<%BANNER%>

Regulation of the Type III Secretion System in Pseudomonas aeruginosa

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110403_AAAAHQ INGEST_TIME 2011-04-04T00:00:44Z PACKAGE UFE0013501_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 8423998 DFID F20110403_AACDTZ ORIGIN DEPOSITOR PATH wu_w_Page_008.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
3191b0544395d492a166e5f7d273d92a
SHA-1
88151aa03d263103fe21f4fd80546a43c5756d5a
960740 F20110403_AACEAI wu_w_Page_037.jp2
de0dd90b3221842eafc79b975ddef7b8
01b1c2f54c0bdcad665efd09ad358e4b0e5e9cec
F20110403_AACDVB wu_w_Page_075.tif
2e4512ed21ad9ad8a23ed451471e29eb
a5442d944a43b1aa6e039b08ea89304d2cf905f5
F20110403_AACDUN wu_w_Page_036.tif
20af50951ee9356fcd23adc0f21e3636
6be94bec04d88b0204f9b95e69ecaab2a8e5362a
1051930 F20110403_AACEAJ wu_w_Page_038.jp2
640bc152da1948cf92f143f9cf867449
7c90f1ba3942fb931cd54ba2b277a225cfec089d
F20110403_AACDVC wu_w_Page_077.tif
1d7d5629c6d701ed0993f6c32d311179
6378ecab3974f0ee93796200a8753e697c489fd8
F20110403_AACDUO wu_w_Page_042.tif
8046c2d6a95162ffa4469fe73a73c363
b00c2493ff1c50a57c768be9626799e54a8878bc
F20110403_AACDVD wu_w_Page_079.tif
863b74aee9e1321682c9ef1941d1b665
7adb1623c797eef641bfd8eadaa0f20beae566c0
F20110403_AACDUP wu_w_Page_050.tif
9955c229b10106c7e25085edec362198
d4bff2360b2b3e6f7cbc6aa0b854434514dabc46
1051895 F20110403_AACEAK wu_w_Page_040.jp2
4f3d7f6347d9be86f145fb0a9266317c
eb63d94748c4d12587b0ce7e8503d08ec9b6fdd0
F20110403_AACDVE wu_w_Page_085.tif
7981c113be8b12ca336e8b471d02f034
0335b98f8e5c62a65f9dc0f2a74726ef1fc46c70
F20110403_AACDUQ wu_w_Page_051.tif
2acfb9afbf3e18171671ee434f4ce1c5
5063305dbc1039bfdfe21eaa203cad96aef0f549
925498 F20110403_AACEAL wu_w_Page_042.jp2
3a0530c39085047c7d034ee9f563be27
236cd76f86a052c34da2951ef783a7b8be014888
F20110403_AACDVF wu_w_Page_088.tif
212c654044d651615258187152c18372
34fab6d867b11928cebb02b9d186133db3c66869
F20110403_AACDUR wu_w_Page_052.tif
ee370f63a736ff2d832ed0e63c0a87c0
c19878a9bd5bb142dfda000e8c11aad2484f8d85
1051978 F20110403_AACEBA wu_w_Page_075.jp2
4c71be966f1edbf7f00aafe96ff7a185
10d2644c8a9eac40c832b6ac9ef7c497ad354e3c
1051969 F20110403_AACEAM wu_w_Page_044.jp2
538c6cedf6651de3bea4cdd0f2f57533
511ae24d87263241ca04023ca2795f6abaf4f2a2
F20110403_AACDVG wu_w_Page_093.tif
d6591815231c63d92cc6a1a569384ac1
5da1ab4c69f1830ecefaf8922f442c9dff85df4b
F20110403_AACDUS wu_w_Page_053.tif
91c997cf18a306fbca379f3faf7e57b0
9daed6c0b2d35e2cf920a28e2bbcdf281f3c408a
980077 F20110403_AACEBB wu_w_Page_077.jp2
09e56baae320321ef8aba4f641b362aa
67d680079e3492ca5790890a0baa11046665f40c
585998 F20110403_AACEAN wu_w_Page_045.jp2
93583e5cb82ba63b2d3fe9b47629fe05
40b0ddd4487c721a547768c8947ec72887cd6912
F20110403_AACDVH wu_w_Page_098.tif
2247cc1d2b51247e34961d92ec712526
47f6f33897bcdcc797ab652685dc43e1fa9cc550
F20110403_AACDUT wu_w_Page_054.tif
ad835dd4efa22b0846f5fed2c1a23f8d
4125e559c6872f54909a510ccf94d9e54de6ebed
1051967 F20110403_AACEBC wu_w_Page_080.jp2
c520cf2ac6bc512e572cf606345ce6be
636e8ef1e69903daff190f6d74f45b594d3b6fc8
1051934 F20110403_AACEAO wu_w_Page_049.jp2
98a46d9009bc5ef5ec8280637c34ca54
80c4e0d47ca6fa8cb7e694a24e051c3b38414a8c
F20110403_AACDVI wu_w_Page_099.tif
73bfddf33c01138420ab73b3791d09bc
b83fee0d18778bdd83c1f73706a284064b828d9e
F20110403_AACDUU wu_w_Page_056.tif
fdbfa124bb7cab642d3a40a2d886cfb2
a2de700122a4a72ad94643403331cc19509f7cfe
1025855 F20110403_AACEBD wu_w_Page_084.jp2
40460c95f91289e5226732cbf3efd9f0
3f8ce4c250736109c89338b935ec51ce184547db
1051927 F20110403_AACEAP wu_w_Page_052.jp2
22fc06ddc59787b1c7f908300ec55fcd
e2a24010f9a2b0ea6311384c5fe6eb1763e855e6
F20110403_AACDVJ wu_w_Page_100.tif
2e3d542fbf291722355c96a453747b05
d9777e027ae6076771f31cc77caae02877ae8a11
F20110403_AACDUV wu_w_Page_062.tif
f1b0c66ffb216ff4ae2cb439391b45b7
614e605f1ab30ac352de99d41fac19c1b4e6dc8b
1051980 F20110403_AACEBE wu_w_Page_085.jp2
79c06f095032c96b42a10ea2fbb6dc65
49f7407cf78a14f4a3ff393c426a7d639aeb1494
646567 F20110403_AACEAQ wu_w_Page_054.jp2
7f3764847f5b35b03f8e990323bb297b
4a6dad86d6bcd22afa489a2b5968b93bba9e7750
F20110403_AACDVK wu_w_Page_102.tif
78860c2924fc21e38306cff405bf9085
eb26bba7c33d9d8e90ac4d615138f0ecf3a83f56
F20110403_AACDUW wu_w_Page_064.tif
fcad5c181d95de68f18d39b2ca4db1c6
8f24a71e469033c550b492e0678762494a9618e2
1051979 F20110403_AACEBF wu_w_Page_086.jp2
c9a60811bfd7bfa400bc290c12279cda
9bfb338416d3bdfaaddf679fa55e678ce86c58bf
1866 F20110403_AACDWA wu_w_Page_036.txt
77b76ab350dedfec0300cd6a320a7d5e
0d7602a85d9da0b0c386b111f397f49044c258de
1006403 F20110403_AACEAR wu_w_Page_055.jp2
40b87d70c63778ab233705ca42e3cc51
f94c5f869535a78f4483e6cbc181afc2cd5484b3
422 F20110403_AACDVL wu_w_Page_001.txt
bee078ae21e49e237ac95787e744cd70
3406dad705c1596c3bc5ffd757efcbbb93eef684
F20110403_AACDUX wu_w_Page_065.tif
c56a4c5142f39b675ee416a85d96073c
5843f6f0ac983f42034b5176b135b91c10853c31
1051972 F20110403_AACEBG wu_w_Page_088.jp2
babedf547dfda511bb698c7666acd22a
052d13f82b7c26170f0acfe908270f99df4ddec7
1051958 F20110403_AACEAS wu_w_Page_058.jp2
af098dd2db35a7d85b5bb219c7187ff2
10c4d5ae472d0fab1ec7ea12a2767b62b4b86182
105 F20110403_AACDVM wu_w_Page_002.txt
bd82fa8fe8590ccf6a875af247b005cc
0c03e662bd3d9ab0232d47817c6802e950e73fb9
F20110403_AACDUY wu_w_Page_071.tif
ddd70cd7c3711504b12888ec498e3d16
1a5fb001184624420c1e9651131ee41a296b2a9b
1051912 F20110403_AACEBH wu_w_Page_090.jp2
428dd531c39bb88efc95ed6ccce4ae1f
68206c96685e16c317964bec59788e23b06e6d4e
1664 F20110403_AACDWB wu_w_Page_037.txt
548e8db134fac0ae98aad927b1cb5071
27c3d90059c982641530f350a0d2a4f170e29bde
1051961 F20110403_AACEAT wu_w_Page_060.jp2
a9b6b75918dea0abf44ecb528e729d4a
f304a01ef37dadbb01f65740da9f210db696108f
928 F20110403_AACDVN wu_w_Page_005.txt
2e03d00f4ee526747b6a0b561d4d6919
c5fc32bd7aac61f1273f4853d19eacf1796c5d86
F20110403_AACDUZ wu_w_Page_073.tif
b59dff4448b0f91821e3ee472d988ab0
4a272d98dfd471aa588e8b7bb80ab768ac7b9c52
F20110403_AACEBI wu_w_Page_094.jp2
391e5246c27100ebcab508e71935e681
7c7bdbb6d8d679113546f0ebde221b585612eff7
1814 F20110403_AACDWC wu_w_Page_039.txt
810230ed0a8c55eb5b551c6669ae40df
d66bfb966685e5d3815fda489336ef6b13e8bb70
1048751 F20110403_AACEAU wu_w_Page_061.jp2
cbdce87a64337fb67d69395c58cb1397
0dd1f7591e0741a2921d4ce6d3de3d11929db1e4
3205 F20110403_AACDVO wu_w_Page_006.txt
b04bdeb1fb5f29a68487c095bf59503c
77dbce4a32471785ec77b5dd3b744237ced4f7b1
1051973 F20110403_AACEBJ wu_w_Page_097.jp2
644485ebb86b1e1347bb636aec45eb6d
a7166f4c07865763311b04d9aa73f12165ea4b38
2408 F20110403_AACDWD wu_w_Page_041.txt
d051cfb4f6651733c92a97708ec97161
c9545f4219f4929649a186bbe94bc003bc46846e
1051975 F20110403_AACEAV wu_w_Page_062.jp2
08365b4fcf369b6a73524728e9473331
d7b14ff111783020ccd092005e43cb2d55a43e10
2225 F20110403_AACDVP wu_w_Page_010.txt
7ce5458be33711087ba5e91c076032aa
14a98a2514b4b5309b5fd9392b4d2d20b6a4dd0c
1051985 F20110403_AACEBK wu_w_Page_098.jp2
07576a8103d5afaa47eff427208b385a
a90d5153df71d5f9dcebc90820c69afd2d40b31c
2101 F20110403_AACDWE wu_w_Page_042.txt
2cb166ba3ede238fa1da5fac438ad0b4
5e8b92dde364caed196c9a5c21f5675b85bbe75f
1041489 F20110403_AACEAW wu_w_Page_065.jp2
155c705b861bb1c357f609f5eb0f40f2
beb2872f433d482632df171780799999b0851881
204 F20110403_AACDVQ wu_w_Page_011.txt
f54b2dd7f2e4f2d6c556ff944028414d
73145c9797e5ccb80ff56873e45a3273c3da1416
2893 F20110403_AACDWF wu_w_Page_043.txt
808f613903fd03594f25dbf167ca73b9
2da5a8fd8c6747cc3ac8e6b1393ebe41af20673f
853388 F20110403_AACEAX wu_w_Page_067.jp2
d91ce3d856d0b8ba363eead67f6c1750
5a3483d2d4b0a2079f19bf0ef38a8667c027a737
2000 F20110403_AACDVR wu_w_Page_017.txt
c14ab0595384bf44e31f48cb81f34a25
eac62dd652b383e94c77299531b78f9a33672117
1340 F20110403_AACECA wu_w_Page_102thm.jpg
12e39d7a213a06985c0c4a7574dddab3
4a8252755351a0ab95bd05054fdd08cb04312851
1051964 F20110403_AACEBL wu_w_Page_101.jp2
c95b3416e05e7df184eacaa66377961a
8dcfeefb76a7989dc1ef48e193b2efc03e9750fa
2490 F20110403_AACDWG wu_w_Page_044.txt
397ef491d4188254b5316c3e87e9dfad
d2c76ed20186aa3c9c45ec31cd51a9a7b8d5fc7a
931881 F20110403_AACEAY wu_w_Page_070.jp2
c289531f50ec10c1a6b1bdbe1044b777
626c8232e4c22b31cdf7afb26c130187f659fd96
1849 F20110403_AACDVS wu_w_Page_018.txt
7afd99ead972ddecec9489b75028186f
2e03b74428c3e5b0cf8ff32bb5b52bbf1f1e056a
36101 F20110403_AACECB wu_w_Page_072.QC.jpg
86397373b0f54325686dd11a44587b00
59fe889f5832b60e768f8363d49dcbec2e8a93eb
8028 F20110403_AACEBM wu_w_Page_028thm.jpg
fa776c1f48e04688a373ebfcc9fa6b06
a0e1d30c72d818ac7c8d019ce55d5bf6e0cc84d2
2013 F20110403_AACDWH wu_w_Page_049.txt
eb076fd58bf895390cbd15f73fd01d51
d4e83f242f81b3da70cd07f8fff140f90a7e6275
1051960 F20110403_AACEAZ wu_w_Page_072.jp2
f94aa2e66fa5c87b01c204b169dcf347
90f2c18644d1a5fc78913e085b51661837fd5808
1820 F20110403_AACDVT wu_w_Page_020.txt
a1bc91fa0fd007bf15f87137093d1f3b
341ec481d6fc8a171a8112d2c58fbac824d915da
8838 F20110403_AACECC wu_w_Page_101thm.jpg
aef6fcfdd786d498aaf1ee8f75ae56f7
4428e270f84d90f0c3455387440ba66165dd58f8
34397 F20110403_AACEBN wu_w_Page_091.QC.jpg
81c29bfc806c3aff76b6f69746aeee76
4457cfe9ff839270d8036fa668f2eeba67387d14
1653 F20110403_AACDWI wu_w_Page_050.txt
954d8a1fc9873a3cf009e1d16797e39b
19d979fdf16d74391b8369fffebe2d95f29c515b
1785 F20110403_AACDVU wu_w_Page_022.txt
a3c1f2ce2333f1fcc229478788477e85
f4271e8b6ec02a4844eacdc75778f0bde9614428
32912 F20110403_AACECD wu_w_Page_040.QC.jpg
b7e2e8b503ec5efb74e01a9d2cc2d47e
02dafbc9ab8b0e0adde94c8eabe6fd72e9159b27
31926 F20110403_AACEBO wu_w_Page_022.QC.jpg
498087c8423e04548c67537eca3ed85e
f0aba9bfe0b809e2ccf2d0c1c1deb2a5db07fd23
1983 F20110403_AACDWJ wu_w_Page_052.txt
98c2023147f309161ed91386c801a175
0a36bece937ab26361edfc2431912755c92b6d12
1764 F20110403_AACDVV wu_w_Page_023.txt
9b0eecf6ff8ed6818ffb5bf9eb37fc58
950ea31f65f3758e91181f0a6c082fd8c5ca6aab
20703 F20110403_AACECE wu_w_Page_045.QC.jpg
bf34c85b85021ff37820ef8275f44cfc
78fbf4ea83bb760f087eeb3e406f00a215fb40e9
20180 F20110403_AACEBP wu_w_Page_013.QC.jpg
1055d9dafa6476588806300a784564a1
b7741d98496ae7328241ef6d65efe1f9d38245c9
1974 F20110403_AACDWK wu_w_Page_053.txt
cdf0b44b679605cd675795593f4d5e44
77517308d167c2e71d1feba811357e40598564fa
1988 F20110403_AACDVW wu_w_Page_024.txt
5ec8cb1b00737111ea554fea9178da2a
a0d5cd5b0598323192f78862b8f08051ac64e280
6986 F20110403_AACECF wu_w_Page_050thm.jpg
1d94cd565d462ce29a32393b02f60407
96a7b95755319e55f9f8998e78eacd323dda8853
2653 F20110403_AACEBQ wu_w_Page_009thm.jpg
5086bffbd648d3c32e835d219e31050b
553d68c37cf1b259373d367e9d1a2df3e85602e0
2045 F20110403_AACDWL wu_w_Page_056.txt
40757e31700294a59c2bd2a530663e15
e18b563a9b2ae9ff8f991fd340323ab8e1d45f41
2067 F20110403_AACDVX wu_w_Page_027.txt
9aff305d019bf69759a939bcc0056cf2
1a6cda000ba3843712568e586540767155183fb4
7575 F20110403_AACECG wu_w_Page_021thm.jpg
3fd14a862ff73e85680ef244c640d232
3e4e6d5c0a62f54ab56e6f763d11165cf38391b0
43163 F20110403_AACDXA wu_w_Page_021.pro
f4cba4c01ec8f5c4db2bdc31365df675
537eab4d3df97fa944887003b2f0f45a2e35a992
29338 F20110403_AACEBR wu_w_Page_021.QC.jpg
5d89b0bc03c05b9e5647cf94c61488a7
2db47836eeec6d609a2522c2f78b37754e8746df
1882 F20110403_AACDWM wu_w_Page_064.txt
25a51575aa000d595ce241d92872d67a
e36d67cc10292955aeec56f56c48f2452ae9087f
1850 F20110403_AACDVY wu_w_Page_033.txt
c99abde0f0703a94aa2e4cf0d621f4c4
c11f4352c4dcf47105dc006d399b4873963da7b8
7766 F20110403_AACECH wu_w_Page_019thm.jpg
d5ab33b9ec4bf1b56be0bc6102d38335
e335fc4ae3de9de0a0092298dc84702f1716e990
45233 F20110403_AACDXB wu_w_Page_022.pro
fa50b8f7452ce5c5fb8e7c43fe9aa022
6a56abc5d3eaff2e9e1a18e786e46b1bd582d73c
8540 F20110403_AACEBS wu_w_Page_081thm.jpg
a881de77844b9ee741826ba42c566c55
eae1b22b62896232a048262bb74388a259feedad
1779 F20110403_AACDWN wu_w_Page_068.txt
c008e9875611b2b09ed64a470a20e06f
733a5207449ea9185aa91e173015f425d1fe3184
1276 F20110403_AACDVZ wu_w_Page_035.txt
c9c3f01f155611463b2fa294783a0204
fb86226a6a7477e7e7656407c7080a1550ac6606
4269 F20110403_AACECI wu_w_Page_005thm.jpg
9309a0a190a822ae276485e424e7b21e
50272e1a01c5a8e51a69b5dd1fe7ce4b22d3a40a
6096 F20110403_AACEBT wu_w_Page_045thm.jpg
3a8acc7d4fc635592edf9d8d448471a1
a8d7d3ef509ec6ebc72ca9f6b63f6498b6bb646e
2004 F20110403_AACDWO wu_w_Page_075.txt
dcc1d5b62f6de38929254d6b953b39d3
a67866d75f46a5431527e7c5d5ded79326e15302
26495 F20110403_AACECJ wu_w_Page_047.QC.jpg
2132ca01acec49222e61734dd33b5bad
481652701951084a78e3ca482aeec1f3f481f070
37559 F20110403_AACDXC wu_w_Page_023.pro
21ab6c12d6e4fc0052d0ea25da10da03
503cd6666dd8902d9554395d623e2a636f517e21
8554 F20110403_AACEBU wu_w_Page_093thm.jpg
8baa9e7460a61fa221317f8980d474c3
0ea077efe3d0bda5acccce21b3cb55d14943ede4
F20110403_AACDWP wu_w_Page_082.txt
74b0764e8337948d4016d06fc8f3b7c4
b97bc7377a40c1e5e9f5f8a3cb9c1edf30f4d6b9
33232 F20110403_AACECK wu_w_Page_086.QC.jpg
23e7e1a284134550b2e4e111e36ef46d
e5e0d21e81abd27ee225b86aca4b240e80b12f52
29956 F20110403_AACDXD wu_w_Page_025.pro
7eda089e4d63a36b1ca825b31c9d1b6f
cbb66c4608c72af345dd9f4110c7aaca663d7bcc
7877 F20110403_AACEBV wu_w_Page_082thm.jpg
69deae7467a23ce41bd8497c1ded2c22
19f59c2d54b90942ddc397ad3870de9fbe13984e
237 F20110403_AACDWQ wu_w_Page_087.txt
cb0f9fafd95de1cbb38256ada3badeaf
2bd18c9461afdb9349a51a5072797dc2502aeb3b
6866 F20110403_AACECL wu_w_Page_067thm.jpg
39ef407ce04b73f2400a21c25cb16188
366b4475b7024f626e1e320ef46aec714503dcb9
42759 F20110403_AACDXE wu_w_Page_026.pro
1b5324ec23e47ac716858c899722e7f1
0c337afa787ceafc954a262385fb3e3324fc1b46
35222 F20110403_AACEBW wu_w_Page_027.QC.jpg
a2c6a5f42ffef36a18cc2374c0cf66b8
2e1409216a41155e11710b8175c34643a94b45e0
2492 F20110403_AACDWR wu_w_Page_092.txt
94acc9d0788a075411d96aa7d8c279bb
9aa574d20f78a59b42a9506697b8cc5583c14953
8287 F20110403_AACEDA wu_w_Page_075thm.jpg
08e8d6ccbc182598a3aafb91e42d6597
c5112a49955254cdd9b3823431d833e08078272d
51811 F20110403_AACDXF wu_w_Page_027.pro
6206d409612f1a4c360ca34a4717ba76
0642bf82055058ee25d0ca7168c1fcfd1294db21
30782 F20110403_AACEBX wu_w_Page_016.QC.jpg
95beb0e70c91ba6dd77846d855c122b1
daf530265b2cbb4c2c32b88fb374e124729e3c93
2361 F20110403_AACDWS wu_w_Page_095.txt
7f2ef97954097f92fdf63bc0b97a67b7
b778cfede6369a005691fd6060bbc7d310cf430e
37020 F20110403_AACEDB wu_w_Page_089.QC.jpg
3c139e089d349c3b315001866153d694
37b10f76f1e15e75277eed7a498c734bccd1e82b
8634 F20110403_AACECM wu_w_Page_076thm.jpg
4f5a96731a643d18e00a054bfdc360e3
32633754cc52bb670bd8c43516d99c2f1809310a
48459 F20110403_AACDXG wu_w_Page_029.pro
a3c4bd26ebf79402ec1bd4cc143ab2bc
ded18b902fe30f716179c648a0c2845bf8278141
7563 F20110403_AACEBY wu_w_Page_070thm.jpg
6d213453c8fcabb3eb46a4454c035143
ee065b7b3be351a60733fd33c0ec44d92e7ac9ea
2658 F20110403_AACDWT wu_w_Page_100.txt
cca9fe66d62155e3b00e2145af6faab6
a98a7db484ac581f967aab692fc0f23ec6ccf8f2
29588 F20110403_AACEDC wu_w_Page_088.QC.jpg
96477c75f8e2dd6246445821b619c63d
308d803cf399e711f694cec9c8e0d82f856e40b0
7610 F20110403_AACECN wu_w_Page_084thm.jpg
cce8b55a79fea6cb0a2ad3de870f9a0d
92f77d81044aa3aa51b6e3e2503df82813d7129a
46009 F20110403_AACDXH wu_w_Page_033.pro
32d8a2e8a8eda326f929356d51aef55e
b48ca3e2e99ed2a0d1eb3f092af8e7d75c376336
27193 F20110403_AACEBZ wu_w_Page_004.QC.jpg
e97a82fd2244f04bf2e332190ad6c582
39659934f6d39e7bb3022947c6aff59c4c698517
336 F20110403_AACDWU wu_w_Page_102.txt
2c4a2304b40af375bda5de4a1b366c0a
84e3a8e61fd6eb82a868971177d02d27d35badcf
30359 F20110403_AACEDD wu_w_Page_018.QC.jpg
46b9e1ffec47ea0f95b59bde779222a0
82b37e85fee5e55bb1835a48edd96861857935c7
8384 F20110403_AACECO wu_w_Page_046thm.jpg
e906a743e124c9996a82f89a3efb6a55
0c4658cbe11df97bfe125bb8a18cc0f70b3d9734
47311 F20110403_AACDXI wu_w_Page_036.pro
f024eeddccd65b6793bcfbdc07aca0cf
051d979a5d7d2c44d6670174898df09bb30d5ce0
7871 F20110403_AACDWV wu_w_Page_001.pro
21317bc1d3842fd67a5cf919e8b67fa2
6affcc5f6e55fc428e46ec377e5a832a1d06efec
4798 F20110403_AACEDE wu_w_Page_087.QC.jpg
6f317fe0024a901e6834c58ada9c979a
8744f227556c961a796d4e51cca0bb04972c1db4
36646 F20110403_AACECP wu_w_Page_031.QC.jpg
74ee781f63da4a0d06627d1d9692b611
2f766d67045d9cbd57d1e3c9100bff9f0b551ee8
36564 F20110403_AACDXJ wu_w_Page_037.pro
fda544621bdcd7b1b151ddced5d92415
0a27da98c56f627e10c965b39421fecc493e6d7c
77722 F20110403_AACDWW wu_w_Page_006.pro
8b40f92003e104f4f592ffcbd80832be
e2f8a4adf19477e844127e16a17620730f735cb1
8299 F20110403_AACEDF wu_w_Page_086thm.jpg
e66233df84c8fc1630fa951f4f0e27d3
56bb7c5d5897ccb83d0c977140ed4bd25ec6e9b5
33942 F20110403_AACECQ wu_w_Page_101.QC.jpg
2942919a60f3bfeb03edc518df6f9428
83f28339ab05bb3d663cf474c2adcad640fdf956
47691 F20110403_AACDXK wu_w_Page_038.pro
e799d70ba0d3bb421748a2ea71675f47
a157ca29fb1c179d9f65c31fc8aa371d46574bb1
36059 F20110403_AACDWX wu_w_Page_008.pro
c07cfefe0bc60a9357182fffb096c16d
4f5c54783204d11244f1d5e0a25942daa22b44b0
7430 F20110403_AACEDG wu_w_Page_041thm.jpg
8eb55afe4fb9e80d98bae59d4c05e8a7
45ee0fd82ce69fc89c51cb173e898e6de0b06848
50855 F20110403_AACDYA wu_w_Page_088.pro
65e52f031dc500b0ef0b129dd15ca49a
117bb93db3a245843bfa2dea7a48a3d6e6f68609
8620 F20110403_AACECR wu_w_Page_062thm.jpg
c9543e2f8f9fcb2b4d9c7ceb3455a3a1
26a5e1d777a5611b03fc9fbd30f5f04751c2a0c9
22608 F20110403_AACDXL wu_w_Page_045.pro
a7a883d58dc46ae7492f62c998d19239
7084c88a8d5015761dbbd77b844caf4871a64d68
26501 F20110403_AACEDH wu_w_Page_067.QC.jpg
4acc5268d19f9e506f1eb960d04dcbc6
b5c6690a7944974e29fb8e25390e618121476dbc
65723 F20110403_AACDYB wu_w_Page_089.pro
60621aca20255f90f8e74478914d46da
7ce64b880fa1145c01039bc854ea1c6931d92c91
27076 F20110403_AACECS wu_w_Page_041.QC.jpg
72a08131e2f7be000cb8212f2cfa2725
eeb6646de6952a701ea2002cf829e9a7d09efda0
53226 F20110403_AACDXM wu_w_Page_048.pro
7849a7fcd76b67f641adcb5c4882cbac
1910881a6ec63d3f95358aa0e96c76fed395ea24
5005 F20110403_AACDWY wu_w_Page_011.pro
6f2c146ca963197634f8c53366197020
9cd9f91bfae96c930411174c9424e665ebb00b62
33138 F20110403_AACEDI wu_w_Page_046.QC.jpg
5323ff387b79fd7738f22e1b2576ebdb
b16b7d3720046a540eec5d9b70cc7cb8871aa526
60140 F20110403_AACDYC wu_w_Page_091.pro
1a0340b1bd5ce3351d6592c8f1ccc5c1
3829506ff95d4d4278583aa5abed79e0bdece5ff
6812 F20110403_AACECT wu_w_Page_012thm.jpg
f946908fbb6a1a7dd5219b4f34a62631
fb3944a996d8fa35ea24f719a4773a7330b46dbc
35003 F20110403_AACDXN wu_w_Page_050.pro
a1a4bc556f1e3bf8835644208804a355
97563b17a332726280ec3607e579b2eb2b67fdd7
28283 F20110403_AACDWZ wu_w_Page_013.pro
37af7fc9854cc14beb01abef8dd52510
b9902036c804a82a67db9692a5a160680a26e708
35507 F20110403_AACEDJ wu_w_Page_049.QC.jpg
42d5826f9abcc17e3c5d5f461f2e3c69
6ebb1b1a7531471a1fa280f9da89ce8e7143d898
28002 F20110403_AACECU wu_w_Page_037.QC.jpg
48f34f3e1e355a88643b38c88546b575
465d3295883aec007ab63ec2d9bc6590d97602c5
51758 F20110403_AACDXO wu_w_Page_051.pro
06d0547c9329341130215df056ad859a
4c624457177d76ccacd490a19987a90f5228860d
7638 F20110403_AACEDK wu_w_Page_055thm.jpg
59ccd5d2f6627fd8188c13ff00f1629d
a831506138ea340dcfba7c0873ba1237070bc3d7
59675 F20110403_AACDYD wu_w_Page_092.pro
ebbd7839e69544b86cbb8b169280c6d2
3186e2b6e45f8c596237591959fce2b8461ad994
2060 F20110403_AACECV wu_w_Page_003.QC.jpg
4447ba48751494417642d990a5132485
0b68b576612e3d4922614f68072d9e02d5f10ff2
47320 F20110403_AACDXP wu_w_Page_056.pro
38df46ed368c5fa1521dc6cb26c7bd3e
e464c34c6e2431497a08bfa0a253a2fb66e9496e
33063 F20110403_AACEDL wu_w_Page_060.QC.jpg
6efcc27a447e115d7bdf29d97eac4227
9b80ac8e9721c22d19a1f18f58ef12c15e2c31f3
63850 F20110403_AACDYE wu_w_Page_093.pro
65e7b4d71f2a961700b0e123d056ddeb
b0d8159b1e7ba40dcce94b93aa02956668b4006d
8379 F20110403_AACECW wu_w_Page_058thm.jpg
63249235aef96da71c4e6de7fc93cf8c
6ef1423090af48d633e1aa9a4448983da4fe7ee8
47550 F20110403_AACDXQ wu_w_Page_058.pro
ac3d986bc903ef65301f7c4e1043826b
abda2dc332688b4525b654e91df49d50a2eb375d
163814 F20110403_AACEDM UFE0013501_00001.xml FULL
af43810f6eb6e920c3aea8347c428e5a
815aa625823f5955ed7f026122a80170c04babd3
60215 F20110403_AACDYF wu_w_Page_094.pro
d8db512263c0423812fb8c9c0fd6a800
1804f0337d71354494d54565517e2971e98273e9
34042 F20110403_AACECX wu_w_Page_075.QC.jpg
93e3a5647f172c08447345e76bf40a08
ce3381ce0837c1de519fc1475dab8e08b74f40ea
52538 F20110403_AACDXR wu_w_Page_062.pro
d7ef42d67abcea5597ff482408c846f9
4c03b186bc2d0c283571f005e8438bf160306cc9
32555 F20110403_AACEEA wu_w_Page_064.QC.jpg
97ed4a4ae33d14e7c9d629ba33a522d8
73521382ffb23a553ffcc6b5b3140b9e6c18f609
57236 F20110403_AACDYG wu_w_Page_098.pro
5335a6d76cf50062bf05a677fee2e5fd
82640283f89e4f164d0f086a89d4ea6965e04ca6
7787 F20110403_AACECY wu_w_Page_065thm.jpg
cc60fca24b0a53240f6e2e2d7bfa7501
89a39a03ee488a1aa589926962abb0db66dc643c
47755 F20110403_AACDXS wu_w_Page_064.pro
9823aabc39b1c7a17cbc0cee658cbf7f
52de1d9279378fd9e28fc116bdbc5fa5544fa1da
29833 F20110403_AACEEB wu_w_Page_065.QC.jpg
5d8324755189c232285611ee69ecd649
8581a6efa99c32589d75b8bb9b6f45bd053079fa
7441 F20110403_AACEDN wu_w_Page_001.QC.jpg
fa9ea19233a50c14a10ba6f0d1cde581
5f513c30ef743543f838cd44c27baa38f52cf334
28428 F20110403_AACDYH wu_w_Page_103.pro
e4786ec1506d151e694b26a3aaff03db
c1e25400c09b3b7ecd2548f1f950a6072e14341e
7416 F20110403_AACECZ wu_w_Page_077thm.jpg
6af4e9c2396a6d50aea05072d1f7e156
6f49ba2ae6aad5db7e4404c1ab470b1c761b051d
40727 F20110403_AACDXT wu_w_Page_071.pro
ffa118cb985b17b95226ca9a2cab9c90
80d1ce0a75404ce23906d59bc9ec3a2e25d39662
24484 F20110403_AACEEC wu_w_Page_074.QC.jpg
86976fc2ce7b32ff291bf146cb2647be
4961bc7d7b26ef5195b410d6781d93561bfc8381
30436 F20110403_AACEDO wu_w_Page_007.QC.jpg
f19cd1d73d014b0c19ff4b36276a9c67
11517b94ffa4c06145a04aff9f93352076897c0f
4360 F20110403_AACDYI wu_w_Page_002.jpg
99c66a74385dd3d0433a2c14409827c7
fc735ea4d3a83443bc06213a03c6adc7f714cdbf
2879 F20110403_AACDXU wu_w_Page_078.pro
669afd14eb743d6f833118093df0647a
42735aec24b8fa417c5401231057362acccaf226
28715 F20110403_AACEED wu_w_Page_077.QC.jpg
1b9e06faaff423690664f03a435ff6df
7a377425e88d75779fe4fb9a78822bb67037b03a
8757 F20110403_AACEDP wu_w_Page_008.QC.jpg
9127c0f618029fdd2598e96465614830
8b860c5af5a07c052aaf7e52c5c3393b77031750
8127 F20110403_AACDYJ wu_w_Page_003.jpg
51b78a19c8fab91c63db027f73b8dfa0
f867e0a3a4748c7d337a4efc2c54cfe9a219a985
47244 F20110403_AACDXV wu_w_Page_080.pro
fc90bf65367077637c7202071191dc55
0b307c42c02feada8a256c021dc4367e4ad7d985
31674 F20110403_AACEEE wu_w_Page_082.QC.jpg
1880a87e0c8e05b4a8f3198a56dc68e4
f159764a83aea62fe78ef0e032da0e0bb9967b5f
25799 F20110403_AACEDQ wu_w_Page_014.QC.jpg
44f1039afcb73129d335b85656b23fce
2e51a9760c5410cde6bb4c799820766c45995e7b
75548 F20110403_AACDYK wu_w_Page_006.jpg
73ab62d3d08b8d760c33a4f375aced3f
cc1a44c5bc9e3d38ae373984bf73d00ae2c7a10d
46630 F20110403_AACDXW wu_w_Page_082.pro
6c3434c2bbe567c01080f744858a96c5
e9da8053be0bdbb51391d87350483fd1c77d77ef
5212 F20110403_AACEEF wu_w_Page_102.QC.jpg
f5122f5b5b8885a7ac0bfab2b8cec183
1a65a6b9d1a13b8dbb957c23f5c86d52eb5f9819
30669 F20110403_AACEDR wu_w_Page_017.QC.jpg
5feab1d7958b1c5de2afd05f175b53f1
793dff66e959173366af853b62fd9e502986fb4a
39775 F20110403_AACDYL wu_w_Page_008.jpg
518b664bfc827b3ea759f17ff58e62f3
810922111aa06485fa20d3fde60c7bd7f14acda8
31031 F20110403_AACDXX wu_w_Page_083.pro
dc8048bedf1b400de3e0119d7e2bd42d
e342ffe0cd52e5ba376bd927f0abe20fb5a15d47
19789 F20110403_AACEEG wu_w_Page_103.QC.jpg
dc1e0315b8a814717f69faa1a3c467e5
0a40f5dc44103634f563ba8e9be45ff2fbc99489
104354 F20110403_AACDZA wu_w_Page_063.jpg
4e2893e892633b8900b1b0bdbd5f1567
d1ffed188335387abba14942f7fc56dd2cb8b20c
26827 F20110403_AACEDS wu_w_Page_023.QC.jpg
5a614d5dc61ecbadde88a73355d98d56
e8fa165b3fe6c4e56f256b37974e4b5c6ba39a58
85559 F20110403_AACDYM wu_w_Page_012.jpg
5d88bafdb6f09dd1bd5e95dd5d67ef4b
d978c1936d76ed8a59c4c26a70a7d45a5ca3458e
47629 F20110403_AACDXY wu_w_Page_085.pro
bec2adfdd0c56664356bb9d30e5ada05
ff5a31d36a996e39a72610639e6cfa59a2cfba8f
566 F20110403_AACEEH wu_w_Page_002thm.jpg
0c102e83e6d21b2006dddd48855e5cf1
dd0282e90e660291748e2b118a4eb51c55312658
100698 F20110403_AACDZB wu_w_Page_064.jpg
ebf73653181846180804a9be1ca92e80
91e2616ef8d4711ec709179e3f00e075a45dd378
29132 F20110403_AACEDT wu_w_Page_026.QC.jpg
48608d276a8fbd221d0c0d298ffdcac0
689a8b2b957bd4641d9314b1cf1f7de3672a486e
95523 F20110403_AACDYN wu_w_Page_019.jpg
a8e5ae3abd66b92ad0d68627d34039c3
81340b978de0307b426052b68218ecfda36895e1
49826 F20110403_AACDXZ wu_w_Page_086.pro
996b510bef5014c22868ae4d61d2e000
8e34eb483457d2f387cbcc131aedd0a5de6cae04
4046 F20110403_AACEEI wu_w_Page_006thm.jpg
f532f4f819cdff4c906a06308cfe87d1
f474c470298f28031fe134ba5f3d2f0046151b97
109162 F20110403_AACDZC wu_w_Page_066.jpg
3472e9835108366b354a5e230084ba91
ac7a0a1282c0874becb6da968388d4b38f31e417
23837 F20110403_AACEDU wu_w_Page_035.QC.jpg
06cd03a55bc6739d25c869f7548b099d
dad56f6a8cdb26374b02e61580a88c5113ddbdda
92585 F20110403_AACDYO wu_w_Page_020.jpg
6fbfa4cfaed7e79008a343c76eaf72dc
9fa6d3899abda67583cc73fd76c4e811682d0878
2302 F20110403_AACEEJ wu_w_Page_008thm.jpg
2e3dd049af97767eb0f505818518ce73
8ad074ccaf50fd2c5b3a298b7fbbdc4e60b7f988
94851 F20110403_AACDZD wu_w_Page_068.jpg
ee67aad06b373cb293257b27ff4137b9
35c6880681da9e910db79ae0ff2b8b1f3bbf73bf
70612 F20110403_AACDYP wu_w_Page_025.jpg
c7d766fcef8a5ce2fbbd38aa0da8a5a8
eb8a95accc7ca50518521b8be7151cd96127a523
8386 F20110403_AACEEK wu_w_Page_024thm.jpg
dad0af0669bdc594ca6d1742d5f48470
b9955355c0a09ae49600279e71f29f647f16546d
24171 F20110403_AACEDV wu_w_Page_039.QC.jpg
48a3c72f2c550bdaced357df4354b430
9825270cca38c75c38a62d92118c0d43680261ee
90499 F20110403_AACDYQ wu_w_Page_026.jpg
85aef2576e7d0c2457cc07f945857379
435bae077aa528a64ff53c681c73a555918ab5ac
6930 F20110403_AACEEL wu_w_Page_035thm.jpg
8040cf2148ca15abda1dbbbbcd86e3de
340ee913fd22ffa19140c773324083e653438db5
88703 F20110403_AACDZE wu_w_Page_070.jpg
1184f2db6dcb5a1777b90f6b329d8664
d0900c0a382bb303ab9fb5e14aad39977a135fb1
34646 F20110403_AACEDW wu_w_Page_044.QC.jpg
93aacd6b467ce06669161ed769d943d7
e9af2503faba89d0c7b2808b9822ebe7ecd50242
110147 F20110403_AACDYR wu_w_Page_031.jpg
789b9b371c8b7fdb8db6ecf1c67c4faf
45cef2306abfa3c854f6166ea6a4751437a7084e
6865 F20110403_AACEEM wu_w_Page_042thm.jpg
c9184e9f02054a37c4366b2ae2aebaf2
7a6eeebf0bc36d580e4bd51e79993e350c84e2e5
110496 F20110403_AACDZF wu_w_Page_072.jpg
d8e295377ada6a14148957dacebe5467
e9ba8a46cbf0b82125b13728059670a4309c3502
33822 F20110403_AACEDX wu_w_Page_052.QC.jpg
8d470d49d1cf1b0764aa14f531f56a39
84643d812754c911175206504ad05d1ab7e850aa
104435 F20110403_AACDYS wu_w_Page_034.jpg
c33868ca69724e6bebc412fe816a51d6
ad46702aadfc3a074fed040f34860cfc42d42d31
7129 F20110403_AACEEN wu_w_Page_047thm.jpg
bc0e1ed8e9a2f5f9caa61e5afa1462c3
a26aa48ee3d2307a33665f637a2782f040ff746a
93678 F20110403_AACDZG wu_w_Page_073.jpg
84281bb1bac7209ee3903eae17aaa228
49e735a10d37ad5c36820e1bff9d4b3ffa96e86e
33633 F20110403_AACEDY wu_w_Page_053.QC.jpg
e5f57c91e6657fe42f7422b011debf91
1ae420a9c1988e0ea6e613052d160213e81ddd2d
93933 F20110403_AACDYT wu_w_Page_037.jpg
6cc897ef2de22042bca42fe043808e4e
f94375ad3c52c0678a5588d996178343492d9cff
104565 F20110403_AACDZH wu_w_Page_075.jpg
0e91c5692d394440324599dd6a10445d
7f5c7fa1c13da0519e502f4ef940618bdfbfde40
32392 F20110403_AACEDZ wu_w_Page_056.QC.jpg
6544ac3a2b260bf3d9752229966c6191
93353fa2af8c27a8c8cf9c61b17f3ef65a2bd0b5
98455 F20110403_AACDYU wu_w_Page_038.jpg
da6a7b76f62131f65caa7f8461160e5d
a71b66bb3d6043e7c199c26068e2fd3714c4246e
8352 F20110403_AACEEO wu_w_Page_060thm.jpg
3f2a62b6bf05812b15b5d85c0b44e457
742888ab5f4b6db6b3977729cd347268444f9238
105416 F20110403_AACDZI wu_w_Page_076.jpg
64b14be9860f9e70a72e61461bfed3ec
54aa14deca228ef809cbb29ee221932bb3f7e558
107183 F20110403_AACDYV wu_w_Page_049.jpg
06defb7f2d689687e1815d5aa09f93ab
24da55977b1740a36fcebcd6ddd2c1f265a45342
7835 F20110403_AACEEP wu_w_Page_071thm.jpg
54a6587025b1160a76d003130c23a1c2
847c6b5b45c7cc8fba32c2c1d6c40d25016a08c6
104456 F20110403_AACDZJ wu_w_Page_081.jpg
f2a1cf0a7211edead337f910c311ea80
db31021d58b98a8dd076301016a207944798d09b
106071 F20110403_AACDYW wu_w_Page_051.jpg
1b7e3d330b27f929588d8f85f0a29720
436636c181912898244f33ec771b24321cc603dc
6631 F20110403_AACEEQ wu_w_Page_074thm.jpg
13c132931998a5b87c345a20c09f0cf5
432ecf280c6ff00cf2e741fdd5bc774449074541
72702 F20110403_AACDZK wu_w_Page_083.jpg
e60f55cd679724f5923e531a04bfbcef
e33246c0127e7cc4888725b9866055defae7f778
60721 F20110403_AACDYX wu_w_Page_054.jpg
eec23467291a081e2863cf63688c1852
e3b40069b0211229628de3a06c5932b800ec7a53
922 F20110403_AACEER wu_w_Page_078thm.jpg
6dea8d5bf2a3c5febd80f5124b250b97
941af2caa4664ee0bf3242802f104b431cdbb99b
104097 F20110403_AACDZL wu_w_Page_088.jpg
58d24366c733529447c0b3a31c621e41
10414a9c5bef0c632855189f71139547249bccd6
97388 F20110403_AACDYY wu_w_Page_061.jpg
b673d3494f97182633b72ea615e40f33
ed8c70b34c3b4a364d6db4d0376a990594ce6320
7860 F20110403_AACEES wu_w_Page_085thm.jpg
166ace9b7a467d83aec9149224f767a1
21dc2322a30d08123fe5af8d6883e17bb9d2b9c0
123353 F20110403_AACDZM wu_w_Page_094.jpg
a2cc4db575b57b9c311867a50b1ee1a4
998f1c8ccfba2983e6c8c01c21e3d5ef5d155da4
108707 F20110403_AACDYZ wu_w_Page_062.jpg
f52d8ef2eb13310e753ca5b1f6b625bb
6eacca652c4776b1933d401182474119a55497e2
8974 F20110403_AACEET wu_w_Page_089thm.jpg
b35ea0ae3a33fa298377408fe4567197
58e092fecedc8c897e16e64627a82da91e445393
129408 F20110403_AACDZN wu_w_Page_097.jpg
f034336c1d375d384fe644219afcd8ea
b8d533c60a636e8f33c4d64744c9d5be0e5ec924
8617 F20110403_AACEEU wu_w_Page_091thm.jpg
8ee58577fa050036a08acccc985aaf93
2d4cb768a34152e54261bbea9439d900ec6546ae
127439 F20110403_AACDZO wu_w_Page_099.jpg
a9947c107c55d9ac87a8c43e6b6265b9
a2c7e637cb5f2229f6249746a679d516c666c7c0
8459 F20110403_AACEEV wu_w_Page_094thm.jpg
a3440263e92e8efb4790382a165d0914
69deebc71a7ea5b43653280dcc83a4b37b025b7f
121283 F20110403_AACDZP wu_w_Page_101.jpg
d047c7c0352d837554f3f0494977878f
a62f80fc89928b0cb0b3c6eef5c992333cc66ef8
8269 F20110403_AACEEW wu_w_Page_096thm.jpg
f0882dc4fee45315f571a85b81fe7794
1e30e56bfdcf741c918ac179f8df2e1ce0f2b555
17516 F20110403_AACDZQ wu_w_Page_102.jpg
e9aa9975cfe06e0429157e8f06ed077e
e1ba498e320efdf6593ab05fab023c4134e36bea
8687 F20110403_AACEEX wu_w_Page_098thm.jpg
8e10c1d29650b93066b3a3167a8f22c1
559074d44406f91fdbb0603e82bd96ed4a773308
883548 F20110403_AACDZR wu_w_Page_004.jp2
6cfc9e9202aa69eb40f1219448720d3f
76d9c2abaeb6ac520ab3ea068cffcc603cd6096f
5127 F20110403_AACEEY wu_w_Page_103thm.jpg
f1a36d32303284ad133aadf344e82640
313a4fa19f6c60041d9bbe10124c245ff4e993d7
738058 F20110403_AACDZS wu_w_Page_006.jp2
67a8d7481a9b249c008fc2218307c01a
ddeca74fc92a1d7886c7d1c3462539dc7399269f
1051983 F20110403_AACDZT wu_w_Page_007.jp2
a566cadd502349a9636e5b3b5ba3bb2f
6adcaf039782ea23dcd2bc1008cbc09c1eb8a8ea
377392 F20110403_AACDZU wu_w_Page_008.jp2
1e38d1200c7ae0dd23498a88122a96a8
5cc8441e570389fb1f4b93293958d22f48253e1f
74350 F20110403_AACDZV wu_w_Page_011.jp2
fdd76cf32c4f4b7ca828aa927e624bc4
af0e344640fe3d2a6cdf5254522f4809bf3afc41
987900 F20110403_AACDDC wu_w_Page_068.jp2
c0c2e111438af8b6f41239effe61867c
a70b944f832534fbe8914475c3e43e99b5ace9a3
920768 F20110403_AACDZW wu_w_Page_012.jp2
2b9014738f517b2da18ce474389d4164
ec1b230a6c87f39a02b4717d25519202b3a5b014
28128 F20110403_AACDDD wu_w_Page_070.QC.jpg
ff5b3fba96ab48c076f7e57ed2279b0b
43b4cd719413ee7600a343738f0de9598d87aada
985671 F20110403_AACDZX wu_w_Page_015.jp2
ae0e030e39df1f1f8a8e495fa2e640d2
57bdc4de833420cc42d88f28250ccca4bcf0337a
24267 F20110403_AACDDE wu_w_Page_002.jp2
1cd3cb161d702761014d85a56b5a3c16
43a257ce7b622ee54e0ec002e5e0ae1e03a7d40a
1047073 F20110403_AACDZY wu_w_Page_016.jp2
bf172da611dc2ffd642748809c8245e2
c8a37bfcb8cb83330e62cde736c313b57e1d6777
114650 F20110403_AACDDF wu_w_Page_098.jpg
95053020f391d7723b823a92a19e412b
a3a62a4f772dc613b00f15829afc8be22ec127c5
1047894 F20110403_AACDZZ wu_w_Page_019.jp2
90fc6b8fec029d0875003fe17a90d5a8
20b686604b86baa9e5d17313669adba32b486af5
F20110403_AACDDG wu_w_Page_055.tif
d373c988bf493205a3f8cddbcb9cf531
0670e6c4ed274b1742bedf7b8e7e3d08e0cbfb26
2001 F20110403_AACDDH wu_w_Page_081.txt
2dd74422ee6ef37621f8b7abeac36d31
acc93848bcfddb881d184637809292c77c9ec554
35663 F20110403_AACDDI wu_w_Page_099.QC.jpg
21617968315e6b1b24fbcc839826ddaf
db0447cea4e4243ad18532319cfa379e25d3786f
1867 F20110403_AACDDJ wu_w_Page_084.txt
80911c02029105884e489eea203cb3d4
8107ff544ed32a3cf8e22e0f64dc0daa3580b47f
7698 F20110403_AACDDK wu_w_Page_069thm.jpg
4bad2d1c882f45f54ec04be638d3f34f
8ce2d38a9a854d74a53669963fc47f3e3a3d89cc
F20110403_AACDDL wu_w_Page_095.tif
84ede45f50a1e38bbddb43092d38cfc9
66448c1c32a4f914c84930ea198f744f550af18b
89287 F20110403_AACDEA wu_w_Page_050.jpg
d4d62f8c6d3129a2f3d45a01202bb157
9a2e4cf87a613336da9b0d1dac9816dddbca36a6
57980 F20110403_AACDDM wu_w_Page_044.pro
52aa029be18732a652cc6f98dfe90734
302992249059281994dcca9fd8e736bb88a54208
8619 F20110403_AACDEB wu_w_Page_090thm.jpg
d2cd5f4fb35ae99ad3f5ae35947969ed
a6bb121d6944293fb2061bffa70237f7f0f4abd0
F20110403_AACDDN wu_w_Page_034.tif
c929e027833354f43606b22dec51fcce
a668f3ef0dcad9932d5558bb7f646e785e6b4a1b
7780 F20110403_AACDEC wu_w_Page_016thm.jpg
289097d2edfcb5d574c2d49326051ef0
8f82c526485f335179ad2058b9e8c3b35509b25b
2515 F20110403_AACDED wu_w_Page_091.txt
c02dbc6dbb48fe0146680ec332581028
3ce4987226c3e9bd226b32f59f2a966cb8537a29
7783 F20110403_AACDDO wu_w_Page_018thm.jpg
25507ae039e20832f696e14d10cbf32f
6184c912c1c176d279a67340e5a1ccd55ebff838
30331 F20110403_AACDEE wu_w_Page_020.QC.jpg
60536a8aeadb468b3024dc95436dd16b
ca278a6c02a9eae020cad06be28c70f38dc1bfc2
1051971 F20110403_AACDDP wu_w_Page_092.jp2
2b0fb01d605ae040786b75b85cf9e5fa
e75dc3728cf4bb723d3af71a9e053f268741a90d
F20110403_AACDEF wu_w_Page_072.tif
a5e12ee38e71c212888cadd81bd5d367
7c24d58ffc3fc21599d919b281a9cc3a266f3318
19727 F20110403_AACDDQ wu_w_Page_054.QC.jpg
ca8308f2f0a46443c6f39881c0654472
2065693df75edfbcfa2c8a47a74fca6d4e938ec9
F20110403_AACDEG wu_w_Page_067.tif
5c6fae2d3b516c7cbace8d693c3ecd14
c7d555cf9dd54e120136e0c4344661375cf9f6c5
52080 F20110403_AACDDR wu_w_Page_076.pro
aec40c860f2b7a699836e883e60a2b58
05cc5b35a8cc0b6d9c910dd87348a05901ad5412
1602 F20110403_AACDEH wu_w_Page_008.txt
6add2372653ea511c4d03031903171f8
4393bd08b8aef301b40b5ff411e3090c2eb22a7b
46186 F20110403_AACDDS wu_w_Page_032.pro
b1cda5cdcd01a03ae62fc06fb1e6ccc0
a283a5bfa17a33bfd40c42af8bdc2c03009ba0f9
33713 F20110403_AACDEI wu_w_Page_030.QC.jpg
3e2ce9249185dfaf8d0413e4bf9711e6
645492fe4292511e6c1f214cbed7f398758dfb4b
8015 F20110403_AACDDT wu_w_Page_043thm.jpg
4df01f8bc0f642e669deddb24e2dd6ee
6b581750968db2bdbceeb9bd721b2b931a2c4e4b
F20110403_AACDEJ wu_w_Page_040.tif
0d70e17c949fdbc646c8074c192478cb
f465865715dc6191831673c4309064ef20a84338
F20110403_AACDDU wu_w_Page_034.txt
7bf91297f2740a9eedc47363abaa2069
07797314fedefd992e35e71a04824b640886fa17
8775 F20110403_AACDEK wu_w_Page_031thm.jpg
48565f8ad659b5784a03086d4490323a
b590a16efa67b3540d38b4b1f5563257805264f9
125952 F20110403_AACDDV wu_w_Page_093.jpg
397067d27e1eb41e8e771e22cea24cd7
05899f356bd72c7a432642b5b43b1da3ec631ba7
F20110403_AACDEL wu_w_Page_096.jp2
ed63c3f4ea399bc9224733f950811898
587c14a0184c699f229e72a748ccebe125452763
1051943 F20110403_AACDDW wu_w_Page_081.jp2
a738332a5798d24bc3c01338d57a3af0
703292c8564b993ce898d104f4f59f6fa6fd1331
31395 F20110403_AACDFA wu_w_Page_047.pro
409ea7bdb7fa8a4f79856255e3c90795
c49f3d92f6ea831b959d2fc59c3af82f20ebc0a9
F20110403_AACDEM wu_w_Page_066.jp2
f4bec75b9fa58d8cf3ccdb8f3efcb296
95ff95063deaa907e0c4d20ba577474f56d9ced0
31030 F20110403_AACDDX wu_w_Page_071.QC.jpg
9ce437c21170855eb9f9ab5dbfd7a36a
95ffb93e7d84d03cb1c4132112f811bc5309fb26
8327 F20110403_AACDFB wu_w_Page_092thm.jpg
b190948988671bcfabb9f65a01ac18d0
3bd12e1cafc5ec20280988089333bdb2906a2ccc
92733 F20110403_AACDEN wu_w_Page_079.jpg
efee92410988722ce0e0d3e748ed3615
cb7e1b3d7ae78b18f14a4569f22681d91e54986c
F20110403_AACDDY wu_w_Page_094.tif
054db67379f5ac69ddb93d2c3ddfd877
2866d748f225c0a5fa532904ecae08541275d377
1623 F20110403_AACDFC wu_w_Page_014.txt
9753ffa9021c26066bd4cb2f46faca38
29afeeac5079e35858f6124ae13f858da518e8e9
104182 F20110403_AACDEO wu_w_Page_056.jpg
3c01aeff23ddc4d5e94e71b72d8a512c
04b9772637c9f1ba77008a127ed137e9e5ebc81d
116703 F20110403_AACDDZ wu_w_Page_044.jpg
e4bd7c2c28736f18510e5ef4f76aac4b
d0ae1b9ca5a3a4db1917cc10b8263908621229ce
223259 F20110403_AACDFD wu_w_Page_001.jp2
20223db7de6b6e675ccb882189f18953
ec06a8cfa27359c0636cda52785dff2cea3f308e
45145 F20110403_AACDFE wu_w_Page_065.pro
2b2734b7a3298d1edd37943336ccf370
d29859a2804f5f4ee4d8db5f4b65cc35ea5a1b60
114741 F20110403_AACDEP wu_w_Page_043.jpg
9a16f2399da69223b667f8c63fd2c41b
fbf32f26d3a322983a80cb052ed1c44946f9a09a
36388 F20110403_AACDFF wu_w_Page_062.QC.jpg
c231641e36635cedea07c9c9da13106c
31a305f8c0cde9eaabfbcceb63817d834971d57d
F20110403_AACDEQ wu_w_Page_016.tif
f02c8f7e1b93d384c99c37da95da8ad0
133c438b4cf0b0e9893c79fe873a04988914e505
34200 F20110403_AACDFG wu_w_Page_090.QC.jpg
32e3a0c7e946f892991248e6df9fcf0a
031db07fd8bfb00b75f92fcdb59fbb991dc1d0a6
27852 F20110403_AACDER wu_w_Page_074.pro
dcbe47ff61cb4fb114b5452fa155449f
0ef9803ac3e75099e0394f6820a46c8ef6207267
101638 F20110403_AACDFH wu_w_Page_046.jpg
deb3e4950778c6b9db01530d09adb838
cbb468f641c88b1e67b92eb5e97c0ceb5bcbcc17
124313 F20110403_AACDES wu_w_Page_090.jpg
996ddce7916432f42d56c08efe2cff7e
dcd6dbf7208f5c0cc8b829770accd03101f2f235
1113 F20110403_AACDET wu_w_Page_074.txt
a4ff3308bcf7310cf50fb4a9a66ff5c7
a3af451cbd499453348dd2b444765f60d2fa3d16
F20110403_AACDFI wu_w_Page_015.tif
0b69708c423ba0984d6b65f726f5397d
3c9cd4f69c4fc8f0adb891dec618bae727b86d67
33194 F20110403_AACDEU wu_w_Page_092.QC.jpg
fc2bb62bec5f8cba457adb251d4be1b3
f9c59fa2f460088e0730a2059c2bac48d4346a8e
32098 F20110403_AACDFJ wu_w_Page_085.QC.jpg
a2ee69a5f85db58dc8174d98a53f8ff6
d99018b1b2b2d33e3670cb279d34f7ef4591ece2
43569 F20110403_AACDEV wu_w_Page_015.pro
d5b69895ca491bbdee811f5332ccd3ae
8f7d0f8221a54f43db1d8749eba5efc8bb470025
F20110403_AACDFK wu_w_Page_044.tif
a4b9eb4e51c57c6138d5360634c77b5d
3326bd026d7d80f5aebe1028e4b537838b0946e2
32164 F20110403_AACDEW wu_w_Page_009.jpg
e12c70725f36610197e262519c00d5f4
001d12a94a2d63de8c52e46682614a91ef147be6
5074 F20110403_AACDFL wu_w_Page_013thm.jpg
87b8cccabc3afc53cf0fef2f5da2c99f
de83351adf390b38b7415cb11a75820219abb36b
F20110403_AACDEX wu_w_Page_066.tif
cf763afeb9707f7576d859df8a14a9bc
934f72e52c7349e18532cf8af655a6921eeb0338
95737 F20110403_AACDGA wu_w_Page_017.jpg
497953c2d2389e68026bc73a89287eea
9b5f24504cf4fc3d19ca9bb048cfc576e8f28d61
31422 F20110403_AACDFM wu_w_Page_084.QC.jpg
547e32d4b4bff5d35f558d70f45d91c6
4fc3d3b2aaf6f20dbe1ba1c2a162f51dbbbc80d9
2465 F20110403_AACDEY wu_w_Page_096.txt
e2a2bb0600bd0692876a56235f0d5dd3
4686745c6255458d70e7fdb20685c027cd5e4556
55512 F20110403_AACDGB wu_w_Page_010.pro
3cde87ccc9b8141e732128e365d871d3
1952948f0a17a0bd12c05fa9feec1b475953da95
46121 F20110403_AACDFN wu_w_Page_019.pro
d1e2108d900b76721a0051451fd77f47
30a471f96af8a874c907967b73081da3f43387a1
46245 F20110403_AACDEZ wu_w_Page_041.pro
9c4cc25bd2a05900d8028b61120fa359
a7b14133cead7b4aea1e4d611cbc448d3e21a82b
8059 F20110403_AACDGC wu_w_Page_061thm.jpg
51f197eb93f05b28fa697452bb156a25
87df96128e09fe1b135b0cd31818348fa8e0a120
127506 F20110403_AACDFO wu_w_Page_007.jpg
b8429e06a11e2d87ed1782ffbdbd5edb
ec53068b3abd0ee0092fe0323d5c3e6a9204afa4
80522 F20110403_AACDGD wu_w_Page_014.jpg
9c4269c6832f527efc951977166d937a
f0fe091d279b42969b49b665be80972d415be58a
50431 F20110403_AACDFP wu_w_Page_052.pro
0d42322db9c9744b95dff75f937f6bbb
1d8afdeaaac2b2a7cb2d546e406cd248c6815e7d
7041 F20110403_AACDGE wu_w_Page_004thm.jpg
750925d32a274f7237194c4cedb5c57c
852e13dabfe6a692e147078944059b83d58babcd
F20110403_AACDGF wu_w_Page_096.tif
dcc1463b2a5cfe280668bb47bdfd63c6
941509bc455f859453cd6f304977c65b33e3175a
F20110403_AACDFQ wu_w_Page_029.tif
b198a9016c41093349200aa5622fe4e3
50e0e9dbd0ae2896c9e6ba588776237cd9b5fb82
6321 F20110403_AACDGG wu_w_Page_014thm.jpg
07df4a89509257dbc7bdc74a5fb6cd1d
47b598fcd1ae4a9f712341aab21d08f36271b79b
F20110403_AACDFR wu_w_Page_039.tif
2765e0cd431f80710d01a8065f246945
e15b936cc9e72656b94ec623a0ea75258d834c26
8568 F20110403_AACDGH wu_w_Page_027thm.jpg
8e7f446ffb578018962e9a01a8b23af6
d8e2cca564aa813fa53dcc5c68be716b95a3bd98
81319 F20110403_AACDFS wu_w_Page_067.jpg
8b232d295d0155c047fc0218fed9af7b
9fed18deb6f5299da4562a37e09589a98f58c124
F20110403_AACDGI wu_w_Page_003.tif
3ec74cb95f86c317d0901169e6995d75
6fcebe110eb8066f8d90dc4b769deebd007b4caa
103170 F20110403_AACDFT wu_w_Page_032.jpg
30168c896ad431b9e0b4360c02ed34b6
3470966382800feedb2b0cf2ce8dbf8a49c944a8
7039 F20110403_AACDGJ wu_w_Page_015thm.jpg
1f54283247302b21c69bb9ea54fa1af1
98e595a98788182cd85d1b207fddb82bd89a8ab9
4235 F20110403_AACDFU wu_w_Page_007.txt
1755545d265732e1902e1630912d66a4
f29f2c14aa4f7f408bb3259bb2f594a2ff29e034
982103 F20110403_AACDGK wu_w_Page_073.jp2
12c40b274b19fad61e477d249fd11663
3279780498c61121a1aa8581f68371a6363c94d6
8581 F20110403_AACDFV wu_w_Page_049thm.jpg
be9786dda733c584c85fd5b5b8fb5d83
3912117b86c3509ab6088fd6fbc8dde6f77ebc98
8526 F20110403_AACDGL wu_w_Page_095thm.jpg
620c2a0fc6daf3ae6d1b12eb09178438
b5c7305fe420c49dd12bebf7a9d6a5d131c05bc8
F20110403_AACDFW wu_w_Page_031.jp2
0816217a2ea8e4469b373909d7c518cd
332a833512d8c2f918fe1f1048c5a6a522974a6f
F20110403_AACDHA wu_w_Page_038.tif
5f9c95584f3b6fbaff05bb7912a02693
2e3d16fe19596f6ad3bafd82b26b523a54bc750f
102145 F20110403_AACDGM wu_w_Page_030.jpg
1ae24487c3a815ec9ba1d7ab680c3ab6
398ea6cfe600e7bc02e0ef00fbaa7bcb6e6c4397
1940 F20110403_AACDFX wu_w_Page_031.txt
aef288a517ad1f39353f9132441ca3aa
9efdfc90d4f160ede6b2f9656d1d0e99566f63c3
1608 F20110403_AACDHB wu_w_Page_004.txt
81df804eb9aff623bc25efe055f838f6
a85362215efc3c51ed19340603d58383e0659a43
527649 F20110403_AACDGN wu_w_Page_005.jp2
7a0baa92678399c7e89a725cec540ba5
0fe7dc3f5948bc08b98f90ae3b8394c8af0a3d54
1026460 F20110403_AACDFY wu_w_Page_071.jp2
33bf8cb7a9c7dcc99bf72e48544be7a9
9d52e2721300c39be6822cfab6978e924d82bf73
1960 F20110403_AACDHC wu_w_Page_086.txt
dea4e111e5cce9c5749648e06ef84b16
a17b297fd9fe02bee94443bd788321163df489d2
97526 F20110403_AACDGO wu_w_Page_085.jpg
64e3f8b20482a0e0cf577e3ef1e2e1ed
414846819eba1ef92311a5e282aaf0a8b4c250a0
62786 F20110403_AACDFZ wu_w_Page_099.pro
ad1250ee37e099d6071eb381ae516cf8
b4146fd930540f822f2b252dc53839a42d95a7fe
F20110403_AACDHD wu_w_Page_091.tif
e953989f2f06616a59316ae392d6be4f
4a28e4ae01a0cb7167a16a10897e2921a0b41328
