, th is difference did not achieve significance (fig

PAGE 71

58 3-19). In addition, we also observed a trend towards increased DOPAC levels (p=0.02) in the parkin treated animals (f ig. 3-24) which may indicate in creased levels of striatal dopamine or increased levels of dopamine metabolism. Figure 3-18. Rotational data fr om the rAAV5 group (p<0.01). Figure 3-19. Dopamine levels measured by HP LC. Measurements of dopamine levels in the striatum were slightly higher in the rAAV5-parkin treated animals (left bar), as compared to the rAAV5-GFP tr eated group (right bar). These results were, however, not significant (p=0.1). In 6-OHDA lesioned animals, the remaining cells become temporarily overactive in terms of dopamine (Castaneda et al., 1990; Moro z et al., 2004). This hyper-activity is due to increased post-synaptic concentration of D2 receptors which can be measured by

PAGE 72

59 increased rotational behavior during the ad ministration of a D2 agonist such as apomorphine (Schwarting and Huston, 1996). Figure 3-20. Western blots of TH and the D2 receptor. Top lanes show a representative western of TH, with varying amounts of pr otein levels in the right hemisphere in different animals. Bottom lanes show a representative western blot of the dopamine D2 receptor. Very little varia tion of protein levels in the right hemisphere is seen in-between the various animals. Relative levels of protein were measured as compared to an internal standard ( -actin) and presented as a ratio of right/left. We evaluated whether this receptor incr ease occurred at the same level in the parkin treated group as compared with th e GFP group. Western analysis revealed no significant differences of D2 levels be tween the groups (figs. 3-20 & 3-21). Tyrosine hydroxylase Samples from the striatal dissections were al so used in order to evaluate levels of TH in the striatum. Western blot analysis rev ealed that, as for the dopamine content, there is a trend (non-significant) towa rds increased striatal TH in the parkin treated animals (figs. 3-20 & 3-22).

PAGE 73

60 Figure 3-21. D2 receptor protein levels meas ured by western blot (p = 0.3127). Protein levels are expressed as a ratio of right (lesioned) to left (intact) hemisphere. D2 up-regulation was seen in the le sioned hemisphere of all animals. Figure 3-22. Graph of striatal TH protein levels. Displayed as ratio of right (lesioned) versus left (intact) hemisphere. The data indicate a tendency toward increased levels of TH in the parkin treated striatum (p = 0.1). Discussion Our a priori working hypothesis was that nigral parkin expression would enhance proteasomal processing of proteins damage d by uptake of 6-OHDA, thereby protecting DA neurons from the toxic insult. Several lin es of data suggest that oxidative stress and aberrant protein folding/proteasomal processi ng is central to the molecular pathogenesis

PAGE 74

61 of neural degeneration in PD (Bossy-Wetzel et al., 2004; Betarbet et al., 2005). Several genes have been implicated in oxidative stre ss in at least some forms of the disease: PTEN-induced kinase 1 (PINK-1), a putative mitochondrial kinase potentially involved in the regulation of a mitochondrial response to oxidative stress (V alente et al., 2004), and DJ-1, a protein involved the oxidative stress response (Bonifa ti et al., 2003) cause familial PD when the gene is mutated. In addition, over-expression of some identified substrates of parkin has shown to be detrim ental to cells by aggregating and inducing ER stress (Ward et al., 1995) Moreover, it has been shown that dopaminergic neurons are exposed to higher basal levels of oxidative stress due to the metabolism of DA itself (Floor and Wetzel, 1998; Mc Naught et al., 2002), possibly making these cells more sensitive to a break-down in the cellular machinery which normally protects the cell against reactive oxygen species. Excess oxidative stress, in turn, can lead to increased protein damage exacerbating the need for f unctioning protein clearance machinery. Thus, although familial forms of PD are related to distinct cellular components, the molecular pathways may be interlocked and they may converge upon a common downstream fate (Greenamyre and Hastings, 2004; Cookson, 2005a). Indeed, in previous studies over-expr ession of parkin has proven to be neuroprotective against various insults that may be related to the cause of PD. For example, the use of parkin over-expression has also been shown to protect cultured cells against apoptosis induced thr ough the over-expression of various protein substrates such as cyclin E and pael-R (Staropo li et al., 2003; Yang et al., 2003). In vivo lentiviral parkin over-expression has been shown to protect transgenic mice from pathology associated

PAGE 75

62 with an mutant -synuclein (Lo Bianco et al., 2004) and rAAV-parkin has been shown to protect nigral ne urons from rAAV-synuclein over-expressio n (Yamada et al., 2005). Furthermore, we had preliminary data th at agreed with this hypothesis. We performed a previous experiment using iden tical experimental gr oups and rAAV nigral transduction procedures to those report ed here, but 6 weeks following vector administration, we administered a less potent striatal 6-OHDA lesion (2 site x 7 g each site). In general, while the parkin treated rats showed better motor performance in this preliminary experiment, this 6-OHDA lesion did not lead to consistent behavioral deficits in the control group and the functional improve ments in the parkin-t reated group did not reach statistical significance. However, there was greater DA nigrostriatal integrity in the parkin-treated rats in this prelim inary experiment (data not shown). The present results, obtaine d after a more extreme 6-OHDA, clearly show a parkin mediated functional effect. Normally, re ductions in amphetamine-induced rotational asymmetry would indicate improved DA release in the lesioned striatum (Zetterstrom et al., 1986). In this experiment, there was a stable 67% reduction in amphetamine-induced rotational behavior in parkin-treated rats. Similar partial rescue was also seen when assessing spontaneous limb-use in the cylinde r test. However, similar to the amphetamine data, the animals still display a significant amoun t of lateral bias in the cylinder test and essentially no improvement in forelimb akinesia as measured by forelimb stepping indicating partial recovery from the 6OHDA lesion. The lack of improvement in forelimb akinesia (stepping) is consistent with partial parkin-mediated functional improvement because recovery in the steppi ng test appears to require a higher level

PAGE 76

63 nigrostriatal integrity for behavioral improvement to occur (Bjorklund et al., 2000; Georgievska et al., 2002) Unexpectedly, our data do not support our primary hypothesis, i.e., parkin overexpression did not lead to improved DA neur on survival or striatal TH+ innervation. Nevertheless, there are stil l several hypotheses that may account for the observed functional improvement in the parkin-treated rats. First, rAAV-medi ated nigral parkin over-expression may have saved the dopaminerg ic cells but they no longer express their dopaminergic phenotype as assessed by TH stai ning. To evaluate this hypothesis, we examined two other nigral DA neuronal mark ers, DAT and AADC, which also indicated that the TH+ nigral neurons were killed by the lesion. Thus, it is unlikely that the functional data are explained by enhanced surv ival of DA neurons in the parkin-treated groups. Second, since there was no difference in the number of surviving dopaminergic cells between the two groups, the surviving cells in the parkin trea ted SNc either produce more DA, have an altered metabolic state, or are more efficient in DA recycling. Improved function of remaining parkin-transduced nigral neurons may be the direct result of parkin acting on a specific substrate. For instance, some data suggest that parkin is involved in the maintenance of the DAT. By targeting misfolded DAT for degradation, parkin serves as to enhance DAT functi on by concentrating the number of correctly folded receptors at the membrane surface; consequently, significantly enhancing DA uptake and improving the effici ency of DA transmission (Jiang et al., 2004). On the contrary, if enhanced striat al DA function occurred in parkin-treated rats, then DA stimulation of supersensitive DA receptors would be expected to be detected by enhanced

PAGE 77

64 Fos staining in the lesioned striatum. This effect was not found in this study, thus enhanced DA release is an unlikely explan ation for parkin ove r-expression induced behavioral recovery. However, we did see a trend toward increased striatal dopamine levels in the parkin treated gr oup, but this data did not yield significance. Parkin is also believed to be involved in upstream regul ation of MAO expression, decreased MAO levels would in turn lead to decreased metabolism of dopamine (Jiang et al., 2006). However, we did not observe any differences in the metabolite DOPAC (data not shown). Furthermore, recent results suggest a relation between parkin and altered DA metabolism; evaluation of pael-R knockout mi ce showed that these animals displayed lower levels of striatal DA with no anat omical deficit. The knockouts also proved resistant to MPTP toxicity (Marazziti et al., 2004). In a ddition, although th e effects of parkin knock-out in the mouse are unclear, several groups have reported altered DA metabolism in lieu of any hist ological effects e.g. (Sherman and Goldberg, 2001; Itier et al., 2003; Perez and Palmiter, 2005). One gr oup has reported a loss of DA transporter protein levels in the striatum with a resu ltant loss of amphetamine induced locomotor activity (Itier et al., 2003). Third, the observed protection in our study may also be due to a general enhancement of proteasomal processing, thus keeping the surviving nigral cells at a “healthier” state. If th e levels of damaged and unfolded prot eins are allowed to escalate in the cell, unfolded protein responses are ac tivated where translational suppression and altered metabolic state, such as translati onal suppression, may occur (Moore et al., 2005; Xu et al., 2005).

PAGE 78

65 Figure 3-23. Characterization of rAAV2 mid-brain transduction. A Human specific parkin staining at the level of the ST N and EN. The large arrow shows the STN and the area of enlargement in ( B ). The small arrow points to the EN and also shows the area of enlargement shown in ( C ). Only the right hemisphere is transduced. The s cale bar equals 1mm. B High magnification of parkintransduced neurons in the STN. Th e scale bar equals 50 m. C. High magnification of parkin transduced neurons in the EN which is the equivalent of the GPi in humans. The scale bar equals 50 m. D Parkin-transduction at the level of the SNc. The white arrow indicates the area of enlargement shown in ( E ). The scale bar equals 1 mm. E These sections were taken from animal 12 weeks post-6-OHDA lesion and there is an absence of parkin staining in the SNc. There is robust staining in the SNr just dorsal to the cerebral peduncle (cp). The scale bar equals 50 m. F GFP staining at the level of the SNc showing GFP-transduction. Only the right hemisphere is transduced. The white arrow denotes the area of enlargement shown in ( G ). The scale bar equals 1 mm. G GFP+ neurons in the mid-brain just dorsal to the SNc. There were no detectable GFP+ neurons in the SNc due to the 6-OHDA lesion. Scale bar equals 50 m. Fourth, we observed rAAV-mediated pa rkin over-expression in functionally significant midbrain nuclei that are related to basal ganglia motor output such as the SNr, the STN, and the EN. The present data canno t rule out, nor support, the possibility that parkin over-expression generally improves th e function of the neurons in these output

PAGE 79

66 nuclei in a manner that allows partially normali zed motor output. If true, this result is of potential importance for therapy of late stage PD, when few cells are left to rescue in the SNc. Figure 3-24. DOPAC levels in th e striatum. Levels are displayed as percent of the right versus the left hemisphere (p=0.02). It is also important to poin t out that this lesion represen ts a very strong acute toxic insult to the cells and does in no way represent the temporal resolution of oxidative stress a PD affected individual may experience th roughout nigral degene ration. Thus, although we only observe partial functional recove ry in our treated animals, parkin supplementation may prove more efficacious in an imals with weaker lesi ons that result in stable functional deficits. In conclusion, we have demonstrated th at rAAV mediated pa rkin over-expression is partially protectiv e against functional impairments in the 6-OHDA lesion, with no clear neurobiological correlate. These results are im portant because it is still largely uncertain through what mechanism the loss of parkin in PD causes disease, and here we solidify the hypothesis that parkin can confer enhanced pr otection in a state of elevated oxidative

PAGE 80

67 stress, levels that in affected individuals may be also be enhanced due to exogenous (i.e. pesticides) or endogenous (i.e. DA metabolites) factors.

PAGE 81

68 CHAPTER 4 DISCUSSION Summary In the previous chapters I describe th e effects of interfering with endogenous parkin, as well as over-expression of parkin during a toxic insult. Our results from the ribozyme mediated knock-down indicated no cell-l oss, or no accumulation of substrate as a result of reduction in endogenous parkin. Ho wever, we were not able to efficiently isolate transduced cells in order to quantita tively evaluate the level of knockdown and to detect any individual differences in transdu ced cells. Similarly, over-expression of mutant parkin gave us the same resu lts, with no observed pathology. Conversely, using over-expression of normal parkin during an acute toxininduced model of PD, we did see a significant sparing of behavior wh en evaluated in the cylinder-, and amphetamine i nduced rotation paradigm. In terestingly, the resultant behavior was not due to rescue of dopamine rgic neurons during th e lesion time-course. Instead, the behavioral improvement comes from some, yet undiscovered, result of parkin over-expression. We performed our parkin pretreatment model in tr iplicate (with some variation), and we did observe the improve ment in behavior in all three groups. Dopamine and Behavior One important consideration when evalua ting our results in the parkin overexpression/6-OHDA paradigm is to consider the amplitude of observed behavior. Even though we showed partial recovery in behavior in two behavior al tests, it is important to note that the animals are still significantly impaired. In the amphetamine-induced rotation

PAGE 82

69 test, a normal animal, over a period of time, sh ould display no bias in turning behavior (Kirik et al., 2000a). Similarly, in the cylinde r test, an intact animal should use each paw approximately 50% of the time (Choi-Lundberg et al., 1998). If our hypothesis that we improved dopamine production/storage/reduced metabolism holds true, how much more dopamine results in this behavioral respit e? And how much more dopamine is required for full behavioral recovery from the lesion? Does the difference in dopamine levels that we observed, correspond to the reduced numbe r of rotations? Previous studies suggest that a 40-50% reduction of rode nt striatal dopamine levels, and 30-50% loss of nigral cell bodies is required for the observation of ro tational asymmetry (Prze dborski et al., 1995). 6-OHDA Lesion As described in the previous chapter, preliminary studies using parkin overexpression to protect against the 6-OHDA lesi on, we used a milder two-site striatal lesion. Those data indicated beha vioral improvement in the tr eated animals similar to the subsequent studies. However, since these sm aller lesions results in a smaller loss of dopamine, potentially at the threshold for be havioral asymmetry, the variation in the animals was very large. In contrast, the four site lesion utilized represents a very strong and relatively acute insult to the nigro-striatal tract (Kir ik et al., 1998), and maybe too strong for researchers to be ab le to evaluate the true bene fits of enhanced proteasomal processing as a potential therapeutic agent. Subsequently, parkin over-expression should be evaluated in other toxin paradigms such as rotenone and MPTP, which have different temporal resolution in thei r toxicity (Schober, 2004).

PAGE 83

70 Loss of Parkin The data from our parkin knock-down experi ment further validates the results from parkin deficient animals, which displa y varying mild phenotypes, but no cellular pathology (Goldberg et al., 2003; Itier et al., 2003; Von Coe lln et al., 2004; Perez and Palmiter, 2005). It also tells us that, at least under normal conditions, cells are not sensitive to reduced dosing of parkin. Furt hermore, AR-JP is an autosomal recessive disease and expressing a disease mutant together with the wild-type ge ne did not interfere with normal cell function. This brings up the question of why lo ss of parkin function causes PD. One theory that agrees with that of the environmental oxidative stress theories is that loss of parkin function simply sensit izes the cell to further stress, or parkin may simply be integral to the survival of the cel ls that are continuously exposed to the high levels of oxidative stress in dopaminergic neurons (Jenner and Olanow, 1996). What makes AR-JP unique in comparison to idiopathic PD is the early onset and the lack of LB’s in the vast majority of cases. In vitro data from aggresome (localized accumulation of misfolded proteins thought to be analogous to in vivo inclusions such as LB’s (McNaught et al., 2002) studies has shown that these are often situated at the microtubule localization organization center (MLOC), indicating that these formations are the result of active transport, thus an active protective effort of the cell to localize and sequester misfolded proteins and the enzymes required to degrade them (Kopito, 2000). The lack of LBs in parkin-associated disease suggests that parkin somehow is involved in this activity. However, does this mean that the disease causing event is the lack of LB formation, or is it the specific accumulation of a substrate that is detrimental and leads to disease?

PAGE 84

71 Evaluating the parkin disease mutant Q311Stop we again observed no cellular pathology. This result is in line with the fact th at two copies of this allele is required for disease to occur. However, considering the m odel of parkin function as an E3 ligase it is puzzling that these forms of the protein do not create a dominant effect. One could hypothesize that disabling parkin from targeting its substrates to the proteasome would be detrimental to the cell by sequestering mis-fo lded proteins away from wild-type parkin. Since this is not the case, one may speculate that parkin is relian t on other proteins as well in its association with substrate recognition and protea some targeting. Experiments have shown that in certain instances parkin works in concert with other protein complexes. For instance, parkin has been shown to function in a multi-protein ubiquitin ligase complex that includes the F-box/WD re peat protein hSel-10 a nd Cullin-1, targeting cyclin E as a substrate for degradation (Star opoli et al., 2003). Heat chock protein 70 (hsp 70) has been shown to bind to parkin, and i nhibit its activity. This is thought to be a silencing effect of proteasomal processing at times of low levels of unfolded protein stress (UPS) and higher levels of inactive hsp70 in the cytosol. However, a protein termed CHIP (carboxyl terminus of the Hs c70-interacting protein) been shown to enhance parkin function by two different mechanisms: by promotion of hsp70 release from parkin, as well as by enhancing parkin’s ubiquitination activity acting as an E4 ligase (Imai et al., 2000; Imai et al., 2002). These data indica te that parkin’s role in targeting proteins for degradation may not be clear-cut, and that a mix and match situation exists where various proteins can form a complex, and the composition of the complex dictates the target s ubstrate specificity. Furthermore, data suggest that parkin may also have other functions. Parc, a protei n similar in functional domains to parkin,

PAGE 85

72 was found to be important in the regulation of the cellular localizat ion of p53 and in its function. If Parc is inactiva ted, p53 localizes to the nucleus and subsequently activates transcription. In this paradigm, Parc does not confer an enzymatic activity, but simply functions as a cytoplasmic anchor for p53-asso ciated protein comple xes (Nikolaev et al., 2003). Parkin and Dopamine Despite the lack of cellular pathology in parkin deficient anim al models, several groups indicated various aberrations in dopamine levels and metabolism. Since the parkin deficient animals often displayed higher levels of striatal dopamine it is plausible that one function if parkin is to somehow regulat e dopamine production and/or metabolism. One piece of data suggests that parkin does so by enhancing extra-cellular dopamine sequestration by increasing the amount of correctly folded DAT on the surface, presumably through its E3 ligase activity (Jia ng et al., 2004). The DAT is dependent on oligmerization in the ER, and incorrectly folded or glycosylated DAT is retained in the ER until it is degraded (Sorkina et al., 2003). The study of parkin knockout mice supports this notion by showing increased extra-ce llular dopamine (Goldberg et al., 2003), and DAT expression is significantly reduced in the striatum (terminals) (Itier et al., 2003). The interpretation of these da ta is confusing: increased reuptake would presumably increase the levels of intracel lular dopamine metabolites, leading to increased levels of oxidative stressors. However, loss of parkin also reduced levels of VMAT indicating that parkin may be integral to vesicular uptake of parkin as well, the resultant effect being lower intra-, and extra-cellula r levels of dopamine and more efficient transmission. On the other hand, increased reuptake of dopamine may also enhance precision of dopamine signaling and improve the recycling of dopami ne. Furthermore, reduced extra-cellular

PAGE 86

73 dopamine would lead to a decrea se in metabolites that may act on surrounding cells (Itier et al., 2003). Data from one model also indicate that pa rkin may be involved in regulating levels of MAOs (Goldberg et al., 2003). The result would be increased dopamine levels, but also decreased amounts of metabolites. Agai n, the result would be lower levels of oxidative stress and increased dopamine tran smission, and this function of parkin may potentially be analogous to that of Parc (Jiang et al., 2004). Our biochemical data indicate that there may be increased levels of striatal TH and dopamine in the treated animals, there was, however, a large variati on in our results, and this finding may not be enough to explain our resultant improvement in motor behavior. However, further comparing the rotational behavior to dopamine or TH levels in individual animals (fig. 4-1) implies that the reduction in rotations may be due to differences in TH and dopamine levels. Parkin Over-Expression and Therapeutic Potential Since the loss of parkin causes PD, a simple approach would be to do a genereplacement approach by utilizing some form of gene delivery vehicle to deliver a healthy allele. Unfortunately, such an appro ach would not be simple; Onset of symptoms in PD is usually presented when a signifi cant portion of the SNc is gone resulting in approximately 70% decrease in striatal dopami ne levels (Bernheimer et al., 1973). Thus, if one aims to prevent the di sease from onset, one would have to genetically screen the population in order to identify patients. Furthermore, sinc e parkin-associated disease represents a small portion of total cases, few would benefit from this treatment. However, given parkin’s indicated i nvolvement in maintaining dopamine levels, post-threshold patients could potentially benefit from such a treatment.

PAGE 87

74 Figure 4-1. Regression analysis of total numbe r of rotations (y-axis) versus dopamine levels (top) (p = 0.02 R=0.65) and TH levels (bottom) (p = 0.04 R=0.55). Given the data presented, parkin may not help in reducing overall levels of oxidative stress in a diseased state by enha ncing proteasomal pro cessing. Instead, parkin may help control motor dysfunctions by its spec ific activity (be it transcriptional control or receptor enhancement) on dopamine levels in surviving cells. Su ch a treatment would be synonymous to L-Dopa treatment. However, considering that the most probable mode of expression would be from a viral ge nome, one would avoid on-off fluctuations associated with side effects of L-Dopa therapy such as dyskinesias (Mercuri and Bernardi, 2005). Furthermore, current L-dopa treatment is through oral administration, thus systemic side effects through exposures to other organs such as the gastro-intestinal

PAGE 88

75 tract and lungs are common (Zupnick et al ., 1990), and would be avoided through an intra-cranial injection. Moreover, elevated levels of dopamine in the limbic region is associated with schizophrenia, and L-Dopa administration has been shown to induce psychotic symptoms indistinguishable from those of schizophrenia (Jaskiw and Popli, 2004). Again, targeted stereotaxic injections into the SNc would be likely to prevent such adverse effects. Nonetheless, the therapeuti c benefits limit of parkin over-expression in sporadic PD more than likely would be bene ficial for a limited period of time, as there may not be any improvement in cell survival an d the cells would continue to die. At some point the nigral ablation would be to o large and symptoms would progress. Future Studies Since the observed behavior was not the re sult of improved cellular survival in the treated group, one may ask whether or not the le sion was a relevant fact or in our study. If our hypothesis that improved dopamine handling is the beneficial fact or in our treated groups holds true, then we should observe the same phenomenon in animals undergoing the same viral treatment, but without a lesion. Although it is difficult to predict whether or not we would observe any lateral bias in behavior due to increased dopamine content, we should be able to measure this increas e using HPLC analysis of dopamine levels. Conversely, if parkin improves dopamine hand ling, it should do so also if expression ensues after the lesion, i. e. if we inject the animals afte r the lesion is performed. Such an undertaking would also be an important preclin ical study, in order to evaluate whether or not post-threshold parkin treatment would have any therapeutic effects. However, if the lesion is an important factor in our study, and parkin expression somehow improves cellular functio n, this should mean that the effects of the lesion are lingering long after the acute pha se. To evaluate whether or not oxidative stre ss is still a

PAGE 89

76 factor long after the lesion, one could simply look for markers of damage due to oxidative stress such as nitrotyrosine and nitro-phe nylalanine (Henze et al., 2005), or changes in expression such as activation of the antio xidant response element (Rushmore et al., 1991). In addition, other than looking at end-point tissue, it would also be interesting to see expression of such markers at intermitte nt time-points, ranging from immediately following the lesion, to hours and days following the lesion. One observation that is inherent in our st udies utilizing rAAV as a tool to express transgenes in vivo is the apparent variability in copy numbers (viral genomes/cell) in transduced cells. This was observed with our parkin ri bozyme, where cells in the transduced region expresse d various amount of mark er, and we observed the corresponding amount of knockdown. In the park in over-expression study we sought to overcome this shortcoming by doing two in jections with the same virus. We hypothesized that by doing so we would expose each cell to more vi ral particles, and provide for a greater level of super-infection maximizing our transduction efficiency. We believe that the greater volume of injec tion, however, was the reason to why our rAAV2 injection displayed an atypical transduction patter n. Typically, rAAV2 injections are very specific for SNc (Burger et al., 2004), but we observed transduction in the EP and SNr as well. In order to fully evaluate whether or not transduction of these output nuclei was a factor in our result, we would have to trea t animals with only a si ngle injection of rAAV2 prior to the lesion. Concluding Remarks Parkinson’s disease is having a greate r and greater impact upon society, but research into the underlying causes of the di sease has yet to find definitive answers concerning its cause. Shortly after parkin was identified to be mutated in a familial form

PAGE 90

77 of the disease, it was identified as an E3 ligase. This finding was met with great enthusiasm because it started to bring the fi eld to a unifying idea, oxidative stress and protein handling, and parkin became a central entity in the field, predicted to be the panacea of PD. However, as groups started reporting animal models that did not recapitulate the human disease, it came clear th at the picture may not be so simple. In the end, one thing that is becoming clearer is that Parkinson’s disease more likely is the result of divergent causes, but w ith convergent consequences.

