<%BANNER%>

Studies on the Entomopathogenic Fungus Beauveria bassiana: Molecular and Immunological Characterization of Allergens

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110209_AAAABM INGEST_TIME 2011-02-09T06:49:53Z PACKAGE UFE0015542_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 1051959 DFID F20110209_AAAHNN ORIGIN DEPOSITOR PATH westwood_g_Page_074.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
014a8d822bb06f78c1171ec6d2047407
SHA-1
dab1dbcc68465b78e3131b34242c72af87809ebb
96965 F20110209_AAAHIQ westwood_g_Page_063.jpg
58a145a3728564f88dfe260cde27643d
fc9bf62f5eea3346a89d67d9c1d7cad2e1be7c2c
1705 F20110209_AAAHDS westwood_g_Page_055.txt
b5fdb794e2c04683d02797589f87d33c
f952111250d8a47273aa8e0a73dced58edc59391
30046 F20110209_AAAGWV westwood_g_Page_069.QC.jpg
bc7f2a8fdc36b18727abfca130af9606
dcc8ebd3daf6e502b9dfc3828dfb93874d658295
1051924 F20110209_AAAHNO westwood_g_Page_076.jp2
4d2380574cf1663c988fe68530e117d3
0949fb97e2b801f8bb7231ccec6d80fe630797a4
1758 F20110209_AAAHDT westwood_g_Page_056.txt
4a5c50555edfd03a20c880aaf0b19f39
ca0146fca3589b038cd91fe779691b7a7e7dcd10
2050 F20110209_AAAGWW westwood_g_Page_039.txt
af5960364af64cccb2cff142d6c27e65
c682c95428281823461e7a78a29fe732517c47f3
1051984 F20110209_AAAHNP westwood_g_Page_077.jp2
e430fd96c131614b1b23ac11656bc1fb
0989694ab22da45612839fb5f8dd7af6c82c36ac
31673 F20110209_AAAHIR westwood_g_Page_063.QC.jpg
94773c779d974d61651ad2957a6b6bd7
d2e4508dc6bd9904a2f72531df630a9c2844e3d1
1976 F20110209_AAAHDU westwood_g_Page_057.txt
a9fdd8f5b11dbb969cf94aa18b090266
468d8d80ce63eb7e233e5d5830a3c69bc2122279
1051979 F20110209_AAAGWX westwood_g_Page_103.jp2
f8faf108a1671482f01d7a1d839af372
a17b8a4594c5015248e59298ca2feec3506216bf
696131 F20110209_AAAHNQ westwood_g_Page_078.jp2
dfe920355d7a95c62df0eca6a4274a15
a2b86952183730602c15581bd1f7f731895fc532
102524 F20110209_AAAHIS westwood_g_Page_064.jpg
05bdf8d9c3adae9daacda196a27b26d8
aaf30116f60875eab5e2e1430c260bb8703e3ad8
1807 F20110209_AAAHDV westwood_g_Page_058.txt
6462a9d048f670a7fa30db8731c61557
189dcece8fdc2d72ac444f3b0f0b15797b58881f
1051946 F20110209_AAAGWY westwood_g_Page_096.jp2
b44e29074dba79a114834a5c8aa8a272
bac9836c81f8525d34d9bd4dce01dd8324cf4c04
824986 F20110209_AAAHNR westwood_g_Page_080.jp2
72b7c79aff16f07a6bc9abdabc4ed209
b0621132761cead94241cb4f941c5201cf684102
34519 F20110209_AAAHIT westwood_g_Page_064.QC.jpg
915d8e4ae393b584802e699d9bb6401b
a5c6e95315c99e99ec197cad33963e6dcd4bf0b3
1744 F20110209_AAAHDW westwood_g_Page_059.txt
ef71137da42a9e8380fe4f57590b5a57
cc400df21171a58bacae53d5b7b0ba02cbee4b88
7130 F20110209_AAAGUA westwood_g_Page_056thm.jpg
fb5d16629dea10a0505fe5ab4ac2c348
69492f6e01bcc34bae9819739232b7db04b57e25
8306 F20110209_AAAGWZ westwood_g_Page_049thm.jpg
b97d5ab5b05dc4d79dfd2683a9cf744c
27d03c1fbef8e0dba97ef3cb9cc90e54951baf9f
663609 F20110209_AAAHNS westwood_g_Page_081.jp2
b462d22bde1e69b0754d5918f4ab04d0
239e13127037a745fa52067cab2f1d20a28078f4
99842 F20110209_AAAHIU westwood_g_Page_065.jpg
cf4b77c5fd26a1d912d47600978332f2
9f457a5f996d8d8efa98f38f9b47bab5f8af629b
1941 F20110209_AAAHDX westwood_g_Page_060.txt
e3299b5d8e72d35c46fa1379ce96a75e
a17451d724e52fcf7fff30d6f7d6be6889947cf5
33427 F20110209_AAAGUB westwood_g_Page_052.QC.jpg
4329b861a9304d13677510869ade1117
7d9c9a0d2c0a8321169183bb9e27cf2d5030c2f1
729983 F20110209_AAAHNT westwood_g_Page_082.jp2
69d5edf739e93b26edb7b60c86e3dc11
33a75520f9bea4d4d6943f40cda6328ae8b12b3a
32251 F20110209_AAAHIV westwood_g_Page_065.QC.jpg
98072cec85b34c92c2872d310361958e
06e57cae7e1ad7236babefac60bd1a8691b59c61
8423998 F20110209_AAAGZA westwood_g_Page_002.tif
0f1eb3279f90a052d1ceafdc08fbf4ca
a1205ae4268137a1a9a433f0c81ee043d5fb1424
F20110209_AAAHBA westwood_g_Page_071.tif
c297b413bdba90742e76de68671e6f40
0a198370e0af006dcba93b7fcc1f87e13a882cd8
1775 F20110209_AAAHDY westwood_g_Page_061.txt
f68a626e9af4966dcf443290742d2301
85d7cae263cc6e76dbced8ea8e92bf823a93e7d6
1051948 F20110209_AAAGUC westwood_g_Page_016.jp2
2a4279d19549b3cbc06a41643ca21f26
92a82256d6959ee8ab7e8a249acb19cef2ea6bb6
562368 F20110209_AAAHNU westwood_g_Page_083.jp2
500052f41207f722bbd1c4fc7ab4e6e5
28e1883b9f1bb857300963a4b58a09a6ef112d3b
91490 F20110209_AAAHIW westwood_g_Page_066.jpg
23ed744321c0fa12f8a775f942913115
bf6c9273d291554256b2701d4cbe701479a592e0
F20110209_AAAGZB westwood_g_Page_003.tif
075d30b878eb67f3526816291d6ab947
60098f0bd32a029177e3f3c27140d6b5b98d85a0
F20110209_AAAHBB westwood_g_Page_072.tif
9b422ff29b69896f04ad253e1884692d
d28e3d8284635d11b1f78411a2ddc1bf95c995ee
1978 F20110209_AAAHDZ westwood_g_Page_062.txt
bad7639baedc94cc96fd5a2a561d0bef
1643885dc3f9d3653eac3d10aea99efa1b7a6568
F20110209_AAAGUD westwood_g_Page_103.tif
c8fcdbe55b80b8166c83af071bb803bd
20c2f21787c5dceed8cb32b3498c6d1e7bcb7988
999690 F20110209_AAAHNV westwood_g_Page_084.jp2
0218006f0fb5b3ebd85a216e670aab69
10434474e89203f1f680e3cd33f7bae2a3d53e0a
29609 F20110209_AAAHIX westwood_g_Page_066.QC.jpg
de397a48ac271dc1c466735373bda686
076d8fd459e2a289def4d581fa1cd5f07e6b4452
F20110209_AAAGZC westwood_g_Page_004.tif
28e6324c45e182953aca9c3ba8dcda5f
2a024142e5c87141cd5388a5179b20354f213840
F20110209_AAAHBC westwood_g_Page_073.tif
5f4fb6303c83db2dbd45e2dc434ece13
24eb3bcb4e34b69bfe7c780d5fb967b05f0d2fde
F20110209_AAAGUE westwood_g_Page_024.tif
7ce48ac8d41e5007104df6f5423abef7
7cd6150d88c7b8de14c383c1b88299cd3d048b43
96478 F20110209_AAAHIY westwood_g_Page_067.jpg
ad329f613a78f17fe34158ef7b4bdfae
b44379265252d11e3573564e1f5b14332d456482
F20110209_AAAHBD westwood_g_Page_074.tif
519ca52c3e4ae0c4f8b4194af30c3cce
c37c252d9fc790a854ea45546f5f7f37da92e8f2
16730 F20110209_AAAGUF westwood_g_Page_089.QC.jpg
2d4358b56759f1def44b63327b97fe12
adec6549caf5881de9e85dae1f52daebdfd2850f
33890 F20110209_AAAHGA westwood_g_Page_020.QC.jpg
05d97fcdce2439911b620d5aa0d9ca0a
8c11bdac3c1433d05b41e71907b8cdea5807cb43
F20110209_AAAHNW westwood_g_Page_085.jp2
44b4d3d3a560e2375e8da0a34b438d91
269b328bbd0b12d4ffe40e16bfeb86d0c621235a
90213 F20110209_AAAHIZ westwood_g_Page_069.jpg
4af15747514996daab955e577c2b0512
5cfcf170d92f76cba3801f131d7c5eeb24f935df
F20110209_AAAGZD westwood_g_Page_005.tif
be65b25d5c9f64386a45f2569ae0e28f
eaa1745e4032a70d3acab8dad2b95d91d1871eba
F20110209_AAAHBE westwood_g_Page_075.tif
8106c9db179e568f5e61cd45ae458e70
4cd8b1b96582a96f29f386a1fd105d68e36fd5f0
100526 F20110209_AAAGUG westwood_g_Page_030.jpg
e51af8659591d6014f57c1ecf51f2293
69775d1d5de6f182abacec166b96b9a3dc65aa88
100389 F20110209_AAAHGB westwood_g_Page_021.jpg
3abe025396cc73411b4407fe530ce375
7186cc09f9a733baa11ce58ec9245775b1e573fe
1051977 F20110209_AAAHNX westwood_g_Page_086.jp2
e7b85c8967951d3d458df9e3525ac858
8f8b0b156aa12b86dba4b6df688b2b824fc2f27a
F20110209_AAAGZE westwood_g_Page_006.tif
f14955e7409dc32244b397d9a9d098d3
385202401760926fb1974552b9075d3e91736a59
F20110209_AAAHBF westwood_g_Page_076.tif
e34810a4751428a7e5f840ba4c32735d
323adb9ad26bda769910590bb3296cb7c2ba2166
35644 F20110209_AAAGUH westwood_g_Page_101.QC.jpg
7ea61e55d67ccd3211d3418c30d2e014
33d555cd1db292eac69ac5000f39f0177df63134
32715 F20110209_AAAHGC westwood_g_Page_021.QC.jpg
1c8709a17e97465fe4de3a68083d4024
1e08c918e63817ce574192ddcdaaf80d0e90c3be
810049 F20110209_AAAHNY westwood_g_Page_088.jp2
53accad27e46805eecf8f6df230cf0df
c985f71bba55d0c3715370c7ff7183a3064ceb70
30585 F20110209_AAAHLA westwood_g_Page_100.QC.jpg
b60bd9c494c5bd46038b77cdf099a8a4
985fe916f1a7eac50d8255ae305db3d9d3e74181
F20110209_AAAGZF westwood_g_Page_009.tif
e0241c72cdf3813b03b124c0ef23cab6
1764a70db324a4fe0a38a9fd03013e410a4e25c8
F20110209_AAAHBG westwood_g_Page_077.tif
8714e21b7a58cfe67c0b830b9c1cf093
0c2dee19009f14b6aa84c4fd6702d7665d9c7c5c
5452 F20110209_AAAGUI westwood_g_Page_004thm.jpg
2be3791509eb493541e72767963a2c09
7b09f9ab5c64678dc7ba31d3b901b2406737bf5b
100416 F20110209_AAAHGD westwood_g_Page_022.jpg
b35969a36628db9ba2877ab9ff480a79
ddb3af3bc61c02a120b0fe1c2d94252de6c70537
485743 F20110209_AAAHNZ westwood_g_Page_089.jp2
ca336694ac48db378366d485722a2861
11a59acce529736fa3332690a2207b19b80131fe
129506 F20110209_AAAHLB westwood_g_Page_102.jpg
9bcd5ffe31bc334001d7cfb923d3c885
c63ac00f7dc29095820d13335ea7a96b26e73f12
F20110209_AAAGZG westwood_g_Page_010.tif
dfbad4a2788878027f23d30205411c4d
4e0b6124a473c83f117c4d83e40847f6acd1b5ac
F20110209_AAAHBH westwood_g_Page_078.tif
f4107391efeb5206c7e330137a1fbf71
b94ae78ed13f621eea54706046bcae4c92cdc4c4
8260 F20110209_AAAGUJ westwood_g_Page_065thm.jpg
4bf08d718bbb38e2095d1064f57ec620
5ec9671555941507c01ef2e996747820ce222bb0
102365 F20110209_AAAHGE westwood_g_Page_023.jpg
32b7eac2190d6e53091157a602562019
fa61e41614819c3b02f1cb6219ae68a50fc7207d
122322 F20110209_AAAHLC westwood_g_Page_103.jpg
5f3224ace09270cbeedeae0459773d19
1ccc176d46eaaf5765ef4b990ff1038392bae83a
F20110209_AAAGZH westwood_g_Page_012.tif
84f7aa80e40befcf6d2ef8a12110759b
e07b7d52132ac08c45d0bdcae25438fdc9ac4aeb
F20110209_AAAHBI westwood_g_Page_079.tif
a550576175432a09575eabc2e369d223
f5922131d94d8a5078f1b4d2c0cff54a710a74cd
1617 F20110209_AAAGUK westwood_g_Page_007.txt
f75e00bf36d2e8a4f6cd787ad8b92ed2
540fdb728cf8432b95e9a3503f58e62d531182ba
33067 F20110209_AAAHGF westwood_g_Page_023.QC.jpg
b6b55ad1de834ab7adfefaacb62a6eb1
e0739f7abbe027e1d3ec273b2ab544f6b8de4da0
7832 F20110209_AAAHQA westwood_g_Page_059thm.jpg
e8fe14e8aa76535d4c75ca57b98755fc
79ae6b71495209c97ba6b3de28503c7ea2b50304
34142 F20110209_AAAHLD westwood_g_Page_103.QC.jpg
501f0d8a58ef1b1e3fb776d11d76a8d0
0f7676c2ea801f050574b5ba6379daa2bf403f62
F20110209_AAAGZI westwood_g_Page_013.tif
a62786570c88925ad9f451bd23d6332b
8019d0fede0fb423063cf4701105172dc041eb31
F20110209_AAAHBJ westwood_g_Page_080.tif
cc0989435585298aac27ae35d83d747e
034a43ce3ecbd460c7eb717b6e082981fa71010e
1051949 F20110209_AAAGUL westwood_g_Page_087.jp2
420d233765c88f91073e2b20d6731862
792b6592accb01b4c302f81f7cd3092ecc623bce
99342 F20110209_AAAHGG westwood_g_Page_024.jpg
b659f2d696856249d38a65b248271a4e
a5e91d0e55c8b8aee13035e5e4e74073c6d51669
8457 F20110209_AAAHQB westwood_g_Page_060thm.jpg
19c6c8c39473d42cc6c7b2cc1f58fd97
23c4ae66eb35904667b55ad943c42a65ce76df6d
81946 F20110209_AAAHLE westwood_g_Page_104.jpg
ddf9a03f1e69702debe09121d07a99d6
4aba242e3cda9773019b74e78ab5a618c62ca4b0
F20110209_AAAGZJ westwood_g_Page_015.tif
7b8948112ba790afd332899a9a00ae48
e4b762ae1fe5e377105beba6b897ea11628943d8
F20110209_AAAGUM westwood_g_Page_098.tif
520ab26781e1b1c1ea8c852516a96818
8bb754893af750deea2dd18135bde36d4d2db8dc
98161 F20110209_AAAHGH westwood_g_Page_025.jpg
48f4d36564ad0b5f3676ccae7d891e2d
62434264a8f52a017dac78c19981d091d1967372
7742 F20110209_AAAHQC westwood_g_Page_061thm.jpg
56bbdfbf208dbf166f554d9093bc1bb8
94d58d9ef8a1db8b6fcdd783fbea78fdb03670c0
23896 F20110209_AAAHLF westwood_g_Page_104.QC.jpg
3bf45a11900848153b471bf31412b876
69380cbd99dcf7f199c13d3ee2f1f282e4ee629a
F20110209_AAAGZK westwood_g_Page_016.tif
66d636909312c105b53247411bf1ded4
bc76f743147a89eadb0c1ce8e504f160b355b34b
F20110209_AAAHBK westwood_g_Page_083.tif
ee1df964584e296f63a59e9896a7f062
62d46b4145c236fa746f236254f1093ec555345c
1243 F20110209_AAAGUN westwood_g_Page_089.txt
af2193aaf2fe33b95920afbe78baecee
c082180d4be15a3939abb90dee3f30e5d455e9cf
31359 F20110209_AAAHGI westwood_g_Page_025.QC.jpg
6ab075d67bc1e3b200b6aab2ded84c1d
9efa29808d86b717060e092d98914e9b93d150c7
8185 F20110209_AAAHQD westwood_g_Page_062thm.jpg
25667ac3ad7e1a7aa772c2574b8a647d
46dd9c30dc6cb994f5ec541d84bf747c87be99e1
71658 F20110209_AAAHLG westwood_g_Page_105.jpg
a498f14de73d4b1784ac2ef94123998a
c50307c55e6edf39f78d66374ac4d2cabc0b4884
F20110209_AAAGZL westwood_g_Page_017.tif
e79019cd80caedc0a4e2dff22028eb27
790be38d86dbdc16db7307fa000559b0ce5c9990
F20110209_AAAHBL westwood_g_Page_084.tif
617ce9b2054446bc6c32af7d7f5d439a
15e1e2cb76f160fd10d3eb02a906f803970387bf
8539 F20110209_AAAGUO westwood_g_Page_020thm.jpg
e0bbcd824ec0a360397cbadd412cb6d6
03ac289891ae5dc68f5d632580f37183c05b9c8e
102663 F20110209_AAAHGJ westwood_g_Page_026.jpg
827755e3416652e0149f8a783c09b00a
a6252c4815dde36121e332791cad10e2e5454800
8071 F20110209_AAAHQE westwood_g_Page_063thm.jpg
8661e21836df20cc2e56a309be73dc5d
4a41a13825a9e215dcc40a3306aabc691efec4d1
23498 F20110209_AAAHLH westwood_g_Page_105.QC.jpg
69a3bf6de247e880ab43ad9275e4b0d4
f54cc18a6f0ff324a7536d9284e1cff8715c5a82
F20110209_AAAGZM westwood_g_Page_019.tif
7b092e3168a5d199b55eda33aabc0458
ef6792d665db5c7ddd21037b702a5dbdfd704eac
F20110209_AAAHBM westwood_g_Page_085.tif
4b8e5c80151e5c30e90190756603c557
36c92723febe69c0f2990329fcf1907c9628aff1
1051972 F20110209_AAAGUP westwood_g_Page_027.jp2
cfb2572cec639b68cb69923d1fb235b6
159538323cf526328c1c6cb2d31b2cc655b48f47
32966 F20110209_AAAHGK westwood_g_Page_026.QC.jpg
c38789f2319a0afd0f224ecfc74f3ac5
378ea24b4fba2e16a89a9495ffe42d25f7a5dd9b
7487 F20110209_AAAHQF westwood_g_Page_066thm.jpg
fdf884d747b269614c18f1ad007d626d
7e6ebc38aff50707989aa27a8dc814dd62f2c327
274044 F20110209_AAAHLI westwood_g_Page_001.jp2
672cd98567752f0b5033a6e512e13a97
33922e43d44d45b3259a4b263ae8e97b993d9303
F20110209_AAAGZN westwood_g_Page_020.tif
1f6e5d78a966544aaeb4b8851fd413c8
7369cf8cee3aab57c1e03807c9254c28b381ea3f
F20110209_AAAHBN westwood_g_Page_086.tif
e30fa66f766a393c09c12e3d9770ff53
12c00be2967d640dc7bdfd7c285dade05d6390d4
855143 F20110209_AAAGUQ westwood_g_Page_014.jp2
e70cc8526be0fc842a01503273156ce5
1ad17628788c287b348b0aa3ba238deae43d364f
98307 F20110209_AAAHGL westwood_g_Page_027.jpg
f869706ec13a296505c104cb96d81cb1
7c669fd81d0c4b6c2a030871ed9d099ecccceb48
7812 F20110209_AAAHQG westwood_g_Page_067thm.jpg
cad121fa6079bafda1d6c323607fe642
48039f01b0aaf4b5a1cf532f7467eaec83b23a3c
29423 F20110209_AAAHLJ westwood_g_Page_002.jp2
c30622f17010bbb62e918d5b905657ff
73d57b2d2deb4833ce23a0714eca52f56da08429
F20110209_AAAGZO westwood_g_Page_023.tif
efaeff9c0db0bf0b62c8b692d8011889
c9bad02e45e44c75d85ed134552dd819066cae3f
F20110209_AAAHBO westwood_g_Page_088.tif
34fd42198251bfd797f8a6e5ee5fdbca
3176742e77f03ee7090dd0b00e81305d6f3e93bb
32470 F20110209_AAAGUR westwood_g_Page_068.QC.jpg
30a6c040f4cf9c0136161d7ec37e88aa
0a80f89864ef010b63df616c0acdbb8c6b46caba
32117 F20110209_AAAHGM westwood_g_Page_027.QC.jpg
6ae63f14ba04783f96adf7df84ba81ad
e36e0a6da96b56a3fab143bc5eaf12c0ead1c782
8142 F20110209_AAAHQH westwood_g_Page_068thm.jpg
dbd0db3a909b643ab1995cdf3373acec
a6d3ad05b36473267adc3775c9df499c44893a05
35462 F20110209_AAAHLK westwood_g_Page_003.jp2
e224df15f1e16dfbdc78533c17a3a97e
212e709a3ff4cf9e481b643058688587fba32810
F20110209_AAAGZP westwood_g_Page_026.tif
e24d7754a54d7585abf30be42c7bb86a
b3c2a97a7fdd008c0a34d2a5c9ec8774f1c2978d
F20110209_AAAHBP westwood_g_Page_089.tif
bb310b33f4a9817796f53f1e1ee48d41
dfca48cb0255484b386a962e94ed7000608bfcb3
436010 F20110209_AAAGUS westwood_g_Page_007.jp2
e533dc105176a62c874cf97ec2b67922
0bbb78bb9ad828307dbcdf9f63c7a8b8ddd32785
33169 F20110209_AAAHGN westwood_g_Page_028.QC.jpg
4c9b86823a8b76f95abf53b340dd970f
1a18c636fde861ca9a615c6dad2bce561e3d0994
7187 F20110209_AAAHQI westwood_g_Page_069thm.jpg
76699008e51614c70b507d89127d363f
73678ff9c145d6ad7e1e2a54b1092d048dde41a1
706893 F20110209_AAAHLL westwood_g_Page_005.jp2
b282df3b5669c9451c76878e58bccdbb
6c0e0a2c1e18a3b527ccdafe3e4b8663f2eedc03
F20110209_AAAHBQ westwood_g_Page_091.tif
4fc475cfb52ff75b55dc637cc8e27797
1c1feac5472468023217269bac2b3e329082e9fa
119697 F20110209_AAAGUT westwood_g_Page_098.jpg
b1db3a4713f8628d5959a990d23e4dfe
970eba4b1d97d5f7a64487ed4ca93e5fa438a437
103149 F20110209_AAAHGO westwood_g_Page_029.jpg
b01b2d91782721f59e9e1120beca3ba9
148eb576eb23973c3009ce25f12e64db0772c6e4
F20110209_AAAGZQ westwood_g_Page_027.tif
30c2846475b3735250090f738e5ab095
57d87c4e4cfb4c6c64b5523a211ef81661f446f0
7789 F20110209_AAAHQJ westwood_g_Page_070thm.jpg
81508720b735d219c10b1ae077783e51
62891e5b3e26ace1e87bebad88591404a7947498
1041611 F20110209_AAAHLM westwood_g_Page_006.jp2
1328e8b2db924426f1f209f0a231d8e7
99d3917fcac3525d2abefa930c1304a222fa1d1e
F20110209_AAAHBR westwood_g_Page_092.tif
58adcd8646005acfe8484f6b10f7c291
eade35d35ff1b93b0409f5a6fdf50c65329605b9
1980 F20110209_AAAGUU westwood_g_Page_085.txt
7b253057b5d83a76acd38df3df426779
8426f22dc27647e46b94091cdb5c725c2255d96b
F20110209_AAAGZR westwood_g_Page_028.tif
bb31e883d53064caffd049c6a2144a0d
2b533eee2f3973a94db487e4bf39c7694f429ca3
5921 F20110209_AAAHQK westwood_g_Page_071thm.jpg
da6688f3790008d338477a1e757630a3
2e45121de12fb885e164962b41d956030d46a258
783457 F20110209_AAAHLN westwood_g_Page_008.jp2
5d30393ab3829a766f904f5087a9e654
52213221788fd17115cca3d66a9beba6fee65a22
F20110209_AAAHBS westwood_g_Page_093.tif
238430b8220d97a03d087e8dcb89c2fe
d41801afd40af2726403627b9bf8ed1bfa773a63
1051985 F20110209_AAAGUV westwood_g_Page_097.jp2
5489b31a09cfbc53a6a9fbfe10209b9b
613d6b23506a62ea814ae4ba3255b93054bd9384
33010 F20110209_AAAHGP westwood_g_Page_029.QC.jpg
a3bdfc3846a8ba0089cbc74319902e65
a4ce2f96a4b03164288060001b356cfbf2f61a51
F20110209_AAAGZS westwood_g_Page_029.tif
aa3fc9b19e3aaad2eac581ccb3bd511e
a7aa517de92fbf64a20d1b5d5cbade72cfe46344
6939 F20110209_AAAHQL westwood_g_Page_074thm.jpg
99223f32c08e0c59843f5bcc9b841e90
803dedae6736d206274004d6cfba16586b2cd2a2
379246 F20110209_AAAHLO westwood_g_Page_010.jp2
7260c6f761ef689ec180ea74640e3160
d1279f8e7ed5185a28eb9f48afffb0d8837323be
F20110209_AAAHBT westwood_g_Page_095.tif
ab0114e47ba1b72db3a42ea1a6b1c8cb
50b4eea432f8151228bb17b28ce7be90f6f7225d
3852 F20110209_AAAGUW westwood_g_Page_072thm.jpg
c67cb77dd308207c5c69500836432aa4
cd3b13905b8c9c6de406da6c70d392795004ed60
32842 F20110209_AAAHGQ westwood_g_Page_030.QC.jpg
2be51fa6d6f6646de4638fcf9c395538
dd632cf15b32be71f1c30b7dddb1931004acbe25
F20110209_AAAGZT westwood_g_Page_031.tif
57604e1f36eadd6f54b67eb4e4aa05ab
f4d5b5624fbeffe6c05dc64a26b492bdeb63366a
4875 F20110209_AAAHQM westwood_g_Page_075thm.jpg
cf7d75fbdcdf15f5ecc54edc8d08cebc
f1207e02a3b5eeff20d608efd3abd8ee27a5c265
337753 F20110209_AAAHLP westwood_g_Page_011.jp2
5c205d04ca1a92502371ff6106806a50
1793daf597a21aca81eb30e9c1ed4a8403b3dd30
F20110209_AAAHBU westwood_g_Page_096.tif
3beebda3a492eeed776f4df3e1b1589d
a04fd61aa09a17539ec377d77856c742eb437379
7261 F20110209_AAAGUX westwood_g_Page_045thm.jpg
1193ac55045995fb0e3de8e86492b0c8
8c26eafc9418d7d5c2bf81edd9fe52e1d5519b9b
99514 F20110209_AAAHGR westwood_g_Page_031.jpg
d3c41944e32027254f34df92972f578d
b92b0a8f824aab49ea26b17b6d3714ae204a6eb7
F20110209_AAAGZU westwood_g_Page_032.tif
1e8238fc186020b4408c5b8208acb518
440cb64d3d7b07ab652703a59ff9403b225fc7f0
7465 F20110209_AAAHQN westwood_g_Page_076thm.jpg
732d3c98160f1736bedd61eef2de8360
84ca6b3cb0cc91c7a272449dc2620aa16f315207
942284 F20110209_AAAHLQ westwood_g_Page_012.jp2
9e8af5a1d156381128ff49ffca5917fb
4bddabd78a03abb8960dbece808975743037f22c
F20110209_AAAHBV westwood_g_Page_099.tif
aea2ce89d8e0a98908c9269d2a4d241e
1f056b166baa8e6858b3c135c58d73fd4a42cfd4
72033 F20110209_AAAGUY westwood_g_Page_005.jpg
7862d1df4344be04e35f96c2fd7b8646
d0da8778e569dbc91cf0c95a35abf196d88accdb
31979 F20110209_AAAHGS westwood_g_Page_031.QC.jpg
290cabbd1d29b5fea4b4919c7ee8cff7
83de797b9556e51b4000360eba0d0318fce8a3c7
F20110209_AAAGZV westwood_g_Page_033.tif
4ec20a9e96d6788a6947cf006427c5b6
dae6c1161e7811a7db1fe5d3eae4af32296170aa
9043 F20110209_AAAHQO westwood_g_Page_077thm.jpg
fe37a908d4a07895b362d18c6376c365
509c8826cc2a3295edf91e531d084dc1c10aad73
692996 F20110209_AAAHLR westwood_g_Page_013.jp2
c4c89b3e71342e5aaddce99e61567bba
5d5d973ccc64d077d975f587291338aecc7b0516
F20110209_AAAHBW westwood_g_Page_100.tif
be08e1e16a0511f93d02c1564b42a76a
31880c52603852491b0ae55e2dc5399ab3716123
F20110209_AAAGUZ westwood_g_Page_021.tif
8bd18546661b08517f3d33a6ceaedbaa
8feef1f584074eb975ff59bb11c4d0f377e1e19c
103488 F20110209_AAAHGT westwood_g_Page_032.jpg
22821d6396eaaa689627c3ebbb992e11
3b3fb102b0c8c27958411fe05e34f2692c92dab9
F20110209_AAAGZW westwood_g_Page_034.tif
348c36b64a81e40e3e54edb05ba52c75
b68e1026dc231c5c784b1332f7cad076dd1dbe45
6046 F20110209_AAAHQP westwood_g_Page_079thm.jpg
08565f09dbd0fb366ec2a0d52c17250a
67c1b0cb5dfe5fca524d21c27598728bd8ed63d4
F20110209_AAAHLS westwood_g_Page_015.jp2
05414c09abfedf95d2088bed887d385b
933d4f3278f2efff2857001876dbf108e31cdd62
33848 F20110209_AAAHGU westwood_g_Page_032.QC.jpg
2a0c8c427b2894e8a00e0002c46843df
580596b104034eb9e68712d0ff6d790eeee5b997
F20110209_AAAGZX westwood_g_Page_036.tif
57f8fa44336519cdd33a71b7f5e72ad3
49e3b53df42e202b1a417f056c49b253079e5a1e
F20110209_AAAHBX westwood_g_Page_102.tif
b091b033fa77c9d05e13ddbf97f9f344
f668fb130b9acc97a85fd1ddfb59aad148accb79
6340 F20110209_AAAHQQ westwood_g_Page_080thm.jpg
15f5ee5ccf2f97fbd71b33b6ef12254c
89c5427afee4cdfed37343955af36e5fe773e364
F20110209_AAAHLT westwood_g_Page_017.jp2
2c7c35496487de974bfd9884b9efebfe
27abd917c34fe4bd8c8540b24864def5521fc810
102605 F20110209_AAAHGV westwood_g_Page_033.jpg
1045ab74b968f14c375c60135bb2992c
20c1887d9a0dee701287409413691f2ce8be2381
34137 F20110209_AAAGXA westwood_g_Page_049.QC.jpg
ca0034843ac3ffffd8b498b57f20d470
625f5b1017f7b7ddd6202958031e359fa22e0d4f
F20110209_AAAGZY westwood_g_Page_037.tif
5183ca3e7242e5cfbe5c6814b077bf2e
362e35d28f40bf6d403dcb61f0b1a37fec57d693
F20110209_AAAHBY westwood_g_Page_104.tif
32894fd3ca2c1fbf76293c9c292e583b
027cb1a05090f786b923036d365c9919b43e7d73
6001 F20110209_AAAHQR westwood_g_Page_081thm.jpg
87ad32c7a682118055cd72ae4a4c4d68
61d72218daafd24e94769ecd7242a4bb04ee6322
34296 F20110209_AAAHGW westwood_g_Page_033.QC.jpg
0d126d0489c6c34bfa688bb0b4d329eb
dfb734355be63cd8db8f54a51b21a3fe9e2d5840
F20110209_AAAGZZ westwood_g_Page_038.tif
6754a634b60a09d17ad64771f3e577ac
51869a895c39111ff7263f24296eb73d55227a97
F20110209_AAAHBZ westwood_g_Page_105.tif
90d4e5dbcf54f8280904465438d99f95
8d26153fbab4d6e17173d21dacfd0226bea28d9e
3666 F20110209_AAAHQS westwood_g_Page_083thm.jpg
f7cfe8202a47d2906a53402c56c303c1
c03c57d3360bf673991de100f494e6a126a8f195
992016 F20110209_AAAHLU westwood_g_Page_018.jp2
15a168c269f9d56c6e30c4c946e8bcd5
e8f15498f5755fbed6b5d8c48f2a8e52925b2254
96987 F20110209_AAAHGX westwood_g_Page_034.jpg
a5f5d844694afa3f1465705f9a2cf7e1
ce19c49bd8a181d6b04969a33ed066d49741aa6d
1949 F20110209_AAAGXB westwood_g_Page_087.txt
73f7bb9477c41f94f1d6cebba2b02382
b87f89005b22266cc679290eb1832cd94d13ded1
7319 F20110209_AAAHQT westwood_g_Page_084thm.jpg
5ee1f53f01b19db0fa6b8ad52cf09e30
fa7afaf374605290b2d0cd578162fcc3faa34676
1051953 F20110209_AAAHLV westwood_g_Page_019.jp2
e4e86a0ad8c4e0a6569e86a4fee992ec
a8bd1091cbead5b58249290f992062ada0e17986
1975 F20110209_AAAHEA westwood_g_Page_064.txt
cc5a7912033104bb94c22865ca394342
330204818ba3312cea28d21aa975c8f9019f61d8
17309 F20110209_AAAHGY westwood_g_Page_035.QC.jpg
a4f32b183cf375bae93743d423312e20
aab917c67b5c5085abc13a7de1064f9dd131412f
F20110209_AAAGXC westwood_g_Page_007.tif
ad20b58322329a634732ab285179e8ce
36298d917d6784d95b98966d3130b65393fa5c82
7971 F20110209_AAAHQU westwood_g_Page_086thm.jpg
07e925febfca2d7760e649109609ea84
ae06ad639de11cfc4f395c3d23a084153bf55bec
1051960 F20110209_AAAHLW westwood_g_Page_020.jp2
209bd4b13d66c4c2b61dba72ae535acd
437f2ca3281a2b5570a286f5f229a7b21082d162
1865 F20110209_AAAHEB westwood_g_Page_067.txt
19be99ed89478f4fe180d4d3ed578835
1b76678790820e89170d729506c9265f9be44613
34818 F20110209_AAAHGZ westwood_g_Page_036.jpg
4b5e3e37bea19d02c75c5bb89d1d1fa7
343de09e49fe7e9cb267ecdb5eb89fe88ab41342
609271 F20110209_AAAGXD westwood_g_Page_079.jp2
b4a24af76dbc866958d67ef510ace56f
86937245e8f2329a4e1f224434373d2b096aa911
8303 F20110209_AAAHQV westwood_g_Page_087thm.jpg
6cc7526e9af71f6b778372789c904e28
ed5c59332db9b2bd392c0f4b024f38923f88ee07
1051980 F20110209_AAAHLX westwood_g_Page_021.jp2
dd1b3181cccabfd66efaca8904ac922b
2c52037807661e368419e07e9bd53dd7ca0d904d
1957 F20110209_AAAHEC westwood_g_Page_068.txt
81f43a102a01980cb375d84b47c23f43
d3817eafe88fc8ec4f92ae6e6bc443cc8c529256
8382 F20110209_AAAGXE westwood_g_Page_085thm.jpg
4f11bbedd54f165f4f7b82333b478e6a
02d86f413dd8bac73cd765e22ffa26e8904421ff
6190 F20110209_AAAHQW westwood_g_Page_088thm.jpg
a9b066b513e7f381a45ed8a9d58ed29b
b10bb794e417d3f1835d0178d7b02ab49af63fd9
1051910 F20110209_AAAHLY westwood_g_Page_022.jp2
86ee06e92ce8e7b79e8ab2747cbbd4a0
65950f0636dd2372a5c29bb289dbb194713a7c05
1740 F20110209_AAAHED westwood_g_Page_069.txt
f61d33532de01ef58a6c9e4de091158b
4db313898c01230c6c043f4a15d5e079f8246e4b
102533 F20110209_AAAGXF westwood_g_Page_062.jpg
58aa30c407e771a40a0d3e81a0a3c315
b29914d3b1eb728769768be85e4da89c6b73ce49
104415 F20110209_AAAHJA westwood_g_Page_070.jpg
9c39d0c895095b622b26f65f8a545882
dd46168795dbd70a02646c38d2550335e775d6de
5825 F20110209_AAAHQX westwood_g_Page_090thm.jpg
fee7e05dc8e0bfc06c1d743c1cda4323
e024bc6c01ecf4ab02e3d6df64188bd2f2284f37
1051973 F20110209_AAAHLZ westwood_g_Page_023.jp2
8fb498dc2d976c2d25fab7e3957443ce
0d9ee82e32298b7ffd856853534423fae05fd401
2494 F20110209_AAAHEE westwood_g_Page_070.txt
8fe070bf7bbd1d2c1b77e45842d678d1
b11de35c446a46f7142ffa6b87884e60da75ae70
62952 F20110209_AAAGXG westwood_g_Page_079.jpg
bf6b839189473adba795ed57bab727fd
1430b2036f91a3a7d2e4718cbf14e48277957d21
F20110209_AAAHJB westwood_g_Page_070.QC.jpg
7b099060ff0e8e2fc8e9bb364cf9fd8c
8b86744ba4d628d2dda63988b113b131e99fd320
5548 F20110209_AAAHQY westwood_g_Page_091thm.jpg
fc3688833817a29aa95ed94e09740a2c
39338f2357675ba7fb2e3440dba7c04bc476bd89
1479 F20110209_AAAHEF westwood_g_Page_071.txt
2ca0e61933bc301c9aeb12730c2f2eb4
dd551138c3df400fe6450da42ce39a3fc997b57c
F20110209_AAAGXH westwood_g_Page_014.tif
26bcff4697c3a5e514857e5a30ae42d0
ab26411702754ce82be251d5cf828a8aaa483ca8
78352 F20110209_AAAHJC westwood_g_Page_071.jpg
827637615adbd74fac0f4ed61c95d56d
cd129a6370ae0fdfa7b96c4f5f60c19a0e7fcf7c
1051880 F20110209_AAAHOA westwood_g_Page_090.jp2
cd7cc9de31165c090574f0653e7033e0
5f0030a2716a8c68c570fa4d25c681e9be73997e
908 F20110209_AAAHEG westwood_g_Page_072.txt
aef3633a92b570723290efab13292c2a
745a25da2ee069df9657df57aecc005db10a27d7
F20110209_AAAGXI westwood_g_Page_060.jp2
c897786cf2a34427d33adb110d3a8488
c1f263dbfb38c0f58db02ad81e113ad8ca603684
43578 F20110209_AAAHJD westwood_g_Page_072.jpg
3d67e285ba8275997b0177f1f3b0505c
24ed4b7b6b16c23fbf2f37ed2e6100e36e8a36e1
3229 F20110209_AAAHQZ westwood_g_Page_092thm.jpg
7b721c67bf7f058a69bd7473db9740f3
3710f65dcc139e31c13649744b02fdb2693f3d20
1051902 F20110209_AAAHOB westwood_g_Page_091.jp2
de8daf39fde2743a6cf120555ffeb983
a68452c8431e044f3040a208094ab27bfc50d61d
59266 F20110209_AAAHJE westwood_g_Page_073.jpg
75802a8c74e79fb96ef6845e1628cdb5
9821e8ab0395fda4e460d4928d0dcbdd2ff4a83e
940 F20110209_AAAHEH westwood_g_Page_073.txt
9fc2ed2c93d3385f7592350bcbe1140c
aca387b4ee93d89f82adfc3add89ddd0033dfc3a
F20110209_AAAGXJ westwood_g_Page_035.tif
25008a47e19780b30d45f332292ca2a1
11c14f39155a3d7419a22798ef2c2b85a6e70979
397871 F20110209_AAAHOC westwood_g_Page_092.jp2
9377ac7d6b357eb06d6cfbc107fc945f
0332e431fc4491187b499542cd043f07fe53b9ef
18830 F20110209_AAAHJF westwood_g_Page_073.QC.jpg
6ab494a445fdd1c6b92ee03c6b60ea1e
8250caa828447480ebe3a5d01b97a597edbbf9f7
4226 F20110209_AAAHEI westwood_g_Page_074.txt
9124c7edeaf722860f7365931d1b63bf
79600527dde78a4d8a9a1e7f46d3775891fc984d
F20110209_AAAGXK westwood_g_Page_090.tif
385900755941d97f2efedb229b336571
79311cbe3b066bf832da5396d5b3c3177c6c187c
665182 F20110209_AAAHOD westwood_g_Page_093.jp2
f02062af1592c75c2dce01d89612b8c0
b918158348d169b49c937b0c95775cc86b234eb1
123739 F20110209_AAAHJG westwood_g_Page_074.jpg
66fce0f02a0aef7b64fbc684a97f1df3
3b3cb9abab0a564ca59237bf5bf03500171d3e47
2437 F20110209_AAAHEJ westwood_g_Page_075.txt
dfbf9e20fbb8f9646ec7cb7776ccf253
6c0d6b1d31a61a03863dbc6d212b89504246fc18
94320 F20110209_AAAGXL westwood_g_Page_044.jpg
5a3d531846fd50e2ba430a0436d1eda5
b0847618487f3340651b2dbbe540759a52e3fe77
1051983 F20110209_AAAHOE westwood_g_Page_094.jp2
92c7e53c0f3bb81ec8eb3c76524a016e
cfbf053a12f94335a4edade14ed8247c7f0d5ba3
31162 F20110209_AAAHJH westwood_g_Page_074.QC.jpg
a003ea8fb0db038335fd67af030f68c3
6f2332c8ca9fa4ac6f9df7bd4bc17f3df4eb197a
4538 F20110209_AAAHEK westwood_g_Page_076.txt
a6fa151604ce3f7375ab3f88ee30dd38
8d59e05b33d8d7b9d182b9a856e3753d3cfe61f5
5558 F20110209_AAAGXM westwood_g_Page_073thm.jpg
48cb0a33c6a7f5c2e4ede8dba86d5e0e
f03303625667bb4c283428d3d4051233083cf0bc
1051961 F20110209_AAAHOF westwood_g_Page_095.jp2
33b29b7ec6e2933ba8b0dfa7c6258db0
6f99c6d2eb16058cef4da5e2590aa675de70f056
78697 F20110209_AAAHJI westwood_g_Page_075.jpg
d72e7b8b7f357ff4e36e59379a621cd6
3f7c8ea52244e2c71aafd1618c4a00f069f78f6f
5434 F20110209_AAAHEL westwood_g_Page_077.txt
f904727e6941d246161184b76674332b
2a7916133fd4d9394b9f318db96b1fc522279e41
F20110209_AAAGXN westwood_g_Page_045.tif
0ff5915f692b60cc3d40b012eb540436
b9ed2a5263531371603c937afd1aaf0f2518493d
1051954 F20110209_AAAHOG westwood_g_Page_098.jp2
164adfea3b9dc5000047005dbe96d479
0a84434b2d997471910394ef7f613114038a9140
20221 F20110209_AAAHJJ westwood_g_Page_075.QC.jpg
50a524de724f6a95827e56a13a297d5f
4adf4fcc25bf0de0d944cf1f66a7352104047573
953 F20110209_AAAHEM westwood_g_Page_079.txt
733bbc5db981ded3870e4641f23f7cc8
435d198df89c23602f2974e59a66c07b1245b15f
7818 F20110209_AAAGXO westwood_g_Page_043thm.jpg
ce67aaa8611d54980f2a6140fb0612df
8e0e468265e99968047dc22881169b93060cb2bd
1051974 F20110209_AAAHOH westwood_g_Page_099.jp2
209d6c4689df4b5f51c8d5e0f878fffd
d355cc78c04c793615aa031197902e068780a249
137670 F20110209_AAAHJK westwood_g_Page_076.jpg
c5fb6e0dca9d3c84fbca8e5057e6a656
b985477425586aa85c40b06c93aa627ee77ce2f0
14091 F20110209_AAAGXP westwood_g_Page_072.QC.jpg
555e19d95a8da4fa433ffad68f6a4bdf
83e50508c46355d47f4e8cfd09ebfb2ac739de90
1051879 F20110209_AAAHOI westwood_g_Page_100.jp2
90555aea2212f01ffc2049821a49e4ad
c34917b0e2f838646753fc291d7b9bb9743f9d53
33820 F20110209_AAAHJL westwood_g_Page_076.QC.jpg
d3ce2147766d7c215debb2b5215d2a16
aa3a8aa37fb26ee648cf701a8160e8c9f4c2210b
1375 F20110209_AAAHEN westwood_g_Page_080.txt
bb03f46ab7253e8bf3ca0535499acfbc
9c666cf52f94c9b47b70d72c1c2cec3bb0728eaa
104412 F20110209_AAAGXQ westwood_g_Page_020.jpg
af4e8316fa4cb1086931676ee547a565
6593614a74fc9ffa2f5d095f351f589a4a5e2363
1051944 F20110209_AAAHOJ westwood_g_Page_101.jp2
b415ca9ee4146d1f91f6376bb09186be
3db75ab619feb6dd3e3f440c11f9f13ce59652c8
170840 F20110209_AAAHJM westwood_g_Page_077.jpg
2862a098166814b565fe2ae4232e12c5
520ebc3836dcfbfa42f141a8b22c29a8e9a43620
811 F20110209_AAAHEO westwood_g_Page_081.txt
d1f118957f5dd3edf86f624f51f85101
72697b84d040951c5e44da483f7e53c77bbca1f9
4504 F20110209_AAAGXR westwood_g_Page_089thm.jpg
b74b7c9b7eccbf5d85eda7a6841bb7f5
56b1a2d69c5be053f40b3cdd8cd23197afd13c8a
1051971 F20110209_AAAHOK westwood_g_Page_102.jp2
d320788374d5dcf65e57a2bc824e352f
c0899d1d27d52c4824bc8b53e89f6eb8b0113d57
41641 F20110209_AAAHJN westwood_g_Page_077.QC.jpg
6880c6933128b08baf329791f38bb8e3
91770ce64ce37b34e50e589508073aedc0fecacb
1857 F20110209_AAAHEP westwood_g_Page_082.txt
e27ba399e7545606e3ee9e0be20ed1fc
04178b512f3fac90c9ea87059d7b67f18edfe6f6
1476 F20110209_AAAGXS westwood_g_Page_003.QC.jpg
5a38d60ed7d16cf2ed5e47b46cb63b34
f20b0e5aed6005e571e33c1dff5d98fcd973de39
932530 F20110209_AAAHOL westwood_g_Page_104.jp2
fe2563fae931258276afd08013a0dd28
75cf6d16f7d77f89a84f95956be437a5a00dd2ae
67655 F20110209_AAAHJO westwood_g_Page_078.jpg
1347a3d91c0d759e8974a0e87f821b45
2347db00f0e3acf61aec2f42892464a812dd6889
836 F20110209_AAAHEQ westwood_g_Page_083.txt
fe4c15739e29930d7d91c5e0ac403487
89ca8ef405734865b08254769c13435c7fbefbb7
F20110209_AAAGXT westwood_g_Page_097.tif
6bfdbd95fdd7911bbf45eccec449bf7e
b895e86d3dc69867d62dd298af255c751c224cb6
2477 F20110209_AAAHOM westwood_g_Page_001thm.jpg
21508a17a93fabf1c8ceefe55f3ad8e8
44e8aae34709c64bde5f016522748da8a4cf3cb4
20483 F20110209_AAAHJP westwood_g_Page_078.QC.jpg
6e3f9aac50fc2197da162bee0d47235a
9019886d492e22ebb11a508c3e95754232f93336
1977 F20110209_AAAHER westwood_g_Page_086.txt
2faa7c94dab5cd61cfdf05feaf3e2503
e77c8eb6d473b85b2f9b7dd1743cc09fe3f3c018
28991 F20110209_AAAGXU westwood_g_Page_045.QC.jpg
51bb2dc5f85ed38e6789315dd87046ee
897937f51a63177f807bde658de833306878edcd
624 F20110209_AAAHON westwood_g_Page_002thm.jpg
a1c2e7b024b895daefeaadbaf7774c83
d36820533b7d1a403c53fd93c39cb6912c7f3692
20827 F20110209_AAAHJQ westwood_g_Page_079.QC.jpg
9db6447e1e0e6694362ece18b3a0b82b
9660a91e4b00d33988a4c5f36b4444cfb08703ec
1458 F20110209_AAAHES westwood_g_Page_088.txt
51efe7b6b5707a19b44a9a95c2247bb4
544126db7532083c12e955339f7e061503acc8f7
989766 F20110209_AAAGXV westwood_g_Page_075.jp2
8291acd37f49f481852747f906ffe408
24cb2ff696e419cbb46f452f9790d5d5cc9a988b
3723 F20110209_AAAHOO westwood_g_Page_005thm.jpg
d222d44123bb048896e738726ac95b7d
db13a4865817b5542c3e347b5b74b26f004947fd
78720 F20110209_AAAHJR westwood_g_Page_080.jpg
42f7a82e0afd76fc53cae9ae4e98fbd3
dae67888fb3880ad3c5f248abccb96b7af3ce4aa
74269 F20110209_AAAGXW westwood_g_Page_088.jpg
c9534bae944f372c8aca7155b49bcde9
6fe823677addb00a53976abdc25820415d794101
8699 F20110209_AAAHET westwood_g_Page_001.QC.jpg
af228430518ff1646ecb8a27cc499007
6e31db6aa685a86575455bb70138b0fe1806503b
5459 F20110209_AAAHOP westwood_g_Page_006thm.jpg
10b9cdb5c81c310243e265725a4d8bc4
c5ff044021f11b8d4ce632104a8012ebc77f7903
34490 F20110209_AAAGXX westwood_g_Page_092.jpg
08394a8fcd03e0ecd990e5095263e712
0818882b1433cb3c9b6de65ce5077c77c4bbf26b
4853 F20110209_AAAHEU westwood_g_Page_002.jpg
211486e9c849f61c4289beaa64ff5ba7
c1f5c0648fe874938c873f105b93886a68d7ca62
3486 F20110209_AAAHOQ westwood_g_Page_007thm.jpg
e8ec6ffe51751cd4a0b6440fd261121e
e03db8809461e27df2dde5555354d2365092e2b4
23647 F20110209_AAAHJS westwood_g_Page_080.QC.jpg
55379416ef98221ce8135a186960ad6c
bb8c84cdc7ad4f7e77cbfa3061c61fa74170bf18
F20110209_AAAGXY westwood_g_Page_025.tif
38832a8a04e5ffee0d57d33e88d5d0b2
4cb7c46a624ea5ec9ebdcf1e1547298e821a0116
1653 F20110209_AAAHEV westwood_g_Page_002.QC.jpg
1338ef4e882899a78f0bb92c316def3d
d0517179e75048b2435f40da7a42fece622effab
3707 F20110209_AAAHOR westwood_g_Page_010thm.jpg
6622caeb082fe5549e0289ca45635809
df395081221714634fa1a9ce0968042082b37d16
63108 F20110209_AAAHJT westwood_g_Page_081.jpg
15719d4a6061ccda696d12ec7c32730d
74055d9624bf87789dde148e878e4a925fbae89e
1602 F20110209_AAAGXZ westwood_g_Page_053.txt
bf9708bca0994b3025335f5c3a7a79f4
b7e2e1a2c084dd0efcf3fe34f1e4f00016fdb129
5669 F20110209_AAAHEW westwood_g_Page_003.jpg
8b0f462be20965b943548e73c5d30a99
aafa96aeb5b9f26a570eb7e2c26cbfa6fbec126c
F20110209_AAAGVA westwood_g_Page_064.tif
56ecb8e4aecf735963f7924d88555451
f9ed9c5c32972c942bd6fffca5ff35911dc878ea
3567 F20110209_AAAHOS westwood_g_Page_011thm.jpg
a3105494899bd3c6581ac1df79ee9cff
fa32581e357433e0612027920c3d360608c55190
19527 F20110209_AAAHJU westwood_g_Page_081.QC.jpg
0241d9f1ca855a115a494f3935c37d7f
44affabef5f94bdec7970bbdd91c5483c58d2569
64880 F20110209_AAAHEX westwood_g_Page_004.jpg
ef2a123d142a6f743707cc02238f9f83
ba4a4407104bfad9ae32c720eb1028c295cfa75e
106304 F20110209_AAAGVB westwood_g_Page_009.jp2
c37f731916a214a9bdcca5572a05c286
d73bc6887c181d5977f723e97f57bd576454ee2a
6732 F20110209_AAAHOT westwood_g_Page_012thm.jpg
146b11809bb181714f370db5d4623fa8
fbc41257b3e587189e05d020d192040e776488da
67285 F20110209_AAAHJV westwood_g_Page_082.jpg
e92ae372cd466f4a197b7fe4ca35e3b2
95efccd0b19962831bd59c18819cea6ff3414385
111 F20110209_AAAHCA westwood_g_Page_002.txt
3ea2b1a821283ea146240f0984c48483
775691eda6de6a095e60328e83e0ccee5920365a
21751 F20110209_AAAHEY westwood_g_Page_004.QC.jpg
56a808eba1066a4d0efa0d1f13a3c2ce
00c3f522ce800e1072b959c217341212ab777202
F20110209_AAAGVC westwood_g_Page_018.tif
aa0d35e098e8b719c41a24a2565c1d3d
2b73ccb582572b66d1e291a95e43e21955773e6f
6640 F20110209_AAAHOU westwood_g_Page_014thm.jpg
9a625ac231ea10edfe65e0ca1d128b8b
6522b23fe40e384f018a2fa947622efe239db53a
21716 F20110209_AAAHJW westwood_g_Page_082.QC.jpg
d808029fac1ab9a45a5600694f4bffd3
6a17136911030096bde957f2a872b89d4c7326c0
121 F20110209_AAAHCB westwood_g_Page_003.txt
0984c3a80636e7430b1d3061f465c8ab
121c3abf04caef997ed38b1bfbfcaa9d5ff3edcd
15594 F20110209_AAAHEZ westwood_g_Page_005.QC.jpg
748ba85294a25423892490f3efaa15ed
b4a86cfb344700c207e9954c44cd7f4c251319bd
1988 F20110209_AAAGVD westwood_g_Page_026.txt
9d79cf5dc4b430f0857b049e0935546e
cb08be484bf73ee4db38a745e4315c89bfaffc42
7970 F20110209_AAAHOV westwood_g_Page_015thm.jpg
e0b17966d4d87ba62e796f68a76f8d87
100fff67bf01ed2381ac202c2f955c427e74831d
50583 F20110209_AAAHJX westwood_g_Page_083.jpg
f909b1fe5462ad6f96e9b7c34948b38d
870ef19b44ff4b5e4e03270d2757e97ec851ad9f
1286 F20110209_AAAHCC westwood_g_Page_004.txt
b19c47f35e895d6805a919823d84ff64
cea1b4eabf971d6bf5c5ebc1c15e13fb0c9e6ce9
1582 F20110209_AAAGVE westwood_g_Page_045.txt
db1dba63a1f0e9cc92774c12a2282f9a
1f66ddffc7c45dc9ccfa3774c5488ad012504cff
8331 F20110209_AAAHOW westwood_g_Page_016thm.jpg
b78ff8de40c7f6e2f46ad0fd4d1c19f7
545518b38fec9841d2c468e14f4b31f93f6b2bfa
14807 F20110209_AAAHJY westwood_g_Page_083.QC.jpg
5f521c399de533b2423bb1cb697e2910
a798a675644e2536d3e49c01fb09b1936abef526
10502 F20110209_AAAHHA westwood_g_Page_036.QC.jpg
d8f7dc6ce7778347d2bb9134f4070721
959b06fbb537a7da9924bbf2f66742a6f186c77e
3096 F20110209_AAAHCD westwood_g_Page_005.txt
8b9993ad34f845c9f2809ae58dd70cee
e0506216ddb355af4e04cc1601e909640f2ea61a
1051958 F20110209_AAAGVF westwood_g_Page_062.jp2
005a8d7c1ef3b26a2a76733235cbd33e
e527c2de69c5b4b530328694962d6eaaa28d4721
90657 F20110209_AAAHJZ westwood_g_Page_084.jpg
c8efab516cd1d0ef50087214acd03e3f
418d7a390ca215dc3ef880a10de20c5ea1f2efdf
81051 F20110209_AAAHHB westwood_g_Page_037.jpg
60b01755499d85bd9018a7940bb153a7
8bae1091da16745abdee3a0f249a84d53d78f196
4120 F20110209_AAAHCE westwood_g_Page_006.txt
f8c82fed1b107073a168b7b5dd016ea3
4c8a0ff395e6a0c1dc90957f230a0c6b9570ef88
107779 F20110209_AAAGVG westwood_g_Page_090.jpg
d965832ea4de14b4f34863f1535d4034
9fab0b11edc38b87b19962efbbb66957059f8942