9289 F20110403_AACDGP wu_w_Page_100thm.jpg
477e2a24f6ea6893e4d9c3ea08beaab8
dda2cbf7562b62d116e779d11a5a7fa20f0243c1
1783 F20110403_AACDHE wu_w_Page_026.txt
4a7c8ea109667790ca7a13311b5e6a32
1ffb4427f688be9f5fa209e5c4edc598a38c900a
2112 F20110403_AACDGQ wu_w_Page_088.txt
d708d00290dde07df7035f6d848dcc73
4fe040470e02a148dc3a27e6ea740031a517b5c2
45534 F20110403_AACDHF wu_w_Page_042.pro
22243270c4b01881e9306e0f715d0723
d4533fe3f9c06f57045d4a0e24f8968fb687ecdf
89130 F20110403_AACDHG wu_w_Page_041.jpg
f0894f84abf9f6c97ec7dffba8d33fb1
2589a9fa0b9b5b0627f219176605bea59955483a
103065 F20110403_AACDGR wu_w_Page_007.pro
f2340b57e21c6c6da5acb7e6b17149b0
e3be60596354e4beab95fb91dc6cc9ca3c804c20
8093 F20110403_AACDHH wu_w_Page_030thm.jpg
8851396bf75e0d5b1cbe191b0b03f1d2
4ae31e725dd1d747c64936972b442b92c20164a8
940712 F20110403_AACDGS wu_w_Page_050.jp2
62eaf60b2668c63502470add97778672
a400b2df7bb8aed28964edb8b6d185e04f5f7063
7732 F20110403_AACDHI wu_w_Page_068thm.jpg
08dcec61461e3c5d05cb8ab4fbb704ad
afc3309b070a3ec8dd2e0470e421a01cc21d9b8e
7941 F20110403_AACDGT wu_w_Page_080thm.jpg
6ed47d7144c936283f9e6249e44f0a83
34b9d6cd324ffef842f6363fe3b188b045259c9f
97088 F20110403_AACDHJ wu_w_Page_069.jpg
71a1a53b0ea485431f4471875adc6d54
3bda3b20b2659da83be395fc474a9ab09a2e1c51
F20110403_AACDGU wu_w_Page_013.tif
4c631e77de4c0bb5e2d40d12abfd9c73
8c9a3594b15ef77f8e4fd7bcff24f619b735fe92
50051 F20110403_AACDHK wu_w_Page_075.pro
d6da770cfc6bda6cd63a69f3e1ed53ea
cfed051cabcfef47e3a30ad589110e4c115cdaf0
99320 F20110403_AACDGV wu_w_Page_029.jpg
fce6fd9b976312051c23400d4cfec0d0
8bdd8fe91c34ed5819a66c0ce8844ad0a103962d
1386 F20110403_AACDHL wu_w_Page_047.txt
e25cbffa07ccfd9817d78b277cc779ce
be1ae03b7257c87679db8ceb2217df4981e7bf9c
8548 F20110403_AACDGW wu_w_Page_052thm.jpg
0b9842b672e8dde7cca1d5b355c7b986
5ba0bb8484d694636d554de52b31c1ce45125e2e
7458 F20110403_AACDHM wu_w_Page_059thm.jpg
c279333ec0b3aac437725c651d6c6073
b34ec44d6a6752e0a53a069e19c60ff10c1f6490
7038 F20110403_AACDGX wu_w_Page_023thm.jpg
3987d08467e72dbcb9b7c6389fea5eec
c16ea4b2de8bc0b3058a134cda2e335b1de83e29
77530 F20110403_AACDIA wu_w_Page_039.jpg
76ca68d61034a1aca137416bd0276a3d
598e4dea93a64efbfa8653cdef2bb662da8ce2e9
29816 F20110403_AACDHN wu_w_Page_068.QC.jpg
85b959b837108a12b75aef010c6ae6bb
eee5e5959b0da5c485299f58f916b67fd8c34c2f
F20110403_AACDGY wu_w_Page_041.tif
66c81dda1bc22e922c978fa5c03cc323
aefbce4318d05da17f611ec2e410cd15de62758d
F20110403_AACDIB wu_w_Page_101.tif
d4211393b3249fa66e9201aec0854f87
fe614fe82ff28ca283fa3cbf4fd3c67a7e0b18ac
1261 F20110403_AACDHO wu_w_Page_087thm.jpg
8bcaa01778b437e9b900caee1cd9944e
e50f111e83335bcdadc2d008d98cf284ecd7c8f3
50774 F20110403_AACDGZ wu_w_Page_028.pro
c9407544e904da3dffc4faa62f00a50c
2b924809af7d2acbc09832f4dd4271adf49ab522
4890 F20110403_AACDIC wu_w_Page_054thm.jpg
5bcf58bd98d2fcf080f87f7e0fb247d1
a249d5ee02c9453d9421680e4012e76f00f696db
31882 F20110403_AACDHP wu_w_Page_028.QC.jpg
e1a2527c15445a5bdbebf2beb63e2dae
c76bd350f9ee458f50d5c8b0d0bfbf33763c2741
F20110403_AACDID wu_w_Page_032.jp2
be2d3b01bce46d648993c959d72d16a9
f80e1ecaa868dc795409af4d4f2f643365c403e0
2142 F20110403_AACDHQ wu_w_Page_028.txt
f6381de04045dcee70cf2735bb191214
f75717a4ce5205d48e27e40814ebebbb03b21b1f
34246 F20110403_AACDIE wu_w_Page_081.QC.jpg
7fd0afb2f8a806f8cbc9976eb68c3182
f734e05933d097c300f1f74ba490e5e2a51fa815
109628 F20110403_AACDHR wu_w_Page_059.jpg
41fa927fb3f21ff26081d1cd6aa59dfd
2535c5a74bd988f9337e538885f17983695e9fbe
2580 F20110403_AACDIF wu_w_Page_099.txt
90bb9030148b5204698270f833733850
64f97ee153290f7f81a83599035207a2596f3e89
F20110403_AACDIG wu_w_Page_083.tif
c7ad1a9859bc97fb6905c838dbc17bca
c195cf55b9c9da54cd4efd23b478b0442ef846d1
2055 F20110403_AACDHS wu_w_Page_069.txt
f8b1de6ba80dddaf683b9b0d0d7f91c0
b5ab88ce0e9c9cba5d810546e3f9a69ea8e1b9a9
43417 F20110403_AACDIH wu_w_Page_073.pro
d9aa1cfd59247f23bdd3419591bc4ce6
5c36cd394c2d318869d75be6aea766e652a6f66f
8335 F20110403_AACDHT wu_w_Page_057thm.jpg
63a86efaee167f16fc50f9e2c5f6d2e5
82315d15306caae42a370ad387c0ba29c9ab0b2c
45778 F20110403_AACDII wu_w_Page_017.pro
49810d7f24dfebb7e3e1d22764138716
ad1f14cc9dd48f72e0f5c0d86673111fd36946c7
3082 F20110403_AACDHU wu_w_Page_078.QC.jpg
f2f09c11fb3a9797d0f35e3f076a461b
6191a6fbb5eed890553b1914cf2618b31471d379
122568 F20110403_AACDIJ wu_w_Page_091.jpg
8336948886e2c0cb1346a7d0c898ef71
83eea37fb60d7663cc833b13366ef25cb46d4a9d
1812 F20110403_AACDHV wu_w_Page_070.txt
b6514e1610e20594065cd153f4f94ade
8597256509623dd9f65753b9741623260097971a
F20110403_AACDIK wu_w_Page_068.tif
fcbc47ee63353a23237c80b88e6c37de
14efd337f5b4794573f04bb217a8ee5d29180fdc
1051970 F20110403_AACDHW wu_w_Page_100.jp2
74691810ccd906d3e79e831cbbdaa1a8
9267cea95572c7863385354ec40792b154c9a73a
1029869 F20110403_AACDIL wu_w_Page_022.jp2
d252ae88ceb362d294b8e986de782fda
d2acb889ea6e24bc4dca724d49fde38fc49d5c0b
977764 F20110403_AACDHX wu_w_Page_021.jp2
86f1511d30f3a08e42dcafc1de01ffb3
d2938542dfe94e6bea839b89a76216a606651d6f
94269 F20110403_AACDJA wu_w_Page_016.jpg
17ec441102c4269128d32ab2d0074a76
55ed8ac7e1fa79fae5fb6a1082b53b346ab4e18b
880 F20110403_AACDIM wu_w_Page_011thm.jpg
1b9c5eb06ce4a90a0f65ae92eae88d47
58a356b32fc9dc6c7c3d08ff18500b192662a02f
315315 F20110403_AACDHY wu_w_Page_009.jp2
ff2912fa5a0a0c54e4f6d16d20f044fc
afdfb47edc7ce4d0fd3efc69272430bec7bd2ae2
1176 F20110403_AACDJB wu_w_Page_103.txt
de903d600fb04e4f68d8be9914071997
1f57747f65860bfa4e5f7bc11f63b2eb506545bd
187 F20110403_AACDIN wu_w_Page_003.txt
a3ada2486accc86f352a974223117967
bac688a1ec3aada594b91d1c13f8d60b730030fd
1890 F20110403_AACDHZ wu_w_Page_030.txt
8ec5664f97da8cf2ab0555bd123fdb82
6fe323d95862c726dc0074dc38abc21c831d6f55
27237 F20110403_AACDJC wu_w_Page_073.QC.jpg
443a46f16072dca46cdbc00030367fa6
a25bd130ccf45acbd9e194f8db8fc9638cacde23
2184 F20110403_AACDIO wu_w_Page_040.txt
007c522f52de8eb77477d9cd55096629
83248d3b3379d2861c8957bf9ebb3b7dd8d40ed0
1006762 F20110403_AACDJD wu_w_Page_069.jp2
f0ff23cf82af1d72ba75da10faf31609
e09f11463dc6d0bca401c709b32ab7781cae0891
1005798 F20110403_AACDIP wu_w_Page_079.jp2
ad6b1300a451567877b800995ec02ff8
dc5cf968e06ee600ae6c3ffc1cc67c8c390b8067
50587 F20110403_AACDJE wu_w_Page_024.pro
742a4ebc8ce2ce4fb79bf684222babc6
c9a20f4ac002eb9cf970b7035e5822f76c96f592
1051976 F20110403_AACDIQ wu_w_Page_099.jp2
f75939c0061ee4648e6ba599155966e8
a53db2f7704ce22cb27bfac490692abd15826db0
64946 F20110403_AACDJF wu_w_Page_100.pro
372a0f32add0459ffa37884dae3f3f2f
4c003181bede732abf4c61b7d34e58262baac25e
1718 F20110403_AACDIR wu_w_Page_077.txt
be2be072383d60780dda17864ed0edc4
774014fa7de07720ddfac359c17748104b418150
26823 F20110403_AACDJG wu_w_Page_012.QC.jpg
0bce365897fa9d7602c47e3c37839e15
c71fc26654fef47f5957149591d0b860320a0342
99977 F20110403_AACDIS wu_w_Page_036.jpg
672b86ae93b8ecc82ddfee99927b9829
9319c5b0091cc7bd672454f20ca8ae983ce09cd9
56683 F20110403_AACDJH wu_w_Page_095.pro
413edf5608eebbd71eedee5ff14e5527
f43bf472af4f8b202a569bebb43af797f20f1ce9
F20110403_AACDJI wu_w_Page_051.jp2
89c269f7c6a2e7be4850435d5415a021
a7298fb760bbd8ee2053a942a6a3d80d7e31e830
84198 F20110403_AACDIT wu_w_Page_023.jpg
22c4595c6de96f00d4f4b52cb2fcc84f
87fd7e7779fd830ab16e3538dbe5f9eb612109d4
1816 F20110403_AACDJJ wu_w_Page_032.txt
a451952de3432a9429df26c162161504
a7ad918d4e1288b7539d3511b91f623f105eb260
1014 F20110403_AACDIU wu_w_Page_002.pro
a9e9fee686022b7d91bd887451446697
d11ffea7017e7235ad895c883dd7cf188f7334d9
51181 F20110403_AACDJK wu_w_Page_005.jpg
9f23303af9e78f1943965e4e1107836b
8b38520cd574214ab529780d3faa71f1218a7a9b
F20110403_AACDIV wu_w_Page_046.tif
40d23cbaa9f5b48aa69a3e6f6813490a
adb7dd3bbac8c2dbe854cc8436987def0947bf66
91032 F20110403_AACDJL wu_w_Page_077.jpg
81d48d9cb462ab1157a1feecd4b8d965
9945ef08d5f6aebd4e0c8de16d6eeaea4b6aa04c
6135 F20110403_AACDIW wu_w_Page_083thm.jpg
8ed7a1a3c50f9c43a9e5346c300a9ebd
e6b45abd9ce7d0bb1db41dda8b196a9c690438cb
1051942 F20110403_AACDKA wu_w_Page_063.jp2
d2b4af8bd5088401fbc3ec465212a4c1
f233df348dbb6c7296f547d5266c2654cffd83b4
F20110403_AACDJM wu_w_Page_049.tif
cd0208af12c997e5ca0ed237408e9195
86ac215dea46c5853e25da0fea887c174337185a
7887 F20110403_AACDIX wu_w_Page_033thm.jpg
17cb16071af00279f9f1b4ae05007c20
8c7034e5194c896e6eb94f5f264bf5e8524e4a80
F20110403_AACDKB wu_w_Page_059.tif
1bf4a9787253d9db10216b4d72514a6d
c433fe0dd446c480f7bfe0e7ebcb0f9afc4f11d0
94886 F20110403_AACDJN wu_w_Page_018.jpg
4996e45c87a2f82214f2df896f27a8ad
e445bbc9855b26a108e1f68bce136f6c189010fb
1821 F20110403_AACDIY wu_w_Page_019.txt
aa63f93e40c5ef887b5cea75ac99d376
ddc7af1179aab55117247b3a2be0e02fd8144268
2353 F20110403_AACDKC wu_w_Page_098.txt
8f4d2969aa7ff997774463f6db3bf9c1
8c50f7346bd8d564ec1d19a371385642c0f0915f
1393 F20110403_AACDJO wu_w_Page_083.txt
9521a628613c34e2cb80bbd06ac03904
97e6e2fbf4b2a2f27079bab067ba2f2c1e773976
746322 F20110403_AACDIZ wu_w_Page_083.jp2
ab1589c039ea681707d4786a4cd1cd12
8c5d31ac3d9041d2f0f573b468ed2e2739dcc8fc
F20110403_AACDKD wu_w_Page_021.tif
c7bf4597edca90825dd8f74ff37f6eb9
b9988b39a087c7df5d04592eccc0b6c1f90d9405
102296 F20110403_AACDJP wu_w_Page_060.jpg
a99547c0857a7945095d9d7d16f63ca8
3005ed965546e02c7d94c83b1468c6200e6bba26
105280 F20110403_AACDKE wu_w_Page_024.jpg
b03797d24b8d7c70bd34c864fccf253b
a4b295e0c61ca6efc3d57143460ac41db21654e5
31363 F20110403_AACDJQ wu_w_Page_038.QC.jpg
9e0c6aacff3e37d1abbcd3fafab19787
9db4b46f06c3b084bb5e37a9ccf42780d1a556cf
F20110403_AACDJR wu_w_Page_058.tif
19c37ab64adb4dfba6ab5212992468b5
a7eea8f99a3d5ba3c7c48e2d0c55714b22643534
1819 F20110403_AACDKF wu_w_Page_079.txt
10e2fb7abd6d5a7beada45f809613c20
f41425f621d2deea7a89f9a12e6f01a348eaac1e
2196 F20110403_AACDJS wu_w_Page_073.txt
5439edef381070042fbcb796c0f349c7
b9001b574bd2ce9bf8cd76239242b68fb2fc8a43
1051933 F20110403_AACDKG wu_w_Page_093.jp2
0ae168c935dddd43671e7670d512f584
f821b25f1cc633e3a6918a2a3e1a559ba678cd93
1891 F20110403_AACDJT wu_w_Page_085.txt
91a9de65679ea4184ccaa92d1f6f27b7
16fd7bc745b8217f3b739cf116566b4b8b125fc7
91802 F20110403_AACDKH wu_w_Page_021.jpg
cd90f0b4a27b29ea1c10bb42c2e951a6
31a1934306226b0680503e8493c56153763c8341
1051946 F20110403_AACDKI wu_w_Page_024.jp2
9ba79bb12da694aa6de57b005427a656
ffb49a45c00ddcf95e12610d3de3b03b3d3c10ee
F20110403_AACDJU wu_w_Page_061.tif
c0ad0dc735f9cea449823fda3b7bad8c
5d5dc56c9c39e791c1dfb7da71e72fbe6a8ce574
2724 F20110403_AACDKJ wu_w_Page_089.txt
5b1b9ae7240a21476d5d63b8e2accc1a
7b5c7cd5ae133e4043b8062778f3e52fc33c724f
32071 F20110403_AACDJV wu_w_Page_043.QC.jpg
1fc9c9e85af119444de311d8ff45d420
b4a3a6384879e868ca62ebabf4fa39e683d99a48
89529 F20110403_AACDKK wu_w_Page_015.jpg
de02534161e90747d39b1d95555919d3
31b70f0b2fa5d7f03baa50ed05d0b12cf7e86897
51754 F20110403_AACDJW wu_w_Page_040.pro
9e506079c9d4d230f2836ae43fa4252c
54fb5770c8b688d8bbf3a07de866ac7822d158af
64707 F20110403_AACDKL wu_w_Page_078.jp2
b2218232e1aad69869f6ff9036a6be9e
52d9c3dc50c9283f34dea61f3d18ab16ca22221c
699576 F20110403_AACDJX wu_w_Page_035.jp2
9f23235f113c122adf8946cf60406f7c
d2b8aa1d45cdf93193574715070d38edc5540619
2637 F20110403_AACDLA wu_w_Page_003.pro
d5d9dcf69e1f72445de8c9c75b65ef9a
287ba6f8a5d5d1bfd542ab793f5700a9da985df5
2090 F20110403_AACDKM wu_w_Page_065.txt
12141188e78468b0a7a40d82996db24b
1ac0a7c95e3dae298202b27707b656ed19c04762
1051951 F20110403_AACDJY wu_w_Page_048.jp2
aa80ff8468e829cc4b4fdf69bcec4c7a
4788add38b9720eb03b76258a810b11c302d65b8
F20110403_AACDLB wu_w_Page_047.tif
90c00f9e422d08effff706235fa0817f
86d49fd4a49c3796f19a0b89cdd2f2d66491114f
F20110403_AACDKN wu_w_Page_005.tif
9598efffb47f79db09c9eca10956e071
6c95b55556b061a037ce64e5fc33e472815701a0
7890 F20110403_AACDJZ wu_w_Page_022thm.jpg
a74403561ff599cf9e0f2562f937e799
43e00d6790e881320b3b06b2eac5ad9263e2b6ec
7550 F20110403_AACDLC wu_w_Page_037thm.jpg
e0dba5f8f441c22c4c4fd4733920e250
b22650fafcec2317100f53234ea01fb987f2a9d8
41698 F20110403_AACDKO wu_w_Page_070.pro
94ec16190315385a04e40bea0345d85f
2ea996d76013b6bd9e7a61506cf58efdd3227e9c
784137 F20110403_AACDLD wu_w_Page_010.jp2
e6e3502c4109e1c903f0b252e692e889
06b06908136c2a1a3a0e2c1ce612479ccb1f35c9
62457 F20110403_AACDKP wu_w_Page_013.jpg
bd3b4608cb2e8714500136ae2f2ac2f3
60d9d45576e46e32299674081f9864f9e7e05c17
36865 F20110403_AACDLE wu_w_Page_067.pro
30c157bb74e5f59b068ffe33b3e286d0
af3fa2c1e63d2b8bc123e3252bbbd5d660fde74f
159 F20110403_AACDKQ wu_w_Page_078.txt
4e589bcf14deccfee7ec68d09c390b6d
45279f828de5cc4241f150f2408710cdf50edb75
4907 F20110403_AACDLF wu_w_Page_087.pro
9a4865cbf2f13a1bf6e6f6ffa292cc72
6f76b5036b4bbd5fbe78ffb6b0b4498be0caaaa2
39920 F20110403_AACDKR wu_w_Page_077.pro
5e7dce19386b0f93f90a3450930ea60e
4ef2c7ce57bff7c1585cdd4b9cf2b81b68373629
113625 F20110403_AACDLG wu_w_Page_095.jpg
2b7261a94f88abcf960440d20db27b42
17548a9cdbf3da4eba3206437823fbf903a95404
2083 F20110403_AACDKS wu_w_Page_048.txt
84cd94fd6fc882ab3001796a94932760
6fcdf8d06571093b7d86aa3190cf2fad95d7b30e
F20110403_AACDLH wu_w_Page_056.jp2
28b46e18a40938065629aa1e96805558
412c820fb48f4e2ba77a8ee6fef0d954b3b17714
8507 F20110403_AACDKT wu_w_Page_044thm.jpg
05d099b8331399fc5beee67600e8e8b5
b78bd10cda1150b3e49817389df686182ba34912
F20110403_AACDLI wu_w_Page_030.tif
b977d3f04c880ad7cc27cc4a6065b8fa
e9abf49c90e619e54cb0d8aaabb6f15895c44292
31389 F20110403_AACDKU wu_w_Page_061.QC.jpg
333a9ef9f839c40093075e50570d70d3
e1603f82af89ba86de0049d9f941645cae0c683e
7439 F20110403_AACDLJ wu_w_Page_026thm.jpg
60b467c84c7d038a4a1071f795b24216
ed031e6c887ec6aef3fba937ff81b68944de562a
1724 F20110403_AACDLK wu_w_Page_021.txt
cf992f96c744debb5e2b6ace60bb05fe
103c89d6ca319d84e941200c3651702f540cbe92
61982 F20110403_AACDKV wu_w_Page_097.pro
13cf768e90304c6b4446bd43cc9a555b
67592553c865891e039a099cac6a4d52e6f6c8c8
8462 F20110403_AACDLL wu_w_Page_032thm.jpg
acfbbd02bf5a36140bfa10cb592dc33d
938c7541361f2675d257e3400c458d46566b990a
97042 F20110403_AACDKW wu_w_Page_071.jpg
8170f2f4169c597776e5e97088e533c9
5613f1df01e874ab11561f6271642a47aa6965f5
95595 F20110403_AACDMA wu_w_Page_022.jpg
dc06ce545db3ad9e3f31d0306efb10b8
178053e27dcb52835b443f44e85d1012d122a800
8807 F20110403_AACDLM wu_w_Page_099thm.jpg
d3db156637ce5cec275c117012cf0423
9927892be4792f279c967bc2a37a7ac3d3e91aeb
30043 F20110403_AACDKX wu_w_Page_079.QC.jpg
c920de3431cf9a1096db8636b31c8f31
2bd89c58cc00682f31bb278619889b9284ed46a9
36235 F20110403_AACDMB wu_w_Page_048.QC.jpg
28f044d9b02243cfce63c149879ec973
bb4487790cc799e9d2fc7a0c5ed4f49d2730adcc
7938 F20110403_AACDLN wu_w_Page_017thm.jpg
e31da364aef982bb9326a50e71dcf4f3
f0532472702f35b308869727762c133a4093a029
59263 F20110403_AACDKY wu_w_Page_096.pro
4812eb82f880ff531972e0f8101012b8
df5fffffdf07a8c5287ec1573e363f4e7099e408
43823 F20110403_AACDMC wu_w_Page_055.pro
300ac4578db007264f0f143b24acf6e8
1d80fa797f538f1fa1b9152dff4acc620f4445a1
50747 F20110403_AACDLO wu_w_Page_081.pro
566a3c714b6e2dd60cbdd67a31fe810c
186b12ac431f7208a324905946f1d19113234399
30024 F20110403_AACDKZ wu_w_Page_063.QC.jpg
2bc9a58d6b83c0c9944a0ebef311bc45
04fbca4913dcb70e5ec9f916fcc2f21f966047fb
1810 F20110403_AACDMD wu_w_Page_016.txt
b0604dc19d099cd0aedaaab3ee81f255
6b4b39512afd4885dbc4dc7369010ad607925468
F20110403_AACDLP wu_w_Page_076.tif
60b6034bc74d577b0be3cd1d22d9f6bd
0cebfe1019e40b4b252d5dedc3c9061f91ee0ee2
95796 F20110403_AACDME wu_w_Page_080.jpg
5f45d4c2da160f9cc2b2e1faf18e5d28
e558b6226db0ae79bce8ad762a1d5ebf54fa5e6b
43246 F20110403_AACDLQ wu_w_Page_069.pro
49660d74f1417dde125783f0a6c43277
a7e01836d93411a5a3c6c2fce07d818bba510a15
1886 F20110403_AACDMF wu_w_Page_060.txt
0fa7f65261721755bc208ddc01de69fd
afb8e4bff6583de71d7831148f2c78eaecafe151
2536 F20110403_AACDLR wu_w_Page_101.txt
cd27f3489caeb8234b58af19828c2b84
b62ac74a7c55ed238cc7b1369df0be595bfd958e
F20110403_AACDMG wu_w_Page_069.tif
1f1bf4d8c4187f974b037374194a4adc
147de3b92159ccbbf4f0c1ec63f69bc6b9042192
45589 F20110403_AACDLS wu_w_Page_016.pro
c4cc3247ba7807bc661c795e811c58e4
e8cf8e404c013a1a321fde786515595af9b21888
95357 F20110403_AACDMH wu_w_Page_065.jpg
db8599c1d03fb422cf51ab1987561bcb
6551b39d56cc353a2404e47a45cae1596414ea22
34943 F20110403_AACDLT wu_w_Page_057.QC.jpg
d2a349fa0bf82c71d4f6bb69901c115e
272e92d478eb78ff8162d4e8b91a31b3000e81f1
23033 F20110403_AACDMI wu_w_Page_001.jpg
f8c4b9daf3cf00e2885de3bd02e907df
019334a3068affdae827841d78b59adef1841505
F20110403_AACDLU wu_w_Page_092.tif
fe5299cbc8efc399934cf1e6cbffc663
2f3c9c8ae836325dfe9dde3f98c4042ed4b9d32f
849913 F20110403_AACDMJ wu_w_Page_039.jp2
4b4bfd3c43a3538f1ee7647ed946af65
f8642f893c9bfd494ea569bc3856dfd708e98bad
1813 F20110403_AACDLV wu_w_Page_061.txt
c8ab6598737f618e1943c141b70514c7
b59aacaf075c66dbc96f5b644ca363308dba1e27
61763 F20110403_AACDMK wu_w_Page_103.jpg
341bb405ef65490decb3b44615244289
6207498de3e761f1feea1cf0fe5666e2a7c201fd
52390 F20110403_AACDML wu_w_Page_072.pro
ef255e67b8ca6aa58ad8b0a7acff45c7
e3bb70abccbfc211a433e42a552be349f5cc2c48
F20110403_AACDLW wu_w_Page_103.tif
5ab82eea7fb8c77370d585d3752d9384
f687637db75c4b0a98ba84de0b25ee117ff82000
2559 F20110403_AACDMM wu_w_Page_097.txt
73293d6056b0ea8bcd94454eb36c8f48
f28af07bebb81a734b74ffcc11c009760cfa64f5
31197 F20110403_AACDLX wu_w_Page_019.QC.jpg
a58364a983d73fdf09362f3f1cf846e6
93fa523af996991771ec9f280b20fdc952d2f46e
45026 F20110403_AACDNA wu_w_Page_020.pro
b830c7305c72092f8823c59f887d1d39
ce7c53a7c7b868776da0b2b5c1c66bd14299fcdd
1874 F20110403_AACDMN wu_w_Page_058.txt
00d489f57efd62c3a6ab0c752877780b
e5d55d15f1175eee37649b8a24e312ed6417824b
5378 F20110403_AACDLY wu_w_Page_010thm.jpg
c1fa2ca118b97c539563755cf333d119
64d2eb0770d9ff8bff4b475a93ae42d8c3bf2192
30303 F20110403_AACDNB wu_w_Page_055.QC.jpg
ddc036bb55c92a068775a6b4e505d3c8
002889a536d4ebc6f91d92c34bd2b2756bc44709
860 F20110403_AACDMO wu_w_Page_003thm.jpg
2b45ef981079a4c191e9326492851da7
68f53ac7480fe4ccd33746c35b08af821a8da53b
105392 F20110403_AACDLZ wu_w_Page_040.jpg
a4ac6f17b85ed697ca53d33989249814
fd2f1faf1816034fddfe91f921a5a71471a86e69
7276 F20110403_AACDNC wu_w_Page_073thm.jpg
a83211e299587df797ffea83d47b7d50
164ef524c82e6f8c599c93b2f8d830db6341b59c
8031 F20110403_AACDMP wu_w_Page_064thm.jpg
8d150a33e6408710af40e994f01d2b38
a3cfe71dfcd38070846bd472b288cecc89969f37
73380 F20110403_AACDND wu_w_Page_035.jpg
a1722f8c210f4ac3a2184e9734c3f5f0
1d3d3a1d4bf289e358d94a0a8fa3dfadfd6950b7
35631 F20110403_AACDMQ wu_w_Page_097.QC.jpg
6ce58404a228eb6e05134069f4b4e450
bd067b60714bb4b52fa86b51173bf3dbbd0bde7f
56798 F20110403_AACDNE wu_w_Page_057.pro
ccc6574c6900a64c642283f18b80d4a6
4685f247da7999a3ed4d3514dfde8aab2cba5f1e
44130 F20110403_AACDMR wu_w_Page_079.pro
6c10a10590605bc3315d0e94be98b3a8
ced153120bea9be8fe64dd24386b28bf33e4b36b
F20110403_AACDNF wu_w_Page_046.jp2
17b5a5961b8294c26a009c3cc86ec743
d42dc1931aff9d38b96b829fe42ae4552f7a6fdf
946476 F20110403_AACDMS wu_w_Page_041.jp2
3122874eaff78307cda0a55153821cd9
d65154d96409cdb84373a672f365ff6f08b37056
6291 F20110403_AACDNG wu_w_Page_025thm.jpg
8e3784533809e8fe19102a390fc6a627
3dc5e2cacce877ee3fdb9c5c74a9963833a0b25f
1051918 F20110403_AACDMT wu_w_Page_053.jp2
fb344473c548ebee28010f1b835cdb13
047715c3a574eda047ede75e8d8dc1ef64b66c09
F20110403_AACDNH wu_w_Page_089.jp2
281300321f3b72f4b72ce33e37e0f6af
f1a9f7cdf7b2ce3874bc156c322039a024582899
F20110403_AACDMU wu_w_Page_030.jp2
a338312759d77806c95ccac1934d2ff9
ade8fe211c1dc459898f3690d3247265b4bd909f
60381 F20110403_AACDNI wu_w_Page_043.pro
aba5e95a3f5b5ccb16ba8f86f004afb2
c788da564a60ffc271af7f7672a0584ef8d6d682
48496 F20110403_AACDMV wu_w_Page_046.pro
a51d56324292aa85aef0c8713324fb75
48204ec2bb411916cb9679ec19a70c6d9eb8b602
1455 F20110403_AACDNJ wu_w_Page_025.txt
ecb4dff0cbfb097356dfc2752152143f
bd69555f2d8c59d34a5e94cad04dc71208780db7
36499 F20110403_AACDMW wu_w_Page_100.QC.jpg
9f42c98343f4bf4b4da205fe17132a07
2f0f9a6985be9cffaaf0ab66bb35bfc988e7c1eb
109915 F20110403_AACDNK wu_w_Page_048.jpg
6c8e2efb34122303bc72b34e2e5db1ce
6138cb644cfbb556b6ac80b45cce58214b8718e1
48029 F20110403_AACDNL wu_w_Page_030.pro
ba3bce9a80c039b2420d7e42068d4267
38ae596641ed738aa4911de616bf6e1283264d4c
92624 F20110403_AACDMX wu_w_Page_055.jpg
4df9b1d96ce088b00c3215b797ec7dee
a953ad837f0197418d06b09d650c220dea403315
7763 F20110403_AACDOA wu_w_Page_020thm.jpg
0a6e2c95a20465a9b2d774c5066a2801
b6576f33991b1acebeca9fce8b7e40f600646ebd
153788 F20110403_AACDNM wu_w_Page_102.jp2
a8d3cb40b9dcccd7ccadab84041ebc4a
f0c9ff69f4106eff924c4bf5ad684f04c2294868
F20110403_AACDMY wu_w_Page_089.tif
12969b7448920a767363fab93d7ff2c4
6268fba12fe059751b50ed70bca19a05d419709d
6596 F20110403_AACDOB wu_w_Page_039thm.jpg
1cb156f54d306d0d3cadb8654ee9d6b6
9232621dc7967a11c6c0f730dafb01eb1bc183ad
28308 F20110403_AACDNN wu_w_Page_069.QC.jpg
2413929edcf72c4b78e97b057865d171
352c712554aecd014a5cc4b6aac98c24f1646f03
30961 F20110403_AACDMZ wu_w_Page_080.QC.jpg
58433c4db52a7ccd3b8e8dbeb91c9e6f
cab64b6777abcda274b307a5c92c7255c62fbcf8
F20110403_AACDOC wu_w_Page_070.tif
22e3e316475e401ebba7235083e7345c
6b13170bbe6e2291602451a2bf6b5740d2533927
98084 F20110403_AACDNO wu_w_Page_033.jpg
09dde0ca2b69fbe62c50364290056674
ee13586be602739131a3aa86dc2c45497ca83061
1910 F20110403_AACDOD wu_w_Page_046.txt
3904f9109e0524a3d0dcde2f965fb10b
a9a3261ebb77d28d906c84f17676be65407e08f7
8439 F20110403_AACDNP wu_w_Page_034thm.jpg
10c1ec46c5bfad01a8a39038133380a1
2512a7f0ab0771d1e1dc4737b6a5d76ccbdd7466
1826 F20110403_AACDOE wu_w_Page_055.txt
5c004a73df064997fd8400a6fab35cdd
26c36a1fcc5c4088d15f7463169ff65421580758
2058 F20110403_AACDNQ wu_w_Page_062.txt
5513214b6eaefcef805d3449de324e4e
3ecebd6ecf2a345cabab2a2aa01e360e03ee8d92
1036925 F20110403_AACDOF wu_w_Page_018.jp2
3ab898a81e6aa1688ccb10e877001c3d
5aff1941030d64bc029b84fc6c6e63b67a1d54e6
1051959 F20110403_AACDNR wu_w_Page_043.jp2
18c9b0d3f2d83be1181e60144a414e2e
ebf4e4a6ea015277831f476339979da88ab798bd
21791 F20110403_AACDOG wu_w_Page_010.QC.jpg
b64e5e847ab662d84ded1016ac1820fe
f98ddf219598d4e0690d6b5ec878045d8b8f1fde
1125 F20110403_AACDNS wu_w_Page_054.txt
4d4a6491fc95c31a198c5e9a897798e7
40df251237a68a538b3d3dd428959f07d02c8865
106502 F20110403_AACDOH wu_w_Page_027.jpg
0aa7f3f8b05f82ee4c003aad5e655694
167da46398eca1f92563b58d49da86e2ee6a962f
7359 F20110403_AACDNT wu_w_Page_079thm.jpg
6432d21746732fa6ea9288665e19e3c8
64428820286f9c6f2f34a3e5e49f18cd514cf446
42073 F20110403_AACDOI wu_w_Page_068.pro
61addb94628aa5b63ced722602d2dfb9
073d1a6bd5feb126172e084aa662215a97170148
2042 F20110403_AACDNU wu_w_Page_076.txt
0ef1218859339d03d77d3d4f8633ca89
7b74f1541e9fce472f76fae815390f4ef14fa4bd
32849 F20110403_AACDOJ wu_w_Page_036.QC.jpg
e0bb1a30ab056514abd5d318de771233
6d0a82d1a784e39d1d3d59b772af835b7aa16058
34678 F20110403_AACDNV wu_w_Page_051.QC.jpg
096b6eb8b5c21454068e6cc970b9c0af
9a833b84d610204532c873feb4ddbd4f634da141
121249 F20110403_AACDOK wu_w_Page_092.jpg
f96f236cdd448b9efdd46188c9d8f252
492d974bf77bcfc9be32520cf4abb6dba9bd8b7a
7962 F20110403_AACDNW wu_w_Page_036thm.jpg
75219a9e9002b1387426ebe0aafa446d
f6cd827214e48c64cb1fdef5803a8ad18199e1d8
1051936 F20110403_AACDOL wu_w_Page_091.jp2
642bdd2ef3503d240b74710224f3d3c5
ad38c86c7459915acae04369f26a62b22aa6d6ff
33912 F20110403_AACDNX wu_w_Page_032.QC.jpg
1a33bedfc3e19f68accc168ab912ecbb
3245f7fcf2d7248a77e9cb69d283a89008f4ba94
46808 F20110403_AACDPA wu_w_Page_018.pro
bd9312e707900a3bf3bcd2d3263b8204
6aa4709521b44939791368319178e78c07e6df06
6774 F20110403_AACDOM wu_w_Page_007thm.jpg
0366fad824248620c770fc8f21d08fb5
b1015fe80c731857dcc6ba358000f6700d18dbfe
2661 F20110403_AACDPB wu_w_Page_093.txt
7d62a33f417e6336078b97e69a976ce1
ea00f9f191cfa777a4eeba0d741a799adf158512
7880 F20110403_AACDON wu_w_Page_063thm.jpg
137616e2d8912c50f1b703bbef60f89c
674dcd435bcaff61f5eda998b51950b93d96315c
F20110403_AACDNY wu_w_Page_090.tif
bccd54f375987dffbc89e6af91dfd6fd
4f28deda15b4d423a4095fe37bbdf2cba0b9dade
23079 F20110403_AACDOO wu_w_Page_005.pro
e4ca5d91f2f623020169df38b7965674
de54808873c066c8d80cfea838a9d838a27cd483
8086 F20110403_AACDNZ wu_w_Page_078.jpg
7fc74f20c88e8885836e0c95b2a1cbeb
c7a3bbcf7c6962ed901762cdf34ebbf2b6cb50af
F20110403_AACDPC wu_w_Page_080.tif
7c49c1b5138b6adc8e1d60ca2f02a2c9
b22209b67f93f730f816f1beedb98cf09d03d74d
76643 F20110403_AACDOP wu_w_Page_074.jpg
4113e7a7c17c1dc15b1a4b83382b50a0
2a940ab0dab4a04be8b1a3de026ab214f9fdc02b
1683 F20110403_AACDPD wu_w_Page_071.txt
7f83f63d6c2b0a5435c80eb5d362d0be
a6a1981ef3ce4421513830764da1b0e55cb77cc3
61202 F20110403_AACDOQ wu_w_Page_003.jp2
d45e1647896626685013085ea0af1afd
c681c9e38395757ca017c3212322a53c60c8b592
1007658 F20110403_AACDPE wu_w_Page_020.jp2
c568d6bd9e9453443c089da3b2aaf6cf
0a7c98c11fa8a10c007d410c35f235e6c827454a
49410 F20110403_AACDOR wu_w_Page_031.pro
d8dd0cd07c6954aefcc4c4af7012c9e6
5c63e6570f9535da89accbcf372f65b3b51dd1bf
12880 F20110403_AACDPF wu_w_Page_087.jpg
cb855b57bd7df534410f727605329b16
e8ac1ccd4e5a3167ce0431152de1696c93f5be50
2053 F20110403_AACDOS wu_w_Page_072.txt
793a9c2cd72e01b3018aea0baf55e7cb
2af02fa1ec8af7f4b646970c25d18cde8f3f6b30
26338 F20110403_AACDPG wu_w_Page_042.QC.jpg
023aa775c2190fbf475977c073c3a67a
6ddf01a53f658bd1cb35d156f6904cfb2c72fe7d
6991 F20110403_AACDOT wu_w_Page_102.pro
ec3273494a7537186577989e3f86507a
c9717605baeb723b712f163240ae2c9816732895
34581 F20110403_AACDPH wu_w_Page_094.QC.jpg
024c4bb40756f7f38eefba4f2f150fb9
306306065e4a265297d22b3f311ed631dfd422ff
51160 F20110403_AACDOU wu_w_Page_059.pro
fbd4f1b326ffa769ba7a745c16951d28
8f843077e84d287b6e5c90dc918f7e0bb189e6d3
816984 F20110403_AACDPI wu_w_Page_074.jp2
8b63fb594553b2dcd22a369f0781fbce
6b7489bb23645a88303ab06978d85b3b8de4246e
F20110403_AACDOV wu_w_Page_002.tif
34b90b3756183eb564cfa3faff08c777
1b8e380748132fc3f6deea5f58f1f26bad9815ea
51070 F20110403_AACDPJ wu_w_Page_049.pro
8c22c930dc6b2a5db658b0f7aeae17ce
6b7bb4e43f54285d10ab3401351c0bfd30ab923d
F20110403_AACDOW wu_w_Page_037.tif
9692eaa5c1961ee37a52c6fdd3e0642a
9ab56ac420fe52996997beea68c4a6490fce928a
61324 F20110403_AACDPK wu_w_Page_090.pro
8a8cef087a835e5ed04f5f1f61a7fc87
ee3eaaf698dca6c9728a6beb6080432670f4ab64
1428 F20110403_AACDOX wu_w_Page_002.QC.jpg
82ff192afec52ba5ea869be23241e7ed
b96b563f81f548887e0b06c8557db5175e2e85e2
61679 F20110403_AACDPL wu_w_Page_101.pro
97a62ba80b556c64a64b0bc5e23a2162
113a0b5a15feb9134959865e5d3d1bf0de633fb0
F20110403_AACDOY wu_w_Page_001.tif
498524b93bc50c2c43c96cfd884cc93e
daf4b722b086810b1ed3cdbd8f7a37e76fb2d947
F20110403_AACDQA wu_w_Page_033.tif
e336fc6ab8f46a829fcead3b075f4d39
9a8dbf972e10df1aa7692c0b9da1a484c94ad462
1020912 F20110403_AACDPM wu_w_Page_082.jp2
2a45c66c7bf43031fd601f9911facba8
c477debcd7cf6e05e773df567df4251c981515c0
8042 F20110403_AACDQB wu_w_Page_056thm.jpg
46b362ec8513cc7b5af5ee90881b9fe0
c7610548eacb707cd81204073bfa64a210286847
2438 F20110403_AACDPN wu_w_Page_063.txt
130e00dd8952855090f054e925bdcb0b
7d6f8602275cc8030cf88afb9ca4d5ad36d5fa64
F20110403_AACDOZ wu_w_Page_084.tif
aa9563e2ca1ca71eddf4af1ab21aa41f
cbdb40a565dcc689cc4cf270d3b067589d5b631a
8517 F20110403_AACDQC wu_w_Page_053thm.jpg
76f6c287420c22d838d1f5ec2b227ff0
db14d5ef8019a3403bc249cb1cf75abba0e4b639
2031 F20110403_AACDPO wu_w_Page_051.txt
dd37349ba32b7b38fe128a1fd698d5ba
3aa14f638143afae7d31b1195bad3b395ced0f31
F20110403_AACDQD wu_w_Page_086.tif
041ea85c7929ee4cb22f192849c996c1
b6529dfaeb55caa430b72e0b9c1dd785d5708529
1129 F20110403_AACDPP wu_w_Page_013.txt
178b31bc5bb75f01017fde34f480f601
506ff0d0643725d0a59d37cae015f289c8260730
90078 F20110403_AACDQE wu_w_Page_042.jpg
e03b5d5c6e68e2b76a021da4e1330fdf
c3c791b25b5d4fc485321f82f4c6b08ef3dbb559
1037 F20110403_AACDPQ wu_w_Page_045.txt
019169dfe2354876ec4f98685ed630fd
7313fdc9ec23f10347ed7bc2a1a36f23eae49ce7
F20110403_AACDQF wu_w_Page_045.tif
18f720bb1d8606948147924932d93995
0b0ea7ebdbdad27e6b83a6540fc5671513887bd9
93213 F20110403_AACDPR wu_w_Page_084.jpg
2792f8c7a8d3c417036e0f92e3d17671
ed0f0fb2af99b01194637b09f942d21301aac370
40095 F20110403_AACDQG wu_w_Page_012.pro
c4ec27640734bf1b07627019fdffa71e
7953c00a97bfb2a99bd638d611aa15c6603a6d2f
1051977 F20110403_AACDPS wu_w_Page_057.jp2
5fa459c6238ca3530629ea79fae71df7
9b906f819dea7776e8104d1d2aa3398743d72194
60373 F20110403_AACDQH wu_w_Page_045.jpg
cbb42a6874b1b3982b5824b846db4bdd
862bacf1ef2116a1034625e557e32d815481aeac
F20110403_AACDPT wu_w_Page_011.QC.jpg
a4619b3c978627fbef70e7cee1f91614
868a8ba92e1b862abf03779b5ad359fbdb41e393
650864 F20110403_AACDQI wu_w_Page_103.jp2
958a33366efedc96e9eb1155370e2eca
ef20b68b52a6066ab92794f34b35466c3f2cc5e1
989 F20110403_AACDPU wu_w_Page_009.txt
04d06361e9b5d1a55cf63e4982e1df18
ed0780c6ae702a174e2eebf67c1e0121d52d5286
27214 F20110403_AACDQJ wu_w_Page_050.QC.jpg
b006adbe461114863423f06798ad01f0
22c651d7a983e759ddde885e583a31fdca27b5c4
31810 F20110403_AACDPV wu_w_Page_095.QC.jpg
2eac0efb33edb70d6b4d05fb1779af0f
c5647259a2cf06fe6964930a5c58eb4903afae0c
F20110403_AACDQK wu_w_Page_010.tif
e15e21abcd26e640b8d0ab3c3728b7ee
9035d1e26594f70ce602fff96cc7297fd94066d8
120460 F20110403_AACDPW wu_w_Page_057.jpg
c510e422f9a216d2fff93411f82343f7
e450598cf41d4afeaa05fab4a756e24443b93303
8533 F20110403_AACDQL wu_w_Page_048thm.jpg
b5b91483af3664f412f2f908670a4401
0c9eaeccd102c9c84ef319c8ceef90ba68ecef71
F20110403_AACDPX wu_w_Page_097.tif
62bbe8732ce80088a254bf82a3daf2e4
87f924fc2d5d714aaf57f35ca09855b9b76db6aa
F20110403_AACDRA wu_w_Page_082.tif
98608129a8dc6ddaeac59543a0c62791
22a4d81a2654fbc94759b521a2c3d085265a8f64
106535 F20110403_AACDQM wu_w_Page_028.jpg
1ab39d7e9d6005f7f7c0d099cb9919a7
68cab94af292ccd612936213f3e8488a37ceca2d
F20110403_AACDPY wu_w_Page_095.jp2
d4a79481f8b5b40f50041d9dc1f27b1f
e37a23e3f928379004627e47b8a1b5e294f42945
1051984 F20110403_AACDRB wu_w_Page_059.jp2
6ae5f24b79cc8e932be68bb32f72f1ed
f118b1cb12928610a95b13bfda380fc7874cb27e
7982 F20110403_AACDQN wu_w_Page_040thm.jpg
dfe9abfb9a55cfcde966f4402489f0bd
ab00f57ba0d8315ad8c09874795985c605c468fe
50149 F20110403_AACDPZ wu_w_Page_053.pro
270efead032efeea39a0e04a59a9b6a4
4603e853a69f53a81a09cea297ee54b52d5ee0bc
95003 F20110403_AACDRC wu_w_Page_082.jpg
7196001410a3e70b0969aa890a88f8fc
29d7308135fcaa650ddb8cc188af788f8fee560a
110263 F20110403_AACDQO wu_w_Page_087.jp2
a3b76d7b843de33dfb2c48bbc7f40268
2693dcbdd9400e5b72c06774678ebf71edf2b51b
F20110403_AACDRD wu_w_Page_018.tif
42d3ea45a581cbd76dd4f5daaefdf25a
6b1c6dc539f062f5bb41d6d576d5ac6b523f434c
16998 F20110403_AACDQP wu_w_Page_005.QC.jpg
29a1892aca34c153f27dc05b413fb2cf
e49bfdf78964ab8e82e8a77700d591e14fedd7df
129288 F20110403_AACDRE wu_w_Page_100.jpg
eba424282202069a9d58b90b221b6aff
b9e5466c175a3fad514a652a49384a7e1a3ab860
1807835 F20110403_AACDQQ wu_w.pdf
8baecbfc4a87faefc299428bbb06eb23
5edc49c03ce0966acdec1ece65288929f0169663
1749 F20110403_AACDRF wu_w_Page_012.txt
bd4de1c1f4b6f9021d5e062a0cb6e12b
cbed2ce5fdcacdd8e58089f6b6069d086f85c5c8
1864 F20110403_AACDQR wu_w_Page_080.txt
4d557cd7222e5ce1b916c7a014c6f007
813ca2251507d4e7284f143fc4d2b67f202a01fb
662956 F20110403_AACDRG wu_w_Page_013.jp2
4cffbf7863cdb275d94e4d115c7d31cb
1572a0646afb6dd0344315a564afc43cfe946f47
F20110403_AACDQS wu_w_Page_020.tif
36ff9425eb7723f27e432a6465b13403
3ffcb970ccbdf3fb70a0c601bbb8f3ecee9e3e3c
23642 F20110403_AACDRH wu_w_Page_009.pro
ff87830838b6c25eb7f579d5937ac92b
0d9fa136ad2902efbcc8b79d0cc730c14ee78415
33939 F20110403_AACDQT wu_w_Page_024.QC.jpg
9a4ffbaaa87b4a48ad184f2c880d5d5f
e6152a28374fd911307ef7a88a13dae416579e30
39499 F20110403_AACDRI wu_w_Page_004.pro
c955eb221d4ce99efb90c32ae170263b
97c8c410cb96e1d53c6e003af6ded15011350f72
2269 F20110403_AACDQU wu_w_Page_057.txt
59205da3bc2b664eafd6d9959a2f868e
712bab0edaefeac5ca73825fa85e1f7a3048b3ba
50191 F20110403_AACDRJ wu_w_Page_034.pro
2f23a0db3dcd31ae19dabc8d1c19e7fd
fb042ebcbbec8e09b1f4ddeb199f5f248bd0aa6c
827429 F20110403_AACDQV wu_w_Page_047.jp2
f14897391186771afa931d600804bd88
f78345760365a9710caeffd972676cb3700c5618
1865 F20110403_AACDRK wu_w_Page_067.txt
eb14b667fe12b21b8b799eade118deaa
49618aae9bd3b012a96002036ed9c69ceeae10c2
F20110403_AACDQW wu_w_Page_048.tif
db9695ea28715b69e969ba4f9edf0687
16f93e7f2ce9c015e9c63bb664faf6f2f5751be1
1051931 F20110403_AACDRL wu_w_Page_076.jp2
a4f7826bf9cf083c0c3cf57023a4dc8b
d84bba632eb4953bb2176ab4d33711b37ee1b4cd
F20110403_AACDQX wu_w_Page_034.jp2
68f2c7be8d9bf6a1cdf851d49a7717c3
d42a2c3987b664989e239614b78751a22f2e91f1
104376 F20110403_AACDRM wu_w_Page_052.jpg
fda69823549157c99805f5ab4af27298
fcd07c79c8988410c61598c2c815d107c710748d
7653 F20110403_AACDQY wu_w_Page_088thm.jpg
3f8d44007f6b21d64f91011d6377d001
f83b64e52739b5df34b54b7e86955e2ba511b93a
32725 F20110403_AACDSA wu_w_Page_098.QC.jpg
14e677cb22f637e3dda81bfefd50b499
83527df5731ab70c095aba6b6ce2fd9b241ee87d
36466 F20110403_AACDRN wu_w_Page_066.QC.jpg
38f5a24e230a593089dedd56238f266e
0fd701205173ffff1b49bf78c5e6ef8f86bdd9a1
F20110403_AACDQZ wu_w_Page_081.tif
c4f28f2c3a4344224de0ffb8cf9fe18b
e956e9666fe44dbd7eccd3ab84bdc2374ef028c2
51284 F20110403_AACDSB wu_w_Page_066.pro
96024b6c71cfa817af20d87e65aa3260
58481abb8ec88b2c079b8b9ea30e65c27cfa1e7c
102929 F20110403_AACDRO wu_w_Page_086.jpg
6d752c6550fd008cc39602b04641ff93
ac19b36f259290ca0f0b1ed59732dc71d815f6f1
9590 F20110403_AACDSC wu_w_Page_009.QC.jpg
5aa2a5634e92d92606c2a704c799e956
f8b95477a8ad5962daaeba4315e7604d2494871a
F20110403_AACDRP wu_w_Page_011.tif
b60f57784e66ff62f5672d81f9198b50
b043dec442ce69bbabef49a750b630d52f117e5d
F20110403_AACDSD wu_w_Page_057.tif
5cfcb16c1749a51f0c535a5782b75b3d
dd36b95229713515ce4d8fc39c5d3416413d220a
122790 F20110403_AACDRQ wu_w_Page_096.jpg
d32c0f2bcc2d2ac8ea11e55ce8da6467
6a4dba22b4213167b6a745dae1f5ea2a2b53fa69
7858 F20110403_AACDSE wu_w_Page_038thm.jpg
84016117a502695b80a6df349feec0c2
dd42f02fe67d8afa79892adfe17e2649d46e3d77
1023592 F20110403_AACDRR wu_w_Page_017.jp2
1f8fbc249d3c509686e120188a702a0a
d3bbb5d1f41f052936941f704ba98446fd7ad2ca
33865 F20110403_AACDSF wu_w_Page_076.QC.jpg
d0b44e5cc8dcc29d96e9d608c3265bc6
76982a340aa7e4cbea244e52490475698e665b80
33850 F20110403_AACDRS wu_w_Page_096.QC.jpg
d05dfcbd5e358d2e3b8a56fb291065ef
ec40886bb94d1be9484f7246a04828f1219c226c
1767 F20110403_AACDSG wu_w_Page_015.txt
ae90b5e330d0010340acb96d7d93c24e
9d3bbfd4597624b6570ea87d3d533d8e3c827ee3
83906 F20110403_AACDRT wu_w_Page_047.jpg
85d082a815ff2f768cacdfecf1debb83
2cdc6c5f3370b76a11e018f6d9f23160c2d0f2be
F20110403_AACDSH wu_w_Page_064.jp2
62548510b60ca01cef85382e36c41ba9
5cdbbd38df4f86188ad967c0e363b89017437e39
16636 F20110403_AACDRU wu_w_Page_006.QC.jpg
4bf8cc1d98684f76c0509b0e2bdf8343
79611aa57c7f1ae9154316fe823d265ebd5151fd
2010 F20110403_AACDSI wu_w_Page_066.txt
621216b630f12e7c520a5cd18db41711
7c67e7693f60760f2c4d46db38130ba8b311f095
22695 F20110403_AACDRV wu_w_Page_025.QC.jpg
7a34ddb2c4b40957ce76e22a6b4459ee
2114336d3b214d2fa3660b504fa0383c9c803562
F20110403_AACDSJ wu_w_Page_017.tif
ba8745d60a8ae05d96897586a90e0ccd
e0b3ecd23f269bd7e78af780290eb20d2bf0d775
103682 F20110403_AACDRW wu_w_Page_053.jpg
864e51a437617a49d7932d22714d4f6f
fc7521f37cdb4ac619b220b36668e04e98667309
2024 F20110403_AACDSK wu_w_Page_001thm.jpg
1b38cc1a0d2b2f81d303c9e6a0429fb6
253ee39b2f474bde802cd407ae30e3d1363c0aef
2474 F20110403_AACDRX wu_w_Page_094.txt
19f492578d5242c205a4b88974998332
0fb0affb1e2e34c393f4f45dbba9063adebe8462
46172 F20110403_AACDSL wu_w_Page_084.pro
fcf2800d30e94460391f824dba34afac
d14f5e12ae21b0366bd8f899f1cf916f4819ab08
F20110403_AACDRY wu_w_Page_087.tif
362988f430560a08a447cbaa21f38450
5d7c5640363c7290e0028095ebea3a6220c77bc3
44619 F20110403_AACDTA wu_w_Page_061.pro
aed38b40a422404a7f9657cd3153b5ba
0e362a0b8a6ab4fd4426c0c65338410ff9daa781
28243 F20110403_AACDSM wu_w_Page_015.QC.jpg
b2ef879f9b62d1fe1a9902c31625eda8
b3bc9ab2edbd379e0ffcc38628cf4002c7628fc0
F20110403_AACDRZ wu_w_Page_043.tif
22c8aeb7719795081cd75c16eab500d2
648d506798deb0d25ab80e34f88903eb049f05d9
9332 F20110403_AACDTB wu_w_Page_011.jpg
72106055200bbf2afa33fca6b2c6d496
ef8d2962d37a10ceb0256e534f72309c5468cc88
32114 F20110403_AACDSN wu_w_Page_059.QC.jpg
25412c1fad18fb4cdbf27ec2ad6ddb25
53648a4deb0899349bce9e2753963a916b9b7fa1
F20110403_AACDTC wu_w_Page_035.tif
2073fdb2ae163abd1300103b2f103d08
9663d400996be76fd2f93e687e622ccb67807d42
33891 F20110403_AACDSO wu_w_Page_034.QC.jpg
94fd8cb276c376b20c4cdfb1eb6d905d
1ef9a490c90505f76dfbd82400c03df7b325f8b6
2233 F20110403_AACDTD wu_w_Page_029.txt
8484595090929ae830635bf4d9a1abad
445efc0ab43686508d9f215af14ff746812d05df
2556 F20110403_AACDSP wu_w_Page_090.txt
02899603e4ed5a1ec8c9844f30baacf0
d9cb2642ee893684f86c2bd099ed9bd9008448f3
74103 F20110403_AACDTE wu_w_Page_010.jpg
e5488bfdf6eabff6eb5689c4fac15bd6
ac9b002ccd9ee737d0ed59d4cbe897fb588f9a29
34012 F20110403_AACDSQ wu_w_Page_058.QC.jpg
16a3dafae20e8af7ebdcd2741c8695ef
4acea85bf7ee6ddb6a0f22fda7ac10012cbbb375
22617 F20110403_AACDTF wu_w_Page_083.QC.jpg
ef747e993f45aa8badcebfe415f744ee
7d271296081548fba1fad36baf7388b608adb5e9
8696 F20110403_AACDSR wu_w_Page_072thm.jpg
aa9170ac0ffc4262d3e540cd225892db
e717fb7acf58edc9e36358d8c6b43848ae07420b
29253 F20110403_AACDTG wu_w_Page_035.pro
829a31767dcd72788d6227aac3f24939
31c27a6cd00b6e3e11361fcb65e73ea352d5bb73
2128 F20110403_AACDSS wu_w_Page_038.txt
e1739f1b6ff919027046d30667e86d11
ea1d99afdbcf38b271dcd9dd4ef0f4a536e3aeb8
F20110403_AACDTH wu_w_Page_063.tif
e3fe65691e7b1ce78cc1c250f5307a3b
03192e38d7d86b5a3e2d4d7c5cb8677aa1df344c
F20110403_AACDST wu_w_Page_060.tif
b5b8d524f3191d88f0c4e96b52d1814e
f9939ffdbf4038e670f7a3bb3372f36cc53e7769
105223 F20110403_AACDTI wu_w_Page_058.jpg
5eaa8b88cb44026b841fb629fc37e445
0f3fe701a769cd73cb5b46073ab8e984a2c97dfc
8973 F20110403_AACDSU wu_w_Page_097thm.jpg
7fa66e2746aba1b82757539321981295
5ee29b62f38d13e70174b1fbc00ce49aeb95bcd4
39021 F20110403_AACDTJ wu_w_Page_039.pro
5447a4ecaeae23c1915ba53d2b4c758b
f804c5d277c55878a7d80106b8cf1e93efd3727a
48588 F20110403_AACDSV wu_w_Page_063.pro
e14f9b1711fc0b53be42455514db5a95
a993b3c05282e8e2d8557f51f6342503cd3b9eb8
34571 F20110403_AACDTK wu_w_Page_093.QC.jpg
3304186e1ac701c5f5448965e2421320
e92ae5c0a68a7c479bb67d2c0bca849ad17f84c4
2100 F20110403_AACDSW wu_w_Page_059.txt
2a44c71159a43acaece5c48682e4cf68
b3878c7b06460afc762625102c0ef40d7356ee18
133312 F20110403_AACDTL wu_w_Page_089.jpg
7576b99a26e293583a140ec03d0f239b
268092cb5fa2ffad6405e86281d2ed3feb68046a
31798 F20110403_AACDSX wu_w_Page_033.QC.jpg
e3d4d42a6005768c92f98f4f7f6a4f20
462d99c452100318721221b285f4fc490ec0cf9d
47962 F20110403_AACDTM wu_w_Page_060.pro
7fb2efa4a17e6073bc23a6162e7f66ed
702f872ca973477b6e9256b3503dc271c4c3dfcd
880046 F20110403_AACDSY wu_w_Page_014.jp2
13f809d219db5401c0cdc184e9568008
904f0475ca0bea641476e88e5727647900ea1d5f
F20110403_AACDUA wu_w_Page_009.tif
31572b64d9a2b61fbc82044ca1ee67b8
b691cbda10743f6ae9d87a00cc970a1e413582eb
F20110403_AACDTN wu_w_Page_078.tif
f1ed37e6619621e9b160779349e731a2
aa672184a27ce21816b3c669b2c2184f41625796
28179 F20110403_AACDSZ wu_w_Page_054.pro
620742c416d2f4f204a7b69b38e1d003
163215e35f8778bc82092d54aabf56bd9b98c1b2
F20110403_AACDUB wu_w_Page_012.tif
bb32ec1d87910ba8622cdcb437a240ad
f9dd856b4f1ea559e042169ec9e10bd358b720bd
31045 F20110403_AACDTO wu_w_Page_029.QC.jpg
c1b2dfaadee21e4e914debc3f3b01903
69de229d1d60ef26cec375e34b59f210ee078bcd
F20110403_AACDUC wu_w_Page_014.tif
6545a8b67604d9e5db3b1141cdb29384
cdd2c987f68ccb0bed7d69abef120566335c93fd
38447 F20110403_AACDTP wu_w_Page_014.pro
aab53fe17cb0ce487fc989171062338e
139492d5c5453a37d56892492bc258bd5a5b2061
F20110403_AACDUD wu_w_Page_019.tif
3df6cd2ceeefd8a219e69aa7975edd29
54c48d1bcd7f21709042bd4cb53ef023e9003f77
8600 F20110403_AACDTQ wu_w_Page_051thm.jpg
6c1ea6c74161a76be448172b6bd92fb6
2f55a3b01064fa0581da3b9e4c90a1aa24542ac7
F20110403_AACDUE wu_w_Page_022.tif
d1ebfeec6192eb01eca3a42395a6c038
82fea42a9fe7c35af7fb1eb78aaddaa7b38b9c80
8845 F20110403_AACDTR wu_w_Page_066thm.jpg
a22e97a15c16d7d1f7efdcdb2160dbc4
a3c0a3c045825aa8a248d37dc37ea3eaad2f3379
876018 F20110403_AACEAA wu_w_Page_023.jp2
a2c9b9ce7392e24fc4e9f01a3afb4602
d31a06deae92fd311cf530b8d12e8649a8736a00
F20110403_AACDUF wu_w_Page_023.tif
7e2dc003906cbafe007962dca200601a
786ea26c98c9037843b1bcdbd1591d71f427ec96
7616 F20110403_AACDTS wu_w_Page_029thm.jpg
00b1c6004b4dcdccd38e4ee8033859a7
b77506b9cf9a33c32e855d0f5b4c3d7e6fa6ae1e
718898 F20110403_AACEAB wu_w_Page_025.jp2
91eb3d7e56ab1485c4bf36d427be2f93
bfa237a72614f2c6540f7bc04772e40315d77713
F20110403_AACDUG wu_w_Page_024.tif
6e497264640ada0148012d8b4b430fae
627b733c50bb8224ff650bc2976e9037179d7f1f
119980 F20110403_AACDTT UFE0013501_00001.mets
337d3aded0c179b6d459774cbbee6f79
424e6ef17b121ee96c961b2ce55edfdc28cd7e1d
1000089 F20110403_AACEAC wu_w_Page_026.jp2
fa48b253d791ccd94d5e8f0dcd91654f
99fb37bbcaa99a1eae65ffd92d17867f4aaf97a5
F20110403_AACDUH wu_w_Page_025.tif
c60365528bc4fe55233397769358d53e
f3c2f4496e2e277e393fcd4c718b71e3a0162eb9
1051950 F20110403_AACEAD wu_w_Page_027.jp2
5627b50a38fcb8ef5818b506bbea3562
57f738ec6550d63661086719f56442ed8e4b19d6
F20110403_AACDUI wu_w_Page_026.tif
031a11549802ec72b3ecb9982c76f548
bb627e170ad9c852ff68552df42fd21fe2853acd
1051777 F20110403_AACEAE wu_w_Page_028.jp2
69f8c823e7f313dc37c3e360992c42a5
e5971469836be8630f5aefa514327c2bf105bf14
F20110403_AACDUJ wu_w_Page_027.tif
4678ce972a2533924378f4b02d12f85c
f874791adda281cee44b9dc2425f906a09b406cb
F20110403_AACDTW wu_w_Page_004.tif
67f86cf71ac106bf9bc89c16af4c96ae
78343a1c08fb3e7591f33228d1048f6eb6e32ba9
1051974 F20110403_AACEAF wu_w_Page_029.jp2
ee0f2b2071e07bee58dee8b1957ca969
40b4da206f4d1dffb8b6d5a43d54c53a0f3076f6
F20110403_AACDUK wu_w_Page_028.tif
999b36f0c8fbfc2855d5f01cb6943748
0864078242e07f39448034ffaa7f516c4d103450
F20110403_AACDTX wu_w_Page_006.tif
66f3d7ff18e8aeea4f227a4744b22b54
5f45efe3cb4d9767f66598b9a6f6d6a77f9115fd
F20110403_AACEAG wu_w_Page_033.jp2
73049b406ef7a74c86d875613e345015
875a41396ba43efe640ebddb09d834e504580a84
F20110403_AACDUL wu_w_Page_031.tif
a4beb77dc403d552f08beb4908da4283
d62361c4daa68bec762bfbb531743140e6d31ac6
F20110403_AACDTY wu_w_Page_007.tif
4c04833a4bfd34ae456836506f0a9fee
b0cd285c6a57110e69db4c5f61137923f6bb5a5a
F20110403_AACEAH wu_w_Page_036.jp2
052c665c7ff87c87ae25227c985ed626
87cf3537a587f4b3be6cb7e5e817def28fb3df3d
F20110403_AACDVA wu_w_Page_074.tif
576ca82f8f538c7b6887a865afd35248
2f8d343673434e31ec3e120aee24bef81aa3caf5
F20110403_AACDUM wu_w_Page_032.tif
92c992d7138998f405770502e3c5b0a2
2a249a8039ebfac9deda2ad43675ec3e8c9afc95



