<%BANNER%>

Characterization of Adult and Embryonic Stem Cell Proliferation, Differentiation, and Integration in Vitro and in a Nigr...

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110404_AAAACC INGEST_TIME 2011-04-04T14:37:16Z PACKAGE UFE0013743_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 14287 DFID F20110404_AABNAT ORIGIN DEPOSITOR PATH kearns_s_Page_63.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
d3c5bc2d31f03d3d62ddc6966828ae7f
SHA-1
c920228412e04860b78abb8111f8c527b65e84a5
8013 F20110404_AABNZD kearns_s_Page_37thm.jpg
6f1cd7642b2bb51b98876721721dbbfb
1d5fbfe2b06f5869804950f2a054c8b2e1c45da0
8188 F20110404_AABNYP kearns_s_Page_14thm.jpg
81957834af4cac4e72aa2830b0394282
21f26aa7d391db5890aef7dc5cba11e671159ea0
1434 F20110404_AABNBH kearns_s_Page_52.txt
e317821e03932d6407cb7665a49d2b63
345be2cec7d488551ec7b259ee3e3e3a88820ffd
8423998 F20110404_AABNAU kearns_s_Page_91.tif
9a67cbf826b9137017c83121a8d6135f
342658bee08d71fc11992997b3b5ceef5ffd28f6
8407 F20110404_AABNZE kearns_s_Page_38thm.jpg
3513ca4cda369ca21340ab273911b903
efd6ef01833a70a045bb86f2c82612faffaa187d
8267 F20110404_AABNYQ kearns_s_Page_16thm.jpg
2d848ab3825326e2e5ce6cbdfbdb955f
a02707ec853b4d5192143103b8ce6b23f75c090c
681935 F20110404_AABNBI kearns_s_Page_62.jp2
0607c31b89a2b0de90a64e9ab6297ec4
618ddc70774184c7129553a4cf70024a37bf9762
1078 F20110404_AABNAV kearns_s_Page_51.txt
fb24f1d751ff2acef7011a27b63d83c3
0ac7543928cc630bf6cb95902587dc9e08e726ff
7965 F20110404_AABNZF kearns_s_Page_39thm.jpg
fc23895e44f87bdf245e8bce224f4b30
afb927fc514be7e504eefbc98666fecbc633efad
8475 F20110404_AABNYR kearns_s_Page_17thm.jpg
f94835223f827ef66cc181679fef3359
2153b37a9b977e76db40732b4ffc5edb78e1cbec
935173 F20110404_AABNBJ kearns_s_Page_06.jp2
b0aa9091ca46d820d19f7083ee9c946d
14b9dbedcb122a6dca24b16debf49db38cc8ebcd
493916 F20110404_AABNAW kearns_s_Page_75.jp2
faebf375a0232971a70aaab4b9be7cc4
d45b4a739c0543e75a89d923b6ff0f88eb9c8cca
7137 F20110404_AABNZG kearns_s_Page_41thm.jpg
57d984dfa197cc9abd4e5a86bbddd187
a3aee6b3d9e8bf35f96cade9c2007cf32410da35
8393 F20110404_AABNYS kearns_s_Page_18thm.jpg
7674cc8d086bab518201dff7b64a99e3
99d4ad27c7af3b2c3dba8265c5365e8f4936689c
1983 F20110404_AABNBK kearns_s_Page_20.txt
d421c9e962e0938e993664d50ad639ab
e4a587e0901980ad4cdde264f5a51b1b3bca5951
F20110404_AABNAX kearns_s_Page_52.tif
d62f3459fcc3c00fcda95fdfb4e44c9a
ae5ebc8bf3a00e427a4863fb6845dcaca2dbc3de
7407 F20110404_AABNZH kearns_s_Page_42thm.jpg
98965c9beb340db6776c5e3b73e596e9
7c32d22470f820de47592edb6ae22509bd0e8fad
6773 F20110404_AABNYT kearns_s_Page_19thm.jpg
b3d83d7ea3628e4d4de712c1eaecf70c
c080cdbe9b2b28c0074baf8c38faeec67c681154
2017 F20110404_AABNCA kearns_s_Page_48.txt
08049bf793f3a4d53eb5286e00e473ec
797a9c367afb7657fb7a5d97cf283d1f8427a28c
3925 F20110404_AABNBL kearns_s_Page_61thm.jpg
3e7babcd7e4751f80eca6b5130ddce8f
10c0c3f1d8ec9b6e065c772deece7393b935e405
F20110404_AABNAY kearns_s_Page_66.tif
42448d048c8a5f38baf4af427cfa8166
fa25ecf11961a9b263c5594dcf56823862b67a79
8249 F20110404_AABNZI kearns_s_Page_43thm.jpg
c6475521c03873b7cfd467c276b5363b
9e6254bf3e5a97225c1e31b0f108d794d3202521
8323 F20110404_AABNYU kearns_s_Page_21thm.jpg
f5b213f03292f31a8fce0843fbae6c96
c70219103e718e7baf709680df6f3d028d6fb456
1857 F20110404_AABNCB kearns_s_Page_77.txt
f18f2ac8f1f9d6f80f82ccf52d076ea3
47bf3f917acceb46c22ead1711dcc28c1efeab28
29175 F20110404_AABNBM kearns_s_Page_52.QC.jpg
8771d4e699be6076b00f4ac5aee3a73c
e57a8fddd4e0cb154cc525d01c44154864e6cf02
8404 F20110404_AABNAZ kearns_s_Page_27thm.jpg
dc16911ea9cfd45b0f0135f63adf68b2
cbb3c903ee84fd2511d3a95fe2bbae192feba2a3
8152 F20110404_AABNZJ kearns_s_Page_44thm.jpg
64adde12aafd957f782799ff2413e28c
1b376f6b64f801a849ace1ed9692aa9533e6fc92
8226 F20110404_AABNYV kearns_s_Page_23thm.jpg
3cc29eae8b0b160917ccde373a0b835a
4e57de3560724f6fef44779c15826fca64f3c972
32666 F20110404_AABNCC kearns_s_Page_84.QC.jpg
52f1fc256b8f085906c317036678bc30
7f7a1957563e2877ca5fd259e99cf8091818f5c8
F20110404_AABNBN kearns_s_Page_08.tif
afbb365478e649d4e3d987efc97ebbb1
7eaa1ba721a87f857735f7b0a3152b4108763669
8596 F20110404_AABNZK kearns_s_Page_45thm.jpg
19edd22861b18c2600fb9060dc1e184e
1b1b74a51ba8be244c24e19ea2ac59057f45ffd3
8356 F20110404_AABNYW kearns_s_Page_24thm.jpg
b343bb8e107908077e8f6211496ba67c
720f9d869c93ef843d70b9ddfb4c167d842e16db
F20110404_AABNBO kearns_s_Page_55.tif
c51adb420e90fa88b1272e4b7cb9e34c
b18f6b027fa4ae973beb24a2929a53da169bb79b
8241 F20110404_AABNZL kearns_s_Page_49thm.jpg
1b44e2ba1c9d7c11fac14a22aba77de3
20e9b2f8c6b3a46f68c12722babfe59a2d040a1a
8096 F20110404_AABNYX kearns_s_Page_25thm.jpg
efea78f1c3f08132c005ae54ecf5ab14
e69bd64ab501ee59ab5bf39556a1f17f42ee70fe
1521 F20110404_AABNCD kearns_s_Page_31thm.jpg
a0118730e23c466614d135347e9f2b9a
b8f70ee81838bc244013bcd26fddaf95a5af95c4
123024 F20110404_AABNBP kearns_s_Page_88.jpg
b7d3bf16c688f902fe72586011c37a9a
4fd8ce7e9431e3cfec38cc3f38f9794603ad1ed2
8321 F20110404_AABNZM kearns_s_Page_50thm.jpg
79a4864c0669299ff31a681ecec14094
c3eb6c9f480fe8e76d630210e66b7b25b1ba9723
8526 F20110404_AABNYY kearns_s_Page_30thm.jpg
7a036cb96c4d5331b7f0fdc4cc9b5e92
fc2ae5b48ba17ea2ac29ad06bd651c22faade7bf
33028 F20110404_AABNCE kearns_s_Page_38.QC.jpg
8d1788a470aa9ae6f999f0cb1ea1d5d2
a0af92a69e09f949888b897ce0fe03b63fc5d42f
F20110404_AABNBQ kearns_s_Page_02.tif
b792ca1e229b49ac71ae8c3b57700e04
ab8216ccd64ab1a31b149b8ccd2c79b44f2988ca
7493 F20110404_AABNZN kearns_s_Page_52thm.jpg
e71fa8414dcceed8b7b1ca9cd1006cd9
1b18b3af0973286d0d3bf04ea8c9c594f650278c
8423 F20110404_AABNCF kearns_s_Page_20thm.jpg
326a7d9447131de21acb9910c6f45a2a
4be2de796e197cbe9db2794b8d093f9af14cc6a1
3238 F20110404_AABNBR kearns_s_Page_74thm.jpg
5b21b29cf29ef0dda95e2d82d54e5261
9d894e022e7aa34e7c72af0164904421dbd92464
4727 F20110404_AABNZO kearns_s_Page_53thm.jpg
07a3f58ccf05c15b0e17569288fdc09e
1202c9ebcf73bec14a10eb5de502a59cb2b1af21
8554 F20110404_AABNYZ kearns_s_Page_33thm.jpg
c6961d27ab17cd16db143135f842eeef
e108b56cbf14e76f22a84933e1b6f2d5bf5a75db
61675 F20110404_AABNCG kearns_s_Page_94.pro
c84348d982d65483672797470242efec
530d57ef5d2c13fefb66a12995173ff127229cf7
F20110404_AABNBS kearns_s_Page_38.tif
f6ff6cd018f8f8ce47e37bb277e3d51d
758623c0ffa91520e0104b6ac9b2ac421355025f
2890 F20110404_AABNZP kearns_s_Page_56thm.jpg
3700ae1af7591b8aa7c3b13f5673ba82
5436cd6128d177966fd6aeb0e6886fe4ac165994
50372 F20110404_AABNCH kearns_s_Page_25.pro
aec1d3a9cd03aa98b90ed4fe2fad265e
42d76610ae13396b18accdb888ff201b5015cfef
46561 F20110404_AABNBT kearns_s_Page_36.pro
3db788b926a0d0a2d6e43b326fdaaff5
a6d956a52db5fb37c787595c2d4681908bff6adc
4170 F20110404_AABNZQ kearns_s_Page_60thm.jpg
9cd7f4a3620dd9c84ded5f6b9b484b7c
d609302a547da564529c0333485f0e1d6b3ef68e
124535 F20110404_AABNCI kearns_s_Page_94.jpg
e1b03b8ed48f84a49965caa75f31e48c
d36069fbad60161d2131d8912d2d30d7ae069ffc
6347 F20110404_AABNBU kearns_s_Page_74.pro
1753de1a00548d053e9002cd4c0d67d4
df9ac3d0184191fa23c3a9a83a36a2e0fbbc7fa0
4931 F20110404_AABNZR kearns_s_Page_63thm.jpg
c1967a52d7068eebc2492d63fb76fd3f
9cdcafc5be95c23b3a61b699a5aa48048e6f8d53
6998 F20110404_AABNCJ kearns_s_Page_76.pro
7144772255cc2f65ad45aadb805c6917
b8afef50cd3afe41acf6e571e249a42d8139dbe8
F20110404_AABNBV kearns_s_Page_12.tif
056397a0918d19c822d798f7e69e4c45
fb26520eb040eb44fa969956ab80e8971ce7d6e6
3464 F20110404_AABNZS kearns_s_Page_66thm.jpg
883bea0f318ba1d0f27032bd09e62b03
e3c28086073478775d4ada70f246229904ed5b81
873 F20110404_AABNCK kearns_s_Page_97.txt
1444ed6b2986ee353d9723abcbc180c0
fa4d775e6aebe8523730ad793eacb7b32bf120d2
103243 F20110404_AABNBW kearns_s_Page_13.jpg
e01ce67a44197b5c2cb8881f24e0fa06
96c49d1ade1cead74f6eeccfabb7987293677ab5
5052 F20110404_AABNZT kearns_s_Page_69thm.jpg
19a133ba8fc78feaaa7be46c14e48656
0a109a71bfe660f1be98502718135e26b730fd18
F20110404_AABNDA kearns_s_Page_83.tif
ec08a69462cd7b0546c68e8b788f6f30
d972c01963b549533e05d2dd8fc35f7299f4297e
F20110404_AABNCL kearns_s_Page_79.tif
085cfe13757a205bf45176a98bdb633a
05d695b88d164a99f8ecdadb104bb7cf4d88d530
11197 F20110404_AABNBX kearns_s_Page_59.pro
4802551035a1b9449db8f82894f3289b
86af095f897112f21fb29dcb1bf21d609b7de031
4458 F20110404_AABNZU kearns_s_Page_72thm.jpg
9d23239429c3aa41fd517159c7370a7c
5c94942039ae08bc8c0bc85f707bb908931c5de3
34651 F20110404_AABNDB kearns_s_Page_26.QC.jpg
f044ee01ba62ea919ef9c53a80a78221
7ee8812fd55a5ab58ddb2b45b5ee080416fa5ec8
103434 F20110404_AABNCM kearns_s_Page_50.jpg
194a6b9bd1b9867e3977c739e4af714a
6dbdf64f75c0bb296e3566d2202306e5e2d35da8
683054 F20110404_AABNBY kearns_s_Page_86.jp2
7fafb85ae895dabf07ccc4c9b5b0bed9
a8067a7183398fb9a881cf02ddf3017c8a1dd7e4
7459 F20110404_AABNZV kearns_s_Page_76thm.jpg
94bb01c9ed0b899be3f4f6e42739af37
c89ac5f8f0309ae7c92878bc1c0f16ccdeff1214
40028 F20110404_AABNDC kearns_s_Page_59.jpg
09b1bf2fa299cce1349c15fa7e06ffb8
c6220c36575bfea20d3998985e14470d84f2d7cf
2006 F20110404_AABNCN kearns_s_Page_13.txt
dade8fe8a167ae13f111f1f60051c22b
7a7644a89e1767513be3670d14c1757b72aa8471
2127 F20110404_AABNBZ kearns_s_Page_12.txt
c8a8ca8f709cbbfa19f596a27a13a0ca
40c5dcc940354be16f9dd010a41f7690e6946ea1
8543 F20110404_AABNZW kearns_s_Page_78thm.jpg
39a16d1d2efccda5f60a8cc6cf62344c
043574e9e85ceade832031ed9ca901929d4ec8d9
32775 F20110404_AABNDD kearns_s_Page_20.QC.jpg
8f4911a6de99a6a5c167dfcb0bfc8f6f
019ea7aa0d37a9348db63a810bb7753f6f77c504
100523 F20110404_AABNCO kearns_s_Page_28.jpg
536d317ae45bcf6a5f0aa485259ca3b8
f84f259cfc50496216beeaeeb33ada5546aaf43a
8295 F20110404_AABNZX kearns_s_Page_79thm.jpg
dc642469d0471cbd711080638e184a1e
9b79a54a236353102e6bd69280fa7432db2edb67
15140 F20110404_AABNCP kearns_s_Page_72.QC.jpg
d9ffddd7a7a27d354260a7371e12af9f
9faf0ff7c309204d27997e4777aad0b2881572b7
8409 F20110404_AABNZY kearns_s_Page_81thm.jpg
850fd4051f6a30c32049566b3c2c4f8a
81e170f88a3cd14826f48d87ceba71fe4b028316
13020 F20110404_AABNDE kearns_s_Page_97.QC.jpg
534fdb50dfa76b6864f58ae90b3e73c9
5655d428e52fad9c8b4bfb2ceb8152f07a118afe
1925 F20110404_AABNCQ kearns_s_Page_82.txt
3f447d0f2ada137221cf6614b6eeb170
9466a23d06e181cff99ac62290b9e0751439ab30
7955 F20110404_AABNZZ kearns_s_Page_82thm.jpg
9705f14dfe58a3f8d156e4f26efa8b9a
9b45445885c20db01cce8f1d05b95f7df72d2cea
105455 F20110404_AABNDF kearns_s_Page_26.jpg
1a0b93925ace866b54a4cc0112e6e42f
499ec4ae63fc345fedaaf9f011c53f4fe72319bb
121239 F20110404_AABNCR kearns_s_Page_95.jpg
6a03ab6cfee11bdd1ea9186cbe878d3e
62b44898416e8a58a8dceb57456d3da2f28edebd
949218 F20110404_AABNDG kearns_s_Page_32.jp2
203facfe571f6f2b86ef791015364d6a
d87a9b55db6084fcb47568f57184b952d75ed503
27966 F20110404_AABNCS kearns_s_Page_87.QC.jpg
9d491c7b21b752db4e9147f927682634
550b7279046834b9cd4a387fe441b4be695ad05c
101806 F20110404_AABNDH kearns_s_Page_21.jpg
bde99e366934b80da369e8cae73018dc
bc8bcb3b5dae0532104e186fa492298004934e91
1875 F20110404_AABNCT kearns_s_Page_11.txt
5e92a962a4684bb3737a050373c64ff9
0d72354da7aae978465c8b6d97791f9779f639e5
299 F20110404_AABNDI kearns_s_Page_31.txt
9471d7f6da2898a23bbcffd5b0a860a2
b2960c64c6dd1b489f2e4be640ebc58bc9626d23
18526 F20110404_AABNCU kearns_s_Page_55.QC.jpg
b90ca8e3506ac4af7d2cdff4f99e49d8
1110575fd46c06932f57097ba945e29d6d6c1ffd
3988 F20110404_AABNDJ kearns_s_Page_73thm.jpg
e1525895634e156ad73bb3af635105a8
b4e943268ef01575e257c99439590729e9e37bfd
11045 F20110404_AABNCV kearns_s_Page_64.pro
6f833f6be6461502f73d1ed074e41383
2178a400a032daca24232eb2ace8d1cfbcc3a8c8
4817 F20110404_AABNDK kearns_s_Page_06thm.jpg
af048e78c2c9b65ddc51f6c95dde7c88
1b774c3164437f0b28f3272c1335465037d4ff6d
49594 F20110404_AABNCW kearns_s_Page_66.jpg
c4b65b675c98a80c46d2a586d373aa07
b9fc102afebf3e6b3d48a221d80e2fe703df879e
F20110404_AABNDL kearns_s_Page_33.tif
269a012b52baffe7c93d43d30e74b3e6
6be2fb8d0404b43dbac5ce64ea39e2c08cfe0dab
104696 F20110404_AABNCX kearns_s_Page_15.jpg
0028372f3870bf0d61476577ffcffbd4
5a97a708f089b857bbe3e474a6aaa60b4eedc69e
49363 F20110404_AABNEA kearns_s_Page_28.pro
d129ac2203b8ca47cc9d628b8a49f28f
d60f5c523e11103fc80fef3ef18f3f957331cd68
20673 F20110404_AABNDM kearns_s_Page_57.pro
6d67269fff16b24d6bcf2500a4886cd8
a083d018fa33e1ae0a29ea8c6d56394bf38e661c
F20110404_AABNCY kearns_s_Page_43.tif
65f3a4f454c9693db9b28fdcb9c2778b
963fabf2402a704b8d71182e8670707aab4c26d6
1051967 F20110404_AABNEB kearns_s_Page_94.jp2
d8cb8af6586d89c9dc0d0fdc6f43c74b
7cc2f1bfb8b6013673fdaed7f05a4b294d865803
5949 F20110404_AABNDN kearns_s_Page_07thm.jpg
c3b48000a149f84a1d4bd0d45aefadc6
0a55d3400189029e1fa4b6ce3f22828291d48d56
34501 F20110404_AABNCZ kearns_s_Page_15.QC.jpg
c170f9273f0f71c748e174f5e655247b
dded21a2dbf7c7655f910792cddabe3f25a8d8e8
33903 F20110404_AABNEC kearns_s_Page_13.QC.jpg
f8420fad6277ffa449fad0adf4f73288
2cf36288a89f605ea7fb89b141e1f3dfc81a640f
F20110404_AABNDO kearns_s_Page_37.tif
0a962ed14f8a6b360255818179eaef06
6fe51bdecd0b80f2d4b7ca1b52b00a290b7cf3e1
F20110404_AABNED kearns_s_Page_39.tif
e2659969789de5122f17cc72d23d9e7b
a18f558eb75afc11e24156089ba05c3a872eb38b
15939 F20110404_AABNDP kearns_s_Page_53.QC.jpg
2d15bd6baf8ea34e1339dabcfaf463e0
d412e6b411441c127c518125aea0c2d043eb3145
51417 F20110404_AABNEE kearns_s_Page_98.jpg
3019b55d37c7c5ced52fdfd80446a75b
ed54fc39a80cc343a1e3778f0948c220dc4b6986
50881 F20110404_AABNDQ kearns_s_Page_18.pro
625c6cb39c701b7b91dab3a5d9693d25
8043b2a7c53d5ca077998a1c1d98e1a767ee5ec0
63029 F20110404_AABNDR kearns_s_Page_86.jpg
9e9ce600f44221f615ef11985b51a2fd
64f8bce3ede4194c0d42e21142ee4cf92ef2ef10
108366 F20110404_AABNEF kearns_s_Page_33.jpg
894bf9f46f0bb0e788d877b8f8eda3a8
afa30eb7793d0a23c53d1725e83b1627dac8930d
29978 F20110404_AABNDS kearns_s_Page_74.jpg
f22249c3d0def0798bdcecda82880580
9b8c9c7427d8655facf292d4a65e716dff6e2e95
5655 F20110404_AABNEG kearns_s_Page_31.QC.jpg
0a498da3da1016161334b8beaf754ad7
d4f86cbb0879a4145199b3456eeb0abf725dbfae
1051945 F20110404_AABNDT kearns_s_Page_43.jp2
52ca2bedfaba44c98b90d83ab2e88e4e
1432d525261f76e9b17ce04ec58690b35b15f112
14323 F20110404_AABNEH kearns_s_Page_66.QC.jpg
e3d4ea32545c994745f06d293492d0b2
f0f95f616dc5ef973481afa01e521cd427e13400
90977 F20110404_AABNDU kearns_s_Page_11.jpg
7e465b60581f36ea793ed394ea70cb6c
b70e00b35159e9775f869da844b3b9f50a986dbc
25221 F20110404_AABNEI kearns_s_Page_64.QC.jpg
c5b95f358e10ebc0ded53726398517a4
593fb52b74b494f6aac4c4e75f2f64fab504bf51
69735 F20110404_AABNDV kearns_s_Page_03.jp2
eb976d8bffac5ca0f12552299c7213cd
aa8c3de6a57c77094786070cdff35c14fbc37a9f
31656 F20110404_AABNEJ kearns_s_Page_37.QC.jpg
e70e42ec96158da3c7d8ce8f5ad7d3c8
ec86d3e8ad9d3d4b4ab5fc533f18321e97aec920
3707 F20110404_AABNDW kearns_s_Page_68thm.jpg
373e4b951335a4e28cb4002547a2f0ff
245953ac61c53d631934085e06351848fc2044b7
1051960 F20110404_AABNEK kearns_s_Page_37.jp2
bbfc37e43a9180cecaec63e37699a524
884cfff99492e027cbcb2f6117429e8ac2487a52
3450 F20110404_AABNDX kearns_s_Page_08thm.jpg
112899e850cb49e69e73273f1511a16e
bbb9c26a604aea33820bfd004850ff431884db37
F20110404_AABNFA kearns_s_Page_70.tif
1fa498735d5934504ae533391e9fd889
c007afa03a8bdfda5817d9dcfaacb79cfce19f3c
6593 F20110404_AABNEL kearns_s_Page_70thm.jpg
a6cb3db863e0ac4aae9f5fc62c3005bd
8e62a5569e27ef207805899bbfb973251ce22c29
F20110404_AABNDY kearns_s_Page_23.jp2
270ec6624e6f5a2ae5fade0f394fdf3b
b564584c5529f46aff322bbf00f79c17a5cb4d6e
1051981 F20110404_AABNFB kearns_s_Page_27.jp2
6afb1aa4db9aad14de419b60038ca291
e72fc86ad583ebf23b8a1fc3f3a590af97da1a69
7785 F20110404_AABNEM kearns_s_Page_46thm.jpg
f47f0176dc98affcceb70495b2529af0
2601ecd6f082320746c972c53be3e6754f3b52c2
602526 F20110404_AABNDZ kearns_s_Page_60.jp2
e006bc463fc753e75c5c8451f09d89b3
43e98a00e4cc4fcb5568b0c64d6014774faaabfa
F20110404_AABNFC kearns_s_Page_73.tif
b39a62474fe180564cc5109e2ef3dc24
fc3a6a6d7b59f5b59f9c178a449bb893320468cb
1051978 F20110404_AABNEN kearns_s_Page_91.jp2
92c3731f3862d4c38325e4617a73f973
a1070dbf403870e2f2594cd3fa044fdda0c5a0c5
8535 F20110404_AABNFD kearns_s_Page_96thm.jpg
ff145d85c9b135dc249c4d3241d74359
edc503402048892854c76741a9a60fd4cb3cebfd
8450 F20110404_AABNEO kearns_s_Page_13thm.jpg
3df241f11c0f47f54c39d38c5f967b66
b19ccbb412c9cc0e5cd39027b739460c8f2a5838
14556 F20110404_AABNFE kearns_s_Page_71.QC.jpg
01cad50d015da209e9003ef4e83cada6
e04c79a9a5082835be5b9693162b3ea1c8de44f2
5259 F20110404_AABNEP kearns_s_Page_55thm.jpg
164019f3742cc8e5befc2416f9835826
0224bd62581d82f9615da85d31e88160fb77af00
1759 F20110404_AABNFF kearns_s_Page_19.txt
89a5d40a096c691210550f8eceefbec0
28b7c0fbb9eb1e83aa749f8e9ea580596d92aad8
1715 F20110404_AABNEQ kearns_s_Page_09.txt
7504f344985b7cbe1159e7811e970acb
e2c7e4da8101f8a725005cedc17da712c655e13c
97317 F20110404_AABNER kearns_s_Page_39.jpg
1f2bc2712af136ff0a1252115761cd33
21470cf0bac38e34cb1999cd3ff8cac97ef49f32
644 F20110404_AABNFG kearns_s_Page_02thm.jpg
09b61580a376e93f26c51a13085f93a9
279998231e03afaf3f91934d3c3cb56fbebfa229
9444 F20110404_AABNES kearns_s_Page_01.QC.jpg
5c34e541c877bb4bcc20d851e7d91d0b
85b24f46e4b747bbde178a241a2edcf104343450
20492 F20110404_AABNFH kearns_s_Page_06.QC.jpg
f4e18eb9dc4596235f27620d4f682a90
1ae194d7753f88364cebd568716418e85a19ee73
32367 F20110404_AABNET kearns_s_Page_01.jpg
e43e672f5a7005bfb6342694ca944133
fa08d5747328fde676ea239566614779f48c1f7b
233878 F20110404_AABNFI kearns_s_Page_74.jp2
80ca185a0b218b63ec3eec9b2854adbb
d7a75acf71d5c778aa6fb4f64d80d4f766f24259
F20110404_AABNEU kearns_s_Page_95.tif
da0011517c4c1b6f0f90040b589bbb5b
d77c884a3311fc4457e39c7ffe059cd7a6e6e55b
108512 F20110404_AABNFJ kearns_s_Page_17.jpg
5000da98e0c579708547e977db701b2b
ca8ae85d2eab44653bf1c1993896964eab9bdd92
1051955 F20110404_AABNEV kearns_s_Page_87.jp2
a257bf15baaf58689af2c10c17e5b8bc
c9d410b277295d052d5493ef54069277f5e8af6d
1051958 F20110404_AABNFK kearns_s_Page_14.jp2
238d6e5cb5ef1e4789a2d1fcbf0ed02b
29839e306ee94f3b297121c1cae7694b052df370
102249 F20110404_AABNEW kearns_s_Page_38.jpg
d147c417a95e01fa77c9c2aaefb4bf51
d62ef6fd6cb99da8ec68caa4f87395f8bb1f1503
102029 F20110404_AABNGA kearns_s_Page_45.jpg
c3e19dc218249666326bceb5419e05ca
00c530ac2a3ce8299e0b349afcbb4c8070c7f5a4
49434 F20110404_AABNFL kearns_s_Page_87.pro
f1ca537e6fa68730d2bdf2318d41ef96
e4ca8890c03f7a0bf7d44e4b8f5a3d7cd43a7785
31863 F20110404_AABNEX kearns_s_Page_35.QC.jpg
f3b235b22a80735ad7aa7dc4327363c4
bda2cb12101858b1623483eb97970e2ab29ef29c
93512 F20110404_AABNGB kearns_s_Page_64.jpg
2e938b8a4184099517f0aee2593ca393
38235821444eba609641cf995db358ab92f71f9b
6726 F20110404_AABNFM kearns_s_Page_75.pro
ae74857c7aaeb3a4e3a8c938a6a724ec
da30f4a3a7946656343a29d54c40f0bfed326e21
1051976 F20110404_AABNEY kearns_s_Page_50.jp2
6af9fe92cb91f09d2ce605736d1ecf72
293b490fa291cec80a044275d11dea4242b73784
37259 F20110404_AABNGC kearns_s_Page_58.jpg
ae139fb2156aca1703ad089d87f11616
b3ec657fe88322ec50885d2aece29242b7b6991e
519078 F20110404_AABNFN kearns_s_Page_69.jp2
09668ecca636952dd559f86a3c6a195e
c5ef033498d31e82e4b4090debdebe24929f072d
18222 F20110404_AABNEZ kearns_s_Page_51.QC.jpg
2a5c9b94545286f1e3574333ed80fb9e
dd24dd7665ff17d767819757c72860036bdcb167
2021 F20110404_AABNGD kearns_s_Page_50.txt
8859b69b86a0a8d641b691a57f4e9507
5fbeccdbe10145e63f3372e6ac6b5c14461c27cb
11860 F20110404_AABNFO kearns_s_Page_68.QC.jpg
ecd8d586c11f48ddaa57c8e94bb5a10b
48df7a4e5a2bd92fb9459b197168401f507ae979
31193 F20110404_AABNFP kearns_s_Page_39.QC.jpg
9300e67d6b388eccdf1ca85b66337ea4
9a4c8544c68850432868a04c9b922832dcc54726
23430 F20110404_AABNGE kearns_s_Page_40.pro
1e54d4de3218f9b88e2048b40fee4308
6e93ef60b41e6bb37c0e861eb4da1a45289f49f9
7482 F20110404_AABNFQ kearns_s_Page_93thm.jpg
f267e812f4f4d9d4d3d5de5b3e160ea9
b42310a9260bf622e9f31d5137d974b8492c0e39
59137 F20110404_AABNGF kearns_s_Page_55.jpg
f6d04bc880f6fafddb2d1abd7908a5bd
d7aedf9f31e6fa0aebec711b492b81d70879040d
25005 F20110404_AABNFR kearns_s_Page_09.QC.jpg
becc7b0127523c45a067e6522d499293
d413ccd5d8b37be8208eb648c116500fd5294f88
597004 F20110404_AABMZX kearns_s_Page_10.jp2
c8ef9676b5241d85094a4c14262d1382
453f02932516527792ba7218c5ef03c3dcb4ebcf
325 F20110404_AABNGG kearns_s_Page_66.txt
21c1cdebaf99c5e19a73d665ec97e731
568f3572c3f1061815176ba9f2bb8cabefff8cd2
35893 F20110404_AABNFS kearns_s_Page_17.QC.jpg
b6f45d4ab5873ec0c6889cbacab74f24
c1638dc9ce3b905fe436f966d6b8fe80365d5952
52903 F20110404_AABMZY kearns_s_Page_16.pro
e468199057801d785c94f4eff5434fc8
d9722ad3a7e606f6ffad4c2568278e51d6ba6e71
3160 F20110404_AABNFT kearns_s_Page_03.pro
0b19eda3d75f73e0a7667deb19d8ed01
bc174ebde2fc334312d7994da7f185d7a226b0df
925696 F20110404_AABMZZ kearns_s_Page_19.jp2
aff666dc6e0260230a6a21ac41b38f10
2413dd2c1951f814b1899245adb47a0467e300e0
70827 F20110404_AABNGH kearns_s_Page_40.jpg
5b778e862835f8d18755ac6c7f96c37d
595780fd7d5dcffab2c5e7520b13531f2e4967fc
1228 F20110404_AABNFU kearns_s_Page_86.txt
8dbe4b867a24ee21e358d15e838fe6a4
ad349decaeb090c8b1a171dfb37b3695f4034c67
2273 F20110404_AABNGI kearns_s_Page_91.txt
d210c26f3e544898fe0a420d0cc4e9bd
aeb8f261e64933a5b28ef4dd3001925f0ea906d2
11092 F20110404_AABNFV kearns_s_Page_60.pro
b25d90b59ffa3ba3d08f796ac7155fc8
6b0ae390a21ef413efb26087ac604bf46ddd2db9
F20110404_AABNGJ kearns_s_Page_78.tif
5d9d3a49619e57c3f252dca4ac5932f5
43abe13f05e309123f592c18a1e5e856d4bec441
538 F20110404_AABNFW kearns_s_Page_01.txt
5da1c96203098e80d9fc95ebeec585b4
60aeed839b0f1aff9241370b8beb954e598b4054
92004 F20110404_AABNGK kearns_s_Page_34.jpg
05a664dd41ca5df9d6337084df6a792c
d3c16afa08ff156ca3c086cc8d795b75a4598fc8
31601 F20110404_AABNFX kearns_s_Page_56.jpg
a6ec3c5167624ce3f509808608828a96
fdfd3e4cc3477f830de4af907b0ee554821c3813
8302 F20110404_AABNHA kearns_s_Page_28thm.jpg
b9a3eaabd8c6e387b77bc552b592c247
e507d66b704e700be8bcfc8bfeed447f61e7952d
1051985 F20110404_AABNGL kearns_s_Page_44.jp2
6fed1759b61a4b027f9f734f3fa93705
cfcdc60d353dbbd310f8ac3fd5cc527c830ce003
11980 F20110404_AABNFY kearns_s_Page_73.pro
7a03adc024dc7f91141d4b2a2caa2bca
7ef419c6e41c0d4a598358027d75bc911f08ccfb
810 F20110404_AABNHB kearns_s_Page_03thm.jpg
14495c4f10076bc8ccf3da0f800bd7eb
4eb60bdbc03f83f1eb73a563ed8848d1e80bab0c
15649 F20110404_AABNGM kearns_s_Page_31.jpg
aa0219ab4da759e0abf66d9db7a407c8
6c6bc8ba21b54453781c8dbfdc7d1a0ab3307d3b
58613 F20110404_AABNFZ kearns_s_Page_89.pro
b4264f5bd4824c9884bb65423abb47f9
705a2248be77de20eebf6df131872addd4d58d20
3883 F20110404_AABNHC kearns_s_Page_59thm.jpg
d58505fa0ae1db34f1fe3448c7f5db27
fc92784dc6fd60a4d27922fc7395c22427aa5a7c
6165 F20110404_AABNGN kearns_s_Page_58.pro
43e2f0d9af3bd965b7bf6672b6517f33
003843ec0efa50aad7d693b01357599b5d23ed9c
1935 F20110404_AABNHD kearns_s_Page_23.txt
c9b82dc220ae3aaba67f9229bfcaf9e1
3d589ae7777884cba934688741885bd66dbea15f
52597 F20110404_AABNGO kearns_s_Page_53.jpg
18cda7546c01d28d64e865082ff7a1d4
6315b41177ed2acf750c1f24b0a30ea6ebc16898
1832 F20110404_AABNHE kearns_s_Page_35.txt
63e51503e75e4d4d78ced8b193e4fc8d
77ebb65f7d212b7fe39584924876761e03311876
1051986 F20110404_AABNGP kearns_s_Page_93.jp2
932f29d2ddb0b17eeba869b0cbb9d579
571ba276731274f5c78b058b5d345e2535659145
32667 F20110404_AABNHF kearns_s_Page_36.QC.jpg
de2197505495d763f06cab3b88a6f89a
3223d9dee4c7066396e5ecb7cf961e05558a2eb4
2446 F20110404_AABNGQ kearns_s_Page_92.txt
a0a49e3f2a2018faec9f383398a3b552
b1bed799279c847304d0652f12a5e0de9e9eb409
105722 F20110404_AABNHG kearns_s_Page_16.jpg
4b76f4c7913ece8abda9bd0249ddcf8e
179158b75c36c371e607248ebc249a4ae5177151
47764 F20110404_AABNGR kearns_s_Page_49.pro
8fb49604d22b3bfcbf6d55fa0a7e64c4
4e311e80aceeff979d501895497c019e8b81f17d
1051952 F20110404_AABNHH kearns_s_Page_95.jp2
dc69e97b9b105a707d3d1e3fb798d973
770526304a8e879564414fc583cebfb98d7731f7
F20110404_AABNGS kearns_s_Page_32.tif
ca1dc6dc83468bd3af313624a373957c
d9df632d118438885e86e50f3e983c542d15b16e
1051948 F20110404_AABNGT kearns_s_Page_22.jp2
037ead68b45ee36319a2338d1f1c63c3
44cd1814240472a972553475710ae1df0392ad77
666 F20110404_AABNHI kearns_s_Page_72.txt
fe5c2822bc68a1e596568b3f7c99d2c8
a4ee9c0dc37b42318e2c4404e4e6a3ce3b072f4a
33638 F20110404_AABNGU kearns_s_Page_21.QC.jpg
75ea0087c911369ac3b25036041ab798
4b4157630a4557f5eb33d47899c380708e24ba6c
1806 F20110404_AABNHJ kearns_s_Page_39.txt
d4e63e3614a9a55b5169183a0e29c0d9
3e622f915be59cc2fde4e1cb80b988c306c76582
1850 F20110404_AABNGV kearns_s_Page_36.txt
efa6afc64f9568e1da3319a56cba632c
c6b1712b3eb982dae0edbf876e132c9e542deeae
5256 F20110404_AABNHK kearns_s_Page_65thm.jpg
64144971ee06628f4782eb31d3142cb4
94f41d1cfeaf4a57524540354fc2bab5bd52d25a
99774 F20110404_AABNGW kearns_s_Page_82.jpg
3bbb589f2477b1ff383c5d1ebd07dc4c
c74035cfeb0ad7d184f3b2275f0facd2c279f9ca
99705 F20110404_AABNIA kearns_s_Page_87.jpg
caa25566e06ae94a92f430178d949f32
7120aede31276589cf644889ac836bbe56477410
8204 F20110404_AABNHL kearns_s_Page_84thm.jpg
bb3562d52d541694779b9c9adeadbe1b
33763ed371976f2f213e4301399f73c52855da5a
51023 F20110404_AABNGX kearns_s_Page_21.pro
0f59eccb55cceb53a1b9e14bf08e3cf6
b9bde71a94ba1f28ce0e530f0849bb621136a5f9
545 F20110404_AABNIB kearns_s_Page_64.txt
68a8caaedbdea55fc2c4d0d65f9e58aa
bc1b6c37f2987e8dbcff337b8d487a4cd2590b97
33371 F20110404_AABNHM kearns_s_Page_23.QC.jpg
7bd8e94e81a61bcfde1a4af3ca01f40f
019a8e596bf3812444636198e5ae68d3aab10972
29254 F20110404_AABNGY kearns_s_Page_32.QC.jpg
ca8f34cd7613ed9e215259030c600e14
394f19ca47e81ba525781cfe36a1d542a4f0e999
33803 F20110404_AABNIC kearns_s_Page_78.QC.jpg
4548738121b4a865c2e9cf72b0619e8f
105d3fea50443674a879b0e089478e5e7fa731e7
8622 F20110404_AABNHN kearns_s_Page_22thm.jpg
2609de239b776003bd929584f961918f
54eb32a5ce3d37ab3dadbba41f2ac05dce4dd58e
9694 F20110404_AABNGZ kearns_s_Page_56.QC.jpg
47d163d9855497a8fbff4af422764cb5
b7634f12f3da66fbbb144bbded6ed34b91eddeda
F20110404_AABNID kearns_s_Page_77.tif
5b19c6416c266246cd3785d8b2bfb9ab
a2e2a6614227faef55c1557c9c172eae18382e5f
1051944 F20110404_AABNHO kearns_s_Page_79.jp2
24ba25008941c4262ee66077550ee6bd
8d46064867c49cb4cc7e46de98d1f1d160067435
8442 F20110404_AABNIE kearns_s_Page_90thm.jpg
1b21ea8afdc3e24f575ee3c95ea201a0
3a42d80f047dfde48850c4e7036aae5632c8ba38
100078 F20110404_AABNHP kearns_s_Page_20.jpg
f60a471da81d3c5b24982dc8f697d2d1
dd2de14fbf6bee9994796d417082e93a37e6814b
999046 F20110404_AABNIF kearns_s_Page_34.jp2
ec642f165bb8c076d0b5158d512635de
082c1577ceed62ca8b3c4423be97516dbc54cc60
33760 F20110404_AABNHQ kearns_s_Page_96.QC.jpg
95204211fbd5d9f957ec046ca31e83f1
7fb0a2b00848c7334274e097864276808005e902
12450 F20110404_AABNIG kearns_s_Page_53.pro
a35f45936f660b6a520e5044013419a5
d12948811f27a4b68d0e2202df379cc07fa3c179
8552 F20110404_AABNHR kearns_s_Page_15thm.jpg
2a9bab5b5c69bf9f30b260c776daf697
73673e0f7a75a3567af931db0cfc02ca409e478f
4197 F20110404_AABNIH kearns_s_Page_71thm.jpg
549549b323859a7250df5b6540a03ed3
bbe571e086233a6a0cdcb4e62bd1135d3bc9a508
F20110404_AABNHS kearns_s_Page_45.jp2
bdeaad075754d40bbfa8595d213a6ff9
0eb9778e7496acf9791efd8bf58a7e6049cf4681
72005 F20110404_AABNII kearns_s_Page_70.jpg
c1c31df00a393c2dac7e15a5de0f9b2f
ad7c12c0891f30eaecfc03c95ad653b5cc8b3162
4793 F20110404_AABNHT kearns_s_Page_75thm.jpg
f085e8feccd3c923fea45ca8196480e0
825ff1eba1a25e83d48cdcb0f306c10b797eb378
100757 F20110404_AABNHU kearns_s_Page_44.jpg
390d6908e18879efe2af36f4c82cdc91
7471a15540175104ae54a69330f5db9d266a9c67
9627 F20110404_AABNIJ kearns_s_Page_61.pro
df84a493fb392804e0ff03a662fa0cc2
3b225bb4fbd5346349ea08adcf5b53b55e52c229
29781 F20110404_AABNHV kearns_s_Page_77.QC.jpg
8d224ed3ad214d4364b2ceb86928e53f
f9ad7966690ab27073f1b547fe91b07ef87e581d
8528 F20110404_AABNIK kearns_s_Page_80thm.jpg
be27c98369652e41c1c2bec9544d0ee6
f853fdea26b3a364df3fc9c182c82f7c869a6b53
2451 F20110404_AABNHW kearns_s_Page_96.txt
f52368b2e30843cb19555e7ab02dfb19
e383f9e331cf296f40fda7a5fdd8d10e27c8bbc0
8988 F20110404_AABNIL kearns_s_Page_03.jpg
d8065ae78e61d568e51ed6cd99344999
e27b04937dc5553530c0fb73443f5888fc1ceeb5
1051980 F20110404_AABNHX kearns_s_Page_18.jp2
436eeaa686ca68f0b158af0223ed9904
80a8318a7180c144922ab83ec14b8304769458db
6494 F20110404_AABNJA kearns_s_Page_64thm.jpg
7d2a22d8069372ba14223981f6fb5f18
8e1603806faef24af047d9c0da7661d0a6b7298a
2097 F20110404_AABNIM kearns_s_Page_16.txt
e56f7a629daa3f4ac43c4277dc112661
16170ed5d614a52fc9c99b5779cbd77977ba17ac
8053 F20110404_AABNHY kearns_s_Page_67thm.jpg
98d67c017b55166005743e1ec335bf6e
527ec308e0df979e2193e14efd6468f1f24180ca
501 F20110404_AABNJB kearns_s_Page_60.txt
7cd1d7b8790972514a5cf6bbd013bc4a
c3c734457ee54b2cba35c25727368ec57cec087f
53404 F20110404_AABNIN kearns_s_Page_80.pro
d2d5e7ed0a0749b48619626e93850edb
e1848ebc3da332ea8e0b331895ec57ad715e27bf
8211 F20110404_AABNHZ kearns_s_Page_47thm.jpg
f63ad7d26244f7bd23130c5936c0f6f0
2661b1226d81f62a2e2b8252182827b5090d924d
8061 F20110404_AABNJC kearns_s_Page_29thm.jpg
c8a92f471aab3b62549d21a2c6fe6103
a79db985a365fa0b5fd86fa67684095395c7dc9b
28437 F20110404_AABNIO kearns_s_Page_41.QC.jpg
74972722e8e19840a42c09da94ff3432
476124ed60344ba01b0597bd535f04bb7cfa2945
53189 F20110404_AABNJD kearns_s_Page_61.jpg
356debb807cb0277e18ad173091a3ac5
7858ea6432823aa062ff5a29f6516b717051eb9d
F20110404_AABNIP kearns_s_Page_62.tif
7a98ffcc6c53191f1e0cf2bf209d5979
302ec8f6e2f4d8d90f27e6c91ddd292efbe5d868
32832 F20110404_AABNJE kearns_s_Page_79.QC.jpg
1bfb35ff880a390344a6d1c81f71f35e
6775dd6050748e7221e20ab8ccdc81c9355b5fcd
14632 F20110404_AABNIQ kearns_s_Page_69.pro
9ed44f23745f0c9111e94a31c554b8b1
29c4701d3f208ca9ccc9763a7bfaf19d668a2ca3
F20110404_AABNJF kearns_s_Page_29.tif
e32fb646f485154d1f139ec1cc391874
db52e83af80365895e5ba29a274fbcd4132d769f
29558 F20110404_AABNIR kearns_s_Page_93.QC.jpg
16135997b19cd90f6ce32ab55378656a
05e15dced15b16c4fa1f29444a312b78d9a23c1c
190 F20110404_AABNJG kearns_s_Page_03.txt
17abf68b27a7e9a973acc266a3e31998
f7913a8a0ee824482244f1b84b926ad774d43274
F20110404_AABNIS kearns_s_Page_54.tif
ae820d887ea4c206646800fa7bf2de83
06b9ef8b8bff498f30ecff52a5e757242c433d53
917416 F20110404_AABNJH kearns_s_Page_70.jp2
6870753b6af643b79a4508c2e00ba09c
7dbb06f0d69283f3771392ca0d17a2410507b774
32785 F20110404_AABNIT kearns_s_Page_18.QC.jpg
c214602b6eee3b4f5f4a1dfd7ba565d1
590f6815284b0450b7d2008037d3667f47babae7
32087 F20110404_AABNJI kearns_s_Page_82.QC.jpg
81713fba6d35ad827de1cd79d84e5e2f
018d5087b883dffaf8e7f881ab6955dd1615d3e6
34474 F20110404_AABNIU kearns_s_Page_50.QC.jpg
a19e43b12373dc8f7041eda2ffd6b2a9
a78f8d48d9b38e97469fdf0c8aa1a71e180beb68
1051970 F20110404_AABNJJ kearns_s_Page_92.jp2
ec188d76cff12d409379e0ea89e622e6
eeb3876c6dcd63693d81d807ba5ec89f736b86f3
5649 F20110404_AABNIV kearns_s_Page_65.pro
1078318e09018b5f890f9cdf54e7ae33
282761edbaedc3ccf288428249f05a6edbabf55d
67410 F20110404_AABNIW kearns_s_Page_76.jpg
59c72fdfe9f4b0d7a8ecb86d7b53e924
5f8bdba4d174810be8c5b807c4f86acc3b5b1004
F20110404_AABNJK kearns_s_Page_82.tif
9a729e79024de56d082c26755375540f
192dfd21fb470b65cc658d0d758221e399c0e221
15006 F20110404_AABNIX kearns_s_Page_61.QC.jpg
eded56e4a66ad7ea2262e0386ab0d876
a91e24a531ea38c270e518edbab3232804ae9149
738939 F20110404_AABNKA kearns_s_Page_54.jp2
b760f840556cf58d01ebc7a9306ec31b
9584bae41a3696c2be1fd1b9b76e62a1668355a6
8178 F20110404_AABNJL kearns_s_Page_48thm.jpg
211735b6607dcafe39362fb2bb0cea97
0743370841c9802f127af3168b5b426c439603e5
F20110404_AABNIY kearns_s_Page_38.jp2
b9796d18ac29a952f8a8b81185c6b53a
627f075d37a15f5c83fab9c9daf0d5d0686cc7d5
411922 F20110404_AABNKB kearns_s_Page_58.jp2
0ff32aca0fa5ce58b79abb1fccd7e77f
4f6ca9a4585ff58bd6afe6965b6761fb35df7ef5
32898 F20110404_AABNJM kearns_s_Page_28.QC.jpg
46ead008853cf842160297965abb06c7
245086fef286fe73a15a55da2314c5bbfa7966a8
F20110404_AABNIZ kearns_s_Page_13.tif
1c904ae42485e740f51d1b7b83f40167
89f347346fdf4ba998270e3a190ca05f47752773
F20110404_AABNKC kearns_s_Page_26.tif
4f930fde5802cbb1c1ce5597b85a7232
b7ec20303bced8bb16e0669968513a08ee03a442
1051932 F20110404_AABNJN kearns_s_Page_88.jp2
5e526faac324197d507f0d9b8556b698
aafefae7a6899394c299f8350dc40694352b6fe7
1574 F20110404_AABNKD kearns_s_Page_02.QC.jpg
f162d72816620d0101d6d3ffe9f83f33
dd9e1e561ce24c34140ccd6edc5f9c998f49a2d4
23639 F20110404_AABNJO kearns_s_Page_07.QC.jpg
cc94c066668b9fda1f7331f388c60f19
b7682d85cbe90403ab66ea68243fa01dcb7dd53f
855 F20110404_AABNKE kearns_s_Page_57.txt
306fe056c58e6e506a433949ea1f5362
29f84973ebfbf38d3c2bab6e1c1f1bbf9ade7249
551 F20110404_AABNJP kearns_s_Page_53.txt
ab19df8f570b50fadcd58c90ec591b53
ff9556b95b892a6ac83c2896318ba35d192a0e20
80306 F20110404_AABNKF kearns_s_Page_05.jpg
4d6d3630d9e9457ff0beaa0f207fd6b6
9c7a0b7d50f0ecacbddcf2721c1213bed8faa081
1051983 F20110404_AABNJQ kearns_s_Page_26.jp2
b0daa7bd1dbce685a887e8406307396a
afa04e30534d1cee528bb6f458c6ab77cec48e0b
456 F20110404_AABNKG kearns_s_Page_61.txt
0069c1f507882a3096ff436efbf16411
f3564a8b155cde86fc88206628b3a058e2592797
51268 F20110404_AABNJR kearns_s_Page_48.pro
ecc6e93a855ab5c08757a975c69d4fd5
b23e6bd8c987f42ea7efebc9ca72efb3f8c8cfac
F20110404_AABNKH kearns_s_Page_88.tif
a4109a65ad9a425fbb8df6e5a58ddb42
dbfe6c8fb1cbfb383642871691bd6e7feae3c75c
20507 F20110404_AABNJS kearns_s_Page_86.QC.jpg
dd2037d212740d39de85aeeb5d5e3098
922c216a4940247130389aed8d7901e425df8a6b
7006 F20110404_AABNKI kearns_s_Page_32thm.jpg
6b5f919b1f0d08df7201be4f811ac3e8
c364b89cfd3f5b0d0069c492b45cf329fe08830e
F20110404_AABNJT kearns_s_Page_46.tif
20aa4f83706ed8ecadbdcc744873c8d2
4fec567e8b45ab80ac04fe948c75b8aa1bb24385
20119 F20110404_AABNKJ kearns_s_Page_54.QC.jpg
774a0dc97a99ca23611b4fb21203878e
86a2c0c2ab8f83a49d95b1b2579504982ab6b948
102702 F20110404_AABNJU kearns_s_Page_25.jpg
b05b55c17f139cdf5600d757f3d70165
620dc99333ed1eb5ff395761cff4f2de9c3086ed
7552 F20110404_AABNKK kearns_s_Page_77thm.jpg
eff93aed9ad161f24557a23df5891240
fe2844857346d10a3db641cd73f7fa15d5434e7b
18382 F20110404_AABNJV kearns_s_Page_05.QC.jpg
75a2fabd7b56fd88aae5ce5b0f132ce0
897a8ed33c3ca9bdd622c53c7c7396f1374f9500
10120 F20110404_AABNJW kearns_s_Page_74.QC.jpg
a8dab776565f26a977390f6dbb198cc0
530285482de7ea9394694f6b645e6cf679ec6eae
351 F20110404_AABNLA kearns_s_Page_75.txt
715b52c26a8144ec99b86c6d0884458e
bfa7365946054912bf28f47355df6b43de37c9aa
1051977 F20110404_AABNKL kearns_s_Page_25.jp2
3f6b078e1b5bfe4814954f7b01cb11f1
6be5dbfa7055ab2e76cc481e0d7ec8ec780275f8
99706 F20110404_AABNJX kearns_s_Page_29.jpg
31b390cd1698f4410ecab112df38c4eb
6f5a7a2212f0e111d9d646faf2cd330329badb03
533309 F20110404_AABNKM kearns_s_Page_63.jp2
372e458bb21b07c7397248589fd4081d
38cedb00a828a663469de79ed02ae2fc91f7efee
53282 F20110404_AABNJY kearns_s_Page_30.pro
fa7b91560b02076b156c6fd6870bba7a
9d550970da566cd9b235032ed7d9749413b8e573
2096 F20110404_AABNLB kearns_s_Page_27.txt
bf39ce781b6f7217341070c0e2594ebc
b209424d117999a986cd3c4b648c4df127b83222
34456 F20110404_AABNKN kearns_s_Page_43.QC.jpg
250d5f7e2dea668c5a9fe112a40b1656
a2f64709eca63e44d2aa67680299bbb150126b65
8363 F20110404_AABNJZ kearns_s_Page_12thm.jpg
d398ecb11b1074855d1f81bf965d1aae
ff9e29ea4fd71c589fd2d227e618b0c442bd9e94
50749 F20110404_AABNLC kearns_s_Page_79.pro
8ed53938318891796e1c0b5b569c74d6
30db5e0f1344bf8dfd8535b07d072354a5fe66c9
6376 F20110404_AABNKO kearns_s_Page_40thm.jpg
3c96154b08d5d904b4c6a5b007349ba9
b70bc0ed678d4612901fdf4bd43fe88a23ace79c
F20110404_AABNLD kearns_s_Page_82.jp2
5b1515b789a3f4bc061790c543409f73
b940e9d588cdfa1117ca5563f31b92d592b022ef
466194 F20110404_AABNKP kearns_s_Page_08.jp2
f9920a866a5bc56f5d63607db6aa91c3
4a734debbbb314ab155d29fdc714e1287f8f6c93
31532 F20110404_AABNLE kearns_s_Page_52.pro
0ed2ad2122aefb8fdeb671527933c368
d2922884fcb1bee31432c2dfedc9e20fd2acee26
51606 F20110404_AABNKQ kearns_s_Page_47.pro
9cba2578d0be1f1c761aae043fbb96ee
f65207fc756a5d9fbca9eda335f7c98c04f3a202
34991 F20110404_AABNLF kearns_s_Page_16.QC.jpg
318673fae793d4abac5d4405a9368c3e
a8ba4be6af5835ab612a1607baf14a1b7801ff2a
F20110404_AABNKR kearns_s_Page_53.tif
e1b49b34ff458f7d9a765481668c1856
8da9dc686799b7e35e098fa57ae4b0df97f2bc32
F20110404_AABNLG kearns_s_Page_12.jp2
ae5d809004f3df7ce05004b1dc6901e8
a0d4d7666c2d7d6d87488059639c69bf899f0b9f
52025 F20110404_AABNKS kearns_s_Page_22.pro
6bbe3ede8cc69481f1b6795ebb64f935
a82e016eadd476ce2c62a175e3938662927c1812
97726 F20110404_AABNLH kearns_s_Page_36.jpg
8bbc079efebd105147d5ceebb5988862
e66f2d6187eeba1e5b12b9ecfa13128072502079
26960 F20110404_AABNKT kearns_s_Page_51.pro
85791c1635c896a89ff31cab5711b45f
9a1634f6e8f84db76596fc2f0887e9446919e54f
45624 F20110404_AABNLI kearns_s_Page_42.pro
6a71888c1ed80cb32d580a8a202dd29b
cd89f604058842f922ec3ebbd5f0edff74a85ab9
F20110404_AABNKU kearns_s_Page_33.jp2
07de42d70dd1dbbb0a4682f80c5ba17d
09a722773d2d7cb52f69e4220cc898ab3df2dea7
F20110404_AABNLJ kearns_s_Page_59.tif
74e6c53fe12a708ab6f58ca793100ad2
0421b10eae3a94f3a1326bf3ff9f504fb3f573f8
43913 F20110404_AABNKV kearns_s_Page_73.jpg
6c3b5c808ba4a3484fa0e1ab768aac1b
6dc465300fa150ffa1a35ec24e2c254122db01aa
F20110404_AABNLK kearns_s_Page_69.tif
2ae1785a5f9d63913db1b83e0513bb9f
0da71143ad6c78f39cde5ecb0aa21fe5e80b0a71
4819 F20110404_AABNKW kearns_s_Page_51thm.jpg
521ec0051f4134939177c42b90474994
88667d9fc9e8315559ab8b0c5b09ac529e8db905
34369 F20110404_AABNLL kearns_s_Page_27.QC.jpg
17e54b647bc302c3692ac14e2a93b44c
be28b543d0b637bd12d8cfb6dd2022464de04047
F20110404_AABNKX kearns_s_Page_35.jp2
cc1513861753addeb6a24665c87973da
736f5cab0448d39468549f6d66ee7aa00ba457de
34123 F20110404_AABNMA kearns_s_Page_22.QC.jpg
0ec98aa244f2d3224c25e38f662e9ffe
29e4badbbc9d67986d06daec801d628fff5cd14b
370 F20110404_AABNKY kearns_s_Page_68.txt
5a89772d503b66cd9db033441d457808
d3e05aee7e1d0e2c49d843d2213bc389a99c6388
2037 F20110404_AABNMB kearns_s_Page_26.txt
a6c6d22b99d6913163fccb50b1e2a6cb
52b4fb3c402bb945e2d5c49f886a1a23de621268
55959 F20110404_AABNLM kearns_s_Page_07.pro
06f9881bf951018a87eaae020b0ab885
ca8d113ed236f7ba450332a2d6322d54c09c6361
6711 F20110404_AABNKZ kearns_s_Page_66.pro
7022969c71c95c2d425da0eefcead172
fa9af50c2f7e77404be64d3d9fa5257194ae74cd
11348 F20110404_AABNMC kearns_s_Page_58.QC.jpg
a3744bb546eaa0fef1af0cf78d90d464
6d9e2fc01cc05b2c7e99877b2542d11eb9895f87
50930 F20110404_AABNLN kearns_s_Page_50.pro
a0f99fb67e0bcf403a1c6a52f092daac
cd2c378910818ee81ca18ed1520a3f22c0002f3c
117646 F20110404_AABNMD kearns_s_Page_90.jpg
67ccbf479e50f900e02660a35608d90c
21de38f66e762cf49cc468ef4aad28b539be8cb0
673091 F20110404_AABNLO kearns_s_Page_66.jp2
3394b8fff521285c47d7970569cfda07
6f87b77953b78f8566570220d6af7723980cddee
1955 F20110404_AABNME kearns_s_Page_29.txt
852c6f93c4849610058db89f71fc20da
1f8a6f441c43b04054fced3db364367ac4311e2d
4384 F20110404_AABNLP kearns_s_Page_98thm.jpg
f0628a1c82715246e716b5260838b51a
f00f726a693e5f02d81a5ae69f2e3c5e294c68b4
F20110404_AABNMF kearns_s_Page_15.tif
14ebcbfcabb7a453ad500d29c4fce027
f6fb3bf92eb8d6d69d483fc1109801bc93d6388d
67386 F20110404_AABNLQ kearns_s_Page_54.jpg
c12ee2840f1e9ed6216f03a31c4062c4
bfb47b6b7b0e700f0d0bfa172181a7484ab6292d
F20110404_AABNMG kearns_s_Page_74.tif
2c7713d99630a02317217ba5d0473380
a69a927f6dcf8381287ab883739de0e9f68883af
460 F20110404_AABNLR kearns_s_Page_71.txt
a775df1ab7b2ce6ac2ec64d1fdc25dc5
1f3db330dd1a19561a62decada5ed13aa80b1351
104961 F20110404_AABNMH kearns_s_Page_52.jpg
23e8c720d8f6f872f5de29682182c703
26c5985f4bad3d1ee8160d5ae6b81429f5c7ed25
5406 F20110404_AABNLS kearns_s_Page_62thm.jpg
0ada11de5e2bbba116037b741b3dee79
5d9e5141d549d544dee00c10c8eb1402ada2817b
1051964 F20110404_AABNMI kearns_s_Page_96.jp2
d1e027ef0ba131066a5788fea67010d0
47d715441bde96310cea5355e62170231db323a0
F20110404_AABNLT kearns_s_Page_22.tif
a3eb25de3338d963cf84315f30dc84f0
c6924b64ffd0e371cbe748029bf51950416e46bd
5473 F20110404_AABNMJ kearns_s_Page_54thm.jpg
c05797e822006df0b0313499ed6fcd83
efae9593cc1cac2c272aee7431291e75d27dfd07
5219 F20110404_AABNLU kearns_s_Page_86thm.jpg
7c9063faadc7f859eb90d618a5766672
dc79a6d2d961ae239b34e3037c662ba8e4bf74a7
F20110404_AABNMK kearns_s_Page_85.tif
bfef8fa2e42849c813edd9a58be29d9a
4fde94a08e1dd6cbcedbe38b4dd22408f8595a65
F20110404_AABNLV kearns_s_Page_24.jp2
0dc04ac3845380e41d1ae1371c7eafd7
b0d1a6369921412f55e948a133c74a946b58efdb
2062 F20110404_AABNML kearns_s_Page_78.txt
3d79630a7807dbd23625894288cb9618
2a39eb64f75f405c5e732a2762a5d9b7435ac3a9
80087 F20110404_AABNLW kearns_s_Page_07.jpg
5ea527261fcc8c27f2637626d8c2d4a4
a8c78ade022d92ca1fc3eefbfd5634ff0bef9446
158559 F20110404_AABNNA UFE0013743_00001.xml FULL
c4776d1393881dcb6b83c5d7d1da1fc9
64f1fc19b55f9f9bf0a162a18fd3b1acf8fa99b8
BROKEN_LINK
kearns_s_Page_01.tif
33563 F20110404_AABNMM kearns_s_Page_83.QC.jpg
f5b09f7907100e93d8f22265609b8a43
72494a12784d906d4f5c956705e0aaaa4e3ee1c8
45114 F20110404_AABNLX kearns_s_Page_71.jpg
a3b66f1b790e27e20778b84eaacc3857
c39961c3236949fb58c7d2b5189233884abb8cfb
13756 F20110404_AABNLY kearns_s_Page_73.QC.jpg
998fd41960cb67c5d1c81b59ad1721a6
9e640598c0a21b126d8045da09050b1514687df4
13914 F20110404_AABNMN kearns_s_Page_72.pro
2e8009e10ef071fa468685956c88e6f3
26768ef3f3df648d14737c1f8773f4cbe16e12a8
61838 F20110404_AABNLZ kearns_s_Page_62.jpg
50649e524f6114c0c9e0b7ce79e5fe0c
31a1d68b89eecde0575aeb6d2640c112077cd256
F20110404_AABNND kearns_s_Page_03.tif
38924e82bab66d10433cb366981bfc0b
7c89bc32186b0fb269a9c4236bd2b198d2aaf335
20809 F20110404_AABNMO kearns_s_Page_97.pro
95eec3cad0b5a1bc05306e0806755d3b
7379fba0680a4b03f6ab47f538c02a003ce32354
F20110404_AABNNE kearns_s_Page_04.tif
ea72663b05a33f9d3679115f19c94992
