<%BANNER%>

Characterization of the Human Cyt19 Gene Product: An Arsenic Methyltransferase

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101118_AAAAFE INGEST_TIME 2010-11-19T04:38:55Z PACKAGE UFE0014297_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 64360 DFID F20101118_AACZMW ORIGIN DEPOSITOR PATH mcnally_a_Page_68.pro GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
f95e5dfaf43a61ad0a7e342be78ff4b4
SHA-1
f5d391a85a6ff5558c953a1002484fa3c736f537
65357 F20101118_AACZFA mcnally_a_Page_53.jp2
aee56f951707d7c457423078af3d4e47
940aa2f6943f78c050eefe20e28f237d96ebb72b
108222 F20101118_AACZHZ mcnally_a_Page_18.jp2
04475eea3ff0e46fff867dec636b1d5e
37abd0983571c799902515099338baf4905f6d1c
703 F20101118_AACYYD mcnally_a_Page_65.txt
0aabe5ba3c78c00f3661ca8ff67f0419
1257f145b35afff22c6373bdd40c89c0581f15ad
6693 F20101118_AACZAD mcnally_a_Page_74thm.jpg
59425ffa4a87097c8f795628c4c433e1
24857e4e2d8960bb75578b0918837a4f9601e0d8
64372 F20101118_AACZMX mcnally_a_Page_70.pro
9667640061780f978adbcbe62ea138f2
5a4e76581eaec7f1dd9e6062750dcd0caea03cdb
65929 F20101118_AACZFB mcnally_a_Page_73.pro
25ec112ab5c7565c9c667039dbcb8735
d8f65d33107d50d0b8938fc61e058c6fdae91900
726089 F20101118_AACYYE mcnally_a_Page_40.jp2
dcbdb6f39f321c3d1221ba7ae46f2b1d
dae07c34dee3aa5bf4844df12475dc248ef56aa2
1950 F20101118_AACZAE mcnally_a_Page_29.txt
9aa61c2fad48f5e71a42c1005ef7fbaa
c2bed12db8a780c7da8252f3bfcfac261914e28b
16269 F20101118_AACZMY mcnally_a_Page_76.pro
98e2bb8727edffcb479f3e53c56760ee
241f04c66b3cc7293fe4ceada01ead013f3aacee
26378 F20101118_AACZFC mcnally_a_Page_42.jpg
5e9ea5d7e10e9693be4361f333378bab
9777d2d84bd3550799f2a2708902001e08e0b1db
27681 F20101118_AACYYF mcnally_a_Page_20.QC.jpg
bb4d40efd14c24002712b14a304bcafb
f605cec81ecbe990249c174b435ec79e5249d267
27776 F20101118_AACZAF mcnally_a_Page_74.QC.jpg
59d82a7d13e3f02c647e1d83074556b1
d89ea1b3c737c98f45fd679463c36b0d8c7bc5d7
461 F20101118_AACZMZ mcnally_a_Page_01.txt
a3fb441d29f4905c9e3e534f071bceda
c8ad43a4b9f060a07e9f912df252a366d11550f3
110 F20101118_AACZFD mcnally_a_Page_02.txt
0da66834ab422479043c46e54840fea9
9181422d136155dfeb33859a70c0fe01fa866d59
25271604 F20101118_AACYYG mcnally_a_Page_36.tif
aca95da2bec75e4016526c2ef43c0a17
2d14391c48faf07e6b0886f902d8c26aa0d5f68d
5664 F20101118_AACZAG mcnally_a_Page_59thm.jpg
04bb5dcd8bc3684e3a47c1032a8eaa9e
7c835352883cc380af8779bbb4abbf86868aa1b5
592977 F20101118_AACZKA mcnally_a_Page_06.jp2
f18b8c17f761f1f08ba62677a48ee1cd
3384a2f66c4dcd323c17770f7404d8de94631665
6200 F20101118_AACZFE mcnally_a_Page_75thm.jpg
6566b4d3567c3b2e983019f0525602f4
d90e2155bfc44064e1e0b510355ed66aff627870
1925 F20101118_AACYYH mcnally_a_Page_60.txt
3e300ecd461f4a0f14fa8f091f9a0b2a
0ee588061fe6c2042c308e2c8253f259aa030517
877 F20101118_AACZAH mcnally_a_Page_08.txt
a7f6567020bed3527c1fcc7ba41a7927
defc268ff719ebfd98f60ed954e300a3821be030
85381 F20101118_AACZKB mcnally_a_Page_09.jp2
b2a94352296f36c4fc2e0a06f71c322a
1a602e79bd72075964d70859e61518c9b4ec8fbf
1490 F20101118_AACZPA mcnally_a_Page_63thm.jpg
13879cac9b15aa410bfa4665f0e0b00e
e96b0f1a81b6f3824510ec510031ffd18ff1bf9f
1051969 F20101118_AACZFF mcnally_a_Page_04.jp2
1278dd92bd53c278168a6c09b56cffe1
684221a179e03d21cac59e48d019ef3b7778453e
109115 F20101118_AACYYI mcnally_a_Page_19.jp2
fe02868cd3db3e11a648766304c55b6a
29f27bea97df299758758558d5bb2a948acec8d5
45206 F20101118_AACZAI mcnally_a_Page_45.pro
268cb795b9dbaf87318f5fa345650cf7
f3aaa8402440ce2b42297169b7fa8a4ebb9abbd7
86592 F20101118_AACZKC mcnally_a_Page_11.jp2
d7fbdc4bac84530c2b9f5622b5c4fdbf
1a66a95fc77e263f49c9833741e466ece566d38d
20485 F20101118_AACZPB mcnally_a_Page_11.QC.jpg
43fc8a37f75e9d9d2465e52b4ec29346
fe6a81d591e75fd8bd6ecc3ca01894789139cd88
1833 F20101118_AACZFG mcnally_a_Page_31.txt
8f68dd6c69dc4e341f08d9c58155ad65
15ebe6a289350962ebd6ae9e0243862b2a6ad604
F20101118_AACYYJ mcnally_a_Page_04.tif
dc841f517850a5a260428a2768347131
02687b2ea9565ff194954ae1303463a36d3eaf05
1824 F20101118_AACZAJ mcnally_a_Page_16.txt
2a8a267a5e782501337095f429b3559e
2cdd6cb6c1ede9db63ab4098b9f6d8ff822ee774
111002 F20101118_AACZKD mcnally_a_Page_14.jp2
a88139d2a27d463b644ed43e1c04429f
25d3ce3dfd70b1f708790cbca761f23cb74538a2
6462 F20101118_AACZPC mcnally_a_Page_56thm.jpg
1cfeb033d179fccf8a8210cdcb4f599e
d3529f42debd92be5182e773a7529381b902bbf5
2093 F20101118_AACZFH mcnally_a_Page_20.txt
1186eb3fd2a483480f08b0aa09aa9605
7020d4a49c78fff16013fefb145a99182a1e6c0f
111403 F20101118_AACYYK mcnally_a_Page_24.jp2
cc6e56b7532afa32a30b81fc50094090
312b8c43eab4b80ddae3341c255629ad67c147d6
F20101118_AACZAK mcnally_a_Page_06.tif
13e666a86e339656ec285a4ed6f055a5
1d78aca383e64b85be7cdd4fd357327c52897917
110520 F20101118_AACZKE mcnally_a_Page_15.jp2
b0084220d1fd23d0e15ccd7ade416428
374f08e1d18edc3d173f2d51e75e5559251fed79
62905 F20101118_AACZFI mcnally_a_Page_74.pro
0a61f24bfa580b2f29c977de9f74ffdf
b1481466510677579cb13e1160858562eb43df9f
106058 F20101118_AACYYL mcnally_a_Page_46.jp2
58dcbf7a26a88b8b71c44b2c33df41ae
cfdfc9f5b4414721dfc43d687d37681fbedc4dd0
108205 F20101118_AACZAL mcnally_a_Page_13.jp2
2fbbdcbf9fcb410ac8069e57d7457301
583721f00f249878e7193c72f9fcd17ff8e197b5
112253 F20101118_AACZKF mcnally_a_Page_17.jp2
5ab94e0306e09c58d77732797bd55344
eeb9b8b56be136b0f7fe4a9804efe2cb1547abb0
2864 F20101118_AACZPD mcnally_a_Page_38thm.jpg
10ca0e746584b2ae421635507185f315
dc0be7afa74985d0f4f11719b6004a5d08ce1a51
6339 F20101118_AACZFJ mcnally_a_Page_44thm.jpg
6bd88bcd78a1c3129a1ddb964c11ac44
76ad8250567f006b981b7911a6e956ceb97e4ae2
148451 F20101118_AACYYM mcnally_a_Page_73.jp2
665eb9fe04e9c926cc2a66df479e62b2
bd7a65818606a5e9c264b497136a1429f9988891
499 F20101118_AACZAM mcnally_a_Page_64.txt
a7d37610b72c44025d42da845152d303
58685b4632d50944bb5eccab8cb86c0918221eda
110832 F20101118_AACZKG mcnally_a_Page_21.jp2
98b2337b9c596ba66b9ccdabf4b8ed2b
1155fd06dcb72b7d0a4fecced016ad9324223dde
24373 F20101118_AACZPE mcnally_a_Page_31.QC.jpg
88b6391bc497614cd21c679ab42e0d22
d44162473a3ba4d795faa84584699eee42b27477
16060 F20101118_AACZFK mcnally_a_Page_51.QC.jpg
87db3da0983f0e713b3774771c8bb18d
100d58266f390c96211da1529f59eb27f2f98efb
106199 F20101118_AACZAN mcnally_a_Page_73.jpg
121d54730b2f3d2c5f0ab91d75793947
5963308127498de5d4a44eeeb93d5e72b8a2353d
108914 F20101118_AACZKH mcnally_a_Page_29.jp2
064ae91fc698294d4c0d93c2aaf910f3
a9be2693ce3c3de10cef5120e011a10f3735ae2a
28595 F20101118_AACZPF mcnally_a_Page_73.QC.jpg
b611d6b4b2d44845bec8ec2e9844079e
425cfc09f63c16089043ac56340903e9e0722d32
83646 F20101118_AACZFL mcnally_a_Page_13.jpg
b505ddf2bd1dc5d83b457c01eeee148d
a30246e30c3ab93ebccfc95e9eb6ef0c61ae6973
20864 F20101118_AACYYN mcnally_a_Page_01.jpg
833eb41f0970da7de41c3bdfc2ebcdce
0e67aa41406e11dd6dd435bb23e85411f9cab180
8861 F20101118_AACZAO mcnally_a_Page_38.QC.jpg
06fc1a0d8b910b1a02061abcac5f6aed
adcc32de40ebc5cea054d71127cac6875d0c4a5b
101636 F20101118_AACZKI mcnally_a_Page_31.jp2
ad1828f3a7601d3959f231fbdc736063
e4cc33d0adb6fa111e2c09871a983131d6b9224e
1820 F20101118_AACZPG mcnally_a_Page_03thm.jpg
e3d296cb1a6cf80ead6d3df70cbd62bb
9276f3babda5006a1d5504975b87453c1827f451
6137 F20101118_AACZFM mcnally_a_Page_28thm.jpg
30eb2f108af9d5675a2b9e15a0d6d95a
2fe525a0c02cb60a32bf5ac04b2dcb7fe66de19b
2072 F20101118_AACYYO mcnally_a_Page_21.txt
57aa0291ad6d0f157f4285a4fd1aa93c
bccb1205fdad300eb5000b8a31ce1393db5b6f81
1053954 F20101118_AACZAP mcnally_a_Page_63.tif
b07a8d0ed33156d4f867b4490ff9eaec
e9d99315c70dd99bc262fea668dfb94d11f4f76b
64194 F20101118_AACZKJ mcnally_a_Page_32.jp2
363cebdeae91bce60204e4f1d0597727
da9998eef1bea175ed94f5a5994648838fdbffce
29914 F20101118_AACZPH mcnally_a_Page_69.QC.jpg
7dd47f4fadcb0783bfc6171437acadb4
22675444cf85eedf8227b7259c6060fc047cc876
98912 F20101118_AACZFN mcnally_a_Page_10.jp2
754aec9e14b85684f364ef4ed89314d5
cee50d96b0a334461e3fcf2123e0c27f85b131f2
58105 F20101118_AACYYP mcnally_a_Page_51.jpg
8b1f79831b95405bdc76844a6d920fdf
1d756ca641a7e195f40cd179022495e6f80ac349
65615 F20101118_AACZAQ mcnally_a_Page_71.pro
29118c4c2584a136d064fb99ea12226a
6d6297851e84a967ce80b5f59a7f19939c86249d
716793 F20101118_AACZKK mcnally_a_Page_35.jp2
a078533bec8084cd69c5ead4322e873e
a1d0552ddade6040b1908cc0ec2f36b6c924af78
8005 F20101118_AACZPI mcnally_a_Page_06.QC.jpg
38336e918b50eedb9bc6731aaa7d1dd7
ab5682700374caa5527c892dbfd00067ffdc0bb5
5446 F20101118_AACZFO mcnally_a_Page_43thm.jpg
1dd7e44c079b4446e36102997f45697c
340750a41e5b674a113192a2d8630e18c67e89f1
F20101118_AACYYQ mcnally_a_Page_02.tif
7cb9580ae621403289b9560807e4d88f
84f77e6cc55c627ccac865fe1872756759a4ad15
11829 F20101118_AACZAR mcnally_a_Page_50.pro
dae44fa5259885a8c49391841dcaa556
4176004a5ca35c8e52601180e75fd27fb053d4da
712723 F20101118_AACZKL mcnally_a_Page_36.jp2
649a209d0a678273c07dcb3a1e3144fb
c5627657ffdfd35e9b5309e54779cb7ae6fdc68e
3831 F20101118_AACZPJ mcnally_a_Page_58.QC.jpg
fbaf3025b22614a96bb77f3b8fcba004
cf31184309876b0c77d3e08e4cadf368a7201c98
105726 F20101118_AACZFP mcnally_a_Page_48.jp2
fa7b2273fc3e84842e4ccd444a4bc510
20903e4e2c9250cac7326eff6681d87238654da6
51090 F20101118_AACYYR mcnally_a_Page_49.pro
ccbebdf4bca56f9ea0ea8bf3110742fe
43ae9feacb532a7471105738fcde63b051784cb3
2316 F20101118_AACZAS mcnally_a_Page_07.txt
622bc0051518225e21da3e9591758ca8
e6aa91b3dbc425dd358cb7455ebecd2e1b583c20
1051825 F20101118_AACZKM mcnally_a_Page_37.jp2
bdb6e0e56d1141cd5773046a59a7ead4
4ceadf1e67447adfe47932e967aeb38e0965c22c
26683 F20101118_AACZPK mcnally_a_Page_30.QC.jpg
a06a5c1faafa2ab6d008a3e89a36c6d6
4a70d36433a7e9d88b8f0c6f3af6681c67108141
F20101118_AACZFQ mcnally_a_Page_33.tif
1961f80ab0048ba1d3c11aa076be4c24
987b52eb7b76b266608a7f46e7bfa82a3024bf7f
F20101118_AACYYS mcnally_a_Page_56.tif
67c169af666ec4f45a95533783caec1c
a0e28dd6f9e02ff35d0ec2a2b95e18cafdd96dd3
84074 F20101118_AACZAT mcnally_a_Page_61.jpg
612b7866bfaf86611bc6c55d9761761d
e611624422bf2fef80ddbc8bd0346c2b8e949a13
441091 F20101118_AACZKN mcnally_a_Page_38.jp2
4ca82f693094a769e07d3660f38b15bd
b1142666e4eec0b7547cd32279888bb458b929eb
26915 F20101118_AACZPL mcnally_a_Page_56.QC.jpg
b56dff044ce947011c990efcb182e7ca
c83d4881960cbff1192d3293b10fcb37c1471c37
26259 F20101118_AACZFR mcnally_a_Page_60.QC.jpg
558087e8149d86c5db919b1246d6c50f
ef26e67f2feef3d87dffefc1a8960754e3922168
100189 F20101118_AACYYT mcnally_a_Page_74.jpg
1fea57c7de8cb0439bc7ae7c091460f5
30ac68e840462317d32e1fb4882a8ad781804891
108807 F20101118_AACZKO mcnally_a_Page_49.jp2
e588ff24d21a392dd43cf2e381cb9516
66913246b86ce00cab87a90bf338d1c43be7058e
25515 F20101118_AACZPM mcnally_a_Page_46.QC.jpg
aabe507d4c3340e5f4444bc72a5cedff
441790b92d05471e6a34960047cf1691d04d714f
59791 F20101118_AACZFS mcnally_a_Page_72.pro
b7f97d157270434cedc69e799784c26f
d81aa87fac0c6ead496a70fda0cb064a3e01475b
1589 F20101118_AACYYU mcnally_a_Page_54.txt
592fee97941e37bbfa36c750ab98d9ee
3802740361472bc1b95d3e6ee0e06e8fb87f2dbe
31997 F20101118_AACZAU mcnally_a_Page_42.jp2
58defbdb8a9241b82c077fe86d8c5b9b
d3ca5647cd2b3c88082926d7d308838e84eeae19
112657 F20101118_AACZKP mcnally_a_Page_56.jp2
6e059d4fa194f67ba38a834caad65bcc
574e3e5a17ec31384c6fddac692251f6ec791a31
2422 F20101118_AACZPN mcnally_a_Page_66thm.jpg
6eba1725015a8478b37519d0858943a8
7675efcb93a26cf5e4ba5c7e2c89887fc4641c1d
9061 F20101118_AACZFT mcnally_a_Page_64.QC.jpg
2acffe8efedba4905d7ced82f2fa897e
4fb70409437ec9efd0ac1710ee695253a65af8da
2036 F20101118_AACYYV mcnally_a_Page_27.txt
2bcb26ef7d57a0164226c1b668492768
9c4de4c1695435caf4e93687f7eadfca1520e277
1930 F20101118_AACZAV mcnally_a_Page_25.txt
2289b919278b41d312c6bca41659f87c
8639335a66c2482687d3ebf4af0d55dd05a5736b
13450 F20101118_AACZKQ mcnally_a_Page_58.jp2
d548bed962acbbc1f8856112cef3c341
9288952fb757b68ad3200c4c3f99521021bb6f02
6324 F20101118_AACZPO mcnally_a_Page_03.QC.jpg
dfb044f43128c3ed25ad2c73782d26e4
77590ef67ff44e9ccb82f06199a69d4cde095666
462 F20101118_AACYYW mcnally_a_Page_66.txt
cd70a00d766e0c0a069d1b1e3c2aeaf8
27131a70634ba0cc59284c0494943c55d64f5bb3
230 F20101118_AACZAW mcnally_a_Page_58.txt
0b0be3e1b64b9857553f266f79d25b5e
07abc0b839063740e606fbd75130c25da3e92dea
106850 F20101118_AACZKR mcnally_a_Page_60.jp2
cd81dfa93343a5493da01fc357cb99b0
563eb4f92bffd1167011fa716ce5d609d577afb0
51360 F20101118_AACZFU mcnally_a_Page_14.pro
94028588b5268bfb912bd9ab35ea6fa2
e97e6ba9e92dcf6e510ebb654b3fc9efecd3105a
4170 F20101118_AACZPP mcnally_a_Page_40thm.jpg
bb83e9359ac895504da1c532766df8cb
ffbaa0693adf39a8a57ee797c0af690b23bac0d3
1895 F20101118_AACYYX mcnally_a_Page_28.txt
4f58d9ca7440185440830aeea8521050
192615f06009fcad91c50930fe72880289e1511c
101948 F20101118_AACZAX mcnally_a_Page_47.jp2
0b92d3634a24bfd38404954a50e2425c
2dc0cad3738c103b1d0cbd1710458f64b40b951b
311384 F20101118_AACZKS mcnally_a_Page_66.jp2
92a827046a1cc8599e668eb5e09b7cf9
ccc4a3bb72c25c91529406d640076d7b9c5a1593
F20101118_AACZFV mcnally_a_Page_25.tif
0141c7c60ca99d2849ae18dc9ea015c8
bad97bbe1373021e87275a92b8253f07998f7615
26956 F20101118_AACZPQ mcnally_a_Page_14.QC.jpg
d1fecfc2a88597ce05f64bd7c15ec43b
6625514e2cb0c7da36e291f1add94b7f4049b69a
3685 F20101118_AACYYY mcnally_a_Page_32thm.jpg
80876398907c78c4cbc909d2ada59423
34a237c79f132ffe6041ba38e842745f9a78804b
2700 F20101118_AACZAY mcnally_a_Page_71.txt
9ac206fd14f8963cb59f6fe446601c4c
6f7e4d225cf7cb6287603f3673128f5801261233
1050809 F20101118_AACZKT mcnally_a_Page_67.jp2
899e95778d1814d0bd6f291441c74a17
381367072f2d6312a83ef5a4e6f6e6f9f302cde8
2421 F20101118_AACZFW mcnally_a_Page_75.txt
71388e160952f84969c9b2ed96943425
6ab27d90d4af38765f2496ce8591d21cf84812f5
49369 F20101118_AACYWA mcnally_a_Page_53.jpg
116dbc9f8a00e0dfeacbf0a6f8a0e47f
02cd4765b04b9ff69862b7d0c6116ee2e5be72a1
6673 F20101118_AACZPR mcnally_a_Page_68thm.jpg
3289ef1a9d2736bb5e02164870acb887
18ca4b6d87da1151286f51d7c73d965e30f0ef59
34602 F20101118_AACYYZ mcnally_a_Page_08.jpg
90eb26d0f87d7c1f2bc1da862d1064ed
afcae9e1fce38d152c303e5c3ec595ed2bfe7fd3
2012 F20101118_AACZAZ mcnally_a_Page_14.txt
87f122bf778b3d37acef16aaeb753156
b02c3ab8569172dbfb8559a0cb7f109587b54c3f
133166 F20101118_AACZKU mcnally_a_Page_72.jp2
f02d6ac1becafed3b863272ece0be224
87a78e38a1403129c1deba0e164bca5f74f6f20c
6901 F20101118_AACZFX mcnally_a_Page_73thm.jpg
83b26f4598040ea618faa85788a547aa
c000d3241cda118f9c466cfc716e7961c86ace49
45234 F20101118_AACYWB mcnally_a_Page_16.pro
834c1c88d15893e316e353953c344715
89aaf3f0ef294c0a57071cfdf5e97bcbb246ca76
2380 F20101118_AACZPS mcnally_a_Page_41thm.jpg
71e196b8960563bd14d2bec231fc0226
04a34b11458bd47beeb81a352fc2bc9b48407321
141932 F20101118_AACZKV mcnally_a_Page_74.jp2
f3f045808fdd647e8244fd0ab6bee6ef
7031b473c354d0b5c91103bad2e995f92393a179
F20101118_AACZFY mcnally_a_Page_75.tif
3fdf43b47116b2b542b139795970a91e
fb98d7747ab53075d7647aa32ef69e6c5a89f7e2
144992 F20101118_AACYWC mcnally_a_Page_71.jp2
2ffeefac91a576e8fa9c503e7b3cf2d0
50bb52382c8ddc0cb77c2d4998a475e272f7dd38
5895 F20101118_AACZPT mcnally_a_Page_16thm.jpg
dc0d1d9e6496f826c9c6853c777309ee
d46cd4977562c7722f55e8a8fc6b688ffc43a6b3
40175 F20101118_AACZKW mcnally_a_Page_76.jp2
039834f282ab65f66abf44aeca179402
af6f2eb6f142aa4aeb2a67af339de3627fb7f6de
48835 F20101118_AACZDA mcnally_a_Page_25.pro
fa772170021d96d3f29e3500e1ba0cba
2ff6efb0d840e1f103b291d309c1a53f180a19b1
84091 F20101118_AACYWD mcnally_a_Page_15.jpg
df9d32a38bb0ce88c97765e17b630e5a
47c514aa6d7ba2c896657a1d48a17bf0fcee3681
3827 F20101118_AACZPU mcnally_a_Page_65thm.jpg
0700d685e418d61c20d0197951219777
08c551846e9112b08e52d0d4fdd5c22dd30ebce6
F20101118_AACZKX mcnally_a_Page_03.tif
d773ab4a48b9dde947d10e46c26ab73e
64466f81f388d08d9611fa899feea24ab0d27e0a
15489 F20101118_AACZDB mcnally_a_Page_65.pro
c061c9f5fe5c585c714b2736b63b5891
1c3fe96d71d168cb235552f62942a852c71e5d37
38607 F20101118_AACZFZ mcnally_a_Page_65.jpg
bca99bf57e5a562b946a18289000d814
0f208a37ee153b954ca29f9f681ed738600a7001
82763 F20101118_AACYWE mcnally_a_Page_60.jpg
e9c1ce57f77df2aa048046cfaa4e59b2
89a06baa0dcc551d3f010dafa987bc951df80048
117254 F20101118_AACZPV UFE0014297_00001.xml FULL
80787c728334dc6a627ac02db8c3ad8e
e79c0eade137e99c9120668723666ed9eb40fb14
F20101118_AACZKY mcnally_a_Page_05.tif
2847b75b091557d785e690bd964e634c
8bed12ab9a7caedd36dd54532cccc5dfa2c38a40
6458 F20101118_AACZDC mcnally_a_Page_27thm.jpg
c2523ee2d68e09dfe73baa1aecf59e76
93cdc5af0c41cd752930ae3c41bb0998b913bde0
F20101118_AACYWF mcnally_a_Page_21.tif
05a782125f9268a3d45bd2e87315ac43
f4d1d6029352b206d0b198b6cd83afc76b081083
6365 F20101118_AACZPW mcnally_a_Page_01.QC.jpg
b7e60acb38cec5dfeec7d66091ea1674
83f412ceba0d2372eccf8c062cdb8968cecadad5
6489 F20101118_AACZIA mcnally_a_Page_20thm.jpg
606780ad04278b948723ca8132ca665e
b7de7e190f3ef2c8dfe25efbe9fc762b4012f5bb
F20101118_AACZKZ mcnally_a_Page_07.tif
ef35be2bb3947252d35d35a7ea7d0866
6ff8c52da8ebdf2cfb7a034bee09f8dd392f7653
2706 F20101118_AACZDD mcnally_a_Page_22thm.jpg
4b21800fc72d6a7f9bc0d09e5485085c
91ea7fa6930f86d01bcbf8e1e2b0f91f9dc7911c
488709 F20101118_AACYWG mcnally_a_Page_64.jp2
3e6ec49bd03229e37e8b4269824cddd6
a8e34feaf530895bfa242a515d01e8a9f0b0c511
16674 F20101118_AACZPX mcnally_a_Page_04.QC.jpg
948c602e0d4db762e8c5170a797a8414
39635003c3419a97bfb3a73359f272e4ba51e258
25348 F20101118_AACZIB mcnally_a_Page_41.jpg
b1ef6e4267c179649bbe9146123b8fce
71238d0418a3640fd97cd17015ce613f51900730
133294 F20101118_AACZDE mcnally_a_Page_75.jp2
c54ec02ffc694a97cb15e22cda51b1c4
e2c283dde4cca474b679cee3290ef00a6eb6c7ad
27599 F20101118_AACYWH mcnally_a_Page_38.jpg
b3799af21ec3954496bcf7ac8f3bffef
887320caa6f5552e58e5fac3988a66524c759e7d
3438 F20101118_AACZPY mcnally_a_Page_05thm.jpg
71878d972ebbaa25ac9dedbe0bc52dd5
890e0fe59a099b2a2726dad9903c6fad35c0d7d0
3116 F20101118_AACZNA mcnally_a_Page_04.txt
eb3b20fbbe98166f704561693bf10b40
985d3e34a45e4bd2edf7a4e2e4eea037565d95d8
83059 F20101118_AACZIC mcnally_a_Page_18.jpg
dad8082bf79d014d5bd60d7e44fa71ca
a052ad9b29baf5d9d03628a8acc5752d399beac8
795239 F20101118_AACZDF mcnally_a_Page_08.jp2
6b3f3da5980e7c61626a08b7a25260e5
d2604cd10eaa53d7646f5458c6f8eb1b884eac2d
81121 F20101118_AACYWI mcnally_a_Page_45.jpg
90f16658e7def66aaec9f5f4045d99b3
5206a918ba53a5fa3f66fff21c8458954c94fd6f
2216 F20101118_AACZPZ mcnally_a_Page_06thm.jpg
567e92107597f444d5289309315a10e8
eb2988ec2fc05bd3d04da6b9aed616fa8ca56032
37819 F20101118_AACZID mcnally_a_Page_39.jpg
81e289abd4833e056ed77f7dd018ea14
6bb45af4bc06b2e692dd3063e49a98e527e8d16c
F20101118_AACZDG mcnally_a_Page_65.tif
43787fc0ef1570321f26e9d554cd6cf7
2bccdb6f3d9055345c660c43b3c40b8c2e777aa2
92486 F20101118_AACYWJ mcnally_a_Page_23.jp2
7a14cc1f75492bf7ec30a6663d0db42d
0fe7f70a95a38b639f6d0e80021499074958bb86
726 F20101118_AACZNB mcnally_a_Page_06.txt
3cbc32e52c5398b257d654b40ad8d190
2f478deb237a4e3d9b9cd5bc347788d33f6d7c5b
14316 F20101118_AACZIE mcnally_a_Page_35.QC.jpg
fef10b235c05513c87041ea79c843b8a
13ad70a5cb2d6543cf4af9d346bb5d1b0643a932
F20101118_AACZDH mcnally_a_Page_57.tif
490e117ea495e08506c09a53f3216d03
c5a1d90851828908bddce3d5687bf18c6bc8ef81
771 F20101118_AACYWK mcnally_a_Page_39.txt
bc8473c1d61a2b8846432bedd20f69f5
71bcdd0cbca9753dfb6b6e42d14fe61c92c08c2c
1786 F20101118_AACZNC mcnally_a_Page_10.txt
331a7893f541b8eb7a3d7a991697ea50
1b7fd2c61e146848b47814fe2ee5f51222868f86
87570 F20101118_AACZIF mcnally_a_Page_20.jpg
741f33c8c60c9e61452644de6c81f0a6
808fb7ce422afcc57ddf09906cc19690c26d457d
1959 F20101118_AACZDI mcnally_a_Page_15.txt
c798c1c95e2dfb42a888ee4da7d843e4
a47465051a3d326f1f6c8ca664d60482c89d751b
1715 F20101118_AACZND mcnally_a_Page_11.txt
4ea7980ec10f91efe462842cb10e943f
bceb07eba8420fdcfdc520547b4562dfd34a8c06
80818 F20101118_AACZIG mcnally_a_Page_46.jpg
43cec1560dfc7c086854f2c374b315aa
27231e8e1e7fec24bb7ddef41739fbf9f724bab3
1702 F20101118_AACZDJ mcnally_a_Page_09.txt
5bc894ca9056bc5b9347090531457b82
226cb2bd408143cadbe77ee30143b54ef347dbd4
26299 F20101118_AACYWL mcnally_a_Page_72.QC.jpg
4cb7a2348a19a42af189108be6f95c1a
727c84cb2d73f747d30fa085aced51f07060535b
1712 F20101118_AACZNE mcnally_a_Page_23.txt
a5a049fc6712a911c542741cb6b23d6e
e97a14838bb48ba8c01d3e8751d0097479592112
2413 F20101118_AACZIH mcnally_a_Page_37.txt
434863eb2bdffc571bba2e3d976e39ff
0d97c04c9e3b64c7015922e0b50455c6a6fe417a
19335 F20101118_AACZDK mcnally_a_Page_22.pro
4036e62efd8250f7b57ee26dd1380dbc
209fa139b0ff16af0f987d5c5386c2ff9fd73e54
F20101118_AACYWM mcnally_a_Page_47.tif
c79db875a0df4aad5c2f6dc14a2088f2
867a4d25cbb8d5e600a4d45c3a194df01021e3c7
1373 F20101118_AACZNF mcnally_a_Page_35.txt
143ca8905aca64a4d108f33d6304bac3
8db39098dc5e33c0b811f35d1991983bd5179003
F20101118_AACZII mcnally_a_Page_45.tif
4d26c987e27c9d8b9211f894f5e149a0
b46aa902c9416bc0668325e3f8bc9afba8e8fea1
F20101118_AACZDL mcnally_a_Page_30.tif
11395669b7acfca12679bbc1ffe23543
7cfc914b06513d4ab887506ebe9f2292e2bece7b
26086 F20101118_AACYWN mcnally_a_Page_40.pro
e27aa1127c681fa13ec33e400948062e
ea9e922d62f6c0cad2138c22a47b4061fb0038e4
1464 F20101118_AACZNG mcnally_a_Page_36.txt
4e7df65026e228fbc5a4e51f3dc83006
d1fe34750953ee473ec668feb934f64348a56c6d
12113 F20101118_AACZIJ mcnally_a_Page_65.QC.jpg
1c4c736cbafc6b87b004995d226e847e
fff8e9a73ee73514124720524e5335c300f6adf6
1926 F20101118_AACZDM mcnally_a_Page_44.txt
23f15c36086021ec06f7d5429c87e7f6
36f6da5937e300df3d930a67220fe44be41a4b70
6040 F20101118_AACYWO mcnally_a_Page_45thm.jpg
ea2f873be9bc38924ed0470cffb472b3
93d2a67549277c0223c4bbf26806c1085eac2461
535 F20101118_AACZNH mcnally_a_Page_38.txt
f8df1ea7b77c973979c1ed119110beeb
2994474c2ff2fc940b21c64915a750b5c111b4e1
21208 F20101118_AACZIK mcnally_a_Page_67.QC.jpg
7ff3d69b6a9cec8667f9619a97dab12d
3b4104b9627f0efe42711cacbd5a1054382e7247
75120 F20101118_AACZDN mcnally_a_Page_04.jpg
b9bff6ce8a7a26194cf7e934aac37921
4af48387a79e2508cb8a663d126c96e794a4ec9d
24226 F20101118_AACYWP mcnally_a_Page_55.QC.jpg
ec71c85b5a1ee86fb84b6282b598849a
e46c20ee30d2711a66e668ffaadda8c66c5cee71
795 F20101118_AACZNI mcnally_a_Page_42.txt
bb9d9deba992e0c0b5df9a945e705fac
1eef5d3b2a575616f94757114707a1744da24797
108717 F20101118_AACZIL mcnally_a_Page_61.jp2
6f53f2b72b7f31863710de09525c29e8
c505182c6badd7e35b9dcec1bf28c4dafbfc31a4
13171 F20101118_AACZDO mcnally_a_Page_62.jp2
0249e5d3311ff83d77a7d3cb45dc6f54
1d433608f5c6d83f1ba2e9a179ffe4be3b807287
F20101118_AACYWQ mcnally_a_Page_32.tif
a80173c58a950ee9f979e466b34dbb70
91ecb3ba4a12b4742955addc46158cd41390a9c9
1771 F20101118_AACZNJ mcnally_a_Page_43.txt
d88329c78dcce7ed3e86277636f91064
eaf599b3e5c1af454fa8e587e5bcb74f5ba89402
1947 F20101118_AACZIM mcnally_a_Page_13.txt
3f13a608151a4f4b600b8121968b333d
b1799094acb6c442a994e8cc3f0534f168e95513
26736 F20101118_AACZDP mcnally_a_Page_61.QC.jpg
74841cea2082e83ca958c6a9b2d0b7eb
32062d38bd4290754edfbf52bdb0acd0fb963dfc
109344 F20101118_AACYWR mcnally_a_Page_12.jp2
14407f2e9e4527305be8ac3aaa04382f
2b8d8fdf5f977505d06d23745983e7d0e2896b1c
1936 F20101118_AACZNK mcnally_a_Page_46.txt
a13e33aad134bcb959b7c4a5b854703a
2dd6b55da4868631b4a53010017be8bf9d2eebb5
10541 F20101118_AACZIN mcnally_a_Page_64.pro
0d3ed16779572b4a499ee136aa687a95
fa00e6cbef4b37aea60334d379aa0671725ade54
30135 F20101118_AACZDQ mcnally_a_Page_36.pro
3d901258dcf256693664a010e901b4be
abd23274aa81e1c97e245620c422a7faab0b8e84
76517 F20101118_AACYWS mcnally_a_Page_10.jpg
3bbfe58a5eb0043af271b13184ab9a7b
bf62834441bd269e528a19fe6320761da28be476
1870 F20101118_AACZNL mcnally_a_Page_47.txt
74f8aad209b3286275676037bc3c78df
1a0e19e0a3973571010c6a5fa273a8e0b538eae5
653164 F20101118_AACZIO mcnally_a_Page_52.jp2
5c4d181ce26bed6fc8aaabe835e5ee25
918c15a17e1cde1c81cd97d9c6340072c6b6eff9
10917 F20101118_AACZDR mcnally_a_Page_38.pro
d555bc8ad4f0391d5217ec07d985839a
91775ea18fc387a0d9e04baaa07bec41ffb3d942
F20101118_AACYWT mcnally_a_Page_16.tif
e68e1ef83f98225ccf18eb434add0f07
4d071c3333888ff2ed464f131d70de7f072bd28d
1896 F20101118_AACZNM mcnally_a_Page_48.txt
36f0a01878e314c48719f827fda6da14
ada9d95dfb727e1327addca892cd9c127073ec63
F20101118_AACZIP mcnally_a_Page_68.tif
7c0f1e27813444a0e012b364bee3cbb6
2b77bcf136416fccf17ef25d17bb62f793ffdb69
2655 F20101118_AACZDS mcnally_a_Page_70.txt
3315edff50c9e8ee04febccee54684c6
cce449ebfd17dd8ca0b12358601a74b428255426
26839 F20101118_AACYWU mcnally_a_Page_44.QC.jpg
eff8b6127c0c2439935c969e93ba1cce
85a35228b4d456c1dc30baddfc0025916d91db69
2007 F20101118_AACZNN mcnally_a_Page_49.txt
3929c60534cece88a3c34d8b128e162a
584132995e8b3b0abfaad9a98f781a9ef316982d
F20101118_AACZDT mcnally_a_Page_67.tif
cfc8768cfca7282c6577e79409a5a25d
aaea69efaf00c4f2f7cdb5bb7ecf27bf2370c714
53026 F20101118_AACYWV mcnally_a_Page_56.pro
9f28c9d6df5a102ae98378ca4d4a6e60
a1d35d168d31d54902709ba19d43389242df076b
26230 F20101118_AACZIQ mcnally_a_Page_29.QC.jpg
824494e0a16a7f386e8440a22e126f36
39699477af654ea331bff9081541b5707aff1f97
582 F20101118_AACZNO mcnally_a_Page_50.txt
96ca1abc3d36c96229e68ff69e01c89a
5418d243b55f69f2305058a7d68f2f6cf412c13e
F20101118_AACZDU mcnally_a_Page_15.tif
b9c64feb6208439671081dc4aab3fa0b
8dce278887adcc84d43574be493246bbc77cb13c
50725 F20101118_AACYWW mcnally_a_Page_61.pro
5286930ca58e36b59e79eda04025f01b
b9e9ef308adb0b9f3b96aac661fd4a097446965c
78323 F20101118_AACZIR mcnally_a_Page_55.jpg
6c079240abbe035bbf219c539ca82232
32109ebcbfe1bf412aa74587c9eb5bdec0491d8d
1238 F20101118_AACZNP mcnally_a_Page_52.txt
a589fab03ea8b905afbf40dc53ccffc7
50b8d2cadf80472fea8051d37d20da6b2abf5693
23619 F20101118_AACZDV mcnally_a_Page_59.QC.jpg
21062505b562fc78c95bf86eb9bf9b50
5a0c4d8844d3e0ece8f0114b56e98d155401685a
11480 F20101118_AACYWX mcnally_a_Page_41.pro
d92ae25d6184eaacbfd3cccd7a8dca9e
8b1299276d7728f7a25c3f56d14244335c2946a9
F20101118_AACZIS mcnally_a_Page_69.tif
24f5625aa8c8f31b0ba4a0f76e5c04ff
b917b01d56586c56b1d01b66a56a35865e1a0a2e
1901 F20101118_AACZNQ mcnally_a_Page_55.txt
1c1edd7fc9a0eb2de640e312690bb1f9
f05861c9537a9d60d27666bccf017e9c9b4e2e8b
107722 F20101118_AACZDW mcnally_a_Page_71.jpg
c68e3f0c649c67376c2f006fe6759e04
5998c07d3e296e51996311f4135c5f27f01f13cf
F20101118_AACYWY mcnally_a_Page_08.tif
30163eba7d90c60d0ddebf982d80cedd
9a37e321bef4236cdface74bfd7e857fef5b4259
2001 F20101118_AACZIT mcnally_a_Page_24.txt
f32be4ac15a5b852c555065de7d4f7ea
ab28e0d7d87b9b91f73066610b8408145191a35b
2081 F20101118_AACZNR mcnally_a_Page_56.txt
1325f8700f2f455d2a6ddb7119d00ff3
f3d38544a30da35bf0918a67036d6ec8a7bef0c9
4187 F20101118_AACYWZ mcnally_a_Page_77thm.jpg
3281181e9f8558e304e81b5a584451aa
72ec95ed187325d365b7786d25cad3ea0adb207a
90790 F20101118_AACZIU UFE0014297_00001.mets
f8946042fec478e34560fe5596003d09
0dd932695f3c5be9e31175a1d119c82aecbadf19
1997 F20101118_AACZNS mcnally_a_Page_57.txt
70e4af49301b93f22fd0e397bb908ce2
72b0ba152edf5e8cc4ec275edbffbbd5a3111736
28317 F20101118_AACZDX mcnally_a_Page_68.QC.jpg
4c3660d0d55483984d8054921bcda2f8
286721ed08dd85663120007706e218463163ed3a
227 F20101118_AACZNT mcnally_a_Page_62.txt
5ba3b269e54b088238e74cdd821d0ab0
e72da19dd2a557d75630a82f92a086f9bfdcdc52
2476 F20101118_AACZBA mcnally_a_Page_72.txt
19055bee7c077636692075d568d64fef
7b12b90a844f832cf36a02ce159cbcce0291ed2d
103770 F20101118_AACZDY mcnally_a_Page_45.jp2
81a7e32df31041895fd5808ac20698ed
2520e301c2ff6cb3e0fc6a8189d5e03947cd1ec9
1744 F20101118_AACYZA mcnally_a_Page_67.txt
ff58ea09cbb905637614358ed8552e9e
ca2bf928f179ec7a70c27c5cbc879383e3c99ac4
351 F20101118_AACZNU mcnally_a_Page_63.txt
99885ef39466e5411638ca088a52b78a
92f8eca4ee29da7eff2e9188e21cc3955d2e6ae0
F20101118_AACZBB mcnally_a_Page_66.tif
2ee0a0f5464605b45701808814b67ba6
fb9a8a1ee69d52f658264ce829756c326ad501f6
107922 F20101118_AACZDZ mcnally_a_Page_57.jp2
61e3944776e8f320c304149689b3cc0f
7ce33a9f1c32de662b6e024810b28edc66f4cde2
20198 F20101118_AACZIX mcnally_a_Page_03.jpg
2af5e1b56ed7b3df1e381041bc933123
7409050bbcf46a35fc4723a8a111ca3cb1fbdbca
3628 F20101118_AACYZB mcnally_a_Page_51thm.jpg
722ef067629e3fdb215020690c1e8202
ca155e77d4b25867975bbf86e25efbddafb96821
F20101118_AACZNV mcnally_a_Page_73.txt
ca1648e691c0254dd2dab614c84be9a2
c53bee1a9d4ee9a2823d2f8c046218d22505bf7f
58689 F20101118_AACZBC mcnally_a_Page_05.jpg
1b2db80896189ef5aee5921f1e3bbc82
ef5f0e3712a8863ab708cc2eae571cd1512d6724
27995 F20101118_AACZIY mcnally_a_Page_06.jpg
088dd52b63d9e175fe272220664b54c4
6958410bc56f91b441fb8db693d38ec558f860f4
1051978 F20101118_AACYZC mcnally_a_Page_07.jp2
bd3a510ad8a6313c6dffa4de756d0f69
463dd489aab792dbaacbf265e8007906096b4951
2577 F20101118_AACZNW mcnally_a_Page_74.txt
c1530cf4e2c50103f447a0d53390e2f5
2441b0d6482d8b2cc3a2be0fd5e2f908951d4354
F20101118_AACZGA mcnally_a_Page_19.txt
f2b3992442750f5efbe9826de43367b9
f61ef171d61b0b7e2c1a9706de5d713eb1ba7c83
82253 F20101118_AACZIZ mcnally_a_Page_07.jpg
bbda18da882815340e6753a4ee487dc4
9abcb35fdfc094a89b9dbf7c3fdb1e855c1a0159
1021 F20101118_AACYZD mcnally_a_Page_58thm.jpg
49318474c514a5ffb4743a42121aec6b
a84af255314aded9c8071d68f1a2258bb945d572
26417 F20101118_AACZBD mcnally_a_Page_12.QC.jpg
822532a272ef279e3c734d6d5b55c57e
58d305189ad2df56b0109c7ca2273f0880e0bb5f
715 F20101118_AACZNX mcnally_a_Page_76.txt
5acb2a19b96800b929beffe05611ae99
1a49cc55cfac8dc8ebab90d01477f4d92544323c
100251 F20101118_AACZGB mcnally_a_Page_55.jp2
263fcc19cd5e13faeda0f45d67983dc5
ed022d78a3c2f45030b0bc004cc503c6416a7cb5
F20101118_AACYZE mcnally_a_Page_60.tif
518b0c1aff08dbe027f42902e671a5ad
597b960d5bb88ef3eb6d9cad349ed5b0fda235c3
3604 F20101118_AACZBE mcnally_a_Page_52thm.jpg
4887821e821e8d9b799e8d21e44e1f3b
4668d7d63676f41828a02dfa06ad450a16bf745c
1246 F20101118_AACZNY mcnally_a_Page_77.txt
df17d6b17fd98ef001dc6807f6117a53
ad2c81a30559f5c68ebed8c1a8b149ac6b595fbf
69458 F20101118_AACZGC mcnally_a_Page_77.jp2
092a621433551b6061b9884df4907e4d
cbef21c4a19987ced987406599873d371b487725
113673 F20101118_AACYZF mcnally_a_Page_69.jpg
c633c4b19ff39407b9d34c204befb59f
c483decf9174b2fd58d532445d5bd5eba7406681
23496 F20101118_AACZBF mcnally_a_Page_01.jp2
e2db81bc76541b10a8ff5f697172100a
fc57f19bee940fcb12da8df150c0002ca42ef08b
1777 F20101118_AACZNZ mcnally_a_Page_01thm.jpg
e9ec7bd03fbf8bbde90186356390bf61
99e041e9895dbfaff8c2dad7564079a534b20248
F20101118_AACZLA mcnally_a_Page_13.tif
b7771e95af5b42a707c667a57361f3a4
82d13d24db73336351106555e19e5f77a9b29322
1188 F20101118_AACZGD mcnally_a_Page_40.txt
e6c0462bbf9299c19860fde1030e743d
1b5974a74d41d090b377a2cb6edb204a62dd0740
6329 F20101118_AACYZG mcnally_a_Page_24thm.jpg
6fed19d26bce8b16be5c65cbabb64ca5
8339df011968ffb882ea759cf1c95eec72295429
50768 F20101118_AACZBG mcnally_a_Page_17.pro
636874e7c0de9504542b691b215fabda
94becf3ec1f8753e71e160d0adb621f7f0e4db20
F20101118_AACZLB mcnally_a_Page_14.tif
38d2b86acfbfc23840bbc6a4102a0596
68d8ba8266f3d23e50ddf660ebcb7e352cfc2dfe
F20101118_AACZGE mcnally_a_Page_29.tif
9da9764668e9dbd0bb1a7ab4a99c64fe
4eb110b889f0ed8621939374e3313986b72308a2
84292 F20101118_AACYZH mcnally_a_Page_57.jpg
a2ba53fb2dc7710ae202711d71f2c276
31c206b8777ccc6a0588cc3b68ec616c7ff6074c
21729 F20101118_AACZBH mcnally_a_Page_08.pro
2391e5d7fdf2ba580a63d9b1002b1a7e
437411109c76f2372296eb91e78daa7a19e2c064
21460 F20101118_AACZQA mcnally_a_Page_07.QC.jpg
2da8285221c4eff1114afc37a83ee055
1053ea2b4fe6123ce20709976cca1b20e1504f0c
F20101118_AACZLC mcnally_a_Page_20.tif
ab8a22354a95ce0658e7db9d2ce9d08c
2fe82862a5614706425fa831accd4654b1be4f6d
24828 F20101118_AACZGF mcnally_a_Page_16.QC.jpg
c7f5333bc81615a879f67ca3493459b4
671644ab638700c33424c2a07513e74060fbe095
F20101118_AACYZI mcnally_a_Page_10.tif
2726f45d53c08aa5d4105648cc5d3339
b6b3c740bb2ebf4707c98b6dd0317655eb578396
36418 F20101118_AACZBI mcnally_a_Page_34.pro
9a7e1e840650ac38a5f7fc7f7b4dcae8
62509cee4405095f196a3f69b2b270c203c7d26d
2497 F20101118_AACZQB mcnally_a_Page_08thm.jpg
b47cd7c9347999a5bade7a24e3f08fd3
eba5d9c17511cfb320f15209d605bf59f2154719
F20101118_AACZLD mcnally_a_Page_22.tif
bbe9376cd278ba9b57b19a9e7a76b869
03a17e1e73fe02e7cb4b6089fece567d53e0efad
F20101118_AACZGG mcnally_a_Page_46.tif
036482780a569384fac16d7729dc53ce
033054860e7eec36335e112088a63f889e90ade4
90166 F20101118_AACYZJ mcnally_a_Page_37.jpg
d5abb503ebe5054cbccd3c38f9f5f742
9c1bb7508a831d232102e5bd8a4785b212580ff6
22929 F20101118_AACZBJ mcnally_a_Page_23.QC.jpg
7e7062c14ea5afc9fa3aae30583f7f75
143a3b9dd5c0f0c5cf99591d8b87c5e530aad4e7
4905 F20101118_AACZQC mcnally_a_Page_09thm.jpg
674eeb081e4225943289ef07087e8c9b
0983645ccc3b7cfb4ffabe35f3cdbe189397d3a4
F20101118_AACZLE mcnally_a_Page_24.tif
93839a7e2f962854f580f630e7bf7a80
cb4376c6494e4f2e0f409d3908f45071c980b11a
6768 F20101118_AACZGH mcnally_a_Page_70thm.jpg
b9f84490a942ba749027d0e85743f723
cbd2c7da60c36306897b20bdd3460ca7d1056189
6369 F20101118_AACYZK mcnally_a_Page_17thm.jpg
c65bce97bb1ad072d33e4f630c4d0634
8b9a2864093ca25e5a2b4d93f68b304e9c01ebf5
F20101118_AACZBK mcnally_a_Page_18.tif
f6b55b3bceff10589dfbbf320df0dd45
5707a86877cc957fa28e98f4b8ba40251a976b7c
20006 F20101118_AACZQD mcnally_a_Page_09.QC.jpg
6fa0501313adb9e181760f325ce866ce