PAGE 1

REGULATION OF THE TYPE III SECRETION SYSTEM IN Pseudomonas aeruginosa By WEIHUI WU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Weihui Wu

PAGE 3

This dissertation is dedicated to my pare nts, Liuting Wu, Hong Wang and my wife, Chang Xu.

PAGE 4

iv ACKNOWLEDGMENTS This work was carried out at the De partment of Molecular Genetics and Microbiology, College of Medicine, Universi ty of Florida, duri ng the years 2001-2006. It is my great pleasure to thank the followi ng persons who have taken part in this work and thus made it possible. I owe my deepest thanks to my mentor Dr. Shouguang Jin. His encouragement, support, and enthusiastic attitude towards res earch and life in genera l have been inspiring and have guided me during these years and have been more than I could have ever asked for. I greatly appreciate the opportunity to be part of his research team. I would like to sincerely thank my committee, Dr. Shouguang Jin, Dr. Ann Progulske-Fox, Dr. Paul A. Gulig and Dr. Reube n Ramphal, whose insightful advice in the last 4 years has made a great difference in my research progress and in my view of being a serious scientist. Far too many people to mention individually have assisted in so many ways during my work. They all have my sincere gratitude In particular, I would like to thank the past and present members of the Jin labor atory, Dr. Unhwan Ha, Dr. Mounia Alaoue-ElAzher, Dr. Li Liu, Dr. Jae Wha Kim, Xi aoling Wang, Dr. Hongjiang Yang and Dan Li, for their help and advice. Especially, ma ny thanks go to Dr. Lin Zeng and Dr. Jinghua Jia, who have given me tremendous help in my life and research since I came to America. I am also grateful to Wei Lian, M.D., fo r her help and suggestions these years.

PAGE 5

v I would like to thank Dr. William W. Metc alf of the University of Illinois at Urbana-Champaign for providing the transposon plasmid and related E. coli strains used in my work. I would like to thank Dr. Shiwani Aurora from Dr. Reuben Ramphal's lab and Dr. Hassan Badrane from Dr. Henry V. Baker's lab, who have contributed to my research and offered valuable t echnical support and discussions. My final, and most heartfelt, acknowledgmen ts must go to my family. I want to express my earnest gratitude to my pare nts, Liuting Wu and Hong Wang, for their unconditional love, encouragement and for always being there when I needed them most. My wife, Chang Xu, deserves my warmest thanks She is the source of my strength. Her support, encouragement, and companionship have turned my journey through graduate school into a pleasure. For all th at, she has my everlasting love.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES.............................................................................................................x ABSTRACT......................................................................................................................xii CHAPTER 1 INTRODUCTION AND BACKGROUND.................................................................1 Pseudomonas aeruginosa .............................................................................................1 Basic Bacteriology.................................................................................................1 Infections...............................................................................................................1 CF Airway Infection by P. aeruginosa .................................................................2 Antibiotic Resistance....................................................................................................2 Acquired Resistance..............................................................................................3 Intrinsic Resistance................................................................................................3 Multidrug Efflux Systems.....................................................................................3 Virulence Factors..........................................................................................................4 Flagellum...............................................................................................................4 Pilus.......................................................................................................................5 Extracellular Toxins..............................................................................................5 Quorum Sensing....................................................................................................6 Iron Metabolism....................................................................................................6 Alginate.................................................................................................................7 Biofilm...................................................................................................................7 Type III Secretion System............................................................................................7 Function of TTSS Structure Genes........................................................................8 Needle structure genes...................................................................................8 Pore forming components..............................................................................8 Polarization of type III translocation..............................................................9 Effector proteins.............................................................................................9 Regulation of TTSS.............................................................................................10 Other TTSS Related Genes.................................................................................11

PAGE 7

vii 2 MucA-MEDIATED COORDINATION OF TYPE III SECRETION AND ALGINATE SYNTHESIS IN Pseudomonas aeruginosa..........................................13 Introduction................................................................................................................. 13 Material and Methods.................................................................................................14 Bacterial Strains and Growth Conditions............................................................14 Construction of Tn insertional Mutant Bank.......................................................16 Determination of Tn Insertion Sites.................................................................... 17 Generation of Knockout Mutants........................................................................ 17 Plasmid Constructs for Comple mentation and Overexpression.......................... 18 Western Blotting..................................................................................................19 RNA Isolation and Microarray Analysis.............................................................20 Results.........................................................................................................................20 Activation of the TTSS Requires a Functional mucA Gene................................20 Microarray Analysis of Gene Expression in the mucA Mutant...........................25 TTSS Repression in the mucA Mutant is AlgU Dependent................................ 31 AlgR has a Negative Regulatory Function on the TTSS..................................... 33 Discussion and Future Directions...............................................................................34 The Expression of exsA in the mucA Mutant....................................................... 34 The Regulatory Pathway of AlgU Regulon......................................................... 35 The TTSS Activity in P. aeruginosa CF Isolates................................................ 36 Genes Differently Expressed in the mucA Mutant and Isogenic Wild-type PAK..................................................................................................................38 3 PtrB OF Pseudomonas aeruginosa SUPPRESSES THE TYPE III SECRETION SYSTEM UNDER THE STRESS OF DNA DAMAGE............................................ 42 Introduction................................................................................................................. 42 Material and Methords................................................................................................43 Bacterial Strains and Growth Conditions............................................................43 RT-PCR and Quantitative Real-time PCR..........................................................46 Cytotoxicity Assay..............................................................................................47 Application of Bacterio Match Two-hybrid System............................................48 Other Methods.....................................................................................................48 Results.........................................................................................................................48 TTSS Is Repressed in a prtR Mutant................................................................... 48 Identification of the PrtR-regulated Repressor of the TTSS............................... 49 PA0612 and PA0613 Form an Operon Which Is Under the Control of PrtR..... 52 PA0612 Is Required for the Repression of the TTSS In the prtR Mutant........... 53 The Expression of exsA Is Repressed by PtrB in prtR mutants........................... 57 PtrB Might Not Directly Interact with ExsA....................................................... 57 Mitomycin C-mediated Suppression of the TTSS Genes Requires PtrB............ 59 Twitching Motility Was Not Affected by the prtR mutation.............................. 61 Discussion...................................................................................................................62 4 DISCUSSION AND FUTURE DIRECTIONS.......................................................... 66

PAGE 8

viii The TTSS and Environmental Stresses......................................................................66 Repression of the TTSS under Environmental Stresses......................................66 Indication for the Control of P. aeruginosa Infection.........................................67 Regulation of the TTSS under Environmental Stresses......................................68 Expression of ExsA.............................................................................................68 Transcriptional control.................................................................................69 Post-transcriptional control..........................................................................69 Transposon Mutagenesis............................................................................................71 Mutagenesis Efficiency.......................................................................................71 Characteristics of the Tn......................................................................................72 Screen Sensitivity................................................................................................72 LIST OF REFERENCES...................................................................................................75 BIOGRAPHICAL SKETCH.............................................................................................90

PAGE 9

ix LIST OF TABLES Table page 1-1 Regulation and substrates of multidrug efflux systems.............................................4 2-1 Strains and plasmids used in this study....................................................................15 2-2 Expression of AlgU regulon genes in PAK mucA22 ................................................25 2-3 Expression of TTSS-related genes in PAKmucA22................................................27 2-4 Genes up regulated in PAK mucA22 .........................................................................28 2-5 Genes down regulated in PAK mucA22 ....................................................................30 3-1 Strains and plasmids used in this study....................................................................43 3-2 PCR primers used in this study................................................................................46

PAGE 10

x LIST OF FIGURES Figure page 1-1. A model of the regulation of ExsA.............................................................................10 1-2. TTSS related regulatory network...............................................................................12 2-1. Expression of type III secretion genes in Tn insertional mutants of mucA ................22 2-2. Expression and secretion of ExoS protein..................................................................24 2-3. Expression of exsA :: lacZ (A) and exoS :: lacZ (B).......................................................32 2-4. Expression of exsA :: lacZ (A) and exoS :: lacZ (B) in algR mutants............................34 2-5. Proposed model of MucA-mediated co ordination of alginate production and TTSS expression......................................................................................................37 3-1. Expression and secretion of ExoS..............................................................................50 3-2. Genetic organization and put ative promoter regions of prtN prtR PA0612-3.........52 3-3. Expression of PA0612 is repressed by prtR ...............................................................54 3-4. Expression of PA0612:: lacZ .......................................................................................55 3-5. Characterization of ExoS expression and cytotoxicity...............................................56 3-6. Expression of exsA operon in prtR mutants................................................................57 3-7. Monitoring of protein-protein intera ctions by the Bacter ioMatch two-hybrid system.......................................................................................................................58 3-8. Effect of mitomycin C on bact eria growth and TTSS activity...................................60 3-9. Twitching motility of prtR ptrB and PA0613 mutants..............................................61 3-10. Proposed model of PtrB-mediated TTSS repression................................................64 4-1. Structure of the exsCEBA operon...............................................................................69

PAGE 11

xi 4-2. The secondary structure of exsA mRNA 5 terminus. The sequence was analyzed by mfold...................................................................................................................70

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF THE TYPE III SECRETION SYSTEM IN Pseudomonas aeruginosa By Weihui Wu May 2006 Chair: Shouguang Jin Major Department: Molecular Genetics and Microbiology Pseudomonas aeruginosa is an opportunistic bacterial pathogen which primarily infects patients with cystic fibrosis (CF), severe burns, or immunosuppression. P. aeruginosa possesses a type III secretion system ( TTSS) which injects effector proteins into host cells, resulti ng in cell rounding, lifting, and death by necrosis or apoptosis. By screening a transposon insertional mutant libra ry of a wild-type strain PAK, mutation in the mucA or prtR gene was found to cause repression of the TTSS. Mutation in the mucA gene causes alginate overpr oduction, resulting in a mucoid phenotype. Comparison of global ge ne expression profiles of the mucA mutant and wildtype PAK under TTSS inducing condition confir med the down regulation of TTSS genes and up regulation of genes involved in the al ginate biosynthesis. Further analysis indicated that the repres sion of the TTSS in the mucA mutant was AlgU and AlgR dependent. Overexpression of the algR gene inhibited type III gene expression. PrtR is an inhibitor of prtN which encodes a transcrip tional activator for pyocin synthesis genes. In P. aeruginosa pyocin synthesis is activat ed when PrtR is degraded

PAGE 13

xiii during the SOS response. Treatment of a wild-type P. aeruginosa strain with mitomycin C, a DNA-damaging agent resulted in th e inhibition of TTSS activation. A prtR / prtN double mutant had the same TTSS defect as the prtR mutant, and complementation by a prtR gene but not by a prtN gene restored the TTSS functi on. Also, overexpression of the prtN gene in wild-type PAK had no effect on th e TTSS; thus PrtN is not involved in the repression of the TTSS. To identify the PrtR -regulated TTSS represso r, another round of Tn mutagenesis was performed in the background of a prtR / prtN double mutant. Insertion in a small gene, designated ptrB restored the normal TTSS activity. Expression of ptrB is specifically repressed by PrtR, and mitomycin C-mediated suppression of the TTSS is abolished in a ptrB mutant strain. Therefore, PtrB is a newly discovered TTSS repressor that regulates the TTSS under the stress of DNA damage. My study revealed new regulatory relations hip between MucA, PrtR and the TTSS, and indicated that the TTSS might be re pressed under environm ental stresses.

PAGE 14

1 CHAPTER 1 INTRODUCTION AND BACKGROUND Pseudomonas aeruginosa Basic Bacteriology Pseudomonas aeruginosa is a versatile bacterium that is present in soil, marshes, tap water, and coastal marine habitats. It is a straight or slightly curved, gram negative bacillus (0.5-1.0 x 3-4 m), belonging to the -subdivision of the Proteobacteria The bacterium is defined as an obligate aerobe ; however, anaerobic growth can occur when nitrate or arginine is used as an alternate electron acceptor. The genome sequence of this microorganism was completed several years ago and is freely available to the public (www.pseudo monas.com) (124). The complete sequence of this genome was one of th e largest bacterial genomes se quenced to date, with 6.3-Mbp in size encoding 5570 predicted genes (124). Most interesting is the fact that as high as 8% of the genome encodes transcriptional regulators, which is consistent with the observed bacterial adaptability to various growth environments. Infections P. aeruginosa causes a wide range of infections from minor skin infections to serious and sometimes life-th reatening complications. P. aeruginosa is also a causative agent of systemic infections in immunocompr omised patients, such as those receiving chemotherapy, elderly patients, and burn vi ctims (105, 109). Chronic bronchopulmonary infection of P. aeruginosa is the major cause of morbidity and mortality in cystic fibrosis (CF) patients (57).

PAGE 15

2 CF Airway Infection by P. aeruginosa Today, CF is one of the most common genetic disorders in Caucasian populations. Approximately 30,000 individuals are affected in the United States. CF patients bear a defect in the cystic fibrosis transmembran e conductance regulator (CFTR) gene located on the human chromosome 7q31.2 (41, 103). CFTR functions as an apical membrane chloride channel. Due to the mutation in CFTR, little or no Clis transported across the apical surface of secretory cells, whic h leads to an unopposed reabsorbtion of Na+, Cl-, and water. This results in thick mucus in a CF patients airway. The thickened mucus provides a favorable environment fo r opportunistic pathogens including P. aeruginosa Staphylococcus aureus Haemophilus influenzae and Burkholderia cepacia (51). During progression of the infection, P. aeruginosa predominates and grows as a biofilm, which is highly resistant to antibiotics a nd cannot be eradicated. Most clinical isolates from CF patients overproduce an extra cellular polysaccharide called alginate, resulting in a mucoid phenotype. It is believed that the recurring infe ctions that culminate with chronic P. aeruginosa colonization cause the respiratory damage in CF patients, the progressi ve deterioration of respiratory function, and eventually the morta lity of the patient. The clinical treatment typically includes antibiotics, anti-infla mmatory drugs, bronchodilators, and physical therapy (96, 99). Antibiotic Resistance P. aeruginosa exhibits a remarkable ability to develop resistance to multiple antibiotics. The resistance arises through an acquired an d/or intrinsic mechanism.

PAGE 16

3 Acquired Resistance Acquired resistance is devel oped from a mutation or an acquisition of an antibiotic modification enzyme by horiz ontal transfer, such as -lactamase (76, 88) and acetyltransferases (resistance to aminoglycosides) (91, 117). The target gene will avoid recognition of the antibiotic if mutation occurs. For example, mutations causing lipopolysaccharide changes reduce the uptake of aminoglycosides (14). Mutations in GyrA (a DNA gyrase) result in the resistance to fluoroquinolone (94). Other mutations will ca use the decrease of membrane permeability (134) or up regulation of intrinsi c resistant genes/systems (110). Intrinsic Resistance P. aeruginosa is intrinsically resistant to many antibiotics. The mechanisms include chromosomally encoded -lactamase (76), low permeability of outer membrane and multidrug efflux systems (100). Besides these mechanisms, the biofilm mode of growth also leads to an increased antibiotic resistance (58). More of the biofilm will be discussed in the next section. Multidrug Efflux Systems The multidrug efflux system is a three-component channel through the inner and outer membrane which pumps out antimicrobial agents in an energy dependent manner. It contributes to the reduced susceptibility or resistance to many antibiotics such as lactams, aminoglycosides, tetracycline, qui nolones, chloramphenicol, sulphonamides, macrolides and trimethoprim (110). Six multidrug efflux systems have been identified in P. aeruginosa including MexAB-OprM, MexCDOprJ, MexEF-OprN, MexXY-OprM, MexJK-OprM and MexGHI-OpmD. Each of th em has a different substrate specificity. MexJK-OprM and MexGHI-OpmD were found to provide resistance against triclosan

PAGE 17

4 (18) and vanadium (1), respectively. MexABOprM is constitutively expressed at a low level. In wild-type strains, the expr ession of MexAB-OprM, MexCD-OprJ, MexEFOprN and MexXY-OprM is repressed. Mutation in their respective regulator will lead to derepression and increased antibiotic resistan ce. The substrates and regulation of these efflux systems are summarized in Table 1-1. Table 1-1 Regulation and substrates of multidrug efflux systems Multidrug efflux system Regulator Substrates MexAB-OprM MexR (-) -lactams, quinolones, chloramphenicol, tetracycline, trimethoprim, sulphonamides (101) MexCD-OprJ NfxB (-) Cefpirome, quinolones, chloramphenicol, erythromycin, tetracycline (118) MexEF-OprN MexT (+) Imipenem, quinolones, tetr acycline (68) MexXY-OprM MexZ (-) Aminoglycosides, tetracycline, erythromycin (135) -, negative regulator; +, positive regulator Virulence Factors P. aeruginosa harbors an arsenal of virulence fact ors, which enable it to establish localized, chronic colonization or systemic infection. The virulence factors include flagella, pili, extracellular toxins, quorum sensing systems, iron metabolism factors, alginate production, and a type III se cretion system (5, 19, 21, 25, 58, 64, 65, 67, 87, 97, 104, 111, 121). Flagellum P. aeruginosa possesses a single polar flagellum which serves as a motive organelle on the bacterial surface. The flag ellum consists of a basal body, hook, flagellar filament and motor. The basal body anc hors the flagellum on the surface of the bacterium, the hook functions as a joint c onnecting the filament to the basal body, the filament functions as a propeller, and the ro tation of the flagellum is generated by the

PAGE 18

5 motor. By rotating the flagellum, the bacterium can move in the surrounding environment. Two types of movement de pend on flagella, swimming and swarming. Swimming is a movement of bacteria in the surrounding liquid, and swarming is a surface translocation by groups of bacteria ( 17, 50). During the infection, flagella mediate the adhesion of P. aeruginosa to mucin in human airways (5, 104). Pilus Besides flagella, P. aeruginosa produces another motive organelle, the type IV pilus. A pilus is a polar filament structure, mediating attachment to host epithelial cells and a type of surface translocation called twitc hing motility (141). The pilus is composed of a small subunit (pilin). Pilin is synt hesized in the cytoplasm as pre-pilin and translocated through the inner membrane, cell wa ll, and outer membrane to the surface of bacterium. During translocat ion, pre-pilin is cleaved to pilin and made ready to be assembled into a pilus. The pilus is able to extend and retract, resulting in surface translocation (twitching motility) (25, 87). Extracellular Toxins P. aeruginosa produces a variety of extracellu lar virulence determinants and secondary metabolites, which could cause extensive tissue damage, inflammation, and disruption of host defense mechanisms. Th e extracellular toxins include exotoxin A, alkaline protease, phospholipase C, elasta se, hydrogen cyanide, pyocyanin, phenazine and rhamnolipid. Exotoxin A and alkaline protease are under the control of the iron metabolism system and are expressed at a much higher level under iron limited environments (19, 97). The regulation of phospholipase C is regulated by inorganic phosphate (Pi) (121). The remaining virulen ce factors are under th e control of a quorum sensing system (65).

PAGE 19

6 Quorum Sensing P. aeruginosa possesses a signaling system fo r cell-cell communication, called quorum sensing. P. aeruginosa possesses three quorum sensing systems, known as las rhl and PQS (pseudomonas quinolone signal). E ach system contains a small molecule involved in signal communication. The las and rhl systems use acyl-homoserine lactones, C4-HSL and 3OC12-HSL, as si gnal molecules, resp ectively. The signal molecule of the PQS system is quinolone. The signal molecules are secreted into the surrounding environment, and when their concentr ations reach a threshold (usually at the mid or late log phase), they can interact wi th their respective receptors and modulate gene expression in the population. The three quorum sensing systems can interact with each other. When the quorum sensing systems ar e activated, the expression of many virulence genes is up regulated, as re ported previously (65, 133). Besides functioning as signal molecules, C4-HSL and 3OC12-HSL can dire ctly modulate the host immune system. 3OC12-HSL is able to promote induction of apoptosis in macrophages and neutrophils (128). Quorum sensing is required for biof ilm formation (119, 145). Therefore, quorum sensing can be a drug target for the treatment and eradication of P. aeruginosa infection (11, 51). Iron Metabolism Iron is essential for the metabolism and survival of P. aeruginosa To acquire iron from the surrounding environment, P. aeruginosa produces and secretes iron-chelating compounds called siderophores. Two types of siderophores, pyoverdine and pyochelin, are produced by P. aeruginosa with the former having much higher affinity than the latter in binding iron (III). The pyoverdine and pyochelin synthesis genes and receptors

PAGE 20

7 are under the negative control of a regulator, Fu r. Under iron depleted environments, the expression of these genes is derepressed (97, 132). Alginate Alginate is an exopolys accharide synthesised by P. aeruginosa Alginate production is known to be activated by envir onmental stress such as high osmolarity, nitrogen limitation, and membrane pertur bation induced by ethanol (10). Over production of alginate renders muco idy to the bacterium. Most P. aeruginosa clinical isolates from CF patients display a mucoid phenotype (111). The function and regulation of alginate are described in the introduction sectio n of Chapter 3. Biofilm During chronic infection of CF airways, P. aeruginosa forms a biofilm on the respiratory epithelial surface. The biofilm consists of microcolonies surrounded by alginate (58), although alginate is not essent ial for the biofilm formation. The formation of biofilm requires flagella pili, and quorum sensing systems (28, 51, 58). Bacteria growing in a biofilm are much more resist ant to antibiotics than when growing in planktonic mode. It is be lieved that the slow, anaerobic growth inside the biofilm increases the antibiotic resistance. The surrounding negatively charged alginate may function as a barrier against antibiotics, especially positively charged aminoglycosides (58). Due to the biofilm mode of growth, an tibiotic treatment usually fails to eradicate the bacteria (58). Type III Secretion System Type III secretion systems (TTSSs) are complex protein secretion and delivery machineries existing in many animal a nd plant pathogens. The TTSS directly translocates bacterial effector molecules in to the host cell cytoplasm, causing disruption

PAGE 21

8 of intracellular signaling or ev en cell death (35). Component s of TTSSs from a variety of gram-negative bacteria display sequence and st ructural similarity. Most TTSS apparatus are composed of two sets of protein rings embedded in the bacterial inner and outer membranes and a needle-like structure (102). According to the cu rrent working model, the needle forms a pole in the host cell memb rane, and effector pr oteins are delivered through the hollow needle (49, 95, 127). The TTSS is an important virulence factor of P. aeruginosa : it inhibits host defense systems by inducing apoptosis in macrophage s, polymorphonuclear phagocytes, and epithelial cells (21, 64, 67). Th e loss of the TTSS resulted in an avirulent phenotype in a burned mouse model (59). Function of TTSS Structural Genes The P. aeruginosa TTSS machinery is encoded by 31 genes arranged in four operons on the chromosome. Several genes ha ve been well studied for their functions and interactions. Needle structure genes The P. aeruginosa TTSS needle is primarily composed of a 9-kDa protein named PscF. Partially purified needles measured about 7 nm in width and 60-80 nm in length (98). PscF has been shown to have two in tracellular partners, PscE and PscG, which prevent it from polymerizing prematurely in the cytoplasm and keep it in a secretionprone conformation (102). Pore forming components In order for TTSS-containing bacteria to dir ectly deliver effector proteins into the eukaryotic cytoplasm, a mechanism is required for the TTSS to penetrate the double phospholipid cell membrane. The pore-forming activity possessed by the TTSS is

PAGE 22

9 dependent on the pcrGVHpopBD operon (24). Upon cont act with th e host cell membrane, PopB and PopD polymerize and form a ring-like structure in the membrane, through which effector proteins are tans located. PopB and PopD have a common cytoplasmic chaperon, PcrH, which prevents th eir premature aggregation (114). Another gene product of this operon, PcrV, is require d for the assembly and insertion of the PopB/PopD ring into the host ce ll membrane (44). However, no direct interaction has been detected between PcrV and PopB/PopD ( 44). PcrG was found to interact with PcrV (4). Polarization of type III translocation When cultured mammalian cells were infected with wild type P. aeruginosa TTSS effector proteins could be detected only in th e eukaryotic cytoplasm, but not in the tissue culture medium (131). This phenomenon is called polarized transl ocation, during which PopN, PcrG and PcrV are all re quired. Mutation in either popN or pcrG does not affect the TTSS-related cytotoxicity against HeLa cells; however, it results in high levels of ExoS in the tissue culture medium (126). Effector proteins Four different effector pr oteins have been found in P. aeruginosa ExoS, ExoT, ExoY and ExoU. However, no natural P. aeruginosa isolates harbor both ExoS and ExoU simultaneously. ExoS and ExoT share significant sequence homology and structural similarity, with both bearing an ADP-ribosyltransferase activity and a GTPaseactivating protein activity. E xoU and ExoY have lipase and adenylate cyclase activities, respectively (6, 39, 81, 112, 125). The ADP-ribosy ltransferase activity of ExoS has been shown to cause programmed cell death in vari ous types of tissue cu lture cells (64, 67).

PAGE 23

10 Regulation of TTSS Expression of the TTSS regulon can be stim ulated by direct contact with the host cell or by growth under a low Ca2+ environment (61, 131). The expression of type IIIrelated genes is coordinately regulated by a tr anscriptional activator, ExsA (60). ExsA is an AraC-type DNA binding protein that re cognizes a consensus sequence, TXAAAXA, located upstream of the transcri ptional start site of type III secretion genes, including the exsA gene itself (60). Three proteins, ExsD, ExsC and ExsE, directly regulate the activity of ExsA. ExsD represses ExsA activity by dire ctly interacting with it (89). ExsC on the other hand has the ability to interact with both ExsD and ExsE (106, 130). Under TTSS non-inducing conditions, ExsC binds to ExsE; however, when the TTSS is induced, ExsE is secreted outside of the cell by TTSS machiner y. This leads to the increased level of free ExsC, which in turn binds to ExsD and releases ExsA, allowing the transcriptional activation of the TTSS (27, 106, 130). The re gulation cascade of the TTSS through ExsA is summarized in Fig. 1-1. Figure 1-1. A model of the regula tion of ExsA. See text for detail. *, derepressed ExsA. ExsE ExsD ExsC ExsA ExsD ExsC Basal level TTSS expression Activated TTSS expression ExsE Cytoplasm TTSS non-inducing conditions TTSS inducing conditions TTSS machinery ExsA*

PAGE 24

11 Other TTSS Related Genes In addition to genes described thus far, a number of other genes have been shown to affect the expression of type III genes, although the regulatory mechanisms are not known. Under TTSS-induci ng conditions (low Ca2+), the cyclic AMP level increases and a CRP homologue, Vfr, is required for TTSS ac tivation (140). Vfr is a global regulator which mediates the activation of quorum se nsing (3), twitching motility (8), type II secretion (140), and repression of flag ellum synthesis (26). A novel gene, fimL is also required for both TTSS and twitching motility (116, 137). Transcription of vfr is reduced in a fimL mutant, and over expression of Vf r restores both the TTSS and twitching motility, which suggests that the regulatory ro le of Vfr is downstream of FimL (137). Mutation in a hybrid sensor kinase/response regu lator (RtsM or RetS) results in a defect in the TTSS and hyperbiofilm phenotype (42). Over expression of either Vfr or ExsA in a rtsM mutant restores the TTSS activity (72) Furthermore, a three-component regulatory system (SadARS) is also requi red for both TTSS and biofilm formation in P. aeruginosa (69). Some enzymes and metabolic pathways in P. aeruginosa are also found to be essential for the activation of TTSS. These include a periplasmic thiol:disulfide oxidoreductase (DsbA) (48), a tRNA pseudour idine synthase (TruA) (2), pyruvate dehydrogenases (AceAB) (23), and a normal histidine metabolism pathway (107). Additionally, the TTSS in P. aeruginosa is under the negativ e control of the rhl quorumsensing system and the stationary-phase sigm a factor RpoS (12, 56). Over expression of MexCD-OprJ or MexEF-OprN also cause the repression of the TTSS (75). Recently, our lab has demonstrated that a gene highly inducible during infection of the burn mouse model, designated ptrA encodes a small protein whic h inhibits TTSS through direct

PAGE 25

12 binding to ExsA and thus functions as an an ti-ExsA factor. Expression of this gene is specifically inducible by high copper signal in vitro through a CopR/S two-component regulatory system (47). Fig. 1-2 summar izes the knowledge of the TTSS-related regulatory network in P. aeruginosa The regulatory roles played by AlgR and PtrB in TTSS regulation were discovered during my doctoral research period and will be described in Chapter 2 and 3, respectively. Figure 1-2. TTSS related regul atory network. See text for detail. +, positive regulation/relationship; -, negative regulation. 1, direct prot ein-DNA binding has been proved. 2, direct protein-protein in teraction has been proved. 3, 4, this relationship was newly di scovered from the work during my Ph.D. program. TTSS Vfr cAMP FimL Twitching Motility Flagellum Quorum Sensing RpoS SadARS RetS/ RtsM ExsA TruA AlgR3 AlgU MucA Alginate PtrB4 PrtR4 PrtN Pyocin DsbA AceAB + + + + + + + + + + -+ + + + + + + + + +1-1 Normal histidine metabolism Multi-drug Efflux S y stem -Biofilm PtrA -2CopS Co pR +

PAGE 26

13 CHAPTER 2 MucA-MEDIATED COORDINATION OF TYPE III SECRETION AND ALGINATE SYNTHESIS IN Pseudomonas aeruginosa Introduction Among CF patients, P. aeruginosa colonizes inside the th ick mucus layer of the airway. In this anaerobic environment, P. aeruginosa overproduces the exopolysaccharide alginate and forms a biof ilm which protects the bacterium from reactive oxygen intermediates and inhibits phagocytosis (51). More than 90% of P. aeruginosa strains isolated from CF patients show the mucoid phenotype, due to the overproduction of alginate (111). Clearly, alginate overproduction is a strategy to overcome environmental stresses. A number of stress signals trig ger the overproduction of alginate, converting the bacter ium to the mucoid phenotype (84). The genes encoding enzymes for algi nate synthesis form an operon ( algD operon), and the expression of this operon is under the tight control of several regulators. The key regulatory gene of this operon is the algU gene (also called algT ), included in an algU operon which consists of algU-mucA-mucB-mucC-mucD The algU gene encodes a sigma factor, 22, which autoregulates its own promoter and activates many other genes, including those for alginate biosynthe sis (85). The second gene in the algU operon, the mucA gene, encodes a transmembrane protein with a cytoplasmic portion binding to and inactivating AlgU (85). The third gene of the algU operon, the mucB gene, encodes a periplasmic protein, possibly sensing certain environmental signals. Upon sensing certain environmental signals, MucB transduces the signal to MucA, which in turn

PAGE 27

14 releases the bound form of AlgU resulting in activation of al ginate production (85). The majority of P. aeruginosa isolates from the lungs of older CF patients carry mutations in the mucA or mucB gene and display a mucoid phenotype (82). In the AlgU regulon, twocomponent regulatory systems AlgB-FimS ( 78) and AlgR-AlgZ (146) and regulators AlgP (29) and AlgQ (73) are required for alginate synthesis. Among them, AlgR was also shown to be essential for P. aeruginosa pathogenesis (77). An algR mutant is less virulent than a wild-type strain in an acute septicemia infection mouse model (77). AlgR is also required for twitching motility (136, 138). Proteomic analysis of the algR mutant suggested that AlgR is a globa l regulator, affecting the expr ession of multipl e genes (77). In this chapter, a transposon (Tn) insertional mutant bank of a wild type P. aeruginosa strain, PAK, was screened for mutants that are defective in TTSS expression. I found that mutation in the mucA gene suppresses the expression of TTSS genes, greatly reducing the response of the TTSS to low Ca2+. Furthermore, the suppression is dependent on the AlgU and AlgR functions. Comparison of global gene expression of the mucA mutant and wild type PAK under type III-inducing conditi ons confirmed the above observation. Several groups of genes ha ve been found to be differently expressed in the mucA mutant and PAK, and their possible ro les in TTSS expression are discussed. Material and Methods Bacterial Strains and Growth Conditions Plasmids and bacterial strains used in this study are listed in Table 2-1. Bacteria were gown in Luria broth (LB) at 37C. Antibiotics were used at the following concentrations: for Escherichia coli ampicillin at 100 g/ml, gentamicin at 10 g/ml, tetracycline at 10 g/ml, and kanamycin at 50 g/ml; for P. aeruginosa carbenicillin at 150 g/ml, gentamicin at 150 g/ml, tetracy cline at 100 g/ml, spectinomycin at 200

PAGE 28

15 g/ml, streptomycin at 200 g/ml, and neom ycin at 400 g/ml. For -galactosidase assays, three single colonies of each strain we re used. The overnight cultures were diluted 100-fold with fresh LB or 30-fold with LB containing 5 mM EGTA Bacteria were grown to an optical density at 600 nm (OD600) between 1.0 and 2.0 before -galactosidase assays (92). The data were subjected to t -test and P <0.05 was considered as statistically significant. Table 2-1. Strains and plas mids used in this study Strain or plasmid Description Source or reference E. coli strains BW20767/pRL27 RP4-2-Tc::Mu-1 Kan::Tn7 integrant leu63 ::IS 10 recA1 zbf-5 creB510 hsdR17 endA1 thi uidA ( MluI:: pir )/pRL27 (71) DH5 / pir 80 dlacZ M15 ( lacZYA-argF )U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 / pir (71) P. aeruginosa strains PAK Wild-type P. aeruginosa strain David Bradley PAK exsA :: PAK with exsA disrupted by insertion of cassette; SprSmr (36) PAK A44 PAK mucA 1::Tn 5 mutant isolate; Neor This study PAK A61 PAK mucA 2::Tn 5 mutant isolate; Neor This study PAK mucA22 Point mutation ( G440) in mucA gene of PAK This study mucA22 algU ::Gm mucA22 with algU disrupted by insertion of Gm cassette; Gmr This study mucA22 algR ::Gm mucA22 with algR disrupted by insertion of Gm cassette; Gmr This study PAK algU ::Gm PAK with algU disrupted by insertion of Gm cassette; Gmr This study Plasmids pCR2.1-TOPO Cloning vector for the PCR products Invitrogen pHW0005 exoS promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (47) pHW0006 exoT promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (47) pHW0024 pscN promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (47) pHW0032 exsA promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (47) pUCP19 Shuttle vector between E. coli and P. aeruginosa (115)

PAGE 29

16 Table 2-1. Continued Strain or plasmid Description Source or reference pWW020 mucA gene on pUCP19 driven by algU promoter; Apr This study pWW021 mucA gene on pUCP19 driven by lac promoter; Apr This study pWW025 algU gene on pUCP19 driven by lac promoter; Apr This study pMMB67EH Low-copy-numb er broad-host-range cloning vector; Apr (38) pWW022 algR gene on pMMB67EH driven by lac promoter; Apr This study pEX18Tc Gene replacement vector; Tcr oriT+ sacB+ (55) pEX18Ap Gene replacement vector; Apr oriT+ sacB+ (55) pPS856 Source of Gmr cassette; Apr Gmr (55) algU ::GmpEX18Tc algU disrupted by insertion of Gmr cassette on pEX18Tc; Gmr Tcr oriT+ sacB+ This study algR ::GmpEX18Ap algR disrupted by insertion of Gmr cassette on pEX18Ap; Gmr Apr oriT+ sacB+ This study PAK algR ::Gm PAK with algR disrupted by insertion of Gm cassette; Gmr This study Construction of Tn insertional Mutant Bank The P. aeruginosa PAK strain containing the exoT :: lacZ fusion plasmid (pHW0006) was grown overnight at 42C, while E. coli donor strain BW20767/pRL27 was cultured to mid-log phase at 37C. Cells of the two types of bacteria were washed with LB once to remove antibiotics in the culture medium. About 5 x 108 PAK/pHW0006 cells were mixed with 109 donor E. coli cells, and the mixture was filtered onto a sterile nitrocellulose membra ne (pore size, 0.22 m). The membrane was laid on top of nutrient agar and incubated at 37C for 7 to 9 h before washing off the bacterial mixture from the membrane with LB The bacterial suspension was serially diluted with LB and spread on L-agar plat es containing spectino mycin at 100 g/ml, streptomycin at 100 g/ml, tetracycline at 50 g/ml, neomycin at 400 g/ml, and 20 g

PAGE 30

17 of 5-bromo-4-chloro-3-indolyl --L-thiogalactopyranoside (X-Gal) per ml, with or without 2.5 mM EGTA for colony counting as well as mutant screening. Determination of Tn Insertion Sites To locate the Tn insertion s ites of the isolated mutants, the Tn with flanking DNA was rescued as a plasmid from the mutant ch romosome. Plasmid rescue was carried out as previously described (71). Briefly, ge nomic DNA of the Tn insertion mutants was isolated with the Wizard genomic DNA purificati on kit (Promega) and digested with PstI. The digested DNA was subjected to self-ligat ion with T4 DNA ligase and electroporated into DH5 / pir Plasmids were isolated from the transformants and sequenced with primers tpnRL17-1 (5'-AAC AAG CCA GGG ATG TAA CG-3 ') and tpnRL13-2 (5'CAG CAA CAC CTT CTT CAC GA-3') for the DNA flanking the two ends of the Tn. The DNA sequences were then compared with the P. aeruginosa genomic sequence by using BLASTN (124). Generation of Knockout Mutants Chromosome gene knockout mutants were gene rated as previously described (55). The target genes were amplified by PCR and cloned into pCR-TOPO2.1 (Invitrogen). After subcloning the PCR product into pEX 18Tc or pEX18Ap, the target gene was disrupted by insertion of a gentamicin resi stance cassette, leav ing about 1 kb upstream and downstream of the insertion-mutation site. The plasmids were electroporated into wild-type PAK and single-crossover mutants were selected on LB plates containing gentamicin at 150 g/ml, and tetracycline at 100 g/ml or carbenici llin at 150 g/ml. Double-crossover mutants were selected by plating single-crossover mutants on LB plates containing 5% sucrose and gentamicin at 150 g/ml. In the case of the mucA22 mutant, a 1.8-kb fragment of the mucA gene region was amplified from FRD1 (mucoid

PAGE 31

18 strain) (78) genomic DNA, and the fragme nt was cloned into the HindIII site of pEX18Gm. The plasmid was transformed into P. aeruginosa to select for single crossover mutants on LB agar plates contai ning 150 g/ml gentamicin. Single-crossover mutants were plated on L-agar plates c ontaining 5% sucrose to select for doublecrossover mutants. The double-crossover mu tants were mucoid, and the introduction of the mucA22 mutation was confirmed by sequencing of the mucA gene. Plasmid Constructs for Comple mentation and Overexpression Reporter fusions between the exsA exoT exoS and pscN genes and promoterless lacZ on pDN19 lacZ were generated by Ha et al. (47, 48). For mucA gene complementation, the mucA gene was amplified from PAK genomic DNA by PCR with primers MucA-1 (5'-CGG ATC CTC CGC GCT CGT GAA GCA ATC G-3') and MucA2 (5'-TAC TGC GGC GCA CGG TCT CGA C CC ATA C-3'). The PCR product was cloned into pCR-TOPO2.1 and transformed into E. coli TOP10F'. The obtained plasmid was digested with Hin dIIIXmn I and cloned into the Hin dIIISma I sites of pUCP19. The mucA gene in the resulting plasmid, pWW021, is driven by a lac promoter on the vector. To generate a mucA gene driven by the algU promoter, the mucA gene on the pCRTOPO2.1 plasmid was subcloned into the Bam HI and Xmn I sites of pEX18Tc, resulting in mucA -pEX18Tc. To obtain the algU gene promoter, an 800-bp DNA fragment upstream of the algU gene open reading frame (ORF ) was amplified by PCR with primers AlgT1 (5'-CCT TCG CGG GTC A GG TGG TAT TCG AAG C-3') and AlgT2 (5'-TTG GAT CCG CGC TGT ACC CGT TC A ACC A-3') and cloned into pCRTOPO2.1. Then, this fragment was ligated into the Eco RI and Bam HI sites upstream of the mucA gene on the plasmid mucA -pEX18Tc. The obtained plasmid was digested with Eco RIXmn I, and the algU promoter and mucA gene ORF fragment were cloned into the

PAGE 32

19 Eco RISma I sites of pUCP19. On the re sulting plasmid (pWW020), the mucA gene is driven by the algU promoter, and the transc riptional direction is opposite to that of the lac promoter on the vector. For algR complementation, the algR gene was amplified from PAK genomic DNA by PCR with pr imers algR1 (5'-GG T CTA GAG GCC GAG CCC CTC GGG AAA G-3') and algR2 (5'-GTG GAT CCT ACT GCT CTC GGC GGC GCT G-3'). The PCR product was initially cloned into pCR-TO PO2.1. The resulting plasmid was digested with Cla I, blunted ended with Klenow enzyme, and digested with Xba I. The algR gene-containing fragment was ligated into Xba ISma I sites of plasmid pMMB67EH, resulting in pWW022, on which the algR gene is driven by the tac promoter on the vector. For algU gene over expression, the algU gene ORF was amplified from PAK genomic DNA by PCR with primers algU1 (5'-GGG AAA GCT TTT GCA AGA AGC CCG AGT C3') and algU2 (5'-GCT TCG TTA TCC ATC ACA GCG GAC AGA G-3'). The algU gene was cloned into Hin dIIIEco RI sites of pUCP19, where the expression of the algU gene in the resulting plasmid pWW025 was driven by lac promoter on the vector. Western Blotting P. aeruginosa strains were cultured overnight in LB at 37C. Bacterial cells were diluted 100-fold with fresh LB or 30-fold w ith LB containing 5 mM EGTA and cultured for 3.5 h. Supernatant and pellet were se parated by centrifugation and mixed with sodium dodecyl sulfate-polyacr ylamide gel electrophoresis (S DS-PAGE) loading buffer. Equal loading of the protein samples was based on the same number of bacterial cells. The proteins were transferred onto polyvi nylidene difluoride memb rane and probed with rabbit polyclonal antibody agai nst ExoS (self-developed). The signal was detected by

PAGE 33

20 enhanced chemiluminescence following the pr otocol provided by the manufacturer (Amersham Biosciences). RNA Isolation and Microarray Analysis For RNA isolation, three single colonies of PAK and the isogenic mutant PAK mucA22 were each inoculated into 3 ml of LB and grown overnight. PAK and PAK mucA22 were subcultured into LB containi ng 5 mM EGTA. PAK started with an OD600 of 0.03, and the mucA22 mutant started with an OD600 of 0.06. After 3 to 4 h of culture, bacteria were harvested at an OD600 of 1.0 to 1.2. Total RNA was isolated using an RNeasy mini kit (QIAGEN) according to th e manufacturer's instructions. The purity and quantity were determined by spectrometr y and electrophoresis. Fifteen micrograms of RNA of each sample was used for cDNA synthesis. cDNA fragmentation and biotin terminal labeling were carried out as instru cted (Affymetrix). The experiments were performed in triplicate. Mi croarray analysis was perf ormed with the Affymetrix GeneChip P. aeruginosa genome array. The experimental procedure followed the manufacturer's instructions. Data were acquired and analyzed with Microarray Suite version 5.0 (Affymetrix). Signifi cance analysis of microarrays (129) was used to detect differentially expressed ORFs. Then, a cuto ff of 5% false discovery rate (FDR) was chosen to analyze the data. Results Activation of the TTSS Requires a Functional mucA Gene. To identify P. aeruginosa genes that affect the expre ssion of TTSS, a Tn insertion mutant bank was construc ted in PAK containing an exoT :: lacZ (transcriptional fusion) reporter plasmid (pHW0006) (see Materials a nd Methods). On plat es containing X-Gal and EGTA, the density of the blue color of each colony indicated th e expression level of

PAGE 34

21 the exoT gene in that particular Tn insertion mutant. To identify optimal screening conditions, combinations of diffe rent concentrations of X-Gal and EGTA were tested. In the presence of 20 g of X-Gal/ml and 2.5 mM EGTA, wild-type PAK and the type IIIdefective PAK exsA mutant harboring pHW0006 showed the greatest visual difference in colony color (blue) and thus these concen trations were adopted for the screening conditions. The mutant cells were grown on the screening plates, and we looked for colonies with lighter blue color. About 40,000 Tn insertion mutants were screened. Among four colonies with lighter blue colo r, two of them showed a mucoid phenotype and the other two had Tn inserted in a prtR gene. The relationship between PrtR and TTSS will be discussed in Chapter 3. The two mucoid mutants were picked to test their TTSS activity by -galactosidase assay. As shown in Fig. 2-1A, the exoT gene promoter activity was threeto fourfold lower in the mutants than in the parent strain PAK/pHW0006. To confirm this observation, the exoT :: lacZ reporter plasmid was cured from the Tn insertion mutants by passage in the absence of antibi otic selection and a pscN :: lacZ reporter plasmid (pHW0024) was rein troduced. The resulting strain was subjected to a -galactosidase assay. The assa y results shown in Fig. 2-1D indicated that the expression of the pscN gene was also repressed in these mucoid mutants under both TTSS-inducing and -noninducing conditions. Similar results were also obtained by introducing exsA :: lacZ (pHW0032) and exoS :: lacZ (pHW0005) reporter plasmids and testing -galactosidase activiti es (Fig. 2-1B and C), confirming that the two Tn mutants were indeed defective in TTSS expression. The Tn and flanking DNA were rescued from the mutant strains and subjected to sequencing analysis (see Materi als and Methods). Sequencing results showed that the Tn

PAGE 35

22 was inserted into two different positions in the mucA gene in these two mutants, explaining the mucoid phenotype of the isolates. Figure 2-1. Expression of type III secreti on genes in Tn insertional mutants of mucA PAK, PAK exsA and mucA mutants A44 and A61 harboring pHW0006 containing exoT :: lacZ (A), pHW0032 containing exsA :: lacZ (B), pHW0005 containing exoS :: lacZ (C), or pHW0024 containing pscN :: lacZ (D) were tested for -galactosidase activities. Bacteria were grown in LB (w hite bars) or LB containing 5 mM EGTA (black bars) to an OD600 of 1 to 2 before galactosidase assays. Each assay was done in triplicate, and the error bars indicate standard deviations. *, P < 0.001, compared to the values in PAK. 0 50 100 150 200 250 300 350 400 450 500 PAK A44 A61 -Galactosidase activity (Miller unit) exsA 0 500 1000 1500 2000 2500 3000 -Galactosidase activity (Miller unit) PAK exsA A44 A61 0 50 100 150 200 250 300PAK exsA A44 A61 -Galactosidase activity (Miller unit) 0 50 100 150 200 250 300 350 -Galactosidase activity (Miller unit) PAK exsA A44 A61 A B D C * * * * * *

PAGE 36

23 Mutation in the mucA gene is commonly observed among P. aeruginosa isolates from CF patients, such as mucA22 where a nucleotide G was deleted within five G residues between positions 429 and 433 of the mucA coding region, causing protein truncation (13, 111). The identical mucA22 mutant was constructe d in the background of PAK by allelic replacement with a mucA fragment amplified from P. aeruginosa FRD1 (78), which bears the mucA22 mutation (see Materials and Methods). Expression of the effector genes exoS and exoT in the resulting mutant strain PAK mucA22 was compared to that in PAK by Western blot an alysis of the secreted and cell-associated proteins. A polyclonal anti-ExoS antibody was used in the western blot experiment; however, it also cross-recognizes ExoT due to a high seque nce homology between the ExoS and ExoT proteins. As shown in Fig. 2-2A, expre ssion of ExoS and ExoT in the resulting PAK mucA22 was greatly reduced in comparison to that in wild-type PAK when grown under type III-inducing conditions Reporter plasmids pHW0032 ( exsA :: lacZ ) and pHW0005 ( exoS :: lacZ ) were further introduced into PAK mucA22 and tested for galactosidase activity. Similar to the original isolates of the mucA Tn insertional mutants, expression of the exsA and exoS genes in PAK mucA22 was almost nonresponsive to low Ca2+, compared to a threeto fourfold i nduction in the wild-type PAK background (Fig. 2-2B and C). Upon complementation of the PAK mucA22 mutant with the mucA gene in pUCP19, either driven by the algU promoter (pWW020) or lac promoter (pWW021), expression of the exsA and exoS genes in the resulting strains was restored to the wildtype level (Fig. 2-2C). These results clea rly demonstrate that expression of the TTSS genes requires a functional mucA gene.

