<%BANNER%>

Study of the Actin-Related Protein 2/3 Complex and Osteoclast Bone Resorption

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110217_AAAABK INGEST_TIME 2011-02-17T15:49:00Z PACKAGE UFE0015240_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 34613 DFID F20110217_AABHLE ORIGIN DEPOSITOR PATH hurst_i_Page_147.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
c5e7371d9c05e50f79b35b33946f3065
SHA-1
b47ca8c3d9b7a5097ee954b7d7d3851caa9d51ae
36390 F20110217_AABHKQ hurst_i_Page_135.QC.jpg
43723e07e8ffdff562d3c855a73f6f2a
1dab320ce1051db4ad74735826763f7c4cba41dd
35644 F20110217_AABGIC hurst_i_Page_117.QC.jpg
e291f3e95f0cafb9479bd4dbd94be503
b5412d1bfa6bb48d8d37a6e4c8d48038da87c4e7
3853 F20110217_AABGHO hurst_i_Page_102thm.jpg
6eda8bda806e4a2f15d150f71c37e53b
dbd4dc73224fcb0b7e3b5e9700c9b639aa3e0a26
1583 F20110217_AABGGZ hurst_i_Page_010.txt
1b733721da30047c3c9b19795726e621
ea2b4eb4652ecf2f44408cc1e70a7bf531379dd2
130160 F20110217_AABHLF hurst_i_Page_148.jpg
52997890c88daf47ce5f02d584415014
bb8a4e2a8bb7bc15d2867ad81013ed9f9fd6da33
61892 F20110217_AABGID hurst_i_Page_142.pro
cecc8ec0d75def0444989cb76d8ddc48
c6a7a4e27e16a60b7b01ddcff64321e9fac56215
37374 F20110217_AABHLG hurst_i_Page_148.QC.jpg
0b9ddfafb0c152d259ae09838e26d195
01dfae6cad9da192f84ab9f1fc6cce86007b33ea
107092 F20110217_AABHKR hurst_i_Page_136.jpg
18636176d041176bae343d6a06c54f65
c5397b9885c6cff70268a2e57becf8a1bb4ed7f9
8945 F20110217_AABGIE hurst_i_Page_076thm.jpg
4f60a186e20e62466469d22fc44e52e0
7732c099f5fbdd9a745847306cf90904c66b6413
111226 F20110217_AABGHP hurst_i_Page_020.jpg
61c7fd813d67dcf852c32e9e12eba283
0e712fd0ad0aa6bda2419322ce6b5f7c632a6357
133162 F20110217_AABHLH hurst_i_Page_149.jpg
28f4aa1424218d1661971c02fa45dd6a
069b21f3f143ef82f1d8bf82d0c286aeec16fdd3
79812 F20110217_AABHKS hurst_i_Page_137.jpg
de9f4854b4edbbc1d9a0db2b3d73c9eb
29e5f09b0c191991a4e7f27318e4f0445943ba63
116260 F20110217_AABGIF hurst_i_Page_147.jpg
4dcbc9203f06673175e47555166ce05d
2e64d1f484582c8afe9ff79e7893304d3dbf20dd
F20110217_AABGHQ hurst_i_Page_092.QC.jpg
dda8f6036272b88d65ec85c2ab49daab
c39075863c56b74e7cde46dcd96ef1e3fd45b270
37743 F20110217_AABHLI hurst_i_Page_149.QC.jpg
1b308218da2e2262902f9a4ab3cbd82e
c616994b50f3b3d2541e017822648af73998b8d5
27340 F20110217_AABHKT hurst_i_Page_137.QC.jpg
cc5a4c8472cd5087190bfd1ebbda6908
0678600e052b28c563c175a372f1e7bf9a1186d3
1474 F20110217_AABGIG hurst_i_Page_006thm.jpg
1c4ddf90eae95a272aa4382427bfd92f
2cb86f2f9cb60dda7106ffa5dca7f0130c3905fe
715420 F20110217_AABGHR hurst_i_Page_159.jp2
8e1af364ff597b7c4e9467897b824d62
0c0b27c9758008b6ea6df34cc6dde0616fe8853d
131152 F20110217_AABHLJ hurst_i_Page_150.jpg
5de7e3f7d0fb21ffabc92b04fc357010
356661a3627b08c2a5e7c811f3c4ee986be91cf6
104311 F20110217_AABHKU hurst_i_Page_138.jpg
c832d4ed3fc106f10361e6b0d0a3bacc
b2fa04ed32205ab5cf73a1f2602eac08d662595e
37641 F20110217_AABGIH hurst_i_Page_047.QC.jpg
787d767a01f987add090623a1ee4ba51
44944fcb59acd40f554f9244e3767d6c84ef7c8e
8423998 F20110217_AABGHS hurst_i_Page_019.tif
351c3ad35fca647baaecb6e3a20cee86
bcf1cb6924ab3ea2b9a5bdc2a3b37448d919a5e3
36994 F20110217_AABHLK hurst_i_Page_150.QC.jpg
23af19403ce5492b3414152edd7b3a10
d690dd322757a281f9a3dcf0af7e60327fc0af37
30015 F20110217_AABHKV hurst_i_Page_138.QC.jpg
873ad83633c536e2aade922158bd807b
1fbaaa60bf2a04461e9e6e98fa8198edafbb097a
F20110217_AABGII hurst_i_Page_017.tif
e06dc56c52cf246eae69a2fa6565d9c5
ff932a6e247229354b594eef8cf7d98577692252
34319 F20110217_AABGHT hurst_i_Page_013.QC.jpg
3ee062b768336e8b7911333e99317149
43f551bad980ba9e80813fe9ebe9fd9e51241c7e
121056 F20110217_AABHLL hurst_i_Page_151.jpg
25f048b7fa9b70c1c78210d64c9ae958
7110f11f7f711df9b24aecdbfb6a161d9126b850
33016 F20110217_AABHKW hurst_i_Page_139.QC.jpg
fef0f75cc8764dd51bf3ee86f16b4feb
abf61641570add50a2ec0f468dc41bf2a6a80332
50523 F20110217_AABGIJ hurst_i_Page_019.pro
d07694e09390ebc24677b846e62170e8
e879fb6da3eb1cf90b43c53de5964d895974a9c4
8676 F20110217_AABGHU hurst_i_Page_147thm.jpg
fc2423dc452e3d903e2f7e527bcdccb6
a89ebf102c9163f851a51438ef47f671df060aa2
888859 F20110217_AABHMA hurst_i_Page_003.jp2
78aed2bc37fe981156af8f0b712a5c87
0c1ee0cf39476e635612abc4d6261c25b3a502ec
37210 F20110217_AABHLM hurst_i_Page_152.QC.jpg
6f94db66aafa6911f396bc54e5a70cd5
6a1b7252c1a8c2c86fb4903334e6b2e8ebb8ac74
37276 F20110217_AABHKX hurst_i_Page_140.QC.jpg
298b9334a9bf55d0134a5f49b0f285d8
994474579a3b6b8ce35fbe15fb598f95da858efc
1457 F20110217_AABGIK hurst_i_Page_108.txt
be94b47e1786c6d9e00d68ef6a98aec4
22bcf58d5f20d19eb4d4abeb16d4d2853919607f
47917 F20110217_AABGHV hurst_i_Page_071.pro
f6b03c3433cc01d20882b1742bbd9f7e
f59d18b59d1764b4557cdb668e1edca16a0e9c35
639337 F20110217_AABHMB hurst_i_Page_004.jp2
e3ad7cd86cb98f8b1d37a71939e5b358
2d766d7f63b8fb540fd5ee83f47a8c84c912d7fd
133449 F20110217_AABHLN hurst_i_Page_153.jpg
c2fbb6b96f6a256ad3f69244fffdf532
2a418b6390aad0e44a2eee0cf278e46026f33108
35848 F20110217_AABHKY hurst_i_Page_141.QC.jpg
75f657df7a0e005ceed01f9439e3d9bf
f26d0fe3ae41fc2ba0a7da8373101bca0d5c44e5
5184 F20110217_AABGIL hurst_i_Page_124thm.jpg
1cc8a157fa0e673693e4076a42d0ad43
aa6ebf1191f48172a84897fd9dbe24221aecb207
90091 F20110217_AABGHW hurst_i_Page_088.jpg
8433590eab8b719a1648bb3b47b75483
68c1caeee5c674ac693961b9e1a30464ada14de4
590664 F20110217_AABHMC hurst_i_Page_005.jp2
8e6050212fa16ca174f7027cd1de7491
d81ab1bf5b9cadfad4cda5090ba67e5544b98907
38179 F20110217_AABHLO hurst_i_Page_153.QC.jpg
cf13bb8d4fccc42d5e2c2de943df85fd
cc557bd2d203e3e42839e4cecc573674b6bb60d5
136256 F20110217_AABHKZ hurst_i_Page_142.jpg
d48017448d96558de0ae7ea0c8e7cf59
592a4be7edff273d2085fc67cf27471a9d8100df
1765 F20110217_AABGIM hurst_i_Page_071.txt
b5e3c14a0d2b1fc03cc6b71221dd3650
2d4998f9f3b86b5ed29c0478977c0e14319df673
F20110217_AABGHX hurst_i_Page_096.tif
831e8776d9dd347a121a29e71b65cc3c
fbff8a4c56e7973d433000f5a1311585d8371241
13451 F20110217_AABGJA hurst_i_Page_057.QC.jpg
ed01af67793ffb1a90435a4955f10f17
968f9531dbbf88f0849975d3d197657652fed214
113806 F20110217_AABHMD hurst_i_Page_006.jp2
0875df5cb1d3ae7261dae14ddfee1829
c9c90ba5cfe3393c3664fc5162c5c8a6354e1756
142678 F20110217_AABHLP hurst_i_Page_154.jpg
a24d084a583ccc701a9c5817b2ac6dd4
042d25533f9b1893e418b23da6f063e0428d26fc
1051973 F20110217_AABGIN hurst_i_Page_020.jp2
950d7fef7b18050fdb53882c04c276aa
a85022c2caffb30d9bbf36681345074378bd3260
49167 F20110217_AABGHY hurst_i_Page_014.pro
4d0786ffcb7182d1b9688d48bd925d42
9cea2ef5aac543ede61e670c6297de9e1468bfb1
15123 F20110217_AABGJB hurst_i_Page_034.QC.jpg
32639b19ecf55fd1acc12948dc349368
b1b51d488421830f25bc8a91568bb30b02a4b7e8
900264 F20110217_AABHME hurst_i_Page_007.jp2
f09cabc64b51791ed4a380f0f05db496
c37f5b701d56cc6872f6a71527c582c05f796208
129049 F20110217_AABHLQ hurst_i_Page_155.jpg
bb48bcb1d2b431539ffcb1ed43b6d22d
fdf4cf4174d00f7e37c045be386fcb1a9c554a13
15002 F20110217_AABGIO hurst_i_Page_069.pro
623e2e0d7a4a3e6e4de34bf84e80d4d2
8820c1e6a669d61abbd471440b405c902a8ea8ec
36872 F20110217_AABGHZ hurst_i_Page_112.QC.jpg
e95aa7fe2dd0d643f202f8183db1ba2c
99cb55d1e2e31386b0f2482a7a9d132e3c352ebd
7865 F20110217_AABGJC hurst_i_Page_126thm.jpg
9965cd2320b73b4cedbf1ab60f719164
22c7f1c0f836c03e9cf4b99a15132bf86780b52f
1051966 F20110217_AABHMF hurst_i_Page_008.jp2
e7bf5bfdf8c83dc133a9ebb03f2d650a
50408c72be0d34ad25dc15b556bbe02a40c804f5
36238 F20110217_AABHLR hurst_i_Page_155.QC.jpg
0a621d60d411ee1805727de2befc3e7b
97ad5c88a51a197840de54efbcd2ec0a2d84ef60
F20110217_AABGIP hurst_i_Page_070.tif
0a1819fbeab5098556062564c913d396
c8716e0bc616d90bcdea005f37b8afd8ea977864
33553 F20110217_AABGJD hurst_i_Page_090.QC.jpg
c256a3594a2bdc3aaee173e51b0ff5f7
ae7a2df921a2d0cb0d09794dd36d69e5879c90d1
634231 F20110217_AABHMG hurst_i_Page_009.jp2
0588f098e638a03fe10d473c9dfbd9e6
e49ab5f122ed117ec15440cfba46c7549cfd727c
1051947 F20110217_AABGJE hurst_i_Page_156.jp2
927d68d5de4d4553b6287e8407f7e022
42bbecb352e4dc058f5b0749aaa8b6837a2d746a
865653 F20110217_AABHMH hurst_i_Page_010.jp2
95489fdefbf2e2a83c91e10102c9ee0a
ee7d8c0f1b3eea86de598e1b563afa185cc28b47
133862 F20110217_AABHLS hurst_i_Page_156.jpg
07a33999d035f950f481187010e2abc2
f118dd059a492afc412b32dece289edd9e5d33f3
1045619 F20110217_AABGIQ hurst_i_Page_025.jp2
09717ca386f4ed0b164701a70f54c844
7711610c33ccb04559920c50d7165179c424df32
64926 F20110217_AABGJF hurst_i_Page_081.jpg
7c2c8a1dc4edee06dddedb3e45247b42
fd73e8f0f5cfa33af053a8f94b60823b2a01d86d
630202 F20110217_AABHMI hurst_i_Page_011.jp2
a6734f5cb8873190c6e7353ed5c2c8f9
90ff9c4b7118fb09d0260012bfbafb37b315ae54
38068 F20110217_AABHLT hurst_i_Page_156.QC.jpg
47132f43300916f7238f4e92edd077ca
c4e55643d3f6b60f9e10cf208febee804f1cdf8e
51386 F20110217_AABGIR hurst_i_Page_103.jpg
de3e2bc8aa03f2a70013efa621a2e92e
057569f1505dc0ec34aab0cffa6bd20ca0dc4cec
408244 F20110217_AABGJG hurst_i_Page_064.jp2
cae5f9c5f5ec984dfe1a7c60c8831ef9
ef4acec61f4e9020d86c1dbb8ab729450f8838b5
887878 F20110217_AABHMJ hurst_i_Page_012.jp2
9ae7bf682ba154e98189a846a098a271
081f8b1d6257e4ebbd0c87e9eead48e7b6af037b
134164 F20110217_AABHLU hurst_i_Page_157.jpg
46996f2fbb86c373c8971777014fcb5b
542061e856b290bd4d2e0e4e20a4f5427e0b3c0a
479 F20110217_AABGIS hurst_i_Page_123.txt
693a37f2d21a254257b1eb1202ef64fa
b32c0e4b37d4f2dbe93cd11e6208212324af09cf
1051971 F20110217_AABGJH hurst_i_Page_053.jp2
0db5e06597c932ba08e4dd271017ba23
7780a21d152fec76eb284f12f67fa015b281888a
1024243 F20110217_AABHMK hurst_i_Page_013.jp2
9c8eb5d533c3a66991773554c34d549f
620bff9487b5695a47a965078f4b483ff6dc0d75
37786 F20110217_AABHLV hurst_i_Page_157.QC.jpg
1eb3977202da4a5e58527bd901f95a69
cf1c416d2203d44ba03794a2c8c67aff35d68618
29501 F20110217_AABGIT hurst_i_Page_012.QC.jpg
5e110328f7535be22a74001c8a573782
60509b2e66596a81c037236b7397e997dd15020b
18255 F20110217_AABGJI hurst_i_Page_004.QC.jpg
ef2195e25c10b00401c4ef6ad31d5f20
454094e1d374b4b8ea6873429395df510a99a80a
1051976 F20110217_AABHML hurst_i_Page_014.jp2
5f64a49bf5cec1d31e018675329a2547
f379db209b5fece0cf05189a3ed7cb45acf0c46e
32627 F20110217_AABHLW hurst_i_Page_158.QC.jpg
edad34f7ec78c36af4b60ea7bef06027
542055b51036f17a2ada4de98aa0e7e2db8b78f0
F20110217_AABGIU hurst_i_Page_108.tif
704c348685b02b2f049453b167e6f070
13051620fc6f8e9dbd2cc0ffb6059abf127116d7
114692 F20110217_AABGJJ hurst_i_Page_023.jpg
4e86c208eb0a8d6d3ab04861994f7323
e1b15fdcee00c5c6d2dfdb9afa5f7be71339bdac
508086 F20110217_AABHNA hurst_i_Page_034.jp2
16f411e944ae499550b6e3e2748db1c2
169b02aa5039c4a5bdc66e9a809a50bb4cab00fe
1050127 F20110217_AABHMM hurst_i_Page_015.jp2
d69fda9eaecfda7c6740bec23791a793
35f523c17ce00558034064d33eb7ed69f0f5324c
74813 F20110217_AABHLX hurst_i_Page_159.jpg
091728edcce32cb2f76bef9dff94fe30
4afd527a8ac8ee77913107dcb24a982dad85730b
F20110217_AABGIV hurst_i_Page_078.tif
1c7f5e90a5d23f5e2151804bf6d65968
558593baf59e0967f6b88ab1e3fcf37c8ec0f1e3
10844 F20110217_AABGJK hurst_i_Page_125.pro
a86350ef5d5f715e9ecfe86b5dc2a9f7
13f7ed5cc92fb94c0d0fb72fac67b1b3b48d7e2d
528642 F20110217_AABHNB hurst_i_Page_035.jp2
f7cabf4909ff730faac0fde66f8a14c9
5a3f23aaf4d3156c006deac7cfc490ab2e8ba62d
1051954 F20110217_AABHMN hurst_i_Page_016.jp2
d36fa8af660b261beb88d6a9abab0586
558d78606cc046e31f979fdbd267059a2c40c99c
24543 F20110217_AABHLY hurst_i_Page_159.QC.jpg
5f338d6e8624e98887c7e1abaaf7ddc4
a272da25ecfc6dbf661ea9bd22411aefd904a3b1
F20110217_AABGIW hurst_i_Page_102.tif
62753384dc4edf1c408b21164355aa7a
0244aa79ddfbe1414c12e3a2fce1946d6b99b0ce
1051963 F20110217_AABGJL hurst_i_Page_075.jp2
1b5de79fa16a671fc3a91add4c896846
08387fa72838dc365a9b2d332a56e9d4e391939a
672505 F20110217_AABHNC hurst_i_Page_036.jp2
8151e11c67815589351ecb33978623e3
e0550b742204c5d9a74aa0190c89b23f2cbfec1b
1051911 F20110217_AABHMO hurst_i_Page_017.jp2
d551f15d3e0ade18909290071e19a0e1
d39922877ea1d8bb7a79e544b53cd03aedc43279
236673 F20110217_AABHLZ hurst_i_Page_001.jp2
3c3859d99e8858ed2868d17e62532045
e4468ffdabb3d967a32acfbfb215bb8a58496e18
F20110217_AABGIX hurst_i_Page_038.tif
293f805c8933861a865803ed9e9f3fbd
6b7d8d0eba11df3d2b7cbca9e395496bb2dd186f
1759 F20110217_AABGKA hurst_i_Page_136.txt
f73bb3b69b32774d5d4e3f44c13c876b
86f523fa0687621994d23d339f42309a82d58116
1051916 F20110217_AABGJM hurst_i_Page_145.jp2
ef122f1fabe6cf51ac01ffe0cffbdefd
2915d5861b2acf9f8858bb88fcd0c56cb07484c3
677803 F20110217_AABHND hurst_i_Page_037.jp2
39278714caf829ae6e5a62dbe4d54635
cdb4fdb693e9114e6ab6f3885c73da3380a7b43b
999380 F20110217_AABHMP hurst_i_Page_018.jp2
8e96feeec747d7440cf64c8147092f19
e84d383cb1638135d1b8af23cb4d804fc326f5e8
35323 F20110217_AABGIY hurst_i_Page_059.QC.jpg
a25b9aafd8142941f5ddfc5ee1652b89
80d450caa1189a2ddde022506ce4877602df880e
49532 F20110217_AABGKB hurst_i_Page_158.pro
dbeb30a9a923b4f30c0ae97f8e0a57d8
41e48df1b8efb431007cf4a70dedf814ce0d14b4
8917 F20110217_AABGJN hurst_i_Page_096thm.jpg
83788643a0c2ffe52555a5868bc60618
5e7648991c05df9ddc70d0126c5b9510ca81978c
894465 F20110217_AABHNE hurst_i_Page_038.jp2
53a54a60d019c8d92b8d957ecfaa5384
40055895d4611143d7b163899ae409351363d820
1051955 F20110217_AABHMQ hurst_i_Page_019.jp2
304d88766fdcf4334347a47afd52c52b
f2388bd35b7694091e8c2ad339bb55d38ea87031
104812 F20110217_AABGIZ hurst_i_Page_052.jpg
91289cebc15e377e43a8e2ee3bb60694
66470cf64f1301df772ca12bd80d3e015aab9644
16552 F20110217_AABGKC hurst_i_Page_064.pro
9eaa1bc0a2d62d830465a148242167e0
d4243b311a6a64142783079957e81f35853acc2a
8997 F20110217_AABGJO hurst_i_Page_090thm.jpg
7388469b05fd54a493d87fd14fc12e7a
d369b3a26226c1805722e7dda9a633b0ffa2b473
1051930 F20110217_AABHNF hurst_i_Page_039.jp2
3809b60bb3eafbacebfee29ae5823dd3
61713faa078928f569ecfd4fc13732c4c0649351
1039112 F20110217_AABHMR hurst_i_Page_021.jp2
64e2382f3d7fddd7d2143250b47b96d0
c6c11fdf2bfae949cbfecc9e899e43f25c23ede3
109482 F20110217_AABGKD hurst_i_Page_022.jpg
85a4e19beb7a78e0ef10b7c73a521fd6
bf8b41cbee4326b20bd5750ad3044080edbff3fd
1739 F20110217_AABGJP hurst_i_Page_030.txt
3ed948791eff2e8d5d76e69a825033fb
4d2d6aea402162db11116ef39aab5417331f6407
1006936 F20110217_AABHNG hurst_i_Page_040.jp2
ef492c18c128b75ccf2b9f138429b31b
60ab3cd77aaa69e8fb9de87353475c66c278d2b3
F20110217_AABHMS hurst_i_Page_022.jp2
a7b60ffe374e6b0e7aa727e4dc8914fa
58f153c88fe037b57d70a22be54d0f771783e81b
90018 F20110217_AABGKE hurst_i_Page_012.jpg
51ddca04360832e9d1309d05c2f4c816
69acf2eb37b6cd0415fd354ef8bfb6d21236550c
86328 F20110217_AABGJQ hurst_i_Page_108.jpg
cb6a3d44e9afd0f83228457d931b7daa
8e8b8b4732e8f99e9503c7cfe3e5fd2c386adca4
1051943 F20110217_AABHNH hurst_i_Page_042.jp2
1dda746f8411f79887217442d5dfadc6
96deeb58479e452e5ae073ea75bfc43d2cdb41cb
F20110217_AABGKF hurst_i_Page_116.jp2
f130508fbd277d6bb25516fae3ca39d9
f6d262b92ca8df7acb65b7d1e1648fe868cff668
1051979 F20110217_AABHNI hurst_i_Page_043.jp2
64797e83491a1978ace10cd053045d3a
b5ac6e4ee4c8ed30be073012032c0fdae82b41ce
1051960 F20110217_AABHMT hurst_i_Page_023.jp2
a876b2e54da23c3b3a67d75f47a38e44
f1472ca7b92419e134a212da10f491655dd347bb
1051904 F20110217_AABGKG hurst_i_Page_149.jp2
fff2f8587b58f1d88122dfd516802f6e
9f49bc8b06721f4c3c333825c0726d8318c8fea6
19459 F20110217_AABGJR hurst_i_Page_121.pro
ff6ca4b369ea1edff1e2fd715df929d4
5e4a0c0195144db1ea85caa5e88fca78c5fda3bb
1051946 F20110217_AABHNJ hurst_i_Page_044.jp2
578b8aaa35c8abf3613cb241a6db88cb
d4c7b161e0cde6e9dfc527736e08cae4c1697cd2
F20110217_AABHMU hurst_i_Page_026.jp2
9475755a354b1d86892edb54ab19cf0a
3ce2d88444b05cd5f62f19171209927fbe76bf8c
9308 F20110217_AABGKH hurst_i_Page_077thm.jpg
7d50cef3e1e2ff864c41670722c2e714
aaccbe0c9d561b73a50cd5c5181a1ff246a8dea2
3896 F20110217_AABGJS hurst_i_Page_104thm.jpg
f906db069f370814dbaf8607b718fb7a
911f25613ff8d0eb7512e0df425bb8deca3c69a0
1051918 F20110217_AABHNK hurst_i_Page_045.jp2
ec0e3e5361fbf94f8947fe8e0a668f63
4acad65b9334483f617079618c49313405f593c0
1051926 F20110217_AABHMV hurst_i_Page_027.jp2
4244ac92508f643eeaab2310164ae159
2a392de4864376435399bb486786cf9f0f51f790
35058 F20110217_AABGKI hurst_i_Page_151.QC.jpg
2e5238f2b38927e09a20453eb2493661
b25f3c83575487611d1ed1490f1d1a979dedba4d
1049154 F20110217_AABGJT hurst_i_Page_051.jp2
667c0ac99e25bec4ae303046765cb1b4
525de609df2692915004ab5cf43b39951733e16d
1051978 F20110217_AABHNL hurst_i_Page_046.jp2
4f753ce35b8622e9fbcc92a4154dc5c9
5ace28f21bb74563316f502f6aeb645dec56c735
1051970 F20110217_AABHMW hurst_i_Page_028.jp2
3a515a5345966f7ad7acf8eadfa69495
06c9f7b7c7dd94264f4e5fd568003f3b03c895e5
F20110217_AABGKJ hurst_i_Page_068.tif
2f72efc0d364e9954c3b5def242a5dc2
04c66d3057c92a298c9b91080e566fcd9ac11269
1051983 F20110217_AABGJU hurst_i_Page_154.jp2
c9fdd92ef42fe30102c8050bc4cd943d
0ee6336ea32554eee8865003eddd39eff1ffe322
804497 F20110217_AABHOA hurst_i_Page_066.jp2
3993feb8e7eb4e55e314a5cfc1e5d1d5
bda1d8123b871ff05f052b4e9e5afbf953d7af05
1051922 F20110217_AABHNM hurst_i_Page_047.jp2
60e164738c73c3fee3152e519fc3f110
7626a485c3b89000c73d7f422760e9581c3d31e5
1051903 F20110217_AABHMX hurst_i_Page_029.jp2
0bafad360d7061470380e7f64c750e96
a88f3f99a145ed86ef471a393e007369d981ee73
22127 F20110217_AABGKK hurst_i_Page_066.pro
102560d1a14ed8d85a121930016d3ce8
eca5c622eaaa064033aa438a93cdea8dbdd5f0e4
4714 F20110217_AABGJV hurst_i_Page_087thm.jpg
1b4c50cc0505f6bf2dbc22a74d56a10d
4aaedda2b7d4a641a7e4ff4d4288a416b66da847
676976 F20110217_AABHOB hurst_i_Page_068.jp2
ba8e5acb1bf988ddd39e880629559d40
deaf00facf8b391133f912bba210e005af0b1100
F20110217_AABHNN hurst_i_Page_048.jp2
d52e2e77e497b7c0c7cc63f0c51cdfc3
88ae077c0d6c2e20ab39433444313d8714055204
1051982 F20110217_AABHMY hurst_i_Page_031.jp2
2350d9de32e98244bab36d2a41503b2d
71a0d8a252fbf3f8a79011d281c60b4dbdb1495d
50893 F20110217_AABGKL hurst_i_Page_017.pro
920c743a78c9239ed40312add3838740
22ceebe7e1d9c482ee9773b42b19133e56252fae
3858 F20110217_AABGJW hurst_i_Page_119thm.jpg
dd837b341d062ab48bb3276ea4798407
66364ee7450409da535c319900cb128e83785132
388341 F20110217_AABHOC hurst_i_Page_069.jp2
dc746e93e4477fc35333d51ac0623936
7986adddb2efa4e75816080e7c6c4a488a665dd8
F20110217_AABHNO hurst_i_Page_050.jp2
13858522a5c3dd0fa60c2c1c834f3d4d
121a76debbbbedfc76ab17a867de37e8bb386ef3
552466 F20110217_AABHMZ hurst_i_Page_032.jp2
9998a67b69a3c50d8d6df1aa0389875e
2fdd6a98e7c694370c0f313944b9539f83238d21
1051967 F20110217_AABGLA hurst_i_Page_148.jp2
c8b77f2ecfafb27e6ce2048ee9cd894a
55685b555d535951c590ef5ffad30e77e65efa2e
F20110217_AABGKM hurst_i_Page_049.tif
8d60efdbd622859df7162dfeb2339ff0
44df8a4426b81582c906fcd729481189afa4d4e9
102457 F20110217_AABGJX hurst_i_Page_074.jpg
82630e83a10a73a391282c09bfa99226
b0496176fc9623802abb800f676af010b2082790
F20110217_AABHOD hurst_i_Page_071.jp2
c1ce1f15b5ad2f839174db10f6688b46
6fbbe5bf28035ef623aeb7f8b857f47b011a0e46
1050090 F20110217_AABHNP hurst_i_Page_052.jp2
f7a7c5c8e3f4dad4ed5f0a877cd21224
52d1e4af657afa44a350c86ea4262a57ad0a76ad
F20110217_AABGLB hurst_i_Page_012.tif
68913c737060dcaf09229012369f9609
3ebe81e3ee0c2f90b2393d61894c76a3dce2e8fb
1051953 F20110217_AABGKN hurst_i_Page_153.jp2
f47e1e9dd180de1c5146f6d81a55e604
ebe283713b393503f1c97a0e7c7605632d17c76b
7642 F20110217_AABGJY hurst_i_Page_003thm.jpg
16938d4c1dab70ddd924cbc467532a00
dcfdaeda8efe42741ffd11ff9047ccefa614d75f
1010653 F20110217_AABHOE hurst_i_Page_072.jp2
c7c485cc896cc21596678793d0e28ea9
205a4c6eade1db4ba54973c1c5abfe482cf6174c
1051969 F20110217_AABHNQ hurst_i_Page_054.jp2
661ef15c08cfef06b765cd9b0fa03a23
819c7ee750d0cf53e505b0a0962da541acccee76
1827 F20110217_AABGLC hurst_i_Page_050.txt
d64b73b2f8ad23ce91cad1f01cfd367c
c57848553f6a627be75b78e2b7bdf26321e3d494
F20110217_AABGKO hurst_i_Page_048.tif
245891d164905b1f02fcd9856fd6770c
5ece4b66950c0434d27982acbf64cd61195f2d41
1873 F20110217_AABGJZ hurst_i_Page_029.txt
4ebd767b3629948df9c1e3aa813d182c
c076513c58802d57214b0d725c6fced218d18664
1051962 F20110217_AABHOF hurst_i_Page_073.jp2
3814e93fb0294360822c8a5de147daaa
935b5d318f308bfcfd4892a37602ba95d970d363
816211 F20110217_AABHNR hurst_i_Page_055.jp2
0a1ad15a53a4d3b20014038527403a32
fafcb43a1b5be507be78a48d4f6722b1e4b3201f
4452 F20110217_AABGLD hurst_i_Page_035thm.jpg
1372576b1020c83281eb669e4175279e
27c04c6441e876077179925b01ec704619c5cda9
1051927 F20110217_AABGKP hurst_i_Page_030.jp2
dc14f31b6a120449871d4885bcef9e96
c338dfc705b9a5cdd14f7d793b81770d38d9fc4f
1010328 F20110217_AABHOG hurst_i_Page_074.jp2
22866089693fa9cbc85b83f53598307e
60b45ec83a4c073366231dc98613865bb5e4a32c
762397 F20110217_AABHNS hurst_i_Page_056.jp2
f3e2291b856deb165dd6a194316e195a
3772854b5b2441fa6d3dd05206b167ffd86f5e94
690 F20110217_AABGLE hurst_i_Page_124.txt
c6c7bb31682aa861e3dfe09e75cec191
f4559cb5b213df1e7818d887c9bbee9fef20d381
9578 F20110217_AABGKQ hurst_i_Page_019thm.jpg
ca2b49fbb6048d3e4db0817fbe05f7b6
ab1925aed59e42be9df5b3368e233c94d9d89e57
1002425 F20110217_AABHOH hurst_i_Page_076.jp2
74d6bbe66a30e0a8ca8f2aa1bde91d31
bbd0ceb014a4b03e88bacbf7a39ea0f0e35ac018
539634 F20110217_AABHNT hurst_i_Page_057.jp2
cd276287f0227c14c67c1928d218b02a
2ffed6266349105d09a67cf5b9a8c6ee52e49bc7
35801 F20110217_AABGLF hurst_i_Page_130.QC.jpg
bef0dbbeb7d1b1601d894e95aba671a9
5bd897712a4eee89ced467049e2e613cf9da1319
5292 F20110217_AABGKR hurst_i_Page_011thm.jpg
9d077b3e732acdbc96b11c1c05fda542
1e7f9df623445186c1ded5f940c8846fa8ccd580
1039969 F20110217_AABHOI hurst_i_Page_077.jp2
1e77f94ba944424807c1d5e9303960bc
f3c9cc5d5115dc84a4a98281f9b4c6014ffc136d
123172 F20110217_AABGLG hurst_i_Page_141.jpg
410307094722b0cd940e39dbc4911e2b
08ff3ff7594c868ebeb6068d5d66ac02deb6fb10
1051909 F20110217_AABHOJ hurst_i_Page_079.jp2
6fbc9657ca06f5a6b8935dc1821647c4
924e1d6e9438a64c7409957348dd29852f0b83f1
731284 F20110217_AABHNU hurst_i_Page_058.jp2
14c150e0798cc033b2df4aa256c55da5
6bcda797832fa4b1f0e59c6ed865fba53cb59b3b
1667 F20110217_AABGLH hurst_i_Page_077.txt
66d9d574f58e8fb73c724a00c41a7ed2
a95242c967f33d80d8215c3cd250771c6fdafa0c
547104 F20110217_AABGKS hurst_i_Page_122.jp2
469a1859ad5f9a3683e2612ad8b85b75
3bca61426f27d88db11ec451c115dc48bec23c44
480871 F20110217_AABHOK hurst_i_Page_080.jp2
b38c89d21f3aaf960e3e88ef51da8b93
251890dc7ffc1bec5e615ef82685d43379c7dd80
1051915 F20110217_AABHNV hurst_i_Page_059.jp2
74b326d6b00c5e95d0e3a738f4e240a4
d70dc5db20a71a33c6605b366b57c80cf734aabe
46379 F20110217_AABGLI hurst_i_Page_016.pro
52cb34f5dcb2071dfcf3505bf8a0b278
0222a9099681c3ee87c89908c4746c78bc5962ef
38417 F20110217_AABGKT hurst_i_Page_142.QC.jpg
880cd888225b70d487badd4e978994d2
9c7fdb329e6a99a3fad3c167cc1a2b69a5161cc0
711702 F20110217_AABHOL hurst_i_Page_081.jp2
390136b42a2fcc1473548ab1033de36f
da1420b0b19a4dbc106306d451e6cba5f0f419fa
405949 F20110217_AABHNW hurst_i_Page_061.jp2
4f2391adfa7d4e2219f0de42e88e8f38
8429c5f45bcda57a2ce81d2881b736e07e21dfd5
F20110217_AABGLJ hurst_i_Page_142.jp2
a869780c564cf66cb1678fd1b7573694
9b9cc174199bfde9bf3a4c96bc193bc1f10a1a76
34786 F20110217_AABGKU hurst_i_Page_136.QC.jpg
74c41a60cd851e9f5e5897f4b304ff33
be62feb272bcb3f840a9c9f76eb79b3f08844ded
539945 F20110217_AABHPA hurst_i_Page_101.jp2
e9ce76362b3592ead27bd256d3b07be1
e40c7447e3ca4ceafd8032d45bc1bf2ea90e2f08
437030 F20110217_AABHOM hurst_i_Page_082.jp2
93f16265e6d7859660e6e6e4de0dac11
e4f8deee644688f1d9e17cc5ec9a953205b2bacb
865041 F20110217_AABHNX hurst_i_Page_062.jp2
58480584f1749b4c1303f12c5054fd38
c4dc4783772f425303d7c0c20489a79906a319f6
6585 F20110217_AABGLK hurst_i_Page_007thm.jpg
2038cb7f123a271fac3955606733c5b8
202eb28431c7c0ee9635ed987a5201ab8491a65a
F20110217_AABGKV hurst_i_Page_082.tif
a7f2b585b3208b703074fd1a9260e8e9
4ae8e0526d3d82d30a05857b4a7cb85a567983b5
513153 F20110217_AABHPB hurst_i_Page_103.jp2
32bc5a16953e7adbf2a0b1ea5ac49daa
a2525833329b24b333482f74ac637cf4727751fa
459318 F20110217_AABHON hurst_i_Page_083.jp2
e61bcab8b6a69896b9baf83d85ee354e
f1640dbfbc5d828c88758d61ee7fccd0fb1c17af
868515 F20110217_AABHNY hurst_i_Page_063.jp2
bc147c840a476190f2f5248ed796b9e5
83b9b1f36a1ca8908618e55133fc91d7a5f2501d
89500 F20110217_AABGLL hurst_i_Page_049.jpg
73dc468d3cbbaa8ed31c30bd7020f60d
fee3f0c1e642829a48d6ae41e0a538ab9c3ecbda
44621 F20110217_AABGKW hurst_i_Page_013.pro
ba4fb132e80c4bcb5731f72d83989889
ff5813297d6cc3d462586a1c10b34586a007d6cc
437355 F20110217_AABHPC hurst_i_Page_104.jp2
f023af6722f2d783d717e6ad8d930ea8
ac5e9bb1e6f833eef33bcbad890c247a0e0a09f6
480628 F20110217_AABHOO hurst_i_Page_084.jp2
0a55426458ec60b3f1a993d5543ba212
a1aab7bc1ae89a465b08b6028e331f35a56c334a
539283 F20110217_AABHNZ hurst_i_Page_065.jp2
770be2755ee46851314da33d377e9ab5
d32be115af40757b6520769ab0ea6aa6fc9f043b
F20110217_AABGLM hurst_i_Page_047.tif
d065c84de91c73cde7c16f875def3aa3
308a4c72bc660fd62d7b3a2e8b0a383a86d252e6
23578 F20110217_AABGKX hurst_i_Page_032.pro
d93a14a45632218a4b6b3ee8523dd638
9ee65dae4aef52876dd908ba205458b6822f82b5
1781 F20110217_AABGMA hurst_i_Page_073.txt
1156b8ebb7bd4a0064a8b1d4cd89fe5d
39edf3cad1a6865592ff99cce379ef4cf550924a
536072 F20110217_AABHPD hurst_i_Page_105.jp2
4b789df599f54595bb791b837dd7be36
ef9df47770b1f6581ee395c6b0d2c30e4abd7bd6
499443 F20110217_AABHOP hurst_i_Page_085.jp2
e1677c91c948b05e368c83fa284ae264
10ae7823161a7b3c98f77d37ea51799477584336
496264 F20110217_AABGLN hurst_i_Page_099.jp2
5b4103ce2a84ae922f4ddf6c81ae460e
0027c02b4cdd3b63c8c82566d9fe18b83822d0b0
F20110217_AABGKY hurst_i_Page_056.tif
d2d2c8ae4b7b4d62e3098e6757cd60fd
5d79d3214b7fe355b70aaf3a65677b4f2660cb7e
6976 F20110217_AABGMB hurst_i_Page_010thm.jpg
5435e588782329e0e0951570698a85ac
56e00e2d43945b5923b1962971e9ce41daf2f981
323897 F20110217_AABHPE hurst_i_Page_106.jp2
5c69ebbcdb1cc3a57ab4d62da19092f1
5248cae01f6b66313385d0f1897c6263c5cd248f
352166 F20110217_AABHOQ hurst_i_Page_086.jp2
0254bf36013ffeb848ebf72a18da1302
17913964bf20e2d063034f70df7cb4cb20895623
151563 F20110217_AABGKZ hurst_i_Page_144.jpg
b34985ef5b703550e8c23db56a07518f
5052240f93672ad9a36d645b69c26a1cc9f205a2
F20110217_AABGMC hurst_i_Page_076.tif
1cb89d90847195a67d18e6c91e12a09a
b9d4721c584716633098f14703c3339ae327adeb
44703 F20110217_AABGLO hurst_i_Page_090.pro
fbe01aff4d90722312c39757c9a2732b
1800999eda1f6c5d07ac008c0bde05e82012f99a
481590 F20110217_AABHPF hurst_i_Page_107.jp2
03d1b537fc287c44b8d7412940b6df86
2d330aa07f7371ad5f6e57deab343b5ff86b7e5f
891828 F20110217_AABHOR hurst_i_Page_088.jp2
ee94f7596fb2753f300705985d1e417d
632e783d646767fee0ef036b7fa1886cc3311c41
7551 F20110217_AABGMD hurst_i_Page_038thm.jpg
5c74d6d6993ecdcf8d81301ba8fd9d42
7c4a3e477e9fe9201b62570b7440a93b55f9a323
882642 F20110217_AABGLP hurst_i_Page_126.jp2
668a61de2f12e263a95bde1369a8957d
630e2a3f15d06ec2bd0acd51cef3efb433c4631c
854007 F20110217_AABHPG hurst_i_Page_108.jp2
0128172cef6497666ca4b1e3df55d0a4
0dec71be266b62f0873255e0c8c13a9df0ef7e72
1051936 F20110217_AABHOS hurst_i_Page_089.jp2
7d2f6425dbcafabe9019c6d5b93fed4e
4604653083642014f201f78e72cbefd83f422838
1478 F20110217_AABGME hurst_i_Page_009.txt
121c2f0c05a95585ea91e896a0e91c9d
0ce40b1bd3676e448d8643e2cff8f85f300b6788
109572 F20110217_AABGLQ hurst_i_Page_134.jpg
218625983b6d16a6ed3a511da83c8b29
b4b782c4c508492b60293964eb26cc1d226c8899
1017762 F20110217_AABHPH hurst_i_Page_110.jp2
898428cdfadb67a1bdb53e104117f68b
5f32d701556dda89132420064e438888303030d6
F20110217_AABHOT hurst_i_Page_092.jp2
80696bcd5e05923c561526830ec75af2
82fc104b8f3237563fad397a722d83be8a006950
9436 F20110217_AABGMF hurst_i_Page_146thm.jpg
4bc82f97dff3d0200c9a6a41eea89f42
b967500454edea4a405aded46094c7cb395d75b2
36131 F20110217_AABGLR hurst_i_Page_078.QC.jpg
d583c6fb0ef1c87a564e6e35e130470a
c240d49ae7c57509064dc7fbdc4d3554af33e9fc
1041440 F20110217_AABHPI hurst_i_Page_111.jp2
aae50d6e1275cc7021e495ec8eb3593e
ef5b7672823df433a939167f242f158896e8a068
1051972 F20110217_AABHOU hurst_i_Page_093.jp2
f0675ac0a235a74d5841c3ff0529ef56
bbe1be3f6ffafa7270c9b826ca8e6f89560a38a6
2185 F20110217_AABGMG hurst_i_Page_002.QC.jpg
8df207f491cdeb091cb0fc4de46bf5b5
33b5b2982b06102e81b15b082a4df27b8a5feb1b
3697 F20110217_AABGLS hurst_i_Page_036thm.jpg
54ddecf5342f4a93ac385330017e583c
c6d6e92a358defdbcf1dc85b56441d56bc5f290f
1051974 F20110217_AABHPJ hurst_i_Page_112.jp2
69883ae915d431689a003da818a96be7
f46d5bc9eda52b08ad60a2584f08d96ad93d222c
15511 F20110217_AABGMH hurst_i_Page_100.pro
953296afc017c306179dcff24fc62863
571f0ace67968d0647713e20fefd0d636ff2411a
F20110217_AABHPK hurst_i_Page_113.jp2
3fcad9fb126ea36d0a9fe825d8dffcfc
b19e87760a8819c5649dfda122365ecc627ce3ee
889360 F20110217_AABHOV hurst_i_Page_095.jp2
fb0c9d460c7aed6b534bbbb59ba9d841
66d76c42c939f5265e8a073febcbbcbed4068164
46208 F20110217_AABGMI hurst_i_Page_030.pro
6d14368da56dbfe6664096c48427b902
7d34183136dec700f4efd15785e93edb5e49adf2
36359 F20110217_AABGLT hurst_i_Page_050.QC.jpg
f37165fbce17425823a548b7d7d9acfa
b6943aefe967d2ac0ddf499559e59a2db4b99257
1030050 F20110217_AABHPL hurst_i_Page_114.jp2
8fdb6e1ed753818e99511136e512ab7d
781a6bf4cd12b9746b9b0f505195756426d32e88
F20110217_AABHOW hurst_i_Page_096.jp2
4f7fe2f9ed9114d9532293ad5b3d0393
59da407b0a5b413132e73b791ee31b72697fb69d
37345 F20110217_AABGMJ hurst_i_Page_027.QC.jpg
a68f13049b3f8cc33ee1e56adc4b2108
dac450dcc98d84b4762a15a018465ac4c243a2c0
59762 F20110217_AABGLU hurst_i_Page_150.pro
2038b8dde848d93fb09e2cc7d00a77bc
ba050a972a8a199b4ec2ddad0b492eed2f384660
1051872 F20110217_AABHQA hurst_i_Page_133.jp2
c23ebeee84da60007afe7e4b6a5135a2
c56cc2204b274c025cc4337ba385c2ade650df7f
1051948 F20110217_AABHPM hurst_i_Page_115.jp2
3dd8c6d5b658ca2688d6a7288f5f7207
70537bbfba87e9e8ac44980339143261246927e5
1051961 F20110217_AABHOX hurst_i_Page_097.jp2
e7b57354aa31e9c3678aa22b809b21b3
1c4d8d68448b6da1eb433fb455ff5269b1055194
F20110217_AABGMK hurst_i_Page_045.tif
d36c4354f655145dc08070db0e5d044a
64a56fcbc7a1237899e84b6d3e28f99d8c66925d
8153 F20110217_AABGLV hurst_i_Page_158thm.jpg
206051fa7d4c0a17405fb908fe1447f9
fc5bf10007e3e98b12f916d21680328132cbe020
F20110217_AABHQB hurst_i_Page_134.jp2
f56cfed728811b0445f79dc3849ff5f1
5b780a9bf5a6a661b101300b35b604adcf930bae
1051977 F20110217_AABHPN hurst_i_Page_117.jp2
ee8e55ab256d7d1c3cefd23a64f9bf26
a5c39afe8fce9f96e258124e042179c62e9342a3
709226 F20110217_AABHOY hurst_i_Page_098.jp2
9da668a79de6b4b4abf694c5e6a4a483
e26a1562d702855e3d773990fdfe0b60d4511cfc
113235 F20110217_AABGML hurst_i_Page_026.jpg
5865974694e7d5bc33303d80e219be0e
326b14588bde7119891cbd079a128b40d7330039
109750 F20110217_AABGLW hurst_i_Page_135.jpg
c2185f52863d0d20eeca8784b2c0a848
20163f1d1d41ecf3f9bbbef98ffb37ca6d4bcc24
1051928 F20110217_AABHQC hurst_i_Page_136.jp2
edc81629a4c7749b98bff0a5551c6ad0
f7478dc54341502e13ec67453b0e748035f86093
742039 F20110217_AABHPO hurst_i_Page_118.jp2
f2c1202ad7773098c00a74030a873a37
db5cc547929f3f43daff023421cab117e25ef06c
354110 F20110217_AABHOZ hurst_i_Page_100.jp2
9b67a1cddc4da764b6430fb3c9183fd9
ce0ae688d16b814178121caa07d9ab51c32166e1
36479 F20110217_AABGNA hurst_i_Page_146.QC.jpg
7821ac0e3e48fba3f9a2bec1f0f8e0ee
6884c1319bdf74fb2449bdb18e851e75f0b10525
9163 F20110217_AABGMM hurst_i_Page_131thm.jpg
1e08aca9c757718133cf93b97ba661ea
51c0dcef62246876eb975078c56daeb942d02a60
39537 F20110217_AABGLX hurst_i_Page_154.QC.jpg
c6b1ca65e7c200858cd9712beea56aa2
b9ea2395a158f775615fcc98fd82129210f906c6
796200 F20110217_AABHQD hurst_i_Page_137.jp2
b031db4b1b1702245059e08f196fc551
3264d4fa294f2fa5042900e2643b919efb221d86
447237 F20110217_AABHPP hurst_i_Page_119.jp2
1812c0c28ded9ecd926301d347ccd4a2
98934904a28085247334a3de9bb8003965e03e73
43034 F20110217_AABGNB hurst_i_Page_033.pro
1bf3b096d47b3834e8a910b7baf1d303
a768edab140530c0ab368d82afdf989836a6a89b
51256 F20110217_AABGMN hurst_i_Page_004.pro
57a20378d185618e89d42871a8844b47
cbeddd264f741469c147f9b6c5c055057f0eb8ea
39551 F20110217_AABGLY hurst_i_Page_093.QC.jpg
6dbee4b8733187b3ab78cff5622447f0
6fdcdc3ffe1a13ad82435cd116c72a5c92b296a2
1035821 F20110217_AABHQE hurst_i_Page_138.jp2
e02910950dfadab0a845f83ce02c489c
55274e7b1c6fe0b2d306f0f54876eb09cd2f22ec
382204 F20110217_AABHPQ hurst_i_Page_120.jp2
657be5fe365e3f7908483eebd8ad0f1a
0a3bef4665e50e913be382b86439bf0977babdc2
F20110217_AABGNC hurst_i_Page_149.tif
bf0b36befef526e864f4e9906584acd0
dfa204e4f930370018f1415bfc5ae6fc230adc63
F20110217_AABGMO hurst_i_Page_003.tif
a23b1549a0775d9527e156be3229a4ee
0e51737543a3fb3e984d5aa98aee0ac5fafbcea6
48715 F20110217_AABGLZ hurst_i_Page_134.pro
a7b6bfbef13fee721861966c10ec50d8
e0f154a7fb7e73368015ce2ca0ad90ddd53a7927
1051940 F20110217_AABHQF hurst_i_Page_139.jp2
74814a483b4a14b7736b0d5e4dd5596d
52517f1baf3f4e1123774f31ac021c9035771c3c
734105 F20110217_AABHPR hurst_i_Page_121.jp2
9c983e1f05f30fa6c7c135ce3b3f6e4e
308529b42797d20161c52521a13db3dda6124085
46862 F20110217_AABGND hurst_i_Page_112.pro
11ef0eccf64fe90a47b38e778de7d4c1
fb9e0f3a6cd8436d362a4eae62eac8e18186a67a
19711 F20110217_AABGMP hurst_i_Page_122.pro
d30f1be84f71fd0caea200be5c88169e
cf9f241392beb1c694f25c3e8e0d797b3d56e47d
1051888 F20110217_AABHQG hurst_i_Page_140.jp2
04a9109c841e2bb4efdc1584371e5ee6
2dc9305180fcdf0a6c9d03b42115e10486534c5c
466900 F20110217_AABHPS hurst_i_Page_123.jp2
c6b0ad19823c11201bbfb50185ecc9bc
8ee8bf802402adeb7ccd6cce3a79ebde8df07219
1051939 F20110217_AABGNE hurst_i_Page_135.jp2
c96ac73158a72e31f2e8374544d2815c
ad6a70728093b9f0758267a07ceb0eb2da7d7c36
37334 F20110217_AABGMQ hurst_i_Page_029.QC.jpg
32de90660ab366e7c55f11ffffa0f644
0cafee47a425604d610db84b1415bad3a9473f55
1051965 F20110217_AABHQH hurst_i_Page_141.jp2
4e395ff133447eba6fa53f5bdb58cddf
7388e880af27286b66ca87f062c9788736592bf2
556363 F20110217_AABHPT hurst_i_Page_124.jp2
4411a019771d9d2a01befa30f29d4dd5
4178ee092486d8dfc7b78eced5acd691f33b1b3f
15117 F20110217_AABGNF hurst_i_Page_086.pro
ea351ab811be66fb374b8bc174788fd6
ae55ea26193103656adcdbf24d56b46c1f0db573
F20110217_AABGMR hurst_i_Page_132.tif
8fc417d7f0fa789f0953360df5529be9
d3cb730cbe7b55c0f796f1214ad42dda989da9d7
F20110217_AABHQI hurst_i_Page_143.jp2
691b26af47e96b747db3ac5bda83183a
774610283b154e146f7d819fd893daa89009dbf5
283542 F20110217_AABHPU hurst_i_Page_125.jp2
f9ff65641b4eeb8a2dbe95f7e13dddf9
3ae05a46949a844e30bdcf9b7091bee70d2492d0
61494 F20110217_AABGNG hurst_i_Page_155.pro
4e1ba5d704e60aff0f63905c0717f160
6ddb311003c2b5e92189cce10c8c53b0788e9016
57981 F20110217_AABGMS hurst_i_Page_122.jpg
07387bfe92ac82e85a274344119670be
1229eb1422018c2bc49811ffc06eb1391252b2f5
F20110217_AABHQJ hurst_i_Page_144.jp2
54e77e900190cefb0f65a7e968774708
6656cceff063ee835efb5c668d22b643807eadd0
1051920 F20110217_AABHPV hurst_i_Page_127.jp2
992777f1831960ba061edb71ecc49efa
d9bfec4bde26f89204d363a6d67e8a4d26822ee4
106413 F20110217_AABGNH hurst_i_Page_045.jpg
8c7acbd87cc386c3659c3affb4f2bbc7
80e9f24eeb1a8bd73d0af13c7deb08f28c648c93
901081 F20110217_AABGMT hurst_i_Page_049.jp2
23fd1468862c6093d77595bfe3737000
27a521c11870878a278ed878106a579ab44b746b
F20110217_AABHQK hurst_i_Page_147.jp2
382576f13de1f2c62cc1725fd8fafd8b
6247dfeaca99cd4402610c03ebed62b368324588
112309 F20110217_AABGNI hurst_i_Page_112.jpg
948f90d77a96f054adba8e3aa4dd9e80
dc06b2482d3b7a28bd3bd65d1dc89f290d319782
F20110217_AABHQL hurst_i_Page_150.jp2
9473aa5f4079e5e7a049a6ba22957b7c
75b1b1181a22d97cac56abe4355a3b97fb4f1c09
F20110217_AABHPW hurst_i_Page_128.jp2
1f0e27ac1a5e4de6ba08f6fce7393672
b694e5e41c5d82a1b958a78643320119d52299ed
F20110217_AABGNJ hurst_i_Page_086.tif
19e6f4f2784f9e364e7b92b0db7f7b65
45bd06ff385c8040c3d12a5f1edeb2f6af539164
1051984 F20110217_AABGMU hurst_i_Page_109.jp2
f22aefff654dae715706097c0f5c5c18
0063913a4138addbd3628d740fedb6d264b19c67
9156 F20110217_AABHRA hurst_i_Page_016thm.jpg
92c030427c36d0746775381868461c1d
5a0589d4f3faee322bb07b695f307967a512e557
F20110217_AABHQM hurst_i_Page_151.jp2
95906b2e98aacdb144b402b2109a08b1
aa98a8a13dc2a685dab6a10fc3f9cd7fc86c3fae
F20110217_AABHPX hurst_i_Page_129.jp2
1709d922227253a877a1279149d9fbf7
3811fe6a1fa1feca6d2bd317bf029f677949951b
1051986 F20110217_AABGNK hurst_i_Page_024.jp2
39e976f35c597d7f30ad8efa5d882c88
206fdc35ee0fda955da4e94788fe49723425ed88
49346 F20110217_AABGMV hurst_i_Page_083.jpg
0a6853a439b6dbf0e62e236e9223d96e
72334358bc492fe6bd141a6b03078653ebbc042b
9662 F20110217_AABHRB hurst_i_Page_017thm.jpg
6b8fbb492f2be3b87fb14ca20f78dbf8
bd15a6d808e6010b37e647d688a2a03dbfed3ada
F20110217_AABHQN hurst_i_Page_152.jp2
e922f360dab0676254a0e6871d002e86
04f24abf1651c2c0f4e21d896ca430686481127a
F20110217_AABHPY hurst_i_Page_130.jp2
01ffeaef5996b9b852b21e53ef8fc128
e7a691f5fd5c4c69601eb8a22033d2f7dd78038e
F20110217_AABGNL hurst_i_Page_099.tif
e45563633fd6fa32872bae543d596e97
8556572109a9775dd2438c6f1e5853f7ddfd2dd8
F20110217_AABGMW hurst_i_Page_119.tif
cc5b4e13a5f4671baddc6ef10ab27700
aa3a3d01b75ee99e4f11729caeda84ef75a685a8
8905 F20110217_AABHRC hurst_i_Page_018thm.jpg
0f473f0b2c01ed1381722d3adb715575
1fb0fe09054d0616cf2c91e24097cce60102e4ca
F20110217_AABHQO hurst_i_Page_155.jp2
c7f26a661149a256fa3063a1c889dd9b
bf1aca8b6e3f9c2eae8a0a92ee8675e521b2da80
1051985 F20110217_AABHPZ hurst_i_Page_132.jp2
d2cb3f96c8b3f31f71098bac740deea0
a069ded2773afc4433cdf3218b09b1fbf7a653c5
F20110217_AABGNM hurst_i_Page_129.tif
8968ea3e54cbf0ddc4c66f446adca1b0
2bad00799aaef0a25f85700d57601381a35e1b11
1754 F20110217_AABGMX hurst_i_Page_021.txt
9eeb4d0b1c22bf8493abf8e11786d6d6
93780ba34e68c57354e87bdd067122dc0f9f2577
F20110217_AABGOA hurst_i_Page_051.tif
63271b677c5db3bf725b17843b3bcc0b
ce375fb223113b1665079f53070ae0f3703dac5f
9176 F20110217_AABHRD hurst_i_Page_021thm.jpg
ba60de0a6b955a6370df71f187bfc2a9
a967f066fd8696207013b85369cf1ac97b977ce2
F20110217_AABHQP hurst_i_Page_158.jp2
dcd1b799455ad3cd0b0da0ca0720cf0e
977552b07054e36b88c464dd2de804f799a96191
9332 F20110217_AABGNN hurst_i_Page_157thm.jpg
f6aae211e20d36f2e42618c7cfd7251a
629b62e791c85aec13e9f8fe4a35fb640321a479
F20110217_AABGMY hurst_i_Page_158.tif
a3c3fc1623fe1b1c516987362cf4c368
fd371ffc3f5fdd2160feae4844e5ff379162dd68
57794 F20110217_AABGOB hurst_i_Page_032.jpg
d773a7e0902b99f595e24f831a06100f
8bcaa6cd1c0d4fd71a8b7bd9d98d5e665eeec1ae
9340 F20110217_AABHRE hurst_i_Page_022thm.jpg
f9e3c5fafc8f2cefe7953b60fa6c87c9
9778fd5a49aab60d1acd45bf94f30c460d052100
2346 F20110217_AABHQQ hurst_i_Page_001thm.jpg
69ca494b5ae36938ec48a155e89091d5
3e488c998ccfeb724420775ed0bfaa9722cbc203
F20110217_AABGNO hurst_i_Page_088.tif
e3b309168d2e0e4bd29ea52c5dc79a08
9d68c9e316e8a70be1058a285ebd48414cdb57f2
627 F20110217_AABGMZ hurst_i_Page_069.txt
ced6d7015a34aed1b5269440f75e59a6
48339789662ff480927f2d5e28912461ff2b52db
7703 F20110217_AABGOC hurst_i_Page_138thm.jpg
70255cddb9f48aa91d0c243b9c9d5df3
c99641b2571b55c082314b9ab440f3926d679fd3
9593 F20110217_AABHRF hurst_i_Page_023thm.jpg
4cb614b1df4a5b1451613cdaf35a0038
8463a6d39faf17b9c0ee17b2498110d9f51c526e
806 F20110217_AABHQR hurst_i_Page_002thm.jpg
8a3bed9848f3d6c358167d804b6a2561
88fb9fcd6a0033da4a6ffb72d09d52e3d3633483
1051958 F20110217_AABGNP hurst_i_Page_041.jp2
8a3a6bd0d6e59ffa4db563d12e40ae87
7c5408033a3031168b6b274333f04beb0e1dbb43
2244 F20110217_AABGOD hurst_i_Page_146.txt
d8bbe24983417c7a07c8c9367f66d9fb
1eee19113a4d52e44101776cb309f1b6ae4c3c4d
9579 F20110217_AABHRG hurst_i_Page_024thm.jpg
79342fd6f51816becb2a8e83e26c6d30
ebf83fbcd53369c7ca2861f4b18cb95205193423
4289 F20110217_AABHQS hurst_i_Page_004thm.jpg
ed59253554d492e4dbd785464b8644e7
d212e98724b0d0c69822ba50e17187fb410f903d
106979 F20110217_AABGNQ hurst_i_Page_096.jpg
71ec1835d8382f4a7c7a0bff9d015a0d
59e29d2e957ab6c03aa3ef1f388ba4726a4e284b
F20110217_AABGOE hurst_i_Page_124.tif
531c225d600b262f167552383921b98f
c3b09b0c6c9a79cff1ffd1d7a7d18c05af02e776
9052 F20110217_AABHRH hurst_i_Page_025thm.jpg
2f485a6f17ead4984e09ae3905e0951b
315d2caf135d4137803999772b947a19920e4d99
4479 F20110217_AABHQT hurst_i_Page_005thm.jpg
2ddbcb54e65bdf22c23809150d8fc5ba
84ed0b90ebdd55586750b8b4af48bf7ecc5f3725
F20110217_AABGNR hurst_i_Page_078.jp2
0d0b352a154635c21045c85b75e30162
17d34b00c608a69a21dfdb816e80d905bfb8b9da
8361 F20110217_AABGOF hurst_i_Page_139thm.jpg
9801c8eaaaf427b8e5aa863c6a464711
c011505edfed66a273098f3c464696af4088235f
9458 F20110217_AABHRI hurst_i_Page_026thm.jpg
ecaf6cad46b56bbe581ff56b23ac6900
11a003f90d818a35e76dd774ca1f56243aabdb26
8103 F20110217_AABHQU hurst_i_Page_008thm.jpg
6e9e9e97ae8e676961f8c9e2c49a04ea
404fae398e210960359cbe3d27ed20d0db6387a3
5268 F20110217_AABGNS hurst_i_Page_037thm.jpg
0614b8468bb634337f13453d0964aad9
81056753e7f7d514e092a347e355c93f5e07efad
F20110217_AABGOG hurst_i_Page_060.tif
4927a7992c086a3681537bff46907275
e24a944093be3ffad362c64a2c7aa9c2183a283a
9566 F20110217_AABHRJ hurst_i_Page_027thm.jpg
4c387c3596e7f133b516d30b820e688c
dd874e414e5d1276d417a2a9d9fd8fc67e7b234c
4787 F20110217_AABHQV hurst_i_Page_009thm.jpg
bf47399bfd3c3b5a009b6e90cb945fac
0ba05e0b5384afc3a2ad5ae5bd6da8fa55124707
12919 F20110217_AABGNT hurst_i_Page_104.QC.jpg
6ddbb96f4ce7b709176af71bb4f3ca2c
cc3b3e46796ba252f01744290c4bee4eff49d94d
112595 F20110217_AABGOH hurst_i_Page_113.jpg
6fd9c687b66446a6d91bf84c5f030131
f683bd2220bb8104fed3eb6bbbd04da19d028318
9470 F20110217_AABHRK hurst_i_Page_029thm.jpg
f1dc6bf2a4d1b62cf2acb468b58dca10
a0e5f25f033573c798292ad8aff07adea26fb943
7410 F20110217_AABHQW hurst_i_Page_012thm.jpg
849935fc17d374bc5d52b1168cc14368
8b626e5c09fe07e7a4ae1535691a1a8f60307a36
514726 F20110217_AABGNU hurst_i_Page_067.jp2
b1ee873fe5e9f8378d7f132ea11ec179
638161a96d37dc94e41e011c986cfd0892519cd6
44264 F20110217_AABGOI hurst_i_Page_077.pro
be6dc4a51d9fb239bb0d29d12008d337
ac4e0060c89f44b50e4bfe39e85874f22b9ec6f0
8878 F20110217_AABHRL hurst_i_Page_030thm.jpg
fc4c4a62ce03d8fd0d1796b1f34d295b
c97d03ea0911d4a0e9701b44c646e277583c5d86
45148 F20110217_AABGOJ hurst_i_Page_002.jp2
438ff38c20bc9b36015368aac6148d8e
80ca9d9432d0278fa32df3c4309c1180aef42195
7753 F20110217_AABHSA hurst_i_Page_049thm.jpg
dd851cb78b2912ca25b6ddee13af4e73
cb5c5b9250ad654016cf30a8bef010475fd24ed9
9309 F20110217_AABHRM hurst_i_Page_031thm.jpg
303c0770a7b0e583182a7d0fbdbd827f
9b6925e8e0fc08a522edaf33c99036bada3b9533
9192 F20110217_AABHQX hurst_i_Page_013thm.jpg
73fc706cbbdc5a59940d40ed9d119092
dbb316bfd7cef6a8d35193207a41cab3e366d4c2
9297 F20110217_AABGNV hurst_i_Page_028thm.jpg
3138b7720467182a1e23fbea1501f74a
440f44e0837828564415485ec7ec5f33bcc8d160
40408 F20110217_AABGOK hurst_i_Page_144.QC.jpg
7524ff6175b2a14f690dea8eaa0a7ca1
a20246b4fb6be815a4a707e544a25fdd25891311
9454 F20110217_AABHSB hurst_i_Page_050thm.jpg
a9d3877dc57a62e11e7faaab03628a8d
d14209bc4c11fdbc43907cde11f80d457d1a02c1
4697 F20110217_AABHRN hurst_i_Page_032thm.jpg
08a27612b0eb8721f1317736d65c2038
47412c402ac4e7ae5c9b5b1e770d6ee81d8b62c9
9412 F20110217_AABHQY hurst_i_Page_014thm.jpg
491a6675796da5a3933fd8f9ef7549bd
6178f87277521eda41412a81ba77065ed9cc7fad
1532 F20110217_AABGNW hurst_i_Page_088.txt
3c4e06f815710db27dcca2a74e932f6d
f814b936e8eb09bf5abf6c3fc6a0e4e70e442447
29782 F20110217_AABGOL hurst_i_Page_126.QC.jpg
db645a13962629e70284762081148d23
c90ac2964a194fa3614fda5070213c8b2f14aeb4
8869 F20110217_AABHSC hurst_i_Page_051thm.jpg
cc87c5670593fb04a7941e3acd1ca63e
0a77aab01ab820689a52d05b14a1b7842979ed39
6728 F20110217_AABHRO hurst_i_Page_033thm.jpg
31e393bdee2bf4f6f5b95d92ef24ff88
6db02f3e32e78a2ae5db639ad28eaa89ade5621b
9157 F20110217_AABHQZ hurst_i_Page_015thm.jpg
1c791f05e66cdca2d5a5cd3709f0d0c6
0dc3c5743381f2b544cfde68fdf727fdbe0cda04
1045647 F20110217_AABGNX hurst_i_Page_091.jp2
f554bd989492c80bd8c7280c60c95494
2ccdeaa8138324a4482be63fc1979d10ca7766c0
F20110217_AABGPA hurst_i_Page_015.tif
6db188b8ccfd7176eb8ece05be0a9bd8
522b47666cfa91ec6b83653431d7ac46fd7dc372
255317 F20110217_AABGOM UFE0015240_00001.xml FULL
33a995b29fbe9a2628b2502672a9b011
49e68fdc71924ad22ee0a55fc325111c8e5736fa
8743 F20110217_AABHSD hurst_i_Page_052thm.jpg
e02f9f9117783ca207c988b51ef80d67
30a1dc3d0ad71dd6084e020e405dc747900aacac
4295 F20110217_AABHRP hurst_i_Page_034thm.jpg
b8879b4a66ee149b1c14f618b37a1675
e22e24e314da4c6278c8fdd642f00de440389692
395 F20110217_AABGNY hurst_i_Page_120.txt
860c9ec2c8475c7d59e944c55d4e18f9
d2b505d0b549c0f6818262da9bbde25a8a1ca7fe
F20110217_AABGPB hurst_i_Page_016.tif
49f444d16b6d6783532518097c49d68f
3dfa173d7ba88334bc841dcb07d87fb1d31e66a7
9390 F20110217_AABHSE hurst_i_Page_053thm.jpg
c3dba90fc0c0e8a41ce54095e6b8877d
b1aeddbe2615918ed4d635cdaad8ed7d0466e286
9292 F20110217_AABHRQ hurst_i_Page_039thm.jpg
8ba6b9cab9c7e7878e70c222c07d5dfc
58adc75bb1faa0bcc211a4e6904d8c314ce15bce
109350 F20110217_AABGNZ hurst_i_Page_073.jpg
d80696d1487629c74804f73c13616270
f51b01085ef79c80df63a2ad503afb6c893de421
F20110217_AABGPC hurst_i_Page_018.tif
75fe58b5717783f8a44e28e907d0f83f
c980801373b223881d29f812d6efdf7f8770abea
9276 F20110217_AABHSF hurst_i_Page_054thm.jpg
b688ac5a2f29293225e30991c9b41f84
dfe984a6f8f3b2f92e3ba84602c8cc0dd834c764
8596 F20110217_AABHRR hurst_i_Page_040thm.jpg
285e3e29c72b9dc582c6fdfb1584d26b
5275b2d951248ae4834a19f16b70287de835fac2
F20110217_AABGPD hurst_i_Page_020.tif
1bd7e1793780a3d2bcde6e05826c19fb
18475716e0173b4b6e53fdb34da340ec6929674d
F20110217_AABGOP hurst_i_Page_001.tif
a3aa50c0af734c77b5f31a93c1d4591d
3c1426c27ee6ffa430cb033c551029a6e8b40c8d
6789 F20110217_AABHSG hurst_i_Page_055thm.jpg
e9a668ec55138cb85f2190e7542242b6
dac5e3bfeac86dd2b427afd05118230d781fd365
9795 F20110217_AABHRS hurst_i_Page_041thm.jpg
0950cc8f3d0c918d2158b2e9614290a4
262d6200e7760a50b9cfc1538076bbb1f13a53c2
F20110217_AABGPE hurst_i_Page_021.tif
83f6ac46e65ac558febe0ab728ec77cf
be473e6f1b9153b77e836f0b59a52005eafeda7f
F20110217_AABGOQ hurst_i_Page_002.tif
8b4a823384e5761cf0ccb60bc2d9d26d
df9fcf5037fb2344614e97be3dbd75c2c61315cf
3738 F20110217_AABHSH hurst_i_Page_057thm.jpg
d950aa9ab8efb2c4621457ac02ff941d
a5dc9bf2ac83b8a6eacb7dd81f861f69c2fddb74
9695 F20110217_AABHRT hurst_i_Page_042thm.jpg
d303ea0f123640390565168d7d16abb2
ef71dcc0f7d75cb4a09ff1c003dd296e0c8737af
F20110217_AABGPF hurst_i_Page_022.tif
f15ada2501325e44abbb512c1adb0cc7
c51dd555423578e8abd7b39ead5a5ba87af48e63
F20110217_AABGOR hurst_i_Page_004.tif
f7b81b391bc90f202e167b1836989eac
bbae54463abb71937f9f11e7bfeb048bcc6fcf33
6296 F20110217_AABHSI hurst_i_Page_058thm.jpg
8bb23f473e0612448a1931b89244c1e1
9d994c25892c8fce1026026f5ac994614044680e
9413 F20110217_AABHRU hurst_i_Page_043thm.jpg
138624f1f1a1ce7f507dd3d710b7e189
21e67d4742238a980c5a8353d28d42439e61419a
F20110217_AABGPG hurst_i_Page_023.tif
fe41890d37ff98a628d3b16b672a7540
4a9b54ee4a25a97c320eeda4ef7028941c110a4a
F20110217_AABGOS hurst_i_Page_006.tif
0f8bb3ddfe2487ef68d2d0305eda109d
3f29cfd407abb2d0ccf3e5c6e8478888e5cebf6a
9546 F20110217_AABHSJ hurst_i_Page_059thm.jpg
d1b477c0e2d7ff7ba556907237bb7908
77caf9134747fc9dfd1c0738c59704ab29698067
9311 F20110217_AABHRV hurst_i_Page_044thm.jpg
9e612be27ddb53159b9cb008b67f43fb
97bf240e278ce4446d53da21897b49c0c6707b0c
F20110217_AABGPH hurst_i_Page_024.tif
e0499d8863187840a915a30c2e495d40
345b7e435dd9bf43c072cedf921ef9313de01bee
F20110217_AABGOT hurst_i_Page_007.tif
2bd28e21d60a2ca717e4dbbc1db6184d
0df5185ae74b9487ae317b39f41d656f5980bc2b
7533 F20110217_AABHSK hurst_i_Page_060thm.jpg
c06ce44f511c3bbe25a66e02453863c0
df7c1609fb92f6f7c19a3c8247767d9fe6ec827b
9188 F20110217_AABHRW hurst_i_Page_045thm.jpg
eadeecde8de962eaa7f0897d4e1882b8
7c734c6a9e67ccd754c0eb46336aecbcde0d4966
F20110217_AABGPI hurst_i_Page_025.tif
06283394c8c0b362765415b2330ee229
3a7134e7dd0b3a1078d918194d90dab37086e6a6
F20110217_AABGOU hurst_i_Page_008.tif
e8b2ad8a1d5617084dc1864fddfc34de
42ac426c6c591a4846f884391729694f535f5d39
3890 F20110217_AABHSL hurst_i_Page_061thm.jpg
607257724d5d10c8780e126d7eb790bc
05ca9080c05eddd2fee527c84a8168195d49e53a
9465 F20110217_AABHRX hurst_i_Page_046thm.jpg
3ef626fa8389a2513b4c4d203a42361a
dfe74eae9f9f7186ce915bc1ba12eacf8e80b6c4
F20110217_AABGPJ hurst_i_Page_026.tif
c4fd407c963d8d3bb26da1e2966c4e55
3ff29c93bdc882f3eed31379b4da154af447ed93
F20110217_AABGOV hurst_i_Page_009.tif
84b4e1e830095fecb87d1caa131467f2
be6242e435dfbbaaf9a3230d0a2dacabce01d8d5
9227 F20110217_AABHTA hurst_i_Page_078thm.jpg
e6211ead7b38de1271438b473f35a883
9b0bf4da071b52ea3fa4f673b99913df446d786a
7259 F20110217_AABHSM hurst_i_Page_062thm.jpg
249d14cf593ea53d42832d878252ba57
cb84a745cd5320b8cc9cd6c2aea2559cfd7e28ec
F20110217_AABGPK hurst_i_Page_027.tif
bf929ce061215b19297ed06df058c52f
b4ca3edafd1a933343a6e9512c110f6e50d57466
4665 F20110217_AABHTB hurst_i_Page_080thm.jpg
d052068e82baa31ace33da9c6069abf5
59f9ba8da630a326c74ec4323f32a50dc14f4562
6555 F20110217_AABHSN hurst_i_Page_063thm.jpg
de4451910ec27887e5d4f2beb06fb4d2
70686873af69613e4476579dbcf9c6c57cd2826e
9318 F20110217_AABHRY hurst_i_Page_047thm.jpg
09d16fe0c1ab3c0e374ea14ec9b43f20
02869aab10136b76d0e96fa82efda94e921a2c6a
F20110217_AABGPL hurst_i_Page_028.tif
e34f41c13d3c369f57f9cf49ee5a36f0
f54be3748c89ebdf1561e2a37cc9773c285556d2
F20110217_AABGOW hurst_i_Page_010.tif
edbbc2f7c6472ccac27611483957acae
50d1b9a269491946a1ca656ae1184209594eb298
4691 F20110217_AABHTC hurst_i_Page_081thm.jpg
496493b881395b31410b9fbdd7e4443a
0c7d9cdb0cde749e944efb85c2bee7541b898e94
3603 F20110217_AABHSO hurst_i_Page_064thm.jpg
b0e71fabab70b4f86061b7a31f63b7ea
a84148f96f4161d048afc7ee0a868e098a2745f8
F20110217_AABHRZ hurst_i_Page_048thm.jpg
68e42ed79b41efa9b1f858f61723bcd9
defbaf62fc9d6cb34872de7ef6b702319599a1ce
F20110217_AABGQA hurst_i_Page_052.tif
aa485080774d7e0ed703f0b65dbbf2ca
cf1b6163bf556dee16a3bdd064d1e19cff703625
F20110217_AABGPM hurst_i_Page_029.tif
d870f0575bca58c2f3584499af5a54f2
5a58f2df1bc6c8c93adb3c74a30b3fb6a124d9ae
F20110217_AABGOX hurst_i_Page_011.tif
2b05f3a433ebddd592ac080da0ff0193
95cfb460893ccf81617a96c56020fd6451fef250
3709 F20110217_AABHTD hurst_i_Page_082thm.jpg
2d9a307866b044bb7ae0023f1a0c4456
f97616bff43a53b2959c7d61d35ce16824f59d92
5771 F20110217_AABHSP hurst_i_Page_065thm.jpg
872255c198b52fa89f3c8ea793f3e477
e81309b6c8f5ad826398d38303df3a9ca97f0167
F20110217_AABGQB hurst_i_Page_054.tif
be139d289452f2c906abbc4b6d871eaa
8f95685dd42ed0e9e869b6c7bb5c51a1c0e9a7be
F20110217_AABGPN hurst_i_Page_030.tif
2ebfd204c2cebb2accf68a2d3873b645
6e5cf502029a34d09754dd210597656b98ce4b7e
F20110217_AABGOY hurst_i_Page_013.tif
2fa2ae69a6e092beb85ce0f373d69d5e
5113bafcab94cd0cb933354a06b801bc546bf9f4
4595 F20110217_AABHTE hurst_i_Page_084thm.jpg
3526206d2b0bde474bd532185bd76aa0
7f99ebcb0852ea3a2c1f9625c7d9258139180dde
7103 F20110217_AABHSQ hurst_i_Page_066thm.jpg
f9a650ccc409bd86d1eb7596876d3503
52202bd04eb5c982cfb47b90c221cd0c55c4a3de
F20110217_AABGQC hurst_i_Page_057.tif
d76c1a59d98b765f20032dc403944727
6d3e496c5e1207080c2c2f05e61c27c6e600ae76
F20110217_AABGPO hurst_i_Page_031.tif
6d9de16185d49b2ad30ffeb65a6df6fa
b2117ddca94b5215f81d3e6388411b44ec7e76f7
F20110217_AABGOZ hurst_i_Page_014.tif
91dcba716d6ffaf8f7ee6ba23afb2666
cfeab08daddf671771d53e41b636ddca78c717a8
5604 F20110217_AABHTF hurst_i_Page_085thm.jpg
eb05d949b5e20350afdce0227850e6a6
f559c256479dfc8c700c4f1159002726c1aaf300
4530 F20110217_AABHSR hurst_i_Page_067thm.jpg
05282cbc548f88a9e5dbd6a53c0beea5
d53f1e79025196425e7ae6e29e263128473c692d
F20110217_AABGQD hurst_i_Page_058.tif
36e5c12d537bb814a0341d6a9c1ca120
b213d0c260698f04a974c9873c8bd61852cd2cf2
F20110217_AABGPP hurst_i_Page_032.tif
a5635d865f6d05621050754b8200a365
e0caab2de718df87e5cce9dc098d00ee8b664070
2602 F20110217_AABHTG hurst_i_Page_086thm.jpg
b01565384ba18e71f7ce2a880c8dbe9f
5815724abcad41f8ddbdbbfac2dcb659fa7d99a3
4687 F20110217_AABHSS hurst_i_Page_068thm.jpg
eac941d269768f3791aa0222c857eb7e
d5d413ee7ad5583fa622cd31665a961f7bf7cd33
F20110217_AABGQE hurst_i_Page_059.tif
fda43092efe7cbc7c120034427430945
5659ddfcde551d48f75541797b69faf96ad58eb0
F20110217_AABGPQ hurst_i_Page_033.tif
e4734d19acda92d85456ad368e1404e4
747080f49ba9bd3af4984a1363e64b8aca4e1b24
7786 F20110217_AABHTH hurst_i_Page_088thm.jpg
0515b6f41d6f2c362000e74d32da546c
27c8bc13ee97f206bfcc0ecaf5c86d3f69bb0839
2999 F20110217_AABHST hurst_i_Page_069thm.jpg
8700a81a5025fcb5b5b2231b09d7834f
372dd33335cdcbf9d09ca54b34cc477fe36d784a
F20110217_AABGQF hurst_i_Page_061.tif
02f2457d73b17f50b8fb4dc56a7b8d6d
04437ef27fbf5d11171a54f1543f469adcd17fe6
F20110217_AABGPR hurst_i_Page_034.tif
6354a35866fbc69b96c84c3e40ad2f61
0e509681d07a56a2f7652fd3b3647984d6ca1cda
F20110217_AABHTI hurst_i_Page_089thm.jpg
4c16433b409a922e792e7709e8f59cdb
9efb5a1f9ce762579bf9249d1be62337ce922885
7099 F20110217_AABHSU hurst_i_Page_070thm.jpg
5910b7171f3808c4bcc4a62c9acbaef1
02e4ea842e3ad9cf1c2be2c6e42c8dfa86706367
F20110217_AABGQG hurst_i_Page_062.tif
850aafb7f4156ef3007a52c5fc6560a6
5f0eb61a2ad2a8b744c227629caa0979866de6a4
F20110217_AABGPS hurst_i_Page_035.tif
10591bf953614ef86a1a23219e97e14c
3d471929bab4e95ac3befb18b49b330fb6da5e40
8778 F20110217_AABHTJ hurst_i_Page_091thm.jpg
05c13dd87f99ae7dcb10fa4691c33cc1
a873e8750e0989f48b382583003481cdb90b126f
9256 F20110217_AABHSV hurst_i_Page_071thm.jpg
563e75c0adaabb0873327554ec633967
82a5750285e1a9779f660e3d0610ec8170d94c7b
F20110217_AABGQH hurst_i_Page_063.tif
ce5a86d2e3d3bc6b931ad113df582095
281455a6a39bcb87d4a2d1fee7742c6aaa793943
F20110217_AABGPT hurst_i_Page_036.tif
73aa1d4ee0fb00cde10117f57ed9f7a0
abd4f3270f2c1d1f0443a02c60ccb8736a8c695d
9191 F20110217_AABHTK hurst_i_Page_092thm.jpg
0b38b737897c9155879ab52abe8f3026
3ca1ee352279d1d27d6ac116914e2d30b2e4d996
8419 F20110217_AABHSW hurst_i_Page_072thm.jpg
4288015985a1796ee4a761167cb61313
c88b1a924bd2b667b2cc37103ce60fdafc478497
F20110217_AABGQI hurst_i_Page_064.tif
94ccc5c22021bfb39401d4a8a0f588f8
7ba78063aa0e6b04c0cd051ce80f0a6556a179a7
F20110217_AABGPU hurst_i_Page_039.tif
da8c8d0b58b29764c35d85004a1a1f52
d7098120e8cdbb71e77a8e402d907c2f9f5f07bb
9670 F20110217_AABHTL hurst_i_Page_093thm.jpg
f2d667598332f7641ecea1dd06edc35a
cea4f13f4559b23adfd15237ec67a16d5c11b5b4
9241 F20110217_AABHSX hurst_i_Page_073thm.jpg
d0449bc098fe72a6bc0e13b4ddd7003d
5ffd59c65669ca1b28fa6d6a27cc544d02f8a954
F20110217_AABGQJ hurst_i_Page_065.tif
dc88ea4c871347cda851982dd3943c44
dcc20c6cd54260c7d27db22de64a8b9419c79f92
F20110217_AABGPV hurst_i_Page_041.tif
3f6819ea04e8b9c2dd4038f77a7f405d
496d8ca0cd46608dc49ecc369efc580e5b47db94
8630 F20110217_AABHUA hurst_i_Page_111thm.jpg
6ab6a2832ebe8dfe38e89c09159119bc
36e2ac78f7cb57aaea4d1868d790fbebf0103fd9
9598 F20110217_AABHTM hurst_i_Page_094thm.jpg
94d56dfb306f8f3edbe5fa34c9778fae
0af28245127957f1329f35222769b0c1f1ba9cac
8640 F20110217_AABHSY hurst_i_Page_074thm.jpg
0bc95199b3ae00252b5bd0d635083bf1
05ce6a329bdcc2fa0f0fd6df1bae7e8de1a69436
F20110217_AABGQK hurst_i_Page_067.tif
9688a5411f15a8333a8b7f78ffe11ef0
a6adb550fa83e28a47220015f34bb8364f853a52
F20110217_AABGPW hurst_i_Page_043.tif
785770106d1ffc5d2bc0f910890d60cd
84662348a1f248e4f18435a0821e92891b14fa36
9255 F20110217_AABHUB hurst_i_Page_112thm.jpg
4652552dc6623f8541eb1be8954c1036
b109c439619043db0f936bd7021cebaf30e89167
7905 F20110217_AABHTN hurst_i_Page_095thm.jpg
9ec254889a59dab14c4a6a17c2f76bd7
7634e1764b75bdfa07453f7e071d5642870441f3
F20110217_AABGQL hurst_i_Page_069.tif
0fd38cf35dcb4e520445c532710522f3
55a961ac31a396a9dd3cdcda2f94144e6aaaf749
9626 F20110217_AABHUC hurst_i_Page_113thm.jpg
728a6b5a5f99622f22ed41513bee12cb
79e810d4db1af9cf774f2de7d40b8bc7c970edf9
8862 F20110217_AABHTO hurst_i_Page_097thm.jpg
daeb75a560ecfb115e85bfd3ab539559
fb7645985360eae3e2c90ac5c9b287a1c92dd1d2
9601 F20110217_AABHSZ hurst_i_Page_075thm.jpg
c3ce0480f1ed4fee84d16973be6c2e17
bc9f66e5122a7e56e50f88455dd6b29b51d38708
F20110217_AABGPX hurst_i_Page_044.tif
9a52f643a8b4b050e8db25b4846f3262
9a44e4571fc0641eabc160d2c4969cf3ae42f498
F20110217_AABGRA hurst_i_Page_091.tif
e76650fd3bf595189ce70acad2405cb7
50f5670e9229a154fe8fab56af3c36aa47f13f95
F20110217_AABGQM hurst_i_Page_071.tif
6337d8cbeb3d8f24a3322f4d7a814b47
b96e0bfca5e7f5642f6a8443ec196de6e577cd29
8760 F20110217_AABHUD hurst_i_Page_114thm.jpg
5f9b3e218e7341c2019d984004bfac66
841100941d0df0dad314713d14612d296b132120
6151 F20110217_AABHTP hurst_i_Page_098thm.jpg
991c5bd2c01d3731a2ed82d67ebc0e89
64c105648a2ba27b623722d23dbbeeeefa7f7b12
F20110217_AABGPY hurst_i_Page_046.tif
1c2fa09831e36f1db4501a2f0d2f13ca
a02d37b02eeb81e8d5a2a43a4ab4201d358e0b6f
F20110217_AABGRB hurst_i_Page_092.tif
04726979d2e5f8b69679a18f6f9f3457
7b226ab681097b5f4ff11c90f3e00a5388631d83
F20110217_AABGQN hurst_i_Page_072.tif
a86a05d700db336eaac9b4c23c24e92a
fdbf1ae655fa3d58f60a491075110990c164e236
9114 F20110217_AABHUE hurst_i_Page_115thm.jpg
6019d96a44ab46408cb92feb8fe69244
45ecc97a10a3c306d79f9db2c0a890621f49809e
3700 F20110217_AABHTQ hurst_i_Page_099thm.jpg
209076983e0ab2dd014630c0ad7bcadb
4c792cb14a10662ffc92270103c47f1c88664332
F20110217_AABGPZ hurst_i_Page_050.tif
0f3158147ea46c11c6213633f3204350
487d5c8923fcc2aca6dc0b35e02a35de4180190c
F20110217_AABGRC hurst_i_Page_093.tif
d5f39353bfb1a6dcd15272b395df2efb
ecfc65028ebe3699d0362ec5e0e4e27d7a923632
F20110217_AABGQO hurst_i_Page_073.tif
c2877ea498e30c20fdb8ca963aa2ec42
c9fc1d8be39c2fa6f30ec9a613021986727ec758
F20110217_AABHUF hurst_i_Page_116thm.jpg
2d52df34a34cf62cdce7b68343aa22dd
ec022f52d9cd4d42c24342f1982c092581e6e36f
2779 F20110217_AABHTR hurst_i_Page_100thm.jpg
b203cdc1bc8f397a294483f5831a57e7
cf6a01ed0fc95470971c2bf084c7780fc1f6e3eb
F20110217_AABGRD hurst_i_Page_094.tif
8c454f4f07a33cd149d0e5d3cd194034
b4cee6f95db704c9b9922352a42b03053c81e785
F20110217_AABGQP hurst_i_Page_075.tif
9cc3b9d62256f5576595484c098548c0
08a470686596ec20ff4c9c50051a6754cf7d1067
9060 F20110217_AABHUG hurst_i_Page_117thm.jpg
df0ec339e4f7100855a1acbb4d0ea4bd
65d6e53782c05e25e2d07cbd739b81d8f52dae47
5237 F20110217_AABHTS hurst_i_Page_101thm.jpg
9b0eda93aa6921558fe49e52cb85c1be
6ca8d4beb36914e8e64612e06970c4277f1ec1d0
F20110217_AABGRE hurst_i_Page_095.tif
0f7ca16d1d48ecb9e46381bb619c6560
3dc7ddee33655e54cbc0222930566d8fedaf58dc
F20110217_AABGQQ hurst_i_Page_077.tif
cb7a008e7f1f3642f091a3f56397b317
acff6cc36bf436ede349d50c1992aa29e3351e27
6680 F20110217_AABHUH hurst_i_Page_118thm.jpg
3e0d7e48e729d9f2c8fa025f28836da2
61a3b78f11d0c1c65eb01bca597b8cd169aa7298
4503 F20110217_AABHTT hurst_i_Page_103thm.jpg
93810c627b30c0ca1c455371ae841f54
d6be4517838e2333c46dfb472e115c2263b9d1be
F20110217_AABGRF hurst_i_Page_097.tif
257a38d65ea5c44db081613b1f96a5a9
1788f83cd96b5bef7659c1b00b356c8342d163d8
F20110217_AABGQR hurst_i_Page_079.tif
f1adccc0e658ce656d191cc9363d5ba1
aa526aae96279894b2ebc33ad6a976398e1f2ac3
3754 F20110217_AABHUI hurst_i_Page_120thm.jpg
34091ce07a84131dca5dbb49d17edad9
cf2d6515dfb78cab0b495b4940db506e32ff812c
4396 F20110217_AABHTU hurst_i_Page_105thm.jpg
2e537a7e428c8d0ea4f325d84401b0f2
fca710e605e674b79f47b5ceaafa485bb35fc3e4
F20110217_AABGRG hurst_i_Page_098.tif
737c45716bbda79bac0c166b7fd25747
5e22e86e8404624f1cce1bc74596ccbc2644bac7
F20110217_AABGQS hurst_i_Page_080.tif
abe89adbec590081f842fd1b6cf6a364
8f64d6553d37b8ddf3582c815b993bfbc969b100
5730 F20110217_AABHUJ hurst_i_Page_121thm.jpg
c638032d22daef47392a457e7b52fed3
e60eda07bf3d90871e333b1926093e20716209ae
3150 F20110217_AABHTV hurst_i_Page_106thm.jpg
4b0db9dbc24a4d7cc55a02444cceb45d
697ce71673afd9147e65e8669495ac3e9918cbd3
F20110217_AABGRH hurst_i_Page_100.tif
4abc01183a3630c8520aae837c0a7c1a
e4d020fc05ec822e4006abec2c4fe12c03065dbb
F20110217_AABGQT hurst_i_Page_081.tif
9991acca6b39f44313cb7155ae2aa3c7
f86a7cffd56a2c05ff07dc985bfd26b5a1ac9ec3
5727 F20110217_AABHUK hurst_i_Page_122thm.jpg
69a8254d8cf5c1d3fa02a7e3d992e71a
c6dd0b23a285852ed86600ec20fd873425f1b7eb
4625 F20110217_AABHTW hurst_i_Page_107thm.jpg
52b89a9752a8d11e987f6b07dc3ce557
9ccde7ebf504e276c6a79d01c22bf7209a8fec8d
F20110217_AABGRI hurst_i_Page_101.tif
006e1af2767a585357c692e4775f1850
cedeb6b669e1f9aaca66ab95f709d39f822062bf
F20110217_AABGQU hurst_i_Page_083.tif
1c91e95cbfb24051ba146da6d1bbc4ad
f0935a9b90bbd699eaaad5e19068344a2cc9ef58
4083 F20110217_AABHUL hurst_i_Page_123thm.jpg
787b714dc94a774373f2248825b5ac61
115823523997b844f45f81da22bc583661773c7d
7886 F20110217_AABHTX hurst_i_Page_108thm.jpg
9b2448403c44df6d43d1144bd7f1fde2
7673faf3917bd690772c415eb51e925f642d09ce
F20110217_AABGRJ hurst_i_Page_103.tif
c38e75e77b62770efa1102ac2e2dc544
8388fa4a2df342ff8888c150746e4cce3de65e93
F20110217_AABGQV hurst_i_Page_084.tif
5763a5cfcbaee34a4bb2d30a7ba051bc
ec7a500946ee3e72b9b0b7991086bc691579073e
9562 F20110217_AABHVA hurst_i_Page_148thm.jpg
bd4124b7e1ebdc7691b2373ed03321cf
cbfaf3bd3302a82ceb3d06dcd84541cdc0e1b8d8
3316 F20110217_AABHUM hurst_i_Page_125thm.jpg
cf305605a07726ea8d61300331de0386
a48ccb9b42b71229998a6140865bef0e9c15e65b
9259 F20110217_AABHTY hurst_i_Page_109thm.jpg
1354f1fb4fd85faa34b0333a16ea9730
7973a5794571a61d3f80476e8fd0bf714b7dae00
F20110217_AABGRK hurst_i_Page_105.tif
bfe156f974274f3af1c57a337f15035d
6a6d374ead82d66b1ead934a80e5b6cacdc7331a
F20110217_AABGQW hurst_i_Page_085.tif
7e22aada8d2799c0800d13aeed4f0faa
27d9225df2d818acd870404e43f27624cf129c4b
9644 F20110217_AABHVB hurst_i_Page_149thm.jpg
0167c4641e192ba64600bbb81f386192
be733715696d8d66459f130d8b8d9e6cdbfd0d8b
9050 F20110217_AABHUN hurst_i_Page_127thm.jpg
7babb721f6a82146add7d9522fdb2074
fb5953ba8258cc2bd162e18dca24fcc8c95fc695
8956 F20110217_AABHTZ hurst_i_Page_110thm.jpg
ab349108d5b97c3e74f7fae746c77c2c
47bc2de252c2b84bbc01326c7eb7dc9df2da8eca
F20110217_AABGRL hurst_i_Page_106.tif
f07f18e4c37fa82ee1ec8667ef6b106c
88e4efa359c31e42f28dfec5a214b5e2bcb9616e
F20110217_AABGQX hurst_i_Page_087.tif
ba3fa0d9ca01d1ad78fc65019bf97b37
d6b49fe5afc353501d36559f0403ffb6deac4ae1
9420 F20110217_AABHVC hurst_i_Page_150thm.jpg
e635e2fa2253d60fb578acbbe414834b
3ab5343ba9a4319d29c5cfb57e228baea02c48db
9650 F20110217_AABHUO hurst_i_Page_129thm.jpg
ee76547b844acd14520eea1b34dab1af
acf3ab9ca5492ae607227034109e3a99f2cbd9ee
F20110217_AABGSA hurst_i_Page_125.tif
21794f3c40d26132ffcce71f6ff8a0d5
c4bfb7750f737f97b913075938d39c808dc73a57
F20110217_AABGRM hurst_i_Page_107.tif
f6d468ba8d7fdd8b177ee3a3d61d73c8
b48642fa6ca0cbc8871b4c6078e520728c811a9f
9455 F20110217_AABHVD hurst_i_Page_152thm.jpg
79db94697bb1e80781a19cf1ea66d48f
37304e75995482d2e31cb1aaaa51ea8f8d44d4e9
9380 F20110217_AABHUP hurst_i_Page_132thm.jpg
9fb3c825c5f22ce71a170b18554c7223
7d40d07185d33c6d13b5cbbb3ba5bd21319ca4d0
F20110217_AABGSB hurst_i_Page_126.tif
08093d09cbb4598f9f0119f9e837439d
4bcfd909bc7577a8c7843e05260fe4651702dde6
F20110217_AABGRN hurst_i_Page_109.tif
b5607816af758fe1e6f615fe2a4c531b
ed7a07c1d502e8b53b949767f73d6f351ff81311
F20110217_AABGQY hurst_i_Page_089.tif
76326cc51871238bc818b58882ea3941
91bce83babacdc574885fc6460b3bc2885cb8da7
9582 F20110217_AABHVE hurst_i_Page_153thm.jpg
13e4142b617016406db4eecfc999a3d1
5b6a3515ee0ef7e5b7d5aa8e53253757082788bd
9499 F20110217_AABHUQ hurst_i_Page_133thm.jpg
add9665d27b2e4244bc5c5b019ac0ddb
eab1a4a94cdb6b0f7b95444ff35eaa3b5f7b9044
F20110217_AABGSC hurst_i_Page_127.tif
87d125f4e7d45c0b8f17a59d6272a5f3
8fd9ac37d4052dc02f3cb9c4bc1eb150c378cccb
F20110217_AABGRO hurst_i_Page_110.tif
3de72003b11c52188841d0b73f110efd
91ae2b5e891fb62194eef9f97cb0dca8b377917d
F20110217_AABGQZ hurst_i_Page_090.tif
671002bbc72a35932fdf4e06f360c9d9
6c6d2251b1fcc25daccb0c1473e6e4c939ea9290
9770 F20110217_AABHVF hurst_i_Page_154thm.jpg
71d2d152e207f5be4b42051333119818
26d1fa67bb9d38d7ff427cf36be77b7e1407609d
9485 F20110217_AABHUR hurst_i_Page_134thm.jpg
e22e9d5a7023270f11498ed15d0c0d95
e668425dab990015d0c04bbdcbacc372bed68b2f
F20110217_AABGSD hurst_i_Page_128.tif
f4b6e76466a343da81be72278d97718d
752651978ec5ceb076fce5854d4e01652eee356e
F20110217_AABGRP hurst_i_Page_111.tif
2ca962563bee93d9727db17e3a49ef75
b7d826c093e5cd118522a80f0c01f3864866bc1e
9214 F20110217_AABHVG hurst_i_Page_155thm.jpg
fa7b943d9268621a39e0d1909a2a2530
e7a98fdec8c94f239ca34255c15bb45adf2c7161
9149 F20110217_AABHUS hurst_i_Page_135thm.jpg
8edf6aa8743805083b8b1596b8fa7e24
15518ffc817b260eabe8d08f888839d77c7e90e5
F20110217_AABGSE hurst_i_Page_131.tif
67b31d5efeeaa9eaad72ff12c833d0e7
100d4f7865e144b8042efc2b8126ce114704de45
F20110217_AABGRQ hurst_i_Page_112.tif
812d4c20b919fe9482f1fe3a3659a072
99da692750887ecfba88147a30d8d77ccb8887a5
9613 F20110217_AABHVH hurst_i_Page_156thm.jpg
012cd6421a88ae000418c49f46f9c75b
da9a33f1c21f0f93c0cd39da57a47428b28dfb90
8954 F20110217_AABHUT hurst_i_Page_136thm.jpg
ac50e4b01875e1c4d9caaadb48777c23
9ba236b597562178aa5a3b9199666fbb4e38a6d0
F20110217_AABGSF hurst_i_Page_133.tif
2ac764f6c9fa05323d6371691c17bbdd
f25f0fb9d978ab0689de1c9aa764cdb20562d828
F20110217_AABGRR hurst_i_Page_113.tif
98b25da7446a25141058f1e5a843b303
d5432db9d0ff600aaf4f075192fdaf58ea8596c2
6290 F20110217_AABHVI hurst_i_Page_159thm.jpg
c637239506c8692e3ae2c8ae6d9ce7e5
5d292bc9bf07829c5acabdb2adbd2c3aed44b89f
7066 F20110217_AABHUU hurst_i_Page_137thm.jpg
249a7938b0687f1c9b9ba2c05350162e
6a9c3c872c34317c21a99df167d9054264fe0e31
F20110217_AABGSG hurst_i_Page_134.tif
673bf9ed87ceda8c937f4e87504b8e0d
1208ab1bd3d3fe2f62a108ef8b729b63d3f84fdc
F20110217_AABGRS hurst_i_Page_114.tif
5bc94a5d28933e22271191dd249ea82f
5c88179e5df9b23174526eded99b797c5a2f2601
2623828 F20110217_AABHVJ hurst_i.pdf
28e4cd5775c1ec104aaa29f6a2e6235c
4ad99140e5420f46df1e37691238bf313bfeb8cc
9526 F20110217_AABHUV hurst_i_Page_140thm.jpg
049bf55e4f6f52135cdb338a24ecd1a1
aa900e929353ed94378cdec3372360ddc8c19043
F20110217_AABGSH hurst_i_Page_135.tif
3dd5a6786e65f33e8137d3ea5bd47550
67dcb1ee2b816fe6f8c567954de1cb7490fd9acd
F20110217_AABGRT hurst_i_Page_116.tif
0cf6356d7868b6ce25f01c3a78a4298b
9cb3b9f65931e2f9d41ab7a93db3e4b8da66d05c
186160 F20110217_AABHVK UFE0015240_00001.mets
1ea729dd8e3bd1d59fc6a90ab7c4bf73
0a2b2f0e8fefadf80093aa8855d4f4ecf8e7b030
9315 F20110217_AABHUW hurst_i_Page_141thm.jpg
2ca602ae425c38998cc66f4cc273db75
c9505910fa3eccecab801ada3e964ffc36f3d51b
F20110217_AABGSI hurst_i_Page_136.tif
3de5f175bdc7cf7f56e1d7762c943d41
445bf9cd7f624ca8064b289077364fdf81cc7992
F20110217_AABGRU hurst_i_Page_117.tif
934f7804c75681d515c1ee1fa7f8b5e3
1d0a773855c5a24547259569f2cd4ae317377ede
9677 F20110217_AABHUX hurst_i_Page_142thm.jpg
1e24b83c957e43156c5f582ff76d8e64
1a148f2beabe96aee695c2f4aeb3a51d7f34326c
F20110217_AABGSJ hurst_i_Page_137.tif
c18dc8fccc52741b9364636829673fb7
678162156a34c8b5220aac4d03f6e33080d7406f
F20110217_AABGRV hurst_i_Page_118.tif
fc190496e574a2abbd5382c39fa43cf7
5e29f37540401d07e712cd2b6cd7010855d38df0
9805 F20110217_AABHUY hurst_i_Page_144thm.jpg
8dab94557cbf80b361d7eb81be264e0d
4ff65abb08f7cbd53c6d9912b5996e20ff0be38c
F20110217_AABGSK hurst_i_Page_138.tif
95d0b35c1b13dbe30304fb25684d1907
adc7cd2f5ed3ea1278f078400976830167a21783
F20110217_AABGRW hurst_i_Page_120.tif
521a6023020d0acaed1e309683231cda
848ab7284460f1bfb93d0c85da893345bb702eeb
9474 F20110217_AABHUZ hurst_i_Page_145thm.jpg
a53c84f0c88bcf1b5e2def62278078e0
a45641927deaa045856dbcc18b66a5971440ab81
F20110217_AABGSL hurst_i_Page_139.tif
930a0aa4eba4dc0f5d628ee7c2f48e75
aee7148f11590cb77e82d83760ba14c7f339b89e
F20110217_AABGRX hurst_i_Page_121.tif
4c9e3de11e4b8b02884eb4bc369a2d35
c546087ee1e828024364904c22d24dd52f2e288c
F20110217_AABGSM hurst_i_Page_140.tif
0d7e9b5eaecb6a213d7b014ce350180e
495578aa7642f20807ad6d42bbf0082795b9b035
F20110217_AABGRY hurst_i_Page_122.tif
723e45e8013f22cdc3d4a1115e18a2f8
29d6a2f378c3cf4fac31d5323f78058be7f01b85