8ccb6b018bdd4b2e4b9fe0173790f7025865a8ba
F20101118_AACZLF mcnally_a_Page_27.tif
275673ed1ee0e7d4a13091883a5e43ae
f13d1c3faa5cf59e0675ced0e7277ffdb28ccbbf
147660 F20101118_AACZGI mcnally_a_Page_70.jp2
b3275f0b22445a378acfe0ab3700990e
cee1a381b4c73af5474276f136a373947bb10ad5
6228 F20101118_AACYZL mcnally_a_Page_49thm.jpg
d7c09923f666f3555bc48827921486ed
8d0a3faca1f7a7ad16a2a52bad89f78e6f2e2b58
7000 F20101118_AACZBL mcnally_a_Page_69thm.jpg
84cb30af2b5114b1b2e8f7b637d66ce8
2c865ef9d012113f81d9b18ba320603442d8c0e4
F20101118_AACZLG mcnally_a_Page_28.tif
5ac71023e196e4f48e747d27a707f381
a4b5ff7a0c1b192cd475dbb43cfd90e64f0aaf48
51960 F20101118_AACZGJ mcnally_a_Page_27.pro
cc6f6b9f6d5b3d1f96cc9c0ed32bf362
56a756b2f420b05c2ef6b1052c20e1519761517a
6264 F20101118_AACYZM mcnally_a_Page_14thm.jpg
8e01e72bd2fe4470af1c52c9c896ec4c
77ce632bb396eeaef8deb060c65a38a0cf339fbd
3863 F20101118_AACZBM mcnally_a_Page_34thm.jpg
bb8e0bfdf208c9e47b3bcc64cd3a1784
930c2d4075605a4831cf5dddaf01dc2a79c589ec
6256 F20101118_AACZQE mcnally_a_Page_12thm.jpg
5fe2ef16c39c4e33e48de99b4fc3ec0c
e00a6d91e526466f8ca453d167d56bd9ee8e245e
F20101118_AACZLH mcnally_a_Page_34.tif
539ade1d068d040cf5c269671b7964c5
268477a662a9c19bb5cabab0a98d96217dd0c916
20882 F20101118_AACZGK mcnally_a_Page_33.pro
e046b620868621dbed51e7b2286df3cf
67948254b484bd035607adff6a861a8a2332ba4a
8706 F20101118_AACYZN mcnally_a_Page_76.QC.jpg
a809fc3e1ffa206bd245b2dd14df4c76
8af27cb0347f444777a7252d189d355e8c1d75a7
1981 F20101118_AACZBN mcnally_a_Page_18.txt
30162802b6d2ff08f995c2f3ae84ee23
c7718524a9b651c9b5a1cf2db6adf9e4a3a2c5fe
26420 F20101118_AACZQF mcnally_a_Page_13.QC.jpg
785958b65cc6f4bd835a9913ab7731af
23d3b42b3749db0b16ee1d246002ccf587d23f0b
F20101118_AACZLI mcnally_a_Page_37.tif
8925ae3683ea0c183219fea9ef306046
b47875fae9aa48c3984a1f55fe2f25ebe0545e34
22766 F20101118_AACZGL mcnally_a_Page_43.QC.jpg
bf35ee1b2a8a1347e765a54a6a63ee68
7885656b35e1f7e72278bfa25f81466059f602b6
1788 F20101118_AACZBO mcnally_a_Page_45.txt
ef0ff264f144e9117d7e83ec524fc15d
59fdba312962e7f84f4958933a1b955840e7f1df
11067 F20101118_AACZQG mcnally_a_Page_22.QC.jpg
3369e3486d8776af1560042db1255d17
2d3780f5c25595018054ee0e143d265b94cc9217
F20101118_AACZLJ mcnally_a_Page_39.tif
d674435d2ee5743231bd5a7892bfa501
88ae2f038d50a5fa42d0c8fd5e417ccef68dfce1
49335 F20101118_AACZGM mcnally_a_Page_29.pro
4b3142224f6cc65285cdf6db3c969322
d6624b89132c76a80b36be9bb025a576b7ca0fb5
9510 F20101118_AACYZO mcnally_a_Page_50.QC.jpg
020e6852f5a58cef0e20c32592a2d258
dc9ccfebad53758a75b1335f8ec6c0afc97b377b
4678 F20101118_AACZBP mcnally_a_Page_62.pro
b841e2900c0c4e40f0af64eca4c91b63
9f59c1bdb8b446bab0cf6ffe2c5ea97223399f11
27543 F20101118_AACZQH mcnally_a_Page_24.QC.jpg
ed685c2a0cfe0f106edabe4d58dcee25
4898fb0326ea2853216e188450e865019c643b2c
F20101118_AACZLK mcnally_a_Page_40.tif
ea26079b4d6ea9c3f74337ce4da69218
6cd2d3ff4633006ab9cc1b1902616e051ea81dae
1134 F20101118_AACZGN mcnally_a_Page_32.txt
9536f4aaae48e68cbe8781a78b0d2522
8a9457b5f4110434bc463fd3c968830023758d83
2167 F20101118_AACYZP mcnally_a_Page_05.txt
5df7b5ebd4cd57f38c81b75ad63bb6b7
225bca1675b3c5678b9aea46f0992ab8ba36b893
3929 F20101118_AACZBQ mcnally_a_Page_33thm.jpg
7235ebc30713ed36cae7a371d9dfdd79
948aa598c7e3397473884d952787b19b248f4bff
6133 F20101118_AACZQI mcnally_a_Page_26thm.jpg
443d7b2d6bf7942d0f5bafa7d3476b17
60b7e51eb76a9da9722fb035026b069c10eff2ab
F20101118_AACZLL mcnally_a_Page_43.tif
5c00e191589ee96a78d23c82dc7e40ea
f5a5ee3f51db7b7628f0498518bc5cfd9445973f
30624 F20101118_AACZGO mcnally_a_Page_35.pro
5756e5300dfae963d63cf93a5ad2ee98
8b26e1a705058421e1f9365d7f59dba11b8b477c
4226 F20101118_AACYZQ mcnally_a_Page_02.jpg
da596152eeb2bee749a4bef32277608e
1f5c2de02e7d689cb01d52f5c4bf728d4f3403c0
84567 F20101118_AACZBR mcnally_a_Page_25.jpg
94b451984fa2b17a350099ac19144e3e
70a5d1b96bbaa32b624fd6ff7d1ec9a2efbe8560
6355 F20101118_AACZQJ mcnally_a_Page_30thm.jpg
de9c1f42a6964a92f0be8a3a2331fc8e
2e155808ec52470a0ecf0524a579be4cff34ae5d
F20101118_AACZLM mcnally_a_Page_48.tif
56f58f4a44929f9aaf559c3298171a66
ae93d563d9622ee5564d9b637325bd45fbc8076a
1993 F20101118_AACZGP mcnally_a_Page_17.txt
b697c1f7ce46aec5609c667fc513acc1
315320c11941ee20951e787e5d52ca1fddedcc0d
F20101118_AACYZR mcnally_a_Page_61.tif
f4a592fca39ed0fe59871d478823aff9
b9d3d63f7b80ec1df1dcc5e97cc856cfe013e4a7
26161 F20101118_AACZBS mcnally_a_Page_18.QC.jpg
3aee1b7d33d8eead517cd0895052eee8
3814a2539a20b80eee96c481629989d19097bb2c
5947 F20101118_AACZQK mcnally_a_Page_31thm.jpg
4d3d8797198ee33f85da34d4d1b58aa5
27b68b1bc40c4da41a95b569ec5cd2529fa70277
F20101118_AACZLN mcnally_a_Page_49.tif
bd7056458573e410184485cd05296185
46e39b6c15cbc5d580740fd2b954f19609788808
2868 F20101118_AACZGQ mcnally_a_Page_50thm.jpg
ef2129f1b310d7e8f05a9723bc47156a
ffa4b492d373cc3de1f295579c68074285ff5c6a
F20101118_AACYZS mcnally_a_Page_54.tif
9b03688a6bce98b811941ab3c0bd202a
c70f0787b4a492a18a82400c6ba1a42d14a28881
47423 F20101118_AACZBT mcnally_a_Page_39.jp2
20a25f760129efa46503e2eda6248d97
dceedb22bad55a242e1597b2d1bdb71c88a09754
3375 F20101118_AACZQL mcnally_a_Page_35thm.jpg
6dec5b5f5c2ca117fb843ac867c8ea01
3096f9e9436799195574ccc33f6affbf3ec9b2ca
F20101118_AACZLO mcnally_a_Page_50.tif
ab257f85a220b39836b8b7ad1ba4feee
1e21beb12b98040d306f4ea6cd6c0b1c8b987393
1175 F20101118_AACZGR mcnally_a_Page_02.pro
e1f5de938ca75b0c6aee8fb6aaa1ac86
b3f9b5eac8d0ab46e60e0b2d3d7d909309f1101d
F20101118_AACYZT mcnally_a_Page_19.tif
0beeb1aa194be69cdaab5df8b68eaccc
523a8eab88ce718de24418e021226af508a9362b
25247 F20101118_AACZBU mcnally_a_Page_28.QC.jpg
8b953802dda4843682cd9553f8d1369d
a29cea33698a53d76262758b9fe530d664e833e7
4956 F20101118_AACZQM mcnally_a_Page_37thm.jpg
1f2895a7d6c585b6cd792545cc819c7d
122be1f03bbca63e2289135f4fba9c35d1c22682
F20101118_AACZLP mcnally_a_Page_52.tif
16d8408915d8bedaff818bd3bd78606e
a7e3e2d424727355211247c165f9b69d0e96bec3
F20101118_AACZGS mcnally_a_Page_11.tif
9555dba0b157bf8d8d292e4cfc7e20b9
3a63dadf7eb2436b7ec3b98d5dc621555801ce7d
41290 F20101118_AACYZU mcnally_a_Page_23.pro
2c0d4483b670d643b6918693b4b71179
cb2c466a90e2044ce55332a4bdae262d48a1a3f4
7635 F20101118_AACZQN mcnally_a_Page_41.QC.jpg
e068120273c62787279ba35c42d3ac92
399c8a2a072fcdc0e4d411e13a8f94db7259e4d5
F20101118_AACZLQ mcnally_a_Page_53.tif
49a7b1875e022912f5539e17f5ab71e9
2053f7ce5e266473a4baf4fa7c4550c7a3304750
22395 F20101118_AACZGT mcnally_a_Page_63.jp2
c9e23e3e0e75837ce54682743a81c745
7a0f22784ef68dbd4dcce6d2763f7552e54b8354
27560 F20101118_AACYZV mcnally_a_Page_25.QC.jpg
73f1d93493113e505404ab17d0f9b53a
cc6e72416d24f2518911a4d049f4a5ea07e2c4ef
58405 F20101118_AACZBV mcnally_a_Page_75.pro
7cc74c354e1308e8c66d787d8bcbfa75
0475d8c6dba819e19d66e0ced50e80989829c335
25918 F20101118_AACZQO mcnally_a_Page_45.QC.jpg
342f24e118ea32c0c809c66768ac276d
21aa3fcd50daaff560ed9181979114b4d0c35f0c
F20101118_AACZLR mcnally_a_Page_58.tif
2f9c2edf5668b3b8d3fd64b56dcbe4a4
7fa33d979c3875134dfaf1af01daec899e2b1176
9904 F20101118_AACZGU mcnally_a_Page_03.pro
e2035a55d9c7fbfdbd78cbcc3a0127c2
59a32e5005a5adb6c28f44705d0540e294806b90
47931 F20101118_AACYZW mcnally_a_Page_48.pro
bbd798725865e9dd26f665391c9c6c94
a566b2ba36912ba47b2acad789574df1d17fec1e
3294 F20101118_AACZBW mcnally_a_Page_53thm.jpg
c897a368293701330629d846933b107a
802b2818abd26e484c9fc71eae0014375ad9b1a0
6116 F20101118_AACZQP mcnally_a_Page_47thm.jpg
382cfa7cad9edfda11c6b39711d5a615
c1ce07e72b6816ed1c44d540bd5b138bfc0fc364
F20101118_AACZLS mcnally_a_Page_70.tif
0f1782d8046932d99d33be081d224123
26135c4b41319d08e9389f47f6febb5598199f44
15843 F20101118_AACZGV mcnally_a_Page_40.QC.jpg
226cdf6881ecbefd84c259a1d9209719
f6f5bd8503186d2fe5db4a893354252de5a98a98
26113 F20101118_AACYZX mcnally_a_Page_49.QC.jpg
d7ae71f897a68726817275c4187ddb6e
55a11bed913cbdd5d2e07aa85b77a00431700dca
108859 F20101118_AACZBX mcnally_a_Page_25.jp2
be7cea72fa6b400033c43f66def55b82
53ff8b8f3dadd6d0267c3994556687b45c36f689
6175 F20101118_AACZQQ mcnally_a_Page_57thm.jpg
1d343a0bc3cea821653c68918f136ccb
093f12e6c5193816c247abfd925fccc9a51d2752
F20101118_AACZLT mcnally_a_Page_72.tif
d936a504f8e90398c5a105a7fab17775
718a69848ebe51220f2c33beca019b83951298e6
F20101118_AACZGW mcnally_a_Page_44.tif
7afb3294fdf18082b665d548031d898c
a7e2b14449b2e1ab5a208d78ba078c7103f98f06
16049 F20101118_AACYXA mcnally_a_Page_33.QC.jpg
d27b7929aea34d359d99a7575bc2f051
9ca98d4fff655e25c4b07a10d0cd8e42b9868ffa
F20101118_AACYZY mcnally_a_Page_12.tif
36737ece3012f1dc44820bd16e787c93
c8d28e57497cf0936f668b03d0ce34e438355fcb
8485 F20101118_AACZBY mcnally_a_Page_42.QC.jpg
032c96dec60c76c6fafdb8cd8168bb9a
76db79c0a68abbc75b3456e270981566a22effd2
6143 F20101118_AACZQR mcnally_a_Page_60thm.jpg
871abebea61ed952769e86f468004b95
d4af549a0be8f2288a7ebad45d43951fc004ee39
F20101118_AACZLU mcnally_a_Page_73.tif
89be956e8b04ccc2f5cd0a8164893e8f
43f78eb6519b9d942180d24cc5c4f6cd906ab7ff
F20101118_AACZGX mcnally_a_Page_09.tif
dcc5c110a313d824a705416ac99c019b
0e13fa0e68e913347fa43671b299d5e40d65490b
6326 F20101118_AACYXB mcnally_a_Page_29thm.jpg
17335605e2ab824d4b51cb4bda64c26c
bd89661aead18dbf5a9461c9d2da10585851e793
2740 F20101118_AACYZZ mcnally_a_Page_42thm.jpg
cf21f10cc33078354754a9f1a56a8869
c6de2f9bf07c370f2aa5240b8a0baa7d8007646b
6162 F20101118_AACZBZ mcnally_a_Page_63.QC.jpg
e3323fbc748c5042cc21917e61be6612
2745539ee6dab9c31bcc2b9c41ece0eec044289e
3748 F20101118_AACZQS mcnally_a_Page_62.QC.jpg
b17dd58cf3783f2cf32a119ec273c746
e32882a96840fd2094ad2ddc1dfad45c262076e9
F20101118_AACZLV mcnally_a_Page_74.tif
7c363d6b861dd696e45ab83265d1e7cf
927ccd7e60069a1956416c4b25be46436b8eba73
F20101118_AACZGY mcnally_a_Page_31.tif
8b19e6fb435d58ae0dd436edfbf687ae
97350c7d2fe2c3d92a4d02ee43531827fed4b545
83969 F20101118_AACYXC mcnally_a_Page_49.jpg
e7ce2b179f5b652b3e2a3e5a19dce02d
e912d79e80cd5b58a5552a0bb58ea62f357723fd
6632 F20101118_AACZQT mcnally_a_Page_71thm.jpg
9cedcd01992ae47e1924b39375289ae2
72583f584d2c4b21cbb22be3ae634e98110e5f1f
F20101118_AACZLW mcnally_a_Page_76.tif
2319b9886515792833158c931a0f0b28
8a570b510dcfb687eb80963363327c084514859f
75470 F20101118_AACZGZ mcnally_a_Page_67.jpg
7b69b403e74265893ceb84364ae0a08f
2d5f222210ac4b9f0a1df81a4b1180e1b0d7ddd5
1259 F20101118_AACYXD mcnally_a_Page_33.txt
e51978d1076821298e0624fc5b41d016
bd5afff2192e211de6d35d2414b0f6e2e5e59ef6
54133 F20101118_AACZEA mcnally_a_Page_77.jpg
1f069e4d969740891a0d52af49a3605b
90cd71147018208291ac0a96a952263352d285d8
F20101118_AACZLX mcnally_a_Page_77.tif
a36e758a81ff47655476eab08c9218fc
24becb326d8d229725e940afdda05badf46db497
88161 F20101118_AACYXE mcnally_a_Page_27.jpg
45c8680239e6e77f42dedfc62e284858
e772973b6da765cb65560c821757f34226e21012
42782 F20101118_AACZEB mcnally_a_Page_59.pro
6638fcb4a67df610a8a655dd8d15ea92
0fcb92716d0049472cfca13569fc684c6205825f
53330 F20101118_AACZLY mcnally_a_Page_05.pro
6ed4f6ef95ac42f325f8bd20f9ae0a28
cc517f08a82e38b982502c8e31c5da0f51d2cba9
443 F20101118_AACYXF mcnally_a_Page_03.txt
1716e6b325da89f5a86941e5335d8405
1badc6484e2b414e98e3c3d2f460d751cde419f0
66093 F20101118_AACZEC mcnally_a_Page_11.jpg
810f97b2cd7956971ff6d0b8f7c30a30
0b4e51db6f64ecb07f41da032a01e12ca2ca87f8
57920 F20101118_AACZLZ mcnally_a_Page_07.pro
8aa7e00027c5a5d34dd11829a651dfc6
d52a31f8fd9ec082389eb7191b03f932e6263b9e
769 F20101118_AACYXG mcnally_a_Page_22.txt
6262b0824e7b2fe1995a4110c8a58d30
568343e9a93e032052650e160f0b814aef375ae8
66712 F20101118_AACZJA mcnally_a_Page_09.jpg
bded1f1cc4d02119fca3bebcbe61ffa3
8c5de8650e98996b73eca591e09b01f13acafde7
6168 F20101118_AACZED mcnally_a_Page_46thm.jpg
a47e47a84bbb85d312a1ae05df0fbd64
335294d4e34ecf07960aad1f596f85328cc67c10
6165 F20101118_AACYXH mcnally_a_Page_13thm.jpg
5df528c0a6ac18b7a6b0d313bb6e6807
bf4eb116854ed165a86d1c389d7aa79feaf4173b
82546 F20101118_AACZJB mcnally_a_Page_12.jpg
e4d68e96ec17793be14519aa54b5df0a
6a835a092d3faf474c67c80abd073510655586b4
95294 F20101118_AACZEE mcnally_a_Page_59.jp2
0ab760d31b6d5009b0abd5fdea980eb6
e7b463e71ec22bb4bdda9e546c6e98287fda55e9
417775 F20101118_AACZOA mcnally_a.pdf
53df7291fa3d49b6e7133930108a0a3e
9d3d9ed0c7f4e8b550408b37323880a931980b4d
32665 F20101118_AACYXI mcnally_a_Page_76.jpg
d8c36987084a6b876c76dd63032f1f8b
cf90a5838ff3ad57fb2e3a4fa2c9ae59af8ec686
78393 F20101118_AACZJC mcnally_a_Page_16.jpg
7ec5c70b4a943f0e0282097b81676633
c6c28e4da994e49471534032c5b987d6f7a6d17d
387371 F20101118_AACZEF mcnally_a_Page_50.jp2
6ef0a3e019ee3c8be995d96dde77b1c5
2de241139d7db9281fc2c800f31b0c1c23b8fe03
6151 F20101118_AACZOB mcnally_a_Page_48thm.jpg
f3a46523a47ebc82286898e90c714005
dae4dd4fc659df1da3699c2a001f97ff87a073a9
619 F20101118_AACYXJ mcnally_a_Page_41.txt
f8f901ffac7cf088b7b1f7eb782d1fb3
a0ffd7fbb7391721089eab5ed9b92b3b303b4540
83270 F20101118_AACZJD mcnally_a_Page_19.jpg
12631276587e9455840adddcaba19c2b
22d7e8bc31f3d43fb0ca062b5468f2ae8c596e95
28496 F20101118_AACZEG mcnally_a_Page_70.QC.jpg
8bf2ef0507db82ca156aa5cf40b529c6
53183471067ee3d232333bf89c5d72a7f5fa3afb
2848 F20101118_AACYXK mcnally_a_Page_69.txt
ef6ded8ed6e6350603bc3fdaf902d9d8
d0d86f473ec0c2c674fc16c4eaa3b2b7e5cd5ddc
35034 F20101118_AACZJE mcnally_a_Page_22.jpg
4627f21c4bc254b81f9cd1671adb108a
5a667ece60e58f804eb56f22b9df9d496099da83
49479 F20101118_AACZEH mcnally_a_Page_19.pro
a7dc7a259bfd4572ed08eee10b267339
bb62b967eedc6a0f2384b71511865fd42bcf28d0
12977 F20101118_AACZOC mcnally_a_Page_53.QC.jpg
163fb87ad5eaac2401af088a0c740a85
8c00038e61e48ed442d0f4658613f25663a846f6
F20101118_AACYXL mcnally_a_Page_71.tif
a996b3ed7425eade0503b5f03b24b345
d4ba72400a26e75a778ba8dfbfc39ec2d5c99cfa
72968 F20101118_AACZJF mcnally_a_Page_23.jpg
ad0036e7dff47cdde9e68f9e2743b2e5
9c9730af07e9e8833f433914c2741a3ff83fefa5
86490 F20101118_AACZEI mcnally_a_Page_17.jpg
7c3a90460e0e5f3bad7a14887835e53b
58a64dfc77c143d57ef4b0ec1df985be2a90420d
5538 F20101118_AACZOD mcnally_a_Page_67thm.jpg
efc36dd6327617f7256d27b9a451a31f
f1083a47e158f6b82c7b4ea2dde22528ea743fef
86315 F20101118_AACZJG mcnally_a_Page_24.jpg
4ab16e85b9a19c8634ea30f9d0fcf7dd
034cae1746228122a89b25af3c5666e24c0d749a
7814 F20101118_AACZEJ mcnally_a_Page_66.QC.jpg
edb82cd7e034425cf6332e3905058059
529cb55e57f6604e94f3191dd1a025dece02d476
6183 F20101118_AACZOE mcnally_a_Page_25thm.jpg
1b132336cccd167a8d18e9a129484a67
c6fabc055f498bc14d4feb7de7b45be0ef58eea3
2645 F20101118_AACYXM mcnally_a_Page_68.txt
c8772e9726e9c6ee803a2ae66c01e497
6d6e343ff7f354a4b5aa7c430c6ca25432b6184a
80827 F20101118_AACZJH mcnally_a_Page_26.jpg
f927d6fd54a0896154ed15a7d5110c4d
b59f534b3cfb2ab9a2f3d0f80cc6522ea4cd1a95
1795 F20101118_AACZEK mcnally_a_Page_59.txt
a81991d00af0e8fc4ddfb9b42b0ae0a1
d666dc64181db750156d412ea8cc4437a4a7cc40
13664 F20101118_AACZOF mcnally_a_Page_05.QC.jpg
6858ed90da6723400dafe3f2d874f0f4
db7528835f16882cfe00cf5a2aa6639a9655a1f1
F20101118_AACYXN mcnally_a_Page_01.tif
0d26248b0076f2a19cc2685436ab7d8d
55d531e92ca94f3117b345a48fa8cc0224b20a19
84160 F20101118_AACZJI mcnally_a_Page_29.jpg
675bb801f9b6718389517f936f21f59b
4c8b7b1dd0ce303baeef8729c72798fc848424c9
7804 F20101118_AACZEL mcnally_a_Page_01.pro
3b3082a191ff2d32eccc21ec969c30ae
803954db0cafe38cec5c227725618583524c0477
9336 F20101118_AACZOG mcnally_a_Page_08.QC.jpg
9cd30b7ddebdd826688a8a905cb3f264
dec4430825eafe06395b7a3967c3f9b5f050b5e5
74670 F20101118_AACYXO mcnally_a_Page_54.jp2
0740fcfc92ee189b79c7e63d1204f116
7ba7f78fdcea5d42b09a701523ed7762560aa4a7
79053 F20101118_AACZJJ mcnally_a_Page_31.jpg
51b1e1d97867c5c944b57ed36379c796
61151a1eefeb11638ba32f34647dd90093cae17b
23843 F20101118_AACZEM mcnally_a_Page_10.QC.jpg
b973ce0807c831ffdea29e1120f44800
cdb396863c88a27e09895ca56866f522d224d950
5764 F20101118_AACZOH mcnally_a_Page_23thm.jpg
ce414430232398e05b67abc14b8f4311
9fd67ccd8dca1618165ed5f374b112d2160e0fc2
30435 F20101118_AACYXP mcnally_a_Page_41.jp2
b7badcf384efea21af70115527d57719
64cc16799d17b24b1f4cedb1dc409f3575c013d7
49812 F20101118_AACZJK mcnally_a_Page_32.jpg
047ba217990f833a3fb8fda46aefbdb6
411ef3c94e4d9c6bff4a0a1da378af943a660e92
45247 F20101118_AACZEN mcnally_a_Page_22.jp2
8c0de2e4f09d9f5a124592ea0b681e01
4bab63bf7326713b5efaf6f82e02778f0847ca11
5762 F20101118_AACZOI mcnally_a_Page_55thm.jpg
fc6478f9fc9b89211839d36b621c46e4
92d94783c0fe2fbb0908462912c044a43bdf86fe
3510 F20101118_AACYXQ mcnally_a_Page_39thm.jpg
1f031cefebfeb044e779daece75b1a74
e8902bf827f9628148bb01b09c187b0628735845
60569 F20101118_AACZJL mcnally_a_Page_34.jpg
a37eb2f8aeec717ccb9372486b1dd115
42d3e7ec98f601da3a859ef1c730fe1aa58b8ca9
F20101118_AACZEO mcnally_a_Page_38.tif
07acdb8b59a45270c42e3d35e7e80bf6
a5296a0fc549a284a1170c0adcc52450f7a53a44
2913 F20101118_AACZOJ mcnally_a_Page_64thm.jpg
8cbd0dfb5b130002b96d6a8a795c0b00
1f038ed8599e08bd5282164f8fc153ed1bbb6ca0
81921 F20101118_AACYXR mcnally_a_Page_28.jpg
f30cb52e38db290ad40157b1735aa5fb
684c7089d27f07d0e38690de872af2e9da821c20
54576 F20101118_AACZJM mcnally_a_Page_35.jpg
3cfa9df769385804feb1a12e0f95d144
3f6debed7e91cc37168ed1521b4c8cea7a326bbb
69409 F20101118_AACZEP mcnally_a_Page_69.pro
20be7ebcb0f049661ebadc6af06b0ba3
693fd9b8617ac8c413b4db6520b874c76daa630a
28460 F20101118_AACZOK mcnally_a_Page_71.QC.jpg
e54d2eaf5ef036b1691c00dde08dc245
322baf43d4a9ff8f97f27a44fd5f3e68dd00b18e
1939 F20101118_AACYXS mcnally_a_Page_30.txt
5741697c779ef1faf19e90b22b1f28be
7e1acde54f01884f36b9a64c1e8a9b34d3d627a0
72472 F20101118_AACZJN mcnally_a_Page_43.jpg
b9523fec260ead5b3263ee50aa05239a
0cd3c1694cb573d25443114784ee91416ce27afd
F20101118_AACZEQ mcnally_a_Page_17.tif
c9b59dfea4887d753f241a7bef27e564
4bac885bdfb49b2c8d6bf5ca98ce87d11d181566
6244 F20101118_AACZOL mcnally_a_Page_61thm.jpg
a1f788e9a22b46de44a564d37753fa64
4c419c1cf720058945847a72bbba9acb9144f934
1749 F20101118_AACYXT mcnally_a_Page_34.txt
59a64872e9ed3f6adea68f342ff2490f
6062412a69156ff3af7c5cf9ebb2834f1916fe59
85401 F20101118_AACZJO mcnally_a_Page_44.jpg
c0c6e87f583ea44fa65571a009c3251c
25d78009b1809e12cfc5e0b65dd0f23029fd2293
52711 F20101118_AACZER mcnally_a_Page_20.pro
b5daca0bc3dd57dc781f9cd6a3c0e48f
9b3fdcf74facaf4a572e5e47d87a9a1385c9b147
26112 F20101118_AACZOM mcnally_a_Page_75.QC.jpg
ceeae45b4ac1cd4bef9dfb105af4b3ca
4e194c8e23d6205d42e43e04bc4151a823432638
79533 F20101118_AACZJP mcnally_a_Page_47.jpg
90391d1f8b5d6561a5f3bf46e696ff9d
8d4347d0ec0dbbcfed64576bfd1b1e86e32c03eb
46478 F20101118_AACZES mcnally_a_Page_47.pro
4a044694867b4757595ae0010b1f118d
4597366e9463bc8a98e7e2a24961f5b69a7ab008
53104 F20101118_AACYXU mcnally_a_Page_33.jpg
628a0f37c425020f876a8ea7036a1c9e
1aa92671547abe9cf12225b0ebddcdc4da5bebca
5350 F20101118_AACZON mcnally_a_Page_07thm.jpg
231af4b27d689369e7430b9349271c97
08e74172947a6b158aeefc8a9ebe01046c578f0d
29118 F20101118_AACZJQ mcnally_a_Page_50.jpg
20158070139ff0815d7d31d94e5a8c64
4455028c3d4c2e7959b4c0dbb55c846723358f5d
53103 F20101118_AACZET mcnally_a_Page_37.pro
cadd753ecdbfc8b52631b2906c9a0a75
4a692ac0667ae8ad7326a5b4439c0944e70a0f4f
100055 F20101118_AACYXV mcnally_a_Page_75.jpg
3d611f4fcd52eb5f2a39a08c8a4f62c3
2f68f78e9bce654d138911d1c4fb356b5ff0c237
2247 F20101118_AACZOO mcnally_a_Page_76thm.jpg
54ebcde4b9c6dd9e1dcf8ac548f94f76
56e69482fc6a2d6b6cf5721ab4d8eadaaa951c5b
43904 F20101118_AACZJR mcnally_a_Page_52.jpg
7618613d1e92260f797c84df9f8b2cde
be93625a9800fcb70327d424ca90dfe8dcffe256
49380 F20101118_AACZEU mcnally_a_Page_13.pro
53028b23821222f5d1c9324da195f961
d0f24f79c3cdd559386da0a727d52b8c69d827b8
46275 F20101118_AACYXW mcnally_a_Page_31.pro
1b445a0400cead0c8072fb68c79a7128
49b709d482cf333ebafabbaf33cdebd20c4f83a3
22457 F20101118_AACZOP mcnally_a_Page_37.QC.jpg
081f5c90b0041841844763374464bbb1
ab420563f383cc4a3cf706229a5a1793972f3a2c
86675 F20101118_AACZJS mcnally_a_Page_56.jpg
5b4675b3677c82eb67c9b02eac3fb78f
1b5d5492de9c821c7c9d6661d8b9e994728dcb19
987 F20101118_AACZEV mcnally_a_Page_62thm.jpg
46d2db91266fc287c378a99167422ddc
b121447a6d2d65a9fd8429a01be615d70de8c9af
27851 F20101118_AACYXX mcnally_a_Page_27.QC.jpg
25db44fec6cb6496b1430cebafc9414b
7efc1dbca39ff292dfe5ab5aa53231b25e9539e8
12930 F20101118_AACZOQ mcnally_a_Page_52.QC.jpg
0b8f948a45b61572ad2a12b68cf43e18
926dd789ed979c9aa2e9e34559cfd04e63248906
75116 F20101118_AACZJT mcnally_a_Page_59.jpg
dc36ad002648f1352bf79ef777825001
9a87994c085f54388660944816e18e6e828154a4
6166 F20101118_AACZEW mcnally_a_Page_18thm.jpg
41ac3afc9e998b90632fd99e205aeede
04878f12059b7eb47c25edf9e5aadbf525b5c363
508977 F20101118_AACYXY mcnally_a_Page_65.jp2
d69b85d6fc4c133006945b30cadb7788
fcd453a762dc25fdd749a5087025c9e6ebe1a450
24627 F20101118_AACZOR mcnally_a_Page_26.QC.jpg
0dda7eee4c3f80977214c12f9b7253cb
ca3a1a46632c413edbdadcadf0bbd329adfa5bc7
10475 F20101118_AACZJU mcnally_a_Page_62.jpg
0c3b706662d10dd61c27a5b552e39190
ebcf80e290bc793f7ef123340e6f4f864be90646
30164 F20101118_AACZEX mcnally_a_Page_77.pro
50a5f19043b9d28d329514fcd6aac10c
54d09534428881959aa2cbe8a42a32693fa21d28
29459 F20101118_AACYXZ mcnally_a_Page_64.jpg
24a48ee13f1c9a8f408088aab810b27c
583f17e3189c096be9aa2d7bb9f7047cadb045bc
25605 F20101118_AACZOS mcnally_a_Page_48.QC.jpg
42758b121d65c76ff8f119f528b5e8d3
8fd9ed0dab8319a6a3fff8ce0033343f059f5c96
106110 F20101118_AACZJV mcnally_a_Page_68.jpg
73fbe8e76525b75d48c49548edf55b6e
bb10eb91c571d133a411accb425deff79054be08
5684 F20101118_AACZOT mcnally_a_Page_10thm.jpg
9166dae44314c3243ef827d241ff4041
bbb3adafb1e22e082c052f6d64b5271a6da99791
108428 F20101118_AACZJW mcnally_a_Page_70.jpg
ed352aec4945cf659e4ad275497d3d86
1aadd99a531591e38dbac09811ef70405c6a169c
25601 F20101118_AACZCA mcnally_a_Page_03.jp2
e0739a33e8ee15b12a6bf5d3a7cef17c
ecc69fb7e9b94654cdb14e7238d20f31247704b3
56841 F20101118_AACZEY mcnally_a_Page_40.jpg
0655907ea26eaa9290fac2e520b78978
536bd3ecc7ea11a934137b530f920ec2a72335f0
5119 F20101118_AACZOU mcnally_a_Page_11thm.jpg
842eedf0782b2fb5e81e765f1d868cbe
96dbf0d6d20c96e7f1171b367fcce4860cdb7166
98575 F20101118_AACZJX mcnally_a_Page_72.jpg
ab75423e126820a0c2d219d6cd2114ad
b3a9c5cd4cbed0071934fe4112406025f3fe5eed
F20101118_AACZCB mcnally_a_Page_41.tif
92818ba4d35a6700694cec30e03172e0
f25994e96235a9ff55c7b49f8e6fec2358edc15d
81738 F20101118_AACZEZ mcnally_a_Page_48.jpg
9222a3a5554be92fca1113069629867a
43525b89294d8146af99189b3a23f3ef7c351466
14576 F20101118_AACZOV mcnally_a_Page_36.QC.jpg
b19e247659d94131a5364936480aec7f
ff69fe7d7687693dc912fd49c44d729541ca9eaa
5575 F20101118_AACZJY mcnally_a_Page_02.jp2
62ea1a9208282973d6282c5fbbd70897
495ed01981eb38012e05419def74a059eed401f0
18956 F20101118_AACZCC mcnally_a_Page_54.QC.jpg
4d3f2b00496945e4795fd07080949da9
9239004922c146aeb225cfcb0338c2656b916387
532 F20101118_AACZOW mcnally_a_Page_02thm.jpg
da8a057112bf7ebd2cfd39914434e49f
7ea5cbfb610f5268d4e74ff02cc0054f88b17657
1051979 F20101118_AACZJZ mcnally_a_Page_05.jp2
165746ebdb15f9d9f3fa13a2a1b00dee
7ad3b5fdebaef671136ddd0055c4d1487767042d
48288 F20101118_AACZCD mcnally_a_Page_44.pro
b274b2aaf8cb87e2a7cd38778e2b6226
943f9fa76450721d64a69d9b10401371ef50e12b
102723 F20101118_AACZHA mcnally_a_Page_26.jp2
7a48b6f8c9c0eb98ca84a49fc62be04b
295918f94e380761939627f9d5133515280f7848
11795 F20101118_AACZOX mcnally_a_Page_39.QC.jpg
80b2661cccbc8c1abb6341e19afe7443
4adaa2b23abe684d9f0a58099f68c21f160e8cf0
24654 F20101118_AACZCE mcnally_a_Page_47.QC.jpg
d8306afa84e6a672267a851f853f5f98
8e88b6c91a77a4c6047187450a5dc1d5100593f4
84066 F20101118_AACZHB mcnally_a_Page_14.jpg
fcc05baae26202873635efdbc1a60875
a5cb62c4f0bb98ba78ce30719ba85a4f25a5f53b
17009 F20101118_AACZOY mcnally_a_Page_77.QC.jpg
47b1a7525ca4271765bc475f562060d9
1ce5813856629b8e428607f2afdbd034e80c669e
850419 F20101118_AACZCF mcnally_a_Page_34.jp2
292d4929429940a20028aa764be0258c
3a1548dcea9615b1ccdde767e07660268cb0a5c0
50583 F20101118_AACZHC mcnally_a_Page_57.pro
2f8d14b96235d3466ea05ad205c77065
2adf356081541c21074b90503ee806f04b2d0197
26301 F20101118_AACZOZ mcnally_a_Page_15.QC.jpg
fe52f6b55142dce38d1fdbaca85e6bed
7691ec49873c816efb5eeb3eab7631e997fdf5fc
38233 F20101118_AACZMA mcnally_a_Page_09.pro
532a86e876f7ca2bb1ea153fa5728670
23b5917085c1176c8515e7acdc3083311bbdfcf1
84319 F20101118_AACZCG mcnally_a_Page_30.jpg
291bd29d8b7ef7fd829aaf7b22b876c2
1030288f528d2de094578b5585b40485b4d18c67
763544 F20101118_AACZHD mcnally_a_Page_51.jp2
7f2efbbd60868b33680a93499fc3daa8
323cb18aff1a6c47f00532a9025ef5d535620e10
45062 F20101118_AACZMB mcnally_a_Page_10.pro
7d2c4b7797a112a8a6948c07aceab8a7
f46cecb979978192e2f321164f5fb6308c7da1ff
141373 F20101118_AACZCH mcnally_a_Page_68.jp2
88579cfd53a2d334a4618f8a1bf941c6
17dfaddc70a8cf2110a02c463092bc4bc2a192b6
57286 F20101118_AACZHE mcnally_a_Page_33.jp2
0185dca8569d7d9df07a0352839fce75
fab336ef37cf048523f30b1ef78623a138b907ce
40469 F20101118_AACZMC mcnally_a_Page_11.pro
28ad0d4af4e65c05f8c30c986e392fbc
d53ffacfe74dbb2fca4ef298a4bb600d1d856ad7
17079 F20101118_AACZCI mcnally_a_Page_06.pro
972df5895754d78a31cfa1be681bd494
dac04f83874cc8bbd77b2ccb40947682b6d8b1d3
108620 F20101118_AACZHF mcnally_a_Page_30.jp2
09dce66b11a4138a15373789f70f69f1
850e7682d2c4fb39df1d2037ec02c11fb9a29f68
50481 F20101118_AACZMD mcnally_a_Page_12.pro
ab43a609992f573db7b7ee29671d0cd3
dbe682b3a0ab67279e63bbf4baad755c44192061
109238 F20101118_AACZCJ mcnally_a_Page_44.jp2
2e739c83c5388179e3dbf43815a99754
df67b9c4bfe7194a159012fbe133380bed1565df
21050 F20101118_AACZHG mcnally_a_Page_63.jpg
503881a66e6d31ac1f55ee25ec6cb1d6
205e68a8631e9aebeea2cc7637c216d35a64921b
49677 F20101118_AACZME mcnally_a_Page_15.pro
41c23ad3052d902e731506c352f79ca1
341ec015bfdcb921115c907f6faf5aba734ec795
3867 F20101118_AACZCK mcnally_a_Page_04thm.jpg
daffae6c082e5f8cbd806221e5623b02
0c403b435464f8c5c34706032726efa3a6fb1310
1396 F20101118_AACZHH mcnally_a_Page_02.QC.jpg
d2dbe3d58363440f401a76a8ef3202d2
a5407464a537c9ee142121ebd80054f969b49655
49771 F20101118_AACZMF mcnally_a_Page_18.pro
5daca9fa744466b422279fa71f0ae540
2eb1ee4d8fe035a622d10a0349b19ff4a69160ba
155222 F20101118_AACZCL mcnally_a_Page_69.jp2
5b1ca46e1e352eab81ae243c47371a73
da9ee3495805e4d0e264e2da8f226de1438457d9
F20101118_AACZHI mcnally_a_Page_61.txt
810fdda00d49424906bf6555ae34baaf
d33956dfe5e50dee3af0370824ac6eaa207d1fab
52148 F20101118_AACZMG mcnally_a_Page_21.pro
194f2acfd876563e6b1b080e0c072007
fd95f8614c951e89c230317577140fa47e906dd0
F20101118_AACZCM mcnally_a_Page_42.tif
6407a707d37c8b361e49368d5ad23bfe
501939be89c7244014e3d661daeb2ac2c80a38f1
F20101118_AACZHJ mcnally_a_Page_55.tif
801c2e2a631d57ae1653bc027907f80e
c6d597c627798044557aa1cac15ca11bd4ec4bf3
46405 F20101118_AACZMH mcnally_a_Page_26.pro
4df6cc4f4160c4b0323e2b0280c15ecf
2a9d0072bbcc9bbb56a508e0c99f7b94f435e2fd
25941 F20101118_AACZCN mcnally_a_Page_19.QC.jpg
a3766f548382a889ae6eee9a4e213a0e
aec8454e20c9ae26778ad1dbe173dca63e37428d
25442 F20101118_AACZHK mcnally_a_Page_66.jpg
3833bad6d5af31b329f88e7901a2beca
94960d0dfbb2d6c1b98d4c9f7f49ea9f76f0fddc
47344 F20101118_AACZMI mcnally_a_Page_28.pro
53168ae2e9e5e19391335c05d9586edb
ad37d303f6535481b8f9cd38f5e30cf6ab153e93
F20101118_AACZCO mcnally_a_Page_59.tif
5f4214df344df6f307171c4a301efaa5
7f9e4e7db9f9c5fa4e6ac61ecd3283dde4938f0b
75337 F20101118_AACZHL mcnally_a_Page_04.pro
73a0a8f44c38b90cce9b5000d277f87b
7c41a6bde5d8ee7634f04cbdda826ed231398a2e
49254 F20101118_AACZMJ mcnally_a_Page_30.pro
836713793fb1908dd0bf7954cab5a19c
d859d4231eaac5c55620f23f187675fd4e860689
113712 F20101118_AACZCP mcnally_a_Page_27.jp2
91921fe58beb7cb3e87f9888969f6295
3a814a3a7b271599e375fdb547def79b43400255
6226 F20101118_AACZHM mcnally_a_Page_15thm.jpg
9f12fa14dfffca3fd2e4cf8b937dfd65
0bb6bb6b63bdc32f6d9815df204e3a90870daa2f
28392 F20101118_AACZMK mcnally_a_Page_32.pro
eb1fefb106658881edea2eefba8e2046
0013103fb1600e64f6783620367e90c64b42d936
11964 F20101118_AACZCQ mcnally_a_Page_42.pro
45c04965b70547de82612002d06d503a
4c14aae1f1004a354aa2f31b058005e8cac9b4e0
25822 F20101118_AACZHN mcnally_a_Page_57.QC.jpg
f1d69a177be31fabcfc3e313af67b00b
07d3f380d306e251bb5270a4741fe984297a4cd5
16652 F20101118_AACZML mcnally_a_Page_39.pro
797d8ccb85a49c1aa3283e750fcf75f1
d56379af1b308bcdc480648ca43ad82e62400cb8
22903 F20101118_AACZCR mcnally_a_Page_52.pro
2209743058afbfa0cd9d2aa79590c0c3
95b7b4528a36073c5d3b6d1d9a8b1af75d7fe39d
54294 F20101118_AACZHO mcnally_a_Page_36.jpg
74f5136c90db1fb3523129ae3f10368e
d2893479388d8d7beef6342d35004e0750dc0766
42228 F20101118_AACZMM mcnally_a_Page_43.pro
ba8e53fafcdc09ed88caa37db98317b5
653b1bb20b4f26ca73f5a180f7954b364e3a206b
15607 F20101118_AACZCS mcnally_a_Page_32.QC.jpg
40ad03f020e0b3c99abc7742a1a58ec2
0c5916fc9b21e2397301c1284600f5d80fe39998
92293 F20101118_AACZHP mcnally_a_Page_43.jp2
e2d58eacd538d6f2de16aa4744e7f42e
ee2d223bb0b123b8b9baec7b775618414dae3a57
48043 F20101118_AACZMN mcnally_a_Page_46.pro
8d84620debee8770f81abea6d9ab2c45
4b9cfe994b5e6d3957d1a22843d3d4eaacec3e27
1465 F20101118_AACZCT mcnally_a_Page_53.txt
a7a45d593b0bf8c737d9506ff26cae71
ff16d8b814dfd20d06a83c5e434fb1af64f1a7d7
30241 F20101118_AACZHQ mcnally_a_Page_53.pro
0755dcaf302a29b2cb15bb1d7ed6df4d
2a748794f0f5ece274f7d9af8a4625d0ccdbe6a0
32026 F20101118_AACZMO mcnally_a_Page_51.pro
a4e4d1585ee26b145f8fd776b165f0a4
ec5705eee226b714959e4a457a6658233ccde7b6
102280 F20101118_AACZCU mcnally_a_Page_16.jp2
398c380c82c99c3c667022389f24420f
4ce9b90c709b1620ad3cb2a521dbb51a645338ed
65708 F20101118_AACYVW mcnally_a_Page_54.jpg
60b8beccefbe9af20d29337a16554142
2e8acd45b4f6e5c963f969c8fc55abe4d7f22595
F20101118_AACZHR mcnally_a_Page_26.tif
2eee25bfd7d218abbedc67d969d41d03
53ec9cf6cc899298ee49d13ec288ed428651fbe4
35287 F20101118_AACZMP mcnally_a_Page_54.pro
c42d409fb52dc1898eeb101f1069d673
337ae8bfd8658c218ec48cf15ab7270e1c89a9cc
4023 F20101118_AACZCV mcnally_a_Page_54thm.jpg
540c411aa22d73f5d9f32011e42b9775
b1c1620c8c51e0cd9ad9cc7667ffb97f9650704a
F20101118_AACYVX mcnally_a_Page_62.tif
403b6372b6f085fbbb749555b041df28
7b89a2a463d85e37279befe5776725eec2e71da6
2008 F20101118_AACZHS mcnally_a_Page_12.txt
d453c451a79d28d6bd49940e1b9651df
5d9723880a16546a2eefa01295be89c8439c31c9
46697 F20101118_AACZMQ mcnally_a_Page_55.pro
56e3622bf74cf34819bc856a8fe54306
ab6acf39ab8ea4c3242e53761bb215c9a05dad48
10799 F20101118_AACYVY mcnally_a_Page_58.jpg
79a908cbedaa01a4a622eac85a0cd381
c4fdad2cd72efbec90c4baf7a854ca4dc90b83a4
6460 F20101118_AACZHT mcnally_a_Page_72thm.jpg
73ae92d91cd5f570620b17dd92995a44
4b061a778070483ebbad4c929d21b2f4ad2cacb8
4756 F20101118_AACZMR mcnally_a_Page_58.pro
2a96a57fd4c450f6d8a7dc899c494587
43e5b90236ba3c055b329845da397d3b0d12242d
F20101118_AACZCW mcnally_a_Page_64.tif
fa75fffc518790293fdf72e74af3a3df
419e720ac10efddfe13e01db4a69f7fb1ec33af2
6348 F20101118_AACYVZ mcnally_a_Page_21thm.jpg
ce313567d850712592dab51f4d11668b
db61816c8b5f97c6504f546e60a364c78095876b
1514 F20101118_AACZHU mcnally_a_Page_51.txt
17a5e5d8db0b00136313c1f457664b70
5ced6455a4ae4cc7d6b9119ad4a7ce95ed64e234
48054 F20101118_AACZMS mcnally_a_Page_60.pro
b6cea357bb103d7ec948c9ed294d3b04
04effbce6184e61507fdd82b8d9a74a903ed0331
F20101118_AACZHV mcnally_a_Page_35.tif
e2096490a5d4576d3519bf4201adff23
04d1edb777cd85a7128487285cb99abd0aaab2dc
27795 F20101118_AACZCX mcnally_a_Page_17.QC.jpg
76cb2a4e3ac7194ce32bbe9c359ed9f9
74523a46042af5a725a18cf4037ace65c02da842
7728 F20101118_AACZMT mcnally_a_Page_63.pro
b8b54a6e05b99d0113b99ae8208d6475
fd88e538ee0b29c72c43cd5a8eed48ce919611a1
27007 F20101118_AACZHW mcnally_a_Page_21.QC.jpg
849c098458c4fce6c601c77fffb48a20
28fb35f3050dfa3bf80d0c6c8e1329de8bb666f8
6155 F20101118_AACYYA mcnally_a_Page_19thm.jpg
7a3cc10a1fd5c9e35ef4cf2f100ba9d8
634eb4ac4664ecae524127c0f1572e5157e4ff88
106471 F20101118_AACZAA mcnally_a_Page_28.jp2
efd1d4e18fcdf4b3ab8112bb434d32da
da2d814853f232f7387f0847264171377a7d15d7
114657 F20101118_AACZCY mcnally_a_Page_20.jp2
29f5ba745c34bc207e804d97e395636b
6bb2e894c5bcef022745f04897d61023894614af
10198 F20101118_AACZMU mcnally_a_Page_66.pro
78429674d2de6d4fb405974accbe83f6
699b94d7334b56661ebd5a2e5d28f5131dd51819
16530 F20101118_AACZHX mcnally_a_Page_34.QC.jpg
7e70a77274dbf59e2272a51b01080fe3
eef8b7216f06d3a851093f503d79cd72daa4c009
3392 F20101118_AACYYB mcnally_a_Page_36thm.jpg
ff4a92ff01faa9f9178cd49031b23c1a
dee495dba0ffc608e3575326043e07c54b2014cd
85456 F20101118_AACZAB mcnally_a_Page_21.jpg
2ba9b3fda4c667a655445b50804e05cf
9fcb5d69dca9b1a8a92f17d0f3f488f0f587a6a3
F20101118_AACZCZ mcnally_a_Page_23.tif
49b20383d5da6b6f252096d7c08bd6b4
0315d9d9e7f11251835b89c9469f203ebf8f0db0
41872 F20101118_AACZMV mcnally_a_Page_67.pro
bb8d831384f976a3b787f75eaa6cef7c
52d032ff1868a13e2364a525d21968bc218a5048
1834 F20101118_AACZHY mcnally_a_Page_26.txt
1825471fb4dd9e41dc2d5854c112d286
1744c5a1663e57aedd1e70d62a7bc771109eaa19
50266 F20101118_AACYYC mcnally_a_Page_24.pro
f74592f2d023f5534d04892170f9da6d
62ba1efee705e17cdaebe6d488d5a68a0f9a80ca
8423998 F20101118_AACZAC mcnally_a_Page_51.tif
af17f014bc7659041036ebaa00fc3cea
7a266c884613a979b8ff38a68968022c063ee773



