<%BANNER%>

Targeting Angiogenic Growth Factors in Proliferative Diabetic Retinopathy

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110218_AAAACC INGEST_TIME 2011-02-18T12:37:05Z PACKAGE UFE0013783_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 97512 DFID F20110218_AABGJK ORIGIN DEPOSITOR PATH pan_h_Page_085.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
20e476943170f11375b6394db6238c18
SHA-1
8c7202b474d630e82851ed7df48a3335a9f2c0b9
74435 F20110218_AABGIV pan_h_Page_065.jpg
62d342a799a08bc09579bdad5ca9943c
80922dcd8823f9677c6c327a986ced114b1e4a7e
92157 F20110218_AABEZZ pan_h_Page_111.jpg
8e15a4a5680b4ec6e59615f4f0609b76
24d5bb52c2555c5170f10d70be33fb1779c78ebd
8423998 F20110218_AABFGI pan_h_Page_093.tif
25d034fc2fef0d7d6a2d7d625e554121
b64c33e0f7e5e2db94841984601ad7899b91bd18
F20110218_AABFFT pan_h_Page_083.tif
d66dc21d2d5a549310267766c3e6c9e9
d61da1d68e7bed967c84e06c9e6ed452a79c3bcb
81837 F20110218_AABGJL pan_h_Page_086.jpg
1929f28737155dd1e88bf075f1eb8cbe
80a1f292466c9f5a98028a39c77afe5b576e080d
102059 F20110218_AABGIW pan_h_Page_066.jpg
4be63133469442814c7cd22efbc3501c
bf8495b2a3039283a5ab21ef91673cf001d34163
F20110218_AABFGJ pan_h_Page_192.tif
2358c525562362d29c0a3f99fd7bb7d8
2da62a7c2ed6d8b32b7770c42517c6f629a0b804
750291 F20110218_AABFFU pan_h_Page_065.jp2
da66a180520b8f27bb2c6f8f980da06d
bea89720872b36a1edb00955160ad5a468b1c5a4
102698 F20110218_AABGKA pan_h_Page_116.jpg
aa2c69c29caaf307370e404df3198ce5
673f898b4ea45bcc848d9edcd6295a9acfd4f271
107542 F20110218_AABGJM pan_h_Page_087.jpg
b516531e81ecbfd1cde9cd0362d12af5
1e9e276c75dfc12630dc373a1c0a19243205fcdc
81061 F20110218_AABGIX pan_h_Page_067.jpg
cd86bd2c694d6b4db462cf7963b46841
3fff17c005484df8137e675abfca785beb6583b9
1051937 F20110218_AABFGK pan_h_Page_176.jp2
6db4e2733685fa598ea50bea82dcb741
1b28557ee4cacb1cd5a907c03d334ceb2e7fd4d6
707 F20110218_AABFFV pan_h_Page_140.txt
50ec251797fc0dbcaa1a82ed1dc2ed6b
c3ca11c07a46a213a2f5d1f58ec9db70a54692d7
100101 F20110218_AABGKB pan_h_Page_117.jpg
b17e4f80950745d68c919db1657482e3
0ae765518e49f008d591cec8d793a1ff6560c599
78471 F20110218_AABGJN pan_h_Page_089.jpg
4751026d092bdd2c7acbd68337e6f339
eb1a7613ab91beb7e1e323bcbfe9458acb8afd56
104884 F20110218_AABGIY pan_h_Page_068.jpg
2ba68e2dae24048a0fa647222307eea6
19d1f97852625c1d2d60502ed15ccac2fa04c46f
93826 F20110218_AABFGL pan_h_Page_144.jpg
56aa4ac900eaace798dfd8dfa5542450
05bf18343bc37fa4a69c5bfaef8837fb2a781399
49160 F20110218_AABFFW pan_h_Page_176.pro
f5fa7637beba26056291c6d6b42b444d
c832863c0d02c3c73ce56050a8c00105fbc24c58
105873 F20110218_AABGKC pan_h_Page_120.jpg
90e61368999d948e812bc533dcf27104
55c31853985aa22aede80517371e5337b8451277
103452 F20110218_AABGJO pan_h_Page_090.jpg
5d4c4a993ddc8c17ead74f0c15ef305d
3d5587432795c096b605d31bffce4355d72a1419
90903 F20110218_AABGIZ pan_h_Page_069.jpg
58072fc0b875d864137b7d099c3c1557
117fb27e466198ee4204e944434f8d495b828f88
37587 F20110218_AABFGM pan_h_Page_182.QC.jpg
078203b3b9beeef2f05de6d206e4b5fc
716ededbe54bf52ffd6064857b6866cb624dbc58
30592 F20110218_AABFFX pan_h_Page_102.QC.jpg
37287d7a0151717711b25dbf6e97be80
766ff0493d12ca998ed29f9334d2a4ebdedff2a8
53270 F20110218_AABFHA pan_h_Page_101.pro
061bc5ace4e8d396e5a62eb10bc9ba38
ff8b86343d8641e41600751c6ded862f87ef475c
102558 F20110218_AABGKD pan_h_Page_123.jpg
c8319c6618f922935686edf6e05be627
3ae0b041c96178304057d387739a6500207d11a4
104644 F20110218_AABGJP pan_h_Page_091.jpg
dd7c9e9ed6217499afae574bedb8a031
f9a37823fb42918964eba9283526a8947630c572
1960 F20110218_AABFGN pan_h_Page_061.txt
ee1dfe834a57f02a15be3a776cd0f7e3
ae9842a09d3276f005568e5b913ab73e6d1f6191
1051936 F20110218_AABFFY pan_h_Page_170.jp2
04a95da7c9a4b5527973fd75e0ab1274
6a61e7ed0e88a43226510cc0dbc91eb6c5003e56
35035 F20110218_AABFHB pan_h_Page_119.QC.jpg
1c98853fcbbc769b5bebd98ad0e063dc
e51c8970860af87d5555dbacdfdc10efa4fde38a
77470 F20110218_AABGKE pan_h_Page_125.jpg
7429a3dcde2ec8be74157937d3ad26f4
8a85f8fc7e61a3f19910c5b65032009fe4248762
106416 F20110218_AABGJQ pan_h_Page_094.jpg
a662e8e9f903d6e4d9c6d3387fcfb6c2
67b50664605d4474402a02724ccf69ebebe9788b
51780 F20110218_AABFGO pan_h_Page_020.pro
955496d80cecdc65f0cf36259eeb615b
ff03cf1ce832914168663a0abb5bb5c549823085
F20110218_AABFFZ pan_h_Page_010.tif
671eff1744c0478237ed7eb131a34ec7
935705b09daf09fcc0679bf87bc898c6ff60c6e1
1883 F20110218_AABFHC pan_h_Page_051.txt
70689e01a9fd601145850ddfe342a26d
15c692c936d22ba769b354b8d8fc245d923e91a5
94469 F20110218_AABGKF pan_h_Page_126.jpg
726eef1a52ffd093c9e9cf18a8ded60b
8363b63e2c1e34afcae49fd2a115808ae6b25d78
105785 F20110218_AABGJR pan_h_Page_096.jpg
80a54293ea041278782df9b67662b2a8
0ce8b2533921e97584010642d38b9388ddd464c3
666 F20110218_AABFGP pan_h_Page_175.txt
d10bb79891a6f14c4e842b2364a97550
082cfbbdd4ac6e422447f22083ae389c9aeaae3b
28639 F20110218_AABFHD pan_h_Page_176.QC.jpg
61f6e6ca61ff730118db0968dc684ded
66f99027eaa5f84d5118cf21ede1e6fbc8b021b1
79184 F20110218_AABGKG pan_h_Page_128.jpg
c12ab6846c090a3151bed17d8f62e25c
49e9ec9ac8560dd2c2d5884af7eff0b0e4915ae0
1051950 F20110218_AABFHE pan_h_Page_048.jp2
f3d4652a411200a7b8d8f8f1e16df341
1aa8e9f6edcc386a4a25953d6ca9403c01b615c2
126483 F20110218_AABGKH pan_h_Page_129.jpg
5a061b844330139767501fc3d5025f8e
2eaca6978ea1487001529f8835f7e8a280f5a48b
82174 F20110218_AABGJS pan_h_Page_100.jpg
be26952ce50ac09c0fc2a39eb6724ee6
c102737d887d5ccd218cc47a075162ee5792e801
53364 F20110218_AABFGQ pan_h_Page_094.pro
d096043674b347a8e7f1521177aedbab
20e47e0261e1121d80f9779d068be76a2b7ec46b
103383 F20110218_AABFHF pan_h_Page_054.jpg
3f0fef35c360e9147eec7b08124a3643
b42c20e187035e7053117d37ea131d0e96a041c4
62346 F20110218_AABGKI pan_h_Page_130.jpg
a656bcc3b18a6148507feff6d9f75a80
9dd93a22259a9b0279a25d88aa1d43942bb5bb3e
93752 F20110218_AABGJT pan_h_Page_102.jpg
51f9ceed11b3b608885946d399dad4e7
36fe7b7e4baeebfaf5c6cc11beaf2f241321bcc0
889734 F20110218_AABFGR pan_h_Page_006.jp2
10a67f5bc6c32d3e4fd8fd185587efc5
b9e9663886d12464218bbb25f6e416c7e1463430
8011 F20110218_AABFHG pan_h_Page_079thm.jpg
a262184b0f91c7277f0c83b283c5ca6e
3351bf4ddba9d4b2a716ace562e4b952fa550787
115668 F20110218_AABGKJ pan_h_Page_132.jpg
1ad45d51449f6240ae6949d0863e8258
56085cc26bfab146e70996e0afb22d66a13cc754
84328 F20110218_AABGJU pan_h_Page_103.jpg
c3d2cd7d01494453d9cd9d4d4b334070
6dbad1692c0246ce77b8d092af3caf62f4804df3
841288 F20110218_AABFGS pan_h_Page_011.jp2
a06ccebe377223008145b7da3c9e7760
d6b55487f12c7d155d868c4e28a61a8414bdb683
F20110218_AABFHH pan_h_Page_110.tif
7d773cd0f35bb1cc9d7919b584413c81
6e4489d037933ceaf85372c71c64952f2c9b683d
100721 F20110218_AABGKK pan_h_Page_133.jpg
9117206588d3ae4bb516c7c15fe9ab8c
572a0f19fb12f5088d9eee0bd7f74daa8ab10bab
80971 F20110218_AABGJV pan_h_Page_106.jpg
9dc5ba9acc86164f0a96201cc763816a
27791601c2cac91edd5d4a248353caadf29819c2
1650 F20110218_AABFGT pan_h_Page_089.txt
55007db59eb0878c59d8d249c8f424ca
8f8c7b5a634f1cfe7279ab1eb5d7ea8e1e5879e8
1051962 F20110218_AABFHI pan_h_Page_184.jp2
27f9665bec8b3daf7d1b1b004ba4c7ef
1029af32460ffdcf3db8f865e592ebf9f751ae1c
66164 F20110218_AABGKL pan_h_Page_134.jpg
1a684aea1edd682bfffeb5d51c13c4ed
045f0b5edca881a8d23d0924c8fc0df6bc2f1cc7
105976 F20110218_AABGJW pan_h_Page_109.jpg
881fc109e2891af313d9a11f6e283917
5be2c76b6b3bcd15c07bd518fcb6febacb28c10b
33598 F20110218_AABFGU pan_h_Page_167.QC.jpg
c755085037080384466846c3790824a9
7e2f6310abcc50682532842d72f879b782b5ddf1
1051941 F20110218_AABFHJ pan_h_Page_093.jp2
feed55da521a7dc6524a8d1c7419c7ae
2962bdde2417d7b2fedef73e67a6259269bea49d
101967 F20110218_AABGLA pan_h_Page_160.jpg
2ba27bdff7f1d0eb7de31d404965bd4c
59ca2623c73097765a3d5eeaf62c92ccf08282a4
80121 F20110218_AABGKM pan_h_Page_135.jpg
f944ab6b9a2b84ad55b5db8163de705a
bc434bd4c99113d9f7021d1f6fd1e3e9d75fe2fd
66882 F20110218_AABGJX pan_h_Page_112.jpg
fb048573cd0491f8cf89caec0c5a2b84
f057f29792ecf7874d052b9b1a40021a0d18ce1b
1051979 F20110218_AABFGV pan_h_Page_168.jp2
a2d5c233d9fb5a53cd63d6ea442e5820
3d1494ff9cb5a7178aa749473fb73d9f3765cd08
1051954 F20110218_AABFHK pan_h_Page_085.jp2
55c5d1111bd41982820d34383d461522
9c96e0c7c5672f104087d77209d416e927fdd493
105458 F20110218_AABGLB pan_h_Page_163.jpg
e6bcccfaa3aeb8afe646da3b656e9bc3
bfe40e931a841c26508bf0378980e6a46412f4ab
77833 F20110218_AABGKN pan_h_Page_137.jpg
fe65dbe5ed6398d53c281cd3fd1a34a6
f518e6aab40008e3b86ee5f64c912650fad3a852
108655 F20110218_AABGJY pan_h_Page_114.jpg
f939e51c93027275f4170bfa2e7d3ab3
ee6a6bd439126c959a781ef7b7b75ff459c9ed94
2255 F20110218_AABFGW pan_h_Page_135.txt
2b162a8839daa8dc891605e4f61bfa51
7f0d7ec92582d722a0dc3d175665232f698a53ac
2042 F20110218_AABFHL pan_h_Page_121.txt
0c12bea813af01c6dcd198a82ef5b88d
d26fb67dc88b6c78e5fc0f14eb0fda771f883d0c
100042 F20110218_AABGLC pan_h_Page_164.jpg
69d116b0f04d060e4067902f4a63f3ef
cc1ad3c19a508f98eb4ba8e295f5cff5f62e2efd
76459 F20110218_AABGKO pan_h_Page_138.jpg
3ca8f34d4ae6f8217f0f4cbb17241d58
308df8018446d349ce1b43ffd034c1c69e451adf
105558 F20110218_AABGJZ pan_h_Page_115.jpg
7fc3443b66933231eacb3a39b60d1902
54c5b7dd0a953466add60117313c4513d4d3ae5c
2836 F20110218_AABFGX pan_h_Page_195.txt
e1e750c58448a65405324f6b43af5116
6357b1e1184828b0fbbfa74cbc343762ba9b8af4
1013167 F20110218_AABFIA pan_h_Page_111.jp2
d52d049d5287d8e495596c162f0bc682
124367cee81a5e2c3e5fc7f1e048fff60bf918a1
106399 F20110218_AABFHM pan_h_Page_077.jpg
db1bf6a7bcdf8df3122d73a9e48a0fc7
5ac3c12540482b453a23abcdbfc6d2704462a875
104796 F20110218_AABGLD pan_h_Page_165.jpg
7b1f2efef4e56304b7c82166f817dbff
c9a935a84cfa330b0173c69f3a1a2e8ede79dc18
61643 F20110218_AABGKP pan_h_Page_140.jpg
1aeedf4bbc39289532460b199cc1e6a6
a0b3357db029047dae2f133022f53393e5fa6e21
28799 F20110218_AABFGY pan_h_Page_097.QC.jpg
dc581557aa2c426bd3bf3ce33d500904
227b7bf70f69b0fbf077ecd7974e20dc9e0b6b7c
913049 F20110218_AABFIB pan_h_Page_105.jp2
e07b181a446c794c66081aa28710b230
12a83458665dcd46e7da9383a62dad447822defb
48949 F20110218_AABFHN pan_h_Page_164.pro
a3c4f3bf63dc7ef4ffad9a165403f869
8e689316b9df9b34a6895d3728d388647a3eb34e
104999 F20110218_AABGLE pan_h_Page_166.jpg
f53b38c49d142dbd883e4f651666030a
0df758577679a67cbf965574197fa2380068a7dd
88042 F20110218_AABGKQ pan_h_Page_142.jpg
030f4c2f148c2ca9e64a0e8f71d5fafa
4bdf02bd48d3e086b3675160e8faddfcaa7a7759
51355 F20110218_AABFGZ pan_h_Page_047.pro
7148494e12f496068b5aeb87dcda542d
00ad95afc88da76a1d6a1263fef51387069c6d38
2852 F20110218_AABFIC pan_h_Page_209.txt
edc88d48a04343150bb125dfc6d68173
b4d92985146a2e0571c58bc322a0dd87dce5504e
2838 F20110218_AABFHO pan_h_Page_196.txt
dd4565ba19104de121647a715cf47d1f
986ae073c35ba9bad187c03760fa595c7212142a
103752 F20110218_AABGLF pan_h_Page_167.jpg
5dcc7b65aab171127cd6081cba467710
a929a06c20cab4936c84ab01d1111b42483710e5
80552 F20110218_AABGKR pan_h_Page_143.jpg
00487955f30814da84e6bd1b5ca8dc1a
81c5a5f7023f166c08b873f0a6e75108ff4eda0b
2024 F20110218_AABFID pan_h_Page_047.txt
c3a11d2aec6d50500595d14468a626d4
bcaf6d249cc3cee3a2abd4c10c6868672625b446
34015 F20110218_AABFHP pan_h_Page_116.QC.jpg
3aaa4a9d810df26f3957a28b5d9759f6
a285f88a995127f8f1c202c30db5b5ee415165ba
107912 F20110218_AABGLG pan_h_Page_169.jpg
66268fa827c2fa7dd51511dd58eed860
1e4e90dc3a3a20f4191bfef4a14f239a8a5e7582
79164 F20110218_AABGKS pan_h_Page_145.jpg
c1980e08aac7fb45e95af1bc92a74bd3
55585bd8e6226d81368003e8a9c223eececb961b
1051946 F20110218_AABFIE pan_h_Page_200.jp2
73b5f81082dc920cf1e3b6a03e68634e
ff5948b473d7d2d65405206b4e12d560c093be11
53162 F20110218_AABFHQ pan_h_Page_021.pro
f3632c2f7ea2401c5d49da53e41b40f0
e600dd7c5212f4a64feafc12f07219276b9b82f5
35577 F20110218_AABGLH pan_h_Page_171.jpg
748ed1fa59778b60f037c02b82cd0c7f
b08f11139c784c74bc4ba5aaf7a2e274fcbe7f62
956627 F20110218_AABFIF pan_h_Page_157.jp2
67978413d231889c7c2429255e66b1e6
df8b30154a476e02bd8761724a5d9054e02be8b8
70426 F20110218_AABGLI pan_h_Page_172.jpg
ce0e56b45ca9026f8e6bf44bf9ce5d9b
da400078485c31477846769d31788cc03f1d997a
109539 F20110218_AABGKT pan_h_Page_146.jpg
411a23255928e1f38d347d6e91fafe63
15c68264f8761e49e09c9f3d264763ccf3b8e6cc
48042 F20110218_AABFIG pan_h_Page_048.pro
db5fd2837b080e89c0b4bc4520a8c187
5780d9d60233f4ad98366f9ff5be35cb7d225953
F20110218_AABFHR pan_h_Page_056.tif
e5f557de429368377c90f2f69275c219
89093e26c4bebe3ba92573d761f8818e6b48c817
80015 F20110218_AABGLJ pan_h_Page_173.jpg
0c721198ef3e37834ea31e3c647155ec
5499df33605a7689997bd19731724659f0aa59fb
80693 F20110218_AABGKU pan_h_Page_147.jpg
b9bb7ca9182b7e924cca09cafc7d0961
2bf39497bc14818005a398de58a5adb37ae97ef7
26278 F20110218_AABFIH pan_h_Page_147.QC.jpg
1f7969116b1b5b9993e717eacc157612
99dfb4e51e9904322979172fe6f754d3df085f78
7202 F20110218_AABFHS pan_h_Page_147thm.jpg
e545a4ee46424f529ad220e574e4dd6e
84e5b4b129c8353c506b0ef6a6db88a8ecd5e37b
37412 F20110218_AABGLK pan_h_Page_175.jpg
d2bbddc7887c8442486109e43d84cfa5
35d2191b72401adbc48f2178a0f8be73fe7461a2
104695 F20110218_AABGKV pan_h_Page_150.jpg
2e529b233de820070fdf83fc6424a626
214d635ce0238db4818afab64062590e81d4a30a
F20110218_AABFII pan_h_Page_052.tif
73fdc08bd2e3cdc98a43c91977716217
3cbfaeacd946d9f45840d3626790268bafb64f98
F20110218_AABFHT pan_h_Page_167.tif
6f01ce1351c1444a2cdd7ba87c13dbb4
20090997d895ac5fa247a22c62c94cf32b88f7e6
129861 F20110218_AABGLL pan_h_Page_179.jpg
5ee2a5287f59e0aa6ba07a53f01eb78f
36a9c50600879c33cbd8185d518facbe8672dfdf
44809 F20110218_AABGKW pan_h_Page_152.jpg
3932e560fef5fa4c932b4a6e8037ce0e
0ce08a919bc315539b56e0de45da498c5aa25ab0
137226 F20110218_AABFIJ pan_h_Page_191.jpg
d2d99f1c5063209ab2280eb54d2b5030
f9e1d173a1e0fc1b6dbf0e3f23bee86b237ecb0f
24777 F20110218_AABFHU pan_h_Page_029.pro
549e928148fc8eca86312360f5eb94be
4831c400f6b43151a61ce081f1655f29f0ac8f66
130212 F20110218_AABGMA pan_h_Page_204.jpg
a37bfdff4547c24f94cec0bbf2e7f60f
43d2cc3e261a9023572ff42c8ed4b8f5f41734ff
120560 F20110218_AABGLM pan_h_Page_180.jpg
bab15addc3abd373c9886d284f039f6b
fcc1ac3af6dd2603b526e4275f82abc602caa3ad
101550 F20110218_AABGKX pan_h_Page_154.jpg
1cdb3f0b70fb9e2e5320c0ca8461e958
56514190938fc1fd78d54349595b1a7557127342
1051960 F20110218_AABFIK pan_h_Page_185.jp2
c681a6ecb032290a2bb5c1da2bf12d0b
fb01128b982912560a2c311ef8a7a642ca55fe67
8073 F20110218_AABFHV pan_h_Page_040thm.jpg
0b51683b8974eac8d68b74467d919ad1
f1b40d6b966fd2e4861e54370650f9dc31abb5ec
132205 F20110218_AABGMB pan_h_Page_205.jpg
ca3f883c1b386cb4fc12b905b02502be
2cdde4eb3f39663a4d48bbe3cb388ac138bf72b8
136315 F20110218_AABGLN pan_h_Page_182.jpg
39f9acb296637009950307f7026d55ff
114fd85f82376f89ef0a480dd9b0b35ef00c2a88
81621 F20110218_AABGKY pan_h_Page_155.jpg
1a6f2e27e1205da279e197ec14f7aead
d11efd11a975eec42592d0870ca979bc371140e9
8564 F20110218_AABFIL pan_h_Page_068thm.jpg
d9b16787954fd9424710adde3078ea37
8017e57d37050af7d776d70e88b3d7059a79ac17
1051919 F20110218_AABFHW pan_h_Page_115.jp2
c7f6d01177135aabb2c92236916bda87
47c39535996d0bf83f7fe1b367d2ea19e62f4d91
127133 F20110218_AABGMC pan_h_Page_206.jpg
a804c10b1da9d2b2d7dd26af35f27934
af6dea4d92592cb8ea86d1e544bc2767a570bdf2
144611 F20110218_AABGLO pan_h_Page_184.jpg
d211af09affb69048a8972cac47d09c5
2c16bd84aa3d11a988b46979588ad98917fdbf5a
102573 F20110218_AABGKZ pan_h_Page_158.jpg
dd59abf2a3bd6321a6c176a555a52c0e
8ef22a6c841e0bc9d0be056e81bb0498ed4f2c5b
844139 F20110218_AABFJA pan_h_Page_089.jp2
92b938b6e2e686eb94db59afb8da6680
35e419c373a0305a67a267fc18b21092d7021a74
47941 F20110218_AABFIM pan_h_Page_044.pro
652e35f0b546c34a0814cdd1ef9f2620
5aaec78d4b89bfb895d22717457002e5250e7c22
F20110218_AABFHX pan_h_Page_012.tif
41ac229efbe5194255b1719de6ac3ad0
e4652637a0b60a7c11d8dc1d5e0c4d2c95fa206a
130190 F20110218_AABGMD pan_h_Page_211.jpg
d226fbde16640da425932c07b345c15c
9df2fbc7e9f36e47ef04f88606a3ca1ef5b94491
142620 F20110218_AABGLP pan_h_Page_187.jpg
e304cf049c05d1fba0f18bd2c823fb6a
521f3bb769004c6b4ffe8333ce1272d946487c5c
604 F20110218_AABFJB pan_h_Page_152.txt
3b850f33ceef762d22f4d3fb77875146
11bc67b307df9d9815564657fab9f1d983fcb55b
102976 F20110218_AABFIN pan_h_Page_170.jpg
5fb0e405fe55882a7c8e76b2533c3c5d
8ccd0f4c8894187ba8d3403743e0439f5c49c0cf
28977 F20110218_AABFHY pan_h_Page_074.QC.jpg
2a43486e48078bb74020cddd85468ee7
3159ab850cadaa5e000997a3f32687b6cfef67b8
231105 F20110218_AABGME pan_h_Page_001.jp2
b0c3e189826bbb875a4d522cae6b09b3
352c8b4e4061169048ccdfe39de61dfdf327d0f3
137145 F20110218_AABGLQ pan_h_Page_188.jpg
b7549beebbdcc1c78d538e94ac3aba32
8771fc586ef8411f61cd874b2f96bbf96b8e84fb
103092 F20110218_AABFJC pan_h_Page_124.jpg
4aa564f7e42aa4fac38ac7a4fb035fb3
3bc93a34751c2da3ea708e467543b3d8e247e937
60819 F20110218_AABFIO pan_h_Page_201.pro
6fdefa80ecf79624ab29718bd918602a
4b50c9d97f9a15d8d2a39f40f8cc699b6fd094e9
1051959 F20110218_AABFHZ pan_h_Page_066.jp2
a7048b30ab794867baa00654f9ea0116
1cd5f7b2e9992a3b726a414bbbfed16e4225f300
22148 F20110218_AABGMF pan_h_Page_002.jp2
3d05ba67836078e22e06e3bbcdf1c587
d566f1d2255ec4b6ff493b72a10f0ae25867e0dc
141934 F20110218_AABGLR pan_h_Page_190.jpg
1dbf3c1c5804e3d3bd034ce723b13d07
8719570d2b800df18abfa023e7d82be4875501b1
F20110218_AABFJD pan_h_Page_041.tif
890abb91af5c614fd72ffac0521172b1
9f341a194dae7c0ec12a77a7f49a490b187c2e0a
52360 F20110218_AABFIP pan_h_Page_095.pro
96935e3ca5e8991c015d52d67ffde548
e35fce23a9f9cf33969fdc4163f2dca67087f8f0
912314 F20110218_AABGMG pan_h_Page_004.jp2
8205cf8587825f7cf9218ca7d4862c16
97de04bfee259a0312212b77f1d0f28748e7f76f
139922 F20110218_AABGLS pan_h_Page_192.jpg
b1d2fa7b6723519f869ee88e60932166
c212a433ad5c067a360f08ffc528a1f1cf248ccd
47766 F20110218_AABFIQ pan_h_Page_062.pro
a7c92ed410d93a32915044f79b29f914
49eae97557c6239054dbb3a5bb9287cf55cbc0c9
128066 F20110218_AABFJE pan_h_Page_207.jpg
b81ba99499e16dc65f676b0468ee880a
8bf78aeed599108a14952bf265250f746d2e02ac
305239 F20110218_AABGMH pan_h_Page_005.jp2
a952debd52bcd7b8a7b0e6b6560e4c0a
6077551e7571de6a7e465d23b3bdfd5dc5590579
133906 F20110218_AABGLT pan_h_Page_193.jpg
039f868e39e38f0cb93b35a91e1e7423
026576f9e758c0014958597d635d633942664b85
51354 F20110218_AABFIR pan_h_Page_159.pro
6d35449f7b98d2eeb32605470a6011cb
956aeb3f64433cc3c41c00b7ca41a869db8c7055
1014454 F20110218_AABFJF pan_h_Page_153.jp2
d92576091c9e368afdad4a14dee5d5f4
2316cfe5554eb64e24185e6770e6b434d6222b67
66339 F20110218_AABGMI pan_h_Page_009.jp2
b27446b6d5f380c63552f7f263fa9f8e
819cfdefdd947bf435ce69da2c8cc57a138e7650
104188 F20110218_AABFJG pan_h_Page_059.jpg
2487bc06ab525d0531f9bf8f26c07398
78d475d44ab86d3044d248820ad204f2e32628c4
318176 F20110218_AABGMJ pan_h_Page_010.jp2
bd7604d3121b493e65a3f4488aba0d80
98f497dbe752e94b83dfc8a90daf409a00b31cbf
140360 F20110218_AABGLU pan_h_Page_195.jpg
3af5e9e095e6bee78d1a6b16508345cd
ea7364e3887dfd97e049859cb0c0ff30da43687c
1583 F20110218_AABFIS pan_h_Page_027.txt
3e4c56160e020a9700ed67953ed51230
3f4f15a512354f9a58145206d20075ea8c0c0871
90269 F20110218_AABFJH pan_h_Page_022.jpg
171d3878fb43b32f5b009538032e5274
c3df83db94b5f8e3a726316b5ffa87c3a6fb4e57
1023640 F20110218_AABGMK pan_h_Page_012.jp2
daf0344bd41b187e5421b246084a0851
1f3fa9eb1c0cdb9fa714f35f386a9de32b11e027
133147 F20110218_AABGLV pan_h_Page_196.jpg
21510899d280b40739403db73a971fe7
956262de06633051d03e4b8b83169e5e02bad62c
F20110218_AABFIT pan_h_Page_029.tif
b2a03992d2db8364572fa28be37b368b
d2a52983eb915244e3e666184750c23938263d56
35039 F20110218_AABFJI pan_h_Page_169.QC.jpg
054bb7142b41874e9caa661d53d7f6ad
3187c46e79ded5b56f235d9a5b87d56a3efd21e5
1051978 F20110218_AABGML pan_h_Page_013.jp2
8b6661cdb11fd5521349491fef9d1149
55f4843e269d898db2ca541f92610646346de9a3
135167 F20110218_AABGLW pan_h_Page_197.jpg
e04b37044ed1dafc896fd6bf73275628
d2a815f57c252ebb15875717ddf38722b21d3ccd
7740 F20110218_AABFIU pan_h_Page_104thm.jpg
fdfc10b6e4a01d95cfe5c5ccb0b7c9ae
e5e869fa4dc4a1cb92ea6e1089c39d0d4b09de6d
6311 F20110218_AABFJJ pan_h_Page_141thm.jpg
4ac8646269e78d4b6f47f28dfd478c15
dab0a8f1f64e5aebe07e909ae0007b99a00437b0
1051971 F20110218_AABGNA pan_h_Page_045.jp2
e6945b8c1c4e4410f013300c60c3f23d
81c835876f8f48ab135bb7a13e433e4814bc5089
894111 F20110218_AABGMM pan_h_Page_015.jp2
975c547988a05d8741791476a55b27cf
76a095010be983cf1d056309792bd1021c879d13
142473 F20110218_AABGLX pan_h_Page_198.jpg
78efb7ca6b46c8e838be93136dd95a88
c431d8a1ba1e021f0ee06ae57d084a9698f51f7d
8265 F20110218_AABFIV pan_h_Page_069thm.jpg
b4dd743c0880ae31e1cfb30cbd396d31
2468c9482f53addd414827aa2383a3b5711030f1
50998 F20110218_AABFJK pan_h_Page_053.pro
6582425a1f804d2de146bcf1f458814f
4df1c6c0c75f6ff03ba5d46fce6dc575beaa353e
1051982 F20110218_AABGNB pan_h_Page_047.jp2
eb87ce7f06a762ec200a9ba68ba3b0ae
2144ba1d61729192a2efee3fadd233e66c6cf47c
945764 F20110218_AABGMN pan_h_Page_017.jp2
f789e8db447b55ec76c992fc0057499e
fccb0c5496653274deeac3462d52078852bea886
128732 F20110218_AABGLY pan_h_Page_200.jpg
b448e160d7cd324ceb3e8c24c906d1c5
445735ff01cbd308eb78ec446fdcccae6f2b523f
237054 F20110218_AABFIW pan_h_Page_213.jp2
b0faa13b8b56ad0db486fcc841e98480
59572560cf046357cc38e4177617d91ad1ccb336
F20110218_AABFJL pan_h_Page_050.tif
23ec4e1797b3196ab33b8707fad24543
664a78772537acb5fa06d927cd6d312e13cfabec
566124 F20110218_AABGNC pan_h_Page_049.jp2
1cdb6d956b975ec976a2d504210f1ff9
01f0235d14077b9098c96f18583898d500cafe83
990152 F20110218_AABGMO pan_h_Page_022.jp2
6c63203a7e6b3750c08e7012630965bd
417c9766b6b8c5ef5bf5675c9548a61105922849
126029 F20110218_AABGLZ pan_h_Page_201.jpg
9295cde7a80c2d6361e91be82393ad70
681bff1081ef5b55cd071577fd5126a289899751
74121 F20110218_AABFIX pan_h_Page_055.jpg
1bf3855d276c9e91ca0691875bbe18c6
3a766b5c04f407b23ad5d60b956169689076eb6f
105246 F20110218_AABFKA pan_h_Page_064.jpg
7564110bab33eff33501984d7696891c
70290d1bcb3d2f61bd8739fb67c47f5f75b8d29e
141049 F20110218_AABFJM pan_h_Page_189.jpg
8bd1eac066f41bd9f12904a8d6fc274a
3f29ce3c01573e5dee8e48f8f3620269fb10f960
F20110218_AABGND pan_h_Page_050.jp2
3c922b22e9e3a5664f9046b84bab92bc
adf6d60979f8c43308e32e11733fe6e948973f17
1051967 F20110218_AABGMP pan_h_Page_024.jp2
c240631247185f6a05ca5aec67acfab2
7ded50dbac30411bd4f97a0f829f9848e72a2134
2641 F20110218_AABFIY pan_h_Page_207.txt
7734699ec54ce53b3d418c9eb600f9f8
d3df0f791ff1c4292b41664327831b905b360494
31865 F20110218_AABFKB pan_h_Page_101.QC.jpg
07a5dd08a8191be58c4adee48408e2c9
34f49004a4a1fe82b6c980cd43b6719c90d7f1fd
73366 F20110218_AABFJN pan_h_Page_189.pro
7e3b19abfcb5a0f8c5fcfcf5e69af156
c59f62ef86b20d4a5b7579f91b0d9b4f1626e441
F20110218_AABGNE pan_h_Page_052.jp2
098c7d8e602114a04f5504c05341e237
3ce874b72576cc6bfc559abcd01154a6510fe3ca
1010749 F20110218_AABGMQ pan_h_Page_026.jp2
3e60750a00fff87dfd8bbe21308ba7e7
19d53c0fb6e746710fe842b4f6e7ebffc38ca763
103345 F20110218_AABFIZ pan_h_Page_122.jpg
a778fc394f4c1f05bddca1f0d822dc52
c485c10414f61a8d00cf835b565a029ac38826c5
F20110218_AABFKC pan_h_Page_204.tif
99620e9bd03926a13bf97d59212338c2
ce75039cc794e2a4bab901255ce39e142ce50f46
83022 F20110218_AABFJO pan_h_Page_015.jpg
69dab468fd1c92cb52ce9df90a346596
21293db2fdcb66097364e7c14bb9f81961dd2f55
1051921 F20110218_AABGNF pan_h_Page_053.jp2
407b912e5fe2d56276aab2e389c2eff3
02b630a8244ea4aaff71fee511efb96abde839b5
1051958 F20110218_AABGMR pan_h_Page_027.jp2
42f20ca614a7919e277de681aa0f8a90
2cc617f2714f0a76a998063d822d3d86239fc323
141713 F20110218_AABFKD pan_h_Page_209.jpg
d76ede1bac32c93f1a6fddd708bd394b
bbf5ea8a688c30e01650d222de920003410f2f10
1051976 F20110218_AABFJP pan_h_Page_019.jp2
397b99c294481f0fb169e93fa22e1902
59cac386010814910747d5549213bb93e8645d3d
759846 F20110218_AABGNG pan_h_Page_055.jp2
699c56e0ea9236d1bd5e0da2254febbb
b2de438b5b5a0455115b89827c49722d0eaca536
1051974 F20110218_AABGMS pan_h_Page_028.jp2
e92f972ced111b12cbc71adec069a29e
0f26e146094e81ca70de5ab0a559e30c9a223924
1051922 F20110218_AABFKE pan_h_Page_063.jp2
485c0940d625499c8885d4c9cd0a003a
d3548ff04349fe74f3123b5a09cfdf34e8d1a44f
F20110218_AABFJQ pan_h_Page_087.tif
4049c8179c902359990b579b0b31e80f
19253ce1e370b39fa64556fdb3cd0743bd681a13
1051985 F20110218_AABGNH pan_h_Page_057.jp2
cace19a1b632509dd78846bed0b22e1b
9a6bc1cfcfef8760a095eaa0107079dd8215022e
783726 F20110218_AABGMT pan_h_Page_030.jp2
6d6600524e491bb066c66f8717759db6
7c116eec174ec09b9d9ca7459e93db25476e1701
8945 F20110218_AABFKF pan_h_Page_199thm.jpg
3ac00914b45392276c847e296bc992df
b96b5f7256af20455796edc2eba557c3804a48a4
F20110218_AABFJR pan_h_Page_120.tif
a160f5973fdd4eff851e0b189c48ad4c
832baab5ec0d71327e3599f3a2b9204616a5b6ba
1051931 F20110218_AABGNI pan_h_Page_060.jp2
c26b67fc369d709ef2440911996a3fd2
beda4609438caa9b802a5e1a8c44011af3bfc082
960538 F20110218_AABGMU pan_h_Page_031.jp2
12d92a69365d09a3457c4c4789d85350
62f83a6920fb62d0a814ed78446a7d8ac1c910a4
42673 F20110218_AABFKG pan_h_Page_173.pro
e8e9a50a20c929973a8202b50811f2b2
47b96669338a0593b48270a35c035ecfdb91b6da
2005 F20110218_AABFJS pan_h_Page_124.txt
da692f0f3e429aecd463294461843c82
b2a606ddee8e648b05920aa2e514131efa82a055
F20110218_AABGNJ pan_h_Page_061.jp2
fbdee40ad2e21c76c19134a1d18ff580
1c19f656c867092c6c76c1e22e3b31fc7dd68d6d
1292 F20110218_AABFKH pan_h_Page_137.txt
7940cd616d5d2727325738eed2baed3c
fe3d12b5eeff44f682be6b6b63bd7a475b5e8fdb
1051956 F20110218_AABGNK pan_h_Page_062.jp2
6d465f44dd41d12a01b574d474480f41
79895ca27b050bcef86b99f70323307395063a55
851694 F20110218_AABGMV pan_h_Page_034.jp2
2c899609067a76d09cfa5017c76ae4a9
33a03e6df06010e55922bfd150ce97320d773bf5
F20110218_AABFKI pan_h_Page_145.tif
35bbd1de774e61925f558047c5166d62
10eb9848d1d09351878e8baea254388f12c8b800
36352 F20110218_AABFJT pan_h_Page_083.pro
84a4bfd3ebefb42832ce8cc69bd68242
85bb013b6148c8ea133e146f865c86a6363fbc50
1051955 F20110218_AABGNL pan_h_Page_064.jp2
96cf48fbbddd3ed57ada00d4951766c1
2dfdc6dce9be6a7a7e325d6f9c9721ff99a380b8
1051981 F20110218_AABGMW pan_h_Page_037.jp2
62497be03572baa91c43b915ac228e4f
24ab43614af12508d5df1846daf491c3834ba721
7981 F20110218_AABFKJ pan_h_Page_028thm.jpg
f6bcd7c73441ec7f361c0e6274fd328f
64141fa06ec4c968364c83db0283cf30674673b7
75670 F20110218_AABFJU pan_h_Page_149.jpg
ad159de3c71f8b9ed71c025636c664fa
bddacce226f6d92b2524a02587211e6f92dd1ccb
1051932 F20110218_AABGOA pan_h_Page_096.jp2
750b9680c30ff60b1866b9a575bab815
57eb8320edc33bf7e525a9c1f03fa03f2bd595ef
954842 F20110218_AABGNM pan_h_Page_069.jp2
e51ed534e35cf192857e6b3780224c0b
44c3d3ea6935b0b86d9b30aa08537dd2b725a474
F20110218_AABGMX pan_h_Page_038.jp2
dfff3c460c31082c32ca2042485c9634
77e681adcdf451220fb7e2d39e58b80862136c59
6424 F20110218_AABFKK pan_h_Page_009.pro
c30e71b4ee69238ec2bdcfbb0ef874c4
b8914776bc79ab67803a10ba52444230fa1329c4
102800 F20110218_AABFJV pan_h_Page_136.jpg
b4582febbd6e023e66f02921b91ce577
3e198f3daa519d129e16172a2329e95d13c470c7
1015169 F20110218_AABGOB pan_h_Page_097.jp2
1f2dad5a8fc4c7e78e241e0676b04025
9a0fe994445834a006858e77d24817abb12c4ace
F20110218_AABGNN pan_h_Page_070.jp2
b83fd52b3e0aad263313852ccad13edc
f055c7e21461e5ed7e6303959ee94d40eeb056ed
1051938 F20110218_AABGMY pan_h_Page_041.jp2
278455836ae3edd95251c8b3a552af7a
d6fa8034b68a27ad13a849167e38e079999f326e
49033 F20110218_AABFKL pan_h_Page_150.pro
0f2c9d0fece698e335a5f7d62aa6fb6c
595126ff62202d593d7ffce49cabb7909b821e43
35985 F20110218_AABFJW pan_h_Page_197.QC.jpg
ca3de66a19d36ebce32fe6ee71b38b2b
648de8cddd68e6a6aa67fd8f644c119bf4852916
1051969 F20110218_AABGOC pan_h_Page_098.jp2
65577474a9f1b6c581897e82ba0744b1
58a05ab303e02dd3fe055f5e8615f70ec7d3d112
1051943 F20110218_AABGNO pan_h_Page_071.jp2
c40a691f592556da8f9d13caa24b343d
605648886f5544ba93064451e2ab4d5fcd168ba5
1051973 F20110218_AABGMZ pan_h_Page_042.jp2
86360fad1e54cbbfccc1278223e2517c
3d292dd6fae8a55782da67abffcc15a8d4e9c840
2682 F20110218_AABFLA pan_h_Page_204.txt
3ed2da95c09f98e14b1b4c46f372b19a
8a0b63ba3f294a4ae950a934315db0b3362dadad
F20110218_AABFKM pan_h_Page_075.jp2
8402f9f4bbf6e3ecf303716094288242
82219e6bb96cc75e0e91a9330b60bc5c7d519420
48676 F20110218_AABFJX pan_h_Page_045.pro
b21d267cf10efd9c368b9aba3b4c920d
b393c716109c5547eda38529ca3731ecaaf74880
604593 F20110218_AABGOD pan_h_Page_099.jp2
f5dc03c2dcfdc30d9590d4731b417dde
018695727befa086598d0437e6de101197e409e7
1051961 F20110218_AABGNP pan_h_Page_072.jp2
33d10a2b889669f643a549757a201b96
578f72aacbe82cf84676d5a71742335e1449a223
25755 F20110218_AABFLB pan_h_Page_015.QC.jpg
b46735ad0b704c2ff5dc2098ed23cb00
a34bf8f07a6d004ba16ddd31b6949722ea6f6b80
2964 F20110218_AABFKN pan_h_Page_189.txt
03718c0e80e8f29c33a983a5331be564
8800071bde69c1b7a8d1a01c51e914ad8d456c3a
F20110218_AABFJY pan_h_Page_179.tif
53d857caa92ffa17a55e8e1545572cab
39a50d30be7e23a496c213ed43111375a1ec3e31
877981 F20110218_AABGOE pan_h_Page_100.jp2
28505c6eab14ecaa0ba5e607b75c9b08
9ceecb501297624b3fd052768c65eb8c482c61ca
947631 F20110218_AABGNQ pan_h_Page_074.jp2
a5381b6aa6d0cc06d5d658e5ceddd203
6c643b83902d90533c143e2c4fe6e57f0dfaec21
F20110218_AABFLC pan_h_Page_098.tif
511d56f4a9bcc0e4ddb4cb1960c73047
37cd455d1bc881ebe5b3a87b3a092dab73acd1c3
8395 F20110218_AABFKO pan_h_Page_056thm.jpg
cdcf7379100d57681972618b831c4d5c
8de3605a6b5267eae8e883529708f214d2e4f0c0
105273 F20110218_AABFJZ pan_h_Page_095.jpg
cd64a118b07e8382bcd61e57132b7491
35fe195e7bf68e4268a0be2edb5f5b736e1a05c8
979748 F20110218_AABGOF pan_h_Page_101.jp2
6bb753ed56b2193891f24699139036e6
683f250c53df226c9db0a22ce0cc62f577078f2b
F20110218_AABGNR pan_h_Page_077.jp2
9b80910bdcc59732a5ef565d39400a39
b674bc86eec8369b4e96a47ad22fffe634cd59d8
85768 F20110218_AABFLD pan_h_Page_074.jpg
39e5979ceb4401de680da61849c170de
22a4849c36b5864a395eb61bd8886a225ae79263
35168 F20110218_AABFKP pan_h_Page_146.QC.jpg
4c971da18f6df70cc3c5d8946203a302
0085de81b89e0f2c96a124fe27d472d4aab286d3
1027567 F20110218_AABGOG pan_h_Page_102.jp2
a339833b51ea86bfb5b5fd273bafcdd7
03be1c99c42afa17c5de3ab9ba572944b345006c
824971 F20110218_AABGNS pan_h_Page_083.jp2
2c9505555122925252b05d79f8aa918b
ecd98bcf430d5215bae7b91564a1bec7bb7581c2
8243 F20110218_AABFLE pan_h_Page_163thm.jpg
2010cdcd5bf9d431519451bd97269980
55982870703b07586a05b7c812272c7c1cfb3761
F20110218_AABFKQ pan_h_Page_076.tif
606a4d942d5db023ffdc3fbda1cde1e2
522c18f5e2777b7168e9cf0bec3e687ad83b29fb
890087 F20110218_AABGOH pan_h_Page_103.jp2
210bf02767c8826a89c1e0e7b4f0d2cd
cf391a8f003756713189693209a10a3b442ead97
556598 F20110218_AABGNT pan_h_Page_084.jp2
e24242d09cf02d6bfa8772f83200b5b9
3d886fcffe44a6eb5a91b2c929e3943e29742952
646 F20110218_AABFLF pan_h_Page_049.txt
f2226e2a54577e629e76e1052a5d8c2d
7488936da4856fbb0e0a053b9adc3fdb7453d584
F20110218_AABFKR pan_h_Page_017.tif
79484ba6a2d140ea166f89ecfd517df5
355a95b76dfef8ad2948835fbc85265c854d2671
F20110218_AABGOI pan_h_Page_107.jp2
b7885f48ef5c4d1713e5baab4e0926f8
e2fc78beea3d56bd4919f0ece59b4c119ce55b90
1051918 F20110218_AABGNU pan_h_Page_087.jp2
29b5cf6e494915b581b81d686ab0efba
2d52d4ec44053a954dda319688563e5c5196c7a0
8322 F20110218_AABFLG pan_h_Page_119thm.jpg
3e176990842264738f47ce2b66b2996c
61ebea1523d339a8d2f460af7cc04c20f976f624
1051895 F20110218_AABFKS pan_h_Page_129.jp2
bc4649c793758e28ac9c0a87b8ff9d6f
5a5bb7efd16aeb3ffb2faddd867cf226151961c6
F20110218_AABGOJ pan_h_Page_109.jp2
9aa1e174249ce156506ea345ded8c754
63dea8401e5914b64030d64fa1210c4aee0e3654
F20110218_AABGNV pan_h_Page_090.jp2
9b2628ac86513a9004184f7c9e6b761d
4008455ec788f02187f354f117d08c4e8d5ba353
F20110218_AABFLH pan_h_Page_211.jp2
09b13fdc97a36e57ae9082a19068aaf9
3ca4be7aed266fcc2e41631a05d921c39502d0ab
901238 F20110218_AABFKT pan_h_Page_081.jp2
2aeb53bc103d10d60d8bfb3aa7aff7e3
55cfdfbfee0c73a2a0bab06b0bd61017d401ecc0
F20110218_AABGOK pan_h_Page_113.jp2
f622c86e619eaf8837e928e645f3eea5
09c7b9d6d46532e5db9c18cd2187d5e44271ad86
87221 F20110218_AABFLI pan_h_Page_019.jpg
02158b43dfab730feb98175b436e640d
aa9bd2c8960bd6f945ec53efc8b0e563d4ce6f8b
1051966 F20110218_AABGOL pan_h_Page_114.jp2
a6465e8186a922eca1f7d98f3357ef9d
d1c36434fcbf9977c02c03457fb4848568e11065
F20110218_AABGNW pan_h_Page_091.jp2
921cfcb179c144029536dc31e18462f2
7a0be180cfc36f67633e23beb4977ed989e41844
8858 F20110218_AABFLJ pan_h_Page_205thm.jpg
c85c58b9eda33b3b9882dc2f1c6787dd
5470ffae6dee1b3590289323d89f8e0adfb283b3
37688 F20110218_AABFKU pan_h_Page_212.jpg
726ad2dd8ff22a9e7e88c2eff18ad36f
f2f2ee4ab339e7ee0f134a8924d4a6f1afa926eb
1051925 F20110218_AABGPA pan_h_Page_139.jp2
3c024c78cc6fc034343ec8762b8bc8ae
872c8e65be55f89a669f74bf87cdf37e16701e52
F20110218_AABGOM pan_h_Page_116.jp2
ce29345f0af062483df8a6a3afe1f881
24f026ccfa071c7e1af852bc8afe19d9f35a49b9
F20110218_AABGNX pan_h_Page_092.jp2
c0feae7e577db7efa4ede733881fc50a
526959398c00af7e176ebb8886c630315476130d
8767 F20110218_AABFLK pan_h_Page_187thm.jpg
886c8cba66f86c5d87ec753df404e229
fd846403b3f2fad89320106577a843a0e25e8b4a
24712 F20110218_AABFKV pan_h_Page_213.jpg
73dd33e2b93d7d0f39e748fbcb636ea5
88cf7d20b71cc5b1c025a26cd6c4a2300271335b
545893 F20110218_AABGPB pan_h_Page_140.jp2
f1543105e17af9a0474febcbf94286df
786fcd8a338d5c7f373e62903239738226a63d82
1051963 F20110218_AABGON pan_h_Page_117.jp2
a60f1e4d6589c0804ab2d715337fdf9b
434dd631526bdb094176b569dbedf8e21468d276
1051927 F20110218_AABGNY pan_h_Page_094.jp2
9822515822e2c66d4cfee7a91c7aadb8
e47c8a6a14782ce0a4a295d23b70ef32bd95d94b
1446 F20110218_AABFLL pan_h_Page_067.txt
191ee44127cd701651aeca31bf6b706b
f010eaa01559ae0521f8c5ed2e8ba6c398bee0c7
97392 F20110218_AABFKW pan_h_Page_176.jpg
e5919c37568e94fffd4df4536c8fc09d
0d8c5277b07af6c9da5f8676d8e0948b4af69bef
952808 F20110218_AABGPC pan_h_Page_143.jp2
5c817a13fafe1f4a23ace05201fc2e38
117c6be60fd071dbca85cb8a6e0bcf5100d92426
1051929 F20110218_AABGOO pan_h_Page_118.jp2
0b6ee6032bb8f0ae899e63cc25fbcccd
ea3af57f9dbbaf4206616ef985133a067e3324ae
F20110218_AABGNZ pan_h_Page_095.jp2
46cd92176816e0e960a8aa41063042b1
af3a64eb675f6f5ca3a1c12dffa1f2c1fb28a2ad
34278 F20110218_AABFLM pan_h_Page_096.QC.jpg
346e465e24cc90240d8faacdf728aeb8
613b82ffb8b093058c485f9138a4b07c5be804dd
1051984 F20110218_AABFKX pan_h_Page_082.jp2
b785d51c5a71711d5e8ebacc1e08f15b
9d97cc0b28019e4757e32fb905c3499aed2049fd
103648 F20110218_AABFMA pan_h_Page_061.jpg
42fb7e61bf6f8df64a67057610e884bf
a89edd39c8c860d4344dd1abe66f5626530536c1
1006222 F20110218_AABGPD pan_h_Page_144.jp2
0565537543f771ed302f03ee7619a922
7941bf6dfb354347e894e5a8bed68129f481268a
F20110218_AABGOP pan_h_Page_119.jp2
8213e22522b4a889b8b9dbf3e9f2778f
a99fddf2cb0750051aa9e1f18a8e69fdba5b3efb
F20110218_AABFLN pan_h_Page_165.jp2
5e3bf5afee70876846541588567fc1aa
300312b98121bfdac83cfdc56773fa331080dc4f
990869 F20110218_AABFKY pan_h_Page_018.jp2
65e89466ae35a5dd823c28610d8fff51
cf954e5469b8e1eb06d50af9370aaadb0c6ad41d
63087 F20110218_AABFMB pan_h_Page_151.jpg
95944fb50e6fbe99bd87c93098316339
e8e4ae04c736601b3f8169631d5a722e9c4c8bd1
787433 F20110218_AABGPE pan_h_Page_145.jp2
20a8a9510e3b9d0f34954e1706b1a0c6
3af437f65b622cf5a54b4a3b261e24e83aaf880f
1051972 F20110218_AABGOQ pan_h_Page_120.jp2
155f0ca3d967928930f549a8804458f6
4db8cdb2c602da03f4706852360234eee6b2d585
F20110218_AABFLO pan_h_Page_188.tif
3ad6dd2d3e7c020f116ef9dd7f6b8f98
b6a81304ad329311085a9f47cfe81e69e37c0d20
F20110218_AABFKZ pan_h_Page_177.tif
824779a98d7e8c46ca9d46b9f6ee41b9
83c9b569959cad40d06e99a4363a8beb69f1e446
62526 F20110218_AABFMC pan_h_Page_200.pro
5e3eb3fe79cee98b6664fcdfad302e48
a790b09d879647850ac3954a987eb2bdb7553f53
1051819 F20110218_AABGPF pan_h_Page_146.jp2
4f27fd21a73b9a694fa8b968945266e6
7a63c092244abd88968a3e7d0d1f2ded13e7cdc3
F20110218_AABGOR pan_h_Page_122.jp2
05361cf824c88d2f69814f06b3247c25
d2d4f07cf5b5df68ca27d20e62c402e7d6530760
F20110218_AABFLP pan_h_Page_136.jp2
d23b945ea56540c4bf1c48fc653e4855
8b394c4b8af665afc332270587831c8a5f181df5
33456 F20110218_AABFMD pan_h_Page_059.QC.jpg
c44104163a13b801ee7b9d6247b64d4d
5539ffecba3445ccb5811b27c6c3adc2ddd19689
850591 F20110218_AABGPG pan_h_Page_147.jp2
85fbfb5fb786b623df25066d19981432
8cc604405ba2dbc44878611e34390f1afdadc905
F20110218_AABGOS pan_h_Page_123.jp2
af7a44d310c24ed9ad5b9bae007bba00
901a8aac20c3ec0760151b5ea8c315fc8165f565
28177 F20110218_AABFLQ pan_h_Page_043.QC.jpg
7fbfc1f80a5f58de5541a7577c5b3142
6d383ce8ce9c7305805c937098a55bbdd0a7cddf
34235 F20110218_AABFME pan_h_Page_094.QC.jpg
e94322ba556865fbc4a52553f3b880f2
112dcce9aad880d6aaad19a0a4d17ce96b1f09f5
F20110218_AABGPH pan_h_Page_148.jp2
1158f3209267aec135c47fd67a3c2f35
ebeae876d620c6ecdc15a0ba549696c11c8ac880
F20110218_AABGOT pan_h_Page_124.jp2
715d6ffa69f093b07be8e3fb7ef9a93f
6c22c6c8703e363d07ef896b0d0630b962d1aea2
788629 F20110218_AABFLR pan_h_Page_131.jp2
04fd5a6276b6898fb917d189308e127a
f9cd0857d95070cac75c835ef0a40c0a97b15bd7
4891 F20110218_AABFMF pan_h_Page_007.txt
867eef3942bc6d7b42807d7414ace323
d33c743f4ae3aeb6abb744b5c8f19a68ee5fa65c
754440 F20110218_AABGPI pan_h_Page_149.jp2
465fec03dfafa647820b617a4137d497
b54443cbf8eecdec9606198d25988194fa525921
786278 F20110218_AABGOU pan_h_Page_125.jp2
69d35eec7e7a42f9eb89ca3e1ff7730d
326f4d294dc7cac971dded509063edb861c6e66f
49725 F20110218_AABFLS pan_h_Page_162.pro
c7243e06ac2ab1e064a25da8fb65a8bd
fd0e43c5713cb2c6bbfd081b419b5865d9e2a39d
20082 F20110218_AABFMG pan_h_Page_130.QC.jpg
36864f55b9757b564aa6134922ca6ae9
139b3bc3b89162033a86c878f2b538eb8fc1019f
1051884 F20110218_AABGPJ pan_h_Page_150.jp2
b5a6fef827f1b99c832cf188c77a3a02
8fc55f7dbc97d9e6d2b8ea40be8cec77cfe2d8a8
814622 F20110218_AABGOV pan_h_Page_127.jp2
c982127aac9c7c4d2fc4a084a0c3c5a1
bf1ef03ec3f8293fdf91e67b9bc630b389ca0ffa
8153 F20110218_AABFLT pan_h_Page_020thm.jpg
3b8c5a1b9106284221e591be51ecb70c
558d3a2aceb6fd1eab10e5ccd321cd9f56570140
100185 F20110218_AABFMH pan_h_Page_139.jpg
0f390a760a109de3241043ebae661617
bd4109f47d6e318e1565624463a0ed3367f8de11
684506 F20110218_AABGPK pan_h_Page_151.jp2
8a652cf7b1eef0c2c1cfe48f8c255396
baa43fcf0b318f4ab67a120e44eaad0612ffe0a5
859715 F20110218_AABGOW pan_h_Page_128.jp2
bc78ea13e1454bbbf55cad05c38411a4
aff756c9a0a390d1b9093891f5a006eed562d1f6
F20110218_AABFLU pan_h_Page_142.jp2
6628c07db876c082e30b9c710f18519b
e7bba89fbbccf425af2df8717a0e2155fa6a48e3
8150 F20110218_AABFMI pan_h_Page_039thm.jpg
39c7fe225719a6a51a8952fb3666af03
86697ca9e67ce860d2e5ac1c578329f22028252d
398970 F20110218_AABGPL pan_h_Page_152.jp2
41346652ea44cc8d1a11181668f1a82a
0428206ac313084434b3680304318e363f6f9663
7673 F20110218_AABFMJ pan_h_Page_153thm.jpg
b3d43ffa939c59bbef890faba0716357
48dff8bc7326af2a54a80b79acd7bf92e016e9ab
1051917 F20110218_AABGQA pan_h_Page_183.jp2
2e29ddc2103c475648f188da316f625d
46c7456ce82211a051275980babcc00dc0d56027
F20110218_AABGPM pan_h_Page_154.jp2
e674ecbb59f7c09eb073bb2dc6714113
c2705406f04903ba9dce2019b5d9077ada67502c
F20110218_AABGOX pan_h_Page_133.jp2
468451208df1974b75d9eeb2ffc34bbc
b7d32fee4977cf34c26ea25dec7d49d308d9a0cd
98884 F20110218_AABFLV pan_h_Page_093.jpg
4ec58a574d35243db7843c5030af28e4
3712dc10f7de0610646a9f32e1c768528d8a5182
2027 F20110218_AABFMK pan_h_Page_077.txt
6603d999f9288213467ba43456227b78
ca13fdd68a9791c719e69c801b74e0369804e03d
1051864 F20110218_AABGQB pan_h_Page_186.jp2
99c72f3ce31527153c4ea2d2e70fe6e8
ba07744f73df8c39263448d1ff8b193dd80ce266
1051911 F20110218_AABGPN pan_h_Page_155.jp2
24d0dfd0b3233715f4f41b1e1847081d
beccbe142dd7e1681a518ab103684c86786c7882
640487 F20110218_AABGOY pan_h_Page_134.jp2
f1f569ef7a54f1cca861f200321fe428
901c2691f7722816313a52ceca3f3b3b192220c8
2069 F20110218_AABFLW pan_h_Page_025.txt
a5a7cf0ed93ec52b130467fd3b8b817a
f448e154268dc23db8820dc13aa082046c2128a8
25517 F20110218_AABFML pan_h_Page_080.QC.jpg
4a633e8e956db107fab5430be2f119d3
727f0a2745069ab868b1646d9e4a0677545b6204
F20110218_AABGQC pan_h_Page_187.jp2
181126897238aea91573b05882ea2dfc
2fc5e199cf557ab77b9f2a1f4d2b163172aab08c
F20110218_AABGPO pan_h_Page_159.jp2
807594219c1350e58f3d8515744fa9fb
d4e026f7cfcc8162f69c2bc86c9fb37b7a9b22aa
789961 F20110218_AABGOZ pan_h_Page_138.jp2
9e9a1efb1983680c739657033fe23adf
e610378b3b262f71db2e48d486c59a9f3e448e5d
1465 F20110218_AABFLX pan_h_Page_099.txt
78b211711a3af10a5fb3deb7b98f3f48
8f0a3bc1b271b036f52049b43872ee905ee1d5f2
2423 F20110218_AABFNA pan_h_Page_144.txt
d9835856424f1b5de3f2c071eccaf9fd
57775be743b2be42ec4aa50d36bafe496dd8093b
8805 F20110218_AABFMM pan_h_Page_189thm.jpg
071b6e4f71667c974f407c3a59428971
ff487d8128f8a1d23609311995e45b86b5d9dce1
F20110218_AABGQD pan_h_Page_188.jp2
5782c330fa9f3e73b6f05beb6dfd67d5
912524dd5f7259659e1422b9a4be63997ba3f81d
1051970 F20110218_AABGPP pan_h_Page_160.jp2
5ddae6cc4302b0e76d38d7db98c365e4
98ea03488107526ea6da81fd68a7a712eadd2136
F20110218_AABFLY pan_h_Page_184.tif
90ec50a34e874b8603d4a3125ca7e6b1
a222c66a97b8ea6692f975369d42e88f28ab55cb
F20110218_AABFNB pan_h_Page_211.tif
c7fa5b8282ed683f3d3adb88f06ec8a3
3546cd974083be8787c815d792fab87be2fe48ee
399169 F20110218_AABFMN pan_h_Page_156.jp2
cddc676f400c0d5e16fe733ee74c3068
69c5c21e1384f42eec0c6be18fe14f70289cf0bd
F20110218_AABGQE pan_h_Page_190.jp2
8973ac44b7c5fa3be275cb9ded675fb8
da8a8908cf0bdd19b849402a582f18a30bc28a1b
1051949 F20110218_AABGPQ pan_h_Page_164.jp2
368aaf9fe789e890ff20fdd5aebaa9e9
acf2df525e72bf07a94eb696eb5570a101cda6b5
F20110218_AABFLZ pan_h_Page_069.tif
d17e262618e3f5b8fba60f3ed0113086
bae2a043459fbcb5a356486317de4ff966b2f3a7
49518 F20110218_AABFNC pan_h_Page_116.pro
c97a35cb3f5893ae241b8df490103c9a
97eebc2ccab17f608bad7a73f78ee83ce5fa0c69
F20110218_AABFMO pan_h_Page_007.tif
f8396d5b89eba4896d947acd07237674
4fdb7bb7411d8e10df5224ba69f904bbb09e5a24
1051871 F20110218_AABGQF pan_h_Page_191.jp2
62737654e920b3dbe1934b80a9cf7e1b
2683374105e3938f9c0017004fc8eee5cbac5a42
1051977 F20110218_AABGPR pan_h_Page_166.jp2
d9326c3d4d23273d67a1278c42a060fc
e1d2eb50f1e14b072b39cade9f8db7afb01f27a8
45848 F20110218_AABFND pan_h_Page_102.pro
6dbd35c4b24ecf77de8d3944980bb6f7
da18d7f951ad0c8cb2f43409f5921838109ce50f
777201 F20110218_AABFMP pan_h_Page_080.jp2
59333664806f6dfe7dfcb8f0947a8269
1d447eadca59c829005e858c416e9a8696a2b628
F20110218_AABGQG pan_h_Page_192.jp2
d3b59c6e5979bf278a0460c65c24c9b6
c99cf482818cf4d9df2a91005b12b03ca8e3cb62
F20110218_AABGPS pan_h_Page_169.jp2
1f5b3514dd637ff654181e00ab1c74c0
f1788b322a084e917264900f9b32921e0a2d7a2e
48272 F20110218_AABFNE pan_h_Page_066.pro
5ecbd3506affd44bc13a1d79897eb977
37b692aa7a5926e1b747e10a6cbb42c927522de8
F20110218_AABFMQ pan_h_Page_003.tif
e1e5298e192b5ca6f4d5b0d39b759815
66a79821d03a9c5cd6929425a4d02d0cbec28ebd
1051875 F20110218_AABGQH pan_h_Page_198.jp2
7aad9764967acd46ba1a3429ce1a0c85
f2038215ab030cd4a401b7c605abbfc82410edcf
364291 F20110218_AABGPT pan_h_Page_171.jp2
ad1aa46f48bc462666fd45370098a970
050450b768727da0fee30b4ff940d65fc8cde651
1769 F20110218_AABFNF pan_h_Page_174.txt
2e38e5b97a73e7f0b02bf311937c793f
0f2aa67f4bae745b4d49afab854688db8f5304ba
8739 F20110218_AABFMR pan_h_Page_188thm.jpg
016dba74cf42baff4c0a404d3f809628
93cbbbe949a44a82969d4a62ccec4bc830700127
1051901 F20110218_AABGQI pan_h_Page_203.jp2
f6af28098ed101c81bac24bafe05a2f3
ed6317f7c61334d3010ffaaa7d4acae8074609ea
754394 F20110218_AABGPU pan_h_Page_172.jp2
6b123ab9c78f6f87bf769838f4e5fb5f
a985307671e53744a1e7c9d870eb2c7315713e4c
46638 F20110218_AABFNG pan_h_Page_118.pro
82452f464c1194272d2b87f1881336aa
fc815fff68e1b0c2477d86e9b680ab73d917ed51
2819 F20110218_AABFMS pan_h_Page_191.txt
46ec325f279cc5f1707a900ba1959a0e
5ae34fbc81e020ec511739f32fc3ba4ee03d7a40
1051986 F20110218_AABGQJ pan_h_Page_204.jp2
b0152a016232f06514d3d194a23616a5
57a11211ea495ce533e6d04e0873d6d7f297da2e
840828 F20110218_AABGPV pan_h_Page_173.jp2
04aee6a0bf1a4b1be4e6ce0050fb6133
dd14f08c6450e9807ad4a804adf072b5205110f4
86462 F20110218_AABFNH pan_h_Page_006.jpg
eb65f2a4250846aeaa7491f21eb9dab8
f59b5be79285d38c88d52cd955f294f36a64d471
F20110218_AABFMT pan_h_Page_196.tif
3dd4487794b8b207b2b6debe85f6a356
c668ff0100374af69c0fd7ec9901b182c20ddebc
F20110218_AABGQK pan_h_Page_206.jp2
d5221f129b0b31557cf336060399e0c1
7377f31b78cdde50a64791ba58d4ee02ddf0758f
377828 F20110218_AABGPW pan_h_Page_175.jp2
a6f9849ca61884ccba059c1cc6d3c8b2
3ef2dad3a93edd4d34218ab2659d5cb6b13ddad7
1648 F20110218_AABFNI pan_h_Page_105.txt
56cb376a8f586f5c0c6443810f55fc8e
4037b7a22c666cd515d2d1136b9c6e5c7da18711
28465 F20110218_AABFMU pan_h_Page_157.QC.jpg
777608bbd969d4888b22468c1024b260
d90f06742a6dbbf6ba5b2d3a635ec5894d70161e
1051924 F20110218_AABGQL pan_h_Page_207.jp2
aebd3e9101ea0441962eaf7aa690c72c
6fa9924e9b8903992cdd7c6c2b25c81eff6409ec
F20110218_AABGPX pan_h_Page_179.jp2
7bfd3a9fddba60673e4a1775be00517e
76e629749b2382dd4a42883dc9695c67f45f2a4e
284 F20110218_AABFNJ pan_h_Page_151.txt
39ec357cf2a8196406101dd656896a4b
ea8f7a72a5691253dac20a045e7722256dead826
F20110218_AABFMV pan_h_Page_129.tif
b313836b3af1baae9f698f1d78877cc8
eff9b176244717dbcf43b3d2a6658ac991024d8f
2413 F20110218_AABGRA pan_h_Page_213thm.jpg
3613f809dccd55b3271913ea094bbe78
ade33d2becea85a9c83644913310f4eaf892fea6
F20110218_AABGQM pan_h_Page_208.jp2
8c32a22d6634cc1a498fcb5cceb48084
0275c79e76be782de56f033263ba9506a51cc064
41548 F20110218_AABFNK pan_h_Page_156.jpg
a1b9305e40e7625b31181e3ce59f3bcf
e9409ac2f1364f52ec727fe954facf958df076bc
24691 F20110218_AABGRB pan_h_Page_078.QC.jpg
0cb94306c77c3d23c7213ff45cc8a563
a941c05e2f8111bfc92ca32ad97c48609ff26f37
F20110218_AABGQN pan_h_Page_209.jp2
dc63678c05ff0a1c95769e3f691264d8
b1d356f686d224cd475eb2e70bfe22b9785dd48f
1051948 F20110218_AABGPY pan_h_Page_181.jp2
5a0a496349833b9898fa0805d87fcb2b
b89cc835457c6d59a2935f7031aba3c94cee6c3e
F20110218_AABFNL pan_h_Page_193.tif
d49d58e82b1895bf9e1879abfb5d3b4f
5526b12a84c2b7976beb63acb8d315e3cf2b17ce
6917 F20110218_AABFMW pan_h_Page_017thm.jpg
1e4bc01299888bf9d3dc5856c09fafcb
2aafd3b85d90248a7a24dd5812f1c8b831d200b6
8386 F20110218_AABGRC pan_h_Page_120thm.jpg
255981a01d07ce0d5e5b622ab4c6a0e7
a9440fb88aa9f6c5220dbe6a3a0e02b72519f6a8
F20110218_AABGQO pan_h_Page_210.jp2
c7eb42638ebdb1be53339b589c363187
d6ac668feeb2ad6d3b74097adf4cbc7fc81745fc
F20110218_AABGPZ pan_h_Page_182.jp2
a519b84f2dd24d922467681abcc41b45
9fc74f3884769bd009dc71f7357539793655f8bd
6878 F20110218_AABFOA pan_h_Page_080thm.jpg
c9c810c8c5f7b9396061dbc33e162ad3
a3f7c7d0c6c5ed78c4ea65116ecb95aea24ba98d
8251 F20110218_AABFNM pan_h_Page_098thm.jpg
ac8f848880fe6b9f6be06adeeaa2404d
ffb957ffed0367947775071c11e771eb8e53e260
F20110218_AABFMX pan_h_Page_126.tif
45b8a0acac49bf01d8d19661127c18f4
e886b09161333c042c00e39f020845ba0281866e
6957 F20110218_AABGRD pan_h_Page_134thm.jpg
03ca82d6f54c8e2a6fe4f636b200c4dc
6ffb4813e6a25cbe4af3401ec4cf04a539fcfd32
418085 F20110218_AABGQP pan_h_Page_212.jp2
c1a08150f6d4faf89f2cdee0fe215359
61103c035cfb0f54c5fba3ec3388b90a48f6c7bf
8705 F20110218_AABFNN pan_h_Page_179thm.jpg
02e34c63f9c03e4a48d3039fd3fd1d56
ed09064380b59f3a9a159eb7fb866b67171e9ad6
3302 F20110218_AABFMY pan_h_Page_006.txt
cb7f2c362688e6b999ef9046a37299cf
99b357c0616dd48d0bf4d16dc25427a4f26cda72
F20110218_AABFOB pan_h_Page_163.jp2
d986ca23094c145f0c71fdc08d54b3cf
39cde13d47ca895325c76926d52ad2714f317ddf
32914 F20110218_AABGRE pan_h_Page_161.QC.jpg
50f8662f33de9221a64a231a1d78f5c7
0d7bb4abcc7c3d997398270bf5319aef8f20121c
8457 F20110218_AABGQQ pan_h_Page_196thm.jpg
ba3526f1a54d00a436f387253b89e640
6bc2c34e45d088b2c3bb8a660b32e1bfb286c1c4
F20110218_AABFNO pan_h_Page_174.tif
c22de144c1c43571c42040110ea5af45
561a96830cf1d3315eba352436d4e7989b7a2b21
F20110218_AABFMZ pan_h_Page_213.tif
667b78b6f6f83621d8174ab6ea5e08a4
6c30a2e2a8cc05eeec2b43cd28d27c2c53d5f806
2447 F20110218_AABFOC pan_h_Page_180.txt
c3017e70ffd0a0a46b390a1488340981
2fd181fb969cbda937e350e7f7a5017b793541a7
7919 F20110218_AABGRF pan_h_Page_136thm.jpg
b913a13b2273ee08df45cfe2380575af
e7b5c35d58645220271b0b77c757bafc93df2046
34638 F20110218_AABGQR pan_h_Page_032.QC.jpg
0bb93408f99392e87525fca74ae2145f
9993d7e871c116afeb5e1b42661fe55b90fde578
27253 F20110218_AABFNP pan_h_Page_004.QC.jpg
f14b2d83cd76d6723101050f95174200
8fffb0b65d5cd86b48c6f36c667388cbf7161040
31937 F20110218_AABFOD pan_h_Page_075.QC.jpg
1d8f78eec11b40128d62b78a474c1e99
a0825db480c9fee1a92a249d884ab56d213ba573
34589 F20110218_AABGRG pan_h_Page_109.QC.jpg
920af1f52033954371227ad42d5b8331
e9f3987f1a10766168a0a41628d6e1f7aa551ea9
26464 F20110218_AABGQS pan_h_Page_086.QC.jpg
3bd0b0df5d8ab4c5e522e09c1de02b42
7de2c3c0e85b347136bd037048e438d2a15a2a6d
4754 F20110218_AABFNQ pan_h_Page_151.pro
11ca552760665e5a7289a9489faf3038
086441e0a6febca0ff46c5f5ca38293ef94664ec
1817 F20110218_AABFOE pan_h_Page_102.txt
6ce2b71144e81b0eecd5316e06bebe77
a80cb67ee98c4b4d16fda83214eaaaac3aa19ebf
33544 F20110218_AABGRH pan_h_Page_158.QC.jpg
8cfee694a4d812392c96a370ee105abe
cfc4b2d56cc2b5cb113404ed216897fece1fe404
8880 F20110218_AABGQT pan_h_Page_203thm.jpg
3f0313a8aa82c1ed20127fc7daacda32
766b5113b64e6aac60d989c119491006482faa95
69611 F20110218_AABFNR pan_h_Page_073.jpg
de95a46fe9d92212f2b3bc5b22fdcef1
4d2d56e1c0315ba2a5c4421187c83850da805cba
8267 F20110218_AABFOF pan_h_Page_168thm.jpg
130a3f813246bdb6a504387a46c72abe
e993094ccd437e2b595462b92781d33c26de0971
37117 F20110218_AABGRI pan_h_Page_205.QC.jpg
ebe70f31e2bc28f8235d1bacdd518fcd
3f8cb10d1d0fcad74f92b6de74b5b9c28a6348a5
36678 F20110218_AABGQU pan_h_Page_177.QC.jpg
8f1cba64ce7a612ca1a8693c30690d63
f0efd186fd638c8423cd6109dbd486798e08b3ed
816191 F20110218_AABFNS pan_h_Page_046.jp2
9c800820479800961e42abbb67b8173d
a50c2d923fc7df06e885722352d0338c3d6a77f6
2764 F20110218_AABFOG pan_h_Page_182.txt
9c2eb38439634f34b1cc11fcb15b48ae
598985d301b3b5b431aa6e71a9e4c7a8a03ed489
32876 F20110218_AABGRJ pan_h_Page_133.QC.jpg
84c44a6aa7e818cec9e3fc165099e929
c4e4f3b2a0fdc7538a726738f2220883d2012c30
8556 F20110218_AABGQV pan_h_Page_166thm.jpg
8121940e103703e45c78250af081a161
7e88668e3627ae42b2b63f7dc5a4d4ee9bdeffa8
F20110218_AABFNT pan_h_Page_130.tif
81598412098b8df5ae0508135847beaa
240c5bd58259855778387f996fdd9a512610c2cf
F20110218_AABFOH pan_h_Page_079.jp2
22b0f1524b27fcae473bcc9a38a21981
0b4f50e5803ccac26194763370c14a451eb7c1a7
7705 F20110218_AABGRK pan_h_Page_139thm.jpg
b834dbe376858fd605b66d7cae39cc9f
7188877bcdb8116a842639614c46a9f65222f6be
8133 F20110218_AABGQW pan_h_Page_057thm.jpg
38e0fd3c8028cadd454279512cf173de
bb0aa940f151beafc1d8e3f34610c79b4100da98
684475 F20110218_AABFNU pan_h_Page_112.jp2
0782f445fd27a2efe7fb15914adc155c
b6cb0e46e57ffd00c6b2e648bf58b7d4f2e457b6
F20110218_AABFOI pan_h_Page_103thm.jpg
1818c4b98225b5ee7f86132652ea1861
eecd7c0b508178198c24e139d07de35f075ff4e0
20632 F20110218_AABGRL pan_h_Page_151.QC.jpg
de8e77840d4b36134e6e400dbb15ee60
5d38df860fba1cbdcde103dbb83909ff749f4892
31819 F20110218_AABGQX pan_h_Page_028.QC.jpg
453789dfae621b863495d4d93fd051f1
55d83abdfd2a7a36c0eda7498d3f6b83673b8549
41260 F20110218_AABFNV pan_h_Page_076.pro
6b67b17e7d904257916739b831d072c8
21169eef38d13722a16361587afafb748f0b23e0
1051934 F20110218_AABFOJ pan_h_Page_167.jp2
406f3bd6f2c6b5ca201db3202d16118c
f8ae0da4645df1e1386aa1180132839fdbbd331f
26273 F20110218_AABGSA pan_h_Page_125.QC.jpg
0cd2e3f886e911325579522032ee70ca
c754b6eb6c44a5e630c589282d3ab158c881c2c1
559 F20110218_AABGRM pan_h_Page_002thm.jpg
8fd294befd83b85f27cd287e5f48b5b2
ec09ed1bce5c6f6dede7fa771b31cd48cebb2787
8967 F20110218_AABGQY pan_h_Page_195thm.jpg
cdf45106e7dbf8c2c87df930724e8b9b
3a4e1035554f351baa963113c5d2a2a3c8e14778
1012 F20110218_AABFNW pan_h_Page_142.txt
424f7dfc48dfded3b684b91db45ed4c5
7699c44080c22e71e783ea362788c87abcc5c5db
F20110218_AABFOK pan_h_Page_013.tif
9899a1291afbfa1b159bab04cd07d5eb
6d05d91ebf3fe240c64def00e21dd64eb711201b
8424 F20110218_AABGSB pan_h_Page_122thm.jpg
60902ed2496fe96bcac539a548892fd1
18484c9089aa4383e7b4ec0d736d64b85bf7893c
2105 F20110218_AABGRN pan_h_Page_001thm.jpg
05b91c9499761e4a0400b2b15daa100f
e715c901d17b9b37e6c93ddd3d79fb736bb19adb
2197 F20110218_AABFOL pan_h_Page_011.txt
2f4d3cba5cb64690dfefa7bfdb1f6d26
50277b4b5edf613b3b63b5a755ceced0105775ed
32658 F20110218_AABGSC pan_h_Page_057.QC.jpg
2b154fa14fc803835ece6f04c018dc5b
0b9be1230718e3e58ad498d94e5d213b92664e08
4607 F20110218_AABGRO pan_h_Page_006thm.jpg
ef5f39056049982f5879ff6e29cae56d
c3950d52a9ed36032a93cc20ff12406ed467b0f6
5553 F20110218_AABGQZ pan_h_Page_108thm.jpg
d7bd1e29cb0767252f9195e4d5333eab
eec9985d3db5bea7aa2e4885b55223f9260859a2
64925 F20110218_AABFNX pan_h_Page_206.pro
456e8e9f80bfcac4b9a562e3a96a83e7
563354626448c1668715130014925025360bc01c
781 F20110218_AABFPA pan_h_Page_212.txt
3be3b1ed6e05d8a5c3b382271d9feae3
9e426f37b0963d849ca380afd71837011e6335b8
F20110218_AABFOM pan_h_Page_153.tif
4f274ad3ad5b229470ff913a0c3cd64c
67344adced1f533fe8dc12b2bfd7630bea1fc7e8
8676 F20110218_AABGSD pan_h_Page_169thm.jpg
03965ff94ba0057d7c9e0b99f39114b0
7a15f5ce61758393da55484eed89c0b8486acb35
24915 F20110218_AABGRP pan_h_Page_131.QC.jpg
5dc14844c8820ae394112887b872027b
fe480a65088e14dad4b4b89ea8f69bf7aec3f0a6
49359 F20110218_AABFNY pan_h_Page_092.pro
b41a598b3ca56aa4f558b0e299386df3
057e12e8aad95cc3a344e3a869d5928d6171bf5a
34376 F20110218_AABFPB pan_h_Page_134.pro
49ba2507c9da3491e6f8f9cb4e429211
a1509180cd4cc61a5725ace4895f980a1870dfff
34152 F20110218_AABFON pan_h_Page_148.QC.jpg
3282847565c9fa9282e2392b6076198d
259fc145dbb598ceabd95f6d273d70eb26549cad
5421 F20110218_AABGSE pan_h_Page_152thm.jpg
9865538c645c54672123fd1107cf79ce
a8e9bcd6e49b686ef502c02b11bcde16ce55c05e
26052 F20110218_AABGRQ pan_h_Page_106.QC.jpg
c0739e242a4f9759dfb5bb746785bf7f
f4ea3c294dceb47991f7b3315fb520f64cfd63f0
4299 F20110218_AABFNZ pan_h_Page_016thm.jpg
570b9b510e3d25c5d6852facee4cac36
50934395e06d07b6b923c24c18f9257f957228b2
48337 F20110218_AABFPC pan_h_Page_079.pro
a02b6b211232bccd7a5982591475cdc1
ce9620430842579e2db8da0b531f78ee7a8e35df
8349 F20110218_AABFOO pan_h_Page_094thm.jpg
60f791db5cd65e0f59e09eb36db03624
df4f72ffd6c02c3c6022bde8032a6185f3bd407e
7749 F20110218_AABGSF pan_h_Page_143thm.jpg
089e8e9d5053f82cf79c58f1eedec370
35856a7e2afa967065ceb836c7a8a98c72dd0fa9
8881 F20110218_AABGRR pan_h_Page_202thm.jpg
8551dd0bdfb601cd8225a1a0938184ae
2a2d3563c0a777fe49ca40c3732c2b0911375a25
F20110218_AABFPD pan_h_Page_054.jp2
71057720cdf91c982f9852286e8afe9e
a3bb9932f7bc2118b24b70c67cb2d52fd71060ac
8326 F20110218_AABFOP pan_h_Page_091thm.jpg
06be24490c1419aff52502f1fe6795a1
ba43503adebcffdf3ec4fe7894b613d584b07f38
32074 F20110218_AABGSG pan_h_Page_120.QC.jpg
7277d92180a4804a34d52e5cfb842ceb
f75d3c128fdd58ab8610fb26cd2a4128024f6c06
25287 F20110218_AABGRS pan_h_Page_065.QC.jpg
4a765ecfc6c928d465593e353b8d9ddd
020e2f74ae0533110b42c6789dbad5f20d006c26
7963 F20110218_AABFPE pan_h_Page_085thm.jpg
c4af265f9be39bdceef865349957baf4
e6b6f44e5fc3b7cad53c6573294b407a2c2d8cb8
101514 F20110218_AABFOQ pan_h_Page_057.jpg
d68b078b616b66d3cb833805088eadeb
3a3726afc42c7a6c8440458d2f6c7a92450fffd5
37926 F20110218_AABGSH pan_h_Page_187.QC.jpg
1650969db3732289e973c954a2ff1f2b
1879bc49156f6e8748b1f8f25884b7ae038fbe9d
8279 F20110218_AABGRT pan_h_Page_162thm.jpg
7cf6203da9534a9cb5ac0af3f7ab696c
d04ef77e7aa17cf9658f3d5cc4767ac8fd56c3fc
1986 F20110218_AABFPF pan_h_Page_071.txt
cdc2fd239c6288215afda0ecb931382f
af4b0fcda004015daf251100f1324d8da776a607
60396 F20110218_AABFOR pan_h_Page_180.pro
1cfd68f0b2f9c9f8bb938a120d357a1b
4f9b47655c7f79bcbcdb715174430ed67c7c5050
8095 F20110218_AABGSI pan_h_Page_048thm.jpg
0b8ef79874bf2cb185243f88fbdb77d5
4b5a25c16a4dd0697c19aaba7735332cef0f531e
36079 F20110218_AABGRU pan_h_Page_210.QC.jpg
7194bfd5255ef1d96e241ccc39f6716c
6369ce92f586655c1ade6fccbcc963e2edd05b49
F20110218_AABFPG pan_h_Page_020.tif
cd590da7a2a327cfef73f6041eab57a9
1bf429c9a29f30949c86f0acbe8aa71bfa7f284b
47543 F20110218_AABFOS pan_h_Page_051.pro
94bf39e74e56cd28c3c13dd748c802c1
32081847a417a8840828cd8018d3243d68b09969
26231 F20110218_AABGSJ pan_h_Page_135.QC.jpg
e6e51f61cf2cfe84d8a31083dde3edc8
2500775763528725441df5901879ba23e80f98b2
8484 F20110218_AABGRV pan_h_Page_116thm.jpg
35a651e533a135aa81c63d5cd7398289
d8ab852ad26eb2665f0dd182db04c7f276dc5d67
8217 F20110218_AABFPH pan_h_Page_154thm.jpg
c731d1b4e317420161bd09001331f1d7
27127f41fb3b7e614cd076eda81c16d05db9c7d9
F20110218_AABFOT pan_h_Page_163.tif
07a26f787173d13af4388df56f5b455c
7876e527786a291f4aabfb86e70e66f683df2e69
7932 F20110218_AABGSK pan_h_Page_101thm.jpg
85bf22a6d6af59a60b8ebafa52b3a455
f8f3dfcdd893ab76a249939d3f4f025e949eeb59
8214 F20110218_AABGRW pan_h_Page_044thm.jpg
ccefe3f27f3c560cab08020912c2838f
fd33b83d0933b0c65b08c2b4c4c6d4b022e56e05
1916 F20110218_AABFPI pan_h_Page_079.txt
f9f3a0e14e7fe61c375e6dcc530d6b58
5236a2b15bb6b07b0bb7e6a80a6e7855bee92382
F20110218_AABFOU pan_h_Page_084.tif
77998fa452aa356e5ae149942aceda6e
9f7f57d435008886de009be500dad882ff6e84bc
9977 F20110218_AABGSL pan_h_Page_005.QC.jpg
8d4aeab8c310bd8a75db941d3905db4e
b382bd294ae09ebb442ef7c1ed0009f6459a964e
35737 F20110218_AABGRX pan_h_Page_185.QC.jpg
14021f71c3b431f4ef3bb1cc467d68a0
0ac2d7985a8b6f2f840ab9d73d89f6e06ba8ddab
F20110218_AABFPJ pan_h_Page_131.tif
14fdf57022577ed1195491fdf6855597
6c03c810718ec005ec8081d286ed8670f8236960
140395 F20110218_AABFOV pan_h_Page_199.jpg
7f4f7f722ca4a31438e9cbdfce200457
d1234352a31975b2fbc161c1588452c3422fe4f3
6400 F20110218_AABGTA pan_h_Page_131thm.jpg
31a140689e63f1109f641915a157db0f
2b8dd860a43a6cb8c3bb1091be977bae1215a14b
6990 F20110218_AABGSM pan_h_Page_065thm.jpg
df0cbdab8b938351f256ee56fa233dd6
66b3b07ee4d2b759aa2964fa5f8752f1b58259ef
7005 F20110218_AABGRY pan_h_Page_078thm.jpg
82548ac1d41003196069a4658086c758
397c3205b7383e8844147f9201d0efe00def26e6
F20110218_AABFPK pan_h_Page_161.jp2
c072280b90ea27becc4f79f34c4df4e0
7b0c13fb6307cf02bc61bed25de4e461fddc75e1
28001 F20110218_AABFOW pan_h_Page_017.QC.jpg
168271c0f6b3f9f8344df37708019f2f
c32e69e421fbe431abdda215bbbe19570ad54331
33925 F20110218_AABGTB pan_h_Page_039.QC.jpg
86752a623aad76ec637b7b3171f1fd12
c983817dfd36877f35ede0ce1176dd732395799a
32622 F20110218_AABGSN pan_h_Page_051.QC.jpg
18d0f34f45e28b05b03ed225e8bec01e
acba54b74ba68e6903a0b0c7b3d31dbd0cc7d833
8319 F20110218_AABGRZ pan_h_Page_133thm.jpg
76eadf4dbdccfbf2b7b5b17b87b9896c
895ebdcce603a85d6eba3fc027c68c089ff678f8
35217 F20110218_AABFPL pan_h_Page_127.pro
c73d52f8cbf9c8d036b3690339e5773a
a52f1e61ecc837fb61717226ab23c9e11b7a7dfd
7211 F20110218_AABFOX pan_h_Page_105thm.jpg
162942877863f6b2da92f09335f34136
fd5e8900f1e2198ba494ee5bf2b9a0e1ac218e77
31813 F20110218_AABGTC pan_h_Page_013.QC.jpg
bf9d8efed5238f992cdf5164dfbc392c
c1b64e363beed83937e7c0c78b6cbd755b1c9319
8355 F20110218_AABGSO pan_h_Page_090thm.jpg
d213a4ac8640da5228535fd5d49eb1d7
0756676ea99e21ae1ae7e38bf41572998da29df4
91151 F20110218_AABFQA pan_h_Page_153.jpg
47e23d8ad8b7e1915711587f42df35e7
859ee7de6094f61c6f6d1b822eefb46206d4cd5a
131383 F20110218_AABFPM pan_h_Page_202.jpg
d193537a22e76a0714242380497e7632
7a18d778a0fb6c18da20ff7e2bf79c9d244a08f6
338839 F20110218_AABGTD UFE0013783_00001.xml FULL
640b2517fc3015fb923b2394005bdc4e
470c241d150a9c098aae40ffa9494bf52aff20a1
9782 F20110218_AABGSP pan_h_Page_146thm.jpg
45e00f64daf4559df81009b4f07c628d
5a72f637d3e67e2c020e852747e3a8e649876e02
12071 F20110218_AABFQB pan_h_Page_171.QC.jpg
46f150b00b34a3cdf09a6265fcdab223
cd7be7632e9e3d57ebc037f76f70c965b98d76e1
106717 F20110218_AABFPN pan_h_Page_121.jpg
66d3a62fdf73ccef45d3b86bd43fd624
439f00aa58379e5633f3fdeb17a3cfcb7968cfcc
101602 F20110218_AABFOY pan_h_Page_088.jpg
cef3771030260c5cdc3ff58b509e630d
e6a5a62693da3373127dc6ef559c9b141f44fc0d
7627 F20110218_AABGTE pan_h_Page_001.QC.jpg
421a69be1955f48911cc1aaabadac9dc
42c00b5004cecb8281070ec5144a2c1f15601244
32416 F20110218_AABGSQ pan_h_Page_154.QC.jpg
e8af4aaf876022f0b02020d85a205638
5430c6b4a2f18da35478bb79e77d591393f8da30
725118 F20110218_AABFQC pan_h_Page_078.jp2
b26e901732d3d2f59502b45eb0f0f299
5777b70da9cc4c163cf7be43eba120a8c536da00
29876 F20110218_AABFPO pan_h_Page_129.QC.jpg
bf58085f09562ebcce7f0d49a662028b
bb11fee2de2bfd586aaa327ab4abc0587ae4d4ef
F20110218_AABFOZ pan_h_Page_141.tif
658d3f559d24ba372ba65a0849d9d3da
00c8bf301acf85b3969b7a82b2be7a69427eb401
1398 F20110218_AABGTF pan_h_Page_002.QC.jpg
0465b5dec67605afa108530948b30a46
5adc397d3a81c45861d44d7aa080b609135dfaf3
5936 F20110218_AABGSR pan_h_Page_099thm.jpg
ecd9cf603c2737074f409e2b591af5d6
5fb4d5648729ac95477914c95c47ca4964c2ccd1
8100 F20110218_AABFQD pan_h_Page_066thm.jpg
d11ac016789dc15362457ff244112898
824c268e40abf5a733ae0c44532e079f39c98ecf
8538 F20110218_AABFPP pan_h_Page_185thm.jpg
00a3ee894aaaa99254add62900b2f295
3ced392855e9a941a1a2b09ed4dfedb46e8e268f
19899 F20110218_AABGTG pan_h_Page_006.QC.jpg
76e03fd4c631346fdeac9ce9ef03b61b
16e088f90c8d99beeeb2b21a3681b13a2a3a1a9d
37789 F20110218_AABGSS pan_h_Page_181.QC.jpg
7b720c4c77291837aa172cfebcbe1ee6
61d8215c3ec72b13202f36e30cf17fe6498ad226
F20110218_AABFQE pan_h_Page_060.tif
e71c669c161ed20dbcdcedfc145a9097
9ae7b0778ca9d901efce11fe8d79b06586e96f5c
49207 F20110218_AABFPQ pan_h_Page_028.pro
ad214a6e7340d01d81a7690eb6faf398
3f0020ac4864330ad1cb395fbb996cd06fb5cac6
10043 F20110218_AABGTH pan_h_Page_010.QC.jpg
a5b5b90fe4980ad46d0185bb691d31fe
8911f6ea49f497d2e8a96db1ea06db61f4919963
35587 F20110218_AABGST pan_h_Page_159.QC.jpg
0bbb6146eb07ae43323575b172c54a13
5f4356399c5f574308943b3a8bccf2c0e0c981af
42773 F20110218_AABFQF pan_h_Page_132.pro
d66a0fe2a1658a4eb736bf935c851532
6fad131b07a13354d48b5549f0fe93bce66c1d9c
54999 F20110218_AABFPR pan_h_Page_144.pro
377dc53445170a4fdc55105df0c4768e
c000168238b992847253647f014930a059caac74
4762 F20110218_AABGTI pan_h_Page_014.QC.jpg
f6ca17b2a388b5fb1f122196005c61b3
8278e964c9a491e154594322c6e961aa863419e6
8455 F20110218_AABGSU pan_h_Page_025thm.jpg
fd69a7800280b80c0cc8c00bb1311b2b
c448fe8f3dc775b4ab83922a51ca36b22dfe5bce
133961 F20110218_AABFQG pan_h_Page_177.jpg
64a8c725a7ff2f6c8e54c9990a4a2572
4e89b49b0cf5a17f50997fda5e6b37b0ccd58904
943761 F20110218_AABFPS pan_h_Page_076.jp2
f06199d48444bf56a7edbee98542c52f
8c4a35437444bb67aabe611fec06cfb7c3adca36
30119 F20110218_AABGTJ pan_h_Page_018.QC.jpg
6986d89af9fc36dccd3b18d0106bea8e
b5d761be8c7eb06ae34b556a635bef225169f44f
36078 F20110218_AABGSV pan_h_Page_179.QC.jpg
5973e7beb8e1b624423232f5430bd43e
d5a7b04b34874ab4bdb030611c35b317768404fe
1371 F20110218_AABFQH pan_h_Page_149.txt
1a30020922183a3cd1d17cd38c17d4f7
c546b73c73db48e45fdeecac5b5abbaedcce69d9
F20110218_AABFPT pan_h_Page_128.tif
bbffa9b67d2af3b520c2216944affb3a
77d14e5ba964abe9e1095ac94eeeb8448e763a5e
26214 F20110218_AABGTK pan_h_Page_019.QC.jpg
5de214ce181c2916ed8e2c1fd90b8ab2
83f9867f1a71ee79861441047f83e3ff365c480c
38572 F20110218_AABGSW pan_h_Page_198.QC.jpg
0a83c971adc07d04488e2ca47b32796c
2dcba9b62825505492fe89480f8303c1f5c3afac
33400 F20110218_AABFQI pan_h_Page_164.QC.jpg
16b80eabccde3a4b2445b41d038271cf
48f77a1a078b04bf4d33fdfe560dfb9a38eaa6d4
8383 F20110218_AABFPU pan_h_Page_124thm.jpg
2219c19a469a9ed52ca894c453cac13b
daa8875d09e1a3dba75d064c5b1990130e2f5167
33103 F20110218_AABGTL pan_h_Page_020.QC.jpg
ce0c1f3de901f23ce1c1d26760f6b9f5
c4abaa64e419de11bcf33975f88b6cbefa9ca8ca
2749 F20110218_AABGSX pan_h_Page_009.QC.jpg
6053825776a0010220123dc4a723e9fe
fb23d5b94ece06a9d204087e39c7754a04658302
136868 F20110218_AABFQJ pan_h_Page_183.jpg
fa90b3b53bec350a01b0da7abf216fd6
fd0a5f06ce17766b886167bf0939a233b98f7892
F20110218_AABFPV pan_h_Page_057.tif
361476ff91e0bec19fa4f09969f7a624
f3f61d58b6af3608f951a4bb8035d2c08741e5b8
34924 F20110218_AABGUA pan_h_Page_047.QC.jpg
e933e3a99bf13a55502c9dffc941739c
13049d2003978fa75072a688957e496380f536f0
35084 F20110218_AABGTM pan_h_Page_021.QC.jpg
f2c6c5ab128bf9f0342bbac8be1512d9
6fcadd3cd948531e308bcf1447f573af4c8d2215
8734 F20110218_AABGSY pan_h_Page_204thm.jpg
b3346ba32ef0d3da98df906ff4a9239d
be364d597b5db62c68029d7794e14d489fd67578
1051909 F20110218_AABFQK pan_h_Page_033.jp2
c578c9976af7c9210d1e3c17d88eb999
ff8a7f6f9e9685c77dee9533f7664e885737e431
49944 F20110218_AABFPW pan_h_Page_109.pro
2e4e961f86602d842624b5a94316dde7
0af0694f0013ff817c1f35d6a151bab00376e3c0
32562 F20110218_AABGUB pan_h_Page_048.QC.jpg
53bbff7bfd36544497c20a08c61bf42e
657548d1a370b9e4388afa88f67aa7d6a745b278
31783 F20110218_AABGTN pan_h_Page_023.QC.jpg
5b213ee17bf6b000b3eb918c8186caad
c81021309a8e3a11d29fd4697ef8f45c6c64ae64
8142 F20110218_AABGSZ pan_h_Page_117thm.jpg
e03c7bcd55fa68cc71197aef338f7373
cbe16bea36cb51b905ded0ba5ffe7a969987bb11
1849 F20110218_AABFQL pan_h_Page_075.txt
93558aab5c07dce1a2f4e6f55dccb45a
c9e4e5cd6044c587d4590dc5cdd133908e44ee68
1843 F20110218_AABFPX pan_h_Page_003.QC.jpg
1b88ec0cfd5165df357c6a44431a0562
fff322e00313f0ec3a98d73c8c89098006aea2a5
31867 F20110218_AABGUC pan_h_Page_050.QC.jpg
1a3a165b6063374328c7d84b0d04da65
4cf2c284b798f11c5c23382df776e755d3f7f23d
34939 F20110218_AABGTO pan_h_Page_025.QC.jpg
c791ff0b350aae7e8452763957a65dc8
8a22b383d25979ec1da79ba069087c63fa279e10
8638 F20110218_AABFQM pan_h_Page_183thm.jpg
b7ec68153a006eca79415e48a57eaf83
4550afe9c2cb7a75bf5f5abeffeb9d0137b72e92
6637 F20110218_AABFPY pan_h_Page_125thm.jpg
1b387b631934b893f2225368ff574d58
7b12c2d5ef95c107ef1b24b6d50e6dd1e453f48f
1900 F20110218_AABFRA pan_h_Page_033.txt
568105f77dbe5eaad62a455f796f8432
53d8458f8ae49cb39223e9f2dad70e912d2786e8
33179 F20110218_AABGUD pan_h_Page_052.QC.jpg
64b91c5d6fe706951021b9fb12036b45
4eb6c783860c6f7d8b4adb1afed3e90fc7b5a0b6
30230 F20110218_AABGTP pan_h_Page_029.QC.jpg
49e98de5c68eef69a9e63cffbb90c59c
d2e4ac92346f30599dba3d86d65e79e8e2ae19b7
F20110218_AABFQN pan_h_Page_066.tif
24aee18fbe5b855f2ddb2d34fd0993ee
f320831da670c1fb04cb5f1b4218bbc240c23316
F20110218_AABFRB pan_h_Page_158.jp2
0e803feadb8391eb742b8bc22a83d4c4
ebbccf282880b2072f0b13df37b19d9c7f0b5723
34013 F20110218_AABGUE pan_h_Page_053.QC.jpg
c3ef35e2ece71b8156910c3140032a8c
15b2deae66b28c47c088caad97bd9dc030a02655
23363 F20110218_AABGTQ pan_h_Page_030.QC.jpg
883f3fb0aefa77a508c70bf7f62a94f2
7e3509f2694507379d05a240e774efad8ef7c155
30483 F20110218_AABFQO pan_h_Page_099.pro
d0ca293bdee424f72ac33a3351974c4a
ee6c0bb61835738f28c4fc1d336972470e0222f8
8313 F20110218_AABFPZ pan_h_Page_054thm.jpg
9651ba70a9d2896860405ed56d08a661
38a6453829594e0b5139c9799b62ce9901e7b569
24602 F20110218_AABFRC pan_h_Page_001.jpg
871850a91d2fb791763b41b97cf33e76
00ed50ecb1da77d724ded6db5eee379d8c635b22
8874 F20110218_AABHAA pan_h_Page_193thm.jpg
a4b7783d5dd67ff340722fdd70574234
9dda4c6d3ac7e7e5364036f7325a05131f903195
33534 F20110218_AABGUF pan_h_Page_056.QC.jpg
27ed99c311a4c7c32aa8967ad014683d
27b2d5425ba2ae23b5c8bdf4e9e723371dd43116
32524 F20110218_AABGTR pan_h_Page_033.QC.jpg
8ac185910672c67dd663e22f63ad63d3
7ed631a3c07359a62d9f63ad59620896a06dfc72
39206 F20110218_AABFQP pan_h_Page_208.QC.jpg
ca7f67d2dcce4032145aa4141f0de2c8
229728000016068d95a0df15c6b10c22f36fe90b
26676 F20110218_AABFRD pan_h_Page_067.QC.jpg
596f5e646be50c46c16522099bde81d6
a94e28fc628460a79a7036d4cb041b7f1ca35939
9148 F20110218_AABHAB pan_h_Page_194thm.jpg
a2dfdef74b449645ef7290b4c4604265
65172c02635b7cdb297c78ba3cb8905dea564a30
33983 F20110218_AABGUG pan_h_Page_061.QC.jpg
ba323c343f41f4aa528b63e2c591c924
a40a6254628cf0e78b2b58fd2f765c34a869831f
27655 F20110218_AABGTS pan_h_Page_034.QC.jpg
9e7124fdc711fc4f0d7d8156a548745c
413c778e0d390a3fa77e2a234b3b969a6c83f6c3
7657 F20110218_AABFQQ pan_h_Page_046thm.jpg
1cf440b5a4ed988f46047ae26c12ae5f
474b618da004de23ebd4073a11fe4d4c7d3e543e
69922 F20110218_AABFRE pan_h_Page_196.pro
416b569d2c36174f216945e13a24bc8b
7d8ab4af34444c340418c76b5b30125c905f8875
8786 F20110218_AABHAC pan_h_Page_200thm.jpg
558b828440c8081e88424fd56de7777d
fb0c1cee5a6e325e73874232a0ac967e312a7e16
32429 F20110218_AABGUH pan_h_Page_063.QC.jpg
2a6374de07436cc3c181e9c0799d5592
029df7aa3230933385e423e945c0d72c28a77423
33155 F20110218_AABGTT pan_h_Page_035.QC.jpg
d1fcd8517b90215d3acd960f2fa20324
51c883ecc41042add266b88c89f0325463e30f9e
36756 F20110218_AABFQR pan_h_Page_193.QC.jpg
6e72ed82184056f251578ab5c170f10a
b40ec6829df421ccf0979149d7b468276cb66d73
F20110218_AABFRF pan_h_Page_201.tif
9f607b6a3085bab3021fac5ce17bc6be
a0b30296645e8956b34766133ccbe22a35e46596
8571 F20110218_AABHAD pan_h_Page_201thm.jpg
afd0f9e2c6d72aa6d1e902a959cc97c8
0c86b2d4b949a97dd150be36355530f0bbd51954
34578 F20110218_AABGUI pan_h_Page_064.QC.jpg
b68e628efed8972aa2dbc210d68782fa
a0481da9c9642037f6641f311792375c88584878
33408 F20110218_AABGTU pan_h_Page_036.QC.jpg
8e6896290d6003657a82e887548dcb08
7a34559c71eed5f5aa787c8b808a3b7be9185615
147498 F20110218_AABFQS pan_h_Page_014.jp2
6173ce76561885bd351551ea3b289db1
572a601aba08060b59f9546a3b01d93fc6341cc1
F20110218_AABFRG pan_h_Page_036.jp2
4690b9d628adcd727c774854700139aa
c7f5711a49a936d430beef6573faca043386d40b
9104 F20110218_AABHAE pan_h_Page_209thm.jpg
3ccffa87fc6d761f428d85530e547eb7
7748e3db1f409a81dbb23a0edb8b8a8d89764633
33274 F20110218_AABGUJ pan_h_Page_066.QC.jpg
3edb33b88ad6240567b67768bdf67b07
2fbf9f63f6f29e9e590701a76bb54e397121895a
33089 F20110218_AABGTV pan_h_Page_038.QC.jpg
cc582a96ef8e96e9b91d6592411f06f9
4ac2a30039d1e00862dbc237efd58d2a686bc2be
F20110218_AABFQT pan_h_Page_155.tif
e526f477ce39d6d28a9877b66098c6ea
dd86439a573a7e753699d0cec25fd8a2f8039aec
102302 F20110218_AABFRH pan_h_Page_119.jpg
e2683bd35549e1d6c884cad1570965de
25dad9240ae76de77fd0fa0670425f0200709665
8773 F20110218_AABHAF pan_h_Page_210thm.jpg
78b096e9fcc4def8d91026bd80c1ce2d
f36f3de9007e5304a82840c591017b3fa6728dc0
31321 F20110218_AABGUK pan_h_Page_069.QC.jpg
a062246fe079bdc80c8b868df63ce1e3
5bb6f133d1a90d672fb5f7bfd0f1f1536b82b53a
32832 F20110218_AABGTW pan_h_Page_040.QC.jpg
e524c5d196aa2f3e30993eba032c1087
65786eee4fdce89434326f3595cb496c930c57ac
105576 F20110218_AABFQU pan_h_Page_110.jpg
fb7871a2ba89d2ce3258c67040cffac5
2924e17c2cc0287b3d4f23eb928651efb8f7fb8b
8508 F20110218_AABFRI pan_h_Page_082thm.jpg
32bea06ce0c301da85989a686889de66
5840236e4e9996b9d0cfd108afc4dbc9ed25bf90
2703 F20110218_AABHAG pan_h_Page_212thm.jpg
7dfcf0af821dd43798415b4db3ee8c7e
1ba3c29c5a1b57ddd06a927212189e42cc3a1cf2
35808 F20110218_AABGUL pan_h_Page_070.QC.jpg
4aad0b22774890d79d4f1ca87cac3617
6dc501ab1d76bbf192b0d188f6723a572c917b6f
F20110218_AABGTX pan_h_Page_041.QC.jpg
78c87323e3df700e895dc32882b035db
e0122b6af20bc1b73608d666f488f18d6066f4b1
1938 F20110218_AABFQV pan_h_Page_123.txt
3dc2093ec38cfa6ddd5d59ec0b08b97d
12c943f0fe3db4a29f2764186fc968c1cc72422a
6842 F20110218_AABFRJ pan_h_Page_140thm.jpg
bb778e3a2b712e016ec9030e2cb39894
a856093734eb29ac0e8ebb6cfa982bba23ea3775
35345 F20110218_AABGVA pan_h_Page_110.QC.jpg
7d1ec9217dfc7c8de5f3d946c10ba763
a56da90d741311b9a7c3f1f657e76ebd04881702
24863 F20110218_AABGUM pan_h_Page_073.QC.jpg
81a1056e4fec8044931cc99579337594
d78bc0a410019679e1895681cc101fe364cb7901
34759 F20110218_AABGTY pan_h_Page_042.QC.jpg
0e2ab2eed346e939b4dae76165749860
0cc1362f600637a052a661213c7689c17a451470
558 F20110218_AABFQW pan_h_Page_005.txt
4bf850fdb8b533eda4ebaa44d5646f50
13be278c5a068f9522d7da8ec098652e533f6953
F20110218_AABFRK pan_h_Page_048.txt
207e26139f06585cf15f6e32034e9f2a
c017ac5bc222fcf6fe781d6882d607b50d8d5ba6
22357 F20110218_AABGVB pan_h_Page_112.QC.jpg
30d2a842c226fade469a426f4fba2bca
224ffb538a4a07070384f82f5477fa453836636b
29173 F20110218_AABGUN pan_h_Page_076.QC.jpg
e2f323f26e4c2efd06f757612e444b96
9da9bebfd6eb32ba85d9e04a728530d2f2c41530
33461 F20110218_AABGTZ pan_h_Page_045.QC.jpg
b2520edd79df396cf3e7d7bb9d4f34e8
9ea32a3e9eda18e06a46533904a37256774f1326
8953 F20110218_AABFQX pan_h_Page_192thm.jpg
b2a6e5908296f47587ce318c521a47b3
186af5946ae5ca65a5a575d401277276adb28902
8438 F20110218_AABFRL pan_h_Page_022thm.jpg
60374efbefebb4878f1478663d2f3c84
924df3308ac538ff86a0307273b3d13d21918b5b
34484 F20110218_AABGVC pan_h_Page_113.QC.jpg
6f42dc1be78b2a1e8f25995da0b7d781
2ea1bbe14af7a2011d2b6332d9a6e66639012824
27615 F20110218_AABGUO pan_h_Page_081.QC.jpg
ace7d2d2c873d4b758202607445e3120
38398ba45d78ffe092788c3ce86c3a24dab1195d
48806 F20110218_AABFQY pan_h_Page_052.pro
7cb2b48aed3e0d5db4ea31febdbc2b7d
25f3861b31208d5b7baf7b1ff71122c4546b77ed
133545 F20110218_AABFSA pan_h_Page_186.jpg
566dcf4dc1e1cc35631021f71dd3574a
89125ed5e4957c01dad42f191fc6383eef8e0b04
18173 F20110218_AABFRM pan_h_Page_143.pro
2835cb5a3f4c78693bcfa547aed2c11d
264dcf2c7515073146c35888798e5bdd6f997df7
36020 F20110218_AABGVD pan_h_Page_114.QC.jpg
8f9456552ec54a221540fbce3ed8a2ac
96ad93c0bed0446279f3f678e908486dfe082e30
26518 F20110218_AABGUP pan_h_Page_083.QC.jpg
3f664933985a5d36370860119143ac90
ad03d8cc88c73be4b10e9a5faee5c6c7af37edf1
105323 F20110218_AABFQZ pan_h_Page_113.jpg
c8775e9999099d165dceaf1b732c490b
b4f930d6815a39d3abc8b6d3e3908cbfc504bf7b
F20110218_AABFSB pan_h_Page_020.jp2
e4a937ee7c20679732f53d169e93aa4b
b481703bcb7791ef002c3d414e0e0e350bd6bc9b
32836 F20110218_AABFRN pan_h_Page_024.QC.jpg
23eb3218a57cee339ddcafe0510060bb
4152f064a67f4890ceb186f94006f4d339ccc9b6
35551 F20110218_AABGVE pan_h_Page_115.QC.jpg
8608e214106c8512f10177a8c0876dd9
ae968941a60e02a4f0522c63ee813a3beba63229
34569 F20110218_AABGUQ pan_h_Page_087.QC.jpg
897855f30789b4d7135673155a5653fa
bbb9d0866d7cc779a1aeb8c140c1b61d88a7eb9f
8233 F20110218_AABFSC pan_h_Page_032thm.jpg
80913eb24d907cc215b02bf480b987ad
e3a93c6b36bf50e2ceaab597b8bb7b5591b80567
42307 F20110218_AABFRO pan_h_Page_017.pro
020afc4b53f0cb79077cb38f83970f2b
fef95b3d4dba2d2c243764f4de790a2b83dde923
32234 F20110218_AABGVF pan_h_Page_117.QC.jpg
dbdf4aff1e9f44d24e2a7ab855218607
41b58928ec8e0207158b3f051b4dde6fc42a0cf4
25919 F20110218_AABGUR pan_h_Page_089.QC.jpg
c69b9d937e4679dedcbdabd0b0ce1d31
0c95b71306df1e0ea1c566edd3a6abceff7bbd43
20860 F20110218_AABFSD pan_h_Page_173.QC.jpg
87734e5dca8f240c58743bdf08b999b0
0da6f0a55798292db45c4d24d26ed5d7af19f6bc
567973 F20110218_AABFRP pan_h_Page_016.jp2
5618e05eefcf5a7f68e6867cd23c120a
29d751474be9fc901494e1b142685f5abda8c7c2
33062 F20110218_AABGVG pan_h_Page_118.QC.jpg
e37169d0ed7b247ae4648debcfbb23a1
38b0b7616bf3e6bb0fedc6fcdbe574ce4eafa3d5
33218 F20110218_AABGUS pan_h_Page_090.QC.jpg
35a4753848ad520f66fce5e5eab34f42
b5cbf8272927aa58c27aaf06ef24832ba6f40b5a
19526 F20110218_AABFSE pan_h_Page_084.QC.jpg
7b1b65126956fbbf36006f16ecc87fa5
89f3408ac2075adb108df2cd01c4fd55245a6142
33887 F20110218_AABFRQ pan_h_Page_166.QC.jpg
3f26d0faa5fc9d85fca4f6a353bfa59a
76222afcd354686f68deffb722f27f30cfacd00d
35218 F20110218_AABGVH pan_h_Page_121.QC.jpg
e648209e79cbee901a0831345c3952ef
0fc16ca1edb4777636ab783912fc00bfb1f9a696
34794 F20110218_AABGUT pan_h_Page_091.QC.jpg
ed98b28e116e20773691c841a8c6b9d0
04246ba34f609050ebc56cd94f1c051e9b2811dd
109718 F20110218_AABFSF pan_h_Page_008.jpg
a0ec58d095d77cb84dc4dacadcb29fa7
072c34eaa9e429b8dd14ed03fd987b6a3606a637
7009 F20110218_AABFRR pan_h_Page_145thm.jpg
5828e37ef0f99c634cb890c6d74685fe
43674565d6a984dcfda42e852359e96fddc89e06
33881 F20110218_AABGVI pan_h_Page_122.QC.jpg
7535f7226bbd4857ec16c6d1a5ec2472
079f29e0d1a8660e60aeb2cb75ae9434d1f6a433
31934 F20110218_AABGUU pan_h_Page_093.QC.jpg
e6b5e4ad22c6d8a6d0a84eb05f94c318
a3b01b22d5c588f0291bdc0047381f0a8f2a0747
38990 F20110218_AABFSG pan_h_Page_194.QC.jpg
f99e0de866a305d3f34c23ce551f4bf7
5a4ef120d045ace8063ec89a1175d1f5b489f1e2
1543 F20110218_AABFRS pan_h_Page_153.txt
196b3e28c3c3453dd921ee7b61ba6735
bb67fb6bbf59be7749c774e98ee30c4e32332f64
32657 F20110218_AABGVJ pan_h_Page_123.QC.jpg
22c9b5115b04806332297d8820c78b53
90f8bad2b0c74c67c200faaad5f7701d1eb0d975
20890 F20110218_AABGUV pan_h_Page_099.QC.jpg
c836a8c22ca730453559fd66be9c6075
c68dd4ed805b147fa13de0b5477e9f85b023f2c2
F20110218_AABFSH pan_h_Page_028.tif
c079d79a91aca70823ed2b4c3a7a777a
b2a536c0155c4b9b0793bc78ed8872ebbfc3d948
31531 F20110218_AABFRT pan_h_Page_022.QC.jpg
f6441c25586998c51a88416567821827
16b75e3a5eace387c90f40dcc3a4cf7146bd2f36
26064 F20110218_AABGVK pan_h_Page_127.QC.jpg
f3fab0a0b0050c619d65cc9de9bcafe5
3aeeb163ff3ac6cc1fc00b211b1a9d0b72abacae
28623 F20110218_AABGUW pan_h_Page_100.QC.jpg
6e5446f2cf4401f819624299a773e3f4
97e41a2235569db499dcd96118b1be72bd67eef2
4673768 F20110218_AABFSI pan_h.pdf
ab71919897c6227328b7f06c7e6b37db
e2408c23a0298e0e92cfd0f2dc75d8974a1819ed
BROKEN_LINK
adultmodel3D.mpeg
adultmodel3D.mpeg
adultmodel3D.mpeg
8577 F20110218_AABFRU pan_h_Page_042thm.jpg
f22940e2e7769bfef2f2d02e5068ecb4
f333d3527f00d2366e135da7c412689e363b2a4f
34253 F20110218_AABGVL pan_h_Page_132.QC.jpg
241f9e5e3512edcf47443e3b8419636b
7b04e72e899307dadefb52856c46debfb66e6118
27931 F20110218_AABGUX pan_h_Page_103.QC.jpg
c934b48f126325a55d5930c26edefc8b
db8d7374642f87579931a56aa8444beabe8463c7
423936 F20110218_AABFSJ adultmodel.mpeg
12a397c3270f8a905be7bbee46b5f8d2
fd6912cb27f7c16466b4bcf2a9178caf7e9a069e
F20110218_AABFRV pan_h_Page_088.jp2
f25fc7facc985142b280bcb79d0c7521
a35f3e242f5ef089ef64e5aca505e6d1750f605d
15706 F20110218_AABGWA pan_h_Page_156.QC.jpg
19571b3405d760415b1b13bec5d7ffbe
b14a48ac028084bd1668a717e1d4d17bb831f374
22912 F20110218_AABGVM pan_h_Page_134.QC.jpg
02b03d371a069c0b557376a7ba42c30f
35d9e0cfc8215848bd52b3c7d2513a39f2910f05
32139 F20110218_AABGUY pan_h_Page_107.QC.jpg
2b94164937f619c843f276365c6fd208
d53421ffbc546afd9fe343b1990dc57db9d85b44
F20110218_AABFSK pan_h_Page_132.tif
ba6fac5d85c386036b9d01274cdd8963
b5f0a45779c4c602e7ce1a58825d09b020ea3976
1982 F20110218_AABFRW pan_h_Page_116.txt
39d203a3163db5db3c7a5963e38384c7
039a095783a6941e0ec4f9d546bbe0d025747acb
33479 F20110218_AABGWB pan_h_Page_162.QC.jpg
2284ff6b8f83e05413d01444e5c4e449
958d28d208588d4330e1514a46dcd19ed4b5859e
32152 F20110218_AABGVN pan_h_Page_136.QC.jpg
55ea620486e0fd5f6b08de94c3d47a16
68d3abddf819b40e982d8e35bea9ba3cd0a00c5a
21391 F20110218_AABGUZ pan_h_Page_108.QC.jpg
ebf22238431aa7200b5a5bb72815bc47
a20e1e810725a2d469053d99d1495e1060a84c67
28493 F20110218_AABFSL pan_h_Page_031.QC.jpg
9eea7c782f0a374068e18c1c2328e5a9
9ccd406052ee13c8ab85b27765b9e7ac683f8fcf
2570 F20110218_AABFRX pan_h_Page_202.txt
86b1af631116b44862fa015ac4353f11
108ce992e27aa9cdf6dbce97c6ab177f1f48beed
32873 F20110218_AABGWC pan_h_Page_168.QC.jpg
c62645469280bf5740a879bafecf4fd6
968c95911e360cfc72c59caff1a8f7b72ef9df3e
24248 F20110218_AABGVO pan_h_Page_137.QC.jpg
6521fe996b79b889944c499a577dfc44
7d288c954a3564fb2e008b46943813ecdd3ff1a2
F20110218_AABFSM pan_h_Page_075.tif
1f35f9ebc4b304caaa23218366dd9caa
cf5fbdd597d17b3edf82153ef91de343aee82817
23903 F20110218_AABFRY pan_h_Page_011.QC.jpg
bb7a60c1d6f3471832b4211e4fb02de6
5b2da745a083d2777a552cea89955d7bae4d444e
20671 F20110218_AABGWD pan_h_Page_174.QC.jpg
792a6a172c11fb90c46db2856d037a75
ea9fc38543a9747bbd74737059baf357a03a9041
26218 F20110218_AABGVP pan_h_Page_138.QC.jpg
c22cd99ba8105791f685397916e77e2b
17d7710583b7d8ccc4fd772deac3f29cc818c480
F20110218_AABFSN pan_h_Page_178.jp2
0ee18203043ee04ab1b23656b8eecc4b
9e340fc05d59ff27900d4fd872a4ab1de2612426
101734 F20110218_AABFRZ pan_h_Page_098.jpg
b6c4c3c96a8f6590648f850e951874be
ac2ccff1283e27bb45d9d9b0c2dfe49fd56d3c3d
F20110218_AABFTB pan_h_Page_001.tif
ba9d88223636a1bba812bc2c9d9183d1
cc16bc173d078c0563372605a7bbac7ca8ffbb22
33851 F20110218_AABGWE pan_h_Page_178.QC.jpg
625f864cac965c443ca5de9e2d7c14d8
4f4128c41661983173b33107418e0fe6281f8861
32445 F20110218_AABGVQ pan_h_Page_139.QC.jpg
ff3db8f6498f86042342696363925c4e
40f3794ab92a6221966996d5b61e072169fa7512
101366 F20110218_AABFSO pan_h_Page_038.jpg
5cae76ab4b88408e54d5da86f45411b3
c1d8ac3b62c4f48f95aeb1f2ff683b15353a9936
F20110218_AABFTC pan_h_Page_002.tif
2d241935b7c0a083dcc40a97a1e15da6
7578d78a3c6c22d61ce67d314a001087c5e22c6d
39178 F20110218_AABGWF pan_h_Page_184.QC.jpg
f0946f97276c3c0421ab0bb8b9efce4c
7e02e443cbb729008511b05c15d1d4041ce82aff
21376 F20110218_AABGVR pan_h_Page_140.QC.jpg
cb955de7bbf19d85e8387e4ec32cc2bd
9fdde560e1eea76630934b409591f1c2edb16a81
F20110218_AABFSP pan_h_Page_008.tif
5fa113195503082654906d56078fbf8a
23f4cc42cde1e133735cfd49e4650e1bdf125ab3
F20110218_AABFTD pan_h_Page_006.tif
78187e38e3cf0c615bc18e2cca2bf5e9
d8d14d2889c0deedfa548b18bf07324eb904225a
36379 F20110218_AABGWG pan_h_Page_186.QC.jpg
85bdc98daec53366b6902ae84d65b17a
73e23c9dc155aa012afe4a1b3acaaa2db1030088
23967 F20110218_AABGVS pan_h_Page_141.QC.jpg
16d52dd5e7c3da03843f76bf14e9c90b
26499c0f4e0069e602f0bbfdf4e967d08cc4a1ac
F20110218_AABFSQ pan_h_Page_170.tif
397a54131a5596655f6b9187f6cb9bf9
61c2635ba9ade0c713d9eefa65b76cb5fc73f96f
F20110218_AABFTE pan_h_Page_009.tif
e760feb6fab088526f67bc659cbea057
ecb08a1e7adcfc2345d0d4180686999cfaaeec5a
36970 F20110218_AABGWH pan_h_Page_188.QC.jpg
1bcd33e23fa55b36b6a386aaefac815b
b593f36cd37a97b207cfc8743f82b88f37fadd0d
28853 F20110218_AABGVT pan_h_Page_144.QC.jpg
a1a64a1484db07abda19cadce90f3ea0
67aeffb5ed7421ec308d705b0930d230dbc2e598
34633 F20110218_AABFSR pan_h_Page_077.QC.jpg
70169cb6f031924f1b366c69e1284479
6339754c788c071b65e5c22b7f5f98b6bcaf1d2d
F20110218_AABFTF pan_h_Page_011.tif
ed14534285b5dbd3c096fa2b2d50b153
94192b7c53dfef712ce778095ad56e8f6c19c2f8
37864 F20110218_AABGWI pan_h_Page_189.QC.jpg
4777d50ff85cd85b3db1abc97f431742
558693eabeae81a0c9ee4adc038682d5f6d3375c
26121 F20110218_AABGVU pan_h_Page_145.QC.jpg
db61fa951bdcd10f7dff0bfa5f68ed46
11043db0963dd272434eed4b38a6879f75e2f933
1095680 F20110218_AABFSS adultmodel3d.mpeg
e1a14388d2a87707158a95aee30fda1f
d041dd309e44a0e0a92ae7a4b91ee822d63b047e
F20110218_AABFTG pan_h_Page_014.tif
f74af6e4c9bf1cbec44405dd97f5f838
b02247842110780641827383b3deb14c1a9a8d2c
37784 F20110218_AABGWJ pan_h_Page_191.QC.jpg
0b936ac1256295d63de371e6817e6bde
43934961d545356136cc3afee433f5e1d185effd
25766 F20110218_AABGVV pan_h_Page_149.QC.jpg
cb6e5ba0f552c130463f29f42ee3ed5d
55cab6481c0623de5be4b61b4bdc146e54593017
838934 F20110218_AABFST pan_h_Page_135.jp2
91f0444b24292561b21091b069236a08
280a425605b0a6fb473f9baeb4fe9d3beb8e3abb
F20110218_AABFTH pan_h_Page_015.tif
9b2ecf83324ef372f98c0547ad90fe76
dbf7c26889659a8e886522a00d1d5a2792f2a646
38073 F20110218_AABGWK pan_h_Page_192.QC.jpg
a4ec3a52d2a775f9020bda8b46980dae
ad7436db64c05507da32e56d3ceb58cdf155312b
33553 F20110218_AABGVW pan_h_Page_150.QC.jpg
0a49de139bb6655f0a93eb400dde983a
b3a17234db65dc0a5d8677b33879423efed69409
F20110218_AABFSU pan_h_Page_202.tif
ca287bbb52f41bb6677b90cbf632ceca
ed2f278224e853a085375b22160a0908bb25074e
F20110218_AABFTI pan_h_Page_018.tif
7133b7b8acd4784ddb38ac4f95e2eff0
d6bd5316dda4dce829bfbf12caad037285f4582e
37913 F20110218_AABGWL pan_h_Page_195.QC.jpg
bd9a618a8e02988b3a1284ba4af7bd74
f714db074474c48d61f8812c50e56b335c829bf3
17691 F20110218_AABGVX pan_h_Page_152.QC.jpg
7f824919f208c19a75991033505e4407
1cf8607bda018f278c4fc63f600ca084ac31d68a
49970 F20110218_AABFSV pan_h_Page_161.pro
6bdddf8e407d04389d293efd403f1784
29b487bef808b3827775c82c7b96d9450c0e5ee0
F20110218_AABFTJ pan_h_Page_019.tif
aea49839308e978aec4cec983dcf2b93
98805d3b9da2c456af941cee56b952dafb048acb
6042 F20110218_AABGXA pan_h_Page_007thm.jpg
144457f9160701a3180c524f95674526
136306e88f968d2e1f004c1827688b81575b4833
36096 F20110218_AABGWM pan_h_Page_196.QC.jpg
ce39fe0d1026fedfb47418766a3ba483
094b7320a58d1ba004d6d6a346ed24567dded4f0
29983 F20110218_AABGVY pan_h_Page_153.QC.jpg
4a9c2e783364caa25487fd860f2a01c0
abe2e1ca506a05a460804a1e6b81331efb93c960
1386 F20110218_AABFSW pan_h_Page_078.txt
a73466cf789758b0049895ba35231d5a
ffb930e61b7d51313c34fae4f65348a3cdad6631
F20110218_AABFTK pan_h_Page_021.tif
eb6c939fb0c8aababbc75ef83e92230a
461e4f0ad97622b96f59780baabd5bb4391bc4b2
2593 F20110218_AABGXB pan_h_Page_010thm.jpg
054e1556e723df50e00e137437467769
b7910f61c36433fcff765243c72c47c228f9903c
35780 F20110218_AABGWN pan_h_Page_200.QC.jpg
41ebdf35acfd405c88c6340440d3999b
5ef7d8be84a05a79fbbc1827beb9e09b879da0f7
26196 F20110218_AABGVZ pan_h_Page_155.QC.jpg
ee3bd7d86b0fc2c6f8b80e3c2c71a140
0ae2b506b9105395d665372824a95b237e5a20d3
1022 F20110218_AABFSX pan_h_Page_108.txt
adf9dea75d810a808ee554e3ee269dc4
608f830fa264d7e23c29ff8de2390ae1cfa7c158
F20110218_AABFTL pan_h_Page_022.tif
89365bcd4b5ceb23df467824cb84fa8c
9f7bf8826608c81bef057b66b983e57cdd656b93
6006 F20110218_AABGXC pan_h_Page_011thm.jpg
018ca40e304b953905affe21a002c716
35cc8a538a1a0a7ef04a0cc038ca4b6db3e2df5f
35323 F20110218_AABGWO pan_h_Page_201.QC.jpg
d95f90a2557775baede25a06ef2490b7
95233e48d8a394683f8a4116964e6f4690bb515f
245529 F20110218_AABFSY UFE0013783_00001.mets
a451b162e70c5ad48e97b3c3a8a34b46
0d23f58e1b209c1fedd130ae9573ae6581fc6c03
F20110218_AABFUA pan_h_Page_047.tif
3e81c04322cf0236245b89ea8af897ab
3472245ce6ff3352504413fbf12cb07936e6b999
F20110218_AABFTM pan_h_Page_023.tif
396c4a64c71022da52d305c6f638eb15
5490b929cfb6090f6c8aed0bfbff657ac826469a
7625 F20110218_AABGXD pan_h_Page_013thm.jpg
6b35f179f292c21c9871768f2840d933
778ef04b08eff71658e3e217031f0a0dd17efec7
36342 F20110218_AABGWP pan_h_Page_202.QC.jpg
80a2d691445decbb13d74b0c58b295b9
6abd87db2c9dd1312c7fffb1ace851a438000a89
F20110218_AABFUB pan_h_Page_048.tif
dab04a09a7c665dd321d2ded08628413
e66955efc14d3f08453c2fb78a48269718c57a99
F20110218_AABFTN pan_h_Page_024.tif
6ce8b93f02d5b90ae5859d69bc6b5aa3
9ce13ea98f8ebc11c14f784cc0706123e410e200
1568 F20110218_AABGXE pan_h_Page_014thm.jpg
e94722c752d1fdbdd222431a3282615d
d01cb2da095674bfaed8c51463e0ba10751d1b9b
34384 F20110218_AABGWQ pan_h_Page_203.QC.jpg
9b3d251aa2412339e0a4c2fe5e9d5575
12043fe672f84070174d93e1fc0ccc1fadf7fffa
F20110218_AABFUC pan_h_Page_049.tif
43836b8cc3ab19ba79b040f27ec121b6
e3311e651e0d86671c450ec166c42de13f838587
F20110218_AABFTO pan_h_Page_025.tif
c47f889d7d443b6924c394a88f835910
ddf9865b083499aac65379fa15c68e3e1eb4b7de
7952 F20110218_AABGXF pan_h_Page_018thm.jpg
36dc5887d85d1cfbe3c1f91f08c083e6
710eb0a80c8314e1f0e8151663d81662c1a01cf2
35717 F20110218_AABGWR pan_h_Page_206.QC.jpg
4a897ada5e4b5aa5bf9fe5822f3cb691
718efb738b10fc84ea4ba6c31c102e87700bbe17
F20110218_AABFUD pan_h_Page_053.tif
5741e25499d7a8368a2184a2a11d7368
9c018ad525d79cd62d07bcb4c8e655713189b14c
F20110218_AABFTP pan_h_Page_026.tif
cd4deef16c4f642e0291ec325c5cde45
b134fd75310e78433518384c39b436976553a28a
7147 F20110218_AABGXG pan_h_Page_019thm.jpg
fed9df95e8a406f8b28556d4a3512f4e
0fcbb286620ef12166c6b096284ef2bf6d830d13
34819 F20110218_AABGWS pan_h_Page_207.QC.jpg
49ed5d821eb46cea7cd7976ea9722c1b
5261002bf6e65162d5d30d60df01ac924bcda74a
F20110218_AABFUE pan_h_Page_055.tif
9c217ecbb73fddde0740899bdf764e4a
2a5214e396eae052d2f709fad34f45e18fdedac3
F20110218_AABFTQ pan_h_Page_027.tif
8957291ab3a0331d2e0d16841e9aee58
93ba5894d200c04176f9a6c5b103c408bd55b7bc
8451 F20110218_AABGXH pan_h_Page_024thm.jpg
97cb294be225e57f6dbe364744acfede
3868ccea29897af46d11d2c22a99160dc70236c1
38750 F20110218_AABGWT pan_h_Page_209.QC.jpg
5ceecdfc347fdb92ae1bc6b59f3b5f62
fe06919f1baacdeafe464cb95bff62c14a2e2337
2018 F20110218_AABGAA pan_h_Page_110.txt
e6eb5ed3786dc5f4cf6e2b4c9e2a0a9e
640919297c5402807f1bce54d17d27ef8e49930c
F20110218_AABFUF pan_h_Page_059.tif
39314f3e0efb523cba9e8dbf920bc7e7
ae041d47e97e7695d3a0b8e4a0b7dcc3b2a897f8
F20110218_AABFTR pan_h_Page_030.tif
6a21bebb8935bafa1bb3f85152dbc887
075e51bceb14ddca908b501197c0ddec8206924a
7815 F20110218_AABGXI pan_h_Page_026thm.jpg
7a98b9b2bffd91dcc8cd313e26b8663c
649fdaef7b5bee61fb1479d94531d7ef4ce90042
36291 F20110218_AABGWU pan_h_Page_211.QC.jpg
7aefa2a4e453055bb704821b0f63f0cd
3d6bdfea40c68723b8d4ec0b8cf90464a1adbd63
1898 F20110218_AABGAB pan_h_Page_111.txt
7665b7735343a21801cb8c4bb671c704
d4274b1d73ff4d79c0652df51c3ed295fb43e6e1
F20110218_AABFUG pan_h_Page_062.tif
0422fb1742a698542ec8410e65392117
d4b2442887f775e12b2969d2be71ed8693054988
F20110218_AABFTS pan_h_Page_031.tif
75e6bcfd1f535fa5a4113ba690d49599
4153d83717bd3539a5deced9b67959d550e6d4ae
7810 F20110218_AABGXJ pan_h_Page_029thm.jpg
f3be66ecab9339782f04701aa27c2210
392b5b3b73cc6d7c234c21071071b7c737e361c5
11058 F20110218_AABGWV pan_h_Page_212.QC.jpg
501f9776baaecad3fb0983f9dada24f8
108aee92ec2a5158a2b15546c8680f7e7bf2aee0
2032 F20110218_AABGAC pan_h_Page_118.txt
f75cdc4bda50872241727dbe9ae8cbee
6d44d2f683ad1a72c8ab913ab9dbfc20664af6d6
F20110218_AABFUH pan_h_Page_063.tif
4286ef1cb5dbb8bc624adf8486e7ca79
5e5e598c545fe9c9635e1fdd8bff15ae494c3085
F20110218_AABFTT pan_h_Page_033.tif
04fd875b7a61cc9347c762ac3ef91f38
87a77898e59dbf70448b8508cd916b422cc16629
6411 F20110218_AABGXK pan_h_Page_030thm.jpg
eb6d2c7e3c153982f485a44328707369
553fdaf5243a5d3f1ff992b1793bffa1a7839ba2
8065 F20110218_AABGWW pan_h_Page_213.QC.jpg
d6a4bb21e4452fdb19705820d1b22254
e3c4386a60a1f4ced6bd65582c75a40e4b208ba3
1935 F20110218_AABGAD pan_h_Page_119.txt
afbe019859b8980b71a53839bf0b60c5
647f781f68ef8fe2b34efcb9edffff14aaff22e8
F20110218_AABFUI pan_h_Page_065.tif