8070 F20110209_AAAHOX westwood_g_Page_017thm.jpg
83ca1b22c86e4116f50fd1e0a1ac9f91
bbbb3bca8bc66d8333bf6397e0d760e3de682c9c
24149 F20110209_AAAHHC westwood_g_Page_037.QC.jpg
cd72bba3402aa49f8bbc526654545a3d
04bd011d88c4635b65e3a290c0f14e5a452b6144
2233 F20110209_AAAHCF westwood_g_Page_008.txt
86c5914ab4292be28ef5773b685f90c9
935b6c696c3d9d07720d9038e63ea0ad9b3cc6d3
8832 F20110209_AAAGVH westwood_g_Page_095thm.jpg
b7dbe95be8262997f9a28ff3179378f4
b8f2635712bbb1d6b99eceb8cbb7f35aab173c71
7349 F20110209_AAAHOY westwood_g_Page_018thm.jpg
37f4bf4a74915c6950d36bba131476c3
d32ab0e56fb98b4e3d68c4c9e11f3b7a2d1a19b0
F20110209_AAAHMA westwood_g_Page_024.jp2
18b8b79bccfb4e6ddaa9dbcd34af2ee5
785be4f13a8e77528f963b99fb4b902341f87f40
70473 F20110209_AAAHHD westwood_g_Page_038.jpg
429d2cfd7d92bda9d2d4052b7b3d7d29
5c0a1155ac9fd0e06984f46cea3e2a8ba0777afe
369 F20110209_AAAHCG westwood_g_Page_009.txt
2be58c811845fb67a13bd110736b09c3
c99ffbeb96c6fa1a6be0cf4dc4109e0b828633a3
98120 F20110209_AAAGVI westwood_g_Page_068.jpg
5c2eefe52d50064cc5a5e6caad9b5a27
41e3cc433bb670136f89674cb5d3ebeacacf0678
7738 F20110209_AAAHOZ westwood_g_Page_019thm.jpg
dabb9c307d21ab49a13e1185f11f356b
cc761b76c287247469a4d79f836939f039bab6db
1051986 F20110209_AAAHMB westwood_g_Page_025.jp2
45cb295187c2fc436d076070724f160c
8659276b28a61fb56149738e6c05bd5d6c6ca31f
20127 F20110209_AAAHHE westwood_g_Page_038.QC.jpg
b19f772cb43064d73e77d6face26ec80
efc2b8f1ceacecfdf2d8124d13ae51ed5de6709f
883 F20110209_AAAHCH westwood_g_Page_010.txt
424f51683c812adfebe85a553ed0bbc1
2f49fa4f9fe030a3d119fd83bf0e201a9845ec88
8214 F20110209_AAAGVJ westwood_g_Page_032thm.jpg
485777b92e1fe94809617a53a07db650
d99141ad265a060d5e3e8ca7f33fee4812eadd22
F20110209_AAAHMC westwood_g_Page_026.jp2
ec549f52d074a64de89434b7182c9194
c1b612f0335c23266dab62f7793e6bcee8ebdfd4
75457 F20110209_AAAHHF westwood_g_Page_039.jpg
43bb7ff75e44b873f96751bab17d46b6
d7b39e1117abf7da50d6ede085e922e19fa9e9e1
F20110209_AAAHCI westwood_g_Page_012.txt
72b992e422ba7a2a9f157de4e77ef82a
3e76b7b4ddbec83aedd95c025141302366fc3bb1
33283 F20110209_AAAGVK westwood_g_Page_022.QC.jpg
b2ff3785755ba8410e9c151f888ca42f
b72087c71777d074e69ba091e2c11ce241ba98bc
4685 F20110209_AAAHRA westwood_g_Page_093thm.jpg
4e5dd6d404077449830ee06328f2597f
346742ac80db4ca955a00fe3855ae6ec9949294f
F20110209_AAAHMD westwood_g_Page_028.jp2
cf8490e24e6a6e370869c46397836531
d82fcbaf48968ec65c16122a7ea64c56cbc94bad
22851 F20110209_AAAHHG westwood_g_Page_039.QC.jpg
ce52075d9978e33a6439a171ad061aa4
4a34fa86e7fc62b572eef1ddf61aa0c33c05d87e
1203 F20110209_AAAHCJ westwood_g_Page_013.txt
cf6162ea0da823cd686b4a727c4b050e
d203510d542528a39007acbe0e9ebe2fbb1570ae
8174 F20110209_AAAGVL westwood_g_Page_026thm.jpg
0c702777e8bc2f1c05d9c6fed449108e
22a7ef549005d23befc660e49905eff3d9fa7047
7205 F20110209_AAAHRB westwood_g_Page_094thm.jpg
53904041a3c2697e43b8e8223a589eec
9fabe6eb6bf57f1088e5cb133ca8fecce97471e2
1051929 F20110209_AAAHME westwood_g_Page_029.jp2
7563e13181f92ef30b7e24aafadff116
32f2f679a287cccc9dc2f5c9901f1198cf201abd
37181 F20110209_AAAHHH westwood_g_Page_040.jpg
b3f2053919af6bf6d30cb78725423213
9d6921be1a450656e3a3518d4fd91a45ed998f04
2038 F20110209_AAAHCK westwood_g_Page_016.txt
8474a56d03afdeb68a3d16fe35bcd66a
30af622a9df67bc40cde3003623c557e99cefa9b
8147 F20110209_AAAGVM westwood_g_Page_022thm.jpg
6260a4ca9ac664b5cb1b5fcb973c20c4
42eeb3900869ff32e1463172b9f83b7d8a4d429a
8899 F20110209_AAAHRC westwood_g_Page_096thm.jpg
7cb783f018600af3e5252b59a22ee646
942ac50362eff56b63fc9c817423dee428b77e8f
1051957 F20110209_AAAHMF westwood_g_Page_030.jp2
3b66d1001f744289b5361b696cb0720a
55db999412ad62aea9084bb5d04a34b53118c75f
11327 F20110209_AAAHHI westwood_g_Page_040.QC.jpg
09f534250607fe44aa4a1ad183c6b3e6
dc7e545346e3409c0fc372a552e1329d4f836306
7564 F20110209_AAAGVN westwood_g_Page_044thm.jpg
8dd50478b4383b5114ec6b4bc4055c2c
fbfd50e00ece71eab84c4635edaac59a65c3d8dd
8391 F20110209_AAAHRD westwood_g_Page_097thm.jpg
bf80449bcdd52f9a69b885bfd8971f8b
a0576bd8e5a3ccecb18796e2a5c287a7fc940391
F20110209_AAAHMG westwood_g_Page_031.jp2
b9361b33b51c10fa11a2115916bc36a7
9f69ef28ba4124bbb2c2ea1d3e6e50d67cfb1ab0
87598 F20110209_AAAHHJ westwood_g_Page_041.jpg
161e0542fbca53b23fa49694ef3e0d8f
c0bceb1b6064cef33dfa20bcb8d60adc14ed013b
1947 F20110209_AAAHCL westwood_g_Page_017.txt
4c67e1a07ddbadc31e9b8abbcc07850e
97b9cb5e120562301f7b5cb0a1f5af006a32f920
29968 F20110209_AAAGVO westwood_g_Page_043.QC.jpg
10997883dd2f741343c3c7ee7ab3dcb1
00d828f7368b46a41b448fc4c5c19d77a8dd000c
8337 F20110209_AAAHRE westwood_g_Page_098thm.jpg
330c96735847640b00975a9c6b6d3f3b
bfb1f1f55e6c2468577cc819aced3ed92b0b75af
1051931 F20110209_AAAHMH westwood_g_Page_032.jp2
9c0e6d2772eb9e2002b0da0f4c4eba2a
c58a4c76f346e57215f79c1e8e8d7e9947de5784
27714 F20110209_AAAHHK westwood_g_Page_041.QC.jpg
2c6b684a4a1aaffde9fc815bd3931618
3a6b704f325ccf2fdc6929422739ecda253042a5
1765 F20110209_AAAHCM westwood_g_Page_018.txt
ff81df2baa36a85b4bbcb07befb0d927
315c6c2a4a1bfffe449ebf3314a09d8ba47b19b5
614502 F20110209_AAAGVP westwood_g_Page_073.jp2
02e75bf2ea32cbdb9a686ac0b2827b62
bba742a644d7429cd109d89cd6e3f3e32d685e7f
8711 F20110209_AAAHRF westwood_g_Page_099thm.jpg
423fc7a73311f03a6a136f914a9d8e9e
bf48f8e78546138e11993a4fcb2139d89c6267de
1051965 F20110209_AAAHMI westwood_g_Page_033.jp2
a5e7894b697e5643096c4efca6cec0f6
04bf9acef631c12104a67de66768eef43b71d2e9
32843 F20110209_AAAHHL westwood_g_Page_042.QC.jpg
93204aab79933a02cccd9963d95f7c28
079a0f0fe3c1e90f044df670c322f2e11a0dd81e
1895 F20110209_AAAHCN westwood_g_Page_019.txt
c6ac6d4317dbeb98ee6be139d898743d
f13dcfa110b193449d8c93a9e142e715b45c4f43
8096 F20110209_AAAGVQ westwood_g_Page_057thm.jpg
a15502cdef7eda18d16edf1eae4eb1cd
3ec7533478fafd0955280eeecf533227d3868197
7584 F20110209_AAAHRG westwood_g_Page_100thm.jpg
bdf2dd23738641a3ff5f986f0eeda100
147213c809763068f1a95bb141fe2aea2fc56578
375441 F20110209_AAAHMJ westwood_g_Page_036.jp2
9c4bae21d50066627eb3b55ab3937251
ce32e6edea3a65769a03e4accd0d412a0a7cd4b6
91932 F20110209_AAAHHM westwood_g_Page_043.jpg
485f50ef9fc6e9e47e9051929b77840d
a7545e4916a3b099192682f35bf77ae12cbc0fab
2033 F20110209_AAAHCO westwood_g_Page_020.txt
a0e15853b8c55450ebf5b98c3df32846
a3639d9004db617f8e1c10dd062736510b9904a7
21219 F20110209_AAAGVR westwood_g_Page_071.QC.jpg
2dd7f443558cec939bb7bdf9f91413fb
fe3cf068da13a6bcda1cfd99be9d4ed13a5e9fcb
8660 F20110209_AAAHRH westwood_g_Page_101thm.jpg
daa0ab24e7525991790720918c024ed5
52086f4d0877ab0d8c22d3c04e680c2dfa4a3c42
852634 F20110209_AAAHMK westwood_g_Page_037.jp2
d8c44f1f9721cbca4afe59a287b0d1a7
0ef584cc52fe5698c1dcbffe41002d7323d05ed8
31120 F20110209_AAAHHN westwood_g_Page_044.QC.jpg
9dcd369d27edc50f4b07ccd12e83e5cd
d50da081c1ae9f839fb867a3d35f745a9343b690
1968 F20110209_AAAHCP westwood_g_Page_021.txt
898ba048d7fee3de45a9974452682eb7
0e55168e946f52d1b406047ec15cf1768f5b0571
F20110209_AAAGVS westwood_g_Page_081.tif
73f87ae1374808eaa3d75a46a2794f65
88fccb7411a03016ec2d81d105677c1fc5058ca4
8767 F20110209_AAAHRI westwood_g_Page_102thm.jpg
b3066d7acbf0fe711d9a18644d34bf50
bf5e06c27913af516395c983afe7a9b6c95aacb8
821662 F20110209_AAAHML westwood_g_Page_039.jp2
fcc2d56daa6780ec43a8943ac7d7b99f
b4fd4159ebb81ed19998cb9a2c6a68613aae9cb0
94918 F20110209_AAAHHO westwood_g_Page_046.jpg
1a31b113d5d791916d565be74af11999
42be35cb10d94881a17865a94a4a0f4678f13839
1990 F20110209_AAAHCQ westwood_g_Page_023.txt
981902387a063340286349653343078c
c9c9b5095a88c3eb40f3257a1b84418bf8a87aea
1841 F20110209_AAAGVT westwood_g_Page_084.txt
a42cd878ff66de0af9aec78c53011518
a7ffa4d8ca98fc74ee08f2c5748b8a8820fb1e00
8904 F20110209_AAAHRJ westwood_g_Page_103thm.jpg
4b69dd3bd8d98e785fd70cb1e3668ebb
f17a77ffd9607521a7887e82574001fbc1ada88c
367402 F20110209_AAAHMM westwood_g_Page_040.jp2
d3f3af3bfc87c19d46a9c58c06549e6e
6e7d9fd2cd70d9dd2e97e0697d6e93e085003555
30342 F20110209_AAAHHP westwood_g_Page_046.QC.jpg
9f6a8fff4521a6296685955f2020fb70
1ed01337572ae03f39084599060a995c60edfc73
1926 F20110209_AAAHCR westwood_g_Page_024.txt
9460c9a91ec9434f4985ed48b9979a63
f4b53a5c8bb1484a6fa458fb40b29900171696d9
63723 F20110209_AAAGVU westwood_g_Page_013.jpg
fc42f12e85435d067ccd2e2b0b9aa650
909e832433d4c5f3a218ca9f1c5a51e2d4d0dba6
6099 F20110209_AAAHRK westwood_g_Page_104thm.jpg
9ea99ee1e8b69655486e44c4f857f5b7
5650382b9f8ffeb02d892c27dbe039bb42c3f8e1
941994 F20110209_AAAHMN westwood_g_Page_041.jp2
c842c6ec2810d0f299a455dc20d7077c
2286571a38a372f0326f76eee2193bc0a03e4001
1911 F20110209_AAAHCS westwood_g_Page_025.txt
6f865e2e0164f5e43c7967d2c5663ccb
2219f4472dd56de0e4d772a684bbb048f599c402
5506 F20110209_AAAGVV westwood_g_Page_008thm.jpg
9fda47511d18c6f5b058d61bfa6d3ea4
61a3815a251685686c52c5206df62e95cd97cf34
2483917 F20110209_AAAHRL westwood_g.pdf
1e8415f2a5157cda51ef9601c04af8f8
89d2e22faf7e892fe83fabb358fb715bdbfea196
1051981 F20110209_AAAHMO westwood_g_Page_042.jp2
c301b45cb6a6c36fcdb85c784b5a393f
cfe302fdc45106dd03cedc2e1b61efb7c75e3f1a
1887 F20110209_AAAHCT westwood_g_Page_027.txt
af15c689d516fdf2bd462db93d8c6226
cee4bf808f335664c86ca2f6d562b1b1e804c233
102126 F20110209_AAAGVW westwood_g_Page_028.jpg
e28680a3230649f4bb551c620fff961a
38c62a38a95e764267d57966416477d239770ff8
109868 F20110209_AAAHHQ westwood_g_Page_047.jpg
113b06e0d5e68bf7c4ad2fbac2490728
935feba51c8a3e6e883a5c56738c0caeaa8db90f
99982 F20110209_AAAHRM UFE0015542_00001.mets FULL
604c40a6323235dd98a77a7e026734b8
831c0fe15ba4d2485876f1dad4c6ca3fdccddca7
1012527 F20110209_AAAHMP westwood_g_Page_043.jp2
61c2fe954f9b48a084476663eb6b8539
863ebccf520efc1dce7b1351803ca4bd90341c90
2020 F20110209_AAAHCU westwood_g_Page_028.txt
ebcf895dd7cd5b956f6d588cb7de5a72
65a44925f3cc0230f40900b97ed128250a1806de
F20110209_AAAGVX westwood_g_Page_011.tif
51f32445228a50a4dadecfba83ad9667
ecccc446754c20c961f7d87aba7b373cb6faee96
36204 F20110209_AAAHHR westwood_g_Page_047.QC.jpg
198dff5664d7e3f17c74e826e84595a6
cb529fda9991b14b9a4fedc2883fc68c0993dbc7
1024496 F20110209_AAAHMQ westwood_g_Page_044.jp2
c4f3182c7d3577ef753e52935d79deb2
11e2c79938b09f236f1c832f1cbe35d2d8dedd74
1973 F20110209_AAAHCV westwood_g_Page_029.txt
d2c8b3efee3af1e7aff452dfe06765fd
fdd82f210d1764f0f23c90519b49b72583e202a7
F20110209_AAAGVY westwood_g_Page_015.txt
9f6315af3400175b9e0775b44adf5621
378f2b17bcfb675312e119b923aace35808129d1
104304 F20110209_AAAHHS westwood_g_Page_048.jpg
c3566924ec9968cc4aa9b70eb53baf34
6489e5672b675ef420c8e5e7b4bb7b72f2438aee
934341 F20110209_AAAHMR westwood_g_Page_045.jp2
73403415a8b33b6807266c4ce42dc64b
929652236024a9f47ed7e0423aff31ac9819299d
1961 F20110209_AAAHCW westwood_g_Page_030.txt
1cfc857dcfaa857301d9fc9856a11bf2
9f884327df73372127190bfc64ae682326bfe055
1061 F20110209_AAAGVZ westwood_g_Page_078.txt
280d437cb7e5144e1e849027355d372f
55f5772afc6d7d538016b3677579072ae3e88a64
102348 F20110209_AAAHHT westwood_g_Page_049.jpg
67e684438e337298733d2596586d4fb9
1737e56a6619a2ca9bfa1c8e1e445a0e54ec23cd
1048249 F20110209_AAAHMS westwood_g_Page_046.jp2
f0cb3e24e373872b8f6eb59a33ca20a4
78217a1d4af423261237d1aaa4659b142fa0ab6f
1960 F20110209_AAAHCX westwood_g_Page_031.txt
cf26a96a24677378ee4cfec1e08ba4d8
3ac7082c607c6e098ad7a5709984cf766c8a7a72
101603 F20110209_AAAHHU westwood_g_Page_050.jpg
7dd12b33176cf247754e47205ff24459
7e8fd24d3f6ad305cad579788959a223801010f0
1051975 F20110209_AAAHMT westwood_g_Page_047.jp2
38b96d5d6b9af3f4d30cdf099be25cad
37bf00a195b9e7a8bf398a473c55d0f9834d1b4e
F20110209_AAAHAA westwood_g_Page_039.tif
46349ec54dcb43d05f131f20737edde9
fce897f5c765074703949ee4a1e454c927197c0f
2019 F20110209_AAAHCY westwood_g_Page_032.txt
4166e518dcead8988e4117b927d7b011
1e4c8a3f2d93f28b8b75761fa5c6d585e43c4b7a
33953 F20110209_AAAHHV westwood_g_Page_050.QC.jpg
9f52c4185aa3b3af8b13913a95a71892
fbd651a81d774104a06fe1d99871c6f8991d0252
98975 F20110209_AAAGYA westwood_g_Page_042.jpg
51ad89b743b137beafd0ef329e6eeecf
46df595b44fed5adda6c21ce424b36d30edfce03
F20110209_AAAHMU westwood_g_Page_049.jp2
2ff1de2c59ac28742a9668af4ecfd623
fb668714bde6ca270ef5de52644689b3b452a1ea
F20110209_AAAHAB westwood_g_Page_040.tif
3ca59fe088b7ee4046929dccd3a22453
ccb701933028a7fbdb3642289c00335b360a09fa
2040 F20110209_AAAHCZ westwood_g_Page_033.txt
3bfa9a925141c65876ab3665ae397126
18eab96e7b00beaf83f69cca82909aae445c30bc
102441 F20110209_AAAHHW westwood_g_Page_051.jpg
ae28607dff814cfe3f14ae88d07fc3a5
dce6e011c223416c1bd3e4ef9e95df1502b788f7
F20110209_AAAGYB westwood_g_Page_044.tif
e3eb30758cfa856585917764fe710b5a
a0b70f5fbf84da63bed857c92460b4741eaf4b58
F20110209_AAAHAC westwood_g_Page_041.tif
8c9df3c26b417f2c48057e8795c8f44b
88c6bbc7748bb522a0978214f7558a8d8bcae66e
33236 F20110209_AAAHHX westwood_g_Page_051.QC.jpg
593bdde3246fde74c39a3ac39371227c
4d1d8cb368eb8822559e6bd45299d5eb0ffba1fd
F20110209_AAAHMV westwood_g_Page_050.jp2
dd23822ccc9bd17987596f8c2021ef13
6537b5254e350077ea16f96fd5efa4a6c19c8fee
103807 F20110209_AAAHFA westwood_g_Page_006.jpg
eb369867cc8a81cc5eb751dfbf5ae9cf
0085f8c37a73411ee48f55f89e695dac21242bba
104738 F20110209_AAAHHY westwood_g_Page_052.jpg
ad5bd1c67bc2f0d81c206c59c903f008
15374413d6bb299fe74a42419c996718e61805ad
52345 F20110209_AAAGYC westwood_g_Page_035.jpg
078f8d0c0e8ab36fbbecc1ba2cdb9f6f
07066a46f4822d94028fc795c38f0603a9e43dc1
F20110209_AAAHAD westwood_g_Page_043.tif
65b575ce2d199d76b7776c46c5595f60
ce23ca4143337eeb87afe1de1d85aa1c5b0198ca
1051909 F20110209_AAAHMW westwood_g_Page_051.jp2
86f749e75dd0711b21b2d951b8843547
09c5f638be499586bb63cf7af0f6d9ac24c60397
23099 F20110209_AAAHFB westwood_g_Page_006.QC.jpg
4cf7b4cc346d5941bfd68efbe78820bf
94e27b9a05d22e106af3dbe0426c2f964eb90a8a
83474 F20110209_AAAHHZ westwood_g_Page_053.jpg
ffe5909c63fa2fcd3828596204d037ff
fa6305e8643748a25a0e13bbd3cb6c1ac208cc53
25705 F20110209_AAAGYD westwood_g_Page_053.QC.jpg
4eb9a293553d443941c3ea4038260dbf
ba3633f1f8c5834e652200744fa7e57ac5f29c2a
F20110209_AAAHAE westwood_g_Page_046.tif
70018e95507c73b4925c45b49cec65cc
c340d4cb76ec3813efffd981ab93d3d7492ecc0b
F20110209_AAAHMX westwood_g_Page_052.jp2
bb18e4be940091728cfecf4e04238183
edfb2acf6499e8cd524b52fbd62a87ebfab7151e
43015 F20110209_AAAHFC westwood_g_Page_007.jpg
1a82888afb02a36361864d4dd0ac6526
abd532147d24067eb5b168459a5628b0d2181936
1836 F20110209_AAAGYE westwood_g_Page_063.txt
0269e4a10da62f19e307aa5551758216
9ce976e9704123809640865cdc530d714a632e56
F20110209_AAAHAF westwood_g_Page_048.tif
c75cb2bbe47d46d981bdc21527384d46
3d6432825026653ad7c4f03a4adfb696d5faa60c
911878 F20110209_AAAHMY westwood_g_Page_053.jp2
90e4167eb707ad765c34e7eaf630a289
a56bc39af9ad00b893eb0de670222e0001000f03
29538 F20110209_AAAHKA westwood_g_Page_084.QC.jpg
d9b723c93aac3c02f8704c9c90283c8a
8263beecff1cea8832abe79ebd7f9f3ea2abbb55
12113 F20110209_AAAHFD westwood_g_Page_007.QC.jpg
109cad98e7c9cef4f84173d592b09b31
a34260e489b587b05aa95015e161d0d538c3aa38
F20110209_AAAGYF westwood_g_Page_082.tif
184fd99f345f5b1b5e084f5007112a1d
33641c992a9545fe9e476b2f87cf6ee6fd58f375
F20110209_AAAHAG westwood_g_Page_049.tif
125f341f3259b71980a08e7f43b0d68b
8f3a4654fb8bc24b800e576616112f5b14ad457d
762539 F20110209_AAAHMZ westwood_g_Page_054.jp2
71d2a166b3db4d4aea43dc08dc100b83
62dfc495984561f869105d2408ee3c8237ab57c1
102534 F20110209_AAAHKB westwood_g_Page_085.jpg
fad2378a20dd5a751b459a266b3b1521
40dd17f853c051772891bae7216ed8b7b59620da
74284 F20110209_AAAHFE westwood_g_Page_008.jpg
3f585d2f3c4e013bf4b5f5698c2e026e
7fe812e70a5a03663ae2f3378077865916346681
1051955 F20110209_AAAGYG westwood_g_Page_048.jp2
2e6aa1ed688baba6c1b481d59de162eb
5fc56f2d623ef5a2d11751fa3204ce523d9040cb
F20110209_AAAHAH westwood_g_Page_050.tif
67161cbfbf24ede0c3c76c0c436dc6c0
92028697d52579359fc028ddd620819633d00b8c
33026 F20110209_AAAHKC westwood_g_Page_085.QC.jpg
4e86850e9c3556cde6669a90b6e2de1b
4bd3ff1848c4516040958167f5872d9dfd528bf9
22126 F20110209_AAAHFF westwood_g_Page_008.QC.jpg
3631e94deb2b2b544c4f79bfc928b2c6
1b31a750e4ed7d0f0393fd0fece6839289ce4ab4
801 F20110209_AAAGYH westwood_g_Page_011.txt
c31331439fc2a6fd8325f49e4c8c093b
0586e274ed9740a78c9a271d8e6b8f427c3dba6c
F20110209_AAAHAI westwood_g_Page_051.tif
91545cbba72ead86b6f78b72e7ecf1c0
5545be9d9cbdafb09139afd4853a8c1f17ad3531
7976 F20110209_AAAHPA westwood_g_Page_021thm.jpg
7f7741c1551634a4e03bb98e00cfae48
27c46f93ac76a3fa8888be15c5956469ef594ade
99905 F20110209_AAAHKD westwood_g_Page_086.jpg
b74c1420433440807fb95044fa4e9afb
8af0fe92dfc3454b89706241ba5b13ed8cb2031c
13067 F20110209_AAAHFG westwood_g_Page_009.jpg
5edd3974b806afce3b8757cbaa1b83ed
6464ed904e879a12cc9f058dcac6873bf3692ad0
27280 F20110209_AAAGYI westwood_g_Page_090.QC.jpg
f7760dd69f734f81e16b7e259149b6b9
63ab9b7670f72b5d1363f58555ee865137f36e9e
8111 F20110209_AAAHPB westwood_g_Page_023thm.jpg
0fbbe0c8cca038851fb91b1a57a0f3bf
28b3bd3f520848a98b68f25f2601427a3d772f1c
33304 F20110209_AAAHKE westwood_g_Page_086.QC.jpg
9d9a69a9bcf5367de5a70a69505f8283
8fba80f37fbff42db6cad9a43d371379f1bf2b64
3627 F20110209_AAAHFH westwood_g_Page_009.QC.jpg
1ddd25937c82e7f50189a923bda1fe22
befcaccda9aeec4dbd32167f27edd6bfa48cf59d
F20110209_AAAGYJ westwood_g_Page_094.tif
3979b1c09271235336edf9555720c9d9
41db9cb0dfa4562de58618173a14a85e337f7c91
F20110209_AAAHAJ westwood_g_Page_052.tif
8507903c53a5d07c9ab821ae818238ea
63b953e94774eddfca2860bd860e1263759992d1
7991 F20110209_AAAHPC westwood_g_Page_024thm.jpg
eff8795bb8dda7b0306a385cc48f17dc
e2469901c24f99ec836da58317bb31ecae711978
99380 F20110209_AAAHKF westwood_g_Page_087.jpg
bce420c9ed4026c3f904af233649b8c2
2bb2270ece96484145bf8d626d98d633fc92af50
38021 F20110209_AAAHFI westwood_g_Page_010.jpg
f0c95009f2db1661df2af563f13deb30
fc682296bb90f3186e8286e8f12ed7b3884dc1d2
F20110209_AAAGYK westwood_g_Page_034.jp2
c71e13517a3ca53c56213580b463780a
ea00397b7ea27215f0b7def4dd3664ae9d9568f3
F20110209_AAAHAK westwood_g_Page_053.tif
f3ecfb8b5ae9ea05c3611830ec34f2c3
22a0cf4f3cda9ea88a8ddab714af7027384fbdf6
7893 F20110209_AAAHPD westwood_g_Page_025thm.jpg
941c4e712250db43a451c0d55a380d56
2605460f33605eb657957ad3ad853afd1ba6cef9
31543 F20110209_AAAHKG westwood_g_Page_087.QC.jpg
8f272f543a33d8823ee0a60977c3caec
8c8495e75c1a851b36cab19583ae23fc5b8924b3
13486 F20110209_AAAHFJ westwood_g_Page_010.QC.jpg
a29bb262bcc2ad459382528ed4899a7d
de528f40d24f3170543c004aee8cd2a84ed7bacc
8340 F20110209_AAAGYL westwood_g_Page_064thm.jpg
3d911cace0e0117b4d915e078412ab06
37c2626cce79580e0b8b5f35d2310d9a2857da7d
F20110209_AAAHAL westwood_g_Page_054.tif
53a9f21a9a1aaea64331554177a4a7e1
bad1616c171525811014998887ef069f48a45f94
8005 F20110209_AAAHPE westwood_g_Page_027thm.jpg
325bfa959f04c8c8b5fa740d84c8c3a3
f491316fb1eb016901ec28156659338e42bf63ae
24371 F20110209_AAAHKH westwood_g_Page_088.QC.jpg
bf7672bf38feee5bf455f6e3d091a49d
8af989b999951efb385c8ade402810376e01ec73
34587 F20110209_AAAHFK westwood_g_Page_011.jpg
6771b3a3334006e12c9d61c5c2f7b667
ffcca74bc39e7c54637570401a8c8dca82882922
F20110209_AAAGYM westwood_g_Page_008.tif
18c77c2c2cec59821c93c94d73247648
7d1ae3bc995a5ff8710abb604af8fc0b81acf44b
F20110209_AAAHAM westwood_g_Page_055.tif
c227882493976fa73578167629259789
ba5fc13e5e8b238715102bfe636443e594a74ff9
8255 F20110209_AAAHPF westwood_g_Page_028thm.jpg
98d69bfc4537c5bbc016fbb6ac21b5c8
9f5500574879450a1c8f5068c38d5a2f921e993f
49333 F20110209_AAAHKI westwood_g_Page_089.jpg
d22e12ba42f13b5b771482749f3bf307
701818a74fd2dd10e1e9ed90a191c1d6c509ea7f
12345 F20110209_AAAHFL westwood_g_Page_011.QC.jpg
79cdfb94e1df640af495bcf91c9293fa
b89f68b057fa6ec1bf25ef9da4ad91c2c613f305
761774 F20110209_AAAGYN westwood_g_Page_038.jp2
c743c9497415ddffb08c6d2d2acdccba
bbeca1f239f471f04ddb9b9f20ab6469df793410
F20110209_AAAHAN westwood_g_Page_056.tif
bca2e8ca46c2ee38f5e664598fcd383a
603981774b03a9603bc6506d49d03662175f16d3
8094 F20110209_AAAHPG westwood_g_Page_029thm.jpg
b887054cf4ebcc5adcb42b0ed43445fc
47c59bb1fde0e7103426899927979c30c7edc477
100278 F20110209_AAAHKJ westwood_g_Page_091.jpg
4266972c274f4ee540986119f552c811
595d891ad6af1091f5500b2cbfef26f477e99955
87521 F20110209_AAAHFM westwood_g_Page_012.jpg
9291948814dea5cfe0ee63d7e439060b
a957fd61595f81e3b3569aa402a2f1cbd3e419ea
992679 F20110209_AAAGYO westwood_g_Page_066.jp2
c51e31abef093142e38b80b377e100b3
bd05f31207a33767203902fc40de03a027a278f5
F20110209_AAAHAO westwood_g_Page_058.tif
a83671ea63805f0c06986061c18fdfb1
12d7272daa50e9c339edfde58280933ac63cf06d
8120 F20110209_AAAHPH westwood_g_Page_030thm.jpg
443f9896d265a9002b66ea079416637a
6579bd6bd931c740199ab6aa929c54e28d095d8e
26133 F20110209_AAAHKK westwood_g_Page_091.QC.jpg
7ab6b7604ce293d83860f20dfddf53ff
73bc694b1a88aafff381862a655dd118559c091f
5881 F20110209_AAAGTS westwood_g_Page_105thm.jpg
993043eadc61b3b4b320fbc22c95a507
ee995dee4e7e9eb7948ece9548b8c6cc988092fd
26656 F20110209_AAAHFN westwood_g_Page_012.QC.jpg
4c1ff8c74afac76dbacdf477e14e41b8
399d91d1f3bb5d0600e6e87a0af20ba52551ad03
32894 F20110209_AAAGYP westwood_g_Page_024.QC.jpg
c181088f0e216a8c82391b92d5a25723
e91413ed551052d665cf3a81ca034d9611b920cc
F20110209_AAAHAP westwood_g_Page_059.tif
f5cec096c9ee46f02457c5cdd959db43
d885d05da5fce32a6d7c8e578dea9bfa06ddb89f
8312 F20110209_AAAHPI westwood_g_Page_031thm.jpg
c0d71bb443fb106d0cbb0cf098f4c181
81a61d4d1cf96e8c3ff28e1c1c70bd2d24cf7953
10753 F20110209_AAAHKL westwood_g_Page_092.QC.jpg
807a30587721dfc55c774b84df6f5bf8
b7d069fc1fb8d21f63e96634f3529a4839a1d5c0
F20110209_AAAGTT westwood_g_Page_042.tif
447b5f1c653077f7023ef159d05ca4dd
ee247598c3aab9a83f1312692958a53818c5e20c
86648 F20110209_AAAGYQ westwood_g_Page_045.jpg
092abc2f7e65cac681007e1d45467dfb
5b539463fc281df268ebbd716223428552f76d13
F20110209_AAAHAQ westwood_g_Page_060.tif
63fac7507f52f4015f692ad77600f095
83121647ed336a524e374b90129b0e9cb9237b3f
7728 F20110209_AAAHPJ westwood_g_Page_034thm.jpg
39301f46b3460b07bba67a982035496b
15f69ed44c5391a9d17c1cd0f7e5715f9f2fdc68
62003 F20110209_AAAHKM westwood_g_Page_093.jpg
b4bfdf1e78d97903a479b925bd0d6a0d
c073291c215a56044ca94820548ebe8d1498b287
F20110209_AAAGTU westwood_g_Page_063.jp2
ef6bd139edaf3e8f425ed570c28ef722
dfb55bdb499fa0099a29bbacc912b8c9f98b7810
20975 F20110209_AAAHFO westwood_g_Page_013.QC.jpg
9cff6d180ca48fded7d00fba68ade322
f9fcfd29b241a02f6c1f90fd025e9c403ab11e46
865384 F20110209_AAAGYR westwood_g_Page_055.jp2
36dcfaf0efb5af7ae8d20cb0a1877274
ec5233255332f2d483b11feaaded5a8c794f91e8
F20110209_AAAHAR westwood_g_Page_061.tif
31dc3ed9a5a9d323af0cb535cb2b2834
f8ed34900bca24a9dc0c2aa832dedeb54d75c7e5
4251 F20110209_AAAHPK westwood_g_Page_035thm.jpg
c5654c273329c628716435bc5b3c58ec
f0680fd3f8bd2ee487ed46cae01c92aacb9d0ea8
18430 F20110209_AAAHKN westwood_g_Page_093.QC.jpg
0b0ece965a8eac8a9473272d99dc9069
5585c08282fe7a19d9a15d113fa25697f81cbb6b
F20110209_AAAGTV westwood_g_Page_030.tif
9847a2b3d57f909d91ca72952f97897f
5b39a0fb9b20ce62444e677198cb19a00febf674
79569 F20110209_AAAHFP westwood_g_Page_014.jpg
bbbccc5e468d3d734923087c9782bf34
fe618cf443b22676411549bf058cea4abce2c8a0
30671 F20110209_AAAGYS westwood_g_Page_067.QC.jpg
21647167e2f37ce8aca965dc9abaf2ce
b82e75ef949e8f235eec508db7b75e6e91529b31
F20110209_AAAHAS westwood_g_Page_062.tif
fe9065f0019c9607d427d05ec389ed05
f348a09f838b8363e1129ae364826ee31ed11387
3019 F20110209_AAAHPL westwood_g_Page_036thm.jpg
097b07589dd16b91de8436ceba9f19a7
a21896ac8399f832f5ae67429c6f9d0449abf64d
96830 F20110209_AAAHKO westwood_g_Page_094.jpg
334b548a059bc4c6e3563dcdab94fb0d
3a49d663ef555bdbf088f621abbefc4ef98a5296
F20110209_AAAGTW westwood_g_Page_087.tif
3e8b8996966d004f1f618b8d4e2af4b5
f4934e5c50fff1bb811e3f70c703a589796d8046
26025 F20110209_AAAHFQ westwood_g_Page_014.QC.jpg
e8247fc8583142bcd7720448f197701c
b7223e05cc59af6e2bc601f5c96d54749c735130
134143 F20110209_AAAGYT westwood_g_Page_101.jpg
da9040f7f26aa1e48cee814a8ad3beba
b6d04b7802f3e4dd1e95cf2a0d533892a7f44ef0
F20110209_AAAHAT westwood_g_Page_063.tif
4083d547bc21354322b7e48b7f7c355e
587ce58b8c78ec8021f3e38a6267dae1aeb882ba
6650 F20110209_AAAHPM westwood_g_Page_037thm.jpg
a5af65f7f5cb81bef914a14a57553adc
ac872f044fa9f30f5ef3dddeb2fd5960b8fe7ed7
27995 F20110209_AAAHKP westwood_g_Page_094.QC.jpg
c24293aafdc4ea4a2ad9d717785de148
124dfe7f4edfa44edc952d0b508559b8952c665a
F20110209_AAAGTX westwood_g_Page_047.tif
d34dd65a643c310f9f47473e2cc1bc93
a0d70596fc6aef60ff3c739bba459884d0db79a7
100766 F20110209_AAAHFR westwood_g_Page_015.jpg
59935675e56e88dcd307b79e37ae4c78
acaec52eb601917d3d41b0811424322119af98dc
1889 F20110209_AAAGYU westwood_g_Page_065.txt
bbbf05fdebc5c1aaa6722f875b66587d
139b874a664c8c4b9d5347529dd48c4855961d93
F20110209_AAAHAU westwood_g_Page_065.tif
a814796b53176248feeee5ee07af8b54
595c1cfbeefa57407e19ef6f620f18be8f6a61ba
5078 F20110209_AAAHPN westwood_g_Page_038thm.jpg
ce5e41cda7bbfed91a08c84f80eda38f
14239ad9aba99031e57b51d013728a8f1c11c60d
128755 F20110209_AAAHKQ westwood_g_Page_095.jpg
e2f1c59e33319a3b8044fcc1e2221ccb
bc59a68021086901280ca449c36f0c3e6926d0b6
103838 F20110209_AAAHFS westwood_g_Page_016.jpg
7bd8afe7f44a79dce24c86c9db66bb14
adcd150b4f117882a1557a4b876afb027a173ac9
F20110209_AAAGYV westwood_g_Page_101.tif
cc36d72f6fabc4e8dc7334938ba79a05
c8253e60923affb5421c06c0cc330a5a81e0bc29
F20110209_AAAHAV westwood_g_Page_066.tif
844205be4aab469b9d0d2fcbf97693d5
7f9a77bd652b8b4287ef9ddeb7ef96ca56422e7d
487 F20110209_AAAGTY westwood_g_Page_001.txt
d944931268bd361766c39307f99aef4b
5de8d42f72554a03ec1a3823bdcb39d70e9847d4
5622 F20110209_AAAHPO westwood_g_Page_039thm.jpg
1cd2737015469420cbde52337ec8cf0d
16c184f592e7516ac78840a86003c8b8d6edfd47
35216 F20110209_AAAHKR westwood_g_Page_095.QC.jpg
1be459a2170a6e57e9b1338f1195400d
c8dc4a0a798ce77000c25aa62b29462b951996b5
34278 F20110209_AAAHFT westwood_g_Page_016.QC.jpg
50e17afe47e46139ce8a394c7b9e1ee1
0898f21381f61c7f46df68720c6460b349387de9
145956 F20110209_AAAGYW UFE0015542_00001.xml
d3603c6da9fe6478971331e608706c35
2472ab88b0dfa58d73142d9441b7a83db9459140
F20110209_AAAHAW westwood_g_Page_067.tif
abe362872128092491c8b03442bf6487
e24d149496b2f9bbc33faae5348108cd01cfb472
5355 F20110209_AAAGTZ westwood_g_Page_013thm.jpg
7960d5640d7b7992ccb7288999ecf9ce
6e4e3296347ff1e01515754be89cc697c9672aa2
3095 F20110209_AAAHPP westwood_g_Page_040thm.jpg
29f4306471cc6dca245ddb5de1e5ad7b
6c1caabb0b00a3b45071b8dc317711a8e9e89894
124677 F20110209_AAAHKS westwood_g_Page_096.jpg
f15e5dccc89d26de7cfb8b44f5d162ec
4a01e5f414776410f5707ce90aa23d7686023a2f
99139 F20110209_AAAHFU westwood_g_Page_017.jpg
a6baa83c761a91a176f44c739e0edc8d
23788107239ff4af1f59dc0b6934b9d64707be34
F20110209_AAAHAX westwood_g_Page_068.tif
1b0b6cf7bb35fee1e65a867a71ee42fb
40575a47d3413c63d5ef4cead77112da2fc4a29d
F20110209_AAAHPQ westwood_g_Page_042thm.jpg
5f2aa526b3cc2e09ea5c56093b90ff32
a762711e162b07b748e54a58cff876381edb75d9
31791 F20110209_AAAHFV westwood_g_Page_017.QC.jpg
d41f54d03689918b97174457238871b2
4de5d4c526fa29464eac0d47045bf61a551294d2
F20110209_AAAHAY westwood_g_Page_069.tif
e3e60b8bcbb7a55f9d4213f22f47bd62
b40792a99616db800d63add77841c87e279678d9
7805 F20110209_AAAHPR westwood_g_Page_046thm.jpg
0849fcea61e172558127e859dea18154
f138f12fc866a9ed5ab8f1789b555c87f8d0fe72
34770 F20110209_AAAHKT westwood_g_Page_096.QC.jpg
05f1011c0504a2f19a242f691f402d59
7e5835336702419eed11cc72a193bf366ed28edd
90982 F20110209_AAAHFW westwood_g_Page_018.jpg
a69dca9d5e4418cb730f1334cbab67f8
557d2f17761d4f4834bbb3da51222b25c5c225c3
5632 F20110209_AAAGWA westwood_g_Page_082thm.jpg
231b671194d461e1204ce1a232bc87f1
4f3798dbdbc552dd81ee75fe69b2d35fdd5ff61a
F20110209_AAAGYZ westwood_g_Page_001.tif
17dc60501a1f1f61b4d350b0c9126311
f2d444c25482819c4f65330cce3242dee424f54a
F20110209_AAAHAZ westwood_g_Page_070.tif
eae4b1d085b65224fda425f726527e3a
3421076b213c7171b3c7daa26dd9de0e196562fb
8356 F20110209_AAAHPS westwood_g_Page_048thm.jpg
79cc9c9339a83a9944faf9fe2c103381
2b2fb286e8b97ca86d6e233fa65db1cb607ef1db
117965 F20110209_AAAHKU westwood_g_Page_097.jpg
f289e1e24837799bacc6698650d37544
6a54477eda01156c772775997adcc8d7f78137d9
29237 F20110209_AAAHFX westwood_g_Page_018.QC.jpg
68994e4f3744ab276149a5c5bf3cc6b5
cd814cea381bbb32d8491d5521637cbee0ced2b3
30923 F20110209_AAAGWB westwood_g_Page_061.QC.jpg
bd8699b4f437bbbb4b97b01206713ade
4a8ef9180dde609d8f01c44c5b5c5f7db718c54a
8225 F20110209_AAAHPT westwood_g_Page_050thm.jpg
cb96373c0a7eeca00bea237a930b521d
81970ca95052c9b3df73306759559d462191ea8f
33721 F20110209_AAAHKV westwood_g_Page_097.QC.jpg
1177f26923cfb3aa827c83ac74637856
d64d41cb2e95c5f1d16e5c06d0b169d03fed9af2
94965 F20110209_AAAHFY westwood_g_Page_019.jpg
444f05a1c5ec0f4666637607f071faab
2866c314863c01b76e9ca64187ff5eba9809c0cd
F20110209_AAAGWC westwood_g_Page_066.txt
ccedf5b8f658c095ff5b05c7efd624a4
fb789ffb7c5b31d9896230dcf728aeacfdf2c01a
1886 F20110209_AAAHDA westwood_g_Page_034.txt
5d9d404c6a1ed00c47b4774d30e0d387
3ddcb720772987866538b42955aaaa8923e572f6
8459 F20110209_AAAHPU westwood_g_Page_051thm.jpg
c35e212245e4ae685462de3187413efe
f08adf9c175e889d233372cfb92431dff00d18ad
34024 F20110209_AAAHKW westwood_g_Page_098.QC.jpg
5608aef37698d3df5077f3537ef455a5
1aed4a170603ce9f1cc0db552b9701f315cac387
32317 F20110209_AAAHFZ westwood_g_Page_019.QC.jpg
034f923cbd7fe087a4949fd2b46a1b1b
88cbe27bf061ad907f745634d79c4ec417ad40c1
1943 F20110209_AAAGWD westwood_g_Page_022.txt
1ba541f8a0104c3a17567d4dd1693c47
0b6b83110f2a50abb6093053786a4e619b305734
950 F20110209_AAAHDB westwood_g_Page_035.txt
7533e396e401c9f63ac38aff0024ed5d
fc2c6eef69f877847dfb96ecbd718c656d6178cb
8393 F20110209_AAAHPV westwood_g_Page_052thm.jpg
b02b0ef2462c5cd7259dc6884117427c
ed5017acce19736fdc2b637ac495c692705c6cb9
127337 F20110209_AAAHKX westwood_g_Page_099.jpg
a7f516152b99eabf2e7d36aabb375c32
48a9db232017e3fa2ac9938612eaf93588b9ec88
33787 F20110209_AAAGWE westwood_g_Page_015.QC.jpg
d74d6778cce96cbbcd88d2e2b2ccc07e
1dfc4b07b7432d25be438b876e772380177d8a61
618 F20110209_AAAHDC westwood_g_Page_036.txt
4a40a6b6954c27fe9257d250611b912c
8b1677fe9bb83b1e93764c31a9be2ebc810a09d7
7131 F20110209_AAAHPW westwood_g_Page_053thm.jpg
b146135a33f8532157607ab1534b24e5
e4887c9760452176424a0e86c4bf919e10ccf6d6
34985 F20110209_AAAHKY westwood_g_Page_099.QC.jpg
8c40dc1c6c96a273c108100f75ddf921
824cbc46ce202e21d919f542e0aaa9bf2ce1fe18
7132 F20110209_AAAGWF westwood_g_Page_041thm.jpg
31859318d141815bf04a663530524428
ca3c2795cf6103984bf9cc27510442ae041aa539
75666 F20110209_AAAHIA westwood_g_Page_054.jpg
cac0b1dc9dcd43b466fc7f2f810c81c7
0d75ae6298ae3be23b5fc8d7f9991d3d2fbafa26
1438 F20110209_AAAHDD westwood_g_Page_037.txt
ad1db91adb5584139f41b62b1b607f4e
2cdff79f0bb0d83a219895f3d8d88a5fc5ff0427
6769 F20110209_AAAHPX westwood_g_Page_054thm.jpg
32d62b9bbbeb59482ade026fec00f5f5
ef72de91ba01a2af29825e98f7869bb461fcb2b7
111971 F20110209_AAAHKZ westwood_g_Page_100.jpg
0d9211a5fc692b3fa5ae6e5ce7f8fafe
4e139a6e4dd05235cef84b146a8372c5c133f389
553661 F20110209_AAAGWG westwood_g_Page_035.jp2
758633238df6822b46090d0b6a63989f
277c201bfe63923fe15bc55281be6320dfb7c3d5
24103 F20110209_AAAHIB westwood_g_Page_054.QC.jpg
7a2ce0cf63754ac68f6655ecf8051d01
dfd6ec2eab00af69cd9cf89e7041325280d97840
2174 F20110209_AAAHDE westwood_g_Page_038.txt
714fa16f34eebedd276a5d42a0185d60
e357fa2168100e5aa6a417dfe37c8101c7bb6766
6205 F20110209_AAAGWH westwood_g_Page_078thm.jpg
90bbd3d5f40359bcaa5a4b8ad058bb71
ed4e25cf3e76515f544eda744e3fd9139fdf4f84
83997 F20110209_AAAHIC westwood_g_Page_055.jpg
b6af7523bbbddd76a86f170654b74abc
cc61973c960a96845d073640342be4c5f46b3a1c
844 F20110209_AAAHDF westwood_g_Page_040.txt
0c93266a6a899c7fece953717473ea88
30ac356e45b07467660b57aae8294ff3e8be46e7
6702 F20110209_AAAHPY westwood_g_Page_055thm.jpg
9083030ee5e9c6dc1c41e12f5192ce8b
a6470dec6d2cd9ade8473d1ad3eefc288fadcf15
954417 F20110209_AAAHNA westwood_g_Page_056.jp2
6d447444d1a5215eb89b6bb93d48af7b
7122e763320e093c5c9cdfb4a6c40fccf8ed7138
8731 F20110209_AAAGWI westwood_g_Page_047thm.jpg
33476a23e95c100dc9ea4911892d1929
fe2e1057bf5ab76c30728b7fb797b7591762ae36
24264 F20110209_AAAHID westwood_g_Page_055.QC.jpg
1ba926f506480430d1fa013bee5407cc
327ba53bb3a7bea743aeb695221d8f680f12b654
1808 F20110209_AAAHDG westwood_g_Page_041.txt
4790dba772f0b362afb551268653dd8d
a9de2c0887d63c853dd6b5a7402ae08a1127851c
7985 F20110209_AAAHPZ westwood_g_Page_058thm.jpg
3e284b36ed78559a5484df57ff8a1d5c
9a9d3ba4b2d60f13d9a44fcaed967189dff4fa5e
F20110209_AAAHNB westwood_g_Page_057.jp2
facd95df7f1d7ca64a908036537d2c9e
75a4c12930e28a3af40a78c87832e9c88945c32f
691300 F20110209_AAAGWJ westwood_g_Page_004.jp2
5f36135d08a5bb193d6adf26a8d05819
f3b219e2b678a99dd0bca296c96ef573aa9c0182
87276 F20110209_AAAHIE westwood_g_Page_056.jpg
0d0d691286e4053696dfa28ecf3141a5
e102e146b5332cb52e702c78154e0e9a21828260
1964 F20110209_AAAHDH westwood_g_Page_042.txt
7db45a9388b656f5f1d6a6acc800a540
becf7bbfb4bc9ef7747c6ef7e15d12d5a9711fd6
F20110209_AAAHNC westwood_g_Page_058.jp2
61110334a945a080790b1b67da24b35d
ddd766912122975b8bc5bfd31325509cd6d21def
758679 F20110209_AAAGWK westwood_g_Page_105.jp2
d96c4c319a2850e3d0988de2fbb2fc67
7c0fc5b65322363741be478e7a8102e6e1aa6ee5
28347 F20110209_AAAHIF westwood_g_Page_056.QC.jpg
3e8d475624c72a4d03331a0b495997b6
f80624316292150c6ebc6316375c405513bc861d
1732 F20110209_AAAHDI westwood_g_Page_043.txt
cc21cd795ac32cc70f4dbc45c994ee2f
e7b0ce47e3dab5cc4da47c28f9efbf90be593c5f
996801 F20110209_AAAHND westwood_g_Page_059.jp2
ddea6c0d858551d46ead24ee092d9d6a
51f1b884b8b9d294bf0847627274f2fbd7413f28
1624 F20110209_AAAGWL westwood_g_Page_014.txt
74bd7c53d26ff8b3b93ca1007698a2e0
c821b2e70a9df357425a4f0b43c82b54d4cb59d0
101410 F20110209_AAAHIG westwood_g_Page_057.jpg
6e01d32ccf8fb7fb906b1b1655671545
18b56fd8d8aff9679a4d02346ffb376e332ea7bd
1768 F20110209_AAAHDJ westwood_g_Page_044.txt
e4897e8ff7a6f1cf93e67cfc7334ff3e
be9ae046dc9e5e3455c321ecbab5e97e3d8f506a
1031441 F20110209_AAAHNE westwood_g_Page_061.jp2
75ae94fd7c3107123eddf6d610bed69c
17307ae3488868edacb0a254fe286251bf05b5f4
622 F20110209_AAAGWM westwood_g_Page_003thm.jpg
4bc90754fccd5a6e7f473667a4922165
4e0f58b2e3f8d272dbb8ca0022d0c4f24a3d11c3
32129 F20110209_AAAHIH westwood_g_Page_057.QC.jpg
c635c61d69956e6b9f30a1958cd81e8e
3ef9dfe19e7ebead31787075ee357f11e8a03150
1840 F20110209_AAAHDK westwood_g_Page_046.txt
e95f79e323fce581a6ffecbf28d01d47
0c5bfc1386513fefb063819a5a337e80a047b4af
1051934 F20110209_AAAHNF westwood_g_Page_064.jp2
52a64b9dfc4b0f1154928a3ccf8fc967
51ed8645327d61bdf8ccc2aaffdfe4cf652ba60f
F20110209_AAAGWN westwood_g_Page_033thm.jpg
50ff3f0de3058fe3d1819176566c0446
62fc0447d9fe7b0f0d78121578d53806f32efbf7
94878 F20110209_AAAHII westwood_g_Page_058.jpg
c37f137269bd9e7daba141f4c67cb21a
b65b2cc063b3f6334b0a0cd69e292c2fe969cb7e
2127 F20110209_AAAHDL westwood_g_Page_047.txt
ed76b9032d5a44005395c0dad6017ef5
9557ccd79a2bd6964a450ae7a8c9596f95b24ef0
F20110209_AAAHNG westwood_g_Page_065.jp2
9f7691ee802fbc576b91edd2808e3f54
ac06e2e4fc92fa21e87ecf3f9bf35a1a0868f147
35834 F20110209_AAAGWO westwood_g_Page_102.QC.jpg
39049d5b212a56e32400e108a8dcf339
83598fb7eea1d678a268c5c18f6407fdc5c50d90
31722 F20110209_AAAHIJ westwood_g_Page_058.QC.jpg
f3570246e829da0fefe66629c851313c
d95627b20e1d1b2cd7300f8127be1d1a5575ea6c
F20110209_AAAHNH westwood_g_Page_067.jp2
501d0a8ebbc2f86b406dc2534984ed86
ee520e67430791d50df63a0c5dbae65e59ecade1
28162 F20110209_AAAGWP westwood_g_Page_001.jpg
fb92898b4ce3fbc0b7f296b2d814275f
6641d7380001fff01cdd1813060587c0d1c5b37a
92237 F20110209_AAAHIK westwood_g_Page_059.jpg
7d0315dcf51d1432bbca60df2f270c62
21e110ee093d3da9cb70a60cc7debbb161c6ad37
F20110209_AAAHDM westwood_g_Page_048.txt
0a220b565905867a406fbdf85256cbe0
2ef63767a0b829ba97cb7a545853f4d686ec7157
F20110209_AAAHNI westwood_g_Page_068.jp2
55b04ff00249feaa69066160ea5d019a
a38aa6b63c1ba425aca34c17b45fd33648aa4b2c
31364 F20110209_AAAGWQ westwood_g_Page_034.QC.jpg
70b4681da72b8d706301381fc9f311c9
1e08e5a7e76aa395df0923c4d4574ce2a5ae23f1
30140 F20110209_AAAHIL westwood_g_Page_059.QC.jpg
32e70d1a07f977e450e06cb984065ce4
cde935a4d5422a20d7e3f135fabaee56d4736c22
F20110209_AAAHDN westwood_g_Page_049.txt
295d998e434e41f543e94ca8cf15b4b0
7db1c94d242caf33a3cde17399cd816f9616beca
989449 F20110209_AAAHNJ westwood_g_Page_069.jp2
9a7e13d0f8715cac53c720905a6a7d4a
d91b5ca988a2f7dd9706f5cc9523a154fcc16094
33861 F20110209_AAAGWR westwood_g_Page_048.QC.jpg
20f3776b2bf518124f7a451b258a1feb
18340a13f3e18829f3d91d24aeda6f09f3b8f78f
105305 F20110209_AAAHIM westwood_g_Page_060.jpg
164dd474344c85c28902c00ace14172f
fb9116e96ae4d64eb6c24c4f095643e68f456ce1
F20110209_AAAHDO westwood_g_Page_050.txt
d57e618f05c22cc7b149138adbd148b1
3e3dc9814c062b398ca572c2e617e3a7706de4d0
F20110209_AAAHNK westwood_g_Page_070.jp2
a6a26696761889ed100988bc800e45b1
8735a40e6ace3d7fba375c803d3875e447c8208c
1211 F20110209_AAAGWS westwood_g_Page_009thm.jpg
67ae8ffae9bb5193c43b6b746a3eee1a
4bfbd47c7ff97f472af72f06244588341e374516
33933 F20110209_AAAHIN westwood_g_Page_060.QC.jpg
52ba6ecbf1ca9760ce926fb61a2e360e
5173575ed4e31a2f7d7d1858a44f6b8633aa31ed
1982 F20110209_AAAHDP westwood_g_Page_051.txt
70b137cd96712613d45c960b76576f86
a73ac7d9ea7155367cf3e29f46fbf673645693e1
837572 F20110209_AAAHNL westwood_g_Page_071.jp2
58fe448f1a17627a2d162d9780006ae7
d5f6f5a8a81ed63b1df3c07ecaed09675897d53b
F20110209_AAAGWT westwood_g_Page_022.tif
83a23e7de23fe2937472f7084479573a
3b62b7b7f802fddfe33154b88dce409ee0047714
93245 F20110209_AAAHIO westwood_g_Page_061.jpg
de2c3dad7c70b408772b8c8562846d74
045e6a913b493b3eefadc21fd521c94f52ea938e
F20110209_AAAHDQ westwood_g_Page_052.txt
97ca0c1d65aa33d0d401fcbbc9f9a303
b1a6cf7ee817e10444679316425570d39c68a098
434700 F20110209_AAAHNM westwood_g_Page_072.jp2
31ebeba029e854f2edd4c618aa291e6f
cc591182f750ce95020386c611d0d8d59f45b838
32944 F20110209_AAAHIP westwood_g_Page_062.QC.jpg
bb8dea1916ff60bcd2670a6c407324f4
bbff336b09d964314f08c650d62e343021ff0e93
1393 F20110209_AAAHDR westwood_g_Page_054.txt
13f23a07dcab06a253b3f8bc6ba46a76
bcccb8c06854a551def97d83d6d895627bbc6993
F20110209_AAAGWU westwood_g_Page_057.tif
6fdd9b6214227e86e994467f97666969
c80c973a9245d50d3e6480291e39ae51dd271362