PAGE 1

CHARACTERIZATION OF THE HUMAN CYT19 GENE PRODUCT: AN ARSENIC METHYLTRANSFERASE By ALEX J. MCNALLY A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Alex J. McNally

PAGE 3

iii ACKNOWLEDGMENTS I would like to thank my mentor, Dr. Davi d S. Barber, for all his help, guidance, and knowledge he has given me. I would also like to thank my committee members, Dr. Nancy Denslow, Dr. Lena Ma, and Dr. Steve Ro berts, for their suggestions and advise. I thank my fianc and my parents for thei r support and encouragement throughout my graduate studies.

PAGE 4

iv TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES.............................................................................................................vi LIST OF FIGURES..........................................................................................................vii ABSTRACT....................................................................................................................... ix CHAPTER 1 INTRODUCTION........................................................................................................1 Sources of Arsenic........................................................................................................1 Natural Sources.....................................................................................................1 Anthropogenic Sources.........................................................................................1 Exposure and Health Effects........................................................................................2 Exposure................................................................................................................2 Health Effects........................................................................................................3 Mechanisms of Toxicity........................................................................................4 Arsenic Biotransformation............................................................................................6 Reduction of Pentavalent Arsenicals.....................................................................6 Methylation of Trivalent Arsenicals......................................................................7 Variation in Arsenic Methylation.................................................................................8 Role of Methylation in Arsenic Toxicity....................................................................10 Specific Aims of Research..........................................................................................11 2 MOLECULAR CLONING AND CHARACTERIZATI ON OF HUMAN CYT19, AN S-ADENOSYL-L-METHIONINE:AS-METHYLTRANSFERASE FROM HEPG2 CELLS...........................................................................................................13 Introduction.................................................................................................................13 Materials and Methods...............................................................................................14 Molecular Cloning...............................................................................................14 RACE PCR..........................................................................................................15 Expression of Recombinant cyt19.......................................................................15 Characterization...................................................................................................16 Confirmation of Methylated Arsenicals..............................................................17

PAGE 5

v Results and Discussion...............................................................................................18 3 IDENTIFICATION OF A SPLICE VAR IANT OF HUMAN CYT19 ARSENIC METHYLTRANSFERASE........................................................................................33 Introduction.................................................................................................................33 Materials and Methods...............................................................................................34 Molecular Cloning of cyt19 Splice Variants.......................................................34 Human Liver Samples.........................................................................................35 qPCR of cyt19 Splice Variants............................................................................35 Results........................................................................................................................ .36 Discussion...................................................................................................................37 4 GENERAL CONCLUSIONS.....................................................................................45 APPENDIX ROLE OF CYT19 IN ACUTE ARSENI C TOXICITY. IS CYT19 THE ONLY HUMAN ARSENIC METHYLTRANSFERASE?....................................................49 Materials and Methods...............................................................................................49 Results and Discussion...............................................................................................50 cyt19 mRNA Knockdown by siRNA..................................................................50 Antibody Specificity and Purification.................................................................51 Future Experiments.............................................................................................51 LIST OF REFERENCES...................................................................................................57 BIOGRAPHICAL SKETCH.............................................................................................67

PAGE 6

vi LIST OF TABLES Table page 2-1. Primers used in the PCR amplification of cyt19......................................................23 2-2. Kinetic analysis of the methylati on activity of cyt19-WT and cyt19S81R..............23 3-1. The individual information and Shap iro’s score of cyt19 exon 2 and exon 3.........44 3-2. The amount of cyt19 and cyt19 E2 in different human liver samples and HepG2 cells.......................................................................................................................... .44 A-1. Sequence of double stranded siRNA........................................................................53

PAGE 7

vii LIST OF FIGURES Figure page 2-1. Sequence alignment of cyt19t and Genbank sequence (accession AF226730) ......24 2-2. Sequence alignment of cyt19S81R and Genbank sequence (accession AK057833)...............................................................................................................25 2-3. Sequence alignment of cyt19-WT and cyt19t..........................................................26 2-4. Sequence alignments of the 5’ & 3’RACE-PCR products and the Genbank sequences (accession AK057833 and AF226730)...................................................27 2-5. Purification of recombinant human cyt19................................................................28 2-6. The effects of AsIII & MMAV concentrations..........................................................29 2-7. The effect of pH on activity.....................................................................................30 2-8. The effects of reductants on methylation activity....................................................30 2-9. The effect of SAM concentration on activity...........................................................31 2-10. Arsenical metabolites formed after incubation with [3H]SAM and cyt19 for 30 min at 37C................................................................................................................32 3-1. The hypothesized scheme of iAs met hylation proposed by Cullen, McBride et al. 1984.....................................................................................................................40 3-2. PCR products of cyt19 amplification.......................................................................40 3-3. Alignment of the reference cy t19 nucleotide sequence and cyt19 E2....................41 3-4. cyt19 isoforms..........................................................................................................42 3-5. Alignment of the reference cyt19 am ino acid sequence and product of cyt19 E2 uORF........................................................................................................................43 A-1. Determination of the most effici ent siRNA in the knockdown of cyt19 mRNA levels assayed by qPCR............................................................................................54 A-2. The siRNA pool knockdown of cy t19 mRNA relative to control............................54

PAGE 8

viii A-3. Determination of cell viability after siRNA knockdown by the XTT assay............55 A-4. Western blot of the specificity of the crude antisera to the antigen, purified cyt19 protein.......................................................................................................................5 5 A-5. Western blot of the specificity of th e crude antisera to cyt19 in human liver cytosolic preparations...............................................................................................55 A-6. Western blot of the specificity of th e purified antibody to th e antigen, purified cyt19 protein.............................................................................................................56 A-7. Western blot of the specificity of th e crude antisera to cyt19 in human liver cytosolic preparations...............................................................................................56

PAGE 9

ix Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CHARACTERIZATION OF THE HUMAN CYT19 GENE PRODUCT: AN ARSENIC METHLTRANSFERASE By Alex J. McNally May 2006 Chair: David S. Barber Major Department: Veterinary Medicine Chronic arsenic exposure poses a threat to millions of people throughout the world due to arsenic in drinking water; how ever the mechanisms underlying arsenic carcinogenicity and individual susceptibil ity are unknown. Methylation has been considered the primary detoxification pathway of inorganic arsenic in many species but there is evidence that methylation may increase arsenic toxicity. It has been shown that methylated arsenicals that contain AsIII are more cytotoxic and genotoxic than either arsenate or arsenite. Rat liver S -adenosylL -methionine: arsenicIII-methyltransferase has been identified and is homologous to huma n cyt19, but there are species specific differences in arsenic biotransformation and t oxicity. Additionally, th ere is considerable variation among humans in the rate of met hylation of inorganic arsenic leading to measurable differences in toxicity. Therefor e, it is important to better understand the enzymes that catalyze the methylation of ar senic in humans. In this study, we PCR amplified and cloned cyt19, a putative arsenic methyltran sferase from human HepG2

PAGE 10

x hepatoma cells. The PCR product was ligated into an E. coli pET expression vector with a polyhistidine tag at the amino-terminal residue. The recombinant human cyt19 was successfully expressed in BL21 (DE3) and purif ied using a nickel-nitrilotriacetic acid metal-affinity chromatography. The recombin ant protein catalyzes the methylation of arsenite as well as monomethylarsonic acid (MMA). The specific activity of arsenite methylation was 597 pmol/mg protein/min in a reaction mixture containing 5mM GSH, 1 mM DTT, 1 mM MgCl2, 100 M S -adenosylL -methionine, 50M sodium m-arsenite, and 5 g of S -adenosylL -methionine: arsenic methyltransferase in 100mM tris/100mM sodium phosphate buffer pH 7.4 at 37 C for 30 minutes. The result s suggest that the human cyt19 gene, in fact, is translated to an S -adenosylL -methionine: arsenic methyltransferase which methylates both arsenite and MMA. Studies have shown that humans exposed to arsenic excrete variable amounts of methylated arsenicals in the urine which may be due to differences in arsenic methyltransferase activity. While polymor phisms in the coding region of cyt19 may account for some of the observed variation in arsenic methylation, other mechanisms are likely to be involved. In this study we iden tified an alternative splice variant of the human cyt19 (cyt19 E2), in which exon 2 is removed creating a bicistronic transcript that is unlikely to produce an active protein. This variant was expressed in 7 out of 7 male Caucasian human liver samples tested and in HepG2 cells. The human cyt19 appears to be alternatively spliced in ma ny individuals and may play a role in the observed variation in arsenic met hylation seen in individuals.

PAGE 11

1 CHAPTER 1 INTRODUCTION Sources of Arsenic Natural Sources Arsenic (As) is a member of the nitrogen group in the periodic table and is classified as a metalloid. This metalloid is a naturally occurring element and is the 20th most abundant element in the earth’s crust [1 ]. Arsenic is found in the environment as sulfides, and complex sulfides of iron, nick el, and cobalt. The natural weathering of rocks and soils containing various forms of arsenic contribute to its levels in the environment. Arsenic is present in the atmosphere, aquatic environments, soils & sediments, and in organisms. This metall oid is found naturally in rocks, geothermal wells, minerals, and metal ores such as c opper and lead. Arsenic is present in the environment in both organic and inorganic form s and exists in four valence states, -3, 0 (elemental), +3 (trivalent), and +5 (pentavale nt arsenic), however it exists mainly in the latter two valence states. Many marine pl ant and animal species have naturally high levels of As, but in organic forms that appear to cause little toxicity. The main species of arsenic in marine animals is the arsenosugar, arsenobetaine [2]. In general, organic forms of arsenic are less toxic than inorganic forms of arsenic and the pentavalent inorganic forms are less toxic than trivalent inorganic arsenic compounds. Anthropogenic Sources Anthropogenic sources of arsenic stem from its use in pesticides and wood preservatives as well as mining and smelting wastes. In the U.S., 2,200 tons of arsenic

PAGE 12

2 was produced in 1985 [3]. Since 1985, the domes tic production of arsenic in the US has ceased. However, arsenic is still used do mestically and therefore is imported from countries such as China, Japan and Mexi co. In 2003, the United States was world’s largest consumer of arsenic, demanding 21,600 me tric tons [4] Arsenic has also been used in the production of dessicants and as gr owth stimulants for plants and animals. Organoarsenicals have been shown to have both therapeutic and growth promoting properties in poultry and swin e. Arsanilic acid and its sodium salts, such as 4nitrophenylarsonic acid are added to pet feed [5]. Most of this arseni c passes through the animal and becomes part of the waste st ream resulting from animal production. In addition, arsenic has been used for therapeu tic purposes and of course as a poison. Arsenic has been used to treat syphilis, tropical diseases such as trypanosomiasis (African sleeping sickness), yaws, amoebic dysentery and recently as an anticancer. Paul Ehrlich developed an organic arsenical, arsphenami ne, also known as Salvarsan, which was used to treat syphilis [6]. Arsphenamine was also believed to be effective in treating trypanosomiasis [6]. Arsenic trioxide has been shown to be highly effective in the treatment of various cancer s especially of acute promyelocytic leukaemia [7]. Exposure and Health Effects Exposure Arsenic is present throughout our environm ent, in the air we breathe, the water we drink, and the food we eat. Water contributes mo re to iAs exposure than food or air. On average Americans are exposed to 50 g per day of arseni c of which 10 g is in the inorganic form [8]. People are exposed to hi gher than average arsenic due to living or working around higher exposure sources. For example living or working near a hazardous waste site can lead to exposure via the air, ingestion, or the food chain.

PAGE 13

3 Arsenic is present in 47% of all sites on the National Prio rities List (NPL) sites or Superfund sites making it second only to l ead as the most common contaminant of concern [9]. Occupational settings such as workers who use or produce arsenic compounds: vineyards, ceramics, glass-ma king, smelting, pharmaceuticals, refining of metallic ores, pesticide manufacturing & application, wood preservation, or semiconductor manufacturing, have the potential to be exposed to higher than average arsenic levels [1]. Currently, people in Taiwan, Mexico, western United States, western South America, China, West Bengal and Bangladesh are exposed to high levels of arsenic due to anthropogenic and/or natura l contamination of potable water. It has been estimated that 200 million people worldwide are at risk from health effects as sociated with this exposure [10]. The two most affected ar eas in the world are Bangladesh and West Bengal, India; it has been estimated that around 122 million people in these areas are exposed to groundwater arsenic concentrati ons above the World Health Organization maximum permissible limit of 50g/L [11]. The study showed that in West Bengal, 26.4% (n=10,991 tube wells) of the water samp les had arsenic ranging in 100-299 g/L. In the U.S. the arsenic maximum contaminant level (MCL) was decreased to 10g/L by the US Environmental Protection Agency (E PA) in January 2001. Frost et al. [12] identified 33 counties in 11 states in th e western United States with mean arsenic concentrations of 10g/L or greater. In addition, fr om 1950-1990 there were over 60 million people in the US exposed to arsenic contaminated water exceeding 10g/L [12]. Health Effects Ingestion of arsenic is a widespread human health pr oblem. There are different symptoms associated with acute and chronic ar senic exposure. Acute exposure to arsenic

PAGE 14

4 can result in acute pa ralytic syndrome, acute GI syndr ome, and even death. Oral exposure above 60 ppm in food or water can result in death [3]. Chronic arsenic exposure can result in skin disorders such as hyper and hypo pigmentation, and hyperkeratosis [3]. It was found that even at 0.005-0.01mg/L of arsenic in water there is an increase in the prevalence of skin lesions [13]. In addi tion, chronic iAs exposure can affect the circulatory and nervous systems leadin g to diseases such as Blackfoot disease. Major organs such as the liver, kidneys, lung, bladder, and heart can be affected as a result of arsenic cytotoxicity. There is an increase of cancer, death from cancer, and diabetes mellitus associated with chronic ar senic exposure. Epidemiological studies show that there is dose-res ponse relationship between exposur e to iAs and skin cancer [14]. A study in Taiwan[15] and Japan[16] demonstrated a significant association between long-term arsenic exposure in drinking water with lung and bladder cancer. In northern Chile an increase in mortality from bladder, lung, kidney, and skin cancer is associated with As exposure; bladder a nd lung cancer showing highest increase in mortality [17]. A follow up study in Taiwan compared the incidence of diabetes mellitus in an arsenic exposed population to two cont rol areas showed an association between As exposure and diabetes mellitus [18]. Mechanisms of Toxicity The mechanism of arsenic toxicity is de pendent on oxidation state. Trivalent arsenicals, including methylated arsenicals produce toxicity by enzyme inhibition by interactions with sulfhydryl gr oups in proteins [19] and the generation of reactive oxygen species (ROS). For example, in vitro studies have shown that MMAIII and arsenite are capable of inhibiting pyruvate dehydrogena se (PDH) activity in hamster kidney and purified porcine heart PDH resulting in the subsequent blockage of adeonosine

PAGE 15

5 triphosphate (ATP) production be cause of the disruption of the citric acid due to the depletion of cellular citrate [ 20]. Inorganic arsenicals, arse nite and arsenate, have been shown to induce ROS and r eactive nitrogen species (R NS) which result in DNA and protein oxidative damage [21]. A nother study demonstrated that MMAIII and DMAIII induced ROS result in DNA damage [22]. Arse nate has been shown to interfere with ATP production by substituting for phosphate le ading to production of an unstable ADParsenate complex which spontaneo usly hydrolyzes [23]. This process leads to a depletion of cellular energy due to this futile cycle. Although there is strong evidence of the ca rcinogenicity of arsenic in humans, the mechanism by which tumors are produced is unknown. Studies of arsenic carcinogenesis have been hampered because there are very few animal models in which arsenic induces carcinogenesis [3]. DMA concentrations of 50 and 200 ppm have been shown to be carcinogenic in F344 rats urinary bladder [ 24]. Recent work has demonstrated the promotion effects of inorgani c arsenicals and methylated ar senicals. Inorganic arsenic (42.5 and 85 ppm)has been shown to be a transplacental carcin ogen in mice [25]. Organic arsenicals, such as MMA, DMA, and TMAO have been shown to act as promoters in carcinogenesis of se veral rat organs [26]. Howe ver, some of these studies have received much criticism due to the hi gh arsenical exposure le vels used ranging from about 50 to 400 ppm and the use of several initiators such as diethylnitrosamine, NbutylN(4-hydroxybutyl)nitrosamine, NmethylNnitrosourea, dihydroxy-diN propylnitrosamine and N-N’dimethylhydrazine, prior to arsenic exposure. Several possibilities for mechanisms of arsenic induced malignancies have been hypothesized such as chromosomal abnormality, oxidative stress, and the promotion of

PAGE 16

6 tumorigenesis. Zhao et al. [27], have s hown that chronic low le vel arsenic (0-0.5M) exposure will result in the malignant transfor mation of epithelial ce lls associated with DNA hypomethylation due to depletion of SAM and aberrant gene expression. An in vivo long-term arsenic exposure study to mice de monstrated that arse nic in potable water can induce aberrant gene expression, globa l DNA hypomethylation, and hypomethylation of the gene for the estrogen receptorresulting in enhanced transcription, which cumulatively could lead to arsenic hepatocarc inogenesis [28]. Arsenate was shown to have a dose-dependent transcri ptional induction of several different signal transduction pathways, including the dose-re sponse induction of several promoters and/or response elements responsive to oxidative damage and DNA damage [29] which may help understand the mechanisms of carcinogenicity fo r arsenic. Binet et al. [30] has shown that arsenic induced apoptosis via reactive oxygen species (ROS) production occurs but, the ROS is not produced from nicotin amide adenine dinucleotide phosphate dehydrogenase activation. Trivalent methylated arsenicals have been shown to indirectly cause DNA damage by ROS. One study showed that DMAIII promotes tumorigenesis and gentoxicity via dimethylat ed arsenic peroxides [31] Arsenic Biotransformation Reduction of Pentavalent Arsenicals The biotransformation of iAs alternates between the reduction of arsenate (iAsV) to arsenite (iAsIII) followed by oxidative methylation. The hypothesized scheme of iAs methylation involves oxidative methylation and reduction[32]: AsvO4 3+ 2e AsIIIO3 3+ CH3 + CH3Asv O3 2+ 2e CH3AsIIIO2 2+ CH3 + (CH3)2AsvO2 + 2e (CH3)2AsIIIO

PAGE 17

7 Arsenic reduction must occur first before it can be methylated. Several enzymes have been shown capable to reduce arsenic. Purine nucleoside phosphorylase (PNP) has the ability to reduce iAsV to iAsIII in the presence of a dith iol and a purine nucleoside (guanosine or inosine) in v itro [33, 34]. However, studie s performed by Nmeti et al. 2003 showed that PNP does not play a role in iAsV reduction in vivo [35]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in the pres ence of glutathione (GSH) and NAD has the ability to reduce iAsV to iAsIII in human red blood cells and rat liver cytosol [36, 37]. A human arsenate re ductase was discovered capable of reducing arsenate but not methylarsonic acid (MMAV) [38]. Zakharyan et al 1999 presented an enzyme from rabbit liver capable of reducing MMAV, arsenate, and di methylarsinic acid (DMAV) in the presence of GSH; this enzyme was also present in human liver [39]. MMAV reductase was sequenced and 92% of the sequences were identical to human glutathione-S-transferase Omega class (hGS TO-1) [40]. This hG STO-1 catalyzes the reduction of iAsV, MMAV, and DMAV [39, 41]. There is ev idence that pentavalent arsenicals can be reduced nonenzymatically. Glutathione (GSH) has been shown to reduce pentavalent arsenicals [42, 43]. Methylation of Trivalent Arsenicals Following the first reduction step, arsenite is enzymatically oxidatively methylated to MMAV. In this reaction, a high energy met hyl group from S-adenosyl-L-methione (SAM) is transferred to a trivalent arsenica l in an oxidative process that produces a pentavalent methylated arsenical. The resu lting monomethylarsonic acid (MMA) can be reduced a second time and methylated again to form dimethylarsinic acid (DMA). In West Bengal, MMAIII and DMAIII were detected in the urine of exposed humans in 48% and 72% respectively out of th e 428 subjects [44]. In some animals, including humans, a

PAGE 18

8 third methylation can occur resulting in form ation of trimethylarsine oxide (TMAO). It was shown that a single dose of arsenic trioxi de in hamsters resulted in a very small amount of TMAO production in the liver[45]. Yoshida et al 1997 demonstrated that rats excrete TMAO in their urine after a single oral administration of DMA [46]. Urine excretion of TMAO in man has been observe d after ingestion of an arsenosugar and DMA [47, 48]. Arsenic methyltransferases (AS3MT) ha ve been isolated from many mammalian species. An AS3MT has been purified 2000-fold from rabbit liver by DEAE chromatography to a single band [49]. The rabbit liver AS3MT was capable of performing both methylation steps. The Golden Syrian hamster liver was used to purify AS3MT and was shown to have similar activit ies as the rabbit AS3MT [50]. Rat liver Sadenosyl-L-methionine:arsenicIII-methyltransferase has been identified and is homologous to human cyt19 [51]. The rat ar senic methyltransferase has been shown to perform both mono and dimethylation of arseni c. Arsenic methyltransferase activity has been determined in mice and prim ates, including humans [52-55]. Variation in Arsenic Methylation There is significant variation in the arse nic methylation rate and arsenic metabolite production among mammalian species. The variabil ity of arsenic methylation is apparent in the amounts of methylated arsenic metabolites seen in the urine of exposed mammals such as the rat, rabbit, hamster, dog, and mouse. For example, mice quickly excrete about 90% of the dose in two days of whic h 80% is DMA [56]. The rat efficiently methylates arsenic, but it accumulates DMA in red blood cells resul ting in subsequent lower DMA excretion levels making it a poor model for human metabolic studies [57]. Healy et al. [58], purified arse nic methyltransferases from livers of rabbit, hamster, and

PAGE 19

9 rhesus monkey and found different rates of methylation which may affect arsenic elimination and toxicity. However, these mammals with arsenic methylation capacity have something in common which distinguishes them from huma ns. On average, humans exposed to arsenic excrete more MMA in the urine than other mammals specifically 10-30% iAs, 10-20% MMA, and 60-80% DMA [59]. This suggests that non-human mammals are more efficient at catalyzing the second me thylation step which produces MMA. This may relate to their lower susceptibility to iAs carcinogenesis following exposure versus man. Additionally, there is si gnificant variation in human susceptibility to As induced toxicity, which may be related to differenc es in arsenic biotransformation between individuals. Epidemiological studies have shown differen ces in the amount of MMA and DMA excreted in the urine of exposed populations which may be associated with differences in arsenic methyltransferase activ ity. Several studies on the urinary excretion of arsenic metabolites in nativ e Andean people and mixed et hnicities in northeastern Argentina exposed to arsenic in potable wate r revealed low excret ion of MMA [60-63]. One study revealed higher than normal MMA in urine, on average 27%, in people exposed to arsenic in drinking water on the northeast coast of Taiwan [64]. Only a few polymorphisms have been found in the coding region of cyt19 to date. The Met287Thr mutation has been reported on th ree different occasions [65-67]. In two of these studies, the methylat ion activity of this allozyme was determined and showed to have a higher methylation capacity than the w ild-type [65, 67]. Howe ver, the activity of this allozyme was determined either from a cy tosol preparation or by analysis of cells and culture media of exposed human hepatocytes. This type of analysis does not take into

PAGE 20

10 account the possible different expr ession levels of the arsenic me thyltransferase. In fact one study shows that the allozyme Met287Thr was expressed at higher levels than the wild-type arsenic methyltransf erase [67], making unclear as to whether the increase in activity results from the mutation or the increased expression levels. There are differences in arsenic methylation capaci ties among individuals, which cannot be supported alone by polymorphisms within the cyt19 coding region. All of the single nucleotide polymorphisms (SNPs) in cyt19 avai lable as seen in the NCBI SNP database on January 12, 2006 are within th e intron or untranslated regi on (UTR). In addition, two separate studies which examined the frequency of polymorphisms within cyt19 found one nonsynonymous SNPs (nsSNPs) out of 58 SN Ps [66] and the other study found 3 nsSPNPs out of 26 SNPs [67], the remainder of the SNPs occurring in introns or UTRs. There is another mechanism which may help explain the differences seen in arsenic methylation, alternativ e splicing. Alternative splici ng is frequently used to regulate gene expression and to generate tissue-specific mRNA and protein isoforms [68, 69]. Introns contain sequence elements in which splicesome assembly occurs [70]. Mutations within these sequence elements c ould alter the constitutive splicing of a gene which may affect the methylation capacity wi thin and among different population groups. Role of Methylation in Arsenic Toxicity Arsenic methylation has traditionally been thought to be a detoxification pathway. Pentavalent methylated arsenic metabolites ar e less reactive and are readily excreted in the urine compared to iAs [56] Pentavalent methylated arse nicals have also been shown to be less cytotoxic and genot oxic compared to arsenite [71]. Mure et al. [72], demonstrated that arsenite induces delaye d mutagenesis and transformation in human osteosarcoma cells but MMAIII showed no significant increase in mutagenesis or

PAGE 21

11 transformation. While As methylation has been viewed as a detoxification pathway, recent studies have shown monomethylarsonous acid (MMAIII) and dimethylarsinous acid (DMAIII) to be more toxic than inorganic arse nicals. In vitro and in vivo studies have shown that MMAIII is more cytotoxic than AsIII. Petrick et al [20], revealed that the order of toxicity in Chang huma n hepatocytes is as follows: MMAIII > arsenite > arsenate > MMAV = DMAV. In vivo studies performed in hamsters demonstrated that MMAIII is more lethal than arsenite [73]. In addition, Hirano et al. [74], has shown that monomethylarsonous acid diglutathione is more acutely toxic than othe r arsenicals. It is important to point out that not all mammals methylate arsenic such as the marmoset monkey, tamarin, chimpanzee, and the guinea pig [57, 75-78]. These mammals have not been shown to be more susceptible to acu te arsenic intoxication. One study showed no correlation between the induction of micronuclei and the ability to methylate arsenic in the leukocytes of four mamma lian species, humans, mice, rats, and guinea pigs [79]. Another factor that questions the role of methylation is th e fact that arsenic is a known human carcinogen, but very few animals exist in which arsenic initiates carcinogenesis. The debate over whether As methylation is a detoxification or bioactivation pathway leads to confusion over the role of methylation in toxicity. Specific Aims of Research The proposed study will addre ss the role of arsenic met hylation in human toxicity by better understanding the kine tics of the human arsenic met hyltransferase. The overall hypothesis is the following: Human arsenic me thyltransferase, cyt19, activity is the determining factor in the rate of arsenic methylation and toxic ity. To test this hypothesis, I examined two specific aims: 1) clon e and characterize the human arsenic methyltransferase (cyt19) a nd 2) determine cyt19s role in toxicity and arsenic

PAGE 22

12 methylation variability. Speci fic aim one was addressed by determining rate of arsenic methylation by an in vitro assay. The op timum conditions required for human cyt19 activity were determined such as pH optim um, substrate specificity and concentration, and thiol requirements. Specific aim two was addressed by examining the role of polymorphisms and splice variants on arsenic methylation variability. The determination of cyt19s role in toxicity was addressed by As toxicity in the presence and absence of methylation activity. In order to determine if cyt19 is the only arsenic methyltransferase in humans, the mRNA levels, protein concen tration, and activity, in the presence and absence of siRNA knockdown was determined.