c177cc75983190dbcfb8a305c7d855be
f4e8dec2de57891cd0f3cec4cf1ccf42e355585e
F20110218_AABFTU pan_h_Page_036.tif
1ec322a5edac263ee0eec57f7fac38e4
2f0d59fe86316db5278218983722e3f0f687f806
6766 F20110218_AABGYA pan_h_Page_073thm.jpg
2201058a10393844cf6603973fd71f80
e6a59df2d11ad829d405355b93e7449c5a0b096f
7241 F20110218_AABGXL pan_h_Page_031thm.jpg
179713fde7a1639ff9cf0679f40b46e7
90d3f82628d8d0aa6751814503a08e54066384ab
728 F20110218_AABGWX pan_h_Page_003thm.jpg
e368d6962e61e3d1bb1f0b7952ee0e67
0bcba982d81ab1fe81578f49f0ef8ed8f1cf87f6
1980 F20110218_AABGAE pan_h_Page_122.txt
e6af070ff448f223800a766633ecaafd
2dc059516a55e61594f30e6f48f559446eb5fcbb
F20110218_AABFUJ pan_h_Page_067.tif
0847ca7f56e7ba7a9d242d37946673de
0783fefb58f512114ab4376b2b6dddf35aec75f3
F20110218_AABFTV pan_h_Page_037.tif
5d27648f082d21e5ec83b49066d30900
7a6f6430e737d1f7f714ae83d8204fa820d67265
7921 F20110218_AABGXM pan_h_Page_035thm.jpg
c53de3885909782b9f240a920c082e47
e617c4c53eba6f95e97f9e03fa69dc08d0d194e4
7446 F20110218_AABGWY pan_h_Page_004thm.jpg
7a87bcdfeba3f134e2dde5a0d8f94aba
e2a111adeab9f3a9eeb2698689059dc02295a29f
1453 F20110218_AABGAF pan_h_Page_125.txt
230f2bd51e9811fe285ce2e7911f326c
96cd7c40fa9808e64bd8970bff98c743864230f6
F20110218_AABFUK pan_h_Page_068.tif
7edd437cc912ede181a3a2c287888296
6f7fe52bc5d90b9ec3133e7fefde87403ae2ae2f
F20110218_AABFTW pan_h_Page_040.tif
3376f4455ac87e259f2a0e3a4e54f1ac
49b050689b659a7b9c7453f6306370ef862f42ed
8162 F20110218_AABGYB pan_h_Page_075thm.jpg
06a33105443305c1ea5434da4d35f077
51265bc28a8803bee28964cbf4f474cd25923f33
8132 F20110218_AABGXN pan_h_Page_036thm.jpg
168a83a9ccf48f054ba174aac9b3844f
bda181d8b80c48332f67253e9e78c09ded37fafc
2949 F20110218_AABGWZ pan_h_Page_005thm.jpg
e81c3ad2eda3c5f400061f43662cc09f
108cdbdfd2171e7bb6dfb77cdbdfa86cf5b4bfc3
1478 F20110218_AABGAG pan_h_Page_127.txt
ce4798a22f8d094d1686e58a84d6ca96
b2aaa10de6ae98bcb9d1a1155ff3e47e04c09859
F20110218_AABFUL pan_h_Page_070.tif
33bf73972423c0924644deabf2f99267
a2c4dd1843e17f99206de38bf812e7ad3ab6a34d
F20110218_AABFTX pan_h_Page_042.tif
581b3477c954ad5352526a51d96cd848
d2a5172d7352530c0bf59a4a8c065af4de5cd898
8617 F20110218_AABGYC pan_h_Page_077thm.jpg
2fc13d1797c7b8d627d35c124bd329f6
1630338181bda14269e42ec4d2cf37afdcc8c52e
8054 F20110218_AABGXO pan_h_Page_037thm.jpg
15d7bcb3b9da9743724a0dc8079c6984
270a8efc547583b45c3c812a01973cc286a0d108
1597 F20110218_AABGAH pan_h_Page_128.txt
bbba2dbbc2c6963f4fb27e2d45f83e98
2e297e7cb7db761257365a99d4e78facdae33d0c
F20110218_AABFVA pan_h_Page_094.tif
d89102333c198a47117f4cd27cc35edc
7f278515a695dbf43d060057046915f5a1232ada
F20110218_AABFUM pan_h_Page_072.tif
d44876475b109f4ce99e66f735ba0d4e
a662a01d8d76d84c87828481f4eb3e06f4e12d95
F20110218_AABFTY pan_h_Page_044.tif
5697ba0241c7c2b11fb4b37d799b93a8
5d6226bb17c8fbb81ef8f6bd028d7bf301fd9979
6653 F20110218_AABGYD pan_h_Page_083thm.jpg
93ee785ef56b7767635704449c47a598
4bf5edb0498d8425d2a3dfaf2b3cce4325fef036
7309 F20110218_AABGXP pan_h_Page_043thm.jpg
7c1fca3fb817dac77640e023390af3ae
723aaadb4ebf8abee1be0073bcb2f1e347878502
6622 F20110218_AABGAI pan_h_Page_129.txt
1413f3d90dd18ec032ac77b588a61944
cf04e639dd75531ae3dce1695a34f5dca210f4bf
F20110218_AABFVB pan_h_Page_095.tif
9ee2b7dbc91e8518a6548343b14dbb48
0225eb786da77edf5a97ce964121e08590808087
F20110218_AABFUN pan_h_Page_073.tif
1741533f718793a0a98b04afc13aa255
fdeb9d42034d47b0940f549623e3bf6ee3357579
F20110218_AABFTZ pan_h_Page_045.tif
7fc6bb539903075a44f6dd01c82663c0
96da7b9c378add10c692ed4db165146b919a2cbd
5363 F20110218_AABGYE pan_h_Page_084thm.jpg
650560517cb2db82d7c2b4d285b52085
bfbaa08a1f3b18c5dd91fbc250750ef7d7f480e8
6377 F20110218_AABGXQ pan_h_Page_049thm.jpg
1c4b2f08de846983fcebf2b42462a07f
c0f3f1ddb7c534feda3a9fcb565ab3689eae1882
F20110218_AABFVC pan_h_Page_096.tif
ed2e2e27855988ca0e1a4156b2aadb94
42b0030e49c7da1160c192d18b7c4c9ff32b8535
F20110218_AABFUO pan_h_Page_077.tif
fa90af7dd67981f41b4dcc9c741a753a
c5f6c068ca3f8162d49f6f7bc7876f107d19f1b9
7436 F20110218_AABGYF pan_h_Page_086thm.jpg
72d007180bf5e3ed8aa16c7a4a4aed84
fffa3218b1ef6d565581562f60ce76ff7a9d822d
8137 F20110218_AABGXR pan_h_Page_051thm.jpg
99703bdd1e1060882b60e43a58f945da
3cc115e8d6d1e9854582fd71a2ba4d4616c5ab6b
870 F20110218_AABGAJ pan_h_Page_130.txt
3c2a61b19e30ab28695ae6b43d652d92
2e277d9a05f2ee5797a135de559c86dc0420a5bc
F20110218_AABFVD pan_h_Page_097.tif
7c8050006a18549700707a6a32b17153
641dbd8cf6fc5627df54323393945c2c45f12fa2
F20110218_AABFUP pan_h_Page_078.tif
d336c7f8a39ef9338bed160814099d41
b829980186926aa86b4328fbfb264f0349cdb631
8661 F20110218_AABGYG pan_h_Page_087thm.jpg
502297f5752436e9cd6e1c3a2aa56879
d0f245d46e961056f864f43fcbc1f625918c0371
7927 F20110218_AABGXS pan_h_Page_052thm.jpg
9318a43051d8ab7dc3b08743339617f3
7004cbe01f4ae88a55ed23b0f3c52da871433d91
1340 F20110218_AABGAK pan_h_Page_131.txt
43a0be7d30b051b7a210b1d99f86b83a
a2cb90fdd28fb72613af9fd2ad5b8fb9caef15ae
F20110218_AABFVE pan_h_Page_099.tif
6633cdc25368ab7946272e93634331a7
a186f73a2b141be2c0eddd9d6236e98971186b11
F20110218_AABFUQ pan_h_Page_079.tif
74e4d5fbe350f5b11feb975d8f7801f4
12eda7592da4050ec56fbe9b1684338c00977fa5
6643 F20110218_AABGYH pan_h_Page_089thm.jpg
8acfc2e2eea5298d77a6a0c182704096
1577b299e83c70ba47e23e50097c992018f2da49
8205 F20110218_AABGXT pan_h_Page_053thm.jpg
adaee62672c1eb5d2b585cf133447fb5
4e58f38f2696c273aae0a70d232908b1af01c7ff
1970 F20110218_AABGBA pan_h_Page_162.txt
302cd91bba87f515d7b2f71a6962c4d7
58d1ee9f9d8fe6b4c92f825fa7afb292988e40e9
2270 F20110218_AABGAL pan_h_Page_132.txt
08cc0d03f52e7db68ed6285f319aa379
0eb2fc407938b4b545d24a4838059ef22b01f011
F20110218_AABFVF pan_h_Page_102.tif
9e4ae8e06d9018443d9d33dab911669a
e375f3012c18b322f8c5cd2f331656dfffacd346
F20110218_AABFUR pan_h_Page_080.tif
ca8b123365002b953e2cab399a9b7a55
570156ba1587d2d15a3b3c19522cd531696ef9a1
7867 F20110218_AABGYI pan_h_Page_092thm.jpg
cef54fd70d5f401b0ed20d1e14c5c4fe
c24e5b48969a8f0290d43fe52be23d3b86870f69
7961 F20110218_AABGXU pan_h_Page_058thm.jpg
da546aff74f07f4863b34f9603c7c82e
ca85c5a67ac710b826d5e73423a5971ca40cfba2
1969 F20110218_AABGBB pan_h_Page_164.txt
158e58e9f9aa50d428cb743240bf9512
6d4fe0f4f7288854ec955584131e29386f158484
1978 F20110218_AABGAM pan_h_Page_133.txt
40d89428873f31072b70849ea6f4b641
05f95912f6adcd6674df4023131a7a3c84bfa684
F20110218_AABFVG pan_h_Page_103.tif
fef0e85e4de8cb5b42105f42f1a06876
bdf1f47a69cee5a1e529223c692ed1dc603063e1
F20110218_AABFUS pan_h_Page_081.tif
06942222fe5d6a6175e528b813540b46
238adaad8a488a60963abab0e18a352e3b14e028
7858 F20110218_AABGYJ pan_h_Page_093thm.jpg
bc2ca9d69c298f72b60f58cb44e1c56b
208c378b5311e09d56d41babb48545d843671338
8421 F20110218_AABGXV pan_h_Page_061thm.jpg
b93c1ac82ebbd84edb941d968cad10ee
a017ac04044a8142cc85e3c9975dac2b6571bb4a
2036 F20110218_AABGBC pan_h_Page_166.txt
3ce416d15a1ac4dc1f0c27ce9edb84ea
a43bd86261593072fe0f677675bcd50c7a8158b5
2275 F20110218_AABGAN pan_h_Page_134.txt
d77e14d40fe40fc55faac92eeffe4b4d
da8c2548eae07791acbd9843a881ff7cbc77a21e
F20110218_AABFVH pan_h_Page_104.tif
7a3acbab9b39736a374cc43906bf56cd
471ea5223ce7b7ceb1346b2e1055e0056af9c3c2
F20110218_AABFUT pan_h_Page_082.tif
5d9c0ff4e22da0695a7c06b0156be0e3
3ade9c671a3c108afe7d72a4e275268eed5d85db
8472 F20110218_AABGYK pan_h_Page_095thm.jpg
e1f3abb6144c19a2eb0aacba13df8ae7
415584ac131c187e132e647085aae5453724a2fb
8064 F20110218_AABGXW pan_h_Page_062thm.jpg
f441e5d202d82c5d57edf74947014bf5
64ba8276b41b12c01d173e74856d5497757ca31f
1995 F20110218_AABGBD pan_h_Page_167.txt
7a6633f6a496bd312df1b7cbd1e58d19
7df7d7023260907a5ddc6d4f2248f6644d3f4c85
2118 F20110218_AABGAO pan_h_Page_136.txt
d2200f7f40f1fe70ba8bfa6013982dfb
b753532d75ae58ca82b48e1180905627f8d4a32b
F20110218_AABFVI pan_h_Page_105.tif
7de7656f71a3744149f32bdb82df00da
319e3db8b6f4842b33ea220a83861a064cbc7c71
F20110218_AABFUU pan_h_Page_085.tif
9a3b823b219482a9188e5954404cb4fc
89544a585898bd9f2f14d89e7436779f5f043e2e
6703 F20110218_AABGZA pan_h_Page_128thm.jpg
79392eb87204bb917b77cf5f59eeecbf
905bca99eeca051d16eea2cf74f985aef2c8cce8
8501 F20110218_AABGYL pan_h_Page_096thm.jpg
66a6324a8dfef6e05284d26da838fcf8
9febb39d5ddad650422ff229e90bd12780e67fbd
8034 F20110218_AABGXX pan_h_Page_063thm.jpg
45100d00614fc74ec170f503e63c5858
b4ab2fdf72622fbe680e9ad6cfafebe8a7ae9f6b
1961 F20110218_AABGBE pan_h_Page_168.txt
013a3fbcd41cf56089e0d382bdadab30
30821e3e9a879722855e97f7c6b8946b5f5fbc30
1547 F20110218_AABGAP pan_h_Page_138.txt
85b64f8a25d517c2a45b4649c220d131
85d5c57671ec7b4644c6aa762414f86391f69b0a
F20110218_AABFVJ pan_h_Page_106.tif
a800d9c8965de8fca7ea11e412224357
0addf8bb1bfe9fb0e020be9dd63ed8e7256c2238
F20110218_AABFUV pan_h_Page_086.tif
e91565a11a62b10bd073a5911af2442e
6c17ceb4f4e72c73b68d3f8bd6602c2695742638
5391 F20110218_AABGZB pan_h_Page_129thm.jpg
4663b3a2659505d02aada89b899def6c
8ba1f934a69fb056d8dbe135f01124a3db15cb9d
7762 F20110218_AABGYM pan_h_Page_097thm.jpg
9db5e26733ee85b56fb4293714e0c895
8999b7ee67c11b62870901e8f4d36afb897c7924
8389 F20110218_AABGXY pan_h_Page_064thm.jpg
c7f1906e51ccff0ef1f29824a72dc0e5
2f57ede875016771097b3b89fbdf32c906af54bf
1912 F20110218_AABGBF pan_h_Page_170.txt
ea84eca40a0636e69f535aaa5d1a255b
0e0b68f30b493ea588637d286f08953264102542
1940 F20110218_AABGAQ pan_h_Page_139.txt
5e5cebfcfcbb54e5f8b30f5c9b368329
bb730242eda4d5b46cb3a4335c3276a3bd7420e0
F20110218_AABFVK pan_h_Page_107.tif
feba83c19bf815da4a33b0293f592bc0
eb46b53041c7215ee1ac0ebd43e9fc2a11a3b162
F20110218_AABFUW pan_h_Page_089.tif
2812d33a56a0ee15075179cf4c658fe7
00cda76a58cc2636848869256b56aea9528ed13d
8060 F20110218_AABGYN pan_h_Page_100thm.jpg
77c936882a0eec27fb102ef4e03aa614
d895d5427fd2d47e38a932147cec95a587471833
8482 F20110218_AABGXZ pan_h_Page_071thm.jpg
8190cee6ea87e31fd6a45df4d48f30e7
6ec32eb6810eb1daa101b9e145458d6ee1e5a8c1
633 F20110218_AABGBG pan_h_Page_171.txt
4c70280bd4733460280698afbe3249fc
4552b034414f98f7b381048d9702e008d066e81b
1989 F20110218_AABGAR pan_h_Page_148.txt
5a9a104c544301e21d556e61cd992e23
e3955449c99c994c8f5beb7c39f54ac59089afd0
F20110218_AABFVL pan_h_Page_109.tif
763db7cb125b3e1a34ddfcaf3dc56ff6
3fe1110ca81be5a6a7bc3c361cc301b3ce089f87
F20110218_AABFUX pan_h_Page_090.tif
af422617d922bfc2dc41a10209d049c4
4ee9be32fcc15dac906168f4294dfb8e1869caa9
F20110218_AABGZC pan_h_Page_132thm.jpg
36212cc3aab08dabb526206808fc6914
c239b97e20c1e3a5c57cb5f3361a1e33f9805c34
7566 F20110218_AABGYO pan_h_Page_102thm.jpg
337a32e816e0148e2663935b511a8b28
2bac1d17a404a250da68028e4b2a3ab1435cb65e
1631 F20110218_AABGBH pan_h_Page_172.txt
310479b7c1143b1c8b9b8614b50ce672
7bda65d10afa51fc4d16b740390ee1bedba65ae3
1944 F20110218_AABGAS pan_h_Page_154.txt
e98b02b1276b886598257bf80b7ecf4e
8b75f1b6514d01deee2f85f133d83fd90a694a8d
F20110218_AABFVM pan_h_Page_111.tif
14d111bedbcb555ac1d0fd31d1b1835d
22960f6010eb8ceb2fbcc859bf368d9061f0f814
F20110218_AABFUY pan_h_Page_091.tif
43808dcb25cb132d859445b4b86a8294
429720a0df21c764e053993995393ee890c0cfbf
F20110218_AABFWA pan_h_Page_134.tif
e493fd59402805863d14fe2081a13468
9bf39f35fa577eeac0904da1ab95625094c6c9b4
7239 F20110218_AABGZD pan_h_Page_135thm.jpg
c5386ba37c1ab3b5fed6252fbb554c47
363f33507dc5f679950efedee07197d6aa4bd741
6537 F20110218_AABGYP pan_h_Page_106thm.jpg
e5e165b79bf74a4fca178e5c82734952
c37d8cf4301c563ba0ad8a6d16513cbb1cf46078
2611 F20110218_AABGBI pan_h_Page_177.txt
97821af0dccf0937fd7d478fbbe61dd8
f0cab24774f4876ff81890a910d526e4809a85db
257 F20110218_AABGAT pan_h_Page_155.txt
0c1b6f173f8e6e513b05cd9b0af035bd
83c69e115b656eda0ad5baac2a0034be12dfbdb7
F20110218_AABFVN pan_h_Page_112.tif
a1910a000b248fc5c0f76b1cd699d653
423c83521f71ea3223b2c99bc0d81de38b157d40
F20110218_AABFUZ pan_h_Page_092.tif
283b814e01c1c26081b920c1bb0a1b71
45bd7e23c869f2823da533ae6675608ba686c776
F20110218_AABFWB pan_h_Page_135.tif
ba869dce1f4c7e7d4661d8fcd409d2d2
4273e3f35314cf839bd238fdebe7a469f0e04999
7180 F20110218_AABGZE pan_h_Page_142thm.jpg
9c40d7c80505eb4e4e1f8d8ec0eadc3e
8da993d8811d58510041d60b5309fb18d49fca92
7898 F20110218_AABGYQ pan_h_Page_107thm.jpg
86e830841378845157912b070417c70a
fcf2fe2a0a9d89c31f663350e05a15f8a28ca3d4
2436 F20110218_AABGBJ pan_h_Page_178.txt
5041533d9e270560134cb41ac2f4c3ae
c9801ab61f49a35e47632b5001d95431713b1b4b
767 F20110218_AABGAU pan_h_Page_156.txt
f27ada2d3374834451e7a22b4a88ac44
9a31e713fae2bdd04fc870e5f0ff0bf24b5ac5a8
F20110218_AABFVO pan_h_Page_113.tif
230212c29d8648396a966c1032c5a0ad
ef262e83a00f5fc0efbd4e9d2a0897df05ea71ea
F20110218_AABFWC pan_h_Page_139.tif
0a93100722029d4874950a8fd8a9c4ed
ceb528b8951f2f46d6cad100001466b260c35ae7
7080 F20110218_AABGZF pan_h_Page_144thm.jpg
e5191ae5c5a41927fff0890d41abf84d
469edaa89fe38289d0ce869ce39f28ed986b679e
8723 F20110218_AABGYR pan_h_Page_109thm.jpg
d057ed96db8534048ecc8a07480f9ba2
f3b58f19d141697f9e7251878c0598cf06183daf
1780 F20110218_AABGAV pan_h_Page_157.txt
ceefed2f3feeca71517db3d826e1b254
b6939c83222ee26e71220c365b462183f7eb3747
F20110218_AABFVP pan_h_Page_114.tif
83a242fec63123001590ab0a75580458
a7222d02248172deb4b8fd6c18d4f8f24f85958c
F20110218_AABFWD pan_h_Page_140.tif
68b4bf9faf33c2cb328c2561a2e253eb
0ac009e9fac6aeb1e42f894058813b1c77cc3854
8447 F20110218_AABGZG pan_h_Page_148thm.jpg
042d866cc1f3e0f630b8fe5dee205859
0ba78d1fe7866966d1736a0ac8f9701c7acc6103
8461 F20110218_AABGYS pan_h_Page_110thm.jpg
a201a8006845ad3db6fce9afab585cec
fb144b214462160a2aeed48a749932fc97bea60f
2644 F20110218_AABGBK pan_h_Page_179.txt
b1bb325df1c8ff76914326b11c43a94f
436f6c00f6e3e3d99392c814e273d11756b506dc
2016 F20110218_AABGAW pan_h_Page_158.txt
82b77235fb88761bebf83840e00f6f90
0a494bbb86eb4976ffb870ad0267fed905cf53f3
F20110218_AABFVQ pan_h_Page_116.tif
9556fcb3eda5755330d6ce2d1e92a42c
abd5302baaec4b7c28ed5bc79157ea05c87b300d
F20110218_AABFWE pan_h_Page_142.tif
530cc5a7b6de500a70a14830669075bd
d620ae29b3a76b716a59af19c00845b107bab458
6782 F20110218_AABGZH pan_h_Page_149thm.jpg
d85cab9a591b2c2a69c99b132e213026
b3e9111f098cc5a9120ee65c6ae15f20eb862b34
7829 F20110218_AABGYT pan_h_Page_111thm.jpg
eeeda5a70a601efce3057bd4870ba6ae
4bd1ff8bbf55e86cdc40e900cdbcba3fad099fb5
2687 F20110218_AABGCA pan_h_Page_205.txt
0e1339974fe4541ed43358685d81dcf8
b2103281be4ed96b0d3fd3730a9da53c791e77c0
2805 F20110218_AABGBL pan_h_Page_183.txt
a2cc32c140b500180416e2e496d46c9b
797d0e50b314e8c3582c8b92014158a94a587a8c
F20110218_AABGAX pan_h_Page_159.txt
235ffd5c5d39a609be5cdbdad4706884
da78315db6cd0049e6bca6ec2e374752f3839d47
F20110218_AABFVR pan_h_Page_117.tif
add30ced8462c8fd20f2b08992a955af
d251a3e410d96b3f9344b8a4b1510b0364500ccc
F20110218_AABFWF pan_h_Page_143.tif
2b92f6d7d303f29b7a86091009292eb6
e393997d3dd35aaf6902ca80147b6c3e0119f17f
8489 F20110218_AABGZI pan_h_Page_150thm.jpg
6b5e103454bc29e0df473d2065cb5fe6
4af3301ad4f8a079e2e505345ff81a6ad453383c
8301 F20110218_AABGYU pan_h_Page_113thm.jpg
c3b0a7570dd17478096dfe0cf14bb4a5
5fe514c901f040766f8063b46923d28975727337
2632 F20110218_AABGCB pan_h_Page_206.txt
a7c3189ee54e7f7d4cfea21083b3e530
430cf749e60be5ec1447acc6f82a97ff0f15a293
2976 F20110218_AABGBM pan_h_Page_184.txt
0299867393d90d11b4a8eb36c057899b
bb5ffe93d101c3e950cba607f63ed991a00f87ce
1965 F20110218_AABGAY pan_h_Page_160.txt
2bba31553a7beea8208bb7dd16769316
6e3bf152ffe081f78fbb1ab9de78286ed2fb693d
F20110218_AABFVS pan_h_Page_118.tif
096ea25b942f37a080d02319278c2b72
2702c180254148e5d34ba28df524e724d0026ad1
F20110218_AABFWG pan_h_Page_144.tif
e8e7626cb3af35e1116d9253bc78bcd4
e9a41f53c5b73cb5c1a03316b2eb74cc0a43ce10
6060 F20110218_AABGZJ pan_h_Page_151thm.jpg
34f59673a133ea16d8fc028e3424c136
75688526d248bf63d949b1861653acaa74162544
8533 F20110218_AABGYV pan_h_Page_115thm.jpg
d42f7cb47c2d7da4e4227dfd5ec9c9b3
f203b1e27c955de22d52521385b9f3d1fd8ebf88
2638 F20110218_AABGCC pan_h_Page_210.txt
e97d0a5e2558d1d2d76deb4a581d7dc0
39ebfa2624a53bf20818f36b23d8ce7989299c3d
2711 F20110218_AABGBN pan_h_Page_185.txt
5c43c9bd4cab00862fce2ac8557ba68a
987f9d8a35ef3a80fd428c583f046d07e5565c0b
1985 F20110218_AABGAZ pan_h_Page_161.txt
b9d6f4928e23e6db48ce9510b32155fc
bfa8f5ab305a387904a024f140c3c55d309f123a
F20110218_AABFVT pan_h_Page_121.tif
47d93b099be9f74c4f25a6c8eb366235
a08ec7ec4a541cf1b17cca5af3605c8838007fb8
F20110218_AABFWH pan_h_Page_146.tif
041008afad68d78bfd7580ad5f3b3321
1d8fa42a0c74f4ba8e314e74c73b32bcc2dbf8cd
8035 F20110218_AABGZK pan_h_Page_155thm.jpg
b977a7ca539d68bf01576d85e0706f01
f2e4fcceaa3e3df4009df14c088d0770bd2ea1a5
F20110218_AABGYW pan_h_Page_118thm.jpg
7c8af3fa48a8094cc10fce1908a8f0ec
2b4fa0ee1a1f30d5c0d9028514548f1172b2e4dd
2651 F20110218_AABGCD pan_h_Page_211.txt
228507644cce1bf10852be820f6d9f6b
f7ec2c8f09305533088d5616432f28ad9156f8e2
2716 F20110218_AABGBO pan_h_Page_186.txt
2e99330b840a3bd4997271c43cddca57
bf6034b2c3cef020cf4c99eb9d9b03fb8ae73380
F20110218_AABFVU pan_h_Page_122.tif
8293ce080bc72a99312cc53bd4e07f54
9bebfb3dbbf7a35a62f22af656aee6117dc7bdd7
F20110218_AABFWI pan_h_Page_148.tif
a0c1c00e60ef4ece0b30436923a2ac78
1d8414534bedb72a956eeed6e6cb183e236059d9
4858 F20110218_AABGZL pan_h_Page_156thm.jpg
9209131f43f030eee5a9f0fa48662a5e
ab1890bb88f497c0a0aaeed643117155e3582bf9
8601 F20110218_AABGYX pan_h_Page_121thm.jpg
76bc0da8d70c36ed52f06a60282607d5
870c3c15cdc5bba1c517534ff9d64e7d607017bf
443 F20110218_AABGCE pan_h_Page_213.txt
2a5a96bda073b2a8a7e7172e580f61d1
ceef8c274e18957022ad7441e1a61b781e5029be
2940 F20110218_AABGBP pan_h_Page_187.txt
dbf91db27664871d9b3f126a67e70fa2
3ef50ebed0d5446435e25f7e301dd6e44f2b6dac
F20110218_AABFVV pan_h_Page_123.tif
f5e79b481af8333de390f6b89f35d0d3
7a706e42afe9db9fed4ec2cbf4bf7b2a890320e2
F20110218_AABFWJ pan_h_Page_149.tif
4b07d4260841114d1d401bdcce9aeb17
acce958368b21720dc76c2e2da329a3f7d4d412f
7328 F20110218_AABGZM pan_h_Page_157thm.jpg
1f42735f3739770072a5ad6ceeb773c2
bcbf0d7db1782c2c2fe08645ca60079f992aee1b
7937 F20110218_AABGYY pan_h_Page_123thm.jpg
5ee6a6d678c20d1a56a1c734f17da98d
1c5f939f3a891bbdb39ddaf242b16a8d6507207f
963 F20110218_AABGCF pan_h_Page_002.pro
57eaab8c94ce0a3efcc77be835f9d179
d819c60b1f4047ff3348b1e14e5cdffae9fa257f
2864 F20110218_AABGBQ pan_h_Page_188.txt
27efc7c6cb96f930aeba3bbd98159fd8
95452df50ad96d4a28f3bdf550afd78ade3fd5f1
F20110218_AABFVW pan_h_Page_124.tif
1f64503d3f3f0a89dc65b6eb6ad3542e
54bbe115b525d00017a9fc5f8b103e1200dc0811
F20110218_AABFWK pan_h_Page_150.tif
4415e14c146f19a33f16f11f3e7b2ccb
81c96510ba541e272068f4ca9b70c9271922bfb8
8146 F20110218_AABGZN pan_h_Page_160thm.jpg
084a6171337e85acd137c784e3ccb7ab
f818a7838a32af754541e00a05e85a42eb2f0f91
6528 F20110218_AABGYZ pan_h_Page_127thm.jpg
58cf14fdf11be9b5173a9f774ba979d9
31c6faa344d6bb2032ce9eb78d21aabe34656488
13544 F20110218_AABGCG pan_h_Page_005.pro
10f0734278cdf46c6b5c6b36c763a044
43e455ca4f19ce04d5d6cb973607819c93d6e6e8
2916 F20110218_AABGBR pan_h_Page_190.txt
724403db9538bb97c8430eea69c61e7a
b45ee207d464a52785112fd31ecf5e0a4eda8caa
F20110218_AABFXA pan_h_Page_183.tif
d7eb6443c3032fcd0ff0374fe6f91e9f
7de6a5f61558df56b6c60cb90ee2ea9244f8749f
F20110218_AABFWL pan_h_Page_151.tif
c53ce3daa12164724be37d255916fe4a
f4271a495edafb30c1b6bb3f28b300fb51dd7ed0
F20110218_AABFVX pan_h_Page_125.tif
484c62cc83cca433c3b9b48cc9345dbd
7b38ccd84fc515f4024e013baa64d1088663ab36
F20110218_AABGZO pan_h_Page_164thm.jpg
3c70228fffc9d8cedf638eeff92767a5
bcdc131e24b1028c8868ba2535d37f0751d3cf41
78943 F20110218_AABGCH pan_h_Page_006.pro
433acf47b4832e52d11f5714b10cb00f
83cf86434cfd229a8815926f81bb3019c25f252b
F20110218_AABGBS pan_h_Page_192.txt
64bd8b37e759b99bda6e2a53d95ea4c8
1dfce4a2c10e5f45c535ce9d76f86eafa6937056
F20110218_AABFWM pan_h_Page_154.tif
2bd8b71bb628e7ac101813ae549cfff7
2ad8dd4352dd95b90131caa5ac929674ea01943d
F20110218_AABFVY pan_h_Page_127.tif
bf6a77b83b757737e25eddbb6760a47a
2771ff692f5e5dff2bf348a63b027b075210191f
8466 F20110218_AABGZP pan_h_Page_165thm.jpg
7d09324bb6b1996e2301de30d39f16c7
12b2bb201353785730f1fd58c03db5328534b060
118682 F20110218_AABGCI pan_h_Page_007.pro
bdb96098ee2fead363c835f579db7ae0
a051b197904255d154c5707ec77695aaa5415dbc
3015 F20110218_AABGBT pan_h_Page_194.txt
b8a64a84945efdce2caee14526e45cfc
898b24a8592fd9db53a8bc54deadd9d8e3d0cd68
F20110218_AABFXB pan_h_Page_185.tif
5fb5a62ebe57e4775794eed9e8ec7d3f
2c24ca2483693f57b8119ed04150cdccb9a403ce
F20110218_AABFWN pan_h_Page_157.tif
6114c1962673dd030abb742d61a559ea
cfde8d87665448ef7b41dba87beb7a8894855b8d
F20110218_AABFVZ pan_h_Page_133.tif
471b4d436651254991c808a8bd66548b
a9c79abd0d6d75d62031ca5f4247c82c0c3aff6b
8283 F20110218_AABGZQ pan_h_Page_167thm.jpg
8cd01c629e34c95d6eced8573c9929cc
782fa38f5a7b74efdd7b3cd7e2591c44c2bd96cb
104804 F20110218_AABGCJ pan_h_Page_008.pro
38a52c1fcf15da1a4d1e82ffd080f3ba
558f73ca9f8161acfacda7fe4bda1071b56b89a8
2855 F20110218_AABGBU pan_h_Page_197.txt
132d4a7828af3a8d5fb142f1bf48640e
279986b490073071e90aff08ccf5dadf5dd8a6b5
F20110218_AABFXC pan_h_Page_186.tif
8b6244ebbec855a920494c8ff4003aba
5540414ac556225797e3f5369b41d50052c914a8
F20110218_AABFWO pan_h_Page_158.tif
4f742c4d1bde7796624a92fa229f1969
86604826f454cf8253a008767918ebbc5d9f64ba
5010 F20110218_AABGZR pan_h_Page_172thm.jpg
058cfe7d4fbc16c8d48c1156c9852aca
de878d91df9846dca2a3689ce3b2bdb3228bd9aa
55185 F20110218_AABGCK pan_h_Page_011.pro
c7b8ae2ee06faf321efd72a20b322ac2
93ade019fa5fe850e816e8e83e595a2ec2c9b066
2973 F20110218_AABGBV pan_h_Page_198.txt
a41c69e8a9119341086ca69f969afff0
ce319967e04b81771b51658767373c8c503cb752
F20110218_AABFXD pan_h_Page_187.tif
03430613eafbb6e2af3c85d923d32953
99582f2540f3005cdfbd10c19f9e7030c03f3dae
F20110218_AABFWP pan_h_Page_159.tif
de009a6ac8f60b05dccf14dbdf9d9b13
46ebbfb7b7e48f4c020925b6ded60e713264067d
7213 F20110218_AABGZS pan_h_Page_176thm.jpg
cfe1b5daad6aa4e667f4358e4c605ec9
2c018bf088d71daf57e7df40f1f5966c1db2649e
2913 F20110218_AABGBW pan_h_Page_199.txt
582a3dfaf903312a21203055948ec1a4
59dbaf00446b625389045ea55cf6ef430848717e
F20110218_AABFXE pan_h_Page_189.tif
c69e60cd428b58f97aea9d895ec00f69
6b9d10cf2ced463b462bfa63a5fd395836b9ad2b
F20110218_AABFWQ pan_h_Page_160.tif
dfcffdfe1b276a6ee726424dd0e3148d
6e583b664ce456448b1b307fb5639436745f58cc
8390 F20110218_AABGZT pan_h_Page_178thm.jpg
4e2a39be520f3bdc45c0b7a8c6192b6d
963ab9fa2264c3ceb58ef67c974b509f74540cd0
49484 F20110218_AABGDA pan_h_Page_037.pro
18deb30c91e8e475259ad2b13549d524
abff153841486f23b84874215a447e7eb79cdeac
69000 F20110218_AABGCL pan_h_Page_012.pro
5aced5b0fb43d386f807c0a354a5499a
dcf5fe659e17041d3152de92de0e9e1b8b16b218
2530 F20110218_AABGBX pan_h_Page_200.txt
1c29e52aec8477087acb4da9d365e94e
837278947103b5028fcfb67b44a5a262284cfe09
F20110218_AABFXF pan_h_Page_190.tif
746df683dd13de6afd1673b6d5029d60
c055e0183ef6cda696b605184e5e7b591a90ba66
F20110218_AABFWR pan_h_Page_162.tif
a58727d8ee90a4f8a1e874968798b13e
11298377e4becb3c02daaebcb663c6a2214e14ef
9055 F20110218_AABGZU pan_h_Page_181thm.jpg
f0dee5e71907b04c9ee1ab1f6ea4b5ad
79465e069c6728ff8904a8f56e6f589e8bbe1f4e
49789 F20110218_AABGDB pan_h_Page_038.pro
fa393fcdd0bf89f3ac3ed9f13c780b16
8108adafee874594e319dea1c835ee306f783eb5
71383 F20110218_AABGCM pan_h_Page_013.pro
2fe8cab49f1fca8c20f053d6462d7453
5c023f3466196b13329355964c22d607826ac567
2473 F20110218_AABGBY pan_h_Page_201.txt
df0a90162dfc2f2fb1e99f1bb13df49e
c8623e01b1ef088be7a3eddbd07117a3b62a6923
F20110218_AABFXG pan_h_Page_191.tif
54fd1504d3267933f12d77dfff10f339
2bf39f00cca20192185826861558d492a03bcd19
F20110218_AABFWS pan_h_Page_166.tif
025ce87e79f06c4392d677e930614ed0
0a922625101bfe69b0c8d0c8e0b779988b743245
8863 F20110218_AABGZV pan_h_Page_182thm.jpg
ba8b0bb21c1d5af21b580578f03433e1
a511edc82572ab0d8ee8d397f055fb07033f9d86
49144 F20110218_AABGDC pan_h_Page_040.pro
900772ab79681618ec80bb925b289e37
95fe14fd4d16af01ad07edf776811d795c366e0b
9231 F20110218_AABGCN pan_h_Page_014.pro
cc88b4155a16777e3506141f2b4e259c
bfee52d854b4bb5491b12f2aa402aa00617f5c91
2394 F20110218_AABGBZ pan_h_Page_203.txt
0517d3fc68b0c4bd2df45ff01f0ead46
2369c3f7abe9dc4c008b39624a83572e3044dff0
F20110218_AABFXH pan_h_Page_194.tif
108ed395aa685a41c73752bf550afd55
ea6cb95211f557b554fd6443f3d9d64a1123934a
F20110218_AABFWT pan_h_Page_172.tif
cda8db1cd738147841022cfbf44d2102
7c98a4c948cd73f123c1f6ecf2f4183ae9fd8271
89497 F20110218_AABFAA pan_h_Page_026.jpg
ea964b9898aba68fd26d5ef9da2faf09
d20d2263e7310a9bd23010502d6c4800c17f0ca9
8995 F20110218_AABGZW pan_h_Page_184thm.jpg
41785c373706fbf180fade405fde4aa7
803d129f1da295aadfc2813aa2ddba8db4bc21a3
48756 F20110218_AABGDD pan_h_Page_041.pro
af12d8e40f14df8955a01be90bdbcf9a
c17f6b083b8e78521779d76d17dcb54188d16213
38737 F20110218_AABGCO pan_h_Page_015.pro
605175e46e6358aa7639d9f5365ee7c5
d0cd23bbd5d133f2e424a2df35563ca5a9120b5a
F20110218_AABFXI pan_h_Page_195.tif
2d99b371a3a6009d075075366f75c699
c0cb43ef066f3d58e40a6c923e4987874d15de6a
F20110218_AABFWU pan_h_Page_173.tif
e0db8085250976e14d688b6a846cffd1
68ecba2a7a2acf9475b0f8c312685936d67ff71f
1051933 F20110218_AABFAB pan_h_Page_201.jp2
2e2c5960ece2b8ddc3858fd2351c7e18
a5a7ebc3914076fb81983be8557418b11f6bde98
8716 F20110218_AABGZX pan_h_Page_186thm.jpg
1dc35ab8029f0df05ea843d09c18ee02
8d70ca7a067af5f9b8bcf45f4c7a9f2ea6b83391
51056 F20110218_AABGDE pan_h_Page_042.pro
1b90c78da7eeb04da968c199b9de27fe
78464da4d15820e52566592d1db752e29a9652be
46545 F20110218_AABGCP pan_h_Page_018.pro
3b2e111a2ed5d0a43a391688bf4fb583
e3707b1912f070166096174d929d588b11c7771c
F20110218_AABFXJ pan_h_Page_197.tif
10f6a8973fb5ebe334789cfe667d4bc2
1012eb49dac252e46a3b30fd0720e1e45edb8cd7
F20110218_AABFWV pan_h_Page_175.tif
d0f64d320c8f46d60bca23207f0df380
35053126dff47adff6bedd69296075257ca32f46
39390 F20110218_AABFAC pan_h_Page_027.pro
1401c0e9d1f57f874531a908553ca849
0ba42c0250c898c85471b2bd788a3a074bed7db0
8894 F20110218_AABGZY pan_h_Page_190thm.jpg
a203478ccb65eca6e01532ceb53f14cf
c37ac8304c558da8f4cbf971636904f2d1492b31
34135 F20110218_AABGDF pan_h_Page_043.pro
d3a577015e5e9304fafbd929ec0f966b
2bc771a73edb90c727ff9c432ed4c62db311c126
24742 F20110218_AABGCQ pan_h_Page_019.pro
0a0716349987deaf7ebb9c3360eff248
ec187e05cfba7058cd878926bc1b89449ac02c63
F20110218_AABFXK pan_h_Page_198.tif
3ee2bd5a1ded12a24be79aa5369ed22c
4b275af2b728b5fb8bd39cfc483df28f7b8997b0
F20110218_AABFWW pan_h_Page_176.tif
8db2feac1b26e1ddf01eb92eb0fddf29
67d9665e813dbaab9086c781204ce014aeebcce9
1521 F20110218_AABFAD pan_h_Page_024.txt
7ba243575a3d2469b549d52e51df750d
28abe8fb61a4631ff0c92479cbb12c2e66e72ad1
8594 F20110218_AABGZZ pan_h_Page_191thm.jpg
c3f4ceeb27e161d2d12b7c50ed665be7
aba6ca340b3b1b552a13901e5c40cdfd2e6ec7cf
15523 F20110218_AABGDG pan_h_Page_049.pro
d4a74780f09c4afea7fe1fc55e923ef6
efdfaf16807f7c6427a27721e500065815757bfc
46461 F20110218_AABGCR pan_h_Page_023.pro
a5557b3eccee678b2fec8ee86df48c39
4c44e0598e164a246b3117c179060ae14a78a3cd
F20110218_AABFXL pan_h_Page_199.tif
04e4a48082dcb0ac54a4f520a6883d49
05b83514897fdd0f971193c33a06f31831ffcfeb
F20110218_AABFWX pan_h_Page_180.tif
8afd0f3c76d06e0e15c33bf080c71ea8
af3be166bb5454ced6f62aba0622cde32decd8c1
35419 F20110218_AABFAE pan_h_Page_095.QC.jpg
51babb3d52a572c796bd3cfb5bcf9729
f98fbbd59abbe99ccbc5f5defdcd7228b7c96921
1721 F20110218_AABFYA pan_h_Page_015.txt
9d468e4717104aa12e67d89d47f482c7
36759ac47bf4de876cd6b7e5890a213dabb39f58
48332 F20110218_AABGDH pan_h_Page_050.pro
0856a760fee5fd775d9441592dc0ca08
61c5a431d9fbf603ba82a4e83ad0d901dd3d4357
52469 F20110218_AABGCS pan_h_Page_025.pro
90685b6bc5ec6a7d19db8484278c60ab
7e9358266ec556db8abf60528ba1b2d57195cd13
F20110218_AABFXM pan_h_Page_203.tif
cab461fe8c1b619a775e1caa5e8364fd
4d15b4c56deeff9fe35a64b5138c91288b8d0ad2
F20110218_AABFWY pan_h_Page_181.tif
881a1a7ef1282b38be324f3a45748a43
6cb270fc2a203b2132211b289d85da6b42458336
1051975 F20110218_AABFAF pan_h_Page_007.jp2
5391acd08580e3aa570b07cd4c27d3a5
42f8878ae391c86d32990886028584caaf60b698
1773 F20110218_AABFYB pan_h_Page_017.txt
7c463342eb35c931d2e9397da9f6f335
a76705d7682377f789e7bdd9986a0427c3812681
51156 F20110218_AABGDI pan_h_Page_054.pro
4db73b110da392eafd71161bf43a516a
96fc7f805d804c8404727729dbd7a5f481832cb0
32422 F20110218_AABGCT pan_h_Page_026.pro
a11dadc60fdc460350d5e7ff9fe4cca5
57d73ce2d87e5d26e988e2a40f118cab35037f95
F20110218_AABFXN pan_h_Page_205.tif
86e6a05dea1857d622b890c030626745
525a3716885c27c8de80aeabbeb8f8e0d5899b3a
F20110218_AABFWZ pan_h_Page_182.tif
ac2d1ea57dd52dc09fd8fbd9cc5fe197
0ce8bc14fccdc8a72ae28e926fc9808fd2f1057a
F20110218_AABFAG pan_h_Page_101.tif
18623d75b026ac66b445425b82354661
6d5ec502cd6adbcbf4d128ecfc320fd1dab63d64
51872 F20110218_AABGDJ pan_h_Page_056.pro
e7eb8436cd33d3e6bb0029a8206374cd
f8e1207efdf505e39ba3b1a9a0dce16daa16a6b0
27314 F20110218_AABGCU pan_h_Page_030.pro
87c7e18f824766d728ff7f3d07a6b31a
72efb12f1ec9c7edfd8ae657fa33437fa3881278
F20110218_AABFXO pan_h_Page_206.tif
d302d5eaf7525ca7aad2c02d240a4043
cb79fa911965287e669376a8cadfdf4d98d2a1b1
34030 F20110218_AABFAH pan_h_Page_068.QC.jpg
4bfad5bab826febc27d88298e9eb26b7
b23276c7ca639cfd9b43f18082f639714cec5ef6
F20110218_AABEVA pan_h_Page_088.tif
6827805df98b8e518324f0fa59316112
da857075d1155c5c625746d4e612cee0c36ae578
1486 F20110218_AABFYC pan_h_Page_019.txt
093e41e85638889eb7971acf162dfb51
9ebd74fa493720097b660f7949f49399d3bbeae9
48365 F20110218_AABGDK pan_h_Page_058.pro
344fe42fe16084ba6dc4002f40952b46
c5e249985d472044938670a05358cd098274bb27
34142 F20110218_AABGCV pan_h_Page_031.pro
05bfd2bff263a0a14c707f46afdfd393
99af77104514c3186daf2e9906ea434349d51f11
F20110218_AABFXP pan_h_Page_209.tif
928de53956658e238f841645ab850215
1aeb16b827a4451b40c4e024f7e8501760387280
109583 F20110218_AABFAI pan_h_Page_013.jpg
6afa6ecc806c9b81b3f6d37a51941a89
7c0095f9b7dff9766ec04a169862169060ed630a
33952 F20110218_AABEVB pan_h_Page_165.QC.jpg
0365fa86d8fb0e13d0645be7d4525625
15c706e2f8eeb0c393cfd3285b7cd5e3e9fdc3ad
F20110218_AABFYD pan_h_Page_020.txt
f11606af1ad2a450213bbee1cbf06f16
b9b62a36276521fd2c59deb5f233b47bf184fa13
50210 F20110218_AABGDL pan_h_Page_059.pro
04b3eaa73a439500d3dca582512d7c4d
d602c04557b8c9124f61cfff8a38a5dc7df4a56e
51652 F20110218_AABGCW pan_h_Page_032.pro
a0d353203be5c9d5a19e30cdc87e2cba
50a39deea9a4847646e8fca7ed671c1fc15c893b
F20110218_AABFXQ pan_h_Page_212.tif
a9a07d4861c6b1c222f20daf33301d13
e7b5fbb07b9984f147cdfc37f7dbdbf4b7f85ddd
99247 F20110218_AABFAJ pan_h_Page_033.jpg
2989aabc952065353c148b0c980f567d
c6ff6e69820aec5a1d8e2df62672a9f5cc0c3833
49346 F20110218_AABEVC pan_h_Page_080.pro
7629202e5d77996720f5e7d3aca37e66
912e1a372fe21f54a353c2951f66863eec996c32
2123 F20110218_AABFYE pan_h_Page_021.txt
fa04a1267271799bccb875d9112197d9
e8ce2dc3d260c07ee762496048edb69ec3289ebf
49583 F20110218_AABGEA pan_h_Page_082.pro
53f5e2a6bbb309bf79699af4d5ce353a
ecb7c31823d5f99161f1ba7db161bb1bdb1a8317
47911 F20110218_AABGCX pan_h_Page_033.pro
a4a728d2d824165ab2f5588d6855e278
01cfe1e8d3ff899c6a1a977f250a9100ea3ff5a5
460 F20110218_AABFXR pan_h_Page_001.txt
b5299629c3f352389489d4291b44d7ce
832d128d0226c54d976ff8a65ffb24c568ccae0c
2058 F20110218_AABEVD pan_h_Page_163.txt
0fedfdacf832738da464bb19419af07f
11fbfcd33a128a25610cc8edf9742c06f72fb83b
1425 F20110218_AABFYF pan_h_Page_022.txt
27cd4dd85bc8dae6c0c4d5857aad7fea
d7d7e755d2164669e58d670094a222dc3074c40f
27969 F20110218_AABGEB pan_h_Page_084.pro
e4d2abf49a499d159bef13afdf6d7654
8241ff05195135cc22087ecba29488c72705e9e6
50958 F20110218_AABGDM pan_h_Page_060.pro
b75b046b94a3103afff1d5cc2872d455
7fbc7ef876ffa6c2e2deb0c089d79332d9f6c37c
48568 F20110218_AABGCY pan_h_Page_035.pro
8c14e9ef9c0437ff5830eb8126de3901
2a9084893dda81539343f0c8d8f9c009eb8ed42c
104 F20110218_AABFXS pan_h_Page_002.txt
de35ddb3adebdd77b60005a6c8ff3802
aedd5e45282bd802c6da9deb2a63becaeae14af6
1904 F20110218_AABFAK pan_h_Page_088.txt
165ab31537365072214638e5daf444bd
99b4f6e5d7834f22035f97b7fef8159269300f32
F20110218_AABEVE pan_h_Page_061.tif
5e4b28d02418b262ad26a5e7f2b47b8c
248ecd70c13bb44bda126f400e91377437d1442b
F20110218_AABFYG pan_h_Page_023.txt
68550c6782199998184eb376d8c4a218
de1551cd9e294b8b57a6798a14c7a4403c287149
36077 F20110218_AABGEC pan_h_Page_086.pro
6aec3e3acd1304ef42440f960866962d
28094c746754d884f2f43545d195c58a0c4df50b
49393 F20110218_AABGDN pan_h_Page_061.pro
baa9dfc5625b36914497fc67765025bf
0c842594cab626bb98292a8ade4c3377222b93b7
48459 F20110218_AABGCZ pan_h_Page_036.pro
56969c7fdec3b65beb4947eddedef54f
3221ae8d3ccd11be07b20cb9069465731bb70166
1625 F20110218_AABEUR pan_h_Page_086.txt
3eaca9a61722a968582158a482b6cb21
8c7aeeb60c9f0790a050eeefd71e42387a4cd230
146 F20110218_AABFXT pan_h_Page_003.txt
294794574ac58a912180cf687575608a
f2fcf854fdb86ed8ef8bbf44be237bef7427baf5
102808 F20110218_AABFBA pan_h_Page_045.jpg
05c9d1cfcc0273ec44da53eff3df1b5c
37b31d7cad31fec2ec2d7f4e6040a1ccad10ea5a
5537 F20110218_AABFAL pan_h_Page_174thm.jpg
2593ddb6bb4d98666e37ac6e7915ca22
3ab34280d875986a06c872128bb8cb857eeeca95
50518 F20110218_AABEVF pan_h_Page_057.pro
b9a40f36c7aee10d68864efc59771484
ae31d1d1ab6925ca02c986be6e9051ea301dc5ca
1942 F20110218_AABFYH pan_h_Page_028.txt
f93ccca82d3b883d03192bbff7ab507d
a58c12fc5b6d8dd5977612e9e629e728bb234229
F20110218_AABGED pan_h_Page_088.pro
e1d1a6a55df23c4ff22c9b35ad6c8d9d
8668fb02c2ff9a9b2c48015ead3c52f76257d712
51196 F20110218_AABGDO pan_h_Page_064.pro
030aae1cf6542d3d97c42792bc66743e
603ef1956d56e58be9676f5302e042172185c23f
21285 F20110218_AABEUS pan_h_Page_010.pro
d17699fa4e510d8afcc840380a3505c6
106e722c969b917c2406724e79d7f70864077004
1678 F20110218_AABFXU pan_h_Page_004.txt
4703953f74a2c1dbe958b828158e17b2
561b5d3f6d7f144b6d03fd4db15539aff3fc64cf
99888 F20110218_AABFBB pan_h_Page_062.jpg
1743efb0a0304d50ef32843400f1f8cd
ad63fb41c5368f5122ffc6649fd8e4260d2f05bd
41857 F20110218_AABFAM pan_h_Page_081.pro
2b2247231dfa08ff019203b739e716e0
d4032bd3e2389816102ddbc0afe723e1f2882b6a
17746 F20110218_AABEVG pan_h_Page_016.QC.jpg
3ff51326fc599695a40e259ea893c653
5a49c239ac0bca91ba5d37c9337aac93fa5d68a0
1164 F20110218_AABFYI pan_h_Page_030.txt
e249ec5ff018b03cbd527d4befb9fb9d
3faa619cad81c6bb058e2f572dccc4ef01dedcb3
36498 F20110218_AABGEE pan_h_Page_089.pro
43762a2f776cb82262a2a8d092e1512b
3d0a19d9d7ceba9403c793e2a55af8271cf990b8
25156 F20110218_AABGDP pan_h_Page_065.pro
f127c24a1a627a15dea43b4103e160dd
6ea51edea4abd13568f103ff82098ea031c14232
35284 F20110218_AABEUT pan_h_Page_022.pro
cc478adf32320e975c6f8683a13f915d
2063a790c720067898805afbf4ae855fed3904d2
4240 F20110218_AABFXV pan_h_Page_008.txt
a00721ca47c60116c1490417d213377b
16993daa10ce1423555ede12be69991d2c0c5125
34551 F20110218_AABFBC pan_h_Page_124.QC.jpg
df352628330371bfc8b3cd6922aab3e3
01cacff5d550222beb7c2d7be63e99266771dd67
101418 F20110218_AABFAN pan_h_Page_161.jpg
615124f216530a608aae1d429193d5b1
a15d819c0f0ee10bec1ba3c47a84fcbae17a9928
25355 F20110218_AABEVH pan_h_Page_128.QC.jpg
0f2677efb5e6a466c7ec692fefb82bb7
644783e43c6c9e7cc67c7311b25511f6ec3c4b72
1378 F20110218_AABFYJ pan_h_Page_031.txt
1cb423ef61b9304d5696e0485512cee9
700e03b38f41c53475d941980b12bd8257fd93c2
50285 F20110218_AABGEF pan_h_Page_090.pro
05f290ea2e4f1165109de500dcd5f9c9
15f55664c50567bbe0d45d8ca5a633820109dcb7
30815 F20110218_AABGDQ pan_h_Page_067.pro
068e73da1673fae1e0dd4d7e862e1516
fd4b58224e9645c27872a40890f24dad03a83831
52430 F20110218_AABEUU pan_h_Page_039.pro
20aa88d9bd09e839d431eb7d738005f8
53946029c992670d81a5a13fd19ec4c10447e71e
899 F20110218_AABFXW pan_h_Page_010.txt
f0b2c106a68d377987cf54dbf33e16aa
bcf2268ba86ac1a70339a43349ca35ab638467a3
8307 F20110218_AABFBD pan_h_Page_023thm.jpg
5126aaa3980fd7bd201cc013b22e5840
1662f53fab41d61d0b4964c9dc284beb9c343d28
2804 F20110218_AABFAO pan_h_Page_181.txt
9604cbae6ef1bc9b693379355f89c502
ed7bd290671bb2d783303bc6104b16e18fcf8da3
8741 F20110218_AABEVI pan_h_Page_180thm.jpg
ead68fbf4332d1e72aaedf21b9e35cb0
d60206616770bff2a3bab94540b3ef16bd0cf538
2038 F20110218_AABFYK pan_h_Page_032.txt
5ea8f00c42baa0ce3aefa3d6fadc669e
60d9079d80b6cb42e4250a65bdc9e830b2e979f2
51441 F20110218_AABGEG pan_h_Page_091.pro
4094258ffe02acde07ca034c369ff8c9
8235df26d1a40e72584f1357cdd65b03c384a10a
51077 F20110218_AABGDR pan_h_Page_068.pro
4b5edf1bce961671e873da3b1b4b0a10
d32a1c757905b6f97727b582c9df0b8653382e2e
1907 F20110218_AABFZA pan_h_Page_058.txt
335bf240348564e79e32bb6fe3e8c18b
4dc15a05316a995dfc3e5a1dab2f8381aadcf0fa
1945 F20110218_AABEUV pan_h_Page_040.txt
67e89e4a5477b0f6e84cc5c9d75188fa
cb5823b37c0c1c37f79d3e0a45e0ea0725e835bb
F20110218_AABFXX pan_h_Page_012.txt
1ea01537ac043f3ec6617c7b08ff1e97
5e267ca4956a25e01885154fe97fd15f1cf50064
8487 F20110218_AABFBE pan_h_Page_159thm.jpg
23f4195aa976a6be47c84ca0ff1676da
f7f571c530f15d12490ef18336077dd80bd69121
7131 F20110218_AABFAP pan_h_Page_138thm.jpg
309914a648c448d0e2d2d9ecdfc6e70c
03c45c2343940feca777b503b030cf23bcd958a6
8753 F20110218_AABEVJ pan_h_Page_072thm.jpg
4d444a42cc1741613a52acd6191fd6ee
cb5ec5579ab902be9e941779b2df520b0051a88c
1922 F20110218_AABFYL pan_h_Page_035.txt
9a2147e45eedea67a1cffdb554942b35
80f562b8ad9037c2d487bd0770ae2ac055918787
48166 F20110218_AABGEH pan_h_Page_093.pro
60591a08ff0886cc32065bf387e53eb0
0b63fea70ad8007d39d506ab5299f18cd73f2634
50679 F20110218_AABGDS pan_h_Page_070.pro
f5a51941e8b265046fdc2a7a2b6008e2
4cbc0a8905a96df67f07235417160bdebe07faa5
F20110218_AABFZB pan_h_Page_059.txt
20ff8d41f154cfd5743587178095394a
5a9dabd57c43b05b102d296b4409d4a834e63d75
31331 F20110218_AABEUW pan_h_Page_126.QC.jpg
b1ba4c0359ae123c90faac40d83620df
c1e73cd25b8bef4de6df0677b6ccf5fbe842c285
2809 F20110218_AABFXY pan_h_Page_013.txt
d992723f6ae269b9ee5fc62e7b4cabb0
63433149e3feb1140874aa5490bdd49c782e114a
1869 F20110218_AABFBF pan_h_Page_117.txt
0631e35e39efe8836e1b9f4c33549a34
120de72905b4d05f41f071b765fffa5db947406c
107598 F20110218_AABFAQ pan_h_Page_070.jpg
ec9b8ed9c8b8423923b62ca88b290219
5710902e7acb8967cda31d573c3214ed574f6982
51718 F20110218_AABEVK pan_h_Page_166.pro
121c1ff910e075f4e8a1dc8fabf59a52
fed960edc5aa6b22bdee8f428c5273a36e327c2c
1909 F20110218_AABFYM pan_h_Page_036.txt
01800e9cb1100ed9381886c4e324ab9c
21ba382153a585c38302a919dc91a9ecd0d9fc11
52268 F20110218_AABGEI pan_h_Page_096.pro
8f76a34255cf7abd66af40788f4b0870
f97abfdf1af306847c0a60f1d5fb16cb0cf63966
50377 F20110218_AABGDT pan_h_Page_071.pro
a3aa6ddfe3b784e9004e90447e2d9040
24e72a31c5cc627f08f5fbdd3d335423240eb3f5
1864 F20110218_AABFZC pan_h_Page_063.txt
a6e395a2a5bf01c67ce1289e646d8548
937a2fca39d4c82c379cf43f8a2ba31bb489a07a
1024 F20110218_AABEUX pan_h_Page_029.txt
936a4ea98b27ddcf87bca1ff68151cf8
2b43268bd1de31c517eecd3187d446b048b005c2
450 F20110218_AABFXZ pan_h_Page_014.txt
adea79a3055bfa9499424875e6d0e873
c98154adac6451d7ea20623758ef31552bade725
8568 F20110218_AABFBG pan_h_Page_047thm.jpg
e6975530bbcbdbd3588c64b358f1b31e
95b104da793b4da4be6abb61b6463f5ed4ed088f
1494 F20110218_AABEWA pan_h_Page_145.txt
043e7e490b7c0dc61b26a4c0766a8309
494c59b913580a3617a386c91996eb3ff2642a2b
59252 F20110218_AABFAR pan_h_Page_108.jpg
efc0c1badb480f92a0563892184fa26e
b01735519d3f77ed76c52322484a679b0fc92b00
2061 F20110218_AABEVL pan_h_Page_169.txt
fdf83c59117e4318f239f0308628d52a
68e2fefa9f885d8fb0491a0f6c1189875a6d43c6
1955 F20110218_AABFYN pan_h_Page_037.txt
ec8bb7db6029ccee48fa2c2712772a57
129066d7a74b53940f7f07703579ed58e05745de
48343 F20110218_AABGEJ pan_h_Page_098.pro
cde352ec86258db69310f53438b8e012
959353a94bc8c4f4d45d7d083c211359f5d45c62
53438 F20110218_AABGDU pan_h_Page_072.pro
a7532169c5355aaf668a05d9ed5fe34a
f76f49b299b0a2878ec92092306ac489ded46280
F20110218_AABEUY pan_h_Page_137.tif
864c17c47491a2b4b1341f06dc4db184
5dd5b0cc5622d3aff7004dc91912e647f55fd0bf
F20110218_AABFBH pan_h_Page_064.tif
c5e95a0d784cddcf37b740cf7f3584f9
fc1f4aa0e3b6071dfbccaaed5552e07f37ae05a4
F20110218_AABFAS pan_h_Page_202.jp2
4d081233c40ecf1f274e5ec9e9156c7d
c1ed171172e552bba6b6a53525f7da1ba7e2dffd
33157 F20110218_AABEVM pan_h_Page_082.QC.jpg
17a4fcae3937981354321e201fac6ea4
42a90ddf9b92f888a03b0cde97bdc0ead8aa3f9d
2065 F20110218_AABFYO pan_h_Page_039.txt
62e4191a6ed84b2758ab9ce480fd77c8
a0d95d836e2743af22ae6dc5b97d37b3c9282edc
34020 F20110218_AABGEK pan_h_Page_100.pro
5cda7618638423a92fb26190ef2661a0
5a052a251aad031a7a69672f5963619a3254559e
31528 F20110218_AABGDV pan_h_Page_073.pro
4856d476d527900856bb23dd038a06d3
d3dda8b0ace6b6dc3914137e8bdbe15c2ccda9a1
2021 F20110218_AABFZD pan_h_Page_064.txt
694254b5f09e3ede547ef5c9bea6177b
87e07d8e37e3feb6af2ffdf4368f61aa158da2aa
F20110218_AABEUZ pan_h_Page_041thm.jpg
60ba26d775bef0899a7b97e521688f28
37b024c1b4998c564a0a1255e180558c4524e557
605962 F20110218_AABFBI pan_h_Page_108.jp2
ae2a42cf14d43cfb709fe32666171024
540bf43138d1039224a7c99ffdda951c0a8d57f6
10164 F20110218_AABEWB pan_h_Page_175.QC.jpg
c65c60770fcd580d235db604be6bf310
7db37e5bfa79a885fce14dc9f1b80b4bf2a59d58
1051944 F20110218_AABFAT pan_h_Page_189.jp2
ebd2fac0a88134a3ee22f39cc90016ee
4ce339b4b1e3d9e47fab0828df2d9c981eab41cb
1828 F20110218_AABEVN pan_h_Page_173.txt
667c59d1635f15630bc3d5c4167d2ee0
6a5205781d2853eb1855ac16e947c36935288cd1
F20110218_AABFYP pan_h_Page_042.txt
ff9492f85e4f476cdd8fc77ef3ac6320
5509b38a2c94e914acf9320a70daca2cfe9d8ad0
38860 F20110218_AABGEL pan_h_Page_103.pro
c186b2feb7bc0bb09d4c6975b6f2267d
bf7c30ec089bf9ab9171b681cf9a708901c7e9e8
33497 F20110218_AABGDW pan_h_Page_074.pro
0ff36715e92353205ce66ba1f52ec2df
de66ec38016356d0baed22f0f3db501fea01d499
996 F20110218_AABFZE pan_h_Page_065.txt
7e91748f52e134b143749d8b2b42e48a
c90011dc50781217b23d104eb046471989bf4967
18840 F20110218_AABFBJ pan_h_Page_172.QC.jpg
da267a6bf0ffecc259af0acc9648ec7c
b8277ab32d026d9a93d94d8555ca193b2efe95b2
35096 F20110218_AABEWC pan_h_Page_071.QC.jpg
9384f13322ca0dcff918a2199b981b25
974d13578af3dcf7ef75205eb15b274b44d24fca
F20110218_AABFAU pan_h_Page_071.tif
ea50981ece05cf3682d9cff0a5bfc0a2
8233c4053bebadd93ca9a39767149173a13f659d
8997 F20110218_AABEVO pan_h_Page_208thm.jpg
af0f2af3319aba70fcad9796b33e4389
1f7206327890e020586d9043f938dd5e6f9fcd6b
F20110218_AABFYQ pan_h_Page_043.txt
35c5331db493435c059a9eec6ad49d00
90b3847064f708a5ad45d9b314e40d573c092cc5
32537 F20110218_AABGFA pan_h_Page_125.pro
a0f4b5fe4804649365654f7f6008aef4
944cf729666773b6291d5d0fc569075e83b414b3
46215 F20110218_AABGEM pan_h_Page_104.pro
52d9fd62336ce043e43b2a515cdcf503
bac8f1e080cb74f4b200ab926b14f6ed03b2eaf1
46523 F20110218_AABGDX pan_h_Page_075.pro
44045fc7b94ee97c19fd24d572e8e5bd
6dcdcc188ec6440f80541617fcfd15396f37c095
1910 F20110218_AABFZF pan_h_Page_066.txt
f86242942878595112b1a0ab4c1aee19
b6e16a6f378836f909ab69b1efe232ac904ec01e
856523 F20110218_AABFBK pan_h_Page_106.jp2
19d47a03defe46d712dd365fcd7d7ff7
4a39f41e2172ea4a3efaca4505d19d79bac4665e
F20110218_AABEWD pan_h_Page_136.tif
ccd84e69ae4ee9f2f0c43c1d40c52071
0d2a663e0c8a744a72f27c5ef79aa07997c69f65
843224 F20110218_AABFAV pan_h_Page_174.jp2
1ed7532a5874dba30880df6e4309c31c
420697cb5be1912a1d3daec14651ea956bc83aaf
33482 F20110218_AABEVP pan_h_Page_054.QC.jpg
9d3a014c4e9c5d874dc7963f9e1deb82
8d459ff0ac2aeccd7b868ce8701f2edbcb4e5cf7
1923 F20110218_AABFYR pan_h_Page_045.txt
2546beee2a418dee418472430f9ca126
3e00310740c40fc33321c30df0d4ac938018fdf0
42723 F20110218_AABGFB pan_h_Page_126.pro
b39a6cabd4cd096183fa414130cf3410
48dc340af72275c746aff7eac340297d92105c9b
51619 F20110218_AABGDY pan_h_Page_077.pro
bdc41236dd10c333c3522d626da92ce5
8fb75195c63e245969842796a9ef820758e16af2
2006 F20110218_AABFZG pan_h_Page_068.txt
90f6027bf113bf3315238995e6adc06b
ffe391dc20c8e5c2c4dd438c5429a4802773c5a3
6612 F20110218_AABEWE pan_h_Page_015thm.jpg
d718ccf301aa150795dda10c2518a6d4
baf6af2e47e5c8ff2a816ae9d859c4cc1069fdd3
F20110218_AABFAW pan_h_Page_119.tif
9d7d85ee0150d953b4c2645c33e0c39c
c9bcb547a1880c3c10e0d0351c4c9c3d85e8cc7a
99444 F20110218_AABEVQ pan_h_Page_092.jpg
2c2eb028029fd7525cefcc971cfa9b45
0c2e6fa8c2ad2b7e3df5359c79309db4a4aac310
1196 F20110218_AABFYS pan_h_Page_046.txt
a73ed12ecbc4a9a1ee33105d1b7aa5c7
687f806c467a782ed9ecb2da7e3be2087ab44234
37250 F20110218_AABGFC pan_h_Page_128.pro
1f0cbc99db1f2d01ee87597c660ca3bf
f74190622a5a600f7d3af4fe96aa3f338a6fb401
39862 F20110218_AABGEN pan_h_Page_105.pro
d9b3849bec0ef220e1fdf289b36023b6
db7ca56f76f1db49d6ddb47f799dfaae9577e489
29052 F20110218_AABGDZ pan_h_Page_078.pro
293b349705bebb2f55d95fafdc6ab7a6
2a1f1be3ead896671d0e7c1dcaad88053e2d2eae
1884 F20110218_AABFZH pan_h_Page_069.txt
21539efb45390a777e8f156d0315b7af
163a0907e9d6a904f754f48b32e8782bbb7a7da1
F20110218_AABFBL pan_h_Page_056.jp2
65e522495d25065513a6ac16acedd2ba
850725c1a4d00c14d041c6ffb50bbfce356313b3
33199 F20110218_AABEWF pan_h_Page_098.QC.jpg
19a3203b3be575d53013aa7e87f60016
c3028e48a88de08f75376e793b53e2cc1dd3e9f7
F20110218_AABFAX pan_h_Page_058.jp2
df8370516a4ebe2c717d1551773648d5
d98520d4876efc1f57859d0a57751961e30d25bc
F20110218_AABEVR pan_h_Page_208.tif
80e3444807c737cc35abab53081bc88a
1c90d395cf2dde2f6d53e7e31b5ca0f36d709b07
1905 F20110218_AABFYT pan_h_Page_050.txt
5ef0706db1021a93736dd738ef69fa7c
de484abb54d02a18c98995e80b7f785c29b19e3d
F20110218_AABFCA pan_h_Page_051.tif
b99f91f0373191eb36ee61442c33f84f
1fa78371c921ce4a00b93c59ac708565243e77c1
150327 F20110218_AABGFD pan_h_Page_129.pro
3a04a49e7f05bc5fceffb8e0162c3bf1
5f07e7b932f8c5a28e81cf26422f39e24cfc9775
37082 F20110218_AABGEO pan_h_Page_106.pro
b936a2fdc9e526bed71f995e9e8dcbd1
d0dc1abef31f086d5e7e892829ab59d471515e04
2099 F20110218_AABFZI pan_h_Page_072.txt
24411cf72f96b7619d86acbcf825174f
01ec29a57a3dc2e63cc9705a0bd5f9a2f93d299f
76768 F20110218_AABFBM pan_h_Page_127.jpg
4036050ab26a6d33363ec4e72a52181e
546a0a22c11e47f9478a74120c98164272c0b6dc
F20110218_AABEWG pan_h_Page_032.tif
b9d535da24d1921cb77fafa6926c9b19
f903516709d0da879246d5107b88280343203a56
5325 F20110218_AABFAY pan_h_Page_173thm.jpg
37026444b863bb78f2ad4e9c6d755e86
68dfd1fa508d0461c47677cf9b1c3dacda4e1ea2
73961 F20110218_AABEVS pan_h_Page_078.jpg
aba117f98edc3f4a36788a836487b11b
f3a12ab965b11c15fe44de84e1074b333dee1ff6
1937 F20110218_AABFYU pan_h_Page_052.txt
674010057e00fee4475cc675f9cb26d4
ba073027996b236d3dff1cfad0e16f0407709a24
6180 F20110218_AABFCB pan_h_Page_112thm.jpg
d0b5e822447e7f3d97351e917ba5aa11
372e7dab006b0fdabca1e997477fd92098ba73a1
20460 F20110218_AABGFE pan_h_Page_130.pro
bc346d2c6582462c66a67d988bfb96eb
1d6e6e7225144340d31a9801c3847cb7f64480a3
49204 F20110218_AABGEP pan_h_Page_107.pro
f977e141976078340d38b7afa8598922
fc516c3aa2118be8de2a46b0524d7ccb659f7b08
1365 F20110218_AABFZJ pan_h_Page_073.txt
5b3ff9960fa234ab5abf454a92796f28
b59da9b7ecc0921118799c2020fb0a8ce7ca50e2
121603 F20110218_AABFBN pan_h_Page_178.jpg
1f65d347198ce96c00243c8fe695bc81
0d36b3c6f4cbe87fb210cf415dfe1fec694498de
F20110218_AABEWH pan_h_Page_138.tif
99d90d2ce42cf8430df9584ee73a058e
7cae177b7df9af1be0ecc3093e5a78fd782c4338
32504 F20110218_AABFAZ pan_h_Page_088.QC.jpg
c08f93038a3eb0dd13478b2b28773182
f10b9baeb35e94e1ac95d2f1a399f797ea449380
F20110218_AABEVT pan_h_Page_150.txt
9afbe82641e0de41060d8516cba39223
dccb016bd9d8ebaa3a130034a638e7ae9922c525
2011 F20110218_AABFYV pan_h_Page_053.txt
a278e5c680d5d4c8608a94aa300692a1
da7fd05526af79249f52c98d0301767bf31b897c
131557 F20110218_AABFCC pan_h_Page_210.jpg
528510a41891fa9d52b737a77b323c01
d90404381a558f3bbd359ea46fdb190ad0118a62
32605 F20110218_AABGFF pan_h_Page_131.pro
0cf4998ddf04ad52efac2f7da9372ea1
76741a13e53d34664a8ffeb85ddea44dba6f9869
22531 F20110218_AABGEQ pan_h_Page_108.pro
d587aff09866d4efb21eb012df2ddf12
0c209774c38ac0c8a4e7a1223e0ddcd104b8d53e
F20110218_AABFZK pan_h_Page_074.txt
0aed180f016402048fe7bb8f39f93e13
de26809c92aff6212787b563a90d296c433b9d2f
8365 F20110218_AABFBO pan_h_Page_207thm.jpg
5a1b483a577b823ec3b323ca5a12d78d
bb7da3eba21b8a3f2f65e2b84131056af6a517f4
1051968 F20110218_AABEWI pan_h_Page_193.jp2
53243a1982dba7fab550e66f27855f10
4abf5b5a41b4c9b2ebd49328aaa8a3212b00f56d
146796 F20110218_AABEVU pan_h_Page_208.jpg
f42045767ef4b423834e62eab34ad239
f3c55b7be97a572543b5f2788859ab044b20f991
F20110218_AABFYW pan_h_Page_054.txt
0e0b7d4201b33da8ad63083875690c0d
ca746b5e0beef29b7ecaf537dba3d6041138379f
F20110218_AABFCD pan_h_Page_046.tif
d5f8c7cd66b2378fb991930b66434ffd
9cedbdcb867aefbebf611aece0dd74b09b78219f
49461 F20110218_AABGFG pan_h_Page_133.pro
c1bbedee664aa0fae9ab2ef791d9b7ee
b45f2ea9108cd126c92dcfff32e7d27894a4b99d
50522 F20110218_AABGER pan_h_Page_110.pro
2d5a58db085bfed06c9f61b53a49c998
73a528471758214946240bd10d6148d31dc21666
1693 F20110218_AABFZL pan_h_Page_076.txt
de1f0b99d67d3cecccfdfc0d0b5b6c4c
b40dfee5e83efa6705349c8506e72f8e165599d5
1469 F20110218_AABFYX pan_h_Page_055.txt
992c5d4ed2d611f421f221f43d235cda
d5c83f1606635568ddb5b6f6ae60e0f95d3350cc
F20110218_AABFBP pan_h_Page_040.jp2
c065a4ecea8cfdef381ed81e590e66c6
1b1edab42b3387ec33166bc9ff1ef6ffb7a5d435
26683 F20110218_AABEWJ pan_h_Page_007.QC.jpg
6ab9218a1ebdc216b7d3255d114bc97e
2f7c9314f82f363ce77ba22535e24ecffd2b6917
80547 F20110218_AABEVV pan_h_Page_046.jpg
73c8edd2580bc8812ee2335f08895d49
61aec614709317bb88df708e138ce461ac1d62ef
853032 F20110218_AABFCE pan_h_Page_086.jp2
907505b3b75f84e6b9ad1fc97620c766
ab9cd6e1696ded542f293e4a0f3ee5df92781285
41822 F20110218_AABGFH pan_h_Page_135.pro
127383fe4aef380b47fbb2a66f68b7bc
b01ee428c1c85a17912756d3b859ee38cff9e15d
45901 F20110218_AABGES pan_h_Page_111.pro
713ac21f020eb8fd8990216c26222115
777a821d612f0bba41cf32569d4da6d240664772
2796 F20110218_AABFZM pan_h_Page_080.txt
f72b4a1c32219fb0f53ac6217a5f2849
c4bf64695f1b0f69cd546ccab0722ce5c1925b60
2035 F20110218_AABFYY pan_h_Page_056.txt
566294ea5fcecae05143546f0e11b91d
714ab65e390bafcb813a520c0249f6b1d7a752f1
F20110218_AABFBQ pan_h_Page_058.tif
68d3918ccba609c9a39f83428745af96
196b0e1cd9d034778e0668e9072cf963ce09de24
F20110218_AABEWK pan_h_Page_059.jp2
d24c3e8ce050a48946d4e61318e8c5db
c98b2b2bf2705afe35b5eb07dbc85b0c116a9403
66722 F20110218_AABEVW pan_h_Page_193.pro
d29e2635b710e39d2abaaa1302123d93
23330627fac2ce4bb99648f1ada1fad0a5cce67e
107686 F20110218_AABFCF pan_h_Page_159.jpg
5f3ce02b25ddc3a39b13e89b6b302677
7a8f805873a6c55588d69bde3483c0fc387c1677
48154 F20110218_AABGFI pan_h_Page_136.pro
58d039ac4dad284db8805a556ca1f3c7
cc373ff5aabc20a76ef71c5d60a2d16f54ad7b57
30669 F20110218_AABGET pan_h_Page_112.pro
ab23a6e491780485926b3f11174cc792
8f3b8d8c10686b19d3f3f210a9a2b170c3b8aac2
1993 F20110218_AABFZN pan_h_Page_081.txt
3b731f2fdaa0a07576932ab9d4c10c75
ab901c92da57fded8203a369afdd1426fdb82bff
1991 F20110218_AABFYZ pan_h_Page_057.txt
b6e253c46088bc90b8ae6c95432f7bef
3fc8df3edcdd6f4805473731e185ca725fc183c7
51730 F20110218_AABEXA pan_h_Page_087.pro
622e625b0e3efadd3d018bebbdd45a75
4be2844ef980ef2de6b399386a380475c0942691
33393 F20110218_AABFBR pan_h_Page_079.QC.jpg
926c25fbf1ebfa1e6602e91daf314ff2
5d3cffb7aebab1103b777e79f703482de25b3125
8182 F20110218_AABEWL pan_h_Page_126thm.jpg
806904ebcfaf8544fb6603a95d1d8fce
96c73a2a068faacb98bc36f6b44ec41cb7831440
28812 F20110218_AABEVX pan_h_Page_046.QC.jpg
dff168c02b78160a2bdbf9c0c6f9201c
ce71f2809a2e0c1a284f6f51409669227e5f3d2a
108563 F20110218_AABFCG pan_h_Page_118.jpg
15fe3fa26aabbd101e1d6f258d832f29
d6ec78490390bea15db648895a64e08c9b693bfe
29793 F20110218_AABGFJ pan_h_Page_137.pro
7ec57c0b38a205d58c43d032a3ae4953
fcc9911c139a720407c2445fec141262600a00ed
50622 F20110218_AABGEU pan_h_Page_115.pro
ad8e184dcfb9b70d0c1804d332b941d4
dce35a2447b01264e3f528b12f279a2661ad97a5
1615 F20110218_AABFZO pan_h_Page_083.txt
ee8cabad356f7cf13754d3f60709d1a0
cf40c278450a6bb64916cb46ad7b6be6c27abc86
36505 F20110218_AABEXB pan_h_Page_183.QC.jpg
3e269cbfbbe7d931484b7b581a87c034
e3e0c09e4f98d9ca6fa611ac15671c163b6305c2
8910 F20110218_AABFBS pan_h_Page_027thm.jpg
cf724f4332cf1f83aa6a46dbadd60618
63cc49a07f719e831831d0f1cc4c147833a0826e
F20110218_AABEWM pan_h_Page_032.jp2
bae7c5ba9c1a81bf391ad92f128ddafc
8e780583d6b518041a55f482a69040f07a5c9a90
1838 F20110218_AABEVY pan_h_Page_085.txt
5e35dbe9ea26172172883e956d2b8eb2
1a0d954626b154b6ac85e84382d5c658178a1e8b
7702 F20110218_AABFCH pan_h_Page_001.pro
a3e7f934974aa18046a60b7e8ca08da2
77d9e1d675d59ad64b288d342e3731d2183093ea
33625 F20110218_AABGFK pan_h_Page_138.pro
c62451fa39eba7125d8a04f65d23f41f
0cf9de21c085333272bcb2dacb347b537d6936e4
47426 F20110218_AABGEV pan_h_Page_117.pro
8f929d3ee731888cd4a2e9d806cf19d1
cb9a09645ecf022ddf9cc504cceca1a7a8322736
1784 F20110218_AABFZP pan_h_Page_084.txt
b7ce484b00d94b53e57327daa7f69104
6400e72d1713a4196e65ee1e21edb2f7b09fb09a
8255 F20110218_AABFBT pan_h_Page_170thm.jpg
2299439b30db039873c42216fdb3b85f
380e57b061a694e2548c10259fdeeb92b17acd71
107360 F20110218_AABEWN pan_h_Page_047.jpg
63fbe1f40ddad58dea71ccc62795bf7b
2c1d35790a17cf8c0854e152d8a65e6c7dfe1aa3
880 F20110218_AABEVZ pan_h_Page_146.txt
1d9cafa553ef832e10bc37e056d7a581
87161da154105649a2eddb870bb283d14c5512fb
F20110218_AABFCI pan_h_Page_043.tif
58588554aa55870304b464e4b7e45b81
12795d0da7aeac0901d5f2ebc695e17008701d9b
46179 F20110218_AABGFL pan_h_Page_139.pro
ba8df11a32d304d6302752a88299d764
0a801e735a6bf75c47d195d53c60929076c1784f
47445 F20110218_AABGEW pan_h_Page_119.pro
385af4de4d40ca7f79cf12a52fb23149
0b2f77d70400c0004c13244530c3026da44c13e4
2030 F20110218_AABFZQ pan_h_Page_087.txt
a8e4ebdd81b52d149ac0da599b331d06
b14486180a14e5ae3bf49bd133b5e28ea258ebc0
2389 F20110218_AABEXC pan_h_Page_003.pro
6b412e065f48acffced13e17ffcb4c29
19264743d4ea025307a7a456f3192908cd89860a
2989 F20110218_AABFBU pan_h_Page_208.txt
e3137e04c1b03b293b270328c37daef9
5777350698867d116f04ce6f053b3ba1d4f973e8
F20110218_AABEWO pan_h_Page_070.txt
adeda3d8a98ca22dc15016b20781d5da
c56b86de1442f47704fc23f3a133f5350bc84d4d
32547 F20110218_AABFCJ pan_h_Page_037.QC.jpg
eaa434d637315b96b55627e2b63e3890
69e7ee115de1395eea68e8a85f48dc662e591b3e
49827 F20110218_AABGGA pan_h_Page_160.pro
34b024dc5b0024e0c80279af390e2986
5b9c0cb2ed1f867d5f95afd3d5399a5ae7f51610
16357 F20110218_AABGFM pan_h_Page_140.pro
9e3d40a5f90c59730fcaa3f2340ed7db
a2ca8e4046c69cf339f4a383272baa5ba858a2e9
51286 F20110218_AABGEX pan_h_Page_121.pro
c71843002e978b659b96e72c078f2c26
7a308bd2107286ce9d4131d1f89e481588c0d9e5
1987 F20110218_AABFZR pan_h_Page_090.txt
c0b46829b83fde1f2939d745c0c2e75f
70779923bdc44485dd0cdc70b5317de44fdceed2
8867 F20110218_AABEXD pan_h_Page_206thm.jpg
14cef58ed0d58c7610b5654a058ecbca
d6ce7e15d7e92c0a7469bcecb7cc5866445e127b
F20110218_AABFBV pan_h_Page_147.tif
fc53be8bfff2618cdac3c24250c1bf6e
06b80e5051852d149c033cad4763980d744d0474
F20110218_AABEWP pan_h_Page_200.tif
8283c71f04f8920dcd7f23da1fb8502e
c60c41563c41b73bb339c0e5286b7e4f06d8cc24
F20110218_AABFCK pan_h_Page_008.jp2
d0670288c9844d3f4939f85ccea9e53f
31f971ee4c8bbb98e934c3e70081884a1a1a192e
52062 F20110218_AABGGB pan_h_Page_163.pro
95a312b6b6b53ccd55926c0ff06a5e11
8cf72d0f72f093a30811512d0f8dbd5f91620170
29571 F20110218_AABGFN pan_h_Page_141.pro
d2ef97785a1be60cd67cf31b6e76011e
3409839d1296aa29c03a8bedb7e96aff02a48675
49758 F20110218_AABGEY pan_h_Page_122.pro
29e50b36e3d4c1d43e09ca1e957e8d2a
cf587c2886f199238c3d6d8a49b843c0f6f4f73d
2057 F20110218_AABFZS pan_h_Page_091.txt
ba155e9a6dc393d920f53fddb6390b87
3404d1612aa7515a91a37e8247eeffe5598e4fdc
F20110218_AABEXE pan_h_Page_180.jp2
9246bdec242ea27b9159ffdf83d1849f
41389bb7b29bdd4dd9620da7dac1c221f04578f4
717092 F20110218_AABFBW pan_h_Page_073.jp2
1bde65557729c251246499c78deead2f
8689dd13ad429ccfd2753a77cf363233ab865fb4
105680 F20110218_AABEWQ pan_h_Page_148.jpg
e3202101463cc7982edebc7d4301f8d3
d99c45cac87e89fddba46ed2c7b6f088c40a5f01
F20110218_AABFCL pan_h_Page_068.jp2
cf0b5dede88d2237012b50791239616a
98ccad8ce955f159ebc5da4c610c2327a8a15d90
51290 F20110218_AABGGC pan_h_Page_165.pro
8eb9522ec55a1ef7622e140bbb9c6d41
689614a1bf0f5259ae84e8f170c82d9fad1e5ebd
47635 F20110218_AABGEZ pan_h_Page_123.pro
236534e021d039090f6170521c7e469b
f9be354f4b1b1b0d85619082886cf1b0c77ffc8e
1949 F20110218_AABFZT pan_h_Page_092.txt
d35fff06e75f689435983aa07b2a1bdd
1542a5b5d65e0e7c682e9a1bddd00980283ed976
8382 F20110218_AABEXF pan_h_Page_059thm.jpg
f6053ae878de732d4e98edc7c01eb15a
f20727352ab3d26001074bc035e9d9e6edb6785a
7837 F20110218_AABFBX pan_h_Page_074thm.jpg
e8702c163457808125ea1ed81dead3a1
bf3657e290de46c04786034689d442bbee9661aa
8374 F20110218_AABEWR pan_h_Page_045thm.jpg
c53c7e6333470e03a1f3f686b3d0e88b
879d6a96a5922afb3f535fba907535a95bab985f
F20110218_AABFDA pan_h_Page_058.QC.jpg
a7867bb1893ff9048e4700ac800d0de6
f18017bb64009ae654e423455d1fbaf244b45b65
49947 F20110218_AABGGD pan_h_Page_168.pro
43d9a4215a6c2b392141094f7e50f3ba
206f239baf4f49c9786f7b2bf3cf7dd61b3ec5fc
22244 F20110218_AABGFO pan_h_Page_142.pro
9b6bf0bf305ae16f2b935e0324219899
6dba8965005b40d8e40d516c20d3e49ed94313bb
2095 F20110218_AABFZU pan_h_Page_094.txt
47a82677c746eac1aee0d159dc81d647
6340c46c55816e62a93222747352a8da61091090
1558 F20110218_AABEXG pan_h_Page_100.txt
1d1a596f5a7afb91f05eb9fa479d1d67
3dca5415dc59a8dc15e09b30b132286ca02eb09d
1618 F20110218_AABFBY pan_h_Page_103.txt
35eae532eac4f18f6f9cfe8fc0913cf2
ec665a0c4d3af33c2ede81bf6d9660e127582937
93889 F20110218_AABEWS pan_h_Page_104.jpg
3b8b959b4d910a157e51f4d9bbd2222b
6cce47f031cd89c99d9e320b5c5b545b0e04c162
1028769 F20110218_AABFDB pan_h_Page_104.jp2
ac2b4aaad8b7d931009858e23fb1453b
a9001e2bcddfd015a728beee351a82003c74d9bd
32500 F20110218_AABFCM pan_h_Page_092.QC.jpg
4ab660edfed5983794e2f639b4ebbfee
12b2144842d18fbbbcdcd062dd8290317468830d
52518 F20110218_AABGGE pan_h_Page_169.pro
39bf880b03c9e1b18374c19b6f6de776
f1ca5787d6009d4e7ae748b3262221643b903192
33622 F20110218_AABGFP pan_h_Page_145.pro
13a2d90e7ba293840dff2fff9fc2c49f
04e19a2c88e7db72594403522df72a114033eb16
2052 F20110218_AABFZV pan_h_Page_096.txt
3431533a7a7cc60cacd08f9705c80b62
2eba630222aae2f0636c130b8a70bbc6109cd09f
29178 F20110218_AABEXH pan_h_Page_046.pro
94db599a29eb8f0fb485faec27087fbd
21eb693bc1fd55b8041842e1a924e6af8b6a5ee6
60776 F20110218_AABFBZ pan_h_Page_099.jpg
5d13225176ac6710a3d1d5656d84cff2
3440e3bdbb466047f0c3e744f8bbb846f301f9b9
41166 F20110218_AABEWT pan_h_Page_069.pro
f1608c2f2981e1487919328d015b9c93
7ae7d347843948312032fc16ed08a7d8c344b55d
34674 F20110218_AABFDC pan_h_Page_163.QC.jpg
ba3ab989a2805d2fa4b1ba9bc6d6bedc
3b04c24b76eaef915579828bd238bd9079bc3bb8
73539 F20110218_AABFCN pan_h_Page_131.jpg
85ac74f9d1e4cf99ba93690f5b9ef5b0
8e6c99a499d630249e9389eab897233813e32817
48715 F20110218_AABGGF pan_h_Page_170.pro
6cea98efc1e636e1a1ca75cbbf89ee13
d4e5806b47cd596c3af41f77e86a27bd91220712
21600 F20110218_AABGFQ pan_h_Page_146.pro
4f7770ab04e8982bfc75732acae6dfa9
590dec6efede3ad460f1e174e6accde0b131cfe1
F20110218_AABFZW pan_h_Page_098.txt
489c8a29a16afbf6ffbfdabfb6fe2c87
ee4ab93efb64342ee3bb499f164d86d83a2471dc
77711 F20110218_AABEXI pan_h_Page_174.jpg
6352f3d15530f05f21539433cb162211
70ba7eefdcb058b5b066ff442b55f32530c28fc0
38036 F20110218_AABEWU pan_h_Page_190.QC.jpg
db9f2995ebcf64f8fb179be230e98d4d
2fe032e710cb92ab6b3c398d8b0f38bff4c4f274
F20110218_AABFDD pan_h_Page_035.tif
d64e6d83a605892d2b13cf9be70b090a
6451e853847c064e97852e55854abeddd209b688
8460 F20110218_AABFCO pan_h_Page_021thm.jpg
c163d4004ce61390c21005bb58220071
fbd36950bb0699f449f9c4eb8c55336d87fd25fa
15676 F20110218_AABGGG pan_h_Page_171.pro
c71fcbbebb5703d375aa765045e9aa17
5faf51ada4b03551382e12e528b9ac78dc55fcc6
50408 F20110218_AABGFR pan_h_Page_148.pro
1cd6f547375a4b073febb65c7cb85d2e
933e1594f37f73a11fb7d4c026d73a1772b1fbbc
2425 F20110218_AABFZX pan_h_Page_101.txt
2438d294d1a3a6a70b7913d217a5cbaa
3d35aeb737a205c573b600b7eb8526bc8799b184
28552 F20110218_AABEWV pan_h_Page_026.QC.jpg
01118af420ce60846142e4cf9114929d
d6748e1e001ccf36a3c02cd9d4b6fff2a63f041b
36808 F20110218_AABFDE pan_h_Page_072.QC.jpg
f0f8b354399f117df0b46a7e134c191d
f77665d836a90a0fd3e45dd48b59f103ed696599
1890 F20110218_AABFCP pan_h_Page_044.txt
b5f0b452ea88dacb68d92c11259ff40d
19d8296433d606775b2aabb631b724d73fab1ee2
851364 F20110218_AABEXJ pan_h_Page_067.jp2
4260a263aa4675540247af90852cdf98
832e3b8613886dc9bcd79da854cd1881da85d778
35695 F20110218_AABGGH pan_h_Page_172.pro
dd7c8a40c51418b4e929e2f60e89b196
353a68efcc35ac1e1b9a58afd87713e1e2c4faf2
31598 F20110218_AABGFS pan_h_Page_149.pro
1dbdb863acc5e58df7b762452481ca99
b2c04eeaff127b8e5712b8d69f54ef875cfdd67f
1842 F20110218_AABFZY pan_h_Page_104.txt
8288276cdbbfc0129194356e0c98252b
0cac61e3fc1d5abbe4378425ec95ac61010e968c
F20110218_AABEWW pan_h_Page_108.tif
852b8b244da4e50014ddf429eba4d0f1
b577e358b353861ad62271e13adba312a76ef097
F20110218_AABFDF pan_h_Page_005.tif
45e32cb67824294fc131c1f78989ad34
a4fda72917143519a163f3ce7843c6f3bc4fc1d3
144772 F20110218_AABFCQ pan_h_Page_194.jpg
94be5013c7bdcab8ddede67426aad2a5
c4965d522a097b338a97af2c4ec119571fa74aa2
1299 F20110218_AABEXK pan_h_Page_141.txt
b267f31b854bd142bbe8707e10f8f16b
5910515211c24b1814ffca3864a661a142ac7708
40518 F20110218_AABGGI pan_h_Page_174.pro
b1bda3601c2953fcfe8716876579953b
730020d1698f45ea66c0ac537c5ee6183b7ce121
12893 F20110218_AABGFT pan_h_Page_152.pro
28bac864357c7583328f68cf9c45870d
a06665fbf8095ccca62947e22b663de88f18613c
F20110218_AABFZZ pan_h_Page_107.txt
d2077498995a32207710aac32132ab87
d8422862f3b5676dcc9ca43c98e463b80fef9519
F20110218_AABEWX pan_h_Page_110.jp2
f215627f97fc0a99b6612c8602f1c396
0facb5720568b69ea59f20b2794c37ab29ce97de
1689 F20110218_AABFDG pan_h_Page_112.txt
3c43d6e3dafab3a05083b08b9f07756a
628e41400dddd13a59d2b152c2312c88fdeb68f3
8407 F20110218_AABEYA pan_h_Page_060thm.jpg
c624f175abfd00e3fe26c6d44aad1e91
b5d422c1599cc27e131e5ea66a17e793e9216284
46304 F20110218_AABFCR pan_h_Page_085.pro
a6c24e8d8e349ff35fcc133553f41d67
7e65a983ebd353ad2c4e532552de086a188a667c
6699 F20110218_AABEXL pan_h_Page_055thm.jpg
2d52b1687dfb3bfd5f76ed792a4dac80
d75f0d6261fa3d2e7b9889e401042f740f940c25
16755 F20110218_AABGGJ pan_h_Page_175.pro
cab72fcd013d1f139fe70c48cc28f800
fdf5702ad30f12435a11427e4952a0a7d13524da
38498 F20110218_AABGFU pan_h_Page_153.pro
c45563fed519b77819b64296bc2b4dcd
da1be6acd83182b4c93c9322f6d29a5e6610527c
1889 F20110218_AABEWY pan_h_Page_062.txt
a33f52e6513311250d3d16ed457641a8
e36a6eead55936b8d59de0d8ced7f4b7b33cda71
2014 F20110218_AABFDH pan_h_Page_165.txt
1612bcd8ed94c9d48cae6f986a45e523
87109f784eaf6834ded681a443078bf602023363
8599 F20110218_AABEYB pan_h_Page_070thm.jpg
3bb173a496c082408c6e21520600bb18
65be19a7975b792a61bd291782a74abc19e30c66
980654 F20110218_AABFCS pan_h_Page_126.jp2
606a478799aee4adb7d39e80eda9b4f5
9778e7ce7351c25dd739a70f9f509203c582bbd6
8089 F20110218_AABEXM pan_h_Page_038thm.jpg
cef13278c30f294ca48918728e2a30d4
7bf963788e7bc9f2988788c9ebd31b73ef99bc67
64441 F20110218_AABGGK pan_h_Page_177.pro
197f4c8f189e72cff74c0398f15c4d9d
26ded4e6cc2b4e638635710f985aa888062cae95
48983 F20110218_AABGFV pan_h_Page_154.pro
a3014a74a2e4cdfec99a1ebd3e985dde
da429cdfd87614f58ce75e38e0fb8ca17e58125c
88950 F20110218_AABEWZ pan_h_Page_157.jpg
53048328a5529fdf9d07fcf6069d3bb5
cd19581cf8ca9c4b71a82549e02350bbb85aba24
F20110218_AABFDI pan_h_Page_205.jp2
9d70ccac38570133c045f35911b89031
1fe8e2896c2a63565525277f8ed79af887978d3c
F20110218_AABEYC pan_h_Page_044.jp2
2f224c1ecc6740b8bd17245c3aeeb74a
f0187d9fbe7682b4cae1bbc8c153f0ab102d7586
F20110218_AABFCT pan_h_Page_025.jp2
97d5d37c0e3736415a9898b7c2d35a42
11f819f9d7816374052b416cbe6719f59cba4ace
F20110218_AABEXN pan_h_Page_199.jp2
0c88acd9966ea11e8275cdc0b8f43d89
ca661b2cd09796e4cfb893b548d698ca444042dd
59959 F20110218_AABGGL pan_h_Page_178.pro
18b4e7e6caabe0a66f29e57290dd4e0b
9e682904f419d6d516d35d723bf490e8f7e61c83
4879 F20110218_AABGFW pan_h_Page_155.pro
8558dec4b5605fd1fecaa34c46d81bb0
a7966ecf59f637891a6a527a2499a40fc98d3526
3066 F20110218_AABFDJ pan_h_Page_171thm.jpg
83359890a756e01fedd0790ea94e8d54
2124b41f25a2fe8b152e19eee8cf78d8e4d4b36e
52680 F20110218_AABFCU pan_h_Page_003.jp2
fd2cba55abfac489fc4aa031d4493ba2
7b2921af60bfb5966337c6fb6354d25520cfa9a1
6038 F20110218_AABEXO pan_h_Page_130thm.jpg
bd950549e99ef7866e602c174ef7d0dc
de3a27f288425d1f174b0481da2de4447b0019d9
70138 F20110218_AABGHA pan_h_Page_197.pro
e30eac01920810541c583981df99842e
c4cc34f36476b18faebcac499790696c5ee481ea
65497 F20110218_AABGGM pan_h_Page_179.pro
18c2e59d72f3a6fd51758c0cc7976a65
a4dbb47f02f72e9de2361021737a6557f481e834
15123 F20110218_AABGFX pan_h_Page_156.pro
26a705685e47a22c223fee8ecc9df73d
1ed03dd5ffc7a60d92272cf9dfe4a0f63cf512de
84912 F20110218_AABFDK pan_h_Page_105.jpg
d2e94f5bb50561c0bb976e0424118cb7
a08d61160a0de8880a3ee9e07cc5c6781991c902
41046 F20110218_AABEYD pan_h_Page_004.pro
d8f17f1ed7634372dcbe20f91eb9326b
7f93bbd8c2aa88ea259efba55746bd3ca505e707
30934 F20110218_AABFCV pan_h_Page_111.QC.jpg
1be4dfd97ac4361d85b277088255b0a0
2470d2bdcdad26a274cb2283dd652f9cddc789d8
1051980 F20110218_AABEXP pan_h_Page_021.jp2
2bad0325d9b3b3be96fcd9a42f945176
a9aa4925a4c830c4fe43f573f19b4d673581b96c
73444 F20110218_AABGHB pan_h_Page_198.pro
bcfdc667f8a1732c6700e3540010657a
7a9de1160011e8e9d4c83da452e9be6412dd35b2
69519 F20110218_AABGGN pan_h_Page_181.pro
36419971490526b6da335630975b133c
3aba9d6a2f1f2df849f1bd28233079c96839a41a
42462 F20110218_AABGFY pan_h_Page_157.pro
e90884e2afb5b46c35af4cfc1a56f8b3
f80b80a2f09a387fa8a21855579c84cf17879e99
38180 F20110218_AABFDL pan_h_Page_024.pro
afb044211d719a4749de233ed4c15457
3dd26745bdf0ceb54987e45cdb703dcc16a0d017
53753 F20110218_AABEYE pan_h_Page_016.jpg
cdf55ac990fa78688d6078dc88035a36
2cb81594d8590b17ab16821415d73f2cc6465846
1051953 F20110218_AABFCW pan_h_Page_051.jp2
7fa950191a94ef2e24e3d3b993fefe6d
24818a975b0b0b70a58c7b84cb07a48ab9be45c4
F20110218_AABEXQ pan_h_Page_012thm.jpg
9ec0e6b24ed846067a4d6e97f77d43fa
7fd47582498dd2657b177e3dc85a1723f9b3f0fe
63589 F20110218_AABGHC pan_h_Page_202.pro
b140e93635cdd5a426f8894b87dd68ea
793d691a625b102e34e6dce58cfcb1d9153c88c9
68343 F20110218_AABGGO pan_h_Page_182.pro
9de834f0ef6cd355acca18d03c7242f5
fc1355f55ed3fcd5d986e518bbd1bdfba5716d44
51340 F20110218_AABGFZ pan_h_Page_158.pro
d63d585f8aba44bd1f5df44bfbf05101
6b85bf792f4f611c65573d5f7deae63dfa14fec1
36317 F20110218_AABFEA pan_h_Page_147.pro
04b5599b0091b4f120fb86f5575f9b7f
efcab5cb8ca41435cf1f429dd0abab2a40ee794c
1831 F20110218_AABFDM pan_h_Page_126.txt
7330a13c5660af23f360905e49012f8e
6380b5dac9e586784c795156bec01c2ee2c65f31
F20110218_AABEYF pan_h_Page_054.tif
c607844fcbe2c73354bc08454680e46a
74d72e4f3541ab88f9812566caecc33d4d626c63
1002 F20110218_AABFCX pan_h_Page_016.txt
6c88ac4f7cd219dda3d4039721f6c06f
e58bf2827cb681153133a661463aad939fe833f3
49978 F20110218_AABEXR pan_h_Page_124.pro
e77f98282af78c8883ee4586adfd93de
7130f5df4290a1c6a79d0e8b2a7330caddfe4916
59274 F20110218_AABGHD pan_h_Page_203.pro
d9adf7a09b0e85caddbcf6053d3cce31
4929dd8a5cb2b9b59e8e9d7500ec97242c2784ed
2023 F20110218_AABFEB pan_h_Page_113.txt
93738f841ed2463853c52985a36fff46
e1c0a30d4bf483c019d480de0860af190667c8f4
1289 F20110218_AABEYG pan_h_Page_026.txt
e58b0e44b8f32b0e38f36597b4d8125a
4aee9caccd560c3d5945f942da4a6fde761c205d
F20110218_AABFCY pan_h_Page_038.tif
94788ad28fe7d91f30f1895f386012b1
37ebf094bdea0a6e11f0c37f4c9a9408943df8df
1051902 F20110218_AABEXS pan_h_Page_196.jp2
63734d9363e2607d9aeeada0e9d3e6cd
f8e09548d32d80de0684bc5784f53074ca747fda
66115 F20110218_AABGHE pan_h_Page_204.pro
6994421020b6ccfe318835ee85d20546
b1a19c7b08947494bae666a2f8ecaa7fcfafd278
68879 F20110218_AABGGP pan_h_Page_183.pro
4aecb5685a329e169a29c2b6b48b3278
c0690f00f10e8f1e3e936fb2d60f593804e0e2d2
53125 F20110218_AABFEC pan_h_Page_120.pro
319727becb8fa5521ffc975b90b67044
0db1148d640def4a1c4958c15b185cb28b66c106
34196 F20110218_AABFDN pan_h_Page_060.QC.jpg
2b4da0018c9855bbbb86c84092f29588
933b2d5ecbe6460bf416b8ff1b138d9f03231c3d
1036188 F20110218_AABEYH pan_h_Page_023.jp2
9ae5437bfe134fb6f3efed1b3ac68867
71933ef5c63300e06036c0311512418ddd0745d9
104889 F20110218_AABFCZ pan_h_Page_056.jpg
5c49210a89820075282953cc699a0870
76e38f52ecf3e49e51ede2c3db4326af9a4a6189
F20110218_AABEXT pan_h_Page_194.jp2
dff58da0e5f1c1703495c56d1695fc15
cf9d0476c120e7742a5f9978c1afaf0c9ad75de3
66527 F20110218_AABGHF pan_h_Page_205.pro
468bfedc6d3eb4663758d1686452f763
83dad68fed88942f2073aee5d707dc9d9c4bfee9
73560 F20110218_AABGGQ pan_h_Page_184.pro
780edb5750cb92a091e338d7148f919c
7cee7cd8f09661229ba43fae50a215adab83fd55
44884 F20110218_AABFED pan_h_Page_034.pro
3405713791fa10fc0480a0af58a2c11f
dce27ce86b7b29009036da0f0c2393d27b8f4ecf
30013 F20110218_AABFDO pan_h_Page_104.QC.jpg
ce1a90c9baa648bda4b2bd43054fa4a3
c025b71f5a29202403b6b5134333fcb17ab101fb
F20110218_AABEYI pan_h_Page_035.jp2
11936171d50df7851bda79be57849099
1649908432864017a1deef1bc0ddf178e02c668d
30920 F20110218_AABEXU pan_h_Page_055.pro
d427083c565887f35587f3601e9a8a3d
a73fce2c3e51767944d802ba496873ff85f4906f
64988 F20110218_AABGHG pan_h_Page_207.pro
b2078eea6fbee11d3aef95d36e688df6
ff7f9a87603aeb111b775f948ad02c1bfe3a0ce2
66718 F20110218_AABGGR pan_h_Page_185.pro
8a39f18dbc9b2338e64da6cbe2a9ee8e
0053303d24566ee83a78b0f0bb3c345f803c3827
46951 F20110218_AABFEE pan_h_Page_063.pro
de3fb60508ecc4ee88657bfc0c9970d2
c7c6382aab139042930bc1b92a207c7537747a4b
F20110218_AABFDP pan_h_Page_161.tif
d12ed0421e4f66b7b16b05e1f62a5410
09f291494293643644b2a35e7298a5c0b00c92c8
1051908 F20110218_AABEYJ pan_h_Page_121.jp2
38dffe7cb9aa5a2008b62f4aac820aa9
b6c41054a53979d7e4e8f66032936cd210cf141d
F20110218_AABEXV pan_h_Page_164.tif
b1fcf29b53a3582da6a972e2cd105518
f6fe1de81425f57c77d4db6bd726f6e2b3e6c561
70693 F20110218_AABGHH pan_h_Page_209.pro
a0a8805c1b44830cd2b9cabf06162391
40efd9d1020d22caf9bae3e68c6050290a3f0e96
67013 F20110218_AABGGS pan_h_Page_186.pro
5e99fd7ada1fa3187df73bcd268b7b5a
47db183186ada80b041a447e2f58319e6c0584ca
131360 F20110218_AABFEF pan_h_Page_185.jpg
35198513635a04e35b8862f12117391b
b204e01b176b70cf990c64442f157e81c8ebefb2
98072 F20110218_AABFDQ pan_h_Page_063.jpg
f4d9930ac5d89e7d8e56b42762f42d10
c5836e638311af1be7e1aa3ef540a8535845255e
8981 F20110218_AABEYK pan_h_Page_198thm.jpg
b0358a06628dbc2181587c873c982852
ff8389890a989b48c9c30dd6c2ea7fd219896d23
F20110218_AABEXW pan_h_Page_004.tif
5b66ea1c49ba31a0cdd3e4d55215f214
f2c1d5934564653e0a19a424225fd7c0ce8f4e4f
64979 F20110218_AABGHI pan_h_Page_210.pro
914860c56775d0a9059aa707612b435b
433b16b531f75ca7f15cac28a486929ccf09e951
72437 F20110218_AABGGT pan_h_Page_187.pro
33e7f6a8ce12af2e8b1d0abaf9b792e4
a1847f7b7211e0b86a692ce052be192bd5c723b3
8124 F20110218_AABFEG pan_h_Page_088thm.jpg
b2fd0fe9e1825e235b34c782c427ff3c
439fc9b94e3224dee654b7e827b759980daf300e
69420 F20110218_AABEZA pan_h_Page_141.jpg
d2c380d073e885bda573004d53d70536
d9821f167f0f61b75a1f3fcc0c6c05d2fcb05c74
25268 F20110218_AABFDR pan_h_Page_008.QC.jpg
9496fe93082de758ddb834d9c17bbf38
b74eacc4625b2cef7eb6a94faef463ed0cc5d46b
2060 F20110218_AABEYL pan_h_Page_114.txt
84e4b9bb98c151d9b6dd7910a148dfea
830e6a4f2ca4b31dfa979b7658a94d2be68ae3dc
802170 F20110218_AABEXX pan_h_Page_043.jp2
35bd758ef8dd72d360ee52c615e392f0
0f436aa5a01431bcc3d5597f9e3331be3fc3ce96
65252 F20110218_AABGHJ pan_h_Page_211.pro
9090f3877a0a61460f63a64dccf5815c
10669b141cb62ccfee0189f14e4045d98c624db8
70568 F20110218_AABGGU pan_h_Page_188.pro
eff69df5adcdaedaeca667442c8cb48a
97958dfcb7d88bbfe60b0dd06aabf9e51ea5ed05
90293 F20110218_AABEZB pan_h_Page_097.jpg
dfd7eb8dac268636a722eede64ee6e9b
bcde0475a99970657ee76992a3145aba44211b24
1051894 F20110218_AABFDS pan_h_Page_039.jp2
ec1b44b5b1fc9acfe7983c910e749e6e
78fd6a865f4be15eee107ddb9ef1cf5c5ba59344
100720 F20110218_AABEYM pan_h_Page_041.jpg
d2a55f03fa8ef56069ae07db4308b24b
71ad38bc90f18ade543706dbb3790c77bda27b7c
95840 F20110218_AABEXY pan_h_Page_101.jpg
4eef914c5113b44f1ca465cc3002a210
2c30c231f6f87f823400f2ff915187a0ccc1d828
103449 F20110218_AABFEH pan_h_Page_162.jpg
35926faf2651cac3871992904b9be206
7dacbec9f855fd0ec721041142dec4f7951f137c
9900 F20110218_AABGHK pan_h_Page_213.pro
0118f186902a848a722912935060d79f
a14513606c75e65eb389b03eec849c53f51ea23b
71996 F20110218_AABGGV pan_h_Page_190.pro
af8f39a38d561416b3ac1930addfe806
a57fabc00cdfb637d275ad15c30851e13ad6326c
F20110218_AABEZC pan_h_Page_170.QC.jpg
343fc196ebedc49d5f2c044962e13556
8b5f6da13107f4a21b8ed010373b443d177955d7
1051940 F20110218_AABFDT pan_h_Page_132.jp2
fabdb347ad162ee02eed7a7dcd1f748c
5326cda402764ac338c21ed375dc90982a4197d6
51747 F20110218_AABEYN pan_h_Page_114.pro
678f9ce08f9887a2a4ea56336b7882ca
fd6d92563e3c8b7419e1603a5932250eb9595e65
8128 F20110218_AABEXZ pan_h_Page_050thm.jpg
13db2d00fe96d3d7e34296701012de2c
30984f69dcae0bbf96c1d5409d314767f20ac688
7634 F20110218_AABFEI pan_h_Page_081thm.jpg
f6ef026f0fa28a87bfa2a12cc71ebabf
53a87acbbd73970de9ef6601da96d9c334f8e284
7336 F20110218_AABGHL pan_h_Page_003.jpg
e52bb7f5c83df0fe3b21f065f125d62e
09f7b0a10ecda9367a92b6c0398e06799363f739
69579 F20110218_AABGGW pan_h_Page_191.pro
804f4907537fece4058b96e8fa777bfe
988d053bb5342c04ce7ac8c6162ae6ccb9c84a06
1051964 F20110218_AABEZD pan_h_Page_029.jp2
23c096b5636f233c8a35d22b2b70f1f8
07ef53d23da7da68558ca03100f8da2bc837e449
32991 F20110218_AABFDU pan_h_Page_160.QC.jpg
2d9bcc2ce931d607051ecd3938b16791
d9e8d3bdf1a45381cc5a3c64df755d2ba747ba1e
31913 F20110218_AABEYO pan_h_Page_062.QC.jpg
3ef777f46849e05505e6e02c891ffc53
b54fa1dc9594535a819161451dbd34b989baf930
F20110218_AABFEJ pan_h_Page_169.tif
9398d5435c34c46ce55846cc5aac44af
a51bd697d53cb91d1e137bef7ecf109480703e40
106562 F20110218_AABGIA pan_h_Page_025.jpg
c6a6fe82bbb7997ad7c3de9cdc37079c
c47e4d0a569dcd9e95164a5ba94d452de07af471
85385 F20110218_AABGHM pan_h_Page_004.jpg
9914bf70409da635d94ede506c81894b
0058009576e2f7dd9b88c23642c1d8ca6c6e642b
70719 F20110218_AABGGX pan_h_Page_192.pro
00b96f26852ec46fa18f9c29aaa82023
2a481940a5335374570b47f071bfadae681b35da
116597 F20110218_AABFDV pan_h_Page_203.jpg
e4a7b1a96b71fd18a3fd39921bc76de6
88fcb598fdb467438151f456ec3ee605b79a6eb9
73849 F20110218_AABEYP pan_h_Page_208.pro
6b6d38311f9367fc559980ee9f6260cf
fad9edbe83f413b487d1e74810f3f65eeb34f937
F20110218_AABFEK pan_h_Page_207.tif
66363766a2807f403fb972e823b32613
a537cb95c419b908ac93d89434e043d995207473
98689 F20110218_AABGIB pan_h_Page_027.jpg
785bf72f38e5829a3ad1b0f460334d93
dab3570e2451231a7fd471623b0d15d05e7907bd
30906 F20110218_AABGHN pan_h_Page_005.jpg
df115eb005edf3e75d79ef096ce543ed
cabc378b0dfc4a53136e81d832b7f18d47e710f7
74633 F20110218_AABGGY pan_h_Page_194.pro
cc263ee3537ba17386d1fc4c8253550e
17b7690a4db02831bd2c92d6c69b0c7e608068b3
F20110218_AABEZE pan_h_Page_210.tif
39568fddba941b734b3d962f50443e83
20a6b2200b3fe45ee43a2ce54ebd9204b847b4ef
F20110218_AABFDW pan_h_Page_034.tif
67b8665b745b1f04ec0e86d3a268df87
a2049fd57d7ea1b09a0e80235aed3d158dd353b1
2008 F20110218_AABEYQ pan_h_Page_060.txt
1888e79ea05a78a5f32b1c956143e0b5
d3e0fb354d35786792af1a2f6915b3521d7fcbd3
25264 F20110218_AABFEL pan_h_Page_016.pro
68e5914d139ae20556444ff4bd00d1f5
8434f7122a34c75f55b1074eed7d36741b9a07c1
99815 F20110218_AABGIC pan_h_Page_028.jpg
72611bf241b30558c8f2ed3923f24377
2112152a984766aafbea062b03a4c31c94d21319
122233 F20110218_AABGHO pan_h_Page_007.jpg
8e2bcf8082c791fb54a9e72de7d06ef5
63c5f4cb23dc9e76ed3073a0b9331d3e219e6331
70049 F20110218_AABGGZ pan_h_Page_195.pro
44d98b2d10b8386c8be6421becdaee24
caf1a71c4c8badcf8173b00bbf46510b5c47e7c4
8700 F20110218_AABEZF pan_h_Page_114thm.jpg
5f8b29b9ebfec9d318d971a92c72042e
c1c481b80b76d669e45ed6103a76d0a22f725141
1072 F20110218_AABFDX pan_h_Page_097.txt
06ab7cd7056b78f51daefa41c088fb0e
852850893f33e86fec98b99c23cb3691e830c33a
F20110218_AABEYR pan_h_Page_109.txt
759cb4d551021e744a77f2c0eebecbc9
bc5afa8cfd2cb9929ff99e300f9af092875c29a5
F20110218_AABFFA pan_h_Page_074.tif
1e97f682af52a00eac2b006cc8c15e36
a1d4cd5211d4964f8ff4eb25a5763029c9d80514
63009 F20110218_AABFEM pan_h_Page_049.jpg
9038a77302be8d0065dfc1257e38a2d0
c46cfc410e2a7d320a835c27165867538841a3ea
95099 F20110218_AABGID pan_h_Page_029.jpg
cc8a9cbc2e62ca8914787f26d4968b46
7b68ad6ab231d80d563e47586adcc4a18a3e0eea
9300 F20110218_AABGHP pan_h_Page_009.jpg
24a86904bd65117e45e1737bbfe12ecc
656c74c2507fe3c0fda11f5540fb2d5f9bd55f79
2020 F20110218_AABEZG pan_h_Page_176.txt
f6cd9cdbdb7a3546affe4faecdb5deab
a137f24dca457d6ebaa1728c805ba6653e239d87
32890 F20110218_AABFDY pan_h_Page_044.QC.jpg
76341e8002b4db0f15d314e4edc7082d
3f11278d48a7d24d3bd374d34b8488ff9ca43c4c
881 F20110218_AABEYS pan_h_Page_009thm.jpg
90369127df0d899eaa9053089943a595
a561407fc49f0f42907741bbfc7121851a287c76
36162 F20110218_AABFFB pan_h_Page_204.QC.jpg
df866c7eb000bfd4eeca6a5b1644e533
917b639d6676919e55b892b6a54ed51beacbbbc6
2451 F20110218_AABFEN pan_h_Page_120.txt
3750633ebe57ac9304667d3aea260df7
fbe4ca997759e62657ff3ca9263b7afa6330a643
85478 F20110218_AABGIE pan_h_Page_031.jpg
124fd2cf13e55d1473dacce5a1956c51
c87e97dd068bdf06433826b87559b987340e5b9a
F20110218_AABEZH pan_h_Page_197.jp2
c452d436b55980be5dab335e5ec76098
08b1dbddaeb26124f8703a2c045c92866fa7e73a
18054 F20110218_AABFDZ pan_h_Page_212.pro
64024a20fe5c4088c7c7a4b6ef57d4ee
22a76d55de4d325874e4f31527f4b714ad8896c1
7242 F20110218_AABEYT pan_h_Page_137thm.jpg
b3c93ae7cfd0a661d92ba088cab90d4d
72ef8659a6d0bfb7592cffdd6b99c81726fd6135
38435 F20110218_AABFFC pan_h_Page_199.QC.jpg
65e75683ab1ded693ff289dc7c30eea8
b1b8def051235b9c4c163386ca5dd368625cd27e
103428 F20110218_AABGIF pan_h_Page_032.jpg
9727a5da8115d9ec4dfc9fb595b582df
9a980b830d548554eb6a97b26e523275021e59c4
33509 F20110218_AABGHQ pan_h_Page_010.jpg
b907ae62072ae1aee16afb24d5c02e97
5f8f16b35ca8c8f61b5c772270a191a1bb8970b6
F20110218_AABEZI pan_h_Page_039.tif
eda98734e5369953213dbdda0a021938
0bdf1145e009a24573a95f14d5e12d24a3e7e0d2
8371 F20110218_AABEYU pan_h_Page_161thm.jpg
a67f5789268c138d5489cb97d2c704e1
76b4e66182ee2c1841bc5f2f6da266d5e024756d
F20110218_AABFFD pan_h_Page_177.jp2
f7710581d1c83cc51100a251d5d82bdf
36a83d39da18a0c5cba64976a7a02ad2b4e0dae9
2456 F20110218_AABFEO pan_h_Page_034.txt
6624dd0914685923ca8ceb34dccff18b
3ec33f3159f908372abe28835f46f654196bb8e4
81127 F20110218_AABGIG pan_h_Page_034.jpg
8aa9a5f718a9b764aba6fe2b86bb8c30
34eae776edd8b342dab4392cd485215e9d1f3595
80741 F20110218_AABGHR pan_h_Page_011.jpg
5c80cc35c0b249171e2aee65d6de1091
6c446b4075f0c7917cb01da6cd2b65447edb0ff5
F20110218_AABEZJ pan_h_Page_177thm.jpg
b38f9d50318ca28a70c235def3430af0
e35da9355f55584c592ab9dde7deafb6175830ca
34558 F20110218_AABEYV pan_h_Page_027.QC.jpg
3cc7c4b7524bc323e2bf89ad4580d6f8
0a1d1fa00b98dd98d6eb16fb53d20c6394572c9e
F20110218_AABFFE pan_h_Page_038.txt
46f3c141ffc485dcd9931b8fa749e49f
25b4e1941ec8db024fa55889863ac59cfe3dfa0f
4172 F20110218_AABFEP pan_h_Page_002.jpg
501accecd0440f9fa066694f442cc814
e78d1c3e642613e4800406249acd2c8c130171bb
97777 F20110218_AABGIH pan_h_Page_035.jpg
83df1177be7d1e020b11c49466e8d4da
d31f64d548eb7ccaddf71dcb9cffac609d6cc394
95908 F20110218_AABGHS pan_h_Page_012.jpg
2ef064318d7c4cd093e54fee21882719
c346645ca56be1d36d232b2c17ee4e7debd3d3e8
685396 F20110218_AABEZK pan_h_Page_141.jp2
443451d1a569a281b953c1d907cbc377
c073732118eb32f7efd3d88b7947a5ceca4f6e0e
F20110218_AABEYW pan_h_Page_115.tif
f5cde7bbde3525051f0d372fe5690d76
e754155a134b1b4332920a712abe437c7c7f9242
1929 F20110218_AABFFF pan_h_Page_041.txt
8ab63fb8fae9c2854f2b8c96ab1944aa
2f159b38f886769a191830395309c61c7c509470
7363 F20110218_AABFEQ pan_h_Page_076thm.jpg
b276c0139cbc63aad78e9e68d62ca9dd
e57568cc862ced3ec9709d905cd229a276600b91
100183 F20110218_AABGII pan_h_Page_037.jpg
dd55f7a81c36797106fc4854270f5be0
c0c75d3046c2ddc18695d4eaf71a5568468b07f5
16585 F20110218_AABGHT pan_h_Page_014.jpg
b6fa90c44074b024e9ef59f24ff470e2
d3e0b546807ed840bd7951a63323c36075365607
7636 F20110218_AABEZL pan_h_Page_067thm.jpg
08b8a24cca75e5f165c3315a9a2fce60
3c89a116423675b38f6b3c1ec6ebf6ae9134aa26
F20110218_AABEYX pan_h_Page_152.tif
204f2762ee0481a4e8261b48f622e63d
00c97a29b290f8eb131daea5fc714819002a11b9
24131 F20110218_AABFFG pan_h_Page_055.QC.jpg
c34b44847d4b1326891c9f1137bc96b7
e500f46f67c0806cc58707ec0b036f6f967c8e9e
1572 F20110218_AABFER pan_h_Page_106.txt
232e2451e1ec482d529d1891d804867a
fb3ff6645f158ac0295e8b8ba61a443ab5f9758f
104483 F20110218_AABGIJ pan_h_Page_039.jpg
c69de009ebf18da68f905deb6202fb03
e74f9a0766c9675d50f0503855d3d53feeed6bc7
86889 F20110218_AABGHU pan_h_Page_017.jpg
8f59e55d37dc09fe1008a0562fdc8678
42b83cc27d185c754405187325a836a775d57a1d
22892 F20110218_AABEZM pan_h_Page_049.QC.jpg
031502edcb8628652ebc59aec6c81c18
a3fb0468248a0daffd85f0e86acd4d1ec33f8dc4
F20110218_AABEYY pan_h_Page_165.tif
63ee312e11721ef6010681949801e1b1
8cf9ca4afd95ba833da902abbef66b3d5af43436
5906 F20110218_AABFFH pan_h_Page_008thm.jpg
036af8c9312b391d57585edd9c157dc6
bb047453795ec7f6dd11f2893309eca4c1956a9e
1874 F20110218_AABFES pan_h_Page_018.txt
202d9b15bff63debfbe94eb112725dc4
0d99438a67cb642f8802ac1f20b998eabfff2d1b
101942 F20110218_AABGIK pan_h_Page_040.jpg
a3819e407e4426308c4c07bf63566d0c
8e15f15edc65731e15b10f11f9470245643ec88e
90918 F20110218_AABGHV pan_h_Page_018.jpg
9c6c04ccd511600ed6e6eab87fd7d4dc
1fef2e2eea3c6f522594386f45ba72efde7e9c56
690524 F20110218_AABEZN pan_h_Page_130.jp2
e08e841193f2811edb0f48826eb83209
3b0073df5a3c961cd225f42bc410a2922cd19e9f
27648 F20110218_AABEYZ pan_h_Page_142.QC.jpg
a23faa21c3f3e14ce2e49ea883ef1ca6
c550883a7881e43c446e2c739de692ffac746e6f
F20110218_AABFFI pan_h_Page_168.tif
6dfce1593611ebee50ec33303e0aa356
b32fc212394fcc1f273db3a77c5c1bc7096aed27
F20110218_AABFET pan_h_Page_162.jp2
2b196235366dada617ad9aeafc0de884
0758a0ca49fcbde93a5595738337fb801a8af95b
106688 F20110218_AABGIL pan_h_Page_042.jpg
4e49125fe39d83266f03d035bce2a76b
446f2e5e05776c38f49896bb56685e8772811b2d
102511 F20110218_AABGHW pan_h_Page_020.jpg
1f98092049f9bb7a6945b7da64e150f8
e2ceeec6d14a80a06963a2ebdab02e7c22887191
736534 F20110218_AABEZO pan_h_Page_137.jp2
553c78b6b53c6695969629e3a14a544f
3ee9b2a3a2102ec9e33fd008e193e862456923ef
31248 F20110218_AABFFJ pan_h_Page_085.QC.jpg
54a0bf19aaa5abf659ddb2c8981c18f0
6d9bf0edce2088770c19b7afc6925ad21c7e47f9
F20110218_AABFEU pan_h_Page_093.txt
f3e4b783da65683fbee1f4533f96f0e0
0e9d2485e36e6b4ec6d8305c7ef28ae26df3b5dd
107067 F20110218_AABGJA pan_h_Page_071.jpg
ec83d1f9c5742b6e752ac5d12157aba1
04c42d32208c7037523abc01f0367cbb4ef9cc4b
81772 F20110218_AABGIM pan_h_Page_043.jpg
3628af5c5cbb37468dac3830c2d16e20
5c554b434a35bcdfcde9345b1f501ddbd69b6fce
105059 F20110218_AABGHX pan_h_Page_021.jpg
032de62b667cd657a616b6ddc1615c74
8b4b9919b7f75b71ce2eb82ec97d3edf90f7f90f
1540 F20110218_AABEZP pan_h_Page_147.txt
fc829eb38e8ae4a6368f81cab2a7c62d
b0089edf85eb983482efb3ea32a865163ee9a686
8646 F20110218_AABFFK pan_h_Page_211thm.jpg
d8d10fa57511f63b30c77157f0519a13
6ef0eed9960f5bd3b6b50d173a0c6a372c2299ea
8578 F20110218_AABFEV pan_h_Page_197thm.jpg
bf8af880213faf64a4cc4d0332707a16
7ff984a500f18514be5d39124274fba10d97b6e5
110187 F20110218_AABGJB pan_h_Page_072.jpg
609a77c8b6e40a9a35585e9bce6c6818
c62e294642f1f975f7fac191dcfbdd421a941e03
102470 F20110218_AABGIN pan_h_Page_044.jpg
db1f639fb1ce707444e87717cdca86df
1b18607ee0f86f1495a34e0eb564b4d521cca612
95295 F20110218_AABGHY pan_h_Page_023.jpg
ef36333e0f66bb2391df099d2bbbe19b
28f33a953164abb3912e23a9e8e80a009309821a
F20110218_AABEZQ pan_h_Page_158thm.jpg
5a0523d0659cb5df225d90e519e14ddf
a036116c90c7fbba22a6d5f2407fd733842daff8
F20110218_AABFFL pan_h_Page_100.tif
22704c48c618dd4ec191324acb4d5bbf
41b05677b6817025b6b786fe621cd9943c8e8879
100825 F20110218_AABFEW pan_h_Page_036.jpg
5edb349ed0c4f044fe570f10d1452469
396b6cfe68e8f060a2e19e1e1398922b92c42c66
96003 F20110218_AABGJC pan_h_Page_075.jpg
8da787e80efe710910696ac70fd89c02
6f6427283416f0394db0d4c8cc21e43594ac7ad0
101127 F20110218_AABGIO pan_h_Page_048.jpg
b83ecad3ad8c46ab42f8c147104f4bac
c062f66c62cea7da27355ef2b0b0002db4c31f0d
101038 F20110218_AABGHZ pan_h_Page_024.jpg
85120f689d1212037ff7ddcfb642bad0
4ce1c1aa4f11a7c789541fe4e8b43ba8c71f9f08
822 F20110218_AABEZR pan_h_Page_143.txt
3fbfe152146f18d19cfd74add7e46120
7ac74c23d98734f2d845485b4ad3ff5ec8ca72c2
28374 F20110218_AABFGA pan_h_Page_012.QC.jpg
27ec89be98d5c2cf88a7e247751b0e4f
e927ff21333d5d6d7facdf23810f005b0bc4f210
102833 F20110218_AABFFM pan_h_Page_168.jpg
3778aefa292886f108a37d17411e16e0
53f205753f796e543a446231d084568b69bc9056
F20110218_AABFEX pan_h_Page_016.tif
a6a7ef6541c4a08a3a0c49ca276aca2e
07a8f4d3e833506757d346aca562493435a765de
87007 F20110218_AABGJD pan_h_Page_076.jpg
18013c211476cc93bb3d7c453a61d6a3
11a65480db136fa4f034000dca5a8c05c0021b91
99834 F20110218_AABGIP pan_h_Page_050.jpg
1de1dbc0c943f999d98fb7ce1a08ed09
eee6098bf494d881505061cfe49245de7ce07c55
25670 F20110218_AABEZS pan_h_Page_097.pro
dc907344ad00d88337da7f46e86dfb0b
ac077ebee154311a22acaea2b6f9f312bcbf52ab
2702 F20110218_AABFGB pan_h_Page_193.txt
abbb5cf2e568f52884b757f3fe2f8fd7
a33adbc345eae334c87cb145ef2b48d92b629280
F20110218_AABFFN pan_h_Page_178.tif
2e4fb7e8065c2b30c7494d3aa0eaf895
f53bc0ebc38fd4e7a248a18354e44cb79bedfa39
F20110218_AABFEY pan_h_Page_082.txt
d4ee5f7fa60a48940c17c394c687849f
3107670604d44dbeee05f6015d45ff3bbbea5bcd
99751 F20110218_AABGJE pan_h_Page_079.jpg
54125cbf8e18e296f708a348f2caf9a7
5bbc87b3b969e84afd2455b553079961fd091df4
100127 F20110218_AABGIQ pan_h_Page_051.jpg
b60a0f87c73d1d1f28246368987a038b
1184c1be01e73dec813baf7adcedb59b84a0e64b
134908 F20110218_AABEZT pan_h_Page_181.jpg
12ae39b80a4bbacc797527df0ec6d654
e125002cdc04cfd79dab48ce32499f54b98d1b00
8037 F20110218_AABFGC pan_h_Page_033thm.jpg
2dd8c450b79eb865b4fe5faade38f264
aff61ce6a1fb255c6ca879ddd001f012d1edf102
33980 F20110218_AABFFO pan_h_Page_180.QC.jpg
95d0c5b7c6098fc7782d1c300b786ef4
3a91aa510bc7268ccc407a262bc095515c8de9c9
72203 F20110218_AABFEZ pan_h_Page_199.pro
4a124f1c0e06b35ef1171b8fa06269ae
38d366116ae1f3d862c4b323e84b2fd0a782d615
75905 F20110218_AABGJF pan_h_Page_080.jpg
e430d98be1766a27d43e2be7e9b04f6e
26467d4607d184b6e81a01a549b7648f9c2e1b9e
71037 F20110218_AABEZU pan_h_Page_030.jpg
2ec05c436931df7062a4ae36d5a6c8e8
160488fe2dda879ca8bf3ce1b6ad37614a714ac8
26853 F20110218_AABFGD pan_h_Page_143.QC.jpg
86c4775e724e610f6ea8b54b91d7d6f6
95533cb1d78e3f9ca002de7468ef1f1abf4cdec4
84737 F20110218_AABGJG pan_h_Page_081.jpg
a3ce0c6d25613379eb54cf975af4ece4
6789f43e30d881bb3eb58f4db7b2c648558d3ef3
100968 F20110218_AABGIR pan_h_Page_052.jpg
03215ac3a72da5a6f4b53a1fcf6f06e3
049b8ff7fcc0f518eaf66bc15df59f353895a98d
2671 F20110218_AABEZV pan_h_Page_175thm.jpg
83795262491991b7dda79282f393e94d
e93c8d812aa23e3fc5ae16c45ea3fe6db309bcb5
F20110218_AABFGE pan_h_Page_009.txt
31f6622c904b152e7e957c1e22601106
ab321955f52b3e9eff87e3731df2a16e2d671dc8
7780 F20110218_AABFFP pan_h_Page_034thm.jpg
f29b17620bb609d16cb4565e30416e07
910c2283397fe10537ab5141c0fa8dd3f5fd0444
102503 F20110218_AABGJH pan_h_Page_082.jpg
f56c03ee3b4f24984944ea499599ff7e
c6e1095152d471ecc7108400fea08343c8da7b86
102862 F20110218_AABGIS pan_h_Page_053.jpg
a5bdd39a15133d48161068da59a6d902
28d76761b7724c3bcf162fe7bedb7812b811c5c6
2047 F20110218_AABEZW pan_h_Page_115.txt
36c65477475824f35f58427b11e31fed
4c4263c78394b688af441e54d27c9693b306f8e5
F20110218_AABFGF pan_h_Page_171.tif
155c327b8a73c30d605ae626e446a30d
69beae8b93119518a7587a9bb8547867dec5dbb7
99078 F20110218_AABFFQ pan_h_Page_107.jpg
494bf872b106c50292020268f07c8088
543cfecc92bf9f1eb01cc8094939350c62f2f61b
79563 F20110218_AABGJI pan_h_Page_083.jpg
35f7a1bdbf968dcabc21f07eff3f3526
864b78d0fdf935f573d5853f90a5444c5ddf4f39
99204 F20110218_AABGIT pan_h_Page_058.jpg
c5a3cace11b785784dcfeaa8b889e85f
b205fcf5b644a5ee54cd3e8a90666ea90a35e42b
27384 F20110218_AABEZX pan_h_Page_105.QC.jpg
d791b57eb2d356c0fb5776d1dd4c7d0a
df068178fa6ead3bd18bd46044689e7742e36a9d
50730 F20110218_AABFGG pan_h_Page_113.pro
00acc7aa698fb599d418ba094ee5b620
af356a7beafd777456c299b2e64b0f34fe60bbaa
F20110218_AABFFR pan_h_Page_195.jp2
20cdc27cffbc3833f329cfa908808e6b
7be8e3233f62d7769db1e6ba6375fa13a6133a86
56281 F20110218_AABGJJ pan_h_Page_084.jpg
d87f997cb64b7a5098e6b37a3b4cd168
fc2c641e4f3e9a3d766c87cd3a7d863dbbff0823
105350 F20110218_AABGIU pan_h_Page_060.jpg
9e7048afe8723e4fa52ccc5af91021f0
fae5d6cac5766a595032ae72d1793c3aace41171
50780 F20110218_AABEZY pan_h_Page_167.pro
3b173c08c4104d2892c25c73a77da07a
5975c5a1471f25f0782f8c9741e3d4bcf3e0ea8d
F20110218_AABFGH pan_h_Page_156.tif
0e11cb6992e55b5bdcd2d156d14a0e56
7b729c0c7fe87b8d36d204ff00ccc17de866f153
F20110218_AABFFS pan_h_Page_095.txt
ae6bfdde62c7f5027d325d07441daee2
d193e4ec837fd23dd21a676306e0bf6444c651a3