PAGE 1

STUDIES ON THE ENTOMOPATHOGENIC FUNGUS Beauveria bassiana : MOLECULAR AND IMMUNOLOGICAL C HARACTERIZATION OF ALLERGENS By GREG S. WESTWOOD A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Greg S. Westwood

PAGE 3

To my wife and children; they are all that truly matter.

PAGE 4

iv ACKNOWLEDGMENTS I would like to extend my deepest appreciation to my mentor, Dr. Nemat O. Keyhani, whose guidance and direction is reflecte d in every passage of this work. It was under his tutelage that I was able to see my true potential, and understanding of the role research will always play in my life. I w ould also like to thank th e other members of my committee, Dr. Samuel Farrah, Dr. Peter Ki ma, Dr. Howard Johnson, and Dr. Jeffrey Rollins, for all of the advice and encouragement they extended in this challenging stage of my education. I owe a debt of gratitude to Dr. Shih-Wen Huang, who provided the patient sera that played a pinnacle role in our study of a llergenicity; without hi s help, this research would not have been possible. In addition, special thanks go out to all individuals, who devoted their time to assistant to this research ; especially in reference to the injection of foreign extracts into, and/or the donation of, bodily fluids. Finally, I would sincerely lik e to thank fellow graduate students Lawrence Flowers and Nicole Leal whose friends hip and scientific insight ha d a dramatic affect on my personal and educational development.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii LIST OF ABBREVIATIONS..............................................................................................x ABSTRACT......................................................................................................................xii CHAPER 1 INTRODUCTION........................................................................................................1 History of Allergy.........................................................................................................1 Hypersensitivity.....................................................................................................2 Immediate Hypersensitivity...................................................................................3 Allergic Disease.....................................................................................................4 Fungi.......................................................................................................................... ...6 Spores and Conidia................................................................................................6 Health....................................................................................................................8 Nomenclature........................................................................................................9 Major Allergenic Fungi.......................................................................................10 Alternaria alternata ......................................................................................10 Cladosporium herbarum ..............................................................................11 Aspergillus ....................................................................................................11 Cross-Reactivity..................................................................................................13 Beauveria bassiana .....................................................................................................15 History.................................................................................................................15 Physiology/Life Cycle.........................................................................................16 Agricultural/Economic Importance.....................................................................17 Disease Control...................................................................................................19 Research Overview.....................................................................................................20 2 ALLERGENICITY.....................................................................................................28 Introduction.................................................................................................................28 Material and Methods.................................................................................................29

PAGE 6

vi Strains and Cultures.............................................................................................29 Extract Preparation..............................................................................................30 Precipitations.......................................................................................................30 Western Blotting..................................................................................................31 Enzyme Treatments.............................................................................................32 Immunoblot Inhibition.........................................................................................32 Skin Sensitivity Profiles to Fungal Extracts........................................................33 Intradermal Skin Testing.....................................................................................33 Results........................................................................................................................ .33 Identification of IgE Reactive Bands..................................................................33 Immunoprint Analysis of B. bassiana : Reactivity with Individual Sera.............34 Intradermal Skin Testing.....................................................................................36 Cross-Reactivity among Different Fungi............................................................36 Discussion...................................................................................................................37 Conclusion..................................................................................................................40 3 MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF PUTATIVE b. BASSIANA ALLERGENS..................................................................43 Introduction.................................................................................................................43 Materials and Methods...............................................................................................45 Strains and Media................................................................................................45 RACE PCR..........................................................................................................45 Cloning................................................................................................................46 Expression...........................................................................................................46 Western Blot and Immunodetection....................................................................47 Analysis Programs...............................................................................................48 Results........................................................................................................................ .48 Cloning and Sequencing......................................................................................48 Protein Expression...............................................................................................50 Effect of Denaturing Conditi ons on Expressed Proteins.....................................51 IgE Reactivity......................................................................................................51 Phylogenetic Comparison....................................................................................54 Discussion...................................................................................................................55 4 CONCLUSIONS........................................................................................................71 Allergenicity of Beauveria bassiana ..........................................................................72 Characterization of Allergens.....................................................................................73 Future Experiments.....................................................................................................74 APPENDIX ADDITIONAL FIGURES AND TABLES...............................................76 LIST OF REFERENCES...................................................................................................81 BIOGRAPHICAL SKETCH.............................................................................................92

PAGE 7

vii LIST OF TABLES Table page 1 Common allergens....................................................................................................23 1 Major chemical mediators of activated mast cells...................................................25 1 Fungal allergens.......................................................................................................26 2 Allergic profile of patients A G, obtained by skin testing......................................41 2 Intradermal skin test.................................................................................................42 3 PCR Primers.............................................................................................................57 3 Cloning vectors........................................................................................................57 3 Allergens with sequence similarities to B. bassiana ................................................58 3 Result of RACE PCR...............................................................................................59 3 Enolase accession numbers......................................................................................70 A Taxonomy of Beauveria bassiana ............................................................................76 A Molecular properties of B. bassiana genes..............................................................76 A Accession numbers...................................................................................................80

PAGE 8

viii LIST OF FIGURES Figure page 1 Illustrating the central role of IgE activated mast cells............................................24 1 Life cycle of Beauveria bassiana .............................................................................24 2 SDS-PAGE and Immuno blot analysis of B. bassiana .............................................40 2 Immunoblot analysis of B. bassiana extracts...........................................................41 2 IgE immunoblot inhibition with fungal extracts......................................................42 3 cDNA vs genomic....................................................................................................60 3 Illustration depicting genomic gene sequences........................................................60 3 Genomic nucleotide sequence and amino acid translation of bbeno1 .....................61 3 Genomic nucleotide sequence and amino acid translation of bbf2 ..........................62 3 Genomic nucleotide sequence and amino acid translation of bbald ........................63 3 Genomic nucleotide and amino acid sequence of bbhex ..........................................64 3 SDS-PAGE gel of uninduced a nd induced expression cultures,..............................65 3 Coomasie Blue stained 12% SDS-PAGE gel...........................................................65 3 Immunoblot probed with. 10 sera per pool..............................................................66 3 Immunoblot probed with. 2 sera per pool................................................................66 3 10%SDS-PAGE gel stained with Coomasie............................................................67 3 Immunoblots probed with pooled sera.....................................................................67 3 Immunoblots of BbAld protein stri ps probed with 1 sera pools.............................68 3 Immunoblots of B. bassiana proteins.......................................................................68 3 Enolase phylogram...................................................................................................69

PAGE 9

ix A Clastalw alignment of BbEno1................................................................................77 A Clastalw alignment of BbAld...................................................................................78 A Aldehyde dehydrogenase phylogram.......................................................................79

PAGE 10

x LIST OF ABBREVIATIONS Amp ampicillin C degrees centigrade Cam chloramphenicol cDNA complementary deoxyribonucleic acid ddH2O distilled deionized water DDT dichloro diphe nyl trichloroethane DNA deoxyribonucleic acid E. coli Escherichia coli ECF-A eosinophil chemotactic factor A EDTA ethylenediaminetetra-acetic acid EST expressed sequence tag HCl hydrochloric acid Hr hour HRP horseradish peroxidase IgE immunoglobulin epsilon IgG immunoglobulin gamma IPTG Isopropyl--D-thiogalactopyranoside kDa kiloDaltons LB Luria Bertani media LDS lithium dodecyl sulfate

PAGE 11

xi g microgram L microliter mg milligrams min minutes mL milliliters mM millimolar MOPS 3-(N-Morpholino) -propanesulfonic acid NCF-A neutrophil chemotactic factor A OD optical density PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction PD potato dextrose PMSF Phenylmethylsulfonyl fluoride PVDF polyvinylidene-fluoride SDS sodium dodecyl sulfate SSH suppressive subt ractive hybrid ization TBS tris-buffered saline Tris tris hydrozymethyl aminomethane tRNA transfer ribonucleic acid x G gravity

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy STUDIES ON THE ENTOMOPATHOGENIC FUNGUS Beauveria bassiana : MOLECULAR AND IMMUNOLOGICAL C HARACTERIZATION OF ALLERGENS By Greg S. Westwood August 2006 Chair: Nemat O. Keyhani Major Department: Micr obiology and Cell Science Beauveria bassiana is an entomopathogenic fungus currently under development as a biological control agen t against a wide rang of arthropod pests. Although B. bassiana has been reported to be non-toxic to vertebra tes, its potential alle rgenicity has not been studied. Fungal allergens constitute a significa nt proportion of the airborne allergens that affect up to 25% of the population of the industr ialized world. This dissertation examines the ability of B. bassiana to elicit allergic reactions, and describes the immunological and molecular characterization of IgE bindi ng proteins present in this fungus. Immunoblot analyses of B. bassiana proteins probed with pooled and individual human sera revealed IgE reactive antigens, ra nging from 12 to >95 kDa. Variation was noted when blots were probed using individual sera, howev er a 35 kDa protein was the most frequently reactive B. bassiana antigen. Immunoblot in hibitions experiments identified the presence of shared epitopes between B. bassiana and the extracts of several common allergenic fungi (cross-reactivity). IgE binding of the 35 kDa protein was not

PAGE 13

xiii inhibited by any of the funga l extract tested, indicating the possible presence of a B. bassiana specific antigen. Intradermal skin testing confirmed the in vitro results, demonstrating allergenic reactions in a numbe r of individuals, including those who have had occupational exposure to B. bassiana Screening of a B. bassiana cDNA library revealed a number of proteins with sequence similarity to major fungal al lergens. Full length clones of the B. bassiana genes were obtained by 3 and 5 RA CE PCR, and designated as; bbeno1 bbf2 bbald and bbhex All four proteins were expressed in E. coli BbEno1, designated an enolase by sequence similarity, was compared to 20 ot her fungal enolases including five known to be allergenic and cross-reactive. Phyloge nic comparison showed allergenic (and crossreactive) enolases are not limited to closel y related taxa, but ar e equally distributed throughout the phylogram. Immunobl ot analysis of the four B. bassiana proteins revealed BbEno1 and BbAld to be reactive to sera IgEs, and therefor e represent the first allergens to be identified fr om the entomopathogenic fungus Beauveria bassiana

PAGE 14

1 CHAPTER 1 INTRODUCTION History of Allergy The term allergy was coined in 1906 by a Viennese pediatrician named Clemens von Pirquet to describe a hypersensitive immune reaction in response to a substance other than a typical disease causing agent (Wagner, 1968). The word allergy, was derived from the Greek words allos meaning "other" and ergon meaning "reaction" or "reactivity." The word allergy is most commonly used in reference to type I, or immediate onset, hypersensitivity which is characteri zed as an inflammatory reaction caused by excessive activation of IgE bound mast cells in response to a specific but typically benign antigen. The most common clinical aller gy symptoms, hay fever, include runny nose, itchy eyes, and sneezing; however severe alle rgic reactions can l ead to anaphylactic shock and even death (Gould et al ., 2003; Kurup and Banerjee, 2000). Allergens known to affect large groups of people are designated as major allergens and are typically common place in the air we breathe (Table 1-1); a recent survey found that over 54% of US citizens tested positive for sensitivity to at least one allergen (AAAAI, 1996-2001; Arbes et al., 2005). Outdoor allergens include indu strial pollutants, pollens, and other plant mate rials; common indoor allergens include pet dander, dust mites, and cockroach feces. Fungal spores c onstitute a significant portion of both indoor and outdoor major allergens.

PAGE 15

2 Type I hypersensitivity is a gr owing problem; allergic diseas e is projected to effect 20% of the population of the worlds industri alized nations and of those, 10% develop severe allergic disease (Horne r et al., 1995; Kurup et al., 200 2). The National Institute of Allergy and Infectious Diseases estimate that about 50 million Americans are affected by allergic diseases in the United States alone with allergies constituting the sixth leading cause of chronic disease. The cost associated with allergic disease is estimated to exceed 18 billion dollars annually (AAAAI 1996-2001; Sagi-Eisenberg, 2002). Hypersensitivity Hypersensitivity results from over stimulati on of the immune system to an antigen, considered benign typically. Hypersensitivi ty has been characterized immunologically into four types based on thei r clinical symptoms and underl ining mechanism (Horner et al., 1995). Type I, or immediate, hypersensitivity is an activation of mast cells and basophiles by antigen specific membrane bound IgEs. Type II is mediated by the binding of IgE or IgM to a specific antigen on the surface of a cell leading to the destruction of the cell. This process often involves the classic comp lement pathway and is usually associated with hemolytic disease. Blood group inco mpatibility is an example of type II hypersensitivity. Type III is caused by th e formation of antig en antibody (ag-ab) complexes of circulating IgGs, which bind to and activate mast cell via Fc RIII low affinity receptors. Ag-Ab complexes also interact with blood vessel walls which are damaged by a massive infiltration and degranul ation of neutrophils activated by the mast cell cytokines. Type IV or delayed hypersen sitivity is mediated by antigen specific Th1 cells, which lead to the release of cytokines responsible for the recruitment and activation of T-cells and macrophages.

PAGE 16

3 Traditionally the term allergy is used to refer to conditions caused by type I (immediate) hypersensitivity; however, many alle rgic or hypersensit ive disease are not cause by a single type, but result from the comb ined effects of two or more types. This has led to a broader definition of the term a llergy. The Institute of Medicine defines allergy as The state of immune hypersensitivity that results from exposure to an allergen and is distinguished by over production of immune system components (Pope, 1993). In this dissertation the term aller gy is used to describe diseases or conditions that are caused by type I directly, or in which type I plays an essential role. Immediate Hypersensitivity A type I hypersensitive or allergic reac tion is mediated by antigen specific IgEs bound to mast cell and basophiles by a high affinity surface receptor, Fc RIb (von Bubnoff et al., 2003). The reaction is initiated when the binding of an allergen leads to the cross linking of two receptor bound IgEs (Figure 1-1). The cross linking of IgEs triggers a host of cellular res ponses resulting in the release of several chemical mediators (Table 1-2). The first and most dramatic of these is the immedi ate degranulation of storage vacuoles containing the primary vasoactive amine mediators as well as molecules including proteases, hydrolases, and chemot actic factors (Kawakami and Galli, 2002). These mediators and associated factors ar e responsible for the clinical symptoms associated with an immediate inflamma tory response. The cross linking of Fc RI receptors also initiates the de novo synthesis of secondary mediators including leukotrienes and cytokines which are respons ible for the onset of the late-phase inflammatory response (Sagi-Eisenberg, 2002). The vasoactive amine, histamine, is the dominant molecule released by the initial degranulation of an allergen-a ctivated mast cell (Shim et al ., 2003). It is responsible for

PAGE 17

4 triggering numerous cellular responses de pending upon the nature of the surrounding tissue. Its primary function, however, is as a vasodilator leading to vessel leakage and swelling, or inflammation of the surrounding ti ssue. Proteases including, chimase and tryptase exacerbate this pro cess by degradation of blood vesse ls and basement membrane. Chemotactic factors including ECF-A (eosi nophil chemotactic factor A) and NCF-A (neutrophil chemotactic factor A) lead to an influx of secondary leukocyte. Activated by the mast cell mediators these secondary leuko cytes secrete their own mediator molecules causing additional tissue damage as well as the recruitment of ev en more leukocytes. Leukotrienes and prostaglandins are ar achidonic acid metabolit es that act as secondary mediators. They increase vesse l permeability and cau se contraction of pulmonary smooth muscles. Other cytoki nes produced by mast cells act in the recruitment and activation of platelets a nd leukocytes, drawn into the area by the chemotactic factors. The actions of leukoc ytes, such as eosinophils and neutrophils, result in the clinical symptoms of the late phase reaction (Goldsby, 2000). Allergic Disease Atopic allergic disease refers to the imme diate hypersensitive response mediated by IgE. Allergic response occurs at the locati on of antigen contact, and the most common tissues affected are those of the respirator y and digestive tracks, although the eyes and skin are also susceptible to contact with allergens. Allergy to aeroallergens or hay fever is one of the most comm on allergic diseases and is characterized by symptoms including rhinitis, coughing, sneezing, nasal discharge, and conjunctivitis (itchy or wate ry eyes). More severe case s can lead to constriction of bronchia (asthma) manifested as a shortness of breath (Shim et al., 2003). Skin reactions

PAGE 18

5 to dermal contact with an allergen include urticaria and ec zema whose symptoms include swelling and itching. Potentially deadly reactions to allergens are usually asso ciated with food allergies and insect venom. The response to an ingest ed allergen can manifested as abdominal pain, vomiting, diarrhea, and/or sw elling of the tongue and lining of the throat. In severe cases, the swelling can lead to a complete closing of the airw ay. Anaphylaxis is an acute systemic response to an allergen in the bl ood stream. The release of histamine by blood basophils and mast cells into the circulat ory system leads to vessel leakages causing swelling, itching, and hives. Constriction of pulmonary smooth muscles leads to difficulty breathing. Anaphylactic shock is a potentially life thr eatening form of anaphylaxis in which system ic degranulation of mast ce lls and blood basophils, leading to constriction of airways, a ra pid loss of blood pressure, and shock This is most often associated with an allergen entering the bl ood stream by ingestion or injection (insect venom and pharmaceuticals). Type I hypersensitivity also pl ays a fundamental role in ch ronic allergic disease. Chronic allergic disease is usually caus ed by a combination of hypersensitive types including type I. The most common is alle rgic asthma, which is a form of localized anaphylaxis. Degranulation of mast cells in the lungs causes excess mucus secretion, airway edema, and constriction of pulmona ry smooth muscle resulting in airway obstruction (Goldsby, 2000). Seventeen million Americans are afflicted with asthma, which is responsible for more than 5, 000 deaths annually (CDC, 2002; O'Hollaren, 2006).

PAGE 19

6 Allergic bronchopulmonary aspergillosis (ABPA) is an inflammatory disease caused by fungal growth in the mucous of th e lungs, typically due to infections by Aspergillus fumigatus (but can be caused by fungi of other genera) (de Almeida et al., 2006; Denning et al., 2006). Extrinsic allergic alveolitis is a lung disorder resulting from hypersensitivity to inhaled allergens such as fungi and organic dust; this disorder also involves components of the type III and type IV hypersensitiv ity responses (Bush et al., 2006; Horner et al., 1995). Fungi The Fungi represent a taxonomic kingdom comprised of both multicellular and single cellular eukaryotic organisms. F ungi display a wide morphological diversity, ranging from large mushrooms to microsco pic yeasts. Many fungal species are dimorphic and can persist and grow in eith er a single or multicel lular state depending upon environmental conditions. There are cu rrently over 100,000 recognized species of fungi, distributed throughout almost every ecosystem including Antarctica (Palmer and Friedmann, 1988). The largest and most co mmon group of fungi is the Ascomycetes, which are primarily the filamentous mold fungi, but also include some single celled species. Spores and Conidia The fungal life cycle is divided into two stages: sexual and asexual. Many fungi are able to reproduce both sexua lly and asexually. Fungi capab le of reproducing sexually are termed perfect and are considered to be in a telemorphic or sexual state. Sexual reproduction results in the creation of sexua l spores. When a fungus is reproducing asexually it is considered to be an anam orph and the end result is the production of conidia. Fungi that reproduce exclusively in an asexual state or for which no sexual stage

PAGE 20

7 has yet been identified are classified as imperfect or anamorphic fungi. The Deuteromycetes represent a sub-grouping of filamentous fungi within the Ascomycetes that are considered to be strictly anamor phic. Both sexual spores and conidia are propagules released by the parent organism; th e term spore is used in this paper to describe both sexual spores and asexual coni dia. Spores and c onidia are considered relatively more resistant to unf avorable environmental conditi ons than other cells, and are designed to stay metabolically inactive until environmental conditions are favorable for supporting growth. The availability of water (h igh humidity) is usually a major factor in the germination of spores and conidi a (Cole and Kendrick, 1981; Lacey, 1981). Because of their size, spores are eas ily dispersed in the air and are found aerosolized in the atmosphere throughout the world. Aerobiological assessments of indoor and outdoor fungal spores have often been used to determine the identity and concentration of aerospores (Al-Suwaine et al., 1999; Beaumont et al., 1985b; Kurup et al., 2000a). Outdoor concentrations of f ungal aerospores often outnumber pollen counts one hundred to one thousand fold (Horner et al., 1995; Lehrer et al., 1983) and are directly affected by climatic events such as, precipita tion and wind. Although seasonal variations in fungal aerobiologi cal numbers have been noted, this variation is much less than that observed for pollens. Alternaria Cladosporium Epicoccum and Fusarium are examples of outdoor fungi typically associat ed with human allergy. The fungi that dominate indoor air are thos e that commonly grow indoors, and include species of Aspergillus and Penicillium The indoor concentration and type of fungal aerospores is more dependent upon carpet, houseplant, and humidity conditions than outdoor seasonal or climate changes (Kozak, 1979; Salo et al ., 2005). Outdoor fungi can also be found

PAGE 21

8 indoors and their concentrations ar e affected by factors that facil itate entry such as traffic, pets, and ventilation. Health As with all fungi, filamentous fungi acquire nutrients by absorption and are generally saprophytic or symbiotic; although there are some fungal species that are parasitic and/or opportunistic pathogens. In recent years, fungi have become an everincreasing health concern. Immunocompromised patients, particularly those with AIDS, are highly susceptible to some times fatal infections by opportuni stic fungi. This is also true for transplant patients in which the immune system is suppressed to avoid organ rejection. Chemoand radio-therapies for cancer treatment also weaken the immune system, increasing the risk of cancer patient s to infection by opport unistic fungi. With the increasing population of indi viduals with compromised immune systems, there is also an increase in infection by opportunistic fungi such as Aspergillus fumigatus and Histoplasma capsulatum In otherwise immune competent individuals fungal allergies are another serious health concern. Atopic allergy affects up to 25% of the population of industrialized nation with clinical symptoms ranging fr om sneezing and coughing to chronic sinusitis and asthma. Allergens affect th e area that they come in contact with which includes the skin and mucosal layers of the nasal and respir atory tract. For inhaled particles the size of an aeroallergen will determine the location in the respiratory track that the allergen will interact with host tissues initia ting a response. Large particles (>10 m) such as dust, large spores, and pollen cause upper resp iratory problems primarily in the sinuses and nasopharynx (Lieutier-Colas et al., 2003). Smaller particles (<5 m) including many fungal spores penetrate deeper in the respir atory track often affecting the bronchia and

PAGE 22

9 lungs resulting in asthma (Nygaard et al., 2004; Spieksma, 1995). Fungi are responsible for both upper and lower allergy symptoms. Over 80 genera of fungi have been associated with respiratory track allergy symptoms (Edmondson et al., 2005; Nierman et al., 2005; Schwienbacher et al., 2005) and 25% of all allergic asthmas cases have been linked to mold allergies(Kurup et al ., 2002; Vijay and Kurup, 2004). The viability of a fungal spore is not required for eliciti ng allergenic reactions; nonviable spores and hyphal particles are still able to cause allergic reactions. Nomenclature As allergy research identifies an ever-i ncreasing number of allergens, a new method for naming allergens was set forth by the International Union of Immunologic Societies Subcommittee for A llergen Nomenclature (Marsh, 1987). Before definitive naming of an allergen, several criteria have to be met; (1) the allergen must be identified by multiple immunochemical or physiochemical techniques, and (2) the source of the molecule must be clearly defined including spec ies and strain in the case of fungi. An allergen is labeled by the first three letters of the genus followed by a space and the first letter of the species and then a space followed by a number assigned based upon the chronologic order in which the allergen was identified. Th e strain number is the final addition to the new name. In reference to the gene producing the allergen the Arabic numerals are substituted by Roman numerals (King et al ., 1994; King et al., 1995). Inconsistency in the assigned number of an id entified allergen can be observed between the publications of different research group. In this dissertati on, the allergens are designated by the name used by the Intern ational Union of Immunological Societies Allergen Nomenclature Sub-committ ee List of Allergens (Milligen, 2006).

PAGE 23

10 Major Allergenic Fungi Skin test and aerial surveys have identified the most si gnificant fungi associated with human allergy. Some of the most common genera are: Alternaria Cladosporium Epicoccum Aspergillus and Penicillium (Cruz et al., 1997; Kurup and Banerjee, 2000; Shen and Han, 1998); all of which belong to the group Ascomycota. Alternaria alternata Alternaria alternata is one of the most important a llergenic fungi (Herrera-Mozo et al., 2006; Kurup et al., 2 003; Salo et al., 2006). A. alternata is a dematiaceous mold found in the soil, on plants, a nd in the air throughout the wo rld preferring climates that are warm and moist (Achatz et al., 1995; Pr itchard and Muir, 1987). A member of the Deuteromycetes, A. alternata is a health concern as both an opportunistic pathogen and a major allergen (Vartivarian et al., 1993). Although not pathogenic in immune component individuals, Alternaria is of concern, because it can cause both atopic and asthmatic reactions. Indeed, allergy to Alternaria is considered to be a mortal risk factor in asthma patients (Chiu and Fink, 2002). Alternaria allergenicity has been closely examined and a number of allergens have been isolated and ch aracterized from this organism (Table 1-2) (Achatz et al., 1995; Kurup et al., 2002). Alt a 1 is the most common allergen of Alternaria alternata Although its biological function is not known (Saenz-de-S antamaria et al., 2006), it is a secreted homodimer roughly 60 kDa (monomer mw roughly is 30 kDa). Of patients displaying allergic reactions to Alternaria alternata 80% are positive for IgE reactivity to Alt a 1. One factor that contributes to the extreme alle rgenicity of Alt a 1 is that it contains four IgE binding region (Kurup et al., 2003). Other allergens identified in this fungus include Alt a 6, an enolase, and Alt a 10, a protein w ith aldehyde dehydrogena se activity, both of

PAGE 24

11 which are considered common house-keeping enzymes. The enolase has been of particular interest in resent years due to its homology to allergenic enolases found in other fungi; Alt a 10 is also shares sequence similaritie s with a known allergen of Cladosporium herbarum (Cla h 3). Cladosporium herbarum Cladosporium herbarum is a highly allergenic fungus not only because of the large number of allergens it produces, but also because of its rela tively high abundance in the environment. C. herbarum is found throughout the world and is often the dominant outdoor airborne fungal spore es pecially in temperate region s (Achatz et al., 1995; Lacey, 1981). Cladosporium herbarum is a dematiaceous filamentous mold which grows primarily on rotting organic material; although one of the most allerg enic fungi, it is not considered pathogenic (Sutton, 1998). There ar e at least 36 identified allergens produced by C. herbarum (Aukrust, 1992). Cla h 1 may be considered the most important Cladosporium allergen due to its reactive frequency; 61% of C. herbarum sensitive patients possess IgEs that re act positively to Cla h 1 (A chatz et al., 1995). Many C. herbarum allergens display sequence similarity to allergens produced by other fungi, especially those found in Alternaria Cla h 3 is an aldehyde de hydrogenase that is similar to an enzyme allergen found in A. alternata (Alt a 10), and Clah h 6 displays similarity to enolases found in severa l other fungi including A. alternata Aspergillus The genus Aspergillus contains several important sp ecies known to cause health problems in humans (Garrett et al., 1999; Steinbach and Stevens, 2003). Aspergillus species are filamentous fungi found ubiquit ously throughout the world and are commonly found in the soil and the air both indoors and out. Alt hough teleomorphic states have

PAGE 25

12 been described for some species, many Aspergillus species are Deuteromycetes. The incidence of mediated Aspergillus infections, that can sometimes be fatal, has dramatically increased with the increase in patients with compromised immune systems. In addition, this mold is the leading cause of ABPA (allergic bronchopulmonary aspergillosis) and is one of the major risk f actors leading to allergic asthma (Crameri et al., 1998a; Crameri et al., 1998b). Numerous Aspergillus allergens have been isolated and characterized, many of which show strong similarity to allergenic pr oteins or enzymes of other fungi. However, a number of allergens appear to be unique to Aspergillus with no known biological functions or activities. Asp f 5 is an Aspergillus allergen to which many patients are reactive, its function is unknown and there are no know homologs of this protein. Asp f 5 however, is strongly reactive to sera IgEs of ABPA patients as well as asthmatics (Banerjee and Kurup, 2003; Crameri et al., 1998a; de Almeida et al., 2006). Asp f 1 is a ribonuclease, a ribotoxic virule nce factor secreted by the oppo rtunistic fungi that reacts positively with 68% of patients w ho have tested positively for Aspergillus allergy. Asp f 8 is a P2 ribosomal protein (60s porti on of the large ribosomal subunit) that is similar to allergens found in Cladosporium herbarum and Alternaria alternata It is unclear how a ribosomal protein elicits such a strong IgE reaction, however many patients display IgEs that are reactive to all three proteins. The same is true for the Aspergillus enolase (Asp f 22), in which an IgE sens itized to one protei n is reactive to proteins from different f ungi (Hemmann et al., 1997). These data imply conserved allergenic hotspots in term s of protein structure and rec ognition of specific epitopes.

PAGE 26

13 Cross-Reactivity An interesting fact about f ungal allergy is that few patie nts are allergic to a single fungus. One study testing 6,000 allergy patients showed that more than 99% of the patients allergic to A. alternata also displayed allergic reactio ns to other fungi (Horst et al., 1990). Possible factors that may account for this observation include constant exposure to different fungal spores due to seasonal and localized abundance of fungal spores and the aerosolized mechanism of expos ure. These factors make it possible for the immune system to come in contact with numerous species of fungi and fungal antigens that favor an IgE response. Anothe r reason for allergic reactions to multiple fungi is due to IgE recognition of fungal antigen epitopes independent of previous exposure. Cross-reactivity is a common phenomenon among IgEs produced in response to fungal epitopes that result in the induction of an allergic reaction (Aukrust and Borch, 1985). Cross-reactivity is di fferent than paralle l allergy, which is the development of multiple IgE responses to multiple, but simila r, antigen. Development of allergies to parallel antigens, such as the same enzyme fr om two different organisms, is caused by the actions or behaviors of the an tigens and result in allergic reactions mediated by different IgEs. Cross-reactivity is a single allergic reac tion to multiple antigens; this is the result of structural resemblance a nd recognition by the same speci fic IgEs to a single epitope found on all of the antigens (Herrera-Mozo et al., 2006). A large contributor to this phenomenon is that many fungal epitopes ar e highly conservered especially between phylogenetically related species (Horner et al., 1995). Enolase, an enzyme responsible for the glycolytic conversion of 2-phospho-Dglycerate to phosphoenolpyruvate is an example of a fungal allergen that elicits an IgE-

PAGE 27

14 mediated response known to be cross-reactiv e with other fungal enolases. Extensive studies of this allergen by Breitenbach and Simmon-Nobbe have shown that specific epitopes are shared by enolases produced by at least five common fungi; this has led it to being referred to as a pan-allergen (Bre itenbach et al., 2002; Br eitenbach and SimonNobbe, 2002). Enolase was first id entified as an allergen in Saccharomyces cerevisiae and Candida albicans (Baldo and Baker, 1988; Ishiguro et al., 1992; Ito et al., 1995). Later studies concentrated on the enolase allergen Cla h 6 and Alt a 5 that are 90% identical, and were highly IgE immunogenic. Tw enty-two percent of patients allergic to either A. alternata or C. herbarum produced IgEs that reacted with the enolase protein. Competitive inhibition experiments have been performed to analyze cross-reactivity of enolases produced by A. alternata, A. fumigatus, C. herbarum, S. cerevisiae, and C. albicans The results of these experiments show ed that the examined enolases possessed a shared epitope. Althou gh, the enolase produced by C. albicans also displayed a second IgE binding epitope (Simon-Nobbe et al ., 2000). An enolase produced by Hevea brasiliensis (rubber tree) that was than 63% similar to the enolases Alt a 6, and Cla h 6, was also shown to display allergenic cro ss-reactivity (Breitenb ach and Simon-Nobbe, 2002; Posch et al., 1997; Wagner et al., 2000). The clinical implication of cross-reactivity is that a patient who develops an allergy towards one species of fungus can have that allergy activated by cont act with other fungal species, even those to which there had been no previous exposure. Examples of crossreactive allergens are listed on Table 1-4 as taken from (Breitenbach and Simon-Nobbe, 2002; Kurup and Banerjee, 2000).

PAGE 28

15 Beauveria bassiana History In the early 1800s, the silkworm farms of Italy and France were plagued with diseases that periodically decimated the Eur opean silk industry. The disease was called white muscardine after the French word fo r bonbons, as the disease resulted in fluffy white corpses resembling pastries. An Ita lian scientist named Agostino Bassi discovered that the disease was caused by a microbial inf ection and that it c ould be controlled by altering the living conditions of the silkworms to decrease the spread of the disease. One simple recommendation that he made was to remove and destroy infected and dead insects. Later the microbe, a filamentous fungus, responsible for the disease was named Beauveria bassiana in honor of Bassis discovery. In 1835 Agostino Bassi, one of the founding fathers of insect pathology, publis hed his findings in a paper entitled Del mal Del segno, calcinaccio o moscardino ; this publication was one of the first instance of a microbe identified as the causa tive agent of an infectious disease (Alexopoulos, 1996). B. bassiana is considered non-pathogenic to vertebrates; although there are a handful of recorded cases of human infection by this fungus (Kisla et al., 2000; Tucker et al., 2004). These cases however, involved pa tients with compromised immune systems increasing their susceptibility to a wide ra nge of opportunistic in fections. Based upon safety tests and considered a natural product, B. bassiana has been approved by the U.S. Environmental Protection Agency for commercial use. B bassiana is non toxic to mammals, birds, or plants; and use of Beauveria is not expected to have deleterious effects on human health or the enviro nment (EPA, 2000). Strains and various formulations of B. bassiana are available commercially in various parts of the world (commercial companies include Mycotech corp. and Troy bioscience U.S.).

