<%BANNER%>

Biotechnology and Its Uses in Improvement of Canker Resistance in Citrus Trees


PAGE 1

BIOTECHNOLOGY AND ITS USES IN IMPROVEMENT OF CANKER RESISTANCE IN CITRUS TREES By AHMAD AL-SAYED MOHAMAD OMAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Ahmad Al-Sayed Mohamad Omar

PAGE 3

Dedication To the memory of my mother who I w ill never ever forget her undying love and encouragement during all the steps of my life. To the memory of my brother Ragab who ta ught me that dreams are to be pursued and challenges to be met. To my father and my family who give me unconditional support and encouragement during all the steps of my life. To my wife Azza To my beloved daughter whose smile gives me a reason to wake up everyday.

PAGE 4

ACKNOWLEDGMENTS I thank my family for the unconditional support and encouragement during all the steps of the program. They have always beli eved in me and helped me in many ways. I appreciate the undying love and support I receive fr om my sisters and brothers and their respective families. I thank th e Egyptian Government, Ministry of Higher Education, for sponsoring most of my graduate studies abro ad and for its overall attention with the fellows. My time as a graduate student was made more productive because of the outstanding support and the magnifi cent guidance of my major a dvisor, Dr. Jude Grosser. He always provided me with many useful experiences, encouragement, and thoughtful advice for both my professional and personal lif e. I will never forget his words, The moon will be perfect someday during one of the most difficult hardship moments during the program. Without his help and support I w ould never been able to finish my Ph.D. His high ethical standards and respectful views for the others will never be forgotten. For what he did for me, I am grateful beyond words. I thank the other members of my supervis ory committee, Dr. James Graham, for his valuable help and guidance in regard to R eal-Time PCR experiment and canker challenge assay; Dr. Wen-Yuan Song, for his contri bution and suggestions in the DNA cloning aspects; Dr. Frederick Gmitter, for his suggest ions and help. I thank Dr. R. P. Niedz for providing pARS108 plasmid, Dr. Pamela Ronald for providing cDNA of the Xa21 gene, iv

PAGE 5

and Dr. T. E. Clemente for providing pR TL2.vec plasmid. I am highly grateful to Dr. Siddarame Gowda for his help at the first stages of my work. I am also very grateful to my Egyptia n colleagues that shared their care and friendships. I especially want to thank Dr. Fahiem El Borai, for his valuable help and suggestions, Hesham Orbay, Kamal and his fa mily, and Shamel and his family. Thanks go to Dr. Mohamed Ismail for proofreading my manuscript. During my academic and professional carrier I have been fortunate to meet people that helped me in many different ways of positive attitude. I especially thank J. L. Chandler, Gary Barthe, We n Wu Guo, Ananthakrishnan, Vladimir Orbovic, Millica Calovic, Zenadia Viloria, Gemma Pas quali, Marty Dekkers, Anna Redondo, Orrinna Speese, Patricia Brickman, Charles D unning, Julie Gmitter, Avijit Roy, Mohammad Afunian, Mukkades Kayum, Kanjana Mahatt anatawee, Qamar Zaman, Gretchen Baut, Monica Lewendowski, Pamela Russ, Diann Achor, Allan Burrage, and Marcia Alden for the limitless help, understanding, and friendship they have provided to me in the past five years. I also thank Zagazig University, Egypt, for its support in conducting this project and also the faculty of the Biochemistry Department, Colle ge of Agriculture, Zagazig University, Egypt, whose support was essentia l to conduct and conclude this program. I especially thank my professors back in Egypt, Dr. Mahmoud Dohiem and Dr. Samy Sharobeem, who taught me the fundamentals of biochemistry and plant molecular biology. Finally, I would like to extend my special gratitude and thanks to my wife, Azza, for her immeasurable love, constant and unconditional support, a nd encouragement. v

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF TABLES .............................................................................................................ix LIST OF FIGURES .............................................................................................................x ABSTRACT ......................................................................................................................xii CHAPTER 1 INTRODUCTION........................................................................................................1 2 REVIEW OF LITERATURE.......................................................................................5 Citrus Canker................................................................................................................5 Methods of Transformation..........................................................................................7 Arobacterium tumefaciens-Mediated Transformation..........................................8 Biolistics or Microprojectile Bombardment........................................................11 Protoplast Transformation...................................................................................13 Plant Resistance (R) Proteins......................................................................................16 Mode of Action of the Xa21 .......................................................................................19 Objectives...................................................................................................................25 3 TRANSFER OF THE XA21 XANTHOMONAS RESISTANCE GENE FROM RICE INTO HAMLIN SWEET ORANGE [ CITRUS SINENSIS (L.) OSBECK] USING A PROTOPLAST/ GFP CO-TRANSFORMATION SYSTEM...................26 Introduction.................................................................................................................26 Materials and Methods...............................................................................................30 Plasmid Construction...........................................................................................30 Plasmid Multiplication........................................................................................35 Transformation of E. coli .............................................................................35 Quick miniprep plasmid preparation and confirmation of insert orientation.................................................................................................35 Large scale isolation and plasmid preparation.............................................36 Plant Material, Protoplast Transformation, and Culture.....................................36 Establishment and maintenance of suspension cultures...............................36 Transformation and culture of citrus protoplasts.........................................37 vi

PAGE 7

Regeneration and selection of transformed protoplasts...............................38 Comparison of different GFP-containing constructs at the whole plant level...........................................................................................................39 Molecular Analysis of Transgenic Tissue...........................................................39 Polymerase chain reaction (PCR) fo r detection of transformants................40 Southern blot analysis..................................................................................40 Western blot analysis...................................................................................41 Results and Discussion...............................................................................................43 Plasmid Preparation.............................................................................................43 Transformation of Citrus Protopl asts and Plant Regeneration............................43 Comparison of different GFP-containing constructs...................................44 Transient and stable transf ormation frequencies using GFP as a selectable marker......................................................................................45 Plant regeneration.........................................................................................47 Molecular Analysis..............................................................................................55 Polymerase chain reaction (PCR) for screening transformants....................55 Screening for transformants us ing southern blot analysis............................57 Confirmation of transformation using western blot analysis.......................58 4 TRANSGENIC HAMLIN SWEET ORANGE PLANTS CONTAINING A RICE XA21 cDNA XANTHOMONAS RESISTANCE GENE OBTAINED BY PROTOPLAST/ GFP TRANSFORMATION SYSTEM...........................................60 Introduction.................................................................................................................60 Materials and Methods...............................................................................................61 Plasmid Construction...........................................................................................61 Plasmid Multiplication........................................................................................63 Transformation of E. coli .............................................................................63 Quick miniprep plasmid preparation and confirmation of the orientation of the insert...............................................................................................63 Large scale preparation of plasmid DNA.....................................................63 Plant Material, Protoplast Transformation, and Culture.....................................65 Establishment and maintenance of suspension cultures...............................65 Isolation, transformation, and cu lture of citrus protoplasts..........................65 Regeneration and selection of transformed protoplasts...............................65 Molecular Analysis of Transgenic Plants............................................................66 Polymerase chain reaction (PCR) fo r detection of transformants................66 Southern blot analysis..................................................................................66 Western blot analysis...................................................................................67 Results and Discussion...............................................................................................68 Plasmid Preparation.............................................................................................68 Transformation of Citrus Protopl asts and Plant Regeneration............................69 Transient and stable transf ormation frequencies using GFP as selectable marker.......................................................................................................69 Plant regeneration.........................................................................................71 GFP expression at the mature stag e of the transgenic plants.......................75 Molecular Analysis..............................................................................................78 vii

PAGE 8

Polymerase chain reaction for selection of transformants............................78 Screening for transformants us ing southern blot analysis............................78 Confirmation of transformation using western blot analysis.......................79 5 ESTIMATING THE COPY NUMBER OF TRANSGENES IN TRANSFORMED CITRUS PLANTS BY QUANTITATIVE REAL-TIME PCR...83 Introduction.................................................................................................................83 Materials and Methods...............................................................................................87 Transgenic Plants.................................................................................................87 DNA Extraction...................................................................................................88 Quantitative Real-time Polymerase Chain Reaction (qRt-PCR).........................88 Primers and probes.......................................................................................88 Real-time PCR reactions and conditions......................................................89 Optimization of prim er concentrations........................................................90 PCR efficiency.............................................................................................90 Calculation of Copy Number and Statistical Analysis........................................91 Results and Discussion...............................................................................................92 Transgene Xa21 Copy Number Estimation in Transgenic Citrus by Comparison to the Endogenous LTP Gene......................................................92 Validation of the Standard Curves and PCR Efficiency.....................................93 Estimating the Copy Number of Xa21 in the Transgenic Citrus.........................96 Comparison of Copy Number Determina tion by qRT-PCR and Southern Blot Analysis............................................................................................................97 Conclusion..................................................................................................................98 6 SUMMARY AND CONCLUSIONS.......................................................................101 APPENDIX A CITRUS PROTOPLASTS MEDIA AND SOLUTION...........................................104 B PCR PRIMERS AND PROGRAM..........................................................................111 C MOLECULAR ANALYSIS SOLUTION................................................................112 D QUANTITATIVE REAL TIME-PCR.....................................................................114 LIST OF REFERENCES.................................................................................................115 BIOGRAPHICAL SKETCH...........................................................................................131 viii

PAGE 9

LIST OF TABLES Table page 1-1 Total production of citrus fruit...................................................................................4 2-1 Examples of plant protoplast tr ansformation experiments and success of transgenic plant recovery.........................................................................................18 2-2 Plant disease resistan ce (R) proteins and thei r predicted structure..........................22 5-1 Primers pairs and probes of LTP and Xa21 genes used for quantitative real-time PCR assays...............................................................................................................89 5-2 Reproducibility of the Ct meas urement of replicate standards................................97 5-3 Real-time PCR estimates of copy number for Xa21 transgene..............................100 A-1 Composition of the EME medium.........................................................................104 A-2 Composition of RMAN medium............................................................................105 A-3 Composition of 0.6 m BH3 nutrient medium.........................................................106 A-4 Composition of sucrose and mannitol solutions....................................................107 A-5 Composition of protoplast transformation solutions..............................................107 A-6 Composition of H+H medium................................................................................108 A-7 Composition of B+ medium...................................................................................109 A-8 Composition of DBA3 medium.............................................................................110 A-9 Composition of the enzyme solution used for citrus protoplast isolation..............110 ix

PAGE 10

LIST OF FIGURES Figure page 2-1 Schematic representation of different genetically defined plant resistance proteins.....................................................................................................................21 3-1 Schematic diagram of pARS108 ER targeting.........................................................32 3-2 Schematic diagram of p524E GFP Cyt-targeting.....................................................32 3-3 Schematic diagram of the construction of Xa21 cDNA clone pCR504...................33 3-4 Schematic diagram of the construction of pXa21-mTag plasmid............................34 3-5 Cytoplasmic targeting of GFP expression in a mature citrus leaf...........................50 3-6 ER targeting of GFP expression in a mature citrus leaf..........................................51 3-7 Citrus transgenic plant regeneration and GFP monitoring from protoplast to plant..........................................................................................................................52 3-8 in vitro grafting of transgenic Hamlin sweet orange onto nucellar seedlings of Carrizo citrange........................................................................................................54 3-9 Shoot-tip grafting of transgenic Ham lin sweet orange onto Carrizo citrange and/or sour orange....................................................................................................55 3-10 Multiple PCR analysis to detect the presence of the GFP and the cDNA of the Xa21 genes in transgenic citrus plants.....................................................................56 3-11 Southern hybridization analysis of Hamlin sweet orange plants with the cDNA of the Xa21 gene.......................................................................................................57 3-12 Western blotting analysis of transgenic Hamlin sweet orange..............................59 4-1 Schematic diagram of pAO3 plasmid......................................................................64 4-2 Citrus transgenic plant regeneration and GFP monitoring from protoplast to plant..........................................................................................................................73 4-3 ER targeting of GFP expression in a mature citrus leaf..........................................76 x

PAGE 11

4-4 ER targeting of GFP expression in a mature citrus leaf..........................................77 4-5 Multiple PCR analysis to detect the presence of the GFP and the cDNA of the Xa21 genes in transgenic citrus plants.....................................................................81 4-6 Southern hybridization analysis of Hamlin sweet orange plants with the cDNA of the Xa21 gene.......................................................................................................81 4-7 Western blotting analysis of transgenic Hamlin sweet orange..............................82 5-1 Global area of biotech crops.....................................................................................85 5-2 Real-time PCR amplification of endogenous LTP and transgene Xa21 genes........94 5-3 Standard curve of endogenous LTP and transgene Xa21 genes...............................95 5-4 Correlation between the copy numbers in transgenic citrus determined by quantitative RT-PCR and the number of copy /inserts detected with southern blot analysis.....................................................................................................................98 xi

PAGE 12

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOTECHNOLGY AND ITS USES IN IM PROVEMENT OF CANKER RESISTANCE IN CITRUS TREES By Ahmad Al-Sayed Mohamad Omar May 2006 Chair: Jude W. Grosser Major Department: Horticultural Sciences Hamlin sweet orange ( Citrus sinensis (L.) Osbeck) is one of the leading commercial cultivars in Florid a because of its high yield po tential and early maturity. Hamlin also has a high regene ration capacity from protoplasts and is often used in transformation experiments. Citrus canker disease caused by the bacterial pathogen Xanthomonas axonopodis pv. citri is becoming a worldwide problem. The Xa21 gene is a member of the Xa21 gene family of rice that provides broad spectrum Xanthomonas resistance in rice. Since the citrus canker pa thogen is in the same genus, this gene may have the potential to function agai nst canker in citrus. The wild-type Xa21 gene contains an intron, and there is some question as to whether dicot plants can process genes containing monocot introns (t he cDNA is intron free). The development of canker resistant citrus has become an important research objective. Genetic transformation has become a widesp read tool in both basic research and commercial plant breeding programs for dis ease resistance. Plasmid DNA (pARS108) xii

PAGE 13

encoding the non-destructiv e selectable marker Green Fluorescent Protein ( GFP) gene, and the plasmid cDNA of the Xa21 gene (pCR506-mtaq) were co-transformed into Hamlin orange protoplasts using polyethy lene glycol. Also, plasmid DNA (pAO3), encoding the GFP gene and the cDNA of the Xa21 gene, was transformed into Hamlin orange protoplasts. Following protoplast culture in liquid me dium and transfer to solid medium, transformed colonies were microscopically selected via expression of GFP, physically separated from non-transfor med tissue, and cultured on somatic embryogenesis induction medium. More than 150 transgenic embryoids were recovered. Over a thousand transgenic plantlets were regenerated from about 80 independent transformation events. PCR analysis reve aled the presence of the cDNA of the Xa21 and the GFP genes in some of the transgenic plantlets. The recovery of multiple transgenic plants was expedited by in vitro grafting. The transgenic plants have shown normal growth and stable GFP expression for over a year in the greenhouse. Transgenic greenhouse plants include 400 gr owing on different rootstoc ks and over 200 plants on their own roots. This is the first time to report a large population of transgenic Hamlin sweet orange plants using protoplast/ GFP transformation system. PCR analysis revealed the presence of the cDNA of the Xa21 and the GFP genes in the transgenic greenhouse plants. Some of the plants have only GFP. Southern analysis shows integration of the cDNA into different sites ranging from 1-5 sites per plant. Real-Time PCR shows integration of the cDNA into di fferent sites in citrus genom e ranging from 1-4 copies per plant. Western analysis shows th e expression of the cDNA of the Xa21 gene in the transgenic citrus plants. This is the first time that a gene from rice has been stably integrated and expressed in citrus plants. xiii

PAGE 14

CHAPTER 1 INTRODUCTION The importance of emerging biotechnologies in the agriculture industry and the desire to apply science to benefit societ y were among the goals of this study. The significance of the potential benefits biotechnology-base d science offers can be appreciated by considering the tremendous progr ess in plant improvement that has been made in recent years. Recent advances in molecular genetics, informatics, and genomics research have created many new possibiliti es for applying biotec hnology in agriculture. The promise of biotechnology as an instrument of development lies in its capacity to improve the quantity and quality of plants quickly and effectively. The application of biotechnology holds great potentia l for creating plants that are more drought resistant, more tolerant to acidic and saline soils, more resistant to pests (thereby reducing pesticide use), and more resistance to biotic stresses in cluding viral, fungal, and bacterial diseases. Using biotechnology tools in th e agriculture industry can help to supply the world, especially the developing countries w ith enough high quality food and innovative pharmaceutical products, goals that are di fficult to achieve by classical methods. Genetic engineering of agronomically a nd horticulturally important species is creating a new era in agriculture with the first generation of achievements in herbaceous plants already in commercial use and great er prospects on the horizon. The potential of genetic improvement is of great interest to growers of woody fruit plants. Most commercial varieties are propagated vegetativ ely and are hybrids of unknown origin or budsports that have been sele cted by growers and essentiall y cannot easily be improved 1

PAGE 15

2 by traditional breeding methods due to the aspects of their biology including high heterozygosity. Even when traditional breed ing may be effective for crop improvement, there is always a long period of time between generations. Genetic e ngineering allows the insertion of specific genes into the genome of currently successful varieties, theoretically adding desirable traits without othe rwise altering cultivar integrity. Citrus fruits taste good and are a well-know n source of vitamin C and antioxidants. Moreover, several epidemiological studies ha ve shown that citrus fruits and their components are protective against a variety of human cancers (Tian et al., 2001; Manthey and Guthrie, 2002; Rafter, 2002; Kim et al., 200 5). Processed citrus peel and pulp is a valuable, high energy by-product that can partly re place cereal grains in animal diets without adverse effect on their products (i.e., milk in terms of yield or composition) (Fegeros et al., 1995). Because of its nutritional relevance, citrus is an important industry worldwide, raising economies at macro and lo cal levels by supporti ng social development directly with jobs and secondary industries and services. Citrus fruits are produced in many countries around the world, although produc tion shows geographi cal concentration in certain areas, primarily within tropical a nd subtropical regions (w ithin 40 north-south latitude). Mediterran ean countries are the leading produ cers for the international fresh market. The total production has systematically increased in the last four decades, and, more recently reached more than one hundred million tons yearly (Table 1-1) (Anonymous, 2005). It is not only the quantities of c itrus that are important, but also the quality of the fruit. Implementation of modern technology in citrus production has improved efficiency, flexibility, and resulted in high quality standards. As a result of

PAGE 16

3 trade liberalization and technological advances in fruit transport and storage, the citrus fruit industry has become more global in scope. The exact center of origin of citrus is not clearly identified, although most researchers place it in SouthEast Asia, at least 4000 year s BC (Davies and Albrigo, 1994). The spread of citrus fruits from Asia to Europe was initially slow. The Arabs introduced the citron, the sour orange, the lemon, and the shaddock into Spain and the countries of North Africa (Reuther et al., 1967). Probably after the fall of the Roman Empire, citrus was introduced to the South of Europe, and its availa bility expanded in the Middle Ages. Citrus was first brought to the new world by the Spanish and Portuguese explorers at the beginning of the fifteen century (Allen, 2000) By the second half of the nineteen century, the fresh fruit companie s had been established, and the frozen concentrated technology, developed in the 1940s in Florida (Lewandowski, 2000), increased the demand for citrus juices. To achieve and maintain an adequate le vel of quality, many changes in production systems were necessary to meet the ongoing needs of growing markets and the demands of new challenges, such as changes in biol ogical concerns, unexpected drought and cold stresses, outbreaks of pests and diseases, and establishment of economic and political barriers. Consequently, producti on constraints have been overcome by the use of grafted plants to replace seedlings, changes in root stocks, and selection of new cultivars. The application of biotechnology t ools such as somatic hybridization, somaclonal variation, embryo rescue, cytology, and genetic transformation should accelerate the production of improved varieties. Such varieties are expected to help the industry overcome barriers to production and to help create new marketing opportunities.

PAGE 17

4 Available literature suggests that the n eed for innovative rese arch and the use of biotechnology tools in citricul ture are not recent events. In fact, despite frequent new challenges in the last decade, citrus produc tion has exceeded other important fruit crops such as bananas, apples, and grap es according to FAO (Anonymous, 2005). Egypt produces a significant amount of high quality citr us fruits in the world, producing approximately 2.56 million tons in 2004 (ranking number ten in citrus production (Table 1-1)). The breakdown of citrus production in Egypt is as follows: sweet oranges 68%, tangerine and mandarin 20%, lemons and limes 12%, and grapefruit and pummelos less than 1%. The citrus-plant ed area has expanded over the last three decades to reach about 143,883 Ha (Anonymous, 2005). Table 1-1. Total production of citrus fruit (Mt) Country Production (Mt) Metric ton Brazil 20,594,000 United States of America 14,907,660 China 14,654,875 Mexico 6,475,411 Spain 6,206,800 India 4,750,000 Islamic Republic of Iran 3,825,000 Nigeria 3,250,000 Argentina 2,690,000 Egypt 2,561,600 Others 28,620,142 Total (The World) 108,535,488

PAGE 18

CHAPTER 2 REVIEW OF LITERATURE Citrus Canker Asiatic citrus canker (ACC) is one of the most economically damaging plant diseases affecting citrus worldwide. ACC is caused by the bacterial pathogen Xanthomonas axonopodis pv. citri ( Xac ) (syn. X. citri X. campestris pv. citri ). The citrus canker pathogen can affect the majority of the commercial citrus varieties and close relatives of citrus in the family Rutaceae worldwide where moist, subtropical to tropical climates occur. All above ground tiss ues of citrus are susceptible to Xac when they are young, and maximum susceptibility occurs during the last half of the expansion phase of growth (Gottwald and Graham, 1992). The disease symptoms appear as distinctive ne crotic raised lesions on leaves, stems, and fruits. Severe infections can cause defoliation, blemished fruit, premature fruit drop, twig dieback, and general tree decline (Schubert et al., 2001). Stall et al. (1982) reported that once leaves, twigs and fruit reach mature size and begin to harden off physiologically, they become mo re resistant to natural stomatal infection but may be subject to wound infection (Schubert et al., 2001). The disease spreads rapidly in situations in which high wind, rain, and warm temperatures occur at the same time as new shoots and fruit emerge (Gabriel, 2001). Among citrus cultivars, grapefruit is the most susceptible to citrus canker followed by sweet oranges Hamlin, Pineapple a nd Navels, Mexican (Key) lime, and the hybrids of trifoliate orange used as rootst ocks (Gottwald et al., 2002). These cultivars 5

PAGE 19

6 have proven to be very difficult to grow pr ofitably in the presence of the citrus canker pathogen in moist subtropical and tropical climates due to high production costs linked with windbreaks and additional foliar sprays of copper bactericides (Graham, 2001; Gottwald et al., 2002). There are different forms of citrus b acterial canker (CBC) based on different pathogenicities of the bacteria (Cubero and Graham, 2002). The Asiatic type of canker (A type), caused by a group of strains orig inally found in Asia, is by far the most widespread and severe form of the disease. This is the group of X. axonopodis pv. citri strains that causes the disease most referred to as Asiatic citrus ca nker (Gottwald et al., 2002). It is the most virulent form and aff ects the majority of susceptible hosts. The CBC B and C types are caused by X. axonopodis pv. aurantifolii Pathotype B strains are most severe on lemons ( Citrus limon (L.) Burm f.), and are f ound only in Argentina, Uruguay, and Paraguay. Pathotype C strains have b een found in Sao Paulo, Brazil on Key lime ( Citrus aurantifolii (Christm.) Swingle) (Schubert et al., 2001). Vernire et al. (1998) isolated and characterized a new strain of X. axonopodis pv. citri designated as A* from southwest Asia. This strain can infect only Key lime and is closely related to type A strains. A similar strain has been isolated from Florida and designated as A w (Sun et al., 2000). This strain has a restricted host range that includes Key lime and alemow ( Citrus macrophylla Wester). Replacing the susceptible varieties by field resistant cultivars seems to be the best long-term solution. Even though classical selec tion or breeding for canker resistance is a promising solution, it is excessively time c onsuming. Genetic transformation could be a

PAGE 20

7 useful alternative, since the resistance gene could be introduced into the susceptible cultivars without otherwise altering cultivar integrity. Methods of Transformation Plant genetic transformation is a powe rful application used to study gene expression in plants. It has contributed substa ntially to the understa nding of gene function and the regulation of physiological and devel opmental processes, in the generation of transgenic organisms for widespread usage in agriculture, and has in creased the potential uses of plants for industrial and pharmaceuti cal purposes. The powerful combination of genetic engineering and conventional breed ing programs permits the introduction of useful traits encoded by transgenes into comm ercial crops within an economically viable time frame. There is great potential for ge netic manipulation of crops to enhance productivity through increasing resistance to diseases, pests, and environmental stress (Hansen and Wright, 1999). Advances in tissu e culture, combined with improvements in transformation technology, have resulted in increased transformation efficiencies. Successful plant transformation systems requi re that certain criteria be met. Among the requirements for transformation are ta rget tissues capable of propagation or regeneration, an efficient DNA delivery method, agents to select for transgenic tissues, the ability to recover transgenic plants at a reasonable frequency, a simple, efficient, reproducible, genotype-independent and cost-effective process, and a short time frame in culture to avoid somaclonal variation and possible sterility (Hansen and Wright, 1999). There are three techniques that a ppear to meet these criteria: (1) Agrobacteriummediated transformation, (2) biolistics or microprojectile bombardment, and (3) protoplast transformation.

PAGE 21

8 Arobacterium tumefaciens -Mediated Transformation About three decades ago, the concept of using Agrobacterium tumefaciencs as a vector to create transgenic plants was cons idered as a prospect and a wish. Today, many agronomically and horticulturally important species are routinely transformed using this bacterium. Agrobacterium tumefaciencs is the pathogen that caus es crown gall disease in many plant species. The infection cycle of Agrobacterium is very complex, involving a number of signals emitted by both host and the pathogen (Gelvin, 2003). The virulent strains of A. tumefaciencs contain large plasmids that are responsible for the DNA transfer that subsequently causes the gall fo rmation. This plasmids have been termed tumor-inducing or Ti plasmids (Sche ll et al., 1979; Chilton et al., 1980). The transformed DNA (T-DNA) is referred to as the T-region that is located on the Ti plasmid. T-regions on native Ti are approx imately 10 to 30 kbp in size (Barker et al., 1983; Suzuki et al., 2000). Thus, T-regions ge nerally represent less than 10% of the Ti plasmid. Some plasmids contain one T-re gion, whereas the others contain multiple T-regions (Barker et al., 1983). T-regions are specified by TDNA border sequences. These borders are 25 bp in length and highl y homologous in sequen ce (Yadav et al., 1982). In general, the T-DNA borders specify the T-DNA, because these sequences are targets of the VirD1/ VirD2 border specific endonuclease that processes the T-DNA from the Ti plasmid (Gelvin, 2003). Th ere are many proteins encoded by vir genes that play essential roles in the Agrobacterium -mediated transformation process (Christie, 1997; Gelvin, 2000; Zupan et al., 2000; Tzfira and Citovsky, 2002). The T-DNA becomes covalently integr ated into plant nuclear DNA. T-DNA contains two types of genes: the oncogenic genes, encoding for enzymes involved in the synthesis of auxins and cyt okinins and responsible for tu mor formation; and the genes

PAGE 22

9 encoding for the synthesis of opines. These compounds, produced by condensation between amino acids and sugars, are synthesi zed and excreted by the crown gall cells and consumed by A. tumefaciens as carbon and nitrogen sour ces. Located outside the T-DNA are genes for opine catabolism, the genes invo lved in the process of T-DNA transfer from the bacterium to the plant cell and the genes involved in bacterium-bacterium plasmid conjugative transfer (de la Riva et al., 1998). The proce ss of gene transfer from Agrobacterium tumefaciens to plant cells could be summarized as follows: (1) bacterial colonization, (2) induction of bacterial virulence system, (3) generation of T-DNA transfer complex, (4) T-DNA transfer, and (5) integration of T-DNA into plant genome (de la Riva et al., 1998). The T-DNA transf er is mediated by products encoded by the 30-40 kb vir region of the Ti plasmid. This region is composed of at least six essential operons ( virA, virB, virC, virD, virE, virG ) and two non-essential ( virF, virH) (Iuchi, 1993). The activation of vir genes produces the generation of single-stranded (ss) molecules representing the copy of the bottom T-DNA strand. Any DNA placed between T-DNA borders will be transferred to the plant cell as single strand DNA and integrated into the plant genome. These are the only cis acting elements of the T-DNA transfer system. The proteins VirD1 and VirD2 play a key role in this step, recognizing the TDNA border sequences and nick ing (endonuclease activity) th e bottom strand at each border (Zupan and Zambrysk i, 1995; Christie, 1997). Inside the plant cell, the ssT-DNA complex is targeted to the nucleus crossing the nuclear membrane. Among the vir proteins, two have been found to be important in this step VirD2 and VirE2 (the most important); and a third, VirF that probably has a minor contribution to this process (Hooykaas and Sh ilperoort, 1992). The final step of T-DNA

PAGE 23

10 transfer is its integration into the plant genome. The mechanism involved in the T-DNA integration has not been completely characteri zed. It is considered that the integration occurs by illegitimate recombination (Lehman et al., 1994; Puchta, 1998). To use the Agrobacteriummediated system, the optimization of Agrobacterium tumefaciensplant interaction is probably the most important feature to be considered. This interaction could incl ude the wholeness of the b acterial strain, its correct manipulation, and the study of reaction in w ounded plant tissue, which may develop in a necrotic process in the wounded tissue or affect the interacti on and release of inducers or repressors of the Agrobacterium virulence system. The type of explant is also an important fact and it must be suitable fo r regeneration allowing th e recovery of whole transgenic plants. The establ ishment of a method for the efficient regeneration of one particular species is all-im portant for its transformation. The Agrobacterium system is attractive because of the ease of the protocol coupled with minimal equipment costs. Moreover, tran sgenic plants obtained by this method often contain single copy insertions (Hansen and Wright, 1999). At present, many species both monocotyledonous and dicotyledonous have been transformed using Agrobacterium mediated transformation system. In citrus, ma ny researchers reported using the system to transfer different genes into different citrus cultivars. Pea et al. (1995b) used A. tumefaciens EHA105 carrying the binary ve ctor p35SGUSINT that encodes -glucuronidase ( GUS ) gene as a reporter and the ne omycin phosphotransferase II ( NPT II) gene for resistance to kanamycin as a sel ectable marker to tran sform Carrizo citrange stem segments. Embryogenic calluses of Ponkan mandarin has been transformed with a ribonuclease gene using the Agrobacteriun -mediated system (Li et al., 2002). Many

PAGE 24

11 transgenic citrus plants have been obtained by Agrobacterium tumefaciens -mediated transformation system among them grapefruit (Luth and Moore, 1999), Swingle citrumelo ( Citrus paradise Macf. X Poncirus trifoliate L. Raf.) (Molin ari et al., 2004), Washington navel orange (Bond and Roose, 1998), sour orange ( Citrus aurantium L.) (Gutirrez et al., 1997), sweet ora nge (Pea et al., 1995a), lime ( Citrus aurantifolia Swing.) (Pea et al., 1997), and Hamlin ora nge (Mendes et al., 2002; Yu et al., 2002; Boscario et al., 2003). Carrizo citr ange has been transformed via Agrobacterium mediated with the halo-tolerance gene HAL2 originally isolated from yeast and implicated in salt tolerance mechan isms (Cervera et al., 2000). Thus, Agrobacterium mediated transformation has been establishe d for many citrus cultivars by using either embryogenic cell suspension cultures or stem explants. Although Agrobacterium -mediated transformation has been a reliable and efficient system for transforming many dicotyledonous sp ecies, citrus seems to be less amenable to Agrobacterium -mediated gene transfer. Moore et al (1992) suggested that the limiting step in the production of transgenic citrus shoots was the low DNA transfer efficiency; only 4 to 8% of the inoculated explants contained GUS -positive sectors. By comparison, a much higher transfer efficiency has been achieved with fruit crops, including apple 80% (Yao et al., 1995) and kiwifru it 66% (Janssen and Gardner, 19 93). So, it may be useful to explore other DNA transfer systems for certain citrus cultivars. Biolistics or Microprojectile Bombardment The ability to deliver foreign DNA directly into regenerable cells, tissues, or organs was one of the best methods to achieve tr uly genotype-independent transformation in many agronomic crops, bypassing Agrobacterium host-specificity and tissue culture-related regeneration difficultie s. Microprojectile bombardment employs

PAGE 25

12 high-velocity metal particles (tungsten or gol d) to deliver biologi cally active DNA into plant cells (Sanford, 1988). Klein et al. (1987) observed that tungsten particles could be used to introduce macromolecules into epider mal cells of onion with subsequent transient expression of enzymes encoded by these compo unds. Christou et al. (1988) demonstrated that this process could be used to delive r biologically active DNA into living cells and produce stable transformants. Moreover, bom bardments can even be performed using desiccated bacteria (as microprojectiles) containing the gene to be transferred (Rasmunssen et al., 1994). Combining the relative ease of DNA introduction into plant cells with an efficient regeneration protocol not requiring protoplast or suspension cultures, particle bombardment is the optimum system for transformation in many cereals (in which protoplast culture is difficult), as well as dicots which can be recalcitrant to Agrobacterium infection. Gray and Finer (1993) desc ribed several advantages for particle bombardment over Agrobacterium -mediated transformation: (1) non-hosts of Agrobacterium such as monocots, can be transformed, (2) plasmid construction does not require insertion of the sequences essential for DNA replication and transfer in Agrobacterium (3) the introduction of multiple plas mids, Co-transformation, is possible with particle bombardment, (4) false positives resulting from growth of the Agrobacterium in host cells are eliminated, and (5) the transformation protocols are easy by eliminating the complex bacteria-pla nt interaction present with the Agrobacterium system. On the negative side, plants regenera ted from bombarded plant tissues are usually chimeric in terms of introduced foreign ge nes due to random bombardment of a small number of cells in a multiple cell system (Sanford, 1990). Researchers have overcome

PAGE 26

13 this problem by using different selectable mark er genes to sort out transformants that are stabilized in their proge nies (Lowe et al., 1995). Particle bombardment has made it possible to transfer foreign DNA into organelles. Watsona et al. (2004)) reported on the introduction and transient expression of foreign genes in suspension cell-derived chloroplas ts of tobacco. Chloroplast transformation systems offer unique advantages in biotechnol ogy, including a high level of foreign gene expression, maternal inheritance, and polyc istronic expression (Kang et al., 2004) In citrus, particle bombardment has been used to transform tangelo ( Citrus reticulata x Citrus paradisa ) embrogenic cells. Although fifteen transgenic embryo lines were reported, no transgenic plants were obtained (Yao et al., 1996). The bombardment of epicotyl thin explants has been used by F ilho et al. (2003) for stable transformation of Carrizo citrange and sweet orange. Protoplast Transformation Protoplasts are cells (plant, fungal, or bacterial) that have had their cell walls removed. This can be done either by a mechan ical or an enzymatic process. The naked cells are surrounded only by a cell membrane and can be used in a variety of ways. This results in the production of a suspension containing millions of individual cells and therefore offers the advantage of probable si ngle cell targets. Protoplasts are frequently obtained from an established suspension cell line of callus initiated from immature embryos, immature inflorescences, mesoco tyls, immature leaf bases and anthers (Maheshwari et al., 1995). Protoplas ts can either be transformed by Agrobacterium or by direct DNA uptake methods, facilitated by polyethylene glycol treat ment, electroporation or liposomes (Shillito, 1999). DNA uptake in to protoplasts is now a routine and universally accepted procedure in plant bi otechnology for introducing and evaluating

PAGE 27

14 both short-term (transient) and long-term (s table) expression of genes in cells and regenerated plants (Davey et al., 2005b). Mo reover, direct DNA uptake into plant cells has been especially important in transformi ng plants that are not amenable to other methods of gene delivery, particularly, Agrobacterium -mediated transformation (Rakoczy-Trojanowska, 2002). Protoplasts ar e ideal candidate cells for direct DNA uptake and the subsequent sel ection of transgenic events. DNA could be delivered into protoplast cells by either chemical (Pol yethylene glycol (PEG)-mediated) or electroporation. Protoplasts have been transformed with Ti plasmid from Agrobacterium tumefaciens, and genes carried on a simple E. coli-based cloning vector which confirmed that Ti-DNA borders were not important fo r DNA integration into the plant genome (Davey et al., 1989). Songstad et al. (1995) repo rted that the efficiency for recovery of transgenic events is higher because cross feeding and chimerism between transgenic and wild-type cells are minimized in compar ison to transformation systems based on multicellular tissues. However, Davey et al. (2005a) stated that protoplast transformation frequencies remain low (one in 10 4 protoplast giving stably transformed tissues), and protoplast-to-plant systems with efficient selection need to be improved to recover transformed cells and tissues. Protoplasts can be co-transformed with more than one gene carried on the same or separate plasmids. There are many factors that influence protoplasts transformation, with the stage of the cell cycle probably being the most important factor. Some treatments could enha nce transformation frequency, such as heat shock treatment and irradiation of recipi ent protoplasts, probably by increasing the recombination of genomic DNA with incoming foreign DNA, or the initiation of repair mechanisms that favor integration. Carrier DNA and the nature of the plant genome also

PAGE 28

15 affect transformation (Davey et al., 2000). DNA fragment size can influence stable transformation frequencies (Fleming et al ., 1995). Since plants regenerated from protoplast come from a single cell, all cells in the transgenic plant are expected to contain inserted gene(s) of interest. There are many studies utilizing protoplas t procedures for efficient delivery of plasmids into suspension culture-derived pr otoplasts and optimiza tion of protoplast-toplant systems. Many such studies focused on cereals, particularly rice (Davey et al., 2005a). Polyethylene glycol (PEG) has been us ed to induce DNA uptake into protoplasts isolated from tobacco ( Nicotiana tabacum ) (Uchimiya et al., 1986; Jarl and Rietveld, 1996), Arabidopsis thaliana (Damm et al., 1989), Datura inoxia (Schmidt-Rogge et al., 1993), wheat ( Triticum aestivum L.) (Marsan et al., 1993), rice (Alam et al., 1995; Chair et al., 1996), barley (Nobre et al., 2000), sugarbeet (D ovzhenko and Koop, 2003), apple (Maddumage et al., 2002), sweet potato (Garcia et al., 1998 ; Winfield et al., 2001), and citrus (Vardi et al., 1990; Fleming et al ., 2000; Guo et al., 2005). The direct-genemediated method results in more multiple a nd rearranged copy number of the transgene in transgenic plants than does Agrobacterium (Dong et al., 1996; Krasnyanski et al., 1999) DNA can be delivered into protoplasts isolated from different plant species using several different tec hniques (Table 2-1). As nucleases may block DNA uptake into isolated protoplasts, experiments have been undertaken to reduce DNA damage duri ng transformation. Folling et al. (1998) studied PEG-mediated DNA transfer into protoplasts of Lolium perenne and reported that plasmids were protected by a combination of high pH (9.0) and reduced temperature (0 C), since such conditions suppressed DNA nicking and improved transformation

PAGE 29

16 efficiency. The same authors showed that two nucleases usually associated with isolated protoplasts were involved with DNA degrada tion, with one being released into the medium and the other localized to the plasma membrane. Electroporation is used to produce stable ge netic transformants using protoplasts as target cells (Table 2-1). El ectroporation conditions were optimized for transfection of protoplasts isolated from an embr yogenic line of Hamlin orange (Citrus sinensis (L.) Osbeck) and to obtain stable transg enic plants (Niedz et al., 2003). There are several advantages from usi ng transformation technology as a tool to generate new cultivars. First, transgenic lines expressing variable levels of resistance can be selected. For example, some Xa21 transgenic rice lines have shown increased resistance to Xanthomonas oryzae pv. oryzae ( Xoo ) as compared with the donor line (Song et al., 1995). Second, transformation techni ques can be used to improve valuable cultivars currently containing some quantita tive or qualitative resistance to disease leading to increased durability (Wang et al., 1994). Third, transformation results in the modification of a few well-de fined genetic elements, whereas sexual recombination might lead to the introgression of undesira ble genes involved in the production of allergens or toxins, if these genes are linked to the traits of interest (Breiteneder and Radauer, 2004). Finally, intervar ietal, interspecific, or inte rgeneric gene transfer would bypass sterility problems common to inte rspecific hybridization (Ronald, 1997). Plant Resistance (R) Proteins More than 30 resistance genes have b een cloned from both monocotyledonous and dicotyledonous plants (Nurnberger and Sch eel, 2001). The majority of resistance (R) proteins that are activated upon effector recognition are classified into five different classes based primarily upon their combination of a limited number of structural motifs

PAGE 30

17 (Table 2-2) (Martin et al., 2003). Class 1 consists of just one member, Pto from tomato, which has a serine/threonine ki nase catalytic region and a my ristylation motif at its N terminus. Class 2 contains a large number of proteins having a region of leucine rich repeats (LRRs), a putative nucleotide binding site (NBS), and an N-terminal putative leucine-zipper (LZ) or other coiled-coil (CC) sequence. Class 3 is similar to class 2, but instead of the CC sequence, these proteins have a region with similarity to the N terminus of the Toll and Interleukin 1 receptor (IL-1R) proteins (therefore referred to as the TIR region). The R proteins belonging to the firs t three classes lack transmembrane (TM) domains and all are thought to be localized intracellularly. The Cf proteins from tomato form class 4. They lack an NBS and instead have a TM and an extracellular LRR, and a small putatively cytoplasmic tail without obvious motifs. Finally, class 5 consists of just the Xa21 protein from rice that in addition to an extracellular LRR and a TM, has a cytoplasmic serine/threonine kinase region. The Xa21 is the only known resistance gene that encodes three structural features found in various combin ations in other resistance gene products (Century et al., 1999). Thus, R proteins in the five major classes rely on a limited number of structural and functional dom ains, of which the LRR appears to play a central role. A few R proteins do not fit into these five clas ses and form class 6 (Table 2-2). Figure (2-1) shows schematic representation of diffe rent genetically defined plant resistance proteins The structural similarity of diff erent R genes could suggest a common or limited number of resist ance pathways in plants. Resistance genes from monocots and dicots are highly conserved, suggesting th at they share common functional domains (Song et al., 1995). This suggests the possibili ty of using monocot R genes to control dicot diseases.

PAGE 31

18 Table 2-1. Examples of plant protoplast transformation experiments and success of transgenic plant recovery. Plant Transformation Method Transgenic plant obtained References Tobacco Liposome-mediated Yes (Deshayes et al., 1985) Tobacco ( Nicotiana tabacum) PEG a Yes (Uchimiya et al., 1986) Tomato ( Lycopersicon esculentum ) Calcium phosphate/ PEG a or PVA b No (Jongsma et al., 1987) Rassica campestris Agrobacterium No (Ohlsson and Eriksson, 1988) Arabidopsis thaliana PEG a Yes (Damm et al., 1989) Solanum-dulcamara Electroporation/ Agrobacterium Yes (Chand et al., 1989) Tobacco Liposomes Yes (Zhu et al., 1990) Citrus PEG a Yes (Vardi et al., 1990; Fleming et al., 2000) Tobacco ( N. tabacum N. debneyi and N. rustica) Agrobacterium tumefaciens Yes (Dijak et al., 1991) Sugarcane Electroporation Yes (Rathus and Birch, 1992) Pea Electroporation No (Puonti Kaerlas et al., 1992) Datura inoxia PEG a Yes (Schmidt-Rogge et al., 1993) Maize ( Zea mays L.) Electroporation Yes (Sukhapinda et al., 1993) Wheat ( Triticum aestivum L.) PEG a Yes (Marsan et al., 1993) Citrus Electroporation No (Hidaka and Omura, 1993) Wheat ( Triticum aestivum L.) Electroporation Yes (He et al., 1994) Citrus Electroporation No (Niedz et al., 1995) Indica rice PEG a Yes (Alam et al., 1995) Tobacco ( Nicotiana tabacum) PEG a / Electroporation Yes (Jarl and Rietveld, 1996) Rice ( Oryza sativa L.) PEG a Yes (Chair et al., 1996) Creeping bentgrass ( Agrostis palustris Huds.) PEG a Yes (Lee et al., 1996) Linum usitatissimum and L. suffruticosum PEG a / Agrobacterium Yes (Ling and Binding, 1997) Peucedanum terebinthaceum PEG a Yes (Wang et al., 1999) Barley PEG a Yes (Nobre et al., 2000) Barley Microinjection Yes (Holm et al., 2000) Barley (Hordeum vulgare L.) PEG a No (Tiwari et al., 2001) Apple ( Malus domestica Borkh.) PEG a No (Maddumage et al., 2002)

PAGE 32

19 Table 2-1. Continued Plant Transformation Method Transgenic plant obtained References Festuca arundinacea PEG a Yes (Bettany et al., 2002) Cauliflower ( Brassica oleracea var. botrytis) PEG a Yes (Radchuk et al., 2002) Citrus Electroporation Yes (Niedz et al., 2003) Brassica napus Agrobacterium Yes (Wang et al., 2005) Citrus PEG a Yes (Guo et al., 2005) a PEG = Poly-Ethylene Glycol b PVA = Poly-Vinyl Alcohol Among the cloned plant resistance gene s, only three have shown a physical interaction between a resistance protein and the corresponding avirulence (Avr) gene product, Pto in tomato (Tang et al., 1996), Pi-ta in rice (Jia et al., 2000), and RRS1 in Arabidopsis (Deslandes et al., 2003). Mode of Action of the Xa21 The Xa21 gene is a member of a multigene family containing seven members, grouped into two classes based on sequ ence similarity (Song et al., 1997). The Xa21 class contains members Xa21, D and F; and class A2 contains A1, A2, C and E. The identity of nucleotide sequence within each class is very high (98% for Xa21 class and 95.2% for A2 class), but only 63.5% of the identity was observed between the two classes (Song et al., 1997). The Xa21 gene is located on rice chromosome 11 (Ronald et al., 1992; Song et al., 1995). The Xa21 confers resistance to over 30 di stinct strains of the bacterium Xanthomonas oryzae pv. oryzae ( Xoo ), which causes leaf blight in rice (Wang et al., 1996; Hammond-Kosack and Jones, 1997). The Xa21 encodes a 1025-amino acid protein that revealed a novel class of plant disease resistance gene products with several regions exhibiting similarity to known protein domains (Table 1-2 and Figure 2-1). The amino terminus of the Xa21 protein encodes 23 hydrophobic residue s characteristic of a signal

PAGE 33

20 peptide. The central core of the Xa21 contains 23 imperfect copies of a 24 amino acid (extracytoplasmic LRRs) with numerous poten tial gycosylation sites. The LRRs are followed by a 26 amino acid hydrophobic stretch that likely forms a membrane spanning helix tarnsmembrane domain (TM). The carboxy l terminal sequence encodes a putative interacellular serine/threoni ne kinase (STK) domain. This region carries the 11 subdomains and all 15 invariant amino acid di agnostic of protein kinases (Song et al., 1995). Thus, compared with the proteins enco ded by other cloned plant disease-resistance genes, the structure of Xa21 protein is unique because it contains the extracellular receptor LRR domain and the intracellular kinase domain. Based on models of mammalian receptor kinases (RKs), (Ronald, 1997; Wang et al., 1998) proposed a model for Xa21-mediated resistance as follows: first the LRR domain binds a polypeptide produced by the path ogen or plant cell. This specific binding would cause receptor dimerization, activation of the intracellular kinase domain, and subsequent phosphorylation on spec ific serine or threonine residues. Liu et al. (2002) demonstrated that the intracellular domain encoded by the rice disease resistance gene Xa21 is an active serine/threonine kinase capab le of autophosphorylation. The same authors suggested that Xa21 can initiate multiple defense responses by the binding of distinct signaling proteins with specific phosphorylated residues onto Xa21 kinase. Phosphorylated residues may then serve as bind ing sites for proteins that can initiate downstream responses. This reaction may l ead to phosphorylation of transcription factors. Upon phosphorylation, the transcription factors can m ove into the nucleus from the cytosol.

