<%BANNER%>

Phase II Biotransformation of Xenobiotics in Polar Bear (Ursus maritimus) and Channel Catfish (Ictalurus punctatus)

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101219_AAAAEM INGEST_TIME 2010-12-20T00:40:00Z PACKAGE UFE0015605_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 63620 DFID F20101219_AACOWV ORIGIN DEPOSITOR PATH sacco_j_Page_004.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
9ebb29d9179fc4104a37175e754b8ced
SHA-1
8961fa2fea15911a03290e9503caff7a8757dedb
374760 F20101219_AACPDD sacco_j_Page_089.jp2
37756526131fc5714fc43c0f01a4568f
2364617139421f67c9596af4a2ad97cb33b86bc7
66209 F20101219_AACPCP sacco_j_Page_065.jp2
d23c491c368466c6cfd9f8b3fb6708e9
3ee3e5e1e5bb57274493d88ac873312189e18f9c
103632 F20101219_AACOXJ sacco_j_Page_030.jpg
241703757e419fbd894de28144843606
8b60d6ec38bb1f1e43a58871a0750ce750abb830
98316 F20101219_AACOWW sacco_j_Page_005.jpg
f7697b6ec6e2861aa3b11b4d6b786e4f
8138337cb1a50b4573c89e8e120fc0109eed9a56
718332 F20101219_AACPDE sacco_j_Page_090.jp2
f631699883559b8334a87a760f645d9b
67a60594d199f94188de3978ef6b8d9b904f78b8
107539 F20101219_AACPCQ sacco_j_Page_070.jp2
67e79e662d323a57493e05c800d76edc
33e98752a917bef65b40659a3022f0e965f2c12a
107584 F20101219_AACOXK sacco_j_Page_031.jpg
ce2be058d18b15d2dfc19e7d6a0241bc
a974cf14162a8558b2b968169add5f1f5527c13c
83254 F20101219_AACPDF sacco_j_Page_091.jp2
46ab55490e2fff2dd41f439df71499e0
e00386587fd8e65263ddcb39a895b79ee5e6928a
103623 F20101219_AACPCR sacco_j_Page_071.jp2
b6d28912971f7e7abca8fb02ddfd163d
82dc2282e6a97f26bebacc72ebbf32a7dd76b6ec
95104 F20101219_AACOXL sacco_j_Page_035.jpg
188032183d64b8ed76721aca715afa3f
7027b5d5dffa2bd88567698ddabf19bd200ee4f5
108761 F20101219_AACOWX sacco_j_Page_006.jpg
b7d9414c2a36d66d6baf52a10d89eebd
fef2347e7f833907457087d2149891278d540ddb
366726 F20101219_AACPDG sacco_j_Page_093.jp2
820a8d31bd1f5060d0aca4b92f4ea0ff
0a462b445444b7b8aa2a1df1334f1f08b3d7cf81
41039 F20101219_AACOYA sacco_j_Page_060.jpg
396ad662d3d5485c1d760753c625214d
2438631077145003e5d5873bd2f76681613ab8be
82128 F20101219_AACPCS sacco_j_Page_072.jp2
bba90cc547a8d46dfc8c492335abb78a
1a62fac2550d0b76150b98ddc53f59da2c52c285
80935 F20101219_AACOXM sacco_j_Page_036.jpg
b1f09344aefee4c05369826465477f5d
327eb55ca6c76d7fb171e24778635a76faabd365
86111 F20101219_AACOWY sacco_j_Page_012.jpg
d55b1bd4e8a6954c62a00f2f0cd123db
f86f82c1d71d5732c1b997fbb6136a664a979516
654204 F20101219_AACPDH sacco_j_Page_094.jp2
7a8436d02e5b509ac592e7c95298138f
42945cc5b71556b590b51c46c6d530d3a8f12350
79376 F20101219_AACOYB sacco_j_Page_061.jpg
04f153173d1c9b4ef2e629da2cfbf362
6f42f28a7a4b7a7fb22906919caac197eb5d4dd5
103539 F20101219_AACPCT sacco_j_Page_074.jp2
b1879d8763b272ab84e56e9b07960c77
0d9c56f8737df1cdeb94efbcb54fb19074785fc3
31129 F20101219_AACOXN sacco_j_Page_037.jpg
a588a13539ed2ff8c31f0b50d8f3216f
4046e7eb3e2d6e2588c36f0ad3ae629ad5a6c938
80242 F20101219_AACOWZ sacco_j_Page_013.jpg
be652868ac9109afa7c6c5f7a1f91fc5
645c72fdb823d0d0351a8a21d3b3243804ab2087
102333 F20101219_AACPDI sacco_j_Page_097.jp2
641f1b5ffc209edd463ea879e9e6bf1c
a21f0af3195a72ca7ce5c3e1aec524769eddbf91
74611 F20101219_AACOYC sacco_j_Page_062.jpg
fac480b4e9cb16ceaa32b80e143697fa
e101e9cde9685c0f7a313dba731113f82703a5f0
101306 F20101219_AACPCU sacco_j_Page_075.jp2
bc8656a7ae0df449c673486f0a1f9639
773d5ee1517e6e3345539a9f3842ebb88463b743
42094 F20101219_AACOXO sacco_j_Page_038.jpg
e8d9b05bd02cce0ed691e7a178bffea2
db9eb304ada8aba8edad5e59bac8bdf47c9ab1e4
90282 F20101219_AACPDJ sacco_j_Page_099.jp2
7d2e6d5b7b1cedacb30b0997303f8b23
f13ba4b5f8d86349b53f77be38aeb53764c5e2ff
75679 F20101219_AACOYD sacco_j_Page_064.jpg
7ec08a4fae420e1b937cbf73b1511ac7
11f3e40d131d36f672000461621d61a2b31c6967
112111 F20101219_AACPCV sacco_j_Page_077.jp2
24e790829d24b7cb9540c9614f8db144
64cbf61d4c4701938d5890570630b23d97ed566b
85271 F20101219_AACOXP sacco_j_Page_040.jpg
ffa28788906ca8885317286e2d58a0cc
8804f6130e6f4717cc8b4f78a8f9f40c54641e48
92486 F20101219_AACPDK sacco_j_Page_100.jp2
5eedb7a2b919759f7c6ac8f598d06f00
2bda500b0d8186c4ecdbec248e395abd89145ddd
63350 F20101219_AACOYE sacco_j_Page_065.jpg
8bf00490b3af46972cad8f2c4e34a196
b146251d142134d33a0b9e4377e29fc66780f356
77630 F20101219_AACPCW sacco_j_Page_080.jp2
5bd24303a6c6a8aec37418df43c0db47
cb22a1bd020a3ef5977d7bd57d5bc025fd1cc523
63376 F20101219_AACOXQ sacco_j_Page_041.jpg
e2d117e8b564fbe037872af5524658f3
a6aacafe4aef6d84a3be609e72b7cc4a50df9b5d
1051965 F20101219_AACPDL sacco_j_Page_101.jp2
c028937877411ce445cde03aeacb63ec
9d976270cb46e5e2235bb506418c43c4b829d72a
74415 F20101219_AACOYF sacco_j_Page_066.jpg
6771fc26bdb7b999e31ff1528f4e703f
942261a29addef10d7eb9585c80215736c4ad91d
106157 F20101219_AACPCX sacco_j_Page_082.jp2
abd5eafb81f7197191b3e982b4f9594e
0ffea664050ad72ae8608f8b7a56e0f68cc1518d
66948 F20101219_AACOXR sacco_j_Page_045.jpg
5c8ee3953dead26d15631ea31450d62e
ee418d6abc65d33f72670644215cf8cbcfa21476
113946 F20101219_AACPEA sacco_j_Page_126.jp2
d9b8bdb4a2b0f6f1040092b1d7ea4714
1742c4a29e7e0e2246df65355fc10fb2758c0a6c
1051970 F20101219_AACPDM sacco_j_Page_102.jp2
75bc1dcaa1aa8c048e4013db07618c13
5bd9603146b40163d33389ada8f4c883e44eb8d0
100417 F20101219_AACOYG sacco_j_Page_067.jpg
08c3f8f4b774e79efba674fdce898e7d
61cf62a2056217c42fea50c599fcb586220aefbd
88025 F20101219_AACPCY sacco_j_Page_083.jp2
4ca83971ac0a5b76ac24836f448fc72a
8eb1cfb5134523702498dafa13ce3945081ee2b7
100075 F20101219_AACOXS sacco_j_Page_047.jpg
b76d417ca46b91f1b5cab68e64040446
91ce1f9ac7c3d28a1d179840488ee96b8567c0c2
95557 F20101219_AACPEB sacco_j_Page_129.jp2
93990f841b9be99e7face18e9db6db6b
bacd6258a5fa33bc4c7c95b52d18d4ae5463fc20
1051951 F20101219_AACPDN sacco_j_Page_103.jp2
60c42c6e9be18b2526ea1065a11094e2
e83adeb9bb35a8b71044f369726ebb0d5946a8b1
102802 F20101219_AACOYH sacco_j_Page_069.jpg
e0751901e6729c9358d729fad1264cf5
52dee79db8a347885c8a2217fbe39d40a11768f2
109446 F20101219_AACPCZ sacco_j_Page_084.jp2
717427c2103d50b2a0017fe6bf8d139b
fccf002a333d2de7dbf44542c0305e1f54336c88
100121 F20101219_AACOXT sacco_j_Page_048.jpg
edebad61a88ef26c20d0c400ba1915b7
c2ab3cf33a6a10bfe62f3ec77831739b5edb85cd
84401 F20101219_AACPEC sacco_j_Page_130.jp2
86fe9a058f62aa7df3876ba24ca99a4d
8201c2f9cd6b4378a3495a1a7b2d3b8980740d24
481968 F20101219_AACPDO sacco_j_Page_104.jp2
2c64f0e4cea010681022dd1127234c44
6901d475c2485ea4407e5096dc8dfa9a775347e8
103700 F20101219_AACOYI sacco_j_Page_070.jpg
d77353a7fd97a4107922639dc0e1f66a
6857667731fabe6cc16f2c9dcf068141ea8a47a9
106950 F20101219_AACOXU sacco_j_Page_053.jpg
e6975958302a7a34835fc2985da9cfc8
cb559e0efb989213210c25bd24a6a86dcff23b09
88075 F20101219_AACPED sacco_j_Page_131.jp2
1b08ea59ebbacc4fdd6791ae8d9fb9bc
002390502016bd824665960ce74db09bebf1c5aa
1001861 F20101219_AACPDP sacco_j_Page_106.jp2
37d47b1b466cde02478cb9d93345169b
b208715cf64019c133dc4e2e151b62d4f1891238
93240 F20101219_AACOYJ sacco_j_Page_073.jpg
43d42d5a1cf6fd36919a180d4f9ef3b6
a281ea14d393ff7c7cc898942f2283202f3c5391
87084 F20101219_AACOXV sacco_j_Page_054.jpg
c66333189338fde70b9512af8ed4bd01
0b0f15126b0948fc7804276d8bffa98374d3dbf5
1051938 F20101219_AACPDQ sacco_j_Page_107.jp2
586838607e0c01b82c02e2ea13528ee9
50e9f4b1b0ab789791c5c7f552c9d06f237ad018
100033 F20101219_AACOYK sacco_j_Page_074.jpg
7e3686a9d763ccec4907da0fd3feb4dc
37f5f5bde2aaa630b4155d5b85a527fc2917b1a7
67266 F20101219_AACOXW sacco_j_Page_055.jpg
60f75d41d4ebc5f311c14f52c590094c
e03bcf595bcc0909edf9d8952e93360c769798e3
78585 F20101219_AACPEE sacco_j_Page_132.jp2
31a19cf5be75327df7794296184b9b1b
7a2cb333ec003a890286a7363c9790546f7d70f0
1051887 F20101219_AACPDR sacco_j_Page_110.jp2
d1d65b355c04f087ec95e5769d7ac34e
83a2f2c611d12eccbd1e1ebe91f336d32d86f0b3
96471 F20101219_AACOYL sacco_j_Page_075.jpg
ddb51c5cca3dd6c3864b30a3ca11f5f0
7fbba52f930ffc475340b3b22d2313995c972c1f
92359 F20101219_AACOXX sacco_j_Page_057.jpg
4120172a1d46178d1363e060e24a8287
b53643bd64c90b286fd9628fee5e77ac9cf5ccaf
27833 F20101219_AACPEF sacco_j_Page_133.jp2
938c5c7249283b9855d205ff12e21043
c68f73dd9ca8a18870ac98ce20938a8eb682fd49
97835 F20101219_AACOZA sacco_j_Page_095.jpg
fd867818d324ff6000ac0506e0211f38
b632ec76f58ae6e25306280f5b0e3c450e850928
1051985 F20101219_AACPDS sacco_j_Page_111.jp2
99b179a369142f5903261ca24a5689a8
144858b3ed7a863acc4e7ac6327d8c1e476a9849
101812 F20101219_AACOYM sacco_j_Page_078.jpg
47c4be00dc77b4d563f4d0e37a191346
35b9cdea376515bb6ba6bd40493abc5782a4e8f5
39206 F20101219_AACPEG sacco_j_Page_134.jp2
d4cfc50b02bef6d72b19ac919eb61248
c17ee86d6948a5b76050ed7f84957a67f0d1bde9
99063 F20101219_AACOZB sacco_j_Page_097.jpg
8607c36e6fe7f5753d49f86c8eec69be
4f44fd60db65ef9289fee8aee4688e7de7efd554
559930 F20101219_AACPDT sacco_j_Page_114.jp2
f1e070ae536bedfa909d8dfaef0f6906
b4f5ec80f41c7590b66d428b6fed6b97155ddbe2
89820 F20101219_AACOYN sacco_j_Page_079.jpg
e8a2e416f0d8533e11b2079b92d4f434
0c38f3c3da75b58a96d129d36850736c83f39303
73343 F20101219_AACOXY sacco_j_Page_058.jpg
7ea978b7a00661d4597ddea06ec2f0d9
a88069d19ac6b6a36b7da3576f38ad32f5c28f60
71888 F20101219_AACPEH sacco_j_Page_136.jp2
140c25be40dbd5aa9f1e73d44f0ff985
8cc1ec7e14f8a3993549a2790c1e1a079a7dd706
90870 F20101219_AACOZC sacco_j_Page_100.jpg
34de93f1fd39ec7f7af60984dc167df7
531b20bf8b6cc165423e247aa6c2a0f6a36c1e69
1051916 F20101219_AACPDU sacco_j_Page_115.jp2
a2dab5f0afcdb2de03dda981d2a559c5
187e70fc54e3202d4f884f95b0001c94ce199dfa
77255 F20101219_AACOYO sacco_j_Page_080.jpg
d426d6a6d0698c47605661a37b358de9
025eaef98aafa22f6d4b0ded1c2520ffe8f6d3db
38409 F20101219_AACOXZ sacco_j_Page_059.jpg
b689bdef4d6d509a0d2780e81fa495e9
d6293d3d2667205f43dea9cfbca2e2e443fdd92c
67657 F20101219_AACPEI sacco_j_Page_137.jp2
8f38071e1100b3409fadeb3f0c3282c2
4f4608a4d52366f0f09df459c7ad2fd79bfa5348
105169 F20101219_AACOZD sacco_j_Page_101.jpg
a493d873d0a469b4dd10de563180582e
9f2ff695067b09dd30beb75cd744354e01177269
527801 F20101219_AACPDV sacco_j_Page_116.jp2
5422d546c31d210e20c304d1f883e82d
819666e7c904f775ea11f9f517d30391c3fbb360
89495 F20101219_AACOYP sacco_j_Page_081.jpg
c89bc9a307f20845e4383b80fd6fd700
31a4f5211b95cacb793ee909b4b528e74b1064ab
403255 F20101219_AACPEJ sacco_j_Page_139.jp2
7806e063b163e394313d6b76027f37f8
9f1b77122dfe4a324112ecbf54c822729cf45986
101362 F20101219_AACOZE sacco_j_Page_102.jpg
0393a9490bd00092d01c2c3f48501ab0
10fd9706b6be4ea91115a5e9c070c4af6548e8ae
999469 F20101219_AACPDW sacco_j_Page_118.jp2
15dfd9e5c0e2b69197cd1d6f303bfd7f
c9620ba6b139f400a9e04df477dd2acb5aaeb418
103433 F20101219_AACOYQ sacco_j_Page_082.jpg
05106bb469fb3b15e37d0dda31414936
c19a6a958b682541cc662d934405939e0028bb66
92187 F20101219_AACPEK sacco_j_Page_144.jp2
5e1c07710a98e9718bd06ac320476ae8
4f1cabfb9b7c283aac46314b2f87c558c51bec6c
148589 F20101219_AACOZF sacco_j_Page_103.jpg
6693254e839cc10a99602240b5b3281d
5121e8f59fa4b3976d777b663ef839bdbfb4bae7
107943 F20101219_AACPDX sacco_j_Page_120.jp2
7b9c35fb0d54b86443f679b901fbebcc
9c18dfce5c0fc0458ea4d9370a5f5efd62eb3468
85150 F20101219_AACOYR sacco_j_Page_083.jpg
1c70c4f855bfda337bcc0fffb38b12e6
7d9e96cd6842beaf46b2b5778f1f37be0f31ab30
25271604 F20101219_AACPFA sacco_j_Page_006.tif
11cea9099e9d51ea387622a97af605ab
0349e3f13cffd7526d9ae581f4a4e757af95c0d1
149291 F20101219_AACPEL sacco_j_Page_145.jp2
18fed0f3c660a0fab717433ffe648ea1
382a1d0928d645b6658d043b249c73bd45e511cd
136801 F20101219_AACOZG sacco_j_Page_105.jpg
d0c140fae4c859e77f7d9653f8ce2d0e
e8438fbfe9ebe48a4f6036c10d8341566ff980d6
100158 F20101219_AACPDY sacco_j_Page_121.jp2
dca3558e316a509e8d938f3ba2514706
14ee81c3a25b9f2763b2e3f249c849ed5bade10d
107237 F20101219_AACOYS sacco_j_Page_085.jpg
1a61baa80ee91c9ed3be8ba785993d6f
10ac6edd440e810bddc2e1c68cc911c3fc2e2a2c
F20101219_AACPFB sacco_j_Page_007.tif
dc6affe39087576802a25c1ccb0a5094
7ad30999239157db22d1868aa02eb9d892a5d5e0
162829 F20101219_AACPEM sacco_j_Page_147.jp2
e714916e9c3abfb29915b5c1901915f0
04ed44475c5ff9d76353aa944d9996dd241a59fb
103039 F20101219_AACOZH sacco_j_Page_106.jpg
ef8b490412bc9964fcbc29e8f0c9bc4f
ff081533e5b05744ea2e6bb7b494a9bd2b68d758
728541 F20101219_AACPDZ sacco_j_Page_125.jp2
7028e704c43207acf45fcc6786d4c536
c86e0951ac6af786ce8f15ab7b5e038e6167e20d
25166 F20101219_AACOYT sacco_j_Page_088.jpg
1ffba6f8d6302b0c12da7beb6bec99fa
d11fb0e892c996f749379bde15d26f5627eaaf50
F20101219_AACPFC sacco_j_Page_008.tif
b9bde8ab7ff6df457fdec014e641dc40
4c8910ff50fb5ffd5c58212e26a5e402bfef7950
145139 F20101219_AACPEN sacco_j_Page_149.jp2
f8d9590781b5d70fae1138d46be25ebb
688df23e1e4d71aa81a4a7c77fccbef2c6241325
85941 F20101219_AACOZI sacco_j_Page_109.jpg
a475c88b31b6aaabc7e286fa19c92f9b
da5c717c0af43b9350c510294198baef7b51d6f7
32352 F20101219_AACOYU sacco_j_Page_089.jpg
519726f1bf9fd5edbb6aac32d3690233
9f0a4582e0906655b01804127503d8628201b408
F20101219_AACPFD sacco_j_Page_009.tif
6ad6fd61080d231d0cf16c39423beded
8e489d6dc94980eaf2282fe27c79d3f5605b48b8
1051974 F20101219_AACPEO sacco_j_Page_152.jp2
3638d228ca9715843ca8a41f283d2e94
49e24f090e399a7f248aed7580685f9cc04cca58
122725 F20101219_AACOZJ sacco_j_Page_111.jpg
1631aff145a360d6de07ffffdb522679
ae27d95c624f034ab75564f0178b54e7fa11cbd6
61363 F20101219_AACOYV sacco_j_Page_090.jpg
cbff4770a0e72d85901048f3759cb9d8
63a4a9d768306f3e3a16cf2b217ff9b60a28a886
F20101219_AACPFE sacco_j_Page_010.tif
5e7a0f8619854ffeecf355c56addfbf2
2e625a0c8704a9ff4d6a158f59bec2a10d7b83dd
118021 F20101219_AACPEP sacco_j_Page_157.jp2
2bdaed82a1a38c1f44c18fdcef20f4cf
76e676d7a8bb356f09250ce2bbb0229b4b760b60
71600 F20101219_AACOZK sacco_j_Page_113.jpg
6ea4d9edfbbac22b7d03eb238eb3a2bf
3f1f1a14800396e5822224498b89108e3e6f3482
77464 F20101219_AACOYW sacco_j_Page_091.jpg
cc3011966b4f2721a254e666c4f081e1
5cfe4c50133e5efe264794dd6937671ee6f560de
138942 F20101219_AACPEQ sacco_j_Page_159.jp2
b1c7412c15d14478f34bd4a78f31391e
76fb57f9a4749b768e780807485e0ba803c0d7f1
52244 F20101219_AACOZL sacco_j_Page_114.jpg
ac32b90aaaf752b3e46780ec5db680ce
c99d53fb1938b4cc66f93be505686f8558104432
103902 F20101219_AACOYX sacco_j_Page_092.jpg
497f4484ff03bb0c1e94b90230d28ffd
cd48f42a70373dc204885f84205fb633495921c7
1053954 F20101219_AACPFF sacco_j_Page_012.tif
5f4af8f062327b7fe495043aeffdaad1
03526a50b2d9977cd95408f53298ba0003b45347
146363 F20101219_AACPER sacco_j_Page_162.jp2
cf24841ae9403b7fd378a27b9f41a708
b53841b7ef06412846ab909d2c30de6ecdd10ab4
47417 F20101219_AACOZM sacco_j_Page_116.jpg
177a352d6d02db8f46078dca0bd096f0
1549a4b2fa106cb2477ea0b309251cb1336acc30
39442 F20101219_AACOYY sacco_j_Page_093.jpg
b55b23cff26f6832e74cc0b3f9147a28
ec329299cff5a58116ea42d5aedbb0525cb9fb8c
F20101219_AACPFG sacco_j_Page_013.tif
6d77edd71fef1e30cbd61cae5dc452ce
e83d15e6baa286192b9e890b82a850c50f3e2fc1
144617 F20101219_AACPES sacco_j_Page_163.jp2
f89179858528ee5f5c8670ea16c977f4
86eacd9ae24049c895c10a61427131f49839c43c
96835 F20101219_AACOZN sacco_j_Page_117.jpg
f0bb44615ba97bddc1a56b887c7c9c8d
c3a27cde0fc9e6a91248637df8df8ce0e7698aee
F20101219_AACPFH sacco_j_Page_014.tif
eb2bf2a08d93c2550452cbbbdef3ca14
747fd548c018c1e4ebe35693abdaf2687b3a0195
136124 F20101219_AACPET sacco_j_Page_166.jp2
67aa22dca4b8f0607e449625dfc75816
7e8c43b13f6c1bbd30a6f02cdfeda1f07ec91669
66276 F20101219_AACOZO sacco_j_Page_119.jpg
64c5e5e5999c695f59653f0d9456fd97
cfb899eb3e3858820e07b0ecd3f57e8bcfa2c814
67486 F20101219_AACOYZ sacco_j_Page_094.jpg
0b9ce230b5b10cf552637b7705782e74
53ba4275c629e435974b163f76879d663ff156b7
F20101219_AACPFI sacco_j_Page_015.tif
bf0bae1d4043e8dece944337abaafe2a
b93dcedb8706913746a0a9154960a7f056f310e3
134126 F20101219_AACPEU sacco_j_Page_167.jp2
e590a1b2f132b148a129b5637d243b27
0878cb0f9a8fbe851cda9cecaa5b29c7bff29e3e
105265 F20101219_AACOZP sacco_j_Page_120.jpg
e77b00c37869b3a5a3a462c51f1577e9
3c357282bd6285a212a780f482906915cc90a278
F20101219_AACPFJ sacco_j_Page_016.tif
b779c460f485a0fbbd7aa7396f196610
4c69e4fedcbe8b9ace90e07395280d61135a4973
148206 F20101219_AACPEV sacco_j_Page_168.jp2
3977fedd0ae32846abf9e0d5494a6808
e708e20d46e2b9a48fcfe2db3ce494f594a9e5f3
97594 F20101219_AACOZQ sacco_j_Page_121.jpg
49064cab52943e3f8672ee54ce12aadc
89a57c413459ac6daf24e9066f74be7a7a7d5d7b
F20101219_AACPFK sacco_j_Page_017.tif
9ac0b94192c219ce6448bf5df5f71267
d4175132a0ebf3f47ef0ac503fa93da66136e0bf
133633 F20101219_AACPEW sacco_j_Page_169.jp2
bda5690c339622ee8f5070bac6cbb381
2ff8ef0c3e7f9baf22d8574b8de98fb8a9372c93
106180 F20101219_AACOZR sacco_j_Page_122.jpg
1a042205573546bba399dfc3ea4ecd93
7779dd38cf17a4573ecb3733f4d980d107007b45
F20101219_AACPGA sacco_j_Page_050.tif
7170481f07adab0767001d389b138ee9
cd2c723254c32f92ec5e923c0c6f2815b2055786
F20101219_AACPFL sacco_j_Page_021.tif
7ca0e6a8023ecbf92cb0a2a89759c210
106dcce567a937c4bf0f47c44bfc99550c4d0893
65766 F20101219_AACPEX sacco_j_Page_170.jp2
603016334c4946c05efb5f574bee3bcf
384dd89bdbcf4cb97d5a129895bdee475d572203
116185 F20101219_AACOZS sacco_j_Page_123.jpg
c12e0d65e26b2c624dd4ee8d2bc650e4
5b64ecae2d4c2d3b54ec60a8cb0d5fae985b8ec2
F20101219_AACPGB sacco_j_Page_051.tif
8fdc34b369b2d2d60c20ed92848c9379
bcbe3f2320dc8859cabca985d9b741ce04592393
F20101219_AACPFM sacco_j_Page_022.tif
54ce8dccfdb40d3b29105b03ef2332f5
9710f6beff2bb9f53188e709bf809ab66475d00f
F20101219_AACPEY sacco_j_Page_002.tif
ad476ca97d4019c1cc1395866eac7d94
057f95161cb1ad473a819497e337d92ac13aaf17
77634 F20101219_AACOZT sacco_j_Page_124.jpg
ef3d616010795ab803684a08f145817f
62ada9bbafe9dd7faa0bb291d376043a8c7c8e20
F20101219_AACPGC sacco_j_Page_052.tif
1b13aae62ac4d8f01cf6d8827236df40
dcbe188773a0eb8a217eb8d0242ddcf423dc445f
F20101219_AACPFN sacco_j_Page_023.tif
72907ee7d5723ab8888c8dc58a83d6e6
72e3a5fbdd654dc57dbbfc808225a6346060f826
F20101219_AACPEZ sacco_j_Page_003.tif
b06db4601a5d16d033e7ff07be56c3f4
c74e6087b66febda8962ae0f6c85308dad121e5c
67454 F20101219_AACOZU sacco_j_Page_125.jpg
0d25cd64f53216246192bd408184d968
c219c08df4c850f4a50a6be4f8b40a23a7dbe563
F20101219_AACPGD sacco_j_Page_053.tif
12f82780cbf012583d257a6d7228a4b4
3f0775f1f6214ed72aebec243b1aaae0527fca28
F20101219_AACPFO sacco_j_Page_025.tif
94b2cb53ad361403f0c1ff16b85a4185
2f7987bb99113d9c5331144d7a25d92303bf18c3
109779 F20101219_AACOZV sacco_j_Page_126.jpg
e69f4b3b513f4e6655e4350efc49b53f
aa46a9eb2027abd41ded970f2632bdfc7f0a3c9e
F20101219_AACPGE sacco_j_Page_054.tif
9e614162b91709cc27cfa8443d26c807
903bd467205c2dab5b10540cae7ba15de0977def
F20101219_AACPFP sacco_j_Page_028.tif
9a7d9b0f6bcb035e9975812aa308df6f
bc434968b24ee3c6f8abf0eed7a9b646ce335944
90450 F20101219_AACOZW sacco_j_Page_127.jpg
1dca575f1083727bdb1290384b1542d6
ad250864dbd44a59cb8bb04cdcb1a22e07b4453d
F20101219_AACPGF sacco_j_Page_056.tif
542e448e73d8be7b8f96b14f7358938c
768746d3fdc5798a94266b2fccae9f6b23976c1e
F20101219_AACPFQ sacco_j_Page_031.tif
2d021cc0b2a38ffa1bf53f2a58828282
42a0d751efa77dfba5d32451b9616994985ee950
85429 F20101219_AACOZX sacco_j_Page_131.jpg
485774888ccccc1a9ac5d09ac02b2184
ac47f1c52fb9fb0492cc557926189e133686462c
F20101219_AACPFR sacco_j_Page_035.tif
32f72bef2ba9ae352071fc56fb0f6b9d
950f4fe410391b7c9b0a56992abcace327a46477
78206 F20101219_AACOZY sacco_j_Page_132.jpg
a0f717f95e6162ef273dd3f62822820d
d26bc49f2376858d7c6aff720fa507524e6fe5bc
F20101219_AACPGG sacco_j_Page_057.tif
5dae4c99ead81c20f940e49fb89b5fa8
55339e446303bec508e95b704a518064e93f3229
1054428 F20101219_AACPFS sacco_j_Page_037.tif
48f67c801ddf12f3db4f8a934126cb5a
d6cd19575397420ea5e4e9c2b7887cc44feb4b22
F20101219_AACPGH sacco_j_Page_058.tif
021dbd1cd8070fdcff00629101827a84
39c833f9fe13c5638a8a92eef215ead494f18462
F20101219_AACPFT sacco_j_Page_041.tif
2a0315cba87787bcb6aeaa6202bcf8c3
378e2b3e73ab1051919dc0a582a0a359e898bc03
29217 F20101219_AACOZZ sacco_j_Page_133.jpg
c32639cf908b813bf31f8a9e3ed771fb
55f9baac95cb5ade33c10f52961b7568bfff1f20
F20101219_AACPGI sacco_j_Page_059.tif
3426c8bfdfc7b23c74c28132aec1f2e5
fef58193c85472daf3e3152f138a6c745e4fa167
F20101219_AACPFU sacco_j_Page_042.tif
001075dbf05bdea158986fe463021dc0
d891e029831f0d3b23c3637f2efd9a64069d1905
F20101219_AACPGJ sacco_j_Page_060.tif
d8c6e36b57f8800adaa4e448ed23b729
840bc8a15f5450c1725df62925a11bb2dd62fa85
F20101219_AACPFV sacco_j_Page_044.tif
e1515affdda102fefc68c64c99270a9d
72663ed1d06c6146873e3bcb97f3fbeb3dbfd5d8
F20101219_AACPGK sacco_j_Page_061.tif
77a0b8eb39a37d813ca634ba8b649a48
483583e52de4252f71ba63f8e271371844063661
F20101219_AACPFW sacco_j_Page_045.tif
463ae3d28867d51fa55af44f5fbea0bc
49546e436cbc47379b595eeff0dd1d43747b9262
F20101219_AACPGL sacco_j_Page_062.tif
2b932d146918cef5e374cb6b3102d286
e8b8a917edf13ce66b589ef98c664ad4ee9896d9
F20101219_AACPFX sacco_j_Page_047.tif
b0a8adaef750bee713f09e395a7eed4b
8899afd7e44f0147ee61d5206ae180f68d1bb142
F20101219_AACPHA sacco_j_Page_084.tif
1381d07a556295cc60c9cda2206ae98e
9e94a5863bcaece85c99e14bf6ecd7c851824028
F20101219_AACPGM sacco_j_Page_063.tif
eb6cc48a3836ff9abb5ae6ff57709d4e
a436a9d4189b43a66f43e690773dfa55da98f90b
F20101219_AACPFY sacco_j_Page_048.tif
8618a065e8dceedc986ce4f5ead08ac8
ca67558cdb3b73c0524a17176cc7412cd237808f
F20101219_AACPHB sacco_j_Page_086.tif
61bcc63332055bfe3a6fa0db3d1e60db
6ad940121508723de0622999e0271011399c7d2d
F20101219_AACPGN sacco_j_Page_065.tif
f365c415e2f48325a6ab85a871414b9f
d59a335f23860260725c5e1304f81f6c97a8e388
F20101219_AACPFZ sacco_j_Page_049.tif
b34e40ef9c9a99f74ce29244bb9268bf
c4be875417baec7fb02d697ebbbb48c20c2710a3
F20101219_AACPHC sacco_j_Page_087.tif
95b272efdf5bb52d2e6c3f1cb0dae701
f36457da1c954a3a5cde369a19d3892b1dac2161
F20101219_AACPGO sacco_j_Page_066.tif
5f6069a3adbecec453382e58a036176a
8e73d7321d8119d9894ebb5926f472885a32cd89
8423998 F20101219_AACPHD sacco_j_Page_088.tif
479902cd2690a60af0bfa81bcee2ab1e
3f1c9c8ddd228b6f4469d9f5f4f0dcea7556a447
F20101219_AACPGP sacco_j_Page_067.tif
5a7eab52e935c659ac1824cff3f2c511
56deeccc7a46d360d5a13b17264771d91c58a135
F20101219_AACPHE sacco_j_Page_089.tif
e46ff13c01eb78f986083389f921457e
a2448c75499df745456fa97abbc232cf48a4490a
F20101219_AACPGQ sacco_j_Page_069.tif
d47fac46b9c3929823ef38f442546331
6ab64e71d2a2f748ee87bcfc2cdc4867fdffcc03
F20101219_AACPHF sacco_j_Page_090.tif
088d24eda999fad3c4659d71c68d4f78
0068c485cc049832aa7076d654658b2d0f728aaa
F20101219_AACPGR sacco_j_Page_073.tif
3c3cba612453e5e29d28be96d7b9ec3f
7ac92fbc9547d89e477590b1d057053077e67dbb
F20101219_AACPHG sacco_j_Page_091.tif
5f0e81d0c4b2043ffa230d31e4f19ccf
353ecb36f7fbc0cf4ed960a6e5d6700244fa730c
F20101219_AACPGS sacco_j_Page_074.tif
c2f1abc7bc1d543a2163fa27bf4c66da
e79675d678a6f75c845dc7f8bd7f4196ab7f901d
F20101219_AACPGT sacco_j_Page_075.tif
a0b12c25df22602e3fdf9b58124bade8
395fa3de22a6d58a57a90bab7518d45578c6ccda
F20101219_AACPHH sacco_j_Page_092.tif
f6832a3d7c9f5a48ba23ab5ef35b4d79
24345f559442584b0da6d9d0b9873d0369c94225
F20101219_AACPGU sacco_j_Page_076.tif
014ea1a2e257ff822f3e5a7f8823f414
5e57626c45d177fd2922ddcb3d480cb6ef2bc741
F20101219_AACPHI sacco_j_Page_093.tif
0d2c62ce3396a1c6fe10e7dd0e003bd6
bd99c31409e10a99f26f54376965dd76012ec3ee
F20101219_AACPGV sacco_j_Page_077.tif
6625a5437c50a484144781beaea99987
473cf265c04ec73b5fa64675eca6490f11e93a88
F20101219_AACPHJ sacco_j_Page_095.tif
9a65d02ed78675f3a97d389637e75fed
6b2df6bfd488eeeca1ab0df80d41355b9b47daa7
F20101219_AACPHK sacco_j_Page_096.tif
64025317a7e55f24d3d71b06c5a0210d
dd20cb84d5a9c40183f0cc93c5e97573052f222c
F20101219_AACPGW sacco_j_Page_078.tif
e036a520a998930ddd2cd573cf63272d
97b327ff17aee2d66f9e586ce278c8fb48ec2444
F20101219_AACPIA sacco_j_Page_125.tif
b25508a8a44b93c136d88f4311f02ed3
03d91182c7b9f083179a30f38f9ff464eb865457
F20101219_AACPHL sacco_j_Page_097.tif
9580256650e3180357f906d074b5d47d
29d1cd41744c429c3411ef9ddf2e22923496b931
F20101219_AACPGX sacco_j_Page_079.tif
4b47fc7c8d94b04b0c323246340e9130
d91a9ef684b3b4be097106937ca801ec1d9c9bfa
F20101219_AACPIB sacco_j_Page_126.tif
e640079d50a33cdc9690337c5f0b3733
60d54cab055181142f122aca3b5a8014c85b5d7b
F20101219_AACPHM sacco_j_Page_098.tif
4a6f7e44470a5770b83fc38b5d3ad6c3
df90b627b8c2c050f6e52288fbf309cc993d6a71
F20101219_AACPGY sacco_j_Page_080.tif
4883c1e2ef7160a2e44b1d2ab2e79eee
d4eb126e25294129cf8ae25798f56998ef3c7e7d
F20101219_AACPIC sacco_j_Page_127.tif
4fd3ffe636a5837bbed13804815199d8
6e5aba82b97344f0eaeb489dacad3c30dfcde7b1
F20101219_AACPHN sacco_j_Page_100.tif
1df15d84a79f89ab60816d72388bcd9c
125e6b3737a3bcd5fe1affc39ee63f5708ab413c
F20101219_AACPGZ sacco_j_Page_082.tif
bdcd3337b85737a320c4336f6768d97b
7634fb7d85f26024f2d982e6931293fd5213d600
F20101219_AACPID sacco_j_Page_128.tif
9c1a1d006df6bdab81a588ac49401496
1a6793a85ccee56934a8c706dde7a7c1b2ea834b
F20101219_AACPHO sacco_j_Page_102.tif
05938fbf52842fa9dd4f48634573a0fe
568c273a2e8f9c2511dfedc0be837dcab7a7dc63
F20101219_AACPIE sacco_j_Page_130.tif
64db58a0da155d890770ab7c31c3b116
0291bcd20bbfa6fb87520d7036b307bf4be5f5cd
F20101219_AACPHP sacco_j_Page_104.tif
c10592108ae23df3773303d9dc93a00d
80280ab4557c8dd5003cae0a84ba8f6b953bea24
F20101219_AACPIF sacco_j_Page_131.tif
ba0b12e5a383b696dc048d88a1915cd8
32b7082039c1972be756ca8be2cb586a91d9b3b5
F20101219_AACPHQ sacco_j_Page_105.tif
cab4b87c46d90d967f25b690deabfb36
5504e231a4587cd35a635ca63bf97a58a2f47fc1
F20101219_AACPIG sacco_j_Page_134.tif
5e61d01cdcb88f3dcc41af191a0d5a5c
e132a5991540118f8b501dce12a088b40e3fb229
F20101219_AACPHR sacco_j_Page_109.tif
ea255eb069d76658cdcc0d2888cc4696
c2b84de0825c3f4fc58fc04331ca6e84a46c2740
F20101219_AACPIH sacco_j_Page_137.tif
9d6b35317e482ac751ce21f5f803aa85
9a290b0578c69600c91a5bccf52e623b806083c6
F20101219_AACPHS sacco_j_Page_110.tif
200e07ab60b770f1e1a8a7d703c7cdc0
07ed1e2e9214dde6eabe04f2a839888d52e83898
F20101219_AACPHT sacco_j_Page_111.tif
566ec2e550e352c2e07969b2d77912f1
4ba0b48f5d64a6aafe8e4998fc75c6ad9b077177
F20101219_AACPII sacco_j_Page_138.tif
68a46ad83a63a77ae1cdd9c285cd6800
ef4941b7722ced8988ab58368b71073bb00a7f41
F20101219_AACPHU sacco_j_Page_112.tif
3c2eb6023ea0dd49dd68902e6ff74da2
0d372d942cfe702b42635f5666f4d630ea647ce0
F20101219_AACPIJ sacco_j_Page_139.tif
f07e6876f1e631bc15a02e55edf87534
e8178bea41b19dabc95c0944e0eb426b78432839
F20101219_AACPHV sacco_j_Page_114.tif
64c8f9b3533b5ee12eb25f02d845fe54
f5fdfd31073e9209dc648eb566dd8da8446581e6
F20101219_AACPIK sacco_j_Page_140.tif
c215389e242448a97b5cff88bea3987b
f1e05654b30cda768bfcc8eb878d1df9dabd7aab
F20101219_AACPHW sacco_j_Page_117.tif
c6ba702a399e6b456d30a08aa0158912
3e792c5473d9c6c72d58984577cd233d58b0ac10
F20101219_AACPIL sacco_j_Page_141.tif
85f725109288a7d33cb644dad4870230
c7b84dfa3df3cff61eae2fb9cf5b77a3996743f1
F20101219_AACPHX sacco_j_Page_118.tif
5d26430a6176e0868cb7310abc74ac26
e8be96780b6e8cb45357f7d3e6b9930002cc031e
F20101219_AACPJA sacco_j_Page_158.tif
c27e2b5207f2c490d75bffaf926be5d2
222429920c8a13133cd22c39c1dbfa7bd0616037
F20101219_AACPIM sacco_j_Page_142.tif
2ed2c871c684ad7974cac1c1cb6d1e72
52f6f62b20304a064cae293170d1b14c379af85b
F20101219_AACPHY sacco_j_Page_119.tif
ce922a8affe3ecb1c2f0d1c6fc69c5b7
e88429e591d3301998425fb43a21c33b93055e23
F20101219_AACPJB sacco_j_Page_159.tif
c03611e3f8d1d4afc7ce9c3eac6d9c48
148832635083e6c76cae2ffa6b1bd8e751980921
F20101219_AACPIN sacco_j_Page_143.tif
5e90769ab6a1679fd16c1f7a04846dfd
ac7a6160792bfbf22967c94d712c4c7c863336f8
F20101219_AACPHZ sacco_j_Page_124.tif
ab618816528c2a1f818d70255598fdda
0a6e438e084438481acdced96f141c1839ab77cb
96225 F20101219_AACOGA sacco_j_Page_057.jp2
ee2caf55cc508d76d8a917cd862b0248
766a53d884c0f55e14de52ccea7fb1a5c4878379
F20101219_AACPJC sacco_j_Page_162.tif
0414d708ff5080627b064076537696e2
c61872e50c0f81ea9cd3583d4c7353365fd32fb7
F20101219_AACPIO sacco_j_Page_145.tif
368a8911c669d63638ad9616ac09936e
6aad7b8408cc0a72b311325d4c4ca40ec115c549
1051955 F20101219_AACOGB sacco_j_Page_112.jp2
8c2a85c9c6aacbcb0b17193ed4326474
5bffddfd10f32519a704b37a513c04b35a78aad7
F20101219_AACPJD sacco_j_Page_164.tif
c070898c439b26d3297f3573e12546ec
a084915ceb6d6fdfad437109633dd2871cafcc50
F20101219_AACPIP sacco_j_Page_146.tif
b062c9ed3ae701fd74adb1ef12e583ed
83e3504b350515254f2c8fbd0e5945864e57652d
5953 F20101219_AACOGC sacco_j_Page_041thm.jpg
ad790b6caa8acb0f91b55cca0e6a7ec1
126eaee702c3b24d4ede6163a71ebfd9335dd21b
F20101219_AACPJE sacco_j_Page_166.tif
5787cd9e4c7433be215dccfb30542cd1
8e50648e3e135b0f671d9b632b8c2b9b9bf487fb
F20101219_AACPIQ sacco_j_Page_147.tif
532f9471d865c9d5359d8b6e8511849d
5744b68dc51e782a7e42c5659d7ffe00ef659dd2
1885 F20101219_AACOGD sacco_j_Page_048.txt
19b107c8fd86e9e40bf78c3a41719c31
641a02c159e44201c86ead0c66138d067dd3c8e5
F20101219_AACPJF sacco_j_Page_168.tif
cff4f3b46d3ead02791479a4f827a024
82aefdb39aea8a0671d6cdd50b79b0b461715922
F20101219_AACPIR sacco_j_Page_148.tif
76f089fafcf08d3d4c6ff4932c0c7f9f
00f24426f4097573b5dbde95f113e42f3b3109ec
34331 F20101219_AACOGE sacco_j_Page_020.pro
f0f7ac9f02a22f8811888bfcd2ff3b62
6844515a51d877ef807749f5da550a4815597007
F20101219_AACPJG sacco_j_Page_170.tif
1249262898946c63000e9bb6acd9e475
e575b8f30b737578e01f917d3196911b6994a6de
36092 F20101219_AACOFQ sacco_j_Page_110.QC.jpg
1ba7da99803a3031d10250352f2b72af
154f2619cb22f8bcac6073c5acfc6c58164ae6f0
F20101219_AACPIS sacco_j_Page_149.tif
7bed9159bcf581e33025c3f47822dd77
4c641a993b799e3c712d745c70248f620bcd4c32
F20101219_AACOGF sacco_j_Page_001.tif
b7131c1c9fbb23a12d68ae812341ce01
a9b50460d64ff45b6cece09015ad0c4a49f25ff3
8998 F20101219_AACPJH sacco_j_Page_001.pro
79fa54b3592269972c8b4f69e036b6f7
77ca2e044e1da12bed92a0d79c7b00261090acd5
31181 F20101219_AACOFR sacco_j_Page_027.QC.jpg
7de1f4d297efc6f4a60ccd17311a59d0
41f9e1af0e78289c665ace9bbbe77a3c5a90b9b2
F20101219_AACPIT sacco_j_Page_150.tif
4f65e5fa438922acaa2d7190b535d75d
7d3d5d9130420eed941ab09b2f253e56323c3cfb
1098 F20101219_AACOGG sacco_j_Page_135.txt
afed1826abb59cf44bf25d7436da08c4
1ec81212aad8d3b4cd88712198d22a4af8c4df04
1635 F20101219_AACPJI sacco_j_Page_003.pro
0c01ab42a99d9a5c33b26ab108808e04
dd5014824a37f7c48c4bdfaf6e43ccdb095bb526
7898 F20101219_AACOFS sacco_j_Page_161thm.jpg
ca0f1fc975f70ab4f6dbd44e877fb1ee
d1fdd3202f1b30c913d632b8b060efb9da65586b
F20101219_AACPIU sacco_j_Page_151.tif
8df7619649d5affbac2344b0ccf7d758
1b24be962dc7980a3fa52e9a6785634085cb1960
8829 F20101219_AACOFT sacco_j_Page_015thm.jpg
c99d68152c2c3d68e92ef570fa175c3f
ce6dd8ab02b80aa1c1aacd8b5b1ea5c34b959759
F20101219_AACPIV sacco_j_Page_152.tif
724b63b4be13a8dc7556785bdf6a73f1
03699cedce75a27356cc9a6ec213615ba27d386d
77404 F20101219_AACOGH sacco_j_Page_076.jpg
6594eae97684da77f3cd125ce358f928
6de10cf7c401e10120d3fcc2b7856cd84e7b0ee1
33515 F20101219_AACPJJ sacco_j_Page_008.pro
20508a82c9e14fc3f244a5ba7baf2cd8
1687a633eeea7681b3021615aacffdcc149838a9
60828 F20101219_AACOFU sacco_j_Page_022.jpg
ffde62216a103cd40c86e450a8e9a3f8
977030eee5bdb8e02307520775e7c027b626a906
F20101219_AACPIW sacco_j_Page_153.tif
9b2ed844c2696907f948a2cdae7792ba
8b09abf41d7d66a035a70040fa25cb4098fe0061
3132 F20101219_AACOGI sacco_j_Page_111.txt
1726922609e286722cd758a4ad3bc555
ca3f8d0f90813fbe161dcb980dac2617c44a38b2
68846 F20101219_AACPJK sacco_j_Page_010.pro
2ca9b276ee86743d8a419b8db0edc135
ea4617f593771563c426e7b8130ae5fc89869ca9
38336 F20101219_AACPKA sacco_j_Page_036.pro
57ab32212e1fb68448381e1cee28aa00
a8d25e0b90a95911d893bd5a6223f6f9e3e5e1ad
21345 F20101219_AACOFV sacco_j_Page_042.QC.jpg
b0bfa24022b2b7426647512d870d047b
3cfe5de379bda88709c12a91cc041794c1ead88c
F20101219_AACPIX sacco_j_Page_154.tif
dc7db6bc3de6ad3a11e61ef3c6fc1b21
e3e4d15ab11f9262ffd3f4f4b9d07b5ca39adfb3
17189 F20101219_AACOGJ sacco_j_Page_114.pro
9faec270a08a79d234e3d96b749a2729
68b741c1b97fe2aaf3a4aed3a7fbb0d1f097d157
39063 F20101219_AACPJL sacco_j_Page_012.pro
14a4bb1fed1a7f76f14fd0a3117a999e
86dbfcc28afeb7da9baeb8dd36921bba608177c8
39244 F20101219_AACPKB sacco_j_Page_040.pro
e368306d5fb8620e498056f48305bbe2
814c5a23d5e23b77c1383ee5afae4ea04259d2e4
130112 F20101219_AACOFW sacco_j_Page_161.jp2
128c90857e1efd4e2332b243d8ad5df1
cfc0ba2534abe13832cee08b0c6bcc16c0948239
F20101219_AACPIY sacco_j_Page_155.tif
6d3080131089fdc20514ac78a06249f4
0d927832e18d48db690f34efececdc20b25bf68b
F20101219_AACOGK sacco_j_Page_055.tif
a7162fd716421cb5756002cf7a525c7c
c83165416d094d7f256c2205e53ad6025f5e0854
37183 F20101219_AACPJM sacco_j_Page_013.pro
96963b331f4ace2d59c699252dd68bbc
d432cdeb60ac69909138e3fbf7fd589ea4967181
23867 F20101219_AACPKC sacco_j_Page_041.pro
131eb0a120a447a6c5627042a99d5f36
91f807f7e84ce331245a107b2ace25a596b064d0
60096 F20101219_AACOFX sacco_j_Page_135.jp2
7c0eed2f815e8d4ee4ea65249a07a821
0373833057fdb0954d0a0053494e7d21d5c5a4dd
F20101219_AACPIZ sacco_j_Page_156.tif
97a6b85c511e54b24158f9cf58438eb7
96c6cdf96e2427c18ff04d0d34354a5b2cd72be1
131735 F20101219_AACOHA sacco_j_Page_164.jpg
7f362ee93057810261ea5cfa074b423b
dc352a15f0168116366edccb0a4e2b21b1c29fb0
F20101219_AACOGL sacco_j_Page_083.tif
2fa3ced0df6b2f615b32334c4c7d1864
633eed6564eeef7d8c165c05d2f696249f32e291
43908 F20101219_AACPJN sacco_j_Page_014.pro
08c82b9bf0913b7186f5650dd3d00da4
f34fbceceb53287b1312540ccf4efb0d0621ba0d
26647 F20101219_AACPKD sacco_j_Page_042.pro
6016f3331228a948a97e58f413f89eb1
6edc4700263a11a41b69dc0d014d4b099b4a5414
F20101219_AACOFY sacco_j_Page_120.tif
530b6e9fc951f6889a823f1b07963bf2
a95a5c19cac7783d923e0c88c92938a906450a0a
7575 F20101219_AACOHB sacco_j_Page_143.QC.jpg
fb5a2a9791bceb1745cd8f2b3798c4ee
6d42badb0193b10c4e05e94c8b48628668a9fb6d
34304 F20101219_AACOGM sacco_j_Page_169.QC.jpg
b2b43dc0abf23a3bfdf9c2c4cf48d910
a3481bab42e193fd46c102152452c8b4c3a2e50b
43017 F20101219_AACPJO sacco_j_Page_017.pro
a115dd5009628cdd24592b76f9d40976
c6cf135d11ba36f13e4fda6bf2b2b7b6eedd47b8
32051 F20101219_AACPKE sacco_j_Page_044.pro
dc198d19b1939907192e431c344c9654
2a6ae8fa81ddf1ee48c242f8222ea774c70361b5
F20101219_AACOFZ sacco_j_Page_136.tif
c93c8519d33ef68709b767fa8835db97
76d4c83c05f66709787050cc7e5af8d3e57061a2
14634 F20101219_AACOHC sacco_j_Page_116.QC.jpg
7ba23557767c33789692e705d71a45fe
df6d01468ed9e6a8e06f3ac04f669a624589032e
48791 F20101219_AACOGN sacco_j_Page_018.pro
e348641f56914c76b37d82f656973174
758042244a66aa3914677b542471a6902a304566
9778 F20101219_AACPJP sacco_j_Page_019.pro
56520b2f5546682c133278cb1446a5f2
f565fde6c9db3906585e43a023961c37f590fb51
45944 F20101219_AACPKF sacco_j_Page_047.pro
1200d079e6ccf98edbfb5b9dcfe35e3c
c7b44d213fcb089f36d8ed10d4ffaf68c4e1ae30
22301 F20101219_AACOHD sacco_j_Page_118.QC.jpg
67722f43529cb6a04cf65340ffc1a2aa
cc3976afc2a42dbfbecff194e6886ff0fce44990
2984 F20101219_AACOGO sacco_j_Page_109.txt
e2193db72cccda1f77de87b0cdbc8940
3a34f7229c2203b82b3f40c185cb3c73a5d1018b
48814 F20101219_AACPJQ sacco_j_Page_021.pro
dab3c239a94c404af25dc994c3f73c39
f2a605a8134d1867b9cc2dab014ae0b07d7ea7a6
47525 F20101219_AACPKG sacco_j_Page_048.pro
e2b96297fd2a01e4d2c63a58714ce28d
3f80ce9cf2742d2eae05e0de4f34257e330ce9bb
1431 F20101219_AACOHE sacco_j_Page_044.txt
0eeaa67a2c24a4713d186e42bbe9111d
b7238a9b6bdba2cebe4ed33fb7eff0068b15d40f
1616 F20101219_AACOGP sacco_j_Page_040.txt
68ad19395bbe44020d0ec38bea120d03
25c5d9959abd97fc3b4c3d47add10281cbab29d4
28419 F20101219_AACPJR sacco_j_Page_022.pro
0785fd3f72925c05ac5d5f78b5f58332
1c9d196eed5140c204df6a820adb3cbe12f30f39
48664 F20101219_AACPKH sacco_j_Page_049.pro
0e2ce1b7f081e04f527c50806ee5b74a
9fb6debb276c1b36aa77e1d6a3f451e888e66b13
34666 F20101219_AACOHF sacco_j_Page_098.pro
dc21ad816ad98767ad9354642922b929
f7569acd7d6a3c18e6eee4ab0f118eee7f7d1dee
38500 F20101219_AACOGQ sacco_j_Page_010.QC.jpg
637b44e800c51cdb2c907016b10299be
b66c872f6b0745fdb7477cf32f40a6cf910b6e9a
47160 F20101219_AACPJS sacco_j_Page_024.pro
b584bd27d0c854974c9eda88eb06120d
d3deee78336fce41e8a881f45cd30244a192d295
44539 F20101219_AACPKI sacco_j_Page_050.pro
99f3ae18e3138bf0c9465c53744430d5
2fa1085c708695a7ad182c1bdef6caee1b199667
23111 F20101219_AACOHG sacco_j_Page_113.QC.jpg
90df4989bda165e33a5a7d1f962f1be7
1c9c51610d85ac03cfa2998415a8b889efaa9deb