PAGE 29

16 Physiology/Life Cycle Beauveria bassiana is considered to be the anamorph of Cordyceps bassiana an ascomycete in the order Clavicipitales. The genus Cordyceps and its anamorph Beauveria are endoparasitic pathogens of ins ects and other arthropods (Nikoh and Fukatsu, 2000). B. bassiana is a polymorphic fungus whose life cycle includes both single and multicellular stages (Figure 1-2). B. bassiana is an ubiquitous saprobe and can be found in soil or decaying plant material, where it grows as multicellar mycelia by absorbing nutrients from the decaying matter (St-Germ ain, 1996). Reproduction and dispersion of progeny is accomplished by the production of as exual spores called c onidia. Conidia of B. bassiana are smaller than most other fungal spores measuring only 2 m wide (Akbar et al., 2004; Bounechada and Douma ndji, 2004). Conidia are produced from conidiogenic cells that protr ude in a zigzag structure fr om mycelia hyphae. Conidia released into the environment remain dor mant or in a non-vegetative state until appropriate conditions activate ge rmination. Humidity is a ma jor factor in activation of conidia independent of a host (Boucias et al., 1988). Attach ment of the conidia to the exoskeleton of a host insect also stimulates germination. The initial at tachment of B. bassiana conidia to the host exoskeleton is t hought to be a function of hydrophobicity which creates a strong inte raction between the coni dia surface and the waxy layer/chitonous surface of the host (Holde r and Keyhani, 2005). Germination involves the development of a hyphal structure called a germ tube; the germ tube grows along the surface of the cuticle, and can penetrate in to the cuticle by enzymatic digestion and mechanical rupture of exoskeletal compone nts. Once through the exoskeleton, the fungus reaches the hemolymph and there in produces single celled morpho-types known

PAGE 30

17 as in vivo blastospores. These cells replicat e by budding and prolif erate within the hemolymph, evading any innate immune responses (Lord et al., 2002). When nutrients in the hemolymph are consumed the blastospores produce elongating hyphae. These hyphae grow until they exit the cadaver and begin producing conidia one the insect surface. The result is a fuzzy white mummified insect corpse. Agricultural/Economic Importance Agricultural pests continue to be a major problem, responsible for tremendous losses in productivity. Trad itionally, chemical pesticid es such as DDT (dichlorodiphenyl-trichloroethane) and endosulfan have been used to kill unwanted insects. The use of chemical pesticides, however, has re sulted in numerous problems. Many insects develop resistance to chemical poisons ma king these compounds less effective, and therefore required in higher concentrations. Furthermore, extensive application of chemicals into the environment often has deleterious effects on non-target organisms including beneficial insects such as pollinators and natural predators of the target pest. Finally, chemical pesticides display significant health risk s to workers who are exposed to the chemicals in the fields as well as to consumers who purchase food products with residual pesticides. Thus, there is great interest in alternatives to chemical pesticides. The use of biological pestic ides such as entomopathogenic fungi is growing in popularity because it is able to alleviate many of the concerns associated with chemical poisons. First, entomopathogenic fungi ar e found ubiquitously in the soil throughout the world, therefore they would not be consid ered as introduced organisms into the environment. Second, although B. bassiana is considered a broad-spectrum insect pathogen, strains can be devel oped that are more hosts spec ific. With research into

PAGE 31

18 pathogenicity and strain specific ity, it is anticipated that f ungal biological control agents can be selected to target specific insect pest. There are extensive efforts to study/develop Beauveria as a biological agent. Beauveria has been examined as a potential biological control agent of Ocneridia volxemi A species of grasshopper, O. volxemi is one of the most destructive pests of cereals crops in Algeria (Boun echada and Doumandji, 2004). Beauveria is also being examined as method to control the citrus rust mite, Phyllocoptruta oleivora a citrus crop pest of South America (Alves et al., 2005). One of the most de structive pests being targeted by application of Beauveria control is the coffee berry borer ( Hypothenemus hampei ), which is endemic to most coffee gr owing regions and results in up to 40% losses of the crop. H. hampei is an agricultural pest responsible for hundreds of millions of dollars in loses by coffee growers each year (Posada et al., 2004). Beauveri a is studied around the world as an effective control agent of coff ee berry borer including research facilities found in Honduras, Brazil, Mexico and I ndia (Fernndez PM, 1985; Haraprasad N, 2001). Due to the illegalization of some pestic ides including enosulfan; Columbia is an example of a count ry that utilizes Beauveria against this pest (Cruz et al., 2005). B. bassiana as well as Metarhizium anisopliae are under investigation and show promise for the control of the tobacco spider mite. The tobacco spider mite is one of several species of mite s belonging to the genus Tetranychus Found throughout the United States Tetranychus mites are responsible for the destruction of crops ranging from fruits and vegetables to cotton and decorative plants. Studies showed that the treatment of mite-infected tomato plants with conidia of these entomopathogens greatly reduced the

PAGE 32

19 number of mites on the treated plants as compared to untreated plants (Wekesa et al., 2005). Disease Control As agricultural pests present an econ omic and resource production problem to human society, other arthropod pest s are a direct human health c oncern. In this regards, a number of parasitic arthropods act as vectors for the transmis sion of infectious diseases. Because of their ability to access the human circulatory system, blood feeding arthropods, are important vectors by which microbial parasites can be transmitted between various hosts. B. bassiana shows potential for controlling ar thropod disease vectors, and hence has the potential to decrease the spread of diseases carried by these insects. Ticks are an example of an arthropod that can carry and transmit a wide variety of disease causing agents. Ticks, obligate blood feeders, ar e potential carriers of the bacteria Borrelia burgdorferi the causative agent of Lyme disease in humans and domestic animals (Stricker et al., 2006). Other tick born diseases include; R ickettsia rickettsii causative agent of Rocky Mountains spotted fever in both humans and some domestic animals; Babesia canis and B gibsoni a protozoan parasite of dom estic animals; and several species of the genus Ehrlichia an obligate intracellular cocc i responsible for a variety of blood cell diseases in domestic anim als (Ettinger, 2000; Waner T, 2001). Research studies have shown that the prominent ti ck species including those known to transmit Lyme disease are susceptible to infection by B. bassiana (Kirkland et al., 2004). Chagas disease is a parasite infection that is transmitted by an insect vector, primarily the South Am erican kissing bug ( Triatoma infestans) (Lazzarini et al., 2006). Chagas disease is a serious health problem in South America where approximately 20 million people are infected. The health costs as sociated with treating an infection is often

PAGE 33

20 too high for the majority of those inflicted with the disease. For this reason, research into the control and prevention of the disease, is focused on vector c ontrol and involving the use of B. bassiana and other entomopathogenic fungi Brazil and Argentina are two countries with research faciliti es studying the pathogenicity of Beauveria toward these insect disease vectors (Luz and Fargues, 1998; Luz et al., 1998; Marti et al., 2005). B. bassiana may also be a valuable tool in the fight against malaria. Between 300 and 500 million people are infected with malaria, and this disease is responsible for as many 1.5 million deaths annually (Geetha a nd Balaraman, 1999; O'Hollaren, 2006). Currently there are no vaccines against ma laria; however, studies have shown the potential for fungal entomopathogens to reduce th e spread of this dis ease (Blanford et al., 2005; Scholte et al., 2005). In this regard, th e use of entomopathogeni c fungi resulting in the infection of as little as 23% of the indoor mosquitoes reduced the yearly number of bites received by residents by as much as 75%. Indoor treatment combined with outdoor applications to control mosquito populations at hot spots it is projected that bites by mosquitoes could be lowered by as much as 96% (Scholte et al., 2004; Scholte et al., 2005). Research Overview Although not considered pathogenic to humans, the potential for B. bassiana to elicit allergic reactions has not been studied. B. bassiana may pose a certain level of health concern due to immune responses or hypersensitivity to this organism, as has been reported for other filamentous fungi. Although B. bassiana has not been extensively studied as a source of allergenic molecule s, a study performed in the Netherlands indicated potential effects (Beaumont et al., 1985a; Beaumont et al., 1985c). A volumetric survey of aero-conidia revealed that B. bassiana was one of the most

PAGE 34

21 allergenic species examined although its envi ronmental concentration was too low to be considered important. Alt hough in most cases examined, B. bassiana does not persist greater than a couple of week s after application, with the use of organic pest control agents such as B. bassiana the environmental concentrati on of these fungi may increase resulting in short term exposur e of individuals working direc tly with the fungi, such as those involved in the picking and proce ssing of agriculture crops treated with B. bassiana ; or those who live in homes treated with B. bassiana to control nuisance pest like roaches and earwigs. This dissertation reports the characterization of B. bassiana human reactive antigens. Crude extracts of B. bassiana were shown by immuno-blot assays to react strongly with human IgE. This was accomp lished with the use of human sera from patients displaying allerg ic reactions to other fungi. The protein nature of these allergens was confirmed by digestion of the antigens w ith Proteinase K. The allergenicity of B. bassiana extracts varied greatly between individu al seras. Intradermal skin testing confirmed the in vitro results, demonstrating allergen ic reactions in a number of individuals, including those who have had occupational exposure to B. bassiana Furthermore, the cross-reactive nature of B. bassiana allergens was examined. Competitive inhibition experiments where pe rformed using extracts of several know allergenic fungi, including Aspergillus fumigatus, Cl adosporium herbarum, Candida albicans, Epicoccum purpurascens, and Penicillium notatum. The treatment of B. bassiana extracts with sera pretreated with ot her fungal extracts (i mmunoblot inhibition) resulted in the loss of several bands visible in the, untreated sera, co ntrol lanes. A strong

PAGE 35

22 band with the approximate molecular mass of 35 kDa was uninhibited by any of the tested extracts, and may represent a B. bassiana specific allergen. Several potential alle rgens were identified by homology from a B. bassiana cDNA library. The full length genomic and cDNA sequ ences of four putative allergens were isolated. The genes coding for all four wher e cloned into over-expre ssion vectors and the proteins expressed in E. coli Using sera from 20 patie nts BbEno1 was found to react with IgEs in more than 50% of the sera te sted, expressed BbAld displayed reactivity IgEs from 4 sera pools, whereas no reactions were observed for the E. coli expressed BbF2 and BbHex proteins. P hylogenic comparison of B. bassiana enolase shows highly conserved sequence characteristic w ith the glycolytic enolases of Cladosporium herbarum and Alternaria alternata both highly cross-reac tive fungal allergens.

PAGE 36

23 Table 1-1. Common allergens Animal Cockroach Cat and Dog dander Insect venom (bee, wasp, hornet) Mouse urine Rat urine Dust mites Foods Eggs Milk Peanut other nuts (almonds, cashews, etc) Wheat Fish and Shellfish Soy Plants Ragweed ( Ambrosia artemisiifolia) Bermuda grass ( Cynodon dactylon ) Mulberry ( Morus rubra ) Sycamore tree ( Plantanus occidentalis ) Cottonwood ( Populus deltoides ) American elm ( Ulmus americana ) Rye ( Lolium perenne ) Fungi Alternaria alternata Cladosporium herbarum Aspergillus spp. Penicillium chrysogenum Epicoccum nigrum

PAGE 37

24 Mast cell Histamine Mucous glands Smooth muscle Blood vessels Leukocytes Blood platelets Nerve endings Cytokines Leukotrienes Prostaglandins Allergen Figure 1-1. Illustrating the cen tral role of IgE activated mast cells in a Type I hypersensitive response; the release of chemical mediators, and the primary tissue types affected by mast cell chemicals. Saprophytic cycle Parasitic cycle Germination (2) Sporulation (4) Epicuticle Conidia (1) Blastospores Heomocel Procuticle Epidermis (3) (5) (7) (6) Figure 1-2. Life cycle of Beauveria bassiana : Metabolically dormant conidia (1); germination and production of hyphae in response to favorable growth conditions (2); mycelial growth on d ecaying plant matter (3); production of conidiogenic structure and formation and dispersal of new conidia (4); penetration of host cuticle by germ tube (5); fungus multiplies in heomocel as a single-celled blastospore (6). When nutrients are depleted, B. bassiana exits the cadaver as hyphae and begins the process of conidia production (7).

PAGE 38

25 Table 1-2. Major chemical mediators of activated mast cells. Mediator Function Vasoactive amine Histamine Irritate s nerve endings, mucous secretion vasodilatation, bronchi al and intestinal constriction Proteases Tryptase Cleaves fibr inogen, activates collagenase, tissue damage Chymase Converts angioten sin I to angiotensin II, degradation of epidermal basement membrane Chemotaxins ECF-A Eosinophil chemotaxis factor NCF-A Neutrophil chemotaxis factor Lipid mediators Platelet-activating factor Aggregation and degranulation of platelets, pulmonary smooth muscle constriction Prostaglandin D2 Vasodila tor, bronchial constriction, neutrophil chemotaxis Leukotriene C4 Vasodilator, prolonged bronchial constriction Cytokines IL-3 Stimulates mast cell growth and histamine secretion IL-4 B-cell differentiation, mast cell growth factor, Th2 differentiation, IL-5 Eosinophil activator, B-cell activator IL-6 B-cell proliferation into plasma cells IL-13 Inhibits pro duction and release of macrophage cytokines GM-CSF Granulocyte-macr ophage colony stimulating factor, pro-inflammatory effects Table contains the majority of mediators produced by mast cells, it does not list all chemicals produced by mast cells nor does it include all the effects of each chemical listed.

PAGE 39

26 Table 1-3. Fungal allergens Allergen Function MW (kDa) Ref, or ID Alternaria alternata Alt a 1 Unknown 28 U82633 Alt a 3 Heat shock prot. 70 U87807 Alt a 4 disulfideisomerase 57 X84217 Alt a 5 Ribosomal prot. P2 11 X78222 Alt a 6 Enolase 45 U82437 Alt a 7 YCP4 protein 22 X78225 Alt a 10 Aldehyde dehydrogenase 53 X78227 Alt a 12 Ribosomal prot. P1 11 X84216 Cladosporium herbarum Cla h 3 Aldehyde dehydrogenase 53 X78228 Cla h 5 Ribosomal prot. P2 11 X78223 Cla h 6 Enolase 46 X78226 Cla h 7 YCP4 protein 22 78224 Cla h 8 Mannitol dehydrogenase 28 AY191816 Cla h 9 Vacuolar serine protease 55 AY787775 Cla h 12 Ribosomal prot. P1 11 X85180 Aspergillus fumigatus Asp f 2 Unknown 18 U56938 Asp f 3 Peroxisomal protein 37 U20722 Asp f 5 Metalloprotease 40 Z30424 Asp f 8 Prbosomal prot. P2 11 AJ224333 Asp f 10 Aspartic protease 34 X85092 Asp f 12 Heat shock prot. 90 90 (1) Asp f 16 Unknown 16 AJ002026 Asp f 18 Vacuolar serine protease 34 (2) Asp f 22w Enolase 46 AF284645 Penicillium chrysogenum Pen ch 13 Alkaline serine protease 34 AF321100 Pen ch 18 Vacuolar serine protease 32 AF263454 Penicillium citrinum Pen c 19 Heat shock prot. P70 70 U64207 Pen c 22w enolase 46 AF254643 Data was obtained in large part from(Mil ligen, 2006); (1) (Kum ar et al., 1993), (2) (Shen et al., 2001).

PAGE 40

27 Table 1-4. Cross reactive fungal allergens Allergen Cross-reactive allergen or species Enolase Alt a 6, Asp f 22w, C. albicans Cla h 6, S. cerevisiae Aldehyde dehydrogenase Alt a 10, Cla h 3 Heat shock protein Alt a 3, Asp f 12, C. albicans C. herbarum Pen c 1 Peroxiaomal membrane protein Asp f 3, C. boidinii Mal f 2, Mal f 3, Pen c 3 Ribosomal protein P2 Alt a 5, Asp f 8, Cla h 4 Fibrinigen binding protein Asp f 2, C. albicans YCP4 Alt a 7, Cla h 5, S. cerevisiae Vacuolar serine Protease As p f 18, Asp n 18, Pen ch 18, Pen o 18 Table data was obtained in large pa rt from (Kurup and Banerjee, 2000)

PAGE 41

28 CHAPTER 2 ALLERGENICITY1 Introduction Microorganisms are currently under inte nsive study for use as biopesticides (Meikle et al., 2001; Shah and Pell, 2 003). Several fungal species including Metarhizium anisopliae Verticillium lecanii and B. bassiana are being used as bi ocontrol agents for a number of agricultural and nuisance pests (Lecuona et al., 2001; Liu et al., 2003; Reithinger et al., 1997). Strains of B. bassiana have been licensed for commercial use against whiteflies, aphids, thrips, and nume rous other insect and arthropod pests. B. bassiana fungal formulations are being spread on to a range of vegetables, melons, tree fruits and nuts, as well as organic crops. As alternatives to chemical pesticides, these agents are naturally occurring and are cons idered to be non-pathogenic to humans, although a few cases of B. bassiana -mediated tissue infections have been reported (Henke et al., 2002; Kisla et al., 2000). Airborne mould spores are wi despread, and many have been identified as inhalant allergens eliciting type I hypersensitive reacti ons in atopic individuals (Aukrust et al., 1985; Beaumont et al., 1985b; Chiu and Fi nk, 2002; Kurup et al., 2000b; Kurup et al., 2002). Common allergenic moulds include the anamorphs of Ascomycetes including many species within the Alternaria Aspergillus and Cladosporium genera (Banerjee et al., 1998; Banerjee and Kurup, 2003; Horner et al., 1995; Kurup et al., 2000a; Kurup et 1 The text of Chapter 2 of this dissertation is a reprint (in part or in full) of the material as it appears in Clinical and Molecular Allergy (2005, Volume 3:1)

PAGE 42

29 al., 2003). The genes encoding nu merous fungal allergens have been isolated, and their protein products expressed and characterized. Purified fungal allergens have been shown to be bound by human IgEs and to elicit allergic reactions in atopic i ndividuals using skin prick tests. Patients with mould allergie s often display IgE-mediated responses to multiple fungi, a phenomenon typically thought to result from the presence of common cross-reactive antigen(s ) (Aalberse et al., 2001; Aukrust and Borch, 1985; Gupta et al., 2002; Horner et al., 1995), although parallel i ndependent sensitizati on to multiple fungal allergens can also occur. In this regards, identification of genus and/or species-specific antigens would provide useful tools in differentiating allerg ic reactions due to primary sensitization and those mediat ed by cross-reactive epitopes. In the present study, we demonstrate that B. bassiana crude extracts contain numerous allergens recognized by human serum IgEs. The allergens were proteinaceous in nature, and immunoblot inhibition expe riments revealed the presence of shared epitopes between B. bassiana and several other common fu ngal moulds. Potential B. bassiana -specific allergens were also identifi ed, including a str ongly reactive 35 kDa protein band. Intrader mal skin testing using B. bassiana extracts resulted in allergenic reactions in several individua ls, including some who have had occupational exposure to the fungus. Material and Methods Strains and Cultures Beauveria bassiana (ATCC 30517) was grown on Sabour aud dextrose + 1% yeast extract or potato dextrose (PD) media on either agar plates or in liqui d broth. Plates were incubated at 26o C for 10 days and conidia were harvested by flooding the plate with sterile ddH2O containing 0.01% Tween 20. Liquid cult ures were inoculat ed with conidia

PAGE 43

30 harvested from plates at 0.5x105 conidia/mL; 0.1 mL of c onidia suspension per 100 mL culture media. Extract Preparation Lyophilized protein extracts of Alternaria alternata (lot# XPM1X11), Aspergillus fumigatus (lot# XPM3D13), Candida albicans (lot#XPM15D16.35), Cladosporium herbarum (lot# XPM9F6.85), Epicoccum purpurascens (lot#XPM29D3.65), and Penicillium notatum (lot# XPM19D4.8) were acquired from Greer Laboratories inc., (Lenoir, NC). Extracts were resuspended in TE (40 mM Tris-HCl, pH 8.0, 1 mM EDTA) to a fi nal concentration of 2 mg/mL. B. bassiana was grown in Sabourauds broth containing 1% yeas t extract with aeration at 25C for 3 d. Fungal material (mixture of hyphae and blastospores) was harvested by centrifugation and freeze-dried. Cells were resuspended in TE containing 0.1% phenylmethylsulfonyl fluoride (PMSF) and homogenized using a bead-beater apparatus. Precipitations Crude extracts of B. bassiana were subjected to three successive precipitations before use in Western blots. 1) Acetone precipitation: B. bassiana extracts (50 mL) were mixed with 8x volume (400 mL) of acetone (kept at -20 C), with rapid stirring, and incubated overnight at 20 C. The precipitate was collected by centr ifugation (30 min, 4000 x g), and the pellet was air dried (10 min) before being resuspended in TE containing 0.1% PMSF. 2) Streptomycin precipitation (removal of DNA): Streptomycin sulfate (5 mL of 10% solution) was added drop wi se to acetone precipitated B. bassiana extracts (40 mL) at 4 C with rapid stirring. Samp les were incubated for an additional 30 min on ice before

PAGE 44

31 being centrifuged (15 min, 10,000 x g) in order to remove the precipitate. Proteins in the resultant supernatant were precip itated using ammonium sulfate. 3) Ammonium sulfate perc ipitation: The proteins present in the streptomycin sulfate treated supernatant were precipit ated using ammonium sulfate (75%, final concentration). Saturated ammonium sulf ate (120 mL) was added drop wise to the B. bassiana extract (40 mL) at 4 C with rapid stirring. The solution was allowed to stir overnight at 4 C and precipitated proteins were harvested by centrifugation (30 min, 100,000 x g). The protein pellet was resusp ended in TE containi ng 0.1% PMSF (40 mL) and extensively dialyzed agains t the same buffer before use. SDS-Polyacrylamide gel electrophoresis (PAGE): Protein samples (30 g) were analyzed by SDS-PAGE (12% Bis-tris gel, Invitrogen, Carlsbad, CA) using standard protocols. Gels were staine d with Gelcode blue stain reag ent (Pierce, Rockford, IL) and subsequently de-stained with ddH2O. Western Blotting Protein samples were separated under reducing conditions us ing 12% Bis-tris polyacrylamide gels (Invitrogen Mops system ) and transferred to polyvinylidene-fluoride (PVDF) membranes (Invitrogen) as described. Immunoblot experiments were performed using individual and pooled human sera as the primary antibody solu tion as indicated. Typically, sera were diluted 1:5 with Tris -HCl buffered saline (TBS) containing 5% dry milk + 0.1% Tween. IgE-specific reactivit y was visualized using a horseradish peroxidase (HRP) conjugated goat anti-hum an IgE (polyclonal) secondary antibody (BioSource International, Los Angeles, CA ). Membranes were washed with TBS

PAGE 45

32 containing 0.1% Tween and bands were visualized using the Immuno-Star HRP detection system (Biorad, Hercules, CA). Enzyme Treatments The ammonium sulfate fraction of B. bassiana crude extracts was treated with Protease K (ICN-Biomed, Aurora, OH) following standard protocols. Typically, samples (36 L) were incubated with 4 L Proteinase K solution (10 mg/mL in 50 mM Tris-HCl, pH 7.5) for 2 hr at 37 C before analysis. Samples were also treated with endoglycosidase-H (EndoH, New England Bi olabs, Beverly, MA) and peptide: NGlycosidase F (PNGaseF, New England Bi olabs) according to the manufacturers recommendations. For EndoH and PNGaseF tr eatments, samples (36 L) were denatured in 4 L 10x denaturing buffer (0.5% SDS, 1% -mercaptoethanol) at 100 C for 10 min prior to the addition of the EndoH (5 L of 10 x G5 Reaction Buffer, 50 mM sodium citrate, pH 5.5) and PNGaseF reaction bu ffers (50 mM sodium phosphate pH 7.5) and enzymes (5 L), respectively. Reacti ons were incubated at 37 C for 2 hr before being analyzed by SDS-PAGE and Western blotting. Immunoblot Inhibition IgE binding to B. bassiana proteins were competed w ith proteins of other fungal extracts. SDS-PAGE resolved B. bassiana proteins were elec troblotted to PVDF membranes as described above. Membranes were blocked with TB S containing 5% dry milk + 0.1% Tween and strips were incuba ted with pooled human sera (1:5 v/v in same buffer) containing 100 g of the i ndicated fungal crude protein extract.

PAGE 46

33 Skin Sensitivity Profiles to Fungal Extracts Patients were tested with 9 common fungal extracts for allergy diagnosis using a skin prick assay. The following extracts we re obtained from ALA-Abello (Round Rock, TX); Alternaria tenius Aspergillus fumigatus Cephalosporium ( Acremonium strictum ), Curvularia spp. Bipolaris Epicoccum nigram Fusarium spp., Helminthosporium sativum Hormodendrum horde Penicillium chrysogenum (formally P. notatum ). Extracts were tested using a 1:10 diluti on of 20,000 PNU/mL stock solution, and skin sensitivity was recorded on a relative scale from 0 reflecting the size of induration or weal (4 representing the highest reactivity). Histamine (0.1 mg/mL), which was used as a control, typically produced a reaction scored of 3. Intradermal Skin Testing B. bassiana crude extracts were prepared as described above but were extensively dialyzed against 0.15 N NaCl and filtered through a 0.22 m filter before use. Subjects were given intradermal injections of 0.1 mL crude extract ranging in concentration from 0.01 mg/mL. Control injections include d saline and histamine (0.1 mg/mL). Allergenic reactions were allowed to deve lop for 15 min before the height and width of the reactions were recorded. Results Identification of IgE Reactive Bands An ammonium sulfate fraction of B. bassiana proteins was resolved on SDS-PAGE (Figure 2-1, lane B) and tran sferred to PVDF membranes as described in the Materials and Methods. Membranes were probed with sera from individual patients who were reactive to various moulds (Table 2-1), wh ich was pooled and used to demonstrate IgE reactivity against antigens present in B. bassiana extracts (Figure 2-1). Serum mix-I

PAGE 47

34 represents pooled sera derived from patients E, J, K, L, and M, as well as three additional patients that were only tested (skin prick) against Aspergillu s and Penicillium, displaying test scores of 3 for each. These data demonstrate human IgE binding of antigens present in B. bassiana extracts. Init ial blots showed 12 dis tinct reactive protein bands, ranging in molecular mass from 12 kDa to >95 kDa (under denaturing conditions); with the most prominent bands located ar ound 64, 45, and 35 kDa. Control experiments omitting either the primary or secondary antibody incubation steps resulted in complete loss of signal. Proteinase K digestion of sample s also resulted in loss of all sign al (Figure 2-1, lane 4), indicating the pr oteinaceous nature of the IgE reactive bands. Since the carbohydrate moieties of several protein allerg ens are known to play a role in their allergenicity and even cross-reactivity (Aalbe rse et al., 2001; Ebo et al., 2004; Hemmer et al., 2004), samples were treated with the degl ycosylating enzymes EndoH and PNGaseF. Control experiments incubating samples in the EndoH denaturing buffer without any enzyme altered the IgE-reactive signals (Figure 2-1, lane 5), however, samples treated with EndoH did not appear any different than control reactions (Figure 2-1, lane 6). Similar results were obtained in PNGaseF dige sts (data not shown). These data appear to indicate that the B. bassiana IgE-antigen profiles observed on Western blots are proteins with minimal contributions due to glycosylation. Immunoprint Analysis of B. bassiana : Reactivity with Individual Sera In order to determine the variation and distribution of serum IgEs reactive to B. bassiana extracts, individual sera from patients displaying m ould allergies (Figure 2-2, lanes AG) as well as random sera from th e general population (Figure 2-2, lanes HM) were used as probes for western blots (Figur e 2-2). The reactivity of pooled sera from patients AG (termed serum Mix-II) is also sh own (Figure 2-2, lane 2) Skin prick test

PAGE 48

35 results for patients AG are shown for compar ative purposes (Table 2-1) and represent the clinically determined reactiv ity of each patient to extracts of the tested fungal species. Patients (AG) were selected based on skin pr ick reactivity to at le ast 4 different fungi with scores of 2 or greater. Identical concentrations of B. bassiana extract (40 g) were resolved by SDS-PAGE, blotted to PVDF me mbranes, and the lanes were cut into separate strips. Each strip was treated w ith a 1:5 dilution of each respective serum as described in the Materials and Methods (Figure 2-3, lane 2 is the sera pool). A total of 16 individual sera were te sted, with the sera from three pa tients displaying no IgEs reactive to proteins present in the B. bassiana extracts. The results for the remaining 13 sera are shown in Figure 2-2. The data show a large in dividual variation in serum IgEs capable of binding epitopes present in B. bassiana extracts, both in terms of banding distribution and the intensity of the reaction. No correlation was observed be tween measurements of total IgE and the observed binding to B. bassiana antigens. Some patients displayed strong reactions to multiple bands, whereas others to a more limited set of epitopes. Distinct strongly reactive bands ranging from 40 kDa to approximately 200 kDa could be seen in sera A, E, and to a lesser extent L. A str ongly reactive 35 kDa band was visible in sera C, G, E, and L. Several sera displayed IgEs that bound to only a limited set of 2 antigens (C, F, G, weak bands in B, I, J, K, and M) Blots probed with one serum (H) resulted in a large smear ranging from ~30 kDa to 55 kDa. The reason for the observed smear is unknown and efforts to distinguish separate ba nds by manipulating the concentrations of either sera or extract were unsuccessful. A number of bands (based upon molecular mass) appeared to be common to several se ra including proteins of approximately 35, 42

PAGE 49

36 48, and 60 kDa. A number of antigens of high molecular weight (~100 kDa) were also visible; however, the resolution in this range on the Western blots is poor. Intradermal Skin Testing A total of ten individuals were tested for allergenic reactivity to B. bassiana crude extracts using an intradermal deliver y procedure. Data using 1 mg/mL B. bassiana crude extract and histamine controls are presen ted in Table 2-2. Seven out of the ten individuals (ID #s, JO, and Q) displayed skin re activity reactions to the B. bassiana extracts (Table 2-2, also see corresponding West ern blot results for individuals J, K, L, and M; Figure. 2-2). It is in teresting to note that 4 (JM) of 5 individuals (J-M and S) that have had occupational exposure to B. bassiana displayed skin reactivity as well as bands on western blots. A preliminar y correlation was obs erved between the B. bassiana /histamine reaction and the in vitro reactivity of individual sera in Western blots. Individuals J, K, and M, displayed B. bassiana /histamine control ra tios <1, also showed weak bands in western blots (Figure 2-2), whereas individual L who had a B. bassiana /histamine ratio = 1.65, reac ted against numerous epit opes in the extract and with a higher intensity. Cross-Reactivity among Different Fungi In order to determine the ex tent of cross-reactivity of B. bassiana antigens with other fungi, immunoblot inhibition expe riments were performed. Identical concentrations of B. bassiana crude extract (40 g) were resolved by SDS-PAGE, blotted to PVDF membranes, and lanes were cut into se parate strips. Each strip was treated with a 1:5 dilution pooled sera (serum mix-II) as the primary antibody supplemented with concentrations of fungal crude extracts as described in the Materials and Methods. Figure 2-3 shows Western blots in which the binding of human IgEs to antigens present

PAGE 50

37 in B. bassiana extracts were competed with: excess crude extracts from Alternaria alternata (Figure 2-3, Lanes 3,4), Aspergillus fumigatus (Lanes 5,6), Cladosporium herbarum (Lanes 7), Epicoccum purpurascens (Lane 8), Penicillium notatum (Lane 9), and Candida albicans (Lane 10). There was complete lo ss of all signals using 2-fold excess B. bassiana extract as the competitor (data not shown). These data indicate that while B. bassiana possess many epitopes in common with several other fungi, notably Alternaria and Penicillium a 35 kDa major reactive band was not inhibited by any extract tested. Discussion Although it is well known that fungi are importa nt triggers of respiratory allergies, the potential allergenicity of entomopathogenic fungi used in biocont rol has largely been untested. Aerobiological surveys conducted in the Netherlands in the late 1980s comparing the environmental concentrations of fungal spores with their allergenicity, reported that although B. bassiana represented less than 0.1% of the airborne fungal flora, it elicited the most severe allergenic skin test response of a ll fungal species tested (Beaumont et al., 1985a; Beaum ont et al., 1985b; Beaumont et al., 1985c). In rural areas, the use of fungi in agricultural pest mana gement practices can greatly increase the potential for human exposure to these agen ts. Likewise, in urban settings, the commercialization of fungal products for hous ehold use may result in a much wider problem since indoor air concentrations of th e moulds can greatly increase. For these reasons, an examination of th e allergenic potential of B. bassiana is imperative. The present study demonstrated the allergenic potential of B. bassiana directly by intradermal skin testi ng of individuals and in vitro by revealing the presence of serum IgEs capable of binding allergen s present in fungal crude extracts. Over 20 different IgE

PAGE 51

38 binding proteins were observed using West ern blots probed with sera from patients displaying mould allergies. Re sults using individual sera re vealed a wide variation in IgE-binding proteins between sera, although several common bands, including a protein with an apparent molecular mass of 35 kDa, were visible among the sera of several patients. Our in vitro observations were confirmed by intr adermal skin testing on individuals using B. bassiana extracts. While the testing samp le population was small, the results indicated that our extracts were able to elicit allergic reactions in individuals, including some that have had occupational exposure to the fungus. Concentratio ns of ~1 mg/mL of B. bassiana extracts were required to elicit indurations equivalent to 0.1 mg/mL histamine in most individuals, indicating th e possibility of potent allergens in the B. bassiana extract. Interestingl y, not all individuals sp ecifically exposed to B. bassiana displayed allergic reactions a nd individuals J, K, and M (w ho did display mild allergic reactions, Table 2-2) did not react to th e 35 kDa protein based upon Western blotting results (Figure 2-2). We do not, however, have any quantifiable inde x of exposure for the individuals in our sample and any interpre tations should be made with some caution. Numerous studies have rev ealed the presence of cr oss-reactive proteins among fungal species between genera (Aalberse et al., 2001; Aukrus t and Borch, 1985; Gupta et al., 2002; Horner et al., 1995; Si mon-Nobbe et al., 2000; Vieths et al., 2002; Weichel et al., 2003). In our experiments, (excess) crud e extract from a test organism was added during the primary antibody (human sera) incubation. Common or shared epitopes between B. bassiana and the test fungus would resu lt in a loss of signal due to competition for reactive IgEs. However, IgEs reactive to B. bassiana -specific antigens

PAGE 52

39 would not be affected, resulting in no cha nge in the corresponding reactive bands on a Western blot. Loss of a signal would indica te that a homolog or shared epitope (IgEreactive) exists between the two fungal spec ies, implying that primary sensitization by one organism can result in an allergic reac tion when exposed to the homologous allergen of another organism. Competitive immunobl ot inhibition experiments revealed significant epitope homology between B. bassiana and several clinica lly important fungi responsible for IgE-mediated al lergic reactions in atopic indi viduals. Thus, an allergic reaction to B. bassiana exposure may arise in pa tients sensitized to other fungi. Extracts from A. alternata and E. purpurascens almost completely competed with antigens present in the B. bassiana extract with the notable excep tion of the ~35 kDa allergen. Competition experiments using A. fumigatus C. herbarum C. albicans and P. notatum extracts also indicated th e presence of many shared epitopes, although distinct (noncompeted) IgE-binding B. bassiana proteins of 35 kDa, 64 kDa, and >200 kDa molecular mass were detectable. These proteins, part icularly the 35 kDa antigens may represent B. bassiana -specific allergens. E xperiments are underway to characterize the 35 kDa allergen, which may lead to a diagnostic assay for B. bassiana sensitization. Finally, our analysis of potential B. bassiana allergens was limited to cell extracts grown under specific conditions and did not include the culture filtrate. Extracellular proteases, an important class of fungal proteins that can elicit allerg enic reactions, have been characterized form a number of fungal species (Chou et al., 2003; Gupta et al., 2004; Nigam et al., 2003; Shen et al., 2001), and are likely to be present in B. bassiana A careful examination of culture growth conditions is also warranted in order to provide a standardized reagent for testing purposes.

PAGE 53

40 Conclusion Although B. bassiana holds promise as an arthropod biological control agent, there have been few reports on the allergenic potential of these organisms. Identification of B. bassiana -specific allergens can lead to diagnostic methods for determining sensitization to this organism and may provide a rational ba sis for allergen attenua tion in order to yield safer biocontrol products. The observe d cross-reactivity among proteins of B. bassiana and the fungi tested, highlight the importance of considering the possibility that multiple fungal sensitivity can occur due to exposure to a single fungus. Furt her testing should be performed to determine the scope, severit y, and range of allergenic reactions to B. bassiana Figure 2-1. SDS-PAGE and Immunoblot analysis of B. bassiana crude extracts. SDSPAGE, Gelcode blue stained, lanes A) 5 g protein standards, and B) 40 g B. bassiana crude extract. Immunoblots probed with pooled sera mix-I (patients displaying mould allergies) lanes 1), 5 g protei n standards, 2) 20 g B. bassiana crude extract, 3) 40 g crude extract, 4) 40 g crude extract, proteinase K treated, 5) 40 g crude extract, denaturing buffer control (no EndoH), 6) 40 g crude extract, EndoH treated.

PAGE 54

41 Table 2-1 Allergic profile of patient s AG, obtained by skin testing Figure 2-2. Immunoblot analysis of B. bassiana extracts (40 g crude extract/strip) probed with individual se ra. Lane 1) 5 g protein standards, 2) pooled sera mix-II (patients displaying mould allergies). Lanes A)G) membranes strips treated with individual sera from sera mix-II. Lanes H)M) membrane strips probed with individual sera random ly obtained from the general public. Individual Reactivity* to Fungal Extracts Patient no. Alt Asp Cep Cur Epic Fusa Helmin Hormo Pen A 3 2 3 2 2 3 B 3 2 2 3 2 2 2 C 4 3 2 D 2 2 2 2 2 E 3 2 3 2 3 3 F 4 1 1 2 4 2 G 3 4 3 2 *Skin test score is registered 0 with 4 representing the most reactivity. Abbreviations are: Alt-Alternaria, As p-Aspergillus, Cep-Cephalosporium, CurCurvularia, Epic-Epicoccum, Fusa-Fusar ium, Helmin-Helminthosporium, HormoHormodendrum, Pen-Penicillium.

PAGE 55

42 Figure 2-3. IgE immunoblot in hibition with fungal extracts B. bassiana protein strips (40 g crude extract) were blocked a nd incubated with mix containing (500 l) pooled sera (mix-II) 1) Seablue st andard, 2) no additions, 3) 40 g A. alternata crude extract, 4) 400 g A. alternata 5) 40 g A. fumigatus 6) 400 g A. fumigatus 7) 400 g C. herbarum 8) 400 g C. albicans 9) 400 g E. purpurascens and 10) 400 g P. notatum protein. Table 2-2. Intradermal skin test Histamine control (0.1mg/mL) B. bassiana Extract (1mg/mL) B. bassiana /Histamine (mm/mm) Patient ID Induration Erythema Indurat ion ErythemaInduration ratio J 7x6 12x16 8x8 12x13 0.65 K 20x15 55x50 13x12 14x13 0.52 L 11x10 16x33 13x14 26x28 1.65 M 15x16 36x44 10x12 10x12 0.30 N 16x14 38x58 10x11 21x17 0.49 O 21x16 39x59 9x8 18x21 0.21 P 15x17 44x45 5x4 5x4 0.08 Q 15x14 36x38 9x12 10x13 0.51 R 15x15 55x38 4x4 11x13 0.07 S 20x19 38x43 4x4 4x4 0.04 In all instances saline control pr oduced an Induration of 3 x 3 mm. Induration and erythema valu es are recorded in mm. Individual with occ upational exposure to B. bassiana

PAGE 56

43 CHAPTER 3 MOLECULAR AND IMMUNOLOGICAL C HARACTERIZATION OF PUTATIVE B. bassiana ALLERGENS Introduction Allergic diseases represen t a growing human health problem, affecting up to 25% of individuals living in i ndustrialized nations (Chiu a nd Fink, 2002). Both inand outdoor populations of filamentous fungi are a major cause of human allergies, and can in some cases, lead to severe allergic dis ease (Kurup et al., 2000b). Common clinical symptoms of atopic allergy include sneezing, rh initis, shortness of breath, and asthma. Asthma is a chronic respiratory disease that afflicts over 17 million Americans, and is responsible for 5,000 deaths annually (O'Ho llaren, 2006). Some 30% of asthma cases can be attributed to exposure and sensitization to filament ous fungal allergens (Kurup et al., 2002; Vijay and Kurup, 2004; Wuthrich, 1989). Beauveria bassiana is an entomopathogenic fungi currently used as a biological control agent against agricultural insect pests (Shah and Pell, 2003). B. bassiana is considered non pathogenic to vertebrates and has not been deemed a potential health or environmental hazard (EPA, 2000). Research pres ented in this thesis as well as by others has shown, however, that B. bassiana is capable of initiating an allergic response in humans; and applications of this fungus should take into acco unt potential health concerns regarding eliciti ng allergenic reactions. A volumetric assay of allergens in the 1980s revealed that although the environmental concentration of B. bassiana spores was very low, the allergic response

PAGE 57

44 was severe (Beaumont et al., 1985a; Beaumont et al., 1985c). Performing skin prick assays on patients with mold allergies, B. bassiana was shown to elicit on of the strongest reactions relative to the other fungal species in the study. In research presented as part of this thesis we have demonstrated that human IgEs, derived from patients displaying allergies to molds, react with several proteins produced by B. bassiana Furthermore, many of these proteins were cr oss reactive with alle rgens of other major allergenic fungi (Westwood et al., 2005). The majority of fungal allergens are pr oteins of unknown function; however, the biochemical activities of a num ber of allergens have been characterized. These typically fall into several classes including metabolic enzymes, proteases, and enzyme inhibitors (Stewart et al., 1993). An enzy me or protein identified as an allergen in one species of fungus is often found to be allergenic when iden tified in other species due to similarities in structure and/or function. In many cases, stru ctural similarities between the proteins of two species are close enough to be recogni zed by the same specific IgE antibodies, leading to cross-reactivity. Aldehyde dehydr ogenase has been identified as a major allergen in both Alternaria alternata (Alt a10) and Cladosporium herbarum (Cla h3) (Achatz et al., 1995). Enolase (2-phosho-Dglycerate hydrolase), a glycolytic enzyme responsible for the production of phosphoenolpyruvate, has been identified as an allergen of not only C. herbarum and A. alternata but of several other fungal species as well (Simon-Nobbe et al., 2000). Here we report the identification of four B. bassiana proteins as poten tial allergens. Full length cDNA and genomic nucleotide sequen ces of the four genes were determined. Similarity search results of the translated open reading frames of the proteins coded by

PAGE 58

45 the genes have led to their putative designa tion as follows; BbEno1, an enolase; BbF2, major allergen of Aspergillus fumigatus ; BbAld, aldehyde dehydrogenase; and BbHex, acetyhexoseaminadase. The cDNA sequences of all four proteins were used to design primers for subcloning of the genes into E. coli expression vectors. All four proteins were successfully expressed as recombinant proteins in E. coli Two of these proteins, a suspected enolase (BbEno1), and a suspected aldehyde de hydrogenase (BbAld) reacted with human IgEs derived from patients di splaying mold allergies. Materials and Methods Strains and Media B. bassiana (ATCC 90517) was maintained on potato dextrose agar (Difco, MI) at 26 C. For RNA extraction, driver and tester culture where grown on selective metabolic media; media and extraction perform as outlined in (Holder, 2005). E. coli strains used for cloning and heterologous protein expres sion included: TOPO Top 10, chemical competent cells (Invitrogen, CA); BL21 Rose tta (DE3), harbori ng the pRARE plasmid (Novagen, Darmstadt, Germany). E. coli cloning and expression strains were grown and/or maintained in Luria-Bertani (LB) or on LB Agar (LBA) (Difco, Detroit, MI), at 37 C. RACE PCR Full length gene sequences of the B. bassiana genes were obtained by RACE PCR technology (rapid amplification of cDNA ends). The SMART RACE cDNA Amplification kit (Clontech, CA) was used according to manufacturer instructions. Template mRNA was extracted from B. bassiana grown on minimal medium with 1% (w/v) glucose (0.4 g/L KH2PO4, 1.4 g/L Na2HPO4, 0.6 g/L MgSO4.7H2O, 1.0 g/L KCl, 0.25 g/L NH4NO3, 0.01 mg/L FeSO4 and 10 g/L sterilized cu ticle) and was inoculated

PAGE 59

46 with 0.1 mL of the Czapek dox (24 mL) cultu res (6 days). Cultures were grown for 6 days at 26 C with aeration (210 rpm) (Holder, 2005). 5 and 3 primers used for RACE are listed on Table 3-1 Cloning Primers where designed to clone the entire cDNA gene and to incorporate restriction sites for extraction and insertion in to an expression vect or (Table 3-1). An NdeI restriction (catatg) site was incorporated into the forward primer and an EcoRI site (gaattc) was incorporated into the reverse pr imer. PCR products were cloned directly into TOPO 2.1 using TOPO TA cloning syst em and transformed into TOPO Top 10 E. coli cells (Invitrogen, Carlsbad, CA). The B. bassiana genes where subcloned from the TOPO 2.1 constructs into the E. coli pET43.1a (Novagen, Darmstadt, Germany) expression system using the NdeI and EcoRI restriction site s in the clones and vector. Fo r expression, pET43.1a containing B. bassiana genes and amp resistance gene were transferred to an E. coli BL21 and expression strain, Rosetta (DE3) (Novagen, Darmstadt, Germany). The host strain harboring the pRARE plasmid which contai ns the genes for production of the rare codons; proL, leuW, metT, argW, thrT, glyT, tyrU, thrU, argU, and ileX. Thus, final expression cells contain two plasmi ds, pRARE and the pET construct. Expression The four B. bassiana proteins were e xpressed using an E. coli T7 polymerase based recombinant system. Overnight cultures of E. coli BL21 harboring pRARE along with each respective pET43.1a-based construct were grown in 3 mL of LB (Amp 50 g/mL, Cam 12 g/mL) at 37 C with aeration. 5 mL of fresh media was inoculated with 100 L

PAGE 60

47 of the overnight culture, and samples were incubated at 37 C with aeration to OD600 of 0.6.8 (2 hrs). Initial growth aliquots were taken and stor ed as uninduced samples. IPTG (Isopropyl--D-thiogalactopyr anosid) was then added to the remaining culture to a final concentration of 1.5 mM; cu ltures were returned to the incubator for an additional 2 hours. For extract prepara tion, cells were harvested by centrifugation (10,000 x g, 10 min) and the resultant pellet resuspended in 0.5 volumes TE (40 mM Tris, 1 mM EDTA, 0.01% phenylmethylsulfonyl fluoride (PMSF)). Cells were ly sed by sonication (3 x 30 sec) on ice. Sonicated samples were centr ifuged (10,000 x g, 10 min) and separated into soluble and pellet (containing potential inclusion bodies) frac tions. Both fractions were denatured with 1x LDS loading dye and bo iled for 5 min prior to separation by SDSPolyacrylamide gel electrophoresis (SDS-PAGE). Samples (15 L) were analyzed by SDS-PAGE using the Invitrogen NUPage, Mops system (12% Bis-tris gel) using the manufactures recommended protocols. Gels were stained with Coomasie Blue R250 followed by destaining with 10% methanol, 10% acetic acid solution. Western Blot and Immunodetection Protein samples were electrophoresed unde r reducing conditions using Bis-Tris SDS-PAGE 10% gels (Invitrogen Nu PAGE, Mops system), followed by electroblotting to polyvinylidene-fluoride (PVDF) membranes (Invitrogen, Carlsbad, CA). Membranes were incubated in bloc king buffer (TBST (25 mM TBS, 0.1% Tween 20), 10% dry fat free milk), either individua l or pooled human sera as the primary antibody solution. Typically, sera were dilu ted in blocking buffer and incubated with membranes overnight at 4 C with gentle agitation. Membranes were washed 3x using 50 mL TBST for 15 min. Binding of human Ig Es was visualized using a horseradish

PAGE 61

48 peroxidase (HRP) conjugated goat anti-hum an IgE (polyclonal) secondary antibody (BioSource International, CA). Membra nes were incubated in secondary antibody (diluted 1:10,000 in blocking buffer) for 1 hr at room temperature, with gentle agitation. After secondary antibody incubation membra nes were washed 3x using 50 mL TBST. Bands were visualized using the Immuno-Star HRP detection system (Bio-Rad, Hercules, CA). Membrane staining was performed by 5 mi nute incubation in Ponceaus S (Sigma, St. Louis, MO) and destai ned for 2 minutes with ddH2O. Analysis Programs Nucleotide manipulations were done using Vector nti, which was also used to generate figures showing nucleotide and amino acid sequences. Phylogenetic analyses of amino acid sequences were performed using ClustalW and SplitsTree. Initial sequence alignments where performed with ClustalW (Thompson et al., 1994). Alignment files (in Nexus format) were transferred to SplitsTree for analysis and construction of phylograms, with typical bootstrap parame ters set to 1000 (Huson and Bryant, 2006). Results Cloning and Sequencing EST (expressed sequence tag) panning and sc reening of a suppressive subtractive library (SSH) identified gene fragments of four potential allergens by sequence homology (Table 3-2) (Holder, 2005). The B. bassiana genes were designated as follows: bbeno1 similar to Cladosporium herbarum enolase Cla h 6; bbf2 similar to Aspergillus fumigatus major allergen Asp f 2; bbald similar to Cladosporium herbarum allergen Cla h 3, an aldehyde dehydrogenase; and bbhex with similarities to numerous fungal acetylhexosaminidase, including Pen ch 20.

PAGE 62

49 Since the nucleotide fragments (200) re presented only a portion of the entire gene sequence coding for each protein, fu ll length sequences were obtained by two rounds of RACE PCR. Based upon the final assembled gene sequences, primers were designed incorporating the restriction site Nd eI at the 5 end and EcoRI at the 3 end. Primers were designed for amplification of both genomic and cDNA sequences of each gene (Figure 3-1) (Table 3-2). The genomic sequence of bbeno1 consisted of 1548 bp from the start site to the stop codon and contained 4 introns (Figure 33). All four introns were between the lengths of 52 bp and are located in the first half of the gene. bbeno1 1317 bp cDNA sequence, encodes a 47 kDa protein 438 amino acids in length. Blastx similarity searches of BbEno1 amino acid sequence against the NCBI protein database resulted in high similarity to the enolases of seve ral different fungal species, including Aspergillus fumigatus Penicillium citrinum Alternaria alternata and Cladosporium herbarum These enolases are also know n to be highly allergenic. The genomic sequence of bbf2 consisted of 845 bp from st art site to the stop codon and contained one intron that began at bp 412 and was 59 bp in length (Figure 3-4). bbf2 encodes a 28 kDa protein, 261 amino acids in le ngth. Blastx similarity searches for BbF2 against the NCBI protein data bases identified sequence similarity to Aspergillus fumigatus major allergen Asp f 2. The functi on of the protein Asp f 2 is unknown. The genomic sequence of bbald consisted of 1659 bp from start site to stop codon and contained two introns (Fi gure 3-5); the first 106 bp in le ngth, started at bp 62, and the second, 59 bp in length, started at bp 568. bbald 1494 bp cDNA sequence encodes a 53 kDa protein, 497 amino acids in length. Blas t similarity searches of BbAld against the

PAGE 63

50 NCBI protein database revealed amino aci d sequence similarities to the aldehyde dehydrogenases produced by severa l fungal species including Alternaria alternata and Cladosporium herbarum both of which are known allergens. The genomic sequence of bbhex consists of 1959 bp from start site to stop codon and contained no introns (Figur e 3-6); translation results in a 72 kDa protein with an amino acid length of 652. Blastx similarity searches showed sequence similarity to several fungal N-acetylhexosaminid ases one of which (Pen ch 20) is a major allergen of Penicillium chrysogenum. Protein Expression All four B. bassiana genes were subcloned into th e pET43.1a expression vector as described in the Materials and Methods. The integrity of all the clones was verified by sequencing of the inserts. Initial attempts using the E. coli BL21 (DE3) (Novagen) yielded no visible expression of the protei ns after inductions as determined by SDSPAGE. The clones were then transformed into a BL21 E. coli strain containing pRARE, a plasmid that contains the genes for the e xpression of ten rare tRNAs (Novagen). Expression experiments were conducted w ith a 2 hr induction period and samples analyzed by SDS-PAGE. Highly expressed protein bands were visible in lanes containing samples that were IPTG induced, with no highly expresse d protein visible in the uninduced lanes (Figure 3-7). Note that the pET43.1a vector cont ains a collection of fusion tags (Nus-Tag, His-tag, and S-Tag), which were removed in the cloning of B. bassiana putative allergen genes, however in th e no insert control, the combined length of the fusion tags is 1800 bp and results in the expr ession of a polypeptide of approximately 70 kDa (Figure 3-7, lane 10).