PAGE 34

21 Figure 2-1. Schematic representa tion of different genetically defined plant resistance proteins. Protein structures named above are examples of R proteins in their respective class. Proteins are shown in relation to the plant plasma membrane. LRR, leucine-rich repeat; Kinase domain, serine/threonine kinase catalytic core; NBS, nucleotide bibdibg site; TM, transmembrane domain; TIR, Toll/Interleuken 1-re ceptor-like; WRKY, W-box DNA binding domain (Nimchuk et al., 2003)

PAGE 35

22 Table 2-2. Plant disease resistan ce (R) proteins and their pred icted structure (Hulbert et al., 2001; Martin et al., 2003) Class/*R Protein Predicted protein structure Plant Pathogen(s) or Pest(s) Effector(s) 1 Pto Protein Kinase Tomato Pseudomonas syringae (B) AvrPto, AvrPtoB 2 Bs2 NBS-LRR Pepper Xanthomonas campestris (B) AvrBs2 Dm3 NBS-LRR Lettuce Bremia lactucae (F) Gpa2 NBS-LRR Potato Globodera pallida (N) Hero NBS-LRR Potato G. rostochiensis G. pallida (N) HRT NBS-LRR Arabidopsis Turnip Crinkle Virus Coat Protein I2 NBS-LRR Tomato Fusarium oxysporum (F) Mi NBS-LRR Tomato Meloidogyne incognita (N) Mi NBS-LRR Tomato Macrosiphum euphorbiae (I) Mla NBS-LRR Barley Blumeria graminis (F) Pib NBS-LRR Rice Magnaporthe grisea (F) Pi-ta NBS-LRR Rice M. grisea (F) AVR-Pita R1 NBS-LRR Potato Phytophthora infestans (O) Rp1 NBS-LRR Maize Puccinia sorghi (F) RPM1 NBS-LRR Arabidopsis P. syringae (B) AvrRpm1 RPP8 NBS-LRR Arabidopsis Peronospora parasitica (O) RPP13 NBS-LRR Arabidopsis P. parasitica (O) RPS2 NBS-LRR Arabidopsis P. syringae (B) AvrRpt2 RPS5 NBS-LRR Arabidopsis P. syringae (B) AvrPphB Rx1 NBS-LRR Potato Potato Virus X Coat Protein Rx2 NBS-LRR Potato Potato Virus X Coat Protein Sw-5 NBS-LRR Tomato Tomato Spotted Wilt Virus Xa1 NBS-LRR Rice X. oryzae (B) 3 L TIR-NBS-LRR Flax Melampsora lini (F) M TIR-NBS-LRR Flax M. lini (F) N TIR-NBS-LRR Tobacco Tobacco Mosaic Virus Helicase P TIR-NBS-LRR Flax M. lini (F) RPP1 TIR-NBS-LRR Arabidopsis P. parasitica (O) RPP4 TIR-NBS-LRR Arabidopsis P. parasitica (O) RPP5 TIR-NBS-LRR Arabidopsis P. parasitica (O) RPS4 TIR-NBS-LRR Arabidopsis P. syringae (B) AvrRps4 4 Cf-2 LRR-TM Tomato Cladosporium fulvum (F) Avr2 Cf-4 LRR-TM Tomato C. fulvum (F) Avr4 Cf-5 LRR-TM Tomato C. fulvum (F) Cf-9 LRR-TM Tomato C. fulvum (F) Avr9 5 Xa21 LRR-TM-Kinase Rice Xanthomonas oryzae (B) 6 Hm1 Toxin reductase Maize Cochliobolus carbonum (F) HS1 Unique Beet Heterodera schachtii (N) mlo Membrane prot. Barley B. graminis (F) Rpg1 Barley Puccinia graminis (F) RPW8 Unique Arabidopsis Erisyphe chicoracearum (F)

PAGE 36

23 Table 2-2. Continued Class/*R Protein Predicted protein structure Plant Pathogen(s) or Pest(s) Effector(s) RRS1R Arabidopsis Ralstonia solanacearum (B) RTM1 Arabidopsis Tobacco Etch Virus RTM2 Arabidopsis Tobacco Etch Virus Ve1, Ve2 Tomato Verticillium alboatrum (F) R protein = Resistance protein Abbreviated as: B, bacterium; F, fungus; I, insect; N, nematode, O, oomycete. NBS, nucleotide binding site; LRR, leucine-rich repeat; TIR, domain with homology to the Toll gene of Drosophila and the Interleukin-1 receptor of mammals; TM, transmembrane domain. Domains are listed as they appear in the proteins from N to C terminal end (Hulbert et al., 2001) The avrXa21-derived ligand might have a novel molecular identity, because Xanthomonas oryzae pv. oryzae is predominantly a xylem vessel colonizing bacterium. Conceivably, it is delivered extracellularly, unlike other bacterial avr products, in which case the Xa21 LRRs might be involved in the re cognition (Hammond-Kosack and Jones, 1997). The LRR is involved in pr otein-protein interactions. Xa21D is a Xa21 family member that lacks the transmembrane and ki nase domains, but encodes a receptor-like protein carrying LRR motifs in the presumed extracellular domain (Wang et al., 1998). In transgenic rice plants, Xa21D conferred partia l resistance to Xoo at an intermediate level compared with that of Xa21 but showed the same spectrum of resistance as Xa21. However, other members (A1, A2, C, E, F) did not confer any resistance in transgenic plants (Wang et al., 1998). These results suggest that the extracellular LRR domain of Xa21D is involved in pathogen recognition. It was observed that several de fense responses were initiate d in transgenic rice cells expressing a fusion gene composed of the ex tracellular LRR and transmembrane domains of the Arabidopsis receptor kinase BRI1 and the serine/thre onine kinase of Xa21 upon treatment with brassinosteroids, which is the ligand for the BRI1-encoded protein kinase

PAGE 37

24 (He et al., 2000). These results indicated th at the extracellular LRR domain of the Xa21 protein functions in recognition of the Xoo avr proteins and it s interacelluar serine/threonine kinase domain transmits the signal to activate the defense mechanism. The cloning of two plant resistance ge nes encoding serine threonine kinase supports a central role for protein phosphoryl ation in gene-for-gene mediated disease resistance (Martin et al., 1993; Song et al., 1995). The seri ne/threonine kinase capacity possessed by Pto and Xa21 could clearly facilitate dow nstream signaling by a distinct mechansim. A lysine residue is conserved in all protein kinases and is important for phosphor-transfer for both Pto and Xa21 (Andaya and Ronald, 2003). The kinase domain of the rice Xa21 gene product is the most homologous to that of the Arabidopsis protein RLK5 When RLK5 was used in an interaction cloni ng system, a type 2C phosphatase was identified (Stone et al., 1994). Moreover for many gene-mediated resistances, the addition of either kinase or phosphatase inhibitors significant ly blocked the induction of rapid defense responses (Levine et al., 1994; Dunigan and Madlener, 1995). It appears likely that both kinases and phosphatases are in volved in downstream R protein-mediated signaling events. The kinase domain of Xa21 is functional serine/threonine kinase (STKs) (Liu et al., 2002). The same authors confirmed the serine/threonine specificity of Xa21 kinase by phosphoamino acid assays. In these assays, serine and threonine residues were phosphorylated, whereas no detectable tyrosine residues were marked. Also, they showed that the autophophorylated Xa21 kinase can be dephosphorylat ed by the serine/threonine phosphatase PP1. These results indicated that Xa21 kinase carries serine/threonine specificity. By phosphopeptide mapping approaches Liu et al. (2002) demonstrated that

PAGE 38

25 at least 20 of 27 phosphospots on the GST-Xa 21K (Glutathions Stransferase-Xa21K) peptide map were because of autophosphorylation of Xa21 kinase. These observations strongly suggest that multiple residues on Xa21 kinase were phosphorylated, which suggest that Xa21 can initiate multiple defense responses by binding of different signaling proteins with specific phosphorylated residues on Xa21 kinase (Liu et al., 2002). The kinase activity of the Xa21 is very important for full resistance (Andaya and Ronald, 2003). Objectives The major objective of this study was to de velop citrus canker re sistance in one of the most commercially important citrus cultivars, Hamlin sweet orange [ Citrus sinensis (L.) Osbeck], by introducing the cDNA of the Xa21 gene from rice that confers broad spectrum resistance to Xanthomonas oryzae (rice bacterial b light) in rice. The specific goals were to: Clone the cDNA of the Xa21 gene into citrus a transformation vector. Produce transgenic Hamlin sweet orange plants with potential ACC resistance genes from the Xa21 gene family via a protoplast transformation/ GFP system. Characterize the transgenic plants for gene expression and stabili ty of the transgene in the citrus genome. Developed a real-time PCR based method to accelerate characterization of the transgenic plants. Assay transgenic plants for resistance to Asiatic Citrus Canker.

PAGE 39

CHAPTER 3 TRANSFER OF THE XA21 XANTHOMONAS RESISTANCE GENE FROM RICE INTO HAMLIN SWEET ORANGE [ CITRUS SINENSIS (L.) OSBECK] USING A PROTOPLAST/ GFP CO-TRANSFORMATION SYSTEM Introduction Citrus is the most extensively grown fruit crop worldwide. Sweet orange ( Citrus sinensis L. Osbeck) is the most important citr us species. It accounts for approximately 60% of the world citrus production according to FAO (Anonymous, 2005). Hamlin sweet orange is one of the leading commercial cultivars in Florida because of its high yield potential and early maturity. Hamlin orange also has a high regeneration capacity from protoplasts and is often used in transformation studies. Sweet orange improvement via conventiona l breeding programs has been hampered by large plant size, nucellar polyembryony, hi gh levels of heterozygosity, and long juvenility (Grosser and Gmitter, 1990). Most of the commercially cultivated sweet orange cultivars have been developed either from chance seedling selection or from a mutation in a particular seedling cultivar (Hodgson, 1968), rather than from organized breeding programs. Nowadays, biotechnology tools, including tissue-culture based tools and genetic engineering, are being used to im prove sweet orange (Grosser et al., 1996a; Grosser et al., 1996b). Genetic engineering has opened new avenues to modify crops and provided new solutions to solve specific problems (Estruch et al., 1997). Citrus genetic transformation has become more attractive to biotec hnology-based citrus improvement programs because of the exciting possibility of adding a desirable trait to an already established

PAGE 40

27 cultivar without altering its integrity (B ond and Roose, 1998). The powerful combination of genetic engineering and conventional bree ding programs permits introduction of useful traits encoded by transgenes into commercial crops within an economically viable time frame (Hansen and Wright, 1999). There is great potential for genetic engineering of citrus to enhance productivity through in creasing resistance to diseases and environmental stress. Since late 1980s, researchers started to report transgenic citrus (Kobayashi and Uchimaya, 1989; Hidaka et al., 1990; Vardi et al., 1990; Moore et al., 1992; Hidaka and Omura, 1993; Pea et al., 1995a; Gutirrez et al ., 1997; Pea et al., 1997; Cervera et al., 2000; Fleming et al., 2000; Mendes et al., 2002 ; Yu et al., 2002; Niedz et al., 2003; Guo et al., 2005). Most of th ose researchers obtained transgenic citrus via an Agrobacterium mediated transformation system, with the selection of transgenic tissue based on antibiotic resistance and the tissue-destructive GUS reporter-gene system. In the beginning, the transformation efficiency was lo w, but over time it has been improved due to continued-improvements in the Agrobacterium -mediated system (Pea et al., 1995b; Bond and Roose, 1998). More recently, research ers reported transgenic citrus without antibiotic resistance genes and used Green Fluorescent Protein ( GFP) as the reportergene instead of GUS (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005). Since many important citrus cultivars, including some sweet orange clones, are commercially seedless (zero to five seeds per fr uit) or totally seedless, it can be difficult or impossible to obtain adequate nucellar seedling explants for Agrobacterium -mediated transformation. The protoplast transformation could be a promising alternative (Fleming et al., 2000). Protoplast techniques are well es tablished in citrus (Grosser and Gmitter,

PAGE 41

28 1990; Grosser et al., 2000), and progress has been made rega rding the development of a competitive transformation system. Citrus protoplast transformation, selection of transformants via GFP and regeneration of transgenic plants via somatic embryogenesis have recently been reported (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005). On the other hand, protoplast/ GFP-based citrus-transformation system does not utilize antibiotic resistance selection or Agrobacterium Protoplast/GFP transformation system utilizes non-destructive GFP selection, instead of destructive GUS selection and therefore requires no antibiotics. Since these markers are currently not legally accepted for marketing particularly in Europe (Stewa rt, 2001; Puchta, 2003; Schaart et al., 2004), using the protoplast/ GFP system may be an advantage over the Agrobacterium -mediated transformation system. Asiatic citrus canker (ACC) is one of the most economically damaging problems affecting citrus production worldwide. ACC is caused by the bacterial pathogen Xanthomonas axonopodis pv. citri ( Xac ). Canker pathogen can affect the majority of the commercial citrus varieties and close relatives of citrus in the family Rutaceae grown in moist, subtropical to tropical climates. All a boveground tissues of citr us are susceptible to Xac when they are young, and the maximum suscep tibility occurs during the last half of expansion phase of growth (Gottwald and Graham, 1992). The pathogen causes distinctive necrotic raised lesions on leaves, stems, and fruits Severe infections can cause defoliation, blemished fruit, premature fruit, twig dieback, and ge neral tree decline. Citrus canker is not systemic, it causes local lesions only (Schubert et al., 2001). There is no highly effective method for citrus canker control. Moreover, chemical control is expensive and could cause pr oblems in the environment.

PAGE 42

29 Citrus canker eradication programs (CCEP) are very expensive, and many times unsuccessful (Brown, 2001). Nowadays, the st ate of Florida is spending millions of dollars annually in an effort to eradicate c itrus canker. There is no an accurate estimate for how long and how much it will cost to erad icate citrus canker. Moreover, there is a real possibility that the erad ication program may fail or beco me too costly to both state and federal government. Therefore, replacing su sceptible varieties w ith field resistance ones appears to be the best long-term solu tion. Although classical se lection or breeding for canker resistance is a promising solution (V iloria et al., 2004), it is a very long-term solution. Genetic transformation c ould be a useful alternative, since the resistance gene could be introduced into the susceptible varieties without otherwise altering cultivar integrity. The cloned Xa21 gene from rice has been shown to confer resistance to over 30 distinct strains of the bacterium Xanthomonas oryzae pv. oryzae ( Xoo) isolated from eight different countries, which causes leaf blight in rice (Wang et al., 1996; HammondKosack and Jones, 1997). The wild-type Xa21 gene contains an intron, and there is some question as to whether dicot plants can pr ocess genes containing monocot introns (the cDNA is intron free). Since the citrus canker pathogen is in the same genus, this gene may have the potential to confer resistance against canker in citrus. The development of canker resistant citrus has b ecome an important research objective. A similar approach was successful with tomato resistan ce genes to the bacterial pathogen Pseudomonas syringae pv. tomato (Oldroyd and Staskawicz, 1998; Tang et al., 1999). To achieve this objective, the protopl ast isolated from a relatively new embryogenic suspension culture line of Hamlin sweet orange were co-transformed with

PAGE 43

30 GFP for selection and the cDNA of the Xa21 gene. Transformed clones were screened for GFP expression using blue light. Polymerase chain reaction (PCR) was performed to identify the co-transformed clones. Transg enic plants were regenerated from cotransformed clones via somatic embryogenesi s and organogenesis. Transgenic plants containing the cDNA of the Xa21 gene were assayed by southern blot analysis and western blot analysis to determine if the ge ne is integrating into the citrus genome and functioning to produce RNA and subsequently protein. Materials and Methods Plasmid Construction The plasmid pARS108 with the GFP endoplasmic reticulum (ER)-targeting gene was kindly provided by Dr. R. P. Niedz (USDA, Agriculture Research Service, US Horticultural Research Laboratory, Ft. Pier ce, FL, USA). Construction of pARS108 has been described previously (Niedz et al., 2003). Plasmid pARS108 contains the Enhanced Green Fluorescent Protein (EGFP) coding sequence (GenBank accession #U55761) placed under the control of the double 35S cauliflower mosaic virus (35S-35S CaMV) promoter with the alfalfa mosaic virus (AMV) untranslated lead er sequence and the nos terminator. An Arabidopsis signal sequence (SS) is included in the 5 end to target the protein to the endoplasmic reticulum (ER) and the codon sequence of the HDEL amino acid was included in the 3 end for retention of the protei n in the lumen of the ER. The SS-EGFP-HDEL sequence was cloned into pBI524 as a NcoI/BamHI cassette, placing it under the control of the double 35S promoter with the AMV untranslated leader sequence and the nos terminator (Figure 3-1).

PAGE 44

31 The plasmid p524EGFP.1 containing the EGFP reporter gene was constructed and described by Fleming et al. (2000). This version of the GFP is targeted to the cytoplasm. Plasmid p524EGFP.1 contains the EGFP coding sequence (GenBank accession #U55761) placed under the control of the doubl e 35S CaMV promoter with the AMV untranslated leader sequence and the SV40 pol y A terminator. The fragment containing the double 35S cauliflower mosaic virus (3535S CaMV) promoter sequence followed by the alfalfa mosaic virus (AMV) enhance sequence was cloned into the HindIII / BamHI site on the pEGFP.1 from clontech (P alo Alto, CA, USA) (Figure 3-2). Vector pCR504 was kindly provided by Dr Pamela Ronald, University of California-Davis (Figure 33). It contains a 3.1 kb BamHI fragment encoding the entire cDNA of the Xa21 gene from rice. Plasmid pCR504 was a promoterless plasmid containing the cDNA of the Xa21 gene. Methods used for plasmid construction were similar to those described by Sambrook and Russell (2001), or according to the manufacturer. To construct the plasmid used in the co-transformation experiment, the fragment containing the cDNA of the Xa21 gene was excised from pCR504 as a BamHI fragment and ligated into the BamHI site on the pBHU-SalI (provided by Dr. W. Y. Song, Plant Pathology Department, University of Florida, Gainesville, FL, USA) (Figure 3-4). The re-ligated plasmid was designated pBHU-XacDNA. The NotI/ HindIII fragment from pBHU-XacDNA has been replaced by the NotI/ HindIII fragment from pLitmus28-F (provided by Dr. W. Y. Song, Plant Pathol ogy Department, University of Florida, Ganisville, FL), which contains the c-myc tag sequence (mtag) in the 5 end. The resulting plasmid is referred to as pBHU-XacDNA-mtag. The BamHI fragment from pBHU-XacDNA-mtag was excised and ligated into BamHI site on pJIT vector to place

PAGE 45

32 the cDNA-mtag under the control of the 35S cauliflower mosaic virus (35S CaMV) promoter and CaMV poly-A. The final c onstruction was designa ted pXa21-mtag and used in co-transformation experiments (Figure 3-4). Figure 3-1. Schematic diagram of pARS108 ER targeting. Restriction enzyme (H, HindIII ; N, NcoI ; S, SacI ; B, BamHI ; E, EcoRI ). HDEL = Histidine, Aspartic acid, Glutamic acid, and Leucine, respectively. Figure 3-2. Schematic diagram of p524EGFP Cyt-targeting. Restriction enzyme (Bg, BglII ; H, HindIII ; X, XbaI ; B, BamHI ; Br, Brs GI ; N, NotI).

PAGE 46

33 Figure 3-3. Schematic diagram of the construction of Xa21 cDNA clone pCR504.

PAGE 47

34 Figure 3-4. Schematic diagram of the constr uction of pXa21-mTag plasmid. Restriction enzyme (B, BamHI ; K, KpnI ; S, SalI ; N, NotI).

PAGE 48

35 Plasmid Multiplication Transformation of E. coli Before a large scale plasmid preparation can be performed, the plasmid must first be transformed into competent E. coli cells. Max efficiency DH5 TM competent cells were obtained from Invitrogen (Invitrogen Co rporation, Carlsbad, CA, USA, Cat. No. 18258-012). The transformation procedure was followed exactly as described in the product manual. Quick miniprep plasmid preparation and confirmation of insert orientation Plasmid DNA was extracted from severa l recovered bacterial colonies and compared to the DNA from the known plasmi d stock by restriction analysis using agarose gel electrophorosis. Using a sterile bacterial loop, single colonies were selected from the plated culture and transferred to a bacterial culture tube containing 2 ml LB liquid media (10 g/L Bactotryptone, 5 g/L yeast extract, and 10 g/L Na Cl) and the appropriate antibiotic. The bacteria were placed on the shaker at 225 RPM and left to grow overnight at 37 C. The DNA was extracted from the overnight culture bacteria using QIAprep Spin Miniprep kit (QIAGEN Inc., Valencia, CA, USA, Cat. No. 27104). A restriction digest was then performed on the extracted DNA to test for the presence of the cDNA of the Xa21 gene. Reaction volume of 20 l was performed with (4 l DNA, 2 l 10X of the re striction enzyme buffer (Promega), 0.2 l of the restriction enzyme (Promega), and 13.8 l ddH 2 O). The reaction mixture was incubated at 37 C for at least 2 hours. The restric tion enzyme was deactivated by heating the samples at 65 C for 10 minutes. Indicator dye (4 l of 6X loading buffer) was added and the gel was loaded. The gel was run for 90 minutes at 100 Volts in TAE buffer (Tris-Acetate-EDTA).

PAGE 49

36 The gel was removed and stained with 10 l of ethidium bromide (10 mg/ml) in 100 ml TAE buffer with gentle shaking for 15-20 minutes and observed and photographed on a UV Transilluminator. Samples which contai ned the band corresponding to the band for the cDNA of the Xa21 gene were saved to use fo r the large scale isolation. Large scale isolation and plasmid preparation To obtain a large amount of the DNA for the further use, two 1-liter flasks containing 500 ml LB media pl us the appropriate antibiotic were inoculated with the transformed E. coli and the cultures were incubated ove rnight at 37 C on a shaker at 225 RPM. The DNA was extracted from the overnight cultured bacteria using a Wizard PlusMaxiprep DNA Purification System from Promega (Promega Corporation, Madison, WI, USA, Cat. No. A7270). To determine the concentration of plasmid DNA, an absorbance reading at O.D. 260 was obtained, (an absorbance reading of 1.0 corresponds to 50 g of plasmid DNA per ml) (Sambrook and Russell, 2001). Plant Material, Protoplast Transformation, and Culture Establishment and maintenance of suspension cultures The Hamlin sweet orange ( Citrus sinensis L. Osbeck) embryogenic callus line was induced from unfertilized ovules taken from mature fruit and maintained on Murashige and Tuckers (MT) basal medium (Murashige and Tucker, 1969). Suspension cultures were initiated and maintained according to Grosser and Gmitter (1990) in 40-50 ml of H+H liquid media (see appendix A) in 125 ml erlenmeyer flasks covered with aluminum foil and sealed with masking tape. Cultures were maintained on a shaker at 125 RPM. Suspensions were subculture d every 2 weeks by sp litting the contents between two sterile flasks and adding 25 ml of fresh culture medium to each flask. Suspension cells used for protoplast isolati on were taken 4-10 days after subculture.

PAGE 50

37 Transformation and culture of citrus protoplasts The protoplast transformation protocol was modified from the PEG-mediated protoplast fusion protocol developed by Grosser and Gmitter (1990) for citrus somatic hybridization with slight modification. Suspension culture tissue was digested overnight in the enzyme mixture (see appendix A) and the protoplasts were purified by centrifugation on a sucrose-mannitol gradient. The protoplast pellet was resuspended in 3 ml 0.6 M BH3 protoplast culture medium (see appendix A; MT basal medium containing 8-P multivitamins, organic acids, and sugar/alcohol additives (Kao and Michayluk, 1975), at a c oncentration of 2 10 6 cells per ml, as described by Grosser and Gmitter (1990). The plasmids DNA pXa21-mtag and pARS108 or p524EGFP.1 were added (25 g DNA/100 l protoplast suspension ) and mixed well using a pasteur pipet. Four drops of the resuspend mixture were pipe ted to the center of each Petri dish (60 15 mm). Immediately, four drops of a 40% PEG solution were added (see appendix A) to each Petri dish and incubated 25-30 minutes at room temperature. Following incubation in PEG, four drops of 9:1 A:B elution so lution as described by Grosser and Gmitter (1990) (see appendix A) were added to each Petri dish. The A+B solution was mixed immediately prior to use to avoid precipitation. After another in cubation period of 25-30 minutes, approximately 20 drops of fresh BH 3 medium were added around the periphery of the protoplasts. Ten minutes later, th e PEG, A+B solution, and the medium were carefully removed with a Past eur pipet, and immediately replaced with 30 drops of fresh BH3 medium. After 10-15 minut es, the BH3 medium was removed and replaced with another 30 drops of fresh BH3 medium. The la st wash was repeated twice. Following the final wash, the protoplasts were cultured dir ectly in the same Petri dish by adding 15-20 drops of either fresh BH3, EME, (see appendi x A) or a 1:1 (v:v) mixture of both. After

PAGE 51

38 plating, Petri dishes were sealed efficiently with Nescofilm. Protoplasts were incubated in sealable plastic boxes at 25-27 C under low light for 4-6 weeks in which transgenic tissue could be recovered for the subseque nt regeneration of transgenic plants. Regeneration and selection of transformed protoplasts The GFP expression was detected in the transgenic protoplasts illuminated with blue light within 24 h after transformation using a Zeiss SV11 epifluorescence stereomicroscope equipped with a 100 W mercury bulb lig ht source and an FITC/GFP filter set with a 480/30 nm excitation filter and a 515 nm longpass emission filter (Chroma Technology Corp., Brattleboro, VT, USA). Continued expression of the GFP protein was monitored occasionally for the next few weeks. Four weeks following transformation, cultures were supplemented with fresh medium containing reduced osmoticum. This was accomplished by adding 10-12 drops of a 1:2 (v:v) mixture of 0.6 M BH3 medium and 0.146 M EME medium (Grosser and Gmitter, 1990). After two more weeks, another reduction in osmoticum was made by adding 10-12 drops of a 1:1:1 (v:v:v) of 0.6 M BH3 : 0.146 M EME : 0.6 M EM E media. At this point, vigorous colonies from each Petri dish were transferre d to larger plates containing solid medium by pouring over 100 20 mm 2 Petri dishes containing ag ar-solidified EME with 0.146 M maltose, substituted for sucrose to promote embryogenesis. Four weeks following plating the culture on solid medium, transgenic calli and embryoids were identified based on the blue-green fluorescence expression of the GFP protein and were physically separated in vitro from non-transgenic tissues. Selected transgenic embryoids and calli were transferred to new plates of solid EME-maltose overlayed with a thin layer of fresh liquid 0.146 M maltose EME medium to promote continued embryo initiation and development. Regenerated transgenic small embryoids were then cultured on 0.22 m cellulose acetate

PAGE 52

39 membrane filters, which were layed on fresh 1500 medium (MT basal medium containing 1.5 g/L malt extract) (see a ppendix A), to normalize and enlarge the embryoids (Niedz et al., 2002). The cultures were put on fresh 1500 medium for 4 weeks and then transferred onto B+ medium [MT basal medium containing 3.0 mM gibberellic acid and 0.11 mM naphthalene acetic acid (NAA)] ( see appendix A) to encourage embryo conversion (Grosser and Gmitter, 1990) Enlarged transgenic embryos were cultured on DBA3 medium [MT basal me dium containing 13.3 mM 6-benzylaminopurine and 0.045 mM 2,4-dichlorophenoxy-ace tic acid (2,4-D)] for adventitious shoot induction (Deng et al., 1992). Transgenic shoots obtained were transferred to RMAN rooting medium (half-strength MT basal medium containing 0.11 mM NAA and 0.5 g/L activated charcoal) (see appendix A) for root induction (Grosser and Gmitter, 1990). Transgenic shoot tips were also microgr afted onto Carrizo citran ge or sour orange nucellar seedlings according to Navarro (1992 ) to expedite transgenic plant recovery. Comparison of different GFP -containing constructs at the whole plant level Mature leaves from transgenic plan ts obtained from p524EGFP.1 and pARS108 were scanned using a confo cal laser scanner (Leica TCS SL, Exton, PA, USA) with settings for three different fluorescent wavele ngths, green, red and blue, at the same time with a 488, 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spectral window, respectively. Molecular Analysis of Transgenic Tissue Presence of the GFP gene and the cDNA of the Xa21 gene in the selected tissue were confirmed by PCR amp lification of the transg enes. The copy number and integration pattern of the transgenes were determined by Southern blot analysis. The expression of the cDNA of the Xa21 gene was determined by western blot analysis.

PAGE 53

40 Polymerase chain reaction (PCR) for detection of transformants The PCR was used initially to screen regenerated Hamlin sweet orange plants obtained via co-transformation. Genomic DNA was extracted from about 100 mg of young leaf tissue of putative transgenic citrus plants using a GenElute TM Plant Genomic DNA Miniprep kit (Sigma, Inc. St. Louis, MO USA, Cat. No. G2N350). To confirm the presence of the GFP gene and the cDNA of the Xa21 gene, multiple PCR experiments were performed using two different pairs of primers for GFP and the cDNA at the same time. Primers for PCR amplification matching the coding sequence within the GFP gene were 108F, 5 -GAATTCGTGAGCAAGGGCGA-3 and 108R, 5 GGATCCTTAGAGTTCGTCGTG-3 Primers for PCR amplification matching the coding sequence within the cDNA of the Xa21 gene were XaL, 5 AATCCCTAACACGCTTGGTG-3 and XaR, 5 -CACACACTGGAAACAATCCG-3 All primers were synthesized by Qiagen Operon (Alameda, CA, USA). The PCR was performed in 25 l reaction volume containing 12.5 l of 2X GoTaq Green Master Mix (Promega, Cat. No. M7123), 1.5 l of 5 M each primer, 2.5 l genomic DNA (stock 100 ng/l) and 4 l Nuclease-Free Water (Pro mega). The PCR amplification program was 1) 95 C/2 minutes, 2) 95 C/30 seconds, 3) 59 C/30 seconds, 4) 72 C/1 minute, 5) 30 cycle from 2-4, and 6) 72 C/10 minutes(see appendix B). The amplified DNA products were electrophoretical ly separated in 1% agarose gel that contained TAE buffer (Tris-Acetate-EDTA) and 1 l/100 ml ethidium bromide (10 g/ml). Southern blot analysis Southern blot analyses were performed to confirm stable integration of the cDNA of the Xa21 gene in the transgenic plants and to determine the number of integrated

PAGE 54

41 copies of the gene in transgenic clones. Pr ior to the isolation of the genomic DNA, all labware was sterilized by autoclaving for one hour at 15 psi and dried in an oven. All buffers and solutions were sterilized by autoclaving. Gloves were used to handle all glassware during isolation. Genomic DNA was extracted from the leav es of transgenic and non-transgenic plants using the modified CTAB method as described by Dr. T. E. Mirkov (personal communication). Twenty g of DNA was digested with SphI and ApaLI restriction enzymes. Standard protocols for gel electr ophoresis, denaturation, a nd neutralization of the gel were performed as describe d by Sambrook and Russell (2001). After electrophoresis, gels were treated with 0.25 M HCl for 10 minutes, and then washed with 0.4 M NaOH for 10 minutes. DNA was transfer red to positively charged nylon membranes (Immobilon TM -Ny+; Millipore Corporati on, Billerica, MA, USA) by capillary transfer using 20X SSC buffer ove rnight according to Sambrook and Russell (2001). Probe DNA for the cDNA of the Xa21 gene was prepared from the XhoI fragment, 1.49-kb, of the pXa21-mtag plas mid. Probe was labeled with digoxigenindUTP using a random primer labeling kit (D IG High Prime DNA Labeling and Detection Starter Kit II, Roche Applie d Science, Cat No. 11 585 614 910). The probe labeling was performed according to manufacturers ma nual. Fixation of the DNA to the membrane, prehybridizaton, hybridizati on, and immunological detection were performed as described in the instruction manual of DIG High Prime DNA La beling and Detection Starter Kit II. Western blot analysis To carry out western blot analysis, total protein was extracted from transgenic and non-transgenic citrus leaves. About 0.3 g leaf tissue from transgenic and non-transgenic

PAGE 55

42 Hamlin sweet orange plants was collected a nd ground in liquid nitrogen. To isolate the soluble fractions, the ground tissue was thawed in extraction buffer [50 mM Tris-HCl, pH 6.5; 1 mM EDTA; 150 mM NaCl; 0.1% Triton X-100]. Prior to use of the extraction buffer immediately, the following protease inhi bitors were added: 2 g/ml Antipain; 2 g/ml Leupeptin; 2 g/ml Aprotinin; 1 mM of 4-[2-aminoethyl]-benzenesulfonyl fluoride (AEBSF) Sigma; and 5% of 2mercap toethanol. Samples were incubated at 4 C for 30 minutes with shaking and then centr ifuged at 10,000 RPM for 10 minutes at 4 C. The supernatant was recentrifuged at 13,000 RPM for 10 minutes at 4 C. The supernatant was either immediatel y subjected to protein blot an alyses or stored at -80 C after determining the concentr ation of the protein by the me thod of Bradford (Bradford, 1979). After adding the loading dye and boiling the samples for 5 minutes, total protein (35 g) for each sample was separated on 5% stacking and 6.5% separation gels in a Mini-Protean III cell (Bio-Rad) according to Laemmli (1970) using Tris-glycine as the SDS-PAGE electrophoresis buffer. Proteins were electrophoretically transferred to a PVDF membrane (Immobilon TM -P; Millipore Corporation, Bedfor d, MA, USA, Cat. No. IPVH 000 10) using a Trans-Blot Cell (BioRad). The non-sp ecific binding sites on the membrane were then blocked with Blotto [5% non-fat drie d milk in TTBS (100 mM Tris-HCl, pH 7.9; 150 mM NaCl; 0.1% Tween 20) (see appendix C) ] for one hour at room temperature. The membrane was incubated with primary antibody (anti-c-myc, 1:700) in 3% bovine serum albumin (BSA) in TTBS overnight at 4 C. After three 10-minute washes in TTBS, membranes were incubated with secondary antibody (C-myc: Anti-mice IgG), (Amersham Biosciences Corp, Piscataway, NJ USA, Cat. No. NXA931), for one hour at

PAGE 56

43 room temperature, followed by three 10-minute washes in TTBS. Detection of the protein band on blots was carried out according to ECL Plus Western Blotting Detection Kit (Amersham Biosciences Corp, Piscataway, NJ, USA, Cat. No. RPN2133). Membranes were exposed to X-ray film. Results and Discussion Plasmid Preparation The cDNA of the Xa21 gene was inserted into plasmid pJIT (pUC based) as necessary to be under the control of the 35S CaMV promoter and CaMV poly A terminator. A c-myc epitope sequence was tagged to the 5 end of the cDNA. This plasmid was designated pXa21-mtag. Figure (3-4) shows a schema tic diagram of the construction of pXa21-mtag plasmi d. Plasmid was transformed to E. coli strain DH5 TM using a chemical protocol according to th e manufactures instructions. Selection for positive colonies was performed using PCR wi th a specific primer set for the cDNA. Testing for correct orientation was perfor med using restriction enzymes according to Sambrook and Russell (2001) prior to large scal e preparation of the plasmid. The positive bacterial colonies were replat ed and single colonies were se lected to begin large scale plasmid preparation as described previousl y. Preps with DNA concentration of 0.5 g/l and above were used in co-transformation experiments. Plasmid DNA was stored at 20 C for short term use and at -80 C for long-term use. Transformation of Citrus Prot oplasts and Plant Regeneration Isolation and transformation of citrus protoplast and the ultimate regeneration of plants are controlled by several factors. The two most important factors are the quality of the starting material (cell susp ension) and quality of the prot oplasts after isolation (high yields of viable protoplasts with little or no debris). The cell suspension line used was

PAGE 57

44 chosen from Hamlin sweet orange new embryogenic cells because they were exhibiting good regeneration capacity. The best protopl asts were obtained from suspensions 4-10 days after subculture when isolated according to Grosser and Gmitter (1990). Using the sucrose-mannitol gradient allows for the removal of the non-viable protoplasts and cellular debris which could interfere with the uptake of the plasmid by the viable protoplasts, or the regenerati on in the following stages. More over, starting with pure and viable protoplasts could possibly in crease the transformation efficiency. Comparison of different GFP -containing constructs To develop a GFP construct suitable for the identif ication of citrus transformants by visualization of green fluorescence, two plasmid constructs containing either the targeted GFP-ER (Endoplasmic reticulum targeting and retention sequence) for improved fluorescence (Haseloff et al., 1997) or nontargeted GFP (Cytoplasmic targeting) were compared in order to assay stable expression of the protein in the transformed citrus tissue. Both versions of the GFP were cloned under the c ontrol of the double 35S cauliflower mosaic virus promoter with th e alfalfa mosaic virus (AMV) untranslated leader sequence (Figure 3-1 and 3-2). Th e double 35S-AMV promoter was reported by Datla et al. (1993) to increas e expression up to 20-fold relative to the 35S promoter. Although both of these constructs gave tran sient expression at the protoplast level, nontargeted GFP gave less stable expression than targeted GFP at the colony or plant level. The most likely explanation for the l ack of stable expression from nontargeted GFP construct may be due to insufficient accumulatio n of protein for detection because of its degradation by the proteases in the cyt oplasm. Citrus callus tissue sometimes autofluoresces yellow when illuminated w ith blue light. To assure transformant identification without do ubt, strong and stable GFP expression is critical. Thus, the

PAGE 58

45 combination of insufficient protein accumulation and possible pale yellow autofluorescence from callus tissue could have prevented identifica tion of transformed colonies with the nontargeted version of the GFP even though expression at the protoplast level was sufficien t for transient detection. Transient and stable transformation frequencies using GFP as a selectable marker Transient expression of GFP was visible at the protoplas t level as early as 6 hours after transformation in some pARS108 expe riments. Transient expression of green fluorescence was intense 16-24 hours after transformation in both p524EGFP.1 and pARS108 (Figure 3-7B). Visu ally, there was no differen ce in fluorescence intensity between p524EGFP.1 and pARS108 treated protoplasts. The difference between the two constructs became particularly evident by firs t week when the cells had started dividing. This expression persisted for 2-3 weeks, declining more significantly in p524EGFP.1 experiments. The average transient transforma tion frequency varied from one experiment to another, even when using the same GFP construct. This could be influenced by the culture cycle stage and the cultivar of the cu lture used as source of protoplasts. Using a 2-week subculture cycle, pr otoplasts isolated from 4to 10-day-old cell suspension cultures show the best transient expressi on and division capacity. A similar result was reported by Fleming et al. (2000). Stable transformation frequencies, based on the number of transformed protoplasts and not corrected for plating effici ency, were in the range of 1 10 -5 protoplasts. These results are consistent with others in the litera ture. Davey et al. (2005a) reported that stable protoplast transformation freque ncies remain low (one per 10 4 protoplasts), indicating a need to improvement as necessary for effici ent selection and recovery of transformed cells and tissue. Transgenic tissue was se lected and separated from non-transformed

PAGE 59

46 tissue and transferred to solid medium appr oximately 2 months after the transformation procedure. Using the FITC/ GFP filter set, detection of transgenic calli by exposing regenerated tissue under blue light was clear and direct by expression of a bright bluegreen color (Figure 3-7C and D). Autofluores cence was generally not detected from nontransformed calli (Figure 3-7C), with the occasional expression of a pale yellow fluorescence in older cultures. There was little visual difference in fluorescence at this stage between p524EGFP.1 and pARS108. Visual selection of transgenic citrus is particularly effective at this stage as the colonies are sm all enough (250-500 mm) so that a single plate containing thousands of coloni es can be rapidly scr eened, but large enough to be easily rescued and cultured indi vidually. Aside from the expression of GFP detectable with blue light, the transgenic tissue appeared normal and could not be distinguished from non-transformed tissue unde r white light. At the embryo stage, it was easy to distinguish between transformants (green) and non-transformants (red) (Figure 37D). Elliott et al. (1999) tested the effi ciency of visual selection by GFP with no additional selection and concluded that withou t an additional selective agent, preferential growth of GFP -positive tissue is difficult to maintain. However, when GFP-positive tissue can be identified, selectively cultured, and plants regenerated, GFP has been successfully used as a visual screenable ma rker (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005). Protoplasts form colonies or embryoids directly from single cells, making the selection and regene ration of transgenic indivi duals an efficient process, limited only by the efficiency of the particul ar protoplast system. Fluorescent protoplast

PAGE 60

47 derived colonies were regene rated into plants and maintained as cell lines. Green fluorescent colonies were not observed in any of the control plates. At the whole plant level, there were distinct fluorescence differences between shoots transformed with the two GFP constructs. Shoots transgenic for the ER-targeted GFP (pARS108) were generally brighter than those derived from the nontargeted construct (p524EGFP.1), and exhibited a uni form green fluorescence with minimal red fluorescence from chlorophyll (Figure 3-5 and 3-6). However, the fluorescence intensity varied among different parts of the plant, being higher in new expanding leaves. This could be due to lower metabolic activity and chlorophyll accumula tion that partially masks the green fluorescence provided by the GFP in old tissue. Haseloff et al. (1997) reported that they could consistent ly regenerate intensely fluorescent Arabidopsis plants when GFP was targeted to the ER. They also re ported difficulty in regenerating plants from the brightest nontargeted transformants. Both results ar e similar to our observations in citrus. Other than the differences di scussed above, development and regeneration responses appeared similar between plan ts transgenic for either p524EGFP.1 or pARS108. Plant regeneration The newly obtained Hamlin orange embr yogenic suspension culture line used in these experiments was selected because it was rapidly prolifer ating and routinely provided reasonable yields of good quality prot oplasts and high regene rating efficiencies under the optimum condition. However, due to many factors in the procedure, it was difficult to optimize conditions. Embryogenic cal lus and particularly suspension cultures of some citrus cultivars have high rates of mutations and cytological aberrations that diminish their capacity for whole-plant r ecovery (Grosser and Gmitter, 1990). Hamlin

PAGE 61

48 has proven to be a highly stable variety in cu lture. The high performa nce characteristics, high regeneration capacity of the Hamlin suspension line merited its use in these experiments. Furthermore, Hamlin is one of the more highly susceptible varieties to the citrus canker pathogen. For many years J. W. Grosser at CREC, Lake Alfred has been comparing several hundred Hamlin and Valen cia orange somaclones regenerated from embryogenic calli, embryogenic suspension cu lture-derived protoplasts, and from nucellar seedling stem internodes via organogenesis. Although useful somaclonal variation was found in all of these populations, the larg e majority (80%) of the somaclones from all sources are not significan tly different from the original clones (Grosser et al., 1996a). These results suggest th at it should not be diffi cult to recover trueto-type transgenic plants using the protopl ast-transformation system (Fleming et al., 2000). Generally, the colonies selected for GFP expression were transferred to EMEmaltose 4-8 weeks after transformation. Shor tly thereafter, embr yos began to form. Transformed embryogenic callus develops norma l, bipolar, heart sh aped embryos when cultured on cellulose acetate membranes overl aid on solid EME-maltose medium (Figure 3-7E and F). The mechanism of membra ne induced embryo normalization remains unclear (Niedz et al., 2002). These embryos were removed and transferred to another fresh plate containing EME-maltose medium, an d allowed to proliferate. Embryos were then transferred to 1500 medium for further growth. Efforts to regenerate transgenic plants were therefore focused on these cultures. More than 500 transgenic somatic embryos recovered from several experiments were cultured on B+ germination medium for two passages. The majority of these embryos

PAGE 62

49 became larger, but did not convert to plantlets. However, as is often the case with citrus somatic embryos, multiple shoots were regenerated following culture on DBA3 shoot induction medium (Deng et al., 1992; Gro sser et al., 2000) (Figure 3-7G and H). Approximately 200 embryos produced shoots, but a few of them produced both shoots and roots. These plants were transferred to soil but were not successfully acclimated, probably due to poor root quality. Shoots fr om the other germinated embryos were cultured on RMAN root-induction medium, and most of them successfully produced roots (Figure 3-7I). These plants were also transferred to soil but again most of them were not successfully acclimated. Po tting soil contamination was by a fungus determined to be at least partially responsible for this result (about 200 plants were recovered out of more than 1200 plantlets transferred to the soil) (Figure 3-7J and K). As mentioned, the non-converted transgenic embryos were sectioned and cultured on DBA3 shoot-induction medium for two to three passages. Some of them produced multiple shoots and others responded poorly. Many clusters of healthy transgenic shoots were recovered. Shoots were cultured on RM AN root-induction medi um, and again most of them successfully produced roots (>75%). Transgenic plants growing on their own roots exhibited a high level of GFP expression in the root, attributed to the absence of chlorophyll in root tis sue (Data not shown). There are several reasons for the low re generation efficien cy in protoplast transformation experiments. First, problems rela ted to the culturing of the protoplasts, or the condition of the cell suspension cultures used for protoplast isolation could be influential. If large numbers of microcalli are produced (i.e., high plating efficiency), there is a tendency for callus to be form ed at the expense of embryo induction. If

PAGE 63

50 embryos do form, there is often an overgrowth of those embryos by the callus, which inhibits further embryo development. Other r easons for the failure of plant regeneration include contamination of the media, the condi tion of the protoplast s after isolation and transformation, and possibly other unknown factors. Figure 3-5. Cytoplasmic targeting of GFP expression in a mature citrus leaf. Mature leaves from transgenic plant obtain ed from p524EGFP.1 were scanned using confocal laser scanner with a sett ing for three different fluorescent wavelengths, green, red, and blue, at the same time with a 488, 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spectral window, respectively. (A) green, (B) red, (C) blue, and (D) overlay of three filters together.