F20110217_AABGTA hurst_i_Page_155.tif
31c745161f8292d6913e761a6eb02039
4ad613a84425181c328c0503766a65b6684a71be
F20110217_AABGSN hurst_i_Page_141.tif
1f6d154c62ce52ab50b669fd73b81b73
e9ff48d343898ac1313716776de85c39d6d2291e
F20110217_AABGTB hurst_i_Page_157.tif
98a4863dbbc39b9728bceb8d39722706
5dfbf0ce4d6b177e66d98465ef43f454db077be8
F20110217_AABGSO hurst_i_Page_142.tif
4881c5e419c3ae56bf9f4f31b924aeb8
42f328031dd5bdda97b20d01bd085aeaef8384f7
F20110217_AABGRZ hurst_i_Page_123.tif
6763c75873311daad8115cd8099559d6
27abf39b777dcc7b234a9fa369809bc87b70808e
F20110217_AABGTC hurst_i_Page_159.tif
03d21d505ded27508145b478190ade76
db5ed4278650614f23c7789bd6654c144339d8ad
F20110217_AABGSP hurst_i_Page_143.tif
d80a99dfc57d7759ada05cc706e29581
754322f228b59233975080ea2be2626ba3c518d8
430 F20110217_AABGTD hurst_i_Page_001.txt
fe4de4da3347daf4e33fbdf2b82e2655
b5cecef8d5280e0d03465baa09b359a45c8b9f09
F20110217_AABGSQ hurst_i_Page_144.tif
0590e5ed04987106e1e9d16b239521f4
76958def55ad1dd088f69b807ab627e0ff7a9e29
103 F20110217_AABGTE hurst_i_Page_002.txt
3b66698390523718a00b0d20c16080b9
520dc640a634570e23c43f4662c94aa9826a3ab9
F20110217_AABGSR hurst_i_Page_145.tif
c3c7b04dbc58f1f59f51ee4c47641c3a
659a718bc0c993670385e372e9fb15cf7854d874
1499 F20110217_AABGTF hurst_i_Page_003.txt
c249178fa37d0533a17038c02b4636f8
616d63ac9a649488fbebfbc8db2df3956af7db2a
F20110217_AABGSS hurst_i_Page_146.tif
753c2ad1275f9fd87333d53a0fe5042e
5def784404cf50f71f009df954ffc295536ca386
2142 F20110217_AABGTG hurst_i_Page_004.txt
c2f24ab60faa311a8a29c358bb6c944b
c5048ae313b8720f1cca991b52d08072796d3764
F20110217_AABGST hurst_i_Page_147.tif
d841b1856d5bdb32b2805b6adeec1927
b1353a053c3a0246cdb87d5a7d2178e805d6f94c
2034 F20110217_AABGTH hurst_i_Page_005.txt
bde595b4e4ddddf543c77682c6708b72
56d7a65352bca8a332446a481d715fc0a0f351d0
F20110217_AABGSU hurst_i_Page_148.tif
6c581f7f28698b2d0f7fef0d155b160c
53e0d57b7b1a25d33444b5a0a5b97c8d6b10a4ee
334 F20110217_AABGTI hurst_i_Page_006.txt
3968d65700a0d667153d6e8e0866ea5e
111b0b9144efeb8b9abdd1e05fa54559de364d88
F20110217_AABGSV hurst_i_Page_150.tif
a361425285841026fdd2b40e31924de7
3d53c30f1c30ed0fadd01ce127e50f472fb5f575
2138 F20110217_AABGTJ hurst_i_Page_007.txt
f31acea02333be3ed77aae5575e66701
6e7134f6d1d7de8ca304dc8c6153c8e868bbdd08
F20110217_AABGSW hurst_i_Page_151.tif
1bfea3fd974719800e5ccbf86adde965
2686679f7f589019dd46c57f27ffcd2097444c2f
2723 F20110217_AABGTK hurst_i_Page_008.txt
f3833a04f9fbe0b276d2629d17eaec60
b786942804708adf3e160a262be48a6d8f1c4cb9
F20110217_AABGSX hurst_i_Page_152.tif
b2c4d34b13bfe4ff0092effaebb72456
75ba5dac7fead842cd3afcd57aa73297602f7544
986 F20110217_AABGTL hurst_i_Page_011.txt
744aceec789d6274edbdf6fe11bd8b33
8df4605dea4dcefa4690017a27773a5aaee82da3
F20110217_AABGSY hurst_i_Page_153.tif
27c42f620b0ed8116c2008d4d22fcf06
2b85ec367c22d4aa0eba39d30382bf41bc4ebce0
1575 F20110217_AABGUA hurst_i_Page_033.txt
ddd1a106ebb76a606d924734c71eacd5
4c9a9fbc2789b442a8bacce9479b27be608074a2
1515 F20110217_AABGTM hurst_i_Page_012.txt
6123eed837e6e2d2582593934c98a1ba
83e08a4b927d1838e7bb96e3dfe44f4714f2200b
F20110217_AABGSZ hurst_i_Page_154.tif
7bc9b8019c2b18ed91af3018a48785d8
dd85c3486fcdc9de8e903640b8a8f802f3f67b4c
824 F20110217_AABGUB hurst_i_Page_034.txt
c6ea4b0fde60dd32968a696837d9317f
d388553e94def58dee38f0d21069a8fa4405ec59
1671 F20110217_AABGTN hurst_i_Page_013.txt
94744cc24a0a50304ee85ed0d2cc727c
15d3ea76092598bac3e24d9940f9f9b8f938a00e
586 F20110217_AABGUC hurst_i_Page_035.txt
778605fe93b74f5ba9aeda547c44deb7
d018d96a17ec8649567877660c6e0217b6b6ccf2
1810 F20110217_AABGTO hurst_i_Page_014.txt
02039b37afd7c1e0c43ee7aa541173c3
f97db86dea0fa178c0253d44b6e173158d74d849
533 F20110217_AABGUD hurst_i_Page_036.txt
4049d4afc89bcddd21fcfa917f46cdc7
cbabbc2533d6b4b810cd286cbc40937021abba6f
1859 F20110217_AABGTP hurst_i_Page_017.txt
bedd3ef50d7124d80ae53b8638aefa65
4c7c82abfcb34a660bee6ae3268e6309d33a388e
842 F20110217_AABGUE hurst_i_Page_037.txt
91372eb6e1c53c91c4948a3e90bda97e
ad5a68152444ac272fa73102ae6e9906fbc0a614
1694 F20110217_AABGTQ hurst_i_Page_018.txt
ae7a0e1b39fbe4499331e919e726fe32
a6c419d0628e6ba2027ff12925d66bb3856ffd93
1529 F20110217_AABGUF hurst_i_Page_038.txt
9923f4d47406f64c921b580f062ba22e
d5c65f04b9a1f49fe421d8bb7c958581c3321190
1852 F20110217_AABGTR hurst_i_Page_019.txt
57d9660ca6a75009cfdd06d6f0befbc7
7ce9282d40ab555442bea9f7cb58e81dee49c3c3
14363 F20110217_AABHAA hurst_i_Page_061.pro
5de17a9f422f010f2197674258b12762
a0d1558fa3e0adcde142551c5b5c82ee1a915475
1616 F20110217_AABGUG hurst_i_Page_040.txt
1176f76e9fb68a8fd1efe5170ddf007f
021dfb018dcb683e9fdea16e78cba08309dfa19b
1828 F20110217_AABGTS hurst_i_Page_020.txt
b7c0302bf507f50130ac3c64d5f0f8db
4bc861a43e63e54c832f5eb35cb3ddac81504282
26237 F20110217_AABHAB hurst_i_Page_063.pro
be533ec6418fbe74f5e2733a319e1e14
4564877e167d8c00471b6d1a2f83fd95bcf27ec7
1829 F20110217_AABGUH hurst_i_Page_041.txt
bc9f84ac33305e355c226243774b1c04
a56b9eb22d2134b380ccc86647b8c70791f6b00f
1780 F20110217_AABGTT hurst_i_Page_022.txt
005e4ab01c6bbd27e83c2b7d2b9546ba
988cf9ae4d7981015df5ec7cbfc18a9105938d85
16729 F20110217_AABHAC hurst_i_Page_065.pro
794d88dad039943df4c6f0a97d7448a3
16b3b4aa9ebb4e23e8dda7267b89eb2d18bef89f
1842 F20110217_AABGUI hurst_i_Page_042.txt
efc83b8a0024ae1aabaded830034e9b2
8640f25c4181cc4ba90c9e8aa00b4961c610ef06
1854 F20110217_AABGTU hurst_i_Page_023.txt
ed51f319636b8155fb2d816bd37b1523
0ffd8f8e1373b1b48b6e284f37e291368194af97
20822 F20110217_AABHAD hurst_i_Page_067.pro
f2dd3226e6b8bae3b008d84236affd68
7bbc1c290c297991847ebab12b406b9932a8c1a6
1720 F20110217_AABGUJ hurst_i_Page_043.txt
72502dee8154d01632e9e6c96ad28f25
18728b895da57b92b885785c115cbf4ca1aa2afb
1707 F20110217_AABGTV hurst_i_Page_025.txt
0bff968e61709a6769e4da5a57021f59
7d59feecda06839d669b7fb22e5059f190c1c4ee
20530 F20110217_AABHAE hurst_i_Page_068.pro
4e8f9355e11083729a8a5e6266fece2f
d5ca23ea863bc9acd819f6350990195b3a11b7bc
1768 F20110217_AABGUK hurst_i_Page_044.txt
d5ae72a4f2fd1d2180076e5cbbbc9922
28e322b4f2087e593fb78b3dd88b26b3f5f510ec
1849 F20110217_AABGTW hurst_i_Page_027.txt
8fa5396b3f47849e2ea290555417a6a4
423e2665f7143493018b34563df6954072194e49
43904 F20110217_AABHAF hurst_i_Page_072.pro
b23c783a369708dbd862f4c836b36d86
4371c8c2b0be5add77d0c594c8a9f5f0c0d1b020
1705 F20110217_AABGUL hurst_i_Page_045.txt
ad8eec1fd6bccd93c8a1d43ecc18063e
6908c3507ed227733030b87543b98e0e0f7b4471
1822 F20110217_AABGTX hurst_i_Page_028.txt
2d12797a9fbeb01de406e063961f65a4
c8dd2c3a3eac75ff7a22e3b33b01a6fa914dd324
47651 F20110217_AABHAG hurst_i_Page_073.pro
32b32b6ec0455e688d59886cb711606f
085f3a8022c241568e4c0b7c94ad35acd161340f
682 F20110217_AABGVA hurst_i_Page_062.txt
d69e4b8d47831d6c20f3c04569daefe9
0eeb4863ada2df075df7bd784bcda54663ea29a9
1747 F20110217_AABGUM hurst_i_Page_046.txt
ea2b896d337d0daf3e25e8f74bf97cc0
02ed98697c8f425141f40cf5972a7e24b2ee8095
1796 F20110217_AABGTY hurst_i_Page_031.txt
2e2d9cc716fac74336f12b957da30149
bd3680917d49bd06f91ad50b2bb7e8aec151a2e7
972 F20110217_AABGVB hurst_i_Page_063.txt
a70c9362ad95166dafc740fcbe4a7d07
325bd9a2581675795cf592ec48ceb0d2dc68ded3
1618 F20110217_AABGUN hurst_i_Page_047.txt
d66ea236008d8ce9afb3dce74585390c
e008bb250aaa1e8dc561b7fcafdfb2c2fc36f544
910 F20110217_AABGTZ hurst_i_Page_032.txt
2cc15a894774e54bb3d4964ecf0ae237
6281b9a2907487a28efee3ece7d2e9789f7ac503
42181 F20110217_AABHAH hurst_i_Page_074.pro
7991d4d8994a6b0656b038bc222804be
a721c713eda57b62fd7c297b003d9a4a696413e2
780 F20110217_AABGVC hurst_i_Page_065.txt
e7eb75d798d2f3166d6deaae8f7abbbd
2d58b7048b6cbadfca7a77f47997429a9dc2fc59
1851 F20110217_AABGUO hurst_i_Page_048.txt
a01714ac1945e1cd801a69725ca4613b
5d509199fabad45a01c8767e38f3334121d48ccb
46938 F20110217_AABHAI hurst_i_Page_075.pro
6ef09932ee1a611b78972fecb5ff3ff7
f5ee5059327a493ca3554c7120414966a85613f2
858 F20110217_AABGVD hurst_i_Page_066.txt
1d2983c5607f1ab2ea207315bd7c5582
7be3d0dac5c4e52dc66802f6ac29bf8404ada422
1462 F20110217_AABGUP hurst_i_Page_049.txt
f44ab8214bd8e38f41471fbbffea487d
e727fe6ff54b067a61ad6988d7af8a7b169254aa
42060 F20110217_AABHAJ hurst_i_Page_076.pro
fae6ceeb85e7004e6c6a5203b4fe0913
f1b590c238418cbc301a6989635a1f0d282db657
954 F20110217_AABGVE hurst_i_Page_067.txt
dc47ade9b5ccb63e3c8afc466b3a06e6
b0d1dc2bdaac92b59091946afb4603914b5decaa
1693 F20110217_AABGUQ hurst_i_Page_051.txt
71301ba745eca5366376c47944b19b99
79ac3299f158004ff7d4d920e5dc8d7cdad544d0
48974 F20110217_AABHAK hurst_i_Page_078.pro
87ef194963403071b75ae655c160851c
337ee43b167b7bab9b26516175a4292c55e2b3e1
794 F20110217_AABGVF hurst_i_Page_068.txt
3ab058480239f7f1256f922284e08643
8e4c790f9d688702ec6df45bcf1dfb691ef9a580
1755 F20110217_AABGUR hurst_i_Page_052.txt
9d7cf0b1b17280fa9d6933fe5c148f9d
81ff9782e70309cb02552ae0bc43e0ffceeab5aa
16924 F20110217_AABHBA hurst_i_Page_099.pro
d88886068f0aa8ba110345691c7ee518
1fdec37f93f017ad8268e183ef94b2985b843d91
49279 F20110217_AABHAL hurst_i_Page_079.pro
83209cadd4a5e1e9371b48d5d7983cf7
63f85ec5b373418880b9a5b9cd3df2d55b7f57d1
1476 F20110217_AABGVG hurst_i_Page_070.txt
95be59e3fa58e7aa214a1dd19f167930
5b57adebdb10c001c1c61f879b1b37ade5efcbe4
1843 F20110217_AABGUS hurst_i_Page_053.txt
37cb1d262e2058cc2622a17bfcf13adb
6c4f79fa18038bff93f910d2e070e0990872bf6e
12827 F20110217_AABHBB hurst_i_Page_101.pro
54843345b4d9317ebd80b438fe166060
d0e45a25371c5d3dde5e0d33fa7cee2bb8f0b6d2
20740 F20110217_AABHAM hurst_i_Page_080.pro
575f81c147449ee005a987ee449a5d17
8b34ebfab4d0c4d343713d8b9dd8a7c28777c04b
1561 F20110217_AABGVH hurst_i_Page_074.txt
d3a9d75352b02876d903476815661551
0d2bcb073ef8f446d60777f1b9b0be1bbb752803
1833 F20110217_AABGUT hurst_i_Page_054.txt
fa7dc6b807cd134049d952461e9baddc
a180701f8bef1bd7ef9600dce08320920d9d8341
17531 F20110217_AABHBC hurst_i_Page_102.pro
65c72e86b3a58a0623a82dbf6ab86f9e
6e84327f1d551529d1c0f1fb04dad52454406883
19927 F20110217_AABHAN hurst_i_Page_081.pro
17ab098d3549b751faa76e6076b865f0
f78d2b95b0082cf17af6abc8f6ba49a635506af7
1310 F20110217_AABGUU hurst_i_Page_055.txt
3f9d744aa5281c902feb62f6daf4c985
09c8a610bf0494145f2b2cf89c5db558d0ceed4c
16268 F20110217_AABHBD hurst_i_Page_103.pro
1cb4605a10bfaca61ec7d6a6c2ce8388
0f2b020e67315bd734b25554de4a128789d4bcbe
17556 F20110217_AABHAO hurst_i_Page_082.pro
62ceaf6f9ecde25411e9a2abc3b542ea
9fce58b9e975c6b2469d12c52b3526028a32eb8f
F20110217_AABGVI hurst_i_Page_075.txt
45bdaf33f188f07820f6fe2ebe3ce67e
786289fa3387776c4a98eef24ea6995b1f574756
625 F20110217_AABGUV hurst_i_Page_057.txt
3505cb2aa0a7a8399dc4013147ec6864
f2167bc92bc827674f3dde87e22f0e6d5b352767
18367 F20110217_AABHBE hurst_i_Page_104.pro
7072e90f12a055cadee8007044091d90
7695a749ef329e619d112538b00fee40e90b5929
19921 F20110217_AABHAP hurst_i_Page_083.pro
f427790bf65ccf877de024baed7c941e
15c28419208960cb9fdca96a1e436b1be077f742
1560 F20110217_AABGVJ hurst_i_Page_076.txt
30b737e6ca8120444665c08446e0fa10
47194f6fa227a055e24558feb654405442c670e4
1036 F20110217_AABGUW hurst_i_Page_058.txt
84fa24730b0d7243205e38d65d7cc2a2
ea2d7e8b844819bdb6bad36c10fe501aaf70e403
17590 F20110217_AABHBF hurst_i_Page_105.pro
f419eb9b440ece1b459f5ecf845c8e95
2a9be1b79a61c7333fd9141f464e02c9c6ca0b05
15109 F20110217_AABHAQ hurst_i_Page_084.pro
583c1e3c836151d786cf52edb98ebc8a
cb1c3473f1de4b0607fb6073c20dde8407cfedfa
1799 F20110217_AABGVK hurst_i_Page_078.txt
d42e4278c20a685e6944df0f267b0a49
647a3f7ab069ed76ac667e2d07676729d262575f
1670 F20110217_AABGUX hurst_i_Page_059.txt
30c299de3261794390079131c0f3043e
93563270d1504dd101c82bea6ffaac1f8e9fcf78
13001 F20110217_AABHBG hurst_i_Page_106.pro
925fd5c59bacddc04e80dd72cb5bfcdf
a9097b0c0e9ab59e25168787825e2bcd41c02e93
12266 F20110217_AABHAR hurst_i_Page_085.pro
d8fcedcf53e3bd0b31861824259c4550
a1ecc378c1aab8755530edf1f1775358706496f4
1812 F20110217_AABGVL hurst_i_Page_079.txt
2e80ef8161b3b65e62d4e1928ccff483
3c48814027405a718397daeca93caa11ceaf00e7
1214 F20110217_AABGUY hurst_i_Page_060.txt
13428dc9c8feac1ae22d5a9824d62a3c
fb4f8c4b68ae87adb364db1b189e6fd2d433dad1
18266 F20110217_AABHBH hurst_i_Page_107.pro
d925d6828731854fbec4c3573745f869
e8abd6aa92721cdac585f96df67d13d95dc719d7
1489 F20110217_AABGWA hurst_i_Page_095.txt
9b81341163aa7ce7024df20c58fca6d0
0b58fe820bd4aa0cdaad2a4268c086c663744f70
48198 F20110217_AABHAS hurst_i_Page_089.pro
7d64f2093c6cd7b63e1fde6eaf0173a4
2fae139ae32b3d92e3669baa049c4a20e57666ef
F20110217_AABGVM hurst_i_Page_080.txt
669f6d91aeb1106806efaab005b72f3f
a8dcb0403eed3610fa6a387afa7e4e5e7c4df8fc
587 F20110217_AABGUZ hurst_i_Page_061.txt
9bc1c94c414a59000d2ac147f7bcad66
adb7958732d27b4ad047077a374f845fd2d70f4b
1758 F20110217_AABGWB hurst_i_Page_096.txt
1ffcc859d4ae659fbad2ec3a497aa724
03a5a5d1e9bab990026a2af8ecd06c95360ec51a
46185 F20110217_AABHAT hurst_i_Page_092.pro
2d935c647ba787278c441c3d970e0e89
c3c6ec3533d2bca21af7a3d50363f42c8802dacb
816 F20110217_AABGVN hurst_i_Page_081.txt
2e091de59c1aef6e56c8a22c9626a3e4
3ea54ef6fa1cf3387f3ae9e839f2ed9b8500a389
36982 F20110217_AABHBI hurst_i_Page_108.pro
863f4839872eccbae5459ef72ff47226
17946915ebcbaef2699ddb54d1a41209da998bf9
1744 F20110217_AABGWC hurst_i_Page_097.txt
328a162bea3f00914d5f8bbf48fcf777
4b7f8112b9287ccc23e85b7001b92cefbd0cf0a9
47351 F20110217_AABHAU hurst_i_Page_093.pro
67a68c5216bc75df1ee4c4ff1fbb5f6c
69f2deb7f9248edb3a34f7978073536a0e464f0b
673 F20110217_AABGVO hurst_i_Page_082.txt
eea9cd312f90ab6586dad0a82eb2afbc
0e3ed10ca553cf3fd7d50c3e5415e59215394118
44222 F20110217_AABHBJ hurst_i_Page_114.pro
c64aa0730bf019b18a091d8d46086fc9
053b4bc035e2e3685335b3d642518efce8507e4f
1152 F20110217_AABGWD hurst_i_Page_098.txt
5cb2211e53e4a165b9a17c740111e87e
467385e708f251baca08bbc07d0764298184a5e6
50019 F20110217_AABHAV hurst_i_Page_094.pro
63b92137c73c72e6d9ec41a127b2591b
06501a58fcdf53a77ddadac156217099eab7242b
743 F20110217_AABGVP hurst_i_Page_083.txt
af042d2b84f07eeb8fc26c096d770495
5e67876c253ab291a30647bf5a4b7088da3368a9
46240 F20110217_AABHBK hurst_i_Page_115.pro
935e52e655e0a7a0939bc46848fd8f4d
af7e9b65de0b5a7e881a17a265c7edefb2babe77
725 F20110217_AABGWE hurst_i_Page_099.txt
e1b2f22e325c9e6b3d21093916542f7c
c1e7e4b1d425ef479c8741274cec90cf26366c55
38534 F20110217_AABHAW hurst_i_Page_095.pro
640e54c1f42a9139297b734d38e851df
14beb7bb3ac5ac3fd86b72fab05017981b5b9cc9
589 F20110217_AABGVQ hurst_i_Page_084.txt
2a8c4bd4176f67b5981ddf57ac9baf49
8b6c1aeb0a08bf18cf9046bbaddbaaafa65df2d9
47725 F20110217_AABHCA hurst_i_Page_136.pro
5b32b099923a50da3e0480995a0b1432
b9e1f1dd66b740046e0ced017a5c2b101170775a
48991 F20110217_AABHBL hurst_i_Page_116.pro
f934a38dd4b5d11f2adb19955f65eb89
727e1f6d04d84a735a07699dbf012d90fc070fa1
642 F20110217_AABGWF hurst_i_Page_100.txt
ef5251431c7fd86cea8d40bfede17441
4372e47100c5c5c3e9b062343b7ecf94883fe849
46536 F20110217_AABHAX hurst_i_Page_096.pro
bec2d7f1fa8421d9a47554826cb603e6
f4058f2c7fd9f961cfc100df40bcb0ef09e4a783
512 F20110217_AABGVR hurst_i_Page_085.txt
e89e719ecfc128eb9308d156a35416d4
3a22d633d46a7e3fc31b8a396f41e0e23ac70b0a
34460 F20110217_AABHCB hurst_i_Page_137.pro
38b99ede1beec61c321a0bb313116af1
acaf1c98b67de1df5950abc5fc5eb19e247461ce
47292 F20110217_AABHBM hurst_i_Page_117.pro
b66c3e891bde9a3c13e55d638e28f4e4
ce0bd5ac6d22f5b2b51a09ae04bfb68fde0c100a
544 F20110217_AABGWG hurst_i_Page_101.txt
bde3ac8df777cf7a6335fe8c4f928b15
96bc6aa85e02ed1378240794b51574be8a6005a5
47201 F20110217_AABHAY hurst_i_Page_097.pro
15197861ffbef47b6f15b399f53a135a
fcf55b1b18ef92cfb9976428034b9f617e626a53
707 F20110217_AABGVS hurst_i_Page_086.txt
558eeadfffa9668946d9ead7ba21de8c
51b48b42268c350eac9af517130b7ca9155b8e09
46162 F20110217_AABHCC hurst_i_Page_138.pro
0567123881b95006b24f1159272f64e9
aba8d3d1c6c3d7dfee8a9490d9f88631d2631d83
32281 F20110217_AABHBN hurst_i_Page_118.pro
7f1f8c67cffb6ded9ae0c9818b2d5622
3896f07c64c7c999d9949f5e86338ed0178636ab
771 F20110217_AABGWH hurst_i_Page_102.txt
d9bed235d9fa2390fbf20e48674d2ecb
655268f648464f6e6f47d8e1ef56bd00708e8404
30678 F20110217_AABHAZ hurst_i_Page_098.pro
8e6d46036fd7b8be3664774f2a04235a
3f1397f31fa255d061b75dfed5bdfd7550a989c9
1055 F20110217_AABGVT hurst_i_Page_087.txt
42d43d51edf5ee4091d76e6e33614526
4b092f7c648bf36ad8db6915e908e4f9de5035bf
62220 F20110217_AABHCD hurst_i_Page_140.pro
95f7ca253bd14f3a380ca528edc8235d
3f12da754de67b31da22e814065c73f455bb62af
16615 F20110217_AABHBO hurst_i_Page_119.pro
e0069b5a6face2c0a7468624ac108614
101a720abb79708d76ea4aef8cf2377db502abf5
649 F20110217_AABGWI hurst_i_Page_103.txt
bfeb8359b08de5e2c41a283a13c440b7
ae3f08e9e87cfda094927d8816243ba51f0bfe88
1778 F20110217_AABGVU hurst_i_Page_089.txt
1e88b7de82f66d395e1ea0f2aa19d379
42f25df6956394848b7edd4f7082e25eb56ca4d8
58890 F20110217_AABHCE hurst_i_Page_141.pro
3d0a7ba1baf5403ac596455c5a38d91d
caadb21dbe387e1afe5a3595f590f9eef0dad6c9
8982 F20110217_AABHBP hurst_i_Page_120.pro
5c99369cda6a763b608387a70a8999ac
2b9fb7ab832634da41890b3697a6c9f86267fd4e
686 F20110217_AABGWJ hurst_i_Page_105.txt
559f7eb5b8aa1506228384c340a7e007
ed2da6f5377183ea8977e36db29206ad2a02e279
1688 F20110217_AABGVV hurst_i_Page_090.txt
c1e6231b5aa53ca42c24870ff2bdafd0
02814d30d2aa0299dc4d6f0aa50d079e9b6cefc1
61045 F20110217_AABHCF hurst_i_Page_143.pro
3229d82fd5d437a5336641fdc4d4b897
36b60972913574638ff7a89d74edb804594488bb
13240 F20110217_AABHBQ hurst_i_Page_123.pro
65352c9b27d2af3489cb1e7fcd172467
05a9cfcd4345da45bf38c6dfb1efdd4c401b2872
494 F20110217_AABGWK hurst_i_Page_106.txt
5c126a96b9735f1bdd5a28f3bc49102e
6087bb8579585b002e2fdd302249875462f209dd
1640 F20110217_AABGVW hurst_i_Page_091.txt
533888fae3885050ac83fa4c7fab31b3
f31af6f86b3092d0a5a0c33c878b83c23fef9ad6
18429 F20110217_AABHBR hurst_i_Page_124.pro
26444f62e2c2b9c45ed0321581564ebc
a55039b4aea7414273aa08db805cd39a7216d450
714 F20110217_AABGWL hurst_i_Page_107.txt
f8677f85ef4120b7b214d6c1d065636f
c0e1ec155a513ea94d124a138ad6a2aebe100c86
1706 F20110217_AABGVX hurst_i_Page_092.txt
6553e99a2c4fb07c77c064d5d884f367
0ca9a8e14b8609d043399193d74d1ad12d9693ba
68985 F20110217_AABHCG hurst_i_Page_144.pro
6ebc0f8b039d83a29f0ab2df2ed4e33a
5b147ba04d94e88e9d7ad96f119c41b14725335d
1533 F20110217_AABGXA hurst_i_Page_126.txt
9020ffc7a25757d2759fb951a785316c
8aea721886f73552f60ce3145005c27d2e673a79
39054 F20110217_AABHBS hurst_i_Page_126.pro
0dfcc7a026038ffeff73c297e0bd6a79
739505f7719b718574349fa5dd3743911eef3310
1819 F20110217_AABGWM hurst_i_Page_109.txt
78b524146ff54516cf84ab557e0a1858
18503e5f6dde1534d1ef4d42402c1ef468bb8a27
1742 F20110217_AABGVY hurst_i_Page_093.txt
687bc27baccfb1e95af2e362f47069ec
7c6adacd774c02171df0ffd730c5b5691c464a98
62820 F20110217_AABHCH hurst_i_Page_145.pro
f60cefd2ecd19b04e746985d2320f571
c42cefef8ec364c7e88b4077f48da1e23de726fe
1772 F20110217_AABGXB hurst_i_Page_127.txt
49fd0fe123cd607b0811f96fabe2a6f9
0d22be30421a027a4755d9bd1be9aec161058e18
48242 F20110217_AABHBT hurst_i_Page_127.pro
e785f467166c94acc0e0c68e54bd54d3
a363a1778993fef1d17dcb65b6d05b2a17b4cf04
1668 F20110217_AABGWN hurst_i_Page_110.txt
f4ed6f72d7a978777385dd76a03c3270
0ecf84536e64e94657c18f4e6604c67a15ae654d
1832 F20110217_AABGVZ hurst_i_Page_094.txt
47437a0376a6033bda17104167d3fe63
360513ef8399bb758b6a4d73191df513d2721b53
58274 F20110217_AABHCI hurst_i_Page_146.pro
23ea7ae2e51b5885d22d5ae6834507f9
d808e80127a428f4a4ce77a1b18c3a0bf2e00618
1790 F20110217_AABGXC hurst_i_Page_128.txt
c771cda01f0e6609c75ccb0071150424
1e991855243cb968282080b88c19bce5019d5c6b
48361 F20110217_AABHBU hurst_i_Page_128.pro
0280da75af77ab45100c95ee8c112cef
7a249c18f8b10f833e14e9ab8292664c07761c2b
1637 F20110217_AABGWO hurst_i_Page_111.txt
63764b5672d4821c182764ecec409707
8f50ea7f5b52c6dc4547520cea57aeaf41b3a949
1867 F20110217_AABGXD hurst_i_Page_129.txt
fe373eb406f7532540610934584b8afc
b0b6e1ec8c28601c8612584d3b6dfe45e04e179c
51247 F20110217_AABHBV hurst_i_Page_129.pro
47dc6f1b5d4faa9e28a1740bd5a78805
a6d7f6fa3ef6e85f67350615f50dc7df517ae962
1723 F20110217_AABGWP hurst_i_Page_112.txt
c5cfad795228eb924582a862bd400e0a
a8821b01f20f75d3f109f1b79da0f15f32fb22e5
54083 F20110217_AABHCJ hurst_i_Page_147.pro
f8c4466a8701e40a2e8fdd36450ea125
6d4a668446de37e3106d3775b22e48652e89e863
1752 F20110217_AABGXE hurst_i_Page_130.txt
e9f6f4f43c8af08453aa3856c6e0f9e8
308f3f8d5f8f1c8904cf7642290ebd6a97dc3cc0
47554 F20110217_AABHBW hurst_i_Page_130.pro
e9a50fbda6e8909a9f74433d4084f36d
ca526fe2636119b3259bc9df505b6f98cecb1857
1779 F20110217_AABGWQ hurst_i_Page_113.txt
5be22e0fc02d9ff07d68321ede82e43a
276ee8e1aad29d847100c5c0da3634eeb04fd86e
60869 F20110217_AABHCK hurst_i_Page_148.pro
306a78c98e909009596e5aa8d7f011a9
7d2e8d61bbf72ff6457feb1d854b8fc622018f84
1745 F20110217_AABGXF hurst_i_Page_131.txt
83beac5f6809813bcb7c746e612114a6
a510bc5c247f2cf169bea1bf7666f161b8e2e318
47456 F20110217_AABHBX hurst_i_Page_131.pro
06b5f944c9617d413f8ccd78c823c7f3
13d8e60342fb41a0c029e1b4b099b32f3c95c8a9
1669 F20110217_AABGWR hurst_i_Page_114.txt
16bab998af959f3b3b6583fa4f350a9f
7bf34a87abeee6dfd725f9245b80e5fe72a550dd
94318 F20110217_AABHDA hurst_i_Page_007.jpg
fa856cf32a28c7c2e375ede2e140a223
b79283d44418787436da6fcb0366993dbb8273ee
61558 F20110217_AABHCL hurst_i_Page_149.pro
987f2b6b01813de26a1e386091a9e275
132c86102b5b0bccf9e810863086409574a42d91
1801 F20110217_AABGXG hurst_i_Page_132.txt
8a4d912b3b2a3b1649f6605f840c5ee2
c6f5138cb53a9065ecbdc81e356c0c3ebcb3f32a
48258 F20110217_AABHBY hurst_i_Page_132.pro
00dbd535bdb0d7d39d59c86c259933db
d255d58fcf824ca5ba345743ad74fd72cadee4e0
1717 F20110217_AABGWS hurst_i_Page_115.txt
06f889c47e3bcfcf6859639947f92c87
58e77a6fcddcc2842849780f37544e24839fc8ef
26751 F20110217_AABHDB hurst_i_Page_007.QC.jpg
7f0d245b12abc935d9b88693ea0b4b0e
1ebfb5778ed2eb7e644274180f45962bff9c6a16
53304 F20110217_AABHCM hurst_i_Page_151.pro
fac65893c57b7b972a1dd0acab1b55e4
eeb26ae3bbdef90eb5b19b6bc2a287c107ad50a2
1872 F20110217_AABGXH hurst_i_Page_133.txt
89196450fe9be2867a754f56b5b85290
dfc4598ca5d10d8ddfd05cac53c7e7e37ee08ed4
51186 F20110217_AABHBZ hurst_i_Page_133.pro
4184c2b630bad1417d1d6c80db7a9a05
f894ca2a8bda0f670a3de7b71319d0746bca20bf
F20110217_AABGWT hurst_i_Page_116.txt
ff4e00c25c13ab8ad5a15e9983fafce8
816571ff8fe443f9ad76186f87848c23289612ff
117748 F20110217_AABHDC hurst_i_Page_008.jpg
dd217f829bc6d4094c8afc0ad0eb7b08
4c5454d488a6c72c2cb76e57f4dd86544cf25d54
58937 F20110217_AABHCN hurst_i_Page_152.pro
5da841ef3d48b566a59c4439b0ab8d46
550746eebb9a848c1b944d7c2238468e024ee2d7
1789 F20110217_AABGXI hurst_i_Page_134.txt
0614c7630adec95ba1c2badb0d207443
fb0089d3ef2bcc51acd7fa2b5b55e1a87149b870
F20110217_AABGWU hurst_i_Page_117.txt
2651a03b9e0eeead6ff4d4398559dbfc
055ba1352de8c3b4141aaf901754f07bab6d4ca1
33850 F20110217_AABHDD hurst_i_Page_008.QC.jpg
afdeb7ebbfa81ce85db391de6044e04f
7ddab4c9e9ab8f1a9eae540799c843e9b7cb1dfe
64408 F20110217_AABHCO hurst_i_Page_153.pro
41a12c879e503f3bf25b3913a871b9af
3b68f9c41e5ad690c806d60455e9ce2d11cbe947
1825 F20110217_AABGXJ hurst_i_Page_135.txt
3e81e7f7f496f0bf1e1eb3c2e39e9467
5f1e3e041bc5fb52abf49af0d6487d5171ec76a0
1202 F20110217_AABGWV hurst_i_Page_118.txt
f0f4ae056af267c0874bd944e9f893a1
aaac46528bbb610baa165fb4b37c59bdb1e105e7
64542 F20110217_AABHDE hurst_i_Page_009.jpg
8899f0da36a49959e6e732dc8c32eddb
0b223a8bf50521c870b2ca8eeecfe3a877dab429
61770 F20110217_AABHCP hurst_i_Page_156.pro
d48e2581abfc5a96f7ec369dc208d02d
00fb8548626a192639b5cff938e85f71784a8868
1287 F20110217_AABGXK hurst_i_Page_137.txt
19acbc60da4fe63932197e0c1ce64d45
de93c277fa6edfe654b1b3fabd09bb8b4991288d
679 F20110217_AABGWW hurst_i_Page_119.txt
7e3730609d5f582836b59e6540100265
b4942e9592aaabeb42d791973d4cff34456f5254
18859 F20110217_AABHDF hurst_i_Page_009.QC.jpg
fb8ccfbc4392b27ce96036ab976ee4d0
a5ec218b652396f7c5a5a57205cad9753524b5e0
60701 F20110217_AABHCQ hurst_i_Page_157.pro
9e969975beb51bceddd4a948a5fb09a9
60c063aa218f2ab6d87e27d900d72fc07de4f491
2048 F20110217_AABGXL hurst_i_Page_139.txt
7d45c05395807157c8b9b12325464912
f65adbcff116f573b8ef6b89a3d796c4219b32e7
756 F20110217_AABGWX hurst_i_Page_121.txt
66a3038963fe095952de838489789537
ccdbc038b4b31419ae71b2b733645763f6c94d83
84665 F20110217_AABHDG hurst_i_Page_010.jpg
3d464aa747dc40c6106eb8ab3a91a7e8
f5208781e655f1fee62e505e13e58c5c7ab8f27d
31064 F20110217_AABHCR hurst_i_Page_159.pro
e54fa086e85dc2b403b1f06d8da938b8
871dd46443e469bfddc6fd158cde39306ab73769
2403 F20110217_AABGXM hurst_i_Page_140.txt
231f11b19926ca1cadd4d95cd3e2d19f
955c532bb5b1d2a39a27d810c5e60bd0ec0e350e
774 F20110217_AABGWY hurst_i_Page_122.txt
07775ebdb59733370a32c6420a553236
085a261a6dffa15096caa857327c5fa1e5be8df4
27187 F20110217_AABHDH hurst_i_Page_010.QC.jpg
cd7894b3ba8233718665382f7d110481
09558a3d421ab980c4c3213400a765863cc8cd14
2371 F20110217_AABGYA hurst_i_Page_155.txt
46f32fdeb9ab9b7b7c368eba9e4a3594
468855032719c9b1f73810c7adb2167b930f0d19
27528 F20110217_AABHCS hurst_i_Page_001.jpg
780eed8c7a087d8cb79699d3cadda244
975a9bc54529c3b813102bb72fe4876548f7dedb
2275 F20110217_AABGXN hurst_i_Page_141.txt
498d8cb73532791fec6e9d6d82d8f25b
df93fe83e6cf899d29f5aa5d3e41d6a32786effb
437 F20110217_AABGWZ hurst_i_Page_125.txt
4cec9166e2c3578bfc721dfb4ba48938
d9cdd10208879fd3f98d6dc9d1fb3acc277b4110
64157 F20110217_AABHDI hurst_i_Page_011.jpg
c624f0427aa8bc1ad164976316b6ca78
1819cb81b4c1fb1a49f298cffae6bec4858eba44
2366 F20110217_AABGYB hurst_i_Page_156.txt
eb042fa29e7a5709807acda9699f716e
8c6e684a1c1fb7fd52727064d39601608aadae7a
8267 F20110217_AABHCT hurst_i_Page_001.QC.jpg
45f55aec4473a63287f6781df23e170c
99e844c3d0cdf9585262b802a879daf00a20ca0c
2399 F20110217_AABGXO hurst_i_Page_142.txt
5b7a9233a001256e4e46f1c2c85c1da7
606a0112174c4363236b952c847186f8c69a1acd
21725 F20110217_AABHDJ hurst_i_Page_011.QC.jpg
1d278af9be2ec844a1f01d81d748a6d9
c9ab8b88a0a1497c983a3c296f579b48b28df224
2342 F20110217_AABGYC hurst_i_Page_157.txt
5fe81778deafd481e8970bd7e998de88
7dccfe95fde87262b5a6064e5bc0f4f43653baf0
6707 F20110217_AABHCU hurst_i_Page_002.jpg
d97c6b5c7f16516a63ec66179711fb2e
8dd1e3c16c1030c7875ec87ae9224f46bd0164b0
2356 F20110217_AABGXP hurst_i_Page_143.txt
0cb6a1f4ad94f1afb3cc0d1af1f4d296
aa504b25f8f02792519cfbea0eb94d8a2eeed47b
1930 F20110217_AABGYD hurst_i_Page_158.txt
548d1964d2e2916ff58cd4770ddce9a7
fb58fd59018bcffd486b37344194fd15450f0c8c
92080 F20110217_AABHCV hurst_i_Page_003.jpg
14808ff7293a8911bbc135df0790f7b4
b115a8a533c7e6f149eada4128e322143357fe8a
2665 F20110217_AABGXQ hurst_i_Page_144.txt
4972e5e44a296a451d9d229b74a3ba65
796002e15225eeea97f6adb00b9afc54e156d407
102841 F20110217_AABHDK hurst_i_Page_013.jpg
1798b4b93d22e741834922f0f40e6bb5
9296810134060e7f392535fb83e24453938a353e
1195 F20110217_AABGYE hurst_i_Page_159.txt
3213dbc3b6b273b8132ed8f103e9475c
ed53a5f5e8f2cdf9e229cbc7fc72ce23b33b2576
30138 F20110217_AABHCW hurst_i_Page_003.QC.jpg
166b40c78c8dace4253d8c8fbe314286
5d903fca478a6a01a5a4c05a5840d0605bf8d508
2430 F20110217_AABGXR hurst_i_Page_145.txt
12b8fa4a04d58bc98e3b2aca5ba3400d
220d9aab194f40ee704c4cedc8b5177c71872489
109371 F20110217_AABHEA hurst_i_Page_024.jpg
216ce513bdfe0a6d9227abca5c953157
fa437c60199eab26195b423daf7e065a231be2b5
110407 F20110217_AABHDL hurst_i_Page_014.jpg
becda61a0ebd6ec2804ab420a0dfc4fb
87e393a383434a43c3a5a7289c4393afe6395334
8775 F20110217_AABGYF hurst_i_Page_001.pro
e8ca18fe96513f1047bfa54379529db5
97742edc6d724da336d651ff19104c45dad6d513
70503 F20110217_AABHCX hurst_i_Page_005.jpg
00c803753ed756a55617ee4ca6b274e3
73868112e4feb1007fad3daba0c753de14ab5c9b
2083 F20110217_AABGXS hurst_i_Page_147.txt
b3cf2b9022f8c34831c5bef37a6c05ec
1ccebb6ffe17de51448b4d48bc9519bc075128ce
35831 F20110217_AABHEB hurst_i_Page_024.QC.jpg
0109d45691ccfda8124de61fa4953b12
4414d8583928ec33198bf1463a7acc814095fdf4
105319 F20110217_AABHDM hurst_i_Page_015.jpg
2d2d139c6941e1eaed175769a8596e58
1d18ca1ba6da20566c657e243c6b27cf22da17f6
1815 F20110217_AABGYG hurst_i_Page_002.pro
693bd9effa2a04c768855fd0ac2b9b48
7268ed709acbda60d9de00ccc0cb3236eba5bb7e
18394 F20110217_AABHCY hurst_i_Page_005.QC.jpg
decaeaa72894c2dfe215637ce84add76
1e87771be15f714f87e650eec360c27b5fcfc515
2338 F20110217_AABGXT hurst_i_Page_148.txt
224fbcba9581e6202966532669e1de19
b9cc190048008e679f2567e1857f33371f0ab03b
103342 F20110217_AABHEC hurst_i_Page_025.jpg
6a278aa6de57dccfe39d62a44e10f064
0edab4f18551c7dc10c63e0625daba6c16ed9491
35383 F20110217_AABHDN hurst_i_Page_015.QC.jpg
d71ca2bab13bfccfaf3fe262e1fc32e2
0f93a07960952f26cf744e14c1315081e17644da
39645 F20110217_AABGYH hurst_i_Page_003.pro
4b29d9ce16f97550cbc50a3a7f06a24a
dc6615896885a8182a721db70a3a2cef90890f7b
13932 F20110217_AABHCZ hurst_i_Page_006.jpg
7e75b7459ade572c1c2fdac96ffe4c49
4556da428c68957ab4e068065e6ac4323c6a2a43
2351 F20110217_AABGXU hurst_i_Page_149.txt
867d997e7d9bd508968cbf97b900489d
358db0104ca7678f40b24cb4b0dae79f60a68d4a
34171 F20110217_AABHED hurst_i_Page_025.QC.jpg
647a826f59996e6724d7d2b9a6c0a9e4
11f50537afe4cb559882e8d73f7b0a67d8682d00
35821 F20110217_AABHDO hurst_i_Page_016.QC.jpg
863b75d7d323b2b13e0b0b3f8f717611
bb35058be53ffa58e372ad81310ea24c063a42ab
52745 F20110217_AABGYI hurst_i_Page_005.pro
edb5fd7f009355e046e341e1e66dd77e
ddbb3e808df65287d1802721abcc1d4f35372052
2302 F20110217_AABGXV hurst_i_Page_150.txt
e82217e76b6ffa9ad000d7dff855767f
bb7bb7130aad459b8dff88cd1af39279ade4e436
37698 F20110217_AABHEE hurst_i_Page_026.QC.jpg
8739655ce09f6430d3b6c40b77a9e54e
b97ed883a0a4a41dababecb6f4f20a1e9df520ab
116235 F20110217_AABHDP hurst_i_Page_017.jpg
d1190319cddb031fe3a58948e3d3f437
357842b3bf2e66d19319adb5ef7a6512483358b3
8497 F20110217_AABGYJ hurst_i_Page_006.pro
276065eca028bb5551030f383e2fe521
3b143f10e5efe913494f73eb44479560e0b02a8c
F20110217_AABGXW hurst_i_Page_151.txt
20ac9bb908e0a8ac10e8584d9573df56
d6de78b191f78e4a990a0ed1c6b4f7f0502b8810
114170 F20110217_AABHEF hurst_i_Page_027.jpg
6b0b33622210471d2f80031a0674a1da
a5ffc14efebc790f6f05ec677c2b492ae4b79667
38211 F20110217_AABHDQ hurst_i_Page_017.QC.jpg
39bb971a1bd3211cd1a13cb076b898d0
fc1c321d6a7b4ba11fb0be6622a5c8e866b57da9
56057 F20110217_AABGYK hurst_i_Page_007.pro
fc7f15211f57f68a9bfec77df1b29854
75200c6127ee59c758f52f6c1fc1093066f7e35d
2274 F20110217_AABGXX hurst_i_Page_152.txt
d6f6f9852aa62a7787f95f6eb86b440a
7e3006edefa22f1983a58185e92e942bbb31bbbd
110975 F20110217_AABHEG hurst_i_Page_028.jpg
061bbc2773af2c8634193f52ac8a6135
ff8f2231bfbefc99927cac57afcf7452612ed7d7
17249 F20110217_AABGZA hurst_i_Page_034.pro
627c0611940f97858d0f8821489cb22c
dcc6512d30cdbdb8b1d621ca262f2aac4c5817a4
100137 F20110217_AABHDR hurst_i_Page_018.jpg
7724089abd3a319fa6c959b400fa8663
0d2c1b2ab10299c7728f61043c85fa8993f385e6
72481 F20110217_AABGYL hurst_i_Page_008.pro
4c5cffd7ecdc3a9704e908c75ef87459
a43e2c608da96f5b50b1fc18d6c58af142b2db4c
2465 F20110217_AABGXY hurst_i_Page_153.txt
21b8f0c3c33388ccdd1999fca4150ade
1d4e2eb45d3d0b66cb02f56aaf9610d3d7e75ee8
36924 F20110217_AABHEH hurst_i_Page_028.QC.jpg
7ad5a1da407343f5ba1811eb96f4423f
57305b61e73d1b7f839b96984f84a02e542db85e
33559 F20110217_AABHDS hurst_i_Page_018.QC.jpg
a18f5a490d57499f883bc6a5dfc761fe
507fecbbda3b0d71c5ae194d9b5ca0c3543b2117
38734 F20110217_AABGYM hurst_i_Page_009.pro
03fe55d3b53e1062bec7bee582dd6350
a40e060f5b58442e6d86b736ebd1aff37dfd1b30
2460 F20110217_AABGXZ hurst_i_Page_154.txt
353c474d7794ee0849bc58aaf2065b8b
64ee2f80ca59b49329bd118d01fc1e748fc2f2d8
114643 F20110217_AABHEI hurst_i_Page_029.jpg
52d1c1fa94cbc7cc5dfea246e13e385a
be930e6df2e1b7cf0c857d7c9981c83a776e7489
14071 F20110217_AABGZB hurst_i_Page_035.pro
71473c4abe29de09c08905cc2616fd31
b5da88ec4177ec64451e004463ed1c582cf85ed5
113199 F20110217_AABHDT hurst_i_Page_019.jpg
73a5bfaaec2f431b08f6502c184cdde8
d3abe27dd2fa10596c0bf566aae01880137454ad
37322 F20110217_AABGYN hurst_i_Page_010.pro
3d01ec16bffda270a80b9ac0735dd301
d1e44a3aff348c911bf08d65d483f5fbb3f14180
104999 F20110217_AABHEJ hurst_i_Page_030.jpg
875f15c51a2f55ad6e7a93058db21c99
0a18a4bd916cc40f97ecc82b7d276c1c2dacb149
13648 F20110217_AABGZC hurst_i_Page_036.pro
9ab677d212e56813cb8f2ab983b5fbff
cf50dabf1cedf927139f4ec68098761d6ec5fabc
38285 F20110217_AABHDU hurst_i_Page_019.QC.jpg
c6e674d7275c4b4e890f3b52b140f92b
9208496adb92e30fa5e93c5282573536d802ccc1
26558 F20110217_AABGYO hurst_i_Page_011.pro
d9ab41e4534e2d693ffc4993b3dcbab8
0ae9cf54a2e502fca06e5a53002250fe525f9865
34630 F20110217_AABHEK hurst_i_Page_030.QC.jpg
6fdc06cbb8c6257a3a1d5adf9fa9636f
6ac42a03aa8577c6ce106bd81ce25c4a27d2670e
22609 F20110217_AABGZD hurst_i_Page_037.pro
7f42c8d306fb9e69067e0f9121d7656b
42d56173e2d1f9e719443c2606e3643bab2cd9c1
37103 F20110217_AABHDV hurst_i_Page_020.QC.jpg
c6867b2550801388133ea073a2e91cde
692bd950e42050067ad7d206a32155f819535f68
39184 F20110217_AABGYP hurst_i_Page_012.pro
6734bcd2ccd48417e090fe5214bc39d8
4e262db0d2389711257013f1b1d3cc2e2d567ab0
38489 F20110217_AABGZE hurst_i_Page_038.pro
c79b958d0eead89d2df7b8982cf517cc
d9e3fd9ca5bfa1f0f56f6786859d86b8f0ce08c9
103412 F20110217_AABHDW hurst_i_Page_021.jpg
156e54200c6f26a6a23a6eb5d4d24453
ab2856b899bdac8f69466dc6f28a5bd640515f17
44132 F20110217_AABGYQ hurst_i_Page_018.pro
cd62a40d74eed39aa2452ede77088c43
066b16b31ce4742eb0cfe39ba8fd3f87823545e6
110398 F20110217_AABHEL hurst_i_Page_031.jpg
1c67d3a452f921b52f50f10b2ec3f067
95e0df25b444950929a4ebdd1b8ca33e9d787971
48722 F20110217_AABGZF hurst_i_Page_039.pro
664c3f8d8878d84b380f33ddaa4ad211
6a40099162af29be7788ccd8bfc0cfb0ba16c955
35204 F20110217_AABHDX hurst_i_Page_021.QC.jpg
70384e88c4e00d94e361b2a25f280565
7d9ee9c6145b605e6ee275c96645cc23e2f621ad
49240 F20110217_AABGYR hurst_i_Page_020.pro
1d65655059f91eed0150887701efe9f1
5bdff10ef4dbb0d3a0254e23a62717e93def045d
38860 F20110217_AABHFA hurst_i_Page_041.QC.jpg
83580ed5165b8a33842cdb7b9d42b0a4
106915072d2555a09a1a46c22c31c02187072b5f
36101 F20110217_AABHEM hurst_i_Page_031.QC.jpg
6b2d94d4479892a8ba121a33ce49a35d
034c7be9be14f6a66f15db753583d2c582d7714d
42861 F20110217_AABGZG hurst_i_Page_040.pro
6e2b33d0a17c7f259fa13f43b692efdb
80661e20b4b24ca10169a6765ad3b492a0ad07c4
35782 F20110217_AABHDY hurst_i_Page_022.QC.jpg
57b9e89e67a75bf980dfec80da11b1e0
659d00993d77096c81d0ce17fe518438d4be95c5
45997 F20110217_AABGYS hurst_i_Page_021.pro
896b5bed4fc9906d0766e8e55740421c
168af21352142ec5a1a275180e0185133ca34eba
117351 F20110217_AABHFB hurst_i_Page_042.jpg
0cacefe726eadaec1c271147611515a0
a7546a63a998ed70b7da05c5f2764a9945769b5c
114863 F20110217_AABHEN hurst_i_Page_033.jpg
39f57373ebc973ae668aee8972ba9a6a
d84345f5c18ab0a6b7b74c51adfeb0cbc21d7cb1
50013 F20110217_AABGZH hurst_i_Page_041.pro
0ec7294d69bb40286a5e1716ef63d7a2
17658e892a477d25bcee9fbd49af4a00f53c2020
37744 F20110217_AABHDZ hurst_i_Page_023.QC.jpg
1cf9f5f6cadc434acdb6f43550d75374
ea77b49d95bfb189a4469886e4b40e2d6dd3627c
47513 F20110217_AABGYT hurst_i_Page_022.pro
a842aa4047dbb1f74ac9a6f5d17116d3
3765acbe56dcc16eac0ab2dbcdf3f084acfa7632
38766 F20110217_AABHFC hurst_i_Page_042.QC.jpg
2a3d0f496cba9bb5808d6a6b4a871513
5c7ae757a0d5974d972e31e39b4af466df95415f
28487 F20110217_AABHEO hurst_i_Page_033.QC.jpg
4426fe25a9ba036c43952ec28c5ed874
61267144681fa9e7ba8f8531180c439eade25969
50329 F20110217_AABGZI hurst_i_Page_042.pro
5a9300e8b1dba0f8ea057804219a5fea
9a6ecc4196a61b5bc134d11b1ddebd6fbea38522
50570 F20110217_AABGYU hurst_i_Page_023.pro
b16f188968ce1a7e46d384389071b283
231cc1f100764e1ba36d6a63b1fb86f86e52f00c
108435 F20110217_AABHFD hurst_i_Page_043.jpg
f8b62cb1e05ea76c83375c11b1079764
fe57fae95191d9c1319bafa2569c6cb78c681937
51299 F20110217_AABHEP hurst_i_Page_034.jpg
c3c8e85310248c755a75523ec3c08f8f
2d27bd0b5a6dac8f642790f502157e6bb9dd72c6
46625 F20110217_AABGZJ hurst_i_Page_043.pro
c0cce381ed7b9f0eb669f53c6b595e72
3d90cf21f78052d76865a462b7d62b29277c1d31
48253 F20110217_AABGYV hurst_i_Page_024.pro
0fa447a9b02c0962c44b88d19a54f5ce
181b9f855eb3869a87910dedbd57cd53f8be7d23
110819 F20110217_AABHFE hurst_i_Page_044.jpg
d77050608f9f3fa3281ca708e12e8003
2bd2a9ea9d138dc20c848003fecc5124cd0d2dcf
51195 F20110217_AABHEQ hurst_i_Page_035.jpg
75367d03235d7393fae74a3b8fb16aa5
8e511db4f78c2736254479d63f897c13d3a116a1
48066 F20110217_AABGZK hurst_i_Page_044.pro
6c2c81e149098a00f55b3c7bffacd417
dc7f81c18ffe3b1e40d2286db89d8d4a676080c5
49734 F20110217_AABGYW hurst_i_Page_026.pro
7ef07f2589ef3d7acb2291dcedabe229
30f892cdd21f12e3c3bcc29660c9f6145e935f3f
37047 F20110217_AABHFF hurst_i_Page_044.QC.jpg
1f87164ed2fe12c9505e9600472d93c1
5ec4185c324f5d8c788cbea0718b9aad5660ccb5
15315 F20110217_AABHER hurst_i_Page_035.QC.jpg
ba84370b59d6d1c3398d68c6e9f31747
2b35cc74bc30cb0aa29524e431133f1afb41fdeb
46170 F20110217_AABGZL hurst_i_Page_045.pro
5c5e95c1c5c9c8d56400137c2a65b32b
9d369c231720c52cee5ffb00f6a2eccd21f230be
50417 F20110217_AABGYX hurst_i_Page_027.pro
563f54e1839c249c1cda3f4b45481203
bc0346e8f313652871c63c9b39f8828c5ceab50b
36154 F20110217_AABHFG hurst_i_Page_045.QC.jpg
21a4f7d92d3bb96cbe8c2adf2d61ef95
a8ff2462d16bf6595d86ace99b49c1aa5c2cea1f
50754 F20110217_AABHES hurst_i_Page_036.jpg
b1a3b25f808ca2e08432142e56d1afd0
21fe1941fe6d08915bd4ae73ca3bc14e3c326821
47495 F20110217_AABGZM hurst_i_Page_046.pro
f235e328bfec83c2ecaa1357cd1b9015
554c6251dd723e969103cdf9ddd5c96e894f81d1
50936 F20110217_AABGYY hurst_i_Page_029.pro
f19736d2b57498ac4163f74a982ad15a
d444e560241f6710a0b346575e464f8a66fb3155
110548 F20110217_AABHFH hurst_i_Page_046.jpg
d2bbb9f9ecbbe880758b802b1eb9bda2
a6858492a42f75278695ad44352bf158a01b207a
68635 F20110217_AABHET hurst_i_Page_037.jpg
2c045d72f107c9dc8d895d0e7ddfa843
7e5555b73228c00caebb9653bd7c47b9525f8b9a
43841 F20110217_AABGZN hurst_i_Page_047.pro
5b29da67c3e704d0e35651174490195d
d6d57767aa601211fe0fab689b20fd267e2003f6
48767 F20110217_AABGYZ hurst_i_Page_031.pro
93b12c9044a23876de39c6e2012a0533
b719f7667b0e2348e908340626ec77a4209e8ef2
36676 F20110217_AABHFI hurst_i_Page_046.QC.jpg
dfc44c6efad8d4db061337b296aaa4e7
b8ef8a28cf9294b90a3a117ef6a7b993b87bac61
19747 F20110217_AABHEU hurst_i_Page_037.QC.jpg
857ece1c263b25f7960bca58589d566b
32da0719f0f69c60a3e315a454e0f9562f25f9ef
50688 F20110217_AABGZO hurst_i_Page_048.pro
8f567cebb6e5e91e2069d5ba450fe2ec
43cee565db4b87947ddab5817274cad2f35562ad
112058 F20110217_AABHFJ hurst_i_Page_047.jpg
e3343c9b16a9164fba06e33a88eddef8
42e3adf930b293c3392930aedb6e747067635c89
90812 F20110217_AABHEV hurst_i_Page_038.jpg
3fccacdb5ed7062b93256fc5fcd5a409
926c32528466bc483a751500c2f85010e3adb6d5
38174 F20110217_AABGZP hurst_i_Page_049.pro
aaad3d5d07e5944875ae1aae7ff07a54
f080ae14baede4522582324393ada2ef54811ae5
114538 F20110217_AABHFK hurst_i_Page_048.jpg
82df6961a6255f31e1cfc0619ed02e2e
db490c0b7acb0868ccdf382d528716ead4fd144e
110152 F20110217_AABHEW hurst_i_Page_039.jpg
297c883e159eaa5f88d66bff32a75057
338329a62632851b0e787cd90594a59c4c9dcef4
49401 F20110217_AABGZQ hurst_i_Page_050.pro
ffc6d5c6c418736809b15ff3182bffa1
5b7d58683a1159da30716511554956246b632c2b
38392 F20110217_AABHFL hurst_i_Page_048.QC.jpg
9b9bc35ef8a7deb33bebf5725b0325a1
8eeb0f1ad45b9b48ffc9826f2ad7b8bd109a6104
37065 F20110217_AABHEX hurst_i_Page_039.QC.jpg
5e3c56fc7ce8e48643fa76a9b672aeca
82f8f33580ffe32e4b30bfc4cce75eb447b05f36
45579 F20110217_AABGZR hurst_i_Page_051.pro
e19887f3e835785a20fae593cbeb1d66
b4ac177ebcdc7dd4ad95e5cbd500756f60198fa9
90780 F20110217_AABHGA hurst_i_Page_060.jpg
50fb70b5c2eef50555304afce30c8677
692cb2493982f2c270b1278a01b355272dd0fe11
101406 F20110217_AABHEY hurst_i_Page_040.jpg
ae11b1d98715dceba2d3491278e7e09a
f56ad4770fe0658c5a5c14d85b54a5ba7b291dfc
46461 F20110217_AABGZS hurst_i_Page_052.pro
91dcab63aba437b83bf0af359f3bee33
b74e73b02a0a33467331f9b85b48bdcb4995698f
43118 F20110217_AABHGB hurst_i_Page_061.jpg
90053a78873756584b862f6fcd3ad613
a7abbe388f9c0e25d75a0c461ba03a02802350e8
29571 F20110217_AABHFM hurst_i_Page_049.QC.jpg
c6a8b327b9c31ecb4f239d8749449943
a8e8086af1b3b1c9f66686ebd612433bd423169b
116529 F20110217_AABHEZ hurst_i_Page_041.jpg
f9954e945e0b4825d26a2c981ba91ec4
bf99796ddcfc05e692fad3e6280ddf97c1df11ec
50059 F20110217_AABGZT hurst_i_Page_053.pro
8be58529f27c00f175cea9414b8244b8
9ddd33ba058a9ec63c6294bbe82cc92d9a616813
13079 F20110217_AABHGC hurst_i_Page_061.QC.jpg
8de44d05377910cc329cb70eef342bee
2d8fc5fd9fb0a208fa577084535baa3ec61e6ecb
104178 F20110217_AABHFN hurst_i_Page_051.jpg
8953a0d0e1f009231cb6a8b09738d46b
dd452902bf4e7665c067b4dc41c04fd4b2a13825
35033 F20110217_AABGZU hurst_i_Page_055.pro
0c97e0c647c7ba932f58c137c36c53f8
020ab392bf9f4f4a820bd5446d678facfddd307b
78837 F20110217_AABHGD hurst_i_Page_062.jpg
00e99ad59b1602c2d2c67c70538c810b
763af44f85d1fadabe36be10f24091428e196869
34258 F20110217_AABHFO hurst_i_Page_051.QC.jpg
64bf3f9fe881c3ffa4a3a830ed6fd3fd
7566ea7b6021bd0d850f0a5cd3048153b6ae2294
13122 F20110217_AABGZV hurst_i_Page_056.pro
0d777324f173e1f26323409ee3ed190b
c89b5a2ebd518b74c921747dcca280df61f3f656
25150 F20110217_AABHGE hurst_i_Page_062.QC.jpg
f2a3d1b2fd6d249c961bd67614ee10e8
6d6ec06458071dddd7dcc5cc02268d6c2f47579c
109646 F20110217_AABHFP hurst_i_Page_053.jpg
ce8dace38ad7a1d98443f6e3f2d94491
74bf830c34822b4fa56aa9bc015ad2d61bcd5b5c
14813 F20110217_AABGZW hurst_i_Page_057.pro
bac5bfc84bbe7ac09ba5e42508a70171
df6be7ccb9ce17fca3c9350e2eae7256b646078b
85899 F20110217_AABHGF hurst_i_Page_063.jpg
1385deaa562038081936a62ca04527fb
9c04d76dea77901c48303b778f9622e95117e23d
36592 F20110217_AABHFQ hurst_i_Page_053.QC.jpg
912a791215c9917f36353fa14a4d1bde
4d1954812fc2944c12515acc53b17466d20d5264
27567 F20110217_AABGZX hurst_i_Page_058.pro
2bed05dbcf4039d96c97289e08cf4f64
52846f872b1b22de4d0f9e4c1829df7d8e559366
24637 F20110217_AABHGG hurst_i_Page_063.QC.jpg
61767f0ae62aae8bc184b3196e7b788a
0c05928ab7446a874157c08ddc12ffa21545eba4
112589 F20110217_AABHFR hurst_i_Page_054.jpg
4f13d9e82fc71aee8408eb8b6413be63
12016fc99b6711d0692667c5d89b104f41492fa4
42472 F20110217_AABGZY hurst_i_Page_059.pro
a71f74ff11beb31a22c293b1d9ee091e
ef2212c0342ab087f5c2ac23c252914cb4d6b53d
43589 F20110217_AABHGH hurst_i_Page_064.jpg
f02dcc3d00f437e3bb5d341e083959b7
22b6b91285f7612894007fe4b01cf63836528f1b
37105 F20110217_AABHFS hurst_i_Page_054.QC.jpg
da7c89376e8f8bb09cf01609a12795f7
c0f982bedf9eb2cd75478552149573a232288803
32866 F20110217_AABGZZ hurst_i_Page_060.pro
a14b720b34877563d0d084ccd880e98e
19acbf1be9555900f7fa5a75aa088c0382fa5f41
12763 F20110217_AABHGI hurst_i_Page_064.QC.jpg
33ed523232f3439bb885c96ff80a4764
134b327bb7687d2d37f14a0fd0afd8404ff4bfc6
80967 F20110217_AABHFT hurst_i_Page_055.jpg
f9218ca0fce1483e6132213dc11b6920
813b14bf40ad30456964f5091c5978f8db82488d
58318 F20110217_AABHGJ hurst_i_Page_065.jpg
e25581c7dfcfcb9ea109ca0d74b8e4f2
bf07904f0224c10db6398f226892bca938d4965f
72489 F20110217_AABHFU hurst_i_Page_056.jpg
cba8d023c8199f67b61558844f2cd7dd
0643e711e0c04a4a9b83667805e48c33d3912739
18554 F20110217_AABHGK hurst_i_Page_065.QC.jpg
6a8a6c6bd36e1fd8430909ec7d0c2e6d
ee54e8496343b459480a8ce332a8abd183b537e0
22737 F20110217_AABHFV hurst_i_Page_056.QC.jpg
c122077118f9ba9882f3822ebe34adf7
f43694c06a44fdfb88e2c110c88f96bfc87d281e
80530 F20110217_AABHGL hurst_i_Page_066.jpg
e3d1261016d1d683d87bafaae3862d82
87002db4308548ff8024a0908730a22af6f25238
49469 F20110217_AABHFW hurst_i_Page_057.jpg
a2a424edbd286e6f4ed455ba80830723
1b3dd291e754c504c21bc0f17c21c6158bce4113
110361 F20110217_AABHHA hurst_i_Page_075.jpg
9d7eb9e64b8d321a9c8e04543fa43d59
63aea95709e7c67ade141f11bb542e755aaf4f44
25074 F20110217_AABHGM hurst_i_Page_066.QC.jpg
69cdfaa9e2d6a0f416a319efc3ab03d9
8eb4169040b4428fa1daace70ce36e6c9b45398f
75204 F20110217_AABHFX hurst_i_Page_058.jpg
3a87c57f210c08e5c9e3ac18f80cc9ed
09d2a28e550e95a76f22d316bbabe6c7afd0b22b
36978 F20110217_AABHHB hurst_i_Page_075.QC.jpg
93f69eb6e403b9131f6a31fead2a58ae
8b094d65dc0972bf8d4ffa54f3cdac92c33dc4cb
23252 F20110217_AABHFY hurst_i_Page_058.QC.jpg
b6744152c7fcf027ab920d3c095f9f79
a0452b699c6e0d8aa70bc1964bd470b09d61c829
100552 F20110217_AABHHC hurst_i_Page_076.jpg
8c71f14bd88878608845f2729273208b
da0952e6980e1b0465145e9cabfcdc13e4655753
58256 F20110217_AABHGN hurst_i_Page_067.jpg
27f350644d1ba5b3f6deae2435e41a4d
7d2326af3ad1f440c3e23e3a1083668464f3c5bf
123422 F20110217_AABHFZ hurst_i_Page_059.jpg
a6071076e2937b413c2638e42d12bea6
ec98d0b698f1d3915c1036952f221013977e17bc
65272 F20110217_AABHGO hurst_i_Page_068.jpg
6b64b27932f4d2d28998efbd08c364ba
b2951a999fc1cb2a276f91ad02ecf7af1d7606c2
33273 F20110217_AABHHD hurst_i_Page_076.QC.jpg
9e410a79819fbfe20db3ad9a21080195
b6d67fa400cedb661c782512202f56af008db45b
18714 F20110217_AABHGP hurst_i_Page_068.QC.jpg
83e8e0a66f3ae1dde0ef06364571461b
2031e30f30f35a72b3f04b36eea28504e5231663
105011 F20110217_AABHHE hurst_i_Page_077.jpg
97fbb7df8b5eba855710e78df353edcc
6228fb7a46728790df96c1d13d7c2a4589a856d5
44020 F20110217_AABHGQ hurst_i_Page_069.jpg
e334551471e5598afa1ca21640f9e0e3
038411bd0d9474a47fbf6162234a0d107121eb96
34254 F20110217_AABHHF hurst_i_Page_077.QC.jpg
6c31eb691f9099e6682c2af9bec64dc4
ce07f85f6ef3e465b77808127bd278cbe87b0017
11854 F20110217_AABHGR hurst_i_Page_069.QC.jpg
2c6d1aa713fdf57862bf61869344b7bf
8c423cfe89d78951920b296712b7856de2cad52f
110288 F20110217_AABHHG hurst_i_Page_078.jpg
d933a2094482a057650a447733942a19
2a4e394980eec3e10115f0848f5827a0e428771a
85239 F20110217_AABHGS hurst_i_Page_070.jpg
0762f56e4a9371e02eb65d4a4cee7d9c
38aa78eca2e193ffba9f0fcd342e64b56be30fdc
111965 F20110217_AABHHH hurst_i_Page_079.jpg
6872c14a8b0006b5cc346289a61df390
e3ad86a626300c9f610a01098809344202f3fca5
27611 F20110217_AABHGT hurst_i_Page_070.QC.jpg
ade1e285876582b24d546eeb13a4e1b4
5c1dae343558f39f055ec7b63b804f086d793f4d
36619 F20110217_AABHHI hurst_i_Page_079.QC.jpg
3307dd0e45d325f0cf0940cd3884af5f
b1d3814037adc93b5f7e78852eb161c75de37234
107572 F20110217_AABHGU hurst_i_Page_071.jpg
0c88ce17eefbb1ad6fed52f041e38557
30fedbe652f37867e8ea983f61502df0683e982d
50967 F20110217_AABHHJ hurst_i_Page_080.jpg
8281fd879fafb1525779e394cfa5330d
326432c11a08ae2cac2b052980a11b445f01dd8e
34542 F20110217_AABHGV hurst_i_Page_071.QC.jpg
5c187c12bb96a09f4ee6db44a25a2d6c
85dd2ee3a9aee1a8619b431ced319333a6719fe2
17758 F20110217_AABHHK hurst_i_Page_080.QC.jpg
b2ecf9d0d3955384f9bb867cfa459a24
6e4c5260153a36a11709f70d9b8174f5ec7f8497
101200 F20110217_AABHGW hurst_i_Page_072.jpg
fc52b0d87d585a86b70f5422f469cae5
a018e2b64d1ec5e4d16a46b105cb50286f44eb52
18395 F20110217_AABHHL hurst_i_Page_081.QC.jpg
a5f3aa6129ee85f53d9b98bb79b50173
0383618f427707b9b90d63d7a2219a63573c447b
34008 F20110217_AABHGX hurst_i_Page_072.QC.jpg
8a42306b6562bc56c01928b789b317db
7c6a13d7fac8149b7ddb2feb65e91b06e74cf938
101932 F20110217_AABHIA hurst_i_Page_090.jpg
3ffeb31ec11585cf7562d30dfc6b9520
6c9ffed30075eb989d068e0af12afeeee0f70220
47600 F20110217_AABHHM hurst_i_Page_082.jpg
84fcb6ef908b3d1bedad731ccfaac079
22e5667a33a8498cdde125bbe663c396a88c83d4
36240 F20110217_AABHGY hurst_i_Page_073.QC.jpg
9b3ef1eaa4a49250d048a4c7ecbbf705
779950e3da63dd5866939cdffcbc1c4aee5bc10c
35239 F20110217_AABHIB hurst_i_Page_091.QC.jpg
493c799a630d39a89263e439458559ad
47328070ad13c34a92a4d38ba846e52af8f57b5e
1051980 F20110217_AABGEL hurst_i_Page_131.jp2
f99b3c0d6fbf07a6878446e6b4ee6c5e
ffb0758cf0de3e1f0c99a5c339680cd8c3aefa50
13396 F20110217_AABHHN hurst_i_Page_082.QC.jpg
91ff05a7a90099aa50354ddea42f91e1
97432f796ef2d362bb1b775b3be8ec81bb28611c
34202 F20110217_AABHGZ hurst_i_Page_074.QC.jpg
05a21a272f3ee3fc2e97aaafc974c320
99921afc932e387ffc91357613d6f131fc8128dc
F20110217_AABGFA hurst_i_Page_040.tif
e45e15026fc40d5e9d122ab6916a0bc8
552583790c58b3c326e34bb17b5ddb5b31983955
118897 F20110217_AABHIC hurst_i_Page_093.jpg
32e41b8d6a427e1a2e68431f737d037f
6517e6c9feb137110b2954870bb9ab4d4ca3899d
48310 F20110217_AABGFB hurst_i_Page_113.pro
2def68458622574d2a783b54baa5e75e
4be7320f5d144bb8ca38d7302dbfb8a69bd28965
114838 F20110217_AABHID hurst_i_Page_094.jpg
8285807fc95554d31ccdb9e3df0f9130
d9cad0b640eba33cf0bb5973a871df30f6e8c9c0
105680 F20110217_AABGEM hurst_i_Page_016.jpg
708acd738b0410497f006d46a2c44724
7b2029838b573ebcf155c9ecb908a2b78fbb9d75
13886 F20110217_AABHHO hurst_i_Page_083.QC.jpg
6975b1e9d5f9d38536d41acf36915f82
629ca2e4ecf4e1551b3e04b08af3291f14610586
36278 F20110217_AABGFC hurst_i_Page_070.pro
b120bab8126a212cfac8a3fc7e34f544
7eff3d974f13f36f44e508ff50136e0502623394
37709 F20110217_AABHIE hurst_i_Page_094.QC.jpg
a1ae58bce1d1ea37edbff04d1e3d2df3
6ed758351e67b5b032e28737ae52d91d76c6524e
44495 F20110217_AABGEN hurst_i_Page_111.pro
95aa900f415ec6cb29257800168a4688
f3b1eca7366f72b5d366d54c2663f2a6ba8be8f8
48349 F20110217_AABHHP hurst_i_Page_084.jpg
35749a71931a9dd34463df0a4c061e94
5b55625c6e0fab904b09013c50641dad914e4e6e
49432 F20110217_AABGFD hurst_i_Page_109.pro
b2628515f8e641b129378add7399ec8d
e80628be5129fa7c054fcb732c9a31c2c413c32b
87547 F20110217_AABHIF hurst_i_Page_095.jpg
b5e0dd39bcee3c67f9c62b91e61b6f79
6a02d39f31cf22effd2b0804be7a3d43bec900a7
25970 F20110217_AABGEO hurst_i_Page_060.QC.jpg
ee280fa79ad79c06aae3c456dc6caf58
4ba9925397910f56a24c47f08b64e95889268d21
14732 F20110217_AABHHQ hurst_i_Page_084.QC.jpg
2ee54b6b47a15625efcfbaa2b5cefb05
35256fd47f0aa9aab5c78e74342d0f24bacf69c4
F20110217_AABGFE hurst_i_Page_074.tif
a39db985d0eb0ffe430b5489ef570d3e
9d36465bbac26dbd3d198847a4b190ad06fe62bf
30009 F20110217_AABHIG hurst_i_Page_095.QC.jpg
911e3d96c81f9ad911f0aad6eefdc40c
328c91c2e96006dee3e7edc7693db2058d9c7789
133798 F20110217_AABGEP hurst_i_Page_152.jpg
e1cb420446ba675be3c014605415956b
65c278b5a7a95da615b4f1c57e9475245410ea67
53932 F20110217_AABHHR hurst_i_Page_085.jpg
aaef0ece67a9e9bf437cf19fcfe51fd3
b4806bc0151314d085cb2cb831fade53daed14ae
19357 F20110217_AABGFF hurst_i_Page_032.QC.jpg
ce255181b189454bdfe388b260758906
9e2d48e6fb02097c4629dfb6ded263a590705ca6
107138 F20110217_AABHIH hurst_i_Page_097.jpg
5298a1d2320b32927692d55b657d45ac
1df21b3ef74b5f219816cb8ec87e46c09b48917e
33760 F20110217_AABGEQ hurst_i_Page_052.QC.jpg
745924285fc87db21fe95ea24f1c3455
a14e1d70dd960b1d9ec471463eedd254b7ead86f
17848 F20110217_AABHHS hurst_i_Page_085.QC.jpg
1370dce26a2301e5f014548f4e951e66
5c6eee8421de2882618c3d714903507094fbe737
49614 F20110217_AABGFG hurst_i_Page_028.pro
590cce7d0305676c195d1ce38608dfd4
82e928685403d767841b5c0ef55f93bf9305cf3f
35489 F20110217_AABHII hurst_i_Page_097.QC.jpg
ec27c01a70f58ac3e24dbc36c651391f
8bdf6eafaeaf2ecd396f9d47f066a84f527e30bb
108756 F20110217_AABGER hurst_i_Page_092.jpg
88af88cb5198ac0679c8a134a0e45e5d
8522ad0afd0658a197a1979e5953286876839312
37944 F20110217_AABHHT hurst_i_Page_086.jpg
ef8e812474e8fee5e117c8930ca36f77
f1a3a7a0e89ac81619c1cdc3e42e0494a8f6f3ea
F20110217_AABGFH hurst_i_Page_005.tif
b62267df8603a3d5460d349181e042ea
452ec75f491f2295e5b47f72e070e88be917601b
23781 F20110217_AABHIJ hurst_i_Page_098.QC.jpg
a3abe3ae535ce747acbf65f73ccf669d
a4dc8da2f1ffe85b18c7227d7649bcb7da4ffe17
44551 F20110217_AABGES hurst_i_Page_091.pro
de9801b1ea6140c58bbb24d651876795
09f8cf010cf28fdf4b62c33c8f1159c047550aa4
10278 F20110217_AABHHU hurst_i_Page_086.QC.jpg
fa3a54a13a656ed6ecbd92e7b20b7aff
6e0a6dc541c0b481b6ac134bde42014d47617754
1808 F20110217_AABGFI hurst_i_Page_138.txt
2c3a77e1557635fd80ccbaa6c701d4b2
15152a9703c104e1faed275e30f3ae2c4e6ab200
49285 F20110217_AABHIK hurst_i_Page_099.jpg
e88af3784214a83b912d4233db7a5ec7
5aed52dfaa4aec16ce546d6e3537255f91eb5ed2
9286 F20110217_AABGET hurst_i_Page_143thm.jpg
04e3551616cec9567ecf8a7b57c916bd
f69d4daf0742a9e2284bfff2efe3aa0bb956db91
69543 F20110217_AABHHV hurst_i_Page_087.jpg
9fb2ce40ac9d3cfc473168524c16b691
d867de2891507885dff3dee5e037bbbee55639e7
112153 F20110217_AABGFJ hurst_i_Page_116.jpg
f24c37feb350092948d10622485e0e2a
668c664fc8d649767c7531d47e5b2a296e3f8e42
14272 F20110217_AABHIL hurst_i_Page_099.QC.jpg
26f28ff367ee51e7e01964598b62bfb1
e2b8f727dcc85bf8f91b04356a49d6d0e96e9045
50015 F20110217_AABGEU hurst_i_Page_054.pro
20f00bad06aeb936d7601ee0ba987d51
ade2321601d0b93edbe6f871588d775b354b1202
19937 F20110217_AABHHW hurst_i_Page_087.QC.jpg
2fd7e6ff6e31cbf9839e7ac5543368d0
baa0aef51b81676d9f9765c93f5ca8bb6c1c2b21
29282 F20110217_AABHJA hurst_i_Page_108.QC.jpg
260f16fb4f0f69455a89fdc3ac9e0596
ae225a87fce924b168be1a093e872cd204d492ad
17374 F20110217_AABGFK hurst_i_Page_067.QC.jpg
70ba932dcf5b1d1d13d5876d129af37f
6d1fbe650ea132f93635bd359a63a6003f1f06fb
37371 F20110217_AABHIM hurst_i_Page_100.jpg
a1385da51bba48c0c70902abbfd79fdc
4e8b775436f1fd9339cdea60b7d4c58946cdb4d7
964 F20110217_AABGEV hurst_i_Page_104.txt
d26eaccd6256c9bafd0e70250023f01e
c3dbc6bb8d3c3eafecd8138fe48677f83424afbe
29744 F20110217_AABHHX hurst_i_Page_088.QC.jpg
687db6dfab2ef2444655de0a3f2ce561
975864f0e568ace282a01261cfef51b7b7fd6a2c
112326 F20110217_AABHJB hurst_i_Page_109.jpg
d08fc6f6153ef33a016a423c8dc1ac59
daf747f1d61b78fba93e602c6d4b440e1ba3613f
829763 F20110217_AABGFL hurst_i_Page_070.jp2
680568bb57520129af16c2e8a860ce2e
225842a3fd2d78c1840d5586110610199c5bcf67
10621 F20110217_AABHIN hurst_i_Page_100.QC.jpg
ffc57f78ecfbdc71c139f817a4e9e70b
8c864f9bd7a572d609c87ba0537325f624233251
131571 F20110217_AABGEW hurst_i_Page_146.jpg
1874b1ae4f41713b5087332efd217b03
8b9fdd8b529bce65635530527eba6c9447676fc7
107059 F20110217_AABHHY hurst_i_Page_089.jpg
b66062a7d747bcd322786ae9b30f6168
2dcb82ea25d0ad2507ba1b94a0e0d6c9c54f545d
36699 F20110217_AABHJC hurst_i_Page_109.QC.jpg
dca42e96d2c331797ade06fce4b02af3
7092dfb1a5a9af90a4ffb85bf25df44bbf830a23
F20110217_AABGGA hurst_i_Page_104.tif
d8d76e84a57f9611d9a34bd5b17e9ad6
2b1154b59f21f82214b858083c02ee6c6d6976b0
44777 F20110217_AABGFM hurst_i_Page_015.pro
2d23662eb708109b3982c9ba9414861c
39f569695080857846e39e2bd0b5dd6acb876d68
54029 F20110217_AABHIO hurst_i_Page_101.jpg
14068330ba3415612be6952abdea3551
ad2fa78822765b5d007b62005fab4d04f184733d
70956 F20110217_AABGEX hurst_i_Page_098.jpg
a71f301dd775257fa56f9d7cafc1154f
d6121ccaef4997d363b00dbec1f8a0fa09b45fb9
36121 F20110217_AABHHZ hurst_i_Page_089.QC.jpg
3eb5cf517dc391458d5c622385413df9
be5a45618d1769c91f4016ab5b06f3ffc63975ed
102832 F20110217_AABHJD hurst_i_Page_110.jpg
960c8dc59791f00ff4abff96258bc37b
f3de996afa24c8f98a87a42fda5865570fe26a23
674974 F20110217_AABGGB hurst_i_Page_087.jp2
3dfacc2f152e0c73a8593d12f0ac11ed
f5504e951e9c0be7072ae77a187d4f2163115360
1024047 F20110217_AABGEY hurst_i_Page_090.jp2
231d892375d47bbe617f02af5a40042e
5d13ca9d504f32a3d135227955829a30f5492d83
33514 F20110217_AABHJE hurst_i_Page_110.QC.jpg
b51ae6ccdcbd60aac268d8904a631d41
caffe531d1997fb7a1d6d780f7d0aebd1473a542
1666 F20110217_AABGGC hurst_i_Page_015.txt
5f0312b37733735a6bbd86da1e27d6fe
f6d1268ae51f8471b161314d97fcd0457b3fe610
4954 F20110217_AABGFN hurst_i_Page_006.QC.jpg
e5b2bc9efc789332eafeb8b7ccee0b0e
5218d33c050961dde44ccea20096ac22d24ac66b
17426 F20110217_AABHIP hurst_i_Page_101.QC.jpg
2ba7cf6d680a0187325e1cfc462bf0c0
664370d1211640425eff526b7d750acaa6b5c2c4
F20110217_AABGEZ hurst_i_Page_156.tif
a8f2d478f53a406828aff03edb6bee3e
ebba253c72ae75b4c3df3830f539860fbfb175f7
101962 F20110217_AABHJF hurst_i_Page_111.jpg
d26f683993d08e3bddefc8d77a8406c0
ee05c5057070691135a114e59ed6db254cabcc2e
64316 F20110217_AABGGD hurst_i_Page_154.pro
e539621005f86a6be1e0e98210bb37e7
3ba0939b1c9d975c2f38b7513105cc764cf88df8
45571 F20110217_AABGFO hurst_i_Page_025.pro
141fb7d7bd14f078547df16c9e3c0b5b
82cca78a198f310f00a36800f3518012f2b59ee9
45486 F20110217_AABHIQ hurst_i_Page_102.jpg
fc34b90d42b0bb1deb64f6ff06f5dfb9
13f395d2e587d74078a30dcbd9d0c7578509c835
34761 F20110217_AABHJG hurst_i_Page_111.QC.jpg
1b1d7ca31d143cff6d6eecbd0610861c
60712877724868eba1de427bb3fcf8f6dceda8a4
13569 F20110217_AABHIR hurst_i_Page_102.QC.jpg
101992a09620bd02b076bcaa9f3b15c8
6565f72d77322f99e70594f5eac890fc1d626a4d
39232 F20110217_AABGGE hurst_i_Page_088.pro
aec62809a4e9d6a70386ba626ba8f045
4ca5bf4aef195a66043328aeec8822eb9627688e
599 F20110217_AABGFP hurst_i_Page_056.txt
6f13652996ee108ef748a8c890a1b0fd
4e9b15836a61d079fbca84f16defd8274ee12a66
102613 F20110217_AABHJH hurst_i_Page_114.jpg
0965497be1f8ac3f185f2d64e84bd92e
616dfe209eaf0861cc7c9e094ec74a183060b532
15614 F20110217_AABHIS hurst_i_Page_103.QC.jpg
918734ffe654b468f21e6a3daa1510b1
0ad4f438963c5f2bcb92763015fdc5dbc38ffe1f
F20110217_AABGGF hurst_i_Page_066.tif
bac603198b7ce6e45e500ab7f1213c80
e21af98561622c2dfec025c35805508a7ac91ddd
F20110217_AABGFQ hurst_i_Page_115.tif
e8c4a5c8b09efbc4bef3c2d0e4fba48c
91c6680fec8d7dc85ba5a581fc4e64670cde2ecc
34841 F20110217_AABHJI hurst_i_Page_114.QC.jpg
e0113773d478647c0b40021ff6450607
a7deb16a9679604e4bc56afb8732da3169bcd6f9
45734 F20110217_AABHIT hurst_i_Page_104.jpg
10679f91cd2c5e1fab340611ce69a434
87776953fbbbadaa816397c2de6b45a243cafb16
F20110217_AABGGG hurst_i_Page_038.QC.jpg
670f6ad29d309fd4c29653921d58d294
f20bc93abda9a848cca5069077ebd9f66e35c13d
110953 F20110217_AABGFR hurst_i_Page_050.jpg
fb2c0f8f74b4a739a78c768f22dc27d6
31cfba84d3ae3b24d3cbcd44eb49edb7b2ec9961
105750 F20110217_AABHJJ hurst_i_Page_115.jpg
bb1c143bb9b3c28972d66a3a9447f114
87a9973f2fa17db00871ba005f53b1db14f732ab
52852 F20110217_AABHIU hurst_i_Page_105.jpg
a9058629a180fd1aeb477d4ef9ab6c02
4af13bfbe3d0adbee14f8927427254661af15b44
36174 F20110217_AABGGH hurst_i_Page_043.QC.jpg
fa80ae7b2a388524091a8293dc092bb4
59b1ea185a1b1eb44ea5872856d306748361529a
37870 F20110217_AABGFS hurst_i_Page_113.QC.jpg
edecd0fde1c837ef9a843cf6b3c38863
3da2dead9274ab6194e6cef9ed622a38fbc55065
35877 F20110217_AABHJK hurst_i_Page_115.QC.jpg
df2f44caf94ab57905a313d5b78da46a
5ccd13de8af27a25c150b8d6d5156591f2788fa9
15329 F20110217_AABHIV hurst_i_Page_105.QC.jpg
38a0a2b0f518d097f8c65fc1ffe05405
0e7da3281ee0780fb1389eb8042b33c274ffbea3
13873 F20110217_AABGGI hurst_i_Page_036.QC.jpg
60a8b64fec2613f13ef429fc566de34a
49f766ccab0d48f37064790706a0a8b82985a12d
33463 F20110217_AABGFT hurst_i_Page_040.QC.jpg
0cb81cc91aee00b2a4cd6effbf555e3b
4cb7017e16e3528fa358184157090c7e332fec86
36667 F20110217_AABHJL hurst_i_Page_116.QC.jpg
9838eb273c15525f1b2e4e70fa61738e
f03a3247e5845e78ef3b66d41a5d755ceb1b66b5
35658 F20110217_AABHIW hurst_i_Page_106.jpg
ad4278b09c5e2e2763136e0b5c41cdc2
6fdf6d90bdf70250e388f82a7a381083999c8dfa
1631 F20110217_AABGGJ hurst_i_Page_072.txt
ed1815d006f716f280feda270cdf36d5
0c83476619ac785bd7a9f375711d9de442ee0f41
F20110217_AABGFU hurst_i_Page_033.jp2
e173f1d8aa07be31cbba39b153638417
9b6ed91b7753b7db9caa771bb453636f71c98e53
32912 F20110217_AABHKA hurst_i_Page_125.jpg
df76db6b929c34ce4f762cc3c1fa0f99
fb12182efb510561f6eaae8690e56fc2f3039c98
109521 F20110217_AABHJM hurst_i_Page_117.jpg
8797e659f7af9d74a928eaf859723106
6f7ed0ba4ba5d7844834fb1787b72820b87aa409
10238 F20110217_AABHIX hurst_i_Page_106.QC.jpg
5015088bfb7ab54a0cd0e8adcff13bbb
f9aa340ccfa82cb53b4b5eb839a7ecd2350299ea
9119 F20110217_AABGGK hurst_i_Page_128thm.jpg
a904abd2d479879bad361eacf1fcf519
3b42370b92630fbd3b3c49b20774586f4d84e95b
1823 F20110217_AABGFV hurst_i_Page_016.txt
2c4db8165c153d81ce92dc1bf111b4af
d6e59d05f41a0de27d74bc038118cc7e216d906a
89869 F20110217_AABHKB hurst_i_Page_126.jpg
454381278017b07684d6007fe9106a56
af23c887bac75d3ede07ed62f4334adfe40e55bb
74671 F20110217_AABHJN hurst_i_Page_118.jpg
433cfbb778b413eef8ab2739ef2796a4
33f418a43c7f18fc396fd7c6f1caf7b9fcd42aa3
52596 F20110217_AABHIY hurst_i_Page_107.jpg
337b443aeb09f714619aa8345e5b84c8
05f3b0f26951a15c8e15c972b1b63e695e0901ef
1824 F20110217_AABGGL hurst_i_Page_026.txt
bf547679465c2b8028b61e5072f8f058
6d5e02fddc42344d9e3e27cefa56b03f41ac6793
8998 F20110217_AABGFW hurst_i_Page_130thm.jpg
45a05a99a9751d339eabadc2dc9df257
d30da6187d85b12e93210360c1034414e19a1b5f
107878 F20110217_AABHKC hurst_i_Page_127.jpg
991898582211e0d209c17ed4a92ee2f4
e6acbe2413bcbff6ace3a60faff085e9ed411365
26025 F20110217_AABHJO hurst_i_Page_118.QC.jpg
4169b1d9e3e7488fe5a4be58ab7a6cad
21ab50d557eeed0adb53df12852fcb8ca1de9d2c
15507 F20110217_AABHIZ hurst_i_Page_107.QC.jpg
d33d8104961a87447e5eaf031b936f88
71dde33c9c3ffab7659b44bbdc2c9b31d9204552
10667 F20110217_AABGGM hurst_i_Page_125.QC.jpg
95e16b284305d8a760a664a606243f97
b70fe378fbe444719c8f89d436ce97268a817d48
34800 F20110217_AABGFX hurst_i_Page_096.QC.jpg
1302e0f564ce501dbe757b80714875dd
9f8cb96cdb1c13900e146e73bbd8956cdd85ee5c
27373 F20110217_AABGHA hurst_i_Page_055.QC.jpg
1dfce9fc3c6687f76fbb37fae55edf05
4fbd4de0afa4ae1ca6d4ab85a29e3bc9ad63fca6
35816 F20110217_AABHKD hurst_i_Page_127.QC.jpg
8c7979e99e62356b951213b18a7b418d
4d382b54f325ed3f3c71c7dee28f916f4c18845c
44328 F20110217_AABHJP hurst_i_Page_119.jpg
5f5f15e89f4464b678e82322f85d2233
404937eb47dc743fcd3dcd6e9217eb48a0ca1a21
F20110217_AABGGN hurst_i_Page_042.tif
d598d128fec02dacd1199e87483b07a7
93c5f2b3c308236829e228fb28c989fed51596cb
9447 F20110217_AABGFY hurst_i_Page_020thm.jpg
28a0522dca6bcba6b129dfcd94835657
5a5a5b3ac975cded5f991eb3be85acff8dbb6746
6417 F20110217_AABGHB hurst_i_Page_056thm.jpg
58e0708f8d66dee3216600826d826d76
2fe6354f988d2c996e70289aee8966f59df32bce
108346 F20110217_AABHKE hurst_i_Page_128.jpg
a85effaa9132890d0a67eca7c6d2fbc9
d79d7cde28392fd8e0046bae844e701658478a36
44123 F20110217_AABGFZ hurst_i_Page_110.pro
875aa5c4aa11345e953edc845f51b279
2ea3fec9e4d72372d508d53ca0a17f73caeac825
115692 F20110217_AABGHC hurst_i_Page_139.jpg
862f2a998ff6784d5bb3f09622903e74
403e9174e740ab019ac808ba7d5c6004463be3ad
F20110217_AABHKF hurst_i_Page_128.QC.jpg
b9920b6f8513c7131de07ade51f58383
c9b37bc90eb19ebf26460220f4280c33e43eabc8
13043 F20110217_AABHJQ hurst_i_Page_119.QC.jpg
537c3f6a54ac949c8725a6eba52bdab9
1d59da2be2681b5a210980a6ac7acf8fe0e8cdd3
F20110217_AABGGO hurst_i_Page_024.txt
b3d857ab6797f8f53a2a0aed64367627
e2fecb62072e62cf24304bd476ed84c1c4e215df
1795 F20110217_AABGHD hurst_i_Page_039.txt
4e6ef60ac17496fc2c3ae294388858cc
a7b76b24cf699c40a9880fa2c5c839b36656670f
115700 F20110217_AABHKG hurst_i_Page_129.jpg
18611c36b41e9af690919e8c35f1b861
9c1ba6ffcc623d4f110df96538d5867ccc5d3d16
35363 F20110217_AABHJR hurst_i_Page_120.jpg
99fb5acda0fead3e7d8a640e374086b0
3afbb43e8a9b9551b857e0f2b7ee631f16731425
18279 F20110217_AABGGP hurst_i_Page_062.pro
fb9dee99615299254b322bed12a2d8f8
4f0284218c9895d3cab81ec082bde12d521450a1
F20110217_AABGHE hurst_i_Page_037.tif
f75442eb1e14fa884051ee0066f7783d
fc9e175e96c9a2e260bb07893ba614f32055b68a
38461 F20110217_AABHKH hurst_i_Page_129.QC.jpg
0962bfb035117b996e38a003a00387f6
be1eb77fb459236c9c430d44b681cd1639278dc7
11423 F20110217_AABHJS hurst_i_Page_120.QC.jpg
07c0c9494fb146cce1bcb51aa9e5aaa6
9295aabfd4bd1b27056a40f88dfc2f036089c07b
112238 F20110217_AABGHF hurst_i_Page_158.jpg
e74ac1256c1daa0487c0a51c4925b985
e6e7932d950e89381b16acd6df0ba893a1138b74
F20110217_AABGGQ hurst_i_Page_053.tif
71e270d60b671718ce9b8bca7464c75c
ac77facd2d6d3f8422d571d7ab03837193fc3fb0
107987 F20110217_AABHKI hurst_i_Page_130.jpg
51acd636a1a8256f0b340566edd14016
ed4f4654cb9b4f381c90e4714e8a1991f6c24fa2
69036 F20110217_AABHJT hurst_i_Page_121.jpg
c52601ec0420bcd9718279858fc3d3d3
e2ff8ed72bdd613b8a9021e23bd6567ec466ad02
468980 F20110217_AABGHG hurst_i_Page_102.jp2
ca40fbebefa393b76b9402ed051a7efc
0309ae7b7d021e5179d651b5cb01ad8cb01faa6c
72911 F20110217_AABGGR hurst_i_Page_004.jpg
d6b4dc6331f0e268779d02dada90028a
148949b23f73d3a2d553f49d27a715bbff544d6e
108487 F20110217_AABHKJ hurst_i_Page_131.jpg
db620c4f76b05b928c85f37dd5a65d30
2645201aeb7c4787e665cc6995f60e2f434e00cf
21246 F20110217_AABHJU hurst_i_Page_121.QC.jpg
246fc5daee97a8e514eb758fc2edd8e9
fef448f2b7c9f6c098ff0b939dd6960564ceddc3
1051900 F20110217_AABGHH hurst_i_Page_094.jp2
e6331ef4ff381456dc927781039fd03c
d9283f7242532bd085b8b8a7389fd34543a4752e
F20110217_AABGGS hurst_i_Page_157.jp2
05f83b13c432ddd9ce81b92994d4d7a3
2b4711a2a30c6fb4d6233fbcbed0c196119c8e53
35926 F20110217_AABHKK hurst_i_Page_131.QC.jpg
dba23f66658e04d8e15ea2a3549e25b6
d8882d48c1366e1f0c5b709060c023c885c545e6
18363 F20110217_AABHJV hurst_i_Page_122.QC.jpg
422f8e3ac85c3d700cfa882ca441e019
2d115942a24ad54a250af9f0f81df00ae5ce298f
9322 F20110217_AABGHI hurst_i_Page_079thm.jpg
6a9f730ee9cac71ee4c4afd4e0bf2931
4dc503dfadc884de9995d21e5c374a8dbb89a2e1
49078 F20110217_AABGGT hurst_i_Page_135.pro
de4775e41c929fd58018e7b4af1acd2d
2640f2f6ab2f2434f147668f5ed147e827d7bce4
109400 F20110217_AABHKL hurst_i_Page_132.jpg
b0f6410cdd0fd4369bcf8b7065b1abe2
4bc7915f9629064a22ff73f7bb842b76aca766c4
46402 F20110217_AABHJW hurst_i_Page_123.jpg
92595e8d057fc1a9771cd07b8acdb18d
2e6d7e1020e4a990dd1ac57dacaf452a825645cb
103790 F20110217_AABGHJ hurst_i_Page_091.jpg
ab604384bc39ac8a02efd8550de47074
99d53039d6229bc29573ad290a458ffd5ada2543
669 F20110217_AABGGU hurst_i_Page_064.txt
8fc41946dcbfe0703a68cbfdd8553442
e48ef52962ffb8bab45f73c49afaf1d4330b425b
136177 F20110217_AABHLA hurst_i_Page_143.jpg
6ca6242aa90db12e035ce45556660a91
949c9a3ee2905e514f8b0b776c569cb5d69225b4
35759 F20110217_AABHKM hurst_i_Page_132.QC.jpg
13e2f913116779e972a20ae768739452
dd14bc239205f50e4152eceae820a07a31c2da07
13622 F20110217_AABHJX hurst_i_Page_123.QC.jpg
1e6810bdbb973f2b5f4378c279070371
867b03c3c5eee3d9a2b0f1872ba68b4cbfd5cb58
3901 F20110217_AABGHK hurst_i_Page_083thm.jpg
406f0911509c2da49a31a784ecf37643
7ea9443b9878e287d42f20be298157dd440404e3
892725 F20110217_AABGGV hurst_i_Page_060.jp2
00cc0a951a73eeaade1be8a939ab0fd8
dee79c2fd71ddf7ef7cdbaf84c8979e4d311aab4
38150 F20110217_AABHLB hurst_i_Page_143.QC.jpg
be18c01d643f3fd44c1d493084306692
d4af90129a04426afd69798d63b1906a76dd989d
114733 F20110217_AABHKN hurst_i_Page_133.jpg
44f74dd0990a6eccba0dfa56e68b3cea
6aed6aaed905481d00fee1a04705b975b38a9be7
57396 F20110217_AABHJY hurst_i_Page_124.jpg
5d3b561f9d4355d7f467cf947fe3da0c
20b11e4de9fdbeb0ca0fab1c876a0d8be76edc78
F20110217_AABGHL hurst_i_Page_055.tif
6f9d8ffcb4ab2396d27638ca65667574
f8edb78f58ac8a19fbb5da21f06876fbeeb5cc4c
52095 F20110217_AABGGW hurst_i_Page_139.pro
cafadb08a084111a659b85679c55af28
9fe83053b4a14cb024e440ad1f2f1d31eb92d506
138169 F20110217_AABHLC hurst_i_Page_145.jpg
70129ee0864650bf8fc7a431556da492
66e292a7cbf83d2460f49ff5e8f1b8736627b310
37788 F20110217_AABHKO hurst_i_Page_133.QC.jpg
9e94df4357747375012c01b1e73232ea
495b7f0310af5c53f9c876ab2386876373945027
18249 F20110217_AABHJZ hurst_i_Page_124.QC.jpg
5942e77d95285df0fa1dfd128a6d0b38
2fd658a0d89e9bf5c0d570a30acdc740b18ae269
F20110217_AABGIA hurst_i_Page_146.jp2
ec70c20b08d9e0af4c6a70b4fa565726
9d1714c7dc1dab924a8244587d79ef001f73f0a8
24641 F20110217_AABGHM hurst_i_Page_087.pro
4b4c4a62fb59d8ff03167d58086eb492
200705f9c0b0686d0ee14305d773f62e3b6f0ec6
9212 F20110217_AABGGX hurst_i_Page_151thm.jpg
9c4a750056ee2243f04ed4a806c64752
ca0833f7812bc5aa00972fdcbca1074d17e340b9
37683 F20110217_AABHLD hurst_i_Page_145.QC.jpg
0d590d477ae58710f1202b88e271ca5f
fbcb6c8baed92e511580e7992b77b22e8d993e39
36830 F20110217_AABHKP hurst_i_Page_134.QC.jpg
d678bd076ae698f76bd40464ad2ad032
ab0c35e264322456ac4621fcab5ad60e73750bfe
F20110217_AABGIB hurst_i_Page_130.tif
c0bfb62840399c1e84eae32425ba239c
a38a7751fc212225d90814ec8641672745b4bc5f
37349 F20110217_AABGHN hurst_i_Page_014.QC.jpg
f49a7c369c3c0ee0afb3482990eff34c
310c4ea3a5ddc4fe0b8468ecf14856ea356eb6a4
133344 F20110217_AABGGY hurst_i_Page_140.jpg
e02e68cbf4559fe8ef2aa618e343ac62
db800b9d707761ddf58339666b918015dccc74a1



