<%BANNER%>

Effects of Polyunsaturated Fatty Acids and Bovine Somatotropin on Endocrine Function, Embryo Development, and Uterine-Co...


PAGE 1

EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE SOMATOTROPIN ON ENDOCRINE FUNC TION, EMBRYO DEVELOPMENT, AND UTERINE-CONCEPTUS INTERA CTIONS IN DAIRY CATTLE By TODD RUSSELL BILBY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Todd R. Bilby

PAGE 3

To my parents, Ross and Cheryl Bilby, for their endless support

PAGE 4

iv ACKNOWLEDGMENTS I am deeply indebted to Dr. William W. Th atcher, my supervisory committee chair. Dr. Thatcher provided endless guidance, en couragement, inspiration, and financial support. Dr. Thatcher provided me with the skil ls to be successful and instilled in me a passion for knowledge. I am proud of the opport unity I had to work with him and will always consider Dr. Thatcher an excelle nt mentor and great friend. I extend my appreciation to my committee members: Dr. Peter J. Hansen, who allowed me to use his laboratory for my final project and provided en dless insight into my projects, curriculum, and overall professional development; Dr. Loke nga Badinga for his teaching in the area of nutritional physiology, and for always bei ng willing to answer any questions; and Dr. Nasser Chegini for the use of his laboratory and invaluable contributions. All committee members provided continual suppor t throughout my Ph.D. program. I greatly appreciate Dr. Charles Staples for his patience and guidance in working with me on my projects, editing papers and providing knowledge on dairy cattle nutrition. I would also like to thank Dr. Stapless gradua te students: Mr. Bruno Amaral for his help with my last research project a nd Mrs. Faith Cullens for her assistance at the Dairy Research Unit with my projects. I extend my appreciation to Mrs. MarieJoelle Thatcher for all her help with different hormone assays, statistics, excel spreadsheets, and for the excellent French cuisine.

PAGE 5

v I would like to express my gratitude to Mr. Jeremy Bl ock for being a great friend, colleague, and roommate. Jeremy was always willing and able to help me at any time during my projects at the DRU without complaint. I owe special thanks to all of the memb ers of the Thatcher Lab (Dr. Flavio Silvestre, Dr. Julian Bartolome, Dr. Metin Pancarci, Dr. Allessandr o Sozzi, Dr. Aydin Guzeloglu, Mr. Ocilom Sa Filho) for helping w ith all aspects of my projects, for their insightful discussions, and for the great camarad erie. I thank the laboratory technicians who worked in Dr. Thatchers laboratory (M r. Oscar Hernandez, Mr. Frank Michel and Ms. Idania Alverez) for teaching me various molecular biology techniques, and for their continuous technical support. I am very grateful to Dr. Shunichi Kamimura, Dr. Ana Meikle, Dr. Leslie MacLaren, Dr. Maarten Drost, Dr. Tom Jenkins, and Dr. Alan Ealy for their assistance and guidance with my research papers and projects. I would like to acknowledge me mbers of the Hansen Lab: Dr. Rocio Rivera, Mrs. Amber Brad, Mr. Jeremy Block, Mr. Dean Jous an, Mr. Moises Franc o, Ms. Maria Padua, Dr. Luiz de Castro e Paula, Ms. Barbara L oureiro, Dr. Katherine Hendricks, and Dr. Zvi Roth. I could always find someone in their la boratory to help me at any time, nights or weekends. They included me in many of thei r social functions. Words cannot express all the fun, friendship, and knowledge I gained through knowing each one of them. I express appreciation to Dr. Herbert Head, Mrs. J oyce Hayen, Dr. Marcio Liboni, and Dr. Tomas Belloso for their as sistance with my radioimmunoassays. I thank Mr. David Armstrong and Mrs. Mary Russell, and all the staff at the Dairy Research Unit for their safe care and handling of the cows for all of my projects. I am

PAGE 6

vi also very grateful to the facu lty, staff and students of the Animal Sciences department for creating a positive working environment, and for all their support, discussion, and friendship. I would like to extend special thanks to Ms. Myriam Lopez for her endless patience and continuous support. Ms. Lopez always made herself available to help with my research projects, no matter the time or da y. There are not enough words to express how thankful I am for her encouragement and meaningful friendship. Last but not least, I extend my utmost sincere apprecia tion to my parents, Ross and Cheryl Bilby. Their never-ending love and unconditional moral and financial support brought me where I am today. They have alwa ys encouraged my brother and me to look toward the future and experience life. Th rough them, I learned that hard work, a good personality, a sense of humor, and a strong e ducation will lead to success and happiness. For all of that and much more, I thank them. I would also like to thank my brother, Chad Bilby. His encouragement and excellent advice has proven true, time and time again. To all my family and friends in both the United States and now in other countries, I give heartfelt thanks.

PAGE 7

vii TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................xii LIST OF FIGURES...........................................................................................................xv LIST OF ABBREVIATIONS........................................................................................xviii ABSTRACT.....................................................................................................................xx i CHAPTER 1 INTRODUCTION........................................................................................................1 2 REVIEW OF LITERATURE.......................................................................................7 Reproductive Challenges of the High-Producing Dairy Cow......................................7 Transition Period and Energy Balance..................................................................7 Fertility..................................................................................................................9 Follicle and Estradiol...........................................................................................12 Corpus Luteum and Progesterone Production.....................................................14 Oocyte Competence and Early Embryo..............................................................16 Conceptus and Maternal Unit..............................................................................19 Fatty Acid Metabolism...............................................................................................22 Enzymes..............................................................................................................22 Biohydrogenation................................................................................................24 Fatty-Acid Intermediates.....................................................................................25 Effects of Supplemental Lipids on the High-Producing Dairy Cow..........................28 Transition Period and Energy Balance................................................................28 Fertility................................................................................................................32 Follicles and Estradiol.........................................................................................34 Corpus Luteum and Progesterone.......................................................................36 Oocyte and Early Embryo...................................................................................38 Conceptus and Maternal Unit..............................................................................41 Peroxisome Proliferator-Activated Receptors.....................................................44 Bovine Somatotropin and the Insu lin-Like Growth Factor System...........................46 Bovine Somatotropin...........................................................................................46 Structure, synthesis, and secretion...............................................................46 Receptor and ligand binding........................................................................50

PAGE 8

viii Second messengers.......................................................................................51 Insulin-like Growth Factor System.....................................................................52 Structure, synthesis, and secretion...............................................................52 Receptors and ligand binding.......................................................................54 Second messengers.......................................................................................56 Binding proteins...........................................................................................57 Effects on Lactation.............................................................................................58 Effects on Reproduction......................................................................................62 3 PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING DAIRY COWS: RESPONSES OF THE OVARIAN, CONCEPTUS AND IGF SYSTEMS..................................................................................................................70 Introduction.................................................................................................................70 Materials and Methods...............................................................................................72 Materials..............................................................................................................72 Animals and Experimental Design......................................................................73 Tissue Sample Collection....................................................................................74 Interferon-tau Antiviral Assay.............................................................................75 Ribonucleic Acid Isolation and Northern Blotting..............................................76 Analysis of Hormones in Plasma and ULF.........................................................76 Analysis of Uterine Luminal IGFBPs.................................................................77 Statistical Analyses..............................................................................................78 Results........................................................................................................................ .80 Pregnancy Rates, Conceptus Si zes, and Total Amount of IFNin ULF...........80 Ovarian Responses on Days 7, 16, and 17..........................................................80 Plasma and ULF Hormone Concentrations.........................................................81 Endometrial mRNA Expressi on of the GH/IGF-I System..................................82 Analysis of ULF for IGFBPs...............................................................................82 Simple and Partial Correlations for the GH-IGF System....................................82 Discussion...................................................................................................................83 Conclusions.................................................................................................................90 4 PREGNANCY, BOVINE SOMATOTR OPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAI RY COWS: I. OVARIAN, CONCEPTUS, AND GROWTH HORM ONEIGF SYSTEM RESPONSES......100 Introduction...............................................................................................................100 Materials and Methods.............................................................................................102 Materials............................................................................................................102 Animals and Experimental Diets.......................................................................103 Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment......105 Tissue Sample Collection..................................................................................106 Interferon-tau Antiviral Assay...........................................................................107 Quantitative Real-Time Reverse Transcription-PCR........................................107 Ribonucleic Acid Isolation and Northern Blotting............................................108 Analysis of Hormones in Plasma and Uterine Luminal Flushings....................109

PAGE 9

ix Analysis of Uterine Luminal IGFBP.................................................................110 Statistical Analyses............................................................................................111 Results.......................................................................................................................1 13 Weight, BCS, and Milk Pr oduction before the Start of Synchronization.........113 Ovarian and Uterine Responses befo re the Start of Synchronization...............114 Concentrations of Plasma and UL F Hormones before the Start of Synchronization.............................................................................................115 Milk Production after an Induced Ovulation.....................................................115 Ovarian Responses after an Induced Ovulation................................................116 Plasma and ULF Hormone Concentrati ons after an Induced Ovulation...........116 Ovarian and Uterine Responses at Day 17........................................................118 Pregnancy Rates, Conceptus Sizes, IFNmRNA and Protein, and ISG-17 Protein at Day 17...........................................................................................118 Endometrial mRNA Expression of the GH-IGF-I System at Day 17...............119 Analysis of ULF for IGFBP at Day 17..............................................................120 Simple and Partial Correlations for the GH-IGF System at Day 17.................120 Discussion.................................................................................................................121 Conclusions...............................................................................................................128 5 PREGNANCY, BOVINE SOMATOTR OPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: II. GENE EXPRESSION RELATED TO MAINTENANCE OF PREGNANCY............................................143 Introduction...............................................................................................................143 Materials and Methods.............................................................................................146 Materials............................................................................................................146 Animals and Experimental Diets.......................................................................146 Estrus Synchronization and Tissue Collection..................................................147 Ribonucleic Acid Isolation and Northern Blotting............................................149 Immunohistochemical Analyses........................................................................150 Microscopic Image Analysis.............................................................................151 Western Blotting for ER and PGHS-2 Proteins..............................................152 Radioimmunoasssay..........................................................................................153 Statistical Analyses............................................................................................153 Results.......................................................................................................................1 54 Endometrial PR Expression...............................................................................154 Endometrial ER Expression............................................................................155 Endometrial OTR Expression............................................................................156 Endometrial PGHS-2 Expression......................................................................156 Endometrial PGFS and PG ES mRNA Expression............................................157 Total Contents of PGF2 and PGE2 in ULF.......................................................157 Simple and Partial Correlations for the PG Cascade at Day 17........................157 Discussion.................................................................................................................158 Conclusions...............................................................................................................166

PAGE 10

x 6 PREGNANCY, BOVINE SOMATOTR OPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: III. FATTY ACID DISTRIBUTION......................................................................................................172 Introduction...............................................................................................................172 Materials and Methods.............................................................................................174 Animals and Experimental Diets.......................................................................174 Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment......175 Tissue Sample Collection..................................................................................176 Milk Fat Isolation and Analyses of Fatty Acid Composition............................177 Statistical Analyses............................................................................................178 Results.......................................................................................................................1 79 Long Chain Fatty Acid Composition among Tissues........................................179 Fatty Acid Composition in Endometrium at Day 17.........................................180 Fatty Acid Composition in Liver at Day 17......................................................181 Fatty Acid Composition in Mammary Tissue at Day 17...................................181 Fatty Acid Composition in Milk at Day 17.......................................................182 Fatty Acid Composition in Muscle at Day 17...................................................182 Fatty Acid Composition in Subcutan eous Adipose Tissue at Day 17...............182 Fatty Acid Composition in Internal Adipose Tissue at Day 17.........................183 Discussion.................................................................................................................183 Conclusions...............................................................................................................192 7 EFFECTS OF DIETS ENRICHED IN DIFFERENT FATTY ACIDS ON OOCYTE QUALITY AND FOLLICULAR DEVELOPMENT IN LACTATING DAIRY COWS IN SUMMER..................................................................................204 Introduction...............................................................................................................204 Materials and Methods.............................................................................................206 Materials............................................................................................................206 Animals and Experimental Diets.......................................................................207 Synchronization for OPU and TAI....................................................................209 Blood and Temperature Sampling.....................................................................210 Ultrasonography and OPU Procedure...............................................................211 In Vitro Production of Embryos fr om Oocytes Collected by OPU...................212 In Vitro Production of Embryos from Ovaries Collected from an Abattoir......214 Group II Caspase Activity.................................................................................214 The TUNEL Assay, Assessment of Tota l Cell Number, and Progression to Metaphase II...................................................................................................215 Statistical Analyses............................................................................................216 Results.......................................................................................................................2 17 Dry Matter Intake, Body We ight, and Milk Yield............................................217 Follicle and Oocyte Responses to Different Diets............................................218 Follicle and Oocyte Responses to Diffe rent Days of the Estrous Cycle...........219 Oocyte Quality for the 5th OPU session............................................................219 Internal IVF Control from Slaughterhouse Ovaries..........................................220 Progesterone, Ovarian, and Pregnancy Responses............................................220

PAGE 11

xi Discussion.................................................................................................................221 Conclusions...............................................................................................................229 8 GENERAL DISCUSSION AND CONCLUSIONS................................................240 LIST OF REFERENCES.................................................................................................254 BIOGRAPHICAL SKETCH...........................................................................................298

PAGE 12

xii LIST OF TABLES Table page 3-1 Least squares means and pooled SE for conceptus length, IFN(g/total uterine luminal flushing), number of corpora lutea (CL), CL tissue volume (mm3), and CL weight (g) on d 17 after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P) cows inject ed with bST (+/-) on d 0 and 11...........................92 3-2 Least squares means and pooled SE for uterine endometrial mRNA, uterine luminal flushings (ULF) protein expre ssion, and hormone concentration at d 17 after a synchronized estrus (d 0) in n onlactating cyclic (C) and pregnant (P) dairy cows injected with bST (+/-) on d 0 and 11....................................................99 4-1 Ingredient and chemical composition of diets containing 0 or 1.9% calcium salts of fish oil enriched lipid product (FO)...................................................................129 4-2 Bovine IFNprimers and probe sequences us ed for quantitative real-time reverse transcription-PCR......................................................................................131 4-3 Least squares means and pooled SE fo r conceptus size, interferon tau (IFN) mRNA (mean fold effect), IFN(g/total uterine luminal flushing [ULF]), IFN stimulated gene-17 (ISG-17) protein, nu mber of corpora lutea (CL), CL tissue volume (mm3), CL weight (g), uterine endometrial mRNA, ULF protein expression, and hormone concentration at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a contro l diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enrich ed lipid (FO) diet an d injected with or without bST on d 0 and d 11..................................................................................141 5-1 Least squares means and pooled SE fo r uterine endometrial mRNA and protein, and uterine luminal flushings (ULF) protein expression at d 17 after a synchronized estrus (d 0) in lactating cycl ic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic co ws fed a fish oil enriched lipid (FO) diet and injected with or wit hout bST on d 0 and 11 (n = 28)...............................168 5-2 Least squares means and pooled standard error (SE) for uterine endometrial protein expression responses at d 17 after an induced ovulation (d 0) in lactating dairy cows injected with or without bST on d 0 and 11.........................................169 5-3 Statistical analyses of uterine endom etrial protein expres sion for Table 5-2.........170

PAGE 13

xiii 6-1 Least squares means and pooled SE of the endometrium fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11............................................................................................................................1 94 6-2 Least squares means and pooled SE fo r different fatty acid percentages in endometrium and liver tissue at d 17 af ter a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control di et, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11.....................................................................................195 6-3 Least squares means and pooled SE of th e liver fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cy clic (C) cows fed a control diet, pregnant (P) co ws fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11.............196 6-4 Least squares means and pooled SE for the mammary tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11............................................................................................................................1 97 6-5 Least squares means and pooled SE fo r different fatty acid percentages in mammary tissue and milk fat at d 17 af ter a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control di et, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11.....................................................................................198 6-6 Least squares means and pooled SE for th e milk fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cy clic (C) cows fed a control diet, pregnant (P) co ws fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11.............199 6-7 Least squares means and pooled SE for the muscle fatty acid profile (% total fatty acids) at d 17 after a synchronized estr us (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control di et, and cyclic cows fed a fish oil enriched lipid (FO) diet and in jected with or without bST on d 0 and 11.200 6-8 Least squares means and pooled SE fo r different fatty acid percentages in muscle, subcutaneous adipose, and in ternal adipose tissue at d 17 after a synchronized estrus (d 0) in lactating cycl ic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic co ws fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11.............................................201