PAGE 64

51 Figure 3-6. ER targeting of GFP expression in a mature citrus leaf. Mature leaves from a transgenic plant obtained from pARS 108 were scanned using confocal laser scanner with setting for three differe nt fluorescent wavelengths, green, red, and blue, at the same time with a 488 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spec tral window, respectively. (A) green, (B) red, (C) blue, and (D) ove rlay of three filters together.

PAGE 65

52 Figure 3-7. Citrus transgenic plant regeneration and GFP monitoring from protoplast to plant. (A) protoplasts af ter isolation from the ring between sucrose 25% and mannitol 13%; (B) protoplasts after 24 hours from co-transformation with pARS108/p524EGFP.1 and pXa21-mtag by direct DNA uptake protocol using Polyethylene Glycol (PEG); (C) protoplast-derived calli (transformed and non-transformed) on EME-maltose solid medium 36 days after transformation, (Left) blue light; (Right) white ligh t; (D) transgenic (green) and non-transgenic (red) somatic em bryos growing on EME medium 6 to 8 weeks after transformation; (E) tran sgenic somatic embryos growing on cellulose acetate membranes laid on 1500 medium 2-3 months after transformation; (F) transgenic (gr een) and non-transgenic (red) somatic embryos growing on 1500 media 3-4 m onths after transformation; (G) embryo-derived transformed (green) a nd non-transformed (red) shoots on B+ medium 5-6 months after transforma tion; (H) embryo-derived transformed shoots on DBA3 medium 6 months after transformation; (I) in vitro rooted transgenic citrus plants constitutively expressing the GFP gene; (J and K) transgenic Hamlin sweet orange plants in soil.

PAGE 66

53 Shoots failing to produce roots were either in vitro grafted to nucellar seedlings of Carrizo citrange (Figure 3-8) or shoot-tip grafted onto Ca rrizo citrange and/or sour orange in the greenhouse (Figure 3-9). The grafting technique was chosen based on the shoot condition. Small and soft shoots were selected for in vitro micrografting, whereas larger and more hardened ones were chosen for shoot-tip grafting in the greenhouse. Over 95% of the in vitro micrografts were successful, producing more vigorous plantlets that were, acclimated with a 75% success rate. Shoot-tip grafting has been used succe ssfully to recover transgenic shoots regenerated from citrus epicotyls treated with Agrobacterium (Pea et al., 1995a; 1997; Bond and Roose, 1998; Cervera et al., 2000). Gr afting of small shoots (<1 cm) as they arise overcomes rooting difficulties that can occur (Moore et al., 1992). Rooting protoplast derived sweet orange plants can take up to 3 months before roots emerge. Shoot-tip grafting grea tly accelerates plant recovery. Over 500 transgenic plants were obtained from co-transformation experime nts using shoot tip grafting. The typical morphology of the regenerated transgenic Hamlin orange plants was similar to that of the non-transformed plants recove red from the control cultures. The time frame from initial protoplast isolati on to plant establishment in soil varied greatly from one experiment to another. Seve ral factors influence this chain of events. Delays in the osmoticum reduction process and culture transfer slowed down calli and embryo growth. In some experiments, rapidl y developing embryos c ould be transferred directly from EME to B+ medium, skipping the transfer to 1500 medium. In others, embryo growth was slower, requiring an additional subculture on EME, 1500, or B+

PAGE 67

54 media. However, if all the stages went smoot hly, the plantlets could be established in soil in as little as 5 to 6 months. Figure 3-8. in vitro grafting of transgenic Hamlin sw eet orange onto nucellar seedlings of Carrizo citrange. (A) shoots failing to root in vitro ; (B) grafted transgenic scion (green) onto Carrizo s eedling (red); (C) micrografted transgenic Hamlin sweet orange onto Carrizo plant in vitro ; (D) transgenic Hamlin sweet orange growing on Carrizo rootst ock in soil 6 weeks after grafting; (E) transgenic plant more than a year in soil under the greenhouse condition. From more than 15 co-transforma tion experiments with p524EGFP.1 and pXa21-mtag, only one transgenic event was recovered and 7 transgenic plants were successfully propagated using grafting techni ques. From more than 30 co-transformation

PAGE 68

55 experiments with pARS108 and pXa21-mtag, 75 transgenic events were recovered and more than 500 transgenic plants were re generated and transferred to the greenhouse. According to the literature, th is is the first time to re port a large population of normal transgenic Hamlin sweet orange plants using the protoplast/ GFP transformation system. Figure 3-9. Shoot-tip grafting of transgenic Hamlin sweet orange onto Carrizo citrange and/or sour orange. (A) shoot failing to root in vitro ; (B) shoot tip grafting of transgenic Hamlin sweet orange onto Carrizo plant in soil (under the tip); (C) transgenic Hamlin sweet orange growing onto Carrizo rootstock in soil 2-3 weeks after removing the tip; (D) transgenic scion growing onto Carrizo rootstock in soil 6-8 weeks after removi ng the tip; (E) transgenic plants after more than a year in soil. Molecular Analysis Polymerase chain reaction (PCR) for screening transformants When putative transgenic scions grafte d onto Carrizo citrange seedlings had developed several leaves, a leaf was removed fr om each plant, excited with blue light to confirm GFP expression. The polymerase chain reac tion was used initially to screen

PAGE 69

56 regenerated Hamlin orange plants obtaine d via co-transformation. The PCR analysis was performed using DNA from leaves of regenerated plants, transgenic and nontransgenic. To confirm the presence of the GFP gene and the cDNA of the Xa21 gene in the transgenic plant genomes, multiple P CR experiments were performed using two different pairs of primers for GFP and the cDNA at the same time. A predicted internal fragment of about 780 nucleotides was am plified in all DNA samples from green fluorescent leaves (Figure 3-10). No amplif ication was detected in DNA samples from non-transgenic regenerated control plants which emitted red fluorescence under blue light. A predicted internal fragment of a bout 1400 nucleotides was amplified in 35% of the DNA samples from green fluorescent leav es, which corresponds to the cDNA of the Xa21 gene (Figure 3-10). Figure 3-10. Multiple PCR analysis to detect the presence of the GFP (0.8 kb) and the cDNA of the Xa21 (1.4 kb) genes in transgenic citrus plants. Lane 24 is a positive control for both genes (DNA plasmid). Products have shown in lanes 2-20 the presence of GFP gene and the cDNA of the Xa21 gene in the transgenic plants. Lanes 21 and 22 are positive for GFP only. Lane 23 is negative for both genes. Lane 1 is a non-transgenic control, and lane 25 is negative control (H 2 O), MM = 1 kb DNA ladder.

PAGE 70

57 Screening for transformants using southern blot analysis When the grafted plants measured 20-30 cm in height, southern analysis was performed to confirm the stable integration of the cDNA of Xa21 coding sequence in the transgenic plants genome and to provide so me information regarding their integration patterns. Eight randomly chosen putative transg enic plants (grown in the green house for more than 12 months), which were PCR positive for GFP and Xa21 were analyzed. Genomic DNA was digested with SphI that has a unique restri ction site within the 5 end of the integrated sequ ence of the cDNA of the Xa21, and ApaLI that does not cut in the cDNA. Therefore, bands hybridizing to the probe result from one site within the vector and one site within the flanking genomic DNA. Hybridization patterns with multiple bands were observed (Figure 3-11). In genera l, the direct-gene-me diated method results in more multiple and rearranged fragment in transgenic plants than do plants transformed by the Agrobacterium -method (Dong et al., 1996; Krasnyans ki et al., 1999), and this was the case for this study on citrus. Even though different hybridizat ion patterns were observed, the results of southern blot analys is provided molecular evidence confirming the presence of the introduced cDNA of the Xa21 gene in the citrus genome. Figure 3-11. Southern hybridization analysis of Hamlin sweet orange plants with the cDNA of the Xa21 gene. The probe was a 1641-bp NcoI855 NcoI2496 fragment of the cDNA of the Xa21 gene isolated from plasmid pAO3. Lanes 1-9 Genomic DNAs were digested with SphI and ApaLI Lanes 1-8 transgenic plants and lane 9 non-transgenic plant.

PAGE 71

58 Confirmation of transformation using western blot analysis Leaf tissue from transgenic plants was us ed to obtain crude protein extracts for Western analyses. The extracted proteins (35 g per lane) were separated subsequently by SDS/PAGE on 5% stacking and 6.5% separa tion gels and transf erred to ImmobilonPVDF membranes for immunostaining. The Western blots were developed with anti-c-myc as primary antibody followe d by anti-mice immunoglobulin G (IgG) antibody conjugated with horseradish peroxidase as a secondary antibody as described in the material and methods. Detection of im mune complexes was achieved by enhanced chemiluminescence according to ECL Plus We stern Blotting Det ection Kit. Finally, expression of the Xa21 was detected on the membrane to verify that the gene was integrated and expressed in the transgenic plants. In this assay, a protein product of 120 kDa corresponding to the cDNA of the Xa21 gene was immunoreactive with the monoclonal antibody in 22 out of 34 tested transgenic plants (F igure 3-12). In this assay soluble extracts of the transgenic rice expressing the wild-type Xa21 gene and nontransgenic rice were used as positive and ne gative controls. As s hown in Figure (3-12), there is a non-specific band appearing in al l the samples which is larger than the Xa21 corresponding band. Some of the transgenic plants were PCR and southern analysis positive, but did not have the corresponding band for the Xa21 protein. The most likely explanation for this phenomenon is that ev en though the DNA had been transferred and integrated into the plant genome, it was not transcribed to RNA and subsequently protein. As shown, most Southern-positive pl ants transformed with cDNA of the Xa21 express Xa21 protein to detectable levels According to the literature, this is the first time that a gene from rice has been stably integrated and expressed in citrus plants. After more than

PAGE 72

59 12 months growing in the greenhouse, all tr ansgenic plants showed a normal phenotype, identical to that of control non-tr ansformed Hamlin orange plants. Figure 3-12. Western blotting analysis of transgenic Hamlin sweet orange. The extracted proteins (35 g per lane ) were separated subsequently by SDS/PAGE on 5% stacking and 6.5% sepa ration gels and transferred to polyvinylidene difluoride membranes for immunostaining. Soluble extracts of the transgenic rice expressing the wild-type Xa21 gene (lane 20), non-transgenic rice (lane 21), tran sgenic citrus expressing the GFP gene only (lane 1), non-transgenic citrus (lane 2), transgenic citrus positive for GFP and Xa21 genes (lanes 4-19) were subjected to Western blotting with reference to molecular mass markers (indicated in lane 1). The Western blots were developed with anti-c-Myc as primary antibody and c-Myc: Anti-mice IgG as a secondary antibody as described in the material and methods.

PAGE 73

CHAPTER 4 TRANSGENIC Hamlin SWEET ORA NGE PLANTS CONTAINING A RICE XA21 cDNA XANTHOMONAS RESISTANCE GENE OBTAINED BY PROTOPLAST/ GFP TRANSFORMATION SYSTEM Introduction Hamlin sweet orange ( Citrus sinensis (L.) Osbeck) is one of the leading commercial cultivars in Florid a because of its high yield po tential and early maturity. Hamlin also has a high regene ration capacity from protoplasts and is often used in transformation experiments. Citrus canker disease caused by the bacterial pathogen Xanthomonas axonopodis pv. citri is becoming a worldwide problem. The Xa21 is a member of the Xa21 gene family of rice which provides broad spectrum Xanthomonas resistance in rice. Since the citrus canker pa thogen is in the same genus, this gene may impart resistance to canker in citrus. The wild-type Xa21 gene contains an intron, and there are some questions whether dicot pl ants can process genes containing monocot introns (the cDNA is intron free). In the last decade, improvements of plant transformation vectors and methodologies have increased the efficiency of plant transformation and the ability to stably express transgenes in plants. DNA has been delivered into the plant cell using a wide range of tools such as Agrobacterium -mediated transformation, microprojectile bombardment, chemical (PEG) treatment of protoplasts and electroporation of protoplasts. Using chemical (PEG) treatment of pr otoplasts to transfer the gene of interest can be done by either transformation or co-t ransformation system. In co-transformation experiments, researchers used two different plasmids, one encodes the reporter gene and 60

PAGE 74

61 the other encodes the gene of interest. This is very labori ous, costly, and time consuming. In addition, the final transforma tion efficiency will be low because it is not guaranteed that in all the cases both plasmids will be transferred. A transformation system using a single plasmid, which encodes both the reporter and the gene of in terest, is an alternative. Producing transgenic plants containing the plasmid pAO3, which encodes the GFP endoplasmic reticulum (ER)-targeting and the cDNA of the Xa21 gene from the Xa21 gene family of rice into one construc tion, was among the objectives of this study. To achieve this objective, protoplasts is olated from a new embryogenic callus line of Hamlin sweet orange were transformed with plasmid DNA (pAO3) using polyethylene glycol. Transformed clones were screened for GFP expression using blue light. Polymerase chain reactions (PCR) we re performed to identify the transformed clones. Transgenic plants were regenera ted from transformed clones via somatic embryogenesis and organogenesis. Transgen ic plants containing the cDNA of the Xa21 gene were assayed by southern bl ot analysis and western blot analysis to determine if the gene is integrated into the citrus genome and functioni ng to produce RNA and subsequently protein. Materials and Methods Plasmid Construction The plasmid pARS108 containing the GFP ER-targeting gene was kindly provided by Dr. R. P. Niedz (USDA, Agriculture Research Service, US Horticultural Research Laboratory, Ft. Pierce, FL, USA). Construction of pARS108 has been described previously by Niedz et al. ( 2003). Plasmid pARS108 contains the EGFP coding sequence (GenBank accession #U55761) placed under the control of the double 35S cauliflower mosaic virus (35S-35S CaMV) promoter with the alfalfa mosaic virus (AMV)

PAGE 75

62 untranslated leader sequence and the nos terminator. An Arabidopsis signal sequence (SS) is included in the 5 end to target the protein to the ER, and the codon sequence for the amino acids HDEL were included at the 3 end for retention of the protein in the lumen of the ER (Figure 3-1 in chapter 3). Vector pCR504 was kindly provided by Dr Pamela Ronald, University of California-Davis (Figure 3-3 in ch apter 3). It contains a 3.1 kb BamHI fragment containing the entire cDNA of the Xa21 gene from rice. Plasmid pCR504 is a promoterless plasmid containing the cDNA of the Xa21 gene. Methods used for plasmid construction were similar to those described by Sambrook and Russell (2001). Plasmid pXa21-mtag has been constructe d as described in chapter 3 and used to construct a new DNA plasmid pAO3. To construct a new plasmid which contains ER-targeted GFP and the cDNA of Xa21 in one construction, first the cDNA needed to be cloned into a separate plasmid with specific restriction enzymes. Plasmi d pRTL2.vec was kindly provided by Dr. T. E. Clemente (Plant Science Initiative, University of Nebraska, Lincoln, NE, USA). This plasmid contains the 35S CaMV promoter and terminator cascade To construct the plasmid used in the transformation experiment, the BamHI fragment containing the cDNA of Xa21 with the c-myc sequence was excised from pXa21-mtag and ligated into BamHI site of pRTL2.vec (Figure 4-1). The re -ligated plasmid contained the cDNA of Xa21 gene under the control of E35S promot er and T35S terminator was designated pAORTL. This plasmid could be used in co-transformation experiments. The PstI fragment from pAORTL (E35S-TEV-Xa21 cDNA-T35S) was ex cised and inserted into the PstI site of pARS108. The resulting plasmid is referred to as pAO3. The new plasmid

PAGE 76

63 (pAO3) has both of the cDNA-mtag under the control of the 35S cauliflower mosaic virus (35S CaMV) promoter and T35S terminator and the ER-targeted GFP (Figure 4-1). Plasmid Multiplication Transformation of E. coli Before a large scale plasmid preparation can be performed, the plasmid must first be transformed into competent E. coli cells. Max efficiency DH5 TM competent cells were obtained from Invitrogen (Invitrogen Coporation, Carlasbad, CA, USA, Cat. No. 18258-012). The transformation procedure was followed exactly as described in the product manual. Quick miniprep plasmid preparation and confirmation of the orientation of the insert Plasmid DNA was extracted from severa l recovered bacterial colonies and compared to the DNA from the known plasmi d stock by restriction analysis using agarose gel electrophorosis as described pr eviously in chapter 3. To confirm the orientation of the insert, a re striction digest was then performed on the extracted DNA to test for the presence of the cDNA of the Xa21 gene and it orientation as described in previously in chapter 3. Large scale preparation of plasmid DNA To obtain a large amount of the DNA, tw o 1-liter flasks containing 500 ml LB media plus the appropriate antibiotic were inoculated with the transformed E. coli and the cultures were incubated overnight at 37 C on a shaker at 225 RPM. The DNA was extracted from the overnight culture bacteria using Wizard PlusMaxipreps DNA Purification System (Promega Corporati on, Madison, WI, USA, Cat. No. A7270). To determine the concentration of plasmid DNA, an absorbance reading at an O.D. 260 was

PAGE 77

64 obtained, (an absorbance reading of 1.0 corre sponds to 50 g of plasmid DNA per ml) (Sambrook and Russell, 2001). Figure 4-1. Schematic diagram of pAO3 plasmid. Restriction enzyme (B, BamHI ; E, EcoRI ; H, HindIII ; K, KpnI ; N, NcoI ; P, PstI; Sa, SacI ; Sm, SmaI; X, XbaI ). HDEL = Histidine, Aspartic acid, Glutam ic acid, and Leucine, respectively.

PAGE 78

65 Plant Material, Protoplast Transformation, and Culture Establishment and maintenance of suspension cultures A Hamlin sweet orange ( Citrus sinensis L. Osbeck) embryogenic callus line was induced from unfertilized ovules taken from mature fruit and maintained on Murashige and Tuckers (MT) basal medium (Murashi ge and Tucker, 1969). Suspensions cultures were maintained according to Grosser and Gmitter (1990) and subcultured every two weeks by splitting the contents between two st erile flasks and adding a 25 ml of fresh culture medium to each flask. The cells were used for protoplast isolation 4-10 days after subculture. Isolation, transformation, and cu lture of citrus protoplasts Protoplasts were isolated from an em bryogenic suspension culture of Hamlin sweet orange ( C. sinensis L. Osbeck) and maintained on a 2-week subculture cycle according to Grosser and Gmitter (1990). Protoplasts were isolated from suspension culture 4-10 days after subcu lture as described in detail previously in chapter 3. The protoplast transformation protocol was modified from the PEG-mediated protoplast fusion developed by Grosser and Gmitter (1990) for citrus somatic hybridization with slight modification as describe d previously in chapter 3. Regeneration and selection of transformed protoplasts The GFP expression was detected in the transgenic protoplasts illuminated with blue light within 24 hours after transfor mation using a Zeiss SV11 epifluorescence stereomicroscope equipped with a 100 W mercury bulb lig ht source and an FITC/GFP filter set with a 480/30 nm excitation filter and a 515 nm longpass emission filter (Chroma Technology Corp., Brattleboro, VT, USA). Continued expression of the GFP protein was monitored occasionally for the next few weeks. Cultures were treated exactly

PAGE 79

66 as described previously in chapter 3 to obtain transgenic plantlets. Transgenic shoot tips were micrografted onto Carrizo citrange or sour orange nuc ellar seedlings according to Navarro (1992) to expedite transgenic plant recovery. Molecular Analysis of Transgenic Plants Presence of the GFP gene and the cDNA of Xa21 in the selected tissue were confirmed by PCR amplification of the transgenes. The copy number and integration pattern of the transgene were determined by Southern blot an alysis. The expression of the cDNA of the Xa21 gene was determined by western blot analysis. Polymerase chain reaction (PCR) for detection of transformants The PCR was used initially to screen regenerated Hamlin sweet orange plant obtained via protoplast/GFP transformation system. Geno mic DNA was extracted from young leaf tissue of transgenic and non-tran sgenic citrus plants using a GenElute TM Plant Genomic DNA Miniprep kit (Sigma, Inc., St Louis, MO, USA, Cat. No. G2N350). To confirm the presence of GFP and the cDNA of Xa21, multiple PCR experiments were performed using two different pairs of primers for GFP and for the cDNA simultaneously as described previously in chapter 3. Southern blot analysis The genomic DNA samples used for southern blot analysis were extracted and purified from young leaves of transgenic a nd non-transgenic plan ts using the CTAB method (Sambrook and Russell, 2001) as modified by T. E. Mirkov (personal communication). Twenty g of DNA was digested with SphI and ApaLI restriction enzymes. Standard protocol for gel electr ophoresis, denaturation, and neutralization of the gel were described by Sambrook and Ru ssell (2001). After electrophoresis, the gels were treated with 0.25 N HCl for 10 minutes, and then washed with 0.4 N NaOH for

PAGE 80

67 10 minutes. DNA was transferred to a positively charged nylon membrane (Immobilon TM -Ny+; Millipore Corporat ion, Billerica, MA, USA) by capillary transfer using 20X SSC buffer overnight according to Sambrook and Russell (2001). Probe DNA for the cDNA of the Xa21 gene was prepared from an XhoI fragment (1.49-kb) of the pXa21-mtag plasmid. Probe was labeled with digoxigenin-dUTP using a random primer labeling kit (DIG High Prime DNA Labeling a nd Detection Starter K it II, Roche Applied Science, Cat No. 11 585 614 910). The probe la beling was performed according to the manufacturers manual. Fixation the DNA to the membrane, prehybridizaton, hybridization, and immunological detection were performed as described in the instruction manual of DIG High Prime DNA Labeling and Detection Starter Kit II. Western blot analysis To carry out western blot analysis, total protein was extracted from transgenic and non-transgenic plants. About 0.3 g leaf ti ssue from transgenic and non-transgenic Hamlin sweet orange plants was collected a nd ground in liquid nitrogen. To isolate the soluble fractions, the ground tissue was thawed in extraction buffer [50 mM Tris-HCl, pH 6.5; 1 mM EDTA; 150 mM NaCl; 0.1% Triton X100]. Prior to use the extraction buffer immediately, the following prot ease inhibitors were added: 2 g/ml Antipain; 2 g/ml Leupeptin; 2 g/ml Aprotinin; 1 mM of 4[2-aminoethyl]-benzenesulfonyl fluoride (AEBSF) Sigma; and 5% of 2mercaptoetha nol. Samples were incubated at 4 C for 30 minutes with shaking and then centrifuge d at 10,000 RPM for 10 minutes at 4 C. The supernatant was recentrifuged at 13,000 RPM for 10 minutes at 4 C. The supernatant was either immediately subjecte d to protein blot analyses or stored at -80 C after determinating the concentra tion of the protein by the me thod of Bradford (Bradford, 1979). After adding the loading dye and boiling the samples for 5 minutes, total protein

PAGE 81

68 (35 g) for each sample was separated on 5% stacking and 6.5% separation gels in a MiniProtean III cell (Bio-Rad) according to Laemmli (1970) using Tris-glycine as the SDS-PAGE electrophoresis buffer. Proteins were electrophore tically transferred to a PVDF membrane (Immobilon TM P; Millipore Corporation, Bedford, MA, USA, Cat. No. IPVH 000 10) using Trans-Blot Cell (BioRad). The non-specific binding sites on the membrane were then blocked with Blotto [5% non-fat dried milk in TTBS ( 100 mM Tris-HCl, pH 7.9; 150 mM NaCl; 0.1% Tween 20) (see appendix C)] for one hour at room temperature. The membrane was incubated with primary anti body (anti-c-myc, 1:700) in 3% bovine serum albumin (BSA) Fwashes in TTBS, the membrane was incuba ted with secondary antibody (C-myc: Antimice IgG) (Amersham Biosciences Corp, Pi scataway, NJ, USA, Cat. No. NXA931) for one hour at room temperature, followed by three 10-minute washes in TTBS. Detection of the protein band on the blot was carried out according to the ECL Plus Western Blotting Detection Kit instru ction (Amersham Biosciences Corp, Piscataway, NJ, USA, Cat. No. RPN2133). The membrane was exposed to X-ray film. Results and Discussion Plasmid Preparation The cDNA of the Xa21 gene was inserted into plasmid pRTL2.vec under the control of 35S CaMV promoter and CaMV poly A terminator. A c-myc epitope sequence was tagged to the 5 end of the cDNA as described prev iously in chapter 3. This plasmid was designated pAORTL. The PstI fragment from pAORTL (E35S-TEV-Xa21 cDNAT35S) was excised and inserted into PstI site on pARS108. The new construction was referred to as pAO3. Figure (4-1) shows a schematic diagram of the construction of pAO3 plasmid. Chemically competent E. coli strain DH5 TM was transformed with

PAGE 82

69 pAO3 plasmid according to the manufactures instructions. Colony selection was performed using PCR with gene specific primers. Testing for the orientation of the insert was performed using restriction enzyme s according to Sambrook and Russell (2001) prior to large scale pr eparation of the plasmid DNA. The positive bacterial colonies were replated and single colonies were selected to begin large scale plasmid DNA preparation as described previously. Prep s with DNA concentration of 0.5 g/l and above were used in transformation experiments. Plasmid DNA was stored at -20 C for short-term use and at -80 C for long-term use. Transformation of Citrus Prot oplasts and Plant Regeneration Isolation and transformation of protoplast and the ultimate regeneration of plants are controlled by several factor s. The two most important f actors are the quality of the starting material (cell suspensi on) and quality of the protoplas t after isolati on (high yields of viable protoplasts with lit tle or no debris). The cell su spension line used was chosen from Hamlin sweet orange new embryogenic cells because they were exhibiting a good regeneration capacity. The best protoplasts were obtained from suspensions 4-10 days after subculture when isolated according to Grosser and Gmitter (1990). Using the sucrose-mannitol gradient allows for the removal of the non-viable protoplasts and cellular debris which could interfere with the uptake of the plasmid by the viable protoplasts, or the regenerati on in the following stages. More over, starting with pure and viable protoplasts could possibly in crease the transformation efficiency. Transient and stable transformation frequencies using GFP as selectable marker Transient expression of GFP was visible at the protoplast level as early as 6-12 hours after transformation with pAO3 plasmid. Transient e xpression of green fluorescence was intense 16-24 hours after tran sformation (Figure 4-2 B). The average

PAGE 83

70 transient transformation freque ncy varied between experiments. This may have been influenced by the culture cycle stage and/or the cultivar used as source of protoplasts. Using a 2-week subculture cycle, protoplast isolated from 4to 10-day-old cell suspension culture showed the best transien t expression and divisi on capacity. A similar results was reported by Fleming et al. (2000). Stable transformation frequencies, based on the number of transformed protoplasts and not corrected for plating effici encies, were in the range of 1X10 -5 protoplasts. These results are consistent with others in the li terature. Davey et al. (2005a) reported that protoplast transformation freque ncies remain low (one in 10 4 protoplasts giving stably transformed tissues) which requirers protoplast-to -plant system with efficient selection to recover transformed cells and tissue. Transgenic tissue was selected from non-transformed tissue and transf erred to solid medium approximately 2 months after the transformation procedure. Using the FITC/GFP filter set, detection of transgenic calli by exposing regenerated tissue with blue light was detected by expression of a bright bluegreen color (Figure 4-2 C and D). Autofluorescence was generally not detected from non-transformed calli (Figure 4-2 C), with th e occasional expression of a pale yellow fluorescence in older cultures. Visual selecti on of transgenic citr us is particularly effective at this stage as the colonies are small enough (250-500 mm) so that a single plate containing thousands of colonies can be rapidly screened, but large enough to be easily rescued and cultured individu ally. Aside from the expression of GFP detectable with blue light, the transgenic tissue appear ed normal and could not be distinguished from non-transformed tissue under white light. At the embryo stage, it is very easy to

PAGE 84

71 distinguish between transformant (green) and non-transformant once (red) (Figure 4-2 D). Elliott et al. (1999) tested the effi ciency of visual selection by GFP with no additional selection and concluded that withou t an additional selective agent, preferential growth of GFP -positive tissue is difficult to maintain. However, when GFP-positive tissue can be identified, selectively cultured, and plants regenerated, GFP has been successfully used as a visual screenable ma rker (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005). Protoplasts form colonies or embryoids directly from single cells, making the selection and regene ration of transgenic indivi duals an efficient process limited only by the efficiency of the particul ar protoplast system. Fluorescent protoplastderived colonies were regene rated into plants and maintained as cell lines. Nontransformed green fluorescent colonies were not observed in any of th e subculture control plates. Plant regeneration The newly obtained Hamlin sweet orange embryogenic suspension culture line used in these experiments was selected because it was rapidly proliferating and routinely provided reasonable yields of good quality prot oplasts and high regene rating efficiencies under the optimum condition. However, due to ma ny factors that influence the procedure, it was difficult to optimize the condition. Embr yogenic callus and part icularly suspension cultures of some cultivars have high a rate of mutations and cytological aberrations that diminish the capacity for whole-plant r ecovery (Grosser and Gmitter, 1990). The high performance characteristics and high regenera tion capacity of the Hamlin callus line merited its use in these experiments. Moreover, Hamlin is one of the highly susceptible varieties to citr us canker pathogen.

PAGE 85

72 Generally, the colonies selected for GFP expression were transferred to EME-maltose medium 4-8 weeks after transf ormation. Shortly thereafter, embryos began to form. Transformed embryogenic callus de veloped normal, bipolar, heart shaped embryos when cultured on cellulose acetate membranes overlaid on solid EME-maltose medium (Figure 4-2 D). The mechanism of membrane induced embryo normalization remains unclear (Niedz et al ., 2002). These embryos were removed and transferred to another fresh plate containing EME-maltose medium, and allowed to proliferate. Embryos were then transferred to 1500 medium for further growth. Efforts to regenerate transgenic plants were focused on these cultures. More than 200 transgenic somatic embryos recovered from several experiments were cultured on B+ germination medium for two passages. The ma jority of these embryos became larger, but did not convert to plantlets. However, as is often the case with citrus somatic embryos, multiple shoots were regenerated following culture on DBA3 (Deng et al., 1992). Only eight embryos produced shoots, but three of them produced both shoots and roots. Half of the plants were transferred to soil but were not successfully acclimated, probably due to poor root quality. The other half and shoots from the other germinated embryos were cultured on RMAN root-induction medium, and most of them successfully produced roots (Figure 4-2E). Some of these plants were transferred to soil, but again all of them were not successfully acclimated, probably due to poor root quality. Also, a fungal potting soil contamination was determined to at least partially responsible. As mentioned, the non-converted transgenic embryos were sectioned and cultured on DBA3 shoot-induction medium for five to seven passages, but none of them produced shoots. Shoots recovered from the eigh t lines were culture d on RMAN root-induction

PAGE 86

73 medium, and again most of them successfully produced roots (>90%). Transgenic plants growing on their own root are showing a high level of GFP expression in the root, attributed to the absence of chlor ophyll in root tissue (data not shown). Figure 4-2. Citrus transgenic plant regeneration and GFP monitoring from protoplast to plant. (A) protoplasts af ter isolation from the ring between sucrose 25% and mannitol 13%; (B) protoplasts after 24 hours from transformation with pAO3 by direct DNA uptake protocol using Polyethylene Glycol (PEG); (C) protoplast-derived calli (transformed and non-transformed) on EME-maltose solid medium 36 days after transforma tion; (D) transgenic (green) and nontransgenic (red) somatic embryos grow ing on EME medium 6 to 8 weeks after transformation; (E) in vitro rooted transgenic citrus plants constitutively expressing the GFP gene; (F) shoot tip grafting of transgenic Hamlin sweet orange onto Carrizo plant in soil (under the tip).

PAGE 87

74 There are several reasons for the low re generation efficien cy in protoplast transformation experiments. First, problems rela ted to the culturing of the protoplast, or the condition of the cell suspension cultures used for protoplast isolation could be influential. If large numbers of microcalli are produced (i.e., high plating efficiency), there is a tendency for callus to be form ed at the expense of embryo induction. If embryos do form, there is often an overgrowth of those embryos by the callus, which inhibits further embryo development. Other r easons for the failure of plant regeneration include contamination of the media, the condi tion of the protoplast after isolation and transformation, and possibly other unknown factors. Shoots failing to produce roots were either in vitro grafted to nucellar seedlings of Carrizo citrange or shoot-tip grafted onto Carrizo citrange and/ or sour orange in the green house. Since small plantlets did not pass the a cclimation stage in soil, they have been used as a source of grafting material. The grafting technique was chosen based on the shoot condition. Small and soft shoots were chosen for in vitro micrografting, whereas larger and more hardened ones were chosen for shoot-tip grafting in the greenhouse. One hundred percent of the i n vitro micrografts were successf ul, producing more vigorous plantlets that were acclimated with 90% success rate. Shoot-tip grafting has been used succe ssfully to recover transgenic shoots regenerated from citrus epicotyls treated with Agrobacterium (Pea et al., 1995a; Pea et al., 1997; Bond and Roose, 1998; Cervera et al., 2000). Grafting of small shoots (<1 cm) as they arise overcomes rooting difficulties that can occur (Moore et al., 1992). Rooting protoplast derived sweet orange plants can take up to 3 month before roots emerge. Shoot-tip grafting greatl y accelerates the recovery of plants. About 72 transgenic plants

PAGE 88

75 were obtained by using shoot tip grafting from eight different transgenic events. The typical morphology of the regene rated transgenic Hamlin plants was similar to that of the non-transformed plants recove red from the control cultures. The time frame from initial protoplast isolati on to plant establishment in soil varied greatly from one experiment to another. Seve ral factors influence th is chain of events. Delays in the osmoticum reduction proce ss and transferring slowed down calli and embryo growth. In some experiments, rapidl y developing embryos c ould be transferred directly from EME to B+ medium, skipping th e transfer to 1500 medi um. In others, they required an additional subculture on EME, 1500, or B+ media. However, if all the stages went smoothly, the plantlets were establishe d in soil in as little as 5 to 6 months. From over 20 transformation experiments w ith pAO3, only eight transgenic events were recovered and 72 transgenic plants were propagated using grafting techniques and transferred to the greenhouse. GFP expression at the mature stage of the transgenic plants At the mature plants stage, the fluorescence intensity varied among different parts of the plant, being higher in new growing leav es than in old ones (Figure 4-3 and 4-4). That could be due to lower metabolic activ ity and chlorophyll accumulation that partially masked the green fluorescence provided by the GFP in old tissue. Haseloff et al. (1997) reported that they could consistent ly regenerate intensely fluorescent Arabidopsis plants when GFP was targeted to the ER. They also re ported difficulty in regenerating plants from the brightest nontargeted transformants. Both results ar e similar to our observations in citrus. Other than the differences disc ussed above, developmental and regeneration responses appeared similar between tr ansgenic and non-transgenic plants.

PAGE 89

76 Figure 4-3. ER targeting of GFP expression in a mature citr us leaf. New growing leaf from a transgenic plant obtained from pAO3 were scanned using confocal laser scanner with setting for three different fluorescent wavelengths, green, red, and blue, simultaneously with a 488, 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spectral window, respectively. (A) green, (B) red, (C) blue, and (D) overlay of three filters together.

PAGE 90

77 Figure 4-4. ER targeting of GFP expression in a mature citr us leaf. Old growing leaf from a transgenic plant obtained from pAO3 were scanned using confocal laser scanner with setting for three different fluorescent wavelengths, green, red, and blue, at the same time with a 488, 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spectral window, respectively. (A) green, (B) red, (C) blue, and (D) overlay of three filters together.

PAGE 91

78 Molecular Analysis Polymerase chain reaction for selection of transformants When putative transgenic scions graf ted on Carrizo citrange seedlings had developed several leaves, a leaf was removed fr om each plant, excited with blue light to confirm GFP expression. PCR was used initially to screen regenerated Hamlin sweet orange plant obtained via transformation. P CR analysis was performed using DNA from leaves of regenerated plants, both transgenic and non-transgenic. To confirm the presence of the GFP gene and the cDNA of the Xa21 gene in the transgenic plant genome, multiple PCR experiments were performed using two different pairs of primers for GFP and Xa21 simultaneously. A predicted internal fragment of about 780 nucleotides was amplified in all DNA samples from green fluorescent leaves (Figure 4-5). No amplification was detected in DNA samples from non-transgenic regenerated control plants, which emitted red fluorescence under blue light. A predicted internal fragment of about 1400 nucleotides was amplified in 100% of the DNA samples from green fluorescent leaves, which corresponds to Xa21 (Figure 4-5). This is compared with protoplast/ GFP co-transformation system in which just 35% of the DNA samples from green fluorescent leaves had the co rresponded band to the cDNA of the Xa21 gene. Thus, these results indicated that the final transformation efficiency for protoplast/GFP transformation is higher th an for co-transformation. Screening for transformants using southern blot analysis When the grafted plants measured 20-30 cm in height, southern analysis was performed to confirm the stable integration of the cDNA of Xa21 coding sequence in the transgenic plants genome and provide some information related to their integration pattern. Five chosen putative transgenic lines (grown in the greenhouse for more than

PAGE 92

79 12 months), which were PCR positive for GFP and Xa21, were analyzed. Genomic DNA was digested with SphI a unique restriction site within the 5 end of the integrated sequence of the cDNA of the Xa21, and ApaLI that does not cut in Xa21. Therefore, bands hybridizing to the probe result from one site within the vector and one site within the flanking genomic DNA. Hybridization pa tterns with 1-3 bands/copy numbers were observed (Figure 4-6). In general, the dire ct-gene-mediated met hod results in more multiple insertions and rearranged fragments in transgenic plants than Agrobacterium mediated transformation (Dong et al., 1996; Krasnyanski et al., 1999) and that was the case for this study on citrus. Even though different hybridiz ation patterns were observed, the results of southern blot analysis provi ded molecular evidence confirming the presence of the introduced cDNA of the Xa21 gene in the Hamlin sweet orange genome. Many researchers reported that transgenic plants with multiple copies of the integrated DNA into one or more chromosomal location have been shown to be more likely to exhibit transgene silencing (Iyer et al., 2000; Jame s et al., 2002) by affecting the level and stability of gene expression. However in a recent study, Craig et al (2005) reported that there is no correlation between the number of gene insertions and gene expression level, suggesting that multiple insertions may have little or no effect on transgene expression. Confirmation of transformation using western blot analysis Leaf tissue from transgenic plants was us ed to obtain crude protein extracts for Western analyses. The extracted proteins ( 35 g per lane) were separated by SDS/PAGE on 5% stacking and 6.5% separation gels and transferred to Immobilon-PVDF membranes for immunostaining. The western blots were deve loped with anti-c-myc as the primary antibody followed by anti-mice immunoglobulin G (IgG) antibody

PAGE 93

80 conjugated with horseradish peroxidase as a secondary antibody as described previously. Detection of immune complexes was ach ieved by enhanced chemiluminescence according to ECL Plus Western Blotting Detecti on Kit. Finally, to verify that the gene was integrated and expressed into the transgenic plants, expression of Xa21 was detected on the membrane. In this assay, a protei n product of 120 kDa corresponding to the expressed Xa21 was seen in seven out of eight tested transgenic plants (Figure 4-7). In this assay, soluble extracts of the tr ansgenic rice expressing the wild-type Xa21 gene and non-transgenic rice were used as positive and negative controls. As shown in Figure (4-7), a non-specific band appeared in a ll the samples which is larger than the Xa21 corresponding band. One transgenic plant was PCR and southern analyses positive, but did not have the corresponded band for the Xa21 protein. The most likely explanation for this phenomenon, even though the DNA has been transferred and integrated into the plant genome, it was not transcribed or expresse d. As shown, all but one Southern-positive plant transformed with cDNA of the Xa21 expressed Xa21 protein at detectable levels. According to the literature, this is the first time that a gene from rice has been stably integrated and expressed in citrus plants. After more than 12 months growing in the greenhouse, all transgenic plants showed a nor mal phenotype, identical to that of control non-transformed Hamlin orange plants.

PAGE 94

81 Figure 4-5. Multiple PCR analysis to detect the presence of the GFP (0.8 kb) and the cDNA of the Xa21 (1.4 kb) genes in transgenic citrus plants. Lane 11 is a positive control for both genes (pAO3 plasmid). Products are seen in lanes 2-9 indicate the presence of GFP gene and the cDNA of the Xa21 gene in the transgenic plants. Lane 1 is a non-transgenic control, and lane 10 is negative control (H 2 O), MM = 1 kb DNA ladder. Figure 4-6. Southern hybridization analysis of Hamlin sweet orange plants with the cDNA of the Xa21 gene. The probe was a 1641-bp NcoI855 NcoI2496 fragment of the cDNA of the Xa21 gene isolated from plasmid pAO3. Lanes 1-6 Genomic DNAs were digested with SphI and ApaLI Lanes 1-5 transgenic plants and lane 6 non-transgenic plant.

PAGE 95

82 Figure 4-7. Western blotting anal ysis of transgenic Hamlin sweet orange. The extracted proteins (35 g per lane) were sepa rated by SDS/PAGE on 5% stacking and 6.5% separation gels and transferred to polyvinylidene difluoride membranes for immunostaining. Soluble extracts tr ansgenic rice expres sing the wild-type Xa21 gene (lane 11), non-transgenic rice (lane 12), non-transgenic citrus (lane 2), transgenic citrus positive for GFP and Xa21 genes by PCR and Southern (lanes 3-10) were subjected to western blotting. Molecular markers indicated in lane 1. The western blots were devel oped with anti-c-Myc as primary antibody and c-Myc: Anti-mice IgG as a secondary antibody as described in the material and methods.

PAGE 96

CHAPTER 5 ESTIMATING THE COPY NUMBER OF TRANSGENES IN TRANSFORMED CITRUS PLANTS BY QUANTITATIVE REAL-TIME PCR Introduction Genetic transformation has become a widesp read tool in both basic research and commercial plant breeding programs. Its applicat ion requires that transgenes be stably integrated and expressed in the plant genom e. During the last decade, the area under cultivation with transgenic crops has increased worldwide from 1.7 million hectares in 1996 to 81 million hectares in 2004 (Figure 5-1), and were grown mostly in the U.S. (47.6 million ha), Argentina (16.2 million ha), Canada (5.4 million ha), Brazil (5.0 million ha), China (3.7 million ha) a nd Paraguay (1.2 million ha) (James, 2004). When new transgenic plants are develope d, two early and essential questions are which plants contain the transg ene and in how many copies. T hus, transgenic plants must be characterized at the molecular level b ecause the new DNA is randomly inserted into the plant genome. While multiple copies of the transgene are useful for over-expression experiments, transformants that carry multiple copies of the integrated DNA into one or more chromosomal locations have been show n to be more likely to exhibit transgene silencing (Iyer et al., 2000; Ja mes et al., 2002), by affecting th e level and stability of gene expression. However, in recent study Craig et al. (2005) reported that there is no correlation between the number of gene inser tions and gene expre ssion level, suggesting that multiple insertions may have little or no effect on transgene expression. Thus, estimating transgene copy number is critical to the selection and cultivation of the 83

PAGE 97

84 transgenic plants. Most of the transgenic plants obtained via direct DNA delivery methods such as particle bombardment, electroporation, PEG, etc., may consist of complex patterns of transgene integrations, i.e., multiple copies and/or partial insertion of the integrated DNA (Dong et al., 1996; K ohli et al., 1998; Krasnyanski et al., 1999; Srivastava et al., 1999). Less than 20% of th e transgenic events generated using direct DNA delivery display low-copy integration (three copies or less) (Song et al., 2002). To date, there is no transforma tion method that can completely control the number of transgene integrations into the plant genome. Therefore, transgenic events should be screened as early in the transformation pr ocess as possible to identify multiple copy transformants, allowing for continued focus on low copy number transformants. Such screening can be very difficult to handle, especially when the number of independent transformed events is sufficiently large. Southern blot analysis, in which a bl ot of digested genomic plant DNA is hybridized with a labeled DNA probe corres ponding to the transgene to produce an instructive band pattern, has been used to estimate transgene copy number. This method has become a routine procedure in many labs around the world because of its highly reliable results under the optimum condition. Ho wever, it is quite co stly in terms of reagents, labor, and time, and also requires a considerable amount of DNA from fresh or frozen material. Furthermore, Southern bl ot analysis may not be accurate enough to determine a copy number greater than tw o (Honda et al., 2002), although multiple integrations are often found w ith transgenic plants (Dong et al., 1996; Kohli et al., 1998; Krasnyanski et al., 1999; Srivastava et al., 1999 ). Some other methods could be used for the same purpose including comparative genomic hybridization (Larramendy et al.,

PAGE 98

85 1998), fluorescence in situ hybridization (Kallioniemi et al., 1996), multiplex amplification probe hybridizati on (Armour et al., 2000) and microarray (Li et al., 2002). Unfortunately, all of those methods share the sa me limitations as southern blot analysis. Figure 5-1. Global area of bi otech crops (James, 2004). The polymerase chain reaction (PCR) is one of the most sensitive techniques for detecting the integrated gene in the transgen ic plant genome, and thus it can reduce the amount of DNA required for analysis (W ong and Medrano, 2005). Advances in PCR instrumentation and fluorescence chemistry have made the precise quantification of specific amplification products possible wit hout the need for post-PCR analyses. In contrast to conventional PCR where only the amount of end product is determined

PAGE 99

86 (Freeman et al., 1999), real-time PCR allows researchers to track the changes of PCR product during the reaction. Quan titative real-time PCR technology relies on the ability to progressively monitor fluorescence em itted from nonspecific double-stranded DNA binding dyes (SYPR Green I) or fluorophore-labeled specific probes (TaqMan ) that hybridize with target sequences during the exponential phase of the PCR reaction. The probe is labeled at the 5 end with a fluorescent molecule and at the 3 end with a quencher molecule. In an intact probe, the 5 and 3 labels are in close proximity, and the quencher silences the fluorescent signal th at would otherwise be generated by the 5 fluorescent label (Livak et al ., 1995). In the TaqMan assa y, the degradation of targetspecific probe molecules by the 5 -3 exonuclease activity of the Taq DNA polymerase liberates the fluorescent label, which subse quently produces a fluorescent signal during each cycle of the amplification. For a high fl uorescent signal, the probe must bind tightly to the template, enabling Taq polymerase to cleave nucleotides from the 5 end of the probe (Bubner and Baldwin, 2004). This fl uorescent signal is proportional to the accumulation of PCR product generated which is proportional to the quantity of initial DNA template in the sample (Livak et al., 1995). Fluorescence levels are detected during each cycle of amplification by specialized in strumentation. During the early cycles of amplification, the fluorescence level is low, but at a critical point fluorescence accumulates to a significant level perceived by the instruments detection system. This point, which is called the threshold cycle (C t) depends primarily on the starting amount of nucleic acid (Heid et al., 1996). The higher the initial amount of nucleic acid in the reaction, the smaller the Ct valu es. In practice, there is a li near relationship between the log of the starting quantity of the template and its Ct value during real-time PCR reaction.