PAGE 64

51 Induction of the BbEno1 clone by IPTG re sulted in the production of two bands, the first having the expected mass of 47 kD a, and a second smaller band with a mass 45 kDa (Figure 3-7, lane 2). The BbF2 clone al so appeared to produce two protein bands of 28 kDa (Figure 3-7, lane 4). Experiments were performed varying the induction time from 1 to 3 hrs and in all cases the expre ssion of two proteins was apparent in the BbEno1 and BbF2 (data not shown). Effect of Denaturing Conditi ons on Expressed Proteins In order to determine whether the tw o bands observed during expression of BbEno1 and BbF2 was the result of cleavage of the intact protein during denaturation, protein aliquots were placed in PAGE samp le buffer and boiled for various times. Fresh cultures were grown and induced (2 hrs with 1.5 mM IPTG), and aliquo ts were placed in 1x LDS loading buffer. Samples of all the four induced cultures were incubated at 95 C for 1, 5, and 20 minutes to lyse cells and dena ture proteins prior to being analyzed on 12% PAGE gels (Figure 3-8), a similar e xperiment was conducted with a 5 minute incubation of time and increasing temperatures 95, 100, 110 C (data not shown). The data revealed that denaturing conditions (boi ling in sample buffer) results in the partial breakdown of some of the expressed clones vi sualized by the increasing intensity of a lower molecule weight band. Only a single band was visible in the induced lanes of BbEno1 and BbF2 when denatured (heated) for one minute at 95 C, whereas increased time course of heating led to the appearan ce of a second BbAld band. The 72 kDa band produced by BbHex clone was not affected under the conditions tested (Figure 3-8). IgE Reactivity To test for allergenicity, the four recombinant B. bassiana proteins were separated by PAGE electrophoresis and electroblotted onto PVDF membranes. Membranes were

PAGE 65

52 blocked with 10% milk in TBST and treated wi th human sera to test for IgE reactivity. Sera used were collected from 20 patients with known fungal allergies. Each serum was randomly assigned an alphabetical designati on, and in most instances pooled was described alphabetically according to the sera it contained. Figur e 3-9 shows two blots containing all four expressed proteins as well as a crude B. bassiana extract (positive control), that were probed with one of tw o sera pools containing serum from ten patients each, pools AJ and KT. Each blot was treated with 200 L of each serum diluted in 5 mL blocking buffer, with a final volume of 7 mL and the concentration of each serum being 1:35. HRP conjugated goat anti-human Ig E was used to identify bands that had been bound by human IgEs. The blot probed w ith pool AJ revealed strong IgE binding of the two protein bands corresponding to BbEno1, as well as several reactive (background) E. coli bands (Figure 3-9). The B. bassiana crude extract reacted with a variety of IgEs present in the sera (Figur e 3-9, lane 5 and 10). Since, a number of experiments resulted in the faint potential inte raction of sera IgEs with BbF2 and BbAld experiments performed using smaller sera pools in which the concentration of any individual sera was increased. Five sera pools were created each co ntaining 1:5 dilutions of two sera each, designated as AB, CD, EF, GH and IJ. Thes e pools were then used to probe blots containing BbEno1, BbF2, and BbAld, (BbHex wa s omitted due to the lack of even faint reactivity). Background bands were highly variable between pools and were the results of specific IgE interactions. P ool EF reacted strongly against E. coli proteins of similar molecular weight as BbEno1 and BbAld (Fi gure 3-10), and was therefore not used any

PAGE 66

53 further. IgEs in pools AB and GH react ed against BbEno1. Human IgE binding to BbAld was also noted with pools AB and GH. Since many recombinant proteins often fo rm inclusion bodies when expressed in E. coli soluble and pellet fractions were isolated for all four E. coli expressed B. bassiana proteins after IPTG induction. SDS-PAGE anal yses of these fractions revealed, that all four B. bassiana proteins were located in the in soluble pellet fract ion, and hence are likely localized within incl usion bodies (Figure 3-11). Figure 3-12 presents three blots demo nstrating the human IgE binding and specificity of BbEno1. Panel (ABCD) shows BbEno1 (unfractionated samples) sample treated with a pool of ABCD (1:10 diluti on). The two bands corresponding to BbEno1 were bound by sera IgEs (Molecular mass range between 45 kDa). Panel (AB) of Figure 3-12 shows that there are no reactive ba nds present when serum (pool AB) is used to screen the uninduced sample or the soluble fraction. Panel (CD) of Figure 3-12 show a blot treated with human sera (pool CD) from individuals no t sensitized (allergic) to BbEno1. To confirm BbAld reactivity, 15 L sample s of BbAld pellet fraction were run on a 10%, 15 lane polyacrylamide gel (NuPAGE, In vitrogen); the thinner lanes and lower percent gel appeared to sli ghtly improve the resolution of the protein bands. After electroblotting onto PVDF membranes, cut lanes were treated with sera pools as follows: AB, CD, GH, IJ, KJ, MN, OP, QR, and ST (1:5 dilutions), 9 pools total (Figure 3-13). These results demonstrated BbAld specific IgEs we re present in four of the nine sera pool tested including pool AB.

PAGE 67

54 A further experiment testing for the pres ence of sera IgEs capable of binding BbEno1 and BbAld was performed. Figure 3-14 shows the results of blots containing the pellet fraction of the four B. bassiana proteins, probed with in dividual serum A and B. Blots were compared to a membrane stai ned with Ponceaus S, which confirms the presence and efficient transfer of the proteins (Figure 3-14). Phylogenetic Comparison BbEno1 displays high sequence similarity to fungal enolases many of which are major allergens. All available fungal enol ase sequences were ga thered including both allergenic enolases as well as enolases not know n to be allergenic in order to construct a phylogenetic comparison. The enolase from Hevea brasiliensis (rubber tree) was included in this comparison since it too is an allergen. Two additional non-fungal enolases were included as outlying sequen ces for rooting the tree. The non-fungal enolases included the enzymes from Drosophila melanogaster (fruit fly) and Escherichia coli (prokaryotic bacterium). Enolase amino acid sequences where prepar ed for phylogenetic analysis by first running a ClustalX alignment (Thompson et al ., 1994), and the resultant product saved in Nexus format to enable analysis by Sp litsTree phylogenetic program (Huson, 1998). Data was analyzed and organized into root ed phylograms (Figure 3-15). Probabilities were calculated using a b ootstrap value set to 1000. Of the 21 fungal enolases, eight have b een identified as allergenic including BbEno1. Known allergens are depicted by an as terisk in Figures 3-15. The positions of the allergens on the phylogram do not appear to be grouped or form any pattern, and they are equally distributed throughout the cladogram. It should be noted that enolases not

PAGE 68

55 marked as allergens do not necessarily repr esent non-allergens, but reflect cases where allergenicity has not been reported. Discussion Several studies have demons trated the potential of B. bassiana to elicit allergic reactions in humans (Beaum ont et al., 1985a; Beaumont et al., 1985c; Westwood et al., 2005). In this study we have taken the next step toward a better understanding of the allergenicity of B. bassiana Allergic testing towards B. bassiana is not routinely perfor med and indeed there are no approved extracts for testing patients for B. bassiana allergy. Theref ore, the serum collected was from patients that reacted to other fungi such as Aspergillus Alternaria and Epicoccum Since many patients that display allergies are often sensitive to multiple fungi (Horst et al., 1990), it was hypothesized that within a population of patients with known fungal allergies there would exist indi viduals sensitive to B. bassiana and that the cross-reactive nature of f ungal allergenic epitopes woul d increase the likely hood of finding individuals allergic to B. bassiana proteins. We have demonstrated th at crude extracts of B. bassiana contained several proteins that reacted with human sera IgE. EST and SSH revealed four protei ns that were highly similar to other fungal allergen s. Using the sera from 20 patients, human IgE binding of two of the proteins, BbEno1 and BbAld, was shown. Due to the small sample size and because the sera used to screen for allergen icity was not derived form patients with know B. bassiana allergies, the lack of reactivity of BbF2 and BbHe x does not discount them as potential allergens. Allergenic fungal enolases ha ve been shown to be highly cross reactive, and it has been reported that IgE cross-reactivity exists between the enolases of at least five fungal

PAGE 69

56 species, extending even to the plant enolase ( Hevea brasiliensis ) (Simon-Nobbe et al., 2000; Wagner et al., 2000). P hylogenetic analysis of availa ble fungal enolase sequences, including those shown to be allergens (and cros s-reactive) resulted in no clear distribution pattern. The enolases which have been identi fied as allergens were distributed equally throughout the phylograms. This could indicate that the shape or f unction of the enzyme has an effect on the immune response, resul ting in a preference towards humeral and IgE pathways. This has been seen with other highly allergenic enzyme s (Gough et al., 2003; Gough et al., 2001). The cross-reactive nature of these enolases increases their impor tance as causes of allergic reactions. The cross reactive enol ases are seen throughout the phylogram and even include cross-reactivity between fungal and non-fungal enolases. This indicates that not only does the enzymatic enolase have a propensity towards humeral immune response but that the allergenic region of the protein is highly conserved even between distant taxa. Although based on sequence similarity, BbE no1 has been designated as an enolase and BbAld as an aldehyde dehydrogenase, bioc hemical confirmation is still required. Immunoblot results demonstrated both BbEno1 and BbAld are bound by specific human IgEs and can therefor e elicit allergic responses. BbEno1 and BbAld represent the first identification of allergens from the filamentous fungus B. bassiana Future research is aimed at confirming the function of BbEno1 a nd BbAld, as well as continuing to isolate and identify the epitopes responsible of B. bassiana allergenicity.

PAGE 70

57 Table 3-1. PCR Primers Clone Primer ID Primer sequence (53) Function BbEno1 11010110i-r cctcggcgaaggggtcttcgatg 5' RACE 11010110i-f atgattgggaggcctggagctacttctaca 3' RACE Beab1-f gaaagacagtcc at atggccatcaccaagg Forward Beab1-r gaatt ccgtcacgccgcatgtcagcactcc Reverse BbF2 11130106i-f gggctgcgacatcgtacgcccaaa 5' RACE 11130106i-r ccggagttggatgcactggcaagct 3' RACE Beab2-f gacatcacaatcc at atgaagacaccgagc Forward Beab2-r gaattcgacaatacatttg cttcatccaccgcactc Reverse BbAld 3H05-f tcaggt tccaggaatgcagcagctttga 5' RACE 3H05-r agaaggtcactcttgagctcggtggcaagt 3' RACE Beab3-f2 cat atgactttgacagtgcagctatctacgcccgct Forward Beab3-r gaattc tgttgatgtcccaagagcttgtctgggc Reverse BbHex 5'HexosRace aacgagggggtggccgcagt 5' RACE 5'HexosRace2 gcgcgcgtatg caatgaggtctttaac 5' RACE Beab4-f ca tatgcgttctcagtcattgtcctctggtttgc Forward Beab4-r gaattc gaatgacaagtcctacactattgccgctgctcc Reverse Modified or inserted base pairs are underline. Table 3-2. Cloning vectors Plasmid Gene E. coli strain Notes Cell stock BbEno1 pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20a pCR2.1-TOPO genomic Top 10 Sequence confirmed G13 pET43.1a cDNA BL21(DE3) Sequence confirmed G21a pET43.1a cDNA BL21(DE3) pRARE/expression G23a BbF2 pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20b pCR2.1-TOPO genomic Top 10 Sequence confirmed G14 pET43.1a cDNA BL21(DE3) Sequence confirmed G21b pET43.1a cDNA BL21(DE 3) pRARE/expression G22b BbAld pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G24 pCR2.1-TOPO genomic Top 10 Sequence confirmed G15 pET43.1a cDNA Top 10 Sequence confirmed G25 pET43.1a cDNA BL21(DE3) pRARE/expression G26 BbHex pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20d pCR2.1-TOPO genomic Top 10 Sequence confirmed G16 pET43.1a cDNA BL21(DE3) Sequence confirmed G21d pET43.1a cDNA BL21(DE 3) pRARE/expression G23d

PAGE 71

58 Table 3-3. Allergens with sequence similarities to B. bassiana Species Function Allergen I.D. Accession number E* value BbEno1 Alternaria alternata enolase Alt a 6 U82437 0.0 Cladosporium herbarum enolase Cla h 6 X78226 0.0 Aspergillus fumigatus enolase Asp f 22w AF284645 0.0 Neurospora crassa enolase XM3231500.0 Penicillium citrinum enolase Pen c 22w AF254643 0.0 BbF2 Aspergillus fumigatus major allergen Asp f 2 AAC59357-64 Aspergillus nidulans antigen 1 XP659435 -55 Candida albicans pH regulated antigen AAC00525-52 Candida albicans fibrinogen binding mannoprotein AAC49898-52 BbAld Alternaria alternata aldehyde dehydrogenase Alt a 10 X78227 0.0 Cladosporium herbarum aldehyde dehydrogenase Cla h 10 X78228 0.0 Cladosporium fulvum aldehyde dehydrogenase AF275347 0.0 Neurospora crassa aldehyde dehydrogenase XM9517690.0 Aspergillus nidulans aldehyde dehydrogenase XM6530660.0 BbHex Metarhizium anisopliae acetylglucosaminidase DQ000319 0.0 Aspergillus fumigatus acetylhexosaminidase XM7422140.0 Aspergillus oryzae acetylhexosaminidase AB085840 0.0 Penicillium chrysogenum acetylglucosaminidase Pen ch 20 AAB34785-47 E=Kmn e^S Blastx statistical value; E = the chance the match was made in error.(Fitch, 1983).

PAGE 72

59 Table 3-4. Result of RACE PCR Clone Gene Insert Length Atgstop poly a 11190110i bbeno1 original SSH clone 271 2110202 bbeno1 5 RACE product 907 2250210 bbeno1 3 RACE product 410 601 bbeno1 Total sequence 1317 1508 11130106i bbf2 original SSH clone 190 388 2110205 bbf2 5 RACE product 736 2200211 bbf2 3 RACE product 50 217 bbf2 Total sequence 786 984 3H05 bbald original SSH clone 195 2110209 bbald 5 RACE product 775 2250212 bbald 3 RACE product 719 839 bbald Total sequence 1494 1618 1H10 original SSH clone 651 787 6170201 bbhex 5 RACE product 864 7260201 bbhex 5 RACE 2nd round 912 bbhex Total sequence 1959 2095

PAGE 73

60 Figure 3-1. cDNA vs genomic: (2) bbeno1 cDNA ;(3) bbeno1 genomic DNA; (4) bbf2 cDNA; (5) bbf2 genomic DNA; (6) bbald cDNA; (7) bbald genomic DNA; (8) bbhex cDNA; (9) bbhex genomic DNA; (1) lambda DNA, Hind III digest (New England Biolabs, MA), (10) 50kb ladder (BioRad, CA). BbEno1 1548 bp BbF2 845 bp BbAld 1659 bp BbHex 1996 bp Figure 3-2. Illustration depicting genomic gene sequences of putative B. bassiana allergens with relative si ze and location of introns.

PAGE 74

61 Figure 3-3. Genomic nucleotide sequ ence and amino acid translation of bbeno1

PAGE 75

62 Figure 3-4. Genomic nucleotide sequ ence and amino acid translation of bbf2

PAGE 76

63 Figure 3-5. Genomic nucleotide sequ ence and amino acid translation of bbald

PAGE 77

64 Figure 3-6. Genomic nucleotid e and amino acid sequence of bbhex

PAGE 78

65 Figure 3-7. SDS-PAGE gel of unfractioned uninduced and induced expression cultures, and stained with Coomasie Blue. Lane (1) BbEno1 uninduced, (2) BbEno1 induced, (3) BbF2 uninduced, (4) BbF2 induced, (5) BbAld uninduced, (6) BbAld induced, (7) BbHex uninduced, (8) BbHex induced, (9) uninduced unmodified pET vector and (10) induced unmodified pET vector. Figure 3-8. Coomasie Blue stained 12% SDS-PAGE gel. Lane (1) BbEno1 pellet fraction, (2) BbF2 pellet fraction, (3) BbAld pellet fraction, and (4) BbHex pellet fraction. Proteins treated with 1x LDS sample buffer and incubated at 95 C for (a) 1 minute, (b) 5 minutes, and (c) 20 minutes.

PAGE 79

66 Figure 3-9. Immunoblot: panels designated ac cording to the sera in the pool it was probed with. 10 sera per pool, final concen tration of each serum (1:35). Lane (1) BbEno1 induced sample, (2) BbF2 induced sample, (3) BbAld induced sample, (4) BbHex induced sample, and (5) 40 g crude B. bassiana extract. Figure 3-10. Immunoblot panels are designate d according to the sera in the pool it was probed with. 2 sera per pool, final concen tration of each serum (1:5). Lane 1 3, induced culture (unfractioned) (1) BbEno1 sample (2) BbF2 sample (3) BbAld sample.

PAGE 80

67 Figure 3-11. 10%SDS-PAGE gel stained with Coomasie. (1) BbEno1 induced soluble fraction; (2) BbEno1 induced pellet fract ion; (3) BbF2 induced soluble; (4) BbF2 induced pellet fraction; (5) BbAl d induced soluble; (6) BbAld induced pellet fraction; (7) BbHex induced soluble; (8) BbHe x induced pellet fraction; (9) BbHex uninduced soluble; (10) BbHex uninduced unfractioned; (11) BbHex uninduced pellet fraction. Figure 3-12. Immunoblots probed with pooled sera final dilution of each serum in each pool (1:10). Panals are labeled accord ing to screening pool. Lane (1) BbEno1 induced unfractioned, (2) BbF2 induced unfractioned (3) BbEno1 uninduced unfractioned, (4) BbHex induced unfractioned. (u) BbEno1 uninduced unfractioned, (i) BbEno1 induced unf ractioned, (s) BbEno1 induced soluble fraction, (p) BbEno1 induced pellet fraction.

PAGE 81

68 Figure 3-13. Immunoblots of Bb Ald protein strips probed with 1 mL of sera pool. Each pool contained two sera (final dilution 1:5 each sera) lanes are label according to the sera in the pool it was probed with. Figure 3-14. Immunoblots of B. bassiana proteins (pellet fraction). Lane (1) BbEno1, (2) BbF2, (3) BbAld, and (4) BbHex; pa nel (1) PVDF membrane stained with Ponceaus S; panel (A) blot treated wi th serum A (1:5) as primary antibody; panel (B) blot treated with serum B (1:5) as primary antibody.

PAGE 82

69 Figure 3-15. Enolase phylogram, numbers at nodes are posterior probabilities values greater than or equal to 90%. Species that produce an enolase known to be allergenic are denoted by an asterisk.

PAGE 83

70 Table 3-5. Enolase accession numbers Species Accession number Alternaria alternata U82437 Ashbya gossypii Q756H2 Aspergillus fumigatus AF284645 Aspergillus nidulans XM_658258 Aspergillus oryzae D64113 Beauveria bassiana DQ767719 Cladosporium herbarum X78226 Candida albicans enolase L04943 Candida glabrata Q6FTW6 Cryphonectria parasitica Q6RG04 Cunninghamella elegans O74286 Curvularia lunata AY034826 Debaryomyces hansenii Q6BTB1 Drosophila melanogaster NM_164434 Escherichia. coli P0A6Q1 Hevea brasiliensis Q9LEJ0 Kluyveromyces lactis AJ586240 Neocallimastix frontalis P42894 Neurospora crassa XM_323160 Penicillium chrysogenum AB091508 Penicillium citrinum AF254643 Rhodotorula rubra Q870B9 Saccharomyces cerevisiae J01323 Schizosaccharomyces pombe P40370

PAGE 84

71 CHAPTER 4 CONCLUSIONS In industrialized nations, allergic dise ase is a growing health concern with symptoms ranging from atopic hay fever (s neezing, itching, and coughing) to chronic disease even death. Allergens produced by f ilamentous fungi contribute to symptoms in all three categories, and therefore pose a human health threat independent of pathogenicity or virulence. Angioedema hypersensitivity pneumonitis, sinusitis, and asthma are example of serious acute and ch ronic allergen induced diseases caused by fungi without actual infection. Beauveria bassiana is an entomopathogenic fungus currently used as a biological pesticide and studied as a potenti al tool for controlling the spr ead of insect borne diseases (Geetha and Balaraman, 1999; Haraprasad N, 2001; Scholte et al., 2005; Shah and Pell, 2003). B. bassiana was tested and approved for commercial use by the U.S. Environmental Protection Agency after tests showed that B. bassiana does not pose a threat of infection to humans or other vert ebrates (EPA, 2000). Although not a threat as an infectious disease, B. bassiana is a filamentous fungus that may pose a health concern as an allergen; this is especi ally true for individuals working directly with the fungus in an industrial or agricultural se tting, where aerial conidia concen tration would be highest. Human sera and immunoblot analysis were used to study the ability of B. bassiana to react with human IgE in order to gauge the validity of the following hypothesis: B. bassiana is a filamentous fungus capable of in itiating an IgE-mediated hypersensitive response in humans; a response mediated by specific IgEs due to direct sensitivity

PAGE 85

72 developed towards B. bassiana allergens, or epitope recognition of a B. bassiana antigen(s) by specific IgEs pr oduced in response to another species of fungus (crossreactivity) (Aukrust and Borch, 1985). To this point in our study, we revealed that B. bassiana produces many IgE reactive proteins, ranging from 12 kDa to >95 kDa, with the most prominent antigens at 35, 42 52, and 60. Immunoblots place the allergen ic proteins BbEno1 and BbAld in the region of 42 kDa and are suspected to be th e cause of IgE reactivity in this region. Continued research will concentrate on conf irming the role these proteins play in B. bassiana hypersensitivity, as well as identifying the remaining major allergenic proteins produced by B. bassiana Allergenicity of Beauveria bassiana Proteins produced by B. bassiana were probed by human sera, and tested for the binding of sera IgEs. Experiments resulted in clear reactivity between extract proteins and human IgE. Reactive proteins bands vari ed in size and intensity, with the strongest bands at 35, 42, and 60 kDa. Western blots probed with individual sera confirmed that antibody-antigen interactions are the result of specific recognition of B. bassiana proteins by sera IgEs. Although common bands can be seen between individuals, each serum produced a unique ba nding pattern due to the variation in reactive IgEs. The most common band was located at 35 kDa band, which was present in 6 of the 10 sera showing IgE reactive. On ly two sera had the identical reaction to B. bassiana both patients displayed reaction to the 35 kDa protein alone. Of the individual serum tested, 13 came from patients with known fungal allergies; all had tested positive for allergic reactions to at least two other sp ecies of fungi. Of these 13 patients, 8 sera tested positive for IgE binding to B. bassiana proteins.

PAGE 86

73 To address the issue of cross-reactivity, competitive inhibition experiments showed that B. bassiana shared several allergen ic epitopes with other common allergenic fungi. Although no single fungus removed all bands, Alternaria and Epicoccum shared the most allergenic epitopes. No fungus removed the 35 kDa band which may represent direct sensitivity to B. bassiana Skin tests confirm the ability of B. bassiana proteins to elicit an IgE specific allergic response. Characterization of Allergens Screening of EST and SSH libraries (Hol der, 2005), revealed proteins with sequence similarity to major fungal allergen s; the proteins were cloned and designated BbEno1, BbF2, BbAld, and BbHex. Of the four BbEno1 was of particular interest due to its sequence similarities to a highly cross-reactive group of fungal enolases. Of the twenty fungal enolase sequences found in the NCBI protein data base, seven have been identified as major allergens. Fungal enolase has been calle d a pan-allerge n, since cross reactivity has been shown to ex ist between epitopes shared by at least five allergenic fungal enolases, cross-reactivity has also been seen between fungal and plant enolases (Breitenbach and Simon-Nobbe, 2002; Simon-Nobbe et al., 2000). Phylogenetic comparisons of enolase seque nces show that allergenic and crossreactive epitopes are not limited to a specific group of fungi, but are distributed throughout the cladogram and includes Hevea brasiliensis (non-fungal enolase). For this reason, it is likely that more of the identif ied enolases will prove to be allergens once tested. The putative B. bassiana enolase, BbEno1, was tested for allergenicity by probing western blots with human serum. Sera cam e from patients with known fungal allergens, and blots confirmed that BbEno1 is rec ognized and bound by specific IgE(s). BbEno1

PAGE 87

74 was tested with several different sera pools showing the IgE binding is specific to the BbEno1 protein and that the reaction occurs in a significant percent of the patient sera tested. Due to the conserved nature of funga l enolases it is likely that BbEno1 will prove to be cross-reactive with IgEs from other allergenic enolases. BbAld was also shown by Imm unoblot analysis using human sera to be capable of initiating an allergic respons e by binding sera IgEs. Alt hough not as numerous as fungal enolase, aldehyde dehydrogenases are includ e in the list of major and minor fungal allergens. Alternaria alternata and Cladosporium herbarium are two fungi that posses aldehyde dehydrogenase that are not only allergenic but also believed to be cross-reactive (Kurup and Banerjee, 2000). Future Experiments We have shown that B. bassiana produces many proteins capable of initiation a human allergic response either by cross-react ivity or by direct deve loped sensitivity to B. bassiana antigens. Although we have isolated an d identified two allergenic proteins, continued work is needed to identify the remaining allergens, as well as further characterization of BbEno1 and BbAld. Future research will concentr ate on three areas; (1) the continued identification of allerg ens; (2) the functional and biochemical characterization of allerg ens; (3) development of hypoallergenic strains. Identifying the major allergenic proteins of B. bassiana is the primary goal of future research. It is believed that BbEno1 a nd BbAld are responsible, at least in part, for the high reactive 42 kDa region seen in immu noblot assays. Competitive inhibition blots using purified BbEno1 and BbAld can be performed to confirm or identify the role these proteins play in the allergenicity of this region. Identification of the remaining

PAGE 88

75 major bands at 60 and especially the 35 kDa is important for understanding the allergenicity of this fungus. Once identified as allergenic, steps will to be taken to confirm the identity of the protein. By sequence similarity BbEno1 has been designated to be and enolase and BbAld to be aldehyde dehydrogenase. Bioc hemical function and/or properties of BbEno1, BbAld, and all other B. bassiana allergens that are identified, can be confirmation by enzyme assay. Northern blot s analysis can be utilized to understand production and regulation of the identified allergens. The identification, isolation, and characterization, of the major B. bassiana allergens are preparatory to the production of knockout strains, which will be used to study the effect or the importanc e of the proteins in fungal metabolism and virulence. If an identified allergen carrie s out a redundant function then its removal may not affect its virulence. If a knockout strains result in th e loss or significant decr ease in function, then restoration of function may be obtained by complementation with non-allergenic forms of the enzyme. B. bassiana has great potential in commercial and agricultural pest management as well as insect borne di sease control; the production and use of hypoallergenic strains of B. bassiana could reduce the potential th reat of causing acute or chronic allergic disease.

PAGE 89

76 APPENDIX ADDITIONAL FIGURES AND TABLES Table A-1. Taxonomy of Beauveria bassiana Holomorph Anamorph Kingdom Fungi Phylum Ascomycotina Subphylum Pezizomycotina Deuteromycota Class Sordariomycetes Hyphomycetes Subclass Hypocreomycetidae Order Hypocreales Moniliales Family Clavicipitaceae Genus Cordyceps Beauveria Species bassiana bassiana Table A-2. Molecular properties of B. bassiana genes Gene product MW (kDa) Putative Function Intron number Gene length Gen. Gene length cDNA # AA pI BbEno1 47.4 Enolase 4 1548 1317 438 5.07 BbF2 28.6 Unknown 1 845 786 261 7.64 BbAld 53.9 Aldehyde dehydrogenase 2 1659 1494 497 5.99 BbHex 72 Hexos-aminidase 0 1959 1959 652 5.56

PAGE 90

77 Figure A-1. Clastalw alignment of BbE no1 and the allergenic enolases from, Alternaria alternata (alt a 6), Cladosporium herbarum (Cla h 6), and Aspergillus fumigatus (asp f 22w).

PAGE 91

78 Figure A-2. Clastalw alignment of BbAld and the allergenic Aldehyde dehydrogenase from Alternaria alternata (alt a 10), and Cladosporium herbarum (Cla h 3).

PAGE 92

79 Figure A-3. Aldehyde dehydr ogenase phylogram, numbers at nodes are posterior probability values. Species that pr oduce an aldehyde dehydrogenase, known to be allergenic are denoted by an asterisk.

PAGE 93

80 Table A-3. Accession numbers Species Accession number Enolase Aldehyde dehydrogenase Alternaria alternata U82437 X78227 Ashbya gossypii Q756H2 Aspergillus fumigatus AF284645 745933 Aspergillus nidulans XM_658258 XM_653066 Aspergillus oryzae D64113 Beauveria bassiana DQ767719 DQ767721 Cladosporium fulvum AF275347 Cladosporium herbarum X78226 X78228 Candida albicans L04943 XM_710254 Candida glabrata Q6FTW6 Cryphonectria parasitica Q6RG04 Cunninghamella elegans O74286 Curvularia lunata AY034826 Debaryomyces hansenii Q6BTB1 XM_461708 Drosophila melanogaster NM_164434 Escherichia. coli P0A6Q1 P0A9Q7 Hevea brasiliensis Q9LEJ0 Kluyveromyces lactis AJ586240 Neocallimastix frontalis P42894 Neurospora crassa XM_323160 3873009 Penicillium chrysogenum AB091508 Penicillium citrinum AF254643 Rhodotorula rubra Q870B9 Saccharomyces cerevisiae J01323 P47771 Schizosaccharomyces pombe P40370

PAGE 94

81 LIST OF REFERENCES AAAAI. (1996-2001) The Allergy Report: Scienc e Based Findings on the Diagnosis & Treatment of Allergic Disorders. Amer ican Academy of A llergy, Asthma and Immunology (AAAAI). Aalberse R. C., Akkerdaas J. and van Ree R. (2001) Cross-reactivity of IgE antibodies to allergens. Allergy 56 478-90. Achatz G., Oberkofler H., Lechenauer E., Simon B., Unger A., Kandler D., Ebner C., Prillinger H., Kraft D. and Breitenbach M. (1995) Mol ecular cloning of major and minor allergens of Alternaria al ternata and Cladosporium herbarum. Mol Immunol 32 213-27. Akbar W., Lord J. C., Nechols J. R. a nd Howard R. W. (2004) Diatomaceous earth increases the efficacy of Beauveria bassi ana against Tribolium castaneum larvae and increases conidia attachment. J Econ Entomol 97 273-80. Al-Suwaine A. S., Bahkali A. H. and Hasn ain S. M. (1999) Seasonal incidence of airborne fungal allergens in Riyadh, Saudi Arabia. Mycopathologia 145 15-22. Alexopoulos C. J., C. W. Mims, M. Blackwell. (1996) Introductory Mycology John Wiley and Sons, inc, New York. Alves S. B., Tamai M. A., Rossi L. S. a nd Castiglioni E. (2005) Beauveria bassiana pathogenicity to the citrus rust mite Phyllocoptruta oleivora. Exp Appl Acarol 37 117-22. Arbes S. J., Jr., Gergen P. J., Elliott L. a nd Zeldin D. C. (2005) Prevalences of positive skin test responses to 10 common allerg ens in the US population: results from the third National Health and Nutrition Examination Survey. J Allergy Clin Immunol 116 377-83. Aukrust L. (1992) Mold allergy. Introduction. Clin Rev Allergy 10 147-51. Aukrust L. and Borch S. M. ( 1985) Cross reactivity of moulds. Allergy 40 57-60. Aukrust L., Borch S. M. and Einarsson R. (1985) Mold allergy--s pores and mycelium as allergen sources. Allergy 40 43-8.

PAGE 95

82 Baldo B. A. and Baker R. S. (1988) Inhalant allergies to fungi: reactions to bakers' yeast (Saccharomyces cerevisiae) and identifica tion of bakers' yeast enolase as an important allergen. Int Arch Allergy Appl Immunol 86 201-8. Banerjee B., Greenberger P. A., Fink J. N. and Kurup V. P. (1998) Immunological characterization of Asp f 2, a major a llergen from Aspergillus fumigatus associated with allergic bronchopulmonary aspergillosis. Infect Immun 66 517582. Banerjee B. and Kurup V. P. (2003) Mol ecular biology of Aspergillus allergens. Front Biosci 8 S128-39. Beaumont F., Kauffman H. F., de Monchy J. G., Sluiter H. J. and de Vries K. (1985a) Volumetric aerobiological surv ey of conidial fungi in the North-East Netherlands. II. Comparison of aerobiological data and skin tests with mould extracts in an asthmatic population. Allergy 40 181-6. Beaumont F., Kauffman H. F., Sluiter H. J. and De Vries K. (1985b) Sequential sampling of fungal air spores inside and outside the homes of mould-sensitive, asthmatic patients: a search for a relati onship to obstructive reactions. Ann Allergy 55 7406. Beaumont F., Kauffman H. F., van der Mark T. H., Sluiter H. J. and de Vries K. (1985c) Volumetric aerobiological surv ey of conidial fungi in the North-East Netherlands. I. Seasonal patterns and the influe nce of metereological variables. Allergy 40 173-80. Blanford S., Chan B. H., Jenkins N., Sim D., Tu rner R. J., Read A. F. and Thomas M. B. (2005) Fungal pathogen reduces po tential for malaria transmission. Science 308 1638-41. Boucias D. G., Pendland J. C. and Latge J. P. (1988) Nonspecifi c Factors Involved in Attachment of Entomopathogenic Deuter omycetes to Host Insect Cuticle. Appl Environ Microbiol 54 1795-1805. Bounechada M. and Doumandji S. E. (2004) Effection of Ocneridia volxemi Bolivar (Pamphaginae, Orthoptera) hoppers a nd adults by Beauveria bassiana (Deuteromycotina, hyphomycetes) c onidia in an oil formulation. Commun Agric Appl Biol Sci 69 211-8. Breitenbach M., Crameri R. and Lehrer S. B. (2002) Impact of current genome projects on the study of pathogeni c and allergenic fungi. Chem Immunol 81 5-9. Breitenbach M. and Simon-Nobbe B. (2002) The allergens of Cladosporium herbarum and Alternaria alternata. Chem Immunol 81 48-72. Bush R. K., Portnoy J. M., Saxon A., Terr A. I. and Wood R. A. (2006) The medical effects of mold exposure. J Allergy Clin Immunol 117 326-33.

PAGE 96

83 CDC. (2002) Fast Stats A-Z, Vital and Health Statistics, Vol. Seri es 10; 205. Retrieved June 12, 2006 from http://www.cdc.gov/nchs/dat a/series/sr_10/sr10_205.pdf. Center of Disease control. Chiu A. M. and Fink J. N. (2002) Funga l allergy and pathogenicity. Introduction. Chem Immunol 81 1-4. Chou H., Chang C. Y., Tsai J. J., Tang R. B ., Lee S. S., Wang S. R., Peng H. J. and Shen H. D. (2003) The prevalence of IgE antibody reactivity against the alkaline serine protease major allergen of Penicillium chrysogenum increases with the age of asthmatic patients. Ann Allergy Asthma Immunol 90 248-53. Cole G. T. and Kendrick B. (1981) Biology of Conidial Fungi, Vol. 2. Academic Press, NY. Crameri R., Hemmann S., Ismail C., Menz G. and Blaser K. (1998a) Disease-specific recombinant allergens for the dia gnosis of allergic bronchopulmonary aspergillosis. Int Immunol 10 1211-6. Crameri R., Hemmann S., Ismail C., Menz G. and Blaser K. (1998b) [Recombinant allergens for diagnosis of allergic bronchopulmonary aspergillosis]. Pneumologie 52 183-5. Cruz A., Saenz de Santamaria M., Martinez J ., Martinez A., Guisantes J. and Palacios R. (1997) Fungal allergens from important allergenic fungi imperfecti. Allergol Immunopathol (Madr) 25 153-8. Cruz L. P., Gaitan A. L. and Gongora C. E. (2005) Exploiting the genetic diversity of Beauveria bassiana for improving the biolog ical control of the coffee berry borer through the use of strain mixtures. Appl Microbiol Biotechnol 1-9. de Almeida M. B., Bussamra M. H. a nd Rodrigues J. C. (2006) Allergic bronchopulmonary aspergillosis in paed iatric cystic fibrosis patients. Paediatr Respir Rev 7 67-72. Denning D. W., O'Driscoll B. R., Hogaboam C. M., Bowyer P. and Niven R. M. (2006) The link between fungi and severe asthma: a summary of the evidence. Eur Respir J 27 615-26. Ebo D. G., Hagendorens M. M., Bridts C. H., De Clerck L. S. and Stevens W. J. (2004) Sensitization to cross-re active carbohydrate determin ants and the ubiquitous protein profilin: mimickers of allergy. Clin Exp Allergy 34 137-44. Edmondson D. A., Nordness M. E., Zacharisen M. C., Kurup V. P. and Fink J. N. (2005) Allergy and "toxic mold syndrome". Ann Allergy Asthma Immunol 94 234-9. EPA. (2000) Biopesticide Fact Sheet: B eauveria bassiana stra in ATCC 74040 (128818).

PAGE 97

84 Ettinger S. J., Feldman, E.C. (2000) Diseases of the Dog and Cat. In Textbook of Veterinary Internal Medicine Vol. 1, p. 402-406. W.B. Saunders Co, Philadelphia. Fernndez PM L. R., Alves S. (1985) Patogenicidade de Beauveria bassiana (Bals) Vuill a broca do cafe Hypothenemus hampei (F errari 1867) Coleoptera, Scolytidae. Ecossistema 10 176-182. Fitch W. M. (1983) Random sequences. J Mol Biol 163 171-6. Garrett D. O., Jochimsen E. and Jarvis W. ( 1999) Invasive Aspergillu s spp infections in rheumatology patients. J Rheumatol 26 146-9. Geetha I. and Balaraman K. (1999) Eff ect of entomopathogenic fungus, Beauveria bassiana on larvae of thr ee species of mosquitoes. Indian J Exp Biol 37 1148-50. Goldsby R. A., Kindt, T.J., Osborne, B.A. (2000) Kuby Immunology W.H. Freedman and co. Gough L., Campbell E., Bayley D., Van Heek e G. and Shakib F. (2003) Proteolytic activity of the house dust mite allergen Der p 1 enhances allergenicity in a mouse inhalation model. Clin Exp Allergy 33 1159-63. Gough L., Sewell H. F. and Shakib F. (2001) The proteolytic activity of the major dust mite allergen Der p 1 enhances the Ig E antibody response to a bystander antigen. Clin Exp Allergy 31 1594-8. Gould H. J., Sutton B. J., Beavil A. J., Beavil R. L., McCloskey N., Coker H. A., Fear D. and Smurthwaite L. (2003) The biology of IGE and the basis of allergic disease. Annu Rev Immunol 21 579-628. Gupta R., Sharma V., Sridhara S., Singh B. P. and Arora N. (2004) Identification of serine protease as a major al lergen of Curvularia lunata. Allergy 59 421-7. Gupta R., Singh B. P., Sridhara S., Gaur S. N., Kumar R., Chaudhary V. K. and Arora N. (2002) Allergenic cross-reactivity of Curvul aria lunata with other airborne fungal species. Allergy 57 636-40. Haraprasad N N. S., Prakash HS, Shetty HS, Wahab S. (2001) Beauveria bassiana a potential mycopesticide for the effi cient control of coffee berry borer, Hypothenemus hampei (Ferrari) in India. Biocontrol Science and Technology 11 251-260. Hemmann S., Blaser K. and Cr ameri R. (1997) Allergens of Aspergillus fumigatus and Candida boidinii share IgE-binding epitopes. Am J Respir Crit Care Med 156 1956-62.

PAGE 98

85 Hemmer W., Focke M., Kolarich D., Dalik I., Gotz M., Jarisch R., Ebo D. G., Hagendorens M. M., Bridts C. H., De Cl erck L. S. and Stevens W. J. (2004) Identification by immunoblot of venom glycoproteins displaying immunoglobulin E-binding N-glycans as cross-reactive al lergens in honeybee and yellow jacket venom Sensitization to cros s-reactive carbohydrate determinants and the ubiquitous protein profilin: mimickers of allergy. Clin Exp Allergy 34 460-9. Henke M. O., De Hoog G. S., Gross U., Zimmermann G., Kraemer D. and Weig M. (2002) Human deep tissue infection with an entomopathogenic Beauveria species. J Clin Microbiol 40 2698-702. Herrera-Mozo I., Ferrer B., Lu is Rodriguez-Sanchez J. and Juarez C. (2006) Description of a Novel Panallergen of Cross-R eactivity between Moulds and Foods. Immunol Invest 35 181-97. Holder D. J. (2005) Adhesion propertie s and cell surface char acteristics of the entomopathogenic fungus Beauveria ba ssiana: A link between morphology and virulence. In Microbiology and Cell Science Vol. Ph.D., p. 105. University of Florida, Gainesville. Holder D. J. and Keyhani N. O. (2005) Adhesion of the en tomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl Environ Microbiol 71 5260-6. Horner W. E., Helbling A., Salvaggio J. E. and Lehrer S. B. (1995) Fungal allergens. Clin Microbiol Rev 8 161-79. Horst M., Hejjaoui A., Horst V., Michel F. B. and Bousquet J. (1990) Double-blind, placebo-controlled rush immunotherapy with a standardized Alte rnaria extract. J Allergy Clin Immunol 85 460-72. Huson D. H. (1998) Splits Tree: analyzing and visua lizing evolutionary data. Bioinformatics 14 68-73. Huson D. H. and Bryant D. (2006) Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23 254-67. Ishiguro A., Homma M., Torii S. and Tanaka K. (1992) Identification of Candida albicans antigens reactive with im munoglobulin E antibody of human sera. Infect Immun 60 1550-7. Ito K., Ishiguro A., Kanbe T., Tanaka K. and Torii S. (1995) Characterization of IgEbinding epitopes on Candida albicans enolase. Clin Exp Allergy 25 529-35. Kawakami T. and Galli S. J. (2002) Regula tion of mast-cell and basophil function and survival by IgE. Nat Rev Immunol 2 773-86.

PAGE 99

86 King T. P., Hoffman D., Lowenstein H., Marsh D. G., Platts-Mills T. A. and Thomas W. (1994) Allergen nomenclature. WH O/IUIS Allergen Nomenclature Subcommittee. Int Arch Allergy Immunol 105 224-33. King T. P., Hoffman D., Lowenstein H., Marsh D. G., Platts-Mills T. A. and Thomas W. (1995) Allergen nomenclature. Allergy 50 765-74. Kirkland B. H., Westwood G. S. and Ke yhani N. O. (2004) Pathogenicity of entomopathogenic fungi Beauveria bassi ana and Metarhiziu m anisopliae to Ixodidae tick species Dermacentor variab ilis, Rhipicephalus sanguineus, and Ixodes scapularis. J Med Entomol 41 705-11. Kisla T. A., Cu-Unjieng A., Sigler L. a nd Sugar J. (2000) Medical management of Beauveria bassiana keratitis. Cornea 19 405-6. Kozak P. P., Jr. (1979) Mold control. West J Med 131 315. Kumar A., Reddy L. V., Sochanik A. a nd Kurup V. P. (1993) Isolation and characterization of a recombinant heat shock protein of Aspergillus fumigatus. J Allergy Clin Immunol 91 1024-30. Kurup V. P. and Banerjee B. (2000) Fungal allergens and peptide epitopes. Peptides 21 589-99. Kurup V. P., Banerjee B., Hemmann S., Greenbe rger P. A., Blaser K. and Crameri R. (2000a) Selected recombinant Aspergillus fu migatus allergens bi nd specifically to IgE in ABPA. Clin Exp Allergy 30 988-93. Kurup V. P., Shen H. D. and Banerjee B. (2000b) Respiratory fungal allergy. Microbes Infect 2 1101-10. Kurup V. P., Shen H. D. and Vijay H. (2002) Immunobiology of fungal allergens. Int Arch Allergy Immunol 129 181-8. Kurup V. P., Vijay H. M., Kumar V., Cas tillo L. and Elms N. (2003) IgE binding synthetic peptides of Alt a 1, a major allergen of Alternaria alternata. Peptides 24 179-85. Lacey J. (1981) The aerobiology of conidial fungi (Edited by (ed) G. T. C. a. B. K.), Vol. p. 373-416. Academic Press, Inc, New York. Lazzarini G. M., Rocha L. F. and Luz C. (2006) Impact of moisture on in vitro germination of Metarhizium anisopliae a nd Beauveria bassiana and their activity on Triatoma infestans. Mycol Res 110, 485-92. Lecuona R. E., Edelstein J. D., Berretta M. F., La Rossa F. R. and Arcas J. A. (2001) Evaluation of Beauveria bassiana (hyphomy cetes) strains as potential agents for control of Triatoma infest ans (Hemiptera: Reduviidae). J Med Entomol 38 172-9.

PAGE 100

87 Lehrer S. B., Aukrust L. and Salvaggio J. E. (1983) Respiratory al lergy induced by fungi. Clin Chest Med 4 23-41. Lieutier-Colas F., Purohit A ., Meyer P., Fabries J. F., Kopferschmitt M. C., Dessanges J. F., Pauli G. and de Blay F. (2003) Bronc hial challenge tests in patients with asthma sensitized to cats: the importan ce of large particles in the immediate response. Am J Respir Crit Care Med 167 1077-82. Liu H., Skinner M., Brownbridge M. and Pa rker B. L. (2003) Characterization of Beauveria bassiana and Metarhizium anis opliae isolates for management of tarnished plant bug, Lygus lineo laris (Hemiptera: Miridae). J Invertebr Pathol 82 139-47. Lord J. C., Anderson S. and Stanley D. W. (2002) Eicosanoids mediate Manduca sexta cellular response to the fungal pathogen Beauveri a bassiana: a role for the lipoxygenase pathway. Arch Insect Biochem Physiol 51 46-54. Luz C. and Fargues J. (1998) Factors affecti ng conidial production of Beauveria bassiana from fungus-killed cadaver s of Rhodnius prolixus. J Invertebr Pathol 72 97-103. Luz C., Silva I. G., Cordeiro C. M. a nd Tigano M. S. (1998) Beauveria bassiana (Hyphomycetes) as a possible agent for bi ological control of Chagas disease vectors. J Med Entomol 35 977-9. Marsh D. G., L. Goodfriend, T.P. King, H. Lowenstein, T.A. E. Platts-Mills. (1987) Allergen nomenclature. J. Allergy Clin. Immunol 80 1221-1229. Marti G. A., Scorsetti A. C., Siri A. and Lastra C. C. (2005) Isolation of Beauveria bassiana (Bals.) Vuill. (Deuteromyco tina: Hyphomycetes) from the Chagas disease vector, Triatoma infestans (Hemiptera: Reduviidae) in Argentina. Mycopathologia 159 389-91. Meikle W. G., Cherry A. J., Holst N., Hounna B. and Markham R. H. (2001) The Effects of an entomopathogenic fungus, Beauveria bassiana (balsamo) vuillemin (hyphomycetes), on Prostephanus truncatus (h orn) (Col.: Bostrichidae), Sitophilus zeamais motschulsky (Col.: Curculionidae) and grain losses in stored maize in the Benin Republic. J Invertebr Pathol 77 198-205. Milligen F. v. (2006) Offici al list of allergens, p. http://fm810062.nt.uni2.dk/Allergen.aspx I.U.I.S. Allergen Nomenclature Subcommittee, access date June 2006.

PAGE 101

88 Nierman W. C., Pain A., Anderson M. J., Wort man J. R., Kim H. S., Arroyo J., Berriman M., Abe K., Archer D. B., Bermejo C., Bennett J., Bowyer P., Chen D., Collins M., Coulsen R., Davies R., Dyer P. S ., Farman M., Fedorova N., Fedorova N., Feldblyum T. V., Fischer R., Fosker N., Fr aser A., Garcia J. L., Garcia M. J., Goble A., Goldman G. H., Gomi K., Gr iffith-Jones S., Gwilliam R., Haas B., Haas H., Harris D., Horiuchi H., Huang J., Humphray S., Jimenez J., Keller N., Khouri H., Kitamoto K., Kobayashi T., Konzack S., Kulkarni R., Kumagai T., Lafon A., Latge J. P., Li W., Lord A., Lu C., Majoros W. H., May G. S., Miller B. L., Mohamoud Y., Molina M., Monod M., Mouyna I., Mulligan S., Murphy L., O'Neil S., Paulsen I., Penalva M. A., Pert ea M., Price C., Pritchard B. L., Quail M. A., Rabbinowitsch E., Rawlins N., Ra jandream M. A., Reichard U., Renauld H., Robson G. D., Rodriguez de Cordoba S., Rodriguez-Pena J. M., Ronning C. M., Rutter S., Salzberg S. L., Sanchez M., Sanchez-Ferrero J. C., Saunders D., Seeger K., Squares R., Squares S., Takeuc hi M., Tekaia F., Turner G., Vazquez de Aldana C. R., Weidman J., White O ., Woodward J., Yu J. H., Fraser C., Galagan J. E., Asai K., Machida M., Hall N., Barrell B. and Denning D. W. (2005) Genomic sequence of the pathogeni c and allergenic filamentous fungus Aspergillus fumigatus. Nature 438 1151-6. Nigam S., Ghosh P. C. and Sarma P. U. (2003) A new glycoprotein allergen/antigen with the protease activity from Aspergillus fumigatus. Int Arch Allergy Immunol 132 124-31. Nikoh N. and Fukatsu T. (2000) Interki ngdom host jumping underground: phylogenetic analysis of entomoparasitic fungi of the genus cordyceps. Mol Biol Evol 17 62938. Nygaard U. C., Samuelsen M., Aase A. and L ovik M. (2004) The capacity of particles to increase allergic sensitiza tion is predicted by particle number and surface area, not by particle mass. Toxicol Sci 82 515-24. O'Hollaren M. T. (2006) Allergic Diseases -How Big Is the Problem Part 1 of 3. In Medscape Allergy & Clinical Immunology Medscape. Palmer R. J., Jr. and Friedmann E. I. (1988) Incorporation of inorganic carbon by Antarctic cryptoendolithic fungi. Polarforschung 58 189-91. Pope A. M., R. Patterson, and H. Burge (e d). (1993) Indoor allergens: assessing and controlling adverse health effects. National Academy Press, Washington D.C. 245. Posada F., Vega F. E., Rehner S. A., Blackwe ll M., Weber D., Suh S. O. and Humber R. A. (2004) Syspastospora parasitica, a mycoparasite of the fungus Beauveria bassiana attacking the Colorado potato beetle Leptinotarsa decemlineata: a tritrophic association. J Insect Sci 4 24.