PAGE 1

STUDY OF THE ACTIN-RELA TED PROTEIN 2/3 COMPLEX AND OSTEOCLAST BONE RESORPTION By IRENE RITA MARAGOS HURST A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOIRDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

COPYRIGHT Copyright 2006 By Irene Rita Maragos Hurst

PAGE 3

iii ACKNOWLEDGEMENTS There are many individuals to whom I owe my success in this scholastic endeavor. First, I would like to thank my parents for their constant support. Through their parenting, I was able to un derstand the importa nce of advanced education, and it is w hat propelled me to further my education. Second, I would like to thank the faculty members that have helped me through this difficult period. My work in research began in embryology under the guidance of Gertrude Hinsch, Ph.D., at the University of South Florida, Tampa, FL. I furthered my research work at the University of Louisville studying microbiological contamination of dental unit air lines under Robert Staat, Ph.D. It was under his guidance that I was able to obtain my MS in oral biology and made the decision to continue my research wo rk and obtain a Ph.D. For the last 5 years, I have had the explicit pleasure working under L. Shannon Holliday, Ph.D., as well as Timothy T. W heeler, DMD, Ph.D., and Caloge ro Dolce, DDS, Ph.D. Their support and guidance have been invaluable The strength of this program, in both clinical and basic science resear ch, has allowed me to learn and utilize many research techniques as well as become an independent thinker. Last, I would like to thank my husband who has trav eled from city to city to support my endeavors. Without him, I would never have made it to this point.