PAGE 1

TARGETING ANGIOGENIC GROWTH FACT ORS IN PROLIFERATIVE DIABETIC RETINOPATHY By HAO PAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Hao Pan

PAGE 3

This document is dedicated to the graduate students of the University of Florida.

PAGE 4

iv ACKNOWLEDGMENTS Since coming to the United States in A ugust 2001, it has been five years. This was the most challenging five years and th ere was happy and hard time. To study abroad, especially in the United Stat es, was one of my dreams when I was in high school. Now, with the completed dissertation in ha nd, I can tell myself: Hao, you made it! Language has been the biggest obstacle in my study. I was confident about my English, but I came here and found that there is still so much to learn and it still takes time. The study and life for me has been harder than most American students. But I am happily seeing my improvement everyday. I co mposed my dissertation in English, gave seminars in English and passed the final defe nse in English; all of these are making me proud. I thank my mentor, Dr. Maria Grant, for her patient and inspiring guidance in the past four years. Every member in my co mmittee, Dr. Alfred Lewin, Dr. Sean Sullivan and Dr. Stratford May, has given me great s uggestions for my disse rtation work. I thank everybody in the lab. Dr. Lynn Shaw instru cted me in great details during my experiments and dissertation wr iting. Dr. Aqeela Afzal was also a great help for my bench work. And every other member in th e lab has given me great support for my defense. I thank my parents. They are far away in China but I am sure they are proud and as happy as I am now. They have done everyt hing they could to provide me the best education opportunities and they have always been there encouragi ng all the way along. I

PAGE 5

v am the only child in the family and I am tha nkful that they suppor ted when I decided to study abroad. I thank Yao for her great help and support. Her love strengthened me during the hardest time. Without her, I could not have overcome all the difficu lties and successfully graduated. There is still a long way ahead, with mo re challenges and opportunities. I would cherish everything I have had in the Universi ty of Florida. The orange and blue will always be a source of courage and confidence. Go Gators!

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...............................................................................................................x LIST OF FIGURES...........................................................................................................xi ABSTRACT....................................................................................................................... xv CHAPTERS 1 BACKGROUND..........................................................................................................1 Introduction and Project Aim.......................................................................................1 The Eye........................................................................................................................ .2 The Anatomy of the Eye........................................................................................2 The Retina.............................................................................................................2 The Blood Supply to the Retina............................................................................4 Retinopathies................................................................................................................5 Age-Related Macular Degeneration (ARMD)......................................................6 Retinopathy of Prematurity (ROP)........................................................................9 Diabetic Retinopathy (DR)..................................................................................11 Current Treatments for Retinopathies.................................................................13 Pathogenesis of Diabetic Retinopathy.................................................................16 Increased Polyol Pathway Flux....................................................................17 Production of AGE.......................................................................................17 Generation of Reactive Oxygen Species......................................................19 Activation of Diacylglycerol a nd Protein Kinase C Isoforms......................19 How Does the Change in Retinal Blood Flow Occur?.................................20 What Causes Retinal Ca pillary Cell Death?................................................21 What Causes Retinal Ischemia?...................................................................21 Angiogenesis and Growth Factors..............................................................................22 Vasculogenesis and Angiogenesis.......................................................................22 Hypoxia-Induced Factor (HIF)............................................................................23 Vascular Endothelial Gr owth Factor (VEGF).....................................................25 VEGF Family and Isoforms.........................................................................25 VEGF Receptors..........................................................................................27 VEGF Receptor Signaling............................................................................30 The Function of VEGF in Ocular Neovascularization.................................33

PAGE 7

vii Basic Fibroblast Growth Factor (bFGF or FGF2)...............................................35 Angiopoietins......................................................................................................36 Platelet-Derived Growth Factor (PDGF).............................................................36 Integrins...............................................................................................................37 Integrin Signaling.........................................................................................38 Relationships between Integrin and Other Growth Factor Receptors in Angiogenesis.............................................................................................42 Pigment Epithelium-Derived Factor (PEDF)......................................................47 Insulin-Like Growth Factor (IGF)-1...................................................................47 IGF-1 and IGF-1R........................................................................................48 IGFBPs and ALS..........................................................................................51 The Involvement of Insulin Recepto r (IR) and IGF-2 in Angiogenesis......56 RNA Silencing Technologies.....................................................................................57 Antisense Oligonucleotides.................................................................................59 Ribozymes...........................................................................................................62 Self Splicing Introns.....................................................................................63 RNase P........................................................................................................65 Hammerhead Ribozymes.............................................................................66 Hairpin Ribozymes.......................................................................................67 Hepatitis Delta Virus (HDV) Ribozymes and Neurospora Varkud Satullite (VS) Ribozymes.........................................................................69 RNA Interference................................................................................................69 Gene Therapy Overview.............................................................................................75 Non-Viral Gene Delivery....................................................................................76 Viral Gene Delivery............................................................................................78 Adeno-Associated Viral (AAV) Vectors.....................................................79 Adenovirus (Ad) Vectors.............................................................................86 Retrovirus Vectors........................................................................................88 Herpes Simplex Virus Type 1 (HSV-1) Vectors..........................................89 2 METHODS AND MATERIALS...............................................................................90 Hammerhead Ribozyme Target Sites.........................................................................90 Accessibility of Target Site........................................................................................91 Kinase of Target Oligonucleotides.............................................................................92 Time Course of Cleavage Reactions for Hammerhead Ribozymes...........................93 Multiple Turnover Kinetics........................................................................................94 Cloning of the Ribozymes into an rAAV Expression Vector.....................................95 Screening and Sequencing of the Clones....................................................................97 HREC Tissue Culture.................................................................................................98 Transfection of HRECs with Lipofectamine..............................................................99 Total RNA Extraction.................................................................................................99 Relative Quantitative RT-PCR.................................................................................100 Reverse TranscriptionReal Time PCR....................................................................102 Total Protein Extraction............................................................................................103 Western Blotting.......................................................................................................103 Flow Cytometry........................................................................................................104

PAGE 8

viii Migration Assay........................................................................................................105 Cell Proliferation Assay (BrdU)...............................................................................106 Tube formation Assay (Matrigel).............................................................................107 Proliferating Endothelial-Cell Sp ecific Promoter Constructs...................................107 Plasmid Formulation for Adult Mouse Eye Gene Transfer......................................107 Animals.....................................................................................................................108 Intravitreal Injection in to the Mouse Model of Oxygen-induced Retinopathy (OIR).....................................................................................................................108 Intravitreal Injection into the Adult Mouse Model of Laser-Induced Retinopathy..110 Immunohistological Studies.....................................................................................111 Statistical Analysis....................................................................................................111 3 RESULTS.................................................................................................................112 Ribozyme Design......................................................................................................112 Target Site Selection..........................................................................................112 Accessibility of Target Site...............................................................................114 Sequences of the Ribozymes and the Targets...................................................116 In Vitro Testing of Ribozymes.................................................................................117 Time Course of Cleavage..................................................................................117 Kinetic Analysis................................................................................................119 Functional Analysis of Ribozymes in HRECs..........................................................120 Inhibition of mRNA Expression........................................................................120 Protein Levels....................................................................................................121 Migration Assays...............................................................................................123 Cell Proliferation Assays...................................................................................124 Tube Formation Assays.....................................................................................125 In Vivo Analysis of Ribozymes................................................................................126 Promoter Development.............................................................................................128 Integrin Ribozyme Expression in vivo with the CMV/ -actin Enhancer Promoter.........................................................................................................129 The Proliferating Endothelia l Cell-Specific Promoter......................................131 The New Promoter Tested in vivo .....................................................................133 The New Promoter Tested with Integrin Ribozyme..........................................138 4 DISCUSSION...........................................................................................................141 Ribozyme Testing Results and Antisense Effect......................................................141 VEGFR-1 and VEGFR-2 Interactions......................................................................143 The Proliferating Endothelial Cell Specific Promoters............................................145 Other Voices on Neovasculariza tion in Diabetic Retinopathy.................................147 Final Words on RNA Silencing................................................................................148 LIST OF ABBREVIATIONS..........................................................................................156

PAGE 9

ix LIST OF REFERENCES.................................................................................................160 BIOGRAPHICAL SKETCH...........................................................................................197

PAGE 10

x LIST OF TABLES Table page 2.1 Sequences of primer pairs and anne aling temperatures used in relative quantitative PCR....................................................................................................102 2.2 Summary of primary and secondary an tibodies used in western blottings............104 3.1 Summary of ribozyme and target sequences..........................................................116 3.2 Summary of ribozyme kinetic data........................................................................120 3.3 Reduction in target mRNA levels in HREC by the ribozymes..............................121 3.4 Reduction in protein levels by the ribozymes........................................................123 3.5 All ribozymes tested in vivo ...................................................................................128

PAGE 11

xi LIST OF FIGURES Figure page 1.1 Basic structure of human eye (cou rtesy of National Eye Institute, www.nei.nih.gov).......................................................................................................3 1.2 Cross section of the retina (http://th alamus.wustl.edu/course/eyeret.html)...............3 1.3 Normal view vs. ARMD (courtesy of National Eye Institute, www.nei.nih.gov).....6 1.4 Fundus photograph and fluorescen ce angiogram of ARMD [11]..............................8 1.5 Five stages in ROP (courtesy of National Eye Institute, www.nei.nih.gov)............10 1.6 Normal view vs. DR (courtesy of National Eye Institute, www.nei.nih.gov).........11 1.7 Fundus photograph and fluorescence angiogr am of non-proliferative DR [11]......13 1.8 Fundus photograph and fluorescence angi ogram of proliferative DR [11].............13 1.9 Photocoagulation (courtesy of Na tional Eye Institute, www.nei.nih.gov)...............14 1.10 Cryotheropy (http://www.chec docs.org/dr_treatment.htm).....................................15 1.11 Polyol Pathway [31].................................................................................................18 1.12 AGE formation [31].................................................................................................18 1.13 VEGF-A isoforms [92].............................................................................................27 1.14 VEGF family ligands an d their receptors [116].......................................................30 1.15 VEGF signaling via VEGFR-2 [92].........................................................................33 1.16 The activation of integrins can lead to the signal transduction in a number of pathways. [180]........................................................................................................39 1.17 IGF-1 signaling transduction [216]..........................................................................49 1.18 Proposed pathway of IGF-de pendent IGFBP action [223]......................................51 1.19 Overview of possible IGFBP-3 an tiproliferation pa thways [223]...........................53

PAGE 12

xii 1.20 The crosstalk between IGF-1, IGF2 and Insulin signalings [254]..........................57 1.21 Overview of RNA silenc ing technologies [258]......................................................58 1.22 Modifications in antisense technology [258]...........................................................60 1.23 Self-cleaving and se lf-splicing reactions in ribozymes [263]..................................62 1.24 Secondary structure and self spli cing steps in group I intron [263].........................64 1.25 Secondary structures of natural and synthetic substrates for RNAse P[275]...........65 1.26 Structure of the hammerhead ribozyme...................................................................67 1.27 Structure of the hairpin ribozyme.............................................................................68 1.28 RNA interference [293]............................................................................................70 1.29 Designing artificial shRNA for RNAi [303]............................................................73 1.30 AAV internalization and intr acellular trafficking [330]...........................................81 1.31 AAV2 genome and the vector genome [330]...........................................................83 1.32 Helper virus free systems in rAAV production [334]............................................84 1.33 The 6 pDF helper plasmids in the two-plasmid system [330]..................................85 1.34 Ad genome and the vector genome [324]................................................................87 1.35 MLV genome structure [329]...................................................................................89 2.1 Typical structures of hammerhead ribozyme predicted by Mfold [257]..................92 2.2 The pTRUF21 expression and cloning vect or and the orientation and position of the hammerhead and hairpin ribozyme cassette.......................................................96 2.3 Time course of OIR mouse model.........................................................................109 2.4 Time course of the adult mouse mode l of laser-induced neovascularization.........110 3.1 The human IR cDNA sequence with ribozyme target site highlighted..................113 3.2 Mfold structures predicted fo r the human IR target region....................................114 3.3 Mfold predicted secondary stru cture of human IR ribozyme................................115 3.4 The 34-base ribozymes (black) annealed to the 13-base targets (red) for both human and mouse...................................................................................................116

PAGE 13

xiii 3.5 Cleave time course of human IR ribozyme............................................................118 3.6 Summary of time courses cleavage of th e ribozymes generated in this study.......118 3.7 Multiple-turnover kinetic analysis of a human IR ribozyme.................................119 3.8 Insulin receptor mRNA levels in HRECs..............................................................121 3.9 Western analysis of IR levels in ce lls expressing the human IR ribozyme............122 3.10 HREC migration assays in response to IGF-1.......................................................124 3.11 Effect of the VEGFR-1 and VEGF R-2 ribozymes on HREC migration...............124 3.12 Effect of ribozyme expre ssion on cell proliferation...............................................125 3.13 Effect of ribozymes on HREC tube formation.......................................................126 3.14 Cross section of a mouse eye showing pre-retinal vessels.....................................127 3.15 Ribozyme reduction of pre-retinal ne ovascularization in the OIR model..............127 3.16 Reduction of pre-retinal neovasculari zation in the OIR mouse model with expression of the 1 or 3 integrin ribozymes.......................................................129 3.17 Expression of 1 ribozyme in OIR model results in severe deformations of the eye..........................................................................................................................13 0 3.18 pLUC1297/1298 vectors and pLUC1297HHHP/1298HHHP clones....................131 3.19 Verification of the cell speci ficity of the proliferati ng endothelial cell-specific enhancer/promoter..................................................................................................133 3.20 The proliferating endoth elial cell-specific promoter limits expression of luciferase to the actively prolifera ting blood vessels in the OIR model................135 3.21 Quantitative assessment of the IGF-1R ri bozymes ability to inhibit pre-retinal neovascularization when expr essed from the promoter.........................................136 3.22 New promoter tested in adult mouse m odel of laser-induced neovascularization.136 3.23 The expression of the IGF-1R riboz yme from the new promoter reduced aberrant blood vessel formati on in the adult laser model.......................................137 3.24 Expression of integrin ribozyme driven by proliferating endot helial cell-specific promoter resulted in less eye deformation.............................................................139 3.25 Proliferating endothelial ce ll specific promoter with integrin ribozyme tested in OIR model..............................................................................................................140

PAGE 14

xiv LIST OF OBJECTS Object page 3.1 A blood vessel from the adult mouse model shows the luciferase expression is specific for proliferatin g endothelial cells..............................................................137 3.2 The 3-D view of the blood vessel from the adult mouse model............................137

PAGE 15

xv Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TARGETING ANGIOGENIC GROWTH FACT ORS IN PROLIFERATIVE DIABETIC RETINOPATHY By Hao Pan May 2006 Chair: Maria B. Grant Major Department: Pharmacology and Therapeutics Proliferative diabetic retinopathy is the leading cause of blin dness in the working age adults. Pre-retinal angiogenesis is the hallm ark of this disease and can lead to vessel leaking, exudate accumulation, hemorrhage, or even retinal detachment. Many growth factors have been identified to promot e the vessel growth, physiologically and pathologically. Inhibition of these growth f actors can result in less abnormal angiogenesis and potentially prevent the onset of vision impairment. One gene silencing technology, hammerhead ribozyme, was used to inhibit the signaling of thes e growth factors. Ribozymes are small RNA molecules that can recognize and cleave sp ecific sequence in the target mRNA. Ribozymes against the genes of a number of growth factor receptors, including IGF-1R, insulin receptor, VEGF-R 1, VEGF-R2, and multiple integrins, were designed and tested in vitro and in vivo All ribozymes were tested by cleavage time courses, kinetic analysis a nd proved to be capable of cl eaving synthetic RNA targets. Then they were transfected in human retina l endothelial cells, and the mRNA levels and

PAGE 16

xvi protein levels of the growth factor re ceptors were reduced. Also the migration, proliferation and tube formation of thes e cells were inhibited. We used the oxygeninduced retinopathy mouse model to test the ribozymes in vivo The expression of the ribozymes induced significant reductions in the pre-retinal neovascul arization levels. To better target the proliferating endothelium in vivo and to minimize the adverse effect of ubiquitous ablation of targeted growth factor receptors, a proliferating endothelial cellspecific promoter was designed. This new pr omoter was tested with IGF-1R ribozyme and showed specific expression in the prol iferating endothelium a nd significant reduction in the pre-retinal neovascularization levels. Ou r results suggest that these ribozymes are a useful tool to inhibit the angiogenesis in retinopathy, and the proliferating endothelial cell-specific promoter adds the specif icity without losing expression strength.