PAGE 14

xiv 6-9 Least squares means and pooled SE for subcutaneous adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and inject ed with or without bST on d 0 and 11..................................................................................................202 6-10 Least squares means and pooled SE for inte rnal adipose tissue fatty acid profile (% total fatty acids) at d 17 af ter a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P ) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected w ith or without bST on d 0 and 11...............................................................................................................203 7-1 The percent of fatty acids from the total fatty acids in the supplemental fat sources....................................................................................................................231 7-2 Body temperature, and follicular and oocyte responses of lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13)...............................................................233 7-3 Follicular and embryonic responses of lactating multiparous and primiparous cows fed diets enriched in either C18: 1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13) and transvag inaly aspirated on d 3, 6, 9 and 12 of a synchronized estrous cycle.....................................................................................234 7-4 Oocyte quality responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14) C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13).........................................................................................................235 7-5 Follicle, corpus luteum (CL) and pregnancy responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) a nd C18:3 (n =13) and transvaginally aspirated.................................................................................................................239

PAGE 15

xv LIST OF FIGURES Figure page 2-1 Pathway of desaturation and elonga tion of linoleic and linolenic acids sequentially acted upon by -6 desaturase, elongase, and -5 desaturase enzymes....................................................................................................................69 3-1 Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography.......................................................................91 3-2 Profiles of plasma progesterone c oncentrations of cyclic (C) cows ( ) and pregnant (P) cows ( ) from d 0 to 17 of a synchronized estrous cycle (* P < 0.05; aP < 0.10)..................................................................................................................93 3-3 Profiles of plasma growth hormone (GH) concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchronized estrous cycle..............94 3-4 Profiles of plasma IGF -I concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchronized estrous cycle.........................................95 3-5 Profiles of plasma insulin concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchronized estrous cycle.........................................96 3-6 Representative Northern blots of IG F-I, IGF-II, IGFBP-2 and IGFBP-3 mRNA...97 3-7 Representative Ligand Blot detected IGFBP-3, IGFBP-4 and IGFBP-5 in the uterine luminal flushings (ULF) of co ws on d 17 after a synchronized estrus (d0)........................................................................................................................... 98 4-1 Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography.....................................................................130 4-2 Regression analysis (third order cu rves) of daily milk production starting 10 DIM until the start of bST treatment and timed AI for cows fed either 0 (Least squares means: ) or 1.9% (Least squares means: ) calcium salt of fish oil enriched lipid diets.................................................................................................132 4-3 Linear regression of plasma insulin con centrations for cows fed fish oil enriched lipid (FO) at 0 (Least squares means: ) or 1.9% (Least squares means: ) of dietary DM from 14 to 53 DIM..............................................................................133

PAGE 16

xvi 4-4 Overall pooled linear regression e quations of GH (Least squares means: ) and IGF-I (Least squares means: ) plasma concentrations from 14 to 53 DIM for all cows fed either 0 or 1.9% calcium salt of fish oil enri ched lipid diets.............134 4-5 Regression analysis (second order curves ) of daily milk production from d 0 to 17 of a synchronized estrous cycle (d 0) for cyclic and pregnant cows fed the control diet and injected w ith bST (Least squares means: ) or not (Least squares means: ) on d 0 and 11...........................................................................135 4-6 Concentrations of plasma progesterone of cyclic cows injected or not injected bST (n = 11) ( ) and pregnant cows injected or not injected with bST (n = 10) ( ), measured from d 0 to 17 of a sync hronized estrous cycle differed (P < 0.05) between d 0 and 11.................................................................................................136 4-7 Concentrations of plasma progesterone of cyclic and pregnant cows not given bST (n = 10) ( ) and those given bST (n = 11) ( ) collected from d 0 to 17 of a synchronized estrous cycle differed ( P < 0.05)......................................................137 4-8 Profiles of plasma GH concentrations of cyclic cows fed control diet (no bST) ( ), cyclic cows fed control diet with bST injections ( ), cyclic cows fed FO (-x-), cyclic cows fed FO with bST in jections (-o-), pregnant cows fed control diet (no bST) ( ), and pregnant cows fed control diet with bST injections ( ) from d 0 to 17 of a synchronized estrous cycle.............................138 4-9 Profiles of plasma IGF-I concentrations of cyclic cows fed c ontrol diet (no bST) ( ), cyclic cows fed control diet with bST injections ( ), cyclic cows fed FO (-x-), cyclic cows fed FO with bST injections (-o-), pregnant cows fed control diet (no bST) ( ), and pregnant cows fed control diet with bST injections ( ) from d 0 to 17 of a synchronized estrous cycle.............................139 4-10 Plasma insulin concentrations of cyclic cows fed a control diet (C), cyclic cows fed the fish oil enriched diet (FO), and pregnant cows fed th e control diet (P) from d 0 to 17 of a synchronized estrous cycle......................................................140 4-11 Representative autoradiograph from li gand blot analysis of uterine luminal IGFBP at d 17 following an induced ovulation......................................................142 5-1 Expression of PR (A, B, C), ER (D, E, F), and PGHS-2 (G, H, I) in bovine endometrium at d 17 following an induced ovulation............................................171 7-1 Experimental protocol illustrating the days in m ilk (DIM) for synchronization injections, ultrasonography, ovum pickup, and timed artificial insemination (TAI; d 0)...............................................................................................................232 7-2 Percent of cleaved embryos at either th e 2 to 3, 4 to 7 or > 8 cell stage on d 3 following insemination of either Holstein (n = 115) or Non-Holstein (n = 112) oocytes collected from slaughterhouse ova ries with semen from Angus bulls......236

PAGE 17

xvii 7-3 Percent of embryos on d 8 following insemination based on stage of development as affected by oocyte genotype.........................................................237 7-4 Plasma progesterone concentration (n g/mL) and corpus luteum (CL) volume (mm3) collected on d 3, 6, 9, 12, and 16 of a synchronized estrous cycle from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C1 8:2 (n=13) and C18:3 (n =13).......................238 8-1 Plasma GH (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)..................................................248 8-2 Plasma IGF-I (ng/mL) of pregnant co ws that were nonlactating or lactating. Cows received injections of bST (+/; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)......................................249 8-3 Plasma insulin (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)......................................250 8-4 Model diagram representing the effect s of bST on genes and proteins of the prostaglandin cascade in the endometrial ce ll of pregnant lact ating dairy cows...251 8-5 Model diagram representing the effects of pregnancy on genes and proteins of the prostaglandin cascade in the endometria l cell of lactating dairy cows............252 8-6 Model diagram representing the effects of an enriched fish oil diet on genes and proteins of the prostaglandin cascade in the endometrial cell of lactating cyclic dairy cows..............................................................................................................253

PAGE 18

xviii LIST OF ABBREVIATIONS AA Arachidonic acid AI Artificial insemination BCS Body condition score bST Recombinant bovine somatotropin C Cyclic cows CT Comparative threshold cycle CL Corpus luteum CLA Conjugated linoleic acid COC Cumulus oocyte complexes DGE Deep glandular epithelium DHA Docosahexaenoic acid DIM Days in milk DIX Desaturase index DMI Dry matter intake DS Deep stroma EPA Eicosapentaenoic acid ER Estradiol receptor FO Fish oil enriched lipid FSH Follicle simulating hormone GH Growth hormone

PAGE 19

xix GHR Growth hormone receptor GHRH Growth hormone-releasing hormone GnRH Gonadotropin releasing hormone IFNInterferonIGF Insulin-like growth factor IGFBP Insulin-like growth factor binding protein IRS-1 Insulin receptor substrate-1 JAK2 Janus kinase 2 KSOM Potassium simplex optimized medium LCFA Long chain fatty acid LE Luminal epithelium LH Luteinizing hormone MUFA Monounsaturated fatty acid OCM Oocyte collection medium OMM Oocyte maturation medium OPU Ovum pick-up OTR Oxytocin receptor P Pregnant cows PG Prostaglandin PGES Prostaglandin E synthase PGFM 13, 14-dihydro-15-keto-PGF2 metabolite PGF2 Prostaglandin F2 alpha PGFS Prostaglandin F synthase

PAGE 20

xx PGHS-2 Prostaglandin H synthase-2 PPAR Peroxisome proliferator-activated receptors PR Progesterone receptor PUFA Polyunsaturated fatty acid PVP Polyvinylpyrrolidone SFA Saturated fatty acid SGE Superficial gl andular epithelium SS Superficial stroma STAT Signal transducer and activator of transcription TALP Tyrodes albumi n lactate pyruvate TAI Timed artificial insemination TUNEL Terminal deoxynucleotidyl transfer ase-mediated dUTP nick end labeling ULF Uterine luminal flushings UFA Unsaturated fatty acid

PAGE 21

xxi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE SOMATOTROPIN ON ENDOCRINE FUNC TION, EMBRYO DEVELOPMENT, AND UTERINE-CONCEPTUS INTERA CTIONS IN DAIRY CATTLE By Todd R. Bilby December 2005 Chair: William W. Thatcher Major Department: Animal Sciences A series of experiments were conducted to investigate mechanisms through which polyunsaturated fatty acids (PUFA) and bovine somatotropin (bST) increase fertility. The first study used nonlactating dairy co ws to examine the effects of bST on components of the insulin-like growth fact or (IGF) system. Exogenous bST decreased pregnancy rates. However, con ceptus length and in terferon-tau (IFN) in uterine flushings were increased. The bST may have hyper-stimulated IGF-I and insulin concentrations, causing detrimental effects on conceptus viability. The second experiment used the same es trous synchronization protocol and bST treatment as the first study; however, lactating dairy cows were used and effects of a diet supplemented with a fish o il enriched lipid (FO) were evaluated. Exogenous bST increased pregnancy rates, conceptus size, and IFNin uterine flushings. The FO altered uterine gene expression, prot eins, and plasma hormones in a manner that mimicked pregnancy. Furthermore, FO reduced the n6:n-3 ratio and increas ed conjugated linoleic

PAGE 22

xxii acid (CLA) concentrations in milk. Pregnanc y altered endometrial expression of certain antiluteolytic associated genes and fatty acid composition, whic h may attenuate the luteolytic pulsatile secretion of prostaglandin F2 alpha (PGF2 ) contributing to embryo survival. In the last experiment, diet s enriched in different omega fatty acids altered oocyte quality and follicular dynamics in lactating da iry cows. The C18:2 enriched diet reduced oocyte quality, as indicated by reduced in vi tro embryo development, versus a C18:1 cis enriched diet. Previously documented be nefits of PUFA on reproductive responses reflect actions at alternativ e biological windows other than oocytes from follicles < 12 mm. Possible beneficial effects of PUFA on the periovulatory follicle and corpus luteum (CL) were evident by the incr ease in dominant follicle size and CL volume due to feeding PUFA. In summary, bST had differential respons es on fertility which were dependent on lactational status. The bST appears to in crease pregnancy thru increased conceptus length and subsequent IFNproduction in lactating dairy cows and by altering IGF gene expression in uterine endometrium. The FO altered endometrial responses and fatty acid distribution which may benefit pregnancy. Diets enriched in particular fatty acids may have different effects on oocyte quality and fo llicular dynamics in l actating dairy cows.

PAGE 23

1 CHAPTER 1 INTRODUCTION Over the past decade commercial dairy farms have changed dramatically. The amount of milk produced per cow, larger he rd sizes, genetic selection, and improved management and nutrition are just some of these changes. A shift toward more productive, large-scale farms has been asso ciated with a decline in reproductive efficiency. Beam and Butler (1999) reported that conception rates have declined from 66% in 1951 to approximatel y 40% in 1999. During this same period, yearly milk production per cow increased 218% (National Agricultural Statistic s Service, USDA). However, Butler and Smith, (1989) indicated no negative genetic trend on fertility because conception rates afte r artificial insemination (A I) in nonlactating heifers remained constant (between 70 and 80%) dur ing this same time period. In addition, Lopez-Gatius et al. (2005) indicated th at high individual milk production can be positively related to high fertility. In contrast other studies indicate that there is clearly an antagonistic relati onship between milk production a nd reproduction in dairy cattle (Dematawewa and Berger, 1998; Hansen, 2000). The important determinant of dairy farm profitability is the amount of milk produced and sold. Earlier studies reported th at to increase farm profitability, calving intervals need to be between 12 to 13.5 mont hs to increase the amount of time cows spend in peak milk production (Louca a nd Legates, 1968; Holmann et al., 1984). However, in recent years, reports recomm end extending calving intervals to 14 to 15 months (Arbel et al., 2001; Roenfeldt, 1996) The logic underlying this recommendation

PAGE 24

2 is that there is less need to initiate anot her lactation in a cow if she is producing at relatively high levels in the la tter days of lactation. The in creased calving interval may depend on variables such as increased m ilk production, milk prices, parity, and replacement heifer prices. Cows with great er milk production have a better chance of staying in the herd longer compared with cows in lower milk production which would ultimately increase the calving interval. In order for a dairy farm to achieve a calving interval of 14 months, cows need to beco me pregnant within th e first 140 days of lactation. Presently pregnancy and parturit ion are still the only means of inducing copious secretion and production of milk. Ther efore strategies to increase reproduction would prove beneficial for farm profitability. Most reproductive inefficiency on dairy fa rms is due to a high rate of embryonic mortality, particularly early embryonic loss es. Early embryonic loss, as defined by Santos et al. (2004a), is the loss of a pr egnancy before d 24 after fertilization. Fertilization rate is approximately 76% but pr egnancy rate falls to approximately 40% at 30 d after AI. Thurmond et al. (1990) estima ted that dairy farms, on average, lose $640 for each pregnancy lost. Decreasing the high amount of early embryonic loss would increase both reproductive performance and total milk production, and thus improve the economic success or profitability of dairy farms. A critical point with in the time period constituting early embryonic loss is when the elongating conceptus interacts with the ma ternal unit to sustain the CL, thereby maintaining pregnancy. Between d 15 to 17 af ter estrus, the conceptus produces maximal amounts of IFNwhich leads to the inhibiti on of episodic pulses of PGF2 (Thatcher et al., 2001). The PGF2 causes CL regression, which induc es a return to estrus in

PAGE 25

3 nonpregnant cows or terminates the pregnanc y with a loss of the embryo. Therefore, some of the embryonic losses in cattle are t hought to be mediated by the inability of the conceptus to suppress the lu teolytic cascade during the pe riod of CL maintenance (Thatcher et al., 1986). One poten tial reason for the inability of the conceptus to suppress PGF2 is due to reduced development and gr owth of the embryo/conceptus thereby reducing the amount of IFNavailable to prevent luteolysis. Elongation of the embryo is associated with increased secretion of IFN(Hansen et al., 1988). Therefore stimulation in conceptus le ngth, (thereby increasing IFN) may reduce the amount of embryonic loss. An alternative way to reduce embryonic loss would be through regulation of endometrial tissu e to attenuate mechanisms involved in the biosynthesis of PGF2 This later strategy, coupled with IFNproduced from an underdeveloped conceptus, may provide a strong enough signa l to overcome luteolysis and enhance embryo survival. Two strategic approaches may be used to decrease early embryonic loss (without compromising milk production) and to increas e milk production. The first strategy is to use bST. The recombinant bST is produ ced through fermentation technology and is coupled with a slow release formulation, al lowing bST to be injected biweekly to increase milk production. The administrati on of bST to dairy cows is now an accepted and widely used management practice (Bauma n, 1999). However, in earlier studies, bST administration was shown to have negative effects on reproductive performance (Cole et al., 1991; Downer et al., 1993). One of the ma in negative effects of bST is a reduction in estrus behavior that contributes to poor repr oductive efficiency due to decreased rates of heat detection. With the adve nt of timed artificial insemi nation (TAI) programs such as