66944 F20101219_AACOGR sacco_j_Page_163.pro
2abaa58075284ed1b7fd4e2dfb7a5e2d
3884600be26126daf54f97e2314c807f45eff2b5
15884 F20101219_AACPJT sacco_j_Page_026.pro
250c77c2884fa637b759b9319977a828
b005811c6696b3ec74c199d417c72e75a74c5a87
47915 F20101219_AACPKJ sacco_j_Page_052.pro
0d41cdf654090a08821736c5683f5db9
0e6851af95ebb1526ff3b73e68e00e4d0615cd1b
1838 F20101219_AACOHH sacco_j_Page_074.txt
32ca7fec431d9e14575c80ec60c2dbce
f21b874381060faa05e54d57b3770b25f11b81c7
8482 F20101219_AACOGS sacco_j_Page_092thm.jpg
9514a816c5c61c49ccf9c4417e366ff0
9ba8171db273e681d10888358f8cf9d5ad8ab424
43416 F20101219_AACPJU sacco_j_Page_027.pro
5c7dd5d408dfb8e770ffbe34aee3e49d
f9f762bcc98fe21f2f55c13076f9e5359706ae28
106570 F20101219_AACOGT sacco_j_Page_069.jp2
0ca0bf70e4bfc50d8dfdf37c4c774b3a
c1db2cb0e2b90430b159bc8495cd18483107a4fe
47945 F20101219_AACPJV sacco_j_Page_030.pro
f245cf5186a86afa6d0d23c0268ed8cb
306918f578568ef076450580ca4f8266637798a4
51097 F20101219_AACPKK sacco_j_Page_053.pro
dc2d7c45561bc61c5b8a561c3bb1d732
0ac21c46430736ae57f7c01f74a0be41de2444d3
47304 F20101219_AACPJW sacco_j_Page_032.pro
b2c8004752b8741d97e0cb4a406e176b
8e167da5c6be405aea0ebd4ef16448aa18ab0f03
763937 F20101219_AACOHI sacco_j_Page_045.jp2
e4d84a81e16e2a8fd91a3b0185fdb121
317a26fdd8d05d15349958c493f02e2f55f15896
129275 F20101219_AACOGU sacco_j_Page_108.jpg
991e6b4cc9abd05e270158d37b63b6f4
da0ddbfd1d3f7bda1eedb2f23ec1f35440535385
48469 F20101219_AACPLA sacco_j_Page_078.pro
02ae3f37bd59e1378f277822be96f0dd
eb627d91830c892acabf5a97b70d8e5b2de7c2d3
37576 F20101219_AACPKL sacco_j_Page_054.pro
bf5ea5f50b1b2968d0f53ddc6ee1372e
f622b6b21321cc868b7878be03939794456062ca
50059 F20101219_AACPJX sacco_j_Page_033.pro
00543f522aeb6c7a5bc5703b89bbae67
92010097f4d67de155220242476718f800628db3
1535 F20101219_AACOHJ sacco_j_Page_094.txt
7c5a31fad12b0fd1be324b679bf37c0e
eedea3f1474cdfaba126e93492f4217697d6c7f0
42966 F20101219_AACOGV sacco_j_Page_028.jpg
b81a5b13baba803e0a4a11fe0587727a
870dd2fb7e6026d49e9f208a75a85e5697dca07c
40757 F20101219_AACPLB sacco_j_Page_083.pro
4d6e7b0c7e63a206739d67b1b0bb1d7b
a0764132b3fd62fc80b5ec69a14354efd363025e
43192 F20101219_AACPKM sacco_j_Page_057.pro
d0b13236c40a7bbc78ca6366cd71e7e2
f0b649a530253a59d632fb2d6e15aa18d1a29e36
51032 F20101219_AACPJY sacco_j_Page_034.pro
f452d5179c2c2a86f380df1bac11769f
86d93af1b3c6f6539ab5410151bd95a905d83c9b
93927 F20101219_AACOHK sacco_j_Page_050.jpg
1f7e9649156ad3ba5dbaa46ab7097685
4fa3b7c9c882d388a951cda5b8f7443b1463d41f
35788 F20101219_AACOGW sacco_j_Page_113.pro
5efb91ac6692da2ced60b57c274e633d
75d2b8dc0fe9b01ec88e0125c62d3cf02db3134a
49041 F20101219_AACPLC sacco_j_Page_085.pro
8648c9a061a13535d331ca18827714d6
0e570ab09b46825aa326248aa07f8870f90fee6a
32137 F20101219_AACPKN sacco_j_Page_058.pro
eb68d4da0a769022e7a7882e9db64fb5
0d5604f63c17ba4a6039d3d5df53fd5f5a829326
44461 F20101219_AACPJZ sacco_j_Page_035.pro
a318cc519ebb0ba228013774cb1b8f16
e3150739bbbacd24ce9d1c1af0e273bf21cb150c
60370 F20101219_AACOIA sacco_j_Page_151.pro
04f0d70b348cb2ccc77d377026d97ba5
cbddb4d1db2e141fd69c70404852b1ab47af5208
1983 F20101219_AACOHL sacco_j_Page_122.txt
bcc42ac94e0f6cf739b024aa5e18fa04
6e1b1c4d951bca65b4a871192d9b52867ba6cfd9
1051977 F20101219_AACOGX sacco_j_Page_153.jp2
9b391774424e654a3a863c76d6e35209
abac1a992e4085174e4112e6dd88d155f3aadb5a
48195 F20101219_AACPLD sacco_j_Page_086.pro
29f08824d9dbdbfbc2bf711675a7c5f2
21cb419b667ad3c42e3b5ed1fb5494957d078b8f
34441 F20101219_AACPKO sacco_j_Page_061.pro
a58fd7b9f5c36a1fe0c6622ef02f6246
2fb71456b396d5e219ec6c4f57aa0005fde6970d
101693 F20101219_AACOIB sacco_j_Page_086.jpg
8021e5b4db367acff11ce7a31465085c
bb55b1aa97421c9940c062a23934552b1db23205
934 F20101219_AACOHM sacco_j_Page_138.txt
f38c73852b309dd1715a3245c0b1698b
6a660c87e330c847976928964cc422b2f2060f4f
3965 F20101219_AACOGY sacco_j_Page_148thm.jpg
597334fdfb21d6463894e12fbe307122
78a8443a20d3c724f5ba54b650194bcafbabd0e0
37748 F20101219_AACPLE sacco_j_Page_087.pro
c98423e24d4cf969e6ca9b31ef662a00
fb219d2dc70eeeaa05061592cd3bd0457b0c047c
13417 F20101219_AACPKP sacco_j_Page_063.pro
0e6abd85b6f695eef9e473a0da1a66b3
49db6cab79f3f243639f033fd51a7bbceaf8dcb8
106184 F20101219_AACOIC sacco_j_Page_122.jp2
80b97c4ab12f1b58b1260e547b93779b
1929cda119dda92f7d4d5ecb5a6f013cd7f880fd
1901 F20101219_AACOHN sacco_j_Page_082.txt
ee5cbfb2a9e135e14e31fdb1b69a7e80
bec432ba0d421d26f818c47931f6b5555d2f9776
50234 F20101219_AACOGZ sacco_j_Page_029.pro
379c7230dec2554fcdffdf52beb81b50
f4cf85b5571ef7ab21b00ed98627f9a5f6ac3fb9
6148 F20101219_AACPLF sacco_j_Page_088.pro
9bbeeda8960d3e889b6454f40bb496eb
143a6569d2ab657c50b6809c71964d333a436593
27918 F20101219_AACPKQ sacco_j_Page_065.pro
9d6848b93b7035a8e029cd4bf208d117
1edc78fc76e38db293273f25c46a7c67bc194368
2165 F20101219_AACOID sacco_j_Page_154.txt
31553336e8960df185ec1423eaae19b3
2bd40f4fe4cf4e89c7875cf80e1774ecf62fc921
51330 F20101219_AACOHO sacco_j_Page_056.pro
d837e6eb8830ac673d7b32249f36b85d
6191eb7af18268de29dc3d05046c22757bda8d2c
6342 F20101219_AACPLG sacco_j_Page_089.pro
a669d309d0b4cdb5a00da88400776a4d
ebd1751468ac070a820458c76c685e2fa742978f
30867 F20101219_AACPKR sacco_j_Page_066.pro
3e86120c9e1b33e92414c3b6969c26cc
a12868a351464401cc474a212c5f87da15e61873
1360 F20101219_AACOIE sacco_j_Page_066.txt
49e2f3177c6f2b3338f49388ffab98d1
354b040b39809a6fcc08e8e8cb86bf4430e7e769
7094 F20101219_AACOHP sacco_j_Page_117thm.jpg
b57dd7ea77edc3a0ca1157dd45b56514
7fc3d832a2f4583780e35934df363e26796081a3
21515 F20101219_AACPLH sacco_j_Page_090.pro
e29d445f265c570e725eb8d6336bc1a3
eb923045c3312c45c874fb59622c6dda00a22387
47341 F20101219_AACPKS sacco_j_Page_067.pro
40165fd3e6e4f45c2dc0e022ebe73347
3ed6df9c06584303cf0c3dd97e53bb70259e8eac
30664 F20101219_AACOIF sacco_j_Page_051.QC.jpg
2f9ba8cfef00e74cac9176f08c38be30
74fc5216c6a78998d1afcd63b82027fbd6244395
1466 F20101219_AACOHQ sacco_j_Page_003.QC.jpg
46d34fdcc6229d7c3128b8219cf29c72
2b2e23e194c252da117df7cb99fe01de27939833
38009 F20101219_AACPLI sacco_j_Page_091.pro
20a100a4a5f0aebeb74cbe7e5921a78a
bd39075d114e385cc10ff4f174f91f07aa0c8727
49702 F20101219_AACPKT sacco_j_Page_068.pro
13201a58396c225b4d3e0d231b1cf568
62c57532b9fbccf5e5718d878d0b9cfc017baa47
103754 F20101219_AACOIG sacco_j_Page_115.jpg
b27f77270ca1d5f7b33fd6ae0529e872
b961328c706128aae1325d8425f64da9d95b54ef
6208 F20101219_AACOHR sacco_j_Page_136thm.jpg
653e4c676ef497c0752a3bfe2049deeb
15bceae7a9fc3714f8c9e17006ce5dd8603a5141
17045 F20101219_AACPLJ sacco_j_Page_093.pro
4ee683a7ba36b3f5d7c3e58001a6cd04
815da91efc235ce4fde9a34a8c3c23f7aaf77f70
49403 F20101219_AACPKU sacco_j_Page_070.pro
39ccc9a915f253d6b7726791df15bf65
21e568ebe0d7f476eacfbd412e7643ee5026b99b
6899 F20101219_AACOIH sacco_j_Page_065thm.jpg
bd90579493817a44e959db7b87da67b1
da87d7604bf732ca5f687c3086513f549f2a5d38
1649 F20101219_AACOHS sacco_j_Page_023.txt
aed2eba81547e14b8df6af2fb31ddd99
2519f745f8be4108e390df4984edb8fae3e4aba4
26386 F20101219_AACPLK sacco_j_Page_094.pro
a2c2ae31ad5f128baa0ebd74a8010a66
891210da1a38f8e4614344f574be8e389faf9629
36673 F20101219_AACPKV sacco_j_Page_072.pro
1d48cb03747da60c549d3dd1dd850c2b
850a5fd09d6878e256a58247a7d72e7f224c5663
F20101219_AACOII sacco_j_Page_107.jpg
94dd8b0bcbd528bac8828a2228e10d5c
59ef7838f7fde0fb2df16545ffd678bf8761b0ef
46816 F20101219_AACOHT sacco_j_Page_104.jpg
cb1ee32dc3d8cb8e48cf3232a2a01258
19acd59a22fc75608036f59d3ef001da275814fa
42501 F20101219_AACPKW sacco_j_Page_073.pro
1403c138b870f94972f312940ee381aa
4e493ca4646c23acbc825291c02a538061e451a5
64084 F20101219_AACOHU sacco_j_Page_039.jpg
7be7900ae05b80cf0e2a9a46eaa678f0
3fb1e9ae7965596dbc5b0db9ed46332a195ddd9d
20433 F20101219_AACPMA sacco_j_Page_116.pro
3daa5f2323266b5528ab8c33486ef39b
9db8e120cbb96ae6fd0d68b710ba04d126fb8eb0
42582 F20101219_AACPLL sacco_j_Page_095.pro
358f17510853f21f0f01daae3067b33d
b5590c40e4b405b8be00d640271c166275079276
46522 F20101219_AACPKX sacco_j_Page_074.pro
e7dab682fe1214efca74d52fdf8c7cc9
2249544871f7946c5f71f4ebc138c08d21af2801
27795 F20101219_AACOHV sacco_j_Page_061.QC.jpg
344b2a66bcb784aed7f9f01639e60f5f
48eabe23ae5c813b189463f4898ecc9591012969
860 F20101219_AACOIJ sacco_j_Page_093.txt
7fd99d805d75f8b8f33a33bbc7127159
086738f9d3f5c0f9942578074deb772ddcfc294e
45057 F20101219_AACPMB sacco_j_Page_117.pro
64224ca412c0e74986e4df4f84807592
4aaef1f53505241144bbd4a6580d092836261e58
36194 F20101219_AACPLM sacco_j_Page_096.pro
a52e344debbe1198bf84c3a34f7ef9c2
bd10b454d2c1d332dd4fa182b5be3cd3102471a1
45495 F20101219_AACPKY sacco_j_Page_075.pro
2bf6ed1060a3caa7dc4c938f3a6b3fdb
76bce8e008965a06b4e11ed2a9c101d6baedb7c8
2075 F20101219_AACOHW sacco_j_Page_005.txt
1502916b84eefbe89c47e24e8c227fa2
fe6b4cad0d5968b6c1643708295e8236de38901a
49494 F20101219_AACOIK sacco_j_Page_031.pro
816139d871bd9a0762280f347f598794
87d5c94482d67a54b4df828622f93d0007f44199
25325 F20101219_AACPMC sacco_j_Page_119.pro
4063e9e7cee2d663e04365d5c38f7cdd
89361dbeb90e7260d3f0ec96f8b405d2da60227c
46700 F20101219_AACPLN sacco_j_Page_097.pro
3adf0cb48a16744344b98552230fc7e6
008d431b1cd9c509bd1ec62d5fbadec69a5ca78e
30205 F20101219_AACPKZ sacco_j_Page_076.pro
7bee13b0fae860d56fe3ede2ea5047f4
cb81f977f06959429e485721c698b0076e9feccc
38878 F20101219_AACOHX sacco_j_Page_131.pro
640f70f3a251bbc4fcdcc6b70cf3ea0e
4aab064cb08cf3117f79e8e4c971ffea2e7cdff1
1385 F20101219_AACOJA sacco_j_Page_124.txt
a59c5b2e1b7e3a9ebf9615df753be128
8c18dcabd4b5ece47bd3a37f11e791952684a525
468472 F20101219_AACOIL sacco_j_Page_016.jp2
6351a164b01a653f60ce0f043bbdd753
b3b1946b8e7efb2faf882b7f9ad881e26d36438a
48997 F20101219_AACPMD sacco_j_Page_120.pro
5369af9e686619cb94ac4e004014c183
b1faa8753d5e9cbcdece99c537eb038a3c5cd44b
39956 F20101219_AACPLO sacco_j_Page_099.pro
af8db6db713527d372e52173ccb8ab44
2a29e27e32e60c0ddf3a5d2a99af20cd29291964
F20101219_AACOHY sacco_j_Page_165.tif
cde2a892f970ce8e3d833f11291a7715
dca741cfe944c44e5d6480ae585808e5fcef299f
8612 F20101219_AACOJB sacco_j_Page_120thm.jpg
8e2543591291cad9332fdc6013931127
abad8af6b9b1ee7b1d6af85ba83f9500ddcc7bf3
1516 F20101219_AACOIM sacco_j_Page_025.txt
530468c700866c60958b6490dfec5dae
1453bd32bb938a29a2815891648afa9484b8e2f7
47588 F20101219_AACPME sacco_j_Page_122.pro
d605373c8d6e42fed2958b65d8f224cb
e0181b9d38785424c640433457e0d2d59716e413
40715 F20101219_AACPLP sacco_j_Page_100.pro
e7eeee6a2e2591d7c91103e969b88e0c
f8d8f5789d0f6540850d726919ac231c10c430c8
44334 F20101219_AACOHZ sacco_j_Page_019.jp2
f01d1120e3947a1d7ebf1829b4613925
7703cb2bfa83ba2d0f3f2de1afce751a68cae2d0
64313 F20101219_AACOJC sacco_j_Page_119.jp2
7f00ea541513c57826602923d6e1d576
a629519c5bf88d97c4ebd7683d5b6b5da00e65d5
50314 F20101219_AACOIN sacco_j_Page_084.pro
5b576d74e112f9907c8742edcbfb8849
d20b63c4eceadba858936658bd5ecab32590184c
28534 F20101219_AACPMF sacco_j_Page_125.pro
a5e7bd8e32bfa120719b276b9e5641e1
07dc80df31e8cdea99dd441140ca8a63c8528d13
45584 F20101219_AACPLQ sacco_j_Page_102.pro
60b3ac2b30aaec27bc6dd40034883a8b
39e603740fb21ecaa41c80dd0785428808ce4357
6406 F20101219_AACOJD sacco_j_Page_023thm.jpg
e3d52df8ec7f0daa0ab162f2779e7b67
cf9d24990dc8646faca0bcfd6fcf31a131c4b433
118126 F20101219_AACOIO sacco_j_Page_007.jpg
121dd2a878866d2be732b28c012ec0ca
7376981c98b0c398f201aa565eb22a32eb4f2e7c
52322 F20101219_AACPMG sacco_j_Page_126.pro
0630993c0e5042f4a055ab31a8628bd4
9ed9e18bd515b62612146974648043d30b157029
81073 F20101219_AACPLR sacco_j_Page_103.pro
b118c1c834a5456cfbed3966b927aa93
8aa40eaa0b05be3edceb21eea585dfcab28b16db
102695 F20101219_AACOJE sacco_j_Page_049.jpg
d7e63e97f2d8446bbfb3535eb66c976f
03c22e329791d9f5ba326a1be2f8b82010cad87b
3403 F20101219_AACOIP sacco_j_Page_133thm.jpg
2978015277bb7a88e789479ad040b3ff
c8426ecdda01fb944f2097c9ca8f687dd4735dc7
36910 F20101219_AACPMH sacco_j_Page_127.pro
af3325c70c6d7391d11643294a548c77
c06a4c36c4056ced15ca596321f631d16d5e6ebe
73563 F20101219_AACPLS sacco_j_Page_105.pro
260214736e76468c6b989c1b1aa7008c
fda699fc1a7c4df7e855cb1a36f6eaa6f2de631a
141120 F20101219_AACOJF sacco_j_Page_168.jpg
d90e7c5d04d9d8cc2bc17964a1a908e5
9c75b0dcedd4910815632ad26640811e2019074b
137322 F20101219_AACOIQ sacco_j_Page_164.jp2
eb303be0e4f1035cb0802f0f92e0a35a
59c322aa073e32bd6344dd48301f02798d4aad05
42759 F20101219_AACPMI sacco_j_Page_129.pro
c29e5b4fb5d2a7a67add2cb1929f0b45
eb0e12df8c447a7bf74f005f47f5509bf1770c50
41047 F20101219_AACPLT sacco_j_Page_106.pro
524371d7498822c2a6025101260db276
289c7e1725ad1b78de6e8f814fafd02c5cf56f10
108873 F20101219_AACOJG sacco_j_Page_056.jpg
ec0df7d4f273ac0ab38a86b1bfaf964b
cd1a1722465cd83daa9179d81b60fad97dd51681
60294 F20101219_AACOIR sacco_j_Page_153.pro
9cb416a3294019ac2999273c809ba3dc
0fee35a0c5336f7b8a0160af381d9a43feb17e57
36854 F20101219_AACPMJ sacco_j_Page_130.pro
fb3b3a2ce19f09a66fe4938181c35db5
2e501f2c5f43d7a04eea1c896842986762db82d2
61652 F20101219_AACPLU sacco_j_Page_107.pro
5507c9729ca923d26a42e4c0a0662002
0f93749aaebbbc69263710dbdf9d34ff63b681a1
2745 F20101219_AACOJH sacco_j_Page_162.txt
ffdfbd111462cf8c6773d14980c136f4
79031c6473796a8bfee056c7a1a8d3f14235ce9a
35243 F20101219_AACOIS sacco_j_Page_031.QC.jpg
44c31aca26c9e8316cfd3d5f82465eb4
642680032c60e996b0ca61102a04806d52f4b161
35330 F20101219_AACPMK sacco_j_Page_132.pro
9a432002d613d19a1dff8a91a310d40a
34749f626950a5eb6600fa458a81b9ff01c46027
78231 F20101219_AACPLV sacco_j_Page_108.pro
1f95b6cfa25168d85a662fb0352d735d
8fda797f3cfa8e67d900e280f4e8ad36ae3ca654
5549 F20101219_AACOJI sacco_j_Page_119thm.jpg
33dfd7e81593dabba16c7bd3a96f5744
367514373d45dbc128f506056a0d6f02e0468b02
23979 F20101219_AACOIT sacco_j_Page_143.jp2
47f98d850a8b6c18b287261e3fa39654
ae82556a8f6c7342eb91692c378b721cc0687bf2
7935 F20101219_AACPML sacco_j_Page_133.pro
6537e73a28503692ac979603eaa90575
11569699f7034e0a2041d03c25f71d387c54f459
52722 F20101219_AACPLW sacco_j_Page_109.pro
bced60a18cd442e11eeaf22f55a6dbb6
1bd326a36413fb318a34ab0cc301923043fcf9bd
107648 F20101219_AACOJJ sacco_j_Page_018.jp2
95fd74a4780cd1a66d9b150972ef4b5e
d213feff676d901b8c0af383f9c3feb92fbb7a60
1416 F20101219_AACOIU sacco_j_Page_132.txt
b96ce14ad559a255b5448a5715212b08
b2ee192dc22764fc7bb1bf6b8c5be1b476c43de5
56658 F20101219_AACPNA sacco_j_Page_152.pro
bdcf9713914a635dc1ec225d28ea647c
38977f1d4420ba1e82a34849d911a9d2529c3ee1
80406 F20101219_AACPLX sacco_j_Page_110.pro
4093eb950146cd9ac23386ca78f4f31d
e823691989c1ea0127ee9bf13b4330139eec325d
95102 F20101219_AACOIV sacco_j_Page_154.jpg
0685c4cf7e55f00205195cce6f48bf08
6c21bc70e8271812c684e302df09b2425974123e
51312 F20101219_AACPNB sacco_j_Page_154.pro
4ed491e32c00a3b471a1ebb95e366d00
37765a9258095b29a85a5709aea3c57796547278
13858 F20101219_AACPMM sacco_j_Page_134.pro
a85e1d15615d4eb9ca83305cc7e7cfc6
e2fc203ecae806cef487333dd96ee94305c7b164
74273 F20101219_AACPLY sacco_j_Page_112.pro
dda7147f7046fe5a941059b89587d37c
e1cb84575080c880428eeea9fd5e1de0b0533ef9
28526 F20101219_AACOJK sacco_j_Page_127.QC.jpg
472ff9ad172e73423a4d4d129326a6e2
645c60f36d5a86a13c8d738672c4f85c7ea6b2db
1888 F20101219_AACOIW sacco_j_Page_142.txt
189cec1b636666dd69ee2d0bd44e67bd
3e0f59785823b3f705bd4e2b220cd7391c5f9c25
50204 F20101219_AACPNC sacco_j_Page_155.pro
ddbd0c92c4da4de9a52210791e82b154
6b1fe03e659d8d269842df1d034c07bdefbe4a08
24804 F20101219_AACPMN sacco_j_Page_135.pro
49be71211f1e9b659942c2c5963e9fd0
afb676751d81fce1c4ea7fd7c3c3119155e7f69d
59277 F20101219_AACPLZ sacco_j_Page_115.pro
0b423b3e001b41fbc8873c5347404508
5b373b8770c22128ae27ac4a423bc7e60d09d6d9
109292 F20101219_AACOKA sacco_j_Page_033.jpg
9038f89d294c600ece9381a292753399
c76c0b73c7351d765faa735eab1fcb791ed5e2ed
71085 F20101219_AACOJL sacco_j_Page_044.jpg
1d0ebf1b3762b26f86862324a114e2c9
0823dfc38dbb69cc71ef586614f79e54d6fcdf82
8365 F20101219_AACOIX sacco_j_Page_047thm.jpg
52f06d53bba8b22a8cfb3e6fbb54cb7c
ed9d771901a648098a270a26152fa40f064bdc3e
F20101219_AACPND sacco_j_Page_156.pro
4bd04c1a6e0d68c86f49a69df696a921
c4a60740387eae5b2418556f4146a1e3e7bcc35d
28411 F20101219_AACPMO sacco_j_Page_136.pro
04c62740220a12c22882fa6eac9bae2e
b605a482975efdc2703bb280863b7baca0d9a85d
7725 F20101219_AACOKB sacco_j_Page_028.pro
f074c116522a58ddb73f99105b97c86a
868c4c7d6cd090e01d514d004d8f7567b8e326f6
20745 F20101219_AACOJM sacco_j_Page_170.QC.jpg
887a11d61c516027b24cf60fb419dd86
b5d806df1d3628ab2332974d8d7a984936d8f256
F20101219_AACOIY sacco_j_Page_113.tif
d9a042e7854a8de32483bb9410575c2a
d26a01c02b6989f14183016fd9e38f1ca5488e40
53981 F20101219_AACPNE sacco_j_Page_157.pro
6ba6c9ea5598bd3d8922a960cbddf569
33d213134feeb28761af47f4c3839a3014550f27
28631 F20101219_AACPMP sacco_j_Page_137.pro
4a493a217970adf7874b70a24c914a42
cd1c1770be938cd4b0f1e46a5aeae3b642fcc683
269 F20101219_AACOKC sacco_j_Page_089.txt
24e743b6821f20f477a2c301bb94fca9
71f0d8ee12734f61f8bb6696e82d1384fd1aa7d8
13476 F20101219_AACOJN sacco_j_Page_019.QC.jpg
5c7c1d369edcac826d960c17da5b62b9
1249d79f08f8f8685e588da3f0373bd6687136ba
93001 F20101219_AACOIZ sacco_j_Page_129.jpg
a8b2ce785e3477fa2bbaa301c6e69da9
9cbc84bf033f5602646a39a209b0c92f99e75771
65687 F20101219_AACPNF sacco_j_Page_158.pro
e03fafaf7e2b28a47410ada01ff39e6c
cc3e2f0311ca0df788c166af8f16065d922b0379
18904 F20101219_AACPMQ sacco_j_Page_138.pro
bb422b8585e634d7a33582e322d3d3fe
f3f26f1cc45aab024f29388f148c5e2947ff6934
1051973 F20101219_AACOKD sacco_j_Page_151.jp2
3e0c99fd1cb4680c40cf7857b906e6df
5619876633159cd28b2c13a895b15250e57e3ee0
434059 F20101219_AACOJO sacco_j_Page_059.jp2
7eedb9850a1eb7d09f3023d0a6d0e0bc
0f151f4e0ca475d484e015c15f8a8d8fc1e56321
64988 F20101219_AACPNG sacco_j_Page_159.pro
8968d2a223dfe07afc45624b1ef3adf9
894862e64e7cd19da80042db21a5b4f8094181b0
48989 F20101219_AACPMR sacco_j_Page_140.pro
c73701aa930d0a705cb920d77bab34c7
2df278a50b35135552376f68791d85b1c7a417f0
8858 F20101219_AACOKE sacco_j_Page_163thm.jpg
094c8d030f3d1f608656fcac87d48ebf
9818bbc2586df5bb1ef31813f5a9e862f43cdfc2
71695 F20101219_AACOJP sacco_j_Page_043.jpg
9c41bf64c659f91e6cbbba536bcac514
6e6c93ea359041e340d4a4b959e90157c9cb3337
54731 F20101219_AACPNH sacco_j_Page_160.pro
8ecbc4feb64694990f67523ea5fdaad6
5db72ff7f3ca0e5952e97e6b40f1992056fe0a44
50858 F20101219_AACPMS sacco_j_Page_141.pro
b0c71f11e52e47984bbb0b259cbcabc7
a85e4bd2e90c02e30eba3a751ca08539447df362
8132 F20101219_AACOKF sacco_j_Page_122thm.jpg
6ab139275e421404ec6c0362c014bea8
e72d7aff099820825587fbd3db1d3eb97363ab26
35311 F20101219_AACOJQ sacco_j_Page_084.QC.jpg
047eefb89f693ea3205fefd73efedf87
92b8f79bc677ece95d6a6359c80ecb9995ed7cdd
59419 F20101219_AACPNI sacco_j_Page_161.pro
3f0f203a494851cb93445c78ee5187fc
2fb2efee4f34f708d75144389adf9f5e52fd5884
46956 F20101219_AACPMT sacco_j_Page_142.pro
47960fc75aedd6d8d81b5276fe522132
e71078e17fde3535753e77f2f1668efd77c7b28c
F20101219_AACOKG sacco_j_Page_122.tif
5993c3d9695348312d2e313594628d93
8715e0496e0388e1759d952fa66b58278a1a4ac7
109 F20101219_AACOJR sacco_j_Page_002.txt
9c9f012a6957e0073d7291839d111a2c
6f3e2ad6b32a75aec5517ddb0bce6833f4965237
67410 F20101219_AACPNJ sacco_j_Page_162.pro
4b515729aad7c098c968a4d2e68e6a05
a286165e20031012e59fa1793b10d311480a4634
72991 F20101219_AACPMU sacco_j_Page_145.pro
bdee635798596361457289ec3bff0403
227fae32a5cb661a6293e044a48b86c071b4f8a4
975 F20101219_AACOKH sacco_j_Page_055.txt
aaf4cca6b4709b3abcb719fbdcf40659
80d0aa5b658fd4f72709f4722ae47074b43d7c32
986790 F20101219_AACOJS sacco_j_Page_127.jp2
025a96eac57abcffc792f19841e0d9a8
d0427fe0ef5c1205705c3e751000006a49f0d46e
F20101219_AACPNK sacco_j_Page_164.pro
32d3e32469b11ebfb8c184d5b24e91e7
6c5fa700ccf96ce11312ef18c7f848608c2b6ecf
67530 F20101219_AACPMV sacco_j_Page_146.pro
493ecba515a2625b445300082032e91b
3ce0716140ffc19060e8b6f8fad81e1650763781
F20101219_AACOKI sacco_j_Page_133.tif
9ff678aaf6a33ac3c4b5b49446124fd5
a8e995a5c48942a12d88b844154fbfd0d5643edc
F20101219_AACOJT sacco_j_Page_099.tif
7c8ac4b43ed75ea1eebd2313e0a458b9
c8391426fa46c5f3d991dd98805903518f34814d
63372 F20101219_AACPNL sacco_j_Page_165.pro
e363a478cceb5d4f182f55ff899cbf08
31f34757ffc40e7dd12e2954d9ff4b7decfb4ce0
79773 F20101219_AACPMW sacco_j_Page_147.pro
780e36fd9298bbe5174016a536f9ae49
83d999d954a9ffa95cf4606ada2aa9b72f14b42a
4542 F20101219_AACOKJ sacco_j_Page_059thm.jpg
f0227056096b23523a1564065e00b89f
1d680d98d0edff1924f43c2e37aa33d858563009
137072 F20101219_AACOJU sacco_j_Page_110.jpg
f3b16e35d8c0ec92d17590f2f48121ec
810eef3176b842641785c12be760bc319e2b8927
557 F20101219_AACPOA sacco_j_Page_019.txt
a639036a2c5afcf85202783bf5819366
39c8324012129b742176546c937df7568b768cb9
62589 F20101219_AACPNM sacco_j_Page_166.pro
50e517b2cfb54ca306ec3b6908ecf5f0
3cd8cb280d8dc93921ee9e4f464da97623e0366a
48097 F20101219_AACPMX sacco_j_Page_148.pro
461d7f7164eaf8e02030476917c93722
f5eff843969adadeabb864d0847c37b2e944476d
85319 F20101219_AACOKK sacco_j_Page_087.jpg
cd1104a059f4892bad0c0c86a4bcbefc
0afae9621c6fa410412ba4acf88f38f4224aa58c
108247 F20101219_AACOJV sacco_j_Page_140.jp2
6331626bf020353f305f7075219807b2
a726073352f38d5b4b83041bf7e7b55bd96621d2
1890 F20101219_AACPOB sacco_j_Page_024.txt
ddd2c1a18ee41e2106a03db1e81094e2
e53e718eb4024589371ea8fbb1b898d0f0799242
72020 F20101219_AACPMY sacco_j_Page_149.pro
efd0f06ad7f6c807bdba8f8433da9427
bd52749af86e33761169bd268e331663f85dbbdb
F20101219_AACOJW sacco_j_Page_036.tif
9d61709c67c4064c5efd98480270d03d
fb0d514536e0bd20b34d003e91426d3101733eb7
634 F20101219_AACPOC sacco_j_Page_026.txt
93cfd88943dc55982759856e7d3abda1
5e371252de5970d91d96021fde0ec65b7032c1fc
69248 F20101219_AACPNN sacco_j_Page_168.pro
9cd2b548fb583c4d3a0a59cea6573cca
e69bede59bca7d9acb28dfbc38f1c94d2f1376dd
75918 F20101219_AACPMZ sacco_j_Page_150.pro
8819c82a564b5cb9ead01453f3e3fa76
c72b1d833e326d7e6570abc21e96339fa7e5e99f
25254 F20101219_AACOKL sacco_j_Page_066.QC.jpg
5b9b467e088b85467e18bd296349421e
079f896919920060aa9169f96326e7f7a904e1ba
34474 F20101219_AACOJX sacco_j_Page_015.QC.jpg
12b34b059abb89d1782ccd3592d3fda5
82ce7949b0b11720574ed10471cb95aacc27a987
108658 F20101219_AACOLA sacco_j_Page_077.jpg
a7e4bc780aabc8f453098ef3c1b0d24b
e2778215946646ec344184a3175c1448c61947f4
1771 F20101219_AACPOD sacco_j_Page_027.txt
680b8dc0b2c370e6a8157c5ee51f2bca
2f153c53811472d195e5a74b94990045279b33ed
480 F20101219_AACPNO sacco_j_Page_001.txt
bbb27e29842460acce5fab391b3a2777
11b0f0982e5d4786caeec90b514650583e845a69
72051 F20101219_AACOKM sacco_j_Page_111.pro
5ef29077e45cfd4704b05ddc0a2077fa
c90d073e3014c7bc2aa547591460291b81674d7f
F20101219_AACOJY sacco_j_Page_024.QC.jpg
c2927212f830a0dedad6482af8330449
2465cf65b1026c24e80f1800546447473c1ab20d
2656 F20101219_AACOLB sacco_j_Page_158.txt
00615e71d1d1bd0a50e7fdb7ce0b681b
6387b1111a9df4127f007d342974535c8dd16141
397 F20101219_AACPOE sacco_j_Page_028.txt
ac02d53d920d5e0c34838c3332b49067
49007e30058d8a081c918348429345167396b173
119 F20101219_AACPNP sacco_j_Page_003.txt
b5d79cf024aac1b8d8c1c66a1eef3b2f
cab008bf46ab78b9949311b55858b95886b0fc72
27816 F20101219_AACOKN sacco_j_Page_130.QC.jpg
04248f0c4b477d971502c621496e49b1
a89cc44426b0405d16a79724afa8527160f89162
92737 F20101219_AACOJZ sacco_j_Page_081.jp2
32c3d7ff510211a79e901ee22e20996b
bb44884a2945135e7dd718144ed5319187a27d10
72000 F20101219_AACOLC sacco_j_Page_008.jpg
9a053d14a01ccc3a644edff2c5acada5
715716eff573ca360bf83b6884a0787a05dbc6bf
1962 F20101219_AACPOF sacco_j_Page_030.txt
cb590ef6a005d635af8b9d7aaa88058f
43babf46e0e34b7a2a328515e41acf4ef8e60dd4
1174 F20101219_AACPNQ sacco_j_Page_004.txt
d134018ed34e7f6c3d755ec4ebbf10c2
750d3033ddf59f25772e27b9e34e935c6b3c2308
F20101219_AACOKO sacco_j_Page_081.tif
4725a2a11cced2f10ed46efee378e4c2
dda1a46bf3a0fc81ebb2b86c5457c4d8b6fd6f53
1051964 F20101219_AACOLD sacco_j_Page_108.jp2
75abcda89524017dae25b6a53df65e50
faab460d27384d79efb650cbb743d08925e3f904
1946 F20101219_AACPOG sacco_j_Page_031.txt
26f3509684c08f7261a266445eafcc5e
812d585af4978f1e90adc864cc373a46b5ec8dc6
1387 F20101219_AACPNR sacco_j_Page_008.txt
a52327f63bc1b479a3b05ed01825ab6a
a302764ca4249c3a77c456cec3e1a61479651f6e
672347 F20101219_AACOKP sacco_j_Page_039.jp2
cf523d2a89805e8943a7a0115ef48f27
588a3a2a6289a49dd5160e45224dff474b9222dd
47301 F20101219_AACOLE sacco_j_Page_092.pro
75d8d347504570559d4f4db1cc103d6f
b8aaaea936f205a3bf809128643dd393e793ade0
1853 F20101219_AACPOH sacco_j_Page_032.txt
84db7a467b02f2ad3c743b286f395746
e4d8ef9ac7ead07239b6552c0483b9c226988205
2769 F20101219_AACPNS sacco_j_Page_010.txt
ea0d80c89ddd252b1e5bcf153b3855eb
cdbe7db8fc7b16a006c14ddcb0a2bdae5ca47bc6
F20101219_AACOKQ sacco_j_Page_101.tif
e6486db77810d5aff900303838a682ff
b9015501d78fceae0708651f51c6a6d52c61c824
24149 F20101219_AACOLF sacco_j_Page_062.QC.jpg
618d8c073bf7b62b58ccbc96f971ed08
ade9de8d5e5ddfba7251eaa50526801c423704c6
2005 F20101219_AACPOI sacco_j_Page_034.txt
bb1df40fabf005886165f4fc9c29ca63
8b324738b8f2993da84b3aa0b16ecb7d795c6533
2218 F20101219_AACPNT sacco_j_Page_011.txt
0e278ae36885898ec90b972b655064b1
322cc80bab3cbcd3ff75612cd89c3f3a625d8c7a
32826 F20101219_AACOKR sacco_j_Page_052.QC.jpg
9bf41ea1b5c9f3753fad156a39dd8458
bbbaa022b729dddef269b04f7f65d46ba61aefdd
103870 F20101219_AACOLG sacco_j_Page_142.jp2
101d8600961ec7bdb1c0ea45bf930e9f
bcc73c94dc3cceb3371d0394b5dda25c849f14a2
1587 F20101219_AACPOJ sacco_j_Page_036.txt
8698a7ebf6c8025f76cc56f6fdce9b4c
0696243d2ee1663ab467efbb703d2d65fba6e79e
1498 F20101219_AACPNU sacco_j_Page_013.txt
1a58a0c8d0e4ec197fe30557e2aec696
d80573536f51178a8dd32ef942f755daa3a20c36
27696 F20101219_AACOKS sacco_j_Page_117.QC.jpg
9b4b16ee576c086ef375da969bf942af
3bb62a2dc62722befd5d12d7b1f49ccc27d12ebd
F20101219_AACOLH sacco_j_Page_116.tif
899a2b1dd91917c0102a478b830fd06b
b6027d0c08bf9646f5422fca3f1accff2610a48d
993 F20101219_AACPOK sacco_j_Page_037.txt
b1feb34720316ac6a524583fb441f2b7
fe37a46ef0b6ee5e74f8a752b14f677395423c12
1807 F20101219_AACPNV sacco_j_Page_014.txt
3997248fa62b016777e687d8f069ee5c
5d80dbac59d1c4beeba5d198f60e765c9ef9755c
102016 F20101219_AACOKT sacco_j_Page_052.jpg
62ee7e9f33071b80a2c535615a48ecf6
d7edc9b8ca77126e7188e62bc2117f02943cb769
1926 F20101219_AACOLI sacco_j_Page_021.txt
a82e1f90886aa55a77a5a1457283d368
622a0f014f3c3b554182b87b5be32e99a1ada601
1250 F20101219_AACPOL sacco_j_Page_039.txt
9b80a5adb528e271f248c40b603bac99
7205db6e2688431b532c8dc4d5d045065be0da40
1970 F20101219_AACPNW sacco_j_Page_015.txt
38d4baf91aa80ef31fbad88652fc7709
84982d2b1651f5c7282f5fb60f9f5911f15c2d98
126586 F20101219_AACOKU sacco_j_Page_167.jpg
3723245aa1de8517e109831d4cefc849
8d20bb54e51b1dfb4731fffcc604bf2a4e70e32d
27996 F20101219_AACOLJ sacco_j_Page_087.QC.jpg
9e703bb515d8665c183287909d2212cb
1629f5f731066d9ab8f66220572fe145cad4f813
1877 F20101219_AACPPA sacco_j_Page_067.txt
88835f7850fb1f903623a587ee4755de
7b159fe8cf2cafbdab339dacd0d2ebefd81e59a7
1212 F20101219_AACPOM sacco_j_Page_041.txt
ed4f8f5f4b97d51784504b8c7b3623a9
30c85d5f05e2d6caed5c5df4ecb377720cf7db75
460 F20101219_AACPNX sacco_j_Page_016.txt
7cc89bd6b74260c2b7964eb29414a500
332bd41a2f30f785ae356019f079afe8221c134b
F20101219_AACOKV sacco_j_Page_099.txt
864e7b91aeb320117fb53b0ef764fc91
bbd669da3dd7469a42911669785039ef8ee38ee7
14390 F20101219_AACOLK sacco_j_Page_139.pro
537faa1d17ad64b7e29cf746371a9ba8
25f10a0f75b9714cff81bb774318eed8fc31e034
1952 F20101219_AACPPB sacco_j_Page_068.txt
ad3579a2957968e52a8c18c927764848
3b951b80314c44f0f597e35ebf7dacde0faa251a
1251 F20101219_AACPON sacco_j_Page_043.txt
d721aff03ba5e9ac6d0fb681488fbba8
e979b5b1d24a9bf16a3bd4cad1d3942e5eefe924
1748 F20101219_AACPNY sacco_j_Page_017.txt
1ca10827144ecc154625fe00fe18ac21
9828690b249bb26adf1104892554a2a59eaaca99
21619 F20101219_AACOKW sacco_j_Page_043.QC.jpg
2ed5644eb59d16fc12df673f0d06b3f8
25d1fdc9c323d98becd33c02784db0456d0c4af6
28222 F20101219_AACOLL sacco_j_Page_043.pro
e31efc939ef8d9b61d69960a878df918
bee3900b55607c75f93d4bb49d6ab8beed03c49e
1938 F20101219_AACPPC sacco_j_Page_069.txt
807a50cd03ed2c3e4ab5880ed9dbd1cb
2fa44618658d3b8cbe13e97c687c582fedad512e
1929 F20101219_AACPNZ sacco_j_Page_018.txt
90ffae0514e9296f9c49499827a5db88
b7a170347c97f5a7f71d4b57dbb6fb1415984aee
1826 F20101219_AACOKX sacco_j_Page_022.txt
cd94e81e080a5af46f7061a44ce0043f
0eda415da7377722e807fcd13832cd61c24febfe
4051 F20101219_AACOMA sacco_j_Page_155thm.jpg
c12dc335f8aa6a0ba071fd7d0083301a
65f00e528368cbda8cba821ba61d24c8935fee1b
1855 F20101219_AACPPD sacco_j_Page_071.txt
2fb4ff942c4902a4037407ff77f16e3d
d1a35788b2fc58307fbc3573e233f56e95661459
1282 F20101219_AACPOO sacco_j_Page_045.txt
b8851b50bff5fa03b124920b627d0853
b3340499d5959678ae0ede2205e1e0b2c11cb3b8
1768 F20101219_AACOKY sacco_j_Page_073.txt
c753780545667c9a0c312a0df3006d3d
b6f87e3fba4cdcbf722fa9f356d2a7b2d2f75dca
79321 F20101219_AACOMB sacco_j_Page_098.jp2
2f7e218200e6e12d239de334e30235fb
3666be722bf7d897c017b90b203564c76ef6aa3d
110956 F20101219_AACOLM sacco_j_Page_141.jp2
4230063d58e0ef811e5ab1c79ae468e8
f4d89ff418b9ab897d70bb551ece200f53350037
1494 F20101219_AACPPE sacco_j_Page_072.txt
f6d0a457e6020eb17d8c1bb3ab4e37ef
eb84e00ca2ea5513a1bbcbe4e6184dd49c01f5de
F20101219_AACPOP sacco_j_Page_046.txt
cd68fc5b75a38b7c7eb5cc6387937a92
45430935de60c8bdd34a6ed53472b0e1e42f11f2
123668 F20101219_AACOKZ sacco_j_Page_169.jpg
e3dfb643a744a9612102296c222b885c
b79c4943b3ea1bbc131fddd626a00a17b1d32363
7721 F20101219_AACOMC sacco_j_Page_017thm.jpg
ed8838a5dad8e3a3ae36530c9df194e3
e92617fdea4a5614c2dc2a1ac1d68a9bf207eab5
F20101219_AACOLN sacco_j_Page_115.tif
b56b468d33479261f8e3a992b525fd03
f1b3e3a497fb25ca78ca6027079493a40970a576
1878 F20101219_AACPPF sacco_j_Page_075.txt
0efc7e0d0a4d51f620d57421197c4dd5
130aeb109bd244e1ec83a13b7a2a9df8a3b0e478
1924 F20101219_AACPOQ sacco_j_Page_049.txt
60467fa4d93b0eb52fbd088b7eae889a
9e4d151f6cedd4b878dc2b4796d5f7bef6ec1abb
20098 F20101219_AACOMD sacco_j_Page_119.QC.jpg
02c2ab6efb69c3d203c1aae1675c7e7b
14ead8b8e945ae5170c582d2a7bbc754e3060c28
20342 F20101219_AACOLO sacco_j_Page_023.QC.jpg
a1b08c533c4dadb05e0d2b3ae1a417d0
fc4ea40f923ba3baea88b8705bafffb623cbc0fe
1732 F20101219_AACPPG sacco_j_Page_076.txt
d722148a43c09a9e4fc7f12d70ba762d
ce915ae8dab87451ef592f27062e9122b4d79e4e
1780 F20101219_AACPOR sacco_j_Page_051.txt
e83521e98083af68694135ab4e91f4cc
89e149f04be1a759a9554eade02578043a581b37
F20101219_AACOME sacco_j_Page_121.tif
fb26f1fe1c04b4609c0b59c561060a00
f514b6f3b856f9f913dbc98576164d6dcd530a01
1145 F20101219_AACOLP sacco_j_Page_002.pro
cdf999aada20559fa692940d0b7d08d0
1994b0e8ba624bab8e19cb5a50ea904f9b143eaf
1990 F20101219_AACPPH sacco_j_Page_077.txt
1d124b3b777b64cfd7f565ee8d9f0dbc
8fac7bbcee1464cb0ccc4ca249d1fe48b72b5f42
1900 F20101219_AACPOS sacco_j_Page_052.txt
f75a8572fc10a2c39912c92a60d87cc3
d5098d6f731dd18febd60fa8f5a88b642ef5b852
26862 F20101219_AACOMF sacco_j_Page_023.pro
7e84cc34c0a733dd90cb37f05d760105
bcabb85d07a18053e1e848d01e174daf0142bafe
22712 F20101219_AACOLQ sacco_j_Page_136.QC.jpg
b8910e96e79246720b0d718dd634e41d
e2c82cd2acfb93048daafb5f721dc79b399afc66
1345 F20101219_AACPPI sacco_j_Page_080.txt
670c5055d3ef7a4253d1d573fcf8183e
eed28cd0b3925de1b1abe21d47ec237664aa0159
2011 F20101219_AACPOT sacco_j_Page_053.txt
520a0223e8e185942efc1642a4d57ae5
2deee6349ee3fabef07068f5d217447665789bf2
1396 F20101219_AACOMG sacco_j_Page_098.txt
123522b1a3d9a8ae7dd1f885cc61b76f
09b6007c2cdaf58df80a914f1be3b18d4e20f1b3
137970 F20101219_AACOLR sacco_j_Page_162.jpg
14816b8b0c34a74695e18cee733ae226
c745e6ad48647468a9729da7eb9930ed650a170b
1684 F20101219_AACPPJ sacco_j_Page_081.txt
15d2e7775b9eeb45390da4e57d981400
57f15fa4eafda7d8b52248fbaf6c0b1137b07b94
1571 F20101219_AACPOU sacco_j_Page_054.txt
46761a0b408f6ca9caeda49e44d41ebf
12c086ad0d2eea557a25a8d7621da4854843f61e
2550 F20101219_AACOMH sacco_j_Page_167.txt
3dce60a44048c0f5f8bde88a32df4d07
5d730d8db0869073296a949d920b90b278f6d396
105481 F20101219_AACOLS sacco_j_Page_086.jp2
bc4ef722635fc160b88a07d4019acb15
f573cc2827b28ccc0e90b9d8cdb76aaec9e6875e
293 F20101219_AACPPK sacco_j_Page_088.txt
9f9ef21dc012df6c1c4322659653c73f
798e0ef25ae270301eb698ae5b14bd397c020143
2023 F20101219_AACPOV sacco_j_Page_056.txt
efa9c5275f889b9f6b6ecbbfab9e87b6
367869b0be0199bd3117f850c7ec36f80fe4c5f1
108728 F20101219_AACOMI sacco_j_Page_068.jp2
00f24894a37c9373868b3d4d11b8c3ec
3fb5a0297eb88c7aa607690e5018af15ebfe6878
80057 F20101219_AACOLT sacco_j_Page_064.jp2
272a80ed5302482c6a46126ca5ac5def
40c2cbd585b7e55cd2e4d54aba0cf79fd4b032b8
1060 F20101219_AACPPL sacco_j_Page_090.txt
9c3cf1afa905383ebc9baefbc697e119
4ad969492844ec93d237feddd29895c103844756
283 F20101219_AACPOW sacco_j_Page_059.txt
d4627da4011c2365f18fb10a59ddcc1d
aa6377ef3d3945f3faf771bd8d10877c328b61dc
789 F20101219_AACOMJ sacco_j_Page_134.txt
935c475b5d09f06cd85960d7a95a61bb
0958c04e4fd5319f01b2d2b8bc99d97f0ed681cc
F20101219_AACOLU sacco_j_Page_032.tif
7dfab6da28c68b707f735b0342ab12fe
3c982ba67f089b85b6f4debd8eaf52952654501f
1996 F20101219_AACPQA sacco_j_Page_117.txt
ea00249d0a6d44e89164c1d5a9402edd
2863abf859574b8019e787586d5e69cb19e06bb4
2130 F20101219_AACPPM sacco_j_Page_091.txt
ef30dbdc202f73e45f17a875eb0a6aef
18e345491203bbb6b2e0ddc04fa02387de00060c
F20101219_AACPOX sacco_j_Page_061.txt
900fac658cb2febc443bd0e70ed470b1
2bd9f9001fd117a9e972b40ff2908bdd022c8455
1051983 F20101219_AACOMK sacco_j_Page_123.jp2
caf8880df391a38b88c681dd5b78f309
75cc11ca1a180be1cf37d1a3f29d6eefcd658f4a
3351 F20101219_AACOLV sacco_j_Page_103.txt
a413910845dbbaa259c3599040056f82
c389e53f55f399707b4a1467d04824b06510a5c8
1070 F20101219_AACPQB sacco_j_Page_119.txt
e806e5880869b50813e3a3d0148c3b23
1a7cc9eeb6fedf05e57c993c3322143812c69987
1907 F20101219_AACPPN sacco_j_Page_092.txt
fc72e2f980975b25194eb16377b15b58
edfc4db75e72e1f7d5015bad5d1c9509e8eb960a
1403 F20101219_AACPOY sacco_j_Page_064.txt
5525262e9f098ac5620ebe07a4d960c1
0c003d530627e49262056607496ef33f8ab23bfe
F20101219_AACOML sacco_j_Page_033.tif
791b2ddad027d0742126f35178f4dc96
993b650cf982f5861644a78441732b83643fb07c
1912 F20101219_AACOLW sacco_j_Page_078.txt
659261ed81267ba77ed6e99fc240bd8d
d1c8127e592c89946a135b5ace508d823346792e
1984 F20101219_AACPQC sacco_j_Page_120.txt
edba62276636eb79bb7572e560ae12a2
3ae6038388b3a4070907edf1262786e1caef1d07
1493 F20101219_AACPPO sacco_j_Page_096.txt
155122305612f3951c62775db1212433
724adc4c61a9387576f99e0cf2ca315a2c34129c
1397 F20101219_AACPOZ sacco_j_Page_065.txt
4898e4f579bea50e36d03c2bf1b88e91
be30411707b404ee3e95e6ed93b378750880571e
1969 F20101219_AACONA sacco_j_Page_029.txt
634bf8a94659bf1ffdab2f97ff46efbe
6477441a10845a2a526a3b182dd6c4202a89e2df
32400 F20101219_AACOMM sacco_j_Page_097.QC.jpg
6084cf640fd480cc1811d4204782eb96
aa3396a950374d792da51d611182b95742325ff8
F20101219_AACOLX sacco_j_Page_160.tif
9ec6c101eca0c91f2c664e24e99aa59d
aea893d4a9a6d68236cf35574547b02b3c7e0927
2737 F20101219_AACPQD sacco_j_Page_123.txt
5305dc64ef3bd191fe1a71a959b0ee37
aac7d90ead66eeacd1bd563b531b55daa16ed433
4338 F20101219_AACONB sacco_j_Page_060thm.jpg
6001ced220e792e07638d3f9b5ee64de
02152e3c740c7d20507ebe44d027dab5d5af62f9
6813 F20101219_AACOLY sacco_j_Page_062thm.jpg
05208ef15905645ae02464431aef7d88
9a7709c91ac522f7850b217a3dd2ca8f607b1585
1564 F20101219_AACPQE sacco_j_Page_127.txt
d69361481c298bf5fb1a72a20dc8fe1b
7c14065797c0cb0749deffb57ebe19fd78cce07e
1850 F20101219_AACPPP sacco_j_Page_097.txt
84652e7b6c7c97fe331980390af88d62
aa6bdc51126bfe380401190d8c291118caff1a40
96313 F20101219_AACONC sacco_j_Page_017.jp2
2f703f74f1ffd2b0a5dab27038e2cd24
cc5bf6bad590a36a79c22e69d83e5c42489ddeae
F20101219_AACOMN sacco_j_Page_085.tif
036b4674a2d7fde7bb8e8d2c85615813
f1ffd841f6f32a244ec79eb48fb70d4cbfe77eb2
103852 F20101219_AACOLZ sacco_j_Page_067.jp2
24acced4dafaeac828fdf6981a863031
f01d75599af8a466e34b3bcafc286f8786ad0f96
F20101219_AACPQF sacco_j_Page_129.txt
0b6421fa3f1acc6dd005be69f61f0888
8d8ed4e328bb72c69aeb61340fe9fd7894862734
1624 F20101219_AACPPQ sacco_j_Page_100.txt