PAGE 4

iv TABLE OF CONTENTS page ACKNOWLEDG MENTS .......................................................................................iii LIST OF TABLES.................................................................................................vi LIST OF FI GURES..............................................................................................vii ABSTRACT..........................................................................................................x CHAPTER 1 IN TRODUCTION...........................................................................................1 Osteoclast Differentiation: RANKL Si gnalling................................................2 Hormonal Control of Bone Resorp tion...........................................................5 Mechanism of Action of Oseocla st ................................................................5 Sealing Zone..................................................................................................7 Podosomes....................................................................................................7 Transportation of V-ATPase to the Ruffled Membrane..................................9 Ruffled Memb rane........................................................................................10 Osteoclast Adhesio n....................................................................................10 Osteoclasts and Disea se.............................................................................11 Treatment of Osteoporos is and Osteopet rosis.............................................14 Osteoclast and Dentistr y..............................................................................19 General Purpose of Res earch......................................................................21 2 THE ACTIN RELATED PROTEIN (ARP ) 2/3 COMPLEX: AN ELEMENT OF ACTIN RI NGS........................................................................................27 Introducti on..................................................................................................27 Materials and Methods .................................................................................29 Results .........................................................................................................38 Discussio n....................................................................................................41

PAGE 5

v 3 THE ARP2/3 COMPLEX: A POSSI BLE LINK IN THE TRANSLOCATION OF V-ATPASE TO AND FROM THE RUFFLED MEMBRANE....................59 Introducti on..................................................................................................59 Materials and Methods .................................................................................62 Result s.........................................................................................................64 Discussio n....................................................................................................66 4 THE ROLE OF CORTACTIN IN OSTEOCLASTOGE NESIS.......................77 Introducti on..................................................................................................77 Materials and Methods .................................................................................79 Result s.........................................................................................................84 Discussio n....................................................................................................85 5 THE ROLE OF VASP IN OSTEOCLASTOGE NESIS..................................97 Introducti on..................................................................................................97 Materials and Methods .................................................................................99 Results .......................................................................................................103 Discussio n..................................................................................................105 7 MODEL AND FUTURE DIRECTIO NS.......................................................115 The Model and Hy pothesis ........................................................................115 Future Direc tions........................................................................................ 121 Significance of Study..................................................................................124 LIST OF REFE RENCES..................................................................................127 BIOGRAPHICAL SKETCH ...............................................................................148

PAGE 6

vi LIST OF TABLES Table page 2.1 PCR primers used for ident ification of Arp3 isoforms...................................................58 3.1 PCR primers used for identification of Arp2/3 related prot eins...................76

PAGE 7

vii LIST OF FIGURES Figure page 1.1 Resorbing os teoclast .................................................................................22 1.2 The OPG/RANK/RANKL triad pla ys an important role in the bone, immune, and vascula r systems..................................................................23 1.3 Binding of the adaptor protein TRAF6 is the initial step in RANKL signaling .....................................................................................................24 1.4 The dynamic nature of the podosomes of ac tin rings .................................25 1.5 In unactivated osteoclasts, V-ATPa se is not present at the plasma membrane but is stored in cytoplasmic vesicles; but upon activation, it is transported via actin filaments to the ruffled membrane............................26 2.1 The Arp2/3 comple x...................................................................................45 2.2 Purification of the Arp2/3 co mplex from human platel ets...........................46 2.3 Upregulation of Arp2 and Arp3 during ost eoclastogenes is........................47 2.4 Two isoforms of Arp3, Arp3 and Ar p3-beta, are present in unactivated and activated os teoclasts...........................................................................48 2.5 Arp2/3 complex is present in actin rings of osteocla sts..............................48 2.6 Arp2/3 complex is enriched relative to F-actin near the sealing zone........49 2.7 Arp2/3 does not co-localize wi th vinculin in actin rings..............................50 2.8 Treatment with chem ical agents, cytochalasin B, echistatin, and wortmannin, causes a disruption of the actin rings of osteoclasts..............51 2.9 The Arp2/3 remains co-localized in the actin based podosomal core regardless of actin ring di sruption by wo rtmanni n......................................52 2.10 Wortmannin and echistatin treatment of osteoclasts results in a decrease in the number of actin rings ........................................................................52

PAGE 8

viii 2.11 siRNA 19942 but not 19944 reduces the Arp2 cont ent of osteoclast-like cell extract 70% after 30 hours compared wit h acti n..................................53 2.12 Actin rings are disrupt ed in Arp2 k nockdown.............................................54 2.13 Actin rings are disrupted in marro w osteoclasts on coverslips or on bone slices by siRNA di rected agains t Arp2.......................................................55 2.14 Experimental siRNA reduces the number of actin rings on coverslips by over 95%....................................................................................................56 2.15 Dendritic nu cleation model .........................................................................57 3.1 The structure of V-AT Pase.........................................................................70 3.2 The B1 (1-106) fusion protein of V-ATPase and t he Arp2/3 complex do not show a direct intera ction by bindi ng assay...........................................71 3.3 The B1 (1-106) fusion protein of V-ATPase and t he Arp2/3 complex do not show a direct interaction by immunoprecipitation of B1 subunit...........72 3.4 Cortactin is preferentially upregu lated during osteoclastogenesis as identified by PCR.......................................................................................73 3.5 Vasodilator stimulat ed phosphoprotein is identified to have a possible interaction wit h V-ATPa se..........................................................................74 3.6 Immunoprecipitation experiments with the B subunit of V-ATPase suggest a possible direct link age between VASP and V-ATPase..............75 4.1 Cortactin, N-WASP, and Arp2/3 form a synergistic, ternary complex to initiate actin pol ymerizat ion........................................................................88 4.2 Cortactin is upregulated in re sponse to RANKL stimulat ion.......................89 4.3 Cortactin co-localizes with the podosomal core proteins, actin and the Arp2/3 comp lex..........................................................................................90 4.4 siRNA 120649, but not a control siRNA (120653), effectively knocks down the cortactin content to an undetec table level of osteoclast-like cell extract after 30 hours co mpared with actin................................................91 4.5 Actin rings are disrupted in cortactin knockdow n.......................................92 4.6 An siRNA known to downregulate co rtactin (Ambion) effectively knocks down the cortactin content of osteoclast-like cell extract to an undetectable level after 30 hour s compared wit h actin..............................93

PAGE 9

ix 4.7 Actin rings are disrupt ed in cortactin knockdow n.......................................94 4.8 Transformation and purification of GST-cortactin fu sion prot ein................95 4.9 Immunoprecipitation experiments with GST-cortactin show a linkage between cortactin and Arp3, VASP, NWASP, and the E subunit of VATPase ......................................................................................................96 5.1 The ENA/V ASP family .............................................................................108 5.2 VASP is present in the acti n rings of ost eoclasts .....................................109 5.3 VASP is phosphorylated at Seri ne 157 in response to calcitonin treatment and results in the disr uption of the ac tin ring ............................110 5.4 Calcitonin induces a three fold increase in phosphorylation levels of VASP at Seri ne 157................................................................................. 111 5.5 Identification of VASP null mice fr om breeding of homozygous females with a heterozy gous male ........................................................................112 5.6 Osteoclasts of mice lacking the VASP gene are able to form actin rings and respond to calcitonin in the sa me fashion as c ontrol ce lls.................113 5.7 Evl, a member of t he ENA/VASP family, is up regulated in response to osteoclasto genesis ..................................................................................114

PAGE 10

x Abstract of Dissertation Pr esented to the Graduate School Of the University of Florida in Partial Fulfillment of the Requirements for t he Degree of Doctor of Philosophy STUDY OF THE ACTIN-RELATE D PROTEIN 2/3 COMPLEX AND OSTEOCLAST BONE RESORPTION By Irene Rita Maragos Hurst August 2006 Chair: Lexie Shannon Holliday Major Department: Medi cal Sciences--Molecular Cell Biology To resorb bone, osteoclasts form an extracellular acidic compartment segregated by a sealing zone. This is dependent on an actin ring that is composed of filamentous actin organi zed into dynamic structures called podosomes. The molecular basis of ac tin rings and their association with vacuolar H+-ATPase (V-ATPase) mediat ed-acidification during bone resorption were examined. Immunoblotting and immunocytochemic al studies showed for the first time that the actin-related protein (A rp) 2/3 complex is upregulated during osteoclastogenesis and expressed in ac tin rings. Knockdowns of Arp2, a component of the Arp2/3 complex, with s hort interfering RNAs (siRNAs) revealed that it is essential for actin ring formati on. No direct associations between VATPase and Arp2/3 complex were detected. Two proteins involved in regulating Arp2/3 mediated actin polymerization were iden tified in in vitro binding studies as

PAGE 11

xi interacting with V-ATPase: cortactin and vasodilator-stimulated phosphoprotein (VASP). Cortactin binds and activates Arp2/3 complex. It was upregulated during osteoclastogenesis and localized to the cores of podosomes. siRNA knockdowns showed that it was required fo r actin ring formation. Binding studies suggest that it may interact with V-AT Pase indirectly through the glycolytic enzyme aldolase. VASP was shown to be present in actin rings and phosphorylated in response to calcitoni n, which disrupts actin rings. VASP knockout mice did not demonstrate ost eoclast or bone defects. ENA-VASP-like protein (Evl), a protein closely rela ted to VASP, was al so expressed in osteoclasts and may substitute for t he lack of VASP. These data demonstrate that the Arp2/3 complex and cortactin play significant roles in osteoclastic bone resorption and may provide targets for therapeutic agents des igned to limit the activity of osteoclasts.

PAGE 12

1 CHAPTER 1 INTRODUCTION Bone remodeling is a result of the processes of bone resorption and formation and primarily involves two types of cells (1). Osteoblasts, cells of the mesenchymal lineage, form bone and r egulate osteoclast differentiation and activation (1). Osteoclasts, the bon e resorbing cells, are derived from hematopoietic precursors and are close relatives of macrophages (2-4). Upon activation, the osteoclast under goes profound reorganizations (5, 6) and becomes polarized, forming morpholog ically and functionally distinct basolateral and resorptive domains (3, 7, 8) (Figure 1.1). The bone-apposing resorptive domain contains three primar y functional structur es: the sealing or clear zone, the ruffled membrane, and integrin-mediated adhesions. The ability of the osteoclast to resorb bone is dependent on it s ability to generate an extracellular acidic com partment between itself and the bone (7-9). This local acidification is maintained by t he presence of the sealing zone, which forms tight contact with the bone surface (6, 9, 10). The acidic pH of this compartment is created by vacuolar H+ATPases (V-ATPases ) (8, 11), in the ruffled membranes which are bounded by sealing zones. V-ATPases pump protons into the extracellular space, solubilizing hydroxya patite crystals (2), and providing the acidic environm ent required for the acid cysteine

PAGE 13

2 protease, Cathepsin K, whic h is involved in the dige stion of the organic bone matrix (2, 5, 9, 12). Osteoclast Differentia tion: RANKL Signalling Osteoclasts differentiate from ci rculating hematopoietic stem cells that are recruited to the bone to fuse and form mu ltinucleated osteoclasts (13-16). The osteoclast has phenotypic feat ures that distinguish it from other members of the macrophage/monocyte family such as the ex pression of tartrate-resistant acid phosphatase (TRAP) and the calcitonin recept or and the formation of the ruffled membrane (4, 13). Osteoclastogenesis is dependent on two important fa ctors, receptor activator of nuclear factor kappa B lig and (RANKL), a tumor necrosis factor (TNF) related cytokine, and co lony stimulating factor-1 (CSF-1) (Figure 1.2) (4, 13, 17). These factors induce the osteoc last to express genes specific for osteoclastogenesis such as thos e encoding cathepsin K, TRAP, and 3-integrin (3). Once osteoclastogenesis has occurr ed, RANKL and interleukin 1 function to increase the osteoclast survival time by inducing nuclear factor kappa B (NF B) activity (13). RANKL is a TNF-related type II transmembrane protein found on osteoblasts either as a su rface protein or in a prot eolytically released soluble form (1, 4, 13). The expression of RANKL coordinates bone remodeling by stimulating bone resorption in the osteoclast by bindi ng and activating the tumor necrosis factor receptor (TNFR)-rela ted protein, RANK, a transmembrane receptor expressed on the surface of hem atopoietic precursors (1, 4, 13). The

PAGE 14

3 requirement of these two proteins in os teoclastogenesis is indicated as mice deficient in either RANK or RANKL are severely osteopetrotic with the inability to resorb bone (1). In addition, anti bodies neutralizing RANKL inhibit bone resorption induced by stimulants such as parathyroid hormone (PTH) and prostaglandin E2 (PGE2) (16). Activation of RANK leads directly to the expression of os teoclast specific genes by the association of various TNF -receptor associated factor proteins (TRAFs) relaying the signal to at least fi ve major signaling cascades: inhibitor of NFB kinase (IKK), c-Jun N-terminal kinase (JNK), p38, extracellular signalrelated kinase (ERK), and Src pathways (1, 13, 17) (Figure 1.3). The initial step is the binding of TRAFs, cytoplasmic adaptor proteins, to specific domains of the cytoplasmic portion of RANK, in which three putative TRAF binding domains have been identified (1, 13, 17). The binding sites of TRAF-2, -5, and -6 to RANK have been identified; however, only muta tions in TRAF-6 result in a loss of osteoclast activity, resulting in osteopet rosis (1, 13, 18). TRAF6 is the key adaptor linking the expression of NFB and activator protein-1 (AP-1) to RANK (1, 13). Osteoclastogenesis is inhibite d by mutations in the p50/p52 component of NFB or the c-Fos component of AP-1, resulting in osteopetrosis (1, 13). TRAF2 and 5 are also able to activate NFB pathways, but thei r contributions to osteoclastogenesis are minor TRAF3, however, has been shown to serve as a negative regulator of NFB activation (1, 13). Activation of the protein kinase p38 by RANK results in the activation of the transcriptional regulator mi/Mitf (13). This regul ator controls the gene

PAGE 15

4 expression of both TRAP and Cathepsin K, which are both required for the osteoclast phenotype (13). ERK-1 kinase is also regulated by RANKL through upstream activation by MEK-1 (13). ER K appears to negatively regulate osteoclastogenesis as inhibitors of ERK potentiate RANKL induced osteoclastogenesis (13). Src protein binds TRAF6, pe rmitting RANK-mediated signaling to continue through the tyrosine phosphorylation of phos phatidylinositol 3-OH kinase (PI3K) and the serine/threonine protein kinase (A KT) (13). Both PI3K and AKT are involved in various cellular processe s, such as motility, cytoskeletal rearragements, and cell survival (13). Mu tations in the Src protein have been shown to cause osteopetrosis in mice ( 13, 19). Multiple factors are res ponsible for both positively and negatively regulating osteoclastogenesis by affecting expression of RANKL. Interluekin-1, c-Fms, tumor necrosis factor (TNF), prostaglandin (PG) E2, and transforming growth factor (TGF)activate surface receptors on the osteoclast to potentiate osteoclastogenesis and bone re sorption (13, 17). It is known that IL1-R and TNFR1 signal through the TRAF6 pathw ay and have a synergistic effect on RANK mediated TRAF6 activation, while c-Fms and TGFaffect osteoclastogenesis by upregul ation of its components, such as the surface receptor RANK (13, 17). Negative regulation of ost eoclastogenesis through RANKL occurs by osteoprotegerin (OPG), a solu ble protein secreted by osteoblasts (1, 13, 17). OPG is a TNFR-related protein and acts as a decoy receptor by binding to

PAGE 16

5 RANKL and blocking its ability to bind RA NK (1, 13, 17). It is controlled hormonally by bone anabolic agents such as bone morphogenic proteins (BMPs) (13). These factors caus e an overproduction of OPG which blocks osteoclast differentiation, leading to osteopetrosis (13). Hormonal Control of Bone Resorption Stimulation of osteoclastogenesis by calciotropic factors and proresorptive cytokines such as parathyroid hormone related peptide (PTHrP), parathyroid hormone (PTH), interleukin (IL)1b, tumor necrosis factor (TNF), 1,25 dihydroxyvitamin D3, or prostaglandin (PG) E2 (13, 20, 21), acts indirectly via osteoblastic stromal cells (16, 22) by i nducing mRNA expression of RANKL. In converse, factors such as estrogens c ause a decrease in RANKL expression and an increase in OPG expression, causing reduced numbers of osteoclasts (13). The cytokine, thrombopoietin, has al so been identified to induce OPG expression. Calcitonin also is known to inhibit bone resorption (13). Mechanism of Action of Osteoclast Once the osteoclast attaches to bone, there is segregation of an extracellular compartment between it and th e bony surface (1). The area of tight adhesion segregating this extr acellular compartment is termed the sealing zone (1). Bounded by the sealing zone is t he ruffled membrane (1). The ruffled membrane is a convoluted membrane pa cked with vacuolar proton ATPase (VATPase), the osteoclast proton pump ( 23). The protons, which are pumped by the V-ATPase and are responsible for bone demineralization, are obtained by various mechanisms. One mechanism is the hydration of carbon dioxide to

PAGE 17

6 carbonic acid by carbonic anhydrase II (C A II) (3). The carbonic acid then dissociates into protons and bicarbonate ions. Although traditionally described as the primary mechanism of proton prod uction in the osteoclast, osteopetrosis caused by mutations in carbonic anhydras e II is mild and improves with age (24, 25). This would suggest an alternative source of protons is available. Osteoclastic glycolysis provides the me chanism for an alternative source of protons. In the glycolytic process, one or two hydrogen ions are generated for every ATP molecule produced or glucose mo lecule consumed respectively (26). Recent data indicate that several glyco lytic enzymes bind directly to the VATPase and that V-ATPase assembly requires the glycolytic enzyme aldolase (26, 27). These data s uggest that V-ATPase, by directly interacting with glycolytic enzymes, forms an acidifying me tabolon. Regardless of their source, at the resorptive membrane, the protons are utilized by the V-ATPase to acidify the extracellular compar tment (23, 28). At the basolateral membrane, bicarbonate is exchanged for chloride ions in an energy dependent manner (3). The chloride ions, which have entered the osteoclast, pass into the extracellular compartment through a volt age gated anion channe l coupled to the V-ATPase (3, 23). The V-ATPase generates a membr ane potential and the chloride channel dissipates this potential formed by the pr otons from the V-ATPase allowing the pH to decrease in the extracellular com partment to approximat ely 4.5 (3, 23). The highly acidic nature of the extrac ellular compartment dissolves the bone mineral, which in turn, exposes the organic matrix of the bone (3). Cathepsin K, an acid cysteine proteinase generated by the osteoclast, is then able to degrade

PAGE 18

7 the bone matrix, which is primarily composed of type I collagen and non collagenous proteins (3). The degraded bon e, both protein and mineral, are then transcytosed through the osteoclast and secreted into the microenvironment through the basolateral membrane (3). Sealing Zone The sealing zone segregates the acidic resorption compartment from the surrounding environment, analogous to creati on of an extracellular lysosome (7, 8). By electron microscopy, this ar ea of the plasma membrane demonstrates extremely tight adhesion, less than 10 nm, between the plasma membrane and the adjacent bone surface (29). The mo lecular mechanisms accounting for the sealing zone are still unknown. Several actin binding proteins including vinculin and gelsolin, have been localized to the sea ling zone (30). In addition, there is much evidence that the formation of an ac tin ring is required for formation of the sealing zone (5-7, 31, 32). When acti n rings are disrupted by calcitonin, herbimycin A, or bisphosphonates, ruffled membrane formation and bone resorption are inhibited (31). Thus, this region is critical in osteoclastic bone resorption. Podosomes Podosomes are small, discrete but highly dynamic F-actin based structures. Structural studies indicate that there are two main domains of podosomes, a cylindrical dense actin core with a surrounding ring enriched with v3 and focal adhesion proteins, such as int egrins, vinculin, paxillin, and talin (33, 34). Along with actin, additiona l core components in clude Wiskott-Aldrich

PAGE 19

8 Syndrome protein (WASP) family members, the Actin Related Protein (Arp) 2/3 complex, and cortactin (35, 36). The core and ring may be linked by a bridging protein such as -actinin. Peripheral to the ring domain, it is hypothesized that a cloud of monomeric actin resides (33, 37). Although podosomes are typically found in monocytic cells and are not specific to the osteoclast (38), it is only in the osteoclast that they arrange themselves into a defined actin ring and are associated with a sealing zone (33, 39). Podosom es can also be found or induced in several other cell types, such as endothelial cells, and cells transformed with v-src (33, 35, 40, 41). Podosomes are relatively sma ll with a diameter of 0.5-1 m and a depth of approximately 0.2-0.4 m (33). Although small, they are found in great numbers in osteoclasts (33, 42). Current res earch suggests that the actin ring of osteoclasts is formed by a rearrangement and fusion of individual podosomes with a slightly different 3-dimensional struct ure (43). This structure still maintains an actin based core but the cloud of pr oteins is now propos ed to surround the entire actin ring structure rather t han each individual podosome (43). These actin ring structures can become as large as 4 m in height and diameter (43). Regardless, podosomes are highly dynamic turning over every 2-12 minutes, with the the length of the actin core turning over mult iple times within the lifespan of the podosome, likely facili tated by gelsolin (44) and dynamin (36, 42). Figure 1.4 depicts the dynamic nature of podosoma l structures in the actin ring. Rhodamine actin was introduced into saponin-permeabilized activated osteoclasts to allow for the fluorescent visu alization of incorpor ation of actin into

PAGE 20

9 the actin ring. If the actin ring is stat ic, no incorporation would occur; however, within 10 minutes, the rhodamine actin wa s incorporated into the actin ring, verifying the dynamic nature of the actin ri ng. To confirm this dynamic nature, the activated osteoclasts were treated with latrunculin A, which binds monomeric actin (45, 46). Due to the inability to add new actin monomers, a loss of podosomal structures and actin ring is observed. Podosome assembly and disassembly occurs from front to end wit h F-actin continuously adding at the leading edge and treadmilling through to the basolateral region (33, 35). It is of note that podosomes are only present on adherent cells, indicating that attachment may be the initiating fact or with regulation occurring by a variety of mechanisms. Signalin g pathways which regulate po dosomal formation include Rho family GTPases, such as R hoA, Rac1, or CDC42, and tyrosine phosphorylation by Src or Csk. (35, 47). It has been noted that both dominant active and inactive mutations in Rho fa mily GTPases affect the formation and localization of podosomes; however, t he mechanism of disruption has been shown to be dependent on cell type (47). In addition, the use of Src kinase inhibitors causes failure of podosom es while the use of phosphotyrosine phosphatase inhibitors induces podosomal formation (48, 49). Transportation of V-ATPase to the Ruffled Membrane The vacuolar H+-ATPase plays a vital role in bone resorption, as it is the proton pump responsible for acidification of the extracellular compartment and demineralization of the bone (8, 9, 11, 12, 23). In unactivated osteoclasts, VATPase is not present at the plasma me mbrane but rather stored in cytoplasmic

PAGE 21

10 vesicles (23, 50). In the inactivated stat e, the V-ATPase is bound to F-actin (9, 51); but upon activation, the mechanism by which translocation of actin and VATPase to the plasma membrane occurs is still unknown (Figure 1.5) (9). Ruffled Membrane The ruffled membrane is the resorption or ganelle of the osteoclast (8). Its name is derived from the brush border-like appearance of the plasma membrane (8). The ruffled border is formed by the fu sion of intracellular acidic vesicles with the plasma membrane, adjacent to the bone surface (6, 8, 11). The fusion of these vesicles causes an enr ichment of vacuolar proton ATPase in the plasma membrane (7, 11), which pumps protons to acidify the resorption compartment (23, 50). Osteoclast Adhesion Adhesion of the osteoclast to bone is integral in the resorption process. The integrin, v3, is a key player in adhesion of the osteoclast to bone (30, 52) by recognizing Arginine-Glycine-Aspartic Ac id (RGD) moieties in extracellular matrix (ECM) proteins (53). This int egrin has been localized to the basolateral membrane, intracellular vesicles and ruffl ed border (30, 54). Bone resorption, osteoclast formation and attachment have been shown to be inhibited by disintegrins, blocking antibodies, and RGD mimetic peptides, indicating the importance of v3 in osteoclast adhesion ( 55-57). Echistatin, an RGD containing disintegrin which binds v3 tightly, induces osteoclastic detachment from its substrate (55, 58) The use of echistatin in vivo causes an inhibition of bone resorption without significantly alteri ng the number of osteoclasts (59),

PAGE 22

11 resulting in a decreased osteoclastic efficiency without effects on osteoclast differentiation and recruitment (60). In addition, a deletion of the 3 integrin subunit did not affect osteoclast recruitm ent, which is thought to be mediated by 5, or the formation of reso rption lacunae (52). The 3 -/mice did show decreased bone resorption, abnormal ruffled membranes, and increased osteoclast number, most likely caused from stimulation by hyperparathyroidism secondary to the hypocalcemia produced by decreased bone resorption (52). Skeletal remodeling in the 3 -/mice proceeds even in the absence of v3; it is hypothesized that an adequate resorption rate is achieved by the increased number of osteoclasts, even in the presence of decreased resorption per osteoclast (52). Howe ver, with age, the compensation decreases, and osteosclerosis occurs (52). Although onc e thought to mediate the extremely tight seal of the sealing zone, Lakkakorpi et al. (57) and Masarachia et al. (59) have shown the specific exclusion of v3 from the sealing zone. However, its absence from the sealing zone does not preclude its ability to cause a visible disruption of the sealing z one as was shown by Nakamura et al. (60). It seems likely that proper stimulat ion of integrin-based sig nal transduction pathways normally plays a role in the acquisition and maintenance of osteoclast polarity during bone resorption (61). Osteoclasts and Disease As previously stated, bone homeos tasis is dependent on a delicate balance between bone resorption and bone formation (62). When one is in excess of the other, bone diseases occur. Most commonly, skeletal diseases are

PAGE 23

12 a result of an excessive am ount of bone resorption, result ing in osteoporosis (1, 62). Osteoclastic bone diseases are c aused by reduced number of osteoclasts, reduced or loss of function or overac tivity of osteoclasts (62). There are several diseases which result in reduced osteoclast activity and thus, osteopetrosis, which often leads to brittle bones and fractures (62-64). Autosomal recessive malignant osteopetrosis is a result of a mutation in the TCIRG1 gene (65, 66). This gene enc odes for the 116 kD a3 subunit of VATPase (65, 66). The resultant phenoty pe is osteoclast-rich but with poor resorptive abilities (65, 66). Autoso mal dominant osteopetrosis type II (AlbersSchonberg disease) results from a muta tion in the CLCN7 gene, which encodes for the CLC7 chloride chann el (67-69). As a result of this mutation, normal numbers of osteoclasts are present; how ever, resorption is inhibited as acidification of the resorption lacunae is hindered (67-69). Autosomal dominant osteopetrosis type I has been linked to a gain of function mutation in the LRP5 gene (70-72). In this disease, osteoc last function is not impaired; however, abnormally low numbers are present (70). It is hypothesized that the mutations in the LRP5 gene alter the osteoblast, decreasing the potential to support osteoclastogenesis (70). Pycnodyostosis has been showed to be a result from mutations in the Cathepsin K gene, an ac id cysteine protease responsible for the degradation of organic bone matrix (73-75). A deficiency in this protease results in elevated numbers of os teoclasts and disorganized bone structure (73-75). Another osteopetrotic disease is t he autosomal recessive syndrome of osteopetrosis with renal tubular acidosis and cerebral calcification; which is, most

PAGE 24

13 frequently referred to as carbonic anhydrase isoenzyme II deficien cy (24, 25, 76). CAII is responsible for one of the mechani sms by which the protons, which are responsible for acidification of the re sorption compartment, are produced (3). Thus, prevention of normal acidification occu rs (24, 25, 76). A decrease in osteoclast number may result from defects in the CSF1 (colony stimulating factor) gene (62). De fect in this gene in the murine model results in a broad spectrum of pathology fr om a delay in osteoclast formation to a complete inhibition of osteoclast forma tion. In addition, polarization can be affected and there may be a loss of the ru ffled border (62). However, to date, there have been no human case s of osteopetrosis attri buted to a lack of CSF-1 (62). The diseases of increased osteoclast ic activity include Pagets disease (PD), expansile skeletal hyper-phosphatasia and famili al expansile osteolysis (FEO) (77). The second most common bone disease, after osteoporosis, is Pagets disease of bone (77). This diseas e primarily occurs as a result from a mutation in SQSTM1, which encodes sequestosome 1, an ubiquitin binding protein involved in multiple signaling pat hways, including RANKL, IL-1 and TNF (78, 79). However, recent cases hav e reported a mutation in the TNFRSF11A gene as well which encodes RANK (80-83) Unlike Pagets, familial expansile osteolysis and expansile skeletal hyperphosphatasia result primarily from defects in the TNFRSF11 A, which is the gene encodi ng RANK (80, 83). Regardless of mutation location, these defec ts result primarily in an enlargement of the osteoclasts with an increased number of nuclei ( 80-83). In addition, there

PAGE 25

14 can be an increase in osteoclast number as well as in activity (80-83). A striking finding in both FEO and PD are nuclear inclusions similar to those seen by viral infections (83). The osteoclast is also im plicated in diseases in which skeletal pathology results from inflammation (84-86). In rheumatoid diseases, such as rheumatoid arthritis, seronegative spondyloarthropat hies, and systemic lupus erythematosis, as well as periodontal disease, the osteoclast has been identified as the dominant cell type which mediates th e inflammatory bone loss (84-86). Activation of the osteoclasts occurs due to increases in proinflammatory cytokines, such as TNF, Interferon (INF), and interleukins, which then modulate expression of RANKL and OPG (84, 85). Treatment of Osteoporos is and Osteopetrosis Osteoporosis occurs as a result of an imbalance in the bone remodeling cycle resulting in excessive bone loss (87-89). For the past decade, the treatment of osteoporosis wa s based on the retardation of bone mineral density loss (88). However, bone formative medi cations have recently come on the market. The anti-resorptive medications slow bone resorption and formation, but the effect on formation is less dramatic, allowing bone formation to exceed bone resorption and bone density to increase modestly (88). Anti-resorptive medications include the bi sphosphonates, estrogens, sele ctive estrogen receptor modulators, and calcitonin. Calcium is important in the preventi on and treatment of osteoporosis (90, 91). Adequate calcium is important for i ndividuals at all ages Individuals, with

PAGE 26

15 high calcium intake as children, hav e increased bone mass, which is an important variable in future fracture risk, as the risk for osteoporotic fractures is inversely related to bone mineral densit y (91). Post-menopausal use of calcium has been shown to decrease bone loss and prev ent tooth loss but there is little or no reduction in the risk of spinal fractu res (90, 91). Calcium intake should be between 1000-2000 mg/daily (91) Although calcium may slow the loss of bone mineral density, most physicians suppor t the use of additional pharmacologic intervention to prevent/treat osteoporosis (91). Estrogens and SERMS function as estrogen receptor agonists (88, 89, 92, 93). Estrogen therapy, also known as hormone replacement therapy, has been approved primarily for the prevention of os teoporosis. It has also been shown to increase bone density modestly, reduc e bone loss and reduce the risk of fractures in postmenopausal women (92, 93). Selective Estrogen Receptor Modulators (SERMS) bind to the estrogen receptor. Although their mechanism of action is not fully understood, these agents may f unction by inducing conformational changes in the estrogen re ceptor, causing differential expression of specific estrogen-regulated genes in different tissues (92, 93). SERMS (raloxifene) are used for both the pr evention and treatment of post-menopausal osteoporosis. They function like the es trogens but without the disadvantages of estrogens, such as the increase in uterine cancer (92, 93). Raloxifene has been shown to increase bone mass and reduce spinal fractures; however, as of yet, there is no evidence indicating a decreas e in non-spinal fractures (92, 93). Recent data have shown signific ant risks for breast cancer, venous

PAGE 27

16 thromboembolism and stroke with the us e of estrogens and SERMS (94, 95). Data on the incidence of breast cancer hav e identified an increa sed risk in ductal and lobular cancer with the use of medium potency estrogens and an increase in lobular cancer with low potency estrogens (94). In addition, if additional risk factors are added, such as alcohol consumption and th e use of oral contraceptives, an increase in all three brea st cancer subtypes (ductal, lobular or tubular) was observed (94). An examination of the lite rature identified increased risks of thromboembolism in pati ents in their first year of therapy and those taking an estrogen-progesterone or high dose estrogen preparation (95). Route of administration also increases the risk as oral administratio n had significantly higher incidence of thromboem bolism than transdermal (95). The bisphosphonates, alendronate, i bandronate and risedronate, are used for the prevention and treatment of postmenopausal bone loss (88, 89, 92, 93, 96, 97). They function to slow bone loss, increase bone density and reduce the risk of skeletal fractures (97). There ar e two main categories of bisphosphonates (96). Amino bisphosphonates inhi bit osteoclastogenesis by blocking isoprenylation of Rho and Rap and indu cing apoptosis wh ile the non-amino bisphosphonates are metabolized to cytot oxic ATP analogues thus inducing cell death (69, 98). Although very effective in the treatment of osteoporosis, the use of bisphosphonates carries significant side effects (99). Several studies have demonstrated a high risk of gastric duodenal, and esophageal ulcers with administration (100). In addition, two percent of bisphosphonate users demonstrate acute systemic inflammatory reactions, ocular complications, acute

PAGE 28

17 and chronic renal failure, and electrolyte imbalances (99). Osteonecrosis of the mandible or maxilla has recently been iden tified as sequelae of treatment with bisphosphonates (99, 101-103). Thes e lesions presented as non-healing, usually as the result of dental surgical intervention (99, 101, 102). Although the large majority of these pat ients were receiving parenter al administration of the drug, several patients were on oral dos es (99, 101, 102). Many researchers strongly support further studies to ident ify the risks and benefits of continuing bisphosphonate therapy (99, 101-103). Calcitonin is also used for the prev ention and treatment of osteoporosis (104, 105). This naturally occurring hor mone is involved in calcium regulation and bone metabolism (104, 106, 107). It is administer ed nasally rather than orally, as it is a protein and would be degraded prior to its function (104). Calcitonin has been shown to increase bon e mass and reduce spinal fractures. In addition, studies have shown a decrease in pain post-fractur e with the use of calcitonin (105). Non-spinal fracture s, however, have not been shown to be reduced with calcitonin treat ment (105). A resistance to continuous treatment with calcitonin, with a loss of inhibitory effects on bone resorption, has been shown to occur within 12-18 months afte r initiation of treatment due to a downregulation of the calcitonin receptor, by both internalization of the receptor and a reduced concentration of de novo rec eptor synthesis (106, 107). Recent data have shown that this resistance can be avoided by the use of intermittent administration of calcitonin, as calcitonin receptor mRNA expression returns to normal by 96 hours after discont inuation (106, 107).

PAGE 29

18 Teraparatide (Forteo), par athyroid hormone [1-34], is a newly approved medication to treat osteoporosis via bo ne formation (108-110). Its mechanism of action is to increase bone formation by t he osteoblasts (108-110). It has been shown to stimulate bone formation and in crease bone mass to a greater extent than the anti-resorptive agents (108-110). Reductions in spinal and non-spinal fractures have been shown (108-110). Like calcitonin, it is a peptide but it is given by injection daily whic h is a disadvantage of this treatment (108, 110). The most common adverse effects of treat ment with teraparat ide include headache, nausea, dizziness, and cram ping; however, only dizziness and cramping differed from placebo in a randomized clinical trial (111). Other less common complications include hypercalcemia and hyperuricemia (111). These complications can often be inhibited by a reduction of the dosage but may require complete cessation of the drug (111). An imal studies have shown an increased risk for osteosarcoma with the use of te raparatide; however, osteosarcoma has not been identified in over 2800 patients in human clinical trials (111). Several new treatment modalities are on the horizon for osteoporosis. Zolendronic acid, an injectable bisphosphona te, is currently being studied. It has been shown to increase bone mineral density modestly as do the other bisphosphonates (93). In addition, strontium ranelate, the only current drug known to decrease bone resorption and increase bone formation concomitantly, has just recently finished Phase III trials (93, 112). It has been shown to reduce both vertebral and non-vertebral fractures (93). Its efficacy and safety have been shown; and therefore, it should be marketed soon (112). In addition, as the proof

PAGE 30

19 of concept for bone anabolic therapy has been established with the use of parathyroid hormone, ot her parathyroid hormone analogues are being investigated as well as the development of non-peptide small molecules targeted against the parathyroid hormone receptor. The treatment of osteopetrosis has fo cused on the stimulation of host osteoclasts with calcium restriction, calc itrol, steroids, parathyroid hormone, and interferon (113, 114). Infantile maligna nt osteopetrosis has also been treated with bone marrow transplantat ion (113, 114). Coccia et al. (115) documented a case of successful bone-marrow transplantati on in a five month old girl in 1980. Prior to transplantation, the patient exhibited anemia, thrombocytopenia, low serum calcium and elevated serum alkali ne phosphatase and acid phosphatase all of which normalized within 12 weeks po st-transplantation (115). In addition, histologic sections prior to transplantat ion showed an increa se in osteoclast number but no bone resorpti on occurring (115). Post -transplantation, active osteoclastic bone resorption occurred (115) Unfortunately, although there have been some reports of successful treatment of osteopetrosis, most research indicates ineffectiveness of treatment and patients are us ually given poor prognosis (113). Difficulty in treatment also stems from the mult iple etiologies of osteopetrosis, and therefore, treatment must be individualized to each patient (113). Osteoclasts and Dentistry Osteoclasts play a significant role in the oral cavity, both through physiologic and pathologic proce sses. The osteoclast is central to the bone loss

PAGE 31

20 observed in periodontal disease. In the inflammatory process in the periodontium, recent data have show n increased levels of RANKL and decreased levels of OPG in patients wit h periodontal disease (116-118). Recent data have also identified RANKL expressi on on both T and B lymphocytes (117). It is suggested that the bacterial biofil m initiates an immune response with expression of RANKL which in turn st imulates osteoclastogenesis and bone resorption (117). This hypothesis is c onfirmed by data show ing an abrogation of bone resorption when RANKL is inhi bited or knocked out (117). Dental root resorption is anot her pathologic process mediated by the osteoclast. Dental root resorption is fair ly unpredictable and t he etiology is still unknown (119). Recent studies however identify increased le vels associated with the IL-1 gene (120). Studies on RANKL and OPG expression when heavy forces are applied during or thodontic tooth movement s how increased levels of RANKL to OPG associated with root resorption (121). In contrast, root resorption has been shown to be inhibited with echist atin treatment, a known inhibitor of osteoclasts (119). Osteoclasts do not always play a pathologic role in the oral cavity. In fact, resorption can be accelerated or inhibite d based on the needs of the orthodontic patient. Several studies have shown that osteoclastic bone resorption can be decreased with the addition of chemical mediators or cyt okines (122-126). Mice lacking the TNF type 2 receptor show less bone resorption than wild type mice (126). Addition of OPG to the periodontal tissues of mice has also been shown to decrease osteoclastogenesis (125). In a ddition, inhibition of orthodontic tooth

PAGE 32

21 movement has been observed when tr eated with matrix metalloproteinase inhibitors, echistatin or an RGD peptide (123). In contrast, orthodontic tooth movement can be accelerated by the remo val of OPG. Compared to wild type OPG littermates, OPG knock out mice sh ow increased osteoclast number and increased alveolar bone resorption (127). In the future, the power of the osteoclast may be able to be harnessed to enhance the treatment of the dental patient. General Purpose of Research The general purpose of the work pres ented in this dissertation has been to learn more about the actin ri ng of osteoclasts, its char acteristics and composition and requirements for formation. In addition, we sought to identify a relationship between components of the actin ring and V-ATPase, another specialized structure of the osteoclast.

PAGE 33

22 Figure 1.1. Resorbing osteoclast. Once the osteoclast attaches to bone, there is segregation of an extracellu lar compartment between it and the bony surface. The area of tight adhesion segregating this extracellular compartment is termed the sealing zone. Bounded by the seali ng zone is the ruffled membrane. The ruffled membrane is a convoluted memb rane packed with vacuolar proton ATPase (VATPase), the osteoclast proton pump (3). Bone degradation is initiated by hydration of carbon dioxide to carbonic acid by carbonic anhydrase II (CA II). The carbonic acid then dissociates into protons and bicarbonate ions. At the apical membrane, the pr otons are pumped into the extracellular compartment via the V-ATPase. At the basolateral membrane, bicarbonate is exchanged for chloride ions in an energy dependent manner The chloride ions, which have entered the osteoclast, pass into the extr acellular compartment through an anion channel coupled to the V-ATPase. The protons and chloride ions form hydrochloric acid and reduce the pH in the extracellular compartment to approximately 4.5, which a llows the deminera lization of the bone mineral and exposes the organic matrix of the bone Cathepsin K, an acid cysteine proteinase, is then able to degrade the bone matrix. The degraded products, collagen and calcium, are then transcytosed through the osteoclast and secreted into the microenvironment through the basol ateral membrane. (Teitelbaum et al. J Bone Miner Res 2000; 18:344-349) (3)

PAGE 34

23 Figure 1.2. The OPG/RANK/RANKL triad pl ays an important role in the bone, immune, and vascular systems. In t he bone system, the interaction between OPG and RANKL promotes eit her osteoclast differentiation and survival or osteoclast apoptosis. (Theoley re et al. Cytokine and Growth Factor Reviews. 2004; 15:457-475) (17)

PAGE 35

24 Figure 1.3. Binding of t he adaptor protein TRAF6 is the initial step in RANKL signaling. Down stream targets of TRAF6 in clude nuclear transcription factors, such as NF B, and signal transduction molecules, such as c-Src. (Theoleyre et al. Cytokine and Growth Factor Reviews. 2004; 15:457-475) (17)

PAGE 36

25 CONTROL LATRUNCULIN A Figure 1.4. The dynamic nature of the podosomes of actin rings Rhodamine actin was incorporated into saponin permeabi lized osteoclast like cells. In the control cells, the rhodami ne actin was quickly incorpor tated (within 10 minutes) into the actin rings of osteoclasts. In t he latrunculin A treated cells, which inhibits G-actin from polymerization, a complete loss of the actin ring was observed. (Hurst and Holli day, unpublished)

PAGE 37

26 ACTIN MERGE V-ATPase Figure 1.5. In unactivated osteoclasts, V-ATPase is not pres ent at the plasma membrane but is stored in cytoplasmic vesicles, but upon activation, it is transported via actin filaments to the ruffled membrane. Mouse marrow osteoclasts were loaded onto bovine cortical bone slices cultured for 2 days, and fixed and stained with anti-VATPase antibody and phalloid in. This micrograph is representative of an early resorptive os teoclast. The white arrow identifies a region where the V-ATPase has been trans ported to the ruffled membrane which is bounded by actin. The black arrow, below, identifies a unactivated region, where the V-ATPase and acti n are still found to be co-localized in cytoplasmic vesicles (Lee et al. J Biol Chem 1999; 274(41):29164-29171) (9)

PAGE 38

27 CHAPTER 2 ACTIN RELATED PROTEIN (ARP) 2/3 COMPLEX: AN ELEMENT OF ACTIN RINGS Introduction The Arp2/3 complex was or iginally identified by Machesky et al, 1994 (128) as a contaminant during affini ty chromatography of profilin from Acanthamoeba castellani Further studies have show n the Arp2/3 co mplex to be ubiquitous (129). It has been isolated and studied in detail from sources including human platelets, bovine br ain extract, Xenopus laevis and Sacchromyces cerevisiae (130-133). The Arp2/3 comp lex is a globular particle of 220 kD (134, 135) and is composed of seven subuni ts (131, 136-139), which have been highly conserved during evol ution (136). Arp2 and Arp3 are actin related proteins, sharing sequence hom ology with actin in the nucleotide and divalent cation binding domains (131). The other five subunits are novel (131, 137, 139). The subunits ar e present in stoichiometr ic amounts (131, 140). Two isoforms of both the Arp3 and p40 subunits have been identified ( 130, 133, 139, 141). The two isoforms of the Arp3 subun it, Arp3 and Arp3B, share 92% identity(139). Expression of the two isoforms di ffers with tissue (139). Arp3 is present ubiquitously, while Arp3B is found predominantly in th e brain, liver, muscle and pancreas (142). The two isoforms of the p40 subunit share only 68% sequence similarity (130, 133, 139, 141).

PAGE 39

28 The Arp2/3 complex is a key regul ator and nucleator of actin polymerization (32, 129). The Arp2/3 complex functions to stimulate actin polymerization at the barbed end of actin filaments, form a nucleation core to trigger actin polymerization de novo, and bi nd to the side of actin filaments where actin polymerization is triggered, resulti ng in the formation of an orthogonal actin network (134, 136, 137). Neither Arp2 no r Arp3 is able to independently induce polymerization of actin (133, 136). T he formation of a dimer between the two subunits in the complex is required to form the nucleation core to trigger polymerization of actin (Figur e 2.1) (138); this process is considered a possible rate limiting step (137, 138, 143, 144). The formation of the dimer is a result of activators such as the WASP family pr oteins, VASP via ActA, and cortactin (138, 143-146). Arp2/3 complex driven polymerization is th ought to be required for centrally-important cell processes including amoeboid movement and phagocytosis (147-150). The fa ct that the Arp2/3 complex is a central player in the actin-based motility of certain pat hogens has proven to be invaluable to understanding how Arp2/3 wo rks (130, 148-150). Activa tion of the Arp2/3 complex by WASP family members and sm all G-proteins results in actin polymerization resulting in the movem ent of bacterial pathogens such as Listeria, Shigella and Rickettsia as well as the enveloped vi rus vaccinia (129, 151-153). This motility actin polymerization that se rves as the basis for this movement results in an actin comet tail. This mo vement is involved in the spread of the pathogens from cell to cell (145, 149, 150). Reconstitution of actin-based

PAGE 40

29 motilities in vitro has been successful using F-acti n, the Arp2/3 complex, actin depolymerizing complex (ADF), and capping protein (154). The motility of this system proceeds at slow speeds; however, with the addition of Arp2/3 regulators, such as profilin, actinin, and VASP, there is an incr ease in motility (154). In this study, we examined the presence of the Ar p2/3 complex in osteoclasts and its localization during ost eoclastogenesis. In addition, we tested its requirement for actin ring formation. Materials and Methods Materials Anti-Arp2 and anti-Arp3 antibodies we re purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rhodamine labeled phalloidin was obtained from Sigma-Aldrich (St. Louis, MO). All CY2 and Texas Red-labeled secondary antibodies were obtained fr om Jackson-ImmunoResearch (West Grove, PA, USA). The expression ve ctor containing a RANKL [158-316] glutathione-S-transferase fusion protein construct was a kind gift of Dr. Beth S Lee (Ohio State University Columbus, OH, USA) Arp 2/3 purification The Arp2/3 complex was purified fr om outdated human platelets (Civitan Blood Bank, Gainesville, FL, USA) by a method previously described by Welch and Mitchison (155) based on conventional chromatography. The platelets were centrifuged at 160g for 15 minutes. The platelet pellet was resuspended in 20 volumes of wash buffer (20 mM PIPES, pH 6.8, 40mM KCL, 5 mM ethylenebis(oxyethylenenitrilo)tetraac etic acid (EGTA), 1 mM Et hylenediaminetetraacetic

PAGE 41

30 acid (EDTA) per volume of packed platelets and centrifuged at 2000g for 15 minutes. The wash was repeated two times. After the final spin, the pellet was resuspended in five volumes of wash bu ffer on ice for 10 minutes. An equal volume of lysis buffer (Wash buffer pl us 10 ug/ml leupeptin, pepstatin, and chymostatin (LPC protease inhibitors), 1 mM benzamidine, 1 mM phenylmethylsuflonyl fluoride (PMSF), 1% Triton X-100, and 0.05 mM adenosine triphosphate) was added on ice for 5 minute s. The lysate was centrifuged at 2000g for 2 minutes at 4oC to pellet the triton-insolubl e cytoskeleton. The pellet was resuspended in 5 volumes of resusp ension buffer (Wash buffer plus LPC protease inhibitors, 100mM sucrose, 0.05 mM ATP and 1 mM dithiothreitol (DTT)). The resuspended lysate was c entrifuged at 2000g fo r 2 minutes at 4oC. The pellet was gently resuspended in 10 volumes of low salt buffer (20 mM PIPES, pH 6.8, 10mM KCl, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, LPC protease inhibitors) and repelleted by centrifugat ion at 2000g for 2 minutes. The pellet was resuspended in 5 volumes of extracti on buffer (20 mM PIPES, pH 6.8, 0.6 M KCl, 5 mM EGTA, 1 mM EDTA, 1 mM D TT, 0.2 mM ATP, LPC protease inhibitors). This suspension was hom ogenized for 2 minutes using a Teflon tissue homogenizer. The homogenate was incubated on ice for 30 minutes and then centrifuged at 25,000g for 15 minutes. The supernat ant was collected the first fraction of the cytoskeletal extract. The pellet was resuspended in 5 volumes of extraction buffer, and homogenized for 1 minute, followed by incubation on ice for 2 hours. This step was repeated two ti mes; after which, the homogenate was centrifuged at 25,000g for 15 minutes at 4oC. The supernatant was collected and

PAGE 42

31 added to the first fraction of the cytoskele tal extract. Figure 2.2 lane 1 shows the total protein extract from the human plat elets. ATP was added to a 5 mM final concentration and EGTA was ad ded to a 10 mM final concentration. The extract was incubated at 4oC for 16 hours. The extract wa s centrifuged at 25,000g for 15 minutes. The extract was desalted by us e of a 10 ml gel filtration column preequilibrated with Q-Buffe r A supplemented with 100 mM KCl (20 mM Tris, pH 8.0, 2 mM MgCl2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM ATP, 2.5% v/v glycerol). The desalted extract was passed over a 5 ml-Hi-trap Q-Sepharose HP Column pre-equilibrated with Q Buffer A plus 100 mM KCl. The column was presaturated with ATP prior to loading the desalted extract. The Arp2/3 complex is isolated in the flow through fractions Figure 2.2 lane 2 shows the protein composition of the Q-S epharose flow through fraction. The flow-through fractions were pooled and the pH was adjust ed to pH 6.1 by the addition of MES, pH 6.1 to a final concentration of 40 mM. Glycerol to 10% v/v and LPC protease inhibitors were added and the KCl concentration was adjusted to 50 mM by the 1:2 dilution of sample to S-buffer A (20 mM 2-[N-Morpholino] ethanesulfonic acid (MES), pH 6.1, 2 mM MgCl2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM ATP, 5-10% v/v glycerol). The diluted flow-through fractions were passed over a 1 ml Hi-trap SP-Sepharose HP column pr e-equilibrated with S-buffer plus 50 mM KCl at a rate of 0.5 ml/min. The column was washed with 10 volumes of S buffer with 50 mM KCl. The Arp2/ 3 complex was eluted with a linearly increasing gradient of KCl from 50 mM to 500 mM. The Arp2/3 complex eluted at 175-200 mM KCl. The peak fractions were pool ed and concentrated to 0.5 ml.

PAGE 43

32 The concentrated fractions we re loaded onto a Superose 6-HR 10/30 gel filtration column pre-equili brated with gel filtration bu ffer (20 mM MOPS, pH 7.0, 100 mM KCl, 2 mM MgCl2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM ATP, 5-10% v/v glycerol). Fractions of 0.5 ml were collected and the Arp2/3 complex was the only detectable peak eluted from the column at A280. The fractions containing the purified Arp2/3 complex were pooled and concentrated using Centricon 30 concentrators. The protein was frozen in liquid nitrogen and stored at oC. Approximately 500 ug of protein was recove red from 10 ml of cytoskeletal extract (250 ml of plasma). Cell culture Osteoclasts were obtained from two s ources. Mouse marrow osteoclasts were grown from marrow derived from t he long bones of the hi nd legs of SwissWebster mice. The marrow cells were grown in -MEM medium with 10% fetal bovine serum (FBS) plus 10-8 M 1,25-dihydroxyvitamin D3 for a period of approximately seven days. Osteoclasts were also grown from the RAW 264.7 cell line, which is a mouse hematopoietic ce ll line. This protocol was approved by the University of Florida Institutional Animal Care and Usage Committee. RAW 264.7 cells were grown in Dulbecco s Modified Eagles Medium (DMEM) containing gentamicin and 10% FBS for 4 days with fresh media being added on day 2. On day four, the cells were detac hed by scraping, gently triturated and counted with a hemacytometer. The cell density is crucial for osteoclast differentiation. A cell c ount of 15,000-20,000 cells/cm2 was cultured with 50 ng/ml recombinant receptor activato r of nuclear factor kappa b ligand

PAGE 44

33 (RANKL)(amino acids 158-316)-GST for 4-5 da ys. With the ad dition of RANKL, the RAW 264.7 cells become large, multinucleated cells expressing characteristics of osteoclasts includi ng actin ring formation, expression of tartrate-resistant acid phosphatase activi ty and the ability to resorb bone. The osteoclasts and RAW 264.7 cell s were cultured in tiss ue-culture grade dishes. Once mature, the cells were scraped and r eplated on either glass coverslips or dentine bone slices. Western blot analysis with quantitation of Arp2/3 Anti-Arp2/3 antibodies were obtained from Santa Cruz Biotechnology Inc (Santa Cruz, CA). The Anti-Arp2 anti body was generated again st the carboxyl terminus of the Arp2 protein while the Anti-Arp3 antibody was generated against the amino terminus. The specificity of the antibodies was determined by Western Blot analysis, by probing the purified Arp2/3 complex (F igure 2.3A). RAW 264.7 cells were grown as previously described, plated on 6 well plates, and either left unstimulated or stimulated with RANKL. Ce ll lysates were collected from both the control and treated cells. Cells were washed twice with ice cold PBS and scraped from the plates. The cells were then detergent solubilized in 0.2% Triton X-100 in PBS. Equal am ounts of the lysates were separated by SDS-PAGE, followed by Western Transfer. The nitroc ellulose blots were then incubated with either anti-Arp3 or antiArp2 antibodies for one hour, washed three times, incubated with HRP conjugat ed secondary antibody, washed three times, and incubated with Super Signal Dura West Chemiluminescent Substrate (Pierce, Rockford, IL). The blots were then viewed on a Fluorochem 8000 (Alpha-

PAGE 45

34 Innotech, San Leandro, CA), and qua ntitation was performed by Spot Densitometry (Fluor-Phor Software, Al pha-Innotech, San Leandro, CA). The integrated density values (IDV) were obtained (white = 65535, black = 0). Background values were subtracted, and t he intensities were normalized against the value of actin in the sample. The values were then compared between stimulated and unstimulated cells. The st imulated and unstimulated values were statistically analyzed using the students t-test, with st atistical significance (p) being less than 0.05. Immunofluorescence Immunofluorescence was performed to vi sualize the distribution of the Arp2/3 complex in the resorptive osteocla st as well as its co-localization with actin. The marrow or RAW264.7-deriv ed osteoclasts were fixed in 2% formaldehyde in PBS on ice for 20 minutes The cells were then detergentpermeabilized by the addition of 0.2% Triton X-100 in PBS for 10 minutes, washed in PBS and blocked in PBS with 2% bovine serum albumin (BSA) for one hour. Cells were stained with rhodaminephalloidin, or antibodies recognizing Arp3 or Arp2 at a dilution of 1:100 in PBS Secondary antibodies were diluted according to manufacturers instructions. Osteoclasts were visualized using the MRC-1024 confocal laser scanning micr oscope and LaserSharp software (BioRad, Hercules, CA). Images were taken in sequential series to eliminate any overlap of emission and analyzed by confocal assistant software. Additional imm unofluorescence experimentation was performed to identify changes in the distribution of the Ar p2/3 complex when introduced to agents

PAGE 46

35 known to disrupt actin ring formation. Cell culture was perfo rmed as previously described. On day 6 of differentiation (ma ny large multinucleated cells present), wortmannin (100 nM), cytochalasin D (20 M) or echistatin (10 nM) were added to the cells and incubated for 10-30 minutes The cells were then fixed in 2% formaldehyde, solubilized in 0.2% Trit on X-100 in PBS and blocked in PBS with 2% BSA. Cells were stained with rhodamine-phalloidin, or antibodies recognizing Arp3 or Arp2 at a dilution of 1:100 in PBS. Secondary antibodies were diluted according to manufacture rs instructions. Osteoclasts were visualized using the M RC-1024 confocal laser scanning microscope and LaserSharp software (Bio-Rad, Hercules, CA ). Images were taken in sequential series to eliminate any overlap of emi ssion and analyzed by confocal assistant software. Polymerase chain reaction of the two isoforms of Arp3 To determine the redundancy of the Arp3 protein, RNA was extracted from RANKL differentiated RAW 264.7 cells as well as from unstimulated RAW 264.7 cells using RNAeasy Mini Kit (Qiagen, Valencia, CA) and quantified by spectrophotometer. The sequences for Arp3 and Arp3-beta were obtained from Gen Bank. Primers were designed as des cribed in Table 2.1. For standard RTPCR, 3 g of total RNA was annealed to an oligo-dt prim er and first strand cDNA synthesis was performed us ing Thermoscript RT-PCR System (Invitrogen, Carlsbad, CA) following manufacturers dire ctions. One-twentieth of the cDNA was subjected to amplification by P CR. PCR was performed under the following conditions: 95oC for 2 minutes, then 35 cycles of 90oC, 30 seconds; 58oC, 30

PAGE 47

36 seconds; 72oC, 30 seconds. One-half of the PCR product was separated on 0.5% agarose gel with ethidium bromi de staining for 1 hour. Images were detected using UV transillumination on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA). Knock down of Arp2 with siRNA Five siRNA complexes were designed against the Arp2 protein (accession no. XM_195339) and produced by Sequitur (Natick, MA, USA): 19941 (targeting bp 21-39) sense 5-GGUGGUGGUGU GCGACAAUTT-3, antisense 5AUUGUCGCACACCACCACCTT-3; 19942 (t argeting bp 138-156) sense 5AGGGGGAAACAUUGAAAUCTT-3, antis ense 5-GAUUUCAAUGUUUCCCCC UTT-3; 19943 (targeting bp 255-273) sense 5-CAGAGAGAAGAUUGU AAAGTT-3, antisense 5CUUUACAAUCUUCUCUC UGTT3; 19944 (targeting bp 372-390) sense 5-CUCUGGAGA UGGUGUCACUTT-3, antisense 5AGUGACACCAUCUCCAGAGTT-3; 19945 (targeting bp 513-531) sense 5CCAUUCUGCUGAUUUUG AGTT-3, antisense 5-CUCAAAAUCAGCAGAAUG GTT-3. Initial experim entation showed that only siRNA 19942 was capable of producing downregulation of t he Arp2 protein. The other siRNAs were used as ineffective controls. For morphologic al examination, RANKL stimulated RAW 264.7 cells on glass coverslips in 24-well pl ates were either not transfected or transfected using 1.5 U control or ine ffective siRNA and 1.5 U fluorescent double stranded RNA combined with 2 ul Lipofecta mine 2000 (Invitrogen) in Opti-Mem media supplemented with RANKL on day 5 of differentiation (at the appearance of multinucleated cells). Six hours afte r transfection, the media was replaced

PAGE 48

37 with DMEM supplemented with FBS and RANKL. No antibiotics were used. The cells were incubated for 24 hours at 37o C in a CO2 incubator; after which, the cells were fixed in 2% paraformaldehy de. Rhodamine phalloidin was used to visualize actin ring morphololgy. Only cells with uptake of the fluorescent oligomer were identified as having been transfected wit h the control or Arp2 siRNA. Morphological exam ination was performed using confocal microscopy. Mouse marrow osteoclasts were grown on tissue culture plates for 5 days and supplemented with calcitriol as described previously. The cells were then scraped and transfected as described fo r the RAW 264.7 cells, except MEM was used in place of DMEM. Cells we re analyzed as described above for RAW 264.7 cells. For assessment of prot ein expression, RANKL stimulated RAW 264.7 cells on 6 well pl ates were either not transfe cted or transfected using 7.5 U control or experimental siRNA combined with 10 ul Lipofectamine 2000 on day 5 of differentiation. Six hours after transfe ction, the media was replaced by DMEM with FBS and RANKL. The cells we re incubated for 30 hours at 37o C in a CO2 incubator. Cells were scraped and washed twice with PBS. The pellets were lysed using 250 ul of cell extraction bu ffer (BioSource International, Camarillo, CA, USA) supplemented with protease inhibitor cocktail (Sigma P2714) and phenylmethylsulfonyl fluoride (PMSF) for 30 minutes on ice with vortexing every 10 minutes. The extract was centrif uged for 10 minutes at 13,000 rpm at 4o C. Bradford assay was performed on the lysates. Equal c oncentrations of protein were separated by SDS-PAGE, followed by western transfer. The nitrocellulose blots were blocked in bl ocking buffer overnight and in cubated with bot h anti-Arp2

PAGE 49

38 and anti-actin antibodies for 2 hours. T he blots were washed and incubated with a horseradish peroxidase (HRP)-labeled secondary antibody for 1 hour, followed by incubation with a chemiluminescent su bstrate. The blots were visualized using an Alpha Innotech Fluorochem 8000. Quantitation was performed using densitometry measuring integr ated density values. Results Arp2 and Arp3 are upregulat ed during osteoclastogenesis After the purified Arp2/3 comp lex was isolated from platelets, the specificities of the anti-Arp2 and ant i-Arp3 antibodies we re determined by western blot analysis (Figure 2.3A). Bo th antibodies recognized their target proteins. When observing total protein leve ls, by western blot analysis, from nonstimulated RAW 264.7 cells and RAW 264.7 cells induced to differentiate into osteoclasts by treatment with RANKL, both Arp2 and Arp3 were upregulated approximately three-fold in response to RANKL stimulation (Figure 2.3B and 2.3C). Both isoforms of the Arp3 pr otein are present in osteoclasts The Arp3 protein has been identified in two different isoforms. By PCR analysis, both isoforms are expressed in t he activated osteocla st (Figure 2.4). This may allow for redundancy of the Arp3 protein, which would allow the maintenance of essential func tion of the Arp 2/3 protei n even if one isoform was mutated or lost.