8ce16c7bc316c092f16a4544736090a6160fd050
F20110404_AABNMP kearns_s_Page_97.tif
5a513edfebf9dd25026534f8cf5eece8
4500042edad427abb637d4486636bb90753c11ea
F20110404_AABNNF kearns_s_Page_05.tif
79ba12b6a91d627f07d2daf274124049
7928d8f0454ff8c788a67f82065b46562bb51026
100123 F20110404_AABNMQ kearns_s_Page_14.jpg
150c337a56c28ba69d436335c7d0f083
10457f8e8f906b3219eb296660f99b889fd3fc92
F20110404_AABNNG kearns_s_Page_06.tif
4f4715a5f76f61d4862f2538bb50c6a5
4a67f640f1d4e05199fec353334f05a90d1c267b
F20110404_AABNMR kearns_s_Page_81.tif
fc77644a43b36f52e252bf2115760758
c0c1677404ced02dd26a6738ce56ca2c4a73308f
F20110404_AABNNH kearns_s_Page_09.tif
5ac9d748f47eba8075deb253eeae771d
f0e48de9c70486d43f7f6193571318af911cffca
49233 F20110404_AABNMS kearns_s_Page_23.pro
91e95b366f356c50bdbb5144fb271899
39c329d555fda70823460ae7e40fbd2291fb20e2
F20110404_AABNNI kearns_s_Page_10.tif
e4bcc19ca0485e136d061695d6a8acc5
fd1c723b6312f6e79e0369dbf7f444eb74d2388e
3415 F20110404_AABNMT kearns_s_Page_97thm.jpg
9426794d630c8525c888c8f47ce41117
19014b7cd4e13a304e7572ade27c7ae196bb1a9e
F20110404_AABNNJ kearns_s_Page_11.tif
dce1ae78f30006680a65df55187ed103
c67dc904ba6410847806fd9082b98d8d98aad8b7
1051923 F20110404_AABNMU kearns_s_Page_85.jp2
c9f6800ce09e7fa04b6f69e8bfc3f7b7
56ddc449586d5806ca95751b8a14232700b47f17
F20110404_AABNNK kearns_s_Page_14.tif
d32063733694f0204a6e020ee13b4864
6a4dbb2cffef3be867b0b267be531e1b136ca03c
F20110404_AABNMV kearns_s_Page_60.tif
74af2d8d1577246251b479c21ce89e79
bf9d46e39ecd4cf48c7e947bef826bd8dcd983df
F20110404_AABNNL kearns_s_Page_16.tif
cb5a204e1d26cb511a6f5e549b7ed5d9
0c3e5f2a6dc84009c0815e4284c414bf1196a698
609 F20110404_AABNMW kearns_s_Page_04.txt
7f2ed458900a50412e93a7bb2516f941
6ef216587c9136622080ef2b218891d1e79b703b
F20110404_AABNNM kearns_s_Page_17.tif
548a1ba7366e944e1a879500bca4ab1e
9f5ed1863775f79dda83576076bbe34b9f4482d2
101088 F20110404_AABNMX kearns_s_Page_24.jpg
f6d3fa0136d1776dbfbc7a76a825c9f0
18360c9b1eff89a00f079f9880b5425671487f4a
F20110404_AABNOA kearns_s_Page_36.tif
cf90292ac090fc2b445f52949b54c5c4
3d743c8c6afbb13dc08a53758ee9af5ccaa9f29b
F20110404_AABNNN kearns_s_Page_18.tif
e3a456fa155eeec2daf94ac173369403
c13958b78d0a06daa26b874d260ebb12f56696ba
56628 F20110404_AABNMY kearns_s_Page_95.pro
53ace581cef9e742605db60a1e136493
5d6d4961f3fed7f744dbeb142d5f1e7042368242
F20110404_AABNOB kearns_s_Page_40.tif
a591bc84f1fbe88083b2c5433ee86e98
5d9d5c96e88f8e12928d5577b6678d6ec8bcb56b
16878 F20110404_AABNMZ kearns_s_Page_62.pro
41899df023dc88ec37f932a0076a2e6c
c0e4545ff357731bde2bbddc5a94c9d7287eff38
F20110404_AABNOC kearns_s_Page_41.tif
d1161f529ad3c7c8255c6574b185d5d4
4db203bb8d7bf0068309e4ba97b8af4ace190226
F20110404_AABNNO kearns_s_Page_19.tif
c91d15f498d7f7e0f37a28f88e1db533
abadc55d237edd14223a2c8b6bddedd769f2e844
F20110404_AABNOD kearns_s_Page_42.tif
a0d32e5c7d45536c4e5d61c7eab88c62
1bb6ed13d7d798e15db46cf64ec087b9c1bb4907
F20110404_AABNNP kearns_s_Page_20.tif
294d8262f25a9d164462f37d6ca1be86
1c70d10d9c86ce2194894463139a9bf16045af4d
F20110404_AABNOE kearns_s_Page_44.tif
6c1f99a4e59aa3063b5042a43dfb6975
2bbe7e19cd9051004440ab07d0f69cb31ec864cd
F20110404_AABNNQ kearns_s_Page_21.tif
7a68980b0f975179f7f0bc151af9c179
214b77bc070f733a98a5d341f47bae573f170587
F20110404_AABNOF kearns_s_Page_45.tif
69ed6c9e6975096943be900afbddf080
ce499b5667fbc5eb3729328a54599e4e18f39702
F20110404_AABNNR kearns_s_Page_23.tif
c02a2ff2855e8216b14a0348cb233f02
d1a069b0ce32785da1f29058a5a4b5e778e202a0
F20110404_AABNOG kearns_s_Page_47.tif
7889554347f237b6de193fa163174647
ae1dd4db117826f6c09861b1bfd4078d4f744369
F20110404_AABNNS kearns_s_Page_24.tif
c4f4321f06ac87caace32c944db480e4
bed1b9207439ce20f83d34500cf0bed4a1cbf771
F20110404_AABNOH kearns_s_Page_48.tif
627503848e9408bc74b72cd0b40a3873
8d55fd169eaa55ef0e59f71bc242cee17087e063
F20110404_AABNNT kearns_s_Page_25.tif
1ab1f90de8c73882649c95f8d5a3ab0b
f5412e97453e981991f6b736a1bed575e8b95870
F20110404_AABNOI kearns_s_Page_50.tif
c1167851b8cd54ec59646d24f5b9da8d
c5a0ebb461388dc6b52ea5b5a0234bff51c25b3b
F20110404_AABNNU kearns_s_Page_27.tif
b459b22a6b94e26b212688cec59141bd
1ff70e790fc192c3d65597b32611276e5e5c2506
F20110404_AABNOJ kearns_s_Page_51.tif
39864f55a85a0c7f7f0903bd2c583c6e
f0fb6175d6082271afd1daa9809e140b02dd7788
F20110404_AABNNV kearns_s_Page_28.tif
a8581e5fed11b27b8f7a0cad113141d2
d73f6735d323ba9f41e6ef68f9da81bd975e74a8
F20110404_AABNOK kearns_s_Page_56.tif
1d794d4ec5d53b5780086fc2ee56a7c0
039a1d6e4d71dece7790b5de41b54ca00bb93354
F20110404_AABNNW kearns_s_Page_30.tif
8e601a04bc39417a4232f662d8c95331
aca97a9c7904dabb635dc131c772e950e70b68c8
F20110404_AABNOL kearns_s_Page_57.tif
406dd97e1dab6d607cd0165db4cbb6ee
56b5abe757b8b349e396a1540c5f931848695ddb
F20110404_AABNNX kearns_s_Page_31.tif
2a48112c02cf7459321358e23a4895ab
bbc2e31227ff6ef013bcaa16c86c025e18194dc2
F20110404_AABNPA kearns_s_Page_89.tif
2407f1f30e2e1cf6960ed4bc029c0ba9
3474e160d49bfc6ef9ab6b72efb66ff454ab8037
F20110404_AABNOM kearns_s_Page_58.tif
872622bd3a7dd81c55d811db6c0e0add
39906c8aedf0bcd6cdf203e0992388d33745aa8c
F20110404_AABNNY kearns_s_Page_34.tif
dc927fb3338cb2358d2670cfb2c2a4c3
ecfe0bc9ebba6f7de5f5e97aee419b77ba1d182c
F20110404_AABNPB kearns_s_Page_90.tif
0f616af52770b36eeade14df68fb66cf
2ecd38313aea3f0af789a8cf18c1c9114411b194
F20110404_AABNON kearns_s_Page_61.tif
cd3bd0b960c6159ed8668a5b954c776a
6c8eba060406548b186e22bc94a77acfd454ee38
F20110404_AABNPC kearns_s_Page_92.tif
efabe604ab22a9036abd27cfcfb1f8d5
2ca5038f3d8ff9da714b56c9b4c2b441df3bc987
F20110404_AABNOO kearns_s_Page_63.tif
959616f6a1cd512e5ab3215d235125eb
5d65f97bd661ad5410c5e4e6445a8c51fa4945c9
F20110404_AABNNZ kearns_s_Page_35.tif
3238a64ee7ec6b7b1e57183627a0079a
b0856102d729bc2c559b91ed4606884549b48721
F20110404_AABNPD kearns_s_Page_93.tif
aed87a1c0bb95ef8758f03913bf2d81d
9e41d6b77c67e64ba0e36c2f5bf2fd6cf2886553
F20110404_AABNPE kearns_s_Page_94.tif
59d03a764742c810b09b304a99914498
f25976fac2ad8b5d03843b1cc3aab4e326453e3c
F20110404_AABNOP kearns_s_Page_64.tif
d34a8b0d2066c37a00a01def00aacc36
daa5afd35b29847c639d68b4e55486080c66c550
F20110404_AABNPF kearns_s_Page_96.tif
26afb912fa1302bb664c8bb8c2591855
c0510af32bc351b6b36ba8e895d512f4798fbc10
F20110404_AABNOQ kearns_s_Page_65.tif
a9ae367bbba982dddf245a3835a34288
b1d7096a7eaff2dc0d856dd5a4711eab699e433f
F20110404_AABNPG kearns_s_Page_98.tif
1d6d4b3eecb3fc65aa72f22026b3f214
e4efda58c92f47e43ec7e19f9451baca9d99c2ea
F20110404_AABNOR kearns_s_Page_68.tif
38ab7ccbce1e950c4f0875cda1cec390
af37e32ec63c36d1022385ed93643f65fe48948a
99 F20110404_AABNPH kearns_s_Page_02.txt
c1a868943a70f89f3d60aa46b8a8c97c
71f16e679d26617e9a6cb44d32c3a51d5f552388
F20110404_AABNOS kearns_s_Page_71.tif
09624fcb00aad8e0e63246f9401d10a6
80f1d259e3140a30c14e98887e19818639d4a54d
3243 F20110404_AABNPI kearns_s_Page_05.txt
8c979060ef99ea1240f9399567ee766f
44648892e63a54dadb9489bdcb40fa7c7cf34a86
F20110404_AABNOT kearns_s_Page_72.tif
de1bc392e119f2620bc3d376b1209326
a2e773a31afae59d3695617347eb8053c86cc7b2
3140 F20110404_AABNPJ kearns_s_Page_06.txt
57464b1490bb46bfeeb2105bf9b31ecd
7f17f4cd3d223cd1f622e0669a1f0d66017f475a
F20110404_AABNOU kearns_s_Page_75.tif
abbb550ff533767578d419f2239de694
f7196f925b30d46dcae8d339dbf2c671ec4a86ec
2233 F20110404_AABNPK kearns_s_Page_07.txt
34b9aaf356237c39d2c71529ffee1d80
c6c95ac8e9243f706652077c8646eb22e697096a
F20110404_AABNOV kearns_s_Page_76.tif
7c0c26273ac6ebb92f89dd7dfc0ea82b
f1f56ad456a24219c094f2dbf48a3de35130e255
1214 F20110404_AABNPL kearns_s_Page_08.txt
206c32891814022892f0da03eddfb884
794b7364242189f4427a0c621f025dab66ebf876
F20110404_AABNOW kearns_s_Page_80.tif
f1d34e59b6117922cde48fc142e76eb2
c5b9f9ad3a8e481b8a771bb1c344d5673a83ea3d
1086 F20110404_AABNPM kearns_s_Page_10.txt
81578ca07bdc5853e0d2c5953173c3c9
e067c7dd57a903a4f43bdfd182a63549773b19d4
F20110404_AABNOX kearns_s_Page_84.tif
c847f59d41e02c840705f8ecd97015a1
20227dca687f6a50ddbe2c938e2fe20b912bd752
1916 F20110404_AABNQA kearns_s_Page_38.txt
60d2880386515d18773d7ed0c96cdc61
1380ec82a0310152cb17554a10f8190fa3e7830c
1997 F20110404_AABNPN kearns_s_Page_14.txt
31ec3ecbb6f8518e84a7587b9408045a
4cf13b641a0aed7a93ed5bdd813c81cb21b95ec2
F20110404_AABNOY kearns_s_Page_86.tif
19a136851ff4c86928e3eb8ed3e5a360
ea91ae80fcf66265f00830b9f23eb8369298770e
1808 F20110404_AABNQB kearns_s_Page_41.txt
93fd2e9591978fc06d066c25ae3ac729
0e3c8d69180f220b54f8efe871f7e7a24bff5a15
F20110404_AABNPO kearns_s_Page_17.txt
4301736f38e2e307a3087c7d106e18d1
2ee189d4daefe48cab681b853dde4bb6b655d4fe
F20110404_AABNOZ kearns_s_Page_87.tif
a71e3f1a4840d1f71e1af44dff455014
b9e6e7b59313338a9fd9445cc219010e0dabcf5c
2032 F20110404_AABNQC kearns_s_Page_43.txt
ee9ac69d2b27c240ee2fc8450c809b86
e736d7b8b26dd0d5439c8865b5c1501f06179963
1998 F20110404_AABNPP kearns_s_Page_18.txt
298bc20d7ecd0fa3ccf627347a046d70
a02cd06d5bca03f123a9bc52f65127eb2781eea2
1966 F20110404_AABNQD kearns_s_Page_44.txt
4ecd1a193139c9d714b645f080ff819c
385a4215d2599897003a6eabfe9f6aa955832836
1996 F20110404_AABNQE kearns_s_Page_45.txt
44d208480499bbe5c4e9a91c571f027a
3c47f1d7111e222703ad4c0179975f10000def8b
2023 F20110404_AABNPQ kearns_s_Page_21.txt
d0c2b78c054313fdfe6f91526ae18fcc
7c635e30d844040dfba817b71ee7efce3b02cc4f
1870 F20110404_AABNQF kearns_s_Page_46.txt
f875ecf2ed3e0b0879a9d48c4bae68dc
28b69d85a155930bf5fa7e551972338da01987cf
2038 F20110404_AABNPR kearns_s_Page_22.txt
65c3fb52ddf6ebc8fbf8d46b4fb00939
d907ec9ff175dd9d37f0d7e226949fbeb83d844d
2042 F20110404_AABNQG kearns_s_Page_47.txt
54813b894db4a025d6d08760e2d9cd38
c00588f3aa81747996e71ab7c080a2d8f75205f3
1975 F20110404_AABNPS kearns_s_Page_24.txt
56a802e9aed3dad85ab5b6d3db40e00b
b633774e06d2d8be83bc95ed961dfe5d8a620d62
1887 F20110404_AABNQH kearns_s_Page_49.txt
a87839579ae082a44e6e748b2ce4d3c4
8a2a483e8062366d6d13153fa39ededf59812dce
1978 F20110404_AABNPT kearns_s_Page_25.txt
10a17b57b0f546eb88353330cd5d2f62
44deb0cc10cc6fd6551f8cb2e0b3d496522a5242
F20110404_AABNQI kearns_s_Page_54.txt
a6ef754d4f9dc4d8e50cc37087eaa0e1
86ec0a4b3f98bbc30e46470d8a4ab38187b7331a
1960 F20110404_AABNPU kearns_s_Page_28.txt
bd59b37252e1651e08025569dabfb908
1feae3dc8d8cbc71abecafa7ef13b0654f855d6a
803 F20110404_AABNQJ kearns_s_Page_55.txt
7ba8c0d6d37c89cd0aad4159bd72c1fa
6733a816b96afe56681f2dc13d0747ade458f847
2085 F20110404_AABNPV kearns_s_Page_30.txt
15400c86783b0d18f8692b23a5781de7
31efac88724fcc374b1e61a31f57f4c210b4466d
605 F20110404_AABNQK kearns_s_Page_56.txt
650452ab71d393901c7166b170974e91
3d067e730694952dc27d00f92df1daf461ad6bde
1691 F20110404_AABNPW kearns_s_Page_32.txt
70e00b08b1f6e51910eb25050f1a114d
eb419f6620b86ac214d20a025e3bc91ca1996949
306 F20110404_AABNQL kearns_s_Page_58.txt
87a23f71fa89d3402bbbc6e90ccc7819
032c031740f6a82235b13c21e89a79daeb02142a
2007 F20110404_AABNPX kearns_s_Page_33.txt
196a1f8932c00bd6b3bf054cb0481ac7
93968fc5d6dbfee2d5d5979e7546a0bd60d12518
2053 F20110404_AABNRA kearns_s_Page_87.txt
819ee55196b9669f74ae4a598a3adb85
7eebc67b04b8437e128b5b8173a4dde76f84d681
492 F20110404_AABNQM kearns_s_Page_59.txt
65fe0b4389ad22aa8df2e7bd92bc45ae
21528a94476afacce2e0b821756aba26c1dd6b73
1703 F20110404_AABNPY kearns_s_Page_34.txt
7834930a18785331087660e5e1d2e0b4
c665e70e368e235d7121550e5a83fda7124a50b5
F20110404_AABNRB kearns_s_Page_88.txt
2f06f0efbfe5f0cdfc2e58ec8365f0bb
1d79621a392fdec0b7bffe136e9cb2b3970992a9
749 F20110404_AABNQN kearns_s_Page_62.txt
a2824e00a81330f1ca1756ad9f7aada4
23ef92fcf7f43a5e0250a5402bd5977c2135a4a6
1856 F20110404_AABNPZ kearns_s_Page_37.txt
8f56e5b499d96a39fe044f9e23bc41a6
ab88eaa34149a49c14464e92d1b3638bafdf944b
2421 F20110404_AABNRC kearns_s_Page_89.txt
6fbc2b5c8380a3b93e39023405721972
926939209b9b03d312771bed05bdd4852054341f
F20110404_AABNQO kearns_s_Page_63.txt
a6b6283547a2ee2b10370525edf164da
b449128a03a813a5614d7f2393d92c65c0772f8e
2325 F20110404_AABNRD kearns_s_Page_90.txt
1278ee4c15dde3a20c6706f1a3937475
ab47d62ca3d884518e1c8657a44c61926a04bc39
333 F20110404_AABNQP kearns_s_Page_65.txt
e0efdcfe4477caadd526bb53c8222496
06dd91cc6f4910ed1b0fb245f7866409bc608132
2102 F20110404_AABNRE kearns_s_Page_93.txt
50d9c82f0eb85506db8642952d3bf3e4
07bcf2b892f3baca7020f6363fc053e1877969de
850 F20110404_AABNQQ kearns_s_Page_67.txt
c3b9204cc25e220b51a6ad854de65dd7
27bb95cc41160c686939cf1e56984abcf120fcf2
2550 F20110404_AABNRF kearns_s_Page_94.txt
39dcc7c7899f52abb7f5ffb1487a8df4
219c9f3f2d894219a39ccaf86ad66295880f6629
2364 F20110404_AABNRG kearns_s_Page_95.txt
bda05c1525762d178251eb59ee7827c6
8d57900746b7586d8189be092ed40eb9992bd32c
611 F20110404_AABNQR kearns_s_Page_69.txt
978c018b74a1ae53ea4c5211dc7162f1
00c46d3c9ba88e9f228f570518ae450fcd313310
9993 F20110404_AABNRH kearns_s_Page_01.pro
6835573297b6bd14afb28ece19d6e2c9
cfa6ff373449dda2fd98fa4e762e82b7b3bd4c26
652 F20110404_AABNQS kearns_s_Page_73.txt
fa2a5bad86ef6f1cb6a95b9507bbb57f
cd75c89fbf0eb31b1a0b55f058f4b46843efff7e
1147 F20110404_AABNRI kearns_s_Page_02.pro
1f7eb325d126240c42dc8a994622b36e
ef128577062bd1d025f1b2f269e4406003a60787
F20110404_AABNQT kearns_s_Page_74.txt
2092b5b1a38ac1a725addd9c734b7fef
3a2ba653535d5ba05f61b2d2a970a503ca98b587
14129 F20110404_AABNRJ kearns_s_Page_04.pro
827d196330bb058e9ed9196f6db1d305
6811a5f9917765547dd1d3dddcfe185aed08a18a
385 F20110404_AABNQU kearns_s_Page_76.txt
6cf8afebcc0cbdc0f704b90953e42395
89b220173fccf218d9dcdd2c65bebbe8d775624e
77209 F20110404_AABNRK kearns_s_Page_05.pro
da5749d2170c752a4ada6c06b97e05b7
0eabeb22cea171c85695f67baf3af1bc0523c9fa
F20110404_AABNQV kearns_s_Page_79.txt
d4a2e802433e757a1d6818a422aafa25
ffa6b3ee9e7b50c2eafc599afa4f08466a754d82
75961 F20110404_AABNRL kearns_s_Page_06.pro
42bbac485e2bc1e3e15e7310a4a4f62c
e3e6fd19814ab7d14c64d5462d1321d696b25100
2093 F20110404_AABNQW kearns_s_Page_80.txt
37610ed1673047217056ccec6e08594c
33e1f1e16619fea98a4abc81199b4b391f21d001
6433 F20110404_AABNSA kearns_s_Page_31.pro
4dad6712ba0122cd6e0c1da2d49a916e
d7a23a562e4be94a2fb0a717f433313436b2c9ee
30525 F20110404_AABNRM kearns_s_Page_08.pro
30a95fc35c1bbeccdca659a1bfae7b5e
3a54eefaeffec0a299cfbd46a27cfb247aea16ba
1985 F20110404_AABNQX kearns_s_Page_81.txt
d751ba8ee722bc283ede08bc4f913c07
b6fdbdd9055e02c74b46b674272aa9027d4f45e1
40722 F20110404_AABNSB kearns_s_Page_32.pro
d0719d7a96d2aa9a588b29f015dcecb3
94ab0069ab111c75b87b71d2213b805dcff7dd72
38639 F20110404_AABNRN kearns_s_Page_09.pro
35a175bbf68388b8a85b3ac9b4b03a47
afe1dc953f1dd7aebf35b4fdb5c7aa0ef4cc0b56
2010 F20110404_AABNQY kearns_s_Page_83.txt
f4c9bff1c559c3b76333c1a891377bc2
4a891003a3dc264ed5075a7b521b745c8c4307a8
51124 F20110404_AABNSC kearns_s_Page_33.pro
26fee765aa4e0aeed62744f67f82eec9
9959b4b9510d13ee1f723a8ee7577110580d7e23
F20110404_AABNRO kearns_s_Page_10.pro
9c32c6af5b80d2843e061d625b7f25a8
f2aa359ec2a58ba1855cecb05a2cb81f773efac3
F20110404_AABNQZ kearns_s_Page_85.txt
955e65388a3b90794de6d37e9f2a01e6
34f1aa4bec2479b0f2e83b9e2d6725b0a13ed9db
42981 F20110404_AABNSD kearns_s_Page_34.pro
17c36614bbcfa3ed3628d58bf90bd455
2e2aababead6f9af1ee37f4abb8c5c5768aa2e57
44935 F20110404_AABNRP kearns_s_Page_11.pro
438f10fa4c138fddcd0b7443255cdee6
5b63bc3c37bbd87f441add602090922abcf0dc65
46556 F20110404_AABNSE kearns_s_Page_35.pro
99834cafdd7b208373da07112ab2b785
099f0bf03a64d012bda892b03498f86e8e26f313
53159 F20110404_AABNRQ kearns_s_Page_12.pro
9060ecc76c0a90796694b0ef1c8e64a5
0e713aa806b3d1d6607545ddb7a6611f75b550ab
46893 F20110404_AABNSF kearns_s_Page_37.pro
e5c2aef821f7b73282e144b128f7c8ac
cad7ca1b602e5a6da5e575c5702643b9082665d7
51207 F20110404_AABNRR kearns_s_Page_13.pro
9bcbea075dd908f8105051c42f06710c
94e0be6477fc03e9693fd65b30554930a9690b8f
48215 F20110404_AABNSG kearns_s_Page_38.pro
5fe2d090387dc7a0b94f2f01fb7bfa66
3ab4b4bcb208fc3b681a6564c415c56f0153cc07
45601 F20110404_AABNSH kearns_s_Page_39.pro
aa0cfa14f31e08ee89b09dd15f368b1d
54b40d6d66e86c1d65b499f73614072d02149c9d
52280 F20110404_AABNRS kearns_s_Page_15.pro
ea32b89e41046852a545a72916f72e3b
24d0ccb19c04fda8c28183095d2bbe214c1dba5d
43697 F20110404_AABNSI kearns_s_Page_41.pro
4617acc157377c33ab791fc170d01a91
d4caf15528b301fd60b425fbce82e33b5a83ff97
52994 F20110404_AABNRT kearns_s_Page_17.pro
0163283fc8598e2f8914ac2446c7aeb6
0438dcac86ece0e5f82673eaebe08965fb57c83a
F20110404_AABNSJ kearns_s_Page_44.pro
3322629989f59a9324e5adf12c9e912b
487e3555f549d2f623a4c97c976198ebd49f21cf
41912 F20110404_AABNRU kearns_s_Page_19.pro
6277c1119a2aa87847ca75c97ab61683
1e160f14fc12ff4ead563aa22e35eb2ccd9db8b6
50719 F20110404_AABNSK kearns_s_Page_45.pro
6ca1fef06e59ee9f0d38d50de2ed197d
c562f0954c44797eaaea00fd35b78990a24ba5ed
50253 F20110404_AABNRV kearns_s_Page_20.pro
786bad0d16cb5748c0855d7269843028
6307b26634ffb6b2a92ce8e0ee965405dd8cdaa0
46618 F20110404_AABNSL kearns_s_Page_46.pro
1d9af538ded37c6d227a3b201e392d0d
baf5f48ffb0bb1c5e362c0868157737912c992d1
49463 F20110404_AABNRW kearns_s_Page_24.pro
e2f43dc9024d283f6409df111da38cac
714fbba8b4fc0c68caf2cc0366c0071dcce9138c
18424 F20110404_AABNSM kearns_s_Page_55.pro
5792492b80f24d37948872ae59c727f0
6422b456b44e939d42bc58241da638c07af14444
51958 F20110404_AABNRX kearns_s_Page_26.pro
2edfafd342aaf9a6b0adb7357cb99d83
8a9dc3ea9a0a174ab52f8aa08258bdce8eba76c7
30797 F20110404_AABNTA kearns_s_Page_86.pro
47734ba0fd1a232fcefb8d3466202ae7
688e5ac19698e1c63adf6cdef822a40066c51bb2
13227 F20110404_AABNSN kearns_s_Page_56.pro
fede54f9ff1fca2bb605958c5cce824a
c8fdad9fa8664f1495c3cdc6ce6e98de5c145a22
52455 F20110404_AABNRY kearns_s_Page_27.pro
5a6121b67ad541f837ea36fa96ca30b1
eca34943dbe7e8e4241f59b928a309c2c12659e6
56288 F20110404_AABNTB kearns_s_Page_90.pro
c3379735aaecdafce25365d20e0b25de
58c020b33f2a8456db93d16e623cbc096701f76b
9521 F20110404_AABNSO kearns_s_Page_63.pro
b054bd538dd93e65f8ccfedc5da38575
5bda248e22268d58aff65aee742cc8c14ba83ca8
49665 F20110404_AABNRZ kearns_s_Page_29.pro
9474bff851026e18576456e439e11255
41de5e388e6e7176d532811e8bae219d7dfd8c4b
55076 F20110404_AABNTC kearns_s_Page_91.pro
242bfcf317b72a7c92eb5b75b058ee3e
566f17bc8ef3a7f07ee62f85ae21f06191cce411
12087 F20110404_AABNSP kearns_s_Page_67.pro
f9491d07309d1b0153543f09a99b43de
e0037a18d2c58ad87cece859d11b165541368196
58986 F20110404_AABNTD kearns_s_Page_92.pro
3863e719245ebdfaeca94eee8f75b4d0
e35ae5303acbab12ef7f0da44e3e23eecb4cf238
6960 F20110404_AABNSQ kearns_s_Page_68.pro
fbe96dddd21388efbd55ed4ce5f838dc
ba4ae59f27551f793e5941a0f7390bf346c5dcbb
50308 F20110404_AABNTE kearns_s_Page_93.pro
5964b3848cd7d9c17a46e1733d5cf033
dc7ada83d5ab20c86bea7a2392538a7b59038a43
13807 F20110404_AABNSR kearns_s_Page_70.pro
2094686223039667e0cd908b137a18f7
d8169f2610eecd765cf766a209138dfa5d0cef52
59715 F20110404_AABNTF kearns_s_Page_96.pro
bb449a43930a8023132752647cd2c2ea
2ed6de0df9bcab60cdf9f1df76ad696a3be0e391
8795 F20110404_AABNSS kearns_s_Page_71.pro
67e64f4a3d9777944905aae9e574c380
596e57fdfe82160c8c09466553dcb473ce3a36ed
23201 F20110404_AABNTG kearns_s_Page_98.pro
bd540fd76cfbb704ace75680621b4246
2b8a50736fb30e9accade333f3b94c04cbf1b188
4676 F20110404_AABNTH kearns_s_Page_02.jpg
3805ba50159da18b271b7201d38523b9
5bc28aa6c2d3a44c541944fcfc887ddfc968dc38
45504 F20110404_AABNST kearns_s_Page_77.pro
ae938c02931b072eeecce38839318562
a1f5499db944752f3e82c12f9f147b70545d3484
2315 F20110404_AABNTI kearns_s_Page_03.QC.jpg
9a9749a2a26dac6dd545bd64c9c304dd
0dc3d5d7b6df54e43cc33abb2a80c71be4f62e76
52430 F20110404_AABNSU kearns_s_Page_78.pro
03b24a2d36c8bb83cf5a229f6b3a5693
4885a04aca3a86678780994f7c6b181953e4b64c
32020 F20110404_AABNTJ kearns_s_Page_04.jpg
fa9b640ad2673ba359ae0fcaf9095fb4
89877fd4e5b3021cd6b9e5706bf912935dd46769
50423 F20110404_AABNSV kearns_s_Page_81.pro
2aebf52c0b6d3a4463425a6466149262
ea70605e30947cf46cb27fe4cd9d32b5f42e0c44
10902 F20110404_AABNTK kearns_s_Page_04.QC.jpg
0dbe271bd2759064dd3153894c71b16d
3e47f4c0d0466fb835aa786bc5aa3c7d968e692a
88228 F20110404_AABNTL kearns_s_Page_06.jpg
d3077702536f9ced8f1338fe4629723e
ee49e9d9c379d4b550a37ce2e473d022034e7a29
48817 F20110404_AABNSW kearns_s_Page_82.pro
d753f2e891a07da0001c03d1896d0405
a143cd10917a13d9a2122c03b0ceac4122326be4
33567 F20110404_AABNUA kearns_s_Page_25.QC.jpg
f8e20449041b33969dc7388f8adfde5a
656e03550a473f973d486052ae19b6ecef28e515
46010 F20110404_AABNTM kearns_s_Page_08.jpg
3d314b4204b1c556a6bed2b2465bc60d
6f96a0e1b946138cf07f750e3af31f03c96a1723
50887 F20110404_AABNSX kearns_s_Page_83.pro
e177f93aa9b4beb3555e0a12aa57facf
c3ee6a17527403d4d62eb675ed0790026d2f53a0
33616 F20110404_AABNUB kearns_s_Page_29.QC.jpg
45d1b40844e384cc1df232cb50db56e1
960047fb7dd13706df1cb8d193519ae0a8de1eb9
13349 F20110404_AABNTN kearns_s_Page_08.QC.jpg
0c4f93e63eafddbb18fcd1b32a47a4d1
59ca2725dfd2f50eba6c1b37184cd79b72db3799
50448 F20110404_AABNSY kearns_s_Page_84.pro
7998e74d6479caae108dbcf6823b3f98
09292c24cf7a4483a45b311fd326e4c8780aa9a5
106280 F20110404_AABNUC kearns_s_Page_30.jpg
93dfae5510ff52aece1855a2a650ce5b
c9fc676e69157e89b215f634ab3961394639d4e0
83477 F20110404_AABNTO kearns_s_Page_09.jpg
87df050c1de566a95be2038900cb4c32
673aef3151fd9a7ee126080bcf2ed32cf628217b
48513 F20110404_AABNSZ kearns_s_Page_85.pro
6e9946c3ce0879628c7b98b80d5eec58
9e12da751c33284bd704bd1b254b7405cfa54e62
34636 F20110404_AABNUD kearns_s_Page_30.QC.jpg
a9e2b1644ce17ce013ddd3b22f3b8d46
e7617e870ffa2cae64030e865da49e34336d62ce
55882 F20110404_AABNTP kearns_s_Page_10.jpg
9dd9b1a0fcf971b344b04e197d9ac3ab
662d692fcf610159e4b5134ae2af5b0b5cde8ac6
87605 F20110404_AABNUE kearns_s_Page_32.jpg
b6744e307749d8ca62a77505c6166595
6fa996039b891e8082b3196d3c843180dca0479c
18385 F20110404_AABNTQ kearns_s_Page_10.QC.jpg
2940e9356cb8592de0773ce290b4742d
84ee0c963c1f1575533addabbdfc35194ff8525a
36065 F20110404_AABNUF kearns_s_Page_33.QC.jpg
788f8209fa7c8a3903dc1f8d8c320b7b
701d38f528715e086891a22141dc1d34253e278b
28910 F20110404_AABNTR kearns_s_Page_11.QC.jpg
2e2fcb9511516ecb7349af9a9bb839d7
c801d8249874f6e3ce7bb8ebdc8e7a0532310be6
29157 F20110404_AABNUG kearns_s_Page_34.QC.jpg
6bb306bf8869fd54695078ac61abdc93
42df1aabb72378b7942fec532f6ce99ba68a9efd
105183 F20110404_AABNTS kearns_s_Page_12.jpg
51a44401375bea286ddd8a55be873e72
eaf83016c5f3a1e4973ffaba7e71c294f054979f
F20110404_AABOAA kearns_s_Page_83thm.jpg
62008224f63bb71ebe1dd61b2b1a8485
20298dfb2f1140f4f29eb3bc1654668e433bea70
97102 F20110404_AABNUH kearns_s_Page_35.jpg
91464dc9a9982eb7c2d38ce5e449c895
c19e3da52690d696abf26df181db8f9037982fd9
34553 F20110404_AABNTT kearns_s_Page_12.QC.jpg
fb34b0072ed63b1ca3dd1052e303a974
e74079a2cd6c90d82251a08a6c7072e1a454246a
8027 F20110404_AABOAB kearns_s_Page_85thm.jpg
e783e7a03acc356a993b9971cfec67b8
844a6ebcfe690c02a4466f3be0e78493f33401bd
98728 F20110404_AABNUI kearns_s_Page_37.jpg
c3cf0216abe9cfa1da888045c13f71b1
d6a6b97b3f8e2d81c4866f48a4db8bfae68b5842
7241 F20110404_AABOAC kearns_s_Page_87thm.jpg
afd85c77c1b242644f4fdbf91606b12d
e9e080695811942496e6fbf27adfb1e05cfcec82
22073 F20110404_AABNUJ kearns_s_Page_40.QC.jpg
f0ae640370d37c76f7f4f05c200137cb
69727c2e796cec0eb03985446aab2e9b3b3a94da
32962 F20110404_AABNTU kearns_s_Page_14.QC.jpg
27d314f64e8bf63bbab1734e34152f1c
5da44c543cef023e842c4dbc257a0ce72fa1b541
8670 F20110404_AABOAD kearns_s_Page_88thm.jpg
bed963a31e50bae8b2529a6b05ee1a00
fd271f07f255c429f5d9d9ccaddc690a5358f54e
89395 F20110404_AABNUK kearns_s_Page_41.jpg
c72e8b1aa19ffe48f18396107739cf0d
aa21a58f061ce4322d9650852b6c3a7b8c8c7081
102994 F20110404_AABNTV kearns_s_Page_18.jpg
2d56d2c30177557207be4f4f281fbc64
c59a4a8533f15abdd1023a4fa3c3fbd39ac5aae2
8600 F20110404_AABOAE kearns_s_Page_89thm.jpg
c66420ca350d26292e4d5d2bac570672
87e5d30070b1bc08b0096b106e60c3a489ed406c
93665 F20110404_AABNUL kearns_s_Page_42.jpg
c08e9f9f179a391460b512f0c967e093
9ec39207c7baf0432f859e870ef25ee34eab3221
27384 F20110404_AABNTW kearns_s_Page_19.QC.jpg
b3240ec0eca7a6903dc766d531191665
fba0b4af0434b47f190e3b1a315d59628daa8358
8007 F20110404_AABOAF kearns_s_Page_91thm.jpg
4b25374bf036c70eb7983ba83dfc82b7
10344f0f2e451efc7a158e465257d533572ae960
104704 F20110404_AABNUM kearns_s_Page_43.jpg
59992f27cfd08a5484d63d1dedc4f2a9
592d6e771b556b26b152ffa50ea923dad514cb2b
105253 F20110404_AABNTX kearns_s_Page_22.jpg
051f46f667bc84b2837ad7720d90aa7d
558872110f81a49109ca6534ca8baadc3bceccb6
8353 F20110404_AABOAG kearns_s_Page_92thm.jpg
d22fe85d81a648d413ed1a658497c121
bd08cf0573f53095a81c11cfb66c11a5affd5e37
46749 F20110404_AABNVA kearns_s_Page_60.jpg
e474ee6c6efa50cb7b969ada2103525a
a4c1af84a2760f2cae1f4c05a96601d20c12c88d
33012 F20110404_AABNUN kearns_s_Page_44.QC.jpg
721b7dc0d93591d78e7499add8dcdc05
782c9fe4960ae0fd284278863869f119c1ff5b95
100902 F20110404_AABNTY kearns_s_Page_23.jpg
8730cf7052ef79ae83d280dbb48ab08f
28d16494aec7f769b118086b2f620d853145ad42
8435 F20110404_AABOAH kearns_s_Page_94thm.jpg
b899bf82044e4c85a82ff86ab244710d
363a865c12f930471baa32ceb3abcd1d91edbf0f
18551 F20110404_AABNVB kearns_s_Page_62.QC.jpg
5bd10e45655131b6d8e0a012a6f76e72
954e815f0a3f5ca74f88a690be6b334593e615db
32796 F20110404_AABNUO kearns_s_Page_45.QC.jpg
15e42eca17a3729069ef0c86b315b088
2911ea9598b9842f24cd4a4cf15a8eabe7dd2bc1
33339 F20110404_AABNTZ kearns_s_Page_24.QC.jpg
7a667ca69e8bdac3220c92e63fe7964c
fa601f13a9fa02833f2ac193dd2fe1a599880b6c
7836 F20110404_AABOAI kearns_s_Page_95thm.jpg
4e2981e9ac230bd6e0f834f5a788b76b
706fd071e0d604a28dca2db48562788275dccb7a
45939 F20110404_AABNVC kearns_s_Page_63.jpg
455fd871a8fb627537c001e2d52183b3
7930fc4c6dcc165f6c207093e7cfb8fb7aeff072
94322 F20110404_AABNUP kearns_s_Page_46.jpg
8036a74e56b475b9ef9d352d55f9d643
77e4b28a45b6000ca6fcf6082acdc6647e41a6bd
2516988 F20110404_AABOAJ kearns_s.pdf
ab87a216c72b5325b35f6721f5084068
c9f58f9cd5b280b07716993300947ab6dd8ec880
67867 F20110404_AABNVD kearns_s_Page_65.jpg
c9c37e13466855a86134cb43d40e3253
f7143a0e90025ca6f7e15fa900e29e2a96b77a37
30929 F20110404_AABNUQ kearns_s_Page_46.QC.jpg
529209d3354bea2a4c14ad2eb19f6d74
557da6e592c4c6b2f81d6ad7653c11a41146bc34
116296 F20110404_AABOAK UFE0013743_00001.mets
efdfbacfe1c58937744fea79c4a10f2e
3f14b665ab7fdc6cb0715a426da81ad380138eda
kearns_s_Page_01.tif
20320 F20110404_AABNVE kearns_s_Page_65.QC.jpg
b76518509f2b8603250b068537624fd1
50fcdb8ad085e4ac5561af299d3ce65c1514a17c
104912 F20110404_AABNUR kearns_s_Page_47.jpg
cfff77c1e870d3e8c614f25b3f083ccf
065394a64b69e439e9bbb82fabc068f28d8ee6f4
109462 F20110404_AABNVF kearns_s_Page_67.jpg
6592807437d4fc6b371f1bb2dfa71c7f
b6a6675767a7f8d4767fb827b40e4d09af5f4bdf
34043 F20110404_AABNUS kearns_s_Page_47.QC.jpg
8f2c6685e08ee11b445383dfab8707b2
156a7d22a7001a65baca6ec1bbab443aa290fab0
34136 F20110404_AABNVG kearns_s_Page_67.QC.jpg
fbe158046f7a8057b53a9f43cf9dbf9c
40a2d590e6236343ac19bfc414f542204b04b109
103003 F20110404_AABNUT kearns_s_Page_48.jpg
bdaf33d9dbfca6f5dd6e0edebb277978
70ebd9f2eb4e7d598ad6ae73cd88c2c8584921aa
37138 F20110404_AABNVH kearns_s_Page_68.jpg
14ee73bc0322f39caea6e22275d16233
f7550da9cac5aee0c92a58ac0cd27fee54ffbf59
34193 F20110404_AABNUU kearns_s_Page_48.QC.jpg
4e37324109dfe29cb3943840443c49b2
0158c0b72acef5a29143174ce9288823e14abfef
52774 F20110404_AABNVI kearns_s_Page_69.jpg
cb4c0973897ac921155b58568f522359
d83929245825dcda9cbad612def5c04eaedbe3b9
16482 F20110404_AABNVJ kearns_s_Page_69.QC.jpg
735e17e591bb62fe5730f3ff67d3c71a
a5c0c1b250820f66843744e09195bcb169d90c4d
32490 F20110404_AABNUV kearns_s_Page_49.QC.jpg
c91e4e157322e0713f2250a7194ddfc5
7d149b8d108aa777b60a690d9b7f3afcca8ee3fe
21677 F20110404_AABNVK kearns_s_Page_70.QC.jpg
7245d36f387aa632d226f4eba65d4861
34204883f291535f08f419bc541de16bac49a54a
56470 F20110404_AABNUW kearns_s_Page_51.jpg
d6c143b53913bb3aa06188c2a9cc0ca2
8941a8b51cdc6d0e17ebbc3f61ca9ddbfbcc3c15
50407 F20110404_AABNVL kearns_s_Page_72.jpg
a43dcbfafdec81f26de52604d2b8ae69
e15f562ca1fdd192e53e648404965e5b81458935
66926 F20110404_AABNUX kearns_s_Page_57.jpg
a197fe443cf3ac59998f3391e749c375
9c3f36f260e284bfb775896d6168d2d3d0b6b3c9
119968 F20110404_AABNWA kearns_s_Page_89.jpg
f87c2165f020396aeb3d0d3b19f70046
a9c5281905950d2162c4670db821c5884a394c39
45808 F20110404_AABNVM kearns_s_Page_75.jpg
942e6c7a904e0d7d6dd5f60de647fde7
0cb5d7d8cbf87d78ded886985514d540fba84632
19351 F20110404_AABNUY kearns_s_Page_57.QC.jpg
a3d81b75c65ec89ab16d25aa1d8bc920
9767cda8ed9a2cae4fc311246eb42ae1dba924f2
33672 F20110404_AABNWB kearns_s_Page_89.QC.jpg
c2622c2081715497222b8d2599f08e8a
b275e5fcdc34819eab53026e76246b103e595ebf
15617 F20110404_AABNVN kearns_s_Page_75.QC.jpg
cd456e5de173e683c8b692d0e2d70ebf
f75d408a08b55c098e1af3b56d81c029070ef90b
13225 F20110404_AABNUZ kearns_s_Page_59.QC.jpg
17668e94712e59c8aa2e8f1e8fca719f
1c7fad3145af414c0e0396efa4ffd137db48da71
32965 F20110404_AABNWC kearns_s_Page_90.QC.jpg
c13747313e91bb846edbe2381bf93ac1
97888c139af5591c56dd96923c1a4b6f7723e05f
23715 F20110404_AABNVO kearns_s_Page_76.QC.jpg
2a5195ee54abb632f7610c9560b5e708
83d87581e914257d4bdc34e245171f6fa33baa2f
113885 F20110404_AABNWD kearns_s_Page_91.jpg
318d9685593f4c5eb480c4229213434e
fcf20e2d0385c7f0aa2154768bdeb0aad2933e47
91870 F20110404_AABNVP kearns_s_Page_77.jpg
56438b706ef301afbfb846c4050a593f
7279fa06c32abe54f4a605d84e0872c944521941
32245 F20110404_AABNWE kearns_s_Page_91.QC.jpg
d48abbbd0520bcc5dc07f738b90d5186
04bb731094c70a4c0cc56428925a995523adc596
105417 F20110404_AABNVQ kearns_s_Page_78.jpg
1d319f93fb368d114929e4d3c947f495
ef1ecd8984d34aaee9195db81a9b209e9d5ab2a0
116063 F20110404_AABNWF kearns_s_Page_92.jpg
71e70ad2941cb11eb019ff1e2d7f3fb7
dec26090ef5ffdd105f5be062839fdb6098ef6ab
101400 F20110404_AABNVR kearns_s_Page_79.jpg
5a12f92f0acf56a060b7f56353ed3aba
78bab05f2d3dbf2dabf2dce985a66a167920d40f
32098 F20110404_AABNWG kearns_s_Page_92.QC.jpg
4e02190f3215dabba422e4d04a9e2d68
b0955a5d79299a58f2d6cda8791c7a9ddfa4ca4d
106138 F20110404_AABNVS kearns_s_Page_80.jpg
340d416d221347d649af587952e5e8a5
6dd5b79ace4d38cc81843a750aeece4414284ffe
103229 F20110404_AABNWH kearns_s_Page_93.jpg
217e1bf8a631e91d9c6ffa14084c434f
05d3d1d4686a8e4d7b32314190c1dd0140a5899e
34225 F20110404_AABNVT kearns_s_Page_80.QC.jpg
f026c3f6fa4d2b66850be50d67b5d50c
4324f5e43484acf921e129ce2fdcc45b2c744d18
33038 F20110404_AABNWI kearns_s_Page_94.QC.jpg
95560a0eab2bd01f8e42abd6b3278b76
791de4e5ecbf8bf56a5e4c9e02c2eed7f494ce65
101517 F20110404_AABNVU kearns_s_Page_81.jpg
6970dd83173696709b257b4dab4832f8
1a04ae14339501c409167e8dade6991eb81fd7e0
32029 F20110404_AABNWJ kearns_s_Page_95.QC.jpg
e1f7cd433fa4a1590803c346c9c5146a
5d24939512be13a32edbb51a0b8173127d55d5ed
32401 F20110404_AABNVV kearns_s_Page_81.QC.jpg
07c64c170b5798f2cd036e3c0a5eb2f6
1aa5badcb6a84ed3de03bb1aa32b8b0eb322514f
123594 F20110404_AABNWK kearns_s_Page_96.jpg
03ac6c3a58844468d51e6fb47b70ffe3
a0f445f5725623ccb18aee8201084f5eda16368d
46841 F20110404_AABNWL kearns_s_Page_97.jpg
bf6e794f3964bf9416733af53c0b78bf
4e581c8ba8f63a01bffbec42a2127d03a2260236
102548 F20110404_AABNVW kearns_s_Page_83.jpg
2f126351cab3de466ddbb340384ec73c
f0381e06da1169a0693918ee3748046abcd591ed
1051972 F20110404_AABNXA kearns_s_Page_29.jp2
7d45af9f73feaf84a548016c4f6ef4c8
bdedaa59b0a9a22d37bb0fd14b4c46c2665df5a0
16866 F20110404_AABNWM kearns_s_Page_98.QC.jpg
a4ce983abf98d41b66188450d060001b
472c95a9e9ce5dc0ccb6c510578057b7de209e6f
101787 F20110404_AABNVX kearns_s_Page_84.jpg
15a067b9e3a5af9d90ab6283145c69db
3fea68879fa03d19d795b2c2085b6c07a7581d57
1051949 F20110404_AABNXB kearns_s_Page_30.jp2
69294af36cf5251004d2d1fe18e4024f
e27715cced2175b432ce5db1f6b64e78723055d9
296149 F20110404_AABNWN kearns_s_Page_01.jp2
f735d7a044a82144a867f84069237cfb
b0700b6cbf12c9cb1086590e97e5b8c643829281
99720 F20110404_AABNVY kearns_s_Page_85.jpg
d4de128c6e43c486c075c5438f71c0c1
75fbb0c28c1651b434db3bed531bd14f3d410290
141895 F20110404_AABNXC kearns_s_Page_31.jp2
5266b2e124e2d3531b868de612609311
30a6f7b22ccc4450ec237b4f02824b0f0aca5626
26810 F20110404_AABNWO kearns_s_Page_02.jp2
f7428f105484f9d58657edd019fe8e79
674cbb4bb56680d394d2bb7c1adcedfb8bf3532b
34108 F20110404_AABNVZ kearns_s_Page_88.QC.jpg
c745c0a909a9ffb75563e3b3d09549f8
d174f104cc43f978020d50d2e1d12c348783a8d6
1051975 F20110404_AABNXD kearns_s_Page_36.jp2
5c7f47df694dba2a23407f86aff52b6e
ce83031f0de8f19c9ff1117b4242baef288ff501
320339 F20110404_AABNWP kearns_s_Page_04.jp2
1a7a3baba372012ff5c4a2bf75bf1af2
34cc9a69fc41f7f27931d5ba2798dde5d3342eb8
1038231 F20110404_AABNXE kearns_s_Page_39.jp2
670f3313303e48d403d67febbe3239ea
fee893709c3b981b0739fa7aac107c241d1c6c8d
811543 F20110404_AABNWQ kearns_s_Page_05.jp2
e7fe35a3c3e062386357a7ef0aa5fefe
fc0eb020dfd722c973a15fbacacacc457ca65a54
776440 F20110404_AABNXF kearns_s_Page_40.jp2
ae42a176fdce0d3d1922a5d9daea405a
d87e606ad21c3e4ae59ad7922bbed5c1d058cf12
857574 F20110404_AABNWR kearns_s_Page_07.jp2
0e3c6f0c10e4c02e724bb75271d3b2c1
859b4d556c34a1156801d11a951c88662e36755d
959032 F20110404_AABNXG kearns_s_Page_41.jp2
bc4a619f61e9430ff305c21269e50200
04b9cac8bf7c0df65a1a32b0d6487d8c7379483d
885254 F20110404_AABNWS kearns_s_Page_09.jp2
c4d22c8766264b3907f5cf85294ee7a1
1049bfd387e3085d20812f45700287e75edcca3d
1025855 F20110404_AABNXH kearns_s_Page_42.jp2
4436a446dbb6c2d2b7a9298fdeb6d463
838d3ebe863cfa7eccd0e4639ad066c4d767dfd0
979110 F20110404_AABNWT kearns_s_Page_11.jp2
c7266381782ec741429d650dedf5c756
41393014facd86c4d5fa9aa18e4cc9a747f17e46
14195 F20110404_AABNAA kearns_s_Page_60.QC.jpg
234ca278595e7efe43f788eb0cabdf0a
d74ed3fc720dc8a6bdebc91a335367b3e0180b0c
1031054 F20110404_AABNXI kearns_s_Page_46.jp2
c358820285cb2ef7e832cc59c26badfd
7aafb0d9f9d07a1053fdf377396d1ab4e6f86d01
F20110404_AABNWU kearns_s_Page_13.jp2
178aed0e1624f38e6389f096061cd309
b943dbd2caeb2985f295794ea230064cd52b7540
1051954 F20110404_AABNXJ kearns_s_Page_47.jp2
298333fb42d9866a6e13964cec0811e0
95ea3f57a7bb6ee838d7f6dab291422ac490a087
1051925 F20110404_AABNWV kearns_s_Page_15.jp2
113f7c87dc676df74395ec67bc7b2999
302f4117f062925d628e1aa35775c7a5b61f6770
F20110404_AABNAB kearns_s_Page_49.tif
d22733d2c53e4600ae0a5493c5ac99ef
d47d57e6bcaa395d3e5efb0317c8a984bfdf3df3
1051984 F20110404_AABNXK kearns_s_Page_48.jp2
fd2a1d6d0b09a90b2410d7b84050a03e
3d976e7e777a0a16e8f2c9be08551df5b2369bde
F20110404_AABNWW kearns_s_Page_16.jp2
5a0c85327cd72ef6fecab4392ca2d431
a3e64f0a9d3d095a8d32b559ce4209269ebd90d5
8617 F20110404_AABNAC kearns_s_Page_26thm.jpg
acc7d076016c1881e1a2ee9996226535
5d77ac7f6b8be012a95dcd06f56d2527ddeb928d
F20110404_AABNXL kearns_s_Page_49.jp2
7e38d7388252fad62d522d892fece4a4
d3654b70b282d81c3490d27b26bf9b2d984fbe86
1001 F20110404_AABNAD kearns_s_Page_40.txt
5521e70153f8a9d93f95e70dae7c8a3d
a7072b04f3bc2f1fb7a6f3b15886e988970228aa
602312 F20110404_AABNXM kearns_s_Page_51.jp2
e2eedd31824226fc7a27a8797bdaa462
81d8ac0f69f3e3972acdf93d48784e5ce8b0661d
F20110404_AABNWX kearns_s_Page_17.jp2
8873fb6c99c79ac1416f400c6e64e0f3
64db295073ea13e2e19e392b013ce207e1d7c02a
5289 F20110404_AABNAE kearns_s_Page_57thm.jpg
ecd15bc421f04a3b936a07e380803223
6037156e8634d7c1c04b1074f552db2252dea6ef
756042 F20110404_AABNYA kearns_s_Page_76.jp2
75b0339cd8f437673a7b0ea8ea4c3905
32f821f1002e21c72cf0e8b3dab75aa3709da97e
F20110404_AABNXN kearns_s_Page_52.jp2
462867b082659991f75eb8639a154185
e5aeeb888c0ecf95de8617ca6788d82a7cc3f989
F20110404_AABNWY kearns_s_Page_21.jp2
fbea649d3ddc3e42f4ea91aa6901bd04
b038b2dd7660acfb40e557ee8fcb049c1bc1145d
2052 F20110404_AABNAF kearns_s_Page_15.txt
cd91521eaeca65409d95cc3856292eab
eb4ed4064f45808e489299004bab85ff8f52a16c
1007284 F20110404_AABNYB kearns_s_Page_77.jp2
fafb0283119bfe41b346272afd5dd32d
83038c0a5b40913814f1afe712052f293f7b3f82
566751 F20110404_AABNXO kearns_s_Page_53.jp2
a221ab60af9889b7c48af6375627a4cf
2b9ce5d1bf6742beb959d41b50f4a9992fca8661
1051971 F20110404_AABNWZ kearns_s_Page_28.jp2
a9dd3a63e59d3854f170011d06ce6633
aae3856de53d4012e94b81502397accac66f4064
534592 F20110404_AABNAG kearns_s_Page_98.jp2
b934b6138d038dc4f7f94724a1927d06
c707e77d095603ae1f036aaf3171524c2cb496af
F20110404_AABNYC kearns_s_Page_78.jp2
5cc9b40027562dd836302e52fe8cdc50
da58111d77215d1501d8e3a6d5ae8543360f1c55
648534 F20110404_AABNXP kearns_s_Page_55.jp2
d666c9c313348d3a3ae0d2057f8e9e90
a32947269d7b47431d46447fe57ac275c982c801
31473 F20110404_AABNAH kearns_s_Page_42.QC.jpg
c4c0d730a8089fa1691d766adb601c0b
4acb6d27d1861ee1c00f9aaaa043e503bbd3ef3b
1051963 F20110404_AABNYD kearns_s_Page_80.jp2
5cd58eece61e95662d4d91fdd7adee6b
ffa828f53e8058bff75f3920d425bb4ee827691e
325020 F20110404_AABNXQ kearns_s_Page_56.jp2
3f10d3a0871ab4af360e153cb3edb0b3
479e601fa422b557caff608ee062dd917d06e4e7
98478 F20110404_AABNAI kearns_s_Page_49.jpg
ea39bd5dedc511430bc6b8068473c3d1
56512b3ff945c7d44543b4e82d0c0d334468135e
F20110404_AABNYE kearns_s_Page_81.jp2
837a1eefff4d8720d4599b8767cd35b6
825bedb109b6b9b8d3af7d4625f4d11a743340d7
747073 F20110404_AABNXR kearns_s_Page_57.jp2
5a547c9bf275db78c351409bb584a254
4b88a074b6426f6927e3e5c63cd2e570ce99e4f8
19245 F20110404_AABNAJ kearns_s_Page_54.pro
d9b34816e2f4dc85dce6e02d0ecbbb7d
8bc7b8a36eacb6ff7302bbb9b102002ee528f1cb
1051946 F20110404_AABNYF kearns_s_Page_83.jp2
30aedef4cdb74700cc2a5c662ee6d313
9b83e8640f006eec5f3d6ec522bc59acebe58ef8
374053 F20110404_AABNXS kearns_s_Page_59.jp2
ec1de4bc04b96991263f453108e31f62
9db8e7e2aebb1f11ebd88f37165700031ac6f899
F20110404_AABNAK kearns_s_Page_67.tif
ef3ec1ae4abd108effd60d0d159121d7
20c2a36e3e8a1a6216952228ee3044c54facbdd6
1051959 F20110404_AABNYG kearns_s_Page_84.jp2
00dc3cf5548a35313cf76a230f17faf5
ca76a7dc27f4a90b66889c9ed2315c4d4d6ce5de
704929 F20110404_AABNXT kearns_s_Page_61.jp2
c99048c8db6f183bf4a5806b92760080
e5d418457dd21252fecd8916fb3347f76fc5c09d
59477 F20110404_AABNBA kearns_s_Page_88.pro
4ec185e57759288beab6fa15769a7bfd
5fe017acf261fca3cce6c78b6834ba0b9974780f
F20110404_AABNAL kearns_s_Page_84.txt
de84e42b45523377d811a3a5b6de49c5
b39815ec8f9bf94ac3cef10f01aab33c8cf32818
F20110404_AABNYH kearns_s_Page_89.jp2
0a5f3ee40227b5d33035f7787a2c75d8
91381716b136409e9a6ce8c70eca4bbbbfb53df0
32129 F20110404_AABNBB kearns_s_Page_85.QC.jpg
1fb1228f18be0bf87141670089b0581a
e61a786daea5e5d4ac084307cdb5a2603052e688
49873 F20110404_AABNAM kearns_s_Page_14.pro
4e489ea3b104a528699e1ea55fa904ee
971ed111edaf88c403711486bf1d41f20be61a88
475833 F20110404_AABNYI kearns_s_Page_97.jp2
518c11c11b37694de7fe6a0c4d5c6f31
10817b72e3b26cf999773550ed3e332575a66c2c
1051866 F20110404_AABNXU kearns_s_Page_64.jp2
26e4cadd8247e78735fe0d349ee7bbcd
7de43e416b68cb18584458521faa7747ad10c872
539273 F20110404_AABNAN kearns_s_Page_72.jp2
c4375b9efbf8eff4537a44170a380d22
ceb02b701cf66451193c41ad6cc5388a5a93a2b7
2539 F20110404_AABNYJ kearns_s_Page_01thm.jpg
af2b17fed56fbb793d8fa35dbad1571f
6f47348e2e76c630ef4c98b9789e1b58cf875a3d
979137 F20110404_AABNXV kearns_s_Page_65.jp2
380d8441d8ec22758e74d42582ecab26
5c1d26524f78bf7b44a61da161c0f2311411010e
F20110404_AABNBC kearns_s_Page_20.jp2
935394d6098e7f824d4a4f7e2ad97f1a
c94ce4db040ae82d3c6ecec8b1303025fbc7685b
646 F20110404_AABNAO kearns_s_Page_70.txt
aa0abe58d84ac9d8947b931f4d6b5551
76acf06add533742de115665898c8482b45613d7
2844 F20110404_AABNYK kearns_s_Page_04thm.jpg
4c9edf91b4315361cb44ad3f86ac684e
1247150a747a923f7aa36c59b5fd4747470c9547
1051956 F20110404_AABNXW kearns_s_Page_67.jp2
ae10f8b2ede4774048d939c04464f487
8e6c901d4e7f456fea8400fed0cf9934503144b6
86853 F20110404_AABNBD kearns_s_Page_19.jpg
e8851bb6840ac32960e1aaf6201ffad3
5beea7bc3092289157e1ddc43943cb4192f43719
971 F20110404_AABNAP kearns_s_Page_98.txt
9d99ed17eee0128de7f1a3c905dffad2
0a5864e2c90352bdfc724658c0399fe489c097f9
4449 F20110404_AABNYL kearns_s_Page_05thm.jpg
90b4be2bc706754655d7f5f6f3dc15c1
f88396e66a13c2f6479ca0da28237a6f96b82b88
328361 F20110404_AABNXX kearns_s_Page_68.jp2
e0f8085f51c461544570bbf5e67b5a63
20dd2e2d699038260478e5b77202f44a05e76a46
106709 F20110404_AABNBE kearns_s_Page_27.jpg
28b728d2e3e666a5b10fa1856880af35
ec60f3b00ba29a43ef7c2db6fe30e2c7584d2c9b
F20110404_AABNAQ kearns_s_Page_07.tif
9cd81256c700ff72255b908341b1774a
edceeee2bbb7b4fb737b0a800e3ab36b0b2286e0
7623 F20110404_AABNZA kearns_s_Page_34thm.jpg
cdd0e0232b52a5c30b3e6ed418b23238
47c91aab7c14068a479296ecc028cbedcfe6482b
6665 F20110404_AABNYM kearns_s_Page_09thm.jpg
e41cc1c304d8c90c340f23c075a4d6b3
e0b2803a9073609a726a731473fa1d6e648d0220
51805 F20110404_AABNBF kearns_s_Page_43.pro
f1fa9b687ae6c0a8ea96c23abd9a036c
7668dfa3c0beaf50171bf2677e8b2fe4aa2f7047
3461 F20110404_AABNAR kearns_s_Page_58thm.jpg
72f9229f9dbf0d7662292c1b89a86133
af359de1891a3e5186b8ddc1dcd4fa7373cb40ef
7959 F20110404_AABNZB kearns_s_Page_35thm.jpg
76424f42b6ba20c9450e6aab0eb37307
18d67d7e0b9424b08b1805c86ca4bf98e2ec87d7
4511 F20110404_AABNYN kearns_s_Page_10thm.jpg
66845ed8c5c8e4c8073f802a0ac353cc
5b24bbc562eac003649ff8d0eb769f9b06af8539
496788 F20110404_AABNXY kearns_s_Page_71.jp2
ce7575b559754a676d56f4b73c000bde
42c9c58d2d015038af85c3cb3e442818a08f3208
1805 F20110404_AABNAS kearns_s_Page_42.txt
6ec04e5c035ccb4b7781c9cf2a68289f
a23e36738bcc544acd85f9ece9a07cf59c2db478
8222 F20110404_AABNZC kearns_s_Page_36thm.jpg
ca5985d8553e724c184e6c634eeb067c
e3b08da716fa346e871b29edf32dc7eefedf65aa
7355 F20110404_AABNYO kearns_s_Page_11thm.jpg
83fcd07c2e64c7d042cd51eee20dea1a
99dbf0f56f0d71d0ff3b5fcc3eced2565fe684b4
539930 F20110404_AABNXZ kearns_s_Page_73.jp2
4e9175d6a94f43f9f00e2daf53830fb3
9886422c16001ff45036a05780b85f88d997931e
F20110404_AABNBG kearns_s_Page_90.jp2
646c158f67e628ea4812777410340a05
47baa81c3a3df2919f328a0a9a8e0262ce1231e1