PAGE 91

78 CHAPTER 5 MATERIALS AND METHODS Ribozyme i n Vitro Testing Target Labeling RNA oligonucleotides encoding the ri bozymes and short RNA targets were ordered from Dharmacon, Inc. (Lafayette, CO). Radioactive labeling of targets was done as follows: 20 pmole RNA oligo, 50 mM Tris-HCl, pH 7.6, 10mM MgCl2, 0.1 mM spermidine HCl, 0.1 mM EDTA, 1 l RNasin, 10mM DTT, 10 Ci [ 32dATP], 1 l poly nucleotide kinase was mixed in a total volume of 10 l. The labeling was done for 30 minutes in 370C. The oligos were ther eafter extracted using 100 l phenol/chloroform/iso-amyl alcohol and purified using a G-50 spin column. Time-Course 2 pm of the ribozyme was diluted in 40 mM Tris-HCl, pH 7.4 and denatured in 650C for 2 minutes, and cooled in room temper ature for 10 minutes. To this mixture DTT and MgCl2 was added to final concentrations of 10mM and 5 mM respectively. In addition 1ul RNasin was added to the mi xture, and incubated 30 minutes at 370C for 30 minutes. Finally, a mixture of labeled target (1 l 32P-target) and excess non-labeled target (25 pmoles) was added to the initia l solution. At various time-points (0, 1min, 2min, 4 min, 8min, 16min, 32min, 64min, 128mi n) following the last addition, aliquots were removed and stopped by mixing with a formamide dye mix (90% formamide, 50 mM EDTA, pH 8.0, 0.05% bromoph enol blue, 0.05% xylene alcohol). The samples were

PAGE 92

79 thereafter heat-denatured and by boiling for 5 minutes, and thereafter visualized on a 10% PAGE-8M UREA denaturing gel. The gel was dried and placed on a Phos phoimager screen and exposed overnight. The screen was thereafter scanned in a Stor m scanner (GE Healthcare, Piscataway, NJ), and image analysis was done measuring pixel density of bands. The fraction of target cleaved was then graphed against time. The time at which 10-20 % of cleavage was selected for multi-turnover kinetic analysis. Multi-turnover Kinetic Analysis The time-course analysis is an evaluation of ribozyme activity in excess substrate conditions. Various ratios of ribozyme to target (1:40, 1:60, 1:80, 1:100, 1:200, 1:400, 1:600, 1:800, 1:1000) were used, all reactions we re done in duplicate, and the conditions were the same as for the time-course with the with the following exceptions: When everything except the target and magnesium was added, the mixture was incubated at 650C for 2 minutes, and room temperature for 10 minutes. The MgCl2 was thereafter added and incubated at 370C for 10-30 minutes. Once the target was added, the reaction was stopped using 20 l of formamide dye mix. 6 l of each reaction was run on a 10% PAGE-8M UREA denaturing gel, and the results were visuali zed as described above. The data were plotted and values for Vmax a nd Km where obtained using Lineveawer-Burke plots, and kcat was determined by the calculation: kcat= Vmax/[Rbz]. Virus Preparations Parkin Full-length human parkin was obtained by PCR from a human clone (MJF 115) obtained from Paul Lockhart. The forward PCR primer contains a HindIII site followed by a Kozak sequence for optimal translation immediately followed by the start codon of

PAGE 93

80 human parkin; hparkin fw: 5’CCAAGCTTCCACCATGATAGTG TTTGTCAGGTTCAACTCC-3’. The reverse PCR primer contains the stop codon followed by an NsiI restriction s ite; hparkin rev:5’TGCATGCATCTACACGTCGAACCAGTGGT-3 ’. The PCR product of 1420 bp was digested with HindII and NsiI and cloned in to a HindIII-NsiI digested pTRUF20-WPRE AAV vector (See figure 1A). The resulting clone was sequenced and the sequence was found to be identical to MJF 115 and to the human parkin Genbank sequence AB009973, except for three changes: 1. change in nucle otide position 769 C of AB009973 to T in our clone (causing a change from proline to serine Serine is the amino acid present at this position in the mouse and rat sequences); 2. nucleotide 935 T to C (silent); 3. nucleotide 947 A to G (silent). These changes are al so present in clone MJF 115. The cDNA was then cloned in an AAV bac kbone containing the chicken -actin promoter (CBA) (Niwa et al., 1991). The transgene was inserted immediately upstream from a cis-acting woodchuck post-transcriptional regulato ry element (WPRE) followed by a SV40 polyadenylation signal. This expression ca ssette was flanked by AAV type 2 terminal repeats (Fig. 1A). The cDNA for the control (GFP) virus was constructed as previously described (Burger et al., 2004), a nd was isolated as described in (Zolotukhin et al., 2002) and eluted and concentrated in lactated Ri nger’s solution. The virus stock was at least 99% pure as judged by silver-s tained SDS acrylamide gel fr actionation. Vector titers were determined by dot-blot assay as de scribed (Wu et al., 2000) and was 1.1 x 1012 genome copies/ml (hparkin) and 1.3 x 1012 genome copies/ml (GFP). Ribozyme DNA oligos encoding full length parkin ribozymes 131 and 534 were ordered from Invitrogen (Carlsbad, CA). 131 sense: 5’ P-AGC TTG GAA CTG ATG AGC GCT TCG

PAGE 94

81 GCG CGA AA 3’, 131 anti-sense: 5’ P-CTA GTC AGC ATT TCG CGC CGA AGC GCT CAT CAG TTC CA 3’, 534 SENS E: 5’ AGC TTG CAG TAC TGA TGA GCG CTT CGG CGC GAA AAC AAA AA 3’, a nd 534 anti-sense: 5’ P-CTA GTT TTT GTT TTC GCG CCG AAG CGC TCA TCA GTA CTG CA 3’. The oligos were designed to, when annealed, cr eate an upstream Hind III site and a downstream SpeI site for easy insertion into the AAV backbone UF12. The UF12 utilizes a hybrid chicken actin promoter/cytomegalovirus enhancer hybrid promoter driving the expression. Downstream of the ribozyme an IRES drives the translation of the GFP transduction marker. Immediately following the ribozyme in sertion site is a se lf-cleaving hairpin ribozyme, designed to liberate the transcri pt. To insert the ribozyme, the AAV plasmid was digested with HindIII and SpeI, treated with shrimp alkaline phosphatase, and gel purified. 600 pm of each ribozyme strand wa s mixed together with 10 l Promega (Madison, WI) buffer E (proprietary) in a to tal volume of 100 l This mixture was denatured at 950C for 3 minutes, and slow cooled to room temperature. The annealed oligos were thereafter ligated into the linearized AAV backbone plasmid. The expression cassette was flanked by AAV2 terminal repeat s, and viral production was performed as described above. Surgical Procedures All surgical procedures were performed us ing aseptic techniques and an isoflurane gas anesthesia machine. Following anesthesia the rats received a subcutaneous injection of marcaine at the incision site and then were placed in a stereotaxic frame (Kopf Instruments, Tujunga, CA, USA) while conti nuously under isoflurane anesthesia during the injection procedure. Inject ions were performed with a 10 l Hamilton syringe fitted with a glass micropipette with an opening of approximately 60–80 m. The speed of the

PAGE 95

82 injection was accurately controlled by an in fusion pump that pushes a piston, which in turn depresses the plunger on the Hamilton syringe. Intracerebral Injections of AAV Vectors Double injection in the SNc Each injection group consisted of 9 adult female Sprague-Dawley rats, and each rat received 2 injections in the right substantia nigra of either the G FP control virus or the virus expressing the human parkin transgene. The brain coordinates for the injections were anterior–posterior (AP) -5.3 mm and -6.0 mm, medial-l ateral (ML) -2.0 for both injections, and dorsoventral (DV) -7.2 mm from dura for both injections. Two l of vector were injected pe r site at a rate of 0.5 l/min. Following the injection, the glass micropipette was left in place an additional 5 minutes before being slowly removed from the brain. Single injection in the SNc The injection protocol for animals treat ed with rAAV-parkin ribozymes or rAAV mutant parkin was the same as above, however the injection coordi nates were: anterior– posterior (AP) -5.4 mm and 2.0 mm, medial-lateral (ML), and dorsoventral (DV) -7.2 mm from dura. 6-OHDA Lesions Six weeks following the viral injections all animals received four unilateral stereotaxic injections of 7 g (calculated as free base; Sigma, St. L ouis, MO) dissolved in ascorbate-saline (0.05%). The coordinates were AP +1.3 mm, ML -2.6 mm; AP +0.9 mm, ML -3.0 mm; AP-0.4 mm, ML -4.2 mm; AP -1.3 mm, ML -4.5 mm. DV coordinates for all injections were -5.0 mm. The injection rate was 1.0 l/min, and the micropipette was left at the site for an additi onal 5 minutes before being retracted.

PAGE 96

83 Behavioral Analysis Rotational Behavior At 4, 8, and 12 weeks after the 6-OHDA lesion rotational analysis was performed in automated rotometer bowls (Ungerstedt, 1968). Drug-induced rotational behavior was measured following a d-amphetamine sulfate injection (2.5 mg/kg i.p. igma, St. Louis, MO). Rotations were measured during a 90 minute period, and full 3600 ipsilateral turns were counted as +1. Cylinder Test Four, 8 and 12 weeks following the 6-OHDA lesion the animals were observed for spontaneous front-limb use during vertical ex ploration and was perf ormed as described previously by Schallert and Tillerson (Moroz et al., 2004) During the test, the animal was allowed to move around freely in a plex iglass cylinder until it had performed 10 rears. During this time, the animal was vi deotaped, and mirrors are placed behind the cylinder to ensure full visibility of all pa w placements on the walls. The video-tapes were then scored by a blinded observer, where each paw placement on the wall was counted. The data are presented as contralateral (in rela tion to lesion) paw touc hes as percentage of total. Forelimb Akinesia (Stepping Test). Eight and 12 weeks following the lesion the animals were observed for forelimb akinesia (Olsson et al., 1995; Schallert et al., 2000), at each time point the test was performed for 2 consecutive days where only th e second days data was collected. Briefly, the animal was held in such a way that th e lower body and the paw not being tested is supported. The paw under observation was then dragged across a surface (90 cm) either backhand (across the body) or fore-hand (a long the body), and each step (paw lifting and

PAGE 97

84 replanting) was scored. The data are presented as contra-lat eral (in relation to lesion) steps as percentage of total. Histological Procedures Perfusion and Tissue Processing Twelve weeks following the lesion and 3-6 hours after the last amphetamine test, the animals were deeply anesthetized with pentobarbital and perfused through the ascending aorta with sterile Tyrode’s soluti on, followed by 350 ml of ice-cold 4% paraformaldehyde in 0.01M PBS buffer. Brains were rapidly remove d and post-fixed for 4 hours in the same solution, and then transfer red to a solution of 30% sucrose in 0.01M PBS solution. Brains were cut into 40 m thick sections using a freezing stage sliding microtome. Recovery of Fresh Tissue for Parkin Over-Expression Project Twelve weeks following the lesion the anim als were deeply anesthetized with pentobarbital and decapitated. The brains were rapidly removed and placed in a block, the brain was then sectioned coronally at the level of th e cerebral peduncles. The region posterior to the cut, containing the midbrai n, was immediately placed in ice-cold 4% paraformaldehyde in 0.01M PBS buffer and post-fixed for 24 hours. The tissue was thereafter transferred into a solution of 30% sucrose in 0.01M PBS solution. Brains were cut into 40 m thick sections using a freezing stage sliding microtome. The left and right striata were dissected from the region anteri or to the cut: the left and right hemisphere were separated, and each striatum isolated from the surrounding tissue. The striatum from each hemisphere was homogenized and separated into two separate tubes, sample weights recorded, and quickly frozen in liquid nitroge n. The tissue was thereafter stored in -800C until further use.

PAGE 98

85 Recovery of Fresh Tissue for Ribozyme Project Twelve weeks following the lesion the anim als were deeply anesthetized with pentobarbital and decapitated. The brains were rapidly frozen, and sectioned into 20 m thin sections using a cryostat. Immunohistochemistry Floating sections were washed with 0 .01 M PBS and then treated for 15 minutes with 0.5% H2O2 + 10% methanol in 0.01 M PBS. For TH immunohistochemistry the sections were preincubated with 3% normal horse serum (NHS) + 0.1% Triton X-100 in 0.01 M PBS, and then incubated overnight in room temperature with a 1:2000 dilution of a mouse anti-TH antibody ( Chemicon Temecula, CA). For parkin, dopa decarboxylase (AADC), DAT, and Fos immunohistochemistry the sections were pr eincubated with 5% normal goat serum (NGS), and then incubate d overnight in room temperature with a 1:500 dilution of rabbit anti -dopa decarboxylase, DAT ( Chemicon Temecula, CA), 1:200 dilution of rabbit anti-Fos (Santa Cruz, Sa nta Cruz, CA) or a 1:1000 dilution of rabbit anti-parkin (HP5A) gift from Dr. Sclossmach er (Schlossmacher et al., 2002). Following the incubation, the tissue was washed and inc ubated for 2 hours at room temperature with an appropriate secondary antibody directed against the species in which the primary antibody was raised. The reactions were visu alized using a avidin-biotin peroxidase complex (Vector Laboratories, Burlingame CA) followed by incubation with NovaRED substrate (Vector Laboratories, Burlingame CA). Sections were mounted on subbed slides, dehydrated in ascending alcohol concentrations, clea red in xylene, and coverslipped in permount.

PAGE 99

86 In Situ Hybridization Oligo Probe 3’OH labeling Probes were ordered from Invitrogen: target site bp 88: 5’ GAA GAT GCT GGT GTC AGA ATC GAC CTC CAC T GG GAA GCC ATA GCT GG 3’, target site bp 345: 5’ TGA CTG CTG AGG TCC ACT CGA GT C AAG CTT CTG GGC TCC CAT AT 3’, target site bp 1412: 5’ ACA CGT C AA ACC AGT GAT CAC CCA TGC AGG CTC GGT TCC ACT CAC AG 3’. 1.0 l of probes (40ng/l) were labeled with -[35S] for 2 hours at 370C in 50mM sodium cacodylate, pH 7.2, 1mM CoCl2; 0.1 mM 2-mercaptoethanol, 2.5 U/ l terminal deoxynucleotydil transferase, 6 Ci/l [35S] dATP. The labeled pr obes were purified by centrifugation using ProbeQuant Sephadex G-50 micro columns, and the isotope incorporation was determined using a scintillation counter. Hybridization Prior to the hybridization r eaction the sections were allowed to dry in room temperature for several hours. 1 ml of the hybridization cock tail (50% deionized formamide, 4x SSC, 1% Denhardt solution, 1% lauryl sarcosyl, 20mM sodium phosphate buffer pH 7.0, 10% (w/v) dextran sulphate ) was mixed with 50 l salmon sperm, 10 x 10-6 cpm of labeled probe, and 40 l 5M DTT. Each slide was treated with 200 l of the hybridization mixture, covers lipped, and incubated at 420C for 18 hours. Following hybridization the slides were washed as follows: 4x15 minutes in 1X SSC at 550C 1x30 minutes in 1x SSC at room temperature, 10s in H2O, 30s in 65% ethanol, 30s in 95 ethanol. The slides were thereafter dried fo r several hours and placed in autoradiography cassettes together with an x-ray film (Kodak Biomax MR cat# 870 1302) and placed in 40C for 6-10 weeks when the x-rays were developed.

PAGE 100

87 High Performance Liquid Chromatography 450 l of 0.1N perchloric acid was added to one tube of striatal sample-tissue along with 50 l (750 ng/ml) of the internal st andard dihydroxybenzylamine (DHBA) used as the internal standard to correct for cha nges is tissue concentration due to sample preparation. The sample was allowed to thaw and thoroughly homogenized using a micro-homogenizer for 10-20 seconds. An aliquot equivalent to 3 mg sample was thereafter transferred to sepa rate tube containing 0.1N perc hloric acid to yield a total volume of 1 ml. The diluted sample was thereafter centrifuged at 40C for 12 minutes. The supernatant was thereafter filtered through a nylon 0.2 micron syringe filter, and collected into an HPLC sample vial. D opamine and DOPAC levels were thereafter analyzed using a C18 “Waters Symmetry column (3.9mm X 15cm), electrochemical detection (ESA Coulochem III set up with a high sensitivity analytical cell (5011A)), and internal standard quantitation. The assay was done on a Beckman System Gold HPLC system. (DHBA). The flow rate was 1.5 ml/mi n, and the mobile phase was composed as follows: 8.2 mM Citric Acid, 8.5 mM sodium phosphate monobasic, 0.25 mM EDTA, 0.30 mM Sodium octyl sulfat e, 7.0% Acetonitrile in H2O, pH adjusted to 3.5 with sodium hydroxide and filtered through a 0.2 m filter membrane. Western Blotting 100 l Laemmli sample buffer (4% SDS, 20% glycerol, 50mM Tris pH 6.8, 1X HALT protease inhibitor cocktail (Pierce, cat# 78410)) was added to each tissue sample, and the tissue was sonicated for 20s. Tissue was thereafter stored at -800C until further use. Protein concentrations were estimated using the Bio-Rad DC assay (cat# 500-0120)). 2 g of sample was mixed with the Laemmli sample buffer to yield a total volume of 30 l. 15 l of 3X loading dye (0.167 M Tris pH 6.8, 6.6% SDS, 0.03% bromophenol blue,

PAGE 101

88 33% glycerol, 2% mercaptoethanol in H2O) was thereafter added to the mixture, and the sample was boiled for 5 minutes. 20 l of the same sample was loaded onto two different 12% SDS-polyacrylamide gels ( Bio-Rad cat # 161-1102). The sample was separated by electrophoresis at approximately 100V for 3 hours (running buffer: 25mM Tris base, 192 mM glycine, 0.1% glycine). The gels where then transferred overnight at 0.3 A at 40C onto 0.45 m nitrocellulose membranes ( Osmo nics, cat# EP4HY450F5) (transfer buffer: 42mM sodium phosphate dibasic anhydr ous, 7mM sodium phosphate monobasic anhydrous). Membranes were thereafter blocke d (5% milk in PBS) for 30 minutes at room temperature. Membranes were incuba ted with the primary antibody (mouse anti-TH 1:2500: Chemicon Temecula, CA; mouse anti -actin 1:5000: Abcam cat# 8226) in 5% milk in PBS for 2 hours at RT. Membranes were then washed 3X (0.1% Tween-20 in PBS). Secondary antibodies (Anti-mouse hor se radish peroxida se conjugated, 1:5000 (Amersham Biosciences cat# NXA 931)) were incubated for 1 hour in 5% milk in PBS. Membranes were thereafter washed 3X in 0.1% Tween-20 in PBS. Proteins were visualized by incubating the membranes with ECL plus western blotting detection system (GE Healthcare cat# RPN2132) for 5 minutes, and thereafter exposed on x-ray film (RPI cat# EBNU2) for various periods of time (5s1min). The developed X-rays where than scanned into TIF files and the protein levels were quantified as a fr action of the internal loading control ( -actin) using QunantityOne (Bio-Rad) software. Estimation of Nigral TH+ Neuronal Survival Series of sections stained for TH were us ed to perform stereology covering nigral sections stretching over the enti re rostral-caudal axis. Unbiased stereological cell counts of the total number of TH positive neurons in the SNc were performed using the optical fractionator method as previously described (West et al., 1991). Sampling of cells was

PAGE 102

89 performed using the MicroBrightfield Stereo Investigator System. The software was utilized to outline the SNc using a 4x objectiv e. The software then generated a counting area by placing counting grids (in order to achiev e a coefficient of error <0.1 the size of the grid varied between 75m x 75m to 100m x 100m) in the outlined area. A counting frame was placed randomly in th e counting area and methodically moved through all grids until the entire delineated area was sampled. The estimate of the total number of positive cells was calculated using the optical fractionator formula (West et al., 1991), and the coefficient of error was cal culated according to Gundersen and Jensen (Gundersen et al., 1999). The counter was una ware of the group membership of any of the animals. Three animals could not be count ed due to missing nigral tissue. Therefore, 7 parkinand 8 GFPtreated animals we re evaluated for TH+ neuron survival. Fos Over-Expression Series of sections stained for c-Fos were used to perform stereology covering the substantia nigra pars compacta stretching over the entire rostral-caudal axis. The procedure was performed as described above with the following exception: for each sampling site two different markers were c ounted 1) overall positive cells, and 2) cells with significantly higher Fos expression rela tive to all Fos expressing cells throughout the SNr in the same animal. Statistical Methods One-way repeated measures analysis of variance (ANOVA) was used to determine significant differences between groups in the be havioral tests. Ther e were no significant interaction terms in these an alyses so main effects between groups were reported in figure 1 ( level was set at p < 0.05) Significant difference between the groups with regard to estimated numbers of TH+ and cFos+ neurons was determined using one-way

PAGE 103

90 analysis of variance. A repeated measures 2-way ANOVA was utilized for the stepping test using vector and side as the 2 factors.

PAGE 104

91 LIST OF REFERENCES Adler CH (2005) Nonmotor complications in Parkinson's disease. Mov Disord 20 Suppl 11:S23-29. Adler CH, Thorpy MJ (2005) Sleep issues in Parkinson's disease. Neurology 64:S12-20. Alam ZI, Daniel SE, Lees AJ Marsden DC, Jenner P, Halliwell B (1997a) A generalised increase in protein carbonyls in the brain in Parkinson's but not incidental Lewy body disease. J Neurochem 69:1326-1329. Alam ZI, Jenner A, Daniel SE Lees AJ, Cairns N, Mars den CD, Jenner P, Halliwell B (1997b) Oxidative DNA damage in the parkin sonian brain: an apparent selective increase in 8-hydroxyguanine levels in substantia nigra. J Neurochem 69:11961203. Amarzguioui M, Brede G, Babaie E, Gro tli M, Sproat B, Prydz H (2000) Secondary structure prediction and in vitro accessibility of mRNA as tools in the selection of target sites for ribozymes. Nucleic Acids Res 28:4113-4124. Andrew R, Watson DG, Best SA, Midgley JM, Wenlong H, Petty RK (1993) The determination of hydroxydopamines and othe r trace amines in the urine of parkinsonian patients and normal controls. Neurochem Res 18:1175-1177. Ardley HC, Scott GB, Rose SA, Tan NG, Markham AF, Robinson PA (2003) Inhibition of proteasomal activity causes inclusion formation in neuronal and non-neuronal cells overexpressing Parkin. Mol Biol Cell 14:4541-4556. Bernheimer H, Birkmayer W, Hornykiewicz O, Jellinger K, Seitelberger F (1973) Brain dopamine and the syndromes of Parkins on and Huntington. Clinical, morphological and neurochemical correlations. J Neurol Sci 20:415-455. Berns KI (1996) Parvoviridae : The Viruses and Their Replication, 3rd Edition. Philadelphia: Lippincott-Raven. Betarbet R, Sherer TB, Greenamyre JT (2002) Animal models of Parkinson's disease. Bioessays 24:308-318. Betarbet R, Sherer TB, Greenamyre JT (2005) Ubiquitin-proteasome system and Parkinson's diseases. Exp Neurol 191 Suppl 1:S17-27.

PAGE 105

92 Betarbet R, Sherer TB, MacKenzie G, Ga rcia-Osuna M, Panov AV, Greenamyre JT (2000) Chronic systemic pesticide exposur e reproduces features of Parkinson's disease. Nat Neurosci 3:1301-1306. Bjorklund A, Kirik D, Rosenblad C, Geor gievska B, Lundberg C, Mandel RJ (2000) Towards a neuroprotective gene therapy for Parkinson's disease: use of adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the nigrostriatal system in the rat Parkinson model. Brain Res 886:82-98. Blum D, Torch S, Lambeng N, Nissou M, Benabid AL, Sadoul R, Verna JM (2001) Molecular pathways involved in the neurotoxicity of 6-OHDA, dopamine and MPTP: contribution to the a poptotic theory in Parkinson's disease. Prog Neurobiol 65:135-172. Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, van Dongen JW, Vanacore N, van Swieten JC, Brice A, Meco G, van Duijn CM, Oostra BA, Heutink P (2003) Mutations in the DJ-1 gene associated with autosomal re cessive early-onset parkinsonism. Science 299:256-259. Bonini NM, Giasson BI (2005) Snaring th e function of alpha-synuclein. Cell 123:359361. Bossy-Wetzel E, Schwarzenbacher R, Lipton SA (2004) Molecular pathways to neurodegeneration. Nat Med 10 Suppl:S2-9. Bove J, Prou D, Perier C, Przedborski S ( 2005) Toxin-induced models of Parkinson's disease. NeuroRx 2:484-494. Brooks AI, Chadwick CA, Gelbard HA, Cory-S lechta DA, Federoff HJ (1999) Paraquat elicited neurobehavioral syndrome caused by dopaminergic neuron loss. Brain Res 823:1-10. Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004) Recombinan t AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nerv ous system. Mol Ther 10:302-317. Casarejos MJ, Menendez J, Solano RM, Rodri guez-Navarro JA, Garcia de Yebenes J, Mena MA (2006) Susceptibility to rotenone is increased in neurons from parkin null mice and is reduced by minoc ycline. J Neurochem 97:934-946. Castaneda E, Whishaw IQ, Robinson TE (1990) Changes in striatal dopamine neurotransmission assessed with microdialys is following recovery from a bilateral 6-OHDA lesion: variation as a function of lesion size. J Neurosci 10:1847-1854.

PAGE 106

93 Chandra S, Gallardo G, Fernandez-Chacon R, Schluter OM, Sudhof TC (2005) Alphasynuclein cooperates with CSPalpha in preventing neurodegeneration. Cell 123:383-396. Choi-Lundberg DL, Lin Q, Schallert T, Cr ippens D, Davidson BL, Chang YN, Chiang YL, Qian J, Bardwaj L, Bohn MC (1998) Be havioral and cellular protection of rat dopaminergic neurons by an adenoviral vector encoding glial cell line-derived neurotrophic factor Exp Neurol 154:261-275. Chung KK, Zhang Y, Lim KL, Tanaka Y, Huang H, Gao J, Ross CA, Dawson VL, Dawson TM (2001) Parkin ubiquitinates the alpha-synuclein-interacting protein, synphilin-1: implications for Lewy-body formation in Parkinson disease. Nat Med 7:1144-1150. Conway KA, Lee SJ, Rochet JC, Ding TT, Williamson RE, Lansbury PT, Jr. (2000) Acceleration of oligomerization, not fibril lization, is a shared property of both alpha-synuclein mutations linked to early-on set Parkinson's disease: implications for pathogenesis and therapy. Proc Natl Acad Sci U S A 97:571-576. Cookson MR (2005a) The biochemistry of Parkinson's disease. Annu Rev Biochem 74:29-52. Cookson MR (2005b) Neurons inflic t self-harm. Nat Med 11:1159-1161. Cooper JR, Bloom FE, Roth RH (1996) Th e Biochemical Basis of Neuropharmacology, 7th Edition. New York: Oxford University Press. Copani A, Uberti D, Sortino MA, Bruno V, Nicoletti F, Memo M (2001) Activation of cell-cycle-associated proteins in neuronal death: a mandatory or dispensable path? Trends Neurosci 24:25-31. Corti O, Hampe C, Koutnikova H, Darios F, Jacquier S, Prigent A, Robinson JC, Pradier L, Ruberg M, Mirande M, Hirsch E, R ooney T, Fournier A, Brice A (2003) The p38 subunit of the aminoacyl-tRNA syntheta se complex is a Parkin substrate: linking protein biosynthesis and ne urodegeneration. Hum Mol Genet 12:14271437. Curran T, Morgan JI (1985) Superinduction of c-fos by nerve growth factor in the presence of peripherally active be nzodiazepines. Science 229:1265-1268. D'Agata V, Zhao W, Pascale A, Zohar O, S capagnini G, Cavallaro S (2002) Distribution of parkin in the adult rat brain. Pr og Neuropsychopharmacol Biol Psychiatry 26:519-527. Dexter DT, Carter CJ, Wells FR, Javoy-Agid F, Agid Y, Lees A, Jenner P, Marsden CD (1989) Basal lipid peroxidation in substant ia nigra is increased in Parkinson's disease. J Neurochem 52:381-389.