PAGE 37

24 Figure 2-2. Expression and secr etion of ExoS protein. (A ) Comparison of cellular and secreted forms of ExoS in strains PAK and PAK mucA22 grown in LB or LB plus 5 mM EGTA. Supernatants and pe llets from equivalent bacterial cell numbers were loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and immunoblotted with anti-ExoS antibody. Both ExoS and ExoT are indicated by the arrow. Anti-ExoS polyclonal antibody also recognizes ExoT due to high homology between these two proteins. (B) Expression of exsA :: lacZ (pHW0032) in the backgrounds of PAK, PAK mucA22 with or without the mucA clone driven by an algU promoter (pWW020) or lac promoter (pWW021), PAK mucA22algU ::Gm and PAK mucA22algR ::Gm (C) Expression of exoS :: lacZ (pHW0005) in the same backgrounds as described above. Bacteria were grown to an OD600 of 1 to 2 in LB with (black bars) or without (w hite bars) EGTA befo re -galactosidase assays. *, P < 0.05, compared to the values in mucA22 PAK mucA22 mucA22 /pWW020 mucA22 /pWW021 mucA22 algU ::Gm mucA22 algR ::Gm -Galactosidase ac tivity (Miller unit) -Galactosidase ac tivity (Miller unit) PAK mucA22 mucA22 /pWW020 mucA22 /pWW021 mucA22 algU ::Gm mucA22 algR ::Gm B C 0 500 1000 1500 2000 2500 3000 3500 4000 0 20 40 60 80 100 120 140 160 180 ExoS ExoT + + EGTA mucA22 PAK + + mucA22 PAK supernatant pellet A * * * * *

PAGE 38

25 Microarray Analysis of Gene Expression in the mucA Mutant To further understand the mechanism of MucA-mediated regulation of TTSS genes, global gene expression prof iles were compared between PAK mucA22 and its wildtype parent strain PAK grown under TTSS-i nducing conditions. Previously, a microarray analysis compared global gene ex pression patterns between mucoid ( mucA mutant) and wild-type P. aeruginosa under non-TTSS-inducing conditi ons (32). Under these conditions, the TTSS activity in both strains was low; thus, no obvious effect of the mucA gene on the TTSS was observed. Results of our gene array analysis were c onsistent with the p ublished data (32, 33); genes under the control of AlgU are up regulated in the PAK mucA22 mutant background compared to those in wild-type PAK, includ ing genes for alginate biosynthesis (operon PA3540-3551) and regulation (Table 2-2). Also up regulated was operon, PA4468-4471, which includes the sodM gene (PA4468) encoding manganese superoxide dismutase, whose production is known to be higher in mucoid than that in nonmucoid P. aeruginosa (54), and the fumC gene (PA4470) encoding a tricarboxyl ic acid cycle enzyme fumarase C, which is essential for alginate production (53). Their results va lidated our gene array data. Table 2-2. Expression of AlgU regulon genes in PAK mucA22 (examed in microarray) Group and ID no. Name Function Fold change in mucA22 vs wild type** Alginate biosynthesis genes PA3540 algD Alginate biosynthesis 64.2* PA3541 alg8 Alginate biosynthesis 29.9* PA3542 alg44 Alginate biosynthesis 28.9* PA3543 algK Alginate biosynthesis 81.2* PA3544 algE Alginate biosynthesis 47.9* PA3545 algG Alginate biosynthesis 38.0*

PAGE 39

26 Table 2-2. Continued Group and ID no. Name Function Fold change in mucA22 vs wild type** PA3546 algX Alginate biosynthesis 86.0* PA3547 algL Alginate biosynthesis 43.7* PA3548 algI Alginate biosynthesis 55.2* PA3549 algJ Alginate biosynthesis 27.2* PA3550 algF Alginate biosynthesis 70.5* PA3551 algA Phosphomannose isomerase 38.7* Alginate biosynthesis regulatory genes PA0762 algU Sigma factor 2.6* PA0763 mucA Anti-sigma factor 2.4* PA0764 mucB Negative regulator for alginate biosynthesis 1.3 PA5261 algR Alginate biosynthesis; twocomponent system 1.5 PA5483 algB Alginate biosynthesis; twocomponent system 2.0* PA5484 kinB Two-component sensor 2.1 Genes known to be up regulated in mucA mutants PA0059 osmC Osmotically inducible protein 3.8* PA0376 rpoH Sigma factor 1.3 PA4876 osmE Osmotically inducible lipoprotein 3.0* PA5489 dsbA Thiol:disulfide interchange protein 1.3 *, FDR<5%. **, Expression data is presented as fold change in mucA22 relative to wildtype PAK. Meanwhile, the expression levels of exoS exoT exoY and other T3SS-related genes were clearly down regulated in the mucA mutant background compared to those in wild-type PAK under TTSS-inducing conditions (Table 2-3), which confirmed our galactosidase assay and the We stern blotting results. However, no significant changes in

PAGE 40

27 the expression of the exsA gene and a few other TTSS ge nes were observed. A previous gene array study also showed that expression of the exsA gene and the exsD-pscL operon is relatively nonresponsive to Ca2+ depletion (140), yet a clear difference in the galactosidase activities could be observed when PAK harboring exsA :: lacZ (pHW0032) was grown in LB with or without EGTA. Sim ilarly, we have seen differences in the galactosidase activities between PAK(pHW0032) and PAK mucA22 (pHW0032) under type III-inducing conditions without observing such differe nces in gene array data, suggesting possible involvement of po sttranscriptional control of the exsA gene. Table 2-3. Expression of TTSS-related gene s in PAKmucA22 (examed in microarray) ID no. Gene Function Fold change in mucA22 vs wild type** PA0044 exoT Exoenzyme T .0* PA2191 exoY Adenylate cyclase .3 PA3841 exoS Exoenzyme S .1* PA1707 pcrH Regulatory protein .4 PA1708 popB Translocator protein .6 PA1709 popD Translocator outer membrane protein .5 PA1718 pscE Type III export protein .4 PA1719 pscF Type III export protein .5 *, FDR<5%. **, Expression data is presented as fold change in mucA22 relative to wildtype PAK. From the microarray analysis, genes that are differentially expressed more than threefold between PAK mucA22 and PAK are listed in Tables 2-4 and 2-5. A number of genes known to be inducible under iron de privation was also elevated in the mucA22 mutant, including the sigma factor PvdS and genes regulated by PvdS for pyoverdine synthesis (53), the operon PA4468-4471 ( 53), and the probable two-component regulatory genes PA1300 and PA1301, encoding the extracytoplasmic function sigma-70 factor and a transmembrane sensor, respectiv ely (97). Compared to the global gene expression profile of PAK grown under TTSS inducing or noninducing conditions, none

PAGE 41

28 of the above genes seem to be affected by Ca2+ depletion (140). The mechanism by which these genes are activated is not clear. Table 2-4. Genes up regulated in PAK mucA22 (examed in microarray) ID no.a Gene Function Fold change in mucA22 vs wild type** TSBb (fold) LBb (fold) PA0059 osmC Adaptation, protection 3.75 1.23 .29 PA2386 pvdA Adaptation, protection 3.89 .50 1.07 #PA2397 pvdE Adaptation, protection, membrane proteins, transport of small molecules 3.92 .00 .99 PA2401 Adaptation, protection 3.06 .00 .74 PA4468 sodM Adaptation, protection 5.60 .30 1.02 PA2018 Antibiotic resistance and susceptibility, membrane proteins, transport of small molecules 3.88 .50 1.65 PA2019 Antibiotic resistance and susceptibility, transport of small molecules 4.16 .50 .36 PA1985 pqqA Biosynthesis of cofactors, prosthetic groups, and carriers 2.99 .10 .24 PA1988 pqqD Biosynthesis of cofactors, prosthetic groups, and carriers 3.18 .50 .28 PA1989 pqqE Biosynthesis of cofactors, prosthetic groups, and carriers 3.00 1.44 .34 #PA2414 Carbon compound catabolism 5.17 .00 .29 PA3158 wbpB Cell wall, LPS, and capsule; putative enzymes 5.76 .20 .08 PA0102 Central intermediary metabolism 3.38 .40 .15 PA2393 Central intermediary metabolism 3.27 .70 .76 PA2717 cpo Central intermediary metabolism 4.75 1.21 .72 PA4470 fumC1 Energy metabolism 5.81 1.05 .62 PA5491 Energy metabolism 2.97 .30 1.08 #PA0320 Hypothetical 3.86 .80 .43 PA0586 Hypothetical 5.10 1.61 1.96 PA0587 Hypothetical 4.57 1.11 1.64

PAGE 42

29 Table 2-4. Continued ID no.a Gene Function Fold change in mucA22 vs wild type** TSBb (fold) LBb (fold) PA0588 Hypothetical 4.57 1.12 1.64 PA0613 Hypothetical 3.60 1.14 .55 #PA0737 Hypothetical 10.80 1.70 .00 PA0807 Hypothetical 3.97 1.21 .52 PA0990 Hypothetical 3.45 2.31 .48 PA1245 Hypothetical; membrane proteins 5.12 .10 .20 PA1323 Hypothetical 4.21 1.94 2.25 #PA1471 Hypothetical 12.4 1.46 1.07 #PA1784 Hypothetical 6.71 1.33 .31 PA1852 Hypothetical 3.34 1.90 .03 PA2159 Hypothetical 3.56 1.44 .46 PA2161 Hypothetical 2.95 1.50 .92 #PA2167 Hypothetical 9.54 1.16 .06 PA2168 Hypothetical 3.20 .20 .80 #PA2172 Hypothetical 3.86 .90 .99 PA2176 Hypothetical 7.30 1.79 2.10 PA2403 Hypothetical; membrane proteins 4.96 .30 .52 PA2404 Hypothetical; membrane proteins 5.83 1.27 .69 #PA2405 Hypothetical 10.00 1.10 .91 PA2406 Hypothetical 5.79 .10 .22 PA2412 Hypothetical 4.56 .30 .72 PA2485 Hypothetical 5.16 .20 5.51 PA2486 Hypothetical 6.30 1.17 1.41 PA2562 Hypothetical 3.30 1.27 2.38 PA3274 Hypothetical 5.30 1.61 .16 PA4154 Hypothetical 3.63 1.49 1.08 #PA4469 Hypothetical 8.78 .30 .64 PA4471 Hypothetical 3.00 .00 .49 PA5182 Hypothetical; membrane proteins 4.81 1.29 2.11 PA5183 Hypothetical; membrane proteins 3.88 1.20 2.02 PA5212 Hypothetical 3.24 1.32 1.83 PA2409 Membrane proteins, transport of small molecules 4.21 .20 .46 PA4876 osmE Membrane proteins, adaptation, protection 3.00 1.36 1.27 PA2407 Motility and attachment 4.73 .20 .61

PAGE 43

30 Table 2-4. Continued ID no.a Gene Function Fold change in mucA22 vs wild type** TSBb (fold) LBb (fold) PA2385 Putative enzymes 3.19 1.05 .36 PA2394 Putative enzymes 3.56 1.00 .75 PA2402 Putative enzymes 3.18 .70 .00 PA2413 Putative enzymes 5.97 1.46 .32 PA4785 Putative enzymes 4.51 1.70 .98 PA0724 Related to phage, transposon, or plasmid 3.48 1.83 .39 PA1300 Transcriptional regulators 3.66 .70 .13 PA2426 pvdS Transcriptional regulators 4.39 .40 .38 PA2408 Transport of small molecules 4.09 2.08 .14 PA3049 rmf Translation, posttranslational modification, degradation 6.81 2.03 1.38 PA3188 Transport of small molecules 3.08 4.04 15.76 PA5470 Translation, posttranslational modification, degradation 3.31 .50 1.15 #PA2398 fpvA Transport of small molecules 6.65 .10 .51 *, genes with FDR<5% and changes greater than threefold. **, Expression data is presented as fold change in mucA22 relative to wild-type PAK. a #, up regulated in mucA mutant compared to PAK, but down regulated in PAK under type II I-inducing conditions versus noninducing conditions, and vice versa. Not included are those known to be affected by the growth medium, such as those varied in TSB versus LB (140). b Change in gene expression in PAK grown under TTSS inducing conditions versus PAK grown under TTSS noninducing conditions (140). B acteria were grown in TSB or LB. Table 2-5. Genes down regulated in PAK mucA22 (examed in microarray) ID no.a Gene Function Fold change in mucA22 vs wild type** TSBb (fold) LBb (fold) PA3450 Adaptation, protection .5 1.84 1.17 PA2138 DNA replication, recombination, modification, and repair .2 .50 .19 PA0523 norC Energy metabolism .0 .70 .7 #PA3445 Hypothetical .9 2.66 1.59 #PA3446 Hypothetical .1 1.36 1.57 PA3931 Hypothetical .8 1.91 1.22 PA0281 cysW Membrane proteins, transport of small molecules .5 1.18 1.13 PA0282 cysT Membrane proteins, transport of small molecules .0 .10 .07 PA1601 Putative enzymes .5 1.35 .44 PA3444 Putative enzymes .1 1.11 .51

PAGE 44

31 Table 2-5. Continued ID no.a Gene Function Fold change in mucA22 vs wild type** TSBb (fold) LBb (fold) PA1246 aprD Secreted factors (toxins, enzymes, alginate); protein secretion-export apparatus .4 2.05 .64 PA1312 Transcriptional regulators .1 .10 .55 PA3927 Transcriptional regulators .1 .70 .67 PA0198 exbB1 Transport of small molecules .5 2.71 .68 PA0280 cysA Transport of small molecules .0 .00 .18 PA2204 Transport of small molecules .7 1.16 .16 *, genes with FDR<5% and changes greater th an threefold. **, Expression data is presented as fold change in mucA22 relative to wild-type PAK. a #, up regulated in mucA mutant compared to PAK but down regulated in PAK under type III-inducing conditions versus noninducing conditions and vice versa. Not included are those known to be affected by the growth medium, such as those varied in TSB versus LB (140). b Change in gene expression in PAK grown under TTSS inducing conditions versus PAK grown under TTSS noninducing conditions (140). B acteria were grown in TSB or LB. TTSS Repression in the mucA Mutant is AlgU Dependent. MucA is an anti-sigma factor whic h represses the acti vity of AlgU ( 22). In the mucA mutant, AlgU is derepresse d and activates the expressi on of genes for alginate synthesis, resulting in a mucoid phenotype. AlgU can also activate the expression of itself and downstream genes ( mucA-B-C-D ) in the same operon. To determine the role of AlgU in the repression of TTSS in the mucA mutant, the algU gene was knocked out in the background of PAK mucA22 resulting in a PAK mucA22algU ::Gm double mutant. Under TTSS inducing conditions, expression of the exsA and exoS genes in this double mutant was similar to that in the wild-type (Fig. 2-2B and C), indi cating that AlgU is required for the TTSS repression in the mucA mutant. An algU ::Gm mutant was further generated in the background of PAK, and TTSS activity in the resulting mutant was compared with that in PAK. As shown in Fig. 2-3, expression of the exsA and exoS genes was the same in the PAK algU ::Gm mutant and wild-type PAK under both TTSS

PAGE 45

32 inducing and noninducing condition s, suggesting that the basa l level of AlgU in wildtype P. aeruginosa does not play a significant role in the regulation of TTSS genes. Figure 2-3. Expression of exsA :: lacZ (A) and exoS :: lacZ (B) in strains PAK, PAK mucA22 PAK algU ::Gm, and PAK harboring algU overexpression plasmid pWW025. Bacteria were grown in LB (white bars) or LB plus 5 mM EGTA (black bars) to an OD600 of 1 to 2 before -galactosidase assays. *, P <0.05, compared to the values in PAK. When the algU gene was overexpressed in wild-type PAK by introducing pWW025, the TTSS activity was partially re pressed under type III -inducing conditions 0 500 1000 1500 2 000 2 500 3000 3500 4 000PAK mucA22 PAK /pWW025 PAK algU ::Gm -Galactosidase activity (Miller unit) 0 50 100 150 200 250 300PAK mucA22 PAK /pWW025 PAK algU ::Gm -Galactosidase activity (Miller unit) A B * *

PAGE 46

33 (Fig. 2-3B). Since AlgU me diates the activation of the algU mucA operon, an extra copy of algU also increased the expression of its repressor MucA; thus, overexpression of the algU gene could not repress TTSS expr ession to the level seen in the mucA mutant. AlgR has a Negative Regulatory Function on the TTSS algR is a regulatory gene required for algina te synthesis and is under the control of AlgU (78, 146). To investigate the role of AlgR in the regulation of TTSS, the algR gene was knocked out in the background of PAK mucA22 In the PAK mucA22algR ::Gm double mutant, the expression of the exsA and exoS genes was restored to that of the wild type (Fig. 2-2A and B), suggesting that the repressi on of TTSS in the mucA mutant is also AlgR dependent. To test the functi on of AlgR on TTSS in wild-type P. aeruginosa an algR ::Gm mutant was generated in the P AK background. The expression of the exoS gene was consistently hi gher in the resulting PAK algR ::Gm mutant than in PAK under both type III inducing and noni nducing conditions (Fig. 2-4B). However, the expression of the exsA gene was similar in the PAK algR ::Gm mutant and wild-type PAK. Complementation of the algR mutant with an algR -expressing clone (pWW022) decreased exsA and exoS expression under both type III inducing and noninducing conditions (Fig. 2-4). Howe ver, higher expression of algR induced by increasing the amount of isopropyl--D-thiog alactopyranoside (IPTG) c ould not further decrease exsA and exoS expression (Fig. 2-4). These results indicate that AlgR has a negative regulatory effect on the TTSS, but the up regula tion of AlgR alone might not be sufficient to repress TTSS activity to the level seen in the mucA mutant. It is likely that in the mucA mutant, algR gene expression is activated by AlgU, which in turn represses TTSS activity.

PAGE 47

34 Figure 2-4. Expression of exsA :: lacZ (A) and exoS :: lacZ (B) in the backgrounds of PAK, PAK mucA22 PAK algR ::Gm, and PAK algR ::Gm complemented with algR expressing plasmid pWW022. For algR gene complementation, various concentrations of IPTG were added in to the culture medium as indicated. Bacteria were grown in LB (white bars ) or LB plus 5 mM EGTA (black bars) to an OD600 of 1 to 2 before -ga lactosidase assays. *, P < 0.05, compared to the values in PAK; **, P < 0.01, compared to the values in mucA22 Discussion and Future Directions The Expression of exsA in the mucA Mutant TTSS is an important virulence determinant for P. aeruginosa : it inhibits the host defense system by inducing apoptosis in macrophages, polymorphonuclear phagocytes, and epithelial cells. In our screen fo r mutants with lower TTSS activities, mucA mutants were found defective in exoT expression under type III-inducing conditions. PAK mucA22 PAK algR ::Gm/pWW022 PAK algR ::Gm -Galactosidase ac tivity (Miller unit) 0 g/ml 250 g/ml 500 g/ml IPTG 0 500 1000 1500 2000 2500 3000 3500 4000 4500PAK mucA22 -Galactosidase ac tivity (Miller unit) PAK algR ::Gm/pWW022 0 g/ml 250 g/ml 500 g/ml 0 50 100 150 200 250 300 350 400*PAK algR ::Gm IPTG * * * * ** **

PAGE 48

35 Furthermore, the basal promoter activity of the type III master regulatory gene exsA was decreased twoto threefold in the mucA mutant compared to that in wild-type PAK, suggesting that the down regulation of TTSS genes occurs through repression of ExsA. Since ExsA is an autoactivator (60), the repr ession could be on the transcriptional or posttranscriptional level. Ou r microarray results showed th at the transcript level of exsA in the mucA mutant was similar to that in wi ld-type PAK under type III-inducing conditions, which suggested th at the activity of ExsA might be repressed at the posttranscriptional level. However, the data from exsA :: lacZ reporter plasmid indicates that the promoter activity of exsA gene is much lower in the mucA mutant (Fig.2-1B). Real-time PCR may be necessary to preci sely determine the mRNA levels of exsA gene. Further study is required to clarify the mechanism of exsA gene regulation. The Regulatory Pathway of AlgU Regulon MucA is a transmembrane protein, with its cytoplasmic domain binding to and repressing the sigma factor AlgU. Mutation in the mucA gene leads to derepression of AlgU, which in turn activates genes for algi nate synthesis as well as others, such as dsbA oprF osmE and rpoH (32, 80). In the mucA mutant, not only the sigma factor AlgU but also AlgQ, an anti70 factor, are activated (31), thus posing the possibility that sigma factor competition by AlgU and AlgQ eff ectively decreases th e availability of 70containing RNA polymerase for the expression of TTSS related genes (62). However, the observation that AlgR, an AlgU-dependent transcriptional activator, is required for the TTSS suppression makes it unlikely that si gma factor competition leads to the type III gene suppression; instead, an AlgR-dependent repressor is likely i nvolved. AlgR is a global regulator, affecting expression of multip le genes. Proteomics analysis of an algR ::Gm mutant showed that more than 17 pr oteins were up regulat ed and 30 proteins

PAGE 49

36 were down regulated (77). In the presen t study, AlgR was also found to mediate the repression of type III secretion genes. In the PAK algR ::Gm mutant background, expression of the exoS gene was higher than in wild -type PAK and, when complemented by an algR gene clone, expression of exsA and exoS genes decreased to about 50% of that seen in wild-type PAK (Fig. 2-4). The inabil ity to suppress TTSS genes to the level seen in the mucA mutant by pWW022 was possibly due to a lower level of expression of the algR gene from pWW022 than that in the PAK mucA background, in which algR is activated through the MucA-A lgU pathway. pMMB67HE is a low-copy-number plasmid (38), and the tac promoter is not as strong a promoter in P. aeruginosa as it is in E. coli AlgR is a DNA binding protein which bi nds to the promoter regions of algD (93) and hcnA (hydrogen cyanide synthesis gene) (15). It is possible that AlgR represses exsA expression by directly binding to the promoter region of the exsCEBA operon. The protein-DNA binding can be tested by gel-shift assay and the algD promoter can be used as a positive control. Alternatively, other regulatory genes might be involved in the repression of TTSS. Further study is n eeded to understand this observation. We propose a model for TTSS repression in the mucA mutant (Fig. 2-5). With the activation of AlgU, the regulatory genes algP algQ algB and algR are activated, which up regulates the expression of the algD operon. AlgR is required for TTSS repression in the mucA mutant, but whether the repression func tion is directly on ExsA or not is unclear. The involvement of other regulatory genes ( algP algQ and algB ) in TTSS regulation awaits further study. The TTSS Activity in P. aeruginosa CF Isolates During chronic infection of CF patient airways, P. aeruginosa overproduces alginate and forms a biofilm (58). Alginate production is known to be activated by high

PAGE 50

37 osmolarity, nitrogen limitation, and membra ne perturbation induced by ethanol (10); thus, the high salt concentration in the CF patient airway might be a signal for the overproduction of alginate. The biofilm mode of growth can help the bacterium survive in hostile environments and also rend er resistance against macrophages and polymorphonuclear cells (58). Figure 2-5. Proposed model of MucA-mediate d coordination of al ginate production and TTSS expression. MucA is a transmem brane protein, with its cytoplasmic portion binding and inhibiting the sigma f actor AlgU. Upon sensing of certain environmental stress signals by the periplasmic MucB, it signals MucA through the periplasmic domain to rel ease the bound AlgU. Free AlgU is required for the expression of downstr eam transcriptional activators AlgP, AlgQ, AlgB, and AlgR, all of which c ontribute to the optimal expression of the algD operon, encoding enzymes for the s ynthesis of alginate. AlgR, on the other hand, also activa tes downstream genes which are responsible for the suppression of the type III secretion genes. Our experimental data suggest that bacter ia have evolved a mechanism to turn off TTSS when they need to synthesize alginate to overcome environmental stress. Such AlgU AlgP AlgQ MucB AlgB AlgR algD operon Alginate ??? ExsA TTSS MucA

PAGE 51

38 coordinated regulation of two energy-expensiv e processes is likely to render to the bacterium a survival advantage under environm ental stress conditions. In addition, when the bacteria are surrounded by alginate, no in timate contact can be established between the bacteria and host cells. Under this ci rcumstance, the TTSS needle can not reach the host cell membrane, which renders the TTSS un necessary. This might be another reason to turn off TTSS while over producing alginate. Indeed, a majority of P. aeruginosa isolates from CF patients at a late stage in the disease displays the mucoid phenotype (34, 111) and are defective in type III gene expres sion (22). In a prev ious report, introduction of the wild-type exsA gene into type III secretion-defectiv e clinical isolates restored type III secretion (22). However, our attempts to restore TTSS gene expression in 10 mucoid CF isolates by introducing a mucA gene clone failed, althoug h all of the transformants were reverted back to the nonmucoid phenotype. It is possible that t hose mucoid clinical isolates may harbor additional mutations in the TTSS genes. Genes Differently Expressed in the mucA Mutant and Isogenic Wild-type PAK Known TTSS regulators include ExsA, Vfr, CyaA/B, ExsD, ExsC and ExsE (27, 60, 89, 106, 130, 140). Recently, DsbA and AceAB were also found to be necessary for the expression of TTSS. AceA and -B are subunits of pyruvate dehydrogenase, suggesting that metabolic imbalance influen ces the expression of TTSS (23, 107). DsbA is a periplasmic thiol-disulfide oxidoreducta se and was shown to affect TTSS expression, twitching motility, and intracellular survival of P. aeruginosa upon infection of HeLa cells (48, 80). Interestingly, the dsbA gene is up regulated in the mucA mutant background, and its expression was shown to be regulated by AlgU (80). However, the role of DsbA on the TTSS is believed to be through its general effect on protein disulfide

PAGE 52

39 bond formation in the periplasm, and up regulatio n of this gene may not be related to the MucA-AlgU-AglR-mediated suppression of the TTSS. From the microarray analysis of the mucA mutant and wild-typ e strain under TTSS inducing conditions, alginate synthesis genes and genes known to be under the control of AlgU were up regulated, while TTSS genes were down regulated in the mucA mutant (Tables 2-2 and -3). In addition, pyoverd ine synthesis genes as well as an operon, PA4468-4471, which might be under the control of Fur (54), were up regulated in the mucA mutant under TTSS-inducing conditions (Table 2-4). These findings are consistent with published results, in which mucoid P. aeruginosa strains produced higher levels of pyoverdine, pyochelin, manganese superoxi de dismutase (PA4468), and fumarase (PA4470) than wild-type strain s (52) (53). However, pyoche lin synthesis genes were not seen up regulated in our microarray data. The mechanism by which these genes are up regulated in the mucA mutant background is not known. The mucA gene mutation-mediated suppression of the TTSS genes requires AlgR, which is a transcriptional regulator; thus, it is likely that AlgR may repress TTSS genes or an AlgR-regulated repressor mediates th e suppression of TTSS genes. To identify such candidate genes from the gene array da ta, I initially identified genes that were differentially expressed in the mucA mutant compared to w ild-type PAK under type III inducing conditions. The selected genes include those that were up regulated in the mucA mutant compared to PAK under type III inducin g conditions but were down regulated in PAK under type III inducing conditions versus noninducing conditions, and vice versa. I further eliminated those known to be affected by the growth medium, such as those with varied responses in tryptic soy broth (TSB) ve rsus LB (140). Based on the above criteria,

PAGE 53

40 13 genes were identified (Tables 2-4 and -5 ). For example, expression of the PA2172 gene in mucA22 was up regulated about fourfold co mpared to that in wild-type PAK under TTSS inducing conditions. From published data, the expression of this gene was down regulated twofold in wild-type PAK grown under type III inducing conditions compared to that under noninducing conditi ons (140). Therefore, mutation in the mucA gene reversed the expression of PA2172 in response to the type III-inducing signal. Among the 13 genes, pvdE and fpvA are involved in pyoverdine synthesis and absorption, respectively; PA2414 is involve d in carbon compound catabolism. The remaining 10 genes are all hypothetical ge nes. The expression of PA0737, PA2167, PA2176, and PA4785 seems to be ExsA dependent, since in the exsA mutant the expression of these genes was lower than in wild-type PAK unde r type III inducing conditions and overexpression of exsA could activate expression of these genes under non-type III-inducing conditions (140). It is reasonable to hypothesize that one or more of such differentially expr essed genes mediate the repr ession of the TTSS in the mucA mutant. It will be interesting to mutate each of these candidate genes in the background of PAK mucA22 and test the TTSS activities. Another approach to identify the TTSS repr essor is to screen a random Tn library generated in the background of PAK mucA22 for those mutants with restored wild-type TTSS activity. In those mutants, the TT SS repressor should be knocked out by the insertion of Tn. There are tw o potential pitfalls in this Tn mutagenesis strategy. One is that the mucA mutant over produces alginate which might obstruct the intimate contact between the E. coli donor strain and the P. aeruginosa recipient strain. To solve this problem, I can knock out the alginate synthesis gene, algD which would render the mucA

PAGE 54

41 mutant non-mucoid. The other problem is that, when cultured statically, mucA mutants tend to become non-mucoid, due to spontaneous mutations in the algU gene (143). During the conjugation for Tn mutagenesis, algU mutants may accumulate in the population. These mucAalgU double mutants display wild-type TTSS activity, which may lead to wrong interpretation of Tn mutate d genes. It was reported that cultures containing the alternative electron acceptor ni trate may decrease the mutation rate of the algU gene. So during the conjugation, nitrate can be added into the nutrient agar. In conclusion, in mucA mutants, the TTSS is represse d and the repression is AlgU and AlgR dependent. Most P. aeruginosa clinical isolates from CF patients display mucoid phenotype and are defective in the TTSS. This study provides possible explanation on the relationship between thes e two phenotypes and indicates that during chronic infection, P. aeruginosa might over produce alginate, which might function as a protection mechanism, and down regulat e the TTSS, a virulence factor.

PAGE 55

42 CHAPTER 3 PtrB OF Pseudomonas aeruginosa SUPPRESSES THE TYPE III SECRETION SYSTEM UNDER THE STRE SS OF DNA DAMAGE Introduction As described in Chapter 2, two muta nts with Tn inserted into the prtR gene were found to be defective in th e TTSS activity. PrtR is a CI homologue which binds to the promoter region of the prtN gene and inhibits its expressi on. PrtN is an activator of genes required for the production of a kind of bacteriocins, called pyocins. Three types of pyocins, R-, Fand S-type, have been identified. Rand F-type pyocins resemble phage tails. After they bind to their receptors, lipopolysaccharides (LPS), R-type pyocins cause a depolarization of the cytoplasmic me mbrane, which leads to cell death. S-type pyocins cause cell death by DNA breakdown due to their endonuclease ac tivity (90). The uptake of most S-type pyocins occurs thr ough ferripyoverdine receptors so that their killing activity is great ly increased when bacteria are grown under iron-limited conditions (7). The production of pyocins is induced by DNA-damaging agents, such as UV light and mitomycin C, when the bacterial SOS re sponse is activated. Under these conditions, the RecA protein is activated and cleaves Pr tR. As a result, PrtN is up regulated and actives the expression of pyoc in synthesis genes (86, 90). In this Chapter, I describe a coordinated repression of the TTSS under the stress of DNA damage. The expression of TTSS genes was found to be repressed in the background of a prtR mutant. Further analysis eliminat ed the possible involvement of the prtN gene in the TTSS repression. A gene designated ptrB has been identified which is

PAGE 56

43 specifically repressed by PrtR and mediates the suppression of the TTSS genes. PtrB has a prokaryotic DskA/TraR C4-type zinc-finger mo tif but may not directly interact with the master regulator, ExsA. Material and Methords Bacterial Strains and Growth Conditions Plasmids and bacterial strains used in th is study are listed in Table 3-1. Growth conditions and antibiotic concentrations ar e the same as described in Chapter 2. Table 3-1. Strains and plas mids used in this study Strain or plasmid Description Source or reference E. coli strains BW20767/pRL27 RP4-2-Tc::Mu-1 kan::Tn 7 integrant leu-63 ::IS10 recA1 zbf-5 creB510 hsdR17 endA1 thi uidA ( Mlu I):: pir+/pRL27 (71) DH5 / pir 80 dlacZ M15 ( lacZYA-argF ) U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 / pir (71) P. aeruginosa strains PAK Wild-type P. aeruginosa strain David Bradley PAK A51 PAK prtR ::Tn 5 mutant isolate; Neor This study PAK prtNprtR ::Gm PAK with prtN and prtR disrupted by replacement of Gm cassette; Gmr This study PAK prtN ::Gm PAK with prtN disrupted by in sertion of Gm cassette; Gmr This study F4 PAK prtNprtR ::GmPA0612::Tn5; Gmr Neor This study PAK prtNprtR ::Gm PA0612-613 PAK prtNprtR ::Gm with deletion of PA0612 and PA0613; Gmr This study PAK prtNprtR ::Gm PA0612 PAK prtNprtR ::Gm with deletion of PA0612; Gmr This study PAK prtNprtR ::Gm PA0613 PAK prtNprtR ::Gm with deletion of PA0613; Gmr This study PAK PA0612-613 PAK with deletion of PA0612 and PA0613 This study PAK PA0612 PAK with deletion of PA0612 This study PAK PA0613 PAK with deletion of PA0613 This study Plasmids pCR2.1-TOPO Cloning vector for the PCR products Invitrogen pHW0005 exoS promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (46)

PAGE 57

44 Table 3-2. Continued Strain or plasmid Description Source or reference pHW0006 exoT promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr (46) pUCP19 Shuttle vector between E. coli and P. aeruginosa (47) pEX18Gm Gene replacement vector; Gmr, oriT+ sacB+ (55) pEX18Ap Gene replacement vector; Apr, oriT+ sacB+ (55) pPS856 Source of Gmr cassette; Apr Gmr (55) pWW031 prtN gene of PAK on pUCP19 driven by lac promoter; Apr This study pWW037 prtR gene of PAK on pUCP19 driven by lac promoter; Apr This study pWW033 prtN disrupted by insertion of Gm cassette on pEX18Ap; Apr Gmr This study pWW035 prtN and prtR disrupted by replacement of Gm cassette on pEX18Ap; Apr Gmr This study pWW048-1 PA0612 promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr This study pWW048-2 exsC promoter of PAK fused to promoterless lacZ on pDN19lacZ ; Spr Smr Tcr This study pWW069 Deletion of PA0612 and PA0613 on plasmid pEX18Ap; Apr This study pWW070 Deletion of PA0612 and PA0613 on plasmid pEX18Gm; Gmr This study pWW075 Deletion of PA0612 on plasmid pEX18Gm; Gmr This study pWW076 Deletion of PA0613 on plasmid pEX18Gm; Gmr This study pWW071 PA0613 open reading frame cloned into pCR2.1TOPO; Apr This study pWW072 PA0612 open reading frame cloned into pCR2.1TOPO; Apr This study pBT Bait vector plasmid encoding full length bacterial phage c I protein; Chlr Stratagene pTRG Target vector plasmid encoding RNAP-alpha subunit protein; Tcr Stratagene pBT-LGF2 Interaction contro l plasmid containing dimerization domain of Gal4 on bait vector; Chlr Stratagene pTRG-Gal 11p Interaction control plasmid encoding mutant form of Gal11 on target vector; Tcr Stratagene pWW077 PA0612 open reading frame cloned into pTRG; Tcr This study pWW078 PA0613 open reading frame cloned into pTRG; Tcr This study pWW079 PA0612 open readi ng frame cloned into pBT; Chlr This study pWW080 PA0613 open readi ng frame cloned into pBT; Chlr This study pHW0315 exsA open reading frame cloned into pTRG; Tcr (47) pWW081 exsA open reading frame cloned into pBT; Chlr This study

PAGE 58

45 For prtR gene complementation, a prtR containing fragment was amplified from PAK genomic DNA by PCR (Table 3-2). The PCR product was cloned into pCR2.1TOPO (Invitrogen), resulting in pTopoprtR From pTopoprtR the prtR gene was isolated as a Hin cIIHin dIII fragment and cloned into Sma IHin dIII sites of pUCP19, resulting in pWW037, where the prtR gene is driven by a lac promoter. For prtN gene overexpression, prtN coding sequence was amplified by P CR (Table 3-2), initially cloned into pCR2.1-TOPO, and subcloned into Hin dIIIXba I sites of pUCP19, where the expression of the prtN gene in the resulting plasmid, pWW031, was driven by the lac promoter on the vector. The promoter region of PA0612 was amplified from PAK chromosomal DNA (Table 3-2), cloned into pCR2.1-TOPO, and subcloned into Eco RIBam HI sites of pDN19 lacZ resulting in pWW048-1. For the construction of exsC :: lacZ reporter plasmid, a P CR product containing exsCEBA (Table 3-2) was cloned into pCR2.1-TOPO. The exsC promoter was cut out with Eco RI and Hin cII, and subcloned into pDN19 lacZ Chromosomal gene mutations were genera ted as described (5 5). A fragment containing the prtN and prtR genes was amplified by PCR using the primers PrtR1 and PrtN2. The PCR product was cloned into pCR2.1-TOPO and subcloned into Hin dIIIXba I sites of pEX18Ap, resul ting in pEX18Ap-prtNR. For construction of a prtN prtR double mutant, a Sph I fragment containing 3'-terminal sequence of prtR and 5'-terminal sequence of prtN was replaced with a gentamicin resistance cassette, resulting in pWW035. For the construction of PA 0612-613, PA0612, and PA0613 mutants, a 2.4-kb fragment was amplified from PAK chro mosomal DNA with primers 612-3M1 and 6123M2 (Table 3-2), followed by cloning into pCR2.1-TOPO. A SacII fragment containing

PAGE 59

46 both PA0612 and PA0613 was deleted to generate the PA0612-613 mutant. A 76-bp SacII-PstI fragment within PA0612 was removed to generate the PA0612 mutant, while a 116-bp ClaI-SacII fragment was deleted to ge nerate the PA0613 mutant. The resulting plasmids were transformed into wild-type PAK or PAK prtNprtR ::Gm and selected for single and double crossover mutants as descri bed previously (55). Construction of a transposon (Tn5) insertion mutant library, pl asmid rescue, and sequence analysis were conducted as described in Chapter 2. Table 3-2. PCR primers used in this study Gene Amplicon size (bp) Sequences of primers ptrR 1,355 PrtR1: 5'-CCAGTTCGTTGGCGTGATCGGCAAGGTC-3' PrtR2: 5'-CCCTCCTGCGGCTACACGTCGTTGAGGG-3' prtN 1,376 PrtN1: 5'-CCATGCAGCCATCCATCGCCCCTAGCAC-3' PrtN2: 5'-CCGTCGCAGCGCATGTCCATCGAATTCA-3' ptrB (promoter) 616 lac1H: 5'-AAGCTTTCGGGCGGGATCTGGGTGCTCT-3' lacB2: 5'-TGGGATCCCCGCAGTCCTCGCAGTCTTC-3' PA0612-3 2,417 612-3M1: 5'-AAGCTTATCTGGCGGCTGCGCATGTCCT-3' 612-3M2: 5'-CAGCATCACCGCCACGCCGCAGACAATC-3' PA0612 240 612BT1: 5'-GCGGCCGCCACGCCAGGGAGGCTTTCCA-3' 612BT2: 5'-CTCGAGGTCGGTTCAACGGCGCTCGTGG-3' PA0613 417 613BT1: 5'-GCGGCCGCGAAAGGAGACACGACCGTGAT-3' 613BT2: 5'-CTCGAGGGGGGACACGGTATCCGGTCCAG-3' exsCEBA 2662 exsA1: 5-TGCAGCTCATCCAGCAGTACACCCAGAGCCATAAC-3 exsA3: 5-ACAAACTGCTCGATGCGTAACCCGGCACC-3 PA0612-3 (RTPCR) 649 612GS1: 5'-GGATCCCCATGGCTGACCTTGCCGATCAC-3' 613BT2: 5'-CTCGAGGGGGGACACGGTATCCGGTCCAG-3' ptrB (Q-PCR)a 101 Forward: 5'-GATCACGCCAACGAACTGGTC-3' Reverse: 5'-CCGCAGTCCTCGCAGTCTTCC-3' rpsL (Q-PCR) 120 Forward: 5'-CAAGCGCATGGTCGACAAGAG-3' Reverse: 5'-ACCTTACGCAGTGCCGAGTTC-3' RT-PCR and Quantitative Real-time PCR Overnight cultures of bacterial cells were diluted 100-fold into fresh medium and grown to an optical density at 600 nm (OD600) of 1.0. Total RNA was isolated with an RNeasy Mini kit (QIAGEN). DNA was eliminat ed by column digestion as described by

PAGE 60

47 the manufacturer (QIAGEN). cDNA was synthe sized with an iScrip t cDNA synthesis kit (Bio-Rad). Taq DNA polymerase from E ppendorf was used in PCRs. The cDNAs synthesized by reverse transc ription-PCR (RT-PCR) were used as templates in quantitative real-time PCR. The cDNA was mixed with 5pm ol of forward and reverse primers (Table 3-2) and iQ SYBR Green Supe rmix (Bio-Rad). Quantitative real-time PCR was conducted using the ABI Prism 7000 sequence detection system (Applied Biosystems). The results were analyzed w ith ABI Prism 7000 SDS software. Transcript for the 30S ribosomal protein ( rpsL ) was used as an internal standard to compensate for differences in the amount of cDNA. The mRNA levels of ptrB in test strains were expressed relative to that of PAK, which was set at 1.00. Cytotoxicity Assay HeLa cells (5 x 104) were seeded into each well of a 24-well plate. The cells were cultured in Dulbecco's modified Eagle's medi um with 5% fetal calf serum at 37C with 5% CO2 for 24 h. Overnight bacterial cultures were washed with LB and subcultured to log phase before infection. Bacteria were washed once with phosphate-buffered saline and resuspended in tissue culture medium. HeLa cells were in fected with the bacteria at a multiplicity of infection (MO I) of 20. A cell lifting assay was performed after 4 h of infection. Culture medium in each well was aspirated. Cells were washed twice with phosphate-buffered saline (PBS) and stained w ith 0.05% crystal violet for 5 min. The stain solution was discarded, and the plates were washed twice with water. A 250-l volume of 95% ethanol was then added into ea ch well and incubated at room temperature for 30 min with gentle shaking. The ethanol solution with dissolved crystal violet dye was used to measure absorbance at a wavelength of 590 nm.

PAGE 61

48 Application of BacterioMatch Two-hybrid System PA0612 and PA0613 open reading frames we re amplified from PAK chromosomal DNA with primers 612BT1 plus 612BT2 and 613BT1 plus 613BT2, respectively (Table 3-2). The PCR products were cloned into pCR2.1-TOPO, and each was subcloned into Not IXho I sites of pBT and pTRG, resulting in pWW079 (PA0612 in pBT), pWW077 (PA0612 in pTRG), pWW080 (PA0613 in pBT) and pWW078 (PA0613 in pTRG). The exsA open reading frame was isolated from pHW0315 ( exsA in pTRG) as a Not ISpe I fragment. The Spe I site was blunt ende d and ligated into Not ISma I sites of pBT, resulting in pWW081 ( exsA in pBT). Desired pairs of plasmids were cotransformed into a reporter strain by electropor ation, and the protein-protei n interaction assays were performed following the protocol supplied by the manufacturer (Stratagene). The interaction between two proteins is indicated by the expression level of a lacZ reporter gene. By testing the -galactosidase activity of the re porter strains containing cloned genes on pBT and pTRG, the interaction be tween the two proteins can be tested. Other Methods Western blotting, -Galactosidase activity assays and statistical assays were done as described in Chapter 2. For twitching mo tility assays, bacteria were stabbed into a thin-layer LB plate and incubated overnight at 37C. The LB plate was directly stained with Coomassie blue at room temperatur e for 5 min and destained with destaining solution. Results TTSS Is Repressed in a prtR Mutant As described in Chapter 2, by screening a Tn insertion library consisting of 40,000 independent mutants, two prtR mutants were found to be defective in TTSS activity (Fig.

PAGE 62

49 3-1). Complementation of the original prtR ::Tn mutants with a prtR gene partially restored the TTSS activity (Fig. 3-1A). PrtR is a repressor of pyocin synthesis, which is a set of bacteriocins synthesized by P. aeruginosa PrtR binds to the promoter region of the prtN gene and represses its expression. Pr tN is also a DNA binding protein which recognizes a highly conserved sequence (P box) present upstream of pyocin synthesis genes and activates their expression (86). Based on this regulator y pathway, either the up-regulated PrtN is respons ible for the TTSS repression or another gene under the control of PrtR mediates the TTSS repression. To te st these possibilities, a prtR prtN double mutant was generated in the background of wild-type PAK. The resulting mutant, PAK prtNprtR ::Gm, had the same TTSS defect as the prtR ::Tn5 mutant (Fig. 3-1A and B), and complementation by a prtR gene (pWW037) but not by a prtN gene (pWW031) restored the TTSS inducibility (Fig. 31A). Furthermore, introduction of a prtN expressing clone in a high-copy-number plas mid (pWW031) in wild-type PAK had no effect on the TTSS activity (Fig. 3-1A and B). Thus, all of the a bove results indicated that PrtN is not involved in the TTSS repres sion. Therefore, it is likely that another gene(s) under the control of PrtR mediates the repression of the TTSS. Identification of the PrtR-reg ulated Repressor of the TTSS Since PrtR functions as a repressor, it might also repress the expression of a hypothetical TTSS repressor. With the mutation in prtR this hypothetical repressor would be up regulated and therefore would re press the expression of the TTSS. Thus, upon inactivation of this repressor gene in the prtR mutant background, the TTSS activity should be restored to that of wild-type. To identify this hypothetical repressor, the prtNprtR ::Gm double mutant containing exoT :: lacZ (pHW0006) was subjected to transposon mutagenesis. A plasmid c ontaining a Tn5 transposon (pRL27) was

PAGE 63

50 transferred from E. coli donor strain BW20767 into P. aeruginosa by conjugation. The double mutant strain prtNprtR ::Gm was chosen as a recipien t, since it has an identical phenotype of a TTSS defect as the prtR ::Tn mutant. More importantly, constitutive production of pyocin by a prtR mutant seems to have a detrimental effect on the E. coli donor strain which may lowe r the conjugation frequency. Figure 3-1. Expression and secretio n of ExoS. (A) Expression of exoS :: lacZ in the backgrounds of PAK, prtR ::Tn5, prtR ::Tn5 containing prtR expression plasmid pWW037 ( prtR -pUCP19), prtNR ::Gm, prtNR ::Gm containing pWW037 ( prtR -pUCP19) or prtN expression plasmid pWW031 ( prtN pUCP19), and PAK with pWW031 ( prtN -pUCP19). Bacteria were grown to an OD600 of 1 to 2 in LB with (black ba rs) or without (white bars) EGTA before -galactosidase assays. (B) Ce llular and secreted forms of ExoS in strains PAK, prtR ::Tn5, prtNR ::Gm, and PAK containing pWW031 ( prtN pUCP19). Overnight bacterial cultures were diluted to 1% in LB or 3% in LB plus 5 mM EGTA and grown at 37C for 3.5 h. Supernatants and pellets from equivalent bacterial cell numbers were loaded onto SDS-PAGE gels and immunoblotted with anti-E xoS antibody. Both ExoS and ExoT are indicated by arrows. Anti-ExoS polyclonal anti body also recognizes ExoT due to high homology between them. *, P < 0.01, compared to the values in PAK. **, P < 0.05, compared to the values in prtR ::Tn5. -Galactosidase activity (Miller unit) PAK prtR ::Tn5 prtNR ::Gm prtNR ::Gm/ prtR -pUCP19 prtR ::Tn5/ prtR -pUCP19 0 50 100 150 200 250 300 prtNR ::Gm/ prtN -pUCP19 PAK prtR ::Tn prtNR ::Gm PAK/ prtN -pUCP19 EGTA + + + + supernatant pellet ExoT ExoS ExoT ExoS A B ** ** **PAK/ prtN -pUCP19 *

PAGE 64

51 The Tn insertion mutants were spread on LB agar plates containing 20 g/ml XGal, 2.5 mM EGTA, and proper an tibiotics. Blue colonies we re looked for in which the TTSS repressor under the contro l of PrtR should have b een knocked out. About 100,000 Tn insertion mutants were screened. Thirty blue colonies were picked and cultured in liquid LB for -galactosidase assay. Sixteen mutants showed restored TTSS activity compared to the parent strain. Sequence analys is of the Tn inserti on sites showed that 14 mutants had Tn insertions at a single locus (PA0612) at nine different positions. PA0612 encodes a hypothetical protei n with a consensus prokaryot ic DksA/TraR C4-type zincfinger motif. The dksA gene product suppresses the temp erature-sensitive growth and filamentation of a dnaK deletion mutant of E. coli (66), while TraR is involved in plasmid conjugation (30). These proteins contain a C-terminal region thought to fold into a four-cysteine zinc finger (30). Its homologues also ex ist in other gram-negative bacteria, such as Pseudomonas syringae Pseudomonas putida E. coli Salmonella enterica serovar Typhimurium and Shigella flexneri However, the functions of these gene homologues have not been studied. Th e remaining two mutants contained a Tn insertion in the genes PA2265 and PA5021, respectively. PA2265 encodes a putative gluconate dehydrogenase. Promoter analysis (http://www.fruitfly.org/seq_tools/ promoter.html) indicates it is in the same operon with an upstream gene, PA2264, as well as a downstream gene, PA2266. PA2264 is an unknown gene, while PA2266 encodes a puta tive cytochrome c precursor. PA5021 encodes a probable sodium:hydrogen antiporter. Promoter analysis indicated that two downstream genes, PA5022 and PA5023, are in the same operon with PA5021, where

PAGE 65

52 PA5022 and PA5023 encode two unknown proteins. We further pursued the regulation and function of PA0612 in this study. PA0612 and PA0613 Form an Operon Whic h Is Under the Control of PrtR Promoter analysis predicted that PA 0612 and PA0613 may form an operon, while the pyocin synthesis gene PA0614 has its own promoter. The downstream gene (PA0613) encodes an unknown protein. On the chromosome of PAO1, PA0612 is located next to the prtR gene in the opposite directi on. In the promoter region of PA0612, a 14-base sequence was obse rved that was also present as a direct repeat in the predicted prtN promoter region, which might be the Pr tR recognition site (Fig. 3-2) (86). Therefore, it is highly likely that the expr ession of PA0612 is under the control of PrtR and mediates the repression of TTSS. Figure 3-2. Genetic organization an d putative promoter regions of prtN prtR PA0612-3. Computer-predicted promoters of prtN prtR PA0612-613, and PA0614 are indicated with arrows. Two promoters ar e predicted for the prtR gene and are designated promoters 1 and 2. The pot ential PrtR binding sequences are underlined. The arrow of each open reading frame represents the transcriptional direction. To confirm the prediction that PA0612 a nd PA0613 are in the same operon, a pair of primers annealing to the 5' end of PA0612 (612GS1) and 3' end of PA0613 (613BT2) prtN prtR PA0612 PA0613 prtN promoter Direct repeat Direct repeat TGCTCGGCAATCTACAGACCGATGGATTTTCTGTAAAGAGCCTAGGTGTTGACGATAA ATAGCTTTGGTTGT AATTTCTCTTCCGTCAGAAAGCG prtR promoter 1 prtR promoter 2 PA0612 promoter Direct repeat GGTATTCCCTCCTGCGGCTACACGTCGTTGAGGGAAAT ATAGCTCAGGTTGT TTTCTTGTTCA ATAGCTGAAGTTGT AGAGCGGGCGAGCGCCAGGCGC

PAGE 66

53 was designed for RT-PCR analysis (Table 3-2). A 649-bp PCR product was amplified using total RNA isolated from prtR ::Tn or prtNprtR ::Gm (Fig. 3-3A), and the size was the same as that when PAK genomic DNA was used as template (data not shown). However, when total RNA from PAK or PAK/pWW031 ( prtN overexpresser) was used as template, a faint PCR product could be s een (Fig. 3-3A), indicating low abundance of this transcript. These results suggested that PA0612 and PA0613 are in the same operon, which is under the negative control of PrtR Transcription of PA0612 was investigated further by real-time PCR. E xpression of PA0612 mRNA in prtR ::Tn and prtNR ::Gm was 30and 38-fold greater than that in PAK, respectively, while overexpression of the prtN gene had little effect on the transcript level of PA0612 (Fig. 3-3B). To further confirm this, the promoter of PA0612 was fused with a promoterless lacZ gene on plasmid pDN19lacZ, and the resulting fusion construct (pWW048-1) was introduced into various strain backgrounds for the -galact osidase assay. As shown in Fig. 3-4, the expression of PA0612 was up regulated in both prtR ::Tn and prtNprtR ::Gm mutant backgrounds compared to that in PAK or PAK overexpressing prtN (PAK/pWW031), further proving that the expression of PA 0612 and PA0613 is repressed by PrtR. The above results also reaffirmed our earlier conclusion that prtN has no effect on the expression of PA0612 and PA0613. PA0612 Is Required for the Repre ssion of the TTSS In the prtR Mutant Since PA0612 and PA0613 are in the same operon, insertion of a Tn in PA0612 will have a polar effect on th e expression of PA0613. To test which of the two genes is required for the TTSS repression in the prtR mutant, deletion mutants of PA0612 and PA0613 and the PA0612 PA0613 double mutant were generated in the background of the prtNprtR ::Gm mutant. The production and secre tion of ExoS, as judged by Western