PAGE 17

1 CHAPTER 1 BACKGROUND Introduction and Project Aim Vascular retinopathies, incl uding retinopathy of prematurit y, proliferative diabetic retinopathy and age-related macular degene ration, are the leading cause of vision impairment worldwide. Pre-retinal vessel growth is the hallmark for retinopathy of prematurity and proliferative diabetic retinopathy. These new blood vessels are abnormally positioned and are fragile, easy to leak, and can result in hemorrhage and retinal detachment. Currently there is no cu re for these diseases. The initiation and maintenance of these pre-retinal blood vessels depend on the involvement of many growth factors. In this project, with the he lp of a gene silencing technology, hammerhead ribozyme, efforts have been made to target and inhibit the expre ssion of a number of growth factor receptors to reduce the growth factor signaling. Ri bozymes are small RNA molecules that can specifically bind to a sequence in the target mRNA and perform cleavage. The genes of IGF-1R, VEGFR-1, VEGFR-2, integrins and insulin receptor have been targeted and the inhibition effects were examined in vitro and in vivo To better target the proliferating endothelium in vivo and to minimize the adverse effect of ubiquitous ablation of targeted growth factor receptors, a proliferating endothelial cellspecific promoter was designe d and tested. In the basic science point of view, the investigations on the involveme nt of the growth factors in the pre-retinal angiogenesis can provide useful information about their si gnaling details; in the clinical application

PAGE 18

2 point of view, this work could also imply new targets and methods for the disease treatment in the future. The Eye The Anatomy of the Eye Optically working like a film camera, the eyes of all the vertebrates are structurally similar. The light enters the eye through the pupil and forms an inverted image on the retina, the light -capturing component that f unctions like the film in a camera. The cornea and the lens help to focus so that the clearest image is presented on the retina. The white outer surface of the eye ball is termed sclera which consists of tough but flexible fibrous tissu e and provides the mechanical support of the entire eye. The choroid is a layer contained within the sclera, and it is a dense meshwork of blood vessels and other tissues. One of the most important functions of the choroid is to provide nutritional and metabolic support for the retina, which is a neuronal sheet that lies within the choroid. The retina is the most inner surface at the back of the eye. Most of the space in the eye is filled with a gelatinous body, cal led vitreous. It is surrounded by the lens and the retina and the ciliary body. In the ciliar y body, the cells secrete the aqueous fluid into the eye, which contributes to the maintena nce of the pressure within the eye. The Retina The retina, a layer about 0.4 mm in thickness, is primarily composed of neural tissue including five classes of neurons. It spreads out on the interi or surface of the back of the eye. The visual pathway is initiated when the light stimulates the photoreceptors that are embedded in the outer retinal layers. The signal is transmitted to bipolar cells and then to ganglion cells. The signal then travel s along the axon of the ganglion cells lining

PAGE 19

3 Figure 1.1. Basic structure of human eye (courtesy of National Eye Institute, www.nei.nih.gov ). Figure 1.2. Cross section of the retina ( http://thalamus.wustl.edu/course/eyeret.html ). the inner surface of the retina to the optic nerve, which pene trates the retina and connects to the brain. There are two more classes of neurons, horizontal cells and amacrine cells. They are both interneuron and assist in si gnal processing. Horizontal cells primarily contact with photoreceptor axons and bipolar cells in the outer pl exiform layer and the

PAGE 20

4 inner nuclear layer, respec tively, while amacrine cells c ontact with bipolar axons primarily in the inner plexiform layer. Light passes through almost the whole thic kness of the retina to be captured by photoreceptors, or the outer segments of the photoreceptor in deta il, where the visual pigment molecules for light capturing are lo cated. There are two types of photoreceptors, rods and cones. Rods are specialized to c onvey variations in li ght intensity in dim conditions, but they are not ab le to function in bright li ght. Cones are specialized for bright light conditions, but they are not as sensitive as rods. The retina cross section can be divided in to multiple layers. The nuclear layers are basically where cell nuclei are located, and the synaptic laye rs are the place where cells communicate and transmit electri c or chemical signals. The retinal pigment epithelium (RPE) functions as the outer blood-retinal ba rrier (BRB) that shut off the diffusion of large molecules from choroicapillaries. And the retinal vasculature doesnt grow beyond the inner limiting membranes under normal physiological conditions. The Blood Supply to the Retina The metabolism in the retina performs in the highest rate in the body. For the same mass of tissue, the metabolic needs of the retina are about seven times that of the brain. In order to meet these high metabolic n eeds, two separate circulations are involved. They are retinal and choroidal circulations. Th e larger arteries and veins of the retinal circulation can be seen under an ophthalmoscope, and most of the retinal surface is occupied with a meshwork of retinal capilla ries. These capillaries form the inner BRB. The endothelial cells at the capillaries are connected by tight junc tions that prevent leakage from the vessels. A lot of proteins or molecules work in the binding of the adjacent cells. Because of the tight junctions proteins and solutes have to pass through

PAGE 21

5 the apical and the basal membra nes of the endothelial cells in order to go into or out of the circulation from or to surrounding tissu es. Water, small molecules and dissolved gases can do so, such as glucose, oxyge n, carbon dioxide, and so on. But most large molecules, including protei ns, cannot pass through freel y. The only possible way for them to pass through is through a process of act ive transport with th e help of the proper membrane tunnel proteins. So basically th e BRB provides a mechanism of keeping the substance entering the retinal neural tissue in a controlled manner. The central artery and vein of retinal ci rculation originate al ong the optical nerve and extend into the retina from the center of the optical disc. While the choroidal arteries and veins of pass through the sclera at multip le places around the optical nerve, and then they branch into a meshwork of very larg e capillaries, called choroicapillaries. Large capillaries increase the rate of blood passi ng through, which keeps th e concentration of oxygen high and the concentration of carbon di oxide low, and also quick removes the heat from focused light on the eye bottom. The BRB is not maintained by choroidal circulations, because the cells on the side f acing the RPE are fenestrated, and there is no tight junction between these cells. However, the RPE connecting with the choroid have tight-junctions and provide the outer portion of the bl ood-retinal barrier. Retinopathies Retinopathies are diseases that affect the function of re tinas. Usually they involve the abnormalities in the vasculatures that nou rish the retina. These abnormalities included ectopic angiogenesis, rupture a nd leakage on the vessels, accum ulation of exudates, retina detachment caused by vessel and fibrous tissu e contractions, and so on. There are three types of retinopathy clinical ly identified: age-related macular degeneration (ARMD), which occurs in the elderly people; diabet ic retinopathy (DR), which occurs in the

PAGE 22

6 working age people; and retinopa thy of prematurity (ROP), which occurs in infants. ARMD more involves the abnor malities in choroicapillari es, while DR and ROP are basically related to the abnorma lities of retinal vasculature. Age-Related Macular Degeneration (ARMD) ARMD is the leading cause of blindness among those aged over 65 in the western world [1-3]. It affects the outer retina, RPE, Bruchs membrane and the choroids. Thickening of Bruchs membrane is seen in this disease. Our understanding about the pathogenesis has grown in the past decad e, but still a lot remains unknown and the current therapy is limited. Figure 1.3. Normal view vs. ARMD (c ourtesy of National Eye Institute, www.nei.nih.gov ). The clinical hallmark of ARMD is the a ppearance of drusen, localized deposits lying between the basement membrane of the RPE and Bruchs membrane. Drusen can be shown as semi-translucent punctuate or ye llow-white deposits depending on the stage of the disease. Morphologically drusen are cl assified as hard and soft. Hard drusen are pinpoint lesions; soft drusen are larger with vague edges and they are easy to become confluent. Drusen can become calcified and they may also regress. Typically clustered drusen are located in the central macula, so th ey can lead to deficits in macular function

PAGE 23

7 such as color contrast sensitivity, central visual field sensitivity and spatiaotemporal sensitivity [4]. Increased quantity and size of drusen are an independent risk factor for visual loss in ARMD. Geographic atrophy is also seen in ARMD which refers to confluent areas of RPE cell death accompanied by overlying phot oreceptor atrophy [5]. Geographic atrophy leads to vision impairment, especially the visual function in dark situations [6]. This loss of function is probably because the RPE lo ss results in reduced nutrients for those photoreceptors that are located in the RPE atrophy areas. Apoptosis in the corresponding area are found [7]. Choroidal (or subretinal) ne ovascularization (CNV) is a major cause of vision loss in ARMD. As the term itself indicates, C NV refers to the new blood vessel growth from the choroids. It breaks through the Bruchs membrane into the space underneath RPE, or it may further penetrate the RPE layer into the subretinal space. Usually CNV is associated with leakage of fluid and blood. The repeated leakage of blood, serum, and lipid can stimulate fibroglial organization leading to a cicatricial scar [4]. Drusen and CNV can cause irregular elev ation of RPE, which can lead to RPE detachment or even RPE tear. RPE detachment can cause visual loss in patients with ARMD [8]. Depending on whether CNV is present, ARMD is classified into the dry form or the wet form. The dry ARMD is nonexudative [4]. This is the early phase of ARMD, and the earliest pathological changes are the a ppearance of basal laminar deposits between the plasma membrane and basal lamina of the RPE, and the appearance of basal linear deposits located in the inner collagenous zone of Bruchs membrane. The former deposits

PAGE 24

8 are seen in an increase amount in ARMD [9 ], and the later deposits are only seen in ARMD [10]. Approximately 10 percent of persons with AMD develop the exudative form of the disease, or wet ARMD. E xudative AMD accounts for 80 to 90 percent of cases of severe vision loss related to AMD. CNV occurrence is the hallmark of wet ARMD. CNV is associated with abnormal vessels that leak fluid and blood in the macula, resulting in blurred or di storted central vision. Figure 1.4 is the fundus photograph (A) and fluorescence angiogram (B) of an eye of a patient with exudative ARMD. Note subretinal neovascularisation (A, asterisk) with surrounding hard exudates (arrowheads). On the angiogram (B) the neovascularization is clearly stained by fluorescein (black arrow) [11]. Figure 1.4. Fundus photograph and fluores cence angiogram of ARMD [11]. As for the pathogenesis of ARMD, shor tly speaking, Campochiaro and coworkers suggested that the age-relate d thickening of Bruchs membra ne reduces the diffusion of oxygen from the choroid to the RPE and retina [12], and recent evidence suggests that VEGF plays an important role in the deve lopment of CNV. VEGF expression was found to be increased in RPE cells of maculae of patients with age-related maculopathy, a condition with a high risk of CNV occurrence [13] and in experimental animal models [14]. VEGF levels in the v itreous of wet ARMD were f ound to be significantly higher

PAGE 25

9 than healthy controls [15]. Chronic inflamma tion from drusen may be involved in the development of ARMD [16], but the inflammatory contributi on is still controversial. Retinopathy of Prematurity (ROP) ROP is an adverse effect of treating t hose premature neonates in respiratory distress with high oxygen. The high oxygen helps these infant s to survive, but it can cause ROP, which will impair their vision. ROP mainly affects premature infants weighing about 1250 grams or less that are born be fore 31 weeks of gestation. It is one of the most common visual loss diseases in childhood. According to the National Eye Institute, there are about 28,000 infants born weighing 1250 grams or less in the U.S., and among them, 14,000-16,000 of the infants are aff ected by ROP to some degree. 10% of them need medical treatment and 400-600 infant s annually become legally blind of ROP. The ROP complete progression can be divided into 5 stages. Stage 1 is characterized by a demarcation line between the normal retina (near the optic nerve) and vascularized retina. In stage 2, a ridge of scar tissue rises up from the retina due to growth of abnormal vessels. This ridge forms in plac e of the demarcation line. In stage 3, the vascular ridge grows due to spread of abnor mal vessels and extends into the vitreous. Stages 4 and 5 refer to retinal detachment; st age 4 refers to a partial retinal detachment caused by contraction of the ridge, thus pulling the retina away from the wall of the eye; and stage 5 refers to comp lete retinal detachment. ROP is now considered as a two-phase process during the disease development. In the first stage, the high oxygen cond ition will make the developing retinal blood vessels and especially the developing capillary buds be more pruned to drop out. This pathological vessel dropout is an exaggeration of the normal physiologic process, in which there is a constant balance between de veloping and degenerating capillary buds, as

PAGE 26

10 Figure 1.5. Five stages in ROP (courtesy of National Eye Institute, www.nei.nih.gov ). tissue demand changes [17]. In short, the hype roxic vaso-obliteration occurs in the first stage. When the high oxygen care is complete and the infants survive, they are taken out the high oxygen environment and the second stag e occurs. Because of the vessel loss, the tissue becomes hypoxic and the ischemia-induc ed vaso-proliferation begins. The hypoxia stimulates growth factors increases, especi ally VEGF. These growth factors play very important roles in the vaso-proliferation. The vaso-proliferation is abnormal in that these new vessels are fragile and leak, scarring th e retina and pulling it out of position, which

PAGE 27

11 will lead to retinal folds and retinal detach ment. The term babies are less affected by fluctuations in oxygen levels as once the vessels become developed and surrounded by supportive matrix, thus they are no longe r susceptible to pruning by hypoxia [18]. Diabetic Retinopathy (DR) Diabetic retinopathy is one the three major complications of diabetes mellitus (the other two are neuropathy and nephr opathy) and occurs in both type I and type II diabetes. DR primarily affects the working age people an d is the leading cause of new-onset visual loss in working people in the U.S. and other industrialized countri es [19]. DR affects approximately three-fourths of diabetic patien ts within 15 years afte r onset of the disease [20]. Retinal neovascularizati on and macular edema are central features of DR and also the two factors that cause vision loss. The ne wly-formed vessels are fragile and abnormal and they can leak blood into the center of the eye, blurring vision. Macular edema usually occurs as the disease progresses. The fluid leaks in the center of macular and makes the macula swell, blurring vision. Other charac teristics found in DR include basement membrane thickening, pericyte lo ss, microaneurysms, and so on. Figure 1.6. Normal view vs. DR (cour tesy of National Eye Institute, www.nei.nih.gov ). In the beginning stage of DR, there are no clinically evident symptoms, but the biochemical and cellular alterations are goi ng on in the retinal vasculature. These

PAGE 28

12 alterations include increased adhesion of le ukocytes to the vessel wall, alterations in blood flow, basement membrane thickening. Thes e factors are involved in the blockage of the retinal capillaries, which is tho ught to induce hypoxia and further trigger the overexpression of the angiogenic factors. Othe r vascular alterations include death of retinal pericytes, subtle increases in vascul ar permeability, or even the loss of vascular endothelial cells. Following th is, the blood and fluid leak age may come. The loss of endothelial cells also leads to acellular capillarie s worsening ischemia. With time, more abnormal phenomena occur and they are clinically observable. These abnormalities include microaneurysms, dot/blot hemorrhages cotton-wool spots, venous beading and vascular loops [20]. The blood and fluid leak out the vessels and accumu late in the retinal tissue, giving rise to exudates. When this occurs in macula, patients will have macular edema and impaired vision. This stage is al so called nonproliferative retinopathy. With the progression the disease, next stage is the proliferative reti nopathy, featuring the growth of new vessels on the surface of the retina. The new vessels are abnormal, fragile and easy to break. The leaking blood can cloud the vitreous and further impair vision. In more advanced stages, the exaggerated pre-re tinal neovascularization can grow from the retinal surface into the vitreous cavity. This can cause retinal detachment can lead to blindness. Proliferative retinopat hy typically develops in pati ents with type I diabetes, whereas nonproliferative reti nopathy with macular edema is more common in patients with type II diabetes [20]. Figure 1.7 shows the fundus photograph (A) and fluorescence angiogram (B) of an eye of a patient with nonproliferative diabetic retinopat hy. The arrowheads in Panel A

PAGE 29

13 point to intra-retinal hard exudates surr ounding areas of leaking microaneurysms (B, white arrows) [11]. Figure 1.7. Fundus photograph and fluorescence a ngiogram of non-proliferative DR [11]. Fundus photograph (A) and fluorescence angi ogram (B) of an eye of a patient with proliferative diabetic retinopathy is shown in Figure 1.8. Note pre-retinal neovascularization (black arrow) on the optic disc (A), which is extensively leaking fluorescein (B. white arrows) [11]. Figure 1.8. Fundus photograph and fluorescence a ngiogram of proliferative DR [11]. Current Treatments for Retinopathies Currently the clinical proved treatments for retinopathies are limited, and few drug medications are available. The c onventional treatments include laser photocoagulation, cryotherapy, photodynamic th erapy, scleral buckle, and vitrectomy. All of them cannot cure th e disease, but can only de lay the disease progression.

PAGE 30

14 In laser photocoagulation, the doctor pl aces thousands, up to 3,500, small laser burns on the retina. These burns will dest roy the normal tissue a nd decrease the oxygen needs of the retina. The treatment is usually effective, but at the cost of loss of normal tissue, and it reduces peripheral vision, impair night vision and change color perception. The laser photocoagulation is not a cure, as the disease ca n still progress in spite of treatment. More treatments may be needed to further prevent vision loss. Laser treatment is currently applied in all retinopathies, that is, ROP, DR, and ARMD. Laser is also used to target at the leaking spots, like in severe macular edema, the laser burning is applied in a focal way. When preventing abnormal vessel growth, as in proliferative DR, the laser burning is applied in a scattered way. Figure 1.9. Photocoagulation (courte sy of National Eye Institute, www.nei.nih.gov ).

PAGE 31

15 Cryotherapy is a procedure in which physic ians use an instrument that generates freezing temperature to briefly touch spots on the surface of the eye that overlie the periphery of the retina. It also destroys th e tissue and impairs the side vision. Cryotherapy is more used for ROP. In Figure 1.10, cartoon is showing cryothera py application to the anterior avascular retina. A cold probe is pl aced on the sclera till an ice ball forms on the retinal surface. Multiple app lications are done to cover th e entire vascular area. This treatment thins the tissue under the retina a nd allows easier oxygen diffusion through the retina. Figure 1.10. Cryotheropy ( http://www.checdocs.org/dr_treatment.htm ). In photodynamic therapy, a drug called verte porfin is injected i.v. and perfused to the vasculature in the eye. The drug tends to stick to the surf ace of new blood vessels, and then, a light is shined into the eye for about 90 seconds, and th e light activates the drug to destroy the new blood vessels. The a dvantage of this method is that the drug doesnt destroy the normal tissue surrounding. But the patient needs to avoid bright light for five days because the drug can be activated in their exposed body parts. Photodynamic therapy is more used to treat wet ARMD.

PAGE 32

16 In later stages of ROP, scleral buckle is another treatment option [21]. This involves placing a silicone band around the eye and tightening it. This keeps the vitreous from pulling on the scar tissue and allows the retina to flatten back down onto the wall of the eye. The band will be removed later. In most severe conditions in retinopathies, vitrectomy can be applied, in which the vitr eous is removed, scar tissue on the retina peeled back or cut away, and saline so lution is replaced for vitreous. The retina reattachment can be seen after this surgical treatment [22]. Pathogenesis of Diabetic Retinopathy Diabetes mellitus is a serious disease lead ing to morbidity and mortality as it has long-term complications include macrovascular and microvascular di sease. Both type I (characterized by no insulin pr oduction) and type II (charact erized by insulin resistance) diabetes can have these co mplications. Retinopathy is one of the microvascular complications. It is believed that the chroni c hyperglycemia has a st rong relationship with microvascular complications, and clinical re search data demonstrates that improved glycemic control contributes to signifi cant microvascular risk reduction [23, 24]. Experiments on animal models also suggest th at long-term hyperglycemia is necessary to induce changes in the retin al vasculature [25]. In the retina, GLUT1, which is one of a family of glucose transporters, is responsible for glucose transf er across BRB into the endothelial cell and retinal cells. While in most other cells in the body, insulin assistance is required for internalize glucose; this is not the case with the re tina. Excessive transport of glucose through GLUT1 [26], the involvement of GLUT1 in RPE cells [27], and increased density of relocalized GLUT1 in inner BRB [28] have been proposed to be related with intracellular hyperglycemia. Intracellular hyperglycemia in the early stages of diabetes causes

PAGE 33

17 abnormalities in blood flow and increases in vascular permeability. The blood flow changes come from decreased activity of vasodi lators, such as nitric oxide, and increased activity of vasoconstrictors such as angiot ensin II and endothelin-1 [29]. The increase in vascular permeability comes from VEGF functioning on endothelial cells and changes in extracellular matrix. With time, hypergly cemia can further induce cell loss and progressive capillary occlusion. All these changes will eventually lead to edema, ischemia and hypoxia-induced neovascularization. To date, there are several hypothesized theories on how hyperglycemia contributes to microvascular damage, or retinopathy. The most common ones are polyol pathway theory, advanced glycation end-pr oducts (AGE) theory, oxi dative stress theory and PKC activation theory. Increased Polyol Pathway Flux As shown in Figure 1.11, glucose is redu ced to sorbitol by aldose reductase, and at the same time, nicotinamide-adenine di nucleotide phosphate (NADPH) is oxidized to NADP+. Then sorbitol is oxidized by sorbitol dehydrogenase to fructose, coupled with the reduction of oxidized nicoti namide-adenine dinucleotide (NAD+) to NADH [29]. So the intracellular high glucose level will result in excess sorbitol, fructose, NADH accumulation and decrease in NADPH. Some damages caused by increase flux through polyol pathway have been proposed to incl ude: activation of prot ein kinase C [30], contribution of AGE formation [30], decr eased activity of Na /K-ATPase [29], and increase in the formation of reactive oxygen species leading to oxidative stress [29]. Production of AGE AGE are irreversibly cross-linked subs tances. Intracellular hyperglycemia is possibly the primary initiating event in the formation of intracellular and extracellular

PAGE 34

18 AGE [32, 33]. During formation of AGE, gluc ose reacts nonenzymatically with the amino group of proteins and other macromol ecular to form Schiff bases, which are transformed into Amadori products that even tually lead to AGE formation [34]. When AGE bind their receptors, RAGEs, some abnormal cellular events can occur, including: the stimulation of the pr oduction of the vasocons trictor e ndothelin-1, VEGF production that is associated with increased permeability, and production of reactive oxygen species. The long-term eff ects induced by AGE and RAGEs are mostly mediated by transcription factor B to express cytokines a nd growth factors [29]. Figure 1.11. Polyol Pathway [31]. Figure 1.12. AGE formation [31] There are several adverse al terations in the micro vasc ulature associated with AGE. AGE formation can contribute to thicke ning of the basement membrane and to microvascular hypertension by inactivating nitric oxide [31]. The thickening and

PAGE 35

19 hypertension can lead to micr ovascular leakage and occlusio n. AGE can adversely affect vascular permeability, alter the functions of ma trix molecules, and alter the functions of vessels, by decreasing the vessel elasticity, increasing fluid filt ration across vessels [29], decreasing endothelial cell adhesion [35], and so on. Generation of Reac tive Oxygen Species The term oxidative stress refers to the imbalance between the production of reactive oxygen species and th e normal antioxidant protective mechanisms present to guard tissues from oxidative damage [36]. As discussed above, both polyol pathway and AGE formation can lead to the generation of reactive oxygen species. Glucose also has pro-oxidant properties in the pr esence of heavy metals and the auto-oxidation of glucose can form free radicals too. These reactive oxyg en species can inactiv e or reduce nitric oxide levels [37]. The reactive oxygen species can result in damaged protein and mitochondrial DNA that have adverse effects on the microva sculature [38], especially leading to increased microvascular permeability [39]. Oxidative stress has been shown to increase intracellular calcium levels, which have been associated with endothelial hyperpermeability of macromolecules [40]. Activation of Diacylglycerol a nd Protein Kinase C Isoforms It has been shown that di acylglycerol (DAG) formation can be induced by glucose in cell cultures, animal tissues, and diabetic patients [31]. DAG is very important in the activation of various protein kinase c (PKC) isoforms, with the isoform being thought to be the most sensitive to changes in DAG levels. PKChas been shown to be increased in various vascular tissues following hyperglycemic exposure [41]. PKC, PKC1 and PKC2 are seen to be elevated in the retina during acute and chronic

PAGE 36

20 hyperglycemic states [42]. The conseque nces induced by PKC activation include increased retinal permeability [43], increased basement matrix protein formation [44], VEGF formation [44], and so on. So PKC ma y have adverse long-term effects in the vasculature. Based on the involvement of these pathwa ys, a lot of pathological changes can happen in diabetic retinopathy. Some of the most important change s are covered below. They will lead to edema, ischemia and hypoxia in the retina, which all lead to abnormal neovascularization. How Does the Change in Retinal Blood Flow Occur? Hyperglycemia induces changes in re tinal blood flow via its effects on vasodilators and vasoconstric tors. Nitric oxide (NO) is one of the most important vasodilators. It is synthesized from L-arginine or L-citrullin e in cells via activation of a calcium-dependent nitric oxide synthase (NOS). The NOS isoform produced in endothelium is called eNOS. NO functi ons by entering smooth muscle cells and activating soluble guanylate cyclase, which will result in increased level of cyclic guanosine 3, 5-monophosphate (cGMP). cGMP can relax the smooth muscle cells through a decrease in Ca2+ and dephosphorylation of myosin light chains [45]. In the hyperglycemic environment, a couple of pathways mentioned above can lead to decreased level of NO. In th e polyol pathway as mentioned earlier, sorbitol is produced coupled with the oxidation of NADPH a nd this reduces NADPH availability, and NADPH is one of the cofactors for NO synthe sis. AGE production can lead to subsequent superoxide generation result ing in NO inactivation. PKC ac tivation reduces the capacity of a number of agonists to increase intracellular Ca2+ and to stimulate NO production; on the other hand, the superoxide expression may also result from PKC activation.

PAGE 37

21 Endothelin (ET)-1 is a powerful vasoconstr ictor. At low concen trations, it induces vasodilation. While at high concentrations it causes the constrictive response by interacting with its receptors on smooth mu scle cells and pericytes in the retinal vasculature. Hyperglycemia-induced PKC activation can enhance ET-1 transcription level [46]. What Causes Retinal Capillary Cell Death? Pericytes loss and endothelial cells loss are both seen in diabetic retina. The cell death will inevitably lead to microaneurysms and vascular obstruction. Polyol pathway, AGE pathway and oxidative stress are all t hought to be associated with cell death. Sorbitol accumulated in polyol pathway may cause hyperosmolality of the cells [47]; accumulated AGE production in the glycati on pathway will form cross-links and to generate oxygen-derived free radicals [48]; and the oxidative stress will inactivate NO and cause abnormal chemical changes in DNA structure [49]. What Causes Retinal Ischemia? Hyperglycemia causes ischemia via several possible mechanisms, including thickened basement membrane, platelet aggr egation, leukocyte activation and adherence. Hyperglycemia is sufficient to increase the synthesis of basement membrane components, like fibronectin [50], various types of collagens [51] and vitronectin [52]. Increased number and size of platelet-fibrin thrombi in retinal capillaries have been found in the retina of patients with diabetic retinopat hy [53]. Hyperglycemia-induced PKC activation will stimulate platelet-deriv ed factor (PAF) production, wh ich will activate platelets. Activated platelets can produce platelet-derived microparticles, which are involved in the thrombus formation [54]. PAF can also stim ulate their receptors on leukocytes rolling on the luminal endothelial membrane and activate them. 2 integrins on activated leukocytes

PAGE 38

22 enable them to adhere tightly to the endothelial cells via binding intercellular adhesion molecule-1 (ICAM-1), while as the same IC AM-1 is also unregulated by PKC activation. And NO downregulation can allow leukocytes to escape from NO control, also leading to leukocyte activation a nd adherence [54]. Angiogenesis and Growth Factors Vasculogenesis and Angiogenesis Small blood vessels consist only of endotheli al cells (ECs), whereas larger vessels are surrounded by mural cells (pericytes in medium-sized vessels and smooth muscle cells (SMCs) in large vessels ) [55]. Vessels can grow in several ways. Vasculogenesis refers to the formation of blood vessels by endot helial progenitors [55]. It is a process by which the initial vascular tree forms in th e yolk sac and aortic arches, and begins immediately following gastrulation when mes odermal cells aggregate into blood islands. Blood islands contain the precursors of hemat opoietic and vascular endothelial lineages [56]. Angiogenesis refers to the formation of new vessels formation by sprouting from pre-existing vessels and subs equent stabilization of th ese sprouts by mural cells. Additional modes of vascular growth incl ude intususception, bridge formation, and vascular splitting, in which inva ginations or extensions of th e vessel wall form tubes that connect or bifurcate parent vessels [56]. The traditional view is that vessels in the embryo developed from endothelial progenitors, whereas sprouting of vessels in the adult resu lted only from division of differentiated ECs. However, recent eviden ce has shown that endothelial progenitors contribute to vessel growth bot h in the embryo and in ischemic, malignant or inflamed tissue in the adult. They can even be used th erapeutically to stimulate vessel growth in ischemic tissues, a progress called Thera peutic Vasculogenesi s [57-59]. Although

PAGE 39

23 retinal neovascularization has been thought to be due to proliferation of endothelial cells by angiogenesis, Grant et al. showed that hematopoietic stem cells can enter the circulation and reach the areas of angiogenesis, and clonally differentia te into endothelial cells [60]. In another study, adult Lin(-) hemato poietic stem cells inje cted intravitreally into neonatal mouse eyes have been shown to in teract with retinal astrocytes that serve as a template for retinal angiogenesis [61]. Bl ood vessels are being modified by endothelial progenitor cells, hematopoietic stem cells or other stem cells, and th ese cells functionally contribute to physiological and pathological angiogenesis. Angiogenesis is usually inactivated or kept at low levels in normal tissue of an adult, but may be activated to an excessive st ate in a number of diseases, such as cancer, psoriasis, arthritis, retinopathy, obesity, asthma atherosclerosis, and infectious diseases. Cancer is another best known disease that involves pathologi cal angiogenesis that can be potentially targeted for therapy. In 1972 Folkman proposed that solid tumors are dependent on angiogenesis for growth greater than a few millimeters in size, and that increases in tumor diameter require a corres ponding increase in vascularization [62]. A critical step during angiogenesis is the loca l stimulation of endothelial cells by various cytokines and growth factors. Stimulation causes the endothelial cells to lose their contact inhibition, migrate and breach the basement me mbrane, proliferate, and differentiate to organize into new vessels [63]. Hypoxia-Induced Factor (HIF) Beyond a size limitation, simple diffusi on of oxygen to metabolizing tissues becomes inadequate, and specialized systems of increasing complexity have evolved to meet the demands of oxygen delivery in highe r animals [64]. One important role in the systems is angiogenesis, to make new vesse ls sprouting into the location that blood

PAGE 40

24 delivery is needed. So ischemia or hypoxia is one of the key factor s that lead to the initiation of angiogenesis. Exactly ho w hypoxia induces angiogenesis was however poorly understood. The landmark of hypoxia st udy in the early 1990s showed that hypoxia could induce expression of platelet-derived growth factor (PDGF) mRNA [65] and vascular endothelial grow th factor (VEGF) mRNA in ti ssue culture [66]. Both PDGF and VEGF are thought to be important growth factors triggering angiogenesis. A large number of genes are involved in differ ent steps in angiogenesis and they are independently responsive to hypoxia in tissue culture. Besides PDGF and VEGF, nitric oxide synthase, fibroblast growth factor, angi opoietins, and matrix metalloproteinases are involved [67-69]. Many of the individual phenot ypic processes in angiogenesis such as cell migration or endothelial tube formati on can be induced by hypoxia tissue culture [70]. Further study of hypoxia-induced angiogene sis leaded to the discovery of a key transcriptional regulato r, hypoxia-inducible factor (HIF)-1 [47, 68, 69, 71]. HIF-1 is a heterodimer DNA-binding factor. HIF-1 consists of an and subunits, both of which have a number of isoforms. HIF-1 subunits are constitutive nuclear proteins, while HIF-1 subunits are hypoxia-inducible There are three isoforms for subunit. HIF-1 and HIF-2 appear closely related and ar e both able to interact with hypoxia response elements (HREs) to induce tran scriptional activity [ 72, 73]. In contrast, HIF-3 appears to negatively regulate the re sponse, through an alternatively spliced transcript [74]. The molecular mechanism behind HIF-1 is a pathway that links oxygen availability and the gene expression of vari ous growth factors, especially VEGF. In normoxia and hyperoxia oxygen-dependent prolyl hydroxylases hydroxylate HIF-1

PAGE 41

25 proline residues, and this chemical modifi cation leads to a HIF-1 capture by a ubiquitin ligase complex that directs it to the proteasome for destruction. Under hypoxic conditions, HIF-1 is not hydroxylated, escapes ubiqui tination, accumulates and directs pro-angiogenic expression [75]. Vascular Endothelial Growth Factor (VEGF) VEGF was originally discovered as the vascular permeability factor (VPF) that increased the vascular permeability in the skin [76]. In 1989 Ferrara and Henzel identified a growth factor for endothelial ce lls from bovine follicular pituitary cells and named it VEGF [77], which was then proved to be identical to VPF [78, 79]. VEGF is the most potent endothelial cell growth factor f ound to date. In the past two decades, this growth factor has been studied extensivel y and its key roles in the proliferation, migration, invasion, cell survival, differentiati on of endothelial cells and other cell types have been established. It is critical in the normal embryonic development of vasculature and has essential functions in adults during normal physiologi cal events such as would healing, menstrual cycle, even though the mRNA levels of VEGF and its receptors decrease significantly postna tally. Meanwhile, VEGF is also an important factor in numerous pathological situ ations, many of which involve abnormal angiogenesis, for example, inflammation, retinopathies, psoriasi s, and cancer. Targeting VEGF signaling in these diseases has been studied with ent husiasm and a number of novel drugs targeting VEGF are being tested in clinical trials. VEGF Family and Isoforms The VEGF gene family consists of multiple variants, including VEGF-A (hereafter referred to as VEGF), VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF-F and placental growth factor (PlGF-1 and PlGF-2 is oforms). They are secreted glycoproteins

PAGE 42

26 that form homodimers, which belong to a st ructural superfamily of growth factors, including the platelet derive d growth factor (PDGF), char acterized by the presence of eight conserved cysteine residues [80, 81]. VEGF-A is believed to be the major stimulator for vascular angiogenesis. VEGF-B is structurally similar to VEGF-A and PlGF is highly abundant in heart, skelet al muscle and pancreas and may regulate endothelial cell functions via a paracrin e fashion [82]. VEGF-C and VEGF-D are basically involved in lymphangiogenesis and i nduce the proliferation and cell survival of lymphatic endothelial cells [83-85]. VEGF-E, encoded by the Orf virus, is structurally similar to VEGF-A, specifically binds to VEGFR-2 and induces angiogenesis [86]. VEGF-F, as a collective name, summarized the variants isol ated from snake venoms [87]. The term VEGF refers to a collection of related isoforms expressed from the same gene [88]. The gene encoding VEGF, or VEGF-A, is located on the short arm of chromosome 6 in humans [89] and on chromosome 17 in mice [90]. The vegf gene consists of eight exons and seven introns, al ternative splicing resu lts in many isoforms. The best studied isoforms in human ar e VEGF121, VEGF165 and VEGF189. In mice, the homologous counterpart isoforms contai n one less amino acid, so mVEGF164 is the corresponding isoform for hVEGF1 65 [90], for example. In all isoforms, the transcrips of exon 1-5 are all conserved and exon 6 and 7 are where the alternative splicing occurs. Exon 3 and 4 encode the binding domains fo r VEGFR-1 and VEGFR-2 [91]. Exon 6 and 7 encode two heparin-binding domains, which influence receptor binding and solubility [92]. VEGF189, containing both the exon 6 and 7 transcripts, has high affinity for heparin sulfate and is mostly associated w ith the cell surface and th e extracellular matrix [93]. On the contrary, VEGF165, lacking e xon 6, is moderately diffusible; and

PAGE 43

27 VEGF121, lacking both exon 6 and 7, is high diffusible [94]. Recently a new isoform called VEGF165b, a variant of VEGF165, has been identified [95]. The C-terminus of VEGF165b is encoded by exon 9, instead of e xon 8 as in VEGF165 and other isoforms [96]. VEGF165b binds to but does not trigger receptor phosphorylation, so it is actually an endogenous inhibitory form of VEGF [9 6]. This is due to a missing exon 8-encoded C-terminus, which has mitogenic signa ling functions. Figure 1.13 [92] shows the alternative splicing among VEGF isoforms. Figure 1.13. VEGF-A isoforms [92]. VEGF Receptors VEGF binds to three cell surface receptor tyrosine kinases: VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR) and VEGFR-3 (flt-4) VEGFR-1 and VEGFR-2 are primarily located on vascular endothelium while VEGFR-3 is mostly found on lymphatic endothelium. These receptors are structura lly similar: all of them contain seven extracellular immnoglobin (Ig )-like domains, a transmembrane domain, a regulatory juxtamembrane domain, and a consensus tyrosine kinase domain interrupted by a kinaseinsert domain. The second and third Ig-like domains function as the high-affinity VEGF

PAGE 44

28 binding domain, whereas the first and fourth Ig-like domains regulate ligand binding and facilitate receptor dimeri zation, respectively [97-99]. VEGFR-1 has a molecular weight of 180 kDa and binds VEGF-A, VEGF-B and PlGF. The affinity of VEGFR-1 for VEGF is ten-fold higher than VEGFR-2 but its tyrosine kinase activity is ten-fold weaker th an VEGFR-2 [92]. In the classical views, one of the major functions for VEGFR-1 is to ac t as a decoy receptor restricting VEGF to bind to VEGFR-2, which is more mitogeni c [100]. VEGFR-1 is required for normal blood vessel development during embryogenesis and a VEGFR-1 knock-out is lethal in mice at embryonic day E8.5. The lethality was sh own to be associated with an abnormal increase in the number of endothelial proge nitors, which is the phenotype as VEGF hyperactivity, indicating a negative regulat ory function of VEGFR-1 [101]. Supporting this, a modified form of VEGFR-1 without the tyrosine kinase domain was constructed and found to be compatible with normal va scular development and angiogenesis in transgenic mice [102]. A naturally occurri ng soluble form of VEGFR-1, called sVEGFR1 or sFlt-1, is expressed from differentia l pre-mRNA splicing. sVEGFR-1 has the same ligand affinity as VEGFR-1, but is missing th e transmembrane and intracellular domains [103, 104]. It binds to free VEGF and reduces its availability to VEGF receptors, which further suggests its relative, VEGFR-1, as a negative regulator for VEGF signaling. However, VEGFR-1 does mediate VEGF signali ng in non-endothelial cells, especially those cells that only express VEGFR-1 as the VEGF receptor, such as monocytes and macrophages [105, 106]. A recent study showed that PlGF signaling mediated by VEGFR-1 in monocytes is associated with the inflammatory reac tions [107]. Besides

PAGE 45

29 monocytes, VEGFR-1 signaling is also beli eved to be important for endothelial progenitors and carcinoma cells. VEGFR-2, a 230 kDa glycoprotein, is rec ognized as the primary mediator of VEGF signaling. It regulates e ndothelial cell proliferation, migration, differentiation, cell survival and vessel permeability and dila tion. VEGFR-2 knock-out mice die between E8.5 and E9.5 due to deficiency in blood ve ssel formation [108], indicating that VEGFR2 is also crucial for the functions of he matopoietic/endothelial progenitors. VEGFR-3, 170 kDa, binds to VEGF-C and VEGF-D. It is expressed in embryoni c endothelial cells but postnatally becomes restricted to the lymphatic endothelium [109]. Apart from these three VEGF receptors, neurophilins (NRPs) can also act as cell surface receptor for VEGF, but in an is oform specific manner. NRP-1, originally identified on neuron cells as a receptor for class 3 semaphor ines/collapsins family of neuronal guidance mediators [110], is also expressed on endothelial cells. It lacks the intracellular tyrosine domain and needs to associate VEGFR-1 [111] and/or VEGFR-2 [112] to transduce a signal. It is suggeste d that NRP-1, as a co-receptor, can form a receptor complex with VEGFR-2 to enhan ce the binding the signaling of VEGF165 and VEGFR-2 cannot sufficiently transducer the VEGF signaling w ithout NRP-1 [113]. NRP-1 also binds VEGFR-1 forming a lig and-independent complex [111]. NRP-2, lacking an intracellular domain like NR P-1, can also bind to VEGF. It can bind VEGF121, VEGF145 and VEGF165, but NRP-1 ca nnot bind VEGF145. NRP-2 can also bind to PlGF and can interact with VEGFR-1 [114]. In addition to NRPs, heparin sulfate proteoglycans (HSPGs) can bind to the VE GF isoforms with the heparin binding domains, such as VEGF165 and VEGF189. H SPGs are abundant, highly conserved

PAGE 46

30 components of the cell surface and the extracellu lar matrix of all cells and have been reported to play a critical role in modulating the differential biological activities of VEGF isoforms [115]. Figure 1.14 [116] demonstrates the binding of VEGF varian ts to the receptors. In summary, VEGF-A binds to VEGFR-1, VEGFR2 and the receptor heterodimer; VEGFC and VEGF-D bind to VEGFR-2 and VEGFR-3. Notably, PlGF and VEGF-B exclusively bind to VEGFR-1 and VEGF-E excl usively binds to VEGFR-2, which is very useful in receptor specificity studies. Figure 1.14. VEGF family ligands and their receptors [116]. VEGF Receptor Signaling As mentioned above, VEGFR-2 is thought to be the major receptor for VEGF signaling in endothelial cel ls. Upon binding of VEGF, VEGFR-2 is activated by

PAGE 47

31 autophosphorylation, and initiates a number of signaling cascades that induce cell proliferation, migration, survival and/or increase in endot helium permeability. The cell proliferation induced by VEGF R-2 signaling typica lly involves MAPK pathways. Activation of VEGFR2 recruits Grb-2 and activat es it, which leads to the activation of Sos, then the activation of Ras, eventually the stimulation of Raf1/MEK/ERK signaling cascade [117]. Activat ed MAPK pathways will translocate to the nucleus and regulate the gene expressi on and cell proliferation. VEGFR-2 can also recruit PLC -1, and the activation of PLC -1 will induce phosphatidylinositol 4,5bisphosphate (PIP2) hydrolysis producing 1,2-diacylg lycerol (DAG) and inositol 1,4,5trisphosphate (IP3). The activation of PKC can result from the production of DAG, which further leads to the Ras-independent Raf ac tivation and thus the stimulation of ERK activity [118]. The data dem onstrating the requirement of PI3 kinase in the VEGFR-2induced cell proliferation ar e conflicting, so the involve ment of PI3 kinase is controversial [119, 120]. Cells expressing VE GFR-1 are unable to activate MAPK [121]. VEGF can act as a chemoattractant for e ndothelial cells so th at VEGF signaling is believed to be involved in cel l migration. Firstly, the sign aling from activated VEGFR-2 can promote focal adhesion kinase (FAK) phosphorylation and recruit it to focal adhesions, together with paxil lin and actin-anchoring proteins like talin or vinculin [122, 123]. Therefore the cytoskeleton organization is modified and cell migration is promoted. Secondly, the p38/MAPK pathway can be activated upon VEGF binding to VEGFR-2, and thus may play a role in cell migration and p38 inhibitors can decrease cell migration [124]. Thirdly, the PI3 kinase/Akt pathway can regulate the actin organization and cell migration [125]. Besides VEGF R-2, VEGFR-1 and NRPs have all been implicated in

PAGE 48

32 VEGF-mediated cell migration and invasion [92] However VEGFR-2 is considered to be the main mediator of cell migration. VE GFR-1 stimulates p38 phosphorylation and has no effect on endothelial cell migration [126]. PI3 kinase/Akt pathway plays an im portant role in the VEGF-induced cell survival. The phosphorylation of VEGFR-2 can l ead to the activation of PI3 kinase and Akt/protein kinase B (PKB). Akt is an anti-a poptotic factor and is sufficient to promote cell survival. It has been re ported that the inhibition of PI3 kinase abolished Akt activation and the VEGF-mediate d cell survival was also bl ocked [127]. VE-cadherin and -catenin can complex with VEGFR-2 and PI3 kinase and form a transient tetramer to promote cell survival [128]. The expression of some anti-apoptotic factors can also be induced by VEGF and contribute to cell surviv al, for instance, caspase inhibitors Bcl-1 and A1 [129] and IAP (apoptosis inhibitors ) family proteins [130]. VEGFR-1 cannot associate with the VE-cadherin complex [128] and does not activate the PI3 kinase/Akt pathway [127], so that it is thought to not be involved in VEGF-induced cell survival. Originally discovered as a vascular pe rmeability factor, VEGF can also increase the vascular permeability. The administration of VEGF to endothelial cells is shortly followed by the formation of some specialized regions in the cell membrane that are highly permeable to macromolecules [131]. PI3 kinase and p38/MAPK have been suggested to be involved in the increase of membrane permeab ility [132]. In the established vessels, VEGF also regulates vascular permeability by affecting the components of tight, adherence and ga p junctions, such as VE-cadherin, -catenin and occludin [116]. Another aspect of this intera ction is that endothelial NO synthase (eNOS)

PAGE 49

33 can induce the activation of Ak t, which further regulates th e NO level and leads to vessel dilation and permeabilization [133, 134]. Figure 1.15 [92] summarizes VE GF signaling via VEGFR-2. Figure 1.15. VEGF signaling via VEGFR-2 [92]. The Function of VEGF in Ocular Neovascularization VEGF is thought to play a central role in retinal angiogenesis as supported by data from animal models and clini cal investigation. VEGF is upre gulated in the retina during neovascularization in animal models with ischemia-induced retinopathy [135-138], and

PAGE 50

34 the VEGF mRNA is increased by three-fold within 12 hours of the onset of relative hypoxia and maintained for many da ys at higher levels until new vessels start to regress [136]. Patients with active PDR were found to have increased levels of aqueous and vitreous VEGF [139-145]. Higher levels of VEGF expression were also reported in epiretinal neovascular membranes and reti nas from PDR patients [146, 147]. However, an interesting finding in the active PDR pa tients showed that there was a significant decrease in VEGF levels after panretinal laser photocoagulation tr eatment [140]. Further evidence supporting VEGFs major role in re tinal neovascularizati on comes from VEGF inhibition studies. VEGF receptor chimeric proteins, neutralizing antibodies, and antisense oligonucleotides have succe ssfully showed inhibition effects on neovascularization [148-151]. Based on the evidence, it is widely accep ted that VEGF is very important and necessary for retinal neovascularization, but VE GF may not be sufficient for it. Repeated intraocular injections of VEGF or sustained intravitreous release of VEGF in primates results in severe changes to retinal vessels including di lation, leakage, and microaneurysms, but no apparent retinal neovascularization [152, 153]. When VEGF expression is driven by the reti nal-specific rhodopsin promoter in the transgenic mice, the development of neovascularization was produced in the deep capillary bed of the retina, and high levels of VEGF expression can furt her cause retinal traction and detachment [154]. The new vessels grew from the deep cap illary bed into the s ubretinal space. The close proximity of the deep capillary bed to the photorec eptor expressing VEGFs and differential susceptibility of the vascular beds might be an explanation for this vascular growth [155].

PAGE 51

35 The role of VEGF in choroidal neovascu larization (CNV) is less clear. Increased VEGF expression was found in fibroblasts and RPE cells of choroidal neovascular membranes surgically removed from patie nts [146, 156, 157]. And in the animal model of laser-induced CNV, it has been shown th at VEGF mRNAs were upregulated in the neovascular lesions [158]. VEGF is thought to be necessary in CNV development because several specific VEGF signaling inhi bitors have shown reduced CNV [159-161]. But VEGF is not a sufficient stimulator of CNV because increased expression of VEGF in photoreceptors or RPE cells do es not lead to CNV [154, 162]. Basic Fibroblast Growth Factor (bFGF or FGF2) FGF is a family of heparin-binding growth factors. bFGF has been localized in the adult retina. In the mouse model of ischemia -induced retinopathy, bFGF level is elevated during neovascularization [163] In the animal model of laser-induced subretinal neovascularization, RPE cells were found to be stained with aFGF and bFGF [164]. In studies on clinical specimen, both elevated a nd non-significantly-changed levels of bFGF have been reported in the vitreous samp le of PDR patients [165, 166], which argues against a major role in retinal neovasculariz ation. Further evidence comes from animal models. In the ischemia-induced retinopat hy or laser-induced CNV mouse model, transgenic mice deficient in bFGF developed the same amount of retinal or CNV as the wild-type mice, respectively, indicating bF GF expression may not be necessary in angiogenesis [167, 168]. It has been hypothesize d that bFGF will manifest its angiogenic potential when there is cell injury. It is found that bFGF can get access to the extracellular compartment during photorec eptor damage and increased CNV can be stimulated [169].

PAGE 52

36 Angiopoietins Angiopoietins and their receptors (Tie re ceptors) are another endothelial-specific system that has been implicated in va scular growth and development. Current understanding about the Tie receptors is that Tie1 signaling is important for vascular integrity and Tie2 signaling is important in remodeling of the developing vessels by maximizing the interactions between endothe lial and supporting cells [155]. The ligand for Tie1 has not been identified. Angiopoiet in (Ang) 1 and 2 are ligands for Tie2 receptor. Ang1 binds with high affinity and initiates Tie2 phosphorylation and downstream signaling. Ang2 also binds with high affinity, but does not stimulate phosphorylation of Tie2. It l ooks like Ang2 is a naturally occurring antagonist for Ang1 and Tie2. The interaction of Ang1 and Tie2 is essential for the remodeling function of Tie2 on newly developing vessels. And it has been hypothesized that Ang2 might provide a key destabilizing signal involved in in itiating angiogenic remodeling. The Ang2 blockade of Tie2 signaling can disrupt sta bilizing inputs to ECs, making ECs more responsive to VEGF and thereby stimulating angiogenesis. But when there is no VEGF present, those ECs are prone to apoptosis a nd the destabilized ve ssels regress [170]. Ang2 mRNA levels have been reported to increase in normal and pathological retinal angiogenesis [171-174]. It has been shown that Ang2 can stimulate a significant upregulation of proteinases in EC [174] that may be important for cell migration during retinal neovascularization. Platelet-Derived Growth Factor (PDGF) PDGF, a dimer protein, a potent mitogen and a chemoattractant, has been implicated in angiogenesis. Similar to VEGF PDGF is another grow th factor that is elevated after hypoxia [65]. Recent findings a bout PDGF include: increased levels of

PAGE 53

37 PDGF-AB was reported in vitreous sample s of PDR patients [ 175]; overexpression of PDGF-B in transgenic mice leads to prolifera tion of endothelial cells, pericytes and glial cells resulting in tract ion retinal detachment [176-179]. It has been proposed that PDGF may act in concert with VEGF in ischemic retinopathy [176-178]. Integrins Integrins are a family of transmembrane proteins that are the major cell surface receptors responsible for the at tachment of cells to the extr acellular matrix. Structurally, integrins are heterodimeric recep tors composed of two subunits, and More than 20 different integrins are formed from the combination of 18 known subunits and 8 known subunits. Each integrin binds to its own corresponding extracel lular matrix (ECM) and/or cell surface ligand. These include stru ctural ECM proteins, such as collagens, fibronectins, and laminins, as well as provisi onal ECM proteins that are deposited during tissue remodeling and thrombotic events [180] .The first integrin-binding site to be identified was the sequence Arg-Gly-Asp, wh ich is recognized by several integrins. However, other integrins bind to other distin ct peptide sequences. Wh ile integrins are one of the most essential cell su rface components in the body and are present in almost all tissues, no cell expresses all integrins. Indeed the particular integrin types expressed are dependent on the ECM ligands present with in the local microenvironment. Even on a given cell type, the specific integrins expresse d are also altered to match the concurrent changes within the local ECM. So the expressi on of integrin is spatially and temporally regulated. The integrins also function as an anc hor for the cytoskeleton. The interaction between the cytoskeleton and th e extracellular matrix is resp onsible for the stability of cell-matrix junctions. There are two categorie s of cell-matrix junctions: focal adhesion

PAGE 54

38 and hemidesmosome. In focal adhesi ons the cytoplasmic domains of the subunits of integrins associate with bundles of actin filame nts to anchor the actin cytoskeleton at the cell-matrix junctions. While in hemidesmosom e integrins interact with intermediate filaments instead of actin. Hemidesmosome is mostly found in the an chorage of epithelial cells to the basal lamina. Integrin Signaling Unlike many cell surface receptors that c ontain tyrosine kinases, integrins do not contain intrinsic tyrosine kinase activit y. Upon ligand binding, th e integrins undergo a conformational change into its activation st ate. The change in activation has been assessed by showing evidence of polymerizati on, clustering, or the surface exposure of different antibody binding epitopes [181]. Since the cytoplasmic domains of the integrins can bind constitutively to cytoskeletal com ponents such as talin, the conformational change and activation of integrins can result in changes in cytoskeletal protein functions, which will lead to major changes in cell shape and locomotion. On the other hand the activation of integrins can initiate a seri es of signaling tran sductions, with the involvement and assembly of a variety of signaling molecules. A non-receptor protein tyrosine kinase cal led FAK (focal adhesion kinase) plays a key role in integrin signaling. FAK is loca lized at the focal a dhesion and is rapidly tyrosine auto-phosphorylated following lig and binding by integrins. Besides FAK, members of the Src family or non-receptor prot ein tyrosine kinases also associate with focal adhesion and are involved in integrin si gnaling. Src and FAK prob ably interact with each other, resulting from the binding of th e Src SH2 domain to the auto-phosphorylated sites of FAK. Src then phosphorylates additi onal sites on FAK. In addition to Src, the binding sites for SH2 domain created dur ing FAK phosphorylation are also taken

PAGE 55

39 advantage of by other downstream molecules, fo r instance, PI-3 kinase and the Grb2-Sos complex. These signaling molecules can form multicomponent signaling complexes that recruit and include small GTPase proteins su ch as Ras, Rho, Rac. Their involvement and activation will further lead to the activati on of a number of signaling cascades. Figure 1.16 [180] demonstrates the in tegrin signaling via the Akt, ERK and JNK pathways. These signals collaborate to regulate cellular pr oliferation, migration and survival. And also, many small GTPases like Rho and Rac play critical roles in cytoskeletal remodeling events [180]. Figure 1.16. The activation of inte grins can lead to the signal transduction in a number of pathways. [180]. As mentioned above, integrins need to be activated to serve as a signaling molecule. The activation involves a conformational change that results in an increase in ligand-binding affinity. Proposed in the current model, the inactive fo rm of integrins are

PAGE 56

40 in a folded conformation in which the lig and-binding domain is adjacent to the membrane. When activated, the affinity for the ligand is increased, and ligand occupancy stabilizes the extended conformation of the integrin [182] Simultaneously, the associated topological change in the transmembrane and cytoplasmic domains makes them separate and bind to intracellular signaling molecule s to initiate downstream pathways [182]. According to this model, the conformational ch ange in integrins that induces signaling is the same as the one that is induced by ac tivation. And this ac tivation state can be promoted by both extracellular lig ands (so-called outside-in signaling) and intracellular signaling molecules (inside-out signaling) [182]. The outside-in signaling is usually triggered by ECM ligands and the inside-out si gnaling molecules are usually the effectors of the activation of growth factor receptors. The ECM (l ocal determiner) and growth factors (systemic and local determiner) can work synergically to enhance the signaling outcome induced by specific integrins in a gi ven cell. Under certain circumstances it is not sufficient to promote cell survival a nd proliferation until both proper ECM and growth factors are both present. The activation of integrins, especially t hose involving the interaction with growth factor receptors, usually o ccur in lipid-raft microdomains, where cholesterol and glycosphingolipids [183] and intracellular signaling molecules like Src family kinases [184] are relatively concentrated in the cel l membrane. These lipid-raft microdomains are distinct from the surrounding membrane in that they restrict the diffusion of the contents. It is suggested that the lipid -raft has other functions [182]. First, they could serve as a physical concentration of pre-assembled mo lecules for signaling upstream or downstream of the integrin, and the si gnaling inhibitory molecules could be excluded. Second,

PAGE 57

41 different integrin pools could be separated so that their ow n distinct function could be better performed. Third, the lipi d-raft may also facilitate and/or maintain integrin activation. In addition to help from concentr ated pre-assembled molecules, the altered membrane structure, due to the distinct ch emical characteristics in the lipid-raft, may favor conformational equilibrium between the inactive and the active forms. It is also proposed that the active integrin s might help to generate the lipid-rafts in other models [185]. The integrins can regulate the signaling of growth factor re ceptors. First the phosphorylation state of the grow th factor receptors can be regulated. One example is the interaction between v 3 and the epidermal growth fact or receptor (EGFR) on human endothelial cells. The adhesi on to the ECM mediated by integrin can lead to a low phosphorylated state within the cell, resulti ng in the phosphorylation of four tyrosine residues but not on the fifth tyrosine which is only phosphor ylated by EGF binding. This phosphorylated state is lower than in high concentration of EGF but ECM attachment doesnt occur. This low phosphorylated state is sufficient to induce ce ll survival but not proliferation. However, if only low con centrations of EGF ar e present, the ECM attachment can promote the phosphorylation sim ilar to high concentrations of EGF alone [182]. Thus the phosphorylation of EGFR on endothelial cells is not only regulated by ligand binding, but also regulated by integrins. The regulation on growth factor receptors can also occur when integrins inte rfere with the receptor expression. As for the inside-out signaling, the activa tion of growth factor receptors is usually the source of signaling. Integrins can be re gulated by growth factor receptors in many aspects and cell behavior can be altered. The integrin expression leve l can be altered, for

PAGE 58

42 instance, the expression level of a number of integrins on endothelial cells are increased by angiogenic growth factors such as FGF-2 [186]. The phosphorylated state of integrins can also be regulated by growth factor rece ptors. One example is the laminin receptor 6 4, an essential component in the hemi desmosomes, influences epidermal cell attachment to the underlying basal lamina. EGFR can induce the phosphorylation of the cytoplasmic domain of 4 subunit. This results in the cyto plasmic recruitment of Shc, and the activation MAPK and PI3K More importantly, the change in the phosphorylation state leads to release of the integrin from its liga nd, thus the hemidesmosome disassembles, which is a required step for cell proliferation and/ or migration [187]. Besides the phosphorylation state, growth fact or receptors can also alter the activation state of integrins. For example, it ha s been shown that VEGF can activate v 3 on human umbilical vein endothelial cells thus the adhesion to ECM is promoted and cell migration follows [188]. Relationships between Integrin and Other Growth Factor Receptors in Angiogenesis Among the over 20 integrins that have b een discovered to date, two of them, v 3 and v 5, are thought to be especia lly important for angiogenesi s. These integrins are not seen on normal epithelial cells in skin, but are highly expressed on endothelial cells participating in angiogenesis [189]. Only v 3 was found in choroidal neovascular membranes from ARMD patients, while both v 3 and v 5 were found in epiretinal membranes from DR patients [190]. Therefore, retinal and choroida l neovascularization may differ in the integrin requirement. Inhibi tion studies on integrin s further support this. Agents that bind v 3 and/or v 5 can suppress retinal neov ascularization, even though

PAGE 59

43 the effect is modest, but the inhibition of v 3 or v 5 has no significant effect on choroidal neovascularization [189]. Endothelial cells express at least eight different integrins including v 3 and v 5 [191], each of them having their own specifi c ligand. For example, collagen is a ligand for 2 1 while fibrin is a ligand for v 3, so that v 3 influences adhesion and signaling events of the endothelial cells bound to fibr in [192] but not of those bound to collagen [40, 193]. However, the endothelial cells w ill eventually become apoptotic when bound with collagen alone via 2 1. The unligated v 3 receptors seem to cluster on the cell membrane and colocalize with caspase activity, especially caspase 8 [194]. In addition to v 3, many other unligated integrins are likely to induce cell death, this is why integrins could be categorized as dependent recep tors under a variety of circumstances. v 3, expressed (although not exclusively) on endothelial cells, has been linked to many angiogenic signaling pathways via the in teraction with recepto rs for a number of growth factors, such as VEGF, EGF, IGF1, PDGF and insulin. Since VEGF and IGF-1 are the two most important growth factor s involved in my dissertation work, I am focusing on the interaction between v 3 and VEGFR and IGF-1R. VEGFR-2 activation by phosphor ylation is promoted by v 3 [195]. v 3 and VEGFR-2 interact and the co -immunoprecipitation of these two receptors has been demonstrated. However VEGFR-2 does not co-immunoprecipitation with the 1 or 5 subunits. VEGFR-2 phosphorylation and mitogeni city are enhanced in cells plated on vitronectin, an v 3 ligand, compared with cells plated on fibronectin, an 5 1 ligand, or collagen, an 2 1 ligand; further demonstrating a f unctional relationship between VEGR2 and v 3. Cell adhesion, migration, soluble ligand binding, and adenovirus gene

PAGE 60

44 transfer mediated by v 3 are all enhanced by VEGFR-2 signaling. An anti3 integrin antibody reduces VEGFR-2 phosphorylation and PI3 kinase activity suggesting that VEGFR-2 signaling initiated by v 3 occurs through the PI3 kinase pathway. Another molecule, p66 Shc (Src homology 2 domain containing), has been shown to play a key role in the VEGFv 3 interplay during tumor gr owth and vascularization [196]. The activation state of v 3 integrin has a critical function in in vivo tumor growth by influencing VEGF expressi on. By using a non-activable 3, a S752P mutant that cannot cluster, it was found that the stimul ation of VEGF expre ssion also depends on v 3 clustering. The recruitment of p66 Shc and phosphorylation of 3-associated p66 Shc are enhanced following v 3 clustering. The recruitment is not sufficient for v 3mediated effects on VEGF production and tumo r vascularization but the phosphorylation is necessary, in that a dominant-negative form of p66 Shc, which is phosphorylationdefective, completely abolished integrin-induced VEGF expression. IGF-1 is a classic endocrine hormone a nd systemically synthesized in liver and transported to the peripheral tissues stimulating growth. In addition, IGF-1 is also synthesized locally in peripheral tissue to promote growth in an autocrine/paracrine manner. Similar to VEGF and other growth factors, the extra cellular environment contributes to influence the outcome of th e hormone signaling. It has been shown that many ECM proteins, such as collagen type I and type IV, fibr onectin, thrombospondin, and osteopontin, can modulate the response of various cell types to IGF-1 stimulation via their integrin receptors [181] The interactions between v 3 and IGF-1 on vascular smooth muscle cells (SMC) have been illustrated in great detail and can be used as a good example of how growth factors and in tegrin signaling influence each other.

PAGE 61

45 When IGF-1 binds to the IGF1-R, IGF1-R will auto-transphosphorylate its two subunits, and further recruit signaling molecule s such as insulin re ceptor substrate-1 (IRS-1) and Shc, which can transduce the singling into correspondi ng cascades, such as the PI3K and MAPK pathways. Despite kina ses, phosphatases also participate in the signaling modulation. Phosphatases induce deph osphorylation reactions which can result in either activation or inactivation of signaling molecules. One phosphatase, Src homology 2 containing tyrosine phosphatase (SHP-2), normally transfers to IGF-1R 20 minutes after IGF-1 stimulat ion, resulting in a decrease in the phosphorylation level of the receptor and subsequent at tenuation of MAKP and PI3K activation [181]. However, a premature transfer at 5 minutes and prem ature attenuation has been found when the ligand occupancy of v 3 is blocked [197]. So obvious ly the properly liganded and activated v 3 is a necessary partne r in IGF-1R signaling. Normally when IGF1-R and v 3 are activated after ligand binding, SHP-2 will transfer to the phosphorylated 3 subunit first. An adaptor protein, DOK-1, facilitates the transfer. DOK-1 is phosphorylated after IG F-1 stimulation, and the YXXL motifs within its C-terminus domain become capable of bi nding to SHP-2 via SH-2 domains [198]. Also, DOK-1 contains a phosphotyr osine binding (PTB) domain, which allows it to bind to 3 at a tyrosine that is phosphorylated after v 3 activation [199]. Thus DOK-1 mediates SHP-2/ 3 association. If the transfer of SHP-2 to 3 is impaired for any reason, SHP-2 will be aberrantly tran sfer to IGF-1R instead and the premature dephosphorylation of IGF-1R occurs [181]. One SHP substrate, SHPS-1, becomes phos phorylated after IGF-1R activation. It is a single chain transmembrane protein a nd SHP-2 can bind to it via SH-2 domain. The

PAGE 62

46 transfer of SHP-2 from 3 to phosphorylated SHPS-1 is a necessary step to maintain optimal MAPK and PI3K activation [200]. SHPS -1 also recruits Shc to form a complex that is critical for MAPK a nd PI3K activation. SHP-2 can activate a Src family kinase via SH-2 domain binding, so that this Src fa mily kinase is recruited to SHPS-1 and phosphorylates Shc in the complex [181]. SHP-2 is further transferre d to the appropriate downstream signaling molecules to main tain MAPK and PI3K activation. v 3 has several ECM ligands, such as osteopontin, thrombospondin and vitronectin. For v 3 on SMC, the major ECM ligand is vitronectin. The heparin binding domain and RGD (arginine-glycine-asparg inine) sequence can both function as the v 3 binding site. It is believed that the heparin binding domain is the binding site triggering 3 activation, in that the exposure of cells with the heparin binding domain peptide results in v 3 phosphorylation and recruitment of SHP2 to the plasma membrane [201]. Contrarily, binding of 3 to the RGD sequence has been found to induce the cleavage of 3, thus also the premature recruitment of SHP-2 to IGF-1R and the premature IGF-1R dephosphorylation [202]. Similar to the interaction between integrin s and other receptors, it is believed that v 3 and IGF1-R signaling occurs within a restricted compartment on the membrane. Integrin-associated protein (IA P) facilitates the formation of this compartment. After IGF-1 exposure, IAP is transl ocated to the regions where v 3 resides [181]. More importantly, IAP can induce an increase in the affinity of v 3 for its ligands [203]. The extracellular domain of IAP can associate with SHPS-1 and an antibody disrupting this association prevents IGF-1 stimulation of SHPS-1 phosphorylation and SHP-2 transfer to

PAGE 63

47 SHPS-2 [204]. Therefore, the clustering of v 3 and the assembly of a signaling complex involving SHPS-1 may be a crucial in v 3 and IGF-1R signaling. Pigment Epithelium-Derived Factor (PEDF) The vasculature is normally quiescent under physiological conditions, since there is a balance between the proangiogenic and anti-angiogeni c factors. Angiogenesis is initiated when there is increase in pro-a ngiogenic factors and/or decrease in antiangiogenic factors. PEDF is one of the na turally occurring antiangiogenic factors. In the mouse model of retinopathy, it has been shown that hyperoxia results in a decline of VEGF levels with a concomitant expression of PEDF, and the relative hypoxia led to downregulation of PEDF during the angiogenesis process [205]. Systemic or intravitreal administration of PEDF [206, 207] and gene transfer w ith adenoviral vectors expressing PEDF [176-179] have been reported to decrease the ocul ar neovascularization levels, In the clinical studies, The vitreous levels of PEDF from PDR patients were found to be lower than normal [208], and the im munochemical staining of PEDF on retinas from PDR patients are much less intense co mpared with non-PDR [208]. All of these evidence supports that PEDF an anti-angiogenic factor may be involved in the suppression of retinopathies. Insulin-Like Growth Factor (IGF)-1 The discovery of a role of growth hormone (GH)/IGF-1 in DR can be traced back to 1950s. The regression of retinal neovascular ization was seen afte r pituitary infarction [209], and pituitary ablation was even used as a therapeutic method for PDR. More recently, in several studies in patients with PD R, elevated serum and vitreous levels of IGF-1 have been associated with retinal neovascularization [210-212].

PAGE 64

48 In a GH inhibition study, retinal neovascu larization was suppre ssed in transgenic mice expressing a GH antagonist gene and norma l mice treated with an inhibitor of GH secretion [213]. This inhibition of neovasc ularization could be reversed by exogenous administration of IGF-1. IGF-1 also plays a necessary role in nor mal retinal vascular development. In IGF-1 knockout mice, norma l development of the retinal vasculature was arrested despite the presence of VEGF [214]. This also supports the idea that VEGF alone is not sufficient for the development of retinal vessels. Clinic ally it has been found that the development of ROP in premature infants was strongly associated with a prolonged period of low levels of IGF-1 [214]. This suggests that the critical role IGF-1 plays during normal retina vascular developm ent. Lack of IGF-1 in the early neonatal period leads to the development of avascular retina, and late r the proliferative phase of ROP [155]. The function of IGF1 in CNV is still not clear. The IGF system includes the IGF-1, IGF2, the IGF-1 receptor (IGF-1R), and IGF binding proteins (IGFBPs). IGF-1 can be expressed in the liver and utilized systemically as an endocrine, or can be expressed at pe ripherals and function in autocrine/paracrine mechanisms. The multiple physiologic and pa thologic effects of IGF-1 are primarily mediated by IGF-1R, and are also modulated by complex interactions with IGFBPs, which themselves are also modulated at multiple levels. IGF-1 and IGF-1R IGFs are synthesized in almost all tiss ues and have important regulatory function on cell growth, differentiation, and transf ormation. IGF-1 is the product of the IGF-1 gene, which has been mapped to chromosome 12 in humans and chromosome 10 in mice [215]. IGF-1 functions in both prenatal and postnatal development and exerts all of its known physiological effects through binding with IGF-1R. Circulating IGF-1 is

PAGE 65

49 generated in the liver under the contro l of growth hormone [216], and bound with IGFBPs as the endocrine form in the circula tion. The IGF-1 produced in other organs and tissues has a lower affinity for IGFBPs, re presenting autocrine and paracrine forms of IGF-1. The IGF-1R gene is located on chromosome 15 in human [215], and IGF-1R is expressed everywhere in the body. The mature receptor is a tetramer consisting of 2 extracellular -chains and 2 intracellular -chains with the intracellular tyrosine kinase domain. IGF-1R signaling involves autophosphorylation a nd subsequent tyrosine phosphorylation of Shc and insulin receptor subs trate (IRS) -1, -2, 3, and -4. IRS serves as a docking protein and can activate multiple signaling pathways, including PI3K, Akt, and MAPK. The activation of these signali ng pathways will then induces numerous biologic actions of IGF1 (Figure 1.17 [216]). Figure 1.17. IGF-1 signaling transduction [216].

PAGE 66

50 The expression of IGF-1 in ECs is low, but it is expressed both in macrovessel and microvessel ECs. IGF-1 stimulates vascul ar EC migration and tube formation. IGF-1 is important for promoting retinal angiogene sis, and an IGF-1R antagonist suppresses retinal neovascularization in vivo by inhibiting vascular e ndothelial growth factor (VEGF) signaling [217]. The effect of IGF-1 on ECs is mediated in different signaling pathways. For example, IGF-1-induced nuclear factorB (NFB) translocation requires both PI3K and extracellular-regulated kina se, while IGF-1-stimu lated EC migration requires only PI3K activation [218]. And th e IGF-1 effects are also regulated by endothelial nitric oxide synthase (eNOS) expression and VEGF signaling [217]. IGF-1 and IGF-1R are also expressed in vascular smooth muscle cells (VSMCs), and their expressions are regul ated by several growth factors in different pathways. Thrombin and serum deprivation, tumor necrosis factor (TNF), and estrogen downregulate IGF-1 mRNA and protein levels ; reactive oxygen species (ROS) increases the levels; Ang2 and PDGF have been reporte d to both increase and decrease the levels. IGF-1 functions as a potent mitogen and antiap optotic factor and migration stimulator for VSMCs [216]. As for the IGF-1R, its expr ession can be upregul ated by Ang2 via the activation of NFB [219]; can be upregulated by fi broblast growth factor (FGF), mediated by the transcriptional factor ST AT1, STAT 3 [220]; and the Ras-Raf-MAPK kinase pathway was shown to be required fo r both of the above growth factor. The crosstalk between IGF-1R and other receptors can also regulate IGF-1 function. For instance, blocking ligand occupancy of V 3 integrin receptor results in premature recruitment of SHP-2 to the IGF-1R receptor a nd reduces IGF-1 signaling [200].

PAGE 67

51 IGFBPs and ALS At least 6 IGFBPs have been well charac terized, and they function as transporter proteins and as storage pools for IGF-1. The expression of IGFBPs is tissueand developmental stagespecific, and the con centrations of IGFBPs in different body compartments are different. The functions of IGFBPs are regulated in multiple ways, such as phosphorylation, proteoly sis, polymerization [221], and cell or matrix association [222] of the IGFBP. All IGFBPs have been shown to inhibit IGF-1 action, but IGFBP-1, 3, and -5 are also shown to stimulate IGF-1 action [223]. Some of IGFBPs effects might be IGF-1 independent. Figure 1.18. Proposed pathway of IG F-dependent IGFBP action [223]. The precursor forms of IGFBPs have secretary signal peptides and mature proteins are all found extracellularly. They a ll have a conserved amino-terminal domain, a conserved carboxyl-terminal domain and a non-conserved central domain. Both of the amino-terminal and carboxyl-terminal contri bute to IGF binding [223], which implies

PAGE 68

52 IGF-binding pocket structure. The major IGF transport function can be attributed to IGFBP-3, the most abundant circulating IGFBP. It carries 75% or more of serum IGF-1 and IGF-2 in heterotrimeric complexes that also contain the aci d labile subunit (ALS) [224]. Free or binary-complexes (without AL S) are believed to exit the circulation rapidly, whereas ternary complexes appear to be essentially confin ed to the vascular compartment. In addition to their effects de rived form circulation, IGFBPs also have local actions, both autocrine a nd paracrine. They have been documented to affect cell mobility and adhesion [225, 226], apoptosis a nd survival, and cell cycle [227-229]. I will concentrate on IGFBP-3 in this discussion. IGFBP-3 have both potentiation and inhibi tion effect on IGF-1 actions. It is thought that IGFBP-3 inhibits IGF-1-mediated effects via its high-affinity sequestration of the IGF-1. But in contrast, preincuba tion of cells with IGFBP-3 before IGF-1 treatment can lead to the accumulation of cell-bound forms of IGFBP-3 with lowered affinity for IGF [230], which may enhance th e presentation of IGF1 to IGF-1R. But It was also found that cell-bound forms of IGFB P-3 could still attenuate IGF-1-mediated IGF-1R signaling [231]. It has also been reported, based on competitive ligand-binding studies, that IGFBP-3 can inte ract with IGF-1R, causing inhi bition of IGF-1 binding to its receptor [232]. Therefore, the interaction of IGFBP-3 with IGF-1 and IGF-1R signaling system requires further study. Limited digest ion from proteases on IGFBP-3 can release IGF-1 from the complex and control the bi oavailability of IGF-1. These specific proteases include serine pr otease, cathepsins, and matr ix metalloproteinases [223]. Proteolysis results in IGFBP-3 fragments with decrease affinity for IGF-1, but several studies have shown the inhibition of IGF acti ons by IGFBP-3 fragments with low affinity

PAGE 69

53 for IGFs [223]. It is not clear whether this inhibition comes form IGF-1 sequestration or from its interaction with IG F-1R. IGFs themselves can al so influence the production of IGFBPs and IGFBP-specific proteases, or regula te the activity of these proteases [223]. Figure 1.18 [223] summarizes proposed IGFBP actions that depend on binding of IGFs and modulation of IGF-1R. Figure 1.19. Overview of possible IGFBP3 antiproliferation pathways [223]. IGFBPs also have their own intrinsic bi oactivity, without modulating IGF actions, either in the absence of IGFs (IGF-independent effects) or in the presence of IGFs without triggering IGF-1R signaling (IGF-1R-i ndependent effects). Recently there has been particular interest in IGFBP-3s f unction to induce apopto sis independently of inhibiting the survival functi ons of IGF-1 [233-236]. Several studies using human breast cancer cells have correlated the induction of IGFBP-3 mRNA and protein expression with growth-inhib itory effects of vari ous antiproliferative agents including TGF, retinoic acid [237], antiestrogens [238 ], vitamin D analogs [239], and TNF[240]. IGFBP-3 expression is also upregulated by the transcription factor p53 in colon

PAGE 70

54 carcinoma cells. And in the experiments using antisense IGFBP-3 or specific antibodies to sequester the IGFBP-3, the antiproliferativ e effects of some of these factors and be partially abrogated [223]. In addition, there is evidence s howing that some proteolyzed forms of IGFBP-3 also have IGF-independent effect, especially some IGFBP-3 aminoterminal fragments [223], and they showed little or no affinity for IGFs. This supports the existence of IGF-independent bioactivity. Figure 1.19 [223] summarized some of the proposed pathways of IGFBP-3 independent functions. IGFBP-3 has IGF-1 independent effects. Interactions of IG FBP-3 with known signaling pathways have been demons trated. The type V receptor for TGF(T RV) has been shown to be bound with IGFBP-3 relati ve specifically and may be involved in IGFBP-3 inhibitory signa ling [241]. IGFBP-3 has been shown to stimulate the phosphorylation of T RI of the signaling intermediate s Smad2 and Smad3 [242], while T RV signaling does not involve Smad phosphoryl ation. All-tans-retinoic acid (RA) is a potent inducer of IGFBP-3 in some cancer ce lls [223]. The growth-inhibitory effect of RA requires the presence of RA receptor (RAR)and can be blocked by retinoid X receptor (RXR)-specific retinoids. IGFBP-3 ha s been shown to inhibit RA signaling, possibly through enhancing RXR signaling [223] IGFBP-3 may also interact with PI3kinase pathway and MAPK pathway. LY294002, an inhibitor of PI3-kinase activity, could block the effects of IGFBP-3 [243] ; MAPK/ERK pathway inhibitor, PD98059, can restore the inhibitory effect of IGFBP-3 on DNA synthesis, blocked in cells expressing oncogenic ras in breast epithelial ce lls [244]. Recently it has been shown that IGFBP-3 strongly up-regulate signal tran sducer and activator of tran scription 1(STAT1) mRNA in the process of chondrocyte differentiation, and phospho-STAT1 protein was shown to

PAGE 71

55 increase and translocate to the nucleus, more over, the antiproliferative effects of IGFBP3 in these cells can be ablate d in the presence of STAT1 an tisense oligonucleotide [245]. The acid-labile subunit (ALS ), together with IGFBP-3 and IGF-1, forms the ternary complex as the storage pool in the pl asma. ALS is synthesized almost exclusively by the liver, and predominantly stimulated by GH [246]. Presence of ALS after birth is coincident with increased responsiveness to GH resulting from an increase in GH secretion and hepatic GF receptors. After pube rty, ALS concentrations basically remain stable throughout adulthood [246]. ALS is a single copy gene, containing 2 exons and 1 intron. ALS has no affinity for free IGFs and very low affinity for uncomplexed IGFBP3, and even its affinity for binary comp lex (IGF-1 + IGFBP-3) is 300-1000 fold lower that that of IGFBP-3 for IG Fs [247]. The ability of ALS to form ternary complex is irreversibly destroyed under acidic conditions. IGFBP-3 and IGFBP5 can both associate with ALS, with the latter being much w eaker [246]. The carboxyl-terminal domains of IGFBP-3 and IGFBP5 are important for bindi ng. The association is proposed to happen within the negative-charged sialic acid on the glycan chains of ALS and an 18 amino acid positive-charged domain in IGFBPs [246]. Besides liver, ALS local synthesis may occur in kidney, developing bone, lactating mammary gland, thymus and lung [ 248, 249]. Their functions are to sequester IGFs into ternary complex. A GH-responsive element of the ALS gene transcriptional promoter was identified [250]. This se quence was called ALSGAS1 because of its resemblance with the consensus sequence for -interferon activated sequence (GAS). The effects of GH on the ALS gene are mediated by the JAK-STAT pathway [251, 252]: the tyrosine kinase JAK2 is recruited to the activated GH receptor complex and

PAGE 72

56 phosphorylates signal transducers and activat ors of transcription (STAT)-5a and STAT5b. After dimerization, STAT5 isomers tran slocate to the nucl eus, and activate ALS gene transcription by binding to the ALSGAS1 elem ent. The GH signaling pathway leading to increased ALS gene transcription is critically dependent on the activation of STAT5 isomers, and is indepe ndent of RAS activation. One the of physiological significances of AL S is to extend the half-lives of IGFs from 10 min when in free form, and 30-90 min when in binary complexes, to more than 12 hours when in ternary complexes [253]. The other important role of ALS is to prevent the non-specific metabolic effects of the IGFs given that serum IGF concentration is ~1000 fold that of insulin [246]. IGFs in ternary complexes cannot traverse capillary endothelia and activate the insu lin receptor, whereas free IGFs and IGFs bound as binary complexes can do so. Incorporation of IGFs in to ternary complexes therefore completely restrains the intrinsic insulin-like eff ects of the IGFs. Null ALS mouse shows significantly reduced circulating IGF-1 and IG FBP-3 concentrations [246], which proves that ALS is absolutely necessary for se rum accumulation of both IGF-1 and IGFBP-3. The Involvement of Insulin Receptor (IR) and IGF-2 in Angiogenesis IGF-1 primarily binds to IGF-1R, and insu lin primarily binds to IR, while IGF-2 can bind to both of the two receptors and its own IGF-2R, as shown in Figure 1.20 [254]. Regarding retinopathy, insulin and IGF1 have gained more attention. Kondo et a t [255], using the Cre-Lox knockout system, found that (1) the retinas of mice develop normally in the absence of endothelial IR or IGF-1R. Presumably, suff icient growth factors (for example, VEGF) are present to facilitate normal developmen t. (2) Under conditions of relative hypoxia and in the pr esence of endothelial IR/IGF -1R, VEGF, eNOS, and ET-1 are increased, leading to extra-retinal neovascularization. (3) Under conditions of relative

PAGE 73

57 hypoxia and in the absence of endothelial IR or IGF-1R, VEGF, eNOS, and ET-1 are reduced, possibly due to impaired HIF-1 activ ation or reduced PI3K activity related to IG/IGF-1R [256]. Reduced neovascularization results from less IR/IGF-IR input. And in their experiments, the reduction of VEGF, eNOS, and ET-1 are reduced to a greater extend in IR knockout mouse than IGF-1R knockout mouse, which has brought more emphasis on IR function in the retinopathy, wh ile traditionally IGF-1R is thought to be more important. Figure 1.20. The crosstalk between IGF-1, IGF-2 and Insulin signalings [254]. RNA Silencing Technologies The traditional method to inactive a gene is to create a gene knockout animal model. This process has its advantages, in that it entir ely abolishes a gene expression, however, the disadvantages are that it is time consuming, expensive, labor-intensive, and subject to possible failure due to embryonic lethality [257]. RNA silencing technologies, which

PAGE 74

58 inhibit gene expression at the RNA leve l, are valuable tools to inhibit the Figure 1.21. Overview of RNA s ilencing technologies [258]. expression of a target gene in a sequence-sp ecific manner, and may be used for functional genomics, target validation and therapeutic purposes. Theoretically, RNA silencing could be used to cure any disease that is caused by the expression of a deleterious gene [258]. There are three common types of anti-mR NA strategies. Firstly, the use of single stranded antisense oligonucle otides; secondly, the triggeri ng of RNA cleavage through catalytically active oligori bonucleotides referred to as ribozymes; and thirdly, RNA interference induced by small interfering R NA molecules. Figure 1.21 [258] basically summarized the mechanisms of these th ree kinds of antisense technologies.This scheme also demonstrates the difference between an tisense approaches and conventional drugs, most of which bind to proteins and there by modulate their function. In contrast, RNA silencing agents act at the mRNA leve l, preventing translation. Antisense-

PAGE 75

59 oligonucleotides pair with their comple mentary mRNA, whereas ribozymes and DNA enzymes are catalytically active oligonucleotid es that not only bind, but can also cleave, their target RNA. RNA interf erence is a highly efficient method of suppressing gene expression in mammalian cells by the use of 21 23-mer small interfering RNA (siRNA) molecules. These three RNA silenc ing methods are detailed below. Antisense Oligonucleotides The antisense oligonucleotides was first described by Zamecnik and Stephenson who used a 13-mer DNA to inhibit Rous sarc oma virus expression in infected chicken embryonic fibroblasts [259]. The antisense gene silencing naturally occurs in genomic imprinting, in which only one copy of a gene in the mammalian genome is expressed while the other is silenced. It could be the maternally inherited allele or the paternal inherited allele. Antisense oligonucleotides are comple mentary to the target mRNA and are usually 15-20 nucleotides in le ngth [258]. There are two majo r antisense mechanisms that have been proposed [258]. First, RNase H cleaves RNA in the RNA-RNA heteroduplex (or RNA:DNA heteroduplex for antisense DNA o ligonucleotides), induced by binding of the antisense oligonucleotides. This results in rapid degrad ation of the cleaved mRNA products and a reduction in ge ne expression. Second, transla tion is arrested by steric blocking the ribosome by the binding of antis ense oligonucleotides. When the target sequence is located within the 5 terminus of a gene, the binding and assembly of the translation machinery can be prevented. The first step in designing an antisense oligonucleotides is ta rget selection and verification of target site accessibility. Computer program s, like Mfold, perform mRNA

PAGE 76

60 secondary structure analysis. This analys is can generate several mRNA secondary structures centered on our target sequence. If the target is always contained within a stable stem in every structure, this target shou ld be eliminated. In addition to this type of in silico analysis of RNA secondary structure, a number of in vitro methods have been developed to examine secondary structure in solution. One way is to directly probe the secondary structure of the ta rget RNA with 1-cyclohexyl-(2morpholinoethylo)cabodiimide methop -toluene sulfonate (CMCT) [260]. CMCT will mainly modify Us, and to a lesser extent Gs, in single-stranded regions of an RNA molecule. CMCT modification is followed by reverse transcription. Modification of Us and Gs will prevent read-through by reverse tran scription, resulting in a pause or stop site at the modified position. When these modifi cation/reverse transcri ption reaction products are separated on an appropriate electrophoresis gel next to DNA sequencing reactions of the target mRNA region, accessible regions of the target RNA are easily identified.The most sophisticated approach reported so far is to desi gn DNA array to map an RNA for hybridization sites of oligonucleotides [261]. Figure 1.22. Modifications in an tisense technology [258]. When designing antisense oligonucleotides there are some points to consider. Four contiguous guanosine residues should be avoided due to the G-quartets formation

PAGE 77

61 and CpG motifs should be avoided due to poten tial stimulation of the immune system. In addition, a BLAST search for each oligonucle otide sequence is required to avoid significant homology with other mRNAs that could cause unwanted gene silencing. Unmodified oligonucleotides are rapidl y degraded in biological fluids by nucleases. So one of the major challenges for antisense RNA approaches is the stabilization of RNA oligonucleotides. Chemi cal modifications of the bases and/or and phospho sugar backbone have been developed to increase resistance against RNase (Figure 1.22 [258]. The major repr esentative of in the first generation modification is the Phosphorothioate (PS) oligonuc leotides, in which one of the nonbridge oxygen atoms in the phosphodiester bond is replaced by sulfur [258]. The shortcomings include binding to certain proteins, such as hepa rin-binding proteins, and their slightly reduced affinity to the complementary RNA sequences [262]. In the second generation, most the emphasis was placed on the 2 hydroxyl group. 2-O-m ethyl and 2-O-methoxyl-ethyl RNA are the most common types of modifications [258] However, RNase H cleavage can be somewhat reduced or even blocked with thes e types of modifications, possibly due to the steric blockade. One way to overcome this disadvantage is the gapmer technology [258], in which the 2-modified nucleotides are placed only at the ends of antisense oligonucleotides. This protects the ends from degradation a nd a contiguous stretch of at least four or five non2-modified residues in the center ar e sufficient for th e activation of RNase H. A variety of modified nucleotides ha ve been developed in the third generation, the antisense oligonucleotides properties such as target affinity, nuc lease resistance and pharmacokinetics have been improved [258]. Th e concept of conformational restriction has been used widely to help enha nce binding affinity and biostability.

PAGE 78

62 Ribozymes Ribozymes, or RNA enzymes, are cataly tic molecules that can catalyze the hydrolysis and phosphoryl exchange at the pho sphodiester linkages within RNA resulting in cleavage of the RNA strand. There are tw o types of chemical reactions that are catalyzed during phosphate-group transfer by naturally occurring ribozymes: selfcleaving and self-splicing reactions. The riboz ymes that perform self-cleaving reactions include hammerhead, hairpin, he patitis delta virus (HDV) and Neurospora Varkud satellite (VS) ribozymes. They are usually sma ll RNAs of tens of nucleotides in length. The ribozymes that perform self-splicing re actions include self-splicing introns and RNase P. They are much larger in size a nd usually hundreds of nucleotides in length. Figure 1.23. Self-cleaving a nd self-splicing reactions in ribozymes [263].