0c4b3cc23ebe6cda11e975eaaf668042
0082992be18e188be68209a9fbc1a9f6f0c27938
F20101219_AACOND sacco_j_Page_046.tif
383c332ebf5c0fe2b8571bd8a8a852dd
30a45f4d6012c02c0f147a733da2ccc4194073fb
25904 F20101219_AACOMO sacco_j_Page_107.QC.jpg
f5dd50111b19b32fdf98184e29d36ae5
0c65d339d8cb0053d912b688dc4aa33f16d8d174
549 F20101219_AACPQG sacco_j_Page_133.txt
d616f44aaa751e14fb9b9fb2bbc03339
fdd08c3cd123c5cad513548d42bef7b9a304ffa1
1840 F20101219_AACPPR sacco_j_Page_102.txt
eba29d5b03634ad0d8356c69c21298f6
5daa32154a12f0a38800b05a8d5df158e4741406
5660 F20101219_AACONE sacco_j_Page_137thm.jpg
19b582fdd974af34d0b84c23ad5ee3ce
04c5be9f0ea997469811a56b6c3003420db198f7
102298 F20101219_AACOMP sacco_j_Page_155.jp2
a75993da5f30d7e89e1e3a1643082035
e0d7cfe7d3726b65eb2808cc6668d44439d37f11
1168 F20101219_AACPQH sacco_j_Page_136.txt
3ab06575552b48bee0f042d1882309a7
ae605e2faa5a455273c9b65e35f2f96ceb4effc0
F20101219_AACPPS sacco_j_Page_104.txt
3c2dec878a840dac65bc6bcf3436ffb3
305f6b49f0c9cc3eb8bc2a32832b05e6c42dcf13
87346 F20101219_AACONF sacco_j_Page_148.jpg
ca72c4562fb66bd0e0c979c6a463f1e6
64b8226e1e71e5b6c56e5cedf402dedc75f6fee0
F20101219_AACOMQ sacco_j_Page_169.tif
a14730ab5dc42661221cbde9610db68c
fb11ee05faad9d59615d6811b3869c767a31dd6e
1216 F20101219_AACPQI sacco_j_Page_137.txt
ed3fdaf8591c79a0a4f9c92f6f722828
ac48d87f192914ed87718ff60bd2f3e89fd5e787
2949 F20101219_AACPPT sacco_j_Page_105.txt
f299f4434a8c860d5bc00de7ec36e9d3
fbe8f7ccb4d0b9bae74ee106627fb31d6f407326
F20101219_AACOMR sacco_j_Page_129.tif
287084e550b64083cd7785cd886f5daa
9f0e9b15cc23bf60aa03aeefed9997232a0b97c6
1248 F20101219_AACONG sacco_j_Page_125.txt
680a1b453304b51b85987c1d6966b66a
81868ab10687d9824ddae7836ffe47becf6d9134
1973 F20101219_AACPQJ sacco_j_Page_140.txt
a6b4e52a59da8b98f0ee87fba7b11cbb
e51a45dc6faa51e3bc881499f2345efbfb7e8212
1711 F20101219_AACPPU sacco_j_Page_106.txt
da8bf8d2d8a8d19d397ae96a81936db4
2122852e3bdd3515a4027bc07534f67349fd4684
33542 F20101219_AACOMS sacco_j_Page_080.pro
df2792c60e96ece9e462d0c16f268e0a
2e9280c8c4b692e26072cac690b8bd71b1b4bc11
35447 F20101219_AACONH sacco_j_Page_029.QC.jpg
83a46824cbbef6745d686279033dd5a3
2796db26d768bea5dcdba31172995c186ba42c6a
F20101219_AACPQK sacco_j_Page_141.txt
9263e37b5d86f215673566be409f73f5
5f66a82643050ae6ceb52cf2bed33faa3787a65c
3167 F20101219_AACPPV sacco_j_Page_108.txt
630bc7ebf332363fbe84fb979826edf6
7be67188ad9c09b9d3676e63ee517fdce0ee4a38
107829 F20101219_AACOMT sacco_j_Page_029.jpg
998f4a08a0378f93c1e25a2d54207164
580d9cb1768db9909866f2f74dc6774864ecc2a6
F20101219_AACONI sacco_j_Page_107.tif
2da38a705d4eec9431da8e2d7fc27cd3
3433c70343705e9dc138fc6719647b011f6e1ff1
439 F20101219_AACPQL sacco_j_Page_143.txt
73ebfac1c7c14d9d9df321ed8885d853
5436ea640bc7c11ee0223e1c194fdb0bb8aa6875
3282 F20101219_AACPPW sacco_j_Page_110.txt
8a182fa24d13e403df59694856f42969
29087d3617b5a3e39923e3ed7958408e981b6c04
106352 F20101219_AACOMU sacco_j_Page_078.jp2
12e4b0ad038d772fd0f71c01d5e71c41
d9c09cca103ea164e5db9f90d46ef03469f33067
F20101219_AACONJ sacco_j_Page_108.tif
7809980f8b45831cdf90734cdcfe51e8
1e5229a094768a791d2f1a5ca33fe0998e302c34
2579 F20101219_AACPRA sacco_j_Page_165.txt
be4b14fdb8710701720d570e164ecc51
d72601364ac99b83939a2f86dc974b7865f09473
1747 F20101219_AACPQM sacco_j_Page_144.txt
dec847234d44f26ffbeed7f1f5d008d6
8bf709ec50eb93a33367b6a58249008863e467b4
1656 F20101219_AACPPX sacco_j_Page_113.txt
7762bb871710069505e2db9c055c6fb0
1b9b9aba687cd18806311bbb5d4ade31b3b39950
27973 F20101219_AACOMV sacco_j_Page_045.pro
2cb8ada573ee372fdef1d38ea88b91e0
7cb18833b9a86d7257d7e9815eca0a5af2bb5503
F20101219_AACONK sacco_j_Page_106.tif
f4838f56547d557380363d08ca00b74f
e126acf583eebe8c917737e39b7e2ac53406fe0e
2545 F20101219_AACPRB sacco_j_Page_166.txt
1d08525b5ca472579b44daeddd8e232e
e990ab05e9ae0570d5432bd950f1c56668280a56
2824 F20101219_AACPQN sacco_j_Page_146.txt
a3e5165400971c10fb29f6f05c55d6c4
a564e90cf2ab5f037ec255557914f1127b26ade0
2634 F20101219_AACPPY sacco_j_Page_115.txt
5f784559b9ad13b2677cf79a965039dd
50842d4be834a622a6d3e6410b02b5e438a64ca3
2105 F20101219_AACOMW sacco_j_Page_155.txt
96243b7d3b6a11999f83583422229d96
60718805f79daee1d3ac26b8c38a16b894534256
37060 F20101219_AACONL sacco_j_Page_026.jpg
dd366560b46e5dfbb35f3064e0075ada
ab2116ea90f6e7f4c885de0bb8613432291b2124
2811 F20101219_AACPRC sacco_j_Page_168.txt
398550bb9a3ec675bca3cc674a2e8a1f
a897f26096fa5303111acfb2970990009a69da99
3349 F20101219_AACPQO sacco_j_Page_147.txt
59b0ab558bb9d13be21d5db8e9639716
64f0e5f87a86301488c6706e6beb168f67e41199
1083 F20101219_AACPPZ sacco_j_Page_116.txt
ff63d4e62d730bb834caee0b7d9a1550
d8db081290939573f4164be9376b5d279c2f81b1
140282 F20101219_AACOMX sacco_j_Page_158.jp2
a5a3ee569232f9281f19fcd77216bdef
1ba8b8cb2f21d6ffeb6e9cd285b7fad97a005bf7
20027 F20101219_AACOOA sacco_j_Page_008.QC.jpg
62edadaafca82cbff218830413f8b2a6
90f41c8ee0a35a40882aedace242f4be8d6956ca
35833 F20101219_AACONM sacco_j_Page_034.QC.jpg
9df456d37431d1314161972695440d84
c5b0857731f8efb1d0ff504fe8f979572e5a24df
1200 F20101219_AACPRD sacco_j_Page_170.txt
1dda15ec1aa897477739de9ae79bd96b
1bc06156ee085e428627ec13d8bc17427795f625
2029 F20101219_AACPQP sacco_j_Page_148.txt
b9fec5d5cb7e1ddb6582bb134117183d
2c064b3e54c95b1add110e95611cb37e7320fdb7
1049257 F20101219_AACOMY sacco_j_Page_109.jp2
36197cc36223d5483997477ce2e0f381
95a0e4a8beb90febe5ee0f096318959bf8e77303
15254 F20101219_AACOOB sacco_j_Page_028.QC.jpg
0a413050c74df5800e4aae16f48e9149
93548aa2a0e8fea10e2f9812c8fa5ec9fd758b6d
53697 F20101219_AACONN sacco_j_Page_011.pro
bc62c70f8e11f4bbda9da733236fadfe
0593227cd50655471b1d5ab467916c3b10d0d556
2345 F20101219_AACPRE sacco_j_Page_001thm.jpg
a56311ec3bbfd3bcfa5cbc78818f8076
e6de441392ee622058689ad3272f898d5f412ff4
1051967 F20101219_AACOMZ sacco_j_Page_105.jp2
3293104a618e93942bd5336f0e54ec7e
348d9c86cbf1312eddcf179394a1ac9c7348695c
109113 F20101219_AACOOC sacco_j_Page_009.jpg
b536cd564e80bc86bdf1fa5c7c6607c6
bad9ac7d67930b854bd23a675d476285780abff1
9012 F20101219_AACPRF sacco_j_Page_126thm.jpg
b4f82f22810b42dccaa661b97bb544cb
0f58010666fe791e786c351cfb17132d66022970
3008 F20101219_AACPQQ sacco_j_Page_149.txt
5e3f3c7875096f8000e4056527710bb6
0e9e624a4783f1b84659becd7c76540e71c99caa
1782 F20101219_AACOOD sacco_j_Page_035.txt
d49c1242758f32d2831d0f83a7660758
92669a4d4dae288e35240e4f56db2c95002a665f
5855 F20101219_AACONO sacco_j_Page_146thm.jpg
fb8daa276ea761bffa763f154c85367d
a57668dd83d0a975ae2916b25fba30ff916fe69a
5616 F20101219_AACPRG sacco_j_Page_045thm.jpg
834edbf4e04100ad862f903958ed61f7
66722751335de0fd8f6e28ef39d4e17d0de91cd9
3138 F20101219_AACPQR sacco_j_Page_150.txt
07c5b7f647ae7e5e70dda390431159aa
79d4dfbbcbd10aae718b0d99583945d413ad0d8f
1104 F20101219_AACOOE sacco_j_Page_038.txt
2d88f601998f0728e2602da5c3a96de0
671ee577e58dedbf405bef2add82f2e413ed719f
1808 F20101219_AACONP sacco_j_Page_130.txt
f8e24bc23513a461882fdb5aba26ae83
949d5eff0fb8f8a17aa936a135b0b7c53945ebea
25436 F20101219_AACPRH sacco_j_Page_115.QC.jpg
994c0d46afc7ef1d79186db3443476ea
e146df474380a1cc4f6e7a4e76f88e38361aa6fb
2562 F20101219_AACPQS sacco_j_Page_151.txt
fb3f0832140049dafbd26e2c206445ea
8ab28b0211da750a9d1d9f92e56a3f66d8a46e5a
1805 F20101219_AACOOF sacco_j_Page_050.txt
7ca314ad77f94d6b46e825d9194b91ba
3c45951aa4aefedd436d4a49419d2e1afcb10eda
F20101219_AACONQ sacco_j_Page_094.tif
85dbb75671ff6c86a4c254bc170cc645
f9c27509209061e21056f58df8f6e08d250ae6b9
34536 F20101219_AACPRI sacco_j_Page_053.QC.jpg
203255a3f21ba296104801deda07ff09
7da6d0eefe0403670c0f905232c4970b8e49195d
2339 F20101219_AACPQT sacco_j_Page_152.txt
dc5704aaf230bbb7d90c92501f432ba6
2f8f0ef988d953df497d9d85304d2deaec334877
6980 F20101219_AACOOG sacco_j_Page_098thm.jpg
335fc44acd08bea2cd621a7516941d41
a4923d1a888fa2dd8b11a9a430eaa62a514461d9
2054 F20101219_AACONR sacco_j_Page_126.txt
34d9401872e73e8f4458005a3a6775c5
0a7450bc6a0864ba4d1a9517cb9a485f3a742d86
8421 F20101219_AACPRJ sacco_j_Page_069thm.jpg
e7b0dcb30db97005c213ae5b3387dc91
bfbc70ea4cad390d44ddcc5a6ead469572e979ea
2483 F20101219_AACPQU sacco_j_Page_153.txt
3cfb56140c190ff09f2c1640c37b3443
96bce44531225474abbf010af64b6fa5501a3e3e
104807 F20101219_AACOOH sacco_j_Page_046.jpg
9b5ce49dabbbff6e9c7c3935beebe2a2
4c7634c0dcab7906262d2a4bb908f36c81a98a1a
28126 F20101219_AACONS sacco_j_Page_004.pro
d7657ed72350d2d01b5a02ef5d51a0a8
d1cd993ef5b61b4cb4896dcbec6dd3f164f42ee6
5647 F20101219_AACPRK sacco_j_Page_004thm.jpg
c722709c605416d5fd7132ef6ba471f0
05798f951f63f50cdeea99f9a821a0fcc5ee0660
F20101219_AACPQV sacco_j_Page_156.txt
9bcf3f139b9c610adbc0a6c6a7542bb0
d8918dc2e39d8e11bfc29afa71e92c507ec3d0d6
1051976 F20101219_AACOOI sacco_j_Page_009.jp2
1e892003b7878399203472e95778a050
aa62f3b871a43d210eef5e40019f951d379960a3
102228 F20101219_AACONT sacco_j_Page_047.jp2
d477af073d9859fcb0a52466e7124469
c6b35c87b0e87ff8c04eb6c6acaaa7d173e97ecf
9081 F20101219_AACPRL sacco_j_Page_077thm.jpg
8fcd038670e8577ede67c6ec4ab1aa84
016af6325ab1c6529a92dbf0a89d959c18459871
2195 F20101219_AACPQW sacco_j_Page_157.txt
d96ee6deb6c48ac010c015c332c1da35
4dd540da0011ad41451084936bc501367fc0ac08
29767 F20101219_AACOOJ sacco_j_Page_081.QC.jpg
58fd0227d4fcd6c4ee78cc859783d433
d61e6d714c2afe21135634977b5cf63bc69340db
3635 F20101219_AACONU sacco_j_Page_089thm.jpg
142f343eeb091e33e2b93ec74042a75a
b4704314dfa0e0c17b2b26509020c58cc5dab073
33882 F20101219_AACPSA sacco_j_Page_086.QC.jpg
a72a050f1ee747252cd0ed8a4bd6ce2f
3f31215cbf858ae18dc05c1c92ef33b9dc317992
34855 F20101219_AACPRM sacco_j_Page_092.QC.jpg
88072b04f03f672d47732e19e5133591
b21d671107bba636a5957e3b2ca67bbcf83a0e00
2638 F20101219_AACPQX sacco_j_Page_159.txt
edccf83e25b6c7e3515104f84aee0412
83e7fe4a88f36c27da7091270e003b62c2eecd3c
154581 F20101219_AACOOK sacco_j_Page_150.jp2
79385c057f85b1587670b104b1f46795
de0f756c6a34b70e88cfd9a7bde2cb61f4148fce
6853 F20101219_AACONV sacco_j_Page_012thm.jpg
8cc91d384511b4b35e1f993146bdfd78
cc681fb95b9510b83cad4f4516a5043764af972c
26050 F20101219_AACPSB sacco_j_Page_153.QC.jpg
73858ef3b4f7984fa0e19905b9051062
32b79cfa6e5556bc546e5b1ec8ab69b9a2494154
7652 F20101219_AACPRN sacco_j_Page_076thm.jpg
5a2a862ebb97f110ad7468dc5222ccc7
df6b9cf93344c0cc8ec2270b290914ef115d9d3a
2432 F20101219_AACPQY sacco_j_Page_161.txt
e793542f945fc315fbb2fe2df7109f54
d1de47ba954b5a2f4957d7da62203ab47d072245
96063 F20101219_AACOOL sacco_j_Page_051.jp2
7cd9f04f3d0bc15e3fd9b5a0cbb86231
6ceccdcabc015caeb4ba0fa0167f92467a123875
93921 F20101219_AACONW sacco_j_Page_051.jpg
c2810f4f52ab2d848619791c3054b4d9
16fc5e0e6aea42d609135aff8a88b4002b9c860d
33719 F20101219_AACPSC sacco_j_Page_147.QC.jpg
aa1cf75ea0f094e0f2152401722a323c
cf653462088e6d7828dfa13340512901b5274b34
8099 F20101219_AACPRO sacco_j_Page_088.QC.jpg
00db37d8f32408a7f4ddaafc1cea240a
fdc5b08e2055e0feecd57b9f271d8853c8a043b9
2709 F20101219_AACPQZ sacco_j_Page_163.txt
74ec3814b60e7ad3704e5a83be2a4239
43c852fc4aab1ac2e575a378549e178a21f1a457
830804 F20101219_AACOPA sacco_j_Page_124.jp2
da0412fc35ea581ce381e6d9ca3215bc
9680aa43c139cafff28183559f2366cfc25cb76b
813 F20101219_AACOOM sacco_j_Page_139.txt
22e5837d208b21cca43fc58a566a35c8
5e2f49f183bdb38f1bb599a9c40eb6eb33ec8a04
20785 F20101219_AACONX sacco_j_Page_156.QC.jpg
bdd11d76dd024e30056273a8f2891040
fdc1120632585042557e4f77cd2a44db38fd5fa1
8759 F20101219_AACPSD sacco_j_Page_097thm.jpg
4665004fa8ec17de59e0dcf83a9dfe4f
a36c81ea7865dba7af1451c88135649fa3267f47
23868 F20101219_AACPRP sacco_j_Page_005.QC.jpg
31f75bff28d4e45f15ae197338bdd38f
44a0d80444874b992bd626f7f75c63ea7dbcbdf0
1312 F20101219_AACOPB sacco_j_Page_058.txt
7f753681f02e827e593c9856cd7068ad
5bde7b298345c58ffbad650e6b429b94acd1e708
F20101219_AACOON sacco_j_Page_034.tif
d21653262b9131b99b6c60c037e839bb
0e7aaf541581d9daaf3bcb05931a25911034446c
F20101219_AACONY sacco_j_Page_005.tif
cc4e1507becd2e7ae449dbe7a8704d70
5dcdaa44eb1a089075b99fdb1bf93aa31eaa9e5b
8990 F20101219_AACPSE sacco_j_Page_031thm.jpg
7c312ba14faeb0b2b53d405eceba3984
b4b3726d2d1f4e0214a2292af5304ac1503ca5df
4047 F20101219_AACPRQ sacco_j_Page_156thm.jpg
ac0b373b6a123607b3eb7865f18c839c
babb1c65759152326306d179660aaf3bff0499f2
43164 F20101219_AACOPC sacco_j_Page_063.jpg
0c603c976e900143043fedddf97fa623
e801b4fac2d83bba20f3a3639d9f3bff9b2ee03d
1960 F20101219_AACOOO sacco_j_Page_033.txt
1bb4cf03866625e04d5ac580a8252890
c298f94ae1ed3062166aa98e90f06010e3896453
32527 F20101219_AACONZ sacco_j_Page_095.QC.jpg
c1b171a552aa79b02e55b4137680c39d
42193cd9378dbf5214c69191f98b79f486a65cba
7723 F20101219_AACPSF sacco_j_Page_108thm.jpg
994172d5208d33dc69fe49139468c1f1
8e86fc8c0628bd932bd262fc1965c7bac6b7bccb
88045 F20101219_AACOPD sacco_j_Page_099.jpg
1223f1033c7724cadac6a798d8bfa65b
ae758b3af97aafc1cb9f4e76fa8f57ab1d36f54b
12771 F20101219_AACPSG sacco_j_Page_038.QC.jpg
13f4ea80ab218c2ea8b6539aaaadb675
359f2ab1631c7dd114e911f3d31702506088b3dd
5269 F20101219_AACPRR sacco_j_Page_135thm.jpg
02d6c4783cb26e2d9920eccb48c39422
33be4fb2ef351e919fa7bfdd57d411bbd81ed008
48214 F20101219_AACOPE sacco_j_Page_005.pro
182757fcd63677f960ea143f05ed0424
56b8a2f0532da02a973e4552b1b432a102930b3f
49133 F20101219_AACOOP sacco_j_Page_069.pro
c8340031d79149d3eee001e6821b2457
e707d2eb91ce3d6c5603f18b38281df18d14b751
31248 F20101219_AACPSH sacco_j_Page_145.QC.jpg
6fe07048578b239c30d56fd6bde24826
058395f2cc91b5d877db9d3555762d59db1d0c0a
38679 F20101219_AACPRS sacco_j_Page_163.QC.jpg
356f181a4712c06f482477e97dce483b
fe7fd00ba8e1b5afc369c23ae17520b274ccaae7
72099 F20101219_AACOPF sacco_j_Page_042.jpg
da2b7ca8ce903e7f8b420fd0836329d1
0cc3f8c46760267e0ca4df7a6be34103854c90dd
598888 F20101219_AACOOQ sacco_j_Page_022.jp2
38a04c3c24c6296485f8b6eff32a4d56
3d07148dc2d557c4d102f5ca2b86beb8ad9c69ed
3195 F20101219_AACPSI sacco_j_Page_026thm.jpg
8a0e43916b3922db8bb98c2c9f2fcfbb
6d78a0dc85f3ecae6d213d566cff5ed6cbb4730c
8658 F20101219_AACPRT sacco_j_Page_078thm.jpg
0a6e8f981dceace44e307abb2aad5207
56593987da900d077bceb6b2080c3305247247ad
790173 F20101219_AACOPG sacco_j_Page_113.jp2
1a804a895f72a4c67ec0bd821840c05c
399865582441fac2d8f9d9fa3645f346c7137dd7
6211 F20101219_AACOOR sacco_j_Page_125thm.jpg
65107f6302e3b26892bdb374e697e4f6
c82c871e74fac554f9090ac7077aa918b98486d4
27405 F20101219_AACPSJ sacco_j_Page_098.QC.jpg
5e8c88eca10768a292889fe03b1c40b3
bd982873b71ef5ce275edfca27bcd1e75247556a
6828 F20101219_AACPRU sacco_j_Page_025thm.jpg
a44c6c0f256b96489b100a7e52c2e3b3
b1daf570fd134d55e9e3eeb4d74983cc491a2165
136325 F20101219_AACOPH sacco_j_Page_146.jp2
2805235dd7040567fb293ccc25a0cd76
ffa971e1d170beb324b29659ef725eeaf3a1e8c9
85361 F20101219_AACOOS sacco_j_Page_096.jp2
5c388a108c4ee4516e5640b56f197145
a6eeae80734df9bde01d607b31ab59bfb59da230
8385 F20101219_AACPSK sacco_j_Page_048thm.jpg
0fa14c4128c551252cf0d585a9824a1c
aed7fced9c8267e99300a24b95f274693ef65f5a
9228 F20101219_AACPRV sacco_j_Page_105thm.jpg
eae92bd31a18a04f3ae538085a2b0333
a77664fecadc7eb367530ebca427069dd5dd76fc
91560 F20101219_AACOPI sacco_j_Page_155.jpg
97a22c77abdfd925f4be8f909a6aec06
5c2e68dcd7379ff0b1d6c1d685a4e7dbc92d3955
94766 F20101219_AACOOT sacco_j_Page_014.jpg
f6363d7c1f827c580971981c3fd8dcdb
aa18a6bed2cdc065eff17e556469a19d08913d00
14847 F20101219_AACPSL sacco_j_Page_138.QC.jpg
f87f3348be47c55db8a504fae29e8ea7
5c3f1a4908163f314c3185cbcf08e8a7ea39c70a
8847 F20101219_AACPRW sacco_j_Page_053thm.jpg
fc2d82358a31137f950228d5b624f47b
d24d0ab77c9f805235d7e7f3b6a9f542769e5a70
F20101219_AACOPJ sacco_j_Page_135.tif
5796daec7d25f2415f47c666d92fc3cb
faad7145226ca97c9266c70c2baef000a591c1fa
2593 F20101219_AACOOU sacco_j_Page_164.txt
9a4ba7e47152f1d28ec101e9f7002021
aa0fb4b99180414ff4a49cb486c16feb8e88dfe9
35763 F20101219_AACPTA sacco_j_Page_159.QC.jpg
4183dcb2a92efa7fbf03a26b364d5fc2
ad6a4ba0471e84f395fb716c4af296b29f2a38f8
8260 F20101219_AACPSM sacco_j_Page_052thm.jpg
c3ec3b7b53adc9c7831640ee9095a6d3
1f55414a95d3754a6f89e8f3bbfbf3157299a625
30102 F20101219_AACPRX sacco_j_Page_100.QC.jpg
3c440e8cd9d0fe350e8c6a9380ea4ac6
03db3561e283b202c12736b5c8ca13a5ad34a5be
1756 F20101219_AACOPK sacco_j_Page_057.txt
74dfedce26ecd1e25697defe0a56b907
177610666db1eca0034f6088b279c1f970c7736a
F20101219_AACOOV sacco_j_Page_084.txt
de6821d1ce99c4c387ff91b55c3dd64e
ba190c47f2a2cfd7fe4d78697f31ea16cfcee90f
9244 F20101219_AACPTB sacco_j_Page_010thm.jpg
4a74d0d31dac5e0a4c9a27b77abaa65d
d73b0aba776b11d923475a2dc89684ad9a8e233a
34039 F20101219_AACPSN sacco_j_Page_070.QC.jpg
f7f1e0d69a7528e672b5fa746163ad20
63cd398b8c62a2cf919e2769fcb5ea7b950fdbc4
26951 F20101219_AACPRY sacco_j_Page_076.QC.jpg
08f3023d10228fdf5d40b7118cffeef2
5680c0863d6a6f148194e542292b0dcd21d55ad3
F20101219_AACOPL sacco_j_Page_019.tif
c3bcfbe3ef27be5deccd2fb375a6501e
a6bcc094b1c5ed6047056efa1a0a697dcaee9048
57514 F20101219_AACOOW sacco_j_Page_006.pro
f2675b8e1b62ca0763ae28aff03a87fa
0a29b841bf19acd7b5a643dc7253f8041303c798
8630 F20101219_AACPTC sacco_j_Page_164thm.jpg
60ca5e87f189b59aa50bf8a0d3700dc9
9e9297f0575847c20b6831602936d7b1ea8b58d0
5392 F20101219_AACPSO sacco_j_Page_170thm.jpg
df1b1620f3bffe1f1f4f1c848eea3206
3fa7df6d919c714829d1ac41c265f7d71c4b863a
30727 F20101219_AACPRZ sacco_j_Page_014.QC.jpg
ca39a4014c600cf101356e81b99e2617
b75a6da5c638bfbd691d04e7ed01a0296194670f
4373 F20101219_AACOPM sacco_j_Page_154thm.jpg
6347f762f051f599aed481f128fea061
3f7995cd386fb37d1ffe9b1a7a3dae945856c6f7
1509 F20101219_AACOOX sacco_j_Page_079.txt
b8c70d071e681644153e3b23c2970eca
199828559498a1da2d3969aa081038cf44aae0d1
1722 F20101219_AACOQA sacco_j_Page_012.txt
a3fde2a12d97206e7612dca521b956af
adc808b05d84f6a7f0f322f957495fb0cb2b340f
252548 F20101219_AACPTD UFE0015605_00001.xml FULL
24733f68e95ad2d9bd42eb328cb7c36b
24e2f2cd1a395e7ca7b438c7cec691d6ddd04faa
BROKEN_LINK
sacco_j.pdf
7933 F20101219_AACPSP sacco_j_Page_007thm.jpg
6b75d3a044f58aaef7055a7cf882f18a
ff1d4ef6b6b5caa14040895e420b9f20b11d8878
25926 F20101219_AACOPN sacco_j_Page_124.QC.jpg
be9f6acc6d66404213c3527ffa8ff310
0f37293565948760ec222183b418adbd719e5069
5519 F20101219_AACOOY sacco_j_Page_153thm.jpg
471fc63c2fa4fd671bc7e16174261690
28fe2513fa6e3bbc0c5c565ed86a90ea8b2ae68b
102323 F20101219_AACOQB sacco_j_Page_156.jp2
a477c3be739586e8190614c7ba4af02b
3d1c21100a04d9d76b9f8a185a82b8fcc6995bd5
8241 F20101219_AACPTE sacco_j_Page_001.QC.jpg
232feea8aaf54d451062b326dbe0cf6f
d52b3bf5818032a409b108493aed927496d78cf1
32630 F20101219_AACPSQ sacco_j_Page_149.QC.jpg
97a51a3bb38ab97305482a0df8da8b07
5e8803fd55c29ad4923edc8bb3152fc0ef8aee11
36296 F20101219_AACOPO sacco_j_Page_164.QC.jpg
8143a31b05e28f06dd3cec38833c3ffc
8a104afede14924d68c2a9ab0bccc7dc05fcafc5
47948 F20101219_AACOOZ sacco_j_Page_138.jp2
3e45e681b1a55444fb37b85934e1d927
0388494e52756eff98d36f58bef4ffe5b97480d8
24913 F20101219_AACOQC sacco_j_Page_091.QC.jpg
52697aa5d9048628ab7c0be01d7bb940
8fff0a4b30703983cade5ed96d47c9dade57603c
21588 F20101219_AACPTF sacco_j_Page_004.QC.jpg
e6ddeffaf9d0dd62c194e57f1e0eefd1
5b57c38c7a99f8f0e37307ab21e91efeb92353b5
8601 F20101219_AACPSR sacco_j_Page_049thm.jpg
47570b76f434c572578a1139989d5d63
1ef33e26ed06b3401c6c219e4ae7091eb4a338d2
F20101219_AACOPP sacco_j_Page_123.tif
588f3c8860d9395b636f031d7b5402cf
71b69752c987c53640a901508e9a3adeac899173
22832 F20101219_AACOQD sacco_j_Page_094.QC.jpg
ba6c715614bb758ec61e12c524f08de5
b4e3b524babfa674b33a87f6946d1e401330702f
5813 F20101219_AACPTG sacco_j_Page_005thm.jpg
afe45daa1f9761aa49329427627437fa
c65f59570b06971e7f4da2fb55b7e76883032277
30860 F20101219_AACOQE sacco_j_Page_128.pro
5093529e5fe62020c871be815b2e7247
bac7fbf32205e77aabfb3cdfe777cbf92e685b40
25532 F20101219_AACPTH sacco_j_Page_006.QC.jpg
1c0e46992baf3dc6fb89311dd41301c7
48a2eed3e1cd029616d693a2799ffbd3291a67a7
5319 F20101219_AACPSS sacco_j_Page_115thm.jpg
66a0154de7062b277a967dba97e1cf0a
e54a6739fdb55b781546296f5b7870c5a22a1d1a
138610 F20101219_AACOPQ sacco_j_Page_010.jpg
8b24c92128b1576f19a0feb97c524034
798584c34d9682dbf1584d1c6655433cd274b98a
F20101219_AACOQF sacco_j_Page_004.tif
810b1ab689685dca3888166fa7a15cdb
7523d18a58eb38b3deb51bdccde5766b9393b0a5
4981 F20101219_AACPTI sacco_j_Page_008thm.jpg
1c841b641501a5e13cdb63f3a2748427
f07a9670b8bfd7a678f6c1d7e091273b6165c4cb
8022 F20101219_AACPST sacco_j_Page_121thm.jpg
07bdfff6068b772da064462a5cf601e6
0855089dfedf6ff8d22033206a947056b2710504
13365 F20101219_AACOPR sacco_j_Page_093.QC.jpg
72f4da1965adca644fb49a43039e6ae9
bc567a79bb6f33a6f8a43ad843392325a8ed05dc
32884 F20101219_AACOQG sacco_j_Page_047.QC.jpg
22ec9d29d0d1c4bbceeced13763d13f2
0ba3b69a771a6cd856bfc91c4f16009cda1c7553
29257 F20101219_AACPTJ sacco_j_Page_009.QC.jpg
5781ae52357efb9ec3328f514ddfc272
32043e576d84009fe551c69dac17592c5768b42c
32504 F20101219_AACPSU sacco_j_Page_111.QC.jpg
2eda150884301114bd212e72a742ee2e
cdff63c1df5ef4b1f89481e233a143e6e5f95e7b
F20101219_AACOPS sacco_j_Page_079thm.jpg
a2993976671d72d58af057dac7595614
69f29825edaf9a4cfe41edb1302daadcece623b7
104566 F20101219_AACOQH sacco_j_Page_154.jp2
e4a66b6a54c544edf1c539c4cd3b6861
b652e9132cd412e648a8c2d8b0d5b8305b0ad476
32186 F20101219_AACPTK sacco_j_Page_011.QC.jpg
ccd29f6493d2f10762d4c9c9366bf5a4
cb47cd44214dff59abfaa2e2969bc9b69ce83825
33313 F20101219_AACPSV sacco_j_Page_048.QC.jpg
918999c97690fc334cec77c48c0561f0
61fa18a8fe556945f3b02fe74fb8931cc88fa03a
2126 F20101219_AACOPT sacco_j_Page_009.txt
93e952cacd659e5f4ded0ea79c5d2f9a
819f0b1115deb860296e0e0b984154e70807c151
88154 F20101219_AACOQI sacco_j_Page_012.jp2
70710b2a42581ee4d24c3f522315f5d0
b4b4e8112b6113f7e080032fc92f12a122f1ed6c
7806 F20101219_AACPTL sacco_j_Page_011thm.jpg
5793d7643df241057c10ef0e69c31d76
5222a728db69066d84e2f516aa18950cbd7491c3
33019 F20101219_AACPSW sacco_j_Page_007.QC.jpg
5bd9b4955385650c7039dfd88812b6f6
fa7faf69ac54ab40c7151d6bfcea7de5f21a9ed2
122296 F20101219_AACOPU sacco_j_Page_160.jp2
63196aa70bd57f897da433d84de381f8
1f9e7a55ad248cbf5723836e3b4c2ae948eea085
33127 F20101219_AACOQJ sacco_j_Page_142.QC.jpg
46437d5fb483dea7d71413713ce2ad64
81274f82e31dcc6e8f7dd40dc1e4b460fa53aba7
F20101219_AACPUA sacco_j_Page_027thm.jpg
4dd67e8c9635bf04e0702fd750f4f3b1
2adc1ae4a7dfc615d71716d0f17dfcb288a59697
26779 F20101219_AACPTM sacco_j_Page_012.QC.jpg
70003d4dfc645b9a1e2cff6423dc6e67
1ef42809842ac808f720ffad2ab6596f39fd4f66
5767 F20101219_AACPSX sacco_j_Page_128thm.jpg
34aa650aa67782b26f4b5e2bb7f19a7f
f071cbfacfb208666bf7877c32b45a142fa51cf9
1411 F20101219_AACOPV sacco_j_Page_062.txt
3538507b043d087a529c1e5609e5a418
bda3f5c05c69166717192e82eaaeff317ea49639
65022 F20101219_AACOQK sacco_j_Page_170.jpg
9ff7aa33d2cb75bf59ac651d83188311
aa8c71561784056c9a613faef500de1e7253fada
4871 F20101219_AACPUB sacco_j_Page_028thm.jpg
0ea629f6617b754343f57a64c1facdd0
0aba045c3ff3e83529627c678365571291b33bb6
F20101219_AACPTN sacco_j_Page_013thm.jpg
e15e7ab0652bf2671d0ef9f7289c5f5b
7017855674366ad74ac49e535edabc5bddb4d4e3
13542 F20101219_AACPSY sacco_j_Page_059.QC.jpg
1fdfb60e3b1a5d9a2976bb45d0a583d4
25e0b43c29cd3c122eb0384ab9c8c58322221bb4
638757 F20101219_AACOPW sacco_j_Page_023.jp2
2094bd3053d2c49eb00a2de3f5a83fcc
7ae80b357a629a726f4a492168d540c76eef07fd
5736 F20101219_AACOQL sacco_j_Page_059.pro
63f238e384068d0c876396bb9beecd74
8eae38ff0eb1afd7f7efb3977fb9b4cb23f711ef
8719 F20101219_AACPUC sacco_j_Page_029thm.jpg
42cbbdf5313105066de91decd041fa0c
3e00eaf1a42572382ad753eee4af4e2a7681beb6
16752 F20101219_AACPTO sacco_j_Page_016.QC.jpg
1169f107e172ed8ffc9c4e3172669441
fe31ce8ecde0a19a16baa35acf6f5826adbbb548
35361 F20101219_AACPSZ sacco_j_Page_068.QC.jpg
766e0588bcac728ffc545b1bcd18dd0b
91bb4f7363de795ae1a8edb128d4a958a1614b12
F20101219_AACOPX sacco_j_Page_068.tif
9146ff090ddf66571a112dc50d4bd280
e7566b451416808d05d440f080b0da32169d8a19
1047096 F20101219_AACORA sacco_j_Page_095.jp2
138bfd26db87de30e484ac2b1eab276f
8ee0e46b0f95ec2d7ccc051cfd04f0c25fc9e70b
7712 F20101219_AACOQM sacco_j_Page_129thm.jpg
a0411b84941ea30dd41f9ab32f86e419
cc77a6edd8d730d18a7f7dbf244bedcfbceb5024
33604 F20101219_AACPUD sacco_j_Page_032.QC.jpg
172ac1041b418fa63efeb0497ac6293c
b63b5df13748b0aba328638e4d6048fa438a1cff
5404 F20101219_AACPTP sacco_j_Page_016thm.jpg
daacfd1ff4d400be04f033a0bb433786
23229fafecced555877e8fb9240541e6744f7ece
105199 F20101219_AACOPY sacco_j_Page_112.jpg
d7c2b073194e9f7669ffad17ace87e33
4d394006046925ba8e7f49f9b46e4e055ddd5406
26731 F20101219_AACORB sacco_j_Page_039.pro
b8667653814e114d91f78186d487740c
ddd92d670239c2151dcc4c4a2a01bd606293068e
14179 F20101219_AACOQN sacco_j_Page_134.QC.jpg
c0015ed7f87ab881d724e2fb34d4cb62
02f4b738a9082fd90a6527a528e3fac0e561fbfb
8463 F20101219_AACPUE sacco_j_Page_032thm.jpg
c9fe770f0d3fb83528132ff3cf132253
8ac8b3e1151e999a8189e547da03b6a9e480eba1
30636 F20101219_AACPTQ sacco_j_Page_017.QC.jpg
bbf8bc303225252673c8cec9196015b0
4f6417e9c72c993c6eb3b73b0b544286861317aa
7358 F20101219_AACOPZ sacco_j_Page_009thm.jpg
95d126be9c3d94d2a9111533c3baf980
e9f22d104911fba20b63638f3b37c506913892d7
71015 F20101219_AACORC sacco_j_Page_025.jpg
182124f8560ebb46c5d64b33471ecc08
31db9792a56e044d78d59519c108570490136427
F20101219_AACOQO sacco_j_Page_103.tif
9e2a51558307a952eb2296aa0d70bfd1
278465bb7a3702dc43430f7a596476cf92881b9c
35557 F20101219_AACPUF sacco_j_Page_033.QC.jpg
c5bfc09a82e6b7f843fb818e32018eeb
a080b00c9facea70130a1d11fd0f4d83094169d5
33780 F20101219_AACPTR sacco_j_Page_018.QC.jpg
84884cdf382c57088fd96ee259414b33
f346aca5878ce6797159e66834d0922064701289
F20101219_AACORD sacco_j_Page_132.tif
5f74590add41deb634cf1aefdbdb32e3
3d218bb935828a124a2a3218ac1f731135855cec
25524 F20101219_AACOQP sacco_j_Page_064.QC.jpg
d7900efa3fe473c9a48b5ec81689b336
b1de3b9b9d52a896cd3da8d27b813366677bbeaf
9222 F20101219_AACPUG sacco_j_Page_033thm.jpg
f95f3f34e0af6fb13e7f6e9cce79fe2f
b55c9d98ba7e682aa1d42a0d1f389d5861d813b5
28507 F20101219_AACPTS sacco_j_Page_020.QC.jpg
b707f8a9e5a803e9c4c69a6eb1f60235
4bcdad23c21ce38b409aba4d6f8d4f6af337244f
10583 F20101219_AACORE sacco_j_Page_016.pro
f1f7c9f9a054df1c0e1ed7f922686ff1
a48ec4136b48a2590f0bd206900757b0e0716376
50032 F20101219_AACOQQ sacco_j_Page_015.pro
12815c2a9b84a808534eda123b143cd0
c3adead0fe6b0358671f1f81d3e6dd4c675d6941
9082 F20101219_AACPUH sacco_j_Page_034thm.jpg
e45264ca36508f158a6747c35dce8bf8
3146d40a1826cc998ca9e8a27721258f1e7b3e82
79984 F20101219_AACORF sacco_j_Page_072.jpg
429e984af6052254cd22eb944e5b10e4
fc202e4096318efc79f6a14e5a7a3beeb80c2635
31130 F20101219_AACPUI sacco_j_Page_035.QC.jpg
ec734af926a5d681c5f21c72c20184e3
f9c24f7915a4a01a5bd72c505064e441d782c8ec
7315 F20101219_AACPTT sacco_j_Page_020thm.jpg
ebaee068b397c82b4fb851f43afd9622
6799c9e23a29877c7f7b1f491439ccbca08669ef
7377 F20101219_AACORG sacco_j_Page_080thm.jpg
3e55cf8968bbc40aa750f086ddc338f0
3cded79e9fc964ff05ee2f8b8eb3118d12a764eb
43214 F20101219_AACOQR sacco_j_Page_051.pro
6c5e41ed1c84a11f5411932ed781ab45
a400b886f0e20df6dd512d9e4026d5ea2f590f01
7756 F20101219_AACPUJ sacco_j_Page_035thm.jpg
991f2a8a357e27e1eb652beb7d35bf18
d5b469ef13802c8f563d55a5935277a83127afd4
34694 F20101219_AACPTU sacco_j_Page_021.QC.jpg
eb39269f1fac4ad7d5d37ce42cf3df81
f0df518acc57e8d7870a6854acfc2cb77ac93299
643 F20101219_AACORH sacco_j_Page_063.txt
202a6a66a81cb7dbb7a0c430d1ae51fa
ba21c499173f2e8534c26411a17e948b05fabe60
1646 F20101219_AACOQS sacco_j_Page_020.txt
f677546c0864a395a60852ee333d363d
40d236ebd709c52a8aebff06fe279ef94a161528
27070 F20101219_AACPUK sacco_j_Page_036.QC.jpg
ec2a30e7a2f30070eff4a196dc75c26a
aaeb5c7e028a7757fdd1019124269eff15a676cd
9030 F20101219_AACPTV sacco_j_Page_021thm.jpg
2818bf27bf70f958bef06c333372d141
157f9e7e038530b012188ff4a434e4fdcc2df3bc
1233 F20101219_AACORI sacco_j_Page_128.txt
41c98be3eea40d3e878e33a756748765
997bc48f09e531a98e51f941ea7eae54692827e2
47020 F20101219_AACOQT sacco_j_Page_101.pro
2e2fce616df9c631538e910a8cabaeb5
4bfd3fbda4a604b414e5dbcd7f902154c5e1c8f6
7061 F20101219_AACPUL sacco_j_Page_036thm.jpg
e636d1019a2de58d9dc49a3971db90ec
3f717559b47a9263a4d128818b63bcafee7c74ab
6010 F20101219_AACPTW sacco_j_Page_022thm.jpg
7fc2ace299018832b1f955671edf6088
b034ad24c778b07e016c3430420b71f8e168de9b
48142 F20101219_AACORJ sacco_j_Page_082.pro
1ca7aeacae028722299502f1af2c2b91
845ae25c643c3ef3e066cdce6f52df1fbbd0d5b1
46881 F20101219_AACOQU sacco_j_Page_071.pro
d4fb589e443c187a230614dcfa6d9ea2
b8139caa9ba3bd006c7ebdf40d3022e2aa419d83
7605 F20101219_AACPVA sacco_j_Page_051thm.jpg
e26a96e7d4aef65eb8576b68272e1727
dd69f4b3d13fed453510ee72367f094cb63ce8ee
3376 F20101219_AACPUM sacco_j_Page_037thm.jpg
43f549d7165cb795a0cdb56e4d96f20a
3838b77606384f689bca8430515a375b5b7451c9
8410 F20101219_AACPTX sacco_j_Page_024thm.jpg
da2290d196c53570201332a07b5ba6d7
b20c5a560331c9936d5a97c3587cb39f4273e04b
9151 F20101219_AACORK sacco_j_Page_084thm.jpg
49e1d73f29490491bf7b06df244b1c1f
eb74ce8202a8da0154ad118e33d53cffb310fda5
83616 F20101219_AACOQV sacco_j_Page_013.jp2
960797a5d03e74681c650efb0fae5e4f
f630be82cd1d0dbe72d48b6584e7d0a5d8feb882
7475 F20101219_AACPVB sacco_j_Page_054thm.jpg
e96e86debcf70b95a3684b29527f36e7
652f1b6a8f2500e1517c61a34d612144e9185fbe
4063 F20101219_AACPUN sacco_j_Page_038thm.jpg
e952592c6922b743730a06830accaefd
cda1098fe859d00b2a797eb935636ee5130746fb
24779 F20101219_AACPTY sacco_j_Page_025.QC.jpg
72bc212fe54cf96fa0d4b5709e5e5e4c
d2ffe87b3b463d3774a8d2ee6bfedce7f34ff6a3
41059 F20101219_AACORL sacco_j_Page_019.jpg
aafb02663f46fa7c92be41508377ed77
9df204e81d412e40243296e5c8ffbac3ce4b4fe0
8310 F20101219_AACOQW sacco_j_Page_110thm.jpg
a5451a5b6a44b496c799b007111b1746
96ada0569b6adc770d7ef3a47b4f771dcc2c80f6
22715 F20101219_AACPVC sacco_j_Page_055.QC.jpg
f6a01f6a8d400cc92f8be4281ac2e13d
f087efd14ef4e7a662528aa120259a659700e518
21372 F20101219_AACPUO sacco_j_Page_039.QC.jpg
a318470a7c44add56adb45ce16777d44
6271d9e9633bca4fd4966f3b3c9bd1b7eadca165
12840 F20101219_AACPTZ sacco_j_Page_026.QC.jpg
d953093a5c3909b5680e11986913768d
fadd2949373ef59c3f2d892c529cc32fb10aa6bc
76137 F20101219_AACOSA sacco_j_Page_118.jpg
fba62397d132e5f3f7fdf4d528d78b85
5ab28e5227cfd25f99c6fe9383f7028eb2e34754
2532 F20101219_AACORM sacco_j_Page_169.txt
14512310d0237073482b5145ea07fb0b
4b397852b9a8de00c0cb56b0a3ce167c23c6220e
592 F20101219_AACOQX sacco_j_Page_003thm.jpg
0d261ff58dd63feec741f84f7af4276e
0c483fed845d16ed89f6ca5046694fae95c82563
6533 F20101219_AACPVD sacco_j_Page_055thm.jpg
f4d13d988382c822f5bfc9992ca1ca2f
0db186b978d57dd2bd5b921cb6f9ca8e7a1d0c4a
5979 F20101219_AACPUP sacco_j_Page_039thm.jpg
a543afa89bb4001b2c3e98a85e982eab
f2770b921c183d62e713ea422debfec48eb1a0bd
28765 F20101219_AACOSB sacco_j_Page_054.QC.jpg
af15caa46164b0aed4bfd476aba89ba1
d812074a3265b4cc6b6b1b9afa521d3cfa62a2bf
F20101219_AACORN sacco_j_Page_167.tif
68395f86510979c70aa659d5b50720fe
974f5c3e84875a01f7bcda70308eab7be5798736
5049 F20101219_AACOQY sacco_j_Page_114thm.jpg
8cee6e5f78e98d5f5dd26760a23682ca
54b2a39fe0246f0e9b96f77039564a0988b9c03d
35240 F20101219_AACPVE sacco_j_Page_056.QC.jpg
dd3f2dd15252e5f7b651b37016c39f04
8480db80efdff0969b899fc2dfb4f3c21d6c5ea4
26082 F20101219_AACPUQ sacco_j_Page_040.QC.jpg
a8a6ce962329f25734dce7d3ab1a5f45
958d13ee7dc570a504a1e6c7f3a49e0e7f41dc38
1818 F20101219_AACOSC sacco_j_Page_047.txt
91cfbc0df6c8c3930e9cf1a87deb8581
1ebae9df40e8e2d8614bdfc06c6a1a57995c185e
1629 F20101219_AACORO sacco_j_Page_131.txt
bc1cbed71423424617baea19132b0374
16b541a4edf6ba54d7419a206ea12344d5f9072b
F20101219_AACOQZ sacco_j_Page_064.tif
29e2f19a8bb3699d1e889e34ef48808a
0e17ef48fafdfa6963f11c5baebdf5950432a1b2
9127 F20101219_AACPVF sacco_j_Page_056thm.jpg
d5bbdb33faeb25ddfb7e1c4910ca35a7
dd48fc8ca35e51511a919deb521d4f434f8dadf4
7017 F20101219_AACPUR sacco_j_Page_040thm.jpg
da0478b0ca91d1d1bf941166cfe0d1a9
23de80f26e2d511fbba2d09b0316c7d057869e6b
37487 F20101219_AACORP sacco_j_Page_162.QC.jpg
aa596e1dce16696e9cf59225428b199a
10e1ec0ba0e66858145298afd8b15c6f3a5dba21
1954 F20101219_AACOSD sacco_j_Page_070.txt
cdd4a74a6500a9eac000acf5c4d20a45
db03bf3d09cb1a3efde4c00c4928534bee6267e2
30528 F20101219_AACPVG sacco_j_Page_057.QC.jpg
93796d8b04c95d408506bf6bd51e5149
cafb3a7f4815ffd594bd6035804692fa248cbf91
5337 F20101219_AACPUS sacco_j_Page_042thm.jpg
5f35fc66603ce0718bdc2a6a4c9db5f2
df98ddc16a0c215bbe61c164eb7c17e10bb25298
4166 F20101219_AACORQ sacco_j_Page_019thm.jpg
7144e4398ba64baa1ca995a45c378e38
15f8d5f0328860ab77f9ff4267a11a4907e92885
F20101219_AACOSE sacco_j_Page_027.tif
2e1249d84eb7a49229aa8413b9a34eb6
65fdef55c762fb1892108b6e98ace9cba2ba5144
24840 F20101219_AACPVH sacco_j_Page_058.QC.jpg
4284d7e670a9c2424480fdaf251d73bb
131b7a23259dfc89e5da7297b7fd31b143ab60d0
6289 F20101219_AACPUT sacco_j_Page_043thm.jpg
5616472f2979fbc329f584782cb99c96
24a1f44ab78e474f1c4e2475e87c24dee32c44cd
15097 F20101219_AACORR sacco_j_Page_104.pro
afbbf54d2a0163d39e57d153ac0b39ad
d395c732f1b7a84b06ddfbd06317a44533004233
8199 F20101219_AACOSF sacco_j_Page_074thm.jpg
fd0353a71c8d9750238e7e7d2c3065e5
ece221842956126199962351babb6ca6bfc2fcb0
6476 F20101219_AACPVI sacco_j_Page_058thm.jpg
9fc9344870edfe143a8658a26d96b7ac
71ee49de552269731705991f23a926fc5fa98bb1
F20101219_AACOSG sacco_j_Page_029.tif
d3eb72da0da069fc4fa9b6d91dd7ad21
e2f7a23db7a861a640dfac19518341ba1a2434fd
14477 F20101219_AACPVJ sacco_j_Page_060.QC.jpg
2f0ff56a76406f1317d55abdf0889564
8014cb135838fbdf6efacfce7344662bc5a309d3
22038 F20101219_AACPUU sacco_j_Page_044.QC.jpg
b54de0cc55deb79b462debf904b777c8
fdff04d84d15740d87f50a2598bcb7533ebd20dd
27690 F20101219_AACORS sacco_j_Page_013.QC.jpg
e3bb3d570f7d50a5833746236bb021a0
d641cc12f36bb21724140c411a96162576f8e027
98813 F20101219_AACOSH sacco_j_Page_148.jp2
3eac2aee8d76a0e910ac790bdfe9265b
ae511330fc0ba5e51d2e176a8dedd22050abacdd
15726 F20101219_AACPVK sacco_j_Page_063.QC.jpg
485942ce16fad8400bb9f0b7115e63ce
686e30b6940a62ffdc2fd666b6ced2f8cf584710
5794 F20101219_AACPUV sacco_j_Page_044thm.jpg
e3630839321d9773d33b298a4bd7e4a7
5de21e9f9fcb47a490f3b33bb70b8f38a361df22
878984 F20101219_AACORT sacco_j_Page_076.jp2
a0351a178537896896084afb65619a7d
62328caeb87b7ab199333ffa070853a0f76f296d
F20101219_AACOSI sacco_j_Page_163.tif
9e3a9492fac49a6104444e51a93bd7f9
af4027feb90f3266c9af9633f167e3a957c87e46
5138 F20101219_AACPVL sacco_j_Page_063thm.jpg
a4a339135d887615ec62b5db6ebeb3c2
a1f1af99033d881ac2674e64e9a14237f114bf0b
21310 F20101219_AACPUW sacco_j_Page_045.QC.jpg
4702e55b3d05d1f574f6b84d0ffb07f3
ccac9568ea6abcf083f9a73202e10e72bbeb0987
106332 F20101219_AACORU sacco_j_Page_068.jpg
c52d62d56ad4450212d2d18ff62b30b7
a2e9bf5b416b9da5b2fdbfb8e63729592d06e3e9
F20101219_AACOSJ sacco_j_Page_144.tif
ddd344a4e9a9a5ad578c48f4670db6f4
72466efa92a2ba14e53b35a1b8ee846269a3cc66
34300 F20101219_AACPWA sacco_j_Page_078.QC.jpg
1bfb44f6a317671b059005496ec1423b
008ae283cb35c5bd7e940a1cb576b4c012ecf3f8
6565 F20101219_AACPVM sacco_j_Page_064thm.jpg
cb534bd0f9a2b9506f06c65a062636c5
76e178fe5e8b4be93050d922fdc10d9c4db7b515
9054 F20101219_AACPUX sacco_j_Page_046thm.jpg
b6c8b06c5905b739b522a36e59bbf2d9
809368fb328ab84cad705ded41cc71210f72d5ec
61673 F20101219_AACORV sacco_j_Page_169.pro
905aeba0fa6d901656a40f8d925578e6
cb4d840bcc3142abe3ef842c14c2910523366451
422510 F20101219_AACOSK sacco_j_Page_038.jp2
8e002ecb658670c986424cba0412b0c1
5a157c975f61bba314dc960d941fa510975fa2fb
29857 F20101219_AACPWB sacco_j_Page_079.QC.jpg
d837481e7683604eed46ea7df31daef6
bc50368ee38aa24a9650eb29ab3ac5cf928e44cb
21015 F20101219_AACPVN sacco_j_Page_065.QC.jpg
9a1344e633754d7a239ba18e8941c01c
248b4c3e0b020fb27323c731451a785b258f9df7
33539 F20101219_AACPUY sacco_j_Page_049.QC.jpg
8e08a41e26372b8cf2b782888a3e54a9
0d0e4ed8eb26332d736634bd3f3f0c5affd4bfc4
F20101219_AACORW sacco_j_Page_039.tif
26135767bc0d680bfc33bf5b770cd085
9af934995dfbb08ba3d103de5cf390de824a41e0
137429 F20101219_AACOSL sacco_j_Page_165.jp2
5e7388eae15061eece4354068957ae30
d9f72a2507a75e0778f24989a980fcaf477924cc