PAGE 107

94 Doudna JA, Cech TR (2002) The chemical re pertoire of natural ribozymes. Nature 418:222-228. Duan D, Yue Y, Engelhardt JF (2001) Expanding AAV packaging capacity with transsplicing or overlapping vectors: a qua ntitative comparison. Mol Ther 4:383-391. Eckert T, Eidelberg D (2005) Neuroimaging a nd therapeutics in m ovement disorders. NeuroRx 2:361-371. Eslamboli A, Georgievska B, Ridley RM, Ba ker HF, Muzyczka N, Burger C, Mandel RJ, Annett L, Kirik D (2005) Continuous low-le vel glial cell line-derived neurotrophic factor delivery using recombinant ad eno-associated viral vectors provides neuroprotection and induces behavioral rec overy in a primate model of Parkinson's disease. J Neurosci 25:769-777. Fahn S (2003) Description of Parkinson's dis ease as a clinical syndrome. Ann N Y Acad Sci 991:1-14. Faull RL, Laverty R (1969) Changes in dopamine levels in the corpus striatum following lesions in the substantia nigra. Exp Neurol 23:332-340. Fedorow H, Tribl F, Halliday G, Gerlach M, Riederer P, Double KL (2005) Neuromelanin in human dopamine neurons : comparison with peripheral melanins and relevance to Parkinson's di sease. Prog Neurobiol 75:109-124. Ferger B, Rose S, Jenner A, Halliwell B, Jenner P (2001) 6-hydroxydopamine increases hydroxyl free radical produc tion and DNA damage in rat striatum. Neuroreport 12:1155-1159. Fleming SM, Fernagut PO, Chesselet MF (2005) Genetic mouse models of parkinsonism: strengths and limitations. NeuroRx 2:495-503. Floor E, Wetzel MG (1998) In creased protein oxidation in hu man substantia nigra pars compacta in comparison with basal ganglia a nd prefrontal cortex measured with an improved dinitrophenylhydrazine assay. J Neurochem 70:268-275. Flotte TR (2005) Adeno-associated virus-ba sed gene therapy for inherited disorders. Pediatr Res 58:1143-1147. Forman MS, Lee VM, Trojanowski JQ (2003) 'Unfolding' pathways in neurodegenerative disease. Trends Neurosci 26:407-410. Georgievska B, Kirik D, Bj orklund A (2002) Aberrant spr outing and downregulation of tyrosine hydroxylase in lesioned nigrostr iatal dopamine neurons induced by longlasting overexpression of glial cell line deri ved neurotrophic fact or in the striatum by lentiviral gene tran sfer. Exp Neurol 177:461-474.

PAGE 108

95 Gerfen CR (1992) The neostriatal mosaic: multiple levels of compartmental organization. Trends Neurosci 15:133-139. Giasson BI, Uryu K, Trojanowski JQ, Lee VM (1999) Mutant and wild type human alpha-synucleins assemble into elongated filaments with distinct morphologies in vitro. J Biol Chem 274:7619-7622. Gill SS, Patel NK, Hotton GR, O'Sullivan K, McCarter R, Bunnage M, Brooks DJ, Svendsen CN, Heywood P (2003) Direct br ain infusion of glia l cell line-derived neurotrophic factor in Parkin son disease. Nat Med 9:589-595. Goldberg MS, Fleming SM, Palacino JJ, Cepe da C, Lam HA, Bhatnagar A, Meloni EG, Wu N, Ackerson LC, Klapstein GJ, Ga jendiran M, Roth BL, Chesselet MF, Maidment NT, Levine MS, Shen J (2003) Parkin-deficient mice exhibit nigrostriatal deficits but not loss of d opaminergic neurons. J Biol Chem 278:4362843635. Graybiel AM, Moratalla R, Robertson HA (1990) Amphetamine and cocaine induce drug-specific activation of the c-fos gene in striosome-matrix compartments and limbic subdivisions of the striatum. Proc Natl Acad Sci U S A 87:6912-6916. Greenamyre JT, Hastings TG (2004) Biomedicine. Parkinson's--divergent causes, convergent mechanisms Science 304:1120-1122. Grimm D, Kay MA (2003) From virus evoluti on to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy. Curr Gene Ther 3:281-304. Gundersen HJ, Jensen EB, Ki eu K, Nielsen J (1999) The efficiency of systematic sampling in stereology--recons idered. J Microsc 193:199-211. Hashimoto M, Rockenstein E, Masliah E ( 2003) Transgenic models of alpha-synuclein pathology: past, present, and fu ture. Ann N Y Acad Sci 991:171-188. Hattori N, Mizuno Y (2004) Pathogenetic mechan isms of parkin in Parkinson's disease. Lancet 364:722-724. Hattori N, Matsumine H, Asakawa S, Kitada T, Yoshino H, Elibol B, Brookes AJ, Yamamura Y, Kobayashi T, Wang M, Yoritaka A, Minoshima S, Shimizu N, Mizuno Y (1998) Point mutations (Thr240A rg and Gln311Stop) [correction of Thr240Arg and Ala311Stop] in the Pa rkin gene. Biochem Biophys Res Commun 249:754-758. Hebb MO, Robertson HA (1999) Motor effects and mapping of cerebral alterations in animal models of Parkinson's and Hun tington's diseases. J Comp Neurol 410:99114.

PAGE 109

96 Henze C, Earl C, Sautter J, Schmidt N, Themann C, Hartmann A, Oertel WH (2005) Reactive oxidative and nitrogen species in the nigrostriatal system following striatal 6-hydroxydopamine lesi on in rats. Brain Res 1052:97-104. Hertel KJ, Herschlag D, Uhlenbeck OC ( 1994) A kinetic and thermodynamic framework for the hammerhead ribozyme reaction. Biochemistry 33:3374-3385. Hudson JL, van Horne CG, Stromberg I, Broc k S, Clayton J, Masserano J, Hoffer BJ, Gerhardt GA (1993) Correlation of apomorphineand amphetamine-induced turning with nigrostriatal dopamine content in unilateral 6-hydroxydopamine lesioned rats. Br ain Res 626:167-174. Hughes AJ, Daniel SE, Blankson S, Lees AJ (1993) A clinicopa thologic study of 100 cases of Parkinson's disease. Arch Neurol 50:140-148. Huynh DP, Scoles DR, Nguyen D, Pulst SM (2003) The autosomal recessive juvenile Parkinson disease gene product, park in, interacts with and ubiquitinates synaptotagmin XI. Hum Mol Genet 12:2587-2597. Hyun DH, Lee M, Hattori N, Kubo S, Mizuno Y, Halliwell B, Jenner P (2002) Effect of wild-type or mutant Parkin on oxidative damage, nitr ic oxide, antioxidant defenses, and the proteasome. J Biol Chem 277:28572-28577. Imai Y, Soda M, Takahashi R (2000) Parkin suppresses unfolded pr otein stress-induced cell death through its E3 ubi quitin-protein ligase activ ity. J Biol Chem 275:3566135664. Imai Y, Soda M, Inoue H, Hattori N, Mizuno Y, Takahashi R (2001) An unfolded putative transmembrane polypeptide, whic h can lead to endoplasmic reticulum stress, is a substrate of Parkin. Cell 105:891-902. Imai Y, Soda M, Hatakeyama S, Akagi T, Hashikawa T, Nakayama KI, Takahashi R (2002) CHIP is associated with Parkin, a gene responsible for familial Parkinson's disease, and enhances its ubiquiti n ligase activity. Mol Cell 10:55-67. Ishikawa A, Tsuji S (1996) Clinical analysis of 17 patients in 12 Japanese families with autosomal-recessive type juvenile parkinsonism. Neurology 47:160-166. Itier JM, Ibanez P, Mena MA, Abbas N, C ohen-Salmon C, Bohme GA, Laville M, Pratt J, Corti O, Pradier L, Ret G, Joubert C, Periquet M, Araujo F, Negroni J, Casarejos MJ, Canals S, Solano R, Serrano A, Galle go E, Sanchez M, Denefle P, Benavides J, Tremp G, Rooney TA, Brice A, Garc ia de Yebenes J (2003) Parkin gene inactivation alters behaviour and dopamine neurotransmission in the mouse. Hum Mol Genet 12:2277-2291. Jacobson AB, Zuker M (1993) Structural analys is by energy dot plot of a large mRNA. J Mol Biol 233:261-269.

PAGE 110

97 Jain S, Wood NW, Healy DG (2005) Molecular genetic pathways in Parkinson's disease: a review. Clin Sci (Lond) 109:355-364. Jaskiw GE, Popli AP (2004) A meta-analysi s of the response to chronic L-dopa in patients with schizophrenia: therap eutic and heuristic implications. Psychopharmacology (Berl) 171:365-374. Jenner P, Olanow CW (1996) Oxidative stress and the pathogenesis of Parkinson's disease. Neurology 47:S161-170. Jiang H, Jiang Q, Feng J (2004) Parkin incr eases dopamine uptake by enhancing the cell surface expression of dopamine transporter. J Biol Chem 279:54380-54386. Jiang H, Jiang Q, Liu W, Feng J (2006) Park in suppresses the expr ession of monoamine oxidases. J Biol Chem 281:8591-8599. Kanthasamy AG, Kitazawa M, Kanthasamy A, Anantharam V (2005) Dieldrin-induced neurotoxicity: relevance to Parkinson' s disease pathogenesi s. Neurotoxicology 26:701-719. Kikkert M, Hassink G, Wiertz E (2005) The role of the ubiquitination machinery in dislocation and degradation of endoplasmi c reticulum proteins. Curr Top Microbiol Immunol 300:57-93. Kirik D, Rosenblad C, Bj orklund A (1998) Characteriza tion of behavioral and neurodegenerative changes following partia l lesions of the nigrostriatal dopamine system induced by intrastriatal 6-hydr oxydopamine in the rat. Exp Neurol 152:259277. Kirik D, Rosenblad C, Bjor klund A (2000a) Preservation of a functional nigrostriatal dopamine pathway by GDNF in the intrastriatal 6-OHDA lesion model depends on the site of administration of the tr ophic factor. Eur J Neurosci 12:3871-3882. Kirik D, Georgievska B, Bjor klund A (2004) Localized striatal delivery of GDNF as a treatment for Parkinson dis ease. Nat Neurosci 7:105-110. Kirik D, Rosenblad C, Bjorklund A, Mandel RJ (2000b) Long-term rAAV-mediated gene transfer of GDNF in the rat Parkinson's model: intrastriatal but not intranigral transduction promotes functional regenerati on in the lesioned nigrostriatal system. J Neurosci 20:4686-4700. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M, Mizuno Y, Shimizu N (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392:605-608. Klein RL, Lewis MH, Muzyczka N, Meyer EM (1999) Prevention of 6hydroxydopamine-induced rotational behavior by BDNF somatic gene transfer. Brain Res 847:314-320.

PAGE 111

98 Kopito RR (2000) Aggresomes, inclusion bodies and protein aggrega tion. Trends Cell Biol 10:524-530. Kordower JH, Palfi S, Chen EY, Ma SY, Sendera T, Cochran EJ, Cochran EJ, Mufson EJ, Penn R, Goetz CG, Comella CD (1999) Clinicopathological findings following intraventricular glial-deri ved neurotrophic factor treat ment in a patient with Parkinson's disease. Ann Neurol 46:419-424. Kotin RM, Siniscalco M, Samulski RJ, Zhu XD, Hunter L, Laughlin CA, McLaughlin S, Muzyczka N, Rocchi M, Berns KI (1990) Site-specific integration by adenoassociated virus. Proc Na tl Acad Sci U S A 87:2211-2215. Kruger R, Kuhn W, Leenders KL, Sprengelmeyer R, Muller T, Woitalla D, Portman AT, Maguire RP, Veenma L, Schroder U, Schol s L, Epplen JT, Riess O, Przuntek H (2001) Familial parkinsonism with synuclein pathology: clinical and PET studies of A30P mutation carriers. Neurology 56:1355-1362. Langston JW, Ballard P, Tetrud JW, Irwin I ( 1983) Chronic Parkinsonism in humans due to a product of meperi dine-analog synthesi s. Science 219:979-980. LaVoie MJ, Ostaszewski BL, Weihofen A, Schlossmacher MG, Selkoe DJ (2005) Dopamine covalently modifies and f unctionally inactivates parkin. Nat Med 11:1214-1221. Leroy E, Boyer R, Auburger G, Leube B, Ulm G, Mezey E, Harta G, Brownstein MJ, Jonnalagada S, Chernova T, Dehejia A, Lavedan C, Gasser T, Steinbach PJ, Wilkinson KD, Polymeropoulos MH (1998) The ubiquitin pathway in Parkinson's disease. Nature 395:451-452. Lewin AS, Hauswirth WW (2001) Ribozyme gene therapy: applications for molecular medicine. Trends Mol Med 7:221-228. Lindvall O, Bjorklund A (2004a) Cell therapy in Parkins on's disease. NeuroRx 1:382393. Lindvall O, Bjorklund A (2004b) Cell replacement therapy: helping the brain to repair itself. NeuroRx 1:379-381. Liu DX, Greene LA (2001) Neuronal apoptosis at the G1/S cell cycle checkpoint. Cell Tissue Res 305:217-228. Lo Bianco C, Schneider BL, Bauer M, Saja di A, Brice A, Iwatsubo T, Aebischer P (2004) Lentiviral vector de livery of parkin prevents dopaminergic degeneration in an alpha-synuclein rat model of Parkins on's disease. Proc Natl Acad Sci U S A 101:17510-17515. Lu Y (2004) Recombinant adeno-associated viru s as delivery vector for gene therapy--a review. Stem Cells Dev 13:133-145.

PAGE 112

99 Mandel RJ, Snyder RO, Leff SE (1999) Recomb inant adeno-associated viral vectormediated glial cell line-derived neurotrophi c factor gene transfer protects nigral dopamine neurons after onset of progre ssive degeneration in a rat model of Parkinson's disease. Exp Neurol 160:205-214. Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C (2006) Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther 13:463-483. Manfredsson FP, Lewin AS, Mandel RJ (2006) RNA knockdown as a potential therapeutic strategy in Parkinson' s disease. Gene Ther 13:517-524. Marazziti D, Golini E, Mandillo S, Magrelli A, Witke W, Matteoni R, Tocchini-Valentini GP (2004) Altered dopamine signaling and MPTP resistance in mice lacking the Parkinson's disease-associated GPR37/park in-associated endothelin-like receptor. Proc Natl Acad Sci U S A 101:10189-10194. McLaughlin SK, Collis P, Hermonat PL, Muzyczka N (1988) Adeno-associated virus general transduction vectors: analysis of proviral st ructures. J Virol 62:1963-1973. McNaught KS, Olanow CW (2003) Proteoly tic stress: a unifyi ng concept for the etiopathogenesis of Parkinson's disease. Ann Neurol 53 Suppl 3:S73-84; discussion S84-76. McNaught KS, Shashidharan P, Perl DP, Jenner P, Olanow CW (2002) Aggresomerelated biogenesis of Lewy bodies. Eur J Neurosci 16:2136-2148. Mercuri NB, Bernardi G (2005) The 'magic of L-dopa: why is it the gold standard Parkinson's disease therapy? Trends Pharmacol Sci 26:341-344. Moore DJ, Zhang L, Troncoso J, Lee MK, Ha ttori N, Mizuno Y, Dawson TM, Dawson VL (2005) Association of DJ-1 and parkin mediated by pathogenic DJ-1 mutations and oxidative stress. Hum Mol Genet 14:71-84. Mori H, Kondo T, Yokochi M, Matsumine H, Nakagawa-Hattori Y, Miyake T, Suda K, Mizuno Y (1998) Pathologic and biochemical studies of juvenile parkinsonism linked to chromosome 6q. Neurology 51:890-892. Mori K (2000) Tripartite management of unf olded proteins in the endoplasmic reticulum. Cell 101:451-454. Moro E, Scerrati M, Romito LM, Roselli R, Tonali P, Albanese A (1999) Chronic subthalamic nucleus stimulation reduces medication requirements in Parkinson's disease. Neurology 53:85-90.

PAGE 113

100 Moroz IA, Pecina S, Schallert T, Stewar t J (2004) Sparing of behavior and basal extracellular dopamine after 6-hydroxydopa mine lesions of the nigrostriatal pathway in rats exposed to a prelesion sensitizing regimen of amphetamine. Exp Neurol 189:78-93. Murakami T, Shoji M, Imai Y, Inoue H, Ka warabayashi T, Matsubara E, Harigaya Y, Sasaki A, Takahashi R, Abe K (2004) Pael -R is accumulated in Lewy bodies of Parkinson's disease. Ann Neurol 55:439-442. Nagatsu T, Ichinose H (1999) Molecular bi ology of catecholamine-related enzymes in relation to Parkinson's disease. Cell Mol Neurobiol 19:57-66. Nikolaev AY, Li M, Puskas N, Qin J, Gu W (2003) Parc: a cytoplasmic anchor for p53. Cell 112:29-40. Niwa H, Yamamura K, Miyazaki J (1991) Efficient selection for high-expression transfectants with a novel euka ryotic vector. Gene 108:193-199. Nutt JG, Burchiel KJ, Comella CL, Jankovi c J, Lang AE, Laws ER, Jr., Lozano AM, Penn RD, Simpson RK, Jr., Stacy M, Wooten GF (2003) Randomized, doubleblind trial of glial cell line -derived neurotrophic fact or (GDNF) in PD. Neurology 60:69-73. Olanow CW, Perl DP, DeMartino GN, McNa ught KS (2004) Lewy-body formation is an aggresome-related process: a hypot hesis. Lancet Neurol 3:496-503. Olsson M, Nikkhah G, Bentlage C, Bjorklund A (1995) Forelimb akinesia in the rat Parkinson model: differential effects of dopa mine agonists and nigr al transplants as assessed by a new stepping te st. J Neurosci 15:3863-3875. Panov A, Dikalov S, Shalbuyeva N, Taylor G, Sherer T, Greenamyre JT (2005) Rotenone model of Parkinson disease: multiple br ain mitochondria dysfunctions after short term systemic rotenone int oxication. J Biol Chem 280:42026-42035. Parkinson J (2002) An essay on the shak ing palsy. 1817. J Neuropsychiatry Clin Neurosci 14:223-236; discussion 222. Patel NK, Bunnage M, Plaha P, Svendsen CN, Heywood P, Gill SS (2005) Intraputamenal infusion of glial cell line-d erived neurotrophic factor in PD: a twoyear outcome study. Ann Neurol 57:298-302. Peden CS, Burger C, Muzyczka N, Mandel RJ (2004) Circulating anti-wild-type adenoassociated virus type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)mediated, but not rAAV5-mediated, gene transfer in the brain. J Virol 78:63446359. Perez FA, Palmiter RD (2005) Parkin-def icient mice are not a robust model of parkinsonism. Proc Natl Acad Sci U S A 102:2174-2179.

PAGE 114

101 Perez FA, Curtis WR, Palmiter RD (2005) Parkin -deficient mice are not more sensitive to 6-hydroxydopamine or methamphetamine neurotoxicity. BM C Neurosci 6:71. Pierson J, Svenningsson P, Caprioli RM, Andr en PE (2005) Increased levels of ubiquitin in the 6-OHDA-lesioned striatum of rats. J Proteome Res 4:223-226. Poirier J, Dea D, Baccichet A, Thiffault C (1994) Superoxide dismutase expression in Parkinson's disease. Ann N Y Acad Sci 738:116-120. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarin i AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276:2045-2047. Przedborski S, Levivier M, Jiang H, Ferreira M, Jacks on-Lewis V, Donaldson D, Togasaki DM (1995) Dose-dependent lesi ons of the dopaminergic nigrostriatal pathway induced by intrastriatal injec tion of 6-hydroxydopamine. Neuroscience 67:631-647. Purdy SE, Blair JA, Barford PA (1981) I nhibition of dihydropt eridine reductase by dopamine. Biochem J 195:769-771. Ren Y, Zhao J, Feng J (2003) Parkin binds to alpha/beta tubulin and increases their ubiquitination and degrada tion. J Neurosci 23:3316-3324. Robertson HA, Peterson MR, Murphy K, R obertson GS (1989) D1-dopamine receptor agonists selectively activate striatal c-fos independen t of rotational behaviour. Brain Res 503:346-349. Rosenblad C, Kirik D, Devaux B, Moffat B, Phillips HS, Bjorklund A (1999) Protection and regeneration of nigral dopaminergic ne urons by neurturin or GDNF in a partial lesion model of Parkinson's disease after administration into the striatum or the lateral ventricle. Eur J Neurosci 11:1554-1566. Rushmore TH, Morton MR, Pickett CB (1991) The antioxidant responsive element. Activation by oxidative stress and iden tification of the DNA consensus sequence required for functional activit y. J Biol Chem 266:11632-11639. Sauer H, Oertel WH (1994) Pr ogressive degeneration of ni grostriatal dopamine neurons following intrastriatal terminal lesi ons with 6-hydroxydopamine: a combined retrograde tracing and immunocytochemical study in the rat. Neuroscience 59:401415. Schallert T, Fleming SM, Leasure JL, Tillers on JL, Bland ST (2000) CNS plasticity and assessment of forelimb sensorimotor outcome in unilateral rat models of stroke, cortical ablation, parkins onism and spinal cord injury. Neuropharmacology 39:777787.

PAGE 115

102 Schlossmacher MG, Frosch MP, Gai WP, Medina M, Sharma N, Forno L, Ochiishi T, Shimura H, Sharon R, Hattori N, Langst on JW, Mizuno Y, Hyman BT, Selkoe DJ, Kosik KS (2002) Parkin localizes to th e Lewy bodies of Parkinson disease and dementia with Lewy bodies. Am J Pathol 160:1655-1667. Schnepp BC, Jensen RL, Chen CL, Johnson PR Clark KR (2005) Characterization of adeno-associated virus genomes isolat ed from human tissues. J Virol 79:1479314803. Schober A (2004) Classic toxin-induced animal models of Parkinson's disease: 6-OHDA and MPTP. Cell Tissue Res 318:215-224. Schwarting RK, Huston JP (1996) The unila teral 6-hydroxydopamine lesion model in behavioral brain research. An alysis of functional deficits recovery and treatments. Prog Neurobiol 50:275-331. Sherer TB, Betarbet R, Greenamyre JT (2002) Environment, mitochondria, and Parkinson's disease. Neuroscientist 8:192-197. Sherman MY, Goldberg AL (2001) Cellular de fenses against unfolde d proteins: a cell biologist thinks about neurodege nerative diseases. Neuron 29:15-32. Shimura H, Schlossmacher MG, Hattori N, Fr osch MP, Trockenbacher A, Schneider R, Mizuno Y, Kosik KS, Selkoe DJ (2001) Ubiquitination of a new form of alphasynuclein by parkin from human brain: implications for Parkinson's disease. Science 293:263-269. Shimura H, Hattori N, Kubo S, Mizuno Y, Asakawa S, Minoshima S, Shimizu N, Iwai K, Chiba T, Tanaka K, Suzuki T (2000) Familial Parkinson disease gene product, parkin, is a ubiquitin-protei n ligase. Nat Genet 25:302-305. Sinn PL, Sauter SL, McCray PB, Jr. (2005) Gene therapy progress and prospects: development of improved lentiviral and re troviral vectors--d esign, biosafety, and production. Gene Ther 12:1089-1098. Smeyne RJ, Jackson-Lewis V (2005) The MPTP model of Parkinson's disease. Brain Res Mol Brain Res 134:57-66. Sorkina T, Doolen S, Galperin E, Zahnise r NR, Sorkin A (2003) Oligomerization of dopamine transporters visualized in li ving cells by fluorescence resonance energy transfer microscopy. J Biol Chem 278:28274-28283. Spillantini MG, Schmidt ML, Lee VM, Troj anowski JQ, Jakes R, Goedert M (1997) Alpha-synuclein in Lewy bodies. Nature 388:839-840. Squire LR, Bloom FE, McConnell SK, Robert s JL, Spitzer NC, Zigmond MJ, eds (2002) Fundamental Neuroscience, 2nd Edition. London: Academic Press.

PAGE 116

103 Staropoli JF, Abeliovich A (2005) The ubiqui tin-proteasome pathway is necessary for maintenance of the postmitotic status of neurons. J Mol Neurosci 27:175-183. Staropoli JF, McDermott C, Martinat C, Schul man B, Demireva E, Abeliovich A (2003) Parkin is a component of an SCF-lik e ubiquitin ligase complex and protects postmitotic neurons from kainate excitotoxicity. Neuron 37:735-749. Takahashi R, Imai Y (2003) Pael receptor, endoplasmic reticulum stress, and Parkinson's disease. J Neurol 250 Suppl 3:III25-29. Tanaka K, Suzuki T, Chiba T, Shimura H, Hattori N, Mizuno Y (2001) Parkin is linked to the ubiquitin path way. J Mol Med 79:482-494. Thiruchelvam M, Brockel BJ, Richfiel d EK, Baggs RB, Cory-Slechta DA (2000) Potentiated and preferential effects of combined paraquat and maneb on nigrostriatal dopamine systems: environmenta l risk factors for Parkinson's disease? Brain Res 873:225-234. Trono D (2000) Lentiviral vectors: turning a d eadly foe into a therapeutic agent. Gene Ther 7:20-23. Tsai YC, Fishman PS, Thakor NV, Oyler GA ( 2003) Parkin facilitate s the elimination of expanded polyglutamine proteins and lead s to preservation of proteasome function. J Biol Chem 278:22044-22055. Ungerstedt U (1968) 6-Hydr oxy-dopamine induced degeneration of central monoamine neurons. Eur J Pharmacol 5:107-110. Valente EM, Abou-Sleiman PM, Caputo V, Muq it MM, Harvey K, Gispert S, Ali Z, Del Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, GonzalezMaldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ, Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160. Von Coelln R, Thomas B, Savitt JM, Lim KL, Sasaki M, Hess EJ, Dawson VL, Dawson TM (2004) Loss of locus coeruleus neurons and reduced startle in parkin null mice. Proc Natl Acad Sci U S A 101:10744-10749. Ward CL, Omura S, Kopito RR (1995) Degradation of CFTR by the ubiquitinproteasome pathway. Cell 83:121-127. Weintraub D, Stern MB (2005) Psychiatric complications in Parkinson disease. Am J Geriatr Psychiatry 13:844-851. West MJ, Slomianka L, Gundersen HJ (1991) Unbiased stereological estimation of the total number of neurons in thesubdivisions of the rat hippocampus using the optical fractionator. Anat Rec 231:482-497.