PAGE 23

13 CHAPTER 2 MOLECULAR CLONING AND CHARACTERIZATION OF HUMAN CYT19, AN SADENOSYL-L-METHIONINE:AS-METHYLTRANSFERASE FROM HEPG2 CELLS Introduction Chronic arsenic exposure is a threat to millions of people throughout the world. Exposure to arsenic has been linked to various types of cancers such as skin cancer, lung cancer, and cancer of other inte rnal organs [71]. Methyla tion has been considered the major route of biotransformation and excreti on of inorganic arsenic (iAs) in many species including humans. The hypothe sized scheme of iAs met hylation involves reduction followed by oxidative methylation [80]: AsvO4 3+ 2e AsIIIO3 3+ CH3 + CH3Asv O3 2+ 2e CH3AsIIIO2 2+ CH3 + (CH3)2AsvO2 + 2e (CH3)2AsIIIO While traditionally thought to be a detoxification path way, recent studies have shown monomethylarsonous acid (MMAIII) and dimethylarsonous acid (DMAIII) to be more toxic than inorganic arse nicals [73]. In addition, Hira no et al.[74], has shown that monomethylarsonous acid diglutathione is more acutely toxic than ot her arsenicals. The debate over whether As methylation is a det oxification or bioactivation pathway leads to confusion over the role of methylation in toxicity. Rat liver S-adenosyl-Lmethionine:arsenicIII-methyltransferase has been iden tified and is homologous to human cyt19 [51]. While this enzyme can be used as a model for human arsenic biotransformation, the rat is considered a poor model for metabolic studies due to its accumulation in red blood cells and subsequent lower DMA excretion levels [57]. There

PAGE 24

14 are also other species specific differences in arsenic biotransformation and toxicity. Healy et al. (1999) [58], pur ified arsenic methyltransfer ases from livers of rabbit, hamster, and rhesus monkey and found differe nt rates of methylation which may affect arsenic elimination and toxicity. Humans excrete greater amounts of monomethylarsonic acid (MMAV) compared to most other mammals [81] Additionally, there is considerable variation among humans in the rate of methyl ation of inorganic arsenic possibly leading to measurable differences in toxicity [82]. Therefore it is importan t to better understand the arsenic methylation capacity in human. To date, human cyt19 has been expressed, but it has not been fully char acterized [52]. In this study, we cloned, expressed, and characterized cyt19, an arsenic methyltran sferase from human HepG2 hepatoma cells. Materials and Methods Molecular Cloning Two separate sequences available from Genbank (accession number AK057833 and AF226730) were used to design primers to amplify the open read ing frame (ORF) of cyt19, an arsenic methyltransferase (Table 1) Total RNA was isolated from HepG2 cells using Trizol reagent (Invitrog en, Carlsbad, USA)). Total RNA was treated with DNAase (DNA-free kit, Ambion, Austin, USA), and reverse transcribed (RETROscript for RTPCR, Ambion) using 2 g of RNA. HepG2 cDNA was polymerase chain reaction (PCR)-amplified, the PCR product was ligat ed in pET100/D-TOPO (Invitrogen) and transformed into chemically competent Escherichia coli One Shot TOP10 chemically competent cells (Invitrogen). The P CR reaction consisted of 2.5 U of Pfu DNA polymerase, 0.4 M each primer, 5 l of the RT reaction, 0.2 mM dNTP mix, 5 l of 10X PCR Buffer, and nuclease-free water to 50 l. The PCR conditions were as follows: an initial denaturation at 94C for 2min, follo wed by 35 cycles of denaturation at 94C for

PAGE 25

15 1min, annealing at 60C for 1min, extension fo r 72C for 2min 30s and a final extension at 72C for 7min. The PCR products, the comp lete open reading frame of cyt19 (cyt19WT), the mutated cyt19 (cyt19S81R), and the truncated cyt19 (cyt19t) were then ligated and transformed. Ampicillin resistant coloni es were analyzed by PCR and visualized by agarose gel electrophoresis. Once a correct clone was identified it was sent for sequencing to the DNA Sequencing Core Laboratory at the Univer sity of Florida. Each clone was sequenced several times a nd the consensus sequence determined. RACE PCR Rapid amplification of cDNA ends (RACE) was performed to determine which of the two separate sequences av ailable in Genbank was actually expressed in HepG2 cells. The RACE-PCR was performed using the FirstChoice RLM-RACE kit from Ambion. Primers were designed (Table 1) accordi ng to the instruction manual and the PCR reaction consisted of 1.25 U of Taq DNA polymerase, 0.4 M each primer, 1 l of the RT reaction, 0.2 mM dNTP mix, 5 l of 10X PCR Buffer, and nuclease-free water to 50 l. The PCR conditions were as follows: an ini tial denaturation at 94C for 3min, followed by 35 cycles of denaturation at 94C for 30s annealing at 60C for 30s, extension for 72C for 1min and a final extension at 72C for 7min. The PCR product was ligated in pGEM-T Easy Vector (Promega) and tran sformed into chemically competent Escherichia coli JM109 chemically competent cells (Promega). Expression of Recombinant cyt19 The pET100/D-TOPO constructs (cyt19-WT, cyt19S81R, and cyt19t) were transformed into BL21 Star (DE3) E. coli strain for expression (I nvitrogen). First, 10ml of Luria-Bertani (LB) broth containing ampicillin (100 g/ml) and 1% glucose were inoculated with the transfor med bacteria and the cultures were grown overnight. The

PAGE 26

16 next day, 5ml of the overnight culture wa s used to inoculate 250ml of LB broth containing ampicillin and 1% glucose and grown to an OD600 of 0.5. Expression was induced by the addition of 1mM isopropyl-1-thio-D-galactoside. The culture was allowed to grow for one hour.The pET100/D-TO PO construct was then transformed into BL21 Star (DE3) E. coli strain for expre ssion (Invitrogen). The cells were harvested by centrif ugation at 5,000g for 15 minutes at 4 C. The pellet was resuspended in binding buffer (50mM NaH2PO4, 300mM NaCl, 10mM imidazole, pH 8.0). The cells were lysed by a ddition of lysozyme to a final concentration of 1mg/ml and incubated on ice for 30 mi nutes followed by further incubation for 10 minutes at 4C on a rocking platform. Triton X-100 was added to a final concentration of 1% and the incubation continued for anothe r 10 minutes at 4C with rocking. The cellular debris was removed by centrifugation of the lysate at 3000g for 30 minutes at 4C The recombinant 6xHis-ta gged protein was purified usin g a nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromat ography according to th e manufacturer’s instructions (QIAGEN, Valencia, USA). Characterization Activity of the expressed proteins wa s determined by the rate of arsenic methylation. All incubations were carried ou t at 37C for 30 minutes in a final volume of 250 l, unless otherwise noted. The reacti on mixtures contained 5mM glutathione (GSH), 1 mM dithiothreitol (DTT), 1 mM MgCl2, 100 M S-adenosyl-L-methionine (SAM), 13pM (3H-methyl)-SAM (S.A.), 50M sodi um m-arsenite, and 5 g of S adenosylL -methionine: arsenic methyltransf erase in 100mM tris/100mM sodium phosphate buffer pH 7.4. The pH optimum wa s determined using the above conditions

PAGE 27

17 but at different pHs (6.0 – 11). The s ubstrate specificity and optimum substrate concentrations were also determined by addi tion of various concentrations of sodium marsenite or MMA, ranging from 1M to 200 M or 10 M to 1000 M respectively. The requirements of SAM and reductants by cyt19 were determined by addition of various concentrations of SAM, a nd the reductants GSH and tris(2-carboxyethyl)-phosphine (TCEP). The methylation reactions were stopped by placing on ice. The standard extraction procedure described by Zakharyan et al. [49] was used to separate radioactive SAM from radioactive MMA and DMA. Br iefly, the reaction mixture (250 l) was treated with 10 l of 40% KI, 20 l of 1.5% potassium dichromate, 750 l of concentrated HCl and 750 l of chloroform. The mixture was then mixed on a vortex for 3 min followed by centrifugation at 1500g for 3 min. The upper aqueous phase contained SAM and was discarded. The lower organi c phase was washed tw ice with 250 l of water, 5 l of 40% KI, and 750 l of con centrated HCl. The mixture was mixed on a vortex and centrifuged and the upper aqueous phase was discarded each time. The methylated arsenicals contained in the organi c phase were back extracted with 1 mL of water, vortexed for 3min and centrifuged at 1500g for 5 min. Half a milliliter from the final aqueous phase after back extraction wa s counted in a liquid scintillation counter. The activity was calculated from the dpm 3H transferred from SAM to arsenic. Confirmation of Methylated Arsenicals Methylated arsenicals were separated from each other and contaminating species using the ion exchange method described prev iously by Zakharyan et al. (1995) [49]. A 10 mL glass pipette was filled to 2 mL with Bio-Rad AG 50W-X4 cation exchange resin (100-200 M mesh). The column was equili brated by addition of 0.5N HCl (30 mL), followed by water until the pH of the effl uent was 5.5, 0.5N NaOH (30 mL), water until

PAGE 28

18 the pH of the effluent was 5.5, 0.5N HCl (30 mL), and 0.05N HCl (50 mL). After equilibrating the column, 0.5 mL of the fi nal aqueous phase extract from above was applied to the column. The columns were eluted by 6 mL of 0.05M HCl to obtain MMA and 10 mL of 0.5M NaOH for DMA elution. One milliliter of the these fractions were counted in a liquid sc intillation counter. Results and Discussion Both cyt19 and cyt19t transcripts were amplified by PCR from HepG2 cells and human liver samples. The sequencing results of cyt19t showed 4 point mutations, 3 transverions and 1 transition, (Figure 2-1A) resulting in 3 missense mutations (Figure 21B) compared to the Genbank sequence (ac cession AF226730). The wild-type cyt19 was also amplified, cloned, and sequenced from tw o different populations of HepG2 cells. One of the clones, designated cyt19-WT was aligned to the Genbank sequence, accession AK057833, and showed a 100% homology (data not shown). The other clone designated cyt19S81R contained a nonsynonym ous single nucleotide polymorphism (nsSNPs) when compared to the Genba nk sequence, accession AK057833 (Figure 2-2A), which results in a change from serine to ar ginine at residue 81 in the peptide sequence (Figure 2-2B). This change occurs in the SAM-binding site, however SAM-dependent methyltransferases have poor conservation of SAM-binding residue s. SAM-dependent methyltransferases contain 3 re gions of sequence similarity (m otif I, II, and III) which are thought to be important in SAM binding. Th e only highly conserved residues in the SAM-binding N-terminal region appear to be the glycine-rich sequence E/DXGXGXG found at residues 76 to 82 [83]. Therefore, the amino acid change may not have a significant effect on the activity of the recombinant protein.

PAGE 29

19 The cyt19t clone and the cyt19-WT clone are id entical except for the deletion of a nucleotide at position 997 resulting in a pr emature stop codon (Figure 2-3A). Further analysis of the protein sequences revealed 6 missense mutations including a cysteine to valine mutation and deletions of the final 37 am ino acids from the C-terminus including 4 cysteines due to the deletion in the nucleoti de sequence (Figure 2-3B). In other SAMdependent methyltransferases, the C-terminus is important in substrate binding [83]. The cyt19t protein showed no arsenic methylation activ ity. This indicates that the cysteine rich C-terminus is important for As binding and critical for activity. RACE-PCR was performed on both the 5’ and 3’ ends. The sequencing results revealed that the 5’end of the cDNA was identical to the ORF of both sequences available in Genbank (accession AK057833 a nd AF226730). The 5’-untranslated region (UTR) is different from the Genbank sequences containing 18 mutati ons (Figure 2-4A). The 3’RACE-PCR revealed that HepG2 cells expressed mRNA identical to the 3’end of the Genbank sequence, accession AK057833. In particular, the seque ncing showed that HepG2 cells cyt19 mRNA does not have a nucle otide deletion resul ting in a premature stop codon (Figure 2-4B). The recombinant human cyt19s (cyt19-WT, cyt19t, and cyt19S81R) were successfully expressed in BL21 (DE3) and purified to homogeneity using a nickelnitrilotriacetic acid metal-affinity chromatography (Figure 5). The recombinant proteins, cyt19S81R and cyt19-WT, catalyze the tran sfer of a methyl group from SAM to AsIII as well as MMAIII, which is consistent with previo us studies (Figure 2-6) [51, 52]. However, the different arsenite methyltransf erase activity profiles between cyt19-WT and cyt19S81R are apparent. Arsenite concentr ations above 50 M appears to have an

PAGE 30

20 inhibitory effect on cyt19S81R ac tivity, which is similar to what is seen in the rabbit [49]. This inhibitory effect is not seen in the cyt19-WT arseni te methylation activity. The apparent Km and Vmax of cyt19 AsIII methyltransferase (AS3MT ) activity for cyt19-WT and cyt19S81R are 251.6 M, 3505 pmole/mg/min, 6.176 M, and 804.9 pmole/mg/min respectively (Table 2). The Km and Vmax values of cyt19-WT MMA methylation is 164.6 M and 926.8 pmole/mg/min (Table 2). The MM A methylation profile is very similar to that seen in the rabbit. These enzymes seem to saturate at MMA concentrations of 1000 M [49]. The Km values can be used to interpret the affi nity of an enzyme for its substrate (a larger Km implies a weak affinity). Other ki netic analysis of the human arsenic methyltransferase had very low Km [67, 84] values compared to cyt19-WT but, the Km value of cyt19S81R was very similar to the ot her kinetic analysis. However, these other studies did not use purified enzymes which ma y explain the differenc e, especially the difference seen with cyt19-WT. The kinetic analysis suggests that the cyt19S81R has a higher affinity for arsenite than cyt19-WT However, cyt19-WT has a considerably higher Vmax value compared to cyt19S81R. The Vmax values of both cyt19-WT and cyt19S81R are considerably higher than th at seen among other mammals such as the hamster, rabbit, and rhesus monkey [50]. Kinetic analysis of MMA methylation demonstrates that the Vmsx and Km values for cyt19-WT are mu ch higher than the values seen in the hamster, rabbit, and rhesus monkey. The higher Vmax values of arsenite methyltransferase compared to MMA methy ltransferase in cyt19-WT may explain the higher MMA urine excretion levels seen in humans compared to other mammals. The rabbit, which excretes higher amounts of MMA than most other mammals, has a higher

PAGE 31

21 MMA than arsenite methyltransferase Km [50]. Possibly, arsenite is converted very quickly to MMA, allowing it to accumulate before the dimethyla tion resulting in the higher excretion of MM A seen in humans. The optimum pH of AsIII methylation for cyt19-WT and cyt19S81R was found to be about 8 and about 9 respectively (Figure 27). This is similar to previous results which show that at basic pHs, met hylation activity of rat cyt19, and AsIII methyltransferase & MMAIII methyltransferase activity fr om rabbit liver increase [49, 51]. This may be due to the deprotonation of cysteines at higher pHs, which increases the rate of binding between arse nic and cysteines in the s ubstrate binding domain. The reductant requirements were examined and it was determined that GSH is not required for cyt19-WT to methylate arsenic (Figure 28). In addition, it was determined that cyt19S81R does not require GSH. Previous st udy suggests that the substrates for cyt19 are arsenic triglutathione and monomethyl arsonic glutathione [52]. Our results demonstrate that only a strong reductant such as TCEP is necessary for methylation of arsenic by cyt19, however, the addition of GSH appears to increase the activity above the reductant alone. Finally, the effect that different SAM concentrations would have on activity was determined. It was found th at above 500 M, SAM began to have an inhibitory effect (Figure 2-9). This diffe rs from what is seen in rat, where SAM concentrations above 50 M have an inhibitory effect [51]. The ion exchange method confirmed th at cyt19 indeed produces MMA when arsenite is the substrate (Figure 2-10A). When MMAV is used as the substrate, both MMA and DMA are seen as products (Figure 2-10B). However, DMA is the major

PAGE 32

22 metabolite. The MMAV used as a substrate is not 100% pure and likely contains some iAs as contaminants. It is possible that th e contaminating iAs is methylated to MMA. In conclusion, we have shown that cyt19 is in fact an arsenic methyltransferase methylating both arsenite and MMA Examination of the cyt19t activity, indicates that the cysteine rich C-terminus is important for As binding and critical for activity. The data suggests that a mutation within the SAM-bi nding site of cyt19 can drastically change the methylation capacity of the enzyme. Th e characterization and kinetic analysis may explain the higher MMA urine ex cretion levels and increased susceptibility seen in humans compared to other mammals. It appears that arsenite is conve rted very quickly to MMA, allowing it to accumulate before th e dimethylation resu lting in the higher excretion of MMA seen in humans. The appa rently deficient dimethylation activity in humans compared to other mammals is s upported by the kinetic analysis and suggests that methylation may actually be a detoxification pathway.

PAGE 33

23 Table 2-1. Primers used in the PCR amplification of cyt19 Primer Sequence cyt19 Forward: CACCATGGCTGCACTTCGT GACGCTGAGATACAG Reverse: TTAGCAGCTTTTCTTTGTG CCACAGCAGCCTCC cyt19t Forward: CACCATGGCTGCACTTCGT GACGCTGAGATACAG Reverse: TTAACTCCAAAGCAGAACAGCTCCAGATGT 5’RACE Outer: TTTCA GCCACTTCCACCTGGCCTT Inner: CAGGGATCA CCAGACCACAGCCAT 3’RACE Outer: AGGACCAACCAAGAGATGCCAA Inner: GCCAGAAGAAATCAGGACACACAA Figure 2-2. Kinetic analysis of the methyl ation activity of cyt19-WT and cyt19S81R. cyt19-WT cyt19S81R Arsenite methyltransferase activity Km (M) 83.010.9 6.20.9 Vmax (pmole/mg/min) 1585142 804.933.4 MMA methyltransferae activity Km (M) 164.641.2 43.713.3 Vmax (pmole/mg/min) 926.875.4 365.125.7

PAGE 34

24 A. 301 350 AF226730 ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA cyt19t ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA 351 400 AF226730 TCACATGGAA AAATATGGCT TCCAGGCATC TAATGTGACT TTT T T C CATG cyt19t TCACATGGAA AAATATGGCT TCCAGGCATC TAATGTGACT TTT A T T CATG 401 450 AF226730 GC A ACATTGA GAAGTTGG C A GAGGCTGGAA TCAAGAATGA GAGCCATGAT cyt19t GC T ACATTGA GAAGTTGG G A GAGGCTGGAA TCAAGAATGA GAGCCATGAT 451 500 AF226730 ATTGTTGTAT CAAACTGTGT TATTAACCTT GTGCCTGATA AACAACAAGT cyt19t ATTGTTGTAT CAAACTGTGT TATTAACCTT GTGCCTGATA AACAACAAGT B. 1 50 AF226730 MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV cyt19t MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV 51 100 AF226730 HEEVALRYYG CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ LVGEKGHVTG cyt19t HEEVALRYYG CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ LVGEKGHVTG 101 150 AF226730 IDMTKGQVEV AEKYLDYHME KYGFQASNVT F F HG N IEKL A EAGIKNESHD cyt19t IDMTKGQVEV AEKYLDYHME KYGFQASNVT F I HG Y IEKL G EAGIKNESHD 151 200 AF226730 IVVSNCVINL VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL ELPEEIRTHK cyt19t IVVSNCVINL VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL ELPEEIRTHK Figure 2-1. Sequence alignment of cyt19t and Genbank sequence (accession AF226730). (A) Nucleotide alignment of cyt19t and Genbank sequence. The four point mutation are in red. (B) Alignment of the deduced cyt19t amino acid sequence and Genbank sequence. The 3 resulti ng missense mutations are in red.

PAGE 35

25 A. 151 200 AK057833 CACGAAGAAG TAGCCCTAAG ATATTATGGC TGTGGTCTGG TGATCCCTGA cyt19S81R CACGAAGAAG TAGCCCTAAG ATATTATGGC TGTGGTCTGG TGATCCCTGA 201 250 AK057833 GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA A GTGGCAGAG cyt19S81R GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA C GTGGCAGAG 251 300 AK057833 ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA cyt19S81R ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA B. 1 50 AK057833 MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV cyt19S81R MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV 51 100 AK057833 HEEVALRYYG CGLVIPEHLE NCWILDLGSG S G RDCYVLSQ LVGEKGHVTG cyt19S81R HEEVALRYYG CGLVIPEHLE NCWILDLGSG R G RDCYVLSQ LVGEKGHVTG 101 150 AK057833 IDMTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG EAGIKNESHD cyt19S81R IDMTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG EAGIKNESHD Figure 2-2. Sequence alignment of cy t19S81R and Genbank sequence (accession AK057833). (A) Nucleotide alignment of cyt19S81R and Genbank sequence. The tranversion is in red. (B) Alignment of deduced cyt19S81R amino acid sequence and Genbank sequence. The resulting nsSNP is in red. The SAMbinding N-terminal region site is underlined.

PAGE 36

26 A. 951 1000 cyt19-WT AGATTTTCTG ATCAGACCAA TTGGAGAGAA GTTGCCAACA TCTGGAGGCT cyt19t AGATTTTCTG ATCAGACCAA TTGGAGAGAA GTTGCCAACA TCTGGA.GCT 1001 1050 cyt19-WT GTTCTGCTTT GGAGTTAAAG GATATAATCA CAGATCCATT TAAGCTTGCA cyt19t GTTCTGCTTT GGAGT TAA ~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1051 1100 cyt19-WT GAAGAGTCTG ACAGTATGAA GTCCAGATGT GTCCCTGATG CTGCTGGAGG cyt19t ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 1101 1128 cyt19-WT CTGCTGTGGC ACAAAGAAAA GCTGCTAA cyt19t ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~ B. 201 250 cyt19-WT VLWGECLGGA LYWKELAVLA QKIGFCPPRL VTANLITIQN KELERVIGDC cyt19t VLWGECLGGA LYWKELAVLA QKIGFCPPRL VTANLITIQN KELERVIGDC 251 300 cyt19-WT RFVSATFRLF KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV cyt19t RFVSATFRLF KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV 301 350 cyt19-WT EVDEETAAIL KNSRFAQDFL IRPIGEKLPT SGGCSALELK DIITDPFKLA cyt19t EVDEETAAIL KNSRFAQDFL IRPIGEKLPT SG AVLLWS *~ ~~~~~~~~~~ 351 376 cyt19-WT EESDSMKSRC VPDAAGGCCG TKKSC* cyt19t ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~ Figure 2-3. Sequence alignment of cyt19-WT and cyt19t. (A) Nucleotide alignment of cyt19-WT and cyt19t sequence. The missense mutations are in red. The 5 cysteine residues which are not included in the cyt19t are highlighted in the cyt19-WT sequence.

PAGE 37

27 A. 1 50 5’RACE ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ AK057833 ACAGGAGCTG GCTGCGGGAG CCCGCCGTCC TGAGTCGCAG GCCGAGGAGA AF226730 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 51 100 5’RACE ~~~~~~~~~~ ~~~~~~~~~~ ~~ A CAGG AGC T GG CTG C G G G AGCCCGC CG T AK057833 CAGTGAGTGC GCGCCCTGAG TCGCAGGCCG AGGAGACAGT GAGTGCGCGC AF226730 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~GAGACAGT GAGTGCGCGC 101 150 5’RACE CCTGAGTCGC AGGCCGAGGA GACAGTGAGT GCGCGCCCTG AGTCGCAGGC AK057833 CCTGAGTCGC AGGCCGAGGA GACAGTGAGT GCGCGCCCTG AGTCGCAGGC AF226730 CCTGAGTCGC AGGCCGAGGA GACAGTGAGT GCGCGCCCTG AGTCGCAGGC 151 200 5’RACE CGAGGAGACA TGGCTGCACT TCGTGACGCT GAGATACAGA AGGACGTGCA AK057833 CGAGGAGACA TGGCTGCACT TCGTGACGCT GAGATACAGA AGGACGTGCA AF226730 CGAGGAGACA TGGCTGCACT TCGTGACGCT GAGATACAGA AGGACGTGCA B. 1151 1200 3’RACE CTGGAGGCTG TTCTGCTTTG GAGTTAAAGG ATATAATCAC AGATCCATTT AK057833 CTGGAGGCTG TTCTGCTTTG GAGTTAAAGG ATATAATCAC AGATCCATTT AF226730 CTGGA.GCTG TTCTGCTTTG GAGT TAA AGG ATATAATCAC AGATCCATTT 1201 1250 3’RACE AAGCTTGCAG AAGAGTCTGA CAGTATGAAG TCCAGATGTG TCCCTGATGC AK057833 AAGCTTGCAG AAGAGTCTGA CAGTATGAAG TCCAGATGTG TCCCTGATGC AF226730 AAGCTTGCAG AAGAGTCTGA CAGTATGAAG TCCAGATGTG TCCCTGATGC 1251 1300 3’RACE TGCTGGAGGC TGCTGTGGCA CAAAGAAAAG CTGCTAAATC TATAGCCAAC AK057833 TGCTGGAGGC TGCTGTGGCA CAAAGAAAAG CTGC TAA ATC TATAGCCAAC AF226730 TGCTGGAGGC TGCTGTGGCA CAAAGAAAAG CTGCTAAATC TATAGCCAAC 1301 1350 3’RACE CAGGGGACCA CAGTAGTGGG CAAGAGTGAT CTGCATGTTT TTTAACCTGC AK057833 CAGGGGACCA CAGTAGTGGG CAAGAGTGAT CTGCATGTTT TTTAACCTGC AF226730 CAGGGGACCA CAGTAGTGGG CAAGAGTGAT CTGCATGTTT TTTAACCTGC Figure 2-4. Sequence alignments of the 5’ & 3’RACE-PCR products and the Genbank sequences (accession AK057833 and AF226730) (A) Sequence alignment of the 5’RACE-PCR product against the Genbank sequences. The mutations in the 5’RACE product are in red. The st art codon for all three sequences are highlighted. (B) Sequence alignment of the 3’RACE-PCR product and the Genbank sequences. The nucleotide deletion in the Genbank sequence, accession AF226730, is highlighted. The stop sites for the Genbank sequences are in red.

PAGE 38

28 Figure 2-5. Purification of r ecombinant human cyt19. Fractio ns were electrophoresed on a 10% polyacrylamide gel and stained. Lane1, molecular weight markers; Lane2, cell lysate; Lane3, flowthr ough, Lane4, Wash1, Lane5, Wash2, Lane6, Wash3, Lane7, Elution 1 2 3 4 5 6 7 215 k 120 k 84 k 60 k 39.2 k 28 k 18.3 k

PAGE 39

29 A. 0 200 400 600 800 1000 1200 1400 1600 1800 050100150200250 AsIII (uM)Specific Activity (pmole/mg/min) cyt19-WT cyt19R81S B. 0 100 200 300 400 500 600 700 800 900 1000 020040060080010001200 MMAV (uM)Specific Activity (pmole/mg/min) cyt19-WT cyt19R81S Figure 2-6. The effects of AsIII & MMAV concentrations. All in cubations were carried out at 37C for 30 min. in a final volum e of 250 l. A) Reaction mixtures contained 5 mM GSH, 1 mM DTT, 1 mM MgCl2, 13 pM [3H]SAM, 0.1 mM SAM, various [AsIII], and 5 g of cyt19, in 100 mM Tris/100 mM Na phosphate, pH 7.4 B) Same as B but with various [MMAv].

PAGE 40

30 0 100 200 300 400 500 600 700 56789101112 pHSpecific Activity (fmole/mg/min) cyt19-WT cyt19R81S Figure 2-7. The effect of pH on activity. All incubations were carried out at 37C for 30 min. in a final volume of 250 l. Reac tion mixtures contained 5 mM GSH, 1 mM DTT, 1 mM MgCl2, 13 pM [3H]SAM, 50 M AsIII, and 5 g of cyt19, in 100 mM Tris/100 mM Na phosphate of the appropriate pH. 0 100 200 300 400 500 600 700 800 900 1000 5mM GSH5mM GSH+1mM DTT 1mM TCEP1mM TCEP+1mM GSH 1mM TCEP+5mM GSH ReductantsSpecific Activity (pmole/mg/min) cyt19-WT cyt19R81S N.D. Figure 2-8. The effects of reductants on met hylation activity. All incubations were carried out at 37C for 30 min. in a fina l volume of 250 l. Reaction mixtures contained 1 mM MgCl2, 13 pM [3H]SAM, 0.1 mM SAM, 50 M AsIII, and 5 g of cyt19-WT, in 100 mM Tris/1 00 mM Na phosphate, pH 7.4, with different reductants. The activity of cyt19R81S was not determined for 1 mM TCEP + 1 mM GSH.

PAGE 41

31 0 50 100 150 200 250 300 350 400 020040060080010001200 SAM (uM)Specific Activity (pmole/mg/min) Figure 2-9. The effect of SAM concentration on activity. All incuba tions were carried out at 37C for 30 min. in a final vol ume of 250 l. Reaction mixtures contained 5 mM GSH, 1 mM DTT, 1 mM MgCl2, 13 pM [3H]SAM, 50 M AsIII, and 5 g of cyt19-WT, in 100 mM Tris/100 mM Na phosphate pH 7.4. with various [SAM].

PAGE 42

32 A. AsIII0 500 1000 1500 2000 2500 0510152025 Fraction NumberDPM B. MMAV0 100 200 300 400 500 600 700 0510152025 Fraction NumberDPM Figure 2-10. Arsenical metabolites formed after incubation with [3H]SAM and cyt19 for 30 min at 37C. (A) Formation of MMA and DMA using AsIII as a substrate. (B) Formation of MMA and DMA using MMAV as the substrate.

PAGE 43

33 CHAPTER 3 IDENTIFICATION OF A SPLICE VARIA NT OF HUMAN CYT19 ARSENIC METHYLTRANSFERASE Introduction Arsenic (As) is a naturally occurring element and ranks 20th in abundance in the earth’s crust [85]. Arsenic is present in the environment in both organic and inorganic forms and exists mainly in three valence st ates, -3, +3, and +5. Generally, inorganic arsenic (iAs) is the more toxic form and pe ople are exposed to iAs primarily through food and potable water. In Taiwan, Mexico, we stern United States, western South America, China, and Bangladesh, people are exposed to high levels of arsenic due to anthropogenic and/or natural contamination of potable wa ter [12, 62, 86]. In these areas, chronic exposure to arsenic is associ ated with various tumors o ccurring in skin, liver, lung, urinary bladder, and prostate [8, 87]. Once in the body, many mammals, incl uding humans, methylate iAs to monomethylarsonic acid (MMA) and dimet hylarsinic acid (DMA) [49, 51, 54]. The biotransformation of iAs alternates between the reduction of arsenate (iAsV) to arsenite (iAsIII) followed by oxidative methylation (Figur e 1) [88, 89]. Because pentavalent methylated arsenicals are less toxic than inorganic arsenic, methylation has been considered a detoxification mechanism. Recen t studies indicate that trivalent methylated arsenicals may be more acutely toxic and genot oxic than iAs suggesting that methylation may actually be a bioactivation of iAs [ 20, 73, 74, 90]. For this reason the role of methylation in acute and chronic arsenic to xicity remains unclear. There is significant

PAGE 44

34 variation in human susceptibility to As i nduced toxicity, which may be related to differences in arsenic biotransformation be tween individuals [82]. Epidemiological studies have shown differences in the amount of MMA and DMA excreted in the urine of exposed populations which may be associated with genetic polymorphisms [62]. Cyt19 has been identified as a human S-adenosyl-L -methionine:arsenic methyltransferase [52, 55] however, only a few coding region polymor phisms have been detected which may alter the iAs methylation rate [ 65, 67]. In this study we iden tified an alternative splice variant of human cyt19, which contains an upstream open reading frame (uORF) followed by an internal start codon (AUG). Th is variant was expre ssed in 7 out of 7 human livers and represents another possibl e mechanism for regulating As methylation. Materials and Methods Molecular Cloning of cyt19 Splice Variants Total RNA was isolated from HepG2 cells and human liver samples using Trizol reagent according to the manufacturer’s inst ruction (Invitrogen, Carlsbad, USA). Total RNA was treated with DNase I using the DNAfree ™ kit from Ambion (Austin, TX) and cDNA was made using the RETROscript™ Kit for RT-PCR and 2 g of RNA as template (Ambion). HepG2 cDNA was pol ymerase chain reaction (PCR)-amplified using the following primers: forward primer (5’CACCATGGCTGCACTTCGTGACGCTGAGATACAG3’) and the reverse primer (5’TTAACTCCAAAGCAGAACAGCTCCAGATGT-3’). The PCR reaction consisted of 2.5 U of Pfu DNA polymerase, 0.4 M each primer, 5 l of the RT reaction, 0.2 mM dNTP mix, 5 l of 10X PCR Buffer, and nuclease-free water to 50 l. The PCR conditions were as follows: an initial denaturation at 94C for 2min, followed by 35 cycles of denaturation at 94C for 1min, annealing at 60C for 1min, extension for 72C

PAGE 45

35 for 2min 30s and a final extension at 72 C for 7min. The PCR products, designated cyt19 and cyt19 E2, were ligated into the pET100/ D-TOPO vector (Invitrogen) and transformed into competent Escherichia coli ( E. coli ) One Shot TOP10 chemically competent cells (Invitrogen). Ampicillin re sistant colonies were analyzed by PCR and visualized by agarose gel electrophoresis. Several clones cont aining inserts were sequenced by the DNA Sequencing Core Labor atory at the University of Florida. Human Liver Samples Human liver samples were obtained from Vitron (Tucson, AZ). All the tissues were from Caucasian males between the ages of 24 and 46. The tissues were preserved in Viaspan after death. The tissue samples were stored at -80C until use. All procedures using human samples were approved by the Inst itutional Review Board at the University of Florida and all identifying information has been removed. qPCR of cyt19 Splice Variants Total RNA was isolated and cDNA synthe sized as described above. Real-time quantitative PCR (qPCR) was carried out us ing a Bio-Rad iCycler with the following primers: cyt19 forward primer: (5’TTCGTGACGCTGAGATACAGAAG-3’); reverse primer: (5’-TGGAGGTCTGCCGATCTCTT-3’); cyt19 E2 forward primer: (5’GATACAGAAGGACGTGCAGATATTATG-3 ’); reverse primer: (5’CCAGATCCAAAATCCAGCA GTT-3’). Each PCR reaction consisted of 12.5 l iTaq SYBR Green Supermix w ith ROX (Bio-rad), 0.4 M each primer, 5 l of the RT reaction, and RNase/DNase-free water to 25 l. The PCR cycling conditions included an initial denaturation of 95C for 3 min followed by cy cling at 95C for 15s, 60C for 45s for 45 cycles. The constructs, p ET100-cyt19 and pET100-cyt19 E2 were used to generate

PAGE 46

36 calibration curves for quantif ication of cyt19 and cyt19 E2. A melting curve analysis was performed after every run to determine product uniformity. Results When the full open reading frame of cyt19 was amplified using the primers described in Molecular Cloning of cyt19 splice variants under Materials & Methods, two products were generated, 1132 bp (cyt19) and 1005 bp (cyt19 E2) products (Figure 3-2). Sequencing of these two products revealed th at the 1132 bp product is the reference cyt19 while the 1005 bp product is a sp lice variant (Figure 3-3). The reference cyt19 mRNA is composed of 10 exons (Figure 3-4A) which encode a 375 amino acid protein with a theoretical molecular wei ght of 41.747 kDa (Figure 35). The product, cyt19 E2, is missing 128 bp due to a deletion of exon 2 which could result in a protein that is about 102 amino acids shorter and the creation of a short 24 amino acid peptide as a product from an upstream open reading frame (uORF) (Figure 3-3 & Figure 3-4B). This variant may encode a 273 amino acid polypeptide chain th at is identical to the reference cyt19 but lacks the first 102 amino acids present in th e reference (Figure 3-5). Analysis of the sequences surrounding the splice revealed that the splice occurs at conserved acceptor and donor sites (Figure 3-4C). The individua l information (Ri) technique and Shapiro’s method were used to compare the splice-si tes strength of exon 3 and exon 2 of cyt19 [91]. Exon3, a constitutive exon has a str onger splice site comp ared to exon2, the alternative exon (Table 3-1). The steady state mRNA levels of each transc ript were determined in 7 human liver samples as well as in HepG2 cells by qPCR (T able 3-2). Expression of cyt19 mRNA in the human liver samples ranged from 410 04 7 to 610 26 1 copies per microgram of

PAGE 47

37 RNA. The cyt19 E2 splice variant was detected in all 7 human liver samples tested. (Table 3-2). The amount of cyt19 E2 mRNA was much lower than cyt19 mRNA ranging from 310 89 1 through 310 33 4 copies per microgram of RNA. The HepG2 cells had an average of 610 14 5 copies/g RNA and 410 55 8 copies/g RNA of cyt19 and cyt19 E2 mRNA, respectively. Discussion In this study, we identified an alternative splice variant of cyt19, which contains an uORF. The variant mRNA contains a shor t ORF followed by an internal AUG codon beginning 106bp downstream from the uORF (Figur e 3-3). While this alternative variant may encode a 273 amino acid protein it is unlikely that expression of the cyt19 E2 splice variant will result in produc tion of an active protein. Studies have shown that SAM dependent methyltransferases share 3 regions of sequence similarity (m otif I, II, and III) [92]. These motifs are found in the same or der on the polypeptide chain and separated by similar intervals [92]. It has been suggested that thes e conserved regions are important in SAM binding [92]. Mutations of a cons erved amino acid in rat guanidinoacetate methyltransferase near motif I have result ed in an inactive enzyme. In addition, mutations of motif II lead to reduced Kcat/Km values for substrates [93]. It is unlikely that the protein translated from cyt19 E2 would result in an active protein due to the removal of motif I (Figure 3-5). Whether the mRNA actually is translated into protein is not clear because the internal AUG codon contains a relatively weak Kozak sequence suggesting that translation may not reinitiate at the internal start codon. The sequence (GCCA/GCCATG G) is a consensus Kozak sequence fo r the initiation of translation in

PAGE 48

38 vertebrates [94, 95]. Deviation from the c onsensus sequence at position -3 and +4 would be considered a weak initiator codon. The cyt19 E2 transcript deviates from the consensus sequence at position +4; the variant contains an A instead of a G (Figure 3-3). It is also possible that cyt19 E2 will not be translated but that this variant is a substrate for the nonsense mediated decay (NMD) pathway due to the premature stop codon. NMD is a pathway that recognizes and quickly degrad es mRNAs containing premature translation termination codons (P TC) in eukaryotes [96]. While cyt19 E2 does contain a PTC, Zhang et al. identified a sequence motif which when present 3’ of a nonsense codon promotes rapid decay of the mRNA transcript by the NMD pathway [97]. This sequence motif (TGYYGA TGYYYYY) is not found in the cyt19 E2 mRNA transcript and it remains unclear if this variant will undergo degradation by the NMD pathway. The cyt19 E2 variant was present in all seven human liver samples tested, suggesting that cyt19 mRNA exists both in th e full length and alternatively spliced form in most individuals. The cyt19 E2 variant mRNA comprised 0.2 to 3.8% of the total cyt19 transcript. The liver samples had lo wer copy numbers per microgram of RNA of both reference and cyt19 E2 variants compared to HepG2 cells. It is possible that some degradation of cyt19 message occurred during collection and storage of the livers which reduced apparent copy number. Many mammalian species methylate arsenic through an enzymatic reaction that is performed by cyt19. There are significant va riations in the arsenic methylation capacity between species and within species including humans [58, 59, 62, 81]. The reason for this variation is uncl ear but has been attributed to cy t19 polymorphisms. However, only

PAGE 49

39 a few polymorphisms have been found in the coding region of cyt19 to date [65, 67], while the vast majority of mutations are found within the introns and the 5’ and 3’ untranslated region (UTR). Introns c ontain the acceptor site, branchpoint, polypyrimidine tract, and the donor site, wh ich are conserved se quences in which splicesome assembly occurs [70]. While muta tions within these sequence elements could alter the constitutive splicing of a gene [ 98-100], there are differences in arsenic methylation capacities among individuals, which are unlikely to be supported solely by polymorphisms within the cyt19 coding region. Alternative splicing is frequently used to regulate gene expres sion and to generate tissue-specific mRNA and protein isoforms [68, 69]. Thirty-five to 60% of human genes produce transcripts that are alternatively spli ced, in addition 70-90% of these variants alter the resulting protein products [101, 102] Further studies s hould analyze the mRNA expression levels of cyt19 splice variants in a larger number of fresh liver samples or primary hepatocytes and correlate it to arsenic methylation activity. In addition, work to determine if this transcript is a substrate for the NMD pathway or if a variant protein is expressed will help clarify the role of cyt19 E2 in human arsenic metabolism. Even though the splice variant comprises a relatively sm all fraction of the total cyt19 transcript in the livers tested it is possible that differe nt population groups have varying amounts of the cyt19 splice variant. It is al so likely that the level of cyt19 E2 in an individual will change over time as alternativ e splice selection can be controlled by many variables including developmental stage and xenobiotics [103, 104]. In conclusion, cyt19 appears to be alternatively spliced in many indivi duals and may play a role in the observed variation in arsenic methyl ation seen in individuals.