PAGE 26

4 Ovsynch, the need for estrus detection was elim inated. Several studie s indicated that bST given at or around TAI increased pregnancy rates (Moreira et al ., 2000b and 2001; Santos et al., 2004b; Morales-Roura et al., 2001). In addition, Moreira et al. (2002a and 2002b) reported that bST increased embryonic deve lopment when measured at d 7 after fertilization utilizing an in vitro as well as in vivo model with the use of lactating dairy cows. Furthermore, bST reduced endometrial PGF2 secretion in vitro (Badinga et al., 2002). However the mechanisms by which bS T increases pregnancy rates during the critical window of CL maintenance are unknown. The second strategy to increase fertility and possibly milk production is by using supplemental fats in the diet. Supplemental fa ts are used as an energy source in the diet to support the high demands of lactation. One su ch fat source is fish meal or fish oil which is relatively high in two fatty ac ids: eicosapentaenoic acid (EPA) and docosahexanoic acid (DHA). Fish meal increas ed pregnancy rates in lactating dairy cows (Carroll et al., 1994; Bruckental et al., 1989; Armstrong et al., 1990). In addition, feeding fish meal (Mattos et al., 2002) or fish oil (Mattos et al., 2004) to lactating dairy cows reduced circulating concentrations of PGF2 Production of PGF2 was also reduced by bovine endometrial cells when incubated with EPA and DHA (Mattos et al., 2003). Several mechanisms by which EPA and DHA can decrease PGF2 have been hypothesized; however, the precis e mechanism(s) are unknown. Another beneficial effect of supplementing diets with long chain fatty acids (LCFA; such as those found in fish oil) is the health-promoting fact ors that are increased in the milk for human consumption. Unsaturated fatty acids (UFA) have anticarcinogenic effects and other human health-promoting properties (Bauman et al.,

PAGE 27

5 2001). Understanding the mechanisms by whic h fish oil increases fertility may be beneficial for the cow; understanding how fish oil regulates fatty acid distribution in meat and milk for human consumption may be beneficial for humans. Although supplemental fat feeding has shown to increase fertility, studies have not been conducted to document which fatty acids are beneficial, which ones have no effect and which ones have negative effects on repr oductive processes. Understanding which fatty acids are beneficial, and formulating diet s enriched in those particular fatty acids, may enhance reproductive performance. This dissertation will review the many reproductive challenge s facing the modern day dairy cow and the effects of both supplem ental fat feeding and bST administration on reproduction (Chapter 2). In addition, experi ments are described that were conducted to elucidate the mechanisms by which bST increases pregnancy rates, in particular, at the time when there is a dialogue between concep tus and endometrium to maintain the CL. The nonlactating dairy cow was used first (Cha pter 3) as an experimental model to evaluate bST effects given at TAI on concep tus and endometrial f unction at d 17 of the estrous cycle or pregnancy. Ovarian functi on, conceptus development, and regulation of the GH-IGF system in the uterus were examined. This study was repeated in a second experiment using lactating dairy cows as th e experimental model and also examining the effects of a supplement containing calcium salts of fish oil enriched lipid. Responses evaluated were: Ovarian, conceptus and the GHIGF system (Chapter 4) Endometrial gene expression related to th e maintenance of pregnancy (Chapter 5) Distribution of fatty acids in tissues and milk (Chapter 6)

PAGE 28

6 The last experiment (Chapter 7) evaluated th e effects of diets enri ched in different UFA on oocyte quality and follicular deve lopment in lactating dairy cows.

PAGE 29

7 CHAPTER 2 REVIEW OF LITERATURE Reproductive Challenges of the High-Producing Dairy Cow Transition Period and Energy Balance A critical time period in the life cycle of dairy cattle is the period 3 weeks before and after calving (the transition period). Many dramatic physiological changes occur to both endocrine and nutritional statuses to support milk production. Just before parturition, nutrient demand increases markedly to satisfy late fetal development at a time when dry matter intake (DMI) is decreasi ng. Consequently, body reserves must be mobilized to meet demand. After parturi tion, nutritional requirements increase suddenly with initiation of milk production, and cows enter a ne gative energy balance. The degree and duration of tissue mobilization are primarily related to DMI rather than milk yield. The DMI can be influenced by several f actors, such as body condition prior to calving (Grummer, 1993), environment (Dre w, 1999; Fuquay, 1981), diet (Allen, 2000), management (Drew, 1999), and immune stresso rs like uterine, hoof, and (or) metabolic disorders (Formigoni and Trevisi, 2003). Negative energy balance usually reaches its lowest point or nadir between the second and third weeks of lacta tion (Butler and Smith, 1989). The DMI needs to increase four to six fold to meet the high nutrient demands of milk production. However, the dairy cow in early lactation cannot increase DMI fast enough to meet nutrient demands required for la ctation and, as a result, fat and protein are mobilized from body reserves. Tamminga et al. (1997) found that energy partitioning in early lactation resulted in mobilization of 42 kg of empty body weight, 31 kg fat, and

PAGE 30

8 5 kg protein. On a per-day basis, cows m obilized an average of 0.7 kg for empty body weight, 0.56 kg for fat and 0.04 kg for protei n; however, the largest part of the mobilization occurs in the fi rst week of parturition: 37% of empty body weight, 12% of total fat, and 58% of total protein are mobili zed. This further decr ease in energy balance profoundly affects fertility by decreasing lu teinizing hormone (LH) pulse frequency, reducing the diameter of the dominant follicle with low estradiol production, the period of low concentrations of plasma progesterone, and increasing the interval to first estrus (Roche et al., 2000). Metabolic hormones also are altered with an increased concentration of growth hormone (GH) possibly associated with an uncoupling of the GH receptor (GHR) and IGF-I production (Kobayashi et al., 1999). The result is decreased systemic concentrations of IGF-I and possibly intr a-follicular IGF-I, decreased body condition score (BCS), lower glucose and insulin concentrations of plasma, and higher concentrations of nonesterified fatty acids, -hydroxy butyrate and triacyl glycerol in plasma (Beam and Butler, 1999; Roche et al., 2000). Thus high DMI early postpartum in high-producing dairy cows is critical to nor mal resumption of ovulation and development of a normal size CL with sufficient production of progesterone to su stain high fertility (Vandehaar et al., 1995). Consequently, nutritional management of the high-producing dairy cow during the transition period has si gnificant carry-over effe cts on reproductive efficiency. Staples et al. (1990) reported lower milk pr oduction and feed intake resulting in a more-negative energy balance in anestr ous dairy cows compared with cows that returned to cyclic ovarian ac tivity before d 60 postpartum. Lucy et al. (1992) fed cows a high-energy diet to achieve a positive energy balance, or fed cows a low-energy diet to

PAGE 31

9 maintain negative energy balance during th e early postpartum period. The nonesterified fatty acid levels were elevated and the IG F-I was reduced in cows fed the low energy diet. In addition, the growth of the preovulat ory follicles in cows fed the low energy diet was reduced by 50% versus that of co ws fed the high energy diet. Fertility Milk production per cow increased steadily during the last 20 y ears, because of a combination of improved management, better nutrition, and intense genetic selection. Also, dairy farms have moved toward large r-scale operations: nearly 30% of the dairy farms in the United States have 500 or more cows (Lucy, 2001). This shift toward more productive cows and larger herds is associated with a decrease in reproductive efficiency. Butler (1998) documented a decline in first-se rvice conception rate from approximately 65% in 1951 to 40% in 1996. Cows inseminate d artificially at obser ved estrus typically had conception rates of approximately 55% (Casida, 1961). However, more recent studies report conception rate s of approximately 45% for in seminations at spontaneous estrus (Dransfield et al., 1998) and approximately 35% when TAI is used (Burke et al., 1996; Pursley et al., 1997a, 1997b, and 1998). During the last 10 years, milk producti on has increased approximately 20% and reproductive efficiency has declined (Lucy, 2001). However, an epidemiology analysis of reproductive performance in dairy cows indicated that the hazard ratio for initial cumulative 60-d milk yield in US Holstein cattle was near 1.0 (i.e., neutral effect) on conception rate (Grohn and Rajala-Schultz, 2000 ). Only at the highest level of milk production was there a nonsignifi cant increase in hazard rati o. Other factors such as postpartum disorders affected conception rate suggesting that fact ors such as energy

PAGE 32

10 balance, postpartum disease, embryonic loss, inbreeding, and heat stress are affecting reproductive performance (Lucy, 2001). Cows undergo a normal process of nutr ient partitioning and adipose tissue mobilization during early lacta tion (Bauman and Currie, 1980) associated with negative energy balance, weight loss, and decreased BCS. This is the time when nutrient requirements for maintenance and lactation ex ceed the ability of the cow to consume energy in the feed. Garnsw orthy and Webb (1999) found the lowest conception rates in cows that lost more than 1.5 BCS units be tween calving and insemi nation. In addition, Butler (2000) reported that conception rates range betw een 17% and 38% when BCS decreases 1 unit or more, between 25% and 53% if the loss is betw een 0.5 and 1 unit, and is >60% if cows do not lose more than 0.5 units or gain weight. An inadequate immune status can negatively a ffect fertility in lactating dairy cattle. Several epidemiological studies reveal a re duction in fertility for cows affected by disorders of the reproductive tr act (Labernia et al., 1999), mammary gland (Schrick et al., 2001), feet (Dobson et al., 2001), and metabolic di seases such as ketosis, milk fever and left-displaced abomasums (Markusfeld et al ., 1997; Beaudeau et al., 2000). Retained placenta, metritis, and ovarian cysts are risk factors for conception. Cows had lower conception rates of 14% with retained placen ta, 15% with metritis and 21% for those with ovarian cysts (Grohn and Rajala-Schultz 2000). Mastitis also significantly reduces fertility in lactating dairy cattle (Hansen et al., 2004). Embryonic loss is a large problem reducing fertility and farm profitability in lactating dairy cows. In a recent review (San tos et al., 2004a), lactating dairy cows seem to be most susceptible to reproductive failure in part due to low fertilization rate (~ 76%)

PAGE 33

11 and embryo viability in the first few days of gestation, but also because of extensive embryonic and fetal death (~ 60%). In he ifers and moderate yielding dairy cows (Sreenan et al., 2001) fert ilization rates upwards of 90% and calving rates of approximately 55% indicate an overall embryonic and fetal mortality rate of approximately 40%. It was concluded that fe w embryos are lost afte r fertilization and up to d 8 of pregnancy, and about 70 to 80% of total embryo loss occurs between d 8 and 18 after breeding. Subsequent losses were es timated to be around 10% between d 16 and 42 and 5 to 8% between d 42 and calving (Sreenan et al., 2001). Beef heifers were used to determine embryo survival during distinct stages of pregnancy with 93% survival rates to d 8, 66% to d 16 and 58% to d 42 (Diskin and Sreenan, 1980). Vasconcelos et al. (1997) reported losses of 20% between 28 and 98 d after insemination in high-producing dairy cows. Inadequate progesterone concentrations can cause ch anges in concentrations of hormones such as LH and estradiol which can negatively affect the oocyte, embryo, and uterine environment subsequently owing to high rates of embryonic loss (Inskeep, 2004). Genetic selection for milk production has been optimized at the expense of fertility. Inbreeding has increased in US Holsteins since 1980 (Lucy, 2001). Present levels of inbreeding are approximately 5% and some have predicted that levels of inbreeding will be 10% by 2020 (Hansen, 2000). Each 1% incr ease in inbreeding led to a 0.17 increase in services per conception, a 2 d increase in days open, and a 3.3 percentage unit decrease in conception rate. If these estimates are correct then inbreeding alone could account for the decline in fertility since the 1980s. Heat stress is a major contributing factor to the low fertility of dairy cows inseminated in the summer months (Ray et al., 1992; Thompson et al., 1996). Bradley

PAGE 34

12 (2000) reported the decade of the 1990s was the warmest since the beginning of instrumental temperature recording capabilities The decrease in c onception rate during the hot season can range betw een 20 and 30% compared to the winter season (Cavestany et al., 1985; Badinga et al., 1985) Reproduc tion in high-producing dairy cows is extremely sensitive to heat stress because of the high metabolic rate associated with increased milk yields (Wolfenson et al., 2000) Al-Katanani et al. (1999) examined 90-d return rates throughout the calendar year and re ported that summer infertility was greatest in the highest milk producing dairy cattle. Therefore, there are negative additive effects of heat stress and increased milk producti on on first-service con ception rate in dairy cattle. There are also clear se asonal patterns in efficiency of estrus detection, day to first service and conception rate in dairy cows with lower conception rates consistently observed in summer months (Cavestany et al ., 1985; Ryan et al., 1993; Almier et al., 2002). There appear to be nega tive carry-over effects of heat stress on fertility into the autumn months (Badinga et al ., 1985; Wolfenson et al ., 1997). It is suggested that this could be an effect of heat stress damage on early antral follicles during the summer that develop into large less fertile dominant follic les 40 to 50 d later (Roth et al., 2001). Follicle and Estradiol A transient increase in follicle stimula ting hormone (FSH) at 2 or 3 d after parturition induces emergence of a cohort of three to six follic les (4 to 6 mm) in diameter and by d 10 one of these follicles will have achieved dominance (Roche and Diskin, 2001). The LH pulse frequency increases during the first 2 weeks after parturition and is higher in cows that ovulate thei r first dominant follicle in co mparison with cows that do not (Beam and Butler, 1999). Cows have ovari an follicular waves with each wave being 7 to 10 d in duration and comprised of distin ct phases defined as emergence, deviation,

PAGE 35

13 dominance and atresia or ovulation. The co ws estrous cycle normally has one or two non-ovulatory waves and a termin al ovulatory wave. Hormonal interactions within a wave involve pituitary gonadotropins (LH and FSH), proteins and peptides of follicular origin (inhibin and follistatin), ovarian st eroids of follicular (estradiol) or luteal (progesterone) origin (Mihm et al., 2002), and PGF2 having a critical role within the ovulatory wave. Follicles generally reach ovu latory size at a diameter of 13 to 20 mm with the interval between the preovulatory surge of LH and ovulation of 28 h. The LH surge causes differentiation of the granul ose cells from producing estradiol to progesterone (Juengel and Niswender, 1999) The LH surge also activates an inflammatory reaction involving both hyperemia and collagen degradation mediated by increased production of PGE2 and PGF2 leading to a thinning and eventual rupture of the follicular wall (Espey, 1980). Lactating Holstein cows tend to have two-wave cycles (T ownson et al., 2002), whereas beef and dairy heifers tend to have eith er twoor three-wave cycles (Ginther et al., 1989). The peak and average plasma concen trations of FSH and inhibin are lower in the two non-ovulatory waves of a three-wave cycle than in the ovulatory wave, but are similar in two-wave cycles (Parker et al., 2003) Number of follicula r waves in the cycle preceding estrus did not influence the probabi lity of conception in beef cattle; however, there were only eight three-wave cycles to characterize conception rate (Ahmad et al., 1997). Holstein cows with a three-wave cycle preceding insemination had higher conception rates to first insemination than those with two waves (Townson et al., 2002). Beef cows with three waves in the cycle following insemination had a higher conception rate (Ahmad et al., 1997). T hus number of follicular waves in a cycle may increase the

PAGE 36

14 probability of conception in animals with thr ee-wave cycles. This could be because the ovulatory follicle developed over a shorter pe riod (Mihm et al., 1994; Townson et al., 2002), or because there was a slightly longer lu teal phase after inse mination (Ginther et al., 1989) that may benefit grow th of the conceptus. Metabolism may also affect bl ood concentrations of estradio l. Sartori et al. (2002a) reported lactating cows had larger preovulat ory follicles than did heifers but lower preovulatory concentrations of estradiol in blood. In a study comp aring lactating and nonlactating dairy cows, plasma estradiol conc entrations during the preovulatory period were several-fold higher in nonlactating compared with lactating cows (de la Sota et al., 1993). Beam and Butler (1994) compared cows that were either not milked (Dry), milked twice per day or three times per da y following parturition. This resulted in different energy balance and body weight lo ss among groups during the first 4 weeks postpartum. Although peak plasma estr adiol was similar among groups, maximum diameter of the dominant preovulatory follicle from the first follicular wave postpartum was larger in both the 3x and 2x cows compared with the dry cows. Therefore, lactational status or large differences in energy balance do not prevent the formation of follicular waves but apparently alter the gr owth and ultimate diameter of dominant follicles. Corpus Luteum and Progesterone Production The CL is formed from an ovulated domina nt follicle and secretes progesterone which is critical for establishment and main tenance of pregnancy. Pregnant dairy cows have greater concentrations of blood proge sterone compared with non-pregnant dairy cows within the first week to 10 d after in semination (Mann et al., 1999). Low plasma progesterone has been associated with a decr ease in fertility possi bly due to increased