PAGE 102

89 Posch A., Chen Z., Wheeler C., Dunn M. J ., Raulf-Heimsoth M. and Baur X. (1997) Characterization and identification of latex allergens by two-dimensional electrophoresis and protein microsequencing. J Allergy Clin Immunol 99 385-95. Pritchard R. C. and Muir D. B. (1987) Black fungi: a survey of dematiaceous hyphomycetes from clinical specimens iden tified over a five year period in a reference laboratory. Pathology 19 281-4. Reithinger R., Davies C. R., Cadena H. a nd Alexander B. (1997) Evaluation of the fungus Beauveria bassiana as a potentia l biological control agent against phlebotomine sand flies in Colombian coffee plantations. J Invertebr Pathol 70 131-5. Saenz-de-Santamaria M., Postigo I., Gutierr ez-Rodriguez A., Cardona G., Guisantes J. A., Asturias J. and Martinez J. (2006) The major allergen of Alternaria alternata (Alt a 1) is expressed in other me mbers of the Pleosporaceae family. Mycoses 49 91-5. Sagi-Eisenberg R. (2002) The molecula r mechanisms of allergic diseases: immunoglobulin E dependent and independe nt signaling pathways converge in eliciting the release of ar achidonic acid metabolites. Isr Med Assoc J 4 963-6. Salo P. M., Arbes S. J., Jr., Cohn R. D., Burge H. A., London S. J. and Zeldin D. C. (2006) Alternaria alternata antigens in US homes. J Allergy Clin Immunol 117 473; author reply 474. Salo P. M., Yin M., Arbes S. J., Jr., Cohn R. D., Sever M., Muilenberg M., Burge H. A., London S. J. and Zeldin D. C. (2005) Dust borne Alternaria al ternata antigens in US homes: results from the National Surv ey of Lead and Allergens in Housing. J Allergy Clin Immunol 116 623-9. Scholte E. J., Knols B. G., Samson R. A. and Takken W. (2004) Entomopathogenic fungi for mosquito control: a review. J Insect Sci 4 19. Scholte E. J., Ng'habi K., Kihonda J., Takken W., Paaijmans K., Abdulla S., Killeen G. F. and Knols B. G. (2005) An entomopathoge nic fungus for contro l of adult African malaria mosquitoes. Science 308 1641-2. Schwienbacher M., Israel L., Heesemann J. and Ebel F. (2005) Asp f6, an Aspergillus allergen specifically recognized by IgE from patients with allergic bronchopulmonary aspergillosis, is diffe rentially expressed during germination. Allergy 60 1430-5. Shah P. A. and Pell J. K. (2003) Entomopa thogenic fungi as biol ogical control agents. Appl Microbiol Biotechnol 61 413-23. Shen H. D. and Han S. H. (1998) Characte rization of allergens of Penicillium and Aspergillus species. J Microbiol Immunol Infect 31 141-5.

PAGE 103

90 Shen H. D., Lin W. L., Tam M. F., Chou H., Wang C. W., Tsai J. J., Wang S. R. and Han S. H. (2001) Identification of vacuolar se rine proteinase as a major allergen of Aspergillus fumigatus by immunoblotting and N-terminal amino acid sequence analysis. Clin Exp Allergy 31 295-302. Shim J. Y., Kim B. S., Cho S. H., Min K. U. and Hong S. J. (2003) Allergen-specific conventional immunotherapy decreases immunoglobulin E-mediated basophil histamine releasability. Clin Exp Allergy 33 52-7. Simon-Nobbe B., Probst G., Kajava A. V ., Oberkofler H., Susani M., Crameri R., Ferreira F., Ebner C. and Breitenbach M. (2000) IgE-binding ep itopes of enolases, a class of highly conser ved fungal allergens. J Allergy Clin Immunol 106 887-95. Spieksma F. T. (1995) Aerobiology of inhalatory alle rgen carriers. Allergol Immunopathol (Madr) 23 20-3. St-Germain G., and R. Summerbell. (1996) Identifying Filamentous Fungi A Clinical Laboratory Handbook Star Publishing Compa ny, Belmont, California. Steinbach W. J. and Stevens D. A. (2003) Review of newer antifungal and immunomodulatory strategies for invasive aspergillosis. Clin Infect Dis 37 Suppl 3 S157-87. Stewart G. A., Thompson P. J. and McWillia m A. S. (1993) Bioche mical properties of aeroallergens: contribu tory factors in allergic sensitization? Pediatr Allergy Immunol 4 163-72. Stricker R. B., Lautin A. and Burrascano J. J. (2006) Lyme disease: the quest for magic bullets. Chemotherapy 52 53-9. Sutton D. A., A. W. Fothergill, and M. G. Rinaldi (ed.). (1998) Guide to Clinically Significant Fungi Williams & Wilkins, Baltimore. Thompson J. D., Higgins D. G. and Gibs on T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 4673-80. Tucker D. L., Beresford C. H., Sigler L. and Rogers K. (2004) Disseminated Beauveria bassiana infection in a patient w ith acute lymphoblastic leukemia. J Clin Microbiol 42 5412-4. Vartivarian S. E., Anaissie E. J. and Bode y G. P. (1993) Emergi ng fungal pathogens in immunocompromised patients: classi fication, diagnosis, and management. Clin Infect Dis 17 Suppl 2 S487-91. Vieths S., Scheurer S. and Ballmer-Weber B. (2002) Current understanding of crossreactivity of food allergens and pollen. Ann N Y Acad Sci 964 47-68.

PAGE 104

91 Vijay H. M. and Kurup V. P. (2004) Fungal allergens. Clin Allergy Immunol 18 223-49. von Bubnoff D., Novak N., Kraft S. and Bieber T. (2003) The central role of FcepsilonRI in allergy. Clin Exp Dermatol 28 184-7. Wagner R. (1968) Clemens Von Pirquet: His Life and Work The Johns Hopkins Press, Baltimore. Wagner S., Breiteneder H., Simon-Nobbe B ., Susani M., Krebitz M., Niggemann B., Brehler R., Scheiner O. and Hoffma nn-Sommergruber K. (2000) Hev b 9, an enolase and a new cross-reactive alle rgen from hevea latex and molds. Purification, characteriza tion, cloning and expression. Eur J Biochem 267 700614. Waner T H. S., Jongejan F, Bark H, Keysar y A. (2001) Cornelissen A: Significance of serological testing for ehrlichial diseas es in dogs with special emphasis on the diagnosis of canine monocytic ehrlic hiosis caused by Ehrlichia canis. Vet Parasitology 95 1-15. Weichel M., Schmid-Grendelmeier P., Flucki ger S., Breitenbach M., Blaser K. and Crameri R. (2003) Nuclear transport fact or 2 represents a novel cross-reactive fungal allergen. Allergy 58 198-206. Wekesa V. W., Maniania N. K., Knapp M. and Boga H. I. (2005) Pathogenicity of Beauveria bassiana and Metarhizium anisopliae to the tobacco spider mite Tetranychus evansi. Exp Appl Acarol 36 41-50. Westwood G. S., Huang S. W. and Keyha ni N. O. (2005) Allergens of the entomopathogenic fungus Beauveria bassiana. Clin Mol Allergy 3 1. Wuthrich B. (1989) Epidemiology of the al lergic diseases: are they really on the increase? Int Arch Allergy Appl Immunol 90 Suppl 1 3-10.

PAGE 105

92 BIOGRAPHICAL SKETCH Greg Westwood was born in Texas in 1975, to John and Nate Westwood. As is common for individuals raised in a milita ry home, Greg attended grade schools in Germany, Virginia, and Kansas, before m oving to Puyallup, Washington, where he attended Furrucci Junior High School for grades 7. High school began at West Springfield High, in Springfield Virginia, wh ere Greg spent all of his tenth-grade year and half of his eleventh before moving to El Paso Texas to finish off his degree. Greg received his diploma from Austin High School in 1994, due in large part to the kindness and understanding of Principle Yturralde. Greg immediately moved to St. George Ut ah, where he attending Dixie community college. After a couple of years of hard work and encouragement from his wife, Greg transferred to Southern Utah University in Ce dar City. It was at SUU that Greg found his passion for microbiology and began research under the direction of Microbiology professor Dr. Ronald Martin. Greg Westw ood received his Bachelor of Science degree from the Southern Utah University in May 2000 and began his graduate education at the University of Florida In August of that same year. Greg received his Ph.D. in August 2006.


Permanent Link: http://ufdc.ufl.edu/UFE0015542/00001

Material Information

Title: Studies on the Entomopathogenic Fungus Beauveria bassiana: Molecular and Immunological Characterization of Allergens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015542:00001

Permanent Link: http://ufdc.ufl.edu/UFE0015542/00001

Material Information

Title: Studies on the Entomopathogenic Fungus Beauveria bassiana: Molecular and Immunological Characterization of Allergens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015542:00001


This item has the following downloads:


Full Text












STUDIES ON THE ENTOMOPATHOGENIC FUNGUS Beauveria bassiana:
MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF ALLERGENS















By

GREG S. WESTWOOD


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Greg S. Westwood

































To my wife and children; they are all that truly matter.















ACKNOWLEDGMENTS

I would like to extend my deepest appreciation to my mentor, Dr. Nemat O.

Keyhani, whose guidance and direction is reflected in every passage of this work. It was

under his tutelage that I was able to see my true potential, and understanding of the role

research will always play in my life. I would also like to thank the other members of my

committee, Dr. Samuel Farrah, Dr. Peter Kima, Dr. Howard Johnson, and Dr. Jeffrey

Rollins, for all of the advice and encouragement they extended in this challenging stage

of my education.

I owe a debt of gratitude to Dr. Shih-Wen Huang, who provided the patient sera

that played a pinnacle role in our study of allergenicity; without his help, this research

would not have been possible. In addition, special thanks go out to all individuals, who

devoted their time to assistant to this research; especially in reference to the injection of

foreign extracts into, and/or the donation of, bodily fluids.

Finally, I would sincerely like to thank fellow graduate students Lawrence Flowers

and Nicole Leal whose friendship and scientific insight had a dramatic affect on my

personal and educational development.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .............. .................. ............ .......... ................. vii

LIST OF FIGURES .............. ................. ............ .............. ........... viii

L IST O F A B B R E V IA TIO N S ................................................................... .....................x

ABSTRACT .............. ..................... .......... .............. xii

CHAPTER

1 IN TR OD U CTION ............................................... .. ......................... ..

H history of A allergy ............................................................................................. ...... 1
Hypersensitivity .................. .............. .................................. .2
Im m ediate H ypersensitivity.............................. ........................... ........ 3
A llergic D isease.................................................. 4
Fungi ............................................................................... 6
Spores and C onidia................................................ 6
H health ......................................................................... . 8
N om en clatu re ....................................................... 9
M ajor Allergenic Fungi ................................. .......................... ........ 10
A lternaria alternate ......................................................................................10
Cladosporium herbarum ....... ........... ................... ...... 11
A sp erg illu s ....................................................................................... 1
C ro ss-R eactiv ity .............................................................13
Beauveria bassiana............................................................15
H history ...............................................15............................
Physiology/Life Cycle .......................................... ................. .... ....... 16
Agricultural/Economic Importance ..........................................17
D ise a se C o n tro l ............................................................................................. 19
R research O verview ...............................................20

2 ALLERGENICITY ............................................................................. 28

Introduction ........................................................................................................ 28
M material and M methods ................................................................. ............. .. 29


v









Strains and Cultures............... ...... .................. .......... 29
Extract Preparation ..................... .. ........................ .. ....... .......... ...... 30
P re c ip itatio n s ................................................................................................. 3 0
Western Blotting .............. ...... .......... ............ ...............31
Enzym e Treatm ents ......... ................ .... .................. .. ....... 32
Immunoblot Inhibition.................................................. 32
Skin Sensitivity Profiles to Fungal Extracts ......... ...................................... 33
Intraderm al Skin Testing ................................ ......................... .......... ..... 33
R e su lts ............................... ... ..... ............................................................. ...............3 3
Identification of IgE Reactive Bands ................................................. ...............33
Immunoprint Analysis of B. bassiana: Reactivity with Individual Sera.............34
Intradermal Skin Testing ......................... ............... ............... 36
Cross-Reactivity among Different Fungi ......................................................36
D iscu ssio n ...................................... ................................................. 3 7
C conclusion ............................................................... ..... ..... ........ 40

3 MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF
PUTATIVE b. BASSIANA ALLERGENS ............. .......... .......................43

Introduction ............. ..... ............. .... ................................... 43
M materials and M methods ....................................................................... ..................4 5
Strains and M edia ......................... ... .... ...... .. ...... ............. 45
RACE PCR ................ ....................... 45
C lo n in g ................................................................4 6
Expression ...................... .......................... 46
W western Blot and Im m unodetection ............................................................... 47
A analysis Program s .............................................. ........ ... ............ 48
R e su lts ...........................................................................................4 8
C loning and Sequencing ........................................................... ............... 48
Protein Expression................ ................................... ....... 50
Effect of Denaturing Conditions on Expressed Proteins.................................51
IgE R activity ................................................................. ........... .. 5 1
Phylogenetic C om parison......................................................... ............... 54
D isc u ssio n ............................................................................................................. 5 5

4 CON CLU SION S .................................. .. .......... .. .............71

Allergenicity of Beauveria bassiana .............................. .................... 72
Characterization of Allergens .............. .......................... ..... ............... 73
F uture E xperim ents.......... ..... .......................................................... ........... ...... 74

APPENDIX ADDITIONAL FIGURES AND TABLES ............................................76

L IST O F R E F E R E N C E S ......... ................... ................ ................................................8 1

B IO G R A PH IC A L SK E TCH ..................................................................... ..................92
















LIST OF TABLES

Table p

1- 1 C om m on allergen s.......... ................................................................. ........ .. ....... .. 23

1-2 Major chemical mediators of activated mast cells. ...................... ...............25

1-3 Fungal allergens ................... .... ............................ .. ...... .. ............. 26

2-1 Allergic profile of patients A-G, obtained by skin testing .................................41

2-2 Intraderm al skin test ............................................... .. .... ................. 42

3-1 PCR Prim ers .................. .................. .................. .......... .. ............. 57

3-2 Cloning vectors ............................................ ............. .... ....... 57

3-3 Allergens with sequence similarities to B. bassiana............................. .............58

3-4 R result of R A C E P C R .............................................................................. ........ 59

3-5 Enolase accession num bers ............................................. ............................. 70

A-1 Taxonomy of Beauveria bassiana.............................................................. 76

A-2 Molecular properties of B. bassiana genes. .................................. .................76

A 3 A ccession num b ers.......................................................................... ................... 80
















LIST OF FIGURES


Figure page

1-1 Illustrating the central role of IgE activated mast cells................. ................24

1-2 Life cycle of Beauveria bassiana.................................... .......................... ......... 24

2-1 SDS-PAGE and Immunoblot analysis of B. bassiana ..........................................40

2-2 Immunoblot analysis of B. bassiana extracts.......................................................41

2-3 IgE immunoblot inhibition with fungal extracts ............................................... 42

3- 1 cD N A vs genom ic .............................. .................... .. .. ......... .... ...... ...... 60

3-2 Illustration depicting genomic gene sequences....................................................60

3-3 Genomic nucleotide sequence and amino acid translation of bbenol. ..................61

3-4 Genomic nucleotide sequence and amino acid translation of bbf2 ........................62

3-5 Genomic nucleotide sequence and amino acid translation of bbald .....................63

3-6 Genomic nucleotide and amino acid sequence of bbhex............... ...................64

3-7 SDS-PAGE gel of uninduced and induced expression cultures,...........................65

3-8 Coomasie Blue stained 12% SDS-PAGE gel................................... ... ..................65

3-9 Immunoblot probed with. 10 sera per pool ................................... .................66

3-10 Immunoblot probed with. 2 sera per pool ..................................... .................66

3-11 10% SDS-PAGE gel stained with Coomasie.................................... .................67

3-12 Immunoblots probed with pooled sera ........................................ ...............67

3-13 Immunoblots of BbAld protein strips probed with 1 sera pools ...........................68

3-14 Immunoblots of B. bassiana proteins........................ ...................68

3- 15 E nolase phylogram ................. .............................................. .. ........ .. .... ........ 69









A-1 Clastalw alignment of BbEnol ........................................ .......................... 77

A -2 Clastalw alignm ent of B bA ld................................................................................78

A-3 Aldehyde dehydrogenase phylogram ............................. ....................................79















LIST OF ABBREVIATIONS

Amp ampicillin

oC degrees centigrade

Cam chloramphenicol

cDNA complementary deoxyribonucleic acid

ddH20 distilled deionized water

DDT dichloro diphenyl trichloroethane

DNA deoxyribonucleic acid

E. coli Escherichia coli

ECF-A eosinophil chemotactic factor A

EDTA ethylenediaminetetra-acetic acid

EST expressed sequence tag

HC1 hydrochloric acid

Hr hour

HRP horseradish peroxidase

IgE immunoglobulin epsilon

IgG immunoglobulin gamma

IPTG Isopropyl-B-D-thiogalactopyranoside

kDa kiloDaltons

LB Luria Bertani media

LDS lithium dodecyl sulfate









Itg microgram

tL microliter

mg milligrams

min minutes

mL milliliters

mM millimolar

MOPS 3-(N-Morpholino)-propanesulfonic acid

NCF-A neutrophil chemotactic factor A

OD optical density

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PD potato dextrose

PMSF Phenylmethylsulfonyl fluoride

PVDF polyvinylidene-fluoride

SDS sodium dodecyl sulfate

SSH suppressive subtractive hybridization

TBS tris-buffered saline

Tris tris hydrozymethyl aminomethane

tRNA transfer ribonucleic acid

x G gravity















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

STUDIES ON THE ENTOMOPATHOGENIC FUNGUS Beauveria bassiana:
MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF ALLERGENS

By

Greg S. Westwood

August 2006

Chair: Nemat O. Keyhani
Major Department: Microbiology and Cell Science

Beauveria bassiana is an entomopathogenic fungus currently under development as

a biological control agent against a wide rang of arthropod pests. Although B. bassiana

has been reported to be non-toxic to vertebrates, its potential allergenicity has not been

studied. Fungal allergens constitute a significant proportion of the airborne allergens that

affect up to 25% of the population of the industrialized world. This dissertation examines

the ability of B. bassiana to elicit allergic reactions, and describes the immunological and

molecular characterization of IgE binding proteins present in this fungus.

Immunoblot analyses of B. bassiana proteins probed with pooled and individual

human sera revealed IgE reactive antigens, ranging from 12 to >95 kDa. Variation was

noted when blots were probed using individual sera, however a 35 kDa protein was the

most frequently reactive B. bassiana antigen. Immunoblot inhibitions experiments

identified the presence of shared epitopes between B. bassiana and the extracts of several

common allergenic fungi (cross-reactivity). IgE binding of the 35 kDa protein was not









inhibited by any of the fungal extract tested, indicating the possible presence of a B.

bassiana specific antigen. Intradermal skin testing confirmed the in vitro results,

demonstrating allergenic reactions in a number of individuals, including those who have

had occupational exposure to B. bassiana.

Screening of a B. bassiana cDNA library revealed a number of proteins with

sequence similarity to major fungal allergens. Full length clones of the B. bassiana genes

were obtained by 3' and 5' RACE PCR, and designated as; bbenol, bbf2, bbald, and

bbhex. All four proteins were expressed in E. coli. BbEnol, designated an enolase by

sequence similarity, was compared to 20 other fungal enolases including five known to

be allergenic and cross-reactive. Phylogenic comparison showed allergenic (and cross-

reactive) enolases are not limited to closely related taxa, but are equally distributed

throughout the phylogram. Immunoblot analysis of the four B. bassiana proteins

revealed BbEnol and BbAld to be reactive to sera IgEs, and therefore represent the first

allergens to be identified from the entomopathogenic fungus Beauveria bassiana.














CHAPTER 1
INTRODUCTION

History of Allergy

The term allergy was coined in 1906 by a Viennese pediatrician named Clemens

von Pirquet to describe a hypersensitive immune reaction in response to a substance other

than a typical disease causing agent (Wagner, 1968). The word "allergy," was derived

from the Greek words allos meaning "other" and ergon meaning "reaction" or

"reactivity."

The word allergy is most commonly used in reference to type I, or immediate

onset, hypersensitivity which is characterized as an inflammatory reaction caused by

excessive activation of IgE bound mast cells in response to a specific but typically benign

antigen. The most common clinical allergy symptoms, hay fever, include runny nose,

itchy eyes, and sneezing; however severe allergic reactions can lead to anaphylactic

shock and even death (Gould et al., 2003; Kurup and Banerjee, 2000).

Allergens known to affect large groups of people are designated as major allergens

and are typically common place in the air we breathe (Table 1-1); a recent survey found

that over 54% of US citizens tested positive for sensitivity to at least one allergen

(AAAAI, 1996-2001; Arbes et al., 2005). Outdoor allergens include industrial pollutants,

pollens, and other plant materials; common indoor allergens include pet dander, dust

mites, and cockroach feces. Fungal spores constitute a significant portion of both indoor

and outdoor major allergens.









Type I hypersensitivity is a growing problem; allergic disease is projected to effect

20-25% of the population of the world's industrialized nations and of those, 10% develop

severe allergic disease (Horner et al., 1995; Kurup et al., 2002). The National Institute of

Allergy and Infectious Diseases estimate that about 50 million Americans are affected by

allergic diseases in the United States alone, with allergies constituting the sixth leading

cause of chronic disease. The cost associated with allergic disease is estimated to exceed

18 billion dollars annually (AAAAI, 1996-2001; Sagi-Eisenberg, 2002).

Hypersensitivity

Hypersensitivity results from over stimulation of the immune system to an antigen,

considered benign typically. Hypersensitivity has been characterized immunologically

into four types based on their clinical symptoms and underlining mechanism (Horner et

al., 1995).

Type I, or immediate, hypersensitivity is an activation of mast cells and basophiles

by antigen specific membrane bound IgEs. Type II is mediated by the binding of IgE or

IgM to a specific antigen on the surface of a cell leading to the destruction of the cell.

This process often involves the classic complement pathway and is usually associated

with hemolytic disease. Blood group incompatibility is an example of type II

hypersensitivity. Type III is caused by the formation of antigen antibody (ag-ab)

complexes of circulating IgGs, which bind to and activate mast cell via FcyRIII low

affinity receptors. Ag-Ab complexes also interact with blood vessel walls which are

damaged by a massive infiltration and degranulation of neutrophils activated by the mast

cell cytokines. Type IV or delayed hypersensitivity is mediated by antigen specific Thl

cells, which lead to the release of cytokines responsible for the recruitment and activation

of T-cells and macrophages.









Traditionally the term "allergy" is used to refer to conditions caused by type I

(immediate) hypersensitivity; however, many allergic or hypersensitive disease are not

cause by a single type, but result from the combined effects of two or more types. This

has led to a broader definition of the term allergy. The Institute of Medicine defines

allergy as "The state of immune hypersensitivity that results from exposure to an allergen

and is distinguished by overproduction of immune system components" (Pope, 1993). In

this dissertation the term allergy is used to describe diseases or conditions that are caused

by type I directly, or in which type I plays an essential role.

Immediate Hypersensitivity

A type I hypersensitive or allergic reaction is mediated by antigen specific IgEs

bound to mast cell and basophiles by a high affinity surface receptor, FceRIb (von

Bubnoff et al., 2003). The reaction is initiated when the binding of an allergen leads to

the cross linking of two receptor bound IgEs (Figure 1-1). The cross linking of IgEs

triggers a host of cellular responses resulting in the release of several chemical mediators

(Table 1-2). The first and most dramatic of these is the immediate degranulation of

storage vacuoles containing the primary vasoactive amine mediators as well as molecules

including proteases, hydrolases, and chemotactic factors (Kawakami and Galli, 2002).

These mediators and associated factors are responsible for the clinical symptoms

associated with an immediate inflammatory response. The cross linking of FcFRI

receptors also initiates the de novo synthesis of secondary mediators including

leukotrienes and cytokines which are responsible for the onset of the late-phase

inflammatory response (Sagi-Eisenberg, 2002).

The vasoactive amine, histamine, is the dominant molecule released by the initial

degranulation of an allergen-activated mast cell (Shim et al., 2003). It is responsible for









triggering numerous cellular responses depending upon the nature of the surrounding

tissue. Its primary function, however, is as a vasodilator leading to vessel leakage and

swelling, or inflammation of the surrounding tissue. Proteases including, chimase and

tryptase exacerbate this process by degradation of blood vessels and basement membrane.

Chemotactic factors including ECF-A eosinophill chemotactic factor A) and NCF-A

(neutrophil chemotactic factor A) lead to an influx of secondary leukocyte. Activated by

the mast cell mediators these secondary leukocytes secrete their own mediator molecules

causing additional tissue damage as well as the recruitment of even more leukocytes.

Leukotrienes and prostaglandins are arachidonic acid metabolites that act as

secondary mediators. They increase vessel permeability and cause contraction of

pulmonary smooth muscles. Other cytokines produced by mast cells act in the

recruitment and activation of platelets and leukocytes, drawn into the area by the

chemotactic factors. The actions of leukocytes, such as eosinophils and neutrophils,

result in the clinical symptoms of the late phase reaction (Goldsby, 2000).

Allergic Disease

Atopic allergic disease refers to the immediate hypersensitive response mediated by

IgE. Allergic response occurs at the location of antigen contact, and the most common

tissues affected are those of the respiratory and digestive tracks, although the eyes and

skin are also susceptible to contact with allergens.

Allergy to aeroallergens or hay fever is one of the most common allergic diseases

and is characterized by symptoms including rhinitis, coughing, sneezing, nasal discharge,

and conjunctivitis (itchy or watery eyes). More severe cases can lead to constriction of

bronchia (asthma) manifested as a shortness of breath (Shim et al., 2003). Skin reactions









to dermal contact with an allergen include urticaria and eczema whose symptoms include

swelling and itching.

Potentially deadly reactions to allergens are usually associated with food allergies

and insect venom. The response to an ingested allergen can manifested as abdominal

pain, vomiting, diarrhea, and/or swelling of the tongue and lining of the throat. In severe

cases, the swelling can lead to a complete closing of the airway. Anaphylaxis is an acute

systemic response to an allergen in the blood stream. The release of histamine by blood

basophils and mast cells into the circulatory system leads to vessel leakages causing

swelling, itching, and hives. Constriction of pulmonary smooth muscles leads to

difficulty breathing. Anaphylactic shock is a potentially life threatening form of

anaphylaxis in which systemic degranulation of mast cells and blood basophils, leading

to constriction of airways, a rapid loss of blood pressure, and shock. This is most often

associated with an allergen entering the blood stream by ingestion or injection (insect

venom and pharmaceuticals).

Type I hypersensitivity also plays a fundamental role in chronic allergic disease.

Chronic allergic disease is usually caused by a combination of hypersensitive types

including type I. The most common is allergic asthma, which is a form of localized

anaphylaxis. Degranulation of mast cells in the lungs causes excess mucus secretion,

airway edema, and constriction of pulmonary smooth muscle resulting in airway

obstruction (Goldsby, 2000). Seventeen million Americans are afflicted with asthma,

which is responsible for more than 5,000 deaths annually (CDC, 2002; O'Hollaren,

2006).









Allergic bronchopulmonary aspergillosis (ABPA) is an inflammatory disease

caused by fungal growth in the mucous of the lungs, typically due to infections by

Aspergillusfumigatus (but can be caused by fungi of other genera) (de Almeida et al.,

2006; Denning et al., 2006). Extrinsic allergic alveolitis is a lung disorder resulting from

hypersensitivity to inhaled allergens such as fungi and organic dust; this disorder also

involves components of the type III and type IV hypersensitivity responses (Bush et al.,

2006; Homer et al., 1995).

Fungi

The "Fungi" represent a taxonomic kingdom comprised of both multicellular and

single cellular eukaryotic organisms. Fungi display a wide morphological diversity,

ranging from large mushrooms to microscopic yeasts. Many fungal species are

dimorphic and can persist and grow in either a single or multicellular state depending

upon environmental conditions. There are currently over 100,000 recognized species of

fungi, distributed throughout almost every ecosystem including Antarctica (Palmer and

Friedmann, 1988). The largest and most common group of fungi is the Ascomycetes,

which are primarily the filamentous mold fungi, but also include some single celled

species.

Spores and Conidia

The fungal life cycle is divided into two stages: sexual and asexual. Many fungi

are able to reproduce both sexually and asexually. Fungi capable of reproducing sexually

are termed "perfect" and are considered to be in a telemorphic or sexual state. Sexual

reproduction results in the creation of sexual spores. When a fungus is reproducing

asexually it is considered to be an anamorph and the end result is the production of

conidia. Fungi that reproduce exclusively in an asexual state or for which no sexual stage









has yet been identified are classified as "imperfect" or anamorphic fungi. The

Deuteromycetes represent a sub-grouping of filamentous fungi within the Ascomycetes

that are considered to be strictly anamorphic. Both sexual spores and conidia are

propagules released by the parent organism; the term spore is used in this paper to

describe both sexual spores and asexual conidia. Spores and conidia are considered

relatively more resistant to unfavorable environmental conditions than other cells, and are

designed to stay metabolically inactive until environmental conditions are favorable for

supporting growth. The availability of water (high humidity) is usually a major factor in

the germination of spores and conidia (Cole and Kendrick, 1981; Lacey, 1981).

Because of their size, spores are easily dispersed in the air and are found

aerosolized in the atmosphere throughout the world. Aerobiological assessments of

indoor and outdoor fungal spores have often been used to determine the identity and

concentration of aerospores (Al-Suwaine et al., 1999; Beaumont et al., 1985b; Kurup et

al., 2000a). Outdoor concentrations of fungal aerospores often outnumber pollen counts

one hundred to one thousand fold (Horner et al., 1995; Lehrer et al., 1983) and are

directly affected by climatic events such as, precipitation and wind. Although seasonal

variations in fungal aerobiological numbers have been noted, this variation is much less

than that observed for pollens. Alternaria, Cladosporium, Epicoccum, and Fusarium are

examples of outdoor fungi typically associated with human allergy. The fungi that

dominate indoor air are those that commonly grow indoors, and include species of

Aspergillus and Penicillium. The indoor concentration and type of fungal aerospores is

more dependent upon carpet, houseplant, and humidity conditions than outdoor seasonal

or climate changes (Kozak, 1979; Salo et al., 2005). Outdoor fungi can also be found









indoors and their concentrations are affected by factors that facilitate entry such as traffic,

pets, and ventilation.

Health

As with all fungi, filamentous fungi acquire nutrients by absorption and are

generally saprophytic or symbiotic; although there are some fungal species that are

parasitic and/or opportunistic pathogens. In recent years, fungi have become an ever-

increasing health concern. Immunocompromised patients, particularly those with AIDS,

are highly susceptible to sometimes fatal infections by opportunistic fungi. This is also

true for transplant patients in which the immune system is suppressed to avoid organ

rejection. Chemo- and radio-therapies for cancer treatment also weaken the immune

system, increasing the risk of cancer patients to infection by opportunistic fungi. With

the increasing population of individuals with compromised immune systems, there is also

an increase in infection by opportunistic fungi such as Aspergillusfumigatus and

Histoplasma capsulatum.

In otherwise immune competent individuals, fungal allergies are another serious

health concern. Atopic allergy affects up to 25% of the population of industrialized

nation with clinical symptoms ranging from sneezing and coughing to chronic sinusitis

and asthma. Allergens affect the area that they come in contact with which includes the

skin and mucosal layers of the nasal and respiratory tract. For inhaled particles the size

of an aeroallergen will determine the location in the respiratory track that the allergen

will interact with host tissues initiating a response. Large particles (>10 tm) such as

dust, large spores, and pollen cause upper respiratory problems primarily in the sinuses

and nasopharynx (Lieutier-Colas et al., 2003). Smaller particles (<5 tm) including many

fungal spores penetrate deeper in the respiratory track often affecting the bronchia and









lungs resulting in asthma (Nygaard et al., 2004; Spieksma, 1995). Fungi are responsible

for both upper and lower allergy symptoms. Over 80 genera of fungi have been

associated with respiratory track allergy symptoms (Edmondson et al., 2005; Nierman et

al., 2005; Schwienbacher et al., 2005) and 25-30% of all allergic asthmas cases have

been linked to mold allergies(Kurup et al., 2002; Vijay and Kurup, 2004). The viability

of a fungal spore is not required for eliciting allergenic reactions; nonviable spores and

hyphal particles are still able to cause allergic reactions.

Nomenclature

As allergy research identifies an ever-increasing number of allergens, a new

method for naming allergens was set forth by the International Union of Immunologic

Societies Subcommittee for Allergen Nomenclature (Marsh, 1987). Before definitive

naming of an allergen, several criteria have to be met; (1) the allergen must be identified

by multiple immunochemical or physiochemical techniques, and (2) the source of the

molecule must be clearly defined including species and strain in the case of fungi. An

allergen is labeled by the first three letters of the genus followed by a space and the first

letter of the species and then a space followed by a number assigned based upon the

chronologic order in which the allergen was identified. The strain number is the final

addition to the new name. In reference to the gene producing the allergen the Arabic

numerals are substituted by Roman numerals (King et al., 1994; King et al., 1995).

Inconsistency in the assigned number of an identified allergen can be observed between

the publications of different research group. In this dissertation, the allergens are

designated by the name used by the International Union of Immunological Societies

Allergen Nomenclature Sub-committee List of Allergens (Milligen, 2006).









Major Allergenic Fungi

Skin test and aerial surveys have identified the most significant fungi associated

with human allergy. Some of the most common genera are: Alternaria, Cladosporium,

Epicoccum, Aspergillus and Penicillium (Cruz et al., 1997; Kurup and Banerjee, 2000;

Shen and Han, 1998); all of which belong to the group Ascomycota.

Alternaria alternate

Alternaria alternate is one of the most important allergenic fungi (Herrera-Mozo et

al., 2006; Kurup et al., 2003; Salo et al., 2006). A. alternate is a dematiaceous mold

found in the soil, on plants, and in the air throughout the world preferring climates that

are warm and moist (Achatz et al., 1995; Pritchard and Muir, 1987). A member of the

Deuteromycetes, A. alternate is a health concern as both an opportunistic pathogen and a

major allergen (Vartivarian et al., 1993). Although not pathogenic in immune component

individuals, Alternaria is of concern, because it can cause both atopic and asthmatic

reactions. Indeed, allergy to Alternaria is considered to be a mortal risk factor in asthma

patients (Chiu and Fink, 2002). Alternaria allergenicity has been closely examined and a

number of allergens have been isolated and characterized from this organism (Table 1-2)

(Achatz et al., 1995; Kurup et al., 2002).

Alt a 1 is the most common allergen of Alternaria alternate. Although its

biological function is not known (Saenz-de-Santamaria et al., 2006), it is a secreted

homodimer roughly 60 kDa (monomer mw roughly is 30 kDa). Of patients displaying

allergic reactions to Alternaria alternate, 80% are positive for IgE reactivity to Alt a 1.

One factor that contributes to the extreme allergenicity of Alt a 1 is that it contains four

IgE binding region (Kurup et al., 2003). Other allergens identified in this fungus include

Alt a 6, an enolase, and Alt a 10, a protein with aldehyde dehydrogenase activity, both of









which are considered common "house-keeping" enzymes. The enolase has been of

particular interest in resent years due to its homology to allergenic enolases found in

other fungi; Alt a 10 is also shares sequence similarities with a known allergen of

Cladosporium herbarum (Cla h 3).

Cladosporium herbarum

Cladosporium herbarum is a highly allergenic fungus not only because of the large

number of allergens it produces, but also because of its relatively high abundance in the

environment. C. herbarum is found throughout the world and is often the dominant

outdoor airborne fungal spore especially in temperate regions (Achatz et al., 1995; Lacey,

1981). Cladosporium herbarum is a dematiaceous filamentous mold which grows

primarily on rotting organic material; although one of the most allergenic fungi, it is not

considered pathogenic (Sutton, 1998). There are at least 36 identified allergens produced

by C. herbarum (Aukrust, 1992). Cla h 1 may be considered the most important

Cladosporium allergen due to its reactive frequency; 61% of C. herbarum sensitive

patients possess IgEs that react positively to Cla h 1 (Achatz et al., 1995). Many C.

herbarum allergens display sequence similarity to allergens produced by other fungi,

especially those found in Alternaria. Cla h 3 is an aldehyde dehydrogenase that is similar

to an enzyme allergen found in A. alternate (Alt a 10), and Clah h 6 displays similarity to

enolases found in several other fungi including A. alternate.

Aspergillus

The genus Aspergillus contains several important species known to cause health

problems in humans (Garrett et al., 1999; Steinbach and Stevens, 2003). Aspergillus

species are filamentous fungi found ubiquitously throughout the world and are commonly

found in the soil and the air both indoors and out. Although teleomorphic states have









been described for some species, many Aspergillus species are Deuteromycetes. The

incidence of mediated Aspergillus infections, that can sometimes be fatal, has

dramatically increased with the increase in patients with compromised immune systems.

In addition, this mold is the leading cause of ABPA (allergic bronchopulmonary

aspergillosis) and is one of the major risk factors leading to allergic asthma (Crameri et

al., 1998a; Crameri et al., 1998b).

Numerous Aspergillus allergens have been isolated and characterized, many of

which show strong similarity to allergenic proteins or enzymes of other fungi. However,

a number of allergens appear to be unique to Aspergillus with no known biological

functions or activities. Asp f 5 is an Aspergillus allergen to which many patients are

reactive, its function is unknown and there are no know homologs of this protein. Asp f 5

however, is strongly reactive to sera IgEs of ABPA patients as well as asthmatics

(Banerjee and Kurup, 2003; Crameri et al., 1998a; de Almeida et al., 2006). Asp f 1 is a

ribonuclease, a ribotoxic virulence factor secreted by the opportunistic fungi that reacts

positively with 68-83% of patients who have tested positively for Aspergillus allergy.

Asp f 8 is a P2 ribosomal protein (60s portion of the large ribosomal subunit) that is

similar to allergens found in Cladosporium herbarum and Alternaria alternate. It is

unclear how a ribosomal protein elicits such a strong IgE reaction, however many

patients display IgEs that are reactive to all three proteins. The same is true for the

Aspergillus enolase (Asp f 22), in which an IgE sensitized to one protein is reactive to

proteins from different fungi (Hemmann et al., 1997). These data imply conserved

allergenic "hotspots" in terms of protein structure and recognition of specific epitopes.









Cross-Reactivity

An interesting fact about fungal allergy is that few patients are allergic to a single

fungus. One study testing 6,000 allergy patients showed that more than 99% of the

patients allergic to A. alternate also displayed allergic reactions to other fungi (Horst et

al., 1990). Possible factors that may account for this observation include constant

exposure to different fungal spores due to seasonal and localized abundance of fungal

spores and the aerosolized mechanism of exposure. These factors make it possible for

the immune system to come in contact with numerous species of fungi and fungal

antigens that favor an IgE response. Another reason for allergic reactions to multiple

fungi is due to IgE recognition of fungal antigen epitopes independent of previous

exposure.

Cross-reactivity is a common phenomenon among IgEs produced in response to

fungal epitopes that result in the induction of an allergic reaction (Aukrust and Borch,

1985). Cross-reactivity is different than parallel allergy, which is the development of

multiple IgE responses to multiple, but similar, antigen. Development of allergies to

parallel antigens, such as the same enzyme from two different organisms, is caused by the

actions or behaviors of the antigens and result in allergic reactions mediated by different

IgEs. Cross-reactivity is a single allergic reaction to multiple antigens; this is the result

of structural resemblance and recognition by the same specific IgEs to a single epitope

found on all of the antigens (Herrera-Mozo et al., 2006). A large contributor to this

phenomenon is that many fungal epitopes are highly conservered especially between

phylogenetically related species (Horner et al., 1995).

Enolase, an enzyme responsible for the glycolytic conversion of 2-phospho-D-

glycerate to phosphoenolpyruvate is an example of a fungal allergen that elicits an IgE-









mediated response known to be cross-reactive with other fungal enolases. Extensive

studies of this allergen by Breitenbach and Simmon-Nobbe have shown that specific

epitopes are shared by enolases produced by at least five common fungi; this has led it to

being referred to as a pan-allergen (Breitenbach et al., 2002; Breitenbach and Simon-

Nobbe, 2002). Enolase was first identified as an allergen in Saccharomyces cerevisiae

and Candida albicans (Baldo and Baker, 1988; Ishiguro et al., 1992; Ito et al., 1995).

Later studies concentrated on the enolase allergen Cla h 6 and Alt a 5 that are 90%

identical, and were highly IgE immunogenic. Twenty-two percent of patients allergic to

either A. alternate or C. herbarum produced IgEs that reacted with the enolase protein.

Competitive inhibition experiments have been performed to analyze cross-reactivity of

enolases produced by A. alternate, A. fumigatus, C. herbarum, S. cerevisiae, and C.

albicans. The results of these experiments showed that the examined enolases possessed

a shared epitope. Although, the enolase produced by C. albicans also displayed a second

IgE binding epitope (Simon-Nobbe et al., 2000). An enolase produced by Hevea

brasiliensis (rubber tree) that was than 63% similar to the enolases Alt a 6, and Cla h 6,

was also shown to display allergenic cross-reactivity (Breitenbach and Simon-Nobbe,

2002; Posch et al., 1997; Wagner et al., 2000).

The clinical implication of cross-reactivity is that a patient who develops an allergy

towards one species of fungus can have that allergy activated by contact with other fungal

species, even those to which there had been no previous exposure. Examples of cross-

reactive allergens are listed on Table 1-4 as taken from (Breitenbach and Simon-Nobbe,

2002; Kurup and Banerjee, 2000).









Beauveria bassiana

History

In the early 1800s, the silkworm farms of Italy and France were plagued with

diseases that periodically decimated the European silk industry. The disease was called

white muscardine after the French word for bonbons, as the disease resulted in fluffy

white corpses resembling pastries. An Italian scientist named Agostino Bassi discovered

that the disease was caused by a microbial infection and that it could be controlled by

altering the living conditions of the silkworms to decrease the spread of the disease. One

simple recommendation that he made was to remove and destroy infected and dead

insects. Later the microbe, a filamentous fungus, responsible for the disease was named

Beauveria bassiana in honor of Bassi's discovery. In 1835 Agostino Bassi, one of the

founding fathers of insect pathology, published his findings in a paper entitled Del mal

Del segno, calcinaccio o moscardino; this publication was one of the first instance of a

microbe identified as the causative agent of an infectious disease (Alexopoulos, 1996).

B. bassiana is considered non-pathogenic to vertebrates; although there are a

handful of recorded cases of human infection by this fungus (Kisla et al., 2000; Tucker et

al., 2004). These cases however, involved patients with compromised immune systems

increasing their susceptibility to a wide range of opportunistic infections. Based upon

safety tests and considered a "natural product," B. bassiana has been approved by the

U.S. Environmental Protection Agency for commercial use. B. bassiana is non toxic to

mammals, birds, or plants; and use of Beauveria is not expected to have deleterious

effects on human health or the environment (EPA, 2000). Strains and various

formulations of B. bassiana are available commercially in various parts of the world

(commercial companies include Mycotech corp. and Troy bioscience U.S.).









Physiology/Life Cycle

Beauveria bassiana is considered to be the anamorph of Cordyceps bassiana, an

ascomycete in the order Clavicipitales. The genus Cordyceps and its anamorph

Beauveria are endoparasitic pathogens of insects and other arthropods (Nikoh and

Fukatsu, 2000).

B. bassiana is a polymorphic fungus whose life cycle includes both single and

multicellular stages (Figure 1-2). B. bassiana is an ubiquitous saprobe and can be found

in soil or decaying plant material, where it grows as multicellar mycelia by absorbing

nutrients from the decaying matter (St-Germain, 1996). Reproduction and dispersion of

progeny is accomplished by the production of asexual spores called conidia. Conidia of

B. bassiana are smaller than most other fungal spores measuring only 2-4 [tm wide

(Akbar et al., 2004; Bounechada and Doumandji, 2004). Conidia are produced from

conidiogenic cells that protrude in a zigzag structure from mycelia hyphae. Conidia

released into the environment remain dormant or in a non-vegetative state until

appropriate conditions activate germination. Humidity is a major factor in activation of

conidia independent of a host (Boucias et al., 1988). Attachment of the conidia to the

exoskeleton of a host insect also stimulates germination. The initial attachment of B.

bassiana conidia to the host exoskeleton is thought to be a function of hydrophobicity

which creates a strong interaction between the conidia surface and the waxy

layer/chitonous surface of the host (Holder and Keyhani, 2005). Germination involves

the development of a hyphal structure called a germ tube; the germ tube grows along the

surface of the cuticle, and can penetrate into the cuticle by enzymatic digestion and

mechanical rupture of exoskeletal components. Once through the exoskeleton, the

fungus reaches the hemolymph and there in produces single celled morpho-types known









as in vivo blastospores. These cells replicate by budding and proliferate within the

hemolymph, evading any innate immune responses (Lord et al., 2002). When nutrients in

the hemolymph are consumed the blastospores produce elongating hyphae. These

hyphae grow until they exit the cadaver and begin producing conidia one the insect

surface. The result is a fuzzy white mummified insect corpse.

Agricultural/Economic Importance

Agricultural pests continue to be a major problem, responsible for tremendous

losses in productivity. Traditionally, chemical pesticides such as DDT (dichloro-

diphenyl-trichloroethane) and endosulfan have been used to kill unwanted insects. The

use of chemical pesticides, however, has resulted in numerous problems. Many insects

develop resistance to chemical poisons making these compounds less effective, and

therefore required in higher concentrations. Furthermore, extensive application of

chemicals into the environment often has deleterious effects on non-target organisms

including beneficial insects such as pollinators and natural predators of the target pest.

Finally, chemical pesticides display significant health risks to workers who are exposed

to the chemicals in the fields as well as to consumers who purchase food products with

residual pesticides. Thus, there is great interest in alternatives to chemical pesticides.

The use of biological pesticides such as entomopathogenic fungi is growing in

popularity because it is able to alleviate many of the concerns associated with chemical

poisons. First, entomopathogenic fungi are found ubiquitously in the soil throughout the

world, therefore they would not be considered as "introduced" organisms into the

environment. Second, although B. bassiana is considered a broad-spectrum insect

pathogen, strains can be developed that are more hosts specific. With research into









pathogenicity and strain specificity, it is anticipated that fungal biological control agents

can be selected to target specific insect pest.

There are extensive efforts to study/develop Beauveria as a biological agent.

Beauveria has been examined as a potential biological control agent of Ocneridia

volxemi. A species of grasshopper, 0. volxemi is one of the most destructive pests of

cereals crops in Algeria (Bounechada and Doumandji, 2004). Beauveria is also being

examined as method to control the citrus rust mite, Phyllocoptruta oleivora, a citrus crop

pest of South America (Alves et al., 2005). One of the most destructive pests being

targeted by application of Beauveria control is the coffee berry borer (Hypothenemus

hampei), which is endemic to most coffee growing regions and results in up to 40%

losses of the crop.

H. hampei is an agricultural pest responsible for hundreds of millions of dollars in

loses by coffee growers each year (Posada et al., 2004). Beauveria is studied around the

world as an effective control agent of coffee berry borer including research facilities

found in Honduras, Brazil, Mexico and India (Fernandez PM, 1985; Haraprasad N,

2001). Due to the illegalization of some pesticides including enosulfan; Columbia is an

example of a country that utilizes Beauveria against this pest (Cruz et al., 2005).

B. bassiana as well as Metarhizium anisopliae are under investigation and show

promise for the control of the tobacco spider mite. The tobacco spider mite is one of

several species of mites belonging to the genus Tetranychus. Found throughout the

United States Tetranychus mites are responsible for the destruction of crops ranging from

fruits and vegetables to cotton and decorative plants. Studies showed that the treatment

of mite-infected tomato plants with conidia of these entomopathogens greatly reduced the









number of mites on the treated plants as compared to untreated plants (Wekesa et al.,

2005).

Disease Control

As agricultural pests present an economic and resource production problem to

human society, other arthropod pests are a direct human health concern. In this regards, a

number of parasitic arthropods act as vectors for the transmission of infectious diseases.

Because of their ability to access the human circulatory system, blood feeding arthropods,

are important vectors by which microbial parasites can be transmitted between various

hosts. B. bassiana shows potential for controlling arthropod disease vectors, and hence

has the potential to decrease the spread of diseases carried by these insects. Ticks are an

example of an arthropod that can carry and transmit a wide variety of disease causing

agents. Ticks, obligate blood feeders, are potential carriers of the bacteria Borrelia

burgdorferi, the causative agent of Lyme disease in humans and domestic animals

(Stricker et al., 2006). Other tick born diseases include; Rickettsia rickettsii, causative

agent of Rocky Mountains spotted fever in both humans and some domestic animals;

Babesia canis, and B. gibsoni, a protozoan parasite of domestic animals; and several

species of the genus Ehrlichia, an obligate intracellular cocci responsible for a variety of

blood cell diseases in domestic animals (Ettinger, 2000; Waner T, 2001). Research

studies have shown that the prominent tick species including those known to transmit

Lyme disease are susceptible to infection by B. bassiana (Kirkland et al., 2004).

Chagas disease is a parasite infection that is transmitted by an insect vector,

primarily the South American kissing bug (Triatoma infestans) (Lazzarini et al., 2006).

Chagas disease is a serious health problem in South America where approximately 20

million people are infected. The health costs associated with treating an infection is often









too high for the majority of those inflicted with the disease. For this reason, research into

the control and prevention of the disease, is focused on vector control and involving the

use of B. bassiana and other entomopathogenic fungi. Brazil and Argentina are two

countries with research facilities studying the pathogenicity ofBeauveria toward these

insect disease vectors (Luz and Fargues, 1998; Luz et al., 1998; Marti et al., 2005).

B. bassiana may also be a valuable tool in the fight against malaria. Between 300

and 500 million people are infected with malaria, and this disease is responsible for as

many 1.5 million deaths annually (Geetha and Balaraman, 1999; O'Hollaren, 2006).

Currently there are no vaccines against malaria; however, studies have shown the

potential for fungal entomopathogens to reduce the spread of this disease (Blanford et al.,

2005; Scholte et al., 2005). In this regard, the use of entomopathogenic fungi resulting in

the infection of as little as 23% of the indoor mosquitoes reduced the yearly number of

bites received by residents by as much as 75%. Indoor treatment combined with outdoor

applications to control mosquito populations at "hot spots" it is projected that bites by

mosquitoes could be lowered by as much as 96% (Scholte et al., 2004; Scholte et al.,

2005).

Research Overview

Although not considered pathogenic to humans, the potential for B. bassiana to

elicit allergic reactions has not been studied. B. bassiana may pose a certain level of

health concern due to immune responses or hypersensitivity to this organism, as has been

reported for other filamentous fungi. Although B. bassiana has not been extensively

studied as a source of allergenic molecules, a study performed in the Netherlands

indicated potential effects (Beaumont et al., 1985a; Beaumont et al., 1985c). A

volumetric survey of aero-conidia revealed that B. bassiana was one of the most









allergenic species examined although its environmental concentration was too low to be

considered important. Although in most cases examined, B. bassiana does not persist

greater than a couple of weeks after application, with the use of organic pest control

agents such as B. bassiana the environmental concentration of these fungi may increase

resulting in short term exposure of individuals working directly with the fungi, such as

those involved in the picking and processing of agriculture crops treated with B.

bassiana; or those who live in homes treated with B. bassiana to control nuisance pest

like roaches and earwigs.

This dissertation reports the characterization of B. bassiana human reactive

antigens. Crude extracts of B. bassiana were shown by immuno-blot assays to react

strongly with human IgE. This was accomplished with the use of human sera from

patients displaying allergic reactions to other fungi. The protein nature of these allergens

was confirmed by digestion of the antigens with Proteinase K. The allergenicity of B.

bassiana extracts varied greatly between individual seras. Intradermal skin testing

confirmed the in vitro results, demonstrating allergenic reactions in a number of

individuals, including those who have had occupational exposure to B. bassiana.