PAGE 50

40 Figure 3-1. The hypothesized scheme of iAs me thylation proposed by Cullen, McBride et al. 1984. Figure 3-2. PCR products of cyt19 amplifi cation. 1% Agarose DNA gel of cyt19 and cyt19 E2. 1 – Reduction step of As biotransformation 2 – O xidative meth y lation ste p of As biotransformation CH 3 AsIIIO2 2+ CH 3 + ( CH 3 ) 2AsvO2 -+ 2e( CH 3 ) 2AsIIIO2 1AsvO4 3+ 2eAsIIIO 3 3-+ CH 3 + CH 3 Asv O 3 2+ 2e1 2 1 cyt19 cyt19 E2 100 bp Ladder

PAGE 51

41 A. $ cyt19 E2 ATGGCTGCAC TTCGTGACGC TGAGATACAG AAGGACGTGC AG~~~~~~~~ cyt19 ATGGCTGCAC TTCGTGACGC TGAGATACAG AAGGACGTGC AGACCTACTA 50 cyt19 E2 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ cyt19 CGGGCAGGTG CTGAAGAGAT CGGCAGACCT CCAGACCAAC GGCTGTGTCA 100 cyt19 E2 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ cyt19 CCACAGCCAG GCCGGTCCCC AAGCACATCC GGGAAGCCTT GCAAAATGTA 150 cyt19 E2 ~~~~~~~~~~ ~~~~~~~~~~ ATATTATGGC TGTGGTCTGG TGATCCCTGA cyt19 CACGAAGAAG TAGCCCTAAG ATATTATGGC TGTGGTCTGG TGATCCCTGA 200 cyt19 E2 GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA AGTGGCAGAG cyt19 GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA CGTGGCAGAG 250 cyt19 E2 ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA cyt19 ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA 300 + cyt19 E2 ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA cyt19 ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA 350 Figure 3-3. Alignment of the referen ce cyt19 nucleotide sequence and cyt19 E2. $ Represents the initial start codon. *R epresents the putative PTC which results due to the removal of exon 2. + Represen ts the putative downstream start site. The kozak sequence is underlined. The deviation from the kozak sequence at position +4 is highlighted in grey. Exon1 Exon2 Exon 3 Exon4

PAGE 52

42 Figure 3-4. cyt19 isoforms. (A) Diagram repr esenting the exonic regi ons of the wild-type cyt19 mRNA. The region in which th e alternative splicing occurs is demonstrated in greater detail. (B) Schematic representation of the two alternative splice variants, the refere nce or wild-type sequence, and the deletion of exon 2. The shaded box re presents the cassette exon. (C) The donor and acceptor site of the two alternative spli ce variants. The exonic nucleotides are capitalized while the accep tor and donor sites are in lower case letters.

PAGE 53

43 1 50 cyt19 MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV cyt19 E2 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 51 100 cyt19 HEEVALRYYG CGLVIPEHLE NCWILDLGSG SG RDCYVLSQ LVGEKGHVTG cyt19 E2 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ 101 150 cyt19 IDMTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG EAGIKNESHD cyt19 E2 ~~MTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG EAGIKNESHD 151 200 cyt19 IVVSNCVINL VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL ELPEEIRTHK cyt19 E2 IVVSNCVINL VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL ELPEEIRTHK 201 250 cyt19 VLWGECLGGA LYWKELAVLA QKIGFCPPRL VTANLITIQN KELERVIGDC cyt19 E2 VLWGECLGGA LYWKELAVLA QKIGFCPPRL VTANLITIQN KELERVIGDC 251 300 cyt19 RFVSATFRLF KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV cyt19 E2 RFVSATFRLF KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV 301 350 cyt19 EVDEETAAIL KNSRFAQDFL IRPIGEKLPT SGGCSALELK DIITDPFKLA cyt19 E2 EVDEETAAIL KNSRFAQDFL IRPIGEKLPT SGGCSALELK DIITDPFKLA 351 376 cyt19 EESDSMKSRC VPDAAGGCCG TKKSC* cyt19 E2 EESDSMKSRC VPDAAGGCCG TKKSC* Figure 3-5. Alignment of the reference cyt19 amino acid sequence and product of cyt19 E2 uORF. Consensus Motif I for SAM dependent methyltransferases is underlined.

PAGE 54

44 Table 3-1. The individual information and Sh apiro’s score of cyt19 exon 2 and exon 3. Sequence Splice site Shapiro’s method Ri, bits Exon 2a GACGCTGGGTCAGAAcceptor (-13 to +1)61.5 -1.9 AAGGTAGAGT Donor (-3 to +7) 72.0 5.5 Exon 3 TTCCATTTCCCAGA Acceptor (-13 to +1)84.8 9.5 CAGGTGAGGC Donor (-3 to +7) 88.1 7.4 a. Exon 2 is the alternative exon of cy t19 and exon 3 is the constitutive exon. Table 3-2. The amount of cyt19 and cyt19 E2 in different human liver samples and HepG2 cells. The percentage of cy19 E2 in each sample. Samples cyt19 (copies/g RNA) cyt19 E2 (copies/g RNA) %cyt19 E2a HL-541 6 610 49 0 10 21 1 3 310 14 1 10 25 3 0.27 HL-546 5 510 35 0 10 22 1 3 310 89 0 10 55 3 2.83 HL-611 4 410 91 3 10 04 7 3 310 45 1 10 89 1 2.61 HL-612 5 510 78 1 10 89 7 3 310 70 2 10 63 3 0.46 HL-656 5 510 44 0 10 09 1 3 310 69 0 10 33 4 3.84 HL-710 5 510 64 2 10 40 8 3 310 06 1 10 95 3 0.47 HL-714 6 610 42 0 10 26 1 3 310 23 1 10 22 3 0.26 HepG2 cells 6 610 08 1 10 14 5 4 410 42 6 10 55 8 1.64 a. The percentage of cyt19 E2 is calculated by dividing the copies/g of RNA for each sample by the total copies of both transcripts for each sample (cyt19 E2/(cyt19 + cyt19 E2)*100).

PAGE 55

45 CHAPTER 4 GENERAL CONCLUSIONS The first study showed that cyt19 is an ar senic methyltransferase. In addition, we have demonstrated that this enzyme does both methylation steps involved in arsenic biotransformation seen in humans. We also s howed that the C-terminus is critical in the activity of the protein. In other SAM-dependent methyltransferases, the C-terminus is important in substrate binding. This indicates that the cysteine rich C-terminus is important for As binding and critical for activ ity. Others have shown that mutations can change the methylation capacity of the protei n. Here, we demons trated that a single mutation can drastically change the activity of the protein even though we believed that the amino acid change would not have a si gnificant effect on the activity of the recombinant protein. This change occurs in motif I of the SAM-binding site which might inhibit its ability to bind SAM therefore decr easing its activity. The mutation appears to cause a change in the substrate affinity of the proteins as well as cause different methylation profiles specifically for arsenite. However, the Vmax values of both cyt19WT and cyt19R81S are considerably higher th an that seen among other mammals such as the hamster, rabbit, and rhesus monkey. Th e kinetic analysis of these proteins may explain the high levels of MMA excreted in human urine. Po ssibly, arsenite is converted very quickly to MMA, allowing it to accumulate before the dimethylation step resulting in the higher excretion of MMA seen in human s. The human arsenic methyltransferase did have some similarities with the other ma mmalian arsenic methyltransferases. These arsenic methyltransferases have been shown to increase in activity at basic pHs which

PAGE 56

46 may be due to the deprotonation of cysteines at higher pHs, which in creases the rate of binding between arsenic and cysteines in th e substrate binding domain. Our results demonstrate that only a strong reductant is n ecessary for methylation of arsenic by cyt19, however, the addition of GSH appears to incr ease the activity above the reductant alone. The second study introduced another possi ble explanation for the variability in arsenic methylation capacities among individu als, alternative splic ing. Alternative splicing is frequently used to regulate gene expression and to gene rate tissue-specific mRNA and protein isoforms. Thirty-five to 60% of human genes produce transcripts that are alternatively spliced, in addition 70-90% of these variants alter the resulting protein products. In this study we identified an al ternative splice varian t of the human cyt19 (cyt19 E2), in which exon 2 is removed creating a bicistronic transcript. The cyt19 E2 variant was present in all seven human liver samples tested, suggesting that cyt19 mRNA exists both in the full length and in alternatively spliced forms in most individuals. It is unlikely that this variant woul d result in expression of an active protein. Studies have shown that SAM dependent met hyltransferases share 3 regions of sequence similarity (motif I, II, and III). It has been suggeste d that these conserved re gions are important in SAM binding. Therefore, it is unlikely that the protei n translated from cyt19 E2 would result in an active protein due to the removal of exon 2 which cotains motif I. Whether the mRNA actually is translated into protein has not been determined. The majority of mutations discovered within the cyt19 gene occur within the intron or untranslated regions [66, 67]. In fact, only 4 mutations have been found within the coding region. Introns contain sequence elements in whic h splicesome assembly occurs [66, 67]. Mutations within these elements could alter the constitutive splicing of a gene.

PAGE 57

47 Future studies should focus on isolating the human AS3MT from human livers. To this date, preparations from human liver s, cytosolic or homogenates have shown no activity in arsenic methylation. Reasons for th is may be due to inhi bitory factors present in the liver preparation or the process of ma king the preparations may render the protein inactive. Yet another explanation may be due to the possibility that cyt19 is an inducible protein. Perhaps the average daily exposure does not cause high leve ls of expression of the protein, making it difficult to purify from liver samples. It may be beneficial to attempt protein purification from known highe r than normal arsenic exposed populations. Perhaps populations exposed to higher than normal levels have reached a threshold of exposure resulting in higher expression leve ls of cyt19. Another possibility for purification of cyt19 from normally exposed populations may be by immunoprecipitation from human liver preparations using an an tibody which is highly selective for cyt19. Further studies should analyze the mR NA expression levels of cyt19 splice variants in a larger number of fresh liver sa mples or primary hepatocytes and correlate it to arsenic methylation activity. In addition, work to determine if this transcript is a substrate for the NMD pathway or if a variant protein is expressed will help clarify the role of cyt19 E2 in human arsenic metabolism. In addition, more investigations should look at mutations within the in tron of cyt19 and determine if these alter splic ing events. Another important study would be to establis h a method to test exposed populations at both the mRNA and protein levels of cyt19. This study would help determine vulnerable individuals in high arsenic exposed populations Finally, the ultimat e question which still remains unanswered: is arsenic methylation a bioactivation or detoxi fication mechanism.

PAGE 58

48 If time and funding were not a factor, I woul d enjoy working on solving these different unanswered questions which may help iden tifying possible vulnerable populations.

PAGE 59

49 APPENDIX ROLE OF CYT19 IN ACUTE ARSENIC TO XICITY. IS CYT19 THE ONLY HUMAN ARSENIC METHYLTRANSFERASE? While my work has clearly demonstr ated that cyt19 is a human arsenic methyltransferase, it is not clear that it is th e only arsenic methyltransferase in humans. In order to address this question, it is necessa ry to: 1) alter the expr ession of cyt19 and 2) have the ability to measure cyt19 protein leve ls. The first challenge was addressed by the use of small interfering RNA (siRNA) to reduce the expression of cyt19. The second challenge was addressed by developing an antibody specific for human cyt19. Small RNAs can theoretically be used to reduce the expression of any target gene. There are two main categories of small R NA, microRNA (miRNA) and siRNA. These small RNA have natural functions such as de fense from viral and transposon invasion as well as gene regulation. Scientists have used this new technology for several reasons such as determination of gene function, valida ting drug targets, and treatment of diseases. Small RNAs have two mechanisms by which protei n translation is inhibited. If the small RNA is 100% homologous to its mRNA target it results in degrada tion of the mRNA. However, if the small RNA is not 100% iden tical to its mRNA target it results in inhibition of translation w ithout mRNA degradation [105]. Materials and Methods Multiple siRNAs were designed and synthesized according to the Silencer™ siRNA Construction Kit (Ambion) Forty-five thousand HepG 2 cells were plated on a 24 well plate in normal growth media overnight and transfected in duplicates with the

PAGE 60

50 appropriate siRNA according to Silencer™ siRNA Trasnfection Kit. Total RNA was isolated 2 days after transf ection. The most efficient siRNA was assessed by measuring the mRNA levels of cyt19 normalized to RNA polymerase II (RPII) by quantitative PCR (qPCR). Once the most efficient siRNA is de termined, further optimization steps can be taken such as cell plating density, transf ection agent, and siRNA amount. The siRNA pool was further optimized in a 96-well plate using 16,000 cells per well and assayed. The mRNA levels were measured by qPCR as above, and the viability was determined by the XTT assay. GAPDH was used as negative control. An antibody to cyt19 was developed in rabbits by sending purified recombinant cyt19 to Cocalico. The antibody specificity was determined from western blots of purified protein and HepG2 cell extracts. To increase the specificity of the antibody, it was affinity purified using the AminoLink Kit (Pierce) according the manufacturer’s instructions. Briefly, the purified cyt19 protein was coupled to the gel followed by affinity purification. Results and Discussion cyt19 mRNA Knockdown by siRNA Three different siRNAs were designed (T able 1). The efficiency of all three siRNAs as well as a pool of the three siR NAs was determined (Figure 1). The data demonstrates that the knockdown was succe ssful with the pool of siRNAs, however further optimization is still required. It appe ars that the first three siRNAs had no effect on the cyt19 mRNA levels. The pool of a ll three siRNAs appear s to knockdown cyt19 mRNA levels by about 26%, relative to c ontrol. The second attempt at cyt19 mRNA knockdown demonstrated that 16,000 cells pe r well in a 96-well plate resulted in a greater knockdown of cyt19 mRNA of about 40% compared to 45,000 cells used in the

PAGE 61

51 first attempt (Figure 2). It appears that cyt19 mRNA levels might have been slightly reduced in the negative control. In additi on, the siRNA transfection did not result in a decrease of viability relative to control (F igure 3). The data demonstrates that the optimal cell density and the tran sfection agent are important to optimize. Taken together the results suggest that the concentration of the siRNA requires further optimization or perhaps new siRNAs can be designed and tested. Antibody Specificity and Purification Crude antiserum was shown to be able to detect the antigen up to about 25 ng (Figure 4). The antibody was not able to detect cyt19 in any of the human liver cytosol preparations tested. In add ition, the antibody appears not to be very specific (Figure 5). Once purified, the antibody was characterized and found to be able to detect the antigen up to about 40 ng (Figure 6). The specificity of the antibody was increased dramatically and is able to detect cyt19 in all tested human liver samples and in HepG2 cytosol tested (Figure 7). In order to determine if the antibody is in fact reco gnizing cyt19 in these cytosol preparations, the protein must be immunoprecipita ted and sequenced. Future Experiments Further studies are needed in order to better understand th e role of arsenic methylation in acute human arsenic exposures However, two very important steps in answering this question have been addresse d, knockdown of cyt19 and the ability to measure cyt19 protein levels through antibody specificity. We have to determine the correlation between mRNA levels and protein levels. It may be possible to knockdown the mRNA levels without affecting the protein levels if the protein has a long half-life. The opposite may be true as well, we may not see much affect in the mRNA levels but the siRNA may be able to suppress protein expression thereby reduc ing methylation.

PAGE 62

52 Once we prove the protein levels are down, we can determine the effects of As exposure as well as determine if cyt19 is the only arsenic methyltransferase in humans.

PAGE 63

53 Table A-1. Sequence of double stranded siRNA siRNA 1: 5’-CAU U GA GAA GUU GGC AGA GUU-3’ 3’-UU GUA ACU CUU CAA CCG UCU C-5’ siRNA 2: 5’-UGU GA C UUU UUU CC A UGG CUU-3’ 3’-UU AC A CUC AAA AAA GGU ACC G-5’ siRNA3: 5’-GUU GG C AGA GGC UGG AAU CUU-3’ 3’-UU CAA CCG UCU CCG ACC UUA G-5’

PAGE 64

54 cyt19 mRNA Knockdown0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 siRNA1siRNA2siRNA3siRNApRelative cyt19 mRNA L evels Figure A-1. Determination of the most efficient siRNA in the knockdown of cyt19 mRNA levels assayed by qPCR. cyt19 mRNA Knockdown0 0.2 0.4 0.6 0.8 1 1.2 1.4 GAPDH-siRNA poolRelative cyt19 mRNA Levels Figure A-2. The siRNA pool knockdown of cyt19 mRNA relative to control.

PAGE 65

55 Cytotoxic Assay 0 20 40 60 80 100 120 140 CONTROLGAPDH-cyt19p% of Control Viabilit y Figure A-3. Determination of cell viabil ity after siRNA knockdown by the XTT assay. Figure A-4. Western blot of the specificity of the crude antisera to the antigen, purified cyt19 protein. Figure A-5. Western blot of th e specificity of the crude antisera to cyt19 in human liver cytosolic preparations. 1) HL-93-F6; 2) HL-93-F7; 3) HL-94-F4; 4) HL-9721; 5) purified cyt19. 1 4 5 3 2 25ng 50ng 100ng 200ng300ng

PAGE 66

56 Figure A-6. Western blot of the specific ity of the purified an tibody to the antigen, purified cyt19 protein. Figure A-7. Western blot of th e specificity of the crude antisera to cyt19 in human liver cytosolic preparations. 1) HL-97-21; 2) HL-H-F6; 3) HL-93-F7; 4) HL-94F4; 5) HL-714 6) HeG2 cytosol 7) purified cyt19. 40ng 125ng 60ng 250ng500ng1 3 2 4 5 7 6

PAGE 67

57 LIST OF REFERENCES 1. NAS, Arsenic: Medical and Biologic Effe cts of Environmental Pollutants. 1977, Washington, D.C. 2. Maher, WA, The Presence of Arsenobetaine in Marine Animals. Comp Biochem Physiol C, 1985. 80(1): p. 199-201. 3. ATSDR, Toxicological Profile for Arseni c (Draft for Public Comment). 2005, Atlanta, GA: U.S. Department of Hea lth and Human Services, Public Health Service. 4. Brooks, WE. Arsenic. U.S. Geological Survey, Mineral Commodity Studies. 2005 [accessed 2006 April]; Available from: http://minerals.usgs.gov/minerals/pubs/commodity/arsenic/arsenmcs05.pdf 5. Jelinek, CF and Corneliussen, PE, Levels of Arsenic in the United States Food Supply. Environ Health Perspect, 1977. 19: p. 83-7. 6. Aronson, SM, Arsenic and Old Myths. R I Med, 1994. 77(7): p. 233-4. 7. Miller, WH, Jr., Schipper, HM, L ee, JS, Singer, J, and Waxman, S, Mechanisms of Action of Arsenic Trioxide. Cancer Res, 2002. 62(14): p. 3893-903. 8. Abernathy, CO, Thomas, DJ, and Calderon, RL, Health Effects and Risk Assessment of Arsenic. J Nutr, 2003. 133(5 Suppl 1): p. 1536S-8S. 9. EPA. Arsenic Treatment Technologies for Soil, Waste, and Water. 2002 [cited 2006 March 2]. 10. NRC, Arsenic in Drinking Water. 2001, Washington, DC: National Academy Press. 11. Chowdhury, UK, Biswas, BK, Chowdhury, TR, Samanta, G, Mandal, BK, Basu, GC, Chanda, CR, Lodh, D, Saha, KC, Mukherjee, SK, Roy, S, Kabir, S, Quamruzzaman, Q, and Chakraborti, D, Groundwater Arsenic Contamination in Bangladesh and West Bengal, India. Environ Health Perspect, 2000. 108(5): p. 393-7.

PAGE 68

58 12. Frost, FJ, Muller, T, Petersen, HV, Thomson, B, and Tollestrup, K, Identifying Us Populations for the Study of Health Effe cts Related to Drinking Water Arsenic. J Expo Anal Environ Epidemiol, 2003. 13(3): p. 231-9. 13. Yoshida, T, Yamauchi, H, and Fan Sun, G, Chronic Health Effects in People Exposed to Arsenic Via the Drinking Water: Dose-Response Relationships in Review. Toxicol Appl Pharmacol, 2004. 198(3): p. 243-52. 14. Tseng, WP, Chu, HM, How, SW, Fong, JM, Lin, CS, and Yeh, S, Prevalence of Skin Cancer in an Endemic Area of Chronic Arsenicism in Taiwan. J Natl Cancer Inst, 1968. 40(3): p. 453-63. 15. Chiou, HY, Hsueh, YM, Liaw, KF, Ho rng, SF, Chiang, MH, Pu, YS, Lin, JS, Huang, CH, and Chen, CJ, Incidence of Internal C ancers and Ingested Inorganic Arsenic: A Seven-Year Follow-up Study in Taiwan. Cancer Res, 1995. 55(6): p. 1296-300. 16. Tsuda, T, Babazono, A, Yamamoto, E, Kurumatani, N, Mino, Y, Ogawa, T, Kishi, Y, and Aoyama, H, Ingested Arsenic and Intern al Cancer: A Historical Cohort Study Followed for 33 Years. Am J Epidemiol, 1995. 141(3): p. 198-209. 17. Smith, AH, Goycolea, M, Haque, R, and Biggs, ML, Marked Increase in Bladder and Lung Cancer Mortality in a Region of Northern Chile Due to Arsenic in Drinking Water. Am J Epidemiol, 1998. 147(7): p. 660-9. 18. Tseng, CH, Tai, TY, Chong, CK, Tse ng, CP, Lai, MS, Lin, BJ, Chiou, HY, Hsueh, YM, Hsu, KH, and Chen, CJ, Long-Term Arsenic Exposure and Incidence of Non-Insulin-Dependent Diabetes Mel litus: A Cohort Study in ArseniasisHyperendemic Villages in Taiwan. Environ Health Perspect, 2000. 108(9): p. 84751. 19. Li, JH and Rossman, TG, Inhibition of DNA Ligase Activity by Arsenite: A Possible Mechanism of Its Comutagenesis. Mol Toxicol, 1989. 2(1): p. 1-9. 20. Petrick, JS, Ayala-Fierro, F, Cullen, WR, Carter, DE, and Vasken Aposhian, H, Monomethylarsonous Acid (Mma(Iii)) Is More Toxic Than Arsenite in Chang Human Hepatocytes. Toxicol Appl Pharmacol, 2000. 163(2): p. 203-7. 21. Ding, W, Hudson, LG, and Liu, KJ, Inorganic Arsenic Compounds Cause Oxidative Damage to DNA and Protein by Inducing Ros and Rns Generation in Human Keratinocytes. Mol Cell Biochem, 2005. 279(1-2): p. 105-12. 22. Nesnow, S, Roop, BC, Lambert, G, Ka diiska, M, Mason, RP, Cullen, WR, and Mass, MJ, DNA Damage Induced by Methylated Trivalent Arsenicals Is Mediated by Reactive Oxygen Species. Chem Res Toxicol, 2002. 15(12): p. 1627-34.

PAGE 69

59 23. Ray, BD, Moore, JM, and Rao, BD, 31p Nmr Studies of Enzyme-Bound Substrate Complexes of Yeast 3-Phosphoglycerate Kinase: Iii. Two Adp Binding Sites and Their Mg(Ii) Affinity; Effects of Vanadate and Arsenate on Enzymic Complexes with Adp and 3-P-Glycerate. J Inorg Biochem, 1990. 40(1): p. 47-57. 24. Wei, M, Wanibuchi, H, Morimura, K, Iwai, S, Yoshida, K, Endo, G, Nakae, D, and Fukushima, S, Carcinogenicity of Dimethylarsi nic Acid in Male F344 Rats and Genetic Alterations in I nduced Urinary Bladder Tumors. Carcinogenesis, 2002. 23(8): p. 1387-97. 25. Waalkes, MP, Ward, JM, Liu, J, and Diwan, BA, Transplacental Carcinogenicity of Inorganic Arsenic in the Drinking Wa ter: Induction of Hepatic, Ovarian, Pulmonary, and Adrenal Tumors in Mice. Toxicol Appl Pharmacol, 2003. 186(1): p. 7-17. 26. Wanibuchi, H, Salim, EI, Kinoshita, A, Shen, J, Wei, M, Morimura, K, Yoshida, K, Kuroda, K, Endo, G, and Fukushima, S, Understanding Arsenic Carcinogenicity by the Use of Animal Models. Toxicol Appl Pharmacol, 2004. 198(3): p. 366-76. 27. Zhao, CQ, Young, MR, Diwan, BA Coogan, TP, and Waalkes, MP, Association of Arsenic-Induced Malignant Transfo rmation with DNA Hypomethylation and Aberrant Gene Expression. Proc Natl Acad Sci U S A, 1997. 94(20): p. 10907-12. 28. Chen, H, Li, S, Liu, J, Diwan, BA, Barrett, JC, and Waalkes, MP, Chronic Inorganic Arsenic Exposure Induces Hepatic Global and Individual Gene Hypomethylation: Implications fo r Arsenic Hepatocarcinogenesis. Carcinogenesis, 2004. 25(9): p. 1779-86. 29. Tully, DB, Collins, BJ, Overstreet, JD, Smith, CS, Dinse, GE, Mumtaz, MM, and Chapin, RE, Effects of Arsenic, Cadmium, Chromium, and Lead on Gene Expression Regulated by a Battery of 13 Different Promoters in Recombinant Hepg2 Cells. Toxicol Appl Pharmacol, 2000. 168(2): p. 79-90. 30. Binet, F, Cavalli, H, Moisan, E, and Girard, D, Arsenic Trioxide (at) Is a Novel Human Neutrophil Pro-Apoptotic Agent: Effects of Catalase on at-Induced Apoptosis, Degradation of Cytoskeletal Pr oteins and De Novo Protein Synthesis. Br J Haematol, 2006. 132(3): p. 349-58. 31. Yamanaka, K, Kato, K, Mizoi, M, An, Y, Takabayashi, F, Nakano, M, Hoshino, M, and Okada, S, The Role of Active Arsenic Species Produced by Metabolic Reduction of Dimethylarsinic Acid in Genotoxicity and Tumorigenesis. Toxicol Appl Pharmacol, 2004. 198(3): p. 385-93. 32. Cullen, WR, McBride, BC, and Reglinski, J, The Reduction of Trimethylarsine Oxide to Trimethylarsine by Thiols: A Mechanistic Model for the Biological Reduction of Arsenicals. Journal of Inorganic Biochemistry, 1984. 21(1): p. 45.

PAGE 70

60 33. Gregus, Z and Nemeti, B, Purine Nucleoside Phosphorylase as a Cytosolic Arsenate Reductase. Toxicol Sci, 2002. 70(1): p. 13-9. 34. Radabaugh, TR, Sampayo-Reyes, A, Zakharyan, RA, and Aposhian, HV, Arsenate Reductase Ii. Purine Nucleosi de Phosphorylase in the Presence of Dihydrolipoic Acid Is a Route for Re duction of Arsenate to Arsenite in Mammalian Systems. Chem Res Toxicol, 2002. 15(5): p. 692-8. 35. Nemeti, B, Csanaky, I, and Gregus, Z, Arsenate Reduction in Human Erythrocytes and Rats--Testing the Role of Purine Nucleoside Phosphorylase. Toxicol Sci, 2003. 74(1): p. 22-31. 36. Gregus, Z and Nemeti, B, The Glycolytic Enzyme Glyceraldehyde-3-Phosphate Dehydrogenase Works as an Arsenate Reductase in Human Red Blood Cells and Rat Liver Cytosol. Toxicol Sci, 2005. 85(2): p. 859-69. 37. Nemeti, B and Gregus, Z, Reduction of Arsenate to Arsenite by Human Erythrocyte Lysate and Rat Liver Cytoso l Characterization of a Glutathioneand Nad-Dependent Arsenate Reduc tion Linked to Glycolysis. Toxicol Sci, 2005. 85(2): p. 847-58. 38. Radabaugh, TR and Aposhian, HV, Enzymatic Reduction of Arsenic Compounds in Mammalian Systems: Reduction of A rsenate to Arsenite by Human Liver Arsenate Reductase. Chem Res Toxicol, 2000. 13(1): p. 26-30. 39. Zakharyan, RA and Aposhian, HV, Enzymatic Reduction of Arsenic Compounds in Mammalian Systems: The Rate-Limiti ng Enzyme of Rabbit Liver Arsenic Biotransformation Is Mma(V) Reductase. Chem Res Toxicol, 1999. 12(12): p. 1278-83. 40. Zakharyan, RA, Sampayo-Reyes, A, H ealy, SM, Tsaprailis, G, Board, PG, Liebler, DC, and Aposhian, HV, Human Monomethylarsoni c Acid (Mma(V)) Reductase Is a Member of the Glut athione-S-Transferase Superfamily. Chem Res Toxicol, 2001. 14(8): p. 1051-7. 41. Vasken Aposhian, H, Zakharyan, RA, Avram, MD, Sampayo-Reyes, A, and Wollenberg, ML, A Review of the Enzymology of Arsenic Metabolism and a New Potential Role of Hydrogen Peroxide in the Detoxication of the Trivalent Arsenic Species. Toxicol Appl Pharmacol, 2004. 198(3): p. 327-35. 42. Scott, N, Hatlelid, KM, MacKenzie, NE, and Carter, DE, Reactions of Arsenic(Iii) and Arsenic(V) Species with Glutathione. Chem Res Toxicol, 1993. 6(1): p. 1026. 43. Delnomdedieu, M, Basti, MM, Otvos, JD, and Thomas, DJ, Reduction and Binding of Arsenate and Dimethylarsinate by Glutathione: A Magnetic Resonance Study. Chemico-Biological Interactions, 1994. 90(2): p. 139.

PAGE 71

61 44. Mandal, BK, Ogra, Y, and Suzuki, KT, Identification of Dimethylarsinous and Monomethylarsonous Acids in Human Urine of the Arsenic-Affected Areas in West Bengal, India. Chem Res Toxicol, 2001. 14(4): p. 371-8. 45. Yamauchi, H and Yamamura, Y, Metabolism and Excretion of Orally Administrated Arsenic Trioxide in the Hamster. Toxicology, 1985. 34(2): p. 11321. 46. Yoshida, K, Chen, H, Inoue, Y, Wanibuchi, H, Fukushima, S, Kuroda, K, and Endo, G, The Urinary Excretion of Arsenic Metabolites after a Single Oral Administration of Dimethylarsinic Acid to Rats. Archives of Environmental Contamination and Toxicology, 1997. 32(4): p. 416. 47. Marafante, E, Vahter, M, Norin, H, E nvall, J, Sandstrom, M, Christakopoulos, A, and Ryhage, R, Biotransformation of Dimethylar sinic Acid in Mouse, Hamster and Man. J Appl Toxicol, 1987. 7(2): p. 111-7. 48. Francesconi, KA, Tanggaar, R, McKenzie, CJ, and Goessler, W, Arsenic Metabolites in Human Urine afte r Ingestion of an Arsenosugar. Clin Chem, 2002. 48(1): p. 92-101. 49. Zakharyan, R, Wu, Y, B ogdan, GM, and Aposhian, HV, Enzymatic Methylation of Arsenic Compounds: Assay, Partial Pu rification, and Properties of Arsenite Methyltransferase and Monomethylarsonic Acid Methyltransferase of Rabbit Liver. Chem Res Toxicol, 1995. 8(8): p. 1029-38. 50. Wildfang, E, Zakharyan, RA, and Aposhian, HV, Enzymatic Methylation of Arsenic Compounds. Vi. Characterizati on of Hamster Liver Arsenite and Methylarsonic Acid Methyltransferase Activities in Vitro. Toxicol Appl Pharmacol, 1998. 152(2): p. 366-75. 51. Lin, S, Shi, Q, Nix, FB, Styblo, M, Beck, MA, Herbin-Davis, KM, Hall, LL, Simeonsson, JB, and Thomas, DJ, A Novel S-Adenosyl-L-M ethionine:Arsenic(Iii) Methyltransferase from Rat Liver Cytosol. J Biol Chem, 2002. 277(13): p. 10795803. 52. Hayakawa, T, Kobayashi, Y, Cui, X, and Hirano, S, A New Metabolic Pathway of Arsenite: Arsenic-Glutathione Complexes Are Substrates for Human Arsenic Methyltransferase Cyt19. Arch Toxicol, 2004. 53. Healy, SM, Casarez, EA, Ayala-Fierro, F, and Aposhian, H, Enzymatic Methylation of Arsenic Compounds. V. Arse nite Methyltransferase Activity in Tissues of Mice. Toxicol Appl Pharmacol, 1998. 148(1): p. 65-70. 54. Wildfang, E, Radabaugh, TR, and Vasken Aposhian, H, Enzymatic Methylation of Arsenic Compounds. Ix. Liver Arsenite Me thyltransferase and Arsenate Reductase Activities in Primates. Toxicology, 2001. 168(3): p. 213-21.

PAGE 72

62 55. McNally, AJ and D.S., B, Molecular Cloning and Characterization of Human Cyt19, an S-Adenosyl-L-Methionine:As -Methyltransferase from Hepg2 Cells. Itinerary Planner. New Orleans, LA: Soci ety of Toxicology, 2005: p. Abstract No. 131. 56. Vahter, M and Marafante, E, Intracellular Interaction and Metabolic Fate of Arsenite and Arsenate in Mice and Rabbits. Chem Biol Interact, 1983. 47(1): p. 29-44. 57. Vahter, M, Marafante, E, and Dencker, L, Tissue Distribution and Retention of 74as-Dimethylarsinic Acid in Mice and Rats. Arch Environ Contam Toxicol, 1984. 13(3): p. 259-64. 58. Healy, SM, Wildfang, E, Zakharyan, RA, and Aposhian, HV, Diversity of Inorganic Arsenite Biotransformation. Biol Trace Elem Res, 1999. 68(3): p. 24966. 59. Vahter, M, Genetic Polymorphism in the Biot ransformation of Inorganic Arsenic and Its Role in Toxicity. Toxicol Lett, 2000. 112-113: p. 209-17. 60. Concha, G, Vogler, G, Lezcano, D, Nermell, B, and Vahter, M, Exposure to Inorganic Arsenic Metabolites During Early Human Development. Toxicol Sci, 1998. 44(2): p. 185-90. 61. Vahter, M, Concha, G, Nermell, B, Nil sson, R, Dulout, F, and Natarajan, AT, A Unique Metabolism of Inorganic Arsenic in Native Andean Women. Eur J Pharmacol, 1995. 293(4): p. 455-62. 62. Concha, G, Nermell, B, and Vahter, MV, Metabolism of Inorganic Arsenic in Children with Chronic High Arsenic Exposure in Northern Argentina. Environ Health Perspect, 1998. 106(6): p. 355-9. 63. Concha, G, Vogler, G, Nermell, B, and Vahter, M, Low-Level Arsenic Excretion in Breast Milk of Native Andean Women Ex posed to High Levels of Arsenic in the Drinking Water. Int Arch Occup Environ Health, 1998. 71(1): p. 42-6. 64. Chiou, HY, Hsueh, YM, Hsieh, LL, Hsu, LI, Hsu, YH, Hsieh, FI, Wei, ML, Chen, HC, Yang, HT, Leu, LC, Chu, TH, Ch en-Wu, C, Yang, MH, and Chen, CJ, Arsenic Methylation Capacity, Body Retention, and Null Genotypes of Glutathione S-Transferase M1 and T1 am ong Current Arsenic-Exposed Residents in Taiwan. Mutat Res, 1997. 386(3): p. 197-207. 65. Drobna, Z, Waters, SB, Walton, FS, LeCluyse, EL, Thomas, DJ, and Styblo, M, Interindividual Variation in the Met abolism of Arsenic in Cultured Primary Human Hepatocytes. Toxicol Appl Pharmacol, 2004. 201(2): p. 166-77.

PAGE 73

63 66. Meza, MM, Yu, L, Rodriguez, YY, Guild, M, Thompson, D, Gandolfi, AJ, and Klimecki, WT, Developmentally Restricted Ge netic Determinants of Human Arsenic Metabolism: Association between Urinary Methylated Arsenic and Cyt19 Polymorphisms in Children. Environ Health Perspect, 2005. 113(6): p. 775-81. 67. Wood, TC, Salavaggione, OE, Mukherj ee, B, Wang, L, Klumpp, AF, Thomae, BA, Eckloff, BW, Schaid, DJ, Wieben, ED, and Weinshilboum, RM, Human Arsenic Methyltransferase (As3mt) P harmacogenetics: Gene Resequencing and Functional Genomics Studies. J Biol Chem, 2006. 68. Jeanteur, P, Regulation of Alternative Splicing. Progress in Molecular and Subcellular Biology, 31. 2003, Berlin; New York: Springer. xiii, 245. 69. Schoenberg, DR, Mrna Processing and Metaboli sm: Methods and Protocols. 2004, Totowa, NJ: Humana Press. xv, 270. 70. Black, DL, Mechanisms of Alternative Pre-Messenger Rna Splicing. Annu Rev Biochem, 2003. 72: p. 291-336. 71. Klaassen, CD, Casarett and Doull's Toxicology: The Basic Science of Poisons. 6th ed. 2001, New York: McGraw-Hill Medi cal Publishing Division. xix, 1236. 72. Mure, K, Uddin, AN, Lopez, LC, Styblo, M, and Rossman, TG, Arsenite Induces Delayed Mutagenesis and Transformati on in Human Osteosarcoma Cells at Extremely Low Concentrations. Environ Mol Mutagen, 2003. 41(5): p. 322-31. 73. Petrick, JS, Jagadish, B, Mash, EA, and Aposhian, HV, Monomethylarsonous Acid (Mma(Iii)) and Arsenite: Ld(50) in Hamsters and in Vitro Inhibition of Pyruvate Dehydrogenase. Chem Res Toxicol, 2001. 14(6): p. 651-6. 74. Hirano, S, Kobayashi, Y, Cui, X, Kanno, S, Hayakawa, T, and Shraim, A, The Accumulation and Toxicity of Methylat ed Arsenicals in Endothelial Cells: Important Roles of Thiol Compounds. Toxicol Appl Pharmacol, 2004. 198(3): p. 458-67. 75. Healy, SM, Zakharyan, RA, and Aposhian, HV, Enzymatic Methylation of Arsenic Compounds: Iv. In Vitro and in Vi vo Deficiency of the Methylation of Arsenite and Monomethylarsonic Acid in the Guinea Pig. Mutat Res, 1997. 386(3): p. 229-39. 76. Vahter, M, Couch, R, Nermell, B, and Nilsson, R, Lack of Methylation of Inorganic Arsenic in the Chimpanzee. Toxicol Appl Pharmacol, 1995. 133(2): p. 262-8. 77. Zakharyan, RA, Wildfang, E, and Aposhian, HV, Enzymatic Methylation of Arsenic Compounds. Iii. The Marmoset and Tamarin, but Not the Rhesus, Monkeys Are Deficient in Methyltransfer ases That Methylate Inorganic Arsenic. Toxicol Appl Pharmacol, 1996. 140(1): p. 77-84.