PAGE 67

54 blotting, were restored in the PA0612 a nd PA0612-013 mutants but not in the PA0613 mutant (Fig. 3-5A). The reporter plasmid of exoT :: lacZ (pHW0006) was further transformed into these mutants and subjected to a -galactos idase assay. As the results show in Fig. 3-5B, transcription of the exoT gene was partially restored in the backgrounds of prtNprtR ::Gm PA0612-013 and prtNprtR ::Gm PA0612 mutants, while they remained repressed in the background of the prtNprtR ::Gm PA0613 mutant, indicating that PA0612 is required fo r repression of the TTSS in the prtR mutant background. Figure 3-3. Expression of PA0612 is repressed by prtR (A) RT-PCR of the PA06120613 operon. Total RNA was isolated from PAK, prtR ::Tn5, prtNR ::Gm, and PAK/pWW031. One microgram of RNA from each sample was used to synthesize cDNA, and the cDNA was diluted 100-fold for subsequent PCR amplification. The primers used in th e PCR anneal to the 5' end of PA0612 and the 3' end of PA0613. (B) Quan titation of PA0612 gene expression by real-time PCR. Data are expressed relative to the qua ntity of PA0612 mRNA in PAK. *, P < 0.01, compared to the values in PAK. 649 bp PAK prtR ::Tn prtNR ::Gm PAK/ pUCP19prtN PAK Genomic DNA Marker 0 5 10 15 20 25 30 35 40 45 50PAK prtR ::Tn prtNR ::Gm PAK/ pUCP19prtN Relative value of mRNAs A B *

PAGE 68

55 Figure 3-4. Expression of PA0612:: lacZ (pWW048-1) in PAK, prtR ::Tn5, prtNR ::Gm, and PAK/pWW031. Bacteria were grown in LB for 10 h before galactosidase assays. *, P < 0.01, compared to the values in PAK. The TTSS of PAK can directly deliver ExoS ExoT, and ExoY into the host cell, resulting in cell rounding and lifting (46, 125, 131) HeLa cells were infected with wildtype PAK and prtR mutants at a MOI of 20. Upon infection by PAK, almost all of the HeLa cells were rounded after 2.5 h. Under the same conditions, the PAK exsA :: mutant, a TTSS-defective mutant, had no eff ect on HeLa cell rounding; similar to the PAK exsA :: mutant, low cytotoxicity was seen with mutant strains prtR ::Tn, prtNprtR ::Gm, and prtNprtR ::Gm PA0613. However, prtNprtR ::Gm PA0612-013 and prtNprtR ::Gm PA0612 caused comparable levels of HeLa cell lifting as that seen with PAK. Quantitative assay of the cell lifti ng was further performed by crystal violet staining of the adhered cells afte r 4 h of infection. As shown in Fig. 3-5C, mutant strains prtNprtR ::Gm PA0612-013 and prtNprtR ::Gm PA0612 showed similar cytotoxicity as wild-type PAK. However, PrtR ::Tn, prtNprtR ::Gm, and prtNprtR ::Gm PA0613 showed much-reduced cytotoxicity. The a bove observations clearly indicated that PA0612, but not PA0613, is required fo r the TTSS repression in the prtR mutant background. We designate this newly identifi ed repressor gene as pseudomonas type III repressor gene B or, ptrB 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 -Galactosidase activity (Miller unit) PAK prtR ::Tn prtNR ::Gm PAK/ pUCP19prtN *

PAGE 69

56 Figure 3-5. Characterization of ExoS expression and cytotoxicity. (A) Cellular and secreted forms of the ExoS in strains PAK, prtNR ::Gm, prtNR ::Gm PA0612-0613, prtNR ::Gm PA0612, and prtNR ::Gm PA0613. Overnight bacteria cultur es were diluted to 1% in LB or 3% in LB plus 5 mM EGTA and grown at 37C for 3.5 h. Supernatants and pellets from equivalent bacterial cell numbers were loaded onto SDSPAGE gels and immunoblotted with anti-ExoS antibody. Both ExoS and ExoT are indicated by arro ws. (B) Expression of exoT :: lacZ (pHW0005) in the backgrounds of PAK, prtNR ::Gm, prtNR ::Gm PA0612-0613, prtNR ::Gm PA0612, and prtNR ::Gm PA0613. Bacteria were grown to an OD600 of 1 to 2 in LB with (black ba rs) or without (white bars) EGTA before -galactosidase assays. (C) Cell lifting assay. HeLa cells were infected with PAK, prtR ::Tn5, prtNR ::Gm, prtNR ::Gm PA0612-0613, prtNR ::Gm PA0612, and prtNR ::Gm PA0613 at an MOI of 20. After a 4-hour infection, cell lifting was measured with crystal violet staining (see Materials and Methods for details). *, P < 0.01, compared to the values in PAK; **, P < 0.01, compared to the values in prtNR ::Gm. 0 50 100 150 200 250 300 350 400 450 500PAK prtNR ::Gm 612-3 prtNR ::Gm 612 prtNR ::Gm 613 prtNR ::Gm prtR ::Tn5 prtNR ::Gm 612::Tn5 -Galactosidase activity (Miller unit) 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5Cell PAK exsA :: prtR ::Tn5 prtNR ::Gm prtNR ::Gm 612 prtNR ::Gm 613 * * ** ** OD590 B C pellet PAK prtNR ::Gm 612-3 prtNR ::Gm 612 prtNR ::Gm 613 EGTA + + + + supernatant ExoS ExoT ExoS ExoT prtNR ::Gm +A prtNR ::Gm 612-3 * ** ** **

PAGE 70

57 The Expression of exsA Is Repressed by PtrB in prtR mutants The master activator of TTSS genes is ExsA. It is the last gene in the exsCEBA operon (144). The great reduction of ExoS and ExoT in prtR mutants may occur through the repression of exsA expression. To test the transcription of exsA an exsC :: lacZ reporter plasmid was introduced into the prtR mutants. As shown in Fig. 3-6, the expression of the exsCEBA operon was greatly reduced in prtR and prtNR mutants. Deletion of PA0612-3 and ptrB but not PA0613, partially restor ed the promoter activity of exsC Since ExsA is also the activator of its own operon (60), the repression may be on the transcriptional, translati onal or protein level. So I further tested the interaction between ExsA and PtrB. Figure 3-6. Expression of exsA operon in prtR mutants. Bacteria were grown to an OD600 of 1 to 2 in LB with (black bars) or without (white bars) EGTA before galactosidase assays. *, P < 0.01, compared to the values in PAK; **, P < 0.01, compared to the values in prtNR ::Gm; ***, P < 0.001, compared to the values in prtNR ::Gm ptrB PtrB Might Not Directly Interact with ExsA In earlier reports, it has been shown th at ExsA activity can be repressed by interaction with ExsD or PtrA (47, 89). We wanted to test if the TTSS repressor function of PtrB is achieved through a direct interaction with th e master regulator, ExsA. A 0 500 1000 1500 2000 2500 prtNR ::Gm prtR ::Tn5 PAK ** ** ** *** prtNR ::Gm 612-3 prtNR ::Gm ptrB prtNR ::Gm 613 -Galactosidase ac tivity (Miller unit)

PAGE 71

58 bacterial two-hybrid system (Stratagene) was us ed to test the inter action between the two components. ptrB and exsA were each cloned into bait (pBT) or prey (pTRG) plasmids, fused with CI and RNA polymerase (RNAP) -subunit at C terminus, respectively. Interaction between the two te sted proteins can stable CI and RNAP in the promoter region of a lacZ gene and activates its expression. Thus, the interaction of two proteins was indicated by the expression of lacZ in the reporter strai n. -Galactosidase assay results, however, did not suggest a direct interaction between Pt rB and ExsA, although strong interaction was observ ed between the positive cont rols provided (Fig. 3-7). Therefore, the mechanism of TTSS repression in the prtR mutant might not involve a direct binding of PtrB to Ex sA. Negative results were also obtained in similar tests between PtrB and PA0613, indicating no direct interaction of the two small proteins encoded in the same operon. Figure 3-7. Monitoring of prot ein-protein interactions by the BacterioMatch two-hybrid system. pBT, bait vector; pTRG, target vector; 2BT, ptrB cloned into bait vector; 2TRG, ptrB cloned into target vector; 3BT, PA0613 cloned into bait vector; 3TRG, PA0613 cloned into target vector; exsA BT, exsA cloned into bait vector; exsA TRG, exsA cloned into target vector ; positive, positive control provided by the manufacturer. *, P < 0.01, compared to the values in the positive control. 0 20 40 60 80 100 120 1402BT-3 T RG 2BTe xsATRG 2BT-pTRG 3BT-2TRG 3BT-e xs A T R G 3B T pTRG ex s A BT-2 T R G exsAB T 3 T R G exsAB T p T R G 2TR GpBT 3TR GpB T exsATRG-pBT pTR Gp BT posit iv e -Galactosidase activity (Miller unit) * * * * * * *

PAGE 72

59 Mitomycin C-mediated Suppression of the TTSS Genes Requires PtrB Pyocin production can be triggered by muta genic agents, such as mitomycin C. In response to the DNA damage, RecA is activat ed and cleaves PrtR, similar to LexA cleavage by RecA in E. coli during the SOS response (90). In the absence of PrtR, the expression of prtN is derepressed, resulting in up re gulation of the pyocin synthesis genes. Under this circumstance, the ptrB gene should also be up regulated, resulting in TTSS repression. To test this prediction, w ild-type PAK was treated with mitomycin C under TTSS inducing and noninducing condition s and the expression of ExoS was monitored by Western blot analysis. In pr evious reports, 1 g/ml of mitomycin C was shown to be able to induce pyocin synthesi s (90). After treatment with 1 g/ml of mitomycin C for 1.5 h, the OD600 of PAK began to decrease with or without EGTA due to the toxic effect of the m itomycin C (Fig. 3-8A); therefor e, we collected the samples 1.5 h after mitomycin C treatment. Two culture methods were used. One was to grow PAK with mitomycin C for 30 min and then EGTA was added to induce TTSS for 1 hour. The other was to add mitomycin C and EGTA at the same time and induce for 1 hour. Experimental results showed that when w ild-type PAK was treated with mitomycin C and EGTA at the same time, normal TTSS activation was observed. However, when cells were treated with m itomycin C 30 min before the addition of EGTA, a clear repression of the TTSS was observed (F ig. 3-8B). To test whether the ptrB gene mediates the repression of the TTSS by mitomycin C, a deletion mutant of ptrB was further generated in the background of wild-type PAK. Deletion of ptrB in PAK had no effect on the expression of the TTSS (Fig. 3-8B and C). Interestingly, even with the 30min pretreatment of mitomycin C (1 g/ml), production of ExoS in the PAK ptrB mutant was activated by EGTA, even higher than that without m itomycin C treatment

PAGE 73

60 (Fig. 3-7B). Clearly, mito mycin C-mediated suppressi on of the TTSS requires the ptrB gene. Figure 3-8. Effect of mitomycin C on bacter ia growth and TTSS activity. (A) An overnight culture of PAK was diluted to an OD600 of 0.8 in LB, LB plus 1 g/ml mitomycin C, LB plus 5 mM EG TA, or LB plus 1 g/ml mitomycin C plus 5 mM EGTA. The OD600 of each sample was measured at 30-min intervals. The cell densities were calculated based on the OD600. (B) Overnight cultures of PAK, PA0612-0613, and ptrB were diluted to an OD600 of 0.5 with LB or LB plus 1 g/m l mitomycin C. After 30 min, EGTA was added to the culture medium at a fi nal concentration of 5 mM. One hour later, each culture was mixed with protein loading buffer. Samples derived from equivalent bacterial cell numbers were loaded onto SDS-PAGE gels and immunoblotted with anti -ExoS antibody. *, PAK was grown in LB for 30 min, and then both mitomycin C and EGTA were added at the same time. (C) Overnight cultures of PAK, PA0612-0613, and ptrB strains were diluted to 1% in LB or 3% in LB plus 5 mM EGTA and grown at 37C for 3.5 h. Supernatants and pellets from equivale nt bacterial cell num bers were loaded onto SDS-PAGE gels and immunoblotted with anti-ExoS antibody. 1.0E+08 1.0E+09 1.0E+10 012345hr Cell density LB LB+Mitomycin C LB+EGTA LB+EGTA+ Mitomycin C Time PAK EGTA + + +Mitomycin C + + +* ExoS 612-3 p trB + + -+ + + + + + pellet PAK 612-3 ptrB 613 EGTA + + + + supernatant ExoS ExoT ExoS ExoT A B C

PAGE 74

61 Twitching Motility Was Not Affected by the prtR mutation The TTSS genes have been shown to be affected by Vfr and CyaA/B, homologues of CRP and cyclic AMP synthase (140). Vfr is well known for its involvement in the regulation of twitching motility (8), flagellum synthesis (26) type II secretion (140), and quorum sensing (3). Recently, FimL was found to regulate both the TTSS and twitching motility through Vfr (137). To test whether mutation of prtR affects twitching motility, strains with prtR and ptrB mutations were subjected to a stab assay. Mutation in the prtR or ptrB gene had no effect on twitching motility (Fig. 3-9), indicating that the repression of the TTSS in the prtR mutant does not go through the Vfr pathway. Figure 3-9. Twitching motility of prtR ptrB and PA0613 mutants. The bacteria of each strain were stabbed into a thin-layer LB agar. The plate was incubated at 37C over night. The whole plate was directly stained with Coomassie blue at room temperature for 5 min and destained with destain solution. PAK prtR ::Tn prtNR ::Gm 612-3 prtNR ::Gm ptrB prtNR ::Gm 613 prtNR ::Gm 612-3 ptrB 613

PAGE 75

62 Discussion During early infection of cystic fibrosis patients, P. aeruginosa produces S-type pyocins (9); however, the exact physiological role played by pyoc ins is unclear. Pyocins might ensure the predominance of a given strain in a bacterial niche against other bacteria of the same species. The pyocin production starts when adverse conditions provoke DNA damage. Under these conditions, the eff ect of pyocins is likely to preserve the initial predominance of pyocinogenic bacteria against pyocin-sensitiv e cells (90). Upon activation by DNA-damaging agents RecA mediates the cleava ge of PrtR, derepressing the expression of prtN resulting in active synthesis of pyocins. Thus, the pyocin synthesis is dependent on the SOS response, resembling those responses of temperate bacteriophages in E. coli (16, 90). Indeed, DNA-damaging agents, such as UV irradiation and mitomycin C, induce the synthesis of pyocins in a recA -dependent manner (90). Apparently, in response to the DNA damage stress signal, P. aeruginosa not only turns on the SOS response system for DNA repa ir and pyocin synthesi s but also actively represses the energy expensive type III secre tion system, an example of coordinated gene regulation for survival. Along the regulatory pathway, mutation of the prtR gene results in the up regulation of prtN (86). We found that PrtN is not re sponsible for the repression of the TTSS; rather, ptrB next to and under the control of prtR is required for the TTSS repression. We also found that the downst ream gene PA0613 was in the same operon with PA0612. Homologues of th ese genes are also found in Pseudomonas putida (PP3039 and PP3037) and Pseudomonas syringae (PSPT03417 and PSPT03419), where they seem to also form operon structures although with one a dditional gene between them (PP3038 or PSPR03418). The promoter of ptrB contains a 14-base sequence that

PAGE 76

63 was also found in the prtN promoter (86), which may be a binding site for PrtR. Considering that PrtR is the ortholog of CI, which functions as a homodimer (16), PrtR may also form a dimer. Whether PrtR rec ognizes these potential binding sites is not known. Interestingly, th e PtrB protein contains a proka ryotic DksA/TraR C4-type zincfinger motif (www.pseudomonas.com). The dksA gene product suppresses the temperature-sensitive growth and filamentation of a dnaK deletion mutant of E. coli (66), while TraR is involved in plasmid conjugation (30). These proteins contain a C-terminal region thought to fold into a f our-cysteine zinc-finger (30). Yersinia sp also encodes a small-sized protein, YmoA (8 kDa), which ne gatively regulates th e type III secretion system (79). YmoA resembles the histone-like protein HU and E. coli integration host factor; thus, it is likely to repress t ype III genes through its influence on DNA conformation. Whether PtrB exerts its repressor functi on through interaction with another regulator or through binding to specific DNA sequences present in the TTSS operons or their upstream regulat or genes is not known. It w ould also be interesting to investigate on what other genes of the P. aeruginosa genome PtrB effects on. It is not surprising that P. aeruginosa has multiple regulatory networks, since 8% of its genome codes for regulatory genes, indicating that P. aeruginosa has dynamic and complicated regulatory mechanisms responding to various environmental signals (108, 124). Also, due to the requirement of a large number of genes, construction of the type III secretion apparatus is an energy-expensive process. Thus, P. aeruginosa might have evolved multiple signaling pathways to fine-tune the regulation of the type III secretion system in response to the environmental changes. Similarly, Yersinia has been reported to have several regulators, such as an ac tivator, VirF, and repressor molecules, LcrQ,

PAGE 77

64 YscM1, YscM2, and YmoA, that ar e involved in the control of yop gene transcription (20, 139, 142). Current efforts are focuse d on the elucidation of the molecular mechanism by which PtrB mediates suppression of the TTSS. Also, the relevance of the two additional genes, PA2265 and PA5021, to the regulation of the TTSS needs more investigation. Figure 3-10. Proposed model of PtrB-media ted TTSS repression. In wild-type PAK, PrtR represses the expression of prtN and ptrB In response to DNA damage, RecA is activated and cleaves PrtR, resulting in increas ed expression of prtN and ptrB PrtN activates the e xpression of pyocin synthesis genes, while PtrB represses the type III secretion ge nes directly or through additional downstream genes. Based on our results, we propose a model for the repression of the TTSS induced by DNA damage (treatment with mitomycin C) (Fig. 3-10). DNA damage induces the SOS response, in which RecA is activated. RecA cleaves PrtR, resulting in the up regulation of prtN and ptrB PrtN activates the expressi on of pyocin synthesis genes, while PtrB represses the TTSS genes. How PtrB represses the TTSS is not known. In the bacteria two-hybrid system, I failed to detect the interaction between PtrB and ExsA. However, PtrB is a small protein (~6.7 kDa), and when fused with either CI or RNAP subunit, its interaction with ExsA might be affected due to conformational change or DNA damage RecA RecA PrtR PtrB PrtN X X Pyocin synthesis TTSS ExsA ???

PAGE 78

65 steric hindrance. Further experiments are needed to study the inte raction between PtrB and ExsA.

PAGE 79

66 CHAPTER 4 DISCUSSION AND FUTU RE DIRECTIONS The TTSS and Environmental Stresses Repression of the TTSS under Environmental Stresses The TTSS of P. aeruginosa is under the control of a complicated regulatory network. ExsA, an AraC-type protein, is the ma ster activator of the TTSS. Two proteins, ExsD and PtrA, have been found to directly interact with ExsA. ExsD is an antiactivator, inhibiting the activity of ExsA (89). PtrA is an in vivo inducible protein and represses the activity of Ex sA through direct binding. In vitro the expression of PtrA is inducible by high copper stress signal th rough a CopR/S two-component regulatory system (47). Over expression of multidrug efflux systems MexCD-OprJ and MexEFOprN leads to repression of the TTSS (75). The expression of multi-drug efflux systems are usually triggered by antibiotics which is a detrimental stress. We also found that mutation in the mucA gene not only results in overproduc tion of alginate but also causes repression of the TTSS (Chapter 2). MucA-re gulated alginate production is induced by environmental stresses, such as high osmo larity, reactive oxygen intermediates, and anaerobic environment (45, 84). Metabolic imbalance was also shown to cause repression of the TTSS, which represents a nu tritional stress (23, 107) In Chapter 3 we reported that mutation in the prtR gene resulted in repressi on of the TTSS. PrtR is a repressor whose activity is regulated by DNA damage (90), yet another stress signal. Mitomycin C, a mutagenic agent, can indeed repress the activity of the TTSS. My preliminary data showed that heat shock could also cause re pression of the TTSS. These

PAGE 80

67 discoveries indicate that the TTSS is effectiv ely turned off under various environmental stresses, which might be an important surviv al strategy for this microorganism. Since mounting an effective resistan ce against stress requires a full devotion of energy, turning off other energy-expensive processes, such as the TTSS, will be beneficial to the bacterium. Indication for the Control of P. aeruginosa Infection Mutation in TTSS renders P. aeruginosa avirulence in a burned mouse model (59). In a mouse model of P. aeruginosa pneumonia and a rabbit m odel of septic shock, antibodies against PcrV ( require d for effectors translocation) are able to decrease lung injury and ensure survival of the infected animals (37, 113, 120). These results indicated that inactivation of the TTSS is a prospectiv e therapeutic strategy. Since environmental stresses can lead to the repression of the TTSS, drugs can be designed towards components in the stress response signaling pathways, such as DNA damage, heat shock, metabolism imbalance, copper stress, etc. The more we know about the regulatory pathways, the more candidate targets we will have. This strategy might be extended to the control of other virulence mechanisms, su ch as biofilm formation. During the chronic infection in CF lungs, P. aeruginosa grows under a low oxygen environment in the form of a biofilm. Quorum sensing mutants ( lasR or rhlR ) are unable to survive in the anaerobic condition, due to the metabolic intoxication by nitr ic oxide (145). Therefore, drugs targeting the quorum sensing system might facilitate the eradication of P. aeruginosa biofilm (51). Indeed, some non-native AHLs (autoinducers of the las and rhl quorum sensing systems) have been found to disrupt P. aeruginosa biofilm formation (40).

PAGE 81

68 Regulation of the TTSS under Environmental Stresses Among all the environmental stresses that induce TTSS repression, only one regulatory pathway (PtrA) is well understood (4 7). Based on the experimental data for PtrA and PtrB, it is possible that each environmental stress involves a specific TTSS repressor, such as PtrA for copper stress a nd PtrB for DNA damage stress (Chapter 3). Some of these repressors may even have common regulators. For example, cAMP and Vfr are required for the TTSS. Any environmental signals affecting cAMP level or Vfr activity will affect the TTSS. It will be inte resting to measure the expression level of Vfr as well as cAMP level under va rious environmental stresses. The ExsA activity is under the direct cont rol of a regulatory cascade, consisting of ExsE, ExsC and ExsD (Fig.1-1) (27, 89, 106, 130) Each of the components can also be the target of regulation u nder stress conditions. Activation of ExsA depends on the secretion of ExsE through the TTSS machiner y. Any environmental stresses that block the ExsE secretion will result in inhibition of the ExsA function (106, 130). Furthermore, expression of exsA may also be affected by stress responses. Expression of ExsA exsA is the last gene in the exsCEBA operon as shown in Fig. 4-1, which is activated by ExsA itself (144). It is not know n which sigma factor recognizes this operon promoter. Interestingly, the predicted exsB open reading frame (ORF) seems not translated in either P. aeruginosa or E.coli (43). Neither point mutation of the exsB start cordon nor over expression of exsB had any effect on the TTSS activity (43, 106). However, deletion of the exsE and exsB region (StuI sites, Fig 41) resulted in a drastic reduction of the TTSS activity. Since ExsE is a TTSS repressor, mutation in exsE should lead to derepression of the TTSS (106) These results indicate that the exsB region (DNA

PAGE 82

69 or RNA) might affect the transc ription or translation of ExsA. It will be interesting to delete only the exsB region and test the effect on the expression of exsA Figure 4-1. Structure of the exsCEBA operon. The ORFs and transcription directions are indicated as arrows. Transcriptional control The exsB DNA fragment might control the transcription of exsA gene through the formation of a secondary structure. This type of regulation usually happens at the promoter region, where RNA polymerase or regulators bind to (16). Since exsA does not have its own promoter immediate upstream of its coding sequence ( 144), it is unlikely that exsB DNA has this type of function. Post-transcriptional control Microarray analysis and lacZ transcriptional fusion experiments indicate that the mRNA level of exsCEBA operon does not change much under TTSS inducing vs. noninducing conditions (72, 140). A real-time PCR experiment is needed to precisely determine the mRNA levels of each ORF and the region between exsB and exsA Despite the minimal increase at the transcriptiona l level, the ExsA protein level increased significantly under TTSS inducing conditions as judged by Western bl ot analysis (27), suggesting that the expression of ExsA is under post-transcriptiona l control. Well known mechanisms of the post-transcriptional contro ls include mRNA stability or formation of secondary structures which affect translat ion efficiency (16, 74) In prokaryotes, untranslated mRNA tends to be degraded qui ckly by endoribonucleas es or exonucleases (70). The translation of an mRNA can be affected by secondary structures formed by StuI StuI C E B A 1000 2000 exs C exsE ex s B exsA

PAGE 83

70 endogenous sequences or with an antisense RNA. A likely hair-pin structure has indeed been found in the exsB exsA junction (Fig. 4-2) which may blocks the access of the ribosome to its binding site for the translation for exsA Experimental tests, deletion as well as site-directed mutagenesis, are needed to confirm this possibility. Figure 4-2. The seconda ry structure of exsA mRNA 5 terminus. The sequence was analyzed by mfold (http://www.bioinfo.r pi.edu/applications/mfold/old/rna/). The mRNA stability and secondary structur e can also be controlled by small RNAs (sRNAs). sRNAs, with length range from 50 to 200 nucleotides, are used by bacteria to rapidly tune gene expression in responding to changing e nvironments (83, 123). sRNAs usually anneal to 5 untranslated region (5 UTR) of target mRNAs. The effects of sRNA binding include increase or d ecrease of mRNA stability, e xposure or blockage of ribosome binding site. Most interactions between sRNA and target mRNA require a small protein called Hfq. Mutation of Hfq in P. aeruginosa resulted in impaired 5 3 S tartcordonof exsA

PAGE 84

71 twitching motility and attenuation of virulence wh en injected intraperitoneally into mice (122). It will be interesting to test the TTSS activity in the hfq mutant, which may give us a clue whether sRNAs are i nvolved in the TTSS regulation. In summary, the transcriptiona l and translational control of exsA is not clear at present time. Understanding the regulatory mechanism of exsA may help us to clarify the relationship between TTSS and many other gene s that affect its activity. Also, it will help us to develop strategies to control P. aeruginosa infections. Transposon Mutagenesis My project started from the construction and screening of Tn insertional mutant libraries. This strategy is a powerful tool in searching genes relate d to certain phenotype. The success of this method relies on the hi gh efficiency of transposition, special characteristics of the Tn a nd sensitive screening methods. Mutagenesis Efficiency Usually, the Tn is on a suicide plasmid a nd transferred into the recipient through conjugation or sometimes by electroporation. In my experiments, the growth phase of E.coli donor strain was important, with the hi ghest efficiency achieved by using cells grown to OD600=0.6-1.0. The growth phase of P. aeruginosa recipient strain seems less important. The optimum donor to recipient ra tio ranged between 3:1 and 8:1, with about 5X108 recipient cells in each conjugation mixture. During the growth of the c onjugation mixtures (121), P. aeruginosa seems to kill E.coli resulting in low conjugation efficienc y. This killing can be repressed by performing the conjugation on nutrient agar. Probably, P. aeruginosa produces fewer bactericidal factors when grown on nutrien t agar medium compared to the L-agar.

PAGE 85

72 Another factor limiting the conjugation e fficiency is the DNA modification and restriction system of the recipient, which mediates the degradation of foreign DNA. Growth of the recipient at 42C for at least 2 hours be fore conjugation can greatly increase the mutagenesis e fficiency, presumably due to the repression of the DNA modification and restriction system. In most of my experiments, 1-3x104 Tn insertion mutants can readily be obtained from each conjugation. P. aeruginosa has about 5600 genes; thus theoretically, 3x104 mutants should provide about 5-fold coverage of these genes (63). Characteristics of the Tn Most Tn insertional mutagenesis do not en sure every target gene being hit by the Tn, although statistically the number of the mutants should saturate the whole genome. Tns seem preferentially to insert in certain regions while avoiding other regions, so called hot and cold spots, respectively. The Tn used in my research is a deri vative of Tn5 (71). In my Tn5 mutagenesis experiments, no insertion was found in the TTSS region, suggesting it is a cold spot for the Tn5. In agreement with my experience, a Tn5 insertion library constructed in strain PAO1 by Jacobs et al. (University of Washington Genome Center, Seattle) has also concluded that the codi ng region of the TTSS apparatus is a clod spot (63). Testing of different tr ansposons might identify ones that can readily transpose into the TTSS region. Screen Sensitivity The success of Tn mutagenesis experiments also depends on the screening strategy. Two types of screening methods are widely used. One is to individually test for phenotypes of interests, which provides a hi gh accuracy. However, it takes a lot of manpower and is cumbersome. The other one is to do large scale screening on the whole

PAGE 86

73 library. By this method, a large number of mutants can be screened quickly, although the accuracy is compromised. Usually, this met hod requires a reporter gene, either encoded on the Tn or harbored by the recipien t strain. In my experiments, an exoT :: lacZ fusion on plasmid was used as the reporter. On plates containing X-gal, the dens ity of blue color of each colony represents the exoT promoter activity. With this method, 100,000 mutants can be screened in less than one hour. The s hortcoming of this method is that the color density is judged by eyes; thus many mutant s with interesting phenotypes might have been missed. Indeed, although I succ essfully identif ied two genes, mucA and prtR which are required for the TTSS activity, no othe r genes known to regulate the TTSS were identified. Possibly either I missed those col onies with minor changes in blue color or the Tn insertion libraries were not saturate d. Other Tn with more sensitive screening methods might be needed to identify additional TTSS related genes. In summary, I developed a screening sy stem for the identification of the TTSS related genes. From the Tn insertion librari es constructed in wild type PAK containing exoT :: lacZ reporter plasmid, two genes, mucA and prtR were found to be related to the TTSS. I further studied the regulatory rela tionship between MucA and the TTSS as well as PrtR and the TTSS. In the mucA mutant, AlgU and AlgR are required for the repression of the TTSS. In the prtR mutant, a newly identified gene, ptrB is up regulated and responsible for the repression of the TTSS. Wild type P. aeruginosa strain will turn into mucoid phenotype in response to some environmental stresses, such as anaerobic environment, high osmolarity and reactive oxygen intermediates. PrtR is a regulator of pyocin synthesis, it responses to DNA damage. All my results suggest that TTSS will be

PAGE 87

74 repressed under environmental stresses (10) which may provide a potential strategy for the control of the TTSS activity and improve the treatment of P. aeruginosa infection.

PAGE 88

75 LIST OF REFERENCES 1. Aendekerk, S., B. Ghysels, P. Cornelis, and C. Baysse. 2002. Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium. Microbiology 148: 2371-81. 2. Ahn, K. S., U. Ha, J. Jia, D. Wu, and S. Jin. 2004. The truA gene of Pseudomonas aeruginosa is required for the expression of type III secretory genes. Microbiology 150: 539-47. 3. Albus, A. M., E. C. Pesci, L. J. Runyen-Janecky, S. E. West, and B. H. Iglewski. 1997. Vfr controls quorum sensing in Pseudomonas aeruginosa J. Bacteriol. 179: 3928-35. 4. Allmond, L. R., T. J. Karaca, V. N. Nguyen, T. Nguyen, J. P. WienerKronish, and T. Sawa. 2003. Protein binding between PcrG-PcrV and PcrHPopB/PopD encoded by the pcrGVH popBD operon of the Pseudomonas aeruginosa type III secretion sy stem. Infect. Immun. 71: 2230-3. 5. Arora, S. K., B. W. Ritchings, E. C. Almira, S. Lory, and R. Ramphal. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD is responsible for mucin adhesion. Infect. Immun. 66: 1000-7. 6. Barbieri, J. T., and J. Sun. 2004. Pseudomonas aeruginosa ExoS and ExoT. Rev. Physiol. Biochem. Pharmacol. 152: 79-92. 7. Baysse, C., J. M. Meyer, P. Plesiat, V. Geoffroy, Y. Michel-Briand, and P. Cornelis. 1999. Uptake of pyocin S3 occurs through the outer membrane ferripyoverdine type II receptor of Pseudomonas aeruginosa J. Bacteriol. 181: 3849-51. 8. Beatson, S. A., C. B. Whitchurch, J. L. Sargent, R. C. Levesque, and J. S. Mattick. 2002. Differential regulation of twitching motility and elastase production by Vfr in Pseudomonas aeruginosa J. Bacteriol. 184: 3605-13. 9. Beckmann, C., M. Brittnacher, R. Erns t, N. Mayer-Hamblett, S. I. Miller, and J. L. Burns. 2005. Use of phage display to identify potential Pseudomonas aeruginosa gene products relevant to early cy stic fibrosis airway infections. Infect. Immun. 73: 444-52.

PAGE 89

76 10. Berry, A., J. D. DeVault, and A. M. Chakrabarty. 1989. High osmolarity is a signal for enhanced algD transcription in mucoid and nonmucoid Pseudomonas aeruginosa strains. J. Bacteriol. 171: 2312-7. 11. Bjarnsholt, T., P. O. Jensen, T. B. Ra smussen, L. Christophersen, H. Calum, M. Hentzer, H. P. Hougen, J. Rygaard, C. Moser, L. Eberl, N. Hoiby, and M. Givskov. 2005. Garlic blocks quorum sensi ng and promotes rapid clearing of pulmonary Pseudomonas aeruginosa infections. Microbiology 151: 3873-80. 12. Bleves, S., C. Soscia, P. Nogueira-O rlandi, A. Lazdunski, and A. Filloux. 2005. Quorum sensing negatively controls t ype III secretion regulon expression in Pseudomonas aeruginosa PAO1. J. Bacteriol. 187: 3898-902. 13. Boucher, J. C., H. Yu, M. H. Mudd, and V. Deretic. 1997. Mucoid Pseudomonas aeruginosa in cystic fibrosis: character ization of muc mutations in clinical isolates and analysis of clea rance in a mouse model of respiratory infection. Infect. Immun. 65: 3838-46. 14. Bryan, L. E., K. O'Hara, and S. Wong. 1984. Lipopolysaccharide changes in impermeability-type aminoglycoside resistance in Pseudomonas aeruginosa Antimicrob. Agents Chemother. 26: 250-5. 15. Carterson, A. J., L. A. Morici, D. W. Jackson, A. Frisk, S. E. Lizewski, R. Jupiter, K. Simpson, D. A. Kunz, S. H. Davis, J. R. Schurr, D. J. Hassett, and M. J. Schurr. 2004. The transcriptio nal regulator AlgR controls cyanide production in Pseudomonas aeruginosa J. Bacteriol. 186: 6837-44. 16. Champness, L. S. A. W. 1997. Molecular genetics of bacteria. ASM Press, Washington, D.C. 17. Chilcott, G. S., and K. T. Hughes. 2000. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia coli Microbiol Mol Biol Rev 64: 694-708. 18. Chuanchuen, R., C. T. Narasaki, and H. P. Schweizer. 2002. The MexJK efflux pump of Pseudomonas aeruginosa requires OprM for antibiotic efflux but not for efflux of triclosan. J. Bacteriol. 184: 5036-44. 19. Colmer, J. A., and A. N. Hamood. 1998. Characterization of ptxS a Pseudomonas aeruginosa gene which interferes with the effect of the exotoxin A positive regulatory gene, ptxR Mol. Gen. Genet. 258: 250-9. 20. Cornelis, G. R., C. Sluiters, I. Delo r, D. Geib, K. Kaniga, C. Lambert de Rouvroit, M. P. Sory, J. C. Vanooteghem, and T. Michiels. 1991. ymoA a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions. Mol. Microbiol. 5: 1023-34.

PAGE 90

77 21. Dacheux, D., I. Attree, C. Schneider, and B. Toussaint. 1999. Cell death of human polymorphonuclear neutrophils induced by a Pseudomonas aeruginosa cystic fibrosis isolate requires a func tional type III secretion system. Infect. Immun. 67: 6164-7. 22. Dacheux, D., I. Attree, and B. Toussaint. 2001. Expression of ExsA in trans confers type III secretion system-dependent cytotoxicity on noncytotoxic Pseudomonas aeruginosa cystic fibrosis is olates. Infect. Immun. 69: 538-42. 23. Dacheux, D., O. Epaulard, A. de Groot, B. Guery, R. Leberre, I. Attree, B. Polack, and B. Toussaint. 2002. Activation of the Pseudomonas aeruginosa type III secretion system requires an intact pyruvate dehydrogenase aceAB operon. Infect. Immun. 70: 3973-7. 24. Dacheux, D., J. Goure, J. Chabert, Y. Usson, and I. Attree. 2001. Poreforming activity of type III system-secreted proteins leads to oncosis of Pseudomonas aeruginosa -infected macrophages. Mol. Microbiol. 40: 76-85. 25. Darzins, A., and M. A. Russell. 1997. Molecular genetic analysis of type-4 pilus biogenesis and twitching motility using Pseudomonas aeruginosa as a model system--a review. Gene 192: 109-15. 26. Dasgupta, N., E. P. Ferrell, K. J. Ka nack, S. E. West, and R. Ramphal. 2002. fleQ the gene encoding the majo r flagellar regulator of Pseudomonas aeruginosa is sigma70 dependent and is downregulated by Vfr, a homolog of Escherichia coli cyclic AMP receptor protein. J. Bacteriol. 184: 5240-50. 27. Dasgupta, N., G. L. Lykken, M. C. Wolfgang, and T. L. Yahr. 2004. A novel anti-anti-activator mechanism regulates expression of the Pseudomonas aeruginosa type III secretion system. Mol. Microbiol. 53: 297-308. 28. De Kievit, T. R., R. Gillis, S. Marx, C. Brown, and B. H. Iglewski. 2001. Quorum-sensing genes in Pseudomonas aeruginosa biofilms: their role and expression patterns. Appl. Environ. Microbiol. 67: 1865-73. 29. Deretic, V., and W. M. Konyecsni. 1990. A procaryotic regulatory factor with a histone H1-like carboxy-terminal domain : clonal variation of repeats within algP a gene involved in regulation of mucoidy in Pseudomonas aeruginosa J. Bacteriol. 172: 5544-54. 30. Doran, T. J., S. M. Loh, N. Firth, and R. A. Skurray. 1994. Molecular analysis of the F plasmid traVR region: traV encodes a lipoprotein. J. Bacteriol. 176: 41826.

PAGE 91

78 31. Dove, S. L., and A. Hochschild. 2001. Bacterial twohybrid analysis of interactions between region 4 of the sigma(70) subunit of RNA polymerase and the transcriptional regulators Rsd fr om Escherichia coli and AlgQ from Pseudomonas aeruginosa J. Bacteriol. 183: 6413-21. 32. Firoved, A. M., and V. Deretic. 2003. Microarray anal ysis of global gene expression in mucoid Pseudomonas aeruginosa J. Bacteriol. 185: 1071-81. 33. Firoved, A. M., S. R. Wood, W. Ornatowski, V. Deretic, and G. S. Timmins. 2004. Microarray analysis and functional char acterization of the nitrosative stress response in nonmucoid and mucoid Pseudomonas aeruginosa J. Bacteriol. 186: 4046-50. 34. FitzSimmons, S. C. 1993. The changing epidemiology of cystic fibrosis. J. Pediatr. 122: 1-9. 35. Francis, M. S., H. Wolf-Watz, and A. Forsberg. 2002. Regulation of type III secretion systems. Curr. Opin. Microbiol. 5: 166-72. 36. Frank, D. W., G. Nair, and H. P. Schweizer. 1994. Construction and characterization of chromosomal insertional mutations of the Pseudomonas aeruginosa exoenzyme S trans-regulato ry locus. Infect. Immun. 62: 554-63. 37. Frank, D. W., A. Vallis, J. P. Wiener-Kronish, A. Roy-Burman, E. G. Spack, B. P. Mullaney, M. Megdoud, J. D. Marks, R. Fritz, and T. Sawa. 2002. Generation and characterization of a protective monoclonal antibody to Pseudomonas aeruginosa PcrV. J. Infect. Dis. 186: 64-73. 38. Furste, J. P., W. Pansegrau, R. Frank, H. Blocker, P. Scholz, M. Bagdasarian, and E. Lanka. 1986. Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene 48: 119-31. 39. Garrity-Ryan, L., S. Shafikhani, P. Balachandran, L. Nguyen, J. Oza, T. Jakobsen, J. Sargent, X. Fang, S. Cordwell, M. A. Matthay, and J. N. Engel. 2004. The ADP ribosyltransferase domain of Pseudomonas aeruginosa ExoT contributes to its biological activities. Infect. Immun. 72: 546-58. 40. Geske, G. D., R. J. Wezeman, A. P. Siegel, and H. E. Blackwell. 2005. Small molecule inhibitors of b acterial quorum sensing and biofilm formation. J. Am. Chem. Soc. 127: 12762-3. 41. Gibson, R. L., J. L. Burns, and B. W. Ramsey. 2003. Pathophysiology and management of pulmonary infections in cy stic fibrosis. Am. J. Respir. Crit. Care Med. 168: 918-51.

PAGE 92

79 42. Goodman, A. L., B. Kulasekara, A. Riet sch, D. Boyd, R. S. Smith, and S. Lory. 2004. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa Dev. Cell 7: 745-54. 43. Goranson, J., A. K. Hovey, and D. W. Frank. 1997. Functional analysis of exsC and exsB in regulation of exoenzyme S production by Pseudomonas aeruginosa J. Bacteriol. 179: 1646-54. 44. Goure, J., A. Pastor, E. Faudry, J. Chabert, A. Dessen, and I. Attree. 2004. The V antigen of Pseudomonas aeruginosa is required for assembly of the functional PopB/PopD translocation pore in host cell membrane s. Infect. Immun. 72: 4741-50. 45. Govan, J. R., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepac ia. Microbiol. Rev. 60: 539-74. 46. Ha, U., and S. Jin. 2001. Growth phase-dependent invasion of Pseudomonas aeruginosa and its survival within HeLa cells. Infect. Immun. 69: 4398-406. 47. Ha, U. H., J. Kim, H. Badrane, J. Jia, H. V. Baker, D. Wu, and S. Jin. 2004. An in vivo inducible gene of Pseudomonas aeruginosa encodes an anti-ExsA to suppress the type III secretion system. Mol. Microbiol. 54: 307-20. 48. Ha, U. H., Y. Wang, and S. Jin. 2003. DsbA of Pseudomonas aeruginosa is essential for multiple virule nce factors. Infect. Immun. 71: 1590-5. 49. Hakansson, S., K. Schesser, C. Persson, E. E. Galyov, R. Rosqvist, F. Homble, and H. Wolf-Watz. 1996. The YopB protein of Yersinia pseudotuberculosis is essential for the tr anslocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. Embo. J. 15: 5812-23. 50. Harshey, R. M. 2003. Bacterial motility on a surface: many ways to a common goal. Annu. Rev. Microbiol. 57: 249-73. 51. Hassett, D. J., J. Cuppoletti, B. Trapnell, S. V. Lymar, J. J. Rowe, S. S. Yoon, G. M. Hilliard, K. Parvat iyar, M. C. Kamani, D. J. Wozniak, S. H. Hwang, T. R. McDermott, and U. A. Ochsner. 2002. Anaerobic metabolism and quorum sensing by Pseudomonas aeruginosa biofilms in chronically infected cystic fibrosis airways: rethinking antibiotic tr eatment strategies a nd drug targets. Adv. Drug Deliv. Rev. 54: 1425-43.

PAGE 93

80 52. Hassett, D. J., M. L. Howell, U. A. Ochs ner, M. L. Vasil, Z. Johnson, and G. E. Dean. 1997. An operon containing fumC and sodA encoding fumarase C and manganese superoxide dismutase is contro lled by the ferric uptake regulator in Pseudomonas aeruginosa : fur mutants produce elevated alginate levels. J. Bacteriol. 179: 1452-9. 53. Hassett, D. J., M. L. Howell, P. A. Sokol, M. L. Vasil, and G. E. Dean. 1997. Fumarase C activity is elevated in res ponse to iron deprivation and in mucoid, alginate-producing Pseudomonas aeruginosa : cloning and characterization of fumC and purification of native fumC J. Bacteriol. 179: 1442-51. 54. Hassett, D. J., W. A. Woodruff, D. J. Wozniak, M. L. Vasil, M. S. Cohen, and D. E. Ohman. 1993. Cloning and characterization of the Pseudomonas aeruginosa sodA and sodB genes encoding manganes eand iron-cofactored superoxide dismutase: demonstration of increased manganese superoxide dismutase activity in alginate-pr oducing bacteria. J. Bacteriol. 175: 7658-65. 55. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer. 1998. A broad-host-range Flp-FRT recombination system for sitespecific excision of chromosomally-lo cated DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: 77-86. 56. Hogardt, M., M. Roeder, A. M. Schreff, L. Eberl, and J. Heesemann. 2004. Expression of Pseudomonas aeruginosa exoS is controlled by quorum sensing and RpoS. Microbiology 150: 843-51. 57. Hoiby, N., G. Doring, and P. O. Schiotz. 1987. Pathogenic mechanisms of chronic Pseudomonas aeruginosa infections in cystic fibrosis patients. Antibiot. Chemother. 39: 60-76. 58. Hoiby, N., H. Krogh Johansen, C. Moser, Z. Song, O. Ciofu, and A. Kharazmi. 2001. Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth. Microbes Infect. 3: 23-35. 59. Holder, I. A., A. N. Neely, and D. W. Frank. 2001. Type III secretion/intoxication system important in virulence of Pseudomonas aeruginosa infections in burns. Burns 27:129-30. 60. Hovey, A. K., and D. W. Frank. 1995. Analyses of the DNA-binding and transcriptional activation properties of Ex sA, the transcriptional activator of the Pseudomonas aeruginosa exoenzyme S regulon. J. Bacteriol. 177: 4427-36. 61. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Micr obiol. Mol. Biol. Rev. 62: 379-433.

PAGE 94

81 62. Ishihama, A. 2000. Functional modulation of Escherichia coli RNA polymerase. Annu. Rev. Microbiol. 54: 499-518. 63. Jacobs, M. A., A. Alwood, I. Thaipisuttikul, D. Spencer, E. Haugen, S. Ernst, O. Will, R. Kaul, C. Raymond, R. Levy, L. Chun-Rong, D. Guenthner, D. Bovee, M. V. Olson, and C. Manoil. 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa Proc. Natl. Acad. Sci. U S A 100: 14339-44. 64. Jia, J., M. Alaoui-El-Azher, M. Chow, T. C. Chambers, H. Baker, and S. Jin. 2003. c-Jun NH2-terminal kinase-media ted signaling is essential for Pseudomonas aeruginosa ExoS-induced apoptosis. Infect. Immun. 71: 3361-70. 65. Juhas, M., L. Eberl, and B. Tummler. 2005. Quorum sensing: the power of cooperation in the world of Pseudomonas Environ. Microbiol. 7: 459-71. 66. Kang, P. J., and E. A. Craig. 1990. Identification and characterization of a new Escherichia coli gene that is a dosage-dependent suppressor of a dnaK deletion mutation. J. Bacteriol. 172: 2055-64. 67. Kaufman, M. R., J. Jia, L. Zen g, U. Ha, M. Chow, and S. Jin. 2000. Pseudomonas aeruginosa mediated apoptosis re quires the ADP-ribosylating activity of exoS. Microbiology 146 ( Pt 10): 2531-41. 68. Kohler, T., M. Michea-Hamzehpour, U. He nze, N. Gotoh, L. K. Curty, and J. C. Pechere. 1997. Characterization of MexE-M exF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa Mol. Microbiol. 23: 345-54. 69. Kuchma, S. L., J. P. Connolly, and G. A. O'Toole. 2005. A three-component regulatory system regulates biofilm ma turation and type III secretion in Pseudomonas aeruginosa J. Bacteriol. 187: 1441-54. 70. Kushner, S. R. 2004. mRNA decay in prokaryotes and eukaryotes: different approaches to a similar problem. IUBMB Life 56: 585-94. 71. Larsen, R. A., M. M. Wilson, A. M. Guss, and W. W. Metcalf. 2002. Genetic analysis of pigment biosynthesis in Xa nthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is functional in a wide variety of bacteria. Arch. Microbiol. 178: 193-201. 72. Laskowski, M. A., E. Osbo rn, and B. I. Kazmierczak. 2004. A novel sensor kinase-response regulator hybrid regulates type III secretion a nd is required for virulence in Pseudomonas aeruginosa Mol. Microbiol. 54: 1090-103.

PAGE 95

82 73. Ledgham, F., C. Soscia, A. Chakra barty, A. Lazdunski, and M. Foglino. 2003. Global regulation in Pseudomonas aeruginosa : the regulatory protein AlgR2 (AlgQ) acts as a modulator of quorum sensing. Res. Microbiol. 154: 20713. 74. Lewin, B. 1994. Genes V. Oxford University Press. New York. 75. Linares, J. F., J. A. Lopez, E. Camafe ita, J. P. Albar, F. Rojo, and J. L. Martinez. 2005. Overexpression of the multidr ug efflux pumps MexCD-OprJ and MexEF-OprN is associated with a reduction of type III secretion in Pseudomonas aeruginosa J. Bacteriol. 187: 1384-91. 76. Livermore, D. M. 1995. beta-Lactamases in laborat ory and clinical resistance. Clin. Microbiol. Rev. 8: 557-84. 77. Lizewski, S. E., D. S. Lundberg, and M. J. Schurr. 2002. The transcriptional regulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect. Immun. 70: 6083-93. 78. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J. Wozniak. 1998. Phosphorylation-independent ac tivity of the response regulators AlgB and AlgR in promoting al ginate biosynthesis in mucoid Pseudomonas aeruginosa J. Bacteriol. 180: 956-68. 79. Madrid, C., J. M. Nieto, and A. Juarez. 2002. Role of the Hha/YmoA family of proteins in the thermoregulation of the e xpression of virulence factors. Int. J. Med. Microbiol. 291: 425-32. 80. Malhotra, S., L. A. Silo-Suh, K. Mathee, and D. E. Ohman. 2000. Proteome analysis of the effect of mucoid c onversion on global prot ein expression in Pseudomonas aeruginosa strain PAO1 shows induc tion of the disulfide bond isomerase, dsbA J. Bacteriol. 182: 6999-7006. 81. Maresso, A. W., M. J. Riese, and J. T. Barbieri. 2003. Molecular heterogeneity of a type III cytotoxin, Pseudomonas aeruginosa exoenzyme S. Biochemistry 42: 14249-57. 82. Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. Govan, B. W. Holloway, and V. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients. Proc. Natl. Acad. Sci. U S A 90: 8377-81. 83. Masse, E., N. Majdalani, and S. Gottesman. 2003. Regulatory roles for small RNAs in bacteria. Curr. Opin. Microbiol. 6: 120-4.

PAGE 96

83 84. Mathee, K., O. Ciofu, C. Sternberg, P. W. Lindum, J. I. Campbell, P. Jensen, A. H. Johnsen, M. Givskov, D. E. Ohman, S. Molin, N. Hoiby, and A. Kharazmi. 1999. Mucoid conversion of Pseudomonas aeruginosa by hydrogen peroxide: a mechanism for virulence activ ation in the cystic fibrosis lung. Microbiology 145 ( Pt 6): 1349-57. 85. Mathee, K., C. J. McPherson, and D. E. Ohman. 1997. Posttranslational control of the algT ( algU )-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J. Bacteriol. 179: 3711-20. 86. Matsui, H., Y. Sano, H. Ishihara, and T. Shinomiya. 1993. Regulation of pyocin genes in Pseudomonas aeruginosa by positive ( prtN ) and negative ( prtR ) regulatory genes. J. Bacteriol. 175: 1257-63. 87. Mattick, J. S., C. B. Whitchurch, and R. A. Alm. 1996. The molecular genetics of type-4 fimbriae in Pseudomonas aeruginosa --a review. Gene 179: 147-55. 88. Mavroidi, A., E. Tzelepi, A. Tsakris, V. Miriagou, D. Sofianou, and L. S. Tzouvelekis. 2001. An integron-associated beta-lactamase (IBC-2) from Pseudomonas aeruginosa is a variant of the extended-spectrum beta-lactamase IBC-1. J. Antimicrob. Chemother. 48: 627-30. 89. McCaw, M. L., G. L. Lykken, P. K. Singh, and T. L. Yahr. 2002. ExsD is a negative regulator of the Pseudomonas aeruginosa type III secretion regulon. Mol. Microbiol. 46: 1123-33. 90. Michel-Briand, Y., and C. Baysse. 2002. The pyocins of Pseudomonas aeruginosa Biochimie. 84: 499-510. 91. Miller, G. H., F. J. Sabatelli, R. S. Hare, Y. Glupczynski, P. Mackey, D. Shlaes, K. Shimizu, and K. J. Shaw. 1997. The most frequent aminoglycoside resistance mechanisms--changes with tim e and geographic area: a reflection of aminoglycoside usage patterns? Aminogl ycoside Resistance Study Groups. Clin. Infect. Dis. 24 Suppl 1: S46-62. 92. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, New York, N.Y. 93. Mohr, C. D., N. S. Hibler, and V. Deretic. 1991. AlgR, a response regulator controlling mucoidy in Pseudomonas aeruginosa binds to the FUS sites of the algD promoter located unusually far upstr eam from the mRNA start site. J. Bacteriol. 173: 5136-43.

PAGE 97

84 94. Nakajima, A., Y. Sugimoto, H. Yoneyama, and T. Nakae. 2002. High-level fluoroquinolone resistance in Pseudomonas aeruginosa due to interplay of the MexAB-OprM efflux pump and the DNA gyr ase mutation. Microbiol. Immunol. 46: 391-5. 95. Neyt, C., and G. R. Cornelis. 1999. Insertion of a Yop tran slocation pore into the macrophage plasma membrane by Yersinia enterocolitica : requirement for translocators YopB and YopD, but not LcrG. Mol. Microbiol. 33: 971-81. 96. Nixon, G. M., D. S. Armstrong, R. Carzino, J. B. Carlin, A. Olinsky, C. F. Robertson, and K. Grimwood. 2001. Clinical outcome after early Pseudomonas aeruginosa infection in cystic fibrosis. J. Pediatr. 138: 699-704. 97. Ochsner, U. A., P. J. Wilderman, A. I. Vasil, and M. L. Vasil. 2002. GeneChip expression analysis of the iron starvation response in Pseudomonas aeruginosa : identification of novel pyoverdine bios ynthesis genes. Mol. Microbiol. 45: 127787. 98. Pastor, A., J. Chabert, M. Louwagie, J. Garin, and I. Attree. 2005. PscF is a major component of the Pseudomonas aeruginosa type III secretion needle. FEMS Microbiol. Lett. 253: 95-101. 99. Pier, G. B., M. Grout, and T. S. Zaidi. 1997. Cystic fibrosis transmembrane conductance regulator is an epithel ial cell receptor for clearance of Pseudomonas aeruginosa from the lung. Proc. Natl. Acad. Sci. U S A 94: 12088-93. 100. Poole, K. 2001. Multidrug efflux pumps a nd antimicrobial resistance in Pseudomonas aeruginosa and related organisms. J. Mol. Microbiol. Biotechnol. 3: 255-64. 101. Poole, K., K. Tetro, Q. Zhao, S. Neshat D. E. Heinrichs, and N. Bianco. 1996. Expression of the multidrug resistance operon mexA mexB oprM in Pseudomonas aeruginosa : mexR encodes a regulator of oper on expression. Antimicrob. Agents Chemother. 40: 2021-8. 102. Quinaud, M., J. Chabert, E. Faudry, E. Neumann, D. Lemaire, A. Pastor, S. Elsen, A. Dessen, and I. Attree. 2005. The PscE-PscF-PscG complex controls type III secretion needle biogenesis in Pseudomonas aeruginosa J. Biol. Chem. 280: 36293-300. 103. Rajan, S., and L. Saiman. 2002. Pulmonary infections in patients with cystic fibrosis. Semin.Respir. Infect. 17: 47-56. 104. Ramphal, R., L. Koo, K. S. Ishimoto, P. A. Totten, J. C. Lara, and S. Lory. 1991. Adhesion of Pseudomonas aeruginosa pilin-deficient mutants to mucin. Infect. Immun. 59: 1307-11.

PAGE 98

85 105. Richards, M. J., J. R. Edwards, D. H. Culver, and R. P. Gaynes. 1999. Nosocomial infections in medical inte nsive care units in the United States. National Nosocomial Infections Surveillance System. Crit. Care. Med. 27: 887-92. 106. Rietsch, A., I. Vallet-Gely, S. L. Dove, and J. J. Mekalanos. 2005. ExsE, a secreted regulator of type III secretion genes in Pseudomonas aeruginosa Proc. Natl. Acad. Sci. U S A 102: 8006-11. 107. Rietsch, A., M. C. Wolfgang, and J. J. Mekalanos. 2004. Effect of metabolic imbalance on expression of type III secretion genes in Pseudomonas aeruginosa Infect. Immun. 72: 1383-90. 108. Rodrigue, A., Y. Quentin, A. Lazdunski, V. Mejean, and M. Foglino. 2000. Two-component systems in Pseudomonas aeruginosa : why so many? Trends. Microbiol. 8: 498-504. 109. Rosenfeld, M., B. W. Ramsey, and R. L. Gibson. 2003. Pseudomonas acquisition in young patients with cystic fibrosis: pa thophysiology, diagnosis, and management. Curr. Opin. Pulm. Med. 9: 492-7. 110. Rossolini, G. M., and E. Mantengoli. 2005. Treatment and control of severe infections caused by multiresistant Pseudomonas aeruginosa Clin. Microbiol. Infect. 11 Suppl 4: 17-32. 111. Rowen, D. W., and V. Deretic. 2000. Membrane-to-cyto sol redistribution of ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol. Microbiol. 36: 314-27. 112. Sato, H., J. B. Feix, C. J. Hillard, and D. W. Frank. 2005. Characterization of phospholipase activity of the Pseudomonas aeruginosa type III cytotoxin, ExoU. J. Bacteriol. 187: 1192-5. 113. Sawa, T., T. L. Yahr, M. Ohara, K. Kura hashi, M. A. Gropper, J. P. WienerKronish, and D. W. Frank. 1999. Active and passive immunization with the Pseudomonas V antigen protects against t ype III intoxication and lung injury. Nat. Med. 5: 392-8. 114. Schoehn, G., A. M. Di Guilmi, D. Lema ire, I. Attree, W. Weissenhorn, and A. Dessen. 2003. Oligomerization of type III s ecretion proteins PopB and PopD precedes pore formation in Pseudomonas. Embo. J. 22: 4957-67. 115. Schweizer, H. P. 1991. EscherichiaPseudomonas shuttle vectors derived from pUC18/19. Gene 97: 109-21.