PAGE 100

87 Accordingly, the Ct is defined as the cycl e at which the reactions fluorescence reaches the threshold line. Quantitative real-time P CR (qTR-PCR) techniques have been reported for determining transgene copy number in transformed plants (Ingham et al., 2001; Mason et al., 2002; Song et al., 2002; Yang et al., 2005). To date, the use of qRT-PCR for estimati ng transgene copy number in citrus has not yet been investigated. In this chapter, we will describe a quantitative RT-PCR assay for fast and accurate estimation of exogenous Xa21 gene copy numbers in transgenic citrus by comparison with the citrus endogenous reference gene coding for Lipid Transfer Protein ( LTP ) (Wu and Burns, 2003). We used quantitative multiplex TaqMan assay, in which two TaqMan probes were simultaneously used within the same reaction to identify the copy number of the transgene. One Ta qMan probe was designed to identify the transgene (Xa21) while the other identified an endogenous reference gene ( LTP ). We have chosen the citrus lipid transfer protein ( LTP ) gene (Wu and Burns, 2003), a known two-copy gene, as a reference gene. For the purpose of choosing a gene to use as an endogenous control in a comparative Ct multip lexed PCR reactions, any gene, regardless of how many homologous sequences may exist in the genome, may successfully be used (Schmidt and Parrott, 2001). Since the pr oportion of the reference endogenous gene remains constant relative to the total ge nomic DNA, it was possible to normalize differences in the amount of DNA in each re action. Moreover, real-time PCR results can be subjected to statistical analysis. Materials and Methods Transgenic Plants Plasmid pXa21-mtag and pAO3 containing cDNA of the Xa21 gene under the control of 35S CaMV promoter (described pr eviously in chapters 3 and 4, respectively)

PAGE 101

88 were introduced into Hamlin sweet orange ( Citrus sinensis L. Osbeck) by means of protoplast/GFP transformation or co-transfo rmation system. Transgenic plants were obtained as described previous ly in chapters 3 and 4. DNA Extraction For the events generated containing th e plasmid DNA pXa21-mtag based on the conventional PCR results, genomic DNA samples from 34 transgenic plants were used for the quantitative RT-PCR. Genomic DNA was extracted and purified from about 100 mg of young leaf tissue using a GenElute TM Plant Genomic DNA Miniprep kit (Sigma, Inc. St. Louis, MO, USA, Cat. No. G2N350). For the PCR analysis, genomic DNA was diluted to 10 ng/l in free nuclease water (Promega). The citrus genomic DNA samples used for Southern blot analysis were extracted and purified from fresh leaves of transgenic and non-transgenic plants acco rding to the CTAB method (Sambrook and Russell, 2001) and modified by T. E. Mirkov (personal communi cation). Genomic DNA was measured by UV absorption at 260 nm, while DNA purity was evaluated based on the UV absorption ratio at 260/280 nm. Twenty g of DNA was digested with SphI and ApaLI restriction enzymes. Standard protocol for southern blot an alysis including gel electrophoresis, denaturation, neutralization, fixation, prehybridization, hybridization, and immunological detection was performed as described previously in chapter 3. Quantitative Real-time Polymera se Chain Reaction (qRt-PCR) Primers and probes The oligonucleotide primers and TaqMan probe used in this study (Table 5-1) were designed with the Primer Express 2.0 soft ware (Applied Biosystems-Perkin-Elmer, Foster City, CA, USA). All primers and probes were synthesized by Integrated DNA Technologies (IDT, Coralville, IA, USA). The internal oligonucleotid e probe specific for

PAGE 102

89 the Xa21 gene (Song et al., 1995) was 5 end-labeled with the fluorescent reporter dye FAM (6-carboxy-fluoroscein, excitation wavelength = 494 nm, emission wavelength = 521nm), whereas the probe specific for the endogenous gene, lipid transfer protein ( LTP) (Wu and Burns, 2003), was labeled with the fluorescent reporter dye VIC (excitation wavelength = 535 nm, emission wavelength = 555 nm, a proprietary dye by ABI, Foster City, CA, USA) on the 5 end. The 3 end of both probes was labe led with the fluorescent quencher dye TAMRA (6-carboxy-tetramet hyl-rhodamine) and phosphate-blocked to prevent extension during PCR cycling. Th e Xa21-mtag-2823F/Xa21-mtag-2889R primer pair combined with the Xa21-mtag-2847T probe and LTP-178F/LTP-236R primer pair with the LTP-196T probe were employed for Xa21 and LTP quantitative real-time PCR yielding amplicons of 67 bp and 86 bp, respectively. The LTP gene was chosen as lowcopy number endogenous control for the citrus samples in the comparative Ct method. Table 5-1. Primers pairs and probes of LTP a and Xa21 b genes used for quantitative realtime PCR assays Name Orientation Sequence (5 -3 ) Length (bp) Position (bp) LTP-178F Forward primer GC TGCCGCCAGAACCA 16 178-194 LTP-236R Reverse primer GCGGCTTGCTTCAAGCA 17 236-253 LTP-196T Forward probe CCTGACCGCCAAACTGCATGC 21 196-217 Xa21-mtag-2823F Forward prime CGGCCAACTGACAGTACATTCA 22 2823-2845 Xa21-mtag-2889R Reverse primer CATGTAGGCCCAGTTCAACGT 21 2889-2910 Xa21-mtag-2847T Forward probe CCCGATTTGGGCCTCCGTCAG 21 2847-2868 a LTP gene from GenBank acc. No. AF369931 b cDNA of Xa21 gene from GenBank acc. No. U37133 Real-time PCR reactions and conditions Quantitative multiplex real-time PCR (qRT-P CR) assays were carried out in a fluorometric thermal cycler (ABI PRISM TM 7000 Sequence Detection System, Applied Biosystems-Perkin-Elmer, Foster City, CA, USA) in 96-well plat e microtubes using a TaqMan system in a final volume of 25 l. The reaction mixture contained 1x TaqMan Universal PCR Master Mix (2X) (Applie d Biosystems), 25 ng DNA sample and an

PAGE 103

90 optimal concentration of each transgene-spec ific primer and probe (900 nM each primer and 300 nM each probe, see appendix D). The amplification conditions consisted of one cycle of one 2 minute cycle at 50 C and a 10 minute cycle at 95 C, followed by 40 cycles of 15 seconds at 95 C and 1 minute at 60 C. Fluorescence was monitored during the 60 C annealing step. Each sample including all the cont rols and points from the standard curves, were quantif ied in four replicates. The data were analyzed with ABI PRISM TM 7000 SDS software ver.1.1 provided by P. E. Applied Biosystems. To generate a standard curve for the endogenous LTP and the transgene Xa21, genomic DNA from one of the transgenic lin es was used (Mason et al., 2002). Standard curves were calibrated using four concen trations of genomic DNA of the chosen transgenic line, i.e., 25, 50, 75, and 100 ng per r eaction. These standard curves were used for relative quantifica tion of the endogenous gene and the transgene. A no-template control (NTC) was also prepared as a negative control for the analysis. Optimization of primer concentrations The variables most likely to affect PCR efficiency are MgCl 2 primer, and probe concentration. It is best to maintain a consta nt annealing temperature if possible, as all assays can be run under the same PCR cyc ling condition. A preliminary experiment was performed to optimize the primer concentra tion. Real-time PCR reactions were run with different concentrations of primer. Prim er concentrations were 100, 300, and 900 nM (final concentration) for the e ndogenous gene and the transgene. PCR efficiency PCR amplification efficiency of the reaction is an important factor when using a relative quantification method. The common logarithm of dilution series of DNA was plotted against the Ct values of those dilutions. The PCR efficiency can be calculated

PAGE 104

91 from the equation E = 10 -(1/slope) 1 as described by Ginzi nger (2002). The ideal slope should be -3.32 for 100% PCR efficienc y, which means that the PCR product concentration doubles during every cycle within the exponential phase of the reaction (Gibson et al., 1996). However, using the rela tive quantification me thod requires that the PCR efficiencies of all genes be similar and preferably at or over 90% (Ginzinger, 2002). Calculation of Copy Number and Statistical Analysis To calculate the Xa21 copy numbers, we used a relative quantitative method (referred to as comparative Ct) that combin ed two absolute quantification reactions: one for the target-specific gene and the other fo r the endogenous reference gene (Schmidt and Parrott, 2001; Mason et al., 2002; Ding et al ., 2004; Yang et al., 2005). Therefore, we compared the quantified results of the Xa21 transgene with those of the LTP endogenous gene. Standard curves were prepared for the transgene Xa21 and the endogenous LTP gene; these were compared to the experimentally determined levels in each transgenic citrus sample, and the amount of transg ene was divided by the amount of endogenous gene. Each reaction ha d four replicates. We followed the calculation method descri bed by Mason et al. (2002), which can be summarized as follows: Using the generated standard curve to determine the starting quantities for the transgene and the endogenous then the ratio: r line = SQ Xa21 /SQ LTP Eq. 1 where SQ is the starting qua ntities. The uncertainty ( r line ) was propagated from equation No. 2 r line = r line [( SQ Xa21 /SQ Xa21 ) 2 + ( SQ LTP /SQ LTP ) 2 ] Eq. 2

PAGE 105

92 To determine the copy number for each line, Ingham et al. (2001) and Bubner and Baldwin (2004) chose a transgenic line whos e copy number is known to be one copy as a calibrator. The r line ratio for the calibrator (r cal ) line would be associated with one copy of the transgene, therefore the copy number fo r other lines would be determined as r line /r cal Since such a transgenic line is not available in our case, we will use the virtual calibrator as described by Mason et al. (2002) in which all the availa ble lines are considered. The main idea is to find a value called r 1 corresponding to copy number one, then this value will be used instead of r cal in determining the copy numbers of the transgenic lines. To choose the value of r 1 the following equation should be applied: F(r1) = lines [r line /r 1 N(r line /r 1 )] 2 / ( r line ) 2 Eq. 3 Where N(r line /r 1 ) is the nearest integer of r line /r 1 (for more information about F(r 1 ) see Mason et al. 2002). The r 1 value in this study was 0.37 for the transgene Xa21 Once r 1 was calaulated, the copy number for each line was determined as r line /r 1 All the calculation steps were presented together with their 95% confidence interval. Results and Discussion Transgene Xa21 Copy Number Estimation in Transg enic Citrus by Comparison to the Endogenous LTP Gene A pair of primers and an internal hyb ridization fluorogenic TaqMan probe for detecting the endogenous LTP and the transgene Xa21, present in transgenic citrus plants, were designed for quantitative real time PCR (Table 5-1). In this method, multiplexed PCR reactions were performed whereby the am plification of the transgene of interest ( Xa21) was compared to that of an endogenous gene ( LTP ). The two genes had different fluorogenic TaqMan probes. By amplifying both genes in the same reaction tube simultaneously, we achieved identical conditio ns. DNA was prepared from the transgenic

PAGE 106

93 plants as well as the non-transgenic plants (c ontrol). Four replicates of samples from each plant were subjected to the multiplex reaction. Standard curves were obtained from serial dilution of a transgenic line using ABI PRISM TM 7000 Sequence Detection System. The correlation coefficients of the standard curves were 0.98 and 0.985 for the endogenous LTP and the transgene Xa21, respectively (Figure 5-2 and 5-3). Validation of the Standard Curves and PCR Efficiency For any quantitative assay, the establishment of a standard curve is one of the key steps in determining the copy number of the transgene. Ideally, a standard curve should be established using one of the transgenic lines in which the copy number had been previously determined by Southern blot analys is. In our case, such a line of transgenic was not available. Therefore, transgene copy number estimations were made in relation to standardized curves obtained fr om quantitative RT-PCR analysis of serial standard DNA dilutions of the LTP and Xa21 genes. Before using the relative quantitative method to estimate the transgene copy numbers, we need ed to validate the curves and demonstrate that the reaction efficiencies for the transgenes and the endogenous reference gene were identical or very close. The success of the assay depends on the assurance that the endogenous and transgene amplifications occur at approxima tely equal efficiencies. Thus, determining PCR efficiency is especially important for relative quantification. Serial dilutions of genomic DNA from one of the transgenic plants were assayed in multiplex reactions to determine the reactions efficiency accordi ng to the equation desc ribed by Ginzinger (2002). By plotting the comm on logarithm of dilution series of DNA (25, 50, 75, and 100 ng) against the Ct values of these diluti ons, the efficiency can be calculated by the formula [10 (1/-slope) 1].

PAGE 107

94 Figure 5-2. Real-time PCR am plification of endogenous LTP and transgene Xa21 genes. (A) real-time PCR logarithmic plot resu lting from the amplification of four serial dilutions of a citrus standard DNA using the LTP -specific primers and probe; (B) real-time PCR logarithmic plot resu lting from the amplification of four serial dilutions of a citrus standard DNA using the Xa21 -specific primers and probe; (C) multiplex real-time PCR for both genes simultaneously.

PAGE 108

95 Figure 5-3. Standard curve of endogenous LTP and transgene Xa21 genes. Correlation coefficient and slope values are indicated. The calculated Ct values were plotted versus the log ng total DNA of each starting quantity. Each sample was run in four replicates. These efficiencies were 98% for endogenous LTP and 96% for transgene Xa21 in the standard dilutions, indicating high and ve ry close efficiency in both reactions. The high R 2 values obtained indicate very low pipeting error in this experiment. The ideal slope should be -3.32 for 100% PCR efficien cy (Ginzinger, 2002). Equal efficiencies could be achieved by testing several combinati ons of primer concentrations of the two PCR reactions and finding the condition whereby one reaction is not competing with the other and thereby consuming the reaction components (Schmidt and Parrott, 2001). The PCR efficiencies obtained in this study we re adequately functional and accurate to calculate the starting amount of the unknown samples.

PAGE 109

96 To further validate the quantification accu racy, the standard curve was generated three times. The reproducibility of this quant itative real-time PCR system was estimated with four citrus DNA dilutions, 25, 50, 75, and 100 ng. The Ct values ranged from 23.07 to 26, the coefficient of va riation (CV%) values varied from 2.14 to 2.91, and the standard deviation (SD) values ra nged from 0.52 to 0.69 for the endogenous LTP (Table 5-2). These values for the transgene Xa21 were Ct (24.06-27.5), CV% (2.66-3.01) and SD (0.71-0.97). These results showed that the CV% and the SD values derived from these tests were relatively small, indicating th at this quantitative real-time PCR assay was stable and reliable. Estimating the Copy Number of Xa21 in the Transgenic Citrus The copy numbers of Xa21 were determined by comparing the absolutely quantified Xa21 transcripts with thos e of the endogenous LTP gene in terms of the standard curves. It follows that the validity of this technique relies on the transgene and reference gene being amplified at approximate ly equal efficiency, which was the case in this study. Each transgenic citrus DNA sample wa s tested in four replicates to correct for pipetting errors and the values were averag ed to give the starti ng copy numbers of the transgene or endogenous gene. With the abilit y to measure the PCR products as they are accumulated or in real time, it is possible to measure the amount of PCR product at a point in which the reaction is still in th e exponential phase. It is only during this exponential phase of the PCR reaction that it is possible to extrapolate back to determine the starting amount of template. These values were given with a 95% confidence interval and used to calculate the copy number of th e transgene in each transgenic citrus DNA sample (Table 5-3).

PAGE 110

97 Table 5-2. Reproducibility of the Ct measur ement of replicate standards 25, 50, 75, and 100 ng citrus genomic DNA for endogenous LTP and transgene Xa21 using multiplex quantitative real-time PCR. LTP Ct value for reaction DNA amount (ng) 1 2 3 Mean SD a CV% b 25 25.11 24.98 26.00 25.36 0.56 2.19 50 23.94 23.97 24.85 24.25 0.52 2.14 75 23.45 23.48 24.67 23.87 0.69 2.91 100 23.07 23.17 24.26 23.50 0.66 2.80 Xa21 Ct value for reaction DNA amount (ng) 1 2 3 Mean SD a CV% b 25 26.09 26.67 27.50 26.75 0.71 2.66 50 24.85 25.71 26.32 25.63 0.74 2.88 75 24.44 25.28 26.01 25.24 0.79 3.12 100 24.06 24.76 25.55 24.79 0.75 3.01 a Standard deviation b Coefficient of variation To estimate the number of the transgene copies in the transgenic plants, the ratio between transgene and endogenous gene (r line ) was calculated (Table 5-3). Using the r line values, the virtual calibrator (r 1 ) was calculated. The virtual calibrator is the value which corresponding to one copy of the tr ansgene (Mason et al., 2002). The r 1 value in this study was 0.37 for the transgene Xa21 The copy number for each plant was then determined as r line /r 1 (Table 5-3). Thirty-four transgenic citrus samples were tested, and the results indicated that two samples had one copy, five samples had two copies, 22 samples had three copies, and five samples had four copies of the transgene (Table 5-3). Comparison of Copy Number Determinat ion by qRT-PCR and Southern Blot Analysis Correlation analysis revealed that there was a strong re lationship between the copy number determined by qRT-PCR and the c opy number determined by Southern blot analysis (Figure 5-4). Th e correlation efficiency was 0.834. However, among the 34 transgenic plants, the copy number determ ined by quantitative RT-PCR was not always similar to the number detected by Southern blot analysis. However, when qRT-PCR had

PAGE 111

98 been run with different from the same line, the result was always the same. This result indicates again that this qRT-PCR assay was stable and reliable. y = 0.6343x + 0.8265 R2 = 0.8337 0 1 2 3 4 5 0246 Number of copy/insert (Southern)Estimated copy number (RT-PCR) Figure 5-4. Correlation between the copy numbers in transgenic citrus determined by quantitative RT-PCR and the number of c opy/inserts detected with southern blot analysis. Conclusion The results we obtained from quantitativ e real-time PCR for quantifying transgene copy number correlated highly with those obtai ned using the traditi onal southern blot analysis. In addition, the high sensitivity and e fficiency of this technology allowed us to analyze more samples and quantify the transgene copy number more quickly and accurately; up to 96 samples can be prepared and analyzed in approximately 3 hours. In citrus, this assay could have numerous potenti al applications in ge netic engineering and tissue culture, including the expediting of the identification of transgenic tissue and selecting transformation events with low copy number of the transgenes. A distinct benefit of early analysis of regenerating plants is the early identification of escapes as well as multiple-copy transformants that may exhibit gene silencing (Iyer et al., 2000; James et al., 2002) The prompt identific ation of low copy number lines would thus

PAGE 112

99 expedite plant transformation a nd breeding projects, especially those of species that have long generation times, such as citrus. In quant itative real-time PCR, there is no post-PCR analysis of samples, thereby minimizing handling time and lessening the likelihood of contamination that may lead to false positive results. As reported previously, direct DNA delivery transformation methods yield a high proportion of transformants with highly differing numbers of transgenes, and only a small proportion of the primary transformants with low copy numbers (Dong et al., 1996; Kohli et al., 1998; Krasnyanski et al., 1999; Srivastava et al., 1999 ). Thus, it is important to sc reen the transformants at an early stage to distinguish transformants w ith low copy number from those with high copy number. Quantitative real-time PCR provides a fast and reliable method to achieve this goal.

PAGE 113

100 Table 5-3. Real-time PCR estimates of copy number for Xa21 transgene. Calculated starting quantities (SQ) of the two genes (endoge nous and transgene) and calculated copy number for Xa21 transgene, all data are shown together with their 95% confidence interval. Line SQ-LTP SQXa21 r line (SQXa21/SQLTP ) (r line /r 1 ) b Copy number NT a 70.01 4.37 2.79 0.29 0.04 0.01 0.14 0.03 0 AO1 76.11 14.41 74.50 9.77 0.98 0.06 2.52 0.15 3 AO2 53.79 8.38 51.18 12.53 0.95 0.09 2.43 0.24 2 AO3 73.38 12.52 63.89 6.94 0.87 0.09 2.24 0.24 2 AO4 36.50 3.91 60.14 6.66 1.65 0.03 4.22 0.08 4 AO5 101.07 2.08 107.33 6.10 1.06 0.04 2.72 0.11 3 AO6 57.62 5.12 60.59 5.19 1.05 0.10 2.70 0.27 3 AO7 166.04 6.16 176.67 4.71 1.06 0.02 2.73 0.04 3 AO8 116.09 8.05 125.66 8.52 1.08 0.05 2.78 0.13 3 AO9 81.50 3.45 124.88 5.39 1.53 0.09 3.93 0.24 4 AO10 196.42 13.71 205.09 10.22 1.04 0.02 2.68 0.06 3 AO11 205.15 23.78 229.48 34.23 1.12 0.05 2.87 0.13 3 AO12 252.54 22.98 280.04 20.98 1.11 0.04 2.84 0.09 3 AO13 160.12 11.43 173.92 14.73 1.09 0.02 2.78 0.06 3 AO14 206.72 18.29 238.91 21.39 1.16 0.07 2.97 0.19 3 AO15 211.01 15.23 218.92 18.83 1.04 0.10 2.66 0.24 3 AO16 235.02 8.66 250.23 9.72 1.06 0.03 2.73 0.09 3 AO17 225.55 12.15 251.63 16.23 1.12 0.06 2.86 0.16 3 AO18 92.98 10.59 101.09 10.76 1.09 0.03 2.79 0.08 3 AO19 344.77 18.85 376.22 8.23 1.09 0.05 2.80 0.13 3 AO20 118.92 14.38 103.39 8.37 0.87 0.08 2.23 0.20 2 AO21 20.55 2.30 24.09 2.13 1.17 0.06 3.01 0.16 3 AO22 71.79 7.42 73.28 5.45 1.02 0.04 2.62 0.11 3 AO23 54.77 5.69 56.04 2.56 1.03 0.08 2.63 0.20 3 AO24 40.58 8.60 63.00 7.60 1.56 0.16 4.01 0.41 4 AO25 115.38 9.05 119.51 7.90 1.04 0.07 2.66 0.19 3 AO26 35.50 7.02 32.56 3.31 0.92 0.09 2.37 0.23 2 AO27 27.70 8.53 9.30 4.01 0.33 0.07 0.85 0.18 1 AO28 28.93 7.05 15.88 2.47 0.55 0.08 1.42 0.20 1 AO29 218.81 7.71 211.02 12.38 0.96 0.03 2.47 0.08 2 AO30 200.82 23.92 295.78 40.17 1.47 0.13 3.78 0.32 4 AO31 282.42 30.68 278.87 20.49 0.99 0.06 2.54 0.15 3 AO32 265.74 45.55 370.82 44.35 1.40 0.08 3.59 0.22 4 AO33 311.32 70.61 335.36 61.75 1.08 0.09 2.77 0.23 3 AO34 117.78 11.34 131.68 3.88 1.12 0.10 2.87 0.25 3 a NT = non-transgenic b r line /r 1 = estimated copy number

PAGE 114

CHAPTER 6 SUMMARY AND CONCLUSIONS The successful transformation and co-transformation of Hamlin sweet orange with cDNA of the Xa21 Xanthomonas resistance gene using PEG-mediated direct DNA uptake were achieved. From over 20 transformation experiments using pAO3, only eight independent transgenic events were recovere d and 73 transgenic plan ts were propagated using grafting techniques. These plants were successfully acclimated and transferred to a greenhouse. From more than 15 co-transfo rmation experiments using p524EGFP.1 and pXa21-mtag, only one independent transgenic event was recovered and 7 transgenic plants were successfully propagated using grafting techniques. From more than 30 co-transformation experiments using pARS 108 and pXa21-mtag, 75 transgenic events were recovered and more than 500 transgenic plants were regenerated and transferred to the greenhouse. To accelerate regeneration of the transgenic plants, two different grafting techniques were used: in vitro micrografting and standard shoot tip grafting. It is important to note that these transgenic plants were obtained without any antibiotic resistance genes for selection at the cellular le vel. This is an advantage over the standard citrus transformation methodology using Agrobacterium in which antibiotic resistance genes are used for selection and to kill Agrobacterium following transformation. Selection was made first based on expression of the GFP (Green Fluorescent Protein) gene at the protoplast, calli, and somatic em bryo level. Further verification was achieved using the polymerase chain react ion. Confirmation of stable tr ansgene integration into the Hamlin genome was shown by Southern blot analysis and west ern blot analysis. 101

PAGE 115

102 Western analysis showed expression of the Xa21 gene in the transgenic plants obtained from transformation and co-transformation at 87.5% and 24%, respectively. This is the first time to report a large population of normal transgenic Hamlin sweet orange plants using the protoplast/GFP transformation system. According to the literature, this is the first time that a gene from rice has been stab ly integrated and expre ssed in citrus plants. To accelerate characterization of the tran sgenic plants, a real-time PCR based method has been developed to determine the copy number of the transgene in recovered transgenic plants. The results obtained from real-time PCR analysis for quantifying transgene copy number correlated highly with those obtained using the traditional Southern blot analysis. In addition, the high sensitivity and efficiency of this technology allowed us to analyze more samples and quantify the transgene copy number more quickly and accurately. Up to 96 samples can be prepared and analyzed in approximately 3 hours. In citrus, this assa y could have numerous potential applications in genetic engineering and tissue culture, including the ex pediting of the identification of transgenic tissue and selection of transfor mants with low transgene copy numbers. A distinct benefit of the early analysis of transgenic plants is that escapes and multiple-copy transformants that may exhibit gene silencing can be iden tified (Iyer et al., 2000; James et al., 2002). The prompt identification of low copy number lines would thus expedite plant transformation and breeding projects, especi ally those of species that have long generation times, such as citrus. Thus, it is im portant to screen the transformants at an early stage and distinguish transformants w ith low copy number from those with high copy number. Quantitative multiplex real-time PCR was shown to be a successful

PAGE 116

103 screening tool for estimating transgene copy num ber in transgenic citr us at a very early stage of the process. This could save up to 6-9 months time in the overall process. Evidence of somaclonal variation was difficult to ascertain in the populations of transgenic plants. There were differences in growth rate, particularly for the transgenic plants obtained from transformation expe riments using pAO3 plasmid DNA and a few events from co-transformation experiment s. The reasons for this are difficult to determine. The stunting of the plants could be due to a positional effect of the inserted gene, the effect of the Xa21 gene product, or a combination of these and other metabolic pathways in the regenerated transgenic plants. The regenerated transgenic plants are now ready to be tested by challenge inoculation with the citrus canker pathogen, Xanthomonas axonopodis pv. citri ( Xac ), in the greenhouse at the quarantine facility in Gaines ville. The results of this test will help to determine whether these transgenic plants ha ve acquired a potential level of resistance against the citrus canker pathogen. If these tests are positive, field-testing can then be conducted at the appropriate location. Positive re sults in the field would mean that citrus canker-resistant Hamlin sweet orange has been achieved. If successful, this technology could be applied to other commercially im portant scions, including other oranges, grapefruit, and mandarins.

PAGE 117

APPENDIX A CITRUS PROTOPLASTS MEDIA AND SOLUTION Table A-1. Composition of the EME medium. Component mg/L NH 4 NO 3 1,650 KNO 3 1,900 KH 2 PO 4 170 MgSO 4 .7H 2 O 370 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 22.30 ZnSO 4 .7H 2 O 8.60 H 3 BO 3 6.20 KI 0.63 Na 2 MoO 4 .2H 2 O 0.25 CuSO 4 .5H 2 O 0.025 CoCl 2 .6H 2 O 0.025 Thiamine.HCl 10 Pyridoxine.HCl 10 Myo-inositol 100 Malt extract 500 Nicotinic acid 5 50 g/L sucrose was added for 0.146 M EME and 205.38 g/L sucrose for 0.6 M EME. For 1500 EME malt extract was added at 1500 mg/L and sucrose at 50 g/L. Solid medium contains 8 g/L agar. 104

PAGE 118

105 Table A-2. Composition of RMAN medium. Component mg/L NH 4 NO 3 825 KNO 3 950 KH 2 PO 4 85 MgSO 4 .7H 2 O 185 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 11.15 ZnSO 4 .7H 2 O 4.30 H 3 BO 3 3.10 KI 0.42 Na 2 MoO 4 .2H 2 O 0.13 CuSO 4 .5H 2 O 0.013 CoCl 2 .6H 2 O 0.013 Thiamine.HCl 5 Pyridoxine.HCl 5 Nicotinic acid 0.50 Naphhthalin acetic acid 0.020 Activated charcoal 500 Sucrose 25,000 Agar 8,000

PAGE 119

106 Table A-3. Composition of 0.6 m BH3 nutrient medium. Com p onen t m g /L KH 2 PO 4 170 MgSO 4 .7H 2 O 370 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 22.30 ZnSO 4 .7H 2 O 8.60 H 3 BO 3 6.20 KCl 1,500 KI 0.63 Na 2 MoO 4 .2H 2 O 0.25 CuSO 4 .5H 2 O 0.025 CoCl 2 .6H 2 O 0.025 Glutamine 3,100 Thiamine.HCl 10 Pyridoxine.HCl 10 Myo-inositol 100 Malt extract 500 Casein hydrolysate 250 Nicotinic acid 1 Mannitol 81,990 Sucrose 51,350 (85,560 for 0.7 M) Coconut water 20 mL Fructose 250 Ribose 250 Xylose 250 Mannose 250 Rhamanose 250 Cellobiose 250 Galactose 250 Glucose 250 Sodium pyruvate 20 Citric acid 40 Malic acid40 40 Fumaric acid 40 Vitamin B12 0.02 Calcium pantothene 1 Ascorbic acid 2 Choline chloride 1 p-aminobezoic acid 0.02 Folic acid 0.40 Riboflavin 0.20 Biotin 0.01 Vitamin A (retinol) 0.01 Vitamin D3 (cholecalciferol) 0.01

PAGE 120

107 Table A-4. Composition of sucrose and mannitol solutions (CPW salts). Component mg/L MgSO 4 .7H 2 O 250 KNO 3 100 KH 2 PO 4 27.20 KI 0.16 CuSO 4 .5H 2 O 0.00025 CaCl 2 .2H 2 O 150 For CPW-25 sucrose, 25 g/100 mL sucrose was added and for CPW-13 mannitol, 13 g/100 mL mannitol was added. pH of both solutions was 5.8. Table A-5. Composition of protopl ast transformation solutions. IPolyethylene Glycol 40% 40% polyethylene glycol (PEG) (MW = 8000) 0.3 M Glucose 66 mM CaCl 2 pH = 6 IISolutions A and B Solution A Solution B Component g/100 mL Component g/100 mL Glucose (0.4 M) 7.20 Glycine (0.3 M) 2.2 CaCl2 (66 mM) 0.97 DMSO 10 mL pH 6.0 pH 10.5

PAGE 121

108 Table A-6. Composition of H+H medium. Component mg/L NH 4 NO 3 825 KNO 3 950 KH 2 PO 4 170 MgSO 4 .7H 2 O 370 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 22.30 ZnSO 4 .7H 2 O 8.60 H 3 BO 3 6.20 KI 0.63 KCl 750 Na 2 MoO 4 .2H 2 O 0.25 CuSO 4 .5H 2 O 0.025 CoCl 2 .6H 2 O 0.025 Thiamine.HCl 10 Pyridoxine.HCl 10 Myo-inositol 100 Malt extract 500 Nicotinic acid 5 Glutamine 1,550 Sucrose 35,000

PAGE 122

109 Table A-7. Composition of B+ medium. Component mg/L NH 4 NO 3 1,650 KNO 3 1,900 KH 2 PO 4 170 MgSO 4 .7H 2 O 370 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 22.30 ZnSO 4 .7H 2 O 8.60 H 3 BO 3 6.20 KI 0.63 Na 2 MoO 4 .2H 2 O 0.25 CuSO 4 .5H 2 O 0.025 CoCl 2 .6H 2 O 0.025 Thiamine.HCl 10 Pyridoxine.HCl 10 Myo-inositol 100 Malt extract 500 Nicotinic acid 5 Coconut water 20 mL Coumarin 14.60 NAA 0.02 GA 1 Sucrose 25,000 Agar 8,000

PAGE 123

110 Table A-8. Composition of DBA3 medium. Component mg/L NH 4 NO 3 1,485 KNO 3 1,710 KH 2 PO 4 153 MgSO 4 .7H 2 O 333 CaCl 2 .2H 2 O 440 Na 2 EDTA 37.30 FeSO 4 .7H 2 O 27.80 MnSO 4 .H 2 O 21.40 ZnSO 4 .7H 2 O 7.70 H 3 BO 3 5.58 KI 0.567 Na 2 MoO 4 .2H 2 O 0.225 CuSO 4 .5H 2 O 0.0225 CoCl 2 .6H 2 O 0.0225 Thiamine.HCl 9 Pyridoxine.HCl 9 Myo-inositol 90 Nicotinic acid 4.5 Coconut water 20 mL Malt extract 1,500 2,4 D 0.01 DAP 3 Sucrose 25,000 Agar 8,000 Table A-9. Composition of the enzyme solutio n used for citrus protoplast isolation. Component Concentration Mannitol 0.7 M CaCl 2 12.0 mM MES 1 (buffer) 6.0 mM NaH 2 PO 4 1.4 mM Onozuka RS cellulose 1% Macerase or macerozyme 1% Pectolyase Y-23 0.2% pH = 5.6 Filter sterilize (Nalgene 0.2 m 1 MES = 2[N-morpholino] ethane sulfonic acid.

PAGE 124

APPENDIX B PCR PRIMERS AND PROGRAM PCR primers For pARS108 108F 5 -GAATTCGTGAGCAAGGGCGA-3 108R 5 -GGATCCTTAGAGTTCGTCGTG-3 For pXa21-mtag XaL 5 -AATCCCTAACACGCTTGGTG-3 XaR 5 -CACACACTGGAAACAATCCG-3 PCR reaction mixture GoTaq Green Master Mix 2X 12.5 l 5 M 108F primer 1.5 l 5 M 108R primer 1.5 l 5 M XaL primer 1.5 l 5 M XaR primer 1.5 l DNA template (100 ng/l) 2.5 l Nuclease-Free Water 4.0 l PCR program Step 1. 2 minutes at 95 C Denaturation Step 2. 30 seconds at 95 C Denaturation Step 3. 30 seconds at 59 C Annealing Step 4. 1 minute at 72 C Elongation Step 5. Repeat steps 2-4 30 times Step 6. 10 minutes at 72 C Elongation Step 7. 4 C forever Step 8. End 111

PAGE 125

APPENDIX C MOLECULAR ANALYSIS SOLUTION Southern Blot analysis Solution 5 M NaCl 292.2 g NaCl dissolve into 1000 ml H 2 O 10 N NaOH 100 g NaOH dissolve into 250 ml H 2 O 10% SDS 10 g SDS dissolve into 100 ml H 2 O 20X SSC 1 Litter NaCl 175.3 g Sodium Citrate 88.2 g Adjust pH to 7.0 Autoclave Standard Hybridization Buffer: Stock 1 Litter 5X SSC 20X 250 ml N-lauroylsarsine 0.1% 10% 10 ml SDS 0.02% 10% 2 ml 1% Dry milk ----10 g Keep in freezer (-20 C) Buffer 1 (Maleic acid buffer) 1 Litter 0.1 M Maleic acid 11.61 g 0.15 M NaCl 8.786 g Adjust pH to 7.5 w/ solid NaOH (about 7.8 g) Autoclave 112

PAGE 126

113 Buffer 2 (Blocking solution) 2% dry milk in maleic acid buffer Buffer 3 (Detection buffer) 1 Litter 0.1 M Tris-base 12.1 g 0.1 M NaCl 5.84 g Adjust pH to 9.5 w/ NaOH or HCl Autoclave Western Blot Analysis Tris Buffered Saline (TBS): 1 L 4 L 8 L 10 L Tris base 12.11 g 48.44 g 96.88 g 121.1 g NaCl 8.775 g 35.1 g 70.2 g 87.75 g pH = 7.9 Autoclave Tween-Tris buffered saline (TTBS): 1 L TBS + 1 ml Tween-20 5 x Transfer Buffer: 1 L 2 L Final for 1X Tris base 15.1 g 30.2 g 24.9 mM Glycine 72.0 g 144.0 g 191.8 mM 5 x Running Buffer: 1 L Glycine 72 g Tris base 15 g 10% SDS 50 ml; Loading Dye: 2X 1 ml 4X 1 ml Final Tris-HCl pH 6.8 125 l 250 l 62.5 mM Glycerol 200 l 400 l 10% SDS 200 l of 20% 20 mg 2% 5% -ME 100 l 200 l 0.5% Bromophenol blue 2 mg 4 mg 0.1% H 2 O To 1 ml To 1 ml

PAGE 127

APPENDIX D QUANTITATIVE REAL TIME-PCR Primers pairs and probes of LTP a and Xa21 b genes used for quantitative real-time PCR assays. N ame Orientation Se q uence ( 5 -3 ) Length (bp) Position (bp) LTP-178F Forward primer GC TGCCGCCAGAACCA 16 178-194 LTP-236R Reverse primer GCGGCTTGCTTCAAGCA 17 236-253 LTP-196T Forward probe CCTGACCGCCAAACTGCATG 21 196-217 Xa21-mtag-2823F Forward prime CGGCCAACTGACAGTACATT 22 2823-2845 Xa21-mtag-2889R Reverse primer CATGTAGGCCCAGTTCAACG 21 2889-2910 Xa21-mtag-2847T Forward probe CCCGATTTGGGCCTCCGTCA 21 2847-2868 a LTP gene from GenBank acc. No. AF369931 b cDNA of Xa21 gene from GenBank acc. No. U37133 Real-time PCR reaction. Number of reactions 1 ( l ) 96 ( l ) Final TaqMan Universal PCR Master Mix (2X) 12.5 1200 1X Xa21-mtag-2823F primer (15 mM) 1.5 144 900 nM 2 Xa21-mtag-2889R primer (15 mM) 1.5 144 900 nM LTP-178F primer (15 mm) 1.5 144 900 nM LTP-236R primer (15 mm) 1.5 144 900 nM Xa21-matg-2847 probe (5 mM) 1.5 144 300 nM LTP-196 probe (5 mM) 1.5 144 300 nM Free Nuclease Water 1 96 -------DNA (10 ng/ l) 2.5 240 25 ng Total 25 2400 _____ 114

PAGE 128

LIST OF REFERENCES Alam, M.F., Oliva, N.P., Zapata, F.J., and Datta, S.K. (1995). Fertile transgenic indica rice plants by PEG-mediated protoplast transformation. Journal of Genetics and Breeding 49, 303-308. Allen, M. (2000). A seed is planted: Citrus emerges to cultivate a new land. In Florida Grower, pp. 10-13. Andaya, C.B., and Ronald, P. (2003). A catalytically impaired mutant of the rice Xa21 receptor kinase confers partial resistance to Xanthomonas oryzae pv oryzae Physiological and Molecular Plant Pathology 62, 203-208. Anonymous. (2005). Faostat: Agricultu re data. avialable at http://apps.fao.org last accessed September 10, 2005. Armour, J.A., Sismani, C., Pa tsalis, P.C., and Cross, G. (2000). Measurement of locus copy number by hybridization with amplif iable probe. Nucleic Acid Research 28, 605-609. Barker, R.F., Idler, K.B., Thompson, D.V., and Kemp, J.D. (1983). Nucleotide sequence of the T-DNA region from the Agrobacterium tumefaciens octopine Tiplasmid pTi15955. Plant Molecular Biology 2, 335-350. Bettany, A.J.E., Dalton, S.J., Timms, E., Dhanoa, M.S., and Morris, P. (2002). Effect of selectable gene to reporter gene ratio on the frequency of co-transformation and co-expression of uidA and hpt transgenes in protoplast-derived plan ts of tall fescue. Plant Cell, Tissue and Organ Culture 68, 177-186. Bond, J.E., and Roose, M.L. (1998). Agrobacterium -mediated transformation of the commercially important citrus cultivar Washington navel orange. Plant Cell Reports 18, 229-234. Boscario, R.L., Almeida, W.A.B., Derbyshi re, M.T.V.C., Mouro Filho, F.A.A., and Mendes, B.M.J. (2003). The use of the PMI/mannose selection system to recover transgenic sweet orange plants ( Citrus sinensis L. Osbeck). Plant Cell Reports 22, 122-128. Bradford, M.M. (1979). A rapid and sensitive met hod for the quantitation of microgram quantities of protein utilizing the princi ple of protein-dye binding. Analytical Biochemistry 72, 248-254. 115

PAGE 129

116 Breiteneder, H., and Radauer, C. (2004). A classification of plant food allergens. Journal of Allergy a nd Clinical Immunology 113, 821-830. Brown, K. (2001). Florida fights to st op citrus canker. Science 292, 2275-2276. Bubner, B., and Baldwin, I.T. (2004). Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Reports 23, 263-271. Century, K.S., Lagman, R.A., Adkisson, M., Morlan, J., Tobias, R., Schwartz, K., Smith, A., Love, J., Ronald, P., and Whalen, M.C. (1999). Developmental control of Xa21-mediated disease resistance in rice. The Plant Journal 20, 231-236. Cervera, M., Ortega, C., Navarro, A., Navarro, L., and Pena, L. (2000). Generation of transgenic citrus plants with the tolerance-to-salinity gene HAL2 from yeast. The Journal of Horticultural Science and Biotechnology 75, 26-30. Chair, H., Legavre, T., and Guiderdoni, E. (1996). Transformation of haploid, microspore-derived cell suspen sion protoplasts of rice ( Oryza sativa L.). Plant Cell Reports 15, 766-770. Chand, P.K., Rech, E.L., Golds, T.J., Power, J.B., and Davey, M.R. (1989). Electroporation stimulates transformati on of freshly isolated cell suspension protoplasts of Solanum-dulcamara by Agrobacterium Plant Cell Reports 8, 86-89. Chilton, M.D., Saiki, R.K., Yadav, N., Gordon, M.P., and Quetier, F. (1980). T-DNA from Agrobacterium Ti plasmid is in the nuclear DNA fraction of crown gall tumor cells. Proceedings of the National Academy of Sciences 77, 4060-4064. Christie, P.J. (1997). Agrobacterium tumefaciens T-complex transport apparatus: A paradigm for new family of multifunctional transportsin eubacteria. Journal of Bacteriology 179, 3085-3094. Christou, P., McCabe, D.E., and Swain, W.F. (1988). Stable transformation of soybean callus by DNA-coated gold par ticles. Plant Physiology 87, 671-674. Craig, W., Gargano, D., Scotti, N., Nguyen T.T., Lao, N.T., Kavanagh, T.A., Dix, P.J., and Cardi, T. (2005). Direct gene transfer in potato: A comparison of particle bombardment of leaf explants and PEG-me diated transformation of protoplasts. Plant Cell Reports 24, 603-611. Cubero, J., and Graham, J.H. (2002). Genetic relationshi p among worldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their indentication by PCR. Applied and Environmental Microbiology 68, 1257-1264. Damm, B., Schmidt, R., and Willmitzer, L. (1989). Efficient transformation of Arabidopsis thaliana using direct gene transfer to protoplasts. Molecular and General Genetics 217, 6-12.