PAGE 74

64 78. Aposhian, HV, Enzymatic Methylation of A rsenic Species and Other New Approaches to Arsenic Toxicity. Annu Rev Pharmacol Toxicol, 1997. 37: p. 397419. 79. Peng, B, Sharma, R, Mass, MJ, and Kligerman, AD, Induction of Genotoxic Damage Is Not Correlated with the Ability to Methylate Arsenite in Vitro in the Leukocytes of Four Mammalian Species. Environ Mol Mutagen, 2002. 39(4): p. 323-32. 80. Cullen, WR, McBride, BC, Pickett, AW, and Reglinski, J, The Wood Preservative Chromated Copper Arsenate Is a Substrat e for Trimethylarsine Biosynthesis. Appl Environ Microbiol, 1984. 47(2): p. 443-4. 81. Vahter, M, Methylation of Inorganic Arsenic in Different Mammalian Species and Population Groups. Sci Prog, 1999. 82 (Pt 1): p. 69-88. 82. Loffredo, CA, Aposhian, HV, Cebrian, ME, Yamauchi, H, and Silbergeld, EK, Variability in Human Metabolism of Arsenic. Environ Res, 2003. 92(2): p. 85-91. 83. Martin, JL and McMillan, FM, Sam (Dependent) I Am: The SAdenosylmethionine-Dependent Methyltransferase Fold. Curr Opin Struct Biol, 2002. 12(6): p. 783-93. 84. Zakharyan, RA, Ayala-Fierro, F, Culle n, WR, Carter, DM, and Aposhian, HV, Enzymatic Methylation of Arsenic Co mpounds. Vii. Monomethylarsonous Acid (Mmaiii) Is the Substrate for Mma Methyl transferase of Rabbit Liver and Human Hepatocytes. Toxicol Appl Pharmacol, 1999. 158(1): p. 9-15. 85. NRC, Arsenic: Medical and Biologic Effe cts of Environmental Pollutants. 1977, Washington DC: National Academy of Sciences. 86. Brown, KG and Ross, GL, Arsenic, Drinking Water, and Health: A Position Paper of the American Council on Science and Health. Regul Toxicol Pharmacol, 2002. 36(2): p. 162-74. 87. ATSDR, Toxicological Profile for Arsenic (Update). August 1998. 88. Cullen, WR, K.J. Reimer, Arsenic Speciation in the Environment. Chemical Review, 1989. 89: p. 713-764. 89. Cullen, WR, McBride, BC, and Reglinski, J, The Reduction of Trimethlarsine Oxide to Trimethylarsine by Thiols: A Mechanistic Model for the Biological Reduction of Arsenicals. J. Inorg. Biochem., 1984. 21: p. 45-60. 90. Styblo, M, Del Razo, LM, Vega, L, Ge rmolec, DR, LeCluyse, EL, Hamilton, GA, Reed, W, Wang, C, Cullen, WR, and Thomas, DJ, Comparative Toxicity of Trivalent and Pentavalent Inorganic and Methylated Arsenicals in Rat and Human Cells. Arch Toxicol, 2000. 74(6): p. 289-99.

PAGE 75

65 91. Itoh, H, Washio, T, and Tomita, M, Computational Comparative Analyses of Alternative Splicing Regula tion Using Full-Length Cdna of Various Eukaryotes. Rna, 2004. 10(7): p. 1005-18. 92. Kagan, RM and Clarke, S, Widespread Occurrence of Three Sequence Motifs in Diverse S-Adenosylmethionine-Depe ndent Methyltransferases Suggests a Common Structure for These Enzymes. Arch Biochem Biophys, 1994. 310(2): p. 417-27. 93. Hamahata, A, Takata, Y, Gomi, T, and Fujioka, M, Probing the SAdenosylmethionine-Binding Site of Rat Guanidinoacetate Methyltransferase. Effect of Site-Directed Mutagenesis of Residues That Are Conserved across Mammalian Non-Nucleic Acid Methyltransferases. Biochem J, 1996. 317 (Pt 1): p. 141-5. 94. Kozak, M, Possible Role of Flanking Nucleo tides in Recognition of the Aug Initiator Codon by Eukaryotic Ribosomes. Nucleic Acids Res, 1981. 9(20): p. 5233-52. 95. Kozak, M, Compilation and Analysis of Sequences Upstream from the Translational Start Site in Eukaryotic Mrnas. Nucleic Acids Res, 1984. 12(2): p. 857-72. 96. Baker, KE and Parker, R, Nonsense-Mediated Mrna Decay: Terminating Erroneous Gene Expression. Curr Opin Cell Biol, 2004. 16(3): p. 293-9. 97. Zhang, S, Ruiz-Echevarria, MJ, Quan, Y, and Peltz, SW, Identification and Characterization of a Sequence Motif Involved in Nonsense-Mediated Mrna Decay. Mol Cell Biol, 1995. 15(4): p. 2231-44. 98. Ketterling, RP, Drost, JB, Scaringe, WA, Liao, DZ, Liu, JZ, Kasper, CK, and Sommer, SS, Reported in Vivo Splice-Site Mutations in the Factor Ix Gene: Severity of Splicing Defects and a Hypothe sis for Predicting Deleterious Splice Donor Mutations. Hum Mutat, 1999. 13(3): p. 221-31. 99. Moller, LB, Tumer, Z, Lund, C, Petersen, C, Cole, T, Hanusch, R, Seidel, J, Jensen, LR, and Horn, N, Similar Splice-Site Mutations of the Atp7a Gene Lead to Different Phenotypes: Classical Menkes Disease or Occipital Horn Syndrome. Am J Hum Genet, 2000. 66(4): p. 1211-20. 100. Faustino, NA and Cooper, TA, Pre-Mrna Splicing and Human Disease. Genes Dev, 2003. 17(4): p. 419-37. 101. Mironov, AA, Fickett, JW, and Gelfand, MS, Frequent Alternative Splicing of Human Genes. Genome Res, 1999. 9(12): p. 1288-93.

PAGE 76

66 102. Kan, Z, Rouchka, EC, Gish, WR, and States, DJ, Gene Structure Prediction and Alternative Splicing Analysis Us ing Genomically Aligned Ests. Genome Res, 2001. 11(5): p. 889-900. 103. Hagiwara, M, Alternative Splicing: A New Drug Target of the Post-Genome Era. Biochim Biophys Acta, 2005. 1754(1-2): p. 324-31. 104. Hui, J and Bindereif, A, Alternative Pre-Mrna Splicing in the Human System: Unexpected Role of Repetitive Sequences as Regulatory Elements. Biol Chem, 2005. 386(12): p. 1265-71. 105. Zamore, PD and Haley, B, Ribo-Gnome: The Big World of Small Rnas. Science, 2005. 309(5740): p. 1519-24.

PAGE 77

67 BIOGRAPHICAL SKETCH Alex J. McNally is the youngest so n of Eduaurdo and Ligia McNally, who immigrated from Managua, Nicaragua. He wa s born on April 6, 1980, in Miami, FL. He was raised in Hialeah, FL, where he attend ed North Miami Senior High and graduated with honors on May 1998. He then attended th e University of Florida where he dualed major in animal science and microbiology and cell science. He further enhanced his undergraduate experience working as a student lab assistant at the Un iversity of Florida microbiology and cell science building. He worked with cloning arogenate dehydrogenase from Arabidopsis thaliana under the guidanc e of Dr. Carol Bonner and Dr. Nemat Keyhani. After earning his Bach elor of Science, on August 2003, Alex continued his graduate studies at the Universi ty of Florida, pursui ng a Master of Science specializing in toxicology in May of 2004. He emphasized his graduate research on the characterization of cyt19, an arsenic methy ltransferase, under the guidance of Dr. David S. Barber. He now plans to pursue a caree r in a research laboratory where he can enhance his knowledge and practical experience.


Permanent Link: http://ufdc.ufl.edu/UFE0014297/00001

Material Information

Title: Characterization of the Human Cyt19 Gene Product: An Arsenic Methyltransferase
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0014297:00001

Permanent Link: http://ufdc.ufl.edu/UFE0014297/00001

Material Information

Title: Characterization of the Human Cyt19 Gene Product: An Arsenic Methyltransferase
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0014297:00001


This item has the following downloads:


Full Text












CHARACTERIZATION OF THE HUMAN CYT19 GENE PRODUCT: AN ARSENIC
METHYLTRANSFERASE















By

ALEX J. MCNALLY


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Alex J. McNally















ACKNOWLEDGMENTS

I would like to thank my mentor, Dr. David S. Barber, for all his help, guidance,

and knowledge he has given me. I would also like to thank my committee members, Dr.

Nancy Denslow, Dr. Lena Ma, and Dr. Steve Roberts, for their suggestions and advise. I

thank my fiance and my parents for their support and encouragement throughout my

graduate studies.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ......... .............. .................................................................... iii

L IS T O F T A B L E S .................. ........ .............................................................. v i

LIST OF FIGURE S ......... ..................................... ........... vii

ABSTRACT ........ .............. ............. ...... ...................... ix

CHAPTER


1 IN TR OD U CTION ............................................... .. ......................... ..

Sources of A rsenic .................. ............................. .. ...... ................... .
N atu ral S ou rces ............................................................... 1
A nthropogenic Sources ................................................................................... 1
Exposure and H health Effects ............................................................................ 2
E x p o su re ................................................................................. 2
H health E effects ....................................................... 3
M echanism s of Toxicity ......................................................... ...............
A rsenic B iotransform ation................................................... ............................. 6
Reduction of Pentavalent Arsenicals ............... .............................................6
M ethylation of Trivalent Arsenicals................................... ....................... 7
V ariation in A rsenic M ethylation ....................................................... .... ........... 8
Role of M ethylation in Arsenic Toxicity ............... ............................................ 10
Specific A im s of R esearch......................................................................................... 11

2 MOLECULAR CLONING AND CHARACTERIZATION OF HUMAN CYT19,
AN S-ADENOSYL-L-METHIONINE:AS-METHYLTRANSFERASE FROM
H E P G 2 C E L L S .............................................. .............................................. .. 13

Introduction ............... ........... ........................ ............................13
M materials and M methods ....................................................................... .................. 14
M molecular Cloning ................................ .... ........ ...... .. ................. 14
RACE PCR .................. ....... ....... ...............15
Expression of Recombinant cytl9 ....... ......... ................... .................15
Characterization ........ ............ ........ ... ..................... 16
Confirmation of Methylated Arsenicals .................. ....... ..................17









R results and D iscu ssion ................... .................................................. .............. 18

3 IDENTIFICATION OF A SPLICE VARIANT OF HUMAN CYT19 ARSENIC
M ETH YLTRAN SFERA SE............................................... ............................. 33

Introduction .............. ... .... ............. .......... .......... ............ 33
M materials and M methods ..................................................................... ....................34
Molecular Cloning of cytl9 Splice Variants.............. .... ..................34
H um an L iv er Sam ples ..............................................................................35
qPCR of cytl9 Splice Variants............................ ..................................... 35
R results .............. ......... ............ .... ............................................36
Discussion ............ .............................................. ....... ... ...... .. 37

4 GENERAL CONCLUSIONS............................ .................................. 45


APPENDIX


ROLE OF CYT19 IN ACUTE ARSENIC TOXICITY. IS CYT19 THE ONLY
HUMAN ARSENIC METHYLTRANSFERASE?.............. ...............49

M materials and M methods ....................................................................... ..................49
R results and D iscu ssion ..................................................................... ................ .. 50
cytl9 mRNA Knockdown by siRNA.....................................................50
Antibody Specificity and Purification............... ................................................51
F uture E xperim ents ......................... ...................... .. .. ...... .......... 5 1

L IST O F R EFER EN CE S ........................................................................... ...............57

B IO G R A PH IC A L SK E TCH ..................................................................... ..................67
















LIST OF TABLES


Table pge

2-1. Primers used in the PCR amplification ofcytl9 .................................................23

2-2. Kinetic analysis of the methylation activity of cytl9-WT and cytl9S81R..............23

3-1. The individual information and Shapiro's score of cytl9 exon 2 and exon 3. ........44

3-2. The amount of cytl9 and cytl9AE2 in different human liver samples and HepG2
c e lls ........................................................................... 4 4

A-1. Sequence of double stranded siRNA ............................ ........ ............. .................. 53
















LIST OF FIGURES


Figure pge

2-1. Sequence alignment of cytl9t and Genbank sequence (accession AF226730) ......24

2-2. Sequence alignment of cytl9S81R and Genbank sequence (accession
A K 057833) ....................................................................... 25

2-3. Sequence alignment of cytl9-W T and cytl9t .....................................................26

2-4. Sequence alignments of the 5' & 3'RACE-PCR products and the Genbank
sequences (accession AK057833 and AF226730)..................... .................27

2-5. Purification of recombinant human cytl9.................................... .................... 28

2-6. The effects of As"' & MINAV concentrations ..................................................29

2-7. The effect of pH on activity ...................................... ............... 30

2-8. The effects of reductants on methylation activity ..............................................30

2-9. The effect of SAM concentration on activity ............................... .....................31

2-10. Arsenical metabolites formed after incubation with [3H]SAM and cytl9 for 30
m in at 3 7 C ........................................................................... 3 2

3-1. The hypothesized scheme of iAs methylation proposed by Cullen, McBride et
al. 1984 ....................................................................40

3-2. PCR products of cytl9 amplification................................. ...............40

3-3. Alignment of the reference cytl9 nucleotide sequence and cytl9AE2 ..................41

3-4. cytl9 isoforms ......... ......... .......... ...............42

3-5. Alignment of the reference cytl9 amino acid sequence and product of cytl9AE2
u O R F ...............................................................................4 3

A-1. Determination of the most efficient siRNA in the knockdown of cytl9 mRNA
levels assayed by qP C R ............................................................................. .... .... 54

A-2. The siRNA pool knockdown of cytl9 mRNA relative to control............................54









A-3. Determination of cell viability after siRNA knockdown by the XTT assay............55

A-4. Western blot of the specificity of the crude antisera to the antigen, purified cytl9
p ro te in ...................................... ................................................... 5 5

A-5. Western blot of the specificity of the crude antisera to cytl9 in human liver
cytosolic preparations.................. ......................... .. ......55

A-6. Western blot of the specificity of the purified antibody to the antigen, purified
cy tl9 p rotein ........................................................................................... 5 6

A-7. Western blot of the specificity of the crude antisera to cytl9 in human liver
cytosolic preparations.................. ......................... .. ......56















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

CHARACTERIZATION OF THE HUMAN CYT19 GENE PRODUCT: AN ARSENIC
METHLTRANSFERASE

By

Alex J. McNally

May 2006

Chair: David S. Barber
Major Department: Veterinary Medicine

Chronic arsenic exposure poses a threat to millions of people throughout the world

due to arsenic in drinking water; however the mechanisms underlying arsenic

carcinogenicity and individual susceptibility are unknown. Methylation has been

considered the primary detoxification pathway of inorganic arsenic in many species but

there is evidence that methylation may increase arsenic toxicity. It has been shown that

methylated arsenicals that contain As"' are more cytotoxic and genotoxic than either

arsenate or arsenite. Rat liver S-adenosyl-L-methionine: arsenic"'-methyltransferase has

been identified and is homologous to human cytl9, but there are species specific

differences in arsenic biotransformation and toxicity. Additionally, there is considerable

variation among humans in the rate of methylation of inorganic arsenic leading to

measurable differences in toxicity. Therefore, it is important to better understand the

enzymes that catalyze the methylation of arsenic in humans. In this study, we PCR

amplified and cloned cytl9, a putative arsenic methyltransferase from human HepG2









hepatoma cells. The PCR product was ligated into an E. coli pET expression vector with

a polyhistidine tag at the amino-terminal residue. The recombinant human cytl9 was

successfully expressed in BL21 (DE3) and purified using a nickel-nitrilotriacetic acid

metal-affinity chromatography. The recombinant protein catalyzes the methylation of

arsenite as well as monomethylarsonic acid (MMA). The specific activity of arsenite

methylation was 597 pmol/mg protein/min in a reaction mixture containing 5mM GSH, 1

mM DTT, 1 mM MgC12, 100 iM S-adenosyl-L-methionine, 50M sodium m-arsenite,

and 5 .g of S-adenosyl-L-methionine: arsenic methyltransferase in 100mM tris/100mM

sodium phosphate buffer pH 7.4 at 37 C for 30 minutes. The results suggest that the

human cytl9 gene, in fact, is translated to an S-adenosyl-L-methionine: arsenic

methyltransferase which methylates both arsenite and MMA.

Studies have shown that humans exposed to arsenic excrete variable amounts of

methylated arsenicals in the urine which may be due to differences in arsenic

methyltransferase activity. While polymorphisms in the coding region of cytl9 may

account for some of the observed variation in arsenic methylation, other mechanisms are

likely to be involved. In this study we identified an alternative splice variant of the

human cytl9 (cytl9AE2), in which exon 2 is removed creating a bicistronic transcript

that is unlikely to produce an active protein. This variant was expressed in 7 out of 7

male Caucasian human liver samples tested and in HepG2 cells. The human cytl9

appears to be alternatively spliced in many individuals and may play a role in the

observed variation in arsenic methylation seen in individuals.














CHAPTER 1
INTRODUCTION

Sources of Arsenic

Natural Sources

Arsenic (As) is a member of the nitrogen group in the periodic table and is

classified as a metalloid. This metalloid is a naturally occurring element and is the 20th

most abundant element in the earth's crust [1]. Arsenic is found in the environment as

sulfides, and complex sulfides of iron, nickel, and cobalt. The natural weathering of

rocks and soils containing various forms of arsenic contribute to its levels in the

environment. Arsenic is present in the atmosphere, aquatic environments, soils &

sediments, and in organisms. This metalloid is found naturally in rocks, geothermal

wells, minerals, and metal ores such as copper and lead. Arsenic is present in the

environment in both organic and inorganic forms and exists in four valence states, -3, 0

(elemental), +3 (trivalent), and +5 pentavalentt arsenic), however it exists mainly in the

latter two valence states. Many marine plant and animal species have naturally high

levels of As, but in organic forms that appear to cause little toxicity. The main species of

arsenic in marine animals is the arsenosugar, arsenobetaine [2]. In general, organic forms

of arsenic are less toxic than inorganic forms of arsenic and the pentavalent inorganic

forms are less toxic than trivalent inorganic arsenic compounds.

Anthropogenic Sources

Anthropogenic sources of arsenic stem from its use in pesticides and wood

preservatives as well as mining and smelting wastes. In the U.S., 2,200 tons of arsenic









was produced in 1985 [3]. Since 1985, the domestic production of arsenic in the US has

ceased. However, arsenic is still used domestically and therefore is imported from

countries such as China, Japan and Mexico. In 2003, the United States was world's

largest consumer of arsenic, demanding 21,600 metric tons [4] Arsenic has also been

used in the production of dessicants and as growth stimulants for plants and animals.

Organoarsenicals have been shown to have both therapeutic and growth promoting

properties in poultry and swine. Arsanilic acid and its sodium salts, such as 4-

nitrophenylarsonic acid are added to pet feed [5]. Most of this arsenic passes through

the animal and becomes part of the waste stream resulting from animal production. In

addition, arsenic has been used for therapeutic purposes and of course as a poison.

Arsenic has been used to treat syphilis, tropical diseases such as trypanosomiasis (African

sleeping sickness), yaws, amoebic dysentery and recently as an anticancer. Paul Ehrlich

developed an organic arsenical, arsphenamine, also known as Salvarsan, which was used

to treat syphilis [6]. Arsphenamine was also believed to be effective in treating

trypanosomiasis [6]. Arsenic trioxide has been shown to be highly effective in the

treatment of various cancers especially of acute promyelocytic leukaemia [7].

Exposure and Health Effects

Exposure

Arsenic is present throughout our environment, in the air we breathe, the water we

drink, and the food we eat. Water contributes more to iAs exposure than food or air. On

average Americans are exposed to 50 .g per day of arsenic of which 10 .g is in the

inorganic form [8]. People are exposed to higher than average arsenic due to living or

working around higher exposure sources. For example living or working near a

hazardous waste site can lead to exposure via the air, ingestion, or the food chain.









Arsenic is present in 47% of all sites on the National Priorities List (NPL) sites or

Superfund sites making it second only to lead as the most common contaminant of

concern [9]. Occupational settings such as workers who use or produce arsenic

compounds: vineyards, ceramics, glass-making, smelting, pharmaceuticals, refining of

metallic ores, pesticide manufacturing & application, wood preservation, or

semiconductor manufacturing, have the potential to be exposed to higher than average

arsenic levels [1].

Currently, people in Taiwan, Mexico, western United States, western South

America, China, West Bengal and Bangladesh are exposed to high levels of arsenic due

to anthropogenic and/or natural contamination of potable water. It has been estimated

that 200 million people worldwide are at risk from health effects associated with this

exposure [10]. The two most affected areas in the world are Bangladesh and West

Bengal, India; it has been estimated that around 122 million people in these areas are

exposed to groundwater arsenic concentrations above the World Health Organization

maximum permissible limit of 50g/L [11]. The study showed that in West Bengal,

26.4% (n=10,991 tube wells) of the water samples had arsenic ranging in 100-299 [g/L.

In the U.S. the arsenic maximum contaminant level (MCL) was decreased to 10g/L by

the US Environmental Protection Agency (EPA) in January 2001. Frost et al. [12]

identified 33 counties in 11 states in the western United States with mean arsenic

concentrations of 10g/L or greater. In addition, from 1950-1990 there were over 60

million people in the US exposed to arsenic contaminated water exceeding 10g/L [12].

Health Effects

Ingestion of arsenic is a widespread human health problem. There are different

symptoms associated with acute and chronic arsenic exposure. Acute exposure to arsenic









can result in acute paralytic syndrome, acute GI syndrome, and even death. Oral

exposure above 60 ppm in food or water can result in death [3]. Chronic arsenic

exposure can result in skin disorders such as hyper and hypo pigmentation, and

hyperkeratosis [3]. It was found that even at 0.005-0.01mg/L of arsenic in water there is

an increase in the prevalence of skin lesions [13]. In addition, chronic iAs exposure can

affect the circulatory and nervous systems leading to diseases such as Blackfoot disease.

Major organs such as the liver, kidneys, lung, bladder, and heart can be affected as a

result of arsenic cytotoxicity. There is an increase of cancer, death from cancer, and

diabetes mellitus associated with chronic arsenic exposure. Epidemiological studies

show that there is dose-response relationship between exposure to iAs and skin cancer

[14]. A study in Taiwan[15] and Japan[16] demonstrated a significant association

between long-term arsenic exposure in drinking water with lung and bladder cancer. In

northern Chile an increase in mortality from bladder, lung, kidney, and skin cancer is

associated with As exposure; bladder and lung cancer showing highest increase in

mortality [17]. A follow up study in Taiwan compared the incidence of diabetes mellitus

in an arsenic exposed population to two control areas showed an association between As

exposure and diabetes mellitus [18].

Mechanisms of Toxicity

The mechanism of arsenic toxicity is dependent on oxidation state. Trivalent

arsenicals, including methylated arsenicals produce toxicity by enzyme inhibition by

interactions with sulfhydryl groups in proteins [19] and the generation of reactive oxygen

species (ROS). For example, in vitro studies have shown that MMA111 and arsenite are

capable of inhibiting pyruvate dehydrogenase (PDH) activity in hamster kidney and

purified porcine heart PDH resulting in the subsequent blockage of adeonosine









triphosphate (ATP) production because of the disruption of the citric acid due to the

depletion of cellular citrate [20]. Inorganic arsenicals, arsenite and arsenate, have been

shown to induce ROS and reactive nitrogen species (RNS) which result in DNA and

protein oxidative damage [21]. Another study demonstrated that MMA"' and DMA"'

induced ROS result in DNA damage [22]. Arsenate has been shown to interfere with

ATP production by substituting for phosphate leading to production of an unstable ADP-

arsenate complex which spontaneously hydrolyzes [23]. This process leads to a depletion

of cellular energy due to this futile cycle.

Although there is strong evidence of the carcinogenicity of arsenic in humans, the

mechanism by which tumors are produced is unknown. Studies of arsenic carcinogenesis

have been hampered because there are very few animal models in which arsenic induces

carcinogenesis [3]. DMA concentrations of 50 and 200 ppm have been shown to be

carcinogenic in F344 rats urinary bladder [24]. Recent work has demonstrated the

promotion effects of inorganic arsenicals and methylated arsenicals. Inorganic arsenic

(42.5 and 85 ppm)has been shown to be a transplacental carcinogen in mice [25].

Organic arsenicals, such as MMA, DMA, and TMAO have been shown to act as

promoters in carcinogenesis of several rat organs [26]. However, some of these studies

have received much criticism due to the high arsenical exposure levels used ranging from

about 50 to 400 ppm and the use of several initiators such as diethylnitrosamine, N-butyl-

N-(4-hydroxybutyl)nitrosamine, N-methyl-N-nitrosourea, dihydroxy-di-N-

propylnitrosamine and N-N'-dimethylhydrazine, prior to arsenic exposure.

Several possibilities for mechanisms of arsenic induced malignancies have been

hypothesized such as chromosomal abnormality, oxidative stress, and the promotion of









tumorigenesis. Zhao et al. [27], have shown that chronic low level arsenic (0-0.5[iM)

exposure will result in the malignant transformation of epithelial cells associated with

DNA hypomethylation due to depletion of SAM and aberrant gene expression. An in

vivo long-term arsenic exposure study to mice demonstrated that arsenic in potable water

can induce aberrant gene expression, global DNA hypomethylation, and hypomethylation

of the gene for the estrogen receptor-a resulting in enhanced transcription, which

cumulatively could lead to arsenic hepatocarcinogenesis [28]. Arsenate was shown to

have a dose-dependent transcriptional induction of several different signal transduction

pathways, including the dose-response induction of several promoters and/or response

elements responsive to oxidative damage and DNA damage [29] which may help

understand the mechanisms of carcinogenicity for arsenic. Binet et al. [30] has shown

that arsenic induced apoptosis via reactive oxygen species (ROS) production occurs but,

the ROS is not produced from nicotinamide adenine dinucleotide phosphate

dehydrogenase activation. Trivalent methylated arsenicals have been shown to indirectly

cause DNA damage by ROS. One study showed that DMA"' promotes tumorigenesis

and gentoxicity via dimethylated arsenic peroxides [31]

Arsenic Biotransformation

Reduction of Pentavalent Arsenicals

The biotransformation of iAs alternates between the reduction of arsenate (iAsV) to

arsenite (iAs"') followed by oxidative methylation. The hypothesized scheme of iAs

methylation involves oxidative methylation and reduction[32]:

AsVO43- + 2e As"133- + CH3 CH3As 032- + 2e CH3As"122- + CH3+

(CH3)2AsVO2- + 2e (CH3)2As"'O









Arsenic reduction must occur first before it can be methylated. Several enzymes

have been shown capable to reduce arsenic. Purine nucleoside phosphorylase (PNP) has

the ability to reduce iAsV to iAs"' in the presence of a dithiol and a purine nucleoside

guanosinee or inosine) in vitro [33, 34]. However, studies performed by Nemeti et al.

2003 showed that PNP does not play a role in iAsv reduction in vivo [35].

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in the presence of glutathione

(GSH) and NAD has the ability to reduce iAsV to iAs"' in human red blood cells and rat

liver cytosol [36, 37]. A human arsenate reductase was discovered capable of reducing

arsenate but not methylarsonic acid (MMAV) [38]. Zakharyan et al 1999 presented an

enzyme from rabbit liver capable of reducing MMAV, arsenate, and dimethylarsinic acid

(DMAv) in the presence of GSH; this enzyme was also present in human liver [39].

MMAV reductase was sequenced and 92% of the sequences were identical to human

glutathione-S-transferase Omega class (hGSTO-1) [40]. This hGSTO-1 catalyzes the

reduction of iAsV, MMAV, and DMAv [39, 41]. There is evidence that pentavalent

arsenicals can be reduced nonenzymatically. Glutathione (GSH) has been shown to

reduce pentavalent arsenicals [42, 43].

Methylation of Trivalent Arsenicals

Following the first reduction step, arsenite is enzymatically oxidatively methylated

to MMAV. In this reaction, a high energy methyl group from S-adenosyl-L-methione

(SAM) is transferred to a trivalent arsenical in an oxidative process that produces a

pentavalent methylated arsenical. The resulting monomethylarsonic acid (MMA) can be

reduced a second time and methylated again to form dimethylarsinic acid (DMA). In

West Bengal, MMA1" and DMA1" were detected in the urine of exposed humans in 48%

and 72% respectively out of the 428 subjects [44]. In some animals, including humans, a









third methylation can occur resulting in formation of trimethylarsine oxide (TMAO). It

was shown that a single dose of arsenic trioxide in hamsters resulted in a very small

amount of TMAO production in the liver[45]. Yoshida et al 1997 demonstrated that rats

excrete TMAO in their urine after a single oral administration of DMA [46]. Urine

excretion of TMAO in man has been observed after ingestion of an arsenosugar and

DMA [47, 48].

Arsenic methyltransferases (AS3MT) have been isolated from many mammalian

species. An AS3MT has been purified 2000-fold from rabbit liver by DEAE

chromatography to a single band [49]. The rabbit liver AS3MT was capable of

performing both methylation steps. The Golden Syrian hamster liver was used to purify

AS3MT and was shown to have similar activities as the rabbit AS3MT [50]. Rat liver S-

adenosyl-L-methionine:arsenic"'-methyltransferase has been identified and is

homologous to human cytl9 [51]. The rat arsenic methyltransferase has been shown to

perform both mono and dimethylation of arsenic. Arsenic methyltransferase activity has

been determined in mice and primates, including humans [52-55].

Variation in Arsenic Methylation

There is significant variation in the arsenic methylation rate and arsenic metabolite

production among mammalian species. The variability of arsenic methylation is apparent

in the amounts of methylated arsenic metabolites seen in the urine of exposed mammals

such as the rat, rabbit, hamster, dog, and mouse. For example, mice quickly excrete

about 90% of the dose in two days of which 80% is DMA [56]. The rat efficiently

methylates arsenic, but it accumulates DMA in red blood cells resulting in subsequent

lower DMA excretion levels making it a poor model for human metabolic studies [57].

Healy et al. [58], purified arsenic methyltransferases from livers of rabbit, hamster, and









rhesus monkey and found different rates of methylation which may affect arsenic

elimination and toxicity.

However, these mammals with arsenic methylation capacity have something in

common which distinguishes them from humans. On average, humans exposed to

arsenic excrete more MMA in the urine than other mammals, specifically 10-30% iAs,

10-20% MMA, and 60-80% DMA [59]. This suggests that non-human mammals are

more efficient at catalyzing the second methylation step which produces MMA. This

may relate to their lower susceptibility to iAs carcinogenesis following exposure versus

man. Additionally, there is significant variation in human susceptibility to As induced

toxicity, which may be related to differences in arsenic biotransformation between

individuals. Epidemiological studies have shown differences in the amount of MMA and

DMA excreted in the urine of exposed populations which may be associated with

differences in arsenic methyltransferase activity. Several studies on the urinary excretion

of arsenic metabolites in native Andean people and mixed ethnicities in northeastern

Argentina exposed to arsenic in potable water revealed low excretion of MMA [60-63].

One study revealed higher than normal MMA in urine, on average 27%, in people

exposed to arsenic in drinking water on the northeast coast of Taiwan [64].

Only a few polymorphisms have been found in the coding region of cytl9 to date.

The Met287Thr mutation has been reported on three different occasions [65-67]. In two

of these studies, the methylation activity of this allozyme was determined and showed to

have a higher methylation capacity than the wild-type [65, 67]. However, the activity of

this allozyme was determined either from a cytosol preparation or by analysis of cells and

culture media of exposed human hepatocytes. This type of analysis does not take into









account the possible different expression levels of the arsenic methyltransferase. In fact

one study shows that the allozyme Met287Thr was expressed at higher levels than the

wild-type arsenic methyltransferase [67], making unclear as to whether the increase in

activity results from the mutation or the increased expression levels. There are

differences in arsenic methylation capacities among individuals, which cannot be

supported alone by polymorphisms within the cytl9 coding region. All of the single

nucleotide polymorphisms (SNPs) in cytl9 available as seen in the NCBI SNP database

on January 12, 2006 are within the intron or untranslated region (UTR). In addition, two

separate studies which examined the frequency of polymorphisms within cytl9 found one

nonsynonymous SNPs (nsSNPs) out of 58 SNPs [66] and the other study found 3

nsSPNPs out of 26 SNPs [67], the remainder of the SNPs occurring in introns or UTRs.

There is another mechanism which may help explain the differences seen in

arsenic methylation, alternative splicing. Alternative splicing is frequently used to

regulate gene expression and to generate tissue-specific mRNA and protein isoforms [68,

69]. Introns contain sequence elements in which splicesome assembly occurs [70].

Mutations within these sequence elements could alter the constitutive splicing of a gene

which may affect the methylation capacity within and among different population groups.

Role of Methylation in Arsenic Toxicity

Arsenic methylation has traditionally been thought to be a detoxification pathway.

Pentavalent methylated arsenic metabolites are less reactive and are readily excreted in

the urine compared to iAs [56]. Pentavalent methylated arsenicals have also been shown

to be less cytotoxic and genotoxic compared to arsenite [71]. Mure et al. [72],

demonstrated that arsenite induces delayed mutagenesis and transformation in human

osteosarcoma cells but MMA1" showed no significant increase in mutagenesis or









transformation. While As methylation has been viewed as a detoxification pathway,

recent studies have shown monomethylarsonous acid (MMA"') and dimethylarsinous

acid (DMA"') to be more toxic than inorganic arsenicals. In vitro and in vivo studies

have shown that MMA1" is more cytotoxic than As"'. Petrick et al [20], revealed that the

order of toxicity in Chang human hepatocytes is as follows: MMA11 "> arsenite > arsenate

> MMAV = DMAv. In vivo studies performed in hamsters demonstrated that MMA"11 is

more lethal than arsenite [73]. In addition, Hirano et al. [74], has shown that

monomethylarsonous acid diglutathione is more acutely toxic than other arsenicals. It is

important to point out that not all mammals methylate arsenic such as the marmoset

monkey, tamarin, chimpanzee, and the guinea pig [57, 75-78]. These mammals have not

been shown to be more susceptible to acute arsenic intoxication. One study showed no

correlation between the induction of micronuclei and the ability to methylate arsenic in

the leukocytes of four mammalian species, humans, mice, rats, and guinea pigs [79].

Another factor that questions the role of methylation is the fact that arsenic is a known

human carcinogen, but very few animals exist in which arsenic initiates carcinogenesis.

The debate over whether As methylation is a detoxification or bioactivation pathway

leads to confusion over the role of methylation in toxicity.

Specific Aims of Research

The proposed study will address the role of arsenic methylation in human toxicity

by better understanding the kinetics of the human arsenic methyltransferase. The overall

hypothesis is the following: Human arsenic methyltransferase, cytl9, activity is the

determining factor in the rate of arsenic methylation and toxicity. To test this hypothesis,

I examined two specific aims: 1) clone and characterize the human arsenic

methyltransferase (cytl9) and 2) determine cytl9s role in toxicity and arsenic









methylation variability. Specific aim one was addressed by determining rate of arsenic

methylation by an in vitro assay. The optimum conditions required for human cytl9

activity were determined such as pH optimum, substrate specificity and concentration,

and thiol requirements. Specific aim two was addressed by examining the role of

polymorphisms and splice variants on arsenic methylation variability. The determination

of cytl9s role in toxicity was addressed by As toxicity in the presence and absence of

methylation activity. In order to determine if cytl9 is the only arsenic methyltransferase

in humans, the mRNA levels, protein concentration, and activity, in the presence and

absence of siRNA knockdown was determined.














CHAPTER 2
MOLECULAR CLONING AND CHARACTERIZATION OF HUMAN CYT19, AN S-
ADENOSYL-L-METHIONINE:AS-METHYLTRANSFERASE FROM HEPG2 CELLS

Introduction

Chronic arsenic exposure is a threat to millions of people throughout the world.

Exposure to arsenic has been linked to various types of cancers such as skin cancer, lung

cancer, and cancer of other internal organs [71]. Methylation has been considered the

major route of biotransformation and excretion of inorganic arsenic (iAs) in many species

including humans. The hypothesized scheme of iAs methylation involves reduction

followed by oxidative methylation [80]:

AsVO43- + 2e -> As"33- + CH3+ CH3As 032- + 2e CH3As"O22- + CH3+

(CH3)2Asv02- + 2e > (CH3)2As"IO

While traditionally thought to be a detoxification pathway, recent studies have

shown monomethylarsonous acid (MMA1") and dimethylarsonous acid (DMA"') to be

more toxic than inorganic arsenicals [73]. In addition, Hirano et al.[74], has shown that

monomethylarsonous acid diglutathione is more acutely toxic than other arsenicals. The

debate over whether As methylation is a detoxification or bioactivation pathway leads to

confusion over the role of methylation in toxicity. Rat liver S-adenosyl-L-

methionine:arsenic"'-methyltransferase has been identified and is homologous to human

cytl9 [51]. While this enzyme can be used as a model for human arsenic

biotransformation, the rat is considered a poor model for metabolic studies due to its

accumulation in red blood cells and subsequent lower DMA excretion levels [57]. There









are also other species specific differences in arsenic biotransformation and toxicity.

Healy et al. (1999) [58], purified arsenic methyltransferases from livers of rabbit,

hamster, and rhesus monkey and found different rates of methylation which may affect

arsenic elimination and toxicity. Humans excrete greater amounts of monomethylarsonic

acid (MMAV) compared to most other mammals [81]. Additionally, there is considerable

variation among humans in the rate of methylation of inorganic arsenic possibly leading

to measurable differences in toxicity [82]. Therefore it is important to better understand

the arsenic methylation capacity in human. To date, human cytl9 has been expressed,

but it has not been fully characterized [52]. In this study, we cloned, expressed, and

characterized cytl9, an arsenic methyltransferase from human HepG2 hepatoma cells.

Materials and Methods

Molecular Cloning

Two separate sequences available from Genbank (accession number AK057833

and AF226730) were used to design primers to amplify the open reading frame (ORF) of

cytl9, an arsenic methyltransferase (Table 1). Total RNA was isolated from HepG2 cells

using Trizol reagent (Invitrogen, Carlsbad, USA)). Total RNA was treated with DNAase

(DNA-free kit, Ambion, Austin, USA), and reverse transcribed (RETROscript for RT-

PCR, Ambion) using 2 tg of RNA. HepG2 cDNA was polymerase chain reaction

(PCR)-amplified, the PCR product was ligated in pET100/D-TOPO (Invitrogen) and

transformed into chemically competent Escherichia coli One Shot TOP 10 chemically

competent cells (Invitrogen). The PCR reaction consisted of 2.5 U of Pfu DNA

polymerase, 0.4 pM each primer, 5tl of the RT reaction, 0.2 mM dNTP mix, 5Pl of 10X

PCR Buffer, and nuclease-free water to 50pl. The PCR conditions were as follows: an

initial denaturation at 940C for 2min, followed by 35 cycles of denaturation at 940C for









Imin, annealing at 600C for Imin, extension for 720C for 2min 30s and a final extension

at 720C for 7min. The PCR products, the complete open reading frame of cytl9 (cytl9-

WT), the mutated cytl9 (cytl9S81R), and the truncated cytl9 (cytl9t) were then ligated

and transformed. Ampicillin resistant colonies were analyzed by PCR and visualized by

agarose gel electrophoresis. Once a correct clone was identified it was sent for

sequencing to the DNA Sequencing Core Laboratory at the University of Florida. Each

clone was sequenced several times and the consensus sequence determined.

RACE PCR

Rapid amplification of cDNA ends (RACE) was performed to determine which of

the two separate sequences available in Genbank was actually expressed in HepG2 cells.

The RACE-PCR was performed using the FirstChoice RLM-RACE kit from Ambion.

Primers were designed (Table 1) according to the instruction manual and the PCR

reaction consisted of 1.25 U of Taq DNA polymerase, 0.4 VM each primer, 1 l of the RT

reaction, 0.2 mM dNTP mix, 5pl of 10X PCR Buffer, and nuclease-free water to 50al.

The PCR conditions were as follows: an initial denaturation at 940C for 3min, followed

by 35 cycles of denaturation at 940C for 30s, annealing at 600C for 30s, extension for

720C for Imin and a final extension at 720C for 7min. The PCR product was ligated in

pGEM-T Easy Vector (Promega) and transformed into chemically competent

Escherichia coli JM109 chemically competent cells (Promega).

Expression of Recombinant cytl9

The pET100/D-TOPO constructs (cytl9-WT, cytl9S81R, and cytl9t) were

transformed into BL21 Star (DE3) E. coli strain for expression (Invitrogen). First, 10ml

of Luria-Bertani (LB) broth containing ampicillin (100[tg/ml) and 1% glucose were

inoculated with the transformed bacteria and the cultures were grown overnight. The









next day, 5ml of the overnight culture was used to inoculate 250ml of LB broth

containing ampicillin and 1% glucose and grown to an OD600 of 0.5. Expression was

induced by the addition of ImM isopropyl-1-thio-P-D-galactoside. The culture was

allowed to grow for one hour.The pET100/D-TOPO construct was then transformed into

BL21 Star (DE3) E. coli strain for expression (Invitrogen).