PAGE 37

15 milk yield in high-producing lactating dairy cows (Lucy, 2001). Sartori et al. (2002a) found that concentrations of progesterone a nd estradiol in lactating dairy cows were lower than in heifers in summer and similar to dry cows in winter, despite the fact that they had larger ovulatory follicles and larger CL. Although CL mass of high-producing dairy cows may be larger, progesterone secretion and clearance may be more important to fertility. Starbuck et al. (2001) showed that cows with adequate milk progester one (>3 ng/mL) had pregnancy rates of approximately 50 to 55%, whereas cows with concentrations of < 1 ng/mL had pregnancy rates < 10%. Lucy et al. (1998a) found lower plasma concentrations of progesterone in higher producing cows than controls. Poor nut rition and weight loss in beef cattle causes a decrease in blood progesterone con centrations (Beal et al., 1978). Progesterone concentrations in blood ar e determined by rates of secretion, metabolism, and clearance. The liver is the primary site of progest erone metabolism, and progesterone and its metabolites are excreted in the feces, urine, and milk (Parr, 1992). A study comparing dairy cows implanted with progesterone releasi ng devices, either grazing pasture ad libitum or gr azing pasture for a restricted period of time, showed that cows grazing pasture ad libitum had lowe r plasma concentrations of progesterone (Rabiee et al., 2000). In addition, Sangsrita vong et al. (2000) demons trated that liver blood flow (liter/h) and proge sterone metabolism (ng/mL) in creased by greater than 50% when feed intake was either acutely or chr onically increased. Sheep also demonstrated an increase in progesterone metabolism with in creased level of feeding (Parr, 1992). The previous studies concluded that the mode rn day high-producing dairy cow has lower blood concentrations of progester one due to an increased meta bolic rate associated with

PAGE 38

16 increased consumption of feed to meet ener gy demands for lactation. During lactation, luteal phase progesterone con centrations were lower in hi gher yielding dairy cows, and there was a delay in the increa se of progesterone in the earl y luteal phase in cows with peak milk production > 42 kg/day. However, in lower yielding cows no such relationships are apparent (L ucy and Crooker, 2001). Also, it has been suggested that lower progesterone concentrati ons may be related to a greater liver mass and associated higher catabolic activity when cattle and sheep receive a greater dietary input (OCallaghan et al., 2001). Oocyte Competence and Early Embryo The ability of an oocyte to mature, be fer tilized and finally develop into a viable embryo is acquired gradually by the oocyte during folliculogenesis. During the period just prior to ovulation, cytoplasmic and nuclear maturation occurs allowing for developmental competence of the early embr yo. During this long period of follicular growth up to ovulation, developmental compet ence of the oocyte is determined. Thus many diseases and disorders may negatively a ffect oocytes within follicles that begin their development during the early postpart um period. For instance, during the early postpartum period the high-producing dairy co w goes through a negative energy balance and body weight loss as mentioned previous ly. Snijders et al. (2000) found that the ability of an oocyte to be fertilized and develop to th e blastocyst stage in vitro was affected by body condition of the donor dairy cow. Oocytes fertilized in vitro from dairy cows in low body condition had a lower cleav age rate and lower developmental rate compared with oocytes from dairy cows in better body condition. They also noted reduced developmental competence of oocytes collected from high genetic merit and first lactation cows, suggesting th at reproductive efficiency is compromised by genetic

PAGE 39

17 selection as well as first lactation. The exact period of nutritional imprinting of the oocyte is not known but many have speculated th at it occurs during the 2 months that it takes upon activation for a follicle to progress from the primordial to preovulatory stage. The possibility that the modern day dairy cow has poor oocyte quality and low fertilization capacity in vivo has been examined by comparing cleavage stage of embryos from lactating and nonlactating dairy cattle (S artori et al., 2002b). The percentage of normal embryos 4 to 5 d after estrus was lo w (58%) for lactating cattle and lower than historical values reported by Ayalon (1978) The percentage of normal embryos for nonlactating dairy cattle was comparable to hi storical values for nor mal lactating cattle (82%). The percentage of early stage em bryos in lactating cows approached that expected for repeat-breeder cattle (cows with four or more inseminations and failing to achieve pregnancy) described in the 1 970s (Ayalon, 1978). Sa rtori et al. (2002b) concluded that high milk production exerts negative effects on oocyte quality and embryo development that can be detected by 5 d afte r ovulation. Also the detrimental effect is augmented by increased environmental temp erature due to pronounced heat stress in lactating cows reducing fertil ization rate. Gwazdauskas et al. (2000) collected oocytes throughout lactation (30 to 100 da ys in milk [DIM]) by twice weekly follicular aspiration and concluded that cows on high energy diet s produced more high quality oocytes, but stage of lactation negatively influenced oocyte quality. During the summer months, heat stress re duces pregnancy and conception rates which can carry-over into the fall months (Wolfenson et al., 2000). Oocytes obtained from dairy cows collected during the summer heat stress period had reduced developmental competence in vitro (Rocha et al., 1998). In th is experiment oocytes were

PAGE 40

18 collected from Holstein cows with ul trasound guided aspiration. The proportion of oocytes classified as morphologically normal and the rate of blastocyst development following in vitro fertilization was lower in summer ve rsus winter. Rutledge et al. (1999) also reported a decrease in the number of Holstein oocytes that developed to the blastocyst stage during July and August compar ed to cooler months. In both of these studies, fertilization rate wa s not affected by season but th e lower development following fertilization during the summer was indicative of oocyte da mage. When superovulated donor heifers were exposed to heat stress for 16 h beginning at the on set of estrus, there was no effect on fertilization rate. However, there was a reduced number of normal embryos recovered on d 7 after estrus (Putney et al., 1988a). This illustrates that a brief heat stress can still affect oocyte competence within the periovulatory follicle. In addition, exposure of cultured oocytes to elevated temperature during maturation decreased cleavage rate and the proportion of oocytes that became blastocysts (Edwards et al., 1997). Heat stress can also affect the early de veloping embryo. When a heat stress was applied from d 1 to 7 after estrus there wa s a reduction in embryo quality and stage from embryos flushed from the reproductive tract at d 7 after estrus (Put ney et al., 1989). In addition, embryos collected from superovulated donor cows in the summer months were less able to develop in culture than embryos collected from superovulated cows during the fall, winter, and spring months (Mont y and Racowsky, 1987). Drost et al. (1999) demonstrated that transfer of in vivo produced embryos from cows exposed to thermoneutral temperatures increased pregnanc y rate in heat stressed recipient cows compared to that in heat stressed cows subjected to AI. Embryos appear to have

PAGE 41

19 developmental stages in which they are more su sceptible to the deleterious effects of heat stress as shown in vitro Heat shock in vitro at the 2 to 4 cell stage caused a larger reduction in embryo cell number than heat s hock at the morula stage (Paula-Lopes and Hansen, 2002). Earlier studies also showed that heat shock caused a greater reduction in embryo development when applied at the 2 cell stage than the morula stage (Arechiga et al., 1995; Edwards and Hansen, 1997) or at d 3 following fertilization than at d 4 (Ju et al., 1999). Conceptus and Maternal Unit High rates of embryonic loss have been obs erved between the period of conception and around the time of maternal recognition of pregnancy, which occurs between d 17 to 19 after estrus (Mann et al., 1999). During this time, the conceptus must secrete sufficient amounts of IFNto inhibit CL regression in order to maintain both progesterone production and pregnancy. Disc ord between the concep tus secretions and maternal unit can cause early embryonic loss. Studies utilizing embryo transfer and early pregnancy diagnosis indicate that less than 50% of the viable embryos establish pregnancy by 27 to 30 d after ovulation in lact ating dairy cows (Drost et al., 1999; Santos et al., 2004a), whereas in beef cattle 69 and 83% of frozen and fresh embryos, respectively, establish pregna ncy on d 37 of gestation. In normal cows, a large percentage of embryos are lost between d 8 and 16 of pregnancy (Diskin and Sreen an, 1980; Dunne et al., 2000 ) which is the period of conceptus elongation and IFNproduction to inhibit PGF2 pulsatile release. Conceptuses (d 17 to 19) from repeat-breed er cows were smaller than normal cows (Ayalon, 1978) and may be incapable of bloc king the luteolytic cascade resulting in embryonic loss. When reciprocal embryo tran sfer was performed between repeat-breeder

PAGE 42

20 and normal cattle, the repeat-breeder cattle failed to achieve normal pregnancy rates even though an embryo from a normal cow was tran sferred (Gustafsson and Larsson, 1985). On the contrary, normal cattle had normal pregnancy rates when an embryo from a repeat-breeder cow was transferred. This sugge sts that the failure to establish pregnancy may be due to a suboptimal uterine environment. One reason for the discord between the c onceptus and maternal unit may be the presence of a retarded embryo that cannot sufficiently produce IFN. Hansen et al. (1988) stated that elongation of the embryo is associated with increa sed secretion of IFN, and that most of the increased output of IFNis due to the increased size of the embryo and not increased synthesis per unit weight. By increasing embryo/conceptus growth, the antiluteolytic signal (IFN) may be strong enough to suppress pulsatile release of PGF2 such that more animals establish and maintain pregnancy. Progesterone secretion by the CL is esse ntial for coordinating the histotrophic environment to nourish the developing conceptu s. Progesterone plays a vital role in stimulating the production of several endometri al proteins and grow th factors important for embryo/conceptus growth (Geisert et al., 1992). Concentrations of plasma progesterone have a marked influence on th e development of the embryo (Mann et al., 1996) and its ability to secrete IFN(Mann et al., 1998; Mann and Lamming, 2001). Dairy cows with early post ovulatory in creases and greater concentrations of progesterone during the luteal phase had larger conceptuses on d 16 that secreted more IFNthan cows with late increases in progesterone and lower progesterone concentrations (Mann et al., 1998). Supplemen tal progesterone during the first 4 d after AI increased morphological de velopment and biosynthetic activity of d 14 conceptuses

PAGE 43

21 (Garret et al., 1998). Lamming and Darwas h, (1995) observed that a delay in the postovulatory rise and low proge sterone was associated with reduced pregnancy rates. However, when an accessory CL is induced 5 d following estrus to increase progesterone concentrations in lact ating dairy cows, conception rate s were greater at d 28 (46 vs. 39%), 45 (40 vs. 36%), and 90 days (38 vs 32%) after AI (Santos et al., 2001). Furthermore, if the high-producing dairy cow has a lower rise in progesterone concentrations during early diestrus, it could compromise the ability of the conceptus to be large enough to secret e ample amounts of IFNto inhibit luteolysis. This could contribute to the large rate of embryo death (Mann and Lamming, 1999; Darwash and Lamming, 1998). Not only can heat stress affect the oocy te and the early em bryo, but it can also reduce growth of the conceptus. Biggers et al. (1987) showed that heat stress reduced the weights of conceptuses recovered on d 17 from beef cows. This reduction in conceptus size would reduce the amount of IFNavailable to inhibit PGF2 pulsatile secretion. In addition, Putney et al. (1988b) incubated conc eptuses and endometrial explants obtained on d 17 of pregnancy at a thermoneutral (39C, 24 h) or heat stress (39C, 6 h; 43C, 18 h) temperatures. The heat stress decreased protein synthesis a nd secretion of IFNby 71% in the conceptuses. Howeve r, endometrial secretion of PGF2 and conceptus secretion of PGE2 increased in response to heat stre ss by 72%. Wolfenson et al. (1993) observed that secretion of PGF2 was increased in vivo when heifers were exposed to high ambient temperatures. Collectively these studies demonstrate that both the conceptus and the uterine environment can be disrupted due to heat stress inhibiting the conceptuses ability to secrete IFNand maintain pregnancy.

PAGE 44

22 A reduction in the amount of growth factor s, due to a high level of milk production and (or) nutritional status, may reduce the amount of embryotrophic growth factors that are needed for embryo/conceptus growth. Secr etion of embryotrophic growth factors into the uterine lumen may be controlled by nut ritional status of the cow since embryo transfer pregnancy rates were reduced in re cipients with low BCS (Mapletoft et al., 1986). Also GH, IGFs, and their binding protei ns may be regulated by nutritional status and level of milk production which are important for embryo/conceptus growth. Fatty Acid Metabolism Enzymes Enzymes found in the rumen of dairy cows modify dietary fatty acids before they are absorbed in the small intestine. Lipol ytic anaerobic bacteria found in the rumen secrete enzymes (lipases) which rapidly hydrol yze fats to release the fatty acids and galactose from their glycerol backbone. Both glycerol and galactose are released and fermented by the bacteria to volatile fatty aci ds. The length of the acyl chain, the number of double bonds in the chain, and the type s of isomers formed by each double bond determines fatty acid structure and function (M attos et al., 2000). For instance, saturated fatty acids (SFA) do not have double bonds in the acyl chain. Unsa turated fatty acids have double bonds in their acyl chain and are classified according to the position of the first double bond in relation to the methyl end of the molecule (Cook, 1996). For example, linoleic acid has 18 carbon atoms a nd two double bonds (C18:2), with its first double bond located at the sixth position from the methyl end, and is therefore a member of the n-6 family. In contrast, linolenic acid has three double bonds (C18:3) and belongs to the n-3 family because the first doubl e bond is at the thir d carbon position. Rumen

PAGE 45

23 enzymes acting upon fatty acids of one family (i .e., n-3) can only gene rate fatty acids of that same family (Jenkins, 1993). Three different enzymes, designated as is omerases, desaturases and elongases, play a large role in modifying the configur ation around a double bond, number of double bonds, and length of the acyl chain, respectively. By changing the structure of the fatty acid, these enzymes also are changing their function and type of fatty acid. Isomerases change the orientation of the fatty acid molecule around a double bond, converting the native cis-isomers into trans-isomers. Isomer ization also can change the location of the double bonds in the carbon chain (Khanal and Dh iman, 2004). For example, linoleic acid (cis-9, cis-12 C18:2) can be isomerized into conjugated linoleic acid (cis-9, trans-11 C18-2) which has human health promoting prope rties (i.e., anticarcinoge nic, antidiabetic, antiatherosclerosis etc.; Bauman et al., 2001). Elongation involves the additi on of two carbon units to the acyl chain of the fatty acid by an elongase enzyme. For example, stearidonic acid (C18:4) is elongated to eicosatetraenoic acid (C20:4). Fatty aci d desaturases are nonheme iron-containing enzymes that introduce a double bond between defined carbons of fatty acyl chains. Delta desaturases create a double bond at a fixed position counted from the carboxyl end of fatty acids. Stearoyl Co A desaturases (also called -9 desaturase) catalyze synthesis of monounsaturated fatty acids (MUFAs) fr om SFA (Bauman and Griinari, 2003). For example, stearic acid (C18:0) is acted upon by -9 desaturase to form the UFA, oleic acid (C18:1). The desaturases are classified acco rding to the position of insertion of the double bond. For instance, the -9 desaturase enzymes introduce the first cis-double bond at the 9, 10 position from the carboxyl end of fatty acids. The -6 desaturases and

PAGE 46

24 -5 desaturases are required for th e synthesis of highly UFA. The -6 desaturases are membrane bound desaturases that cataly ze the synthesis of PUFAs. The -6 desaturases and -5 desaturases are classifi ed as front-end desaturase s because they introduce a double bond between the pre-existing doubl e bond (i.e., omega-3 and -6) and the carboxyl (front) end of the fatty acid (Nakamura and Nara, 2004). The -6 desaturase inserts the double bond between the sixth and seventh carbon from the carboxyl end and -5 desaturase insert s the double bond between the fift h and sixth position from the carboxyl end. Examples of -6 and -5 desaturase are the co nversion of C24:5 into C24:6 and C20:3 into C20:4, respectively. In animals, desaturation of fatty acids doe s not occur at positions in the acyl chain greater than -9 (Cook, 1996). This does not allow th e animal to produce fatty acids of the n-3 or n-6 family. However, animals have absolute requirements for some fatty acids from the n-3 and n-6 families. These fatty acids are considered to be essential fatty acids since they must be provided by the diet (Lam bert et al., 1954). The two essential fatty acids are linoleic (C18:2, n-6) and linolenic acid (C18:3, n-3). For example, linoleic acid is essential for the synthesis of AA (C20:4, n-6). Linoleic acid is converted to AA by both a -5 and -6 desaturase and an elongase (Figur e 2.1). Linolenic acid is converted to EPA (C20:5) by both a -5 and -6 desaturase and an elongase (Figure 2.1). Biohydrogenation The two major components in a dairy cows diet are forages and concentrates. The forages consist largely of glycolipids and phos pholipids. The major fatty acids in these two lipid classes are linolenic (C18:3) and linoleic acid (C18:2) which are the essential fatty acids. In contrast, the main lipids in s eed oils used in concentrate feedstuffs are predominantly triglycerides containing linoleic and oleic acid (cis-9 C18:1). When these