Furthermore, the cross-reactive nature of B. bassiana allergens was examined.

Competitive inhibition experiments where performed using extracts of several know

allergenic fungi, including Aspergillusfumigatus, Cladosporium herbarum, Candida

albicans, Epicoccumpurpurascens, and Penicillium notatum. The treatment of B.

bassiana extracts with sera pretreated with other fungal extracts (immunoblot inhibition)

resulted in the loss of several bands visible in the, untreated sera, control lanes. A strong









band with the approximate molecular mass of 35 kDa was uninhibited by any of the

tested extracts, and may represent a B. bassiana specific allergen.

Several potential allergens were identified by homology from a B. bassiana cDNA

library. The full length genomic and cDNA sequences of four putative allergens were

isolated. The genes coding for all four where cloned into over-expression vectors and the

proteins expressed in E. coli. Using sera from 20 patients BbEnol was found to react

with IgEs in more than 50% of the sera tested, expressed BbAld displayed reactivity IgEs

from 4 sera pools, whereas no reactions were observed for the E. coli expressed BbF2

and BbHex proteins. Phylogenic comparison of B. bassiana enolase shows highly

conserved sequence characteristic with the glycolytic enolases of Cladosporium

herbarum and Alternaria alternate both highly cross-reactive fungal allergens.












Table 1-1. Common allergens
Animal


Foods


Plants


Fungi


Cockroach
Cat and Dog dander
Insect venom (bee, wasp, hornet)
Mouse urine
Rat urine
Dust mites

Eggs
Milk
Peanut
other nuts (almonds, cashews, etc)
Wheat
Fish and Shellfish
Soy

Ragweed (Ambrosia artemisiifolia)
Bermuda grass (Cynodon dactylon)
Mulberry (Morus rubra)
Sycamore tree (Plantanus occidentalis)
Cottonwood (Populus deltoides)
American elm (Ulmus americana)
Rye (Lolium perenne)


Alternaria alternate
Cladosporium herbarum
Aspergillus spp.
Penicillium chrysogenum
Epicoccum nigrum










A




Mast cell


Leukocytes


Blood
platelets


Allergen



9 U1OB, Histamine ,

9 V O a

o Cytokines Leukotrienes
Cytokines rostaglandins

0
a o
9 9


Figure 1-1. Illustrating the central role of IgE activated mast cells in a Type I
hypersensitive response; the release of chemical mediators, and the primary
tissue types affected by mast cell chemicals.


V Conldia (1)
Sporulation (4) Codia()
t _


-- Germination (2)


1 (6) B5tospores
Figure 1-2. Life cycle ofBeauveria bassiana: Metabolically dormant conidia (1);
germination and production of hyphae in response to favorable growth
conditions (2); mycelial growth on decaying plant matter (3); production of
conidiogenic structure and formation and dispersal of new conidia (4);
penetration of host cuticle by germ tube (5); fungus multiplies in heomocel as
a single-celled blastospore (6). When nutrients are depleted, B. bassiana exits
the cadaver as hyphae and begins the process of conidia production (7).


Mucous
glands


Smooth
muscle


Blood
vessels

Nerve
endings









Table 1-2. Major chemical mediators of activated mast cells.
Mediator Function
Vasoactive amine Histamine Irritates nerve endings, mucous secretion
vasodilatation, bronchial and intestinal
constriction
Proteases Tryptase Cleaves fibrinogen, activates collagenase,
tissue damage
Chymase Converts angiotensin I to angiotensin II,
degradation of epidermal basement
membrane
Chemotaxins ECF-A Eosinophil chemotaxis factor
NCF-A Neutrophil chemotaxis factor
Lipid mediators Platelet-activating Aggregation and degranulation of platelets,
factor pulmonary smooth muscle constriction
Prostaglandin D2 Vasodilator, bronchial constriction,
neutrophil chemotaxis
Leukotriene C4 Vasodilator, prolonged bronchial constriction
Cytokines IL-3 Stimulates mast cell growth and histamine
secretion
IL-4 B-cell differentiation, mast cell growth
factor, Th2 differentiation,
IL-5 Eosinophil activator, B-cell activator
IL-6 B-cell proliferation into plasma cells
IL-13 Inhibits production and release of
macrophage cytokines
GM-CSF Granulocyte-macrophage colony stimulating
factor, pro-inflammatory effects
Table contains the majority of mediators produced by mast cells, it does not list all
chemicals produced by mast cells nor does it include all the effects of each chemical
listed.









Table 1-3. Fungal allergens
MW
Allergen Function WRef, or ID
(kDa)


Alternaria alternate
Alt a 1 Unknown 28
Alt a 3 Heat shock prot. 70
Alt a 4 disulfideisomerase 57
Alt a 5 Ribosomal prot. P2 11
Alt a 6 Enolase 45
Alt a 7 YCP4 protein 22
Alt a 10 Aldehyde dehydrogenase 53
Alt a 12 Ribosomal prot. P1 11
Cladosporium herbarum
Cla h 3 Aldehyde dehydrogenase 53
Cla h 5 Ribosomal prot. P2 11
Cla h 6 Enolase 46
Cla h 7 YCP4 protein 22
Cla h 8 Mannitol dehydrogenase 28
Cla h 9 Vacuolar serine protease 55
Cla h 12 Ribosomal prot. P1 11
Aspergillusfumigatus
Asp f 2 Unknown 18
Asp f 3 Peroxisomal protein 37
Asp f 5 Metalloprotease 40
Asp f 8 Prbosomal prot. P2 11
Asp f 10 Aspartic protease 34
Asp f 12 Heat shock prot. 90 90
Asp f 16 Unknown 16
Asp f 18 Vacuolar serine protease 34
Asp f 22w Enolase 46
Penicillium chrysogenum
Pen ch 13 Alkaline serine protease 34
Pen ch 18 Vacuolar serine protease 32
Penicillium citrinum
Pen c 19 Heat shock prot. P70 70
Pen c 22w enolase 46
Data was obtained in large part from(Milligen, 2006); (1)
(Shen et al., 2001).


U82633
U87807
X84217
X78222
U82437
X78225
X78227
X84216

X78228
X78223
X78226
78224
AY191816
AY787775
X85180

U56938
U20722
Z30424
AJ224333
X85092
(1)
AJ002026
(2)
AF284645

AF321100
AF263454


U64207
AF254643
(Kumar et al., 1993), (2)









Table 1-4. Cross reactive fungal allergens
Allergen Cross-reactive allergen or species
Enolase Alt a 6, Asp f 22w, C. albicans, Cla h 6,
S. cerevisiae


Aldehyde dehydrogenase Alt a 10, Cla h 3
Heat shock protein Alt a 3, Asp f 12, C. albicans, C. herbarum, Pen c
1
Peroxiaomal membrane Asp f 3, C. boidinii, Mal f 2, Mal f 3, Pen c 3
protein
Ribosomal protein P2 Alt a 5, Asp f 8, Cla h 4
Fibrinigen binding protein Asp f 2, C. albicans
YCP4 Alt a 7, Cla h 5, S. cerevisiae
Vacuolar serine Protease Asp f 18, Asp n 18, Pen ch 18, Pen o 18
Table data was obtained in large part from (Kurup and Banerjee, 2000)















CHAPTER 2
ALLERGENICITY1

Introduction

Microorganisms are currently under intensive study for use as biopesticides

(Meikle et al., 2001; Shah and Pell, 2003). Several fungal species including Metarhizium

anisopliae, Verticillium lecanii, and B. bassiana are being used as biocontrol agents for a

number of agricultural and nuisance pests (Lecuona et al., 2001; Liu et al., 2003;

Reithinger et al., 1997). Strains of B. bassiana have been licensed for commercial use

against whiteflies, aphids, thrips, and numerous other insect and arthropod pests. B.

bassiana fungal formulations are being spread onto a range of vegetables, melons, tree

fruits and nuts, as well as organic crops. As alternatives to chemical pesticides, these

agents are naturally occurring and are considered to be non-pathogenic to humans,

although a few cases of B. bassiana-mediated tissue infections have been reported

(Henke et al., 2002; Kisla et al., 2000).

Airborne mould spores are widespread, and many have been identified as inhalant

allergens eliciting type I hypersensitive reactions in atopic individuals (Aukrust et al.,

1985; Beaumont et al., 1985b; Chiu and Fink, 2002; Kurup et al., 2000b; Kurup et al.,

2002). Common allergenic moulds include the anamorphs of Ascomycetes including

many species within the Alternaria, Aspergillus, and Cladosporium genera (Banerjee et

al., 1998; Banerjee and Kurup, 2003; Horner et al., 1995; Kurup et al., 2000a; Kurup et


1 The text of Chapter 2 of this dissertation is a reprint (in part or in full) of the material as it appears in
Clinical and Molecular Allergy (2005, Volume 3:1)









al., 2003). The genes encoding numerous fungal allergens have been isolated, and their

protein products expressed and characterized. Purified fungal allergens have been shown

to be bound by human IgEs and to elicit allergic reactions in atopic individuals using skin

prick tests. Patients with mould allergies often display IgE-mediated responses to

multiple fungi, a phenomenon typically thought to result from the presence of common

cross-reactive antigen(s) (Aalberse et al., 2001; Aukrust and Borch, 1985; Gupta et al.,

2002; Homer et al., 1995), although parallel independent sensitization to multiple fungal

allergens can also occur. In this regards, identification of genus and/or species-specific

antigens would provide useful tools in differentiating allergic reactions due to primary

sensitization and those mediated by cross-reactive epitopes.

In the present study, we demonstrate that B. bassiana crude extracts contain

numerous allergens recognized by human serum IgEs. The allergens were proteinaceous

in nature, and immunoblot inhibition experiments revealed the presence of shared

epitopes between B. bassiana and several other common fungal moulds. Potential B.

bassiana-specific allergens were also identified, including a strongly reactive 35 kDa

protein band. Intradermal skin testing using B. bassiana extracts resulted in allergenic

reactions in several individuals, including some who have had occupational exposure to

the fungus.

Material and Methods

Strains and Cultures

Beauveria bassiana (ATCC 30517) was grown on Sabouraud dextrose + 1% yeast

extract or potato dextrose (PD) media on either agar plates or in liquid broth. Plates were

incubated at 260 C for 10-12 days and conidia were harvested by flooding the plate with

sterile ddH20 containing 0.01% Tween 20. Liquid cultures were inoculated with conidia









harvested from plates at 0.5-1x105 conidia/mL; 0.1 mL of conidia suspension per 100

mL culture media.

Extract Preparation

Lyophilized protein extracts ofAlternaria alternate (lot# XPM1-X11), Aspergillus

fumigatus (lot# XPM3-D13-15), Candida albicans (lot#XPM15-D16-23.35),

Cladosporium herbarum (lot# XPM9-F6-1-23.85), Epicoccum purpurascens

(lot#XPM29-D3-19.65), and Penicillium notatum (lot# XPM19-D4-16.8) were acquired

from Greer Laboratories inc., (Lenoir, NC). Extracts were resuspended in TE (40 mM

Tris-HC1, pH 8.0, 1 mM EDTA) to a final concentration of 2 mg/mL. B. bassiana was

grown in Sabouraud's broth containing 1% yeast extract with aeration at 250C for 3-5 d.

Fungal material (mixture of hyphae and blastospores) was harvested by centrifugation

and freeze-dried. Cells were resuspended in TE containing 0.1% phenylmethylsulfonyl

fluoride (PMSF) and homogenized using a bead-beater apparatus.

Precipitations

Crude extracts of B. bassiana were subjected to three successive precipitations

before use in Western blots.

1) Acetone precipitation: B. bassiana extracts (50 mL) were mixed with 8x volume

(400 mL) of acetone (kept at -200C), with rapid stirring, and incubated overnight at -

20C. The precipitate was collected by centrifugation (30 min, 4000 x g), and the pellet

was air dried (10 min) before being resuspended in TE containing 0.1% PMSF.

2) Streptomycin precipitation (removal of DNA): Streptomycin sulfate (5 mL of

10% solution) was added drop wise to acetone precipitated B. bassiana extracts (40 mL)

at 4C with rapid stirring. Samples were incubated for an additional 30 min on ice before









being centrifuged (15 min, 10,000 x g) in order to remove the precipitate. Proteins in the

resultant supernatant were precipitated using ammonium sulfate.

3) Ammonium sulfate percipitation: The proteins present in the streptomycin

sulfate treated supernatant were precipitated using ammonium sulfate (75%, final

concentration). Saturated ammonium sulfate (120 mL) was added drop wise to the B.

bassiana extract (40 mL) at 4C with rapid stirring. The solution was allowed to stir

overnight at 4C and precipitated proteins were harvested by centrifugation (30 min,

100,000 x g). The protein pellet was resuspended in TE containing 0.1% PMSF (40 mL)

and extensively dialyzed against the same buffer before use.

SDS-Polyacrylamide gel electrophoresis (PAGE): Protein samples (30-40 fig) were

analyzed by SDS-PAGE (12% Bis-tris gel, Invitrogen, Carlsbad, CA) using standard

protocols. Gels were stained with Gelcode blue stain reagent (Pierce, Rockford, IL) and

subsequently de-stained with ddH2O.

Western Blotting

Protein samples were separated under reducing conditions using 12% Bis-tris

polyacrylamide gels (Invitrogen Mops system) and transferred to polyvinylidene-fluoride

(PVDF) membranes (Invitrogen) as described. Immunoblot experiments were performed

using individual and pooled human sera as the primary antibody solution as indicated.

Typically, sera were diluted 1:5 with Tris-HCl buffered saline (TBS) containing 5% dry

milk + 0.1% Tween-20. IgE-specific reactivity was visualized using a horseradish

peroxidase (HRP) conjugated goat anti-human IgE polyclonall) secondary antibody

(BioSource International, Los Angeles, CA). Membranes were washed with TBS









containing 0.1% Tween-20 and bands were visualized using the Immuno-Star HRP

detection system (Biorad, Hercules, CA).

Enzyme Treatments

The ammonium sulfate fraction ofB. bassiana crude extracts was treated with

Protease K (ICN-Biomed, Aurora, OH) following standard protocols. Typically, samples

(36 [tL) were incubated with 4 p.L Proteinase K solution (10 mg/mL in 50 mM Tris-HC1,

pH 7.5) for 2 hr at 37C before analysis. Samples were also treated with

endoglycosidase-H (EndoH, New England Biolabs, Beverly, MA) and peptide: N-

Glycosidase F (PNGaseF, New England Biolabs) according to the manufacturer's

recommendations. For EndoH and PNGaseF treatments, samples (36 pL) were denatured

in 4 [L 10x denaturing buffer (0.5% SDS, 1% P-mercaptoethanol) at 100C for 10 min

prior to the addition of the EndoH (5 [L of 10 x G5 Reaction Buffer, 50 mM sodium

citrate, pH 5.5) and PNGaseF reaction buffers (50 mM sodium phosphate pH 7.5) and

enzymes (5 [tL), respectively. Reactions were incubated at 37C for 2 hr before being

analyzed by SDS-PAGE and Western blotting.

Immunoblot Inhibition

IgE binding to B. bassiana proteins were competed with proteins of other fungal

extracts. SDS-PAGE resolved B. bassiana proteins were electroblotted to PVDF

membranes as described above. Membranes were blocked with TBS containing 5% dry

milk + 0.1% Tween-20 and strips were incubated with pooled human sera (1:5 v/v in

same buffer) containing 100-500 [g of the indicated fungal crude protein extract.









Skin Sensitivity Profiles to Fungal Extracts

Patients were tested with 9 common fungal extracts for allergy diagnosis using a

skin prick assay. The following extracts were obtained from ALA-Abello (Round Rock,

TX); Alternaria tenius, Aspergillusfumigatus, Cephalosporium (Acremonium strictum),

Curvularia spp. Bipolaris, Epicoccum nigram, Fusarium spp., Helminthosporium

sativum, Hormodendrum horde, Penicillium chrysogenum (formally P. notatum).

Extracts were tested using a 1:10 dilution of 20,000 PNU/mL stock solution, and skin

sensitivity was recorded on a relative scale from 0-4 reflecting the size of induration or

weal (4 representing the highest reactivity). Histamine (0.1 mg/mL), which was used as a

control, typically produced a reaction scored of 3.

Intradermal Skin Testing

B. bassiana crude extracts were prepared as described above but were extensively

dialyzed against 0.15 N NaCl and filtered through a 0.22 [tm filter before use. Subj ects

were given intradermal injections of 0.1 mL crude extract ranging in concentration from

0.01-1 mg/mL. Control injections included saline and histamine (0.1 mg/mL).

Allergenic reactions were allowed to develop for 15-30 min before the height and width

of the reactions were recorded.

Results

Identification of IgE Reactive Bands

An ammonium sulfate fraction ofB. bassiana proteins was resolved on SDS-PAGE

(Figure 2-1, lane B) and transferred to PVDF membranes as described in the Materials

and Methods. Membranes were probed with sera from individual patients who were

reactive to various moulds (Table 2-1), which was pooled and used to demonstrate IgE

reactivity against antigens present in B. bassiana extracts (Figure 2-1). Serum mix-I









represents pooled sera derived from patients E, J, K, L, and M, as well as three additional

patients that were only tested (skin prick) against Aspergillus and Penicillium, displaying

test scores of 3-4 for each. These data demonstrate human IgE binding of antigens

present in B. bassiana extracts. Initial blots showed 12-15 distinct reactive protein

bands, ranging in molecular mass from 12 kDa to >95 kDa (under denaturing conditions);

with the most prominent bands located around 64, 45, and 35 kDa. Control experiments

omitting either the primary or secondary antibody incubation steps resulted in complete

loss of signal. Proteinase K digestion of samples also resulted in loss of all signal (Figure

2-1, lane 4), indicating the proteinaceous nature of the IgE reactive bands. Since the

carbohydrate moieties of several protein allergens are known to play a role in their

allergenicity and even cross-reactivity (Aalberse et al., 2001; Ebo et al., 2004; Hemmer et

al., 2004), samples were treated with the deglycosylating enzymes EndoH and PNGaseF.

Control experiments incubating samples in the EndoH denaturing buffer without any

enzyme altered the IgE-reactive signals (Figure 2-1, lane 5), however, samples treated

with EndoH did not appear any different than control reactions (Figure 2-1, lane 6).

Similar results were obtained in PNGaseF digests (data not shown). These data appear to

indicate that the B. bassiana IgE-antigen profiles observed on Western blots are proteins

with minimal contributions due to glycosylation.

Immunoprint Analysis of B. bassiana: Reactivity with Individual Sera

In order to determine the variation and distribution of serum IgEs reactive to B.

bassiana extracts, individual sera from patients displaying mould allergies (Figure 2-2,

lanes A-G) as well as random sera from the general population (Figure 2-2, lanes H-M)

were used as probes for western blots (Figure 2-2). The reactivity of pooled sera from

patients A-G (termed serum Mix-II) is also shown (Figure 2-2, lane 2). Skin prick test









results for patients A-G are shown for comparative purposes (Table 2-1) and represent

the clinically determined reactivity of each patient to extracts of the tested fungal species.

Patients (A-G) were selected based on skin prick reactivity to at least 4 different fungi

with scores of 2 or greater. Identical concentrations of B. bassiana extract (40 [tg) were

resolved by SDS-PAGE, blotted to PVDF membranes, and the lanes were cut into

separate strips. Each strip was treated with a 1:5 dilution of each respective serum as

described in the Materials and Methods (Figure 2-3, lane 2 is the sera pool). A total of 16

individual sera were tested, with the sera from three patients displaying no IgEs reactive

to proteins present in the B. bassiana extracts. The results for the remaining 13 sera are

shown in Figure 2-2. The data show a large individual variation in serum IgEs capable of

binding epitopes present in B. bassiana extracts, both in terms of banding distribution and

the intensity of the reaction. No correlation was observed between measurements of total

IgE and the observed binding to B. bassiana antigens. Some patients displayed strong

reactions to multiple bands, whereas others to a more limited set of epitopes. Distinct

strongly reactive bands ranging from 40 kDa to approximately 200 kDa could be seen in

sera A, E, and to a lesser extent L. A strongly reactive 35 kDa band was visible in sera C,

G, E, and L. Several sera displayed IgEs that bound to only a limited set of 2-3 antigens

(C, F, G, weak bands in B, I, J, K, and M). Blots probed with one serum (H) resulted in a

large smear ranging from -30 kDa to 55 kDa. The reason for the observed smear is

unknown and efforts to distinguish separate bands by manipulating the concentrations of

either sera or extract were unsuccessful. A number of bands (based upon molecular

mass) appeared to be common to several sera including proteins of approximately 35, 42-









48, and 60 kDa. A number of antigens of high molecular weight (-100-200 kDa) were

also visible; however, the resolution in this range on the Western blots is poor.

Intradermal Skin Testing

A total of ten individuals were tested for allergenic reactivity to B. bassiana crude

extracts using an intradermal delivery procedure. Data using 1 mg/mL B. bassiana crude

extract and histamine controls are presented in Table 2-2. Seven out of the ten

individuals (ID #s, J-O, and Q) displayed skin reactivity reactions to the B. bassiana

extracts (Table 2-2, also see corresponding Western blot results for individuals J, K, L,

and M; Figure. 2-2). It is interesting to note that 4 (J-M) of 5 individuals (J-M and S)

that have had occupational exposure to B. bassiana displayed skin reactivity as well as

bands on western blots. A preliminary correlation was observed between the B.

bassiana/histamine reaction and the in vitro reactivity of individual sera in Western blots.

Individuals J, K, and M, displayed B. bassiana/histamine control ratios <1, also showed

weak bands in western blots (Figure 2-2), whereas individual L who had a B.

bassiana/histamine ratio = 1.65, reacted against numerous epitopes in the extract and

with a higher intensity.

Cross-Reactivity among Different Fungi

In order to determine the extent of cross-reactivity ofB. bassiana antigens with

other fungi, immunoblot inhibition experiments were performed. Identical

concentrations of B. bassiana crude extract (40 tg) were resolved by SDS-PAGE, blotted

to PVDF membranes, and lanes were cut into separate strips. Each strip was treated with

a 1:5 dilution pooled sera (serum mix-II) as the primary antibody supplemented with

concentrations of fungal crude extracts as described in the Materials and Methods.

Figure 2-3 shows Western blots in which the binding of human IgEs to antigens present









in B. bassiana extracts were competed with: excess crude extracts from Alternaria

alternate (Figure 2-3, Lanes 3,4), Aspergillusfumigatus (Lanes 5,6), Cladosporium

herbarum (Lanes 7), Epicoccum purpurascens (Lane 8), Penicillium notatum (Lane 9),

and Candida albicans (Lane 10). There was complete loss of all signals using 2-fold

excess B. bassiana extract as the competitor (data not shown). These data indicate that

while B. bassiana possess many epitopes in common with several other fungi, notably

Alternaria and Penicillium, a 35 kDa major reactive band was not inhibited by any

extract tested.

Discussion

Although it is well known that fungi are important triggers of respiratory allergies,

the potential allergenicity of entomopathogenic fungi used in biocontrol has largely been

untested. Aerobiological surveys conducted in the Netherlands in the late 1980s

comparing the environmental concentrations of fungal spores with their allergenicity,

reported that although B. bassiana represented less than 0.1% of the airborne fungal

"flora", it elicited the most severe allergenic skin test response of all fungal species tested

(Beaumont et al., 1985a; Beaumont et al., 1985b; Beaumont et al., 1985c). In rural areas,

the use of fungi in agricultural pest management practices can greatly increase the

potential for human exposure to these agents. Likewise, in urban settings, the

commercialization of fungal products for household use may result in a much wider

problem since indoor air concentrations of the moulds can greatly increase. For these

reasons, an examination of the allergenic potential of B. bassiana is imperative.

The present study demonstrated the allergenic potential of B. bassiana directly by

intradermal skin testing of individuals and in vitro by revealing the presence of serum

IgEs capable of binding allergens present in fungal crude extracts. Over 20 different IgE









binding proteins were observed using Western blots probed with sera from patients

displaying mould allergies. Results using individual sera revealed a wide variation in

IgE-binding proteins between sera, although several common bands, including a protein

with an apparent molecular mass of 35 kDa, were visible among the sera of several

patients.

Our in vitro observations were confirmed by intradermal skin testing on individuals

using B. bassiana extracts. While the testing sample population was small, the results

indicated that our extracts were able to elicit allergic reactions in individuals, including

some that have had occupational exposure to the fungus. Concentrations of-1 mg/mL of

B. bassiana extracts were required to elicit indurations equivalent to 0.1 mg/mL

histamine in most individuals, indicating the possibility of potent allergens in the B.

bassiana extract. Interestingly, not all individuals specifically exposed to B. bassiana

displayed allergic reactions and individuals J, K, and M (who did display mild allergic

reactions, Table 2-2) did not react to the 35 kDa protein based upon Western blotting

results (Figure 2-2). We do not, however, have any quantifiable index of exposure for the

individuals in our sample and any interpretations should be made with some caution.

Numerous studies have revealed the presence of cross-reactive proteins among

fungal species between genera (Aalberse et al., 2001; Aukrust and Borch, 1985; Gupta et

al., 2002; Homer et al., 1995; Simon-Nobbe et al., 2000; Vieths et al., 2002; Weichel et

al., 2003). In our experiments, (excess) crude extract from a test organism was added

during the primary antibody (human sera) incubation. Common or shared epitopes

between B. bassiana and the test fungus would result in a loss of signal due to

competition for reactive IgEs. However, IgEs reactive to B. bassiana-specific antigens









would not be affected, resulting in no change in the corresponding reactive bands on a

Western blot. Loss of a signal would indicate that a homolog or shared epitope (IgE-

reactive) exists between the two fungal species, implying that primary sensitization by

one organism can result in an allergic reaction when exposed to the homologous allergen

of another organism. Competitive immunoblot inhibition experiments revealed

significant epitope homology between B. bassiana and several clinically important fungi

responsible for IgE-mediated allergic reactions in atopic individuals. Thus, an allergic

reaction to B. bassiana exposure may arise in patients sensitized to other fungi. Extracts

from A. alternate and E. purpurascens almost completely competed with antigens present

in the B. bassiana extract with the notable exception of the -35 kDa allergen.

Competition experiments using A. fumigatus, C. herbarum, C. albicans, and P. notatum

extracts also indicated the presence of many shared epitopes, although distinct (non-

competed) IgE-binding B. bassiana proteins of 35 kDa, 64 kDa, and >200 kDa molecular

mass were detectable. These proteins, particularly the 35 kDa antigens may represent B.

bassiana-specific allergens. Experiments are underway to characterize the 35 kDa

allergen, which may lead to a diagnostic assay for B. bassiana sensitization. Finally, our

analysis of potential B. bassiana allergens was limited to cell extracts grown under

specific conditions and did not include the culture filtrate. Extracellular proteases, an

important class of fungal proteins that can elicit allergenic reactions, have been

characterized form a number of fungal species (Chou et al., 2003; Gupta et al., 2004;

Nigam et al., 2003; Shen et al., 2001), and are likely to be present in B. bassiana. A

careful examination of culture growth conditions is also warranted in order to provide a

standardized reagent for testing purposes.








Conclusion
Although B. bassiana holds promise as an arthropod biological control agent, there

have been few reports on the allergenic potential of these organisms. Identification of B.

bassiana-specific allergens can lead to diagnostic methods for determining sensitization

to this organism and may provide a rational basis for allergen attenuation in order to yield

safer biocontrol products. The observed cross-reactivity among proteins ofB. bassiana

and the fungi tested, highlight the importance of considering the possibility that multiple

fungal sensitivity can occur due to exposure to a single fungus. Further testing should be

performed to determine the scope, severity, and range of allergenic reactions to B.

bassiana.



A B (kDa) 1 2 3 4 5 6

191 g
97 i
64 -*
51

39

28


Figure 2-1. SDS-PAGE and Immunoblot analysis of B. bassiana crude extracts. SDS-
PAGE, Gelcode blue stained, lanes A) 5 pg protein standards, and B) 40 pg B.
bassiana crude extract. Immunoblots probed with pooled sera mix-I (patients
displaying mould allergies), lanes 1), 5 .g protein standards, 2) 20 gg B.
bassiana crude extract, 3) 40 .g crude extract, 4) 40 .g crude extract,
proteinase K treated, 5) 40 .g crude extract, denaturing buffer control (no
EndoH), 6) 40 pg crude extract, EndoH treated.









Table 2-1. Allergic profile of patients A-G, obtained by skin testing
Patient Individual Reactivity* to Fungal Extractst
no.
Alt Asp Cep Cur Epic Fusa Helmin Hormo Pen
A 3 2 3 2 2 3
B 3 2 2 3 2 2 2
C 4 3 2
D 2 2 2 2 2
E 3 2 3 2 3 3
F 4 1 1 2 4 2
G 3 4 3 2
*Skin test score is registered 0-4 with 4 representing the most reactivity. t
Abbreviations are: Alt-Alternaria, Asp-Aspergillus, Cep-Cephalosporium, Cur-
Curvularia, Epic-Epicoccum, Fusa-Fusarium, Helmin-Helminthosporium, Hormo-
Hormodendrum, Pen-Penicillium.


S1 A B C D EF G 2H I J
I(kD ABCDEFG2HIJKLM
J(kDa)


191
97
64
51

39

28


Figure 2-2. Immunoblot analysis of B. bassiana extracts (40 gg crude extract/strip)
probed with individual sera. Lane 1) 5 tg protein standards, 2) pooled sera
mix-II (patients displaying mould allergies). Lanes A)-G) membranes strips
treated with individual sera from sera mix-II. Lanes H)-M) membrane strips
probed with individual sera randomly obtained from the general public.










MW 1
(kDa
191
97
64
51

39


28


2 3 4 5 6 7 8 9 10


Figure 2-3. IgE immunoblot inhibition with fungal extracts. B. bassiana protein strips
(40 tg crude extract) were blocked and incubated with mix containing (500
1tl) pooled sera (mix-II) 1) Seablue standard, 2) no additions, 3) 40 tg A.
alternate crude extract, 4) 400 tg A. alternate, 5) 40 tg A. fumigatus, 6) 400
tg A. fumigatus, 7) 400 tg C. herbarum, 8) 400 tg C. albicans, 9) 400 tg E.
purpurascens, and 10) 400 tg P. notatum protein.


Table 2-2. Intradermal skin test
Patient Histamine control B. bassiana Extract B. bassiana/Histamine
ID (0.1 mg/mL) (Img/mL) (mm2/mm2)
Induration Erythema Induration Erythema Induration ratio
J3 7x6 12x16 8x8 12x13 0.65
K3 20x15 55x50 13x12 14x13 0.52
L3 11x10 16x33 13x14 26x28 1.65
M3 15x16 36x44 10x12 10x12 0.30
N 16x14 38x58 10x11 21x17 0.49
0 21x16 39x59 9x8 18x21 0.21
P 15x17 44x45 5x4 5x4 0.08
Q 15x14 36x38 9x12 10x13 0.51
R 15x15 55x38 4x4 11x13 0.07
S3 20x19 38x43 4x4 4x4 0.04
'In all instances saline control produced an Induration of 3-4 x 3-4 mm.
2Induration and erythema values are recorded in mm.
3Individual with occupational exposure to B. bassiana.














CHAPTER 3
MOLECULAR AND IMMUNOLOGICAL CHARACTERIZATION OF PUTATIVE B.
bassiana ALLERGENS

Introduction

Allergic diseases represent a growing human health problem, affecting up to 25%

of individuals living in industrialized nations (Chiu and Fink, 2002). Both in- and

outdoor populations of filamentous fungi are a major cause of human allergies, and can in

some cases, lead to severe allergic disease (Kurup et al., 2000b). Common clinical

symptoms of atopic allergy include sneezing, rhinitis, shortness of breath, and asthma.

Asthma is a chronic respiratory disease that afflicts over 17 million Americans, and is

responsible for 5,000 deaths annually (O'Hollaren, 2006). Some 30% of asthma cases

can be attributed to exposure and sensitization to filamentous fungal allergens (Kurup et

al., 2002; Vijay and Kurup, 2004; Wuthrich, 1989).

Beauveria bassiana is an entomopathogenic fungi currently used as a biological

control agent against agricultural insect pests (Shah and Pell, 2003). B. bassiana is

considered non pathogenic to vertebrates and has not been deemed a potential health or

environmental hazard (EPA, 2000). Research presented in this thesis as well as by others

has shown, however, that B. bassiana is capable of initiating an allergic response in

humans; and applications of this fungus should take into account potential health

concerns regarding eliciting allergenic reactions.

A volumetric assay of allergens in the 1980's revealed that although the

environmental concentration of B. bassiana spores was very low, the allergic response









was severe (Beaumont et al., 1985a; Beaumont et al., 1985c). Performing skin prick

assays on patients with mold allergies, B. bassiana was shown to elicit on of the strongest

reactions relative to the other fungal species in the study. In research presented as part of

this thesis we have demonstrated that human IgEs, derived from patients displaying

allergies to molds, react with several proteins produced by B. bassiana. Furthermore,

many of these proteins were cross reactive with allergens of other major allergenic fungi

(Westwood et al., 2005).

The majority of fungal allergens are proteins of unknown function; however, the

biochemical activities of a number of allergens have been characterized. These typically

fall into several classes including metabolic enzymes, proteases, and enzyme inhibitors

(Stewart et al., 1993). An enzyme or protein identified as an allergen in one species of

fungus is often found to be allergenic when identified in other species due to similarities

in structure and/or function. In many cases, structural similarities between the proteins of

two species are close enough to be recognized by the same specific IgE antibodies,

leading to cross-reactivity. Aldehyde dehydrogenase has been identified as a major

allergen in both Alternaria alternate (Alt al0) and Cladosporium herbarum (Cla h3)

(Achatz et al., 1995). Enolase (2-phosho-D-glycerate hydrolase), a glycolytic enzyme

responsible for the production of phosphoenolpyruvate, has been identified as an allergen

of not only C. herbarum and A. alternate but of several other fungal species as well

(Simon-Nobbe et al., 2000).

Here we report the identification of four B. bassiana proteins as potential allergens.

Full length cDNA and genomic nucleotide sequences of the four genes were determined.

Similarity search results of the translated open reading frames of the proteins coded by









the genes have led to their putative designation as follows; BbEnol, an enolase; BbF2,

major allergen ofAspergillusfumigatus; BbAld, aldehyde dehydrogenase; and BbHex,

acetyhexoseaminadase. The cDNA sequences of all four proteins were used to design

primers for subcloning of the genes into E. coli expression vectors. All four proteins

were successfully expressed as recombinant proteins in E. coli. Two of these proteins, a

suspected enolase (BbEnol), and a suspected aldehyde dehydrogenase (BbAld) reacted

with human IgEs derived from patients displaying mold allergies.

Materials and Methods

Strains and Media

B. bassiana (ATCC 90517) was maintained on potato dextrose agar (Difco, MI) at

26C. For RNA extraction, driver and tester culture where grown on selective metabolic

media; media and extraction perform as outlined in (Holder, 2005). E. coli strains used

for cloning and heterologous protein expression included: TOPO Top 10, chemical

competent cells (Invitrogen, CA); BL21 Rosetta (DE3), harboring the pRARE plasmid

(Novagen, Darmstadt, Germany). E. coli cloning and expression strains were grown

and/or maintained in Luria-Bertani (LB) or on LB Agar (LBA) (Difco, Detroit, MI), at

37C.

RACE PCR

Full length gene sequences of the B. bassiana genes were obtained by RACE PCR

technology (rapid amplification of cDNA ends). The SMART RACE cDNA

Amplification kit (Clontech, CA) was used according to manufacturer instructions.

Template mRNA was extracted from B. bassiana grown on minimal medium with 1%

(w/v) glucose (0.4 g/L KH2PO4, 1.4 g/L Na2HP04, 0.6 g/L MgSO4.7H20, 1.0 g/L KC1,

0.25 g/L NH4N03, 0.01 mg/L FeSO4 and 10 g/L sterilized cuticle) and was inoculated









with 0.1 mL of the Czapek dox (24 mL) cultures (6 days). Cultures were grown for 6

days at 26C with aeration (210-230 rpm) (Holder, 2005). 5' and 3' primers used for

RACE are listed on Table 3-1

Cloning

Primers where designed to clone the entire cDNA gene and to incorporate

restriction sites for extraction and insertion into an expression vector (Table 3-1). An

Ndel restriction (catatg) site was incorporated into the forward primer and an EcoRI site

(gaattc) was incorporated into the reverse primer. PCR products were cloned directly

into TOPO 2.1 using TOPO TA cloning system and transformed into TOPO Top 10 E.

coli cells (Invitrogen, Carlsbad, CA).

The B. bassiana genes where subcloned from the TOPO 2.1 constructs into the E.

coli pET43.1a (Novagen, Darmstadt, Germany) expression system using the Ndel and

EcoRI restriction sites in the clones and vector. For expression, pET43. la containing B.

bassiana genes and amp resistance gene were transferred to an E. coli BL21 and

expression strain, Rosetta (DE3) (Novagen, Darmstadt, Germany). The host strain

harboring the pRARE plasmid which contains the genes for production of the rare

codons; proL, leuW, metT, argW, thrT, glyT, tyrU, thrU, argU, and ileX. Thus, final

expression cells contain two plasmids, pRARE and the pET construct.

Expression

The four B. bassiana proteins were expressed using an E. coli T7 polymerase based

recombinant system. Overnight cultures of E. coli BL21 harboring pRARE along with

each respective pET43. la-based construct were grown in 3 mL of LB (Amp 50 [tg/mL,

Cam 12 [tg/mL) at 37C with aeration. 5 mL of fresh media was inoculated with 100 ptL









of the overnight culture, and samples were incubated at 37C with aeration to OD600 of

0.6-0.8 (2-3 hrs). Initial growth aliquots were taken and stored as uninduced samples.

IPTG (Isopropyl-B-D-thiogalactopyranosid) was then added to the remaining culture to a

final concentration of 1.5 mM; cultures were returned to the incubator for an additional 2

hours. For extract preparation, cells were harvested by centrifugation (10,000 x g, 10

min) and the resultant pellet resuspended in 0.5 volumes TE (40 mM Tris, 1 mM EDTA,

0.01% phenylmethylsulfonyl fluoride (PMSF)). Cells were lysed by sonication (3 x 30

sec) on ice. Sonicated samples were centrifuged (10,000 x g, 10 min) and separated into

soluble and pellet (containing potential inclusion bodies) fractions. Both fractions were

denatured with lx LDS loading dye and boiled for 5-10 min prior to separation by SDS-

Polyacrylamide gel electrophoresis (SDS-PAGE). Samples (15 [tL) were analyzed by

SDS-PAGE using the Invitrogen NUPage, Mops system (12% Bis-tris gel) using the

manufacture's recommended protocols. Gels were stained with Coomasie Blue R250

followed by destaining with 10% methanol, 10% acetic acid solution.

Western Blot and Immunodetection

Protein samples were electrophoresed under reducing conditions using Bis-Tris

SDS-PAGE 10-12% gels (Invitrogen NuPAGE, Mops system), followed by

electroblotting to polyvinylidene-fluoride (PVDF) membranes (Invitrogen, Carlsbad,

CA). Membranes were incubated in blocking buffer (TBST (25 mM TBS, 0.1% Tween-

20), 10% dry fat free milk), either individual or pooled human sera as the primary

antibody solution. Typically, sera were diluted in blocking buffer and incubated with

membranes overnight at 4-8C with gentle agitation. Membranes were washed 3x using

50 mL TBST for 15 min. Binding of human IgEs was visualized using a horseradish









peroxidase (HRP) conjugated goat anti-human IgE polyclonall) secondary antibody

(BioSource International, CA). Membranes were incubated in secondary antibody

(diluted 1:10,000 in blocking buffer) for 1 hr at room temperature, with gentle agitation.

After secondary antibody incubation membranes were washed 3x using 50 mL TBST.

Bands were visualized using the Immuno-Star HRP detection system (Bio-Rad, Hercules,

CA).

Membrane staining was performed by 5 minute incubation in Ponceaus S (Sigma,

St. Louis, MO) and destined for 2 minutes with ddH20.

Analysis Programs

Nucleotide manipulations were done using Vector nti, which was also used to

generate figures showing nucleotide and amino acid sequences. Phylogenetic analyses of

amino acid sequences were performed using ClustalW and SplitsTree. Initial sequence

alignments where performed with ClustalW (Thompson et al., 1994). Alignment files (in

Nexus format) were transferred to SplitsTree for analysis and construction of

phylograms, with typical bootstrap parameters set to 1000 (Huson and Bryant, 2006).

Results

Cloning and Sequencing

EST (expressed sequence tag) panning and screening of a suppressive subtractive

library (SSH) identified gene fragments of four potential allergens by sequence homology

(Table 3-2) (Holder, 2005). The B. bassiana genes were designated as follows: bbenol,

similar to Cladosporium herbarum enolase Cla h 6; bbf2, similar to Aspergillusfumigatus

major allergen Asp f 2; bbald, similar to Cladosporium herbarum allergen Cla h 3, an

aldehyde dehydrogenase; and bbhex, with similarities to numerous fungal acetyl-

hexosaminidase, including Pen ch 20.









Since the nucleotide fragments (200-900) represented only a portion of the entire

gene sequence coding for each protein, full length sequences were obtained by two

rounds of RACE PCR. Based upon the final assembled gene sequences, primers were

designed incorporating the restriction site Ndel at the 5' end and EcoRI at the 3' end.

Primers were designed for amplification of both genomic and cDNA sequences of each

gene (Figure 3-1) (Table 3-2).

The genomic sequence of bbenol consisted of 1548 bp from the start site to the

stop codon and contained 4 introns (Figure 3-3). All four introns were between the

lengths of 52-69 bp and are located in the first half of the gene. bbenol, 1317 bp cDNA

sequence, encodes a 47 kDa protein 438 amino acids in length. Blastx similarity searches

of BbEnol amino acid sequence against the NCBI protein database resulted in high

similarity to the enolases of several different fungal species, including Aspergillus

fumigatus, Penicillium citrinum, Alternaria alternate, and Cladosporium herbarum.

These enolases are also known to be highly allergenic.

The genomic sequence of bbf2 consisted of 845 bp from start site to the stop codon

and contained one intron that began at bp 412 and was 59 bp in length (Figure 3-4). bbf2

encodes a 28 kDa protein, 261 amino acids in length. Blastx similarity searches for BbF2

against the NCBI protein data bases identified sequence similarity to Aspergillus

fumigatus major allergen Asp f 2. The function of the protein Asp f 2 is unknown.

The genomic sequence of bbald consisted of 1659 bp from start site to stop codon

and contained two introns (Figure 3-5); the first 106 bp in length, started at bp 62, and the

second, 59 bp in length, started at bp 568. bbald 1494 bp cDNA sequence encodes a 53

kDa protein, 497 amino acids in length. Blast similarity searches of BbAld against the









NCBI protein database revealed amino acid sequence similarities to the aldehyde

dehydrogenases produced by several fungal species including Alternaria alternate and

Cladosporium herbarum, both of which are known allergens.

The genomic sequence of bbhex consists of 1959 bp from start site to stop codon

and contained no introns (Figure 3-6); translation results in a 72 kDa protein with an

amino acid length of 652. Blastx similarity searches showed sequence similarity to

several fungal N-acetylhexosaminidases one of which (Pen ch 20) is a major allergen of

Penicillium chrysogenum.

Protein Expression

All four B. bassiana genes were subcloned into the pET43.1a expression vector as

described in the Materials and Methods. The integrity of all the clones was verified by

sequencing of the inserts. Initial attempts using the E. coli BL21 (DE3) (Novagen)

yielded no visible expression of the proteins after inductions as determined by SDS-

PAGE. The clones were then transformed into a BL21 E. coli strain containing pRARE,

a plasmid that contains the genes for the expression of ten rare tRNAs (Novagen).

Expression experiments were conducted with a 2 hr induction period and samples

analyzed by SDS-PAGE. Highly expressed protein bands were visible in lanes

containing samples that were IPTG induced, with no highly expressed protein visible in

the uninduced lanes (Figure 3-7). Note that the pET43. la vector contains a collection of

fusion tags (Nus-Tag, His-tag, and S-Tag), which were removed in the cloning of B.

bassiana putative allergen genes, however in the "no insert" control, the combined

length of the fusion tags is z1800 bp and results in the expression of a polypeptide of

approximately 70 kDa (Figure 3-7, lane 10).









Induction of the BbEnol clone by IPTG resulted in the production of two bands,

the first having the expected mass of 47 kDa, and a second smaller band with a mass -45

kDa (Figure 3-7, lane 2). The BbF2 clone also appeared to produce two protein bands of

z28 kDa (Figure 3-7, lane 4). Experiments were performed varying the induction time

from 1 to 3 hrs and in all cases the expression of two proteins was apparent in the

BbEnol and BbF2 (data not shown).

Effect of Denaturing Conditions on Expressed Proteins

In order to determine whether the two bands observed during expression of

BbEnol and BbF2 was the result of cleavage of the intact protein during denaturation,

protein aliquots were placed in PAGE sample buffer and boiled for various times. Fresh

cultures were grown and induced (2 hrs with 1.5 mM IPTG), and aliquots were placed in

lx LDS loading buffer. Samples of all the four induced cultures were incubated at 95C

for 1, 5, and 20 minutes to lyse cells and denature proteins prior to being analyzed on

12% PAGE gels (Figure 3-8), a similar experiment was conducted with a 5 minute

incubation of time and increasing temperatures 95, 100, 110C (data not shown). The

data revealed that denaturing conditions (boiling in sample buffer) results in the partial

breakdown of some of the expressed clones visualized by the increasing intensity of a

lower molecule weight band. Only a single band was visible in the induced lanes of

BbEnol and BbF2 when denatured (heated) for one minute at 95C, whereas increased

time course of heating led to the appearance of a second BbAld band. The 72 kDa band

produced by BbHex clone was not affected under the conditions tested (Figure 3-8).

IgE Reactivity

To test for allergenicity, the four recombinant B. bassiana proteins were separated

by PAGE electrophoresis and electroblotted onto PVDF membranes. Membranes were









blocked with 10% milk in TBST and treated with human sera to test for IgE reactivity.

Sera used were collected from 20 patients with known fungal allergies. Each serum was

randomly assigned an alphabetical designation, and in most instances pooled was

described alphabetically according to the sera it contained. Figure 3-9 shows two blots

containing all four expressed proteins as well as a crude B. bassiana extract (positive

control), that were probed with one of two sera pools containing serum from ten patients

each, pools A-J and K-T. Each blot was treated with 200 pL of each serum diluted in 5

mL blocking buffer, with a final volume of 7 mL and the concentration of each serum

being 1:35. HRP conjugated goat anti-human IgE was used to identify bands that had

been bound by human IgEs. The blot probed with pool A-J revealed strong IgE binding

of the two protein bands corresponding to BbEnol, as well as several reactive

(background) E. coli bands (Figure 3-9). The B. bassiana crude extract reacted with a

variety of IgEs present in the sera (Figure 3-9, lane 5 and 10). Since, a number of

experiments resulted in the faint potential interaction of sera IgEs with BbF2 and BbAld

experiments performed using smaller sera pools in which the concentration of any

individual sera was increased.

Five sera pools were created each containing 1:5 dilutions of two sera each,

designated as AB, CD, EF, GH and IJ. These pools were then used to probe blots

containing BbEnol, BbF2, and BbAld, (BbHex was omitted due to the lack of even faint

reactivity). Background bands were highly variable between pools and were the results

of specific IgE interactions. Pool EF reacted strongly against E. coli proteins of similar

molecular weight as BbEnol and BbAld (Figure 3-10), and was therefore not used any









further. IgEs in pools AB and GH reacted against BbEnol. Human IgE binding to

BbAld was also noted with pools AB and GH.

Since many recombinant proteins often form inclusion bodies when expressed in E.

coli, soluble and pellet fractions were isolated for all four E. coli expressed B. bassiana

proteins after IPTG induction. SDS-PAGE analyses of these fractions revealed, that all

four B. bassiana proteins were located in the insoluble pellet fraction, and hence are

likely localized within inclusion bodies (Figure 3-11).

Figure 3-12 presents three blots demonstrating the human IgE binding and

specificity of BbEnol. Panel (ABCD) shows BbEnol (unfractionated samples) sample

treated with a pool of ABCD (1:10 dilution). The two bands corresponding to BbEnol

were bound by sera IgEs (Molecular mass range between 45-49 kDa). Panel (AB) of

Figure 3-12 shows that there are no reactive bands present when serum (pool AB) is used

to screen the uninduced sample or the soluble fraction. Panel (CD) of Figure 3-12 show a

blot treated with human sera (pool CD) from individuals not sensitized (allergic) to

BbEnol.

To confirm BbAld reactivity, 15 [L samples of BbAld pellet fraction were run on a

10%, 15 lane polyacrylamide gel (NuPAGE, Invitrogen); the thinner lanes and lower

percent gel appeared to slightly improve the resolution of the protein bands. After

electroblotting onto PVDF membranes, cut lanes were treated with sera pools as follows:

AB, CD, GH, IJ, KJ, MN, OP, QR, and ST (1:5 dilutions), 9 pools total (Figure 3-13).

These results demonstrated BbAld specific IgEs were present in four of the nine sera pool

tested including pool AB.









A further experiment testing for the presence of sera IgEs capable of binding

BbEnol and BbAld was performed. Figure 3-14 shows the results of blots containing the

pellet fraction of the four B. bassiana proteins, probed with individual serum A and B.

Blots were compared to a membrane stained with Ponceaus S, which confirms the

presence and efficient transfer of the proteins (Figure 3-14).

Phylogenetic Comparison

BbEnol displays high sequence similarity to fungal enolases many of which are

major allergens. All available fungal enolase sequences were gathered including both

allergenic enolases as well as enolases not known to be allergenic in order to construct a

phylogenetic comparison. The enolase from Hevea brasiliensis (rubber tree) was

included in this comparison since it too is an allergen. Two additional non-fungal

enolases were included as outlying sequences for rooting the tree. The non-fungal

enolases included the enzymes from Drosophila melanogaster (fruit fly) and Escherichia

coli prokaryoticc bacterium).

Enolase amino acid sequences where prepared for phylogenetic analysis by first

running a ClustalX alignment (Thompson et al., 1994), and the resultant product saved in

Nexus format to enable analysis by SplitsTree phylogenetic program (Huson, 1998).

Data was analyzed and organized into rooted phylograms (Figure 3-15). Probabilities

were calculated using a bootstrap value set to 1000.

Of the 21 fungal enolases, eight have been identified as allergenic including

BbEnol. Known allergens are depicted by an asterisk in Figures 3-15. The positions of

the allergens on the phylogram do not appear to be grouped or form any pattern, and they

are equally distributed throughout the cladogram. It should be noted that enolases not









marked as allergens do not necessarily represent non-allergens, but reflect cases where

allergenicity has not been reported.