26515 F20101219_AACPWC sacco_j_Page_080.QC.jpg
6e1cd2f1792a203ef4ffe0d73306bb46
7c57071869c177c0da57a6bc1ade16559484313f
7397 F20101219_AACPVO sacco_j_Page_066thm.jpg
e62703604f5d84ac8b9b330c83bc9a8f
ab109014e4f56ce9c83da7ce86462a38f37285e9
31286 F20101219_AACPUZ sacco_j_Page_050.QC.jpg
947154c3368c8e91d204cb2aad6f82b7
d84271b691a65ab7591e390f744957baa61efd93
75158 F20101219_AACORX sacco_j_Page_066.jp2
6bcf66f723dfd35340fd82a84f8c9d44
75cfc7bb0fcef866542df593ea3666be68b1f6c4
3056 F20101219_AACOTA sacco_j_Page_145.txt
753aa766423a64ab196002fc1ccb960b
60645195629aa6007bdfbe4285395016fb4952ce
8474 F20101219_AACOSM sacco_j_Page_030thm.jpg
4ffbf2508aa921cf6866e6167eac8257
1bb898e168cbbcaf75a73817cea068544f6a8210
7598 F20101219_AACPWD sacco_j_Page_081thm.jpg
d121fd2ff25dc891b378e20ea47de55a
103855661bc9909a91b0fce46321a83c29ddd479
32658 F20101219_AACPVP sacco_j_Page_067.QC.jpg
57448ebeca93fd90aa186e7bedd642e3
ed81648a58feda9cc80aad9b61c377d2a0d999fd
34934 F20101219_AACORY sacco_j_Page_064.pro
ce04df957ed53c22dc2d7ba6837abb9d
63ebbcb94c2c7a8fd48c360920a9538aa5fafa63
7313 F20101219_AACOTB sacco_j_Page_061thm.jpg
5dfb93e278d45ec71ab79a2690d68b61
8ce647902dfe7709ef38b78fa141e53ab5abcdf7
F20101219_AACOSN sacco_j_Page_043.tif
0d67f3c1700f7f80ea186f500fe650bd
1e77eca49a9e3e6bbe431ce7408519c782357389
35138 F20101219_AACPWE sacco_j_Page_082.QC.jpg
bea9d9e3e631a76027ecfb0196289226
9e0bb38ad1c0f25dedad8973e87c68c5648e2846
33081 F20101219_AACPVQ sacco_j_Page_069.QC.jpg
b4e1d92daf0db6e91637d63521420567
6e0feeff1a3df370bc5fab97aad1f8ffc819e6a5
21779 F20101219_AACORZ sacco_j_Page_154.QC.jpg
106b1fe8b50a0ed69921b0c12568d81b
dc109c85b923881aa1937bca67441819cc071c8a
1870 F20101219_AACOTC sacco_j_Page_101.txt
ee3bb627fe9bd00d5202024b068280a6
1203cf2db59ed53906600540ed91c51dd3cd33c1
32640 F20101219_AACOSO sacco_j_Page_160.QC.jpg
96ee35da97a82f0b941549dcbafe3117
a50df20237a910410ddfddc6055327a038ad2b77
8864 F20101219_AACPWF sacco_j_Page_082thm.jpg
986449fa790b046c989302e2df336e08
4f416a52966c048bd5b652b15ef548be7ca7153f
9097 F20101219_AACPVR sacco_j_Page_070thm.jpg
17a0712bf27cc7daaab170db0b113467
90a71040c6c2de5ef238c63547f39237cf74b0af
7803 F20101219_AACOTD sacco_j_Page_014thm.jpg
a808378e472031c65918ea585c92aa50
0d0ff46faceeb0776ee67e8904cbb8e87f429357
118189 F20101219_AACOSP sacco_j_Page_011.jpg
c305cbb2a315e97c74f4d23b3da0090b
d0cd371b34b20e1aa489a26b80079f13d358e06e
27994 F20101219_AACPWG sacco_j_Page_083.QC.jpg
dfdd627723a14803bc65447f00b01079
ff27549cb0500e8643b21906ed539c5a82472441
33084 F20101219_AACPVS sacco_j_Page_071.QC.jpg
e92c4ce671717b6ecf674d2dbd400d79
314b358f44bd18dc9dd529367d1ccb6ca2e95158
65427 F20101219_AACOTE sacco_j_Page_123.pro
e38fe88945b4122c0fc46ae39e040643
ec74545fcb533aafad9ddb00bff8adfdf462fa96
F20101219_AACOSQ sacco_j_Page_030.tif
8d89b18a01335cf05da0f47dcf114183
7f308fcc50a2ff5fb7dc1f46caf6876aad1c1460
7609 F20101219_AACPWH sacco_j_Page_083thm.jpg
173d0c8ff7c0df23d4ff51684f5f925c
ebee982140de04d896da7dae1f7a0447986f7c83
8272 F20101219_AACPVT sacco_j_Page_071thm.jpg
f2e92be99a13755b28235f73c9e856da
561f2207ba60ea9fd728f44c7b64465d88d96f82
8822 F20101219_AACOTF sacco_j_Page_102thm.jpg
37305a28162d13730b8362e9229c85f1
6ad361b088b93ec84902596c8c65ccd3307bf3b0
10568 F20101219_AACOSR sacco_j_Page_037.QC.jpg
ff0ce93a59e531f1026ba5b0de04beff
c9c9edda7443ad5b226cecf8c63b28174a422073
34942 F20101219_AACPWI sacco_j_Page_085.QC.jpg
5b876b691997a6fe86900f4b3570539c
0923d46bfd3e32437a8d10eb60f11a796506d5e5
25707 F20101219_AACPVU sacco_j_Page_072.QC.jpg
fe5f9dcf0f0f249cae85e78d446e67d3
eaf6bae168fa65b967dab3b3c2e8a0a711901bb3
108056 F20101219_AACOTG sacco_j_Page_141.jpg
b7dc9c33b5358a0b6f3ce44e2240b980
7ef34d0ef79a6a051589a83f4ce6e611f5946896
F20101219_AACOSS sacco_j_Page_042.txt
ee551e00ac79acf1083ec830a5466903
d9e9ed8d8136d2b52ca3f17b5e4151d6ab94d9ff
8977 F20101219_AACPWJ sacco_j_Page_085thm.jpg
9685efdf358416d24a36fd16e06d42c8
5ee45d3b00bb8efa9e345679bd99df11f6ef9dcd
37314 F20101219_AACOTH sacco_j_Page_079.pro
2f053badc5ce0b87f950f1259bccebec
22b231d20745df33cf376607bb948388642f30c6
8627 F20101219_AACPWK sacco_j_Page_086thm.jpg
b0af590af1ccce8ade721ba45ad071f0
7b43aceb0f96f348aac30baf664201ec91066c12
6732 F20101219_AACPVV sacco_j_Page_072thm.jpg
4ec673ab4e95b764fc345bb5161e60f9
65eb35a55f6b689f8a799e6ce228e61f37ff4f4c
57791 F20101219_AACOTI sacco_j_Page_007.pro
cb9167f377970abc8020c60aeb5805c8
690ea20cd5692b0e34a646967b03388750637223
107833 F20101219_AACOST sacco_j_Page_034.jpg
f755ff5ece769d8434def0ff3b5578d7
5a2ac5e75a2681316ceca2b8892fa2e189205325
2654 F20101219_AACPWL sacco_j_Page_088thm.jpg
2957e8cfb12f2a24dcbb945b0ed452b3
8ba8a9516d4512d0c5810087cdcbb557f5f58791
7638 F20101219_AACPVW sacco_j_Page_073thm.jpg
7309d9dca7d0cd86bc202a4605312caf
7771c92b295cde6b81de8e8c771823dd0f9be7c2
1051980 F20101219_AACOTJ sacco_j_Page_011.jp2
bb4c069785372f66e1117270dedbe9fb
f20aeb6b94a8555df1e232340aa9c493610bc95a
101561 F20101219_AACOSU sacco_j_Page_032.jpg
a21ae51c45cce68b105e4e43f15d4ae4
26ccc66b2c696a47013269b404d38cd43315e9da
F20101219_AACPXA sacco_j_Page_102.QC.jpg
d3b29ece2caf15ac10709f3b26bdec80
1240ce4d74fe394bc0b88602f15e3f52099eec33
10943 F20101219_AACPWM sacco_j_Page_089.QC.jpg
df39cf6d3d0a9920be4aa55d8432ccd2
330963a3d86a8470b75bd0d0b89886da4ce03e6f
32696 F20101219_AACPVX sacco_j_Page_074.QC.jpg
aea89be3a3cc2960ca0b31c8e7887cd4
8660c1ce94c719a22e4c6f8eafe29d1586bdadc4
62368 F20101219_AACOTK sacco_j_Page_167.pro
ef9bb99cd41fd298e681ca733f979a42
b30704ffd2e222361ee99fcef726db3589c1409f
1738 F20101219_AACOSV sacco_j_Page_083.txt
0b95a31d8a49de6b44c6dd0852dabd67
c99ef5164a298f6b415b53c6fa66df90d4f0d59c
37383 F20101219_AACPXB sacco_j_Page_103.QC.jpg
ae8866d31820bcd22e138422393973d5
4cd9908ebedff9dcc5c30553d8904d56f7db0134
19926 F20101219_AACPWN sacco_j_Page_090.QC.jpg
03744644ef63299fd26f2b120f2f26e4
e68ce41eafe4dae1337a5765f3967a174e5c8257
31246 F20101219_AACPVY sacco_j_Page_075.QC.jpg
09ea1b04b344ebed3afc5ac998575aab
361e68a2c50963abc3d80494da933a1908720990
623 F20101219_AACOTL sacco_j_Page_002thm.jpg
958ca5dea6f19309a19e060bcec30b22
41e35b14727abbc0755d825f57a2433f9a6ac741
40313 F20101219_AACOSW sacco_j_Page_144.pro
bca7d3fb2cb271dab3b3c25580c4b288
101d1ef1ac59db9b01e0473dbe1ec65ac9b463bb
8118 F20101219_AACPXC sacco_j_Page_103thm.jpg
e2ff1a98e8bbc47ff99c23c35c6eb07c
8e89b7e62cd53b377aaa1341a0545d47d589a401
5503 F20101219_AACPWO sacco_j_Page_090thm.jpg
9513c23f4cb825f589f8adc616d0340e
962fa7552621deff79f19e44b0bc8868cf212d39
36150 F20101219_AACPVZ sacco_j_Page_077.QC.jpg
80b915abdf5eae2443a02dffe8ef558f
05981aeae5bb85bbd177b73eed9cdaf8c55996d5
110261 F20101219_AACOUA sacco_j_Page_033.jp2
d1bbaaac411fa8e40b9bc990c62dff89
7a42ca405b28aea52231350bf4f6ec213878fee4
388 F20101219_AACOTM sacco_j_Page_060.txt
35c059b99dd92ef01d0267a8f3b34793
93b3b05acbcd3eb8921cc4f6975e1b4970f394b3
1540 F20101219_AACOSX sacco_j_Page_087.txt
4bc493bc5d96a32adb58083716b50952
8156f8970839db8aa4e8156290b250c7f762a3a5
14442 F20101219_AACPXD sacco_j_Page_104.QC.jpg
1bb06ad89474573304fd317a0e1d2c97
a67099fb239653d2cc13cea0005de8830e6d79da
6650 F20101219_AACPWP sacco_j_Page_091thm.jpg
63fa9c5f395965806766e0bd3a8b7a36
16c289ca8d40a0f8811d3adf103e07d6c808492a
69543 F20101219_AACOUB sacco_j_Page_128.jp2
19481de891d7b4a5ec4110a4202e5f91
49ab9e077cb72d0160f5c863aa82929f2db61e21
2461 F20101219_AACOTN sacco_j_Page_006.txt
ed70a0cdf45cdef047489122f08fdc3f
a0f13640fc372561bbeb86dab08a9a82795f4909
F20101219_AACOSY sacco_j_Page_085.txt
58d9e92a080e121907855b6fb2a2e15c
0b6835835c2167f84a283e96553bd14987a781e6
4532 F20101219_AACPXE sacco_j_Page_104thm.jpg
bd4d09a16099ae51b4450f01aafeeaaf
9c8d1107d7b60298e73356cef8bb892d0fb04e0c
4867 F20101219_AACPWQ sacco_j_Page_093thm.jpg
af5bd423d8c3d1005e0af1671af65216
38e1cd5ef365ab30de30336f5855841b83d2cf8a
45586 F20101219_AACOUC sacco_j_Page_121.pro
2a38a3c608db7ea80cacac4bd4a25079
2d83ffe4e822623bb12fea411e24bbe792e768da
21742 F20101219_AACOTO sacco_j_Page_137.QC.jpg
b95ba696a92cfe4085cce81d71a168a3
515a46d425d625234cd14f7579c9b68959a2ea6c
80037 F20101219_AACOSZ sacco_j_Page_096.jpg
23be6f319accab96282c17c4ded6ae67
d132ac062e4bc38fee28136798757e3a64379cff
37195 F20101219_AACPXF sacco_j_Page_105.QC.jpg
d9e9333d66e50adc7bd04492b22e169c
1c95410c65dc7626f849f0dff06314a02c72b189
6441 F20101219_AACPWR sacco_j_Page_094thm.jpg
bde4b3d16428d82b875796de5ff8039d
231e7db8125cb17bd675fd63bdcc28ca11df6ee0
96178 F20101219_AACOUD sacco_j_Page_073.jp2
bbdb19d451540b8a847fd5675f107bac
35ec543108f53703a8c8ab522ce6da783d354713
985 F20101219_AACOTP sacco_j_Page_118.txt
7b9f593421d3aa4e42bc63447dd60652
da16d42b80f8a1bd9b23db8254557f1f794c09ab
28681 F20101219_AACPXG sacco_j_Page_106.QC.jpg
c09055870e4579f152d5d83dde69e1f6
25a21638c5176594e4bae3f091676d4b027027b7
8572 F20101219_AACPWS sacco_j_Page_095thm.jpg
e72f3c9a22036bbcfdf17564cc7d5cad
458dbaa06e6752b3f0233cc9fe64adf97505aacf
8106 F20101219_AACOUE sacco_j_Page_075thm.jpg
7d79a478a20ffbcf7726f85e3ec3e77d
fd1a688091918e6ae5d983e7ba31011826b93033
29422 F20101219_AACOTQ sacco_j_Page_025.pro
f17b0303014730625c788a0723a19f36
eafbfd096ca6cdb91cf70262f385c3f7eb8d3f71
7137 F20101219_AACPXH sacco_j_Page_106thm.jpg
6743efaad267067fe01489a65c98519f
ca4f2825058fc40f85126a2fe04524c2b87f23df
25110 F20101219_AACPWT sacco_j_Page_096.QC.jpg
efe57b8bf3c310b12dec77690c7761ec
31cb745e276722da1a9b221e9de882b128c5f4be
5564 F20101219_AACOUF sacco_j_Page_144thm.jpg
7b14454dca17d9c5eac0feb642d4612d
1b59690bc757a5421511e7352be8f9154e531b33
F20101219_AACOTR sacco_j_Page_038.tif
1aa93c35508eb90569593c0e3f25b023
ae91270d39e679f3f2a100a2717bffdf2d632030
5812 F20101219_AACPXI sacco_j_Page_107thm.jpg
2de834cae049ed6c435cd8fc3ef10449
5dd96ecc9609e0d9e2db125ba9f18530e5768b44
6426 F20101219_AACPWU sacco_j_Page_096thm.jpg
06cb426af7bd02d869d1622e98d29903
9e6560b1bcc51fc4f69c099ea2b2d32dda97bb8b
F20101219_AACOUG sacco_j_Page_026.tif
073c2e06d9eff6b56d0d7e43879e8f02
54664c7e7abd6137a4d59ec2d0e7e95edd216018
7051 F20101219_AACOTS sacco_j_Page_150thm.jpg
de2fb1e45940d01c87ed824f01eae352
79417ea8e49a847fe19ed53a5cdc868f0a6d4dc1
43361 F20101219_AACPAA sacco_j_Page_134.jpg
85b1e92ded1aac3fbc5245c5ba178264
294ecd596f679d79e4867b9debe133173b7f6bde
33312 F20101219_AACPXJ sacco_j_Page_108.QC.jpg
214e82ccaf22a9a9c0849a0f5314fe0a
b938419b9498ec2621dad8fb1419aa261f41866d
29121 F20101219_AACPWV sacco_j_Page_099.QC.jpg
03b92feff8d5937a50ade39a39e85403
4605234f3acaea1a8ed30481fb12ee7b33d7b5b1
34070 F20101219_AACOUH sacco_j_Page_062.pro
2ce3f165d2cdc7856f900ffc59bee02b
8fc970cfcc2de123d1bb949e3b2d218d2472fbb9
F20101219_AACOTT sacco_j_Page_020.tif
4c09a1abde44b03fda6b7bcc893106b7
192986188dbd4b168006ccecc800e6e3a23620ed
59999 F20101219_AACPAB sacco_j_Page_135.jpg
738d0b925630f2fbd010f2f43b506ade
17409c71735364eab0bb4290e8fac9e37286a0a8
23127 F20101219_AACPXK sacco_j_Page_109.QC.jpg
92f3d639833c9ed47f05ad226a17a88f
673d72e29d27dc92d1d6302fe2514906fcb78662
33512 F20101219_AACOUI sacco_j_Page_030.QC.jpg
545f8ed1a11922b6b1708102d01f922c
1903ee6a0f566f3931d2d64f9879c86b78093bfc
73485 F20101219_AACPAC sacco_j_Page_136.jpg
3ff74d6e0cc34132d61eef0a1248de8a
6508b35c670ac5957276b3fa1857fd58621f5ada
5666 F20101219_AACPXL sacco_j_Page_109thm.jpg
22dba35e7c62c307cad1379553268e97
eb4c03fffcbf97b523a5f5969541361736a11328
7332 F20101219_AACPWW sacco_j_Page_099thm.jpg
28c90fbbef858cc3a74c6ff963be409a
5263f34d97e1154f09824f3471f2cad67f2bfe09
87327 F20101219_AACOUJ sacco_j_Page_130.jpg
0670281a0807b038225f3a91a5dc54ea
566ae9d7f0d6210595bb4fec5a3c6dc094a4aec9
104109 F20101219_AACOTU sacco_j_Page_152.jpg
3330b6ea811955fb85ae1c53fd276cc6
2c384148fa1ed3d567527819ed39b5589e6c6344
66298 F20101219_AACPAD sacco_j_Page_137.jpg
b6afaeceaafbdef7e77ecfc29fef865e
598fd561a42ae416bb78e3c624e572d908de430c
30252 F20101219_AACPYA sacco_j_Page_129.QC.jpg
f8780c147236602983138e5cd4c6b961
91c0efa948b5b2b1358bb50216744b2562f8c867
7706 F20101219_AACPXM sacco_j_Page_111thm.jpg
b695478dbf1f0d5831f2d77c090ec553
4e43ae91115720ea7293d3a128e987afefc82828
7714 F20101219_AACPWX sacco_j_Page_100thm.jpg
cb7bee046d508e6ef417dfe40eea27ba
769ed39adabadac1996a54ae2faa1a684851b75f
20533 F20101219_AACOUK sacco_j_Page_041.QC.jpg
af70a23a3e3d9f3997b33814201080e9
724396b864fef2b8be1b2ce94187e1fe89692f23
66406 F20101219_AACOTV sacco_j_Page_128.jpg
e273ad8e771c7f48a3e96fadb63d4d59
8f5077fba2715d6efdf2ef3351fef4873de3095f
48435 F20101219_AACPAE sacco_j_Page_138.jpg
9f753958bd44a7fc57b2e284e892a008
13565ae005d1303efe0635ddccc5e35067221de2
7412 F20101219_AACPYB sacco_j_Page_130thm.jpg
30b17a336bc899edc5d89634f857464a
5edf9e8b1840ce34d88bab4a22ef1ee31d579c4b
29003 F20101219_AACPXN sacco_j_Page_112.QC.jpg
9a3a1e48f08a33733969c795cd77d1ac
52aa0029101c8ad83df5fb2869667a07851bfbe4
33958 F20101219_AACPWY sacco_j_Page_101.QC.jpg
3ee912997730580b6f7a6aec5df7d56c
638541cfacebefd6c1af296479514d5a59e1dad6
F20101219_AACOUL sacco_j_Page_070.tif
d94dfa7831d322dc7177486252127c7c
2066206908846e054153a31d51bf84213aee1424
F20101219_AACOTW sacco_j_Page_161.tif
7cf999e9ffde224aa5cc8704b6c049ee
06b8733d39593b4ada6c6f621baed6d82643a913
44339 F20101219_AACPAF sacco_j_Page_139.jpg
26e888424d64e77522183b146210148a
2b459dd51a32be2793487d0fc258bcb8b004648c
28349 F20101219_AACPYC sacco_j_Page_131.QC.jpg
8d566c2e000846e3062164062227af5f
4cf52b16bbf0f893a907cd0e54e9e94f92662a38
6567 F20101219_AACPXO sacco_j_Page_112thm.jpg
73707cd6020f5bf1fff0f569f7263644
b1c9487586956885d62f135d5b18be4a60c25318
8986 F20101219_AACPWZ sacco_j_Page_101thm.jpg
ca28732480df79279cee6b19879814e0
856457c92b59e5d3e6b41ba7fd9c756a693f3c57
2242 F20101219_AACOUM sacco_j_Page_160.txt
d0fb4df27d4f1258100e6859e6635e37
e9f1859da1b13f27597052bc926fc95d0a2250b5
F20101219_AACOTX sacco_j_Page_018.tif
fb8dfe3ea72c92d7480bbdca17587e39
29e40e6f3a96f33dc6c36f00e0504919a8607e0f
105453 F20101219_AACPAG sacco_j_Page_140.jpg
e524c48d3da085b314762e3c0cc4126c
fc87c17f1a832317e847bdee9730d6e6c0a22c05
F20101219_AACOVA sacco_j_Page_024.tif
cd42da1a2134c60c26c1e615581b506d
ebe4ea2959104c3140efcdd6cf8a8904cdba7981
7195 F20101219_AACPYD sacco_j_Page_131thm.jpg
287640da1e39fb51c7d5d5d0b4202d12
87817e45982a54e9e729d2c2a0c2ad28a0acf13c
18515 F20101219_AACPXP sacco_j_Page_114.QC.jpg
eb40fb222cc5b161b8f19091bfdad1b3
515997b7502b0fa2255d3910dfe542a799ff85b9
50344 F20101219_AACOUN sacco_j_Page_046.pro
ab4ba3016c9d439c30ec3281afb18702
c060f96358d3815ebb26e5551108ec417abfff07
826437 F20101219_AACOTY sacco_j_Page_043.jp2
d1f2239abad2a9114b9b6e6000043ec9
cda4e6813435f434eea9024a5cad9d532bdac33e
101536 F20101219_AACPAH sacco_j_Page_142.jpg
af2b533cb80892764714a362169485ab
61953de76989695154116d2552f3641fe6d8cf14
3356 F20101219_AACOVB sacco_j_Page_112.txt
60506f4d58aab6395e4ab55c51831d8c
e8086f6539d6b4ef31cb30c66ea550b5d3d46c42
24680 F20101219_AACPYE sacco_j_Page_132.QC.jpg
42a8825a5569713f341fb95d25e9884f
a137d97cf2c495ece64b5feaf3d189b0076610db
4350 F20101219_AACPXQ sacco_j_Page_116thm.jpg
ef81dc67f1e195a23dcf52b042fe2bbe
5ca37ae1c0e8058f1d7e35442dbf1079a2a1c093
8692 F20101219_AACOUO sacco_j_Page_067thm.jpg
faab88fe312fcb08bd0dc9bd9b61a0c0
5f0707e167bfb42523f9e549b46bef7be64a4617
28972 F20101219_AACOTZ sacco_j_Page_170.pro
05ade45af08082f9cc762f76b034f556
c5d837306a94c70fcadfb494301502a5ff8c191a
23087 F20101219_AACPAI sacco_j_Page_143.jpg
545aa372418cf034f9fdf9fc75e6114c
02a0361d303844a717702c3d9bd98ff8f5c17500
9886 F20101219_AACOVC sacco_j_Page_143.pro
91d559e2f68cf8137aa74ae0c4636ef3
d69808a381488b02e243deb53e709f59b7c91af4
6353 F20101219_AACPYF sacco_j_Page_132thm.jpg
cdec97f2a5526fdc735d330b7e1b4c37
90679432ca49bd3f46398d1a7d0eff29def74436
6677 F20101219_AACPXR sacco_j_Page_118thm.jpg
112ad95f7ae2d9f96dd325a97c8abb44
7542bb7417a0850533672c4345da58d363e1a1ba
110625 F20101219_AACOUP sacco_j_Page_029.jp2
3ac5aa19df29c1cf9cfcf1f3070c06d7
497f6b7a3026dbb811eda8f292601dcd9c57030d
86227 F20101219_AACPAJ sacco_j_Page_144.jpg
53bb51ec48f289f03dbf2079231481f2
623cf40a80d1ec9494d1750cf05aae52259f85f0
26128 F20101219_AACOVD sacco_j_Page_151.QC.jpg
81fb7ce5d58650dac9e91d54d4bf8e9a
1eb4b33fb91168d79373cb78afe21b7ab970df07
9345 F20101219_AACPYG sacco_j_Page_133.QC.jpg
24d5e1916292e98da43adca0c0fcdcfe
74629fc24c108ae1ef0a2ec04edac0ce37338f46
33892 F20101219_AACPXS sacco_j_Page_120.QC.jpg
41bebbdefd852072acfba1deaecffaae
3e8979abf55a8b2b874085f82b4f97d0605c6c81
15783 F20101219_AACOUQ sacco_j_Page_038.pro
e4d681606cbe21959e945379767b6523
8be4b8107b8a71e1ddcaefe3da3b113b664eb9d1
131826 F20101219_AACPAK sacco_j_Page_145.jpg
e1cb38b6407f76a5d32f5d27d662410d
daaa828767afe3564183b621e09d18b8374ce114
F20101219_AACOVE sacco_j_Page_121.txt
c1c28ac1984e3f452988383c4a519d1c
4c39265ff1e89a47c947643db4d81f61bb569cce
4208 F20101219_AACPYH sacco_j_Page_134thm.jpg
264f0d32416177f93d4a7c2c80d8bb24
2e5e6fe102f58bc6372c9abee6d35cfc92209e3d
32693 F20101219_AACPXT sacco_j_Page_122.QC.jpg
8e7df5ab5a543a9381ba9ce16602d6e0
36e6f4921302e7d5ef1e292e7c50d2513d3e1962
F20101219_AACOUR sacco_j_Page_157.tif
a2604c5782a85818f218eb6aa579c71f
432ae7bda62f18dcf728843e0cdbc9b65c0610a0
6654 F20101219_AACPBA sacco_j_Page_003.jp2
4ddb372e1950ec12139252c5b1f0e03a
16d6de8fa76181cdb3cb3169282540158575610e
123218 F20101219_AACPAL sacco_j_Page_146.jpg
7cb6ca9dc2312353bfbd98903d7788ce
5d0e39f7b0f5eac69cf979782c9005195a05c22b
30600 F20101219_AACOVF sacco_j_Page_073.QC.jpg
39ba2a149e0ffcd2ea88a9030786d929
83bcafcf1e3704852ca886697b20bbfc583217b8
19195 F20101219_AACPYI sacco_j_Page_135.QC.jpg
e2b8b2583f503a95d70c482d03688ffa
4aa653de62a2f7d8aa4427a1f007f4141cad539e
33182 F20101219_AACPXU sacco_j_Page_123.QC.jpg
7437c61d120cb4137d1f0d4278baa872
f0c1642a0e63092ee5206738ca051b34009dff14
F20101219_AACOUS sacco_j_Page_011.tif
acaf3b87efcf7d1d368fac228b0f2710
43c295f64834a540b032ba0eaf2104be6bd46ffa
140609 F20101219_AACPAM sacco_j_Page_147.jpg
a71a8bb73e0e87d2dae09c3b0bb0149d
23be21633d6d1cae473a0323712aa70a2b6e3330
51937 F20101219_AACOVG sacco_j_Page_009.pro
fa535a1db3b5375d735988b210173a9c
eeefcf45a196681f333f1ff35ca8b2c19a352ecb
4066 F20101219_AACPYJ sacco_j_Page_138thm.jpg
16291dcb932b8d30a113630df00bc15f
659b15eba532f2b232817dc6a58f43ab468b696d
8468 F20101219_AACPXV sacco_j_Page_123thm.jpg
92ccdd28faf3b09162a62da2606af5a1
357044597eb678c434a20c32e356b1214932aa4d
34814 F20101219_AACOUT sacco_j_Page_046.QC.jpg
2ff63a3ed92b167e5f983e33d09559e2
1599560a65e277e892439331676a268674c00f34
65135 F20101219_AACPBB sacco_j_Page_004.jp2
9606192cd33a60694c72d82953545d01
fdd64ca422a302c0d72a6e2c2eb7fd4fde224752
130716 F20101219_AACPAN sacco_j_Page_149.jpg
12ebe5639cabdb31d43cb221648183f3
d19abe4507e368ad502c44a4195fa3e833a15080
5656 F20101219_AACOVH sacco_j_Page_006thm.jpg
56d7ec0849a93bd1a7632c6e97464553
8491987c52539d8e7a7ef37d392b00230b388913
16362 F20101219_AACPYK sacco_j_Page_139.QC.jpg
e9cd4d9dc0a8074556d93bbf5d6579e6
cf1623abef00feace8a5d14bd09515e43ce96d03
22834 F20101219_AACPXW sacco_j_Page_125.QC.jpg
e63f159ca8d748336a502eea35e0b23c
69106791b2c846c5ba27366ed4f249a90c718b98
F20101219_AACOUU sacco_j_Page_071.tif
a0cede3aa7a472f971027ec2b6d3e4b7
cde3e116a708655a68feaa9ea6895ae42f6f4817
1051978 F20101219_AACPBC sacco_j_Page_005.jp2
e2152526d922325d3cf3e92107bf146a
7e0a247448649c529866615b90c8644ee3c5c0b1
136449 F20101219_AACPAO sacco_j_Page_150.jpg
1f199e385ca286e1524a0d78d67469e1
bb3dda25a755ae9b11563fb4f27157581e484bd8
F20101219_AACOVI sacco_j_Page_040.tif
fe4f8890929058a56aacda4f075f94af
20f9bd0647ed9fd7f228711fcc6716075a9ecbef
8599 F20101219_AACPYL sacco_j_Page_140thm.jpg
bf389f9aaba70fcc3a4b37b4e2561aab
0da38633889b5d0753cba836206be5c5385b83fb
1051971 F20101219_AACPBD sacco_j_Page_006.jp2
1287b6ef14183895f0df12f4959559bd
7a7708306f9aad95bbf6331c26c281bfdf6d4da7
113351 F20101219_AACPAP sacco_j_Page_151.jpg
3832631b1e3e27ddc15d138d3f129d5f
d2142cde9c2b43fc227b10d262df71bd92c67f4f
24661 F20101219_AACOVJ sacco_j_Page_118.pro
161053051aff497183013b3a1b3e40a2
cb3e149442e4ebe975e36e19304e51e49a7aa584
20814 F20101219_AACPZA sacco_j_Page_155.QC.jpg
5f5f74d3d1b09af8279921204515ee29
a783d6a03b76eff4210243323c1d72514fcbd6b2
35280 F20101219_AACPYM sacco_j_Page_141.QC.jpg
9e356060a2ae05d724f4c59922387de7
3763f3e18f409d44abd89609d33aa248726f5e05
35471 F20101219_AACPXX sacco_j_Page_126.QC.jpg
e23e4a13321b9aed382568972af3d80f
488309d0ad487de3dcdda7cdc1191bba9fb6bc5e
8115 F20101219_AACOUV sacco_j_Page_050thm.jpg
7c3e80982e128ce59e574823edb0ce0e
f5e8cc4a6bbe8e3eb24838d053cd63edc596d6ff
1051981 F20101219_AACPBE sacco_j_Page_007.jp2
1053668072f2db863d61c4704acb18be
e7c2ecb5650b6b4700784c37f6ee3089a47adc4e
110867 F20101219_AACPAQ sacco_j_Page_153.jpg
fc3cf1099509cf85fd846b2edc222c7b
ec346449b3da066f489246a710f7fcdd9f89a762
36196 F20101219_AACOVK sacco_j_Page_165.QC.jpg
b27ff4001c3306a7968138669c7e1cd4
936a18e30db0d44f01d607157997b0a110204256
30016 F20101219_AACPZB sacco_j_Page_157.QC.jpg
e07207a4c6bfd2aa937a3612ece1cabf
fea6de2929dc7c1a9307afe7a747f1072c048dad
8802 F20101219_AACPYN sacco_j_Page_141thm.jpg
6d50322894702e83733711e2419ff6f2
bbb42f6a5b93230033a3ee939540fae6fa51ab2f
7920 F20101219_AACPXY sacco_j_Page_127thm.jpg
570da042d9be51c038d6d4e1130f255e
36f24dafa12dbed638c2eb34f21a2c0ed90846e6
8397 F20101219_AACOUW sacco_j_Page_060.pro
0cc22125bc245f6f3ea5e60a1aaebc2a
aeccb32760e8be99e73a2c01a8c42d7df207d70c
F20101219_AACPBF sacco_j_Page_008.jp2
cc0fd17743ffd0f65d87b5a59ef92e58
b91fb4415b6ef50a941b222844b7112e2b8bbb2f
109763 F20101219_AACPAR sacco_j_Page_157.jpg
825703354270e6011bae15a2817a7b51
c8180df270ed97dc2d7bc2ce633c103267500b0c
F20101219_AACOVL sacco_j_Page_117.jp2
72b833b4475feefe87203f6665f0828f
8777fb4bf596b9cbeab5237e4877a7014a4b937b
7404 F20101219_AACPZC sacco_j_Page_157thm.jpg
38b9b15838341b4a5f3d5d6340fe5969
d6307c95949381e1d9434358389d7e103dbc6f2b
8548 F20101219_AACPYO sacco_j_Page_142thm.jpg
7c36d25c9d7e90245c1089858bb87d5f
1c64eb0d7cbefb67ba83b2fd9d2b7bb5f4802dff
22417 F20101219_AACPXZ sacco_j_Page_128.QC.jpg
724f8cdd60d3fa2637cdc3bf0da92fcd
748db1cb1345aea3757012bd20a03610bdcc4d7b
8470 F20101219_AACOUX sacco_j_Page_166thm.jpg
e86bfc6f9c9c049c3ce00ba70049a4a6
7891c2a12b492eabe9410acf0d5e4210de65b38a
F20101219_AACPBG sacco_j_Page_010.jp2
cc3691b62aec3ed78543d522c547f7bd
3738e71d68b6fd05adae59471f16f53596a1d504
20768 F20101219_AACOWA sacco_j_Page_022.QC.jpg
8bd3c65a6916cb7ddd92aac6ee9cdd2c
01098990a08931a705e6fd2f4ce13b4f4b848c67
133888 F20101219_AACPAS sacco_j_Page_158.jpg
d898b7d45d94411c4b13aa551b48be87
a18ff30d2a01f25023389bf80857ce38dfc9b9ea
2467 F20101219_AACOVM sacco_j_Page_107.txt
98df22fafcd49bbf23ad0b34a4084d24
99eb72fe20a46892df853b22f27764316a4da108
36736 F20101219_AACPZD sacco_j_Page_158.QC.jpg
a8443c8503831bbb6e4d08e6a16f302e
460a2461187696d1ba888eab1b7cce577be4f4d6
2162 F20101219_AACPYP sacco_j_Page_143thm.jpg
b3183fb0836bc3b421f53bb113de7853
85f9781ed1beb466af87f197381f7d72dece52a3
1897 F20101219_AACOUY sacco_j_Page_086.txt
d7ca2733908046b817d2e17fce362e46
51455b3a662c6f61de66a02f9102009840e3f5cb
98223 F20101219_AACPBH sacco_j_Page_014.jp2
5234208194500659fe36a83580dd39de
aa4ff4a82acbd66f614dda3bfce6c0cd4f7ca99f
9099 F20101219_AACOWB sacco_j_Page_068thm.jpg
cb5b36ae1bee56e71e77c046cdb367a1
f721fd439dbbea1a77d8beaf3a166583081c8952
131358 F20101219_AACPAT sacco_j_Page_159.jpg
546f381afe5586ee344938bbdd209b6d
000b204f651c09443d0e962b7342595dec974fa4
21702 F20101219_AACOVN sacco_j_Page_037.pro
7c6c7bfcf091aa6360031c98029f4fd6
ec061a939d0cf16f6c5e56c2e4e5a46cdaba3ffd
8030 F20101219_AACPZE sacco_j_Page_160thm.jpg
3c5a4c53f635b4c99a8501075a558ae0
25ac24c940606380e11a2d4e08f86ed2414360e6
22662 F20101219_AACPYQ sacco_j_Page_144.QC.jpg
4eb4d648c6b491c41219ccda0e3bb828
3b8fe8bda264f9b806e298e2eb2a57e139246573
110832 F20101219_AACOUZ sacco_j_Page_160.jpg
2f488a04c1dd06f2ca88a80ffacd95d9
7f60405f9f3ccaa701167a3a1d36fc3d9f32d282
109788 F20101219_AACPBI sacco_j_Page_015.jp2
ad86ce63c7206b191c898fd0e00d9c7b
e2426e78659851fd46e775f5a78dec43dc7bf2c3
20605 F20101219_AACOWC sacco_j_Page_055.pro
f81dff31a90656cfd466578cc4f3cd84
94cc76bf87761bc9ec0013ca6925e706635ed7ec
122248 F20101219_AACPAU sacco_j_Page_161.jpg
4214b5e585737956725aa0e33a1c426f
2e609fb5a8b3ae8dd31b1261be5556fbff845ee4
91838 F20101219_AACOVO sacco_j_Page_079.jp2
0949b86e56a3394b83f2a317f4bf779d
3f5818b2f341b69574574cb67f631e74f784784b
33376 F20101219_AACPZF sacco_j_Page_161.QC.jpg
94b8a343a757828878eb9cd163b655e9
e71a9ad8117e1145988bb17ae0d321f4366f23ff
6416 F20101219_AACPYR sacco_j_Page_145thm.jpg
b54444261d1f8d48f441a85b4f765420
e184cd187b9f4106992deedcf07132bf6e19a6e5
90183 F20101219_AACPBJ sacco_j_Page_020.jp2
d08e28b80bac0c7c5b100cdf51876211
057a9d81ed8f8b576c9a7e27a6c73498e574eb88
108705 F20101219_AACOWD sacco_j_Page_084.jpg
9b9f716854cbbf95652ed6d96a92b71b
ed82d3d05d28fb5ba0327795625ef2c3387a02ba
141603 F20101219_AACPAV sacco_j_Page_163.jpg
454a9e4a836e2946f152f3eca97dfd9b
95fe7ee3741d9d3425293dcf671f4808cab925e0
1702 F20101219_AACOVP sacco_j_Page_002.QC.jpg
6d2520745b671ab8eaab55a2a5342bfc
e8f6b23f85184ec8aef89ed443d9871b4434e513
8871 F20101219_AACPZG sacco_j_Page_162thm.jpg
5acfafe3a410415ec68d59a7c82b76c7
575a82a16c7e73172632fb9210412b814a8f2712
29175 F20101219_AACPYS sacco_j_Page_146.QC.jpg
f79dfc48c79356051dbc58d146e62e69
ddf4d3422b4d884dbe600bbea874730f051ba5d9
107669 F20101219_AACPBK sacco_j_Page_021.jp2
d0d65c685e4b0a2662061754bfe5e32b
ae6001869a73b5958c3bcc342f1f56b6897a2dad
106356 F20101219_AACOWE sacco_j_Page_092.jp2
5828528a6b757fde243f8a40459fcf59
4e1b8c28c06c09ba62fd54b54e32e3ef3b556a41
130225 F20101219_AACPAW sacco_j_Page_165.jpg
4e3e6a6da48f3a99b3574d49477811a7
0922f2fe11d48bf194004c3c2288e23beb60d974
8073 F20101219_AACOVQ sacco_j_Page_057thm.jpg
7b55dc96960cd65dd79cd560f2586e70
aa9db6b895a105319193ad92f2fb50daa044fa65
8452 F20101219_AACPZH sacco_j_Page_165thm.jpg
168a2baced7b15ed1a28ba291e924f26
7d950c1a69aca4bce9b9c1c2536f057b2b5d1e89
6755 F20101219_AACPYT sacco_j_Page_147thm.jpg
ab45eac16240b97f5cca3e13b6827ca5
f6ae9b33148bea20463c44c1b98e48beb0cec063
104765 F20101219_AACPBL sacco_j_Page_024.jp2
6e1bf30f011374a70e57afbb45e1575f
85dd23bbc304652905acfcb492bd43d5f7dfcc2c
32870 F20101219_AACOWF sacco_j_Page_124.pro
4dcaac62a6a25762a17a47454c52b842
73910735b65f95181399a73dc1a42bc020bd922d
128733 F20101219_AACPAX sacco_j_Page_166.jpg
c24fa47ec58bbeab5a0f0396d74ecf86
89ef4b06adb0c17bf4599743834ad9d200209f23
50699 F20101219_AACOVR sacco_j_Page_077.pro
ecd3d72c4139acf0909d445cf724f0e8
a703a7ed4879f6bd9f1413763bad3f643ae97e5a
792628 F20101219_AACPCA sacco_j_Page_044.jp2
2a615f1a2db0feee7875bd0c7a574396
7b0069719d82df5888faed4bd52c73e8f9d4dacf
34898 F20101219_AACPZI sacco_j_Page_166.QC.jpg
fe065adefeb6fbc9aa6ccde3451a61de
27a6e03f647f9779d3c44bfad75f4e51ea70dfbc
20250 F20101219_AACPYU sacco_j_Page_148.QC.jpg
c2f3776c0cb4df60cf75aa2327e275d6
a1230f8d3a54866c652d7e33e1c653d7948f259f
703621 F20101219_AACPBM sacco_j_Page_025.jp2
a86052c91e0bdc8af796a880094cb31c
8f479c6d50dca9baffc6877a2f1cc97568c50c98
1713 F20101219_AACOWG sacco_j_Page_095.txt
40181654717ea066552739697b0fbbe2
cc1477aa0d2a04306f1b72eb28063ef194f96ade
26060 F20101219_AACPAY sacco_j_Page_001.jp2
f1ef551d9eafd67ea783e41634880c9a
aaa65db496d311a4186bfd20edc9507e4082738c
6328 F20101219_AACOVS sacco_j_Page_113thm.jpg
9deaf84a944595f4b096da212595745f
17387597067b5cfb6554f0115ec4a7ea812fcaf9
108886 F20101219_AACPCB sacco_j_Page_046.jp2
a3e80ab78e29dec4b31d33c000949280
1cd8062c6c513eff806bbeba416a6f47703c7106
34384 F20101219_AACPZJ sacco_j_Page_167.QC.jpg
a450c969b80e32811ceaacef4a732439
dc4a87e1078e6cad358ff815d11b5abe288a1b49
6874 F20101219_AACPYV sacco_j_Page_149thm.jpg
53d92ecfbe98cef61a97b0d75ecb9367
cfcafef09ee8d324ed724cadffcf0fea1dc31b02
39186 F20101219_AACPBN sacco_j_Page_026.jp2
3beafa2c7d1b013601d25564233b0dbd
b6665ee7e2415e834f974d5cd6c9441261847116
F20101219_AACOWH sacco_j_Page_072.tif
4c2d19bfa37641ecc21b683e3f45e04f
968835f36171aee3de0a696405100986d6e387a8
5883 F20101219_AACPAZ sacco_j_Page_002.jp2
87fe338795b0d0a9b0841fee8ba2c4f2
bf777ee90cb6546422ee73c03b676d4f2ee62e6c
32518 F20101219_AACOVT sacco_j_Page_121.QC.jpg
554628f8467a5a05b56dd4b602bc63bc
0d5260549286d8630b682c1a7656e71d1a86b657
8508 F20101219_AACPZK sacco_j_Page_167thm.jpg
946abaddea09ab0bf20a3b72ba409325
6085e2408f849d4f9f8a6530eb39c5c8ef7c943d
33326 F20101219_AACPYW sacco_j_Page_150.QC.jpg
ba5510c5055b47ad78390c6ca728ad4a
28b4104138710c73d174e100417225f1e142ccd7
97206 F20101219_AACPBO sacco_j_Page_027.jp2
eecd0da7f5f899f2574f34d09360c660
c63762fd6229455324a64e12d6b5355c3add5ba4
8734 F20101219_AACOWI sacco_j_Page_158thm.jpg
7370ffee887bf55254ccaba8905a4599
64c63cb18b42959d2110de9fe3997eb075563245
100540 F20101219_AACOVU sacco_j_Page_071.jpg
7ead4bdf9e2e37b10863d45f244ed9c1
cca42899349a5b45820f2b6e12d760b9cf9f402d
102980 F20101219_AACPCC sacco_j_Page_048.jp2
1544daf99eaf166af9e82166f60bc2c7
ccab7b23cb6e62f6a96f3a3b90287cbc50d7a9ee
38261 F20101219_AACPZL sacco_j_Page_168.QC.jpg
0827b6cd94d7ef6acdadf102fef5a6c3
dfd7908c97e6a4746e23df2068a4571c99bac67b
5646 F20101219_AACPYX sacco_j_Page_151thm.jpg
7d53b0cdd019d80a74659cb22a329b7d
10ac6becf984e410131d35fba960c37428d9bc3d
391078 F20101219_AACPBP sacco_j_Page_028.jp2
e8b08c96158d7b5150bff3c209ca1202
bb2ae56689e69bfa7bb83a0043c8250fe7429bcc
8431 F20101219_AACOWJ sacco_j_Page_159thm.jpg
b0434e228cbb2385eae526baf3d76c70
2be56b7852e0ac636f08152624c2e84d89f02d06
34676 F20101219_AACOVV sacco_j_Page_140.QC.jpg
1c85eb0625ae080ee4dc28a990237618
8cd7ef0b7764ebb7dd388eca75dbb5144b4742ba
107466 F20101219_AACPCD sacco_j_Page_049.jp2
942a600e3707af5bc3548ce502b768ee
07ba802c5219ace132b9092d600856398a57a024
8870 F20101219_AACPZM sacco_j_Page_168thm.jpg
e6f164b93bb0575bf1dd4944b6a692bb
e66c52ffaf58fcba57f8d87e10223fb706f96658
106618 F20101219_AACPBQ sacco_j_Page_030.jp2
323b3e197ad4a50b956bbcdf45a4690f
8cbb3d467052721149b4cbb7bbb3492d1131b54c
7414 F20101219_AACOWK sacco_j_Page_087thm.jpg
ca4328c73c27d2ea01cc472b225a6758
c8c381e666f312ad22aba429b2d6a8716d4830b8
98261 F20101219_AACPCE sacco_j_Page_050.jp2
ad17018ed3022c145cae4adf3ff76019
e50c7318392634e4b0e00771922db1b3df4d311f
8362 F20101219_AACPZN sacco_j_Page_169thm.jpg
7a28b0bc6a94d9c950420f05fcb4f83f
9b7aed6c1a8e7246a8e5336db9d2dc203005fd37
24167 F20101219_AACPYY sacco_j_Page_152.QC.jpg
0c74c6c12bce39239589965140677311
3dce33dce3b8ffa4c924827c606289987c8b721f
110159 F20101219_AACPBR sacco_j_Page_031.jp2
50ea91a934d62b9c7713aef237ab450f
4a12a8c7a5812107f866e4148921fd530a94c7dd
91555 F20101219_AACOWL sacco_j_Page_156.jpg
5948316e606236018199116336b9bff2
3ff2e44c4781843ab055c355cafd66e5d1fe8021
8531 F20101219_AACOVW sacco_j_Page_018thm.jpg
9e36921273f466aa3623a2f2c0d150f7
e875c5f38a4c1ae024799510469b33ed1dc8910a
105119 F20101219_AACPCF sacco_j_Page_052.jp2
cdd2dc26148465033d992ec95286af21
72151577b346d6a2497f920d285c2ac8e769ffe5
4765 F20101219_AACPYZ sacco_j_Page_152thm.jpg
bba3582f1841bfe58f04cfc9128660a0
01cafc647c1d21c0895d9630e33ba061326e8f60
104970 F20101219_AACPBS sacco_j_Page_032.jp2
4eff860ff3b81c91830dac04cd51bcbf
9de1894f21ddc2ff7655dce136a2acb70dd04c67
41575 F20101219_AACOWM sacco_j_Page_081.pro
acc0d43452d1636a052baa615b00de23
e9efacb1ae72fa199e9d9f7e10f3261d9f0e8aea
2376 F20101219_AACOVX sacco_j_Page_007.txt
c1e03a74b08731decaa3c798cdc66c2e
85cab107612ef1ef21ae59f7be2d6d7f0c6ced62
111722 F20101219_AACPCG sacco_j_Page_053.jp2
dd715a1222140771cbd3ac9d0dabf59e
f2f5cd47091d83ac4086daea97232accdbaedfef
106837 F20101219_AACOXA sacco_j_Page_015.jpg
8c853c387b6716d937c656c9a9460ca2
29d8aeea2e1df3e13e1d294da732ab3207d1ff19
112249 F20101219_AACPBT sacco_j_Page_034.jp2
0fd65908279a65c3e4a1346a62374377
23bd063ffef9d46c7f7a40c9865088ba47f5a5ed
6805 F20101219_AACOWN sacco_j_Page_124thm.jpg
7a716208633676fa2042adb15c39f74e
b901423d878650a773d76e2d8be45ca5290f8f8d
4913 F20101219_AACOVY sacco_j_Page_139thm.jpg
59340b7eb36fdb0afb3ec59b2a8b9f2a
fd00a00bf4ea071007d08ca1863f8248d0ea341c
89091 F20101219_AACPCH sacco_j_Page_054.jp2
650880dee27c5b4e3c15d8d0873a8723
1e10a121b73c2377ad64b69184e89cd6613a0397
47427 F20101219_AACOXB sacco_j_Page_016.jpg
4b70abb534341e1e58324689bde60f55
66eef141b6d870937e97f375377b0effd03f262b
97961 F20101219_AACPBU sacco_j_Page_035.jp2
5811ebfdbbe526e392d834fdf84b739e
7b9775a28b77b54f92f78bb45a74b2ada4f6240a
884 F20101219_AACOWO sacco_j_Page_114.txt
e304a7d0fa4716d8c0c8794c160dd202
3bfddee79d44cf1cec33cab6c79811b1daa22b28
80625 F20101219_AACOVZ sacco_j_Page_098.jpg
824f76f2ec698e3f188b5829b8f4e1d0
fa123d11d7764629b8aa7d00763a391bd82cd60c
71351 F20101219_AACPCI sacco_j_Page_055.jp2
ce92f9fe577e2d1138d6892a2dcbcd91
9eca9f8d47b8e079556aa3683f790e7dbb7daee2
92539 F20101219_AACOXC sacco_j_Page_017.jpg
bdddff54fb0e3cbd9dc389430459bbec
4e8c07397c551ffee9ddb624e23a0ba3d7b9c45f
83984 F20101219_AACPBV sacco_j_Page_036.jp2
7564116a93230e4df7b0c327e95d336e
82bba1ea448fec1e47a3ca96e2341e5ca0d06d26
195071 F20101219_AACOWP UFE0015605_00001.mets
f56465e5aadd0094f5e5dbd1d0156324
d9fb0b194b8e61d191ecb0d6e51af25459f1e731
sacco_j.pdf
112144 F20101219_AACPCJ sacco_j_Page_056.jp2
8addd6dbc1fbba37e1fcd7e6fb5d3dee
ca403c968102634432d0496907cff62559fd5369
102493 F20101219_AACOXD sacco_j_Page_018.jpg
e361a35b3e18f1303623f39c338f0576
0d9ce8e505df194a2d935b6fe0834f5ab0b36bf2
49501 F20101219_AACPBW sacco_j_Page_037.jp2
e533b84b9e66dd12cc297ab9b8c8c422
e7d72490a170d3d869145071ed05c2bc359eb409
74221 F20101219_AACPCK sacco_j_Page_058.jp2
d618e37741ef398a0f723bbfde95c6a4
6f563df98896c87f582fae642fd54ef93a84d3fc
86887 F20101219_AACOXE sacco_j_Page_020.jpg
2973c3c7449142eb2087d5a69b005e9c
236c66dbe8373a65f3a123854e753389f30a959f
85434 F20101219_AACPBX sacco_j_Page_040.jp2
711e322610315862a341722d6dec1580
e17ca412ce80e3dad516441c9fbe15f424c3cdb7
108433 F20101219_AACPDA sacco_j_Page_085.jp2
3dbd943b5e8fa5f903760ebe7208ae04
c4f91f3fe92163a18224cdfed8716bad45ab9e00
481306 F20101219_AACPCL sacco_j_Page_060.jp2
815680d65d42fc6617727d49bf5f4b18
eab4bd55a795bef44de9a9a054f149e262d9684d
105235 F20101219_AACOXF sacco_j_Page_021.jpg
98a3a1cd01edac951ad42639e54bad9a
66e88b379a89ae25b2315d1b8cf63503ba7e0e40
649446 F20101219_AACPBY sacco_j_Page_041.jp2
c2ea59ab92ebc0acd219248696655818
2b6a660f2b08979938a914dcfcb7ab68853c1904
27316 F20101219_AACOWS sacco_j_Page_001.jpg
72feb12c9408d370820060c7cd5e217d
854e0248256a8c393c1bf5c60665d6d1154900ab
905641 F20101219_AACPDB sacco_j_Page_087.jp2
62e8f49f98fb8e30377bd1f92f2783a6
cfe0a142245bd4a9ebd9bb64e14bad521795be15
77313 F20101219_AACPCM sacco_j_Page_061.jp2
c22f45c030aa0cbd09db3f5857f9f2d1
57e2ccabbf1cd86087d89bf122db423c6774dac5
68071 F20101219_AACOXG sacco_j_Page_023.jpg
e9934504fd809d20a5689b1404c19f46
167bf1605444016535993070c61af47aa027f72f
F20101219_AACOWT sacco_j_Page_002.jpg
132a4dc2985daf7673c1beb1e5e0b334
1b32d162e0c88447087549afc76e6742175658c5
265870 F20101219_AACPDC sacco_j_Page_088.jp2
efd204389dcbd8097c39212af1c422bd
911b959c9f60345fcbe6a235eebf108389aa21c7
77959 F20101219_AACPCN sacco_j_Page_062.jp2
a21902055af7eee476dec234f154bd72
fdb615b2ac9ad2b7cf3b79cf218a1fbced63e2cc
100066 F20101219_AACOXH sacco_j_Page_024.jpg
146882663d1122bcf02f3befeaa2eeb8
adb6bf071b46269459343725f8f833f90bca1d43
856872 F20101219_AACPBZ sacco_j_Page_042.jp2
af3c9c73c60336748bbcc676e61da6d6
7d2d32ab3ce54856ccf86af97949ee58ae4db2e0
5620 F20101219_AACOWU sacco_j_Page_003.jpg
6317392860b0b1d654bd145b387b399a
1e30da786e38312c08399e993b2f2046eed60f8b
423645 F20101219_AACPCO sacco_j_Page_063.jp2
77ccc214ea88f1ea2b94e02f9c65abe8
f10f0364f3ab2b902717093e79a2cd2c7fc60c0d
93726 F20101219_AACOXI sacco_j_Page_027.jpg
93261acfaee2f39523abdb28c0e2b541
e56094485662260c7bbea0df5776c4355040f2fc