PAGE 1

CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A NIGROSTRIATAL SLICE CULTURE SYSTEM By SEAN M. KEARNS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Sean M. Kearns

PAGE 3

I would like to thank my wife, family and friends without whose help all of this would not have been possible.

PAGE 4

ACKNOWLEDGMENTS I would like to thank my family (Mom, Dad, and Kelly) for all the love and support they have given me growing up. I thank my friends for all the good times that made life worth living. I would also like to thank Dr. Dennis Steindler, Dr. Eric Laywell, and the rest of the Steindler and Laywell labs for teaching me how to do science, and for helping me to find why I do science. Finally I thank my wife Debbie. Her love and support have made me complete, and I am eternally grateful that she is a part of my life. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF FIGURES ..........................................................................................................vii ABSTRACT .......................................................................................................................ix CHAPTER 1 STEM CELL BIOLOGY..............................................................................................1 Stem Cell Characterization...........................................................................................1 Embryonic Stem Cells..................................................................................................2 Adult Stem Cells...........................................................................................................4 Adult Neural Stem Cell Differentiation........................................................................6 Stem Cell Niches and Extracellular Matrix..................................................................7 2 PARKINSONS DISEASE..........................................................................................9 Overview and Anatomy................................................................................................9 Genetic Links To Parkinsons Disease.......................................................................11 Alpha-Synuclein Mutations.................................................................................11 Parkin Mutations.................................................................................................13 PTEN Induced Kinase-1 Mutations.....................................................................14 Environmental Links To Parkinsons Disease............................................................14 Rural Living Conditions......................................................................................14 Pesticides and Parkinsons Disease.....................................................................15 Heavy Metal Exposure and Parkinsons Disease................................................16 Modeling Parkinsons Disease...................................................................................17 Current Therapies for Parkinsons Disease................................................................18 Pharmacological Therapies.................................................................................18 Surgical Therapies...............................................................................................19 Cell Replacement Therapies................................................................................19 3 MATERIALS AND METHODS...............................................................................22 Neurosphere Culture and Asteron Cell Characterization...........................................22 Generation of Neurospheres................................................................................22 Differentiation and Immunolabeling of Spheres.................................................22 v

PAGE 6

In Situ Hybridization with GFAP cDNA.............................................................23 Analysis of Cell Death.........................................................................................24 Electrophysiology................................................................................................25 ECM Effects on Neurosphere Migration....................................................................26 Slice Culture Preparation............................................................................................27 6-Hydroxy Dopamine Nigrostriatal Lesions.......................................................27 Embryonic Stem Cell Neural Precursor Transplants...........................................28 Immunocytochemistry and Quantification..........................................................28 Electrophysiology of Slice Culture Transplants..................................................29 4 RESULTS...................................................................................................................31 Neural Stem Cell Differentiation and the Asteron Phenotype....................................31 Combination of Asteron Markers........................................................................32 Analysis of Cell Death.........................................................................................32 Physiological Properties of Hybrid Asterons......................................................33 Extracellular Matrix Influence on Neurosphere Migration........................................34 Nigrostriatal Slice Culture..........................................................................................36 6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures...........................37 Real Time Analysis of Nigrostriatal Degeneration.............................................38 Nigrostriatal Slice Culture Applications.....................................................................38 Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice Cultures............................................................................................................39 Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice Cultures............................................................................................................39 Dopaminization of Transplantable Cell Populations..................................................40 Dopamine Neuron Generation from ESNP Culture In Vitro...............................40 Dopamine Neuron Generation from ESNP Cultures in Slice Culture................40 Dopaminization of Adult Stem Cell Cultures.....................................................41 5 DISCUSSION AND CONCLUSIONS......................................................................67 LIST OF REFERENCES...................................................................................................77 BIOGRAPHICAL SKETCH.............................................................................................88 vi

PAGE 7

LIST OF FIGURES Figure page 4-1. Combined -III tubulin and GFAP immunolabeling reveals the temporal progression of the asteron phenotype.......................................................................42 4-2. Antibodies against -III tubulin and GFAP reveal three immunophenotypes, and label separate sub-cellular elements within asterons................................................43 4-3. Asterons co-express -III tubulin with S100, and transcribe GFAP mRNA........44 4-4. Asteron appearance corresponds with neuronal reduction that is not attributable to apoptotic cell loss.................................................................................................45 4-5. Caspase 3 analysis of cell death accords well with TUNEL data............................46 4-6. Physiology of neurons, astrocytes, and asterons......................................................47 4-7. Phenotype immunostaining of neurosphere derived cells........................................48 4-8. Velocity plot of neurosphere derived cells on different ECM substrates..................49 4-9. Migration distances of neurosphere derived cells on ECM substrates.....................50 4-10. Neurosphere derived cell migration patterns and measurements............................51 4-11. Slice culture viability and nigrostriatal circuit maintenance...................................52 4-12. 6-Hydroxy Dopamine lesion of nigrostriatal slice cultures.....................................53 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.........54 4-14. Cytoarchitectural changes in 6-OHDA lesion slice.................................................55 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. ...............56 4-17. Real time analysis of TH-GFP.................................................................................58 4-18. ESNP transplants into slice cultures........................................................................59 4-19. Long term ESNP transplants in slice cultures.........................................................59 vii

PAGE 8

4-20. Laminin enhances ESNP migration through slice cultures After 6 days in cultures.....................................................................................................................60 4-21. Laminin enhances process outgrowth of ESNPs in slice cultures.........................60 4-22. Green fluroescent protein Positive ESNP striatal transplant...................................61 4-23. Electrophysiological Characterization of Transplanted Cells.................................62 4-24. ESNPs located near the substantia nigra................................................................62 4-25. Increase in TH+ neurons derived from ESNPs exposed to ventralizing agents.....63 4-26. In vitro ESNP dopaminization.................................................................................63 4-27. Dopaminized ESNPs implanted into slice cultures................................................64 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH................65 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH, and pleiotrophin........................................................................................................66 viii

PAGE 9

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A NIGROSTRIATAL SLICE CULTURE SYSTEM By Sean M. Kearns August 2006 Chair: Dennis A. Steindler Major department: Medical SciencesMolecular Cell Biology Stem cell therapy holds great promise in repairing brain damage caused by neurodegenerative diseases, such as Parkinsons disease. To fully use these cells, a better understanding is needed of the mechanisms and processes that control their proliferation, migration, and differentiation. Our study used both in vitro and slice culture techniques to examine adult neural and embryonic stem cells. Our initial experiments showed that adult neural stem cells can generate hybrid cells (asterons) in culture. These asterons appear to be hybrid cells that express both markers of immature neurons and astrocytes, and appear to be the result of transdifferentiation from a neuron to an astrocyte. We also examined the effects of different extracellular matrix molecules on the migration of adult neurosphere derived cells. Our results showed that laminin and fibronectin are permissive for migration and enhance outgrowth. In contrast, chondroitin sulfate proteoglycan inhibits migration and impedes outgrowth. ix

PAGE 10

Finally, to better assess stem cell integration into the central nervous system, we devised a novel slice-culture system that recreates the degeneration seen in Parkinsons disease. Using this slice culture model, we showed that ES cell-derived neurons can survive in culture, and integrate synaptically. We also were able to dopaminize these ES derived neurons and show that they maintain their dopamine phenotype in the slice. To enhance transplant integration, we examined the effect of adding extracellular matrix to the cell transplant. Our results suggest that laminin enhances the integration of these cells into the slice. Our study examined the plasticity of adult and embryonic stem cells in culture and showed that these cells are responsive to environmental factors that interact with their differentiation and migration. Development of a slice culture model system that recreates the neuronal environment allows the development and future use of transplant enhancements for stem cell grafts into the brain. x