PAGE 47

25 dietary lipids are consumed by ruminants, th ey undergo two important transformations in the rumen (Dawson and Kemp, 1970; Keeney, 1 970; Dawson et al., 1977). The first step in the fatty acid transformation is hydrolysis of the ester linkages catalyzed by microbial lipases. The anaerobic bacteria found in the rumen secrete lipases which rapidly hydrolyze fats to release the fatty acids and galactose from their gl ycerol backbone. The glycerol and galactose released are fermented by the bacteria to volatile fatty acids. The second step for fatty acid transformati on is a process called biohydrogenation. Biohydrogenation is attained th rough the addition of a hydrogen ion at the point of the double bond. Hydrogenation results in the conver sion of UFA into SFA. An example of this would be the conversions of C18:3, C18: 2, and C18:1 into C18:0. As a result, the proportion of SFA reaching the small intestine is greater than that entering the rumen. This increased amount of SFA occurs at the expense of UFA such as the essential fatty acids, linoleic and linolenic acid. Fatty-Acid Intermediates Biohydrogenation in the rumen is not comple tely efficient in that some proportion of a fatty acid molecular class can be comp letely biohydrogenated, some of the molecules are partially biohydrogenated, and some remain in the original native state. During the biohydrogenation of linoleic acid to stearic acid C18:0, eigh t isomers known as CLA are formed. Also CLAs can be synthesized in animal tissues from the conversion of transvaccenic acid (trans-11 C18:1), anothe r intermediate of rumen biohydrogenation of linoleic or linolenic acid, by the -9 desaturase enzyme to form cis-9, trans-11 CLA (Corl et al., 2001; Griinari and Bauman, 1999). T hus, rumen production of trans-11 C18:1 and mammary tissue -9 desaturase are important in dete rmining the CLA content in milk. However, a range of trans C18:1 isomers ar e produced in the rumen and subsequently

PAGE 48

26 absorbed from the small intestine and incor porated into milk fat (Corl et al., 2001). These different isomers, specifically trans-10 C18:1 reduced milk fat synthesis, rather than C18:1 isomers in general (Griinari et al ., 1996). In addition Baumgard et al. (2000) demonstrated that trans-10, cis-12 CLA inhib ited milk fat synthesi s, whereas the cis-9, trans-11 CLA isomer had no effect. The mechanism by which trans-10 C18:1 and trans-10, cis-12 CLA reduce fat synthesis may be multifaceted. Baumgard et al. (2002) utilized mammary tissue biopsies obtained on d 5 of treatment with trans-10, ci s-12 CLA and observed that the reduction in milk fat yield corresponded to reductions in mRNA abundance for genes that encoded for enzymes involved in the uptake and transport of fatty acids (i.e., lipoprotein lipase and fatty acid binding protein), de novo fatty acid synthesis (i.e., acetyl CoA carboxylase and fatty acid synthetase), desatu ration of fatty acids (i.e., -9 desaturase), and triglyceride synthesis (i.e., glycerol phosphate acyltransferase and acylglycerol phosphate acyltransferase). Two candidates for control of these genes in reducing milk fat synthesis are peroxisome proliferator-activated recep tors (PPAR) and sterol regulatory element binding proteins which both are regulated by PUFAs (Clarke, 2001; Jump and Clarke, 1999). An increasing interest in CL A consumption from animal products is attributed to their potential health benefits such as antic arcinogenic, antiatherogenic, antidiabetic and antiadipogenic effects (Banni et al., 2003; Belury, 2003; Kritchevsky, 2003; Pariza, 1999). Of the two physiologically important isomers (cis-9, trans11 and trans-10, cis-12 CLA), cis-9 trans-11 CLA is the most predom inate comprising 80 to 90% of total CLA in milk and meat from ruminants, whereas tran s-10 cis-12 is present in small amounts at 3

PAGE 49

27 to 5% of total CLA (Parodi, 2003). Previous studies have demonstr ated that the cis-9 trans-11 CLA reduces mammary tumor incidenc e in rats when added to the diet or consumed as a natural component of butte r (Ip et al., 1999). The estimated average consumption of CLA is 1 g/d for adults, belo w the estimated 3.5 g/d intake suggested as a protective amount. An epidemiological study involving >2300 middle-aged men reported a decreased incidence of heart di sease for men consuming milk and butter (Elwood, 1991). A large interest in discovering ways to in crease CLAs in milk and meat from cows has emerged. The CLAs increase due to di etary changes such as supplementation with unsaturated fats. In a study by Griinari et al. (1998), CLA of the milk fat in dairy cows increased from 0.35 to 1.98% when the diet was changed from a saturated to an unsaturated fat diet. Plant o ils such as sunflower, soyb ean, corn, canola, linseed, and peanut profoundly increase CLA. In particular plant oils high in linoleic acid give the greatest response (Kelly et al., 1998), and there is a clear dose dependent increase in milk fat content of CLA (Bauman et al., 1999a). Additi on of dietary fish oils or fish meal also increases milk fat CLA. In addition, fish o ils seem to produce a la rger increase in milk fat CLA than an equal amount of plant oils (Chouinard et al., 1998). Although the rumen biohydrogenation of the PUFAs found in fish oil is not well understood (Harfoot and Hazelwood, 1988), neither CLA nor trans-11 octadecenoic acid seem to be intermediates. Chilliard et al. (1999) demonstrated that feedi ng of fish oil results in increased ruminal production of trans-11 octadecenoic acid. Th e increase in trans-11 octadecenoic acid could involve inhibiti on of bacteria that reduce octade cenoic acid (C18:1) since trans-11

PAGE 50

28 C18:1 is not an intermediate. More tran s-11 octadecenoic acid in creases the amount of precursor for -9 desaturases that can be conve rted endogenously into CLA. Polyunsaturated fatty acids of the n-3 family such as EPA (C20:5, n-3) and DHA (C22:6, n-3), have been shown to undergo l ittle biohydrogenation (Ash es et al., 1992). The EPA and DHA are found typically in diets de rived from fish meal or oil which also increases amounts of CLAs in ruminant products. However, PUFAs themselves can also be essential for growth and development, prevention and treatment of heart disease, arthritis, inflammation, autoimmune diseases, and cancer (Simopoulos, 1999). Accordingly, there are now dietary recommendations and guidelines for omega-3 fatty acid intakes. For example, in a recent scientific statement, the AHA Dietary Guidelines suggest Americans c onsume at least two servings of fish per wee k, and include in the diet vegetable oils rich in the omega-3 fatty acids such as C18:3, EPA and DHA (KrisEtherton et al., 2003). It also recommends that 1.3 to 2.7 g/d total omega-3 fats be consumed. Despite these recommendations, it is estimat ed that actual dietary intakes of omega-3 fatty acids, and EPA and DHA specifi cally, are as low as one-tenth of these levels. It is estimated that to achieve the recommended le vels of EPA and DHA, a fourfold increase in fish consumption in the United St ates is necessary (Kris-Etherton et al., 2000). The possible feeding of fish oi ls to dairy cows will increase human consumption of PUFAs, specifically EPA and DHA, by increasing their concentration in meat and milk. Effects of Supplemental Lipids on the High-Producing Dairy Cow Transition Period and Energy Balance The transition period (3 weeks before unt il 3 weeks after parturition) is a time marked by physiological changes to accommodate fetal growth, parturition, lactogenesis,

PAGE 51

29 galactopoeisis, and uterine involution. These ch anges, which are more dramatic than at any other time during the gestation-lacta tion cycle, influence tissue metabolism and nutrient utilization. A reduction in feed intake is initiated during th e prepartum transition period, yet nutrient demands for support of in itiation of milk synt hesis and reproduction are increasing. This instills a negative en ergy status on the high-producing cow, that until alleviated antagonizes proper im mune and reproductive function. Fat supplementation is commonly used to incr ease the energy density of the diet of lactating dairy cows. Previous studies suppl ementing fat to improve the energy status of the cow during the transition period have been shown to have differing effects depending on whether DMI suppression occurred. The ty pe of fat fed as well as the type and amount of forage will have an effect on th e extent to which DMI is affected (Allen, 2000). The mechanisms by which fat can depress DMI are not clear. Intake could be depressed when supplemental fats are fed due to decreased palatability, ruminal fill due to decreased fiber digestion, regulation of the gut hormone cholecystokinin on the brain satiety centers, and increased amount of fatty aci d oxidation in the liver that alters signals generated by hepatic vagal afferent nerves to brain centers signaling satiety (Allen, 2000). However, other studies have reported that f eeding fat can have no effect on DMI (Staples et al., 1998). In addition, some studies reported DMI was depressed early in the experiment but had no effect later in the e xperiment after cows ha d consumed the diets for a longer period of time (Beam and Butle r, 1998; Chouinard et al., 1997; GarciaBojalil et al., 1998). This indicates there is a period in which cows must become adjusted to the supplemental fat source. In studies were fat did not depress DMI and did not change the energy status of the cow, more energy was probably utilized for milk

PAGE 52

30 production. Production of fat-co rrected milk was increased by 2.2 kg/d (Andrew et al., 1991) and by 1.4 kg/d (Harrison et al., 1995) when cows were fed supplemental fats and neither energy status nor DMI was changed compared to controls. Supplementation of fat has also resulted in higher DMI in several studies (Allen, 2000). Substitution of fat for grain can re duce the hypophagic effects of propionate by reducing its flux to the liver. Also, dietary fat has a lower heat increment per unit of energy than other energy sources and its inclusion in the diet has been advocated as a possible means of reducing heat stress and increasing DMI of dairy cows (Beede and Collier, 1986; Morrison, 1983). In a study by Sk aar et al. (1989), DMI was increased 7% in the warm season and was 5% lower in the cool season for cows consuming diets with added fat compared to diets w ithout supplemental fat. Howeve r, in other studies utilizing lactating dairy cows in heat stress versus th ermoneutral environments and fed diets with or without supplemental fat, there was no in teraction of diet and environment on feed intake. The fatty acid composition of different fat sources varies widely. For example, unprocessed plant oils contain a large amount of PUFAs such as lin oleic and linolenic acid. Rendered fats like tallow and yellow gr ease contain a large portion of MUFAs such as oleic acid. Granular fats such as calcium salts of palm oil and prilled fats, contain high amounts of saturated fats palmitic and stearic acids. The hypophagic effects of added fat has shown to increase with increasing am ounts of UFA (Jenkins and Jenny, 1989; Pantoja et al., 1996; Pantoja et al., 1994) and the m echanisms behind this are unknown. Greater hypophagic effects of LCFA with increased degree of unsatur ation were observed when LCFA were infused into the abomasum, w ith no effects of fat source on total tract

PAGE 53

31 digestibility of fatty acids (Bremmer et al., 1998). Drackely et al. (1992) suggested that unsaturated LCFA reaching the small intestin e of dairy cows affects gastrointestinal motility and DMI. The differences in DMI due to differing types of fatty acids are not clearly determined and await affordable s ources of pure fatty aci d products (C18:1, C18:2 etc.) to understand this phe nomenon (Bremmer et al., 1998). Supplemental fats can also affect metabol ic hormones such as insulin that would regulate not only feed intake but also reproductive responses such as interval to first ovulation. In a review by Staples et al. ( 1998), out of 17 fat studies that measured insulin, eight showed a decrease in plasma in sulin. Insulin concentrations usually reflect energy intake. For example plasma concentra tions of insulin increased with increasing DIM and DMI (Lucy et al., 1991b). In additi on, when energy status was used as a covariate in the statis tical model, the significant differe nces of diet and day on insulin were eliminated, suggesting insulin differen ces among diets were due to differences in energy status. Insulin suppression by suppl emental feeding of fat may benefit the development of follicles. Spicer et al. (1993) reported that bovine granulosa cells tended to produce less IGF-I when cultured with insu lin and GH. Because IGF-I is a potent stimulator of bovine granulosa cells in vitro (Spicer et al., 1993), suppression of insulin through the feeding of fat may allow IGF-I to affect positively follicle development. However, several other studies have shown that increased in sulin concentration positively affects interval to first ovulation and resu mption of normal estrous cycles (Armstrong et al., 2003). As mentioned earlier, an inadequate immune status during the transition period can negatively affect fertility. Diets differing in t ype of fatty acids such as n-3 or n-6 PUFAs

PAGE 54

32 have been shown to be important modulators of immune function (C alder et al., 2002). In mice fed an enriched n-3 PUFA diet, inflammatory reactions were reduced, and different types of antibody response to anti genic stimulation were developed compared with mice fed an n-6 enriched diet (Albers et al., 2002). Lessard et al (2003) fed diets of calcium salts of palm oil, flaxseed, or soyb eans to cows from 6 wks prepartum to 6 wks postpartum. The lymphocyte response of blood mononuclear cells to mitogenic stimulation was lower in cows fed soybeans th an in those receiving flaxseed or calcium salts of palm oil. Thus a diet high in linoleic acid (soybeans) may improve immune function. A possible explanation of the mechanis m behind modulation of immune function due to different fats may be related to eicosa noid synthesis such as prostaglandins (PG) and leukotrienes. Omega-6 fatty acids such as linoleic acid (C18:2) and omega-3 fatty acids such as -linolenic (C18:3) leads to the form ation of arachidonic acid (AA) and EPA, respectively. Both AA and EPA are precu rsors of eicosanoids, but those that are synthesized from EPA, such as PGE3 and leukotriene B5, do not have a strong biological activity as do those produ ced from AA, such as PGF2 PGE2 and leukotriene B5 (Yaqoob and Calder, 1995). As a result, feeding plant or fish oil rich in omega-3 PUFAs generally reduces inflammatory reactions and as well as production of interleukin-1, -6, and tumor necrosis factorin different animal species, including human (Yaqoob and Calder, 1995).. Fertility Many studies report an improvement in reproductive performance of cows fed supplemental fat. Staples et al. (1998) repor ted an improvement in fertility in 11 of 20 reviewed articles and it appeared that it was due to supplementation of a fat source and

PAGE 55

33 not solely due to an improvement in energy status. The average increase in rate of conception or pregnancy of the studies repo rting a positive response was 17 percentage units. In addition, Scott et al. (1995) conducted a large study in five herds and reported a greater proportion of cows fed calcium salts of LCFA expre ssed stronger signs of estrus, more active ovaries, and re quired less exogenous PGF2 to induce estrus. First service conception rate was improved when 253 cows over four herds were fed 2% ruminally inert fat from 0 to 150 DIM (43 vs. 59%; Ferg uson et al., 1990). When lactating dairy cows were fed either tallow or no tallow as a fat supplement, cows fed tallow tended to have a better conception rate (62 vs. 44%) by 98 days in milk (DIM ; Son et al., 1996). Petit et al. (2001) fed formaldehyde-treated flax seed from 9 to 19 w eeks of lactation to dairy cows which experienced a greater firs t service conception rate than those fed calcium salts of palm oil (87 vs. 50%). Feeding a calcium salt of palm and soybean oil (i.e., 26% linoleic acid and 4% linolenic acid) increased first service pregnancy rate of lactating dairy cows compared to an unsuppl emented control (27 vs. 58%; Cullens et al., 2004). In a study using a calcium salt blend of primarily C18:2 and C18:1 trans versus a calcium salt blend of primarily palm oil (C 16:0 and C18:1), the la ctating dairy cows receiving the calcium salt blend of C18:2 and C18:1 had an improved first service conception rate (25.6 vs. 33.5%; Juchem et al ., 2004). The latter study indicates that the type of fatty acid can have differential effects on fertility. In Staple s et al. (1998) review of the literature there was an improvement in pr egnancy rate for four studies that fed fish meal to dairy cows. However, in some of these studies the inclusion of fish meal partially replaced soybean meal such that one can not determine whether a beneficial effect of fish meal is due to reduced degradable protein or increased fatty acids such as