PAGE 130

117 Datla, R.S.S., Bekkaoui, F., Hammerlindl, J.K., Pilate, G., Dunstan, D.I., and Crosby, W.L. (1993). Improved high-level constitu tive foreign gene expression in plants using an AMV RNA4 untransla ted leader sequence. Plant Science 94, 139149. Davey, M.R., Rech, E.L., and Mulligan, B.J. (1989). Direct DNA tran sfer to plant cells. Plant Molecular Biology 13, 273-285. Davey, M.R., Power, J.B., and Lowe, K.C. (2000). Plant protoplasts. In Encyclopaedia of cell technology, R.E. Spier, ed (New York, USA: John Wiley and Sons), pp. 1034-1042. Davey, M.R., Anthony, P., Power, J.B., and Lowe, K.C. (2005a). Plant protoplasts: Status and biotechnological pers pectives. Biotechnology Advances 23, 131-141. Davey, M.R., Anthony, P., Power, J.B., and Lowe, K.C. (2005b). Plant protoplast technology: Current status. Ac ta Physiologiae Plantarum 27, 117-129. Davies, F.S., and Albrigo, L.G. (1994). Citrus. (Wallingford: CAB International). de la Riva, G.A., Gonzlez-Cabrera, J., V zquez-Padrn, R., and Ayra-Pardo, C. (1998). Agrobacterium tumefaciens : A natural tool for plant transformation. Electronic Journal of Biotechnology 1, 118-133. Deng, X.X., Grosser, J.W., and Gmitter, F.G. (1992). Intergeneric somatic hybrid plants from protoplast fusion of Fortunella crassifolia cultivar Meiwa with Citrus sinensis cultivar Valencia. Scienta Horticulture 49, 55-62. Deshayes, A., Herrera Estrella, L., and Caboche, M. (1985). Liposome-mediated transformation of tobacco mesophyll protoplasts by an Escherichia coli plasmid. European Molecular Biol ogy Organization Journal 4, 2731-2738. Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C., Somssich, I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS1-R, a protein conferring resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proceedings of the National Academy of Sciences 100, 8024-8029. Dijak, M., Sproule, A., Keller, W., Pandeya, R., and Gleddie, S. (1991). Transformation of Nicotiana tabacum Nicotiana debneyi And Nicotiana rustica inheritance and protop last expression of antibiotic re sistance. Plant Cell, Tissue and Organ Culture 25, 189-198. Ding, J., Jia, J., Yang, L., Wen, H ., Zhang, G., Liw, W., and Zhang, D. (2004). Validation of rice-specific gene, sucrosephosphate synthase, used as endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. Journal of agricultural and food chemistry 52, 3372-3377.

PAGE 131

118 Dong, J., Teng, W., Buchholz, W.G., and Hall, T.C. (1996). Agrobacterium -mediated transformation of Javanica rice. Molecular Breeding 2, 267-276. Dovzhenko, A., and Koop, H.U. (2003). Sugarbeet ( Beta vulgaris L): Shoot regeneration from callus a nd callus protoplasts. Planta 217, 374-381. Dunigan, D.D., and Madlener, J.C. (1995). Serine/threonine protein phosphatase is required for tobacco mosaic virus-me diated programmed cell death. Virology 207, 460-466. Elliott, A.R., Campbell, J.A., Dugdale, B., Brettell, R.I.S., and Grof, C.P.L. (1999). Green fluorescent protein facilitates rapi d in vivo detecti on of genetically transformed plant cells. Plant Cell Reports 18, 707-714. Estruch, J.J., Carozzi, N.B., Desai, N ., Duck, N., B., Warren, G.W., and Koziel, M.G. (1997). Transgenic plants: An emergi ng approach to pest control. Nature Biotechnology 15, 137-141. Fegeros, K., Zervas, G., Stamouli, S., and Apostolaki, E. (1995). Nutritive value of dried citrus pulp and its e ffect on milk yield and milk composition of lactating ewes. Journal of Dairy Science 78, 1116-1121. Filho, J.C.B., Kobayashi, A.K., Pereira, L.F.P., Galvo, R.M., and Vieira, L.G.E. (2003). Transient gene experssion of -glucuronidase in citrus thin epicotyl transversal sections using pa rticle bombardment. Brazili an Archives of Biology and Technology 46, 1-6. Fleming, G.H., Kramer, C.M., Le, T., and Shillito, R.D. (1995). Effect of DNA gragment size on transformation frequencies in tpbacco (Nicotiana Tabacum ) and maize (Zea mays). Plant Science 110, 187-192. Fleming, G.H., Olivares-Fuster, O., Del-Bosco, S.F., and Grosser, J.W. (2000). An alternative method for the genetic transfor mation of sweet orange. In Vitro Cellular and Developmental Biology-Plant 36, 450-455. Folling, M., Pedersen, C., and Olesen, A. (1998). Reduction of nuclease activity from lolium protoplasts: Effect on transformation frequency. Plant Science 139, 29-40. Freeman, W.M., Walker, S.J., and Vrana, S.J. (1999). Quantitative RT-PCR: Pitfalls and potential. Biotechniques 26, 112-125. Gabriel, D.W. (2001). Citrus canker. In Encyclopedia of Plant Pathology, O.C. Maloy and T.D. Murray, eds (John Wile y & Sons, Inc.), pp. 215-217. Garcia, R., Pimentel, E., Somonte, D ., Mena, J., Zaldua, Z., and Lopez, A. (1998). Isolation and transient tran sformation of stem and leaf protoplasts from sweet potato ( Ipomoea batatas L). Asia-Pacific Journal of Molecular Biology and Biotechnology 6, 145-151.

PAGE 132

119 Gelvin, S.B. (2000). Agrobacterium and plant genes involved in T-DNA transfer and integration. Annual Reviw in Plant P hysiology and Plant Molecular Biology 51, 223-256. Gelvin, S.B. (2003). Agrobacterium -mediated plant transformation: The biology behind the "Gene-Jockeying" tool. Microbi ology and Molecular Biology Reviews 76, 1637. Gibson, U.E., Heid, C.A., and Williams, P.M. (1996). A novel method for real time quantitative RT-PCR. Genome Research 6, 995-1001. Ginzinger, D.G. (2002). Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Experimental Hematology 30, 503-512. Gottwald, T.R., and Graham, J.H. (1992). A device for precise and nondisruptive stomatal inoculation of leaf tissue wi th bacterial pathogens. Phytopathology 82, 930-935. Gottwald, T.R., Graham, J.H., and Schubert, T.S. (2002). Citrus canker: The pathogen and its impact. Online. Plant Health Progress doi:10.1094/PHP-20020812-01-RV. Graham, J.H. (2001). Varietal suscep tibility to citrus canke r: Observations from southern Brazil. Citrus Industry 82, 15-17. Gray, D.J., and Finer, J.J. (1993). Development and operati on of five particle guns for introduction of DNA into plant cells. Plant Cell, Tissue and Organ Culture 33, 219. Grosser, J.W., and Gmitter, F.G. (1990). Protoplast fusion and citrus improvement. Plant Breeding Reviews 8, 339-374. Grosser, J.W., Gmitter, F.G., and Chandler, J.L. (1996a). Somaclonal variation in sweet orange: A tool for cultivar improvement. Proceding International Society of Citriculture 1, 203-206. Grosser, J.W., Mourao-Fo, F.A.A., Gmitter, F.G., Louzada, E.S., Jiang, J., Baergen, K., Quiros, A., Cabasson, C., Schell, J.L., and Chandler, J.L. (1996b). Allotetraploid hybrids between citrus and seven related genera produced by somatic hybridization. Theoretical and Applied Genetics 92, 557-582. Grosser, J.W., Ollitrault, P., and Olivares-Fuster, O. (2000). Somatic hybridization in citrus: An effective tool to facilitate variety improvement. In Vitro Cellular and Developmental Biology-Plant 36, 434-449. Guo, W., Duan, Y., Olivares-Fuster, O., Wu Z., Arias, C.R., Burns, J.K., and Grosser, J.W. (2005). Protoplast transformation and regeneration of transgenic Valencia sweet orange pl ants containing a juice quality-related pectin methylesterase gene. Plant Cell Reports 24, 482-486.

PAGE 133

120 Gutirrez, M.A., Luth, D., and Moore, G.A. (1997). Factors affecting Agrobacterium mediated transformation in citrus and production of sour ornage ( Citrus aurantium L) plants experssing the coat protein gene of citrus triste za virus. Plant Cell Reports 16, 745-753. Hammond-Kosack, K.E., and Jones, J.D.G. (1997). Plant disease resistance genes. Annual Review of Plant Physio logy and Plant Molecular Biology 48, 575-607. Hansen, G., and Wright, M.S. (1999). Recent advances in the transformation of plants. Trends in Plant Science 4, 226-231. Haseloff, J., Siemer ing, K.R., Prasher, D.C., and Hodge, S. (1997). Removal of a cryptic intron and subcellular localizati on of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences 94, 2122-2127. He, D.G., Mouradov, A., Yang, Y.M., Mouradova, E., and Scott, K.J. (1994). Transformation of wheat ( Triticum aestivum L.) through electroporation of protoplasts. Plant Cell Reports 14, 192-196. He, Z., Wang, Z.Y., Li, J., Zhu, Q., Lamb, C., Ronald, P., and Chory, J. (2000). Perception of brassinosteroids by the extr acellular domain of the eeceptor kinase BRI1. Science 288, 2360-2363. Heid, C.A., Stevens, J., Livak, K.J., and Williams, P.M. (1996). Real time quantitative PCR. Genome Research 6, 986-994. Hidaka, T., and Omura, M. (1993). Transformation of citrus protoplasts by electroporation. Journal of the Japanese Society for Horticultural Science 62, 371376. Hidaka, T., Omura, M., Ugaki, M., Tomi yama, M., Kato, A., Oshima, M., and Motoyoshi, F. (1990). Agrobacterium -mediated transformation and regeneration of citrus spp. from suspension cells. Japanese Journal of Breeding 40, 199-207. Hodgson, R.W. (1968). Horticultural varieties of citrus. In The citrus industry, 1, W. Reuther, H.J. Webber, and L.D. Batchelor, eds (Berkeley: University of California Press), pp. 431-591. Holm, P.B., Olsen, O., Schnorf, M., Brinch-Pedersen, H., and Knudsen, S. (2000). Transformation of barley by microinjecti on into isolated zygote protoplasts. Transgenic Research 9, 21-32. Honda, M., Muramoto, Y., Kuzuguchi, T ., Sawano, S., Machida, M., and Koyama, H. (2002). Determination of gene copy number and genotype of transgenic Arabidopsis thaliana by competitive PCR. Journal of Experimental Botany 53, 1515-1520.

PAGE 134

121 Hooykaas, P.J.J., and Shilperoort, R.A. (1992). Agrobacterium and plant genetic engineering. Plant Molecular Biology 19, 15-38. Hulbert, S.H., Webb, C.A., Smith, S.M., and Sun, Q. (2001). Resistance gene complexes: Evolution and utilizatio n. Annual Review of Phytopathology 39, 285312. Ingham, D.J., Beer, S., Money, S., and Hansen, G. (2001). Quantitative real-time PCR assay for determining transgene copy numb er in transformed plants. Biotechniques 31, 132-140. Iuchi, S. (1993). Phosphorylation/dephosphorylati on of the receiver module at the conserved aspartate residue controls tran sphosphorylation activ ity of istidine kinase in sensor protein ArcB of Escherichia coli Journal of Biological Chemistry 268, 23972-23980. Iyer, L.M., Kumpatla, S.P., Chandrasekharan, M.B., and Hall, T.C. (2000). Transgene silencing in monoc ots. Plant Molecular Biology 43, 323-346. James, C. (2004). Global status of commercialized transgenic crops; The International Service for the Acquisition of Agri-biot ech Applications (ISAAA) Briefs no. 32; ISAAA: Ithaca, NY, 2004; http://www.isaaa.org/ James, V.A., Avart, C., Worland, B., Snape, J.W., and Vain, P. (2002). The relationship between homozygous and hemizygous transgene expression levels over generations in populations of transgen ic rice plants. Theoretical and Applied Genetics 104, 553-561. Janssen, B.J., and Gardner, R.C. (1993). The use of transient GUS expression to develop an Agrobacterium -mediated gene transfer system for kiwifruit. Plant Cell Reports 13, 28-31. Jarl, C.I., and Rietveld, E.M. (1996). Transformation effici encies and progeny analysis after varying different parameters of direct gene transfer of Nicotiana tabacum protoplasts. Physiologia Plantarum 98, 550-556. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. European Molecula r Biology Organization Journal 19, 4004-4014. Jongsma, M., Koornneef, M., Zabel, P., and Hille, J. (1987). Tomato protoplast DNA transformation physical linkage and r ecombination of exogenous DNA sequences. Plant Molecular Biology 8, 383-394. Kallioniemi, A., Visakorpi, T., Karhu, R., Pinkel, D., and Kallioniemi, O.P. (1996). Gene copy number analysis by fluorescence in situ hybridization and comparative genomic hybridization. Methods 9, 113-121.

PAGE 135

122 Kang, T.J., Han, S.C., Kim, M.Y., Kim, Y.S., and Yang, M.S. (2004). Expression of non-toxic mutant of Escherichia coli heat-labile enterotoxin in tobacco chloroplasts. Protein Expression and Purification 38, 123-128. Kao, K.N., and Michayluk, M.R. (1975). Nutritional requirem ents for the growth of Vicia hajastana cells and protoplasts at a very low populatio n density in liquid media. Planta 126, 105-110. Kim, M.-J., Park, H.J., Hong, M.S., Park H.-J., Kim, M.-S., Leem, K.-H., Kim, J.B., Kim, Y.J., and Kim, H.K. (2005). Citrus reticulata blanco induces apoptosis in human gastric cancer cells S NU-668. Nutrition and Cancer 51, 78-82. Klein, T.M., Wolf, E.D., Wu, R., and Sanford, J.C. (1987). High velocity microprojectiles for delivering nucleic acids into living cells. Nature 327, 70-73. Kobayashi, S., and Uchimaya, H. (1989). Expression and integr ation of a foreign gene in orange ( Citrus sinensis Osb.) protoplasts by direct DNA transfer. Japanese Journal of Genetics 64, 91-97. Kohli, A., Leech, M., Vain, P., Laurie, D.A., and Christou, P. (1998). Transgene organization in rice engineered through direct DNA transfer supports a two-phase integration mechanism mediated by the es tablishment of inte gration hot spots Proceedings of the National Academy of Sciences 95, 7203-7208. Krasnyanski, S., May, R.A., Loskutov, A., Ball, T.M., and Sink, K.C. (1999). Transformation of the limonene s ynthase gene into peppermint ( Mentha piperita L.) and preliminary studies on the essential oil profiles of single transgenic plants. Theoretical and Applied Genetics 99, 676-682. Laemmli, U.K. (1970). Cleavage of struct ural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Larramendy, M.L., El-Rifai, W., Kokkol a, A., Puolakkainen, P., Monni, O., Salovaara, R., Aarnio, M., and Knuutila, S. (1998). Comparative genomic hybridization reveals differences in DNA copy number changes between sporadic gastric carcinomas and gastric carcin omas from patients with hereditary nonpolyposis colorectal cancer. Can cer Genetic and Cytogenetic 106, 62-65. Lee, L., Laramore, C.L., Day, P.R., and Tumer, N.E. (1996). Transformation and regeneration of cr eeping bentgrass ( Agrostis palustris Huds.) protoplasts. Crop Science 36, 401-406. Lehman, C.W., Trautman, J.K., and Carroll, D. (1994). Illegitimate recombination in Xenopus: Characterization of end-joined junctions. Nucleic Acid Research 22, 434442.

PAGE 136

123 Levine, A., Tenhaken, R., Dixon, R., and Lamb, C. (1994). H 2 O 2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-593. Lewandowski, M. (2000). Formulating frozen concen trate. In Florida Grower, pp. 44-48. Li, D.D., Shi, W., and Deng, X.X. (2002). Agrobacterium -mediated transformation of embryogenic calluses of Ponkan mandarin and the regenration of plants containing the chimeric ribonuclease gene. Plant Cell Reports 21, 153-156. Li, J., Protopopov, A., Wang, F., Senchenk o, V., Petushkov, V., Vorontsova, O., Petrenko, L., Zabarovska, V., Murave nko, O., Braga, E., Kisselev, L., Lerman, M.I., Kashuba, V., Klein, G., Ernberg, I., Wahlestedt, C., and Zabarovsky, E.R. (2002). NotI subtraction and NotI-specific microarrays to detect copy number and methylation changes in whole genome s. Proceedings of the National Academy of Sciences 99, 10724-10729. Ling, H.Q., and Binding, H. (1997). Transformation in protoplast cultures of Linum usitatissimum and L. suffruticosum mediated with PEG and with Agrobacterium tumefaciens. Journal of Plant Physiology 151, 479-488. Liu, G.Z., Pi, L.Y., Walker, J.C., Ronald, P., and Song, W.Y. (2002). Biochemical characterization of the kinase domain of the rice disease resistance receptor-like kinase XA21 The Journal of Biological Chemistry 277, 20264-20269. Livak, K.J., Flood, S.J., Marmar o, J., Giusti, W., and Deetz, K. (1995). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR pro duct and nucleic acid hybridization,. PCR: Methods and Applications 4, 357-362. Lowe, K., Bowen, B., Hoerster, G., Ross, M., Bond, D., Pierce, D., and GordonKamm, B. (1995). Germlines transformation of maize following manipulation of chimeric shoot meristems. Bio/Tenhnology 13, 677-682. Luth, D., and Moore, G.A. (1999). Transgenic grapefruit plants obtained by Agrobacterium tumefaciens -mediated transformation. Pl ant Cell, Tissue and Organ Culture 57, 219-222. Maddumage, R., Fung, R.M.W., Ding, H., Simons, J.L., and Allan, A.C. (2002). Efficient transient transformation of susp ension culture-derived apple protoplasts. Plant Cell, Tissue and Organ Culture 70, 77-83. Maheshwari, N., Rajyalakshmi, K., Bawej a, K., Dhir, S.K., Chowdhry, C.N., and Maheshwari, S.C. (1995). In vitro culture of wheat and genetic transformation: Retrospect and prospect. Critical Reviews in Plant Sciences 14, 149-178.

PAGE 137

124 Manthey, J.A., and Guthrie, N. (2002). Antiproliferative activities of citrus flavonoids against six human cancer cell lines. Jour nal of Agricultural and Food Chemistry 50, 5837-5843. Marsan, P.A., Lupotto, E., Locatelli, F., Qiao, Y.M., and Cattaneo, M. (1993). Analysis of stable events of transf ormation in wheat via PEG-mediated DNA uptake into protoplasts. Plant Science 93, 85-94. Martin, G., Brommonschkel, J., Chunwongse A., Frary, M., Ganal, R., Spivey, T., Wu Earle, E., and Tanksley, S. (1993). Map based cloni ng of a protein kinase gene conferring disease resistance in tomato. Science 262, 1432-1436. Martin, G.B., Bogdanove, A.J., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins Annual Review Plant Biology 54, 23-61. Mason, G., Provero, P., Vaira, A.M., and Accotto, G.P. (2002). Estimating the number of integrations in transformed plan ts by quantitative real-time PCR. BMC Biotechnology 2, 20-30. Mendes, B.M.J., Boscario, R.L., Mouro Filho, F.A.A., and Almeida, W.A.B. (2002). Agrobacterium -mediated transformation of 'Hamlin' sweet orange. Pesquisa Agropecuria Brasileira 37, 955-961. Molinari, H.B.C., Bespalhak, J.C., Kobayashi, A.K., Pereira, L.F.P., and Vieira, L.G.E. (2004). Agrobacterium tumefaciens-mediated transformation of Swingle citrumelo ( Citrus paradise Macf. X Poncirus trifoliate L. Raf.) using thin epicotyl sections. Scientia Horticulturae 99, 379-385. Moore, G.A., Jacono, C.C., Neidigh, J.L., Lawrence, S.D., and Cline, K. (1992). Agrobacterium -mediated transformation of citrus stem segments and regeneration of transgenic plants. Plant Cell Reports 11, 238-242. Murashige, T., and Tucker, D.P. (1969). Growth factor requ irements of citrus tissue culture. In Proceeding of 1 st International Citrus Symposium, pp. 1155-1161. Navarro, L. (1992). Citrus shoot tip grafting in vitro In Biotechnology in agriculture and forestry, No. 18. High-tech and micropropa gation, Y.P.S. Bajaj, ed (Berlin: Springer-Verlag), pp. 327-338. Niedz, R.P., Sussman, M.R., and Satterlee, J.S. (1995). Green fluorescent protein: an in vivo reporter of plant gene expression. Plant Cell Reportes 14, 403-406. Niedz, R.P., Hyndman, S.E., Wynn, E.T., and Bausher, M.G. (2002). Normalizing sweet orange ( C. sinensis (L.) Osbeck ) somatic embryogenesis with semipermeable membranes. In Vitro Cellular and Developmental Biology-Plant 38, 552-557.

PAGE 138

125 Niedz, R.P., Mckendree, W.L., and Shatters, R.G.J. (2003). Electroporation of embryogenic protoplasts of sweet orange ( Citrus sinensis L. Osbeck) and regeneration of transformed plantsast. In Vitro Cellular and Developmental Biology-Plant 39, 586-594. Nimchuk, Z., Eulgem, T., Holt, B.F., and Dangl, J.L. (2003). Recognition and response in the plant immune syst em. Annual Review of Genetics 37, 579-609. Nobre, J., Davey, M.R., Lazzeri, P.A., and Cannell, M.E. (2000). Transformation of barley scutellum protoplasts: Regeneration of fertile transgenic plants. Plant Cell Reports 19, 1000-1005. Nurnberger, T., and Scheel, D. (2001). Signal transmission in plant immune response. Trends in Plant Science 6, 372-379. Ohlsson, M., and Eriksson, T. (1988). Transformation of Brassica campestris protoplasts with Agrobacterium tumefaciens. Hereditas (Lund) 108, 173-178. Oldroyd, G.E.D., and Staskawicz, B.J. (1998). Genetically engi neered broad-spectrum disease resistance in tomat o. Proceedings of the National Academy of Sciences 95, 10300-10305. Pea, L., Cervera, M., Jurez, J., Navarro, A., Pina, J.A., and Navarro, L. (1997). Genetic transformation of lime ( Citrus aurantifolia Swing.): Factors affecting transformation and regeneration. Plant Cell Reports 16, 731-737. Pea, L., Cervera, M., Jurez, J., Navarr o, A., Pina, J.A., Durn-Vila, N., and Navarro, L. (1995a). Agrobacterium -mediated transformation of sweet orange and regeneration of transgenic plants. Plant Cell Reports 14, 616-619. Pea, L., Cervera, M., Jurez, J., Orte ga, C., Pina, J.A., Durn-Vila, N., and Navarro, L. (1995b). High efficiency Agrobacterium -mediated transformation and regeneration of c itrus. Plant Science 104, 183-191. Puchta, H. (1998). Repair of genomic double-stra nd breaks in somatic cells by one-side invasion of homologous se quences. Plant Journal 13, 331-339. Puchta, H. (2003). Marker-free transg enic plants. Plant Cell, Tissue and Organ Culture 74, 123-134. Puonti Kaerlas, J., Ottosson, A., and Eriksson, T. (1992). Survival and growth of pea protoplasts after transfor mation by electroporation. Pl ant Cell, Tissue and Organ Culture 30, 141-148. Radchuk, V.V., Ryschka, U., Sc humann, G., and Klocke, E. (2002). Genetic transformation of cauliflower ( Brassica oleracea var. botrytis) by direct DNA uptake into mesophyll protoplasts. Physiologia Plantarum 114, 429-438.

PAGE 139

126 Rafter, J.J. (2002). Scientific basis of biomarkers and benefits of functional foods for reduction of disease risk: Cancer British Journal of Nutrition 88, s219-s224. Rakoczy-Trojanowska, M. (2002). Alternative methods of plant transformation. Cell Molecular Biology Letter 7, 849-858. Rasmunssen, J.L., Kikkert, J.R., Roy, M.K., and Sanford, J.C. (1994). Biolistic transformation of tobacco and maize susp ension cells using bacterial cells as microprojecriles. Plant Cell Reportes 13, 212-217. Rathus, C., and Birch, R.G. (1992). Stable transformation of callus from electroporated sugarcane protoplas ts. Plant Science 82, 81-89. Reuther, W., Webber, H.J., and Batchelor, L.D. (1967). The citrus industry. (Oakland: Division of Agriculture and Natural Re sources, University of California). Ronald, P. (1997). The molecular basis of disease resistance in rice. Plant Molecular Biology 35, 179-186. Ronald, P., Albano, B., Tabien, R., Abenes, L., Wu, K., McCouch, S.R., and Tanksley, S.D. (1992). Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21. Molecular and General Genetics 236, 113-120. Sambrook, J., and Russell, D. (2001). Molecular cloni ng: A laboratory manual, 3 rd ed. (New York: Cold Spring Harbor Laboratory Press). Sanford, J.C. (1988). The biolistic proce ss. Trends in Biotechnology 6, 299-302. Sanford, J.C. (1990). Biolistic plant transf ormation. Physiologia Plantarum 79, 206-209. Schaart, J.G., Krens, F.A., Pelgrom, K.T.B., Mendes, O., and Rouwendal, G.J.A. (2004). Effective production of marker-free transgenic strawberry plants using inducible site-specific recombination and a bifunctional selectable marker gene. Plant Biotechnology Journal 2, 233-240. Schell, J., Van Montagu, M., De Beuckeleer, M., De Block, M., Depicker, A., De Wilde, M., Engler, G., Genetello, M., H ernalsteens, J.P., Holsters, M., Seurink, J., Silva, B., Van Vliet, F., and Villarroel, R. (1979). Interactions and DNA transfer between Agrobacterium tumefaciens, the Ti-plasmid and the plant host. Proceedings of the Royal Society-B 204, 251-266. Schmidt, M.A., and Parrott, W.A. (2001). Quantitative detection of transgenes in soybean [ Glycine max (L.) Merrill ] and peanut ( Arachis hypogaea L.) by real-time polymerase chain reaction. Plant Cell Reports 20, 422-428.

PAGE 140

127 Schmidt-Rogge, T., Meixner, M., Srivastava, V., Guha-Mukherjee, S., and Schieder, O. (1993). Transformation of haploid Datura inoxia protoplasts and analysis of the plasmid integration pattern in regenerate d transgenic plants. Plant Cell Reports 12, 390-394. Schubert, T.S., Rizvi, S.A., Sun, X., Gottw ald, T.R., Graham, J.H., and Dixon, W.N. (2001). Meeting the challenge of eradicati ng citrus canker in Florida-again. Plant Disease 85, 340-356. Shillito, R. (1999). Methods of genetic tran sformations: Electroporation and polyethylene glycol treatment. In Molecular Improvement of Cereal Crop, I. Vasil, ed (Dordrecht, The Neth erlands: Kluwer), pp. 9-20. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S. Pi, L.Y., Holston, T., Gradner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor kinaselike protein encoded by the rice disease resistance gene, Xa21. Science 270, 1804-1806. Song, W.Y., Pi, L.Y., Wang, G.L., Gardner, J., HoIsten, T., and Ronald, P. (1997). Evolution of the rice Xa21 disease resistance gene family. The Plant Cell 9, 12791287. Song, P., Cai, C.Q., Skokut, M., and Kosegi, B.D. (2002). Quantitative real-time PCR as a screening tool for estimating transgene copy number in WHISKEPRS TM derived transgenic maize. Plnat Cell Reports 20, 948-954. Songstad, D.D., Somers, D.A., and Griesbach, R.J. (1995). Advances in alternative DNA delivery techniques. Plant Ce ll, Tissue and Organ Culture 40, 1-15. Srivastava, V., Anderson, O.D., and Ow, D.W. (1999). Single-copy transgenic wheat generated through the resolution of comple x integration patterns. Proceedings of the National Academy of Sciences 96, 11117-11121. Stall, R.E., Marc, G.M., and Canteros de Echeniquie, B.I. (1982). Importance of mesophyll in mature-leaf resistance to cancrosis of citr us. Phytopathology 72, 1097-1100. Stewart, C.N. (2001). The utility of green fluorescent protein in transgenic plants. Plant Cell Reports 20, 376-382. Stone, J.M., Collinge, M.A., Smith, R.D., Horn, M.A., and Walker, J.C. (1994). Interaction of a protei n phosphatase with an Arabidopsis serine-threonine receptor kinase. Science 266, 793-795. Sukhapinda, K., Kozuch, M.E., Rubin-Wilson, B., Ainley, W.M., and Merlo, D.J. (1993). Transformation of maize ( Zea mays L.) protoplasts an d regeneration of haploid transgenic plan ts. Plant Cell Reports 13, 63-68.

PAGE 141

128 Sun, X., Stall, R.E., Cubero, J., Gottwald, T.R., Graham, J.H., Dixon, W.N., Schubert, T.S., Peacock, M.E., Dickstein, E.R., and Chaloux P.H. (2000). Detection of an unique isolate of citr us canker bacterium from Key lime in Wellington and Lake Worth, Florida. In Pr oceedings of the International Citrus Canker Research Workshop (Ft. Pierce, Florida), pp. 15. Suzuki, K., Hattori, Y., Uraji, M., Ohta, N., Iwata, K., Murata, K., Kato, A., and Yoshida, K. (2000). Complete nucleotide sequence of a plant tumor inducing Ti plasmid. Gene 242, 331-336. Tang, X., Frederick, R.D., Zhou, J., Halt erman, D.A., Jia, Y., and Martin, G.B. (1996). Initiation of plant disease re sistance by physical interaction of AvrPto and Pto kinase. Science 274, 2060-2063. Tang, X., Xie, M., Kim, Y.J., Zhou J., Klessig, D.F., and Martin, G. (1999). Overexperssion of Pto activates defense response a nd confers broad resistance. Plant Cell 11, 15-30. Tian, Q., Miller, E.G., Ahmad, H., Tang, L., and Patil, B.S. (2001). Differential inhibition of human cancer cell proliferat ion by citrus limonoids. Nutrition and Cancer 40, 180-184. Tiwari, V.K., Zhang, J., Gold s, T.J., Cocking, E.C., Davey, M.R., and Power, J.B. (2001). Effect of heat shock trea tment on Hordeum vulgare protoplast transformation mediated by polyeth ylene glycol. Biologia Plantarum 44, 25-31. Tzfira, T., and Citovsky, V. (2002). Partners in infection: Host proteins involved in the transformation of plant cells by Agrobacterium Trends Cell Biology 12, 121-128. Uchimiya, H., Hirochika, H., Hashimoto, H., Hara, A., Ma suda, T., Kasumimoto, T., Harada, H., Ikeda, J.E., and Yoshioka, M. (1986). Co-expression and inheritance of foreign genes in transformants obt ained by direct DNA transformation of tobacco Nicotiana tabacum protoplasts. Molecular and General Genetics 205, 1-8. Vardi, A., Bleichman, S., and Aviv, D. (1990). Genetic transformation of citrus protoplasts and regeneration of tr ansgenic plants. Plant Science 69, 199-206. Vernire, C., Hartung, J.S., Pruvost, O.P., Civerolo, E.L., Alvarez, A.M., Maestri, P., and Luisetti, J. (1998). Characteriza tion of phenotypically distinct strains of Xanthomonas axnoopodis pv. citri from southwest Asia. European Journal of Plant Pathology 104, 477-487. Viloria, Z., Drouillard, D.L., Graham, J.H., and Grosser, J.W. (2004). Screening triploid hybrids of 'Lakeland' limequat for resistance of citrus canker. Plant Disease 88, 1056-1060.

PAGE 142

129 Wang, G.L., Mackill, D.J., Bonman, J.M ., McCouch, S.R., and Nelson, R.J. (1994). RFLP mapping of genes conferring complete and partial resistance to blast in a durably resistant rice cultiar. Genetics 136, 1421-1434. Wang, G.L., Song, W.Y., Wu, R.L., Sideris, S., and Ronald, P. (1996). The cloned gene, Xa27, confers resistance to multiple Xanthomonas oryzae pv. oryzae isolates in transgenic plants. Molecula r Plant-Microbe Interactions 9, 850-855. Wang, G.L., Ruan, D.L., Song, W.Y., Sideri s, S., Chen, L., Pi, L.Y., Zhang, S., Zhang, Z., Fauquet, C., Gaut, B.S., Whalen, M.C., and Ronald, P. (1998). Xa21D encodes a receptor-like molecule with a leucinerich repeat domain that determines racespecific recognition and is subject to adaptive evolution. Plant Cell 10, 765-779. Wang, X.F., Yang, A.F., and Zhang, J.R. (1999). Genetic transformation of protoplasts from Peucedanum terebinthaceum and regeneration of herbic ide-resistant plantlets. Acta Botanica Sinica 41, 706-710. Wang, Y.P., Sonntag, K., Rudloff, E., and Han, J. (2005). Production of fertile transgenic Brassica napus by Agrobacterium -mediated transformation of protoplasts. Plant Breeding 124, 1-4. Watsona, J., Koyaa, V., Lepplab, S.H., and Daniell, H. (2004). Expression of Bacillus anthracis protective antigen in transgenic ch loroplasts of tobacco, a non-food/feed crop. Vaccine 22, 4374-4384. Winfield, S., Lawton, R., Daniell, H., and Dhir, S.K. (2001). Transformation of sweet potato tissues with green fluorescent protein gene In Vitro Cellular and Developmental Biology-Plant 37, 648-653. Wong, M.L., and Medrano, J.F. (2005). Real-time PCR fo r mRNA quantification. BioTechniques 39, 75-85. Wu, Z., and Burns, J.K. (2003). Isolation and characte rization of a cDNA ecoding a lipid transfer protein expressed in Valen cia orange during abscission. Journal of Experimental Botany 54, 1183-1191. Yadav, N., Van der Leyden, J., Bennett, D.R., Barnes, W.M., and Chilton, M.D. (1982). Short direct repeats fla nk the T-DNA on a nopaline Ti-plasmid. Proceedings of the National Academy of Sciences 79, 6322-6326. Yang, L., Ding, J., Zhang, C., Jia, J., Weng, H., Liu, W., and Zhang, D. (2005). Estimating the copy number of transgenes in transformed rice by real-time quantitative PCR. Plant Cell Reports 23, 759-763. Yao, J.L., Cohen, D., Atkinson, R., Richardson, K., and Morris, B. (1995). Regeneration of transgenic plants from co mmercial apple culture royal gala. Plant Cell Reports 14, 407-412.

PAGE 143

130 Yao, J.L., Wu, J.-H., Gleave, A.P., and Morris, B.A.M. (1996). Transformation of citrus embryogenic cells using partivle bom bardment and production of transgenic embryos. Plant Science 113, 175-183. Yu, C.H., Huang, S., Chen, C.X., Den g, Z.N., Ling, P., and Gmitter, F.G. (2002). Factores affecting Agrobacterium -mediated transformatiom and regeneration of sweet orange and citrange. Plant Cell, Tissue and Organ Culture 71, 147-155. Zhu, Z., Hughes, K.W., and Huang, L. (1990). Transformation of tobacco protoplasts with DNA entrapped in pH-sensitive li posomes. Plant Cell, Tissue and Organ Culture 22, 135-146. Zupan, J., and Zambryski, P. (1995). Transfer of T-DNA from Agrobacterium to the plant cell. Plant Physiology 107, 1041-1047. Zupan, J., Muth, T.R., Draper, O., and Zambryski, P. (2000). The transfer of DNA from Agrobacteriom tumefaciens into plants: a feast of fundamental insights. Plant Journal 23, 11-28.

PAGE 144

BIOGRAPHICAL SKETCH Ahmad Al-Sayed Mohamad Omar was bor n in El-Senblaween, Dakahiliah, Egypt, on February 1, 1971. He graduated form Ah med Lotfey El-sayed High School in El-Senblaween in 1989. He received a Bachelor of Science in Agricultural from Zagazig University, Egypt, with an honor s degree in a major of agri culture chemistry in June 1993. Upon graduation, Ahmad was appointed to a position as a research assistant by Biochemistry Department, Zagazig Universit y, Egypt, where he received the Master of Science in biochemistry in November 1997. During this period, Ahmad conducted biochemical research and taught inorga nic chemistry, organic chemistry, and biochemistry courses for undergraduate student s at the Faculty of Agriculture, Zagazig University. Ahmad was awarded a scholar ship from the Egyptian Government to pursue his Ph.D. studies abroad. In the spring of 2000, he enrolled in the graduate program of the Plant Pathology Department at University of Florida. In the summer of 2000, he changed the program to the Horticultu ral Science Department at the same university under the supervision of Dr. Jude W. Grosser, professor of cell genetics at University of Florida. He completed his research at the Citrus Resear ch and Education Center in Lake Alfred, Florida. After completing his Ph.D. program, Ahmad will continue to work in Dr. J. W. Grossers program as a postdoctoral researcher to gain mo re experience in the area of biochemistry and plant biotechnology. After hi s wife finishes her Ph.D. program, they 131

PAGE 145

132 will return to Egypt to take their positions as an assistant professor at Biochemistry Department, Faculty of Agriculture, Za gazig University (Ahmad) and Mansoura University (Azza). Ahmad will teach undergra duate and graduate biochemistry and molecular biology courses and conduct research to apply what he has learned to improve the Egyptian citrus industry. He also is an active member of the E gyptian Student Association North America (ESANA). He is married to Azza H. Mohamed who is pursuing her Ph.D. at the University of Florida, too. They have one daughter, Aala A. Omar. Finally, after more than five years in which life has happened, te ars have been shed, and dreams that did not come true exactly the way he expected, HE IS GOING TO HAVE HIS DOCTORATE.


Permanent Link: http://ufdc.ufl.edu/UFE0013483/00001

Material Information

Title: Biotechnology and Its Uses in Improvement of Canker Resistance in Citrus Trees
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013483:00001

Permanent Link: http://ufdc.ufl.edu/UFE0013483/00001

Material Information

Title: Biotechnology and Its Uses in Improvement of Canker Resistance in Citrus Trees
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013483:00001


This item has the following downloads:


Full Text












BIOTECHNOLOGY AND ITS USES IN IMPROVEMENT OF CANKER
RESISTANCE IN CITRUS TREES
















By

AHMAD AL-SAYED MOHAMAD OMAR


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Ahmad Al-Sayed Mohamad Omar














Dedication


To the memory of my mother who I will never ever forget her undying love and
encouragement during all the steps of my life.





To the memory of my brother Ragab who taught me that dreams are to be pursued and
challenges to be met.





To my father and my family who give me unconditional support and encouragement
during all the steps of my life.





To my wife Azza


To my beloved daughter whose smile gives me a reason to wake up everyday.















ACKNOWLEDGMENTS

I thank my family for the unconditional support and encouragement during all the

steps of the program. They have always believed in me and helped me in many ways.

I appreciate the undying love and support I receive from my sisters and brothers and their

respective families. I thank the Egyptian Government, Ministry of Higher Education, for

sponsoring most of my graduate studies abroad and for its overall attention with the

fellows.

My time as a graduate student was made more productive because of the

outstanding support and the magnificent guidance of my major advisor, Dr. Jude Grosser.

He always provided me with many useful experiences, encouragement, and thoughtful

advice for both my professional and personal life. I will never forget his words, "The

moon will be perfect someday" during one of the most difficult hardship moments during

the program. Without his help and support I would never been able to finish my Ph.D.

His high ethical standards and respectful views for the others will never be forgotten. For

what he did for me, I am grateful beyond words.

I thank the other members of my supervisory committee, Dr. James Graham, for his

valuable help and guidance in regard to Real-Time PCR experiment and canker challenge

assay; Dr. Wen-Yuan Song, for his contribution and suggestions in the DNA cloning

aspects; Dr. Frederick Gmitter, for his suggestions and help. I thank Dr. R. P. Niedz for

providing pARS 108 plasmid, Dr. Pamela Ronald for providing cDNA of the Xa21 gene,









and Dr. T. E. Clemente for providing pRTL2.vec plasmid. I am highly grateful to

Dr. Siddarame Gowda for his help at the first stages of my work.

I am also very grateful to my Egyptian colleagues that shared their care and

friendships. I especially want to thank Dr. Fahiem El Borai, for his valuable help and

suggestions, Hesham Orbay, Kamal and his family, and Shamel and his family. Thanks

go to Dr. Mohamed Ismail for proofreading my manuscript.

During my academic and professional carrier I have been fortunate to meet people

that helped me in many different ways of positive attitude. I especially thank J. L.

Chandler, Gary Barthe, Wen Wu Guo, Ananthakrishnan, Vladimir Orbovic, Millica

Calovic, Zenadia Viloria, Gemma Pasquali, Marty Dekkers, Anna Redondo, Orrinna

Speese, Patricia Brickman, Charles Dunning, Julie Gmitter, Avijit Roy, Mohammad

Afunian, Mukkades Kayum, Kanjana Mahattanatawee, Qamar Zaman, Gretchen Baut,

Monica Lewendowski, Pamela Russ, Diann Achor, Allan Burrage, and Marcia Alden for

the limitless help, understanding, and friendship they have provided to me in the past five

years.

I also thank Zagazig University, Egypt, for its support in conducting this project

and also the faculty of the Biochemistry Department, College of Agriculture, Zagazig

University, Egypt, whose support was essential to conduct and conclude this program.

I especially thank my professors back in Egypt, Dr. Mahmoud Dohiem and Dr. Samy

Sharobeem, who taught me the fundamentals of biochemistry and plant molecular

biology.

Finally, I would like to extend my special gratitude and thanks to my wife, Azza,

for her immeasurable love, constant and unconditional support, and encouragement.
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ......... .................................................................................... iv

LIST OF TABLES ................ ........... ..... ................. .... ..................... .. ix

LIST OF FIGURES ............................... ... ...... ... ................. .x

ABSTRACT ........ .............. ............. .. ...... .......... .......... xii

CHAPTER

1 INTRODUCTION ............... ................. ........... ................. ... ..... 1

2 REVIEW OF LITERATURE ......................................................... .............. 5

C itru s C an k er ...................................... ................................ ................ .. 5
M methods of Transform action ............ .......................... .. ......................................7
Arobacterium tumefaciens-Mediated Transformation ............... .... ..............8
Biolistics or M icroprojectile Bombardment.................. .. ............... .....................11
Protoplast Transform ation ........................................................ ............. 13
Plant R resistance (R ) Proteins............................................. ............................. 16
M ode of Action of the Xa2 ................................ ... ........ ...................... 19
O b j e c tiv e s ...................................................................................................2 5

3 TRANSFER OF THE XA21 XANTHOMONAS RESISTANCE GENE FROM
RICE INTO 'HAMLIN' SWEET ORANGE [CITRUS SINENSIS (L.) OSBECK]
USING A PROTOPLAST/GFP CO-TRANSFORMATION SYSTEM ...................26

In tro du ctio n ..................................... ................... ............................ 2 6
M materials and M methods ....................................................................... ..................30
Plasmid Construction............. ...... ........................ 30
Plasm id M ultiplication ............................................... ............................. 35
Transform ation of E. coli ............... ........... ....... .. ................. .... 35
Quick miniprep plasmid preparation and confirmation of insert
orientation ................................. .......................... ...........35
Large scale isolation and plasmid preparation .......................................... 36
Plant Material, Protoplast Transformation, and Culture .....................................36
Establishment and maintenance of suspension cultures...........................36
Transformation and culture of citrus protoplasts ......................................37









Regeneration and selection of transformed protoplasts .............................38
Comparison of different GFP-containing constructs at the whole plant
level ............... ...... ........ ................... 39
M olecular Analysis of Transgenic Tissue .............. ...................................... 39
Polymerase chain reaction (PCR) for detection of transformants................40
Southern blot analysis ............................................................................ 40
W western blot analysis ......................... .. .. ......... ......... ........ ......41
R results and D iscu ssion ............................. ........................ .. ...... .... ...... ...... 43
Plasm id Preparation.............................. .. ...... .. .. ................ ......... .... .43
Transformation of Citrus Protoplasts and Plant Regeneration............................43
Comparison of different GFP-containing constructs.............................. 44
Transient and stable transformation frequencies using GFP as a
selectable m arker ........ ...................................... .. ... ....... ........ .... 45
Plant regeneration ........ ....................................................................... 47
M molecular Analysis............................... .. ........ .. ............ 55
Polymerase chain reaction (PCR) for screening transformants....................55
Screening for transformants using southern blot analysis..........................57
Confirmation of transformation using western blot analysis ..................58

4 TRANSGENIC 'HAMLIN' SWEET ORANGE PLANTS CONTAINING A
RICE XA21 cDNA XANTHOMONAS RESISTANCE GENE OBTAINED BY
PROTOPLAST/GFP TRANSFORMATION SYSTEM ..........................................60

In tro du ctio n ..................................... ................... ............................ 6 0
M materials and M methods ....................................................................... ..................6 1
Plasm id C onstruction...... .......... .... .................... .. ...... ........ .. ......... 61
Plasm id M ultiplication ............................................... ............................. 63
Transform ation ofE coli ................. .... ................... ............... .... 63
Quick miniprep plasmid preparation and confirmation of the orientation
of the insert .................................. ................................ .......... 63
Large scale preparation of plasmid DNA................... ........... .................. 63
Plant Material, Protoplast Transformation, and Culture ...................................65
Establishment and maintenance of suspension cultures...........................65
Isolation, transformation, and culture of citrus protoplasts..........................65
Regeneration and selection of transformed protoplasts .............................65
M olecular Analysis of Transgenic Plants..................................... ................... 66
Polymerase chain reaction (PCR) for detection of transformants ..............66
Southern blot analysis ............................................................................ 66
W western blot analysis .............................................................................67
R results and D iscu ssion ............................. ........................ .. ...... .... ...... ...... 68
Plasm id Preparation.............................. .. ...... .. .. ................ ......... .... .68
Transformation of Citrus Protoplasts and Plant Regeneration............................69
Transient and stable transformation frequencies using GFP as selectable
marker ......................................................................... ......... .................. 69
Plant regeneration ........... ...... .... .... ....... ..... ..................... 71
GFP expression at the mature stage of the transgenic plants.....................75
M olecular A naly sis........... .............................................................. ...... ... 78









Polymerase chain reaction for selection of transformants .........................78
Screening for transformants using southern blot analysis..........................78
Confirmation of transformation using western blot analysis ....................79

5 ESTIMATING THE COPY NUMBER OF TRANSGENES IN
TRANSFORMED CITRUS PLANTS BY QUANTITATIVE REAL-TIME PCR...83

In tro d u ctio n ...................................... ................................................ 8 3
M materials and M methods ....................................................................... ..................87
T ran sgenic P lants........... ............................................................. .. .... .. ... .. 87
D N A E extraction .......... .................... ...... .... ...... .... .... ........ ... ..... ....... .....88
Quantitative Real-time Polymerase Chain Reaction (qRt-PCR) .......................88
P rim ers and probes ........... .. ........... ......................... .. ................ .. 88
Real-time PCR reactions and conditions ..............................................89
Optim ization of prim er concentrations ................................ ............... 90
PCR efficiency .................... ............ .... ................. ............. ........ 90
Calculation of Copy Number and Statistical Analysis...................................... 91
R results and D discussion ............... ........................................ ........... ...... ........ .. 92
Transgene Xa21 Copy Number Estimation in Transgenic Citrus by
Comparison to the Endogenous LTP Gene........................ .................92
Validation of the Standard Curves and PCR Efficiency .................................93
Estimating the Copy Number of Xa21 in the Transgenic Citrus.........................96
Comparison of Copy Number Determination by qRT-PCR and Southern Blot
A n a ly sis ...................................................................................................... 9 7
C conclusion ............. ................................................................................. 98

6 SUMMARY AND CONCLUSIONS.................. ......... ...............101

APPENDIX

A CITRUS PROTOPLASTS MEDIA AND SOLUTION.....................................104

B PCR PRIMERS AND PROGRAM .....................................................................111

C MOLECULAR ANALYSIS SOLUTION ...........................................................112

D QUANTITATIVE REAL TIME-PCR ............ ........................ 114

L IST O F R E FE R E N C E S ........................................................................ ................... 115

BIOGRAPHICAL SKETCH ......................................................................... 131
















LIST OF TABLES


Table page

1-1 T otal production of citrus fruit.............................................................................