PAGE 11

CHAPTER 1 STEM CELL BIOLOGY Stem Cell Characterization To understand the potential of using stem cells, one must first understand what a stem cell is. A variety of definitions have been proposed, but a common set of terms and properties emerged that serves as a starting point. By focusing on embryonic stem cells and neural stem cells we compared and contrast the two most common types of stem cells: embryonic and adult stem cells. The minimal definition of a stem cell is a cell that can divide to renew itself and give rise to a more committed progenitor (Morrison et al., 1997). Some argued that self-renewal may be present in mature cell types (e.g., lymphocytes) and have pushed for a definition based on the plasticity of the stem cell (Zipori, 2005). Those against self-renewal as a stem cell trait argue that plasticity is the main defining characteristic separating stem cells from other types of cells. A stem cell functions to generate mature, committed cell types to create or repair tissues and organs. Embryonic stem cells (ES) in vivo contribute to all body tissues when implanted into a blastocyst (Bradley et al., 1984). In vitro ES cells have been shown to create almost all of the mature cell types found in the body (Keller, 1995; Draper and Andrews, 2002). Adult stem cells have been found in most adult tissues and organs. Functionally they are an integral part of normal operation of the system (e.g., the hematopoitic and nervous system) or they play a role in tissue repair and regeneration (e.g., the hepatic system). Evidence also shows that adult stem cells (whose in vivo distribution is limited to their target tissues) may in vitro be capable 1

PAGE 12

2 of transdifferentiating into other types of mature adult cells. This potential is still controversial and may not exist in all adult stem cell types, but it further argues that stemness is a function of its plasticity, and not its renewal capability. While still under debate, self renewal and plasticity are likely both key components of a stem cell definition. More information about stem cell functions will refine their definition. Embryonic Stem Cells Embryonic stem cells (ES) are derived from the intracellular mass (ICM) of a developing blastocyst. This region of the blastocyst gives rise to all of the cell types found in the adult organism. ES cells were first derived from rodents and were shown to be pluripotent (Bradley et al., 1984). Human ES cells were generated later and were shown to have properties similar to those of rodent ES cells, while requiring a different set of culture conditions (Thomson et al., 1998). The primary focus for ES cells has been keeping them undifferentiated in long-term cultures, and in the exact protocols needed to differentiate ES cells into adult cell types in an easy and reliable manner. Mouse ES cells initially had to be grown on mouse fibroblast feeder layers to remain undifferentiated. Further studies identified leukemia inhibitory factor (LIF) as one of the primary molecules secreted by feeder-cell layers that maintained ES cells in their undifferentiated state (Smith et al., 1988). With the discovery of LIF as a mediator of differentiation, downstream transcriptional targets of LIF were identified that appear to regulate the pluripotency of ES cells. Transcription factors such as Nanog and Oct3/4 were found to be expressed in ES cells, and their expression decreased as cells differentiated into mature phenotypes (Niwa et al., 2000; Chambers et al., 2003) Human ES cells (hES) have been shown to behave slightly differently from rodent ES cells. Human ES cells do not maintain a pluripotent state when treated with LIF,

PAGE 13

3 though hES cells can be maintained on feeder layers, or on laminin-coated culture plates when fed with feeder-layer conditioned media (Thomson et al., 1998; Xu et al., 2001). The use of feeder layers was questioned because of the possibility of cross-contamination from animal cells. Recent evidence suggested the presence of a rodent glycopolysacarrhide in hES cultured on mouse feeder layers (Martin et al., 2005). This foreign molecule could induce an immune response to these cells that would likely kill them if transplanted. Research on feeder layer and conditioned media-free cultures shows promising results, suggesting that hES cells can be maintained in an environment that minimizes cross contamination. Differentiation of ES cells can be performed in a few ways. One way is to culture ES cells in an aggregate colony form, known as embryoid bodies (EBs) (Keller, 1995). The EBs can be maintained in culture for some time, and provide cell-cell interactions important for ES cell survival. The EBs can be plated to generate a monolayer of cells that can be treated with various cytokines and other factors to induce a specific lineage in the cells. For example, ES cells can be induced to a neuroectoderm lineage through a sequential EB culture protocol that adds (then removes) serum from the cultures, and allows the EBs to attach and generate a monolayer (Okabe et al. 1996). All three major neural cell types (neurons, astrocytes, and oligodendrocytes) can be produced from ES cell cultures, and in relatively pure populations. Further manipulations of neuronal cultures can yield subtypes of neurons, such as dopaminergic or GABAergic neurons. Dopaminergic neuron generation is being heavily studied as a possible way to replace the neurons lost in Parkinsons disease. (Jung et al., 2004; Zeng et al., 2004; Takagi et al., 2005) provided a working paradigm for efficient generation of dopamine-producing

PAGE 14

4 neurons, and provides a useful example of how ES cell manipulation is carried out. The initial protocol relied on treating ES cells with cytokines, such as sonic hedgehog and FGF8, that have been linked to endogenous dopamine cell generation during development. Adult Stem Cells Unlike ES cells, which are generated from the inner cell mass of a developing blastocyst, adult stem cells have been isolated from numerous adult tissue types, including brain, bone marrow, liver, and skin (Weiss et al., 1996). Like ES cells, adult stem cells are capable of asymmetric division, producing a relatively undifferentiated copy of themselves, and a more-committed daughter cell. Initial isolation and characterization of these adult stem cells showed them to be multipotent, capable of giving rise to only certain cell types of the tissue they were isolated from. Further studies introduced the idea that under certain conditions, these cells could transdifferentiate, or turn into mature cells from other tissue types (Brazelton et al., 2000; Theise et al., 2000; Ianus et al., 2003). These findings remain controversial, but evidence supports at least a limited potential for adult stem cell transdifferentiation. Because so many tissues appear to have adult stem cells associated with them, we have limitd the scope of this overview to discussing adult neural stem cells. Stem cells in the CNS have been hypothesized for more than 4 decades. Evidence of neurogenesis in rodent hippocampus was described by (Altman and Das, 1965, 1966; Altman, 1969a, b). They described postnatal neurogenesis and suggested that undifferentiated cells existed within the mature CNS; and that they gave rise to new neurons, and to new glial cells. The early 1990s began a push to isolate and expand the neural stem cell. A key discovery was the primary niches of adult neural stem cells

PAGE 15

5 (NSCs): the subventricular zone (SVZ) of the lateral ventricles and the subgranular layer of the hippocampus. (Lois and Alvarez-Buylla, 1993; Kuhn et al., 1996). The SVZ stem cells generate new neuron progenitors that migrate along the rostral migratory stream to the olfactory bulb, where they integrate into the periglomerular and granule cell layers of the olfactory bulb in the rodent. When cells from these regions were cultured in clonal conditions with suitable growth factors, they gave rise to a sphere that contained both stem cells and lineage-restricted progenitor cells. Later studies of these cells from the SVZ, cultured as neurospheres, identified a multipotent astrocyte as the neural stem cell (Doetsch et al., 1999b; Laywell et al., 2000). In the SVZ a dynamic relationship exists between NSCs and more restricted progenitors. Early experiments on rodents found several different cell types in the SVZ (Doetsch et al., 1999a): the B cell, the multipotent astrocyte stem cell (NSC), the C cells (a rapidly dividing precursor cell), and the A cell (a restricted neuronal progenitor cell). Evidence for this model came from studies using cytosine arabinoside (Ara-C) to kill rapidly proliferating cells in the SVZ. Examining which cells were killed by Ara-C allowed the relative cell-cycle times of SVZ cell types to be established. The C cells showed the shortest cell-cycle time and were almost completely destroyed by Ara-C treatment. Type A cells also were almost completely eliminated by the treatment. Type B cells showed the least effect from Ara-C treatment. After only 2 days, regeneration of cell types had begun. After 4.5 days, A and C cells were almost at normal levels. In addition, giving a second treatment of Ara-C during this regenerative period killed a large number of the B cells, which had been activated and were dividing to try and reconstitute the SVZ, and led to no significant regeneration of the cell types in the SVZ.

PAGE 16

6 This evidence of postnatal neurogenesis mediated through NSCs brought a great push to harness this innate potential to regenerate damaged regions in the brain. Currently there is no evidence that massive regeneration occurs in the CNS as a result of lesion or injury (Rakic, 1985). Some evidence suggests that endogenous stem cell populations contribute to repair in damaged regions such as the cortex (Magavi et al., 2000). However, this repair seems limited to small, specific lesions that do not create large glial scars, or large amounts of cell necrosis or apoptosis. Additional debate centers on whether neurogenesis occurs in regions outside the olfactory bulb and hippocampus. Reports of neurogenesis in the adult monkey (Gould et al., 1999) suggested that primates and possibly humans might generate new neurons in their cortex. However, evidence for this was challenged, based on confocal analysis that suggested cells appearing to be newly generated neurons were actually a neuron closely associated with a satellite glial cell (Kornack and Rakic, 2001) Adult Neural Stem Cell Differentiation By definition, the NSC must be able to generate the three distinct cell types of the central nervous system; neurons, astrocytes, and oligodendrocytes. Microglial cells, although restricted to the CNS, are believed to be developmentally derived from the hematopoietic system and do not constitute a neural lineage. On plating, NSCs have been observed to give rise to the three neural cell types. What remains poorly understood is the mechanisms of this differentiation and how static the process is. Recent evidence in the CNS suggested that cells exist along a continuum of differentiation, and that cell groups are much more fluid than previously proposed. This idea is supported by the life cycle of the NSC, which initially exists as a type of specialized astrocyte that (through cell division and differentiation) can give rise to neurons. Our results also suggest that

PAGE 17

7 neuronal cells derived from these NSCs are in a state of phenotypic flux and may turn from neuronally committed to glial cells in vitro (Laywell, 2005). Stem Cell Niches and Extracellular Matrix An important concept in stem cell biology is that of the stem cell niche. Basically it suggests that the stem cell is able to perform its function, because of its environment, and the physical and biochemical cues from this niche influence cell division, differentiation, and migration. The niche first came to prominence in the hematopoietic stem cell (HSC) field, where the composition of bone marrow was found to play an active role in HSC function. Research on niches in regard to neural stem cells has focused on the extracellular matrix comprising the SVZ and RMS, and the cytokines and signaling molecules that target this region. The extracellular matrix (ECM) environment of the central nervous system (CNS) is responsible for a large number of regulatory functions both during development and adulthood. The ECM provides signals for cell growth, differentiation and migration (Novak and Kaye, 2000; Steindler, 1993; Steindler et al., 1990). These activities are critical for the development of CNS organization, and disruptions of ECM interactions can cause severe developmental defects (Novak and Kaye, 2000). During CNS histogenesis, ECM defines functional boundaries for cells (Steindler, 1993; Steindler et al., 1989) and is involved in signaling after injury (Laywell et al., 1992). Permissive substrates for neurosphere differentiation may underlie migratory pathways, whereas non-permissive substrates may mark more sedentary cell zones. In the SVZ stem cell niche the ECM, composed primarily of tenascin and chondroitin sulfate proteoglycans (CSPG), is believed to act as a barrier, keeping the NSC in the SVZ. This ECM composition is set up late in embryonic development and is persistent throughout the life of the animal. During early development the presence of the

PAGE 18

8 dense ECM may allow the niche to remain undisturbed through development and prevent axons from innervating the region, and possibly degrading the ECM matrix (Gates 1993, 1995, Steindler 1993). CSPGs are known to be present in other regions of the CNS and function in axon guidance by restricting axon growth to inappropriate targets (Treloar et al., 1996), and the CSPG versiscan, has been shown to inhibit migration of neural crest cells (Landolt et al., 1995). Treatment with enzymes that degrade these CSPGs has been shown to be beneficial in axon regrowth in CNS injuries (Bradbury et al., 2002). In addition circuits where the region has been depleted of glial cells show an increased in the amount of axon regrowth they experience. This is believed to be the result of a decrease in scar formation and a decrease in glial elements that inhibit axon growth (Moon et al., 2000). In contrast, laminin and fibronectin are known to be potent permissive substrates for a variety of cell types in vitro, including cerebellar and SVZ derived neurospheres (Kearns, 2003). Neither fibronectin nor laminin are present in high levels in the adult animal; however, fibronectin knockout animals demonstrate neural tube abnormalities that are embryonic lethal (George, 1993). Laminin has been shown to be present in the developing cerebellum and acts as a permissive migratory substrate for granule cell precursors to migrate from the external granule cell layer into the internal granule cell layer (Pons et al., 2001). Laminin has been shown to enhance neurite elongation of cultured neurons (Rogers et al., 1983) and to increase the integration and regeneration of cells within injury sites (Grimpe et al., 2002). Slice co-culture transplants with laminin have been reported to enhance the ability of fetal dopaminergic neurons to reconstruct a damaged nigrostriatal circuit in adult rats (Dunnett et al., 1989).

PAGE 19

CHAPTER 2 PARKINSONS DISEASE Overview and Anatomy Parkinsons disease (PD) has classically been defined as a progressive neurodegeneration of the nigrostriatal circuit. Clinically this presents as a whole body tremor, rigid posture, racheting motion of the limbs, dysphagia, and in late stage cases a loss of voluntary motor control and movement The demographics for PD are heavily skewed towards the elderly, except in specific familial cases where the gene mutations can cause a significant decrease in the age of onset. The disease was first reported in the medical literature by James Parkinson in 1817, and described as the shaking palsy (Parkinson, 1817). Later the clinical anatomy and lesion were discovered that underlie the disease. Rosegay was the first to conclusively label and demonstrate a circuit that originated in the substantia nigra and terminated in the striatum using a feline model (Rosegay, 1944). Anden et al were the first to demonstrate that dopamine was the primary neurotransmitter released into the striatum from the axons of neurons in the SNc (Anden et al., 1964; Anden et al., 1965; Anden et al., 1966). The loss of SNc cells, the only observable lesion seen in Parkinsons patients, led them to correctly hypothesize that the symptoms of Parkinsons were a direct result of the loss of dopamine neurotransmission from the SNc to the striatum. Pathologically, PD is associated with the significant loss of the SNc fibers running to the striatum, and the atrophy of the cells bodies within the SNc. Another notable pathology is 9

PAGE 20

10 the formation of intracellular protein aggregates seen within SNc cell bodies, termed Lewy bodies. These cytoplamsic inclusions are seen in several different neurological conditions, but when closely associated with the SNc are hallmarks of PD (Gibb and Lees, 1988). The nigrostriatal circuit is an important component of the voluntary motor pathway in the central nervous system. Information from the motor cortex is sent to the striatum. From the striatum it is sent to the globus pallidus then to the thalamus where it is processed and from the thalamus goes to the motor cortex to be sent through the corticospinal tract. The overall output from the SNc to the striatum is inhibitory. The more inhibited the SNc causes the striatum to become, the less inhibitory and more excitatory the globus pallidus becomes. This feedback loop of inhibitory and excitatory circuitry allows for voluntary motor movements to proceed smoothly (Blandini et al., 2000). In the case of Parkinsons disease the degeneration of the SNC causes a loss of inhibitory output to the striatum. This loss of inhibition causes the striatum to send a stronger inhibitory signal to the external globus pallidus (eGP). The inhibition of the eGP causes the subthalamic nucleus (STN) to send a stronger excitatory signal to the internal globus pallidus (iGP). The iGP normally sends an inhibitory signal to the thalamus. In Parkinsons this inhibitory signal is much stronger, due to the increased excitatory signal from the STN, and the motor pathways in the thalamus are thus inhibited, resulting in the difficulty initiating voluntary motor movement (Albin et al., 1995). The underlying molecular causes of PD are still being debated. What is established is that there are both environmental and genetic risk factors that are associated with the development of PD. Rare familial forms of PD have been studied that

PAGE 21

11 have allowed scientists to better understand what mutations and biochemical effects may be linked to PD. Epidemiological data has also been collected that points to environmental toxins, such as pesticides and heavy metals, that appear to increase the chances of developing PD. Genetic Links To Parkinsons Disease A variety of genetic studies have been performed to ascertain genes that play a role in causing or predisposing an individual to PD. Three of the most prevalent mutations are alpha-synuclein, Parkin, and PINK1 (Gasser, 2005). Each of these genes has been found to be abnormal in a large number of familial PD patients, or those with a clearly defined genetic linkage to the disease. All of these mutations share a common link in the ubiquitin-proteosome pathway. This pathway is involved in the targeting and degrading misfolded or damaged proteins within the cell and is a critical part of the intracellular machinery. Dysfunctions in the proteosome pathway are believed to induce a state of oxidative stress within the cell and lead to abnormal protein aggregation, like the Lewy bodies seen in PD. The role of these aggregates is unclear, some believe them to be a defense mechanism that the cell uses to isolate abnormal proteins, but many others believe that the aggregates themselves cause an increase in free radicals that can overload the cell with oxidative stress and induce programmed cell death or apoptosis. Alpha-Synuclein Mutations Alpha-synuclein is perhaps the best studied mutation in PD. It was first identified as the root cause of familial PD in a kindred in Italy, and has since believed to be isolated to a founder mutation that originated in Greece (Polymeropoulos et al., 1997). Patients with this mutation display many of the same characteristics as those suffering from sporadic PD, including the formation of Lewy bodies in the SNc, and responsiveness to levodopa.

PAGE 22

12 The key feature that separates this familial form from sporadic is the early age of onset which is around 46 years, compared to the average age of onset for sporadic which is around 62 years (Pankratz and Foroud, 2004). At the molecular level alpha-synuclein is believed to act as a lipid binding protein that plays a role in neurotransmitter vesicle release and recycling, as well as synaptic plasticity. In familial forms of PD linked to alpha-synuclein mutations, the mutated protein folds abnormally and generates Lewy bodies, the protein aggregates seen in PD. Several different mutations have been identified in the alpha-synuclein gene, most of which are point mutations that alter a single amino acid in the protein and cause protein misfolding. Recent reports of duplication and triplication of the wild type alpha-synuclein gene have linked these mutations to the development of PD (Singleton et al., 2003). This is an important finding, since it reinforces the data showing that Lewy bodies in sporadic PD are composed mostly of aggregated alpha-synuclein. Here we see the intersection of environmental and genetic factors that may play a role in the development of PD. If wild type alpha-synuclein is more susceptible than other proteins to environmental agents that cause protein misfolding, then it represents a common target for therapeutics against protein misfolding related degenerative diseases. Recent studies looked at alpha-synuclein polymorphisms that may underlie sporadic PD (Pals et al., 2004). Unlike familial cases there is no clear genetic link or clearly identified protein abnormality in sporadic cases. However some reports have suggested that polymorphisms in the alpha-synuclein gene may predispose individuals to develop PD. One recent study reported that there was a specific haplotype in the alpha-synuclein gene that appeared to increase the risk of developing PD 1.4 times in heterozygotes, and twice as likely in

PAGE 23

13 homozygotes (Mueller et al., 2005). The mechanism underlying this predisposition is still not understood, but further study on polymorphisms in PD related genes is one of the most important areas in PD research. Parkin Mutations A common theme in the genetics of PD is the relationship the genes have with the misfolded protein response and the proteosome pathway. Alpha-synuclein appears to interfere with the proteosome pathway by overloading it with too much aggregated mutant protein. Another proteosome pathway protein, parkin appears to be the most frequently mutated protein in familial PD with some estimates suggesting it may be the cause of 50% of early onset familial PD (Lucking et al., 2000). Parkin is a ubiquitin ligase, responsible for attaching ubitquitin molecules to proteins to target them for degradations (Zhang et al., 2000). The exact molecular mechanism by which parkin mutations may cause degeneration is unknown, but current research suggests that mutations in parkin decrease its ability to targets proteins for degradation. Without this targeting the cellular machinery is unable to degrade proteins and they can accumulate and form aggregates. One of the primary proteins targeted by parkin for degradation is alpha-synuclein (Shimura et al., 2001). What is unusual about most cases of familial PD associated with parkin mutations is the relative lack of Lewy body inclusions. This led some to suggest that parkin mutations act through an alternate pathway to induce SNc degeneration without Lewy body formation. Recent studies have implicated the JNK mediated apoptsis pathway. Under this paradigm, mutations in parkin cause an increase it parkin substrates, which could induce cellular stress and activate the JNK pathway. In addition the activation and control of JNK effects may be directly regulated by

PAGE 24

14 ubiquititination through parkin, and the loss of parkin could cause upregulate the apoptotic effects of JNK (Cha et al., 2005). PTEN Induced Kinase-1 Mutations PTEN induced kinase-1 (PINK1) is a relatively new genetic mutation identified in early onset familial PD. While it only accounts for 1-2% of the early onset cases, PINK1 is being studied intently due to its biochemical functions. (Valente et al., 2004). Analysis of the PINK1 gene product has revealed a mitchocondrial protein that appears to function in oxidative stress response. A recent report found that PINK1 appears to mediate cytochtome c release from the mitochondria, which is an important apoptotic signal (Petit et al., 2005). When cells were transfected with a mutant from of PARK1, which destroys the kinase activity of the protein and is known to exist in PD patients, they noted a significant increase in basal and induced levels of apoptosis in the mutant cells compared to controls. This is another finding that links the development of PD to alternations in the cells ability to deal with oxidative stress. The fact that PINK1 is localized to the mitochondria has implications for certain environmental toxins related to PD. Many of the chemicals that are experimentally used to make PD models act by interfering with mitochondrial function and induction of oxidative stress and apoptosis (Ungerstedt, 1968; Jenner, 2003; Kress and Reynolds, 2005). While there are no reports on polymorphisms associated with PINK1, a reduction in the capacity to deal with mitochondrial insults from an environmental exposure could be a factor in developing PD. Environmental Links To Parkinsons Disease Rural Living Conditions Since most PD cases are late onset, sporadic instances, it is clear that genetics does not dictate the entire risk potential of developing PD. With the advent of

PAGE 25

15 epidemiological studies of PD patients it has become clear that there are environmental risk factors that exist which increase the chances of developing PD (Lai et al., 2002). In addition the development of animal models of PD, based on toxins has opened up new avenues, not only in studying how to treat the disease, but how environmental stresses can lead to neurodegeneration. The majority of the studies in the past 50 years have looked at a small set of epidemiological factors that may play a role in PD. Living location, especially rural or urban, has become a widely studied variable as a risk factor for PD. An analysis of studies done on rural living showed that 7 out of 20 showed a significant positive correlation between living in rural areas and an increased risk of developing PD. The rest found either no correlation, or an insignificant one. While far from definitive proof, at least some evidence exists that rural living may increase the chance of developing PD (Lai et al., 2002). Pesticides and Parkinsons Disease One of the primary reasons that rural living was suspected as playing a role in the development of PD, was the discovery that exposure to pesticides has been shown increase the risk of PD. A meta-analysis of 19 pesticide exposure studies concluded that there was a significant positive association between pesticide exposure and risk of PD (Priyadarshi et al., 2000). This has been further reinforced by experimental studies that have linked the pesticide rotenone to dopamine neuron toxicity. Rotenone is a known mitochondrial complex I inhibitor that induces apoptosis, and it has been showed that chronic rotenone exposure in rodents caused a selective degeneration in dopamine neurons and induced formation of intracellular inclusions similar to Lewy bodies (Greenamyre et al., 2003; Betarbet et al., 2005). One likely scenario is that rural living

PAGE 26

16 typically involves drinking water from a well. Pesticides leaching into the soil and into the well water presents a likely delivery mechanism for human exposure to pesticides. Heavy Metal Exposure and Parkinsons Disease Another positive, although contested, association exists between heavy metal exposure and PD. One study found a positive correlation between workers that had 20 or more years exposure to copper or manganese and development of PD (Gorell et al., 1997). However another study, using the same group as above, found that this increase was broken down among those with a family history of PD and those without (Rybicki et al., 1999). Another study found that 30 or more years exposure to lead, aluminum, and manganese increased the incidence of PD, independent of family history (Lai et al., 2002). Iron exposure has become an important research direction in PD due to a better understanding of the type of free radical damage prevalent in the SNc. Dopamine is a relatively unstable molecule that breaks down, generating free radicals. In addition the substance that gives the SNc its distinctive black hue, neuromelanin, is high in iron content (Youdim et al., 1989; Linert et al., 1996; Hirsch and Faucheux, 1998; Castellani et al., 2000; Gerlach et al., 2003). Iron has been shown to catalyze what is known as the Fenton reaction, which generates hydroxyl radicals. These radicals have been shown to induce DNA damage and to induce apoptosis in exposed cells. There is mounting evidence that the increased iron in the SNc may lead to an increase in Fenton derived free radicals that could be responsible for the neurodegeneration pattern seen in PD. Some of the other metals suspected, have also been linked to free radical generation or a reduction in the ability to scavenge them. This evidence, while not conclusive, does suggest that heavy metal exposure may at the least increase the oxidative stress that the SNc is under.

PAGE 27

17 Modeling Parkinsons Disease Currently most PD research is performed in isolated cell-culture models or in animal models, using either toxic lesions or genetic mutant animals. Isolated cell cultures allow for an easily controlled environment where variables such as toxin exposure or mutated proteins can be observed and easily manipulated. The development of SNc cultures allowed the work being done in cell cultures to help define and profile the at-risk cell populations. Isolated cell cultures are also often the first step in examining whether a chemical or genetic lesion is effective in causing cell death in SNc cells, and examining the effectiveness of therapies in preventing cellular degeneration. Unfortunately isolated cell cultures do a poor job of recreating the actual physiological environment that the cells would normally be found in. Animal models of PD focused on rodent and primate models that mimic the degeneration seen in human PD cases. Most of the work is performed on rodents using toxin models that induce degeneration in the nigrostriatal circuit (Gerlach and Riederer, 1996). Compounds such as 6-hydroxy dopamine (6-OHDA) and MPTP specifically target the nigrostriatal circuit and destroy the cells (Ungerstedt, 1968; Heikkila and Sonsalla, 1992; Glinka et al., 1997; Smeyne and Jackson-Lewis, 2005). Unfortunately these models do not recreate the progressive nature of PD and lack some of the pathological hallmarks of PD, such as lewy bodies. A new method using general proteosome inhibitors, such as lactacyctin, have shown promise in animal models of causing a progressive loss of nigrostriatal neurons with evidence of lewy bodies in cells (McNaught et al., 2002). Slice culture models, like that presented here, allow for a bridge between in vivo and in vitro technologies. The ability to generate mid sagittal slices that contain the nigrostriatal circuit has allowed for modeling of Parkinsons using the endogenous at risk

PAGE 28

18 population of neurons within their neuronal environment, but with the accessibility ability to observe and manipulate of in vitro cultures (Kearns, 2006). Current Therapies for Parkinsons Disease Pharmacological Therapies The current state of PD treatments lies in either pharmacological intervention, typically in early stage PD, and later in a variety of neurosurgical treatments. Neither of the current therapies serves to slow or reverse the cellular degeneration, but instead rely on enhancing the existing dopaminergic signal to compensate or removing inhibitory influences on the circuit to enhance the message. Pharmacological treatment is led by L-dopa administration. L-dopa is a precursor to dopamine that is able to cross the blood brain barrier and can be converted using aromatic acid decarboxylase into dopamine (Joseph et al., 1978; Olanow et al., 2004). This is a dramatic treatment, since it instantly increases the amount of dopamine present in the nigrostiatal circuit and can initially reverse most of the motor deficits seen in PD. However L-dopa has a serious problem in its long term usage. Patients become non-responsive to L-dopa, usually within 5-10 years, and during an OFF phase with L-dopa, the symptoms can return, and even when the drug is working during an ON phase, their can be abnormal hyperactive motor movements and muscle tension (Deane et al., 2004; Brotchie et al., 2005). L-dopa is still considered a first use drug, but the search for other more effective pharmacological options is proceeding. Several other classes of drugs that have been suggested or tried, include dopamine reuptake blockers, to keep dopamine in the synapse longer and enhance its ability to signal, and drugs that prevent the enzymatic breakdown of dopamine to keep it active longer (Johnston and Brotchie, 2004). These drugs have had

PAGE 29

19 therapeutically relevant effects, but due to the progressive nature of PD, their efficiency decreases with the increase in cellular degeneration. Surgical Therapies Surgical intervention for PD preceeded the development of pharmacological intervention strategies by several decades. Until L-dopa was used, the standard treatment for those willing to undertake it was a surgical lesion of the globus pallidus (Ansari et al., 2002; Valldeoriola et al., 2002; Walter and Vitek, 2004). As outlined previously, the globus pallidus sends an inhibitory output to the striatum, as part of the feedback mechanism of the basal ganglia. A lesion of the globus pallidus removes this inhibitory output, and effectively enhances the excitatory signal from the SNc to the striatum. More recently, surgical interventions have begun to use deep brain stimulators in an attempt to block inhibitory outputs to the striatum in an effort to enhance the SNc excitation to the striatum (Lozano and Eltahawy, 2004; Diamond and Jankovic, 2005; Lyons and Pahwa, 2005). Deep brain stimulations precise mechanism of action is not clearly understood, but it is believed that the electrical impulses either induce a depolarizing block on the cells, preventing them from firing, or the electrical impulses may desynchronize electrical oscillations present in basal ganglia loops. Abnormal oscillations in firing patterns have been theorized to underlie the abnormal motor movements in the PD, and may also be present during ON medication phases, explaining side effects such as dyskinesia (Silberstein et al., 2005). Cell Replacement Therapies A recent addition to the therapeutic options for PD, has been cell replacement therapy. This approach seeks to replace, using stem cells or fetal progenitors, the lost dopaminergic SNc neurons. Initial experiments performed in the late 1980s showed

PAGE 30

20 proof of principle for cell replacement strategies and had promising results. Many of the first open label trials showed evidence of significant improvement with patients reporting decreased need for L-dopa treatment, and an increased level of dopamine uptake in the putamen (Hauser et al., 1999). Further double blind studies were better able to quantify graft effects and found that the age of the PD patient was a significant factor in the level of improvement the patient experienced (Freed et al., 2001). Another factor in the variable outcome is the variable number of surviving graft neurons. Recent reports have contested the negative analysis of transplants, arguing that the effect seen is positive and beneficial, considering that the trend in behavioral testing scores showed steady improvement. In addition the beneficial effects observed were due to the few cells that survived transplant. As transplantation techniques improve and cell survival increases then clinical improvements should also increase (Isacson et al., 2001). There has been significant debate about the development of post-operative dyskinesias. These abnormal motor movements have been reported in various frequencies in graft patients ranging from 15% (Freed et al., 1992) to 56.5% (Olanow et al., 2003). The underlying mechanism for the development of these dyskinesias remains elusive, but one interesting hypothesis is that the type of neurons being placed into the brain is not the appropriate cell type. A9 type neurons are specific to the SNc region and among their distinguishing features is the expression of the dopamine reuptake transporter D2. This autoreceptor helps modulate dopamine release from these cells and is thought to underlie the strength and modulation of the signal from the SNc to the striatum. A10 type cells lack this autoreceptor and in transplant grafts, a mixture of the two cell types is used. With a portion of the cells releasing dopamine in a non modulated fashion, the signaling

PAGE 31

21 pattern may be disrupted leading to the development of dyskinesias (Isacson et al., 2003). As further refinements of cell differentiation and selection occur the ability to transplant cells without these side effects should improve.

PAGE 32

CHAPTER 3 MATERIALS AND METHODS Neurosphere Culture and Asteron Cell Characterization Generation of Neurospheres Postnatal day 1-10 (P1-P10) C57BL/6 mice (The Jackson Laboratory, USA) deeply anesthetized by hypothermia and decapitated. The SEZ and cerebellar cortex were removed, and dissociated into a single-cell suspension as previously described (Laywell et al., 2002). Cells were then plated into standard T25 tissue culture flasks in growth medium consisting of DMEM/F12 containing N2 supplements, 5% fetal bovine serum (FBS; Atlanta Biologicals, USA), 20ng/mL epidermal growth factor (EGF; Sigma, St. Louis), and 10ng/mL basic fibroblast growth factor (bFGF; Sigma). After 1-2 days, floating cells were collected, centrifuged, trypsinized, triturated into a single-cell suspension, and counted. A secondary culture was initiated by resuspending cells in growth medium (with or without BrdU), and plating them into ultra low attachment polystyrene 6-well plates (Corning, USA) at densities ranging from 1x10 3 to 1x10 5 cells/cm 2 Neurospheres became apparent within 3-5 days. Differentiation and Immunolabeling of Spheres To promote differentiation, spheres were placed into a drop of differentiation medium (DMEM/F12 + N2 supplements + 5% FBS, with or without on coverglass coated sequentially with polyornithine and laminin (10g/mL and 5g/mL, respectively; Sigma, USA). Some neurospheres were plated in the presence of 10M bromodeoxyuridine (BrdU; Sigma, USA) in order to label proliferating cells. Eighteen 22

PAGE 33

23 hours to 4 weeks after plating, coverslips were fixed with 4% paraformaldehyde in PBS, and processed for immunofluorescence as described (Laywell et al., 2000) with a variety of antibodies, including monoclonal (Promega, USA) and polyclonal (Covance, Richmond, CA) antibodies against the neuronal cytoskeletal protein -III tubulin, monoclonal and polyclonal antibodies against the astrocyte intermediate glial fibrillary acidic protein (GFAP), (Immunon, USA), a monoclonal antibody against the neuronal nuclear protein NeuN (Chemicon, USA), polyclonal antibodies against the astrocyte-associated calcium binding protein S100 (Swant, Switzerland). For detection of BrdU, cells were first incubated in 1:1 formamide:2x SSC for 2 hr. at 65 o and 2N HCl for 30 min. at 37 o After equilibrating for 10 min. in borate buffer, cells were immunolabeled with a monoclonal rat antibody against the thymidine analog BrdU (Abcam, USA) in combination with anti-GFAP and anti-III tubulin antibodies. After washing and applying appropriate fluorescent secondary antibodies (Molecular Probes, USA), the cells were counterstained with Hoechst 33342 fluorescent nuclear stain (Sigma, USA), coverslipped, and viewed with epifluorescence or confocal microscopy. Images were captured on a Spot camera and Spot software and Adobe Photoshop were used to adjust contrast and brightness to more closely resemble images seen under the microscope. In Situ Hybridization with GFAP cDNA GFAP cDNA probes were generated by RT-PCR amplification of a 401bp DNA fragment from neonatal mouse brain tissue with a pair of primers designed with the Primer 3 program ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ), using the GFAP sequence from the Genebank database (gi: 26080421). Forward primer: GCCACCAGTAACATGCAAGA; Reverse primer: ATGGTGATGCGGTTTTCTTC. The PCR product was cloned into the PCR4 TOPO vector (Invitrogen, USA). After

PAGE 34

24 linearization, plasmids extracted from clones of both directions were used as templates to synthesize digoxigenin (DIG)-labeled GFAP sense and antisense probes using the T7 RNA polymerase (1277073 Roche, USA). The hybridization protocol followed the method of Braissant and Wahli (Braissant and Wahli, 1998), with a probe concentration of 400ng/ml, and the hybridization temperature set at 45C. Hybridized probe was immunodetected with a monoclonal antibody against DIG (Roche, USA) using alkaline phosphatase as the chromagen. Finally, hybridized cells were processed for immunolabeling with antibodies against GFAP and -III tubulin, as described above. Analysis of Cell Death Apoptotic cells within plated spheres were visualized using a fluorometric terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay (G3250 USA) according to the manufacturers recommendations. This assay measures the fragmented DNA of apoptotic cells by incorporating fluoroscein-labeled dUTP at the 3 ends of DNA strands. As a positive control, some spheres were processed for TUNEL following 30 min. incubation with DNase. Alternatively, activated caspase 3, an enzyme present in early stages of apoptosis, was detected in plated spheres using an anti-activated caspase 3 antibody (BD Pharmingen, USA). As a positive control, some spheres were treated with staurosporine (1g/ml for 4 hours at 37 o C) prior to immunolabeling. Following TUNEL processing or caspase 3 labeling, spheres were immunolabeled as above with antibodies against -III tubulin, and counterstained with Hoechst 33342 (Sigma, USA).

PAGE 35

25 Cell death was quantified by counting the number of TUNEL+ or caspase 3+ nuclei within every sphere on each of three coverslips (range = 12-15 spheres/coverslip). The criterion for apoptotic neurons was intentionally liberal to avoid undercounting. All TUNEL+ or caspase 3+ cells contacting a -III tubulin+ process were counted as apoptotic neurons. Electrophysiology Spheres plated for 48 to 96 hours were used to assess membrane properties of asterons. Coverslips were placed in a recording chamber perfused with artificial cerebrospinal fluid (ACSF) containing (in mM) 124 NaCl, 26 NaHCO 2 1.25 NaH 2 PO 4 2.5 KCl, 2 CaCl 2 1 MgCl 2 20 D-glucose, oxygenated with 95% O 2 and 5% CO 2 giving a pH of 7.4. All recordings were performed at room temperature (22C). Putative neurons, astrocytes, and asterons were visually identified using infrared DIC videomicroscopy with a fixed-stage microscope equipped with a 40X, 0.8 W water-immersion lens (Zeiss, Germany), and whole-cell patch-clamp recordings were performed. Patch electrodes had a resistance of 6-8 M when filled with intracellular solution containing (in mM): 120 K-gluconate, 8 NaCl, 10 HEPES, 4 Mg ATP, 0.3 Na 3 GTP, 0.2 EGTA, 0.1% biocytin (pH 7.3 with KOH, osmolarity 290-300 mOsm). Cells were recorded under either current-clamp or voltage-clamp mode using an Axopatch 1D amplifier (Axon Instruments, USA). Series resistance was 10-25 M and cells were rejected if resistance changed more than 10% throughout the recording session. Action potentials were observed in current-clamp mode by injecting a number of current steps (from -50 pA to 150 pA, in 50pA increments). Na + and K + currents were studied in voltage-clamp mode. Cells were held at -65 mV, and steps of voltage were

PAGE 36

26 imposed (from -80mV to 55mV, with 15 mV increments). Maximum Na + current usually occurred when cells were held at -5 mV or 10 mV. The magnitude of K + current was measured at the steady part of the trace of the last step (55mV). Action potentials and Na-currents were abolished by adding 1M TTX (Sigma, USA). Recorded cells were filled with biocytin, and visualized by application of an avidin-AMCA conjugate (Vector, USA). Cell phenotypes were confirmed by immunolabeling the biocytin-filled cells with antibodies against GFAP and -III tubulin, as above ECM Effects on Neurosphere Migration Cells were isolated from postnatal days 3 to 5 C57BL/6 mice pups. Neurospheres were prepared as described above. The matrices tested were laminin, fibronectin, and CSPG. Glass coverslips were incubated for 24 h with poly-L-ornithine, followed by 8 h incubation with laminin (L-2020, Sigma, USA), fibronectin (F-4759, Sigma, USA), or CSPG (C-9819, Sigma, USA). Spheres were seeded onto each coverslip in N2 media containing 5% FBS and 10 ug/ml of EGF and FGF-2. At 24, 48, 72, and 144 h coverslips from each condition were removed and fixed with ethanol/acetic acid for 30 min. Immunohistochemistry for the neuron-specific protein B-III tubulin (Covance, USA) and the astrocyte specific intermediate filament protein glial fibrillary acidic protein (GFAP) (Immunon, USA) was performed to assess cell differentiation. Hoechst nuclear staining was performed to visualize cell migration outward from the neurosphere. Measurements were performed with a Leica compound fluorescence microscope and SPOT software (Diagnostic Instruments Inc., USA). Migration distance was calculated as a straight line measurement from the edge of the sphere to the farthest

PAGE 37

27 defined edge of the migratory cell boundary. Velocity data were defined as total distance migrated over time. Measurements were analyzed using the Students t test. Slice Culture Preparation Slice cultures were generated from postnatal day 7 to 15 (n=10), with a total of 48 slices cultured for this study. See Figure 3-1 for the preparation outline. Briefly, animals were euthanized under halothane, and their brains were cut at the midline into two sagittal halves. These halves were then superglued, medial surface down to the vibratome stage, covered in cool, molten 2% agar, and immersed in cold preparation media (DMEM F12, 100 ug/mL L-ascorbic acid, 2 mM L-glutamate, and antibiotic/antimycotic (Invitrogen, USA)). 300-400 uM thick slices were cut using a vibratome (Leica S1000, Germany), transferred to a Petri dish with cold preparation media, and scanned using a dissection microscope (4X magnification) to select slices. Typically 4-6 mid-sagittal slices per animal from the levels 0.8-2.0 mM lateral from midline were obtained (Franklin, 1996). Slices were then immediately transferred to a transwell membrane inset (#3650, Falcon,USA), placed in a 6 well plate, and incubated at humidified 35 degrees C and 5% CO2. Each inset was suspended in 1 mL of A media, containing 25 % horse serum (Kluge et al., 1998). A media was sequentially replaced by thirds with a serum free DMEM F12 based B media, containing B27, and N2 supplements (Invitrogen, USA) until day 7 when cultures contained only B media (Benninger et al., 2003; Scheffler et al., 2003). 6-Hydroxy Dopamine Nigrostriatal Lesions For nigrostriatal lesion studies the dopaminergic neurotoxin 6-OHDA (Sigma, USA) was used. 6-OHDA was applied either prior to slices being placed on the

PAGE 38

28 membrane, submerged in 20 mM 6-OHDA/saline for 10 min, or 7 days after plating. For 7 day old cultures, all media was replaced with sterile saline and the slices submerged in 20 mM 6OH-DA/saline with 25% mannitol, for 10 minutes. Mannitol was used to disrupt the glial scar and enhance 6-OHDA penetration into the slice. After treatment all saline and 6-OHDA were aspirated and replaced with B media. Embryonic Stem Cell Neural Precursor Transplants ESNPs were derived from GFP expressing R1 ES cells (Hadjantonakis et al., 1998) and cultured as described by Okabe et al (Okabe et al., 1996). TH expression was induced in cells using bFGF (10 ng/ml), FGF8 (100 ng/ml), SHH (500 ng/ml), PTN (100 ng/ml) (Sigma, USA) which were added to the culture media every day 50-100,000 cells were transplanted using a 5 uL Hamilton syringe to deliver 2 uL to the region around the substantia nigra or directly onto the striatum. For cotransplants with laminin, 50 ug of laminin was added to a mixture of cells, 2% methylcellulose, and B media for transplant. Immunocytochemistry and Quantification For morphological and phenotype analysis, slices were slices were fixed with 4% paraformaldehyde for at least 24 h at 4 C. Sections were then either processed as whole mounts or embedded in paraffin and sections cut at 10 um. Immunocytochemistry for tyrosine hydroxylase (1:1000, polyclonal, Chemicon, USA), GFP (1:1000, Sigma, USA), Nissl (NeuroTrace, Molecular Probes, USA) and DAPI (Vector, USA) was performed on these sections to assay slice viability as well as ESNP survival and integration. Sections were mounted on slides and incubated in primary antibody overnight at 4 C. Labeling with fluorescent secondary antibodies (Molecular Probes, USA) was performed at room temperature for one hour. DiI labeling

PAGE 39

29 was performed using a DiI paste (Molecular probes, USA) applied using a 16 gauge needle tip. Paste was applied to the striatum of slices after one week in culture. Cell counts were performed on 10 uM sections. Serial sections, at least 40 uM apart were analyzed. TH+ and Nissl/DAPI+ cells in the SNc were counted, and the counts averaged across conditions. For striatal density, digital photos were taken of the striatum under the same shutter and gain settings. Image J (NIH, USA) was used to calculate the mean grey value of a random region of the striatum. All measurements were individually normalized to the grey value of adjacent cortex to account for staining variations. All counts and intensity data was analyzed using GraphPad Prism (Graphpad.com, USA). Electrophysiology of Slice Culture Transplants Culture media was removed and slices were placed into a holding chamber continuously perfused with oxygenated artificial cerebrospinal fluid (aCSF) containing, in mM: 125 NaCl, 3 KCl, 26 NaHCO 3 1.25 NaH 2 PO 4 20 glucose, 1 MgCl 2 and 2 CaCl 2 and maintained at 35 C during experiments. Intracellular pipette solution comprised of, in mM: 145 K-gluconate, 10 HEPES, 10 EGTA, and 5 MgATP (pH 7.2, osmolarity 290). For experiments in which post-synaptic currents were recorded, 145 K-gluconate was replaced with 125 KCl and 20 K-gluconate. Recordings were performed with an Axopatch-1D (Axon Instruments, USA) and filtered at 5 kHz. Clampex 8.2 (Axon Instruments, USA) was used to deliver command potentials and for data collection. Series resistances were < 20 M and checked frequently to ensure that they did not deviate. During current-clamp experiments a step protocol was utilized in which currents

PAGE 40

30 between 10-100 pA were applied per step. Clampfit 8.2 (Axon Instruments, USA) was used to analyze voltage and current traces. Figure 3-1. Slice Culture Protocol Schematic. Slice cultures are generated from postnatal mice brains. A) After the brain is removed, th e cerebellum is removed and the hemispheres are se parated. B) Hemispheres are then superglued to a vibratome stage and covered in molten agar to support the tissue during sectioning. After sectio ning, slices are selected from the appropriate level for culture. C) Secti ons for 6-OHDA treatment are bathed in a 20 mM solution for 10 min prior to plating and the media is changed on the samples as indicated in the timeline.