PAGE 56

34 EPA and DHA characteristic of fish. Burke et al. (1996) fed fish meal to lactating dairy cows while maintaining ruminally undegradable protein constant. Conception rate was improved due to the fish meal suggesting a fish oil beneficial effect on fertility. Several studies reported a decrease in con ception rate of cows fed supplemental fat (Sklan et al., 1994; Sklan et al., 1991; Ericks on et al., 1992). However, in each of these studies the lowered conception rate was accomp anied by an increase in milk production. High milk production has been linked to a decrea se in fertility as described previously. Number of days open was unaffected by fat supplementation with one positive exception (Sklan et al., 1991), and number of AI pe r conception was decreas ed in three studies (Armstrong et al., 1990; Fergus on et al., 1990; Sklan et al ., 1991) in which fat was supplemented. Follicles and Estradiol Many studies reported that number and grow th dynamics of ovarian follicles are altered due to lipid supplementa tion. Many of the lipid effects on the follicle are due to the supplemental lipid source and not just energy. Lucy et al. (1991a) replaced corn with Ca-LCFA in a diet c ontaining whole cottonseeds that wa s fed to lactating dairy cows beginning at parturition. The number of sm all (2 to 5 mm) follicles decreased and number of medium (6 to 9 mm) follicles increased within 25 DIM in cows fed the CaLCFA. Just after the 25 DIM and during a sync hronized estrous cycle, number of small (2 to 5 mm) follicles and large (> 15 mm) follic les increased in cows fed Ca-LCFA. In addition, the diameters of the largest (18.2 vs. 12.4 mm) and second largest (10.9 vs. 7.4 mm) follicles were greater in cows fed Ca-LCFA. However, in this study, the two diets were not of equal energy density and the re sponses may have been due to either the supplemental fat source or the increased ener gy. When this study was repeated, lactating

PAGE 57

35 Holstein cows fed the Ca-LCFA diet had a larger second wave dominant follicle versus cows fed a diet of similar energy density without Ca-LCFA (16.1 vs. 18.7 mm; Lucy et al., 1993b). Dominant follicle size was increased in cows fed diets enriched in PUFAs compared with cows fed a diet enriched in MUFAs, indicating th at it was PUFAs that were most effective (Staples et al., 2000). In addition, Beam and Butler, (1997) reported that supplemental fat increased the diameter of the largest follicle of the first wave follicle from d 8 to 14 of the estrous cycle. Oldick et al. (1997) infused water, glucose, tallow or yellow grease into the abomasums of lactating dairy cows. The first wave dominant follicle grew faster to a larger size in cows infu sed with yellow grease versus tallow. It appears that diets enriched in di fferent fatty acids can have differential effects on follicle development. The increased follicle size may be due to fats affecting plasma LH secretion to stimulate follicular growth. However, plasma LH during the luteal phase of the estrous cycle was unaffected by a diet containi ng Ca-LCFA but was increased during the follicular phase in primiparous cows (Sklan et al., 1994). Lucy et al. (1991a) reported that the LH profile was unaffected in dair y cows fed Ca-LCFA in the early postpartum period. However, as LH pulse amplitude increased, the diameter of the largest follicle increased, and energy status was less negative. Lipid supplementation is used to increase the amount of energy consumed to improve th e energy status of the cow. Cows in negative energy status have a prolonged postp artum anestrous (Roche and Diskin, 2000) and the frequency of LH pulses are reduced which may limit both follicle growth to the

PAGE 58

36 preovulatory stage and ovulation (Schillo, 1992). Lipid supplementation may aid in increasing energy status and improve LH pulse frequency. Estradiol has stimulatory e ffects on uterine secretion of the luteolytic hormone, PGF2 (Knickerbocker et al., 1986). In addition, estradio l can increase the sensitivity of the CL to PGF2 ,(Howard et al., 1990) which can cause a more complete regression of the CL. Thus lowered plasma estradiol may pr event premature CL regression and prevent early embryonic mortality. Oldi ck et al. (1997) infused into the abomasum of lactating dairy cows either water, gl ucose, tallow or yellow grease and reported that tallow and yellow grease had lower concentrations of plasma estradiol (2.42 vs. 3.81 pg/mL) on d 15 to 20 of a synchronized estrous cycle compared to cows infused with glucose. When supplemental lipids were fed to beef cows during the early postpartum period, serum concentrations of estradiol were lower compared to unsupplemented cows (1.41 vs. 1.61 ng/mL; Hightshoe et al., 1991). Also, con centration of estradiol was lower in the follicular fluid from beef cows fed soybean oil (Ryan et al., 1992). Other studies have reported no effect of supplemental fats on es tradiol concentrations during either the follicular or luteal phase of lactating dair y cows (Lucy et al., 1991a; Lucy et al., 1993b; Sklan et al., 1994). Corpus Luteum and Progesterone Since follicle size is increas ed due to lipid supplementation, the subsequent CL from the larger follicle may also be larger. Larger ovulating dominant follicles in heifers, nonlactating, and lactating dairy cows resulted in larger corpora lutea (Sartori et al., 2002a; Moreira et al., 2000a) which was a ssociated with greater circulating concentrations of plasma proge sterone. When lactating dair y cows were fed either 0 or 2.2% Ca-LCFA starting at parturition and exam ined weekly by rectal palpation for the

PAGE 59

37 first 60 DIM, the number of CL (0.85 vs. 1.05) and the size of the largest CL (12.2 vs. 17.2 mm) tended to be greater in cows fed Ca -LCFA (Garcia-Bojalil et al., 1998). Larger CL were detected in lactating dairy cows fe d high levels of omega-3 fatty acids through the diet as formaldehyde-treated linseed or as a mixture of formal dehydetreated linseed and fish oil (Petit et al., 2002). A larger CL may not only be due to ovulati on of a larger follic le but also through direct developmental and steroidogenic e ffects on the CL. Electron microscopic examination of CL tissue revealed that lipid co ntent was greater in lu teal cells from beef heifers fed Ca-LCFA compared with unsupplem ented controls (Hawkins et al., 1995). Increased concentrations of progester one were associated with improved conception rates of lactating dairy cows (Bu tler et al., 1996). Previous studies have reported an increase (Staples et al., 1998), no effect (Mattos et al ., 2002), or a decrease (Robinson et al., 2002) in plasma progesterone in dairy cows supplemented with LCFA. Moallem et al. (1999) fed Ca salts of palm o il from 0 to 150 DIM to lactating dairy cows and reported an increase not only in progester one concentration in follicular fluid (55.4 vs. 33.0 ng/mL) but also in progesterone conten t of fluid from estr adiol-active follicles (173.9 vs. 68.3 ng). Concentrati on of progesterone in follicula r fluid also was greater for beef cows fed soybean oil compared to control cows (Ryan et al., 1992). With a larger CL due to supplemental fa t, progesterone concentration in the blood may be increased; however, this may not be th e only reason. Cholesterol is a precursor for the synthesis of progesterone, and f eeding supplemental fat increases plasma concentrations of cholesterol probably because cholesterol is needed for supplemental fat absorption (Grummer and Carroll, 1991).

PAGE 60

38 Also, progesterone concentra tions may be increased if the clearance rate of progesterone from the blood is reduced in cows fed supplemental lipids. Hawkins et al. (1995) fed beef heifers either 0 or 0.57 kg/d of Ca salts of palm oil from 100 d prepartum through the third estrous cycle postpartum. Average concentrations of plasma progesterone and cholesterol were elevated in heifers fed fat. Heifers were ovariectomized on d 12 to 13 of the third estrous cycle, and blood samples were taken repeatedly thereafter. Increased plasma c oncentrations of progesterone from repeated samples taken just before and after ovariect omy in the fat-fed group indicated a greater half-life of progesterone. This supported the concept that feeding supplemental lipids caused a slower clearance rate of progesteron e from plasma. When liver slices in media were incubated with progesterone, estradiol, an d fatty acids such as C18:2, the half-life of progesterone and estradiol increased in th e C18:2 treatment compared with media containing no fatty acids (S angritavong et al., 2002). Oocyte and Early Embryo Acquisition of oocyte developmental competence occurs as a continuum throughout folliculogenesis. This acquisition ca n be divided into three separate stages defined by particular physiological events. The first stage is oocyte growth, which takes place mainly during the beginning of follicle gr owth. Second stage is oocyte capacitation (preparation of the oocyte for supporti ng early embryo development by acquiring important factors such as mR NAs, proteins, mitochondria, et c.), starting at the end of oocyte growth in antral follicles. Lastly is oocyte maturation which starts after the LH surge in preovulatory follicles or after removal of the oocyte from the follicular environment which inhibits meiotic re sumption (Mermillod et al., 1999). The preovulatory LH surge or removal of the oocyt e from its follicular inhibitory environment

PAGE 61

39 triggers resumption of meiosis for maturation to metaphase II and is termed nuclear maturation. During the entire life of the oocyt e and for a distinct period after the LH surge, the oocyte is going through cytoplasmic maturation. Cytoplasmic maturation is the accumulation of mRNA, proteins, mitochondria, and many other important cellular nutrients which are critical fo r subsequent fertilization and embryo development. Homa and Brown, (1992) cultured bovine oocytes, from slaughterhouse ova ries, with linoleic acid and noticed a significant reduction in spontaneous germinal vesicle breakdown compared with oocytes cultured without fatty ac ids. This illustrates that fatty acids can affect nuclear maturation and could possibly affect cytoplasmic ma turation with profound effects on subsequent embryo development. When bovine follicles are dissected and cl assified according to size, the oocytes harvested from larger follicles undergo be tter development than those from smaller follicles (Pavlok et al., 1992; Lonergan et al ., 1994). Follicle size is stimulated due to supplemental fat feeding which may increase ooc yte competence leading to an increase in fertility as previously discussed. Nutritiona l induced changes in endocrine and metabolic signals that regulate follicular growth also can influence oocyte maturation (Armstrong et al., 2001; Boland et al., 2001). Competence of the oocyte and embryo is al so related to fatty acid composition; specifically, phospholipid conten t of the cellular membrane plays a vital role in development during and after fertilization. The amount of lipid in the ruminant oocyte is approximately 20-fold greater than that of th e mouse (76 vs. 4 ng) and consists (w/w) of approximately 50% triglyceride, 20% phospholip id, 20% cholesterol and 10% free fatty acids (McEvoy et al., 2000). Previous studies showed that C16:0 and C18:1 acids were

PAGE 62

40 the most abundant fatty acids in the phospholip id fraction of oocytes from cattle and may function as an energy reserve (Kim et al., 2001; Zeron et al., 2001). Polyunsaturated fatty acids comprise <20% of total fatty acids with linoleic (C18:2n -6) being the most abundant. Temperature modulates the physical propertie s of the lipids in cell membranes and changes lipid composition of the membrane (Quinn, 1985). Zeron et al. (2001) reported that oocyte membrane fluidity is affected by temperature alterations between seasons, as well as by changes in fatty acid compos ition. Furthermore, a relationship was documented between decreased PUFA content, a change in biophysical behavior of oocytes, and low fertility of dairy cows duri ng summer. Zeron et al. (2001) documented that MUFA and PUFA contents are lower in oocytes and granulosa cells in the summer compared to the winter season in dairy cattl e. The number of high quality oocytes was higher in ewes fed PUFAs than in contro l ewes (74.3 and 57.0%, respectively), and PUFA supplementation increased the proporti on of LCFA in the plasma and cumulus cells (Zeron et al., 2002). However, these changes in fatty acid composition were relatively small in oocytes indicating that uptake of PUFAs to the oocyte is either selective or highly regulated. Few studies have investig ated the effects of fat supplementation on oocyte and embryo quality in lactating dairy cattle. In a study by Fouladi-Nashta et al. (2004), lactating dairy cows were fed either 200 or 800 g/d of Ca salts of palm and soybean oil, and follicles were transvaginally aspirated 3 to 4 d apart. A total of 1157 oocytes were collected from 20 cows, and oocytes we re matured, fertilized and cultured in vitro A greater percentage of oocyte s developed into blastocysts from cows fed the higher fat

PAGE 63

41 diet. In another study, concepti on rate to first service was in creased when lactating dairy cows were fed a mixture of calcium salts of linoleic and trans fatty acids compared to palm oil (33.5 vs. 25.6%; Juchem et al., 2004). In a sub-sample of the cows, fertilization rate (87 vs. 73%), number of total cells, percentage of liv e cells, and percentage of embryos graded 1 and 2 (73 vs. 51%) were gr eater for calcium salt blend of primarily C18:2 and C18:1 trans versus a calcium sa lt blend of primarily palm oil (C16:0 and C18:1; Cerri et al., 2004). Also, the number of accessory sperm cells attached to the zona pellucida was greater. However, whether the be neficial effects are due to an enrichment of linoleic and (or) 18:1 trans fatt y acids cannot be determined. Conceptus and Maternal Unit Although, to date, no studies ha ve investigated the effects of supplemental fats on conceptus development in lactating dairy co ws, several studies ha ve investigated the effects of supplemental fats on the cross-talk between the co nceptus and maternal unit. The maternal unit constitutes all tissues in th e female reproductive tract that directly or indirectly interacts with gametes or concep tus. Appropriate exchange (cross-talk) of hormonal signals between both units is re quired for successful establishment and completion of pregnancy. Discord between the conceptus and maternal unit can cause early embryonic loss and the start of a new estrous cycle. Early pregnancy loss in lactating dairy cat tle can have devastating effects on the economic success of dairy farms (Santos et al., 2004a). Nearly 40% of pregnancy losses have been estimated to occur be tween d 8 to 17 following estrus. This is the critical time period during which the conceptus must produce sufficient quantities of IFNto prevent pulsatile PGF2 secretion and maintain the CL (Thatcher et al., 1995). Changing from a cyclic to a pregnant state not only depends on the production of antiluteolytic signals

PAGE 64

42 from the developing conceptus but also the capacity of the endome trium to respond to these signals, thus bl ocking pulsatile PGF2 production (Binelli et al., 2001b). Such communications between the conceptus and ma ternal units are not always successful, thus leading to early embryonic loss. The endometrium plays a critical role in regulating the estrous cycle and establishment of pregnancy. Elevated concen trations of plasma progesterone during the late luteal phase of an estrous cycle cau ses down regulation of progesterone receptors (PR) in the uterus (Spencer and Bazer, 1995; Wathes and Lammi ng, 1995; Robinson et al. 2001). Loss of PR in the uterus activat es oxytocin receptor (OTR) expression and subsequent luteolysis (Wathes and Lammi ng, 1995). Conversely, estradiol receptor (ER ) concentrations are upregulated during lute olysis in sheep. Although the role of PR and ER in regulating the OTR regulation is not clearly elucidated, the OTR certainly is suppressed by IFNsecreted from the conceptus (Flint et al., 1992; Wathes and Lamming, 1995; Mann et al., 1999). In the uterine luminal epithelium, AA is released from phospholipids by hydrolysis and acted upon by prostaglandin H sy nthase (PGHS-2) to form PGH2, which is converted to either PGF2 and (or) PGE2 through the two reductases, prostaglandin F synthase (PGFS) and prostaglandin E synthase (P GES), respectively. It is unknown whether relative endometrial expression of the 2 s ynthetic enzymes, PGFS and PGES, changes during the period of CL maintenance in pregnant lactating dairy cattle. Previous studies reported that feeding fa ts, in particular PUFAs, can attenuate endometrial PGF2 production. In a study by Burke et al. (1996), a higher proportion of lactating dairy cows fed fish meal had hi gher plasma progesterone concentrations 2 d