Permanent Link: http://ufdc.ufl.edu/UFE0015605/00001

Material Information

Title: Phase II Biotransformation of Xenobiotics in Polar Bear (Ursus maritimus) and Channel Catfish (Ictalurus punctatus)
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015605:00001

Permanent Link: http://ufdc.ufl.edu/UFE0015605/00001

Material Information

Title: Phase II Biotransformation of Xenobiotics in Polar Bear (Ursus maritimus) and Channel Catfish (Ictalurus punctatus)
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015605:00001


This item has the following downloads:


Full Text











PHASE II BIOTRANSFORMATION OF XENOBIOTICS IN POLAR BEAR
(Lh-sus maritimus) AND CHANNEL CATFISH (Ictalurus punctatus)














By

JAMES C. SACCO


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006
































Copyright 2006

by

JAMES C. SACCO


































This document is dedicated to Denise and my parents.
















ACKNOWLEDGMENTS

First and foremost, I would like to thank my mentor, Dr. Margaret O. James, for

her instruction, guidance, and support throughout my PhD program. Through her

excellent scientific and mentoring skills I not only managed to complete several

interesting studies but also rekindled my scientific curiosity with regards to

biotransformation and biochemistry in general. I greatly appreciate the advice and

instruction of Ms. Laura Faux, our laboratory manager, on enzyme assays, HPLC, and

fish dissection. The assistance and advice of Dr. David S. Barber, Mr. Alex McNally,

and Mr. Jason Blum at the Center for Human and Environmental Toxicology in walking

me through the complexities of molecular cloning are much appreciated. Academic

discussions with Dr. Liquan Wang, Dr. Ken Sloan, Dr. Joe Griffitt and Dr. Nancy

Denslow also helped me to interpret my results and design better experiments

accordingly.

Last but not least, I would like to thank my fiancee, Denise, and my parents, for

their support and encouragement throughout my doctoral studies.




















TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .............. .................... iv


LI ST OF T ABLE S ................. ................. vii........ ....


LIST OF FIGURES .............. .................... ix


AB STRAC T ................ .............. xii


CHAPTER


1 BIOTRANSFORMATION AND ITS IMPORTANCE IN THE
DETOXIFICATION OF XENOBIOTICS ................. ...............1............ ....


2 PHASE II CONJUGATION: GLUCURONIDATION AND SULFONATION .........4


UJDP-Glucuronosyltransferases (UGTs) .....__.....___ ..........._ ............7
Sulfotransferases (SULTs) ............ ..... ._ ...............11....

3 SULFONATION OF XENOBIOTICS BY POLAR BEAR LIVER .........................14


Hypothesis .............. ...............17....
M ethodology ................. ...............17.................
Re sults ................ ...............23.................
Discussion ................. ...............32.................
Conclusions............... ..............3


4 GLUCURONIDATION OF POLYCHLORINATED BIPHENYLOLS BY
CHANNEL CATFISH LIVER AND INTESTINE ......____ ........_ ...............38


Hypothesis .............. ...............41....
M ethodology ................. ...............41....... .....
Re sults ....._ _................ ........_ _..........4
Discussion .........._ ......... ...... ...............53....
Conclusions and Recommendations .....__................. ........_ .........5


5 CLONING OF UDP-GLUCURONOSYLTRANSFERASES FROM CHANNEL
CATFISH LIVER AND INTESTINE............... ...............6


Piscine UGT Gene Structure and Isoforms ............. ..............60.....