The cells were harvested by centrifugation at 5,000g for 15 minutes at 40C. The

pellet was resuspended in binding buffer (50mM NaH2PO4, 300mM NaC1, 10mM

imidazole, pH 8.0). The cells were lysed by addition oflysozyme to a final concentration

of lmg/ml and incubated on ice for 30 minutes followed by further incubation for 10

minutes at 40C on a rocking platform. Triton X-100 was added to a final concentration of

1% and the incubation continued for another 10 minutes at 40C with rocking. The

cellular debris was removed by centrifugation of the lysate at 3000g for 30 minutes at

4C The recombinant 6xHis-tagged protein was purified using a nickel-nitrilotriacetic

acid (Ni-NTA) metal-affinity chromatography according to the manufacturer's

instructions (QIAGEN, Valencia, USA).

Characterization

Activity of the expressed proteins was determined by the rate of arsenic

methylation. All incubations were carried out at 370C for 30 minutes in a final volume of

250 il, unless otherwise noted. The reaction mixtures contained 5mM glutathione

(GSH), 1 mM dithiothreitol (DTT), 1 mM MgC12, 100 [M S-adenosyl-L-methionine

(SAM), 13pM (3H-methyl)-SAM (S.A.), 50KM sodium m-arsenite, and 5 pg of S-

adenosyl-L-methionine: arsenic methyltransferase in 100mM tris/100mM sodium

phosphate buffer pH 7.4. The pH optimum was determined using the above conditions









but at different pHs (6.0 11). The substrate specificity and optimum substrate

concentrations were also determined by addition of various concentrations of sodium m-

arsenite or MMA, ranging from 1 iM to 200 iM or 10 iM to 1000 iM respectively. The

requirements of SAM and reductants by cytl9 were determined by addition of various

concentrations of SAM, and the reductants GSH and tris(2-carboxyethyl)-phosphine

(TCEP). The methylation reactions were stopped by placing on ice. The standard

extraction procedure described by Zakharyan et al. [49] was used to separate radioactive

SAM from radioactive MMA and DMA. Briefly, the reaction mixture (250 il) was

treated with 10 il of 40% KI, 20 [l of 1.5% potassium dichromate, 750 [l of

concentrated HC1 and 750 pl of chloroform. The mixture was then mixed on a vortex for

3 min followed by centrifugation at 1500g for 3 min. The upper aqueous phase contained

SAM and was discarded. The lower organic phase was washed twice with 250 pl of

water, 5 il of 40% KI, and 750 pl of concentrated HC1. The mixture was mixed on a

vortex and centrifuged and the upper aqueous phase was discarded each time. The

methylated arsenicals contained in the organic phase were back extracted with 1 mL of

water, vortexed for 3min and centrifuged at 1500g for 5 min. Half a milliliter from the

final aqueous phase after back extraction was counted in a liquid scintillation counter.

The activity was calculated from the dpm 3H transferred from SAM to arsenic.

Confirmation of Methylated Arsenicals

Methylated arsenicals were separated from each other and contaminating species

using the ion exchange method described previously by Zakharyan et al. (1995) [49]. A

10 mL glass pipette was filled to 2 mL with Bio-Rad AG 50W-X4 cation exchange resin

(100-200 iM mesh). The column was equilibrated by addition of 0.5N HC1 (30 mL),

followed by water until the pH of the effluent was 5.5, 0.5N NaOH (30 mL), water until









the pH of the effluent was 5.5, 0.5N HC1 (30 mL), and 0.05N HC1 (50 mL). After

equilibrating the column, 0.5 mL of the final aqueous phase extract from above was

applied to the column. The columns were eluted by 6 mL of 0.05M HC1 to obtain MMA

and 10 mL of 0.5M NaOH for DMA elution. One milliliter of the these fractions were

counted in a liquid scintillation counter.

Results and Discussion

Both cytl9 and cytl9t transcripts were amplified by PCR from HepG2 cells and

human liver samples. The sequencing results of cytl9t showed 4 point mutations, 3

transverions and 1 transition, (Figure 2-1A) resulting in 3 missense mutations (Figure 2-

1B) compared to the Genbank sequence (accession AF226730). The wild-type cytl9 was

also amplified, cloned, and sequenced from two different populations of HepG2 cells.

One of the clones, designated cytl9-WT, was aligned to the Genbank sequence,

accession AK057833, and showed a 100% homology (data not shown). The other clone

designated cytl9S81R contained a nonsynonymous single nucleotide polymorphism

(nsSNPs) when compared to the Genbank sequence, accession AK057833 (Figure 2-2A),

which results in a change from serine to arginine at residue 81 in the peptide sequence

(Figure 2-2B). This change occurs in the SAM-binding site, however SAM-dependent

methyltransferases have poor conservation of SAM-binding residues. SAM-dependent

methyltransferases contain 3 regions of sequence similarity (motif I, II, and III) which are

thought to be important in SAM binding. The only highly conserved residues in the

SAM-binding N-terminal region appear to be the glycine-rich sequence E/DXGXGXG

found at residues 76 to 82 [83]. Therefore, the amino acid change may not have a

significant effect on the activity of the recombinant protein.









The cytl9t clone and the cytl9-WT clone are identical except for the deletion of a

nucleotide at position 997 resulting in a premature stop codon (Figure 2-3A). Further

analysis of the protein sequences revealed 6 missense mutations including a cysteine to

valine mutation and deletions of the final 37 amino acids from the C-terminus including 4

cysteines due to the deletion in the nucleotide sequence (Figure 2-3B). In other SAM-

dependent methyltransferases, the C-terminus is important in substrate binding [83]. The

cytl9t protein showed no arsenic methylation activity. This indicates that the cysteine

rich C-terminus is important for As binding and critical for activity.

RACE-PCR was performed on both the 5' and 3' ends. The sequencing results

revealed that the 5'end of the cDNA was identical to the ORF of both sequences

available in Genbank (accession AK057833 and AF226730). The 5'-untranslated region

(UTR) is different from the Genbank sequences containing 18 mutations (Figure 2-4A).

The 3'RACE-PCR revealed that HepG2 cells expressed mRNA identical to the 3'end of

the Genbank sequence, accession AK057833. In particular, the sequencing showed that

HepG2 cells cytl9 mRNA does not have a nucleotide deletion resulting in a premature

stop codon (Figure 2-4B).

The recombinant human cytl9s (cytl9-WT, cytl9t, and cytl9S81R) were

successfully expressed in BL21 (DE3) and purified to homogeneity using a nickel-

nitrilotriacetic acid metal-affinity chromatography (Figure 5). The recombinant proteins,

cytl9S81R and cytl9-WT, catalyze the transfer of a methyl group from SAM to As"' as

well as MMA1", which is consistent with previous studies (Figure 2-6) [51, 52].

However, the different arsenite methyltransferase activity profiles between cytl9-WT and

cytl9S81R are apparent. Arsenite concentrations above 50 uiM appears to have an









inhibitory effect on cytl9S81R activity, which is similar to what is seen in the rabbit [49].

This inhibitory effect is not seen in the cytl9-WT arsenite methylation activity. The

apparent Km and Vmax of cytl9 As"' methyltransferase (AS3MT) activity for cytl9-WT

and cytl9S81R are 251.6 riM, 3505 pmole/mg/min, 6.176 riM, and 804.9 pmole/mg/min

respectively (Table 2). The Km and Vmax values of cytl9-WT MMA methylation is 164.6

IM and 926.8 pmole/mg/min (Table 2). The MMA methylation profile is very similar to

that seen in the rabbit. These enzymes seem to saturate at MMA concentrations of 1000

IM [49].

The Km values can be used to interpret the affinity of an enzyme for its substrate (a

larger Km implies a weak affinity). Other kinetic analysis of the human arsenic

methyltransferase had very low Km [67, 84] values compared to cytl9-WT but, the Km

value of cytl9S81R was very similar to the other kinetic analysis. However, these other

studies did not use purified enzymes which may explain the difference, especially the

difference seen with cytl9-WT. The kinetic analysis suggests that the cytl9S81R has a

higher affinity for arsenite than cytl9-WT. However, cytl9-WT has a considerably

higher Vmax value compared to cytl9S81R. The Vmax values of both cytl9-WT and

cytl9S81R are considerably higher than that seen among other mammals such as the

hamster, rabbit, and rhesus monkey [50]. Kinetic analysis of MMA methylation

demonstrates that the Vmsx and Km values for cytl9-WT are much higher than the values

seen in the hamster, rabbit, and rhesus monkey. The higher Vmax values of arsenite

methyltransferase compared to MMA methyltransferase in cytl9-WT may explain the

higher MMA urine excretion levels seen in humans compared to other mammals. The

rabbit, which excretes higher amounts of MMA than most other mammals, has a higher









MMA than arsenite methyltransferase Km [50]. Possibly, arsenite is converted very

quickly to MMA, allowing it to accumulate before the dimethylation resulting in the

higher excretion of MMA seen in humans.

The optimum pH of As"' methylation for cytl9-WT and cytl9S81R was found to

be about 8 and about 9 respectively (Figure 2-7). This is similar to previous results

which show that at basic pHs, methylation activity of rat cytl9, and As"'

methyltransferase & MMA1" methyltransferase activity from rabbit liver increase [49,

51]. This may be due to the deprotonation of cysteines at higher pHs, which increases the

rate of binding between arsenic and cysteines in the substrate binding domain. The

reductant requirements were examined and it was determined that GSH is not required

for cytl9-WT to methylate arsenic (Figure 2-8). In addition, it was determined that

cytl9S81R does not require GSH. Previous study suggests that the substrates for cytl9

are arsenic triglutathione and monomethylarsonic glutathione [52]. Our results

demonstrate that only a strong reductant such as TCEP is necessary for methylation of

arsenic by cytl9, however, the addition of GSH appears to increase the activity above the

reductant alone. Finally, the effect that different SAM concentrations would have on

activity was determined. It was found that above 500 riM, SAM began to have an

inhibitory effect (Figure 2-9). This differs from what is seen in rat, where SAM

concentrations above 50 |iM have an inhibitory effect [51].

The ion exchange method confirmed that cytl9 indeed produces MMA when

arsenite is the substrate (Figure 2-10A). When MMAV is used as the substrate, both

MMA and DMA are seen as products (Figure 2-10B). However, DMA is the major









metabolite. The MMAV used as a substrate is not 100% pure and likely contains some

iAs as contaminants. It is possible that the contaminating iAs is methylated to MMA.

In conclusion, we have shown that cytl9 is in fact an arsenic methyltransferase

methylating both arsenite and MMA. Examination of the cytl9t activity, indicates that

the cysteine rich C-terminus is important for As binding and critical for activity. The

data suggests that a mutation within the SAM-binding site of cytl9 can drastically change

the methylation capacity of the enzyme. The characterization and kinetic analysis may

explain the higher MMA urine excretion levels and increased susceptibility seen in

humans compared to other mammals. It appears that arsenite is converted very quickly to

MMA, allowing it to accumulate before the dimethylation resulting in the higher

excretion of MMA seen in humans. The apparently deficient dimethylation activity in

humans compared to other mammals is supported by the kinetic analysis and suggests

that methylation may actually be a detoxification pathway.









Table 2-1. Primers used in the PCR amplification of cytl9


Primer Sequence
cytl9 Forward:
CACCATGGCTGCACTTCGTGACGCTGAGATACAG
Reverse:
TTAGCAGCTTTTCTTTGTGCCACAGCAGCCTCC
cytl9t Forward:
CACCATGGCTGCACTTCGTGACGCTGAGATACAG
Reverse:
TTAACTCCAAAGCAGAACAGCTCCAGATGT
5'RACE Outer: TTTCAGCCACTTCCACCTGGCCTT
Inner: CAGGGATCACCAGACCACAGCCAT
3'RACE Outer: AGGACCAACCAAGAGATGCCAA
Inner: GCCAGAAGAAATCAGGACACACAA

Figure 2-2. Kinetic analysis of the methylation activity of cytl9-WT and cytl9S81R.

cytl9-WT cytl9S81R
Arsenite
methyltransferase Km (FM) 83.010.9 6.20.9
activity
Vmax
vm. 1585142 804.933.4
(pmole/mg/min)
MMA
methyltransferae Km (FiM) 164.641.2 43.713.3
activity
Vmax
a. 926.875.4 365.125.7
(pmole/mg/min)














301
AF226730 ATAGACATGA
cytl9t ATAGACATGA

351
AF226730 TCACATGGAA
cytl9t TCACATGGAA

401
AF226730 GCAACATTGA
cytl9t GCTACATTGA

451
AF226730 ATTGTTGTAT
cytl9t ATTGTTGTAT


350
CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA
CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA


AAATATGGCT TCCAGGCATC TAATGTGACT
AAATATGGCT TCCAGGCATC TAATGTGACT


GAAGTTGGCA GAGGCTGGAA TCAAGAATGA
GAAGTTGGGA GAGGCTGGAA TCAAGAATGA


400
TTTTTCCATG
TTTATTCATG

450
GAGCCATGAT
GAGCCATGAT


500
CAAACTGTGT TATTAACCTT GTGCCTGATA AACAACAAGT
CAAACTGTGT TATTAACCTT GTGCCTGATA AACAACAAGT


AF226730 MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP
cytl9t MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP


51
AF226730 HEEVALRYYG
cytl9t HEEVALRYYG

101
AF226730 IDMTKGQVEV
cytl9t IDMTKGQVEV

151
AF226730 IWSNCVINL
cytl9t IWSNCVINL


CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ
CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ


AEKYLDYHME KYGFQASNVT FFHGNIEKLA
AEKYLDYHME KYGFQASNVT FIHGYIEKLG


VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL
VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL


50
KHIREALQNV
KHIREALQNV

100
LVGEKGHVTG
LVGEKGHVTG

150
EAGIKNESHD
EAGIKNESHD

200
ELPEEIRTHK
ELPEEIRTHK


Figure 2-1. Sequence alignment of cytl9t and Genbank sequence (accession AF226730).
(A) Nucleotide alignment of cytl9t and Genbank sequence. The four point
mutation are in red. (B) Alignment of the deduced cytl9t amino acid sequence
and Genbank sequence. The 3 resulting missense mutations are in red.











A.

AK057833
cytl9S81R


AK057833
cytl9S81R


AK057833
cytl9S81R


151
CACGAAGAAG
CACGAAGAAG

201
GCATCTAGAA
GCATCTAGAA

251
ATTGCTATGT
ATTGCTATGT


TAGCCCTAAG ATATTATGGC TGTGGTCTGG
TAGCCCTAAG ATATTATGGC TGTGGTCTGG


AACTGCTGGA TTTTGGATCT GGGTAGTGGA
AACTGCTGGA TTTTGGATCT GGGTAGTGGA


ACTTAGCCAG CTGGTTGGTG AAAAAGGACA
ACTTAGCCAG CTGGTTGGTG AAAAAGGACA


200
TGATCCCTGA
TGATCCCTGA

250
AGTGGCAGAG
CGTGGCAGAG

300
CGTGACTGGA
CGTGACTGGA


AK057833 MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV
cytl9S81R MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP KHIREALQNV


51
AK057833 HEEVALRYYG CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ
cytl9S81R HEEVALRYYG CGLVIPEHLE NCWILDLGSG RGRDCYVLSQ

101
AK057833 IDMTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG
cytl9S81R IDMTKGQVEV AEKYLDYHME KYGFQASNVT FIHGYIEKLG


100
LVGEKGHVTG
LVGEKGHVTG

150
EAGIKNESHD
EAGIKNESHD


Figure 2-2. Sequence alignment of cytl9S81R and Genbank sequence (accession
AK057833). (A) Nucleotide alignment of cytl9S81R and Genbank sequence.
The tranversion is in red. (B) Alignment of deduced cytl9S81R amino acid
sequence and Genbank sequence. The resulting nsSNP is in red. The SAM-
binding N-terminal region site is underlined.












A.
951
cytl9-WT AGATTTTCTG
cytl9t AGATTTTCTG

1001
cytl9-WT GTTCTGCTTT
cytl9t GTTCTGCTTT


cytl9-WT
cytl9t



cytl9-WT
cytl9t


1051
GAAGAGTCTG
----------


1101
CTGCTGTGGC


ATCAGACCAA TTGGAGAGAA GTTGCCAACA
ATCAGACCAA TTGGAGAGAA GTTGCCAACA


GGAGTTAAAG
GGAGTTAA--


GATATAATCA CAGATCCATT


ACAGTATGAA GTCCAGATGT GTCCCTGATG


1000
TCTGGAGGCT
TCTGGA.GCT

1050
TAAGCTTGCA
----------


1100
CTGCTGGAGG


1128
ACAAAGAAAA GCTGCTAA


201
cytl9-WT VLWGECLGGA
cytl9t VLWGECLGGA

251
cytl9-WT RFVSATFRLF
cytl9t RFVSATFRLF

301
cytl9-WT EVDEETAAIL
cytl9t EVDEETAAIL


LYWKELAVLA QKIGFCPPRL VTANLITIQN
LYWKELAVLA QKIGFCPPRL VTANLITIQN


250
KELERVIGDC
KELERVIGDC


300
KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV
KHSKTGPTKR CQVIYNGGIT GHEKELMFDA NFTFKEGEIV


KNSRFAQDFL IRPIGEKLPT SGGCSALELK
KNSRFAQDFL IRPIGEKLPT SGAVLLWS*-


350
DIITDPFKLA


351
EESDSMKSRC


376
VPDAAGGCCG TKKSC*


Figure 2-3. Sequence alignment of cytl9-WT and cytl9t. (A) Nucleotide alignment of
cytl9-WT and cytl9t sequence. The missense mutations are in red. The 5
cysteine residues which are not included in the cytl9t are highlighted in the
cytl9-WT sequence.


cytl9-WT
cytl9t















ACAGGAGCTG GCTGCGGGAG CCCGCCGTCC TGAGTCGCAG GCCGAGGAGA


A.

5'RACE
AK057833
AF226730



5'RACE
AK057833
AF226730



5'RACE
AK057833
AF226730



5'RACE
AK057833
AF226730


101
CCTGAGTCGC
CCTGAGTCGC
CCTGAGTCGC

151
CGAGGAGACA
CGAGGAGACA
CGAGGAGACA



1151
CTGGAGGCTG
CTGGAGGCTG
CTGGA.GCTG

1201
AAGCTTGCAG
AAGCTTGCAG
AAGCTTGCAG

1251
TGCTGGAGGC
TGCTGGAGGC


AGGCCGAGGA
AGGCCGAGGA
AGGCCGAGGA



TGGCTGCACT
TGGCTGCACT
TGGCTGCACT




TTCTGCTTTG
TTCTGCTTTG
TTCTGCTTTG



AAGAGTCTGA
AAGAGTCTGA
AAGAGTCTGA


--ACAGGAGC
TCGCAGGCCG


GACAGTGAGT
GACAGTGAGT
GACAGTGAGT



TCGTGACGCT
TCGTGACGCT
TCGTGACGCT




GAGTTAAAGG
GAGTTAAAGG
GAGTTAAAGG



CAGTATGAAG
CAGTATGAAG
CAGTATGAAG


TGGCTGCGGG
AGGAGACAGT
--GAGACAGT



GCGCGCCCTG
GCGCGCCCTG
GCGCGCCCTG



GAGATACAGA
GAGATACAGA
GAGATACAGA




ATATAATCAC
ATATAATCAC
ATATAATCAC



TCCAGATGTG
TCCAGATGTG
TCCAGATGTG


TGCTGTGGCA CAAAGAAAAG CTGCTAAATC
TGCTGTGGCA CAAAGAAAAG CTGCTAAATC


100
AGCCCGCCGT
GAGTGCGCGC
GAGTGCGCGC

150
AGTCGCAGGC
AGTCGCAGGC
AGTCGCAGGC

200
AGGACGTGCA
AGGACGTGCA
AGGACGTGCA



1200
AGATCCATTT
AGATCCATTT
AGATCCATTT

1250
TCCCTGATGC
TCCCTGATGC
TCCCTGATGC

1300
TATAGCCAAC
TATAGCCAAC


TGCTGGAGGC TGCTGTGGCA CAAAGAAAAG CTGCTAAATC TATAGCCAAC


1301
CAGGGGACCA
CAGGGGACCA
CAGGGGACCA


CAGTAGTGGG
CAGTAGTGGG
CAGTAGTGGG


CAAGAGTGAT
CAAGAGTGAT
CAAGAGTGAT


CTGCATGTTT
CTGCATGTTT
CTGCATGTTT


1350
TTTAACCTGC
TTTAACCTGC
TTTAACCTGC


Figure 2-4. Sequence alignments of the 5' & 3'RACE-PCR products and the Genbank
sequences (accession AK057833 and AF226730). (A) Sequence alignment of
the 5'RACE-PCR product against the Genbank sequences. The mutations in
the 5'RACE product are in red. The start codon for all three sequences are
highlighted. (B) Sequence alignment of the 3'RACE-PCR product and the
Genbank sequences. The nucleotide deletion in the Genbank sequence,
accession AF226730, is highlighted. The stop sites for the Genbank
sequences are in red.


CAGTGAGTGC GCGCCCTGAG


3'RACE
AK057833
AF226730



3'RACE
AK057833
AF226730



3'RACE
AK057833
AF226730



3'RACE
AK057833
AF226730











1 2 3

215k k


120 k .

84 k



60 k




39.2 k A.


28 k

18.3 k ,


5 6


ikvM-H.-id:

0iccC


4W.F.U if .: IBMlf


Figure 2-5. Purification of recombinant human cytl9. Fractions were electrophoresed on
a 10% polyacrylamide gel and stained. Lanel, molecular weight markers;
Lane2, cell lysate; Lane3, flowthrough, Lane4, Washl, LaneS, Wash2, Lane6,
Wash3. Lane7. Elution


-- I~..
















-- cyti9-WT
-u-cytl9R81S


0 50 100 150 200 250
Aslll (uM)


- cyt19-WT
-- cytl9R81S


0 200


600
MMAV (uM)


1000 1200


Figure 2-6. The effects of As" & MMAV concentrations. All incubations were carried
out at 370C for 30 min. in a final volume of 250 [il. A) Reaction mixtures
contained 5 mM GSH, 1 mM DTT, 1 mM MgCl2, 13 pM [3H]SAM, 0.1 mM
SAM, various [As"'], and 5 tg of cytl9, in 100 mM Tris/100 mM Na
phosphate, pH 7.4 B) Same as B but with various [MMAV].


1800
S1600
E 1400
6 1200
. 1000
800
600
400
. 200
0


1000
900
800
700
600
500
400
300
200
100
0














E 600
E
S500
o
. 400

5 300

200

' 100
U)


5 6 7 8 9 10 11 12
pH


Figure 2-7. The effect of pH on activity. All incubations were carried out at 370C for 30
min. in a final volume of 250 gl. Reaction mixtures contained 5 mM GSH, 1
mM DTT, 1 mM MgC12, 13 pM [3H]SAM, 50 gM AsIII, and 5 gg of cytl9, in
100 mM Tris/100 mM Na phosphate of the appropriate pH.


1000
900
800
700
600
500
400
300
200
100
0 -


5mM GSH


5mM
GSH+lmM
DTT-


1mM TCEP 1mM
TCEP+1mM
GSH
Reductants


a cytl9-WT
o cytl9R81S


1mM
TCEP+5mM
GSH


Figure 2-8. The effects of reductants on methylation activity. All incubations were
carried out at 370C for 30 min. in a final volume of 250 gl. Reaction mixtures
contained 1 mM MgC12, 13 pM [3H]SAM, 0.1 mM SAM, 50 gM AsIII, and 5
gg of cytl9-WT, in 100 mM Tris/100 mM Na phosphate, pH 7.4, with
different reductants. The activity of cytl9R81S was not determined for 1 mM
TCEP + 1 mM GSH.












400 -

S350

E 300

o 250

200

150

100

50

0
0 200 400 600 800 1000 1200
SAM (uM)


Figure 2-9. The effect of SAM concentration on activity. All incubations were carried
out at 370C for 30 min. in a final volume of 250 pil. Reaction mixtures
contained 5 mM GSH, 1 mM DTT, 1 mM MgCl2, 13 pM [3H]SAM, 50 ipM
AsIII, and 5 pg of cytl9-WT, in 100 mM Tris/100 mM Na phosphate pH 7.4.
with various [SAM].











A.

Aslll

2500

2000

1500
Q.
1000 -

500 -


0 5 10 15 20 25
Fraction Number



B.

MMAV

700
600
500
5 400
o 300
200
100
0 .
0 5 10 15 20 25
Fraction Number



Figure 2-10. Arsenical metabolites formed after incubation with [3H]SAM and cytl9 for
30 min at 37C. (A) Formation of MMA and DMA using As"' as a substrate.
(B) Formation of MMA and DMA using MMAV as the substrate.














CHAPTER 3
IDENTIFICATION OF A SPLICE VARIANT OF HUMAN CYT19 ARSENIC
METHYLTRANSFERASE

Introduction

Arsenic (As) is a naturally occurring element and ranks 20th in abundance in the

earth's crust [85]. Arsenic is present in the environment in both organic and inorganic

forms and exists mainly in three valence states, -3, +3, and +5. Generally, inorganic

arsenic (iAs) is the more toxic form and people are exposed to iAs primarily through food

and potable water. In Taiwan, Mexico, western United States, western South America,

China, and Bangladesh, people are exposed to high levels of arsenic due to anthropogenic

and/or natural contamination of potable water [12, 62, 86]. In these areas, chronic

exposure to arsenic is associated with various tumors occurring in skin, liver, lung,

urinary bladder, and prostate [8, 87].

Once in the body, many mammals, including humans, methylate iAs to

monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA) [49, 51, 54]. The

biotransformation of iAs alternates between the reduction of arsenate (iAsV) to arsenite

(iAs"') followed by oxidative methylation (Figure 1) [88, 89]. Because pentavalent

methylated arsenicals are less toxic than inorganic arsenic, methylation has been

considered a detoxification mechanism. Recent studies indicate that trivalent methylated

arsenicals may be more acutely toxic and genotoxic than iAs suggesting that methylation

may actually be a bioactivation of iAs [20, 73, 74, 90]. For this reason the role of

methylation in acute and chronic arsenic toxicity remains unclear. There is significant









variation in human susceptibility to As induced toxicity, which may be related to

differences in arsenic biotransformation between individuals [82]. Epidemiological

studies have shown differences in the amount of MMA and DMA excreted in the urine of

exposed populations which may be associated with genetic polymorphisms [62]. Cytl9

has been identified as a human S-adenosyl-L-methionine:arsenic methyltransferase [52,

55] however, only a few coding region polymorphisms have been detected which may

alter the iAs methylation rate [65, 67]. In this study we identified an alternative splice

variant of human cytl9, which contains an upstream open reading frame (uORF)

followed by an internal start codon (AUG). This variant was expressed in 7 out of 7

human livers and represents another possible mechanism for regulating As methylation.

Materials and Methods

Molecular Cloning of cytl9 Splice Variants

Total RNA was isolated from HepG2 cells and human liver samples using Trizol

reagent according to the manufacturer's instruction (Invitrogen, Carlsbad, USA). Total

RNA was treated with DNase I using the DNA-freeTM kit from Ambion (Austin, TX) and

cDNA was made using the RETROscriptTM Kit for RT-PCR and 2 ig of RNA as

template (Ambion). HepG2 cDNA was polymerase chain reaction (PCR)-amplified

using the following primers: forward primer (5'-

CACCATGGCTGCACTTCGTGACGCTGAGATACAG-3') and the reverse primer (5'-

TTAACTCCAAAGCAGAACAGCTCCAGATGT-3'). The PCR reaction consisted of

2.5 U ofPfu DNA polymerase, 0.4 tM each primer, 5[l of the RT reaction, 0.2 mM

dNTP mix, 5[l of 10X PCR Buffer, and nuclease-free water to 50al. The PCR

conditions were as follows: an initial denaturation at 940C for 2min, followed by 35

cycles of denaturation at 940C for Imin, annealing at 600C for Imin, extension for 72C









for 2min 30s and a final extension at 720C for 7min. The PCR products, designated

cytl9 and cytl9AE2, were ligated into the pET100/D-TOPO vector (Invitrogen) and

transformed into competent Escherichia coli (E. coli) One Shot TOP 10 chemically

competent cells (Invitrogen). Ampicillin resistant colonies were analyzed by PCR and

visualized by agarose gel electrophoresis. Several clones containing inserts were

sequenced by the DNA Sequencing Core Laboratory at the University of Florida.

Human Liver Samples

Human liver samples were obtained from Vitron (Tucson, AZ). All the tissues

were from Caucasian males between the ages of 24 and 46. The tissues were preserved

in Viaspan after death. The tissue samples were stored at -800C until use. All procedures

using human samples were approved by the Institutional Review Board at the University

of Florida and all identifying information has been removed.

qPCR of cytl9 Splice Variants

Total RNA was isolated and cDNA synthesized as described above. Real-time

quantitative PCR (qPCR) was carried out using a Bio-Rad iCycler with the following

primers: cytl9 forward primer: (5'-TTCGTGACGCTGAGATACAGAAG-3'); reverse

primer: (5'-TGGAGGTCTGCCGATCTCTT-3'); cytl9AE2 forward primer: (5'-

GATACAGAAGGACGTGCAGATATTATG-3'); reverse primer: (5'-

CCAGATCCAAAATCCAGCAGTT-3'). Each PCR reaction consisted of 12.5 [l iTaq

SYBR Green Supermix with ROX (Bio-rad), 0.4 tM each primer, 5[l of the RT reaction,

and RNase/DNase-free water to 25 al. The PCR cycling conditions included an initial

denaturation of 95C for 3 min followed by cycling at 950C for 15s, 600C for 45s for 45

cycles. The constructs, pET100-cytl9 and pET100-cytl9AE2 were used to generate









calibration curves for quantification of cytl9 and cytl9AE2. A melting curve analysis

was performed after every run to determine product uniformity.

Results

When the full open reading frame of cytl9 was amplified using the primers

described in Molecular Cloning of cytl9 splice variants under Materials & Methods, two

products were generated, 1132 bp (cytl9) and 1005 bp (cytl9AE2) products (Figure 3-2).

Sequencing of these two products revealed that the 1132 bp product is the reference cytl9

while the 1005 bp product is a splice variant (Figure 3-3). The reference cytl9 mRNA is

composed of 10 exons (Figure 3-4A) which encode a 375 amino acid protein with a

theoretical molecular weight of 41.747 kDa (Figure 3-5). The product, cytl9AE2, is

missing 128 bp due to a deletion of exon 2 which could result in a protein that is about

102 amino acids shorter and the creation of a short 24 amino acid peptide as a product

from an upstream open reading frame (uORF) (Figure 3-3 & Figure 3-4B). This variant

may encode a 273 amino acid polypeptide chain that is identical to the reference cytl9

but lacks the first 102 amino acids present in the reference (Figure 3-5). Analysis of the

sequences surrounding the splice revealed that the splice occurs at conserved acceptor

and donor sites (Figure 3-4C). The individual information (Ri) technique and Shapiro's

method were used to compare the splice-sites strength of exon 3 and exon 2 of cytl9

[91]. Exon3, a constitutive exon has a stronger splice site compared to exon2, the

alternative exon (Table 3-1).

The steady state mRNA levels of each transcript were determined in 7 human liver

samples as well as in HepG2 cells by qPCR (Table 3-2). Expression of cytl9 mRNA in

the human liver samples ranged from 7.04 x 104 to 1.26 x 106 copies per microgram of









RNA. The cytl9AE2 splice variant was detected in all 7 human liver samples tested.

(Table 3-2). The amount of cytl9AE2 mRNA was much lower than cytl9 mRNA

ranging from 1.89 x 103 through 4.33 x 103 copies per microgram of RNA. The HepG2

cells had an average of 5.14 x106 copies/Gg RNA and 8.55 x104 copies/Gg RNA of cytl9

and cytl9AE2 mRNA, respectively.

Discussion

In this study, we identified an alternative splice variant of cytl9, which contains an

uORF. The variant mRNA contains a short ORF followed by an internal AUG codon

beginning 106bp downstream from the uORF (Figure 3-3). While this alternative variant

may encode a 273 amino acid protein it is unlikely that expression of the cytl9AE2 splice

variant will result in production of an active protein. Studies have shown that SAM

dependent methyltransferases share 3 regions of sequence similarity (motif I, II, and III)

[92]. These motifs are found in the same order on the polypeptide chain and separated by

similar intervals [92]. It has been suggested that these conserved regions are important in

SAM binding [92]. Mutations of a conserved amino acid in rat guanidinoacetate

methyltransferase near motif I have resulted in an inactive enzyme. In addition,

mutations of motif II lead to reduced Kcat/Km values for substrates [93]. It is unlikely

that the protein translated from cytl9AE2 would result in an active protein due to the

removal of motif I (Figure 3-5).

Whether the mRNA actually is translated into protein is not clear because the

internal AUG codon contains a relatively weak Kozak sequence suggesting that

translation may not reinitiate at the internal start codon. The sequence

(GCCA/GCCATGG) is a consensus Kozak sequence for the initiation of translation in









vertebrates [94, 95]. Deviation from the consensus sequence at position -3 and +4 would

be considered a weak initiator codon. The cytl9AE2 transcript deviates from the

consensus sequence at position +4; the variant contains an A instead of a G (Figure 3-3).

It is also possible that cytl9AE2 will not be translated but that this variant is a

substrate for the nonsense mediated decay (NMD) pathway due to the premature stop

codon. NMD is a pathway that recognizes and quickly degrades mRNAs containing

premature translation termination codons (PTC) in eukaryotes [96]. While cytl9AE2

does contain a PTC, Zhang et al. identified a sequence motif which when present 3' of a

nonsense codon promotes rapid decay of the mRNA transcript by the NMD pathway

[97]. This sequence motif (TGYYGATGYYYYY) is not found in the cytl9AE2 mRNA

transcript and it remains unclear if this variant will undergo degradation by the NMD

pathway.

The cytl9AE2 variant was present in all seven human liver samples tested,

suggesting that cytl9 mRNA exists both in the full length and alternatively spliced form

in most individuals. The cytl9AE2 variant mRNA comprised 0.2 to 3.8% of the total

cytl9 transcript. The liver samples had lower copy numbers per microgram of RNA of

both reference and cytl9AE2 variants compared to HepG2 cells. It is possible that some

degradation of cytl9 message occurred during collection and storage of the livers which

reduced apparent copy number.

Many mammalian species methylate arsenic through an enzymatic reaction that is

performed by cytl9. There are significant variations in the arsenic methylation capacity

between species and within species including humans [58, 59, 62, 81]. The reason for

this variation is unclear but has been attributed to cytl9 polymorphisms. However, only









a few polymorphisms have been found in the coding region of cytl9 to date [65, 67],

while the vast majority of mutations are found within the introns and the 5' and 3'

untranslated region (UTR). Introns contain the acceptor site, branchpoint,

polypyrimidine tract, and the donor site, which are conserved sequences in which

splicesome assembly occurs [70]. While mutations within these sequence elements could

alter the constitutive splicing of a gene [98-100], there are differences in arsenic

methylation capacities among individuals, which are unlikely to be supported solely by

polymorphisms within the cytl9 coding region.

Alternative splicing is frequently used to regulate gene expression and to generate

tissue-specific mRNA and protein isoforms [68, 69]. Thirty-five to 60% of human genes

produce transcripts that are alternatively spliced, in addition 70-90% of these variants

alter the resulting protein products [101, 102]. Further studies should analyze the mRNA

expression levels of cytl9 splice variants in a larger number of fresh liver samples or

primary hepatocytes and correlate it to arsenic methylation activity. In addition, work to

determine if this transcript is a substrate for the NMD pathway or if a variant protein is

expressed will help clarify the role of cytl9AE2 in human arsenic metabolism. Even

though the splice variant comprises a relatively small fraction of the total cytl9 transcript

in the livers tested it is possible that different population groups have varying amounts of

the cytl9 splice variant. It is also likely that the level of cytl9AE2 in an individual will

change over time as alternative splice selection can be controlled by many variables

including developmental stage and xenobiotics [103, 104]. In conclusion, cytl9 appears

to be alternatively spliced in many individuals and may play a role in the observed

variation in arsenic methylation seen in individuals.










As043- + 2e- As"033- + CH3+ CH3ASV032-+ 2e-


2 1
CH3As' 022-+ CH3+ (CH3)2As'2 + 2e --


(CH3)2AsI'O


1 Reduction step of As biotransformation
2 Oxidative methvlation steD of As biotransformation

Figure 3-1. The hypothesized scheme of iAs methylation proposed by Cullen, McBride et
al. 1984.

100 bp
Ladder cytl9 cytl9AE2




34






Figure 3-2. PCR products of cytl9 amplification. 1% Agarose DNA gel of cytl9 and
cytl9AE2.

















I $
cytl9AE2 ATGGCTGCAC
cytl9 ATGGCTGCAC


Exon 1


TTCGTGACGC TGAGATACAG AAGGACGTGC
TTCGTGACGC TGAGATACAG AAGGACGTGC


Exon 2


AG----~~~~
AGACCTACTA 50


cytl9AE2
cytl9


cyt19AE2
cytl9




cytl9AE2
cytl9


cytl9AE2
cytl9


---------- ---------- ---------- ---------- ----------
CGGGCAGGTG CTGAAGAGAT CGGCAGACCT CCAGACCAAC GGCTGTGTCA



CCACAGCCAG GCCGGTCCCC AAGCACATCC GGGAAGCCTT GCAAAATGTA
Exon 3


---- -- ATATTATGGC TGTGGTCTGG TGATCCCTGA
CACGAAGAAG TAGCCCTAAG ATATTATGGC TGTGGTCTGG TGATCCCTGA


GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA AGTGGCAGAG
GCATCTAGAA AACTGCTGGA TTTTGGATCT GGGTAGTGGA CGTGGCAGAG


cytl9AE2 ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA
cytl9 ATTGCTATGT ACTTAGCCAG CTGGTTGGTG AAAAAGGACA CGTGACTGGA 300
Exon 4

+
cytl9AE2 ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA
cytl9 ATAGACATGA CCAAAGGCCA GGTGGAAGTG GCTGAAAAGT ATCTTGACTA 350


Figure 3-3. Alignment of the reference cytl9 nucleotide sequence and cytl9AE2. $
Represents the initial start codon. *Represents the putative PTC which results
due to the removal of exon 2. + Represents the putative downstream start site.
The kozak sequence is underlined. The deviation from the kozak sequence at
position +4 is highlighted in grey.










A.

Cytgl9oen e
2 3 5 6 7 8 9




/42bp 1 i2bp 1jl 1bp
1 2 3 mRNA Splicing
7 3 V ibp 7,2 2?bp

B.
Reference 2 3




Exon 2 1 3





C.
Exo 1 EMon 3
GCAGgt aTATATIA Exon 2A


Eam 1 ErLon 2
GCAGgt agACCTAC Reference


Figure 3-4. cytl9 isoforms. (A) Diagram representing the exonic regions of the wild-type
cytl9 mRNA. The region in which the alternative splicing occurs is
demonstrated in greater detail. (B) Schematic representation of the two
alternative splice variants, the reference or wild-type sequence, and the
deletion of exon 2. The shaded box represents the cassette exon. (C) The
donor and acceptor site of the two alternative splice variants. The exonic
nucleotides are capitalized while the acceptor and donor sites are in lower case
letters.












1
MAALRDAEIQ KDVQTYYGQV LKRSADLQTN GCVTTARPVP


51
HEEVALRYYG


101
cytl9 IDMTKGQVEV
cytl9AE2 --MTKGQVEV

151
cytl9 IVVSNCVINL
cytl9AE2 IVVSNCVINL

201
cytl9 VLWGECLGGA
cytl9AE2 VLWGECLGGA

251
cytl9 RFVSATFRLF
cytl9AE2 RFVSATFRLF

301
cytl9 EVDEETAAIL
cytl9AE2 EVDEETAAIL

351
cytl9 EESDSMKSRC
cytl9AE2 EESDSMKSRC


cytl9
cytl9AE2



cytl9
cytl9AE2


50
KHIREALQNV
----------


100
LVGEKGHVTG
----------


150
EAGIKNESHD
EAGIKNESHD

200
ELPEEIRTHK
ELPEEIRTHK

250
KELERVIGDC
KELERVIGDC

300
NFTFKEGEIV
NFTFKEGEIV

350
DIITDPFKLA
DIITDPFKLA


VPDAAGGCCG TKKSC*
VPDAAGGCCG TKKSC*


Figure 3-5. Alignment of the reference cytl9 amino acid sequence and product of
cytl9AE2 uORF. Consensus Motif I for SAM dependent methyltransferases
is underlined.


CGLVIPEHLE NCWILDLGSG SGRDCYVLSQ



AEKYLDYHME KYGFQASNVT FIHGYIEKLG
AEKYLDYHME KYGFQASNVT FIHGYIEKLG



VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL
VPDKQQVLQE AYRVLKHGGE LYFSDVYTSL



LYWKELAVLA QKIGFCPPRL VTANLITIQN
LYWKELAVLA QKIGFCPPRL VTANLITIQN



KHSKTGPTKR CQVIYNGGIT GHEKELMFDA
KHSKTGPTKR CQVIYNGGIT GHEKELMFDA



KNSRFAQDFL IRPIGEKLPT SGGCSALELK
KNSRFAQDFL IRPIGEKLPT SGGCSALELK
KNSREAQDFL IRPIGEKLPT SGGCSALELK









Table 3-1. The individual information and Shapiro's score of cytl9 exon 2 and exon 3.

SSequence Splice site Shapiro's method Ri, bits
Exon 2 GACGCTGGGTCAGA Acceptor (-13 to +1) 61.5 -1.9
AAGGTAGAGT Donor (-3 to +7) 72.0 5.5
Exon 3 TTCCATTTCCCAGA Acceptor (-13 to +1) 84.8 9.5
CAGGTGAGGC Donor (-3 to +7) 88.1 7.4
a. Exon 2 is the alternative exon of cytl9 and exon 3 is the constitutive exon.

Table 3-2. The amount of cytl9 and cytl9AE2 in different human liver samples and
HepG2 cells. The percentage of cyl9 AE2 in each sample.