PAGE 117

104 Wu P, Xiao W, Conlon T, Hughes J, Agba ndje-McKenna M, Ferkol T, Flotte T, Muzyczka N (2000) Mutational analysis of the adeno-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism. J Virol 74:8635-8647. Xu C, Bailly-Maitre B, Reed JC (2005) E ndoplasmic reticulum stress: cell life and death decisions. J Clin Invest 115:2656-2664. Yamada M, Mizuno Y, Mochizuki H ( 2005) Parkin gene therapy for alphasynucleinopathy: a rat model of Parkins on's disease. Hum Gene Ther 16:262-270. Yang Y, Nishimura I, Imai Y, Takahashi R, Lu B (2003) Parkin suppresses dopaminergic neuron-selective neurotoxicity induced by Pael-R in Drosophila. Neuron 37:911924. Yao D, Gu Z, Nakamura T, Shi ZQ, Ma Y, Gaston B, Palmer LA, Rockenstein EM, Zhang Z, Masliah E, Uehara T, Lipton SA (2004) Nitrosative stress linked to sporadic Parkinson's disease: S-nitrosylation of parkin regulates its E3 ubiquitin ligase activity. Proc Natl Acad Sci U S A 101:10810-10814. Youdim MB, Edmondson D, Tipton KF (2006) The therapeutic poten tial of monoamine oxidase inhibitors. Nat Rev Neurosci 7:295-309. Zern MA, Ozaki I, Duan L, Pomerantz R, Liu SL, Strayer DS (1999) A novel SV40based vector successfully transduces and expresses an alpha 1-antitrypsin ribozyme in a human hepatoma-derived cell line. Gene Ther 6:114-120. Zetterstrom T, Herrera-Marsch itz M, Ungerstedt U (1986) Simultaneous measurement of dopamine release and rotational behaviour in 6-hydroxydopamine denervated rats using intracerebral dialysis. Brain Res 376:1-7. Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM (2000) Parkin functions as an E2-dependent ubiquitinprotein ligase and promotes the degradation of the synaptic vesicle-associat ed protein, CDCrel-1. Pr oc Natl Acad Sci U S A 97:13354-13359. Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, Kachergus J, Hulihan M, Uitti RJ, Calne DB, Stoessl AJ, Pfeiffer RF, Patenge N, Carbajal IC, Vieregge P, Asmus F, Muller-Myhsok B, Dickson DW, Meitinger T, Strom TM, Wszolek ZK, Gasser T (2004) Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 44:601-607. Zolotukhin S, Potter M, Zolotukhin I, Saka i Y, Loiler S, Fraites TJ, Jr., Chiodo VA, Phillipsberg T, Muzyczka N, Hauswirth WW, Flotte TR, Byrne BJ, Snyder RO (2002) Production and purification of se rotype 1, 2, and 5 recombinant adenoassociated viral vectors. Methods 28:158-167.

PAGE 118

105 Zuker M (2003) Mfold web server for nucleic acid folding and hybrid ization prediction. Nucleic Acids Res 31:3406-3415. Zupnick HM, Brown LK, Miller A, Moros DA (1990) Respiratory dysfunction due to Ldopa therapy for parkinsonism: diagnosis us ing serial pulmonary function tests and respiratory inductive plethysmography. Am J Med 89:109-114.

PAGE 119

106 BIOGRAPHICAL SKETCH Fredric Per Manfredsson was born in Mora Sweden, in 1974. the son of Carina Manfredsson and Dieter Benthin. Shortly foll owing his birth the family moved to Slen on the Norwegian border, where he liv ed until he started high-school. After graduating from St. Mikael gymnasi um in Mora, Sweden, with a degree in natural sciences, Fredric move d to Tempe, Arizona, where he attended Arizona State University from 1995-1999, majoring in micr obiology. He was the recipient of a Howard Hughes Medical Institute undergraduate resear ch fellowship, and conducted virology and gene-therapy under the supervision of Dr. Da vid C. Bloom and Dr. Edward Castaneda. He graduated in December 1999 with summa cum laude honors with a Bachelor of Science in microbiology. From December of 1999 until the summer of 2001 Fredric worked as a chemist with Biomedic Industries in Phoenix, Arizona. In the fall of 2001, he entered into his gradua te studies at the University of Florida, as a student in the Interdis ciplinary Program in Biomedical Sciences, and has conducted research under the supervision of Dr. Rona ld J. Mandel and Alfred S. Lewin. Following completion of his Ph.D., Fredric plans to cont inue his research into protein folding and neurodegenerative diseas e under the continued supe rvision of Dr. Mandel.


Permanent Link: http://ufdc.ufl.edu/UFE0015709/00001

Material Information

Title: RAAV Mediated Modulation of Parkin in the Rat Basal Ganglia
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015709:00001

Permanent Link: http://ufdc.ufl.edu/UFE0015709/00001

Material Information

Title: RAAV Mediated Modulation of Parkin in the Rat Basal Ganglia
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015709:00001


This item has the following downloads:


Full Text












RAAV MEDIATED MODULATION OF PARKING IN THE RODENT BASAL
GANGLIA















By

FREDRIC PER MANFREDSSON


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Fredric Per Manfredsson



































Pro totus magister.















ACKNOWLEDGMENTS

Work such as this would never be possible without the help and influence from

numerous individuals. First and foremost I would like to thank my mentors, Dr. Ronald

Mandel and Dr. Alfred Lewin, for their never-ending patience, support, and mentoring

during my graduate school tenure under their care. From these two individuals I have

learned the best of two worlds: molecular biology and neuroscience. I would also like to

thank my mentors Dr. Lucia Notterpek and Dr. David Bloom for their input and advice.

I would also like to thank Dr. Bloom for introducing me to the world of molecular

biology and research, and for introducing me to the University of Florida.

I also must extend my appreciation to all the members of the Lewin and Mandel

laboratories, past and present. They have all in one way or another been helpful in my

accomplishment of this work. I also would like to extend special thanks to James Thomas

Jr. and Isabelle "Izzie" Williams for being instrumental in allowing the laboratories to

operate smoothly, and for always offering their assistance. I would also like to thank

Layla Sullivan for her assistance in my cloning work and HPLC analysis, Dr Corinna

Burger and Dr. Nicolas Muzyczka for their advice and for providing me with some of my

vectors, and Thomas Doyle for always being willing to supply me with cells. BJ

Streetman for keeping a close watch on me, and for the assistance in doing all my official

paperwork.









My work was also made much easier thanks to Mark Potter and the vector core

lab of the Powell Gene Therapy Center, and Vince Chiodo of the Hauswirth vector

production group who provided me with all my viruses.

Of course, this would never be possible without the support from friends and

family. I would like to thank my grandparents Karin and Arne Manfredsson, my mother

Carina and sister Sarah, and my best friend Anders Eldh, for always being there,

believing in me and doing whatever they could to make this happen.

Thank you!
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES ....................................................... ... .......... ... ..... ..... ix

LIST OF FIGURES .............. ... ................................ ......... ..x

ABSTRACT .............. ..................... .......... .............. xii

CHAPTER

1 IN TR O D U C T IO N ............................................................. .. ......... ...... .....

P arkinson 's D disease ....................................................................................... 1
B background ............................................................................................. ..............
A n ato m y o f P D ............................................................................... 2
D o p a m in e .............................................................................................................. 5
Treatments for PD ...................... ....................................... .. ....................... 8
L-Dopa and Other Current Treatments ........................................ 8
Gene-therapy Utilizing Trophic Factor Delivery for PD ....................................9
C a u se s o f P D .......................................................................................................... 1 0
G enetic Causes of PD ..............................................................................10
a- Synu clein ................................................... .... 10
Parkin and UCHL 1 ................. ...............................11
PINK-1 and DJ-1 ..... ......... .. ......... ...... .........15
Idiopathic PD ......................................................................... ......... ................... 17
Animal Models of PD ............... ......... ........ ......... 18
M P T P .............................................................................................................. 1 8
P araquat ................................................................................................... ........ 19
R o te n o n e .....................................................................................1 9
6-O H D A ................................................................... 20
A deno-A associated V irus ............. ......... ................ ...........................................21
A A V Production ................. ................................... ....... ...... .........22
AAV as a Gene Delivery Vector ............................ ......... ......... 23
R ib o zy m e s ................................................................2 5
P roje ct .............................................. ... ................................ 2 7









2 RAAV MEDIATED PARKING MUTANT EXPRESSION AND RIBOZYME
EXPRESSION TARGETING PARKING IN THE SUBSTANTIAL NIGRA DOES
NOT CAUSE DOPAMINERGIC CELL LOSS.............................. ...............28

Intro du action .................................................................................................... 2 8
Background .................. ........................ 28
P arkin A nim al M odels.............................................................. .....................29
Proj ect .................... .............. ...............30
R ib o z y m e ............................................................................................... 3 0
P arkin M utants .............................. ........................ .. ........ .... ............32
Results ........... ........... ............. ............... 33
Ribozym e In Vitro K inetics.......................................... ........................... 33
In V ivo E x p ressio n ......................................................................................... 3 6
R ib ozy m e ....................... .......................... .. .. ........ .... ..... ...... 36
Mutant Parkin ..................... .............. ............... 37
D discussion ......... ...... ............ ...................... ................... 37

3 RAAV MEDIATED NIGRAL PARKING OVER-EXPRESSION PARTIALLY
AMELIORATES MOTOR DEFICITS IN A RAT MODEL OF PARKINSON' S
D IS E A S E .......................................................................... 4 3

Introdu action ...................... ............... ....................................................... 4 3
B background ...................... ............... .. .. ..................................43
P ro j e c t ............................................................................................................ 4 5
R e su lts ............... ............ .. .. .........................................................................................4 5
Am phetam ine Induced Rotations ............................................................. 46
Cylinder Testing ...... ......... ......... .......... ........47
Stepping Test ....................... ...................... 49
rAAV-M ediated Transduction........................................... 50
Nigrostriatal DA Neurons ....................................................... 51
F o s E x p re ssio n ............................................................................................... 5 5
B iochem ical E v alu ation ................................................................................. 57
D o p a m in e ............................................................................................... 5 7
Tyrosine hydroxylase ................................. ........................... ..... 59
D isc u ssio n ............................................................................................................. 6 0

4 D ISC U S SIO N ............................................................................... 68

S u m m a ry ............................................................................................................... 6 8
D opam ine and B behavior ........................................................... ............... 68
6-O H D A L esion ................................................................................. 69
L o ss of P ark in ................................................................................7 0
P arkin and D opam ine ...... .................... ...................................................72
Parkin Over-Expression and Therapeutic Potential....................... ............... 73
F u tu re S tu d ie s .................................................................................................. 7 5
Concluding Rem arks .................................. ........................................... 76









5 M ATERIALS AND M ETHOD S ........................................ ......................... 78

R ibozym e in Vitro T testing ............................................................... .....................78
T arg et L ab elin g ............................................................................................. 7 8
Time-Course ............................................ ........................78
M ulti-turnover K inetic A nalysis...................................... ........................ 79
V irus Preparations .......................................... ............. .... ....... 79
Parkin ................................................................................ .......... .........................79
Ribozym e................................................... .... ... ....80
Surgical P procedures ............................................................................8 1
Intracerebral Injections of AAV Vectors ....... ........................................ ...82
D ouble injection in the SN c ........................................ ...... ............... 82
Single injection in the SN c................................ ......................... ....... 82
6-O H D A Lesions ........ .. ..................... ........ .......... .............. 82
B ehavioral A naly sis.......... ........................................................................... .. .... 83
R otational B ehavior............ .... .................................................. .. .... .... .... 83
Cylinder Test .......................... .................. 83
Forelimb Akinesia (Stepping Test). ........................................ ............... 83
H istological Procedures ................................................... ......... ............... .84
Perfusion and Tissue Processing ........................ .............. ............... .... 84
Recovery of Fresh Tissue for Parkin Over-Expression Project ...........................84
Recovery of Fresh Tissue for Ribozyme Project...............................................85
Immunohistochemistry .............. ........................... ..... ............... 85
In Situ H ybridization .................................... ................... ..... .... 86
Oligo Probe 3'OH Labeling ..............................................86
H ybridization ........................................................................... ............... 86
High Performance Liquid Chromatography ....................................................87
W western B lotting.................. .. .......... ................. ... ............. .............. 87
Estimation ofNigral TH+ Neuronal Survival ............................................. 88
Fos O ver-Expression ......................... .. .................. ......... ...............89
Statistical M ethods........... ................................................ ............ ......... ....... 89

L IST O F R EFER EN CE S ......... ......... ......... .......... ........................... ............... 91

BIOGRAPHICAL SKETCH ......... .. ................. ......... .... ....................... 106
















viii
















LIST OF TABLES

Table p

1-1. Table of genes linked to PD. .................... .................... 11

1-2. Proposed substrates of parking. ..................................... ......... .... ............... 14

2-1. Com prison of parking m house m odels. .............. ........... ...................... .................30
















LIST OF FIGURES

Figure page

1-1. Striatal PET scan. ................................ .. ...... .. ............ .... ....

1-2. Gross midbrain sections showing SN loss.................. ............................................. 3

1-3. Basic schem atic of the basal ganglia. ................................ ................... ..................5

1-4. Demonstration of Lewy bodies in the SNc..............................................................7

1-5. Schematic of parking poly-ubiquitination. ........ .........................................12

1-6. Convergent mechanisms of familial forms of PD ................................................. 16

1-7. Schematic of various toxin induced models of PD.......................................21

1-8. Midbrain transduction utilizing various pseudotyped rAAV vectors.........................25

1-9. Schem atic of ribozym e binding ............................................ ........... ............... 26

2-1. Schematic of rAAV expressing ribozyme. ........................................... 31

2-2. rA A V expressing Q 311 Stop ............................................... ............................ 32

2-3. Time-course experiment of ribozyme 131.................................... ............... 34

2-4. M ulti-turnover kinetic analysis .............. ............. ......................... .. .. ............ 35

2-5. Com prison of V m ax......... ................. ................. ......................... ............... 35

2-6. Confocal imaging of substantial nigra treated with parking ribozyme........................37

2-7. In situ hybridization and western blot of parking in the SN............... ................... 38

2-8. C-term inal parking dom inant negative. .............................................. .....................39

2-9. N-terminal parking. .......................................... ........ .. ....... ..... 40

3-1. E xperim mental design. ........................ ........................ .. .. .. ..... .... ...........44

3-2. Parkin plasm id..................................................................45



x









3-3. Image of rat undergoing rotational analysis. ............................ ..... .. ............. 46

3-4. Amphetamine induced rotations for rAAV2 injected group....................................47

3-5. C cylinder test ......... ...... ................................................ ..........................48

3-6. Results from cylinder testing of the rAAV2 injected group ................ ................. 48

3-7. Stepping test. .......................................... ............................ 49

3-8. Stepping test data............... .................. ........ .. ..... .. ................ 50

3-9. GFP transgene expression in the midbrain. ...................................... ............... 50

3-10. Parkin transgene expression in the midbrain.............................. ..................51

3-11. Striatal TH im m unoreactivity ...................................................... ............... 52

3-12. N igral TH staining. ............................................................... .... ...... 53

3-13. R result of TH stereology .............................................. ............................ 53

3-14. DAT expression in the substantial nigra........... ................................ ................54

3-15. AADC expression in the substantial nigra............... .............. ................... 54

3-16. Activity of basal ganglia output nuclei via Fos over-expression ...........................56

3-17. Number of Fos expressing cells in the SNr. .......................................................57

3-18. Rotational data from the rAAV5 group ........................................ ............... 58

3-19. Dopamine levels measured by HPLC................................. ...............58

3-20. Western blots of TH and the D2 receptor............................ ............... 59

3-21. D2 receptor protein levels measured by western blot ................... ..................60

3-22. Graph of striatal TH protein levels. ........................................ ....................... 60

3-23. Characterization of rAAV2 mid-brain transduction ......... ................................65

3-24. D OPA C levels in the striatum ............................................................................ 66

4-1. R egression analy sis........... .................................................................. ........ .. ...... .. 74















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

RAAV MEDIATED MODULATION OF PARKING IN THE RAT BASAL GANGLIA

By

Fredric Per Manfredsson

August 2006

Chair: Ronald J. Mandel
Major Department: Neuroscience

Parkinson's disease (PD) is a progressive neuro-degenerative disease with a strong

prevalence in the aging population. Characterized by a loss of cell bodies in the midbrain

nucleus substantial nigra pars compact, PD leads to numerous motor dysfunctions which

increase in severity with the disease progression. The cause of the sporadic form of PD is

largely unknown although several hypotheses converge on increased cellular oxidative

stress, exposure to environmental toxins such as pesticides, and aberrant protein

accumulation. In the last decades, several familial forms of PD have been identified,

several of which are due to mutations in genes involved in proteasomal processing and

oxidative stress responses. One such gene encodes the E3 ligase parking. Several

mutations in various regions of parking have been identified, and they cause a juvenile

onset form of the disease termed autosomal recessive juvenile PD (ARJP). Interestingly,

a vast majority of ARJP patients lack a distinguishing feature of sporadic PD: Lewy

bodies, proteinaceous intra-cellular inclusions. Thus, it has been suggested that parking is

intimately involved in the formation in these potentially neuro-protective structures.









In this work I present the results from manipulating parking expression in the rat

basal ganglia. Using rAAV to over-express parking during a toxic oxidative insult to the

SN, we observed an improvement in behavior as compared to control. However, to our

surprise, histological examination showed no increase in cell survival. Thus the benefit

from parking over-expression may not have been due to protection against increased levels

of oxidative stress. Conversely, we utilized rAAV expressing ribozymes targeting parking

expression, as well as rAAV expressing mutant alleles of parking. In line with published

data from parking deficient animals; neither the mutants nor reduced levels of parking led to

any histo-pathological effects in the substantial nigra, and neither did we see any

accumulation of putative parking substrates. The lack of detrimental effects suggests that

parking deficiency in human patients may be only a predisposing factor, and that

additional insults may be required to develop PD.














CHAPTER 1
INTRODUCTION

Parkinson's Disease

Background

Parkinson disease (PD) was first described in 1817 by James Parkinson in his

"Essay on the Shaking Palsy" (Parkinson, 2002). Today PD is recognized as one of the

most common neurological disorders in the population, second only to Alzheimer's

disease, affecting approximately 1% of individuals over the age of 65. The disease is

distributed roughly equally amongst the sexes and with no difference due to ethnic

background. With an increasingly aged population, the disease is becoming more

prevalent and imparts a great economical impact onto society.

Clinically, the disease is characterized by a number of cardinal motor dysfunctions

that include a well defined 4-6 Hz resting tremor which is often described with a "pill-

rolling" quality when seen in the hands; rigidity due to increase in muscle tone which is

seen as increase in resistance to passive maneuvers; postural instability as evidenced by

shortened arm-swing, shortened stride and loss of postural reflexes and bradykinesia,

which may be manifested as decreased facial expression, slowness of movement, or

clumsiness in an extremity. One example of bradykinesia often displayed in PD patients

is micrographia in which the affected individual's handwriting decreases in completeness

and legibility from the beginning of a sentence to the end (Fahn, 2003). Other symptoms

include autonomic problems: severe constipation, urinary frequency/nocturia, and

problems with thermo-regulation (Adler, 2005). Psychiatric and cognitive impairments









(late-stage dementia (Adler and Thorpy, 2005), depression, hallucinations, and sleep

disturbances) are also frequent (Weintraub and Stern, 2005).













Figure 1-1. Striatal PET scan. IV-3 and IV-5 are scans from patients with familial PD.
IV-6 is a healthy control, and the right scan shows a patient with sporadic PD
(Kruger et al., 2001).

A clinical diagnosis of PD is mainly based on observation of the previously

described motor dysfunctions and responsiveness to pharmaceutical treatment of L-3,4-

dihydroxyphenylalanine (L-DOPA). A more definitive diagnosis is accompanied by

evaluating the patient with Positron Emission Tomography (PET) (fig. 1-1) where a

labeled amino-acid 3,4-Dihydroxy-6-fluoro-DL-phenylananine (F-DOPA) is used as a

tracer in the PET examination in order to determine whether the brain has a deficiency in

dopamine synthesis. If it does not, Parkinson's disease can be ruled out and possible

tremors in the patient's muscles will be treated differently (Eckert and Eidelberg, 2005).

Anatomy of PD

Anatomically, PD is characterized by a progressive loss of the midbrain nucleus

Substantia Nigra pars compact (SNc) (fig. 1-2). The onset of the disease is usually

observed after a 70% reduction in striatal dopamine (Bernheimer et al., 1973). These cells

are part of the basal ganglia (BG) circuitry (fig. 1-3) and have their terminal fields in the

striatum where they release dopamine. The basal ganglia are a large and complex sub-









cortical structure comprised of several different nuclei: the striatum caudatee, putamen,

nucleus accumbens), subthalamic nucleus (STN), globus pallidus internal/external

(GPi/GPe), ventral pallidum, substantial nigra pars compact and pars reticulata (SNr).

Although the relationships between the various nuclei in the basal ganglia are by no

means completely understood, many connections have been elucidated.






















Figure 1-2. Gross midbrain sections showing SN loss. Right brain is from a healthy
individual, and the left brain is from a PD affected individual, observe the loss
of pigmented neurons in the SN (Hughes et al., 1993).

The basal ganglia, via the striatum, receives its input from the cortex (corticostriate

projections) as well as the intralaminar nuclei of the thalamus. The striatum, in turn,

projects its efferents both to the GPi and GPe and the SNc/SNr. The STN has a central

role in the BG, relaying input from the motor and pre-motor cortex to the GP. A majority

of the output from the BG comes from the GP and the SNr communicating its output is to

the frontal cortex through the thalamus, and the brain stem. The BG is further divided

into a direct and indirect pathway. The direct pathway projects its inhibitory circuits from









the striatum to the GPi/SNr, leading to disinhibition of the thalamus and is thought to

facilitate motion by exciting the supplemental motor area of the cortex. Conversely, the

indirect pathway is thought to inhibit movement by inhibitory projections from the

striatum to the GPe, which removes its inhibition from the STN. The activation of the

STN is excitatory to the GPi/SNr which in turn inhibits the thalamus and its cortical

projections. The basal ganglia circuitry is involved in motor function, or more

specifically, the control of motor function, translation of information from the neo-cortex

to motor areas as well as automatic execution of learned motor activity (Squire et al.,

2002).

The neurons of the SNc contain a by-product of dopamine metabolism,

neuromelanin. This substance gives these neurons their characteristic dark appearance

(fig. 1-2) (Substantia Nigra = black substance) (Fedorow et al., 2005). The SNc receives

inhibitory GABAergic (gamma-aminobutyric acid) input from the striatum, and SNc

neurons terminate in the striatum where it stimulate various G protein coupled DA

receptors (D1-D5), which react differently to dopamine.

It is not entirely clear as to how the loss of the nigro-striatal circuitry in PD causes

various motor problems. It is believed that the tremor is due to abnormal bursting of

neurons in the thalamus which receives input from the basal ganglia. The slowness of

movement is thought to be due to increase in activity of globus pallidus internal, and

postural dysfunction is thought to be a result of an inability to suppress the transcortical

stretch-reflex (Squire et al., 2002).

In addition to nigral degeneration in PD, there is also some loss of dopaminergic

neurons in the ventral tegmental area and norepinephrine neurons in the locus coeruleus.






























\ \ utamiat BASAL GANGUA CIRCUITS
utame ".L J |
Subthalamlc Excitatory numrons am
D2 n nucleus depicted in blue.
-\ Inhibitory neurona am
substaa Nir, depicted in red.
pc comipacta
Dopamine excites DI and
Inhibits D2 receptors.

Figure 1-3. Basic schematic of the basal ganglia (Gerfen, 1992).

Dopamine

Dopamine belongs to a family of neurotransmitters termed catecholamines.

Catecholamines are organic compounds consisting of a catechol nucleus (benzene ring

with two hydroxyl groups) and an amine group. In addition to dopamine, other members

of this family are noradrenaline and epinephrine. All three neurotransmitters are part of

the same biosynthesis pathway, and the presence of certain enzymes dictates what cells

produce what transmitter. Phenylalanine and tyrosine are the amino-acid precursors for

catecholamine synthesis. Dietary phenylalanine is converted to tyrosine by phenylalanine

hydroxylase. Tyrosine hydroxylase (TH) then converts L-tyrosine into 3,4-

dihydroxyphenylalanine dopaA). TH mediated activity is highly regulated through end









product inhibition; where dopamine interferes with the required co-factor 6(R)-l-erythro-

5,6,7,8-tetrahydrobiopterin (BH4) by binding to TH and inhibiting reduction of enzyme-

bound iron by BH4 (Purdy et al., 1981) as well as through direct competition for a TH

binding site (Cooper et al., 1996). TH is also regulated through phosphorylation of one of

its four serine sites. DOPA is rapidly decarboxylated to dopamine by L-aromatic amino

acid decarboxylase. In dopaminergic neurons, dopamine is the end-product; however, in

adrenergic cells, dopamine is further modified (Nagatsu and Ichinose, 1999).

DA is concentrated into vesicles by the monoamine transporter (VMAT) and

these vesicles are localized mainly to the pre-synaptic terminal. Dopamine is released

into the synaptic cleft through calcium dependent exocytosis. DA can also be released

through the reversal of the dopamine transporter which occurs as the result of

amphetamine administration. Once release has been achieved, the stimulus is regulated

through the mechanisms of certain pre-synaptic dopaminergic autoreceptors such as D2

receptors. Dopamine is quickly metabolized by the actions of monoamine oxidase and

catechol-o-methyl-transferase (COMT) (extra-cellular) yielding 3,4-

dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA) via the intermediate

3-methoxytyramine (3-MT) metabolites. DOPAC is known to produce potentially

cytotoxic compounds such as hydroxyl radical and superoxide. Extracellular dopamine is

also subject to reuptake by the cell through the activity of the dopamine transporter

(DAT).

The onset of Parkinson's disease is observed at the time when approximately 50%

nigral neurons are lost, resulting in a 70-80% loss of striatal dopamine (Bemheimer et al.,

1973). The onset is typically unilateral with a subsequent bilateral progression.









4P E


-w r-











Figure 1-4. Demonstration of Lewy bodies in SNc dopaminergic neurons in sporadic PD.
Conventional haematoxylin (blue) and eosin (pink) histological staining (A)
reveals a spherical Lewy body (arrow) in SNc dopamine neurons with a
distinct central core and a peripheral halo. Electron micrograph of a Lewy
body (B) reveals that the core (C) contains granular material and the outer
halo (h) is composed of radiating filaments. A standard immunohistochemical
protocol shows two Lewy bodies (arrow) with ubiquitin concentrated in the
core (C) and two Lewy bodies (arrow) with a synuclein concentrated in the
halo (D) (Olanow et al., 2004).

Furthermore, postmortem evaluation reveals the hallmark histological feature of the

disease, the presence of Lewy Bodies (LB) (fig. 1-4), intracytoplasmic eosinophillic

inclusions, and Lewy neurites in the SNc and Locus coreuleus. These structures are

intracellular aggregations of proteins and lipids, and immunostaining has revealed that

they contain several proteins involved in proteasomal processing, which has led to the

formulation of the hypothesis that these inclusions are an active localization of potentially

damaging mis- (un-) folded proteins to one cellular compartment for degradation









(Sherman and Goldberg, 2001). In addition these structures also are highly immuno-

reactive to a-synuclein (Spillantini et al., 1997). However, the inclusion formation may

simply be the result of aberrant protein aggregation (McNaught and Olanow, 2003).

Nonetheless, it is still unclear whether or not these Lewy structures are toxic, or, in fact,

protective (Olanow et al., 2004).