PAGE 99

86 116. Shan, Z., H. Xu, X. Shi, Y. Yu, H. Yao, X. Zhang, Y. Bai, C. Gao, P. E. Saris, and M. Qiao. 2004. Identification of two new genes involved in twitching motility in Pseudomonas aeruginosa Microbiology 150: 2653-61. 117. Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying en zymes. Microbiol. Rev. 57: 138-63. 118. Shiba, T., K. Ishiguro, N. Takemoto, H. Koibuchi, and K. Sugimoto. 1995. Purification and characterization of the Pseudomonas aeruginosa NfxB protein, the negative regulator of the nfxB gene. J. Bacteriol. 177: 5872-7. 119. Shih, P. C., and C. T. Huang. 2002. Effects of quorum-sensing deficiency on Pseudomonas aeruginosa biofilm formation and antibiotic resistance. J. Antimicrob. Chemother. 49: 309-14. 120. Shime, N., T. Sawa, J. Fujimoto, K. Faure, L. R. Allmond, T. Karaca, B. L. Swanson, E. G. Spack, and J. P. Wiener-Kronish. 2001. Therapeutic administration of anti-PcrV F(ab' )(2) in sepsis associated with Pseudomonas aeruginosa J. Immunol. 167: 5880-6. 121. Shortridge, V. D., A. Lazdunski, and M. L. Vasil. 1992. Osmoprotectants and phosphate regulate expressi on of phospholipase C in Pseudomonas aeruginosa Mol. Microbiol. 6: 863-71. 122. Sonnleitner, E., S. Hagens, F. Rosenau, S. Wilhelm, A. Habel, K. E. Jager, and U. Blasi. 2003. Reduced virulence of a hfq mutant of Pseudomonas aeruginosa O1. Microb. Pathog. 35: 217-28. 123. Storz, G., J. A. Opdyke, and A. Zhang. 2004. Controlling mRNA stability and translation with small, noncodi ng RNAs. Curr. Opin. Microbiol. 7: 140-4. 124. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406: 959-64. 125. Sundin, C., B. Hallberg, and A. Forsberg. 2004. ADP-ribosylation by exoenzyme T of Pseudomonas aeruginosa induces an irreversible effect on the host cell cytoskeleton in vi vo. FEMS Microbiol. Lett. 234: 87-91.

PAGE 100

87 126. Sundin, C., J. Thelaus, J. E. Broms, and A. Forsberg. 2004. Polarisation of type III translocation by Pseudomonas aeruginosa requires PcrG, PcrV and PopN. Microb. Pathog. 37: 313-22. 127. Tardy, F., F. Homble, C. Neyt, R. Wattiez, G. R. Cornelis, J. M. Ruysschaert, and V. Cabiaux. 1999. Yersinia enterocolitica type III secretion-translocation system: channel formation by secreted Yops. Embo. J. 18: 6793-9. 128. Tateda, K., Y. Ishii, M. Horikawa, T. Matsumoto, S. Miyairi, J. C. Pechere, T. J. Standiford, M. Ishiguro, and K. Yamaguchi. 2003. The Pseudomonas aeruginosa autoinducer N-3-oxododecanoyl homo serine lactone accelerates apoptosis in macrophages and neutrophils. Infect. Immun. 71: 5785-93. 129. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microarrays applied to the ionizing radiat ion response. Proc. Natl. Acad. Sci. U S A 98: 5116-21. 130. Urbanowski, M. L., G. L. Lykken, and T. L. Yahr. 2005. A secreted regulatory protein couples transcription to the secretory activity of the Pseudomonas aeruginosa type III secretion system. Proc. Natl. Acad. Sci. U S A 102: 9930-5. 131. Vallis, A. J., T. L. Yahr, J. T. Barbieri, and D. W. Frank. 1999. Regulation of ExoS production and secretion by Pseudomonas aeruginosa in response to tissue culture conditions Infect. Immun. 67: 914-20. 132. Vasil, M. L., and U. A. Ochsner. 1999. The response of Pseudomonas aeruginosa to iron: genetics, biochemistry and virulence. Mol. Microbiol. 34: 399413. 133. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski. 2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J. Bacteriol. 185: 2080-95. 134. Wang, Y., U. Ha, L. Zeng, and S. Jin. 2003. Regulation of membrane permeability by a two-component regulatory system in Pseudomonas aeruginosa Antimicrob. Agents. Chemother. 47: 95-101. 135. Westbrock-Wadman, S., D. R. Sherman, M. J. Hickey, S. N. Coulter, Y. Q. Zhu, P. Warrener, L. Y. Nguyen, R. M. Shawar, K. R. Folger, and C. K. Stover. 1999. Characterization of a Pseudomonas aeruginosa efflux pump contributing to aminoglycoside impermeability. Antimicrob. Agents. Chemother. 43: 2975-83. 136. Whitchurch, C. B., R. A. Alm, and J. S. Mattick. 1996. The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa Proc. Natl. Acad. Sci. U S A 93: 9839-43.

PAGE 101

88 137. Whitchurch, C. B., S. A. Beatson, J. C. Comolli, T. Jakobsen, J. L. Sargent, J. J. Bertrand, J. West, M. Klausen, L. L. Waite, P. J. Kang, T. TolkerNielsen, J. S. Mattick, and J. N. Engel. 2005. Pseudomonas aeruginosa fimL regulates multiple virulence functions by intersecting with Vfr-modulated pathways. Mol. Microbiol. 55: 1357-78. 138. Whitchurch, C. B., T. E. Erova, J. A. Emery, J. L. Sargent, J. M. Harris, A. B. Semmler, M. D. Young, J. S. Mattick, and D. J. Wozniak. 2002. Phosphorylation of the Pseudomonas aeruginosa response regulator AlgR is essential for type IV fimbria-mediat ed twitching motility. J. Bacteriol. 184: 454454. 139. Wilharm, G., W. Neumayer, and J. Heesemann. 2003. Recombinant Yersinia enterocolitica YscM1 and YscM2: homodimer formation and susceptibility to thrombin cleavage. Protein. Expr. Purif. 31: 167-72. 140. Wolfgang, M. C., V. T. Lee, M. E. Gilmore, and S. Lory. 2003. Coordinate regulation of bacterial virulence gene s by a novel adenylate cyclase-dependent signaling pathway. Dev. Cell 4: 253-63. 141. Woods, D. E., D. C. Straus, W. G. Johanson, Jr., V. K. Berry, and J. A. Bass. 1980. Role of pili in adherence of Pseudomonas aeruginosa to mammalian buccal epithelial cells. Infect. Immun. 29: 1146-51. 142. Wulff-Strobel, C. R., A. W. Williams, and S. C. Straley. 2002. LcrQ and SycH function together at the Ysc type III secretion system in Yersinia pestis to impose a hierarchy of secretion. Mol. Microbiol. 43: 411-23. 143. Wyckoff, T. J., B. Thomas, D. J. Hassett, and D. J. Wozniak. 2002. Static growth of mucoid Pseudomonas aeruginosa selects for non-mucoid variants that have acquired flagellum-dependent motility. Microbiology 148: 3423-30. 144. Yahr, T. L., and D. W. Frank. 1994. Transcriptional organization of the transregulatory locus which controls exoenzyme S synthesis in Pseudomonas aeruginosa J. Bacteriol. 176: 3832-38. 145. Yoon, S. S., R. F. Hennigan, G. M. Hillia rd, U. A. Ochsner, K. Parvatiyar, M. C. Kamani, H. L. Allen, T. R. DeKievit, P. R. Gardner, U. Schwab, J. J. Rowe, B. H. Iglewski, T. R. McDermott, R. P. Mason, D. J. Wozniak, R. E. Hancock, M. R. Parsek, T. L. Noah, R. C. Boucher, and D. J. Hassett. 2002. Pseudomonas aeruginosa anaerobic respiration in biof ilms: relationships to cystic fibrosis pathogenesis. Dev. Cell 3: 593-603.

PAGE 102

89 146. Yu, H., M. Mudd, J. C. Boucher, M. J. Schurr, and V. Deretic. 1997. Identification of the algZ gene upstream of the response regulator algR and its participation in control of alginate production in Pseudomonas aeruginosa J. Bacteriol. 179: 187-93.

PAGE 103

90 BIOGRAPHICAL SKETCH Weihui Wu was born in Tianjin, Peoples Republic of China, in June, 1976. From 1988 to 1994, he attended Tianjin No.2 middl e school and high school. In 1994, he received admission from Nankai University, where he started his study in microbiology. After obtaining a Bachelor of Science degr ee in the summer of 1998, Weihui continued to study microbiology as a graduate student. He spent the next three years in studying Bacillus thuringiensis and received a Master of Scie nce degree in 2001. After that, he decided to continue his study in microbi ology. In August, 2001, Weihui came to America as a graduate student in the Interdisciplinary Program in Biomedical Sciences at the University of Florida. One year later, he joined Dr. Shouguang Jins laboratory. In the next four years, he studied the regulat ion of the type III secretion system in Pseudomonas aeruginosa under the supervision of Dr. Shouguang Jin. After obtaining a Ph.D. degree in microbiology and immunology, We ihui plans to continue to pursue his research career in the biomedical field.


Permanent Link: http://ufdc.ufl.edu/UFE0013501/00001

Material Information

Title: Regulation of the Type III Secretion System in Pseudomonas aeruginosa
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013501:00001

Permanent Link: http://ufdc.ufl.edu/UFE0013501/00001

Material Information

Title: Regulation of the Type III Secretion System in Pseudomonas aeruginosa
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013501:00001


This item has the following downloads:


Full Text












REGULATION OF THE TYPE III SECRETION SYSTEM IN Pseudomonas aeruginosa


By

WEIHUI WU













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Weihui Wu

































This dissertation is dedicated to my parents, Liuting Wu, Hong Wang and my wife,
Chang Xu.















ACKNOWLEDGMENTS

This work was carried out at the Department of Molecular Genetics and

Microbiology, College of Medicine, University of Florida, during the years 2001-2006.

It is my great pleasure to thank the following persons who have taken part in this work

and thus made it possible.

I owe my deepest thanks to my mentor, Dr. Shouguang Jin. His encouragement,

support, and enthusiastic attitude towards research and life in general have been inspiring

and have guided me during these years and have been more than I could have ever asked

for. I greatly appreciate the opportunity to be part of his research team.

I would like to sincerely thank my committee, Dr. Shouguang Jin, Dr. Ann

Progulske-Fox, Dr. Paul A. Gulig and Dr. Reuben Ramphal, whose insightful advice in

the last 4 years has made a great difference in my research progress and in my view of

being a serious scientist.

Far too many people to mention individually have assisted in so many ways during

my work. They all have my sincere gratitude. In particular, I would like to thank the

past and present members of the Jin laboratory, Dr. Unhwan Ha, Dr. Mounia Alaoue-El-

Azher, Dr. Li Liu, Dr. Jae Wha Kim, Xiaoling Wang, Dr. Hongjiang Yang and Dan Li,

for their help and advice. Especially, many thanks go to Dr. Lin Zeng and Dr. Jinghua

Jia, who have given me tremendous help in my life and research since I came to America.

I am also grateful to Wei Lian, M.D., for her help and suggestions these years.









I would like to thank Dr. William W. Metcalf of the University of Illinois at

Urbana-Champaign for providing the transposon plasmid and related E. coli strains used

in my work. I would like to thank Dr. Shiwani Aurora from Dr. Reuben Ramphal's lab

and Dr. Hassan Badrane from Dr. Henry V. Baker's lab, who have contributed to my

research and offered valuable technical support and discussions.

My final, and most heartfelt, acknowledgments must go to my family. I want to

express my earnest gratitude to my parents, Liuting Wu and Hong Wang, for their

unconditional love, encouragement and for always being there when I needed them most.

My wife, Chang Xu, deserves my warmest thanks. She is the source of my strength. Her

support, encouragement, and companionship have turned my journey through graduate

school into a pleasure. For all that, she has my everlasting love.
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TA BLES .................................................................... ............ .. ix

LIST OF FIGURES ............................... ... ...... ... ................. .x

ABSTRACT .............. ..................... .......... .............. xii

CHAPTER


1 INTRODUCTION AND BACKGROUND ..................................... ...............

Pseudomonas aeruginosa .............................................................................. 1
B asic B acteriology ................................................... ....... .............. .
Infections ................................. .................................. ...............1
CF Airway Infection by P. aeruginosa ...................................... ............... 2
Antibiotic Resistance ............................................ .............. ..... ......... 2
A acquired R resistance .................... ............................ .. ......... ............ .. .. .
Intrinsic R esistance.......... ..... ...................................................... ............... .3
M ultidrug Efflux System s .................................. ...................... ...............3
V irulence F actors ................................................................................................. 4
F lag ellu m .................................................................................. . 4
P ilu s .................................................................................................. . 5
E xtracellular T oxin s ................................................... .. ........ .......... .. .. ....
Q uorum Sensing .................................................................... 6
Iron M etab olism ....................................................... 6
A lginate ............................................................. . 7
B iofilm ................................................... 7
Type III Secretion System ....................................................... 7
Function of TTSS Structure G enes.................................................. 8
Needle structure genes ................. ................................. 8
Pore form ing com ponents .......................................................8
Polarization of type III translocation .......................................................9
Effector proteins ....................................................................... 9
R regulation of TTSS ................................................................................ 10
O their TTSS R elated G enes ................................ ........................ ...............11









2 MucA-MEDIATED COORDINATION OF TYPE III SECRETION AND
ALGINATE SYNTHESIS IN Pseudomonas aeruginosa .........................................13

In tro d u ctio n ...................................... ................................................ 13
M material and M ethods ........................................................... ........................ 14
Bacterial Strains and Growth Conditions............. ............................................14
Construction of Tn insertional M utant Bank.....................................................16
Determination of Tn Insertion Sites .............. ..................................... ......... 17
Generation of Knockout M utants ................................. ............. .................. 17
Plasmid Constructs for Complementation and Overexpression.......................18
W western Blotting ............... .. ................ ......... ....... ........ ...............19
RNA Isolation and M icroarray Analysis............................................... 20
R results .................... ...................... ..... .. ........... .. .............. ..... ........20
Activation of the TTSS Requires a Functional mucA Gene.............................20
Microarray Analysis of Gene Expression in the mucA Mutant.........................25
TTSS Repression in the mucA Mutant is AlgU Dependent. ............................31
AlgR has a Negative Regulatory Function on the TTSS..................................33
D discussion and Future D directions ...................... ............... ....... .....................34
The Expression of exsA in the mucA Mutant ................................. ...............34
The Regulatory Pathway of AlgU Regulon.................................. ................. 35
The TTSS Activity in P. aeruginosa CF Isolates................................ ..........36
Genes Differently Expressed in the mucA Mutant and Isogenic Wild-type
P A K ........................................................................... 3 8

3 PtrB OF Pseudomonas aeruginosa SUPPRESSES THE TYPE III SECRETION
SYSTEM UNDER THE STRESS OF DNA DAMAGE ...................... ...............42

Introdu action ...................................... ................................................. 42
M material and M ethords................................................................... .....................43
Bacterial Strains and Growth Conditions...................................................43
RT-PCR and Quantitative Real-time PCR ...................................................46
C ytotoxicity A ssay ............... .... ................ ..................... 47
Application of BacterioMatch Two-hybrid System ........................................48
Other M methods ............... ...... .. ................ .......... 48
Results ............................................................................48
TTSS Is Repressed in a prtR M utant .................................................................. 48
Identification of the PrtR-regulated Repressor of the TTSS ...............................49
PA0612 and PA0613 Form an Operon Which Is Under the Control of PrtR .....52
PA0612 Is Required for the Repression of the TTSS In the prtR Mutant...........53
The Expression of exsA Is Repressed by PtrB in prtR mutants...........................57
PtrB M ight Not Directly Interact with ExsA .................................................... 57
Mitomycin C-mediated Suppression of the TTSS Genes Requires PtrB ..........59
Twitching Motility Was Not Affected by the prtR mutation .............................61
D isc u ssio n .............................................. ........................ ................ 6 2

4 DISCUSSION AND FUTURE DIRECTIONS....................................66









The TTSS and Environm mental Stresses ........................................... ............... 66
Repression of the TTSS under Environmental Stresses..................... ...........66
Indication for the Control of P. aeruginosa Infection...................................67
Regulation of the TTSS under Environmental Stresses ...................................68
Expression of ExsA .................................. .......... .......... .............. 68
Transcriptional control ........................................ ........................... 69
Post-transcriptional control ........................................ ....... ............... 69
Transposon M utagenesis ................................................. ............................... 71
M utagenesis E efficiency ............................................... ............................ 71
C characteristics of the T n ........................................................................ ... ..... 72
Screen Sensitivity ........................................ ................... ..... .... 72

L IST O F R E F E R E N C E S ....................................................................... ... ................... 75

B IO G R A PH IC A L SK E TCH ..................................................................... ..................90






































viii
















LIST OF TABLES


Table p

1-1 Regulation and substrates of multidrug efflux systems ...........................................4

2-1 Strains and plasmids used in this study .......................................... ...............15

2-2 Expression of AlgU regulon genes in PAKmucA22 .............................................25

2-3 Expression of TTSS-related genes in PAKmucA22 .............................................27

2-4 Genes up regulated in PAKmucA22.................... ... ........................... 28

2-5 Genes down regulated in PAKmucA22 ...................................................... 30

3-1 Strains and plasmids used in this study ............... .......................... .... ............. 43

3-2 PCR prim ers used in this study ........................................... ......................... 46
















LIST OF FIGURES


Figure p

1-1. A m odel of the regulation of ExsA ..................................................... ........... 10

1-2. TTSS related regulatory netw ork.. ....................................................... .....................12

2-1. Expression of type III secretion genes in Tn insertional mutants of mucA................22

2-2. Expression and secretion of ExoS protein......... .......................................24

2-3. Expression of exsA::lacZ (A) and exoS::lacZ (B)................... .................................32

2-4. Expression of exsA::lacZ (A) and exoS::lacZ (B) in algR mutants .........................34

2-5. Proposed model of MucA-mediated coordination of alginate production and
T T S S expression .. ......................................................................37

3-1. Expression and secretion of E xoS.. ................................................. .....................50

3-2. Genetic organization and putative promoter regions ofprtN, prtR, PA0612-3. ........52

3-3. Expression of PA0612 is repressed by prtR .............................................................54

3-4. Expression of PA0612::lacZ................................................... ...............55

3-5. Characterization of ExoS expression and cytotoxicity ...........................................56

3-6. Expression of exsA operon inprtR mutants ...................... ............... ........... 57

3-7. Monitoring of protein-protein interactions by the BacterioMatch two-hybrid
system ............... ..... ......... ......................... ...... ................. .. 58

3-8. Effect of mitomycin C on bacteria growth and TTSS activity................................60

3-9. Twitching motility ofprtR, ptrB and PA0613 mutants.........................................61

3-10. Proposed model ofPtrB-mediated TTSS repression.............................................64

4-1. Structure of the exsCEBA operon. ........................................ ......................... 69









4-2. The secondary structure of exsA mRNA 5' terminus. The sequence was analyzed
b y m fo ld .. .................................................................................7 0















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

REGULATION OF THE TYPE III SECRETION SYSTEM IN Pseudomonas aeruginosa

By

Weihui Wu

May 2006

Chair: Shouguang Jin
Major Department: Molecular Genetics and Microbiology

Pseudomonas aeruginosa is an opportunistic bacterial pathogen which primarily

infects patients with cystic fibrosis (CF), severe bums, or immunosuppression. P.

aeruginosa possesses a type III secretion system (TTSS) which injects effector proteins

into host cells, resulting in cell rounding, lifting, and death by necrosis or apoptosis. By

screening a transposon insertional mutant library of a wild-type strain PAK, mutation in

the mucA orprtR gene was found to cause repression of the TTSS.

Mutation in the mucA gene causes alginate overproduction, resulting in a mucoid

phenotype. Comparison of global gene expression profiles of the mucA mutant and wild-

type PAK under TTSS inducing condition confirmed the down regulation of TTSS genes

and up regulation of genes involved in the alginate biosynthesis. Further analysis

indicated that the repression of the TTSS in the mucA mutant was AlgU and AlgR

dependent. Overexpression of the algR gene inhibited type III gene expression.

PrtR is an inhibitor ofprtN, which encodes a transcriptional activator for pyocin

synthesis genes. In P. aeruginosa, pyocin synthesis is activated when PrtR is degraded









during the SOS response. Treatment of a wild-type P. aeruginosa strain with mitomycin

C, a DNA-damaging agent resulted in the inhibition of TTSS activation. AprtR/prtN

double mutant had the same TTSS defect as theprtR mutant, and complementation by a

prtR gene but not by aprtNgene restored the TTSS function. Also, overexpression of the

prtN gene in wild-type PAK had no effect on the TTSS; thus PrtN is not involved in the

repression of the TTSS. To identify the PrtR-regulated TTSS repressor, another round of

Tn mutagenesis was performed in the background of aprtR/prtN double mutant.

Insertion in a small gene, designatedptrB, restored the normal TTSS activity. Expression

ofptrB is specifically repressed by PrtR, and mitomycin C-mediated suppression of the

TTSS is abolished in aptrB mutant strain. Therefore, PtrB is a newly discovered TTSS

repressor that regulates the TTSS under the stress of DNA damage.

My study revealed new regulatory relationship between MucA, PrtR and the TTSS,

and indicated that the TTSS might be repressed under environmental stresses.














CHAPTER 1
INTRODUCTION AND BACKGROUND

Pseudomonas aeruginosa

Basic Bacteriology

Pseudomonas aeruginosa is a versatile bacterium that is present in soil, marshes,

tap water, and coastal marine habitats. It is a straight or slightly curved, gram negative

bacillus (0.5-1.0 x 3-4 [m), belonging to the y-subdivision of the Proteobacteria. The

bacterium is defined as an obligate aerobe; however, anaerobic growth can occur when

nitrate or arginine is used as an alternate electron acceptor.

The genome sequence of this microorganism was completed several years ago and

is freely available to the public (www.pseudomonas.com) (124). The complete sequence

of this genome was one of the largest bacterial genomes sequenced to date, with 6.3-Mbp

in size encoding 5570 predicted genes (124). Most interesting is the fact that as high as

8% of the genome encodes transcriptional regulators, which is consistent with the

observed bacterial adaptability to various growth environments.

Infections

P. aeruginosa causes a wide range of infections, from minor skin infections to

serious and sometimes life-threatening complications. P. aeruginosa is also a causative

agent of systemic infections in immunocompromised patients, such as those receiving

chemotherapy, elderly patients, and burn victims (105, 109). Chronic bronchopulmonary

infection of P. aeruginosa is the major cause of morbidity and mortality in cystic fibrosis

(CF) patients (57).









CF Airway Infection by P. aeruginosa

Today, CF is one of the most common genetic disorders in Caucasian populations.

Approximately 30,000 individuals are affected in the United States. CF patients bear a

defect in the cystic fibrosis transmembrane conductance regulator (CFTR) gene located

on the human chromosome 7q31.2 (41, 103). CFTR functions as an apical membrane

chloride channel. Due to the mutation in CFTR, little or no C1- is transported across the

apical surface of secretary cells, which leads to an unopposed reabsorbtion ofNa+, Cl-,

and water. This results in thick mucus in a CF patient's airway. The thickened mucus

provides a favorable environment for opportunistic pathogens including P. aeruginosa,

Staphylococcus aureus, Haemophilus influenza, and Burkholderia cepacia (51). During

progression of the infection, P. aeruginosa predominates and grows as a biofilm, which is

highly resistant to antibiotics and cannot be eradicated. Most clinical isolates from CF

patients overproduce an extracellular polysaccharide called alginate, resulting in a

mucoid phenotype.

It is believed that the recurring infections that culminate with chronic P. aeruginosa

colonization cause the respiratory damage in CF patients, the progressive deterioration of

respiratory function, and eventually the mortality of the patient. The clinical treatment

typically includes antibiotics, anti-inflammatory drugs, bronchodilators, and physical

therapy (96, 99).

Antibiotic Resistance

P. aeruginosa exhibits a remarkable ability to develop resistance to multiple

antibiotics. The resistance arises through an acquired and/or intrinsic mechanism.









Acquired Resistance

Acquired resistance is developed from a mutation or an acquisition of an antibiotic

modification enzyme by horizontal transfer, such as p-lactamase (76, 88) and acetyl-

transferases (resistance to aminoglycosides) (91, 117).

The target gene will avoid recognition of the antibiotic if mutation occurs. For

example, mutations causing lipopolysaccharide changes reduce the uptake of

aminoglycosides (14). Mutations in GyrA (a DNA gyrase) result in the resistance to

fluoroquinolone (94). Other mutations will cause the decrease of membrane permeability

(134) or up regulation of intrinsic resistant genes/systems (110).

Intrinsic Resistance

P. aeruginosa is intrinsically resistant to many antibiotics. The mechanisms

include chromosomally encoded P-lactamase (76), low permeability of outer membrane

and multidrug efflux systems (100). Besides these mechanisms, the biofilm mode of

growth also leads to an increased antibiotic resistance (58). More of the biofilm will be

discussed in the next section.

Multidrug Efflux Systems

The multidrug efflux system is a three-component channel through the inner and

outer membrane which pumps out antimicrobial agents in an energy dependent manner.

It contributes to the reduced susceptibility or resistance to many antibiotics such as P-

lactams, aminoglycosides, tetracycline, quinolones, chloramphenicol, sulphonamides,

macrolides and trimethoprim (110). Six multidrug efflux systems have been identified in

P. aeruginosa, including MexAB-OprM, MexCD-OprJ, MexEF-OprN, MexXY-OprM,

MexJK-OprM and MexGHI-OpmD. Each of them has a different substrate specificity.

MexJK-OprM and MexGHI-OpmD were found to provide resistance against triclosan









(18) and vanadium (1), respectively. MexAB-OprM is constitutively expressed at a low

level. In wild-type strains, the expression of MexAB-OprM, MexCD-OprJ, MexEF-

OprN and MexXY-OprM is repressed. Mutation in their respective regulator will lead to

derepression and increased antibiotic resistance. The substrates and regulation of these

efflux systems are summarized in Table 1-1.

Table 1-1 Regulation and substrates of multidrug efflux systems
Multidrug efflux Regulator Substrates
system
MexAB-OprM MexR (-) p-lactams, quinolones, chloramphenicol,
tetracycline, trimethoprim, sulphonamides
(101)
MexCD-OprJ NfxB (-) Cefpirome, quinolones, chloramphenicol,
erythromycin, tetracycline (118)
MexEF-OprN MexT (+) Imipenem, quinolones, tetracycline (68)
MexXY-OprM MexZ (-) Aminoglycosides, tetracycline, erythromycin
(135)
-, negative regulator; +, positive regulator

Virulence Factors

P. aeruginosa harbors an arsenal of virulence factors, which enable it to establish

localized, chronic colonization or systemic infection. The virulence factors include

flagella, pili, extracellular toxins, quorum sensing systems, iron metabolism factors,

alginate production, and a type III secretion system (5, 19, 21, 25, 58, 64, 65, 67, 87, 97,

104, 111, 121).

Flagellum

P. aeruginosa possesses a single polar flagellum which serves as a motive

organelle on the bacterial surface. The flagellum consists of a basal body, hook, flagellar

filament and motor. The basal body anchors the flagellum on the surface of the

bacterium, the hook functions as a joint connecting the filament to the basal body, the

filament functions as a propeller, and the rotation of the flagellum is generated by the









motor. By rotating the flagellum, the bacterium can move in the surrounding

environment. Two types of movement depend on flagella, swimming and swarming.

Swimming is a movement of bacteria in the surrounding liquid, and swarming is a

surface translocation by groups of bacteria (17, 50). During the infection, flagella

mediate the adhesion of P. aeruginosa to mucin in human airways (5, 104).

Pilus

Besides flagella, P. aeruginosa produces another motive organelle, the type IV

pilus. A pilus is a polar filament structure, mediating attachment to host epithelial cells

and a type of surface translocation called twitching motility (141). The pilus is composed

of a small subunit (pilin). Pilin is synthesized in the cytoplasm as pre-pilin and

translocated through the inner membrane, cell wall, and outer membrane to the surface of

bacterium. During translocation, pre-pilin is cleaved to pilin and made ready to be

assembled into a pilus. The pilus is able to extend and retract, resulting in surface

translocation (twitching motility) (25, 87).

Extracellular Toxins

P. aeruginosa produces a variety of extracellular virulence determinants and

secondary metabolites, which could cause extensive tissue damage, inflammation, and

disruption of host defense mechanisms. The extracellular toxins include exotoxin A,

alkaline protease, phospholipase C, elastase, hydrogen cyanide, pyocyanin, phenazine

and rhamnolipid. Exotoxin A and alkaline protease are under the control of the iron

metabolism system and are expressed at a much higher level under iron limited

environments (19, 97). The regulation of phospholipase C is regulated by inorganic

phosphate (Pi) (121). The remaining virulence factors are under the control of a quorum

sensing system (65).









Quorum Sensing

P. aeruginosa possesses a signaling system for cell-cell communication, called

quorum sensing. P. aeruginosa possesses three quorum sensing systems, known as las,

rhl and PQS (pseudomonas quinolone signal). Each system contains a small molecule

involved in signal communication. The las and rhl systems use acyl-homoserine

lactones, C4-HSL and 30C12-HSL, as signal molecules, respectively. The signal

molecule of the PQS system is quinolone. The signal molecules are secreted into the

surrounding environment, and when their concentrations reach a threshold (usually at the

mid or late log phase), they can interact with their respective receptors and modulate gene

expression in the population. The three quorum sensing systems can interact with each

other. When the quorum sensing systems are activated, the expression of many virulence

genes is up regulated, as reported previously (65, 133). Besides functioning as signal

molecules, C4-HSL and 30C12-HSL can directly modulate the host immune system.

30C12-HSL is able to promote induction of apoptosis in macrophages and neutrophils

(128). Quorum sensing is required for biofilm formation (119, 145). Therefore, quorum

sensing can be a drug target for the treatment and eradication ofP. aeruginosa infection

(11, 51).

Iron Metabolism

Iron is essential for the metabolism and survival ofP. aeruginosa. To acquire iron

from the surrounding environment, P. aeruginosa produces and secretes iron-chelating

compounds called siderophores. Two types of siderophores, pyoverdine and pyochelin,

are produced by P. aeruginosa, with the former having much higher affinity than the

latter in binding iron (III). The pyoverdine and pyochelin synthesis genes and receptors









are under the negative control of a regulator, Fur. Under iron depleted environments, the

expression of these genes is derepressed (97, 132).

Alginate

Alginate is an exopolysaccharide synthesised by P. aeruginosa. Alginate

production is known to be activated by environmental stress such as high osmolarity,

nitrogen limitation, and membrane perturbation induced by ethanol (10). Over

production of alginate renders mucoidy to the bacterium. Most P. aeruginosa clinical

isolates from CF patients display a mucoid phenotype (111). The function and regulation

of alginate are described in the introduction section of Chapter 3.

Biofilm

During chronic infection of CF airways, P. aeruginosa forms a biofilm on the

respiratory epithelial surface. The biofilm consists of microcolonies surrounded by

alginate (58), although alginate is not essential for the biofilm formation. The formation

ofbiofilm requires flagella, pili, and quorum sensing systems (28, 51, 58). Bacteria

growing in a biofilm are much more resistant to antibiotics than when growing in

planktonic mode. It is believed that the slow, anaerobic growth inside the biofilm

increases the antibiotic resistance. The surrounding negatively charged alginate may

function as a barrier against antibiotics, especially positively charged aminoglycosides

(58). Due to the biofilm mode of growth, antibiotic treatment usually fails to eradicate

the bacteria (58).

Type III Secretion System

Type III secretion systems (TTSSs) are complex protein secretion and delivery

machineries existing in many animal and plant pathogens. The TTSS directly

translocates bacterial effector molecules into the host cell cytoplasm, causing disruption









of intracellular signaling or even cell death (35). Components of TTSSs from a variety of

gram-negative bacteria display sequence and structural similarity. Most TTSS apparatus

are composed of two sets of protein rings embedded in the bacterial inner and outer

membranes and a needle-like structure (102). According to the current working model,

the needle forms a pole in the host cell membrane, and effector proteins are delivered

through the hollow needle (49, 95, 127).

The TTSS is an important virulence factor ofP. aeruginosa: it inhibits host defense

systems by inducing apoptosis in macrophages, polymorphonuclear phagocytes, and

epithelial cells (21, 64, 67). The loss of the TTSS resulted in an avirulent phenotype in a

burned mouse model (59).

Function of TTSS Structural Genes

The P. aeruginosa TTSS machinery is encoded by 31 genes arranged in four

operons on the chromosome. Several genes have been well studied for their functions

and interactions.

Needle structure genes

The P. aeruginosa TTSS needle is primarily composed of a 9-kDa protein named

PscF. Partially purified needles measured about 7 nm in width and 60-80 nm in length

(98). PscF has been shown to have two intracellular partners, PscE and PscG, which

prevent it from polymerizing prematurely in the cytoplasm and keep it in a secretion-

prone conformation (102).

Pore forming components

In order for TTSS-containing bacteria to directly deliver effector proteins into the

eukaryotic cytoplasm, a mechanism is required for the TTSS to penetrate the double

phospholipid cell membrane. The pore-forming activity possessed by the TTSS is









dependent on thepcrGVHpopBD operon (24). Upon contact with the host cell

membrane, PopB and PopD polymerize and form a ring-like structure in the membrane,

through which effector proteins are tanslocated. PopB and PopD have a common

cytoplasmic chaperon, PcrH, which prevents their premature aggregation (114). Another

gene product of this operon, PcrV, is required for the assembly and insertion of the

PopB/PopD ring into the host cell membrane (44). However, no direct interaction has

been detected between PcrV and PopB/PopD (44). PcrG was found to interact with PcrV

(4).

Polarization of type III translocation

When cultured mammalian cells were infected with wild type P. aeruginosa, TTSS

effector proteins could be detected only in the eukaryotic cytoplasm, but not in the tissue

culture medium (131). This phenomenon is called polarized translocation, during which

PopN, PcrG and PcrV are all required. Mutation in eitherpopN orpcrG does not affect

the TTSS-related cytotoxicity against HeLa cells; however, it results in high levels of

ExoS in the tissue culture medium (126).

Effector proteins

Four different effector proteins have been found in P. aeruginosa, ExoS, ExoT,

ExoY and ExoU. However, no natural P. aeruginosa isolates harbor both ExoS and

ExoU simultaneously. ExoS and ExoT share significant sequence homology and

structural similarity, with both bearing an ADP-ribosyltransferase activity and a GTPase-

activating protein activity. ExoU and ExoY have lipase and adenylate cyclase activities,

respectively (6, 39, 81, 112, 125). The ADP-ribosyltransferase activity of ExoS has been

shown to cause programmed cell death in various types of tissue culture cells (64, 67).









Regulation of TTSS

Expression of the TTSS regulon can be stimulated by direct contact with the host

cell or by growth under a low Ca2+ environment (61, 131). The expression of type III-

related genes is coordinately regulated by a transcriptional activator, ExsA (60). ExsA is

an AraC-type DNA binding protein that recognizes a consensus sequence, TXAAAXA,

located upstream of the transcriptional start site of type III secretion genes, including the

exsA gene itself (60). Three proteins, ExsD, ExsC and ExsE, directly regulate the activity

of ExsA. ExsD represses ExsA activity by directly interacting with it (89). ExsC on the

other hand has the ability to interact with both ExsD and ExsE (106, 130). Under TTSS

non-inducing conditions, ExsC binds to ExsE; however, when the TTSS is induced, ExsE

is secreted outside of the cell by TTSS machinery. This leads to the increased level of

free ExsC, which in turn binds to ExsD and releases ExsA, allowing the transcriptional

activation of the TTSS (27, 106, 130). The regulation cascade of the TTSS through ExsA

is summarized in Fig. 1-1.

TTSS non-inducing conditions TTSS inducing conditions
TTSS machinery



s^ VExsC
EExsx
ExsD
ExsD Cytoplasm
ExsA ExsA


Basal level TTSS Activated TTSS
expression expression
Figure 1-1. A model of the regulation of ExsA. See text for detail. *, derepressed ExsA.









Other TTSS Related Genes

In addition to genes described thus far, a number of other genes have been shown

to affect the expression of type III genes, although the regulatory mechanisms are not

known. Under TTSS-inducing conditions (low Ca2+), the cyclic AMP level increases and

a CRP homologue, Vfr, is required for TTSS activation (140). Vfr is a global regulator

which mediates the activation of quorum sensing (3), twitching motility (8), type II

secretion (140), and repression of flagellum synthesis (26). A novel gene,fimL, is also

required for both TTSS and twitching motility (116, 137). Transcription of vfr is reduced

in afimL mutant, and over expression of Vfr restores both the TTSS and twitching

motility, which suggests that the regulatory role of Vfr is downstream of FimL (137).

Mutation in a hybrid sensor kinase/response regulator (RtsM or RetS) results in a defect

in the TTSS and hyperbiofilm phenotype (42). Over expression of either Vfr or ExsA in

a ArtsM mutant restores the TTSS activity (72). Furthermore, a three-component

regulatory system (SadARS) is also required for both TTSS and biofilm formation in P.

aeruginosa (69).

Some enzymes and metabolic pathways in P. aeruginosa are also found to be

essential for the activation of TTSS. These include a periplasmic thiol:disulfide

oxidoreductase (DsbA) (48), a tRNA pseudouridine synthase (TruA) (2), pyruvate

dehydrogenases (AceAB) (23), and a normal histidine metabolism pathway (107).

Additionally, the TTSS in P. aeruginosa is under the negative control of the rhl quorum-

sensing system and the stationary-phase sigma factor RpoS (12, 56). Over expression of

MexCD-OprJ or MexEF-OprN also cause the repression of the TTSS (75). Recently, our

lab has demonstrated that a gene highly inducible during infection of the bum mouse

model, designated ptrA, encodes a small protein which inhibits TTSS through direct









binding to ExsA and thus functions as an anti-ExsA factor. Expression of this gene is

specifically inducible by high copper signal in vitro through a CopR/S two-component

regulatory system (47). Fig. 1-2 summarizes the knowledge of the TTSS-related

regulatory network in P. aeruginosa. The regulatory roles played by AlgR and PtrB in

TTSS regulation were discovered during my doctoral research period and will be

described in Chapter 2 and 3, respectively.


MucA
|. RetS/
+ RtsM
Alginate--AlgU \

AlgR3
AlgR


PrtR4-- -

PrtN

Pyocin


.-4 r


CopS
Co oR


trLt -00 TTSS


FimL + Twitching
SMotility

+ Flagellum +
Vfr + Quorum + Biofilm
SSensing

\+ aRpoS +

4- + SadARS


/ 1 +\
Normal histidine TruA AceAB DsbA
metabolism


Multi-drug
Efflux System


Figure 1-2. TTSS related regulatory network. See text for detail. +, positive
regulation/relationship; -, negative regulation. 1, direct protein-DNA binding
has been proved. 2, direct protein-protein interaction has been proved. 3, 4, this
relationship was newly discovered from the work during my Ph.D. program.














CHAPTER 2
MucA-MEDIATED COORDINATION OF TYPE III SECRETION AND ALGINATE
SYNTHESIS IN Pseudomonas aeruginosa

Introduction

Among CF patients, P. aeruginosa colonizes inside the thick mucus layer of the

airway. In this anaerobic environment, P. aeruginosa overproduces the

exopolysaccharide alginate and forms a biofilm which protects the bacterium from

reactive oxygen intermediates and inhibits phagocytosis (51). More than 90% of P.

aeruginosa strains isolated from CF patients show the mucoid phenotype, due to the

overproduction of alginate (111). Clearly, alginate overproduction is a strategy to

overcome environmental stresses. A number of stress signals trigger the overproduction

of alginate, converting the bacterium to the mucoid phenotype (84).

The genes encoding enzymes for alginate synthesis form an operon (algD operon),

and the expression of this operon is under the tight control of several regulators. The key

regulatory gene of this operon is the algU gene (also called algT), included in an algU

operon which consists of algU-mucA-mucB-mucC-mucD. The algU gene encodes a

sigma factor, 22, which autoregulates its own promoter and activates many other genes,

including those for alginate biosynthesis (85). The second gene in the algU operon, the

mucA gene, encodes a transmembrane protein with a cytoplasmic portion binding to and

inactivating AlgU (85). The third gene of the algU operon, the mucB gene, encodes a

periplasmic protein, possibly sensing certain environmental signals. Upon sensing

certain environmental signals, MucB transduces the signal to MucA, which in turn









releases the bound form of AlgU, resulting in activation of alginate production (85). The

majority of P. aeruginosa isolates from the lungs of older CF patients carry mutations in

the mucA or mucB gene and display a mucoid phenotype (82). In the AlgU regulon, two-

component regulatory systems AlgB-FimS (78) and AlgR-AlgZ (146) and regulators

AlgP (29) and AlgQ (73) are required for alginate synthesis. Among them, AlgR was

also shown to be essential for P. aeruginosa pathogenesis (77). An algR mutant is less

virulent than a wild-type strain in an acute septicemia infection mouse model (77). AlgR

is also required for twitching motility (136, 138). Proteomic analysis of the algR mutant

suggested that AlgR is a global regulator, affecting the expression of multiple genes (77).

In this chapter, a transposon (Tn) insertional mutant bank of a wild type P.

aeruginosa strain, PAK, was screened for mutants that are defective in TTSS expression.

I found that mutation in the mucA gene suppresses the expression of TTSS genes, greatly

reducing the response of the TTSS to low Ca2+. Furthermore, the suppression is

dependent on the AlgU and AlgR functions. Comparison of global gene expression of

the mucA mutant and wild type PAK under type Ill-inducing conditions confirmed the

above observation. Several groups of genes have been found to be differently expressed

in the mucA mutant and PAK, and their possible roles in TTSS expression are discussed.

Material and Methods

Bacterial Strains and Growth Conditions

Plasmids and bacterial strains used in this study are listed in Table 2-1. Bacteria

were gown in Luria broth (LB) at 370C. Antibiotics were used at the following

concentrations: for Escherichia coli, ampicillin at 100 [tg/ml, gentamicin at 10 [tg/ml,

tetracycline at 10 [g/ml, and kanamycin at 50 ig/ml; for P. aeruginosa, carbenicillin at

150 ig/ml, gentamicin at 150 ig/ml, tetracycline at 100 ig/ml, spectinomycin at 200









ig/ml, streptomycin at 200 ig/ml, and neomycin at 400 ig/ml. For 8-galactosidase

assays, three single colonies of each strain were used. The overnight cultures were diluted

100-fold with fresh LB or 30-fold with LB containing 5 mM EGTA. Bacteria were

grown to an optical density at 600 nm (OD600) between 1.0 and 2.0 before 8-galactosidase

assays (92). The data were subjected to t-test and P <0.05 was considered as statistically

significant.

Table 2-1. Strains and plasmids used in this study
Strain or plasmid Description Source or
reference


E. coli strains
BW20767/pRL27


DH5 /lApir

P. aeruginosa strains
PAK
PAK exsA::o

PAK A44
PAK A61
PAK mucA22
mucA22
algU: :Gm
mucA22 algR::Gm

PAK algU::Gm

Plasmids
pCR2.1-TOPO
pHW0005

pHW0006

pHW0024

pHW0032

pUCP19


RP4-2-Tc::Mu-1 Kan::Tn7 integrant leu-
63::ISO1 recAl zbf-5 creB510 hsdR17 endAl
thi uidA (AMluI::pir)/pRL27
#80dlacZAM15 &(lacZYA-argF)U169 recAl
hsdR1 7 deoR thi-1 supE44 gyrA96 relA 1/pir

Wild-type P. aeruginosa strain
PAK with exsA disrupted by insertion of V.
cassette; SprSmr
PAK mucA 1: :Tn5 mutant isolate; Neor
PAK mucA2::Tn5 mutant isolate; Neor
Point mutation (AG440) in mucA gene of PAK
mucA22 with algU disrupted by insertion of
Gm cassette; Gmr
mucA22 with algR disrupted by insertion of
Gm cassette; Gmr
PAK with algU disrupted by insertion of Gm
cassette; Gmr

Cloning vector for the PCR products
exoS promoter of PAK fused to promoterless
lacZ on pDN191acZQ; Spr Smr Tcr
exoT promoter of PAK fused to promoterless
lacZ on pDN191acZL; Spr Smr Tcr
pscN promoter of PAK fused to promoterless
lacZ on pDN191acZQ; Spr Smr Tcr
exsA promoter of PAK fused to promoterless
lacZ on pDN191acZQ; Spr Smr Tcr
Shuttle vector between E. coli and P.
aeruminosa


(71)


(71)


David Bradley
(36)

This study
This study
This study
This study

This study

This study


Invitrogen
(47)

(47)

(47)

(47)

(115)









Table 2-1. Continued
Strain or plasmid Description Source or
reference
pWW020 mucA gene on pUCP19 driven by algU This study
promoter; Apr
pWW021 mucA gene on pUCP19 driven by lac This study
promoter; Apr
pWW025 algU gene on pUCP19 driven by lac This study
promoter; Apr
pMMB67EH Low-copy-number broad-host-range cloning (38)
vector; Apr
pWW022 algR gene on pMMB67EH driven by lac This study
promoter; Apr
pEX18Tc Gene replacement vector; Tcr oriF sacB+ (55)
pEX18Ap Gene replacement vector; Apr ori7 sacB (55)
pPS856 Source of Gm' cassette; Ap' Gm' (55)
algU::Gm- algU disrupted by insertion of Gmr cassette This study
pEX18Tc on pEX18Tc; Gmr Tc' oriT sacB
algR::Gm- algR disrupted by insertion of Gmr cassette This study
pEX18Ap on pEX18Ap; Gm' Ap' oriT sacB+
PAK algR::Gm PAK with algR disrupted by insertion of Gm This study
cassette; Gmr

Construction of Tn insertional Mutant Bank

The P. aeruginosa PAK strain containing the exoT: :lacZ fusion plasmid

(pHW0006) was grown overnight at 420C, while E. coli donor strain BW20767/pRL27

was cultured to mid-log phase at 370C. Cells of the two types of bacteria were washed

with LB once to remove antibiotics in the culture medium. About 5 x 108

PAK/pHW0006 cells were mixed with 109 donor E. coli cells, and the mixture was

filtered onto a sterile nitrocellulose membrane (pore size, 0.22 .im). The membrane was

laid on top of nutrient agar and incubated at 370C for 7 to 9 h before washing off the

bacterial mixture from the membrane with LB. The bacterial suspension was serially

diluted with LB and spread on L-agar plates containing spectinomycin at 100 [tg/ml,

streptomycin at 100 [tg/ml, tetracycline at 50 [tg/ml, neomycin at 400 [tg/ml, and 20 tg









of 5-bromo-4-chloro-3-indolyl-B-L-thiogalactopyranoside (X-Gal) per ml, with or

without 2.5 mM EGTA for colony counting as well as mutant screening.

Determination of Tn Insertion Sites

To locate the Tn insertion sites of the isolated mutants, the Tn with flanking DNA

was rescued as a plasmid from the mutant chromosome. Plasmid rescue was carried out

as previously described (71). Briefly, genomic DNA of the Tn insertion mutants was

isolated with the Wizard genomic DNA purification kit (Promega) and digested with PstI.

The digested DNA was subjected to self-ligation with T4 DNA ligase and electroporated

into DH5a/pir. Plasmids were isolated from the transformants and sequenced with

primers tpnRL17-1 (5'-AAC AAG CCA GGG ATG TAA CG-3') and tpnRL13-2 (5'-

CAG CAA CAC CTT CTT CAC GA-3') for the DNA flanking the two ends of the Tn.

The DNA sequences were then compared with the P. aeruginosa genomic sequence by

using BLASTN (124).

Generation of Knockout Mutants

Chromosome gene knockout mutants were generated as previously described (55).

The target genes were amplified by PCR and cloned into pCR-TOPO2.1 (Invitrogen).

After subcloning the PCR product into pEX18Tc or pEX18Ap, the target gene was

disrupted by insertion of a gentamicin resistance cassette, leaving about 1 kb upstream

and downstream of the insertion-mutation site. The plasmids were electroporated into

wild-type PAK and single-crossover mutants were selected on LB plates containing

gentamicin at 150 [tg/ml, and tetracycline at 100 [tg/ml or carbenicillin at 150 [tg/ml.

Double-crossover mutants were selected by plating single-crossover mutants on LB

plates containing 5% sucrose and gentamicin at 150 [g/ml. In the case of the mucA22

mutant, a 1.8-kb fragment of the mucA gene region was amplified from FRD1 mucoidd









strain) (78) genomic DNA, and the fragment was cloned into the HindIII site of

pEX18Gm. The plasmid was transformed into P. aeruginosa to select for single

crossover mutants on LB agar plates containing 150 [g/ml gentamicin. Single-crossover

mutants were plated on L-agar plates containing 5% sucrose to select for double-

crossover mutants. The double-crossover mutants were mucoid, and the introduction of

the mucA22 mutation was confirmed by sequencing of the mucA gene.

Plasmid Constructs for Complementation and Overexpression

Reporter fusions between the exsA, exoT, exoS, and pscN genes and promoterless

lacZ on pDN191acZ were generated by Ha et al. (47, 48). For mucA gene

complementation, the mucA gene was amplified from PAK genomic DNA by PCR with

primers MucA-1 (5'-CGG ATC CTC CGC GCT CGT GAA GCA ATC G-3') and MucA-

2 (5'-TAC TGC GGC GCA CGG TCT CGA CCC ATA C-3'). The PCR product was

cloned into pCR-TOPO2.1 and transformed into E. coli TOP 1OF'. The obtained plasmid

was digested with HindII-XmnI and cloned into the HindIIl-Smal sites of pUCP19. The

mucA gene in the resulting plasmid, pWWO21, is driven by a lac promoter on the vector.

To generate a mucA gene driven by the algU promoter, the mucA gene on the pCR-

TOPO2.1 plasmid was subcloned into the BamHI and XmnI sites of pEX18Tc, resulting

in mucA-pEX18Tc. To obtain the algU gene promoter, an 800-bp DNA fragment

upstream of the algUgene open reading frame (ORF) was amplified by PCR with

primers AlgT1 (5'-CCT TCG CGG GTC AGG TGG TAT TCG AAG C-3') and AlgT2

(5'-TTG GAT CCG CGC TGT ACC CGT TCA ACC A-3') and cloned into pCR-

TOPO2.1. Then, this fragment was ligated into the EcoRI and BamHI sites upstream of

the mucA gene on the plasmid mucA-pEX18Tc. The obtained plasmid was digested with

EcoRI-XmnI, and the algU promoter and mucA gene ORF fragment were cloned into the









EcoRI-Smal sites of pUCP19. On the resulting plasmid (pWW020), the mucA gene is

driven by the algU promoter, and the transcriptional direction is opposite to that of the

lac promoter on the vector. For algR complementation, the algR gene was amplified

from PAK genomic DNA by PCR with primers algR1 (5'-GGT CTA GAG GCC GAG

CCC CTC GGG AAA G-3') and algR2 (5'-GTG GAT CCT ACT GCT CTC GGC GGC

GCT G-3'). The PCR product was initially cloned into pCR-TOPO2.1. The resulting

plasmid was digested with Clal, blunted ended with Klenow enzyme, and digested with

Xbal. The algR gene-containing fragment was ligated into XbaI-Smal sites of plasmid

pMMB67EH, resulting in pWW022, on which the algR gene is driven by the tac

promoter on the vector. For algU gene over expression, the algU gene ORF was

amplified from PAK genomic DNA by PCR with primers algUl (5'-GGG AAA GCT

TTT GCA AGA AGC CCG AGT C-3') and algU2 (5'-GCT TCG TTA TCC ATC ACA

GCG GAC AGA G-3'). The algUgene was cloned into Hindll-EcoRI sites of pUCP19,

where the expression of the algU gene in the resulting plasmid pWW025 was driven by

lac promoter on the vector.

Western Blotting

P. aeruginosa strains were cultured overnight in LB at 370C. Bacterial cells were

diluted 100-fold with fresh LB or 30-fold with LB containing 5 mM EGTA and cultured

for 3.5 h. Supernatant and pellet were separated by centrifugation and mixed with

sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer.

Equal loading of the protein samples was based on the same number of bacterial cells.

The proteins were transferred onto polyvinylidene difluoride membrane and probed with

rabbit polyclonal antibody against ExoS (self-developed). The signal was detected by









enhanced chemiluminescence following the protocol provided by the manufacturer

(Amersham Biosciences).

RNA Isolation and Microarray Analysis

For RNA isolation, three single colonies of PAK and the isogenic mutant

PAKmucA22 were each inoculated into 3 ml of LB and grown overnight. PAK and

PAKmucA22 were subcultured into LB containing 5 mM EGTA. PAK started with an

OD600 of 0.03, and the mucA22 mutant started with an OD600 of 0.06. After 3 to 4 h of

culture, bacteria were harvested at an OD600 of 1.0 to 1.2. Total RNA was isolated using

an RNeasy mini kit (QIAGEN) according to the manufacturer's instructions. The purity

and quantity were determined by spectrometry and electrophoresis. Fifteen micrograms

of RNA of each sample was used for cDNA synthesis. cDNA fragmentation and biotin

terminal labeling were carried out as instructed (Affymetrix). The experiments were

performed in triplicate. Microarray analysis was performed with the Affymetrix

GeneChip P. aeruginosa genome array. The experimental procedure followed the

manufacturer's instructions. Data were acquired and analyzed with Microarray Suite

version 5.0 (Affymetrix). Significance analysis of microarrays (129) was used to detect

differentially expressed ORFs. Then, a cutoff of 5% false discovery rate (FDR) was

chosen to analyze the data.

Results

Activation of the TTSS Requires a Functional mucA Gene.

To identify P. aeruginosa genes that affect the expression of TTSS, a Tn insertion

mutant bank was constructed in PAK containing an exoT::lacZ (transcriptional fusion)

reporter plasmid (pHW0006) (see Materials and Methods). On plates containing X-Gal

and EGTA, the density of the blue color of each colony indicated the expression level of









the exoT gene in that particular Tn insertion mutant. To identify optimal screening

conditions, combinations of different concentrations of X-Gal and EGTA were tested. In

the presence of 20 [g of X-Gal/ml and 2.5 mM EGTA, wild-type PAK and the type III-

defective PAKexsA mutant harboring pHW0006 showed the greatest visual difference in

colony color (blue) and thus these concentrations were adopted for the screening

conditions. The mutant cells were grown on the screening plates, and we looked for

colonies with lighter blue color. About 40,000 Tn insertion mutants were screened.

Among four colonies with lighter blue color, two of them showed a mucoid phenotype

and the other two had Tn inserted in aprtR gene. The relationship between PrtR and

TTSS will be discussed in Chapter 3. The two mucoid mutants were picked to test their

TTSS activity by B-galactosidase assay. As shown in Fig. 2-1A, the exoTgene promoter

activity was three- to fourfold lower in the mutants than in the parent strain

PAK/pHW0006. To confirm this observation, the exoT: :lacZ reporter plasmid was cured

from the Tn insertion mutants by passage in the absence of antibiotic selection and a

pscN::lacZ reporter plasmid (pHW0024) was reintroduced. The resulting strain was

subjected to a B-galactosidase assay. The assay results shown in Fig. 2-1D indicated that

the expression of the pscN gene was also repressed in these mucoid mutants under both

TTSS-inducing and -noninducing conditions. Similar results were also obtained by

introducing exsA::lacZ (pHW0032) and exoS::lacZ (pHW0005) reporter plasmids and

testing B-galactosidase activities (Fig. 2-1B and C), confirming that the two Tn mutants

were indeed defective in TTSS expression.

The Tn and flanking DNA were rescued from the mutant strains and subjected to

sequencing analysis (see Materials and Methods). Sequencing results showed that the Tn








was inserted into two different positions in the mucA gene in these two mutants,

explaining the mucoid phenotype of the isolates.


500
,450
S400-
350
S 300
o 250
200
2 loo
j150-
Q5 100-
50-
A


B 3000


2500

2000

.. 1500

S 1000



0


tl


PAK exsA A44 A61

nn


34


250
-
200
b
'o
* 150

S100

S50
c9


PAK exsA A44 A61


350


300

= 250
200
S150
S100
50


PAK exsA A44 A61 PAK exsA A44 A61
Figure 2-1. Expression of type III secretion genes in Tn insertional mutants of mucA.
PAK, PAKexsA, and mucA mutants A44 and A61 harboring pHW0006
containing exoT::lacZ (A), pHW0032 containing exsA::lacZ (B), pHW0005
containing exoS::lacZ(C), or pHW0024 containing pscN::lacZ (D) were tested
for f-galactosidase activities. Bacteria were grown in LB (white bars) or LB
containing 5 mM EGTA (black bars) to an OD600 of 1 to 2 before B-
galactosidase assays. Each assay was done in triplicate, and the error bars
indicate standard deviations. *, P < 0.001, compared to the values in PAK.


* iA


ribrc


1


rlA rL









Mutation in the mucA gene is commonly observed among P. aeruginosa isolates

from CF patients, such as mucA22, where a nucleotide G was deleted within five G

residues between positions 429 and 433 of the mucA coding region, causing protein

truncation (13, 111). The identical mucA22 mutant was constructed in the background of

PAK by allelic replacement with a mucA fragment amplified from P. aeruginosa FRD1

(78), which bears the mucA22 mutation (see Materials and Methods). Expression of the

effector genes exoS and exoTin the resulting mutant strain PAKmucA22 was compared to

that in PAK by Western blot analysis of the secreted and cell-associated proteins. A

polyclonal anti-ExoS antibody was used in the western blot experiment; however, it also

cross-recognizes ExoT due to a high sequence homology between the ExoS and ExoT

proteins. As shown in Fig. 2-2A, expression of ExoS and ExoT in the resulting

PAKmucA22 was greatly reduced in comparison to that in wild-type PAK when grown

under type III-inducing conditions. Reporter plasmids pHW0032 (exsA::lacZ) and

pHW0005 (exoS::lacZ) were further introduced into PAKmucA22 and tested for 3-

galactosidase activity. Similar to the original isolates of the mucA Tn insertional mutants,

expression of the exsA and exoS genes in PAKmucA22 was almost nonresponsive to low

Ca2+, compared to a three- to fourfold induction in the wild-type PAK background (Fig.

2-2B and C). Upon complementation of the PAKmucA22 mutant with the mucA gene in

pUCP 19, either driven by the algU promoter (pWW020) or lac promoter (pWW021),

expression of the exsA and exoS genes in the resulting strains was restored to the wild-

type level (Fig. 2-2C). These results clearly demonstrate that expression of the TTSS

genes requires a functional mucA gene.