PAGE 50

39 Expression of Arp2/3 complex in the actin ring The actin rings on osteoclasts of either glass coverslips or bone slices were stained with ant i-Arp3 and anti-Arp2 antibodies (Fig ure 2.5). In addition to actin ring staining, osteoclasts on covers lips often showed intense patches of Arp3-staining with little F-actin co-sta ining in the center of the cell. Confocal z-sections of actin rings of osteoclasts on coverslips and on resorbing bone slices revealed that Arp3 was present throughout the actin ring and was enriched, relative to F-actin, at the apical membrane, in proximity to the sealing zone. Figure 2.6 A and B show a pr ojection of 44 slices of the edge of a mouse marrow osteoclast on glass stained with anti-Arp3 (A) or phalloidin (B). These slices were stacked and digitally rotated 90o so that the apical surface was at the bottom and the basolateral at the top. Figure 2.6C is the rotated version of 2.6A and Figure 2.6E is the rotated versi on of 2.6B. Figure 2.6E is the merged image of Figures 2.6C and 2.6D, with the Arp3 staini ng pseudocolored green and phalloidin staining pseudocol ored red. Notice that Arp3 was enriched compared with F-actin at the apical boundary, and F-actin was re latively enriched near the basolateral boundary. Figures 2.6F and G show a proj ection through the actin ring of a resorbing osteoclast stained with anti-Ar p3 (F) or phalloidin (G). Figures 2.6H and 2.6I show a smaller portion of t he rings found in Figures 2.6F and 2.6G. The smaller section was rotated 90o so that the apical surfac e, which contacts bone, was down, and the basolateral su rface was at the top (Figur e 2.6J). Using a small section of the actin ring, the image was si mplified and more easily interpreted.

PAGE 51

40 Anti-Arp3 staining was pseudocolor ed green and phalloidin staining was pseudocolored red. Similar results we re observed as with the unactivated osteoclasts. Arp3 was enriched relative to F-actin at the apical boundary. Arp3 does not co-localize with the actin associated protein, vinculin Osteoclasts were co-stained with ano ther actin associated protein, vinculin. The vinculin staining (Figure 2.7) surrounded that of Arp3 with little colocalization occurring. Disruption of Arp3 distribut ion by chemical agents The distribution of the Arp2/3 complex was identified after disruption of the actin ring by the chemical agents, wort mannin, cytochalasin D and echistatin (Figure 2.8). Disruption of the actin ring occurred r egardless of the chemical agent used; however, the Arp2/ 3 complex continued to co -localize with actin in podosomes (Figure 2.9). Figure 2.10 quant itatively describes the effects of wortmannin and echistatin treatment on osteoc last-like cells on glass coverslips. Arp2 is required for actin ring formation Five siRNAs were generated against ta rgets in Arp2. Pr eliminary studies showed that one (19942) effectively knoc ked down Arp2 expression, whereas the others were ineffective. RAW 264.7 ce lls were stimulated with recombinant RANKL and transfected just as they began to fuse. Transfection efficiency was from 65 to 80% of the to tal giant cells, as judged by uptake of a fluorescent double-stranded oligomer. Western blot anal ysis (Figure 2.11) of osteoclasts 30 hours after transfection showed a 70% decr ease in the amount of Arp2 found in the total cell extract.

PAGE 52

41 Other RAW 264.7 osteoclast-like cells were fixed 30 hours after transfection with effective or ineffectiv e siRNAs. Both nontransfected cells or cells transfected with ineffective siRNAs showed normal actin rings (Figure 2.11). In contrast, fewer structures that look like podosomes were apparent in the knock down cells, and actin rings were rarely observed (less than 1% of controls). Typically F-actin was concentrated in centra l regions of giant ce lls in which Arp2 was knocked down. Mouse marrow osteoclasts were al so transfected with effective or ineffective siRNAs (Figure 2.13). Transfe ction efficiency was very low, but a few transfected osteoclasts were identifi ed based on the entry of the fluorescent double-stranded oligomer. Osteoclast tr ansfection with 19942 did not have actin rings after 30 hours, whereas the majority of the osteoclasts transfected with the ineffective control did show actin rings. This was true for both activated and inactivated osteoclasts. Discussion These studies demonstrate for the firs t time that the Arp2/3 complex is a component of the actin ring of osteoclast s and is required for its formation. The Arp2/3 complex was upregulated three-fold during differentiation. This is consistent with the Arp2/3 playing a role in actin ring formation, specialized structures specific to ost eoclasts. The Arp2/3 comple x is abundant in actin rings, co-localizes with the actin core of podosomes and is enric hed at the apical boundary near where the osteocla sts contact the substrate. Vinculin, a focal adhesion protein, was enriched at the apical border of ac tin rings but did not co-

PAGE 53

42 localize with actin or the Arp2/3 comple x but rather surrounded them in a cloud, which is consistent with current studies (33). The organization of podos omes in the actin rings of osteoclasts has been shown to be disrupted by the addition of ch emical agents such as wortmannin, echistatin and cytochalasin D. Cytochalasin D is a fungal toxin that reduces actin polymerization by inhibiting G-actin and is known to disrupt actin ring formation in the osteoclast (156, 157). The actin fibers of podosomes depolymerize as the effective concentration of G-actin becomes limiting (156, 157). Wortmannin is a fungal toxin and functions as a selective inhibitor of PI3 Kinase activity (158). Echistatin is a snake venom to xin and inhibits the integrin, v3 (159, 123). In osteoclasts, echistatin causes a di sruption of the sealing zone and an internalization of integrin s from the basolateral membranes to intracellular vesicles. The treated osteoclasts tend to round up and collapse. Although the osteoclasts are still adherent to bone, osteoc lastic resorptive ability is severely reduced as is seen by a reduction in resorptive pit number and size. Regardless of the type of inhibition, disruption of t he actin ring occurs but with a continuous co-localization of the Arp2/3 comple x with the podosomal core. These data support high integrity of the podosom al core. It has become clear that much of t he actin filament dynamics in cells depends on the Arp2/3 complex (160). Ac tivated Arp2/3 comp lex interacts with actin monomers to promote f ilament assembly. Activation occurs in response to interactions with accessory proteins that are in turn activated in response to signal transduction. Recent data indica te that actin treadmills rapidly through

PAGE 54

43 podosomes, entering apically and removed basolaterally (Figure 2.15) (161). The plasma membrane is pushed forward by this actin polymerization until capping of the barbed end occurs. As the filaments age, the ATP bound to each subunit is hydrolyzed, with slow dissociation of the -phosphate. ADF/cofilin cause severing of actin filaments and t he dissociating of AD Pactin (161, 162). The exchange of ADP for ATP is catalyzed by profilin, and a regeneration of the pool of profilactin is ava ilable for the next generation of filaments (162). This mechanism suggests a role for the Arp2/3 complex. In addition, the enrichment of the Arp2/3 complex at t he apical boundary of the podosomes of actin rings that we observed is consistent with the Arp2/3 complex playing a role in the entry of actin monomers into the actin ring filam ents. The true functi on of the treadmilling is not currently known; however, it is plausible that the podosomes may be exerting force on the plasma membrane, caus ing it to conform to bone (160). It is known that actin polymerization can pr oduce protrusive forces required for cell crawling as well as the intracellula r propulsion of microbial pathogens and organelles. An important example of this force generation via actin polymerization occurs is in the propulsion of Listeria monocytogenes. Loisel et al. (154) have shown the reconsti tution of sustained movement in Shigella and Listeria with the addition of pur ified Arp2/3 complex, acti n, actin depolymerizing protein (cofilin), and capping protein. As the Arp2/3 co mplex is a known central player in the actin-based motility of cert ain pathogens, this same force generation may be within the realm of the Arp2/3 comp lex in the actin ring of osteoclasts (144-146).

PAGE 55

44 In osteoclasts, gelsolin has been implicated in triggering actin ring formation (44, 163). This could potentiall y be accomplished by cleaving existing filaments and uncapping barbe d ends in a regulated m anner (164). Moreover, the gelsolin knockout mouse is mildly osteopetrotic, suggesting a role for gelsolin in bone resorption (165). Howeve r, the mildness of the osteopetrosis suggests other mechanisms contribute to the cytoskeletal dynamics required for bone resorption (166, 167). A strong po ssibility may be coordination between gelsolin and the Arp2/3 co mplex. A recent m odel describing podosomes suggests a balance of actin polymerization, which, based on our re sults, is likely regulated by the Arp2/3 comple x, and filament cleavage, by proteins like gelsolin (33). This balance could account for t he structure and dynamics of podosomes. In summary, the Arp2/3 complex is pr esent in the podosomal structures of the actin rings of osteoclasts. Knock down of Arp2 using siRNA shows that the Arp2/3 complex is required for actin ring formation. These data suggest that the Arp2/3 complex plays a role in osteocla stic bone resorption and may provide a target for therapeutic agents designed to limit the activi ty of osteoclasts.

PAGE 56

45 Figure 2.1. The Arp 2/3 complex. A) Crystal structure of the 7 subunits of the Arp2/3 complex. B) The Arp2/3 complex remains in an inactive conformation. Upon activation by WASP family member s, the Arp2 and Arp3 subunits undergo a conformational change and allow the complex to beco me active and participate in actin polymerization. (Robinson et al. Science. 2001; 294:1679-1684) (138)

PAGE 57

46 Total Protein Q Sepharose SP Sepharose Gel Filtration Extract from Column Elution Column Elution Column Elution Platelets Figure 2.2. The purification of th e Arp2/3 complex fr om human platelets The Arp2/3 complex was purified from human platelets by a previously published method by Welch and Mitchison using conv entional chromatography. Each lane depicts the elution from the columns r un with purified Arp2/ 3 complex obtained after gel filtration.

PAGE 58

47 0 5000 10000 15000 20000 25000 30000 35000 Figure 2.3. Arp2 and Arp3 are upregulated during osteoclastogenesis (A) Human platelet Arp2/3 co mplex was subjected to SDS-PAGE, blotted to nitrocellulose, and probed with antibodies against Arp3 and Arp2, and the bound antibody was detected by chemiluminesc ence. B) RAW 264.7 cells were cultures with (black bars) or without (w hite bars) RANKL. Total protein was extracted and equal amounts of protein were loaded and separated by SDSPAGE and transferred to nitrocellulose and probed with anti-actin, anti-Arp2 and anti-Arp3 antibodies. Arp2 and Arp3 expression was upregulated during osteoclastogenesis compared with actin. C) Quantit ation of four independent blots confirmed upregulation of Arp2 and Arp3 as osteoclasts differentiated. Error bars represent standard error. p < 0.05 by students t-test. A r p 3 Ar p 2 *

PAGE 59

48 Arp3b Arp3 GAPDH S U S U S U Figure 2.4. The two isoforms of Ar p3, Arp3 and Arp3-beta, are present in unactivated and activated osteoclasts. RAW 264.7 cells were cultured with (stimulated) or without (unstimulated) RANKL. Cells were harvested and RNA was obtained using RNAeasy Mini Kit (Q iagen, Valencia, CA). RT-PCR was performed using primers specific to Ar p3 and Arp3-beta. Both Arp3 and Arp3beta were present and are upregulated in response to RANKL stimulation. Figure 2.5. Arp2/3 co mplex is present in the actin rings of osteoclasts. Mouse marrow osteoclasts were loaded onto bovine cortical bone slices (A-C) or glass coverslips (D-E), cultured for 2 days, and fixed and stai ned with anti-Arp3 antibody (A and D) and phalloidin (B and E). Im ages were merged (C and F), with Arp3 staining pseudocolor ed green and phalloidin pseudocolored red. Colocalization of the two is yellow. A-C) A projection of 15 confocal slices (0.5 m) is shown. The arrow indicated the acti n ring. The green stai ning of the nuclei was the result of cross reactivity by the secondary antibody. Note the yellow staining of the actin ring in the merged image indicating co-loca lization. D-F) This is an image of a single optical section (0.5 m) of a mouse marrow osteoclast on a glass coverslip. The sma ll arrow points to Arp2/3-rich spots; the large arrow identifies the actin rings. The size bar is equivalent to 5 m in A-C and 25 m in D-F.

PAGE 60

49 Figure 2.6. Arp2/3 complex is enriched rela tive to F-actin near the sealing zone. A and B) A projection of the edge of an os teoclast on a coverslip is shown, stained with (A) anti-Arp3 or (B) phalloidin C-E) The images in A and B were computer rotated 90o to examine the cell in side vi ew. The apical side is down. The podosomal nature of the ring is read ily apparent. As shown by the arrows, Arp3 (pseudocolored green) was enriched near the apic al surface (the contact area with the coverslip), whereas micr ofilaments (pseudocolored red) were enriched at the basolateral bou ndary of the actin ring. Areas of co-localization are yellow. F and G) The image of a resorbing osteoclast on a bone slice is shown. H and I) A section of the actin ring is identified from F and G. J) The images in H and I were then merged and rotated 90o so that the apical surface was down. Arp3 is pseudocol ored green and phalloidin is red. As observed in the osteoclast on a glass coverslip, Ar p3 is enriched near the apical boundary near the sealing zone (arrow). The size bar is 10 m in A and B; 5 m in C-I, and 2 m in J.

PAGE 61

50 Figure 2.7. Arp2/3 does not co-localize with vinculin in actin rings. RAW 264.7 cells were stimulated with RANKL to differentiate into osteoclast-like cells and fixed and stained with either anti-Arp3 or ant i-vinculin. The images were merged. A) Image of actin ring st ained with anti-Arp3 and pseudocolored red. B) Image of actin ring stained wit h anti-vinculin and pseudocol ored green. C) Merged image of A and B. Note there is little co-localization between Arp3 and vinculin. The size bar is 3 m.

PAGE 62

51 Actin Arp3 Control Cytochalasin D Echistatin Wortmannin Figure 2.8. Treatment with the chemical agents, cytoc halasin D, echistatin and wortmannin, cause a disrupti on of the actin rings of osteoclasts. Mouse marrow osteoclasts were loaded onto bovine cort ical bone slices or glass coverslips, cultured for 2 days, and eit her untreated or treated with with cytochalasin D, echistatin or wortmannin for 30 minut es and fixed and stained with anti-Arp3 antibody and phalloidin. Note the disruption of the acti n ring in all cells but colocalization of the Arp2/3 comple x with actin remains stable.

PAGE 63

52 ARP3 AC TIN MERGE Figure 2.9. Arp2/3 remains co-localiz ed in the actin based podosomal core regardless of actin ring disruption by wortmannin. RAW 264.7 cells were cultured with RANKL until oste oclast-like cells were observed. The cells were then treated with 100 nM wortma nnin for 15 mintues, afte r which they were fixed and stained with either rhodam ine phalloidin or anti-Arp3 antibody. Although actin ring structure has been disrupt ed, Arp3 continues to co-localize with actin in the podosomal core. Figure 2.10. Wortmannin and echistatin treatment of osteoclasts results in a decrease in the number of actin rings. Ac tin rings were counted after either no treatment or treatment with wortmannin or echistatin A significant decrease in actin rings, more than 90%, was observed afte r treatment with either inhibitor.

PAGE 64

53 NO TREATMEN T 19944 19942 ARP2 ACTIN Figure 2.11. siRNA 19942 but not 19944 redu ces the Arp2 content of osteoclastlike cell extract 70% after 30 hours compar ed with actin. RAW 264.7 cells were stimulated with RANKL. Ju st as large, multinucl eated osteoclasts began to appear, cells were transfected as noted. Cells transfected with siRNA 19942, which had proved effective at knocking down Arp2 in pre liminary experiments, reduced Arp2 levels dramatic ally compared with either control cells or cells transfected with an ineffective siRNA 19944.

PAGE 65

54 FITC-OLIGOMER TRITC-PHALLOIDIN NO TREATMENT 19941 19942 Figure 2.12. Actin rings are disrupted in Arp2 knockdown Untransfected RAW 264.7 osteoclast-like cells or osteoclast-like cells transfected with ineffective siRNA (19941) or effective siRNA ( 19942) were fixed after 30 hours and examined for the presence of fluorescent ol igo marker of transfection (left panels) or F-actin by staining with phalloid in (right panels). The photographs are representative cells. The effective siRNA disrupted the ability of the osteoclasts to form actin rings. The size bar equals 25 m.

PAGE 66

55 Figure 2.13. Actin rings ar e disrupted in marrow osteocla sts on coverslips or on bone slices by siRNA directed against Arp2 Mouse marrow in tissue culture plates was stimulated with calcitriol for 5 days to produce osteoclasts. These were scraped and loaded onto coverslips (A-D) or bone slices (E-H) and transfected with (A, B, G, and H) 19942 or (C-F) 19941. The cells were stained with phalloidin (B, D, E, and G) or the fluorescent olig omer (A, C, F, and H) was detected. Note that in osteoclasts transfected with the effective siRNA (19942), no actin rings were present. In cells transfected with the ineffective control siRNA (19941), actin rings appeared normal. Standard bar in D is for A-D and represents 10 m. Standard bar in H is for E-H and represents 10 m.

PAGE 67

56 Figure 2.14. Experimental siRNA reduces the number of actin rings on coverslips by over 95%. RAW 264.7 osteoc last-like cells or os teoclast-like cells transfected with no siRNA, ineffective si RNA (19941) or effective siRNA (19942) were fixed after 30 hours and examined fo r the presence of fluorescent oligo marker of transfection. The actin rings of the cells with the ma rker of transfection present were counted to quantify changes in the number of actin rings formed. There was a significant decrease in the num ber of actin rings after treatment with effective siRNA. Error bars represent stan dard error. p < 0.05 by students ttest. *

PAGE 68

57 Figure 2.15. Dendrit ic Nucleation Model. Upon activation of WASP/Scar family proteins, the Arp2/3 complex is activated, resulting in actin polymerization and side-branching of new f ilaments on existing filaments. As the filaments elongate, they push the membrane forward. Profilac tin is required for filament elongation at the barbed ends and may be localized to this region by VASP. (ATP-actin white; ADP-P-actin orange; AD P-actin red; profilin black) (Blanchoin L. et al. Nature. 2000;404:1007-1011) (37)

PAGE 69

58 Table 2.1. PCR Primers Us ed for Identification of Ar p3 Isoforms. The sequences of primers used for PCR as well as their positions numbered relative to the AUG start site and the expected product size. All primers were designed against murine sequences. RT-PCR Target Position of Primers Size of Product Sequence of Primers (5-3) 750-769 AGAGCACCAGAGAGAGCAGA Arp3 921-940 191 bp CACACCACACGGCTACTACA 380-403 CCATGTTTGTGATGGGTGTGAACC GAPDH (Control) 1068-1091 711 bp TGTGAGGGAGATGCTCAGTGTTGG \

PAGE 70

59 CHAPTER 3 THE ARP2/3 COMPLEX: A POSSIBLE LINK IN THE TRANSLOCATION OF V-ATPASE TO AND FROM THE RUFFLED MEMBRANE Introduction V-ATPase plays a vital role in the osteoclast as it is responsible for acidification of the extrac ellular compartment segregat ed by the osteoclast and subsequent demineralization of the bone mi neral (11, 12). Mutations in the V1 subunit B1 result in distal renal tubul ar acidosis accompanied by osteopetrosis (64). In addition, recessive osteopetrosis, with deficient acid secretion, is caused by mutations in the V0 domain or in the chloride channel (64). The vacuolar proton ATPase is composed of 13 or mo re different proteins and over 20 subunits and consists of two major functional domains, V1 and Vo (Figure 3.1) (11-170). The V1 domain, a peripherally loca ted cytoplasmic section, contains at least eight different subunits (A-H) and contains three catalytic sites for ATP hydrolysis (168). These sites ar e formed from the A and B subunits (11, 168). The Vo domain, a proton channel, is co mposed of at least 5 subunits and allows for proton translocation across the ruffled membrane (168). V-ATPase is present in osteoclast precursors at high levels (171); but upon osteoclastogenesis, the levels of V-ATPase increase significantly and

PAGE 71

60 isoforms selective to the osteoclast are expressed (171, 172). Prior to activation of the osteoclast, the V-ATPa se is stored in intracellula r cytoplasmic vesicles (23, 50). As the cell is activated, V-ATPase binds to actin and is transported to the ruffled membrane, a specialized region of the plasma membrane. Once a resorption cycle has been completed, the VATPase is internalized into the cytosol (173). V-ATPase binding to F-actin has been identified with the F-actin binding site localized to a profilin-like domain in subunit B (11). This domain is localized to amino acids 23-67 in the B1 subunit and bi nding is in a direct 1:1 relationship (174). Since there are three B subunits, there are at least three actin binding sites present on the V-ATPase, and two more may be associated with the C subunit as it has also been shown to bind acti n (175). It is of not e that the levels of actin bound to V-ATPase fluctuate with t he resorptive state of the osteoclast. Binding of F-actin to V-ATPase appears to be physiologically controlled with evidence supporting signaling through v3 and PI3K activity (12, 52, 163, 175177). During translocation of the V-ATPase to and from the ruffled membrane, F-actin and V-ATPase are components of discrete structures termed podosomes (178). There are several lines of ev idence supporting the dependency of the cytoskeleton for transportation of V-ATPa se to and from the ruffled membrane. The grey lethal mutation (gl), which caus es osteopetrosis, results in defective cytoskeletal organization (179). In the majo rity of cases, a mutation is found in the gene, TCIRG1, which encodes the a3 s ubunit of the osteoclast V-ATPase

PAGE 72

61 (179). Mutations of this protein may prohibit the V-ATPase from assembling which would be consistent with the lack of ruffled border formation and improper and disorganized localization of V-ATPa se (180-182). In addition, the oc/oc osteosclerotic mouse shows a lack of association between the cytoskeleton and V-ATPase, hindering the localization of V-ATPase to the ruffled membrane (180182). This mouse is characterized by extensive bone deformities (180-182). These data support the hypothesis that the detergent insoluble cytoskeleton plays a key role in transportation of t he V-ATPase to the ruffled membrane. As previously stated, t he Arp2/3 complex is a cent ral player in the actinbased motility of certain pathogens (144147). The Arp2/3 complex has been shown to co-localize with actin in the ac tin ring and as a vital component of the actin ring of osteoclasts. In addition, the Arp2/3 complex responds by various proteins, such as cortactin and VASP, which are members of various signal transduction pathways. From this interact ion with actin dynamics, its ability to be regulated by signal transduction me chanisms, and its sequence homology with actin, it might be hypothesized that t he Arp2/3 complex may bind V-ATPase, as actin does, and function as a possible player in the transportation of V-ATPase to and from the ruffled membrane. In this study, we tested for an a ssociation between V-ATPase and the Arp2/3 complex. Since no associatio n could be determined, other potential VATPase binding partners were identified.

PAGE 73

62 Materials and Methods V-ATPase/Arp2/3 binding assay To determine if the Arp2/3 complex bi nds to V-ATPase, a protein binding assay was performed. Twenty five l of a maltose binding protein (MBP) -B1 fusion protein (B1-109) was incubated with 25 l of purified Arp2/3 complex for 1 hour. Amylose beads, which are an affinity matrix used to isolate proteins fused to MBP, were prepared by sequential washes in column buffer followed by Fbuffer. The amylose beads (25 l) were then added to t he Arp2/3-fusion protein mixture and incubated for 30 minutes. The solution was centrifuged at 13,000 rpm for 2 minutes. The supernatant was collected, and the beads were washed with F-buffer. This was repeated three times. The beads were then incubated with 25 l of 100 mM maltose for 10 minutes and eluted by centrifugation. The supernatant was separated by SDS-PAG E and stained with Coomasie Blue. Immunoprecipitation was performed to id entify binding of Arp2/3 with VATPase. The MBP-tagged B1 fusion protei n was incubated with purified Arp2/3 complex and protein G beads (t o allow for clearance of any non-specific binding). The mixture was centrifuged and the supernat ant collected. Anti-maltose binding protein antibody was incubated with the supernatant for 30 minutes. Protein G beads were added and incubated for 10 minut es. The mixture was centrifuged and the supernatant collected (to determine in which frac tion the original sample was). The pellet was washed three time s. The pellet wa s incubated with SDS and centrifuged at 13,000 rpm for 2 minut es. The supernatant was then separated by SDS-PAGE follow ed by western transfer. The nitrocellulose blots

PAGE 74

63 were then incubated with ant i-Arp2 antibodies for one hour washed three times, incubated with anti-goat HRP conjugated secondary antibody, washed three times, and incubated with Super Signal Du ra West Chemiluminescent Substrate (Pierce, Rockford, IL). The blots were then viewed on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA). PCR to identify other actin associated proteins involved in V-ATPase translocation and actin ring dynamics To identify other key proteins invo lved in osteoclastogenesis, RNA was extracted from RANKL di fferentiated RAW 264.7 cells as well as from unstimulated RAW 264.7 cells using RN Aeasy Mini Kit and quantified by spectrophotometer. The sequences fo r WASP, n-WASP, VASP, Cortactin, and Arp3 were obtained from Gen Bank. Primers were desig ned as described in Table 3.1. For standard RT-PCR, 3 g of total RNA was annealed to an oligo-dt primer and first strand cDNA synthesis was performed using Thermoscript RTPCR System (Invitrogen, Ca rlsbad, CA) following manufacturers directions. One-twentieth of the cDNA was subject ed to amplification by PCR using the primers listed in Table 3.1. PCR was performed under the follo wing conditions: 95oC for 2 minutes, then 35 cycles of 90oC, 30 seconds; 58oC, 30 seconds; 72oC, 30 seconds. One-half of the PCR pr oduct was separated on 0.5% agarose gel with ethidium bromide st aining for 1 hour. Images were detected using UV transillumination on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA).

PAGE 75

64 Immunoprecipitation with the B subuni t of V-ATPase suggests a possible direct linkage between VASP and V-ATPase. To identify possible bindi ng partners with the B2 s ubunit of V-ATPase, cell lysates were extracted from RANKL stimulated RAW 264.7 cells. The cell lysates were subjected to high speed ce ntrifugation to pellet actin and to avoid the presence of actin fila ment complexes in the im munoprecipitate. The B2 antibody was biotinylated using EZ-link Su lfo-NHS-LC-biotinylat ion kit (Pierce, Rockford, IL). The lysates were incubat ed with either B2-biotinylated or B2 antibody. The B2 (non-biotinylated) anti body was used as a c ontrol. Complexes were pulled down with streptav idin agarose, which affini ty purifies biotin labeled proteins. The agarose was washed and eluted with loading buffer. The elution was separated by SDS-PAGE and western tr ansfer. The nitrocellulose blots were then probed with antibodies direct ed against various actin associated proteins such as N-WASP, cortactin, VASP, WASP, and Arp3. The blots were washed and incubated with secondary antibodies and incubated with Super Signal Dura West Chemilumi nescent Substrate (Pierce, Rockford, IL). The blots were then viewed on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA). Results The B1 (1-106) subunit of V-ATPase does not bind purified Arp2/3 complex. Purified Arp2/3 complex and the B1(1106) maltose binding protein fusion protein, which contains the actin binding site, were incubated together. After being separated on amylose resin and elut ed with maltose, the elution was separated by SDS-PAGE and We stern transfer. The blots were then probed with

PAGE 76

65 either anti-B1 or anti-Ar p3 antibody. Only the B1 subunit was pulled down, suggesting that the Arp2/3 complex does not bind to V-ATPase in the actin binding region (Figure 3.2 and 3.3). Cortactin is preferentially upregulat ed at the transcriptional level during osteoclastogenesis To identify other actin associated proteins involved in V-ATPase translocation and actin ring dynamics, PCR was performed using primers to detect changes in gene expression in severa l actin-associated proteins during osteoclastogenesis. Unlike the other proteins tested, cortactin mRNA was the only gene preferentially upreg ulated during osteoclasto genesis, with a complete lack of detection prior to treatment of RAW 264.7 cells with RANK -L (Figure 3.4). This was expected based on a previ ous publication which identified an upregulation of cortactin prot ein in chicken osteoclasts. These data identify upregulation occurs at t he transcriptional level. Vasodilator stimulated phosphoprotein (VASP) is identified to have a possible interaction with V-ATPase. A signal transduction assay was peformed using a standard array by Hypromatrix (work done by Sandra Vergara). The me mbrane was incubated with RANKL-induced RAW 264.7 whole cell extract. The membrane was then incubated with a biotinylat ed-B2 antibody, washed and labeled with a secondary antibody. Chemiluminescent substrate was applied and the membrane was viewed by a Fluorochem 8000. Among 29 responsive proteins, vasodilator

PAGE 77

66 stimulated phosphoprotein was identified as having an interaction with the B2 subunit (Figure 3.5). Immunoprecipitation with the B subuni t of V-ATPase suggests a possible direct linkage between VASP and V-ATPase. To identify possible bi nding partners wit h V-ATPase, cell lysates were extracted from RANKL stim ulated RAW 264.7 cells. The cell lysates were subjected to high speed centrifugation to remove any contamination by actin complexes in the immunoprecipitate. T he lysates were incubated with either biotinylated-B2 or non-biotinylated B2 antibody. Complexes were pulled down with streptavidin agarose, to isolate any protein complexes bound to the biotinylated antibody. T he non-biotinylated B2 antibody was used as a control. Efforts to pull down cortac tin in immunoprecipitations of V-ATPase were not successful; and of all the proteins tested, VASP was identified to form a complex with the B2 subunit of V-ATPase (Fi gure 3.6), suggesting a potential complex that includes VASP, cortactin and V-ATPase. Discussion The actin binding site on V-ATPase has been identified to amino acid sequence 23-67 of the B1 subunit of th e V-ATPase (183). Based on the sequence homology between actin and the Ar p2/3 complex, we hypothesized that V-ATPase might bind the Arp2/3 co mplex. Experiments with both binding assays and immunoprecipitatio n experiments with the B1 fusion protein failed to show a direct linkage between V-ATPase and the Arp2/3 complex. However, this result does not confirm an absence of a direct interaction between the two

PAGE 78

67 proteins. Binding of t he Arp2/3 complex may occur through a different amino acid sequence than that of the fusion protein or the Arp2/3 complex may not be in the correct structural conformation to bind to the V-ATPase in the performed experiments. Isolation of purified V-ATPase was attempted to determine binding with the Arp2/3 complex but has not been successful thus far. As identification of a direct inte raction between V-ATPase with Arp2/3 could not be established, re search focused on the identifi cation of other proteins which could play pivotal roles in osteoc last function. Se mi-quantitative PCR analysis of several actin related proteins was performed to determine if there were any changes during osteoclastogenesis. Cortactin was identified as being preferentially upregulated dur ing osteoclastogenesis at the transcriptional level (184), indicating a possible key role in ac tin ring formation or translocation of VATPase to the ruffled membrane. This finding is not surprising as previous research in chicken osteoclasts has shown the cortactin upregulation at the protein level (184); however, our findings identify for the first time that the upregulation occurs at a transcriptional le vel. Cortactin is involved in the activation and stabilization of actin based net works, inhibiting their disassembly (135, 185-187). Cortactin ca n bind and activate the Arp2/3 complex through binding the Arp3 subunit (186, 187). Cortactin, n-WASp, and Arp2/3 form a synergistic, ternary complex to initiate actin polymerizat ion (186, 188). Although no additional proteins were found to have significant differences in levels of mRNA before and after osteoclastogenesis real-time PCR woul d be of value in

PAGE 79

68 determining minor variations in mRNA co ncentration not detectable by traditional PCR. In addition to cortactin, we sought to identify other actin binding proteins that could have a possible interacti on with V-ATPase. A signal transduction antibody array was performed by Sandra Vergara (University of Florida, Gainesville, FL) to determine possible in teractions between signal transduction proteins and V-ATPase from RANK-L induced RAW264.7 whole cell extracts. The results from this array indicated t hat Vasodilator Stimul ated Phosphoprotein might be linked with V-ATPase. Further immunoprecipitation experiments show that VASP is pulled down in a complex wi th the B2 subunit of V-ATPase. VASP plays a key role in actin based motility and is localized predominantly at focal adhesions, cell/cell contacts and regions of highly dynamic actin reorganizations such as podosomes (151, 185). VASP can bi nd directly to G-actin and F-actin as well as recruit profilactin complexes to the site of actin polymerization. In addition, VASP is known to enhance Arp 2/3 activity and prevent capping proteins. VASP is phosphorylated in re sponse to protein kinase A (PKA) and protein kinase G (PKG) (189, 190). The ability of VASP to be phosphorylated allows it to be both a positive and negativ e regulator of actin polymerization. Calcitonin induces alterations in the cytoskeleton of the osteoclast through the protein kinase A pathway (191, 192). It is plausible that the disruption of the actin cytoskeleton by calcitonin could be mediated by VASP. Phosphorylation of VASP has also been shown to diminish F-actin binding, suppressing actin nucleation as well as inhibi ting Arp2/3 triggered actin poly merization; thus, it can

PAGE 80

69 be a negative regulator of actin polymeri zation (185). Thus, VASP may play an important role in the regul ation of the translocation of V-ATPase to and from the plasma membrane. In summary, the Arp2/3 complex di d not bind the same amino acid sequence of the B1 subunit of V-ATPase as did actin. Further studies are required to determine if binding exists at another sequence. Two additional proteins, cortactin and VASP, were identif ied as having possible key roles in osteoclast function. Cortactin was f ound to be preferenti ally upregulated in response to RANKL stimulation while VASP was found to associate with the B2 subunit, either directly or indirectly th rough other V-ATPase su bunits or other VATPase bound proteins.

PAGE 81

70 Figure 3.1. The st ructure of V-ATPase The vacuolar proton ATPase is composed of 13 or more diffe rent proteins and over 20 subunits and consists of two major functional domains, V1 and Vo. The V1 domain, a peripherally located cytoplasmic section, contains at least eight different subunits (A-H) and contains three catalytic sites for ATP hydrolysis. These sites are formed from the A and B subunits. The Vo domain, a proton channel, is co mposed of at least 5 subunits and allows for proton translocation acro ss the ruffled membrane. (Sun-Wada et al. Biochimica et Biophysica Acta. 2004; 1658: 106-114) (168)

PAGE 82

71 B1 (1-106) Puri fied Subunit of Arp2/3 V-ATPase Co mplex IP: Amylose B1 Figure 3.2. The B1 (1-106) fusion prot ein of V-ATPase and the Arp 2/3 complex do not show a direct interaction by bi nding assay. The B1-MBP fusion protein and the Arp2/3 complex were incubated t ogether. The sample was then run on amylose resin to bind the maltose binding protein. The column was then eluted with maltose. The samples were s eparated by SDS-PAGE and stained with Coomasie. The B1 subunit was pulled do wn in the amylose column but Arp3 was not, indicating a lack of binding between the two proteins.

PAGE 83

72 IP: MBP IP: MBP Probe: B1 Probe: B1 Probe: Arp3 Probe: Arp3 Figure 3.3. The B1 (1-106) fusion prot ein of V-ATPase and the Arp 2/3 complex do not show a direct interaction by immunoprecipitat ion of B1 subunit. The B1MBP fusion protein and the Arp2/3 comp lex were incubated together. The sample was then incubated wit h a maltose binding protei n antibody. The sample was then immunoprecipitated wit h protein G beads which bind the antibody. The beads were washed and eluted with sodium dodecyl sulfate. The elution was then probed using the B1 or Arp3 antibodies. B1 was pul led down by the protein G beads but Arp3 was not, indicating a lack of binding between the two proteins.

PAGE 84

73 Stimulat ed Unstimulated Cortactin WASP N-WASP VASP Arp3 GAPDH Figure 3.4. Cortactin is preferentially upregulated during osteoclastogenesis as identified by PCR. RAW 264.7 cells were cultured with (stimulated) or without (unstimulated) RANKL. Cells were harvested and RNA was obtained using RNAeasy Mini Kit. RT-PCR was performed us ing primers specific to cortactin, WASP, N-WASP, VASP and G APDH (control). Cortactin was the only actinassociated protein preferent ially upregulated in response to osteoclastogenesis.

PAGE 85

74 Figure 3.5. Vasodilator st imulated phosphoprotein is i dentified to have a possible interaction with V-ATPase. Signal Tran sduction Array by Hypromatrix was probed with biotinylated B2 antibody (wor k by Sandra Vergara) to identify possible signal transduction molecules wh ich may interact with V-ATPase. Vasodilator stimulated phos phoprotein, an actin asso ciated protein, was identified as having a possible interaction.

PAGE 86

75 B2 Biotin B2 IP: B2 subunit Streptav idin VASP Figure 3.6. Immunoprecipi tation experiments with t he B subunit of V-ATPase Suggests a Possible Direct Linkage between VASP and V-ATPase. RANKL stimulated RAW 264.7 cell lysates were incubated with biotinylated B2 antibody, pulled down on streptavidin agarose, separated by SDSPAGE and western transfer, and probed wit h the antibodies of various ac tin related proteins. Of all the proteins tested, only VASP was pulled down in complex with the B2 subunit of the V-ATPase.

PAGE 87

76 Table 3.1. PCR Primers Us ed for Identification of Arp2/ 3 Related Proteins. The sequences of primers used for PCR as well as their positions numbered relative to the AUG start site and the expected pr oduct size. All primers were designed against murine sequences. RT-PCR Target Position of Primers Size of Product Sequence of Primers (5-3) 529-548 ATTCGGGGTGTCAAGTACAA VASP 736-755 227 bp TTCTGTTGTTCCAGCTCCTC 1442-1461 CCTGAGCCTGACTACAGCAT Cortactin 1608-1627 186 bp GTAGTCATACAGGGCGATGG 425-444 GCCAATGAAGAAGAAGCAAA n-WASp 602-621 197 bp TCTTTGGTGTGGGAGATGTT 92-111 ACATTCCTTCCAACCTCCTC WASP 314-333 242 bp CAGCTCCTGTTCCCAGAGTA 750-769 AGAGCACCAGAGAGAGCAGA Arp3 921-940 191 bp CACACCACACGGCTACTACA 380-403 CCATGTTTGTGATGGGTGTGAACC GAPDH (Control) 1068-1091 711 bp TGTGAGGGAGATGCTCAGTGTTGG

PAGE 88

77 CHAPTER 4 THE ROLE OF CORTACTIN IN OSTEOCLASTOGENESIS Introduction Cortactin is a monomeric, long, flexib le protein (186) with a multidomain structure consisting of an acidic domain at the amino terminus, followed by 6 and 1/2 tandemly repeated 37 ami no acid segments, a helical region, a proline rich region, and a Src homology 3 (SH3) domai n at the carboxyl terminus (135, 136, 186). The multidomain struct ure of cortactin allows a multitude of interactions. Cortactin binds directly to F-actin th rough sequences in the tandem region while binding to the Arp2/3 comp lex occurs at the amino terminus (136, 186, 188). Various signaling proteins bind the c-te rminal proline rich and SH3 domains (135, 185, 188). Cortactin is a physiologically significant substrate for tyrosine phosphorylation by src kinases (135). This is important because actin ring formation requires the activity of pp60c-src ( 193, 194). Mutations in c-src in mice results in osteopetrosis and failure of podosome formation (19). Faciogenital dysplasia protein 1 (Fgd1), a CDC42 guani ne nucleotide exchange factor, also binds the SH3 domain of cortactin ( 195). This association allows proper localization of Fgd1 to the actin cyto skeleton (196). Mutations in Fgd1 are implicated in the human disease faciogeni tal dysplasia (197, 198). The pathology of this disorder includes bone abnormalities.

PAGE 89

78 Cortactin is involved in the activation and stabilization of actin based networks (185, 186). Initiall y, the role of cortactin was hypothesized as a result of its localization to the same regions as Arp2/3 and n-WASP in vesicles, podosomes, and the actin based rocket tails of Listeria (135, 186, 188, 199). The function of cortactin as a regulator of the Arp2/3 comp lex is two fold. First, cortactin can bind and activate the Ar p2/3 complex through binding the Arp3 subunit (186, 188), although its activation potent ial is four to five fold lower than that of the WASP fam ily proteins (135, 187). Second, cortactin stabilizes Arp2/3 induced branched actin networks, inhibiting their disassembly (135, 187, 200). Recent studies suggest that cortactin, N-WASP, and Arp2/3 form a synergistic, ternary complex to initiate actin polym erization as depicted in Figure 4.1 (186, 188). In this model, N-WASP activates nucleation by interacting with F-actin and the Arp2 and p40 subunits while cortactin stabilizes the branching points by binding to F-actin and the Ar p3 subunit (135, 187, 200). Cortactins main role may invo lve the carboxy terminal SH3 domain. This domain allows interactions with various signaling molecules, including src kinases (186, 200). The tyrosine phosphoryl ation of cortactin occurs in response to integrin ( v 3) binding in endothelia l cells (200). This is of note as the integrin, v 3, is also the major integrin of ma ture osteoclasts (55, 56). Cortactin may be responsible for organization of rec eptor signaling in the region of the sealing zone as it possesses both proper spatial and temporal localization with newly forming actin networks (186, 188, 200).

PAGE 90

79 Cortactin may not be a direct acti vator of the Arp2/3 complex. However, the multidomain structure of cortactin, in conjuncti on with its distribution in dynamic cortical actin structures, may allow it to bridge regions of actin reorganization with receptor signaling complexes, protein tyrosine kinases, and/or to recruit proteins that may positively or negatively regulate actin polymerization (186, 188, 200). Cortactin was previously identifi ed as being preferent ially upregulated during osteoclastogenesis. In this st udy, our objective was to identify the localization of cortactin in the osteoc last and to determine its requirement for actin ring formation. Materials and Methods Western blot analysis with quantitation of cortactin Anti-cortactin antibodies were obt ained from Upstate Biotechnology (Charlottesville, VA). RAW 264.7 cells were grown as previously described, plated on 6 well plates, and either left un stimulated or stim ulated with RANKL. Cell lysates were collected from both t he control and treated ce lls. Cells were washed twice with ice cold PBS and scraped from the plates. The cells were then detergent solubilized in 0.2% Triton X-100 in PBS Equal amounts of the lysates were separated by SDS-PAGE, followed by Western Transfer. The nitrocellulose blots were then incubat ed with anti-cortactin antibodies for one hour, washed three times, incubated wit h HRP conjugated secondary antibody, washed three times, and incubated with Super Signal Dura West Chemiluminescent Substrate (Pierce, Rockford, IL). The blots were then viewed

PAGE 91

80 on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA), and quantitation was performed by Spot Densitometry (Fluo r-Phor Software, Alpha-Innotech, San Leandro, CA). The integrat ed density values (IDV) were obtained (white = 65535, black = 0). Background values were subtracted, and the intensities were normalized against the value of actin in the sample. The values were then compared between stimulated and unstimula ted cells. The stimulated and unstimulated values were statistically analyzed using the paired t-test, with statistical significance (p) being less than 0.05. Co-localization of cortactin with actin and Arp3 Cell culture was performed as previ ously described for RAW 264.7 cells and mouse marrow osteoclasts. To determine the co-localization of cortactin with actin in the actin ring, osteoclasts we re fixed in 2% formaldehyde, detergentpermeabilized with 0.2% Triton X-100 in PBS for 10 minutes, washed in PBS and blocked in PBS with 2% BSA (bovine serum albumin) for one hour. Actin filaments were stained with TRITC phalloid in. Cortactin was probed with an anticortactin monoclonal antibody (Upstate Biotechnology). Subunit B2 of V-ATPase was detected with an anti-B2 polyclonal antibody (34). Bound antibodies were detected by labeling with CY2 tagged anti-mouse secondary antibody. Osteoclasts were visualized using t he MRC-1024 confocal laser scanning microscope and LaserSharp software (Bio -Rad, Hercules, CA). Images were taken in sequential series to eliminate any overlap of emission and analyzed by confocal assistant software.

PAGE 92

81 Immunoprecipitation of actin associated proteins using a GST-cortactin construct To determine the interaction of cortac tin with actin associated proteins in osteoclasts, Glutathione S-transferase (GST)cortactin prokaryotic expression construct GST-cortactin was obtained fr om Scott Weed, Ph.D. (West Virginia University, Morgantown, WV). The GST construct was transformed into Escherichia coli strain DH5 The fusion protein was pur ified by induction of the bacterium with isopropyl-1-thio-b-D-galac topyranoside. The fusion protein was run on a glutathione-Sepharose 4B column and eluted with 10 mM reduced glutathione in lysis buffer. Cell lysa tes were obtained from RANKL stimulated RAW 264.7 cells as described previously. Prior to incubation, the cell lysates were centrifuged at high speed to remove an y actin to prevent mi sleading results. The GST-fusion protein conjugated to Seph arose was incubated with cell lysates from RANKL stimulated cells. As a c ontrol, Sepharose without the GST-cortactin fusion protein was also incubated with t he cell lysates from RANKL stimulated cells. The Sepharose was centrifuged and washed twice with binding buffer lacking ATP. Bound proteins were visua lized by Western blotting with anti-Arp3, anti-VASP, anti-E subunit of V-ATPase, anti-WASP (Sant a Cruz), and anti-actin (Sigma) antibodies after SDS-PAGE. Knocking down gene expressi on of cortactin using siRNA Five single interfering RNA (siRNA) duplexes to murine cortactin (accession no. NM_007803) were designed and produced by Sequitur (Natick, MA): 120648 (targeting bp 626-644) anti-sense 5-UCUUGUCUACACGGUC

PAGE 93

82 AGCTT-3, sense 5-GCUGACCGUGUAGA CAA GATT-3; 120649 (targeting bp 919-937) antisense 5GAAACCAGUCUUA UAGUCUTT, sense 5AGACUAUA AGACUGGUUUCTT-3; 120650 (target ing bp 1169-1187) antisense 5UAGCACGGAUAUUACUGGUTT-3, s ense 5-ACCAGUAAUAUCCGUGCUATT3; 120651 (targeting bp 673-691) antisense 5-AGACUCAUGCUUCUCCG UCTT-3, sense 5-GACGGAG AAGCAUGAGU CUTT -3; 120652 (targeting bp 830-848), antisense 5-UCUGCACACCAAA CUUUCCTT-3, sense 5-GGAAAG UUUGGUGUGC AGATT-3; 120653 (control) antisense 5-UGGUCAUUAUA GGCACGAUTT-3, sense 5-AUCGUGCCUAUAAUGACCATT-3. Initial experimentation showed only siRNA 120649 capable of downregulating cortactin; the other siRNAs were used as ineffective controls. In addition, a siRNA known to downregulate cortactin was obtained (Ambion part no. 60931, targeting exon 5) as well as both positive (GAPDH) and negative controls. RANKL stimulated RAW 264.7 cells on glass covers lips in 24 well plates were not transfected or transfected with either 150 nM of t he experimental or control siRNA and 2 g/ml Lipofectamine 2000 (Invitrogen) in Op ti-MEM media supplemented with RANKL on day 4 of differentiation (at the appe arance of multinucleated cells) and monitored for siRNA uptake. A fluoresc ent oligomer (part no. 2013; Sequitur) was added for uptake assessement. Six hour s after transfection, the media was replaced with DMEM with fe tal bovine serum and RANKL. The cells were incubated for 48 hours at 37oC in a CO2 incubator. They were then fixed in 2% paraformaldehyde and viewed for incorporati on of the siRNA with the use of the FITC label. Only cells labeled with FITC were identi fied as having either the

PAGE 94

83 control siRNA or experimental siRNA. The cells were stained with TRITC phalloidin to visualize the actin ring mo rphology. Osteoclasts were visualized using the MRC-1024 confocal laser scanning microsc ope and LaserSharp software (Bio-Rad, Hercules, CA). Images were taken in sequential series to eliminate any overlap of emission and analyz ed by confocal assistant software. To determine the downregulation of pr otein expression, RANKL stimulated RAW 264.7 cells were grown on 6 well plat es. On day 6 of differentiation, they were either not transfected or transfected wit h 150 nM of control or experimental siRNA in 10 l lipofecta mine 2000. The media was replaced with DMEM with FBS and RANKL 6 hours after transfection. The cells were incubated for 48 hours at 37oC in a CO2 incubator. The cells were scraped and washed twice with cold PBS. The lysates were centrifuged and the cell pellet was lysed on ice using 150 l cell extraction buffer (BioSource In ternational, Camarillo, CA, USA) supplemented with protease inhibito r cocktail (Sigma P2714) and phenylmethylsulfonylfluoride (P MSF) for 30 minutes, vortexing every 10 minutes. The cell lysate was then centrifuged at 13,000 rpm for 10 minutes at 4oC. Bradford assay was performed to determi ne protein concentration. Equal concentrations of proteins were separat ed by SDS-PAGE, followed by transfer to nitrocellulose. The nitroc ellulose blots were incuba ted overnight in blocking buffer, after which they were incubat ed with both anti-cortactin and anti-actin antibodies for 2 hours, followed by in cubation with secondary horseradish peroxidase labeled antibodies for 1 hour Chemiluminescent substrate was added and the blots were visualized using an Alpha Innotech Fluorochem 8000.

PAGE 95

84 Results Cortactin is upregulated at the transcriptional level during osteoclastogenesis Cortactin protein levels increase during osteoclastogen esis as is verified by Figure 4.2 (184). Increased expression is due to transcriptional rather than translational regulation as was identified by PCR analysi s (Figure 3.3). Unlike the other proteins tested, cortactin mRNA was not detec ted prior to treatment of RAW 264.7 cells with RANKL. Cortactin in the actin rings of resorbing osteoclasts Figure 4.3 shows represent ative micrographs of the staining of activated osteoclasts on dentine bone with anti-cortacti n and anti-Arp 3 or phalloidin. As described in previous research, in the activated osteoclast on bone slices, actin is enriched in the ring surrounding the ruffl ed membrane. Cortactin is shown to be a major element of the actin ring of resorbing osteoclasts. Cortactin is required for actin ring formation A new siRNA (120648) was identifi ed that knocked down cortactin expression (Figure 4.4). A commercial siRNA known to downregulate cortactin was also used to confirm our data (Figure 4.6). Osteoclast-like RANKL stimulated RAW 264.7 cells on 6 well plates were transfected and kept in culture for 48 H. Cortactin was not detected by Western analysis in the cells transfected with effe ctive anti-cortactin siRNAs (Figure 4.4 and 4.6).

PAGE 96

85 RANKL stimulated RAW 264.7 cells on gl ass coverslips were grown on 24 well plates and transfected wit h experimental or control siRNAs. The cells were incubated for 48 hours at which time they were fixed. Immunocytochemistry showed normal actin rings in the no tr eatment and control si RNA groups (Figure 4.5 and 4.7). However, a complete loss of actin ring podosomal organization occurred in the experimental group. Although there was a loss of actin rings, the cells remained viable and well spread. Cortactin-binding proteins in extr acts from osteoclast-like cells To identify actin-associat ed proteins that interact with cortactin, pull-down experiments were performed on detergent solubilized extracts of RANKL stimulated R264.7 cells. Recombinant GST-cortactin (Figure 4.8) or vehicle was added to the extracts, and then pulled do wn with Glutathione Sepharose beads, separated by SDS-PAGE and Western blotted. Consistent with previous reports, cortactin was found to interact with Arp2/ 3 complex and n-WASp (Figure 4.9). Surprisingly, we detected high levels of Vasodilator-stimulated phosphoprotein (VASP), a regulator of actin polymerization, and V-ATPase subunits (Figure 4.9). Efforts to pulldown cortactin in immunopr ecipitations of V-ATPase were not successful. However, we did identify VAS P, suggesting a potential complex that includes VASP, cortactin and, V-ATPase (Figure 3.5). Discussion As previously shown, cortactin is differentially upregulated during osteoclastogenesis (184). This preferential upregulati on in response to RANKL stimulation supports a hypot hesis that it is import ant for osteoclastic bone

PAGE 97

86 resorption and may be a vital component in either V-ATPase tr anslocation to the ruffled membrane or formation of the actin ring. Cortactin co-localizes with the Arp2/ 3 complex in the actin ring of osteoclasts. Previous data have shown t hat cortactin forms a tertiary complex with the Arp2/3 complex and N-WASP to activate actin polymerization and for stabilization of actin based networks (186, 188). Its identification in the actin ring supports its localization to this complex of proteins. Immunoprecipitation with the GST-cortactin fusi on protein identified associations between the Ar p2/3 complex and N-WASP, wh ich is consistent with previous studies that demonstrated the complex composed of these proteins plays a role in the regulation of actin polymerization (186, 188) Unexpectedly, cortactin also interacted with V-AT Pase and Vasodilator stimulated phosphoprotein. VASP is an ac tin associated protein that tracks the fast growing end of actin filaments (201, 202). It is still unclear as to the precise mechanism of actin; however, it may be involved in protecting growing ac tin filaments from capping proteins (201, 202). In addition, the capacity of VASP to concentrate profilactin complex near the fast growing end of actin filaments may be vital (202). This is the first report of VASP and cortactin in the sa me complex. We currently do not know whether the interact ion is direct or indirect. Potential interaction domains are present in t he two proteins. VASP contains a src homology region 3 (SH3) binding domain in the proline-rich central region (203), while cortactin has a carboxy-terminal SH 3 domain (204). Efforts are underway

PAGE 98

87 to determine whether these domains in teract and to explore the functional consequences of the interaction. The use of siRNA to knock down cortac tin results in a loss of actin ring formation which demonstrates that cortac tin is crucial for the formation of podosomes and actin rings in osteoclast s. Two separate siRNAs targeting cortactin greatly reduced cortactin levels and disabled the capac ity of osteoclasts to form actin rings and podosomes. Together with the fact that cortactin is specifically upregulated during osteoclast ogenesis (184), these data suggest that cortactin plays a vital role in osteoclast function. In summary, we showed that cortactin is required for the formation of the podosomes and actin rings that are vital for osteoclast function. Cortactin interacts with Arp2/3 comple x and n-WASp as expected in osteoclasts extracts (186, 188). Novel interactions betw een cortactin and VASP and cortactin and VATPase were identified. Our data are co nsistent with cortacti n playing a role in osteoclasts in the integration of cytoskeletal and membrane dynamics.

PAGE 99

88 Figure 4.1. Cortactin, NWASp and Arp2/3 form a synergi stic, ternary complex to initiate actin polymerization. The Arp2/3 complex is inactive in its unbound form. Activation of the Arp2/3 complex occurs through the N-WASP family of proteins binding to the Arp2 subunit. Upon activation, a confo rmation change occurs in between the Arp2 and Arp3 subunits induci ng actin polymerization. Cortactin binds to the Arp3 subunit and functions to enhance actin polymerization as well as stabilize the Arp2/3 i nduced branched actin networks. (Weaver et al. Curr Biol. 2002; 12:1270-1278) (188)

PAGE 100

89 RANKL RANKL Stimulated Unstimulated Anti-Cortactin Figure 4.2. Cortactin is upregulated in response to RANKL stimulation. Cell lysates were extracted from unstimulat ed or RANKL stimulated RAW 264.7 cells. Bradford assay was performed to standar dize protein concentrations. Cell lysates were separated by SDS-PAGE and western transfer and probed with anti-cortactin antibody. In unstimul ated RAW 264.7 cells, cortactin is undetectable by western analysis; however upon RANKL stimulation, cortactin expression is induced.

PAGE 101

90 ACTIN CORTACTI N MERGE AR P3 CO RTACTIN MERGE Figure 4.3. Cortactin co-localizes with the podosomal core proteins, actin and the Arp2/3 complex. RA W 264.7 cells were stim ulated with RANKL to differentiate into osteoclast-like cells and fixed and stained with anti-cortactin antibody and rhodamine phalloid in or anti-Arp3 antibodies. Note that there is precise co-localization between Arp3 and co rtactin and actin and cortactin.

PAGE 102

91 Figure 4.4. siRNA 120649, but not a cont rol siRNA (120653), effectively knocks down the cortactin content to an undetectabl e level of osteocla st-like cell extract after 30 hours compared with actin. RAW 264.7 cells were stimulated with RANKL. Just as large, multinucleated osteoclasts began to appear, cells were transfected as noted. Cells transfected with siRNA 120649, which had proved effective at knocking down cortactin in preliminary experiments, reduced cortactin levels dramatically compared with either c ontrol cells or cells transfected with an ineffective siRNA 120653.

PAGE 103

92 Figure 4.5 Actin rings are di srupted in cortactin knockd own. Untransfected RAW 264.7 osteoclast-like cells or osteoclast-like cells transfected with ineffective siRNA (120653) or effective siRNA (120649) were fixed after 30 hours and examined for the presence of fluorescent oligo marker of transfection (bottom panels) or F-actin by staining with phal loidin (top panels). The photographs are representative cells. The effective siRNA disrupted the ability of the osteoclasts to form actin rings.

PAGE 104

93 Figure 4.6. An siRNA known to downreg ulate cortactin (Ambion) effectively knocks down the cortactin content of osteoclast-like cell extract to an undetectable level after 30 hours compared with actin. RAW 264.7 cells were stimulated with RANKL. Ju st as large, multinucl eated osteoclasts began to appear, cells were transfected as noted. Cells transfected with Ambion siRNA, which is known to knock down cortactin levels, reduced cortactin levels dramatically compared with ei ther control cells or cells transfected with either positive or negative controls.

PAGE 105

94 Figure 4.7 Actin rings are disr upted in cortactin knockdown Untransfected RAW 264.7 osteoclast-like cells or osteoclast-like cells transfected with ineffective siRNA (negative control) or effective siRNA (positive cont rol) were fixed after 30 hours and examined fo r the presence of fluorescent oligo marker of transfection (middle panels) or F-actin by staining wi th phalloidin (left panels). A merged image is shown in the right panels T he photographs are representative cells. The effective siRNA disrupted the ability of the osteoclasts to form actin rings.

PAGE 106

95 Total Purified Protein GST-Cortactin Extract Figure 4.8. Transformation and Purificati on of GST-cortactin fusion protein. A GST-cortactin fusion protei n was obtained from Dr. Scott Weed (West Virginia University, Morgantown, WV). The constr uct was transformed into E.coli strain DH5a and induced with IPTG. The fusi on protein extract was run on a glutathione-sepharose column and el uted with reduced glutathione. Cortactin

PAGE 107

96 G-S/C/L G-S/ L IP: GST-Cortactin Probe: Cortactin Arp3 VASP N-WASP E Subunit of V-ATPase Actin Figure 4.9. Immunoprecipitation Ex periments with GST-Cortactin Show a Linkage between Cortactin and Arp3, VAS P, N-WASp and the E Subunit of VATPase. Cells lysates from RANKL stimulat ed RAW 264.7 cells were incubated with glutathione sepharose with or with out GST-cortactin. The lysates were washed and eluted in loading buffer. They were separated by SDS-PAGE and Western transfer. Bound proteins were th en visualized by pr obing with anti-Arp3, anti-cortactin, anti-VASP, anti-N-WASP, anti-E s ubunit, and anti-actin.

PAGE 108

97 CHAPTER 5 THE ROLE OF VASP IN OSTEOCLASTOGENESIS Introduction Like cortactin, numerous additional proteins have been identified as components of the cytoskeletal machinery. VASP is one such protein. It may act directly as a nucleator of the Arp2/3 comp lex or indirectly as a structural scaffold for signaling and cytoskeletal proteins such as vinculin, ActA, zyxin, and Fyb/Slap (149, 151). VASP is a 46 kD protein (203, 205) originally is olated from human platelets and is the foundi ng member of the Ena/VAS P family composed of Vasodilator-Stimulated Phosphoprotein (VASP), mammalian Enabled (Mena), and ENA/VASP-like protein (Evl ) (Figure 5.1) (203, 205, 206). This family of proteins plays a key role in actin bas ed motility and is localized predominantly at focal adhesions, cell/cell contacts, and regions of highly dynamic actin reorganizations such as lamellipodia (151, 203). The VASP protein contains three primary domains, EVH (Ena/VASP Ho mology domain) I, proline rich, and EVH2 (189, 203, 206). The EVHI domain is located at the N-terminus and binds actin related proteins such as zyxin vinculin, and ActA (189, 203, 206). The proline rich region interacts wit h proteins containing SH3 and WW domains and contains a 4 GP5 motif which is the binding site of profilin, a G-actin

PAGE 109

98 regulatory protein (189, 203, 206). The EVH2 domain contains the actin binding site and is the location for oligom erization (189, 203, 206). VASP is phosphorylated by both the Protein Kinase A (PKA) and Protein Kinase G (PKG) pathways (207). The phosphorylated protein has an apparent weight of 50 kD (205, 207) PKA preferentially phos phorylates VASP at Ser157 which is located N-terminal to the (GP5)4 profilin binding site in the proline rich region (189, 203, 206). This phosphorylati on site is in close proximity to the ligand binding module which in turn alters the ligand binding properties (189, 203, 206). In addition, it al so phosphorylates Thr274 although the consequences of this phosphorylation ar e not fully understood (189, 203, 206). The PKG pathway preferentially phosphorylat es Ser239, but like PKA, will also phosphorylate Thr274 (189, 203, 206). Phosphorylation by the PKA pathway has been shown to diminish F-actin binding, suppressing actin nucleation as well as inhibiting Arp2/3 triggered actin polymeriz ation; thus, it can be a negative regulator of actin polymerization (189, 203, 206). The PKA pathway is activated in mu rine osteoclasts in response to calcitonin (207). Calcitonin is a known i nhibitor of bone resorption and is used to treat metabolic bone diseases such as osteoporosis and Paget's disease (190, 207). The calcitonin receptor, a 7 trans membrane G-protein coupled receptor, is located on the cell surface of osteoclast s (191, 192). Activation by calcitonin signals the receptor to activate the PKA pathway (190, 191). This could lead to phosphorylation of the VASP protein and in turn to the changes in the organization of F-actin that are known to occur in response to calcitonin.

PAGE 110

99 In this study, our objective was to examine the role of VASP in osteoclastogenesis. We sought to det ermine the localization of VASP in the osteoclast and well as its requirement fo r actin ring formation. In addition, we sought to determine what effect phosphor ylation of VASP would have on the actin ring of osteoclasts. Materials and Methods Distribution of VASP in the actin ring Cell culture was performed as previous ly described. For identification of VASP localization, the cells were fixed in 2% formaldehy de, solubilized in 0.2% Triton X-100 in PB S and blocked in PBS with 2% BSA. Cells were stained with rhodamine phalloidin or antibodies recogni zing VASP at a dilution of 1:100 in PBS. Secondary antibodies were dilu ted according to manufacturers instructions. Osteoclasts were visual ized using the MRC-1024 confocal laser scanning microscope and LaserSharp softwar e (Bio-Rad, Hercules, CA). Images were taken in sequential series to e liminate any overlap of emission and analyzed by confocal assistant software. Effects of calcit onin on actin rings of osteoclasts Cell culture was performed as previously described. On day 6 of differentiation (many large multinucleat ed cells present), calcitonin (10nM) was added to the cells and incubated for time poi nts of 1, 2, and 24 hours. For identification of morp hological characteristics, the cells were then fixed in 2% formaldehyde, solubilized in 0.2% Trit on X-100 in PBS and blocked in PBS with 2% BSA. Cells were stai ned with rhodamine phalloidin or antibodies recognizing

PAGE 111

100 Arp 3 or phospho-VASP (Ser 157) at a dilution of 1:100 in PBS. Secondary antibodies were diluted according to manu facturers instructions. Osteoclasts were visualized using the MRC-1024 co nfocal laser scanning microscope and LaserSharp software (Bio-Rad, Hercules, CA ). Images were taken in sequential series to eliminate any overlap of emi ssion and analyzed by confocal assistant software. For assessment of protein expression, RANKL stimulated RAW 264.7 cells on 6 well plates were either untr eated or treated with calc itonin (10 nM) for 1, 2 or 24 hours. Cells were then scraped and washed twice with PBS. The pellets were lysed using 250 l of cell extraction buffer (B ioSource International, Camarillo, CA, USA) supplemented with protease inhibitor cocktail (Sigma P2714) and phenylmethylsulfonyl fluoride (PMSF) for 30 minutes on ice with vortexing every 10 minutes The extract was centrifuged for 10 minutes at 13,000 rpm at 4o C. Bradford assay was perfo rmed on the lysates. Equal concentrations of protein were separat ed by SDS-PAGE, followed by western transfer. The nitrocellulose blots were blocked in blocking buffer overnight and incubated with both antiVASP and anti-phospho-VASP (S er 157) antibodies for 2 hours. The bots were washed and incubated with a horseradish peroxidase (HRP)-labeled secondary antibody for 1 hour, followed by incubation with a chemiluminescent substrate. The blots we re visualized usin g an Alpha Innotech Fluorochem 8000. Quantitation wa s performed using densitometric measurements of integrated density values.

PAGE 112

101 VASP-null colony To determine the effects of knocking out VASP expression in osteoclasts, three female heterozygous mice and one homozygous VASP knockout male mouse were obtained as a generous gift fr om Dr. Ulrich Walter (Institute of Clinical Biochemistry and Pathobiochemistr y, Wurzberg, Germany). A breeding colony was initiated with appr oval from the University of Florida Institutional Animal Care and Usage Committee. Ba sed on Mendelian genetics, half of each litter should be homozygous knock out mi ce and half should be heterozygous. After weaning, a tail sample from eac h pup was obtained and RNA was extracted with RNAeasy Mini Kit (Qiagen, Valenc ia, CA) following the manufacturers instructions and quantified by spectr ophotometer. The sequence for VASP was obtained from Gen Bank. Primers were designed as follows: forward 5GAGGAGCTGGAACAACA GAA-3; reve rse 5-CCAGGCAGGAAGTACA GAAA3. For standard RT-PCR, 3 ug of total RNA were anneale d to an oligo-dt primer and first strand cDNA synthesis was performed using Thermoscript RT-PCR System (Invitrogen, Carlsbad, CA) follo wing manufacturers directions. Onetwentieth of the cDNA was subjected to amplification by PCR. PCR was performed under the follo wing conditions: 95oC for 2 minutes, then 35 cycles of 90oC, 30 seconds; 58oC, 30 seconds; 72oC, 30 seconds. O ne-half of the PCR product was separated on 0.5% agarose gel with ethidium bromide staining for 1 hour. Images were detected using UV tran sillumination on a Fluorochem 8000 (Alpha-Innotech, San Leandro, CA). Homozygous mice were determined to be those by which PCR with multip le primers was unsuccessful.