Treatments for PD

L-Dopa and Other Current Treatments

Current treatments for the disease are limited. The main stream intervention is L-

3,4-dihydroxyphenylalanine (L-dopa) administration. TH is the rate-limiting step in DA

synthesis converting tyrosine in to DOPA. Thus, administration of L-dopa effectively

bypasses this rate-limiting step, resulting in increased levels of DA. However, treatment

is only temporarily efficacious and leads to side-effects such as the development of motor

fluctuations ('wearing-off and 'on-off phenomena) and dyskinesias. More importantly,

treatment does not stop neural degeneration (Mercuri and Bemardi, 2005). Other

pharmaceutical options include dopamine agonists such as pergolide, piribedil,

pramipexole, and ropinirole, and mono-amine oxidase inhibitors such as selegiline

(Youdim et al., 2006). Another therapeutic option, deep brain stimulation (DBS) is a

surgical option to alleviate symptoms by electrically stimulating the thalamus,

subthalamic nucleus or the globus pallidus. This high frequency stimulation inactivates

its target nuclei, thus effectively creating a functional lesion without actually removing

the nucleus. DBS is an alternative to physical lesions which have shown to produce side-

effects like hemiballismus, a condition resulting in ballistic and choreiform movements of

limbs (Moro et al., 1999).









In addition, there have been several other experimental treatments aimed at halting

degeneration and/or inducing striatal reinnervation, such as intrastriatal transplants of

fetal mesencephalic tissue. However, such treatments are limited by the lack of donor

cells, variability in efficacy, as well as ethical concerns (Lindvall and Bjorklund, 2004a,

2004b). One promising potential therapeutic agent for PD may be glial cell derived

neurotrophic factor (GDNF) (Mandel et al., 2006).

Gene-therapy Utilizing Trophic Factor Delivery for PD

GDNF has been the focus of a large number of gene therapy studies. GDNF has

proven to be a potent trophic factor for the dopaminergic neurons in the regions affected

in PD (Kirik et al., 2004). In rodent models where parkinsonian conditions are induced

utilizing various toxins such as 6-hydroxy dopamine (6-OHDA) or 1-methyl-4-phenyl-

1,2,3,6-tetrahydropyridine (MPTP), adeno associated virus (AAV) mediated GDNF

expression has been shown to be both protective and restorative (Mandel et al., 1999).

Nigral GDNF expression protects the cell bodies against retrograde toxicity due to a

striatal lesion, but the loss of striatal innervation is critical to recovery of motor function

(Bjorklund et al., 2000). Protection against terminal withdrawal was observed if the virus

was expressed directly at the lesion site leading to recovery of function. When similar

experiments were done in non-human primates, striatal injections of rAAV expressing

GDNF were performed prior to a 6-OHDA lesion, the treated animals displayed an

improvement in motor function, and histological evaluation showed a significant increase

in surviving cells (Eslamboli et al., 2005). There are concerns, however, with GDNF

transgene expression. It has been demonstrated, using lenti-viral vectors, that high levels

of GDNF results in decreased expression of TH in the striatum of both intact and lesioned

animals, as well as aberrant fiber sprouting in the SN (Georgievska et al., 2002).









However, this down-regulation effect was not seen using similar rAAV mediated GDNF

doses in marmosets (Eslamboli et al., 2005) which may indicate a differential GDNF

response between rodent and primate nigrostriatal dopamine neurons.

In humans, GDNF has been delivered in 3 clinical trials either intraventricularly

(Kordower et al., 1999; Nutt et al., 2003) or intrastriatally (Gill et al., 2003; Patel et al.,

2005). The results of these studies indicated that there was very little or no improvement

of the parkinsonian symptoms, although increases in dopamine levels were seen. In

addition, especially after intraventricular GDNF infusion, psychiatric and other

hyperdopaminergic side effects such as anorexia were observed.

Causes of PD

The cause of the idiopathic form of PD is not yet known, although numerous

hypotheses have been put forth including increased oxidative stress or exposures to

environmental toxins such as pesticides, possibly leading to mitochondrial dysfunction

(Sherer et al., 2002). Clues to the pathological mechanisms of PD have come from the

identification of several familial forms of PD and the genes involved (table 1-1).

Genetic Causes of PD

a- Synuclein

The first gene to be associated with PD was identified by Polymeropoulos and

colleagues and was named a- synuclein (Polymeropoulos et al., 1997). a- synuclein is

expressed in the synaptic terminals and has been suggested to be involved in the

maintenance of synaptic terminals (Bonini and Giasson, 2005; Chandra et al., 2005). The

mutant proteins identified in the genetic form of the disease displayed an increased

propensity to aggregate (Giasson et al., 1999; Conway et al., 2000) and subsequent









Table 1-1. Table of genes linked to PD (Moore et al., 2005).
L s Chromosome Inheritance
Locus Gene
location pattern
PARK1 & 4q21-q23 a- AD
PARK4 synuclein
PARK2 6q25.2-q27 parking usually AR

PARK3 2pl3 unknown AD, IP

PARKS 4pl4 UCH-L1 Unclear
PARK6 1p35-p36 PINK1 AR

PARK7 lp36 DJ-1 AR

PARK8 12pll.2-ql3.1 LRRK2 AD
PARK10 lp32 unknown Unclear
PARK 11 2q36-q37 unknown Unclear
NA 5q23.1-q23.3 Synphilin- Unclear
1
NA 2q22-q23 NR4A2 Unclear


Typical phenotype

Earlier onset, features of
DLB common
Earlier onset with slow
progression
Classic PD, sometimes
dementia
Classic PD
Earlier onset with slow
progression
Earlier onset with slow
progression
Classic PD
Classic PD
Classic PD
Classic PD

Classic PD


studies also showed that LBs stained heavily for a- synuclein suggesting a role in

idiopathic PD as well (Spillantini et al., 1997). The identification of a- synuclein was an

early suggestion that protein folding may be important to the disease, and this notion was

further intensified with the identification of additional familial forms that were both

shown to play a role in the cellular proteasomal machinery.

Parkin and UCHL1

The first ubiquitin-proteosome gene to be identified was ubiquitin carboxyl-

terminal hydrolase-1 (UCHL1) (Leroy et al., 1998). The second gene was parking (Kitada

et al., 1998), which was identified to be a E3 ubiquitin ligase (Shimura et al., 2000).

Parkin serves its function by linking certain substrate proteins to degradation by the 26S

proteasome (fig. 1-5). This is achieved by linking a E2-ubiquitin conjugating enzyme









through parking's two carboxy terminal RING finger motifs to a substrate recognition

domain in the amino-terminus, facilitating subsequent poly-ubiquitination of the target

substrate, tagging it for degradation (Tanaka et al., 2001). Parkin-associated PD is

characterized by a juvenile-onset (before 40 years of age, average 26 years) of

symptoms, and this form of the disease has been termed autosomal recessive juvenile PD

(AR-JP) (Ishikawa and Tsuji, 1996).




Parkin !

UPD

_J abJ El






ATP iATP
E1+Ub
ADP
Pi
26S Proteasome





Peptides
Figure 1-5. Schematic of parking poly-ubiquitination (Tanaka et al., 2001).

Interestingly, a vast majority of individuals do not have LBs (Mori et al., 1998)

further implicating parking's importance in protein clearance and/or maintenance of these

structures (Ardley et al., 2003).









The identification of these familial forms of PD, including a- synuclein, put forth

the idea that aberrant protein folding and a hampering of subsequent proteasomal

processing may be a common pathological process in PD. Consequently, when LBs were

examined it was shown that they contained many components of the proteasomal

machinery, including ubiquitin and subunits of the proteasome (Sherman and Goldberg,

2001). Following the identification of parking as a causative gene in PD, a number of

putative substrates have been identified (table 1-2): CDC-rell which is thought to be

involved in dopamine storage (Zhang et al., 2000), parkin-associated endothelin-like

receptor (Pael-r) (also called GPR37) (Imai et al., 2001), synphillin-1 (Chung et al.,

2001), a rare O-glycosylated form of a- synuclein (Shimura et al., 2001), a-tubulin (Ren

et al., 2003), the p38 subunit of aminoacyl-tRNA synthase complex (Corti et al., 2003),

and synaptotagmin XI (Huynh et al., 2003). Parkin also facilitates poly-ubiquitination of

cyclin E when parking is part of a larger complex including cullin-1 (Staropoli et al.,

2003). In addition, parking has been generally implicated in the elimination of

aggregation-prone cytosolic proteins, including poly-glutamine polypeptides (Tsai et al.,

2003). Many of these parking substrates have later been identified as components of the

LBs (Murakami et al., 2004).

It is not clear why the lack of functional parking is detrimental. It may be through a

general accumulation of substrates leading to apoptosis through an unfolded protein

response (Mori, 2000) or endoplasmic reticulum (ER) associated degradation (ERAD)

and an ER stress response (Forman et al., 2003; Takahashi and Imai, 2003). It may also

be a toxic gain-of-function through the accumulation of a specific protein substrate.

Cyclin E for instance, is involved in the G1/S cell-cycle transition. When activated in









dividing cells, division ensues. However, when expressed in post-mitotic cells (e.g.

neurons) the aberrant activation leads to cell-death through apoptosis (Copani et al.,

2001; Liu and Greene, 2001), and data suggests that proteasomal processing plays an

integral part in regulating cell-cycle events in post-mitotic neurons (Staropoli and

Abeliovich, 2005).

Table 1-2. Proposed substrates of parking (Hattori and Mizuno, 2004).
Substrate Proposed function
CDCrel-1 Exocytosi s (dopamine storage?)
CDCrel-2
Pael receptor Stress in endoplasmic reticulum (unfolded protein
response)


O-glycosy ated ot-synuclein Lewy-body formation
Synphilin-1 Lewy-body formation
Cyclin E Apoptosis (kainate excitoxication)
ai/ tubulin Microtubules (assembly dysfunction)
p38 subunit aminoacyl-tRNA synthesis (protein biosynl
SynaptotagminXI Fusion ordocking, synaptic functions
Parkln- nteractlng proteins
UbcH7, UbcH8, Ubc6/7, E2
Ubc4
Actin filament Morphology
CASK/Lin2 PDZ-containing scaffolding protein
Cullin-1 Multiprotein ligase
-y-tubulin Centrosome
Rpn 10 Binding of park in to proteasomal proteins

PDZ=possynapti density-95, disc large, zonaoccbdens.


thesis)


Cyclin E has been shown to accumulate in cells due to pro-apoptotic excitotoxic

stimulus such as kainite, but parking over-expression in conjunction with a kainite regimen

has been shown to reduce apoptotic activity (Staropoli et al., 2003). In contrast, pael-R

over-expression in transgenic flies has been shown to result in accumulation and

associated cell death (Yang et al., 2003).









Interestingly, several mouse knock-out lines of parking have been constructed in

order to model PD but display no significant alteration in phenotype relative to control

animals, and the model does not recapitulate the disease progress (Goldberg et al., 2003;

Itier et al., 2003; Von Coelln et al., 2004; Perez and Palmiter, 2005). In addition,

localized knock-down of parking in the SNc using rAAV mediated ribozyme expression

indicated no cellular pathology or substrate accumulation (Manfredsson et al., 2006). In

vitro experiments, however, have shown that mutant parking expression results in an

increase in markers for oxidative stress (Hyun et al., 2002).

PINK-1 and DJ-1

Additional genes have also been identified implicating oxidative stress in some

forms of the disease. PTEN-induced kinase 1 (PINK-1), a putative mitochondrial kinase

proposed to be involved in the regulation of a mitochondrial response to oxidative stress

(Valente et al., 2004), and DJ-1, a protein thought to be involved the oxidative stress

response by acting as a cellular sensor and SUMOylation (a process similar to

ubiquitination) (Bonifati et al., 2003). Interestingly, data suggests that parking may interact

with DJ-1 during oxidative stress conditions, promoting its stability (Moore et al., 2005).

The most recent gene to have been associated with PD is leucine-rich-repeat kinase

2 (LRRK2), a protein whose normal function is largely unknown (Zimprich et al., 2004).

It has been shown that dopaminergic neurons are exposed to higher basal levels of

oxidative stress due to the metabolism on dopamine itself (Jenner and Olanow, 1996),

possibly making these cells more sensitive to a break-down in the cellular machinery

which normally protects the cell against stresses.
















DJ-1 o-synuclein UCHL1 Parkin PINK1
S/ ,.

S' I /?
I I Protein Oxidative
cross-linking !" r stress
Saggregation
SOxidativea D
Stress


V UPS



Dopamire mtDNA
oxidaton polymorphisms


DA, DA A'rA
'--- o-synuclein .

Environmental toxins ?

Figure 1-6. Convergent mechanisms of familial forms of PD (Greenamyre and Hastings,
2004).

Excess oxidative stress will, in turn, lead to increased protein damage exacerbating

the need for functioning protein clearance machinery. Furthermore, protein damage to the

proteasomal machinery itself may be an important factor. It has been shown that S-

nitrosylation of parking occurs during nitrosative stress, impairing its function (Yao et al.,

2004). Thus, although the familial forms are of distinct cellular components, the









molecular pathways may be interlocked and they may converge upon a common

downstream fate (fig. 1-6) (Greenamyre and Hastings, 2004).

Idiopathic PD

Despite insight gained from studying the familial forms of PD, researchers still

have not defined or pinpointed the cause ofidiopathic PD. However, there is a common

theme amongst the familial models which is aberrant protein folding/aggregation and

oxidative stress. One robust indicator of the involvement of oxidative stress in PD is the

detection of oxidative damage to lipids (Dexter et al., 1989), DNA (Alam et al., 1997b),

and proteins (Alam et al., 1997a). Furthermore, increased activity of superoxide

dismutase (SOD) has been reported, which may indicate as a response to increased

formation ofROS (Poirier et al., 1994). One significant unknown in PD disease

progression is the relatively specific degeneration of the nigral neurons. One answer may

be the highly reactive byproducts of DA metabolism leading to high basal levels of

oxidative stress (Jenner and Olanow, 1996), leaving the cell much more vulnerable to

only slight increases in cellular stress, perhaps mediated by exposure to pesticides,

increased levels of misfolded proteins due to mutations and so on. Furthermore,

discovery of the 6-OHDA model precipitated the finding that this toxin occurs naturally

in dopaminergic neurons as a by-product in the hydroxylation of dopamine in the

presence of iron (Blum et al., 2001). These findings are further supported by the finding

of 6-OHDA in urine of PD patients (Andrew et al., 1993). Epidemiological studies of

sporadic PD have shown increased incidence in areas with high use of pesticides and

herbicides, or the consumption of well water in industrialized countries. However, despite

intense research a common causative agent has not been found, and these studies do not









fully explain the high occurrence of the disease in other areas as well (Kanthasamy et al.,

2005).

Animal Models of PD

The lack of a true model that recapitulates all facets of PD has plagued the field.

Nigral degeneration has been achieved using various toxins such as 6-OHDA

(Ungerstedt, 1968; Sauer and Oertel, 1994), MPTP (Langston et al., 1983), rotenone

(Betarbet et al., 2000), and paraquat (Brooks et al., 1999) (fig. 1-7).

MPTP

MPTP was accidentally discovered when several drug users in northern California

developed acute akinesia following intravenous injection of the street drug 1-methyl-4-

phenyl-4-propionpiperidine (MPPP), an analog of the narcotic meperidine. MPTP was

discovered to be a byproduct of production and the causative agent behind the symptoms

(Langston et al., 1983). When administered systemically MPTP is converted to 1-methyl-

4-phenylpyridinium (MPP ) through the action of monoamine oxidase-B in glial cells or

endothelial cells in the blood brain barrier (BBB). MPP+ is a polar compound and can

freely exit glial and endothelial cells and is taken up by dopaminergic cells through the

dopamine transporter (DAT). Once inside the cell MPP+ enters the mitochondria through

diffusion and blocks the electron transport enzyme NADH:ubiquinone oxidoreductase

(complex I) (Blum et al., 2001). Although inhibition of complex I is thought to be a

major action of MPP it has also been shown to directly inhibit complexes III

(ubiquinol:ferrocytochrome c oxidoreductase) and IV (ferrocytochrome c:oxygen

oxidoreductase or cytochrome c oxidase) of the electron transport chain. Interfering with

these complexes leads to a reduction of cellular ATP, and to the generation of oxygen

free radicals and subsequent formation of hydrogen peroxide and hydroxyl radicals









(Smeyne and Jackson-Lewis, 2005). MPTP has been shown to be an effective inducer of

the degeneration of dopaminergic neurons when delivered systemically to non-human

primates and mice. MPTP intoxication in humans and non-human primates leads to a

display of many of the cardinal symptoms normally found in PD (Bove et al., 2005).

Paraquat

Paraquat (N,N'-dimethyl-4-4'-bipiridinium) is an agricultural herbicide with a

structure very similar to that of MPP+, and when it is injected systemically it causes

reduction in dopaminergic neurons and striatal innervation. The deleterious effects come

from oxidative stress due to redox cycling mediated by a cellular diaphorase such as

nitric oxide synthase yielding reactive oxygen species (ROS) (Brooks et al., 1999; Bove

et al., 2005). Combined administration of paraquat with manganese

ethylenebisdithiocarbamate (Maneb), another herbicide often used in conjunction with

paraquat, resulted in a greater effect than either of the chemicals alone (Thiruchelvam et

al., 2000).

Rotenone

Similarly to paraquat, rotenone also can be found in the environment, and is used

as a pesticide. Rotenone is a complex I inhibitor and chronic administration lead to the

selective degeneration of the SN dopamine neurons, beginning in the nerve terminals and

progressing retrogradely to the cell bodies. Unlike MPP which specifically targets

dopaminergic neurons, rotenone administration creates systemic inhibition of complex I.

Subsequent findings indicated increase in oxidative protein damage carbonylss). It has

been postulated that rotenone binding to complex I leads to the leakage of electrons from

the respiratory chain, binding to molecular oxygen leading to ROS. Furthermore, animals









treated with rotenone accumulate cytoplasmic inclusions reminiscent of LBs containing

ubiquitin and a-synuclein (Betarbet et al., 2000; Panov et al., 2005).

6-OHDA

6-OHDA has to be injected directly into the nigro-striatal circuit to create a lesion.

The ability to do a unilateral injection is advantageous in the aspect that it creates a

behavioral asymmetry which allows the researcher to evaluate the extent of the lesion by

measuring side-differences in various motor functions. 6-OHDA is an analog of

dopamine and undergoes uptake into the neuron through the dopamine transporter. When

inside the cell, 6-OHDA generates hydrogen peroxide through auto-oxidation or through

the action of monoamine oxidase with the subsequent production of toxic oxygen

radicals which are damaging to proteins, lipids and DNA and toxic to the mitochondria

(Ungerstedt, 1968; Faull and Laverty, 1969; Blum et al., 2001; Betarbet et al., 2002).

Furthermore, peroxynitrite (ONOO-) is produced from the reaction of NO and superoxide

(Ferger et al., 2001). This compound also leads to protein damage. Recent data suggest

that accumulation of ubiquitin increases in the lesioned striatum, indicating that the lesion

has an effect on ubiquitin dependent protein handling either directly or indirectly (Pierson

et al., 2005).

The extent of the lesion is dependent on the site of injection and the volume of

chemical injected. Striatal injection provides a more progressive retrograde degeneration

of the neurons in the SN occurring over several weeks.

A four-site striatal lesion has been shown to create a significant lesion with

significant behavioral impairment when measured in amphetamine induced rotations and

spontaneous paw use. This type of lesion is thought to better represent symptomatic

stages of PD, as the pathology is analogous to that of those patients (Kirik et al., 1998). In









contrast, injections directly into the SN and the medial forebrain bundle (MFB) creates an

acute degeneration within 24 hours with a subsequent depletion of striatal dopamine

within 2-3 days and a complete denervation of the nigro-striatal tract and is defined as a

complete lesion (Kirik et al., 1998; Betarbet et al., 2002).


figure 1-/. Schematic ot various toxin induced models ot PD (Schober, 200UU4).

Although these toxin induced models recapitulate a common end-stage of PD,

loss of nigral neurons, the time-course is relatively acute, and the disease progression is

not representative of that of PD.

Adeno-Associated Virus

Adeno-associated viruses (AAV) belong to the family of human parvoviruses and

contain a 4.7kb linear single-stranded DNA genome. The non-enveloped icosahedral

virion is small, with a diameter of only 22 nm. The genome consists of two genes; Rep

(replication associated proteins) and Cap capsidd associated proteins). The cap proteins









VP-1 and VP-2 are products of alternative splicing, and VP-3 a result of proteolytic

cleavage. In the viral capsid these proteins are present at a ratio of 1:1:20

(VP1:VP2:VP3). The rep gene, through the use of two promoters and alternative splicing,

encodes four regulatory proteins that are dubbed Rep78, Rep68, Rep52 and Rep40. The

virus does not encode any DNA polymerase, and is fully dependent on cellular

polymerases for genome replication (Berns, 1996). The genome also is flanked by two

145 bp inverted terminal repeats, and these palindromic structures are thought to act as

primers for replication and are required for viral packaging (McLaughlin et al., 1988).

AAV belongs to a separate genus of parvoviruses termed dependoviruses. It is

completely dependent of co-infection of other viruses including adenoviruses (Ad),

herpes simplex virus type I and II, cytomegalovirus or pseudorabies in order for

replication to take place. For instance, the Ad early gene E1A is required for AAV

transcription. In addition, the E4 and E2A genes are required for AAV gene regulation

and DNA synthesis respectively. In the absence of helper virus AAV establishes a latent

infection by entering the nucleus where the DNA is uncoated and integrated into the

cellar DNA preferentially at a site in the long arm of chromosome 19 (Kotin et al., 1990).

Upon super-infection of a helper virus the AAV genome is excised from the

chromosome, and replication and packaging of the AAV genome ensues. Viral release

occurs from helper mediated cellular lysis (Berns, 1996).

AAV Production

To render rAAV completely replication deficient, the rep and cap ORFs are

replaced with a gene expression cassette of interest, and during vector production these

proteins and helper virus elements are supplied in trans. Plasmids encoding the transgene

and Rep and Cap genes, as well as Ad helper genes are co-transfected into HEK 293









cells, allowing replication only to occur during vector production. Utilizing plasmids

expressing helper genes also ensures that the viral prep does not become contaminated

with helper viruses such as Adenovirus. Cell lysates are thereafter fractionated using a

density gradient using compounds such as Iodixanol or CsC1. The viral fraction is further

purified using column chromatography. Recent improvements in vector production

through the use of large scale cell factories and improved purification protocols has

significantly improved titers and efficiency of production, and has allowed for the

development of scalable production systems (Zolotukhin et al., 2002).

AAV as a Gene Delivery Vector

The fact that AAV is not associated with disease and that transgene expression

ensues quickly has made AAV an attractive tool as a gene transfer vector (Flotte, 2005).

Integration occurs at rather low frequency in rAAV lacking rep, and the genome is

maintained as an extra-chromosomal episome (Schnepp et al., 2005). Nonetheless,

integration is not an immediate concern since the preferential site does not cause a gene-

interuption as have been seen with randomly integrating gene-therapy vectors such as

retro-viruses (Sinn et al., 2005). However, a large fraction of the population are sero-

positive (-80%) and this issue has raised a serious concern about a immune response,

possibly rendering infections with a potential therapeutic AAV ineffective. Depending on

the route of administration some cell mediated immunity has been demonstrated. Studies

looking at levels of transgene expression in the brain of animals pre-immunized with wild

type AAV showed that transgene levels were reduced. However, transgene levels were

maintained by injecting the animal with a different serotype from that of the immunizing

agent. Furthermore, repeat administration in the brain resulted in an activation of a cell-

mediated immune response and cytotoxicity (Peden et al., 2004). Although studies like









these may not entirely mimic the levels of neutralizing antibodies in the general

population, it does pose potential problems when undertaking clinical trials using rAAV.

Recombinant adeno-associated virus (rAAV) has been used to transfer various

transgenes to different tissues in a wide variety of animals (including humans), and has

demonstrated an ability to infect a wide variety of cell types (Grimm and Kay, 2003). The

first AAV to be identified was AAV type 2 with a specific tissue tropism, AAV2

attachment is primary mediated by heparan sulphate proteoglycans, while internalization

is aided by the co-receptors, such as av35 integrin and fibroblast growth factor receptor 1

(FGFR1) (Lu, 2004). Subsequently, several other serotypes of AAV were identified, all

with distinct tropisms due to different capsid receptors.

In the brain, certain rAAV serotypes and pseudotypes (matching the genome of one

serotype with the capsid of a different serotype) have proven to be particularly effective

in transducing certain cell types. For mid-brain injections to areas such as the SN rAAV

utilizing the genome from rAAV-2 and the capsid of serotype 1 (rAAV 2/1) or 5 (rAAV

2/5) has shown to be most efficient. On the other hand rAAV2/2, although less efficient,

is relatively specific for the pars compact when targeting the SN (Burger et al., 2004)

(fig. 1-8).

However, one of the drawbacks of rAAV is the size limitation, expression cassettes

larger than 4.7 kbs have proven to significantly inhibit vector production (dong frizzell

1996). Complete genes and/or endogenous promoters often encompass larger sequences,

and as such researchers often have to resort to cDNA only transgenes and other

ubiquitous promoters. However, it has been shown that superinfection of viral particles

with different payloads allow for intermolecular recombination, an approach that may









allow the researcher to potentially overcome the limited carrying capability of AAV

(Duan et al., 2001).


A AAV1
IrV


merg


F AAV2


J


K AAV5





P Q
2OOO E 12 A
E

200000oooo 1o' 1


' Soooo -- 150000 -
|+J 100000-


/AV1 AAv3 AAV5 AAV1 AAV2 AAV5
Figure 1-8. Midbrain transduction utilizing various pseudotyped rAAV vectors. A,F,K
shows the transduction pattern of the various GFP expressing vectors. C-E,
and M-O shows the transduction (GFP) of several non-dopaminergic neurons
(shown as red TH+ cells) using AAV1 and 5 respectively. Conversely, AAV2
transduces dopaminergic neurons almost exclusively (H-J). The total number
of cells transduced (P) as well as the total trasnsduction area (Q), is
significantly higher in AAV1 (Burger et al., 2004).

Ribozymes

Ribozymes (fig. 1-9) are enzymatic RNA molecules that are involved in a number

of cellular processes. The family of ribozymes includes the ribosome and spliceosome.

Other ribozymes such as the hammerhead and hairpin ribozymes, which are derived from


GFP










plant virus satellite RNAs, are much smaller and can be engineered to cleave RNA

molecules in trans, destining the molecule for degradation.


B Target 5CAGCAIJUUCCAA 3'
RZ arms 3'GUCGUA AGGUU 5"
RZ seq 5'
UUGGAAUJ(3AUJGIAGCG(iCIJC(ljC(O C C(iOAAU
GCUG 3'

CAGCAJUUIJCCAA
GUCGUA AGGUU
A AU
G C


CCC
;-C
C-(i
G-C
G U
C U




Figure 1-9. Schematic of ribozyme binding. A) 3D rendering of the hammerhead
ribozyme (purple strand) binding to the target RNA (yellow strand), and the
location of the divalent ion (red ball). B) Letter diagram of ribozyme and
target, substitution of G to C in the catalytic core renders the ribozyme
inactive. Courtesy Dr. Lynn Shaw.