2-1 Examples of plant protoplast transformation experiments and success of
transgenic plant recovery ................................................ ............................. 18

2-2 Plant disease resistance (R) proteins and their predicted structure ........................22

5-1 Primers pairs and probes ofLTP and Xa21 genes used for quantitative real-time
P C R a ssay s ...............................................................................................................8 9

5-2 Reproducibility of the Ct measurement of replicate standards ..............................97

5-3 Real-time PCR estimates of copy number for Xa21 transgene..............................100

A-i Composition of the EME medium ................................................. ...............104

A-2 Composition of RMAN medium................................................................. 105

A-3 Composition of 0.6 m BH3 nutrient medium....................................................... 106

A-4 Composition of sucrose and mannitol solutions ...............................................107

A-5 Composition of protoplast transformation solutions.............................................107

A -6 Com position of H +H m edium .................................................................... .... .. 108

A-7 Composition of B+ medium .................. ................................. 109

A -8 Com position of DBA 3 m edium ................................... ............................. ....... 110

A-9 Composition of the enzyme solution used for citrus protoplast isolation ............10
















LIST OF FIGURES


Figure page

2-1 Schematic representation of different genetically defined plant resistance
p ro te in s ................................................... .................... ................ 2 1

3-1 Schematic diagram of pARS108 ER targeting............... ..... ...............32

3-2 Schematic diagram ofp524EGFP Cyt-targeting ............................................. 32

3-3 Schematic diagram of the construction of Xa21 cDNA clone pCR504...................33

3-4 Schematic diagram of the construction of pXa21-mTag plasmid..........................34

3-5 Cytoplasmic targeting of GFP expression in a mature citrus leaf ...........................50

3-6 ER targeting of GFP expression in a mature citrus leaf ........................................51

3-7 Citrus transgenic plant regeneration and GFP monitoring from protoplast to
plant ................. ...... ............................... ...........................52

3-8 in vitro grafting of transgenic 'Hamlin' sweet orange onto nucellar seedlings of
Carrizo citrange ............ ............ ............. ............. 54

3-9 Shoot-tip grafting of transgenic 'Hamlin' sweet orange onto Carrizo citrange
and/or sour orange .......... .. .................................... ...... ............ ............ 55

3-10 Multiple PCR analysis to detect the presence of the GFP and the cDNA of the
Xa21 genes in transgenic citrus plants .......................................... ............... 56

3-11 Southern hybridization analysis of 'Hamlin' sweet orange plants with the cDNA
of th e X a 2 1 g en e .................................................. .............. ................ 57

3-12 Western blotting analysis of transgenic 'Hamlin' sweet orange............................59

4-1 Schem atic diagram of pAO3 plasmid .............................. .... ..... ..................... 64

4-2 Citrus transgenic plant regeneration and GFP monitoring from protoplast to
p lant ............. .......... ... ......... .................... ............................7 3

4-3 ER targeting of GFP expression in a mature citrus leaf .......................................76









4-4 ER targeting of GFP expression in a mature citrus leaf .......................................77

4-5 Multiple PCR analysis to detect the presence of the GFP and the cDNA of the
Xa21 genes in transgenic citrus plants .......................................... ............... 81

4-6 Southern hybridization analysis of 'Hamlin' sweet orange plants with the cDNA
of th e X a 2 1 g en e .................................................. ............. .................. 8 1

4-7 Western blotting analysis of transgenic 'Hamlin' sweet orange ...........................82

5-1 G global area ofbiotech crops........... ................. .......... ............... ............... 85

5-2 Real-time PCR amplification of endogenous LTP and transgene Xa21 genes ........94

5-3 Standard curve of endogenous LTP and transgene Xa21 genes..............................95

5-4 Correlation between the copy numbers in transgenic citrus determined by
quantitative RT-PCR and the number of copy/inserts detected with southern blot
analy sis. ..............................................................................98















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

BIOTECHNOLOGY AND ITS USES IN IMPROVEMENT OF CANKER RESISTANCE
IN CITRUS TREES

By

Ahmad Al-Sayed Mohamad Omar

May 2006

Chair: Jude W. Grosser
Major Department: Horticultural Sciences

'Hamlin' sweet orange (Citrus sinensis (L.) Osbeck) is one of the leading

commercial cultivars in Florida because of its high yield potential and early maturity.

'Hamlin' also has a high regeneration capacity from protoplasts and is often used in

transformation experiments. Citrus canker disease caused by the bacterial pathogen

Xanthomonas axonopodis pv. citri is becoming a worldwide problem. The Xa21 gene is a

member of the Xa21 gene family of rice that provides broad spectrum Xanthomonas

resistance in rice. Since the citrus canker pathogen is in the same genus, this gene may

have the potential to function against canker in citrus. The wild-type Xa21 gene contains

an intron, and there is some question as to whether dicot plants can process genes

containing monocot introns (the cDNA is intron free). The development of canker

resistant citrus has become an important research objective.

Genetic transformation has become a widespread tool in both basic research and

commercial plant breeding programs for disease resistance. Plasmid DNA (pARS108)









encoding the non-destructive selectable marker Green Fluorescent Protein (GFP) gene,

and the plasmid cDNA of the Xa21 gene (pCR506-mtaq) were co-transformed into

'Hamlin' orange protoplasts using polyethylene glycol. Also, plasmid DNA (pAO3),

encoding the GFP gene and the cDNA of the Xa21 gene, was transformed into 'Hamlin'

orange protoplasts. Following protoplast culture in liquid medium and transfer to solid

medium, transformed colonies were microscopically selected via expression of GFP,

physically separated from non-transformed tissue, and cultured on somatic

embryogenesis induction medium. More than 150 transgenic embryoids were recovered.

Over a thousand transgenic plantlets were regenerated from about 80 independent

transformation events. PCR analysis revealed the presence of the cDNA of the Xa2] and

the GFP genes in some of the transgenic plantlets. The recovery of multiple transgenic

plants was expedited by in vitro grafting. The transgenic plants have shown normal

growth and stable GFP expression for over a year in the greenhouse. Transgenic

greenhouse plants include 400 growing on different rootstocks and over 200 plants on

their own roots. This is the first time to report a large population of transgenic 'Hamlin'

sweet orange plants using protoplast/GFP transformation system. PCR analysis revealed

the presence of the cDNA of the Xa21 and the GFP genes in the transgenic greenhouse

plants. Some of the plants have only GFP. Southern analysis shows integration of the

cDNA into different sites ranging from 1-5 sites per plant. Real-Time PCR shows

integration of the cDNA into different sites in citrus genome ranging from 1-4 copies per

plant. Western analysis shows the expression of the cDNA of the Xa21 gene in the

transgenic citrus plants. This is the first time that a gene from rice has been stably

integrated and expressed in citrus plants.














CHAPTER 1
INTRODUCTION

The importance of emerging biotechnologies in the agriculture industry and the

desire to apply science to benefit society were among the goals of this study. The

significance of the potential benefits biotechnology-based science offers can be

appreciated by considering the tremendous progress in plant improvement that has been

made in recent years. Recent advances in molecular genetics, informatics, and genomics

research have created many new possibilities for applying biotechnology in agriculture.

The promise of biotechnology as an instrument of development lies in its capacity to

improve the quantity and quality of plants quickly and effectively. The application of

biotechnology holds great potential for creating plants that are more drought resistant,

more tolerant to acidic and saline soils, more resistant to pests (thereby reducing pesticide

use), and more resistance to biotic stresses including viral, fungal, and bacterial diseases.

Using biotechnology tools in the agriculture industry can help to supply the world,

especially the developing countries with enough high quality food and innovative

pharmaceutical products, goals that are difficult to achieve by classical methods.

Genetic engineering of agronomically and horticulturally important species is

creating a new era in agriculture with the first generation of achievements in herbaceous

plants already in commercial use and greater prospects on the horizon. The potential of

genetic improvement is of great interest to growers of woody fruit plants. Most

commercial varieties are propagated vegetatively and are hybrids of unknown origin or

budsports that have been selected by growers and essentially cannot easily be improved









by traditional breeding methods due to the aspects of their biology including high

heterozygosity. Even when traditional breeding may be effective for crop improvement,

there is always a long period of time between generations. Genetic engineering allows the

insertion of specific genes into the genome of currently successful varieties, theoretically

adding desirable traits without otherwise altering cultivar integrity.

Citrus fruits taste good and are a well-known source of vitamin C and antioxidants.

Moreover, several epidemiological studies have shown that citrus fruits and their

components are protective against a variety of human cancers (Tian et al., 2001; Manthey

and Guthrie, 2002; Rafter, 2002; Kim et al., 2005). Processed citrus peel and pulp is a

valuable, high energy by-product that can partly replace cereal grains in animal diets

without adverse effect on their products (i.e., milk in terms of yield or composition)

(Fegeros et al., 1995). Because of its nutritional relevance, citrus is an important industry

worldwide, raising economies at macro and local levels by supporting social development

directly with jobs and secondary industries and services. Citrus fruits are produced in

many countries around the world, although production shows geographical concentration

in certain areas, primarily within tropical and subtropical regions (within 40 north-south

latitude). Mediterranean countries are the leading producers for the international fresh

market. The total production has systematically increased in the last four decades, and,

more recently reached more than one hundred million tons yearly (Table 1-1)

(Anonymous, 2005). It is not only the quantities of citrus that are important, but also the

quality of the fruit. Implementation of modern technology in citrus production has

improved efficiency, flexibility, and resulted in high quality standards. As a result of









trade liberalization and technological advances in fruit transport and storage, the citrus

fruit industry has become more global in scope.

The exact center of origin of citrus is not clearly identified, although most

researchers place it in South-East Asia, at least 4000 years BC (Davies and Albrigo,

1994). The spread of citrus fruits from Asia to Europe was initially slow. The Arabs

introduced the citron, the sour orange, the lemon, and the shaddock into Spain and the

countries of North Africa (Reuther et al., 1967). Probably after the fall of the Roman

Empire, citrus was introduced to the South of Europe, and its availability expanded in the

Middle Ages. Citrus was first brought to the new world by the Spanish and Portuguese

explorers at the beginning of the fifteen century (Allen, 2000). By the second half of the

nineteen century, the fresh fruit companies had been established, and the frozen

concentrated technology, developed in the 1940s in Florida (Lewandowski, 2000),

increased the demand for citrus juices.

To achieve and maintain an adequate level of quality, many changes in production

systems were necessary to meet the ongoing needs of growing markets and the demands

of new challenges, such as changes in biological concerns, unexpected drought and cold

stresses, outbreaks of pests and diseases, and establishment of economic and political

barriers. Consequently, production constraints have been overcome by the use of grafted

plants to replace seedlings, changes in rootstocks, and selection of new cultivars. The

application of biotechnology tools such as somatic hybridization, somaclonal variation,

embryo rescue, cytology, and genetic transformation should accelerate the production of

improved varieties. Such varieties are expected to help the industry overcome barriers to

production and to help create new marketing opportunities.









Available literature suggests that the need for innovative research and the use of

biotechnology tools in citriculture are not recent events. In fact, despite frequent new

challenges in the last decade, citrus production has exceeded other important fruit crops

such as bananas, apples, and grapes according to FAO (Anonymous, 2005).

Egypt produces a significant amount of high quality citrus fruits in the world,

producing approximately 2.56 million tons in 2004 (ranking number ten in citrus

production (Table 1-1)). The breakdown of citrus production in Egypt is as follows:

sweet oranges 68%, tangerine and mandarin 20%, lemons and limes 12%, and grapefruit

and pummelos less than 1%. The citrus-planted area has expanded over the last three

decades to reach about 143,883 Ha (Anonymous, 2005).

Table 1-1. Total production of citrus fruit (Mt)
Country Production (Mt) Metric ton
Brazil 20,594,000
United States of America 14,907,660
China 14,654,875
Mexico 6,475,411
Spain 6,206,800
India 4,750,000
Islamic Republic of Iran 3,825,000
Nigeria 3,250,000
Argentina 2,690,000
Egypt 2,561,600
Others 28,620,142
Total (The World) 108,535,488














CHAPTER 2
REVIEW OF LITERATURE

Citrus Canker

Asiatic citrus canker (ACC) is one of the most economically damaging plant

diseases affecting citrus worldwide. ACC is caused by the bacterial pathogen

Xanthomonas axonopodis pv. citri (Xac) (syn. X citri, X campestris pv. citri). The citrus

canker pathogen can affect the majority of the commercial citrus varieties and close

relatives of citrus in the family Rutaceae worldwide where moist, subtropical to tropical

climates occur. All above ground tissues of citrus are susceptible to Xac when they are

young, and maximum susceptibility occurs during the last half of the expansion phase of

growth (Gottwald and Graham, 1992).

The disease symptoms appear as distinctive necrotic raised lesions on leaves,

stems, and fruits. Severe infections can cause defoliation, blemished fruit, premature fruit

drop, twig dieback, and general tree decline (Schubert et al., 2001). Stall et al. (1982)

reported that once leaves, twigs and fruit reach mature size and begin to harden off

physiologically, they become more resistant to natural stomatal infection but may be

subject to wound infection (Schubert et al., 2001). The disease spreads rapidly in

situations in which high wind, rain, and warm temperatures occur at the same time as

new shoots and fruit emerge (Gabriel, 2001).

Among citrus cultivars, grapefruit is the most susceptible to citrus canker followed

by sweet oranges 'Hamlin', 'Pineapple' and 'Navels', 'Mexican' (Key) lime, and the

hybrids of trifoliate orange used as rootstocks (Gottwald et al., 2002). These cultivars









have proven to be very difficult to grow profitably in the presence of the citrus canker

pathogen in moist subtropical and tropical climates due to high production costs linked

with windbreaks and additional foliar sprays of copper bactericides (Graham, 2001;

Gottwald et al., 2002).

There are different forms of citrus bacterial canker (CBC) based on different

pathogenicities of the bacteria (Cubero and Graham, 2002). The Asiatic type of canker

(A type), caused by a group of strains originally found in Asia, is by far the most

widespread and severe form of the disease. This is the group of X axonopodis pv. citri

strains that causes the disease most referred to as Asiatic citrus canker (Gottwald et al.,

2002). It is the most virulent form and affects the majority of susceptible hosts. The CBC

B and C types are caused by X axonopodis pv. aurantifolii. Pathotype B strains are most

severe on lemons (Citrus limon (L.) Burm f.), and are found only in Argentina, Uruguay,

and Paraguay. Pathotype C strains have been found in Sao Paulo, Brazil on 'Key' lime

(Citrus aurantifolii (Christm.) Swingle) (Schubert et al., 2001). Verniere et al. (1998)

isolated and characterized a new strain ofX. axonopodis pv. citri designated as A* from

southwest Asia. This strain can infect only 'Key' lime and is closely related to type A

strains. A similar strain has been isolated from Florida and designated as A" (Sun et al.,

2000). This strain has a restricted host range that includes 'Key' lime and alemow (Citrus

macrophylla Wester).

Replacing the susceptible varieties by field resistant cultivars seems to be the best

long-term solution. Even though classical selection or breeding for canker resistance is a

promising solution, it is excessively time consuming. Genetic transformation could be a









useful alternative, since the resistance gene could be introduced into the susceptible

cultivars without otherwise altering cultivar integrity.

Methods of Transformation

Plant genetic transformation is a powerful application used to study gene

expression in plants. It has contributed substantially to the understanding of gene function

and the regulation of physiological and developmental processes, in the generation of

transgenic organisms for widespread usage in agriculture, and has increased the potential

uses of plants for industrial and pharmaceutical purposes. The powerful combination of

genetic engineering and conventional breeding programs permits the introduction of

useful traits encoded by transgenes into commercial crops within an economically viable

time frame. There is great potential for genetic manipulation of crops to enhance

productivity through increasing resistance to diseases, pests, and environmental stress

(Hansen and Wright, 1999). Advances in tissue culture, combined with improvements in

transformation technology, have resulted in increased transformation efficiencies.

Successful plant transformation systems require that certain criteria be met. Among

the requirements for transformation are target tissues capable of propagation or

regeneration, an efficient DNA delivery method, agents to select for transgenic tissues,

the ability to recover transgenic plants at a reasonable frequency, a simple, efficient,

reproducible, genotype-independent and cost-effective process, and a short time frame in

culture to avoid somaclonal variation and possible sterility (Hansen and Wright, 1999).

There are three techniques that appear to meet these criteria: (1) Agrobacterium-mediated

transformation, (2) biolistics or microprojectile bombardment, and (3) protoplast

transformation.









Arobacterium tumefaciens-Mediated Transformation

About three decades ago, the concept of using Agrobacterium tumefaciencs as a

vector to create transgenic plants was considered as a prospect and a wish. Today, many

agronomically and horticulturally important species are routinely transformed using this

bacterium. Agrobacterium tumefaciencs is the pathogen that causes crown gall disease in

many plant species. The infection cycle of Agrobacterium is very complex, involving a

number of signals emitted by both host and the pathogen (Gelvin, 2003). The virulent

strains ofA. tumefaciencs contain large plasmids that are responsible for the DNA

transfer that subsequently causes the gall formation. This plasmids have been termed

tumor-inducing or Ti plasmids (Schell et al., 1979; Chilton et al., 1980).

The transformed DNA (T-DNA) is referred to as the T-region that is located on the

Ti plasmid. T-regions on native Ti are approximately 10 to 30 kbp in size (Barker et al.,

1983; Suzuki et al., 2000). Thus, T-regions generally represent less than 10% of the Ti

plasmid. Some plasmids contain one T-region, whereas the others contain multiple

T-regions (Barker et al., 1983). T-regions are specified by T-DNA border sequences.

These borders are 25 bp in length and highly homologous in sequence (Yadav et al.,

1982). In general, the T-DNA borders specify the T-DNA, because these sequences are

targets of the VirDl/VirD2 border specific endonuclease that processes the T-DNA from

the Ti plasmid (Gelvin, 2003). There are many proteins encoded by vir genes that play

essential roles in the Agrobacterium-mediated transformation process (Christie, 1997;

Gelvin, 2000; Zupan et al., 2000; Tzfira and Citovsky, 2002).

The T-DNA becomes covalently integrated into plant nuclear DNA. T-DNA

contains two types of genes: the oncogenic genes, encoding for enzymes involved in the

synthesis of auxins and cytokinins and responsible for tumor formation; and the genes









encoding for the synthesis of opines. These compounds, produced by condensation

between amino acids and sugars, are synthesized and excreted by the crown gall cells and

consumed by A. tumefaciens as carbon and nitrogen sources. Located outside the T-DNA

are genes for opine catabolism, the genes involved in the process of T-DNA transfer from

the bacterium to the plant cell and the genes involved in bacterium-bacterium plasmid

conjugative transfer (de la Riva et al., 1998). The process of gene transfer from

Agrobacterium tumefaciens to plant cells could be summarized as follows: (1) bacterial

colonization, (2) induction of bacterial virulence system, (3) generation of T-DNA

transfer complex, (4) T-DNA transfer, and (5) integration of T-DNA into plant genome

(de la Riva et al., 1998). The T-DNA transfer is mediated by products encoded by the

30-40 kb vir region of the Ti plasmid. This region is composed of at least six essential

operons (virA, virB, virC, virD, virE, virG ) and two non-essential (virF, virH) (Iuchi,

1993). The activation of vir genes produces the generation of single-stranded (ss)

molecules representing the copy of the bottom T-DNA strand. Any DNA placed between

T-DNA borders will be transferred to the plant cell as single strand DNA and integrated

into the plant genome. These are the only cis acting elements of the T-DNA transfer

system. The proteins VirD1 and VirD2 play a key role in this step, recognizing the T-

DNA border sequences and nicking (endonuclease activity) the bottom strand at each

border (Zupan and Zambryski, 1995; Christie, 1997).

Inside the plant cell, the ssT-DNA complex is targeted to the nucleus crossing the

nuclear membrane. Among the vir proteins, two have been found to be important in this

step VirD2 and VirE2 (the most important); and a third, VirF, that probably has a minor

contribution to this process (Hooykaas and Shilperoort, 1992). The final step of T-DNA









transfer is its integration into the plant genome. The mechanism involved in the T-DNA

integration has not been completely characterized. It is considered that the integration

occurs by illegitimate recombination (Lehman et al., 1994; Puchta, 1998).

To use the Agrobacterium-mediated system, the optimization of Agrobacterium

tumefaciens-plant interaction is probably the most important feature to be considered.

This interaction could include the wholeness of the bacterial strain, its correct

manipulation, and the study of reaction in wounded plant tissue, which may develop in a

necrotic process in the wounded tissue or affect the interaction and release of inducers or

repressors of the Agrobacterium virulence system. The type of explant is also an

important fact and it must be suitable for regeneration allowing the recovery of whole

transgenic plants. The establishment of a method for the efficient regeneration of one

particular species is all-important for its transformation.

The Agrobacterium system is attractive because of the ease of the protocol coupled

with minimal equipment costs. Moreover, transgenic plants obtained by this method often

contain single copy insertions (Hansen and Wright, 1999). At present, many species both

monocotyledonous and dicotyledonous have been transformed using Agrobacterium-

mediated transformation system. In citrus, many researchers reported using the system to

transfer different genes into different citrus cultivars. Pefia et al. (1995b) used

A. tumefaciens EHA105 carrying the binary vector p35SGUSINT that encodes

P-glucuronidase (GUS) gene as a reporter and the neomycin phosphotransferase II (NPT

II) gene for resistance to kanamycin as a selectable marker to transform Carrizo citrange

stem segments. Embryogenic calluses of 'Ponkan' mandarin has been transformed with a

ribonuclease gene using the Agrobacteriun-mediated system (Li et al., 2002). Many









transgenic citrus plants have been obtained by Agrobacterium tumefaciens-mediated

transformation system, among them grapefruit (Luth and Moore, 1999), Swingle

citrumelo (Citrus paradise Macf X Poncirus trifoliate L. Raf.) (Molinari et al., 2004),

'Washington' navel orange (Bond and Roose, 1998), sour orange (Citrus aurantium L.)

(Gutierrez et al., 1997), sweet orange (Pefia et al., 1995a), lime (Citrus aurantifolia

Swing.) (Pefia et al., 1997), and 'Hamlin' orange (Mendes et al., 2002; Yu et al., 2002;

Boscario et al., 2003). Carrizo citrange has been transformed via Agrobacterium-

mediated with the halo-tolerance gene HAL2, originally isolated from yeast and

implicated in salt tolerance mechanisms (Cervera et al., 2000). Thus, Agrobacterium-

mediated transformation has been established for many citrus cultivars by using either

embryogenic cell suspension cultures or stem explants.

Although Agrobacterium-mediated transformation has been a reliable and efficient

system for transforming many dicotyledonous species, citrus seems to be less amenable

to Agrobacterium-mediated gene transfer. Moore et al. (1992) suggested that the limiting

step in the production of transgenic citrus shoots was the low DNA transfer efficiency;

only 4 to 8% of the inoculated explants contained GUS-positive sectors. By comparison,

a much higher transfer efficiency has been achieved with fruit crops, including apple 80%

(Yao et al., 1995) and kiwifruit 66% (Janssen and Gardner, 1993). So, it may be useful to

explore other DNA transfer systems for certain citrus cultivars.

Biolistics or Microprojectile Bombardment

The ability to deliver foreign DNA directly into regenerable cells, tissues, or organs

was one of the best methods to achieve truly genotype-independent transformation in

many agronomic crops, bypassing Agrobacterium host-specificity and tissue

culture-related regeneration difficulties. Microprojectile bombardment employs









high-velocity metal particles (tungsten or gold) to deliver biologically active DNA into

plant cells (Sanford, 1988). Klein et al. (1987) observed that tungsten particles could be

used to introduce macromolecules into epidermal cells of onion with subsequent transient

expression of enzymes encoded by these compounds. Christou et al. (1988) demonstrated

that this process could be used to deliver biologically active DNA into living cells and

produce stable transformants. Moreover, bombardments can even be performed using

desiccated bacteria (as microproj ectiles) containing the gene to be transferred

(Rasmunssen et al., 1994). Combining the relative ease of DNA introduction into plant

cells with an efficient regeneration protocol not requiring protoplast or suspension

cultures, particle bombardment is the optimum system for transformation in many cereals

(in which protoplast culture is difficult), as well as dicots which can be recalcitrant to

Agrobacterium infection. Gray and Finer (1993) described several advantages for particle

bombardment over Agrobacterium-mediated transformation: (1) non-hosts of

Agrobacterium, such as monocots, can be transformed, (2) plasmid construction does not

require insertion of the sequences essential for DNA replication and transfer in

Agrobacterium, (3) the introduction of multiple plasmids, Co-transformation, is possible

with particle bombardment, (4) false positives resulting from growth of the

Agrobacterium in host cells are eliminated, and (5) the transformation protocols are easy

by eliminating the complex bacteria-plant interaction present with the Agrobacterium

system. On the negative side, plants regenerated from bombarded plant tissues are usually

chimeric in terms of introduced foreign genes due to random bombardment of a small

number of cells in a multiple cell system (Sanford, 1990). Researchers have overcome









this problem by using different selectable marker genes to sort out transformants that are

stabilized in their progenies (Lowe et al., 1995).

Particle bombardment has made it possible to transfer foreign DNA into organelles.

Watsona et al. (2004)) reported on the introduction and transient expression of foreign

genes in suspension cell-derived chloroplasts of tobacco. Chloroplast transformation

systems offer unique advantages in biotechnology, including a high level of foreign gene

expression, maternal inheritance, and polycistronic expression (Kang et al., 2004).

In citrus, particle bombardment has been used to transform tangelo (Citrus

reticulata x Citrusparadisa) embrogenic cells. Although fifteen transgenic embryo lines

were reported, no transgenic plants were obtained (Yao et al., 1996). The bombardment

of epicotyl thin explants has been used by Filho et al. (2003) for stable transformation of

Carrizo citrange and sweet orange.

Protoplast Transformation

Protoplasts are cells (plant, fungal, or bacterial) that have had their cell walls

removed. This can be done either by a mechanical or an enzymatic process. The "naked"

cells are surrounded only by a cell membrane and can be used in a variety of ways. This

results in the production of a suspension containing millions of individual cells and

therefore offers the advantage of probable single cell targets. Protoplasts are frequently

obtained from an established suspension cell line of callus initiated from immature

embryos, immature inflorescences, mesocotyls, immature leaf bases and anthers

(Maheshwari et al., 1995). Protoplasts can either be transformed by Agrobacterium or by

direct DNA uptake methods, facilitated by polyethylene glycol treatment, electroporation

or liposomes (Shillito, 1999). DNA uptake into protoplasts is now a routine and

universally accepted procedure in plant biotechnology for introducing and evaluating









both short-term (transient) and long-term (stable) expression of genes in cells and

regenerated plants (Davey et al., 2005b). Moreover, direct DNA uptake into plant cells

has been especially important in transforming plants that are not amenable to other

methods of gene delivery, particularly, Agrobacterium-mediated transformation

(Rakoczy-Trojanowska, 2002). Protoplasts are ideal candidate cells for direct DNA

uptake and the subsequent selection of transgenic events. DNA could be delivered into

protoplast cells by either chemical (Polyethylene glycol (PEG)-mediated) or

electroporation. Protoplasts have been transformed with Ti plasmid from Agrobacterium

tumefaciens, and genes carried on a simple E. coli-based cloning vector which confirmed

that Ti-DNA borders were not important for DNA integration into the plant genome

(Davey et al., 1989). Songstad et al. (1995) reported that the efficiency for recovery of

transgenic events is higher because cross feeding and chimerism between transgenic and

wild-type cells are minimized in comparison to transformation systems based on

multicellular tissues. However, Davey et al. (2005a) stated that protoplast transformation

frequencies remain low (one in 104 protoplast giving stably transformed tissues), and

protoplast-to-plant systems with efficient selection need to be improved to recover

transformed cells and tissues. Protoplasts can be co-transformed with more than one gene

carried on the same or separate plasmids. There are many factors that influence

protoplasts transformation, with the stage of the cell cycle probably being the most

important factor. Some treatments could enhance transformation frequency, such as heat

shock treatment and irradiation of recipient protoplasts, probably by increasing the

recombination of genomic DNA with incoming foreign DNA, or the initiation of repair

mechanisms that favor integration. Carrier DNA and the nature of the plant genome also









affect transformation (Davey et al., 2000). DNA fragment size can influence stable

transformation frequencies (Fleming et al., 1995). Since plants regenerated from

protoplast come from a single cell, all cells in the transgenic plant are expected to contain

inserted gene(s) of interest.

There are many studies utilizing protoplast procedures for efficient delivery of

plasmids into suspension culture-derived protoplasts and optimization of protoplast-to-

plant systems. Many such studies focused on cereals, particularly rice (Davey et al.,

2005a). Polyethylene glycol (PEG) has been used to induce DNA uptake into protoplasts

isolated from tobacco (Nicotiana tabacum) (Uchimiya et al., 1986; Jarl and Rietveld,

1996), Arabidopsis thaliana (Damm et al., 1989), Datura inoxia (Schmidt-Rogge et al.,

1993), wheat (Triticum aestivum L.) (Marsan et al., 1993), rice (Alam et al., 1995; Chair

et al., 1996), barley (Nobre et al., 2000), sugarbeet (Dovzhenko and Koop, 2003), apple

(Maddumage et al., 2002), sweet potato (Garcia et al., 1998; Winfield et al., 2001), and

citrus (Vardi et al., 1990; Fleming et al., 2000; Guo et al., 2005). The direct-gene-

mediated method results in more multiple and rearranged copy number of the transgene

in transgenic plants than does Agrobacterium (Dong et al., 1996; Krasnyanski et al.,

1999) DNA can be delivered into protoplasts isolated from different plant species using

several different techniques (Table 2-1).

As nucleases may block DNA uptake into isolated protoplasts, experiments have

been undertaken to reduce DNA damage during transformation. Folling et al. (1998)

studied PEG-mediated DNA transfer into protoplasts of Lolium perenne and reported that

plasmids were protected by a combination of high pH (9.0) and reduced temperature

(0 oC), since such conditions suppressed DNA nicking and improved transformation









efficiency. The same authors showed that two nucleases usually associated with isolated

protoplasts were involved with DNA degradation, with one being released into the

medium and the other localized to the plasma membrane.

Electroporation is used to produce stable genetic transformants using protoplasts as

target cells (Table 2-1). Electroporation conditions were optimized for transfection of

protoplasts isolated from an embryogenic line of 'Hamlin' orange (Citrus sinensis (L.)

Osbeck) and to obtain stable transgenic plants (Niedz et al., 2003).

There are several advantages from using transformation technology as a tool to

generate new cultivars. First, transgenic lines expressing variable levels of resistance can

be selected. For example, some Xa21 transgenic rice lines have shown increased

resistance to Xanthomonas oryzae pv. oryzae (Xoo) as compared with the donor line

(Song et al., 1995). Second, transformation techniques can be used to improve valuable

cultivars currently containing some quantitative or qualitative resistance to disease

leading to increased durability (Wang et al., 1994). Third, transformation results in the

modification of a few well-defined genetic elements, whereas sexual recombination

might lead to the introgression of undesirable genes involved in the production of

allergens or toxins, if these genes are linked to the traits of interest (Breiteneder and

Radauer, 2004). Finally, intervarietal, interspecific, or intergeneric gene transfer would

bypass sterility problems common to interspecific hybridization (Ronald, 1997).

Plant Resistance (R) Proteins

More than 30 resistance genes have been cloned from both monocotyledonous and

dicotyledonous plants (Nurberger and Scheel, 2001). The majority of resistance (R)

proteins that are activated upon effector recognition are classified into five different

classes based primarily upon their combination of a limited number of structural motifs









(Table 2-2) (Martin et al., 2003). Class 1 consists of just one member, Pto from tomato,

which has a serine/threonine kinase catalytic region and a myristylation motif at its N

terminus. Class 2 contains a large number of proteins having a region of leucine rich

repeats (LRRs), a putative nucleotide binding site (NBS), and an N-terminal putative

leucine-zipper (LZ) or other coiled-coil (CC) sequence. Class 3 is similar to class 2, but

instead of the CC sequence, these proteins have a region with similarity to the N terminus

of the Toll and Interleukin 1 receptor (IL-1R) proteins (therefore referred to as the TIR

region). The R proteins belonging to the first three classes lack transmembrane (TM)

domains and all are thought to be localized intracellularly. The Cf proteins from tomato

form class 4. They lack an NBS and instead have a TM and an extracellular LRR, and a

small putatively cytoplasmic tail without obvious motifs. Finally, class 5 consists of just

the Xa21 protein from rice that in addition to an extracellular LRR and a TM, has a

cytoplasmic serine/threonine kinase region. The Xa21 is the only known resistance gene

that encodes three structural features found in various combinations in other resistance

gene products (Century et al., 1999). Thus, R proteins in the five major classes rely on a

limited number of structural and functional domains, of which the LRR appears to play a

central role. A few R proteins do not fit into these five classes and form class 6 (Table

2-2). Figure (2-1) shows schematic representation of different genetically defined plant

resistance proteins. The structural similarity of different R genes could suggest a common

or limited number of resistance pathways in plants. Resistance genes from monocots and

dicots are highly conserved, suggesting that they share common functional domains

(Song et al., 1995). This suggests the possibility of using monocot R genes to control

dicot diseases.










Table 2-1. Examples of plant protoplast transformation experiments and success of
transgenic plant recovery.


Plant


Tobacco
Tobacco (NiLcotiana
tabacum)
Tomato (Lycopersicon
esculentum)
Rassica campestris

Arabidopsis thaliana
Solanum-dulcamara

Tobacco
Citrus

Tobacco (N. tabacum, N.
debneyi and N. rustica)
Sugarcane
Pea

Datura inoxia

Maize (Zea mays L.)
Wheat (Triticum aestivum
L.)
Citrus

Wheat (Triticum aestivum
L.)
Citrus
Indica rice
Tobacco (Nicotianu
tabacum)
Rice (Oryza sativa L.)
Creeping bentgrass (Agrostis
palustris Huds.)
Linum usitatissimum and L.
suffruticosum
Peucedanum terebinthaceum
Barley
Barley
Barley (Hordeum vulgare
L.)
Apple (Malus domestic
Borkh.)


Transformation
Method
Liposome-mediated
PEGa

Calcium phosphate/
PEGa or PVAb
Agrobacterium

PEGa
Electroporation/
Agrobacterium
Liposomes
PEGa

Agrobacterium
tumefaciens
Electroporation
Electroporation

PEGa

Electroporation
PEGa

Electroporation

Electroporation

Electroporation
PEGa
PEG /
Electroporation
PEGa
PEG

PEG /
Agrobacterium
PEGa
PEGa
Microinjection
PEGa

PEGa


Transgenic
plant obtained
Yes
Yes


Yes

Yes
No

Yes

Yes
Yes

No

Yes

No
Yes
Yes


Yes

Yes
Yes
Yes
No

No


References


(Chair et al., 1996)
(Lee et al., 1996)

(Ling and Binding,
1997)
(Wang et al., 1999)
(Nobre et al., 2000)
(Holm et al., 2000)
(Tiwari et al., 2001)

(Maddumage et al.,
2002)


(Deshayes et al., 1985)
(Uchimiya et al., 1986)

(Jongsma et al., 1987)

(Ohlsson and Eriksson,
1988)
(Damm et al., 1989)
(Chand et al., 1989)

(Zhu et al., 1990)
(Vardi et al., 1990;
Fleming et al., 2000)
(Dijak et al., 1991)

(Rathus and Birch, 1992)
(Puonti Kaerlas et al.,
1992)
(Schmidt-Rogge et al.,
1993)
(Sukhapinda et al., 1993)
(Marsan et al., 1993)

(Hidaka and Omura,
1993)
(He et al., 1994)

(Niedz et al., 1995)
(Alam et al., 1995)
(Jarl and Rietveld, 1996)









Table 2-1. Continued
Plant Transformation Transgenic References
Method plant obtained
Festuca arundinacea PEGa Yes (Bettany et al., 2002)
Cauliflower (Brassica PEGa Yes (Radchuk et al., 2002)
oleracea var. botrytis)
Citrus Electroporation Yes (Niedz et al., 2003)
Brassica napus Agrobacterium Yes (Wang et al., 2005)
Citrus PEGa Yes (Guo et al., 2005)
a PEG = Poly-Ethylene Glycol
b PVA = Poly-Vinyl Alcohol

Among the cloned plant resistance genes, only three have shown a physical

interaction between a resistance protein and the corresponding avirulence (Avr) gene

product, Pto in tomato (Tang et al., 1996), Pi-ta in rice (Jia et al., 2000), and RRS1 in

Arabidopsis (Deslandes et al., 2003).

Mode of Action of the Xa21

The Xa21 gene is a member of a multigene family containing seven members,

grouped into two classes based on sequence similarity (Song et al., 1997). The Xa21 class

contains members Xa21, D and F; and class A2 contains Al, A2, C and E. The identity of

nucleotide sequence within each class is very high (98% for Xa21 class and 95.2% for A2

class), but only 63.5% of the identity was observed between the two classes (Song et al.,

1997). The Xa21 gene is located on rice chromosome 11 (Ronald et al., 1992; Song et al.,

1995). The Xa21 confers resistance to over 30 distinct strains of the bacterium

Xanthomonas oryzae pv. oryzae (Xoo), which causes leaf blight in rice (Wang et al.,

1996; Hammond-Kosack and Jones, 1997). The Xa21 encodes a 1025-amino acid protein

that revealed a novel class of plant disease resistance gene products with several regions

exhibiting similarity to known protein domains (Table 1-2 and Figure 2-1). The amino

terminus of the Xa21 protein encodes 23 hydrophobic residues characteristic of a signal









peptide. The central core of the Xa21 contains 23 imperfect copies of a 24 amino acid

(extracytoplasmic LRRs) with numerous potential gycosylation sites. The LRRs are

followed by a 26 amino acid hydrophobic stretch that likely forms a membrane spanning

helix tamsmembrane domain (TM). The carboxyl terminal sequence encodes a putative

interacellular serine/threonine kinase (STK) domain. This region carries the 11

subdomains and all 15 invariant amino acid diagnostic of protein kinases (Song et al.,

1995). Thus, compared with the proteins encoded by other cloned plant disease-resistance

genes, the structure of Xa21 protein is unique because it contains the extracellular

receptor LRR domain and the intracellular kinase domain.

Based on models of mammalian receptor kinases (RKs), (Ronald, 1997; Wang et

al., 1998) proposed a model for Xa21-mediated resistance as follows: first the LRR

domain binds a polypeptide produced by the pathogen or plant cell. This specific binding

would cause receptor dimerization, activation of the intracellular kinase domain, and

subsequent phosphorylation on specific serine or threonine residues. Liu et al. (2002)

demonstrated that the intracellular domain encoded by the rice disease resistance gene

Xa21 is an active serine/threonine kinase capable of autophosphorylation. The same

authors suggested that Xa21 can initiate multiple defense responses by the binding of

distinct signaling proteins with specific phosphorylated residues onto Xa2] kinase.

Phosphorylated residues may then serve as binding sites for proteins that can initiate

downstream responses. This reaction may lead to phosphorylation of transcription

factors. Upon phosphorylation, the transcription factors can move into the nucleus from

the cytosol.










O LRR repeat
Kinase domain
I Coiled Coil domain
STM


RPS2, RPM1,
RPS5, RPP8,
HRT, Dm3, Mi,
MIa, Rpl, Bs2,
Xal, Rx, Gpa2,
Pto PRF


* NBS domain
, TIR domain
M WRKY domain


N, L,
M,
RPP5,
RPP1,
RPP2,
RPS4,
Bs4 RRS1 RPW8


Figure 2-1. Schematic representation of different genetically defined plant resistance
proteins. Protein structures named above are examples of R proteins in their
respective class. Proteins are shown in relation to the plant plasma membrane.
LRR, leucine-rich repeat; Kinase domain, serine/threonine kinase catalytic
core; NBS, nucleotide bibdibg site; TM, transmembrane domain; TIR,
Toll/Interleuken 1-receptor-like; WRKY, W-box DNA binding domain
(Nimchuk et al., 2003)


Cf-2, 4, 5, 9


Xa21










Table 2-2. Plant disease resistance (R) proteins and their predicted structure (Hulbert et
al., 2001; Martin et al., 2003)
Class/*R Predicted protein
Class/*R Predicted protein Plant Pathogen(s) or Pest(s) Effector(s)
Protein structure
1 Pto Protein Kinase Tomato Pseudomonas syringae (B) AvrPto,


2 Bs2
Dm3
Gpa2
Hero

HRT
12
Mi
Mi
Mla
Pib
Pi-ta
RI
R1
Rpl]
RPM1
RPP8
RPP13
RPS2
RPS5
Rxl
Rx2
Sw-5
Xal
3 L
M
N
P
RPPI
RPP4
RPP5
RPS4
4 Cf-2
Cf-4
Cf-5
Cf-9
5 Xa21
6 Hml
HS1
mlo
Rpgl
RPW8


NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR

NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
TIR-NBS-LRR
LRR-TM
LRR-TM
LRR-TM
LRR-TM
LRR-TM-Kinase
Toxin reductase
Unique
Membrane prot.

Unique


Pepper
Lettuce
Potato
Potato

Arabidopsis
Tomato
Tomato
Tomato
Barley
Rice
Rice
Potato
Maize
Arabidopsis
Arabidopsis
Arabidopsis
Arabidopsis
Arabidopsis
Potato
Potato
Tomato
Rice
Flax
Flax
Tobacco
Flax
Arabidopsis
Arabidopsis
Arabidopsis
Arabidopsis
Tomato
Tomato
Tomato
Tomato
Rice
Maize
Beet
Barley
Barley
Arabidopsis


AvrPtoB
AvrBs2


Xanthomonas campestris (B)
Bremia lactucae (F)
Globodera pallida (N)
G. rostochiensis, G. pallida
(N)
Turnip Crinkle Virus
Fusarium oxysporum (F)
Meloidogyne incognita (N)
Macrosiphum euphorbiae (I)
Blumeria graminis (F)
- A ,g ti '"" 1 h. grisea (F)
M grisea (F)
Phytophthora infestans (0)
Puccinia sorghi (F)
P. syringae (B)
Peronospora parasitica (0)
P. parasitica (0)
P. syringae (B)
P. syringae (B)
Potato Virus X
Potato Virus X
Tomato Spotted Wilt Virus
X oryzae (B)
Melampsora lini (F)
M lini (F)
Tobacco Mosaic Virus
M lini (F)
P. parasitica (0)
P. parasitica (0)
P. parasitica (0)
P. syringae (B)
Cladosporium fulvum (F)
C. fulvum (F)
C. fulvum (F)
C. fulvum (F)
Xanthomonas oryzae (B)
Cochliobolus carbonum (F)
Heterodera schachtii (N)
B. graminis (F)
Puccinia graminis (F)
Erisyphe chicoracearum (F)


Coat Protein





AVR-Pita


AvrRpml


AvrRpt2
AvrPphB
Coat Protein
Coat Protein




Helicase




AvrRps4
Avr2
Avr4

Avr9









Table 2-2. Continued
Class/*R Predicted
Class/R Predicted Plant Pathogen(s) or Pest(s) Effector(s)
Protein protein structure
RRS1- Arabidopsis Ralstonia solanacearum (B)
R
RTM1 Arabidopsis Tobacco Etch Virus
RTM2 Arabidopsis Tobacco Etch Virus
Vel, Tomato Verticillium alboatrum (F)
Ve2
* R protein = Resistance protein
Abbreviated as: B, bacterium; F, fungus; I, insect; N, nematode, 0, oomycete.
NBS, nucleotide binding site; LRR, leucine-rich repeat; TIR, domain with homology to the Toll
gene of Drosophila and the Interleukin-1 receptor of mammals; TM, transmembrane domain.
Domains are listed as they appear in the proteins from N to C terminal end (Hulbert et al., 2001)

The avrXa21-derived ligand might have a novel molecular identity, because

Xanthomonas oryzae pv. oryzae is predominantly a xylem vessel colonizing bacterium.

Conceivably, it is delivered extracellularly, unlike other bacterial avr products, in which

case the Xa21 LRRs might be involved in the recognition (Hammond-Kosack and Jones,

1997). The LRR is involved in protein-protein interactions. Xa21D is a Xa21 family

member that lacks the transmembrane and kinase domains, but encodes a receptor-like

protein carrying LRR motifs in the presumed extracellular domain (Wang et al., 1998). In

transgenic rice plants, Xa21D conferred partial resistance to Xoo at an intermediate level

compared with that of Xa21 but showed the same spectrum of resistance as Xa21.

However, other members (Al, A2, C, E, F) did not confer any resistance in transgenic

plants (Wang et al., 1998). These results suggest that the extracellular LRR domain of

Xa21D is involved in pathogen recognition.