Hypothesis ................ ...............62...
Method ology (part 1) ............... ...............62...
Results and discussion (part 1) .............. ...............74....
Methodology (part 2) .........__.. ..... ._ __ ...............79....
Overview of RLM-RACE ....._.. ................ ........_._ ......... 7
5' RLM-RACE procedure .............. ...............8 4....
3' RACE procedure ..................... ...............86.
PCR amplification of entire UGT gene ......___ ..... .._.. ......_._.........8
Results (part 2)............... ... ...............8
Nucleotide sequence analysis ................ ...............89........... ....
Protein sequence analysis ................ ...............100................
Cloning of entire UGT gene ................. ...............104........... ...
Discussion ................. ...............107................
Limitations ................. ............ ...............110......
Conclusions and recommendations ................. ......... ......... .............1


6 DETERMINATION OF PHYSIOLOGICAL UDPGA CONCENTRATIONS IN
CHANNEL CATFISH LIVER AND INTESTINE ......____ ........ __ ..............116


UDP-Glucuronic Acid (UDPGA) ................. ...............116................
Obj ective ................. ....._ __ ...............118......
M ethod Development ................. ...............118....... ......
Sample Digestion ....__ ................. .........__..........19
H PLC ............ _...... ...............1 1....
Final M ethod .............. ...............123....
Re sults............ ..... .. ...............125...
Discussion ............ __... ...._ ..... ._ ............12
Conclusions and Recommendations ....__ ......_____ .......___ .............2


APPENDIX


A SEQUENCES OF UGT PARTIAL CLONES AND AMPLICONS ................... .....131


B SEQUENCES FOR UGT FULL-LENGTH CLONES FROM CATFISH LIVER..138

LIST OF REFERENCES ........._._ ...... ..... ...............144....


BIOGRAPHICAL SKETCH ........._... ...... .___ ...............157....

















LIST OF TABLES


Table pg

2-1 Expression of human UGT mRNA in various tissues ................. ........... ..........9

2-2 Tissue distribution of SULTs (cDNA and mRNA) in humans.............. ...... ........._12

3-1 Estimated kinetic parameters (Mean + SD) for (a) sulfonation and (b)
glucuronidation of 3-OH-B[a]P by polar bear liver cytosol and microsomes. ........24

3-2 Kinetic parameters (Mean + SD) for the sulfonation of various xenobiotics by
polar bear liver cytosol, listed in order of decreasing enzymatic efficiency. ...........27

4-1 Estimated kinetic parameters (mean & S.D.) for the co-substrate UDPGA in the
glucuronidation of three different OH-PCBs. ...........__......_ ................44

4-2 Kinetic parameters (Mean & S.D.) for the glucuronidation of 4-OHBP and OH-
PCBs. ........... ..... .. ...............48....

4-3 Comparison of the estimated kinetic parameters for OH-PCB glucuronidation in
catfish liver and proximal intestine .............. ...............48....

4-4 Comparison of kinetic parameters (Mean & SEM) for the glucuronidation of
OH- PCBs grouped according to the number of chlorine atoms flanking the
phenolic group ........._.__...... ..__ ...............49....

4-5 Results of regression analysis performed in order to investigate the relationship
between the glucuronidation of OH-PCBs by catfish proximal intestine and liver
and various estimated physical parameters. ............. ...............52.....

5-1 5' 3' Sequences of degenerate primers chosen. ......___ ... ...... ..............66

5-2 Primer pairs chosen, showing annealing temperature and estimated amplicon
length ................. ...............67.................

5-3 Results of BLASTn search of cloned putative partial UGT sequences ........._........78

5-4 Gene-specific primers used in initial 5'RLM-RACE study. ................ ................82

5-5 Gene-specific primers used in succeeding RLM-RACE study ............... .... ............83

5-6 Primers used for amplifying liver and intestinal UGT gene .............. ..................87











5-7 Results of blastn search for livUGTn (and intUGTn) ................ ......................92

5-8 Promoter prediction ................. ...............92........... ....

5-9 Results of blastp search for liv/intUGTp ................. .....__ ............. ......9

5-10 Results of blastn search for I35R C............... ...............99...

5-11 Potential antigenic sites on liv/intUGTp. ............. ...............101....

5-12 Results of blastp search for I3SRCp ................. ...............102........... .

5-13 Results of ClustalW multiple sequence alignment analysis of the cloned UGTs
and the original livUGTn .............. ...............106....

5-14 Conserved consecutive residues observed in catfish liver and mammalian UGTs
(sequences shown in Figure 5-13)............... ...............109.

6-1 UDPGA concentrations (C1M) in liver and intestine of various species ................. 117

6-2 Elution times of certain physiological substances (standards dissolved in mobile
phase) using the anion-exchange HPLC conditions described above...................124

6-3 UDPGA concentrations in CIM (duplicates for individual fish), in catfish liver
and intestine ................. ...............126................

















LIST OF FIGURES


Figure pg

1-1 Schematic of select xenobiotic (represented by hydroxynaphthalene)
biotransformation pathways in the mammalian cell. ............. ....................3

2-1 Structure of the co-substrates PAPS and UDPGA (transferred moieties shown in
bold) and the formation of the polar sulfonate and glucuronide conjugates,
shown here competing for the same substrate ................. .............................6

2-2 Proposed structure of UGT, based on amino acid sequence .............. ..............7

2-3 Complete human UGT1 complex locus represented as an array of 13 linearly
arranged first exons. ............. ...............10.....

2-4 The human UGT2 family. ............. ...............10.....

3-1 Structures of sulfonation sub states investigated in thi s study ................. ...............1 5

3-2 Sulfonation of 3 -OH-B[a]P at PAPS = 0.02 mM ................. ................ ...._..25

3-3 Eadie-Hofstee plot for the glucuronidation of 10 CIM 3-OH-B[a]P, over a
UJDPGA concentration range of 5-3000 CIM. ............. ...............26.....

3-4 Sulfonation of 4'-OH-PCB79, PAPS = 0.02 mM. ................... ............... 2

3-5 Autoradiogram showing the reverse-phase TLC separation of sulfonation
products of OHMXC ................ ...............29........... ....

3-6 Autoradiogram showing the reverse-phase TLC separation of sulfonation
products from incubations with TCPM ................. ...............30........... ...

3-7 Autoradiogram showing the reverse-phase TLC separation of sulfonation
products of TCPM and the effect of sulfatase treatment............._. .. ........._._ ...31

3-8 Autoradiogram showing reverse-phase TLC separation of sulfonation products
from the study of PCP kinetics ....__. ................. ...............32. ...

4-1 Structure of sub states used in channel catfi sh glucuronidation study ................... ..42










4-2 UDPGA glucuronidation kinetics in 4 catfish............... ...............46

4-3 Representative kinetics of the glucuronidation of OH-PCB s in 4 catfi sh. ...............47

4-4 Decrease in Vmax with addition of second chlorine atom flanking the phenolic
group, while keeping the chlorine substitution pattern on the nonphenolic ring
constant ................. ...............50.................

4-5 Relationship between Vmax for OH-PCB glucuronidation in intestine and liver
and ovality .............. ...............53....

5-1 Summary of methods used to clone channel catfish UGT ..........__..................63

5-2 Products of PCR reaction. 1(from intestine), 2 and 3 (from liver) ................... ........75

5-3 Plasmid DNA obtained from cultures transformed with vector containing inserts
from liver and intestine. ............. ...............76.....

5-4 Product of ecoRI digest of purified plasmids containing liver inserts L1-L8..........77

5-5 5'- RLM-RACE and 3'- RACE ................. ........._._......... ................80

5-6 Primer positions for 5'- and 3'-RACE ......... ........ ................ ...............81

5-7 Full nucleotide sequence obtained for hepatic catfish UGT (livUGTn), derived
from 4 sequencing runs each. .............. ...............90....

5-8 Sizes and positions of partial UGT sequences (cross-hatched rectangles) from
intestine and liver, corresponding to two distinct isoforms, relative to complete
sequences for liver and intestinal UGT (solid rectangles). ............. ....................91

5-9 Identification of open reading frame using ORF Finder ................. ............... ....93

5-10 Predicted protein sequence liv/intUGTp from liv/intUGTn .............. ..................93

5-11 Comparison ofliv/intUGTp with homologous proteins in other fish, showing
scores and alignment of closely related sequences. ............. .....................9

5-12 Phylogram for fish UGT proteins homologous to liv/intUGTp .............. ..............96

5-13 Alignment of liv/intUGTp (excluding UTRs) with selected mammalian UGT
proteins, showing scores and multiple alignment of sequences, highlighting
important regions and residues (see discussion) .............. ...............97....

5-14 Phylogram for I.punctatus liv/intUGTp and selected mammalian UGT proteins ...98

5-15 Multiple sequence alignment between livUGTn and I35RC. ............. .................99

5-16 Results of NCBI conserved domain search ................. ...............100........... .










5-17 Kyte-Doolittle Hydrophobicity Plot for liv/intUGTp .............. .....................0

5-18 Results of NCBI conserved domain search for I35R Cp .............. ...................103

5-19 Alignment of predicted protein sequences from cloned catfish UGTs. Regions of
interest and the starting and ending residue of the mature product are
highlighted. ........... ..... ._ ...............104...

5-20 Cloning of livUGTn. ..........._.....__ .....__ .....__ ........... ....105

5-21 Cloning of intUGTn. ..........._.....__ .....__ .....__ ........... ....105

5-22 Multiple sequence alignment for fish sequences homologous to catfish UGT
isolated from liver and intestine, showing regions where substrate binding of
phenols is thought to occur for mammalian UGTI1A isozymes. ................... .........110

5-23 Results of 3' RACE performed on liver, showing multiple products obtained...... 111

5-24 3' RACE for I4. ................ ...............112..............

5-25 PCR amplification of UGT using degenerate primers. ........._._ ... ......_._.......1 14

6-1 Heat-induced degradation of UDPGA (boiling in 0.25 M H2PO4 buffer) ............120

6-2 Decomposition of UDPGA to UDP and UMP after boiling in 0.25 M H2PO4
buffer for 10 minutes ..........._ _..... .._ ...............120.

6-3 Effect of boiling liver tissue for 1 minute in two different concentrations of
buffer. A, 0.25 M H2PO4, pH 3.4; B, 0.30 M H2PO4, pH 4.3 ................ ............... 121

6-4 HPLC chromatogram for catfish AT17 liver. Center refers to region of liver
from which the sample was taken. ............. ...............122....

6-5 HPLC chromatogram for catfish AT18 intestine. Rep 2 refers to second sample
taken from AT18 intestine. .........__ _............ ...............123.

6-6 HPLC chromatogram of UDP, UDP-galacturonic acid (UDPGTA), and UDPGA
standards ................. ...............125................

6-7 Comparison of hepatic and intestinal [UDPGA] in 4 individual channel catfish. .126
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

PHASE II BIOTRANSFORMATION OF XENOBIOTICS BY POLAR BEAR (Grsus
maritimus) AND CHANNEL CATFISH (Ictalurus punctatus)

By

James C. Sacco

August 2006

Chair: Margaret O. James
Major Department: Medicinal Chemistry

Both polar bears and channel catfish are subject to bioaccumulation of persistent

toxic environmental pollutants including hydroxylated compounds, which are potential

substrates for detoxification via phase II conjugative processes such as sulfonation and

glucuronidation. The objectives of this dissertation were to (a) study the capability of

polar bear liver to sulfonate a structurally diverse group of environmental chemicals, and

to study the glucuronidation of 3-OH-B[a]P; (b) study the effects of chlorine substitution

pattern on the glucuronidation of polychlorinated biphenylols (OH-PCBs) by catfish liver

and proxi mal inte sti ne; (c) clone UDP -glucurono syltran sferase (UGT) from catfish liver

and intestine; (d) develop a method to determine physiological concentrations of UDP-

glucuronic acid (UDPGA) in catfish liver and intestine.

In the polar bear, the efficiency of sulfonation decreased in the order 3-OH-

B[a]P>>>triclosan>>4'-OH-PCB79>OHMXC>4'-OH-C165>TCPM>4'-OH-PCB 159

>PCP, all of which produced detectable sulfate conjugates. Substrate inhibition was









observed for the sulfonation of 3-OH-B[a]P and 4'-OH-PCB79. The hexachlorinated

OH-PCBs, TCPM and PCP were poor substrates for sulfonation, suggesting that this may

be one reason why these substances and structurally similar xenobiotics persist in polar

bears .

OH-PCBs are glucuronidated with similar efficiency by channel catfish liver and

proximal intestine. There were differences in the UGT activity profile in both organs.

Both hepatic glucuronidation and intestinal glucuronidation were decreased with the

addition of a second chlorine atom flanking the phenolic group, which is an arrangement

typical of toxic OH-PCBs that persist in organisms.

One full length UGT from catfish liver, together with a full-length UGT (identical

to the liver UGT), and a partial sequence of a different UGT from catfish intestine were

cloned. The full-length catfish UGT clone appeared to be analogous to mammalian

UGTIAl or UGTIA6.

The anion-exchange HPLC method developed to determine UDPGA was sensitive,

reproducible and displayed good resolution for the co-substrate. The hepatic UDPGA

levels determined by this method were similar to those in other mammalian species and

higher than reported for two other fish species. This was the first time intestinal UDPGA

concentrations in any piscine species were determined; the values were similar to rat

intestine, but significantly higher than in human small intestine.















CHAPTER 1
BIOTRANSFORMATION AND ITS IMPORTANCE INT THE DETOXIFICATION OF
XENOBIOTIC S

The exposure of biological systems to environmental compounds which may be

potentially toxic to these systems has spurred the evolution of an elaborate, protective

biochemical system whereby these xenobiotics are eliminated from cells and whole

organisms, usually via chemical transformation (or biotransformation). This system is

composed of a multitude of enzymes, which while being distributed in many tissues and

organs, are principally located in organs such as liver, intestine and lungs. This is of

physiological significance since these tissues represent major routes of xenobiotic entry

into organisms. Within cells, biotransformation enzymes also display a level of

organization in that while some are soluble and found in the cytosol (e.g.

sulfotransferases (SULT), glutathione-S-transferases), others are relatively immobile and

membrane-bound (e.g. UDP-glucuronosyltransferases (UGT) and cytochrome P450s

(CYP) in the endoplasmic reticulum).

Since it is highly improbable that the organism has a substrate-specific enzyme for

metabolizing every potential xenobiotic, biotransformation enzymes are generally non-

specific, acting on a broad range of structurally unrelated substrates. In addition, several

isoforms of the same enzyme (or more than one enzyme) may catalyze product formation

from the same substrate, albeit at different rates and with different affinities. Enzymes in

the same superfamily as those that act upon xenobiotics can also biotransform

endogenous substances, indicating an equally important regulatory role for these










enzymes. This interrelationship between different enzymes and substrates can be

illustrated by the metabolism of P-estradiol in humans, which can be biotransformed both

via sulfonation (SULTIE1, which also acts on 7-hydroxymethyl-12-dimethylbenz-

anthracene, the product of CYP450-catalyzed hydroxylation of 7, 12-dimethyldibenz-

anthracene (Glatt et al., 1995)) and glucuronidation (UGTIA1, which can also conjugate

1-naphthol (Radominska-Pandya et al., 1999)).

While these enzymes mainly represent a cellular defense mechanism against

toxicity, occasionally procarcinogenic and protoxic xenobiotics are metabolized to active

metabolites that attack macromolecules such as DNA, proteins and lipids.

In exposed organisms, metabolism is an important factor in determining the

bioaccumulation, fate, toxicokinetics, and toxicity of contaminants. The majority of the

compounds of interest to this study are derived from Phase I metabolism of

environmental pollutants. These metabolites have been shown to have toxic effects both

in vitro and in vivo, effects that can be eliminated by Phase II biotransformation (Chapter

2). In addition, contaminant exposure can result in the induction or inhibition of both

Phase I and Phase II enzymes. For example, induction of CYP 1A (e.g., by polyaromatic

hydrocarbons (PAHs) or co-planar polychlorinated biphenyls (PCBs)), CYP 2B and

CYP3A (e.g., by o-chlorine substituted PCBs) will lead to increased formation of

hydroxylated metabolites. Thus, a balance between the CYP and conjugative Phase II

enzymes, sometimes directly mediated by the xenobiotic substrates and/or their

metabolites, is responsible for either the detoxification or the accumulation of toxic

metabolites in the body. The final removal of these metabolites from the cell is brought

about by several different groups of membrane proteins (e.g., organic anion transport










protein (OATP), multidrug-resistance associated protein (MRP)), a process sometimes


referred to as Phase III biotransformation (Figure 1-1).


MRP
OA TP


' OH


MRP
OA TP


'"r
oHOH


I I


\ cytosol ER membrane ER lumen
Figure 1-1. Schematic of select xenobiotic (represented by hydroxynaphthalene)
biotransformation pathways in the mammalian cell. For abbreviations see text.


I















CHAPTER 2
PHASE II CONJUGATION: GLUCURONIDATION AND SULFONATION

Biotransformation has been conveniently categorized into two distinct phases.

While the consecutive numbering of these processes implies a sequence, this is not

always the case and the extent of involvement of both phases in the metabolism of a

compound depends on both its chemical structure and physical properties. Phase I

biotransformation usually consists of oxidations carried out largely by CYP enzymes and

flavin monooxygenases and hydrolysis reactions executed by ester hydrolase, amidase

and epoxide hydrolase (EH). A variety of chemical moieties can be conjugated to suitable

acceptor groups on xenobiotics as part of Phase II biotransformation, including

glucuronic acid (UGT), sulfonic acid (SULT), glutathione (GST), amino acids, and an

acetyl group (N-acetyltransferase) .

With the exception of acetylation, methylation and fatty acid conjugation, the

strategy of Phase II biotransformation is to convert a xenobiotic to a more hydrophilic

form via the attachment of a chemical moiety which is ionizable at physiological pH. The

resulting anionic conjugate is then readily excreted in bile, feces, or urine, and is

generally unable to undergo passive penetration of cell membranes. This metabolic

transformation also results in reduced affinity of the compound for its cellular target.

Enterohepatic recycling may result in the hydrolysis of biliary excreted conjugates and

the regeneration of the parent compound, which is then subj ect again to

biotransformation after being reabsorbed through the gut mucosa. In a few cases, the










conjugate is pharmacologically active, as in the case of morphine-6-glucuronide

(Yoshimura et al., 1973) and minoxidil sulfate (Buhl et al., 1990).

The moieties attached to the xenobiotic in the case of sulfonation and

glucuronidation are a sulfonate group (pKa 2) or glucuronic acid (pKa 4-5). The co-

substrates which supply these highly polar species are, respectively, 3'-phosphoadenosyl-

5'-phosphosulfate (PAPS) and uridine 5' -diphosphoglucuronic acid (UDPGA) (Figure 2-

1). The mechanism of both reactions, which occurs as a ternary complex, is a SN2

reaction, the deprotonated acceptor group of the substrate attacking the sulfur in the

phosphosulfate bond of PAPS, or the C1 of the pyranose ring to which UDP is attached in

an ot-glycosidic bond in the case of UDPGA. The resulting conjugates are then released.

PAP and UDP also leave the enzyme's active site and are subsequently regenerated.

There may be competition for the same acceptor group, especially for phenols.

Other acceptor groups that can be conjugated by both processes include alcohols,

aromatic amines and thiols. Glucuronidation is also active on other functional groups,

including carboxylic acids, hydroxylamines, aliphatic amines, sulfonamides and the C2 Of

1 ,3 -di carb onyl compounds. SULTs are generally high-affinity, low-capacity

biotransformation enzymes that operate effectively at low substrate concentrations. Thus,

typical Knas for the sulfonation of xenobiotic substrates are usually significantly lower

than Knas for the same substrates undergoing biotransformation by the low-affinity, high-

capacity UGTs. For example, kinetic parameters for the sulfonation and glucuronidation

of the antimicrobial agent triclosan in human liver are Km values of 8.5 and 107 C1M and

Vmax of 96 and 739 pmol/min/mg protein respectively (Wang et al., 2004).

















OH OH/
o P P O

'OHH

UDPGA


PAPS


PAP


SULT (cytosol)





~UG T (ER)


sulfonate conjugate






\ 0,0




Cl OH


xenobiotic


UDP


glucuronide conjugate



Figure 2-1. Structure of the co-substrates PAPS and UDPGA (transferred moieties shown
in bold) and the formation of the polar sulfonate and glucuronide conjugates,
shown here competing for the same substrate.










UDP-Glucuronosyltransferases (UGTs)

The primary sequence of human UGTs ranges from 529 to 534 amino acids in

length (Tukey and Strassburg 2000). These 50-56 kDa proteins reside in the endoplasmic

reticulum, whereby the amino terminus and around 95% of the subsequent residues are

located in the lumen. A 17-amino acid-long transmembrane segment connects the

lumenal part of the enzyme with the short (19-24 residues) carboxyl-terminus located in

the cytosol (Figure 2-2). The active enzyme probably consists of dimers, linked together

at the C-terminus (Meech and Mackenzie 1997). The existence of tetramers for the

formation of the diglucuronide of B[a]P-3,6-diphenol has been suggested (Gschaidmeier

and Bock 1994).

++
COO. Cytosol

ER
III membrane

ER lumen

NH3+
Ag lycone
UDPGA






Figure 2-2. Proposed structure of UGT, based on amino acid sequence

Based on evolutionary divergence, mammalian UGTs have been classified into four

distinct families (Mackenzie et al., 2005): family 1, which includes bilirubin, thyroxine

and phenol UGTs; family 2, which includes steroid UGTs; family 3, which includes

UGTs whose substrate specificity is, as yet, unknown (Mackenzie et al., 1997); family 8,

represented by UGT8Al which utilizes UDP-galactose as the sugar donor (Ichikawa et










al., 1996). Although the liver is the major site of glucuronidation in the living organism,

several other tissues have been shown to express UGTs. The small intestine appears to be

an equally important site of glucuronidation, particularly for ingested xenobiotics. In

addition, expression of some UGT isoforms is tissue-specific (Table 2-1).

The nine family 1 UGT isoforms (UGT1) are all encoded by one gene that has

multiple unique exons located upstream of four common exons on human chromosome

2q37 (Figure 2-3). The isoforms are generated by differential splicing of one unique first

exon (which encodes two-thirds of the lumenal domain, starting from the N-terminus,

288 amino acids long) to the four common exons (exons 2-5, which encode the remainder

of the lumenal domain, the transmembrane domain and the cytosolic tail, 246 amino

acids long). Due to this unusual gene structure and splicing mechanism, the UGT1

isoforms have variable amino-terminal halves and identical carboxyl-terminal halves.

While the first exon determines substrate specificity, the common exons specify the

interaction with UDPGA (Ritter et al., 1992; Gong et al., 2001). Thus, the major bilirubin

UGT (UGTIAl) of humans, rats and other species is encoded by exon 1 and the adjacent

4 common exons. The phenol UGT (UGTIA6) is encoded by exon 6 and the 4 common

exons.

The human UGT2 gene family includes three members of the UGT2A subfamily

and twelve members of the UGT2B subfamily (Mackenzie et al., 2005). The UGT2

proteins are encoded by separate genes consisting of six exons located on human

chromosome 4ql3. The region of the protein encoded by exons 1 and 2 is equivalent to

that encoded by the unique exons 1 of the UGT1 isoforms, and the subsequent

intron/exon boundaries are in corresponding positions in both gene families. Similar to









the UGTIA enzymes, the UGT2Al and 2A2 proteins have identical C-termini and

different N-termini that arise due to differential splicing of the first exon (Figure 2-4). By

contrast, the UGT2A3 gene comprises six exons that are not shared with the other two.

Table 2-1. Expression of human UGT mRNA in various tissues
UGT Liver Intestine Esophagus Kidney Brain Prostate Other tissues
& stomach
1Al ///
1A3 J J Jb
1A4
1A6 J J Jb J testis, ovary
1A7 c
1A8
1A9
1A10c
2Al Olfactory
epithelium, lung
2B4
2B7 Pancreas
2B10 mammary
gland,
2B11 mammary
gland, adrenal,
skin, adipose
2B15 mammary
gland, adipose,
skin, lung,
testis, uterus,
placenta
2Bl7

a Tukey and Strassburg 2000; King et al., 2000; Lin and Wong 2002; Wells et al., 2004
b only a third of the population expresses these isoforms in gastric epithelium (Strassburg
et al., 1998)
c expressed in bile ducts











5' 3'
Exons 1 C~*ommon
1A12plA11p 1A8 1A10 1A13p 1A9 1A7 1A6 1A51A41A3 1A~plA1
2345



300 kb 218 kb 95 kb

Primary transcripts

Et UGT1A1
L--~~X/CUGT1A8

Isozymes
IIIIIUGT1A1
Etc .
I UGT1A8



Figure 2-3. Complete human UGT1 complex locus represented as an array of 13 linearly
arranged first exons.

Each first exon, except for the defective UGTIAl2p and UGTIAl3p pseudo
ones, contains a 5'proximal TATA box element (bent arrow) that allows for
the independent initiation of RNA polymerase activity that generates a series
of overlapping RNA transcripts (Adapted from Gong et al., 2001).

5' 3'
2B29p 2B17p 2815 2810 2A3 2B27p 2B26p 2B7 2811 2B28 2B25P 2B24P 2B4 2A1/2
I UI I UI I UI U U U U UI U U 1





2A1 2A2 2 3 4 5 6

1 1 11 I l


Figure 2-4. The human UGT2 family.

Each gene (not drawn to scale), consisting of six exons, is represented by a
white rectangle, except for '2A1/2', which represents seven exons (1 unique
first exon and shared exons 2-6). Adapted from Mackenzie et al. (2005).









Sulfotransferases (SULTs)

Sulfotransferases can be either membrane-bound in the Golgi or in the cytosol.

While the membrane-bound SULTs sulfonate large molecules such as

glucosaminylglycans, the cytosolic enzymes are involved in the inactivation of

endogenous signal molecules (steroids, thyroid hormones, neurotransmitters) and the

biotransformation ofxenobiotics.

Each cytosolic SULT is a single a/p globular protein with a characteristic five-

stranded parallel sheet, with a-helices flanking each sheet. The active enzyme is a

homodimer, with each polypeptide chain having a MW of about 35,000. Kakuta et al.

(1997) were the first group to solve the first X-ray structure for the SULT family. Mouse

estrogen sulfotransferase (mEST) was shown completed with PAP and the substrate

estradiol (E2). The binding of estradiol to human SULTIAl has also been demonstrated

(Gamage et al., 2005). Both PAPS- and substrate-binding sites are located deep in the

hydrophobic substrate pocket. The structures of four human cytosolic enzymes have also

been elucidated : SULT 1Al (Gamage et al., 2003), dop ami ne/c atechol ami ne

sulfotransferase (SULTIA3) (Bidwell et al., 1999; Dajani et al., 1999), hydroxysteroid

sulfotransferase (SULT2Al; hHST) (Pedersen et al., 2000), and estrogen sulfotransferase

(SULTIE1; hEST) (Pedersen et al., 2002).

Five SULT gene families have been identified in mammals (SULTsl-5). While

SULT enzymes have different substrate specificities, the repertoire of suitable substrates

is so broad that it is not uncommon that one substrate is biotransformed by more than one

enzyme. SULTs are distributed in a wide variety of tissues (Table 2-2). In humans, liver

cytosol has been shown to contain mostly SULTslA1, 2A1, and 1E1, with lesser amounts














































4Al J

a reviewed by Glatt 2002.
b mRNA of fetal tissues
Soral mucosa


Using 3 -hydroxy-benzo(a)pyrene (3-OH-B[a]P) and 9-OH-B[a]P, the existence of

multiple SULT isoforms in channel catfish liver and intestine, including a 3-

methylcholanthrene-inducible form of phenol-SULT in liver, has been established

(Gaworecki et al., 2004; James et al., 2001). The phenol-SULT in catfish liver and


of SULTs 1A2, 1B1, 1El and 2Al. While SULTIAl and SULTIE1 are responsible for

most of the phenol and estrogen SULT hepatic activity respectively, SULT2Al

(hydroxysteroid SULT) shows greater affinity for alcohols and benzylic alcohols (Mulder

and Jakoby, 1990; Glatt, 2002).


Table 2-2. Tissue distribution of SULTs (cDNA and mRNA) in humans
SULT Liver Intestine Esophagus Kidney Brain Lung Other tissues
& stomach


J /
J /
/
J /


J /
J J


1Al
1A2
1A3
1B1


IC2


1C4


1El


2Al


2B1


Platelets


J Platelets
J J Spleen, kidney,
leukocytes
J Jb Ovary, spinal
cord, heart
J J Thyroid gland,
ovary
Jb J Jb Endometrium,
skin, mammary
Adrenal gland,
ovary
J J Placenta,
prostate,
platelets









intestine has been isolated as a 41,000 Da protein. A second protein with a molecular

weight of 31,000 Da, isolated from liver, has not been identified to date. Interestingly

enough, SULT activity with phenolic substrates is higher in intestine than liver (Tong and

James 2000). Other hepatic SULTs isolated and characterized from fish include

petromyzonol SULT from lamprey (Petromyzon marinus) larva (which displays 40%

homology with mammalian SULT2Bla, or cholesterol SULT) and a bile steroid SULT

from the shark Heterodontus portusjacksoni (Venkatachalam et al., 2004; Macrides et al.,

1994).















CHAPTER 3
SULFONATION OF XENOBIOTICS BY POLAR BEAR LIVER

The lipophilicity and inherent chemical stability of persistent organic pollutants

(POPs) renders them excellent candidates for absorption through biological membranes

as well as accumulation in both organisms and their environment. Many POPs have been

shown to biomagnify in food webs to potentially toxic levels in top predators such as the

polar bear (Grsus maritimus), whose diet mainly consists of ringed seal (Phoca hispida)

blubber (Kucklick et al., 2002).

Since the sulfonation of xenobiotics has never been studied in the polar bear, the

obj ective of this study was to investigate the efficiency of this route of detoxification on a

select group of known environmental pollutants: 4'-hydroxy-3,3',4,5 '-

tetrachlorobiphenyl (4'OH-PCB79), 4'-hydroxy-2,3,3 ',4,5,5 '-hexachlorobiphenyl (4'-

OH-PCBl159), 4'-hydroxy-2,3,3 ',5,5 ',6-hexachlorobiphenyl (4'-OH-PCBl165),

pentachlorophenol (PCP), tris(4-chlorophenyl)-methanol (TCPM), 2-(4-methoxyphenyl)-

2-(4-hydroxyphenyl)- 1,1,1 -trichloroethane (OHMXC), 3 -hydroxybenzo(a)pyrene (3-OH-

B [a]P), triclosan (2,4,4'-trichloro-2 '-hydroxydiphenyl ether) (Figure 3-1). The OH-PCBs

were named as PCB metabolites, according to the convention suggested by Maervoet et

al. (2004).

Polychlorinated biphenylols (OH-PCBs), major biotransformation products of

PCBs (James, 2001), have been shown to be present in relatively high concentrations in

polar bears (Sandau and Norstrom 1998; Sandau et al., 2000). The abundance of these

hydroxylated metabolites may be due to CYP induction (Letcher et al., 1996), inefficient








































(5) (6)


Figure 3-1. Structures of sulfonation substrates investigated in this study.

(1) 3-OH-B[a]P; (2) triclosan; (3) 4'-OH-PCB79; (4) 4'-OH-PCBl159; (5) 4'-OH-
PCBl65; (6) OHMXC; (7) TCPM; (8) PCP. Full names of each compound are
given in the text.


CI









CI OH









Phase II detoxication, and inhibition of their own biotransformation. The 4'-OH-PCB79

(an oxidation product of PCB congener 77) is a potent inhibitor of the sulfonation of

several substrates, including 3-OH-B[a]P in channel catfish intestine and human liver

(van den Hurk et al., 2002, Wang et al., 2005), 4-nitrophenol by human SULTIAl (Wang

et al., 2006), 3,5-diiodothyronine (T2) in rat liver (Schuur et al., 1998), and estradiol by

human SULTIE1 (Kester et al., 2000). Both 4'-OH-PCBl59 and 4'-OH-PCBl65 have

been shown to inhibit the sulfonation of 3-OH-B[a]P and 4-nitrophenol by human SULT

(Wang et al., 2005, 2006). Another compound detected in polar bears is PCP (Sandau and

Norstrom 1998), a commonly used wood preservative that has been implicated in thyroid

hormone disruption in Arctic Inuit populations (Sandau et al., 2002). TCPM is a globally

distributed organochlorine compound of uncertain origin, which was reported in human

adipose tissue (Minh et al., 2000). Polar bear liver contains 4000-6800 ng/g lipid weight

TCPM, the highest levels recorded for this compound in all species studied (Jarman et al.,

1992). TCPM is a potent androgen receptor antagonist in vitro (Schrader and Cooke

2002). OHMXC, formed by demethylation of the organochlorine pesticide methoxychlor,

is an estrogen receptor (ER) oc agonist, an ERP antagonist and an androgen receptor

antagonist (Gaido et al., 2000). The ubiquitous environmental pollutant benzo[a]pyrene is

mainly metabolized to 3-OH-B[a]P, a procarcinogen that can be eliminated via

sulfonation (Tong and James 2000). Together with its 7,8-dihydrodiol-9, 10-oxide and

7,8-oxide metabolites, 3-OH-B[a]P can form adducts with macromolecules and initiate

carcinogenesis (Ribeiro et al., 1986). Triclosan is an antimicrobial agent that has been

detected in human plasma and breast milk (Adolfsson-Erici et al., 2002). In vitro studies









have shown that triclosan inhibits various biotransformation enzymes, including SULT

and UDP-glucuronosyltransferases (UGT) (Wang et al., 2004).

The fact that 3-OH-B[a]P, triclosan, OHMXC, 4'-OH-PCB79, 4'-OH-PCBl59 and

4'-OH-PCBl165 have not been reported as environmental contaminants in polar bears to

date may be due to non-significant levels in the Arctic environment or efficient

metabolism via, for example, sulfonation. On the other hand, the presence of PCP and,

particularly, high amounts of TCPM in these Arctic carnivores, may indicate poor

sulfonation of these substrates. The polychlorobiphenylols 4'-OH-PCBl59 and 4'-OH-

PCBl165 are of interest since though they have not been detected in polar bears, they are

structurally similar to 4'-OH-PCBl72, one of the major OH-PCBs found in polar bear

plasma (Sandau et al., 2000). It is thus possible that these compounds are sulfonated with

similar efficiencies. The other major Phase II biotransformation pathway for the above-

mentioned compounds is glucuronidation. Polar bear liver efficiently glucuronidated 3-

OH-B[a]P and several OH-PCBs (Sacco and James 2004).

Hypothesis

Sulfonation occurring in polar bear liver is an inefficient route of detoxification for

a structurally diverse group of environmental contaminants.

Methodology

Unlabeled PAPS was purchased from the Dayton Research Institute (Dayton, OH).

Uridine 5' -diphosphoglucuronic acid (UDPGA) was obtained from Sigma (St.Louis,

MO). Radiolabeled [35S]PAPS (1.82 or 3.56 Ci/mmol) was obtained from Perkin-Elmer

Life Sciences, Inc. (Boston, MA). The benzo[a]pyrene metabolites 3-OH-B[a]P, B[a]P-3-

O-sulfate and B [a]P-3-O-glucuronide were supplied by the Midwest Research Institute

(Kansas City, MO), through contact with the Chemical Carcinogen Reference Standard










Repository of the National Cancer Institute. Dr. L.W.Robertson, U of Iowa, kindly

donated the 4'-OH-PCB79, and 4'-OH-PCBl59 and 4'-OH-PCBl65 were purchased

from AccuStandard, Inc. (New Haven, CT). PCP from Fluka Chemical (Milwaukee, WI)

was used to prepare the water-soluble sodium salt (Meerman et al., 1983). Triclosan and

sulfatase (Type VI from Aerobacter, S1629) were purchased from Sigma (St.Louis, MO),

while methoxychlor and TCPM were purchased from ICN Biomedical (Aurora, OH) and

Lancaster Synthesis, Inc. (Pelham, NH), respectively. The OHMXC was prepared by the

demethylation of methoxychlor and purified by recrystallization (Hu and Kupfer 2002).

Tetrabutyl ammonium hydrogen sulfate (PIC-A low UV reagent) was from Waters

Corporation, Milford, MA. Other reagents were the highest grade available from Fisher

Scientific (Atlanta, GA) and Sigma.

Animals. The samples used in this study were a kind donation from Dr. S. Bandiera (U

British Columbia) and Dr. R. Letcher (Environment Canada). They were derived from

the distal portion of the right lobe of livers of three adult male bears G, K and X. Bears G

and K were collected as part of a legally-controlled hunt by Inuit in the Canadian Arctic

in April 1993 near Resolute Bay, Northwest Territories, while bear X was collected in

November 1993 near Churchill, Manitoba, just after the fasting period. Liver samples

were removed within 10-15 minutes after death, cut into small pieces and frozen at -

196oC in liquid N2. The samples were subsequently stored at -80oC.

Cytosol and Microsomes Preparation. Prior to homogenization, the frozen polar

bear liver samples (~2g) were gradually thawed in a few ml of homogenizing buffer.

Homogenizing buffer consisted of 1.15% KC1, 0.05 M K3PO4 pH 7.4, and 0.2 mM

phenylmethylsulfonyl fluoride, added from concentrated ethanol solution just before use.









Resuspension buffer consisted of 0.25 M sucrose, 0.01 M Hepes pH 7.4, 5% glycerol, 0. 1

mM dithiothreitol, 0.1 mM ethylene diamine tetra-acetic acid and 0.1 mM phenylmethyl

sulfonyl fluoride. The liver was placed in a volume of fresh ice-cold buffer equal to 4

times the weight of the liver sample. The cytosol and microsomal fractions were obtained

using a procedure described previously (Wang et al., 2004). Microsomal and cytosolic

protein contents were measured by the Lowry assay, using bovine serum albumin (BSA)

as standard.

Sulfotransferase Assays

A. Fluorometric method. The activity was measured on the basis that at alkaline pH, the

benzo[a]pyrene-3 -O-sulfate has different wavelength optima for fluorescence excitation

and emission (294/415 nm) from the benzo[a]pyrene-3 -O-phenolate anion (3 90/545 nm)

(James et al., 1997). Saturating concentrations of PAPS were determined by performing

the assay at 1 C1M 3-OH-B[a]P. The reaction mixture for detecting the sulfation of 3-OH-

BaP by polar bear liver cytosol consisted of 0.1 M Tris-Cl buffer (pH 7.6), 0.4% BSA,

PAPS (0.02 mM), 25 Clg polar bear hepatic cytosolic protein, and 3-OH-B[a]P (0.05-25

CIM) in a total reaction volume of 1.0 mL. SULT activity (pmol/min/mg) was calculated

from a standard curve prepared with B[a]P-3-O-sulfate standards. Substrate consumption

did not exceed 10%.

B. Radiochemical extraction method. This method, based on Wang and co-workers

(2004), was employed in the study of the sulfonation of 4'-OH-PCB79, 4'-OH-PCBl159,

4'-OH-PCBl65, triclosan, PCP, TCPM and OHMXC. Cytosolic protein concentrations

and incubation time were optimized for every test substrate to ensure that the reaction

was linear during the incubation period. Substrate consumption did not exceed 5%. The









incubation mixture consisted of 0.1 M Tris-Cl buffer (pH 7.0), 0.4% BSA in water, 20

CIM PAPS (10% labelled with 35S), 0.1 mg polar bear hepatic cytosolic protein, or 0.005

mg in the case of 4'-OH-PCB79 and triclosan, and substrate in a total reaction volume of

0.1 mL, or 0.5 mL in the case of TCPM. The OH-PCBs, triclosan and OHMXC were

added to tubes from methanol solutions, and the methanol was removed under N2 priOr to

addition of other components. The TCPM was dissolved in DMSO, the solvent being

present at a concentration not exceeding 1% in the final assay volume. Control

determinations utilizing 1% DMSO had no inhibitory effect on sulfonation. Aqueous

solutions of sodium pentachlorophenolate were utilized in the case of PCP. Tubes

containing all components except the co-substrate were placed in a water bath at 37oC

and PAPS was added to initiate the reaction. Incubation times were 5 min (TCPM), 20

min (4'-OH-PCB79, triclosan), 30 min (PCP) and 40 min (OHMXC, 4'-OH-PCBl59, 4'-

OH-PCBl165). The incubation was terminated by the addition of an equal volume of a 1:1

mixture of 2.5% acetic acid and PIC-A and water. The sulfated product was extracted

with 3.0 mL ethyl acetate as described previously (Wang et al., 2004) and the phases

were separated by centrifugation. Duplicate portions of the ethyl acetate phase were

counted for quantitation of sulfate conjugates.

C. Radiochemical TLC method. Since the ethyl acetate phase contains sulfate

conjugates formed from both the substrate of interest and substrates already present in

polar bear liver, TLC was used to quantify substrate sulfation in cases where SULT

activity was similar in samples and substrate blanks. After evaporating 2 ml of ethyl

acetate extract from the SULT assay under N2, the solutes were reconstituted in 40 C1L

methanol. For 4'-OH-PCBl59, 4'-OH-PCBl65, PCP and OHMXC, the substrate










conjugates were separated on RP-18F254s TOVeTSe phase TLC plates with fluorescent

indicator (Merck, Darmstadt, Germany) using methanol:water (80:20). For TCPM,

Whatman KClsF reverse phase 200 Clm TLC plates with fluorescent indicator in

conjunction with a developing solvent system consisting of methanol:water:0.28 M PIC-

A (40:60:1.9 by volume) were employed. Electronic autoradiography (Packard Instant

Imager, Meriden, CT) was used to identify and quantify the radioactive bands separated

on the TLC plate. The counts representing the substrate sulfate conjugate products were

expressed as a fraction of the total radioactivity determined by scintillation counting, thus

enabling the radioactivity due to the substrate conjugate to be accurately determined.

The identity of the conjugate of TCPM as a sulfate ester was verified by studying

its sensitivity to sulfatase. Polar bear cytosol (0.5 mg) was incubated for 75 minutes with

or without 200 CLM TCPM. The incubation was terminated, and the product extracted into

ethyl acetate as above. The ethyl acetate was evaporated to dryness and dissolved in 0.25

mL of Tris buffer, pH 7.5, containing 0 or 0.08 units of sulfatase. Following an overnight

incubation at 35oC, the reaction was stopped by the addition of methanol and the tubes

were centrifuged. The supernatants were evaporated to dryness, reconstituted in methanol

and analyzed by TLC as described above.

UDP-Glucuronosyltransferase Assay. The reaction mixture for detecting the

glucuronidation of 3-OH-B[a]P by polar bear liver microsomes consisted of 0. 1 M Tris-

HCI buffer (pH 7.6), 5 mM MgCl2, 0.5% Brij-58, UDPGA (4 mM), 5 Clg polar bear

hepatic microsomal protein, and 3-OH-B[a]P in a total reaction volume of 500 CIL. The

substrate, 3-OH-B[a]P in methanol, was blown dry under N2 in the dark in a tube to

which, after complete evaporation, a premixed solution of microsomal protein and Brij-









58 (in a 5:1 ratio) was added, vortexed, and left for 30 minutes on ice. Subsequently, the

buffer and water were added in that order and vortex-mixed. Immediately preceding a 20-

minute incubation at 37oC, UDPGA was added to initiate the reaction. The reaction was

terminated by the addition of 2 mL ice-cold methanol. Precipitated protein was pelleted

by centrifugation at 2000 rpm for 10 minutes. The supernatant, 2 mL, was then mixed

with 0.5 mL NaOH (lN) and the fluorescence of B[a]P-3-glucuronic acid measured at

excitation/emission wavelengths of 300/421 nm (Singh & Wiebel, 1979). The activity of

UGT (nmol/min/mg) was then determined.

Preliminary studies established the conditions for linearity of reaction with respect

to time, protein and detergent concentrations, at the same time ensuring that substrate

consumption did not exceed 10%. The apparent Km for UDPGA was determined by

performing experiments at a fixed concentration of 3-OH-B[a]P (10 C1M). Saturating

UDPGA concentrations were used in order to determine 3-OH-B[a]P glucuronidation

kinetics.

Kinetic Analysis. Duplicate values for the rate of conjugate formation at each substrate

concentration were used to calculate kinetic parameters using Prism v 4.0 (GraphPad

Software, Inc., San Diego, CA). Equations used to fit the data were the Michaelis-Menten

hyperbola for one-site binding (eq. 1), the Hill plot (eq. 2), substrate inhibition for one-

site binding (eq. 3) (Houston and Kenworthy 2000), and partial substrate inhibition due to

binding at an allosteric site (eq. 4) (Zhang et al., 1998).

v = Vmax[S] / (Km + [S]) (1)

v = Vmax[S]h / (S50h + [S]h) (2)

v = Vmax[S] / (Km + [S] + ([S]2/K,)) (3)









v = Vmaxy(1 + (Vmax2[S]/Vmax;K,)) / (1 + Km/[S] + [S]/K,) (4)

Values for K, and Vmax derived from equation 1 were used as initial values in the

fitting of data to equations 3 and 4. Eadie-Hofstee plots were used in order to analyze the

biphasic kinetics observed.