These ribozymes can be designed in the laboratory to target specific genes of

interest, and, due to highly specific hybridization dynamics, ribozymes can be created to

specifically target transcripts with single point mutations, while leaving wild-type

transcripts relatively untouched (Lewin and Hauswirth, 2001). This specificity has

allowed researchers to co-express a certain ribozyme targeting a dominant mutation

together with a "hardened target", a therapeutic gene-replacement carrying a single silent

mutation rendering it invisible to the ribozyme (Zern et al., 1999). The hammerhead

ribozyme cleaves preferentially after a NUX sequence, where X can be any

ribonucleotide except guanosine, and N any nucleotide. Flanking this cleavage sequence,

the ribozyme is designed to base-pair with the target mRNA (5-7 nucleotides). The









hammerhead ribozyme requires a divalent ion such s Mg2+ as a co-factor for cleavage to

occur. Once the correct three-dimensional conformation of the ribozyme has been

achieved and it has base-paired with the target sequences the enzyme hydrolyzes the 5'3'

phosphodiester bond at the cleavage site. The resultant products are two RNA fragments

carrying either a 5' hydroxyl, or 2'3' cyclic phosphate groups (Doudna and Cech, 2002).

The cleavage rate is relatively fast and the rate-limiting step is the release of the mRNA

from the ribozyme hybridization arms (Hertel et al., 1994). When designing a ribozyme

to target a gene (mRNA) of interest one also has to consider the local secondary structure

of the RNA, where a highly stable and folded RNA molecule can interfere with the

binding of the ribozyme. There are several structure predicting programs available such

as MFOLD (Zuker, 2003), but the ultimate efficacy of a ribozyme must be determined

experimentally (Lewin and Hauswirth, 2001).

Project

The following chapters illustrate two independent projects where expression levels

of parking in the rat basal ganglia have been modified. I will discuss the findings of a

preliminary study where endogenous parking was knocked down utilizing rAAV mediated

ribozyme expression, aiming to model the human disease. Second, I will describe the

findings of a project where animals were pre-injected with a rAAV expressing parking

prior to being subjected to a strong acute lesion of the nigro-striatal tract. Interestingly,

our results indicated a positive effect. However, our apriori working hypothesis did not

hold true as we did not rescue cells per se, but still showed behavioral improvement in

the treated animals.














CHAPTER 2
RAAV MEDIATED PARKING MUTANT EXPRESSION AND RIBOZYME
EXPRESSION TARGETING PARKING IN THE SUBSTANTIAL NIGRA DOES NOT
CAUSE DOPAMINERGIC CELL LOSS

Introduction

Background

Parkinson's disease (PD) is a very common neurodegenerative disease affecting

approximately 2% of the population over the age of 65. The disease is manifested as a

progressive loss of dopaminergic neurons in the Substantia Nigra pars compact leading

to motor deficits such as muscular rigidity, resting tremor, and slowness of, or lack of

movement. The cause of PD is yet to be determined and is probably multifactoral.

Numerous hypotheses have been put forth describing environmental toxins, oxidative

stress, and aberrant proteasomal processing, all leading to the ablation of the SN.

Recently, several familiar forms of PD have been linked to two genes involved in

proteasomal processing: Parkin and ubiquitin carboxy-terminal-hydroxylase-L1 (UCH-

Ll), as well as a-synuclein (a-syn) whose mutant version may accumulate as a result of

oligomerization and/or aberrant removal (Jain et al., 2005).

The lack of a true animal model has long plagued PD research. Several toxin

models exist, however, although causing selective degeneration of the SN, these models

may not fully recapitulate the true molecular events leading to degeneration. In addition

to toxin models (Bove et al., 2005), several knock-out and transgenic mouse lines have

been created (Hashimoto et al., 2003).









Parkin Animal Models

A number of groups have reported parking knockout and parking mutant transgenic

mice (Goldberg et al., 2003; Itier et al., 2003; Von Coelln et al., 2004; Perez and

Palmiter, 2005) with varying results (table 2-1). Most striking is the lack of a distinct

phenotype that one would predict in terms of modeling a human disease gene. One parking

knock-out line describes a slight increase in extra-cellular dopamine in the striatum, but

with no pathology or accumulation of parking substrates. However, when measuring the

synaptic response of striatal medium-sized spiny neurons (target of nigral dopaminergic

projections), the current required to evoke action potentials synaptically in parkin-/-

neurons was significantly higher (Goldberg et al., 2003). A parking knockout by Itier et

al., again showed no pathology. However, DAT and VMAT2 levels were significantly

reduced in the striatum of mutant mice when measured by western blots. Again,

dopamine levels were slightly higher in certain regions of these animals (Itier et al.,

2003). Another parking deficient strain created by Dawson and colleagues displayed a loss

of neurons in the locus coeruleus (another region that display some cell loss in PD).

There was, however, no alteration in dopamine levels in these animals (Von Coelln et al.,

2004). A fourth knock-out line has been evaluated in great depth, and the investigators

found very little differences when evaluating parking knock-out in two different

backgrounds (Perez and Palmiter, 2005).

Although the results of the various parking KO's are varied, 3 of the groups report

some form of alteration in dopamine or dopamine metabolism. Increase in DOPAC

formation by MAO (an enzyme considered mainly intraneuronal) as opposed to 3-MT

formation by COMT (this enzyme is mainly extraneuronal) suggests that parking











dysfunction maybe demonstrated in impairment of release of dopamine and increased


intraneuronal metabolism (Goldberg et al., 2003).


Table 2-1. Comparison of parking mouse models. (Perez and Palmiter, 2005).
Itier et al. (1) Goldberg et al. (2) von Coelln et al. (3) Perez and Palmiter
Exon targeted 3 3 7 2
Targeting approach Pgk-neo' EGFP and Pgk-neor Cre-mediated deletion Polr2a-neo'
Allele tmlRoo tmlShln tmilnTmd tmlRpa
Strain tested B6:129S2 B6:129S4 B6:129S7;129S4 B6:129S4 and 129S4
General
Body weight Decreased (1-16) Decreased (1-12) No difference Decreased* (6; not 3.12,18.22)
Body temperature Decreased (4) No difference (3.22)
Adhesive-removal test Deficit (2-4.7: not 18) No difference (19)
Acoustic-startle test Decreased amplitude (9) Increased sensitivity (12-15)
Motor
Open-field Reduced (6) No difference (6,12,18) No difference (18) Increased (12; not 3,6.18-22)
test/locomotion
Amphetamine response Reduced (6) No difference (3)
Rotarod No difference (6,12,18) No difference (3-24) Increased grip (6: not 3,12.18)
Balance-beam test Deficit (2-4,7.18) No difference (19)
Cognitive
Refuse to perform tests More likely (15) No difference (3,6,12.18-22)
T-maze alternation Decreased alternation (4) No difference (12-15,20)
Neurochemistry
Striatal DOPAC/3-MT Increased (11) No difference, B6:129S4 (22)
Olfactory bulb NE Reduced (18) No difference. 129S4 (18-22)
Spinal cord NE Reduced (18) No difference, 129S4 (18-22)
Published interpretation Early signs ofparkinsonism Nigrostriatal dysfunction Noradrenergic dysfunction No robust phenotype
Cognitive dysfunction
Numbers in parentheses indicate the age (in months) of mice tested.
*B. P. Zambrowicz, personal communication.
tFindings that were not reproducible on a 129S4 genetic background.




One concern raised by the variability in these knock-out models is that the observed


differences are due to artifacts due to technical difficulties in gene targeting in mice. For


instance, one group used a Pgk-neo' cassette which can effect regulation in neighboring


genes. Furthermore, parking deficient mice were tested on a B6; 129 genetic background


which can lead to false positives depending of the segregation of genes in which strain


differences can account for differences in behavior (Perez and Palmiter, 2005).


Project

Ribozyme

In this project we evaluated whether or not spatio-temporal knockdown of parking in


the SN would result in TH down-regulation or loss of cells. By using a rAAV mediated


ribozyme expression (fig. 2-1) injected directly into the SNC we hypothesized that we









would avoid any confounding effects due to genetic variation in the strain background of

the parking deficient strains.

fl(+) origin TR
1\\ _CMV ie enhancer
%lk _Chiken b-actin promoter
1Exonl

ApR Intron

pTR-UF12 PARKING RZ131 HP
6875 bp
6875 bp ,- Parkin Ribozyme 13
Hairpin Rz
ColE o-
IRES

TR / GFP (F64L, S65T)
SV40 poly(A)
Figure 2-1. Schematic of rAAV expressing ribozyme.

The hammerhead ribozyme is a catalytic RNA molecule which can function in the

cleavage of particular RNA molecules, in this case, parking mRNA. When designing a

hammerhead ribozyme to target a certain mRNA, one must find a region in the target

containing NUX, where N represents any nucleotide, U stands for Uridine, and X may be

any nucleotide other than guanosine. The 6-8 basepairs flanking the X (which does not

base-pair with the ribozyme) on either side are then included in the ribozyme sequence to

confer specificity for the gene (Lewin and Hauswirth, 2001). Since the occurrence of the

NUX sequence will be high in any given mRNA, further analysis may be done, utilizing

various algorithms, finding the RNA regions with the least amount of secondary structure

(Jacobson and Zuker, 1993; Amarzguioui et al., 2000).









Parkin Mutants

In addition to the ribozyme injections we also treated some animals with rAAV

expressing two different mutant parking genes (supplied by Dr. Corinna Burger).

Q311 Stop (fig. 2-2) caused the translation of a truncated protein, terminating

immediately upstream of the IBR domain (Hattori et al., 1998). We hypothesized that this

construct would potentially take on a dominant negative form by binding to a specific

substrate but being unable to perform poly-ubiquitination. The second mutant was not a

disease mutant per se, but a version of parking where the start-codon was moved

downstream from that of the normal start site (named C-terminal parking .

nCl origli TR
C~C Iot amso r

-- ---E





pTRAJ F-W. I pa rkirq3 15tiop








TR

tV4O podA


Figure 2-2. rAAV expressing Q311 Stop.

Again, we rationalized that over-expressing this mutant form would potentially

bind to, and sequester, components of the proteasomal machinery, overall reducing the

level of proteasomal processing.









We successfully designed a ribozyme targeting human parking that showed strong

kinetics in vitro as well as robust knockdown in vivo. However, we did not see any

accumulation of substrate due to technical difficulties discussed below. This was the

result of an inherent difficulty with studying certain bio-molecule levels such as RNA in

the SN which became evident in our study. Proteins such as parking are ubiquitously

expressed in the brain, but the rAAV transduction pattern that we observed was highly

specific for the SNc (Burger et al., 2004), thus it became difficult to isolate these nigral

neurons, and to analyze their content without background from surrounding tissue.

Furthermore, the substrates that we analyzed showed no accumulation using

immunohistochemistry, but it was difficult to obtain a positive control for this since

expression levels of cyclin E, for instance, in normal brain tissue is very low.

Furthermore, there are no commercially available antibodies for several of the substrates,

thus we were not able to study those. Over-expression of the mutant forms of parking

showed similar results, using human specific antibodies we were able to show

transduction, but we did not observe any pathology, nor did we see any significant

accumulation of substrates.

Results

Ribozyme In Vitro Kinetics

The published parking mRNA sequence was scanned for GUC or CUC sites. The

immediate sequence surrounding the putative cleaving sites where thereafter analyzed

using MFOLD (Zuker, 2003) to find those regions most favorable to ribozyme access.

The first in vitro step was then to evaluate whether or not the ribozyme would cleave the

target (time-course experiment).






















- t


Figure 2-3. Time-course experiment of ribozyme 131. Left Image: Upper band shows the
end-labeled target RNA, and the bottom band is the product of ribozyme
cleavage. The target is almost fully depleted after -90 minutes of incubation
(time-axis left-right). Right graph shows quantification of ribozyme
cleavage.

In the time-course experiment the ribozyme is incubated with a small radioactively end-

labeled RNA molecule. The ribozyme reaction was allowed to carry on for different

periods of time ranging from seconds to a couple of hours. The amount of cleavage is

thereafter quantified to evaluate how much of target is cleaved over time (fig. 2-3).

The second step in the in vitro analysis was to evaluate the ribozymes under

substrate excess for a period of time (multiple turnover kinetic analysis) established in the

time-course where the cleavage rate is linear and no more than 10% of substrate has been

converted.

The reaction conditions were the same as for the time-course analysis, but with

increasing amounts of target (3-300pm target, 0.3pm ribozyme). Values for Vmax and Km

where obtained using Lineveawer-burke plots, and kcat was determined by the calculation:


kcat= Vmax/[Rbz] (figs. 2-4, 2-5). From these assays we chose a ribozymes cleaving parking

mRNA at position 131 for in vivo testing.


08
S0.7
U
nos


02
(11
a


2 4D W 80 100 12D 11
Time (min)




























Figure 2-4. Multi-turnover kinetic analysis. Left graph is showing a Lineveawer-burke
plot illustrating the results from the multi-turnover kinetic analysis of
ribozyme 131. Right graph shows the saturation kinetics for the same
ribozyme. The results for target 131 was: Vmax=l lm/min; Km=4.0gM;
Kcat=6.7 min1.


322 499


534 621


Figure 2-5. Comparison of Vmax between the various ribozymes tested. From these
results the ribozyme targeting bp. 131 was selected for further study.


DNA oligos encoding the ribozyme were then cloned into a rAAV cloning


plasmid, pTRUF-12. This plasmid contains an enhanced CBA/CMV promoter hybrid


driving the expression of the ribozyme followed by a self-cleaving hairpin ribozyme.


There is also an internal ribozyme entry site (IRES) facilitating the expression of the


transduction marker GFP (fig. 2-1).


aw *
OW

006

01104
0+0
OD3 J ) f=3Raf*Wt
oiw -- -098O


-4A-04 0 EJO+0 4DE-04 8.EK- 12E03 IJE-03 2lEC3
iS


Saturation Curve
90
80


50
30

20
10
0
0 5000 10000 15000 20000
Substrate (nriM)









In Vivo Expression

Ribozyme

The virus was subsequently injected unilaterally into the SNc of adult female

Sprague-Dawley rats. Five weeks post-injection the animals were euthanized and their

brains were recovered for histological examination. Laser scanning confocal microscopy

of the SNc indicate that we achieved a robust knock-down of parking using ribozyme 131

in cells that also carry the marker of transduction. There was, however, great variability

in the reduction levels in these cells. This variation in reduction is probably due to a

variation in the copy number of the ribozyme cDNA, a feature of the use of rAAV which

cannot be controlled (fig. 2-6). Furthermore, due to the nature of the SNc it is virtually

impossible to dissect out only the dopaminergic cells of this region using conventional

methods and the surrounding tissue does express equally high levels of parking.

We also recovered fresh tissue from four animals expressing ribozyme 131, and

this tissue was analyzed for parking expression using in situ hybridization as well as

western blotting. Since there are several splice variants of parking we used three different

probes when looking at the expression, figure 2-7 (top panel) shows the result of two

probes, indicating a significant reduction in parking mRNA levels. The results from the in

situ hybridization indicate a sharp reduction in parking levels in the SNc, however, when

the SN was dissected out in serial sections and parking protein levels analyzed

electrophoretically, we were not able to detect any difference between the treated and

untreated sides (fig. 2-7 bottom panel). Furthermore, there seems to be no decrease in TH

expressing cell numbers in the injected SNc, indicating that although we achieved parking

knockdown, that there was no resultant pathological effect.






























Figure 2-6. Confocal imaging of substantial nigra treated with parking 131 ribozyme. Panel
A shows the transduction resulting in GFP expression. Panel B & C shows TH
and parking expression in the ribozyme injected side respectively. Panel D
shows a merged image of all stains. Yellow arrows indicate cells that are GFP
and TH positive, but lack parking expression. White arrows indicate TH
positive cells that express GFP, but are parking positive. Panels E-G shows the
same stains in the uninjected hemisphere white white arrows indicating cells
expressing both parking and TH (Manfredsson et al., 2006).

Mutant Parkin

rAAV expressing mutant parking was injected unilaterally into the SNc of adult

female Sprague-Dawley rats. Six weeks following the injections the animals were

sacrificed by perfusion. Immunohistological evaluation indicate strong transduction for

the C-terminal parking (fig. 2-8), and a large number oftransgene expressing cells in the

case of Q311 stop (fig. 2-9). However, as with the ribozyme injections, no loss of TH

expressing cells or substrate accumulation was observed.

Discussion

In this study we utilized rAAV mediated ribozyme expression to knock down

parking expression in the rat SNc. Despite apparent robust knockdown in dopaminergic









neurons, no pathology or accumulation of substrate was observed. These findings support

the findings that no cellular pathology is observed in the parking deficient mouse strains

(Fleming et al., 2005).








I










Figure 2-7. In situ hybridization and western blot of parking in the SN. Top image shows
the result of in situ hybridization using two different probes for parking. White
arrow indicates the injected SN and black arrow the un-injected SN. Bottom
panel shows the protein levels of parking in the dissected SN by western blot.
The two lanes on the right are from the left and right hemisphere of a naive
animal. There were no observable differences in protein levels in any animal.

The fact that loss of parking in the rodent does not cause the same symptoms that are

observed in AR-JP may be due to the simple fact that there are essential differences

between rodent and human parking. Additionally, there may be redundancy in the rodent

polyubiquitination system, making it less susceptible to parking loss (Kikkert et al., 2005).

This would explain the lack of substrate accumulation. Finally, one attractive hypothesis

would be that loss of parking or expression of mutant- parking sensitizes the affected

individual to a second insult, for instance environmental stress such as pesticides.

However, when one strain of parking deficient mice was challenged with 6-OHDA, no

increased pathology was seen (Perez et al., 2005). Obviously more common











environmental toxins such as rotenone and paraquat should be tested in order to test this

hypothesis. In vitro data suggests that exposing mesencephalic primary cultures to

rotenone was more toxic in cells taken from parking deficient animals (Casarejos et al.,

2006), but this has not been tested in vivo.


c-terminal parking


i-


. ,


I
"~ q


TH


Figure 2-8. C-terminal parking dominant negative. Animals that received unilateral nigral
injections of rAAV-C-terminal parking 4 weeks previously were stained using
a human specific C-terminal antibody kindly provided by Michael
Schlossmacher (Harvard University). The top two panels show the nigral
staining for the C-terminal parking protein. No staining is visible on the other
side of the brain. Arrows point to a landmark present in all the panels. The
bottom panels show TH staining of serial sections. This figure shows that
TH+ neurons in the substantial nigra probably received the vector but there is
no loss of nigral TH+ neurons.


r
c


4 P


^ t ft
- <..
^










rAAV-q311 stop


1.~ 9
.- 4L
r -~pt.


A
H. ;-



Figure 2-9. N-terminal parking. This construct was intended to be a dominant negative by
virtue of binding to a parking substrate but not allowing binding to the poly-
ubiquitinating complex. The vector transduction is shown by immuno-
staining with an antibody raised against an epitope in the N-terminal region of
parking. As can be seen in the TH panels, there was no cell loss in these
animals which lived 6 weeks post-transduction. There was also no obvious
accumulation of cyclin E.


parking


cyclin E









cyclin E


P7









The lack of pathology when over-expressing the disease mutant and the C-

terminal form of parking could also be expected when one considers the human disease

which is a genetically recessive disease. Although we were able to show strong

transduction, especially for C-terminal parking, it is not likely that these alleles confer a

toxic gain of function.

This study also demonstrated the difficulties associated with quantitatively

demonstrating the knock-down of certain messages in the brain when the target is

ubiquitously expressed throughout the brain. It is well established that rAAV does not

readily infect non-neuronal cells in the brain, but parking is ubiquitously expressed in glial

cells as well (D'Agata et al., 2002). In such instances, alternative vectors such as

lentivirus vectors, which lack neuronal specificity, may be of better use, allowing for

knockdown in all cells of a distinct region (Trono, 2000).

The rAAV transduction pattern that we observed was highly specific for the SNc

(Burger et al., 2004), thus the parking knock-down was isolated to these nigral neurons.

Thus it became impractical to analyze the cell-specific effects by using sampling

procedures such as tissue punches due to the dilution effect from surrounding tissue.

Furthermore, the substrates that we analyzed showed no accumulation using

immunohistochemistry, but it was difficult to obtain a positive control for this since

expression levels of cyclin E, for instance, in normal brain tissue is very low.

Furthermore, there are no commercially available antibodies for several of the substrates,

thus we were not able to study those.

Our results do strengthen the indications from studying the animal models, that

parking knockdown alone will not be a good model for PD, at least not in the rodent.









Furthermore, evaluation of parking knockdown does not provide many clues of how loss

of parking actually does cause PD. One common indicator in many in vivo and in vitro

models indicates an involvement of parking in dopamine production and/or metabolism.

Parkin has been shown to enhance DAT function (Jiang et al., 2004) as well as

modulating dopamine metabolism in a neuronal cell-line by suppressing expression of

endogenous MAO. This effect was not due to enhanced poly-ubiquitination of MAO, but

rather a reduction in MAO mRNA levels, suggesting that parking may either act on some

regulatory element in transcription or have an alternative function. Parc (parkin-like

cytoplasmic E3 ligase), another E3 ligase with similar motifs to that of parking has been

shown to silence p53, not by poly-ubiquitination, but by sequestering p53 in the

cytoplasm, keeping it away from the nucleus. Interestingly, parking expression had no

effect on exogenously expressed MAO, when co-transfected into a non-neuronal cell line,

indicating that parking function may be cell specific (Jiang et al., 2006).














CHAPTER 3
RAAV MEDIATED NIGRAL PARKING OVER-EXPRESSION PARTIALLY
AMELIORATES MOTOR DEFICITS IN A RAT MODEL OF PARKINSON' S
DISEASE.

Introduction

Background

Parkin is an E3-ligase that functions to poly-ubiquinate proteins that are destined

for degradation by the proteasome (Shimura et al., 2000). Mutations in the parking gene

causes Autosomal Recessive Juvenile Parkinsonism (ARJP) which is an early onset form

of familial Parkinson's disease (PD) (Kitada et al., 1998). The idiopathic form of PD is a

common neurodegenerative disease that is clinically characterized by a number of motor

dysfunctions such as a well defined resting tremor, rigidity and slowness of movement.

Neuropathologically, PD is characterized by a progressive loss of the midbrain

dopamine (DA) neurons residing in the substantial nigra pars compact (SNc). These cells

are part of the basal ganglia circuitry and have their terminal fields in the striatum.

Furthermore, a hallmark feature of the disease is the presence of Lewy Bodies (LB)

which are intracytoplasmic eosinophilic inclusions. LBs are thought to be the result of an

active accumulation of potentially damaging mis-folded proteins (Shimura et al., 2000;

Olanow et al., 2004). Early in the course of PD, the disease can be successfully treated

by peripheral L-dihydroxyphenylalanine (L-dopa) but the effectiveness of this

pharmacotherapy inevitably wanes as the disease progresses. Therapies that affect the

ongoing neurodegeneration via interfering with the disease process would be

advantageous.









However, since the etiology of the idiopathic form of PD is not yet known, the

effort to find disease-altering therapies has been slowed. Several hypotheses to explain

the causes of PD have been put forth including: impaired proteasomal processing,

increased oxidative stress, or exposure to environmental toxins such as pesticides,

possibly leading to mitochondrial dysfunction (Sherer et al., 2002). In addition, the

discovery of parking's causative role in ARJP, the accumulation of another familial PD

gene product, a- synuclein in LB, as well as mutations in another proteasomal enzyme,

C-terminal hydrolase isozyme 1 causing familial PD (Leroy et al., 1998), have supported

the idea that aberrant proteasomal processing may lead to PD (Betarbet et al., 2005;

Cookson, 2005a). Moreover, oxidative stress, which has been reported to be exaggerated

in DA neurons may interact with abnormal protein accumulation to damage nigral DA

neurons (McNaught et al., 2002). Furthermore, parking has been shown to directly interact

with DA (LaVoie et al., 2005), and some of parking's putative substrates may be directly

toxic to DA neurons (Staropoli et al., 2003; Yang et al., 2003). Therefore, it is reasonable

to hypothesize that enhancing the function of parking might make proteasomal processing

in DA neurons more efficient thereby protecting these neurons against multifactorial

insults (Cookson, 2005b).


rAAV injection 6-OHDA lesion

I I


Rotational Behavior

Cylinder & Stepping testing

I II.


Sacrifice


Figure 3-1. Experimental design.









Project

In this study, we sought to evaluate whether enhanced levels of parking expression

during the course of a 6-hydroxydopamine (6-OHDA) lesion would alleviate the effects

from oxidative stress and rescue the cells from cell-death.

We utilized rAAV2 to deliver a human form of parking to the SNc of the rat 6 weeks

prior to a 4-site striatal 6-OHDA lesion. This lesion-model was chosen because it

provides a progressive (Kirik et al., 1998), yet complete lesion. Following the lesion, the

animals were subjected to a battery of behavioral tests which have been well

characterized for this type of lesion (fig. 3-1). Preliminary data using a weaker 2 site

lesion indicated that there was functional improvement in parking treated animals:

however, the weaker lesion yields a wide range of damage, and the variation in behavior

was too large.



Chicken P-actin promoter
CMV ie enhancer Exon 1 SV40 poly A
TR human parking gene WPRE TR

Intron



Figure 3-2. Parkin plasmid. Parkin expression is driven by a hybrid CMVie/CBA
promoter. Downstream of the parking cDNA is a cis-acting woodchuck
postregulatory regulatory element (WPRE).

Results

In order to evaluate the effects of nigral parking over-expression, we injected 2 tl of

either rAAV2- human parking (hparkin) (fig. 3-2) or rAAV2-GFP in 2 sites in the

substantial nigra in naive rats. Six weeks later, we performed a four-site 28 tg 6-OHDA

lesion that results in a near complete DA depletion of the striatum but leaves the nucleus









accumbens intact.(Kirik et al., 1998). These animals were tested monthly on a series of

behavioral tests sensitive to striatal DA-mediated motor behaviors (fig. 3-1). This

experimental layout was also duplicated for a group of animals receiving rAAV5-hparkin

or rAAV5-GFP. The rAAV5 groups, however, were evaluated only for rotational

behavior in order to validate functional improvement.

A unilateral 6-OHDA lesion leads to the depletion of dopaminergic terminals in the

ipsilateral striatum. Subsequent systemic administration of amphetamine results in the

release of DA from storage vesicles in the presynaptic terminals, and due to the

imbalance between the lesioned and non-lesioned side, rotational behavior is observed

(fig. 3-3).

Amphetamine Induced Rotations













Figure 3-3. Image of rat undergoing rotational analysis. This animal has been lesioned on
the left side and has been injected with amphetamine. Note the counter-
clockwise (ipsiversive) turning.

Measurable turning behavior requires the depletion of a significant portion of the

nigrostriatal neurons (>60%). Since the non-lesioned side contain more terminals and

thus more DA, turning behavior is ipsiversive (towards the side of the lesion)

(Ungerstedt, 1968). Fewer rotations in this test usually indicate less striatal DA depletion

(Zetterstrom et al., 1986; Hudson et al., 1993).