PAGE 113

102 Mouse marrow osteoclasts were grown from marrow derived from the long bones of the hind legs of the homozy gous VASP knockout and the heterozygous mice. The marrow cells were grown in -MEM medium with 10% fetal bovine serum (FBS) plus 10-8 M 1,25-dihydroxyvitamin D3 for a period of approximately seven days. The cells were then scraped, plated on 24 well plates, and treated with calcitonin (10nM) for 1 hour. The ce lls were fixed in 2% paraformaldehyde, detergent-permeabilized with 0.2% Triton X-100 in PBS for 10 minutes, washed in PBS and blocked in PBS with 2% BSA (bovine serum albumin) for one hour. Actin filaments were stained with TRITC phalloidin. VASP was probed with an anti-VASP polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Bound antibodies were det ected by labeling with CY2 tagged anti-rabbit secondary antibody. Osteoclasts were visualized using t he MRC-1024 confocal laser scanning microscope and LaserSharp software (Bio-Rad, Hercules, CA). Images were taken in sequentia l series to eliminate any overlap of emission and analyzed by confocal assistant software. This protocol was approved by the University of Florida Institutional Animal Care and Usage Committee. PCR analysis of the ENA/VASP family member, Evl RNA was extracted from RANKL different iated RAW 264.7 cells as well as from unstimulated RAW 264.7 cells using RNAeasy Mini Kit (Qiagen, Valencia, CA) and quantified by spec trophotometer. The sequ ence for evl was obtained from Gen Bank. The following pr imers were designed: forward 5ACCAGCAGGTTGTGATCAAT-3; revers e 5-AATAGACCCGGTGTTCT GTG-3. For standard RT-PCR, 3 g of total RNA were annealed to an oligo-dt primer and

PAGE 114

103 first strand cDNA synthesis was perfo rmed using Thermoscript RT-PCR system following manufacturers directions. One-tw entieth of the cDNA was subjected to amplification by PC R using the above mentioned primers. PCR was performed under the following conditions: 95oC for 2 minutes, then 35 cycles of 90o C, 30 seconds; 58oC, 30 seconds; 72oC, 30 seconds. One hal f of the PCR product was separated on 0.5% agarose gel with et hidium bromide staining for 1 hour. Images were detected using UV trans illumination on a Fluorochem 8000. Results VASP is present in the actin rings of osteoclasts. The actin rings of osteoclasts were stained with anti-VAS P or phalloidin. Figure 5.2 is a representat ive micrograph of the staini ng. Co-localization was observed between VASP and actin. VASP is phosphorylated at Serine 157 in response to calcitonin treatment and results in the disruption of the actin ring of osteoclasts. Osteoclasts were treated with calcitonin at baseline, and cells were fixed and stained with phos pho-VASP Serine 157 or Arp3 ant ibodies at 1, 2 and 24 hour time periods (Figure 5.3). Osteoclasts at baseline showed no phosphorylation of VASP. Treat ment with calcitonin ca used a phosphorylation of VASP at Serine 153 as obser ved by the increased signal intensity at 1 and 2 hours. This phosphorylation coincided wit h a disruption of the microfilament organization in the actin rings from tight ly focused rings to broad bands of actin. By 24 hours, the phosphorylat ion and actin ring morphology were returning to baseline levels.

PAGE 115

104 Western analysis of the ca lcitonin-treated osteoclast s showed a three fold increase in phosphorylation of VASP at Se rine 157 at 1 and 2 hour time points (Figure 5.4). This confirms VASP is pho sphorylated in response to calcitonin treatment. The osteoclasts of mice lacking the VASP gene are able to form actin rings. Heterozygous female and homozygous male knockout mice were obtained from Ulrich Walter (Institute fo r Clinical Biochemistry and Pathobiology, Medizinische Universittsklinik, Wrzburg, Germany). The mi ce were bred and homozygous VASP-null mice were identified by tail DNA isolat ion (Figure 5.5). Osteoclasts were cultured from the mous e marrow of the hind legs of the VASP deficient mice. The osteoclasts were then fixed and stained with phalloidin or treated with calcitonin and fixed and stained with phalloidin. Normal actin ring morphology was observed in osteoclasts from VASP-null mice (Figure 5.6). Treat ment with calcitonin, which disrupts actin ring morphology by the PKA pathway disrupted the actin rings of both the control, as expected, and the VASP null osteoclasts. This suggests that calcitonin may exert its functions through anot her VASP/Ena family member. Evl is upregulated in response to osteoclast differentiation To identify other members of the ENA/ VASP family that could play a role in osteoclastogenesis, PCR was performed using primers to detect changes in gene expression in evl. Unlike VASP, Ev l mRNA was preferentially upregulated during osteoclastogenesis, with a complete la ck of detection prior to treatment of RAW 264.7 cells with RANK-L (Figure 5.7).

PAGE 116

105 Discussion Vasodilator stimulated phosphoprote in is a member of the ENA/VASP family of proteins (190, 192, 203, 206, 207). These proteins localize to areas of dynamic actin polymerization and are know n downstream effectors of multiple signaling pathways (189). These studies show that VASP is a component of the actin ring of osteoclasts, which is cons istent with its localization to areas of dynamic actin reorganization (205). The function of VASP in the actin ring of osteoclasts is still unknown. However, ENA/VASP proteins bind directly to Gactin and F-actin as well as profilacti n and are known to promote the elongation of actin filaments by recrui ting profilactin complexes to the sites of dynamic actin reorganization (205, 208-210). VASP also functions to enhance Arp2/3 activity and prevent capping proteins from inhibi ting actin polymerization (210). These data strongly suggest that VASP plays a key role in actin dynamics. VASP has been identified as a subs trate for both the PKA and PKG phosphorylation (208, 211, 212). Platelet s from VASP null mice have defective PKA signaling and exhibit deficiencies in platelet aggregation (213-215). Calcitonin is a known activator of the PKA pathway and induces changes in the cytoskeleton (191, 192). Treatment of osteoclast s with calcitonin shows a three-fold increase in phos phorylation of VASP at Seri ne 157 within the first two hours of treatment with a return to base line by 24 hours. The actin rings of calcitonin-treated osteocla sts were disrupted as the microfilament organization changed from a tightly focused ring to bro ad bands of actin. By 24 hours, the actin ring morphology had re turned to baseline morphology This is consistent

PAGE 117

106 with data indicating that VASP plays a ro le in actin filam ent organization by affecting the branching activity of the Arp2/3 complex. Upon activation of VASP, the density of Arp2/3 induced branching is decreased, resulting in larger and more sparsely branched filaments (216) Upon deactivati on, Arp2/3 mediated actin polymerization and branching occurs resulting in a dense, tightly branched network. Although data confirm that VASP is a ssociated with the reorganization that occurs in the actin ring of osteoclast s, VASP null mice hav e no real skeletal deficiencies (212-214). Ost eoclasts from VASP null mi ce exhibit normal actin ring morphology. In addition, when treated with calcitonin, the osteoclasts exhibit actin ring disruption similar to that obser ved in control cells. These findings support the lack of skeletal deficiencies id entified in VASP null mice and suggest that VASP may not play a major role in th e dynamic actin polymerization found in the podosomes of the actin ring. The ENA/VASP family consists of three mammalian members, VASP, Mena (mammalian Enabled) and Evl (Ena/ VASP-like protein) (211, 217). PKA phosphorylation, as induced by calcitonin, is known to affect two members of the ENA/VASP family, VASP, as our data have shown, and Evl (203, 211). Evl is highly expressed in cells of hema topoietic lineage and has been shown to nucleate actin polymerization (203, 206). In addition, phosphorylation of Evl results in a decrease in nucleation activi ty (211). These data suggest that Evl may be the Ena/VASP family member that plays a key role in osteoclastogenesis. PCR analysis of unstimulated and RANKL stimulated RAW

PAGE 118

107 264.7 cells indicates that Evl is prefer entially upregulated in response to RANKL stimulation, as is seen with cortactin. This pref erential upregulation suggests it functions in the dynamic actin reorganiza tions that occur during osteoclastic differentiation. In summary, VASP is present in the actin rings of osteoclasts and is phosphorylated at Serine 157 in response to calcitonin treatment, which activates the PI3K pathway. This activation caus es a disruption of the actin ring of osteoclasts. Although treat ment with calcitonin may indicate a role for VASP in actin ring formation and maintenance, we did not detect any skeletal defects in the VASP knockout mouse. Osteocla sts cultured from VASP knockout mice respond similarly to those from control mi ce, indicating another ENA/VASP family member may play a more dominant role in osteoclastogenesis. Evl, an ENA/VASP family member, is present in cells of hematopoietic lineage (14) and has been shown to be preferentially upregulated in response to RANKL treatment. Evl may be responsible for t he structural changes se en in actin ring morphology when treated with calcitonin.

PAGE 119

108 Figure 5.1. The E na/VASP family. Cartoons of t he three mammalian members of the Ena/VASP family are depicted. All three members share a similar domain structure which consists of an aminoterminal EVH1 domain, a central prolinerich region, and a carboxy-terminal EVH2 domain. In addition, all mammalian Ena/VASP proteins share an amino-termi nal PKA/PKG phosphorylation site (Ser157 of VASP). (Kwiatkowski AV et al. Trends Cell Biol. 2003; 13(7):386-92) (206)

PAGE 120

109 Actin VASP Figure 5.2. VASP is present in the actin ring of osteoclasts. Mouse marrow osteoclasts were cultured on bovine dentin slices fo r 2 days and then fixed and stained with rhodamine phalloidin and anti-V ASP antibody. VASP is observed to co-localize with actin in the podosomes of the actin ring.

PAGE 121

110 B aseline 1 hour 2 hours 24 hours PhosphoVASP Arp3 Figure 5.3. VASP is phosphorylated at Se rine 157 in response to calcitonin treatment and results in the disruption of the actin ring. RAW 264.7 cells were cultured with RANKL until mu ltinucleated osteoclast-lik e cells were observed. The cells were then treated with 10 nM calcit onin and fixed at bas eline, 1, 2, and 24 hour time points. The cells were st ained with antibodies re cognizing Arp3 and phospho-VASP Ser 157. Calcitonin trea tment caused a phosphorylation of VASP at 1 and 2 hour time points but returned to base line by 24 hours. A broadening of the actin ring coincided with the observed phosphorylation.

PAGE 122

111 Figure 5.4. Calcitonin induc es a three fold increase in phosphorylation levels of VASP at Serine 157. Cell lysates were collected from the RAW 264.7 cells treated with calcitonin at bas eline, 1 hour and 2 hours. A Bradford assay was performed to standardize prot ein concentrations. The lysates were separated by SDS-PAGE and western analysis and pro bed with either antiPhospho-VASP (Serine 157) or anti-VASP antibodies. Quantitation was performed on the western blots by densitomet ry measuring integrated dens ity values.

PAGE 123

112 Figure 5.5. Identificati on of VASP null mice from breeding of heterozygous female with a homozygous male. RNA was extracted from the tail of each pup in the breeding colony. Prim ers were synthesized again st VASP to determine which mice were lacking the VASP gene. The white circle ident ifies the presence of the VASP gene, while the black circle identifies a VASP nu ll mouse. These identified VASP null mice were then used for immunocytochemical studies.

PAGE 124

113 Figure 5.6. Osteoclasts of mice la cking the VASP gene are able to form actin rings and respond to calcitonin in the same fashion as control cells. Osteoclasts were cultured from the m ouse marrow of the hind legs of VASP null or control mice. The osteoclasts were either untr eated or calcitonin ( 10 nM) treated for 10 minutes and then fixed and stained with rhodamine phal loidin. The VASP null osteoclasts form actin rings like the controls. In addition, treatment with calcitonin, which disrupts actin ring morphol ogy, similarly disrupts the actin ring in both control and VASP null osteoclasts.

PAGE 125

114 Unstimulat ed Stimulated EVL GAPDH Figure 5.7. Evl, a mem ber of the ENA/VA SP family, is upregulated in response to osteoclastogenesis. RNA was extracted from RAW 264.7 cells unstimulated or stimulated with RANKL. Primers were designed again st Evl, a member of the ENA/VASP family. RT-PCR identifies preferential upregulation of Evl in response to RANKL stimulation.

PAGE 126

115 CHAPTER 6 MODEL AND FUTURE DIRECTIONS The Model and Hypothesis This project has tested two novel hy potheses regarding t he actin ring of osteoclasts and the association of actin ring proteins with V-ATPase. Our model first proposes that upon activation of t he osteoclast, the cell becomes polarized, and the Arp2/3 complex is recruited to t he apical membrane. It is hypothesized that the actin polymerizati on that ensues is Arp2/3 m ediated and forms the actin ring. It is possible that this polym erization produces force at the plasma membrane, driving the membrane into the bone and forcing it to conform, creating a tight, yet dynamic seal. To c ounter the force being applied to the bone at the sealing zone, int egrin-mediated focal adhesions elsewhere on the apical surface maintain the osteoclast in posit ion. This hypothesis would account for the dynamic nature of the actin ring and sealing zone as well as the specific exclusion of integrins from t he area of the sealing zone. In addition, it is also hypothesiz ed that the Arp2/3 complex or its associated proteins may bind V-ATPa se and that Arp2/3 mediated actin polymerization may be involved in translocation of V-ATPase to and from the ruffled membrane. The association of V-ATPase with actin based networks is first confirmed by the actin binding abilit y of V-ATPase (9, 11, 218). Several V-

PAGE 127

116 ATPase subunits have been identified to bind actin (9, 11, 218). In addition, in inactivated osteoclasts, F-actin and V-ATPa se co-localize in cytosolic vesicles (9). This co-localization is only di srupted upon activation of the cell, where VATPase is then inserted into the ruffled membrane and actin is localized to the area of the sealing zone (9). Due to the highly dynamic nature of Arp2/3 mediated actin polymerization and the clos e proximity of the ruffled membrane and actin ring, this would seem a plausible mechanism. This study has identified many important characterist ics of the actin ring of osteoclasts. We have shown for th e first time that the dynamic actin polymerization in the actin ring of osteoclasts is Arp 2/3 mediated. Osteoclast actin rings are now identified as being composed of discrete and dynamic actin based structures, termed podosomes (33, 34, 43). Presented immunocytochemical data confirms the cu rrent literature t hat podosomes are composed of a core of actin and asso ciated proteins, such as the Arp2/3 complex, cortactin and VASP (35, 36). These proteins, when viewed in zsection, are concentrated at the resorptive surface, which is consistent with their role in the force production at the reso rptive surface and their incorporation of actin into filaments at the resorpti ve surface and treadmilling toward the basolateral membrane. In addition, focal adhesion proteins, such as vinculin, do not co-localize with the acti n ring but surround the actin ring, as a cloud (33, 34). Subsequent to our findings, Jurdic et al. (43) redefined the parameters of the podosomes of the actin ring. The ac tin ring podosomes differ from individual

PAGE 128

117 podosomes in that the core proteins surround the entire ri ng instead of each individual podosome, as we observed with vinculin (43). The dynamic nature of these podosomes was confirmed by various studies. First, rhodamine-actin incorpor ated into the actin ring of saponinpermeabilized RANKL stimulated RAW 264. 7 cells within 10 minutes after treatment. In addition, the inclusion of latrunculin A, which sequesters G-actin, inhibits loss of podosomal structure. Th is indicates that new polymerization is inhibited while original filaments are treadmilling and disassembling. Second, treatment with various chem ical agents known to disrupt actin ring structures, such as wortmannin, calcit onin and cytochalasin D, also show rapid dissolution and relocation of the podosomes in osteoclasts. Upon stimulation by various factors, proteins are ofte n upregulated in response to specific functions in cells. For the osteoclast, st imulation by RANKL and CSF cause the osteoclast to polarize and specialized struct ures specific to the resorbing osteoclast to form, specif ically the ruffled membrane and the actin ring (8). We identified by PCR and wester n blot analysis two proteins that were upregulated in response to RANKL stimul ation. The upregula tion of Arp2 and Arp3 at a translational level and cortactin at a transcrip tional level suggest that these proteins play specia lized roles in osteoclastog enesis. In addition, their known association with actin related comple xes suggests that this role is in the formation of the actin ring. The function of the Arp2 and cortacti n proteins on actin ring formation and osteoclast function were examined via k nock down by siRNA. Knock down of

PAGE 129

118 either protein resulted in a decreas e in actin rings, confirming actin polymerization is mediated by the Arp2/3 complex. It was interesting to note that the Arp2 knock down cells appeared apoptotic while the cortactin knock down cells appeared viable. These data may sup port the role of the Arp2/3 complex in cell viability as well as its resorption function although a loss of actin ring formation cannot directly confirm a loss of bone resorption. Chellaiah et al. (165) showed initially that the gelsolin knock out mouse, which appeared to lack a podosomal-based actin ring, was capabl e of bone resorption albeit much reduced. The hypothesis is that alter native mechanisms of adhesion, such as integrins, are capable of maintaining adequate ad hesion for the resorption compartment to remain intact. 3 -/mice show decreased bone resorption, abnormal ruffled membranes, and increased osteoclast number, most likely caused from stimulation by hyperparathyroidism secondary to the hypocalcemia produced by decreased bone resorption (52). Skeletal remodeling in the 3 -/mice proceeds even in the absence of v 3; it is hypothesized that an adequate resorption rate is achieved by the increas ed number of osteoclasts, even in the presence of decreased resorption per osteoc last (52). Furt her studies with the gelsolin knockout mouse identify a W ASP-containing actin ring, capable of maintaining bone resorption, with sli ghtly reduced efficiency (219). These studies suggest that actin ring formation, in addition to integrins, is important for osteoclastic bone resorption as studies have shown that a lo ss of actin ring formation is concurrent with a reduction in bone resorption (31). The fact that reduced bone resorption has been identified ev en in the absence of the actin

PAGE 130

119 rings suggests that the osteoclast has alternative adhesive mechanisms to support an extracellular resorption compar tment (219). It is reasonable to postulate that for efficient bone re sorption, both integr in-based adhesion and actin ring formation are necessary. Arp2/3 mediated actin pol ymerization is known to proceed via a complex of proteins, including the Arp2/3 comple x, n-WASP, and cortactin (135, 188). The Arp2/3 complex is inactive in its unbound form (136, 137). Activation of the Arp2/3 complex occurs via its interaction with members of the N-WASP family of proteins (136, 137). This interaction causes a conformational change in the structure of the complex, inducing acti n polymerization (136, 137). Based on the data generated, as loss of Arp2 and cortacti n disrupted actin ring formation, it was logical to propose that actin ring poly merization was a function of this ternary complex. Immunoprecipitat ion experiments with a GSTcortactin fusion protein pulled down Arp3, N-WASP, VASP, and t he E subunit of V-ATPase. Although we cannot confirm if the bindi ng is direct or indirect, th e pull down of Arp3 and NWASP is consistent with the formation of this ternary complex. The binding of VATPase and VASP were unexpec ted. The ability of cortactin to pull down the E subunit of V-ATPase may ident ify an additional binding par tner for V-ATPase that may be involved in its translocation to and from the membrane. Taken together, these data support t he initial hypothesis generated for this project that actin ring formation is a result of Arp2/3 mediated actin polymerization. Based on new methods rec ently presented, further insights into

PAGE 131

120 the effects of a loss of actin ring forma tion on bone resorption will be able to be elucidated (Future Directions). The hypothesis that V-ATPase is translocated throughout the cell via Arp2/3 mediated actin polymeriz ation is attractive as it poses a highly dynamic mechanism of movement and responds appropriately to several chemical mediators. However, curr ent research does not suppor t this hypothesis as we have been unable to show a direct lin k between V-ATPase and the Arp2/3 complex. A limitation of this study was that only t he actin binding sequence of the B1 subunit was used to identify an interaction with th e purified Arp2/3 complex. This sequence was used si nce the Arp2/3 comple x and actin share extensive sequence homology; it would seem logical that they may also interact via the same binding site. Unfortunately, interaction was not detected via this sequence. Although a link was not di rectly identified between the Arp2/3 complex and V-ATPase, immunoprecipitatio n experiments with the B-subunit of V-ATPase and signal transduction array did identify VASP as a potential binding partner to VATPase. VASP is known to be phosphorylated in response to activation by the PKA and PKG pathways (203, 207). Previous data also show that calcitonin, which activates the PKA pathway, disrupt s actin rings (190, 191). When taken together, these data suggest that actin ring disruption may result from the phosphorylation of VASP. VASP is an acti n-associated protei n that tracks the fast growing end of actin filaments (201). The prec ise role of VASP remains unclear. However, it may be involved in protecting growing actin filaments ends

PAGE 132

121 from capping proteins (201). Data have al so been presented that indicate that VASP has the capacity to conc entrate profilactin comple x near the fast growing end of actin filaments and this may be vi tal to ensuring the rapid treadmilling of podosomes (202). One caveat to the ro le of VASP in osteoclastic bone resorption is that VASP knock out mice have no detected skeletal defects (213, 214). This study identifies that, in fact VASP is present in the actin rings of osteoclasts and is phosphorylated in respon se to calcitonin treatment. However, based on immunocytochemical experiment ation of osteoclasts of VASP knock out mice, there is no effect on actin ring formation. In addition, the response of the VASP knock out osteoclasts to calcitonin is equal to that of the control. These data suggests that VASP may not play a vital role in osteoclastic bone resorption. However, the Ena/VASP fam ily member, EVL, identified specifically in cells of hematopoietic lineage (211), wa s found in this study to be preferentially upregulated in response to osteoclastoge nesis. This protein warrants further study (Future Directions). Future Directions There are several future directions for this research. Previous siRNA knock down studies have lacked the ability to clearly define effects on in vitro bone resorption due to an extremely low e fficiency of transfection of mouse marrow cultures. Although RAW 264.7 cells can be efficiently transfected, VATPase is not properly located to t he ruffled membrane and thus bone resorption does not occur adequately for experiment ation. Although the mechanisms of actin ring formation can be studied as there seems to be no effect on the actin

PAGE 133

122 ring, bone resorption assays in RAW cells are suspect. Rece nt literature has identified a novel method of transfection of siRNAs into mouse marrow cultures (220). Experimental siRNA, along with RNAse inhibitors, are added directly to the mouse marrow osteoclasts prior to scr aping and transferring to bovine dentin slices. The siRNA is taken up during tran sfer onto bone slices. This technique was recently published by Hu et al. ( 220), who showed successful knock down of the a3 subunit of V-ATPase by this met hod. Subsequent to th at study, we also tested a known siRNA against the a3 su bunit of V-ATPase on mouse marrow osteoclasts. Protein ex pression was reduced approx imately 70-80%, which is extremely efficient for mouse marrow osteoc lasts. If we are able to get this efficiency when knocking down Arp2 or cort actin with siRNA, we will be able to examine the effects on bone re sorption in vitro. Our hypothesis also focuses on the ac tin ring being responsible for force production required for the formation of an external resorption compartment. Arp2/3 mediated actin polymeriz ation is known to be c apable for force generation as is seen in the actin-based mot ility of certain pathogens such as Listeria, Shigella and Rickettsia and the enveloped virus vacci nia (151-153). This actin polymerization that serves as the basis fo r this movement results in an actin comet tail. This movement is involved in the spread of the pathogens from cell to cell (149, 150). Based on the capabilit y of Arp2/3 mediated force generation, the data supporting the requirem ent of the actin ring fo r efficient bone resorption and the extremely tight adhesion at the region of the sea ling zone, it is plausible that this adhesion is produced by force gener ation. A long term goal is to study

PAGE 134

123 force generation of the actin ring of osteoc lasts using deformable membranes. If force was generated against a deformable memb rane, it should be identified as a divot in the membrane. Another goal is to identify a link between Arp2/3 mediated actin polymerization and V-ATPase translocation. Recent st udies have shown that VATPase directly binds to aldolase, whic h functions in glycolysis (26, 27). In addition, aldolase has been shown to inte ract with actin and actin-associated proteins such as WASP and cortactin ( 221, 222). These data suggest that aldolase may function as a link between the Arp2/3, cortactin, N-WASP ternary complex and V-ATPase. The dynamic inte ractions that interplay between these components may prove to be vital for trans location of V-ATPase to and from the plasma membrane. The identification of di rect or indirect interactions between these proteins can be ident ified via immunoprecipitatio n experiments using GSTcortactin or GST-VCA domai n of N-WASP constructs (Dr. Scott Weed, West Virginia University Morgantown, WV) or sp ecific antibodies. Once direct binding partners are identified, specific binding sequences will be determined, and identification of the func tional consequences examined by constructing fusion proteins with mutations in t he binding region. The identification of another ENA/VASP family member preferentially upregulated during osteoclastogenesis merits further identification. Based on literature studies, evl, whic h is highly expressed in hem atopoietic cells (211), is the least studied of the three family member s. Evl may function as the regulator of profilactin at the active sites of acti n polymerization, which, if altered, may

PAGE 135

124 affect actin nucleation rates. Characteri zation of this protein in the osteoclast model may give many valuable insights into actin ring formation. Initial studies will focus on the localization of evl usi ng immunocytochemical experiments. If co-localized with the actin ring, further st udies on the requirement of evl for actin ring formation using knock down studies wi ll be performed. The loss of evl may not completely disrupt actin ring forma tion but may slow down polymerization; actin polymerization assays might prove usef ul to identify rate changes based on the presence or absence of evl. Significance of Study Bone homeostasis is the maintenance of a delicate balance between two opposite and dynamic processes, bone formation and resorption (2). Bone resorption is a mandatory event in the no rmal physiological functioning of the human body, required for such processe s as human growth, tooth movement, and the maintenance of plasma calcium levels (223). Bone resorption also has extensive implications in disease proc esses. Enhanced bone resorption is associated with diseases such as malignant hypercalcemia, osteoporosis, osteolytic dysplasia, and metastatic bone tumors (224, 225). Such osteolytic lesions mediate bone resorption by either increasing osteocla stic stimulatory factors to activate differentiation of pr ogenitor cells, activating mature osteoclasts directly, or inducing the i mmune system to release additi onal factors to stimulate bone resorption (225, 226). Osteoclastic ce lls observed in disease states are in general larger in size and number, resulting in an increased resorptive activity and efficiency (227). Morbidity associated with such resorptive diseases includes

PAGE 136

125 pain, pathological fractures, debilitati on, and deformity (225, 226). Although these diseases all have diffe rent etiologies, in each disease, a resorption lacunae must be segregated by the sealing zone creating the acidic extracellular compartment, by which the mineralized bone is resorbed (54, 226). This research has focused on identif ying the proteins functioning in the formation of the sealing zone. We have iden tified for the first time the presence of Arp2/3 in the actin ring and that acti n polymerization proceeds via an Arp2/3 mediated process as is shown by knock dow n of the protein. This process, in contrast to those utilizing formins or SPIRE (228, 229), results in networks of densely branched actin filaments, consist ent with podosome stru cture (33). We have also identified that these branched networks are very dynamic and fairly sensitive to the surrounding environment. At this time, we have not established a mechanism for Arp 2/3 mediated V-ATPa se translocation. However, based on these data, it is proposed that the Arp2/3 complex can pose as a target to alter osteoclast function. We have also identified cortactin as an important protein in the actin ring of osteoclasts. Cortactin stabilizes the Arp2/3 mediated branched filaments (185). The knock down of cortactin in th e actin ring of osteoclasts results in a loss of podosomal arrangement of the actin ring but the ce lls remain viable. This finding is significant as cortactin has al so been implicated in cancer metastasis through the formation of podosomal-like invadopodia (230). The modulation of this protein may allow for alterations in bone resorption and cancer metastasis.

PAGE 137

126 Although VASP initia lly appeared very promisi ng in both its effects on actin ring function and translocation of V-ATPase to and from the ruffled membrane, experimentation proved other wise. VASP is phosphorylated in response to the protein kinase A pat hway (203, 207), which can cause a loosening of the actin ring. However, the osteoclasts from VASP knock out mice had normal actin ring morphology and no ske letal deformities were detected (213, 214). The benefit of studying VASP is the identif ication of another ENA/VASP family member, ev l. Evl may prove to be t he family member involved in actin ring dynamics. The clinical significance of this pr oject is the ident ification of the podosomal actin ring proteins and the effects of their knock down. It is known that podosomes are not only involved in physiological processes but also in disease states such as cancer (231). We have identified that the knock down of cortactin and Arp2 causes a disruption of podosomal organization. Based on our findings, it is hypothes ized that these proteins could be targeted using viral vector therapy and/or osteocla st specific promoters to re gulate osteoclastic bone resorption or possibly inhibit cancer metastasis.

PAGE 138

127 REFERENCE LIST 1. Horowitz MC, Xi Y, Wi lson K, Kacena MA. Contro l of osteoclastogenesis and bone resorption by members of t he TNF family of receptors and ligands. Cytokine and Growth Fa ctor Reviews. 2001; 12: 9-18. 2. Rousselle AV, Heymann D. Osteoc lastic acidification pathways during bone resorption. Bone. 2002; 30(4):533-540. 3. Teitelbaum SL. Osteoclasts, int egrins and osteoporosis. J Bone Miner Metab. 2000; 18:344-349. 4. Wada T, Nakashima T, Hiroshi N, Penninger JM. RANKL-RANK signaling in osteoclastogenesis and bone disease. TRENDS in Molecular Medicine. 2005; 20(20):1-9. 5. Stenbeck G, Horton MA. A new spec ialized cell-matrix interaction in actively resorbing osteoclasts. J Cell Sci. 2000; 113:1577-1587. 6. Redey SA, Razzouk S, Rey C, Bernache-Assollant D, Leroy G, Nardin M, Cournot G. Osteoclast adhesion and ac tivity on synthetic hydroxyapatite, carbonated hydroxyapatite, and natural ca lcium carbonate: relationship to surface energies. J Biomed Mater Res. 1999; 45(2):140-147. 7. Salo J, Metsikko K, Paloka ngas H, Lehenkari P, Vaananen HK. Boneresorbing osteoclasts reveal a dy namic division of basal plasma membrane into two different domains. J Cell Sci. 1996; 109:301-307. 8. Vaananen HK, Zhao H, Mulari M, Halleen JM. The cell biology of osteoclast function. J Ce ll Sci. 2000; 113:377-381. 9. Lee BS, Gluck SL, Ho lliday SL. Interacti on between vacuolar H+-ATPase and microfilaments during osteoclast ac tivation. J Biol Chem. 1999; 274(41):29164-29171. 10. Suda T, Nakamura I, Jimi E, Tak ahashi N. Regulation of osteoclast function. J Bone Miner Res. 1997; 12:869-879.

PAGE 139

128 11. Holliday LS, Lu M, Lee BS, Nelson RD, Solivan S, Zhang L, Gluck SL. The amino-terminal domain of the B subunit of vacuolar H+-ATPase contains a filamentous actin binding si te. J Biol Chem. 2000; 275(41): 32331-32337. 12. Holliday LS, Welgus HG, Fliszar CJ, Veith GM, Jeffrey JJ, Gluck SL. Initiation of osteoclast bone resorption by interstitial collagenase. J Biol Chem. 1997; 272(35):22053-22058. 13. Boyle WJ, Simonet WS, Lacey DL Osteoclast differentiation and activation. Nature. 2003; 423:337-342. 14. Ash P, Loutit JF, Townsend KMS. Osteoclasts derived from hematopoietic stem cells. Nature. 1980; 283:669-670. 15. Gothlin G, Ericsson J. The osteoclast. Clin Orthoped Rel Res. 1976; 120:201-231. 16. OBrien EA, Williams JHH, Marshall MJ. Osteoprotegerin ligand regulates osteoclast adherence to the bone surfac e in mouse calvaria. Biochem Biophys Res Commun. 2000; 274:281-290. 17. Theoleyre S, Wittrant Y, Tat SK, Fortun Y, Redini F, Heymann D. The molecular triad OPG/RANK/RANKL: in volvement in the orchestration of pathophysiological bone remodeling. Cytokine and Growth Factor Reviews. 2004; 15:47-475. 18. Ryu J, Kim H, Lee SK, Chang E-J, Kim HJ, Kim H-H. Proteomic identification of the TRAF 6 regulation of vacuolar ATPase for osteoclast function. Proteomi cs. 2005; 5:4152-4160. 19. Nermut MV, Eason P, Hirst EM, Kellie S. Cell/substratum adhesions in RSV-transformed rat fibroblasts. Ex p.Cell Res. 1991; 193: 382-397. 20. Tsukii K, Shima N, Mochizuki S, Yamaguchi K, Kinosaki M, Yano K, Shibata O, Udagawa N, Yasuda H, Suda T, Higashio K. Osteoclast differentiation factor mediates an e ssential signal for bone resorption induced by 1 ,25-dihydroxyvitamin D3, prostaglandin E2, or parathyroid hormone in the microenvironment of bone. Biochem Biophys Res Commun. 1998; 246:337-341.

PAGE 140

129 21. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Ta kahashi N, Suda T. Os teoclast differentiation factor is a ligand for os teoprotegerin/ osteoclastogen esis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA. 1998; 95:3597-3602. 22. Suda T. Udagawa N, Nakamura I, Miyaur a C, Takahashi N. Modulation of osteocalst differentiation by local fa ctors. Bone. 1995; 17(Suppl.2):87S91S. 23. Blair HC, Teitelbaum SL, Ghiselli R, Gluck S. Osteoclastic bone resorption by a polarized vacuolar proton pump Science. 1989; 245:855-857. 24. Ohlsson A, Cumming WA, Paul A, Sly WS. Carbonic anhydrase II deficiency syndrome: recessive ost eopetrosis with renal tubular acidosis and cerebral calcification. Pediatrics. 1986; 77(3): 371-381. 25. Whyte MP. Carbonic anhydrase II def iciency. Clin Orthop Relat Res. 1993; 294:52-63. 26. Lu M, Sautin YY, Holliday LS, Glu ck SL. The glycolyti c enzyme aldolase mediates assembly, expression, and acti vity of vacuolar H+-ATPase. J Biol Chem. 2004; 279(10):8732-9. 27. Lu M, Holliday LS, Zhang L, Dunn WA, Gluck SL. Interaction between aldolase and vacuolar H+-ATPase: evidence for direct coupling of glycolysis to the ATP-hydrolyzing pr oton pump. J Biol Chem. 2001; 276(32):30407-13. 28. Schlesinger PH, Blair HC, Teitelb aum SL, Edwards JC. Characterization of the osteoclast ruffled border chlo ride channel and its role in bone resorption. J Biol Chem. 1997; 272:18636-18643. 29. Holtrop ME, King GJ. The ultras tructure of the osteoclast and its functional implications. Clin Orthop. 1977; 123:177-196. 30. Helfrich MH, Nesbitt SA, Lakkakorp i PT, Barnes MJ, Bodary SC, Shankar G, Mason WT, Mendrick DL, Vaananen HK, Horton MA. 1 integrins and osteoclast function: involvement in collagen recognition and bone resorption. Bone. 1996; 19(4):317-328. 31. Nakamura I, Takahashi N, Sasaki T, Tanaka S, Udagawa N, Murakami H, Kimura K, Kabuyama Y, Kurokawa T, Suda T, Fukui Y. Wortmannin, a specific inhibitor of phosphatidylinositol -3 kinase, blocks osteoclastic bone resorption. FEBS. 1995; 361:79-84.

PAGE 141

130 32. Lakkakorpi PT, Vaananen HK. Cytoske letal changes in osteoclasts during the resorptive cycle. Microsc Res Tech. 1996; 33(2):171-81. 33. Destaing O, Saltel F, Geminard J-C, Jurdic P, Ba rd F. Podosomes display actin turnover and dynamic self-organization in osteoclasts expressing actin-green fluorescent protein. Mol Biol of Cell. 2003; 14:407-416. 34. Luxenburg C, Addadi L, Geiger B. The molecula r dynamics of osteoclast adhesions. Eur J Cell Biol. 2006; 85(3-4):203-11. 35. Linder S, Kopp P. Podosomes at a glance. J Cell Sci. 2005. 118(10); 2079-2082. 36. Buccione R, Ortho JD, MA McNiv en. Foot and mouth: podosomes, invadopodia and circular dorsal ruffles. Nat Rev Mol Cell Biol. 2004; 5:647-657. 37. Akisaka T, Yoshida H, Inoue S, Shim izu K. Organization of cytoskeletal Factin, G-actin, and gelsolin in t he adhesion structures in cultured osteoclast. J Bone Miner Res. 2001; 16(7):1248-55. 38. Lehto VP, Hovi T, Vartio T, Badl ey RA and Virtanen I. Reorganization of cytoskeletal and contractile elem ents during transition of human monocytes into adherent macrophages. 1982. Lab. Invest. 47: 391-199. 39. Pfaff M, Jurdic P. Podosomes in os teoclast-like cells: structural analysis and cooperative roles of pa xillin, proline-rich ty rosine kinase 2 (Pyk2) and integrin alphaVbeta3. J Ce ll Sci. 2001; 114:2775-2786. 40. Moreau V, Tatin F, Va ron C, and Genot E. Ac tin can reorganize into podosomes in aortic endothelail cells, a process controlled by Cdc42 and RhoA. Mol Cell Biol. 2003; 23:6809-6822. 41. Tarone G, Cirillo D, Giancotti FG, Comoglio PM, and Marchisio PC. Rous sarcoma virus-transformed fibroblas ts adhere primarily at discrete protrusions of the ventral membrane called podosomes. Exp Cell Res. 1985; 159:141-157. 42. McNiven MA, Baldassarre M, Buccione R. The role of dynamin in the assembly and function of podosomes and invadopodia. Front. Biosci. 2004; 9:1944-1953. 43. Jurdic P, Saltel F, Chabadel A, Destaing O. Podosome and sealing zone: Specificity of the osteoclast model. Eur J Cell Biol. 2006; 85(3-4):195202.

PAGE 142

131 44. Chellaiah M, Fitzgerald C, Alvarez U, Hruska K. c-Src is required for stimulation of gelsolin-associated phos phatidylinositol 3-kinase. J Biol Chem. 1998; 273:11908-11916. 45. Coue M, Brenner SL, Spector I, Ko rn ED. Inhibition of actin polymerization by latrunculin A. FEBS letters. 1987; 213:316-318. 46. Yarmola EG, Somasundaram T, Bori ng TA, Spector I, Bubb MR. Actinlatrunculin A structure and function. J Biol Chem. 2000; 275(36):2812028127. 47. Burns S, Thrasher AJ, Blundell MP, Machesky L, Jones GE. Configuration of human dendr itic cell cytoskeleton by Rho GTPases, the WAS protein, and differentiati on. Blood. 2001; 98:1142-1149. 48. Linder S, Aepfelbacher M. Podosomes: adhesion hot-spots of invasive cells. Trends Cell BIol. 2003; 13:376-385. 49. Marchisio PC, DUrso N, Comoglio PM, Giancotti FG, Tarone G.. Vanadate-treated baby hamst er kidney fibroblasts show cytoskeleton and adhesion patterns similar to their Rous sarcoma virus-transformed counterparts. J Cell Bioc hem. 1988; 37:151-159. 50. Vaananen HK, Karhukorpi EK, Sundq uist K, Wallmark B, Roininen I, Hentunen T, Tuukkanen J, Lakkakorpi P. Evidence for the presence of a proton pump of the vacuolar H(+)-A TPase type in the ruffled borders of osteoclasts J Cell Biol. 1990; 111:1305-1311. 51. Zuo J, Jiang J, Chen SH, Vergara S, Gong Y, Xue J, Hu ang H, Kaku M, Holliday LS. Actin Binding Activity of Subunit B of Vacuolar H(+)-ATPase Is Involved in Its Targeting to Ruffl ed Membranes of Osteoclasts. J Bone Miner Res. 2006; 21(5): 714-21. 52. McHugh KP, Hodivala-Dilke K, Z heng MH, Namba N, Lam J, Novack D, Feng X, Ross FP, Hynes RO, Te itelbaum SL. Mice lacking 3 integrins are osteosclerotic because of dysfunc tional osteoclasts. J Clin Invest. 2000; 105:433-440. 53. Hynes RO. Integrins: versatilit y, modulation, and signaling in cell adhesion. Cell. 1992; 69:11-25. 54. Duong LT, Lakkakorpi P, Nakamura I, Rodan GA. Integrins and signaling in osteoclast function. Matrix Biol. 2000; 19:97-105. 55. Chambers TJ, Fuller K, Darby JA, Pringle JAS, Horton MA, Monoclonal antibodies against osteoclasts inhibit bone resorption in vitro. J Bone Miner Res. 1986; 1:127-135.

PAGE 143

132 56. Sato M, Garsky MK, Grasser WA, Garsky VM, Murray JM, Gould RJ. Structure-activity studies of the s-echi statin inhibition of bone resorption. J Bone Miner. Res. 1994; 9:1441-1449. 57. Lakkakorpi PT, Horton MA, Helfrich MH, Karhukorpi EK, Vaananen HK. Vitronectin receptor has a role in bone resorption but does not mediate tight sealin zone attachment of ost eoclasts to the bone surface. J Cell Biol. 1991; 115:1179-1186. 58. Horton MA, Taylor ML, Arnett TR, Helfrich MH. Arg-Gly-Asp (RGD) peptides and the anti-vitronectin recept or antibody 23C6 inhibit dentine resorption and cell spreading by osteoc lasts. Exp Cell Res. 1991; 195:368-375. 59. Masarachia P, Yamamoto M, Leu C-T, Rodan G, Duong LT. Histomorphometric evidence for echistat in inhibition of bone resorption in mice with secondary hyperparathyroidis m. Endocrinology. 1998; 139: 1401-1410. 60. Nakamura I, Pilkington MF, Lakkakorp i PT, Lipfert L, Sims SM, Dixon SJ, Rodan GA, Duong LT. Role of v 3 integrin in osteoclast migration and formation of the sealing zone. J Cell Sci. 1999; 112:3985-3993. 61. Masarachia P, Yamamoto M, Rodan GA Duong LT. Co-localization of the vitronectin receptor v3 and echistatin in osteoclasts during bone resorption. J Bone Miner Res. 1995; 10(Suppl 1): S164. 62. Helfrich MH. Osteoclast diseases and dental abnormalitie s. Archives or Oral Biology. 2005; 50:115-122. 63. Balemans W, Van Wesenbeeck L, Van Hul W. A clinical and molecular overview of human osteopetroses. Calcif Tissue Int. 2005; 77:263-274. 64. Alper SL. Genetic disease of acid -base transporters. Annu Rev Physiol. 2002; 64:899-923. 65. Frattini A, Orchard PJ, Sobacchi C, Giliani S, Abinun M, Mattsson JP, Keeling DJ, Andersson A-K, Wallbr andt P, Zecca L, Notarangelo LD, Vezzoni P, Villa A. Natu re Genetics. 2000; 25:343-346. 66. Susani L, Pangrazio A, Sobacchi C, Taranta A, Mortier G, Savarirayan R, Villa A, Orchard P, Vezzoni P, Albertini A, Frattini A, Pagani F. TCIFG1dependent recessive osteopetrosis: mutation analysis, functional identification of the splicing defects and in vitro rescue by U1 snRNA. Hum Mutat. 2004; 24(3):225-35.

PAGE 144

133 67. Kornak U, Kasper D, Bosl MR, Kaiser E, Schwei zer M, Schulz A, Friedrich W, Delling G, Jentsch TJ. Loss of the ClC-7 chloride channel leads to osteopetrosis in mice and man. Cell. 2001; 104(2):205-15. 68. Waguespack SG, Koller DL, White KE, Fishburn T, Carn G, Buckwalter KA, Johnson M, Kocisko M, Evans WE, Foroud T, Econs MJ. Chloride channel 7 (ClCN7) gene mutati ons and autosomal dominant osteopetrosis, type II. J Bone Miner Res. 2003; 18(8):1513-1518. 69. Cleiren E, Benichou O, Van Hul E, Gram J, Boll ersley J, Singer FR, Beaverson K, Aledo A, Whyte MP, Yoneyama T, deVernejoul MC, Van Hul W. Albers-schonberg disease ( autosomal dominant osteopetrosis, type II) results from mutations in the ClCN7 chloride channel gene. Hum Mol Genet. 2001; 10(25):2861-7. 70. Henriksen K, Gram J, Hoegh-Andersen P, Jemtland R, Ueland T, Dziegiel MH, Schaller S, Bollerslev J, Karsdal MA. Osteoclasts from patients with autosomal dominant osteopetrosis type I caused by a T253I mutation in low-density lipoprotein receptor-related protein 5 are normal in vitro, but have decreased resorptive capacity in vivo. Am J Pathol. 2005; 167(5):1341-8. 71. Boyden LM, Mao J, Belsky J, Mitzner L, Farhi A, Mitnick MA, Wu D, Insogna K, Lifton RP. High bone density due to a mutation in LDLreceptor-related protein 5. N Engl J Med 2002; 346:1513. 72. Little RD, Carulli JP, Del Mastro RG, Dupuis J, Osborne M, Folz C, Manning SP, Swain PM, Zhao SC, Eust ace B, Lappe MM, Spitzer L, Zweier S, Braunschweiger K, Benchekro un Y, Hu X, Adair R, Chee L, FitzGerald MG, Tulig C, Caruso A, Tzellas N, Bawa A, Franklin B, McGuire S, Nogues X, Gong G, All en KM, Anisowicz A, Morales AJ, Lomedico PT, Recker SM, Van Eerdewegh P, Recker RR, Johnson ML. A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass tr ait. Am J Hum Genet. 2002; 70:1119 73. Kiviranta R, Morko J, Alatalo SL, NicAmhlaoibh R, Risteli J, LaitalaLeinonen T, Vuorio E. Impaired bone resorption in cathepsin K-deficient mice is partially compensated for by enhanced osteoclastogenesis and increased expression of other proteases via an increased RANKL/OPG ratio. Bone. 2005; 36(1):159-172. 74. Li CY, Jepsen KJ, Majeska RJ, Zhang J, Ni R, Gelb BD, Schaffler MB. Mice lacking cathepsin K maintain bone remodeling but develop bone fragility despite high bone mass. J B one Miner Res. 2006; 21(6):865-875.

PAGE 145

134 75. Ho N, Punturieri A, Wilkin D, Szabo J, Johnson M, Whaley J, Davis J, Clark A, Weiss S, Francomano C. Mutations of CTSK result in pycnodysostosis via a reduction in cathepsin K protein. J Bone Miner res. 1999; 14(10):1649-1653. 76. Sly WS, Hewett-Emmett D, Whyte MP Yu Y-SL, Tashian RE. Carbonic anhydrase II deficiency identified as t he primary defect in the autosomal recessive syndrome of osteopetrosis with renal tubular acidosis and cerebral calcification. Proc Natl Acad Sci USA. 1983; 80:2752-2756. 77. Helfrich MH. Osteoclast diseases Microsc Res Tech. 2003; 61(6):51432. 78. Layfield R, Hocking LJ. SQSTM1 and pagets disease of bone. Calcif Tissue Int. 2004; 75(5):347-57. 79. Hocking LJ, Lucas GJ, Daroszweska A, Mangion J, Olavesen M, Cundy T, Nicholson GC, Ward L, Bennett ST, Wu yts W, Van Hul W, Ralston SH. Domain-specific mutations in sequestosome 1 (SQSTM1) cause familial and sporadic pagets disease. Hu m Mol Genet. 2002; 11(22):2735-9. 80. Hughes AE, Ralston SH, Marken J, Bell C, MacPherson H, Wallace RG, van Hul W, Whyte MP, Nakatsuka K, Hovy L, Anderson DM. Mutations in TNFRSF11A, affecting the signal peptide of RANK, cause familial expansile osteolysis. Nat Genet. 2000; 24:45-48. 81. Wuyts W, Van Wesenbeeck L, Morale s-Piga A, Ralston S, Hocking L, Vanhoenacker F, Westhovens R, Verb ruggen L, Anderson D, Hughes A, Van Hul W. Van Wesenbeeck L, Morales-Pi ga A. Evaluation of the role of RANK and OPG genes in Pagets dis ease of bone. Bone. 2001; 28:104107. 82. Hofbauer LC, Huefelder AE. The role of receptor activator of nuclear factor-kB ligand and osteoprotegerin in the pathogenesis and treatment of metabolic bone diseases. J Clin Endocrinol. 2000; 85:2355-2363. 83. Dickson GR, Shirodria PV, Kanis JA Beneton MN, Carr KE, Mollan RA. Familial expansile osteolysis: a morphological, histomorphometric and serological study. Bone. 1991; 12(5):331-8. 84. Walsh NC, Crotti TN, Goldring SR, Gr avallese EM. Rheumatic diseases: the effects of inflammation on bone. Immunol Rev. 2005; 208:228-51. 85. Boyce BF, Li P, Yao Z, Zhang Q, Badell IR, Schwarz EF, OKeefe RJ, Xing L. TNF-alpha and pathologic bone resorption. Keio J Med. 2005; 54(3): 127-31.

PAGE 146

135 86. Takayanagi H. Inflammatory bone destruction and osteoimmunology. J Periodont Res. 2005; 40:287-293. 87. Harada S-I, Rodan GA. Control of os teoblast function and regulation of bone mass. Nature. 2003; 423:349-355. 88. Cosman F. The prevention and treatm ent of osteoporosis: a review. Med Gen Med. 2005; 7(2):73. 89. Delaney MF. Strategies for the pr evention and treatment of osteoporosis during early menopause. Am. J. Obstet. Gynecol. 2006; 194 (2supplement):S12-22. 90. Rusoff LL. Calcium osteoporosis and blood pressure. J Dairy Sci. 1987; 20(2):407-13. 91. Hobar C. Osteoporosis and Calcium. eMedicine.com, Inc. http://www.emedicinehealth.com 2005; accessed 4/2006. 92. Reginster JY, Sarlet N. T he treatment of severe menopausal osteoporosis: a review of current and emerging ther apeutic options. Treat Endocrinol. 2006; 5(1):15-23. 93. Handy RC, Chesnut CH 3rd, Gass MC, Holick MF, Leib ES, Lewiecki ME, Maricic M, Watts NB. Review of treatment modalities for postmenopausal osteoporosis. South Med J. 2005; 98(10):1000-14. 94. Rosenberg LU, Magnusson C, Lindstr om E, Wedren S, Hall P, Dickman PW. Menopausal hormone t herapy and other breast cancer risk factors in relation to the risk of different histol ogical subtypes of breast cancer: a case-control study. Breast Cancer Res. 2006; 8(1):R11. 95. Wu O. Postmenopausal hormone replacement therapy and venous thormboembolism. Gend Med. 2005; 2 Suppl A:S18-27. 96. Rogers MJ. New insights into the molecular mechanism of action of bisphosphonates. Curr Pharm Des. 2003; 9(32):2643-2658. 97. Palomo L. Bissada N, Liu J. Bisphosphanate therapy for bone loss in patients with osteoporosis and periodontal disease: clinical perspectives and review of literatur e. Quitessence Int. 2006; 37(2):103-107. 98. Luckman SP, Hughes DE, Coxon FP, Graham R, Russell G, Rogers MJ. Nitrogen-containing bisphosp honates inhibit the mevalonate pathway and prevent post-translational prenylation of GTP-binding proteins, including Ras. J Bone Miner Re s. 1998; 13(4):581-9.

PAGE 147

136 99. Tanvetayanon T, Stiff PJ. Management of the adverse effects associated with intravenous bisphosphonates. Ann Oncol. 2006; 17(6):897-907. 100. Lanza FL. Gastrointestinal adverse effects of bisphosphonates: etiology, incidence and prevention. Treat Endocrinol. 2002; 1(1):37-43. 101. Badros A, Weikel D, Salama A, Goloubeva O, Sc hneider A, Rapoport A, Fenton R, Gahres N, Sausvi lle E, Ord R, Meiller T. Osteonecrosis of the jaw in multiple myeloma patients: clin ical features and risk factors. J Clin Oncol. 2006; 24(6):945-952. 102. Farrugia MC, Summerlin DJ, Krow iak E, Huntley T, Freeman S, Borrowdale R, Tomich C. Osteonec rosis of the mandible or maxilla associated with the use of new generation bisphosphonates. Laryngoscope. 2006; 116(1):115-120. 103. Melo MD, Obeid G. Osteonecrosis of the jaws in patients with a history of receiving bisphosphonate therapy: st rategies for prevention and early recognition. J Am Dent Assoc. 2005; 136(12):1675-81. 104. Greenblatt D. Treatment of postmenopausal osteoporosis. Pharmacotherapy. 2005; 25(4), 574-584. 105. Mahakala A, Thoutreddy S, Kleerekoper M. Prev ention and treatment of postmenopausal osteoporosis. Treat Endocrinol. 2003; 2(5): 331-345. 106. Gennari C, Agnusdei D. Calcitonins and osteoporosis. Br J Clin Pract. 1994; 48(4):196-200. 107. Wada S, Yasuda S. Appropriate clinical usage of calcitonin escape phenomenon and intermittent vs daily admi nistration of calcitonin. Clin Calcium. 2001; 11(9):1169-1175. 108. St-Marie CG, Schwartz SL, Hossain A, Desaiah D. Gaich GA. Effect of teriparatide on bone mineral densit y when given to postmenopausal women receiving HRT. J Bone Mi ner Res. 2006; 21(2):283-291. 109. Holick MF. PTH(1-34): a novel anabolic drug fo r treatment of osteoporosis. South Med J. 2005; 98(11):1114-1117. 110. Bilezikian JP. Anabolic therapy fo r osteoporosis. Int J Fertil Womens Med. 2005; 50(2):53-60.

PAGE 148

137 111. Brixen KT, Christensen PM, Ejerst ed C, Langdahl BL. Teriparatide (Biosynthetic human parathyroid horm one 1-34): a new paradigm in the treatment of osteoporosis. Basic Clin Pharmacol Toxicol. 2004; 94(6):260-70. 112. Burlet N, Reginster J-Y. Strontium ranelate: the fi rst dual acting treatment for postmenopausal osteoporosis. Clin Orthopaed Rel Res. 2006; 443, 55-60 113. Kocher MS, Kasser JR. Osteopetro sis. Am J Orthop. 2003; 32(5):222228. 114. Ogbureke KU, Zhao Q, Li YP. Hu man osteopetroses and the osteoclast V-H+-ATPase enzyme system. Front Biosci. 2005; 10:2940-2954. 115. Coccia PF, Krivit W, Cervenka J, Clawson C, Kersey JH, Kim TH, Nesbit ME, Ramsay NK, Warkentin PI, Teit elbaum SL, Kahn AJ, Brown DM. Successful bone-marrow transplantat ion for infantile malignant osteopetrosis. N Engl J Med. 1980; 302(13):701-708. 116. Mogi M, Otogoto J, Ota N, Togari A. Different ial expression of RANKL and osteoprotegerin in gingival cr evicular fluid of patients with periodontitis. J Dent Re s. 2004; 83(2):166-9. 117. Taubman MA, Valverde P, Han X, Kawai T. Immune response: the key to bone resorption in periodontal diseas e. J Periodontol. 2005; 76(11 Suppl):2033-41. 118. Crotti T, Smith MD, Hirsch R, Soukoulis S, We edon H, Capone M, Ahern MJ, Haynes D. Receptor activator NF kappaB ligand (RANKL) and osteoprotegerin (OPG) prot ein expression in peri odontitis. J Periodontol Res. 2003; 38(4):380-7. 119. Talic NF, Evans C, Zaki AM. Inhi bition of orthodontically induced root resorption with echistatin, an RGD-c ontaining peptide. Am J Orthod Dentofac Orthop. 2006; 129(2):252-60. 120. Al-Qawasami RA, Hartsfield JK Jr, Ev erett ET, Flury L, Liu L, Foroud TM, Macri JV, Roberts WE. Genetic predisp osition to external apical root resorption. Am J Orthod Dentof ac Orthop. 2003; 123(3):242-52. 121. Low E, Zoellner H, Kharbanda OP, Darendeliler MA Expression of mRNA for osteoprotegerin and receptor acti vator of nuclear factor kappa beta ligand (RANKL) during root resorption induced by the ap plication of heavy orthodontic forces on rat molars. Am J Orthod Dentofac Orthop. 2005; 128(4):497-503.

PAGE 149

138 122. Jager A, Zhang D, Kawarizadeh A, Tolba R, Braumann B, Lossdorfer S, Gotz W. Soluble cytokine receptor treatment in experimental orthodontic tooth movement in the rat. Eur J Orthod. 2005; 27(1):1-11. 123. Dolce C, Vakani A, Ar cher L, Morris-Wiman JA, Ho lliday LS. Effects of echistatin and an RGD peptide on orthod ontic tooth movement. J Dent Res. 2003; 82(9):682-6. 124. Holliday LS, Vakani A, Archer L, Dolce C. Effects of matrix metalloproteinase inhibitors on bone resorption and orthodontic tooth movement. J Dent Res. 2003; 82(9):687-91. 125. Kanzaki H, Chiba M, Takahashi I, Ha ruyama N, Nishimura M, Mitani H. Local OPG gene transfer to periodontal tissue inhibits orthodontic tooth movement. J Dent Res. 2004; 83(12):920-5. 126. Yoshimatsu M, Shibata Y, Kitaura H, Chang X, Mo riishi T, Hashimoto F, Yoshida N, Yamaguchi A. Experim ental model of tooth movement by orthodontic forces in mice and its application to tumor necrosis factor receptor-deficient mice. J Bone Miner Metab. 2006; 24(1):20-7. 127. Sasaki T. Differentiation and func tions of osteoclast s and odontoclasts in mineralizerd tissue resorption. Micr osc Res Tech. 2003; 61(6):483-95. 128. Machesky LM, Atkinson SJ, Ampe C, Vandekerckhove J, Pollard TD. Purification of a cortical complex containing two unconventional actins from Acanthamoeba by affinity chromatography on profilin-agarose. J Cell Biol. 1994; 127:107-115. 129. Olazabal IM and Machesky LM. Abp1p and cortactin, new hand-holds for actin. J Cell Biol 2001; 154(4):679-682. 130. Welch MD, Iwamatsu A, Mitchison TJ Actin polymerization is induced by Arp2/3 protein complex at surface of Listeria monocytogenes. Nature. 1997; 285:265-269. 131. Machesky LM and Gould KL The arp2/3 complex: a multifunctional actin organizer. Curr Opin in Cell Biol. 1999; 11:117-121. 132. Winter D, Podtelejni kov AV, Mann M, Li R. The complex containing actinrelated proteins Arp2 and Arp3 is requi red for the motility and integrity of actin patches. Curr Biol. 1997; 7:519-529. 133. Welch MD. The world according to Arp: regulation of actin nucleation by the Arp2/3 complex. Trends in Cell Biology. 1999; 9:423-427.

PAGE 150

139 134. Mullins RD, Heuser JA, Pollard TD. The interaction of Arp2/3 complex with actin-nucleation, high affinity pointed end capping, and formation of branching networks of fila ments. Proc Natl Acad Sci USA. 1998; 95:6181-6186. 135. Uruno T, Liu J, Zhang P, Fan Y, Egile C, Li R, Mueller SC, Zhan X. Activation of Arp2/3 comp lex-mediated actin polymer ization by cortactin. Nat Cell Biol. 2001; 3(3):259-266. 136. Schafer DA, Schroer TA. Actin-rela ted proteins. Annu Rev Cell Dev. Biol. 1999; 15:341-363. 137. Mullins RD, Pollard TD. Structure and function of the Arp2/3 complex. Curr Opin in Struct Biol. 1999; 9:244-249. 138. Robinson RC, Turbedsky K, Kaiser DA, Marchand J-B, Higgs HN, Choe S, Pollard TD. Crystal stru cture of Arp2/3 co mplex. Science. 2001; 294: 1679-1684. 139. Higgs HN, Pollard TD. Regulation of actin filament network formation through Arp2/3 complex: activation by a diverse array of proteins. Annu Rev Biochem. 2001; 70:649-676. 140. Mullins RD, Stafford WF, Pollard TD. Structure, subunit topology and actin-binding activity of the Arp2/3 complex from Acanthamoeba. J Cell Biol. 1997; 136(2):331-343. 141. Machesky LM, Reeves E, Wientjes F, Mattheyse FJ, Grogan A, Totty NF, Burlingame AL, Hsuan JJ, Segal AW. Mammalian actin-related protein 2/3 complex localizes to regions of lamellipodial protrusion and is composed of evolutionarily conserved proteins. Biochem J. 1997; 328: 105-112. 142. Jay B, Berge-Lefranc JL, Massacrier A, Roessler E, Wa llis D, Muenke M, Gastaldi M, Taviaux S, Cau P, Bert a P. ARP3beta, the gene encoding a new human actin-related protein, is alternatively spliced and predominantly expressed in brain neuronal cells. Eur J Biochem. 2000; 267(10):2921-2928. 143. Suetsugu S, Miki H, Ta kenawa T. Spatial and temporal regulation of actin polymerization for cytoskeleton fo rmation through Arp2/3 complex and wasp/wave proteins. Cell Motilit y and Cytoskeleton. 2002; 51:113-122. 144. Dayel MJ, Holleran EA, Mullin s RD. Arp2/3 co mplex requires hydrolyzable ATP for nucleation of new actin filaments. PNAS. 2001; 98(26):14871-14876.

PAGE 151

140 145. Condeelis J. How is ac tin polymerization nucleated in vivo? Trends in Cell Biology. 2001; 11(7):288-293. 146. Cooper JA, Schafer DA. Control of actin assembly and disassembly at filament ends. Curr Opin Cell Biol. 2000; 12:97-103. 147. May RC, Caron E, Hall A, Machesky LM. Involvement of the Arp2/3 complex in phagocytosis mediated by Fc R or CR3. Nat Cell Biol. 2000; 2:246-248. 148. Moreau V, Galan J-M, Devilliers G, Haguenauer-Tsapis R, Winsor B. The yeast actin-related protein Arp2p is r equired for the internalization step of endocytosis. Mol Cell Biol. 1997; 8:1361-1375. 149. Skoble J, Auerbuch V, Goley ED, Welc h MD, Portnoy DA. Pivotal role of VASP in Arp2/3 comple x-mediated actin nucleation, actin branchformation, and Listeria monocytogenes motility. J Cell Biol. 2001; 155(1): 89-100. 150. Zalevsky J, Grigorova I, Mullins RD. Activation of the Arp2/3 complex by Listeria ActA protein. J Biol Chem. 2001; 276(5):3468-3475. 151. Bear JE, Krause M, Gertler FB. Regu lating cellular actin assembly. Curr Opin Cell Biol. 2001; 13:158-166. 152. Cudmore S, Cossart P, Griffith s G, Way M. Actin-based motility of vaccinia virus. Natu re. 1995; 378:636-638. 153. Taunton J, Rowning BA, Coughlin ML, Wu M, Moon RT, Mitchison TJ, Larabell CA. Actin-dependent propul sion of endosomes and lysosomes by recruitment of N-WASP. J Ce ll Biol. 2000; 148(3):519-530. 154. Loisel TP, Boujemaa R, P antaloni D, Carlier MF. Reconstitution of actin based motility of Listeria and Shigella using pure proteins. Nature. 1999; 40:613-616. 155. Welch MD, Mitchison TJ. Purificati on and assay of the platelet Arp2/3 complex. Methods En zymol. 1998; 298:52-61. 156. Cooper JA. Effects of cytochalasin and phalloidin on actin. J Cell Biol. 1987; 105:1473-1478. 157. MacLean-Fletcher SD, Pollard TD. Mechanism of action of cytochalasin B on actin. Cell. 1980; 20:329-341.

PAGE 152

141 158. Ziwarl A, Xie MW, Xing Y, Lin L, Zhang PF, Zou W, Saxe JP, Huang J. Novel function of the PI metabolic pathway discovered by a chemical genomics screen by wortmannin. Proc Natl Acad Sci USA. 2003; 100(6):3345-3350. 159. Sato M, Sardana MK, Grasser WA, Garsky VM, Murray JM, Gould RJ. Echistatin is a potent inhi bitor of bone resorption in culture. J Cell Biol. 1990; 111(4):1713-23. 160. Pollard TD, Blanchoin L, Mullins RD. Actin dynami cs. J Cell Sci. 2001; 114:3-4. 161. Blanchoin L, Amann KJ, Higgs HN, Marchand JB, Kaiser DA, Pollard TD Direct observation of dendritic actin f ilament networks nucleated by Arp2/3 complex and WASP/Scar proteins. Nature. 2000; 404(6781):1007-11. 162. Pollard TD, Beltzner CC. Structure and function of the Arp2/3 complex. Curr Opin Struct Bi ol. 2002;12(6):768-74. 163. Chellaiah MA, Biswas RS, Y uen D. Alvarez UM, Hruska KA. Phosphatidylinositol 3,4,5-triphosphate direct s association of Src homology 2-containing signaling prot eins with gelsolin. J Biol Chem. 2001; 276:47434-47444. 164. Korn ED. Actin polymerization and its regulation by proteins from nonmuscle cells. Physiol Rev. 1982; 62:672-737. 165. Chellaiah M, Kizer N, Silva M, Al varez U, Kwiatkowski D. Hruska KA. Gelsolin deficiency blocks podosom e assembly and produces increased bone mass and strength. J Ce ll Biol. 2000; 148:665-678. 166. Li YP, Chen W, Liang Y, Li E, St ashenko P. Atp6i-deficient mice exhibit severe osteopetrosis due to loss of osteoclast-mediated extracellular acidification. Nat Genet. 1999; 23:447-451. 167. Scimeca JC, Franchi A, Trojani C, Parrinello H, Grosgeorge J, Robert C, Jaillon O, Poirier C, G audray P, Carle GF. The gene encoding the mouse homologue of the human osteoclast-spec ific 116 k-Da V-ATPase subunit bears a deletion in osteo sclerotic (oc/oc) mutants. Bone. 2000; 26:207213. 168. Sun-Wada G-H, Wada Y, Futai M. Diverse and essential roles of mammalian vacuolar-type proton pump ATPase: toward the physiological understanding of inside ac idic compartments. Bi ochimica et Biophysica Acta. 2004; 1658:106-114.

PAGE 153

142 169. Gluck SL, Lee BS, Wang SP, Underhill D, Nemoto J, Holliday LS. Plasma membrane V-ATPases in proton-tr ansporting cells of the mammalian kidney and osteoclast Acta Physiol Scand Suppl. 1998; 643:203-212. 170. Nishi T, Forgac M. The vacuolar (H+)-ATPases--nature's most versatile proton pumps. Nat Rev Mol Cell Biol. 2002; 3:94-103. 171. Lee BS, Holliday LS, Krits I, Gluck SL. Vacuolar H+-ATPase activity and expression in mouse bone marrow cultures. J Bone Miner Res. 1999; 142127-2136. 172. Toyomura T, Oka T, Yamaguchi C, Wada Y, Futai M. Three subunit a isoforms of mouse vacuolar H(+)-ATP ase. Preferential expression of the a3 isoform during osteoclast differentia tion. J Biol Chem. 2000; 275:87608765. 173. Nakamura I, Sasaki T, Tanaka S, Tak ahashi N, Jimi E, Kurokawa T, Kita Y, Ihara S, Suda T, Fukui Y. Phosphatid ylinositol-3 kinase is involved in ruffled border formation in osteoclast s. J Cell Physiol. 1997; 172:230-239. 174. Holliday LS, Bubb MR, Jiang J, Hu rst IR, Zuo J. In teractions between vacuolar H+-ATPases and microfilaments in os teoclasts. J Bioenergentics and Biomembranes. 2005; 37(6):419-423. 175. Vitavska O, Merzendorfer H, Wieczore k H. The V-ATPase subunit C binds to polymeric F-actin as well as to monomeric G-actin and induces crosslinking of actin filaments. J Biol Chem. 2005; 280:1070-1076. 176. Feng X, Novack DV, Faccio R, OR y DS, Aya K, Boyer MI, McHugh KP, Ross FP, Teitelbaum SL. A Glanzm ann's mutation in beta 3 integrin specifically impairs osteoclast function J Clin Invest. 2001; 107:11371144. 177. Biswas RS, Baker D, Hruska KA, Chellaiah MA. Polyphosphoinositidesdependent regulation of t he osteoclast actin cytoskeleton and bone resorption. BMC Cell Biol. 2004; 5:19. 178. Teti A, Barattolo R, Grano M, Colucci S, Argent ino L, Teitelbaum SL, Hruska KA, Santacroce G, Zamboni n ZA. Podosome expression in osteoclasts: influence of high extracellu lar calcium concentration. Boll Soc Ital Biol Sper. 1989; 65:1039-1043. 179. Ramirez A, Faupel J, Goebel I, Stille r A, Beyer S, Stockle C, Hasan C, Bode U, Kornak U, Kubisch C. Identificatio n of a novel mutation in the coding region of the grey-lethal gene OSTM1 in human ma lignant infantile osteopetrosis. Hum Mu tat. 2004;23(5):471-6.