PAGE 65

43 after PGF2 injection indicating attenuation in efficiency of CL regression due to fish oils. In this study pregnancy rates were increased from 32 to 41%. In a study by Mattos et al. (2002), cyclic lactating dairy cows fed fish meal, containing EPA and DHA, had reduced plasma 13, 14-dihydro-15-keto-PGF2 metabolite (PGFM) concentrations compared to unsupplemented controls when challenged with estradiol and oxytocin injections. Dairy cows fed diets containing fish oil during th e transition period ha d greater EPA and DHA concentrations in caruncular tissues collected within 12 h after parturition as compared to control cows fed olive oil (Mat tos et al., 2004). Furthermore, the lactating dairy cows fed fish oil had reduced plasma concentrations of PGFM just after parturition. A series of in vitro studies were performed to evaluate the effects of particular MUFAs and PUFAs on PGF2 secretion (Mattos et al., 2003 ). An immortalized bovine endometrial (BEND) cell line was used to test the effects of no fatty acid (control) or C18:1, C18:2, C18:3, C20:4, C20:5, and C22:6 fatty acids (i.e., 100 M) on PGF2 secretion. Only C20:4, precursor for PGF2 stimulated PGF2 production compared to control cells. The C18:3, C20:5, and C20:6 fatty acids were the only fatty acids to suppress synthesis of PGF2 with C20:5 (EPA) and C20:6 (DHA) being the most suppressive. Also C18:2, which is also a precursor for PGF2 did not increase PGF2 and it was hypothesized that perhaps the bend cells were not capable of efficiently converting linoleic acid (C18:2) to AA (C 20:4). Robinson et al. (2002) fed soybeans (high in C18:2) that were partially protected from biohydroge nation, to lactating dairy cows. The PGFM plasma concentration was increased, after oxytocin challenge, compared to cows fed other fat sources. Another study fed whole sunflower seeds, also high in C18:2, to lactating dairy cows and reported an increase in plasma concentrations of PGFM after an

PAGE 66

44 oxytocin challenge compared to cows fed ot her fat sources (Petit et al., 2004). Thus supplemental lipids can either inhibit or stimulate PG secretion depending upon the specific fatty acids. The mechanism by which PUFAs inhibit PGF2 secretion may involve decreasing the availability of AA precursor increasing the concentration of fatty acids that compete with AA for processing by PGHS-2, or inhibiti on of PGHS-2. Reduced availability of AA in the uterine phospholipid pool for conve rsion to PGs of the 2 series can occur through a reduction in the synthesis of AA or through displacement of existent AA from the phospholipids pool by other fatty acids (Mattos et al., 2000). Collectively these studies show that differe nt fatty acids can either increase or decrease PGF2 secretion. Decreasing PGF2 pulsatile secretion through fatty acid feeding coupled with a conceptus producing IFNmay allow a more effective antiluteolytic signal so that more cows to establish and maintain pregnancy. Peroxisome Proliferator-Activated Receptors The PPARs are a family of nuclear re ceptors activated by selected LCFA, eicosanoids and peroxisome proliferators. Three PPAR isoforms, encoded by separate genes, have been iden tified thus far: PPAR PPAR and PPAR which upon ligand binding, heterodimerize with the retinoid rece ptor and interact with specific PPAR response elements in the promoter region of target genes to affect transcription. Regulation of promoter function is complex, since there is tissue specific expression of the PPAR and retinoid receptor subtypes, comp etition for the retinoid receptor binding partner, and differences in binding affi nity among the PPAR subtypes and among the retinoid receptor subtypes (Desvergne and Wahli, 1999). PPAR activation may be ligand dependent or independent, and there is also cross-talk with other nuclear receptors and

PAGE 67

45 their response elements, as well as several transcription factors (D esvergne and Wahli, 1999; Nunez et al., 1997). The PPARs are best known for their roles in lipid metabolism, but they are also involved in development, epidermal maturation, reproduction in several animal models, and functions of nerve, lung, kidney and car diac tissues (Desvergne and Wahli, 1999; Berger and Moller, 2002). The PPAR is expressed in a broa d range of tissues incl uding heart, skeletal muscle, colon, small and large intestines, ki dney, pancreas, adipose, and spleen. The PPAR is required in adipocyte differentiation, and regulate genes that control cellular energy homeostasis and insulin actio n (Berger and Mo ller, 2002). In rodents and humans, PPAR is expressed in numer ous metabolically active tissues including liver, kidney, heart, skeletal muscle, ovary and brown fat (Nunez et al., 1997; Braissant et al., 1996; A uboeuf et al., 1997). It is also present in monocytic (Chinetti et al., 1998), vascular endothelial (Inoue et al., 199 8), uterine epithelial (Nunez et al., 1997) and vascular smooth muscle cells (Staels et al., 1998). The PPAR has been shown to play a critical role in the re gulation of cellular up take, activation, and oxidation of fatty acids (Berger and Moller, 2002). Long-chain UFA such as linoleic, arachidonic, EPA, and linolenic acids, as well as the branched chai n fatty acid phytanic acid bind to PPAR with reasonable affinity (Willson et al., 2000). In contrast to PPAR PPAR has a preference for PUFAs over MUFA or UFA (Khan and Heuvel, 2003). The PPAR is expressed in a wide range of ti ssues and cells, with relatively higher levels of expression noted in brain, adipose, a nd skin (Braissant et al., 1996; Amri et al., 1995). Importantly, in the endometrium PPAR is vital for normal fertility serving as a

PAGE 68

46 regulator of PG production and is required for implantation in rodent models (Lim et al., 1997; Lim et al., 1999). MacLaren et al. (2005) reported similar expression of PPAR and PPAR mRNA levels in BEND cells and endo metrium from cyclic and pregnant Holstein cows (MacLaren et al., 2003, 2005). The PPAR / agonist cPGI had a dramatic stimulatory effect on PGHS-2 mRNA levels and synthesis of PGF2 and PGE2, which appeared to be mediated at least in part through PPAR (MacLaren et al., 2005). They hypothesized that PPAR is involved in the pregnancy recognition process of cattle and that it mediates at least some of the bene ficial effects of long chain omega-3 PUFA supplementation on fertility. Also Balaguer et al. (2005) reported an inverse relationship between endometrial PPAR mRNA concentration and that of ER and PGHS-2 within the first week of the estrous cycle in lactating Holstein dairy cattle. The inverse relationship between these ge nes spawned further speculation that PPARs, PPAR in particular, are mediators of uterine PGF2 biosynthesis in dairy cattle. In addition, PPARs appear to be one possible route in which PUFAs can have beneficial effects in humans through regul ation of atherosclerotic plaq ue formation and stability, vascular tone, angiogenesis, anti-inflammation, cellular differentitiation, and anticarcinogenic (Berger and Moller, 2002). Feed ing fatty acids that influence PPARs may regulate PGF2 synthesis and possibly implantation ow ing to the beneficial effects of certain fat supplements on dairy cattle fertility. Bovine Somatotropin and the Insu lin-Like Growth Factor System Bovine Somatotropin Structure, synthesis, and secretion In the bovine literature, GH and bST are used interchangeably. For clarity purposes in this dissertation, GH will be used to illustrate naturally produced GH, and

PAGE 69

47 exogenous recombinant GH will be referred to as bST. In cattle, GH is a 191 amino acid single chain polypeptide with a molecula r weight of 22 kDa (Secchi and Borromeo, 1997). Four cysteines form two disulfide bridges within the GH molecule (Secchi and Borromeo, 1997). The molecular structure of GH contains four alpha helixes arranged in an up-up-down-down configuration (Secch i and Borromeo, 1997). Prolactin and placental lactogen are structurally related to GH because each hormone contains a similar helix bundle (van der Walt, 1994). The GH, prolactin, and placental lactogen are members of a larger family of hormones cal led the hematopoietic cytokines. Other members of this family include erythropoieti n, the interleukins and other growth factor receptors (Horseman and Yu-lee, 1994). In humans, two forms of the GH gene are pr oduced by alternative splicing such that there are two forms of GH found in the peri pheral system (Baumann, 1991). The most common form has a molecular weight of 22 kD a (Lewis, 1992). This form of GH makes up 70 to 75% of the total GH in circulation. The other less common form makes up 5 to 10% of the circulating GH and has a lowe r molecular weight of 20 kDa (Tuggle and Trenkle, 1996) because it lacks 15 amino acids (Baumann, 1991). This less abundant form was not found in other mammals such as cattle (van der Walt, 1994). The remaining circulating forms of GH are de rivatives of the 22-kDa isoform (Tuggle and Trenkle, 1996). The GH gene is located on the long arm of chromosome 17 (Baumann, 1991). The GH gene is approximately 2.6 to 3.0 kb in le ngth with five exons and four introns (Tuggle and Trenkle, 1996). Compared to other species, the amino acid sequence of bovine GH is 66.5 to 99% homologous (Secchi and Borromeo, 1997).

PAGE 70

48 Growth hormone is produced and secreted fr om cells in the anterior pituitary called somatotrophs (van der Walt, 1994). Somatotr ophs comprise 40 to 50% of the total number of cells in the anterior pituit ary. Two hypothalamic peptides control GH secretion: growth hormone-releasing hormone (GHRH) and somatostat in (Cuttler, 1996). The GHRH can stimulate secretion and synthesis of GH by the somatotrophs. Adenylate cyclase is activated by a stimul atory G-protein when GHRH binds to GHRH receptors on somatotrophs. Adenylate cyclase causes an increase in cyclic adenosine monophosphate (cAMP) which ultimately increase s intracellular calcium concentrations. Increases in calcium concentrations stimul ate GH secretion (Mayo et al., 1995; Cuttler, 1996). The increase in cAMP also activates kinases that phosphoryl ate proteins that activate GH synthesis. The somatostatin inhibits GH secretion, but does not affect GH synthesis. Both the short and long forms of somato statin have the same affect on GH secretion. However, the shorter form is the most abundant in the circul ation. After somatostatin is secreted from the hypothalamus, it binds to somatostatin re ceptors on somatotrophs. Activation of the somatostatin receptor complex stimulates an inhibitory G-protein that suppresses cAMP production which blocks calcium release a nd prevents GH secretion (Cuttler, 1996). However, somatostatin and GHRH collate th eir effects to repl enish GH pools within somatotrophs before GH release (Gillies, 1997). Regulation of GH secretion can also occur due to hormones from the gastric lining. Small synthetic molecules called growth hormo ne secretagogues stimulate the release of growth hormone from the pituitary. They act through the GH secretagogue receptor, a G protein-coupled receptor whos e ligand has only been discov ered recently (Kojima and

PAGE 71

49 Kangawa, 2005). Using a reverse pharmaco logy paradigm with a stable cell line expressing GH secretagogue receptor, the endogenous ligand for GH secretagogue receptor was purified from rat stomach and named "ghrelin" (Kojima et al., 1999). Ghrelin is a peptide hormone in which the th ird amino acid, usually a serine but in some species a threonine, is modified by a fatty acid; this modifica tion is essential for ghrelin's activity. The discovery of ghrelin indicates that the re lease of GH from the pituitary might be regulated not only by hypothalamic GH RH, but also by ghrelin derived from the stomach. In addition, ghrelin stimulates a ppetite by acting on th e hypothalamic arcuate nucleus, a region known to control food inta ke (Korbonits et al., 2004). Ghrelin is orexigenic; it is secreted from the stomach and circulates in the bloodstream under fasting conditions, indicating that it transmits a hunge r signal from the periphery to the central nervous system (Kamegai et al., 2001). Ta king into account all these activities, ghrelin plays important roles for maintaining GH re lease and energy homeostasis in animals. Age, body composition, steroids, sleep, nutr ition, stress, exercise, and gender are involved in the regulation of GH secretion. Ca lves also have great er GH concentrations compared to 3 to 6 month old cattle (Reyn aert et al., 1976). Adi posity is negatively correlated with GH concentrations. Concentr ations of GH in cattle were greater during negative energy balance compared to the period of positive energy balance (Gluckman et al., 1987; Vandehaar et al., 1995) Elevated GH is required for normal accelerated growth when cattle are maturing. Growth horm one secretion is grea ter during deep sleep in humans (Cuttler, 1996), but not in cattle (Gluckman et al., 1987). Protein rich diets can stimulate GH secretion, whereas free fatty acids reduce GH secret ion (Cuttler, 1996). In cattle, infusing glucose resulted in elevat ed GH concentrations (McAtee and Trenkle,

PAGE 72

50 1971). Stress in cattle decreased GH possibly by increasing circulating free fatty acids (Reynaert et al., 1976). Lastl y, bulls have more pulses of GH secretion whereas cows have fewer pulses with higher ma gnitude (Reynaert et al., 1976). Receptor and ligand binding The greatest numbers of GHR are found in the liver (Hause r et al., 1990). However, many reproductive tissues have GHR mRNA. For example, hypothalamus, pituitary, CL, ovarian follicle, oviduct, e ndometrium, myometrium, and placenta have GHR mRNA (Heap et al., 1996; Kirby et al ., 1996; Lucy et al., 1998b). In addition Izadyar et al. (1997 and 2000) was able to de tect GHR mRNA in bovi ne granulosa cells, cumulus cells, oocyte and embryos at all stages of development up to d 9 post fertilization. The bovine GHR has 242 amino acids in the extracellular binding domain, 24 amino acids in the single transmembrane dom ain and 350 amino acids in the intracellular domain. The extracellular domain of the GHR has seven N-linked glycosylation sites and seven cysteine residues. All seven extrac ellular cysteines and four of the seven glycosylation sites are conser ved between species. An additional seven cysteines are found in the intracellular re gion (Hauser et al., 1990). In all mammalian species examined, except for humans, there is a conserved amino acid sequence proximal to the membrane in the extracellular portion of cy tokine/hematopoietin receptors. The six amino acid sequence consists of tryptophan, serine, no specific amino acid, tryptophan and serine (WSXWS motif). Both motifs s eem to be important for GH binding. Another important feature of the GHR is the intracellu lar Box 1 and Box 2 regions. Box 1 is more proximal to the cell membrane compared to Box 2. These amino acid sequences are

PAGE 73

51 important for signal transduction (Postel-Vi nay and Finidori, 1995; Carter-Su et al., 1996). The GH molecule contains two binding s ites for the GHR. Site 1 has greater receptor affinity than site 2 and binds to th e receptor first. After binding of site 1, a second GHR binds to site 2 and forms a comple x (one ligand and dimerized receptor). Receptor dimerization is important for GH signal transduction. High circulating GH concentrations diminish receptor dimeriza tion because site 1 binds both undimerized GHR not allowing site 2 binding and inhibi ting dimerization (Waters et al., 1994). Alanine mutations in the GH molecule can decrease GH binding by 400% without affecting the tertiary stru cture of the molecule (Cunningham and Wells, 1989). Second messengers Several proposed second messenger system s have been reported for GH. One common protein to all GH second messenger path ways is Janus Kinase 2 (JAK2). The JAK2 protein is one of four members in the Ja nus tyrosine kinase family (Carter-Su et al., 1996). After GH binding and receptor dimerization, JAK2 is activated and binds intracellular portions of each GHR. The JAK2 binding initiates GH si gnal transduction. The JAKs transphosphorylate each other at ty rosine residues and then phosphorylate tyrosine residues located on the GHR. Phosphor ylation of GHR creates docking sites for the Src homology 2 domain of downstream signal transducers and activators of transcription (STAT) molecules. Tyrosine phosphorylation of ST AT molecules occurs after STAT binding to the GHR. The STAT molecules then ei ther heteroor homodimerize and translocate to the nucleus to effect gene transc ription. Although there are seven STAT molecules (Darnell Jr, 1997) only STATs 1, 3 and 5 are involved in GH signal transduction (Carte r-Su et al., 1996 and 1997).