Results

Sulfonation and glucuronidation of 3-OH-B[a]P

Optimum conditions for sulfonation were 10 minutes incubation time and 25 Cpg

cytosolic protein. A concentration of 0.02 mM PAPS provided saturating concentrations

of the co-substrate and enabled kinetic parameters at 1.0 CLM 3-OH-B [a]P to be calculated

by the application of eq. 1 (Table 3-la). The data for the sulfonation of 3-OH-B[a]P was

fit to a two-substrate model (eq. 3), whereby the binding of a second substrate to the

enzyme is responsible for the steep decline in enzyme activity at concentrations

exceeding 1 CLM (Figure 3-2a). Initial estimates of Vmaxi and Km were provided by the

initial data obtained at low [S] (non-inhibitory), while Vmax2 WAS constrained to 65 + 20

pmol/min/mg, which is slightly below the plateau in Figure 3-2a.

The kinetic scheme (Figure 3-2b) illustrates the proposed partial substrate

inhibition process, which assumes that substrate binding is at equilibrium, which is

probable due to the low turnover rate of SULT. The best fit of the data was provided by a

K, of 1.0 + 0.1 CLM. Binding of the second substrate molecule results in a tenfold

reduction in the rate of sulfonate formation.





































a constrained variables to obtain best fit
b ValUeS for high-affinity component
c values for low-affinity component


Table 3-1. Estimated kinetic parameters (Mean f SD) for (a) sulfonation and (b) glucuronidation of 3-OH-B[a]P by polar bear liver
cytosol and microsomes. Values were calculated as described in the Methodology.


(a) sulfonation

Substrate Vmax1 (app)

(pmol/min/mg)

3-OH-B[a]P 500 f 8

PAPS 162 f 35

(b) glucuronidation

Sub state Vmax (app)


Km (app)

(cLM)

0.41 f 0.03

0.22 f 0.07


Vmaxl/Km Vmax2 (app) a

(CIL/min/mg) (pmol/min/mg)

1220 f 70 65.0 f 20.0


Kz (app)

(cLM)

1.01 & 0.10


Vmax2/K,

(CLL/min/mg)

66.2 f 26.8


(nmol/min/mg)

3.00 f 1.18

1.53 f 0.56b, 1.47 f 0.48c


Km (app)

(cLM)

1.4 f 0.2

42.9 f 2.5b, 200 f 68c


Vmax/ Km

(CLL/min/mg)

1900 f 544


3 -OH-B [a]P

UDPGA
















(a)

300- PB G
I PB K
liii v PB X
E 200-







0 10 20 30

[3-OH-B(a)P] ( CMh)

(b)

PAPS K,, 10.4 IIM) PAPS V,,avy (471.8 pmol/min/mg)
E E
30HBaP

1K, (1.2 p M)


E PPSV,,,, (45 .0 pmnol'mninl'm g)
(30HBaP)2


Figure 3-2. Sulfonation of 3-OH-B[a]P at PAPS = 0.02 mM.

A. Each data point represents the average of duplicate assays for each bear,
while the error bars represent the standard deviation. The line represents the
best fit to the data of equation (3). B) Kinetic model for partial substrate
inhibition of SULT by 3-OH-B[a]P, after Zhang et al. (1998). E refers to
SULT .









Optimum conditions for the glucuronidation of 3-OH-B[a]P by polar bear

microsomes were found to be 5 Cpg microsomal protein and a 20-minute incubation. A

concentration of 4 mM UDPGA was determined to be suitable for providing saturating

concentrations of the co-substrate. The binding of UDPGA to UGT at 10 CLM 3-OH-

B[a]P was shown to be biphasic, with a fivefold reduction in affinity at higher UDPGA

concentrations (Table 3-1b). The kinetic parameters for the co-substrate were calculated

by deconvoluting the curvilinear data in the Eadie-Hofstee plot (Figure 3-3). In the

presence of 4 mM UDPGA, the formation of B[a]P-3-O-glucuronide followed Michaelis-

Menten kinetics (Table 3-1b).





ow-affinity
3- A high-affinity









0 10 20J 30 40
vi[S]


Figure 3-3. Eadie-Hofstee plot for the glucuronidation of 10 CLM 3-OH-B[a]P, over a
UJDPGA concentration range of 5-3000 CLM.

Each data point represents the average of duplicate assays for all bears, while
the error bars represent the standard deviation.





Sulfonation of other substrates

Triclosan sulfate was formed rapidly, with the overall kinetics conforming to a

hyperbolic curve (eq. 1) (Table 3-2). Substrate inhibition was observed for 4'-OH-PCB79

(Figure 3-4), with the data fitting equation (3). The value of K, that gave the best fit was

217 f 25 CLM (Table 3-2). Sulfate conjugation of 4'-OH-PCBl59 and 4'-OH-PCBl65,

which proceeded via Michaelis-Menten kinetics, was, respectively, 11 and 5 times less

efficient than the sulfonation of 4'-OH-PCB79 (Table 3-2). At a concentration of 10 CLM,

4'-OH-PCBl165 was observed to inhibit sulfonation of substrates already present in polar

bear liver cytosol by 60%.


Table 3-2. Kinetic parameters (Mean f SD) for the sulfonation of various xenobiotics by
polar bear liver cytosol, listed in order of decreasing enzymatic efficiency.
All data fit equation (1), except for 4'-OH-PCB79 and PCP, which fit
equations (3) and (2) respectively (see Methodology for equations).

Substrate Vmax Km Vmax / Km Ki
(pmol/min/mg) (yM) (pL/min/mg) (yM)


triclosan 1008 f 135 11 f 2
4'-OH-PCB79 372 f 38 123 f 20
OHMXC 51.1 f 7.8 67 f 4
4'-OH-PCBl165 8.6 f 2.0 17 f 7
TCPM 62.0 f 11.2 144 f 36
4'-OH-PCBl159 14.8 f 2.3 60 f 21
PCP 13.8 f 1.2 72 f 14b
aK, for bears G, K and X were 240, 220 and 190 LM
constrained to obtain the best fit for the data
bSso; h = 2.0 f 0.4


90.8 f 6.8
3.1 f 0.3 217 f 25a
0.8 f 0.1
0.56 f 0.17
0.44 f 0.06
0.28 f 0.12
0.20 f 0.05
respectively. These values were











I PBK
SPB X











0 100 200 300 4100 500 600 700 800


[4'-OH-PCB79] (CLM)


Figure 3-4. Sulfonation of 4'-OH-PCB79, PAPS = 0.02 mM.

Each data point represents the average of duplicate assays for each bear, while
the error bars represent the standard deviation. The line represents the best fit
to equation (4) for 4'-OH-PCB79.


Due to variable rates of sulfonation of these unknown substrates, autoradiographic

counts corresponding to the OHMXC-O-sulfate band were used to correct the activities

calculated from the scintillation counter data (Figure 3-5). This enabled the transformed

data to be fit into a Michaelis-Menten model (Table 3-2). The autoradiograms obtained

showed that increasing concentrations of OHMXC resulted in decreased counts for the

unknown sulfate conjugates (Figure 3-5). Sulfonation of the unknown substrates in polar

bear cytosol was reduced by half at OHMXC concentrations < 20 LM.

































0 20 50 '100 200 300
IgM OHMXC


Figure 3-5. Autoradiogram showing the reverse-phase TLC separation of sulfonation
products of OHMXC.

Incubations were carried out with the indicated concentrations of OHMXC.
The arrow indicates the sulfate conjugate of the OHMXC, while other bands
represent unidentified sulfate conjugates formed from endobiotics or other
xenobiotics in polar bear liver cytosol.


The total TCPM sulfate conjugate production formed after 5 minutes under initial

rate conditions did not exceed 30 pmol. TLC, followed by autoradiography, was thus

used to distinguish the TCPM-sulfate band (Rf 0.54) from other sulfate conjugates (Rf

0.05 and 0.72) originating from compounds in the polar bear liver cytosol (Figure 3-6).

The data obtained followed hyperbolic kinetics (Table 3-2). Even though the TLC

from the kinetic experiments showed a TCPM concentration-dependent increase of the

band corresponding to the purported TCPM-sulfate, and this band was absent in the









substrate blank, the fact remained that we were apparently looking at the only instance

ever reported of a successful sulfonation of an acyclic tertiary alcohol.








*#4@










PC P100 CO C100 HO H100


Figure 3-6. Autoradiogram showing the reverse-phase TLC separation of sulfonation
products from incubations with TCPM using polar bear (P), channel catfish
(C), and human (H) liver cytosol in the absence of (0), and presence of 100
CLM TCPM (100).

The arrow indicates the sulfate conjugate of the substrate, while other bands
represent unidentified sulfate conjugates formed from endobiotics or other
xenobiotics in liver cytosol.


Thus, additional experiments were performed to verify the identity of this

conjugate. The purity of the TCPM was tested in the event that the additional band was

due to an impurity in the substrate. However, the substrate used was found to be free of

contaminants by HPLC (C18 reverse phase column, with detection at 268 and 220 nm,

using 90% methanol in water and a flow rate of 1 mL/min). A single peak was recorded









at 7.3 minutes. Another experiment involved a 60-minute incubation performed with 100

CLM TCPM and 0.1 mg cytosolic protein from polar bear, channel catfish and human

liver. For each of the three species, we detected a conjugate at Rf = 0.54. The substrate

blanks showed no band at the same position (Figure 3-6). The TCPM sulfate conjugate

from polar bear could be hydrolyzed by sulfatase (Figure 3-7), providing further evidence

of the sulfonation of this alcohol.

A B
12 34
















Figure 3-7. Autoradiogram showing the reverse-phase TLC separation of sulfonation
products of TCPM and the effect of sulfatase treatment.

A, incubation in the absence of TCPM (lane 1), and following treatment with
sulfatase (lane 2). B, incubation with 200 CLM TCPM (lane 3), and following
treatment with sulfatase (lane 4). The arrow indicates the sulfate conjugate of
the TCPM, while other bands represent unidentified sulfate conjugates formed
from endobiotics or other xenobiotics in polar bear liver cytosol.


Inhibition of sulfonation of substrates already present in the polar bear liver was

noted upon adding 1 CLM PCP (Figure 3-8). The data for PCP sulfonation fitted the

nonlinear Hill plot (eq. 2) (Table 3-2).






























0 1 2 5 10 20 50 75 100
E-M PCP


Figure 3-8. Autoradiogram showing reverse-phase TLC separation of sulfonation
products from the study of PCP kinetics.

The arrow indicates the sulfate conjugate of PCP, while other bands represent
unidentified sulfate conjugates formed from endobiotics or other xenobiotics
in polar bear liver cytosol.


Discussion

The sulfonation of hydroxylated metabolites of benzo[a]pyrene has been reported

in various species, including fish (James et al., 2001) and humans (Wang et al., 2004).

Benzo[a]pyrene-3 -glucuronide has been shown to be produced by fish (James et al.,

1997), rats (Lilienblum et al., 1987) and humans (Wang et al., 2004). There are,

however, few studies investigating the kinetics of these conjugation reactions.

Glucuronidation of 3-OH-B[a]P was more efficient in polar bear liver than in human liver

or catfish intestine. On the other hand, the efficiency of sulfonation was similar to that

shown in human liver but around three times less than in catfish intestine (Wang et al.,










2004, James et al., 2001). From the limited comparative data available, it can be surmised

that, in general, polar bear liver is an important site of 3-OH-B[a]P detoxication,

particularly with respect to glucuronidation.

Substrate inhibition for the sulfonation of 3-OH-B[a]P has been observed at

relatively low concentrations of the xenobiotic in other species such as catfish and human

(Tong and James 2000, Wang et al., 2005). Data from the polar bear sulfonation assay

fitted a two-substrate model developed for the sulfonation of 17P-estradiol by SULTIE

(Zhang et al., 1998). This model was also used to explain the sulfonation profie observed

for the biotransformation of 1-hydroxypyrene, a compound structurally similar to 3-OH-

B[a]P, by SULTs 1Al and 1A3 (Ma et al., 2003). In the original model, SULTIE1 was

saturated with PAPS, and each of the estradiol substrate molecules bound independently

to the enzyme. The estradiol binding sites were proposed to consist of a catalytic site, and

an allosteric site that regulates turnover of the substrate (Zhang et al., 1998). The

substrate inhibition observed with polar bear liver cytosol at higher 3-OH-B[a]P

concentrations (>0.75 pLM) can thus be explained by the binding of a second substrate

molecule to an allosteric site, which leads to a two-fold decrease in affinity and an

eightfold decrease in V;;;a.

SULTs are generally high-affinity, low-capacity biotransformation enzymes that

operate effectively at low substrate concentrations. Thus, typical K;;s for the sulfonation

of xenobiotic substrates are usually significantly lower than K;;s for the same substrates

undergoing biotransformation by low-affinity, high-capacity glucuronosyltransferases

(UGTs). In polar bear liver, both pathways showed similar apparent affinities for 3-OH-

B[a]P, with K;;s of 0.4 and 1.4 CLM for sulfonation and glucuronidation respectively,










suggesting these two pathways of Phase II metabolism compete at similar 3-OH-B[a]P

concentrations. However, the apparent maximal rate of sulfonation was about 7.5 times

lower than the rate of glucuronidation.

It was previously reported that the maximum rate of glucuronidation of 3-OH-

B[a]P by polar bear liver was 1.26 nmol/min/mg, or around half the V;;;a value obtained

in this study (Sacco and James 2004). However, the preceding study utilized 0.2 mM

UJDPGA, which, as seen from Table 3-2a, is equivalent to the K,; (for UDPGA) of the

low-affinity enzyme, and thus does not represent saturating concentrations of the co-

substrate. The affinity of the enzyme for 3-OH-B[a]P did not change significantly with a

20-fold increase in UDPGA concentrations, suggesting that substrate binding is

independent of the binding of co-substrate. The binding of UDPGA was biphasic,

indicating that multiple hepatic UGTs may be responsible for the biotransformation.

Biphasic UDPGA kinetics have also been demonstrated in human liver and kidney for 1-

naphthol, morphine, and 4-methylumbelliferone (Miners et al., 1988a,b; Tsoutsikos et al.,

2004). While V;;;a was similar for both components, there was a fivefold decrease in

enzyme affinity for UDPGA as the co-substrate concentration was increased. The

involvement of at least two enzymes can be physiologically advantageous since it enables

the maintenance of a high turnover rate even as UDPGA is consumed. Although

physiological UDPGA concentrations in polar bear liver are unknown, mammalian

hepatic UDPGA has been determined to be around 200-400 CLM (Zhivkov et al., 1975,

Cappiello et al., 1991), implying that the observed nonlinear kinetics in the polar bear

may operate in vivo.










The rate of triclosan sulfonation was the highest of all the substrates studied;

apparent V;;; was twice as high as for 3-OH-B[a]P. However, the overall efficiency of

sulfonation of the hydroxylated PAH was still 13 times higher than for triclosan

sulfonation. The presence of three chlorine substituents (though none flanking the phenol

group) does not hinder the sulfonation of triclosan when compared to the 'chlorine-free'

3-OH-B[a]P. Triclosan sulfonation in polar bear liver was similar to human liver with

respect to enzyme affinity; however the maximum rate was tenfold higher in polar bears

than in humans (Wang et al., 2004). This may be one reason why triclosan has not been

detected in polar bear plasma or liver to date.

Our data fitted a model that indicates the substrate inhibition observed for 4'-OH-

PCB79 may be due to a second substrate molecule interacting with the enzyme-substrate

complex at the active site rather than an allosteric site, resulting in a dead-end complex.

Unlike 3-OH-B[a]P, sulfonation can only proceed via the single substrate-SULT

complex. Models of SULTIAl and 1A3, with two molecules of p-nitrophenol or

dopamine at the active site respectively, have been proposed as a mechanism of substrate

inhibition (Gamage et al., 2003, Barnett et al., 2004), while the crystal structure of human

EST containing bound 4,4'-OH-3,3',5,5 '-tetrachlorobiphenyl at the active site has not

provided any evidence of an allosteric site (Shevtsov et al., 2003). The slower sulfonation

of 4'-OH-PCB79 compared with 3-OH-B[a]P may result from the inductive effect of the

chlorines flanking the phenolic group rather than steric hindrance (Duffel and Jakoby,

1981). However, polar bear liver sulfonated 4'-OH-PCB79 more rapidly than the other

OH-PCB substrates studied.









The inclusion of two additional chlorine substituents on the non-phenol ring (with

respect to 4'-OH-PCB79) resulted in both 4'-OH-PCBl59 and 4'-OH-PCBl65 being

very poor substrates. Ineffieient sulfonation may be one reason why the related

compound 4'-OH-PCBl72 accumulates in polar bears. Some degree of substrate

inhibition may also be expected to contribute to this accumulation, as was observed with

4'-OH-PCBl165.

Sulfonation was not an efficient pathway of OHMXC detoxification. The rate of

OHMXC-sulfonate formation was around 7 times lower than for 4'-OH-PCB79. Since

resonance delocalization of negative charge on the phenolic oxygen by the flanking

chlorines in chlorophenols may decrease Vmax by increasing the energy of the transition

state of the reaction (Duffel and Jakoby, 1981), it is possible that in the case of OHMXC

(with no chlorines flanking the phenolic group), product release, rather than sulfonate

transfer, may have been the rate-limiting step.

TCPM was a poor substrate for sulfonation, and this may be one reason why it has

been measured in such high amounts in polar bear liver. To our knowledge, sulfonation

of acyclic tertiary alcohols has not been reported in the literature. Despite the

considerable steric hindrance of three phenyl groups, the alcohol group could be

sulfonated. Although the alcohol in TCPM is not of the benzylic type, the presence of

three proximal phenyl groups may give this group some benzylic character, rendering

sulfonation of the alcohol possible. Both SULT 1El and SULT 2Al have been shown to

sulfonate benzylic alcohol groups attached to large molecules (Glatt, 2000). Sulfation of

the benzylic hydroxyl group leads to an unstable sulfate conjugate that readily degrades

to the reactive carbocation or spontaneously hydrolyzes back to the alcohol. Attempts to









recover TCPM-O-sulfonate from TLC plates resulted in recovery of TCPM from the

conjugate band, perhaps because of the conjugate' s instability.

A study of the sulfonation of PCP was complicated by the fact that it is a known

SULT inhibitor, often with K,s in the submicromolar range. In our experiments, this was

seen as a 74% decrease in formation of the unidentified sulfonate conjugates (band

shown at the solvent front in Figure 3-8) upon addition of 1 CLM PCP. Although PCP was

a strong inhibitor of SULTI1E1 (Kester et al., 2000), and has been postulated to be a dead-

end inhibitor for phenol sulfotransferases (Duffel and Jakoby, 1981), it was possible that

polar bear SULT 1A isoforms were not completely inhibited by PCP, or that other SULT

isoform(s) were responsible for the limited sulfonation activity observed. Thus, we have

shown that, in vitro at least, one mammalian species is capable of limited PCP

sulfonation. Even though the tertiary alcohol of TCPM was a poor candidate for

sulfonation, it was metabolized at twice the efficiency of PCP, which has a phenolic

group that is usually more susceptible to sulfonation. This demonstrates the extent of the

decreased nucleophilicity on the phenolic oxygen due to the resonance delocalization

afforded by the five chlorine substituents.

Conclusions

In summary, this study demonstrated that, in polar bear liver, 3-OH-B[a]P was a

good substrate for sulfonation and glucuronidation. Other, chlorinated, substrates were

biotransformed with less efficiency, implying that reduced rates of sulfonation may

contribute to the persistence of compounds such as hexachlorinated OH-PCBs, TCPM

and PCP in polar bear tissues.















CHAPTER 4
GLUCURONIDATION OF POLYCHLORINATED BIPHENYLOLS BY CHANNEL
CATFISH LIVER AND INTESTINE

Polychlorinated biphenyls (PCBs) were extensively used as dielectrics in the mid-

twentieth century. Despite a ban on their use in the US, Europe and Japan since the mid

1970s, the chemical stability of PCBs has resulted in their persistence at all trophic levels

around the globe. Enzyme-mediated biotransformation is an important influence on PCB

persistence, and its significance in PCB toxicokinetics is dependent on congener structure

and the metabolic capacity of the organism.

Polychlorinated biphenylols (OH-PCBs) are products of CYP-dependent oxidation

of PCBs (James 2001). While OH-PCBs are more polar than their parent molecules, they

are still lipophilic enough to be orally absorbed, and distribute to several tissues (Sinjari

et al., 1998). Thus, not only have these compounds been detected in the plasma (which

represents recent dietary exposure, biotransformation, and remobilization into the

circulation) of a variety of animal species, such as polar bear (Sandau et al., 2004),

bowhead whale (Hoekstra et al., 2003), catfish (Li et al., 2003), and humans (Fangstroim

et al., 2002; Hovander et al., 2002), but also significantly, from a developmental

toxicology aspect, in fetuses and breast milk (Sandau et al., 2002; Guvenius et al., 2003).

OH-PCBs may contribute significantly to the recognized toxic effects of PCBs such

as endocrine disruption (Safe 2001; Shiraishi et al., 2003), tumor promotion (VondrBkek

et al., 2005) and neurological dysfunction (Sharma and Kodavanti 2002; Meerts et al.,

2004).









Elimination of these toxic metabolites via Phase II conjugation reactions, such as

glucuronidation and sulfonation, are thus important routes of detoxification. In view of

the persistence of certain OH-PCBs, it is surprising that only a few studies have

attempted to investigate the biotransformation of these compounds in animals or humans,

particularly by glucuronidation (Tampal et al., 2002; Sacco and James 2004; Daidoji et

al., 2005), which is normally a higher-capacity pathway than sulfonation.

Glucuronidation is catalyzed by a family of endoplasmic reticular membrane-bound

enzymes, the UDP-glucuronosyltransferases (UGTs), which transfer a D-glucuronic acid

moiety from the co-substrate UDP-glucuronic acid (UDPGA) to a xenobiotic containing

a suitable nucleophilic atom such as oxygen, nitrogen and sulfur. UGTs are mainly found

in the liver, but also in extrahepatic tissues, such as the small intestine and kidney (Wells

et al., 2004).

The various chlorine and hydroxyl substitution patterns possible on the biphenyl

structure may lead to significant differences in glucuronidation kinetics. One explanation

for the retention of certain OH-PCBs may thus be that they are poor substrates for

glucuronidation. Tampal and co-workers (2002) studied the glucuronidation of a series of

OH-PCBs by rat liver microsomes. Efficiency of glucuronidation varied widely, and

substitution of chlorine atoms at the m- and p-positions on the nonphenolic ring greatly

lowered Vmax. Weak relationships were observed between the dihedral angle, pKa, log D

and enzyme activity. The experimentally determined kinetic parameters determined in the

Tampal et al study were subsequently related to the physicochemical properties and

structural features of the OH-PCBs by means of a quantitative structure-activity









relationship (QSAR) study. Hydrophobic and electronic aspects of OH-PCBs were shown

to be important in their glucuronidation (Wang, 2005).

Most of the persistent OH-PCBs found in human plasma are hydroxylated at the p-

position, in addition to being meta-chlorinated on either side of the phenolic group. The

remaining substitution pattern on both rings is highly variable (Bergman et al., 1994;

Sjoidin et al., 2000). An OH group in the para position, with two flanking chlorine atoms

was associated with estrogen and thyroid hormone sulfotransferase inhibitory activity

(Kester et al., 2000; Schuur et al., 1998), and exhibited the highest affinity for

transthyretin (TTR) (Lans et al., 1993), the major transport protein in non-mammalian

species (Cheek et al., 1999). Such OH-PCBs were potent inhibitors of the sulfonation of

3 -hydroxybenzo[a]pyrene (Wang et al., 2005). In contrast, the OH-PCBs having an

unhindered hydroxyl group substituted at the para position (relative to the biphenyl bond)

have exhibited the strongest binding to the rodent estrogen receptor (ER), although the

competitive ER binding affinities were <100-fold lower than that observed for estradiol

(Korach et al., 1988; Arulmozhiraja et al., 2005).

In the channel catfish, individual OH-PCBs have been shown to inhibit the in vitro

intestinal glucuronidation of several hydroxylated metabolites of benzo[a]pyrene (BaP)

(van der Hurk et al., 2002; James and Rowland-Faux 2003). The in situ hepatic

glucuronidation of a procarcinogenic BaP metabolite, the (-)benzo[a]pyrene-7,8-dihydro-

diol, was also inhibited by a mixture of OH-PCBs, consequently increasing the formation

of DNA adducts (James et al., 2004). It is possible that these compounds inhibit their own

glucuronidation. The OH-PCB metabolites of 3,3,4,4-tetrachlorobiphenyl (CB-77), one

of the most toxic PCBs known, were poor substrates for catfish intestinal glucuronidation









(James and Rowland-Faux, 2003). This may help to explain the persistence of these

compounds.

Hypothesis

The glucuronidation kinetics of a series of potentially toxic p-OH-PCBs by channel

catfish liver and proximal intestine is influenced by the structural arrangement of the

chlorine substituents around the biphenyl ring.

Methodology

Chemicals. A total of 14 substrates were used in this study (Figure 4-1). The

nomenclature of the OH-PCBs is based on the recommendations of Maervoet and co-

workers (2004).

The following substrates (Catalog no. in parentheses) were purchased from

Accustandard (New Haven, CT): 4-OHCB2 (1003N), 4-OHCBl4 (2004N), 4'-OHCB69

(4008N), 4'-OHCB72 (4009N), 4'-OHCB106 (5005N), 4'-OHCBll2 (5006N), 4'-

OHCBl21 (5007N), 4'-OHCBl59 (6001N), and 4'-OHCBl65 (6002N). The compounds

4'-OHCB35, 4-OHCB39, 4'OHCB68, 4'-OHCB79 were synthesized by Suzuki-coupling

(Lehmler and Robertson, 2001; Bauer et al., 1995). The 4-hydroxy biphenyl (4-OHBP)

was purchased from Sigma (St.Louis, MO). 14C-UDPGA (196 CICi/Clmol) was obtained

from PerkinElmer Life and Analytical Sciences (Boston, MA). The 14C-UDPGA was

diluted with unlabelled UDPGA to a specific activity of 1.5-5 CICi/Clmol for use in

enzyme assays. PIC-A (tetrabutylammonium hydrogen sulfate) was obtained from

Waters Corp. (Milford, MA). Other reagents were the highest grade available from Fisher

Scientific (Atlanta, GA) and Sigma.


















4-OHCB2


4' -OHCB3 5


4-OHCB39 4' -OHCB6 8

CICl


Cl ClI Cl' Cl

OH
OH

4' -OHCB79 4' -OHCB 106


4' -OHCB72


4' -OHCB 112


Cl Cl
4' -OHCB l59 4' -OHCBl165


Figure 4-1. Structure of substrates used in channel catfish glucuronidation study.

Animals. Channel catfish (Ictalurus punctatus), with weights ranging from 2.1 -

3.7 kg, were used for this study. All fish were kept in flowing well water and fed a fish

chow diet (Silvercup, Murray, UT). Care and treatment of the animals was conducted as

per the guidelines of the University of Florida Institutional Animal Care and Use

Committee. The microsomal fractions were obtained from liver and intestinal mucosa


OH

4-OHCB14





-OH

4' -OHCB69


OH

4-OHBP


I~ OH

4' -OHCB l21










using a procedure described previously (James et al., 1997). Only the proximal portion of

the intestine was used in the study. Protein determination was carried out by the method

of Lowry and co-workers (195 1) using bovine serum albumin as protein standard.

Glucuronidation assay. A radiochemical ion-pair extraction method was

employed to investigate the glucuronidation of the 4-OHPCBs and 4-OHBP. Substrate

consumption did not exceed 10%. Initial experiments determined the saturating

concentrations of UDPGA to be employed. The incubation mixture consisted of 0.1 M

Tris-Cl buffer (pH 7.6), 5 mM MgCl2, 0.5% Brij-58, 200 CIM or 1500 CIM [14C]UDPGA

(intestine and liver, respectively), 100 Clg catfish intestinal or hepatic microsomal protein,

and substrate in a total reaction volume of 0. 1 mL. Initially, the OH-PCBs were added to

tubes from methanol solutions and evaporated under nitrogen. In all cases, the protein

and Brij-58 were added to the dried substrate, thoroughly vortexed and left on ice for 30

minutes. Subsequently, the buffer, MgCl2, and water were added in that order and vortex-

mixed. After a pre-incubation of 3 minutes at 35oC, UDPGA was added to initiate the

reaction, which was terminated after 30 minutes incubation by the addition of a 1:1

mixture of 2.5% acetic acid and PIC-A in water, such that the final volume was 0.5 mL.

The glucuronide product was extracted by two successive 1.5 mL portions of ethyl

acetate. The phases were separated by centrifugation, and duplicate portions of the ethyl

acetate phase were counted for quantitation of glucuronide conjugate.

Physicochemical parameters. The structural characteristics of the OH-PCBs were

calculated using ChemDraw 3D (CambridgeSoft Corp., Cambridge, MA). Parameters

used were: the Connolly Accessible Surface Area (CAA, the locus of the center of a

probe sphere, representing the solvent, as it is rolled over the molecular shape), the









Connolly Molecular Surface Area (CMA, the contact surface created when a probe

sphere (radius = 1.4 A+, the size of H20), representing the solvent, is rolled over the

molecular shape), the Connolly Solvent-Excluded Volume (CSV, the volume contained

within the contact molecular surface, or that volume of space that the probe is excluded

from by collisions with the atoms of the molecule), the ovality (the ratio of the Molecular

Surface Area to the Minimum Surface Area, which is the surface area of a sphere having

a volume equal to CSV of the molecule), and dihedral angle (the angle formed between

the planes of the two rings, which is related to the extent of coplanarity of the molecule).

ACD/ILab software (Advanced Chemistry Development, Ontario, Canada) was used to

predict log P, log D (at pH 7.0), and the pKa (of the phenolic group).

Kinetic analysis. Duplicate values were employed for the rate of conjugate

formation at each substrate concentration to calculate kinetic parameters using Prism v4.0

(GraphPad Software, Inc., San Diego, CA). Equations used to fit the data were the

Michaelis-Menten hyperbola for one-site binding and the Hill plot for positive

cooperativity.

Results

The kinetics for UDPGA were analyzed for the glucuronidation of three

representative OH-PCBs (Table 4-1). Saturating concentrations of UDPGA were higher

in liver than in intestine (Figure 4-2). The glucuronidation of most of the OH-PCBs tested

followed Michaelis-Menten kinetics (Figure 4-3A). In the case of the glucuronidation of

4'OHCB35 by liver and 4'OHCBll2 by proximal intestine, the data fitted the Hill plot

(Figure 4-3B).









Table 4-1. Estimated kinetic parameters (mean & S.D.) for the co-substrate UDPGA in
the glucuronidation of three different OH-PCBs.
Substrate Substrate Vmax (app) Km (app)
Concentration (CIM) (nmol/min/mg) (CLM)
Liver
4'-OHCB-3 5 500 0.87 & 0.20 697 & 246

4'-OHCB-72 250 0.32 & 0.14 247 & 162

Intestine
4'-OHCB-69 200 0.20 + 0. 11 27 & 14




The estimated apparent maximal rate of glucuronidation of polychlorinated

biphenylols by channel catfish ranged from 124-784 pmol/min/mg for proximal intestine

and 404-2838 pmol/min/mg for the liver (Table 4-2). The Kms for individual OH-PCBs

tended to be different in the two organs, with a few exceptions (40HCB2, 4'OHCBl65).

Vmax was significantly higher in liver than in intestine. Conversely, the affinity of

intestinal catfish UGTs (Km range: 42-572 C1M) for the OH-PCBs tested was higher than

for liver UGTs (Km range: 111-1643 CIM). These contrasting differences are reflected in

the lack of any difference in the efficiency of glucuronidation in both organs when all the

OH-PCB substrates were considered (Table 4-3). Vmax for OH-PCB glucuronidation in

both organs were strongly correlated with each other (R2=0.74). This relationship did not

exist for Km (R2=0.003).




























[UDPGA] (CIM)


0 25 50 75 100


[UDPGA] (CIM)


Figure 4-2. UDPGA glucuronidation kinetics in 4 catfish.

A) in liver, using 500 CLM 4'-OH-CB35. B) in proximal intestine, using 200
CLM 4'-OH CB69



























0 250 500 750 1000 1250 1500


[4'-OH CB 159] (CLM)


0 100 200 300 400 500 600 700


[4'-OH CB 112] (CIM)


Figure 4-3. Representative kinetics of the glucuronidation of OH-PCBs in 4 catfish.

A) Michaelis-Menten plot for 4'-OHCB-159 by liver. B) Hill plot for 4'-
OHCB-112 by proximal intestine





Units for Km and Vmax are CLM and pmol/min/mg protein, respectively. Bold indicates Sso
in place of Km. ND, not done.

Table 4-3. Comparison of the estimated kinetic parameters for OH-PCB glucuronidation
in catfish liver and proximal intestine
Parameter Liver Intestine p-value

Vmax (app) 1370 & 275 364 & 70 0.002

Km (app) 567 & 128 210 & 46 0.016

Vmax/Km 3.7 & 0.6 3.4 & 1.8 0.857

(Mean & SEM for all OH-PCB substrates)


Table 4-2. Kinetic parameters (Mean & S.D.) for the glucuronidation of 4-OHBP and OH-
PCBs.


Intestine
Substrate Vmax (app) Km (app)


Liver
Vmax (app)


Km (app)


4-OHBP

4-OHCB2

4-OHCB14

4'-OHCB3 5

4-OHCB 3 9

4'-OHCB68

4'-OHCB69

4'-OHCB72

4'-OHCB79

4'-OHCB 106

4'-OHCBl12

4'-OHCBl121

4'-OHCBl159

4'-OHCBl165


43 A 10

417 & 57

255 & 59

784 & 348

220 + 90

213 & 91

751 & 253

401 & 236

124 & 36

431 & 60

401 & 67

220 & 39

188 & 66

163 & 26


599 & 110

572 & 47

387 & 65

265 & 85

134 & 36

119 & 75

42 & 21

183 A 126

87 & 21

183 & 58

163 & 24

130 & 21

213 A 136

137 & 44


182 & 78

2277 & 849

2022 & 936

2838 & 1456

1716 & 536

ND

2774 & 1153

ND

869 & 318

1579 & 645

2144 & 1007

1046 & 408

681 +141

404 & 116


502 & 235

583 & 95

614 & 202

455 & 89

242 & 76

ND

1071 & 410

ND

476 & 201

798 & 122

1643 & 545

207 & 97

318 & 91

111 & 28









The Vmax for glucuronidation in both proximal intestine and liver was significantly

decreased upon addition of a second chlorine substituent flanking the phenolic moiety,

while keeping the chlorine substitution pattern in the rest of the molecule constant (Table

4-4, Figure 4-4). The affinity of hepatic UGTs for the OH-PCBs appeared to increase

with the addition of a second flanking chlorine atom; however, this relationship did not

achieve statistical significance.


Table 4-4. Comparison of kinetic parameters (Mean & SEM) for the glucuronidation of
OH- PCBs grouped according to the number of chlorine atoms flanking the
phenolic group

Parameter Flanking chlorines p-value
1 2


Liver

Vmax (app), pmol/min/mg 2247 & 204 1002 & 274 0.007

Km (app), CIM 856 & 209 342 & 88 0.053


Intestine

Vmax (app), pmol/min/mg 560 + 85 190 & 23 0.003
Km (app), CIM 274 & 97 191 & 53 0.473




The effect of chlorine substituents on the nonphenolic ring on glucuronidation of

OH-PCBs was also investigated. No significant differences on Km and Vmax could be

observed between the absence or presence of specific chlorine substituents on the

nonphenolic ring. The only exception was that the presence of an ortho-chlorine

significantly (p=0.03) decreased the Km in the proximal intestine.














































U


I one flanking Cl
EC: two flanking Cl


0 3,4 2,4,6 2,3,4,5 2,3,5,6
Substitution pattern on nonphenol ring


Sone flanking Cl
..I~ two flanking Cl


40001

30001

2000-

1000-


~I


03,4 2,4,6
Substitution pattern on


2,3,4,5 2,3,5,6
nonphenol ring


Figure 4-4. Decrease in Vmax with addition of second chlorine atom flanking the phenolic
group, while keeping the chlorine substitution pattern on the nonphenolic ring
constant.


A) proximal intestine. B) liver.


I










Regression analysis was performed between the kinetic parameters for the

glucuronidation of OH-PCBs and several physical parameters for these substrates (Table

4-5). The data for 40HBP was not used since this compound is not a OH-PCB. The

affinity of intestinal UGTs was negatively correlated with the Connolly solvent-

accessible surface area, the molecular surface area, solvent-excluded volume, ovality,

dihedral angle, log P, and positively correlated with pKa. The maximum rate of hepatic

glucuronidation was negatively correlated with the Connolly solvent-accessible surface

area, the molecular surface area, solvent-excluded volume, ovality, and log P, and

positively correlated with pKa (which showed a similar relationship with intestinal Vmax).

Ovality was also significantly negatively correlated with the maximum rate of intestinal

glucuronidation of the OH-PCBs studied (Figure 4-5).

A paired t-test performed in order to investigate the physicochemical parameters

involved in the significant decrease in Vmax observed for the glucuronidation of OH-

PCBs with two chlorine atoms flanking the phenolic group revealed that, for OH-PCBs

with this structural arrangement, pKa was decreased (p=0.02), while log P, and

parameters indicating molecular size (CAA, CMA, CSEV, ovality) were all increased (all

p <0.0001).




















CAA




CMA




CSEV




Ovality




Dihedral

angle


log P




log D
(pH 7.0)


pKa


Sign in parentheses indicates type of correlation where it achieved significance.


Physical
Parameter


Table 4-5. Results of regression analysis performed in order to investigate the
relationship between the glucuronidation of OH-PCBs by catfish proximal
intestine and liver and various estimated physical parameters.


Intestine

Vmax (app)


0.060
0.079


0.056
0.087


0.047
0.118




0.014


0.002
0.755


0.058
0.086


0.011
0.467


0.143 (+)
0.006


Liver

Vmax (app)


0.253 (-)
0.0005


0.249 (-)
0.0006


0.236 (-)
0.0008


0.286 (-)
0.0002


0.077
0.068


0.250 (-)
0.003


0.015
0.490


0.306 (+)
0.0007


Statistic


R2

p-value


R2

p-value


R2

p-value


R2

p-value


R2

p-value


R2

p-value


R2

p-value


R2

p-value


Km (app)


0.439 (-)
<0.0001


0.423 (-)
<0.0001


0.396 (-)
<0.0001


0.431 (-)
<0.0001


0.248 (-)
0.0002




0.044


0.035
0.271


0.108 (+)
0.047


Km (app)


0.004
0.685


0.002
0.780


<0.001
0.962


0.068
0.088


0.026
0.296


0.061
0.137


<0.001
0.963


0.093
0.063











'-- a Vmax (int)
g a Vmax (liv)









1.360 1.385 1.410 1.435
ovality




Figure 4-5. Relationship between Vmax for OH-PCB glucuronidation in intestine and liver
and ovality

Discussion

In comparison to catfish intestine, catfish liver displayed higher rates of

glucuronidation of OH-PCBs, however both organs collectively biotransform the OH-

PCBs studied with similar efficiency. This occurred because while the glucuronidation

Vmax in the intestine was lower than in the liver, the affinity of intestinal UGTs for the

OH-PCBs was higher than liver UGTs. However, the efficiency of glucuronidation of 4'-

OHCB69 was seven times higher in the proximal intestine; when the data for this

substrate was excluded, the efficiency of glucuronidation was significantly higher

(p=0.01) in liver.

The total UGT capacity in the liver is much greater than in intestine when the total

content of microsomal protein in these two organs is taken into consideration. In fact, the

levels of microsomal protein from liver were always higher than in the intestine of each

individual fish studied, possibly because of the decreased amount of endoplasmic









reticulum in enterocytes relative to hepatocytes (DePierre et al., 1987). Thus, the intestine

appears to compensate for the lower glucuronidation capacity by expressing UGTs with a

higher affinity.

No relationship was established between Kms for the glucuronidation of OH-PCBs

in liver and intestine. When individual OH-PCBs were considered, there were significant

differences in efficiency. These results suggest that these two organs have different UGT

isoform profiles, with the intestine possessing one or more isoforms that display greater

specificity for OH-PCBs. Possible UGT isoforms responsible may be catfish enzymes

analogous to rat UGTIA1, UGTIA6 and UGT2B1 (Daidoji et al., 2005), and to plaice

hepatic UGTIBl, which has been shown to conjugate planar phenols (Clarke et al.,

1992).

The substrates 4'-OHCB69 and 4-OHCB39 were glucuronidated with the highest

efficiency in the intestine and liver respectively. 4'-OHCB35 showed the highest rates of

glucuronidation in both liver and intestine. The poorest substrates were 4-OHCBl4 in the

intestine and 4'-OHCBll2 in the liver. In contrast, rat liver glucuronidates 4-OHCBl4

with the highest efficiency, relative to other OH-PCBs studied (Tampal et al., 2002).

Overall, the efficiency of glucuronidation of the OH-PCBs by rat liver is higher than in

catfish liver. While these dissimilarities may be ascribed to differences in UGT isoform

type and expression due to the different species and tissues in the two studies, it may also

indicate an increased susceptibility of catfish to the toxic effects of OH-PCBs due to an

increased bioavailability.

Compared to the OH-PCBs, 4-OHBP was the poorest substrate for glucuronidation.

This compound had the lowest Vmax in both liver and proximal intestine. The affinity for









4-OHBP in the intestine was also the lowest. In the liver however, the Km was

comparable to other OH-PCBs. These results are surprising in view of the fact that 4-

OHBP has been shown to be a good substrate for glucuronidation using rat, guinea pig,

beagle dog and rhesus monkey liver microsomes (Yoshimura et al., 1992), and human

expressed UGTs (King et al., 2000; Ethell et al., 2002). In isolated rat hepatocytes, 4-

OHBP is a cytotoxic major metabolite of biphenyl, impairing oxidative phosphorylation

(Nakagawa et al., 1993). These results suggest that this compound may be potentially

more toxic to catfish than to mammals, unless cleared by another pathway such as

sulfonation.

While the decreased glucuronidation of 4-OHBP may be due to the lack of a

specific phenol UGT isoform in catfish, the known broad substrate specificity of phenol

UGTs, together with the observed higher rates of glucuronidation for the OH-PCBs, leads

us to hypothesize that this compound may be such a poor substrate due to its lower

lipophilicity, as has been observed for other substituted phenols (Kim 1991). In fact,

addition of a single chlorine atom flanking the phenolic group (as represented by

40HCB2) resulted in at least a tenfold increase in Vmax in both liver and intestine, with no

significant change in Km (with respect to 4-OHBP). This increased lipophilicity

(represented by an estimated log P increase from 3.2 to 3.8) appeared to impact the

formation of the glucuronide and not the initial binding of substrate to UGT. Good UGT

substrates tend to be lipophilic compounds which are thought to diffuse through the

endoplasmic reticular bilayer and reach the substrate-binding site in the lumenal N-

terminal part of the enzyme, which contains a region of strong interaction with the

membrane (Radominska-Pandya et al., 2005). For all the OH-PCBs studied, we only









observed weak inverse correlations (R2<0.3) between log P and intestinal Km and liver

Vmax. No significant relationship could be observed between parameters of lipophilicity

and intestinal Vmax. The absence and weakness of such relationships may reflect the need

for OH-PCBs with additional structural variation to be included in studies of this type.

Another explanation may be the perturbation of the lipid bilayer of the microsomes,

resulting in rate-limiting partitioning, which would not be present in vivo (Tampal et al.,

2002).

As the estimated pKa of the OH-PCBs increased, so did hepatic and intestinal Vmax

for glucuronidation. These results are in agreement with a previous OH-PCB

glucuronidation study in rats (Tampal et al., 2002). Thus, a greater proportion of ionized

OH-PCB molecules appear to have an adverse effect on glucuronidation. Such charged

molecules present at the active site of UGT may interfere with the charge-relay system

that relies on a basic negatively charged residue to deprotonate the phenolic group, prior

to transfer of glucuronic acid (Yin et al., 1994).

Since the use of microsomal systems to elucidate structure-activity relationships

involves incubations of substrate with a heterogeneous population of UGTs exhibiting

different levels of expression and activity, it was not the intention of this study to attempt

to predict the effect of molecular structure and physicochemical parameters on the

glucuronidation of OH-PCBs, which is better achieved using individual isoforms.

However, if any such effects can be observed at a microsomal level, then it is likely that

such processes are occurring in the organism, whose detoxification route depends on

various UGTs metabolizing substrate simultaneously and not in isolation. This may help

to further delineate the different toxicokinetics of OH-PCBs.









The p-OH-PCBs used in this study all had one or two chlorine atoms flanking the

phenolic group. This structural motif is of interest since it imparts several toxic properties

to these compounds. OH-PCBs with two flanking chlorines were found to be poorer

substrates than compounds with one flanking chlorine atom, in both liver and intestine.

Thus, for example, while 4'-OHCB35 was a very good substrate for glucuronidation,

addition of a second flanking chlorine (as in 4'-OHCB79) resulted in a greater decrease in

Vmax than the addition of two adjacent chlorine substituents on the aphenolic ring (as in

4'-OHCB 106). A comparison of the physicochemical parameters of the two different

structural arrangements suggests that lipophilicity, pKa, and molecular size may all be

contributing to this effect on Vmax.