PAGE 154

143 180. Nakamura, I., Takahashi, N., Udagaw a, N., Moriyama, Y., Kurokawa, T., Jimi, E., Sasaki, T., and Suda, T. Lack of vacuolar proton ATPase association with the cytoskeleton in os teoclasts of osteosclerotic (oc/oc) mice. FEBS Lett. 1997; 401:207-212. 181. Rajapuprohitam V, Chal houb N, Benachenhou N, Ne ff L, Baron R, Vacher J. The mouse osteopetrotic grey-l ethal mutation induces a defect in osteoclast maturation/function. Bone. 2001; 28:513-523. 182. Chalhoub N, Benac henhou N, Rajapurohitam V, Pata M, Ferron M, Frattini A, Villa A, Vacher J. Grey-lethal mutation induces severe malignant autosomal recesive osteopetrosis in mouse and human. Nat Med. 2003; 9:399-406. 183. Chen SH, Bubb MR, Yarmola EG, Zuo J, Jiang J, Lee BS, Lu M, Gluck SL, Hurst IR, Holliday LS. Vacuolar H+-ATPase binding to microfilaments: regulation in response to phosphatid ylinositol 3-kinase activity and detailed characterization of the actinbinding site in subunit B. J Biol Chem. 2004; 279(9):7988-98. 184. Hiura K, Lim SS, Little SP, Lin A, Sato M. Differentiation dependent expression of tensin and cortactin in chicken osteoclasts. Cell Motil Cytoskeleton. 1995; 30:272-284. 185. Weed SA, Parsons JT. Cortactin: coupling membrane dynamics to cortical actin assembly. Oncogene. 2001; 20:6418-6434. 186. Weaver AM, Karginov AV, Kinley AW, Weed SA, Li Y, Parsons JT, Cooper JA. Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr.Biol. 2001; 11:370-374. 187. Didry D, Carlier M, Pantaloni D. Synergy between profilin and actin depolymerizing factor (ADF/c ofilin) in enhancing actin filament turnover. J Biol Chem. 1999; 273:25602-25611. 188. Weaver AM, Heuser JE, Karginov AV, Lee W, Parsons JT, Cooper JA. Interactions of cortactin and N-WASp with Arp2/3 complex. Curr Biol. 2002; 12:1270-1278. 189. Comerford KM, Lawrence DW, Synnestv edt K, Levi BP, Colgan SP. Role of vasodilator-stimulated phosphoprotein in PKA-induced changes in endothelial junctional permeability. FASEB Journal. 2002; 16:538-585. 190. Harbeck B, Huttelmaier S, Schlut er K, Jockusch BM, Illenberger S. Phosphorylation of the vasodilator-sti mulated phosphoprotein regulates its interaction with actin. J Biol Chem. 2000; 275(40):30817-30825.

PAGE 155

144 191. Suzuki H, Nakamura I, Takahashi N, Ikuhara T, Matsuzaki K, Isogai Y, Hori M, Suda T. Calcitonin-induc ed changes in the cytoskeleton are mediated by a signal pathway asso ciated with protein kinase A in osteoclasts. Endocri nol. 1996; 137(11):4685-90. 192. Samura A, Wada SA, Suda S, Iitaka M, Katayama S. Calcitonin receptor regulation and responsiveness to calciton in in human osteoclast-like cells prepared in vitro using receptor acti vator of nuclear factor-kB ligand and macrophage colony stimulating fact or. Endocrinology. 2000; 141(10): 3774-3782. 193. Weed SA, Karginov AV, Schafer DA, Weaver Am, Kinley AW, Cooper JA, Parsons JT. Cortactin localization to sites of actin assembly in lamellipodia requires interactions wit h F-actin and the Ar p2/3 complex. J Cell Biol. 2000; 151(1):29-40. 194. Soriano P, Montgomery C, Geske R, Bradley A. Targeted disruption of the c-src proto-onc ogene leads to osteopetrosis in mice. Cell. 1991; 64:693-702. 195. Hou P, Estrada L, Kinley AW, Parsons JT, Vojtek AB, Gorski JL. Fgd1, the Cdc42 GEF responsible for Faciogenit al Dysplasia, directly interacts with cortactin and mAbp1 to modulate cell shape. Hum Mol Genet. 2003; 12:1981-1993. 196. Kim K, Hou P, Gorski JL, Cooper JA. Effect of Fgd1 on cortactin in Arp2/3 complex-mediated actin assembly. Bi ochemistry. 2004; 43:2422-2427. 197. Orrico A, Galli L, Bu oni S, Hayek G, Luchetti A, Lorenzini S, Zappella M, Pomponi MG, Sorrentino V. Attention-deficit/hyperactivity disorder (ADHD) and variable clinical expre ssion of Aarskog-Scott syndrome due to a novel FGD1 gene mutation (R408Q). Am J Med Genet A. 2005; 135:99-102. 198. Pasteris NG, Gorski JL. An intragenic TaqI polymorphism in the faciogenital dysplasia (FGD1) locu s, the gene responsible for Aarskog syndrome. Hum Gene t. 1995; 96(4):494. 199. Abu-Amer Y, Ross FP, Schlesinger P, Tondravi MM, Teitelbaum SL. Substrate recognition by osteoclast pr ecursors induced s-crc/microtubule association. J Cell Biol. 1997; 137:247-258. 200. Kaksonen M, Peng HB, Rauvala H. Association of cortactin with dynamic actin in lamellipodia and on endosomal vesicles. J cell Sci. 2000; 113:4421-4426.

PAGE 156

145 201. Bear JE, Svitkina TM, Krause M, Schafer DA, Loureiro JJ, Strasser GA, Maly IV, Chaga OY, Cooper JA, Bori sy GG, Gertler FB. Antagonism between Ena/VASP prot eins and actin filament capping regulates fibroblast motility. Cell. 2002; 109:509-521. 202. Kang F, Laine RO, Bubb MR, Southwick FS, Purich DL. Profilin interacts with the Gly-Pro-Pro-ProPro-Pro sequences of vasodilator-stimulated phosphoprotein (VASP): implications fo r actin-based Listeria motility. Biochemistry. 1997; 36:8384-8392. 203. Krause M, Dent EW, Bear JE, Loureiro JJ, Gertler FB. Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu.Rev.Cell Dev.Biol. 2003; 19:541-564. 204. Daly RJ. Cortactin signalling and dynamic actin networks. Biochem.J. 2004; 382:13-25. 205. Reinhard M, Halbrugge M, Scheer U, Wiegand C, Jo ckusch BM, Walter U. The 46/50 kDa phosphoprotei n VASP purified from hu man platelets is a novel protein associated with actin fila ments and focal contacts. EMBO J. 1992; 11:2063-2070. 206. Kwiatkowski AV, Gertler FB, Lourei ro JJ. Function and regulation of ENA/VASP proteins. Trends Ce ll Biol. 2003; 13(7):386-92. 207. Howe AK, Hogan BP, Juliano Rl. Re gulation of vasodilator-stimulated phosphoprotein phosphorylation and intera ction with Able by protein kinase A and cell adhesion. J. Biol Chem. 2002; 277( 41):38121-38126. 208. Gertler FB, Niebuhr K, Reinhard M, Wehland J, Soriano P. Mena, a relative of VASP and Drosophila Enabled is implicated in the control of microfilament dynamics. Cell. 1996; 87:227-239. 209. Bachmann C, Fischer L, Walter U, Reinhard M. The EVH2 domain of the vasodilator-stimulated phosphoprotein m ediates tetrameriization, F-actin binding, and actin bundl e formation. J Biol C hem. 1999; 274(33):2354957. 210. Sechi AS, Wehland J. ENA/VASP pr oteins: multifuncti onal regulators of actin cytoskeleton dynamics. Front Biosci. 2004; 9:1294-1310. 211. Lambrechts A. Kwiatkowski AV, Lani er LM, Bear JE, Vandekerckhove J, Ampe C, Gertler FB. cAMP-dependent protein kinase phosphorylation of EVL, a Mena/VASP relative, regulates its interaction with actin and SH3 domains. J Biol Chem. 2000; 46(17):36143-36151.

PAGE 157

146 212. Haffner C, Jarchau T, Reinhard M, Hoppe J, Lohmann SM, Walter U. Molecular cloning, structural analysis and functional expression of the proline-rich focal adhesion and micr ofilament-associated protein VASP. EMBO J. 1995; 14:19-27. 213. Massberg S, Guner S, Konrad I, Ar guinzonis MIG, Eigenthaler M, Hemler K, Kersting J, Schulz C, Muller I, Be sta F, Nieswandt B, Heinzmann U, Walter U, Gawaz M. E nhanced in vivo platelet adhesion in vasodilatorstimulated phosphoprotein ( VASP)-deficient mice. Blood. 2004; 103(1): 136-42. 214. Hauser W, Knobeloch KP, Eigenthaler M, Gambar yan S, Krenn V, Geiger J, Glazova M, Rohde E, Horak I, Wa lter U, Zimmer M. Megakaryocyte hyperplasia and enhanced agonist-indu ced platelet activation in vasodilator-stimulated phosphoprotein k nockout mice. Proc Natl Acad Sci USA. 1999; 96(14):8120-25. 215. Azodi 99Aszodi A, Pfeifer A, Ahmad M, Glauner M, Zhou XH, Ny L, Andersson KE, Kehrel B, Offermanns S, Fassler R. The vasodilatorstimulated phosphoprotein (VASP) is involved in cGMPand cAMPmediated inhibition of agonist-induced platelet aggregation, but is dispensable for smooth muscle function. EMBO J. 1999; 18(1):37-48. 216. Cramer LP. ENA/VASP: Solving a cell motility paradox. Curr Biol. 2002;12(12):417-419. 217. Barzik M, Kotova TI, Higgs HN, Hazelwood L, Hanein D. Gertler FB, Schafer DA. Ena/VASP proteins enhanc e actin polymerization in the presence of barded end capping proteins J Biol Chem. 2005; 280(31): 28653-28662. 218. Vitavska O, Wieczorek H, Merzendorfer H. A novel role for subunit C in mediating binding of the H+-V-ATPase to the actin cytoskeleton. J Biol Chem. 2003; 278(20):18499-505. 219. Chellaiah MA. Regul ation of actin ring forma tion by rho GTPases in osteoclasts. J Biol Chem. 2005; 280(38):32930-43. 220. Hu Y, Nyman J, Muho nen P, Vaananen HK, Laitala-L einonen T. Inhibition of the osteoclast V-ATPase by sma ll interfering RNAs. FEBS Lett. 2005; 579(22):4937-42. 221. Buscaglia CA, Penesetti D, Tao M, Nussenzweig V. Characterization of an aldolase-binding site in the Wisko tt-Aldrich syndrome protein. J Biol Chem. 2006; 281(3):1324-31.

PAGE 158

147 222. Waingeh VF, Gustafs on CD, Kozliak EI, Lowe SL Knull HR, Thomasson KA. Glycolytic enzyme interacti ons with yeast and skeletal muscle Factin. Biophys J. 2006; 90(4):1371-84. 223. Lazner F, Gowen M, Pavasovic D, Kola I. Osteoporosis and osteopetrosis: two sides of the same coin. Human Molecular Genetics. 1999;8(10):1839-1846. 224. Whyte MP, Reinus WR, Podgornik MN, Mills BG. Familial expansile osteolysis (excessive RANK effect) in a 5-generation American kindred. Medicine. 2002;81(2):101-121. 225. Finley RS. Bisphosphonates in the treatment of bone metastases. Seminars in Oncology. 2002;29(1, Supplement 4):132-138. 226. Good CR, OKeefe RJ, Puzas E, Schwarz EM, Rosier RN. Immunohistochemical study of receptor activator of nuclear factor kappa-B ligand (RANK-L) in human osteolytic bone tumors. Journal of Surgical Oncology. 2002;79:174-179. 227. Lees RL, Sabharwal VK, Heersche JNM. Resorptive state and cell size influence intracellular pH regulation in rabbit osteoclasts cultured on collagen-hydroxyapatite film s. Bone. 2001;28(2):187-194. 228. Higgs HN. Formin proteins: a domain-based approach. Trends Biochem Sci. 2005; 30(6):342-53. 229. Baum B, Kunda P. Actin nucleation: spire actin nuc leator in a class of its own. Curr Biol. 2005; 15(8):R305-8. 230. Bowden ET, Barth M, Thomas D, Glazer RI, Mueller SC.An invasionrelated complex of cortactin, pa xillin and PKCmu associates with invadopodia at sites of extrac ellular matrix degradation. Oncogene. 1999; 18(31):4440-9. 231. Mizutani K, Miki H, He H, Maruta H, Takenawa T. Essential role of neural Wiskott-Aldrich syndrome protein in podosome formation and degradation of extracellular matrix in src-transfo rmed fibroblasts. Cancer Res. 2002; 62(3):669-74.

PAGE 159

148 BIOGRAPHICAL SKETCH Irene Rita Maragos Hurst is the daughter of Drs. Nicolas and Thelma Maragos, and was born and raised in t he St. Petersburg area. She was educated at Keswick Christian School and wa s president and vale dictorian of the Class of 1991. Dr. Hurst attended the University of South Florida (1991-1996) where she received degrees in both biol ogy and science education. During her time at USF, Dr. Hurst was actively involved in numerous honor and social organizations, including Kappa Delta Soro rity. In 1997, she took a leave from college to teach 7th grade math and science at McLane Middle School in Brandon, FL. The following year, Dr. Hurst enrolled at the University of Louisville College of Dentistry where s he received her Doctor of Dental Medicine degree as well as her Master of Science in oral biology. In 2001, Dr. Hurst began a joint Ph.D./residency program at the Universi ty of Florida. She completed her orthodontic training in 2006 at the University of Flori da College of Dentistry as well as her Ph.D. in biomedical scienc es through the College of Medicine.


Permanent Link: http://ufdc.ufl.edu/UFE0015240/00001

Material Information

Title: Study of the Actin-Related Protein 2/3 Complex and Osteoclast Bone Resorption
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015240:00001

Permanent Link: http://ufdc.ufl.edu/UFE0015240/00001

Material Information

Title: Study of the Actin-Related Protein 2/3 Complex and Osteoclast Bone Resorption
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0015240:00001


This item has the following downloads:


Full Text










STUDY OF THE ACTIN-RELATED PROTEIN 2/3 COMPLEX
AND OSTEOCLAST BONE RESORPTION












By

IRENE RITA MARAGOS HURST


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLOIRDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006














COPYRIGHT


Copyright 2006

By

Irene Rita Maragos Hurst














ACKNOWLEDGEMENTS

There are many individuals to whom I owe my success in this scholastic

endeavor. First, I would like to thank my parents for their constant support.

Through their parenting, I was able to understand the importance of advanced

education, and it is what propelled me to further my education. Second, I would

like to thank the faculty members that have helped me through this difficult

period. My work in research began in embryology under the guidance of

Gertrude Hinsch, Ph.D., at the University of South Florida, Tampa, FL. I

furthered my research work at the University of Louisville studying

microbiological contamination of dental unit air lines under Robert Staat, Ph.D. It

was under his guidance that I was able to obtain my MS in oral biology and made

the decision to continue my research work and obtain a Ph.D. For the last 5

years, I have had the explicit pleasure working under L. Shannon Holliday, Ph.D.,

as well as Timothy T. Wheeler, DMD, Ph.D., and Calogero Dolce, DDS, Ph.D.

Their support and guidance have been invaluable. The strength of this program,

in both clinical and basic science research, has allowed me to learn and utilize

many research techniques as well as become an independent thinker. Last, I

would like to thank my husband who has traveled from city to city to support my

endeavors. Without him, I would never have made it to this point.














TABLE OF CONTENTS

page

ACKNOWLEDGMENTS .............. ............ .......................... iii

L IS T O F T A B L E S ............................................................................................ v i

LIST OF FIGURES ......................... ......... ......... vii

A B S T R A C T .............. ...... ........... ................................... ............................ . x

CHAPTER

1 INTRODUCTION....................... ......... ................ ......... 1

Osteoclast Differentiation: RANKL Signalling.................................... 2
Hormonal Control of Bone Resorption .................. ........... 5
Mechanism of Action of Oseoclast .................................... ......... ....... 5
Sealing Zone ......................... ........... ......... 7
Podosom es ......... ............... .............. ................. .. 7
Transportation of V-ATPase to the Ruffled Membrane ...... ........................ 9
Ruffled Membrane ................... ................ ............... 10
Osteoclast Adhesion ............. .......................... 10
Osteoclasts and Disease ............ ............................... ......... 11
Treatment of Osteoporosis and Osteopetrosis.................... ............... 14
O steoclast and Dentistry ....................... .... .. ....... .. ...... ............... 19
General Purpose of Research.............................. ...... 21

2 THE ACTIN RELATED PROTEIN (ARP) 2/3 COMPLEX: AN ELEMENT
OF ACTIN RINGS ............... .. ......................... 27

Introduction ........... .... .... ......... ....... ............... 27
Materials and Methods ................ ..... ... ................ ......... .... 29
Results ............ ................................38
D iscussio n .................................................. 4 1










3 THE ARP2/3 COMPLEX: A POSSIBLE LINK IN THE TRANSLOCATION
OF V-ATPASE TO AND FROM THE RUFFLED MEMBRANE .................... 59

Introd uctio n .............. ............. .......... ..... ................ .. .......... 59
Materials and Methods ...... ..................................... ... ............ 62
Results .............. .............. .... ...... .............................. 64
D iscussio n ............................................. ...... ........... 6 6

4 THE ROLE OF CORTACTIN IN OSTEOCLASTOGENESIS ................. 77

Introduction ..................... ............ .................. ......... ..... ........... 77
Materials and Methods ........................ .......... ........ .......... 79
Results ............... ......... ........................................................... 84
D iscussio n ............................................. ...... ........... 8 5

5 THE ROLE OF VASP IN OSTEOCLASTOGENESIS .............................. 97

Introduction ............................................................................ .............. 97
Materials and Methods ........................ .......... ........ .......... 99
R e su lts ............. ..... .. ... ................................. ............... 10 3
Discussion ........................................ ........... 105

7 MODEL AND FUTURE DIRECTIONS .................. ..................... 115

The M odel and Hypothesis ............... ..... ........................................ 115
Future Directions ................ .... ........ ....................... 121
Significance of Study.................................................. 124

LIST O F R E FE R E N C E S .............................................................. ............... 127

BIO G RAPHICAL SKETCH ............................................................ ....... 148














LIST OF TABLES


Table page

2.1 PCR primers used for identification of Arp3 isoforms ................................................... 58

3.1 PCR primers used for identification of Arp2/3 related proteins................... 76















LIST OF FIGURES


Figure page

1.1 Resorbing osteoclast .............. ....... .................... ............... 22

1.2 The OPG/RANK/RANKL triad plays an important role in the bone,
im m une, and vascular system s........................................... .... .. ............... 23

1.3 Binding of the adaptor protein TRAF6 is the initial step in RANKL
signaling .......... .... ....... ........................... .................. 24

1.4 The dynamic nature of the podosomes of actin rings.............................. 25

1.5 In unactivated osteoclasts, V-ATPase is not present at the plasma
membrane but is stored in cytoplasmic vesicles; but upon activation, it is
transported via actin filaments to the ruffled membrane. .............. ........... 26

2.1 The Arp2/3 complex ......... ............................... ................. 45

2.2 Purification of the Arp2/3 complex from human platelets............. ........... 46

2.3 Upregulation of Arp2 and Arp3 during osteoclastogenesis ................... 47

2.4 Two isoforms of Arp3, Arp3 and Arp3-beta, are present in unactivated
and activated osteoclasts........................ ... ............................ 48

2.5 Arp2/3 complex is present in actin rings of osteoclasts.......................... .. 48

2.6 Arp2/3 complex is enriched relative to F-actin near the sealing zone........ 49

2.7 Arp2/3 does not co-localize with vinculin in actin rings ............. .............. 50

2.8 Treatment with chemical agents, cytochalasin B, echistatin, and
wortmannin, causes a disruption of the actin rings of osteoclasts........... 51

2.9 The Arp2/3 remains co-localized in the actin based podosomal core
regardless of actin ring disruption by wortmannin.......................... 52

2.10 Wortmannin and echistatin treatment of osteoclasts results in a decrease
in the n u m be r of actin ring s .................................................. .... .. ............... 52









2.11 siRNA 19942 but not 19944 reduces the Arp2 content of osteoclast-like
cell extract 70% after 30 hours compared with actin............................... 53

2.12 Actin rings are disrupted in Arp2 knockdown ....... ..... ...................... 54

2.13 Actin rings are disrupted in marrow osteoclasts on coverslips or on bone
slices by siRNA directed against Arp2 ............ ................................. 55

2.14 Experimental siRNA reduces the number of actin rings on coverslips by
over 95% ....................... ................. ........... ... ...... 56

2 .15 D endritic nucleation m ode l.................................................. .... .. ............... 57

3.1 The structure of V-ATPase.......................................... ......................... 70

3.2 The B1 (1-106) fusion protein of V-ATPase and the Arp2/3 complex do
not show a direct interaction by binding assay........................................ 71

3.3 The B1 (1-106) fusion protein of V-ATPase and the Arp2/3 complex do
not show a direct interaction by immunoprecipitation of B1 subunit......... 72

3.4 Cortactin is preferentially upregulated during osteoclastogenesis as
identified by PCR ............. ...................... ........... ............... 73

3.5 Vasodilator stimulated phosphoprotein is identified to have a possible
interaction w ith V-ATPase......................................... ......... ... ............... 74

3.6 Immunoprecipitation experiments with the B subunit of V-ATPase
suggest a possible direct linkage between VASP and V-ATPase.............. 75

4.1 Cortactin, N-WASP, and Arp2/3 form a synergistic, ternary complex to
initiate actin polymerization ............... ........... ...... .. ............... 88

4.2 Cortactin is upregulated in response to RANKL stimulation................... 89

4.3 Cortactin co-localizes with the podosomal core proteins, actin and the
Arp2/3 com plex .......... .......... .......................... ............... 90

4.4 siRNA 120649, but not a control siRNA (120653), effectively knocks
down the cortactin content to an undetectable level of osteoclast-like cell
extract after 30 hours compared with actin ........................................... 91

4.5 Actin rings are disrupted in cortactin knockdown ...................................... 92

4.6 An siRNA known to downregulate cortactin (Ambion) effectively knocks
down the cortactin content of osteoclast-like cell extract to an
undetectable level after 30 hours compared with actin ........................... 93









4.7 Actin rings are disrupted in cortactin knockdown...................................... 94

4.8 Transformation and purification of GST-cortactin fusion protein................ 95

4.9 Immunoprecipitation experiments with GST-cortactin show a linkage
between cortactin and Arp3, VASP, N-WASP, and the E subunit of V-
ATPase ................ ............................... ............. ... ...... 96

5.1 The ENA/ASP family ................ ..... .................... 108

5.2 VASP is present in the actin rings of osteoclasts.................................. 109

5.3 VASP is phosphorylated at Serine 157 in response to calcitonin
treatment and results in the disruption of the actin ring.......................... 110

5.4 Calcitonin induces a three fold increase in phosphorylation levels of
VASP at Serine 157 ........... ...... ............... ......... ............. 111

5.5 Identification of VASP null mice from breeding of homozygous females
w ith a heterozygous m ale ................................... ........... .................. 112

5.6 Osteoclasts of mice lacking the VASP gene are able to form actin rings
and respond to calcitonin in the same fashion as control cells............... 113

5.7 Evl, a member of the ENA/VASP family, is upregulated in response to
osteoclastogenesis .......................................... .................. 114















Abstract of Dissertation Presented to the Graduate School
Of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

STUDY OF THE ACTIN-RELATED PROTEIN 2/3 COMPLEX
AND OSTEOCLAST BONE RESORPTION

By

Irene Rita Maragos Hurst

August 2006

Chair: Lexie Shannon Holliday
Major Department: Medical Sciences--Molecular Cell Biology

To resorb bone, osteoclasts form an extracellular acidic compartment

segregated by a sealing zone. This is dependent on an actin ring that is

composed of filamentous actin organized into dynamic structures called

podosomes. The molecular basis of actin rings and their association with

vacuolar H+-ATPase (V-ATPase) mediated-acidification during bone resorption

were examined.

Immunoblotting and immunocytochemical studies showed for the first

time that the actin-related protein (Arp) 2/3 complex is upregulated during

osteoclastogenesis and expressed in actin rings. Knockdowns of Arp2, a

component of the Arp2/3 complex, with short interfering RNAs (siRNAs) revealed

that it is essential for actin ring formation. No direct associations between V-

ATPase and Arp2/3 complex were detected. Two proteins involved in regulating

Arp2/3 mediated actin polymerization were identified in in vitro binding studies as
x









interacting with V-ATPase: cortactin and vasodilator-stimulated phosphoprotein

(VASP). Cortactin binds and activates Arp2/3 complex. It was upregulated

during osteoclastogenesis and localized to the cores of podosomes. siRNA

knockdowns showed that it was required for actin ring formation. Binding studies

suggest that it may interact with V-ATPase indirectly through the glycolytic

enzyme aldolase. VASP was shown to be present in actin rings and

phosphorylated in response to calcitonin, which disrupts actin rings. VASP

knockout mice did not demonstrate osteoclast or bone defects. ENA-VASP-like

protein (Evl), a protein closely related to VASP, was also expressed in

osteoclasts and may substitute for the lack of VASP. These data demonstrate

that the Arp2/3 complex and cortactin play significant roles in osteoclastic bone

resorption and may provide targets for therapeutic agents designed to limit the

activity of osteoclasts.














CHAPTER 1
INTRODUCTION

Bone remodeling is a result of the processes of bone resorption and

formation and primarily involves two types of cells (1). Osteoblasts, cells of

the mesenchymal lineage, form bone and regulate osteoclast differentiation

and activation (1). Osteoclasts, the bone resorbing cells, are derived from

hematopoietic precursors and are close relatives of macrophages (2-4).

Upon activation, the osteoclast undergoes profound reorganizations (5, 6)

and becomes polarized, forming morphologically and functionally distinct

basolateral and resorptive domains (3, 7, 8) (Figure 1.1). The bone-apposing

resorptive domain contains three primary functional structures: the sealing or

clear zone, the ruffled membrane, and integrin-mediated adhesions. The

ability of the osteoclast to resorb bone is dependent on its ability to generate

an extracellular acidic compartment between itself and the bone (7-9). This

local acidification is maintained by the presence of the sealing zone, which

forms tight contact with the bone surface (6, 9, 10). The acidic pH of this

compartment is created by vacuolar H+ATPases (V-ATPases) (8, 11), in the

ruffled membranes which are bounded by sealing zones. V-ATPases pump

protons into the extracellular space, solubilizing hydroxyapatite crystals (2),

and providing the acidic environment required for the acid cysteine









protease, Cathepsin K, which is involved in the digestion of the organic bone

matrix (2, 5, 9, 12).

Osteoclast Differentiation: RANKL Signalling

Osteoclasts differentiate from circulating hematopoietic stem cells that are

recruited to the bone to fuse and form multinucleated osteoclasts (13-16). The

osteoclast has phenotypic features that distinguish it from other members of the

macrophage/monocyte family such as the expression of tartrate-resistant acid

phosphatase (TRAP) and the calcitonin receptor and the formation of the ruffled

membrane (4, 13).

Osteoclastogenesis is dependent on two important factors, receptor

activator of nuclear factor kappa B ligand (RANKL), a tumor necrosis factor

(TNF) related cytokine, and colony stimulating factor-1 (CSF-1) (Figure 1.2) (4,

13, 17). These factors induce the osteoclast to express genes specific for

osteoclastogenesis such as those encoding cathepsin K, TRAP, and 33-integrin

(3). Once osteoclastogenesis has occurred, RANKL and interleukin 1 function to

increase the osteoclast survival time by inducing nuclear factor kappa B (NFKB)

activity (13).

RANKL is a TNF-related type II transmembrane protein found on

osteoblasts either as a surface protein or in a proteolytically released soluble

form (1, 4, 13). The expression of RANKL coordinates bone remodeling by

stimulating bone resorption in the osteoclast by binding and activating the tumor

necrosis factor receptor (TNFR)-related protein, RANK, a transmembrane

receptor expressed on the surface of hematopoietic precursors (1, 4, 13). The









requirement of these two proteins in osteoclastogenesis is indicated as mice

deficient in either RANK or RANKL are severely osteopetrotic with the inability to

resorb bone (1). In addition, antibodies neutralizing RANKL inhibit bone

resorption induced by stimulants such as parathyroid hormone (PTH) and

prostaglandin E2 (PGE2) (16).

Activation of RANK leads directly to the expression of osteoclast specific

genes by the association of various TNF-receptor associated factor proteins

(TRAFs) relaying the signal to at least five major signaling cascades: inhibitor of

NF-KB kinase (IKK), c-Jun N-terminal kinase (JNK), p38, extracellular signal-

related kinase (ERK), and Src pathways (1, 13, 17) (Figure 1.3). The initial step

is the binding of TRAFs, cytoplasmic adaptor proteins, to specific domains of the

cytoplasmic portion of RANK, in which three putative TRAF binding domains

have been identified (1, 13, 17). The binding sites of TRAF-2, -5, and -6 to

RANK have been identified; however, only mutations in TRAF-6 result in a loss of

osteoclast activity, resulting in osteopetrosis (1, 13, 18). TRAF6 is the key

adaptor linking the expression of NF-KB and activator protein-1 (AP-1) to RANK

(1, 13). Osteoclastogenesis is inhibited by mutations in the p50/p52 component

of NF-KB or the c-Fos component of AP-1, resulting in osteopetrosis (1, 13).

TRAF2 and 5 are also able to activate NF-KB pathways, but their contributions to

osteoclastogenesis are minor. TRAF3, however, has been shown to serve as a

negative regulator of NF-KB activation (1, 13).

Activation of the protein kinase p38 by RANK results in the activation of

the transcriptional regulator mi/Mitf (13). This regulator controls the gene









expression of both TRAP and Cathepsin K, which are both required for the

osteoclast phenotype (13). ERK-1 kinase is also regulated by RANKL through

upstream activation by MEK-1 (13). ERK appears to negatively regulate

osteoclastogenesis as inhibitors of ERK potentiate RANKL induced

osteoclastogenesis (13).

Src protein binds TRAF6, permitting RANK-mediated signaling to continue

through the tyrosine phosphorylation of phosphatidylinositol 3-OH kinase (P13K)

and the serine/threonine protein kinase (AKT) (13). Both P13K and AKT are

involved in various cellular processes, such as motility, cytoskeletal

rearragements, and cell survival (13). Mutations in the Src protein have been

shown to cause osteopetrosis in mice (13, 19).

Multiple factors are responsible for both positively and negatively

regulating osteoclastogenesis by affecting expression of RANKL. Interluekin-1,

c-Fms, tumor necrosis factor (TNF)-a, prostaglandin (PG) E2, and transforming

growth factor (TGF)-p activate surface receptors on the osteoclast to potentiate

osteoclastogenesis and bone resorption (13, 17). It is known that IL1-R and

TNFR1 signal through the TRAF6 pathway and have a synergistic effect on

RANK mediated TRAF6 activation, while c-Fms and TGF-3 affect

osteoclastogenesis by upregulation of its components, such as the surface

receptor RANK (13, 17).

Negative regulation of osteoclastogenesis through RANKL occurs by

osteoprotegerin (OPG), a soluble protein secreted by osteoblasts (1, 13, 17).

OPG is a TNFR-related protein and acts as a decoy receptor by binding to






5

RANKL and blocking its ability to bind RANK (1, 13, 17). It is controlled

hormonally by bone anabolic agents such as bone morphogenic proteins (BMPs)

(13). These factors cause an overproduction of OPG which blocks osteoclast

differentiation, leading to osteopetrosis (13).

Hormonal Control of Bone Resorption

Stimulation of osteoclastogenesis by calciotropic factors and proresorptive

cytokines such as parathyroid hormone related peptide (PTHrP), parathyroid

hormone (PTH), interleukin (IL)-1b, tumor necrosis factor (TNF)-a, 1,25

dihydroxyvitamin D3, or prostaglandin (PG) E2 (13, 20, 21), acts indirectly via

osteoblastic stromal cells (16, 22) by inducing mRNA expression of RANKL. In

converse, factors such as estrogens cause a decrease in RANKL expression and

an increase in OPG expression, causing reduced numbers of osteoclasts (13).

The cytokine, thrombopoietin, has also been identified to induce OPG

expression. Calcitonin also is known to inhibit bone resorption (13).

Mechanism of Action of Osteoclast

Once the osteoclast attaches to bone, there is segregation of an

extracellular compartment between it and the bony surface (1). The area of tight

adhesion segregating this extracellular compartment is termed the sealing zone

(1). Bounded by the sealing zone is the ruffled membrane (1). The ruffled

membrane is a convoluted membrane packed with vacuolar proton ATPase

(VATPase), the osteoclast proton pump (23). The protons, which are pumped by

the V-ATPase and are responsible for bone demineralization, are obtained by

various mechanisms. One mechanism is the hydration of carbon dioxide to









carbonic acid by carbonic anhydrase II (CA II) (3). The carbonic acid then

dissociates into protons and bicarbonate ions. Although traditionally described

as the primary mechanism of proton production in the osteoclast, osteopetrosis

caused by mutations in carbonic anhydrase II is mild and improves with age (24,

25). This would suggest an alternative source of protons is available.

Osteoclastic glycolysis provides the mechanism for an alternative source of

protons. In the glycolytic process, one or two hydrogen ions are generated for

every ATP molecule produced or glucose molecule consumed respectively (26).

Recent data indicate that several glycolytic enzymes bind directly to the V-

ATPase and that V-ATPase assembly requires the glycolytic enzyme aldolase

(26, 27). These data suggest that V-ATPase, by directly interacting with

glycolytic enzymes, forms an acidifying metabolon. Regardless of their source,

at the resorptive membrane, the protons are utilized by the V-ATPase to acidify

the extracellular compartment (23, 28). At the basolateral membrane,

bicarbonate is exchanged for chloride ions in an energy dependent manner (3).

The chloride ions, which have entered the osteoclast, pass into the extracellular

compartment through a voltage gated anion channel coupled to the V-ATPase (3,

23). The V-ATPase generates a membrane potential and the chloride channel

dissipates this potential formed by the protons from the V-ATPase allowing the

pH to decrease in the extracellular compartment to approximately 4.5 (3, 23).

The highly acidic nature of the extracellular compartment dissolves the bone

mineral, which in turn, exposes the organic matrix of the bone (3). Cathepsin K,

an acid cysteine proteinase generated by the osteoclast, is then able to degrade









the bone matrix, which is primarily composed of type I collagen and non

collagenous proteins (3). The degraded bone, both protein and mineral, are then

transcytosed through the osteoclast and secreted into the microenvironment

through the basolateral membrane (3).

Sealing Zone

The sealing zone segregates the acidic resorption compartment from the

surrounding environment, analogous to creation of an extracellular lysosome (7,

8). By electron microscopy, this area of the plasma membrane demonstrates

extremely tight adhesion, less than 10 nm, between the plasma membrane and

the adjacent bone surface (29). The molecular mechanisms accounting for the

sealing zone are still unknown. Several actin binding proteins, including vinculin

and gelsolin, have been localized to the sealing zone (30). In addition, there is

much evidence that the formation of an actin ring is required for formation of the

sealing zone (5-7, 31, 32). When actin rings are disrupted by calcitonin,

herbimycin A, or bisphosphonates, ruffled membrane formation and bone

resorption are inhibited (31). Thus, this region is critical in osteoclastic bone

resorption.

Podosomes

Podosomes are small, discrete but highly dynamic F-actin based

structures. Structural studies indicate that there are two main domains of

podosomes, a cylindrical dense actin core with a surrounding ring enriched with

avp3 and focal adhesion proteins, such as integrins, vinculin, paxillin, and talin

(33, 34). Along with actin, additional core components include Wiskott-Aldrich









Syndrome protein (WASP) family members, the Actin Related Protein (Arp) 2/3

complex, and cortactin (35, 36). The core and ring may be linked by a bridging

protein such as a-actinin. Peripheral to the ring domain, it is hypothesized that a

"cloud" of monomeric actin resides (33, 37). Although podosomes are typically

found in monocytic cells and are not specific to the osteoclast (38), it is only in

the osteoclast that they arrange themselves into a defined actin ring and are

associated with a sealing zone (33, 39). Podosomes can also be found or

induced in several other cell types, such as endothelial cells, and cells

transformed with v-src (33, 35, 40, 41).

Podosomes are relatively small with a diameter of 0.5-1 pm and a depth of

approximately 0.2-0.4 pm (33). Although small, they are found in great numbers

in osteoclasts (33, 42). Current research suggests that the actin ring of

osteoclasts is formed by a rearrangement and fusion of individual podosomes

with a slightly different 3-dimensional structure (43). This structure still maintains

an actin based core but the "cloud of proteins" is now proposed to surround the

entire actin ring structure rather than each individual podosome (43). These

actin ring structures can become as large as 4 |jm in height and diameter (43).

Regardless, podosomes are highly dynamic turning over every 2-12 minutes,

with the the length of the actin core turning over multiple times within the lifespan

of the podosome, likely facilitated by gelsolin (44) and dynamin (36, 42). Figure

1.4 depicts the dynamic nature of podosomal structures in the actin ring.

Rhodamine actin was introduced into saponin-permeabilized activated

osteoclasts to allow for the fluorescent visualization of incorporation of actin into









the actin ring. If the actin ring is static, no incorporation would occur; however,

within 10 minutes, the rhodamine actin was incorporated into the actin ring,

verifying the dynamic nature of the actin ring. To confirm this dynamic nature, the

activated osteoclasts were treated with latrunculin A, which binds monomeric

actin (45, 46). Due to the inability to add new actin monomers, a loss of

podosomal structures and actin ring is observed. Podosome assembly and

disassembly occurs from front to end with F-actin continuously adding at the

leading edge and treadmilling through to the basolateral region (33, 35).

It is of note that podosomes are only present on adherent cells, indicating

that attachment may be the initiating factor with regulation occurring by a variety

of mechanisms. Signaling pathways which regulate podosomal formation include

Rho family GTPases, such as RhoA, Rac1, or CDC42, and tyrosine

phosphorylation by Src or Csk. (35, 47). It has been noted that both dominant

active and inactive mutations in Rho family GTPases affect the formation and

localization of podosomes; however, the mechanism of disruption has been

shown to be dependent on cell type (47). In addition, the use of Src kinase

inhibitors causes failure of podosomes while the use of phosphotyrosine

phosphatase inhibitors induces podosomal formation (48, 49).

Transportation of V-ATPase to the Ruffled Membrane

The vacuolar H-ATPase plays a vital role in bone resorption, as it is the

proton pump responsible for acidification of the extracellular compartment and

demineralization of the bone (8, 9, 11, 12, 23). In unactivated osteoclasts, V-

ATPase is not present at the plasma membrane but rather stored in cytoplasmic









vesicles (23, 50). In the inactivated state, the V-ATPase is bound to F-actin (9,

51); but upon activation, the mechanism by which translocation of actin and V-

ATPase to the plasma membrane occurs is still unknown (Figure 1.5) (9).

Ruffled Membrane

The ruffled membrane is the resorption organelle of the osteoclast (8). Its

name is derived from the brush border-like appearance of the plasma membrane

(8). The ruffled border is formed by the fusion of intracellular acidic vesicles with

the plasma membrane, adjacent to the bone surface (6, 8, 11). The fusion of

these vesicles causes an enrichment of vacuolar proton ATPase in the plasma

membrane (7, 11), which pumps protons to acidify the resorption compartment

(23, 50).

Osteoclast Adhesion

Adhesion of the osteoclast to bone is integral in the resorption process.

The integrin, av33, is a key player in adhesion of the osteoclast to bone (30, 52)

by recognizing Arginine-Glycine-Aspartic Acid (RGD) moieties in extracellular

matrix (ECM) proteins (53). This integrin has been localized to the basolateral

membrane, intracellular vesicles and ruffled border (30, 54). Bone resorption,

osteoclast formation and attachment have been shown to be inhibited by

disintegrins, blocking antibodies, and RGD mimetic peptides, indicating the

importance of avP3 in osteoclast adhesion (55-57). Echistatin, an RGD

containing disintegrin which binds av33 tightly, induces osteoclastic detachment

from its substrate (55, 58). The use of echistatin in vivo causes an inhibition of

bone resorption without significantly altering the number of osteoclasts (59),









resulting in a decreased osteoclastic efficiency without effects on osteoclast

differentiation and recruitment (60). In addition, a deletion of the 33 integrin

subunit did not affect osteoclast recruitment, which is thought to be mediated by

a335, or the formation of resorption lacunae (52). The 33 -/- mice did show

decreased bone resorption, abnormal ruffled membranes, and increased

osteoclast number, most likely caused from stimulation by hyperparathyroidism

secondary to the hypocalcemia produced by decreased bone resorption (52).

Skeletal remodeling in the 33 -/- mice proceeds even in the absence of acv3; it is

hypothesized that an adequate resorption rate is achieved by the increased

number of osteoclasts, even in the presence of decreased resorption per

osteoclast (52). However, with age, the compensation decreases, and

osteosclerosis occurs (52). Although once thought to mediate the extremely tight

seal of the sealing zone, Lakkakorpi et al. (57) and Masarachia et al. (59) have

shown the specific exclusion of av33 from the sealing zone. However, its

absence from the sealing zone does not preclude its ability to cause a visible

disruption of the sealing zone as was shown by Nakamura et al. (60). It seems

likely that proper stimulation of integrin-based signal transduction pathways

normally plays a role in the acquisition and maintenance of osteoclast polarity

during bone resorption (61).

Osteoclasts and Disease

As previously stated, bone homeostasis is dependent on a delicate

balance between bone resorption and bone formation (62). When one is in

excess of the other, bone diseases occur. Most commonly, skeletal diseases are









a result of an excessive amount of bone resorption, resulting in osteoporosis (1,

62). Osteoclastic bone diseases are caused by reduced number of osteoclasts,

reduced or loss of function or overactivity of osteoclasts (62).

There are several diseases which result in reduced osteoclast activity and

thus, osteopetrosis, which often leads to brittle bones and fractures (62-64).

Autosomal recessive malignant osteopetrosis is a result of a mutation in the

TCIRG1 gene (65, 66). This gene encodes for the 116 kD a3 subunit of V-

ATPase (65, 66). The resultant phenotype is osteoclast-rich but with poor

resorptive abilities (65, 66). Autosomal dominant osteopetrosis type II (Albers-

Schonberg disease) results from a mutation in the CLCN7 gene, which encodes

for the CLC7 chloride channel (67-69). As a result of this mutation, normal

numbers of osteoclasts are present; however, resorption is inhibited as

acidification of the resorption lacunae is hindered (67-69). Autosomal dominant

osteopetrosis type I has been linked to a gain of function mutation in the LRP5

gene (70-72). In this disease, osteoclast function is not impaired; however,

abnormally low numbers are present (70). It is hypothesized that the mutations

in the LRP5 gene alter the osteoblast, decreasing the potential to support

osteoclastogenesis (70). Pycnodyostosis has been showed to be a result from

mutations in the Cathepsin K gene, an acid cysteine protease responsible for the

degradation of organic bone matrix (73-75). A deficiency in this protease results

in elevated numbers of osteoclasts and disorganized bone structure (73-75).

Another osteopetrotic disease is the autosomal recessive syndrome of

osteopetrosis with renal tubular acidosis and cerebral calcification; which is, most









frequently referred to as carbonic anhydrase isoenzyme II deficiency (24, 25, 76).

CAII is responsible for one of the mechanisms by which the protons, which are

responsible for acidification of the resorption compartment, are produced (3).

Thus, prevention of normal acidification occurs (24, 25, 76).

A decrease in osteoclast number may result from defects in the CSF1

(colony stimulating factor) gene (62). Defect in this gene in the murine model

results in a broad spectrum of pathology from a delay in osteoclast formation to a

complete inhibition of osteoclast formation. In addition, polarization can be

affected and there may be a loss of the ruffled border (62). However, to date,

there have been no human cases of osteopetrosis attributed to a lack of CSF-1

(62).

The diseases of increased osteoclastic activity include Paget's disease

(PD), expansile skeletal hyper-phosphatasia and familial expansile osteolysis

(FEO) (77). The second most common bone disease, after osteoporosis, is

Paget's disease of bone (77). This disease primarily occurs as a result from a

mutation in SQSTM1, which encodes sequestosome 1, an ubiquitin binding

protein involved in multiple signaling pathways, including RANKL, IL-1 and TNF

(78, 79). However, recent cases have reported a mutation in the TNFRSF11A

gene as well which encodes RANK (80-83). Unlike Pagets, familial expansile

osteolysis and expansile skeletal hyper-phosphatasia result primarily from

defects in the TNFRSF11A, which is the gene encoding RANK (80, 83).

Regardless of mutation location, these defects result primarily in an enlargement

of the osteoclasts with an increased number of nuclei (80-83). In addition, there









can be an increase in osteoclast number as well as in activity (80-83). A striking

finding in both FEO and PD are nuclear inclusions similar to those seen by viral

infections (83).

The osteoclast is also implicated in diseases in which skeletal pathology

results from inflammation (84-86). In rheumatoid diseases, such as rheumatoid

arthritis, seronegative spondyloarthropathies, and systemic lupus erythematosis,

as well as periodontal disease, the osteoclast has been identified as the

dominant cell type which mediates the inflammatory bone loss (84-86).

Activation of the osteoclasts occurs due to increases in proinflammatory

cytokines, such as TNF-a, Interferon (INF)-y, and interleukins, which then

modulate expression of RANKL and OPG (84, 85).

Treatment of Osteoporosis and Osteopetrosis

Osteoporosis occurs as a result of an imbalance in the bone remodeling

cycle resulting in excessive bone loss (87-89). For the past decade, the

treatment of osteoporosis was based on the retardation of bone mineral density

loss (88). However, bone formative medications have recently come on the

market. The anti-resorptive medications slow bone resorption and formation, but

the effect on formation is less dramatic, allowing bone formation to exceed bone

resorption and bone density to increase modestly (88). Anti-resorptive

medications include the bisphosphonates, estrogens, selective estrogen receptor

modulators, and calcitonin.

Calcium is important in the prevention and treatment of osteoporosis (90,

91). Adequate calcium is important for individuals at all ages. Individuals, with









high calcium intake as children, have increased bone mass, which is an

important variable in future fracture risk, as the risk for osteoporotic fractures is

inversely related to bone mineral density (91). Post-menopausal use of calcium

has been shown to decrease bone loss and prevent tooth loss but there is little or

no reduction in the risk of spinal fractures (90, 91). Calcium intake should be

between 1000-2000 mg/daily (91). Although calcium may slow the loss of bone

mineral density, most physicians support the use of additional pharmacologic

intervention to prevent/treat osteoporosis (91).

Estrogens and SERMS function as estrogen receptor agonists (88, 89, 92,

93). Estrogen therapy, also known as hormone replacement therapy, has been

approved primarily for the prevention of osteoporosis. It has also been shown to

increase bone density modestly, reduce bone loss and reduce the risk of

fractures in postmenopausal women (92, 93). Selective Estrogen Receptor

Modulators (SERMS) bind to the estrogen receptor. Although their mechanism

of action is not fully understood, these agents may function by inducing

conformational changes in the estrogen receptor, causing differential expression

of specific estrogen-regulated genes in different tissues (92, 93). SERMS

(raloxifene) are used for both the prevention and treatment of post-menopausal

osteoporosis. They function like the estrogens but without the disadvantages of

estrogens, such as the increase in uterine cancer (92, 93). Raloxifene has been

shown to increase bone mass and reduce spinal fractures; however, as of yet,

there is no evidence indicating a decrease in non-spinal fractures (92, 93).

Recent data have shown significant risks for breast cancer, venous









thromboembolism and stroke with the use of estrogens and SERMS (94, 95).

Data on the incidence of breast cancer have identified an increased risk in ductal

and lobular cancer with the use of medium potency estrogens and an increase in

lobular cancer with low potency estrogens (94). In addition, if additional risk

factors are added, such as alcohol consumption and the use of oral

contraceptives, an increase in all three breast cancer subtypes (ductal, lobular or

tubular) was observed (94). An examination of the literature identified increased

risks of thromboembolism in patients in their first year of therapy and those taking

an estrogen-progesterone or high dose estrogen preparation (95). Route of

administration also increases the risk as oral administration had significantly

higher incidence of thromboembolism than transdermal (95).

The bisphosphonates, alendronate, ibandronate and risedronate, are used

for the prevention and treatment of postmenopausal bone loss (88, 89, 92, 93,

96, 97). They function to slow bone loss, increase bone density and reduce the

risk of skeletal fractures (97). There are two main categories of bisphosphonates

(96). Amino bisphosphonates inhibit osteoclastogenesis by blocking

isoprenylation of Rho and Rap and inducing apoptosis while the non-amino

bisphosphonates are metabolized to cytotoxic ATP analogues thus inducing cell

death (69, 98). Although very effective in the treatment of osteoporosis, the use

of bisphosphonates carries significant side effects (99). Several studies have

demonstrated a high risk of gastric, duodenal, and esophageal ulcers with

administration (100). In addition, two percent of bisphosphonate users

demonstrate acute systemic inflammatory reactions, ocular complications, acute









and chronic renal failure, and electrolyte imbalances (99). Osteonecrosis of the

mandible or maxilla has recently been identified as sequelae of treatment with

bisphosphonates (99, 101-103). These lesions presented as non-healing,

usually as the result of dental surgical intervention (99, 101, 102). Although the

large majority of these patients were receiving parenteral administration of the

drug, several patients were on oral doses (99, 101, 102). Many researchers

strongly support further studies to identify the risks and benefits of continuing

bisphosphonate therapy (99, 101-103).

Calcitonin is also used for the prevention and treatment of osteoporosis

(104, 105). This naturally occurring hormone is involved in calcium regulation

and bone metabolism (104, 106, 107). It is administered nasally rather than

orally, as it is a protein and would be degraded prior to its function (104).

Calcitonin has been shown to increase bone mass and reduce spinal fractures.

In addition, studies have shown a decrease in pain post-fracture with the use of

calcitonin (105). Non-spinal fractures, however, have not been shown to be

reduced with calcitonin treatment (105). A resistance to continuous treatment

with calcitonin, with a loss of inhibitory effects on bone resorption, has been

shown to occur within 12-18 months after initiation of treatment due to a

downregulation of the calcitonin receptor, by both internalization of the receptor

and a reduced concentration of de novo receptor synthesis (106, 107). Recent

data have shown that this resistance can be avoided by the use of intermittent

administration of calcitonin, as calcitonin receptor mRNA expression returns to

normal by 96 hours after discontinuation (106, 107).









Teraparatide (Forteo), parathyroid hormone [1-34], is a newly approved

medication to treat osteoporosis via bone formation (108-110). Its mechanism of

action is to increase bone formation by the osteoblasts (108-110). It has been

shown to stimulate bone formation and increase bone mass to a greater extent

than the anti-resorptive agents (108-110). Reductions in spinal and non-spinal

fractures have been shown (108-110). Like calcitonin, it is a peptide but it is

given by injection daily which is a disadvantage of this treatment (108, 110). The

most common adverse effects of treatment with teraparatide include headache,

nausea, dizziness, and cramping; however, only dizziness and cramping differed

from placebo in a randomized clinical trial (111). Other less common

complications include hypercalcemia and hyperuricemia (111). These

complications can often be inhibited by a reduction of the dosage but may require

complete cessation of the drug (111). Animal studies have shown an increased

risk for osteosarcoma with the use of teraparatide; however, osteosarcoma has

not been identified in over 2800 patients in human clinical trials (111).

Several new treatment modalities are on the horizon for osteoporosis.

Zolendronic acid, an injectable bisphosphonate, is currently being studied. It has

been shown to increase bone mineral density modestly as do the other

bisphosphonates (93). In addition, strontium ranelate, the only current drug

known to decrease bone resorption and increase bone formation concomitantly,

has just recently finished Phase III trials (93, 112). It has been shown to reduce

both vertebral and non-vertebral fractures (93). Its efficacy and safety have been

shown; and therefore, it should be marketed soon (112). In addition, as the proof









of concept for bone anabolic therapy has been established with the use of

parathyroid hormone, other parathyroid hormone analogues are being

investigated as well as the development of non-peptide small molecules targeted

against the parathyroid hormone receptor.

The treatment of osteopetrosis has focused on the stimulation of host

osteoclasts with calcium restriction, calcitrol, steroids, parathyroid hormone, and

interferon (113, 114). Infantile malignant osteopetrosis has also been treated

with bone marrow transplantation (113, 114). Coccia et al. (115) documented a

case of successful bone-marrow transplantation in a five month old girl in 1980.

Prior to transplantation, the patient exhibited anemia, thrombocytopenia, low

serum calcium and elevated serum alkaline phosphatase and acid phosphatase

all of which normalized within 12 weeks post-transplantation (115). In addition,

histologic sections prior to transplantation showed an increase in osteoclast

number but no bone resorption occurring (115). Post-transplantation, active

osteoclastic bone resorption occurred (115). Unfortunately, although there have

been some reports of successful treatment of osteopetrosis, most research

indicates ineffectiveness of treatment and patients are usually given poor

prognosis (113). Difficulty in treatment also stems from the multiple etiologies of

osteopetrosis, and therefore, treatment must be individualized to each patient

(113).

Osteoclasts and Dentistry

Osteoclasts play a significant role in the oral cavity, both through

physiologic and pathologic processes. The osteoclast is central to the bone loss









observed in periodontal disease. In the inflammatory process in the

periodontium, recent data have shown increased levels of RANKL and

decreased levels of OPG in patients with periodontal disease (116-118). Recent

data have also identified RANKL expression on both T and B lymphocytes (117).

It is suggested that the bacterial biofilm initiates an immune response with

expression of RANKL which in turn stimulates osteoclastogenesis and bone

resorption (117). This hypothesis is confirmed by data showing an abrogation of

bone resorption when RANKL is inhibited or knocked out (117).

Dental root resorption is another pathologic process mediated by the

osteoclast. Dental root resorption is fairly unpredictable and the etiology is still

unknown (119). Recent studies however identify increased levels associated

with the IL-1 3 gene (120). Studies on RANKL and OPG expression when heavy

forces are applied during orthodontic tooth movement show increased levels of

RANKL to OPG associated with root resorption (121). In contrast, root resorption

has been shown to be inhibited with echistatin treatment, a known inhibitor of

osteoclasts (119).

Osteoclasts do not always play a pathologic role in the oral cavity. In fact,

resorption can be accelerated or inhibited based on the needs of the orthodontic

patient. Several studies have shown that osteoclastic bone resorption can be

decreased with the addition of chemical mediators or cytokines (122-126). Mice

lacking the TNF type 2 receptor show less bone resorption than wild type mice

(126). Addition of OPG to the periodontal tissues of mice has also been shown

to decrease osteoclastogenesis (125). In addition, inhibition of orthodontic tooth









movement has been observed when treated with matrix metalloproteinase

inhibitors, echistatin or an RGD peptide (123). In contrast, orthodontic tooth

movement can be accelerated by the removal of OPG. Compared to wild type

OPG littermates, OPG knock out mice show increased osteoclast number and

increased alveolar bone resorption (127). In the future, the power of the

osteoclast may be able to be harnessed to enhance the treatment of the dental

patient.

General Purpose of Research

The general purpose of the work presented in this dissertation has been to

learn more about the actin ring of osteoclasts, its characteristics and composition

and requirements for formation. In addition, we sought to identify a relationship

between components of the actin ring and V-ATPase, another specialized

structure of the osteoclast.


































Figure 1.1. Resorbing osteoclast. Once the osteoclast attaches to bone, there is
segregation of an extracellular compartment between it and the bony surface.
The area of tight adhesion segregating this extracellular compartment is termed
the sealing zone. Bounded by the sealing zone is the ruffled membrane. The
ruffled membrane is a convoluted membrane packed with vacuolar proton
ATPase (VATPase), the osteoclast proton pump (3). Bone degradation is
initiated by hydration of carbon dioxide to carbonic acid by carbonic anhydrase II
(CA II). The carbonic acid then dissociates into protons and bicarbonate ions. At
the apical membrane, the protons are pumped into the extracellular compartment
via the V-ATPase. At the basolateral membrane, bicarbonate is exchanged for
chloride ions in an energy dependent manner. The chloride ions, which have
entered the osteoclast, pass into the extracellular compartment through an anion
channel coupled to the V-ATPase. The protons and chloride ions form
hydrochloric acid and reduce the pH in the extracellular compartment to
approximately 4.5, which allows the demineralization of the bone mineral and
exposes the organic matrix of the bone. Cathepsin K, an acid cysteine
proteinase, is then able to degrade the bone matrix. The degraded products,
collagen and calcium, are then transcytosed through the osteoclast and secreted
into the microenvironment through the basolateral membrane. (Teitelbaum et al.
J Bone Miner Res 2000; 18:344-349) (3)





























I Immuse System


Y RANK
SRANKL







re nbrtle I
0F1









Pmahtinr of Fedef Or1Kte0ea
iemniCaleipa Siem CeA Prhcrr
(CFll-C tl


M-CSF


M-CSF
T7VFI
ILI


Orot i Sutnrl
amd ardsklm
A

TNFt N7VFa
ILI ILl


Figure 1.2. The OPG/RANK/RANKL triad plays an important role in the bone,
immune, and vascular systems. In the bone system, the interaction between
OPG and RANKL promotes either osteoclast differentiation and survival or
osteoclast apoptosis. (Theoleyre et al. Cytokine and Growth Factor Reviews.
2004; 15:457-475) (17)


Vascular System a
Ewdhri sad sm moth mmsc lt l

* m

96d W


















Osteoblastic
Stromal Cells


,*I --.. Pi3K
.. ..... Other kiases ?

.........; -KT
..IKK KKK 6, o MEKI AKT'


Differentiation


Osteoclastic Survival
Cystoskeletal effects


Figure 1.3. Binding of the adaptor protein TRAF6 is the initial step in RANKL
signaling. Down stream targets of TRAF6 include nuclear transcription factors,
such as NFKB, and signal transduction molecules, such as c-Src. (Theoleyre et
al. Cytokine and Growth Factor Reviews. 2004; 15:457-475) (17)






















LATRUNCULIN A


* .


Figure 1.4. The dynamic nature of the podosomes of actin rings. Rhodamine
actin was incorporated into saponin permeabilized osteoclast like cells. In the
control cells, the rhodamine actin was quickly incorporated (within 10 minutes)
into the actin rings of osteoclasts. In the latrunculin A treated cells, which inhibits
G-actin from polymerization, a complete loss of the actin ring was observed.
(Hurst and Holliday, unpublished)


CONTROL


,~8~+,

















V-ATPase


Figure 1.5. In unactivated osteoclasts, V-ATPase is not present at the plasma
membrane but is stored in cytoplasmic vesicles, but upon activation, it is
transported via actin filaments to the ruffled membrane. Mouse marrow
osteoclasts were loaded onto bovine cortical bone slices cultured for 2 days, and
fixed and stained with anti-V-ATPase antibody and phalloidin. This micrograph is
representative of an early resorptive osteoclast. The white arrow identifies a
region where the V-ATPase has been transported to the ruffled membrane which
is bounded by actin. The black arrow, below, identifies a unactivated region,
where the V-ATPase and actin are still found to be co-localized in cytoplasmic
vesicles. (Lee et al. J Biol Chem. 1999; 274(41):29164-29171) (9)


MERGE


ACTIN














CHAPTER 2
ACTIN RELATED PROTEIN (ARP) 2/3 COMPLEX:
AN ELEMENT OF ACTIN RINGS

Introduction

The Arp2/3 complex was originally identified by Machesky et al, 1994

(128) as a contaminant during affinity chromatography of profilin from

Acanthamoeba castellani. Further studies have shown the Arp2/3 complex to be

ubiquitous (129). It has been isolated and studied in detail from sources

including human platelets, bovine brain extract, Xenopus laevis and

Sacchromyces cerevisiae (130-133). The Arp2/3 complex is a globular particle

of 220 kD (134, 135) and is composed of seven subunits (131, 136-139), which

have been highly conserved during evolution (136). Arp2 and Arp3 are actin

related proteins, sharing sequence homology with actin in the nucleotide and

divalent cation binding domains (131). The other five subunits are novel (131,

137, 139). The subunits are present in stoichiometric amounts (131, 140). Two

isoforms of both the Arp3 and p40 subunits have been identified (130, 133, 139,

141). The two isoforms of the Arp3 subunit, Arp3 and Arp3B, share 92% identity-

(139). Expression of the two isoforms differs with tissue (139). Arp3 is present

ubiquitously, while Arp3B is found predominantly in the brain, liver, muscle and

pancreas (142). The two isoforms of the p40 subunit share only 68% sequence

similarity (130, 133, 139, 141).









The Arp2/3 complex is a key regulator and nucleator of actin

polymerization (32, 129). The Arp2/3 complex functions to stimulate actin

polymerization at the barbed end of actin filaments, form a nucleation core to

trigger actin polymerization de novo, and bind to the side of actin filaments where

actin polymerization is triggered, resulting in the formation of an orthogonal actin

network (134, 136, 137). Neither Arp2 nor Arp3 is able to independently induce

polymerization of actin (133, 136). The formation of a dimer between the two

subunits in the complex is required to form the nucleation core to trigger

polymerization of actin (Figure 2.1) (138); this process is considered a possible

rate limiting step (137, 138, 143, 144). The formation of the dimer is a result of

activators such as the WASP family proteins, VASP via ActA, and cortactin (138,

143-146).

Arp2/3 complex driven polymerization is thought to be required for

centrally-important cell processes including amoeboid movement and

phagocytosis (147-150). The fact that the Arp2/3 complex is a central player in

the actin-based motility of certain pathogens has proven to be invaluable to

understanding how Arp2/3 works (130, 148-150). Activation of the Arp2/3

complex by WASP family members and small G-proteins results in actin

polymerization resulting in the movement of bacterial pathogens such as Listeria,

Shigella, and Rickettsia as well as the enveloped virus vaccinia (129, 151-153).

This motility actin polymerization that serves as the basis for this movement

results in an actinn comet tail". This movement is involved in the spread of the

pathogens from cell to cell (145, 149, 150). Reconstitution of actin-based









motilities in vitro has been successful using F-actin, the Arp2/3 complex, actin

depolymerizing complex (ADF), and capping protein (154). The motility of this

system proceeds at slow speeds; however, with the addition of Arp2/3 regulators,

such as profilin, a-actinin, and VASP, there is an increase in motility (154).

In this study, we examined the presence of the Arp2/3 complex in

osteoclasts and its localization during osteoclastogenesis. In addition, we tested

its requirement for actin ring formation.

Materials and Methods

Materials

Anti-Arp2 and anti-Arp3 antibodies were purchased from Santa Cruz

Biotechnology (Santa Cruz, CA, USA). Rhodamine labeled phalloidin was

obtained from Sigma-Aldrich (St. Louis, MO). All CY2 and Texas Red-labeled

secondary antibodies were obtained from Jackson-lmmunoResearch (West

Grove, PA, USA). The expression vector containing a RANKL [158-316]

glutathione-S-transferase fusion protein construct was a kind gift of Dr. Beth S

Lee (Ohio State University, Columbus, OH, USA)

Arp 2/3 purification

The Arp2/3 complex was purified from outdated human platelets (Civitan

Blood Bank, Gainesville, FL, USA) by a method previously described by Welch

and Mitchison (155) based on conventional chromatography. The platelets were

centrifuged at 160g for 15 minutes. The platelet pellet was resuspended in 20

volumes of wash buffer (20 mM PIPES, pH 6.8, 40mM KCL, 5 mM ethylene-

bis(oxyethylenenitrilo)tetraacetic acid (EGTA), 1 mM Ethylenediaminetetraacetic









acid (EDTA) per volume of packed platelets and centrifuged at 2000g for 15

minutes. The wash was repeated two times. After the final spin, the pellet was

resuspended in five volumes of wash buffer on ice for 10 minutes. An equal

volume of lysis buffer (Wash buffer plus 10 ug/ml leupeptin, pepstatin, and

chymostatin (LPC protease inhibitors), 1 mM benzamidine, 1 mM

phenylmethylsuflonyl fluoride (PMSF), 1% Triton X-100, and 0.05 mM adenosine

triphosphate) was added on ice for 5 minutes. The lysate was centrifuged at

2000g for 2 minutes at 40C to pellet the triton-insoluble cytoskeleton. The pellet

was resuspended in 5 volumes of resuspension buffer (Wash buffer plus LPC

protease inhibitors, 100mM sucrose, 0.05 mM ATP and 1 mM dithiothreitol

(DTT)). The resuspended lysate was centrifuged at 2000g for 2 minutes at 40C.

The pellet was gently resuspended in 10 volumes of low salt buffer (20 mM

PIPES, pH 6.8, 10mM KCI, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, LPC protease

inhibitors) and repelleted by centrifugation at 2000g for 2 minutes. The pellet

was resuspended in 5 volumes of extraction buffer (20 mM PIPES, pH 6.8, 0.6 M

KCI, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, 0.2 mM ATP, LPC protease

inhibitors). This suspension was homogenized for 2 minutes using a Teflon

tissue homogenizer. The homogenate was incubated on ice for 30 minutes and

then centrifuged at 25,000g for 15 minutes. The supernatant was collected the

first fraction of the cytoskeletal extract. The pellet was resuspended in 5 volumes

of extraction buffer, and homogenized for 1 minute, followed by incubation on ice

for 2 hours. This step was repeated two times; after which, the homogenate was

centrifuged at 25,000g for 15 minutes at 40C. The supernatant was collected and









added to the first fraction of the cytoskeletal extract. Figure 2.2 lane 1 shows the

total protein extract from the human platelets. ATP was added to a 5 mM final

concentration and EGTA was added to a 10 mM final concentration. The extract

was incubated at 40C for 16 hours. The extract was centrifuged at 25,000g for

15 minutes. The extract was desalted by use of a 10 ml gel filtration column

preequilibrated with Q-Buffer A supplemented with 100 mM KCI (20 mM Tris, pH

8.0, 2 mM MgCI2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM ATP, 2.5%

v/v glycerol). The desalted extract was passed over a 5 mi-Hi-trap Q-Sepharose

HP Column pre-equilibrated with Q Buffer A plus 100 mM KCI. The column was

presaturated with ATP prior to loading the desalted extract. The Arp2/3 complex

is isolated in the flow through fractions. Figure 2.2 lane 2 shows the protein

composition of the Q-Sepharose flow through fraction. The flow-through

fractions were pooled and the pH was adjusted to pH 6.1 by the addition of MES,

pH 6.1 to a final concentration of 40 mM. Glycerol to 10% v/v and LPC protease

inhibitors were added and the KCI concentration was adjusted to 50 mM by the

1:2 dilution of sample to S-buffer A (20 mM 2-[N-Morpholino]ethanesulfonic acid

(MES), pH 6.1, 2 mM MgCI2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM

ATP, 5-10% v/v glycerol). The diluted flow-through fractions were passed over a

1 ml Hi-trap SP-Sepharose HP column pre-equilibrated with S-buffer plus 50 mM

KCI at a rate of 0.5 ml/min. The column was washed with 10 volumes of S buffer

with 50 mM KCI. The Arp2/3 complex was eluted with a linearly increasing

gradient of KCI from 50 mM to 500 mM. The Arp2/3 complex eluted at 175-200

mM KCI. The peak fractions were pooled and concentrated to 0.5 ml.