PAK mucA22
J_ J_


EGTA


- ExoT
ExoS


supernatant pellet


.9






S1
*_









h
5


s'3
>


4000
3500
3000
2500
2000
1500
1000
500
0


180
160
140
120
100
80
60
40
20
0


mucA22 mucA22 mucA22 mucA22
/pWW020 /pWW021 algU::Gm algR::Gm


PAK mucA22 mucA22 mucA22 mucA22 mucA22
/pWW020 /pWW021 algU::Gm algR::Gm

Figure 2-2. Expression and secretion of ExoS protein. (A) Comparison of cellular and
secreted forms of ExoS in strains PAK and PAKmucA22 grown in LB or LB
plus 5 mM EGTA. Supernatants and pellets from equivalent bacterial cell
numbers were loaded onto sodium dodecyl sulfate-polyacrylamide gel
electrophoresis gels and immunoblotted with anti-ExoS antibody. Both ExoS
and ExoT are indicated by the arrow. Anti-ExoS polyclonal antibody also
recognizes ExoT due to high homology between these two proteins. (B)
Expression of exsA::lacZ (pHW0032) in the backgrounds of PAK,
PAKmucA22, with or without the mucA clone driven by an algU promoter
(pWW020) or lac promoter (pWW021), PAKmucA22algU::Gm and
PAKmucA22algR::Gm (C) Expression of exoS::lacZ (pHW0005) in the same
backgrounds as described above. Bacteria were grown to an OD600 of 1 to 2
in LB with (black bars) or without (white bars) EGTA before 3-galactosidase
assays. *, P < 0.05, compared to the values in mucA22.


PAK


mucA22









Microarray Analysis of Gene Expression in the mucA Mutant

To further understand the mechanism of MucA-mediated regulation of TTSS

genes, global gene expression profiles were compared between PAKmucA22 and its wild-

type parent strain PAK grown under TTSS-inducing conditions. Previously, a microarray

analysis compared global gene expression patterns between mucoid (mucA mutant) and

wild-type P. aeruginosa under non-TTSS-inducing conditions (32). Under these

conditions, the TTSS activity in both strains was low; thus, no obvious effect of the mucA

gene on the TTSS was observed.

Results of our gene array analysis were consistent with the published data (32, 33);

genes under the control of AlgU are up regulated in the PAKmucA22 mutant background

compared to those in wild-type PAK, including genes for alginate biosynthesis (operon

PA3540-3551) and regulation (Table 2-2). Also up regulated was operon, PA4468-4471,

which includes the sodM gene (PA4468) encoding manganese superoxide dismutase,

whose production is known to be higher in mucoid than that in nonmucoid P. aeruginosa

(54), and thefumC gene (PA4470) encoding a tricarboxylic acid cycle enzyme fumarase

C, which is essential for alginate production (53). Their results validated our gene array

data.

Table 2-2. Expression of AlgU regulon genes in PAKmucA22 (examed in microarray)
Group and ID no. Name Function Fold change
in mucA22 vs
wild type**
Alginate biosynthesis
genes
PA3540 algD Alginate biosynthesis 64.2*
PA3541 alg8 Alginate biosynthesis 29.9*
PA3542 alg44 Alginate biosynthesis 28.9*
PA3543 algK Alginate biosynthesis 81.2*
PA3544 algE Alginate biosynthesis 47.9*
PA3545 algG Alginate biosynthesis 38.0*









Table 2-2. Continued
Group and ID no. Name Function


PA3546
PA3547
PA3548
PA3549
PA3550
PA3551


algX
algL
algI
algJ
algF
algA


Alginate biosynthesis
regulatory genes
PA0762
PA0763
PA0764


PA5261


PA5483


PA5484


Alginate biosynthesis
Alginate biosynthesis
Alginate biosynthesis
Alginate biosynthesis
Alginate biosynthesis
Phosphomannose
isomerase


Sigma factor
Anti-sigma factor
Negative regulator
for alginate
biosynthesis
Alginate
biosynthesis; two-
component system
Alginate
biosynthesis; two-
component system
Two-component
sensor


algU
mucA
mucB


algR


algB


kinB


Fold change
in mucA22 vs
wild type**
86.0*
43.7*
55.2*
27.2*
70.5*
38.7*



2.6*
2.4*
1.3


1.5


2.0*


2.1


Genes known to be up
regulated in mucA
mutants
PA0059 osmC Osmotically 3.8*
inducible protein
PA0376 rpoH Sigma factor 1.3
PA4876 osmE Osmotically 3.0*
inducible lipoprotein
PA5489 dsbA Thiol:disulfide 1.3
interchange protein
*, FDR<5%. **, Expression data is presented as fold change in mucA22 relative to wild-
type PAK.

Meanwhile, the expression levels of exoS, exoT, exoY, and other T3SS-related

genes were clearly down regulated in the mucA mutant background compared to those in

wild-type PAK under TTSS-inducing conditions (Table 2-3), which confirmed our 3-

galactosidase assay and the Western blotting results. However, no significant changes in









the expression of the exsA gene and a few other TTSS genes were observed. A previous

gene array study also showed that expression of the exsA gene and the exsD-pscL operon

is relatively nonresponsive to Ca2+ depletion (140), yet a clear difference in the 3-

galactosidase activities could be observed when PAK harboring exsA::lacZ (pHW0032)

was grown in LB with or without EGTA. Similarly, we have seen differences in the 3-

galactosidase activities between PAK(pHW0032) and PAKmucA22(pHW0032) under

type Ill-inducing conditions without observing such differences in gene array data,

suggesting possible involvement of posttranscriptional control of the exsA gene.

Table 2-3. Expression of TTSS-related genes in PAKmucA22 (examed in microarray)
ID no. Gene Function Fold change in mucA22 vs
wild type**
PA0044 exoT Exoenzyme T -2.0*
PA2191 exoY Adenylate cyclase -1.3
PA3841 exoS Exoenzyme S -2.1*
PA1707 pcrH Regulatory protein -1.4
PA1708 popB Translocator protein -1.6
PA1709 popD Translocator outer membrane protein -1.5
PA1718 pscE Type III export protein -1.4
PA1719 pscF Type III export protein -1.5
*, FDR<5%. **, Expression data is presented as fold change in mucA22 relative to wild-
type PAK.
From the microarray analysis, genes that are differentially expressed more than

threefold between PAKmucA22 and PAK are listed in Tables 2-4 and 2-5. A number of

genes known to be inducible under iron deprivation was also elevated in the mucA22

mutant, including the sigma factor PvdS and genes regulated by PvdS for pyoverdine

synthesis (53), the operon PA4468-4471 (53), and the probable two-component

regulatory genes PA1300 and PA1301, encoding the extracytoplasmic function sigma-70

factor and a transmembrane sensor, respectively (97). Compared to the global gene

expression profile of PAK grown under TTSS inducing or noninducing conditions, none









of the above genes seem to be affected by Ca2+ depletion (140). The mechanism by

which these genes are activated is not clear.

Table 2-4. Genes up regulated in PAKmucA22* (examed in microarray)
ID no." Gene Function Fold change TSB" LBb
in mucA22 vs (fold) (fold)
wild type**
PA0059 osmC Adaptation, protection 3.75 1.23 -1.29
PA2386 pvdA Adaptation, protection 3.89 -1.50 1.07
#PA2397 vvdE Adaptation. protection. 3.92 -3.00 -1.99


membrane proteins, transport
of small molecules
Adaptation, protection
Adaptation, protection
Antibiotic resistance and
susceptibility, membrane
proteins, transport of small


molecules
PA2019 Antibiotic resistance and
susceptibility, transport of
small molecules
PA1985 pqqA Biosynthesis of cofactors,
prosthetic groups, and
carriers
PA1988 pqqD Biosynthesis of cofactors,
prosthetic groups, and
carriers
PA1989 pqqE Biosynthesis of cofactors,
prosthetic groups, and
carriers
#PA2414 Carbon compound
catabolism
PA3158 wbpB Cell wall, LPS, and capsule;
putative enzymes
PA0102 Central intermediary
metabolism
PA2393 Central intermediary
metabolism
PA2717 cpo Central intermediary
metabolism
PA4470 fumCl Energy metabolism
PA5491 Energy metabolism
#PA0320 Hypothetical
PA0586 Hypothetical
PA0587 Hypothetical


3.06
5.60
3.88


1.00
1.30
1.50


-5.74
1.02
1.65


-1.50 -1.36


-1.10 -1.24


-1.50 -1.28


1.44 -1.34


-3.00 -1.29

-1.20 -1.08

-2.40 -1.15

-1.70 -4.76

1.21 -1.72


4.16


2.99


3.18


3.00


5.17

5.76

3.38

3.27

4.75

5.81
2.97
3.86
5.10
4.57


1.05
-1.30
-7.80
1.61
1.11


-1.62
1.08
-1.43
1.96
1.64


PA2401
PA4468
PA2018


sodM











ID no.a Gene Function Fold change TSBb LBb
in mucA22 vs (fold) (fold)
wild type**


PA0588
PA0613
#PA0737
PA0807
PA0990
PA1245

PA1323
#PA1471
#PA1784
PA1852
PA2159
PA2161
#PA2167
PA2168
#PA2172
PA2176
PA2403

PA2404

#PA2405
PA2406
PA2412
PA2485
PA2486
PA2562


PA3274 Hypothetical
PA4154 Hypothetical
#PA4469 Hypothetical
PA4471 Hypothetical
PA5182 Hypothetical; membrane
proteins
PA5183 Hypothetical; membrane
proteins
PA5212 Hypothetical
PA2409 Membrane proteins, transport
of small molecules
PA4876 osmE Membrane proteins,
adaptation, protection
PA2407 Motility and attachment


4.57
3.60
10.80
3.97
3.45
5.12


1.12
1.14
1.70
1.21
2.31
-1.10

1.94
1.46
1.33
1.90
1.44
1.50
1.16
-1.20
-1.90
1.79
-1.30


Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical; membrane
proteins
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical; membrane
proteins
Hypothetical; membrane
proteins
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical
Hypothetical


1.64
-1.55
-1.00
-1.52
-1.48
-1.20

2.25
1.07
-1.31
-1.03
-2.46
-4.92
-1.06
-2.80
-1.99
2.10
-1.52


1.27 -1.69


4.21
12.4
6.71
3.34
3.56
2.95
9.54
3.20
3.86
7.30
4.96

5.83

10.00
5.79
4.56
5.16
6.30
3.30

5.30
3.63
8.78
3.00
4.81

3.88

3.24
4.21

3.00

4.73


-5.91
-1.22
-2.72
5.51
1.41
2.38

-2.16
1.08
-1.64
-3.49
2.11


1.20 2.02

1.32 1.83
-1.20 -1.46

1.36 1.27

-1.20 -1.61


1.10
-1.10
-1.30
-1.20
1.17
1.27

1.61
1.49
-1.30
-1.00
1.29


Table 2-4.


Continued











ID no.a Gene Function Fold change TSBb LBb
in mucA22 vs (fold) (fold)
wild type**


Table 2-5. Genes down regulated in PAKmucA22* (examed in microarray)
ID no." Gene Function Fold change TSBb LBb
in mucA22 vs (fold) (fold)
wild type**
PA3450 Adaptation, protection -3.5 1.84 1.17
PA2138 DNA reDlication -3.2 -2.50 -3.19


PA0282 cysT

PA1601
PA3444


1 ,
recombination, modification,
and repair
Energy metabolism
Hypothetical
Hypothetical
Hypothetical
Membrane proteins,
transport of small molecules
Membrane proteins,
transport of small molecules
Putative enzymes
Putative enzymes


-1.70
2.66
1.36
1.91
1.18


-1.7
1.59
1.57
1.22
1.13


-1.10 -1.07

1.35 -1.44
1.11 -1.51


PA0523
#PA3445
#PA3446
PA3931
PA0281


norC



cysW


PA2385 Putative enzymes 3.19 1.05 -2.36
PA2394 Putative enzymes 3.56 1.00 -1.75
PA2402 Putative enzymes 3.18 -1.70 -2.00
PA2413 Putative enzymes 5.97 1.46 -2.32
PA4785 Putative enzymes 4.51 1.70 -1.98
PA0724 Related to phage, transposon, 3.48 1.83 -2.39
or plasmid
PA1300 Transcriptional regulators 3.66 -1.70 -1.13
PA2426 pvdS Transcriptional regulators 4.39 -1.40 -1.38
PA2408 Transport of small molecules 4.09 2.08 -3.14
PA3049 rmf Translation, posttranslational 6.81 2.03 1.38
modification, degradation
PA3188 Transport of small molecules 3.08 4.04 15.76
PA5470 Translation, posttranslational 3.31 -1.50 1.15
modification, degradation
#PA2398 fpvA Transport of small molecules 6.65 -2.10 -1.51
*, genes with FDR<5% and changes greater than threefold. **, Expression data is
presented as fold change in mucA22 relative to wild-type PAK. a #, up regulated in mucA
mutant compared to PAK, but down regulated in PAK under type III-inducing conditions
versus noninducing conditions, and vice versa. Not included are those known to be
affected by the growth medium, such as those varied in TSB versus LB (140). b Change
in gene expression in PAK grown under TTSS inducing conditions versus PAK grown
under TTSS noninducing conditions (140). Bacteria were grown in TSB or LB.


Table 2-4.


Continued










Table 2-5. Continued
ID no.a Gene Function Fold change TSBb LBb
in mucA22 vs (fold) (fold)
wild type**
PA1246 aprD Secreted factors (toxins, -3.4 2.05 -2.64
enzymes, alginate); protein
secretion-export apparatus
PA1312 Transcriptional regulators -3.1 -1.10 -1.55
PA3927 Transcriptional regulators -5.1 -1.70 -1.67
PA0198 exbB] Transport of small molecules -5.5 2.71 -3.68
PA0280 cysA Transport of small molecules -6.0 -1.00 -1.18
PA2204 Transport of small molecules -4.7 1.16 -1.16
*, genes with FDR<5% and changes greater than threefold. **, Expression data is
presented as fold change in mucA22 relative to wild-type PAK. a #, up regulated in mucA
mutant compared to PAK but down regulated in PAK under type III-inducing conditions
versus noninducing conditions and vice versa. Not included are those known to be
affected by the growth medium, such as those varied in TSB versus LB (140). b Change
in gene expression in PAK grown under TTSS inducing conditions versus PAK grown
under TTSS noninducing conditions (140). Bacteria were grown in TSB or LB.

TTSS Repression in the mucA Mutant is AlgU Dependent.

MucA is an anti-sigma factor which represses the activity of AlgU (022). In the

mucA mutant, AlgU is derepressed and activates the expression of genes for alginate

synthesis, resulting in a mucoid phenotype. AlgU can also activate the expression of

itself and downstream genes (mucA-B-C-D) in the same operon. To determine the role of

AlgU in the repression of TTSS in the mucA mutant, the algU gene was knocked out in

the background of PAKmucA22, resulting in a PAKmucA22algU::Gm double mutant.

Under TTSS inducing conditions, expression of the exsA and exoS genes in this double

mutant was similar to that in the wild-type (Fig. 2-2B and C), indicating that AlgU is

required for the TTSS repression in the mucA mutant. An algU::Gm mutant was further

generated in the background of PAK, and TTSS activity in the resulting mutant was

compared with that in PAK. As shown in Fig. 2-3, expression of the exsA and exoS

genes was the same in the PAKalgU::Gm mutant and wild-type PAK under both TTSS










inducing and noninducing conditions, suggesting that the basal level of AlgU in wild-

type P. aeruginosa does not play a significant role in the regulation of TTSS genes.


'3500

3000

2500

S2000

1500

1000

500
ca.


PAK


mucA22 PAK
algU::Gm


PAK
/pWW025


250

200


150

100 *






PAK mucA22 PAK PAK
algU::Gm /nWW025

Figure 2-3. Expression of exsA::lacZ (A) and exoS::lacZ (B) in strains PAK,
PAKmucA22, PAKalgU::Gm, and PAK harboring algU overexpression
plasmid pWW025. Bacteria were grown in LB (white bars) or LB plus 5 mM
EGTA (black bars) to an OD600 of 1 to 2 before 8-galactosidase assays. *,
P<0.05, compared to the values in PAK.

When the algU gene was overexpressed in wild-type PAK by introducing

pWW025, the TTSS activity was partially repressed under type Ill-inducing conditions









(Fig. 2-3B). Since AlgU mediates the activation of the algU-mucA operon, an extra copy

of algU also increased the expression of its repressor MucA; thus, overexpression of the

algU gene could not repress TTSS expression to the level seen in the mucA mutant.

AlgR has a Negative Regulatory Function on the TTSS

algR is a regulatory gene required for alginate synthesis and is under the control of

AlgU (78, 146). To investigate the role of AlgR in the regulation of TTSS, the algR gene

was knocked out in the background of PAKmucA22. In the PAKmucA22algR::Gm

double mutant, the expression of the exsA and exoS genes was restored to that of the wild

type (Fig. 2-2A and B), suggesting that the repression of TTSS in the mucA mutant is also

AlgR dependent. To test the function of AlgR on TTSS in wild-type P. aeruginosa, an

algR::Gm mutant was generated in the PAK background. The expression of the exoS

gene was consistently higher in the resulting PAKalgR::Gm mutant than in PAK under

both type III inducing and noninducing conditions (Fig. 2-4B). However, the expression

of the exsA gene was similar in the PAKalgR::Gm mutant and wild-type PAK.

Complementation of the algR mutant with an algR-expressing clone (pWW022)

decreased exsA and exoS expression under both type III inducing and noninducing

conditions (Fig. 2-4). However, higher expression of algR induced by increasing the

amount of isopropyl-1-D-thiogalactopyranoside (IPTG) could not further decrease exsA

and exoS expression (Fig. 2-4). These results indicate that AlgR has a negative

regulatory effect on the TTSS, but the up regulation of AlgR alone might not be sufficient

to repress TTSS activity to the level seen in the mucA mutant. It is likely that in the

mucA mutant, algR gene expression is activated by AlgU, which in turn represses TTSS

activity.










4500
4000
3500
= 3000
- 2500
. 2000
S1500
1000
o 500
a o
=-L


PAK mucA22 PAK PAK algR::Gm/pWW022
algR::Gm 0 gg/ml 250tg/ml 500tg/ml IPTG


PAK mucA22 PAK PAK alR::Gm/pWW022
algR::Gm 0 gg/ml 250tg/ml 500tg/ml IPTG
Figure 2-4. Expression of exsA::lacZ (A) and exoS::lacZ (B) in the backgrounds of PAK,
PAKmucA22, PAKalgR::Gm, and PAKalgR::Gm complemented with algR-
expressing plasmid pWW022. For algR gene complementation, various
concentrations of IPTG were added into the culture medium as indicated.
Bacteria were grown in LB (white bars) or LB plus 5 mM EGTA (black bars)
to an OD600 of 1 to 2 before 8-galactosidase assays. *, P < 0.05, compared to
the values in PAK; **, P < 0.01, compared to the values in mucA22.

Discussion and Future Directions

The Expression of exsA in the mucA Mutant

TTSS is an important virulence determinant for P. aeruginosa: it inhibits the host

defense system by inducing apoptosis in macrophages, polymorphonuclear phagocytes,

and epithelial cells. In our screen for mutants with lower TTSS activities, mucA mutants

were found defective in exoT expression under type III-inducing conditions.









Furthermore, the basal promoter activity of the type III master regulatory gene exsA was

decreased two- to threefold in the mucA mutant compared to that in wild-type PAK,

suggesting that the down regulation of TTSS genes occurs through repression of ExsA.

Since ExsA is an autoactivator (60), the repression could be on the transcriptional or

posttranscriptional level. Our microarray results showed that the transcript level of exsA

in the mucA mutant was similar to that in wild-type PAK under type III-inducing

conditions, which suggested that the activity of ExsA might be repressed at the

posttranscriptional level. However, the data from exsA::lacZ reporter plasmid indicates

that the promoter activity of exsA gene is much lower in the mucA mutant (Fig.2-1B).

Real-time PCR may be necessary to precisely determine the mRNA levels of exsA gene.

Further study is required to clarify the mechanism of exsA gene regulation.

The Regulatory Pathway of AlgU Regulon

MucA is a transmembrane protein, with its cytoplasmic domain binding to and

repressing the sigma factor AlgU. Mutation in the mucA gene leads to derepression of

AlgU, which in turn activates genes for alginate synthesis as well as others, such as dsbA,

oprF, osmE, and rpoH (32, 80). In the mucA mutant, not only the sigma factor AlgU but

also AlgQ, an anti-o70 factor, are activated (31), thus posing the possibility that sigma

factor competition by AlgU and AlgQ effectively decreases the availability of C70-

containing RNA polymerase for the expression of TTSS related genes (62). However,

the observation that AlgR, an AlgU-dependent transcriptional activator, is required for

the TTSS suppression makes it unlikely that sigma factor competition leads to the type III

gene suppression; instead, an AlgR-dependent repressor is likely involved. AlgR is a

global regulator, affecting expression of multiple genes. Proteomics analysis of an

algR::Gm mutant showed that more than 17 proteins were up regulated and 30 proteins









were down regulated (77). In the present study, AlgR was also found to mediate the

repression of type III secretion genes. In the PAKalgR::Gm mutant background,

expression of the exoS gene was higher than in wild-type PAK and, when complemented

by an algR gene clone, expression of exsA and exoS genes decreased to about 50% of that

seen in wild-type PAK (Fig. 2-4). The inability to suppress TTSS genes to the level seen

in the mucA mutant by pWW022 was possibly due to a lower level of expression of the

algR gene from pWW022 than that in the PAKmucA background, in which algR is

activated through the MucA-AlgU pathway. pMMIB67HE is a low-copy-number plasmid

(38), and the tac promoter is not as strong a promoter in P. aeruginosa as it is in E. coli.

AlgR is a DNA binding protein which binds to the promoter regions of algD (93) and

hcnA (hydrogen cyanide synthesis gene) (15). It is possible that AlgR represses exsA

expression by directly binding to the promoter region of the exsCEBA operon. The

protein-DNA binding can be tested by gel-shift assay and the algD promoter can be used

as a positive control. Alternatively, other regulatory genes might be involved in the

repression of TTSS. Further study is needed to understand this observation.

We propose a model for TTSS repression in the mucA mutant (Fig. 2-5). With the

activation of AlgU, the regulatory genes algP, algQ, algB, and algR are activated, which

up regulates the expression of the algD operon. AlgR is required for TTSS repression in

the mucA mutant, but whether the repression function is directly on ExsA or not is

unclear. The involvement of other regulatory genes (algP, algQ, and algB) in TTSS

regulation awaits further study.

The TTSS Activity in P. aeruginosa CF Isolates

During chronic infection of CF patient airways, P. aeruginosa overproduces

alginate and forms a biofilm (58). Alginate production is known to be activated by high









osmolarity, nitrogen limitation, and membrane perturbation induced by ethanol (10);

thus, the high salt concentration in the CF patient airway might be a signal for the

overproduction of alginate. The biofilm mode of growth can help the bacterium survive

in hostile environments and also render resistance against macrophages and

polymorphonuclear cells (58).




MucA













algD operon

SExsA'


Alginate S

Figure 2-5. Proposed model of MucA-mediated coordination of alginate production and
TTSS expression. MucA is a transmembrane protein, with its cytoplasmic
portion binding and inhibiting the sigma factor AlgU. Upon sensing of certain
environmental stress signals by the periplasmic MucB, it signals MucA
through the periplasmic domain to release the bound AlgU. Free AlgU is
required for the expression of downstream transcriptional activators AlgP,
AlgQ, AlgB, and AlgR, all of which contribute to the optimal expression of
the algD operon, encoding enzymes for the synthesis of alginate. AlgR, on
the other hand, also activates downstream genes which are responsible for the
suppression of the type III secretion genes.

Our experimental data suggest that bacteria have evolved a mechanism to turn off

TTSS when they need to synthesize alginate to overcome environmental stress. Such









coordinated regulation of two energy-expensive processes is likely to render to the

bacterium a survival advantage under environmental stress conditions. In addition, when

the bacteria are surrounded by alginate, no intimate contact can be established between

the bacteria and host cells. Under this circumstance, the TTSS needle can not reach the

host cell membrane, which renders the TTSS unnecessary. This might be another reason

to turn off TTSS while over producing alginate. Indeed, a majority of P. aeruginosa

isolates from CF patients at a late stage in the disease displays the mucoid phenotype (34,

111) and are defective in type III gene expression (22). In a previous report, introduction

of the wild-type exsA gene into type III secretion-defective clinical isolates restored type

III secretion (22). However, our attempts to restore TTSS gene expression in 10 mucoid

CF isolates by introducing a mucA gene clone failed, although all of the transformants

were reverted back to the nonmucoid phenotype. It is possible that those mucoid clinical

isolates may harbor additional mutations in the TTSS genes.

Genes Differently Expressed in the mucA Mutant and Isogenic Wild-type PAK

Known TTSS regulators include ExsA, Vfr, CyaA/B, ExsD, ExsC and ExsE (27,

60, 89, 106, 130, 140). Recently, DsbA and AceAB were also found to be necessary for

the expression of TTSS. AceA and -B are subunits of pyruvate dehydrogenase,

suggesting that metabolic imbalance influences the expression of TTSS (23, 107). DsbA

is a periplasmic thiol-disulfide oxidoreductase and was shown to affect TTSS expression,

twitching motility, and intracellular survival of P. aeruginosa upon infection of HeLa

cells (48, 80). Interestingly, the dsbA gene is up regulated in the mucA mutant

background, and its expression was shown to be regulated by AlgU (80). However, the

role of DsbA on the TTSS is believed to be through its general effect on protein disulfide









bond formation in the periplasm, and up regulation of this gene may not be related to the

MucA-AlgU-AglR-mediated suppression of the TTSS.

From the microarray analysis of the mucA mutant and wild-type strain under TTSS

inducing conditions, alginate synthesis genes and genes known to be under the control of

AlgU were up regulated, while TTSS genes were down regulated in the mucA mutant

(Tables 2-2 and -3). In addition, pyoverdine synthesis genes as well as an operon,

PA4468-4471, which might be under the control of Fur (54), were up regulated in the

mucA mutant under TTSS-inducing conditions (Table 2-4). These findings are consistent

with published results, in which mucoid P. aeruginosa strains produced higher levels of

pyoverdine, pyochelin, manganese superoxide dismutase (PA4468), and fumarase

(PA4470) than wild-type strains (52) (53). However, pyochelin synthesis genes were not

seen up regulated in our microarray data. The mechanism by which these genes are up

regulated in the mucA mutant background is not known.

The mucA gene mutation-mediated suppression of the TTSS genes requires AlgR,

which is a transcriptional regulator; thus, it is likely that AlgR may repress TTSS genes

or an AlgR-regulated repressor mediates the suppression of TTSS genes. To identify

such candidate genes from the gene array data, I initially identified genes that were

differentially expressed in the mucA mutant compared to wild-type PAK under type III

inducing conditions. The selected genes include those that were up regulated in the mucA

mutant compared to PAK under type III inducing conditions but were down regulated in

PAK under type III inducing conditions versus noninducing conditions, and vice versa. I

further eliminated those known to be affected by the growth medium, such as those with

varied responses in tryptic soy broth (TSB) versus LB (140). Based on the above criteria,









13 genes were identified (Tables 2-4 and -5). For example, expression of the PA2172

gene in mucA22 was up regulated about fourfold compared to that in wild-type PAK

under TTSS inducing conditions. From published data, the expression of this gene was

down regulated twofold in wild-type PAK grown under type III inducing conditions

compared to that under noninducing conditions (140). Therefore, mutation in the mucA

gene reversed the expression of PA2172 in response to the type III-inducing signal.

Among the 13 genes, pvdE andfpvA are involved in pyoverdine synthesis and

absorption, respectively; PA2414 is involved in carbon compound catabolism. The

remaining 10 genes are all hypothetical genes. The expression ofPA0737, PA2167,

PA2176, and PA4785 seems to be ExsA dependent, since in the exsA mutant the

expression of these genes was lower than in wild-type PAK under type III inducing

conditions and overexpression of exsA could activate expression of these genes under

non-type III-inducing conditions (140). It is reasonable to hypothesize that one or more

of such differentially expressed genes mediate the repression of the TTSS in the mucA

mutant. It will be interesting to mutate each of these candidate genes in the background

of PAKmucA22 and test the TTSS activities.

Another approach to identify the TTSS repressor is to screen a random Tn library

generated in the background of PAKmucA22 for those mutants with restored wild-type

TTSS activity. In those mutants, the TTSS repressor should be knocked out by the

insertion of Tn. There are two potential pitfalls in this Tn mutagenesis strategy. One is

that the mucA mutant over produces alginate which might obstruct the intimate contact

between the E. coli donor strain and the P. aeruginosa recipient strain. To solve this

problem, I can knock out the alginate synthesis gene, algD, which would render the mucA









mutant non-mucoid. The other problem is that, when cultured statically, mucA mutants

tend to become non-mucoid, due to spontaneous mutations in the algU gene (143).

During the conjugation for Tn mutagenesis, algU mutants may accumulate in the

population. These mucAalgU double mutants display wild-type TTSS activity, which

may lead to wrong interpretation of Tn mutated genes. It was reported that cultures

containing the alternative electron acceptor nitrate may decrease the mutation rate of the

algU gene. So during the conjugation, nitrate can be added into the nutrient agar.

In conclusion, in mucA mutants, the TTSS is repressed and the repression is AlgU

and AlgR dependent. Most P. aeruginosa clinical isolates from CF patients display

mucoid phenotype and are defective in the TTSS. This study provides possible

explanation on the relationship between these two phenotypes and indicates that during

chronic infection, P. aeruginosa might over produce alginate, which might function as a

protection mechanism, and down regulate the TTSS, a virulence factor.














CHAPTER 3
PtrB OF Pseudomonas aeruginosa SUPPRESSES THE TYPE III SECRETION
SYSTEM UNDER THE STRESS OF DNA DAMAGE

Introduction

As described in Chapter 2, two mutants with Tn inserted into theprtR gene were

found to be defective in the TTSS activity. PrtR is a XCI homologue which binds to the

promoter region of the prtN gene and inhibits its expression. PrtN is an activator of

genes required for the production of a kind of bacteriocins, called pyocins. Three types

of pyocins, R-, F- and S-type, have been identified. R- and F-type pyocins resemble

phage tails. After they bind to their receptors, lipopolysaccharides (LPS), R-type pyocins

cause a depolarization of the cytoplasmic membrane, which leads to cell death. S-type

pyocins cause cell death by DNA breakdown due to their endonuclease activity (90). The

uptake of most S-type pyocins occurs through ferripyoverdine receptors so that their

killing activity is greatly increased when bacteria are grown under iron-limited conditions

(7). The production of pyocins is induced by DNA-damaging agents, such as UV light

and mitomycin C, when the bacterial SOS response is activated. Under these conditions,

the RecA protein is activated and cleaves PrtR. As a result, PrtN is up regulated and

actives the expression of pyocin synthesis genes (86, 90).

In this Chapter, I describe a coordinated repression of the TTSS under the stress of

DNA damage. The expression of TTSS genes was found to be repressed in the

background of aprtR mutant. Further analysis eliminated the possible involvement of the

prtNgene in the TTSS repression. A gene designatedptrB has been identified which is









specifically repressed by PrtR and mediates the suppression of the TTSS genes. PtrB has

a prokaryotic DskA/TraR C4-type zinc-finger motif but may not directly interact with the

master regulator, ExsA.

Material and Methords

Bacterial Strains and Growth Conditions

Plasmids and bacterial strains used in this study are listed in Table 3-1. Growth

conditions and antibiotic concentrations are the same as described in Chapter 2.

Table 3-1. Strains and plasmids used in this study
Strain or plasmid Description Source or
reference
E. coli strains


BW20767/pRL27


DH5o/Apir

P. aeruginosa strains
PAK

PAK A51
PAKAprtNprtR::Gm

PAKprtN::Gm

F4
PAKA
prtNprtR: :GmA
PA0612-613
PAKA
prtNprtR: :GmAPA0612
PAKA
prtNprtR :GmAPA0613
PAKAPA0612-613
PAKAPA0612
PAKAPA0613
Plasmids
pCR2.1-TOPO
pHW0005


RP4-2-Tc::Mu-1 kan::Tn7 integrant leu-63::IS 10
recA1 zbf-5 creB510 hsdR 7 endA1 thi uidA (A
Mlul): :pir+/pRL27
080dlacZAM15 A(lacZYA-argF)U169 recAl
hsdR 7 deoR thi-1 supE44 gyrA96 relA1/Apir

Wild-type P. aeruginosa strain

PAKprtR::Tn5 mutant isolate; Neor
PAK with prtN and prtR disrupted by replacement
of Gm cassette; Gmr
PAK with prtN disrupted by insertion of Gm
cassette; Gmr
PAKAprtNprtR: :GmPA0612 :Tn5; Gmr Neor
PAKAprtNprtR::Gm with deletion of PA0612 and
PA0613; Gmr

PAKAprtNprtR::Gm with deletion of PA0612;
Gmr
PAKAprtNprtR::Gm with deletion of PA0613;
Gmr
PAK with deletion of PA0612 and PA0613
PAK with deletion of PA0612
PAK with deletion of PA0613

Cloning vector for the PCR products
exoS promoter of PAK fused to promoterless lacZ
on pDN191acZQd S)r Smr Tcr


(71)


(71)


David
Bradley
This study
This study

This study

This study
This study


This study

This study

This study
This study
This study

Invitrogen
(46)


j









Table 3-2. Continued
Strain or plasmid


pHW0006

pUCP19
pEX18Gm
pEX18Ap
pPS856
pWW031

pWW037

pWW033

pWW035

pWW048-1

pWW048-2

pWW069

pWW070

pWW075
pWW076
pWW071

pWW072

pBT

pTRG

pBT-LGF2

pTRG-Gal 11

pWW077
pWW078
pWW079
pWW080
pHW0315
pWW081


Description


exoT promoter of PAK fused to promoterless lacZ
on pDN191acZO; Spr Smr Tcr
Shuttle vector between E. coli and P. aeruginosa
Gene replacement vector; Gmr, ori7 sacB+
Gene replacement vector; Apr, oriT sacB+
Source of Gmr cassette; Apr Gmr
prtN gene of PAK on pUCP19 driven by lac
promoter; Apr
prtR gene of PAK on pUCP 19 driven by lac
promoter; Apr
prtN disrupted by insertion of Gm cassette on
pEX18Ap; Apr Gmr
prtN and prtR disrupted by replacement of Gm
cassette on pEX18Ap; Apr Gmr
PA0612 promoter of PAK fused to promoterless
lacZ on pDN191acZQ; Spr Smr Tcr
exsC promoter of PAK fused to promoterless lacZ
on pDN191acZQ; Spr Smr Tcr
Deletion of PA0612 and PA0613 on plasmid
pEX18Ap; Apr
Deletion of PA0612 and PA0613 on plasmid
pEX18Gm; Gmr
Deletion of PA0612 on plasmid pEX18Gm; Gmr
Deletion of PA0613 on plasmid pEX18Gm; Gmr
PA0613 open reading frame cloned into pCR2.1-
TOPO; Apr
PA0612 open reading frame cloned into pCR2.1-
TOPO; Apr
Bait vector plasmid encoding full length bacterial
phage AcI protein; Chlr
Target vector plasmid encoding RNAP-alpha
subunit protein; Tcr
Interaction control plasmid containing dimerization
domain of Gal4 on bait vector; Chlr
Interaction control plasmid encoding mutant form
of Gal 11 on target vector; Tcr
PA0612 open reading frame cloned into pTRG; Tcr
PA0613 open reading frame cloned into pTRG; Tcr
PA0612 open reading frame cloned into pBT; Chlr
PA0613 open reading frame cloned into pBT; Chlr
exsA open reading frame cloned into pTRG; Tcr
exsA open reading frame cloned into pBT; Chlr


Source or
reference
(46)

(47)
(55)
(55)
(55)
This study

This study

This study

This study

This study

This study

This study

This study


This
This
This


study
study
study


This study

Stratagene

Stratagene

Stratagene

Stratagene

This study
This study
This study
This study
(47)
This study









ForprtR gene complementation, aprtR containing fragment was amplified from

PAK genomic DNA by PCR (Table 3-2). The PCR product was cloned into pCR2.1-

TOPO (Invitrogen), resulting in pTopo-prtR. From pTopo-prtR, the prtR gene was

isolated as a HinclI-HindIIl fragment and cloned into Smal-HindII sites of pUCP19,

resulting in pWW037, where the prtR gene is driven by a lac promoter. ForprtN gene

overexpression, prtN coding sequence was amplified by PCR (Table 3-2), initially cloned

into pCR2.1-TOPO, and subcloned into Hindlll-Xbal sites of pUCP19, where the

expression of the prtN gene in the resulting plasmid, pWW031, was driven by the lac

promoter on the vector. The promoter region ofPA0612 was amplified from PAK

chromosomal DNA (Table 3-2), cloned into pCR2.1-TOPO, and subcloned into EcoRI-

BamHI sites of pDN191acZ, resulting in pWW048-1. For the construction of exsC::lacZ

reporter plasmid, a PCR product containing exsCEBA (Table 3-2) was cloned into

pCR2.1-TOPO. The exsC promoter was cut out with EcoRI and HincII, and subcloned

into pDN191acZ.

Chromosomal gene mutations were generated as described (55). A fragment

containing theprtN andprtR genes was amplified by PCR using the primers PrtR1 and

PrtN2. The PCR product was cloned into pCR2.1-TOPO and subcloned into HindlII-

Xbal sites of pEX18Ap, resulting in pEX18Ap-prtNR. For construction of aprtNprtR

double mutant, a SphI fragment containing 3'-terminal sequence ofprtR and 5'-terminal

sequence ofprtN was replaced with a gentamicin resistance cassette, resulting in

pWW035. For the construction ofPA0612-613, PA0612, and PA0613 mutants, a 2.4-kb

fragment was amplified from PAK chromosomal DNA with primers 612-3M1 and 612-

3M2 (Table 3-2), followed by cloning into pCR2.1-TOPO. A SacII fragment containing










both PA0612 and PA0613 was deleted to generate the PA0612-613 mutant. A 76-bp

SacII-PstI fragment within PA0612 was removed to generate the PA0612 mutant, while a

116-bp ClaI-SacII fragment was deleted to generate the PA0613 mutant. The resulting

plasmids were transformed into wild-type PAK or PAKprtNprtR::Gm and selected for

single and double crossover mutants as described previously (55). Construction of a

transposon (Tn5) insertion mutant library, plasmid rescue, and sequence analysis were

conducted as described in Chapter 2.


Table 3-2. PCR primers used in this study
Gene Amplicon Sequences of primers
size (bp)


ptrR 1,355


prtN


ptrB (promoter)

PA0612-3

PA0612

PA0613

exsCEBA

PA0612-3 (RT-
PCR)

ptrB (Q-PCR)a

rpsL (Q-PCR)


1,376

616

2,417

240

417

2662

649


101

120


PrtRl: 5'-CCAGTTCGTTGGCGTGATCGGCAAGGTC-3'
PrtR2: 5'-CCCTCCTGCGGCTACACGTCGTTGAGGG-3'
PrtNl: 5'-CCATGCAGCCATCCATCGCCCCTAGCAC-3'
PrtN2: 5'-CCGTCGCAGCGCATGTCCATCGAATTCA-3'
laclH: 5'-AAGCTTTCGGGCGGGATCTGGGTGCTCT-3'
lacB2: 5'-TGGGATCCCCGCAGTCCTCGCAGTCTTC-3'
612-3M1: 5'-AAGCTTATCTGGCGGCTGCGCATGTCCT-3'
612-3M2: 5'-CAGCATCACCGCCACGCCGCAGACAATC-3'
612BT1: 5'-GCGGCCGCCACGCCAGGGAGGCTTTCCA-3'
612BT2: 5'-CTCGAGGTCGGTTCAACGGCGCTCGTGG-3'
613BT1: 5'-GCGGCCGCGAAAGGAGACACGACCGTGAT-3'
613BT2: 5'-CTCGAGGGGGGACACGGTATCCGGTCCAG-3'
exsAl: 5' -TGCAGCTCATCCAGCAGTACACCCAGAGCCATAAC-3'
exsA3: 5'-ACAAACTGCTCGATGCGTAACCCGGCACC-3'
612GS1: 5'-GGATCCCCATGGCTGACCTTGCCGATCAC-3'

613BT2: 5'-CTCGAGGGGGGACACGGTATCCGGTCCAG-3'
Forward: 5'-GATCACGCCAACGAACTGGTC-3'
Reverse: 5'-CCGCAGTCCTCGCAGTCTTCC-3'
Forward: 5'-CAAGCGCATGGTCGACAAGAG-3'
Reverse: 5'-ACCTTACGCAGTGCCGAGTTC-3'


RT-PCR and Quantitative Real-time PCR

Overnight cultures of bacterial cells were diluted 100-fold into fresh medium and

grown to an optical density at 600 nm (OD600) of 1.0. Total RNA was isolated with an

RNeasy Mini kit (QIAGEN). DNA was eliminated by column digestion as described by









the manufacturer (QIAGEN). cDNA was synthesized with an iScript cDNA synthesis kit

(Bio-Rad). Taq DNA polymerase from Eppendorf was used in PCRs. The cDNAs

synthesized by reverse transcription-PCR (RT-PCR) were used as templates in

quantitative real-time PCR. The cDNA was mixed with 5pmol of forward and reverse

primers (Table 3-2) and iQ SYBR Green Supermix (Bio-Rad). Quantitative real-time

PCR was conducted using the ABI Prism 7000 sequence detection system (Applied

Biosystems). The results were analyzed with ABI Prism 7000 SDS software. Transcript

for the 30S ribosomal protein (rpsL) was used as an internal standard to compensate for

differences in the amount of cDNA. The mRNA levels ofptrB in test strains were

expressed relative to that of PAK, which was set at 1.00.

Cytotoxicity Assay

HeLa cells (5 x 104) were seeded into each well of a 24-well plate. The cells were

cultured in Dulbecco's modified Eagle's medium with 5% fetal calf serum at 370C with

5% CO2 for 24 h. Overnight bacterial cultures were washed with LB and subcultured to

log phase before infection. Bacteria were washed once with phosphate-buffered saline

and resuspended in tissue culture medium. HeLa cells were infected with the bacteria at

a multiplicity of infection (MOI) of 20. A cell lifting assay was performed after 4 h of

infection. Culture medium in each well was aspirated. Cells were washed twice with

phosphate-buffered saline (PBS) and stained with 0.05% crystal violet for 5 min. The

stain solution was discarded, and the plates were washed twice with water. A 250-1tl

volume of 95% ethanol was then added into each well and incubated at room temperature

for 30 min with gentle shaking. The ethanol solution with dissolved crystal violet dye

was used to measure absorbance at a wavelength of 590 nm.









Application of BacterioMatch Two-hybrid System

PA0612 and PA0613 open reading frames were amplified from PAK chromosomal

DNA with primers 612BT1 plus 612BT2 and 613BT1 plus 613BT2, respectively (Table

3-2). The PCR products were cloned into pCR2.1-TOPO, and each was subcloned into

Notl-Xhol sites of pBT and pTRG, resulting in pWW079 (PA0612 in pBT), pWW077

(PA0612 in pTRG), pWW080 (PA0613 in pBT), and pWW078 (PA0613 in pTRG). The

exsA open reading frame was isolated from pHW0315 (exsA in pTRG) as a Notl-Spel

fragment. The Spel site was blunt ended and ligated into Notl-Smal sites of pBT,

resulting in pWW081 (exsA in pBT). Desired pairs of plasmids were cotransformed into

a reporter strain by electroporation, and the protein-protein interaction assays were

performed following the protocol supplied by the manufacturer (Stratagene). The

interaction between two proteins is indicated by the expression level of a lacZ reporter

gene. By testing the P-galactosidase activity of the reporter strains containing cloned

genes on pBT and pTRG, the interaction between the two proteins can be tested.

Other Methods

Western blotting, 1-Galactosidase activity assays and statistical assays were done

as described in Chapter 2. For twitching motility assays, bacteria were stabbed into a

thin-layer LB plate and incubated overnight at 370C. The LB plate was directly stained

with Coomassie blue at room temperature for 5 min and destined with destaining

solution.

Results

TTSS Is Repressed in aprtR Mutant

As described in Chapter 2, by screening a Tn insertion library consisting of 40,000

independent mutants, two prtR mutants were found to be defective in TTSS activity (Fig.









3-1). Complementation of the original prtR::Tn mutants with aprtR gene partially

restored the TTSS activity (Fig. 3-1A). PrtR is a repressor of pyocin synthesis, which is a

set of bacteriocins synthesized by P. aeruginosa. PrtR binds to the promoter region of

the prtN gene and represses its expression. PrtN is also a DNA binding protein which

recognizes a highly conserved sequence (P box) present upstream of pyocin synthesis

genes and activates their expression (86). Based on this regulatory pathway, either the

up-regulated PrtN is responsible for the TTSS repression or another gene under the

control of PrtR mediates the TTSS repression. To test these possibilities, aprtRprtN

double mutant was generated in the background of wild-type PAK. The resulting mutant,

PAKAprtNprtR::Gm, had the same TTSS defect as theprtR::Tn5 mutant (Fig. 3-1A and

B), and complementation by aprtR gene (pWW037) but not by aprtNgene (pWW031)

restored the TTSS inducibility (Fig. 3-1A). Furthermore, introduction of aprtN-

expressing clone in a high-copy-number plasmid (pWW031) in wild-type PAK had no

effect on the TTSS activity (Fig. 3-1A and B). Thus, all of the above results indicated

that PrtN is not involved in the TTSS repression. Therefore, it is likely that another

gene(s) under the control of PrtR mediates the repression of the TTSS.

Identification of the PrtR-regulated Repressor of the TTSS

Since PrtR functions as a repressor, it might also repress the expression of a

hypothetical TTSS repressor. With the mutation inprtR, this hypothetical repressor

would be up regulated and therefore would repress the expression of the TTSS. Thus,

upon inactivation of this repressor gene in the prtR mutant background, the TTSS activity

should be restored to that of wild-type. To identify this hypothetical repressor, the

AprtNprtR::Gm double mutant containing exoT::lacZ (pHW0006) was subjected to

transposon mutagenesis. A plasmid containing a Tn5 transposon (pRL27) was










transferred from E. coli donor strain BW20767 into P. aeruginosa by conjugation. The

double mutant strain AprtNprtR::Gm was chosen as a recipient, since it has an identical

phenotype of a TTSS defect as the prtR::Tn mutant. More importantly, constitutive

production of pyocin by aprtR mutant seems to have a detrimental effect on the E. coli

donor strain which may lower the conjugation frequency.

A S 300
250
200 -**
150
100 *
$ 50
0
^ PAK prtR::Tn5 prtR::Tn5/ AprtNR::Gm AprtNR::Gm/ AprtNR::Gm/ PAK/
prtR-pUCP19 prtR-pUCP19 prtN-pUCP19 prtN-pUCP19
PAK/
B PAK prtR::Tn JprtNR::Gm prtN-pUCP19
EGTA + + + +

E ExoT
supematant ExoS


pellet --ExoT
*ExoS


Figure 3-1. Expression and secretion of ExoS. (A) Expression of exoS::lacZin the
backgrounds of PAK, prtR::Tn5, prtR::Tn5 containing prtR expression
plasmid pWW037 (prtR-pUCP19), AprtNR::Gm, AprtNR::Gm containing
pWW037 (prtR-pUCP19) orprtN expression plasmid pWW031 (prtN-
pUCP19), and PAK with pWW031 (prtN-pUCP19). Bacteria were grown to
an OD600 of 1 to 2 in LB with (black bars) or without (white bars) EGTA
before 1-galactosidase assays. (B) Cellular and secreted forms of ExoS in
strains PAK, prtR::Tn5, AprtNR::Gm, and PAK containing pWW031 (prtN-
pUCP19). Overnight bacterial cultures were diluted to 1% in LB or 3% in LB
plus 5 mM EGTA and grown at 370C for 3.5 h. Supernatants and pellets from
equivalent bacterial cell numbers were loaded onto SDS-PAGE gels and
immunoblotted with anti-ExoS antibody. Both ExoS and ExoT are indicated
by arrows. Anti-ExoS polyclonal antibody also recognizes ExoT due to high
homology between them. *, P < 0.01, compared to the values in PAK. **, P
< 0.05, compared to the values inprtR::Tn5.









The Tn insertion mutants were spread on LB agar plates containing 20 tg/ml X-

Gal, 2.5 mM EGTA, and proper antibiotics. Blue colonies were looked for in which the

TTSS repressor under the control of PrtR should have been knocked out. About 100,000

Tn insertion mutants were screened. Thirty blue colonies were picked and cultured in

liquid LB for 1-galactosidase assay. Sixteen mutants showed restored TTSS activity

compared to the parent strain. Sequence analysis of the Tn insertion sites showed that 14

mutants had Tn insertions at a single locus (PA0612) at nine different positions. PA0612

encodes a hypothetical protein with a consensus prokaryotic DksA/TraR C4-type zinc-

finger motif. The dksA gene product suppresses the temperature-sensitive growth and

filamentation of a dnaK deletion mutant of E. coli (66), while TraR is involved in

plasmid conjugation (30). These proteins contain a C-terminal region thought to fold into

a four-cysteine zinc finger (30). Its homologues also exist in other gram-negative

bacteria, such as Pseudomonas syringae, Pseudomonas putida, E. coli, Salmonella

enterica serovar Typhimurium, and .\/nge/ll flexneri. However, the functions of these

gene homologues have not been studied. The remaining two mutants contained a Tn

insertion in the genes PA2265 and PA5021, respectively. PA2265 encodes a putative

gluconate dehydrogenase. Promoter analysis

(http://www.fruitfly.org/seq tools/promoter.html) indicates it is in the same operon with

an upstream gene, PA2264, as well as a downstream gene, PA2266. PA2264 is an

unknown gene, while PA2266 encodes a putative cytochrome c precursor. PA5021

encodes a probable sodium:hydrogen antiporter. Promoter analysis indicated that two

downstream genes, PA5022 and PA5023, are in the same operon with PA5021, where










PA5022 and PA5023 encode two unknown proteins. We further pursued the regulation

and function of PA0612 in this study.

PA0612 and PA0613 Form an Operon Which Is Under the Control of PrtR

Promoter analysis predicted that PA0612 and PA0613 may form an operon, while

the pyocin synthesis gene PA0614 has its own promoter. The downstream gene

(PA0613) encodes an unknown protein. On the chromosome ofPAO1, PA0612 is

located next to the prtR gene in the opposite direction. In the promoter region of

PA0612, a 14-base sequence was observed that was also present as a direct repeat in the

predicted prtN promoter region, which might be the PrtR recognition site (Fig. 3-2) (86).

Therefore, it is highly likely that the expression of PA0612 is under the control of PrtR

and mediates the repression of TTSS.

prtN promoter
GGTATTCCCTCCTGCGGCTACACGTCGTTGAGGGAAATATAGCTCAGGTTGTrTTCTTGTTCAATAGCTGAAGTTGTAGAGCGGGCGAGCGCCAGGCGC
Direct repeat Direct repeat


PA0612 PA0613







Direct repeat
TGCTCGGCAATCTACAGACCGATGGATTTTCTGTAAAGAGCCTAGGTGTTGACGATAAATAGCTTTGGTTGTAATTTCTCTTCCGTCAGAAAGCG
prtR promoter 1 PA0612 promoter
prtR promoter 2
Figure 3-2. Genetic organization and putative promoter regions ofprtN, prtR, PA0612-3.
Computer-predicted promoters of prtN, prtR, PA0612-613, and PA0614 are
indicated with arrows. Two promoters are predicted for the prtR gene and are
designated promoters 1 and 2. The potential PrtR binding sequences are
underlined. The arrow of each open reading frame represents the
transcriptional direction.

To confirm the prediction that PA0612 and PA0613 are in the same operon, a pair

of primers annealing to the 5' end of PA0612 (612GS1) and 3' end of PA0613 (613BT2)









was designed for RT-PCR analysis (Table 3-2). A 649-bp PCR product was amplified

using total RNA isolated fromprtR::Tn or AprtNprtR::Gm (Fig. 3-3A), and the size was

the same as that when PAK genomic DNA was used as template (data not shown).

However, when total RNA from PAK or PAK/pWW031 (prtN overexpresser) was used

as template, a faint PCR product could be seen (Fig. 3-3A), indicating low abundance of

this transcript. These results suggested that PA0612 and PA0613 are in the same operon,

which is under the negative control of PrtR. Transcription of PA0612 was investigated

further by real-time PCR. Expression of PA0612 mRNA inprtR::Tn and AprtNR::Gm

was 30- and 38-fold greater than that in PAK, respectively, while overexpression of the

prtN gene had little effect on the transcript level of PA0612 (Fig. 3-3B). To further

confirm this, the promoter of PA0612 was fused with a promoterless lacZ gene on

plasmid pDN191acZ, and the resulting fusion construct (pWW048-1) was introduced into

various strain backgrounds for the 1-galactosidase assay. As shown in Fig. 3-4, the

expression of PA0612 was up regulated in bothprtR::Tn and AprtNprtR::Gm mutant

backgrounds compared to that in PAK or PAK overexpressingprtN (PAK/pWW031),

further proving that the expression of PA0612 and PA0613 is repressed by PrtR. The

above results also reaffirmed our earlier conclusion that prtN has no effect on the

expression of PA0612 and PA0613.

PA0612 Is Required for the Repression of the TTSS In the prtR Mutant

Since PA0612 and PA0613 are in the same operon, insertion of a Tn in PA0612

will have a polar effect on the expression of PA0613. To test which of the two genes is

required for the TTSS repression in the prtR mutant, deletion mutants of PA0612 and

PA0613 and the PA0612 PA0613 double mutant were generated in the background of the

AprtNprtR::Gm mutant. The production and secretion of ExoS, as judged by Western







54


blotting, were restored in the PA0612 and PA0612-013 mutants but not in the PA0613

mutant (Fig. 3-5A). The reporter plasmid of exoT: :lacZ (pHW0006) was further

transformed into these mutants and subjected to a B-galactosidase assay. As the results

show in Fig. 3-5B, transcription of the exoT gene was partially restored in the

backgrounds of AprtNprtR::GmAPA0612-013 and AprtNprtR::GmAPA0612 mutants,

while they remained repressed in the background of the AprtNprtR::GmAPA0613 mutant,

indicating that PA0612 is required for repression of the TTSS in the prtR mutant

background.


A PAK
Marker Genomic PAK prtR::Tn AprtNR::Gm PAK/
DNA pUCP19-prtN


649 bp



B 50
45 -
40 -

30 -
a 25
20
a 15
S10-
z 5
0-

PAK prtR::Tn AprtNR::Gm PAK/
pUCP19-prtN
Figure 3-3. Expression of PA0612 is repressed by prtR. (A) RT-PCR of the PA0612-
0613 operon. Total RNA was isolated from PAK, prtR::Tn5, AprtNR::Gm,
and PAK/pWW031. One microgram of RNA from each sample was used to
synthesize cDNA, and the cDNA was diluted 100-fold for subsequent PCR
amplification. The primers used in the PCR anneal to the 5' end ofPA0612
and the 3' end of PA0613. (B) Quantitation of PA0612 gene expression by
real-time PCR. Data are expressed relative to the quantity of PA0612 mRNA
in PAK. *, P < 0.01, compared to the values in PAK.










5000
4500
4000
3500
S3000 -
2500
2000
1500
g 1000
500
0
PAK prtR::Tn J prtNR::Gm PAK/
pUCP 19-prtN
Figure 3-4. Expression of PA0612::lacZ (pWW048-1) in PAK, prtR::Tn5, AprtNR::Gm,
and PAK/pWW031. Bacteria were grown in LB for 10 h before 8-
galactosidase assays. *, P < 0.01, compared to the values in PAK.

The TTSS of PAK can directly deliver ExoS, ExoT, and ExoY into the host cell,

resulting in cell rounding and lifting (46, 125, 131). HeLa cells were infected with wild-

type PAK and prtR mutants at a MOI of 20. Upon infection by PAK, almost all of the

HeLa cells were rounded after 2.5 h. Under the same conditions, the PAKexsA::Q

mutant, a TTSS-defective mutant, had no effect on HeLa cell rounding; similar to the

PAKexsA::Q mutant, low cytotoxicity was seen with mutant strains prtR::Tn,

AprtNprtR::Gm, and AprtNprtR::GmAPA0613. However, AprtNprtR::GmAPAO612-013

and AprtNprtR::GmAPA0612 caused comparable levels of HeLa cell lifting as that seen

with PAK. Quantitative assay of the cell lifting was further performed by crystal violet

staining of the adhered cells after 4 h of infection. As shown in Fig. 3-5C, mutant strains

AprtNprtR::GmAPAO612-013 and AprtNprtR::GmAPAO612 showed similar cytotoxicity

as wild-type PAK. However, PrtR::Tn, AprtNprtR::Gm, and AprtNprtR::GmAPA0613

showed much-reduced cytotoxicity. The above observations clearly indicated that

PA0612, but not PA0613, is required for the TTSS repression in theprtR mutant

background. We designate this newly identified repressor gene as pseudomonas type III

repressor gene B or, ptrB.











PAK AprtNR::Gm AprtNR::Gm AprtNR::Gm AprtNR::Gm
A612-3 A612 A613
EGTA + -- + +


pellet


**








PAK prtR::Tn5 AprtNR::Gm AprtNR::Gm AprtNR::Gm AprtNR::Gm AprtNR::Gm
612::Tn5 A612-3 A612 A613

*


Cell PAK exsA::fl prtR::Tn5 AprtNR::Gm AprtNR::Gm AprtNR::Gm AprtNR::Gm
A612-3 A612 A613


Figure 3-5. Characterization of ExoS expression and cytotoxicity. (A) Cellular and
secreted forms of the ExoS in strains PAK, AprtNR::Gm,
AprtNR::GmAPAO612-0613, AprtNR: :GmAPA0612, and
AprtNR::GmAPA0613. Overnight bacteria cultures were diluted to 1% in LB
or 3% in LB plus 5 mM EGTA and grown at 370C for 3.5 h. Supernatants
and pellets from equivalent bacterial cell numbers were loaded onto SDS-
PAGE gels and immunoblotted with anti-ExoS antibody. Both ExoS and
ExoT are indicated by arrows. (B) Expression of exoT::lacZ(pHW0005) in
the backgrounds of PAK, AprtNR::Gm, AprtNR::GmAPA0612-0613,
AprtNR::GmAPA0612, and AprtNR::GmAPA0613. Bacteria were grown to
an OD600 of 1 to 2 in LB with (black bars) or without (white bars) EGTA
before 1-galactosidase assays. (C) Cell lifting assay. HeLa cells were
infected with PAK, prtR: :Tn5, AprtNR: :Gm, AprtNR::GmAPA0612-0613,
AprtNR::GmAPA0612, and AprtNR::GmAPA0613 at an MOI of 20. After a
4-hour infection, cell lifting was measured with crystal violet staining (see
Materials and Methods for details). *, P < 0.01, compared to the values in
PAK; **, P < 0.01, compared to the values in AprtNR::Gm.


supernatant


S ExoT
- ExoS


S ExoT
- ExoS


C 4.5
4
3.5
S3
S2.5
2
1.5
1
0.5
0









The Expression of exsA Is Repressed by PtrB inprtR mutants

The master activator of TTSS genes is ExsA. It is the last gene in the exsCEBA

operon (144). The great reduction of ExoS and ExoT inprtR mutants may occur through

the repression of exsA expression. To test the transcription of exsA, an exsC::lacZ

reporter plasmid was introduced into theprtR mutants. As shown in Fig. 3-6, the

expression of the exsCEBA operon was greatly reduced in prtR and AprtNR mutants.