PAGE 41

CHAPTER 4 RESULTS Neural Stem Cell Differentiation and the Asteron Phenotype Shortly after the initiation of sphere differentiation by plating onto adhesive substrata, combined -III tubulin/GFAP immunolabeling reveals distinct neuron/astrocyte mixtures (Fig. 4-1A, B), in which no individual cells are seen co-expressing these markers. During the first day post-plating, immature neurons are apparent as small, rounded cells with relatively short processes (Fig. 4-1). Over the next 1-2 days, the neuronal phenotype begins to mature as they start to show a more fibroblastic soma in combination with longer, branching processes (Fig. 4-1B). Shortly after this stage, exclusively -III tubulin+ neurons can be seen combining fine neuronal-like processes with wide, flattened cell bodies characteristic of astrocytes (Fig. 4-1C). By 5-6 days post-plating, there are few cells left that exclusively express -III tubulin, while the number of co-expressing asterons reaches its maximum level (Fig. 4-1D). Asterons continue to display flatter, more stellate morphologies (Fig. 4-1E), and in the second post-plating week show a wide, flat, fibroblastic morphology typical of cultured astrocytes (Fig. 4-1F). During this transition period of neuronal decline and asteron increase, cells with all three phenotypes (neuron, astrocyte, and asteron) can often be seen in a single, high magnification field of view (Fig. 4-2A), arguing against the interpretation that the asteron phenotype results simply from antibody cross-reactivity. Likewise, confocal microscopy of individual asterons reveals that antibodies for neuronal and glial 31

PAGE 42

32 markers are co-localized within the same cell, and it appears that these markers label separate populations of subcellular elements within the same cell (Fig. 4-2B-D), suggesting that the asteron phenotype is not the result of antibody cross-reactivity or epifluorescence bleed-through. Combinations of monoclonal anti--III tubulin + polyclonal anti-GFAP, and polyclonal anti--III tubulin + monoclonal anti-GFAP co-label hybrid asteron cells equivalently. Combination of Asteron Markers In addition to -III tubulin and GFAP, asterons also co-label with a combination of monoclonal anti--III tubulin and polyclonal anti-S100. Again, some but not all -III tubulin+ cells are also immunopositive for S100 (Fig. 4-3A & insets). Likewise, asterons are immunolabeled with antibodies against GFAP and the neuronal protein, MAP2 (data not shown). However, when we combine polyclonal anti-GFAP with monoclonal anti-NeuN, a protein thought to be restricted to fully mature neurons, we never observe cells expressing both markers (25 spheres examined), even though it is clear from positive controls that both antibodies are present at optimal concentrations for immunolabeling (data not shown). Finally, combining GFAP cDNA in situ hybridization with -III tubulin and GFAP immunolabeling shows that cells transcribing astrocyte-associated mRNA are immunopositive for both gliaand neuron-associated cytoskeletal proteins (Fig 4-3B, C). Analysis of Cell Death Neurons (i.e. cells exclusively expressing neuronal phenotype markers) become apparent immediately after spheres attach to substrate and begin differentiation, then decrease in number until, after approximately two weeks, they are no longer detectable.

PAGE 43

33 The observed decrease in neuron number is paralleled by an increase in asteron cells co-expressing neuronal and glial phenotype markers, and it is this inverse relationship that originally led us to hypothesize that neurons in these cultures undergo a phenotypic transformation into hybrid neuron/astrocytic cells. A partial alternative to this hypothesis, though, is that the reduction in neuronal cells is due simply to cell death. In order to determine if cell death plays a significant role in neuronal reduction, we used two methods to analyze apoptosis in cerebellar-derived spheres: TUNEL and caspase 3 immunolabeling. We focused our apoptosis analysis on the six days immediately after sphere plating, since this time window corresponds to the vast majority of neuron/asteron inversion. At all time points assessed only a small number of sphere-derived cells are TUNEL+ (Fig.4-4B, compare to +control in 4A). Quantification of sphere composition (including both the penumbral and the central sphere mass) with respect to neurons, astrocytes, and TUNEL+ cells (Fig. 4C) shows that even if all of the TUNEL+ cells represented dying neurons, it could not account for the dramatic reduction in neuron number during the first few days after plating. The TUNEL analysis is mirrored very closely by immunodetection of the early apoptosis marker, activated caspase 3; again, only a small number of sphere cells at all time points analyzed are caspase+, and only a fraction of these cells (6% of all caspase+ cells) are immunopositive for IIItubulin (Figure 4-5). Physiological Properties of Hybrid Asterons Electrophysiological recording of 20 candidate neurons, astrocytes, and asterons reveals that retrospectively identified asterons (Fig. 4-6A,B) have a varied electrophysiological profile. Clearly-identified neurons show both K+ and Na+ channels, a depolarizing spike, and resting membrane potentials of -70 mV or lower (Fig 4-6C),

PAGE 44

34 whereas astrocytes show large K+ channels, small (or no) Na+ channels, no depolarizing spike, and resting membrane potentials usually greater than -70 mV (Fig. 7G). Asterons show wide variability in resting membrane potential (-52 to -78 mV), but consistently display K+ currents with relative amplitudes that place them between the amplitudes seen for neuronal and astrocytic K+ currents. We found examples of asterons that display physiological profiles that resemble astrocytes (Fig. 4-6F; compare to 4-6G), though with lower amplitude K+ current. In addition, one confirmed asteron showed intermediate amplitude K+ channels, neuron-like Na+ channels, and a Na+ spike that could be abolished by the administration of TTX (Fig. 4-6D&E). The relative amplitude of the K+ current among the different cell types, combined with the presence or absence of significant Na+ channels suggests that as cells transition into asterons from neurons, they begin to turn off Na+ channel expression and upregulate K+ channel amplitude. Extracellular Matrix Influence on Neurosphere Migration Neurospheres derived from both SVZ and cerebellar niches developed in culture and when plated on adherent substrates generated robust numbers of neurons and glial cells (Figure 4-7). The results indicate that cells generated from neurospheres display differential migration patterns on the three different ECM substrates tested. Analyzing the distance migrated outward from the edge of the sphere to the furthest observed cell allowed us to generate a plot of migratory velocity, and of total distance migrated. Laminin and fibronectin allow multipotent neurosphere cells to migrate faster compared to CSPG. After 24 h, spheres on all substrates attached and cells began to migrate outward in a radial pattern. Laminin showed a significantly faster migration velocity compared to

PAGE 45

35 CSPG, but the difference between fibronectin and laminin was not significant. Although not reaching the level of statistical significance, the difference between fibronectin and CSPG was consistent between trials and did appear to favor migration on fibronectin. At 48 h fibronectin showed a significant difference from both laminin and CSPG in outgrowth velocity, and laminin contributed to a significantly faster cell migration compared to CSPG. At 72 h laminin gave rise to no significant difference in velocity from fibronectin, but both fibronectin and laminin substrates generated significantly faster migratory rates of neurosphere cells compared to CSPG. At 144 h the velocities for all the substrates decreased, suggesting a loss of migratory capacity in the maturing cell population. Total migratory distance followed the same pattern of ECM preference as migration velocity. At 24 h laminin showed a significantly larger outgrowth over CSPG, and fibronectin showed a large but not significant difference over CSPG. At 48 h the increase in fibronectin velocity led to a significant difference in migration distance over both laminin and CSPG. At 72 h, laminin and fibronectin both maintained a significant increase in outgrowth distance over CSPG. This same pattern continued at 144 h. The values obtained for the migration velocities on laminin and fibronectin prior to 144 h are in accordance with cell migration rates reported in slice culture studies by Komuro and Rakic (1995), who observed an average velocity of 13.9 uM/h for migrating cerebellar granule cells in cerebellar slice cultures. This is in agreement with our data showing that the maximal velocity for neurosphere cells on fibronectin at 48 h was 13.94 uM/h and for laminin 12.86 uM/h at 72 h. The velocity data suggests a maturing cell population that begins to mature and cease migrating around 144 h. This decrease does

PAGE 46

36 not seem to be distance-related, as each substrate showed a deceleration with significant differences in the migration distance. In addition, whereas the assay does not discriminate between random and directed migration, the radial outward pattern of migration and the lack of asymmetric migration suggests that there is little directed migration (Figure 4-10). Since all substrates exhibited this pattern of nondirected migration we concluded that distance and velocity measures were affected only by matrix composistion. We did not note any difference in neuron/glial percentages between the different ECM substrates that were tested. Nigrostriatal Slice Culture Long-term parasagittal slice cultures demonstrated good viability all the way through 4 weeks in culture. Figure 4-11A shows staining for TH, with robust expression in the SNc, the medial forebrain bundle (MFB) and the striatum, after 3 weeks in culture. In parasagittal slices of postnatal mouse brains, there are 2-3 400 m thick slices with both the SNc and striatum present from each side, with the MFB also being present between these structures. Figure 4-11B shows DiI labeling of a slice 4 days after application. There is extensive label within the DiI application points in the striatum, and labeled fibers and cells away from the application in the nigral region (Fig. 4-11B), suggesting active transport of the dye through intact fibers. Axon tracing using a 10,000 MW dextran tracer (Fluro-Ruby) placed in the striatum show labeled cells in the cortex (e.g. layer V) and in the nigral area (Fig. 4-11C). Taken together, these data show that long term parasagittal slice cultures retain a sufficient three dimensional organization to functionally model their in vivo correlates.

PAGE 47

37 6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures Exposure of the slices to 6-OHDA caused a significant reduction in the number of SNc TH positive neurons. Figure 4-12A shows the TH staining of a slice exposed to 6-OHDA at the time of initial plating, with an almost complete lack of staining in the striatum, and a significant reduction in the medial forebrain bundle and SNC after 3 weeks in culture. Cell counts of lesioned slices showed a significant (P=0.0092) 46% % decrease in TH+ cell bodies in the SNc (4-12B). In addition, there was also a significant (P=0.0172) reduction, 60% 6%, in the striatal TH density (Fig 4-12C). Nova-red visible chromagen staining (Figure 4-13 A,B) showed robust TH staining throughout the entire nigrostriatal circuit. Lesioned slices showed a similar pattern staining loss as the fluorescent labeling. We did note a difference in dorsal compared to ventral striatal labeling. This is likely due to the sparing of the ventral tegmental area dopamine neurons in the midbrain which preferentially project to the ventral striatum and are less susceptible to 6-OHDA lesioning. High magnification views of the slice cultures also show characteristic lesion-induced changes. Figure 4-14A shows the effect of 6-OHDA on the SNc of slice cultures. In control slices the SNc is morphologically intact with discrete TH staining and a clear cytoarchitecture including fine intranigral fibers. 6-OHDA lesioned slices show a loss of discrete labeling and a reduction in the number of clearly identified cell bodies and intranigral fibers. In the striatum, the loss of TH staining is very pronounced in the lesioned slices (Figure 4-14B). Nova-red staining for TH confirmed the results of fluorescent antibody labeling. High magnification views of the striatum showed a significant reduction in TH staining compared to control slices after 2 weeks in culture (4-15 A,B). High magnification views

PAGE 48

38 of the SNc (Figure 4-16 A,B) also showed a reduction in TH staining in lesioned slices. We noted a reduction in non-specific punctuate labeling with the nova-red staining over the fluorescent secondary antibodies suggesting that the visible chromagen method may be the preferred method for visualizing the effect of lesions on the slices. The trade off is that the current nova-red technique has difficulty in resolving cell bodies in control slices due to the staining intensity. Further refinement of the staining methods should enhance the ability to visualize cell bodies in control and lesioned slices. Real Time Analysis of Nigrostriatal Degeneration The use of slices from animals expressing GFP under the control of the TH promoter shows that 6-OHDA exposure causes a loss of GFP expression confirming a similar loss of TH+ cells and fibers in this transgenic mouse model Using slice cultures from the TH-EGFP mouse, it was possible to track, in living slices the loss of GFP signal which corresponded to the loss of dopaminergic innervation. Our initial results demonstrated a strong GFP signal localized to the striatum and the SNc (Figure 4-17). When slices were treated with 6-OHDA prior to their culture, GFP was significantly reduced in the striatum within 4 days of plating. The control GFP signal remained strong for at least a week in culture, suggesting that the culture conditions are amenable to keeping the nigrostriatal circuit intact. Nigrostriatal Slice Culture Applications Using the 6-OHDA lesion model system we have begun to screen a variety of potential therapeutic options. The majority of the work has been done on dennervated slices using ES derived neuronal precursors to try and repair and reconnect damaged circuitry. These cells have demonstrated a robust survival in slice cultures preparations and are amenable to manipulation prior to transplantation. We have examined the effect

PAGE 49

39 of laminin on ESNP migration and integration into the slice culture. In vitro and in vivo experiments were performed to induce a dopaminergic phenotype in the ESNP cells, in order to replace the cell type lost in Parkinsons. Given the ease of manipulation and access to the slice culture and the transplanted cells we have also demonstrated functional characterization of implanted ESNPs. Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice Cultures ESNPs transplanted into slice cultures remained viable for up to 4 weeks in culture. When initially plated the cells tended to exist as aggregates that cells slowly migrated out from. Figure 4-18 shows ESNPs implanted on the slice after 6 days in culture. After 3 weeks in culture, ESNPs were observed throughout the implantation area and possessed a more mature phenotype with processes and expression of neural cytoskeletal markers, such as MAP2 (Figure 4-19). Adding laminin to the ESNP transplant mixture enhanced the outgrowth of cells through the slice culture. Within 6 days in the presence of laminin, cells had dispersed out in the slice and there was a lack of cellular aggregation seen with laminin (Figure 4-20, 4-21). Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice Cultures ESNP integration into the slice culture appeared robust, with many of the cells developing extensive processes (Figure 4-22). ESNPs implanted into the slice culture striatum matured and were able to integrate into the slice culture circuitry. Electrophysiological recording from an ESNP in the striatum showed that the cell was capable of generating an action potential and responded to post synaptic currents, suggesting that the cell was receiving inputs from surrounding neurons in the striatum.

PAGE 50

40 Figure 4-23 shows a mature ESNP in the striatum, and shows the recorded cell and the electrophysiologal traces that were performed on the cell within the slice. The ultimate goal of transplantation regeneration is to replace the cell population lost in the degeneration and to have the transplant reside in the anatomically correct location. Preliminary results with transplants near the intact SNc have shown that ESNPs are able to mature in this region and survive (Figure 4-24). Dopaminization of Transplantable Cell Populations Dopamine Neuron Generation from ESNP Culture In Vitro Culturing ESNPs in the presence of FGF8, SHH, and FGF8, enhanced the differentiation of these cells into dopamine neurons. Our results with a 7 day induction protocol showed an approximate 10-fold increase in the number of TH+ neurons generated compared to non-induced controls (Figure 4-25). In vitro dopaminized ESNPs matured rapidly on laminin coated coverslips and extended long processes. Figure 4-26 shows the typical morphology of in vitro dopaminized ESNPs. Dopamine Neuron Generation from ESNP Cultures in Slice Culture Using our slice culture model system we showed the ability of ES derived neurons to mature and integrate within the culture environment. Our next step involved manipulating the cells that we were transplanting in order to try and selectively replace the population of neurons that was lost in our lesion model, the dopaminergic neurons of the SNc. Various strategies have been attempted to try and induce a dopaminergic phenotype in cells, ranging from genetic knock-ins of transcriptions factors to culture in the presence of cytokines and growth factors. Using a combination strategy of two of the more potent cytokine induction methods, we were able to enhance dopaminergic neuron generation in our ESNP cultures, and obtained interesting results using this induction method on other

PAGE 51

41 cell populations. In the slice cultures, dopaminized ESNPs survived for at least 2 weeks in the slice and exhibited morphological maturation. We observed transplanted dopaminized neurons located in ectopic locations such as the striatum and cortex (Figure 4-27). In general these neurons had robust process extension, but did not appear to have any sort of directed growth Dopaminization of Adult Stem Cell Cultures Given the success of the cytokine cocktail on inducing a dopamine phenotype, preliminary work has begun on inducing adult stem cell neuroblasts to a dopaminergic phenotype. The initial results have suggested that adult neural stem cells can be induced using cytokines, but that the effect is more limited than in ES derived neurons (Figure 4-28). In addition we noted a lack of co-localization of TH with neuronal markers. While this does not rule out the possibility that these cells are neuronal, it does raise the issue of whether non-neuronal cell types can be induced to express TH (Figure 4-29).

PAGE 52

42 Figure 4-1. Combined -III tubulin and GFAP immunolabeling reveals the temporal progression of the asteron phenotype. A) Shortly after initiation of differentiation, spheres contain non -overlapping populations of cells immunopositive for either -III tubulin (red), or GFAP (green). No cells are seen co-expressing both markers (inset in A, higher magnification). B) Twenty-four hours post-plating, spheres still contain cells with mutually exclusive -III tubulin (red)/GFAP(green) labeling patterns, but neuronal morphology is more mature (inset in B). C) Phenotypic heterogeneity is increased two days after plating, with cells that co-label with both neuron (red) and astrocyte (green) markers (arro w pointing to yellow cell). D) At three days post-plating, few cells exclusively expressing -III tubulin can be seen, and the number of co-expressing as terons increases. E) At five days neurons are very scarce, and co-expre ssing asterons display astrocytic morphologies. Inset in (E) shows a higher magnification of an asteron at this stage. F) By six days co-expressing cells show a wide, flat, fibroblast-like morphology typical of cultured astrocytes.

PAGE 53

43 Figure 4-2. Antibodies against -III tubulin and GFAP reveal three immunophenotypes, and label separate sub-cellular elements within asterons. A) -III tubulin+ neurons (red), GFAP+ astrocytes (green), and co-expressing asterons (yellow) can be seen in close proximity with no evidence of antibody cross-reactivity. B-D) Confocal microscopy shows the co -localization of both immunomarkers in a single z-axis of an asteron. Scale bar in (A) applies to all panels.

PAGE 54

44 Figure 4-3. Asterons co-express -III tubulin with S100, and transcribe GFAP mRNA Two days after plating, some cells (e.g. arrows) are co-labeled with both the astrocyte calcium-binding protein S100 and -III tubulin (A). Not all -III tubulin+ cells are also S100 + (lower left inset in A: arrow indicates a cell exclusively expressing -III tubulin), indicating that the staining pattern does not result from antibody cro ss-reactivity. Lower ri ght inset in (A) shows higher magnification of a double-labeled asteron. (B&C). Some cells that hybridze GFAP cDNA (asterisk in B) also immunolabel for GFAP and -III tubulin (asterisk in C). Inset in (B) shows that -III tubulin+ neurons (red) do not hybridize GFAP cDNA.

PAGE 55

45 Figure 4-4. Asteron appearance corresponds with neuronal reduction that is not attributable to apoptotic cell loss. A) TUNEL staining reveals cells undergoing apoptosis in control DNAse-tr eated sphere cells. B) Untreated sphere cells plated for three days C) The temporal relationship among neurons, asterons, and apoptotic cells. As neurons (blue line) decrease, there is a corresponding increase in asterons (green line). TUNEL (red line) shows that there is a steady rate of 1-3 apoptotic cells pe r sphere during the first week after plating.

PAGE 56

46 Figure 4-5. Caspase 3 analysis of cell death accords well with TUNEL data. Histogram shows that the level of cell death de tected with caspase 3 immunolabeling during the first week afte r plating corresponds remark ably well with the level of TUNEL staing. Apoptosis was induced w ith staurosporine in spheres plated for 48 hours as a positive control (red bar).

PAGE 57

47 Figure 4-6. Physiology of neurons, astrocytes, and asterons. A) Candidate asterons immunolabeled for -III tubulin (red) and GFAP (green) were voltage clamped. B) Patched cells were filled with biocy tin (blue) duri ng recording and later immunostained C) Voltageclamp recordings demonstrate the Na+ and K+ current pr ofiles of a typical neuron. D) Tracing of an asteron possessing Na+ and K+ currents. E) TTX exposure blocks the Na+ current activity of this cell. F) Another example of an as teron shows no Na+ current, and a more astrocytic K+ current. G) A trace from a typical astrocyte shows a large amplitude K+ current with no Na+ current.

PAGE 58

48 Figure 4-7. Phenotype immunostaining of neurosphere derived cells. Neurosphere derived cells immunolabeled for -III tubulin (red) and GFAP (green) show evidence of morphologically maturing neurons on the astrocyte monolayer.

PAGE 59

49 Figure 4-8. Velocity plot of neurosphere derived cells on different ECM substrates. Velocity plots show that the different ECM substrates have variable effects on neurosphere cell speed. Laminin and fibr onectin show the fastest migration speeds, while CSPG significantly sl ows down cell migration. Cells on all substrates begin to show a decrease in speed after 72 hours in culture.

PAGE 60

50 Figure 4-9. Migration distances of neurosphere derived cells on ECM substrates. Neurosphere derived cells show significan t differences in migration distance on different ECM substrates. Laminin and fibronectin show the longest migration distances with CSPG signifi cantly reducing cell migration distance.

PAGE 61

51 Figure 4-10. Neurosphere derived cell migration patterns and measurements.Cells migrating from neurospheres migrate in a radial pattern outward from the sphere core. A) Neurosphere derived cel ls on laminin after 144 h in culture. B) Neurospere derived cells on fibr onectin after 144 h in culture. C) Neurosphere derived cells on CSPG after 144 h in culture.

PAGE 62

52 Figure 4-11. Slice culture viability and nigrostriatal circuit maintenance. A) Montage of TH staining in an intact slice after 2.5 weeks in culture. Inset into A is a nuclear stain of the hippocampus showing the intact cytoarchitecture. B) DiI tracing within a slice after 4 days in culture with the application points in the striatum and backfilled cells in the SNc. C) Dextran tracing of an intact slice after 3 days in culture. Arrows represen t application points in the striatum and there are labeled cells in the SNc and the cortex (Higher magnification insets of these regions).

PAGE 63

53 Figure 4-12. 6-OHDA lesion of nigrostriatal slice cultures. A) TH staining of a slice culture that was exposed to 20 mM 6-OHDA. B) Histogram showing the percent reduction in SNc cell bodies, P<0.05. C) Reduction in optical density of TH staining.

PAGE 64

54 Figure 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry. A) Intact control slice culture after 2 weeks in culture. The nigrostriatal circuit, including SNc, MFB, and striat um are all preserved and show intense labeling. B) A 6-OHDA lesioned slice, after 2 we eks in culture. The TH staining is reduced, notably in th e SNc and in the dorsal striatum.

PAGE 65

55 Figure 4-14. Cytoarchitectural changes in 6-OHDA lesion slice. A) TH staining in the SNc of control and lesioned slices. B) TH staining in the striatum in control and lesioned slice.

PAGE 66

56 Figure 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. A) Striatal TH labeling in a c ontrol slice culture striatum after 2 weeks in culture. B) Striatal labeling in a 6-OHDA lesioned striatum after two weeks in culture.

PAGE 67

57 Figure 4-16. Nova-red staining of the SNc reveals loss of staining after exposure to 6OHDA. A) Representative sections from control slice cultures after 1-2 weeks in culture. B) Representative sections from slice cultures after 1-2 weeks in cultur e after exposure to 6-OHDA. Slices exposed to 6-OHDA show a significant reduction in staining intens ity and in observable cell bodies.

PAGE 68

58 Figure 4-17. Real time analysis of TH-GFP. A) Control slices show intense GFP labeling in the striatum at 4 and 7 days. B) 6-OHDA treated slices at the same time points show a significant decrease in GFP intensity suggesting a loss of dopaminergic fibers.

PAGE 69

59 Figure 4-18. ESNP transplants into slice cultures. Transplanted ESNPs after 6 days in the slice culture appear as cellular aggreg ates with little evidence of migration into the slice tissue. Figure 4-19. Long term ESNP transplants in slice cultures. After 23 days in culture, ESNPs have migrated through the slice culture and in this high magnification view can be seen extending processes through the slice. In set shows a MAP2 positive GFP+ neuron, showing that the transplanted cells are expressing neuronal markers.

PAGE 70

60 Figure 4-20. Laminin enhances ESNP migration through slice cultures After 6 days in cultures, ESNPs that were transplanted in the presence of soluble laminin show an increased spread through the slice culture and less cellular aggregation. Figure 4-21. Laminin enhances process outgrowth of ESNPs in slice cultures. After 6 days in culture, ESNPs, under high magnification, show evidence of extensive process outgrowth, comparable to ESNPs not treated with laminin after 3 weeks in culture.

PAGE 71

61 Figure 4-22. GFP+ ESNP striatal transplant. GFP+ ESNP located in the striatum after 2 weeks in culture. This ESNP demonstr ates a significant level of maturation with extensive process arborizati on. Red is TH staining showing the dopaminergic fibers running into the st riatum, green is GFP and blue is a nuclear counter stain.

PAGE 72

62 Figure 4-23. Electrophysiological Characterization of Transplanted Cells. (A) GFP+ ESNP cell in the striatum with patc h clamp. B)Tracing indi cating that the patched cell has the capability to ge nerate an action potential. C) Tracing showing that the cell exhibits post synaptic currents. Figure 4-24. ESNPs located near the substantia nigra. ESNPs located near the SNc show survival and process extension after 2 weeks in culture, suggesting that this region is capable of supporting ESNP engraftment.

PAGE 73

63 Figure 4-25. Increase in TH+ neurons derived from ESNPs exposed to ventralizing agents. Figure 4-26. In vitro ESNP dopaminization.. ESNPs cultured on laminin coated coverslips, under the influence of indu cing cytokines, express TH and show a high level of maturation including extensive process extension.

PAGE 74

64 4-27. Dopaminized ESNPs implanted into slice cultures TH+ ESNP cells were observed in slice cultures 2 weeks after transplantation. The cells were generally seen in isolation, with el aborate short distance processes. Cells were implanted into the striatum and were observed in the striatum and neighboring cortex.

PAGE 75

65 Figure 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH. Cultured adult neual stem cells can be treated with FGF8, SHH, and pleiotropin to induce TH expr ession in a subset of cells. Red is beta III tubulin and green is TH.

PAGE 76

66 Figure 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH, and pleiotrophin. Panel A shows TH+ cells, Panel B is beta III tubulin positive cells and Panel C shows the merged image with a nuclear counterstain.

PAGE 77

CHAPTER 5 DISCUSSION AND CONCLUSIONS Adult neural stem cells and ES derived neurons represent two populations of cells that may be amenable to repair and regeneration within the central nervous system. One of the biggest challenges to utilizing stem cells effectively is controlling cell migration, differentiation, and integration into damaged tissue. Our initial work with adult neurosphere cultures focused on cell fate determination. In these experiments we observed a hybrid cell type that we termed asterons that appeared to posses characteristics of both neurons and astrocytes. Further analysis of neurosphere cells on different ECM molecules allowed us to generate migration profiles that have identified ECM molecules that enhance migration of neural stem cells. In order to better understand how stem cells behave in the neuronal environment we have developed a novel slice culture bioassay system. Using this slice culture model system we can observe in real time the fate choice and integration potential of both adult and embryonic stem cells. Stem cell repair of damaged circuits within the brain is a key area of stem cell therapy and our slice culture bioassay focused on examining stem cell behavior in a model of Parkinsons disease. Characterizing and manipulating stem cell fate choice is a critical component of utilizing stem cells for regeneration based therapies. Without the ability to make the right type of cell, stem cell based therapies would be ineffective or potentially more harmful to the patient. In addition, basic questions of cell phenotype and cellular developmental processes can be examined using stem cells as a recapitulation of cellular differentiation. 67

PAGE 78

68 Our initial experiments on adult neural stem cell derived neurosphere cells allowed us to examine postnatally derived glial and neuronal development. Our observations indicated a time dependent decrease in the neuronal population, coincident with the appearance of the hybrid cell type asterons. Our hypothesis was that a subset of neurons in the neurosphere cultures was transdifferentiating from early immature neurons into glial cells. Our data showed that only immature neuronal markers, such as beta III tubulin, co-localized with astrocyte markers such as GFAP in asterons. Mature markers, such as NeuN did not co-localize with any glial markers. This suggests that the asteron is only expressing immature markers of differentiation. Electrophysiological recording from asterons showed an variable intermediate profile of membrane currents and potential. Compared to neurons, asterons tend to lose Na+ currents, show increased K+ amplitude and generally have a lower resting membrane potential. However we did observe asterons that were capable of generating action potentials that could be blocked using Na+ channel blockers. Cell death analysis did not show any significant levels of neuronal apoptosis, suggesting that not all of the neuronal loss was due to cell death. All of the evidence then supports are hypothesis that neurosphere derived early neurons may be capable of altering their cell fate choice during early development. While there is no reliable evidence for asterons in vivo, there have been several reports of cells that appear to have intermediate properties. Some GFAP+ cells derived from human embryonic CNS stem cells can exhibit spontaneous neuronal firing patterns in vitro (Gritti et al., 2000), and a GluR-expressing astrocyte in the hippocampus has been described that may represent an intermediate cell type (referred to as an astron) that possesses glial properties, but may have begun to express neuronal genes (Matthias et al.,

PAGE 79

69 2003). While it is possible that the asteron may only represent an in vitro state, it does suggest that environmental factors can be used to alter cell fate choice, and in addition generate unique cell type. An intriguing possibility is that the asteron represents an open ended state of stem cell differentiation. At this stage the asteron may be more receptive to exogenous influences to determine cell fate as well as certain intrinsic programs. Damage to these intrinsic developmental programs has been linked to the development of tumors derived from stem cells (Perryman and Sylvester, 2006). In addition there have been reports of cells similar to asterons isolated from cortical brain tumors of humans (Ignatova et al., 2002). The asteron therefore could be an in vitro representation of an in vivo stem cell state that allows for differentiation, but may also represent a state where oncogenic disruptions might initiate tumor formation. Our next area of study using these adult neural stem cell derived cells was to examine the effect of extracellular matrix molecules on cell fate choice as well as physical properties of migration. Extracellular matrix molecules have long been shown to affect cell migration and differentiation, both in vivo and in vitro. Neural stem cells in particular are normally restricted to their germinal zones through the use of inhibitory and permissive ECM. Neurosphere derived cells plated on laminin and fibronectin showed and enhanced migration capacity, compared to CSPG substrate. Our results indicated that neural stem cells on all tested substrates demonstrated a time dependant increase, then decrease, in migration velocity. This pattern is suggestive of a maturing cell population that becomes less mobile, and more morphologically mature. The velocity data also shows that fibronectin and laminin are more permissive for neural stem cell and daughter

PAGE 80

70 cell migration than CSPG. There was no appreciable difference in cell fate, suggesting that the adult neural stem cell does not respond to these ECM molecules in determining fate. Given the predictable nature of neural stem cell behavior on these substrates it becomes feasible to generate scaffolds for neural stem cell transplants or as bridges for endogenous stem cell migration. Permissive substrates placed inside the rostral migratory stream could hypothetically be used to transport endogenous stem cells to the site of an injury. This scaffold could be seeded with cytokines and transcription factor activators that could be used to induce SVZ stem cells into the appropriate cell type for repair. Working within the in vitro cell culture model provides advantages in observation and manipulation, but does not provide enough information regarding how in vivo environments and conditions may interact with cell transplants. Since cell transplants are being aggressively targeted for neurodegenerative disorders, we decided to focus our stem cell characterization and manipulation on a model of Parkinsons disease. Based on our observations using adult neurosphere derived cells, we needed a system where we could track over time the differentiation and migration of cells within the model. Organotypic slice cultures represent a novel culture method that combines advantages of in vitro and in vivo environments. By maintaining the cytoarchitecture of the brain, cell transplants are exposed to factors and environmental conditions similar to in vivo transplants. In addition slice cultures allow for the direct manipulation and observation of transplanted cells. Developing a novel mid-sagittal slice culture system that maintains an intact nigrostriatal circuit was our first challenge. Once we accomplished creating the slice model, our experiments demonstrated that both embryonic and adult stem cell fate determination is dependent on the interplay of many different factors. The ability to

PAGE 81

71 observe and manipulate these cells inside the neuronal environment is critical to better understand how these transplants might behave in patients. Cell transplants are being developed as a therapy for neurodegenerative diseases. Our slice culture model provides a suitable paradigm to model nigrostriatal degeneration and allows for a Parkinsons disease in a dish system. This novel system maintains an intact connection between the circuit components throughout the entire culturing period, as opposed to other slice culture paradigms that rely on regrowth of axons in culture to recreate connections in the dish. This model system can be used to observe the endogenous cells within the slice, as well as test a variety of toxic or therapeutic agents. Using 6-OHDA we have selectively degenerated the nigrostriatal circuit and generated a model of PD that is amenable to testing therapeutic options such as stem cell replacement therapies. Exposure to 6-OHDA induced a significant level of nigrostriatal degeneration, causing an approximate 46% reduction in SNc cell bodies and a 60% reduction in striatal dopamine innervation. These reductions are in the rage of those seen in early to mid stage PD, and represent a reasonable level of degeneration at which to test cell replacement strategies. This model system is also amenable to future lesion options. Initial work is being done on other potential toxic lesions, including using proteosome inhibitors. Previous work using these compounds in animal models has shown degeneration in the nigrostriatal circuit and evidence of lewy bodies inclusions. This toxin model may more accurately model the progressive nature of PD, and recreate the key pathological hallmark of intracellular inclusions. Using this toxin in a slice culture model should allow for a detailed examination of how intracytoplasmic inclusions may initiate cellular

PAGE 82

72 degeneration. Real time observation of cell states during inclusion generation may yield clues as to what cellular processes or insults precipitate lewy body formation. Besides toxic lesions, the availability of genetic mutants has allowed for the examination of specific mutations on the development of neurodegeneration. Mutants such as the alpha synuclein, and parkin mutations have provided valuable insight as to what biochemically occurs in neuronal cells with known PD mutations. Slice cultures allow for the examination of these mutant models, independent of co-morbidity factors that are often present in these mutants. An example of this is the weaver mutation. Weaver mutants display a severe cerebellar dysfunction and exhibit ataxia, as well as progressive degeneration in the nigrostriatal circuit with a specific loss of A9 dopamine neurons in the SNc (Triarhou, 2002). The mutation linked to weaver, the GIRK2 potassium channel mutation, has been shown to be important in A9 dopaminergic SNc neurons genesis and survival (Triarhou et al., 1988). While this mutant shows some useful features of PD, its limited lifespan, postnatal day 21 usually, makes it a difficult animal model. We have cultured weaver brain slice cultures past this day 21 mark and initial results suggest that the viability of non affected regions are not significantly reduced. Since the cause of death in most of the mutants is a failure to thrive due to motor deficits, the slice culture model is an effective way to track the ongoing degeneration caused by the mutation independent of the animal. As more mutations are discovered in familial and sporadic PD, the number of mutant models will increase, and this slice culture model system represents a promising methodology to rapidly screen mutant disease progression and therapeutic efficiencies.

PAGE 83

73 ES cell derived neurons were implanted into slice cultures and survived and integrated into the host tissue. This integration may be enhanced by the addition of permissive ECM molecules that would increase cellular migration and process extension. Experiments presented here have shown that adult neural stem cells show an increase in migratory potential on laminin and fibronectin over CSPG. Based on these results, the seeding of neural stem cells in different matrices may allow for a precise and directed migratory pattern. Further development of ECM substrates may allow for the development of grafts that could redirect endogenous stem cells to areas of damage and degeneration and allow for in situ regeneration. The presence of laminin with our transplanted ESNPs enhanced their migratory potential and integration into the slice. This observation may have important clinical implications as stem cell transplantation strategies become more refined. The addition of permissive ECM molecules to stem cell transplants in clinical settings may allow for better cell survival and integration. ECM molecules have been implicated in ES derived neuron maturation and phenotype fate. Understanding what ECM molecules direct ES cell fate choice it may be possible to replicate this in transplants. As a general rule the more immature a cell is the better chance that it has to survive and integrate into a host environment. Being able to implant less mature ES derived neurons that can complete their maturation and development within the host would allow for a better integration. Directing ES and adult neural stem cells toward the appropriate phenotype is a critical step in ensuring that the cells being transplanted respond in the correct physiological manner. Our results with FGF8, SHH, and pleiotrophin, demonstrated that cytokine exposure is a potent paradigm for inducing TH expression in ES derived

PAGE 84

74 neurons and to a lesser extent adult neural stem cells. While the tested cells are positive for tyrosine hydroxylase, there is still little evidence that these cells are actively releasing dopamine. Future work on these induced cells will hopefully be able to analyze conditioned media from these cells and assay the presence of dopamine or its metabolites in the media. Even with appropriate release of dopamine, there are still hurdles in reconnecting the circuitry. Recent evidence from patients treated with fetal dopaminergic cells has suggested that the incidence of dyskinesia, abnormal and exaggerated motor movements, is the result of inappropriate dopamine release, and loss of dopamine reuptake, from the transplanted cells. Within the ventral mesencephalon there are two distinct groups of dopamine cells, the A9 and A10 type cells. A9 cells of the SNc are involved in the motor pathway and express dopamine autoreceptors that modulate dopamine release. A10 cells of the ventral tegmental area are involved in reward pathways with dopamine release, and lack the autoreceptor feedback. Since A9 and A10 cells are both part of the transplanted cell mixture put into the damaged striatum, there is the potential for unregulated dopamine release that can lead to the dyskinesia.. Along with ESNPs we examined the use of adult stem cells as an inducible cell population. Our initial results suggest that adult derive neural stem cells could be induced to generate TH+ cells. Further work to be done on fine tuning the dopaminergic phenotype will likely focus on genetic manipulation, through induction of SNc specific transcription factors. Analysis of different dopaminergic populations to better understand which genetic factors are involved in the final differentiation should allow for production of tailored neurons that provide the correct signal output. Coupled with the information

PAGE 85

75 on stem cell behavior on various substrates, this presents a possible transplantation enhancement strategy for use in cell replacement therapies in neurodegenerative diseases. Nigrostriatal slice cultures provide an adaptable and scalable methodology for gene therapy based approaches for prevention and/or treatment of Parkinsons disease. Gene therapy systems using AAV or Lentiviral vectors to introduce growth factors such as brain derived growth factor (BDNF) or glial derived growth factor (GDNF) into animal models of nigrostriatal degeneration (Bjorklund, 2000) The ability to deliver gene therapy agents directly to the brain regions of interest reduces the difficulty associated with this procedure as well as allowing for a smaller volume to be more precisely delivered. In addition there is initial data on the efficacy of using a polymer based gene therapy system (Hofland, 1996) to introduce genes into glioblastomas located within slice cultures. One of the most promising potential applications for this slice culture model system is the ability to do high throughput screening of compounds that either increase cellular degeneration or ones that prevent it. Slice cultures allow for more experiments per animal and for direct manipulation of the tissue and the environment. Using slice cultures from the TH-GFP animals we have been able to show proof of concept that these slices can provide a read out of TH innervation in real time. Using 6-OHDA we have noted a significant reduction in GFP intensity within the striatum compared to control slices that have been in culture for over a week. Using this system a large number of compounds could be assayed and effects over time measured. Given the epidemiological data for pesticides and heavy metal exposure, the TH-GFP slice culture system may provide a

PAGE 86

76 way to track how important factors such dose and time of exposure are for the potential toxicity of these compounds. The research presented here describes a novel slice culture model system that provides a Parkinsons in a dish model system. Using this and in vitro cultures, we have examined ES and adult neural stem cell differentiation, migration and integration under a variety of conditions. Our results suggest that stem cells are greatly influenced by their environment. Factors present during their culture can induce cell fate choices, and can even promote hybrid cell types not normally seen in vivo. Extracellular matrix molecules, such as laminin and fibronectin, can enhance stem cell migration, while ECM such as chondroitin sulfate inhibits cell migration. In slice cultures laminin enhances stem cell migration and morphological maturation. As stem cell therapy becomes more widely available the need for information on how to condition these cells prior to transplantation and how to best deliver and control them during and after transplantation will be key to harnessing the power of these cells to rebuild damaged circuits and restore function.

PAGE 87

LIST OF REFERENCES Albin RL, Young AB, Penney JB (1995) The functional anatomy of disorders of the basal ganglia. Trends Neurosci 18:63-64. Altman J (1969a) Autoradiographic and histological studies of postnatal neurogenesis. 3. Dating the time of production and onset of differentiation of cerebellar microneurons in rats. J Comp Neurol 136:269-293. Altman J (1969b) Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell proliferation and migration in the anterior forebrain, with special reference to persisting neurogenesis in the olfactory bulb. J Comp Neurol 137:433-457. Altman J, Das GD (1965) Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol 124:319-335. Altman J, Das GD (1966) Autoradiographic and histological studies of postnatal neurogenesis. I. A longitudinal investigation of the kinetics, migration and transformation of cells incorporating tritiated thymidine in neonate rats, with special reference to postnatal neurogenesis in some brain regions. J Comp Neurol 126:337-389. Anden NE, Dahlstroem A, Fuxe K, Larsson K (1965) Further Evidence for the Presence of Nigro-Neostriatal Dopamine Neurons in the Rat. Am J Anat 116:329-333. Anden NE, Dahlstrom A, Fuxe K, Larsson K (1966) Functional role of the nigro-neostriatal dopamine neurons. Acta Pharmacol Toxicol (Copenh) 24:263-274. Anden NE, Carlsson A, Dahlstroem A, Fuxe K, Hillarp NA, Larsson K (1964) Demonstration and Mapping out of Nigro-Neostriatal Dopamine Neurons. Life Sci 15:523-530. Ansari SA, Nachanakian A, Biary NM (2002) Current surgical treatment of Parkinsons disease. Saudi Med J 23:1319-1323. Benninger F, Beck H, Wernig M, Tucker KL, Brustle O, Scheffler B (2003) Functional integration of embryonic stem cell-derived neurons in hippocampal slice cultures. J Neurosci 23:7075-7083. 77

PAGE 88

78 Betarbet R, Sherer TB, Greenamyre JT (2005) Ubiquitin-proteasome system and Parkinson's diseases. Exp Neurol 191 Suppl 1:S17-27. Blandini F, Nappi G, Tassorelli C, Martignoni E (2000) Functional changes of the basal ganglia circuitry in Parkinson's disease. Prog Neurobiol 62:63-88. Bjorklund A, Kirik D, Rosenblad C, Georgievska B, Lundberg C, Mandel RJ (2000) Towards a neuroprotective gene therapy for Parkinson's disease: use of adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the nigrostriatal system in the rat Parkinson model. Brain Res 886:82-98. Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW, McMahon SB (2002) Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416:636-640. Bradley A, Evans M, Kaufman MH, Robertson E (1984) Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309:255-256. Braissant O, Wahli W (1998) Differential expression of peroxisome proliferator-activated receptor-alpha, -beta, and -gamma during rat embryonic development. Endocrinology 139:2748-2754. Brazelton TR, Rossi FM, Keshet GI, Blau HM (2000) From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290:1775-1779. Brotchie JM, Lee J, Venderova K (2005) Levodopa-induced dyskinesia in Parkinson's disease. J Neural Transm 112:359-391. Castellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy bodies in Parkinson's disease. Acta Neuropathol (Berl) 100:111-114. Cha GH, Kim S, Park J, Lee E, Kim M, Lee SB, Kim JM, Chung J, Cho KS (2005) Parkin negatively regulates JNK pathway in the dopaminergic neurons of Drosophila. Proc Natl Acad Sci U S A 102:10345-10350. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A (2003) Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643-655. Deane KH, Spieker S, Clarke CE (2004) Catechol-O-methyltransferase inhibitors for levodopa-induced complications in Parkinson's disease. Cochrane Database Syst Rev:CD004554. Diamond A, Jankovic J (2005) The effect of deep brain stimulation on quality of life in movement disorders. J Neurol Neurosurg Psychiatry 76:1188-1193.

PAGE 89

79 Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1999a) Regeneration of a germinal layer in the adult mammalian brain. Proc Natl Acad Sci U S A 96:11619-11624. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999b) Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97:703-716. Draper JS, Andrews PW (2002) Embryonic stem cells: advances toward potential therapeutic use. Curr Opin Obstet Gynecol 14:309-315. Dunnett SB, Rogers DC, Richards SJ (1989) Nigrostriatal reconstruction after 6-OHDA lesions in rats: combination of dopamine-rich nigral grafts and nigrostriatal "bridge" grafts. Exp Brain Res 75:523-535. Franklin BJ, Paxinos, G.T. (1996) The Mouse Brain in Stereotaxic Coordinates. New York: Academic Press. Freed CR, Rosenberg NL, Schneck SA, Breeze RE (1992) Improved drug responsiveness following fetal tissue implant for Parkinson's disease. Neurochem Int 20 Suppl:321S-327S. Freed CR, Greene PE, Breeze RE, Tsai WY, DuMouchel W, Kao R, Dillon S, Winfield H, Culver S, Trojanowski JQ, Eidelberg D, Fahn S (2001) Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med 344:710-719. Gasser T (2005) Genetics of Parkinson's disease. Curr Opin Neurol 18:363-369. Gates MA, O'Brien TF, Faissner A, Steindler DA (1993) Neuron-glial interactions during the in vivo and in vitro development of the nigrostriatal circuit. J Chem Neuroanat 6:179-189. George EL, Georges-Labouesse EN, Patel-King RS, Rayburn H, Hynes RO (1993) Defects in mesoderm, neural tube and vascular development in mouse embryos lacking fibronectin. Development 119:1079-1091. Gerlach M, Riederer P (1996) Animal models of Parkinson's disease: an empirical comparison with the phenomenology of the disease in man. J Neural Transm 103:987-1041. Gerlach M, Double KL, Ben-Shachar D, Zecca L, Youdim MB, Riederer P (2003) Neuromelanin and its interaction with iron as a potential risk factor for dopaminergic neurodegeneration underlying Parkinson's disease. Neurotox Res 5:35-44. Gibb WR, Lees AJ (1988) The relevance of the Lewy body to the pathogenesis of idiopathic Parkinson's disease. J Neurol Neurosurg Psychiatry 51:745-752.