PAGE 79

63 As shown in Figure 1.23 [263], in the self-c leaving reactions, the RNAs catalyze a reversible phosphodiester-cl eavage reaction. The nucleophilic attack from the 2hydroxyl group results in 5-hydroxyl and 2-3 -cyclic phosphate termini. The bridging 5-oxygen is the leaving group. While in th e self-splicing reactions, an exogenous nucleophile attacks on the phosphorus gene rates a 5-phosphate and a 3-hydroxyl termini. The bridging 3-oxygen is the leavi ng group. In the first st eps of group I intron and group II intron self splicing and the RNas e P-mediated cleavage of precursor of tRNAs, the exogenous nucleophiles are, respectively, the 3-hydroxyl group of exogenous guanosine, the 2-hydroxyl group of an adenosine in the intron, and the water. They are indicated by the ROH in Figure 1.23 b. The transition states are shown in brackets. Self Splicing Introns Self splicing introns can be divided into 2 classes based on the conserved secondary structure and splicing mechanisms : Group I and Group II. Group I is found in a variety of species, including prokaryotes and lower eukaryotes. Except for the Tetrahymena large rRNA group I intron, all other know n group I introns require a single protein co-factor to provide a scaffold to hold the RNA in the catalytic reaction [264]. Group II introns are found within nuclear pre-mRNA and organell e pre-mRNA [265]. A spliceosome consisting of proteins and sma ll nuclear RNAs (SnRNA) is formed in the catalytic reaction and high concentrations of magnesium and potassium are necessary [265]. The splicing action of both group I and gr oup II introns consists of two similar consecutive transphosphoesterific ation reactions. In the first step, the 5-end of the intron is attacked by an exogenous nucleophile which is the 3-hydroxyl group of exogenous

PAGE 80

64 guanosine in group I introns, or the 2-hydroxyl group of an adenosine in group II introns. This results in the cleavage at that site and the additio n of the guanosine or adenosine to the 5-end of the intron. In th e second step, the oxygen in the 3-hydroxyl group of the 3-end of the up stream exon attacks the 3-end of the intron. In group I introns, it is a guanosine at the 3 -end of the intron that is attacked. This cleaves the 3end of the intron, releasing the intron, and results in ligation of the upstream and downstream exons. Figure 1.24 [263] shows th e secondary structure and self splicing steps of group I introns. Figure 1.24. Secondary structure and self sp licing steps in group I intron [263].

PAGE 81

65 RNase P RNase P is a ribonucleoprotein complex that removes the 5 lead er sequence form precursor tRNAs (ptRNAs) via a hydrolysis reaction. It consists of a catalytic RNA subunit (M1 RNA in E. coli ) and a protein subunit (C5 protein in E. coli ) [266, 267]. In vitro M1 RNA can cleave its ptRNA substrat e without C5 protei n, but the reaction requires high concentrations of Mg2+. However, C5 protein can dramatically increase the rate the cleavage, even at low concentration of Mg2+ [268]. In vivo C5 protein is required for RNase P activity and cell viability [ 266, 267]. Thus both the RNA subunit and the protein subunit are essential for RNAse P func tion. It has been proposed that C5 protein can facilitate the stabilizati on of the M1 RNA conformation and also enhance the enzyme and substrate interaction [269, 270]. Figure 1.25. Secondary structures of natural a nd synthetic substrates for RNAse P[275]. All the natural substrates of RNAse P (ptRNAs, precursor of 3.5S RNA and several small RNAs [271-273] in E. coli ) have a common feature in their secondary structure which includes a 5 leader sequen ce, and acceptor-stem-like structure and a 3CCA sequence. A synthetic external guide sequence (E GS) combined with a CCA sequence has been designed to base pair with a targeted sequence to form a structure very

PAGE 82

66 similar to the natural substrates of RNase P. The M1 RNA from E. coli can cleave at this synthetic target site [274]. This EGS-based technology can be used to guide RNAse P to cleave a targeted sequ ence. Figure 1.25 shows the secondary structures of ptRNA and the 3.8s RNA and the hybridization of the EG S with the target ed sequence [275]. Hammerhead Ribozymes The hammerhead ribozyme was the first small self-cleaving RNA to be discovered [276, 277], the first ribozyme to be crystallized [278, 279] and the smallest naturally occurring catalytic R NA identified so far. It was found in several plant virus satellite RNAs and is required for the rolling circle mechanis m of virus replication [280]. The hammerhead ribozyme cleaves the multimeric transcripts of the circular RNA genome into single genome length strands. Hammerhead ribozymes are approximately 30-90 bases in length and cleave RNA targets in trans Annealing of the hammerhead ri bozyme with the target sequence produces a structure consisting of three stems, a tetra-loop and a conserved catalytic core as shown in the Figure 1.26. Any mutation in the catalytic core will prevent catalytic cleavage. The catalytic core has two func tions: it destabilizes the substrate strand by twisting it into a cleavable confirmation, and also binds the metal cofactor (Mg2+) needed for catalysis [278]. The absolute requiremen t of the target sequence is a NUX cleavage site, where N is any nucleotide and X is any nucleotide except G. The targeting arms of the hammerhead ribozyme bind either side of the U of the NUX site forming stems I and III. GUC has been shown to be the most effi cient cleavage site [281], followed by CUC, UUC and AUC. The advantages of hammerhead ribozymes include its small size, easy of cloning and packaging into viral delivery systems, and versatili ty in target site selection.

PAGE 83

67 In the traditional view, the Mg2+ and water are both required in the transesterification reaction. The hydrated magnesium ion can help to provide an environment to facilitate the nuc leophilic attack, in which the Mg2+ acts as a Lewis acid to coordinate directly with the 2-hydroxyl and the 5-leaving oxygen for activation of the nucleophile and for stabilization of the environment. It has be en also reported that some monovalent cations (Li+ and NH4 +) at higher concentrati on can substitute for Mg2+ [282]. There is another kind of antisense agent called DNA enzyme, which is similar to the hammerhead ribozyme in structure and f unction but avoids the high susceptibility to nucleases that is common to ribozymes. The best studied DNA enzyme, named -23 [283], consists of a catalytic core of 15 nuc leotide and two substrate recognition arms. It is highly sequence-specific and can cleav e any junction between a purine and a pyrimidine, and its efficiency is si milar to hammerhead ribozymes [283]. Figure 1.26. Structure of the hammerhead ribozyme. Hairpin Ribozymes Similar to the hammerhead ribozyme, th e hairpin ribozymes was first derived from tobacco ring spot virus satellite RNA [284].When the hairpin ribozyme binds to the

PAGE 84

68 substrate, a structure with 4 helices and 2 l oops is formed. Helix 1 (6 base pairs) and helix 4 (4 base pairs) are wh ere the hairpin hybridizes to th e target RNA. In loop A, a BNGUC target sequence is required for cleavage, where B is G, C or U, and N is any nucleotide [285]. Figure 1.27 shows the structur e of the binding complex of the hairpin ribozyme and its substrate. Figure 1.27. Structure of the hairpin ribozyme. Hairpin and hammerhead ribozymes can al so catalyze the ligation of the cleaved products, which is the reverse of the cleavag e reaction. The ligation efficiency is much higher for the hairpin than the hammerhead. Another unique feature for the hairpin ribozyme is that it does not require metal ions as cofactors [282, 286].

PAGE 85

69 Hepatitis Delta Virus (HDV) Ribozymes and Neurospora Varkud Satullite (VS) Ribozymes HDV ribozymes and VS ribozymes also cl eave the substrates via self-cleaving reactions. HDV ribozymes are derived from th e genomic and the anti-genomic RNAs of HDV [287, 288]. Naturally, the HDV ribozyme cl eaves its substrat e during the rolling circle replication mechanism of the circ ular RNA genome, like other self cleaving ribozymes. The VS ribozyme was originated from the mitochondria of certain isolates of Neurospora [289]. The self cleaving reactions require a divale nt cation but it has also been shown that monovalent cations are be sufficient for the ribozyme to catalyze proficiently [282]. RNA Interference RNA interference (RNAi) is a naturally occurring proce ss and is a potent sequence-specific mechanism for post-transcri ptional gene silencing (PTGS). It was described early in C. elegans [290] and th en found to exist throughout nature as an evolutionarily conserved mechanism in euka ryotic cells. RNAi has regulatory roles in gene expression, such as genomic imprinting, translation regulation, alternative splicing, X-chromosome inactivation and RNA editing [2 91]. In plants and lower organisms RNAi also protects the genome from viruses and insertion of rogue genetic elements, like transposons [292]. Figure 1.28 [293] shows the RNA interf erence pathways. Long double-stranded (ds)RNA is cleaved by Dicer, an RNase III fam ily member, into short interfering RNAs (siRNAs) in an ATP-dependent reaction. Th ese siRNAs contain an approximately 22nucleotide (nt) duplexed region and 2-nt unpaired and unphosphorylated 3-ends. The 5end is phosphorylated, which is a crucial requirement for furthe r reactions. In fact, if the

PAGE 86

70 Figure 1.28. RNA interference [293]. siRNA is introduced into human cells as a synthetic molecule, its 5 hydroxyl gets phosphorylated shortly after entry into th e cells [294-296]. These siRNAs are then incorporated into the RNA-inducing silenc ing complex (RISC). Although the uptake of siRNAs by RISC is independent of ATP, the unwinding of the siRNA duplex requires ATP. The unwinding favors the terminus with the lower melting temperature as the start point. Thus the termini containing more A-U base pairs are prefe rred as the unwinding start point. The strand whose 5-end is at the start point will be used by RISC as the guide sequence and the other strand is release and degraded. Once unwound, the guide strand positions the RISC/siRNA complex with the mRNA that has a complementary sequence to the siRNA, and the endonucleolytic cleavag e of the target mRNA occurs. The target

PAGE 87

71 mRNA is cleaved at the single site in the center of the duplex re gion between the guide siRNA and the target mRNA. The microR NA (miRNA) pathway is another RNA silencing pathway and is similar to siRNA. miRNA is also approxi mately 22-nt long, but it is a product of a sequen tial processing on a single-stranded RNA by two enzymes of the RNaseIII superfamily [297-299]. The long pr imary transcript (pri-miRNA) is cleaved by a nuclear enzyme, named Drosha in huma n, into an approximately 70-nt long premiRNA. The pri-miRNA is basically a s hort hairpin RNA (shRNA) and is further processed in the cytoplasm by Dicer to pr oduce the final miRNA. For both siRNAs and miRNAs, the perfect or near-perfect match will lead to the degradation of the target upon association with RICS, and mism atches will repress the translat ion. It now appears that at least seven continuous complementary base pairs are required for cleavage [300]. Introduction of synthetic siRNAs as a mimic for the Dicer cleavage process triggers the RNAi machinery. In addition, siRNAs or miRNAs produced form shRNA expression cassettes can be cloned into RNA expression v ectors to produce the selfcomplementary hairpin sequences that induc e the RNAi pathway. More importantly, the shRNA expressed from a vector could establis h long-term silencing of a targeted gene expression. The transcription of shRNA from the vector is usually conducted using an RNA polIII promoter such as the H1 or U6 promoter [301, 302]. U6 promoter strongly favors a G residue at the first position of th e transcribed sequence and H1 weakly prefers an A residue [303]. The transcription mediat ed by polIII promoters terminates after the second or third (less commonly) residue of a TTTTT stretch, which results in a 3-UU tail that forms the 3-2-nt unpaired overha ng end in the hairpin structure after self complementarily annealing of the transcript. Both the preference of first residue and the

PAGE 88

72 3-2-nt unpaired UU end influen ce the target site selection. Similar to miRNAs, shRNAs (in the nuclei) are bound by a complex consisti ng of the nuclear expor t factor Exportin 5 (Exp5) and the GTP-bound form of the cofactor Ran [304, 305]. For nuc lear export, this complex requires an RNA stem of 16 bp, a short 3-overhang and a terminal loop of 6 nt [304, 306]. The efficient cleav age by Dicer requires an RNA of 19 bp and a short 3-overhang [307]. These prerequisites can be easily met when designing the shRNA expression cassette. Considering the strand preference of RI SC during unwinding, the 3 end of the guide strand in shRNA is designed tightly ba se-pair (higher CG cont ents) and the 5 end of the guide strand is designe d loose base-pair (higher AU contents). As an example shown in Figure 1.29 [303], two GC base pair s at the 3-end of gui de strand (red) are designed. More AU pairs at the 5end of the guide strand would be appreciated for correct unwinding and even a mismatch can be included. Actually bu lges resulting from mismatches are always present in natural primiRNAs and they may help to fine-tune the cleavage sites used by Drosha and Dicer and/or may preclude activation of dsRNAresponsive cellular signaling pa thway like interferon responses [303]. During the design of the shRNA, it is encouraged to include a bulge close to the 5 end of the guide strand, which should be done by a introducing a mutati on into the to-be-degraded (sense) strand, not into the guide (antisense) strand. It has also been repo rted that an A residue at position 3 and a U at position 10 of the se nse strand can enhance siRNA function significantly. And a G at position 13 of the se nse strand may need to be avoided [308]. Figure 1.29 [303] shows the sequence of the designed shRNA, with the reference to

PAGE 89

73 human pre-miR-1 sequence and structure. The blue strand is sense and the red strand is antisense. Arrows mark the Dicer cleavage sites. Figure 1.29. Designing artificia l shRNA for RNAi [303]. It has also been found that small dsR NA that are 25-30 nt in length requiring RNAi processing appear to be more effici ent in inducing RNAi than smaller 22 nt siRNAs [309], which could be due to the fact that Dicer may direct endogenously processed siRNAs and miRNAs to the RI SC complex. This gives vector-expressed shRNA an extra advantage over synthetic 22 nt siRNAs. Multiple shRNAs or siRNAs can be introduced into the cell simultaneousl y, but it is worth keeping in mind that the RNAi machinery can be limiting [310] so that the competence between exogenous shRNAs and endogenous miRNAs, or betw een exogenous and endogenous siRNAs, for limited amount of Dicer and RISC could occu r, which would interfere with the cells endogenous RNAi pathways. Particularly when the cell is undergoi ng a cell division, the RNAi machinery could be diluted and adve rsely affected by inhi biting the gene knockdown mechanism.

PAGE 90

74 RNAi is highly specific to its target and not toxic in almost all situations; however, when designing an siRNA or shR NA, some off-target effects should be considered and avoided. dsRNAs that are 30 nu cleotides or longer tend to trigger at least two cellular stress response pathways, both of which will lead to a general and nonspecific abrogation of protein synthesis, or even apoptosis [295, 311]. The IFN pathway is usually a mechanism to eliminate virus-in fected cells, in which the long dsRNA binds to and activates the dsRNA-activated pr otein kinase (PKR). PKR can further phosphorylate the translation initiation factor, eIF-2 and induce global translation inhibition and even apoptosis. In another path way, dsRNA activates 2-5 oligoadenylate synthetase. The 2-5 oligoadenylate will then be formed and bond to and activate RNase I, resulting in non-specific degradation of RNAs. Although siRNA or shRNA, less than 30 nucleotides in length, usually do not activat e these stress response pathways. In highly sensitive cell lines and at high concentra tions, a subset of in terferon genes can be activated [312-314]. In the design ing of siRNAs or shRNA, the ones that have significant homology to other irrelevant mRNAs shoul d be avoided. As noted before, a seven consecutive base pairing can be enough to activate the RISC-induced gene silencing. Even the guide strand (antisense) has been desi gned to introduce RISC to the target site after unwinding, it is still possi ble that unwinding could initiat e from the 5 end of the sense strand and thus sense strand would gui de the RISC. The homology of the sense strands should also be checked. Vector-mediated expression of shRNA can lead to long-term RNAi and the silencing effect has been observed even af ter two months [302]. The half-life of unmodified siRNAs in vivo is only seconds to minutes [315]. The most important reason

PAGE 91

75 for this short half-life is the rapid elimina tion by kidney filtration due to the small size (~7 kDa). Endogenous serum RNases can degr ade the siRNAs limiting the serum halflife to 5-60 minutes. The half-l ife can be extended in a num ber of ways, for instance, complexing the siRNAs with other molecules or incorporating them into various types of particles to bypass renal filtr ation [315-317], chemically modifying the ribose [316, 318320], or capping the ends of the siRNA [315, 320]. The modification on the ribose usually takes place at the 2-position; 2 -deoxyribose, 2-O-metheyl and 2-fluoro substitutions/modifications have been re ported [316, 318-320]. Usually the silencing effects are affected more or less by these m odifications but a modifi ed siRNA, with two 2-O-methyl at the 5 end and four methyl ated monomers at the 3 end, has been demonstrated to be as active as its unm odified counterpart [321]. Even though siRNAs have the potential to activate interfer on pathways, no toxic effects after siRNA application have been observed [258]. There is no strict specific se quence requirement in RNA interference (although there are preferred bases at some positions), and, therefore, the range of target for siRNA is greater th at with ribozymes or antisense therapies. Gene Therapy Overview With the progress of Human Genome Proj ect, people are reaching a new level of understanding of many biological events, including the etio logy of diseases with or without proved treatment. Especially for t hose diseases currently without treatment, finding the genes that are invol ved in the initiation and de velopment of the diseases provides new treatment targets. The most common gene therapy targets are monogenic recessively inherited diseases such as hemophilia [322]. In the tr eatment of these diseases, gene therapy is designed to introduce a functional gene into a target cell to restore protein production that

PAGE 92

76 is absent or deficient due to the genetic disorder. Conversely in monogenic dominantly inherited diseases like hypercholesteroleam ia [323], successful treatment requires the aberrant gene to be silenced, and this is usually done by means of gene-silencing technologies. Cancer, as an acquired genetic disease, is also a good candidate for gene therapy. Apart from expressing functional tumo r suppressor genes and silencing activated oncogenes, gene therapy in cancer treatment has also been applied to introduce the expression of immunopotentiation proteins, the expression of a toxic product in transformed cells, and the expression of protei ns in healthy cells he lping the cell to be resistant to higher doses of chemotherapy [324]. The methods to deliver a gene into cells can be roughly categorized into virusbased system and non-viral system. Non-Viral Gene Delivery The gene transfer in non-vira l system is in general ine fficient and often transient compared with viral vectors, but it has advant ages such as low toxi city, simplicity of use and ease of large-scale production. In addition, the transient expression of a therapeutic gene would be desirable in the treatment of certain conditions, such as retinopathy of prematurity. Basically there are three categor ies of methods for non-viral gene delivery: naked DNA in the form of plasmid, liposom al packaging of the DNA and molecular conjugates. Naked DNA is the simplest way to delivery a gene. It is not very efficient and can result in prolonged low levels of expression. Th e simplest way is to inject directly into the tissue of interest or inject systemically from a vessel. The expression level and area are usually limited in a systemic injection due to the rapid degrad ation by nuclease and clearance by mononuclear phagocyte system. To facilitate the uptake of naked DNA,

PAGE 93

77 several techniques, in addition to simple in jection, have been developed. The Gene Gun is a technology to shoot gold particles coated with DNA whic h allows direct penetration through the cell membrane into the cytopl asm and even the nucleus, bypassing the endosomal compartment [325]. Electroporation, the application of c ontrolled electric fields to facilitate cell permeabilization, is another way to facilitate DNA uptake. Skin and muscle are ideal targets due to the ease of administration. Ultrasound can also increase the permeability of cell membrane to macromolecules like plasmid DNA and has been used to facilitate the gene transfer. Liposomes are lipid bilayers entrappi ng a DNA fragment with a fraction of aqueous fluid. It can naturally merge onto cel l membrane and initiate the endocytosis process. To improve transfection efficiency, target proteins rec ognized by cell surface receptors have been included in liposome to facilitate uptake, for example, anti-MHC antibody [326], transferrin [327], and Sendai virus of its F protein [328], which help DNA to escape from endosome into cytoplasm t hus to increase DNA transportation to the nucleus. The inclusion of a DNA binding protein on the liposome also enhances transcription by bringing the plasmid DNA into the nucleus [328]. Molecular conjugates are us ually a synthetic agent that can bind to DNA and a ligand at the same time [324]. Thus the binding of the ligand to its receptor will initiate the receptor-mediated endocytosis for the complex. This method is more specific for different cell types and receptor types. Th e synthetic agent needs to be designed accordingly, but this is useful in tissue-spec ific transfection. The transgene expression in this method tends to be transient and lim ited by endosomal and lysosomal degeneration.

PAGE 94

78 Viral Gene Delivery Viral gene delivery systems are based on replicating viruses that can deliver genetic information into the host cell. According to the existence status of the viruses, the virus vectors can be divided into two categ ories: integrating and non-integrating [329]. Integrating virus includ e adeno-associated virus, retrovi rus, and so on. These viruses can integrate the viral genome into chromosoma l DNA so that a life-long expression of transgene could be possibly achieved. Adenovi rus and herpes simplex virus fall into the category of non-integrating viruses. They deliver viral genome in to the nucleus of targeted cell, however the vi ral genome remain episomal, so it is possible that the transgene gets dilute d during cell divisions. Generally speaking, genomes of replica ting viruses contain coding regions and cis -acting regulatory elements. The coding sequ ences enclose the genetic information of the viral structural and regul atory proteins and are requi red for propagation, whereas cis acting sequences are essential for packaging of viral genomes and integration into the host cell. To generate a replication-defective viral vector, the coding regions of the virus are replaced by a transgene, leaving the cis -acting sequences intact. When a helper plasmid or virus providing th e structural viral proteins in trans is introduced into the producer cell, production of non-replicating vi rus particles containi ng the transgene is established. An ideal viral vector should have these characteristics: 1) The virus genome is relatively simple and easy to manipulat e; 2) The viral transduction can yield high vector concentration in the producer cells (>108 particles /ml); 3) The vector should have no limitation in size capacity; 4) The viral vector can tran sduce dividing and non-dividing cells; 5) The vector can deliver the transgene as integration in the host cell genome or as segregation being an episome along with cell division so that sustained expression can be

PAGE 95

79 established; 6) The vector has a nave or modified tissue specificity and the transgene expression can be regulated; 7) The vect or produces no or low immune response and allows subsequent re-administration. [330] The expression specificity can be regulate d in many aspects. For tissue specificity, we can pick the virus that has the right trop ism specific to some tissue, and in addition tissue-specific promoters can be added to further define the sp ecificity. For spatial specificity, radiation in conjuga tion with radiation-activated pr omoter (for example, ergl promoter [331]) would be a good method. Of course the local delivery into the right place is always preferred than systemic administration, if feasible. For temporal specificity, drug-inducible promoters can provide a convenient way to switch the transgene expression on and off. The drug can be used to work on transcription activation or repressor elements to modulate the expr ession. There are many established drugregulated gene expression systems, such as rapamycin-regulated gene expression [332] and RU486-regulated gene expression from GAL4 site [333]. And for promoters containing binding site for hormone receptor, he avy metals or cytokines, these specific hormone, heavy metals and cytokines can al so be used to induce the expression. Adeno-Associated Viral (AAV) Vectors AAV is currently the virus closest to an ideal vector that is under study and application. It belongs to th e family of parvovirus; it is non-pathogenic and depends on helper virus (usually adenovirus (Ad) or herpes virus) to prol iferate. It is a non-enveloped particle with a size of 20 -25 nm and has a vector capacity of 4.7 kb [334]. AAV can infect both dividing and non-divi ding cells, with the transduc tion efficiency best in Sphase of host cell cycle. The viral genome coded in a single-stranded DNA, has two open-reading frames (ORF). One is rep which is responsible for viral structural proteins,

PAGE 96

80 integration and replicatio n proteins. The other is cap coding for capsid proteins. There are inverted terminal repeats (ITR) at both ends of the genome sized around 150 bp, Tshaped and forming palindromic structure. TR is GC rich and contai ns a promoter. Due to the integration into the host genome, AAV vector can potentially deliver a long term expression of the transgene. Another advantag e of AAV is that it induces overall low immune response. Presence of circulating neut ralizing antibodies is in the majority of populations, but they dont prevent re-admin istration or shut down promoter activity [329]. Small packaging capacity is the number one disadvant age of AAV vectors. Using concatamers, formed by head-to-tail recombin ation in ITRs, up to 10 kb of transgenes can be packaged for delive ry [335], by means of splitti ng promoter and transgenes sequences over two AAV vectors. But this t echnology reduces transduction efficiencies. The infection of a host cell starts when th e viral particle binds to its receptor on the cell membrane and initiates the endocytic pathway. The receptor type varies with AAV serotypes. The AAV-2 serotype, the most studied and commonly used serotype, has as its primary receptor heparin sulfate pr oteoglycans (HSPG) [336] HSPG is widely expressed in various tissues a nd this is why AAVs have a wi de tropism. There are also co-receptors for AAV-2 to faci litate endocytosis. Fibroblas t growth factor receptor-1 (FGFR1), one of the co-receptors, can enhance the virus attachment to the cells [337]. Integrin v 3, another co-receptor, can facilitate endocytosis in the clathrin-mediated process, and it may also activate Rac1 a nd further phosphorylate PIP3 Kinase [338], which leads to microfilaments and mi crotubes rearrangement to support AAV2 trafficking to the nucleus. After entering the cell, the viral particle is released from the endosome at low pH conditions. Low pH probably induces a conformational change of

PAGE 97

81 viral proteins and thus helps with endosom e release and nuclear entry [339]. The viral particle is uncoated in the nucleus, a nd ssDNA is duplicated into dsDNA by either annealing with a complementary DNA strand from a second AAV or by the host cell machinery. The duplication from ssDNA to dsDNA is the rate-limiting step in AAV transduction. To overcome this, self comple mentary vector (scAAV) has been designed to expedite this process [340]. With the help of rep proteins, the viral genome or the transgene is integrated to a specific site in chromosome 19 via a non-homologous recombination and will be expressed by host cell transcriptional machinery. Some virus may remain episomal and also get expresse d. Figure 1.30 [330] summarizes major steps in the AAV internalization a nd intracellular trafficking. Figure 1.30. AAV internalization and intr acellular trafficking [330].

PAGE 98

82 AAV has a number of serotypes. AAV-1 a nd AAV-4 were isolated from simian sources; AAV-2, -3, -5 were isolated from hu man clinical specimens; AAV-6 is thought to be the recombination of AAV-1 and AAV-2 (AAV-1s 3 end recombined with AAV2s 5 end), and AAV-7 and AAV8 were isolated from rhes us monkey [330]. They have their own tropisms, which are determined by the capsid proteins. For example, AAV-2 is preferred to use for infection of the huma n eye, spine, while AAV-1 has the highest transduction efficiency in muscle and liver and AAV-5 has high tropism for retina and is able to transduce airway epithelial cells. Among all the serotypes, AAV-2 is the most studied and commonly used. As with all the AAV serotypes, the AAV-2 genome has two ORFs, rep and cap which span over 90% of the genome. As shown in Figur e 1.31 [330] Panel A, in the ORF of rep there are two promoters, p5 and p19, encoding four proteins. Rep 78 and its splicing variant, Rep68 are transcribed from p5. They play importa nt roles in replica tion, transcriptional control and site-specific inte gration. Rep52 and its splicing va riant, Rep40 are transcribed form p19. They are important for the accumula tion of single-stranded genome used for packaging. The other ORF cap encodes for VP1, VP2 and VP3 which are transcribed from p40. They are capsid proteins and have pivotal roles in tropi sm specificity. These three proteins are expressed in the ratio of 1:1:20, making the capsid with icosahedral symmetry. The ITRs at both ends of the vi ral genome have a couple of functions. The detailed structure and sequence of ITR is s hown in Figure 1.31 [330] Panel C. First, the 3 end of the ITR on the 5 end the genome se rves as primer in the synthesis of a new DNA strand. Second, ITRs contain Rep bindi ng site (RBS) for Rep78 and Rep68 and

PAGE 99

83 help them work as a helicase and an endonuc lease. Third, the terminal resolution site (TRS) is identical to a sequence in chromosome 19, serving as integration sequence [341]. Figure 1.31. AAV2 genome and the vector genome [330]. When making an AAV viral vector, the two ORFs and the viral promoter are all replaced by a transgene and the only cis elements needed for AAV integration, packaging and assembly are the ITRs. The vector genome is shown in Figure 1.31 [330] Panel B.

PAGE 100

84 rep and cap will be provided in trans in another plasmid, and helper virus gene products (E1a, E1b, E2a, E4 and VA RNA from Ad) are also provided in trans Originally the vector production method is to co-transfect the HeLa cells with transgene plasmid, the plasmid providing rep and cap and wide type Ad, or to co-transfect human 293 cells with the transgene plasmid, rep and cap plasmid, and E1-deleted Ad, as the E1gene products can be provided endogenously in 293 ce lls. Recently helper virus-free system has been designed to minimize the safety issues. See Figure 1.32 [334]. Figure 1.32. Helper virus free sy stems in rAAV production [334]. The helper virus-free system has the three-plasmid system and the two-plasmid system [334]. In the three-plasmid system besides AAV vector plasmid and AAV helper plasmid providing rep and cap genes, an Ad helper plasmi d is introduced to provide the helper virus gene products (E2A, E4 a nd VA RNA from Ad) and human 293 cells are used as the host cell to provide Ad E1 gene products. The best molar ratio for these three

PAGE 101

85 plasmids is 1:1:1, or 1:1:3 in mass [342] The two-plasmid system combines the AAV helper plasmid and the Ad helper plasmid into one. The most recent version (called pDF) has 6 different helper plasmids, common in rep gene (AAV-2 rep ) but varying in cap genes (AAV-1 to AAV-6 cap ) [330]. Whats more, different fluorescence protein gene is incorporated in the different plasmids. Because there are 5 kinds of most frequently used fluorescence protein genes, the plasmid having AAV-1 cap and the plasmid having AAV-6 cap use the same fluorescence protein gene cyan fluorescence protein (CFP). The other four plasmids encode green fl uorescence protein (GFP), yellow fluorescence protein (YFP), blue fluores cence protein (BFP), red fluores cence protein (RFP). This two-plasmid system is called Helper virus fr ee, Optically controllable, Two-plasmid-base, or HOT [343]. This system not only minimizes safety issues and simplifies operation, but also adds controllable tropism Figure 1.33 [330] summarizes the rep and cap genes, fluorescence and preferred tropism fo r these 6 pDF helper plasmids. Figure 1.33. The 6 pDF helper plasmids in the two-plasmid system [330]. After the production of the AAV vectors, the vector purification can be accomplished in several ways, such as CsCl gradient ultracentrifugation, iodixanol

PAGE 102

86 discontinuous gradient ultracentrifugation, heparin affinity column (for AAV-2), and HPLC [330]. The combined use of heparin affinity column and HPLC for AAV-2 can result in more than 50% recovery and more than 99% purity [344, 345]. Beyond a vectors own tropism, if we want to regulate the transgene expression more specifically or more precisely, some modification on AAV vector can be done. A linker molecule between the viru s and the target cell can be in corporated as an indirect modification. The linker molecule can be bispecific antibody or streptarvidin. One example is the antibody F(ab )2 which is used to help AAV-2 capsid to target 2 3 integrin [346]. A direct modi fication would be the modifi cation on capsid proteins, for instance, the serpin receptor ligand has been incorporated into AAV-2 capsid gene [347]. Besides the modification on external su rface of the vectors, tissue specific promoters/enhancers can also be used to regu late the transgene expression is specific tissue. Adenovirus (Ad) Vectors Adenoviruses are non-enveloped, dsDNA viruse s. Ad vectors can capacitate up to 30 kb of transgene [324], which is larger than AAV vectors. Ad is non-integrating virus and remains as an episomal element in the nuc leus. Ad is very efficient at transducing, in vivo and in vitro dividing and non-dividing cells and can produce very high titers (>1011/ml). Ad vector administration usually induces strong immune response. After intravenous injection, 90% of the vector is degraded in the liver and the remaining viruses have their promoter inactivated [348]. The persisting antibody prevents subsequent administration. Transit immunosuppre ssive therapies may be needed with Ad vector administration.

PAGE 103

87 The Ad genome has four early transcrip tional units (E1, E2, E3, E4), which have regulatory functions, and one la te transcript, which encodes the structural proteins. The gutless vector contains the inverted term inal repeats (ITR), the packaging sequences around the transgene, and additional stuffe r DNA to maintain the optimum package size. The necessary viral genes are provided in trans by helper virus. Figure 1.34 [324] shows a simple structure of the Ad genome, vector genome and helper virus. Figure 1.34. Ad genome and the vector genome [324]. During transduction, the fiber protein in Ad binds to cellular receptors, which are usually MHC class I molecules [349] and coxsackievirus-adenovirus receptors (CAR) [350]. Next the penton base protein on Ad binds to the co-receptor, v 3 and v 5 integrins, and internalize via clathrin-mediate d endocytosis. After tran sport to the nucleus, the transcription of early genes is initiated and interferes with the antiviral defense of host cells. DNA replication is initiate d by E2 products. In the late phase, structural proteins are highly expressed and vi rus assembly starts. Simila r to AAV, specific cellular promoters/enhancers are used to direct tissue specific transgene expression.

PAGE 104

88 Retrovirus Vectors Retroviruses are enveloped, ssRNA viru ses. ssRNA needs to be reversely transcribed into dsDNA and then the viral genom e can integrate into th e host gene but the virus can only target dividing cells. The vector capacity is around 7.5 kb [324]. The vector is easily inactivated by c1 complement protein and antigalaetosyl epitope antibody, both of them are pr esent in human sera [351, 352] The biggest disadvantage for retrovirus vectors is that insertiona l mutagenesis can possibly occur, because retrovirus (with its own proto-oncogene remove d) can transform cells by integrating near a cellular protoncogene and dr ive inappropriate expression from its 3 long terminal repeats (LTR); or disrupt a tumor suppressor gene. There are three categories of retrovirus: onc oretrovirus, lentivirus and spumavirus [329]. Oncoretrovirus is the simplest in st ructure and is the most commonly used. The oncorectrovirus genome contains three genes: gag encoding the core proteins, pol encoding the reverse transcriptase, env encoding the envelope pr oteins and determining tropism. There are LTR at both ends of the ge nome. The LTR is comprised of 3 regions, which are U3, R and U5. The LTR is essentia l for reverse transcri ption, integration and transcriptional activation as it contains a viral promoter/enhancer. located between the 5 LTR and the viral genes. This sequence re quired for packaging. In retrovirus vectors, LTRs and are retained and the viral genome is replaced by a transgene. Transgene expression can be driven by the viral prom oter/enhance in the 5 LTR or by other exogenous promoters. Figure 1.35 [329] shows the genomic struct ure of MLV DNA, which is the most frequently used vector in oncoretravirus.

PAGE 105

89 Figure 1.35. MLV genome structure [329]. Herpes Simplex Virus Ty pe 1 (HSV-1) Vectors HSV-1 are dsDNA, neurotropic viruses, a nd are good for neural gene transfers. The capacity of HSV-1 is about 40-50 kb [324] HSV-1 has two life cycles. In the lytic life cycle, the viral genes get expressed s hortly after transducti on and new viruses are packed and released. In latent life cycle, th e virus remains an intranuclear episome and the infected cell functions normally. Structurally, beside s envelope, capsid and viral genome, the HSV-1 contains tegument, which is a protein layer be tween capsid and the envelope. Tegument is essential for viral in ternalization, resistance from the host cell defense system and transcription activati on [329]. The HSV-1 genome has three classes of genes: immediate-early gene, early genes, and late genes. One kind of plasmid vector derived from HSV-1 is called amplicon. It contains Col E1 ori (an Ecoli origin of replication), Ori S (HSV-1 origin of replication) and HSV1 packing sequence [324]. The transgene is under the control of an immediate-early promoter. The expression is dependent on help er virus or helper plasmid containing the necessary genes from helper virus. The othe r kind of HSV-1 vector is the replicationdeficient HSV-1, which is made by deletion of one immediate-early gene [324]. The deleted immediate-early gene is provided in trans

PAGE 106

90 CHAPTER 2 METHODS AND MATERIALS Hammerhead Ribozyme Target Sites The hammerhead ribozymes designed for th is study were all 34 bases in length. They formed three stem structures when bound to target. The targeting arms of the ribozyme bound to either side of the X of th e target NUX sequence to form stems I and III. The cleavage target was, therefore, 13 base s in length. Stem II was four base pairs in length and formed a stabilizing tetraloop within the folded ribozyme structure. An internal loop, formed with in the ribozyme when it was bound to target, contained the catalytic core of the hammerhead ribozyme. Choosing a target site in the mRNA seque nce was the first step in ribozyme design. Shimayama et al. [281] refined the NUX rule of hammerhead ribozyme target site selection and demonstrated that a GUC site is the most efficient site for cleavage. Then Fritz and colleagues found GUCUU or GUCUA was more efficient cleaved [257]. The initial step in designing a ribozyme wa to s earch for potential target sites within the mRNA sequence of the target gene. The so ftware package Vector NTi (Invitrogen, Carlsbad, CA) can be used for this purpos e. The target mRNA sequence was downloaded into Vector NTi from GeneBank and the sequence was searched for the presence of GUCUU and GUCUA sites. Once potential target si tes were identified the next step was to determine target accessibility.

PAGE 107

91 Accessibility of Target Site All the selected sites were only potential ta rget sites because in the real world the secondary and tertiary stru cture of mRNA would affect the sequence accessibility significantly. To select the most accessibl e sites we used Zukers Mfold program ( http://www.bioinfo.rpi.edu/a pplications/mfold/old/rna/ ) to examine target accessibility. This program was used to predict the sec ondary structure of 200 bases of the target mRNA centered on the NUX target sequence. In most cases the program would generate several possible structures. Si nce the structure of RNA in solution is dynamic, it is possible that the target regi on would exist in a dynamic equilibrium made up of the structures generated by Mfold a nd other structures also. For these studies, target sites which were completely or partially accessible within loop structures or at the end of a stem structure were considered accessible. The accessibility and thermodynamic stability of the ribozyme is also very important. After the most accessible targ et sites were found by using Mfold, the corresponding ribozyme secondary structure was then examined using the same program. Generally ribozymes fold into one the four t ypes of secondary struct ures shown in Figure 2.1 [257]. Type A has its two targeting ar ms completely accessible and forming no internal secondary structure with the rest of the ribozym e. Ribozymes that form only structure A, by Mfold analysis, typically have high catalytic ac tivity. Type B and C structures do have internal secondary stru ctures formed within one or both of the targeting arms but have a higher dG than structure A and, therefore, should have relatively good accessibility to bind to the ta rget and possess relatively high catalytic activity. Ribozymes that form structures like D have lower dG values than structure A

PAGE 108

92 and are more stable. Ribozymes that form st ructure D may have very low or no catalytic activity. Figure 2.1. Typical structures of hammerhead ribozyme predicted by Mfold [257]. Once an accessible target site and ribozyme were identified the next step was to purchase RNA oligonucleotides corresponding to both the target and the ribozyme in order to perform in vitro cleavage analysis to determine the kinetic parameters of the ribozyme. Kinase of Target Oligonucleotides For the in vitro assays ribozymes and target RNA oligonucleotides were purchased from Dharmacon (Boulder, CO). They were deprotected according to manufacturers protocols and suspended to a concentration of 300 pmol/l in TE or water

PAGE 109

93 and stored at -70C. The ta rget RNA oligonucleotide was radioactively labeled with 32P at the 5 end. 2 l of RNA oligo (10 pmol/l, 20 pmole total) was mixed with 1 l 10X polynucleotide kinase buffer (Promega, Madiso n, WI), 1 l RNasin (Promega, Madison, WI), 1 l 0.1M DTT (Sigma, St. L ouis, MO), 3 l water, 1 l [ 32P] (10Ci) (ICN, Santa Clara, CA) and 1 l T4 polynucleotide kina se (5 units) (Promega, Madison, WI). Reactions were incubated at 37C for 30 minutes, 65 l of water was added, and the mixture was extracted with 100 l of pheno l/chloroform/isoamyl alcohol solution. The aqueous layer was added to a pre-packed G-50 fine spin column to separate the labeled target oligonucleotide from th e unincorporated label. Sample s were collected in a 1.5 ml Eppendorf tube (Fisher, Suwanee, GA) and st ored at 4C. Samples are usable for one week but best when used within 24 hours. Time Course of Cleavage Reac tions for Hammerhead Ribozymes 1 l of ribozyme (2 pmole total, dilute d from 300 pmol/l stock) was mixed with 13 l of 400 mM Tris-HCl (Fisher, Suwanee, GA), pH 7.4-7.5, and 88 l of water. The mixture was incubated at 90C for 2 minutes to denature the ribozyme and then held at room temperature for 10 minutes. Next 13 l of 1:10 RNasin:0.1M DTT and 13 l of 200 mM MgCl2 (20 mM final) (Sigma, St. Louis, MO) was added and the mixture was incubated at 37C for 10 minutes. Cleav age was initiated by addition of 2 l of target oligonucleotide (1 l 32P-kinased target plus 1 l of cold target (20 pmole, 150 nM final)). The reaction was inc ubated at 37C, and time point s were taken at 0, 1, 2, 5, 10, 15, 30 and 60 minutes. For each time point 10 l of the reaction was added to 10 l of formamide dye mix (90% formamide (Sigma, St. Louis, MO), 50 mM ethylenediamine tetra acetic acid (EDTA) pH 8 (Fisher, Suwanee, GA), 0.05% bromophenol blue (Sigma,

PAGE 110

94 St. Louis, MO) and 0.05% xylene cyanol (Sigma St. Louis, MO)). Samples were placed on ice then stored at -20C. The samples we re heat denatured at 90C for 5 minutes, cooled on ice, and applied to a 10% PAGE-8 M urea gel (6 l sample loaded each well) to separate the reaction products. The gel wa s held at 33 mA until the bromophenol blue moved 60% of the length of the gel. The ge l was fixed and dried. The gel was analyzed on a Molecular Dynamics PhosphoImager (Ammersham, Sunnyvale, CA). The time point when 15% of the target was cleaved was dete rmined and used as the endpoint for the multiple turnover ki netic reactions. Multiple Turnover Kinetics Reactions were done in a final volume of 20 l. Ribozyme (0.3 pmol/l, 15 nM final) in 40 mM Tris-HCl (pH 7.5) was incuba ted at 65C for 2 minutes and then at 25C for 10 minutes. The reactions were supplem ented with DTT (20 mM final) and MgCl2 (20 mM final) and 4 units of RNasin, incuba ted at 37C for 10 minutes. Adding gradient concentrations of the target oligonucleotide (0-3 00 pmol/l; 0-1500 nM final) initiated the cleavage reactions. The reaction tubes were incubated at 37C for a fixed interval determined in the time course analysis of cleavage. This experiment could also be done with incubation in 1 mM MgCl2 at 25C. The addition of 20 l of formamide stopped buffer terminated the reactions. Samples were in itially held on ice then stored at -20C. Later the samples were heat denatured at 90 C for 5 minutes, placed on ice and cleavage products were separated on 10% polyacrylamide-8 M urea gels The gels were analyzed on a Molecular Dynamics PhosphoImager. Treating ribozymes as classical catalytic enzymes, this experiment was done to determine the kinetic parameters (Vmax, Km, kcat). The addition of gr adient concentrations of the target oligonucleotide initiated the cleavage reaction and high concentrations of

PAGE 111

95 target saturate the ribozymes catalytic capability. This fixed interval for reaction incubation was usually how much time it needs to reach the 15% cleavage of the target, at which the cleavage reaction was linear. Thus the average cleavage velocity determined in this interval could be used as the initial reaction velocity. This velocity was determined using the amount of cleavage product divided by the fixed interval of time. The amount of the target cleavage product was dete rmined by autoradiograph. By plotting the cleavage velocity versus the corresponding ta rget concentration, a saturation curve was generated that is a typical Michaelis-Men ten equation curve for the enzyme kinetics study. A double-reciprocal plot (also called: Lineweaver-Bur ke plot) could be further generated to graphically determine the kine tic parameters. This double-reciprocal plot was linear; the slope equaled Km/Vmax and the intercept on the Y-axis equaled 1/Vmax. Thus Vmax and Km could be determined. kcat was the turnover number and assigned as the value of Vmax divided by enzyme total concentr ation. The enzyme (ribozyme) total concentration was a known value. The two equations are listed below. ] [ ] [max 0S K S V vm Michaelis-Menten Equation; max max 01 ] [ 1 1 V S V K vm Lineweaver-Burke Plot; where v0 is the initial reaction velocity, and [S] is the concentr ation of substrate (oligonucleotide target). Cloning of the Ribozymes into an rAAV Expression Vector The rAAV cloning vector was p21NewHp (Figure 2.2) and was described by Shaw and coworkers [353]. This vector was modified from the pTRUF21 plasmid (obtained from the UF Vector Core) by insert ion of a self-cleavi ng hairpin ribozyme

PAGE 112

96 between SpeI and Nsil sites. These sites we re immediately downstream of the position where the hammerhead ribozyme is located. The hairpin ribozyme cassette included a cleavage site at its 5-end that was recognized by the hairpin ribozyme. During transcription, the cytomegalovirus (CMV)/chicken -actin chimeric enhancer/promoter drived the transcription through the hairpi n ribozyme. Self cleavage by the hairpin ribozyme liberated the 3-end of the hammerhead ribozyme with an additional eight bases at the hammerheads 3-end. Cleavage at this position eliminated downstream sequences that could interfere with the hammerh ead ribozyme annealing to its target. Figure 2.2. The pTRUF21 expressi on and cloning vector and the orientation and position of the hammerhead and ha irpin ribozyme cassette.

PAGE 113

97 For the cloning of one of the hamm erhead ribozymes, two synthetic complimentary DNA oligonucleotides with phos phates at the 5-ends that code for a single hammerhead ribozyme were purchased from Invitrogen (Carlsbad, CA). They were annealed by incubating at 90C for 3 minut es then slow cooled to room temperature for about 40 minutes. The annealed produc t was a double-stranded DNA oligonucleotide with a cut HindIII site at 5 end and a cut SpeI site at 3 end. This double stranded DNA fragment was cloned into the HindI II and SpeI site of p21NewHp. The plasmid was digested by HindIII and SpeI restriction endonucleases (Promega, Madison, WI) according to manufact urers protocols. Then the annealed oligonucleotide product was ligated into the Hi ndIII and SpeI sites in the plasmid using DNA T4 Ligase (Promega, Madison, WI) acco rding to manufacturers protocols. The ligated products were transformed into SURE competent cells (Stratag ene, La Jolla, CA) using electroporation. SURE cells were used in order to maintain the integrity of the inverted terminal repeats (TRs). Screening and Sequencing of the Clones The ligation mixture-transformed SRUE cells were grown in terrific broth (TB, Sigma, St. Louis, MO) supplemented with ampicillin at 37oC for 16 hours or less. The plasmid DNA was purified using Genelute HP Plasmid Maxiprep Kit (Sigma, St. Louis, MO). The purified plasmids were digested with PstI restriction endonuclease (Promega, Madison, WI) according to manufacturers protoc ols to monitor the integrity of TRs. The insertion of the hammerhead ribozyme eliminated a PstI site and loss of this site was used as a diagnostic indicatior of ha mmerhead insertion into the vector. In addition, we also performed SmaI digests on the plasmids to de termine the integrity of the TRs. Plasmids that lacked the PstI site and still retained intact TRs were then sequenced to verify the

PAGE 114

98 presence of the hammerhead ribozyme in sert. The plasmids were sequenced using Ladderman Dideoxy Sequencing Kit (TaK aRa Shuzo Co, Japan) according to manufacturers protocol or sequenced at ICRB Core sequencing facility at UF. HREC Tissue Culture Human eyes were obtained from Nationa l Disease Research Interchange within 36 hours of death. HRECs were prepared and ma intained as previously described [354]. The eyes were placed on a sterile gauze pad (Johnson and Johnson Medical Supplies, Arlington, Texas) in a laminar flow hood and wa shed with 5 ml of betadine (Fisher, Suwanee, GA), and dissected with sterile scalpels (No. 1, Feather Industries Limited, Japan) and tweezers. Neural retina was isolat ed from the posterior portion of both eyes clear of RPE layer. The retina was placed on a 53 micron mesh nylon membrane (Tetko Inc, Lab Pack, Kansas City, MO) to separa te the endothelial cells. Phosphate buffered saline (PBS) mixed with 2% antibiotic/antim ycotic mix (ABAM) (Sigma, St. Louis, MO) was used to wash the retina. While washing, the retina was ground over the nylon membrane by a sterile wooden spatula. Then th e remaining retina was transferred to a 20 ml Erlenmeyer flask containing 10 ml of PB S with antibiotics, using a sterile 10 ml pipette. Approximately 1 mg of collagena se (342 units/mg, Worthington Biomedical Corporation, Lakewood, NJ) was added to the flask. The flask was incubated in a 37 C water bath for 15 minutes, and the contents we re stirred every 5 mi nutes to dissolve the collagenase. Then 20 ml of complete endotheli al cell media (250 ml Dulbelcos Modified Eagle Medium (DMEM) low glucose, 250 ml HAMs F12, 10% fetal bovine serum, 15% endothelial cell growth supplement, 15% insu lin/transferring/selen ium, 2% L-glutamic acid, 2% antibiotic/antimycotic mix) was added to the flask. The cells were washed twice with media and placed into a T25 flask (Fishe r, Springfield, NJ) coat ed with 1% gelatin

PAGE 115

99 (Sigma, St. Louis, MO). For the next 48-72 hour s the cells were kept undisturbed so that they could grow and attach to the flask. Th en the media was changed and fresh antibiotics were added. The cells were passaged upon reach ing confluence. They were washed twice with PBS, then washed with 5 ml of trypsin (Sigma, St. Louis, MO) and then incubated in CO2 for 45 seconds. The trypsin was neutraliz ed with 2X volume of the complete endothelial cell media. The cells were centrifuged at 1000 rpm in an Eppendorf CT 5810R, resuspended in 6 ml of complete endot helial cell media and transferred to a T75 flask (Fisher, Suwanee, GA). Next 15 ml of complete endothelial cell growth media and fresh antibiotics were added to the T75 flask to culture the cells. Confluent cells used for the studies were those of passages 3-4 and were ascertained positive for acetylated LDL. Transfection of HRECs with Lipofectamine HRECs were grown on 150 mm plates to confluence before transfection with the ribozyme expressing plasmids using Lipofect amine 2000 (Invitrogen, Carlsbad, CA). For the transfection 728 l of Opti-MEM I wa s mixed with 52 l Lipofectamine 2000 and kept at room temperature fo r 5 minutes. A second aliquot of 780 l of Opti-MEM I was mixed with 13 g of plasmid DNA and held at room temperature for 5 minutes. These two solutions were combined and held at room temperature for 20 minutes. The combined solutions were then added to cell cultures. After 24 hours the media was replaced. Cell cultures were harvest after 72 hours. Tr ansfection efficiency was determined using a rAAV plasmid expre ssing green fluorescent protein (GFP). Total RNA Extraction Trizol LS reagent (Invitrogen, Carlsbad, CA) was used to isolate total RNA from HRECs. Experiments were done following manufacturers protocol. For the 12-well plate, after media removed, 1.5 ml Trizol was added to each well. The cells were

PAGE 116

100 resuspended and then transferred to 1.5 ml eppendorf tubes and incubated at room temperature for 5 minutes. 80 l chloroform was added and the mixture was extracted for 30 seconds on a vortex mixer. After incubation at room temperature for 3 minutes, cells were centrifuged at 7400 rpm for 15 minutes. Th e aqueous layer was then transferred to a fresh tube and 190 l isopropanol was added. The mixture was incubated for 10 minutes at room temperature, and centrifuged at 7400 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 380 l of 75% ethanol. The cells were mixed on a vortex mixer for 15 seconds and centr ifuge at 7400 rpm at 15 minutes and the supernatant was discarded. The pellet was th en air dried for 10 minutes, dissolved in 25 l RNase-free water or TE. Th e product was stored at -70oC, aliquoted at 8 l in 3 tubes for future use. Relative Quantitative RT-PCR Relative quantitative RT-PCR was perfor med on RNA isolated from HRECs transfected with plasmids expressing ri bozymes and the p21NewHp vector expressing no ribozyme. Reverse transcription (RT) re actions were performed using reverse transcriptase (SuperScript from Invitr ogen, Carlsbad, CA) and a random hexamer according to manufacturers protocol. In brief, 8 l of RNA isolated from transfected HRECs and 2 l of random hexamer were mixed and incubated at 90oC for 3 minutes and then held on ice for 5 minutes. Then 4 l 5X RT buffer, 10 mM dNTP and 1 l RNasin, 0.1 M DTT and the reverse transcriptase were added into the reacti on. After a series of incubations at 25oC for 10 minutes, 42oC for 60 minutes and 95oC for 10 minutes, the RT product was complete and stored at -20oC. For the relative quantitative PCR, the linear range of the amplification of the RT product was determined by using a PCR master mix (1 l RT product/50 l, 200 M

PAGE 117

101 dNTPs, 1 mM MgCl2, 0.4 M PCR oligonucleotides, 1x Taq DNA polymerase buffer (Sigma-Aldrich, St. Louis, MO), 2 U Taq DNA polymerase (RED Taq ; Sigma-Aldrich, St. Louis, MO, 0.5 Ci/50 l [ 32P]-dATP (ICN, Irvine, CA)). 50 l of the master mix was separated into eight 0.2 ml tubes, and amplification wa s performed with an annealing temperature of 61C. Samples we re removed at even-numbered cycles starting at cycle 26. For each PCR sample, 5 l was removed and 2 l of formamide dye mix was added. The samples were heat denatured at 95C for 3 minutes, cooled on ice, and applied to a 6% polyacrylamide-8 M urea electrophoresis gel. Dried gels were analyzed on the phosphorescence imager to determine the linear range of amplification. Cycle 34 and cycle 36 was determined to be within the li near range of amplification for IGF-1R and integrin 1 mRNAs, respectively. In the relative quantitative RT-PCR assays the level of target mRNA was determined within each sample relative to an internal -actin standard. -actin mRNA levels were determined with a -actin primer/competimer oligonucleotide set (QuantumRNA) from Ambion (Austin, TX ). The competimer oligonucleotide pair from the -actin primer set annealed to the same targets as the primer oligonucleotide pair, but they were blocked at their 3' ends to prevent extension. This primer/competimer oligonucleotide set allowed us to determine the ratio of primer to competimer that yields a -actin PCR fragment that is approximately equimolar to the IGF-1R PCR product. To determine the ratio of the primer/competim er oligonucleotide set necessary to achieve this, PCR reactions were perf ormed as described earlier, and amplification proceeded for 34 cycles (IGF-1R) or 36 cycles ( 1-integrin). The ratio of primer to competimer

PAGE 118

102 oligonucleotide was determined to be 10:1 at a final concentration of 0.4 M for the combined primer/competimer mixture. Table 2.1. Sequences of primer pairs and a nnealing temperatures used in relative quantitative PCR. mRNA Primer Pairs Annealing C IGF-1R AGGACGGCTACCTTTA CCCGGCACAATTAC ATCAACAGGACAGC GACGGGCAGAG 61 Integrin 1 GAAAAACTCAATGACT TTCAGCGGC CCAGTTGTGTAATGC AAATGTCCACA 54 Integrin 3 CGTCGTCTCCGCCTTC AACCTGGAT GGCCACAGTCACTCC AAGCCACATG 60 Integrin 5 ACCCAGGGTCGGGGG CTTCAACTTA GCCCCGAACCACTG CAAGGACTTGT 61 Integrin v CGCTTCTTCTCTCGGG ACTCCTGCT CAGATGCTCCAAAC CACTGATGGGA 58 PCR reactions were then perf ormed for IGF-1R, integrin 1 and -actin simultaneously to determine the relative amount of IGF-1R to -actin, using the above conditions. Table 2.1 lists the sequences of pr imer pairs and the a nnealing temperatures. PCR products were later separated on 6% pol yacrylamide-8 M urea gels and analyzed on the phosphorescence imager. Reverse TranscriptionReal Time PCR For each reverse transcription (RT) react ion, 4 l of total RNA isolated from HRECs was used with iScr ipt cDNA Synthesis Kit (BioRad, Hercules, CA) following manufacturers protocol in a 20 l reaction. 4 l from the 20l RT-reaction product was used to perform real-time PCR using iQ SYBR Green Supermix (BioRad, Hercules, CA) according to manufacturers protocol. Primer s from manufacturers were resuspended to 7.5 pmol/l before addition to the PCR react ion mix. All reactions were performed in duplicate. -actin PCR primers (Ambion, Austin, TX) were used as the internal normalization control. Real-time PCR was performed on a DNA engine Opticon system

PAGE 119

103 with continuous fluorescence detector ( MJ Research, Waltham, MA). Opticon monitor analysis software (MJ Research, Waltham, MA) was used for analysis. For IR, the sequences of primer pairs used were GATGCACCGTCATCAACGGGAGTCTGATC and GGCGCCCCTTGGTTCCTGAAA CTTC, and annealing temperature was 58 C. For VEGFR-1 and VEGFR-2, the primers were pr e-synthesized from manufacturer (R&D, Minneapolis, MN) and the annealin g temperatures were both 55 C. Total Protein Extraction HRECs grown on 150 mm tissue culture plates were washed with PBS and scraped in ice cold phenol-free Hanks bala nced salt solution (HB SS) containing 1 mM EDTA. The cells were centrifuged at 1000 rp m for 5 minutes at 4C in Eppendorf 5810R centrifuge and 30 l of lysis buffer (150 mM Tris-H Cl, 150 mM NaCl, 1 mM EDTA, 1% Igepal CA-630 (Sigma St. Louis, MO), 1% pr otease inhibitor cocktail (Sigma, St. Louis, MO) and 1 mM DTT (Fisher, Suwanee, GA)) was added. The mixture was sonicated for 2 seconds and then centrifuged at 13,200 rpm for 15 minutes at 4C. Protein levels in the supernatant were determined using a bicinchon inic acid (BCA) protei n assay kit (Pierce, Rockford, IL) according to manufacturers protocol. Western Blotting 80 g of total protein was loaded on a 4%-15% gradient polyacrylamide gel (Criterion; BioRad, Richmond, CA). The gel was electrophoresed at 120 V for 20 minutes to allow for stacking of the samples and then 140 V for 65 minutes to separate proteins. The gel was transfe rred to a nitrocellulose memb rane (Millipore, Bedford, MA) using a blot cell apparatus (BioRad, Rich mond, CA) at 80 V for 5 hours on ice in 4C cold room. The membrane was blocked in TBS containing 0.05% Tween (Sigma St. Louis, MO) and 5% milk for 1 hour at room temperature. Then the membrane was

PAGE 120

104 incubated with primary antibody at 4C overnig ht. The membrane was washed again with TBS containing 0.05% Tween and 5% milk for 5 minutes and then incubated with secondary antibody for 1 hour at room temperat ure. The membrane was washed twice for 5 minutes and twice for 10 minutes with TBS containing 0.05% Tween. Usually the same membrane was also used to detect the internal protein control, -actin or cofilin. An enhanced chemiluminescence (ECL) Western bl ot Detection Kit (Amersham Biosciences Ltd., Amersham, UK) was used to visualize the western bands. Standard molecular weight markers (BioRad, Richmond, CA) were loaded on the same gel and used to determine the target proteins molecular we ight. The band intensity was analyzed using Scion Image (Scion, Frederick, MD). Table 2.2 lists the concentration of primary and secondary antibodies and molecular sizes of probed proteins. Table 2.2. Summary of primary and secondary antibodies used in western blottings. Protein Primary Antibody Secondary Antibody Molecular Size IGF-1R 1:2000 rabbit polyclonal anti-human IGF-1R subunit IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA) 1:2000 horseradish peroxidase (HRP)conjugated mouse antirabbit antibody (Santa Cruz) 95.2 kDa IR 1:100 rabbit polyclonal anti-human IR subunit IgG antibody (Santa Cruz) 1:1000 mouse anti-rabbit IgG-HRP (Santa Cruz) 95 kDa -actin 1:5000 mouse monoclonal anti-actin antibody (Sigma) 1:7500 HRP-conjugated rabbit-anti-mouse IgG antibody (Sigma) 42 kDa Cofilin 1:2000 rabbit anti-cofilin (Cytoskeleton) 1:1000 mouse anti-rabbit IgG-HRP (Santa Cruz) 18 kDa Flow Cytometry The protein levels of VEGFR-1 and VEGFR-2 were determined using flow cytometry rather than western blotting. Transf ected cells were harvested into single cell

PAGE 121

105 suspensions 48 hours post tran sfection. After centrifugation at 1500 rpm at 4 C for 10 minutes, the cell pellets were suspended in 1 ml of buffer (0.1% BSA in 10 mM NaCl and kept on ice). 10 g of either VEGF R-1 antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA) or VEGFR-2 antibody (Neo markers, Fremont, CA) was added to the cells. After an incubation on i ce for 30 minutes, the cells were washed twice in the buffer and incubated with the seconda ry antibody for 30 minutes in the dark (22.5 g of goat anti-rabbit-FITC antibody (Jack son Immuno Research, West Gr ove, PA) in 1 ml of 0.1% BSA). The cells were washed twice in buffer and 5000 cells were analyzed on a FACScan (BD Biosciences, San Jose, CA). Migration Assay The modified Boyden chamber assay was used to assay the cell ability to migrate to increasing concentrations of growth f actors. Trypsin (Trypsin-EDTA solution for endothelial cell culture, Sigma-Al drich) was used to detach the transfected HRECs into a single cell suspension. After the trypsin was in activated, cells were washed three times with PBS and suspended in DMEM to a final concentration of 1000 cells/l. 30,000 cells (30 l) were added per lower well in the blind-well chemotaxis chamber. A porous polyvinyland pyrrolidone-free polycarbonate membrane (12 m pores) coated with 10% bovine collagen was applied on the wells and the chamber was fully assembled. The chemotaxis chamber was inverted and held in 5% CO2 and room air at 37C to allow cell attachment to the membrane. After 4 hours, ch ambers were then placed upright. 50 l of a cocktail containing VEGF (25 ng/ml), bFGF (25 ng/ml), and various concentration s (1 ng/ml, 10 ng/ml, or 100 ng/ml) of the specifi c growth factor required to stimulate migration was added to the upper wells. For exam ple, IGF-1 was used to test the IGF-1R ribozyme, PlGF was used to test the VEGFR1 ribozymes and VEGF-E was used to test

PAGE 122

106 the VEGFR-2 ribozyme. The chamber was incubated in 5% CO2 and room air at 37C overnight. Next, cells on the attachment si de (lower wells) were scraped from the membrane, and only those cells that migrated through the pores of the membrane into the upper wells were left. The cells were fixed in methanol and then stained with a modified Wright-Giemsa stain (LeukoStat solution; Fisher Scientific, Springfield, NJ), and finally mounted on glass slides. DMEM served as a negative control of random cell migration, and DMEM with 10% FBS was used as a positive control in each experiment. A minimum of six replicate wells were assaye d for each condition. A light microscope was used to count the cells, and the average of the number of cells count ed in three separate, high-power (400X) fields was used as a quantita tive reflection of th e number of migrated cells per well. Cell Proliferation Assay (BrdU) The BrdU-incorporation assay was perfor med following manufacturers protocol (Roche Applied Science, Indianapolis, IN). For a 96-well plate, tr ansfected cells were added in a final volume of 100 l/well. The cells were incubated for 48 hours. BrdU was added in the wells to a final concentration of 10 M, and the cells were incubated for 2 hours. The cell media was removed and 200 l/well of FixDenat from the kit was added to the cells and the plate was incubated at room temperature for 30 minutes. The FixDenat was removed and 100 l/well of BrdU antibody-conjugate was added and the plate was incubated for 90 minutes at r oom temperature. The antibody solution was discarded and the cells were washed with 300 l/well of washing solution from the kit. The washing solution was removed and 100 l/w ell of substrate solution was added. The plate was held at room temperature until color development was sufficient for photometric detecti on (5-30 minutes).

PAGE 123

107 Tube formation Assay (Matrigel) Cells were transfected as detailed abov e. 24 hours after tranfection the cells were trypsinized and 5000 cells were seeded on matrigel (BD Biosciences, San Jose, CA) and incubated at 37oC in 5% CO2 environment. The cells were photographed every 24 hours. Proliferating Endothelial-Cell Specific Promoter Constructs The pLUC1297 and pLUC1298 plasmids were transformed into and isolated from DH5 E.Coli Bacteria (Qiagen Mega Kit). Thes e plasmids contained the proliferating endothelial-cell specific promot er and a luciferase reporter gene followed by a polyA site. The promoter was composed of a 4X (1297) or 7X (1298) 46-mer of the endothelin enhancer upstream of the human cdc6 promoter. The pLUC1297HHHP and pLUC1298 plasmids contained the IGF-1R hammerhead ribozyme/hairpin ribozyme cassette. A variant of pLUC1298HHHP designated pG E1298HHHP was missing the luciferase reporter gene. The cloning of IGF-1R ha mmerhead ribozyme with immediatedownstream processing hairpin ribozyme into the vectors was performed as detailed above, but ligation was into the Xba1 a nd Xho1 sites. The ligation product was transformed in StblII cells and the anti-kan amycin clones were selected. The isolated plasmid DNA (Giga Prep Kit-Qiagen) was sequenced to confirm ribozyme sequences. Plasmid Formulation for Adult Mouse Eye Gene Transfer Plasmid DNA was isolated and purified from StblII bacteria (Invitrogen). A cationic lipid (Lipid 89 Genzyme Corporation) in a molar ration of 3:1 lipid:plasmid was used to condense the DNA in 40% ethanol/5% dextrose. A helper lipid mixture composed of lysophospatidylcholine: monoacylglycerol: free fatty acid (1:4:2) (mole/mole/mole) was mixed with the cationic lipid. The lengths of the acyl chain helper lipids were 18:2

PAGE 124

108 and the ratio of cationic lipid to helper lip id mixture was 10:90. Ethanol was removed by dialysis against PBS and the final DNA concentration was 0.5 mg/ml. Animals All animals were treated in accordance w ith the ARVO statement for the use of animals in Ophthalmic and Vision Research a nd with the Guide for the Care and Use of Laboratory Animals. All protoc ols were approved by the IA CUC of the University of Florida. C57BL6/J timed pregnant mice a nd adult mice were obtained from Jackson Laboratories (Bar Harbor, ME). The mice we re housed in the University of Florida Health Science Center Animal Resources facilities. Ketamine (70 mg/kg body weight) and xylazine (14 mg/kg body weight) mixture was i.p. injected to anesthetize mice before laser treatments or euthanizat ion. Intravitreal injection in to 24-hour-old mouse pups was accomplished by placing the pups on a plastic sh ield on ice in order to anesthetize the pups before injection. Intravitreal Injection into the Mouse Mo del of Oxygen-induced Retinopathy (OIR) Shown in Figure 2.3 is the time course of the mouse model of oxygen-induced retinopathy (OIR). The newborn mouse pups we re injected intrav itreally with 0.5 l plasmid (2 mg/ml) in the right eye within 24 hours of birth. Left eyes were used as uninjected controls. Seven days after birth the pups were placed in a chamber that maintained a 75% oxygen environment. After 5 days the 12-day-old pups were returned to normal room air. Return to normal air si mulated a hypoxic response that resulted in the onset of retinopathy. This process mimicked human retinopathy of prematurity, and the aberrant neovascularization was very similar to what is seen in diabetic retinopathy patients. Neovascularization was initiated upon return to normal room air on day 12 and peaks on day 17 when the mice were sacrificed and the eyes were removed for further

PAGE 125

109 analysis. Selected animals were perfused with 1.5 ml of 4% paraformaldehyde for immunohistological studies. Figure 2.3. Time course of OIR mouse model. The average number of pre-retinal nuclei per retinal cross section was determined and used as a quantitative measure of the extent of abnormal neovascularization. To prepare the eyes for analysis the eyes were fixed in 4% pa raformaldehyde for one hour or in TRUMPS over night, washed in PBS, a nd embedded in paraffin. Each eye was sliced into 300 serial sections (6 m thick) sagita lly through the cornea para llel to the optic disc. Every thirtieth section was placed on slide and stained with hematoxylin-eosin (H&E). Three blinded individuals count ed the number of nuclei in the cross-sections of preretinal blood vessels that grew beyond the retinal inner limiting membrane into the vitreous space. The total number of nuclei was used as the indication of neovascularization levels.

PAGE 126

110 Intravitreal Injection into the Adult Mo use Model of Laser-Induced Retinopathy Figure 2.4 shows the time course of this mouse model. Six to eight week old C57BL/6 mice were intravitreally injected in right eyes wi th 2 l of AAV-VEGF, which expressed VEGF and induced neovascularizati on. Left eyes were uninjected controls. Figure 2.4. Time course of the adult mouse m odel of laser-induced neovascularization. Four weeks later the AAV-VEGF injected eyes were subjected to with laser occlusion of the large venous vessels in the retina. An ar gon green laser system (HGM Corporation, Salt Lake City, UT) with a 78diopter lens was used for retinal vessel photocoagulation. The blue-green argon lase r (wavelength 488-514 nm) was applied to selected venous sites next to the optic nerv e. Laser occlusion was performed at the setting of 1 second duration, 50 m spot size and an average of 600 mW intensity with an average of 44 burns per retina. Immediately af terwards we injected 2 l of the ribozyme expressing plasmid intravitreally in the same eye that had received laser treatment. Plasmids were formulated in a final concentr ation of 0.3 mg/ml with a cationic lipid that can facilitate transfec tion of the adult mouse endothelium The mice were sacrificed three weeks following laser treatment. 3 ml of 4% paraformaldehyde was perfused in each

PAGE 127

111 mouse. The eyes were enucleated and the retinas removed for immunohistological studies. Immunohistological Studies Retinas were placed in 96-well plates and permeabilized with PBS containing 0.2% Triton X-100, 0.1% BSA and 0.1% rabbit serum for 24 hours at 4C. Then they were washed in PBS for 24 hours at 4C. Anti-luciferase pAb (1:50 dilution of goat polyclonal IgG) (Promega, Madison, WI) wa s the primary antibody. After a wash in PBS the retina were treated with 0.1% rabbit serum for 24 hours at 4C. The secondary antibody was FITC-conjugated ra bbit-anti-goat-IgG (green) (1:4000 dilution in PBS) (Sigma, St. Louis, MO). The blood vessels in the flat-mounted retina were labeled with endothelial cell-specific aggl utinin conjugated to rhodamine (red) (1:1000 dilution in permeabilization solution, Vector Laboratories, Burlingame, CA). The retinas were imaged using a MRC-1024 Confocal Laser Scanning Microscope at the Optical Microscopy Facility at the Univ ersity of Florida (Gainesvi lle, FL). ImageJ (ImageJ 1.32j. Wayne Rasband, National Institutes of Health, USA, http://rsb.info.nih.gov/ij/ ) was used to analyze the images. Statistical Analysis Statistical analysis of the data was perf ormed using the Students t-test (Excel; Microsoft, Redmond, WA). Results were re ported in mean SE. P < 0.05 is deemed significant.

PAGE 128

112 CHAPTER 3 RESULTS In this project a number of cell surface protein receptors were selected as our ribozyme targets. These ribozymes were tested in vitro in HRECs and/or in vivo in mouse models of retinal neovasculariz ation. Inactive versions of se lected ribozymes were also produced and tested. A proliferating endotheli al cell-specific promoter was developed and tested with selected ribozymes. Ribozyme Design All hammerhead ribozymes designed in this study were 34 bases in length. They bound to targeted mRNA, formed a three stem st ructure, and cleaved at the 3 end of the X in the NUX triplet within the target sequenc e. The target sequences were all 13 bases long with six bases on either side of the X forming ribozyme stems I and III. The design of a ribozyme began with the GeneBank sear ch of the proteins full cDNA sequence and the selection of a 13-base-long target site. Target Site Selection Taking the insulin receptor (IR) as an example, the human and mouse IR gene sequences were first retrieved from GeneBank (human accession number NM_000208 and mouse accession number NM_010568). We sear ched for GUC sites as the candidates of cleavage sites. All these ca ndidate targets were examined in silico for accessibility. We eventually chose the 5-UUACGUCUGAUUC-3 sequence in the human gene and the 5-GCUUGUCUGAAAU-3sequence in the mouse ge ne as cleavage targ et sites. Figure

PAGE 129

113 3.1 shows the full cDNA sequence of human IR gene and the selected target site is highlighted. Figure 3.1. The human IR cDNA sequence with ribozyme target site highlighted.

PAGE 130

114 Accessibility of Target Site The tertiary structure of the mRNA su rrounding the target site will affect the accessibility. The mRNA sequence from 200bp upstream and downstream of the NUX target site was examined with Zukers Mfold program ( http://www.bioinfo.rpi.edu/a pplications/mfold/old/rna/ ). Figure 3.2 shows some of the possible secondary structures of the huma n IR target region predicted by the Mfold program. As shown, the target site (red arro ws) is partially within the loops, which indicates, at least, partial accessibility of the site. The ideal situation suggesting complete accessibility of the target would be location of the target completely within loops. Figure 3.2. Mfold structures predicte d for the human IR target region.

PAGE 131

115 After determining if the target site was accessible, it was then necessary to examine the potential folding of the riboz yme by Mfold. The sequence of the ribozyme was generated from the target sequence, whic h gave the sequence of the 5and 3-six base targeting arms that form stems I and III and the catalytic core and tetraloop sequence that was used in all of the hammerhead ri bozymes in this study. Figure 3.3 shows the only Mfold structure predicted for the human IR ribozyme. This structure is a typical type A structure, based on the nome nclature of Fritz, et al. [ 257]. In this structure both targeting arms are completely accessible and the internal tetraloop has been formed by stem II hybridization. Only this structure bei ng predicted by Mfold indicates that this ribozyme is completely accessible for target arm binding to the mRNA target sequence. Figure 3.3. Mfold predicted secondary structure of human IR ribozyme. The mouse target and ribozyme selecti on and design were performed as above. Figure 3.4 shows the technical structure of the bound co mplex of the human/mouse insulin receptor ribozymes and their target sequences. The stem I, II, and III in this complex are also marked out.

PAGE 132

116 Figure 3.4. The 34-base ribozymes (black) anneal ed to the 13-base targets (red) for both human and mouse. Sequences of the Ribozymes and the Targets Table 3.1 shows all ribozyme sequences a nd their 13-nucleotide target sequences. Table 3.1. Summary of ribozyme and target sequences. Ribozyme Ribozyme Sequence (5 3) Target Sequence (5 3) Mouse: CUUCGU C UUUGCG Rat: CUU UGU C UUUGC A IGF-1R Rz1 CGCAAA CUGAUGAGCCG UUCGCGGCGAAACGAAG Human: CUUCGU C UUUGC A Mouse: GUAUGU C UUCCAU Rat: GUAUGU C UUCCAU IGF-1R Rz2 AUGGAA CUGAUGAGCCG UUCGCGGCGAAACAUAC Human: GUAUGU C UUCCAU IR human GAAUCA CUGAUGAGCCG UUCGCGGCGAAACGUAA UUACGU C UGAUUC IR mouse AUUUCA CUGAUGAGCCG UUCGCGGCGAAACAAGC GCUUGU C UGAAAU Mouse: GGGUGU C UAUAGG VEGFR-1 CCUAUA CUGAUGAGCCG UUCGCGGCGAAACACCC Human: AGGUGU C UAU CAC VEGFR-2 ACAGAA CUGAUGAGCCG UUCGCGGCGAAACCAUG CAUGGU C UUCUGU Integrin 1 mouse CUUAUA CUGAUGAGCCG UUCGCGGCGAAACAUCU AGAUGU C UAUAAG Integrin 3 mouse CAUGAA CUGAUGAGCCG UUCGCGGCGAAACAUAG CUAUGU C UUCAUG Integrin 5 mouse GUGGCA CUGAUGAGCCG UUCGCGGCGAAACAGGA UCCUGU C UGCCAC Integrin v mouse AACUUG CUGAUGAGCCG UUCGCGGCGAAACCAUU AAUGGU C CAAGUU

PAGE 133

117 Some mRNA sequences shared significan t homology between species so the same ribozyme can target and cleave multiple specie s. Cleavage occurred on the 3 side of the boxed C and the ribozyme and target complime ntary sequences are underlined. The part of the target sequence that is not underlined did not base -pair with the ribozyme. The remainder of the ribozyme sequence formed th e catalytic core and stem II of ribozyme. In Vitro Testing of Ribozymes The first step in testing a ribozyme was to examine its in vitro cleavage activity. 13-base 32P-labeled RNA oligonucleotides were used as the cleavage ta rgets to examine the cleavage activity of the ribozymes. Time Course of Cleavage Time course of cleavage analysis gave the first indication of the level of catalytic activity of a ribozyme. To examine a ribozym es time course of cleavage, synthetic 13nucleotide-long target RNA oligonucle otides were 5-end-labeled with 32P and cleaved by ribozyme in vitro The 5 cleavage product was 7 nucleotides in length. Panel A in Figure 3.5 is the autoradiograph of a 10% polya crylamide-8M urea gel used to separate cleavage products of the hu man IR ribozyme on the human RNA target oligonucleotide. Panel B is the graphical represen tation of the data obtained by analysis of the gel in panel A using a PhosphorImage. The IR ribozyme had good catalytic activity since over 80% of the cleavable RNA oligonucleotide was cl eaved within 2 minutes. Notice, however, that only approximately 60% of the targ et RNA was cleaved in this reaction. The remaining target remained uncleaved presum ably due to a fraction of the ribozyme was misfolded and therefore inactiv e. Some of our other ribozy mes exhibited more complete cleavage reactions that could reach 90% to 100% cleavage of the ta rget oligonucleotide. The situation for this IR ribozyme was not unusual.

PAGE 134

118 Figure 3.5. Cleave time course of human IR ribozyme. Summary of Cleavage Time Course of Ribozymes0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0510152025303540 Time (minutes)Fraction of target cleaved IGF-1R IR VEGFR1 by R1 Rz VEGFR2 by R2 Rz VEGFR1 by R2 Rz VEGFR2 by R1 Rz alpha 1 alpha 3 alpha 5 alpha v Figure 3.6. Summary of time course s cleavage of the ribozymes generated in this study. Other ribozymes were test ed similarly and their time courses of cleavage are shown in Figure 3.6. For IGF-1R ribozyme, th e inactive forms were also tested. As expected, they did not show any cleavage ac tivity (data not shown). We tested VEGFR-1 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 051015202530 Time (minutes)Fraction of target cleaved Target 5 cleavage product IR Rz human 0 1 2 5 15 30 60 120 180 A B

PAGE 135

119 ribozyme on its own target and also the targ et of VEGFR-2 ribozyme. Similarly VEGFR2 ribozyme was also tested with both targ ets. Both VEGFR-1 and VEGFR-2 ribozymes showed high catalytic activity on their respec tive target RNA oligonucleotides. Over 90% of the target RNA oligonucleotides were cleav ed within 5 minutes. On the other hand, we did not see any cleavag e of the VEGFR-1 ribozyme on the VEGFR-2 target or of the VEGFR-2 ribozyme on the VEGFR-1 target. This demonstrated the specificity of these two ribozymes. The cleavage rates of integrin ribozymes varied from lower than 20% cleavage to around 90% cleavage within 10 minutes. Kinetic Analysis After the time course cleavage analysis, multi-turnover kinetic analysis was performed to determine the kinetic parameters (Vmax, Km, kcat). Figure 3.7 shows the saturation curve and the double-reciprocal plot of the human IR ribozyme kinetic analysis. The slope and intercep tion of the double-reci procal plot were used to determine the kinetic parameters. Saturation Curve0 20 40 60 80 100 120 140 05000100001500020000 Substrate (nM)Velocity (nM/min) y = 33.849x + 0.0278 R2 = 0.1361 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 0.20 -1.E-03-5.E-040.E+005.E-041.E-032.E-032.E-03 1/[S]1/v Figure 3.7. Multiple-turnover ki netic analysis of a human IR ribozyme. Table 3.2 summarizes the kinetic parameters (Vmax, Km, kcat) of the ribozymes.

PAGE 136

120 Table 3.2. Summary of ribozyme kinetic data. Ribozyme Vmax (nM/min) Km (M) kcat (min-1) IGF-1R Rz1 7.0.3 47.1.7 0.47.01 IGF-1R Rz2 2.8.60 1.8.1 0.2.04 IR 35.97 1217.59 2.39808 VEGFR-1 227.3.8 5.4.58 15.2.2 VEGFR-2 356.9.2 7.6.35 29.6.6 Integrin 1 57.05.7 25.6.0 3.8.3 Integrin 3 6.1.1 41.6.41 57.05.07 Integrin 5 322.6.6 81.1.2 21.5.8 Integrin v 33.4.7 5.2.2 2.2.2 Functional Analysis of Ribozymes in HRECs Following successful in vitro analysis of the ribozyme s, we cloned the ribozymes into the p21NewHp plasmid and transfected thes e plasmids into HRECs. This allowed for the determination of target mRNA levels, ta rget protein expressi on levels and for the testing of cellular activ ities related to normal HREC physio logical functions such as cell migration, cell proliferation a nd endothelial tube formation. Inhibition of mRNA Expression Messenger RNA was the target of a ribozyme thus mRNA levels were measured after transfection. As an example, IR mRNA levels are shown in Figure 3.8. The mRNA levels were determined using reverse tr anscription on isolated total cellular mRNA followed by real time PCR on the cDNA products w ith primer pairs specific for the target mRNAs. The levels of the target were normalized to -actin mRNA levels. The mRNA levels in mock-transfected cells were se t as 100%. Cells expressing the human IR ribozyme showed a signification reducti on of 42.4.1% in IR mRNA level ( P =0.014). The non-transfection or transformation with the p21NewHp vector showed no significant difference in IR mRNA levels compar ed to the mock-transfected cells ( P =0.35 for NT and P =0.16 for vector)

PAGE 137

121 Insulin Receptor Ribozyme0 20 40 60 80 100 120 NTMockVectorIR Rz% IR mRNA l evels relaive to beta actin Figure 3.8. Insulin receptor mRNA levels in HRECs. Table 3.3 summarizes the reduction in mRNA levels in HRECS after transfection with plasmids expressing the indicated ri bozymes. Inactive versions of the IGF-1R ribozyme 1 and 2 and the 1 integrin ribozyme were also tested. As expected, expression of these inactive ribozymes resulted in no reduction of target mRNA levels ( P >0.1, data not shown). Table 3.3. Reduction in target mRNA levels in HREC by the ribozymes. Ribozyme Reduction in mRNA levels P value RT-PCR method IGF-1R Rz1 39.5.1% 0.003 Relative Quantitative IGF-1R Rz2 12.7.7% 0.003 Relative Quantitative IR 42.4.4% 0.014 Real-time VEGFR-1 71.1.1% 0.0002 Real-time VEGFR-2 85.1.9% 0.0008 Real-time Integrin 1 32.4.0% <0.01 Relative Quantitative Protein Levels IR protein levels were also investigat ed after transfection of HRECs with the plasmids. The -subunit of the IR appeared in tw o bands (around 200 kDa and 90 kDa) as

PAGE 138

122 precursor and mature forms (Figure 3.9). Th e protein level in non-transfected HRECs was set to 100%. Vector-transfected cells s howed no significant reduction. Expression of the human IR ribozyme resulted in a reduction of 20.9.1% ( P =0.006) in IR protein levels. IR Ribozyme0 20 40 60 80 100 120 NTVectorIR Rz%IR protein levels relative to Cofili n Figure 3.9. Western analysis of IR levels in cells expressi ng the human IR ribozyme. While expression of inactive forms of the ribozymes resulted in no reduction in mRNA levels, there was a significant reducti on in protein levels (30.8.6% for inactive IGF-1R Rz1). This reduction resulted from th e antisense binding of the ribozyme to the target mRNA. VEGFR-1 and VEGFR-2 prot eins levels were measured by flow cytometry rather than western analysis. As expected, the VEGFR-1 ribozyme reduced both VEGFR-1 mRNA and prot ein levels and the VEGFR-2 ribozyme reduced both VEGFR-2 mRNA and protein levels. In a ddition the VEGFR-1 ribozyme reduced the levels of VEGFR-2 mRNA and protein and the VEGFR-2 riboz yme reduced the levels of VEGFR-1 mRNA and protein. Th ese results demonstrated that there is co-regulation between these two receptors.

PAGE 139

123 Table 3.4. Reduction in protein levels by the ribozymes. Ribozyme Reduction in protein levels P value IGF-1R Rz1 active 47.7.6% 5.4x10-5 IGF-1R Rz1 inactive 30.8.6% 4.6x10-5 IR 20.9.1% 0.006 VEGFR-1 R-1 protein: 66.7% R-2 protein:34.9% <0.01 VEGFR-2 R-1 protein: 15.4% R-2 protein:41.9% <0.01 VEGFR-1 + VEGFR-2 R-1 protein: 64.1% R-2 protein:27.9% <0.01 Migration Assays Figure 3.10 examines the ability of transf ected HRECs to migr ate in response to increasing concentrations of IGF-1. The cell migration was examined for HRECs transfected with the vector, or plasmids e xpressing the IGF-1R ri bozyme 1 or ribozyme 2, or the inactive ribozyme 1. Migration assa ys were performed in a modified Boyden chamber. The active IGF-1R ribozyme 1 and 2 demonstrated a reducti on in migration of approximately 91% and 58%, respectively. Inac tive ribozyme 1 also showed approximate 51% reduction in cell migrations. This re duction possibly resulted from antisense inhibition of the IGF-1R protein. The effect of the VEGFR-1 or VEGF R-2 ribozymes on migration was also examined (Figure 3.11). For these assays VEGF -E or placental growth factor (PlGF) was used to stimulate migration of HRECs. VE GF-E specifically binds to VEGFR-2 while PlGF specifically binds to VEGFR-1. The abil ity of HRECs, transfected with vector DNA, to migrate across a membrane to soluti ons containing either VEGF-E, PlGF or the heterodimer VEGF-E/PlGF was measured. HRECs expressing the VEGFR-1 ribozyme did not migrate toward PlGF, suggesting th at they lacked VEGFR-1. HRECs expressing the VEGFR-2 ribozyme did not migrate toward a VEGF-E suggesting that they lacked VEGFR-2.

PAGE 140

124 0 50 100 150 200 250 020406080100 IGF1 (ng/ml)Number of Migrating Cells/ High-Powered Field Control Inactive Rz1 Acitve Rz1 0 50 100 150 200 250 300 350 400 450 020406080100 IGF1 (ng/ml)Number of Migrating Cells/ High-Powered Field Control Active Rz2 Figure 3.10. HREC migration assa ys in response to IGF-1. 0 50 100 150 200 250 300 VectorVEGFR1 RzVEGFR2 Rz% Number of migrating cells per high power field VEGF-E PlGF VEGF-E/PlGF Figure 3.11. Effect of the VEGFR-1 and VE GFR-2 ribozymes on HREC migration. Cell Proliferation Assays Cell proliferation was measured by cellu lar incorporation of bromo-uridine (BrdU). Cells transfected with the vector or plasmids expressing the VEGFR-1 or

PAGE 141

125 VEGFR-2 ribozymes or the IGF-1R ribozym e were examined. Results are shown in Figure 3.12. The incorporation of BrdU in v ector-transfected cells was set to 100%. VEGFR-1 ribozyme expression redu ced incorporation by 42.7.5% ( P =5.1x10-4), VEGFR-2 ribozyme expression redu ced incorporation by 50.25.9% ( P =1.3x10-5), and IGF-1R ribozyme expression re duced incorporation by 83.7.7% ( P =6.8x10-7). Ribozymes Inhibit BrdU Incorporation 0 20 40 60 80 100 120 140 MockVectorVEGFR1 RzVEGFR2 RzIGF-1R Rz% BdrU invorporation (RFU ) Figure 3.12. Effect of ribozyme e xpression on cell proliferation. Tube Formation Assays The ability of HRECs to form tubes on Matrigel is anothe r basic function of endothelial cells. HRECs woul d form honeycomb-like structur es consisting endothelial tubes naturally when cultured on Matrigel. Wh en cells were transfected with the plasmid expressing the IGF-1R ribozyme, or the VE GFR-1 ribozyme or the VEGFR-2 ribozyme; tube formation was completely inhibited (Figure 3.13). The empty vector transfected cells were used as the control.

PAGE 142

126 Figure 3.13. Effect of ribozymes on HREC tube formation. In Vivo Analysis of Ribozymes The in vivo effects of the ribozymes were examined in the mouse model of oxygen-induced retinopathy (OIR). Figure 3.14 is a cross section of mouse pup eye, stained with H&E, from the OIR model. All major anatomical parts of the eye are shown in this figure. Pre-retinal blood vessels (green arrows) grew beyond the retinal inner limiting membrane into the vitreous space. They are the representation of abnormal neovascularization. The measure of aberrant neovascularization was determined by the average number of pre-retinal blood vessel nuclei per section.

PAGE 143

127 Figure 3.14. Cross section of a mouse eye showing pre-retinal vessels. IR Ribozyme Tested in OIR Mouse Model0 20 40 60 80 100 120 140 Control IR RzIGF-1R RzCombo Rzs% Average Nuclei per Section Figure 3.15. Ribozyme reduction of pre-retinal neovasculariza tion in the OIR model. Table 3.5 summarizes the results of the OI R mouse model assays on all ribozymes tested. Rows separated by solid lines ar e different groups of mice and dotted lines separate different test litter s in the same group. Inactive ri bozymes led to reductions in pre-retinal neovascularization to some extent. However, the reduction found with inactive

PAGE 144

128 IGF-1R ribozyme 1 and 2 were mi nimal or close to significant ( P <0.05 is considered significant), while the reductions resulted from inactive Integrin ribozymes were significant. Table 3.5. All ribozymes tested in vivo Ribozyme Reduction in average nuclei per section P value IGF-1R Rz1 active 64.7.6% 2.7x10-5 IGF-1R Rz1 inactive 17.3.1% 0.03 IGF-1R Rz2 active 51.7.2% 2.3x10-5 IGF-1R Rz2 inactive 10.1.8% 0.09 VEGFR-1 47.0.0% 5.3x10-4 VEGFR-2 75.5.0% 7.5x10-8 Integrin 1 active 88.8.4% 5.44x10-7 Integrin 1 inactive 46.2.3% 1.7x10-3 Integrin 3 active 83.5.0% 1.31x10-5 Integrin 3 inactive 63.7.7% 1.2x10-4 IR 34.0.3% 8.36x10-7 IGF-1R 42.0.1% 1.66x10-8 IR + IGF-1R (Combo) 36.6.0% 1.27x10-4 Promoter Development The expression of ribozymes cloned into the p21NewHp vector was driven by the CMV enhancer/chicken -actin promoter. This promis cuous enhancer/promoter was active in numerous cell lines a nd under a variety of physiologi cal states. Thus, using this promoter could be a problem since it will result in the expression of the ribozymes in multiple cell types and tissues. The targets of our ribozyme were physiologically required for normal retinal development and function. We only wanted to inhibit the abnormal expression of the target proteins while l eaving normal expression alone. But ubiquitous ribozyme expression could lead to the oblat ion of all normal and abnormal expression and lead to adverse effects. This was observed with the integrin ribozymes.