Discussion

Several studies have demonstrated the potential of B. bassiana to elicit allergic

reactions in humans (Beaumont et al., 1985a; Beaumont et al., 1985c; Westwood et al.,

2005). In this study we have taken the next step toward a better understanding of the

allergenicity of B. bassiana.

Allergic testing towards B. bassiana is not routinely performed and indeed there are

no approved extracts for testing patients for B. bassiana allergy. Therefore, the serum

collected was from patients that reacted to other fungi such as Aspergillus, Alternaria,

and Epicoccum. Since many patients that display allergies are often sensitive to multiple

fungi (Horst et al., 1990), it was hypothesized that within a population of patients with

known fungal allergies there would exist individuals sensitive to B. bassiana, and that the

cross-reactive nature of fungal allergenic epitopes would increase the likely hood of

finding individuals allergic to B. bassiana proteins.

We have demonstrated that crude extracts of B. bassiana contained several proteins

that reacted with human sera IgE. EST and SSH revealed four proteins that were highly

similar to other fungal allergens. Using the sera from 20 patients, human IgE binding of

two of the proteins, BbEnol and BbAld, was shown. Due to the small sample size and

because the sera used to screen for allergenicity was not derived form patients with know

B. bassiana allergies, the lack of reactivity of BbF2 and BbHex does not discount them as

potential allergens.

Allergenic fungal enolases have been shown to be highly cross reactive, and it has

been reported that IgE cross-reactivity exists between the enolases of at least five fungal









species, extending even to the plant enolase (Hevea brasiliensis) (Simon-Nobbe et al.,

2000; Wagner et al., 2000). Phylogenetic analysis of available fungal enolase sequences,

including those shown to be allergens (and cross-reactive) resulted in no clear distribution

pattern. The enolases which have been identified as allergens were distributed equally

throughout the phylograms. This could indicate that the shape or function of the enzyme

has an effect on the immune response, resulting in a preference towards humeral and IgE

pathways. This has been seen with other highly allergenic enzymes (Gough et al., 2003;

Gough et al., 2001).

The cross-reactive nature of these enolases increases their importance as causes of

allergic reactions. The cross reactive enolases are seen throughout the phylogram and

even include cross-reactivity between fungal and non-fungal enolases. This indicates that

not only does the enzymatic enolase have a propensity towards humeral immune response

but that the allergenic region of the protein is highly conserved even between distant taxa.

Although based on sequence similarity, BbEnol has been designated as an enolase

and BbAld as an aldehyde dehydrogenase, biochemical confirmation is still required.

Immunoblot results demonstrated both BbEnol and BbAld are bound by specific human

IgEs and can therefore elicit allergic responses. BbEnol and BbAld represent the first

identification of allergens from the filamentous fungus B. bassiana. Future research is

aimed at confirming the function of BbEnol and BbAld, as well as continuing to isolate

and identify the epitopes responsible of B. bassiana allergenicity.










Table 3-1.
Clone
BbEnol



BbF2



BbAld



BbHex


PCR Primers
Primer ID
11010110i-r
11010110i-f
Beabl-f
Beabl-r
11130106i-f
11130106i-r
Beab2-f
Beab2-r
3H05-f
3H05-r
Beab3-f2
Beab3-r
5'HexosRace
5'HexosRace2
Beab4-f
Beab4-r


Primer sequence (5'-3')
cctcggcgaaggggtcttcgatg
atgattgggaggcctggagctacttctaca
gaaagacagtccatatggccatcaccaagg
gaattccgtcacgccgcatgtcagcactcc
gggctgcgacatcgtacgcccaaa
ccggagttggatgcactggcaagct
gacatcacaatccatatgaagacaccgagc
gaattcgacaatacatttgcttcatccaccgcactc
tcaggt tccaggaatgcagcagctttga
agaaggtcactcttgagctcggtggcaagt
catatgactttgacagtgcagctatctacgcccgct
gaattctgttgatgtcccaagagcttgtctgggc
aacgagggggtggccgcagt
gcgcgcgtatgcaatgaggtctttaac
catatgcgttctcagtcattgtcctctggtttgc
gaattcgaatgacaagtcctacactattgccgctgctcc


Modified or inserted base pairs are underline.

Table 3-2. Cloning vectors
Plasmid Gene E. coli strain Notes Cell
stock

BbEnol
pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20a
pCR2.1-TOPO genomic Top 10 Sequence confirmed G13
pET43.1a cDNA BL21(DE3) Sequence confirmed G21a
pET43.1a cDNA BL21(DE3) pRARE/expression G23a
BbF2
pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20b
pCR2.1-TOPO genomic Top 10 Sequence confirmed G14
pET43.1a cDNA BL21(DE3) Sequence confirmed G21b
pET43.1a cDNA BL21(DE3) pRARE/expression G22b
BbAld
pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G24
pCR2.1-TOPO genomic Top 10 Sequence confirmed G15
pET43.1a cDNA Top 10 Sequence confirmed G25
pET43. la cDNA BL21(DE3) pRARE/expression G26
BbHex
pCR2.1-TOPO cDNA Top 10 NdeI/EcoRI incorporated G20d
pCR2.1-TOPO genomic Top 10 Sequence confirmed G16
pET43.1a cDNA BL21(DE3) Sequence confirmed G21d
pET43.1a cDNA BL21(DE3) pRARE/expression G23d


Function
5'RACE
3'RACE
Forward
Reverse
5'RACE
3'RACE
Forward
Reverse
5'RACE
3'RACE
Forward
Reverse
5'RACE
5'RACE
Forward
Reverse











Species Function Allergen Accession E*
I.D. number value


BbEnol
Alternaria alternate
Cladosporium herbarum
Aspergillusfumigatus
Neurospora crassa
Penicillium citrinum
BbF2
Aspergillusfumigatus
Aspergillus nidulans
Candida albicans

Candida albicans

BbAld
Alternaria alternate
Cladosporium herbarum
Cladosporium fulvum
Neurospora crassa
Aspergillus nidulans
BbHex
Metarhizium anisoplae
Aspergillusfumigatus
Aspergillus oryzae
Penicillium chrvsowenum


enolase
enolase
enolase
enolase
enolase


major allergen
antigen 1
pH regulated antigen
fibrinogen binding
mannoprotein

aldehyde dehydrogenase
aldehyde dehydrogenase
aldehyde dehydrogenase
aldehyde dehydrogenase
aldehyde dehydrogenase

acetylglucosaminidase
acetylhexosaminidase
acetylhexosaminidase
acetylglucosaminidase


Alt a 6 U82437
Cla h 6 X78226
Asp f 22w AF284645
XM323150
Pen c 22w AF254643

Asp f2 AAC59357
XP659435
AAC00525

AAC49898


Alt a 10
Cla h 10


X78227
X78228
AF275347
XM951769
XM653066


DQ000319
XM742214
AB085840
Pen ch 20 AAB34785


* E=Kmn eA^-XS Blastx statistical value; E = the chance the match was made in
error.(Fitch, 1983).


Table 3-3. Allergens with


sequence similarities to B. ba~ssiana











Clone Gene Insert Length
Atg-stop poly a


11190110i
2110202
2250210


271
907
410 601
1317 1508


bbenol
bbenol
bbenol
bbenol

bbf2
bbf2
bbf2
bbf2

bbald
bbald
bbald
bbald



bbhex
bbhex
bbhex


original SSH clone
5' RACE product
3' RACE product
Total sequence

original SSH clone
5' RACE product
3' RACE product
Total sequence

original SSH clone
5' RACE product
3' RACE product
Total sequence

original SSH clone
5' RACE product
5' RACE 2nd round
Total sequence


190
736
50
786

195
775
719
1494

651
864
912
1959


2095


11130106i
2110205
2200211



3H05
2110209
2250212



1H10
6170201
7260201


388

217
984




839
1618

787


Table 3-4.


Result of RACE PCR









1 2 34


5 6 7 8


-2kb

-1kb
-0.5kb




Figure 3-1. cDNA vs genomic: (2)bbenol, cDNA ;(3) bbenol, genomic DNA; (4) bbf2
cDNA; (5) bbf2, genomic DNA; (6) bbald, cDNA; (7) bbald, genomic DNA;
(8) bbhex, cDNA; (9) bbhex, genomic DNA; (1) lambda DNA, Hind III digest
(New England Biolabs, MA), (10) 50-2kb ladder (BioRad, CA).


BbEnol 1548 bp
I I I I I I I I I I

BbF2 845 bp
I n I

BbAld 1659 bp
I I I I I I

BbHex 1996 bp
I
Figure 3-2. Illustration depicting genomic gene sequences of putative B. bassiana
allergens with relative size and location of introns.









61




+1 Met Ala lie Thr Lys Val His Ala Arg Ser Val Tyr Asp Ser Arg Gly Asn Pro Thr Val Glu Val Asp Leu Val Thr Glu-

1 ATGGCCATCA CCAAGGTTCA CGCTCGTTCC GTCTACGATT CTCGTGGCAA CCCCACCGTT GAGGTTGATC TCGTCACTGA
+1 GluThr Gly Leu His Arg Ala lie Val Pro Ser Gly Ala Ser Thr Gly

81 AACCGGCTTG CACCGGGCTA TCGTCCCCTC TGGCGCCTCT ACCGGTCCGT CCCGACCATC CGTCTCCCCT TGCCGAAACA
+2 His Glu Ala Val Glu Leu Arg Asp Gly Asp Lys Ala Lys Trp Ala Gly Lys Gly

161 GCATCGTAAC CGATTGTCAC AGGTCAGCAT GAAGCTGTTG AGCTCCGCGA TGGCGACAAG GCCAAATGGG CTGGCAAGGG
+2 Gly Val Thr Gin Ala Val Ala Asn Val Asn Thr Val lie Gly Pro Ala Leu lie Lys Glu Asn Leu Asp Val Lys Asp Gin Ser

241 TGTCACCCAG GCCGTCGCCA ACGTTAACAC TGTCATTGGC CCTGCTCTGA TTAAGGAGAA TCTTGATGTG AAAGACCAGT
+2 Ser Lys Val Asp Glu Phe Leu Asn Ser Leu Asp Gly Thr Pro Asn Lys Gly Lys Leu Gly Ala Asn Ala lie Leu Gly Val

321 CCAAGGTTGA CGAGTTCCTT AACTCTCTCG ATGGAACTCC CAACAAGGGT AAGCTTGGCG CCAACGCCAT CCTCGGTGTG
+2 Ser Leu Ala Val Ala Lys Ala Gly Ala Ala Glu Lys

401 TCATTGGCCG TTGCCAAGGC TGGTGCCGCT GAAAAGGTAA GTGCATCGCG TTGTCTAGGC TGGCGCCTAC CGTGTAGATC
+2 Val Pro Leu Tyr Ala His lie Ser Asp Leu Ala Gly Thr Lys Lys Pro Tyr Val

481 AGAAGACAAA TTAACCGAAT CCTAGGGTGT CCCTCTCTAC GCTCATATTT CAGACCTGGC TGGTACTAAG AAGCCATACG
+2 Val Leu Pro Val Pro Phe Met Asn Val Leu Asn Gly

561 TTCTCCCCGT TCCTTTCATG AACGTTCTTA ACGGCGGGTA AGTTGCCAAA GTAACGCAAT GTATGCAACA TCGCTAATCA
+2 Ser His Ala Gly Gly Arg Leu Ala Phe Gin Glu Phe Met lie Val Pro

641 TTATAAAGCT CCCACGCTGG TGGCCGCCTT GCTTTTCAGG AGTTCATGAT TGTTCCCTCG TACGTGTCTC GAGTAGATCC
+1 Glu Ala Ala Ser Phe Thr Glu Ala Met Arg Gin Gly Ala Glu Val Tyr

721 AGCGATGTGA ATGCAAGTTA ACTCGAACAC AGTGAGGCTG CAAGCTTCAC CGAGGCCATG CGCCAGGGTG CTGAGGTCTA
+1 Tyr Gln Lys Leu Lys Ser Leu Ala Lys Lys Lys Tyr Gly Gin Ser Ala Gly Asn Val Gly Asp Glu Gly Gly Val Ala Pro Asp

801 CCAGAAGCTC AAGAGTCTCG CCAAGAAAAA GTACGGCCAG TCCGCTGGCA ACGTTGGTGA TGAGGGCGGT GTTGCCCCTG
+1 Asp lie Gin Thr Ala Asp Glu Ala Leu Asp Leu lie Val Glu Ser lie Glu Gin Ala Gly Tyr Thr Gly Lys lie Lys lie

881 ATATCCAGAC CGCCGACGAG GCTCTCGACC TCATCGTGGA GTCCATCGAA CAGGCTGGCT ACACCGGCAA GATCAAGATT
+1 Ala Met Asp Val Ala Ser Ser Glu Phe Tyr Lys Thr Glu Glu Lys Lys Tyr Asp Leu Asp Phe Lys Asn Pro Glu Ser Asp

961 GCCATGGATG TTGCTTCCAG CGAGTTCTAC AAGACCGAAG AGAAAAAGTA CGATCTTGAC TTCAAGAACC CTGAAAGTGA
+1 Asp Pro Thr Gin Trp Leu Thr Tyr Glu Gin Leu Ala Ala Leu Tyr Gly Asp Leu Cys Lys Lys Tyr Pro lie Val Ser lie Glu

1041 CCCAACCCAG TGGCTCACCT ATGAGCAGCT TGCTGCTCTC TACGGTGACC TCTGCAAGAA GTATCCTATT GTCTCCATCG
+1 GluAsp Pro Phe Ala Glu Asp Asp Trp Glu Ala Trp Ser Tyr Phe Tyr Lys Thr Gin Asp lie Gin lie Val Gly Asp Asp

1121 AAGACCCCTT CGCCGAGGAT GATTGGGAGG CCTGGAGCTA CTTCTACAAG ACTCAGGATA TTCAGATTGT CGGTGATGAT
+1 Leu Thr Val Thr Asn Pro Leu Arg lie Lys Lys Ala lie Glu Leu Lys Ala Cys Asn Ala Leu Leu Leu Lys Val Asn Gin

1201 CTGACTGTCA CCAACCCCCT CCGCATCAAG AAGGCTATCG AGCTCAAGGC TTGCAATGCC CTTCTCCTTA AGGTCAATCA
+1 Gin lie Gly Thr Leu Thr Glu Ser lie Gin Ala Ala Lys Asp Ser Tyr Ala Asp Gly Trp Gly Val Met Val Ser His Arg Ser

1281 GATCGGTACC CTGACCGAAT CTATTCAGGC CGCCAAGGAC TCCTACGCCG ACGGTTGGGG TGTCATGGTG TCCCACCGCT
+1 SerGly Glu Thr Glu Asp Val Thr lie Ala Asp lie Val Val Gly lie Arg Ser Gly Glu lie Lys Thr Gly Ala Pro Cys

1361 CTGGTGAGAC CGAGGACGTC ACAATTGCTG ACATCGTTGT GGGTATCCGC TCTGGCGAGA TCAAGACTGG TGCTCCTTGT
+1 Arg Ser Glu Arg Leu Ala Lys Leu Asn Gin lie Leu Arg lie Glu Glu Glu Leu Gly Asp Leu Ala Val Tyr Ala Gly Cys

1441 CGCTCTGAGC GTCTGGCCAA ACTTAACCAG ATTCTCCGCA TTGAAGAGGA GCTTGGCGAT CTGGCTGTCT ACGCCGGTTG
+1 CysAsn Phe Arg Asn Ala Val Asn Gin *

1521 TAACTTCCGC AACGCTGTCA ATCAGTAA


Figure 3-3. Genomic nucleotide sequence and amino acid translation of bbenol.








62



+1 Met Lys Thr Pro Ser Phe Leu Leu Ala Leu Ala Ala Pro Gly Leu Met Ala Ser Pro Leu Ala Ala Glu Lys Ala Thr Pro-
1 ATGAAGACAC CGASCTTTCT ACTTGCGCTT GCTGCCCAG GGCTCATOGC CTCTCCCCTC GCCGCGGAAA AGGCAACGCC
+1 -Pro Thr Glu Leu Val Thr Thr Pro Thr Ala Thr Pro Lys Ala Glu Ala Tyr Asn Trp Ser Asp Gly Trp Glu Gin Ser Phe Pro
81 AACAGAACTG GTCACTACGC CGACTGCAC CCCCAAUGCA GAGGCTTACA ACTGGTCTGA TGGTTGGGAG CAGTCGTTCC
+1 -Pro lie His Ser Ser Cys Asn Ser Thr Leu Arg Ala Gin Leu Gin Thr Gly Leu Asp Asp Ala Val Gin Leu Ala Gin His
161 CCATCCACTC GTCCTGCAAC AGCACGTTAC GCGCGCAGCT TCAGACCGGC CTCGACGACG CTGTGCAGCT GGCCAGCAT
+1 Ala Arg Asn His lie Leu Arg Phe Gly Ser Lys Ser Glu Phe Val Gin Lys Tyr Phe Gly Asn Gly Ser Leu Ala Glu Pro-

241 GCTAAGAAACC ACALTCTGCG TTTCGGAAGC AAGTCGGAAT TTGTGCASAA ATACTTTGGC AACGGCTCCC TCGCGGOSACC
+1 Pro lie Gly Trp Tyr Asp Arg Val Val Ala Ala Asp Lys Ala Ala Met Thr Phe Arg Cys Asp Asp Pro Asp Lys Asn Cys Aa
321 CATTGGCTGG TAGATCGTG TTGTCGCA~C AGACAAGCC GCCATGACCT TTCaGTGCGA TGATCCOCQAC AAGAATTOC
+3 Trp Gly Gly
+1 Ala Ser Lys Pro
401 CGTCGAAACC AAGTAGGTGA AACTGCCTCA ATAGCAAGGA AATATGAGAC AACTGACAAT GATATTTATA GCTTOGGGQA
+3 -GIS His Trp Arg Gly Ser Asn Ala Thr Glu Glu Thr Vai lie Cys Pro Leu Ser Phe Gin lie Arg Arg Pro Leu Ser Ser
481 GCCATTGGCG AGGATCAAAT GCTACGGAAG AAACTGTCAT CTGCCCCCTG TCATTCCAGA TCCGACGCCC ACTCTCATCG
+3 Val Cys Asn Leu Gly Tyr Thr Val Ala Gly Ser Pro Leu Asn Thr lIe Trp Ala Val Asp Leu Leu His Arg Met Phe His
561 GTTTGCAACC TTGGCTATAC TGTCGCGGGA TCTCCTCTAA ACACGATTTG GGCCGTCGAC CTCCTGCATC GAATGTTTCA
+3 His Val Pro Thr lie Asn Val Asn Thr Val Asp His Phe Ala Asp Asp Tyr Asn Gly lie Leu Ala Leu Ala Lys Lys Asp Pro
641 CGTCCCGACA ATCAATGTTA ATACAGTOGA TCATTTTGCG GACGATTACA ATIGCATTCT GGCGTTXGC AAAAAGACC
+3 -Pro S Lys Ser Ala Lys Asp Ser Asn Val Lu Gin Tyr Phe Ala lie Asp Val Trp Ala Tyr Asp Val Ala Ala Pro Gly
721 CATCCAAGAG TGCCAAAGAT AGCAACGTGC TCCAGTATTT TGCCATTGAT GTTTGGGCGT ACGATGTCGC AGCCCCCGGA
+3 Val Gly Cys Thr Gly Lys Leu Arg Arg Ser Gin Arg Leu Asn
801 GTTGGATGCA CTGGCAAGCT GCGGAGAAGT CAAAGGCTTA ATTAA

Figure 3-4. Genomic nucleotide sequence and amino acid translation of bbf2.









63




+1 Met Thr Leu Thr Val Gin Leu Ser Thr Pro Ala Thr Gly Lys Tyr Asp Gin Pro lie Gly Leu

1 ATGACTTTGA CAGTGCAGCT ATCTACGCCC GCTACGGGCA AATATGACCA GCCAATTGGC CTGTAAGTTG TCGTTGCGTG

81 TTGTCTTCTC CGCACGCCCG ACCGGCCATG CGCCGCTTAC ACTACCCCGC CCCCGCGATT TCTTGACTAA CACAAACCTC
+2 lie Asn Asn Glu Trp Val Glu Gly Val Asp Lys Lys Lys Phe Glu Val lie Asn Pro Ser Thr Glu Glu

161 CCCTATAGGT TTATCAACAA CGAGTGGGTT GAGGGTGTCG ATAAGAAAAA GTTTGAAGTC ATCAACCCCT CTACCGAGGA
+2 Glu Val lie Thr Ser Val Cys Glu Ala Thr Glu Lys Asp Val Asp Leu Ala Val Ala Ala Ala Arg Lys Ala Phe Glu Thr Thr

241 GGTCATCACC TCTGTCTGCG AAGCTACCGA GAAGGATGTC GACCTCGCCG TCGCCGCCGC CCGCAAGGCC TTCGAAACCA
+2 ThrTrp Lys Glu Thr Thr Pro Ala Glu Arg Gly Val Leu Met Asn Lys Leu Ala Asp lie Ala Glu Lys Asn Thr Asp Leu

321 CTTGGAAGGA AACGACCCCG GCGGAACGCG GCGTGTTGAT GAACAAACTC GCCGACATTG CCGAGAAGAA CACCGACCTC
+2 Leu Ala Ala Val Glu Ser Leu Asp Asn Gly Lys Ser lie Thr Met Ala Lys Gly Asp Val Gly Ala Val Val Ala Cys lie

401 CTCGCCGCTG TCGAGTCTCT CGACAATGGC AAGTCCATCA CCATGGCCAA GGGCGATGTT GGCGCAGTCG TCGCCTGCAT
+2 IleArg Tyr Tyr Ala Gly Trp Ser Asp Lys lie His Gly Lys Thr Val Asp Val Ale Pro Asp Met His His Tyr Val Thr Lys

481 CCGCTACTAT GCCGGCTGGT CCGACAAGAT CCACGGCAAA ACTGTCGACG TCGCCCCCGA CATGCACCAC TACGTCACGA
+2 Lys Glu Pro
+1 lie Gly Val Cys Gly

561 AGGAGCCTGT ACGTACAATG ATCAGCCTCA GTACAAGTAC GGGTCGAAAT GCTAACTACG AATATAGATT GGTGTCTGCG
+1 Gly Gn lie lie Pro Trp Asn Phe Pro Leu Leu Met Leu Ser Trp Lys lie Gly Pro Ala Leu Ala Thr Gly Asn Thr lie

641 GTCAGATCAT TCCCTGGAAC TTCCCTCTTC TCATGCTTTC CTGGAAGATT GGCCCTGCCC TGGCCACTGG CAACACCATC
+1 Val Met Lys Thr Thr Glu Gin Thr Pro Leu Ser Ala Leu Val Phe Ala Gin Phe Val Lys Glu Ala Gly Phe Pro Pro Gly

721 GTCATGAAGA CTACTGAGCA GACTCCCCTC TCTGCCCTCG TCTTTGCCCA ATTTGTCAAG GAAGCTGGCT TCCCTCCTGG
+1 Gly Val Phe Asn Leu lie Ser Gly Phe Gly Lys Thr Ala Gly Ala Ala Leu Ser Ale His Met Asp Val Asp Lys lie Ala Phe

801 TGTTTTCAAC TTGATCTCTG GTTTCGGCAA GACCGCCGGT GCCGCCCTCT CCGCTCACAT GGACGTAGAC AAGATCGCTT
+1 Phe Thr Gly Ser Thr Leu lie Gly Arg Thr lie Leu Lys Ala Ala Ala Ser Ser Asn Leu Lys Lys Val Thr Leu Glu Leu

881 TCACCGGTTC CACCCTCATC GGCCGCACCA TCCTCAAAGC TGCTGCTTCC TCCAACCTCA AGAAGGTCAC TCTTGAGCTC
+1 Gly Gly Lys Ser Pro Asn lie Val Phe Asn Asp Ala Asp lie Glu Ser Ala lie Ser Trp Val Asn Phe Gly lie Tyr Tyr

961 GGTGGCAAGT CCCCCAACAT CGTCTTCAAT GATGCCGATA TTGAGTCTGC CATCTCCTGG GTCAATTTCG GCATCTACTA
+1 TyrAsn His Gly Gin Cys Cys Cys Ala Gly Thr Arg lie Phe Val Gin Glu Gly lie Tyr Asp Lys Phe Leu Glu Ala PheLys

1041 CAACCACGGT CAGTGCTGCT GTGCTGGTAC TCGCATCTTT GTCCAGGAGG GCATTTACGA CAAGTTCCTC GAGGCTTTCA
+1 Lys Lys Arg Ala Ala Ala Asn Thr Val Gly Asp Pro Phe Asp Thr Lys Thr Phe Gin Gly Pro Gin Val Ser Lys Leu Gin

1121 AAAAGCGCGC TGCCGCCAAC ACTGTCGGTG ACCCCTTTGA CACCAAAACT TTCCAGGGTC CTCAGGTCAG CAAGCTCCAG
+1 Tyr Asp Arg lie Met Ser Tyr lie Gin Ser Gly Lys Glu Glu Gly Ala Thr Val Glu lie Gly Gly Glu Arg His Gly Asp

1201 TACGACCGCA TCATGAGCTA CATCCAGTCT GGCAAGGAAG AGGGTGCCAC TGTCGAGATC GGTGGTGAGC GTCACGGCGA
+1 Asp Lys Gly Phe Phe lie Lys Pro Thr lie Phe Ser Asn Val Arg Ser Asp Met Lys lie Met Gin Glu Glu lie Phe Gly Pro

1281 CAAGGGCTTC TTCATCAAGC CCACCATCTT CTCCAACGTT CGCTCCGACA TGAAGATTAT GCAGGAGGAG ATCTTCGGCC
+1 Pro Val Cys Ser lie Ser Lys Phe Ser Thr Glu Glu Glu Val lie Lys Leu Gly Asn Glu Thr Thr Tyr Gly Leu Ala Ala

1361 CCGTCTGCTC CATCTCCAAG TTCTCCACCG AGGAGGAGGT CATCAAGCTT GGCAACGAGA CCACCTACGG TCTCGCCGCT
+1 Ala Val His Thr Lys Asp Leu Asn Thr Ser lie Arg Val Ser Asn Ala Leu Lys Ala Gly Thr Val Trp Val Asn Cys Tyr

1441 GCCGTTCACA CCAAGGATCT CAACACCAGC ATTCGTGTCA GCAACGCCCT CAAAGCTGGT ACCGTCTGGG TCAACTGCTA
+1 TyrAsn Leu Leu His Ala Ser Val Pro Phe Gly Gly Phe Lys Glu Ser Gly lie Gly Arg Glu Leu Gly Glu Ala Ala Leu Asp

1521 CAACCTTTTG CACGCCTCGG TTCCCTTTGG AGGCTTCAAA GAGTCTGGAA TCGGTCGTGA ATTGGGTGAA GCGGCCCTCG
+1 AspAsn Tyr Leu Gin Thr Lys Ser Val Thr Val Arg Leu Gly Gly Pro Met Phe Gly

1601 ATAACTATCT ACAGACAAAG TCAGTCACTG TCCGTCTGGG AGGCCCAATG TTCGGATAG

Figure 3-5. Genomic nucleotide sequence and amino acid translation of bbald.









64



+1 Met Arg Ser Gin Ser Leu Ser Ser Gly Leu u L Leu Trp Leu Ala Thr Ala Ser Glu Leu Gly Ala Ala Ala Val Lys Val

1 ATGCGTTCTC AGTCATTGTC CTCTGGTTTG CTGCTTTGGC TGGCCACTGC CAGCGAACTC GGGGCTGCTG CCGTCAAGGT
+1 ValAsn Pro Leu Pro Ala Pro Gin Glu lie Thr Trp Gly Ser Ser Gly Pro lie Pro Val Gly Tyr Leu Ser Leu Arg Ala Val

81 GAACCCACTG CCGGCGCCCC AAGAAATCAC CTGGGGCTCC TCGGGCCCCA TTCCCGTCGG GTACCTGTCG CTTCGTGCCG
+1 VaAsn Ala Ser Trp Gly Thr Gin Asp Asn Val Arg lie Val Ser Glu Ala Trp Asn Arg Ala His Gly Ala lie Arg Thr
161 TCAACGCCAG CTGGGGCACT CAGGACAATG TCAGAATTGT CAGTGAAGCG TGGAATCGCG CTCACGGTGC CATAAGAACC
+1 lie Arg Trp Val Pro Gin Ala Val Glu Gin Pro lie Pro Glu Phe Glu Pro Phe Pro Gly Arg Asn Thr Thr Ser Asn Ser

241 ATTCGTTGGG TTCCTCAGGC TGTTGAGCAG CCTATCCCCG AGTTTGAACC CTTTCCTGGT CGAAACACCA CAAGCAACAG
+1 SerLys Arg Ala Glu Ala Gin Ala Gly Asp Ala Glu Ala Pro Ser Ala Ser Ala Ser Ala Pro Ser Ala Ser Ala Pro Ser Ala
321 CAAGCGCGCT GAAGCGCAGG CTGGTGATGC AGAAGCACCA TCAGCTTCCG CATCAGCACC ATCAGCTTCA GCACCATCAG
+1 Ala Ser Ala Pro Ser Ala Ser Ala Pro Ala Asn Gin Asn Ser Arg Trp Leu Asn Glu lie Ser Val Gin Val Glu Asp Trp
401 CTTCAGCACC ATCAGCTTCC GCACCCGCTA ATCAAAACTC CCGATGGCTC AATGAGATTA GCGTACAGGT TGAGGACTGG
+1 Glu Ala Asp Leu Lys His Gly Val Asp Glu Ser Tyr Thr Leu Asn lie Ala Ser Ser Ser Ser Gin Val Gin lie Thr Ala

481 GAAGCCGATC TCAAGCACGG CGTGGATGAA AGCTATACAC TCAACATTGC CTCGTCTTCT TCCCAGGTCC AAATCACTGC
+1 Ala Lys Thr Ser Trp Gly Ala Leu His Ala Phe Thr Thr Leu Gin Gin lie lie lie Ser Asp Gly His Gly Gly Leu MetVal

561 CAAGACGTCC TGGGGTGCTC TTCACGCCTT CACCACTCTG CAGCAGATTA TTATTTCCGA CGGCCACGGT GGACTCATGG
+1 Va Glu Gin Pro Val Glu lie Lys Asp His Pro Asn Tyr Pro Tyr Arg Gly Val Met Val Asp Ser Gly Arg Asn Phe lie
641 TTGAACAGCC TGTTGAGATC AAGGATCACC CAAACTACCC TTACCGCGGT GTCATGGTTG ATTCTGGCCG CAACTTCATC
+1 Ser Val Gin Lys Leu Gin Glu Gin lie Asp Gly Leu Ala Leu Ser Lys Met Asn lie Leu His Trp His lie Thr AspAla

721 TCTGTCCAAA AGCTACAAGA GCAGATCGAC GGACTTGCCC TGTCCAAGAT GAACATTCTC CACTGGCACA TCACTGACGC
+1 Ala Gin Ser Trp Pro lie His Leu Asp Ala Leu Pro Asp Phe Thr Lys Asp Ala Tyr Ser Glu Arg Glu lie Tyr Ser Ala Gin

801 CCAGTCCTGG CCTATCCATC TCGATGCTTT GCCCGACTTT ACCAAGGACG CCTATTCCGA GCGGGAGATA TATTCTGCGC
+1 GlnAsn Val Lys Asp Leu lie Ala Tyr Ala Arg Ala Arg Gly Val Arg Val Val Pro Glu lie Asp Met Pro Gly His Ser
881 AGAATGTTAA AGACCTCATT GCATACGCGC GCGCCCGCGG TGTACGCGTT GTGCCCGAGA TTGACATGCC TGGCCACTCG
+1 Ala Leu Gly Trp Gin Gin Tyr Asp Asn Asp lie Val Thr Cys Gin Asn Ser Trp Trp Ser Asn Asp Asn Trp Pro LeuHis-

961 GCTTTGGGAT GGCAGCAATA CGACAACGAC ATCGTCACTT GCCAGAATAG CTGGTGGTCC AATGACAACT GGCCCCTCCA
+1 His Thr Ala Val Gin Pro Asn Pro Gly Gin Leu Asp Val Leu Asn Pro Lys Thr Tyr Gin Ala Val Glu Lys Val Tyr Ala Glu

1041 CACTGCCGTG CAGCCCAACC CCGGTCAGCT CGATGTCCTC AACCCCAAGA CGTACCAGGC TGTGGAAAAG GTCTACGCGG
+1 Glu Leu Ser Gin Arg Phe Ser Asp Asp Phe Phe His Val Gly Gly Asp Glu Leu Gin Val Gly Cys Phe Asn Phe Ser Lys

1121 AGCTGTCTCA ACGATTCTCC GATGACTTTT TCCATGTTGG TGGCGATGAG CTACAGGTTG GCTGCTTCAA CTTTAGCAAG
+1 Thr lie Arg Asp Trp Phe Ala Ala Asp Ser Ser Arg Thr Tyr PheAsp Leu Asn Gin His Trp Val Asn Thr Ala MetPro

1201 ACTATTCGTG ACTGGTTTGC TGCAGACTCT AGCCGAACCT ACTTTGACCT GAACCAGCAC TGGGTCAATA CGGCCATGCC
+1 Pro lie Phe Thr Ser Lys Asn lie Thr Gly Asn Lys Asp Arg Arg lie Val Met Trp Glu Asp Val Val Leu Ser Pro Asp Ala
1281 CATCTTCACC AGCAAGAATA TAACTGGAAA CAAGGACCGC CGTATTGTCA TGTGGGAAGA CGTTGTTCTG TCCCCAGATG
+1 Ala Ala Ala Lys Asn Val Ser Lys Asn Val lie Met Gin Ser Trp Asn Asn Gly lie Thr Asn lie Gly Lys Leu Thr Ala

1361 CCGCTGCAAA GAATGTCTCC AAAAACGTCA TTATGCAGTC CTGGAACAAC GGCATCACTA ATATTGGCAA ACTGACCGCG
+1 Ala Gly Tyr Asp Val lie Val Ser Ser Ala Asp Phe Leu Tyr Leu Asp Cys Gly Phe Gly Gly Tyr Val Thr Asn AspAla

1441 GCGGGCTACG ATGTTATTGT TTCCAGCGCC GACTTCCTCT ACCTCGATTG CGGCTTCGGC GGCTACGTTA CCAACGACGC
+1 Ala Arg Tyr Asn Val Gin Glu Asn Pro Asp Pro Thr Ala Ala Thr Pro Ser Phe Asn Tyr Gly Gly Asn Gly Gly Ser Trp Cys

1521 CCGCTACAAC GTTCAGGAGA ACCCCGATCC CACTGCGGCC ACCCCCTCGT TCAACTACGG CGGCAATGGC GGTTCTTGGT
+1 CysAla Pro Tyr Lys Thr Trp Gin Arg lie Tyr Asp Tyr Asp Phe Ala Lys Asn Leu Thr Ala Ala Gin Ala Lys His lie

1601 GCGCTCCTTA CAAGACTTGG CAGCGCATCT ACGACTATGA CTTTGCCAAG AATCTGACCG CGGCACAAGC CAAGCACATT
+1 lie Gly Ala Ser Ala Pro Leu Trp Ser Glu Gin Val Asp Asp Thr lie lie Ser Gly Lys Met Trp Pro Arg Ala AlaAla

1681 ATTGGTGCCT CTGCCCCTCT TTGGTCAGAG CAGGTCGATG ACACCATCAT CAGCGGCAAG ATGTGGCCCC GTGCCGCCGC
+1 Ala Leu Gly Glu Leu Val Trp Ser Gly Asn Arg Asp Pro Lys Thr Gly Lys Lys Arg Thr Thr Ser Phe Thr Gin Arg lie Leu

1761 CCTCGGTGAG CTCGTCTGGT CGGGTAACAG AGACCCAAAG ACGGGCAAGA AGCGCACCAC TTCTTTCACG CAGCGCATTC

+1 LeuAsn Phe Arg Glu Tyr Leu Val Ala Asn Gly lie Gly Ala Thr Ala Leu Val Pro Lys Tyr Cys Leu Gin His Pro His

1841 TCAACTTTAG AGAGTACCTC GTCGCCAACG GTATTGGGGC AACTGCCTC GTACCAAAGT ACTGTCTTCA GCATOCTCAC
+1 Ala Cys Asp Leu Tyr Tyr Asp Gin Asp Ala Val Lys "

1921 GCATGCGATC TTTACTATGA CCAAGACGCT GTGAAATAG

Figure 3-6. Genomic nucleotide and amino acid sequence of bbhex.










MW
(kDa)
97-
64-
51-

39-

28-

19-

14-


5 6 7 8 9 10


Figure 3-7. SDS-PAGE gel of unfractioned uninduced and induced expression cultures,
and stained with Coomasie Blue. Lane (1) BbEnol uninduced, (2) BbEnol
induced, (3) BbF2 uninduced, (4) BbF2 induced, (5) BbAld uninduced, (6)
BbAld induced, (7) BbHex uninduced, (8) BbHex induced, (9) uninduced
unmodified pET vector and (10) induced unmodified pET vector.


MW (a)
(kDa)1
191-


(b)
2 3 1


(c)
2 3 4 1


N


97-
64-
51-
39-

28-

14-


a


S


a


a -
a a _


a


* a


Figure 3-8. Coomasie Blue stained 12% SDS-PAGE gel. Lane (1) BbEnol pellet
fraction, (2) BbF2 pellet fraction, (3) BbAld pellet fraction, and (4) BbHex
pellet fraction. Proteins treated with lx LDS sample buffer and incubated at
95C for (a) 1 minute, (b) 5 minutes, and (c) 20 minutes.


2 3 4


1 2 3 4










3 4 5


K-T
1 2


3 4 5


Figure 3-9. Immunoblot: panels designated according to the sera in the pool it was
probed with. 10 sera per pool, final concentration of each serum (1:35). Lane
(1) BbEnol induced sample, (2) BbF2 induced sample, (3) BbAld induced
sample, (4) BbHex induced sample, and (5) 40 gg crude B. bassiana extract.



MW AB CD EF GH IJ
(kDa) 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3
97-
64-
51-

39-

28-

19-

14-

Figure 3-10. Immunoblot panels are designated according to the sera in the pool it was
probed with. 2 sera per pool, final concentration of each serum (1:5). Lane 1-
3, induced culture (unfractioned) (1) BbEnol sample (2) BbF2 sample (3)
BbAld sample.


A-J
1 2


MW
(kDa)
191-

97-

64-
51-

39-

28-











1 2 3 4 5 6 7 8


91- 3
97-
64-S


am


--


e a~ -


a


19_L g --
0-aO~


(kDa)
(kDa)


Figure 3-11. 10%SDS-PAGE gel stained with Coomasie. (1) BbEnol induced soluble
fraction; (2) BbEnol induced pellet fraction; (3) BbF2 induced soluble; (4)
BbF2 induced pellet fraction; (5) BbAld induced soluble; (6) BbAld induced
pellet fraction; (7) BbHex induced soluble; (8) BbHex induced pellet fraction;
(9) BbHex uninduced soluble; (10) BbHex uninduced unfractioned; (11)
BbHex uninduced pellet fraction.


MW
(kDa)


(ABCD)
1 2


97-
64-
51-

39-

28-

19-


(AB)
4 u i s p


~11~


(CD)
u i sp



-4


14-- .

Figure 3-12. Immunoblots probed with pooled sera final dilution of each serum in each
pool (1:10). Panals are labeled according to screening pool. Lane (1) BbEnol
induced unfractioned, (2) BbF2 induced unfractioned (3) BbEnol uninduced
unfractioned, (4) BbHex induced unfractioned. (u) BbEnol uninduced
unfractioned, (i) BbEnol induced unfractioned, (s) BbEnol induced soluble
fraction, (p) BbEnol induced pellet fraction.


91011





o -


1


51-

39-


28-









MW
(kDa)

97-

64-

51-


39-


OP QR ST


AB CD GH IJKL MN


aw


28-
Figure 3-13. Immunoblots of BbAld protein strips probed with 1 mL of sera pool. Each
pool contained two sera (final dilution 1:5 each sera) lanes are label according
to the sera in the pool it was probed with.


(1) (A) (B)
12 4 1 2 1 4 1 2 4 4


Figure 3-14. Immunoblots of B. bassiana proteins (pellet fraction). Lane (1) BbEnol,
(2) BbF2, (3) BbAld, and (4) BbHex; panel (1) PVDF membrane stained with
Ponceaus S; panel (A) blot treated with serum A (1:5) as primary antibody;
panel (B) blot treated with serum B (1:5) as primary antibody.


4-











1.00
1.00- Neocallimastix frontalis

1.00 Drosophila melanogaster

1.00 Hevea brasiliensis*

1.00
10.00 Cladosporium herbarnumt

1.00 1.00
1. Alternaria alterata*

-1.00 Curvularia lunata

1.00 Aspergillus oryzae

1.00
Aspergillus fumigatus"

1.0_ 0.99 1.00 Aspergillus nidulans

-1.00 Penicillium chrysogenum

1.00
1 0- Penicillium citrnum*

1.00
0.98 1.0 Beauveria bassiana*
0.98
1.00
1.00 Neurospora crassa

0.9- Cryphonectria parasitica

1.00 Rhodotorula rubra*

1. 0 Candida albicans*

1.00. Kluyveromyces lactis


1.00 1.00 Ashbya gossypii
1. 0 Candida glabata

1.00 1.00
Saccharomyces cerevisiae*
1.0O0 Debarymyces hansenii

1.00 Schizosaccharomyces pombe

1.00 .
1.0-0 L-Escherichia coli

1.00
Cunninghamella elegans


Figure 3-15. Enolase phylogram, numbers at nodes are posterior probabilities values
greater than or equal to 90%. Species that produce an enolase known to be
allergenic are denoted by an asterisk.









Table 3-5. Enolase accession numbers


Species
Alternaria alternate
Ashbya gossypii
Aspergillus fumigatus
Aspergillus nidulans
Aspergillus oryzae
Beauveria bassiana
Cladosporium herbarum
Candida albicans enolase
Candida glabrata
Cryphonectria parasitica
Cunninghamella elegans
Curvularia lunata
Debaryomyces hansenii
Drosophila melanogaster
Escherichia. coli
Hevea brasiliensis
Kluyveromyces lactis
Neocallimastix frontalis
Neurospora crassa
Penicillium chrysogenum
Penicillium citrinum
Rhodotorula rubra
Saccharomyces cerevisiae
Schizosaccharomyces pombe


Accession number
U82437
Q756H2
AF284645
XM 658258
D64113
DQ767719
X78226
L04943
Q6FTW6
Q6RG04
074286
AY034826
Q6BTB1
NM 164434
POA6Q1
Q9LEJO
AJ586240
P42894
XM 323160
AB091508
AF254643
Q870B9
J01323
P40370














CHAPTER 4
CONCLUSIONS

In industrialized nations, allergic disease is a growing health concern with

symptoms ranging from atopic hay fever (sneezing, itching, and coughing) to chronic

disease even death. Allergens produced by filamentous fungi contribute to symptoms in

all three categories, and therefore pose a human health threat independent of

pathogenicity or virulence. Angioedema, hypersensitivity pneumonitis, sinusitis, and

asthma are example of serious acute and chronic allergen induced diseases caused by

fungi without actual infection.

Beauveria bassiana is an entomopathogenic fungus currently used as a biological

pesticide and studied as a potential tool for controlling the spread of insect borne diseases

(Geetha and Balaraman, 1999; Haraprasad N, 2001; Scholte et al., 2005; Shah and Pell,

2003). B. bassiana was tested and approved for commercial use by the U.S.

Environmental Protection Agency after tests showed that B. bassiana does not pose a

threat of infection to humans or other vertebrates (EPA, 2000). Although not a threat as

an infectious disease, B. bassiana is a filamentous fungus that may pose a health concern

as an allergen; this is especially true for individuals working directly with the fungus in

an industrial or agricultural setting, where aerial conidia concentration would be highest.

Human sera and immunoblot analysis were used to study the ability of B. bassiana

to react with human IgE in order to gauge the validity of the following hypothesis: B.

bassiana is a filamentous fungus capable of initiating an IgE-mediated hypersensitive

response in humans; a response mediated by specific IgEs due to direct sensitivity









developed towards B. bassiana allergens, or epitope recognition of a B. bassiana

antigen(s) by specific IgEs produced in response to another species of fungus (cross-

reactivity) (Aukrust and Borch, 1985).

To this point in our study, we revealed that B. bassiana produces many IgE reactive

proteins, ranging from 12 kDa to >95 kDa, with the most prominent antigens at 35, 42-

52, and 60-64. Immunoblots place the allergenic proteins BbEnol and BbAld in the

region of 42-52 kDa and are suspected to be the cause of IgE reactivity in this region.

Continued research will concentrate on confirming the role these proteins play in B.

bassiana hypersensitivity, as well as identifying the remaining major allergenic proteins

produced by B. bassiana.

Allergenicity of Beauveria bassiana

Proteins produced by B. bassiana were probed by human sera, and tested for the

binding of sera IgEs. Experiments resulted in clear reactivity between extract proteins

and human IgE. Reactive proteins bands varied in size and intensity, with the strongest

bands at 35, 42-52, and 60-64 kDa. Western blots probed with individual sera

confirmed that antibody-antigen interactions are the result of specific recognition of B.

bassiana proteins by sera IgEs. Although common bands can be seen between

individuals, each serum produced a unique banding pattern due to the variation in

reactive IgEs. The most common band was located at 35 kDa band, which was present in

6 of the 10 sera showing IgE reactive. Only two sera had the identical reaction to B.

bassiana, both patients displayed reaction to the 35 kDa protein alone. Of the individual

serum tested, 13 came from patients with known fungal allergies; all had tested positive

for allergic reactions to at least two other species of fungi. Of these 13 patients, 8 sera

tested positive for IgE binding to B. bassiana proteins.









To address the issue of cross-reactivity, competitive inhibition experiments showed

that B. bassiana shared several allergenic epitopes with other common allergenic fungi.

Although no single fungus removed all bands, Alternaria and Epicoccum shared the most

allergenic epitopes. No fungus removed the 35 kDa band which may represent direct

sensitivity to B. bassiana. Skin tests confirm the ability of B. bassiana proteins to elicit

an IgE specific allergic response.

Characterization of Allergens

Screening of EST and SSH libraries (Holder, 2005), revealed proteins with

sequence similarity to major fungal allergens; the proteins were cloned and designated

BbEnol, BbF2, BbAld, and BbHex. Of the four, BbEnol was of particular interest due

to its sequence similarities to a highly cross-reactive group of fungal enolases. Of the

twenty fungal enolase sequences found in the NCBI protein data base, seven have been

identified as major allergens. Fungal enolase has been called a pan-allergen, since cross

reactivity has been shown to exist between epitopes shared by at least five allergenic

fungal enolases, cross-reactivity has also been seen between fungal and plant enolases

(Breitenbach and Simon-Nobbe, 2002; Simon-Nobbe et al., 2000).

Phylogenetic comparisons of enolase sequences show that allergenic and cross-

reactive epitopes are not limited to a specific group of fungi, but are distributed

throughout the cladogram and includes Hevea brasiliensis (non-fungal enolase). For this

reason, it is likely that more of the identified enolases will prove to be allergens once

tested.

The putative B. bassiana enolase, BbEnol, was tested for allergenicity by probing

western blots with human serum. Sera came from patients with known fungal allergens,

and blots confirmed that BbEnol is recognized and bound by specific IgE(s). BbEnol









was tested with several different sera pools showing the IgE binding is specific to the

BbEnol protein and that the reaction occurs in a significant percent of the patient sera

tested. Due to the conserved nature of fungal enolases it is likely that BbEnol will prove

to be cross-reactive with IgEs from other allergenic enolases.

BbAld was also shown by Immunoblot analysis using human sera to be capable of

initiating an allergic response by binding sera IgEs. Although not as numerous as fungal

enolase, aldehyde dehydrogenases are include in the list of major and minor fungal

allergens. Alternaria alternate and Cladosporium herbarium are two fungi that posses

aldehyde dehydrogenase that are not only allergenic but also believed to be cross-reactive

(Kurup and Banerjee, 2000).

Future Experiments

We have shown that B. bassiana produces many proteins capable of initiation a

human allergic response either by cross-reactivity or by direct developed sensitivity to B.

bassiana antigens. Although we have isolated and identified two allergenic proteins,

continued work is needed to identify the remaining allergens, as well as further

characterization of BbEnol and BbAld. Future research will concentrate on three areas;

(1) the continued identification of allergens; (2) the functional and biochemical

characterization of allergens; (3) development of hypoallergenic strains.

Identifying the major allergenic proteins of B. bassiana is the primary goal of

future research. It is believed that BbEnol and BbAld are responsible, at least in part, for

the high reactive 42-52 kDa region seen in immunoblot assays. Competitive inhibition

blots using purified BbEnol and BbAld can be performed to confirm or identify the role

these proteins play in the allergenicity of this region. Identification of the remaining









major bands at 60-64 and especially the 35 kDa is important for understanding the

allergenicity of this fungus.

Once identified as allergenic, steps will to be taken to confirm the identity of the

protein. By sequence similarity BbEnol has been designated to be and enolase and

BbAld to be aldehyde dehydrogenase. Biochemical function and/or properties of

BbEnol, BbAld, and all other B. bassiana allergens that are identified, can be

confirmation by enzyme assay. Northern blots analysis can be utilized to understand

production and regulation of the identified allergens.

The identification, isolation, and characterization, of the major B. bassiana

allergens are preparatory to the production of knockout strains, which will be used to

study the effect or the importance of the proteins in fungal metabolism and virulence. If

an identified allergen carries out a redundant function then its removal may not affect its

virulence. If a knockout strains result in the loss or significant decrease in function, then

restoration of function may be obtained by complementation with non-allergenic forms of

the enzyme. B. bassiana has great potential in commercial and agricultural pest

management as well as insect borne disease control; the production and use of

hypoallergenic strains of B. bassiana could reduce the potential threat of causing acute or

chronic allergic disease.














APPENDIX
ADDITIONAL FIGURES AND TABLES



Table A-1. Taxonomy of Beauveria bassiana
Holomorph Anamorph
Kingdom Fungi
Phylum Ascomycotina
Subphylum Pezizomycotina Deuteromycota
Class Sordariomycetes Hyphomycetes
Subclass Hypocreomycetidae
Order Hypocreales Moniliales
Family Clavicipitaceae
Genus Cordyceps Beauveria
Species bassiana bassiana







Table A-2. Molecular properties ofB. bassiana genes
Gene MW Putative Function Intron Gene Gene # AA pi
product (kDa) number length length
Gen. cDNA
BbEnol 47.4 Enolase 4 1548 1317 438 5.07

BbF2 28.6 Unknown 1 845 786 261 7.64

BbAld 53.9 Aldehyde 2 1659 1494 497 5.99
dehydrogenase
BbHex 72 Hexos-aminidase 0 1959 1959 652 5.56