The concentrated fractions were loaded onto a Superose 6-HR 10/30 gel

filtration column pre-equilibrated with gel filtration buffer (20 mM MOPS, pH 7.0,

100 mM KCI, 2 mM MgCI2, 5 mM EGTA, 1 mM EDTA, 0.5 mM DTT, 0.2 mM

ATP, 5-10% v/v glycerol). Fractions of 0.5 ml were collected and the Arp2/3

complex was the only detectable peak eluted from the column at A280. The

fractions containing the purified Arp2/3 complex were pooled and concentrated

using Centricon 30 concentrators. The protein was frozen in liquid nitrogen and

stored at -800C. Approximately 500 ug of protein was recovered from 10 ml of

cytoskeletal extract (250 ml of plasma).

Cell culture

Osteoclasts were obtained from two sources. Mouse marrow osteoclasts

were grown from marrow derived from the long bones of the hind legs of Swiss-

Webster mice. The marrow cells were grown in a-MEM medium with 10% fetal

bovine serum (FBS) plus 10-8 M 1,25-dihydroxyvitamin D3 for a period of

approximately seven days. Osteoclasts were also grown from the RAW 264.7

cell line, which is a mouse hematopoietic cell line. This protocol was approved by

the University of Florida Institutional Animal Care and Usage Committee. RAW

264.7 cells were grown in Dulbecco's Modified Eagle's Medium (DMEM)

containing gentamicin and 10% FBS for 4 days with fresh media being added on

day 2. On day four, the cells were detached by scraping, gently triturated and

counted with a hemacytometer. The cell density is crucial for osteoclast

differentiation. A cell count of 15,000-20,000 cells/cm2 was cultured with 50

ng/ml recombinant receptor activator of nuclear factor kappa b ligand









(RANKL)(amino acids 158-316)-GST for 4-5 days. With the addition of RANKL,

the RAW 264.7 cells become large, multinucleated cells expressing

characteristics of osteoclasts including actin ring formation, expression of

tartrate-resistant acid phosphatase activity and the ability to resorb bone. The

osteoclasts and RAW 264.7 cells were cultured in tissue-culture grade dishes.

Once mature, the cells were scraped and related on either glass coverslips or

dentine bone slices.

Western blot analysis with quantitation of Arp2/3

Anti-Arp2/3 antibodies were obtained from Santa Cruz Biotechnology Inc

(Santa Cruz, CA). The Anti-Arp2 antibody was generated against the carboxyl

terminus of the Arp2 protein while the Anti-Arp3 antibody was generated against

the amino terminus. The specificity of the antibodies was determined by Western

Blot analysis, by probing the purified Arp2/3 complex (Figure 2.3A). RAW 264.7

cells were grown as previously described, plated on 6 well plates, and either left

unstimulated or stimulated with RANKL. Cell lysates were collected from both

the control and treated cells. Cells were washed twice with ice cold PBS and

scraped from the plates. The cells were then detergent solubilized in 0.2% Triton

X-100 in PBS. Equal amounts of the lysates were separated by SDS-PAGE,

followed by Western Transfer. The nitrocellulose blots were then incubated with

either anti-Arp3 or anti-Arp2 antibodies for one hour, washed three times,

incubated with HRP conjugated secondary antibody, washed three times, and

incubated with Super Signal Dura West Chemiluminescent Substrate (Pierce,

Rockford, IL). The blots were then viewed on a Fluorochem 8000 (Alpha-









Innotech, San Leandro, CA), and quantitation was performed by Spot

Densitometry (Fluor-Phor Software, Alpha-lnnotech, San Leandro, CA). The

integrated density values (IDV) were obtained (white = 65535, black = 0).

Background values were subtracted, and the intensities were normalized against

the value of actin in the sample. The values were then compared between

stimulated and unstimulated cells. The stimulated and unstimulated values were

statistically analyzed using the student's t-test, with statistical significance (p)

being less than 0.05.

Immunofluorescence

Immunofluorescence was performed to visualize the distribution of the

Arp2/3 complex in the resorptive osteoclast as well as its co-localization with

actin. The marrow or RAW264.7-derived osteoclasts were fixed in 2%

formaldehyde in PBS on ice for 20 minutes. The cells were then detergent-

permeabilized by the addition of 0.2% Triton X-100 in PBS for 10 minutes,

washed in PBS and blocked in PBS with 2% bovine serum albumin (BSA) for one

hour. Cells were stained with rhodamine-phalloidin, or antibodies recognizing

Arp3 or Arp2 at a dilution of 1:100 in PBS. Secondary antibodies were diluted

according to manufacturer's instructions. Osteoclasts were visualized using the

MRC-1024 confocal laser scanning microscope and LaserSharp software (Bio-

Rad, Hercules, CA). Images were taken in sequential series to eliminate any

overlap of emission and analyzed by confocal assistant software.

Additional immunofluorescence experimentation was performed to identify

changes in the distribution of the Arp2/3 complex when introduced to agents









known to disrupt actin ring formation. Cell culture was performed as previously

described. On day 6 of differentiation (many large multinucleated cells present),

wortmannin (100 nM), cytochalasin D (20 piM) or echistatin (10 nM) were added

to the cells and incubated for 10-30 minutes. The cells were then fixed in 2%

formaldehyde, solubilized in 0.2% Triton X-100 in PBS and blocked in PBS with

2% BSA. Cells were stained with rhodamine-phalloidin, or antibodies

recognizing Arp3 or Arp2 at a dilution of 1:100 in PBS. Secondary antibodies

were diluted according to manufacturer's instructions. Osteoclasts were

visualized using the MRC-1024 confocal laser scanning microscope and

LaserSharp software (Bio-Rad, Hercules, CA). Images were taken in sequential

series to eliminate any overlap of emission and analyzed by confocal assistant

software.

Polymerase chain reaction of the two isoforms of Arp3

To determine the redundancy of the Arp3 protein, RNA was extracted from

RANKL differentiated RAW 264.7 cells as well as from unstimulated RAW 264.7

cells using RNAeasy Mini Kit (Qiagen, Valencia, CA) and quantified by

spectrophotometer. The sequences for Arp3 and Arp3-beta were obtained from

Gen Bank. Primers were designed as described in Table 2.1. For standard RT-

PCR, 3 |tg of total RNA was annealed to an oligo-dt primer and first strand cDNA

synthesis was performed using Thermoscript RT-PCR System (Invitrogen,

Carlsbad, CA) following manufacturer's directions. One-twentieth of the cDNA

was subjected to amplification by PCR. PCR was performed under the following

conditions: 950C for 2 minutes, then 35 cycles of 900C, 30 seconds; 580C, 30









seconds; 720C, 30 seconds. One-half of the PCR product was separated on

0.5% agarose gel with ethidium bromide staining for 1 hour. Images were

detected using UV transillumination on a Fluorochem 8000 (Alpha-lnnotech, San

Leandro, CA).

Knock down of Arp2 with siRNA

Five siRNA complexes were designed against the Arp2 protein (accession

no. XM_195339) and produced by Sequitur (Natick, MA, USA): 19941 (targeting

bp 21-39) sense 5"-GGUGGUGGUGUGCGACAAUTT-3", antisense 5'-

AUUGUCGCACACCACCACCTT-3'; 19942 (targeting bp 138-156) sense 5'-

AGGGGGAAACAUUGAAAUCTT-3', antisense 5'-GAUUUCAAUGUUUCCCCC

UTT-3'; 19943 (targeting bp 255-273) sense 5'-CAGAGAGAAGAUUGU

AAAGTT-3', antisense 5'-CUUUACAAUCUUCUCUC UGTT-3'; 19944 (targeting

bp 372-390) sense 5'-CUCUGGAGAUGGUGUCACUTT-3', antisense 5'-

AGUGACACCAUCUCCAGAGTT-3'; 19945 (targeting bp 513-531) sense 5'-

CCAUUCUGCUGAUUUUGAGTT-3', antisense 5'-CUCAAAAUCAGCAGAAUG

GTT-3'. Initial experimentation showed that only siRNA 19942 was capable of

producing downregulation of the Arp2 protein. The other siRNAs were used as

ineffective controls. For morphological examination, RANKL stimulated RAW

264.7 cells on glass coverslips in 24-well plates were either not transfected or

transfected using 1.5 U control or ineffective siRNA and 1.5 U fluorescent double

stranded RNA combined with 2 ul Lipofectamine 2000 (Invitrogen) in Opti-Mem

media supplemented with RANKL on day 5 of differentiation (at the appearance

of multinucleated cells). Six hours after transfection, the media was replaced









with DMEM supplemented with FBS and RANKL. No antibiotics were used. The

cells were incubated for 24-48 hours at 370 C in a CO2 incubator; after which, the

cells were fixed in 2% paraformaldehyde. Rhodamine phalloidin was used to

visualize actin ring morphololgy. Only cells with uptake of the fluorescent

oligomer were identified as having been transfected with the control or Arp2

siRNA. Morphological examination was performed using confocal microscopy.

Mouse marrow osteoclasts were grown on tissue culture plates for 5 days and

supplemented with calcitriol as described previously. The cells were then

scraped and transfected as described for the RAW 264.7 cells, except aMEM

was used in place of DMEM. Cells were analyzed as described above for RAW

264.7 cells. For assessment of protein expression, RANKL stimulated RAW

264.7 cells on 6 well plates were either not transfected or transfected using 7.5 U

control or experimental siRNA combined with 10 ul Lipofectamine 2000 on day 5

of differentiation. Six hours after transfection, the media was replaced by DMEM

with FBS and RANKL. The cells were incubated for 30 hours at 370 C in a CO2

incubator. Cells were scraped and washed twice with PBS. The pellets were

lysed using 250 ul of cell extraction buffer (BioSource International, Camarillo,

CA, USA) supplemented with protease inhibitor cocktail (Sigma P2714) and

phenylmethylsulfonyl fluoride (PMSF) for 30 minutes on ice with vortexing every

10 minutes. The extract was centrifuged for 10 minutes at 13,000 rpm at 40 C.

Bradford assay was performed on the lysates. Equal concentrations of protein

were separated by SDS-PAGE, followed by western transfer. The nitrocellulose

blots were blocked in blocking buffer overnight and incubated with both anti-Arp2









and anti-actin antibodies for 2 hours. The blots were washed and incubated with

a horseradish peroxidase (HRP)-labeled secondary antibody for 1 hour, followed

by incubation with a chemiluminescent substrate. The blots were visualized

using an Alpha Innotech Fluorochem 8000. Quantitation was performed using

densitometry measuring integrated density values.

Results

Arp2 and Arp3 are upregulated during osteoclastogenesis

After the purified Arp2/3 complex was isolated from platelets, the

specificities of the anti-Arp2 and anti-Arp3 antibodies were determined by

western blot analysis (Figure 2.3A). Both antibodies recognized their target

proteins. When observing total protein levels, by western blot analysis, from non-

stimulated RAW 264.7 cells and RAW 264.7 cells induced to differentiate into

osteoclasts by treatment with RANKL, both Arp2 and Arp3 were upregulated

approximately three-fold in response to RANKL stimulation (Figure 2.3B and

2.3C).

Both isoforms of the Arp3 protein are present in osteoclasts

The Arp3 protein has been identified in two different isoforms. By PCR

analysis, both isoforms are expressed in the activated osteoclast (Figure 2.4).

This may allow for redundancy of the Arp3 protein, which would allow the

maintenance of essential function of the Arp 2/3 protein even if one isoform was

mutated or lost.









Expression of Arp2/3 complex in the actin ring

The actin rings on osteoclasts of either glass coverslips or bone slices

were stained with anti-Arp3 and anti-Arp2 antibodies (Figure 2.5). In addition to

actin ring staining, osteoclasts on coverslips often showed intense patches of

Arp3-staining with little F-actin co-staining in the center of the cell.

Confocal z-sections of actin rings of osteoclasts on coverslips and on

resorbing bone slices revealed that Arp3 was present throughout the actin ring

and was enriched, relative to F-actin, at the apical membrane, in proximity to the

sealing zone. Figure 2.6 A and B show a projection of 44 slices of the edge of a

mouse marrow osteoclast on glass stained with anti-Arp3 (A) or phalloidin (B).

These slices were stacked and digitally rotated 900 so that the apical surface was

at the bottom and the basolateral at the top. Figure 2.6C is the rotated version of

2.6A and Figure 2.6E is the rotated version of 2.6B. Figure 2.6E is the merged

image of Figures 2.6C and 2.6D, with the Arp3 staining pseudocolored green and

phalloidin staining pseudocolored red. Notice that Arp3 was enriched compared

with F-actin at the apical boundary, and F-actin was relatively enriched near the

basolateral boundary.

Figures 2.6F and G show a projection through the actin ring of a resorbing

osteoclast stained with anti-Arp3 (F) or phalloidin (G). Figures 2.6H and 2.61

show a smaller portion of the rings found in Figures 2.6F and 2.6G. The smaller

section was rotated 900 so that the apical surface, which contacts bone, was

down, and the basolateral surface was at the top (Figure 2.6J). Using a small

section of the actin ring, the image was simplified and more easily interpreted.









Anti-Arp3 staining was pseudocolored green and phalloidin staining was

pseudocolored red. Similar results were observed as with the unactivated

osteoclasts. Arp3 was enriched relative to F-actin at the apical boundary.

Arp3 does not co-localize with the actin associated protein, vinculin

Osteoclasts were co-stained with another actin associated protein,

vinculin. The vinculin staining (Figure 2.7) surrounded that of Arp3 with little co-

localization occurring.

Disruption of Arp3 distribution by chemical agents

The distribution of the Arp2/3 complex was identified after disruption of the

actin ring by the chemical agents, wortmannin, cytochalasin D and echistatin

(Figure 2.8). Disruption of the actin ring occurred regardless of the chemical

agent used; however, the Arp2/3 complex continued to co-localize with actin in

podosomes (Figure 2.9). Figure 2.10 quantitatively describes the effects of

wortmannin and echistatin treatment on osteoclast-like cells on glass coverslips.

Arp2 is required for actin ring formation

Five siRNAs were generated against targets in Arp2. Preliminary studies

showed that one (19942) effectively knocked down Arp2 expression, whereas the

others were ineffective. RAW 264.7 cells were stimulated with recombinant

RANKL and transfected just as they began to fuse. Transfection efficiency was

from 65 to 80% of the total giant cells, as judged by uptake of a fluorescent

double-stranded oligomer. Western blot analysis (Figure 2.11) of osteoclasts 30

hours after transfection showed a 70% decrease in the amount of Arp2 found in

the total cell extract.









Other RAW 264.7 osteoclast-like cells were fixed 30 hours after

transfection with effective or ineffective siRNAs. Both nontransfected cells or

cells transfected with ineffective siRNAs showed normal actin rings (Figure 2.11).

In contrast, fewer structures that look like podosomes were apparent in the knock

down cells, and actin rings were rarely observed (less than 1% of controls).

Typically F-actin was concentrated in central regions of giant cells in which Arp2

was knocked down.

Mouse marrow osteoclasts were also transfected with effective or

ineffective siRNAs (Figure 2.13). Transfection efficiency was very low, but a few

transfected osteoclasts were identified based on the entry of the fluorescent

double-stranded oligomer. Osteoclast transfection with 19942 did not have actin

rings after 30 hours, whereas the majority of the osteoclasts transfected with the

ineffective control did show actin rings. This was true for both activated and

inactivated osteoclasts.

Discussion

These studies demonstrate for the first time that the Arp2/3 complex is a

component of the actin ring of osteoclasts and is required for its formation. The

Arp2/3 complex was upregulated three-fold during differentiation. This is

consistent with the Arp2/3 playing a role in actin ring formation, specialized

structures specific to osteoclasts. The Arp2/3 complex is abundant in actin rings,

co-localizes with the actin core of podosomes and is enriched at the apical

boundary near where the osteoclasts contact the substrate. Vinculin, a focal

adhesion protein, was enriched at the apical border of actin rings but did not co-









localize with actin or the Arp2/3 complex but rather surrounded them in a cloud,

which is consistent with current studies (33).

The organization of podosomes in the actin rings of osteoclasts has been

shown to be disrupted by the addition of chemical agents such as wortmannin,

echistatin and cytochalasin D. Cytochalasin D is a fungal toxin that reduces actin

polymerization by inhibiting G-actin and is known to disrupt actin ring formation in

the osteoclast (156, 157). The actin fibers of podosomes depolymerize as the

effective concentration of G-actin becomes limiting (156, 157). Wortmannin is a

fungal toxin and functions as a selective inhibitor of P13 Kinase activity (158).

Echistatin is a snake venom toxin and inhibits the integrin, av33 (159, 123). In

osteoclasts, echistatin causes a disruption of the sealing zone and an

internalization of integrins from the basolateral membranes to intracellular

vesicles. The treated osteoclasts tend to round up and collapse. Although the

osteoclasts are still adherent to bone, osteoclastic resorptive ability is severely

reduced as is seen by a reduction in resorptive pit number and size. Regardless

of the type of inhibition, disruption of the actin ring occurs but with a continuous

co-localization of the Arp2/3 complex with the podosomal core. These data

support high integrity of the podosomal core.

It has become clear that much of the actin filament dynamics in cells

depends on the Arp2/3 complex (160). Activated Arp2/3 complex interacts with

actin monomers to promote filament assembly. Activation occurs in response to

interactions with accessory proteins that are in turn activated in response to

signal transduction. Recent data indicate that actin treadmills rapidly through









podosomes, entering apically and removed basolaterally (Figure 2.15) (161).

The plasma membrane is pushed forward by this actin polymerization until

capping of the barbed end occurs. As the filaments age, the ATP bound to each

subunit is hydrolyzed, with slow dissociation of the y-phosphate. ADF/cofilin

cause severing of actin filaments and the dissociating of ADP-actin (161, 162).

The exchange of ADP for ATP is catalyzed by profilin, and a regeneration of the

pool of profilactin is available for the next generation of filaments (162). This

mechanism suggests a role for the Arp2/3 complex. In addition, the enrichment

of the Arp2/3 complex at the apical boundary of the podosomes of actin rings that

we observed is consistent with the Arp2/3 complex playing a role in the entry of

actin monomers into the actin ring filaments. The true function of the treadmilling

is not currently known; however, it is plausible that the podosomes may be

exerting force on the plasma membrane, causing it to conform to bone (160). It

is known that actin polymerization can produce protrusive forces required for cell

crawling as well as the intracellular propulsion of microbial pathogens and

organelles. An important example of this force generation via actin

polymerization occurs is in the propulsion of Listeria monocytogenes. Loisel et

al. (154) have shown the reconstitution of sustained movement in Shigella and

Listeria with the addition of purified Arp2/3 complex, actin, actin depolymerizing

protein (cofilin), and capping protein. As the Arp2/3 complex is a known central

player in the actin-based motility of certain pathogens, this same force generation

may be within the realm of the Arp2/3 complex in the actin ring of osteoclasts

(144-146).









In osteoclasts, gelsolin has been implicated in triggering actin ring

formation (44, 163). This could potentially be accomplished by cleaving existing

filaments and uncapping barbed ends in a regulated manner (164). Moreover,

the gelsolin "knockout" mouse is mildly osteopetrotic, suggesting a role for

gelsolin in bone resorption (165). However, the mildness of the osteopetrosis

suggests other mechanisms contribute to the cytoskeletal dynamics required for

bone resorption (166, 167). A strong possibility may be coordination between

gelsolin and the Arp2/3 complex. A recent model describing podosomes

suggests a balance of actin polymerization, which, based on our results, is likely

regulated by the Arp2/3 complex, and filament cleavage, by proteins like gelsolin

(33). This balance could account for the structure and dynamics of podosomes.

In summary, the Arp2/3 complex is present in the podosomal structures of

the actin rings of osteoclasts. Knockdown of Arp2 using siRNA shows that the

Arp2/3 complex is required for actin ring formation. These data suggest that the

Arp2/3 complex plays a role in osteoclastic bone resorption and may provide a

target for therapeutic agents designed to limit the activity of osteoclasts.











































Inactive Active
"Open" "-Cksed"


Figure 2.1. The Arp 2/3 complex. A) Crystal structure of the 7 subunits of the
Arp2/3 complex. B) The Arp2/3 complex remains in an inactive conformation.
Upon activation by WASP family members, the Arp2 and Arp3 subunits undergo
a conformational change and allow the complex to become active and participate
in actin polymerization. (Robinson et al. Science. 2001; 294:1679-1684) (138)




















Total Protein
Extract from
Platelets


Q Sepharose SP Sepharose Gel Filtration
Column Elution Column Elution Column Elution


11 __ -.,-- _





Figure 2.2. The purification of the Arp2/3 complex from human platelets. The
Arp2/3 complex was purified from human platelets by a previously published
method by Welch and Mitchison using conventional chromatography. Each lane
depicts the elution from the columns run with purified Arp2/3 complex obtained
after gel filtration.


~L_ --


11 Mr --At


sc
f"- '~











A Arp3 Arp2


C
B I


I
(,
z


w


z :


anti-actin anti-Arp2 anti-Arp3


Figure 2.3. Arp2 and Arp3 are upregulated during osteoclastogenesis. (A)
Human platelet Arp2/3 complex was subjected to SDS-PAGE, blotted to
nitrocellulose, and probed with antibodies against Arp3 and Arp2, and the bound
antibody was detected by chemiluminescence. B) RAW 264.7 cells were
cultures with (black bars) or without (white bars) RANKL. Total protein was
extracted and equal amounts of protein were loaded and separated by SDS-
PAGE and transferred to nitrocellulose and probed with anti-actin, anti-Arp2 and
anti-Arp3 antibodies. Arp2 and Arp3 expression was upregulated during
osteoclastogenesis compared with actin. C) Quantitation of four independent
blots confirmed upregulation of Arp2 and Arp3 as osteoclasts differentiated.
Error bars represent standard error. p < 0.05 by student's t-test.


35000

30000

25000

20000

15000

10000

5000


ArP3


Arp2










Arp3b Arp3 GAPDH

-


S U S U S U
Figure 2.4. The two isoforms of Arp3, Arp3 and Arp3-beta, are present in
unactivated and activated osteoclasts. RAW 264.7 cells were cultured with
(stimulated) or without (unstimulated) RANKL. Cells were harvested and RNA
was obtained using RNAeasy Mini Kit (Qiagen, Valencia, CA). RT-PCR was
performed using primers specific to Arp3 and Arp3-beta. Both Arp3 and Arp3-
beta were present and are upregulated in response to RANKL stimulation.

















Figure 2.5. Arp2/3 complex is present in the actin rings of osteoclasts. Mouse
marrow osteoclasts were loaded onto bovine cortical bone slices (A-C) or glass
coverslips (D-E), cultured for 2 days, and fixed and stained with anti-Arp3
antibody (A and D) and phalloidin (B and E). Images were merged (C and F),
with Arp3 staining pseudocolored green and phalloidin pseudocolored red. Co-
localization of the two is yellow. A-C) A projection of 15 confocal slices (0.5 pm)
is shown. The arrow indicated the actin ring. The green staining of the nuclei
was the result of cross reactivity by the secondary antibody. Note the yellow
staining of the actin ring in the merged image indicating co-localization. D-F)
This is an image of a single optical section (0.5 pm) of a mouse marrow
osteoclast on a glass coverslip. The small arrow points to Arp2/3-rich spots; the
large arrow identifies the actin rings. The size bar is equivalent to 5 |tm in A-C
and 25 pm in D-F.






























H I -


Figure 2.6. Arp2/3 complex is enriched relative to F-actin near the sealing zone.
A and B) A projection of the edge of an osteoclast on a coverslip is shown,
stained with (A) anti-Arp3 or (B) phalloidin. C-E) The images in A and B were
computer rotated 900 to examine the cell in side view. The apical side is down.
The podosomal nature of the ring is readily apparent. As shown by the arrows,
Arp3 (pseudocolored green) was enriched near the apical surface (the contact
area with the coverslip), whereas microfilaments (pseudocolored red) were
enriched at the basolateral boundary of the actin ring. Areas of co-localization
are yellow. F and G) The image of a resorbing osteoclast on a bone slice is
shown. H and I) A section of the actin ring is identified from F and G. J) The
images in H and I were then merged and rotated 900 so that the apical surface
was down. Arp3 is pseudocolored green and phalloidin is red. As observed in
the osteoclast on a glass coverslip, Arp3 is enriched near the apical boundary
near the sealing zone (arrow). The size bar is 10 am in A and B; 5 [m in C-l,
and 2 am in J.









































Figure 2.7. Arp2/3 does not co-localize with vinculin in actin rings. RAW 264.7
cells were stimulated with RANKL to differentiate into osteoclast-like cells and
fixed and stained with either anti-Arp3 or anti-vinculin. The images were merged.
A) Image of actin ring stained with anti-Arp3 and pseudocolored red. B) Image
of actin ring stained with anti-vinculin and pseudocolored green. C) Merged
image of A and B. Note there is little co-localization between Arp3 and vinculin.
The size bar is 3 tm.









Actin


Control








Cytochalasin D








Echistatin








Wortmannin


Figure 2.8. Treatment with the chemical agents, cytochalasin D, echistatin and
wortmannin, cause a disruption of the actin rings of osteoclasts. Mouse marrow
osteoclasts were loaded onto bovine cortical bone slices or glass coverslips,
cultured for 2 days, and either untreated or treated with with cytochalasin D,
echistatin or wortmannin for 30 minutes and fixed and stained with anti-Arp3
antibody and phalloidin. Note the disruption of the actin ring in all cells but co-
localization of the Arp2/3 complex with actin remains stable.


Arp3








MERGE


Figure 2.9. Arp2/3 remains co-localized in the actin based podosomal core
regardless of actin ring disruption by wortmannin. RAW 264.7 cells were
cultured with RANKL until osteoclast-like cells were observed. The cells were
then treated with 100 nM wortmannin for 15 mintues, after which they were fixed
and stained with either rhodamine phalloidin or anti-Arp3 antibody. Although actin
ring structure has been disrupted, Arp3 continues to co-localize with actin in the
podosomal core.


160


JI I 7-


Control Wortmannin


Echistatin


Figure 2.10. Wortmannin and echistatin treatment of osteoclasts results in a
decrease in the number of actin rings. Actin rings were counted after either no
treatment or treatment with wortmannin or echistatin. A significant decrease in
actin rings, more than 90%, was observed after treatment with either inhibitor.


ARP3


ACTIN


V -'.-l














NO
TREATMENT


19944


19942


I "- I

I.- m


Figure 2.11. siRNA 19942 but not 19944 reduces the Arp2 content of osteoclast-
like cell extract 70% after 30 hours compared with actin. RAW 264.7 cells were
stimulated with RANKL. Just as large, multinucleated osteoclasts began to
appear, cells were transfected as noted. Cells transfected with siRNA 19942,
which had proved effective at knocking down Arp2 in preliminary experiments,
reduced Arp2 levels dramatically compared with either control cells or cells
transfected with an ineffective siRNA 19944.


ARP2


ACTIN








TRITC-PHALLOIDIN


-NO TREATMENT





19941






19942





Figure 2.12. Actin rings are disrupted in Arp2 knockdown. Untransfected RAW
264.7 osteoclast-like cells or osteoclast-like cells transfected with ineffective
siRNA (19941) or effective siRNA (19942) were fixed after 30 hours and
examined for the presence of fluorescent oligo marker of transfection (left panels)
or F-actin by staining with phalloidin (right panels). The photographs are
representative cells. The effective siRNA disrupted the ability of the osteoclasts
to form actin rings. The size bar equals 25 pm.


FITC-OLIGOMER







































Figure 2.13. Actin rings are disrupted in marrow osteoclasts on coverslips or on
bone slices by siRNA directed against Arp2. Mouse marrow in tissue culture
plates was stimulated with calcitriol for 5 days to produce osteoclasts. These
were scraped and loaded onto coverslips (A-D) or bone slices (E-H) and
transfected with (A, B, G, and H) 19942 or (C-F) 19941. The cells were stained
with phalloidin (B, D, E, and G) or the fluorescent oligomer (A, C, F, and H) was
detected. Note that in osteoclasts transfected with the effective siRNA (19942),
no actin rings were present. In cells transfected with the ineffective control
siRNA (19941), actin rings appeared normal. Standard bar in D is for A-D and
represents 10 pm. Standard bar in H is for E-H and represents 10 pm.
















1200

1000
I-
S800
0
w 600

r 400



0
No Control Experimental
Treatment siRNA siRNA



Figure 2.14. Experimental siRNA reduces the number of actin rings on
coverslips by over 95%. RAW 264.7 osteoclast-like cells or osteoclast-like cells
transfected with no siRNA, ineffective siRNA (19941) or effective siRNA (19942)
were fixed after 30 hours and examined for the presence of fluorescent oligo
marker of transfection. The actin rings of the cells with the marker of transfection
present were counted to quantify changes in the number of actin rings formed.
There was a significant decrease in the number of actin rings after treatment with
effective siRNA. Error bars represent standard error. p < 0.05 by student's t-
test.



















(4) Tips of growing filaments fluctuate
100 and push membrane forward


(2) Nucleation
(1) WASP/Scar on the side
activates of filaments
activates complex
Arp2/3 complex


Profilin-actin pool


Figure 2.15. Dendritic Nucleation Model. Upon activation of WASP/Scar family
proteins, the Arp2/3 complex is activated, resulting in actin polymerization and
side-branching of new filaments on existing filaments. As the filaments elongate,
they push the membrane forward. Profilactin is required for filament elongation
at the barbed ends and may be localized to this region by VASP. (ATP-actin -
white; ADP-P-actin orange; ADP-actin -red; profilin black) (Blanchoin L. et al.
Nature. 2000;404:1007-1011) (37)






















Table 2.1. PCR Primers Used for Identification of Arp3 Isoforms. The sequences
of primers used for PCR as well as their positions numbered relative to the AUG
start site and the expected product size. All primers were designed against
marine sequences.


RT-PCR Position of Size of Sequence of Primers (5'-3")
Target Primers Product
Arp3 750-769 191 bp AGAGCACCAGAGAGAGCAGA
921-940 ACACACCACACGGCTACTACA
GAPDH 380-403 711 bp CCATGTTTGTGATGGGTGTGAACC
(Control) 1068-1091 _TGTGAGGGAGATGCTCAGTGTTGG














CHAPTER 3
THE ARP2/3 COMPLEX:
A POSSIBLE LINK IN THE TRANSLOCATION OF V-ATPASE
TO AND FROM THE RUFFLED MEMBRANE

Introduction

V-ATPase plays a vital role in the osteoclast as it is responsible for

acidification of the extracellular compartment segregated by the osteoclast and

subsequent demineralization of the bone mineral (11, 12). Mutations in the V1

subunit B1 result in distal renal tubular acidosis accompanied by osteopetrosis

(64). In addition, recessive osteopetrosis, with deficient acid secretion, is caused

by mutations in the VO domain or in the chloride channel (64).

The vacuolar proton ATPase is composed of 13 or more different proteins

and over 20 subunits and consists of two major functional domains, V1 and Vo

(Figure 3.1) (11-170). The V1 domain, a peripherally located cytoplasmic section,

contains at least eight different subunits (A-H) and contains three catalytic sites

for ATP hydrolysis (168). These sites are formed from the A and B subunits (11,

168). The Vo domain, a proton channel, is composed of at least 5 subunits and

allows for proton translocation across the ruffled membrane (168).

V-ATPase is present in osteoclast precursors at high levels (171); but

upon osteoclastogenesis, the levels of V-ATPase increase significantly and









isoforms selective to the osteoclast are expressed (171, 172). Prior to activation

of the osteoclast, the V-ATPase is stored in intracellular cytoplasmic vesicles (23,

50). As the cell is activated, V-ATPase binds to actin and is transported to the

ruffled membrane, a specialized region of the plasma membrane. Once a

resorption cycle has been completed, the V-ATPase is internalized into the

cytosol (173).

V-ATPase binding to F-actin has been identified with the F-actin binding

site localized to a profilin-like domain in subunit B (11). This domain is localized

to amino acids 23-67 in the B1 subunit and binding is in a direct 1:1 relationship

(174). Since there are three B subunits, there are at least three actin binding

sites present on the V-ATPase, and two more may be associated with the C

subunit as it has also been shown to bind actin (175). It is of note that the levels

of actin bound to V-ATPase fluctuate with the resorptive state of the osteoclast.

Binding of F-actin to V-ATPase appears to be physiologically controlled with

evidence supporting signaling through av33 and P13K activity (12, 52, 163, 175-

177).

During translocation of the V-ATPase to and from the ruffled membrane,

F-actin and V-ATPase are components of discrete structures termed podosomes

(178). There are several lines of evidence supporting the dependency of the

cytoskeleton for transportation of V-ATPase to and from the ruffled membrane.

The grey lethal mutation (gl), which causes osteopetrosis, results in defective

cytoskeletal organization (179). In the majority of cases, a mutation is found in

the gene, TCIRG1, which encodes the a3 subunit of the osteoclast V-ATPase









(179). Mutations of this protein may prohibit the V-ATPase from assembling

which would be consistent with the lack of ruffled border formation and improper

and disorganized localization of V-ATPase (180-182). In addition, the oc/oc

"osteosclerotic" mouse shows a lack of association between the cytoskeleton and

V-ATPase, hindering the localization of V-ATPase to the ruffled membrane (180-

182). This mouse is characterized by extensive bone deformities (180-182).

These data support the hypothesis that the detergent insoluble cytoskeleton

plays a key role in transportation of the V-ATPase to the ruffled membrane.

As previously stated, the Arp2/3 complex is a central player in the actin-

based motility of certain pathogens (144-147). The Arp2/3 complex has been

shown to co-localize with actin in the actin ring and as a vital component of the

actin ring of osteoclasts. In addition, the Arp2/3 complex responds by various

proteins, such as cortactin and VASP, which are members of various signal

transduction pathways. From this interaction with actin dynamics, its ability to be

regulated by signal transduction mechanisms, and its sequence homology with

actin, it might be hypothesized that the Arp2/3 complex may bind V-ATPase, as

actin does, and function as a possible player in the transportation of V-ATPase to

and from the ruffled membrane.

In this study, we tested for an association between V-ATPase and the

Arp2/3 complex. Since no association could be determined, other potential V-

ATPase binding partners were identified.









Materials and Methods

V-ATPase/Arp2/3 binding assay

To determine if the Arp2/3 complex binds to V-ATPase, a protein binding

assay was performed. Twenty five [l of a maltose binding protein (MBP) -B1

fusion protein (B1-109) was incubated with 25 [l of purified Arp2/3 complex for 1

hour. Amylose beads, which are an affinity matrix used to isolate proteins fused

to MBP, were prepared by sequential washes in column buffer followed by F-

buffer. The amylose beads (25 pL1) were then added to the Arp2/3-fusion protein

mixture and incubated for 30 minutes. The solution was centrifuged at 13,000

rpm for 2 minutes. The supernatant was collected, and the beads were washed

with F-buffer. This was repeated three times. The beads were then incubated

with 25 pl of 100 mM maltose for 10 minutes and eluted by centrifugation. The

supernatant was separated by SDS-PAGE and stained with Coomasie Blue.

Immunoprecipitation was performed to identify binding of Arp2/3 with V-

ATPase. The MBP-tagged B1 fusion protein was incubated with purified Arp2/3

complex and protein G beads (to allow for clearance of any non-specific binding).

The mixture was centrifuged and the supernatant collected. Anti-maltose binding

protein antibody was incubated with the supernatant for 30 minutes. Protein G

beads were added and incubated for 10 minutes. The mixture was centrifuged

and the supernatant collected (to determine in which fraction the original sample

was). The pellet was washed three times. The pellet was incubated with SDS

and centrifuged at 13,000 rpm for 2 minutes. The supernatant was then

separated by SDS-PAGE followed by western transfer. The nitrocellulose blots









were then incubated with anti-Arp2 antibodies for one hour, washed three times,

incubated with anti-goat HRP conjugated secondary antibody, washed three

times, and incubated with Super Signal Dura West Chemiluminescent Substrate

(Pierce, Rockford, IL). The blots were then viewed on a Fluorochem 8000

(Alpha-lnnotech, San Leandro, CA).

PCR to identify other actin associated proteins involved in V-ATPase

translocation and actin ring dynamics

To identify other key proteins involved in osteoclastogenesis, RNA was

extracted from RANKL differentiated RAW 264.7 cells as well as from

unstimulated RAW 264.7 cells using RNAeasy Mini Kit and quantified by

spectrophotometer. The sequences for WASP, n-WASP, VASP, Cortactin, and

Arp3 were obtained from Gen Bank. Primers were designed as described in

Table 3.1. For standard RT-PCR, .3tg of total RNA was annealed to an oligo-dt

primer and first strand cDNA synthesis was performed using Thermoscript RT-

PCR System (Invitrogen, Carlsbad, CA) following manufacturer's directions.

One-twentieth of the cDNA was subjected to amplification by PCR using the

primers listed in Table 3.1. PCR was performed under the following conditions:

950C for 2 minutes, then 35 cycles of 900C, 30 seconds; 580C, 30 seconds; 720C,

30 seconds. One-half of the PCR product was separated on 0.5% agarose gel

with ethidium bromide staining for 1 hour. Images were detected using UV

transillumination on a Fluorochem 8000 (Alpha-lnnotech, San Leandro, CA).









Immunoprecipitation with the B subunit of V-ATPase suggests a possible

direct linkage between VASP and V-ATPase.

To identify possible binding partners with the B2 subunit of V-ATPase, cell

lysates were extracted from RANKL stimulated RAW 264.7 cells. The cell

lysates were subjected to high speed centrifugation to pellet actin and to avoid

the presence of actin filament complexes in the immunoprecipitate. The B2

antibody was biotinylated using EZ-link Sulfo-NHS-LC-biotinylation kit (Pierce,

Rockford, IL). The lysates were incubated with either B2-biotinylated or B2

antibody. The B2 (non-biotinylated) antibody was used as a control. Complexes

were pulled down with streptavidin agarose, which affinity purifies biotin labeled

proteins. The agarose was washed and eluted with loading buffer. The elution

was separated by SDS-PAGE and western transfer. The nitrocellulose blots

were then probed with antibodies directed against various actin associated

proteins such as N-WASP, cortactin, VASP, WASP, and Arp3. The blots were

washed and incubated with secondary antibodies and incubated with Super

Signal Dura West Chemiluminescent Substrate (Pierce, Rockford, IL). The blots

were then viewed on a Fluorochem 8000 (Alpha-lnnotech, San Leandro, CA).

Results

The B1 (1-106) subunit of V-ATPase does not bind purified Arp2/3 complex.

Purified Arp2/3 complex and the B1(1-106) maltose binding protein fusion

protein, which contains the actin binding site, were incubated together. After

being separated on amylose resin and eluted with maltose, the elution was

separated by SDS-PAGE and Western transfer. The blots were then probed with









either anti-B1 or anti-Arp3 antibody. Only the B1 subunit was pulled down,

suggesting that the Arp2/3 complex does not bind to V-ATPase in the actin

binding region (Figure 3.2 and 3.3).

Cortactin is preferentially upregulated at the transcriptional level during

osteoclastogenesis

To identify other actin associated proteins involved in V-ATPase

translocation and actin ring dynamics, PCR was performed using primers to

detect changes in gene expression in several actin-associated proteins during

osteoclastogenesis. Unlike the other proteins tested, cortactin mRNA was the

only gene preferentially upregulated during osteoclastogenesis, with a complete

lack of detection prior to treatment of RAW 264.7 cells with RANK-L (Figure 3.4).

This was expected based on a previous publication which identified an

upregulation of cortactin protein in chicken osteoclasts. These data identify

upregulation occurs at the transcriptional level.

Vasodilator stimulated phosphoprotein (VASP) is identified to have a

possible interaction with V-ATPase.

A signal transduction assay was performed using a standard array by

Hypromatrix (work done by Sandra Vergara). The membrane was incubated with

RANKL-induced RAW 264.7 whole cell extract. The membrane was then

incubated with a biotinylated-B2 antibody, washed and labeled with a secondary

antibody. Chemiluminescent substrate was applied and the membrane was

viewed by a Fluorochem 8000. Among 29 responsive proteins, vasodilator









stimulated phosphoprotein was identified as having an interaction with the B2

subunit (Figure 3.5).

Immunoprecipitation with the B subunit of V-ATPase suggests a possible

direct linkage between VASP and V-ATPase.

To identify possible binding partners with V-ATPase, cell lysates were

extracted from RANKL stimulated RAW 264.7 cells. The cell lysates were

subjected to high speed centrifugation to remove any contamination by actin

complexes in the immunoprecipitate. The lysates were incubated with either

biotinylated-B2 or non-biotinylated B2 antibody. Complexes were pulled down

with streptavidin agarose, to isolate any protein complexes bound to the

biotinylated antibody. The non-biotinylated B2 antibody was used as a control.

Efforts to pull down cortactin in immunoprecipitations of V-ATPase were not

successful; and of all the proteins tested, VASP was identified to form a complex

with the B2 subunit of V-ATPase (Figure 3.6), suggesting a potential complex

that includes VASP, cortactin and V-ATPase.

Discussion

The actin binding site on V-ATPase has been identified to amino acid

sequence 23-67 of the B1 subunit of the V-ATPase (183). Based on the

sequence homology between actin and the Arp2/3 complex, we hypothesized

that V-ATPase might bind the Arp2/3 complex. Experiments with both binding

assays and immunoprecipitation experiments with the B1 fusion protein failed to

show a direct linkage between V-ATPase and the Arp2/3 complex. However,

this result does not confirm an absence of a direct interaction between the two









proteins. Binding of the Arp2/3 complex may occur through a different amino

acid sequence than that of the fusion protein or the Arp2/3 complex may not be

in the correct structural conformation to bind to the V-ATPase in the performed

experiments. Isolation of purified V-ATPase was attempted to determine binding

with the Arp2/3 complex but has not been successful thus far.

As identification of a direct interaction between V-ATPase with Arp2/3

could not be established, research focused on the identification of other proteins

which could play pivotal roles in osteoclast function. Semi-quantitative PCR

analysis of several actin related proteins was performed to determine if there

were any changes during osteoclastogenesis. Cortactin was identified as being

preferentially upregulated during osteoclastogenesis at the transcriptional level

(184), indicating a possible key role in actin ring formation or translocation of V-

ATPase to the ruffled membrane. This finding is not surprising as previous

research in chicken osteoclasts has shown the cortactin upregulation at the

protein level (184); however, our findings identify for the first time that the

upregulation occurs at a transcriptional level. Cortactin is involved in the

activation and stabilization of actin based networks, inhibiting their disassembly

(135, 185-187). Cortactin can bind and activate the Arp2/3 complex through

binding the Arp3 subunit (186, 187). Cortactin, n-WASp, and Arp2/3 form a

synergistic, ternary complex to initiate actin polymerization (186, 188). Although

no additional proteins were found to have significant differences in levels of

mRNA before and after osteoclastogenesis, real-time PCR would be of value in









determining minor variations in mRNA concentration not detectable by traditional

PCR.

In addition to cortactin, we sought to identify other actin binding proteins

that could have a possible interaction with V-ATPase. A signal transduction

antibody array was performed by Sandra Vergara (University of Florida,

Gainesville, FL) to determine possible interactions between signal transduction

proteins and V-ATPase from RANK-L induced RAW264.7 whole cell extracts.

The results from this array indicated that Vasodilator Stimulated Phosphoprotein

might be linked with V-ATPase. Further immunoprecipitation experiments show

that VASP is pulled down in a complex with the B2 subunit of V-ATPase. VASP

plays a key role in actin based motility and is localized predominantly at focal

adhesions, cell/cell contacts and regions of highly dynamic actin reorganizations

such as podosomes (151, 185). VASP can bind directly to G-actin and F-actin as

well as recruit profilactin complexes to the site of actin polymerization. In

addition, VASP is known to enhance Arp 2/3 activity and prevent capping

proteins. VASP is phosphorylated in response to protein kinase A (PKA) and

protein kinase G (PKG) (189, 190). The ability of VASP to be phosphorylated

allows it to be both a positive and negative regulator of actin polymerization.

Calcitonin induces alterations in the cytoskeleton of the osteoclast through the

protein kinase A pathway (191, 192). It is plausible that the disruption of the

actin cytoskeleton by calcitonin could be mediated by VASP. Phosphorylation of

VASP has also been shown to diminish F-actin binding, suppressing actin

nucleation as well as inhibiting Arp2/3 triggered actin polymerization; thus, it can









be a negative regulator of actin polymerization (185). Thus, VASP may play an

important role in the regulation of the translocation of V-ATPase to and from the

plasma membrane.

In summary, the Arp2/3 complex did not bind the same amino acid

sequence of the B1 subunit of V-ATPase as did actin. Further studies are

required to determine if binding exists at another sequence. Two additional

proteins, cortactin and VASP, were identified as having possible key roles in

osteoclast function. Cortactin was found to be preferentially upregulated in

response to RANKL stimulation while VASP was found to associate with the B2

subunit, either directly or indirectly through other V-ATPase subunits or other V-

ATPase bound proteins.














V-ATPase


I
ATP


ADP+Pi
I
__J

'4....+



I~~


catalytic
hexamer



stalk


proton
pathway


Figure 3.1. The structure of V-ATPase. The vacuolar proton ATPase is
composed of 13 or more different proteins and over 20 subunits and consists of
two major functional domains, V1 and Vo. The V1 domain, a peripherally located
cytoplasmic section, contains at least eight different subunits (A-H) and contains
three catalytic sites for ATP hydrolysis. These sites are formed from the A and B
subunits. The Vo domain, a proton channel, is composed of at least 5 subunits
and allows for proton translocation across the ruffled membrane. (Sun-Wada et
al. Biochimica et Biophysica Acta. 2004; 1658: 106-114) (168)

















B1 (1-106)
Subunit of
V-ATPase


BI --


Purified
Arp2/3
Complex


IP: Amylose


Figure 3.2. The B1 (1-106) fusion protein of V-ATPase and the Arp 2/3 complex
do not show a direct interaction by binding assay. The B1-MBP fusion protein
and the Arp2/3 complex were incubated together. The sample was then run on
amylose resin to bind the maltose binding protein. The column was then eluted
with maltose. The samples were separated by SDS-PAGE and stained with
Coomasie. The B1 subunit was pulled down in the amylose column but Arp3
was not, indicating a lack of binding between the two proteins.


*- ---


---











IP: MBP


Probe: Arp3


Probe: Arp3


Figure 3.3. The B1 (1-106) fusion protein of V-ATPase and the Arp 2/3 complex
do not show a direct interaction by immunoprecipitation of B1 subunit. The B1-
MBP fusion protein and the Arp2/3 complex were incubated together. The
sample was then incubated with a maltose binding protein antibody. The sample
was then immunoprecipitated with protein G beads which bind the antibody. The
beads were washed and eluted with sodium dodecyl sulfate. The elution was
then probed using the B1 or Arp3 antibodies. B1 was pulled down by the protein
G beads but Arp3 was not, indicating a lack of binding between the two proteins.


Probe: B1


IP: MBP

Probe: B1


- -R









Unstimulated


Cortactin



WASP



N-WASP



VASP



Arp3



GAPDH


Figure 3.4. Cortactin is preferentially upregulated during osteoclastogenesis as
identified by PCR. RAW 264.7 cells were cultured with (stimulated) or without
(unstimulated) RANKL. Cells were harvested and RNA was obtained using
RNAeasy Mini Kit. RT-PCR was performed using primers specific to cortactin,
WASP, N-WASP, VASP and GAPDH (control). Cortactin was the only actin-
associated protein preferentially upregulated in response to osteoclastogenesis.


Stimulated













































Figure 3.5. Vasodilator stimulated phosphoprotein is identified to have a possible
interaction with V-ATPase. Signal Transduction Array by Hypromatrix was
probed with biotinylated B2 antibody (work by Sandra Vergara) to identify
possible signal transduction molecules which may interact with V-ATPase.
Vasodilator stimulated phosphoprotein, an actin associated protein, was
identified as having a possible interaction.


























B2 Biotin B2 IP: B2 subunit
Streptavidin

VASP



Figure 3.6. Immunoprecipitation experiments with the B subunit of V-ATPase
Suggests a Possible Direct Linkage between VASP and V-ATPase. RANKL
stimulated RAW 264.7 cell lysates were incubated with biotinylated B2 antibody,
pulled down on streptavidin agarose, separated by SDS-PAGE and western
transfer, and probed with the antibodies of various actin related proteins. Of all
the proteins tested, only VASP was pulled down in complex with the B2 subunit
of the V-ATPase.



















Table 3.1. PCR Primers Used for Identification of Arp2/3 Related Proteins. The
sequences of primers used for PCR as well as their positions numbered relative
to the AUG start site and the expected product size. All primers were designed
against murine sequences.


RT-PCR Position of Size of Sequence of Primers (5'-3")
Target Primers Product
VASP 529-548 227 bp ATTCGGGGTGTCAAGTACAA
736-755 TTCTGTTGTTCCAGCTCCTC
Cortactin 1442-1461 186 bp CCTGAGCCTGACTACAGCAT
1608-1627 GTAGTCATACAGGGCGATGG
n-WASp 425-444 197 bp GCCAATGAAGAAGAAGCAAA
602-621 TCTTTGGTGTGGGAGATGTT
WASP 92-111 242 bp ACATTCCTTCCAACCTCCTC
314-333 CAGCTCCTGTTCCCAGAGTA
Arp3 750-769 191 bp AGAGCACCAGAGAGAGCAGA
921-940 CACACCACACGGCTACTACA
GAPDH 380-403 711 bp CCATGTTTGTGATGGGTGTGAACC
(Control) 1068-1091 TGTGAGGGAGATGCTCAGTGTTGG














CHAPTER 4
THE ROLE OF CORTACTIN IN OSTEOCLASTOGENESIS

Introduction

Cortactin is a monomeric, long, flexible protein (186) with a multidomain

structure consisting of an acidic domain at the amino terminus, followed by 6 and

1/2 tandemly repeated 37 amino acid segments, a helical region, a proline rich

region, and a Src homology 3 (SH3) domain at the carboxyl terminus (135, 136,

186). The multidomain structure of cortactin allows a multitude of interactions.

Cortactin binds directly to F-actin through sequences in the tandem region while

binding to the Arp2/3 complex occurs at the amino terminus (136, 186, 188).

Various signaling proteins bind the c-terminal proline rich and SH3 domains (135,

185, 188). Cortactin is a physiologically significant substrate for tyrosine

phosphorylation by src kinases (135). This is important because actin ring

formation requires the activity of pp60c-src (193, 194). Mutations in c-src in mice

results in osteopetrosis and failure of podosome formation (19). Faciogenital

dysplasia protein 1 (Fgdl), a CDC42 guanine nucleotide exchange factor, also

binds the SH3 domain of cortactin (195). This association allows proper

localization of Fgdl to the actin cytoskeleton (196). Mutations in Fgdl are

implicated in the human disease faciogenital dysplasia (197, 198). The pathology

of this disorder includes bone abnormalities.









Cortactin is involved in the activation and stabilization of actin based

networks (185, 186). Initially, the role of cortactin was hypothesized as a result

of its localization to the same regions as Arp2/3 and n-WASP in vesicles,

podosomes, and the actin based rocket tails of Listeria (135, 186, 188, 199). The

function of cortactin as a regulator of the Arp2/3 complex is two fold. First,

cortactin can bind and activate the Arp2/3 complex through binding the Arp3

subunit (186, 188), although its activation potential is four to five fold lower than

that of the WASP family proteins (135, 187). Second, cortactin stabilizes Arp2/3

induced branched actin networks, inhibiting their disassembly (135, 187, 200).

Recent studies suggest that cortactin, N-WASP, and Arp2/3 form a synergistic,

ternary complex to initiate actin polymerization as depicted in Figure 4.1 (186,

188). In this model, N-WASP activates nucleation by interacting with F-actin and

the Arp2 and p40 subunits while cortactin stabilizes the branching points by

binding to F-actin and the Arp3 subunit (135, 187, 200).

Cortactin's main role may involve the carboxy terminal SH3 domain. This

domain allows interactions with various signaling molecules, including src

kinases (186, 200). The tyrosine phosphorylation of cortactin occurs in response

to integrin (av33) binding in endothelial cells (200). This is of note as the

integrin, av33, is also the major integrin of mature osteoclasts (55, 56). Cortactin

may be responsible for organization of receptor signaling in the region of the

sealing zone as it possesses both proper spatial and temporal localization with

newly forming actin networks (186, 188, 200).









Cortactin may not be a direct activator of the Arp2/3 complex. However,

the multidomain structure of cortactin, in conjunction with its distribution in

dynamic cortical actin structures, may allow it to bridge regions of actin

reorganization with receptor signaling complexes, protein tyrosine kinases,

and/or to recruit proteins that may positively or negatively regulate actin

polymerization (186, 188, 200).

Cortactin was previously identified as being preferentially upregulated

during osteoclastogenesis. In this study, our objective was to identify the

localization of cortactin in the osteoclast and to determine its requirement for

actin ring formation.

Materials and Methods

Western blot analysis with quantitation of cortactin

Anti-cortactin antibodies were obtained from Upstate Biotechnology

(Charlottesville, VA). RAW 264.7 cells were grown as previously described,

plated on 6 well plates, and either left unstimulated or stimulated with RANKL.

Cell lysates were collected from both the control and treated cells. Cells were

washed twice with ice cold PBS and scraped from the plates. The cells were

then detergent solubilized in 0.2% Triton X-100 in PBS. Equal amounts of the

lysates were separated by SDS-PAGE, followed by Western Transfer. The

nitrocellulose blots were then incubated with anti-cortactin antibodies for one

hour, washed three times, incubated with HRP conjugated secondary antibody,

washed three times, and incubated with Super Signal Dura West

Chemiluminescent Substrate (Pierce, Rockford, IL). The blots were then viewed









on a Fluorochem 8000 (Alpha-lnnotech, San Leandro, CA), and quantitation was

performed by Spot Densitometry (Fluor-Phor Software, Alpha-lnnotech, San

Leandro, CA). The integrated density values (IDV) were obtained (white =

65535, black = 0). Background values were subtracted, and the intensities were

normalized against the value of actin in the sample. The values were then

compared between stimulated and unstimulated cells. The stimulated and

unstimulated values were statistically analyzed using the paired t-test, with

statistical significance (p) being less than 0.05.

Co-localization of cortactin with actin and Arp3

Cell culture was performed as previously described for RAW 264.7 cells and

mouse marrow osteoclasts. To determine the co-localization of cortactin with

actin in the actin ring, osteoclasts were fixed in 2% formaldehyde, detergent-

permeabilized with 0.2% Triton X-100 in PBS for 10 minutes, washed in PBS and

blocked in PBS with 2% BSA (bovine serum albumin) for one hour. Actin

filaments were stained with TRITC phalloidin. Cortactin was probed with an anti-

cortactin monoclonal antibody (Upstate Biotechnology). Subunit B2 of V-ATPase

was detected with an anti-B2 polyclonal antibody (34). Bound antibodies were

detected by labeling with CY2 tagged anti-mouse secondary antibody.

Osteoclasts were visualized using the MRC-1024 confocal laser scanning

microscope and LaserSharp software (Bio-Rad, Hercules, CA). Images were

taken in sequential series to eliminate any overlap of emission and analyzed by

confocal assistant software.









Immunoprecipitation of actin associated proteins using a GST-cortactin

construct

To determine the interaction of cortactin with actin associated proteins in

osteoclasts, Glutathione S-transferase (GST)- cortactin prokaryotic expression

construct GST-cortactin was obtained from Scott Weed, Ph.D. (West Virginia

University, Morgantown, WV). The GST construct was transformed into

Escherichia coli strain DH5a. The fusion protein was purified by induction of the

bacterium with isopropyl-1-thio-b-D-galactopyranoside. The fusion protein was

run on a glutathione-Sepharose 4B column and eluted with 10 mM reduced

glutathione in lysis buffer. Cell lysates were obtained from RANKL stimulated

RAW 264.7 cells as described previously. Prior to incubation, the cell lysates

were centrifuged at high speed to remove any actin to prevent misleading results.

The GST-fusion protein conjugated to Sepharose was incubated with cell lysates

from RANKL stimulated cells. As a control, Sepharose without the GST-cortactin

fusion protein was also incubated with the cell lysates from RANKL stimulated

cells. The Sepharose was centrifuged and washed twice with binding buffer

lacking ATP. Bound proteins were visualized by Western blotting with anti-Arp3,

anti-VASP, anti-E subunit of V-ATPase, anti-WASP (Santa Cruz), and anti-actin

(Sigma) antibodies after SDS-PAGE.

Knocking down gene expression of cortactin using siRNA

Five single interfering RNA (siRNA) duplexes to murine cortactin

(accession no. NM_007803) were designed and produced by Sequitur (Natick,

MA): 120648 (targeting bp 626-644) anti-sense 5'-UCUUGUCUACACGGUC









AGCTT-3', sense 5'-GCUGACCGUGUAGACAA GATT-3'; 120649 (targeting bp

919-937) antisense 5'- GAAACCAGUCUUAUAGUCUTT, sense 5'- AGACUAUA

AGACUGGUUUCTT-3'; 120650 (targeting bp 1169-1187) antisense 5'-

UAGCACGGAUAUUACUGGUTT-3', sense 5'-ACCAGUAAUAUCCGUGCUATT-

3'; 120651 (targeting bp 673-691) antisense 5'-AGACUCAUGCUUCUCCG

UCTT-3', sense 5'-GACGGAG AAGCAUGAGU CUTT -3'; 120652 (targeting bp

830-848), antisense 5'-UCUGCACACCAAACUUUCCTT-3', sense 5'-GGAAAG

UUUGGUGUGC AGATT-3'; 120653 (control) antisense 5'-UGGUCAUUAUA

GGCACGAUTT-3', sense 5'-AUCGUGCCUAUAAUGACCATT-3'. Initial

experimentation showed only siRNA 120649 capable of downregulating cortactin;

the other siRNAs were used as ineffective controls. In addition, a siRNA known

to downregulate cortactin was obtained (Ambion part no. 60931, targeting exon

5) as well as both positive (GAPDH) and negative controls. RANKL stimulated

RAW 264.7 cells on glass coverslips in 24 well plates were not transfected or

transfected with either 150 nM of the experimental or control siRNA and 2?tg/ml

Lipofectamine 2000 (Invitrogen) in Opti-MEM media supplemented with RANKL

on day 4 of differentiation (at the appearance of multinucleated cells) and

monitored for siRNA uptake. A fluorescent oligomer (part no. 2013; Sequitur)

was added for uptake assessment. Six hours after transfection, the media was

replaced with DMEM with fetal bovine serum and RANKL. The cells were

incubated for 48 hours at 370C in a CO2 incubator. They were then fixed in 2%

paraformaldehyde and viewed for incorporation of the siRNA with the use of the

FITC label. Only cells labeled with FITC were identified as having either the









control siRNA or experimental siRNA. The cells were stained with TRITC

phalloidin to visualize the actin ring morphology. Osteoclasts were visualized

using the MRC-1024 confocal laser scanning microscope and LaserSharp

software (Bio-Rad, Hercules, CA). Images were taken in sequential series to

eliminate any overlap of emission and analyzed by confocal assistant software.

To determine the downregulation of protein expression, RANKL stimulated

RAW 264.7 cells were grown on 6 well plates. On day 6 of differentiation, they

were either not transfected or transfected with 150 nM of control or experimental

siRNA in 10 pl lipofectamine 2000. The media was replaced with DMEM with

FBS and RANKL 6 hours after transfection. The cells were incubated for 48

hours at 370C in a CO2 incubator. The cells were scraped and washed twice with

cold PBS. The lysates were centrifuged and the cell pellet was lysed on ice

using 150 pl cell extraction buffer (BioSource International, Camarillo, CA, USA)

supplemented with protease inhibitor cocktail (Sigma P2714) and

phenylmethylsulfonylfluoride (PMSF) for 30 minutes, vortexing every 10 minutes.

The cell lysate was then centrifuged at 13,000 rpm for 10 minutes at 40C.

Bradford assay was performed to determine protein concentration. Equal

concentrations of proteins were separated by SDS-PAGE, followed by transfer to

nitrocellulose. The nitrocellulose blots were incubated overnight in blocking

buffer, after which they were incubated with both anti-cortactin and anti-actin

antibodies for 2 hours, followed by incubation with secondary horseradish

peroxidase labeled antibodies for 1 hour. Chemiluminescent substrate was

added and the blots were visualized using an Alpha Innotech Fluorochem 8000.









Results

Cortactin is upregulated at the transcriptional level during

osteoclastogenesis

Cortactin protein levels increase during osteoclastogenesis as is verified

by Figure 4.2 (184). Increased expression is due to transcriptional rather than

translational regulation as was identified by PCR analysis (Figure 3.3). Unlike

the other proteins tested, cortactin mRNA was not detected prior to treatment of

RAW 264.7 cells with RANKL.

Cortactin in the actin rings of resorbing osteoclasts

Figure 4.3 shows representative micrographs of the staining of activated

osteoclasts on dentine bone with anti-cortactin and anti-Arp 3 or phalloidin. As

described in previous research, in the activated osteoclast on bone slices, actin

is enriched in the ring surrounding the ruffled membrane. Cortactin is shown to

be a major element of the actin ring of resorbing osteoclasts.

Cortactin is required for actin ring formation

A new siRNA (120648) was identified that knocked down cortactin

expression (Figure 4.4). A commercial siRNA known to downregulate cortactin

was also used to confirm our data (Figure 4.6).

Osteoclast-like RANKL stimulated RAW 264.7 cells on 6 well plates were

transfected and kept in culture for 48 H. Cortactin was not detected by Western

analysis in the cells transfected with effective anti-cortactin siRNAs (Figure 4.4

and 4.6).









RANKL stimulated RAW 264.7 cells on glass coverslips were grown on 24

well plates and transfected with experimental or control siRNAs. The cells were

incubated for 48 hours at which time they were fixed. Immunocytochemistry

showed normal actin rings in the no treatment and control siRNA groups (Figure

4.5 and 4.7). However, a complete loss of actin ring podosomal organization

occurred in the experimental group. Although there was a loss of actin rings, the

cells remained viable and well spread.

Cortactin-binding proteins in extracts from osteoclast-like cells

To identify actin-associated proteins that interact with cortactin, pull-down

experiments were performed on detergent solubilized extracts of RANKL

stimulated R264.7 cells. Recombinant GST-cortactin (Figure 4.8) or vehicle was

added to the extracts, and then pulled down with Glutathione Sepharose beads,

separated by SDS-PAGE and Western blotted. Consistent with previous reports,

cortactin was found to interact with Arp2/3 complex and n-WASp (Figure 4.9).

Surprisingly, we detected high levels of Vasodilator-stimulated phosphoprotein

(VASP), a regulator of actin polymerization, and V-ATPase subunits (Figure 4.9).

Efforts to pulldown cortactin in immunoprecipitations of V-ATPase were not

successful. However, we did identify VASP, suggesting a potential complex that

includes VASP, cortactin and, V-ATPase (Figure 3.5).

Discussion

As previously shown, cortactin is differentially upregulated during

osteoclastogenesis (184). This preferential upregulation in response to RANKL

stimulation supports a hypothesis that it is important for osteoclastic bone









resorption and may be a vital component in either V-ATPase translocation to the

ruffled membrane or formation of the actin ring.

Cortactin co-localizes with the Arp2/3 complex in the actin ring of

osteoclasts. Previous data have shown that cortactin forms a tertiary complex

with the Arp2/3 complex and N-WASP to activate actin polymerization and for

stabilization of actin based networks (186, 188). Its identification in the actin ring

supports its localization to this complex of proteins.

Immunoprecipitation with the GST-cortactin fusion protein identified

associations between the Arp2/3 complex and N-WASP, which is consistent with

previous studies that demonstrated the complex composed of these proteins

plays a role in the regulation of actin polymerization (186, 188). Unexpectedly,

cortactin also interacted with V-ATPase and Vasodilator stimulated

phosphoprotein. VASP is an actin associated protein that tracks the fast growing

end of actin filaments (201, 202). It is still unclear as to the precise mechanism

of actin; however, it may be involved in protecting growing actin filaments from

capping proteins (201, 202). In addition, the capacity of VASP to concentrate

profilactin complex near the fast growing end of actin filaments may be vital

(202). This is the first report of VASP and cortactin in the same complex. We

currently do not know whether the interaction is direct or indirect. Potential

interaction domains are present in the two proteins. VASP contains a src

homology region 3 (SH3) binding domain in the proline-rich central region (203),

while cortactin has a carboxy-terminal SH3 domain (204). Efforts are underway









to determine whether these domains interact and to explore the functional

consequences of the interaction.

The use of siRNA to knock down cortactin results in a loss of actin ring

formation which demonstrates that cortactin is crucial for the formation of

podosomes and actin rings in osteoclasts. Two separate siRNAs targeting

cortactin greatly reduced cortactin levels and disabled the capacity of osteoclasts

to form actin rings and podosomes. Together with the fact that cortactin is

specifically upregulated during osteoclastogenesis (184), these data suggest that

cortactin plays a vital role in osteoclast function.

In summary, we showed that cortactin is required for the formation of the

podosomes and actin rings that are vital for osteoclast function. Cortactin

interacts with Arp2/3 complex and n-WASp as expected in osteoclasts extracts

(186, 188). Novel interactions between cortactin and VASP and cortactin and V-

ATPase were identified. Our data are consistent with cortactin playing a role in

osteoclasts in the integration of cytoskeletal and membrane dynamics.























-WASP

















Figure 4.1. Cortactin, N-WASp and Arp2/3 form a synergistic, ternary complex to
initiate actin polymerization. The Arp2/3 complex is inactive in its unbound form.
Activation of the Arp2/3 complex occurs through the N-WASP family of proteins
binding to the Arp2 subunit. Upon activation, a conformation change occurs in
between the Arp2 and Arp3 subunits inducing actin polymerization. Cortactin
binds to the Arp3 subunit and functions to enhance actin polymerization as well
as stabilize the Arp2/3 induced branched actin networks. (Weaver et al. Curr
Biol. 2002; 12:1270-1278) (188)
























RANKL
Stimulated


RANKL
Unstimulated


Anti-Cortactin




Figure 4.2. Cortactin is upregulated in response to RANKL stimulation. Cell
lysates were extracted from unstimulated or RANKL stimulated RAW 264.7 cells.
Bradford assay was performed to standardize protein concentrations. Cell
lysates were separated by SDS-PAGE and western transfer and probed with
anti-cortactin antibody. In unstimulated RAW 264.7 cells, cortactin is
undetectable by western analysis; however, upon RANKL stimulation, cortactin
expression is induced.