Samples cytl9 cytl9AE2 %cyt 9AE2a
(copies/tg RNA) (copies/tg RNA)
HL-541 1.21x106 0.49x106 3.25x103 1.14x103 0.27
HL-546 1.22x105 0.35x105 3.55x103 +0.89x103 2.83
HL-611 7.04x104 +3.91x104 1.89x103 +1.45x103 2.61
HL-612 7.89x105 +1.78x105 3.63x103 +2.70x103 0.46
HL-656 1.09x105 +0.44x105 4.33x103 +0.69x103 3.84
HL-710 8.40x105 +2.64x105 3.95x103 +1.06 103 0.47
HL-714 1.26x106 +0.42x106 3.22x103 +1.23x103 0.26
HepG2 cells 5.14 x106 1.08x106 8.55x104 + 6.42 x104 1.64
a. The percentage of cytl9AE2 is calculated by dividing the copies/Gg of RNA for each
sample by the total copies of both transcripts for each sample (cytl9AE2/(cytl9 +
cytl9AE2)*100).














CHAPTER 4
GENERAL CONCLUSIONS

The first study showed that cytl9 is an arsenic methyltransferase. In addition, we

have demonstrated that this enzyme does both methylation steps involved in arsenic

biotransformation seen in humans. We also showed that the C-terminus is critical in the

activity of the protein. In other SAM-dependent methyltransferases, the C-terminus is

important in substrate binding. This indicates that the cysteine rich C-terminus is

important for As binding and critical for activity. Others have shown that mutations can

change the methylation capacity of the protein. Here, we demonstrated that a single

mutation can drastically change the activity of the protein even though we believed that

the amino acid change would not have a significant effect on the activity of the

recombinant protein. This change occurs in motif I of the SAM-binding site which might

inhibit its ability to bind SAM therefore decreasing its activity. The mutation appears to

cause a change in the substrate affinity of the proteins as well as cause different

methylation profiles specifically for arsenite. However, the Vmax values of both cytl9-

WT and cytl9R81S are considerably higher than that seen among other mammals such as

the hamster, rabbit, and rhesus monkey. The kinetic analysis of these proteins may

explain the high levels of MMA excreted in human urine. Possibly, arsenite is converted

very quickly to MMA, allowing it to accumulate before the dimethylation step resulting

in the higher excretion of MMA seen in humans. The human arsenic methyltransferase

did have some similarities with the other mammalian arsenic methyltransferases. These

arsenic methyltransferases have been shown to increase in activity at basic pHs which









may be due to the deprotonation of cysteines at higher pHs, which increases the rate of

binding between arsenic and cysteines in the substrate binding domain. Our results

demonstrate that only a strong reductant is necessary for methylation of arsenic by cytl9,

however, the addition of GSH appears to increase the activity above the reductant alone.

The second study introduced another possible explanation for the variability in

arsenic methylation capacities among individuals, alternative splicing. Alternative

splicing is frequently used to regulate gene expression and to generate tissue-specific

mRNA and protein isoforms. Thirty-five to 60% of human genes produce transcripts that

are alternatively spliced, in addition 70-90% of these variants alter the resulting protein

products. In this study we identified an alternative splice variant of the human cytl9

(cytl9AE2), in which exon 2 is removed creating a bicistronic transcript. The cytl9AE2

variant was present in all seven human liver samples tested, suggesting that cytl9 mRNA

exists both in the full length and in alternatively spliced forms in most individuals. It is

unlikely that this variant would result in expression of an active protein. Studies have

shown that SAM dependent methyltransferases share 3 regions of sequence similarity

(motif I, II, and III). It has been suggested that these conserved regions are important in

SAM binding. Therefore, it is unlikely that the protein translated from cytl9AE2 would

result in an active protein due to the removal of exon 2 which contains motif I. Whether

the mRNA actually is translated into protein has not been determined. The majority of

mutations discovered within the cytl9 gene occur within the intron or untranslated

regions [66, 67]. In fact, only 4 mutations have been found within the coding region.

Introns contain sequence elements in which splicesome assembly occurs [66, 67].

Mutations within these elements could alter the constitutive splicing of a gene.









Future studies should focus on isolating the human AS3MT from human livers.

To this date, preparations from human livers, cytosolic or homogenates have shown no

activity in arsenic methylation. Reasons for this may be due to inhibitory factors present

in the liver preparation or the process of making the preparations may render the protein

inactive. Yet another explanation may be due to the possibility that cytl9 is an inducible

protein. Perhaps the average daily exposure does not cause high levels of expression of

the protein, making it difficult to purify from liver samples. It may be beneficial to

attempt protein purification from known higher than normal arsenic exposed populations.

Perhaps populations exposed to higher than normal levels have reached a threshold of

exposure resulting in higher expression levels of cytl9. Another possibility for

purification of cytl9 from normally exposed populations may be by immunoprecipitation

from human liver preparations using an antibody which is highly selective for cytl9.

Further studies should analyze the mRNA expression levels of cytl9 splice

variants in a larger number of fresh liver samples or primary hepatocytes and correlate it

to arsenic methylation activity. In addition, work to determine if this transcript is a

substrate for the NMD pathway or if a variant protein is expressed will help clarify the

role of cytl9AE2 in human arsenic metabolism. In addition, more investigations should

look at mutations within the intron of cytl9 and determine if these alter splicing events.

Another important study would be to establish a method to test exposed populations at

both the mRNA and protein levels of cytl9. This study would help determine vulnerable

individuals in high arsenic exposed populations. Finally, the ultimate question which still

remains unanswered: is arsenic methylation a bioactivation or detoxification mechanism.






48


If time and funding were not a factor, I would enjoy working on solving these different

unanswered questions which may help identifying possible vulnerable populations.














APPENDIX
ROLE OF CYT19 IN ACUTE ARSENIC TOXICITY. IS CYT19 THE ONLY HUMAN
ARSENIC METHYLTRANSFERASE?

While my work has clearly demonstrated that cytl9 is a human arsenic

methyltransferase, it is not clear that it is the only arsenic methyltransferase in humans.

In order to address this question, it is necessary to: 1) alter the expression of cytl9 and 2)

have the ability to measure cytl9 protein levels. The first challenge was addressed by the

use of small interfering RNA (siRNA) to reduce the expression of cytl9. The second

challenge was addressed by developing an antibody specific for human cytl9.

Small RNAs can theoretically be used to reduce the expression of any target gene.

There are two main categories of small RNA, microRNA (miRNA) and siRNA. These

small RNA have natural functions such as defense from viral and transposon invasion as

well as gene regulation. Scientists have used this new technology for several reasons

such as determination of gene function, validating drug targets, and treatment of diseases.

Small RNAs have two mechanisms by which protein translation is inhibited. If the small

RNA is 100% homologous to its mRNA target it results in degradation of the mRNA.

However, if the small RNA is not 100% identical to its mRNA target it results in

inhibition of translation without mRNA degradation [105].

Materials and Methods

Multiple siRNAs were designed and synthesized according to the SilencerTM

siRNA Construction Kit (Ambion). Forty-five thousand HepG2 cells were plated on a 24

well plate in normal growth media overnight and transfected in duplicates with the









appropriate siRNA according to SilencerTM siRNA Trasnfection Kit. Total RNA was

isolated 2 days after transfection. The most efficient siRNA was assessed by measuring

the mRNA levels of cytl9 normalized to RNA polymerase II (RPII) by quantitative PCR

(qPCR). Once the most efficient siRNA is determined, further optimization steps can be

taken such as cell plating density, transfection agent, and siRNA amount. The siRNA

pool was further optimized in a 96-well plate using 16,000 cells per well and assayed.

The mRNA levels were measured by qPCR as above, and the viability was determined by

the XTT assay. GAPDH was used as negative control.

An antibody to cytl9 was developed in rabbits by sending purified recombinant

cytl9 to Cocalico. The antibody specificity was determined from western blots of

purified protein and HepG2 cell extracts. To increase the specificity of the antibody, it

was affinity purified using the AminoLink Kit (Pierce) according the manufacturer's

instructions. Briefly, the purified cytl9 protein was coupled to the gel followed by

affinity purification.

Results and Discussion

cytl9 mRNA Knockdown by siRNA

Three different siRNAs were designed (Table 1). The efficiency of all three

siRNAs as well as a pool of the three siRNAs was determined (Figure 1). The data

demonstrates that the knockdown was successful with the pool of siRNAs, however

further optimization is still required. It appears that the first three siRNAs had no effect

on the cytl9 mRNA levels. The pool of all three siRNAs appears to knockdown cytl9

mRNA levels by about 26%, relative to control. The second attempt at cytl9 mRNA

knockdown demonstrated that 16,000 cells per well in a 96-well plate resulted in a

greater knockdown of cytl9 mRNA of about 40% compared to 45,000 cells used in the









first attempt (Figure 2). It appears that cytl9 mRNA levels might have been slightly

reduced in the negative control. In addition, the siRNA transfection did not result in a

decrease of viability relative to control (Figure 3). The data demonstrates that the

optimal cell density and the transfection agent are important to optimize. Taken together

the results suggest that the concentration of the siRNA requires further optimization or

perhaps new siRNAs can be designed and tested.

Antibody Specificity and Purification

Crude antiserum was shown to be able to detect the antigen up to about 25 ng

(Figure 4). The antibody was not able to detect cytl9 in any of the human liver cytosol

preparations tested. In addition, the antibody appears not to be very specific (Figure 5).

Once purified, the antibody was characterized and found to be able to detect the antigen

up to about 40 ng (Figure 6). The specificity of the antibody was increased dramatically

and is able to detect cytl9 in all tested human liver samples and in HepG2 cytosol tested

(Figure 7). In order to determine if the antibody is in fact recognizing cytl9 in these

cytosol preparations, the protein must be immunoprecipitated and sequenced.

Future Experiments

Further studies are needed in order to better understand the role of arsenic

methylation in acute human arsenic exposures. However, two very important steps in

answering this question have been addressed, knockdown of cytl9 and the ability to

measure cytl9 protein levels through antibody specificity. We have to determine the

correlation between mRNA levels and protein levels. It may be possible to knockdown

the mRNA levels without affecting the protein levels if the protein has a long half-life.

The opposite may be true as well, we may not see much affect in the mRNA levels but

the siRNA may be able to suppress protein expression thereby reducing methylation.






52


Once we prove the protein levels are down, we can determine the effects of As exposure

as well as determine if cytl9 is the only arsenic methyltransferase in humans.






53


Table A-1. Sequence of double stranded siRNA


siRNA 1: 5'-CAU UGA GAA GUU GGC AGA GUU-3'
3'-UU GUA ACU CUU CAA CCG UCU C-5'
siRNA 2: 5'-UGU GAC UUU UUU CCA UGG CUU-3'
3'-UU ACA CUC AAA AAA GGU ACC G-5'
siRNA3: 5'-GUU GGC AGA GGC UGG AAU CUU-3'
3'-UU CAA CCG UCU CCG ACC UUA G-5'







54



cytl9 mRNA Knockdown


1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0


siRNA1


siRNA2


siRNA3


siRNAp


Figure A-1. Determination of the most efficient siRNA in the knockdown of cytl9
mRNA levels assayed by qPCR.




cytl9 mRNA Knockdown


* 1.2
u,
S1
1

S0.8
E
0.6

S0.4

0.2

0


GAPDH-


siRNA pool


Figure A-2. The siRNA pool knockdown of cytl9 mRNA relative to control.










Cytotoxic Assay


CONTROL


GAPDH-


cytl9p


Figure A-3. Determination of cell viability after siRNA knockdown by the XTT assay.


25ng 50ng 100ng 200ng 300ng


A"


Figure A-4. Western blot of the specificity of the crude antisera to the antigen, purified
cytl9 protein.


1 2 3 4 5

a


a"


-OOMM "Row


Figure A-5. Western blot of the specificity of the crude antisera to cytl9 in human liver
cytosolic preparations. 1) HL-93-F6; 2) HL-93-F7; 3) HL-94-F4; 4) HL-97-
21; 5) purified cytl9.


z 100
> 80

g 60
-4-
'5 40


I I I I I I


t








40ng 60ng 125ng 250ng 500ng


Figure A-6. Western blot of the specificity of the purified antibody to the antigen,
purified cytl9 protein.


1 2 3 4 5 6


-


Figure A-7. Western blot of the specificity of the crude antisera to cytl9 in human liver
cytosolic preparations. 1) HL-97-21; 2) HL-H-F6; 3) HL-93-F7; 4) HL-94-
F4; 5) HL-714 6) HeG2 cytosol 7) purified cytl9.
















LIST OF REFERENCES


1. NAS, Arsenic: Medical and Biologic Effects of Environmental Pollutants. 1977,
Washington, D.C.

2. Maher, WA, The Presence ofArsenobetaine in Marine Animals. Comp Biochem
Physiol C, 1985. 80(1): p. 199-201.

3. ATSDR, Toxicological Profile for Arsenic (Draft for Public Comment). 2005,
Atlanta, GA: U.S. Department of Health and Human Services, Public Health
Service.

4. Brooks, WE. Arsenic. U.S. Geological Survey, Mineral Commodity Studies. 2005
[accessed 2006 April]; Available from:
http://minerals.usgs.gov/minerals/pubs/commodity/arsenic/arsenmcs05.pdf

5. Jelinek, CF and Corneliussen, PE, Levels ofArsenic in the United States Food
Supply. Environ Health Perspect, 1977. 19: p. 83-7.

6. Aronson, SM, Arsenic and OldMyths. R I Med, 1994. 77(7): p. 233-4.

7. Miller, WH, Jr., Schipper, HM, Lee, JS, Singer, J, and Waxman, S, Mechanisms
ofAction of Arsenic Trioxide. Cancer Res, 2002. 62(14): p. 3893-903.

8. Abernathy, CO, Thomas, DJ, and Calderon, RL, Health Effects andRisk
Assessment ofArsenic. JNutr, 2003. 133(5 Suppl 1): p. 1536S-8S.

9. EPA. Arsenic Treatment Technologies for Soil, Waste, and Water. 2002 [cited
2006 March 2].

10. NRC, Arsenic in Drinking Water. 2001, Washington, DC: National Academy
Press.

11. Chowdhury, UK, Biswas, BK, Chowdhury, TR, Samanta, G, Mandal, BK, Basu,
GC, Chanda, CR, Lodh, D, Saha, KC, Mukherjee, SK, Roy, S, Kabir, S,
Quamruzzaman, Q, and Chakraborti, D, Groundwater Arsenic Contamination in
Bangladesh and West Bengal, India. Environ Health Perspect, 2000. 108(5): p.
393-7.









12. Frost, FJ, Muller, T, Petersen, HV, Thomson, B, and Tollestrup, K, Identifying Us
Populationsfor the Study of Health Effects Related to Drinking Water Arsenic. J
Expo Anal Environ Epidemiol, 2003. 13(3): p. 231-9.

13. Yoshida, T, Yamauchi, H, and Fan Sun, G, Chronic Health Effects in People
Exposed to Arsenic Via the Drinking Water: Dose-Response Relationships in
Review. Toxicol Appl Pharmacol, 2004. 198(3): p. 243-52.

14. Tseng, WP, Chu, HM, How, SW, Fong, JM, Lin, CS, and Yeh, S, Prevalence of
.\kin Cancer in an Endemic Area of Chronic Arsenicism in Taiwan. J Natl Cancer
Inst, 1968. 40(3): p. 453-63.

15. Chiou, HY, Hsueh, YM, Liaw, KF, Horng, SF, Chiang, MH, Pu, YS, Lin, JS,
Huang, CH, and Chen, CJ, Incidence ofInternal Cancers and ingested organic
Arsenic: A Seven-Year Follow-up Study in Taiwan. Cancer Res, 1995. 55(6): p.
1296-300.

16. Tsuda, T, Babazono, A, Yamamoto, E, Kurumatani, N, Mino, Y, Ogawa, T,
Kishi, Y, and Aoyama, H, Ingested Arsenic and Internal Cancer: A Historical
Cohort Study Followedfor 33 Years. Am J Epidemiol, 1995. 141(3): p. 198-209.

17. Smith, AH, Goycolea, M, Haque, R, and Biggs, ML, MarkedIncrease in Bladder
and Lung Cancer Mortality in a Region of Northern Chile Due to Arsenic in
Drinking Water. Am J Epidemiol, 1998. 147(7): p. 660-9.

18. Tseng, CH, Tai, TY, Chong, CK, Tseng, CP, Lai, MS, Lin, BJ, Chiou, HY,
Hsueh, YM, Hsu, KH, and Chen, CJ, Long-Term Arsenic Exposure and Incidence
ofNon-Insulin-Dependent Diabetes Mellitus: A Cohort Study in Arseniasis-
Hyperendemic Villages in Taiwan. Environ Health Perspect, 2000. 108(9): p. 847-
51.

19. Li, JH and Rossman, TG, Inhibition ofDNA Ligase Activity by Arsenite: A
Possible Mechanism of ts Comutagenesis. Mol Toxicol, 1989. 2(1): p. 1-9.

20. Petrick, JS, Ayala-Fierro, F, Cullen, WR, Carter, DE, and Vasken Aposhian, H,
3 f n Oin t) A,, 1 wint, Acid (Mma(Iii)) Is More Toxic Than Arsenite in Chang
Human Hepatocytes. Toxicol Appl Pharmacol, 2000. 163(2): p. 203-7.

21. Ding, W, Hudson, LG, and Liu, KJ, Inorganic Arsenic Compounds Cause
Oxidative Damage to DNA and Protein by Inducing Ros and Rns Generation in
Human Keratinocytes. Mol Cell Biochem, 2005. 279(1-2): p. 105-12.

22. Nesnow, S, Roop, BC, Lambert, G, Kadiiska, M, Mason, RP, Cullen, WR, and
Mass, MJ, DNA Damage Induced by Methylated Trivalent Arsenicals Is Mediated
by Reactive Oxygen Species. Chem Res Toxicol, 2002. 15(12): p. 1627-34.









23. Ray, BD, Moore, JM, and Rao, BD, 31p Nmr Studies ofEnzyme-Bound Substrate
Complexes of Yeast 3-Phosphoglycerate Kinase: Iii. Two Adp Binding Sites and
Their Mg(Ii) Affinity; Effects of Vanadate andArsenate on Enzymic Complexes
1i ith Adp and 3-P-Glycerate. J Inorg Biochem, 1990. 40(1): p. 47-57.

24. Wei, M, Wanibuchi, H, Morimura, K, Iwai, S, Yoshida, K, Endo, G, Nakae, D,
and Fukushima, S, Carcinogenicity ofDiieiliy -A IilliL- Acid in Male F344 Rats
and Genetic Alterations in Induced Urinary Bladder Tumors. Carcinogenesis,
2002. 23(8): p. 1387-97.

25. Waalkes, MP, Ward, JM, Liu, J, and Diwan, BA, Transplacental Carcinogenicity
ofInorganic Arsenic in the Drinking Water: Induction ofHepatic, Ovarian,
Pulmonary, and Adrenal Tumors in Mice. Toxicol Appl Pharmacol, 2003. 186(1):
p. 7-17.

26. Wanibuchi, H, Salim, EI, Kinoshita, A, Shen, J, Wei, M, Morimura, K, Yoshida,
K, Kuroda, K, Endo, G, and Fukushima, S, Understanding Arsenic
Carcinogenicity by the Use ofAnimal Models. Toxicol Appl Pharmacol, 2004.
198(3): p. 366-76.

27. Zhao, CQ, Young, MR, Diwan, BA, Coogan, TP, and Waalkes, MP, Association
ofArsenic-Induced Malignant Transformation i/ ith DNA Hypomethylation and
Aberrant Gene Expression. Proc Natl Acad Sci U S A, 1997. 94(20): p. 10907-12.

28. Chen, H, Li, S, Liu, J, Diwan, BA, Barrett, JC, and Waalkes, MP, Chronic
Inorganic Arsenic Exposure Induces Hepatic Global and Individual Gene
Hypomethylation: Implications for Arsenic Hepatocarcinogenesis.
Carcinogenesis, 2004. 25(9): p. 1779-86.

29. Tully, DB, Collins, BJ, Overstreet, JD, Smith, CS, Dinse, GE, Mumtaz, MM, and
Chapin, RE, Effects ofArsenic, Cadmium, Chromium, and Lead on Gene
Expression Regulated by a Battery of 13 Different Promoters in Recombinant
Hepg2 Cells. Toxicol Appl Pharmacol, 2000. 168(2): p. 79-90.

30. Binet, F, Cavalli, H, Moisan, E, and Girard, D, Arsenic Trioxide (at) Is a Novel
Human Neutrophil Pro-Apoptotic Agent: Effects of Catalase on at-Induced
Apoptosis, Degradation of Cytoskeletal Proteins and De Novo Protein Synthesis.
Br J Haematol, 2006. 132(3): p. 349-58.

31. Yamanaka, K, Kato, K, Mizoi, M, An, Y, Takabayashi, F, Nakano, M, Hoshino,
M, and Okada, S, The Role of Active Arsenic Species Produced by Metabolic
Reduction ofDimethylarsinic Acid in Genotoxicity and Tumorigenesis. Toxicol
Appl Pharmacol, 2004. 198(3): p. 385-93.

32. Cullen, WR, McBride, BC, and Reglinski, J, The Reduction ofT inel'/yAli \iie'
Oxide to Ti inwil/)lh \illue by Thiols: A Mechanistic Modelfor the Biological
Reduction ofArsenicals. Journal of Inorganic Biochemistry, 1984. 21(1): p. 45.









33. Gregus, Z and Nemeti, B, Purine Nucleoside Phosphorylase as a Cytosolic
Arsenate Reductase. Toxicol Sci, 2002. 70(1): p. 13-9.

34. Radabaugh, TR, Sampayo-Reyes, A, Zakharyan, RA, and Aposhian, HV,
Arsenate Reductase Ii. Purine Nucleoside Phosphorylase in the Presence of
Dihydrolipoic Acid Is a Route for Reduction ofArsenate to Arsenite in
Mammalian Systems. Chem Res Toxicol, 2002. 15(5): p. 692-8.

35. Nemeti, B, Csanaky, I, and Gregus, Z, Arsenate Reduction in Human
Elll I i<)eyi1\ and Rats--Testing the Role ofPurine Nucleoside Phosphorylase.
Toxicol Sci, 2003. 74(1): p. 22-31.

36. Gregus, Z and Nemeti, B, The Glycolytic Enzyme Glyceraldehyde-3-Phosphate
Dehydrogenase Works as an Arsenate Reductase in Human Red Blood Cells and
Rat Liver Cytosol. Toxicol Sci, 2005. 85(2): p. 859-69.

37. Nemeti, B and Gregus, Z, Reduction of Arsenate to Arsenite by Human
E iyhiit ,yle. Lysate and Rat Liver Cytosol Characterization of a Glutathione-
and Nad-Dependent Arsenate Reduction Linked to Glycolysis. Toxicol Sci, 2005.
85(2): p. 847-58.

38. Radabaugh, TR and Aposhian, HV, Enzymatic Reduction ofArsenic Compounds
in Mammalian Systems: Reduction ofArsenate to Arsenite by Human Liver
Arsenate Reductase. Chem Res Toxicol, 2000. 13(1): p. 26-30.

39. Zakharyan, RA and Aposhian, HV, Enzymatic Reduction ofArsenic Compounds
in Mammalian Systems: The Rate-Limiting Enzyme of Rabbit Liver Arsenic
Biotransformation Is Mma(V) Reductase. Chem Res Toxicol, 1999. 12(12): p.
1278-83.

40. Zakharyan, RA, Sampayo-Reyes, A, Healy, SM, Tsaprailis, G, Board, PG,
Liebler, DC, and Aposhian, HV, Human f ein ,imiiieti uylti ii- Acid (Mma(V))
Reductase Is a Member of the Glutathione-S-Transferase Superfamily. Chem Res
Toxicol, 2001. 14(8): p. 1051-7.

41. Vasken Aposhian, H, Zakharyan, RA, Avram, MD, Sampayo-Reyes, A, and
Wollenberg, ML, A Review of the Enzymology ofArsenic Metabolism and a New
Potential Role of Hydrogen Peroxide in the Detoxication of the Trivalent Arsenic
Species. Toxicol Appl Pharmacol, 2004. 198(3): p. 327-35.

42. Scott, N, Hatlelid, KM, MacKenzie, NE, and Carter, DE, Reactions ofArsenic(Iii)
andArsenic(V) Species ith Glutathione. Chem Res Toxicol, 1993. 6(1): p. 102-
6.

43. Delnomdedieu, M, Basti, MM, Otvos, JD, and Thomas, DJ, Reduction and
Binding ofArsenate and Dimethylarsinate by Glutathione: A Magnetic Resonance
Study. Chemico-Biological Interactions, 1994. 90(2): p. 139.









44. Mandal, BK, Ogra, Y, and Suzuki, KT, Identification ofDimethylarsinous and
[ /f,111unillylin w1,ini Acids in Human Urine of the Arsenic-Affected Areas in
West Bengal, India. Chem Res Toxicol, 2001. 14(4): p. 371-8.

45. Yamauchi, H and Yamamura, Y, Metabolism and Excretion of Orally
Administrated Arsenic Trioxide in the Hamster. Toxicology, 1985. 34(2): p. 113-
21.

46. Yoshida, K, Chen, H, Inoue, Y, Wanibuchi, H, Fukushima, S, Kuroda, K, and
Endo, G, The Urinary Excretion ofArsenic Metabolites after a Single Oral
Administration ofDimethylarsinic Acid to Rats. Archives of Environmental
Contamination and Toxicology, 1997. 32(4): p. 416.

47. Marafante, E, Vahter, M, Norin, H, Envall, J, Sandstrom, M, Christakopoulos, A,
and Ryhage, R, Biotransformation ofDimethylarsinic Acid in Mouse, Hamster
andMan. J Appl Toxicol, 1987. 7(2): p. 111-7.

48. Francesconi, KA, Tanggaar, R, McKenzie, CJ, and Goessler, W, Arsenic
Metabolites in Human Urine after Ingestion of an Arsenosugar. Clin Chem, 2002.
48(1): p. 92-101.

49. Zakharyan, R, Wu, Y, Bogdan, GM, and Aposhian, HV, Enzymatic Methylation
ofArsenic Compounds: Assay, Partial Purification, and Properties ofArsenite
Slih. i ti'tii ta\r e andMif /,einuell, iyll i s 1iiL. Acid Methyltransferase of Rabbit
Liver. Chem Res Toxicol, 1995. 8(8): p. 1029-38.

50. Wildfang, E, Zakharyan, RA, and Aposhian, HV, Enzymatic Methylation of
Arsenic Compounds. Vi. Characterization ofHamster Liver Arsenite and
1 'ily1l ,, in/\i- Acid Methyltransferase Activities in Vitro. Toxicol Appl
Pharmacol, 1998. 152(2): p. 366-75.

51. Lin, S, Shi, Q, Nix, FB, Styblo, M, Beck, MA, Herbin-Davis, KM, Hall, LL,
Simeonsson, JB, and Thomas, DJ, A Novel S-Adenosyl-L-Methionine:Arsenic(Iii)
S'tiliyhli fiat'e from Rat Liver Cytosol. J Biol Chem, 2002. 277(13): p. 10795-
803.

52. Hayakawa, T, Kobayashi, Y, Cui, X, and Hirano, S, A New Metabolic Pathway of
Arsenite: Arsenic-Glutathione Complexes Are Substrates for Human Arsenic
A ili ,lfuinfa'i ,e Cytl9. Arch Toxicol, 2004.

53. Healy, SM, Casarez, EA, Ayala-Fierro, F, and Aposhian, H, Enzymatic
Methylation of Arsenic Compounds. V Arsenite A1 il'yl ,u/i.fia' ,re Activity in
Tissues ofMice. Toxicol Appl Pharmacol, 1998. 148(1): p. 65-70.

54. Wildfang, E, Radabaugh, TR, and Vasken Aposhian, H, Enzymatic Methylation of
Arsenic Compounds. Ix. Liver Arsenite Methyltransferase andArsenate Reductase
Activities in Primates. Toxicology, 2001. 168(3): p. 213-21.









55. McNally, AJ and D.S., B, Molecular Cloning and Characterization ofHuman
Cytl9, an S-Adenosyl-L-Methionine:As-. lf'i ih1,i anfi' ,,e from Hepg2 Cells.
Itinerary Planner. New Orleans, LA: Society of Toxicology, 2005: p. Abstract No.
131.

56. Vahter, M and Marafante, E, Intracellular Interaction andMetabolic Fate of
Arsenite andArsenate in Mice and Rabbits. Chem Biol Interact, 1983. 47(1): p.
29-44.

57. Vahter, M, Marafante, E, and Dencker, L, Tissue Distribution andRetention of
74as-Dini/iyhi i \in-i Acid in Mice and Rats. Arch Environ Contam Toxicol,
1984. 13(3): p. 259-64.

58. Healy, SM, Wildfang, E, Zakharyan, RA, and Aposhian, HV, Diversity of
Inorganic Arsenite Biotransformation. Biol Trace Elem Res, 1999. 68(3): p. 249-
66.

59. Vahter, M, Genetic Polymorphism in the Biotransformation ofInorganic Arsenic
andIts Role in Toxicity. Toxicol Lett, 2000. 112-113: p. 209-17.

60. Concha, G, Vogler, G, Lezcano, D, Nermell, B, and Vahter, M, Exposure to
Inorganic Arsenic Metabolites During Early Human Development. Toxicol Sci,
1998. 44(2): p. 185-90.

61. Vahter, M, Concha, G, Nermell, B, Nilsson, R, Dulout, F, and Natarajan, AT, A
Unique Metabolism ofInorganic Arsenic in Native Andean Women. Eur J
Pharmacol, 1995. 293(4): p. 455-62.

62. Concha, G, Nermell, B, and Vahter, MV, Metabolism ofInorganic Arsenic in
Children i/th Chronic High Arsenic Exposure in Northern Argentina. Environ
Health Perspect, 1998. 106(6): p. 355-9.

63. Concha, G, Vogler, G, Nermell, B, and Vahter, M, Low-LevelArsenic Excretion
in Breast Milk ofNative Andean Women Exposed to High Levels ofArsenic in the
Drinking Water. Int Arch Occup Environ Health, 1998. 71(1): p. 42-6.

64. Chiou, HY, Hsueh, YM, Hsieh, LL, Hsu, LI, Hsu, YH, Hsieh, FI, Wei, ML, Chen,
HC, Yang, HT, Leu, LC, Chu, TH, Chen-Wu, C, Yang, MH, and Chen, CJ,
Arsenic Methylation Capacity, Body Retention, and Null Genotypes of
Glutathione S-Transferase Ml and T1 among Current Arsenic-Exposed Residents
in Taiwan. Mutat Res, 1997. 386(3): p. 197-207.

65. Drobna, Z, Waters, SB, Walton, FS, LeCluyse, EL, Thomas, DJ, and Styblo, M,
Interindividual Variation in the Metabolism of Arsenic in Cultured Primary
Human Hepatocytes. Toxicol Appl Pharmacol, 2004. 201(2): p. 166-77.









66. Meza, MM, Yu, L, Rodriguez, YY, Guild, M, Thompson, D, Gandolfi, AJ, and
Klimecki, WT, Developmentally Restricted Genetic Determinants of Human
Arsenic Metabolism: Association between Urinary Methylated Arsenic and Cyt19
Polymorphisms in Children. Environ Health Perspect, 2005. 113(6): p. 775-81.

67. Wood, TC, Salavaggione, OE, Mukherjee, B, Wang, L, Klumpp, AF, Thomae,
BA, Eckloff, BW, Schaid, DJ, Wieben, ED, and Weinshilboum, RM, Human
Arsenic Methyltransferase (As3mt) Pharmacogenetics: Gene Resequencing and
Functional Genomics Studies. J Biol Chem, 2006.

68. Jeanteur, P, Regulation ofAlternative Splicing. Progress in Molecular and
Subcellular Biology, 31. 2003, Berlin; New York: Springer. xiii, 245.

69. Schoenberg, DR, Mrna Processing and Metabolism: Methods and Protocols.
2004, Totowa, NJ: Humana Press. xv, 270.

70. Black, DL, Mechanisms ofAlternative Pre-Messenger Rna Splicing. Annu Rev
Biochem, 2003. 72: p. 291-336.

71. Klaassen, CD, Casarett andDoull's Toxicology: The Basic Science ofPoisons.
6th ed. 2001, New York: McGraw-Hill Medical Publishing Division. xix, 1236.

72. Mure, K, Uddin, AN, Lopez, LC, Styblo, M, and Rossman, TG, Arsenite Induces
Delayed Mutagenesis and Transformation in Human Osteosarcoma Cells at
Extremely Low Concentrations. Environ Mol Mutagen, 2003. 41(5): p. 322-31.

73. Petrick, JS, Jagadish, B, Mash, EA, and Aposhian, HV, 3b, iileiliy-li \ilnl,,
Acid (Mma(Iii)) and Arsenite: Ld(50) in Hamsters and in Vitro Inhibition of
Pyruvate Dehydrogenase. Chem Res Toxicol, 2001. 14(6): p. 651-6.

74. Hirano, S, Kobayashi, Y, Cui, X, Kanno, S, Hayakawa, T, and Shraim, A, The
Accumulation and Toxicity ofMethylated Arsenicals in Endothelial Cells:
Important Roles of Thiol Compounds. Toxicol Appl Pharmacol, 2004. 198(3): p.
458-67.

75. Healy, SM, Zakharyan, RA, and Aposhian, HV, Enzymatic Methylation of
Arsenic Compounds: Iv. In Vitro and in Vivo Deficiency of the Methylation of
Arsenite and3 oini ,I,-'iln V/ln1 tic Acid in the Guinea Pig. Mutat Res, 1997.
386(3): p. 229-39.

76. Vahter, M, Couch, R, Nermell, B, and Nilsson, R, Lack ofMethylation of
Inorganic Arsenic in the Chimpanzee. Toxicol Appl Pharmacol, 1995. 133(2): p.
262-8.

77. Zakharyan, RA, Wildfang, E, and Aposhian, HV, Enzymatic Methylation of
Arsenic Compounds. Iii. The Marmoset and Tamarin, but Not the Rhesus,
Monkeys Are Deficient in Methyltransferases That Methylate Inorganic Arsenic.
Toxicol Appl Pharmacol, 1996. 140(1): p. 77-84.









78. Aposhian, HV, Enzymatic Methylation ofArsenic Species and Other New
Approaches to Arsenic Toxicity. Annu Rev Pharmacol Toxicol, 1997. 37: p. 397-
419.

79. Peng, B, Sharma, R, Mass, MJ, and Kligerman, AD, Induction of Genotoxic
Damage Is Not Correlated i/th the Ability to Methylate Arsenite in Vitro in the
Leukocytes ofFour Mammalian Species. Environ Mol Mutagen, 2002. 39(4): p.
323-32.

80. Cullen, WR, McBride, BC, Pickett, AW, and Reglinski, J, The Wood Preservative
Chromated Copper Arsenate Is a Substrate for Trimethylarsine Bit,% luthe',i
Appl Environ Microbiol, 1984. 47(2): p. 443-4.

81. Vahter, M, Methylation of Inorganic Arsenic in Different Mammalian Species and
Population Groups. Sci Prog, 1999. 82 (Pt 1): p. 69-88.

82. Loffredo, CA, Aposhian, HV, Cebrian, ME, Yamauchi, H, and Silbergeld, EK,
Variability in Human Metabolism ofArsenic. Environ Res, 2003. 92(2): p. 85-91.

83. Martin, JL and McMillan, FM, Sam (Dependent) IAm: The S-
A, lew i, %hu netlin ,iiii-Depeendent Methyltransferase Fold. Curr Opin Struct Biol,
2002. 12(6): p. 783-93.

84. Zakharyan, RA, Ayala-Fierro, F, Cullen, WR, Carter, DM, and Aposhian, HV,
Enzymatic Methylation ofArsenic Compounds. Vii. M fIt i, ijtl1, tfi \invIi\ Acid
(Mmaiii) Is the Substrate for Mma Methyltransferase of Rabbit Liver and Human
Hepatocytes. Toxicol Appl Pharmacol, 1999. 158(1): p. 9-15.

85. NRC, Arsenic: Medical and Biologic Effects of Environmental Pollutants. 1977,
Washington DC: National Academy of Sciences.

86. Brown, KG and Ross, GL, Arsenic, Drinking Water, and Health: A Position
Paper of the American Council on Science and Health. Regul Toxicol Pharmacol,
2002. 36(2): p. 162-74.

87. ATSDR, Toxicological Profile for Arsenic (Update). August 1998.

88. Cullen, WR, K.J. Reimer, Arsenic Speciation in the Environment. Chemical
Review, 1989. 89: p. 713-764.

89. Cullen, WR, McBride, BC, and Reglinski, J, The Reduction of Trimethlarsine
Oxide to T iiwilt hil inue by Thiols: A Mechanistic Modelfor the Biological
Reduction ofArsenicals. J. Inorg. Biochem., 1984. 21: p. 45-60.

90. Styblo, M, Del Razo, LM, Vega, L, Germolec, DR, LeCluyse, EL, Hamilton, GA,
Reed, W, Wang, C, Cullen, WR, and Thomas, DJ, Comparative Toxicity of
Trivalent and Pentavalent Inorganic and Methylated Arsenicals in Rat and
Human Cells. Arch Toxicol, 2000. 74(6): p. 289-99.









91. Itoh, H, Washio, T, and Tomita, M, Computational Comparative Analyses of
Alternative Splicing Regulation Using Full-Length Cdna of Various Eukaryotes.
Rna, 2004. 10(7): p. 1005-18.

92. Kagan, RM and Clarke, S, Widespread Occurrence of Three Sequence Motifs in
Diverse S-A.leain yhei/iniiiiie-Dependent A' thh7/i// '/i/, Sug.',et a
Common Structure for These Enzymes. Arch Biochem Biophys, 1994. 310(2): p.
417-27.

93. Hamahata, A, Takata, Y, Gomi, T, and Fujioka, M, Probing the S-
A, leit hue tliil ,in iii-Binding Site ofRat Guanidinoacetate Methyltransferase.
Effect of Site-Directed Mutagenesis of Residues That Are Conserved across
Mammalian Non-Nucleic AcidMethyltransferases. Biochem J, 1996. 317 (Pt 1):
p. 141-5.

94. Kozak, M, Possible Role ofFlanking Nucleotides in Recognition of the Aug
Initiator Codon by Eukaryotic Ribosomes. Nucleic Acids Res, 1981. 9(20): p.
5233-52.

95. Kozak, M, Compilation andAnalysis of Sequences Upstream from the
Translational Start Site in Eukaryotic Mrnas. Nucleic Acids Res, 1984. 12(2): p.
857-72.

96. Baker, KE and Parker, R, Nonsense-MediatedMrna Decay: Terminating
Erroneous Gene Expression. Curr Opin Cell Biol, 2004. 16(3): p. 293-9.

97. Zhang, S, Ruiz-Echevarria, MJ, Quan, Y, and Peltz, SW, Identification and
Characterization of a Sequence MotifInvolved in Nonsense-Mediated Mrna
Decay. Mol Cell Biol, 1995. 15(4): p. 2231-44.

98. Ketterling, RP, Drost, JB, Scaringe, WA, Liao, DZ, Liu, JZ, Kasper, CK, and
Sommer, SS, Reported in Vivo Splice-Site Mutations in the Factor Ix Gene:
Severity of Splicing Defects and a H) prlothe i for Predicting Deleterious Splice
Donor Mutations. Hum Mutat, 1999. 13(3): p. 221-31.

99. Moller, LB, Turner, Z, Lund, C, Petersen, C, Cole, T, Hanusch, R, Seidel, J,
Jensen, LR, and Horn, N, Similar Splice-Site Mutations of the Atp7a Gene Lead to
Different Phenotypes: Classical Menkes Disease or Occipital Horn Syndrome.
Am J Hum Genet, 2000. 66(4): p. 1211-20.

100. Faustino, NA and Cooper, TA, Pre-Mrna Splicing and Human Disease. Genes
Dev, 2003. 17(4): p. 419-37.

101. Mironov, AA, Fickett, JW, and Gelfand, MS, Frequent Alternative Splicing of
Human Genes. Genome Res, 1999. 9(12): p. 1288-93.






66


102. Kan, Z, Rouchka, EC, Gish, WR, and States, DJ, Gene Structure Prediction and
Alternative Splicing Analysis Using Genomically Aligned Ests. Genome Res,
2001. 11(5): p. 889-900.

103. Hagiwara, M, Alternative Splicing: A New Drug Target of the Post-Genome Era.
Biochim Biophys Acta, 2005. 1754(1-2): p. 324-31.

104. Hui, J and Bindereif, A, Alternative Pre-Mrna Splicing in the Human System:
Unexpected Role of Repetitive Sequences as Regulatory Elements. Biol Chem,
2005. 386(12): p. 1265-71.

105. Zamore, PD and Haley, B, Ribo-Gnome: The Big World of Small Rnas. Science,
2005. 309(5740): p. 1519-24.















BIOGRAPHICAL SKETCH

Alex J. McNally is the youngest son of Eduaurdo and Ligia McNally, who

immigrated from Managua, Nicaragua. He was born on April 6, 1980, in Miami, FL. He

was raised in Hialeah, FL, where he attended North Miami Senior High and graduated

with honors on May 1998. He then attended the University of Florida where he dualed

major in animal science and microbiology and cell science. He further enhanced his

undergraduate experience working as a student lab assistant at the University of Florida

microbiology and cell science building. He worked with cloning arogenate

dehydrogenase from Arabidopsis thaliana under the guidance of Dr. Carol Bonner and

Dr. Nemat Keyhani. After earning his Bachelor of Science, on August 2003, Alex

continued his graduate studies at the University of Florida, pursuing a Master of Science

specializing in toxicology in May of 2004. He emphasized his graduate research on the

characterization of cytl9, an arsenic methyltransferase, under the guidance of Dr. David

S. Barber. He now plans to pursue a career in a research laboratory where he can

enhance his knowledge and practical experience.