It was observed that several defense responses were initiated in transgenic rice cells

expressing a fusion gene composed of the extracellular LRR and transmembrane domains

of the Arabidopsis receptor kinase BRI1 and the serine/threonine kinase of Xa21 upon

treatment with brassinosteroids, which is the ligand for the BRIJ-encoded protein kinase









(He et al., 2000). These results indicated that the extracellular LRR domain of the Xa21

protein functions in recognition of the Xoo avr proteins and its interacelluar

serine/threonine kinase domain transmits the signal to activate the defense mechanism.

The cloning of two plant resistance genes encoding serine threonine kinase

supports a central role for protein phosphorylation in gene-for-gene mediated disease

resistance (Martin et al., 1993; Song et al., 1995). The serine/threonine kinase capacity

possessed by Pto and Xa21 could clearly facilitate downstream signaling by a distinct

mechansim. A lysine residue is conserved in all protein kinases and is important for

phosphor-transfer for both Pto and Xa21 (Andaya and Ronald, 2003). The kinase domain

of the rice Xa21 gene product is the most homologous to that of the Arabidopsis protein

RLK5. When RLK5 was used in an interaction cloning system, a type 2C phosphatase was

identified (Stone et al., 1994). Moreover, for many gene-mediated resistances, the

addition of either kinase or phosphatase inhibitors significantly blocked the induction of

rapid defense responses (Levine et al., 1994; Dunigan and Madlener, 1995). It appears

likely that both kinases and phosphatases are involved in downstream R protein-mediated

signaling events.

The kinase domain of Xa21 is functional serine/threonine kinase (STKs) (Liu et al.,

2002). The same authors confirmed the serine/threonine specificity of Xa2 kinase by

phosphoamino acid assays. In these assays, serine and threonine residues were

phosphorylated, whereas no detectable tyrosine residues were marked. Also, they showed

that the autophophorylated Xa21 kinase can be dephosphorylated by the serine/threonine

phosphatase PP1. These results indicated that Xa2] kinase carries serine/threonine

specificity. By phosphopeptide mapping approaches, Liu et al. (2002) demonstrated that









at least 20 of 27 phosphospots on the GST-Xa21K (Glutathions S-transferase-Xa21K)

peptide map were because of autophosphorylation ofXa21 kinase. These observations

strongly suggest that multiple residues on Xa21 kinase were phosphorylated, which

suggest that Xa21 can initiate multiple defense responses by binding of different

signaling proteins with specific phosphorylated residues on Xa21 kinase (Liu et al.,

2002). The kinase activity of the Xa21 is very important for full resistance (Andaya and

Ronald, 2003).

Objectives

The major objective of this study was to develop citrus canker resistance in one of

the most commercially important citrus cultivars, 'Hamlin' sweet orange [Citrus sinensis

(L.) Osbeck], by introducing the cDNA of the Xa21 gene from rice that confers broad

spectrum resistance to Xanthomonas oryzae (rice bacterial blight) in rice.

The specific goals were to:

* Clone the cDNA of the Xa21 gene into citrus a transformation vector.

* Produce transgenic 'Hamlin' sweet orange plants with potential ACC resistance
genes from the Xa21 gene family via a protoplast transformation/GFP system.

* Characterize the transgenic plants for gene expression and stability of the transgene
in the citrus genome.

* Developed a real-time PCR based method to accelerate characterization of the
transgenic plants.

* Assay transgenic plants for resistance to Asiatic Citrus Canker.














CHAPTER 3
TRANSFER OF THE XA21 XANTHOMONAS RESISTANCE GENE FROM RICE
INTO 'HAMLIN' SWEET ORANGE [CITRUS SINENSIS (L.) OSBECK] USING A
PROTOPLAST/GFP CO-TRANSFORMATION SYSTEM

Introduction

Citrus is the most extensively grown fruit crop worldwide. Sweet orange (Citrus

sinensis L. Osbeck) is the most important citrus species. It accounts for approximately

60% of the world citrus production according to FAO (Anonymous, 2005). 'Hamlin'

sweet orange is one of the leading commercial cultivars in Florida because of its high

yield potential and early maturity. 'Hamlin' orange also has a high regeneration capacity

from protoplasts and is often used in transformation studies.

Sweet orange improvement via conventional breeding programs has been hampered

by large plant size, nucellar polyembryony, high levels of heterozygosity, and long

juvenility (Grosser and Gmitter, 1990). Most of the commercially cultivated sweet orange

cultivars have been developed either from chance seedling selection or from a mutation

in a particular seedling cultivar (Hodgson, 1968), rather than from organized breeding

programs. Nowadays, biotechnology tools, including tissue-culture based tools and

genetic engineering, are being used to improve sweet orange (Grosser et al., 1996a;

Grosser et al., 1996b).

Genetic engineering has opened new avenues to modify crops and provided new

solutions to solve specific problems (Estruch et al., 1997). Citrus genetic transformation

has become more attractive to biotechnology-based citrus improvement programs

because of the exciting possibility of adding a desirable trait to an already established









cultivar without altering its integrity (Bond and Roose, 1998). The powerful combination

of genetic engineering and conventional breeding programs permits introduction of useful

traits encoded by transgenes into commercial crops within an economically viable time

frame (Hansen and Wright, 1999). There is great potential for genetic engineering of

citrus to enhance productivity through increasing resistance to diseases and

environmental stress.

Since late 1980s, researchers started to report transgenic citrus (Kobayashi and

Uchimaya, 1989; Hidaka et al., 1990; Vardi et al., 1990; Moore et al., 1992; Hidaka and

Omura, 1993; Pefia et al., 1995a; Gutierrez et al., 1997; Pefia et al., 1997; Cervera et al.,

2000; Fleming et al., 2000; Mendes et al., 2002; Yu et al., 2002; Niedz et al., 2003; Guo

et al., 2005). Most of those researchers obtained transgenic citrus via an Agrobacterium-

mediated transformation system, with the selection of transgenic tissue based on

antibiotic resistance and the tissue-destructive GUS reporter-gene system. In the

beginning, the transformation efficiency was low, but over time it has been improved due

to continued-improvements in the Agrobacterium-mediated system (Pefia et al., 1995b;

Bond and Roose, 1998). More recently, researchers reported transgenic citrus without

antibiotic resistance genes and used Green Fluorescent Protein (GFP) as the reporter-

gene instead of GUS (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005).

Since many important citrus cultivars, including some sweet orange clones, are

commercially seedless (zero to five seeds per fruit) or totally seedless, it can be difficult

or impossible to obtain adequate nucellar seedling explants for Agrobacterium-mediated

transformation. The protoplast transformation could be a promising alternative (Fleming

et al., 2000). Protoplast techniques are well established in citrus (Grosser and Gmitter,









1990; Grosser et al., 2000), and progress has been made regarding the development of a

competitive transformation system. Citrus protoplast transformation, selection of

transformants via GFP and regeneration of transgenic plants via somatic embryogenesis

have recently been reported (Fleming et al., 2000; Niedz et al., 2003; Guo et al., 2005).

On the other hand, protoplast/GFP-based citrus-transformation system does not utilize

antibiotic resistance selection or Agrobacterium. Protoplast/GFP transformation system

utilizes non-destructive GFP selection, instead of destructive GUS selection and therefore

requires no antibiotics. Since these markers are currently not legally accepted for

marketing particularly in Europe (Stewart, 2001; Puchta, 2003; Schaart et al., 2004),

using the protoplast/GFP system may be an advantage over the Agrobacterium-mediated

transformation system.

Asiatic citrus canker (ACC) is one of the most economically damaging problems

affecting citrus production worldwide. ACC is caused by the bacterial pathogen

Xanthomonas axonopodis pv. citri (Xac). Canker pathogen can affect the majority of the

commercial citrus varieties and close relatives of citrus in the family Rutaceae grown in

moist, subtropical to tropical climates. All aboveground tissues of citrus are susceptible to

Xac when they are young, and the maximum susceptibility occurs during the last half of

expansion phase of growth (Gottwald and Graham, 1992). The pathogen causes

distinctive necrotic raised lesions on leaves, stems, and fruits. Severe infections can cause

defoliation, blemished fruit, premature fruit, twig dieback, and general tree decline.

Citrus canker is not systemic, it causes local lesions only (Schubert et al., 2001). There is

no highly effective method for citrus canker control. Moreover, chemical control is

expensive and could cause problems in the environment.









Citrus canker eradication programs (CCEP) are very expensive, and many times

unsuccessful (Brown, 2001). Nowadays, the state of Florida is spending millions of

dollars annually in an effort to eradicate citrus canker. There is no an accurate estimate

for how long and how much it will cost to eradicate citrus canker. Moreover, there is a

real possibility that the eradication program may fail or become too costly to both state

and federal government. Therefore, replacing susceptible varieties with field resistance

ones appears to be the best long-term solution. Although classical selection or breeding

for canker resistance is a promising solution (Viloria et al., 2004), it is a very long-term

solution. Genetic transformation could be a useful alternative, since the resistance gene

could be introduced into the susceptible varieties without otherwise altering cultivar

integrity.

The cloned Xa21 gene from rice has been shown to confer resistance to over 30

distinct strains of the bacterium Xanthomonas oryzae pv. oryzae (Xoo) isolated from

eight different countries, which causes leaf blight in rice (Wang et al., 1996; Hammond-

Kosack and Jones, 1997). The wild-type Xa21 gene contains an intron, and there is some

question as to whether dicot plants can process genes containing monocot introns (the

cDNA is intron free). Since the citrus canker pathogen is in the same genus, this gene

may have the potential to confer resistance against canker in citrus. The development of

canker resistant citrus has become an important research objective. A similar approach

was successful with tomato resistance genes to the bacterial pathogen Pseudomonas

syringae pv. tomato (Oldroyd and Staskawicz, 1998; Tang et al., 1999).

To achieve this objective, the protoplast isolated from a relatively new

embryogenic suspension culture line of 'Hamlin' sweet orange were co-transformed with









GFP for selection and the cDNA of the Xa21 gene. Transformed clones were screened

for GFP expression using blue light. Polymerase chain reaction (PCR) was performed to

identify the co-transformed clones. Transgenic plants were regenerated from co-

transformed clones via somatic embryogenesis and organogenesis. Transgenic plants

containing the cDNA of the Xa21 gene were assayed by southern blot analysis and

western blot analysis to determine if the gene is integrating into the citrus genome and

functioning to produce RNA and subsequently protein.

Materials and Methods

Plasmid Construction

The plasmid pARS108 with the GFP endoplasmic reticulum (ER)-targeting gene

was kindly provided by Dr. R. P. Niedz (USDA, Agriculture Research Service, US

Horticultural Research Laboratory, Ft. Pierce, FL, USA). Construction of pARS108 has

been described previously (Niedz et al., 2003). Plasmid pARS108 contains the Enhanced

Green Fluorescent Protein (EGFP) coding sequence (GenBank accession #U55761)

placed under the control of the double 35S cauliflower mosaic virus (3 5 S-3 5 S CaMV)

promoter with the alfalfa mosaic virus (AMV) untranslated leader sequence and the nos

terminator. An Arabidopsis signal sequence (SS) is included in the 5' end to target the

protein to the endoplasmic reticulum (ER), and the codon sequence of the HDEL amino

acid was included in the 3' end for retention of the protein in the lumen of the ER. The

SS-EGFP-HDEL sequence was cloned into pBI524 as a NcoI/BamHI cassette, placing it

under the control of the double 35S promoter with the AMV untranslated leader sequence

and the nos terminator (Figure 3-1).









The plasmid p524EGFP. 1 containing the EGFP reporter gene was constructed and

described by Fleming et al. (2000). This version of the GFP is targeted to the cytoplasm.

Plasmid p524EGFP. 1 contains the EGFP coding sequence (GenBank accession

#U55761) placed under the control of the double 35S CaMV promoter with the AMV

untranslated leader sequence and the SV40 poly A terminator. The fragment containing

the double 35S cauliflower mosaic virus (35-35S CaMV) promoter sequence followed by

the alfalfa mosaic virus (AMV) enhance sequence was cloned into the HindIIl/BamHI

site on the pEGFP. 1 from clontech (Palo Alto, CA, USA) (Figure 3-2).

Vector pCR504 was kindly provided by Dr. Pamela Ronald, University of

California-Davis (Figure 3-3). It contains a 3.1 kb BamHI fragment encoding the entire

cDNA of the Xa21 gene from rice. Plasmid pCR504 was a promoterless plasmid

containing the cDNA of the Xa21 gene. Methods used for plasmid construction were

similar to those described by Sambrook and Russell (2001), or according to the

manufacturer. To construct the plasmid used in the co-transformation experiment, the

fragment containing the cDNA of the Xa21 gene was excised from pCR504 as a BamHI

fragment and ligated into the BamHI site on the pBHU-SalI (provided by Dr. W. Y.

Song, Plant Pathology Department, University of Florida, Gainesville, FL, USA) (Figure

3-4). The re-ligated plasmid was designated pBHU-XacDNA. The NotIIHindlII fragment

from pBHU-XacDNA has been replaced by the NotI/Hindlll fragment from pLitmus28-F

(provided by Dr. W. Y. Song, Plant Pathology Department, University of Florida,

Ganisville, FL), which contains the c-myc tag sequence (mtag) in the 5' end. The

resulting plasmid is referred to as pBHU-XacDNA-mtag. The BamHI fragment from

pBHU-XacDNA-mtag was excised and ligated into BamHI site on pJIT vector to place








the cDNA-mtag under the control of the 35S cauliflower mosaic virus (35S CaMV)

promoter and CaMV poly-A. The final construction was designated pXa21-mtag and

used in co-transformation experiments (Figure 3-4).


H


\ aiif


HDEL B E

41 Wi


620 bp
620 bp


I AmpR


S800 bp



pARS108


Figure 3-1. Schematic diagram of pARS108 ER targeting. Restriction enzyme (H,
HindlII; N, Ncol; S, Sacl; B, BamHI; E, EcoRI). HDEL = Histidine, Aspartic
acid, Glutamic acid, and Leucine, respectively.


Bg X B
11


EGFPJ


p524EGFPI1


BrN

%


pEGFP.1 backbone


Figure 3-2. Schematic diagram of p524EGFP Cyt-targeting. Restriction enzyme (Bg,
BgllI; H, HindIII; X, XbaI; B, BamHI; Br, Brs GI; N, Notl).


44 bp


EGFP


250 bp


Eg H






K


anR


S-35scaATV AM


SV4D^obAI









pC822
I PCR(pfu)
ATG 822-0.4

0.4 K(b SacI
E -
m_-~ pCR-Script
(SK+)


SBamHI
Sac

BamHI Sacl


Sad


I
E -o

SK-

BamHI Hindlll

2.2 Kb
pCR503


pPKK
I PCR(pfu)


Hindlll

pC822

Sad
Hindlll


., ,:|;a ii ,;b '


0.9 Kb
pCR-Script
(SK+)


SHindll
KpnlI


Hindlll


Hindlll





E
SK-
8K-


BamHI 9 Hindlll

I


Figure 3-3. Schematic diagram of the construction of Xa21 cDNA clone pCR504.


Sop


E
oo O


Kpnl


IPKK-0.9


c









B
BS S HS


pBHU-1

Sall
B Self ligate
BS


pBHU-ISal

BamHI
B B

pBHU-ISal


(insert = 3.1 Kb)
pCR504


BamHI


B B

Xa21 cDNA


I


mTag
NJ H

pLitmus28-F

Notl
Hindlll

N mTag H
II I


BN<$xH B
B!i P B-- x 44
ULUrT !!!!!!l


-


pBH


\


U-Xac[


DNA


Hindlll
I Notl

BN H indlll B



pBHU-XacDNA




B B
pJIT (pUC based)


BN H B


mTag
pBHU-XacDNA-mtag


Figure 3-4. Schematic diagram of the construction of pXa21-mTag plasmid. Restriction
enzyme (B, BamHI; K, Kpnl; S, Sall; N, Notl).









Plasmid Multiplication

Transformation of E. coli

Before a large scale plasmid preparation can be performed, the plasmid must first

be transformed into competent E. coli cells. Max efficiency DH5aTM competent cells

were obtained from Invitrogen (Invitrogen Corporation, Carlsbad, CA, USA, Cat. No.

18258-012). The transformation procedure was followed exactly as described in the

product manual.

Quick miniprep plasmid preparation and confirmation of insert orientation

Plasmid DNA was extracted from several recovered bacterial colonies and

compared to the DNA from the known plasmid stock by restriction analysis using

agarose gel electrophorosis.

Using a sterile bacterial loop, single colonies were selected from the plated culture

and transferred to a bacterial culture tube containing 2 ml LB liquid media (10 g/L Bacto-

tryptone, 5 g/L yeast extract, and 10 g/L NaC1) and the appropriate antibiotic. The

bacteria were placed on the shaker at 225 RPM and left to grow overnight at 370 C. The

DNA was extracted from the overnight culture bacteria using QIAprep Spin Miniprep

kit (QIAGEN Inc., Valencia, CA, USA, Cat. No. 27104).

A restriction digest was then performed on the extracted DNA to test for the

presence of the cDNA of the Xa21 gene. Reaction volume of 20 ptl was performed with

(4 [tl DNA, 2 [tl 10X of the restriction enzyme buffer (Promega), 0.2 [tl of the restriction

enzyme (Promega), and 13.8 tl ddH20). The reaction mixture was incubated at 370 C for

at least 2 hours. The restriction enzyme was deactivated by heating the samples at 650 C

for 10 minutes. Indicator dye (4 pl of 6X loading buffer) was added and the gel was

loaded. The gel was run for 90 minutes at 100 Volts in TAE buffer (Tris-Acetate-EDTA).









The gel was removed and stained with 10 pl of ethidium bromide (10 mg/ml) in 100 ml

TAE buffer with gentle shaking for 15-20 minutes and observed and photographed on a

UV Transilluminator. Samples which contained the band corresponding to the band for

the cDNA of the Xa21 gene were saved to use for the large scale isolation.

Large scale isolation and plasmid preparation

To obtain a large amount of the DNA for the further use, two 1-liter flasks

containing 500 ml LB media plus the appropriate antibiotic were inoculated with the

transformed E. coli and the cultures were incubated overnight at 370 C on a shaker at

225 RPM. The DNA was extracted from the overnight cultured bacteria using a Wizard

PlusMaxiprep DNA Purification System from Promega (Promega Corporation, Madison,

WI, USA, Cat. No. A7270). To determine the concentration of plasmid DNA, an

absorbance reading at O.D.260 was obtained, (an absorbance reading of 1.0 corresponds to

50 pg of plasmid DNA per ml) (Sambrook and Russell, 2001).

Plant Material, Protoplast Transformation, and Culture

Establishment and maintenance of suspension cultures

The 'Hamlin' sweet orange (Citrus sinensis L. Osbeck) embryogenic callus line

was induced from unfertilized ovules taken from mature fruit and maintained on

Murashige and Tucker's (MT) basal medium (Murashige and Tucker, 1969). Suspension

cultures were initiated and maintained according to Grosser and Gmitter (1990) in

40-50 ml of H+H liquid media (see appendix A) in 125 ml erlenmeyer flasks covered

with aluminum foil and sealed with masking tape. Cultures were maintained on a shaker

at 125 RPM. Suspensions were subcultured every 2 weeks by splitting the contents

between two sterile flasks and adding 25 ml of fresh culture medium to each flask.

Suspension cells used for protoplast isolation were taken 4-10 days after subculture.









Transformation and culture of citrus protoplasts

The protoplast transformation protocol was modified from the PEG-mediated

protoplast fusion protocol developed by Grosser and Gmitter (1990) for citrus somatic

hybridization with slight modification. Suspension culture tissue was digested overnight

in the enzyme mixture (see appendix A), and the protoplasts were purified by

centrifugation on a sucrose-mannitol gradient. The protoplast pellet was resuspended in

3 ml 0.6 M BH3 protoplast culture medium (see appendix A; MT basal medium

containing 8-P multivitamins, organic acids, and sugar/alcohol additives (Kao and

Michayluk, 1975), at a concentration of 2 x 106 cells per ml, as described by Grosser and

Gmitter (1990). The plasmids DNA pXa21-mtag and pARS108 or p524EGFP. 1 were

added (25 pg DNA/100 pl protoplast suspension) and mixed well using a pasteur pipet.

Four drops of the resuspend mixture were pipeted to the center of each Petri dish (60 x

15 mm). Immediately, four drops of a 40% PEG solution were added (see appendix A) to

each Petri dish and incubated 25-30 minutes at room temperature. Following incubation

in PEG, four drops of 9:1 A:B elution solution as described by Grosser and Gmitter

(1990) (see appendix A) were added to each Petri dish. The A+B solution was mixed

immediately prior to use to avoid precipitation. After another incubation period of 25-30

minutes, approximately 20 drops of fresh BH3 medium were added around the periphery

of the protoplasts. Ten minutes later, the PEG, A+B solution, and the medium were

carefully removed with a Pasteur pipet, and immediately replaced with 30 drops of fresh

BH3 medium. After 10-15 minutes, the BH3 medium was removed and replaced with

another 30 drops of fresh BH3 medium. The last wash was repeated twice. Following the

final wash, the protoplasts were cultured directly in the same Petri dish by adding 15-20

drops of either fresh BH3, EME, (see appendix A) or a 1:1 (v:v) mixture of both. After









plating, Petri dishes were sealed efficiently with Nescofilm. Protoplasts were incubated in

sealable plastic boxes at 25-27o C under low light for 4-6 weeks in which transgenic

tissue could be recovered for the subsequent regeneration of transgenic plants.

Regeneration and selection of transformed protoplasts

The GFP expression was detected in the transgenic protoplasts illuminated with

blue light within 24 h after transformation using a Zeiss SV11 epifluorescence

stereomicroscope equipped with a 100 W mercury bulb light source and an FITC/GFP

filter set with a 480/30 nm excitation filter and a 515 nm longpass emission filter

(Chroma Technology Corp., Brattleboro, VT, USA). Continued expression of the GFP

protein was monitored occasionally for the next few weeks. Four weeks following

transformation, cultures were supplemented with fresh medium containing reduced

osmoticum. This was accomplished by adding 10-12 drops of a 1:2 (v:v) mixture of

0.6 M BH3 medium and 0.146 M EME medium (Grosser and Gmitter, 1990). After two

more weeks, another reduction in osmoticum was made by adding 10-12 drops of a 1:1:1

(v:v:v) of 0.6 M BH3 : 0.146 M EME : 0.6 M EME media. At this point, vigorous

colonies from each Petri dish were transferred to larger plates containing solid medium

by pouring over 100 x 20 mm2 Petri dishes containing agar-solidified EME with 0.146 M

maltose, substituted for sucrose to promote embryogenesis. Four weeks following plating

the culture on solid medium, transgenic calli and embryoids were identified based on the

blue-green fluorescence expression of the GFP protein and were physically separated in

vitro from non-transgenic tissues. Selected transgenic embryoids and calli were

transferred to new plates of solid EME-maltose overlayed with a thin layer of fresh liquid

0.146 M maltose EME medium to promote continued embryo initiation and development.

Regenerated transgenic small embryoids were then cultured on 0.22 tm cellulose acetate









membrane filters, which were played on fresh 1500 medium (MT basal medium

containing 1.5 g/L malt extract) (see appendix A), to normalize and enlarge the

embryoids (Niedz et al., 2002). The cultures were put on fresh 1500 medium for 4 weeks

and then transferred onto B+ medium [MT basal medium containing 3.0 mM gibberellic

acid and 0.11 mM naphthaleneacetic acid (NAA)] ( see appendix A) to encourage

embryo conversion (Grosser and Gmitter, 1990). Enlarged transgenic embryos were

cultured on DBA3 medium [MT basal medium containing 13.3 mM 6-benzyl-

aminopurine and 0.045 mM 2,4-dichlorophenoxy-acetic acid (2,4-D)] for adventitious

shoot induction (Deng et al., 1992). Transgenic shoots obtained were transferred to

RMAN rooting medium (half-strength MT basal medium containing 0.11 mM NAA and

0.5 g/L activated charcoal) (see appendix A) for root induction (Grosser and Gmitter,

1990). Transgenic shoot tips were also micrografted onto Carrizo citrange or sour orange

nucellar seedlings according to Navarro (1992) to expedite transgenic plant recovery.

Comparison of different GFP-containing constructs at the whole plant level

Mature leaves from transgenic plants obtained from p524EGFP. 1 and pARS 108

were scanned using a confocal laser scanner (Leica TCS SL, Exton, PA, USA) with

settings for three different fluorescent wavelengths, green, red and blue, at the same time

with a 488, 543, and 633 nm excitation filter and a 500-543, 610-630, and 675-750

tunable spectral window, respectively.

Molecular Analysis of Transgenic Tissue

Presence of the GFP gene and the cDNA of the Xa21 gene in the selected tissue

were confirmed by PCR amplification of the transgenes. The copy number and

integration pattern of the transgenes were determined by Southern blot analysis. The

expression of the cDNA of the Xa21 gene was determined by western blot analysis.









Polymerase chain reaction (PCR) for detection of transformants

The PCR was used initially to screen regenerated 'Hamlin' sweet orange plants

obtained via co-transformation. Genomic DNA was extracted from about 100 mg of

young leaf tissue of putative transgenic citrus plants using a GenEluteTM Plant Genomic

DNA Miniprep kit (Sigma, Inc. St. Louis, MO, USA, Cat. No. G2N350). To confirm the

presence of the GFP gene and the cDNA of the Xa21 gene, multiple PCR experiments

were performed using two different pairs of primers for GFP and the cDNA at the same

time. Primers for PCR amplification matching the coding sequence within the GFP gene

were 108F, 5'-GAATTCGTGAGCAAGGGCGA-3' and 108R, 5'-

GGATCCTTAGAGTTCGTCGTG-3'. Primers for PCR amplification matching the

coding sequence within the cDNA of the Xa21 gene were XaL, 5'-

AATCCCTAACACGCTTGGTG-3' and XaR, 5'-CACACACTGGAAACAATCCG-3'.

All primers were synthesized by Qiagen Operon (Alameda, CA, USA). The PCR was

performed in 25 [tl reaction volume containing 12.5 pl of 2X GoTaq Green Master Mix

(Promega, Cat. No. M7123), 1.5 pl of 5 M each primer, 2.5 pl genomic DNA (stock

100 ng/dl) and 4 [l Nuclease-Free Water (Promega). The PCR amplification program

was 1) 95 C/2 minutes, 2) 95 C/30 seconds, 3) 590 C/30 seconds, 4) 72 C/1 minute, 5)

30 cycle from 2-4, and 6) 72 C/10 minutes(see appendix B). The amplified DNA

products were electrophoretically separated in 1% agarose gel that contained TAE buffer

(Tris-Acetate-EDTA) and 1 [l/100 ml ethidium bromide (10 [g/ml).

Southern blot analysis

Southern blot analyses were performed to confirm stable integration of the cDNA

of the Xa21 gene in the transgenic plants and to determine the number of integrated









copies of the gene in transgenic clones. Prior to the isolation of the genomic DNA, all

labware was sterilized by autoclaving for one hour at 15 psi and dried in an oven. All

buffers and solutions were sterilized by autoclaving. Gloves were used to handle all

glassware during isolation.

Genomic DNA was extracted from the leaves of transgenic and non-transgenic

plants using the modified CTAB method as described by Dr. T. E. Mirkov (personal

communication). Twenty [ig of DNA was digested with SphI and ApaLI restriction

enzymes. Standard protocols for gel electrophoresis, denaturation, and neutralization of

the gel were performed as described by Sambrook and Russell (2001). After

electrophoresis, gels were treated with 0.25 M HC1 for 10 minutes, and then washed with

0.4 M NaOH for 10 minutes. DNA was transferred to positively charged nylon

membranes (ImmobilonTM-Ny+; Millipore Corporation, Billerica, MA, USA) by

capillary transfer using 20X SSC buffer overnight according to Sambrook and Russell

(2001). Probe DNA for the cDNA of the Xa21 gene was prepared from the Xhol

fragment, 1.49-kb, of the pXa21-mtag plasmid. Probe was labeled with digoxigenin-

dUTP using a random primer labeling kit (DIG High Prime DNA Labeling and Detection

Starter Kit II, Roche Applied Science, Cat No. 11 585 614 910). The probe labeling was

performed according to manufacturer's manual. Fixation of the DNA to the membrane,

prehybridizaton, hybridization, and immunological detection were performed as

described in the instruction manual of DIG High Prime DNA Labeling and Detection

Starter Kit II.

Western blot analysis

To carry out western blot analysis, total protein was extracted from transgenic and

non-transgenic citrus leaves. About 0.3 g leaf tissue from transgenic and non-transgenic









'Hamlin' sweet orange plants was collected and ground in liquid nitrogen. To isolate the

soluble fractions, the ground tissue was thawed in extraction buffer [50 mM Tris-HC1, pH

6.5; 1 mM EDTA; 150 mM NaCl; 0.1% Triton X-100]. Prior to use of the extraction

buffer immediately, the following protease inhibitors were added: 2 [g/ml Antipain;

2 [g/ml Leupeptin; 2 [g/ml Aprotinin; 1 mM of 4-[2-aminoethyl]-benzenesulfonyl

fluoride (AEBSF) Sigma; and 5% of 2- mercaptoethanol. Samples were incubated at 40 C

for 30 minutes with shaking and then centrifuged at 10,000 RPM for 10 minutes at 40 C.

The supernatant was recentrifuged at 13,000 RPM for 10 minutes at 40 C. The

supernatant was either immediately subjected to protein blot analyses or stored at -80o C

after determining the concentration of the protein by the method of Bradford (Bradford,

1979). After adding the loading dye and boiling the samples for 5 minutes, total protein

(35 Gg) for each sample was separated on 5% stacking and 6.5% separation gels in a

Mini-Protean III cell (Bio-Rad) according to Laemmli (1970) using Tris-glycine as the

SDS-PAGE electrophoresis buffer.

Proteins were electrophoretically transferred to a PVDF membrane

(ImmobilonTM-P; Millipore Corporation, Bedford, MA, USA, Cat. No. IPVH 000 10)

using a Trans-Blot Cell (BioRad). The non-specific binding sites on the membrane were

then blocked with Blotto [5% non-fat dried milk in TTBS (100 mM Tris-HC1, pH 7.9;

150 mM NaCl; 0.1% Tween 20) (see appendix C)] for one hour at room temperature. The

membrane was incubated with primary antibody (anti-c-myc, 1:700) in 3% bovine serum

albumin (BSA) in TTBS overnight at 40 C. After three 10-minute washes in TTBS,

membranes were incubated with secondary antibody (C-myc: Anti-mice IgG),

(Amersham Biosciences Corp, Piscataway, NJ, USA, Cat. No. NXA931), for one hour at









room temperature, followed by three 10-minute washes in TTBS. Detection of the protein

band on blots was carried out according to ECL Plus Western Blotting Detection Kit

(Amersham Biosciences Corp, Piscataway, NJ, USA, Cat. No. RPN2133). Membranes

were exposed to X-ray film.

Results and Discussion

Plasmid Preparation

The cDNA of the Xa21 gene was inserted into plasmid pJIT (pUC based) as

necessary to be under the control of the 35S CaMV promoter and CaMV poly A

terminator. A c-myc epitope sequence was tagged to the 5' end of the cDNA. This

plasmid was designated pXa21-mtag. Figure (3-4) shows a schematic diagram of the

construction of pXa21-mtag plasmid. Plasmid was transformed to E. coli strain DH5aTM

using a chemical protocol according to the manufacture's instructions. Selection for

positive colonies was performed using PCR with a specific primer set for the cDNA.

Testing for correct orientation was performed using restriction enzymes according to

Sambrook and Russell (2001) prior to large scale preparation of the plasmid. The positive

bacterial colonies were related and single colonies were selected to begin large scale

plasmid preparation as described previously. Preps with DNA concentration of 0.5 [g/pl

and above were used in co-transformation experiments. Plasmid DNA was stored at -

200 C for short term use and at -80o C for long-term use.

Transformation of Citrus Protoplasts and Plant Regeneration

Isolation and transformation of citrus protoplast and the ultimate regeneration of

plants are controlled by several factors. The two most important factors are the quality of

the starting material (cell suspension) and quality of the protoplasts after isolation (high

yields of viable protoplasts with little or no debris). The cell suspension line used was









chosen from 'Hamlin' sweet orange new embryogenic cells because they were exhibiting

good regeneration capacity. The best protoplasts were obtained from suspensions

4-10 days after subculture when isolated according to Grosser and Gmitter (1990). Using

the sucrose-mannitol gradient allows for the removal of the non-viable protoplasts and

cellular debris which could interfere with the uptake of the plasmid by the viable

protoplasts, or the regeneration in the following stages. Moreover, starting with pure and

viable protoplasts could possibly increase the transformation efficiency.

Comparison of different GFP-containing constructs

To develop a GFP construct suitable for the identification of citrus transformants

by visualization of green fluorescence, two plasmid constructs containing either the

targeted GFP-ER (Endoplasmic reticulum targeting and retention sequence) for improved

fluorescence (Haseloff et al., 1997) or nontargeted GFP (Cytoplasmic targeting) were

compared in order to assay stable expression of the protein in the transformed citrus

tissue. Both versions of the GFP were cloned under the control of the double 35S

cauliflower mosaic virus promoter with the alfalfa mosaic virus (AMV) untranslated

leader sequence (Figure 3-1 and 3-2). The double 35S-AMV promoter was reported by

Datla et al. (1993) to increase expression up to 20-fold relative to the 35S promoter.

Although both of these constructs gave transient expression at the protoplast level,

nontargeted GFP gave less stable expression than targeted GFP at the colony or plant

level. The most likely explanation for the lack of stable expression from nontargeted GFP

construct may be due to insufficient accumulation of protein for detection because of its

degradation by the proteases in the cytoplasm. Citrus callus tissue sometimes

autofluoresces yellow when illuminated with blue light. To assure transformant

identification without doubt, strong and stable GFP expression is critical. Thus, the









combination of insufficient protein accumulation and possible pale yellow

autofluorescence from callus tissue could have prevented identification of transformed

colonies with the nontargeted version of the GFP, even though expression at the

protoplast level was sufficient for transient detection.

Transient and stable transformation frequencies using GFP as a selectable marker

Transient expression of GFP was visible at the protoplast level as early as 6 hours

after transformation in some pARS 108 experiments. Transient expression of green

fluorescence was intense 16-24 hours after transformation in both p524EGFP. 1 and

pARS108 (Figure 3-7B). Visually, there was no difference in fluorescence intensity

between p524EGFP. 1 and pARS 108 treated protoplasts. The difference between the two

constructs became particularly evident by first week when the cells had started dividing.

This expression persisted for 2-3 weeks, declining more significantly in p524EGFP.1

experiments. The average transient transformation frequency varied from one experiment

to another, even when using the same GFP construct. This could be influenced by the

culture cycle stage and the cultivar of the culture used as source of protoplasts. Using a

2-week subculture cycle, protoplasts isolated from 4- to 10-day-old cell suspension

cultures show the best transient expression and division capacity. A similar result was

reported by Fleming et al. (2000).

Stable transformation frequencies, based on the number of transformed protoplasts

and not corrected for plating efficiency, were in the range of 1 x 10-5 protoplasts. These

results are consistent with others in the literature. Davey et al. (2005a) reported that stable

protoplast transformation frequencies remain low (one per 104 protoplasts), indicating a

need to improvement as necessary for efficient selection and recovery of transformed

cells and tissue. Transgenic tissue was selected and separated from non-transformed









tissue and transferred to solid medium approximately 2 months after the transformation

procedure. Using the FITC/GFP filter set, detection of transgenic calli by exposing

regenerated tissue under blue light was clear and direct by expression of a bright blue-

green color (Figure 3-7C and D). Autofluorescence was generally not detected from non-

transformed calli (Figure 3-7C), with the occasional expression of a pale yellow

fluorescence in older cultures. There was little visual difference in fluorescence at this

stage between p524EGFP.1 and pARS 108. Visual selection of transgenic citrus is

particularly effective at this stage as the colonies are small enough (250-500 mm) so that

a single plate containing thousands of colonies can be rapidly screened, but large enough

to be easily rescued and cultured individually. Aside from the expression of GFP

detectable with blue light, the transgenic tissue appeared normal and could not be

distinguished from non-transformed tissue under white light. At the embryo stage, it was

easy to distinguish between transformants (green) and non-transformants (red) (Figure 3-

7D).

Elliott et al. (1999) tested the efficiency of visual selection by GFP with no

additional selection and concluded that without an additional selective agent, preferential

growth of GFP-positive tissue is difficult to maintain. However, when GFP-positive

tissue can be identified, selectively cultured, and plants regenerated, GFP has been

successfully used as a visual screenable marker (Fleming et al., 2000; Niedz et al., 2003;

Guo et al., 2005). Protoplasts form colonies or embryoids directly from single cells,

making the selection and regeneration of transgenic individuals an efficient process,

limited only by the efficiency of the particular protoplast system. Fluorescent protoplast-









derived colonies were regenerated into plants and maintained as cell lines. Green

fluorescent colonies were not observed in any of the control plates.

At the whole plant level, there were distinct fluorescence differences between

shoots transformed with the two GFP constructs. Shoots transgenic for the ER-targeted

GFP (pARS108) were generally brighter than those derived from the nontargeted

construct (p524EGFP.1), and exhibited a uniform green fluorescence with minimal red

fluorescence from chlorophyll (Figure 3-5 and 3-6). However, the fluorescence intensity

varied among different parts of the plant, being higher in new expanding leaves. This

could be due to lower metabolic activity and chlorophyll accumulation that partially

masks the green fluorescence provided by the GFP in old tissue. Haseloff et al. (1997)

reported that they could consistently regenerate intensely fluorescent Arabidopsis plants

when GFP was targeted to the ER. They also reported difficulty in regenerating plants

from the brightest nontargeted transformants. Both results are similar to our observations

in citrus. Other than the differences discussed above, development and regeneration

responses appeared similar between plants transgenic for either p524EGFP. 1 or

pARS108.

Plant regeneration

The newly obtained 'Hamlin' orange embryogenic suspension culture line used in

these experiments was selected because it was rapidly proliferating and routinely

provided reasonable yields of good quality protoplasts and high regenerating efficiencies

under the optimum condition. However, due to many factors in the procedure, it was

difficult to optimize conditions. Embryogenic callus and particularly suspension cultures

of some citrus cultivars have high rates of mutations and cytological aberrations that

diminish their capacity for whole-plant recovery (Grosser and Gmitter, 1990). 'Hamlin'









has proven to be a highly stable variety in culture. The high performance characteristics,

high regeneration capacity of the 'Hamlin' suspension line merited its use in these

experiments. Furthermore, 'Hamlin' is one of the more highly susceptible varieties to the

citrus canker pathogen. For many years J. W. Grosser at CREC, Lake Alfred has been

comparing several hundred 'Hamlin' and 'Valencia' orange somaclones regenerated from

embryogenic calli, embryogenic suspension culture-derived protoplasts, and from

nucellar seedling stem intemodes via organogenesis. Although useful somaclonal

variation was found in all of these populations, the large majority (80%) of the

somaclones from all sources are not significantly different from the original clones

(Grosser et al., 1996a). These results suggest that it should not be difficult to recover true-

to-type transgenic plants using the protoplast-transformation system (Fleming et al.,

2000).

Generally, the colonies selected for GFP expression were transferred to EME-

maltose 4-8 weeks after transformation. Shortly thereafter, embryos began to form.

Transformed embryogenic callus develops normal, bipolar, heart shaped embryos when

cultured on cellulose acetate membranes overlaid on solid EME-maltose medium (Figure

3-7E and F). The mechanism of membrane induced embryo normalization remains

unclear (Niedz et al., 2002). These embryos were removed and transferred to another

fresh plate containing EME-maltose medium, and allowed to proliferate. Embryos were

then transferred to 1500 medium for further growth.

Efforts to regenerate transgenic plants were therefore focused on these cultures.

More than 500 transgenic somatic embryos recovered from several experiments were

cultured on B+ germination medium for two passages. The majority of these embryos









became larger, but did not convert to plantlets. However, as is often the case with citrus

somatic embryos, multiple shoots were regenerated following culture on DBA3 shoot

induction medium (Deng et al., 1992; Grosser et al., 2000) (Figure 3-7G and H).

Approximately 200 embryos produced shoots, but a few of them produced both shoots

and roots. These plants were transferred to soil but were not successfully acclimated,

probably due to poor root quality. Shoots from the other germinated embryos were

cultured on RMAN root-induction medium, and most of them successfully produced

roots (Figure 3-71). These plants were also transferred to soil but again most of them were

not successfully acclimated. Potting soil contamination was by a fungus determined to be

at least partially responsible for this result (about 200 plants were recovered out of more

than 1200 plantlets transferred to the soil) (Figure 3-7J and K).

As mentioned, the non-converted transgenic embryos were sectioned and cultured

on DBA3 shoot-induction medium for two to three passages. Some of them produced

multiple shoots and others responded poorly. Many clusters of healthy transgenic shoots

were recovered. Shoots were cultured on RMAN root-induction medium, and again most

of them successfully produced roots (>75%). Transgenic plants growing on their own

roots exhibited a high level of GFP expression in the root, attributed to the absence of

chlorophyll in root tissue (Data not shown).

There are several reasons for the low regeneration efficiency in protoplast

transformation experiments. First, problems related to the culturing of the protoplasts, or

the condition of the cell suspension cultures used for protoplast isolation could be

influential. If large numbers of microcalli are produced (i.e., high plating efficiency),

there is a tendency for callus to be formed at the expense of embryo induction. If









embryos do form, there is often an overgrowth of those embryos by the callus, which

inhibits further embryo development. Other reasons for the failure of plant regeneration

include contamination of the media, the condition of the protoplasts after isolation and


transformation, and possibly other unknown factors.


Figure 3-5. Cytoplasmic targeting of GFP expression in a mature citrus leaf. Mature
leaves from transgenic plant obtained from p524EGFP.1 were scanned using
confocal laser scanner with a setting for three different fluorescent
wavelengths, green, red, and blue, at the same time with a 488, 543, and
633 nm excitation filter and a 500-543, 610-630, and 675-750 tunable spectral
window, respectively. (A) green, (B) red, (C) blue, and (D) overlay of three
filters together.









































Figure 3-6. ER targeting of GFP expression in a mature citrus leaf. Mature leaves from a
transgenic plant obtained from pARS108 were scanned using confocal laser
scanner with setting for three different fluorescent wavelengths, green, red,
and blue, at the same time with a 488, 543, and 633 nm excitation filter and a
500-543, 610-630, and 675-750 tunable spectral window, respectively. (A)
green, (B) red, (C) blue, and (D) overlay of three filters together.








































Figure 3-7. Citrus transgenic plant regeneration and GFP monitoring from protoplast to
plant. (A) protoplasts after isolation from the ring between sucrose 25% and
mannitol 13%; (B) protoplasts after 24 hours from co-transformation with
pARS 108/p524EGFP. 1 and pXa21-mtag by direct DNA uptake protocol using
Polyethylene Glycol (PEG); (C) protoplast-derived calli (transformed and
non-transformed) on EME-maltose solid medium 36 days after
transformation, (Left) blue light; (Right) white light; (D) transgenic (green)
and non-transgenic (red) somatic embryos growing on EME medium 6 to
8 weeks after transformation; (E) transgenic somatic embryos growing on
cellulose acetate membranes laid on 1500 medium 2-3 months after
transformation; (F) transgenic (green) and non-transgenic (red) somatic
embryos growing on 1500 media 3-4 months after transformation; (G)
embryo-derived transformed (green) and non-transformed (red) shoots on B+
medium 5-6 months after transformation; (H) embryo-derived transformed
shoots on DBA3 medium 6 months after transformation; (I) in vitro rooted
transgenic citrus plants constitutively expressing the GFP gene; (J and K)
transgenic 'Hamlin' sweet orange plants in soil.









Shoots failing to produce roots were either in vitro grafted to nucellar seedlings of

Carrizo citrange (Figure 3-8) or shoot-tip grafted onto Carrizo citrange and/or sour

orange in the greenhouse (Figure 3-9). The grafting technique was chosen based on the

shoot condition. Small and soft shoots were selected for in vitro micrografting, whereas

larger and more hardened ones were chosen for shoot-tip grafting in the greenhouse. Over

95% of the in vitro micrografts were successful, producing more vigorous plantlets that

were, acclimated with a 75% success rate.

Shoot-tip grafting has been used successfully to recover transgenic shoots

regenerated from citrus epicotyls treated with Agrobacterium (Pefia et al., 1995a; 1997;

Bond and Roose, 1998; Cervera et al., 2000). Grafting of small shoots (<1 cm) as they

arise overcomes rooting difficulties that can occur (Moore et al., 1992). Rooting

protoplast derived sweet orange plants can take up to 3 months before roots emerge.

Shoot-tip grafting greatly accelerates plant recovery. Over 500 transgenic plants were

obtained from co-transformation experiments using shoot tip grafting. The typical

morphology of the regenerated transgenic 'Hamlin' orange plants was similar to that of

the non-transformed plants recovered from the control cultures.

The time frame from initial protoplast isolation to plant establishment in soil varied

greatly from one experiment to another. Several factors influence this chain of events.

Delays in the osmoticum reduction process and culture transfer slowed down calli and

embryo growth. In some experiments, rapidly developing embryos could be transferred

directly from EME to B+ medium, skipping the transfer to 1500 medium. In others,

embryo growth was slower, requiring an additional subculture on EME, 1500, or B+









media. However, if all the stages went smoothly, the plantlets could be established in soil

in as little as 5 to 6 months.


Figure 3-8. in vitro grafting of transgenic 'Hamlin' sweet orange onto nucellar seedlings
of Carrizo citrange. (A) shoots failing to root in vitro; (B) grafted transgenic
scion (green) onto Carrizo seedling (red); (C) micrografted transgenic
'Hamlin' sweet orange onto Carrizo plant in vitro; (D) transgenic 'Hamlin'
sweet orange growing on Carrizo rootstock in soil 6 weeks after grafting; (E)
transgenic plant more than a year in soil under the greenhouse condition.