The addition of a second chlorine atom imparts additional lipophilicity to the

molecule and may increase positive charge on the phenolic carbon atom, which results in

stronger binding to the active site (Wang 2005). This study did show a non-significant

decrease in Km with the addition of the second chlorine atom for both organs. On the

other hand, the 3,5-chlorine substitution pattern may interfere with the mechanism of

glucuronidation because of steric hindrance, although this has been disputed (Mulder and

Van Doorn 1975; Tampal et al., 2002).

The estimated pKas for OH-PCBs with two flanking chlorine substituents were

significantly lower than similar molecules with one flanking chlorine atom. This is

supported by limited experimental data showing that OH-PCBs with two flanking

chlorine atoms have pKa values as low as 6.4 (for 4'-OHCB39, Miller 1978). The

population of OH-PCB molecules which are ionized at physiological pH is significantly

more than OH-PCBs with one flanking chlorine atom, resulting in the adverse effect on









the enzymatically-catalyzed charged relay system described above. In studies conducted

with rat liver microsomes, a decreased maximal rate of glucuronidation was also

observed amongst OH-PCBs differing only in the number of chlorines flanking the

phenolic group (1 pair of OH-PCBs in Tampal et al., 2002; 2 pairs of OH-PCBs in

Daidoji et al., 2005). According to Daidoji and co-workers (2005), UGT2B1 is the

primary rat hepatic UGT isoform responsible for metabolizing OH-PCBs with one

flanking chlorine atom. UGTIAl appears to metabolize both, though with a preference

for structures with two flanking chlorines

These results are significant from a toxicological standpoint since almost all the

major OH-PCBs found in human plasma incorporate a 4'-hydroxy-3',5' -dichloro

structure (Sandau et al., 2002; Fangstrom et al., 2002; Hovander et al., 2002). It is

possible that one reason for the persistence of these OH-PCBs may be a reduced rate of

glucuronidation due to this structural arrangement.

Two or more chlorine substituents that are ortho to the biphenyl bond cause the

molecule to twist and assume a non-coplanar conformation. In the parent PCBs this leads

to toxicological differences, such as loss of AhR agonist activity. The estimated dihedral

angles for the compounds investigated in this study ranged from 360-760. The affinity of

intestinal, but not hepatic, UGTs appeared to increase with the degree of twisting,

suggesting that the predominant isoform(s) in catfish intestine binds more strongly to the

more twisted OH-PCBs. While this may be additional evidence of differences with

respect to isoform profiles between liver and intestine, the weakness of the relationship

(R2~0.3) precludes using this result to solidly support this hypothesis.









Similar to what has been reported for the glucuronidation of OH-PCBs in rats

(Tampal et al., 2002) and simple phenols by human UGTIA6 (Ethell et al., 2002), the

maximal rate of hepatic glucuronidation decreased with increased steric bulk. In the case

of intestinal glucuronidation this relationship was weaker. The enzyme affinity of

intestinal UGTs increased with increasing molecular size, perhaps because the bulkier

molecules tended to be more lipophilic. However, in contrast, the affinity of the liver

UGTs was not affected as much by the molecular size, at least within the restricted size

range offered by the OH-PCBs studied. At this point, no explanation for this discrepancy

between these two tissues is forthcoming.

Conclusions and Recommendations

OH-PCBs are glucuronidated with similar efficiency by channel catfish liver and

proximal intestine. There appear to be differences in the UGT isozyme profile in both

organs. The Vmax for both hepatic and intestinal glucuronidation was decreased with the

addition of a second chlorine atom flanking the phenolic group, which is an arrangement

typical of OH-PCBs that persist in organisms. Future research may be directed towards

cloning, sequencing and characterizing these catfish UGTs, in order to have a better

understanding of the specificity of individual UGT isoforms for particular chlorine

substitution patterns in OH-PCBs.















CHAPTER 5
CLONING OF UDP-GLUCURONOSYLTRANSFERASES FROM CHANNEL
CATFISH LIVER AND INTESTINE

Piscine UGT Gene Structure and Isoforms

Fish are the most ancient vertebrate phylum, and account for over 40% of all living

vertebrate species (Clarke et al. 1992a). Clarke and co-workers (1992b) compared the

hepatic glucuronidation of several xenobiotics and endobiotics in plaice (Pleuronectes

platessa) and rat (Rattus norvegicus), species that are separated by more than 350 million

years of evolutionary divergence. Despite the fact that the plaice showed reduced

glucuronidation activity towards substrates such as morphine, bilirubin and steroids,

weak immunological cross-reactivity was obtained when anti-rat UGT antibodies were

used, indicating the presence of conserved common structural motifs between the two

vertebrates.

Characterization of plaice UGTIB 1 (Accession number (AN): X741 16), an isoform

which conjugates planar phenols and is inducible by polyaromatic hydrocarbons (PAH),

confirmed the strong degree of conservation in gross exon structure and amino acid

character (signal peptide, membrane insertion, and stop sequences) between fish and

mammals. The greatest degree of similarity in amino acid sequence was found with

UGT1 rather than UGT2 (Clarke et al., 1992b, George et al., 1998). Allelic variations in

this UGTIB1 gene are presumed to be functionally silent (George and Leaver 2002).

While there is strong evidence for other distinct isoforms conjugating bilirubin, estrogen

and androgens, to date these have not been characterized. At least six distinct UGTs









exhibited tissue-specific expression in plaice (Clarke et al., 1992c). UGTIB2 mRNA has

recently been sequenced from marbled sole (Pleuronectes yokohamnae) liver (AN:

ABl20133), and a partial sequence of an unidentified UGT isoform has been obtained

from the orange-spotted grouper (Epinephehis coioides) (AN: AY735003). The existence

of a number of partial length sequences of UGT homologues from zebrafish (Dario rerio)

EST projects in GenBank provide evidence for the cDNA of 10 distinct UGTs. The

absence of cDNAs with the same 3'sequence and dissimilar 5-exon 1 coding sequence

suggests the absence of alternative splicing of UGTIA genes as seen in mammals. Thus,

George and Taylor (2002) have suggested the existence of three family 1-related UGTs

and another two related to the UGT 2 family in the zebrafish. In general, however, it

appears that fish possess multiple UGTs with similar functional and structural properties

to mammalian UGT.

Toxicologically, it is important to know whether xenobiotic pollutants such as

PAHs compete with steroids or bilirubin for the same active site on UGT, resulting in

physiological perturbations in reproductive and/or liver function. For example, Atlantic

salmon (Salmo salar) suffering from a multiple pollutant-induced j aundice were shown to

have decreased bilirubin UGT activity (George et al. 1992). Channel catfish are also

exposed to pollutants (such as PAHs and PCBs) which accumulate in sediments. Thus,

this organism may be a useful indicator of the bioavailability of these pollutants in such

sedimentary environments. In addition, the use of this Hish in aquaculture makes it

essential to understand every aspect of its detoxification mechanisms, since these will

ultimately impact human health.









While no UGTs have yet been cloned and characterized from channel catfish, this

species shows glucuronidation activity towards a variety of toxic xenobiotics, including

mono- and di-hydroxy metabolites of benzo[a]pyrene and OH-PCBs (James et al., 2001;

van den Hurk and James 2001; Gaworecki et al., 2004). As with other aquatic species,

pollutants which are direct substrates for glucuronidation, such as pentachlorophenol,

several OH-PCBs, 4-OH-heptachlorostyrene, and which have been shown to be

estrogenic and thyroidogenic, have been detected in channel catfish (Li et al., 2003).

Kinetic differences have been observed between hepatic and intestinal UGT activities,

suggesting expression of different isozymes in these two organs. Thus, knowing more

about the identity and substrate specificity of catfish UGTs will assist our understanding

of the effect of glucuronidation on the contributions of such metabolites to toxicity. Since

the absence of cDNAs with the same 3'sequence and dissimilar 5'exon 1 coding

sequence in fish suggests the absence of alternative splicing of UGTIA genes as seen in

mammals (Gong et al., 2001), additional information on piscine UGT gene structure is

also important from a phylogenetic perspective.

Hypothesis

Multiple UGT isoforms are present in channel catfish liver and intestine

Methodology (part 1)

For convenience, a flowchart summarizing the various steps involved in the cloning

process is shown in Figure 5-1. Because the study utilizing the gene specific primers was

dependent on an initial study which utilized degenerate primers and led to the cloning of

partial sequences of UGT, the methodology and results sections are split correspondingly

mn two parts.


























J


. _ _


Sequencing BLAST search
of partial
1. Des n GS primers
length UGTs 2. 5' and 3' RLMf-RACE
3. Clone and sequence

Sequence overlap
1. Des n GS primers
2. PCR with Super Taq Plus
3. Clone and sequence

Full-length cDNA clone


Figure 5-1. Summary of methods used to clone channel catfish UGT

Animals. A single female adult catfish was sacrificed. Total weights of liver and

intestinal mucosa were recorded. Tissues were immediately processed for RNA isolation.

RNA isolation. Approximately 0.1Ig of tissue from the liver and proximal intestinal

mucosa were homogenized in separate tubes with 1 mL Trizol@ reagent and placed on

ice. The homogenates were incubated for 5 min at room temperature (15-300C) to enable

complete dissociation of nucleoprotein complexes. Chloroform, 0.2 mL, was added and


catfish liver/intestine

1. RNA isolation
2. RT-PCR, using degenerate primers based on consensus sequences


U GT / ~a ion
cDNA f O transformation

pGEM T-Easy vector recombinant plasmid

bacterial/lasmid
replica tion
plasmid
purification!
UGT clones Ecoi ,MO









the tubes were shaken vigorously by hand for 15 seconds and then incubated at room

temperature for 2-3 min. The samples were then centrifuged at 12,000g for 15 min at 2-

80C. This separated the solution into an aqueous phase containing the RNA and an

organic phase containing DNA. The colorless upper aqueous phase was transferred to an

RNase-free tube. The RNA was precipitated by the addition of 0.5 mL propan-2-ol. The

samples were then incubated at room temperature for 10 min, followed by centrifugation

at 12,000g for 10 min at 2-80C. The RNA precipitate was now visible as a gel-like pellet

on the side and bottom of the tube. The supernatant was removed and the RNA pellet was

washed once with 1 mL 75% ethanol. The sample was vortex-mixed and centrifuged at

7,500g for 5 minutes at 2-80C. The RNA pellet was left to air-dry for a few minutes

following decantation of the ethanol. The RNA was dissolved in 100 CIL RNase-free

water for intestine, and 200 CIL RNase-free water for liver (since the solution in this case

appeared to be more concentrated), by passing the solution a few times through a pipette

tip. The solution was then incubated for 10 minutes at 55-600C. The samples were stored

at -800C. The purity of the RNA was checked by running the sample on 1% agarose gel

(with 9.5% formaldehyde) and 10x MOPS buffer. Bands corresponding to the 28S and

18S ribosomal subunits were observed. The purity of the RNA was also checked by

diluting the sample in 10mM Tris HC1, pH 7.5 and measuring the A260/A280 absorbance

ratio (ideally should be between 1.8 and 2.1i).

DNase treatment of RNA samples. This procedure was done in order to remove

contaminating DNA from RNA preparations, and to subsequently remove the DNase and

divalent cations from the sample. Portions of the RNA solutions were diluted to 100

Clg/mL with RNase-free water. The Ambion 9 (Austin, TX) DNA-removal kit was used.










The reaction mix, consisting of 25 CIL RNA, 2.5 CIL 10xDNasel buffer, and 3 CIL DNase I

was incubated at 370C for 1 hour. DNase inactivation reagent, 5 CIL, was added by means

of a wide pipette tip (due to the thick consistency of this reagent). The tubes were then

incubated for 2 min at room temperature, with gentle flicking. The tubes were then

centrifuged at 10,000g for ~1 min to pellet the DNase inactivation reagent. The

supernatant containing the RNA was transferred to a new RNase-free tube and stored at -

800C.

Generation of cDNA library. The Retroscript@ reagent kit manufactured by

Eppendorf (Westbury, NY) was employed in order to heat-denature the RNA. To each of

the two tubes were added 10 CIL liver or intestinal RNA (equivalent to 1 Gig) and 2 C1L

random decamers. The tubes were mixed, centrifuged briefly and heated for 3 min at 70-

850C in the thermocycler. Tubes were removed and left on ice for 1 minute. They were

centrifuged and put on ice again. The following components were added to each tube: 2

CIL 10xRT buffer, 1 C1L dNTP mix (10mM), 0.5 C1L RNase inhibitor, 1 C1L reverse

transcriptase, and RNase-free water to 20 C1L. The tubes were gently mixed and

centrifuged briefly. They were placed in the thermocycler for 1 hr at 42-440C, followed

by 920C for 10 min. The resulting cDNA was either stored at -200C or subjected to a

second round of PCR (liver, see below; for the intestine this procedure was performed a

few days after cDNA generation).

Degenerate primer design. A characteristic 'signature sequence', 44-amino acids

long, probably corresponding to the UDPGA binding site, has been shown to be highly

conserved amongst mammals and other vertebrates (Mackenzie et al., 1997). The relevant

amino acid and nucleotide sequences were compared in 4 species of fish using ClustalW.









The species investigated were Pleuronectes platessa UGTIBl, P.platessa UGT,

Pleuronectes yokohamnae UGT IB2, Epinephelus coiodes UGT and Danio rerio UGT.

Five primers were designed which could hypothetically bind to this sequence. The

application of exclusion criteria (degeneracy- <100-fold, poor or no matches with fish

sequences resulting from BLASTn searches, %GC content <40%, potential to self-

dimerize < -20 kcal/mol) resulted in the selection of two primers, designated as UGTR3

and UGTR4, and chosen to be reverse primers (Table 5-1). An additional reverse primer

(UGT RS) was chosen due to its low degeneracy (4-fold) and its complementarity to the

highly conserved N-terminal domain downstream of the signature sequence. Five

additional primers (UGTF3-7) were also chosen based on these same criteria. Since

these primers were complementary to sequences upstream of the signature sequence, they

were selected to be forward primers (Table 5-1).

Table 5-1. 5' 3' Sequences of degenerate primers chosen.

ID Sequence Direction

UGT F3 GTGGTSCTGGT SCCYGAAASYAGY Forward

UGT F4 CTTACWGAYCCMTTCYTKCC STGYGGC Forward

UGT F5 AAC AT GGTYYWWATYGGRGGYAT CAAC TGT Forward

UGT F6 ATYGGRGGYATCAACTGTGCA Forward

UGT F7 GAGT TTGT SVAHGGC TCW GGA Forward

UGT R3 AAAC AGHGGRAACAT CAVC AT Reverse

UGT R4 YC CYT GS TCK SCAAAC AGHGG Reverse

UGT R5 GT GRTAC TGRAT C CAGTT CAG Reverse









The primer pairs were selected in such a way that their melting temperatures did

not vary by more than 60C and their potential to heterodimerize was more than -20

kcal/mol (Table 5-2)

Table 5-2. Primer pairs chosen, showing annealing temperature and estimated amplicon
length


Pair Forward Reverse Amplicon length (bp)l T (oC)

3 UGT F6 UGT R5 618 52.6

4 UGT F7 UGT R3 288 53.8

5 UGT F6 UGT R3 339 53.8

6 UGT F7 UGT R5 567 52.6

7 UGT F5 UGT R4 363 61.1

8 UGT F3 UGT R4 1003 61.1

9 UGT F4 UGT R4 729 61.1



SBased on Danio rerio UGT sequence (Accession number NP_998587. 1)

PCR amplification of UGT cDNA. A 10 CIM solution of each primer in nuclease-

free water was made up. Each PCR tube consisted of 2 CIL DNA template (from catfish),

2 CIL forward primer, 2 C1L reverse primer, 0.5C1L Taq DNA polymerase (5U/C1L, in Mg

10x buffer), 1 CIL dNTP mix (10mM), 5 C1L 10xPCR buffer, and nuclease-free water up

to 50 CIL. Prior to the initiation of the PCR reaction, with the tubes in place, the

thermocycler lid was heated for two minutes at 1100C to prevent sample evaporation.

Thermocycler parameters (utilizing a gradient PCR program to adjust for the different

optimal annealing temperatures required by the various primer pairs) were as follows:










Stage Temp /oC Duration/min

Initial Denaturation 94 2

Denaturation 94 0.5

Annealing 5715 (L); 5515 (I)' 0.5

Extension 72 1.0

Final extension 72 7.0



annealing temperatures used for: L, liver; I, intestinal cDNA
The program consisted of 35 cycles of denaturation, annealing and extension.

The PCR products were subjected to electrophoresis on 1% agarose gel at 100V (in

lx TAE buffer (40 mM Tris base, 5 mM sodium acetate, 1 mM EDTA, pH 8.0)) using 30

CIL of PCR product; a 100bp DNA ladder was used for size estimates. The DNA bands

were visualized by placing on a UV transilluminator and recorded by photography.

Recovery of PCR product from gel and purification. The desired DNA band

was excised from the gel using a clean scalpel and transferred to a pre-weighed 1.5mL

microcentrifuge tube. The Wizard 9 SV Gel Clean Up system (Promega, Madison, WI)

was used to purify the PCR product by centrifugation. Membrane binding solution (4.5 M

guanidine isothiocyanate, 0.5 M potassium acetate, pH 5.0), 10 C1L per 10 mg gel, was

added to the gel slice. The mixture was vortexed and incubated at 510C for 10 min in

order to dissolve the gel slice. The tube was then briefly centrifuged at room temperature.

For every solution (derived from the cut gel slices), the following procedure was adopted.

One SV Minicolumn was placed in a collection tube. The dissolved gel mixture was

transferred to the SV Minicolumn assembly and incubated for 1 min at room temperature.

The assembly was centrifuged in a microcentrifuge at 16,000g for 1 minute and the liquid










in the collection tube was discarded. The column was washed by 700 C1L of Membrane

Wash Solution (10 mM potassium acetate, pH 5.0, 16.7 CIM EDTA, pH 8.0, 80%

ethanol). The assembly was centrifuged for 1 min at 16,000g, and the collection tube was

emptied. Another 500 CIL Membrane Wash Solution was added to the assembly, followed

by centrifugation for 5 minutes at 16,000g. The collection tube was emptied, and the

collection tube was recentrifuged for 1 minute to dry the column. The SV Minicolumn

was transferred to a clean 1.5 mL microcentrifuge tube and 50 CIL nuclease-free water

was applied to the column and incubated for 1 minute at room temperature. The

Minicolumn/micro-centrifuge tube was centrifuged for 1 minute at 16,000g. The

Minicolumn was discarded and the tube containing the eluted DNA was stored at -200C.

A portion of this DNA was diluted with 10 mM Tris-HC1, 1 mM EDTA, pH 8.0, and

used to calculate the DNA concentration by its absorbance at 260nm.

Ligation and transformation of E.coli. LB plates with ampicillin were first

prepared. LB Agar, 8.75 g, was weighed and dissolved in 250 mL, and the pH was

adjusted to 7.2 with NaOH. The solution was autoclaved for 30 min at 1200C. After the

medium cooled to around 500C, ampicillin was added to a final concentration of 100

Clg/mL. Some of the medium, 30-35 mL, was poured into 85-mm Petri dishes and the

agar left to harden. The plates were left overnight at room temperature and subsequently

stored in an inverted position at 40C

The ligation was performed using the p-GEM T-Easy Vector System@ supplied by

Promega. The volume of PCR product to be used in the ligation reaction could not exceed

3 CIL. The amount required was calculated from the following equation, which assumes

that the optimal insert:vector molar ratio is 3:1:










50 ng vector x a kb insert x 3 = ng insert required
3.0kb vector 1
where a is the approximate size of amplified insert

Because of this limit in sample volume, the amount of insert actually used was less

than that recommended since the concentration of purified DNA was relatively low. The

ligation reactions were setup as follows (all volumes in CIL) in 0.5 mL tubes:

Standard Positive Background
Component Reaction Control Control
2x Rapid Ligation Buffer, T4DNA ligase 5 5 5

pGEM T-Easy Vector (50 ng) 1 1 1

PCR-product (9 ng) 3----

Control insert DNA --- 2--

T4 DNA ligase (3 Weiss units/C1L) 1 1 1

DNase-free water 0 1 3

The ligation buffer was mixed vigorously before use. The reactions were mixed by

pipetting and incubated for 1 hour at room temperature, followed by storing overnight at

40C.

JM109 high-efficiency competent cells (>1x10s ofu/Clg DNA; Promega) were used

for transformation. The following procedure was performed using aseptic technique

(sterile tips and tubes, use of Bunsen flame to create upward convection in work area).

The tubes containing the ligation reactions were centrifuged for 1 minute at 10,000 rpm

and placed on ice. Another tube (transformation control, TC) was set up on ice; this

contained 0. 1 ng uncut plasmid (0. 1 CIL of 0. 1 mg/C1L solution used) in order to determine

the transformation efficiency of the competent cells. Tubes containing frozen aliquots of

JM109 cells were removed from -800C storage and placed on ice until thawed (~5 min).










The cells were mixed by gentle flicking of the tubes. Each ligation reaction, 2C1L, was

added to a 1.5 mL microcentrifuge tube on ice, followed by 50 CIL of cells (100 CIL were

added to the TC). The tubes were mixed by gentle flicking and left on ice for 20 minutes.

The cells were heat-shocked by placing in a 420C water bath for 45-50 sec. The tubes

were then returned to ice for 2 minutes. S.O.C medium (Invitrogen Corp., Carslbad, CA),

950 C1L, was added to each tube (900 CIL was added to the TC). The tubes were then

incubated for 1.5 h at 370C with shaking (~150 rpm). The ampicillin/LB plates were

removed from 40C storage, 100 CIL of 100 mM isopropylthiogalactoside (IPTG, a P-

galactosidase inducer) and 20 CIL of 50 mg/mL 5-bromo-4-chloro-3 -indolyl-P-D-

galactoside (X-Gal, hydrolyzed by P-galactosidase to yield a blue product) were added,

and the mixture spread on each plate. The agar was allowed to absorb these compounds

for 30 min at 370C. Samples, 100 CIL, of each transformation culture were transferred to,

and streaked on, duplicate LB/ampicillin/IPTG/ X-Gal plates; for the TC, 20C1L of tube

culture was diluted with 180 CIL of S.O.C. medium, and 100 C1L of this dilution was

applied to the agar plates. The plates were incubated overnight (~16h) at 370C. Plates

were then stored at 40C for 30 minutes to facilitate color development. The white

colonies should contain plasmids with the insert, while the blue colonies do not contain

the insert since the protein-encoding sequence of the lac Z gene in the vector is not

interrupted by the insert and hence can lead to P-galactosidase synthesis and catalysis of

the X-Gal reaction.

Colony PCR and culturing E.coli with insert of interest. Two white and one

blue colony from each plate were picked by a sterile wooden toothpick, which was

inserted in a PCR tube containing 5 CIL 10x PCR buffer, 5 CIL 10mM dNTP mix, 1 CIL









PUC/M13 forward primer, 1 CIL PUC/M13 reverse primer, 0.5 CIL Taq DNA polymerase,

and DNase-free water to 50 CIL. The pGEM T-Easy Vector contains binding sites for the

PUC/M13 primers. Thermocycler parameters were as shown previously, but with an

annealing temperature of 550C (no temperature gradient). PCR products were run on 1%

agarose gel at 100V, using 15 CIL of the PCR product.

Samples from colonies which showed the presence of insert on the gel were

extracted by an ethanol-flame sterilized metal hoop and dispensed into 14 mL sterile,

round-bottomed Falcon tubes containing 4 mL of LB medium with ampicillin by

swirling. The tubes were incubated with shaking for 16-20 h at 370C.

Purification of plasmid DNA. A sample, 850 CIL, of each culture medium was

diluted up to 1000 CIL with sterile glycerol and stored at -800C. The rest of the culture

medium was dispensed in 1.5 mL microcentrifuge tubes, which were centrifuged for 2

min at 10,000g. The supernatant was poured off and the tubes were blotted upside-down

on a paper towel to remove excess media. For plasmid purification, the Promega Wizard

Plus Minipreps 9 DNA Purification System was used. The cell pellets were resuspended

in 200 CIL of cell resuspension solution (50 mM Tris-HCI (pH 7.5), 10 mM EDTA, 100

Clg/mL RNase A). Cell lysis (0.2 M NaOH, 1% SDS) solution, 200 C1L, was added and

the tubes inverted 4 times to clarify the solution. Neutralization solution (1.32 M

potassium acetate, pH 4.8), 200 CIL, was added and mixed by inverting the tubes for 4

times, resulting in a white precipitate. The lysate was centrifuged at 10,000g for 5-20

minutes, depending on whether a cell pellet was clearly visible.

One Wizard@ Minicolumn was prepared for every Miniprep. A plunger was

removed from a 3 mL disposable syringe and set aside. The syringe barrel was attached









to the Luer-Lok@ extension of the Minicolumn. DNA purification resin (7 M guanidine

HC1), 1 mL, was pipetted in the barrel, followed by the cell lysate. The syringe plunger

was inserted in the barrel and used to push the slurry through the Minicolumn. The

syringe was detached from the Minicolumn and the plunger removed from the syringe

barrel. The barrel was then reattached to the Minicolumn. Column wash solution (80 mM

potassium acetate, 8.3 mM Tris-HCI (pH 7.5), 40 C1M EDTA, 55% ethanol), 2 mL, were

pipetted into the barrel of the Minicolumn/syringe assembly, and the solution was pushed

through the Minicolumn by the plunger. The syringe was removed, and the Minicolumn

was transferred to a 1.5 mL microcentrifuge tube, which was centrifuged at 10,000g for 2

min to dry the resin. The Minicolumn was transferred to a new 1.5 mL microcentrifuge

tube and 50 CIL nuclease-free water was added to the column and left for 1 minute. The

DNA was eluted by centrifuging at 10,000g for 20 sec. The Minicolumn was removed

and discarded, and the DNA solution stored at -200C. Products were visualized by 1%

agarose gel electrophoresis run at 100V, using 3 CIL of purified DNA and 10 CIL

quantitative 1kb plus DNA ladder (0.5 Gig).

Digestion with ecoRI. To ensure that the two DNA bands seen in the purified

plasmid DNA run on agarose gel were due to supercoiling of the DNA and not

contamination, the plasmid DNA was digested with the restriction enzyme ecoRI (pGEM

T-Easy Vector has restriction sites on either side of the insert). Plasmid DNA, 3 CIL, was

added to a tube containing 0.2 CIL acetylated BSA, 2 CIL 10x buffer, and 14.3 CIL DNase-

free water, and mixed by pipetting. ecoRI restriction enzyme (12 U/CIL), 0.5 CIL, was

added and the solution mixed by pipetting. The tubes were briefly centrifuged and









incubated for 2h at 370C. The products were run in 1% agarose at 100V, using all the

incubation mixture.

DNA sequencing and data processing. The concentration of the purified plasmid

DNA was determined prior to submission for sequencing. The DNA sequencing core

requires 1.5 Clg DNA for adequate processing. Cloned DNA sequences obtained were

then compared with nucleotide sequences in GenBank using the BLASTn tool provided

online (http://www.ncbi .nlm.nih.gov/BLAST). Multiple sequence comparisons were

done with SeqWeb, while two-sequence comparisons were done with the BLASTn 2.2.12

program.

Results and discussion (part 1)

Primer pairs 4 and 6 successfully amplified cDNA from catfish liver; while primer

pair 4 amplified cDNA from proximal intestine. The size of the amplicons were

approximately 300bp (pair 4) and 600bp (pair 6) in size, with the gel-clean up system

effectively removing primer dimers and other contamination (Figure 5-2). The controls

indicated that ligation and transformation of the plasmid into E.coli were successful.

Purified plasmid DNA was obtained from several colonies (Figure 5-3), which were

denoted as L1-L8 for the liver and 11-14 for the proximal intestine. The two bands seen in

these gels, did not represent contamination, as verified by the restriction digest of the

plasmid, which resulted in a band corresponding to the vector and one corresponding to

the smaller insert (Figure 5-4).










B


3 2 1 ladder ladder 3 2 1 ladder


500


Figure 5-2. Products of PCR reaction. 1(from intestine), 2 and 3 (from liver)

A. pre-cleanup; B. post-cleanup with the gel clean-up system. 100kb ladder
shown for size estimation.










Liver


L8 L7 L6 L5 L4 L3 L2 L1 1kb ladder


S2,500


Intestine


14 13 12 I11


1kb ladder


2,500


Figure 5-3. Plasmid DNA obtained from cultures transformed with vector containing
inserts from liver and intestine.









100bp ladder L8 L7 L6 L5 L4 L3 L2 L1 1kb ladder





~3,000


600
S300








Figure 5-4. Product of ecoRI digest of purified plasmids containing liver inserts L1-L8




The DNA sequences obtained are detailed in Appendix A. The results of the

BLASTn search (best five sequences for each insert) are summarized below (Table 5-3).

Very good matches were obtained with the Tetraodon nigroviridis cDNA, as well as

Pleuronectes yokohamnae UGT I B2, several Danio rerio sequences and

Strongylocentrotus purpuratus (sea-urchin) UGT2B sequences. There was also a good

similarity between the longer insert and the mammalian UGTIA sequences.

Better matches were obtained with the longer cDNA insert obtained from the liver

(95 sequences with score >50) than with the shorter insert from liver or intestine (9

sequences with score >50).











Table 5-3. Results of BLASTn search of cloned putative partial UGT sequences
Accession no. Short description Insert Score (bits) E-value
CNSOEYO6 Tetraodon nigroviridis, full length cDNA L1 123 3E-25
L4 115 8E-23
L7 113 6E-22
Il 107 2E-20

CNSOEVYF Tetraodon nigroviridis, full length cDNA L1 123 3E-25
L4 115 8E-23
L7 113 6E-22
Il 107 2E-20

AB120133.1 Pleuronectes yokohamae UGT1B2 mRNA L7 85.7 1E-13
L1 67.9 2E-08
L4 67.9 2E-08
Il 60.0 4E-06
AF104339 Macaca fascicularis UGT1A01, mRNA L7 63.9 5E-07
BC109404.1 Danio rerio cDNA clone L7 61.9 2E-06
BC100055.1 Danio rerio cDNA clone L1 60.0 4E-06
Il 52.0 1E-03
BX005348.9 Danio rerio DNA sequence from clone L1 60.0 4E-06
Il 52.0 1E-03
XM 792456.1 Strongylocentrotus purpuratus, UGT2B34 L4 54.0 3E-04
XM792428. 1 Strongylocentrotus purpuratus, UGT2B 17 L4 54.0 3E-04


SeqWeb analysis of the sequences showed that the short inserts were almost

identical with almost all the differences being located in the primer regions and thus may

be attributed to the degenerate nature of the primers. Sequence L1 was found to be 98%

similar to both sequences L7 and II. While this implied that all these sequences are

derived from the same isozyme, this could not be ascertained since most of the sequence

differences between UGT isoforms arise from the N-terminal (substrate-binding) domain

and only that part of the gene which codes for the highly conserved C-terminal domain

was cloned.









Methodology (part 2)

The next step in the cloning study was thus to design GSPs in order to extend the

partial UGT sequences obtained so far to the full-length gene.

Overview of RL~M-RACE

RNA-ligase mediated rapid amplification of cDNA ends, or RLM-RACE is a

procedure used to extend a known DNA sequence towards its 5'- and its 3'- ends

(Maruyama and Sugamo, 1994; Shaefer 1995).

In 5'-RACE, total RNA is treated with calf intestinal phosphatase (CIP) to remove

free 5'-phosphates from molecules such as ribosomal RNA, fragmented mRNA, tRNA,

and contaminating genomic DNA. The cap structure found on intact 5'-ends of mRNA is

not affected by CIP. The RNA is then treated with tobacco acid pyrophosphatase (TAP)

to remove the cap structure from full-length mRNA, leaving a 5'-monophosphate. A 45

base RNA Adapter oligonucleotide is ligated to the RNA population using T4 RNA

ligase. The adapter cannot ligate to dephosphorylated RNA because these molecules lack

the 5'-phosphate necessary for ligation. During the ligation reaction, the majority of the

full-length decapped mRNA acquires the adapter sequence as its 5'-end. A random-

primed reverse transcription reaction and nested PCR then amplifies the 5'-end of a

specific transcript (Figure 5-5). The Ambion kit used in this study provided two nested

primers corresponding to the 5'-RACE Adapter sequence, while two nested antisense

primers were designed to be specific to the target gene.

In 3'-RACE, first-strand cDNA is synthesized from total RNA using the supplied

3'-RACE Adapter. The cDNA is then subjected to PCR using one of the 3'-RACE

primers which are complimentary to the anchored adapter, and a user-supplied primer for

the gene under study (Figure 5-5). Although 3'-RACE may not require a nested PCR










reaction, this may also be performed if no significant amplicons are detected after the

outer PCR.


5' RLM-RACE

CIP treatment to remove 5'PO4
from degraded mRNA, rRNA,
tRNA, and DNA
CIP
5'-PO4~
G--P--P--P- AAAAA




TAP treatment to remove cap
from full-length mRNA


G--P--P--P- AAAAA




reverse transcription with
3' RACE Adapter


TAP
G--P-PI-P~ AAAA ~NVTTTTT-adapter
G--P- P AAAAG---P--P--P AAAAA


5' RACE Adapter Ligation to
decapped mRNA


PCR


5'-RACE adapter AAAAA




reverse transcription

5'-RACE adapter AAAAA

IIIIII


PCR

5'-RACE adapter


Figure 5-5. 5'- RLM-RACE and 3'- RACE


G--P--P--P NVTTTTT-adapter


3' RACE










Design of gene-specific primers (GSPs) for initial 5'-RACE study. The initial

primers used for RACE were designed to be 20-24 bases in length, with 50% G:C

content, and with no secondary structure. Primers contained less than 3G or C residues in

the 3'-most 5 bases, and did not have a terminal G at the 3'-end. An online

oligonucleotide analyzer (www.idtdna.com) was used to determine whether potential

primers self-hybridized or hybridized to the primers supplied with the RLM-RACE Kit.

Figure 5-6 shows where the gene-specific primers and the primers supplied with the kit

should be positioned with respect to the DNA template.

5' RACE

5' RACE 5' RACE UGT-specific
outer inner 5'primer
primer primer

5' RACE Adapter ~10bp



5'RACE UGT- 5'RACE UGT-
specific inner specific outer
primer primer

3' RACE

3'RACE UGT- 3'RACE UGT-
specific outer specific inner
primer primer

3' RACE Adiapter


3'RACE 3'RACE
inner outer
primer primer


Figure 5-6. Primer positions for 5'- and 3'-RACE.









The DNA templates selected were those identified from the previous study, that is,

the sequence isolated from liver (L6) and intestine (14). The primers used in this initial

study are shown in Table 5-4.

Table 5-4. Gene-specific primers used in initial 5'RLM-RACE study.

GSP ID Sequence (5' 3') Start positions PCR step

GSP OUT TGCTCTGAGGTCAGGTCGAA 397 Outer
GSP INN ACAGATACCCTCGTAGATGCCA 280 Inner
From 5' end of sense strand of partial sequence L6

Based on homology with the complete sequences of Pleuronectes platessa UGT1

(PPL249081) and M\'acaca fascicularis UGTIAl (AF104339) it was estimated that, for

the UGT sequence isolated from catfish liver, this sequence needed to be extend by ~920

bp to the 5' -end, and ~183 bp to the 3'-end. Unfortunately, the use of these primers led

to sequences which still lacked the 5'-end (L15R, L25R, L35R, Il5R, I25R, I35R; see

Appendix A). In addition, a high degree of non-specific binding was noted.

Design of GSPs for succeeding 5'- and 3'-RACE study. A new batch of GSPs

was designed (Table 5-5) using different criteria than the ones mentioned above in an

attempt to improve sensitivity. Primer 3.0 Software (http://frodo.wi .mit.edu/cgibin/

primer3/primer3_wYww.cgi) was used to design primers, based on the following criteria:

a. For 5'-RACE, GSPs with a GC-clamp at the 3'-end in order to reduce non-

specific binding were used,

b. The outer and inner primer melting temperatures for the GSPs were within a

degree of the RACE kit supplied primers,

c. For 5'-RACE, the inner primer was long (~27 bp) in order to reduce nonspecific

binding, and











d. The primers were designed to anneal close (50-75 bp) to the existing 5'-end to

avoid large overlaps.

Different sets of primers were designed based on the cDNAs obtained by the study

involving the degenerate primers (I4) and the initial 5'-RACE study (I3 5R and L25R).




Table 5-5. Gene-specific primers used in succeeding RLM-RACE study


GSP ID


Sequence (5'-3')


RACE Start' PCR step


(a) Liver L25R

UGT 50UT1
UGT 50041

UGT 30UT1
UGT 3IbW1

(b) Intestine I4
UGT 50UT2
UGT 50UT2A
UGT 5INN2
UGT 5HOWLL

UGT 30UT2
UGT 30UT2A
UGT 3HItz
UGT 3HOWLL


ATTGGGCATTACAGGTCTCG
CGAGGACGTCTCTGAACGTAACATCC


119 Outer
51 Innel

320 Outer
351 Inner


GATTCCTCAGAGGGTTCTGT
GGGGTCATTCCCAAAGACAT


GCCGTTACAGATACCCTCGT
GTATCGCCACAGAACCCTCT
ACACGAAGGAGCTCAAAGTGAACACG
GCCACTTCATCACTTTGACATTTTCAGG


Outer
Outer
Inmer
Imler

Outer
Outer
Imier
Imier


AATGTCAAAGTGATGAAGTGG
GACATTCCTGAAAATGTCAAA
CCCAAGGCTAAGGTGTTCATC
GACCTCTTAGCACACCCCAAG


(b) Intestine I35R


UGT 50UT3
UGT 50UT3A
UGT 5RIN3
UGT 5HIthk

UGT 30UT3
UGT 30UT3A
UGT 3DIN3
UGT 3INN2A


TGTTAATGACCTTCGGTGTGA
ATGACCTTCGGTGTGAGTTTT
AAACCTAAGAGGTCATTCTGCGGAAGC
ATGGGGACCGGGTGTCTATTTATTACG

TTTCCAGCTAACACTACTTGG
TTACACGTCCTCTAACCGTAA
CCCAAGGCTAAGGTGTTCATC
CCATGGCATCTACGAGGGTAT


Outer
Outer
Innel
Imier

Outer
Outer
Innel
Inner


SStart position from partial DNA sequences obtained so far









5' RLM-RACE procedure

Calf intestinal phosphatase (CIP) treatment. Total RNA (not DNase treated) (2

CIL for liver; 1 CIL for intestine), 10 Gig, as well as 10 Clg of control RNA (mouse thymus)

were gently mixed with CIP buffer, CIP, and nuclease-free water in a total volume of 10

CIL. The mixture was incubated at 370C for 1 hour, and terminated by the addition of 15

CIL ammonium acetate solution. A 115 CIL volume of nuclease-free water was added,

followed by 150 CIL acid phenol-chloroform. The mixture was then vortexed thoroughly

and centrifuged for 5 minutes at room temperature and at > 10,000g. The aqueous phase

was transferred to a new tube, 150 CIL chloroform were added, and the mixture was

thoroughly vortexed and centrifuged for 5 minutes at > 10,000g. The top aqueous layer

was transferred to a new tube, 150 C1L isopropanol were added, followed by thorough

vortexing and chilling on ice for 10 minutes. The mixture was then centrifuged at

maximum speed (16,000g) for 20 minutes. The pellet was rinsed with 0.5 mL cold 70%

ethanol and centrifuged for 5 minutes at 16,000g. The ethanol was carefully removed and

discarded, and the pellet was allowed to air dry (but not completely). The pellet was

resuspended in 11 CIL nuclease-free water and placed on ice. At this point 1 CIL of the

CIP-treated RNA was reserved for the "minus-TAP" control reaction. This RNA was

carried through adapter ligation, reverse transcription and PCR in order to demonstrate

that the products generated by RLM-RACE were specific to the 5'-ends of decapped

RNA.

Tobacco Acid Pyrophosphatase (TAP) treatment. CIP'd RNA, 5 C1L, was gently

mixed with TAP, 10XTAP buffer and nuclease-free water in a total volume of 10 CL.

The mixture was incubated at 370C for 1 hour.









5'RACE Adapter Ligation. CIP/TAP-treated RNA, 2 CIL, and 2 CIL of CIP-treated

RNA (minus-TAP control) was gently mixed with 1 CL 5'RACE adapter (5'-

GCUGAUGGCGAUGAAUGAACACUGCGU7UUGCUGGCU7UUGUAA-3) 1

CIL 10XRNA Ligase buffer (before use, the buffer was quickly warmed by rolling it

between gloved hands to resuspend any precipitate), T4 DNA Ligase (2.5 U/CIL), and

nuclease-free water in a total volume of 10 C1L. The mixture was incubated at 370C for 1

hour, after which it was stored at -200C.

Reverse transcription (RT). Ligated RNA, 2C1L, or minus-TAP control were

gently mixed with 4 CIL dNTP mix, 2 CIL random decamers, 2 CIL 10XRT buffer, 1 C1L

RNase inhibitor, 1 CIL M-MLV reverse transcriptase, and nuclease-free water in a total

volume of 20 CIL. The mixture was incubated at 420C (or 500C, see results) for 1 hour.

The reactions were stored at -200C.

Outer PCR. Each tube contained: 1 CIL RT reaction, 5 C1L 10XPCR buffer, 4 C1L

dNTPmix (4 mM), 2 CIL gene-specific or outer control (reverse) primer (10 CIM), 2 C1L

outer (forward) p ri mer ( 10 CM) (5'- GC TGAT GGC GAT GAAT GAAC AC TG-3'), 0.2 5

CIL Taq DNA polymerase (5 U/C1L), and nuclease-free water in a total volume of 50 CL.

A minus-template control was also included to ensure that one or more of the PCR

reagents was not contaminated with DNA.









Thermocycler parameters were as follows (Lid heating at 1100C):

Step Stage Temp/oC Duration/min

1 Initial denaturation 94 3
2 Denaturation 94 0.5
3 Annealing 59 + 21 0.5
4 Extension 722 13
5 Final extension 72 7

35 cycles of steps 2 4 were performed
1,2,3 These parameters were frequently changed to optimize the PCR. The values given
above are representative of parameters used with the GSP_OUT and control primers.

Inner nested PCR. A mixture was prepared, identical to the one for outer PCR,

except that the DNA template was now 1 C1L of the outer PCR, and 2 C1L each of both

inner primers. The sequence for the inner 5'RACE primer supplied with the kit was 5'-

CGC GGATCCGAACACTGCGTTTGC TGGCTTTGATG -3'. The thermocycler

parameters were similar except for the annealing temperature, which was typically higher

than the one used for the outer PCR.

3' RACE procedure

Reverse transcription. The following components were assembled in a nuclease-

free microfuge tube: 1 Clg total RNA (DNase-treated) from intestine or liver or control

(mouse thymus RNA), 4 CIL dNTP mix, 2 CIL 3'RACE Adapter (5'

GCGAGCACAGAATTAATACGACTCACTATAGG T12VN 3'), 2 CIL 10XRT buffer,

1 CIL RNase inhibitor, 1 C1L M-MLV reverse transcriptase, and nuclease-free water to 20

CIL. The reaction was mixed gently and incubated at 420C or 500C for 1 hour.

PCR. The procedure for the outer and inner PCR was similar to the one performed

for 5'-RACE, the only difference being the GSP and the kit-supplied primers used. The










sequences for the letters were as follows: Outer 5' -GC GAGCACAGAATTAATACGA

CT-3', Inner 5' -CGCGGATCCGAATTAATACGACTCACTATAGG-3'`

PCR amplification of entire UGT gene

Elucidation of the complete gene sequence for liver UGT from catfish by RLM-

RACE (via partial sequence overlap) enabled the design of gene specific primers which

are complementary to the gene itself as well as the untranslated region. The primers used

are shown in Table 5-6. All primers complementary to the untranslated region (UTR)

were designed with the help of Primer3 software, except for the pair of primers that were

complementary to the exact start and end of the gene (LIVUGTF1 and LIVUGTR1

respectively).


Table 5-6. Primers used for amplifying liver and intestinal UGT gene

GSP ID Sequence (5' 3') Start position

UTR Fl CTGCTTCCTCTAGACGTAATTAGAAAC 40
UTR F2 CTCACATTCCTCCTCCTTCTTTTT 76
UTR R1 GAAC GT GGT GAT GAGAACACTATAACT + 121
UTR R2 TAGTGACATCATAACAACCGTAACTGC + 190
LIVUGT Fl ATGCCTCGTCTTCTTGCAGCTCTCTGT 1
LIVUGT R1 TCACTCCTTTTTGCTCTTCTGAGCCCT 1568

Due to the length of the amplicon (~1.6kb), Super Taq Plus polymerase (Ambion

Inc) was employed. This enzyme results in higher yields with amplicons >1kb. In

addition, this enzyme mixture has a proof-reading ability, which will be important for

future expression of the gene, as well as providing greater fidelity and processivity than

ordinary thermos Taq DNA polymerase. An extension temperature of 680C and an

extension time of 1.75 min were used for this PCR. Different combinations of UTR