PAGE 145

129 Integrin Ribozyme Expression in vivo with the CMV/ -actin Enhancer Promoter As detailed in the introdu ction the various integrin dimers are very important for cell adhesion and migration and they play essential roles in normal eye development. We observed severe structural abnormalities in the eye in the OIR mouse model after injection of plasmids expressing ribozymes to the 1 and the 3 subunits of integrin. Figure 3.16. Reduction of pre-retin al neovascularization in the OIR mouse model with expression of the 1 or 3 integrin ribozymes. The 1 and 3 ribozymes significantly reduced the amount of pre-retinal neovascularization in the OIR m ouse model (Figure 3.16). Active 1 and 3 ribozymes resulted in 88.8.4% ( P =5.44x10-7) and 83.5.0% ( P =1.31x10-5) reduction in preretinal neovascularization, respectively. Their inactive forms resulted in a less signification reduction, 46.2.3% ( P =1.7x10-3) for inactive 1 ribozyme and 63.7.7% ( P =1.2x10-4) for inactive 3 ribozyme. These reductions with active or inactive ribozymes were much greater than a ny other ribozymes we tested in the same Integrin Ribzoymes Tested in OIR Mouse Model 0 20 40 60 80 100 120% Average Nuclei per Section Control 1 Rz Active 1 Rz Inactive 3 Rz Active 3 Rz Inactive

PAGE 146

130 mouse model. We also found that even the inactive versions of these two ribozymes could cause structural abnormalities in the developing eye due to antisense inhibition. Figure 3.17. Expression of 1 ribozyme in OIR model results in severe deformations of the eye. Figure 3.17 shows cross sections of a normal uninjected eye and of eyes expressing the integrin ribozymes. Overall the injected eyes showed a number of abnormalities, such as lens separation, retina detachment and closed iris. In addition the injected eyes were smaller than the unin jected eyes (although it is not unusual for intravitreal injection to affect eye size). While integrin ribozyme reduced neovascularization, these integrin ribozyme s also significantly inhibited the normal

PAGE 147

131 development of the eye. It is so interesti ng that the antisense e ffect of the inactive ribozymes was powerful enough to interfere with the developmental process. Due to the severity of deformation found with the CMV expression of the integrin ribozymes, we decided to use a proliferati ng endothelial cell specific pr omoter for integrin ribozyme expression. The Proliferating Endothelial Cell-Specific Promoter To overcome potential expre ssion problems with the CMV/ -actin promoter, we cloned and tested our ribozyme s in a vector that had a pr oliferating endothelial cellspecific promoter. Dr. Sullivan designed and constructed this promoter. Using this promoter, we were hoping to only target prolif erating endothe lial cells while not affecting the quiescent endothelial cells in the developed vasculature and any other cells in the retina. Figure 3.18. pLUC1297/1298 vectors and pLUC1297HHHP/1298HHHP clones Dr. Sullivan tested a number of enhan cers and promoters and eventually found that the combination of endothelin enhancer/c dc6 promoter provided the best specificity

PAGE 148

132 to endothelial cells. Endothelin (ET or ET-1), which is exclusively synthesized by vascular endothelium, is one of the most powerful vasoconstrictors known. Cdc6 is a 30,000-dalton protein essential for the init iation of DNA replication. This protein functions as a regulator at th e early steps of DNA replication. It is thought to be involved in the assembly of minichromosome main tenance proteins onto replicating DNA. It localizes in the cell nuc leus during cell cycle G1, but translocates to the cytoplasm at the start of S phase. Quiescent cells in G0 do not express this protein. Therefore in this specific vector, ET enhancer determined the expression specificity in endothelial cells and cdc6 promoter further narrowed the specif icity into proliferating endothelial cells. Dr. Sullivan produced two specific promoters, both of which had the cdc6 promoter. One vector had a 4X multimer of the ET enhancer, designated pLUC1297, and the other vector had 7X multimer of the ET enhancer, designated pLUC1298. The structure of these promoters is shown in Fi gure 3.18. Downstream of cdc6 promoter was a luciferase reporter gene followed by Poly A signal. The IGF-1R ribozyme was cloned and these two vectors followed by a self-cle aving hairpin ribozyme that generated a discrete 3-end to the run-off transc ript. (pLUC1297HHHP and pLUC1298HHHP). The four plasmids, pLUC1297, pLUC1298, pLUC1297HHHP and pLUC1298HHHP, were transfected into HRECs and fibroblast cells to examine the cellspecific expression of luciferase. We tested the expression in two fibroblast cell lines, shown as F1 and F2 in Figure 3.19, and in HR ECs from two different donors, shown as HREC 10 (ten-year-old donor) and HREC 14 (fourteen-year-old donor) in Figure 3.19. pLUC1297 and pLUC1298 showed high levels of luciferase expression in HRECs compared with fibroblasts (about 200 times higher in HREC 10). Similarly

PAGE 149

133 pLUC1297HHHP and pLUC1298HHHP also showed higher levels of luciferase in HRECs compared with fibroblasts (about 20 times higher in HREC 10). Luciferase expression was higher in HREC 10 than in HREC 14, which probably resulted from a difference in the donor cells. When co mparing pLUC1297HHHP with pLUC1297, or pLUC1298HHHP with pLUC1298, we found that th e ribozyme-inserted constructs had much lower luciferase expression level than th eir parent constructs. This is probably due to the loss of the PolyA signal in the plasmids. 0.0E+00 5.0E+05 1.0E+06 1.5E+06 2.0E+06NTpLUC1297pLUC1298pLUC1297 HHHPpLUC1 298HHHpLuciferase Activity RFU (% relative to NT) F1 F2 HREC 10 HREC 14 Figure 3.19. Verification of the cell specificity of the pro liferating endo thelial cellspecific enhancer/promoter. The New Promoter Tested in vivo We tested the pLUC1298HHHP construc t in the OIR mouse model. Figure 3.20 shows confocal images of eyes from these e xperiments. OS (left ey es) were un-injected eyes and OD (right eyes) were injected eyes. The vessels were labeled with endothelial cell specific agglutinin conjugated with r hodamine, and luciferase expression was

PAGE 150

134 immunofluorescently shown in green by secondary antibody. Un injected eyes (panels A and C) showed background green fluorescence, while the injected eyes (panels B, D, E and F) showed expression of luciferase onl y on the vasculature (green and yellow ). The magnifications of panel E and F were 400x, and panel F was showing greater detail of the boxed part in panel D. When comparing pa nel C and D (magnificat ion 200x), there was a greater density of abnormal, small, blood vesse ls evident in the uninjected eye (panel C) while the injected eye (panel D) showed a lower density of blood vessels on the retina. This suggests that the IGF-1R ribozyme wa s actively expressed and was reducing preretinal neovascularization. This was confirme d by examining H&E stained cross sections that quantitatively showed a reduction in pre-re tinal neovascularization in injected eye as detailed below. Figure 3.21 shows the results of the OI R mouse model injections with the proliferating endothelial cell-sp ecific constructs. Blue bars are injected eyes and brown bars are uninjected eyes. There were five groups of mice, injected with pLUC1297, pLUC1298, pLUC1297HHHP, pLUC1298HHHP pGE1298HHHP respectively. pGE1298HHHP had the same structure as pLUC1298HHHP except that the luciferase reporter gene was eliminated. Uninjected eyes from all groups were averaged together and the average nuclei number was set as 100%. The eyes injected with pLUC1297 and pLUC1298, compared with uninjected eyes, show ed no significant difference as expected ( P =0.47, 0.37, respectively). The eyes injected with the ribozyme-expressing constructs showed significant reduction in pre-retinal neovascularization. pLUC1297HHHP showed 48% ( P =3.58x10-7) reduction; pLC1298HHHP showed 54% ( P =1.46x10-4) reduction; and pGE1298HHH P showed 59% (P=2.89x10-10) reduction.

PAGE 151

135 Figure 3.20. The proliferating e ndothelial cell -specific promoter limits expression of luciferase to the actively prolifera ting blood vessels in the OIR model.

PAGE 152

136 Figure 3.21. Quantitative assessment of the IGF1R ribozymes ability to inhibit preretinal neovascularization when expressed from the promoter. Figure 3.22. New promoter tested in adult mouse model of laser-induced neovascularization.

PAGE 153

137 The proliferating endothelial cell specific constructs were also tested in an adult mouse model of laser-induced neovasculariza tion. The eyes from adult mouse were also stained with endothelial cell specific agglutinin conjugated with rhodamine (red) and a secondary antibody bound to luciferase (gr een). A video clip was made from the animation of a stack of pictur es (400x) focused at same hor izontal position but different vertical levels, about 1m apart between leve ls, taken using a confo cal microscope. Panel A in Figure 3.22 is a snapshot of the clip. A z-projection view of the same vessel was made using imageJ and Panel B is a snapshot of the z-projection view. The green staining was not seen in the interstitia l space outside vasculature, but was colocalized with blood vessels (yellow color for colocalization). Also the green staining was in cell-like shape aligned on vessel walls, which indicated the lu ciferase expression o ccurred in endothelial cells in these small vessels. For a better view of the colocalizations, please see the supplementary movie clips. Object 3.1. A blood vessel from the adult mouse model shows the luciferase expression is specific for prolifera ting endothelial cells. Object 3.2. The 3-D view of the blood vessel from the adult mouse model. Figure 3.23. The expression of the IGF-1R ri bozyme from the new promoter reduced aberrant blood vessel formati on in the adult laser model.

PAGE 154

138 We also perfused retina from the adult mouse model with rhodamine-labeled dextran to examine the state of the vasculat ure on the retina (Figure 3.23). The left panel showed the normal vasculature with no abnor mal (leaky) neovascularization. The middle panel is the eye that had neovascularization i nduced by laser treatment, also injected with empty vector pLUC1298. The hazy areas indica ted the leaky small vessel resulting from the abnormal neovascularization. The right pane l is the eye treated by laser but injected with pLUC1298HHHP, the IGF-1R ribozyme expressing construct. Compared with normal retina we can still see some hazy ar eas but there were much less of them in quantity and the size of leaky areas than pLUC 1298-injected eye. Th is indicated the IGF1R ribozyme inhibited la ser-induced neovasculari zation to some extent. The New Promoter Tested with Integrin Ribozyme The proliferating endothelial cell specif ic promoter was used to express the integrin ribozymes in vivo Five mouse pups were injected with the plasmid in one eye on day 1 of the OIR mouse model as usual. The eye sections are shown in Figure 3.24. Eye A in Figure 3.24 is the section of an uninjected eye. Eyes B, C, D, E and F are sections from injected eyes. Many abnorma lities still existed, such as smaller size in some injected eyes (especially eyes C a nd D), detached retina from choroid, unusual folding in the retina. Noneth eless, compared with CMV/ -actin-driven expression of the integrin ribozymes, much less eye deformati on resulted. The lens in the injected eyes were normal. With the CMV/ -actin promoter no open iris was found on any cross sections. Now, most eyes have an open iris Eye D also had an open iris but the section shown was too close to the cornea/iris boundary to see the pupil. Eye E looked no difference with a normal eye.

PAGE 155

139 Figure 3.24. Expression of integrin ribozyme driven by proliferat ing endothelial cellspecific promoter resulted in less eye deformation.

PAGE 156

140 Figure 3.25. Proliferating endot helial cell specific promoter with integrin ribozyme tested in OIR model The neovascularization quantification re sults showed different levels of reductions in the injected eyes (24.3 17.1% to 91.4.9% as shown in Figure 3.25). Interesting, the most deformed eye (eye C) showed greatest reduction, while the most normal eye (eye E) showed least reduction.

PAGE 157

141 CHAPTER 4 DISCUSSION This project involved developing multiple ribozymes and testing them in vitro and/or in vivo Our primary focus was to use these ri bozymes to inhibit the expression of proteins that play important roles in the a bnormal retinal neovascularization. A number of proteins were chosen as our targets in this study, in cluding IGF-1R, IR, VEGFR-1, VEGFR-2, and integrins. They have differe nt functions but are all important for endothelial cell physiology such as proliferation and migrati on, which are essential in the development of neovascularization. The developing the testing steps were sim ilar to all these ribozymes. We selected target sites in protein gene sequence, designe d the ribozyme accordingl y, tested cleavage reactivity in vitro transfected and functionally analy zed ribozymes in HRECs regarding mRNA levels, protein levels, physiological func tions of HRECs, and eventually tested in mouse models in vivo Ribozyme Testing Results and Antisense Effect All of these ribozymes have been sh own to have cleavage reactivity and can reduce the expression of target proteins. All th e testing results have been summarized in tables in the previous chapter. Taking IGF-1R ribozyme 1 as an example, more than 90% of the target RNA oligos were cleaved within the first 2 minutes in the cleavage time course study, indicating the ri bozyme was highly catalytically active. After HRECs were transfected with the IGF-1R ribozyme, mRNA levels for IGF1-R were reduced by about 40% compared with vector-transfected cells, and the inactive version did not result in any

PAGE 158

142 significant reduction. The IGF-1R ribozyme decr eased protein expression by 48% and the inactive version also decreased the protein expression about 31%. This decrease with inactive ribozyme treatment may have been caused by its antisense effect, in which the catalytic-deficient ribozyme cannot cleave th e mRNA but still complimentarily binds to target site and physically blocks translation. This effect was not unexpected to exist in studies that involve pr otein expression and function. For example, in the migration study, we observed 91% reduction in the cells ability to migrate with active IGF-1R transfection and 58% reduction with inactive IGF-1R transf ection, not surprising for the active version. IGF-1R ribozymes 1 and 2 induced 65% and 52% reductions in the pre-retinal neovascularization levels. Th eir inactive forms also resulted in reductions; these reductions are minimal or close to significant ( P =0.03, P =0.09, respectively), so there was minimal antisense effect in the in vivo test. This is not consistent with in vitro studies in HRECs but our explanations are: 1) A threshold must be achieved in the reduction of protein expression to see a re duction in functional analysis. The threshold may differ in different species and vary with methods of assay. 2) The number of IGF-1R proteins differs substantially in different situati ons including but not limited to species, cell phases, study conditions ( in vitro vs. in vivo ), and so on. According to Rubini et al. [355], taking mouse fibroblasts as a reference, cells in proliferation have more than 30,000 IGF1R proteins per cell while quiescent cells only have 15,000 to 20,000 IGF-1R proteins. In our studies, most in vitro experiments were done with confluent cultured cells, but in vivo experiments were done in developing retinas. So the antisense effect might have been diluted in the mouse model. However th e active ribozymes still resulted in

PAGE 159

143 neovascularization reductions in that they can completely cleave and oblate the protein functions versus possibly partial function i nhibition with inactive ribozymes blockade. More importantly, the active ribozyme has cataly tic ability so it can process much more proteins than inactive version to phy sically block in a 1:1 molar ratio. VEGFR-1 and VEGFR-2 Interactions In the traditional view, VEGFR-1 functions as a decoy receptor and negatively regulates VEGFR-2 signaling. This is basi cally accomplished by VEGFR-1 acting as a sink, binding VEGF ligand, and preventing activation of VEGFR-2. However, some recent data indicate that the kinase activity of VEGFR-1 plays an essential role during pathological angiogenesis and in wound healing, by potentiati ng VEGFR-2 signaling [100, 356, 357]. It has been accepted that th ere is cross talk between VEGFR-1 and VEGF-R2 signaling. PI3 kinase [356] and nitr ic oxide [358]have been proposed to be involved in VEGFR-1 regulat ion of VEGFR-2. In our studies, we showed that transfection of HRECs with the VEGFR1 ribozyme down-regulated theVEGFR-2 mRNA. On the other hand, th e transfection of HRECs with VEGFR-2 ribozyme also downregulated VEGFR-1 mRNA. This is a fu rther support of intraand inter-molecular cross talk between the two receptors. In the OIR mouse model, the VEGFR-1 and VEGFR-2 ribozymes both significantly reduced pre-retinal neovascularization, by 47% and 75%, respectively. The inhibition on VEGF R-2 inhibited neovascularization to a greater extent, which is consistent with the major role of VEGFR-2 in promoting endothelial cell proliferati on, migration and therefore a ngiogenesis, even though the interactions between VEGFR-1 and VEGFR2 exist. Another recognized role for VEGFR-1 kinase activity is its capability of recruiting hematopoietic stem cells from bone marrow precursors [105, 359]. It is possibl e that the decrease in neovascularization

PAGE 160

144 found from blocking of VEGFR1 signaling may affect stem cell involvement. In one study, a chimeric protein containing both the VEGF binding domains of VEGFR-1 and VEGFR-2 was constructed and expressed in a murine model of ischemic retinopathy. A single intravitreal injection the chimeric protein resulted in a >90% reduction of retinal neovascularization compared w ith control eyes [360]. This suggested that a combined targeting of VEGFR-1 and VE GFR-2 may bring about a deep er reduction in retinal neovascularization than either receptor alone A ribozyme that can target both receptors or an administration of both ribo zymes together could be tested. Besides the interactions inside VEGF system, IGF-1 may also crosstalk with VEGF signaling. We have shown that intravitrea l injections of IGF -I result in an acute increase in vascular permeability and vascul ar engorgement, followed by development of pre-retinal angiogenesis in rabbit eyes [361] In addition, IGF-1 production by HRECs, in turn, stimulates increased VE GF production [217] and visa versa [362]. It was also reported that elevated IGF-1 levels in vivo resulted in an increase in VEGF gene expression. Considering that VEGF and IGF-1 and their receptors can all be expressed by HRECs and both these growth factors have autocrine and paracrine function, it is reasonably to propose that the interaction be tween these signaling systems do exist and a better picture of their involvement in pre-retinal neovasc ularization should include their interactions. Apart from endothelial cells VEGF and its receptors ar e expressed in many other cell types, such as inflammatory cells [363] VEGF may function in an autocrine fashion on these cells. Unlike diabetic retinopathy, the ischemia-induced retinopathy was thought to be inflammatory-free; however, it is now known that inflammatory cells are involved

PAGE 161

145 [364]. These inflammatory cells may participat e in the processes of blood-retinal barrier breakdown and neovascularization [115]. Th e plasmid expressing VEGF receptor ribozymes has a CMV/ -actin promoter and does not excl usively target endothelial cells, so it is possible that the inhibition of VEGF signaling on other cell t ypes also contributed to the overall outcome of neovascularization reduction. The Proliferating Endothelial Cell Specific Promoters Expression of the IGF-1 ribozyme by the promiscuous CMV/ -actin promoter did not result in eye deformation like the inte grin ribozymes. However, IGF-1 and its receptor still play a major role in vascular development of both mouse and human eyes, thus the indiscriminant loss of IGF-IR coul d result in altered vascular development and propagate the ischemia observed in ROP infa nts or OIR mice [365]. Therefore, we also used the cell specific promoter to express the IGF-1R ribozyme in vitro and in vivo Our results demonstrated that the cell specific promoter limited expr ession to HRECs and no expression in fibroblasts. Our in vivo results also showed that the new cell specific promoter is active in the rapidly dividing vasculature of the eye. During construction of the new IGF-1R ribozyme plasmid, it was observed that ligation of the IGF-IR hammerhead ribozyme and the hairpin ribozyme caused the endothelin enhancers to be dele ted in several strains of bact eria, DH5, Stable 2s and Top Tens [365]. However, when placed at th e 3 end of the luciferase gene, the hammerhead/hairpin ribozyme insertion did not cause the deleti on of the endothelin enhancer. Thus the luciferase gene was also playing a role in stabilizing the construct. The insertion of the ribozymes made the vector lose the PolyA tail, which affected the stability of the transcript and reduced the expression levels of lu ciferase and IGF-1R

PAGE 162

146 ribozyme. This was confirmed in vitro in HRECs (Figure 3.17). The luciferase expression from these two plasmids was lower than their parent vectors (pLUC1297, pLUC1298). The in vivo study showed that the lucifera se expression fr om pLUC1298HHHP was exclusive limited to proliferating endotheli al cells. The colocaliz ation of luciferase and proliferating endothelia l cells was observed both in the OIR mouse model and the adult mouse model of laser-induced neovascul arization. However, the reduction of preretinal neovascularization from pLUC1298HHHP (54%) we re comparable with the reduction found with IGF-1R ribozyme driven by CMV/ -actin promoter (65%). In addition, expression of the IGF-1R riboz yme from the plasmid pGE1298HHHP, a modified version of pLUC1298HHHP with the de letion of luciferase gene, resulted in 59% reduction in pre-retina l neovascularization. Therefore the luciferase gene did not affect the expression of ribozymes. It is known that systemic administration of plasmid DNA alone by hydrodynamic administration results in initial high levels of expression 24hrs after injection and decreases to 7% of the peak value by day 10 [366, 367]. In our experiments, the luciferase expression and ribozyme activity wa s observed 17 days after administration in OIR model and 21 days after administration in adult mouse model. It is worth mentioning that the expression of luciferase, and by exte nsion of the IGF-1R ribozyme, from naked plasmid in OIR model or formulated plasmid in the adult mouse model exhibited significant expression th rough the time courses of the experiments. The idea of introducing a promoter that is specific for prolif erating endothelial cells originated from the integrin ribozyme in vivo study, since the ubiquitous knockdown of integrin resulted in severe eye deforma tion in the OIR mouse model. The expression of

PAGE 163

147 the same integrin ribozyme (against integrin 1 subunit) driven by the specific promoter showed much fewer problems. However, the de formations were still significant. But due to the specificity of the promoter, these deformations must result from affecting endothelial cells at the rapidl y proliferating vasculature of the eye. Even though decreases in abnormal neovascularization were found w ith the cell specific promoter, further refinement of the promoter, if possible, is required when e xpressing the integrin ribozymes. These problems, found with the integrin ribozymes result from the roles of the 1 integrin subunit in numerous processe s including their direct involvement in angiogenesis. These problems were not f ound with the IGF-1R ri bozyme with either promoter type due to the limited function of th is receptor in the developing vasculature of the eye. Therefore, while study of the integr in ribozyme will be useful from functional and developmental points of view, the use of integrins as therapeutic targets probably has limited or little value in the developing eye. Other Voices on Neovascularization in Diabetic Retinopathy As summarized earlier in the introducti on chapter, there is a tendency to propose that the abnormal neovascularization in diab etic retinopathy is the chronic pathological consequence of hypoxia in the retina. Howe ver, oxygen is the not the only nutrient supplied through blood vessels. Clinically the retinal angiography of diabetic re tinopathy patients shows nonperfused capillaries [368], whic h is indicating that hypoxia taki ng effect. It has also been reported that hyperoxia improved contrast sensitivity in early diabetic retinopathy [369] and that the supplemental oxygen improved di abetic macular edema [370]. However no studies have directly demonstrated reducti on of retinal oxygen levels in humans with diabetes compared with cont rols [368]. In the animal st udies, there was no significant

PAGE 164

148 difference in the pre-retina l oxygenation found between the cats [371] and dogs [372] within 1 year of diabetic ons et and the controls. But in th e long-term study, one group has reported that the retinal oxygen partial pressu re was reduced in cats with 6-8 years of diabetes [373]. Despite the direct eviden ce in the long-term cat study, most other supporting data of hypoxia are based on the overexpression of gr owth factors that are regulated by HIF, such as VEGF and PDGF. Even HIF activity was increased in diabetic rats [374], it is not necessary that the increases in growth factor levels are di rectly linked to HIF. In the diabetic retinas, besides the vascular cells, many other cell types are affected or harmed, including neurons, glial cells and microglial ce lls [375]. It is possible that the need to maintain neuron-dependent vision motivates an giogenesis to compensate for the nutrient deficiency in the neural retina In detail, VEGF could increas e initially to provide trophic support to neurons through VEGF receptors, but at the cost of increased vascular permeability [368]. The physiological compen sation response could convert into a pathological one in a chronic stress situation, and eventually lead to neovascularization and edema due to vascular leakage. One common problem in hypoxic and nut rition deficient cel ls is endoplasmic reticulum (ER) stress. ER stress can influe nce VEGF and PEGF expression levels [376] and thus affect the balance between cell su rvival and death signals. So it is not unreasonable to hypothesize that ER stress could be a potential target in the treatment of neovascular diabetic retinopathy. Final Words on RNA Silencing We used hammerhead ribozymes as a tool to inhibit gene expression. Ribozymes are only one category of RNA silencing tec hnologies. Gene silencing with antisense

PAGE 165

149 oligonucleotides is the earliest discovered and utilized, the easiest to design and has no target sequence requirement other than ta rget accessibility. Bu t, one significant disadvantage is that antisense oligonucleotides function in a 1:1 molar ratio with target mRNAs. This means a significant reduction in translation level may not be achieved without a fairly large amount of antisense oligonucleotides. Ribozymes, however, can catalyze the cleavage of target mRNAs and w ill be recycled and reused again, thus the dose of the RNA silencing agents can be si gnificantly reduced. However, the sequence requirement for ribozymes is the major obsta cle in the developmen t into convenient RNA silencing tools. RNAi, an endogenous and ubiquitous pathway, doesnt have much sequence requirement on targets. RNAi has othe r advantages such as ease of design, ease of synthesis and high specificity. Silencing w ith RNAi has been reported to exceed what can be achieved by antisense oligonucleotide s or ribozymes [377, 378]. In one head-tohead comparison, it has been shown th at siRNAs knocked down gene expression hundreds of time more efficiently than antis ense oligonucleotides [379]. RNAi is an attractive alternative as the ge ne silencing tool in my study. The antisense oligonucleotides have been studied intensively for the longest time and the first antisense DNA agent is now on th e market in the USA and Europe. However its mechanism is still not without contr oversy and it has been proposed that the therapeutic outcome could be a result of the CpG presence and the consequent immune stimulation in some cell types [380]. Two clinic al trials using ribozymes in gene therapy are in progress, in which retr oviral vectors, which express ribozymes targeting sequences in human HIV-1 RNA, are transduced in CD4 lymphocytes or CD34 hematopoietic precursors [381, 382]. Just three years after RNAi was shown to work in mammalian

PAGE 166

150 cells, the first Phase I clinical trials using R NAi have started in which RNAi is used to target the VEGF angiogenic pathway in ARMD patients. No evidence for clinical toxicity or disease progression has been shown in th ese studies conducted by Sirna Therapeutics [292]. These studies indicate that RNA silenc ing tools, especially ribozymes and RNAi, have a great potential to be used as therapeutic agents. New ribozyme types have been discove red. One recent repo rt indicated the existence of a metalolite-respons ive ribozyme in the mRNA of glm S, the Bacillus subtilis gene that encodes flucosamine frustose -6-phosphate aminotransferase [383]. The cleavage product is terminated by a cyclic 2-3 phosphate, very similar to the products of other self cleaving ribozymes, s uggesting that the transesterif ication reaction involves the nucleophilic attack from the 2 -oxygen. In another report, an element in the 3-flanking region of human -globin mRNA has been found that self cleaves [384]. The cleavage site is contained within a re gion that shows some similarity to the hammerhead ribozyme; however the 3-hydroxyl and 5-phosphate te rmini generated in the cleavage reaction imply a different mechanism of cleaving from other self cleaving ribozymes. As mentioned above, an HIV-directed hammerhead ribozyme has been tested in patients to exploit its ability to inhibit HIV replication [385]. The clinical trial is performed in ex vivo in which the peripheral blood T lymphocytes obtained from the HIV-infected patients are transduced with a retroviral vector coding a hammerhead ribozyme against HIV RNA expression. The tran sduced lymphocytes are injected back into HIV patients. The results showed that th e infusion of gene-altered, activated T-cells is safe, that the transduced cells persist fo r long intervals and the possible patient longterm survival resulting from the transduced cells [385]. In another study targeted against

PAGE 167

151 hepatitis C virus (HCV) replication, six hamme rhead ribozymes were designed that are targeted a conserved region of the plus and minus strands of the HCV genome and were expressed using recombinant adenovirus vector s. Testing in primary hepatocytes obtained from HCV-infected patients showed a benefici al antiviral effect of the ribozymes, and when used together with type 1 interferon, th e replication of HCV-po livirus (PV) chimera was inhibited up to 98% [386]. In anothe r study, synthetic and modified hammerhead ribozymes targeting 15 conserved sites at th e 5-untranslated region of HCV RNA were also tested for knock-down efficiency a nd stability [387], and a significant reduction (40%-90%) in gene expression of a reporter gene following the 5 untranslated region was observed [387]. Ribozymes targeted agains t hepatitis B virus (HBV) has also been proposed [388]. Modified hepatitis delta virus has been used to target HBV virus through its natural tropism to hepatocytes and the result of transgene de livery was positive [389, 390]. In cancer therapy, fusion proteins have been suggested as a target for ribozymes. The fusion proteins are expressed from ch imeric genes resulting from abnormal chromosomal translocations, which shuffle th at translocated exons and produce chimeric mRNAs [388]. These are tumor-specific chro mosomal abnormalities and only exist in the tumor cells [391], thus they provide a tumor cell-specific target and the normal cells are not targeted. These type of stra tegies could help to increase the effectiveness of current cancer treatments. In this study the in vivo application of the ribozymes required sufficient expression and stability of the ribozymes to survive the time course of the two animal models. The CMV/ -actin promoter produced qualitat ive expression of a GFP reporter gene beginning on day P11 of the mouse OIR model and extended beyond day P17 (data

PAGE 168

152 not shown). Thus it is expected that the hammerhead ribozy mes are also expressed in a similar manner and can meet the timeframe demand for expression in OIR mouse model. It has been reported that synt hetic siRNA, transfected into human cells, show an optimal effect around 24 hours and the RNAi starts to diminish in 4-7 days [392]. So if we use synthetic RNAs (either ribozymes or siRNAs ) as the gene silencing tool in the OIR mouse model, the synthetic siRNA will probably not last through the 17-day time course of the experiment. However, a vector e xpressing shRNA, similar to our ribozyme expression vectors, could be used. In one study, the AAVcloned shRNA introduced in mouse brain started to silence its target in 4-6 days and the silencing phenotype (Parkinsons disease) reached its peak ar ound two weeks and persisted for nearly two months [393]. Therefore it is probable that vector-expressed shRNAs could be successfully used in the OI R mouse model or even the adult mouse model of laserinduced retinal neovascularization, where the experiment termination is 3-4 weeks after injection. In our in vitro tests of the ribozymes, the ribozyme effects were determined by assaying both mRNA and protein levels us ing relative quantitative RT-PCR, real-time RT-PCR, western analysis and flow cytometry. We assume the transfection efficiency is consistent throughout all expe riments thus did not measur e it every time. However, variations may occur. Cell death resulting fr om transfections could also happen, which may not be the same for the transfection of empty vector, mock transfection, or ribozyme transfection. The normalization with living cell numbers may be useful in a fined measurement of reduced mRNA or proteins levels. In another aspect, the targeted protein could have a relative long half -life thus a modest drop in pr otein expression might not be

PAGE 169

153 seen in a short-period of time post-transf ection. Cullen suggested approach of the introduction of an expression plasmid encodi ng an epitope-tagged form of the target protein [303]. A western blotting using the an tibody against the epitope will be performed to measure the gene silencing effectiveness. In this way, the co-transfection efficiency is technically 100% same for silencing agents and the targets and protein half-life is not an issue any more. The construction of the epitope -tagged form of the targeted protein is laborious and time-consuming; however, this approach could give us an accurate measurement on the effectiveness of the silencin g agents. This is especially important in selecting a best-effective silencing agent for therapeutic purpose. The eye is an ideal target organ for gene therapy, in that it has relatively isolated compartment so that the local delivery of exogenous genes to the eye limits exposure to the rest of the body and reduces the dose. Sim ilar to our injection of ribozymes into the eye, siRNAs have also been injected into th e eye intravitreally and were readily diffused throughout the eye and detectable for at leas t five days [394]. VEGF and its receptors have been attractive targets in RNAi in vivo studies in the eye so far. In one study, hVEGF cDNA, expressed by an adenoviral vector, was subretinally inje cted in both eyes of mice. This was coupled with an siRNA ta rgeting against hVEGF mRNA in one eye, or siRNA targeting against GFP mRNA in the other eye. It was showed that eye injected with hVEGF siRNA had significantly less expr ession of hVEGF comp ared with the GFP siRNA control [395]. In the mouse model of CNV induced by laser photocoagulation, the area of CNV at sites of rupture of Bruchs membrane was significantly less in the eyes that were subretinally inject ed with mVEGF siRNA, compared with GFP siRNA controls [168]. These results directly lead to phase I clinical trials of si RNA against VEGF mRNA

PAGE 170

154 in ARMD patients with subfoveal CNV. In th e studies for corneal neovascularization, a systemic administration of siRNAs agai nst VEGF-A, VEGFR-1, or VEGFR-2 using a polymer delivery system was conducted [396] The polymer was composed of branched polyethylenimine (PEI) as one end, polyethylene glycol (PEG) in the middle and an RGD peptide motif at the other end. This tri-f unctional polymer can self assemble with negatively charged siRNA into a nanopartic le and RGD peptide will be exposed on the surface. The RGD peptide, a specific ligand for v 3 and 5 1 integrins on activated endothelial cells, can introduce the expression of siRNA to the neovasculature. PEF helps to prevent nonspecific binding to other tissu es. Thus the siRNA is delivered via ligandmediated endocytosis. The level of corneal neovascularization was significantly reduced with the administration of VEGF-A, VEGFR-1, or VEGFR-2 siRNAs, and the combination of all the three resulted in further reduction. In a nother study, an siRNA against VEGFR-1 called Sirna-27, was tested and found to maximally reduce VEGFR-1 levels in cultured endothelia l cells compared w ith other siRNA candidates [394]. This siRNA was further examined in mous e models of retinal and choroidal neovascularization. Sirna-027 significantly reduced VEGFR-1 mRNA levels by 57% or 40% after intravitr eal or periocular inj ection, respectively, as m easured by quantitative RT-PCR. In the CNV mouse model, the ar ea of neovascularization was decreased by 45% to 66% after the periocular or intrav itreous injection of Sirna-27. And in the ischemic retinopathy mouse model, the intrav itreous injection of 1.0 g of Sirna-027 significantly reduced retinal neovascularization [397]. All these studies used VEGFR-1 siRNAs and demonstrated that VEGFR-1 has an important role in stimulating ocular

PAGE 171

155 neovascularizations, which further argues ag ainst the hypothesis that VEGFR-1 is only a decoy receptor that negatively regulates the activity of VEGFR-2. Apart from eye diseases, siRNAs ta rgeting against the VEGF pathway, or angiogenesis, have been studied in the tr eatment of cancer, inflammation, and so on [398]. The growth hormones, their receptors signaling transduction factors, matrix metalloproteases and adhesion molecules have al l been used as the RNAi targets. These studies provide strong support that RNAi can be used in novel anti-angiogenesis therapies, from bench to bed.

PAGE 172

156 APPENDIX A LIST OF ABBREVIATIONS AAV Adeno-associated virus ABAM Antibiotic/antimycotic mix Ad Adenovirus AGE Advanced glycation end-products ALS Acid labile acid Ang-1 Angiopoeitin 1 Ang-2 Angiopoeitin 2 ARMD Age Related Macular Degeneration ARVO Association for Research in Vision and Ophthalmology ATP Adenosine triphosphate bFGF Basic fibroblast growth factor BFP Blue fluorescence protein BRB Blood-retinal barrier BrdU Bromo-uridine BSA Bovine serum albumin CAR Coxsackievirus-adenovirus receptor CFP Cyan fluorescence protein cGMP Cyclic guanosine 3,5-monophosphate CHO Chinese hamster ovary cells CMCT 1-cyclohexyl-(2-morpho linoethylo)cabodiimide methop -toluene sulfonate CMV Cytomegalovirus CNV Choroidal neovascularization DAG Diacylglycerol DMEM Dubellcos modifeid eagle medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DR Diabetic retinopahty DTT Dithiothreitol EC Endothelial cells ECL Enhanced chemiluminescence ECM Extracellular matrix EDTA Ethylenediamine tetraacetic acid EGFR Epidermal growth factor receptor EGS External guide sequence eNOS Endothelial NO synthase ER Endoplasmic reticulum ET Endothelin PAF Platelet-derived factor

PAGE 173

157 FAK Focal adhesion kinase FBS Fetal bovine serum FGF Fibroblast growth factor GAGs Glycosaminoglycans GAS -interferon activated sequence GC Guanosine cytosine content GCL Ganglion cell layer GFP Green fluorescent protein GH Growth hormone GLUT1 Glucose transporter 1 HBSS Hanks balanced salt solution HBV Hepatitis B virus HCV Hepatitis C virus HDV Hepatitis delta virus H&E Hematoxylin-eosin HEK 293 Human embryonic kidney cells HIF Hypoxia inducible factor HIV Human immunodeficiency virus HRE Hypoxia response element HRECs Human retinal endothelial cells HSPGs Heparin sulfate proteoglycans HSV-1 Herpes simplex virus type 1 IACUC Institution Animal Care and Use Committee. IAP Integrin-associated protein ICAM-1 Intercellular adhesion molecule-1 Ig Immnoglobin IGF-1 Insulin-like growth factor 1 IGF-1R Insulin-like grow th factor 1 receptor IGF-2 Insulin-like growth factor 2 IGFBP Insulin-like growth factor binding protein ILM Inner limiting membrane INL Inner nuclear layer IP3 Inositol 1,4,5-triphosphate IPL Inner plexiform layer IR Insulin receptor IRS Insulin receptor substrate ITR Inverted terminal repeats LTR Long terminal repeats miRNA microRNA NAD Nicotinamide adenine dinucleotide NADPH Nicotinamide-adenine dinucleotide phosphate NFB Nuclear factorB NFL Nerve fibre layer NO Nitric oxide NOS Nitric oxide synthase NPDR Non proliferative diabetic retinopathy

PAGE 174

158 NRP Neurophilins OIR Oxygen-induced retinoppathy OLM Outer limiting membrane ONL Outer nuclear layer OPL Outer plexiform layer. ORF Open-reading frame PBS Phosphate buffered saline PDGF Platelet-derived growth factor PDR Proliferative diabetic retinopathy PEDF Pigment epithelium-derived factor PEG Polyethylene glycol PEI Polyethylenimine PIP2 Phosphatidylinositol 4,5-bisphosphate PKB Protein kinase B PKC Protein kinase C PLC Phospholipase C PlGF Placental growth factor PS Phosphorothioate PTB Phosphotyrosine binding PTGS Post-transcriptional gene silencing ptRNA Precursor tRNA rAAV Recombinant ade no associated virus RA Retinoic acid RAGE Advanced glycation end-products receptor RAR Retinoic acid receptor RFP Red fluorescence protein RGD Arginine-glyci ne-asparginine RISC RNA-inducing silencing complex ROP Retinopathy of prematurity ROS Reactive oxygen species RNA Ribonucleic acid RNAi RNA interference rRNA Ribosomal RNA RNasin Ribonuclease inhibitor RPE Retinal pigment epithelium RT Reverse transcription RXR Retinoid X receptor Rz Ribozyme scAAV Self complementary AAV SHP-2 Src homology 2 contai ning tyrosine phosphatase shRNA Short hairpin RNA siRNA Small interfering RNA SMCs Smooth muscle cells SnRNA Small nuclear RNA STAT Signal transducer and activator of transcription TBS Tris buffered saline

PAGE 175

159 T RV Type V receptor for tr ansforming growth factorTGF Transforming growth factor Tie 1 and 2 Angiopoeitin receptors 1 and 2 TNF Tumor necrosis factor tPA Tissue type plasminogen activator tRNA Transfer RNA TR Inverted terminal repeats TRS Terminal resolution site uPA Urokinase type plasminogen inhibitor VE cadherin Vascular endothelial cadherins VEGF Vascular endothe lial growth factor VEGFR-1 Vascular endothelial growth factor-receptor 1 VEGFR-2 Vascular endothe lial growth-receptor 2 VPF Vascular permeability factor VS Varkud satellite VSMCs Vascular smooth muscle cells YFP Yellow fluorescence protein

PAGE 176

160 LIST OF REFERENCES 1. Evans, J, Causes of blindness and partial sight in England and Wales 1990 1995, London: Her's Majesty's Stationery Office. 2. Klein, R, Klein, B E K, and Linton, K L P, Prevalence of Age-Related Maculopathy the Beaver Dam Eye Study. Ophthalmology, 1992. 99 (6): p. 933943. 3. Mitchell, P, Smith, W, Attebo, K, and Wang, J J, Prevalence of Cage-Related Maculopathy in Aust ralia the Blue M ountains Eye Study. Ophthalmology, 1995. 102 (10): p. 1450-1460. 4. Ambati, J, Ambati, B K, Yoo, S H, Ianchulev, S, and Adamis, A P, Age-related macular degeneration: Etiology, pathoge nesis, and therapeutic strategies. Survey of Ophthalmology, 2003. 48 (3): p. 257-293. 5. W.R. Green, S N K, 3rd, Senile macular degenerati on: a histopathologic study. Trans Am Ophthalmol Soc, 1977. 75 : p. 180-254. 6. Sunness, J S, Massof, R W, Johnson, M A, Finkelstein, D, and Fine, S L, Peripheral Retinal Function in Ag e-Related Macular Degeneration. Archives of Ophthalmology, 1985. 103 (6): p. 811-816. 7. Sunness, J S, Rubin, G S, Applegate, C A, Bressler, N M, Marsh, M J, Hawkins, B S, and Haselwood, D, Visual function abnormalities and prognosis in eyes with age-related geographic atrophy of the macula and good visual acuity. Ophthalmology, 1997. 104 (10): p. 1677-1691. 8. Dunaief, J L, Dentchev, T, Ying, G S, and Milam, A H, The role of apoptosis in age-related macular degeneration. Archives of Ophthalmology, 2002. 120 (11): p. 1435-1442. 9. Miller, H, Miller, B, and Ryan, S J, The Role of Retinal-Pigment Epithelium in the Involution of Subretinal Neovascularization. Investigative Ophthalmology & Visual Science, 1986. 27 (11): p. 1644-1652. 10. Green, W R, and Enger, C, Age-Related Macular Degeneration Histopathologic Studies the 1992 Zimmerman,Lorenz,E Lecture. Ophthalmology, 1993. 100 (10): p. 1519-1535.

PAGE 177

161 11. Witmer, A N, Vrensen, G F J M, Van Noorden, C J F, and Schlingemann, R O, Vascular endothelial growth fact ors and angiogenesis in eye disease. Progress in Retinal and Eye Research, 2003. 22 (1): p. 1-29. 12. Campochiaro, P A, Retinal and choroidal neovascularization. Journal of Cellular Physiology, 2000. 184 (3): p. 301-310. 13. Kliffen, M, Sharma, H S, Mooy, C M, Kerkvliet, S, and deJong, P T V M, Increased expression of angiogenic growth factors in age-related maculopathy. British Journal of Ophthalmology, 1997. 81 (2): p. 154-162. 14. Schwesinger, C, Yee, C, Rohan, R M, J oussen, A M, Fernandez, A, Meyer, T N, Poulaki, V, Ma, J J K, Redmond, T M, Liu, S Y, Adamis, A P, and D'Amato, R J, Intrachoroidal neovascularization in transgenic mice overexpressing vascular endothelial growth factor in the retinal pigment epithelium. American Journal of Pathology, 2001. 158 (3): p. 1161-1172. 15. Wells, J A, Murthy, R, Chibber, R, Nunn, A, Molinatti, P A, Kohner, E M, and Gregor, Z J, Levels of vascular endothelial growth factor are elevated in the vitreous of patients with s ubretinal neovascularisation. British Journal of Ophthalmology, 1996. 80 (4): p. 363-366. 16. Anderson, D H, Mullins, R F, Hageman, G S, and Johnson, L V, Perspective A role for local inflammation in the fo rmation of drusen in the aging eye. American Journal of Ophthalmology, 2002. 134 (3): p. 411-431. 17. Hutcheson, K, Retinopathy of prematurity. Current Opinion Ophthalmology, 2003. 14 (5): p. 286-290. 18. Zhang, Y F, and Stone, J, Role of astrocytes in the control of developing retinal vessels. Investigative Ophthalmol ogy & Visual Science, 1997. 38 (9): p. 1653-1666. 19. Aiello, L M, Perspectives on diabetic retinopathy. American Journal of Ophthalmology, 2003. 136 (1): p. 122-135. 20. Caldwelll, R B, Bartoli, M, Behzadian, M A, El-Remessy, A E B, Al-Shabrawey, M, Platt, D H, and Caldwell, R W, Vascular endothelial gr owth factor and diabetic retinopathy: pathophysiological mechani sms and treatmen t perspectives. DiabetesMetabolism Research and Reviews, 2003. 19 (6): p. 442-455. 21. Hinz, B J, de Juan, E, and Repka, M X, Scleral buckling surgery for active stage 4A retinopathy of prematurity. Ophthalmology, 1998. 105 (10): p. 1827-1830. 22. Capone, A, and Trese, M T, Lens-sparing vitreous surger y for tractional stage 4A retinopathy of prematurit y retinal detachments. Ophthalmology, 2001. 108 (11): p. 2068-2070.

PAGE 178

162 23. Group, T D C a C T R, The Effect of Intensive Treatment of Diabetes on the Development and Progression of Long-Term Complications in Insulin-Dependent Diabetes-Mellitus. New England Journal of Medicine, 1993. 329 (14): p. 977-986. 24. Grp, U P D S, Tight blood pressure control and risk of macrovascular and microvascular complications in type 2 diabetes: UKPDS 38. British Medical Journal, 1998. 317 (7160): p. 703-713. 25. Alder, V A, Su, E N, Yu, D Y, Cringle, S J, and Yu, P K, Diabetic retinopathy: Early functional changes. Clinical and Experimental Pharmacology and Physiology, 1997. 24 (9-10): p. 785-788. 26. Ban, Y, and Rizzolo, L J, Regulation of glucose transpor ters during development of the retinal pigment epithelium. Developmental Brain Research, 2000. 121 (1): p. 89-95. 27. Badr, G A, Tang, J, Ismail -Beigi, F, and Kern, T S, Diabetes downregulates GLUT1 expression in the retina and its microv essels but not in the cerebral cortex or its microvessels. Diabetes, 2000. 49 (6): p. 1016-1021. 28. Sone, H, Deo, B K, and Kumagai, A K, Enhancement of glucose transport by vascular endothelial growth fact or in retinal endothelial cells. Investigative Ophthalmology & Visual Science, 2000. 41 (7): p. 1876-1884. 29. Brownlee, M, Biochemistry and molecular cell bi ology of diabetic complications. Nature, 2001. 414 (6865): p. 813-820. 30. Williamson, J R, Chang, K, Frangos, M, Hasan, K S, Ido, Y, Kawamura, T, Nyengaard, J R, Vandenenden, M, Kilo, C, and Tilton, R G, Hyperglycemic Pseudohypoxia and Diabetic Complications. Diabetes, 1993. 42 (6): p. 801-813. 31. Setter, S M, Campbell, R K, and Cahoon, C J, Biochemical pathways for microvascular complications of diabetes mellitus. Annals of Pharmacotherapy, 2003. 37 (12): p. 1858-1866. 32. Swidan, S Z, and Montgomery, P A, Effect of blood glucose concentrations on the development of chronic complications of diabetes mellitus. Pharmacotherapy, 1998. 18 (5): p. 961-972. 33. Dyck, P J, and Giannini, C, Pathologic alterations in the diabetic neuropathies of humans: A review. Journal of Neuropathology an d Experimental Neurology, 1996. 55 (12): p. 1181-1193. 34. Brownlee, M, Nonenzymatic Glycosylation of Ma cromolecules Prospects of Pharmacological Modulation. Diabetes, 1992. 41 : p. 57-60.

PAGE 179

163 35. Haitoglou, C S, Tsilibary, E C, Brownlee, M, and Charonis, A S, Altered Cellular Interactions between Endothelial-Cells and Nonenzymatically Glucosylated Laminin Type-Iv Collagen. Journal of Biological Chemistry, 1992. 267 (18): p. 12404-12407. 36. Cai, H, and Harrison, D G, Endothelial dysfunction in cardiovascular diseases The role of oxidant stress. Circulation Research, 2000. 87 (10): p. 840-844. 37. Laight, D W, Carrier, M J, and Anggard, E E, Antioxidants, diabetes and endothelial dysfunction. Cardiovascular Research, 2000. 47 (3): p. 457-464. 38. Baynes, J W, Role of Oxidative Stress in Development of Complications in Diabetes. Diabetes, 1991. 40 (4): p. 405-412. 39. Taylor, A A, Pathophysiology of hypertension an d endothelial dysfunction in patients with diabetes mellitus. Endocrinology and Metabo lism Clinics of North America, 2001. 30 (4): p. 983-+. 40. SiflingerBirnboim, A, Lum, H, DelVecchio, P J, and Malik, A B, Involvement of Ca2+ in the H2O2-induced increase in endothelial permeability. American Journal of Physiology-Lung Cellular and Molecular Physiology, 1996. 14 (6): p. L973L978. 41. Way, K J, Katai, N, and King, G L, Protein kinase C and the development of diabetic vascular complications. Diabetic Medicine, 2001. 18 (12): p. 945-959. 42. Ishii, H, Koya, D, and King, G L, Protein kinase C activation and its role in the development of vascular complic ations in diabetes mellitus. Journal of Molecular Medicine-Jmm, 1998. 76 (1): p. 21-31. 43. Xia, P, Aiello, L P, Ishii, H, Jiang, Z Y, Park, D J, Robinson, G S, Takagi, H, Newsome, W P, Jirousek, M R, and King, G L, Characterization of vascular endothelial growth factor's ef fect on the activation of pr otein kinase C, its isoforms, and endothelial cell growth. Journal of Clinical Investigation, 1996. 98 (9): p. 20182026. 44. Bloomgarden, Z T, The epidemiology of complications. Diabetes Care, 2002. 25 (5): p. 924-932. 45. Imai, T, Morita, T, Shindo, T, Nagai, R, Yazaki, Y, Kurihara, H, Suematsu, M, and Katayama, S, Vascular smooth muscle cell-directed overexpression of heme oxygenase-1 elevates blood pressure thr ough attenuation of nitric oxide-induced vasodilation in mice. Circulation Research, 2001. 89 (1): p. 55-62. 46. Chakrabarti, S, Cukiernik, M, Hileeto, D, Evans, T, and Chen, S, Role of vasoactive factors in the pathogene sis of early changes in diabetic retinopathy. DiabetesMetabolism Research and Reviews, 2000. 16 (6): p. 393-407.

PAGE 180

164 47. Stevens, M J, Henry, D N, Thomas, T P, Killen, P D, and Greene, D A, Aldose Reductase Gene-Expression and Osmotic Dysregulation in Cultured Human Retinal-Pigment Epithelial-Cells. American Journal of Physiology, 1993. 265 (3): p. E428-E438. 48. Stitt, A W, Advanced glycation: an important pa thological event in diabetic and age related ocular disease. British Journal of Ophthalmology, 2001. 85 (6): p. 746753. 49. Moller, P, Loft, S, Lundby, C, and Olsen, N V, Acute hypoxia and hypoxic exercise induce DNA strand breaks and oxidative DNA damage in humans. Faseb Journal, 2001. 15 (7): p. 1181-1186. 50. Jerdan, J A, Michels, R G, and Glaser, B M, Diabetic Preretinal Membranes an Immunohistochemical Study. Archives of Ophthalmology, 1986. 104 (2): p. 286290. 51. Bek, T, and Ledet, T, Glycoprotein deposition in va scular walls of diabetic retinopathy A histopa thological and immunohi stochemical study. Acta Ophthalmologica Scandinavica, 1996. 74 (4): p. 385-390. 52. Nishikawa, T, Giardino, I, Ed elstein, D, and Brownlee, M, Changes in diabetic retinal matrix protein mRNA levels in a common transgenic mouse strain. Current Eye Research, 2000. 21 (1): p. 581-587. 53. Jian, B, Jones, P L, Li, Q Y, M ohler, E R, Schoen, F J, and Levy, R J, Matrix metalloproteinase-2 is associated with te nascin-C in calcific aortic stenosis. American Journal of Pathology, 2001. 159 (1): p. 321-327. 54. Cai, J, and Boulton, M, The pathogenesis of diabetic retinopathy: old concepts and new questions. Eye, 2002. 16 (3): p. 242-260. 55. Carmeliet, P, Angiogenesis in health and disease. Nature Medicine, 2003. 9 (6): p. 653-660. 56. Gariano, R F, Cellular mechanisms in retinal vascular development. Progress in Retinal and Eye Research, 2003. 22 (3): p. 295-306. 57. Luttun, A, Carmeliet, G, and Carmeliet, P, Vascular progenitors: From biology to treatment. Trends in Cardiova scular Medicine, 2002. 12 (2): p. 88-96. 58. Rafii, S, Lyden, D, Benezra, R, Hattori, K, and Heissig, B, Vascular and haematopoietic stem cells: Novel ta rgets for anti-angiogenesis therapy? Nature Reviews Cancer, 2002. 2 (11): p. 826-835. 59. Asahara, T, and Isner, J M, Endothelial progenitor cells for vascular regeneration. Journal of Hematotherapy & Stem Cell Research, 2002. 11 (2): p. 171-178.

PAGE 181

165 60. Grant, M B, May, W S, Caballero, S, Br own, G A J, Guthrie, S M, Mames, R N, Byrne, B J, Vaught, T, Spoerri, P E, Peck, A B, and Scott, E W, Adult hematopoietic stem cells provide functi onal hemangioblast activ ity during retinal neovascularization. Nature Medicine, 2002. 8 (6): p. 607-612. 61. Otani, A, Kinder, K, Ewalt, K, Otero, F J, Schimmel, P, and Friedlander, M, Bone marrow-derived stem cells target retinal astrocytes and can promote or inhibit retinal angiogenesis. Nature Medicine, 2002. 8 (9): p. 1004-1010. 62. Folkman, J, Anti-Angiogenesis New Concept for Therapy of Solid Tumors. Annals of Surgery, 1972. 175 (3): p. 409-&. 63. Liotta, L A, Steeg, P S, and Stetlerstevenson, W G, Cancer Metastasis and Angiogenesis an Imbalance of Positive and Negative Regulation. Cell, 1991. 64 (2): p. 327-336. 64. Pugh, C W, and Ratcliffe, P J, Regulation of angiogenesis by hypoxia: role of the HIF system. Nature Medicine, 2003. 9 (6): p. 677-684. 65. Kourembanas, S, Hannan, R L, and Faller, D V, Oxygen-Tension Regulates the Expression of the Platelet-Derived Gr owth Factor-B Chain Gene in Human Endothelial-Cells. Journal of Clinical Investigation, 1990. 86 (2): p. 670-674. 66. Shweiki, D, Itin, A, Soffer, D, and Keshet, E, Vascular Endothel ial Growth-Factor Induced by Hypoxia May Mediate Hypoxia-Initiated Angiogenesis. Nature, 1992. 359 (6398): p. 843-845. 67. Forsythe, J A, Jiang, B H, Iyer, N V, Agani, F, Leung, S W, Koos, R D, and Semenza, G L, Activation of vascular endothelial gr owth factor gene transcription by hypoxia-inducible factor 1. Molecular and Cellular Biology, 1996. 16 (9): p. 4604-4613. 68. Gleadle, J M, Ebert, B L, Fi rth, J D, and Ratcliffe, P J, Regulation of Angiogenic Growth-Factor Expression by Hypoxia, Tr ansition-Metals, and Chelating-Agents. American Journal of Phys iology-Cell Physiology, 1995. 37 (6): p. C1362-C1368. 69. Liu, Y X, Cox, S R, Morita, T, and Kourembanas, S, Hypoxia Regulates Vascular Endothelial Growth-Factor Gene-Expression in Endothelial-Cells Identification of a 5'-Enhancer. Circulation Research, 1995. 77 (3): p. 638-643. 70. Krishnamachary, B, Berg-Dixon, S, Kelly, B, Agani, F, Feldser, D, Ferreira, G, Iyer, N, LaRusch, J, Pak, B, Taghavi, P, and Semenza, G L, Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1. Cancer Research, 2003. 63 (5): p. 1138-1143. 71. Goldberg, M A, and Schneider, T J, Similarities between the Oxygen-Sensing Mechanisms Regulating the Expression of Vascular Endothelial Growth-Factor and Erythropoietin. Journal of Biological Chemistry, 1994. 269 (6): p. 4355-4359.

PAGE 182

166 72. Tian, H, McKnight, S L, and Russell, D W, Endothelial PAS domain protein 1 (EPAS1), a transcription factor selectiv ely expressed in endothelial cells. Genes & Development, 1997. 11 (1): p. 72-82. 73. Wiesener, M S, Turley, H, Allen, W E, Willam, C, Eckardt, K U, Talks, K L, Wood, S M, Gatter, K C, Harris, A L, Pugh, C W, Ratcliffe, P J, and Maxwell, P H, Induction of endotheli al PAS domain protein-1 by hypoxia: Characterization and comparison with hypoxia-inducible factor-1 alpha. Blood, 1998. 92 (7): p. 22602268. 74. Makino, Y, Cao, R H, Svensson, K, Bertil sson, G R, Asman, M, Tanaka, H, Cao, Y H, Berkenstam, A, and Poellinger, L, Inhibitory PAS domain protein is a negative regulator of hypoxia-ind ucible gene expression. Nature, 2001. 414 (6863): p. 550554. 75. Maxwell, P H, and Ratcliffe, P J, Oxygen sensors and angiogenesis. Seminars in Cell & Developmental Biology, 2002. 13 (1): p. 29-37. 76. Senger, D R, Galli, S J, Dvorak, A M, Perruzzi, C A, Harvey, V S, and Dvorak, H F, Tumor-Cells Secrete a Vascular-Per meability Factor That Promotes Accumulation of Ascites-Fluid. Science, 1983. 219 (4587): p. 983-985. 77. Ferrara, N, and Henzel, W J, Pituitary Follicular Cells Secrete a Novel HeparinBinding Growth-Factor Specific fo r Vascular Endothelial-Cells. Biochemical and Biophysical Research Communications, 1989. 161 (2): p. 851-858. 78. Leung, D W, Cachianes, G, Kuang, W J, Goeddel, D V, and Ferrara, N, Vascular Endothelial Growth-Factor Is a Secreted Angiogenic Mitogen. Science, 1989. 246 (4935): p. 1306-1309. 79. Keck, P J, Hauser, S D, Krivi, G, Sanzo, K, Warren, T, Feder, J, and Connolly, D T, Vascular-Permeability Factor, an Endot helial-Cell Mitogen Related to Pdgf. Science, 1989. 246 (4935): p. 1309-1312. 80. Ciulla TA, D R, Criswell M, Pratt LM., Changing therapeutic paradigms for exudative age-related macular dege neration: antiangiogenic agents and photodynamic therapy. Expert Opin Investig Drugs., 1999. 8 (12): p. 2173-2182. 81. Muller, Y A, Christinger, H W, Keyt, B A, and deVos, A M, The crystal structure of vascular endothelial grow th factor (VEGF) refined to 1.93 angstrom resolution: multiple copy flexibility and receptor binding. Structure, 1997. 5 (10): p. 1325-1338. 82. Olofsson, B, Pajusola, K, Kaipainen, A, vonEuler, G, Joukov, V, Saksela, O, Orpana, A, Petersson, R F, Alitalo, K, and Eriksson, U, Vascular endothelial growth factor B, a novel growth factor for endothelial cells. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93 (6): p. 2576-2581.

PAGE 183

167 83. Lee, J, Gray, A, Yuan, J, Luoh, S M, Avraham, H, and Wood, W I, Vascular endothelial growth factor-r elated protein: A ligand and specific activator of the tyrosine kinase receptor Flt4. Proceedings of the Nationa l Academy of Sciences of the United States of America, 1996. 93 (5): p. 1988-1992. 84. Makinen, T, Veikkola, T, Mustjoki, S, Ka rpanen, T, Catimel, B, Nice, E C, Wise, L, Mercer, A, Kowalski, H, Kerjaschki, D, Stacker, S A, Achen, M G, and Alitalo, K, Isolated lymphatic endothelial cells transduce growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3. Embo Journal, 2001. 20 (17): p. 4762-4773. 85. Achen, M G, Jeltsch, M, Kukk, E, Makinen, T, Vitali, A, Wilks, A F, Alitalo, K, and Stacker, S A, Vascular endothelial growth fa ctor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4). Proceedings of the National Academy of Scie nces of the United States of America, 1998. 95 (2): p. 548-553. 86. Meyer, M, Clauss, M, Lepple-Wienhues, A, Waltenberger, J, Augustin, H G, Ziche, M, Lanz, C, Buttner, M, Rziha, H J, and Dehio, C, A novel vascular endothelial growth factor encoded by Orf virus, VEGF-E, mediates angiogenesis via signalling through VEGFR-2 (KDR) but not VEGFR-1 (Flt-1) receptor tyrosine kinases. Embo Journal, 1999. 18 (2): p. 363-374. 87. Junqueira-de-Azevedo, I D L, da Silva, M B, Chudzinski-Tavassi, A M, and Ho, P L, Identification and cloning of snake venom vascular endothelia l growth factor (svVEGF) from Bothrops erythromelas pitviper. Toxicon, 2004. 44 (5): p. 571-575. 88. Ferrara, N, Houck, K, Jakeman, L, and Leung, D W, Molecular and Biological Properties of the Vascular Endothelial Growth-Factor Family of Proteins. Endocrine Reviews, 1992. 13 (1): p. 18-32. 89. Tischer, E, Mitchell, R, Hartman, T, Silv a, M, Gospodarowicz, D, Fiddes, J C, and Abraham, J A, The Human Gene for Vascular Endothelial Growth-Factor Multiple Protein Forms Are Encode d through Alternative Exon Splicing. Journal of Biological Chemistry, 1991. 266 (18): p. 11947-11954. 90. Shima, D T, Kuroki, M, Deutsch, U, N g, Y S, Adamis, A P, and DAmore, P A, The mouse gene for vascular endot helial growth factor Ge nomic structure, definition of the transcriptional unit, and charac terization of transcriptional and posttranscriptional regulatory sequences. Journal of Biological Chemistry, 1996. 271 (7): p. 3877-3883. 91. Robinson, C J, and Stringer, S E, The splice variants of vascular endothelial growth factor (VEGF) and their receptors. Journal of Cell Science, 2001. 114 (5): p. 853-865.

PAGE 184

168 92. Byrne, A M, Bouchier-Hayes, D J, and Harmey, J H, Angiogenic and cell survival functions of Vascular Endothe lial Growth Factor (VEGF). Journal of Cellular and Molecular Medicine, 2005. 9 (4): p. 777-794. 93. Houck, K A, Leung, D W, Rowland, A M, Winer, J, and Ferrara, N, Dual Regulation of Vascular Endothelial Growth -Factor Bioavailability by Genetic and Proteolytic Mechanisms. Journal of Biological Chemistry, 1992. 267 (36): p. 2603126037. 94. Hoeben A, L B, Highley MS, Wildiers H, Van Oosterom AT, De Bruijn EA., Vascular endothelial grow th factor and angiogenesis. Pharmacol Rev., 2004. 56 : p. 549-580. 95. Bates, D O, Cui, T G, Doughty, J M, Wi nkler, M, Sugiono, M, Shields, J D, Peat, D, Gillatt, D, and Harper, S J, VEGF(165)b, an inhibitory splice variant of vascular endothelial growth factor, is downregulated in renal cell carcinoma. Cancer Research, 2002. 62 (14): p. 4123-4131. 96. Woolard, J, Wang, W Y, Beva n, H S, Qiu, Y, Morbidelli, L, Pritchard-Jones, R O, Cui, T G, Sugiono, M, Waine, E, Perrin, R, Foster, R, Digby-Bell, J, Shields, J D, Whittles, C E, Mushens, R E, Gillatt, D A, Ziche, M, Harper, S J, and Bates, D O, VEGF(165)b, an inhibitory vascular endot helial growth factor splice variant: Mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Research, 2004. 64 (21): p. 7822-7835. 97. Davis-Smyth, T, Presta, L G, and Ferrara, N, Mapping the charged residues in the second immunoglobulin-like domain of the va scular endothelial growth factor placenta growth factor receptor Flt-1 re quired for binding and structural stability. Journal of Biological Chemistry, 1998. 273 (6): p. 3216-3222. 98. Fuh, G, Li, B, Crowley, C, Cunningham, B, and Wells, J A, Requirements for binding and signaling of the kinase domain receptor for vascular endothelial growth factor. Journal of Biological Chemistry, 1998. 273 (18): p. 11197-11204. 99. Shinkai, A, Ito, M, Anazawa, H, Ya maguchi, S, Shitara, K, and Shibuya, M, Mapping of the sites involved in liga nd association and dissociation at the extracellular domain of the ki nase insert domain-contai ning receptor for vascular endothelial growth factor. Journal of Biological Chemistry, 1998. 273 (47): p. 31283-31288. 100. Park, J E, Chen, H H, Winer, J, Houck, K A, and Ferrara, N, Placenta GrowthFactor Potentiation of Vascular Endothe lial Growth-Factor Bioactivity, in-Vitro and in-Vivo, and High-Affinity Binding to Flt-1 but Not to Flk-1/Kdr. Journal of Biological Chemistry, 1994. 269 (41): p. 25646-25654. 101. Fong, G H, Zhang, L Y, Bryce, D M, and Peng, J, Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development, 1999. 126 (13): p. 3015-3025.

PAGE 185

169 102. Hiratsuka, S, Minowa, O, Kuno, J, Noda, T, and Shibuya, M, Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proceedings of the National Academy of Sciences of the United States of America, 1998. 95 (16): p. 9349-9354. 103. Kendall, R L, and Thomas, K A, Inhibition of Vascular Endothelial-Cell GrowthFactor Activity by an Endogenously Encoded Soluble Receptor. Proceedings of the National Academy of Sciences of the United States of America, 1993. 90 (22): p. 10705-10709. 104. Kendall, R L, Wang, G, and Thomas, K A, Identification of a nat ural soluble form of the vascular endothelial grow th factor receptor, FLT-1, and its heterodimerization with KDR. Biochemical and Biophysical Research Communications, 1996. 226 (2): p. 324-328. 105. Barleon, B, Sozzani, S, Zhou, D, Weic h, H A, Mantovani, A, and Marme, D, Migration of human monocytes in response to vascular endothe lial growth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood, 1996. 87 (8): p. 3336-3343. 106. Clauss, M, Weich, H, Breier, G, Knies, U, Rockl, W, Waltenberger, J, and Risau, W, The vascular endothelial growth factor receptor Flt-1 mediates biological activities Implications for a functional role of placenta growth factor in monocyte activation and chemotaxis. Journal of Biological Chemistry, 1996. 271 (30): p. 17629-17634. 107. Selvaraj, S K, Giri, R K, Perelman, N, Johnson, C, Malik, P, and Kalra, V K, Mechanism of monocyte activation a nd expression of proinflammatory cytochemokines by placenta growth factor. Blood, 2003. 102 (4): p. 1515-1524. 108. Shalaby, F, Ho, J, Stanford, W L, Fi scher, K D, Schuh, A C, Schwartz, L, Bernstein, A, and Rossant, J, A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell, 1997. 89 (6): p. 981-990. 109. Kaipainen, A, Korhonen, J, Mustone n, T, Vanhinsbergh, V W M, Fang, G H, Dumont, D, Breitman, M, and Alitalo, K, Expression of the Fms-Like Tyrosine Kinase-4 Gene Becomes Restricted to Lymphatic Endothelium during Development. Proceedings of the National Acad emy of Sciences of the United States of America, 1995. 92 (8): p. 3566-3570. 110. Fujisawa, H, and Kitsukawa, T, Receptors for collapsin/semaphorins. Current Opinion in Neurobiology, 1998. 8 (5): p. 587-592. 111. Fuh, G, Garcia, K C, and de Vos, A M, The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor Flt-1. Journal of Biological Chemistry, 2000. 275 (35): p. 26690-26695.

PAGE 186

170 112. Whitaker, G B, Limberg, B J, and Rosenbaum, J S, Vascular endothelial growth factor receptor-2 and neuropilin-1 form a r eceptor complex that is responsible for the differential signaling pot ency of VEGF(165) and VEGF(121). Journal of Biological Chemistry, 2001. 276 (27): p. 25520-25531. 113. Soker, S, Miao, H Q, Nomi, M, Takashima, S, and Klagsbrun, M, VEGF(165) mediates formation of complexes containing VEGFR-2 and neuropilin-1 that enhance VEGF(165)-receptor binding. Journal of Cellular Biochemistry, 2002. 85 (2): p. 357-368. 114. Fakhari, M, Pullirsch, D, Abraham, D, Paya, K, Hofbauer, R, Holzfeind, P, Hofmann, M, and Aharinejad, S, Selective upregulation of vascular endothelial growth factor receptors neuropilin-1 and-2 in human neuroblastoma. Cancer, 2002. 94 (1): p. 258-263. 115. Ng YS, K D, Shima DT., VEGF function in vascular pathogenesis. Exp Cell Res., 2006. 312 : p. 527-537. 116. Cebe-Suarez S, Z-F A, Ballmer-Hofer K., The role of VEGF receptors in angiogenesis; complex partnerships. Cell Mol Life Sci., 2006: p. Epub ahead of print. 117. Meadows, K N, Bryant, P, and Pumiglia, K, Vascular endothelia l growth factor induction of the angiogenic phenot ype requires Ras activation. Journal of Biological Chemistry, 2001. 276 (52): p. 49289-49298. 118. Takahashi, T, Yamaguchi, S, Chida, K, and Shibuya, M, A single autophosphorylation site on KDR/Flk-1 is essential for VEGF-A-dependent activation of PLC-gamma and DNA synthe sis in vascular endothelial cells. Embo Journal, 2001. 20 (11): p. 2768-2778. 119. Takahashi, T, Ueno, H, and Shibuya, M, VEGF activates protein kinase Cdependent, but Ras-independent Raf-MEK -MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene, 1999. 18 (13): p. 2221-2230. 120. Yu, Y, and Sato, J D, MAP kinases, phosphatidylinositol 3-kinase, and p70 S6 kinase mediate the mitogenic response of human endothelial cells to vascular endothelial growth factor. Journal of Cellular Physiology, 1999. 178 (2): p. 235246. 121. Kroll, J, and Waltenberger, J, The vascular endothelial gr owth factor receptor KDR activates multiple signal transduction pathways in porcine aortic endothelial cells. Journal of Biological Chemistry, 1997. 272 (51): p. 32521-32527. 122. Abedi, H, and Zachary, I, Vascular endothelial growth factor stimulates tyrosine phosphorylation and recruitment to new foca l adhesions of focal adhesion kinase and paxillin in endothelial cells. Journal of Biological Chemistry, 1997. 272 (24): p. 15442-15451.

PAGE 187

171 123. Kanno, S, Oda, N, Abe, M, Terai, Y, Ito, M, Shitara, K, Tabayashi, K, Shibuya, M, and Sato, Y, Roles of two VEGF receptors, Flt-1 and KDR, in the signal transduction of VEGF effects in human vascular endothelial calls. Oncogene, 2000. 19 (17): p. 2138-2146. 124. Rousseau, S, Houle, F, Landry, J, and Huot, J, p38 MAP kinase activation by vascular endothelial growth factor mediates actin reorganization and cell migration in human endothelial cells. Oncogene, 1997. 15 (18): p. 2169-2177. 125. Matsumoto, T, Bohman, S, Dixelius, J, Berge, T, Dimberg, A, Magnusson, P, Wang, L, Wikner, C, Qi, J H, Wernstedt, C, Wu, J, Bruheim, S, Mugishima, H, Mukhopadhyay, D, Spurkland, A, and Claesson-Welsh, L, VEGF receptor-2 Y951 signaling and a role for the adapter mo lecule TSAd in tumor angiogenesis. Embo Journal, 2005. 24 (13): p. 2342-2353. 126. Gille, H, Kowalski, J, Li, B, LeCouter, J, Moffat, B, Zioncheck, T F, Pelletier, N, and Ferrara, N, Analysis of biological effect s and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2) A reasse ssment using novel receptor-specific vascular endothelial gr owth factor mutants. Journal of Biological Chemistry, 2001. 276 (5): p. 3222-3230. 127. Gerber, H P, McMurtrey, A, Kowalski, J, Yan, M H, Keyt, B A, Dixit, V, and Ferrara, N, Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3 '-kinas e Akt signal transduction pathway Requirement for Flk-1/KDR activation. Journal of Biological Chemistry, 1998. 273 (46): p. 30336-30343. 128. Carmeliet, P, Lampugnani, M G, Moons, L, Breviario, F, Compernolle, V, Bono, F, Balconi, G, Spagnuolo, R, Oosthuyse, B, De werchin, M, Zanetti, A, Angellilo, A, Mattot, V, Nuyens, D, Lutgens, E, Clot man, F, de Ruiter, M C, Gittenberger-de Groot, A, Poelmann, R, Lupu, F, Herbert, J M, Collen, D, and Dejana, E, Targeted deficiency or cytosolic truncation of th e VE-cadherin gene in mice impairs VEGFmediated endothelial su rvival and angiogenesis. Cell, 1999. 98 (2): p. 147-157. 129. Gerber, H P, Dixit, V, and Ferrara, N, Vascular endothelial growth factor induces expression of the antiapoptotic proteins Bc l-2 and A1 in vascular endothelial cells. Journal of Biological Chemistry, 1998. 273 (21): p. 13313-13316. 130. Tran, J, Rak, J, Sheehan, C, Saibil, S D, LaCasse, E, Korneluk, R G, and Kerbel, R S, Marked induction of the IAP family anti apoptotic proteins su rvivin and XIAP by VEGF in vascular endothelial cells. Biochemical and Biophysical Research Communications, 1999. 264 (3): p. 781-788. 131. Dvorak, A M, and Feng, D, The vesiculo-vacuolar organelle (VVO): A new endothelial cell permeability organelle. Journal of Histochemistry & Cytochemistry, 2001. 49 (4): p. 419-431.

PAGE 188

172 132. Strickland, L A, Jubb, A M, Hongo, L A, Z hong, F, Burwick, J, Fu, L, Frantz, G D, and Koeppen, H, Plasmalemmal vesicle-associated protein (PLVAP) is expressed by tumour endothelium and is upregulated by vascular endothelia l growth factor-A (VEGF). Journal of Pathology, 2005. 206 (4): p. 466-475. 133. Fulton, D, Gratton, J P, McCabe, T J, Fontana, J, Fujio, Y, Walsh, K, Franke, T F, Papapetropoulos, A, and Sessa, W C, Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature, 1999. 399 (6736): p. 597-601. 134. Michell, B J, Griffiths, J E, Mitchelhi ll, K I, Rodriguez-Crespo, I, Tiganis, T, Bozinovski, S, de Montellano, P R O, Kemp, B E, and Pearson, R B, The Akt kinase signals directly to endot helial nitric oxide synthase. Current Biology, 1999. 9 (15): p. 845-848. 135. Miller, J W, Adamis, A P, Shima, D T, Damore, P A, Moulton, R S, Oreilly, M S, Folkman, J, Dvorak, H F, Brown, L F, Berse, B, Yeo, T K, and Yeo, K T, Vascular Endothelial Growth-Factor Vascular-Per meability Factor Is Temporally and Spatially Correlated with Ocular Angiogenesis in a Primate Model. American Journal of Pathology, 1994. 145 (3): p. 574-584. 136. Pierce, E A, Avery, R L, Foley, E D, Aiello, L P, and Smith, L E H, Vascular Endothelial Growth-Factor Vascular-Perme ability Factor Expression in a Mouse Model of Retinal Neovascularization. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92 (3): p. 905-909. 137. Donahue, M L, Phelps, D L, Watkins, R H, LoMonaco, M B, and Horowitz, S, Retinal vascular endothelial growth factor (VEGF) mRNA expression is altered in relation to neovascularization in oxygen induced retinopathy. Current Eye Research, 1996. 15 (2): p. 175-184. 138. Dorey, C K, Aouididi, S, Reynaud, X, Dvorak, H F, and Brown, L F, Correlation of vascular permeability factor/vascular e ndothelial growth factor with extraretinal neovascularization in the rat. Archives of Ophthalmology, 1996. 114 (10): p. 12101217. 139. Adamis, A P, Miller, J W, Bernal, M T, Damico, D J, Folkman, J, Yeo, T K, and Yeo, K T, Increased Vascular Endothelial Growth -Factor Levels in the Vitreous of Eyes with Proliferat ive Diabetic-Retinopathy. American Journal of Ophthalmology, 1994. 118 (4): p. 445-450. 140. Aiello, L P, Avery, R L, Arrigg, P G, Keyt B A, Jampel, H D, Shah, S T, Pasquale, L R, Thieme, H, Iwamoto, M A, Park, J E, Nguyen, H V, Aiello, L M, Ferrara, N, and King, G L, Vascular Endothelial Growth-Facto r in Ocular Fluid of Patients with Diabetic-Retinopathy and Other Retinal Disorders. New England Journal of Medicine, 1994. 331 (22): p. 1480-1487.

PAGE 189

173 141. Malecaze, F, Clamens, S, Simorrepinatel, V, Mathis, A, Chollet, P, Favard, C, Bayard, F, and Plouet, J, Detection of Vascular Endothelial Growth-Factor Messenger-Rna and Vascular Endothelial Growth Factor-Like Activity in Proliferative Diabetic-Retinopathy. Archives of Ophthalmology, 1994. 112 (11): p. 1476-1482. 142. Peer, J, Folberg, R, Itin, A, Gn essin, H, Hemo, I, and Keshet, E, Upregulated expression of vascular endothelial grow th factor in proliferative diabetic retinopathy. British Journal of Ophthalmology, 1996. 80 (3): p. 241-245. 143. Ambati, J, Chalam, K V, Chawla, D K, DAngio, C T, Guillet, E G, Rose, S J, Vanderlinde, R E, and Ambati, B K, Elevated gamma-aminobutyric acid, glutamate, and vascular endothe lial growth factor levels in the vitreous of patients with proliferative diabetic retinopathy. Archives of Ophthalmology, 1997. 115 (9): p. 1161-1166. 144. Burgos, R, Simo, R, Audi, L, Mateo, C, Mesa, J, GarciaRamirez, M, and Carrascosa, A, Vitreous levels of vascular e ndothelial growth factor are not influenced by its serum concentr ations in diabetic retinopathy. Diabetologia, 1997. 40 (9): p. 1107-1109. 145. Hattenbach, L O, Allers, A, Gumbel, H O C, Scharrer, I, and Koch, F H J, Vitreous concentrations of TPA and plasminogen ac tivator inhibitor are associated with VEGF in proliferative diabetic vitreoretinopathy. Retina-the Journal of Retinal and Vitreous Diseases, 1999. 19 (5): p. 383-389. 146. Frank, R N, Amin, R H, Eliott, D, Puklin, J E, and Abrams, G W, Basic fibroblast growth factor and vascular endothelial grow th factor are present in epiretinal and choroidal neovascular membranes. American Journal of Ophthalmology, 1996. 122 (3): p. 393-403. 147. Spirin, K S, Saghizadeh, M, Lewin, S L, Zardi, L, Kenney, M C, and Ljubimov, A V, Basement membrane and growth factor gene expression in normal and diabetic human retinas. Current Eye Research, 1999. 18 (6): p. 490-499. 148. Aiello, L P, Northrup, J M, Keyt, B A, Takagi, H, and Iwamoto, M A, Hypoxic Regulation of Vascular Endothelial Growth-Factor in Retinal Cells. Archives of Ophthalmology, 1995. 113 (12): p. 1538-1544. 149. Adamis, A P, Shima, D T, Tolentino, M J, Gragoudas, E S, Ferrara, N, Folkman, J, DAmore, P A, and Miller, J W, Inhibition of vascular endothelial growth factor prevents retinal ischemia-associated iris neovascularization in a nonhuman primate. Archives of Ophthalmology, 1996. 114 (1): p. 66-71. 150. Robinson, G S, Pierce, E A, Rook, S L, Foley, E, Webb, R, and Smith, L E H, Oligodeoxynucleotides inhibit retinal ne ovascularization in a murine model of proliferative retinopathy. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93 (10): p. 4851-4856.

PAGE 190

174 151. McLeod, D S, Taomoto, M, Cao, J T, Zhu, Z P, Witte, L, and Lutty, G A, Localization of VEGF receptor-2 (KDR/Flk-1 ) and effects of blocking it in oxygeninduced retinopathy. Investigative Ophthalmol ogy & Visual Science, 2002. 43 (2): p. 474-482. 152. Tolentino, M J, Miller, J W, Gra goudas, E S, Jakobiec, F A, Flynn, E, Chatzistefanou, K, Ferrara, N, and Adamis, A P, Intravitreous injections of vascular endothelial growth factor produce retinal ischemia and microangiopathy in an adult primate. Ophthalmology, 1996. 103 (11): p. 1820-1828. 153. Ozaki, H, Hayashi, H, Vinores, S A, Moromizato, Y, Campochiaro, P A, and Oshima, K, Intravitreal sustained releas e of VEGF causes retinal neovascularization in rabbits and breakdown of the blood-retinal barrier in rabbits and primates. Experimental Eye Research, 1997. 64 (4): p. 505-517. 154. Ohno-Matsui, K, Hirose, A, Yamamoto, S, Saikia, J, Okamoto, N, Gehlbach, P, Duh, E J, Hackett, S, Chang, M, Bok, D, Zack, D J, and Campochiaro, P A, Inducible expression of vascular endothel ial growth factor in adult mice causes severe proliferative retinopathy and retinal detachment. American Journal of Pathology, 2002. 160 (2): p. 711-719. 155. Das, A, and McGuire, P G, Retinal and choroidal angi ogenesis: pathophysiology and strategies for inhibition. Progress in Retinal and Eye Research, 2003. 22 (6): p. 721-748. 156. Amin, R, Puklin, J E, and Frank, R N, Growth-Factor Localization in Choroidal Neovascular Membranes of AgeRelated Macular Degeneration. Investigative Ophthalmology & Visual Science, 1994. 35 (8): p. 3178-3188. 157. Lopez, P F, Sippy, B D, Lambert, H M, Thach, A B, and Hinton, D R, Transdifferentiated retinal pigment ep ithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age-related macular degeneration-related choroi dal neovascular membranes. Investigative Ophthalmology & Visual Science, 1996. 37 (5): p. 855-868. 158. Yi, X J, Ogata, N, Komada, M, Yamamoto, C, Takahashi, K, Omori, K, and Uyama, M, Vascular endothelial growth fa ctor expression in choroidal neovascularization in rats. Graefes Archive for Clinical and Experimental Ophthalmology, 1997. 235 (5): p. 313-319. 159. Seo, M S, Kwak, N, Ozaki, H, Yamada, H, Okamoto, N, Yamada, E, Fabbro, D, Hofmann, F, Wood, J M, and Campochiaro, P A, Dramatic inhibition of retinal and choroidal neovascularization by oral administration of a kinase inhibitor. American Journal of Pathology, 1999. 154 (6): p. 1743-1753. 160. Kwak, N, Okamoto, N, Wood, J M, and Campochiaro, P A, VEGF is major stimulator in model of choroidal neovascularization. Investigative Ophthalmology & Visual Science, 2000. 41 (10): p. 3158-3164.

PAGE 191

175 161. Saishin, Y, Saishin, Y, Ta kahashi, K, Silva, R L E, Hylton, D, Rudge, J S, Wiegand, S J, and Campochiaro, P A, VEGF-TRAP(R1R2) suppresses choroidal neovascularization and VEGF-induced br eakdown of the blood-retinal barrier. Journal of Cellular Physiology, 2003. 195 (2): p. 241-248. 162. Okamoto, N, Tobe, T, Hackett, S F, Ozak i, H, Vinores, M A, LaRochelle, W, Zack, D J, and Campochiaro, P A, Transgenic mice with increased expression of vascular endothelial growth factor in the retina A new model of intraretinal and subretinal neovascularization. American Journal of Pathology, 1997. 151 (1): p. 281-291. 163. Nyberg, F, Hahnenberger, R, Jakobson, A M, and Terenius, L, Enhancement of Fgf-Like Polypeptides in the Retinae of Newborn Mice Exposed to Hyperoxia. Febs Letters, 1990. 267 (1): p. 75-77. 164. Zhang, N L, Samadani, E E, and Frank, R N, Mitogenesis and Retinal-Pigment Epithelial-Cell Antigen Expression in the Rat after Krypton Laser Photocoagulation. Investigative Ophthalmology & Visual Science, 1993. 34 (8): p. 2412-2424. 165. Sivalingam, A, Kenney, J, Brown, G C, Benson, W E, and Donoso, L, Basic Fibroblast Growth-Factor Leve ls in the Vitreous of Patients with Proliferative Diabetic-Retinopathy. Archives of Ophthalmology, 1990. 108 (6): p. 869-872. 166. Damore, P A, Mechanisms of Retinal and C horoidal Neovascularization. Investigative Ophthalmol ogy & Visual Science, 1994. 35 (12): p. 3974-3979. 167. Ozaki, H, Okamoto, N, Ortega, S, Chang, M, Ozaki, K, Sadda, S, Vinores, M A, Derevjanik, N, Zack, D J, Bas ilico, C, and Campochiaro, P A, Basic fibroblast growth factor is neither necessary nor sufficient for the d evelopment of retinal neovascularization. American Journal of Pathology, 1998. 153 (3): p. 757-765. 168. Tobe, T, Ortega, S, Luna, J D, Ozaki, H, Okamoto, N, Derevjanik, N L, Vinores, S A, Basilico, C, and Campochiaro, P A, Targeted disruption of the FGF2 gene does not prevent choroidal neovascularization in a murine model. American Journal of Pathology, 1998. 153 (5): p. 1641-1646. 169. Yamada, H, Yamada, E, Kwak, N, Ando, A, Suzuki, A, Esumi, N, Zack, D J, and Campochiaro, P A, Cell injury unmasks a latent proangiogenic phenotype in mice with increased expression of FGF2 in the retina. Journal of Cellular Physiology, 2000. 185 (1): p. 135-142. 170. Maisonpierre, P C, Suri, C, Jones, P F, Bartunkova, S, Wiegand, S, Radziejewski, C, Compton, D, McClain, J, Aldrich, T H, Papadopoulos, N, Daly, T J, Davis, S, Sato, T N, and Yancopoulos, G D, Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science, 1997. 277 (5322): p. 55-60.

PAGE 192

176 171. Oh, H, Takagi, H, Suzuma, K, Otan i, A, Matsumura, M, and Honda, Y, Hypoxia and vascular endothelial growth factor selectively up-regulate angiopoietin-2 in bovine microvascular endothelial cells. Journal of Biological Chemistry, 1999. 274 (22): p. 15732-15739. 172. Oh, H, Takagi, H, Takagi, C, Suzuma, K, Otani, A, Ishida, K, Matsumura, M, Ogura, Y, and Honda, Y, The potential angiogenic role of macrophages in the formation of choroidal neovascular membranes. Investigative Ophthalmology & Visual Science, 1999. 40 (9): p. 1891-1898. 173. Hackett, S F, Ozaki, H, Strauss, R W, Wahlin, K, Suri, C, Maisonpierre, P, Yancopoulos, G, and Campochiaro, P A, Angiopoietin 2 expression in the retina: Upregulation during physiologic and pathologic neovascularization. Journal of Cellular Physiology, 2000. 184 (3): p. 275-284. 174. Das, A, Talarico, N., Warren, E., McGuire, P.G., Inhibition of angiopoietin signaling suppresses retinal neovascularization in ARVO 2002: Ft. Lauderdale, FL. 175. Freyberger, H, Brocker, M, Yakut, H, Hammer, J, Effert, R, Schifferdecker, E, Schatz, N, and Derwahl, M, Increased levels of platelet-derived growth factor in vitreous fluid of patients with proliferative di abetic retinopathy. Experimental and Clinical Endocrinology & Diabetes, 2000. 108 (2): p. 106-109. 176. Mori, K, Gehlbach, P, Ando, A, McVe y, D, Wei, L, and Campochiaro, P A, Regression of ocular neovascularization in response to increased expression of pigment epithelium-derived factor. Investigative Ophthalmology & Visual Science, 2002. 43 (7): p. 2428-2434. 177. Mori, K, Gehlbach, P, Yamamoto, S, Dub, E, Zack, D J, Li, Q H, Berns, K I, Raisler, B J, Hauswirth, W W, and Campochiaro, P A, AAV-Mediated gene transfer of pigment epithelium-derived factor inhibits choroidal neovascularization. Investigative Ophthalmol ogy & Visual Science, 2002. 43 (6): p. 1994-2000. 178. Mori, K, Gehlbach, P, Ando, A, Dyer, G, Lipinsky, E, Chaudhry, A G, Hackett, S F, and Campochiaro, P A, Retina-specific expression of PDGF-B versus PDGF-A: Vascular versus nonvascular proliferative retinopathy. Investigative Ophthalmology & Visual Science, 2002. 43 (6): p. 2001-2006. 179. Vinores, S A, Seo, M S, Derevian ik, N L, and Campochiaro, P A, Photoreceptorspecific overexpression of platelet-derived growth factor induces proliferation of endothelial cells, pericytes, and glial cells and aberrant vascular development: an ultrastructural and immunocytochemical study. Developmental Brain Research, 2003. 140 (2): p. 169-183. 180. Stupack, D G, Integrins as a distinct subtype of dependence receptors. Cell Death and Differentiation, 2005. 12 (8): p. 1021-1030.

PAGE 193

177 181. Clemmons, D R, and Maile, L A, Interaction between insuli n-like growth factor-I receptor and alpha V beta 3 integrin linked signaling pathways: Cellular responses to changes in multiple signaling inputs. Molecular Endocrinology, 2005. 19 (1): p. 1-11. 182. ffrench-Constant, C, and Colognato, H, Integrins: versatile integrators of extracellular signals. Trends in Cell Biology, 2004. 14 (12): p. 678-686. 183. Brown, D A, and London, E, Structure and function of sphingolipidand cholesterol-rich membrane rafts. Journal of Biological Chemistry, 2000. 275 (23): p. 17221-17224. 184. Simons, K, and Toomre, D, Lipid rafts and signal transduction. Nature Reviews Molecular Cell Biology, 2000. 1 (1): p. 31-39. 185. Li, R H, Mitra, N, Gratkowski, H, Vilair e, G, Litvinov, R, Nagasami, C, Weisel, J W, Lear, J D, DeGrado, W F, and Bennett, J S, Activation of integrin alpha IIb beta 3 by modulation of transmemb rane helix associations. Science, 2003. 300 (5620): p. 795-798. 186. Klein, S, Giancotti, F G, Presta, M, Al belda, S M, Buck, C A, and Rifkin, D B, Basic Fibroblast Growth-Factor Modulates Integrin Expression in Microvascular Endothelial-Cells. Molecular Biology of the Cell, 1993. 4 (10): p. 973-982. 187. Mariotti, A, Kedeshian, P A, Dans, M, Curatola, A M, Gagnoux-Palacios, L, and Giancotti, F G, EGF-R signaling through Fyn kina se disrupts the function of integrin alpha 6 beta 4 at hemidesmosom es: role in epithelial cell migration and carcinoma invasion. Journal of Cell Biology, 2001. 155 (3): p. 447-457. 188. Byzova, T V, Goldman, C K, Pampori, N, Thomas, K A, Bett, A, Shattil, S J, and Plow, E F, A mechanism for modulation of cellu lar responses to VEGF: Activation of the integrins. Molecular Cell, 2000. 6 (4): p. 851-860. 189. Campochiaro, P A, and Hackett, S F, Ocular neovascularization: a valuable model system. Oncogene, 2003. 22 (42): p. 6537-6548. 190. Friedlander, M, Theesfeld, C L, Sugita, M, Fruttiger, M, Thomas, M A, Chang, S, and Cheresh, D A, Involvement of integrins alpha( v)beta(3) and alpha(v)beta(5) in ocular neovascular diseases. Proceedings of the Nationa l Academy of Sciences of the United States of America, 1996. 93 (18): p. 9764-9769. 191. Dwayne G. Stupack, D A C, ECM Remodeling Regulates Angiogenesis: Endothelial Integrins Look for New Ligands. Science's STKE, 2002: p. pe7. 192. Sahni, A, and Francis, C W, Stimulation of endothelial cel l proliferation by FGF-2 in the presence of fibrinogen requires alpha(v)beta(3). Blood, 2004. 104 (12): p. 3635-3641.

PAGE 194

178 193. Senger, D R, Perruzzi, C A, Streit, M, Koteliansky, V E, de Fougerolles, A R, and Detmar, M, The alpha(1)beta(1) and alpha(2)beta(1) Integrins provide critical support for vascular endothelial growth factor signaling, endothelial cell migration, and tumor angiogenesis. American Journal of Pathology, 2002. 160 (1): p. 195-204. 194. Stupack, D G, Puente, X S, Boutsaboual oy, S, Storgard, C M, and Cheresh, D A, Apoptosis of adherent cells by recruitmen t of caspase-8 to unligated integrins. Journal of Cell Biology, 2001. 155 (3): p. 459-470. 195. Soldi, R, Mitola, S, Strasly, M, Defilippi, P, Tarone, G, and Bussolino, F, Role of alpha(v)beta(3) integrin in the activation of vascular endothelial growth factor receptor-2. Embo Journal, 1999. 18 (4): p. 882-892. 196. De, S, Razorenova, O, McCabe, N P, O'Toole, T, Qin, J, and Byzova, T V, VEGFintegrin interplay controls tu mor growth and vascularization. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102 (21): p. 7589-7594. 197. Maile, L A, and Clemmons, D R, Regulation of insulin-like growth factor I receptor dephosphorylation by SHPS-1 and the tyrosine phosphatase SHP-2. Journal of Biological Chemistry, 2002. 277 (11): p. 8955-8960. 198. Ling, Y, Maile, L A, Badley-Clarke, J, and Clemmons, D R, DOK1 mediates SHP2 binding to the alpha V beta 3 integrin and thereby regulates insulin-like growth factor I signaling in cultured vascular smooth muscle cells. Journal of Biological Chemistry, 2005. 280 (5): p. 3151-3158. 199. Calderwood, D A, Fujioka, Y, de Pereda, J M, Garcia-Alvarez, B, Nakamoto, T, Margolis, B, McGlade, C J, Liddi ngton, R C, and Ginsberg, M H, Integrin beta cytoplasmic domain interactions wi th phosphotyrosine-binding domains: A structural prototype for diver sity in integrin signaling. Proceedings of the National Academy of Sciences of the United States of America, 2003. 100 (5): p. 2272-2277. 200. Maile, L A, and Clemmons, D R, The alpha V beta 3 integrin regulates insulin-like growth factor I (IGF-I) receptor phosphorylation by altering the rate of recruitment of the Src-homology 2-c ontaining phosphotyrosine phosphatase-2 to the activated IGF-I receptor. Endocrinology, 2002. 143 (11): p. 4259-4264. 201. Sergent T, B W, Maile LA, Clemmons DR, The heparin binding domain fo vitronectin can enhance IGF1 signaling through activation of alpha(v)beta(3) in an RGD independent manner in Program of the Annual Me eting of The Endocrine Society 2004: New Orleans, LA. 202. Maile LA, C D, Activation of calpain in response to IGF-1 stimulation is required for release of SHP-2 from alpha(v)beta (3) integrin and thereby regulates the transfer of SHP-2 to the IGF-1 receptor. in Program of the Annual Meeting of The Endocrine Society 2004: New Orleans.

PAGE 195

179 203. Gao, A G, Lindberg, F P, Dimitry, J M, Brown, E J, and Frazier, W A, Thrombospondin modulates alpha(v)beta(3) function through integrin-associated protein. Journal of Cell Biology, 1996. 135 (2): p. 533-544. 204. Maile, L A, Badley-Clarke, J, and Clemmons, D R, The association between integrin-associated protein and SHPS-1 re gulates insulin-like growth factor-I receptor signaling in vascular smooth muscle cells. Molecular Biology of the Cell, 2003. 14 (9): p. 3519-3528. 205. Dawson, D W, Volpert, O V, Gillis, P, Cr awford, S E, Xu, H J, Benedict, W, and Bouck, N P, Pigment epithelium-derived factor: A potent inhibitor of angiogenesis. Science, 1999. 285 (5425): p. 245-248. 206. Stellmach, V, Crawford, S E, Zhou, W, and Bouck, N, Prevention of ischemiainduced retinopathy by the natural oc ular antiangiogenic agent pigment epithelium-derived factor. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98 (5): p. 2593-2597. 207. Duh, E J, Yang, H S, Suzuma, I, Miyagi, M, Youngman, E, Mori, K, Katai, M, Yan, L, Suzuma, K, West, K, Davarya, S, Tong, P, Gehlbach, P, Pearlman, J, Crabb, J W, Aiello, L P, Campochiaro, P A, and Zack, D J, Pigment epitheliumderived factor suppresses ischemia-induced retinal ne ovascularization and VEGFinduced migration and growth. Investigative Ophthalmology & Visual Science, 2002. 43 (3): p. 821-829. 208. Spranger J, O M, Reimann M, Mohlig M, Ristow M, Francis MK, Cristofalo V, Hammes HP, Smith G, Boulton M, Pfeiffer AF, Loss of the antiangiogenic pigment epithelium-derived factor in patie nts with angiogen ic eye disease. Daibetes, 2001. 50 (12): p. 2641-2645. 209. Poulsen, J E, The Houssay Phenomenon in Man Recovery from Retinopathy in a Case of Diabetes with Simmonds Disease. Diabetes, 1953. 2 (1): p. 7-12. 210. Merimee, T J, Zapf, J, and Froesch, E R, Insulin-Like Growth-Factors Studies in Diabetics with and without Retinopathy. New England Journal of Medicine, 1983. 309 (9): p. 527-530. 211. Grant, M, Russell, B, Fitzgerald, C, and Merimee, T J, Insulin-Like GrowthFactors in Vitreous Studies in Control and Diabetic Subjects with Neovascularization. Diabetes, 1986. 35 (4): p. 416-420. 212. Dills, D G, Moss, S E, Klein, R, and Klein, B E K, Association of Elevated Igf-I Levels with Increased Retinopat hy in Late-Onset Diabetes. Diabetes, 1991. 40 (12): p. 1725-1730. 213. Smith, L E H, Kopchick, J J, Chen, W, Knapp, J, Kinose, F, Daley, D, Foley, E, Smith, R G, and Schaeffer, J M, Essential role of growth hormone in ischemiainduced retinal neovascularization. Science, 1997. 276 (5319): p. 1706-1709.