1400
I 1200,
S 1000
0
800 -*- parki
z 600- GFP
nr 400 i --"---.--.... .

200- 1

0
o~ ----------

4 wks 8 wks 12 weeks
Time post-lesion
Figure 3-4. Amphetamine induced rotations for rAAV2 injected group (p = 0.0015).

At 4, 8, and 12 weeks following the 6-OHDA lesion the animals were subjected to

this motor test, and at all time-points the parkin-treated group displayed a significant

improvement over the control group, suggesting increased levels of DA in the parking

treated nigrostriatal terminals (fig. 3-4). However, although there was a significant

reduction in turning behavior (67%), this still does not represent a complete rescue of

behavior as a non-lesioned animal would be expected to have no net rotations in one

direction (Kirik et al., 2000a).

Cylinder Testing

Unilateral striatal DA depletions also induce a significant asymmetry in

contralateral front limb use during vertical exploration in a spontaneous motor test that is

carried out in a clear cylinder. During the test, the animal is allowed to explore the sides

of a clear plexiglas cylinder using its front paws for support as it ambulates around the

cylinder walls (Moroz et al., 2004) (fig. 3-5).






48


I~ -























Figure 3-5. Cylinder test. This image illustrates the cylinder test. During actual testing
conditions the animal activity is videotaped in the dark.



a)
0.5



O 0.4

0.3
4-
0*



o 0.2
0
O
nE 0.1
0


Parkin GFP
Figure 3-6. Results from cylinder testing of the rAAV2 injected group. The rAAV2-
parkin treated group displayed a higher use of their contralateral paw (left bar)
as opposed to the rAAV2-GFP treated group (right bar) (p = 0.012).











At all time points in the cylinder test, the parking treated animals displayed a

significant improvement over the GFP treated animals (fig. 3-6), but again, the parkin-

treated rats only used their affected paw approximately 20% of the time whereas normal

animals would use both paws equally to explore the cylinder walls (Choi-Lundberg et al.,

1998).

Stepping Test


















Figure 3-7. Stepping test. Example of fore-hand (dragging the palm) stepping. The
lesioned animal (bottom images) display a significant impairment of the
contralateral paw. Back-hand (dragging the back of the paw) (not pictured)
stepping is generally not impaired in the lesioned animal.

The stepping test is used to evaluate forelimb akinesia that is most likely due to

rigidity of the affected limb (Olsson et al., 1995). 6-OHDA-lesioned rats display a

significant impairment of the contralateral paw (fig. 3-7), and a slight but transient effect

in the ipsilateral paw. Eight and 12 weeks following the lesion, forehand (dragging the

paw of the hand) stepping was unimproved in the parkin-treated group as compared to

controls. However, there was a slight but significant improvement in backhand (dragging







50


the back of the hand) stepping in the parking treated animals. (fig. 3-8). However, we only

observed a slight impairment in backhand stepping in the control group which is a typical

finding after a nigro-striatal lesion.


Forehand stepping Backhand stepping



S0- E t

C5 ,1 r
CIC
4 4
2- 2
'3 0
a weeks 12 weks weeks 12 weeks
Time PosL-tsion Time Poslesion
Figure 3-8. Stepping test data. There was no improvement in forehand stepping (left), but
slight improvement in backhand (right) stepping.

rAAV-Mediated Transduction

The rAAV vectors successfully transduced the DA neurons in the SNc showing

positive human parking staining (figs. 3-10, 3-23) and GFP staining (fig. 3-9). Regions

that might be related to basal ganglia function that were also transduced included the SNr

(fig. 3-23,D-E), the subthalamic nucleus (STN, fig. 3-23,A & B), and the entopeduncular

nucleus (EN, fig 3-23,A & C).




'












Figure 3-9. GFP transgene expression in the midbrain. Using immunohistochemistry
transgene expression is observed in the right hemisphere but not the left.





















Figure 3-10. Parkin transgene expression in the midbrain. Using a transgene specific
antibody, expression is observed in the right hemisphere only.

Because histological examination took place after the 6-OHDA lesion there is no

detectable parking or GFP staining in the SNc. In addition, this extensive midbrain

transduction we observed for the rAAV2 group is in contrast to that reported previously

for rAAV2 which has been shown to specifically transduce the SNc (Klein et al., 1999;

Valente et al., 2004; Mandel et al., 2006). However, in this study, we injected 2 injections

of 2 pl of high titer rAAV2 which may have lead to this extensive but atypical midbrain

transduction pattern.

Nigrostriatal DA Neurons

DA-mediated behavior is critically dependent on the integrity of striatal DA

innervation (Rosenblad et al., 1999; Kirik et al., 2000b). There was no difference in

striatal DA innervation between the parkin-treated animals and the GFP-treated rats in the

striatum (fig 3-11) or apparent differences of TH expressing cells in the SN (fig. 3-12).

In addition, all lesioned animals were evaluated for the number of TH expressing

neurons as a marker for DA neurons. The number of TH positive neurons in the SNc was

estimated using unbiased stereological estimation. Surprisingly, the number of TH

positive neurons did not differ between the two groups (fig 3-13).
for ~. rAA.- .. ..a enshw oseiiclytasue h ~ Ken ta. 99





52

.AM.













ii I-















Figure 3-11. Striatal TH immunoreactivity. Top panel shows striatal TH staining from a
representative rAAV2-GFP treated rat. Bottom panel is from a representative
rAAV2-parkin treated rat. There is no significant detectable TH staining in the
lesioned striatum with either treatment. The scale bar = Imm.

































Figure 3-12. Nigral TH staining. Top panel shows TH staining from a representative
parking treated animal at the level of the SNc. The right hemisphere is almost
completely devoid of TH+ neurons. Bottom panel shows nigral TH expression
in a GFP-treated control (scalebar = Imm).


10-


80-


60.


240

20-


01 I
Pardkn GFP
Figure 3-13. Result of TH stereology. Unbiased estimation of percent survival of TH
positive neurons indicate no benefit to survival of neurons in the rAAV2-
parkin treated group (left bar) versus the control (rAAV2-GFP) group. Data is
displayed as percent survival in the lesioned (right) hemisphere as compared
to the unlesioned (left) hemisphere.







54






i V

". MI








Figure 3-14. DAT expression in the substantial nigra. Immunoreactivity can be seen in the
left SNc, but not in the right hemisphere (lesioned side),










i- .1 *, ..





Figure 3-15. AADC expression in the substantial nigra. AADC expression is observed in
the left SNc, but not in the lesioned (right) SNc.

Thus, the behavioral recovery was not related to the number of surviving neurons.

To verify that the neurons had not simply down-regulated TH, we also looked at the

expression of DA transporter (DAT) in the SNc as well as the expression of L-aromatic

amino acid decarboxylase (AADC), another enzyme involved in the DA production

pathway. Again, these immunohistological results verified the results seen with TH in

that there was no nigral DAT (fig. 3-14)or AADC (fig 3-15) staining on the lesioned side.









Fos Expression


Three to 6 hours after the last amphetamine administration (fig. 3-1), all animals

were perfused with fixative for histological examination. This post-amphetamine time

interval allows the immunohistochemical examination of DA-mediated Fos expression in

striatum and striatal efferent structures (Graybiel et al., 1990). Fos expression in the

basal ganglia in normal animals is almost non-existent (Robertson et al., 1989).

However, after amphetamine-treatment, nuclear Fos staining is increased in the

striatum and basal ganglia nuclei in the output circuit for motor behavior (Hebb and

Robertson, 1999). Fos staining is interpreted as increased neuronal activity but its exact

function is unknown (Curran and Morgan, 1985).

Little or no striatal Fos expression was found in either experimental group (data not

shown). However, there was robust Fos expression in the GP in both treatment groups

(fig. 3-16,A-H) but no difference in the magnitude or intensity of pallidal Fos staining

between the groups could be detected. In contrast to pallidal Fos expression, Fos

expression in the parkin-transduced SNr appeared greater when compared to most of the

GFP-treated animals (fig. 3-16, I-P).

Of the 9 transduced animals in the 2 experimental groups, 2 animals from each

group could not be evaluated due to torn or missing SNr. Of the remaining animals 6/7

parkin-treated animals and 5/7 GFP-treated animals followed the pattern shown in figure

3-16. One GFP-treated rat in particular showed strong Fos staining in the SNr of the

treated hemisphere similar to the parkin-transduced animals and this animal also

displayed amphetamine-induced rotational behavior within the range of parkin-treated

rats' rotational behavior.












.."TI
A. ):... ;B;--*
i. -'".I
-
.h
?
i.
i`l
: ~
,;
;-
,o
L

II. ir:
4 T
.E i

r, I. r.


- -

'5 i


D:





~ *y


* -v-


J


, -. I. .- .
*4: "-+^+ '. --
S** .-



Figure 3-16. Activity of basal ganglia output nuclei via Fos over-expression. Fos staining
from left GP (A & E) and the right GP (B & F, treated hemisphere) from a
representative parkin-treated rat. There was no apparent difference either
between hemispheres or between experimental groups (representative GFP
treated rat C & G [left] and D & H [right]) in the intensity or frequency of Fos
staining in the GP. In contrast, parkin-treated rats tended to have greater Fos
over-expression in the SNr of the treated hemisphere (J & N) as compared to
the untreated hemisphere (I & M). This pattern of greater Fos expression in
the treated hemisphere of parkin-transduced rats was not found in GFP-
transduced rats. Thus, both the left (GFP-untreated) SNr (K & 0) and the
right (GFP-treated) SNr (L & P) displayed approximately equivalent Fos
expression. The stars in lower magnification panels (A-D & I-L) indicate the
area of magnification in the higher magnification panels (E-H & M-P). Scale
bars in A and I equal 500 [m and apply to A-D and I-L. Scale bars in E and
M = 100 [m and apply to E-H and M-P.


Nevertheless, stereological evaluation of Fos expression in the SNr counting total


Fos positive cells as well as cells with relatively high intensity of Fos expression was


* I.:


. 1


:K-
I


. "'*' .


*, _.,-

,r,









performed. The cell counts indicated that there was no difference in the number of Fos

expressing cells in-between the groups (fig 3-17).

m 100



o
0
-- 460



o 40
U

c 20

CL 0
Parkin GFP
Figure 3-17. Number of Fos expressing cells in the SNr. Stereological estimation of Fos
expressing cells did not show any difference between the two groups. Data is
expressed as ratio of Fos expressing cells in the right versus left hemisphere.

Biochemical Evaluation


Dopamine

The rAAV5 treated animals were evaluated for amphetamine induced rotations at 4,

8, and 12 weeks following the lesion. Similarly to the rAAV2 treated group there was a

significant behavioral improvement in the parking treated group (fig 3-18). The animals

were sacrificed 13 weeks after the 6-OHDA lesion and the striatum from each

hemisphere was dissected and divided up in samples to be used for biochemical

evaluation.

Using high performance liquid chromatography (HPLC) we measured dopamine

and DOPAC content of the striatum. There was a trend toward increased dopamine levels

in the parking treated animals. However, this difference did not achieve significance (fig









3-19). In addition, we also observed a trend towards increased DOPAC levels (p=0.02) in

the parking treated animals (fig. 3-24) which may indicate increased levels of striatal

dopamine or increased levels of dopamine metabolism.

1400


O
S1200
0
--


r T -Q- parking
i 800
ci 600* -----G-- GFP
800

2 400

200
tr eek4 tv eek8 vr eek12
Figure 3-18. Rotational data from the rAAV5 group (p<0.01).

100




j60-
0
4-1


20=
(_

) 60






C_ 0

parking GFP
Figure 3-19. Dopamine levels measured by HPLC. Measurements of dopamine levels in
the striatum were slightly higher in the rAAV5-parkin treated animals (left
bar), as compared to the rAAV5-GFP treated group (right bar). These results
were, however, not significant (p=0.1).

In 6-OHDA lesioned animals, the remaining cells become temporarily overactive in

terms of dopamine (Castaneda et al., 1990; Moroz et al., 2004). This hyper-activity is due

to increased post-synaptic concentration of D2 receptors which can be measured by








increased rotational behavior during the administration of a D2 agonist such as

apomorphine (Schwarting and Huston, 1996).


L R L R L R L R


STH



L R L R L R

-.. D2


Figure 3-20. Western blots of TH and the D2 receptor. Top lanes show a representative
western of TH, with varying amounts of protein levels in the right hemisphere
in different animals. Bottom lanes show a representative western blot of the
dopamine D2 receptor. Very little variation of protein levels in the right
hemisphere is seen in-between the various animals. Relative levels of protein
were measured as compared to an internal standard (p-actin) and presented as
a ratio of right/left.

We evaluated whether this receptor increase occurred at the same level in the

parking treated group as compared with the GFP group. Western analysis revealed no

significant differences of D2 levels between the groups (figs. 3-20 & 3-21).

Tyrosine hydroxylase

Samples from the striatal dissections were also used in order to evaluate levels of

TH in the striatum. Western blot analysis revealed that, as for the dopamine content, there

is a trend (non-significant) towards increased striatal TH in the parking treated animals

(figs. 3-20 & 3-22).









w 250

D 200

150
4.-

C
0 100

I 50

0
parking GFP
Figure 3-21. D2 receptor protein levels measured by western blot (p = 0.3127). Protein
levels are expressed as a ratio of right (lesioned) to left (intact) hemisphere.
D2 up-regulation was seen in the lesioned hemisphere of all animals.

S100

0 80
_J
-1-
H 60

c 40
U
.20
0)
cL 0
- O
parking GFP
Figure 3-22. Graph of striatal TH protein levels. Displayed as ratio of right (lesioned)
versus left (intact) hemisphere. The data indicate a tendency toward increased
levels of TH in the parking treated striatum (p = 0.1).



Discussion

Our apriori working hypothesis was that nigral parking expression would enhance

proteasomal processing of proteins damaged by uptake of 6-OHDA, thereby protecting

DA neurons from the toxic insult. Several lines of data suggest that oxidative stress and

aberrant protein folding/proteasomal processing is central to the molecular pathogenesis









of neural degeneration in PD (Bossy-Wetzel et al., 2004; Betarbet et al., 2005). Several

genes have been implicated in oxidative stress in at least some forms of the disease:

PTEN-induced kinase 1 (PINK-1), a putative mitochondrial kinase potentially involved

in the regulation of a mitochondrial response to oxidative stress (Valente et al., 2004),

and DJ-1, a protein involved the oxidative stress response (Bonifati et al., 2003) cause

familial PD when the gene is mutated. In addition, over-expression of some identified

substrates of parking has shown to be detrimental to cells by aggregating and inducing ER

stress (Ward et al., 1995) Moreover, it has been shown that dopaminergic neurons are

exposed to higher basal levels of oxidative stress due to the metabolism of DA itself

(Floor and Wetzel, 1998; McNaught et al., 2002), possibly making these cells more

sensitive to a break-down in the cellular machinery which normally protects the cell

against reactive oxygen species. Excess oxidative stress, in turn, can lead to increased

protein damage exacerbating the need for functioning protein clearance machinery. Thus,

although familial forms of PD are related to distinct cellular components, the molecular

pathways may be interlocked and they may converge upon a common downstream fate

(Greenamyre and Hastings, 2004; Cookson, 2005a).

Indeed, in previous studies over-expression of parking has proven to be

neuroprotective against various insults that may be related to the cause of PD. For

example, the use of parking over-expression has also been shown to protect cultured cells

against apoptosis induced through the over-expression of various protein substrates such

as cyclin E and pael-R (Staropoli et al., 2003; Yang et al., 2003). In vivo, lentiviral parking

over-expression has been shown to protect transgenic mice from pathology associated









with an mutant a-synuclein (Lo Bianco et al., 2004) and rAAV-parkin has been shown to

protect nigral neurons from rAAV-a-synuclein over-expression (Yamada et al., 2005).

Furthermore, we had preliminary data that agreed with this hypothesis. We

performed a previous experiment using identical experimental groups and rAAV nigral

transduction procedures to those reported here, but 6 weeks following vector

administration, we administered a less potent striatal 6-OHDA lesion (2 site x 7 gg each

site). In general, while the parking treated rats showed better motor performance in this

preliminary experiment, this 6-OHDA lesion did not lead to consistent behavioral deficits

in the control group and the functional improvements in the parkin-treated group did not

reach statistical significance. However, there was greater DA nigrostriatal integrity in the

parkin-treated rats in this preliminary experiment (data not shown).

The present results, obtained after a more extreme 6-OHDA, clearly show a parking

mediated functional effect. Normally, reductions in amphetamine-induced rotational

asymmetry would indicate improved DA release in the lesioned striatum (Zetterstrom et

al., 1986). In this experiment, there was a stable 67% reduction in amphetamine-induced

rotational behavior in parkin-treated rats. Similar partial rescue was also seen when

assessing spontaneous limb-use in the cylinder test. However, similar to the amphetamine

data, the animals still display a significant amount of lateral bias in the cylinder test and

essentially no improvement in forelimb akinesia as measured by forelimb stepping

indicating partial recovery from the 6-OHDA lesion. The lack of improvement in

forelimb akinesia (stepping) is consistent with partial parkin-mediated functional

improvement because recovery in the stepping test appears to require a higher level









nigrostriatal integrity for behavioral improvement to occur (Bjorklund et al., 2000;

Georgievska et al., 2002)

Unexpectedly, our data do not support our primary hypothesis, i.e., parking over-

expression did not lead to improved DA neuron survival or striatal TH+ innervation.

Nevertheless, there are still several hypotheses that may account for the observed

functional improvement in the parkin-treated rats. First, rAAV-mediated nigral parking

over-expression may have saved the dopaminergic cells but they no longer express their

dopaminergic phenotype as assessed by TH staining. To evaluate this hypothesis, we

examined two other nigral DA neuronal markers, DAT and AADC, which also indicated

that the TH+ nigral neurons were killed by the lesion. Thus, it is unlikely that the

functional data are explained by enhanced survival of DA neurons in the parkin-treated

groups.

Second, since there was no difference in the number of surviving dopaminergic

cells between the two groups, the surviving cells in the parking treated SNc either produce

more DA, have an altered metabolic state, or are more efficient in DA recycling.

Improved function of remaining parkin-transduced nigral neurons may be the direct result

of parking acting on a specific substrate. For instance, some data suggest that parking is

involved in the maintenance of the DAT. By targeting misfolded DAT for degradation,

parking serves as to enhance DAT function by concentrating the number of correctly

folded receptors at the membrane surface; consequently, significantly enhancing DA

uptake and improving the efficiency of DA transmission (Jiang et al., 2004). On the

contrary, if enhanced striatal DA function occurred in parkin-treated rats, then DA

stimulation of supersensitive DA receptors would be expected to be detected by enhanced









Fos staining in the lesioned striatum. This effect was not found in this study, thus

enhanced DA release is an unlikely explanation for parking over-expression induced

behavioral recovery. However, we did see a trend toward increased striatal dopamine

levels in the parking treated group, but this data did not yield significance. Parkin is also

believed to be involved in upstream regulation of MAO expression, decreased MAO

levels would in turn lead to decreased metabolism of dopamine (Jiang et al., 2006).

However, we did not observe any differences in the metabolite DOPAC (data not shown).

Furthermore, recent results suggest a relation between parking and altered DA

metabolism; evaluation of pael-R knockout mice showed that these animals displayed

lower levels of striatal DA with no anatomical deficit. The knockouts also proved

resistant to MPTP toxicity (Marazziti et al., 2004). In addition, although the effects of

parking knock-out in the mouse are unclear, several groups have reported altered DA

metabolism in lieu of any histological effects e.g. (Sherman and Goldberg, 2001; Itier et

al., 2003; Perez and Palmiter, 2005). One group has reported a loss of DA transporter

protein levels in the striatum with a resultant loss of amphetamine induced locomotor

activity (Itier et al., 2003).

Third, the observed protection in our study may also be due to a general

enhancement of proteasomal processing, thus keeping the surviving nigral cells at a

"healthier" state. If the levels of damaged and unfolded proteins are allowed to escalate in

the cell, unfolded protein responses are activated where translational suppression and

altered metabolic state, such as translational suppression, may occur (Moore et al., 2005;

Xu et al., 2005).










AX












F I ~, -.
*n '' ?;




I,-./



Figure 3-23. Characterization of rAAV2 mid-brain transduction. A. Human specific
parking staining at the level of the STN and EN. The large arrow shows the
STN and the area of enlargement in (B). The small arrow points to the EN and
also shows the area of enlargement shown in (C). Only the right hemisphere
is transduced. The scale bar equals 1mm. B. High magnification of parkin-
transduced neurons in the STN. The scale bar equals 50 im. C. High
magnification of parking transduced neurons in the EN which is the equivalent
of the GPi in humans. The scale bar equals 50 im. D. Parkin-transduction at
the level of the SNc. The white arrow indicates the area of enlargement shown
in (E). The scale bar equals 1 mm. E. These sections were taken from animal
12 weeks post-6-OHDA lesion and there is an absence of parking staining in
the SNc. There is robust staining in the SNr just dorsal to the cerebral
peduncle (cp). The scale bar equals 50 im. F. GFP staining at the level of the
SNc showing GFP-transduction. Only the right hemisphere is transduced. The
white arrow denotes the area of enlargement shown in (G). The scale bar
equals 1 mm. G. GFP+ neurons in the mid-brain just dorsal to the SNc. There
were no detectable GFP+ neurons in the SNc due to the 6-OHDA lesion.
Scale bar equals 50 im.

Fourth, we observed rAAV-mediated parking over-expression in functionally

significant midbrain nuclei that are related to basal ganglia motor output such as the SNr,

the STN, and the EN. The present data cannot rule out, nor support, the possibility that

parking over-expression generally improves the function of the neurons in these output









nuclei in a manner that allows partially normalized motor output. If true, this result is of

potential importance for therapy of late stage PD, when few cells are left to rescue in the

SNc.

LO
( 100

8 80

06
0
4--
4 40
0

2O


parking GFP
Figure 3-24. DOPAC levels in the striatum. Levels are displayed as percent of the right
versus the left hemisphere (p=0.02).

It is also important to point out that this lesion represents a very strong acute toxic

insult to the cells and does in no way represent the temporal resolution of oxidative stress

a PD affected individual may experience throughout nigral degeneration. Thus, although

we only observe partial functional recovery in our treated animals, parking

supplementation may prove more efficacious in animals with weaker lesions that result in

stable functional deficits.

In conclusion, we have demonstrated that rAAV mediated parking over-expression

is partially protective against functional impairments in the 6-OHDA lesion, with no clear

neurobiological correlate. These results are important because it is still largely uncertain

through what mechanism the loss of parking in PD causes disease, and here we solidify the

hypothesis that parking can confer enhanced protection in a state of elevated oxidative






67


stress, levels that in affected individuals may be also be enhanced due to exogenous (i.e.

pesticides) or endogenous (i.e. DA metabolites) factors.














CHAPTER 4
DISCUSSION

Summary

In the previous chapters I describe the effects of interfering with endogenous

parking, as well as over-expression of parking during a toxic insult. Our results from the

ribozyme mediated knock-down indicated no cell-loss, or no accumulation of substrate as

a result of reduction in endogenous parking. However, we were not able to efficiently

isolate transduced cells in order to quantitatively evaluate the level of knockdown and to

detect any individual differences in transduced cells. Similarly, over-expression of mutant

parking gave us the same results, with no observed pathology.

Conversely, using over-expression of normal parking during an acute toxin-

induced model of PD, we did see a significant sparing of behavior when evaluated in the

cylinder-, and amphetamine induced rotation paradigm. Interestingly, the resultant

behavior was not due to rescue of dopaminergic neurons during the lesion time-course.

Instead, the behavioral improvement comes from some, yet undiscovered, result of parking

over-expression. We performed our parking pre-treatment model in triplicate (with some

variation), and we did observe the improvement in behavior in all three groups.

Dopamine and Behavior

One important consideration when evaluating our results in the parking over-

expression/6-OHDA paradigm is to consider the amplitude of observed behavior. Even

though we showed partial recovery in behavior in two behavioral tests, it is important to

note that the animals are still significantly impaired. In the amphetamine-induced rotation









test, a normal animal, over a period of time, should display no bias in turning behavior

(Kirik et al., 2000a). Similarly, in the cylinder test, an intact animal should use each paw

approximately 50% of the time (Choi-Lundberg et al., 1998). If our hypothesis that we

improved dopamine production/storage/reduced metabolism holds true, how much more

dopamine results in this behavioral respite? And how much more dopamine is required

for full behavioral recovery from the lesion? Does the difference in dopamine levels that

we observed, correspond to the reduced number of rotations? Previous studies suggest

that a 40-50% reduction of rodent striatal dopamine levels, and 30-50% loss of nigral cell

bodies is required for the observation of rotational asymmetry (Przedborski et al., 1995).

6-OHDA Lesion

As described in the previous chapter, preliminary studies using parking over-

expression to protect against the 6-OHDA lesion, we used a milder two-site striatal

lesion. Those data indicated behavioral improvement in the treated animals similar to the

subsequent studies. However, since these smaller lesions results in a smaller loss of

dopamine, potentially at the threshold for behavioral asymmetry, the variation in the

animals was very large. In contrast, the four site lesion utilized represents a very strong

and relatively acute insult to the nigro-striatal tract (Kirik et al., 1998), and maybe too

strong for researchers to be able to evaluate the true benefits of enhanced proteasomal

processing as a potential therapeutic agent. Subsequently, parking over-expression should

be evaluated in other toxin paradigms such as rotenone and MPTP, which have different

temporal resolution in their toxicity (Schober, 2004).









Loss of Parkin

The data from our parking knock-down experiment further validates the results from

parking deficient animals, which display varying mild phenotypes, but no cellular

pathology (Goldberg et al., 2003; Itier et al., 2003; Von Coelln et al., 2004; Perez and

Palmiter, 2005). It also tells us that, at least under normal conditions, cells are not

sensitive to reduced dosing of parking. Furthermore, AR-JP is an autosomal recessive

disease and expressing a disease mutant together with the wild-type gene did not interfere

with normal cell function. This brings up the question of why loss of parking function

causes PD. One theory that agrees with that of the environmental oxidative stress theories

is that loss of parking function simply sensitizes the cell to further stress, or parking may

simply be integral to the survival of the cells that are continuously exposed to the high

levels of oxidative stress in dopaminergic neurons (Jenner and Olanow, 1996). What

makes AR-JP unique in comparison to idiopathic PD is the early onset and the lack of

LB's in the vast majority of cases. In vitro data from aggresome (localized accumulation

of misfolded proteins thought to be analogous to in vivo inclusions such as LB's

(McNaught et al., 2002) studies has shown that these are often situated at the microtubule

localization organization center (MLOC), indicating that these formations are the result

of active transport, thus an active protective effort of the cell to localize and sequester

misfolded proteins and the enzymes required to degrade them (Kopito, 2000). The lack of

LBs in parkin-associated disease suggests that parking somehow is involved in this

activity. However, does this mean that the disease causing event is the lack of LB

formation, or is it the specific accumulation of a substrate that is detrimental and leads to

disease?