PAGE 90

80 Glinka Y, Gassen M, Youdim MB (1997) Mechanism of 6-hydroxydopamine neurotoxicity. J Neural Transm Suppl 50:55-66. Gorell JM, Johnson CC, Rybicki BA, Peterson EL, Kortsha GX, Brown GG, Richardson RJ (1997) Occupational exposures to metals as risk factors for Parkinson's disease. Neurology 48:650-658. Gould E, Reeves AJ, Graziano MS, Gross CG (1999) Neurogenesis in the neocortex of adult primates. Science 286:548-552. Greenamyre JT, Betarbet R, Sherer TB (2003) The rotenone model of Parkinson's disease: genes, environment and mitochondria. Parkinsonism Relat Disord 9 Suppl 2:S59-64. Grimpe B, Dong S, Doller C, Temple K, Malouf AT, Silver J (2002) The critical role of basement membrane-independent laminin gamma 1 chain during axon regeneration in the CNS. J Neurosci 22:3144-3160. Gritti A, Rosati B, Lecchi M, Vescovi AL, Wanke E (2000) Excitable properties in astrocytes derived from human embryonic CNS stem cells. Eur J Neurosci 12:3549-3559. Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A (1998) Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 76:79-90. Hauser RA, Freeman TB, Snow BJ, Nauert M, Gauger L, Kordower JH, Olanow CW (1999) Long-term evaluation of bilateral fetal nigral transplantation in Parkinson disease. Arch Neurol 56:179-187. Heikkila RE, Sonsalla PK (1992) The MPTP-treated mouse as a model of parkinsonism: how good is it? Neurochem Int 20 Suppl:299S-303S. Hirsch EC, Faucheux BA (1998) Iron metabolism and Parkinson's disease. Mov Disord 13 Suppl 1:39-45. Hofland HE, Shephard L, Sullivan SM (1996) Formation of stable cationic lipid/DNA complexes for gene transfer. Proc Natl Acad Sci U S A 93:7305-7309. Ianus A, Holz GG, Theise ND, Hussain MA (2003) In vivo derivation of glucose-competent pancreatic endocrine cells from bone marrow without evidence of cell fusion. J Clin Invest 111:843-850. Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA (2002) Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia 39:193-206.

PAGE 91

81 Isacson O, Bjorklund L, Pernaute RS (2001) Parkinson's disease: interpretations of transplantation study are erroneous. Nat Neurosci 4:553. Isacson O, Bjorklund LM, Schumacher JM (2003) Toward full restoration of synaptic and terminal function of the dopaminergic system in Parkinson's disease by stem cells. Ann Neurol 53 Suppl 3:S135-146; discussion S146-138. Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 Suppl 3:S26-36; discussion S36-28. Johnston TH, Brotchie JM (2004) Drugs in development for Parkinson's disease. Curr Opin Investig Drugs 5:720-726. Joseph C, Chassan JB, Koch ML (1978) Levodopa in Parkinson disease: a long-term appraisal of mortality. Ann Neurol 3:116-118. Jung CG, Hida H, Nakahira K, Ikenaka K, Kim HJ, Nishino H (2004) Pleiotrophin mRNA is highly expressed in neural stem (progenitor) cells of mouse ventral mesencephalon and the product promotes production of dopaminergic neurons from embryonic stem cell-derived nestin-positive cells. Faseb J 18:1237-1239. Kearns SM, Laywell ED, Kukekov VK, Steindler DA (2003) Extracellular matrix effects on neurosphere cell motility. Exp Neurol 182:240-244. Kearns SM, Scheffler B, Goetz AK, Lin DD, Baker HD, Roper SN, Mandel RJ, Steindler DA (2006) A method for a more complete in vitro Parkinson's model: Slice culture bioassay for modeling maintenance and repair of the nigrostriatal circuit. J Neurosci Methods. Keller GM (1995) In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7:862-869. Kluge A, Hailer NP, Horvath TL, Bechmann I, Nitsch R (1998) Tracing of the entorhinal-hippocampal pathway in vitro. Hippocampus 8:57-68. Kornack DR, Rakic P (2001) Cell proliferation without neurogenesis in adult primate neocortex. Science 294:2127-2130. Kress GJ, Reynolds IJ (2005) Dopaminergic neurotoxins require excitotoxic stimulation in organotypic cultures. Neurobiol Dis. Kuhn HG, Dickinson-Anson H, Gage FH (1996) Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci 16:2027-2033.

PAGE 92

82 Lai BC, Marion SA, Teschke K, Tsui JK (2002) Occupational and environmental risk factors for Parkinson's disease. Parkinsonism Relat Disord 8:297-309. Landolt RM, Vaughan L, Winterhalter KH, Zimmermann DR (1995) Versican is selectively expressed in embryonic tissues that act as barriers to neural crest cell migration and axon outgrowth. Development 121:2303-2312. Laywell ED, Dorries U, Bartsch U, Faissner A, Schachner M, Steindler DA (1992) Enhanced expression of the developmentally regulated extracellular matrix molecule tenascin following adult brain injury. Proc Natl Acad Sci U S A 89:2634-2638. Laywell ED, Rakic P, Kukekov VG, Holland EC, Steindler DA (2000) Identification of a multipotent astrocytic stem cell in the immature and adult mouse brain. Proc Natl Acad Sci U S A 97:13883-13888. Laywell ED, Kukekov VG, Suslov O, Zheng T, Steindler DA (2002) Production and analysis of neurospheres from acutely dissociated and postmortem CNS specimens. Methods Mol Biol 198:15-27. Laywell ED, Kearns SM, Zheng T, Chen KA, Deng J, Chen HX, Roper SN, Steindler DA (2005) Neuron-to-astrocyte transition: phenotypic fluidity and the formation of hybrid asterons in differentiating neurospheres. J Comp Neurol 493:321-333. Linert W, Herlinger E, Jameson RF, Kienzl E, Jellinger K, Youdim MB (1996) Dopamine, 6-hydroxydopamine, iron, and dioxygen--their mutual interactions and possible implication in the development of Parkinson's disease. Biochim Biophys Acta 1316:160-168. Lois C, Alvarez-Buylla A (1993) Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci U S A 90:2074-2077. Lozano AM, Eltahawy H (2004) How does DBS work? Suppl Clin Neurophysiol 57:733-736. Lucking CB, Durr A, Bonifati V, Vaughan J, De Michele G, Gasser T, Harhangi BS, Meco G, Denefle P, Wood NW, Agid Y, Brice A (2000) Association between early-onset Parkinson's disease and mutations in the parkin gene. French Parkinson's Disease Genetics Study Group. N Engl J Med 342:1560-1567. Lyons KE, Pahwa R (2005) Long-term benefits in quality of life provided by bilateral subthalamic stimulation in patients with Parkinson disease. J Neurosurg 103:252-255.

PAGE 93

83 Magavi SS, Leavitt BR, Macklis JD (2000) Induction of neurogenesis in the neocortex of adult mice. Nature 405:951-955. Martin MJ, Muotri A, Gage F, Varki A (2005) Human embryonic stem cells express an immunogenic nonhuman sialic acid. Nat Med 11:228-232. Matthias K, Kirchhoff F, Seifert G, Huttmann K, Matyash M, Kettenmann H, Steinhauser C (2003) Segregated expression of AMPA-type glutamate receptors and glutamate transporters defines distinct astrocyte populations in the mouse hippocampus. J Neurosci 23:1750-1758. McNaught KS, Bjorklund LM, Belizaire R, Isacson O, Jenner P, Olanow CW (2002) Proteasome inhibition causes nigral degeneration with inclusion bodies in rats. Neuroreport 13:1437-1441. Moon LD, Brecknell JE, Franklin RJ, Dunnett SB, Fawcett JW (2000) Robust regeneration of CNS axons through a track depleted of CNS glia. Exp Neurol 161:49-66. Morrison SJ, Shah NM, Anderson DJ (1997) Regulatory mechanisms in stem cell biology. Cell 88:287-298. Mueller JC, Fuchs J, Hofer A, Zimprich A, Lichtner P, Illig T, Berg D, Wullner U, Meitinger T, Gasser T (2005) Multiple regions of alpha-synuclein are associated with Parkinson's disease. Ann Neurol 57:535-541. Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372-376. Novak U, Kaye AH (2000) Extracellular matrix and the brain: components and function. J Clin Neurosci 7:280-290. Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD (1996) Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech Dev 59:89-102. Olanow CW, Goetz CG, Kordower JH, Stoessl AJ, Sossi V, Brin MF, Shannon KM, Nauert GM, Perl DP, Godbold J, Freeman TB (2003) A double-blind controlled trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol 54:403-414.

PAGE 94

84 Olanow CW, Agid Y, Mizuno Y, Albanese A, Bonuccelli U, Damier P, De Yebenes J, Gershanik O, Guttman M, Grandas F, Hallett M, Hornykiewicz O, Jenner P, Katzenschlager R, Langston WJ, LeWitt P, Melamed E, Mena MA, Michel PP, Mytilineou C, Obeso JA, Poewe W, Quinn N, Raisman-Vozari R, Rajput AH, Rascol O, Sampaio C, Stocchi F (2004) Levodopa in the treatment of Parkinson's disease: current controversies. Mov Disord 19:997-1005. Pals P, Lincoln S, Manning J, Heckman M, Skipper L, Hulihan M, Van den Broeck M, De Pooter T, Cras P, Crook J, Van Broeckhoven C, Farrer MJ (2004) alpha-Synuclein promoter confers susceptibility to Parkinson's disease. Ann Neurol 56:591-595. Pankratz N, Foroud T (2004) Genetics of Parkinson disease. NeuroRx 1:235-242. Parkinson J (1817) An Essay on the Shaking Palsy. London: Whittingham and Rowland. Perryman SV, Sylvester KG (2006) Repair and regeneration: opportunities for carcinogenesis from tissue stem cells. J Cell Mol Med 10:292-308. Petit A, Kawarai T, Paitel E, Sanjo N, Maj M, Scheid M, Chen F, Gu Y, Hasegawa H, Salehi-Rad S, Wang L, Rogaeva E, Fraser P, Robinson B, St George-Hyslop P, Tandon A (2005) Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations. J Biol Chem 280:34025-34032. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 276:2045-2047. Priyadarshi A, Khuder SA, Schaub EA, Shrivastava S (2000) A meta-analysis of Parkinson's disease and exposure to pesticides. Neurotoxicology 21:435-440. Rakic P (1985) DNA synthesis and cell division in the adult primate brain. Ann N Y Acad Sci 457:193-211. Rogers SL, Letourneau PC, Palm SL, McCarthy J, Furcht LT (1983) Neurite extension by peripheral and central nervous system neurons in response to substratum-bound fibronectin and laminin. Dev Biol 98:212-220. Rosegay H (1944) An experimental investigation of the connections between the corpus striatum and the substantia nigra in the cat. Journal of Comparative Neurology 80:293-321.

PAGE 95

85 Rybicki BA, Johnson CC, Peterson EL, Kortsha GX, Gorell JM (1999) A family history of Parkinson's disease and its effect on other PD risk factors. Neuroepidemiology 18:270-278. Scheffler B, Schmandt T, Schroder W, Steinfarz B, Husseini L, Wellmer J, Seifert G, Karram K, Beck H, Blumcke I, Wiestler OD, Steinhauser C, Brustle O (2003) Functional network integration of embryonic stem cell-derived astrocytes in hippocampal slice cultures. Development 130:5533-5541. Shimura H, Schlossmacher MG, Hattori N, Frosch MP, Trockenbacher A, Schneider R, Mizuno Y, Kosik KS, Selkoe DJ (2001) Ubiquitination of a new form of alpha-synuclein by parkin from human brain: implications for Parkinson's disease. Science 293:263-269. Silberstein P, Oliviero A, Di Lazzaro V, Insola A, Mazzone P, Brown P (2005) Oscillatory pallidal local field potential activity inversely correlates with limb dyskinesias in Parkinson's disease. Exp Neurol 194:523-529. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication causes Parkinson's disease. Science 302:841. Smeyne RJ, Jackson-Lewis V (2005) The MPTP model of Parkinson's disease. Brain Res Mol Brain Res 134:57-66. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336:688-690. Steindler DA, Cooper NG, Faissner A, Schachner M (1989) Boundaries defined by adhesion molecules during development of the cerebral cortex: the J1/tenascin glycoprotein in the mouse somatosensory cortical barrel field. Dev Biol 131:243-260. Steindler DA, O'Brien TF, Laywell E, Harrington K, Faissner A, Schachner M (1990) Boundaries during normal and abnormal brain development: in vivo and in vitro studies of glia and glycoconjugates. Exp Neurol 109:35-56. Steindler DA (1993) Glial boundaries in the developing nervous system. Annu Rev Neurosci 16:445-470.

PAGE 96

86 Takagi Y, Takahashi J, Saiki H, Morizane A, Hayashi T, Kishi Y, Fukuda H, Okamoto Y, Koyanagi M, Ideguchi M, Hayashi H, Imazato T, Kawasaki H, Suemori H, Omachi S, Iida H, Itoh N, Nakatsuji N, Sasai Y, Hashimoto N (2005) Dopaminergic neurons generated from monkey embryonic stem cells function in a Parkinson primate model. J Clin Invest 115:102-109. Theise ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, Henegariu O, Krause DS (2000) Liver from bone marrow in humans. Hepatology 32:11-16. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM (1998) Embryonic stem cell lines derived from human blastocysts. Science 282:1145-1147. Treloar HB, Nurcombe V, Key B (1996) Expression of extracellular matrix molecules in the embryonic rat olfactory pathway. J Neurobiol 31:41-55. Triarhou LC (2002) Biology and pathology of the Weaver mutant mouse. Adv Exp Med Biol 517:15-42. Triarhou LC, Norton J, Ghetti B (1988) Mesencephalic dopamine cell deficit involves areas A8, A9 and A10 in weaver mutant mice. Exp Brain Res 70:256-265. Ungerstedt U (1968) 6-Hydroxy-dopamine induced degeneration of central monoamine neurons. Eur J Pharmacol 5:107-110. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, Gonzalez-Maldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ, Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160. Valldeoriola F, Martinez-Rodriguez J, Tolosa E, Rumia J, Alegret M, Pilleri M, Ferrer E (2002) Four year follow-up study after unilateral pallidotomy in advanced Parkinson's disease. J Neurol 249:1671-1677. Walter BL, Vitek JL (2004) Surgical treatment for Parkinson's disease. Lancet Neurol 3:719-728. Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA (1996) Multipotent CNS stem cells are present in the adult mammalian spinal cord and ventricular neuroaxis. J Neurosci 16:7599-7609. Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD, Carpenter MK (2001) Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 19:971-974.

PAGE 97

87 Youdim MB, Ben-Shachar D, Riederer P (1989) Is Parkinson's disease a progressive siderosis of substantia nigra resulting in iron and melanin induced neurodegeneration? Acta Neurol Scand Suppl 126:47-54. Zeng X, Cai J, Chen J, Luo Y, You ZB, Fotter E, Wang Y, Harvey B, Miura T, Backman C, Chen GJ, Rao MS, Freed WJ (2004) Dopaminergic differentiation of human embryonic stem cells. Stem Cells 22:925-940. Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM (2000) Parkin functions as an E2-dependent ubiquitinprotein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci U S A 97:13354-13359. Zipori D (2005) The stem state: plasticity is essential, whereas self-renewal and hierarchy are optional. Stem Cells 23:719-726.

PAGE 98

BIOGRAPHICAL SKETCH Sean Kearns was born October 29 th 1977 in Gainesville, Florida and attended Eastside high schools International Baccalaureate (I.B.) program where a psychology class sparked his interest in neuroscience. Sean attended the University of Florida and received his degree in neuroscience in 2000. From there he decided to pursue neuroscience in the newly completed McKnight Brain Institute. A fortuitous meeting with Dr. Dennis Steindler led Sean to the new and exciting field of stem cell biology. Sean pursued his Ph.D. doing research relating to Parkinsons disease and potential therapies using adult and embryonic stem cells. When not in the lab, Sean is an avid Star Wars fan and collector. He also makes time each year to go someplace new to camp, hike, and fish. He shares his home with his lovely wife Debbie, and their two cats Tigger and Starbuck. 88


Permanent Link: http://ufdc.ufl.edu/UFE0013743/00001

Material Information

Title: Characterization of Adult and Embryonic Stem Cell Proliferation, Differentiation, and Integration in Vitro and in a Nigrostriatal Slice Culture System
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013743:00001

Permanent Link: http://ufdc.ufl.edu/UFE0013743/00001

Material Information

Title: Characterization of Adult and Embryonic Stem Cell Proliferation, Differentiation, and Integration in Vitro and in a Nigrostriatal Slice Culture System
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013743:00001


This item has the following downloads:


Full Text












CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL
PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A
NIGROSTRIATAL SLICE CULTURE SYSTEM















By

SEAN M. KEARNS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006




























Copyright 2006

by

Sean M. Kearns


























I would like to thank my wife, family and friends without whose help all of this would
not have been possible.















ACKNOWLEDGMENTS

I would like to thank my family (Mom, Dad, and Kelly) for all the love and support

they have given me growing up. I thank my friends for all the good times that made life

worth living. I would also like to thank Dr. Dennis Steindler, Dr. Eric Laywell, and the

rest of the Steindler and Laywell labs for teaching me how to do science, and for helping

me to find why I do science. Finally I thank my wife Debbie. Her love and support have

made me complete, and I am eternally grateful that she is a part of my life.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF FIGURE S ......... ..................................... ........... vii

ABSTRACT .............. ................. .......... .............. ix

CHAPTER

1 STEM CELL BIOLOGY .......................................................... ............... 1

Stem Cell Characterization ............................................................ ............... .
Em bryonic Stem Cells .................. ................................... ................ .2
A dult Stem C ells ................................................... ....................... 4
Adult Neural Stem Cell Differentiation.................... ..... .......................... 6
Stem Cell Niches and Extracellular Matrix............ .............................................7

2 PA R K IN SO N 'S D ISEA SE ........................................ .......................................9

O overview and A natom y ............................................................. ............. ............. 9
Genetic Links To Parkinson's Disease ................................................... ...............11
A lpha-Synuclein M utations...................................... ...................... ............ .11
Parkin M stations ............................... ......... ............... .. ............. 13
PTEN Induced Kinase-1 Mutations ......................................... ...............14
Environmental Links To Parkinson's Disease.........................................................14
Rural Living C conditions ......................................................... .............. 14
Pesticides and Parkinson's Disease .............. .............................................. 15
Heavy Metal Exposure and Parkinson's Disease..............................................16
M odeling Parkinson's D disease ............................................................................17
Current Therapies for Parkinson's Disease ......................... ..................... 18
Pharm ecological Therapies ........................................ ........................... 18
Surgical Therapies ............................................... .. ...... .. ............ 19
C ell R eplacem ent Therapies........................................... .......... ............... 19

3 M ATERIALS AND M ETHODS ........................................ ......................... 22

Neurosphere Culture and Asteron Cell Characterization .......................................22
G generation of N eurospheres ....................................................... ..... .......... 22
Differentiation and Immunolabeling of Spheres ...........................................22


v









In Situ Hybridization with GFAP cDNA...........................................................23
A n aly sis of C ell D eath .............................................................. .....................24
E lectrophysiology .................. ............................................... 25
ECM Effects on Neurosphere Migration....... ............................. 26
Slice C culture P reparation ............................................... .......................................27
6-Hydroxy Dopamine Nigrostriatal Lesions ....................................... .......... 27
Embryonic Stem Cell Neural Precursor Transplants.............. ............ 28
Immunocytochemistry and Quantification............................ .....................28
Electrophysiology of Slice Culture Transplants................... .............. 29

4 R E SU L T S ................................ .......... .......................................... 3 1

Neural Stem Cell Differentiation and the Asteron Phenotype............................... 31
Combination of Asteron M arkers............................................... .................. 32
A analysis of C ell D eath............. ... ...... ...................................... ......... 32
Physiological Properties of Hybrid Asterons .................................................33
Extracellular Matrix Influence on Neurosphere Migration .....................................34
N igrostriatal Slice C culture ..................................................................................... 36
6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures ...........................37
Real Time Analysis of Nigrostriatal Degeneration ........................ .................38
Nigrostriatal Slice Culture Applications.................................................38
Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice
C u ltu res ..................... ... ............. .. ..... ...... ......... ... .................. ... .. 39
Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice
C cultures ............... ....... .................... ..... .... ...... .............. ... ........ 39
Dopaminization of Transplantable Cell Populations...........................................40
Dopamine Neuron Generation from ESNP Culture In Vitro............................40
Dopamine Neuron Generation from ESNP Cultures in Slice Culture ...............40
Dopaminization of Adult Stem Cell Cultures ............................................... 41

5 DISCUSSION AND CONCLUSIONS ........................................... ............... 67

L IST O F R EFE R E N C E S ............................ ........... ..... ........................... ............... 77

BIOGRAPH ICAL SKETCH ..................................................... 88
















LIST OF FIGURES


Figure page

4-1. Combined P-III tubulin and GFAP immunolabeling reveals the temporal
progression of the asteron phenotype.. ....................... .. .............. ................... 42

4-2. Antibodies against P-III tubulin and GFAP reveal three immunophenotypes, and
label separate sub-cellular elements within asterons..............................................43

4-3. Asterons co-express 0-III tubulin with S1000, and transcribe GFAP mRNA. .......44

4-4. Asteron appearance corresponds with neuronal reduction that is not attributable
to apoptotic cell loss........................ ... ...... .................... .......... .... ...........45

4-5. Caspase 3 analysis of cell death accords well with TUNEL data. ...........................46

4-6. Physiology of neurons, astrocytes, and asterons. ....................................................47

4-7. Phenotype immunostaining of neurosphere derived cells. ............. .............. 48

4-8. Velocity plot of neurosphere derived cells on different ECM substrates ................49

4-9. Migration distances of neurosphere derived cells on ECM substrates..................... 50

4-10. Neurosphere derived cell migration patterns and measurements..........................51

4-11. Slice culture viability and nigrostriatal circuit maintenance. ................................52

4-12. 6-Hydroxy Dopamine lesion of nigrostriatal slice cultures.............................. 53

4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.........54

4-14. Cytoarchitectural changes in 6-OHDA lesion slice ....................... .............55

4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. ...............56

4-17. Real time analysis of TH-GFP.................. ........ ..................... 58

4-18. ESNP transplants into slice cultures ............................................. ............... 59

4-19. Long term ESNP transplants in slice cultures. .............................. ......... ...... .59









4-20. Laminin enhances ESNP migration through slice cultures After 6 days in
cu ltu re s.....................................................................................6 0

4-21. Laminin enhances process outgrowth of ESNP's in slice cultures .......................60

4-22. Green fluroescent protein Positive ESNP striatal transplant..................................61

4-23. Electrophysiological Characterization of Transplanted Cells...............................62

4-24. ESNP's located near the substantial nigra..................................... .................62

4-25. Increase in TH+ neurons derived from ESNP's exposed to ventralizing agents.....63

4-26. In vitro ESNP dopaminization.................... ........ ............................ 63

4-27. Dopaminized ESNP's implanted into slice cultures....................................64

4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH. ..............65

4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8, SHH,
an d p leiotrop h in ............................ ................................................... ............... 6 6















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF ADULT AND EMBRYONIC STEM CELL
PROLIFERATION, DIFFERENTIATION, AND INTEGRATION IN VITRO AND IN A
NIGROSTRIATAL SLICE CULTURE SYSTEM

By

Sean M. Kearns

August 2006

Chair: Dennis A. Steindler
Major department: Medical Sciences-Molecular Cell Biology

Stem cell therapy holds great promise in repairing brain damage caused by

neurodegenerative diseases, such as Parkinson's disease. To fully use these cells, a better

understanding is needed of the mechanisms and processes that control their proliferation,

migration, and differentiation. Our study used both in vitro and slice culture techniques to

examine adult neural and embryonic stem cells. Our initial experiments showed that adult

neural stem cells can generate hybrid cells (asterons) in culture. These asterons appear to

be hybrid cells that express both markers of immature neurons and astrocytes, and appear

to be the result of transdifferentiation from a neuron to an astrocyte.

We also examined the effects of different extracellular matrix molecules on the

migration of adult neurosphere derived cells. Our results showed that laminin and

fibronectin are permissive for migration and enhance outgrowth. In contrast, chondroitin

sulfate proteoglycan inhibits migration and impedes outgrowth.









Finally, to better assess stem cell integration into the central nervous system, we

devised a novel slice-culture system that recreates the degeneration seen in Parkinson's

disease. Using this slice culture model, we showed that ES cell-derived neurons can

survive in culture, and integrate synaptically. We also were able to dopaminize these ES

derived neurons and show that they maintain their dopamine phenotype in the slice. To

enhance transplant integration, we examined the effect of adding extracellular matrix to

the cell transplant. Our results suggest that laminin enhances the integration of these cells

into the slice.

Our study examined the plasticity of adult and embryonic stem cells in culture

and showed that these cells are responsive to environmental factors that interact with

their differentiation and migration. Development of a slice culture model system that

recreates the neuronal environment allows the development and future use of transplant

enhancements for stem cell grafts into the brain.














CHAPTER 1
STEM CELL BIOLOGY

Stem Cell Characterization

To understand the potential of using stem cells, one must first understand what a

stem cell is. A variety of definitions have been proposed, but a common set of terms and

properties emerged that serves as a starting point. By focusing on embryonic stem cells

and neural stem cells we compared and contrast the two most common "types" of stem

cells: embryonic and adult stem cells.

The minimal definition of a stem cell is a cell that can divide to renew itself and

give rise to a more committed progenitor (Morrison et al., 1997). Some argued that

self-renewal may be present in mature cell types (e.g., lymphocytes) and have pushed for

a definition based on the plasticity of the stem cell (Zipori, 2005). Those against

self-renewal as a stem cell trait argue that plasticity is the main defining characteristic

separating stem cells from other types of cells. A stem cell functions to generate mature,

committed cell types to create or repair tissues and organs. Embryonic stem cells (ES) in

vivo contribute to all body tissues when implanted into a blastocyst (Bradley et al., 1984).

In vitro ES cells have been shown to create almost all of the mature cell types found in

the body (Keller, 1995; Draper and Andrews, 2002). Adult stem cells have been found in

most adult tissues and organs. Functionally they are an integral part of normal operation

of the system (e.g., the hematopoitic and nervous system) or they play a role in tissue

repair and regeneration (e.g., the hepatic system). Evidence also shows that adult stem

cells (whose in vivo distribution is limited to their target tissues) may in vitro be capable









of transdifferentiating into other types of mature adult cells. This potential is still

controversial and may not exist in all adult stem cell types, but it further argues that

stemness is a function of its plasticity, and not its renewal capability. While still under

debate, self renewal and plasticity are likely both key components of a stem cell

definition. More information about stem cell functions will refine their definition.

Embryonic Stem Cells

Embryonic stem cells (ES) are derived from the intracellular mass (ICM) of a

developing blastocyst. This region of the blastocyst gives rise to all of the cell types

found in the adult organism. ES cells were first derived from rodents and were shown to

be pluripotent (Bradley et al., 1984). Human ES cells were generated later and were

shown to have properties similar to those of rodent ES cells, while requiring a different

set of culture conditions (Thomson et al., 1998). The primary focus for ES cells has been

keeping them undifferentiated in long-term cultures, and in the exact protocols needed to

differentiate ES cells into adult cell types in an easy and reliable manner. Mouse ES cells

initially had to be grown on mouse fibroblast feeder layers to remain undifferentiated.

Further studies identified leukemia inhibitory factor (LIF) as one of the primary

molecules secreted by feeder-cell layers that maintained ES cells in their undifferentiated

state (Smith et al., 1988). With the discovery of LIF as a mediator of differentiation,

downstream transcriptional targets of LIF were identified that appear to regulate the

pluripotency of ES cells. Transcription factors such as Nanog and Oct3/4 were found to

be expressed in ES cells, and their expression decreased as cells differentiated into

mature phenotypes (Niwa et al., 2000; Chambers et al., 2003).

Human ES cells (hES) have been shown to behave slightly differently from rodent

ES cells. Human ES cells do not maintain a pluripotent state when treated with LIF,









though hES cells can be maintained on feeder layers, or on laminin-coated culture plates

when fed with feeder-layer conditioned media (Thomson et al., 1998; Xu et al., 2001).

The use of feeder layers was questioned because of the possibility of cross-contamination

from animal cells. Recent evidence suggested the presence of a rodent

glycopolysacarrhide in hES cultured on mouse feeder layers (Martin et al., 2005). This

foreign molecule could induce an immune response to these cells that would likely kill

them if transplanted. Research on feeder layer and conditioned media-free cultures shows

promising results, suggesting that hES cells can be maintained in an environment that

minimizes cross contamination.

Differentiation of ES cells can be performed in a few ways. One way is to culture ES

cells in an aggregate colony form, known as embryoid bodies (EBs) (Keller, 1995). The

EBs can be maintained in culture for some time, and provide cell-cell interactions

important for ES cell survival. The EBs can be plated to generate a monolayer of cells

that can be treated with various cytokines and other factors to induce a specific lineage in

the cells. For example, ES cells can be induced to a neuroectoderm lineage through a

sequential EB culture protocol that adds (then removes) serum from the cultures, and

allows the EBs to attach and generate a monolayer (Okabe et al. 1996). All three major

neural cell types (neurons, astrocytes, and oligodendrocytes) can be produced from ES

cell cultures, and in relatively pure populations. Further manipulations of neuronal

cultures can yield subtypes of neurons, such as dopaminergic or GABAergic neurons.

Dopaminergic neuron generation is being heavily studied as a possible way to replace the

neurons lost in Parkinson's disease. (Jung et al., 2004; Zeng et al., 2004; Takagi et al.,

2005) provided a working paradigm for efficient generation of dopamine-producing









neurons, and provides a useful example of how ES cell manipulation is carried out. The

initial protocol relied on treating ES cells with cytokines, such as sonic hedgehog and

FGF8, that have been linked to endogenous dopamine cell generation during

development.

Adult Stem Cells

Unlike ES cells, which are generated from the inner cell mass of a developing

blastocyst, adult stem cells have been isolated from numerous adult tissue types,

including brain, bone marrow, liver, and skin (Weiss et al., 1996). Like ES cells, adult

stem cells are capable of asymmetric division, producing a relatively undifferentiated

copy of themselves, and a more-committed daughter cell. Initial isolation and

characterization of these adult stem cells showed them to be multipotent, capable of

giving rise to only certain cell types of the tissue they were isolated from. Further studies

introduced the idea that under certain conditions, these cells could transdifferentiate, or

turn into mature cells from other tissue types (Brazelton et al., 2000; Theise et al., 2000;

lanus et al., 2003). These findings remain controversial, but evidence supports at least a

limited potential for adult stem cell transdifferentiation. Because so many tissues appear

to have adult stem cells associated with them, we have limited the scope of this overview

to discussing adult neural stem cells.

Stem cells in the CNS have been hypothesized for more than 4 decades. Evidence

of neurogenesis in rodent hippocampus was described by (Altman and Das, 1965, 1966;

Altman, 1969a, b). They described postnatal neurogenesis and suggested that

undifferentiated cells existed within the mature CNS; and that they gave rise to new

neurons, and to new glial cells. The early 1990s began a push to isolate and expand the

neural stem cell. A key discovery was the primary niches of adult neural stem cells









(NSCs): the subventricular zone (SVZ) of the lateral ventricles and the subgranular layer

of the hippocampus. (Lois and Alvarez-Buylla, 1993; Kuhn et al., 1996). The SVZ stem

cells generate new neuron progenitors that migrate along the rostral migratory stream to

the olfactory bulb, where they integrate into the periglomerular and granule cell layers of

the olfactory bulb in the rodent. When cells from these regions were cultured in clonal

conditions with suitable growth factors, they gave rise to a sphere that contained both

stem cells and lineage-restricted progenitor cells. Later studies of these cells from the

SVZ, cultured as neurospheres, identified a multipotent astrocyte as the neural stem cell

(Doetsch et al., 1999b; Laywell et al., 2000).

In the SVZ a dynamic relationship exists between NSCs and more restricted

progenitors. Early experiments on rodents found several different cell types in the SVZ

(Doetsch et al., 1999a): the B cell, the multipotent astrocyte stem cell (NSC), the C cells

(a rapidly dividing precursor cell), and the A cell (a restricted neuronal progenitor cell).

Evidence for this model came from studies using cytosine arabinoside (Ara-C) to kill

rapidly proliferating cells in the SVZ. Examining which cells were killed by Ara-C

allowed the relative cell-cycle times of SVZ cell types to be established. The C cells

showed the shortest cell-cycle time and were almost completely destroyed by Ara-C

treatment. Type A cells also were almost completely eliminated by the treatment. Type B

cells showed the least effect from Ara-C treatment. After only 2 days, regeneration of cell

types had begun. After 4.5 days, A and C cells were almost at normal levels. In addition,

giving a second treatment of Ara-C during this regenerative period killed a large number

of the B cells, which had been activated and were dividing to try and reconstitute the

SVZ, and led to no significant regeneration of the cell types in the SVZ.









This evidence of postnatal neurogenesis mediated through NSCs brought a great push

to harness this innate potential to regenerate damaged regions in the brain. Currently

there is no evidence that massive regeneration occurs in the CNS as a result of lesion or

injury (Rakic, 1985). Some evidence suggests that endogenous stem cell populations

contribute to repair in damaged regions such as the cortex (Magavi et al., 2000).

However, this repair seems limited to small, specific lesions that do not create large glial

scars, or large amounts of cell necrosis or apoptosis. Additional debate centers on

whether neurogenesis occurs in regions outside the olfactory bulb and hippocampus.

Reports of neurogenesis in the adult monkey (Gould et al., 1999) suggested that primates

and possibly humans might generate new neurons in their cortex. However, evidence for

this was challenged, based on confocal analysis that suggested cells appearing to be

newly generated neurons were actually a neuron closely associated with a satellite glial

cell (Kornack and Rakic, 2001)

Adult Neural Stem Cell Differentiation

By definition, the NSC must be able to generate the three distinct cell types of the

central nervous system; neurons, astrocytes, and oligodendrocytes. Microglial cells,

although restricted to the CNS, are believed to be developmentally derived from the

hematopoietic system and do not constitute a neural lineage. On plating, NSCs have been

observed to give rise to the three neural cell types. What remains poorly understood is the

mechanisms of this differentiation and how static the process is. Recent evidence in the

CNS suggested that cells exist along a continuum of differentiation, and that cell groups

are much more fluid than previously proposed. This idea is supported by the life cycle of

the NSC, which initially exists as a type of specialized astrocyte that (through cell

division and differentiation) can give rise to neurons. Our results also suggest that









neuronal cells derived from these NSCs are in a state of phenotypic flux and may turn

from neuronally committed to glial cells in vitro (Laywell, 2005).

Stem Cell Niches and Extracellular Matrix

An important concept in stem cell biology is that of the stem cell niche. Basically

it suggests that the stem cell is able to perform its function, because of its environment,

and the physical and biochemical cues from this niche influence cell division,

differentiation, and migration. The niche first came to prominence in the hematopoietic

stem cell (HSC) field, where the composition of bone marrow was found to play an active

role in HSC function. Research on niches in regard to neural stem cells has focused on

the extracellular matrix comprising the SVZ and RMS, and the cytokines and signaling

molecules that target this region. The extracellular matrix (ECM) environment of the

central nervous system (CNS) is responsible for a large number of regulatory functions

both during development and adulthood. The ECM provides signals for cell growth,

differentiation and migration (Novak and Kaye, 2000; Steindler, 1993; Steindler et al.,

1990). These activities are critical for the development of CNS organization, and

disruptions of ECM interactions can cause severe developmental defects (Novak and

Kaye, 2000). During CNS histogenesis, ECM defines functional boundaries for cells

(Steindler, 1993; Steindler et al., 1989) and is involved in signaling after injury (Laywell

et al., 1992). Permissive substrates for neurosphere differentiation may underlie

migratory pathways, whereas non-permissive substrates may mark more sedentary cell

zones. In the SVZ stem cell niche the ECM, composed primarily of tenascin and

chondroitin sulfate proteoglycans (CSPG), is believed to act as a barrier, keeping the

NSC in the SVZ. This ECM composition is set up late in embryonic development and is

persistent throughout the life of the animal. During early development the presence of the









dense ECM may allow the niche to remain undisturbed through development and prevent

axons from innervating the region, and possibly degrading the ECM matrix (Gates 1993,

1995, Steindler 1993). CSPG's are known to be present in other regions of the CNS and

function in axon guidance by restricting axon growth to inappropriate targets (Treloar et

al., 1996), and the CSPG versiscan, has been shown to inhibit migration of neural crest

cells (Landolt et al., 1995). Treatment with enzymes that degrade these CSPG's has been

shown to be beneficial in axon regrowth in CNS injuries (Bradbury et al., 2002). In

addition circuits where the region has been depleted of glial cells show an increased in

the amount of axon regrowth they experience. This is believed to be the result of a

decrease in scar formation and a decrease in glial elements that inhibit axon growth

(Moon et al., 2000).

In contrast, laminin and fibronectin are known to be potent permissive substrates

for a variety of cell types in vitro, including cerebellar and SVZ derived neurospheres

(Kearns, 2003). Neither fibronectin nor laminin are present in high levels in the adult

animal; however, fibronectin knockout animals demonstrate neural tube abnormalities

that are embryonic lethal (George, 1993). Laminin has been shown to be present in the

developing cerebellum and acts as a permissive migratory substrate for granule cell

precursors to migrate from the external granule cell layer into the internal granule cell

layer (Pons et al., 2001). Laminin has been shown to enhance neurite elongation of

cultured neurons (Rogers et al., 1983) and to increase the integration and regeneration of

cells within injury sites (Grimpe et al., 2002). Slice co-culture transplants with laminin

have been reported to enhance the ability of fetal dopaminergic neurons to reconstruct a

damaged nigrostriatal circuit in adult rats (Dunnett et al., 1989).
















CHAPTER 2
PARKINSON'S DISEASE

Overview and Anatomy

Parkinson's disease (PD) has classically been defined as a progressive

neurodegeneration of the nigrostriatal circuit. Clinically this presents as a whole body

tremor, rigid posture, racheting motion of the limbs, dysphagia, and in late stage cases a

loss of voluntary motor control and movement. The demographics for PD are heavily

skewed towards the elderly, except in specific familial cases where the gene mutations

can cause a significant decrease in the age of onset.

The disease was first reported in the medical literature by James Parkinson in

1817, and described as the shaking palsy (Parkinson, 1817). Later the clinical anatomy

and lesion were discovered that underlie the disease. Rosegay was the first to

conclusively label and demonstrate a circuit that originated in the substantial nigra and

terminated in the striatum using a feline model (Rosegay, 1944). Anden et al were the

first to demonstrate that dopamine was the primary neurotransmitter released into the

striatum from the axons of neurons in the SNc (Anden et al., 1964; Anden et al., 1965;

Anden et al., 1966). The loss of SNc cells, the only observable lesion seen in Parkinson's

patients, led them to correctly hypothesize that the symptoms of Parkinson's were a direct

result of the loss of dopamine neurotransmission from the SNc to the striatum.

Pathologically, PD is associated with the significant loss of the SNc fibers running to the

striatum, and the atrophy of the cells bodies within the SNc. Another notable pathology is









the formation of intracellular protein aggregates seen within SNc cell bodies, termed

Lewy bodies. These cytoplamsic inclusions are seen in several different neurological

conditions, but when closely associated with the SNc are hallmarks of PD (Gibb and

Lees, 1988).

The nigrostriatal circuit is an important component of the voluntary motor

pathway in the central nervous system. Information from the motor cortex is sent to the

striatum. From the striatum it is sent to the globus pallidus then to the thalamus where it

is processed and from the thalamus goes to the motor cortex to be sent through the

corticospinal tract. The overall output from the SNc to the striatum is inhibitory. The

more inhibited the SNc causes the striatum to become, the less inhibitory and more

excitatory the globus pallidus becomes. This feedback loop of inhibitory and excitatory

circuitry allows for voluntary motor movements to proceed smoothly (Blandini et al.,

2000). In the case of Parkinson's disease the degeneration of the SNC causes a loss of

inhibitory output to the striatum. This loss of inhibition causes the striatum to send a

stronger inhibitory signal to the external globus pallidus (eGP). The inhibition of the eGP

causes the subthalamic nucleus (STN) to send a stronger excitatory signal to the internal

globus pallidus (iGP). The iGP normally sends an inhibitory signal to the thalamus. In

Parkinson's this inhibitory signal is much stronger, due to the increased excitatory signal

from the STN, and the motor pathways in the thalamus are thus inhibited, resulting in the

difficulty initiating voluntary motor movement (Albin et al., 1995).

The underlying molecular causes of PD are still being debated. What is

established is that there are both environmental and genetic risk factors that are

associated with the development of PD. Rare familial forms of PD have been studied that









have allowed scientists to better understand what mutations and biochemical effects may

be linked to PD. Epidemiological data has also been collected that points to

environmental toxins, such as pesticides and heavy metals, that appear to increase the

chances of developing PD.

Genetic Links To Parkinson's Disease

A variety of genetic studies have been performed to ascertain genes that play a role in

causing or predisposing an individual to PD. Three of the most prevalent mutations are

alpha-synuclein, Parkin, and PINK1 (Gasser, 2005). Each of these genes has been found

to be abnormal in a large number of familial PD patients, or those with a clearly defined

genetic linkage to the disease. All of these mutations share a common link in the

ubiquitin-proteosome pathway. This pathway is involved in the targeting and degrading

misfolded or damaged proteins within the cell and is a critical part of the intracellular

machinery. Dysfunctions in the proteosome pathway are believed to induce a state of

oxidative stress within the cell and lead to abnormal protein aggregation, like the Lewy

bodies seen in PD. The role of these aggregates is unclear, some believe them to be a

defense mechanism that the cell uses to isolate abnormal proteins, but many others

believe that the aggregates themselves cause an increase in free radicals that can overload

the cell with oxidative stress and induce programmed cell death or apoptosis.

Alpha-Synuclein Mutations

Alpha-synuclein is perhaps the best studied mutation in PD. It was first identified as

the root cause of familial PD in a kindred in Italy, and has since believed to be isolated to

a founder mutation that originated in Greece (Polymeropoulos et al., 1997). Patients with

this mutation display many of the same characteristics as those suffering from sporadic

PD, including the formation of Lewy bodies in the SNc, and responsiveness to levodopa.









The key feature that separates this familial form from sporadic is the early age of onset

which is around 46 years, compared to the average age of onset for sporadic which is

around 62 years (Pankratz and Foroud, 2004).

At the molecular level alpha-synuclein is believed to act as a lipid binding protein that

plays a role in neurotransmitter vesicle release and recycling, as well as synaptic

plasticity. In familial forms of PD linked to alpha-synuclein mutations, the mutated

protein folds abnormally and generates Lewy bodies, the protein aggregates seen in PD.

Several different mutations have been identified in the alpha-synuclein gene, most of

which are point mutations that alter a single amino acid in the protein and cause protein

misfolding. Recent reports of duplication and triplication of the wild type alpha-synuclein

gene have linked these mutations to the development of PD (Singleton et al., 2003). This

is an important finding, since it reinforces the data showing that Lewy bodies in sporadic

PD are composed mostly of aggregated alpha-synuclein. Here we see the intersection of

environmental and genetic factors that may play a role in the development of PD. If wild

type alpha-synuclein is more susceptible than other proteins to environmental agents that

cause protein misfolding, then it represents a common target for therapeutics against

protein misfolding related degenerative diseases. Recent studies looked at

alpha-synuclein polymorphisms that may underlie sporadic PD (Pals et al., 2004). Unlike

familial cases there is no clear genetic link or clearly identified protein abnormality in

sporadic cases. However some reports have suggested that polymorphisms in the

alpha-synuclein gene may predispose individuals to develop PD. One recent study

reported that there was a specific haplotype in the alpha-synuclein gene that appeared to

increase the risk of developing PD 1.4 times in heterozygotes, and twice as likely in









homozygotes (Mueller et al., 2005). The mechanism underlying this predisposition is still

not understood, but further study on polymorphisms in PD related genes is one of the

most important areas in PD research.

Parkin Mutations

A common theme in the genetics of PD is the relationship the genes have with the

misfolded protein response and the proteosome pathway. Alpha-synuclein appears to

interfere with the proteosome pathway by overloading it with too much aggregated

mutant protein. Another proteosome pathway protein, parking appears to be the most

frequently mutated protein in familial PD with some estimates suggesting it may be the

cause of 50% of early onset familial PD (Lucking et al., 2000). Parkin is a ubiquitin

ligase, responsible for attaching ubitquitin molecules to proteins to target them for

degradations (Zhang et al., 2000). The exact molecular mechanism by which parking

mutations may cause degeneration is unknown, but current research suggests that

mutations in parking decrease its ability to targets proteins for degradation. Without this

targeting the cellular machinery is unable to degrade proteins and they can accumulate

and form aggregates. One of the primary proteins targeted by parking for degradation is

alpha-synuclein (Shimura et al., 2001). What is unusual about most cases of familial PD

associated with parking mutations is the relative lack of Lewy body inclusions. This led

some to suggest that parking mutations act through an alternate pathway to induce SNc

degeneration without Lewy body formation. Recent studies have implicated the JNK

mediated apoptsis pathway. Under this paradigm, mutations in parking cause an increase it

parking substrates, which could induce cellular stress and activate the JNK pathway. In

addition the activation and control of JNK effects may be directly regulated by









ubiquititination through parking, and the loss of parking could cause upregulate the

apoptotic effects of JNK (Cha et al., 2005).