PAGE 196

180 214. Hellstrom, A, Perruzzi, C, Ju, M H, Engs trom, E, Hard, A L, Liu, J L, AlbertssonWikland, K, Carlsson, B, Niklasson, A, Sj odell, L, LeRoith, D, Senger, D R, and Smith, L E H, Low IGF-I suppresses VEGF-surv ival signaling in retinal endothelial cells: Direct correlation with clinical retinopathy of prematurity. Proceedings of the National Academy of Scie nces of the United States of America, 2001. 98 (10): p. 5804-5808. 215. Delafontaine, P, Insulin-like growth factor I and its binding proteins in the cardiovascular system. Cardiovascular Research, 1995. 30 : p. 825-834. 216. Delafontaine, P, Song, Y H, and Li, Y X, Expression, regulation, and function of IGF-1, IGF-1R, and IGF-1 binding proteins in blood vessels. Arteriosclerosis Thrombosis and Vascular Biology, 2004. 24 (3): p. 435-444. 217. Smith, L E H, Shen, W, Perruzzi, C, Soker, S, Kinose, F, Xu, X H, Robinson, G, Driver, S, Bischoff, J, Zhang, B, Schaeffer, J M, and Senger, D R, Regulation of vascular endothelial growth factor-dep endent retinal neovascularization by insulin-like growth factor-1 receptor. Nature Medicine, 1999. 5 (12): p. 1390-1395. 218. Liu, W L, Liu, Y Q, and Lowe, W L, The role of phosphatidylinositol 3-kinase and the mitogen-activated protein kinases in insulin-like growth factor-I-mediated effects in vascular endothelial cells. Endocrinology, 2001. 142 (5): p. 1710-1719. 219. Du, J, Meng, X P, and Delafontaine, P, Transcriptional regulation of the insulinlike growth factor-I receptor gene: Evid ence for protein kinase C-dependent and independent pathways. Endocrinology, 1996. 137 (4): p. 1378-1384. 220. Scheidegger, K J, Du, J, and Delafontaine, P, Distinct and common pathways in the regulation of insulin-like growth factor-1 receptor gene expression by angiotensin II and basic fibroblast growth factor. Journal of Biological Chemistry, 1999. 274 (6): p. 3522-3530. 221. Sakai, K, Busby, W H, Clar ke, J B, and Clemmons, D R, Tissue transglutaminase facilitates the polymerization of insulin -like growth factor-binding protein-1 (IGFBP-1) and leads to loss of IGFBP-1's abi lity to inhibit insulin-like growth factor-I-stimulated protein synthesis. Journal of Biological Chemistry, 2001. 276 (12): p. 8740-8745. 222. Moralez, A, Busby, W H, and Clemmons, D, Control of insulin-like growth factor binding protein-5 protease synthesis and secretion by human fibroblasts and porcine aortic smooth muscle cells. Endocrinology, 2003. 144 (6): p. 2489-2495. 223. Firth, S M, and Baxter, R C, Cellular actions of the insulin-like growth factor binding proteins. Endocrine Reviews, 2002. 23 (6): p. 824-854.

PAGE 197

181 224. Baxter, R C, Martin, J L, and Beniac, V A, High Molecular-Weight Insulin-Like Growth-Factor Binding-Protein Complex Purification and Properties of the AcidLabile Subunit from Human-Serum. Journal of Biological Chemistry, 1989. 264 (20): p. 11843-11848. 225. Jones, J I, Gockerman, A, Busby, W H, Wright, G, and Clemmons, D R, InsulinLike Growth-Factor Binding Protein-1 Stim ulates Cell-Migration and Binds to the Alpha-5-Beta-1 Integrin by Means of Its Arg-Gly-Asp Sequence. Proceedings of the National Academy of Sciences of the United States of America, 1993. 90 (22): p. 10553-10557. 226. Perks, C M, Newcomb, P V, Norman, M R, and Holly, J M P, Effect of insulin-like growth factor binding protein-1 on in tegrin signalling and the induction of apoptosis in human breast cancer cells. Journal of Molecu lar Endocrinology, 1999. 22 (2): p. 141-150. 227. Rajah, R, Valentinis, B, and Cohen, P, Insulin like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factorbeta 1 on programmed cell death through a p53and IGF-independent mechanism. Journal of Biological Chemistry, 1997. 272 (18): p. 12181-12188. 228. Firth, S M, Fanayan, S, Benn, D, and Baxter, R C, Development of resistance to insulin-like growth factor binding protein3 in transfected T47D breast cancer cells. Biochemical and Biophysical Research Communications, 1998. 246 (2): p. 325-329. 229. Miyake, H, Nelson, C, Rennie, P S, and Gleave, M E, Overexpression of insulinlike growth factor binding protein-5 helps accelerate progression to androgenindependence in the human prostate L NCaP tumor model through activation of phosphatidylinositol 3 '-kinase pathway. Endocrinology, 2000. 141 (6): p. 22572265. 230. Conover, C A, Glycosylation of Insulin-Like Gr owth-Factor Binding Protein-3 (Igfbp-3) Is Not Required for Potentiation of Igf-I Action Evidence for Processing of Cell-Bound Igfbp-3. Endocrinology, 1991. 129 (6): p. 3259-3268. 231. Karas, M, Danilenko, M, Fishman, D, LeRoith, D, Levy, J, and Sharoni, Y, Membrane-associated insulin-like growth fa ctor-binding protein-3 inhibits insulinlike growth factor-I-induced insulin-like growth factor-I receptor signaling in ishikawa endometrial cancer cells. Journal of Biological Chemistry, 1997. 272 (26): p. 16514-16520. 232. MohseniZadeh, S, and Binoux, M, Insulin-like growth factor (IGF) binding protein-3 interacts with the type 1 IG F receptor, reducing the affinity of the receptor for its ligand: an alternative m echanism in the regulation of IGF action. Endocrinology, 1997. 138 (12): p. 5645-5648.

PAGE 198

182 233. Williams, A C, Collard, T J, Perks, C M, Newcomb, P, Moorghen, M, Holly, J M P, and Paraskeva, C, Increased p53-dependent apoptosis by the insulin-like growth factor binding protein IGFBP-3 in human colonic adenoma-derived cells. Cancer Research, 2000. 60 (1): p. 22-27. 234. Butt, A J, Firth, S M, King, M A, and Baxter, R C, Insulin-like growth factorbinding protein-3 modulates expression of Bax and Bcl-2 and potentiates p53independent radiation-induced apoptosis in human breast cancer cells. Journal of Biological Chemistry, 2000. 275 (50): p. 39174-39181. 235. Hollowood, A D, Lai, T, Perks, C M, Newcomb, P V, Alderson, D, and Holly, J M P, IGFBP-3 prolongs the p53 response and enhances apoptosis following UV irradiation. International Jour nal of Cancer, 2000. 88 (3): p. 336-341. 236. Lee, D Y, Yi, H K, Hwang, P H, and Oh, Y, Enhanced expression of insulin-like growth factor binding protein-3 sensitizes th e growth inhibitory effect of anticancer drugs in gastric cancer cells. Biochemical and Biophysical Research Communications, 2002. 294 (2): p. 480-486. 237. Gucev, Z S, Oh, Y, Kelley, K M, and Rosenfeld, R G, Insulin-like growth factor binding protein 3 mediates retinoic acidand transforming growth factor beta 2induced growth inhibition in human breast cancer cells. Cancer Research, 1996. 56 (7): p. 1545-1550. 238. Huynh, H, Yang, X F, and Pollak, M, Estradiol and antiestrogens regulate a growth inhibitory insulinlike growth fa ctor binding protein 3 autocrine loop in human breast cancer cells. Journal of Biological Chemistry, 1996. 271 (2): p. 10161021. 239. Colston, K W, Perks, C M, Xie, S P, and Holly, J M P, Growth inhibition of both MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated with increased expression of in sulin-like growth fa ctor binding protein3. Journal of Molecular Endocrinology, 1998. 20 (1): p. 157-162. 240. Rozen, F, Zhang, J C, and Pollak, M, Antiproliferative action of tumor necrosis factor-alpha on MCF-7 breast cancer cells is associated with increased insulin-like growth factor binding protein-3 accumulation. International J ournal of Oncology, 1998. 13 (4): p. 865-869. 241. Ogrady, P, Liu, Q J, Huang, S S, and Huang, J S, Transforming Growth-FactorBeta (Tgf-Beta) Type-V Receptor Has a Tgf-Beta-Stimulated Serine ThreonineSpecific Autophosphorylation Activity. Journal of Biological Chemistry, 1992. 267 (29): p. 21033-21037. 242. Fanayan, S, Firth, S M, and Baxter, R C, Signaling through the Smad pathway by insulin-like growth factor-binding protein-3 in breast cancer cel ls Relationship to transforming growth factor-beta 1 signaling. Journal of Biological Chemistry, 2002. 277 (9): p. 7255-7261.

PAGE 199

183 243. Conover, C A, Bale, L K, Durham, S K, and Powell, D R, Insulin-like growth factor (IGF) binding protein3 potentiation of IGF acti on is mediated through the phosphatidylinositol-3-kinase pathway and is associated with alteration in protein kinase B/AKT sensitivity. Endocrinology, 2000. 141 (9): p. 3098-3103. 244. Martin, J L, and Baxter, R C, Oncogenic ras causes resistance to the growth inhibitor insulin-like growth factor bindi ng protein-3 (IGFBP-3) in breast cancer cells. Journal of Biological Chemistry, 1999. 274 (23): p. 16407-16411. 245. Spagnoli, A, Torello, M, Nagalla, S R, Ho rton, W A, Pattee, P, Hwa, V, Chiarelli, F, Roberts, C T, and Rosenfeld, R G, Identification of STAT-1 as a molecular target of IGFBP-3 in the process of chondrogenesis. Journal of Biological Chemistry, 2002. 277 (21): p. 18860-18867. 246. Boisclair, Y R, Rhoads, R P, Ueki, I, Wang, J, and Ooi, G T, The acid-labile subunit (ALS) of the 150 kDa IGF-bindi ng protein complex: an important but forgotten component of th e circulating IGF system. Journal of Endocrinology, 2001. 170 (1): p. 63-70. 247. Holman, S R, and Baxter, R C, Insulin-like growth factor binding protein-3: Factors affecting binary and ternary complex formation. Growth Regulation, 1996. 6 (1): p. 42-47. 248. Chin, E, Zhou, J, Dai, J, Baxter, R C, and Bondy, C A, Cellular-Localization and Regulation of Gene-Expression for Compone nts of the Insulin-Like Growth-Factor Ternary Binding-Protein Complex. Endocrinology, 1994. 134 (6): p. 2498-2504. 249. Janosi JB, T S, Firth SM, Baxter RC & Delhanty PJD. Histochemical examination of the acid-labile subunit protein in human tissue. in Proceedings of the 5th International Symposium on Insulin-like Growth Factors, 1999. 250. Ooi, G T, Cohen, F J, Tseng, L Y H, Rechler, M M, and Boisclair, Y R, Growth hormone stimulates transcri ption of the gene encodi ng the acid-labile subunit (ALS) of the circulating insulin-like growth factor-binding protein complex and ALS promoter activity in rat liver. Molecular Endocrinology, 1997. 11 (7): p. 9971007. 251. Schindler, C, and Darnell, J E, Transcriptional Responses to Polypeptipe Ligands the Jak-Stat Pathway. Annual Review of Biochemistry, 1995. 64 : p. 621-651. 252. CarterSu, C, Schwartz, J, and Smit, L S, Molecular mechanism of growth hormone action. Annual Review of Physiology, 1996. 58 : p. 187-207. 253. Zapf, J, Hauri, C, Futo, E, Hussain, M, Rutishauser, J, Maack, C A, and Froesch, E R, Intravenously Injected Insulin-Like Grow th-Factor (Igf) I/Igf Binding Protein-3 Complex Exerts Insulin-Li ke Effects in Hypophysectomiz ed, but Not in Normal Rats. Journal of Clinic al Investigation, 1995. 95 (1): p. 179-186.

PAGE 200

184 254. Rother, K I, and Accili, D, Role of insulin receptors and IGF receptors in growth and development. Pediatric Nephrology, 2000. 14 (7): p. 558-561. 255. Kondo, T, Vicent, D, Suzuma, K, Yanagi sawa, M, King, G L, Holzenberger, M, and Kahn, C R, Knockout of insulin and IGF-1 receptors on vascular endothelial cells protects against re tinal neovascularization. Journal of Clini cal Investigation, 2003. 111 (12): p. 1835-1842. 256. Bronson, S K, Reiter, C E N, and Gardner, T W, An eye on insulin. Journal of Clinical Investigation, 2003. 111 (12): p. 1817-1819. 257. Fritz, J J, Lewin, A, Hauswirth, W, Agarwal, A, Grant, M, and Shaw, L, Development of hammerhead ribozymes to modulate endogenous gene expression for functional studies. Methods, 2002. 28 (2): p. 276-285. 258. Kurreck, J, Antisense technologies Improvement through novel chemical modifications. European Journal of Biochemistry, 2003. 270 (8): p. 1628-1644. 259. Zamecnik, P C, and Stephenson, M L, Inhibition of Rous-Sarcoma VirusReplication and Cell Transformation by a Specific Oligodeoxynucleotide. Proceedings of the National Academy of Scie nces of the United States of America, 1978. 75 (1): p. 280-284. 260. Shaw, L C, and Lewin, A S, Protein-Induced Folding of a Group-I Intron in Cytochrome-B Pre-Messenger-Rna. Journal of Biological Chemistry, 1995. 270 (37): p. 21552-21562. 261. Milner, N, Mir, K U, and Southern, E M, Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nature Biotechnology, 1997. 15 (6): p. 537541. 262. Brown, D A, Kang, S H, Gryaznov, S M, Dedionisio, L, Heidenreich, O, Sullivan, S, Xu, X, and Nerenberg, M I, Effect of Phosphorothi oate Modification of Oligodeoxynucleotides on Specific Protein-Binding. Journal of Biological Chemistry, 1994. 269 (43): p. 26801-26805. 263. Fedora, M J, and Williamson, J R, The catalytic diversity of RNAS. Nature Reviews Molecular Cell Biology, 2005. 6 (5): p. 399-412. 264. Tsui, L C, The Spectrum of Cystic-Fibrosis Mutations. Trends in Genetics, 1992. 8 (11): p. 392-398. 265. Michel, F, Hanna, M, Green, R, Bartel, D P, and Szostak, J W, The Guanosine Binding-Site of the Tetrahymena Ribozyme. Nature, 1989. 342 (6248): p. 391-395. 266. Frank, D N, and Pace, N R, Ribonuclease P: Unity and diversity in a tRNA processing ribozyme. Annual Review of Biochemistry, 1998. 67 : p. 153-180.

PAGE 201

185 267. Altman S, K L I G R, Cech TR, Atkins JF, editors., In the RNA World. 2nd ed. 1999, Cold Spring Harbor, NY.: Cold Spring Harbor Laboratory Press. 351-380. 268. Guerriertakada, C, Gardiner, K, Marsh, T, Pace, N, and Altman, S, The Rna Moiety of Ribonuclease-P Is the Cata lytic Subunit of the Enzyme. Cell, 1983. 35 (3): p. 849857. 269. Niranjanakumari, S, Stams, T, Crary, S M, Christianson, D W, and Fierke, C A, Protein component of the ribozyme ribonuc lease P alters substrate recognition by directly contacting precursor tRNA. Proceedings of the National Academy of Sciences of the United States of America, 1998. 95 (26): p. 15212-15217. 270. Reich, C, Olsen, G J, Pace, B, and Pace, N R, Role of the Protein Moiety of Ribonuclease-P, a Ribon ucleoprotein Enzyme. Science, 1988. 239 (4836): p. 178181. 271. Bothwell, A L M, Garber, R L, and Altman, S, Nucleotide-Sequence and Invitro Processing of a Precursor Molecu le to Escherichia-Coli 4.5 S Rna. Journal of Biological Chemistry, 1976. 251 (23): p. 7709-7716. 272. Alifano, P, Rivellini, F, Piscitelli, C, Arraiano, C M, Bruni, C B, and Carlomagno, M S, Ribonuclease-E Provides Substrates for Ribonuclease P-Dependent Processing of a Polycistronic Messenger-Rna. Genes & Development, 1994. 8 (24): p. 3021-3031. 273. Komine, Y, Kitabatake, M, Yokogawa, T, Nishikawa, K, and Inokuchi, H, A Transfer-Rna-Like Structure Is Present in 10sa Rna, a Small Stable Rna from Escherichia-Coli. Proceedings of the National Acad emy of Sciences of the United States of America, 1994. 91 (20): p. 9223-9227. 274. Forster, A C, and Altman, S, External Guide Sequences for an Rna Enzyme. Science, 1990. 249 (4970): p. 783-786. 275. Raj, S M L, and Liu, F Y, Engineering of RNase P ribozyme for gene-targeting applications. Gene, 2003. 313 : p. 59-69. 276. Hutchins, C J, Rathjen, P D, Fo rster, A C, and Symons, R H, Self-Cleavage of Plus and Minus Rna Transcripts of Avocado Sunblotch Viroid. Nucleic Acids Research, 1986. 14 (9): p. 3627-3640. 277. Buzayan, J M, Gerlach, W L, and Bruening, G, Nonenzymatic Cleavage and Ligation of Rnas Complementary to a Plant-Virus Satellite Rna. Nature, 1986. 323 (6086): p. 349-353. 278. Pley, H W, Flaherty, K M, and Mckay, D B, 3-Dimensional Structure of a Hammerhead Ribozyme. Nature, 1994. 372 (6501): p. 68-74.

PAGE 202

186 279. Scott, W G, Finch, J T, and Klug, A, The Crystal-Structure of an All-Rna Hammerhead Ribozyme a Proposed Mechanism for Rna Catalytic Cleavage. Cell, 1995. 81 (7): p. 991-1002. 280. Branch, A D, and Robertson, H D, A Replication Cycle for Viroids and Other Small Infectious Rnas. Science, 1984. 223 (4635): p. 450-455. 281. Shimayama, T, Nishikawa, S, and Taira, K, Generality of the Nux Rule KineticAnalysis of the Results of Systematic Muta tions in the Trinucleotide at the Cleavage Site of Hammerhead Ribozymes. Biochemistry, 1995. 34 (11): p. 3649-3654. 282. Murray, J B, Seyhan, A A, Walter, N G, Burke, J M, and Scott, W G, The hammerhead, hairpin and VS ribozymes are catalytically profic ient in monovalent cations alone. Chemistry & Biology, 1998. 5 (10): p. 587-595. 283. Joyce, G F, RNA cleavage by the 10-23 DNA enzyme. Ribonucleases, Pt A, 2001. 341 : p. 503-517. 284. Cedergren, R, Rna the Catalyst. Biochemistry and Cell Biology-Biochimie Et Biologie Cellulaire, 1990. 68 (6): p. 903-906. 285. Hampel, A, Tritz, R, Hicks, M, and Cruz, P, Hairpin Catalytic Rna Model Evidence for Helices and Sequen ce Requirement for Substrate Rna. Nucleic Acids Research, 1990. 18 (2): p. 299-304. 286. Earnshaw, D J, and Gait, M J, Hairpin ribozyme cleavage catalyzed by aminoglycoside antibiotics and the polyamin e spermine in the absence of metal ions. Nucleic Acids Research, 1998. 26 (24): p. 5551-5561. 287. Khan AU, L S, The white halo plaque phenotype of bacteriophage T4: Its uses and applications in screen ing and mapping of splici ngdefective mutants. J Biochem Mol Biol Biophys, 2001. 5 : p. 237-242. 288. Kuo, M Y P, Sharmeen, L, Dintergottlieb, G, and Taylor, J, Characterization of Self-Cleaving Rna Sequences on the Ge nome and Antigenome of Human Hepatitis Delta-Virus. Journal of Virology, 1988. 62 (12): p. 4439-4444. 289. Collins, R A, and Saville, B J, Independent Transfer of Mitochondrial Chromosomes and Plasmids during Unst able Vegetative Fusion in Neurospora. Nature, 1990. 345 (6271): p. 177-179. 290. Fire, A, Xu, S Q, Montgomery, M K, Ko stas, S A, Driver, S E, and Mello, C C, Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 1998. 391 (6669): p. 806-811. 291. Lavorgna, G, Dahary, D, Lehner, B, So rek, R, Sanderson, C M, and Casari, G, In search of antisense. Trends in Biochemical Sciences, 2004. 29 (2): p. 88-94.

PAGE 203

187 292. Dykxhoorn DM, P D, Lieberman J., The silent treatment: siRNAs as small molecule drugs. Gene Therapy, 2006. 13 (6): p. 541-552. 293. Barik, S, Development of gene-specific double-stranded RNA drugs. Annals of Medicine, 2004. 36 (7): p. 540-551. 294. Schwarz, D S, Hutvagner, G, Haley, B, and Zamore, P D, Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Molecular Cell, 2002. 10 (3): p. 537-548. 295. Nykanen, A, Haley, B, and Zamore, P D, ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell, 2001. 107 (3): p. 309-321. 296. Chiu, Y L, and Rana, T M, RNAi in human cells: Basic structural and functional features of small interfering RNA. Molecular Cell, 2002. 10 (3): p. 549-561. 297. Bartel, D P, MicroRNAs: Genomics, biogene sis, mechanism, and function. Cell, 2004. 116 (2): p. 281-297. 298. Lee, Y, Ahn, C, Han, J J, Choi, H, Kim, J, Yim, J, Lee, J, Provost, P, Radmark, O, Kim, S, and Kim, V N, The nuclear RNase III Drosha initiates microRNA processing. Nature, 2003. 425 (6956): p. 415-419. 299. Lund, E, Guttinger, S, Calado, A, Dahlberg, J E, and Kutay, U, Nuclear export of microRNA precursors. Science, 2004. 303 (5654): p. 95-98. 300. Jackson, A L, and Linsley, P S, Noise amidst the silence: off-target effects of siRNAs? Trends in Genetics, 2004. 20 (11): p. 521-524. 301. Paddison, P J, Caudy, A A, Bernstein, E, Hannon, G J, and Conklin, D S, Short hairpin RNAs (shRNAs) induce sequencespecific silencing in mammalian cells. Genes & Development, 2002. 16 (8): p. 948-958. 302. Brummelkamp, T R, Bernards, R, and Agami, R, A system for stable expression of short interfering RNAs in mammalian cells. Science, 2002. 296 (5567): p. 550-553. 303. BR., C, Induction of stable RNA interference in mammalian cells. Gene Therapy, 2006. 13 (6): p. 503-508. 304. Green, R, and Lorsch, J R, The path to perdition is paved with protons. Cell, 2002. 110 (6): p. 665-668. 305. Benkovic, S, Schray, K., Then Enzymes ed. Boyer. Vol. 8. 1973, New York: Academic Press. 201-238. 306. Young, K J, Gill, F, and Grasby, J A, Metal ions play a passi ve role in the hairpin ribozyme catalysed reaction. Nucleic Acids Research, 1997. 25 (19): p. 3760-3766.

PAGE 204

188 307. Zhang, H D, Kolb, F A, Brondani, V, Billy, E, and Filipowicz, W, Human Dicer preferentially cleaves dsRN As at their termini without a requirement for ATP. Embo Journal, 2002. 21 (21): p. 5875-5885. 308. Reynolds, A, Leake, D, Boese, Q, Scaringe, S, Marshall, W S, and Khvorova, A, Rational siRNA design for RNA interference. Nature Biotechnology, 2004. 22 (3): p. 326-330. 309. Kim, D H, Behlke, M A, Rose, S D, Chang, M S, Choi, S, and Rossi, J J, Synthetic dsRNA Dicer substrates enhan ce RNAi potency and efficacy. Nature Biotechnology, 2005. 23 (2): p. 222-226. 310. Bitko, V, Musiyenko, A, Shulyayeva, O, and Barik, S, Inhibition of respiratory viruses by nasally administered siRNA. Nature Medicine, 2005. 11 (1): p. 50-55. 311. Hutvagner, G, McLachlan, J, Pasquinelli, A E, Balint, E, Tuschl, T, and Zamore, P D, A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science, 2001. 293 (5531): p. 834-838. 312. Persengiev, S P, Zhu, X C, and Green, M R, Nonspecific, concentration-dependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). Rna-a Publication of the Rna Society, 2004. 10 (1): p. 12-18. 313. Sledz, C A, Holko, M, de Veer, M J, Silverman, R H, and Williams, B R G, Activation of the interferon system by short-interfering RNAs. Nature Cell Biology, 2003. 5 (9): p. 834-839. 314. Bridge, A J, Pebernard, S, Ducra ux, A, Nicoulaz, A L, and Iggo, R, Induction of an interferon response by RNAi vectors in mammalian cells. Nature Genetics, 2003. 34 (3): p. 263-264. 315. Soutschek, J, Akinc, A, Bramlage, B, Charisse, K, Constien, R, Donoghue, M, Elbashir, S, Geick, A, Hadwiger, P, Har borth, J, John, M, Kesavan, V, Lavine, G, Pandey, R K, Racie, T, Rajeev, K G, Rohl I, Toudjarska, I, Wang, G, Wuschko, S, Bumcrot, D, Koteliansky, V, Limmer, S, Manoharan, M, and Vornlocher, H P, Therapeutic silencing of an endogenous gene by syst emic administration of modified siRNAs. Nature, 2004. 432 (7014): p. 173-178. 316. Layzer, J M, McCaffrey, A P, Tanner, A K, Huang, Z, Kay, M A, and Sullenger, B A, In vivo activity of nucl ease-resistant siRNAs. Rna-a Publication of the Rna Society, 2004. 10 (5): p. 766-771. 317. Schiffelers, R M, Ansari, A, Xu, J, Zhou, Q, Tang, Q Q, Storm, G, Molema, G, Lu, P Y, Scaria, P V, and Woodle, M C, Cancer siRNA therapy by tumor selective delivery with ligand-targeted sterically stabilized nanoparticle. Nucleic Acids Research, 2004. 32 (19): p. -.

PAGE 205

189 318. Harborth, J, Elbashir, S M, Vandenburgh, K, Manninga, H, Scaringe, S A, Weber, K, and Tuschl, T, Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense & Nucleic Acid Drug Development, 2003. 13 (2): p. 83-105. 319. Chiu, Y L, and Rana, T M, siRNA function in RNAi: A chemical modification analysis. Rna-a Publication of the Rna Society, 2003. 9 (9): p. 1034-1048. 320. Czauderna, F, Fechtner, M, Dames, S, Aygun, H, Klippel, A, Pronk, G J, Giese, K, and Kaufmann, J, Structural variations and stabili sing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Research, 2003. 31 (11): p. 2705-2716. 321. Amarzguioui, M, Holen, T, Babaie, E, and Prydz, H, Tolerance for mutations and chemical modifications in a siRNA. Nucleic Acids Research, 2003. 31 (2): p. 589595. 322. Snyder, R O, Miao, C H, Patijn, G A, Sp ratt, S K, Danos, O, Nagy, D, Gown, A M, Winther, B, Meuse, L, Cohen, L K, Thompson, A R, and Kay, M A, Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nature Genetics, 1997. 16 (3): p. 270-276. 323. Gerard, R D, and Collen, D, Adenovirus gene therapy for hypercholesterolemia, thrombosis and restenosis. Cardiovascular Research, 1997. 35 (3): p. 451-458. 324. Virus Vectors & Gene Therapy:Problems, Promises & Prospects 2004, Microbiology @ Leicester. 325. Robbins, P D, and Ghivizzani, S C, Viral vectors for gene therapy. Pharmacology & Therapeutics, 1998. 80 (1): p. 35-47. 326. Wang, C Y, and Huang, L, Ph-Sensitive Immunoliposomes Mediate Target-CellSpecific Delivery and Controlled Expre ssion of a Foreign Gene in Mouse. Proceedings of the National Academy of Scie nces of the United States of America, 1987. 84 (22): p. 7851-7855. 327. Stavridis, J C, Deliconstantinos, G, Psallidopoulos, M C, Armenakas, N A, Hadjiminas, D J, and Hadjiminas, J, Construction of Transfe rrin-Coated Liposomes for Invivo Transport of Exogenous DNA to Bone-Marrow Erythroblasts in Rabbits. Experimental Cell Research, 1986. 164 (2): p. 568-572. 328. Dzau, V J, Mann, M J, Morishita, R, and Kaneda, Y, Fusigenic viral liposome for gene therapy in cardiovascular diseases. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93 (21): p. 11421-11425. 329. Kootstra, N A, and Verma, I M, Gene therapy with viral vectors. Annual Review of Pharmacology and Toxicology, 2003. 43 : p. 413-439.

PAGE 206

190 330. Lu, Y, Recombinant adeno-associated virus as delivery vector for gene therapy A review. Stem Cells and Development, 2004. 13 (1): p. 133-145. 331. Hallahan, D E, Mauceri, H J, Seung, L P, Dunphy, E J, Wayne, J D, Hanna, N N, Toledano, A, Hellman, S, Kufe, D W, and Weichselbaum, R R, Spatial and Temporal Control of Gene-The rapy Using Ionizing-Radiation. Nature Medicine, 1995. 1 (8): p. 786-791. 332. Rivera, V M, Clackson, T, Natesan, S, Pollo ck, R, Amara, J F, Keenan, T, Magari, S R, Phillips, T, Courage, N L, Cerasoli, F, Holt, D A, and Gilman, M, A humanized system for pharmacologic control of gene expression. Nature Medicine, 1996. 2 (9): p. 1028-1032. 333. Wang, Y, Xu, J, Pierson, T, OMalley, B W, and Tsai, S Y, Positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator. Gene Therapy, 1997. 4 (5): p. 432-441. 334. Merten, O W, Geny-Fiamma C, and Douar, A M, Current issues in adenoassociated viral vector production. Gene Therapy, 2005. 12 : p. S51-S61. 335. Li, C W, Bowles, D E, van Dyke, T, and Samulski, R J, Adeno-associated virus vectors: potential applications for cancer gene therapy. Cancer Gene Therapy, 2005. 12 (12): p. 913-925. 336. Summerford, C, and Samulski, R J, Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. Journal of Virology, 1998. 72 (2): p. 1438-1445. 337. Summerford, C, Bartlett, J S, and Samulski, R J, alpha V beta 5 integrin: a coreceptor for adeno-associated virus type 2 infection. Nature Medicine, 1999. 5 (1): p. 78-82. 338. Qing, K, Mah, C, Hansen, J, Zhou, S Z, Dwarki, V, and Srivastava, A, Human fibroblast growth factor receptor 1 is a co-receptor for infection by adenoassociated virus 2. Nature Medicine, 1999. 5 (1): p. 71-77. 339. Bartlett, J S, Wilcher, R, and Samulski, R J, Infectious entry pathway of adenoassociated virus and adeno-associated virus vectors. Journal of Virology, 2000. 74 (6): p. 2777-2785. 340. McCarty, D M, Monahan, P E, and Samulski, R J, Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Therapy, 2001. 8 (16): p. 12481254. 341. Young, S M, McCarty, D M, Degtya reva, N, and Samulski, R J, Roles of adenoassociated virus Rep protein and hum an chromosome 19 in site-specific recombination. Journal of Virology, 2000. 74 (9): p. 3953-3966.

PAGE 207

191 342. Xiao, X, Li, J, and Samulski, R J, Production of high-tite r recombinant adenoassociated virus vectors in th e absence of helper adenovirus. Journal of Virology, 1998. 72 (3): p. 2224-2232. 343. Grimm, D, Kay, M A, and Kleinschmidt, J A, Helper virus-free, optically controllable, and two-plasmid-based produc tion of adeno-associated virus vectors of serotypes 1 to 6. Molecular Therapy, 2003. 7 (6): p. 839-850. 344. Zolotukhin, S, Byrne, B J, Mason, E, Zolotukhin, I, Potter, M, Chesnut, K, Summerford, C, Samulski, R J, and Muzyczka, N, Recombinant adeno-associated virus purification using no vel methods improves in fectious titer and yield. Gene Therapy, 1999. 6 (6): p. 973-985. 345. Clark, K R, Liu, X L, McGr ath, J P, and Johnson, P R, Highly purified recombinant adeno-associated virus vectors are biologica lly active and free of detectable helper and wild-type viruses. Human Gene Therapy, 1999. 10 (6): p. 1031-1039. 346. Bartlett, J S, Kleinschmidt, J, Boucher, R C, and Samulski, R J, Targeted adenoassociated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab 'gamma)(2) antibody. Nature Biotechnology, 1999. 17 (2): p. 181186. 347. Wu, P, Xiao, W, Conlon, T, Hughes, J, Agbandje-McKenna, M, Ferkol, T, Flotte, T, and Muzyczka, N, Mutational analysis of the ade no-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism. Journal of Virology, 2000. 74 (18): p. 8635-8647. 348. Worgall, S, Wolff, G, FalckP edersen, E, and Crystal, R G, Innate immune mechanisms dominate elimination of ade noviral vectors following in vivo administration. Human Gene Therapy, 1997. 8 (1): p. 37-44. 349. Hong, S S, Karayan, L, Tournier, J, Curiel, D T, and Boulanger, P A, Adenovirus type 5 fiber knob binds to MHC class I alpha 2 domain at the surface of human epithelial and B ly mphoblastoid cells. Embo Journal, 1997. 16 (9): p. 2294-2306. 350. Bergelson, J M, Cunningham, J A, Droguett G, KurtJones, E A, Krithivas, A, Hong, J S, Horwitz, M S, Crowell, R L, and Finberg, R W, Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science, 1997. 275 (5304): p. 1320-1323. 351. Rother, R P, Fodor, W L, Springhorn, J P, Birks, C W, Setter, E, Sandrin, M S, Squinto, S P, and Rollins, S A, A Novel Mechanism of Retrovirus Inactivation in Human Serum Mediated by Anti-Al pha-Galactosyl Natural Antibody. Journal of Experimental Medicine, 1995. 182 (5): p. 1345-1355.

PAGE 208

192 352. Rollins, S A, Birks, C W, Setter, E, Squinto, S P, and Rother, R P, Retroviral vector producer cell killing in human serum is mediated by natural antibody and complement: Strategies for evadi ng the humoral immune response. Human Gene Therapy, 1996. 7 (5): p. 619-626. 353. Shaw, L C, Afzal, A, Lewin, A S, Timmers A M, Spoerri, P E, and Grant, M B, Decreased expression of the insulin-like growth factor 1 receptor by ribozyme cleavage. Investigative Ophthalmol ogy & Visual Science, 2003. 44 (9): p. 41054113. 354. Grant, M B, and Guay, C, Plasminogen-Activator Produc tion by Human Retinal Endothelial-Cells of Nondiabetic and Diabetic Origin. Investigative Ophthalmology & Visual Science, 1991. 32 (1): p. 53-64. 355. Rubini, M, Hongo, A, DAmbrosio, C, and Baserga, R, The IGF-I receptor in mitogenesis and transformation of mouse em bryo cells: Role of receptor number. Experimental Cell Research, 1997. 230 (2): p. 284-292. 356. Autiero, M, Waltenberger, J, Communi, D, Kranz, A, Moons, L, Lambrechts, D, Kroll, J, Plaisance, S, De Mol, M, Bono, F, Kliche, S, Fellbrich, G, Ballmer-Hofer, K, Maglione, D, Mayr-Beyrle, U, Dewerc hin, M, Dombrowski, S, Stanimirovic, D, Van Hummelen, P, Dehio, C, Hicklin, D J, Persico, G, Herbert, J M, Communi, D, Shibuya, M, Collen, D, Conway, E M, and Carmeliet, P, Role of PIGF in the intraand intermolecular cross talk betwee n the VEGF receptors Flt1 and Flk1. Nature Medicine, 2003. 9 (7): p. 936-943. 357. Hiratsuka, S, Maru, Y, Okada, A, Seiki, M, Noda, T, and Shibuya, M, Involvement of Flt-1 tyrosine kinase (vascular endot helial growth factor receptor-1) in pathological angiogenesis. Cancer Research, 2001. 61 (3): p. 1207-1213. 358. Bussolati, B, Dunk, C, Grohman, M, K ontos, C D, Mason, J, and Ahmed, A, Vascular endothelial growth factor r eceptor-1 modulates vascular endothelial growth factor-mediated angiogenesis via nitric oxide. American Journal of Pathology, 2001. 159 (3): p. 993-1008. 359. Hattori, K, Heissig, B, Wu, Y, Dias, S, Te jada, R, Ferris, B, Hicklin, D J, Zhu, Z P, Bohlen, P, Witte, L, Hendrikx, J, Hackett, N R, Crystal, R G, Moore, M A S, Werb, Z, Lyden, D, and Rafii, S, Placental growth factor reconstitutes hematopoiesis by recruiting VEGFR1(+) stem cells from bone-marrow microenvironment. Nature Medicine, 2002. 8 (8): p. 841-849. 360. Tripathi, R C, Li, J P, Tripathi, B J, Chalam, K V, and Adamis, A P, Increased level of vascular endothelial growth fact or in aqueous humor of patients with neovascular glaucoma. Ophthalmology, 1998. 105 (2): p. 232-237. 361. Spoerri PE, R W, Player D, Groome AB, Alexander T, Bodkin NL, Hansen BC, Grant MB., Diabetes related increase in plasminogen activator inhibitor-1 expression in monkey retinal capillaries. Int J Diabetes, 1998. 6

PAGE 209

193 362. Grant, M B, Ellis, E A, Caballero, S, and Mames, R N, Plasminogen activator inhibitor-1 overexpression in nonpr oliferative diabetic retinopathy. Experimental Eye Research, 1996. 63 (3): p. 233-244. 363. Gaudry, M, Brgerie, O, Andrieu, V, ElBe nna, J, Pocidalo, M A, and Hakim, J, Intracellular pool of vascular endothelia l growth factor in human neutrophils. Blood, 1997. 90 (10): p. 4153-4161. 364. Ishida, S, Usui, T, Yamashiro, K, Kaji, Y, Amano, S, Ogura, Y, Hida, T, Oguchi, Y, Ambati, J, Miller, J W, Gragoudas, E S, Ng, Y S, D'Amore, P A, Shima, D T, and Adamis, A P, VEGF(164)-mediated inflammation is required for pathological, but not physiological, ischemia-i nduced retinal neovascularization. Journal of Experimental Medicine, 2003. 198 (3): p. 483-489. 365. LC Shaw, H P, A Afzal, SL Calzi, PE Spoerri, SM Sullivan and MB Grant, Proliferating endothelial cell-specific expression of IGF-I receptor ribozyme inhibits retinal neovascularization. Gene Therapy, 2006: p. 1-9. 366. Anwer, K, Kao, G, Proctor, B, Rolland, A, and Sullivan, S, Optimization of cationic lipid/DNA complexes for system ic gene transfer to tumor lesions. Journal of Drug Targeting, 2000. 8 (2): p. 125-135. 367. Anwer, K, Meaney, C, Kao, G, Hussain, N, Shelvin, R, Earls, R M, Leonard, P, Quezada, A, Rolland, A P, and Sullivan, S M, Cationic lipid-based delivery system for systemic cancer gene therapy. Cancer Gene Therapy, 2000. 7 (8): p. 1156-1164. 368. Gariano, R F, and Gardner, T W, Retinal angiogenesis in development and disease. Nature, 2005. 438 (7070): p. 960-966. 369. Harris, A, Arend, O, Danis, R P, Ev ans, D, Wolf, S, and Martin, B J, Hyperoxia improves contrast sensitivity in early diabetic retinopathy. British Journal of Ophthalmology, 1996. 80 (3): p. 209-213. 370. Nguyen, Q D, Shah, S M, Van Anden, E, Sung, J U, Vitale, S, and Campochiaro, P A, Supplemental oxygen improves diabetic macular edema: A pilot study. Investigative Ophthalmol ogy & Visual Science, 2004. 45 (2): p. 617-624. 371. Stefansson, E, Hatchell, D L, Fisher, B L, Sutherland, F S, and Machemer, R, Panretinal Photocoagulation and Retinal Oxygenation in Normal and Diabetic Cats. American Journal of Ophthalmology, 1986. 101 (6): p. 657-664. 372. Stefansson, E, Peterson, J I, and Wang, Y H, Intraocular Oxygen-Tension Measured with a Fiber-Optic Sensor in Normal and Diabetic Dogs. American Journal of Physiology, 1989. 256 (4): p. H1127-H1133. 373. Linsenmeier, R A, Braun, R D, McRiple y, M A, Padnick, L B, Ahmed, J, Hatchell, D L, McLeod, D S, and Lutty, G A, Retinal hypoxia in l ong-term diabetic cats. Investigative Ophthalmol ogy & Visual Science, 1998. 39 (9): p. 1647-1657.

PAGE 210

194 374. Poulaki, V, Joussen, A M, Mitsiades, N, Mitsiades, C S, Iliaki, E F, and Adamis, A P, Insulin-like growth factor -I plays a pathogenetic role in diabetic retinopathy. American Journal of Pathology, 2004. 165 (2): p. 457-469. 375. Gardner, J L, and Lisberger, S G, Serial linkage of target selection for orienting and tracking eye movements. Nature Neuroscience, 2002. 5 (9): p. 892-899. 376. Holcik, M, Sonenberg, N, and Korneluk, R G, Internal ribosome initiation of translation and the control of cell death. Trends in Genetics, 2000. 16 (10): p. 469473. 377. Dykxhoorn, D M, Novina, C D, and Sharp, P A, Killing the messenger: Short RNAs that silence gene expression. Nature Reviews Molecular Cell Biology, 2003. 4 (6): p. 457-467. 378. Dykxhoorn, D M, and Lieberman, J, The silent revolution: RNA interference as basic biology, research tool, and therapeutic. Annual Review of Medicine, 2005. 56 : p. 401-423. 379. Bertrand, J R, Pottier, M, Vekris, A, Opolon, P, Maksimenko, A, and Malvy, C, Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochemical and Biophysical Re search Communications, 2002. 296 (4): p. 10001004. 380. Tassakka, A C M A R, Savan, R, Watanuki, H, and Sakai, M, The in vitro effects of CpG oligodeoxynucleotides on the expre ssion of cytokine genes in the common carp (Cyprinus carpio L.) head kidney cells. Veterinary Immunology and Immunopathology, 2006. 110 (1-2): p. 79-85. 381. Wong-Staal, F, Poeschla, E M, and Looney, D J, A controlled, phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transduced with a ri bozyme that cleaves HIV-1 RNA. Human Gene Therapy, 1998. 9 (16): p. 2407-2425. 382. Amado, R G, Mitsuyasu, R T, Symonds, G, Rosenblatt, J D, Zack, J, Sun, L O, Miller, M, Ely, J, and Gerlach, W, A phase I trial of autologous CD34(+) hematopoietic progenitor cells trans duced with an anti-HIV ribozyme. Human Gene Therapy, 1999. 10 (13): p. 2255-+. 383. Winkler, W C, Nahvi, A, Roth, A, Collins, J A, and Breaker, R R, Control of gene expression by a natural me tabolite-responsive ribozyme. Nature, 2004. 428 (6980): p. 281-286. 384. Teixeira, A, Tahiri-Alaoui, A, West, S, Thomas, B, Ramadass, A, Martianov, I, Dye, M, James, W, Proudfoot, N J, and Akoulitchev, A, Autocatalytic RNA cleavage in the human beta-globin pre-mR NA promotes transcription termination. Nature, 2004. 432 (7016): p. 526-530.

PAGE 211

195 385. Sarver, N, Cantin, E M, Chang, P S, Za ia, J A, Ladne, P A, Stephens, D A, and Rossi, J J, Ribozymes as Potential Anti-Hiv-1 Therapeutic Agents. Science, 1990. 247 (4947): p. 1222-1225. 386. Macejak, D G, Jensen, K L, Pavco, P A, Phipps, K M, Heinz, B A, Colacino, J M, and Blatt, L M, Enhanced antiviral effect in cell culture of type 1 interferon and ribozymes targeting HCV RNA. Journal of Viral Hepatitis, 2001. 8 (6): p. 400-405. 387. Macejak, D G, Jensen, K L, Jamison, S F, Domenico, K, Roberts, E C, Chaudhary, N, von Carlowitz, I, Bellon, L, Tong, M J, Conrad, A, Pavco, P A, and Blatt, L M, Inhibition of hepatitis C vi rus (HCV)-RNA-dependent translation and replication of a chimeric HCV poliovirus using synthetic stabilized ribozymes. Hepatology, 2000. 31 (3): p. 769-776. 388. Khan, A U, and Lal, S K, Ribozymes: A modern tool in medicine. Journal of Biomedical Science, 2003. 10 (5): p. 457-467. 389. Hsieh SY, T J, Delta virus as a vector for the delivery of biologically-active RNAs: possibly a ribozyme specific for chro nic hepatitis B virus infection. Adv Exp Med Biol., 1992. 312 : p. 125-128. 390. Netter HJ, H S, Lazinski D, Taylor J., Modified HDV as a vector for the delivery of biologically-active RNAs. Prog Clin Biol Res., 1993. 382 : p. 373-376. 391. Cobaleda, C, Perez-Losada, J, and Sanchez-Garcia, I, Chromosomal abnormalities and tumor development: from genes to therapeutic mechanisms. Bioessays, 1998. 20 (11): p. 922-930. 392. Bitko V, B S, Phenotypic silencing of cytoplasm ic genes using sequence-specific double-stranded short interfering RNA and its application in the re verse genetics of wild type negative-strand RNA viruses. BMC Microbiol., 2001. 1 (34). 393. Hommel, J D, Sears, R M, Georgesc u, D, Simmons, D L, and DiLeone, R J, Local gene knockdown in the brain using viral-mediated RNA interference. Nature Medicine, 2003. 9 (12): p. 1539-1544. 394. Shen, J, Samul, R, Silva, R L, Akiyama, H, Liu, H, Saishin, Y, Hackett, S F, Zinnen, S, Kossen, K, Fosnaugh, K, Vargeese, C, Gomez, A, Bouhana, K, Aitchison, R, Pavco, P, and Campochiaro, P A, Suppression of ocular neovascularization with siRNA targeting VEGF receptor 1. Gene Therapy, 2006. 13 (3): p. 225-234. 395. Reich, S, Fosnot, J, Kuroki, A, Tang, W X, Yang, X Y, Maguire, A, Bennett, J, and Tolentino, M, Small interfering RNA (siRNA) targ eting VEGF effectively inhibits ocular neovascularization in a mouse model. Molecular Vision, 2003. 9 (31-32): p. 210-216.

PAGE 212

196 396. Kim, B, Tang, Q Q, Biswas, P S, Xu, J, Schiffelers, R M, Xie, F Y, Ansari, A M, Scaria, P V, Woodle, M C, Lu, P, and Rouse, B T, Inhibition of ocular angiogenesis by siRNA targeting vascular e ndothelial growth fa ctor pathway genes Therapeutic strategy for herpetic stromal keratitis. American Journal of Pathology, 2004. 165 (6): p. 2177-2185. 397. PA., C, Potential applications for RNAi to probe pathogenesis and develop new treatments for ocular disorders. Gene Therapy, 2006. 13 (6): p. 559-562. 398. Lu, P Y, Xie, F Y, and Woodle, M C, Modulation of angiogenesis with siRNA inhibitors for no vel therapeutics. Trends in Molecular Medicine, 2005. 11 (3): p. 104-113.

PAGE 213

197 BIOGRAPHICAL SKETCH Hao Pan was born in Nanjing, China, in Dec 1978 and completed his B.S. in Nanjing University, China, in 2001, majoring in pharmaceutical biotechnology. He was enrolled in the Biomedical Sciences program at College of Medicine, University of Florida, in 2001, and began his research wo rk the following year under the guidance of Dr. Maria B. Grant.


Permanent Link: http://ufdc.ufl.edu/UFE0013783/00001

Material Information

Title: Targeting Angiogenic Growth Factors in Proliferative Diabetic Retinopathy
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013783:00001

Permanent Link: http://ufdc.ufl.edu/UFE0013783/00001

Material Information

Title: Targeting Angiogenic Growth Factors in Proliferative Diabetic Retinopathy
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013783:00001


This item has the following downloads:


Full Text












TARGETING ANGIOGENIC GROWTH FACTORS IN PROLIFERATIVE DIABETIC
RETINOPATHY















By

HAO PAN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Hao Pan

































This document is dedicated to the graduate students of the University of Florida.















ACKNOWLEDGMENTS

Since coming to the United States in August 2001, it has been five years. This

was the most challenging five years and there was happy and hard time. To study abroad,

especially in the United States, was one of my dreams when I was in high school. Now,

with the completed dissertation in hand, I can tell myself: Hao, you made it!

Language has been the biggest obstacle in my study. I was confident about my

English, but I came here and found that there is still so much to learn and it still takes

time. The study and life for me has been harder than most American students. But I am

happily seeing my improvement everyday. I composed my dissertation in English, gave

seminars in English and passed the final defense in English; all of these are making me

proud.

I thank my mentor, Dr. Maria Grant, for her patient and inspiring guidance in the

past four years. Every member in my committee, Dr. Alfred Lewin, Dr. Sean Sullivan

and Dr. Stratford May, has given me great suggestions for my dissertation work. I thank

everybody in the lab. Dr. Lynn Shaw instructed me in great details during my

experiments and dissertation writing. Dr. Aqeela Afzal was also a great help for my

bench work. And every other member in the lab has given me great support for my

defense.

I thank my parents. They are far away in China but I am sure they are proud and

as happy as I am now. They have done everything they could to provide me the best

education opportunities and they have always been there encouraging all the way along. I









am the only child in the family and I am thankful that they supported when I decided to

study abroad.

I thank Yao for her great help and support. Her love strengthened me during the

hardest time. Without her, I could not have overcome all the difficulties and successfully

graduated.

There is still a long way ahead, with more challenges and opportunities. I would

cherish everything I have had in the University of Florida. The orange and blue will

always be a source of courage and confidence. Go Gators!
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES ......... ...... .................................... .. ...... .............

LIST OF FIGURES ......... ........................................... ............ xi

A B S T R A C T .......................................... ..................................................x v

CHAPTERS

1 B A C K G R O U N D ................................................................ ....... ................ .

Introduction and Project Aim ............................ ........................ .............1
T h e E y e ............... ........ ............................... ................................. . 2
T he A natom y of the E ye......... ...................... ................................ ...............
The Retina ................................................2
The B lood Supply to the R etina ........................................ ........................ 4
R etin op ath ies ......................... ... .............................. 5
Age-Related Macular Degeneration (ARMD) ...............................................6
Retinopathy of Prematurity (ROP)............................................... .................. 9
D iabetic R etinopathy (D R )............... ........... .................. ... ............ .11
Current Treatments for Retinopathies ...................................... ............... 13
Pathogenesis of Diabetic Retinopathy .......................... ............. .............. 16
Increased Polyol Pathway Flux ............. ...... .. ........ ............... 17
Production of AGE........................... .......... .... .............. 17
Generation of Reactive Oxygen Species.................................................19
Activation of Diacylglycerol and Protein Kinase C Isoforms...................19
How Does the Change in Retinal Blood Flow Occur?..............................20
What Causes Retinal Capillary Cell Death? ..........................................21
W hat Causes Retinal Ischem ia? ...................................... ............... 21
A ngiogenesis and G row th Factors.................................... ............................. ....... 22
V asculogenesis and A ngiogenesis.................................... ....................... 22
H ypoxia-Induced Factor (H IF)...................................... ................................ 23
Vascular Endothelial Growth Factor (VEGF)................. ............................25
V EGF Fam ily and Isoform s .............................................. ............... 25
VEGF Receptors ........................... ...... .... ..................27
VEGF Receptor Signaling................... ...................30
The Function of VEGF in Ocular Neovascularization..............................33









Basic Fibroblast Growth Factor (bFGF or FGF2).............................................35
A n g io p o ietin s .................................................................... .. 3 6
Platelet-Derived Growth Factor (PDGF).................................. ............... 36
In teg rin s ...................................... ............................................... 3 7
Integrin Signaling ............... .. ...... ....... .... ......... .. .......... ..........38
Relationships between Integrin and Other Growth Factor Receptors in
A n g io g en esis ................... .......................................................... 4 2
Pigment Epithelium-Derived Factor (PEDF) ............................................... 47
Insulin-Like Growth Factor (IGF)- ....................................... ............... 47
IGF-1 and IGF-1R................................ ............... ............... 48
IG F B P s an d A L S ..................... .... ....... ......... ...... ............ .............. 5 1
The Involvement of Insulin Receptor (IR) and IGF-2 in Angiogenesis ......56
R N A Silencing T technologies .......................................................... .....................57
A ntisense O ligonucleotides ......................................... ........................................59
R ib o zy m e s ...................................................... ................ 6 2
Self Splicing Introns ......................................... ............... ........ ...... .... 63
R N a se P ................................................................... ............... 6 5
H am m erhead Ribozym es ........................................ ......... ............... 66
H airpin R ibozym es ............................................... .. ...................... ... .. ..67
Hepatitis Delta Virus (HDV) Ribozymes and Neurospora Varkud
Satullite (V S) R ibozym es ........................................ ...... ............... 69
RN A Interference ...................................... ................. .... ....... 69
G ene Therapy O verview .................................................. ............................... 75
N on-Viral Gene D delivery ............................................................................. 76
V iral G ene D delivery ................................ .............. .............. ............. 78
Adeno-Associated Viral (AAV) Vectors ............................................. 79
A denovirus (A d) V ectors ........................................ ......... ............... 86
R etrovirus V ectors.......... ...... .............. .................... ......... ... ......... 88
Herpes Simplex Virus Type 1 (HSV-1) Vectors..............................89

2 M ETHODS AND M ATERIALS ........................................ .......................... 90

H am m erhead Ribozym e Target Sites ........................................ ...... ............... 90
A accessibility of Target Site ............................................... ............................. 91
Kinase of Target Oligonucleotides .............................. ...... ..... ...............92
Time Course of Cleavage Reactions for Hammerhead Ribozymes .........................93
M multiple T urnov er K inetics ........................................................................................94
Cloning of the Ribozymes into an rAAV Expression Vector ..............................95
Screening and Sequencing of the Clones......................................... ............... 97
HREC Tissue Culture .................. ...... ............. ... ............ .. ............. 98
Transfection of HRECs with Lipofectamine .... ........... .............................. 99
T total R N A E extraction ............................ ....................... .................. ............... 99
R elative Quantitative R T-PCR ............................ ...........................................100
Reverse Transcription-Real Time PCR................. ........ ................... 102
Total Protein Extraction.............. ............................ .................... ............... 103
W western Blotting ............. .. ........ ............ ............ .... ........ .............. ... 103
Flow Cytom etry ................................. ... .. .......... ................... .. 104









M ig ration A ssay ............ .................................................................... .. .... .. ... .. 10 5
Cell Proliferation A ssay (B rdU ) .................................... ............................. ........ 106
Tube formation Assay (Matrigel) ............................... ................................ 107
Proliferating Endothelial-Cell Specific Promoter Constructs................................107
Plasmid Formulation for Adult Mouse Eye Gene Transfer.................................... 107
A nim als .................................. ............... ..... ... ............. ............. 108
Intravitreal Injection into the Mouse Model of Oxygen-induced Retinopathy
(O IR ) ................ .... ..................... ......... .. ....... ...... .. ......................108
Intravitreal Injection into the Adult Mouse Model of Laser-Induced Retinopathy.. 110
Im m unohistological Studies ............................................................................... 111
S statistical A n aly sis ................................................................... ............... 1 1 1

3 RE SU LTS .................................. .................................... ......... 112

R ibozym e D design .............................................................. .. ........ .. 112
Target Site Selection .................. .............................. .. .. .. .. ........ .. 112
A accessibility of Target Site ................. .................. ............................. ........ 114
Sequences of the Ribozymes and the Targets .................................................. 116
In Vitro Testing of R ibozym es ........................................................... .. .............. 117
Tim e Course of Cleavage ............................................. ........................ 117
K inetic A naly sis .............. ............................................................. 119
Functional Analysis of Ribozymes in HRECs........................................ 120
Inhibition of mRNA Expression............................................... ...............120
Protein L evels.................................................. 121
M igration A ssay s............. ........................................................ .. .... ...... .. 123
Cell Proliferation A says ........................................................ ............. 124
Tube Form ation A says ......................................................... ............... 125
In Vivo A analysis of R ibozym es ........................................ .......................... 126
P rom other D evelopm ent.................................................................................... ... 128
Integrin Ribozyme Expression in vivo with the CMV/P-actin Enhancer
Prom oter............................................... ....... .. ......... ................129
The Proliferating Endothelial Cell-Specific Promoter ........... ............... 131
The New Promoter Tested in vivo................... ......... ..... ................133
The New Promoter Tested with Integrin Ribozyme............... ...................138

4 D ISCU SSION ............. ........................................... .. .. .... .. .. ....... ..... 141

Ribozyme Testing Results and Antisense Effect...............................................141
VEGFR-1 and VEGFR-2 Interactions ................................................................. 143
The Proliferating Endothelial Cell Specific Promoters ........................................145
Other Voices on Neovascularization in Diabetic Retinopathy ........... .................147
Final W ords on RN A Silencing................................................................... .. 148

LIST OF ABBREVIA TION S ........................ .. .................... ................. ...............156









L IST O F R E FE R E N C E S ......................................................................... ................... 160

BIOGRAPHICAL SKETCH ............................................................. ..................197
















LIST OF TABLES


Table p

2.1 Sequences of primer pairs and annealing temperatures used in relative
quantitative PCR. ................................ ... ... ........ ............... 102

2.2 Summary of primary and secondary antibodies used in western blottings. ...........104

3.1 Summary of ribozyme and target sequences............. ....... ............... 116

3.2 Summary of ribozyme kinetic data. ........... ...... ...... ...................... 120

3.3 Reduction in target mRNA levels in HREC by the ribozymes...........................121

3.4 Reduction in protein levels by the ribozymes. ............................... ......... ...... 123

3.5 All ribozym es tested in vivo .................... ........ ........... .. ............................128
















LIST OF FIGURES


Figure page

1.1 Basic structure of human eye (courtesy of National Eye Institute,
w w w .nei.nih.gov). ................................................. ....................... 3

1.2 Cross section of the retina (http://thalamus.wustl.edu/course/eyeret.html). ............3

1.3 Normal view vs. ARMD (courtesy of National Eye Institute, www.nei.nih.gov).....6

1.4 Fundus photograph and fluorescence angiogram of ARMD [11]...........................8

1.5 Five stages in ROP (courtesy of National Eye Institute, www.nei.nih.gov) ...........10

1.6 Normal view vs. DR (courtesy of National Eye Institute, www.nei.nih.gov). ........11

1.7 Fundus photograph and fluorescence angiogram of non-proliferative DR [11]. .....13

1.8 Fundus photograph and fluorescence angiogram of proliferative DR [11]. ............13

1.9 Photocoagulation (courtesy of National Eye Institute, www.nei.nih.gov) .............14

1.10 Cryotheropy (http://www.checdocs.org/dr treatment.htm) ............. ................. 15

1.11 Polyol Pathw ay [31] ............................... ..................... .. ............ 18

1.12 A G E form action [31] ............................................................ .................... .... 18

1.13 VEGF-A isoform s [92].......................................................................... 27

1.14 VEGF family ligands and their receptors [116] ............. ..... .................30

1.15 VEGF signaling via VEGFR-2 [92] ............................ ......... ............... 33

1.16 The activation of integrins can lead to the signal transduction in a number of
pathw ay s. [180]. .................................................... ................. 39

1.17 IGF-1 signaling transduction [216]. ........................................................................49

1.18 Proposed pathway of IGF-dependent IGFBP action [223]. ................................... 51

1.19 Overview of possible IGFBP-3 antiproliferation pathways [223]. .........................53









1.20 The crosstalk between IGF-1, IGF-2 and Insulin signalings [254].......................57

1.21 Overview of RNA silencing technologies [258]. ......... ..................................... 58

1.22 M modifications in antisense technology [258]. .................................. .................60

1.23 Self-cleaving and self-splicing reactions in ribozymes [263]. ................................62

1.24 Secondary structure and self splicing steps in group I intron [263].........................64

1.25 Secondary structures of natural and synthetic substrates for RNAse P[275]...........65

1.26 Structure of the hammerhead ribozyme. ............................................................67

1.27 Structure of the hairpin ribozym e................................ ........................ ......... 68

1.28 R N A interference [293]........................................................... ...........................70

1.29 Designing artificial shRNA for RNAi [303]. ................................ .................73

1.30 AAV internalization and intracellular trafficking [330]........................................81

1.31 AAV2 genome and the vector genome [330]................................ ............... 83

1.32 Helper virus -free systems in rAAV production [334] ........................................84

1.33 The 6 pDF helper plasmids in the two-plasmid system [330]..................................85

1.34 Ad genome and the vector genome [324] ...................... ...................................... 87

1.35 M LV genom e structure [329] ......... ................. .............................. ..... .......... 89

2.1 Typical structures of hammerhead ribozyme predicted by Mfold [257]..................92

2.2 The pTRUF21 expression and cloning vector and the orientation and position of
the hammerhead and hairpin ribozyme cassette............... .... .................96

2.3 Time course of OIR mouse model. ............. ...... .......................................... 109

2.4 Time course of the adult mouse model of laser-induced neovascularization......... 110

3.1 The human IR cDNA sequence with ribozyme target site highlighted................113

3.2 Mfold structures predicted for the human IR target region..................................114

3.3 Mfold predicted secondary structure of human IR ribozyme. ............................ 115

3.4 The 34-base ribozymes (black) annealed to the 13-base targets (red) for both
hum an and m house .......................................... ....... ........ .. ........ .. .. 116









3.5 Cleave time course of human IR ribozyme.................. ............................... 118

3.6 Summary of time courses cleavage of the ribozymes generated in this study....... 118

3.7 Multiple-turnover kinetic analysis of a human IR ribozyme ...............................19

3.8 Insulin receptor mRNA levels in HRECs. .................................. ............... 121

3.9 Western analysis of IR levels in cells expressing the human IR ribozyme...........122

3.10 HREC migration assays in response to IGF-1. ........................................ ...........124

3.11 Effect of the VEGFR-1 and VEGFR-2 ribozymes on HREC migration. ..............124

3.12 Effect of ribozyme expression on cell proliferation .................... .....................125

3.13 Effect of ribozymes on HREC tube formation..................................................126

3.14 Cross section of a mouse eye showing pre-retinal vessels................................... 127

3.15 Ribozyme reduction of pre-retinal neovascularization in the OIR model............ 127

3.16 Reduction of pre-retinal neovascularization in the OIR mouse model with
expression of the al or a3 integrin ribozymes. ....................... .......................... 129

3.17 Expression of al ribozyme in OIR model results in severe deformations of the
ey e ....................................................................................... 130

3.18 pLUC1297/1298 vectors and pLUC1297HHHP/1298HHHP clones ....................131

3.19 Verification of the cell specificity of the proliferating endothelial cell-specific
enhancer/prom other .................. ............................ .. ........ .. .......... 133

3.20 The proliferating endothelial cell-specific promoter limits expression of
luciferase to the actively proliferating blood vessels in the OIR model ..............135

3.21 Quantitative assessment of the IGF-1R ribozyme's ability to inhibit pre-retinal
neovascularization when expressed from the promoter. ......................................136

3.22 New promoter tested in adult mouse model of laser-induced neovascularization. 136

3.23 The expression of the IGF-1R ribozyme from the new promoter reduced
aberrant blood vessel formation in the adult laser model............... ............... 137

3.24 Expression of integrin ribozyme driven by proliferating endothelial cell-specific
promoter resulted in less eye deformation. ................................. .................139

3.25 Proliferating endothelial cell specific promoter with integrin ribozyme tested in
O IR m odel ............................................... ............... .................... 140















LIST OF OBJECTS

Object page

3.1 A blood vessel from the adult mouse model shows the luciferase expression is
specific for proliferating endothelial cells................................... ............... 137

3.2 The 3-D view of the blood vessel from the adult mouse model. .........................137















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

TARGETING ANGIOGENIC GROWTH FACTORS IN PROLIFERATIVE DIABETIC
RETINOPATHY

By

Hao Pan

May 2006

Chair: Maria B. Grant
Major Department: Pharmacology and Therapeutics

Proliferative diabetic retinopathy is the leading cause of blindness in the working

age adults. Pre-retinal angiogenesis is the hallmark of this disease and can lead to vessel

leaking, exudate accumulation, hemorrhage, or even retinal detachment. Many growth

factors have been identified to promote the vessel growth, physiologically and

pathologically. Inhibition of these growth factors can result in less abnormal angiogenesis

and potentially prevent the onset of vision impairment. One gene silencing technology,

hammerhead ribozyme, was used to inhibit the signaling of these growth factors.

Ribozymes are small RNA molecules that can recognize and cleave specific sequence in

the target mRNA. Ribozymes against the genes of a number of growth factor receptors,

including IGF-1R, insulin receptor, VEGF-R1, VEGF-R2, and multiple integrins, were

designed and tested in vitro and in vivo. All ribozymes were tested by cleavage time

courses, kinetic analysis and proved to be capable of cleaving synthetic RNA targets.

Then they were transfected in human retinal endothelial cells, and the mRNA levels and









protein levels of the growth factor receptors were reduced. Also the migration,

proliferation and tube formation of these cells were inhibited. We used the oxygen-

induced retinopathy mouse model to test the ribozymes in vivo. The expression of the

ribozymes induced significant reductions in the pre-retinal neovascularization levels. To

better target the proliferating endothelium in vivo, and to minimize the adverse effect of

ubiquitous ablation of targeted growth factor receptors, a proliferating endothelial cell-

specific promoter was designed. This new promoter was tested with IGF-1R ribozyme

and showed specific expression in the proliferating endothelium and significant reduction

in the pre-retinal neovascularization levels. Our results suggest that these ribozymes are a

useful tool to inhibit the angiogenesis in retinopathy, and the proliferating endothelial

cell-specific promoter adds the specificity without losing expression strength.














CHAPTER 1
BACKGROUND

Introduction and Project Aim

Vascular retinopathies, including retinopathy of prematurity, proliferative diabetic

retinopathy and age-related macular degeneration, are the leading cause of vision

impairment worldwide. Pre-retinal vessel growth is the hallmark for retinopathy of

prematurity and proliferative diabetic retinopathy. These new blood vessels are

abnormally positioned and are fragile, easy to leak, and can result in hemorrhage and

retinal detachment. Currently there is no cure for these diseases. The initiation and

maintenance of these pre-retinal blood vessels depend on the involvement of many

growth factors. In this project, with the help of a gene silencing technology, hammerhead

ribozyme, efforts have been made to target and inhibit the expression of a number of

growth factor receptors to reduce the growth factor signaling. Ribozymes are small RNA

molecules that can specifically bind to a sequence in the target mRNA and perform

cleavage. The genes of IGF-1R, VEGFR-1, VEGFR-2, integrins and insulin receptor

have been targeted and the inhibition effects were examined in vitro and in vivo. To better

target the proliferating endothelium in vivo, and to minimize the adverse effect of

ubiquitous ablation of targeted growth factor receptors, a proliferating endothelial cell-

specific promoter was designed and tested. In the basic science point of view, the

investigations on the involvement of the growth factors in the pre-retinal angiogenesis

can provide useful information about their signaling details; in the clinical application









point of view, this work could also imply new targets and methods for the disease

treatment in the future.

The Eye

The Anatomy of the Eye

Optically working like a film camera, the eyes of all the vertebrates are

structurally similar. The light enters the eye through the pupil and forms an inverted

image on the retina, the light-capturing component that functions like the film in a

camera. The cornea and the lens help to focus so that the clearest image is presented on

the retina. The white outer surface of the eye ball is termed sclera, which consists of

tough but flexible fibrous tissue and provides the mechanical support of the entire eye.

The choroid is a layer contained within the sclera, and it is a dense meshwork of blood

vessels and other tissues. One of the most important functions of the choroid is to provide

nutritional and metabolic support for the retina, which is a neuronal sheet that lies within

the choroid. The retina is the most inner surface at the back of the eye. Most of the space

in the eye is filled with a gelatinous body, called vitreous. It is surrounded by the lens and

the retina and the ciliary body. In the ciliary body, the cells secrete the aqueous fluid into

the eye, which contributes to the maintenance of the pressure within the eye.

The Retina

The retina, a layer about 0.4mm in thickness, is primarily composed of neural

tissue including five classes of neurons. It spreads out on the interior surface of the back

of the eye. The visual pathway is initiated when the light stimulates the photoreceptors

that are embedded in the outer retinal layers. The signal is transmitted to bipolar cells and

then to ganglion cells. The signal then travels along the axon of the ganglion cells lining









Vitreous gel

Optic nerve '






Reline



Figure 1.1. Basic structure of human eye (courtesy of National Eye Institute,
www.nei.nih.gov).



J choroid i

r m epithelium
outer segments
inner segments hotore
outer nuclear
layer (ON L)
outer plexiform
layer (OPL) horizontal cell
inner nuclear
layer (INL)
m 1~ inner plexiform
i t layer (IPL)

ganglion cell
layer (CCL)
optic fiber layer
l a (OFL)


Figure 1.2. Cross section of the retina (http://thalamus.wustl.edu/course/eyeret. html).

the inner surface of the retina to the optic nerve, which penetrates the retina and connects

to the brain. There are two more classes of neurons, horizontal cells and amacrine cells.

They are both interneuron and assist in signal processing. Horizontal cells primarily

contact with photoreceptor axons and bipolar cells in the outer plexiform layer and the









inner nuclear layer, respectively, while amacrine cells contact with bipolar axons

primarily in the inner plexiform layer.

Light passes through almost the whole thickness of the retina to be captured by

photoreceptors, or the outer segments of the photoreceptor in detail, where the visual

pigment molecules for light capturing are located. There are two types of photoreceptors,

rods and cones. Rods are specialized to convey variations in light intensity in dim

conditions, but they are not able to function in bright light. Cones are specialized for

bright light conditions, but they are not as sensitive as rods.

The retina cross section can be divided into multiple layers. The nuclear layers are

basically where cell nuclei are located, and the synaptic layers are the place where cells

communicate and transmit electric or chemical signals. The retinal pigment epithelium

(RPE) functions as the outer blood-retinal barrier (BRB) that shut off the diffusion of

large molecules from choroicapillaries. And the retinal vasculature doesn't grow beyond

the inner limiting membranes under normal physiological conditions.

The Blood Supply to the Retina

The metabolism in the retina performs in the highest rate in the body. For the

same mass of tissue, the metabolic needs of the retina are about seven times that of the

brain. In order to meet these high metabolic needs, two separate circulations are involved.

They are retinal and choroidal circulations. The larger arteries and veins of the retinal

circulation can be seen under an ophthalmoscope, and most of the retinal surface is

occupied with a meshwork of retinal capillaries. These capillaries form the inner BRB.

The endothelial cells at the capillaries are connected by tight junctions that prevent

leakage from the vessels. A lot of proteins or molecules work in the binding of the

adjacent cells. Because of the tight junctions, proteins and solutes have to pass through









the apical and the basal membranes of the endothelial cells in order to go into or out of

the circulation from or to surrounding tissues. Water, small molecules and dissolved

gases can do so, such as glucose, oxygen, carbon dioxide, and so on. But most large

molecules, including proteins, cannot pass through freely. The only possible way for

them to pass through is through a process of active transport with the help of the proper

membrane tunnel proteins. So basically the BRB provides a mechanism of keeping the

substance entering the retinal neural tissue in a controlled manner.

The central artery and vein of retinal circulation originate along the optical nerve

and extend into the retina from the center of the optical disc. While the choroidal arteries

and veins of pass through the sclera at multiple places around the optical nerve, and then

they branch into a meshwork of very large capillaries, called choroicapillaries. Large

capillaries increase the rate of blood passing through, which keeps the concentration of

oxygen high and the concentration of carbon dioxide low, and also quick removes the

heat from focused light on the eye bottom. The BRB is not maintained by choroidal

circulations, because the cells on the side facing the RPE are fenestrated, and there is no

tight junction between these cells. However, the RPE connecting with the choroid have

tight-junctions and provide the outer portion of the blood-retinal barrier.

Retinopathies

Retinopathies are diseases that affect the function of retinas. Usually they involve

the abnormalities in the vasculatures that nourish the retina. These abnormalities included

ectopic angiogenesis, rupture and leakage on the vessels, accumulation of exudates, retina

detachment caused by vessel and fibrous tissue contractions, and so on. There are three

types of retinopathy clinically identified: age-related macular degeneration (ARMD),

which occurs in the elderly people; diabetic retinopathy (DR), which occurs in the









working age people; and retinopathy of prematurity (ROP), which occurs in infants.

ARMD more involves the abnormalities in choroicapillaries, while DR and ROP are

basically related to the abnormalities of retinal vasculature.

Age-Related Macular Degeneration (ARMD)

ARMD is the leading cause of blindness among those aged over 65 in the western

world [1-3]. It affects the outer retina, RPE, Bruch's membrane and the choroids.

Thickening of Bruch's membrane is seen in this disease. Our understanding about the

pathogenesis has grown in the past decade, but still a lot remains unknown and the

current therapy is limited.














Figure 1.3. Normal view vs. ARMD (courtesy of National Eye Institute,
www.nei.nih.gov).

The clinical hallmark of ARMD is the appearance of drusen, localized deposits

lying between the basement membrane of the RPE and Bruch's membrane. Drusen can

be shown as semi-translucent punctuate or yellow-white deposits depending on the stage

of the disease. Morphologically drusen are classified as "hard" and "soft". Hard drusen

are pinpoint lesions; soft drusen are larger with vague edges and they are easy to become

confluent. Drusen can become calcified and they may also regress. Typically clustered

drusen are located in the central macula, so they can lead to deficits in macular function









such as color contrast sensitivity, central visual field sensitivity and spatiaotemporal

sensitivity [4]. Increased quantity and size of drusen are an independent risk factor for

visual loss in ARMD.

Geographic atrophy is also seen in ARMD, which refers to confluent areas of

RPE cell death accompanied by overlying photoreceptor atrophy [5]. Geographic atrophy

leads to vision impairment, especially the visual function in dark situations [6]. This loss

of function is probably because the RPE loss results in reduced nutrients for those

photoreceptors that are located in the RPE atrophy areas. Apoptosis in the corresponding

area are found [7].

Choroidal (or subretinal) neovascularization (CNV) is a major cause of vision loss

in ARMD. As the term itself indicates, CNV refers to the new blood vessel growth from

the choroids. It breaks through the Bruch's membrane into the space underneath RPE, or

it may further penetrate the RPE layer into the subretinal space. Usually CNV is

associated with leakage of fluid and blood. The repeated leakage of blood, serum, and

lipid can stimulate fibroglial organization leading to a cicatricial scar [4].

Drusen and CNV can cause irregular elevation of RPE, which can lead to RPE

detachment or even RPE tear. RPE detachment can cause visual loss in patients with

ARMD [8].

Depending on whether CNV is present, ARMD is classified into the dry form or

the wet form. The dry ARMD is nonexudative [4]. This is the early phase of ARMD, and

the earliest pathological changes are the appearance of basal laminar deposits between the

plasma membrane and basal lamina of the RPE, and the appearance of basal linear

deposits located in the inner collagenous zone of Bruch's membrane. The former deposits









are seen in an increase amount in ARMD [9], and the later deposits are only seen in

ARMD [10]. Approximately 10 percent of persons with AMD develop the exudative

form of the disease, or wet ARMD. Exudative AMD accounts for 80 to 90 percent of

cases of severe vision loss related to AMD. CNV occurrence is the hallmark of wet

ARMD. CNV is associated with abnormal vessels that leak fluid and blood in the macula,

resulting in blurred or distorted central vision. Figure 1.4 is the funds photograph (A)

and fluorescence angiogram (B) of an eye of a patient with exudative ARMD. Note

subretinal neovascularisation (A, asterisk) with surrounding hard exudates (arrowheads).

On the angiogram (B) the neovascularization is clearly stained by fluorescein (black

arrow) [11].













Figure 1.4. Fundus photograph and fluorescence angiogram of ARMD [11].

As for the pathogenesis of ARMD, shortly speaking, Campochiaro and coworkers

suggested that the age-related thickening of Bruch's membrane reduces the diffusion of

oxygen from the choroid to the RPE and retina [12], and recent evidence suggests that

VEGF plays an important role in the development of CNV. VEGF expression was found

to be increased in RPE cells of maculae of patients with age-related maculopathy, a

condition with a high risk of CNV occurrence [13] and in experimental animal models

[14]. VEGF levels in the vitreous of wet ARMD were found to be significantly higher









than healthy controls [15]. Chronic inflammation from drusen may be involved in the

development of ARMD [16], but the inflammatory contribution is still controversial.

Retinopathy of Prematurity (ROP)

ROP is an adverse effect of treating those premature neonates in respiratory

distress with high oxygen. The high oxygen helps these infants to survive, but it can

cause ROP, which will impair their vision. ROP mainly affects premature infants

weighing about 1250 grams or less that are born before 31 weeks of gestation. It is one of

the most common visual loss diseases in childhood. According to the National Eye

Institute, there are about 28,000 infants born weighing 1250 grams or less in the U.S., and

among them, 14,000-16,000 of the infants are affected by ROP to some degree. 10% of

them need medical treatment and 400-600 infants annually become legally blind of ROP.

The ROP complete progression can be divided into 5 stages. Stage 1 is

characterized by a demarcation line between the normal retina (near the optic nerve) and

vascularized retina. In stage 2, a ridge of scar tissue rises up from the retina due to growth

of abnormal vessels. This ridge forms in place of the demarcation line. In stage 3, the

vascular ridge grows due to spread of abnormal vessels and extends into the vitreous.

Stages 4 and 5 refer to retinal detachment; stage 4 refers to a partial retinal detachment

caused by contraction of the ridge, thus pulling the retina away from the wall of the eye;

and stage 5 refers to complete retinal detachment.

ROP is now considered as a two-phase process during the disease development.

In the first stage, the high oxygen condition will make the developing retinal blood

vessels and especially the developing capillary buds be more "pruned" to drop out. This

pathological vessel dropout is an exaggeration of the normal physiologic process, in

which there is a constant balance between developing and degenerating capillary buds, as
























Stage I KUP is characterized by a demarcation Stage 2 RUP; the white line is replaced by a
line. The orange vascular retina is on the left ridge of scar tissue R. The arrow shows a tuft
and the gray peripheral retina is on the right of new vessels.
scoartated by the white line.


Stage 3 ROP. The size of the ridge has Plus disease shows dilation and tortuosity of
increased (between arrows) and the growth of blood vessels near the optic nerve.
the ridge extends into the vitreous.

Figure 1.5. Five stages in ROP (courtesy of National Eye Institute, www.nei.nih.gov).

tissue demand changes [17]. In short, the hyperoxic vaso-obliteration occurs in the first

stage. When the high oxygen care is complete and the infants survive, they are taken out

the high oxygen environment and the second stage occurs. Because of the vessel loss, the

tissue becomes hypoxic and the ischemia-induced vaso-proliferation begins. The hypoxia

stimulates growth factors increases, especially VEGF. These growth factors play very

important roles in the vaso-proliferation. The vaso-proliferation is abnormal in that these

new vessels are fragile and leak, scarring the retina and pulling it out of position, which









will lead to retinal folds and retinal detachment. The term babies are less affected by

fluctuations in oxygen levels as once the vessels become developed and surrounded by

supportive matrix, thus they are no longer susceptible to pruning by hypoxia [18].

Diabetic Retinopathy (DR)

Diabetic retinopathy is one the three major complications of diabetes mellitus (the

other two are neuropathy and nephropathy) and occurs in both type I and type II diabetes.

DR primarily affects the working age people and is the leading cause of new-onset visual

loss in working people in the U.S. and other industrialized countries [19]. DR affects

approximately three-fourths of diabetic patients within 15 years after onset of the disease

[20]. Retinal neovascularization and macular edema are central features of DR and also

the two factors that cause vision loss. The newly-formed vessels are fragile and abnormal

and they can leak blood into the center of the eye, blurring vision. Macular edema usually

occurs as the disease progresses. The fluid leaks in the center of macular and makes the

macula swell, blurring vision. Other characteristics found in DR include basement

membrane thickening, pericyte loss, microaneurysms, and so on.














Figure 1.6. Normal view vs. DR (courtesy of National Eye Institute, www.nei.nih.gov).

In the beginning stage of DR, there are no clinically evident symptoms, but the

biochemical and cellular alterations are going on in the retinal vasculature. These









alterations include increased adhesion of leukocytes to the vessel wall, alterations in

blood flow, basement membrane thickening. These factors are involved in the blockage

of the retinal capillaries, which is thought to induce hypoxia and further trigger the

overexpression of the angiogenic factors. Other vascular alterations include death of

retinal pericytes, subtle increases in vascular permeability, or even the loss of vascular

endothelial cells. Following this, the blood and fluid leakage may come. The loss of

endothelial cells also leads to acellular capillaries worsening ischemia. With time, more

abnormal phenomena occur and they are clinically observable. These abnormalities

include microaneurysms, dot/blot hemorrhages, cotton-wool spots, venous beading and

vascular loops [20]. The blood and fluid leak out the vessels and accumulate in the retinal

tissue, giving rise to exudates. When this occurs in macula, patients will have macular

edema and impaired vision. This stage is also called nonproliferative retinopathy. With

the progression the disease, next stage is the proliferative retinopathy, featuring the

growth of new vessels on the surface of the retina. The new vessels are abnormal, fragile

and easy to break. The leaking blood can cloud the vitreous and further impair vision. In

more advanced stages, the exaggerated pre-retinal neovascularization can grow from the

retinal surface into the vitreous cavity. This can cause retinal detachment can lead to

blindness. Proliferative retinopathy typically develops in patients with type I diabetes,

whereas nonproliferative retinopathy with macular edema is more common in patients

with type II diabetes [20].

Figure 1.7 shows the funds photograph (A) and fluorescence angiogram (B) of

an eye of a patient with non-proliferative diabetic retinopathy. The arrowheads in Panel A









point to intra-retinal hard exudates surrounding areas of leaking microaneurysms (B,

white arrows) [11].













Figure 1.7. Fundus photograph and fluorescence angiogram of non-proliferative DR [11].

Fundus photograph (A) and fluorescence angiogram (B) of an eye of a patient

with proliferative diabetic retinopathy is shown in Figure 1.8. Note pre-retinal

neovascularization (black arrow) on the optic disc (A), which is extensively leaking

fluorescein (B. white arrows) [11].













Figure 1.8. Fundus photograph and fluorescence angiogram of proliferative DR [11].

Current Treatments for Retinopathies

Currently the clinical proved treatments for retinopathies are limited, and few

drug medications are available. The conventional treatments include laser

photocoagulation, cryotherapy, photodynamic therapy, scleral buckle, and vitrectomy.

All of them cannot cure the disease, but can only delay the disease progression.









In laser photocoagulation, the doctor places thousands, up to 3,500, small laser

burns on the retina. These burns will destroy the normal tissue and decrease the oxygen

needs of the retina. The treatment is usually effective, but at the cost of loss of normal

tissue, and it reduces peripheral vision, impair night vision and change color perception.

The laser photocoagulation is not a cure, as the disease can still progress in spite of

treatment. More treatments may be needed to further prevent vision loss. Laser treatment

is currently applied in all retinopathies, that is, ROP, DR, and ARMD. Laser is also used

to target at the leaking spots, like in severe macular edema, the laser burning is applied in

a focal way. When preventing abnormal vessel growth, as in proliferative DR, the laser

burning is applied in a scattered way.












The retina immediately after focal laser
treatment





I Ci : rr,-





Scatter laser threaten
Figure 1.9. Photocoagulation (courtesy of National Eye Institute, www.nei.nih.gov).









Cryotherapy is a procedure in which physicians use an instrument that generates

freezing temperature to briefly touch spots on the surface of the eye that overlie the

periphery of the retina. It also destroys the tissue and impairs the side vision. Cryotherapy

is more used for ROP. In Figure 1.10, cartoon is showing cryotherapy application to the

anterior avascular retina. A cold probe is placed on the sclera till an ice ball forms on the

retinal surface. Multiple applications are done to cover the entire vascular area. This

treatment thins the tissue under the retina and allows easier oxygen diffusion through the

retina.

















Figure 1.10. Cryotheropy (http://www.checdocs.org/dr treatment.htm).

In photodynamic therapy, a drug called verteporfin is injected i.v. and perfused to

the vasculature in the eye. The drug tends to "stick" to the surface of new blood vessels,

and then, a light is shined into the eye for about 90 seconds, and the light activates the

drug to destroy the new blood vessels. The advantage of this method is that the drug

doesn't destroy the normal tissue surrounding. But the patient needs to avoid bright light

for five days because the drug can be activated in their exposed body parts.

Photodynamic therapy is more used to treat wet ARMD.









In later stages of ROP, scleral buckle is another treatment option [21]. This

involves placing a silicone band around the eye and tightening it. This keeps the vitreous

from pulling on the scar tissue and allows the retina to flatten back down onto the wall of

the eye. The band will be removed later. In most severe conditions in retinopathies,

vitrectomy can be applied, in which the vitreous is removed, scar tissue on the retina

peeled back or cut away, and saline solution is replaced for vitreous. The retina

reattachment can be seen after this surgical treatment [22].

Pathogenesis of Diabetic Retinopathy

Diabetes mellitus is a serious disease leading to morbidity and mortality as it has

long-term complications include macrovascular and microvascular disease. Both type I

(characterized by no insulin production) and type II (characterized by insulin resistance)

diabetes can have these complications. Retinopathy is one of the microvascular

complications. It is believed that the chronic hyperglycemia has a strong relationship with

microvascular complications, and clinical research data demonstrates that improved

glycemic control contributes to significant microvascular risk reduction [23, 24].

Experiments on animal models also suggest that long-term hyperglycemia is necessary to

induce changes in the retinal vasculature [25].

In the retina, GLUT1, which is one of a family of glucose transporters, is

responsible for glucose transfer across BRB into the endothelial cell and retinal cells.

While in most other cells in the body, insulin assistance is required for internalize

glucose; this is not the case with the retina. Excessive transport of glucose through

GLUT1 [26], the involvement of GLUT1 in RPE cells [27], and increased density of

relocalized GLUT1 in inner BRB [28] have been proposed to be related with intracellular

hyperglycemia. Intracellular hyperglycemia in the early stages of diabetes causes









abnormalities in blood flow and increases in vascular permeability. The blood flow

changes come from decreased activity of vasodilators, such as nitric oxide, and increased

activity of vasoconstrictors such as angiotensin II and endothelin-1 [29]. The increase in

vascular permeability comes from VEGF functioning on endothelial cells and changes in

extracellular matrix. With time, hyperglycemia can further induce cell loss and

progressive capillary occlusion. All these changes will eventually lead to edema,

ischemia and hypoxia-induced neovascularization.

To date, there are several hypothesized theories on how hyperglycemia

contributes to microvascular damage, or retinopathy. The most common ones are polyol

pathway theory, advanced glycation end-products (AGE) theory, oxidative stress theory

and PKC activation theory.

Increased Polyol Pathway Flux

As shown in Figure 1.11, glucose is reduced to sorbitol by aldose reductase, and

at the same time, nicotinamide-adenine dinucleotide phosphate (NADPH) is oxidized to

NADP+. Then sorbitol is oxidized by sorbitol dehydrogenase to fructose, coupled with

the reduction of oxidized nicotinamide-adenine dinucleotide (NAD ) to NADH [29]. So

the intracellular high glucose level will result in excess sorbitol, fructose, NADH

accumulation and decrease in NADPH. Some damages caused by increase flux through

polyol pathway have been proposed to include: activation of protein kinase C [30],

contribution of AGE formation [30], decreased activity of Na/K-ATPase [29], and

increase in the formation of reactive oxygen species leading to oxidative stress [29].

Production of AGE

AGE are irreversibly cross-linked substances. Intracellular hyperglycemia is

possibly the primary initiating event in the formation of intracellular and extracellular










AGE [32, 33]. During formation of AGE, glucose reacts nonenzymatically with the

amino group of proteins and other macromolecular to form Schiff bases, which are

transformed into Amadori products that eventually lead to AGE formation [34].

When AGE bind their receptors, RAGEs, some abnormal cellular events can

occur, including: the stimulation of the production of the vasoconstrictor endothelin-1,

VEGF production that is associated with increased permeability, and production of

reactive oxygen species. The long-term effects induced by AGE and RAGEs are mostly

mediated by transcription factor KB to express cytokines and growth factors [29].


NADPH + H* NADP* NAD* NADH + H4

glucose sorbitol fructose
akdose reductase sdorbitol
dehydrogenase


I \^ AGEs


Lglutathione ImyoAGsitd
NO myolnito
increased osmotic stress nerve conduction
increased call permeability velocity
Soxidative stress LNa'/K-dependent
oxidative stress ATPaa activity
The Km of glucose for aldose reductase is high (70 rM); thus high concentrations
of this substrate are needed to bind to the enzyme.
Figure 1.11. Polyol Pathway [31].


Thlicked
Basnumnt

S-I duas embran
Glume Amdori Glycation iau S

*- Deactivarel Microvawcidr -
Hypelrision


Figure 1.12. AGE formation [31]

There are several adverse alterations in the micro vasculature associated with

AGE. AGE formation can contribute to thickening of the basement membrane and to

microvascular hypertension by inactivating nitric oxide [31]. The thickening and









hypertension can lead to microvascular leakage and occlusion. AGE can adversely affect

vascular permeability, alter the functions of matrix molecules, and alter the functions of

vessels, by decreasing the vessel elasticity, increasing fluid filtration across vessels [29],

decreasing endothelial cell adhesion [35], and so on.

Generation of Reactive Oxygen Species

The term oxidative stress refers to the imbalance between the production of

reactive oxygen species and the normal antioxidant protective mechanisms present to

guard tissues from oxidative damage [36]. As discussed above, both polyol pathway and

AGE formation can lead to the generation of reactive oxygen species. Glucose also has

pro-oxidant properties in the presence of heavy metals and the auto-oxidation of glucose

can form free radicals too. These reactive oxygen species can inactive or reduce nitric

oxide levels [37].

The reactive oxygen species can result in damaged protein and mitochondrial

DNA that have adverse effects on the microvasculature [38], especially leading to

increased microvascular permeability [39]. Oxidative stress has been shown to increase

intracellular calcium levels, which have been associated with endothelial

hyperpermeability of macromolecules [40].

Activation of Diacylglycerol and Protein Kinase C Isoforms

It has been shown that diacylglycerol (DAG) formation can be induced by glucose

in cell cultures, animal tissues, and diabetic patients [31]. DAG is very important in the

activation of various protein kinase c (PKC) isoforms, with the isoform 0 being thought

to be the most sensitive to changes in DAG levels. PKC-0 has been shown to be

increased in various vascular tissues following hyperglycemic exposure [41]. PKC-a,

PKC-P 1 and PKC-02 are seen to be elevated in the retina during acute and chronic









hyperglycemic states [42]. The consequences induced by PKC activation include

increased retinal permeability [43], increased basement matrix protein formation [44],

VEGF formation [44], and so on. So PKC may have adverse long-term effects in the

vasculature.

Based on the involvement of these pathways, a lot of pathological changes can

happen in diabetic retinopathy. Some of the most important changes are covered below.

They will lead to edema, ischemia and hypoxia in the retina, which all lead to abnormal

neovascularization.

How Does the Change in Retinal Blood Flow Occur?

Hyperglycemia induces changes in retinal blood flow via its effects on

vasodilators and vasoconstrictors. Nitric oxide (NO) is one of the most important

vasodilators. It is synthesized from L-arginine or L-citrulline in cells via activation of a

calcium-dependent nitric oxide synthase (NOS). The NOS isoform produced in

endothelium is called eNOS. NO functions by entering smooth muscle cells and

activating soluble guanylate cyclase, which will result in increased level of cyclic

guanosine 3', 5'-monophosphate (cGMP). cGMP can relax the smooth muscle cells

through a decrease in Ca2+ and dephosphorylation of myosin light chains [45]. In the

hyperglycemic environment, a couple of pathways mentioned above can lead to

decreased level of NO. In the polyol pathway as mentioned earlier, sorbitol is produced

coupled with the oxidation of NADPH and this reduces NADPH availability, and

NADPH is one of the cofactors for NO synthesis. AGE production can lead to subsequent

superoxide generation resulting in NO inactivation. PKC activation reduces the capacity

of a number of agonists to increase intracellular Ca2+ and to stimulate NO production; on

the other hand, the superoxide expression may also result from PKC activation.









Endothelin (ET)-1 is a powerful vasoconstrictor. At low concentrations, it induces

vasodilation. While at high concentrations, it causes the constrictive response by

interacting with its receptors on smooth muscle cells and pericytes in the retinal

vasculature. Hyperglycemia-induced PKC activation can enhance ET-1 transcription

level [46].

What Causes Retinal Capillary Cell Death?

Pericytes loss and endothelial cells loss are both seen in diabetic retina. The cell

death will inevitably lead to microaneurysms and vascular obstruction. Polyol pathway,

AGE pathway and oxidative stress are all thought to be associated with cell death.

Sorbitol accumulated in polyol pathway may cause hyperosmolality of the cells [47];

accumulated AGE production in the glycation pathway will form cross-links and to

generate oxygen-derived free radicals [48]; and the oxidative stress will inactivate NO

and cause abnormal chemical changes in DNA structure [49].

What Causes Retinal Ischemia?

Hyperglycemia causes ischemia via several possible mechanisms, including

thickened basement membrane, platelet aggregation, leukocyte activation and adherence.

Hyperglycemia is sufficient to increase the synthesis of basement membrane components,

like fibronectin [50], various types of collagens [51] and vitronectin [52]. Increased

number and size of platelet-fibrin thrombi in retinal capillaries have been found in the

retina of patients with diabetic retinopathy [53]. Hyperglycemia-induced PKC activation

will stimulate platelet-derived factor (PAF) production, which will activate platelets.

Activated platelets can produce platelet-derived microparticles, which are involved in the

thrombus formation [54]. PAF can also stimulate their receptors on leukocytes rolling on

the luminal endothelial membrane and activate them. p2 integrins on activated leukocytes









enable them to adhere tightly to the endothelial cells via binding intercellular adhesion

molecule-1 (ICAM-1), while as the same ICAM-1 is also unregulated by PKC activation.

And NO downregulation can allow leukocytes to escape from NO control, also leading to

leukocyte activation and adherence [54].

Angiogenesis and Growth Factors

Vasculogenesis and Angiogenesis

Small blood vessels consist only of endothelial cells (ECs), whereas larger vessels

are surrounded by mural cells (pericytes in medium-sized vessels and smooth muscle

cells (SMCs) in large vessels) [55]. Vessels can grow in several ways. Vasculogenesis

refers to the formation of blood vessels by endothelial progenitors [55]. It is a process by

which the initial vascular tree forms in the yolk sac and aortic arches, and begins

immediately following gastrulation when mesodermal cells aggregate into blood islands.