Deletion ofPA0612-3 and ptrB, but not PA0613, partially restored the promoter activity

of exsC. Since ExsA is also the activator of its own operon (60), the repression may be

on the transcriptional, translational or protein level. So I further tested the interaction

between ExsA and PtrB.

2500

= 2000

1500 **

1000- **

500

0
ci PAK prtR::Tn5 AprtNR::Gm AprtNR::Gm AprtNR::Gm AprtNR::Gm
A612-3 AptrB A613
Figure 3-6. Expression of exsA operon inprtR mutants. Bacteria were grown to an OD600
of 1 to 2 in LB with (black bars) or without (white bars) EGTA before B-
galactosidase assays. *, P < 0.01, compared to the values in PAK; **, P <
0.01, compared to the values in AprtNR::Gm; ***, P < 0.001, compared to the
values in AprtNR::GmAptrB.

PtrB Might Not Directly Interact with ExsA

In earlier reports, it has been shown that ExsA activity can be repressed by

interaction with ExsD or PtrA (47, 89). We wanted to test if the TTSS repressor function

of PtrB is achieved through a direct interaction with the master regulator, ExsA. A










bacterial two-hybrid system (Stratagene) was used to test the interaction between the two

components. ptrB and exsA were each cloned into bait (pBT) or prey (pTRG) plasmids,

fused with XCI and RNA polymerase (RNAP) a-subunit at C terminus, respectively.

Interaction between the two tested proteins can stable XCI and RNAP in the promoter

region of a lacZ gene and activates its expression. Thus, the interaction of two proteins

was indicated by the expression of lacZ in the reporter strain. 1-Galactosidase assay

results, however, did not suggest a direct interaction between PtrB and ExsA, although

strong interaction was observed between the positive controls provided (Fig. 3-7).

Therefore, the mechanism of TTSS repression in the prtR mutant might not involve a

direct binding of PtrB to ExsA. Negative results were also obtained in similar tests

between PtrB and PA0613, indicating no direct interaction of the two small proteins

encoded in the same operon.


" 140
= 120
100
80 o
60 -
S40 -

20 FF r






Figure 3-7. Monitoring of protein-protein interactions by the BacterioMatch two-hybrid
system. pBT, bait vector; pTRG, target vector; 2BT, ptrB cloned into bait
vector; 2TRG, ptrB cloned into target vector; 3BT, PA0613 cloned into bait
vector; 3TRG, PA0613 cloned into target vector; exsABT, exsA cloned into
bait vector; exsATRG, exsA cloned into target vector; positive, positive control
provided by the manufacturer. *, P < 0.01, compared to the values in the
positive control.









Mitomycin C-mediated Suppression of the TTSS Genes Requires PtrB

Pyocin production can be triggered by mutagenic agents, such as mitomycin C. In

response to the DNA damage, RecA is activated and cleaves PrtR, similar to LexA

cleavage by RecA in E. coli during the SOS response (90). In the absence of PrtR, the

expression ofprtNis derepressed, resulting in up regulation of the pyocin synthesis

genes. Under this circumstance, theptrB gene should also be up regulated, resulting in

TTSS repression. To test this prediction, wild-type PAK was treated with mitomycin C

under TTSS inducing and noninducing conditions and the expression of ExoS was

monitored by Western blot analysis. In previous reports, 1 tg/ml of mitomycin C was

shown to be able to induce pyocin synthesis (90). After treatment with 1 tg/ml of

mitomycin C for 1.5 h, the OD600 of PAK began to decrease with or without EGTA due

to the toxic effect of the mitomycin C (Fig. 3-8A); therefore, we collected the samples 1.5

h after mitomycin C treatment. Two culture methods were used. One was to grow PAK

with mitomycin C for 30 min and then EGTA was added to induce TTSS for 1 hour. The

other was to add mitomycin C and EGTA at the same time and induce for 1 hour.

Experimental results showed that when wild-type PAK was treated with mitomycin C

and EGTA at the same time, normal TTSS activation was observed. However, when

cells were treated with mitomycin C 30 min before the addition of EGTA, a clear

repression of the TTSS was observed (Fig. 3-8B). To test whether theptrB gene

mediates the repression of the TTSS by mitomycin C, a deletion mutant ofptrB was

further generated in the background of wild-type PAK. Deletion ofptrB in PAK had no

effect on the expression of the TTSS (Fig. 3-8B and C). Interestingly, even with the 30-

min pretreatment of mitomycin C (1 ig/ml), production of ExoS in the PAKAptrB

mutant was activated by EGTA, even higher than that without mitomycin C treatment







60


(Fig. 3-7B). Clearly, mitomycin C-mediated suppression of the TTSS requires theptrB

gene.



A 1 0E+10
A LB
^A LB+EGTA
S,1 0,09 LB+Mitomycin C
SA LB+EGTA+
Mitomycin C

1 OE08-
o 1 2 3 4 5 hr
Time


B
EGTA


PAK
- +


Mitomycin C


ExoS-


C
EGTA

supematant


pellet


A612-3
+ + + +


+ + + -


PAK


A612-3
4-I


- + +


AptrB


AptrB
- + +

+ +


A613


*-ExoT
- ExoS

--ExoT
--ExoS


Figure 3-8. Effect of mitomycin C on bacteria growth and TTSS activity. (A) An
overnight culture of PAK was diluted to an OD600 of 0.8 in LB, LB plus 1
[g/ml mitomycin C, LB plus 5 mM EGTA, or LB plus 1 [g/ml mitomycin C
plus 5 mM EGTA. The OD600 of each sample was measured at 30-min
intervals. The cell densities were calculated based on the OD600. (B)
Overnight cultures of PAK, PA0612-0613, and AptrB were diluted to an
OD600 of 0.5 with LB or LB plus 1 [g/ml mitomycin C. After 30 min, EGTA
was added to the culture medium at a final concentration of 5 mM. One hour
later, each culture was mixed with protein loading buffer. Samples derived
from equivalent bacterial cell numbers were loaded onto SDS-PAGE gels and
immunoblotted with anti-ExoS antibody. *, PAK was grown in LB for 30
min, and then both mitomycin C and EGTA were added at the same time. (C)
Overnight cultures of PAK, PA0612-0613, and AptrB strains were diluted to
1% in LB or 3% in LB plus 5 mM EGTA and grown at 370C for 3.5 h.
Supernatants and pellets from equivalent bacterial cell numbers were loaded
onto SDS-PAGE gels and immunoblotted with anti-ExoS antibody.









Twitching Motility Was Not Affected by the prtR mutation

The TTSS genes have been shown to be affected by Vfr and CyaA/B, homologues

of CRP and cyclic AMP synthase (140). Vfr is well known for its involvement in the

regulation of twitching motility (8), flagellum synthesis (26), type II secretion (140), and

quorum sensing (3). Recently, FimL was found to regulate both the TTSS and twitching

motility through Vfr (137). To test whether mutation ofprtR affects twitching motility,

strains with prtR and ptrB mutations were subjected to a stab assay. Mutation in the prtR

orptrB gene had no effect on twitching motility (Fig. 3-9), indicating that the repression

of the TTSS in theprtR mutant does not go through the Vfr pathway.


Figure 3-9. Twitching motility ofprtR, ptrB and PA0613 mutants. The bacteria of each
strain were stabbed into a thin-layer LB agar. The plate was incubated at
370C over night. The whole plate was directly stained with Coomassie blue at
room temperature for 5 min and destined with destain solution.









Discussion

During early infection of cystic fibrosis patients, P. aeruginosa produces S-type

pyocins (9); however, the exact physiological role played by pyocins is unclear. Pyocins

might ensure the predominance of a given strain in a bacterial niche against other bacteria

of the same species. The pyocin production starts when adverse conditions provoke

DNA damage. Under these conditions, the effect of pyocins is likely to preserve the

initial predominance of pyocinogenic bacteria against pyocin-sensitive cells (90). Upon

activation by DNA-damaging agents, RecA mediates the cleavage of PrtR, derepressing

the expression ofprtN, resulting in active synthesis of pyocins. Thus, the pyocin

synthesis is dependent on the SOS response, resembling those responses of temperate

bacteriophages in E. coli (16, 90). Indeed, DNA-damaging agents, such as UV

irradiation and mitomycin C, induce the synthesis of pyocins in a recA-dependent manner

(90). Apparently, in response to the DNA damage stress signal, P. aeruginosa not only

turns on the SOS response system for DNA repair and pyocin synthesis but also actively

represses the energy expensive type III secretion system, an example of coordinated gene

regulation for survival.

Along the regulatory pathway, mutation of the prtR gene results in the up

regulation ofprtN (86). We found that PrtN is not responsible for the repression of the

TTSS; rather, ptrB next to and under the control ofprtR is required for the TTSS

repression. We also found that the downstream gene PA0613 was in the same operon

with PA0612. Homologues of these genes are also found in Pseudomonas putida

(PP3039 and PP3037) and Pseudomonas syringae (PSPT03417 and PSPT03419), where

they seem to also form operon structures, although with one additional gene between

them (PP3038 or PSPR03418). The promoter ofptrB contains a 14-base sequence that









was also found in the prtN promoter (86), which may be a binding site for PrtR.

Considering that PrtR is the ortholog of XCI, which functions as a homodimer (16), PrtR

may also form a dimer. Whether PrtR recognizes these potential binding sites is not

known. Interestingly, the PtrB protein contains a prokaryotic DksA/TraR C4-type zinc-

finger motif (www.pseudomonas.com). The dksA gene product suppresses the

temperature-sensitive growth and filamentation of a dnaK deletion mutant ofE. coli (66),

while TraR is involved in plasmid conjugation (30). These proteins contain a C-terminal

region thought to fold into a four-cysteine zinc-finger (30). Yersinia sp. also encodes a

small-sized protein, YmoA (8 kDa), which negatively regulates the type III secretion

system (79). YmoA resembles the histone-like protein HU and E. coli integration host

factor; thus, it is likely to repress type III genes through its influence on DNA

conformation. Whether PtrB exerts its repressor function through interaction with

another regulator or through binding to specific DNA sequences present in the TTSS

operons or their upstream regulator genes is not known. It would also be interesting to

investigate on what other genes of the P. aeruginosa genome PtrB effects on.

It is not surprising that P. aeruginosa has multiple regulatory networks, since 8% of

its genome codes for regulatory genes, indicating that P. aeruginosa has dynamic and

complicated regulatory mechanisms responding to various environmental signals (108,

124). Also, due to the requirement of a large number of genes, construction of the type

III secretion apparatus is an energy-expensive process. Thus, P. aeruginosa might have

evolved multiple signaling pathways to fine-tune the regulation of the type III secretion

system in response to the environmental changes. Similarly, Yersinia has been reported

to have several regulators, such as an activator, VirF, and repressor molecules, LcrQ,









YscM1, YscM2, and YmoA, that are involved in the control ofyop gene transcription

(20, 139, 142). Current efforts are focused on the elucidation of the molecular

mechanism by which PtrB mediates suppression of the TTSS. Also, the relevance of the

two additional genes, PA2265 and PA5021, to the regulation of the TTSS needs more

investigation.


DNA damage



RecRecA


Pyocin synthesis


Fige)- (a -ExsA'-1TTSS



Figure 3-10. Proposed model ofPtrB-mediated TTSS repression. In wild-type PAK,
PrtR represses the expression ofprtN andptrB. In response to DNA damage,
RecA is activated and cleaves PrtR, resulting in increased expression ofprtN
and ptrB. PrtN activates the expression of pyocin synthesis genes, while PtrB
represses the type III secretion genes directly or through additional
downstream genes.

Based on our results, we propose a model for the repression of the TTSS induced

by DNA damage (treatment with mitomycin C) (Fig. 3-10). DNA damage induces the

SOS response, in which RecA is activated. RecA cleaves PrtR, resulting in the up

regulation ofprtN andptrB. PrtN activates the expression of pyocin synthesis genes,

while PtrB represses the TTSS genes. How PtrB represses the TTSS is not known. In the

bacteria two-hybrid system, I failed to detect the interaction between PtrB and ExsA.

However, PtrB is a small protein (-6.7 kDa), and when fused with either XCI or RNAP a-

subunit, its interaction with ExsA might be affected due to conformational change or






65


steric hindrance. Further experiments are needed to study the interaction between PtrB

and ExsA.














CHAPTER 4
DISCUSSION AND FUTURE DIRECTIONS

The TTSS and Environmental Stresses

Repression of the TTSS under Environmental Stresses

The TTSS ofP. aeruginosa is under the control of a complicated regulatory

network. ExsA, an AraC-type protein, is the master activator of the TTSS. Two proteins,

ExsD and PtrA, have been found to directly interact with ExsA. ExsD is an anti-

activator, inhibiting the activity of ExsA (89). PtrA is an in vivo inducible protein and

represses the activity of ExsA through direct binding. In vitro, the expression of PtrA is

inducible by high copper stress signal through a CopR/S two-component regulatory

system (47). Over expression of multi-drug efflux systems MexCD-OprJ and MexEF-

OprN leads to repression of the TTSS (75). The expression of multi-drug efflux systems

are usually triggered by antibiotics which is a detrimental stress. We also found that

mutation in the mucA gene not only results in overproduction of alginate but also causes

repression of the TTSS (Chapter 2). MucA-regulated alginate production is induced by

environmental stresses, such as high osmolarity, reactive oxygen intermediates, and

anaerobic environment (45, 84). Metabolic imbalance was also shown to cause

repression of the TTSS, which represents a nutritional stress (23, 107). In Chapter 3 we

reported that mutation in theprtR gene resulted in repression of the TTSS. PrtR is a

repressor whose activity is regulated by DNA damage (90), yet another stress signal.

Mitomycin C, a mutagenic agent, can indeed repress the activity of the TTSS. My

preliminary data showed that heat shock could also cause repression of the TTSS. These









discoveries indicate that the TTSS is effectively turned off under various environmental

stresses, which might be an important survival strategy for this microorganism. Since

mounting an effective resistance against stress requires a full devotion of energy, turning

off other energy-expensive processes, such as the TTSS, will be beneficial to the

bacterium.

Indication for the Control of P. aeruginosa Infection

Mutation in TTSS renders P. aeruginosa avirulence in a burned mouse model (59).

In a mouse model ofP. aeruginosa pneumonia and a rabbit model of septic shock,

antibodies against PcrV ( required for effectors translocation) are able to decrease lung

injury and ensure survival of the infected animals (37, 113, 120). These results indicated

that inactivation of the TTSS is a prospective therapeutic strategy. Since environmental

stresses can lead to the repression of the TTSS, drugs can be designed towards

components in the stress response signaling pathways, such as DNA damage, heat shock,

metabolism imbalance, copper stress, etc. The more we know about the regulatory

pathways, the more candidate targets we will have. This strategy might be extended to

the control of other virulence mechanisms, such as biofilm formation. During the chronic

infection in CF lungs, P. aeruginosa grows under a low oxygen environment in the form

of a biofilm. Quorum sensing mutants (lasR or rhlR) are unable to survive in the

anaerobic condition, due to the metabolic intoxication by nitric oxide (145). Therefore,

drugs targeting the quorum sensing system might facilitate the eradication of P.

aeruginosa biofilm (51). Indeed, some non-native AHLs (autoinducers of the las and rhl

quorum sensing systems) have been found to disrupt P. aeruginosa biofilm formation

(40).









Regulation of the TTSS under Environmental Stresses

Among all the environmental stresses that induce TTSS repression, only one

regulatory pathway (PtrA) is well understood (47). Based on the experimental data for

PtrA and PtrB, it is possible that each environmental stress involves a specific TTSS

repressor, such as PtrA for copper stress and PtrB for DNA damage stress (Chapter 3).

Some of these repressors may even have common regulators. For example, cAMP and

Vfr are required for the TTSS. Any environmental signals affecting cAMP level or Vfr

activity will affect the TTSS. It will be interesting to measure the expression level of Vfr

as well as cAMP level under various environmental stresses.

The ExsA activity is under the direct control of a regulatory cascade, consisting of

ExsE, ExsC and ExsD (Fig. 1-1) (27, 89, 106, 130). Each of the components can also be

the target of regulation under stress conditions. Activation of ExsA depends on the

secretion of ExsE through the TTSS machinery. Any environmental stresses that block

the ExsE secretion will result in inhibition of the ExsA function (106, 130). Furthermore,

expression of exsA may also be affected by stress responses.

Expression of ExsA

exsA is the last gene in the exsCEBA operon as shown in Fig. 4-1, which is

activated by ExsA itself (144). It is not known which sigma factor recognizes this operon

promoter. Interestingly, the predicted exsB open reading frame (ORF) seems not

translated in either P. aeruginosa or E.coli (43). Neither point mutation of the exsB start

cordon nor over expression of exsB had any effect on the TTSS activity (43, 106).

However, deletion of the exsE and exsB region (StuI sites, Fig 4-1) resulted in a drastic

reduction of the TTSS activity. Since ExsE is a TTSS repressor, mutation in exsE should

lead to derepression of the TTSS (106). These results indicate that the exsB region (DNA









or RNA) might affect the transcription or translation of ExsA. It will be interesting to

delete only the exsB region and test the effect on the expression of exsA.

StuI .Stu
I 'I I I I I
1000 2000

exsC exsE exsB exsA
Figure 4-1. Structure of the exsCEBA operon. The ORFs and transcription directions are
indicated as arrows.

Transcriptional control

The exsB DNA fragment might control the transcription of exsA gene through the

formation of a secondary structure. This type of regulation usually happens at the

promoter region, where RNA polymerase or regulators bind to (16). Since exsA does not

have its own promoter immediate upstream of its coding sequence (144), it is unlikely

that exsB DNA has this type of function.

Post-transcriptional control

Microarray analysis and lacZ transcriptional fusion experiments indicate that the

mRNA level of exsCEBA operon does not change much under TTSS inducing vs. non-

inducing conditions (72, 140). A real-time PCR experiment is needed to precisely

determine the mRNA levels of each ORF and the region between exsB and exsA. Despite

the minimal increase at the transcriptional level, the ExsA protein level increased

significantly under TTSS inducing conditions as judged by Western blot analysis (27),

suggesting that the expression of ExsA is under post-transcriptional control. Well known

mechanisms of the post-transcriptional controls include mRNA stability or formation of

secondary structures which affect translation efficiency (16, 74). In prokaryotes,

untranslated mRNA tends to be degraded quickly by endoribonucleases or exonucleases

(70). The translation of an mRNA can be affected by secondary structures formed by









endogenous sequences or with an antisense RNA. A likely hair-pin structure has indeed

been found in the exsB-exsA junction (Fig. 4-2) which may blocks the access of the

ribosome to its binding site for the translation for exsA. Experimental tests, deletion as

well as site-directed mutagenesis, are needed to confirm this possibility.

Start cordon of exsA







S 60
ql ,,--
.* A I **IA



A\




OC





5
Figure 4-2. The secondary structure of exsA mRNA 5' terminus. The sequence was
analyzed by mfold (http://www.bioinfo.rpi.edu/applications/mfold/old/rna/).

The mRNA stability and secondary structure can also be controlled by small RNAs

(sRNAs). sRNAs, with length range from 50 to 200 nucleotides, are used by bacteria to

rapidly tune gene expression in responding to changing environments (83, 123). sRNAs

usually anneal to 5' untranslated region (5' UTR) of target mRNAs. The effects of sRNA

binding include increase or decrease of mRNA stability, exposure or blockage of

ribosome binding site. Most interactions between sRNA and target mRNA require a

small protein called Hfq. Mutation of Hfq in P. aeruginosa resulted in impaired









twitching motility and attenuation of virulence when injected intraperitoneally into mice

(122). It will be interesting to test the TTSS activity in the hfq mutant, which may give

us a clue whether sRNAs are involved in the TTSS regulation.

In summary, the transcriptional and translational control of exsA is not clear at

present time. Understanding the regulatory mechanism of exsA may help us to clarify the

relationship between TTSS and many other genes that affect its activity. Also, it will

help us to develop strategies to control P. aeruginosa infections.

Transposon Mutagenesis

My project started from the construction and screening of Tn insertional mutant

libraries. This strategy is a powerful tool in searching genes related to certain phenotype.

The success of this method relies on the high efficiency of transposition, special

characteristics of the Tn and sensitive screening methods.

Mutagenesis Efficiency

Usually, the Tn is on a suicide plasmid and transferred into the recipient through

conjugation or sometimes by electroporation. In my experiments, the growth phase of

E.coli donor strain was important, with the highest efficiency achieved by using cells

grown to OD600=0.6-1.0. The growth phase of P. aeruginosa recipient strain seems less

important. The optimum donor to recipient ratio ranged between 3:1 and 8:1, with about

5X108 recipient cells in each conjugation mixture.

During the growth of the conjugation mixtures (121), P. aeruginosa seems to kill

E.coli, resulting in low conjugation efficiency. This killing can be repressed by

performing the conjugation on nutrient agar. Probably, P. aeruginosa produces fewer

bactericidal factors when grown on nutrient agar medium compared to the L-agar.









Another factor limiting the conjugation efficiency is the DNA modification and

restriction system of the recipient, which mediates the degradation of foreign DNA.

Growth of the recipient at 420C for at least 2 hours before conjugation can greatly

increase the mutagenesis efficiency, presumably due to the repression of the DNA

modification and restriction system.

In most of my experiments, 1-3x104 Tn insertion mutants can readily be obtained

from each conjugation. P. aeruginosa has about 5600 genes; thus theoretically, 3x104

mutants should provide about 5-fold coverage of these genes (63).

Characteristics of the Tn

Most Tn insertional mutagenesis do not ensure every target gene being hit by the

Tn, although statistically the number of the mutants should saturate the whole genome.

Tns seem preferentially to insert in certain regions while avoiding other regions, so called

hot and cold spots, respectively. The Tn used in my research is a derivative of Tn5 (71).

In my Tn5 mutagenesis experiments, no insertion was found in the TTSS region,

suggesting it is a cold spot for the Tn5. In agreement with my experience, a Tn5

insertion library constructed in strain PAO1 by Jacobs et al. (University of Washington

Genome Center, Seattle) has also concluded that the coding region of the TTSS apparatus

is a clod spot (63). Testing of different transposons might identify ones that can readily

transpose into the TTSS region.

Screen Sensitivity

The success of Tn mutagenesis experiments also depends on the screening strategy.

Two types of screening methods are widely used. One is to individually test for

phenotypes of interests, which provides a high accuracy. However, it takes a lot of

manpower and is cumbersome. The other one is to do large scale screening on the whole









library. By this method, a large number of mutants can be screened quickly, although the

accuracy is compromised. Usually, this method requires a reporter gene, either encoded

on the Tn or harbored by the recipient strain. In my experiments, an exoT::lacZ fusion on

plasmid was used as the reporter. On plates containing X-gal, the density of blue color of

each colony represents the exoTpromoter activity. With this method, 100,000 mutants

can be screened in less than one hour. The shortcoming of this method is that the color

density is judged by eyes; thus many mutants with interesting phenotypes might have

been missed. Indeed, although I successfully identified two genes, mucA andprtR, which

are required for the TTSS activity, no other genes known to regulate the TTSS were

identified. Possibly either I missed those colonies with minor changes in blue color or

the Tn insertion libraries were not saturated. Other Tn with more sensitive screening

methods might be needed to identify additional TTSS related genes.

In summary, I developed a screening system for the identification of the TTSS

related genes. From the Tn insertion libraries constructed in wild type PAK containing

exoT::lacZ reporter plasmid, two genes, mucA and prtR, were found to be related to the

TTSS. I further studied the regulatory relationship between MucA and the TTSS as well

as PrtR and the TTSS. In the mucA mutant, AlgU and AlgR are required for the

repression of the TTSS. In theprtR mutant, a newly identified gene, ptrB is up regulated

and responsible for the repression of the TTSS. Wild type P. aeruginosa strain will turn

into mucoid phenotype in response to some environmental stresses, such as anaerobic

environment, high osmolarity and reactive oxygen intermediates. PrtR is a regulator of

pyocin synthesis, it responses to DNA damage. All my results suggest that TTSS will be






74


repressed under environmental stresses (10), which may provide a potential strategy for

the control of the TTSS activity and improve the treatment of P. aeruginosa infection.
















LIST OF REFERENCES


1. Aendekerk, S., B. Ghysels, P. Cornelis, and C. Baysse. 2002. Characterization
of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that
confers resistance to vanadium. Microbiology 148:2371-81.

2. Ahn, K. S., U. Ha, J. Jia, D. Wu, and S. Jin. 2004. The truA gene of
Pseudomonas aeruginosa is required for the expression of type III secretary
genes. Microbiology 150:539-47.

3. Albus, A. M., E. C. Pesci, L. J. Runyen-Janecky, S. E. West, and B. H.
Iglewski. 1997. Vfr controls quorum sensing in Pseudomonas aeruginosa. J.
Bacteriol. 179:3928-35.

4. Allmond, L. R., T. J. Karaca, V. N. Nguyen, T. Nguyen, J. P. Wiener-
Kronish, and T. Sawa. 2003. Protein binding between PcrG-PcrV and PcrH-
PopB/PopD encoded by the pcrGVH-popBD operon of the Pseudomonas
aeruginosa type III secretion system. Infect. Immun. 71:2230-3.

5. Arora, S. K., B. W. Ritchings, E. C. Almira, S. Lory, and R. Ramphal. 1998.
The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin
adhesion. Infect. Immun. 66:1000-7.

6. Barbieri, J. T., and J. Sun. 2004. Pseudomonas aeruginosa ExoS and ExoT.
Rev. Physiol. Biochem. Pharmacol. 152:79-92.

7. Baysse, C., J. M. Meyer, P. Plesiat, V. Geoffroy, Y. Michel-Briand, and P.
Cornelis. 1999. Uptake of pyocin S3 occurs through the outer membrane
ferripyoverdine type II receptor of Pseudomonas aeruginosa. J. Bacteriol.
181:3849-51.

8. Beatson, S. A., C. B. Whitchurch, J. L. Sargent, R. C. Levesque, and J. S.
Mattick. 2002. Differential regulation of twitching motility and elastase
production by Vfr in Pseudomonas aeruginosa. J. Bacteriol. 184:3605-13.

9. Beckmann, C., M. Brittnacher, R. Ernst, N. Mayer-Hamblett, S. I. Miller,
and J. L. Burns. 2005. Use of phage display to identify potential Pseudomonas
aeruginosa gene products relevant to early cystic fibrosis airway infections.
Infect. Immun. 73:444-52.









10. Berry, A., J. D. DeVault, and A. M. Chakrabarty. 1989. High osmolarity is a
signal for enhanced algD transcription in mucoid and nonmucoid Pseudomonas
aeruginosa strains. J. Bacteriol. 171:2312-7.

11. Bjarnsholt, T., P. O. Jensen, T. B. Rasmussen, L. Christophersen, H. Calum,
M. Hentzer, H. P. Hougen, J. Rygaard, C. Moser, L. Eberl, N. Hoiby, and M.
Givskov. 2005. Garlic blocks quorum sensing and promotes rapid clearing of
pulmonary Pseudomonas aeruginosa infections. Microbiology 151:3873-80.

12. Bleves, S., C. Soscia, P. Nogueira-Orlandi, A. Lazdunski, and A. Filloux.
2005. Quorum sensing negatively controls type III secretion regulon expression in
Pseudomonas aeruginosa PAO 1. J. Bacteriol. 187:3898-902.

13. Boucher, J. C., H. Yu, M. H. Mudd, and V. Deretic. 1997. Mucoid
Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in
clinical isolates and analysis of clearance in a mouse model of respiratory
infection. Infect. Immun. 65:3838-46.

14. Bryan, L. E., K. O'Hara, and S. Wong. 1984. Lipopolysaccharide changes in
impermeability-type aminoglycoside resistance in Pseudomonas aeruginosa.
Antimicrob. Agents Chemother. 26:250-5.

15. Carterson, A. J., L. A. Morici, D. W. Jackson, A. Frisk, S. E. Lizewski, R.
Jupiter, K. Simpson, D. A. Kunz, S. H. Davis, J. R. Schurr, D. J. Hassett, and
M. J. Schurr. 2004. The transcriptional regulator AlgR controls cyanide
production in Pseudomonas aeruginosa. J. Bacteriol. 186:6837-44.

16. Champness, L. S. A. W. 1997. Molecular genetics of bacteria. ASM Press,
Washington, D.C.

17. Chilcott, G. S., and K. T. Hughes. 2000. Coupling of flagellar gene expression
to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia
coli. Microbiol Mol Biol Rev 64:694-708.

18. Chuanchuen, R., C. T. Narasaki, and H. P. Schweizer. 2002. The MexJK
efflux pump of Pseudomonas aeruginosa requires OprM for antibiotic efflux but
not for efflux oftriclosan. J. Bacteriol. 184:5036-44.

19. Colmer, J. A., and A. N. Hamood. 1998. Characterization ofptxS, a
Pseudomonas aeruginosa gene which interferes with the effect of the exotoxin A
positive regulatory gene, ptxR. Mol. Gen. Genet. 258:250-9.

20. Cornelis, G. R., C. Sluiters, I. Delor, D. Geib, K. Kaniga, C. Lambert de
Rouvroit, M. P. Sory, J. C. Vanooteghem, and T. Michiels. 1991. ymoA, a
Yersinia enterocolitica chromosomal gene modulating the expression of virulence
functions. Mol. Microbiol. 5:1023-34.










21. Dacheux, D., I. Attree, C. Schneider, and B. Toussaint. 1999. Cell death of
human polymorphonuclear neutrophils induced by a Pseudomonas aeruginosa
cystic fibrosis isolate requires a functional type III secretion system. Infect.
Immun. 67:6164-7.

22. Dacheux, D., I. Attree, and B. Toussaint. 2001. Expression of ExsA in trans
confers type III secretion system-dependent cytotoxicity on noncytotoxic
Pseudomonas aeruginosa cystic fibrosis isolates. Infect. Immun. 69:538-42.

23. Dacheux, D., O. Epaulard, A. de Groot, B. Guery, R. Leberre, I. Attree, B.
Polack, and B. Toussaint. 2002. Activation of the Pseudomonas aeruginosa type
III secretion system requires an intact pyruvate dehydrogenase aceAB operon.
Infect. Immun. 70:3973-7.

24. Dacheux, D., J. Goure, J. Chabert, Y. Usson, and I. Attree. 2001. Pore-
forming activity of type III system-secreted proteins leads to oncosis of
Pseudomonas aeruginosa-infected macrophages. Mol. Microbiol. 40:76-85.

25. Darzins, A., and M. A. Russell. 1997. Molecular genetic analysis of type-4 pilus
biogenesis and twitching motility using Pseudomonas aeruginosa as a model
system--a review. Gene 192:109-15.

26. Dasgupta, N., E. P. Ferrell, K J. Kanack, S. E. West, and R. Ramphal. 2002.
fleQ, the gene encoding the major flagellar regulator of Pseudomonas aeruginosa,
is sigma70 dependent and is downregulated by Vfr, a homolog of Escherichia coli
cyclic AMP receptor protein. J. Bacteriol. 184:5240-50.

27. Dasgupta, N., G. L. Lykken, M. C. Wolfgang, and T. L. Yahr. 2004. A novel
anti-anti-activator mechanism regulates expression of the Pseudomonas
aeruginosa type III secretion system. Mol. Microbiol. 53:297-308.

28. De Kievit, T. R., R. Gillis, S. Marx, C. Brown, and B. H. Iglewski. 2001.
Quorum-sensing genes in Pseudomonas aeruginosa biofilms: their role and
expression patterns. Appl. Environ. Microbiol. 67:1865-73.

29. Deretic, V., and W. M. Konyecsni. 1990. A procaryotic regulatory factor with a
histone HI-like carboxy-terminal domain: clonal variation of repeats within algP,
a gene involved in regulation of mucoidy in Pseudomonas aeruginosa. J.
Bacteriol. 172:5544-54.

30. Doran, T. J., S. M. Loh, N. Firth, and R. A. Skurray. 1994. Molecular analysis
of the F plasmid traVR region: traV encodes a lipoprotein. J. Bacteriol. 176:4182-









31. Dove, S. L., and A. Hochschild. 2001. Bacterial two-hybrid analysis of
interactions between region 4 of the sigma(70) subunit of RNA polymerase and
the transcriptional regulators Rsd from Escherichia coli and AlgQ from
Pseudomonas aeruginosa. J. Bacteriol. 183:6413-21.

32. Firoved, A. M., and V. Deretic. 2003. Microarray analysis of global gene
expression in mucoid Pseudomonas aeruginosa. J. Bacteriol. 185:1071-81.

33. Firoved, A. M., S. R. Wood, W. Ornatowski, V. Deretic, and G. S. Timmins.
2004. Microarray analysis and functional characterization of the nitrosative stress
response in nonmucoid and mucoid Pseudomonas aeruginosa. J. Bacteriol.
186:4046-50.

34. FitzSimmons, S. C. 1993. The changing epidemiology of cystic fibrosis. J.
Pediatr. 122:1-9.

35. Francis, M. S., H. Wolf-Watz, and A. Forsberg. 2002. Regulation of type III
secretion systems. Curr. Opin. Microbiol. 5:166-72.

36. Frank, D. W., G. Nair, and H. P. Schweizer. 1994. Construction and
characterization of chromosomal insertional mutations of the Pseudomonas
aeruginosa exoenzyme S trans-regulatory locus. Infect. Immun. 62:554-63.

37. Frank, D. W., A. Vallis, J. P. Wiener-Kronish, A. Roy-Burman, E. G. Spack,
B. P. Mullaney, M. Megdoud, J. D. Marks, R. Fritz, and T. Sawa. 2002.
Generation and characterization of a protective monoclonal antibody to
Pseudomonas aeruginosa PcrV. J. Infect. Dis. 186:64-73.

38. Furste, J. P., W. Pansegrau, R. Frank, H. Blocker, P. Scholz, M.
Bagdasarian, and E. Lanka. 1986. Molecular cloning of the plasmid RP4
primase region in a multi-host-range tacP expression vector. Gene 48:119-31.

39. Garrity-Ryan, L., S. Shafikhani, P. Balachandran, L. Nguyen, J. Oza, T.
Jakobsen, J. Sargent, X. Fang, S. Cordwell, M. A. Matthay, and J. N. Engel.
2004. The ADP ribosyltransferase domain ofPseudomonas aeruginosa ExoT
contributes to its biological activities. Infect. Immun. 72:546-58.

40. Geske, G. D., R. J. Wezeman, A. P. Siegel, and H. E. Blackwell. 2005. Small
molecule inhibitors of bacterial quorum sensing and biofilm formation. J. Am.
Chem. Soc. 127:12762-3.

41. Gibson, R. L., J. L. Burns, and B. W. Ramsey. 2003. Pathophysiology and
management of pulmonary infections in cystic fibrosis. Am. J. Respir. Crit. Care
Med. 168:918-51.









42. Goodman, A. L., B. Kulasekara, A. Rietsch, D. Boyd, R. S. Smith, and S.
Lory. 2004. A signaling network reciprocally regulates genes associated with
acute infection and chronic persistence in Pseudomonas aeruginosa. Dev. Cell
7:745-54.

43. Goranson, J., A. K. Hovey, and D. W. Frank. 1997. Functional analysis of exsC
and exsB in regulation of exoenzyme S production by Pseudomonas aeruginosa.
J. Bacteriol. 179:1646-54.

44. Goure, J., A. Pastor, E. Faudry, J. Chabert, A. Dessen, and I. Attree. 2004.
The V antigen of Pseudomonas aeruginosa is required for assembly of the
functional PopB/PopD translocation pore in host cell membranes. Infect. Immun.
72:4741-50.

45. Govan, J. R., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis:
mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev.
60:539-74.

46. Ha, U., and S. Jin. 2001. Growth phase-dependent invasion of Pseudomonas
aeruginosa and its survival within HeLa cells. Infect. Immun. 69:4398-406.

47. Ha, U. H., J. Kim, H. Badrane, J. Jia, H. V. Baker, D. Wu, and S. Jin. 2004.
An in vivo inducible gene of Pseudomonas aeruginosa encodes an anti-ExsA to
suppress the type III secretion system. Mol. Microbiol. 54:307-20.

48. Ha, U. H., Y. Wang, and S. Jin. 2003. DsbA of Pseudomonas aeruginosa is
essential for multiple virulence factors. Infect. Immun. 71:1590-5.

49. Hakansson, S., K. Schesser, C. Persson, E. E. Galyov, R. Rosqvist, F.
Homble, and H. Wolf-Watz. 1996. The YopB protein of Yersinia
pseudotuberculosis is essential for the translocation of Yop effector proteins
across the target cell plasma membrane and displays a contact-dependent
membrane disrupting activity. Embo. J. 15:5812-23.

50. Harshey, R. M. 2003. Bacterial motility on a surface: many ways to a common
goal. Annu. Rev. Microbiol. 57:249-73.

51. Hassett, D. J., J. Cuppoletti, B. Trapnell, S. V. Lymar, J. J. Rowe, S. S. Yoon,
G. M. Hilliard, K. Parvatiyar, M. C. Kamani, D. J. Wozniak, S. H. Hwang, T.
R. McDermott, and U. A. Ochsner. 2002. Anaerobic metabolism and quorum
sensing by Pseudomonas aeruginosa biofilms in chronically infected cystic
fibrosis airways: rethinking antibiotic treatment strategies and drug targets. Adv.
Drug Deliv. Rev. 54:1425-43.









52. Hassett, D. J., M. L. Howell, U. A. Ochsner, M. L. Vasil, Z. Johnson, and G.
E. Dean. 1997. An operon containingfumC and sodA encoding fumarase C and
manganese superoxide dismutase is controlled by the ferric uptake regulator in
Pseudomonas aeruginosa: fur mutants produce elevated alginate levels. J.
Bacteriol. 179:1452-9.

53. Hassett, D. J., M. L. Howell, P. A. Sokol, M. L. Vasil, and G. E. Dean. 1997.
Fumarase C activity is elevated in response to iron deprivation and in mucoid,
alginate-producing Pseudomonas aeruginosa: cloning and characterization of
fumC and purification of nativefumC. J. Bacteriol. 179:1442-51.

54. Hassett, D. J., W. A. Woodruff, D. J. Wozniak, M. L. Vasil, M. S. Cohen, and
D. E. Ohman. 1993. Cloning and characterization of the Pseudomonas
aeruginosa sodA and sodB genes encoding manganese- and iron-cofactored
superoxide dismutase: demonstration of increased manganese superoxide
dismutase activity in alginate-producing bacteria. J. Bacteriol. 175:7658-65.

55. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P.
Schweizer. 1998. A broad-host-range Flp-FRT recombination system for site-
specific excision of chromosomally-located DNA sequences: application for
isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86.

56. Hogardt, M., M. Roeder, A. M. Schreff, L. Eberl, and J. Heesemann. 2004.
Expression of Pseudomonas aeruginosa exoS is controlled by quorum sensing
and RpoS. Microbiology 150:843-51.

57. Hoiby, N., G. Doring, and P. O. Schiotz. 1987. Pathogenic mechanisms of
chronic Pseudomonas aeruginosa infections in cystic fibrosis patients. Antibiot.
Chemother. 39:60-76.

58. Hoiby, N., H. Krogh Johansen, C. Moser, Z. Song, O. Ciofu, and A.
Kharazmi. 2001. Pseudomonas aeruginosa and the in vitro and in vivo biofilm
mode of growth. Microbes Infect. 3:23-35.

59. Holder, I. A., A. N. Neely, and D. W. Frank. 2001. Type III
secretion/intoxication system important in virulence of Pseudomonas aeruginosa
infections in burns. Burns 27:129-30.

60. Hovey, A. K., and D. W. Frank. 1995. Analyses of the DNA-binding and
transcriptional activation properties of ExsA, the transcriptional activator of the
Pseudomonas aeruginosa exoenzyme S regulon. J. Bacteriol. 177:4427-36.

61. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of
animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433.









62. Ishihama, A. 2000. Functional modulation of Escherichia coli RNA polymerase.
Annu. Rev. Microbiol. 54:499-518.

63. Jacobs, M. A., A. Alwood, I. Thaipisuttikul, D. Spencer, E. Haugen, S. Ernst,
O. Will, R. Kaul, C. Raymond, R. Levy, L. Chun-Rong, D. Guenthner, D.
Bovee, M. V. Olson, and C. Manoil. 2003. Comprehensive transposon mutant
library of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U S A 100:14339-44.

64. Jia, J., M. Alaoui-El-Azher, M. Chow, T. C. Chambers, H. Baker, and S. Jin.
2003. c-Jun NH2-terminal kinase-mediated signaling is essential for
Pseudomonas aeruginosa ExoS-induced apoptosis. Infect. Immun. 71:3361-70.

65. Juhas, M., L. Eberl, and B. Tummler. 2005. Quorum sensing: the power of
cooperation in the world of Pseudomonas. Environ. Microbiol. 7:459-71.

66. Kang, P. J., and E. A. Craig. 1990. Identification and characterization of a new
Escherichia coli gene that is a dosage-dependent suppressor of a dnaK deletion
mutation. J. Bacteriol. 172:2055-64.

67. Kaufman, M. R., J. Jia, L. Zeng, U. Ha, M. Chow, and S. Jin. 2000.
Pseudomonas aeruginosa mediated apoptosis requires the ADP-ribosylating
activity of exoS. Microbiology 146 (Pt 10):2531-41.

68. Kohler, T., M. Michea-Hamzehpour, U. Henze, N. Gotoh, L. K. Curty, and J.
C. Pechere. 1997. Characterization of MexE-MexF-OprN, a positively regulated
multidrug efflux system ofPseudomonas aeruginosa. Mol. Microbiol. 23:345-54.

69. Kuchma, S. L., J. P. Connolly, and G. A. O'Toole. 2005. A three-component
regulatory system regulates biofilm maturation and type III secretion in
Pseudomonas aeruginosa. J. Bacteriol. 187:1441-54.

70. Kushner, S. R. 2004. mRNA decay in prokaryotes and eukaryotes: different
approaches to a similar problem. IUBMB Life 56:585-94.

71. Larsen, R. A., M. M. Wilson, A. M. Guss, and W. W. Metcalf. 2002. Genetic
analysis of pigment biosynthesis in Xanthobacter autotrophicus Py2 using a new,
highly efficient transposon mutagenesis system that is functional in a wide variety
of bacteria. Arch. Microbiol. 178:193-201.

72. Laskowski, M. A., E. Osborn, and B. I. Kazmierczak. 2004. A novel sensor
kinase-response regulator hybrid regulates type III secretion and is required for
virulence in Pseudomonas aeruginosa. Mol. Microbiol. 54:1090-103.









73. Ledgham, F., C. Soscia, A. Chakrabarty, A. Lazdunski, and M. Foglino.
2003. Global regulation in Pseudomonas aeruginosa: the regulatory protein
AlgR2 (AlgQ) acts as a modulator of quorum sensing. Res. Microbiol. 154:207-
13.

74. Lewin, B. 1994. Genes V. Oxford University Press. New York.

75. Linares, J. F., J. A. Lopez, E. Camafeita, J. P. Albar, F. Rojo, and J. L.
Martinez. 2005. Overexpression of the multidrug efflux pumps MexCD-OprJ and
MexEF-OprN is associated with a reduction of type III secretion in Pseudomonas
aeruginosa. J. Bacteriol. 187:1384-91.

76. Livermore, D. M. 1995. beta-Lactamases in laboratory and clinical resistance.
Clin. Microbiol. Rev. 8:557-84.

77. Lizewski, S. E., D. S. Lundberg, and M. J. Schurr. 2002. The transcriptional
regulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect.
Immun. 70:6083-93.

78. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J.
Wozniak. 1998. Phosphorylation-independent activity of the response regulators
AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas
aeruginosa. J. Bacteriol. 180:956-68.

79. Madrid, C., J. M. Nieto, and A. Juarez. 2002. Role of the Hha/YmoA family of
proteins in the thermoregulation of the expression of virulence factors. Int. J.
Med. Microbiol. 291:425-32.

80. Malhotra, S., L. A. Silo-Suh, K. Mathee, and D. E. Ohman. 2000. Proteome
analysis of the effect of mucoid conversion on global protein expression in
Pseudomonas aeruginosa strain PAO 1 shows induction of the disulfide bond
isomerase, dsbA. J. Bacteriol. 182:6999-7006.

81. Maresso, A. W., M. J. Riese, and J. T. Barbieri. 2003. Molecular heterogeneity
of a type III cytotoxin, Pseudomonas aeruginosa exoenzyme S. Biochemistry
42:14249-57.

82. Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. Govan, B. W. Holloway, and
V. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonas
aeruginosa infecting cystic fibrosis patients. Proc. Natl. Acad. Sci. U S A
90:8377-81.

83. Masse, E., N. Majdalani, and S. Gottesman. 2003. Regulatory roles for small
RNAs in bacteria. Curr. Opin. Microbiol. 6:120-4.









84. Mathee, K., O. Ciofu, C. Sternberg, P. W. Lindum, J. I. Campbell, P. Jensen,
A. H. Johnsen, M. Givskov, D. E. Ohman, S. Molin, N. Hoiby, and A.
Kharazmi. 1999. Mucoid conversion of Pseudomonas aeruginosa by hydrogen
peroxide: a mechanism for virulence activation in the cystic fibrosis lung.
Microbiology 145 (Pt 6):1349-57.

85. Mathee, K., C. J. McPherson, and D. E. Ohman. 1997. Posttranslational
control of the algT (algU)-encoded sigma22 for expression of the alginate regulon
in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and
MucB (AlgN). J. Bacteriol. 179:3711-20.

86. Matsui, H., Y. Sano, H. Ishihara, and T. Shinomiya. 1993. Regulation of
pyocin genes in Pseudomonas aeruginosa by positive (prtN) and negative (prtR)
regulatory genes. J. Bacteriol. 175:1257-63.

87. Mattick, J. S., C. B. Whitchurch, and R. A. Aim. 1996. The molecular genetics
of type-4 fimbriae in Pseudomonas aeruginosa--a review. Gene 179:147-55.

88. Mavroidi, A., E. Tzelepi, A. Tsakris, V. Miriagou, D. Sofianou, and L. S.
Tzouvelekis. 2001. An integron-associated beta-lactamase (IBC-2) from
Pseudomonas aeruginosa is a variant of the extended-spectrum beta-lactamase
IBC-1. J. Antimicrob. Chemother. 48:627-30.

89. McCaw, M. L., G. L. Lykken, P. K. Singh, and T. L. Yahr. 2002. ExsD is a
negative regulator of the Pseudomonas aeruginosa type III secretion regulon.
Mol. Microbiol. 46:1123-33.

90. Michel-Briand, Y., and C. Baysse. 2002. The pyocins of Pseudomonas
aeruginosa. Biochimie. 84:499-510.

91. Miller, G. H., F. J. Sabatelli, R. S. Hare, Y. Glupczynski, P. Mackey, D.
Shlaes, K. Shimizu, and K. J. Shaw. 1997. The most frequent aminoglycoside
resistance mechanisms--changes with time and geographic area: a reflection of
aminoglycoside usage patterns? Aminoglycoside Resistance Study Groups. Clin.
Infect. Dis. 24 Suppl 1:S46-62.

92. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor
Laboratory Press, New York, N.Y.

93. Mohr, C. D., N. S. Hibler, and V. Deretic. 1991. AlgR, a response regulator
controlling mucoidy in Pseudomonas aeruginosa, binds to the FUS sites of the
algD promoter located unusually far upstream from the mRNA start site. J.
Bacteriol. 173:5136-43.









94. Nakajima, A., Y. Sugimoto, H. Yoneyama, and T. Nakae. 2002. High-level
fluoroquinolone resistance in Pseudomonas aeruginosa due to interplay of the
MexAB-OprM efflux pump and the DNA gyrase mutation. Microbiol. Immunol.
46:391-5.

95. Neyt, C., and G. R. Cornelis. 1999. Insertion of a Yop translocation pore into the
macrophage plasma membrane by Yersinia enterocolitica: requirement for
translocators YopB and YopD, but not LcrG. Mol. Microbiol. 33:971-81.

96. Nixon, G. M., D. S. Armstrong, R. Carzino, J. B. Carlin, A. Olinsky, C. F.
Robertson, and K. Grimwood. 2001. Clinical outcome after early Pseudomonas
aeruginosa infection in cystic fibrosis. J. Pediatr. 138:699-704.

97. Ochsner, U. A., P. J. Wilderman, A. I. Vasil, and M. L. Vasil. 2002. GeneChip
expression analysis of the iron starvation response in Pseudomonas aeruginosa:
identification of novel pyoverdine biosynthesis genes. Mol. Microbiol. 45:1277-
87.

98. Pastor, A., J. Chabert, M. Louwagie, J. Garin, and I. Attree. 2005. PscF is a
major component of the Pseudomonas aeruginosa type III secretion needle.
FEMS Microbiol. Lett. 253:95-101.

99. Pier, G. B., M. Grout, and T. S. Zaidi. 1997. Cystic fibrosis transmembrane
conductance regulator is an epithelial cell receptor for clearance of Pseudomonas
aeruginosa from the lung. Proc. Natl. Acad. Sci. U S A 94:12088-93.

100. Poole, K. 2001. Multidrug efflux pumps and antimicrobial resistance in
Pseudomonas aeruginosa and related organisms. J. Mol. Microbiol. Biotechnol.
3:255-64.

101. Poole, K., K. Tetro, Q. Zhao, S. Neshat, D. E. Heinrichs, and N. Bianco. 1996.
Expression of the multidrug resistance operon mexA-mexB-oprMin Pseudomonas
aeruginosa: mexR encodes a regulator of operon expression. Antimicrob. Agents
Chemother. 40:2021-8.

102. Quinaud, M., J. Chabert, E. Faudry, E. Neumann, D. Lemaire, A. Pastor, S.
Elsen, A. Dessen, and I. Attree. 2005. The PscE-PscF-PscG complex controls
type III secretion needle biogenesis in Pseudomonas aeruginosa. J. Biol. Chem.
280:36293-300.

103. Rajan, S., and L. Saiman. 2002. Pulmonary infections in patients with cystic
fibrosis. Semin.Respir. Infect. 17:47-56.

104. Ramphal, R., L. Koo, K. S. Ishimoto, P. A. Totten, J. C. Lara, and S. Lory.
1991. Adhesion ofPseudomonas aeruginosa pilin-deficient mutants to mucin.
Infect. Immun. 59:1307-11.










105. Richards, M. J., J. R. Edwards, D. H. Culver, and R. P. Gaynes. 1999.
Nosocomial infections in medical intensive care units in the United States.
National Nosocomial Infections Surveillance System. Crit. Care. Med. 27:887-92.

106. Rietsch, A., I. Vallet-Gely, S. L. Dove, and J. J. Mekalanos. 2005. ExsE, a
secreted regulator of type III secretion genes in Pseudomonas aeruginosa. Proc.
Natl. Acad. Sci. USA 102:8006-11.

107. Rietsch, A., M. C. Wolfgang, and J. J. Mekalanos. 2004. Effect of metabolic
imbalance on expression of type III secretion genes in Pseudomonas aeruginosa.
Infect. Immun. 72:1383-90.

108. Rodrigue, A., Y. Quentin, A. Lazdunski, V. Mejean, and M. Foglino. 2000.
Two-component systems in Pseudomonas aeruginosa: why so many? Trends.
Microbiol. 8:498-504.

109. Rosenfeld, M., B. W. Ramsey, and R. L. Gibson. 2003. Pseudomonas
acquisition in young patients with cystic fibrosis: pathophysiology, diagnosis, and
management. Curr. Opin. Pulm. Med. 9:492-7.

110. Rossolini, G. M., and E. Mantengoli. 2005. Treatment and control of severe
infections caused by multiresistant Pseudomonas aeruginosa. Clin. Microbiol.
Infect. 11 Suppl 4:17-32.

111. Rowen, D. W., and V. Deretic. 2000. Membrane-to-cytosol redistribution of
ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa
isolates from cystic fibrosis patients. Mol. Microbiol. 36:314-27.

112. Sato, H., J. B. Feix, C. J. Hillard, and D. W. Frank. 2005. Characterization of
phospholipase activity of the Pseudomonas aeruginosa type III cytotoxin, ExoU.
J. Bacteriol. 187:1192-5.

113. Sawa, T., T. L. Yahr, M. Ohara, K Kurahashi, M. A. Gropper, J. P. Wiener-
Kronish, and D. W. Frank. 1999. Active and passive immunization with the
Pseudomonas V antigen protects against type III intoxication and lung injury. Nat.
Med. 5:392-8.

114. Schoehn, G., A. M. Di Guilmi, D. Lemaire, I. Attree, W. Weissenhorn, and A.
Dessen. 2003. Oligomerization of type III secretion proteins PopB and PopD
precedes pore formation in Pseudomonas. Embo. J. 22:4957-67.

115. Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from
pUC18/19. Gene 97:109-21.









116. Shan, Z., H. Xu, X. Shi, Y. Yu, H. Yao, X. Zhang, Y. Bai, C. Gao, P. E. Saris,
and M. Qiao. 2004. Identification of two new genes involved in twitching
motility in Pseudomonas aeruginosa. Microbiology 150:2653-61.

117. Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular
genetics of aminoglycoside resistance genes and familial relationships of the
aminoglycoside-modifying enzymes. Microbiol. Rev. 57:138-63.

118. Shiba, T., K. Ishiguro, N. Takemoto, H. Koibuchi, and K. Sugimoto. 1995.
Purification and characterization of the Pseudomonas aeruginosa NfxB protein,
the negative regulator of the nfxB gene. J. Bacteriol. 177:5872-7.

119. Shih, P. C., and C. T. Huang. 2002. Effects of quorum-sensing deficiency on
Pseudomonas aeruginosa biofilm formation and antibiotic resistance. J.
Antimicrob. Chemother. 49:309-14.

120. Shime, N., T. Sawa, J. Fujimoto, K. Faure, L. R. Allmond, T. Karaca, B. L.
Swanson, E. G. Spack, and J. P. Wiener-Kronish. 2001. Therapeutic
administration of anti-PcrV F(ab')(2) in sepsis associated with Pseudomonas
aeruginosa. J. Immunol. 167:5880-6.

121. Shortridge, V. D., A. Lazdunski, and M. L. Vasil. 1992. Osmoprotectants and
phosphate regulate expression of phospholipase C in Pseudomonas aeruginosa.
Mol. Microbiol. 6:863-71.

122. Sonnleitner, E., S. Hagens, F. Rosenau, S. Wilhelm, A. Habel, K. E. Jager,
and U. Blasi. 2003. Reduced virulence of a hfq mutant of Pseudomonas
aeruginosa 01. Microb. Pathog. 35:217-28.

123. Storz, G., J. A. Opdyke, and A. Zhang. 2004. Controlling mRNA stability and
translation with small, noncoding RNAs. Curr. Opin. Microbiol. 7:140-4.

124. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J.
Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L.
Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L.
Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D.
Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E.
Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of
Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-64.

125. Sundin, C., B. Hallberg, and A. Forsberg. 2004. ADP-ribosylation by
exoenzyme T of Pseudomonas aeruginosa induces an irreversible effect on the
host cell cytoskeleton in vivo. FEMS Microbiol. Lett. 234:87-91.









126. Sundin, C., J. Thelaus, J. E. Broms, and A. Forsberg. 2004. Polarisation of
type III translocation by Pseudomonas aeruginosa requires PcrG, PcrV and PopN.
Microb. Pathog. 37:313-22.

127. Tardy, F., F. Homble, C. Neyt, R. Wattiez, G. R. Cornelis, J. M. Ruysschaert,
and V. Cabiaux. 1999. Yersinia enterocolitica type III secretion-translocation
system: channel formation by secreted Yops. Embo. J. 18:6793-9.

128. Tateda, K., Y. Ishii, M. Horikawa, T. Matsumoto, S. Miyairi, J. C. Pechere,
T. J. Standiford, M. Ishiguro, and K. Yamaguchi. 2003. The Pseudomonas
aeruginosa autoinducer N-3-oxododecanoyl homoserine lactone accelerates
apoptosis in macrophages and neutrophils. Infect. Immun. 71:5785-93.

129. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of
microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U S
A 98:5116-21.

130. Urbanowski, M. L., G. L. Lykken, and T. L. Yahr. 2005. A secreted regulatory
protein couples transcription to the secretary activity of the Pseudomonas
aeruginosa type III secretion system. Proc. Natl. Acad. Sci. U S A 102:9930-5.

131. Vallis, A. J., T. L. Yahr, J. T. Barbieri, and D. W. Frank. 1999. Regulation of
ExoS production and secretion by Pseudomonas aeruginosa in response to tissue
culture conditions. Infect. Immun. 67:914-20.

132. Vasil, M. L., and U. A. Ochsner. 1999. The response of Pseudomonas
aeruginosa to iron: genetics, biochemistry and virulence. Mol. Microbiol. 34:399-
413.

133. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski.
2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons:
effects of growth phase and environment. J. Bacteriol. 185:2080-95.

134. Wang, Y., U. Ha, L. Zeng, and S. Jin. 2003. Regulation of membrane
permeability by a two-component regulatory system in Pseudomonas aeruginosa.
Antimicrob. Agents. Chemother. 47:95-101.

135. Westbrock-Wadman, S., D. R. Sherman, M. J. Hickey, S. N. Coulter, Y. Q.
Zhu, P. Warrener, L. Y. Nguyen, R. M. Shawar, K. R. Folger, and C. K.
Stover. 1999. Characterization of a Pseudomonas aeruginosa efflux pump
contributing to aminoglycoside impermeability. Antimicrob. Agents. Chemother.
43:2975-83.

136. Whitchurch, C. B., R. A. Aim, and J. S. Mattick. 1996. The alginate regulator
AlgR and an associated sensor FimS are required for twitching motility in
Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U S A 93:9839-43.