PTEN Induced Kinase-1 Mutations

PTEN induced kinase-1 (PINK1) is a relatively new genetic mutation identified in

early onset familial PD. While it only accounts for 1-2% of the early onset cases, PINK1

is being studied intently due to its biochemical functions. (Valente et al., 2004). Analysis

of the PINK 1 gene product has revealed a mitchocondrial protein that appears to function

in oxidative stress response. A recent report found that PINK1 appears to mediate

cytochtome c release from the mitochondria, which is an important apoptotic signal (Petit

et al., 2005). When cells were transfected with a mutant from of PARKI, which destroys

the kinase activity of the protein and is known to exist in PD patients, they noted a

significant increase in basal and induced levels of apoptosis in the mutant cells compared

to controls. This is another finding that links the development of PD to alternations in the

cells ability to deal with oxidative stress. The fact that PINK1 is localized to the

mitochondria has implications for certain environmental toxins related to PD. Many of

the chemicals that are experimentally used to make PD models act by interfering with

mitochondrial function and induction of oxidative stress and apoptosis (Ungerstedt, 1968;

Jenner, 2003; Kress and Reynolds, 2005). While there are no reports on polymorphisms

associated with PINK1, a reduction in the capacity to deal with mitochondrial insults

from an environmental exposure could be a factor in developing PD.

Environmental Links To Parkinson's Disease

Rural Living Conditions

Since most PD cases are late onset, sporadic instances, it is clear that genetics

does not dictate the entire risk potential of developing PD. With the advent of









epidemiological studies of PD patients it has become clear that there are environmental

risk factors that exist which increase the chances of developing PD (Lai et al., 2002). In

addition the development of animal models of PD, based on toxins has opened up new

avenues, not only in studying how to treat the disease, but how environmental stresses

can lead to neurodegeneration. The majority of the studies in the past 50 years have

looked at a small set of epidemiological factors that may play a role in PD. Living

location, especially rural or urban, has become a widely studied variable as a risk factor

for PD. An analysis of studies done on rural living showed that 7 out of 20 showed a

significant positive correlation between living in rural areas and an increased risk of

developing PD. The rest found either no correlation, or an insignificant one. While far

from definitive proof, at least some evidence exists that rural living may increase the

chance of developing PD (Lai et al., 2002).

Pesticides and Parkinson's Disease

One of the primary reasons that rural living was suspected as playing a role in the

development of PD, was the discovery that exposure to pesticides has been shown

increase the risk of PD. A meta-analysis of 19 pesticide exposure studies concluded that

there was a significant positive association between pesticide exposure and risk of PD

(Priyadarshi et al., 2000). This has been further reinforced by experimental studies that

have linked the pesticide rotenone to dopamine neuron toxicity. Rotenone is a known

mitochondrial complex I inhibitor that induces apoptosis, and it has been showed that

chronic rotenone exposure in rodents caused a selective degeneration in dopamine

neurons and induced formation of intracellular inclusions similar to Lewy bodies

(Greenamyre et al., 2003; Betarbet et al., 2005). One likely scenario is that rural living









typically involves drinking water from a well. Pesticides leaching into the soil and into

the well water presents a likely delivery mechanism for human exposure to pesticides.

Heavy Metal Exposure and Parkinson's Disease

Another positive, although contested, association exists between heavy metal

exposure and PD. One study found a positive correlation between workers that had 20 or

more year's exposure to copper or manganese and development of PD (Gorell et al.,

1997). However another study, using the same group as above, found that this increase

was broken down among those with a family history of PD and those without (Rybicki et

al., 1999). Another study found that 30 or more years exposure to lead, aluminum, and

manganese increased the incidence of PD, independent of family history (Lai et al.,

2002). Iron exposure has become an important research direction in PD due to a better

understanding of the type of free radical damage prevalent in the SNc. Dopamine is a

relatively unstable molecule that breaks down, generating free radicals. In addition the

substance that gives the SNc its distinctive black hue, neuromelanin, is high in iron

content (Youdim et al., 1989; Linert et al., 1996; Hirsch and Faucheux, 1998; Castellani

et al., 2000; Gerlach et al., 2003). Iron has been shown to catalyze what is known as the

Fenton reaction, which generates hydroxyl radicals. These radicals have been shown to

induce DNA damage and to induce apoptosis in exposed cells. There is mounting

evidence that the increased iron in the SNc may lead to an increase in Fenton derived free

radicals that could be responsible for the neurodegeneration pattern seen in PD. Some of

the other metals suspected, have also been linked to free radical generation or a reduction

in the ability to scavenge them. This evidence, while not conclusive, does suggest that

heavy metal exposure may at the least increase the oxidative stress that the SNc is under.









Modeling Parkinson's Disease

Currently most PD research is performed in isolated cell-culture models or in

animal models, using either toxic lesions or genetic mutant animals. Isolated cell cultures

allow for an easily controlled environment where variables such as toxin exposure or

mutated proteins can be observed and easily manipulated. The development of SNc

cultures allowed the work being done in cell cultures to help define and profile the at-risk

cell populations. Isolated cell cultures are also often the first step in examining whether a

chemical or genetic lesion is effective in causing cell death in SNc cells, and examining

the effectiveness of therapies in preventing cellular degeneration.

Unfortunately isolated cell cultures do a poor job of recreating the actual

physiological environment that the cells would normally be found in. Animal models of

PD focused on rodent and primate models that mimic the degeneration seen in human PD

cases. Most of the work is performed on rodents using toxin models that induce

degeneration in the nigrostriatal circuit (Gerlach and Riederer, 1996). Compounds such

as 6-hydroxy dopamine (6-OHDA) and MPTP specifically target the nigrostriatal circuit

and destroy the cells (Ungerstedt, 1968; Heikkila and Sonsalla, 1992; Glinka et al., 1997;

Smeyne and Jackson-Lewis, 2005). Unfortunately these models do not recreate the

progressive nature of PD and lack some of the pathological hallmarks of PD, such as

lewy bodies. A new method using general proteosome inhibitors, such as lactacyctin,

have shown promise in animal models of causing a progressive loss of nigrostriatal

neurons with evidence of lewy bodies in cells (McNaught et al., 2002).

Slice culture models, like that presented here, allow for a bridge between in vivo

and in vitro technologies. The ability to generate mid sagittal slices that contain the

nigrostriatal circuit has allowed for modeling of Parkinson's using the endogenous at risk









population of neurons within their neuronal environment, but with the accessibility ability

to observe and manipulate of in vitro cultures (Kearns, 2006).

Current Therapies for Parkinson's Disease

Pharmacological Therapies

The current state of PD treatments lies in either pharmacological intervention,

typically in early stage PD, and later in a variety of neurosurgical treatments. Neither of

the current therapies serves to slow or reverse the cellular degeneration, but instead rely

on enhancing the existing dopaminergic signal to compensate or removing inhibitory

influences on the circuit to enhance the message. Pharmacological treatment is led by L-

dopa administration. L-dopa is a precursor to dopamine that is able to cross the blood

brain barrier and can be converted using aromatic acid decarboxylase into dopamine

(Joseph et al., 1978; Olanow et al., 2004). This is a dramatic treatment, since it instantly

increases the amount of dopamine present in the nigrostiatal circuit and can initially

reverse most of the motor deficits seen in PD. However L-dopa has a serious problem in

its long term usage. Patients become non-responsive to L-dopa, usually within 5-10

years, and during an OFF phase with L-dopa, the symptoms can return, and even when

the drug is working during an ON phase, their can be abnormal hyperactive motor

movements and muscle tension (Deane et al., 2004; Brotchie et al., 2005).

L-dopa is still considered a first use drug, but the search for other more effective

pharmacological options is proceeding. Several other classes of drugs that have been

suggested or tried, include dopamine reuptake blockers, to keep dopamine in the synapse

longer and enhance its ability to signal, and drugs that prevent the enzymatic breakdown

of dopamine to keep it active longer (Johnston and Brotchie, 2004). These drugs have had









therapeutically relevant effects, but due to the progressive nature of PD, their efficiency

decreases with the increase in cellular degeneration.

Surgical Therapies

Surgical intervention for PD proceeded the development of pharmacological

intervention strategies by several decades. Until L-dopa was used, the standard treatment

for those willing to undertake it was a surgical lesion of the globus pallidus (Ansari et al.,

2002; Valldeoriola et al., 2002; Walter and Vitek, 2004). As outlined previously, the

globus pallidus sends an inhibitory output to the striatum, as part of the feedback

mechanism of the basal ganglia. A lesion of the globus pallidus removes this inhibitory

output, and effectively enhances the excitatory signal from the SNc to the striatum. More

recently, surgical interventions have begun to use deep brain stimulators in an attempt to

block inhibitory outputs to the striatum in an effort to enhance the SNc excitation to the

striatum (Lozano and Eltahawy, 2004; Diamond and Jankovic, 2005; Lyons and Pahwa,

2005). Deep brain stimulation's precise mechanism of action is not clearly understood,

but it is believed that the electrical impulses either induce a depolarizing block on the

cells, preventing them from firing, or the electrical impulses may desynchronize electrical

oscillations present in basal ganglia loops. Abnormal oscillations in firing patterns have

been theorized to underlie the abnormal motor movements in the PD, and may also be

present during ON medication phases, explaining side effects such as dyskinesia

(Silberstein et al., 2005).

Cell Replacement Therapies

A recent addition to the therapeutic options for PD, has been cell replacement therapy.

This approach seeks to replace, using stem cells or fetal progenitors, the lost

dopaminergic SNc neurons. Initial experiments performed in the late 1980's showed









proof of principle for cell replacement strategies and had promising results. Many of the

first open label trials showed evidence of significant improvement with patients reporting

decreased need for L-dopa treatment, and an increased level of dopamine uptake in the

putamen (Hauser et al., 1999). Further double blind studies were better able to quantify

graft effects and found that the age of the PD patient was a significant factor in the level

of improvement the patient experienced (Freed et al., 2001). Another factor in the

variable outcome is the variable number of surviving graft neurons. Recent reports have

contested the negative analysis of transplants, arguing that the effect seen is positive and

beneficial, considering that the trend in behavioral testing scores showed steady

improvement. In addition the beneficial effects observed were due to the few cells that

survived transplant. As transplantation techniques improve and cell survival increases

then clinical improvements should also increase (Isacson et al., 2001).

There has been significant debate about the development of post-operative

dyskinesias. These abnormal motor movements have been reported in various frequencies

in graft patients ranging from 15% (Freed et al., 1992) to 56.5% (Olanow et al., 2003).

The underlying mechanism for the development of these dyskinesias remains elusive, but

one interesting hypothesis is that the type of neurons being placed into the brain is not the

appropriate cell type. A9 type neurons are specific to the SNc region and among their

distinguishing features is the expression of the dopamine reuptake transporter D2. This

autoreceptor helps modulate dopamine release from these cells and is thought to underlie

the strength and modulation of the signal from the SNc to the striatum. A10 type cells

lack this autoreceptor and in transplant grafts, a mixture of the two cell types is used.

With a portion of the cells releasing dopamine in a non modulated fashion, the signaling






21


pattern may be disrupted leading to the development of dyskinesias (Isacson et al., 2003).

As further refinements of cell differentiation and selection occur the ability to transplant

cells without these side effects should improve.














CHAPTER 3
MATERIALS AND METHODS

Neurosphere Culture and Asteron Cell Characterization

Generation of Neurospheres

Postnatal day 1-10 (P1-P10) C57BL/6 mice (The Jackson Laboratory, USA) deeply

anesthetized by hypothermia and decapitated. The SEZ and cerebellar cortex were

removed, and dissociated into a single-cell suspension as previously described (Laywell

et al., 2002). Cells were then plated into standard T25 tissue culture flasks in growth

medium consisting of DMEM/F 12 containing N2 supplements, 5% fetal bovine serum

(FBS; Atlanta Biologicals, USA), 20ng/mL epidermal growth factor (EGF; Sigma, St.

Louis), and 10ng/mL basic fibroblast growth factor (bFGF; Sigma). After 1-2 days,

floating cells were collected, centrifuged, trypsinized, triturated into a single-cell

suspension, and counted. A secondary culture was initiated by resuspending cells in

growth medium (with or without BrdU), and plating them into ultra low attachment

polystyrene 6-well plates (Corning, USA) at densities ranging from 1x103 to 1x105

cells/cm2. Neurospheres became apparent within 3-5 days.

Differentiation and Immunolabeling of Spheres

To promote differentiation, spheres were placed into a drop of differentiation

medium (DMEM/F12 + N2 supplements + 5% FBS, with or without on coverglass

coated sequentially with polyornithine and laminin (10lg/mL and 5 tg/mL, respectively;

Sigma, USA). Some neurospheres were plated in the presence of 10tM

bromodeoxyuridine (BrdU; Sigma, USA) in order to label proliferating cells. Eighteen









hours to 4 weeks after plating, coverslips were fixed with 4% paraformaldehyde in PBS,

and processed for immunofluorescence as described (Laywell et al., 2000) with a variety

of antibodies, including monoclonal (Promega, USA) and polyclonal (Covance,

Richmond, CA) antibodies against the neuronal cytoskeletal protein 0-III tubulin,

monoclonal and polyclonal antibodies against the astrocyte intermediate glial fibrillary

acidic protein (GFAP), (Immunon, USA), a monoclonal antibody against the neuronal

nuclear protein NeuN (Chemicon, USA), polyclonal antibodies against the astrocyte-

associated calcium binding protein S1000 (Swant, Switzerland). For detection of BrdU,

cells were first incubated in 1:1 formamide:2x SSC for 2 hr. at 650, and 2N HC1 for 30

min. at 37. After equilibrating for 10 min. in borate buffer, cells were immunolabeled

with a monoclonal rat antibody against the thymidine analog BrdU (Abcam, USA) in

combination with anti-GFAP and anti- P-III tubulin antibodies. After washing and

applying appropriate fluorescent secondary antibodies (Molecular Probes, USA), the cells

were counterstained with Hoechst 33342 fluorescent nuclear stain (Sigma, USA),

coverslipped, and viewed with epifluorescence or confocal microscopy. Images were

captured on a Spot camera and Spot software and Adobe Photoshop were used to adjust

contrast and brightness to more closely resemble images seen under the microscope.

In Situ Hybridization with GFAP cDNA

GFAP cDNA probes were generated by RT-PCR amplification of a 401bp DNA

fragment from neonatal mouse brain tissue with a pair of primers designed with the

Primer 3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), using the

GFAP sequence from the Genebank database (gi: 26080421). Forward primer:

GCCACCAGTAACATGCAAGA; Reverse primer: ATGGTGATGCGGTTTTCTTC.

The PCR product was cloned into the PCR4 TOPO vector (Invitrogen, USA). After









linearization, plasmids extracted from clones of both directions were used as templates to

synthesize digoxigenin (DIG)-labeled GFAP sense and antisense probes using the T7

RNA polymerase (1277073 Roche, USA).

The hybridization protocol followed the method of Braissant and Wahli

(Braissant and Wahli, 1998), with a probe concentration of 400ng/ml, and the

hybridization temperature set at 450C. Hybridized probe was immunodetected with

a monoclonal antibody against DIG (Roche, USA) using alkaline phosphatase as the

chromagen. Finally, hybridized cells were processed for immunolabeling with

antibodies against GFAP and P-III tubulin, as described above.

Analysis of Cell Death

Apoptotic cells within plated spheres were visualized using a fluorometric

terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)

assay (G3250 USA) according to the manufacturer's recommendations. This assay

measures the fragmented DNA of apoptotic cells by incorporating fluoroscein-

labeled dUTP at the 3' ends of DNA strands. As a positive control, some spheres

were processed for TUNEL following 30 min. incubation with DNase.

Alternatively, activated caspase 3, an enzyme present in early stages of apoptosis,

was detected in plated spheres using an anti-activated caspase 3 antibody (BD

Pharmingen, USA). As a positive control, some spheres were treated with

staurosporine (1tg/ml for 4 hours at 370C) prior to immunolabeling. Following

TUNEL processing or caspase 3 labeling, spheres were immunolabeled as above

with antibodies against P-III tubulin, and counterstained with Hoechst 33342 (Sigma,

USA).









Cell death was quantified by counting the number of TUNEL+ or caspase 3+

nuclei within every sphere on each of three coverslips (range = 12-15

spheres/coverslip). The criterion for apoptotic neurons was intentionally liberal to

avoid undercounting. All TUNEL+ or caspase 3+ cells contacting a 0-III tubulin+

process were counted as apoptotic neurons.

Electrophysiology

Spheres plated for 48 to 96 hours were used to assess membrane properties of

asterons. Coverslips were placed in a recording chamber perfused with artificial

cerebrospinal fluid (ACSF) containing (in mM) 124 NaC1, 26 NaHCO2, 1.25 NaH2PO4,

2.5 KC1, 2 CaCl2, 1 MgCl2, 20 D-glucose, oxygenated with 95% 02 and 5% CO2, giving

a pH of 7.4. All recordings were performed at room temperature (220C). Putative

neurons, astrocytes, and asterons were visually identified using infrared DIC

videomicroscopy with a fixed-stage microscope equipped with a 40X, 0.8 W water-

immersion lens (Zeiss, Germany), and whole-cell patch-clamp recordings were

performed. Patch electrodes had a resistance of 6-8 MQ when filled with intracellular

solution containing (in mM): 120 K-gluconate, 8 NaC1, 10 HEPES, 4 Mg ATP, 0.3

Na3GTP, 0.2 EGTA, 0.1% biocytin (pH 7.3 with KOH, osmolarity 290-300 mOsm).

Cells were recorded under either current-clamp or voltage-clamp mode using an

Axopatch 1D amplifier (Axon Instruments, USA). Series resistance was 10-25 MQ and

cells were rejected if resistance changed more than 10% throughout the recording

session. Action potentials were observed in current-clamp mode by injecting a number of

current steps (from -50 pA to 150 pA, in 50pA increments). Na+ and K+ currents were

studied in voltage-clamp mode. Cells were held at -65 mV, and steps of voltage were









imposed (from -80mV to 55mV, with 15 mV increments). Maximum Na current usually

occurred when cells were held at -5 mV or 10 mV. The magnitude of K current was

measured at the steady part of the trace of the last step (55mV). Action potentials and Na-

currents were abolished by adding 1I M TTX (Sigma, USA).

Recorded cells were filled with biocytin, and visualized by application of an

avidin-AMCA conjugate (Vector, USA). Cell phenotypes were confirmed by

immunolabeling the biocytin-filled cells with antibodies against GFAP and P-III

tubulin, as above

ECM Effects on Neurosphere Migration

Cells were isolated from postnatal days 3 to 5 C57BL/6 mice pups. Neurospheres

were prepared as described above. The matrices tested were laminin, fibronectin, and

CSPG. Glass coverslips were incubated for 24 h with poly-L-ornithine, followed by 8 h

incubation with laminin (L-2020, Sigma, USA), fibronectin (F-4759, Sigma, USA), or

CSPG (C-9819, Sigma, USA). Spheres were seeded onto each coverslip in N2 media

containing 5% FBS and 10 ug/ml of EGF and FGF-2. At 24, 48, 72, and 144 h coverslips

from each condition were removed and fixed with ethanol/acetic acid for 30 min.

Immunohistochemistry for the neuron-specific protein B-III tubulin (Covance,

USA) and the astrocyte specific intermediate filament protein glial fibrillary acidic

protein (GFAP) (Immunon, USA) was performed to assess cell differentiation. Hoechst

nuclear staining was performed to visualize cell migration outward from the neurosphere.

Measurements were performed with a Leica compound fluorescence microscope

and SPOT software (Diagnostic Instruments Inc., USA). Migration distance was

calculated as a straight line measurement from the edge of the sphere to the farthest









defined edge of the migratory cell boundary. Velocity data were defined as total distance

migrated over time. Measurements were analyzed using the Student's t test.

Slice Culture Preparation

Slice cultures were generated from postnatal day 7 to 15 (n=10), with a total of 48

slices cultured for this study. See Figure 3-1 for the preparation outline. Briefly, animals

were euthanized under halothane, and their brains were cut at the midline into two

sagittal halves. These halves were then superglued, medial surface down to the vibratome

stage, covered in cool, molten 2% agar, and immersed in cold preparation media (DMEM

F12, 100 ug/mL L-ascorbic acid, 2 mM L-glutamate, and antibiotic/antimycotic

(Invitrogen, USA)). 300-400 uM thick slices were cut using a vibratome (Leica S1000,

Germany), transferred to a Petri dish with cold preparation media, and scanned using a

dissection microscope (4X magnification) to select slices. Typically 4-6 mid-sagittal

slices per animal from the levels 0.8-2.0 mM lateral from midline were obtained

(Franklin, 1996). Slices were then immediately transferred to a transwell membrane inset

(#3650, Falcon,USA), placed in a 6 well plate, and incubated at humidified 35 degrees C

and 5% C02. Each inset was suspended in 1 mL of "A" media, containing 25 % horse

serum (Kluge et al., 1998). "A" media was sequentially replaced by thirds with a serum

free DMEM F12 based "B" media, containing B27, and N2 supplements (Invitrogen,

USA) until day 7 when cultures contained only "B" media (Benninger et al., 2003;

Scheffler et al., 2003).

6-Hydroxy Dopamine Nigrostriatal Lesions

For nigrostriatal lesion studies the dopaminergic neurotoxin 6-OHDA (Sigma,

USA) was used. 6-OHDA was applied either prior to slices being placed on the









membrane, submerged in 20 mM 6-OHDA/saline for 10 min, or 7 days after plating. For

7 day old cultures, all media was replaced with sterile saline and the slices submerged in

20 mM 60H-DA/saline with 25% mannitol, for 10 minutes. Mannitol was used to disrupt

the glial scar and enhance 6-OHDA penetration into the slice. After treatment all saline

and 6-OHDA were aspirated and replaced with "B" media.

Embryonic Stem Cell Neural Precursor Transplants

ESNP's were derived from GFP expressing R1 ES cells (Hadjantonakis et al.,

1998) and cultured as described by Okabe et al (Okabe et al., 1996). TH expression was

induced in cells using bFGF (10 ng/ml), FGF8 (100 ng/ml), SHH (500 ng/ml), PTN (100

ng/ml) (Sigma, USA) which were added to the culture media every day. 50-100,000 cells

were transplanted using a 5 uL Hamilton syringe to deliver 2 uL to the region around the

substantial nigra or directly onto the striatum. For co- transplants with laminin, 50 ug of

laminin was added to a mixture of cells, 2% methylcellulose, and B media for transplant.

Immunocytochemistry and Quantification

For morphological and phenotype analysis, slices were slices were fixed with 4%

paraformaldehyde for at least 24 h at 4 C. Sections were then either processed as whole

mounts or embedded in paraffin and sections cut at 10 um.

Immunocytochemistry for tyrosine hydroxylase (1:1000, polyclonal, Chemicon,

USA), GFP (1:1000, Sigma, USA), Nissl (NeuroTrace, Molecular Probes, USA) and

DAPI (Vector, USA) was performed on these sections to assay slice viability as well as

ESNP survival and integration. Sections were mounted on slides and incubated in

primary antibody overnight at 4 C. Labeling with fluorescent secondary antibodies

(Molecular Probes, USA) was performed at room temperature for one hour. Dil labeling









was performed using a Dil paste (Molecular probes, USA) applied using a 16 gauge

needle tip. Paste was applied to the striatum of slices after one week in culture.

Cell counts were performed on 10 uM sections. Serial sections, at least 40 uM

apart were analyzed. TH+ and Nissl/DAPI+ cells in the SNc were counted, and the

counts averaged across conditions. For striatal density, digital photos were taken of the

striatum under the same shutter and gain settings. Image J (NIH, USA) was used to

calculate the mean grey value of a random region of the striatum. All measurements were

individually normalized to the grey value of adjacent cortex to account for staining

variations. All counts and intensity data was analyzed using GraphPad Prism

(Graphpad.com, USA).

Electrophysiology of Slice Culture Transplants

Culture media was removed and slices were placed into a holding chamber

continuously perfused with oxygenated artificial cerebrospinal fluid (aCSF) containing,

in mM: 125 NaC1, 3 KC1, 26 NaHCO3, 1.25 NaH2PO4, 20 glucose, 1 MgCl2, and 2 CaCl2

and maintained at 350 C during experiments. Intracellular pipette solution comprised of,

in mM: 145 K-gluconate, 10 HEPES, 10 EGTA, and 5 MgATP (pH 7.2, osmolarity 290).

For experiments in which post-synaptic currents were recorded, 145 K-gluconate was

replaced with 125 KC1 and 20 K-gluconate. Recordings were performed with an

Axopatch-1D (Axon Instruments, USA) and filtered at 5 kHz. Clampex 8.2 (Axon

Instruments, USA) was used to deliver command potentials and for data collection.

Series resistances were < 20 MQ and checked frequently to ensure that they did not

deviate. During current-clamp experiments a step protocol was utilized in which currents








between 10-100 pA were applied per step. Clampfit 8.2 (Axon Instruments, USA) was

used to analyze voltage and current traces.


A


-I-




*11 I


B


C


6-OHDA
Pre-treatment


Day 0 3
--h--I
Media "A" 2/3 "A"
Mixture 1/3 "B"


Figure 3-1. Slice Culture Protocol Schematic. Slice cultures are generated from
postnatal mice brains. A) After the brain is removed, the cerebellum is
removed and the hemispheres are separated. B) Hemispheres are then
superglued to a vibratome stage and covered in molten agar to support the
tissue during sectioning. After sectioning, slices are selected from the
appropriate level for culture. C) Sections for 6-OHDA treatment are bathed in
a 20 mM solution for 10 min prior to plating and the media is changed on the
samples as indicated in the timeline.


5
-2r
2/3 "B"
1/3 "A"


w


I














CHAPTER 4
RESULTS

Neural Stem Cell Differentiation and the Asteron Phenotype

Shortly after the initiation of sphere differentiation by plating onto adhesive

substrata, combined P-III tubulin/GFAP immunolabeling reveals distinct

neuron/astrocyte mixtures (Fig. 4-1A, B), in which no individual cells are seen co-

expressing these markers. During the first day post-plating, "immature" neurons are

apparent as small, rounded cells with relatively short processes (Fig. 4-1).

Over the next 1-2 days, the neuronal phenotype begins to "mature" as they start to

show a more fibroblastic soma in combination with longer, branching processes

(Fig. 4-1B). Shortly after this stage, exclusively 0-III tubulin+ neurons can be seen

combining fine neuronal-like processes with wide, flattened cell bodies characteristic

of astrocytes (Fig. 4-1C). By 5-6 days post-plating, there are few cells left that

exclusively express 0-III tubulin, while the number of co-expressing asterons

reaches its maximum level (Fig. 4-1D). Asterons continue to display flatter, more

stellate morphologies (Fig. 4-1E), and in the second post-plating week show a wide,

flat, "fibroblastic" morphology typical of cultured astrocytes (Fig. 4-1F). During this

transition period of neuronal decline and asteron increase, cells with all three

phenotypes (neuron, astrocyte, and asteron) can often be seen in a single, high

magnification field of view (Fig. 4-2A), arguing against the interpretation that the

asteron phenotype results simply from antibody cross-reactivity. Likewise, confocal

microscopy of individual asterons reveals that antibodies for neuronal and glial









markers are co-localized within the same cell, and it appears that these markers label

separate populations of subcellular elements within the same cell (Fig. 4-2B-D),

suggesting that the asteron phenotype is not the result of antibody cross-reactivity or

epifluorescence bleed-through. Combinations of monoclonal anti-P-III tubulin +

polyclonal anti-GFAP, and polyclonal anti-P-III tubulin + monoclonal anti-GFAP

co-label hybrid asteron cells equivalently.

Combination of Asteron Markers

In addition to P-III tubulin and GFAP, asterons also co-label with a combination

of monoclonal anti-P-III tubulin and polyclonal anti-S 100. Again, some but not all

P-III tubulin+ cells are also immunopositive for S100 (Fig. 4-3A & insets).

Likewise, asterons are immunolabeled with antibodies against GFAP and the

neuronal protein, MAP2 (data not shown). However, when we combine polyclonal

anti-GFAP with monoclonal anti-NeuN, a protein thought to be restricted to fully

mature neurons, we never observe cells expressing both markers (25 spheres

examined), even though it is clear from positive controls that both antibodies are

present at optimal concentrations for immunolabeling (data not shown). Finally,

combining GFAP cDNA in situ hybridization with P-III tubulin and GFAP

immunolabeling shows that cells transcribing astrocyte-associated mRNA are

immunopositive for both glia- and neuron-associated cytoskeletal proteins (Fig 4-3B,

C).

Analysis of Cell Death

Neurons (i.e. cells exclusively expressing neuronal phenotype markers) become

apparent immediately after spheres attach to substrate and begin differentiation, then

decrease in number until, after approximately two weeks, they are no longer detectable.









The observed decrease in neuron number is paralleled by an increase in asteron cells co-

expressing neuronal and glial phenotype markers, and it is this inverse relationship that

originally led us to hypothesize that neurons in these cultures undergo a phenotypic

transformation into hybrid neuron/astrocytic cells. A partial alternative to this

hypothesis, though, is that the reduction in neuronal cells is due simply to cell death. In

order to determine if cell death plays a significant role in neuronal reduction, we used two

methods to analyze apoptosis in cerebellar-derived spheres: TUNEL and caspase 3

immunolabeling. We focused our apoptosis analysis on the six days immediately after

sphere plating, since this time window corresponds to the vast majority of neuron/asteron

inversion. At all time points assessed only a small number of sphere-derived cells are

TUNEL+ (Fig.4-4B, compare to +control in 4A). Quantification of sphere composition

(including both the penumbral and the central sphere mass) with respect to neurons,

astrocytes, and TUNEL+ cells (Fig. 4C) shows that even if all of the TUNEL+ cells

represented dying neurons, it could not account for the dramatic reduction in neuron

number during the first few days after plating. The TUNEL analysis is mirrored very

closely by immunodetection of the early apoptosis marker, activated caspase 3; again,

only a small number of sphere cells at all time points analyzed are caspase+, and only a

fraction of these cells (6% of all caspase+ cells) are immunopositive for 111- tubulin

(Figure 4-5).

Physiological Properties of Hybrid Asterons

Electrophysiological recording of 20 candidate neurons, astrocytes, and asterons

reveals that retrospectively identified asterons (Fig. 4-6A,B) have a varied

electrophysiological profile. Clearly-identified neurons show both K+ and Na+ channels,

a depolarizing spike, and resting membrane potentials of -70 mV or lower (Fig 4-6C),









whereas astrocytes show large K+ channels, small (or no) Na+ channels, no depolarizing

spike, and resting membrane potentials usually greater than -70 mV (Fig. 7G). Asterons

show wide variability in resting membrane potential (-52 to -78 mV), but consistently

display K+ currents with relative amplitudes that place them between the amplitudes seen

for neuronal and astrocytic K+ currents. We found examples of asterons that display

physiological profiles that resemble astrocytes (Fig. 4-6F; compare to 4-6G), though with

lower amplitude K+ current. In addition, one confirmed asteron showed intermediate

amplitude K+ channels, neuron-like Na+ channels, and a Na+ spike that could be

abolished by the administration of TTX (Fig. 4-6D&E). The relative amplitude of the K+

current among the different cell types, combined with the presence or absence of

significant Na+ channels suggests that as cells transition into asterons from neurons, they

begin to turn off Na+ channel expression and upregulate K+ channel amplitude.

Extracellular Matrix Influence on Neurosphere Migration

Neurospheres derived from both SVZ and cerebellar niches developed in culture

and when plated on adherent substrates generated robust numbers of neurons and glial

cells (Figure 4-7). The results indicate that cells generated from neurospheres display

differential migration patterns on the three different ECM substrates tested. Analyzing the

distance migrated outward from the edge of the sphere to the furthest observed cell

allowed us to generate a plot of migratory velocity, and of total distance migrated.

Laminin and fibronectin allow multipotent neurosphere cells to migrate faster compared

to CSPG.

After 24 h, spheres on all substrates attached and cells began to migrate outward in

a radial pattern. Laminin showed a significantly faster migration velocity compared to









CSPG, but the difference between fibronectin and laminin was not significant. Although

not reaching the level of statistical significance, the difference between fibronectin and

CSPG was consistent between trials and did appear to favor migration on fibronectin. At

48 h fibronectin showed a significant difference from both laminin and CSPG in

outgrowth velocity, and laminin contributed to a significantly faster cell migration

compared to CSPG. At 72 h laminin gave rise to no significant difference in velocity

from fibronectin, but both fibronectin and laminin substrates generated significantly

faster migratory rates of neurosphere cells compared to CSPG. At 144 h the velocities for

all the substrates decreased, suggesting a loss of migratory capacity in the maturing cell

population.

Total migratory distance followed the same pattern of ECM preference as

migration velocity. At 24 h laminin showed a significantly larger outgrowth over CSPG,

and fibronectin showed a large but not significant difference over CSPG. At 48 h the

increase in fibronectin velocity led to a significant difference in migration distance over

both laminin and CSPG. At 72 h, laminin and fibronectin both maintained a significant

increase in outgrowth distance over CSPG. This same pattern continued at 144 h.

The values obtained for the migration velocities on laminin and fibronectin prior to

144 h are in accordance with cell migration rates reported in slice culture studies by

Komuro and Rakic (1995), who observed an average velocity of 13.9 uM/h for migrating

cerebellar granule cells in cerebellar slice cultures. This is in agreement with our data

showing that the maximal velocity for neurosphere cells on fibronectin at 48 h was 13.94

uM/h and for laminin 12.86 uM/h at 72 h. The velocity data suggests a maturing cell

population that begins to mature and cease migrating around 144 h. This decrease does









not seem to be distance-related, as each substrate showed a deceleration with significant

differences in the migration distance. In addition, whereas the assay does not discriminate

between random and directed migration, the radial outward pattern of migration and the

lack of asymmetric migration suggests that there is little directed migration (Figure 4-10).

Since all substrates exhibited this pattern of nondirected migration we concluded that

distance and velocity measures were affected only by matrix composition. We did not

note any difference in neuron/glial percentages between the different ECM substrates that

were tested.

Nigrostriatal Slice Culture

Long-term parasagittal slice cultures demonstrated good viability all the way

through 4 weeks in culture. Figure 4-11A shows staining for TH, with robust expression

in the SNc, the medial forebrain bundle (MFB) and the striatum, after 3 weeks in culture.

In parasagittal slices of postnatal mouse brains, there are 2-3 400 gtm thick slices with

both the SNc and striatum present from each side, with the MFB also being present

between these structures. Figure 4-11B shows Dil labeling of a slice 4 days after

application. There is extensive label within the Dil application points in the striatum, and

labeled fibers and cells away from the application in the nigral region (Fig. 4-11B),

suggesting active transport of the dye through intact fibers. Axon tracing using a 10,000

MW dextran tracer (Fluro-Ruby) placed in the striatum show labeled cells in the cortex

(e.g. layer V) and in the nigral area (Fig. 4-11C). Taken together, these data show that

long term parasagittal slice cultures retain a sufficient three dimensional organization to

functionally model their in vivo correlates.









6-Hydroxy Dopamine Lesions of Nigrostriatal Slice Cultures

Exposure of the slices to 6-OHDA caused a significant reduction in the number of

SNc TH positive neurons. Figure 4-12A shows the TH staining of a slice exposed to 6-

OHDA at the time of initial plating, with an almost complete lack of staining in the

striatum, and a significant reduction in the medial forebrain bundle and SNC after 3

weeks in culture. Cell counts of lesioned slices showed a significant (P=0.0092) 46%

6% decrease in TH+ cell bodies in the SNc (4-12B). In addition, there was also a

significant (P=0.0172) reduction, 60% + 6%, in the striatal TH density (Fig 4-12C).

Nova-red visible chromagen staining (Figure 4-13 A,B) showed robust TH staining

throughout the entire nigrostriatal circuit. Lesioned slices showed a similar pattern

staining loss as the fluorescent labeling. We did note a difference in dorsal compared to

ventral striatal labeling. This is likely due to the sparing of the ventral tegmental area

dopamine neurons in the midbrain which preferentially project to the ventral striatum and

are less susceptible to 6-OHDA lesioning.

High magnification views of the slice cultures also show characteristic lesion-

induced changes. Figure 4-14A shows the effect of 6-OHDA on the SNc of slice cultures.

In control slices the SNc is morphologically intact with discrete TH staining and a clear

cytoarchitecture including fine intranigral fibers. 6-OHDA lesioned slices show a loss of

discrete labeling and a reduction in the number of clearly identified cell bodies and

intranigral fibers. In the striatum, the loss of TH staining is very pronounced in the

lesioned slices (Figure 4-14B).

Nova-red staining for TH confirmed the results of fluorescent antibody labeling.

High magnification views of the striatum showed a significant reduction in TH staining

compared to control slices after 2 weeks in culture (4-15 A,B). High magnification views









of the SNc (Figure 4-16 A,B) also showed a reduction in TH staining in lesioned slices.

We noted a reduction in non-specific punctuate labeling with the nova-red staining over

the fluorescent secondary antibodies suggesting that the visible chromagen method may

be the preferred method for visualizing the effect of lesions on the slices. The trade off is

that the current nova-red technique has difficulty in resolving cell bodies in control slices

due to the staining intensity. Further refinement of the staining methods should enhance

the ability to visualize cell bodies in control and lesioned slices.

Real Time Analysis of Nigrostriatal Degeneration

The use of slices from animals expressing GFP under the control of the TH

promoter shows that 6-OHDA exposure causes a loss of GFP expression confirming a

similar loss of TH+ cells and fibers in this transgenic mouse model Using slice cultures

from the TH-EGFP mouse, it was possible to track, in living slices the loss of GFP signal

which corresponded to the loss of dopaminergic innervation. Our initial results

demonstrated a strong GFP signal localized to the striatum and the SNc (Figure 4-17).

When slices were treated with 6-OHDA prior to their culture, GFP was significantly

reduced in the striatum within 4 days of plating. The control GFP signal remained strong

for at least a week in culture, suggesting that the culture conditions are amenable to

keeping the nigrostriatal circuit intact.

Nigrostriatal Slice Culture Applications

Using the 6-OHDA lesion model system we have begun to screen a variety of

potential therapeutic options. The majority of the work has been done on dennervated

slices using ES derived neuronal precursors to try and repair and reconnect damaged

circuitry. These cells have demonstrated a robust survival in slice cultures preparations

and are amenable to manipulation prior to transplantation. We have examined the effect









of laminin on ESNP migration and integration into the slice culture. In vitro and in vivo

experiments were performed to induce a dopaminergic phenotype in the ESNP' cells, in

order to replace the cell type lost in Parkinson's. Given the ease of manipulation and

access to the slice culture and the transplanted cells we have also demonstrated functional

characterization of implanted ESNP's.

Embryonic Stem Cell Neural Precursor Transplants into Nigrostriatal Slice
Cultures

ESNP's transplanted into slice cultures remained viable for up to 4 weeks in

culture. When initially plated the cells tended to exist as aggregates that cells slowly

migrated out from. Figure 4-18 shows ESNP's implanted on the slice after 6 days in

culture. After 3 weeks in culture, ESNP's were observed throughout the implantation area

and possessed a more mature phenotype with processes and expression of neural

cytoskeletal markers, such as MAP2 (Figure 4-19). Adding laminin to the ESNP

transplant mixture enhanced the outgrowth of cells through the slice culture. Within 6

days in the presence of laminin, cells had dispersed out in the slice and there was a lack

of cellular aggregation seen with laminin (Figure 4-20, 4-21).

Embryonic Stem Cell Neural Precursor Integration and Maturation in Slice
Cultures

ESNP integration into the slice culture appeared robust, with many of the cells

developing extensive processes (Figure 4-22). ESNP's implanted into the slice culture

striatum matured and were able to integrate into the slice culture circuitry.

Electrophysiological recording from an ESNP in the striatum showed that the cell was

capable of generating an action potential and responded to post synaptic currents,

suggesting that the cell was receiving inputs from surrounding neurons in the striatum.









Figure 4-23 shows a mature ESNP in the striatum, and shows the recorded cell and the

electrophysiologal traces that were performed on the cell within the slice.

The ultimate goal of transplantation regeneration is to replace the cell population

lost in the degeneration and to have the transplant reside in the anatomically correct

location. Preliminary results with transplants near the intact SNc have shown that ESNP's

are able to mature in this region and survive (Figure 4-24).

Dopaminization of Transplantable Cell Populations

Dopamine Neuron Generation from ESNP Culture In Vitro

Culturing ESNP's in the presence of FGF8, SHH, and FGF8, enhanced the

differentiation of these cells into dopamine neurons. Our results with a 7 day induction

protocol showed an approximate 10-fold increase in the number of TH+ neurons

generated compared to non-induced controls (Figure 4-25). In vitro dopaminized ESNP's

matured rapidly on laminin coated coverslips and extended long processes. Figure 4-26

shows the typical morphology of in vitro dopaminized ESNPs.

Dopamine Neuron Generation from ESNP Cultures in Slice Culture

Using our slice culture model system we showed the ability of ES derived neurons to

mature and integrate within the culture environment. Our next step involved manipulating

the cells that we were transplanting in order to try and selectively replace the population

of neurons that was lost in our lesion model, the dopaminergic neurons of the SNc.

Various strategies have been attempted to try and induce a dopaminergic phenotype in

cells, ranging from genetic knock-ins of transcriptions factors to culture in the presence

of cytokines and growth factors. Using a combination strategy of two of the more potent

cytokine induction methods, we were able to enhance dopaminergic neuron generation in

our ESNP cultures, and obtained interesting results using this induction method on other









cell populations. In the slice cultures, dopaminized ESNP's survived for at least 2 weeks

in the slice and exhibited morphological maturation. We observed transplanted

dopaminized neurons located in ectopic locations such as the striatum and cortex (Figure

4-27). In general these neurons had robust process extension, but did not appear to have

any sort of directed growth

Dopaminization of Adult Stem Cell Cultures

Given the success of the cytokine cocktail on inducing a dopamine phenotype,

preliminary work has begun on inducing adult stem cell neuroblasts to a dopaminergic

phenotype. The initial results have suggested that adult neural stem cells can be induced

using cytokines, but that the effect is more limited than in ES derived neurons (Figure 4-

28). In addition we noted a lack of co-localization of TH with neuronal markers. While

this does not rule out the possibility that these cells are neuronal, it does raise the issue of

whether non-neuronal cell types can be induced to express TH (Figure 4-29).








































Figure 4-1. Combined P-III tubulin and GFAP immunolabeling reveals the temporal
progression of the asteron phenotype. A) Shortly after initiation of
differentiation, spheres contain non-overlapping populations of cells
immunopositive for either 0-III tubulin (red), or GFAP (green). No cells are
seen co-expressing both markers (inset in A, higher magnification). B)
Twenty-four hours post-plating, spheres still contain cells with mutually
exclusive 0-III tubulin (red)/GFAP(green) labeling patterns, but neuronal
morphology is more mature (inset in B). C) Phenotypic heterogeneity is
increased two days after plating, with cells that co-label with both neuron
(red) and astrocyte (green) markers (arrow pointing to "yellow" cell). D) At
three days post-plating, few cells exclusively expressing P-III tubulin can be
seen, and the number of co-expressing asterons increases. E) At five days
neurons are very scarce, and co-expressing asterons display astrocytic
morphologies. Inset in (E) shows a higher magnification of an asteron at this
stage. F) By six days co-expressing cells show a wide, flat, fibroblast-like
morphology typical of cultured astrocytes.








































Antibodies against P-III tubulin and GFAP reveal three immunophenotypes,
and label separate sub-cellular elements within asterons. A) P-III tubulin+
neurons (red), GFAP+ astrocytes (green), and co-expressing asterons (yellow)
can be seen in close proximity with no evidence of antibody cross-reactivity.
B-D) Confocal microscopy shows the co-localization of both immunomarkers
in a single z-axis of an asteron. Scale bar in (A) applies to all panels.


Figure 4-2.






































Asterons co-express 0-III tubulin with S 100, and transcribe GFAP mRNA
Two days after plating, some cells (e.g. arrows) are co-labeled with both the
astrocyte calcium-binding protein S1000, and P-III tubulin (A). Not all 0-III
tubulin+ cells are also S100p+ (lower left inset in A: arrow indicates a cell
exclusively expressing P-III tubulin), indicating that the staining pattern does
not result from antibody cross-reactivity. Lower right inset in (A) shows
higher magnification of a double-labeled asteron. (B&C). Some cells that
hybridze GFAP cDNA (asterisk in B) also immunolabel for GFAP and P-III
tubulin (asterisk in C). Inset in (B) shows that P-III tubulin+ neurons (red) do
not hybridize GFAP cDNA.


Figure 4-3.






























- neurons
asterons
-e-TUNEL+


1 2 3 4 5 6
days after plating


Asteron appearance corresponds with neuronal reduction that is not
attributable to apoptotic cell loss. A) TUNEL staining reveals cells
undergoing apoptosis in control DNAse-treated sphere cells. B) Untreated
sphere cells plated for three days. C) The temporal relationship among
neurons, asterons, and apoptotic cells. As neurons (blue line) decrease, there is
a corresponding increase in asterons (green line). TUNEL (red line) shows
that there is a steady rate of 1-3 apoptotic cells per sphere during the first
week after plating.


C


2
cc




'Uj
I-





Lu
E


Figure 4-4.











250




Is-
C
cn 20-

Ct
i c. 15l
o ac
1_C.
2 ^
SU
C



0-


24 48 72 168 staurosperine
(48hr)
hours after plating


Caspase 3 analysis of cell death accords well with TUNEL data. Histogram
shows that the level of cell death detected with caspase 3 immunolabeling
during the first week after plating corresponds remarkably well with the level
of TUNEL staying. Apoptosis was induced with staurosporine in spheres plated
for 48 hours as a positive control (red bar).


Figure 4-5.



