Blood islands contain the precursors of hematopoietic and vascular endothelial lineages

[56]. Angiogenesis refers to the formation of new vessels formation by sprouting from

pre-existing vessels and subsequent stabilization of these sprouts by mural cells.

Additional modes of vascular growth include intususception, bridge formation, and

vascular splitting, in which invaginations or extensions of the vessel wall form tubes that

connect or bifurcate parent vessels [56].

The traditional view is that vessels in the embryo developed from endothelial

progenitors, whereas sprouting of vessels in the adult resulted only from division of

differentiated ECs. However, recent evidence has shown that endothelial progenitors

contribute to vessel growth both in the embryo and in ischemic, malignant or inflamed

tissue in the adult. They can even be used therapeutically to stimulate vessel growth in

ischemic tissues, a progress called "Therapeutic Vasculogenesis" [57-59]. Although









retinal neovascularization has been thought to be due to proliferation of endothelial cells

by angiogenesis, Grant et al. showed that hematopoietic stem cells can enter the

circulation and reach the areas of angiogenesis, and clonally differentiate into endothelial

cells [60]. In another study, adult Lin(-) hematopoietic stem cells injected intravitreally

into neonatal mouse eyes have been shown to interact with retinal astrocytes that serve as

a template for retinal angiogenesis [61]. Blood vessels are being modified by endothelial

progenitor cells, hematopoietic stem cells or other stem cells, and these cells functionally

contribute to physiological and pathological angiogenesis.

Angiogenesis is usually inactivated or kept at low levels in normal tissue of an

adult, but may be activated to an excessive state in a number of diseases, such as cancer,

psoriasis, arthritis, retinopathy, obesity, asthma, atherosclerosis, and infectious diseases.

Cancer is another best known disease that involves pathological angiogenesis that can be

potentially targeted for therapy. In 1972 Folkman proposed that solid tumors are

dependent on angiogenesis for growth greater than a few millimeters in size, and that

increases in tumor diameter require a corresponding increase in vascularization [62]. A

critical step during angiogenesis is the local stimulation of endothelial cells by various

cytokines and growth factors. Stimulation causes the endothelial cells to lose their contact

inhibition, migrate and breach the basement membrane, proliferate, and differentiate to

organize into new vessels [63].

Hypoxia-Induced Factor (HIF)

Beyond a size limitation, simple diffusion of oxygen to metabolizing tissues

becomes inadequate, and specialized systems of increasing complexity have evolved to

meet the demands of oxygen delivery in higher animals [64]. One important role in the

systems is angiogenesis, to make new vessels sprouting into the location that blood









delivery is needed. So ischemia or hypoxia is one of the key factors that lead to the

initiation of angiogenesis. Exactly how hypoxia induces angiogenesis was however

poorly understood. The landmark of hypoxia study in the early 1990s showed that

hypoxia could induce expression of platelet-derived growth factor (PDGF) mRNA [65]

and vascular endothelial growth factor (VEGF) mRNA in tissue culture [66]. Both PDGF

and VEGF are thought to be important growth factors triggering angiogenesis. A large

number of genes are involved in different steps in angiogenesis and they are

independently responsive to hypoxia in tissue culture. Besides PDGF and VEGF, nitric

oxide synthase, fibroblast growth factor, angiopoietins, and matrix metalloproteinases are

involved [67-69]. Many of the individual phenotypic processes in angiogenesis such as

cell migration or endothelial tube formation can be induced by hypoxia tissue culture

[70]. Further study of hypoxia-induced angiogenesis leaded to the discovery of a key

transcriptional regulator, hypoxia-inducible factor (HIF)-1 [47, 68, 69, 71].

HIF-1 is a heterodimer DNA-binding factor. HIF-1 consists of an a and P

subunits, both of which have a number of isoforms. HIF-10 subunits are constitutive

nuclear proteins, while HIF-la subunits are hypoxia-inducible. There are three isoforms

for a subunit. HIF-1 a and HIF-2a appear closely related and are both able to interact with

hypoxia response elements (HREs) to induce transcriptional activity [72, 73]. In contrast,

HIF-3a appears to negatively regulate the response, through an alternatively spliced

transcript [74].

The molecular mechanism behind HIF-1 is a pathway that links oxygen

availability and the gene expression of various growth factors, especially VEGF. In

normoxia and hyperoxia oxygen-dependent prolyl hydroxylases hydroxylate HIF-1 a









proline residues, and this chemical modification leads to a HIF-1 capture by a ubiquitin

ligase complex that directs it to the proteasome for destruction. Under hypoxic

conditions, HIF-1 a is not hydroxylated, escapes ubiquitination, accumulates and directs

pro-angiogenic expression [75].

Vascular Endothelial Growth Factor (VEGF)

VEGF was originally discovered as the vascular permeability factor (VPF) that

increased the vascular permeability in the skin [76]. In 1989 Ferrara and Henzel

identified a growth factor for endothelial cells from bovine follicular pituitary cells and

named it VEGF [77], which was then proved to be identical to VPF [78, 79]. VEGF is the

most potent endothelial cell growth factor found to date. In the past two decades, this

growth factor has been studied extensively and its key roles in the proliferation,

migration, invasion, cell survival, differentiation of endothelial cells and other cell types

have been established. It is critical in the normal embryonic development of vasculature

and has essential functions in adults during normal physiological events such as would

healing, menstrual cycle, even though the mRNA levels of VEGF and its receptors

decrease significantly postnatally. Meanwhile, VEGF is also an important factor in

numerous pathological situations, many of which involve abnormal angiogenesis, for

example, inflammation, retinopathies, psoriasis, and cancer. Targeting VEGF signaling in

these diseases has been studied with enthusiasm and a number of novel drugs targeting

VEGF are being tested in clinical trials.

VEGF Family and Isoforms

The VEGF gene family consists of multiple variants, including VEGF-A

(hereafter referred to as VEGF), VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF-F and

placental growth factor (P1GF-1 and P1GF-2 isoforms). They are secreted glycoproteins









that form homodimers, which belong to a structural superfamily of growth factors,

including the platelet derived growth factor (PDGF), characterized by the presence of

eight conserved cysteine residues [80, 81]. VEGF-A is believed to be the major

stimulator for vascular angiogenesis. VEGF-B is structurally similar to VEGF-A and

P1GF is highly abundant in heart, skeletal muscle and pancreas and may regulate

endothelial cell functions via a paracrine fashion [82]. VEGF-C and VEGF-D are

basically involved in lymphangiogenesis and induce the proliferation and cell survival of

lymphatic endothelial cells [83-85]. VEGF-E, encoded by the Orf virus, is structurally

similar to VEGF-A, specifically binds to VEGFR-2 and induces angiogenesis [86].

VEGF-F, as a collective name, summarized the variants isolated from snake venoms [87].

The term VEGF refers to a collection of related isoforms expressed from the same

gene [88]. The gene encoding VEGF, or VEGF-A, is located on the short arm of

chromosome 6 in humans [89] and on chromosome 17 in mice [90]. The vegfgene

consists of eight exons and seven introns, alternative splicing results in many isoforms.

The best studied isoforms in human are VEGF121, VEGF165 and VEGF189. In mice,

the homologous counterpart isoforms contain one less amino acid, so mVEGF164 is the

corresponding isoform for hVEGF165 [90], for example. In all isoforms, the transcrips of

exon 1-5 are all conserved and exon 6 and 7 are where the alternative splicing occurs.

Exon 3 and 4 encode the binding domains for VEGFR-1 and VEGFR-2 [91]. Exon 6 and

7 encode two heparin-binding domains, which influence receptor binding and solubility

[92]. VEGF 189, containing both the exon 6 and 7 transcripts, has high affinity for

heparin sulfate and is mostly associated with the cell surface and the extracellular matrix

[93]. On the contrary, VEGF165, lacking exon 6, is moderately diffusible; and









VEGF121, lacking both exon 6 and 7, is high diffusible [94]. Recently a new isoform

called VEGF165b, a variant of VEGF165, has been identified [95]. The C-terminus of

VEGF165b is encoded by exon 9, instead of exon 8 as in VEGF165 and other isoforms

[96]. VEGF165b binds to but does not trigger receptor phosphorylation, so it is actually

an endogenous inhibitory form of VEGF [96]. This is due to a missing exon 8-encoded

C-terminus, which has mitogenic signaling functions. Figure 1.13 [92] shows the

alternative splicing among VEGF isoforms.

Family Isoform Exons
















Figure 1.13. VEGF-A isoforms [92].
VEGF Receptors
189

165

165b

145

121

Figure 1.13. VEGF-A isoforms [92].

VEGF Receptors

VEGF binds to three cell surface receptor tyrosine kinases: VEGFR-1 (Flt-1),

VEGFR-2 (Flk-1/KDR) and VEGFR-3 (flt-4). VEGFR-1 and VEGFR-2 are primarily

located on vascular endothelium while VEGFR-3 is mostly found on lymphatic

endothelium. These receptors are structurally similar: all of them contain seven

extracellular immnoglobin (Ig)-like domains, a transmembrane domain, a regulatory

juxtamembrane domain, and a consensus tyrosine kinase domain interrupted by a kinase-

insert domain. The second and third Ig-like domains function as the high-affinity VEGF









binding domain, whereas the first and fourth Ig-like domains regulate ligand binding and

facilitate receptor dimerization, respectively [97-99].

VEGFR-1 has a molecular weight of 180 kDa and binds VEGF-A, VEGF-B and

P1GF. The affinity of VEGFR-1 for VEGF is ten-fold higher than VEGFR-2 but its

tyrosine kinase activity is ten-fold weaker than VEGFR-2 [92]. In the classical views, one

of the major functions for VEGFR-1 is to act as a decoy receptor restricting VEGF to

bind to VEGFR-2, which is more mitogenic [100]. VEGFR-1 is required for normal

blood vessel development during embryogenesis and a VEGFR-1 knock-out is lethal in

mice at embryonic day E8.5. The lethality was shown to be associated with an abnormal

increase in the number of endothelial progenitors, which is the phenotype as VEGF

hyperactivity, indicating a negative regulatory function of VEGFR-1 [101]. Supporting

this, a modified form of VEGFR-1 without the tyrosine kinase domain was constructed

and found to be compatible with normal vascular development and angiogenesis in

transgenic mice [102]. A naturally occurring soluble form of VEGFR-1, called sVEGFR-

1 or sFlt-1, is expressed from differential pre-mRNA splicing. sVEGFR-1 has the same

ligand affinity as VEGFR-1, but is missing the transmembrane and intracellular domains

[103, 104]. It binds to free VEGF and reduces its availability to VEGF receptors, which

further suggests its relative, VEGFR-1, as a negative regulator for VEGF signaling.

However, VEGFR-1 does mediate VEGF signaling in non-endothelial cells, especially

those cells that only express VEGFR-1 as the VEGF receptor, such as monocytes and

macrophages [105, 106]. A recent study showed that P1GF signaling mediated by

VEGFR-1 in monocytes is associated with the inflammatory reactions [107]. Besides









monocytes, VEGFR-1 signaling is also believed to be important for endothelial

progenitors and carcinoma cells.

VEGFR-2, a 230 kDa glycoprotein, is recognized as the primary mediator of

VEGF signaling. It regulates endothelial cell proliferation, migration, differentiation, cell

survival and vessel permeability and dilation. VEGFR-2 knock-out mice die between

E8.5 and E9.5 due to deficiency in blood vessel formation [108], indicating that VEGFR-

2 is also crucial for the functions of hematopoietic/endothelial progenitors. VEGFR-3,

170 kDa, binds to VEGF-C and VEGF-D. It is expressed in embryonic endothelial cells

but postnatally becomes restricted to the lymphatic endothelium [109].

Apart from these three VEGF receptors, neurophilins (NRPs) can also act as cell

surface receptor for VEGF, but in an isoform specific manner. NRP-1, originally

identified on neuron cells as a receptor for class 3 semaphorines/collapsins family of

neuronal guidance mediators [110], is also expressed on endothelial cells. It lacks the

intracellular tyrosine domain and needs to associate VEGFR-1 [111] and/or VEGFR-2

[112] to transduce a signal. It is suggested that NRP-1, as a co-receptor, can form a

receptor complex with VEGFR-2 to enhance the binding the signaling of VEGF 165 and

VEGFR-2 cannot sufficiently transducer the VEGF signaling without NRP-1 [113].

NRP-1 also binds VEGFR-1 forming a ligand-independent complex [111]. NRP-2,

lacking an intracellular domain like NRP-1, can also bind to VEGF. It can bind

VEGF121, VEGF145 and VEGF165, but NRP-1 cannot bind VEGF145. NRP-2 can also

bind to P1GF and can interact with VEGFR-1 [114]. In addition to NRPs, heparin sulfate

proteoglycans (HSPGs) can bind to the VEGF isoforms with the heparin binding

domains, such as VEGF165 and VEGF 189. HSPGs are abundant, highly conserved







components of the cell surface and the extracellular matrix of all cells and have been
reported to play a critical role in modulating the differential biological activities of VEGF
isoforms [115].
Figure 1.14 [116] demonstrates the binding of VEGF variants to the receptors. In
summary, VEGF-A binds to VEGFR-1, VEGFR-2 and the receptor heterodimer; VEGF-
C and VEGF-D bind to VEGFR-2 and VEGFR-3. Notably, P1GF and VEGF-B
exclusively bind to VEGFR-1 and VEGF-E exclusively binds to VEGFR-2, which is very
useful in receptor specificity studies.


~1


*VE


PIGF
VEGF-B




GFR-1


NRP-2


VEGFR-1


VEGF-A

h


NRP-1


VEGF-E VEGF-C
VEGF-F VEGF-D



S


II
VEGFR-2


NRP-1


VEGF exon 2-5
VEGF exon 7-8 -
HepaMn 0


IEGFR-3


Formation of blood vessels


Formation of lymphatic vessels


Figure 1.14. VEGF family ligands and their receptors [116].
VEGF Receptor Signaling
As mentioned above, VEGFR-2 is thought to be the major receptor for VEGF
signaling in endothelial cells. Upon binding of VEGF, VEGFR-2 is activated by


1


[Mimi"


E


H









autophosphorylation, and initiates a number of signaling cascades that induce cell

proliferation, migration, survival and/or increase in endothelium permeability.

The cell proliferation induced by VEGFR-2 signaling typically involves MAPK

pathways. Activation of VEGFR-2 recruits Grb-2 and activates it, which leads to the

activation of Sos, then the activation of Ras, eventually the stimulation of

Rafl/MEK/ERK signaling cascade [117]. Activated MAPK pathways will translocate to

the nucleus and regulate the gene expression and cell proliferation. VEGFR-2 can also

recruit PLCy-1, and the activation of PLCy-1 will induce phosphatidylinositol 4,5-

bisphosphate (PIP2) hydrolysis producing 1,2-diacylglycerol (DAG) and inositol 1,4,5-

trisphosphate (IP3). The activation of PKC can result from the production of DAG, which

further leads to the Ras-independent Raf activation and thus the stimulation of ERK

activity [118]. The data demonstrating the requirement of PI3 kinase in the VEGFR-2-

induced cell proliferation are conflicting, so the involvement of PI3 kinase is

controversial [119, 120]. Cells expressing VEGFR-1 are unable to activate MAPK [121].

VEGF can act as a chemoattractant for endothelial cells so that VEGF signaling is

believed to be involved in cell migration. Firstly, the signaling from activated VEGFR-2

can promote focal adhesion kinase (FAK) phosphorylation and recruit it to focal

adhesions, together with paxillin and actin-anchoring proteins like talin or vinculin [122,

123]. Therefore the cytoskeleton organization is modified and cell migration is promoted.

Secondly, the p38/MAPK pathway can be activated upon VEGF binding to VEGFR-2,

and thus may play a role in cell migration and p38 inhibitors can decrease cell migration

[124]. Thirdly, the PI3 kinase/Akt pathway can regulate the actin organization and cell

migration [125]. Besides VEGFR-2, VEGFR-1 and NRPs have all been implicated in









VEGF-mediated cell migration and invasion [92]. However VEGFR-2 is considered to be

the main mediator of cell migration. VEGFR-1 stimulates p38 phosphorylation and has

no effect on endothelial cell migration [126].

PI3 kinase/Akt pathway plays an important role in the VEGF-induced cell

survival. The phosphorylation of VEGFR-2 can lead to the activation of PI3 kinase and

Akt/protein kinase B (PKB). Akt is an anti-apoptotic factor and is sufficient to promote

cell survival. It has been reported that the inhibition of PI3 kinase abolished Akt

activation and the VEGF-mediated cell survival was also blocked [127]. VE-cadherin and

P-catenin can complex with VEGFR-2 and PI3 kinase and form a transient tetramer to

promote cell survival [128]. The expression of some anti-apoptotic factors can also be

induced by VEGF and contribute to cell survival, for instance, caspase inhibitors Bcl-1

and Al [129] and IAP (apoptosis inhibitors) family proteins [130]. VEGFR-1 cannot

associate with the VE-cadherin complex [128] and does not activate the PI3 kinase/Akt

pathway [127], so that it is thought to not be involved in VEGF-induced cell survival.

Originally discovered as a vascular permeability factor, VEGF can also increase

the vascular permeability. The administration of VEGF to endothelial cells is shortly

followed by the formation of some specialized regions in the cell membrane that are

highly permeable to macromolecules [131]. PI3 kinase and p38/MAPK have been

suggested to be involved in the increase of membrane permeability [132]. In the

established vessels, VEGF also regulates vascular permeability by affecting the

components of tight, adherence and gap junctions, such as VE-cadherin, p-catenin and

occludin [116]. Another aspect of this interaction is that endothelial NO synthase (eNOS)









can induce the activation of Akt, which further regulates the NO level and leads to vessel

dilation and permeabilization [133, 134].

Figure 1.15 [92] summarizes VEGF signaling via VEGFR-2.


VWEF Sigpaifg


Figure 1.15. VEGF signaling via VEGFR-2 [92].

The Function of VEGF in Ocular Neovascularization

VEGF is thought to play a central role in retinal angiogenesis as supported by data

from animal models and clinical investigation. VEGF is upregulated in the retina during

neovascularization in animal models with ischemia-induced retinopathy [135-138], and









the VEGF mRNA is increased by three-fold within 12 hours of the onset of relative

hypoxia and maintained for many days at higher levels until new vessels start to regress

[136]. Patients with active PDR were found to have increased levels of aqueous and

vitreous VEGF [139-145]. Higher levels of VEGF expression were also reported in

epiretinal neovascular membranes and retinas from PDR patients [146, 147]. However,

an interesting finding in the active PDR patients showed that there was a significant

decrease in VEGF levels after panretinal laser photocoagulation treatment [140]. Further

evidence supporting VEGF's major role in retinal neovascularization comes from VEGF

inhibition studies. VEGF receptor chimeric proteins, neutralizing antibodies, and

antisense oligonucleotides have successfully showed inhibition effects on

neovascularization [148-151].

Based on the evidence, it is widely accepted that VEGF is very important and

necessary for retinal neovascularization, but VEGF may not be sufficient for it. Repeated

intraocular injections of VEGF or sustained intravitreous release of VEGF in primates

results in severe changes to retinal vessels including dilation, leakage, and

microaneurysms, but no apparent retinal neovascularization [152, 153]. When VEGF

expression is driven by the retinal-specific rhodopsin promoter in the transgenic mice, the

development of neovascularization was produced in the deep capillary bed of the retina,

and high levels of VEGF expression can further cause retinal traction and detachment

[154]. The new vessels grew from the deep capillary bed into the subretinal space. The

close proximity of the deep capillary bed to the photoreceptor expressing VEGFs and

differential susceptibility of the vascular beds might be an explanation for this vascular

growth [155].









The role of VEGF in choroidal neovascularization (CNV) is less clear. Increased

VEGF expression was found in fibroblasts and RPE cells of choroidal neovascular

membranes surgically removed from patients [146, 156, 157]. And in the animal model

of laser-induced CNV, it has been shown that VEGF mRNAs were upregulated in the

neovascular lesions [158]. VEGF is thought to be necessary in CNV development

because several specific VEGF signaling inhibitors have shown reduced CNV [159-161].

But VEGF is not a sufficient stimulator of CNV because increased expression of VEGF

in photoreceptors or RPE cells does not lead to CNV [154, 162].

Basic Fibroblast Growth Factor (bFGF or FGF2)

FGF is a family of heparin-binding growth factors. bFGF has been localized in the

adult retina. In the mouse model of ischemia-induced retinopathy, bFGF level is elevated

during neovascularization [163]. In the animal model of laser-induced subretinal

neovascularization, RPE cells were found to be stained with aFGF and bFGF [164]. In

studies on clinical specimen, both elevated and non-significantly-changed levels of bFGF

have been reported in the vitreous sample of PDR patients [165, 166], which argues

against a major role in retinal neovascularization. Further evidence comes from animal

models. In the ischemia-induced retinopathy or laser-induced CNV mouse model,

transgenic mice deficient in bFGF developed the same amount of retinal or CNV as the

wild-type mice, respectively, indicating bFGF expression may not be necessary in

angiogenesis [167, 168]. It has been hypothesized that bFGF will manifest its angiogenic

potential when there is cell injury. It is found that bFGF can get access to the

extracellular compartment during photoreceptor damage and increased CNV can be

stimulated [169].









Angiopoietins

Angiopoietins and their receptors (Tie receptors) are another endothelial-specific

system that has been implicated in vascular growth and development. Current

understanding about the Tie receptors is that Tiel signaling is important for vascular

integrity and Tie2 signaling is important in remodeling of the developing vessels by

maximizing the interactions between endothelial and supporting cells [155]. The ligand

for Tiel has not been identified. Angiopoietin (Ang) 1 and 2 are ligands for Tie2

receptor. Angl binds with high affinity and initiates Tie2 phosphorylation and

downstream signaling. Ang2 also binds with high affinity, but does not stimulate

phosphorylation of Tie2. It looks like Ang2 is a naturally occurring antagonist for Angl

and Tie2. The interaction of Angl and Tie2 is essential for the remodeling function of

Tie2 on newly developing vessels. And it has been hypothesized that Ang2 might provide

a key destabilizing signal involved in initiating angiogenic remodeling. The Ang2

blockade of Tie2 signaling can disrupt "stabilizing" inputs to ECs, making ECs more

responsive to VEGF and thereby stimulating angiogenesis. But when there is no VEGF

present, those ECs are prone to apoptosis and the "destabilized" vessels regress [170].

Ang2 mRNA levels have been reported to increase in normal and pathological

retinal angiogenesis [171-174]. It has been shown that Ang2 can stimulate a significant

upregulation of proteinases in EC [174] that may be important for cell migration during

retinal neovascularization.

Platelet-Derived Growth Factor (PDGF)

PDGF, a dimer protein, a potent mitogen and a chemoattractant, has been

implicated in angiogenesis. Similar to VEGF, PDGF is another growth factor that is

elevated after hypoxia [65]. Recent findings about PDGF include: increased levels of









PDGF-AB was reported in vitreous samples of PDR patients [175]; overexpression of

PDGF-B in transgenic mice leads to proliferation of endothelial cells, pericytes and glial

cells resulting in traction retinal detachment [176-179]. It has been proposed that PDGF

may act in concert with VEGF in ischemic retinopathy [176-178].

Integrins

Integrins are a family of transmembrane proteins that are the major cell surface

receptors responsible for the attachment of cells to the extracellular matrix. Structurally,

integrins are heterodimeric receptors composed of two subunits, a and P. More than 20

different integrins are formed from the combination of 18 known a subunits and 8 known

p subunits. Each integrin binds to its own corresponding extracellular matrix (ECM)

and/or cell surface ligand. These include structural ECM proteins, such as collagens,

fibronectins, and laminins, as well as provisional ECM proteins that are deposited during

tissue remodeling and thrombotic events [180].The first integrin-binding site to be

identified was the sequence Arg-Gly-Asp, which is recognized by several integrins.

However, other integrins bind to other distinct peptide sequences. While integrins are one

of the most essential cell surface components in the body and are present in almost all

tissues, no cell expresses all integrins. Indeed the particular integrin types expressed are

dependent on the ECM ligands present within the local microenvironment. Even on a

given cell type, the specific integrins expressed are also altered to match the concurrent

changes within the local ECM. So the expression of integrin is spatially and temporally

regulated.

The integrins also function as an anchor for the cytoskeleton. The interaction

between the cytoskeleton and the extracellular matrix is responsible for the stability of

cell-matrix junctions. There are two categories of cell-matrix junctions: focal adhesion









and hemidesmosome. In focal adhesions the cytoplasmic domains of the 0 subunits of

integrins associate with bundles of actin filaments to anchor the actin cytoskeleton at the

cell-matrix junctions. While in hemidesmosome integrins interact with intermediate

filaments instead of actin. Hemidesmosome is mostly found in the anchorage of epithelial

cells to the basal lamina.

Integrin Signaling

Unlike many cell surface receptors that contain tyrosine kinases, integrins do not

contain intrinsic tyrosine kinase activity. Upon ligand binding, the integrins undergo a

conformational change into its activation state. The change in activation has been

assessed by showing evidence of polymerization, clustering, or the surface exposure of

different antibody binding epitopes [181]. Since the cytoplasmic domains of the integrins

can bind constitutively to cytoskeletal components such as talin, the conformational

change and activation of integrins can result in changes in cytoskeletal protein functions,

which will lead to major changes in cell shape and locomotion. On the other hand the

activation of integrins can initiate a series of signaling transductions, with the

involvement and assembly of a variety of signaling molecules.

A non-receptor protein tyrosine kinase called FAK (focal adhesion kinase) plays a

key role in integrin signaling. FAK is localized at the focal adhesion and is rapidly

tyrosine auto-phosphorylated following ligand binding by integrins. Besides FAK,

members of the Src family or non-receptor protein tyrosine kinases also associate with

focal adhesion and are involved in integrin signaling. Src and FAK probably interact with

each other, resulting from the binding of the Src SH2 domain to the auto-phosphorylated

sites of FAK. Src then phosphorylates additional sites on FAK. In addition to Src, the

binding sites for SH2 domain created during FAK phosphorylation are also taken









advantage of by other downstream molecules, for instance, PI-3 kinase and the Grb2-Sos

complex. These signaling molecules can form multicomponent signaling complexes that

recruit and include small GTPase proteins such as Ras, Rho, Rac. Their involvement and

activation will further lead to the activation of a number of signaling cascades. Figure

1.16 [180] demonstrates the integrin signaling via the Akt, ERK and JNK pathways.

These signals collaborate to regulate cellular proliferation, migration and survival. And

also, many small GTPases like Rho and Rac play critical roles in cytoskeletal remodeling

events [180].








Grb2 Shc
Sos
Ras
P13K (k
Nck
Raf. PDK/
I LK Rac
MEK PAK
AKT
ERK1/2 JNK


Proliferation
Survival
Migration


Figure 1.16. The activation of integrins can lead to the signal transduction in a number of
pathways. [180].

As mentioned above, integrins need to be activated to serve as a signaling

molecule. The activation involves a conformational change that results in an increase in

ligand-binding affinity. Proposed in the current model, the inactive form of integrins are









in a folded conformation in which the ligand-binding domain is adjacent to the

membrane. When activated, the affinity for the ligand is increased, and ligand occupancy

stabilizes the extended conformation of the integrin [182]. Simultaneously, the associated

topological change in the transmembrane and cytoplasmic domains makes them separate

and bind to intracellular signaling molecules to initiate downstream pathways [182].

According to this model, the conformational change in integrins that induces signaling is

the same as the one that is induced by activation. And this activation state can be

promoted by both extracellular ligands (so-called "outside-in" signaling) and intracellular

signaling molecules ("inside-out" signaling) [182]. The outside-in signaling is usually

triggered by ECM ligands and the inside-out signaling molecules are usually the effectors

of the activation of growth factor receptors. The ECM (local determiner) and growth

factors (systemic and local determiner) can work synergically to enhance the signaling

outcome induced by specific integrins in a given cell. Under certain circumstances it is

not sufficient to promote cell survival and proliferation until both proper ECM and

growth factors are both present.

The activation of integrins, especially those involving the interaction with growth

factor receptors, usually occur in lipid-raft microdomains, where cholesterol and

glycosphingolipids [183] and intracellular signaling molecules like Src family kinases

[184] are relatively concentrated in the cell membrane. These lipid-raft microdomains are

distinct from the surrounding membrane in that they restrict the diffusion of the contents.

It is suggested that the lipid-raft has other functions [182]. First, they could serve as a

physical concentration of pre-assembled molecules for signaling upstream or downstream

of the integrin, and the signaling inhibitory molecules could be excluded. Second,









different integrin pools could be separated so that their own distinct function could be

better performed. Third, the lipid-raft may also facilitate and/or maintain integrin

activation. In addition to help from concentrated pre-assembled molecules, the altered

membrane structure, due to the distinct chemical characteristics in the lipid-raft, may

favor conformational equilibrium between the inactive and the active forms. It is also

proposed that the active integrins might help to generate the lipid-rafts in other models

[185].

The integrins can regulate the signaling of growth factor receptors. First the

phosphorylation state of the growth factor receptors can be regulated. One example is the

interaction between av33 and the epidermal growth factor receptor (EGFR) on human

endothelial cells. The adhesion to the ECM mediated by integrin can lead to a low

phosphorylated state within the cell, resulting in the phosphorylation of four tyrosine

residues but not on the fifth tyrosine which is only phosphorylated by EGF binding. This

phosphorylated state is lower than in high concentration of EGF but ECM attachment

doesn't occur. This low phosphorylated state is sufficient to induce cell survival but not

proliferation. However, if only low concentrations of EGF are present, the ECM

attachment can promote the phosphorylation similar to high concentrations of EGF alone

[182]. Thus the phosphorylation of EGFR on endothelial cells is not only regulated by

ligand binding, but also regulated by integrins. The regulation on growth factor receptors

can also occur when integrins interfere with the receptor expression.

As for the inside-out signaling, the activation of growth factor receptors is usually

the source of signaling. Integrins can be regulated by growth factor receptors in many

aspects and cell behavior can be altered. The integrin expression level can be altered, for









instance, the expression level of a number of integrins on endothelial cells are increased

by angiogenic growth factors such as FGF-2 [186]. The phosphorylated state of integrins

can also be regulated by growth factor receptors. One example is the laminin receptor

a6p4, an essential component in the hemidesmosomes, influences epidermal cell

attachment to the underlying basal lamina. EGFR can induce the phosphorylation of the

cytoplasmic domain of 34 subunit. This results in the cytoplasmic recruitment of Shc, and

the activation MAPK and PI3K. More importantly, the change in the phosphorylation

state leads to release of the integrin from its ligand, thus the hemidesmosome

disassembles, which is a required step for cell proliferation and/or migration [187].

Besides the phosphorylation state, growth factor receptors can also alter the activation

state of integrins. For example, it has been shown that VEGF can activate avp3 on human

umbilical vein endothelial cells, thus the adhesion to ECM is promoted and cell migration

follows [188].

Relationships between Integrin and Other Growth Factor Receptors in
Angiogenesis

Among the over 20 integrins that have been discovered to date, two of them, avp3

and av35, are thought to be especially important for angiogenesis. These integrins are not

seen on normal epithelial cells in skin, but are highly expressed on endothelial cells

participating in angiogenesis [189]. Only avp3 was found in choroidal neovascular

membranes from ARMD patients, while both avp3 and av35 were found in epiretinal

membranes from DR patients [190]. Therefore, retinal and choroidal neovascularization

may differ in the integrin requirement. Inhibition studies on integrins further support this.

Agents that bind avp3 and/or av35 can suppress retinal neovascularization, even though









the effect is modest, but the inhibition of avp3 or av35 has no significant effect on

choroidal neovascularization [189].

Endothelial cells express at least eight different integrins including avp3 and av35

[191], each of them having their own specific ligand. For example, collagen is a ligand

for a2p31 while fibrin is a ligand for avp3, so that avp3 influences adhesion and signaling

events of the endothelial cells bound to fibrin [192] but not of those bound to collagen

[40, 193]. However, the endothelial cells will eventually become apoptotic when bound

with collagen alone via a2p1. The unligated avp3 receptors seem to cluster on the cell

membrane and colocalize with caspase activity, especially caspase 8 [194]. In addition to

avp3, many other unligated integrins are likely to induce cell death, this is why integrins

could be categorized as dependent receptors under a variety of circumstances.

avp3, expressed (although not exclusively) on endothelial cells, has been linked to

many angiogenic signaling pathways via the interaction with receptors for a number of

growth factors, such as VEGF, EGF, IGF-1, PDGF and insulin. Since VEGF and IGF-1

are the two most important growth factors involved in my dissertation work, I am

focusing on the interaction between avp3 and VEGFR and IGF-1R.

VEGFR-2 activation by phosphorylation is promoted by avp3 [195]. avp3 and

VEGFR-2 interact and the co-immunoprecipitation of these two receptors has been

demonstrated. However VEGFR-2 does not co-immunoprecipitation with the 31 or 35

subunits. VEGFR-2 phosphorylation and mitogenicity are enhanced in cells plated on

vitronectin, an avp3 ligand, compared with cells plated on fibronectin, an a531 ligand, or

collagen, an a23 1 ligand; further demonstrating a functional relationship between VEGR-

2 and avp3. Cell adhesion, migration, soluble ligand binding, and adenovirus gene









transfer mediated by avp3 are all enhanced by VEGFR-2 signaling. An anti-p3 integrin

antibody reduces VEGFR-2 phosphorylation and PI3 kinase activity suggesting that

VEGFR-2 signaling initiated by avp3 occurs through the PI3 kinase pathway.

Another molecule, p66 She (Src homology 2 domain containing), has been shown

to play a key role in the VEGF-avp3 interplay during tumor growth and vascularization

[196]. The activation state of avp3 integrin has a critical function in in vivo tumor growth

by influencing VEGF expression. By using a non-activable 03, a S752P mutant that

cannot cluster, it was found that the stimulation of VEGF expression also depends on

avp3 clustering. The recruitment of p66 She and phosphorylation of 33-associated p66

She are enhanced following avp3 clustering. The recruitment is not sufficient for avp3-

mediated effects on VEGF production and tumor vascularization but the phosphorylation

is necessary, in that a dominant-negative form of p66 Shc, which is phosphorylation-

defective, completely abolished integrin-induced VEGF expression.

IGF-1 is a classic endocrine hormone and systemically synthesized in liver and

transported to the peripheral tissues stimulating growth. In addition, IGF-1 is also

synthesized locally in peripheral tissue to promote growth in an autocrine/paracrine

manner. Similar to VEGF and other growth factors, the extracellular environment

contributes to influence the outcome of the hormone signaling. It has been shown that

many ECM proteins, such as collagen type I and type IV, fibronectin, thrombospondin,

and osteopontin, can modulate the response of various cell types to IGF-1 stimulation via

their integrin receptors [181]. The interactions between avp3 and IGF-1 on vascular

smooth muscle cells (SMC) have been illustrated in great detail and can be used as a

good example of how growth factors and integrin signaling influence each other.









When IGF-1 binds to the IGF l-R, IGF1-R will auto-transphosphorylate its two P

subunits, and further recruit signaling molecules such as insulin receptor substrate-1

(IRS-1) and Shc, which can transduce the singling into corresponding cascades, such as

the PI3K and MAPK pathways. Despite kinases, phosphatases also participate in the

signaling modulation. Phosphatases induce dephosphorylation reactions, which can result

in either activation or inactivation of signaling molecules. One phosphatase, Src

homology 2 containing tyrosine phosphatase (SHP-2), normally transfers to IGF-1R 20

minutes after IGF-1 stimulation, resulting in a decrease in the phosphorylation level of

the receptor and subsequent attenuation of MAKP and PI3K activation [181]. However, a

premature transfer at 5 minutes and premature attenuation has been found when the

ligand occupancy of avp3 is blocked [197]. So obviously the properly liganded and

activated avp3 is a necessary partner in IGF-1R signaling.

Normally when IGF1-R and av33 are activated after ligand binding, SHP-2 will

transfer to the phosphorylated 33 subunit first. An adaptor protein, DOK-1, facilitates the

transfer. DOK-1 is phosphorylated after IGF-1 stimulation, and the YXXL motifs within

its C-terminus domain become capable of binding to SHP-2 via SH-2 domains [198].

Also, DOK-1 contains a phosphotyrosine binding (PTB) domain, which allows it to bind

to p3 at a tyrosine that is phosphorylated after avp3 activation [199]. Thus DOK-1

mediates SHP-2/03 association. If the transfer of SHP-2 to 33 is impaired for any reason,

SHP-2 will be aberrantly transfer to IGF-1R instead and the premature dephosphorylation

of IGF-1R occurs [181].

One SHP substrate, SHPS-1, becomes phosphorylated after IGF-1R activation. It

is a single chain transmembrane protein and SHP-2 can bind to it via SH-2 domain. The









transfer of SHP-2 from p3 to phosphorylated SHPS-1 is a necessary step to maintain

optimal MAPK and PI3K activation [200]. SHPS-1 also recruits She to form a complex

that is critical for MAPK and PI3K activation. SHP-2 can activate a Src family kinase via

SH-2 domain binding, so that this Src family kinase is recruited to SHPS-1 and

phosphorylates She in the complex [181]. SHP-2 is further transferred to the appropriate

downstream signaling molecules to maintain MAPK and PI3K activation.

avp3 has several ECM ligands, such as osteopontin, thrombospondin and

vitronectin. For avp3 on SMC, the major ECM ligand is vitronectin. The heparin binding

domain and RGD (arginine-glycine-asparginine) sequence can both function as the avp3

binding site. It is believed that the heparin binding domain is the binding site triggering

p3 activation, in that the exposure of cells with the heparin binding domain peptide

results in avp3 phosphorylation and recruitment of SHP-2 to the plasma membrane [201].

Contrarily, binding of p3 to the RGD sequence has been found to induce the cleavage of

p3, thus also the premature recruitment of SHP-2 to IGF-1R and the premature IGF-1R

dephosphorylation [202].

Similar to the interaction between integrins and other receptors, it is believed that

avp3 and IGF1-R signaling occurs within a restricted compartment on the membrane.

Integrin-associated protein (IAP) facilitates the formation of this compartment. After

IGF-1 exposure, IAP is translocated to the regions where avp3 resides [181]. More

importantly, IAP can induce an increase in the affinity of avp3 for its ligands [203]. The

extracellular domain of IAP can associate with SHPS-1 and an antibody disrupting this

association prevents IGF-1 stimulation of SHPS-1 phosphorylation and SHP-2 transfer to









SHPS-2 [204]. Therefore, the clustering of avp3 and the assembly of a signaling

complex involving SHPS-1 may be a crucial in av33 and IGF-1R signaling.

Pigment Epithelium-Derived Factor (PEDF)

The vasculature is normally quiescent under physiological conditions, since there

is a balance between the pro-angiogenic and anti-angiogenic factors. Angiogenesis is

initiated when there is increase in pro-angiogenic factors and/or decrease in anti-

angiogenic factors. PEDF is one of the naturally occurring anti-angiogenic factors.

In the mouse model of retinopathy, it has been shown that hyperoxia results in a

decline of VEGF levels with a concomitant expression of PEDF, and the relative hypoxia

led to downregulation of PEDF during the angiogenesis process [205]. Systemic or

intravitreal administration of PEDF [206, 207] and gene transfer with adenoviral vectors

expressing PEDF [176-179] have been reported to decrease the ocular neovascularization

levels, In the clinical studies, The vitreous levels of PEDF from PDR patients were found

to be lower than normal [208], and the immunochemical staining of PEDF on retinas

from PDR patients are much less intense compared with non-PDR [208]. All of these

evidence supports that PEDF, an anti-angiogenic factor, may be involved in the

suppression of retinopathies.

Insulin-Like Growth Factor (IGF)-1

The discovery of a role of growth hormone (GH)/IGF-1 in DR can be traced back

to 1950s. The regression of retinal neovascularization was seen after pituitary infarction

[209], and pituitary ablation was even used as a therapeutic method for PDR. More

recently, in several studies in patients with PDR, elevated serum and vitreous levels of

IGF-1 have been associated with retinal neovascularization [210-212].









In a GH inhibition study, retinal neovascularization was suppressed in transgenic

mice expressing a GH antagonist gene and normal mice treated with an inhibitor of GH

secretion [213]. This inhibition of neovascularization could be reversed by exogenous

administration of IGF-1. IGF-1 also plays a necessary role in normal retinal vascular

development. In IGF-1 knockout mice, normal development of the retinal vasculature

was arrested despite the presence of VEGF [214]. This also supports the idea that VEGF

alone is not sufficient for the development of retinal vessels. Clinically it has been found

that the development of ROP in premature infants was strongly associated with a

prolonged period of low levels of IGF-1 [214]. This suggests that the critical role IGF-1

plays during normal retina vascular development. Lack of IGF-1 in the early neonatal

period leads to the development of avascular retina, and later the proliferative phase of

ROP [155]. The function of IGF-1 in CNV is still not clear.

The IGF system includes the IGF-1, IGF-2, the IGF-1 receptor (IGF-1R), and IGF

binding proteins (IGFBPs). IGF-1 can be expressed in the liver and utilized systemically

as an endocrine, or can be expressed at peripherals and function in autocrine/paracrine

mechanisms. The multiple physiologic and pathologic effects of IGF-1 are primarily

mediated by IGF-1R, and are also modulated by complex interactions with IGFBPs,

which themselves are also modulated at multiple levels.

IGF-1 and IGF-1R

IGFs are synthesized in almost all tissues and have important regulatory function

on cell growth, differentiation, and transformation. IGF-1 is the product of the IGF-1

gene, which has been mapped to chromosome 12 in humans and chromosome 10 in mice

[215]. IGF-1 functions in both prenatal and postnatal development and exerts all of its

known physiological effects through binding with IGF-1R. Circulating IGF-1 is









generated in the liver under the control of growth hormone [216], and bound with

IGFBPs as the endocrine form in the circulation. The IGF-1 produced in other organs and

tissues has a lower affinity for IGFBPs, representing autocrine and paracrine forms of

IGF-1. The IGF-1R gene is located on chromosome 15 in human [215], and IGF-1R is

expressed everywhere in the body. The mature receptor is a tetramer consisting of 2

extracellular a-chains and 2 intracellular 3-chains with the intracellular tyrosine kinase

domain. IGF-1R signaling involves autophosphorylation and subsequent tyrosine

phosphorylation of She and insulin receptor substrate (IRS) -1, -2, -3, and -4. IRS serves

as a docking protein and can activate multiple signaling pathways, including PI3K, Akt,

and MAPK. The activation of these signaling pathways will then induces numerous

biologic actions of IGF-1 (Figure 1.17 [216]).


Figure 1.17. IGF-1 signaling transduction [216].









The expression of IGF-1 in ECs is low, but it is expressed both in macrovessel

and microvessel ECs. IGF-1 stimulates vascular EC migration and tube formation. IGF-1

is important for promoting retinal angiogenesis, and an IGF-1R antagonist suppresses

retinal neovascularization in vivo by inhibiting vascular endothelial growth factor

(VEGF) signaling [217]. The effect of IGF-1 on ECs is mediated in different signaling

pathways. For example, IGF-1-induced nuclear factor-KB (NF-KB) translocation requires

both PI3K and extracellular-regulated kinase, while IGF-1-stimulated EC migration

requires only PI3K activation [218]. And the IGF-1 effects are also regulated by

endothelial nitric oxide synthase (eNOS) expression and VEGF signaling [217].

IGF-1 and IGF-1R are also expressed in vascular smooth muscle cells (VSMCs),

and their expressions are regulated by several growth factors in different pathways.

Thrombin and serum deprivation, tumor necrosis factor (TNF)-a, and estrogen

downregulate IGF-1 mRNA and protein levels; reactive oxygen species (ROS) increases

the levels; Ang2 and PDGF have been reported to both increase and decrease the levels.

IGF-1 functions as a potent mitogen and antiapoptotic factor and migration stimulator for

VSMCs [216]. As for the IGF-1R, its expression can be upregulated by Ang2 via the

activation ofNF-KB [219]; can be upregulated by fibroblast growth factor (FGF),

mediated by the transcriptional factor STAT1, STAT 3 [220]; and the Ras-Raf-MAPK

kinase pathway was shown to be required for both of the above growth factor. The cross-

talk between IGF-1R and other receptors can also regulate IGF-1 function. For instance,

blocking ligand occupancy of aV33 integrin receptor results in premature recruitment of

SHP-2 to the IGF-1R receptor and reduces IGF-1 signaling [200].








IGFBPs and ALS

At least 6 IGFBPs have been well characterized, and they function as transporter

proteins and as storage pools for IGF-1. The expression of IGFBPs is tissue- and

developmental stage-specific, and the concentrations of IGFBPs in different body

compartments are different. The functions of IGFBPs are regulated in multiple ways,

such as phosphorylation, proteolysis, polymerization [221], and cell or matrix association

[222] of the IGFBP. All IGFBPs have been shown to inhibit IGF-1 action, but IGFBP-1, -

3, and -5 are also shown to stimulate IGF-1 action [223]. Some of IGFBPs' effects might

be IGF-1 independent.


Proteolysis


IGF IGFO

0 k Extracellular
IGFRI

Intracellular



Inhibition
Proliferation

Figure 1.18. Proposed pathway of IGF-dependent IGFBP action [223].

The precursor forms of IGFBPs have secretary signal peptides and mature

proteins are all found extracellularly. They all have a conserved amino-terminal domain,

a conserved carboxyl-terminal domain and a non-conserved central domain. Both of the

amino-terminal and carboxyl-terminal contribute to IGF binding [223], which implies









IGF-binding pocket structure. The major IGF transport function can be attributed to

IGFBP-3, the most abundant circulating IGFBP. It carries 75% or more of serum IGF-1

and IGF-2 in heterotrimeric complexes that also contain the acid labile subunit (ALS)

[224]. Free or binary-complexes (without ALS) are believed to exit the circulation

rapidly, whereas ternary complexes appear to be essentially confined to the vascular

compartment. In addition to their effects derived form circulation, IGFBPs also have

local actions, both autocrine and paracrine. They have been documented to affect cell

mobility and adhesion [225, 226], apoptosis and survival, and cell cycle [227-229]. I will

concentrate on IGFBP-3 in this discussion.

IGFBP-3 have both potentiation and inhibition effect on IGF-1 actions. It is

thought that IGFBP-3 inhibits IGF-1-mediated effects via its high-affinity sequestration

of the IGF-1. But in contrast, preincubation of cells with IGFBP-3 before IGF-1

treatment can lead to the accumulation of cell-bound forms of IGFBP-3 with lowered

affinity for IGF [230], which may enhance the presentation of IGF-1 to IGF-1R. But It

was also found that cell-bound forms of IGFBP-3 could still attenuate IGF-1-mediated

IGF-1R signaling [231]. It has also been reported, based on competitive ligand-binding

studies, that IGFBP-3 can interact with IGF-1R, causing inhibition of IGF-1 binding to its

receptor [232]. Therefore, the interaction of IGFBP-3 with IGF-1 and IGF-1R signaling

system requires further study. Limited digestion from proteases on IGFBP-3 can release

IGF-1 from the complex and control the bioavailability of IGF-1. These specific

proteases include serine protease, cathepsins, and matrix metalloproteinases [223].

Proteolysis results in IGFBP-3 fragments with decrease affinity for IGF-1, but several

studies have shown the inhibition of IGF actions by IGFBP-3 fragments with low affinity









for IGFs [223]. It is not clear whether this inhibition comes form IGF-1 sequestration or

from its interaction with IGF-1R. IGFs themselves can also influence the production of

IGFBPs and IGFBP-specific proteases, or regulate the activity of these proteases [223].

Figure 1.18 [223] summarizes proposed IGFBP actions that depend on binding of IGFs

and modulation of IGF-1R.



DNA damage -- p534 baxd bd-2t

Antiestrogens 1 I
Retinoic acid I_____FBP-3 Apoptosis
Vitamin D
TNF-a 0 \t as
IGFBP-3K/ %%tPprESes

TGF-p r IGF-I
p21/wafl
Growth factors a
Mutation- ras_
Cell cycle Migration


Figure 1.19. Overview of possible IGFBP-3 antiproliferation pathways [223].

IGFBPs also have their own intrinsic bioactivity, without modulating IGF actions,

either in the absence of IGFs (IGF-independent effects) or in the presence of IGFs

without triggering IGF-1R signaling (IGF-1R-independent effects). Recently there has

been particular interest in IGFBP-3's function to induce apoptosis independently of

inhibiting the survival functions of IGF-1 [233-236]. Several studies using human breast

cancer cells have correlated the induction of IGFBP-3 mRNA and protein expression

with growth-inhibitory effects of various antiproliferative agents including TGF-3,

retinoic acid [237], antiestrogens [238], vitamin D analogs [239], and TNF-a [240].

IGFBP-3 expression is also upregulated by the transcription factor p53 in colon









carcinoma cells. And in the experiments using antisense IGFBP-3 or specific antibodies

to sequester the IGFBP-3, the antiproliferative effects of some of these factors and be

partially abrogated [223]. In addition, there is evidence showing that some proteolyzed

forms of IGFBP-3 also have IGF-independent effect, especially some IGFBP-3 amino-

terminal fragments [223], and they showed little or no affinity for IGFs. This supports the

existence of IGF-independent bioactivity. Figure 1.19 [223] summarized some of the

proposed pathways of IGFBP-3 independent functions.

IGFBP-3 has IGF-1 independent effects. Interactions of IGFBP-3 with known

signaling pathways have been demonstrated. The type V receptor for TGF-P (TORV) has

been shown to be bound with IGFBP-3 relative specifically and may be involved in

IGFBP-3 inhibitory signaling [241]. IGFBP-3 has been shown to stimulate the

phosphorylation of T3RI of the signaling intermediates Smad2 and Smad3 [242], while

TORV signaling does not involve Smad phosphorylation. All-tans-retinoic acid (RA) is a

potent inducer of IGFBP-3 in some cancer cells [223]. The growth-inhibitory effect of

RA requires the presence of RA receptor (RAR)-P and can be blocked by retinoid X

receptor (RXR)-specific retinoids. IGFBP-3 has been shown to inhibit RA signaling,

possibly through enhancing RXR signaling [223]. IGFBP-3 may also interact with PI3-

kinase pathway and MAPK pathway. LY294002, an inhibitor of PI3-kinase activity,

could block the effects of IGFBP-3 [243]; MAPK/ERK pathway inhibitor, PD98059, can

restore the inhibitory effect of IGFBP-3 on DNA synthesis, blocked in cells expressing

oncogenic ras, in breast epithelial cells [244]. Recently it has been shown that IGFBP-3

strongly up-regulate signal transducer and activator of transcription 1(STAT1) mRNA in

the process of chondrocyte differentiation, and phospho-STAT protein was shown to









increase and translocate to the nucleus, moreover, the antiproliferative effects of IGFBP-

3 in these cells can be ablated in the presence of STAT1 antisense oligonucleotide [245].

The acid-labile subunit (ALS), together with IGFBP-3 and IGF-1, forms the

ternary complex as the storage pool in the plasma. ALS is synthesized almost exclusively

by the liver, and predominantly stimulated by GH [246]. Presence of ALS after birth is

coincident with increased responsiveness to GH resulting from an increase in GH

secretion and hepatic GF receptors. After puberty, ALS concentrations basically remain

stable throughout adulthood [246]. ALS is a single copy gene, containing 2 exons and 1

intron. ALS has no affinity for free IGFs and very low affinity for uncomplexed IGFBP-

3, and even its affinity for binary complex (IGF-1 + IGFBP-3) is 300-1000 fold lower

that that of IGFBP-3 for IGFs [247]. The ability of ALS to form ternary complex is

irreversibly destroyed under acidic conditions. IGFBP-3 and IGFBP5 can both associate

with ALS, with the latter being much weaker [246]. The carboxyl-terminal domains of

IGFBP-3 and IGFBP5 are important for binding. The association is proposed to happen

within the negative-charged sialic acid on the glycan chains of ALS and an 18 amino acid

positive-charged domain in IGFBPs [246].

Besides liver, ALS local synthesis may occur in kidney, developing bone,

lactating mammary gland, thymus and lung [248, 249]. Their functions are to sequester

IGFs into ternary complex. A GH-responsive element of the ALS gene transcriptional

promoter was identified [250]. This sequence was called ALSGAS1 because of its

resemblance with the consensus sequence for y-interferon activated sequence (GAS). The

effects of GH on the ALS gene are mediated by the JAK-STAT pathway [251, 252]: the

tyrosine kinase JAK2 is recruited to the activated GH receptor complex and









phosphorylates signal transducers and activators of transcription (STAT)-5a and STAT-

5b. After dimerization, STATS isomers translocate to the nucleus, and activate ALS gene

transcription by binding to the ALSGAS1 element. The GH signaling pathway leading to

increased ALS gene transcription is critically dependent on the activation of STATS

isomers, and is independent of RAS activation.

One the of physiological significance of ALS is to extend the half-lives of IGFs

from 10 min when in free form, and 30-90 min when in binary complexes, to more than

12 hours when in ternary complexes [253]. The other important role of ALS is to prevent

the non-specific metabolic effects of the IGFs, given that serum IGF concentration is

-1000 fold that of insulin [246]. IGFs in ternary complexes cannot traverse capillary

endothelia and activate the insulin receptor, whereas free IGFs and IGFs bound as binary

complexes can do so. Incorporation of IGFs into ternary complexes therefore completely

restrains the intrinsic insulin-like effects of the IGFs. Null ALS mouse shows

significantly reduced circulating IGF-1 and IGFBP-3 concentrations [246], which proves

that ALS is absolutely necessary for serum accumulation of both IGF-1 and IGFBP-3.

The Involvement of Insulin Receptor (IR) and IGF-2 in Angiogenesis

IGF-1 primarily binds to IGF-1R, and insulin primarily binds to IR, while IGF-2

can bind to both of the two receptors and its own IGF-2R, as shown in Figure 1.20 [254].

Regarding retinopathy, insulin and IGF-1 have gained more attention. Kondo et at [255],

using the Cre-Lox knockout system, found that (1) the retinas of mice develop normally

in the absence of endothelial IR or IGF-1R. Presumably, sufficient growth factors (for

example, VEGF) are present to facilitate normal development. (2) Under conditions of

relative hypoxia and in the presence of endothelial IR/IGF-1R, VEGF, eNOS, and ET-1

are increased, leading to extra-retinal neovascularization. (3) Under conditions of relative








hypoxia and in the absence of endothelial IR or IGF-1R, VEGF, eNOS, and ET-1 are

reduced, possibly due to impaired HIF-1 activation or reduced PI3K activity related to

IG/IGF-1R [256]. Reduced neovascularization results from less IR/IGF-IR input. And in

their experiments, the reduction of VEGF, eNOS, and ET-1 are reduced to a greater

extend in IR knockout mouse than IGF-1R knockout mouse, which has brought more

emphasis on IR function in the retinopathy, while traditionally IGF-1R is thought to be

more important.

Ligands Insulin IGF-2 IGF-1 Other peptides



Receptors IR IGF-2/M-6-P IGF.1R IRR




Substrates IRS family, She, Crk, Gab


I
Metabolic and growth promoting responses

Figure 1.20. The crosstalk between IGF-1, IGF-2 and Insulin signalings [254].
RNA Silencing Technologies
The traditional method to inactive a gene is to create a gene knockout animal model. This

process has its advantages, in that it entirely abolishes a gene expression, however, the

disadvantages are that it is time consuming, expensive, labor-intensive, and subject to

possible failure due to embryonic lethality [257]. RNA silencing technologies, which









inhibit gene expression at the RNA level, are valuable tools to inhibit the


DNA



mRNA
AntisesI I N 1 small interfering RNA
Antisense Ribozyme / !ll NA
Oligonucleotide I DNA Enzyme


RISC
RNase H


X, Translation
blocked

Protein





Figure 1.21. Overview of RNA silencing technologies [258].

expression of a target gene in a sequence-specific manner, and may be used for functional

genomics, target validation and therapeutic purposes. Theoretically, RNA silencing could

be used to cure any disease that is caused by the expression of a deleterious gene [258].

There are three common types of anti-mRNA strategies. Firstly, the use of single

stranded antisense oligonucleotides; secondly, the triggering of RNA cleavage through

catalytically active oligoribonucleotides referred to as ribozymes; and thirdly, RNA

interference induced by small interfering RNA molecules. Figure 1.21 [258] basically

summarized the mechanisms of these three kinds of antisense technologies. This scheme

also demonstrates the difference between antisense approaches and conventional drugs,

most of which bind to proteins and thereby modulate their function. In contrast, RNA

silencing agents act at the mRNA level, preventing translation. Antisense-









oligonucleotides pair with their complementary mRNA, whereas ribozymes and DNA

enzymes are catalytically active oligonucleotides that not only bind, but can also cleave,

their target RNA. RNA interference is a highly efficient method of suppressing gene

expression in mammalian cells by the use of 21-23-mer small interfering RNA (siRNA)


molecules. These three RNA silencing methods are detailed below.

Antisense Oligonucleotides

The antisense oligonucleotides was first described by Zamecnik and Stephenson

who used a 13-mer DNA to inhibit Rous sarcoma virus expression in infected chicken

embryonic fibroblasts [259]. The antisense gene silencing naturally occurs in genomic

imprinting, in which only one copy of a gene in the mammalian genome is expressed

while the other is silenced. It could be the maternally inherited allele or the paternal

inherited allele.

Antisense oligonucleotides are complementary to the target mRNA and are

usually 15-20 nucleotides in length [258]. There are two major antisense mechanisms that

have been proposed [258]. First, RNase H cleaves RNA in the RNA-RNA heteroduplex

(or RNA:DNA heteroduplex for antisense DNA oligonucleotides), induced by binding of

the antisense oligonucleotides. This results in rapid degradation of the cleaved mRNA

products and a reduction in gene expression. Second, translation is arrested by steric

blocking the ribosome by the binding of antisense oligonucleotides. When the target

sequence is located within the 5' terminus of a gene, the binding and assembly of the

translation machinery can be prevented.

The first step in designing an antisense oligonucleotides is target selection and

verification of target site accessibility. Computer programs, like Mfold, perform mRNA









secondary structure analysis. This analysis can generate several mRNA secondary

structures centered on our target sequence. If the target is always contained within a

stable stem in every structure, this target should be eliminated. In addition to this type of

in silico analysis of RNA secondary structure, a number of in vitro methods have been

developed to examine secondary structure in solution. One way is to directly probe the

secondary structure of the target RNA with 1-cyclohexyl-(2-

morpholinoethylo)cabodiimide metho-p-toluene sulfonate (CMCT) [260]. CMCT will

mainly modify Us, and to a lesser extent Gs, in single-stranded regions of an RNA

molecule. CMCT modification is followed by reverse transcription. Modification of Us

and Gs will prevent read-through by reverse transcription, resulting in a pause or stop site

at the modified position. When these modification/reverse transcription reaction products

are separated on an appropriate electrophoresis gel next to DNA sequencing reactions of

the target mRNA region, accessible regions of the target RNA are easily identified. The

most sophisticated approach reported so far is to design DNA array to map an RNA for

hybridization sites of oligonucleotides [261].


B -- Base



O OH Ribose (2' OH group)
I
O =P--O Phosphate backbone

0,


Figure 1.22. Modifications in antisense technology [258].

When designing antisense oligonucleotides, there are some points to consider.

Four contiguous guanosine residues should be avoided due to the G-quartets formation









and CpG motifs should be avoided due to potential stimulation of the immune system. In

addition, a BLAST search for each oligonucleotide sequence is required to avoid

significant homology with other mRNAs that could cause unwanted gene silencing.

Unmodified oligonucleotides are rapidly degraded in biological fluids by

nucleases. So one of the major challenges for antisense RNA approaches is the

stabilization of RNA oligonucleotides. Chemical modifications of the bases and/or and

phospho sugar backbone have been developed to increase resistance against RNase

(Figure 1.22 [258]. The major representative of in the first generation modification is the

Phosphorothioate (PS) oligonucleotides, in which one of the nonbridge oxygen atoms in

the phosphodiester bond is replaced by sulfur [258]. The shortcomings include binding to

certain proteins, such as heparin-binding proteins, and their slightly reduced affinity to

the complementary RNA sequences [262]. In the second generation, most the emphasis

was placed on the 2' hydroxyl group. 2'-O-methyl and 2'-O-methoxyl-ethyl RNA are the

most common types of modifications [258]. However, RNase H cleavage can be

somewhat reduced or even blocked with these types of modifications, possibly due to the

steric blockade. One way to overcome this disadvantage is the gapmer technology [258],

in which the 2'-modified nucleotides are placed only at the ends of antisense

oligonucleotides. This protects the ends from degradation and a contiguous stretch of at

least four or five non-2'-modified residues in the center are sufficient for the activation of

RNase H. A variety of modified nucleotides have been developed in the third generation,

the antisense oligonucleotides properties such as target affinity, nuclease resistance and

pharmacokinetics have been improved [258]. The concept of conformational restriction

has been used widely to help enhance binding affinity and biostability.










Ribozymes

Ribozymes, or RNA enzymes, are catalytic molecules that can catalyze the

hydrolysis and phosphoryl exchange at the phosphodiester linkages within RNA resulting

in cleavage of the RNA strand. There are two types of chemical reactions that are

catalyzed during phosphate-group transfer by naturally occurring ribozymes: self-

cleaving and self-splicing reactions. The ribozymes that perform self-cleaving reactions

include hammerhead, hairpin, hepatitis delta virus (HDV) and Neurospora Varkud

satellite (VS) ribozymes. They are usually small RNAs of tens of nucleotides in length.

The ribozymes that perform self-splicing reactions include self-splicing introns and

RNase P. They are much larger in size and usually hundreds of nucleotides in length.

a Self-cleaving i- I


b Self-splicing
5'k
O N-1


(D OH
-O-P-O
I N+1
R-H'
0 OH
3'-


5,-
O-


O(H) 1 r
S 0O OH
'q


5'
O N-1




S0 0-

HO N+1


O OH
k3'

5'
O N-1


OH OH
0-
R-O-P=O
O N+1


O OH
%3'


Figure 1.23. Self-cleaving and self-splicing reactions in ribozymes [263].









As shown in Figure 1.23 [263], in the self-cleaving reactions, the RNAs catalyze a

reversible phosphodiester-cleavage reaction. The nucleophilic attack from the 2'-

hydroxyl group results in 5'-hydroxyl and 2'-3'-cyclic phosphate termini. The bridging

5'-oxygen is the leaving group. While in the self-splicing reactions, an exogenous

nucleophile attacks on the phosphorus generates a 5'-phosphate and a 3'-hydroxyl

termini. The bridging 3'-oxygen is the leaving group. In the first steps of group I intron

and group II intron self splicing and the RNase P-mediated cleavage of precursor of

tRNAs, the exogenous nucleophiles are, respectively, the 3'-hydroxyl group of

exogenous guanosine, the 2'-hydroxyl group of an adenosine in the intron, and the water.

They are indicated by the ROH in Figure 1.23 b. The transition states are shown in

brackets.

Self Splicing Introns

Self splicing introns can be divided into 2 classes based on the conserved

secondary structure and splicing mechanisms: Group I and Group II. Group I is found in

a variety of species, including prokaryotes and lower eukaryotes. Except for the

Tetrahymena large rRNA group I intron, all other known group I introns require a single

protein co-factor to provide a scaffold to hold the RNA in the catalytic reaction [264].

Group II introns are found within nuclear pre-mRNA and organelle pre-mRNA [265]. A

spliceosome consisting of proteins and small nuclear RNAs (SnRNA) is formed in the

catalytic reaction and high concentrations of magnesium and potassium are necessary

[265].

The splicing action of both group I and group II introns consists of two similar

consecutive transphosphoesterification reactions. In the first step, the 5'-end of the intron

is attacked by an exogenous nucleophile, which is the 3'-hydroxyl group of exogenous










guanosine in group I introns, or the 2'-hydroxyl group of an adenosine in group II

introns. This results in the cleavage at that site and the addition of the guanosine or

adenosine to the 5'-end of the intron. In the second step, the oxygen in the 3'-hydroxyl

group of the 3'-end of the up stream exon attacks the 3'-end of the intron. In group I

introns, it is a guanosine at the 3'-end of the intron that is attacked. This cleaves the 3'-

end of the intron, releasing the intron, and results in ligation of the upstream and

downstream exons. Figure 1.24 [263] shows the secondary structure and self splicing

steps of group I introns.

a P91 b CG -- 3'
A --- [P9.1-P9.2]
Hinge A G
A 320 u 5'- r
A*GACA U
G-C UA G
G-C 20G-C A
P5a C-G G U12 G
G-C U
-U-A P5 20- -U U
C-G A C
GC-G U.G J4/5 G.U* c C
AAU A .- U-A G ",---- 3'
AA*U A *-A
U A A P1 U- GC-w P9.0
U-A C-G
-A AC-G 5' 5'
P5o UuG-C C-G2 -Gste
P G5c GU 4 G-C-CA Gse
AAAGG C-G-U J6 G
C AI UA P7
SG A140 GAU-U I -AA
U G P6 "-A A 1
A-U 1 6a I A4A-4
loG-C J6/6a J3/4 G A
A-U I C
G-C 220 U A
U-A U -A J8/7 1003'
P5b UG C-G P 5 H

AA A [P2-P2.1] ___ ">---A
UG.UG P6a A P3

U -A C 280
C-G U
A-G, U A U 5.AIj

U-A C o2U
C-G
-A -U
P6b A-U U P8
C-G U
A-U
G -C 240 U1
GoA U U 5' 3'
AG AG -

P4-P6 P3-P9


Figure 1.24. Secondary structure and self splicing steps in group I intron [263].










RNase P

RNase P is a ribonucleoprotein complex that removes the 5' leader sequence form

precursor tRNAs (ptRNAs) via a hydrolysis reaction. It consists of a catalytic RNA

subunit (Ml RNA in E. coli) and a protein subunit (C5 protein in E. coli) [266, 267]. In

vitro, Ml RNA can cleave its ptRNA substrate without C5 protein, but the reaction

requires high concentrations of Mg2+. However, C5 protein can dramatically increase the

rate the cleavage, even at low concentration of Mg2+ [268]. In vivo, C5 protein is required

for RNase P activity and cell viability [266, 267]. Thus both the RNA subunit and the

protein subunit are essential for RNAse P function. It has been proposed that C5 protein

can facilitate the stabilization of the Ml RNA conformation and also enhance the enzyme

and substrate interaction [269, 270].

RNase P 5'
CCA3C CCA3
S -S'-ldrC CCA3'
Aoceptor stem
D stem-loop
Gude sequence (GS)
-T-loop

Anclidon sinm-loop Vaa'ble loop

0 3'tail
3'5'
ptRNA 4.5S RNA


Figure 1.25. Secondary structures of natural and synthetic substrates for RNAse P[275].

All the natural substrates of RNAse P (ptRNAs, precursor of 3.5S RNA and

several small RNAs [271-273] in E. coli) have a common feature in their secondary

structure which includes a 5' leader sequence, and acceptor-stem-like structure and a 3'-

CCA sequence. A synthetic external guide sequence (EGS) combined with a CCA

sequence has been designed to base pair with a targeted sequence to form a structure very









similar to the natural substrates of RNase P. The Ml RNA from E. coli can cleave at this

synthetic target site [274]. This EGS-based technology can be used to guide RNAse P to

cleave a targeted sequence. Figure 1.25 shows the secondary structures of ptRNA and the

3.8s RNA and the hybridization of the EGS with the targeted sequence [275].

Hammerhead Ribozymes

The hammerhead ribozyme was the first small self-cleaving RNA to be

discovered [276, 277], the first ribozyme to be crystallized [278, 279] and the smallest

naturally occurring catalytic RNA identified so far. It was found in several plant virus

satellite RNAs and is required for the rolling circle mechanism of virus replication [280].

The hammerhead ribozyme cleaves the multimeric transcripts of the circular RNA

genome into single genome length strands.

Hammerhead ribozymes are approximately 30-90 bases in length and cleave RNA

targets in trans. Annealing of the hammerhead ribozyme with the target sequence

produces a structure consisting of three stems, a tetra-loop and a conserved catalytic core

as shown in the Figure 1.26. Any mutation in the catalytic core will prevent catalytic

cleavage. The catalytic core has two functions: it destabilizes the substrate strand by

twisting it into a cleavable confirmation, and also binds the metal cofactor (Mg2+) needed

for catalysis [278]. The absolute requirement of the target sequence is a NUX cleavage

site, where N is any nucleotide and X is any nucleotide except G. The targeting arms of

the hammerhead ribozyme bind either side of the U of the NUX site forming stems I and

III. GUC has been shown to be the most efficient cleavage site [281], followed by CUC,

UUC and AUC. The advantages of hammerhead ribozymes include its small size, easy of

cloning and packaging into viral delivery systems, and versatility in target site selection.








In the traditional view, the Mg2+ and water are both required in the

transesterification reaction. The hydrated magnesium ion can help to provide an

environment to facilitate the nucleophilic attack, in which the Mg2+ acts as a Lewis acid

to coordinate directly with the 2'-hydroxyl and the 5'-leaving oxygen for activation of the

nucleophile and for stabilization of the environment. It has been also reported that some

monovalent cations (Li and NIH4) at higher concentration can substitute for Mg2+ [282].

There is another kind of antisense agent called DNA enzyme, which is similar to

the hammerhead ribozyme in structure and function but avoids the high susceptibility to

nucleases that is common to ribozymes. The best studied DNA enzyme, named "10-23"

[283], consists of a catalytic core of 15 nucleotide and two substrate recognition arms. It

is highly sequence-specific and can cleave any junction between a purine and a

pyrimidine, and its efficiency is similar to hammerhead ribozymes [283].

3' 5'
N-N

i N-N
N-N
N-N
GAAA- U

SC GGCI NNNNNN-3'
U GCCG UNNNNNN-5'
U A C
II GUAG III


Figure 1.26. Structure of the hammerhead ribozyme.

Hairpin Ribozymes

Similar to the hammerhead ribozyme, the hairpin ribozymes was first derived

from tobacco ring spot virus satellite RNA [284].When the hairpin ribozyme binds to the








substrate, a structure with 4 helices and 2 loops is formed. Helix 1 (6 base pairs) and

helix 4 (4 base pairs) are where the hairpin hybridizes to the target RNA. In loop A, a

BNGUC target sequence is required for cleavage, where B is G, C or U, and N is any

nucleotide [285]. Figure 1.27 shows the structure of the binding complex of the hairpin

ribozyme and its substrate.



UG 2
1 C A -
3'-NNNNNA NNNN-5'
1 1 1 11 1 1 I E E
5'-N N N N NU N N N NA-U-3'
A A C-G
GA
C-G
A A-U
GAG-CCA
G A
A U
U
A
B A
-A U
C A
A C-GGU
A-U
C-G
G-C 4
C-G
U-A
C-G
G A
UA

Figure 1.27. Structure of the hairpin ribozyme.

Hairpin and hammerhead ribozymes can also catalyze the ligation of the cleaved

products, which is the reverse of the cleavage reaction. The ligation efficiency is much

higher for the hairpin than the hammerhead. Another unique feature for the hairpin

ribozyme is that it does not require metal ions as cofactors [282, 286].









Hepatitis Delta Virus (HDV) Ribozymes and Neurospora Varkud Satullite (VS)
Ribozymes

HDV ribozymes and VS ribozymes also cleave the substrates via self-cleaving

reactions. HDV ribozymes are derived from the genomic and the anti-genomic RNAs of

HDV [287, 288]. Naturally, the HDV ribozyme cleaves its substrate during the rolling

circle replication mechanism of the circular RNA genome, like other self cleaving

ribozymes. The VS ribozyme was originated from the mitochondria of certain isolates of

Neurospora [289]. The self cleaving reactions require a divalent cation but it has also

been shown that monovalent cations are be sufficient for the ribozyme to catalyze

proficiently [282].

RNA Interference

RNA interference (RNAi) is a naturally occurring process and is a potent

sequence-specific mechanism for post-transcriptional gene silencing (PTGS). It was

described early in C. elegans [290] and then found to exist throughout nature as an

evolutionarily conserved mechanism in eukaryotic cells. RNAi has regulatory roles in

gene expression, such as genomic imprinting, translation regulation, alternative splicing,

X-chromosome inactivation and RNA editing [291]. In plants and lower organisms RNAi

also protects the genome from viruses and insertion of rogue genetic elements, like

transposons [292].

Figure 1.28 [293] shows the RNA interference pathways. Long double-stranded

(ds)RNA is cleaved by Dicer, an RNase III family member, into short interfering RNAs

(siRNAs) in an ATP-dependent reaction. These siRNAs contain an approximately 22-

nucleotide (nt) duplexed region and 2-nt unpaired and unphosphorylated 3'-ends. The 5'-

end is phosphorylated, which is a crucial requirement for further reactions. In fact, if the











-III

Drosha Dicer

S(Nucleus)


Pri-miRNA Pre-miRNA


dsRNA

1, Dicer
5' kinase
t11 11111111111 Iiiin1 < ; 1iiiiiiiiii
miRNA/siRNA Synthetic siRNA

4 Helicase



J Assembly of single-stranded
miRNA/ siRNA into RISC





miRNA-RISC siRNA-RISC


Target RNA Target RNA


Inhibition of translation Degradation of target
(No PROTEIN) (No RNA, No PROTEIN)
Figure 1.28. RNA interference [293].

siRNA is introduced into human cells as a synthetic molecule, its 5' hydroxyl gets

phosphorylated shortly after entry into the cells [294-296]. These siRNAs are then

incorporated into the RNA-inducing silencing complex (RISC). Although the uptake of

siRNAs by RISC is independent of ATP, the unwinding of the siRNA duplex requires

ATP. The unwinding favors the terminus with the lower melting temperature as the start

point. Thus the termini containing more A-U base pairs are preferred as the unwinding

start point. The strand whose 5'-end is at the start point will be used by RISC as the guide

sequence and the other strand is release and degraded. Once unwound, the guide strand

positions the RISC/siRNA complex with the mRNA that has a complementary sequence

to the siRNA, and the endonucleolytic cleavage of the target mRNA occurs. The target









mRNA is cleaved at the single site in the center of the duplex region between the guide

siRNA and the target mRNA. The microRNA (miRNA) pathway is another RNA

silencing pathway and is similar to siRNA. miRNA is also approximately 22-nt long, but

it is a product of a sequential processing on a single-stranded RNA by two enzymes of

the RNaseIII superfamily [297-299]. The long primary transcript (pri-miRNA) is cleaved

by a nuclear enzyme, named Drosha in human, into an approximately 70-nt long pre-

miRNA. The pri-miRNA is basically a short hairpin RNA (shRNA) and is further

processed in the cytoplasm by Dicer to produce the final miRNA. For both siRNAs and

miRNAs, the perfect or near-perfect match will lead to the degradation of the target upon

association with RICS, and mismatches will repress the translation. It now appears that at

least seven continuous complementary base pairs are required for cleavage [300].

Introduction of synthetic siRNAs as a mimic for the Dicer cleavage process

triggers the RNAi machinery. In addition, siRNAs or miRNAs produced form shRNA

expression cassettes can be cloned into RNA expression vectors to produce the self-

complementary hairpin sequences that induce the RNAi pathway. More importantly, the

shRNA expressed from a vector could establish long-term silencing of a targeted gene

expression. The transcription of shRNA from the vector is usually conducted using an

RNA polIII promoter such as the H1 or U6 promoter [301, 302]. U6 promoter strongly

favors a G residue at the first position of the transcribed sequence and H1 weakly prefers

an A residue [303]. The transcription mediated by polIII promoters terminates after the

second or third (less commonly) residue of a "TTTTT" stretch, which results in a 3'-UU

tail that forms the 3'-2-nt unpaired overhang end in the hairpin structure after self

complementarily annealing of the transcript. Both the preference of first residue and the









3'-2-nt unpaired UU end influence the target site selection. Similar to miRNAs, shRNAs

(in the nuclei) are bound by a complex consisting of the nuclear export factor Exportin 5

(Exp5) and the GTP-bound form of the cofactor Ran [304, 305]. For nuclear export, this

complex requires an RNA stem of 16 bp, a short 3'-overhang and a terminal loop of >

6 nt [304, 306]. The efficient cleavage by Dicer requires an RNA of >19 bp and a short

3'-overhang [307]. These prerequisites can be easily met when designing the shRNA

expression cassette.

Considering the strand preference of RISC during unwinding, the 3' end of the

guide strand in shRNA is designed tightly base-pair (higher CG contents) and the 5' end

of the guide strand is designed loose base-pair (higher AU contents). As an example

shown in Figure 1.29 [303], two GC base pairs at the 3'-end of guide strand (red) are

designed. More AU pairs at the 5- end of the guide strand would be appreciated for

correct unwinding and even a mismatch can be included. Actually bulges resulting from

mismatches are always present in natural pri-miRNAs and they may help to fine-tune the

cleavage sites used by Drosha and Dicer and/or may preclude activation of dsRNA-

responsive cellular signaling pathway like interferon responses [303]. During the design

of the shRNA, it is encouraged to include a bulge close to the 5' end of the guide strand,

which should be done by a introducing a mutation into the to-be-degraded (sense) strand,

not into the guide (antisense) strand. It has also been reported that an A residue at

position 3 and a U at position 10 of the sense strand can enhance siRNA function

significantly. And a G at position 13 of the sense strand may need to be avoided [308].

Figure 1.29 [303] shows the sequence of the designed shRNA, with the reference to









human pre-miR-1 sequence and structure. The blue strand is sense and the red strand is

antisense. Arrows mark the Dicer cleavage sites.


C A AUA
miR-1 5'-CCAUGCUUC UUGCAUUC AUA GUU U
3'-GAGGUAUGAAG AAUGUAAG UAU CGA
A G A ACU



N N AUA
shRNA 5'-GCANNNNNNU NNNNNNN NNN GUU U
3'-UUCGUNNNNNNA NNNNNNN NNN CGA
N N A ACU




mRNA target 5' -AAGCANNNNNNUNNNNNNNNNN-3'

Figure 1.29. Designing artificial shRNA for RNAi [303].

It has also been found that small dsRNA that are 25-30 nt in length requiring

RNAi processing appear to be more efficient in inducing RNAi than smaller 22 nt

siRNAs [309], which could be due to the fact that Dicer may direct endogenously

processed siRNAs and miRNAs to the RISC complex. This gives vector-expressed

shRNA an extra advantage over synthetic 22 nt siRNAs. Multiple shRNAs or siRNAs

can be introduced into the cell simultaneously, but it is worth keeping in mind that the

RNAi machinery can be limiting [310] so that the competence between exogenous

shRNAs and endogenous miRNAs, or between exogenous and endogenous siRNAs, for

limited amount of Dicer and RISC could occur, which would interfere with the cell's

endogenous RNAi pathways. Particularly when the cell is undergoing a cell division, the

RNAi machinery could be diluted and adversely affected by inhibiting the gene knock-

down mechanism.









RNAi is highly specific to its target and not toxic in almost all situations;

however, when designing an siRNA or shRNA, some off-target effects should be

considered and avoided. dsRNAs that are 30 nucleotides or longer tend to trigger at least

two cellular stress response pathways, both of which will lead to a general and non-

specific abrogation of protein synthesis, or even apoptosis [295, 311]. The IFN pathway

is usually a mechanism to eliminate virus-infected cells, in which the long dsRNA binds

to and activates the dsRNA-activated protein kinase (PKR). PKR can further

phosphorylate the translation initiation factor, eIF-2a, and induce global translation

inhibition and even apoptosis. In another pathway, dsRNA activates 2'-5' oligoadenylate

synthetase. The 2'-5' oligoadenylate will then be formed and bond to and activate RNase

I, resulting in non-specific degradation of RNAs. Although siRNA or shRNA, less than

30 nucleotides in length, usually do not activate these stress response pathways. In highly

sensitive cell lines and at high concentrations, a subset of interferon genes can be

activated [312-314]. In the designing of siRNAs or shRNA, the ones that have significant

homology to other irrelevant mRNAs should be avoided. As noted before, a seven

consecutive base pairing can be enough to activate the RISC-induced gene silencing.

Even the guide strand (antisense) has been designed to introduce RISC to the target site

after unwinding, it is still possible that unwinding could initiate from the 5' end of the

sense strand and thus sense strand would guide the RISC. The homology of the sense

strands should also be checked.

Vector-mediated expression of shRNA can lead to long-term RNAi and the

silencing effect has been observed even after two months [302]. The half-life of

unmodified siRNAs in vivo is only seconds to minutes [315]. The most important reason









for this short half-life is the rapid elimination by kidney filtration due to the small size

(-7 kDa). Endogenous serum RNases can degrade the siRNAs limiting the serum half-

life to 5-60 minutes. The half-life can be extended in a number of ways, for instance,

completing the siRNAs with other molecules or incorporating them into various types of

particles to bypass renal filtration [315-317], chemically modifying the ribose [316, 318-

320], or capping the ends of the siRNA [315, 320]. The modification on the ribose

usually takes place at the 2'-position; 2'-deoxyribose, 2'-O-metheyl and 2'-fluoro

substitutions/modifications have been reported [316, 318-320]. Usually the silencing

effects are affected more or less by these modifications but a modified siRNA, with two

2'-O-methyl at the 5' end and four methylated monomers at the 3' end, has been

demonstrated to be as active as its unmodified counterpart [321]. Even though siRNAs

have the potential to activate interferon pathways, no toxic effects after siRNA

application have been observed [258]. There is no strict specific sequence requirement in

RNA interference (although there are preferred bases at some positions), and, therefore,

the range of target for siRNA is greater that with ribozymes or antisense therapies.

Gene Therapy Overview

With the progress of Human Genome Project, people are reaching a new level of

understanding of many biological events, including the etiology of diseases with or

without proved treatment. Especially for those diseases currently without treatment,

finding the genes that are involved in the initiation and development of the diseases

provides new treatment targets.

The most common gene therapy targets are monogenic recessively inherited

diseases such as hemophilia [322]. In the treatment of these diseases, gene therapy is

designed to introduce a functional gene into a target cell to restore protein production that









is absent or deficient due to the genetic disorder. Conversely in monogenic dominantly

inherited diseases like hypercholesteroleamia [323], successful treatment requires the

aberrant gene to be silenced, and this is usually done by means of gene-silencing

technologies. Cancer, as an acquired genetic disease, is also a good candidate for gene

therapy. Apart from expressing functional tumor suppressor genes and silencing activated

oncogenes, gene therapy in cancer treatment has also been applied to introduce the

expression of immunopotentiation proteins, the expression of a toxic product in

transformed cells, and the expression of proteins in healthy cells helping the cell to be

resistant to higher doses of chemotherapy [324].

The methods to deliver a gene into cells can be roughly categorized into virus-

based system and non-viral system.

Non-Viral Gene Delivery

The gene transfer in non-viral system is in general inefficient and often transient

compared with viral vectors, but it has advantages such as low toxicity, simplicity of use

and ease of large-scale production. In addition, the transient expression of a therapeutic

gene would be desirable in the treatment of certain conditions, such as retinopathy of

prematurity. Basically there are three categories of methods for non-viral gene delivery:

naked DNA in the form of plasmid, liposomal packaging of the DNA and molecular

conjugates.

Naked DNA is the simplest way to delivery a gene. It is not very efficient and can

result in prolonged low levels of expression. The simplest way is to inject directly into

the tissue of interest or inject systemically from a vessel. The expression level and area

are usually limited in a systemic injection due to the rapid degradation by nuclease and

clearance by mononuclear phagocyte system. To facilitate the uptake of naked DNA,









several techniques, in addition to simple injection, have been developed. The Gene Gun

is a technology to shoot gold particles coated with DNA which allows direct penetration

through the cell membrane into the cytoplasm and even the nucleus, bypassing the

endosomal compartment [325]. Electroporation, the application of controlled electric

fields to facilitate cell permeabilization, is another way to facilitate DNA uptake. Skin

and muscle are ideal targets due to the ease of administration. Ultrasound can also

increase the permeability of cell membrane to macromolecules like plasmid DNA and has

been used to facilitate the gene transfer.

Liposomes are lipid bilayers entrapping a DNA fragment with a fraction of

aqueous fluid. It can naturally merge onto cell membrane and initiate the endocytosis

process. To improve transfection efficiency, target proteins recognized by cell surface

receptors have been included in liposome to facilitate uptake, for example, anti-MHC

antibody [326], transferring [327], and Sendai virus of its F protein [328], which help

DNA to escape from endosome into cytoplasm thus to increase DNA transportation to the

nucleus. The inclusion of a DNA binding protein on the liposome also enhances

transcription by bringing the plasmid DNA into the nucleus [328].

Molecular conjugates are usually a synthetic agent that can bind to DNA and a

ligand at the same time [324]. Thus the binding of the ligand to its receptor will initiate

the receptor-mediated endocytosis for the complex. This method is more specific for

different cell types and receptor types. The synthetic agent needs to be designed

accordingly, but this is useful in tissue-specific transfection. The transgene expression in

this method tends to be transient and limited by endosomal and lysosomal degeneration.









Viral Gene Delivery

Viral gene delivery systems are based on replicating viruses that can deliver

genetic information into the host cell. According to the existence status of the viruses, the

virus vectors can be divided into two categories: integrating and non-integrating [329].

Integrating virus include adeno-associated virus, retrovirus, and so on. These viruses can

integrate the viral genome into chromosomal DNA so that a life-long expression of

transgene could be possibly achieved. Adenovirus and herpes simplex virus fall into the

category of non-integrating viruses. They deliver viral genome into the nucleus of

targeted cell, however the viral genome remain episomal, so it is possible that the

transgene gets diluted during cell divisions.

Generally speaking, genomes of replicating viruses contain coding regions and

cis-acting regulatory elements. The coding sequences enclose the genetic information of

the viral structural and regulatory proteins and are required for propagation, whereas cis-

acting sequences are essential for packaging of viral genomes and integration into the

host cell. To generate a replication-defective viral vector, the coding regions of the virus

are replaced by a transgene, leaving the cis-acting sequences intact. When a helper

plasmid or virus providing the structural viral proteins in trans is introduced into the

producer cell, production of non-replicating virus particles containing the transgene is

established. An ideal viral vector should have these characteristics: 1) The virus genome

is relatively simple and easy to manipulate; 2) The viral transduction can yield high

vector concentration in the producer cells (>108 particles /ml); 3) The vector should have

no limitation in size capacity; 4) The viral vector can transduce dividing and non-dividing

cells; 5) The vector can deliver the transgene as integration in the host cell genome or as

segregation being an episome along with cell division so that sustained expression can be









established; 6) The vector has a naive or modified tissue specificity and the transgene

expression can be regulated; 7) The vector produces no or low immune response and

allows subsequent re-administration. [330]

The expression specificity can be regulated in many aspects. For tissue specificity,

we can pick the virus that has the right tropism specific to some tissue, and in addition

tissue-specific promoters can be added to further define the specificity. For spatial

specificity, radiation in conjugation with radiation-activated promoter (for example, ergl

promoter [331]) would be a good method. Of course the local delivery into the right place

is always preferred than systemic administration, if feasible. For temporal specificity,

drug-inducible promoters can provide a convenient way to switch the transgene

expression on and off. The drug can be used to work on transcription activation or

repressor elements to modulate the expression. There are many established drug-

regulated gene expression systems, such as rapamycin-regulated gene expression [332]

and RU486-regulated gene expression from GAL4 site [333]. And for promoters

containing binding site for hormone receptor, heavy metals or cytokines, these specific

hormone, heavy metals and cytokines can also be used to induce the expression.

Adeno-Associated Viral (AAV) Vectors

AAV is currently the virus closest to an ideal vector that is under study and

application. It belongs to the family of parvovirus; it is non-pathogenic and depends on

helper virus (usually adenovirus (Ad) or herpes virus) to proliferate. It is a non-enveloped

particle with a size of 20-25 nm and has a vector capacity of 4.7 kb [334]. AAV can

infect both dividing and non-dividing cells, with the transduction efficiency best in S-

phase of host cell cycle. The viral genome, coded in a single-stranded DNA, has two

open-reading frames (ORF). One is rep, which is responsible for viral structural proteins,









integration and replication proteins. The other is cap, coding for capsid proteins. There

are inverted terminal repeats (ITR) at both ends of the genome sized around 150 bp, T-

shaped and forming palindromic structure. TR is GC rich and contains a promoter. Due to

the integration into the host genome, AAV vector can potentially deliver a long term

expression of the transgene. Another advantage of AAV is that it induces overall low

immune response. Presence of circulating neutralizing antibodies is in the majority of

populations, but they don't prevent re-administration or shut down promoter activity

[329]. Small packaging capacity is the number one disadvantage of AAV vectors. Using

concatamers, formed by head-to-tail recombination in ITRs, up to 10 kb oftransgenes

can be packaged for delivery [335], by means of splitting promoter and transgenes

sequences over two AAV vectors. But this technology reduces transduction efficiencies.

The infection of a host cell starts when the viral particle binds to its receptor on

the cell membrane and initiates the endocytic pathway. The receptor type varies with

AAV serotypes. The AAV-2 serotype, the most studied and commonly used serotype, has

as its primary receptor heparin sulfate proteoglycans (HSPG) [336]. HSPG is widely

expressed in various tissues and this is why AAVs have a wide tropism. There are also

co-receptors for AAV-2 to facilitate endocytosis. Fibroblast growth factor receptor-1

(FGFR1), one of the co-receptors, can enhance the virus attachment to the cells [337].

Integrin avp3, another co-receptor, can facilitate endocytosis in the clathrin-mediated

process, and it may also activate Racl and further phosphorylate PIP3 Kinase [338],

which leads to microfilaments and microtubes rearrangement to support AAV2

trafficking to the nucleus. After entering the cell, the viral particle is released from the

endosome at low pH conditions. Low pH probably induces a conformational change of









viral proteins and thus helps with endosome release and nuclear entry [339]. The viral

particle is uncoated in the nucleus, and ssDNA is duplicated into dsDNA by either

annealing with a complementary DNA strand from a second AAV or by the host cell

machinery. The duplication from ssDNA to dsDNA is the rate-limiting step in AAV

transduction. To overcome this, self complementary vector (scAAV) has been designed

to expedite this process [340]. With the help of rep proteins, the viral genome or the

transgene is integrated to a specific site in chromosome 19 via a non-homologous

recombination and will be expressed by host cell transcriptional machinery. Some virus

may remain episomal and also get expressed. Figure 1.30 [330] summarizes major steps

in the AAV internalization and intracellular trafficking.


AAV Vector

Receptor Particle
Binding AZ L Transduced Cell


Figure 1.30. AAV internalization and intracellular trafficking [330].









AAV has a number of serotypes. AAV-1 and AAV-4 were isolated from simian

sources; AAV-2, -3, -5 were isolated from human clinical specimens; AAV-6 is thought

to be the recombination of AAV-1 and AAV-2 (AAV- 's 3' end recombined with AAV-

2's 5' end), and AAV-7 and AAV-8 were isolated from rhesus monkey [330]. They have

their own tropisms, which are determined by the capsid proteins. For example, AAV-2 is

preferred to use for infection of the human eye, spine, while AAV-1 has the highest

transduction efficiency in muscle and liver, and AAV-5 has high tropism for retina and is

able to transduce airway epithelial cells.

Among all the serotypes, AAV-2 is the most studied and commonly used. As with

all the AAV serotypes, the AAV-2 genome has two ORFs, rep and cap, which span over

90% of the genome. As shown in Figure 1.31 [330] Panel A, in the ORF of rep, there are

two promoters, p5 and p19, encoding four proteins. Rep 78 and its splicing variant,

Rep68 are transcribed from p5. They play important roles in replication, transcriptional

control and site-specific integration. Rep52 and its splicing variant, Rep40 are transcribed

form p19. They are important for the accumulation of single-stranded genome used for

packaging. The other ORF cap encodes for VP1, VP2 and VP3 which are transcribed

from p40. They are capsid proteins and have pivotal roles in tropism specificity. These

three proteins are expressed in the ratio of 1:1:20, making the capsid with icosahedral

symmetry. The ITRs at both ends of the viral genome have a couple of functions. The

detailed structure and sequence of ITR is shown in Figure 1.31 [330] Panel C. First, the

3' end of the ITR on the 5' end the genome serves as primer in the synthesis of a new

DNA strand. Second, ITRs contain Rep binding site (RBS) for Rep78 and Rep68 and






83


help them work as a helicase and an endonuclease. Third, the terminal resolution site

(TRS) is identical to a sequence in chromosome 19, serving as integration sequence [341].




A AAV Genome
ITR E ITR


ps psl p4
I .p7. I

epa68 f I
Fmp52 ..I____.._............ I
lep4 2 l ,
Mep42

VP1 (



I kb Pi


B Vector Genome
IT R Promoter Trunegene pA ITR




C
S| Inverted Terminal Repeat


cc
'1 "



Figure 1.1. AAV2 genome and the vector genome [30].





When making an AAV viral vector, the two ORFs and the viral promoter are all


replaced by a transgene and the only cis elements needed for AAV integration, packaging
and assembly are the ITRs. The vector genome is shown in Figure 1.31 [330] Panel B.
cc
SC



Figure 1.31. AAV2 genome and the vector genome [330].

When making an AAV viral vector, the two ORFs and the viral promoter are all

replaced by a transgene and the only cis elements needed for AAV integration, packaging

and assembly are the ITRs. The vector genome is shown in Figure 1.31 [330] Panel B.










rep and cap will be provided in trans in another plasmid, and helper virus gene products

(Ela, Elb, E2a, E4 and VA RNA from Ad) are also provided in trans. Originally the

vector production method is to co-transfect the HeLa cells with transgene plasmid, the

plasmid providing rep and cap, and wide type Ad, or to co-transfect human 293 cells

with the transgene plasmid, rep and cap plasmid, and El-deleted Ad, as the Elgene

products can be provided endogenously in 293 cells. Recently helper virus-free system

has been designed to minimize the safety issues. See Figure 1.32 [334].


recAAV



AAV helper,
eenome


Ad auxiliary
function


+



+
_I ""r vw '" lli a1 "


or or




wMd AdAl


HeLa celk 293 celv
Transitory packaging cells

Figure 1.32. Helper virus -free systems in rAAV production [334].

The helper virus-free system has the three-plasmid system and the two-plasmid

system [334]. In the three-plasmid system, besides AAV vector plasmid and AAV helper

plasmid providing rep and cap genes, an Ad helper plasmid is introduced to provide the

helper virus gene products (E2A, E4 and VA RNA from Ad) and human 293 cells are

used as the host cell to provide Ad El gene products. The best molar ratio for these three


EpHlpe