Evaluating the parking disease mutant Q311 Stop we again observed no cellular

pathology. This result is in line with the fact that two copies of this allele is required for

disease to occur. However, considering the model of parking function as an E3 ligase it is

puzzling that these forms of the protein do not create a dominant effect. One could

hypothesize that disabling parking from targeting its substrates to the proteasome would be

detrimental to the cell by sequestering mis-folded proteins away from wild-type parking.

Since this is not the case, one may speculate that parking is reliant on other proteins as

well in its association with substrate recognition and proteasome targeting. Experiments

have shown that in certain instances parking works in concert with other protein

complexes. For instance, parking has been shown to function in a multi-protein ubiquitin

ligase complex that includes the F-box/WD repeat protein hSel-10 and Cullin-1, targeting

cyclin E as a substrate for degradation (Staropoli et al., 2003). Heat chock protein 70 (hsp

70) has been shown to bind to parking, and inhibit its activity. This is thought to be a

silencing effect of proteasomal processing at times of low levels of unfolded protein

stress (UPS) and higher levels of inactive hsp70 in the cytosol. However, a protein

termed CHIP carboxyll terminus of the Hsc70-interacting protein) been shown to

enhance parking function by two different mechanisms: by promotion of hsp70 release

from parking, as well as by enhancing parking's ubiquitination activity acting as an E4

ligase (Imai et al., 2000; Imai et al., 2002). These data indicate that parking's role in

targeting proteins for degradation may not be clear-cut, and that a mix and match

situation exists where various proteins can form a complex, and the composition of the

complex dictates the target substrate specificity. Furthermore, data suggest that parking

may also have other functions. Parc, a protein similar in functional domains to parking,









was found to be important in the regulation of the cellular localization of p53 and in its

function. If Parc is inactivated, p53 localizes to the nucleus and subsequently activates

transcription. In this paradigm, Parc does not confer an enzymatic activity, but simply

functions as a cytoplasmic anchor for p53-associated protein complexes (Nikolaev et al.,

2003).

Parkin and Dopamine

Despite the lack of cellular pathology in parking deficient animal models, several

groups indicated various aberrations in dopamine levels and metabolism. Since the parking

deficient animals often displayed higher levels of striatal dopamine it is plausible that one

function if parking is to somehow regulate dopamine production and/or metabolism. One

piece of data suggests that parking does so by enhancing extra-cellular dopamine

sequestration by increasing the amount of correctly folded DAT on the surface,

presumably through its E3 ligase activity (Jiang et al., 2004). The DAT is dependent on

oligmerization in the ER, and incorrectly folded or glycosylated DAT is retained in the

ER until it is degraded (Sorkina et al., 2003). The study of parking knockout mice supports

this notion by showing increased extra-cellular dopamine (Goldberg et al., 2003), and

DAT expression is significantly reduced in the striatum (terminals) (Itier et al., 2003).

The interpretation of these data is confusing: increased reuptake would presumably

increase the levels of intracellular dopamine metabolites, leading to increased levels of

oxidative stressors. However, loss of parking also reduced levels of VMAT indicating that

parking may be integral to vesicular uptake of parking as well, the resultant effect being

lower intra-, and extra-cellular levels of dopamine and more efficient transmission. On

the other hand, increased reuptake of dopamine may also enhance precision of dopamine

signaling and improve the recycling of dopamine. Furthermore, reduced extra-cellular









dopamine would lead to a decrease in metabolites that may act on surrounding cells (Itier

et al., 2003).

Data from one model also indicate that parking may be involved in regulating levels

of MAOs (Goldberg et al., 2003). The result would be increased dopamine levels, but

also decreased amounts of metabolites. Again, the result would be lower levels of

oxidative stress and increased dopamine transmission, and this function of parking may

potentially be analogous to that of Parc (Jiang et al., 2004).

Our biochemical data indicate that there may be increased levels of striatal TH and

dopamine in the treated animals, there was, however, a large variation in our results, and

this finding may not be enough to explain our resultant improvement in motor behavior.

However, further comparing the rotational behavior to dopamine or TH levels in

individual animals (fig. 4-1) implies that the reduction in rotations may be due to

differences in TH and dopamine levels.

Parkin Over-Expression and Therapeutic Potential

Since the loss of parking causes PD, a simple approach would be to do a gene-

replacement approach by utilizing some form of gene delivery vehicle to deliver a

healthy allele. Unfortunately, such an approach would not be simple; Onset of symptoms

in PD is usually presented when a significant portion of the SNc is gone resulting in

approximately 70% decrease in striatal dopamine levels (Bernheimer et al., 1973). Thus,

if one aims to prevent the disease from onset, one would have to genetically screen the

population in order to identify patients. Furthermore, since parkin-associated disease

represents a small portion of total cases, few would benefit from this treatment. However,

given parking's indicated involvement in maintaining dopamine levels, post-threshold

patients could potentially benefit from such a treatment.











Rotations Vs. dopamine levels
4500-
4000-
3500-
3000 -
2500-
2000-
1500-
1000-
500- *

-.2 0 .2 .4 .6 .8 1 1.2
Rotations Vs. TH levels
4500
4000-
3500-
3000
2500
2000-
1500-
1000-
500-

0 5 10 15 20 25 30 35 40 45
Figure 4-1. Regression analysis of total number of rotations (y-axis) versus dopamine
levels (top) (p = 0.02 R=0.65) and TH levels (bottom) (p = 0.04 R=0.55).

Given the data presented, parking may not help in reducing overall levels of

oxidative stress in a diseased state by enhancing proteasomal processing. Instead, parking

may help control motor dysfunctions by its specific activity (be it transcriptional control

or receptor enhancement) on dopamine levels in surviving cells. Such a treatment would

be synonymous to L-Dopa treatment. However, considering that the most probable mode

of expression would be from a viral genome, one would avoid on-off fluctuations

associated with side effects of L-Dopa therapy such as dyskinesias (Mercuri and

Bemardi, 2005). Furthermore, current L-dopa treatment is through oral administration,

thus systemic side effects through exposures to other organs such as the gastro-intestinal









tract and lungs are common (Zupnick et al., 1990), and would be avoided through an

intra-cranial injection. Moreover, elevated levels of dopamine in the limbic region is

associated with schizophrenia, and L-Dopa administration has been shown to induce

psychotic symptoms indistinguishable from those of schizophrenia (Jaskiw and Popli,

2004). Again, targeted stereotaxic injections into the SNc would be likely to prevent such

adverse effects. Nonetheless, the therapeutic benefits limit of parking over-expression in

sporadic PD more than likely would be beneficial for a limited period of time, as there

may not be any improvement in cell survival and the cells would continue to die. At some

point the nigral ablation would be too large and symptoms would progress.

Future Studies

Since the observed behavior was not the result of improved cellular survival in the

treated group, one may ask whether or not the lesion was a relevant factor in our study. If

our hypothesis that improved dopamine handling is the beneficial factor in our treated

groups holds true, then we should observe the same phenomenon in animals undergoing

the same viral treatment, but without a lesion. Although it is difficult to predict whether

or not we would observe any lateral bias in behavior due to increased dopamine content,

we should be able to measure this increase using HPLC analysis of dopamine levels.

Conversely, if parking improves dopamine handling, it should do so also if expression

ensues after the lesion, i.e. if we inject the animals after the lesion is performed. Such an

undertaking would also be an important preclinical study, in order to evaluate whether or

not post-threshold parking treatment would have any therapeutic effects.

However, if the lesion is an important factor in our study, and parking expression

somehow improves cellular function, this should mean that the effects of the lesion are

lingering long after the acute phase. To evaluate whether or not oxidative stress is still a









factor long after the lesion, one could simply look for markers of damage due to oxidative

stress such as nitrotyrosine and nitro-phenylalanine (Henze et al., 2005), or changes in

expression such as activation of the antioxidant response element (Rushmore et al.,

1991). In addition, other than looking at end-point tissue, it would also be interesting to

see expression of such markers at intermittent time-points, ranging from immediately

following the lesion, to hours and days following the lesion.

One observation that is inherent in our studies utilizing rAAV as a tool to express

transgenes in vivo is the apparent variability in copy numbers (viral genomes/cell) in

transduced cells. This was observed with our parking ribozyme, where cells in the

transduced region expressed various amount of marker, and we observed the

corresponding amount of knockdown. In the parking over-expression study we sought to

overcome this shortcoming by doing two injections with the same virus. We

hypothesized that by doing so we would expose each cell to more viral particles, and

provide for a greater level of super-infection maximizing our transduction efficiency. We

believe that the greater volume of injection, however, was the reason to why our rAAV2

injection displayed an atypical transduction pattern. Typically, rAAV2 injections are very

specific for SNc (Burger et al., 2004), but we observed transduction in the EP and SNr as

well. In order to fully evaluate whether or not transduction of these output nuclei was a

factor in our result, we would have to treat animals with only a single injection of rAAV2

prior to the lesion.

Concluding Remarks

Parkinson's disease is having a greater and greater impact upon society, but

research into the underlying causes of the disease has yet to find definitive answers

concerning its cause. Shortly after parking was identified to be mutated in a familial form






77


of the disease, it was identified as an E3 ligase. This finding was met with great

enthusiasm because it started to bring the field to a unifying idea, oxidative stress and

protein handling, and parking became a central entity in the field, predicted to be the

panacea of PD. However, as groups started reporting animal models that did not

recapitulate the human disease, it came clear that the picture may not be so simple. In the

end, one thing that is becoming clearer is that Parkinson's disease more likely is the result

of divergent causes, but with convergent consequences.














CHAPTER 5
MATERIALS AND METHODS

Ribozyme in Vitro Testing

Target Labeling

RNA oligonucleotides encoding the ribozymes and short RNA targets were

ordered from Dharmacon, Inc. (Lafayette, CO). Radioactive labeling of targets was done

as follows: 20 pmole RNA oligo, 50 mM Tris-HC1, pH 7.6, 10mM MgC12, 0.1 mM

spermidine HC1, 0.1 mM EDTA, 1 tl RNasin, 10mM DTT, 10 [tCi [y32dATP], 1 tl poly

nucleotide kinase was mixed in a total volume of 10 tal. The labeling was done for 30

minutes in 370C. The oligos were thereafter extracted using 100 tl

phenol/chloroform/iso-amyl alcohol and purified using a G-50 spin column.

Time-Course

2 pm of the ribozyme was diluted in 40mM Tris-HC1, pH 7.4 and denatured in

650C for 2 minutes, and cooled in room temperature for 10 minutes. To this mixture DTT

and MgCl2 was added to final concentrations of 10mM and 5 mM respectively. In

addition lul RNasin was added to the mixture, and incubated 30 minutes at 370C for 30

minutes. Finally, a mixture of labeled target (1 tl 32P-target) and excess non-labeled

target (25 pmoles) was added to the initial solution. At various time-points (0, Imin,

2min, 4 min, 8min, 16min, 32min, 64min, 128min) following the last addition, aliquots

were removed and stopped by mixing with a formamide dye mix (90% formamide, 50

mM EDTA, pH 8.0, 0.05% bromophenol blue, 0.05% xylene alcohol). The samples were









thereafter heat-denatured and by boiling for 5 minutes, and thereafter visualized on a 10%

PAGE-8M UREA denaturing gel.

The gel was dried and placed on a Phosphoimager screen and exposed overnight.

The screen was thereafter scanned in a Storm scanner (GE Healthcare, Piscataway, NJ),

and image analysis was done measuring pixel density of bands. The fraction of target

cleaved was then graphed against time. The time at which 10-20 % of cleavage was

selected for multi-turnover kinetic analysis.

Multi-turnover Kinetic Analysis

The time-course analysis is an evaluation of ribozyme activity in excess substrate

conditions. Various ratios of ribozyme to target (1:40, 1:60, 1:80, 1:100, 1:200, 1:400,

1:600, 1:800, 1:1000) were used, all reactions were done in duplicate, and the conditions

were the same as for the time-course with the with the following exceptions: When

everything except the target and magnesium was added, the mixture was incubated at

650C for 2 minutes, and room temperature for 10 minutes. The MgCl2 was thereafter

added and incubated at 370C for 10-30 minutes. Once the target was added, the reaction

was stopped using 20 k1 of formamide dye mix. 6 k1 of each reaction was run on a 10%

PAGE-8M UREA denaturing gel, and the results were visualized as described above. The

data were plotted and values for Vmax and Km where obtained using Lineveawer-Burke

plots, and kcat was determined by the calculation: kcat= Vmax/[Rbz].

Virus Preparations

Parkin

Full-length human parking was obtained by PCR from a human clone (MJF 115)

obtained from Paul Lockhart. The forward PCR primer contains a HindIII site followed

by a Kozak sequence for optimal translation immediately followed by the start codon of









human parking; hparkin fw: 5'-

CCAAGCTTCCACCATGATAGTGTTTGTCAGGTTCAACTCC-3'. The reverse PCR

primer contains the stop codon followed by an Nsil restriction site; hparkin rev:5'-

TGCATGCATCTACACGTCGAACCAGTGGT-3'. The PCR product of 1420 bp was

digested with HindII and Nsil and cloned into a HindIII-NsiI digested pTRUF20-WPRE

AAV vector (See figure 1A). The resulting clone was sequenced and the sequence was

found to be identical to MJF 115 and to the human parking Genbank sequence AB009973,

except for three changes: 1. change in nucleotide position 769 C of AB009973 to T in our

clone (causing a change from proline to serine. Serine is the amino acid present at this

position in the mouse and rat sequences); 2. nucleotide 935 T to C (silent); 3. nucleotide

947 A to G (silent). These changes are also present in clone MJF 115. The cDNA was

then cloned in an AAV backbone containing the chicken p-actin promoter (CBA) (Niwa

et al., 1991). The transgene was inserted immediately upstream from a cis-acting

woodchuck post-transcriptional regulatory element (WPRE) followed by a SV40

polyadenylation signal. This expression cassette was flanked by AAV type 2 terminal

repeats (Fig. 1A). The cDNA for the control (GFP) virus was constructed as previously

described (Burger et al., 2004), and was isolated as described in (Zolotukhin et al., 2002)

and eluted and concentrated in lactated Ringer's solution. The virus stock was at least

99% pure as judged by silver-stained SDS acrylamide gel fractionation. Vector titers

were determined by dot-blot assay as described (Wu et al., 2000) and was 1.1 x 1012

genome copies/ml (hparkin) and 1.3 x 1012 genome copies/ml (GFP).

Ribozyme

DNA oligos encoding full length parking ribozymes 131 and 534 were ordered from

Invitrogen (Carlsbad, CA). 131 sense: 5' P-AGC TTG GAA CTG ATG AGC GCT TCG









GCG CGA AA 3', 131 anti-sense: 5' P-CTA GTC AGC ATT TCG CGC CGA

AGC GCT CAT CAG TTC CA 3', 534 SENSE: 5' AGC TTG CAG TAC TGA TGA

GCG CTT CGG CGC GAA AAC AAA AA 3', and 534 anti-sense: 5' P-CTA GTT TTT

GTT TTC GCG CCG AAG CGC TCA TCA GTA CTG CA 3'. The oligos were

designed to, when annealed, create an upstream Hind III site and a downstream Spel site

for easy insertion into the AAV backbone UF12. The UF12 utilizes a hybrid chicken 3-

actin promoter/cytomegalovirus enhancer hybrid promoter driving the expression.

Downstream of the ribozyme an IRES drives the translation of the GFP transduction

marker. Immediately following the ribozyme insertion site is a self-cleaving hairpin

ribozyme, designed to liberate the transcript. To insert the ribozyme, the AAV plasmid

was digested with HindIII and Spel, treated with shrimp alkaline phosphatase, and gel

purified. 600 pm of each ribozyme strand was mixed together with 10 pl Promega

(Madison, WI) buffer E (proprietary) in a total volume of 100 pl. This mixture was

denatured at 950C for 3 minutes, and slow cooled to room temperature. The annealed

oligos were thereafter ligated into the linearized AAV backbone plasmid. The expression

cassette was flanked by AAV2 terminal repeats, and viral production was performed as

described above.

Surgical Procedures

All surgical procedures were performed using aseptic techniques and an isoflurane

gas anesthesia machine. Following anesthesia the rats received a subcutaneous injection

of marcaine at the incision site and then were placed in a stereotaxic frame (Kopf

Instruments, Tujunga, CA, USA) while continuously under isoflurane anesthesia during

the injection procedure. Injections were performed with a 10-rl Hamilton syringe fitted

with a glass micropipette with an opening of approximately 60-80 tm. The speed of the









injection was accurately controlled by an infusion pump that pushes a piston, which in

turn depresses the plunger on the Hamilton syringe.

Intracerebral Injections of AAV Vectors

Double injection in the SNc

Each injection group consisted of 9 adult female Sprague-Dawley rats, and each rat

received 2 injections in the right substantial nigra of either the GFP control virus or the

virus expressing the human parking transgene. The brain coordinates for the injections

were anterior-posterior (AP) -5.3 mm and -6.0 mm, medial-lateral (ML) -2.0 for both

injections, and dorsoventral (DV) -7.2 mm from dura for both injections. Two pl of

vector were injected per site at a rate of 0.5 al/min. Following the injection, the glass

micropipette was left in place an additional 5 minutes before being slowly removed from

the brain.

Single injection in the SNc

The injection protocol for animals treated with rAAV-parkin ribozymes or rAAV

mutant parking was the same as above, however, the injection coordinates were: anterior-

posterior (AP) -5.4 mm and -2.0 mm, medial-lateral (ML), and dorsoventral (DV) -7.2

mm from dura.

6-OHDA Lesions

Six weeks following the viral injections, all animals received four unilateral

stereotaxic injections of 7 [tg (calculated as free base; Sigma, St. Louis, MO) dissolved in

ascorbate-saline (0.05%). The coordinates were AP +1.3 mm, ML -2.6 mm; AP +0.9

mm, ML -3.0 mm; AP-0.4 mm, ML -4.2 mm; AP -1.3 mm, ML -4.5 mm. DV coordinates

for all injections were -5.0 mm. The injection rate was 1.0 [tl/min, and the micropipette

was left at the site for an additional 5 minutes before being retracted.









Behavioral Analysis

Rotational Behavior

At 4, 8, and 12 weeks after the 6-OHDA lesion rotational analysis was performed

in automated rotometer bowls (Ungerstedt, 1968). Drug-induced rotational behavior was

measured following a d-amphetamine sulfate injection (2.5 mg/kg i.p. igma, St. Louis,

MO). Rotations were measured during a 90 minute period, and full 3600 ipsilateral turns

were counted as +1.

Cylinder Test

Four, 8 and 12 weeks following the 6-OHDA lesion the animals were observed for

spontaneous front-limb use during vertical exploration and was performed as described

previously by Schallert and Tillerson (Moroz et al., 2004) During the test, the animal

was allowed to move around freely in a plexiglass cylinder until it had performed 10

rears. During this time, the animal was videotaped, and mirrors are placed behind the

cylinder to ensure full visibility of all paw placements on the walls. The video-tapes were

then scored by a blinded observer, where each paw placement on the wall was counted.

The data are presented as contralateral (in relation to lesion) paw touches as percentage of

total.

Forelimb Akinesia (Stepping Test).

Eight and 12 weeks following the lesion the animals were observed for forelimb

akinesia (Olsson et al., 1995; Schallert et al., 2000), at each time point the test was

performed for 2 consecutive days where only the second days data was collected. Briefly,

the animal was held in such a way that the lower body and the paw not being tested is

supported. The paw under observation was then dragged across a surface (90 cm) either

backhand (across the body) or fore-hand (along the body), and each step (paw lifting and









replanting) was scored. The data are presented as contra-lateral (in relation to lesion)

steps as percentage of total.

Histological Procedures

Perfusion and Tissue Processing

Twelve weeks following the lesion and 3-6 hours after the last amphetamine test,

the animals were deeply anesthetized with pentobarbital and perfused through the

ascending aorta with sterile Tyrode's solution, followed by 350 ml of ice-cold 4%

paraformaldehyde in 0.01M PBS buffer. Brains were rapidly removed and post-fixed for

4 hours in the same solution, and then transferred to a solution of 30% sucrose in 0.01M

PBS solution. Brains were cut into 40 tm thick sections using a freezing stage sliding

microtome.

Recovery of Fresh Tissue for Parkin Over-Expression Project

Twelve weeks following the lesion the animals were deeply anesthetized with

pentobarbital and decapitated. The brains were rapidly removed and placed in a block,

the brain was then sectioned coronally at the level of the cerebral peduncles. The region

posterior to the cut, containing the midbrain, was immediately placed in ice-cold 4%

paraformaldehyde in 0.01M PBS buffer and post-fixed for 24 hours. The tissue was

thereafter transferred into a solution of 30% sucrose in 0.01M PBS solution. Brains were

cut into 40 rm thick sections using a freezing stage sliding microtome. The left and right

striata were dissected from the region anterior to the cut: the left and right hemisphere

were separated, and each striatum isolated from the surrounding tissue. The striatum from

each hemisphere was homogenized and separated into two separate tubes, sample weights

recorded, and quickly frozen in liquid nitrogen. The tissue was thereafter stored in -800C

until further use.









Recovery of Fresh Tissue for Ribozyme Project

Twelve weeks following the lesion the animals were deeply anesthetized with

pentobarbital and decapitated. The brains were rapidly frozen, and sectioned into 20 .im

thin sections using a cryostat.

Immunohistochemistry

Floating sections were washed with 0.01 M PBS and then treated for 15 minutes

with 0.5% H202 + 10% methanol in 0.01 M PBS. For TH immunohistochemistry the

sections were preincubated with 3% normal horse serum (NHS) + 0.1% Triton X-100 in

0.01 M PBS, and then incubated overnight in room temperature with a 1:2000 dilution of

a mouse anti-TH antibody (Chemicon, Temecula, CA). For parking, dopa decarboxylase

(AADC), DAT, and Fos immunohistochemistry the sections were preincubated with 5%

normal goat serum (NGS), and then incubated overnight in room temperature with a

1:500 dilution of rabbit anti-dopa decarboxylase, DAT (Chemicon, Temecula, CA), 1:200

dilution of rabbit anti-Fos (Santa Cruz, Santa Cruz, CA) or a 1:1000 dilution of rabbit

anti-parkin (HP5A) gift from Dr. Sclossmacher (Schlossmacher et al., 2002). Following

the incubation, the tissue was washed and incubated for 2 hours at room temperature with

an appropriate secondary antibody directed against the species in which the primary

antibody was raised. The reactions were visualized using a avidin-biotin peroxidase

complex (Vector Laboratories, Burlingame, CA) followed by incubation with NovaRED

substrate (Vector Laboratories, Burlingame, CA). Sections were mounted on subbed

slides, dehydrated in ascending alcohol concentrations, cleared in xylene, and

coverslipped in permount.









In Situ Hybridization

Oligo Probe 3'OH labeling

Probes were ordered from Invitrogen: target site bp 88: 5' GAA GAT GCT GGT

GTC AGA ATC GAC CTC CAC TGG GAA GCC ATA GCT GG 3', target site bp 345:

5' TGA CTG CTG AGG TCC ACT CGA GTC AAG CTT CTG GGC TCC CAT AT 3',

target site bp 1412: 5' ACA CGT CAA ACC AGT GAT CAC CCA TGC AGG CTC

GGT TCC ACT CAC AG 3'.

1.0 l of probes (40ng/pl) were labeled with a-[35S] for 2 hours at 370C in 50mM

sodium cacodylate, pH 7.2, ImM CoC12; 0.1 mM 2-mercaptoethanol, 2.5 U/ l terminal

deoxynucleotydil transferase, 6 pCi/1l a[35S] dATP. The labeled probes were purified by

centrifugation using ProbeQuant Sephadex G-50 micro columns, and the isotope

incorporation was determined using a scintillation counter.

Hybridization

Prior to the hybridization reaction the sections were allowed to dry in room

temperature for several hours. 1 ml of the hybridization cocktail (50% deionized

formamide, 4x SSC, 1% Denhardt solution, 1% lauryl sarcosyl, 20mM sodium phosphate

buffer pH 7.0, 10% (w/v) dextran sulphate ) was mixed with 50 pL salmon sperm, 10 x

10-6 cpm of labeled probe, and 40 l 5M DTT. Each slide was treated with 200 Cl of the

hybridization mixture, coverslipped, and incubated at 420C for 18 hours. Following

hybridization the slides were washed as follows: 4x15 minutes in IX SSC at 550C lx30

minutes in lx SSC at room temperature, 10s in H20, 30s in 65% ethanol, 30s in 95

ethanol. The slides were thereafter dried for several hours and placed in autoradiography

cassettes together with an x-ray film (Kodak Biomax MR cat# 870 1302) and placed in

40C for 6-10 weeks when the x-rays were developed.









High Performance Liquid Chromatography

450 [l of 0.1N perchloric acid was added to one tube of striatal sample-tissue along

with 50 pl (750 ng/ml) of the internal standard dihydroxybenzylamine (DHBA) used as

the internal standard to correct for changes is tissue concentration due to sample

preparation. The sample was allowed to thaw and thoroughly homogenized using a

micro-homogenizer for 10-20 seconds. An aliquot equivalent to 3 mg sample was

thereafter transferred to separate tube containing 0. IN perchloric acid to yield a total

volume of 1 ml. The diluted sample was thereafter centrifuged at 40C for 12 minutes.

The supernatant was thereafter filtered through a nylon 0.2 micron syringe filter, and

collected into an HPLC sample vial. Dopamine and DOPAC levels were thereafter

analyzed using a C18 "Waters Symmetry column (3.9mm X 15cm), electrochemical

detection (ESA Coulochem III set up with a high sensitivity analytical cell (5011A)), and

internal standard quantitation. The assay was done on a Beckman System Gold HPLC

system. (DHBA). The flow rate was 1.5 ml/min, and the mobile phase was composed as

follows: 8.2 mM Citric Acid, 8.5 mM sodium phosphate monobasic, 0.25 mM EDTA,

0.30 mM Sodium octyl sulfate, 7.0% Acetonitrile in H20, pH adjusted to 3.5 with sodium

hydroxide and filtered through a 0.2 [m filter membrane.

Western Blotting

100 [l Laemmli sample buffer (4% SDS, 20% glycerol, 50mM Tris pH 6.8, 1X

HALT protease inhibitor cocktail (Pierce, cat# 78410)) was added to each tissue sample,

and the tissue was sonicated for 20s. Tissue was thereafter stored at -800C until further

use. Protein concentrations were estimated using the Bio-Rad DC assay (cat# 500-0120)).

2 tg of sample was mixed with the Laemmli sample buffer to yield a total volume of 30

[l. 15 tl of 3X loading dye (0.167 M Tris pH 6.8, 6.6% SDS, 0.03% bromophenol blue,