From more than 15 co-transformation experiments with p524EGFP. 1 and

pXa21-mtag, only one transgenic event was recovered and 7 transgenic plants were

successfully propagated using grafting techniques. From more than 30 co-transformation









experiments with pARS108 and pXa21-mtag, 75 transgenic events were recovered and

more than 500 transgenic plants were regenerated and transferred to the greenhouse.

According to the literature, this is the first time to report a large population of normal

transgenic 'Hamlin' sweet orange plants using the protoplast/GFP transformation system.

























Figure 3-9. Shoot-tip grafting of transgenic 'Hamlin' sweet orange onto Carrizo citrange
and/or sour orange. (A) shoot failing to root in vitro; (B) shoot tip grafting of
transgenic 'Hamlin' sweet orange onto Carrizo plant in soil (under the tip);
(C) transgenic 'Hamlin' sweet orange growing onto Carrizo rootstock in soil
2-3 weeks after removing the tip; (D) transgenic scion growing onto Carrizo
rootstock in soil 6-8 weeks after removing the tip; (E) transgenic plants after
more than a year in soil.

Molecular Analysis

Polymerase chain reaction (PCR) for screening transformants

When putative transgenic scions grafted onto Carrizo citrange seedlings had

developed several leaves, a leaf was removed from each plant, excited with blue light to

confirm GFP expression. The polymerase chain reaction was used initially to screen









regenerated 'Hamlin' orange plants obtained via co-transformation. The PCR analysis

was performed using DNA from leaves of regenerated plants, transgenic and non-

transgenic. To confirm the presence of the GFP gene and the cDNA of the Xa21 gene in

the transgenic plant genomes, multiple PCR experiments were performed using two

different pairs of primers for GFP and the cDNA at the same time. A predicted internal

fragment of about 780 nucleotides was amplified in all DNA samples from green

fluorescent leaves (Figure 3-10). No amplification was detected in DNA samples from

non-transgenic regenerated control plants, which emitted red fluorescence under blue

light. A predicted internal fragment of about 1400 nucleotides was amplified in 35% of

the DNA samples from green fluorescent leaves, which corresponds to the cDNA of the

Xa21 gene (Figure 3-10).

MM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25













Figure 3-10. Multiple PCR analysis to detect the presence of the GFP (0.8 kb) and the
cDNA of the Xa21 (1.4 kb) genes in transgenic citrus plants. Lane 24 is a
positive control for both genes (DNA plasmid). Products have shown in lanes
2-20 the presence of GFP gene and the cDNA of the Xa21 gene in the
transgenic plants. Lanes 21 and 22 are positive for GFP only. Lane 23 is
negative for both genes. Lane 1 is a non-transgenic control, and lane 25 is
negative control (H20), MM = 1 kb DNA ladder.









Screening for transformants using southern blot analysis

When the grafted plants measured 20-30 cm in height, southern analysis was

performed to confirm the stable integration of the cDNA of Xa21 coding sequence in the

transgenic plants genome and to provide some information regarding their integration

patterns. Eight randomly chosen putative transgenic plants (grown in the green house for

more than 12 months), which were PCR positive for GFP and Xa21 were analyzed.

Genomic DNA was digested with SphI that has a unique restriction site within the 5' end

of the integrated sequence of the cDNA of the Xa21, and ApaLI that does not cut in the

cDNA. Therefore, bands hybridizing to the probe result from one site within the vector

and one site within the flanking genomic DNA. Hybridization patterns with multiple

bands were observed (Figure 3-11). In general, the direct-gene-mediated method results

in more multiple and rearranged fragment in transgenic plants than do plants transformed

by the Agrobacterium-method (Dong et al., 1996; Krasnyanski et al., 1999), and this was

the case for this study on citrus. Even though different hybridization patterns were

observed, the results of southern blot analysis provided molecular evidence confirming

the presence of the introduced cDNA of the Xa21 gene in the citrus genome.

1 2 3 4 5 6 7 8 9






S__ ___ ___ 2. g


Figure 3-11. Southern hybridization analysis of 'Hamlin' sweet orange plants with the
cDNA of the Xa21 gene. The probe was a 1641-bp NcoI855 -- Nco12496
fragment of the cDNA of the Xa21 gene isolated from plasmid pAO3. Lanes
1-9 Genomic DNAs were digested with SphI and ApaLI. Lanes 1-8 transgenic
plants and lane 9 non-transgenic plant.









Confirmation of transformation using western blot analysis

Leaf tissue from transgenic plants was used to obtain crude protein extracts for

Western analyses. The extracted proteins (35 [g per lane) were separated subsequently

by SDS/PAGE on 5% stacking and 6.5% separation gels and transferred to Immobilon-

PVDF membranes for immunostaining. The Western blots were developed with

anti-c-myc as primary antibody followed by anti-mice immunoglobulin G (IgG)

antibody conjugated with horseradish peroxidase as a secondary antibody as described in

the material and methods. Detection of immune complexes was achieved by enhanced

chemiluminescence according to ECL Plus Western Blotting Detection Kit. Finally,

expression of the Xa21 was detected on the membrane to verify that the gene was

integrated and expressed in the transgenic plants. In this assay, a protein product of

120 kDa corresponding to the cDNA of the Xa21 gene was immunoreactive with the

monoclonal antibody in 22 out of 34 tested transgenic plants (Figure 3-12). In this assay

soluble extracts of the transgenic rice expressing the wild-type Xa21 gene and non-

transgenic rice were used as positive and negative controls. As shown in Figure (3-12),

there is a non-specific band appearing in all the samples which is larger than the Xa21

corresponding band. Some of the transgenic plants were PCR and southern analysis

positive, but did not have the corresponding band for the Xa21 protein. The most likely

explanation for this phenomenon is that even though the DNA had been transferred and

integrated into the plant genome, it was not transcribed to RNA and subsequently protein.

As shown, most Southern-positive plants transformed with cDNA of the Xa21 express

Xa21 protein to detectable levels. According to the literature, this is the first time that a

gene from rice has been stably integrated and expressed in citrus plants. After more than








12 months growing in the greenhouse, all transgenic plants showed a normal phenotype,

identical to that of control non-transformed 'Hamlin' orange plants.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

bonbo IMnnuPn O M o MM
i n ^ S m-S SCS-

L kkth w -
Figure 3-12. Western blotting analysis of transgenic 'Hamlin' sweet orange. The
extracted proteins (35 gg per lane) were separated subsequently by
SDS/PAGE on 5% stacking and 6.5% separation gels and transferred to
polyvinylidene difluoride membranes for immunostaining. Soluble extracts of
the transgenic rice expressing the wild-type Xa21 gene (lane 20),
non-transgenic rice (lane 21), transgenic citrus expressing the GFP gene only
(lane 1), non-transgenic citrus (lane 2), transgenic citrus positive for GFP and
Xa21 genes (lanes 4-19) were subjected to Western blotting with reference to
molecular mass markers (indicated in lane 1). The Western blots were
developed with anti-c-Myc as primary antibody and c-Myc: Anti-mice IgG as
a secondary antibody as described in the material and methods.














CHAPTER 4
TRANSGENIC 'Hamlin' SWEET ORANGE PLANTS CONTAINING A RICE XA21
cDNA XANTHOMONAS RESISTANCE GENE OBTAINED BY PROTOPLAST/GFP
TRANSFORMATION SYSTEM

Introduction

'Hamlin' sweet orange (Citrus sinensis (L.) Osbeck) is one of the leading

commercial cultivars in Florida because of its high yield potential and early maturity.

'Hamlin' also has a high regeneration capacity from protoplasts and is often used in

transformation experiments. Citrus canker disease caused by the bacterial pathogen

Xanthomonas axonopodis pv. citri is becoming a worldwide problem. The Xa21 is a

member of the Xa21 gene family of rice which provides broad spectrum Xanthomonas

resistance in rice. Since the citrus canker pathogen is in the same genus, this gene may

impart resistance to canker in citrus. The wild-type Xa21 gene contains an intron, and

there are some questions whether dicot plants can process genes containing monocot

introns (the cDNA is intron free).

In the last decade, improvements of plant transformation vectors and

methodologies have increased the efficiency of plant transformation and the ability to

stably express transgenes in plants. DNA has been delivered into the plant cell using a

wide range of tools such as Agrobacterium-mediated transformation, microprojectile

bombardment, chemical (PEG) treatment of protoplasts and electroporation of

protoplasts. Using chemical (PEG) treatment of protoplasts to transfer the gene of interest

can be done by either transformation or co-transformation system. In co-transformation

experiments, researchers used two different plasmids, one encodes the reporter gene and









the other encodes the gene of interest. This is very laborious, costly, and time consuming.

In addition, the final transformation efficiency will be low because it is not guaranteed

that in all the cases both plasmids will be transferred. A transformation system using a

single plasmid, which encodes both the reporter and the gene of interest, is an alternative.

Producing transgenic plants containing the plasmid pAO3, which encodes the GFP

endoplasmic reticulum (ER)-targeting and the cDNA of the Xa21 gene from the Xa2]

gene family of rice into one construction, was among the objectives of this study.

To achieve this objective, protoplasts isolated from a new embryogenic callus line

of 'Hamlin' sweet orange were transformed with plasmid DNA (pAO3) using

polyethylene glycol. Transformed clones were screened for GFP expression using blue

light. Polymerase chain reactions (PCR) were performed to identify the transformed

clones. Transgenic plants were regenerated from transformed clones via somatic

embryogenesis and organogenesis. Transgenic plants containing the cDNA of the Xa21

gene were assayed by southern blot analysis and western blot analysis to determine if the

gene is integrated into the citrus genome and functioning to produce RNA and

subsequently protein.

Materials and Methods

Plasmid Construction

The plasmid pARS 108 containing the GFP ER-targeting gene was kindly provided

by Dr. R. P. Niedz (USDA, Agriculture Research Service, US Horticultural Research

Laboratory, Ft. Pierce, FL, USA). Construction of pARS108 has been described

previously by Niedz et al. (2003). Plasmid pARS 108 contains the EGFP coding sequence

(GenBank accession #U55761) placed under the control of the double 35S cauliflower

mosaic virus (35S-35S CaMV) promoter with the alfalfa mosaic virus (AMV)









untranslated leader sequence and the nos terminator. An Arabidopsis signal sequence

(SS) is included in the 5' end to target the protein to the ER, and the codon sequence for

the amino acids HDEL were included at the 3' end for retention of the protein in the

lumen of the ER (Figure 3-1 in chapter 3).

Vector pCR504 was kindly provided by Dr. Pamela Ronald, University of

California-Davis (Figure 3-3 in chapter 3). It contains a 3.1 kb BamHI fragment

containing the entire cDNA of the Xa21 gene from rice. Plasmid pCR504 is a

promoterless plasmid containing the cDNA of the Xa21 gene. Methods used for plasmid

construction were similar to those described by Sambrook and Russell (2001). Plasmid

pXa21-mtag has been constructed as described in chapter 3 and used to construct a new

DNA plasmid pAO3.

To construct a new plasmid which contains ER-targeted GFP and the cDNA of

Xa21 in one construction, first the cDNA needed to be cloned into a separate plasmid

with specific restriction enzymes. Plasmid pRTL2.vec was kindly provided by Dr. T. E.

Clemente (Plant Science Initiative, University of Nebraska, Lincoln, NE, USA). This

plasmid contains the 35S CaMV promoter and terminator cascade. To construct the

plasmid used in the transformation experiment, the BamHI fragment containing the

cDNA of Xa21 with the c-myc sequence was excised from pXa21-mtag and ligated into

BamHI site of pRTL2.vec (Figure 4-1). The re-ligated plasmid contained the cDNA of

Xa21 gene under the control of E35S promoter and T35 S terminator was designated

pAORTL. This plasmid could be used in co-transformation experiments. The PstI

fragment from pAORTL (E35S-TEV-Xa21 cDNA-T35S) was excised and inserted into

the PstI site of pARS108. The resulting plasmid is referred to as pAO3. The new plasmid









(pAO3) has both of the cDNA-mtag under the control of the 35S cauliflower mosaic

virus (35S CaMV) promoter and T35S terminator and the ER-targeted GFP (Figure 4-1).

Plasmid Multiplication

Transformation of E. coli

Before a large scale plasmid preparation can be performed, the plasmid must first

be transformed into competent E. coli cells. Max efficiency DH5aTM competent cells

were obtained from Invitrogen (Invitrogen Coporation, Carlasbad, CA, USA, Cat. No.

18258-012). The transformation procedure was followed exactly as described in the

product manual.

Quick miniprep plasmid preparation and confirmation of the orientation of the
insert

Plasmid DNA was extracted from several recovered bacterial colonies and

compared to the DNA from the known plasmid stock by restriction analysis using

agarose gel electrophorosis as described previously in chapter 3. To confirm the

orientation of the insert, a restriction digest was then performed on the extracted DNA to

test for the presence of the cDNA of the Xa21 gene and it orientation as described in

previously in chapter 3.

Large scale preparation of plasmid DNA

To obtain a large amount of the DNA, two 1-liter flasks containing 500 ml LB

media plus the appropriate antibiotic were inoculated with the transformed E. coli and the

cultures were incubated overnight at 370 C on a shaker at 225 RPM. The DNA was

extracted from the overnight culture bacteria using Wizard PlusMaxipreps DNA

Purification System (Promega Corporation, Madison, WI, USA, Cat. No. A7270). To

determine the concentration of plasmid DNA, an absorbance reading at an O.D.260 was






64


obtained, (an absorbance reading of 1.0 corresponds to 50 [g of plasmid DNA per ml)

(Sambrook and Russell, 2001).


X, B,
Sm,
P K Sa
MCS M


pRTL2.vec

IBamHI
B B


EC;


AH




A MpR


35S P
N H B

CaMV
mTag poly A
pXa21-mtag


AmpR


IBamHI


mT
mTag


B
EDEL B
SEL Sa E p




ARS108 ,


BN H B


Tag
mTag


pAORTL ,


Pst
|Pstl


mTag
V T


Pstl

BNH B


mTag


pH


N H
\


HDEL
/Sa E


3I5N
EGFP


Xa2l cDNA


AmpR


pAO3


Figure 4-1. Schematic diagram of pAO3 plasmid. Restriction enzyme (B, BamHI; E,
EcoRI; H, HindlII; K, Kpnl; N, Ncol; P, Pstl; Sa, Sacl; Sm, SmaI; X, Xbal).
HDEL = Histidine, Aspartic acid, Glutamic acid, and Leucine, respectively.


B
^^ ^{[*H


_______________ tt iS't'S im i't--*' '*


I


/









Plant Material, Protoplast Transformation, and Culture

Establishment and maintenance of suspension cultures

A 'Hamlin' sweet orange (Citrus sinensis L. Osbeck) embryogenic callus line was

induced from unfertilized ovules taken from mature fruit and maintained on Murashige

and Tucker's (MT) basal medium (Murashige and Tucker, 1969). Suspensions cultures

were maintained according to Grosser and Gmitter (1990) and subcultured every two

weeks by splitting the contents between two sterile flasks and adding a 25 ml of fresh

culture medium to each flask. The cells were used for protoplast isolation 4-10 days after

subculture.

Isolation, transformation, and culture of citrus protoplasts

Protoplasts were isolated from an embryogenic suspension culture of 'Hamlin'

sweet orange (C. sinensis L. Osbeck) and maintained on a 2-week subculture cycle

according to Grosser and Gmitter (1990). Protoplasts were isolated from suspension

culture 4-10 days after subculture as described in detail previously in chapter 3.

The protoplast transformation protocol was modified from the PEG-mediated

protoplast fusion developed by Grosser and Gmitter (1990) for citrus somatic

hybridization with slight modification as described previously in chapter 3.

Regeneration and selection of transformed protoplasts

The GFP expression was detected in the transgenic protoplasts illuminated with

blue light within 24 hours after transformation using a Zeiss SV11 epifluorescence

stereomicroscope equipped with a 100 W mercury bulb light source and an FITC/GFP

filter set with a 480/30 nm excitation filter and a 515 nm longpass emission filter

(Chroma Technology Corp., Brattleboro, VT, USA). Continued expression of the GFP

protein was monitored occasionally for the next few weeks. Cultures were treated exactly









as described previously in chapter 3 to obtain transgenic plantlets. Transgenic shoot tips

were micrografted onto Carrizo citrange or sour orange nucellar seedlings according to

Navarro (1992) to expedite transgenic plant recovery.

Molecular Analysis of Transgenic Plants

Presence of the GFP gene and the cDNA of Xa21 in the selected tissue were

confirmed by PCR amplification of the transgenes. The copy number and integration

pattern of the transgene were determined by Southern blot analysis. The expression of the

cDNA of the Xa21 gene was determined by western blot analysis.

Polymerase chain reaction (PCR) for detection of transformants

The PCR was used initially to screen regenerated 'Hamlin' sweet orange plant

obtained via protoplast/GFP transformation system. Genomic DNA was extracted from

young leaf tissue of transgenic and non-transgenic citrus plants using a GenEluteTM Plant

Genomic DNA Miniprep kit (Sigma, Inc., St. Louis, MO, USA, Cat. No. G2N350). To

confirm the presence of GFP and the cDNA of Xa21, multiple PCR experiments were

performed using two different pairs of primers for GFP and for the cDNA simultaneously

as described previously in chapter 3.

Southern blot analysis

The genomic DNA samples used for southern blot analysis were extracted and

purified from young leaves of transgenic and non-transgenic plants using the CTAB

method (Sambrook and Russell, 2001) as modified by T. E. Mirkov (personal

communication). Twenty [g of DNA was digested with SphI and ApaLI restriction

enzymes. Standard protocol for gel electrophoresis, denaturation, and neutralization of

the gel were described by Sambrook and Russell (2001). After electrophoresis, the gels

were treated with 0.25 N HC1 for 10 minutes, and then washed with 0.4 N NaOH for









10 minutes. DNA was transferred to a positively charged nylon membrane

(ImmobilonTM-Ny+; Millipore Corporation, Billerica, MA, USA) by capillary transfer

using 20X SSC buffer overnight according to Sambrook and Russell (2001). Probe DNA

for the cDNA of the Xa21 gene was prepared from an Xhol fragment (1.49-kb) of the

pXa21-mtag plasmid. Probe was labeled with digoxigenin-dUTP using a random primer

labeling kit (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche Applied

Science, Cat No. 11 585 614 910). The probe labeling was performed according to the

manufacturer's manual. Fixation the DNA to the membrane, prehybridizaton,

hybridization, and immunological detection were performed as described in the

instruction manual of DIG High Prime DNA Labeling and Detection Starter Kit II.

Western blot analysis

To carry out western blot analysis, total protein was extracted from transgenic and

non-transgenic plants. About 0.3 g leaf tissue from transgenic and non-transgenic

'Hamlin' sweet orange plants was collected and ground in liquid nitrogen. To isolate the

soluble fractions, the ground tissue was thawed in extraction buffer [50 mM Tris-HC1, pH

6.5; 1 mM EDTA; 150 mM NaCl; 0.1% Triton X-100]. Prior to use the extraction buffer

immediately, the following protease inhibitors were added: 2 [g/ml Antipain; 2 [g/ml

Leupeptin; 2 [g/ml Aprotinin; 1 mM of 4-[2-aminoethyl]-benzenesulfonyl fluoride

(AEBSF) Sigma; and 5% of 2- mercaptoethanol. Samples were incubated at 40 C for

30 minutes with shaking and then centrifuged at 10,000 RPM for 10 minutes at 40 C. The

supernatant was recentrifuged at 13,000 RPM for 10 minutes at 40 C. The supernatant

was either immediately subjected to protein blot analyses or stored at -80o C after

determinating the concentration of the protein by the method of Bradford (Bradford,

1979). After adding the loading dye and boiling the samples for 5 minutes, total protein









(35 ~ig) for each sample was separated on 5% stacking and 6.5% separation gels in a

Mini- Protean III cell (Bio-Rad) according to Laemmli (1970) using Tris-glycine as the

SDS-PAGE electrophoresis buffer.

Proteins were electrophoretically transferred to a PVDF membrane (ImmobilonTM

P; Millipore Corporation, Bedford, MA, USA, Cat. No. IPVH 000 10) using Trans-Blot

Cell (BioRad). The non-specific binding sites on the membrane were then blocked with

Blotto [5% non-fat dried milk in TTBS (100 mM Tris-HC1, pH 7.9; 150 mM NaCl; 0.1%

Tween 20) (see appendix C)] for one hour at room temperature. The membrane was

incubated with primary antibody (anti-c-myc, 1:700) in 3% bovine serum albumin (BSA)

Fwashes in TTBS, the membrane was incubated with secondary antibody (C-myc: Anti-

mice IgG) (Amersham Biosciences Corp, Piscataway, NJ, USA, Cat. No. NXA931) for

one hour at room temperature, followed by three 10-minute washes in TTBS. Detection

of the protein band on the blot was carried out according to the ECL Plus Western

Blotting Detection Kit instruction (Amersham Biosciences Corp, Piscataway, NJ, USA,

Cat. No. RPN2133). The membrane was exposed to X-ray film.

Results and Discussion

Plasmid Preparation

The cDNA of the Xa21 gene was inserted into plasmid pRTL2.vec under the

control of 35S CaMV promoter and CaMV poly A terminator. A c-myc epitope sequence

was tagged to the 5' end of the cDNA as described previously in chapter 3. This plasmid

was designated pAORTL. The PstI fragment from pAORTL (E35 S-TEV-Xa21 cDNA-

T35S) was excised and inserted into PstI site on pARS108. The new construction was

referred to as pAO3. Figure (4-1) shows a schematic diagram of the construction of

pAO3 plasmid. Chemically competent E. coli strain DH5aTM was transformed with









pAO3 plasmid according to the manufacture's instructions. Colony selection was

performed using PCR with gene specific primers. Testing for the orientation of the insert

was performed using restriction enzymes according to Sambrook and Russell (2001)

prior to large scale preparation of the plasmid DNA. The positive bacterial colonies were

related and single colonies were selected to begin large scale plasmid DNA preparation

as described previously. Preps with DNA concentration of 0.5 gg/il and above were used

in transformation experiments. Plasmid DNA was stored at -200 C for short-term use and

at -80o C for long-term use.

Transformation of Citrus Protoplasts and Plant Regeneration

Isolation and transformation of protoplast and the ultimate regeneration of plants

are controlled by several factors. The two most important factors are the quality of the

starting material (cell suspension) and quality of the protoplast after isolation (high yields

of viable protoplasts with little or no debris). The cell suspension line used was chosen

from 'Hamlin' sweet orange new embryogenic cells because they were exhibiting a good

regeneration capacity. The best protoplasts were obtained from suspensions 4-10 days

after subculture when isolated according to Grosser and Gmitter (1990). Using the

sucrose-mannitol gradient allows for the removal of the non-viable protoplasts and

cellular debris which could interfere with the uptake of the plasmid by the viable

protoplasts, or the regeneration in the following stages. Moreover, starting with pure and

viable protoplasts could possibly increase the transformation efficiency.

Transient and stable transformation frequencies using GFP as selectable marker

Transient expression of GFP was visible at the protoplast level as early as

6-12 hours after transformation with pAO3 plasmid. Transient expression of green

fluorescence was intense 16-24 hours after transformation (Figure 4-2 B). The average









transient transformation frequency varied between experiments. This may have been

influenced by the culture cycle stage and/or the cultivar used as source of protoplasts.

Using a 2-week subculture cycle, protoplast isolated from 4- to 10-day-old cell

suspension culture showed the best transient expression and division capacity. A similar

results was reported by Fleming et al. (2000).

Stable transformation frequencies, based on the number of transformed protoplasts

and not corrected for plating efficiencies, were in the range of 1X10-5 protoplasts. These

results are consistent with others in the literature. Davey et al. (2005a) reported that

protoplast transformation frequencies remain low (one in 104 protoplasts giving stably

transformed tissues) which requires protoplast-to-plant system with efficient selection to

recover transformed cells and tissue. Transgenic tissue was selected from

non-transformed tissue and transferred to solid medium approximately 2 months after the

transformation procedure. Using the FITC/GFP filter set, detection of transgenic calli by

exposing regenerated tissue with blue light was detected by expression of a bright blue-

green color (Figure 4-2 C and D). Autofluorescence was generally not detected from

non-transformed calli (Figure 4-2 C), with the occasional expression of a pale yellow

fluorescence in older cultures. Visual selection of transgenic citrus is particularly

effective at this stage as the colonies are small enough (250-500 mm) so that a single

plate containing thousands of colonies can be rapidly screened, but large enough to be

easily rescued and cultured individually. Aside from the expression of GFP detectable

with blue light, the transgenic tissue appeared normal and could not be distinguished

from non-transformed tissue under white light. At the embryo stage, it is very easy to









distinguish between transformant (green) and non-transformant once (red) (Figure

4-2 D).

Elliott et al. (1999) tested the efficiency of visual selection by GFP with no

additional selection and concluded that without an additional selective agent, preferential

growth of GFP-positive tissue is difficult to maintain. However, when GFP-positive

tissue can be identified, selectively cultured, and plants regenerated, GFP has been

successfully used as a visual screenable marker (Fleming et al., 2000; Niedz et al., 2003;

Guo et al., 2005). Protoplasts form colonies or embryoids directly from single cells,

making the selection and regeneration of transgenic individuals an efficient process

limited only by the efficiency of the particular protoplast system. Fluorescent protoplast-

derived colonies were regenerated into plants and maintained as cell lines. Non-

transformed green fluorescent colonies were not observed in any of the subculture control

plates.

Plant regeneration

The newly obtained 'Hamlin' sweet orange embryogenic suspension culture line

used in these experiments was selected because it was rapidly proliferating and routinely

provided reasonable yields of good quality protoplasts and high regenerating efficiencies

under the optimum condition. However, due to many factors that influence the procedure,

it was difficult to optimize the condition. Embryogenic callus and particularly suspension

cultures of some cultivars have high a rate of mutations and cytological aberrations that

diminish the capacity for whole-plant recovery (Grosser and Gmitter, 1990). The high

performance characteristics and high regeneration capacity of the 'Hamlin' callus line

merited its use in these experiments. Moreover, 'Hamlin' is one of the highly susceptible

varieties to citrus canker pathogen.









Generally, the colonies selected for GFP expression were transferred to

EME-maltose medium 4-8 weeks after transformation. Shortly thereafter, embryos began

to form. Transformed embryogenic callus developed normal, bipolar, heart shaped

embryos when cultured on cellulose acetate membranes overlaid on solid EME-maltose

medium (Figure 4-2 D). The mechanism of membrane induced embryo normalization

remains unclear (Niedz et al., 2002). These embryos were removed and transferred to

another fresh plate containing EME-maltose medium, and allowed to proliferate.

Embryos were then transferred to 1500 medium for further growth.

Efforts to regenerate transgenic plants were focused on these cultures. More than

200 transgenic somatic embryos recovered from several experiments were cultured on B+

germination medium for two passages. The majority of these embryos became larger, but

did not convert to plantlets. However, as is often the case with citrus somatic embryos,

multiple shoots were regenerated following culture on DBA3 (Deng et al., 1992). Only

eight embryos produced shoots, but three of them produced both shoots and roots. Half of

the plants were transferred to soil but were not successfully acclimated, probably due to

poor root quality. The other half and shoots from the other germinated embryos were

cultured on RMAN root-induction medium, and most of them successfully produced

roots (Figure 4-2E). Some of these plants were transferred to soil, but again all of them

were not successfully acclimated, probably due to poor root quality. Also, a fungal

potting soil contamination was determined to at least partially responsible.

As mentioned, the non-converted transgenic embryos were sectioned and cultured

on DBA3 shoot-induction medium for five to seven passages, but none of them produced

shoots. Shoots recovered from the eight lines were cultured on RMAN root-induction









medium, and again most of them successfully produced roots (>90%). Transgenic plants

growing on their own root are showing a high level of GFP expression in the root,

attributed to the absence of chlorophyll in root tissue (data not shown).


































Figure 4-2. Citrus transgenic plant regeneration and GFP monitoring from protoplast to
plant. (A) protoplasts after isolation from the ring between sucrose 25% and
mannitol 13%; (B) protoplasts after 24 hours from transformation with pAO3
by direct DNA uptake protocol using Polyethylene Glycol (PEG); (C)
protoplast-derived calli (transformed and non-transformed) on EME-maltose
solid medium 36 days after transformation; (D) transgenic (green) and non-
transgenic (red) somatic embryos growing on EME medium 6 to 8 weeks after
transformation; (E) in vitro rooted transgenic citrus plants constitutively
expressing the GFP gene; (F) shoot tip grafting of transgenic 'Hamlin' sweet
orange onto Carrizo plant in soil (under the tip).









There are several reasons for the low regeneration efficiency in protoplast

transformation experiments. First, problems related to the culturing of the protoplast, or

the condition of the cell suspension cultures used for protoplast isolation could be

influential. If large numbers of microcalli are produced (i.e., high plating efficiency),

there is a tendency for callus to be formed at the expense of embryo induction. If

embryos do form, there is often an overgrowth of those embryos by the callus, which

inhibits further embryo development. Other reasons for the failure of plant regeneration

include contamination of the media, the condition of the protoplast after isolation and

transformation, and possibly other unknown factors.

Shoots failing to produce roots were either in vitro grafted to nucellar seedlings of

Carrizo citrange or shoot-tip grafted onto Carrizo citrange and/or sour orange in the green

house. Since small plantlets did not pass the acclimation stage in soil, they have been

used as a source of grafting material. The grafting technique was chosen based on the

shoot condition. Small and soft shoots were chosen for in vitro micrografting, whereas

larger and more hardened ones were chosen for shoot-tip grafting in the greenhouse. One

hundred percent of the in vitro micrografts were successful, producing more vigorous

plantlets that were acclimated with 90% success rate.

Shoot-tip grafting has been used successfully to recover transgenic shoots

regenerated from citrus epicotyls treated with Agrobacterium (Pefia et al., 1995a; Pefia et

al., 1997; Bond and Roose, 1998; Cervera et al., 2000). Grafting of small shoots (<1 cm)

as they arise overcomes rooting difficulties that can occur (Moore et al., 1992). Rooting

protoplast derived sweet orange plants can take up to 3 month before roots emerge.

Shoot-tip grafting greatly accelerates the recovery of plants. About 72 transgenic plants









were obtained by using shoot tip grafting from eight different transgenic events. The

typical morphology of the regenerated transgenic 'Hamlin' plants was similar to that of

the non-transformed plants recovered from the control cultures.

The time frame from initial protoplast isolation to plant establishment in soil varied

greatly from one experiment to another. Several factors influence this chain of events.

Delays in the osmoticum reduction process and transferring slowed down calli and

embryo growth. In some experiments, rapidly developing embryos could be transferred

directly from EME to B+ medium, skipping the transfer to 1500 medium. In others, they

required an additional subculture on EME, 1500, or B+ media. However, if all the stages

went smoothly, the plantlets were established in soil in as little as 5 to 6 months.

From over 20 transformation experiments with pAO3, only eight transgenic events

were recovered and 72 transgenic plants were propagated using grafting techniques and

transferred to the greenhouse.

GFP expression at the mature stage of the transgenic plants

At the mature plants stage, the fluorescence intensity varied among different parts

of the plant, being higher in new growing leaves than in old ones (Figure 4-3 and 4-4).

That could be due to lower metabolic activity and chlorophyll accumulation that partially

masked the green fluorescence provided by the GFP in old tissue. Haseloff et al. (1997)

reported that they could consistently regenerate intensely fluorescent Arabidopsis plants

when GFP was targeted to the ER. They also reported difficulty in regenerating plants

from the brightest nontargeted transformants. Both results are similar to our observations

in citrus. Other than the differences discussed above, developmental and regeneration

responses appeared similar between transgenic and non-transgenic plants.











































Figure 4-3. ER targeting of GFP expression in a mature citrus leaf. New growing leaf
from a transgenic plant obtained from pAO3 were scanned using confocal
laser scanner with setting for three different fluorescent wavelengths, green,
red, and blue, simultaneously with a 488, 543, and 633 nm excitation filter
and a 500-543, 610-630, and 675-750 tunable spectral window, respectively.
(A) green, (B) red, (C) blue, and (D) overlay of three filters together.










































Figure 4-4. ER targeting of GFP expression in a mature citrus leaf. Old growing leaf
from a transgenic plant obtained from pAO3 were scanned using confocal
laser scanner with setting for three different fluorescent wavelengths, green,
red, and blue, at the same time with a 488, 543, and 633 nm excitation filter
and a 500-543, 610-630, and 675-750 tunable spectral window, respectively.
(A) green, (B) red, (C) blue, and (D) overlay of three filters together.









Molecular Analysis

Polymerase chain reaction for selection of transformants

When putative transgenic scions grafted on Carrizo citrange seedlings had

developed several leaves, a leaf was removed from each plant, excited with blue light to

confirm GFP expression. PCR was used initially to screen regenerated 'Hamlin' sweet

orange plant obtained via transformation. PCR analysis was performed using DNA from

leaves of regenerated plants, both transgenic and non-transgenic. To confirm the presence

of the GFP gene and the cDNA of the Xa21 gene in the transgenic plant genome,

multiple PCR experiments were performed using two different pairs of primers for GFP

and Xa21 simultaneously. A predicted internal fragment of about 780 nucleotides was

amplified in all DNA samples from green fluorescent leaves (Figure 4-5). No

amplification was detected in DNA samples from non-transgenic regenerated control

plants, which emitted red fluorescence under blue light. A predicted internal fragment of

about 1400 nucleotides was amplified in 100% of the DNA samples from green

fluorescent leaves, which corresponds to Xa21 (Figure 4-5). This is compared with

protoplast/GFP co-transformation system in which just 35% of the DNA samples from

green fluorescent leaves had the corresponded band to the cDNA of the Xa21 gene. Thus,

these results indicated that the final transformation efficiency for protoplast/GFP

transformation is higher than for co-transformation.

Screening for transformants using southern blot analysis

When the grafted plants measured 20-30 cm in height, southern analysis was

performed to confirm the stable integration of the cDNA of Xa21 coding sequence in the

transgenic plants genome and provide some information related to their integration

pattern. Five chosen putative transgenic lines (grown in the greenhouse for more than









12 months), which were PCR positive for GFP and Xa21, were analyzed. Genomic DNA

was digested with SphI a unique restriction site within the 5' end of the integrated

sequence of the cDNA of the Xa21, and ApaLI that does not cut in Xa21. Therefore,

bands hybridizing to the probe result from one site within the vector and one site within

the flanking genomic DNA. Hybridization patterns with 1-3 bands/copy numbers were

observed (Figure 4-6). In general, the direct-gene-mediated method results in more

multiple insertions and rearranged fragments in transgenic plants than Agrobacterium-

mediated transformation (Dong et al., 1996; Krasnyanski et al., 1999), and that was the

case for this study on citrus. Even though different hybridization patterns were observed,

the results of southern blot analysis provided molecular evidence confirming the presence

of the introduced cDNA of the Xa21 gene in the 'Hamlin' sweet orange genome. Many

researchers reported that transgenic plants with multiple copies of the integrated DNA

into one or more chromosomal location have been shown to be more likely to exhibit

transgene silencing (Iyer et al., 2000; James et al., 2002) by affecting the level and

stability of gene expression. However in a recent study, Craig et al. (2005) reported that

there is no correlation between the number of gene insertions and gene expression level,

suggesting that multiple insertions may have little or no effect on transgene expression.

Confirmation of transformation using western blot analysis

Leaf tissue from transgenic plants was used to obtain crude protein extracts for

Western analyses. The extracted proteins (35 [tg per lane) were separated by SDS/PAGE

on 5% stacking and 6.5% separation gels and transferred to Immobilon-PVDF

membranes for immunostaining. The western blots were developed with anti-c-myc as

the primary antibody followed by anti-mice immunoglobulin G (IgG) antibody









conjugated with horseradish peroxidase as a secondary antibody as described previously.

Detection of immune complexes was achieved by enhanced chemiluminescence

according to ECL Plus Western Blotting Detection Kit. Finally, to verify that the gene

was integrated and expressed into the transgenic plants, expression of Xa21 was detected

on the membrane. In this assay, a protein product of 120 kDa corresponding to the

expressed Xa21 was seen in seven out of eight tested transgenic plants (Figure 4-7). In

this assay, soluble extracts of the transgenic rice expressing the wild-type Xa21 gene and

non-transgenic rice were used as positive and negative controls. As shown in Figure

(4-7), a non-specific band appeared in all the samples which is larger than the Xa21

corresponding band. One transgenic plant was PCR and southern analyses positive, but

did not have the corresponded band for the Xa21 protein. The most likely explanation for

this phenomenon, even though the DNA has been transferred and integrated into the plant

genome, it was not transcribed or expressed. As shown, all but one Southern-positive

plant transformed with cDNA of the Xa2] expressed Xa21 protein at detectable levels.

According to the literature, this is the first time that a gene from rice has been stably

integrated and expressed in citrus plants. After more than 12 months growing in the

greenhouse, all transgenic plants showed a normal phenotype, identical to that of control

non-transformed 'Hamlin' orange plants.































Figure 4-5. Multiple PCR analysis to detect the presence of the GFP (0.8 kb) and the
cDNA of the Xa21 (1.4 kb) genes in transgenic citrus plants. Lane 11 is a
positive control for both genes (pAO3 plasmid). Products are seen in lanes 2-9
indicate the presence of GFP gene and the cDNA of the Xa21 gene in the
transgenic plants. Lane 1 is a non-transgenic control, and lane 10 is negative
control (H20), MM = 1 kb DNA ladder.


2 3 4


a-


*


-w~: ~.I


S MOON"


,, I


- MNIN I


Figure 4-6. Southern hybridization analysis of 'Hamlin' sweet orange plants with the
cDNA of the Xa21 gene. The probe was a 1641-bp NcoI855 -- Ncoi2496
fragment of the cDNA of the Xa21 gene isolated from plasmid pAO3. Lanes
1-6 Genomic DNAs were digested with SphI and ApaLI. Lanes 1-5 transgenic
plants and lane 6 non-transgenic plant.








1 2 3 4 5 6 7 8 9 10 11 12


"n u n IR a:R I-n









Figure 4-7. Western blotting analysis of transgenic 'Hamlin' sweet orange. The extracted
proteins (35 pg per lane) were separated by SDS/PAGE on 5% stacking and
6.5% separation gels and transferred to polyvinylidene difluoride membranes
for immunostaining. Soluble extracts transgenic rice expressing the wild-type
Xa21 gene (lane 11), non-transgenic rice (lane 12), non-transgenic citrus
(lane 2), transgenic citrus positive for GFP and Xa21 genes by PCR and
Southern (lanes 3-10) were subjected to western blotting. Molecular markers
indicated in lane 1. The western blots were developed with anti-c-Myc as
primary antibody and c-Myc: Anti-mice IgG as a secondary antibody as
described in the material and methods.














CHAPTER 5
ESTIMATING THE COPY NUMBER OF TRANSGENES IN TRANSFORMED
CITRUS PLANTS BY QUANTITATIVE REAL-TIME PCR

Introduction

Genetic transformation has become a widespread tool in both basic research and

commercial plant breeding programs. Its application requires that transgenes be stably

integrated and expressed in the plant genome. During the last decade, the area under

cultivation with transgenic crops has increased worldwide from 1.7 million hectares in

1996 to 81 million hectares in 2004 (Figure 5-1), and were grown mostly in the U.S.

(47.6 million ha), Argentina (16.2 million ha), Canada (5.4 million ha), Brazil

(5.0 million ha), China (3.7 million ha) and Paraguay (1.2 million ha) (James, 2004).

When new transgenic plants are developed, two early and essential questions are

which plants contain the transgene and in how many copies. Thus, transgenic plants must

be characterized at the molecular level because the new DNA is randomly inserted into

the plant genome. While multiple copies of the transgene are useful for over-expression

experiments, transformants that carry multiple copies of the integrated DNA into one or

more chromosomal locations have been shown to be more likely to exhibit transgene

silencing (Iyer et al., 2000; James et al., 2002), by affecting the level and stability of gene

expression. However, in recent study Craig et al. (2005) reported that there is no

correlation between the number of gene insertions and gene expression level, suggesting

that multiple insertions may have little or no effect on transgene expression. Thus,

estimating transgene copy number is critical to the selection and cultivation of the









transgenic plants. Most of the transgenic plants obtained via direct DNA delivery

methods such as particle bombardment, electroporation, PEG, etc., may consist of

complex patterns of transgene integration, i.e., multiple copies and/or partial insertion of

the integrated DNA (Dong et al., 1996; Kohli et al., 1998; Krasnyanski et al., 1999;

Srivastava et al., 1999). Less than 20% of the transgenic events generated using direct

DNA delivery display low-copy integration (three copies or less) (Song et al., 2002). To

date, there is no transformation method that can completely control the number of

transgene integration into the plant genome. Therefore, transgenic events should be

screened as early in the transformation process as possible to identify multiple copy

transformants, allowing for continued focus on low copy number transformants. Such

screening can be very difficult to handle, especially when the number of independent

transformed events is sufficiently large.

Southern blot analysis, in which a blot of digested genomic plant DNA is

hybridized with a labeled DNA probe corresponding to the transgene to produce an

instructive band pattern, has been used to estimate transgene copy number. This method

has become a routine procedure in many labs around the world because of its highly

reliable results under the optimum condition. However, it is quite costly in terms of

reagents, labor, and time, and also requires a considerable amount of DNA from fresh or

frozen material. Furthermore, Southern blot analysis may not be accurate enough to

determine a copy number greater than two (Honda et al., 2002), although multiple

integration are often found with transgenic plants (Dong et al., 1996; Kohli et al., 1998;

Krasnyanski et al., 1999; Srivastava et al., 1999). Some other methods could be used for

the same purpose including comparative genomic hybridization (Larramendy et al.,










1998), fluorescence in situ hybridization (Kallioniemi et al., 1996), multiplex

amplification probe hybridization (Armour et al., 2000) and microarray (Li et al., 2002).

Unfortunately, all of those methods share the same limitations as southern blot analysis.


GLOBAL AREA OF BIOTECH CROPS
Million Hectares (1996 to 2004)

SO 17 Biotech Crop Countries Total
Industrial Countries
70- Developing Countries


60 -

50. .1

40-

30


20


10-



1995 1996 1997 1998 1999 2000 2001 2002 2003 2004
Increase of 2'.. 13.3 trillion hectares or 32.9 rnllhorn acres between 2-Y.) and 2004.
Source: Clie James, 2004

Figure 5-1. Global area ofbiotech crops (James, 2004).

The polymerase chain reaction (PCR) is one of the most sensitive techniques for

detecting the integrated gene in the transgenic plant genome, and thus it can reduce the

amount of DNA required for analysis (Wong and Medrano, 2005). Advances in PCR

instrumentation and fluorescence chemistry have made the precise quantification of

specific amplification products possible without the need for post-PCR analyses. In

contrast to conventional PCR where only the amount of end product is determined









(Freeman et al., 1999), real-time PCR allows researchers to track the changes of PCR

product during the reaction. Quantitative real-time PCR technology relies on the ability to

progressively monitor fluorescence emitted from nonspecific double-stranded DNA

binding dyes (SYPR Green I) or fluorophore-labeled specific probes (TaqMan) that

hybridize with target sequences during the exponential phase of the PCR reaction. The

probe is labeled at the 5' end with a fluorescent molecule and at the 3' end with a

quencher molecule. In an intact probe, the 5' and 3' labels are in close proximity, and the

quencher silences the fluorescent signal that would otherwise be generated by the 5'

fluorescent label (Livak et al., 1995). In the TaqMan assay, the degradation of target-

specific probe molecules by the 5'-3' exonuclease activity of the Taq DNA polymerase

liberates the fluorescent label, which subsequently produces a fluorescent signal during

each cycle of the amplification. For a high fluorescent signal, the probe must bind tightly

to the template, enabling Taq polymerase to cleave nucleotides from the 5' end of the

probe (Bubner and Baldwin, 2004). This fluorescent signal is proportional to the

accumulation of PCR product generated which is proportional to the quantity of initial

DNA template in the sample (Livak et al., 1995). Fluorescence levels are detected during

each cycle of amplification by specialized instrumentation. During the early cycles of

amplification, the fluorescence level is low, but at a critical point fluorescence

accumulates to a significant level perceived by the instrument's detection system. This

point, which is called the threshold cycle (Ct) depends primarily on the starting amount

of nucleic acid (Heid et al., 1996). The higher the initial amount of nucleic acid in the

reaction, the smaller the Ct values. In practice, there is a linear relationship between the

log of the starting quantity of the template and its Ct value during real-time PCR reaction.









Accordingly, the Ct is defined as the cycle at which the reaction's fluorescence reaches

the threshold line. Quantitative real-time PCR (qTR-PCR) techniques have been reported

for determining transgene copy number in transformed plants (Ingham et al., 2001;

Mason et al., 2002; Song et al., 2002; Yang et al., 2005).

To date, the use of qRT-PCR for estimating transgene copy number in citrus has

not yet been investigated. In this chapter, we will describe a quantitative RT-PCR assay

for fast and accurate estimation of exogenous Xa21 gene copy numbers in transgenic

citrus by comparison with the citrus endogenous reference gene coding for Lipid Transfer

Protein (LTP) (Wu and Burns, 2003). We used quantitative multiplex TaqMan assay, in

which two TaqMan probes were simultaneously used within the same reaction to identify

the copy number of the transgene. One TaqMan probe was designed to identify the

transgene (Xa21) while the other identified an endogenous reference gene (LTP). We

have chosen the citrus lipid transfer protein (LTP) gene (Wu and Burns, 2003), a known

two-copy gene, as a reference gene. For the purpose of choosing a gene to use as an

endogenous control in a comparative Ct multiplexed PCR reactions, any gene, regardless

of how many homologous sequences may exist in the genome, may successfully be used

(Schmidt and Parrott, 2001). Since the proportion of the reference endogenous gene

remains constant relative to the total genomic DNA, it was possible to normalize

differences in the amount of DNA in each reaction. Moreover, real-time PCR results can

be subjected to statistical analysis.

Materials and Methods

Transgenic Plants

Plasmid pXa21-mtag and pAO3 containing cDNA of the Xa21 gene under the

control of 35S CaMV promoter (described previously in chapters 3 and 4, respectively)