C D


asteron I w X
J 50spA
20 M5


G


Physiology of neurons, astrocytes, and asterons. A) Candidate asterons
immunolabeled for P-III tubulin (red) and GFAP (green) were voltage
clamped. B) Patched cells were filled with biocytin (blue) during recording
and later immunostained C) Voltage- clamp recordings demonstrate the Na+
and K+ current profiles of a typical neuron. D) Tracing of an asteron
possessing Na+ and K+ currents. E) TTX exposure blocks the Na+ current
activity of this cell. F) Another example of an asteron shows no Na+ current,
and a more astrocytic K+ current. G) A trace from a typical astrocyte shows a
large amplitude K+ current with no Na+ current.


_I SW A
20 ms

F


_0jOpA
20 ft%


asteron 2
0 IM pA
20 TM


Figure 4-6.


J 2000 pA
20 ms





























Figure 4-7. Phenotype immunostaining of neurosphere derived cells. Neurosphere
derived cells immunolabeled for P-III tubulin (red) and GFAP (green) show
evidence of morphologically maturing neurons on the astrocyte monolayer.


































ThIN


Velocity plot of neurosphere derived cells on different ECM substrates.
Velocity plots show that the different ECM substrates have variable effects on
neurosphere cell speed. Laminin and fibronectin show the fastest migration
speeds, while CSPG significantly slows down cell migration. Cells on all
substrates begin to show a decrease in speed after 72 hours in culture.


Figure 4-8.


*cFISPI t
-acer0O




















p(L L,c ,II
p(mr, c)=jj
la ~minn


Time


Migration distances of neurosphere derived cells on ECM substrates.
Neurosphere derived cells show significant differences in migration distance
on different ECM substrates. Laminin and fibronectin show the longest
migration distances with CSPG significantly reducing cell migration distance.


1600D


1400000


1200 O


1000.00


8l00Z
_nm
5 IMM


400d0


Figure 4-9.






















Figure 4-10. Neurosphere derived cell migration patterns and measurements.Cells
migrating from neurospheres migrate in a radial pattern outward from the
sphere core. A) Neurosphere derived cells on laminin after 144 h in culture.
B) Neurospere derived cells on fibronectin after 144 h in culture. C)
Neurosphere derived cells on CSPG after 144 h in culture.



























U


Figure 4-11. Slice culture viability and nigrostriatal circuit maintenance. A) Montage of
TH staining in an intact slice after 2.5 weeks in culture. Inset into A is a
nuclear stain of the hippocampus showing the intact cytoarchitecture. B) Dil
tracing within a slice after 4 days in culture with the application points in the
striatum and backfilled cells in the SNc. C) Dextran tracing of an intact slice
after 3 days in culture. Arrows represent application points in the striatum and
there are labeled cells in the SNc and the cortex (Higher magnification insets
of these regions).

























T


Ia

I I


*


Control 6-OHDA Control 6-OIHDA

Figure 4-12. 6-OHDA lesion of nigrostriatal slice cultures. A) TH staining of a slice
culture that was exposed to 20 mM 6-OHDA. B) Histogram showing the
percent reduction in SNc cell bodies, P<0.05. C) Reduction in optical density
of TH staining.






















































Figure 4-13. Nova-red staining of TH reveals control and lesioned nigrostriatal circuitry.
A) Intact control slice culture after 2 weeks in culture. The nigrostriatal
circuit, including SNc, MFB, and striatum are all preserved and show intense
labeling. B) A 6-OHDA lesioned slice, after 2 weeks in culture. The TH
staining is reduced, notably in the SNc and in the dorsal striatum.





































Figure 4-14. Cytoarchitectural changes in 6-OHDA lesion slice. A) TH staining in the
SNc of control and lesioned slices. B) TH staining in the striatum in control
and lesioned slice.


SNc






6-OHDA

Stratum


























Figure 4-15. Nova-red labeling of striatal TH shows effect of exposure to 6-OHDA. A)
Striatal TH labeling in a control slice culture striatum after 2 weeks in culture.
B) Striatal labeling in a 6-OHDA lesioned striatum after two weeks in culture.


















































Figure 4-16.


57










































Nova-red staining of the SNc reveals loss of staining after exposure to 6-
OHDA. A) Representative secti ons from control slice cultures after 1-2
".4



































weeks in culture. B) Representative sections from slice cultures after 1-2
weeks in culture after exposure to 6-OHDA. Slices exposed to 6-OHDA
show a significant reduction in staining intensity and in observable cell
bodies.
,- bi j ION








NSP
OD A) R en ro
we6 in co





































Figure 4-17. Real time analysis of TH-GFP. A) Control slices show intense GFP labeling
in the striatum at 4 and 7 days. B) 6-OHDA treated slices at the same time
points show a significant decrease in GFP intensity suggesting a loss of
dopaminergic fibers.

























Figure 4-18. ESNP transplants into slice cultures. Transplanted ESNP's after 6 days in
the slice culture appear as cellular aggregates with little evidence of migration
into the slice tissue.


Figure 4-19.


Long term ESNP transplants in slice cultures. After 23 days in culture,
ESNP's have migrated through the slice culture and in this high magnification
view can be seen extending processes through the slice. Inset shows a MAP2
positive GFP+ neuron, showing that the transplanted cells are expressing
neuronal markers.
































Figure 4-20. Laminin enhances ESNP migration through slice cultures After 6 days in
cultures, ESNP's that were transplanted in the presence of soluble laminin
show an increased spread through the slice culture and less cellular
aggregation.


Figure 4-21. Laminin enhances process outgrowth of ESNP's in slice cultures. After 6
days in culture, ESNP's, under high magnification, show evidence of
extensive process outgrowth, comparable to ESNP's not treated with laminin
after 3 weeks in culture.








































Figure 4-22. GFP+ ESNP striatal transplant. GFP+ ESNP located in the striatum after 2
weeks in culture. This ESNP demonstrates a significant level of maturation
with extensive process arborization. Red is TH staining showing the
dopaminergic fibers running into the striatum, green is GFP and blue is a
nuclear counter stain.



















Figure 4-23. Electrophysiological Characterization of Transplanted Cells. (A) GFP+
ESNP cell in the striatum with patch clamp. B)Tracing indicating that the
patched cell has the capability to generate an action potential. C) Tracing
showing that the cell exhibits post synaptic currents.



























Figure 4-24. ESNP's located near the substantial nigra. ESNP's located near the SNc
show survival and process extension after 2 weeks in culture, suggesting that
this region is capable of supporting ESNP engraftment.















12.E-

10,0.


t B.r

a _


TH- GCn T H+ Venl
Figure 4-25. Increase in TH+ neurons derived from ESNP's exposed to ventralizing
agents.





















Figure 4-26. In vitro ESNP dopaminization.. ESNP's cultured on laminin coated
coverslips, under the influence of inducing cytokines, express TH and show a
high level of maturation including extensive process extension.


R HUH
S
s
i
;
i
;
i
;
I
I S ! f !
I
S


- : 1 I t I I 1 i i












































4-27. Dopaminized ESNP's implanted into slice cultures. TH+ ESNP cells were
seen in isolation, with elaborate short distance processes. Cells were implanted
into the striatum and were observed in the striatum and neighboring cortex.



































igure 4-28. Adult neural stem cells exposed to dopaminzing cytokines express TH.
Cultured adult neual stem cells can be treated with FGF8, SHH, and
pleiotropin to induce TH expression in a subset of cells. Red is beta III tubulin
and green is TH.





















































Figure 4-29. Induced TH+ adult stem cells. Adult neural stem cells exposed to FGF8,
SHH, and pleiotrophin. Panel A shows TH+ cells, Panel B is beta III tubulin
positive cells and Panel C shows the merged image with a nuclear
counterstain.













CHAPTER 5
DISCUSSION AND CONCLUSIONS

Adult neural stem cells and ES derived neurons represent two populations of cells

that may be amenable to repair and regeneration within the central nervous system. One

of the biggest challenges to utilizing stem cells effectively is controlling cell migration,

differentiation, and integration into damaged tissue. Our initial work with adult

neurosphere cultures focused on cell fate determination. In these experiments we

observed a hybrid cell type that we termed "asterons" that appeared to posses

characteristics of both neurons and astrocytes. Further analysis of neurosphere cells on

different ECM molecules allowed us to generate migration profiles that have identified

ECM molecules that enhance migration of neural stem cells. In order to better understand

how stem cells behave in the neuronal environment we have developed a novel slice

culture bioassay system. Using this slice culture model system we can observe in real

time the fate choice and integration potential of both adult and embryonic stem cells.

Stem cell repair of damaged circuits within the brain is a key area of stem cell therapy

and our slice culture bioassay focused on examining stem cell behavior in a model of

Parkinson's disease.

Characterizing and manipulating stem cell fate choice is a critical component of

utilizing stem cells for regeneration based therapies. Without the ability to make the right

type of cell, stem cell based therapies would be ineffective or potentially more harmful to

the patient. In addition, basic questions of cell phenotype and cellular developmental

processes can be examined using stem cells as a recapitulation of cellular differentiation.









Our initial experiments on adult neural stem cell derived neurosphere cells allowed

us to examine postnatally derived glial and neuronal development. Our observations

indicated a time dependent decrease in the neuronal population, coincident with the

appearance of the hybrid cell type asterons. Our hypothesis was that a subset of neurons

in the neurosphere cultures was transdifferentiating from early immature neurons into

glial cells. Our data showed that only immature neuronal markers, such as beta III

tubulin, co-localized with astrocyte markers such as GFAP in asterons. Mature markers,

such as NeuN did not co-localize with any glial markers. This suggests that the asteron is

only expressing immature markers of differentiation. Electrophysiological recording from

asterons showed an variable intermediate profile of membrane currents and potential.

Compared to neurons, asterons tend to lose Na+ currents, show increased K+ amplitude

and generally have a lower resting membrane potential. However we did observe asterons

that were capable of generating action potentials that could be blocked using Na+ channel

blockers. Cell death analysis did not show any significant levels of neuronal apoptosis,

suggesting that not all of the neuronal loss was due to cell death.

All of the evidence then supports are hypothesis that neurosphere derived early

neurons may be capable of altering their cell fate choice during early development. While

there is no reliable evidence for asterons in vivo, there have been several reports of cells

that appear to have intermediate properties. Some GFAP+ cells derived from human

embryonic CNS stem cells can exhibit spontaneous neuronal firing patterns in vitro

(Gritti et al., 2000), and a GluR-expressing astrocyte in the hippocampus has been

described that may represent an intermediate cell type (referred to as an astron) that

possesses glial properties, but may have begun to express neuronal genes (Matthias et al.,









2003). While it is possible that the asteron may only represent an in vitro state, it does

suggest that environmental factors can be used to alter cell fate choice, and in addition

generate unique cell type.

An intriguing possibility is that the asteron represents an open ended state of stem

cell differentiation. At this stage the asteron may be more receptive to exogenous

influences to determine cell fate as well as certain intrinsic programs. Damage to these

intrinsic developmental programs has been linked to the development of tumors derived

from stem cells (Perryman and Sylvester, 2006). In addition there have been reports of

cells similar to asterons isolated from cortical brain tumors of humans (Ignatova et al.,

2002). The asteron therefore could be an in vitro representation of an in vivo stem cell

state that allows for differentiation, but may also represent a state where oncogenic

disruptions might initiate tumor formation.

Our next area of study using these adult neural stem cell derived cells was to

examine the effect of extracellular matrix molecules on cell fate choice as well as

physical properties of migration. Extracellular matrix molecules have long been shown to

affect cell migration and differentiation, both in vivo and in vitro. Neural stem cells in

particular are normally restricted to their germinal zones through the use of inhibitory and

permissive ECM. Neurosphere derived cells plated on laminin and fibronectin showed

and enhanced migration capacity, compared to CSPG substrate. Our results indicated that

neural stem cells on all tested substrates demonstrated a time dependant increase, then

decrease, in migration velocity. This pattern is suggestive of a maturing cell population

that becomes less mobile, and more morphologically mature. The velocity data also

shows that fibronectin and laminin are more permissive for neural stem cell and daughter









cell migration than CSPG. There was no appreciable difference in cell fate, suggesting

that the adult neural stem cell does not respond to these ECM molecules in determining

fate. Given the predictable nature of neural stem cell behavior on these substrates it

becomes feasible to generate scaffolds for neural stem cell transplants or as bridges for

endogenous stem cell migration. Permissive substrates placed inside the rostral migratory

stream could hypothetically be used to transport endogenous stem cells to the site of an

injury. This scaffold could be seeded with cytokines and transcription factor activators

that could be used to induce SVZ stem cells into the appropriate cell type for repair.

Working within the in vitro cell culture model provides advantages in observation

and manipulation, but does not provide enough information regarding how in vivo

environments and conditions may interact with cell transplants. Since cell transplants are

being aggressively targeted for neurodegenerative disorders, we decided to focus our

stem cell characterization and manipulation on a model of Parkinson's disease. Based on

our observations using adult neurosphere derived cells, we needed a system where we

could track over time the differentiation and migration of cells within the model.

Organotypic slice cultures represent a novel culture method that combines advantages of

in vitro and in vivo environments. By maintaining the cytoarchitecture of the brain, cell

transplants are exposed to factors and environmental conditions similar to in vivo

transplants. In addition slice cultures allow for the direct manipulation and observation of

transplanted cells. Developing a novel mid-sagittal slice culture system that maintains an

intact nigrostriatal circuit was our first challenge. Once we accomplished creating the

slice model, our experiments demonstrated that both embryonic and adult stem cell fate

determination is dependent on the interplay of many different factors. The ability to









observe and manipulate these cells inside the neuronal environment is critical to better

understand how these transplants might behave in patients.

Cell transplants are being developed as a therapy for neurodegenerative diseases.

Our slice culture model provides a suitable paradigm to model nigrostriatal degeneration

and allows for a "Parkinson's disease in a dish" system. This novel system maintains an

intact connection between the circuit components throughout the entire culturing period,

as opposed to other slice culture paradigms that rely on regrowth of axons in culture to

recreate connections in the dish. This model system can be used to observe the

endogenous cells within the slice, as well as test a variety of toxic or therapeutic agents.

Using 6-OHDA we have selectively degenerated the nigrostriatal circuit and generated a

model of PD that is amenable to testing therapeutic options such as stem cell replacement

therapies. Exposure to 6-OHDA induced a significant level of nigrostriatal degeneration,

causing an approximate 46% reduction in SNc cell bodies and a 60% reduction in striatal

dopamine innervation. These reductions are in the rage of those seen in early to mid stage

PD, and represent a reasonable level of degeneration at which to test cell replacement

strategies.

This model system is also amenable to future lesion options. Initial work is being

done on other potential toxic lesions, including using proteosome inhibitors. Previous

work using these compounds in animal models has shown degeneration in the

nigrostriatal circuit and evidence of lewy bodies inclusions. This toxin model may more

accurately model the progressive nature of PD, and recreate the key pathological

hallmark of intracellular inclusions. Using this toxin in a slice culture model should allow

for a detailed examination of how intracytoplasmic inclusions may initiate cellular









degeneration. Real time observation of cell states during inclusion generation may yield

clues as to what cellular processes or insults precipitate lewy body formation.

Besides toxic lesions, the availability of genetic mutants has allowed for the

examination of specific mutations on the development of neurodegeneration. Mutants

such as the alpha synuclein, and parking mutations have provided valuable insight as to

what biochemically occurs in neuronal cells with known PD mutations. Slice cultures

allow for the examination of these mutant models, independent of co-morbidity factors

that are often present in these mutants. An example of this is the weaver mutation.

Weaver mutants display a severe cerebellar dysfunction and exhibit ataxia, as well as

progressive degeneration in the nigrostriatal circuit with a specific loss of A9 dopamine

neurons in the SNc (Triarhou, 2002). The mutation linked to weaver, the GIRK2

potassium channel mutation, has been shown to be important in A9 dopaminergic SNc

neurons genesis and survival (Triarhou et al., 1988). While this mutant shows some

useful features of PD, its limited lifespan, postnatal day 21 usually, makes it a difficult

animal model. We have cultured weaver brain slice cultures past this day 21 mark and

initial results suggest that the viability of non affected regions are not significantly

reduced. Since the cause of death in most of the mutants is a failure to thrive due to motor

deficits, the slice culture model is an effective way to track the ongoing degeneration

caused by the mutation independent of the animal. As more mutations are discovered in

familial and sporadic PD, the number of mutant models will increase, and this slice

culture model system represents a promising methodology to rapidly screen mutant

disease progression and therapeutic efficiencies.









ES cell derived neurons were implanted into slice cultures and survived and

integrated into the host tissue. This integration may be enhanced by the addition of

permissive ECM molecules that would increase cellular migration and process extension.

Experiments presented here have shown that adult neural stem cells show an increase in

migratory potential on laminin and fibronectin over CSPG. Based on these results, the

seeding of neural stem cells in different matrices may allow for a precise and directed

migratory pattern. Further development of ECM substrates may allow for the

development of grafts that could redirect endogenous stem cells to areas of damage and

degeneration and allow for in situ regeneration.

The presence of laminin with our transplanted ESNP's enhanced their migratory

potential and integration into the slice. This observation may have important clinical

implications as stem cell transplantation strategies become more refined. The addition of

permissive ECM molecules to stem cell transplants in clinical settings may allow for

better cell survival and integration. ECM molecules have been implicated in ES derived

neuron maturation and phenotype fate. Understanding what ECM molecules direct ES

cell fate choice it may be possible to replicate this in transplants. As a general rule the

more immature a cell is the better chance that it has to survive and integrate into a host

environment. Being able to implant less mature ES derived neurons that can complete

their maturation and development within the host would allow for a better integration.

Directing ES and adult neural stem cells toward the appropriate phenotype is a

critical step in ensuring that the cells being transplanted respond in the correct

physiological manner. Our results with FGF8, SHH, and pleiotrophin, demonstrated that

cytokine exposure is a potent paradigm for inducing TH expression in ES derived









neurons and to a lesser extent adult neural stem cells. While the tested cells are positive

for tyrosine hydroxylase, there is still little evidence that these cells are actively releasing

dopamine. Future work on these induced cells will hopefully be able to analyze

conditioned media from these cells and assay the presence of dopamine or its metabolites

in the media. Even with appropriate release of dopamine, there are still hurdles in

reconnecting the circuitry. Recent evidence from patients treated with fetal dopaminergic

cells has suggested that the incidence of dyskinesia, abnormal and exaggerated motor

movements, is the result of inappropriate dopamine release, and loss of dopamine

reuptake, from the transplanted cells. Within the ventral mesencephalon there are two

distinct groups of dopamine cells, the A9 and A10 type cells. A9 cells of the SNc are

involved in the motor pathway and express dopamine autoreceptors that modulate

dopamine release. A10 cells of the ventral tegmental area are involved in reward

pathways with dopamine release, and lack the autoreceptor feedback. Since A9 and A10

cells are both part of the transplanted cell mixture put into the damaged striatum, there is

the potential for unregulated dopamine release that can lead to the dyskinesia..

Along with ESNP's we examined the use of adult stem cells as an inducible cell

population. Our initial results suggest that adult derive neural stem cells could be induced

to generate TH+ cells. Further work to be done on fine tuning the dopaminergic

phenotype will likely focus on genetic manipulation, through induction of SNc specific

transcription factors. Analysis of different dopaminergic populations to better understand

which genetic factors are involved in the final differentiation should allow for production

of tailored neurons that provide the correct signal output. Coupled with the information









on stem cell behavior on various substrates, this presents a possible transplantation

enhancement strategy for use in cell replacement therapies in neurodegenerative diseases.

Nigrostriatal slice cultures provide an adaptable and scalable methodology for gene

therapy based approaches for prevention and/or treatment of Parkinson's disease. Gene

therapy systems using AAV or Lentiviral vectors to introduce growth factors such as

brain derived growth factor (BDNF) or glial derived growth factor (GDNF) into animal

models of nigrostriatal degeneration (Bjorklund, 2000) The ability to deliver gene

therapy agents directly to the brain regions of interest reduces the difficulty associated

with this procedure as well as allowing for a smaller volume to be more precisely

delivered. In addition there is initial data on the efficacy of using a polymer based gene

therapy system (Hofland, 1996) to introduce genes into glioblastomas located within slice

cultures.

One of the most promising potential applications for this slice culture model system

is the ability to do high throughput screening of compounds that either increase cellular

degeneration or ones that prevent it. Slice cultures allow for more experiments per animal

and for direct manipulation of the tissue and the environment. Using slice cultures from

the TH-GFP animals we have been able to show proof of concept that these slices can

provide a read out of TH innervation in real time. Using 6-OHDA we have noted a

significant reduction in GFP intensity within the striatum compared to control slices that

have been in culture for over a week. Using this system a large number of compounds

could be assayed and effects over time measured. Given the epidemiological data for

pesticides and heavy metal exposure, the TH-GFP slice culture system may provide a









way to track how important factors such dose and time of exposure are for the potential

toxicity of these compounds.

The research presented here describes a novel slice culture model system that

provides a "Parkinson's in a dish" model system. Using this and in vitro cultures, we

have examined ES and adult neural stem cell differentiation, migration and integration

under a variety of conditions. Our results suggest that stem cells are greatly influenced by

their environment. Factors present during their culture can induce cell fate choices, and

can even promote hybrid cell types not normally seen in vivo. Extracellular matrix

molecules, such as laminin and fibronectin, can enhance stem cell migration, while ECM

such as chondroitin sulfate inhibits cell migration. In slice cultures laminin enhances stem

cell migration and morphological maturation. As stem cell therapy becomes more widely

available the need for information on how to condition these cells prior to transplantation

and how to best deliver and control them during and after transplantation will be key to

harnessing the power of these cells to rebuild damaged circuits and restore function.















LIST OF REFERENCES


Albin RL, Young AB, Penney JB (1995) The functional anatomy of disorders of the basal
ganglia. Trends Neurosci 18:63-64.

Altman J (1969a) Autoradiographic and histological studies of postnatal neurogenesis. 3.
Dating the time of production and onset of differentiation of cerebellar
microneurons in rats. J Comp Neurol 136:269-293.

Altman J (1969b) Autoradiographic and histological studies of postnatal neurogenesis.
IV. Cell proliferation and migration in the anterior forebrain, with special
reference to persisting neurogenesis in the olfactory bulb. J Comp Neurol
137:433-457.

Altman J, Das GD (1965) Autoradiographic and histological evidence of postnatal
hippocampal neurogenesis in rats. J Comp Neurol 124:319-335.

Altman J, Das GD (1966) Autoradiographic and histological studies of postnatal
neurogenesis. I. A longitudinal investigation of the kinetics, migration and
transformation of cells incorporating tritiated thymidine in neonate rats, with
special reference to postnatal neurogenesis in some brain regions. J Comp Neurol
126:337-389.

Anden NE, Dahlstroem A, Fuxe K, Larsson K (1965) Further Evidence for the Presence
ofNigro-Neostriatal Dopamine Neurons in the Rat. Am J Anat 116:329-333.

Anden NE, Dahlstrom A, Fuxe K, Larsson K (1966) Functional role of the nigro-
neostriatal dopamine neurons. Acta Pharmacol Toxicol (Copenh) 24:263-274.

Anden NE, Carlsson A, Dahlstroem A, Fuxe K, Hillarp NA, Larsson K (1964)
Demonstration and Mapping out ofNigro-Neostriatal Dopamine Neurons. Life
Sci 15:523-530.

Ansari SA, Nachanakian A, Biary NM (2002) Current surgical treatment of Parkinsons
disease. Saudi Med J 23:1319-1323.

Benninger F, Beck H, Wernig M, Tucker KL, Brustle O, Scheffler B (2003) Functional
integration of embryonic stem cell-derived neurons in hippocampal slice cultures.
J Neurosci 23:7075-7083.









Betarbet R, Sherer TB, Greenamyre JT (2005) Ubiquitin-proteasome system and
Parkinson's diseases. Exp Neurol 191 Suppl 1:S17-27.

Blandini F, Nappi G, Tassorelli C, Martignoni E (2000) Functional changes of the basal
ganglia circuitry in Parkinson's disease. Prog Neurobiol 62:63-88.

Bjorklund A, Kirik D, Rosenblad C, Georgievska B, Lundberg C, Mandel RJ (2000)
Towards a neuroprotective gene therapy for Parkinson's disease: use of
adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the
nigrostriatal system in the rat Parkinson model. Brain Res 886:82-98.

Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW,
McMahon SB (2002) Chondroitinase ABC promotes functional recovery after
spinal cord injury. Nature 416:636-640.

Bradley A, Evans M, Kaufman MH, Robertson E (1984) Formation of germ-line
chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309:255-256.

Braissant O, Wahli W (1998) Differential expression of peroxisome proliferator-activated
receptor-alpha, -beta, and -gamma during rat embryonic development.
Endocrinology 139:2748-2754.

Brazelton TR, Rossi FM, Keshet GI, Blau HM (2000) From marrow to brain: expression
of neuronal phenotypes in adult mice. Science 290:1775-1779.

Brotchie JM, Lee J, Venderova K (2005) Levodopa-induced dyskinesia in Parkinson's
disease. J Neural Transm 112:359-391.

Castellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy
bodies in Parkinson's disease. Acta Neuropathol (Berl) 100:111-114.

Cha GH, Kim S, Park J, Lee E, Kim M, Lee SB, Kim JM, Chung J, Cho KS (2005)
Parkin negatively regulates JNK pathway in the dopaminergic neurons of
Drosophila. Proc Natl Acad Sci U S A 102:10345-10350.

Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A (2003)
Functional expression cloning ofNanog, a pluripotency sustaining factor in
embryonic stem cells. Cell 113:643-655.

Deane KH, Spieker S, Clarke CE (2004) Catechol-O-methyltransferase inhibitors for
levodopa-induced complications in Parkinson's disease. Cochrane Database Syst
Rev:CD004554.

Diamond A, Jankovic J (2005) The effect of deep brain stimulation on quality of life in
movement disorders. J Neurol Neurosurg Psychiatry 76:1188-1193.









Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1999a) Regeneration of a germinal
layer in the adult mammalian brain. Proc Natl Acad Sci U S A 96:11619-11624.

Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999b)
Subventricular zone astrocytes are neural stem cells in the adult mammalian brain.
Cell 97:703-716.
Draper JS, Andrews PW (2002) Embryonic stem cells: advances toward potential
therapeutic use. Curr Opin Obstet Gynecol 14:309-315.

Dunnett SB, Rogers DC, Richards SJ (1989) Nigrostriatal reconstruction after 6-OHDA
lesions in rats: combination of dopamine-rich nigral grafts and nigrostriatal
"bridge" grafts. Exp Brain Res 75:523-535.

Franklin BJ, Paxinos, G.T. (1996) The Mouse Brain in Stereotaxic Coordinates. New
York: Academic Press.

Freed CR, Rosenberg NL, Schneck SA, Breeze RE (1992) Improved drug responsiveness
following fetal tissue implant for Parkinson's disease. Neurochem Int 20
Suppl:321S-327S.

Freed CR, Greene PE, Breeze RE, Tsai WY, DuMouchel W, Kao R, Dillon S, Winfield
H, Culver S, Trojanowski JQ, Eidelberg D, Fahn S (2001) Transplantation of
embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med
344:710-719.

Gasser T (2005) Genetics of Parkinson's disease. Curr Opin Neurol 18:363-369.

Gates MA, O'Brien TF, Faissner A, Steindler DA (1993) Neuron-glial interactions during
the in vivo and in vitro development of the nigrostriatal circuit. J Chem Neuroanat
6:179-189.

George EL, Georges-Labouesse EN, Patel-King RS, Rayburn H, Hynes RO (1993)
Defects in mesoderm, neural tube and vascular development in mouse embryos
lacking fibronectin. Development 119:1079-1091.

Gerlach M, Riederer P (1996) Animal models of Parkinson's disease: an empirical
comparison with the phenomenology of the disease in man. J Neural Transm
103:987-1041.

Gerlach M, Double KL, Ben-Shachar D, Zecca L, Youdim MB, Riederer P (2003)
Neuromelanin and its interaction with iron as a potential risk factor for
dopaminergic neurodegeneration underlying Parkinson's disease. Neurotox Res
5:35-44.

Gibb WR, Lees AJ (1988) The relevance of the Lewy body to the pathogenesis of
idiopathic Parkinson's disease. J Neurol Neurosurg Psychiatry 51:745-752.










Glinka Y, Gassen M, Youdim MB (1997) Mechanism of 6-hydroxydopamine
neurotoxicity. J Neural Transm Suppl 50:55-66.

Gorell JM, Johnson CC, Rybicki BA, Peterson EL, Kortsha GX, Brown GG, Richardson
RJ (1997) Occupational exposures to metals as risk factors for Parkinson's
disease. Neurology 48:650-658.

Gould E, Reeves AJ, Graziano MS, Gross CG (1999) Neurogenesis in the neocortex of
adult primates. Science 286:548-552.

Greenamyre JT, Betarbet R, Sherer TB (2003) The rotenone model of Parkinson's
disease: genes, environment and mitochondria. Parkinsonism Relat Disord 9
Suppl 2:S59-64.
Grimpe B, Dong S, Doller C, Temple K, Malouf AT, Silver J (2002) The critical role of
basement membrane-independent laminin gamma 1 chain during axon
regeneration in the CNS. J Neurosci 22:3144-3160.

Gritti A, Rosati B, Lecchi M, Vescovi AL, Wanke E (2000) Excitable properties in
astrocytes derived from human embryonic CNS stem cells. Eur J Neurosci
12:3549-3559.

Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A (1998) Generating
green fluorescent mice by germline transmission of green fluorescent ES cells.
Mech Dev 76:79-90.

Hauser RA, Freeman TB, Snow BJ, Nauert M, Gauger L, Kordower JH, Olanow CW
(1999) Long-term evaluation of bilateral fetal nigral transplantation in Parkinson
disease. Arch Neurol 56:179-187.

Heikkila RE, Sonsalla PK (1992) The MPTP-treated mouse as a model of parkinsonism:
how good is it? Neurochem Int 20 Suppl:299S-303S.

Hirsch EC, Faucheux BA (1998) Iron metabolism and Parkinson's disease. Mov Disord
13 Suppl 1:39-45.

Hofland HE, Shephard L, Sullivan SM (1996) Formation of stable cationic lipid/DNA
complexes for gene transfer. Proc Natl Acad Sci U S A 93:7305-7309.

lanus A, Holz GG, Theise ND, Hussain MA (2003) In vivo derivation of glucose-
competent pancreatic endocrine cells from bone marrow without evidence of cell
fusion. J Clin Invest 111:843-850.

Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA (2002)
Human cortical glial tumors contain neural stem-like cells expressing astroglial
and neuronal markers in vitro. Glia 39:193-206.










Isacson O, Bjorklund L, Pernaute RS (2001) Parkinson's disease: interpretations of
transplantation study are erroneous. Nat Neurosci 4:553.

Isacson 0, Bjorklund LM, Schumacher JM (2003) Toward full restoration of synaptic
and terminal function of the dopaminergic system in Parkinson's disease by stem
cells. Ann Neurol 53 Suppl 3:S135-146; discussion S146-138.

Jenner P (2003) Oxidative stress in Parkinson's disease. Ann Neurol 53 Suppl 3:S26-36;
discussion S36-28.

Johnston TH, Brotchie JM (2004) Drugs in development for Parkinson's disease. Curr
Opin Investig Drugs 5:720-726.

Joseph C, Chassan JB, Koch ML (1978) Levodopa in Parkinson disease: a long-term
appraisal of mortality. Ann Neurol 3:116-118.

Jung CG, Hida H, Nakahira K, Ikenaka K, Kim HJ, Nishino H (2004) Pleiotrophin
mRNA is highly expressed in neural stem (progenitor) cells of mouse ventral
mesencephalon and the product promotes production of dopaminergic neurons
from embryonic stem cell-derived nestin-positive cells. Faseb J 18:1237-1239.

Keams SM, Laywell ED, Kukekov VK, Steindler DA (2003) Extracellular matrix effects
on neurosphere cell motility. Exp Neurol 182:240-244.

Kearns SM, Scheffler B, Goetz AK, Lin DD, Baker HD, Roper SN, Mandel RJ, Steindler
DA (2006) A method for a more complete in vitro Parkinson's model: Slice
culture bioassay for modeling maintenance and repair of the nigrostriatal circuit. J
Neurosci Methods.

Keller GM (1995) In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol
7:862-869.

Kluge A, Hailer NP, Horvath TL, Bechmann I, Nitsch R (1998) Tracing of the
entorhinal-hippocampal pathway in vitro. Hippocampus 8:57-68.

Kornack DR, Rakic P (2001) Cell proliferation without neurogenesis in adult primate
neocortex. Science 294:2127-2130.

Kress GJ, Reynolds IJ (2005) Dopaminergic neurotoxins require excitotoxic stimulation
in organotypic cultures. Neurobiol Dis.

Kuhn HG, Dickinson-Anson H, Gage FH (1996) Neurogenesis in the dentate gyms of the
adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci
16:2027-2033.









Lai BC, Marion SA, Teschke K, Tsui JK (2002) Occupational and environmental risk
factors for Parkinson's disease. Parkinsonism Relat Disord 8:297-309.

Landolt RM, Vaughan L, Winterhalter KH, Zimmermann DR (1995) Versican is
selectively expressed in embryonic tissues that act as barriers to neural crest cell
migration and axon outgrowth. Development 121:2303-2312.

Laywell ED, Dorries U, Bartsch U, Faissner A, Schachner M, Steindler DA (1992)
Enhanced expression of the developmentally regulated extracellular matrix
molecule tenascin following adult brain injury. Proc Natl Acad Sci U S A
89:2634-2638.

Laywell ED, Rakic P, Kukekov VG, Holland EC, Steindler DA (2000) Identification of a
multipotent astrocytic stem cell in the immature and adult mouse brain. Proc Natl
Acad Sci U S A 97:13883-13888.

Laywell ED, Kukekov VG, Suslov O, Zheng T, Steindler DA (2002) Production and
analysis of neurospheres from acutely dissociated and postmortem CNS
specimens. Methods Mol Biol 198:15-27.

Laywell ED, Kearns SM, Zheng T, Chen KA, Deng J, Chen HX, Roper SN, Steindler DA
(2005) Neuron-to-astrocyte transition: phenotypic fluidity and the formation of
hybrid asterons in differentiating neurospheres. J Comp Neurol 493:321-333.

Linert W, Herlinger E, Jameson RF, Kienzl E, Jellinger K, Youdim MB (1996)
Dopamine, 6-hydroxydopamine, iron, and dioxygen--their mutual interactions and
possible implication in the development of Parkinson's disease. Biochim Biophys
Acta 1316:160-168.

Lois C, Alvarez-Buylla A (1993) Proliferating subventricular zone cells in the adult
mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci
U S A 90:2074-2077.

Lozano AM, Eltahawy H (2004) How does DBS work? Suppl Clin Neurophysiol 57:733-
736.

Lucking CB, Durr A, Bonifati V, Vaughan J, De Michele G, Gasser T, Harhangi BS,
Meco G, Denefle P, Wood NW, Agid Y, Brice A (2000) Association between
early-onset Parkinson's disease and mutations in the parking gene. French
Parkinson's Disease Genetics Study Group. N Engl J Med 342:1560-1567.

Lyons KE, Pahwa R (2005) Long-term benefits in quality of life provided by bilateral
subthalamic stimulation in patients with Parkinson disease. J Neurosurg 103:252-
255.









Magavi SS, Leavitt BR, Macklis JD (2000) Induction of neurogenesis in the neocortex of
adult mice. Nature 405:951-955.

Martin MJ, Muotri A, Gage F, Varki A (2005) Human embryonic stem cells express an
immunogenic nonhuman sialic acid. Nat Med 11:228-232.

Matthias K, Kirchhoff F, Seifert G, Huttmann K, Matyash M, Kettenmann H, Steinhauser
C (2003) Segregated expression of AMPA-type glutamate receptors and
glutamate transporters defines distinct astrocyte populations in the mouse
hippocampus. J Neurosci 23:1750-1758.

McNaught KS, Bjorklund LM, Belizaire R, Isacson O, Jenner P, Olanow CW (2002)
Proteasome inhibition causes nigral degeneration with inclusion bodies in rats.
Neuroreport 13:1437-1441.

Moon LD, Brecknell JE, Franklin RJ, Dunnett SB, Fawcett JW (2000) Robust
regeneration of CNS axons through a track depleted of CNS glia. Exp Neurol
161:49-66.

Morrison SJ, Shah NM, Anderson DJ (1997) Regulatory mechanisms in stem cell
biology. Cell 88:287-298.

Mueller JC, Fuchs J, Hofer A, Zimprich A, Lichtner P, Illig T, Berg D, Wullner U,
Meitinger T, Gasser T (2005) Multiple regions of alpha-synuclein are associated
with Parkinson's disease. Ann Neurol 57:535-541.

Niwa H, Miyazaki J, Smith AG (2000) Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372-
376.

Novak U, Kaye AH (2000) Extracellular matrix and the brain: components and function.
J Clin Neurosci 7:280-290.

Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD (1996) Development of
neuronal precursor cells and functional postmitotic neurons from embryonic stem
cells in vitro. Mech Dev 59:89-102.

Olanow CW, Goetz CG, Kordower JH, Stoessl AJ, Sossi V, Brin MF, Shannon KM,
Nauert GM, Perl DP, Godbold J, Freeman TB (2003) A double-blind controlled
trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann Neurol
54:403-414.









Olanow CW, Agid Y, Mizuno Y, Albanese A, Bonuccelli U, Damier P, De Yebenes J,
Gershanik O, Guttman M, Grandas F, Hallett M, Hornykiewicz O, Jenner P,
Katzenschlager R, Langston WJ, LeWitt P, Melamed E, Mena MA, Michel PP,
Mytilineou C, Obeso JA, Poewe W, Quinn N, Raisman-Vozari R, Rajput AH,
Rascol O, Sampaio C, Stocchi F (2004) Levodopa in the treatment of Parkinson's
disease: current controversies. Mov Disord 19:997-1005.

Pals P, Lincoln S, Manning J, Heckman M, Skipper L, Hulihan M, Van den Broeck M,
De Pooter T, Cras P, Crook J, Van Broeckhoven C, Farrer MJ (2004) alpha-
Synuclein promoter confers susceptibility to Parkinson's disease. Ann Neurol
56:591-595.

Pankratz N, Foroud T (2004) Genetics of Parkinson disease. NeuroRx 1:235-242.

Parkinson J (1817) An Essay on the Shaking Palsy. London: Whittingham and Rowland.

Perryman SV, Sylvester KG (2006) Repair and regeneration: opportunities for
carcinogenesis from tissue stem cells. J Cell Mol Med 10:292-308.

Petit A, Kawarai T, Paitel E, Sanjo N, Maj M, Scheid M, Chen F, Gu Y, Hasegawa H,
Salehi-Rad S, Wang L, Rogaeva E, Fraser P, Robinson B, St George-Hyslop P,
Tandon A (2005) Wild-type PINK1 prevents basal and induced neuronal
apoptosis, a protective effect abrogated by Parkinson disease-related mutations. J
Biol Chem 280:34025-34032.

Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H,
Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A,
Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe
LI, Nussbaum RL (1997) Mutation in the alpha-synuclein gene identified in
families with Parkinson's disease. Science 276:2045-2047.

Priyadarshi A, Khuder SA, Schaub EA, Shrivastava S (2000) A meta-analysis of
Parkinson's disease and exposure to pesticides. Neurotoxicology 21:435-440.

Rakic P (1985) DNA synthesis and cell division in the adult primate brain. Ann N Y
Acad Sci 457:193-211.

Rogers SL, Letourneau PC, Palm SL, McCarthy J, Furcht LT (1983) Neurite extension
by peripheral and central nervous system neurons in response to substratum-
bound fibronectin and laminin. Dev Biol 98:212-220.

Rosegay H (1944) An experimental investigation of the connections between the corpus
striatum and the substantial nigra in the cat. Journal of Comparative Neurology
80:293-321.









Rybicki BA, Johnson CC, Peterson EL, Kortsha GX, Gorell JM (1999) A family history
of Parkinson's disease and its effect on other PD risk factors. Neuroepidemiology
18:270-278.

Scheffler B, Schmandt T, Schroder W, Steinfarz B, Husseini L, Wellmer J, Seifert G,
Karram K, Beck H, Blumcke I, Wiestler OD, Steinhauser C, Brustle O (2003)
Functional network integration of embryonic stem cell-derived astrocytes in
hippocampal slice cultures. Development 130:5533-5541.

Shimura H, Schlossmacher MG, Hattori N, Frosch MP, Trockenbacher A, Schneider R,
Mizuno Y, Kosik KS, Selkoe DJ (2001) Ubiquitination of a new form of alpha-
synuclein by parking from human brain: implications for Parkinson's disease.
Science 293:263-269.

Silberstein P, Oliviero A, Di Lazzaro V, Insola A, Mazzone P, Brown P (2005)
Oscillatory pallidal local field potential activity inversely correlates with limb
dyskinesias in Parkinson's disease. Exp Neurol 194:523-529.

Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M,
Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M,
Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D,
Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication
causes Parkinson's disease. Science 302:841.

Smeyne RJ, Jackson-Lewis V (2005) The MPTP model of Parkinson's disease. Brain Res
Mol Brain Res 134:57-66.

Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D (1988)
Inhibition of pluripotential embryonic stem cell differentiation by purified
polypeptides. Nature 336:688-690.

Steindler DA, Cooper NG, Faissner A, Schachner M (1989) Boundaries defined by
adhesion molecules during development of the cerebral cortex: the Jl/tenascin
glycoprotein in the mouse somatosensory cortical barrel field. Dev Biol 131:243-
260.

Steindler DA, O'Brien TF, Laywell E, Harrington K, Faissner A, Schachner M (1990)
Boundaries during normal and abnormal brain development: in vivo and in vitro
studies of glia and glycoconjugates. Exp Neurol 109:35-56.

Steindler DA (1993) Glial boundaries in the developing nervous system. Annu Rev
Neurosci 16:445-470.









Takagi Y, Takahashi J, Saiki H, Morizane A, Hayashi T, Kishi Y, Fukuda H, Okamoto
Y, Koyanagi M, Ideguchi M, Hayashi H, Imazato T, Kawasaki H, Suemori H,
Omachi S, lida H, Itoh N, Nakatsuji N, Sasai Y, Hashimoto N (2005)
Dopaminergic neurons generated from monkey embryonic stem cells function in a
Parkinson primate model. J Clin Invest 115:102-109.

Theise ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, Henegariu O,
Krause DS (2000) Liver from bone marrow in humans. Hepatology 32:11-16.

Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS,
Jones JM (1998) Embryonic stem cell lines derived from human blastocysts.
Science 282:1145-1147.

Treloar HB, Nurcombe V, Key B (1996) Expression of extracellular matrix molecules in
the embryonic rat olfactory pathway. JNeurobiol 31:41-55.

Triarhou LC (2002) Biology and pathology of the Weaver mutant mouse. Adv Exp Med
Biol 517:15-42.

Triarhou LC, Norton J, Ghetti B (1988) Mesencephalic dopamine cell deficit involves
areas A8, A9 and A10 in weaver mutant mice. Exp Brain Res 70:256-265.

Ungerstedt U (1968) 6-Hydroxy-dopamine induced degeneration of central monoamine
neurons. Eur J Pharmacol 5:107-110.

Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del
Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, Gonzalez-
Maldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ,
Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset
Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160.

Valldeoriola F, Martinez-Rodriguez J, Tolosa E, Rumia J, Alegret M, Pilleri M, Ferrer E
(2002) Four year follow-up study after unilateral pallidotomy in advanced
Parkinson's disease. J Neurol 249:1671-1677.

Walter BL, Vitek JL (2004) Surgical treatment for Parkinson's disease. Lancet Neurol
3:719-728.

Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA (1996)
Multipotent CNS stem cells are present in the adult mammalian spinal cord and
ventricular neuroaxis. J Neurosci 16:7599-7609.

Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD, Carpenter MK (2001)
Feeder-free growth of undifferentiated human embryonic stem cells. Nat
Biotechnol 19:971-974.









Youdim MB, Ben-Shachar D, Riederer P (1989) Is Parkinson's disease a progressive
siderosis of substantial nigra resulting in iron and melanin induced
neurodegeneration? Acta Neurol Scand Suppl 126:47-54.

Zeng X, Cai J, Chen J, Luo Y, You ZB, Fotter E, Wang Y, Harvey B, Miura T, Backman
C, Chen GJ, Rao MS, Freed WJ (2004) Dopaminergic differentiation of human
embryonic stem cells. Stem Cells 22:925-940.

Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM (2000) Parkin functions
as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the
synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci U S A
97:13354-13359.

Zipori D (2005) The stem state: plasticity is essential, whereas self-renewal and hierarchy
are optional. Stem Cells 23:719-726.















BIOGRAPHICAL SKETCH

Sean Kearns was born October 29th 1977 in Gainesville, Florida and attended

Eastside high school's International Baccalaureate (I.B.) program where a psychology

class sparked his interest in neuroscience. Sean attended the University of Florida and

received his degree in neuroscience in 2000. From there he decided to pursue

neuroscience in the newly completed McKnight Brain Institute. A fortuitous meeting

with Dr. Dennis Steindler led Sean to the new and exciting field of stem cell biology.

Sean pursued his Ph.D. doing research relating to Parkinson's disease and potential

therapies using adult and embryonic stem cells. When not in the lab, Sean is an avid Star

Wars fan and collector. He also makes time each year to go someplace new to camp,

hike, and fish. He shares his home with his lovely wife Debbie, and their two cats Tigger

and Starbuck.