PAGE 74

52 The second proposed GHR second messenger system involves a more complex group of intracellular events. Similar to the system above, JAK2 binds and phosphorylates the GHR. Then a SH2 domain protein called SHC binds to the GHR and is activated by JAK2 phosphorylation. Once SHC is stimulated, a cascade of downstream events occurs that activates protei ns such as Grb2, SOS, Ras, Raf, MEK and MAPK. The phosphorylated MAPK enters the nucleus target ing genes that may control growth and metabolism (Car ter-Su et al., 1996 and 1997). A third GHR second messenger pathway wa s proposed by Carter-Su et al. (1996 and 1997). This mechanism involved the activa tion of insulin receptor substrate-1 (IRS1). The IRS-1 is a component of insulin a nd IGF-I second messenger systems. Activated IRS-1 stimulates phosphatidyli nositol 3 (PI-3) kinase. The downstream events that occur following PI-3 kinase activation are still unclear (CarterSu et al., 1997). Activation of IRS-1 or SHC by GH occurs in vitro and not in vivo Only the JAK-STAT pathway has been shown to be stimulated in both in vitro and in vivo GH experiments (Chow et al., 1996). Growth and metabolism are regulated by GH. Binding of GH to the GHR affects the transcription of various genes associated with normal growth (Norstedt et al., 1990). Some of the known genes induced by GH are IG F-I, c-fos, c-jun, JunB, serine protease inhibitor 2.1 and 2.2 (Rot wein et al., 1994). Insulin-like Growth Factor System Structure, synthesis, and secretion The IGF-I and IGF-II are growth promoting peptides and members of a superfamily of related insulin-like hormone s in mammals (Rinderknecht and Humbel, 1978; Humbel, 1990). The IGF-I and II are relate d closely to insulin in terms of primary

PAGE 75

53 sequence and biological activit y. The IGFs are major growth factors whereas insulin predominately regulates glucos e uptake and cellular metabolis m. The IGF-I is a 7.6 kDa protein made up of 70 amino acids; however, IG F-II is slightly smaller consisting of 67 amino acids and a molecular mass of 7.5 kD a (Rinderknecht and Humbel, 1978; Rutanen and Pekonen, 1990; Humbel, 1990). The IGFs consis t of A, B, C, and D domains. Large portions of the sequences within th e A and B domains are homologous to and chains of proinsulin. The sequence homology is 43% for IGF-I and 41% for IGF-II. In addition, IGF-I is 65% homologous to IGF-II (Rutanen and Pekonen, 1990). All three hormones (i.e., insulin, IGF-I, and IGF-II) contain and chains, and a connecting peptide region (C). However, amino acid se quences are different among the proteins with no sequence homology between the C domains of IGFs and the C peptide region of proinsulin (Gluckman et al., 1987). The C domain of the IGFs is not removed during prohormone processing. Therefore, the ma ture IGF peptides are single chain polypeptides (Zapf and Froesch, 1986; Daugha day and Rotwein, 1989). Another region in the IGFs different than proinsulin is a carboxy-terminal extens ion called the D domain (Gluckman et al., 1987; Humbel, 1990). The gene encoding IGF-I is highly conser ved such that 57 of 70 residues from the mature protein are identical across species (Zapf and Froesch, 1986). Expression of IGFI is affected at many levels including ge ne transcription, splicing, translation and secretion. Expression of the IGF-I gene is tissue specific and infl uenced by hormones, nutrition, and developmental factors (Biche ll et al., 1992; Gronowski and Rotwein, 1995; Thissen et al., 1994). Furthermore, the molecu lar weight of IGF-I is the same for human,

PAGE 76

54 bovine, porcine, ovine, rat and mouse (Humbel, 1990). Three disulfide bridges within IGF-I aid in proper folding a nd stabilization of the protei n structure (Quin, 1992). The IGF-I found in blood is produced pr imarily by the liver in response to GH (Gluckman et al., 1987). However, many ot her tissues produce IGF-I that exert both paracrine and autocrine eff ects (DErcole et al., 1984). One IGF-I effect is through stimulation of cell growth and proliferation with IGF-I acti ng in an endocrine, paracrine or autocrine manner (Quin, 1992). The GH exerts a dominant endocrine influence on liver production of IGF-I to incr ease circulating concentratio ns of the IGFs (i.e., IGF-I which is 100% GH dependent). Once IGF-I is released from the liver, it is transported through the blood to act on distan t tissues (Zulu et al., 2002). Receptors and ligand binding The biological functions of IGFs are me diated by a family of transmembrane receptors, which includes the insulin, IGF-I, a nd IGF-II receptors. Type I IGF receptors have the greatest affinity for IGF-I, hence the name IGF-I receptor. However, IGF-II can bind to type I IGF receptors but with lower affinity (Sun et al., 1991). The IGF-I receptor is a glycoprotein on the cell surface which binds IGF and activates a highly integrated intracellular signaling syst em (Sepp-Lorenzino, 1998; Kim et al., 2004). Expression of the IGF-I recep tor gene occurs in many tissues such as reproductive tissues, and is expressed cons titutively in most cells (Spicer and Echternkamp, 1995; Eckery et al., 1997). The IGF-I receptor is synthesized on the ribosome as a single polypeptide chain that is post-translationally modified by removal of a 30-amino acid signal peptide, and the pror eceptor undergoes cleavage into a 706 amino acid extracellular -subunit and a 626 amino acid transmembrane -subunit. The two and subunits are linked together by disulfide bonds to form an -half-receptor, which

PAGE 77

55 in turn, is linked subsequently to another -half-receptor (Humbel; 1990). Ligand binding occurs in the cysteine-ric h extracellular domain of the -subunit, while tyrosine kinase activity resides in the cytoplasmic -domain (Jones and Clemmons, 1995). In addition, the intracellular domains of the -subunits contain ATP binding sites. These sites bind ATP for the tyrosine kinase reac tion that occurs afte r receptor binding and activation. Activation of the tyrosine ki nase causes autophosphoryl ation of tyrosine residues on the IGF-I receptor (Rutan en and Pekonen, 1990; Giudice, 1992). Although the IGF-I receptor pr eferentially binds IGF-I, it can also bind IGF-II or insulin (Quin, 1992). However, type II IGF rece ptors have the greatest affinity for IGF-II (Rutanen and Pekonen, 1990; Giudice, 1992). Furthermore the IGF-II receptor has a much lower binding affinity for IGF-I and does not bind insulin (Jones and Clemmons, 1995). The IGF-II receptor is a 250 kDa pol ypeptide monomer with homology to the mannose-6-phosphate receptor. The extracellula r domain is 90% of the receptor and has 15 conserved repeat sequences (Giudice, 1992). A major difference between the IGF-II and IGF-I receptors is that IGF-II receptors l ack tyrosine kinase act ivity (Giudice, 1992). The binding site for IGF-II is distinct from that for mannose-6-phospate, and IGF-II can bind simultaneously with the mannose-6-phos phate ligands (Braul ke et al., 1989). However, the binding of certain lysosomal enzymes can interfere noncompetitively with IGF-II binding and vice versa (Kiess et al., 1988 ). The IGF-II can be cleared from the blood through binding to mannose-6-phospate r eceptors, internalization and subsequent degradation, which can be inhibited by ly sosomal enzymes (Oka et al., 1985). In addition, it is well accepted that IGF-II recepto rs are scavenger receptors which mediate the uptake and degradation of IG F-II (Jones and Clemmons, 1995).

PAGE 78

56 Second messengers Binding of IGF-I to the type I IGF re ceptor activates aut ophosphorylation of tyrosine residues. Therefore, the type I IGF receptor is a tyro sine kinase receptor (Giudice, 1992). In addition to phosphorylating tyrosine residue s, serine residues also are phosphorylated. Activation of the IGF-I r eceptor causes phosphorylation of a 185 kDa protein called insulin receptor substrate 1 (I RS-1), which also can be phosphorylated by insulin receptors (Foncea et al., 1997). Phosphorylation of IRS-1 occurs by direct interaction with the IG F-I receptor (Dey et al., 1996). The IRS-1 protein contains 21 tyrosine phosphorylation sites, six of whic h occur in the YMXM sequence, which is a recognition motif for binding of proteins co ntaining src homology 2 domains (Myers and White, 1993; White and Kahn, 1994). Several second messengers can be activ ated simultaneously once IRS-1 is phosphorylated. Therefore, IRS-1 is vi ewed as a docking protein that after phosphorylation by IGF-I or in sulin receptors forms a large protein complex that activates multiple signaling cascades (Jones a nd Clemmons, 1995). Some proteins that are activated by IRS-1 are th e p85/p110 complex (PI-3 kinase), Grb2, Syp and Nck. All four activated proteins are part of separate intracellular pathways and each contains src homology 2 domains. Activation of the p85/p110 complex, also known as the PI-3 kinase pathway, is important for cell growth. Another pa thway involves activation of Grb2, which stimulates an exchange prot ein called Son of Sevenless causing the phosphorylation of a guanine nucle otide activating Ras. Acti vated Ras stimulates another protein called Raf causing phosphorylation of the MAP kinases which activates cell mitosis and metabolism. The downstream signaling events of the other two IRS-1 activated proteins, Syp and Nck, are unknow n (Jones and Clemmons, 1995). Recent

PAGE 79

57 studies demonstrated that IRS-1 is not th e only second messenger activated by the IGF-I receptor. Another molecule activated by the beta subunits of the IGF-I receptor is the Shc protein. Activation of Shc stimulates the Grb2/SOS complex and their respective downstream intracellular events (Jones and Clemmons, 1995). The IGF-II receptor signal transduction is different from insulin or IGF-I signaling since it lacks both serine and tyrosine kina se activities (Okamoto et al., 1990). Binding of IGF-II to the IGF-II recep tor can cause internalizati on and degradation of IGF-II (Jones and Clemmons, 1995). Prev ious studies have associated an inhibitory G-protein with IGF-II receptor signaling (Okamoto et al., 1990); however, the complete signal transduction mechanism is unknown. Binding proteins A family of six high affinity IGF-bindi ng proteins (IGFBP-1 through IGFBP-6) has been identified. The IGFBPs coordinate and regulate biological activity of IGFs in several ways: 1) transport of IGFs in plasma which controls diffusion and efflux from the vascular space; 2) increase the half-life and regulate cleara nce of the IGFs; 3) provide specific binding sites for the IGFs in the extr acellular and pericellular space; 4) modulate, inhibit or facilitate interac tion of IGFs with their receptors (Rajaram et al., 1997). The IGFBPs are regulated by post-translati onal modifications such as glycosylation and phosphorylation, and (or) differential locali zation of the IGFBPs in the pericellular and extracellular space (Rajaram et al., 1997). In addition to stabi lizing and regulating levels of diffusible IGFs, it has been propos ed that IGFBPs may re gulate IGF-I cellular responses by facilitating receptor targeting of IGF-I or modulating IGF-I bioavailability in the pericellular space (F irth and Baxter, 2002).

PAGE 80

58 The effects of IGFBPs can be regulated fu rther by specific IGFBP proteases, which cleave the IGFBPs into fragments rendering th e IGFBPs incapable of binding the IGFs (Russo et al., 1999). Some IGFBPs such as IGFBP-2 and -3 can induce direct cellular effects independent of the IGFs (Rajaram et al., 1997). The IGFBP-3, similar to IGFBP5, and more recently IGFBP-2 are reported to contain sequences with the potential for nuclear localization and possibl y can regulate gene function (Schedlich et al., 1998). The complexity of the IGFBP system in biological fluids is shown by the presence of six IGFBPs, multiple IGFBP proteases, and th e intricate regulation of the two. Understanding the mechanisms by which the IG Fs are regulated by IGFBPs and IGFBPs by IGFBP proteases may improve our understa nding of the physiological function of IGFs. Effects on Lactation Advances in biotechnology beginning in the early 1980s, such as recombinant DNA technology, allowed for massive production of recombinant GH (bST). The first study in 1982 demonstrated that bST injected into lactating dairy cows increased milk production (Bauman et al., 1982). In 1994, bST was commercialized for use in lactating dairy cows beginning at approxi mately 60 DIM. The recombinant bST was coupled with a slow release formulation that allowed fo r injections of bST (500 mg) to be given biweekly. Injections of bST in lacta ting dairy cows increased milk production from 7 to 41% above untreated controls (Bur ton et al., 1990; Stanisiewski et al., 1992; Downer et al., 1993). The typical milk yield responses are in creases of 10 to 15%; however, the greatest increases occur when management and care of the animals are optimal (Bauman, 1992; Chilliard, 1989). Variability in milk yield re sponse to bST depends on other factors such

PAGE 81

59 as age, parity (Huber et al., 1988; Downer et al., 1993), energy balan ce (Peel et al., 1983; Bauman et al., 1985), nutrition (Elsasser et al., 1989), and milking frequency (Knight, 1992). Injections of bST stimulate the pr oduction of IGF-I in the same manner as endogenous GH. Concentrations of IGF-I incr ease within 48 h of bST treatment (Gong et al., 1993). The major factor affecting the magnitude of milk response to bST is the quality of management, in particular, nutrition (Ether ton and Bauman, 1998). Lucy et al. (1993a) reported that cows initially loose energy as milk production increases and reach an energy balance nadir around the th ird week of treatment. During this time, nutrients are repartitioned to support ener gy and nutrient demands for increased milk production. Supplying adequate amounts of a properly fo rmulated feed ration that provides enough energy to support the cow and lactation are crit ical. An increase in milk production is followed by an increase in feed intake. By the 10th week of treatment, cows generally consume adequate energy for a positive energy balance (Bauman et al., 1985). Injections of bST appear to have little effects on the mammary tissue to increase milk production since very litt le GHR mRNA has been found in mammary tissue. Binelli et al. (1995) did not show an effect of GH on mammary epithe lial cells. Direct arterial infusion of the mammary gland with bST had no effect on milk yield (McDowell et al., 1987), whereas direct arterial infusion of IG F-I or IGF-II stimulated milk yield (Prosser and Davis, 1992; Prosser et al., 1994, 1995). The increase in blood IGF-I concentrati ons that occurs in response to bST treatment is most likely the method for incr eased milk production by bST. Capuco et al. (2001) administered bST to lactating dairy co ws and reported an incr ease in the rate of

PAGE 82

60 cell renewal in the mammary gland thereby reducing the rate of mammary regression during lactation. One important effect mediated by IGF-I is increased cell proliferation (Rechler and Nissley, 1990), which is seen in cultured mammary cells obtained from both pregnant and lactating cows (Baumrucker and Stemberger, 1989). Thus, increased concentrations of IGF-I in bST-treated cows during the postpartum period might have positive effects on cell numbers via either epit helial cell proliferation, differentiation, and (or) maintenance, allowing for a greater milk yield. In addition, IGF -I has been shown to be a potent inhibitor of apoptos is in a variety of tissues (P eruzzi et al., 1999), which may contribute to more mammary cells be ing maintained for lactation. Blood IGF-I concentrations increase from ear ly to late lactation (Vega et al., 1991). Lower blood IGF-I during early lactation is most likely due to energy balance and uncoupling of the GH receptor in the liver. In dairy heifers and cows, serum IGF-I was correlated positively with energy balance (Y ung et al., 1996; Spicer et al., 1990). In addition, dairy heifers in a positive energy ba lance had a greater IGF-I response to bST treatment compared to heifers in a negativ e energy balance (Yung et al., 1996). The IGFI response to bST is also great er during late lactation when most cows are in a positive energy balance (Vicin i et al., 1991). A main reason for an increase in milk yi eld due to bST is through the partitioning of absorbed nutrients to the mammary gland fo r an increase in milk synthesis (Etherton and Bauman, 1998). Many metabolic effects are a direct action of bST involving a variety of tissues and the metabolism of all nutrient classes: carbohydrates, lipids, proteins, and minerals.

PAGE 83

61 Lipid metabolism changes drastically after in jections of bST. Lactating dairy cows in a negative energy balance and treated w ith bST have decreased lipogenesis and increased lipolysis, whereas when dairy cows are in a positive energy balance and treated with bST there is a decrease in lipogenesis without a change in lipolysis (Peel and Bauman, 1987). The reduction in lipogenesis in bST-treated co ws can be as high as 97% and increased lipolysis can occur within 2 h of bST treatment (Lanna et al., 1995; Gluckman et al., 1987). Bell (1995) reported that the changes seen in lipogenesis and activity of lipogenic enzymes occurs partially through bST increasing insulin. Although insulin is increased due to bST injections, bST increases the sensitivity of tissues to insulin (in particular adipose tissue) with no change in maximum response. This leads to a marked decrease in insulin-regulated even ts such as glucose transport, lipogenic enzyme activities, expression of lipogenic en zyme genes, and lipid synthesis (Etherton and Bauman, 1998). Furthermore, changes in lip olysis and (or) lipogenesis can cause an increase in nonesterified fatty acid concentratio ns in dairy cows treat ed with bST (Binelli et al., 1995). Other responses to bST include increas ed hepatic gluconeogenesis, decreased amino acid uptake by the liver, and decrease d urea excretion (Eth erton and Bauman, 1998). Recombinant bST also increased tr ansport and oxidation of glucose which stimulated lactose synthesis (Peel and Ba uman, 1987). Even though nutrient partitioning to the mammary gland is increased, the gr oss composition of milk (fat, protein, and lactose) is not altered by bST treatment (Burton et al., 1994). Therefore the daily production of major milk constituents is in creased by an amount comparable to the increase in milk yield.

PAGE 84

62 Peak milk production usually occurs between 28 to 56 DIM in lactating dairy cows; however, bST is not injected until approximately 60 DIM. The bST appears to increase milk production after bST injections due to a decrease in the normal rate of decline in milk production. Milk production response to bST is greater during late compared to early lactation (McDowell, 1991). Effects on Reproduction Earlier studies examining the effects of bST on reproduction found negative effects such that lactating dairy cows treated with bST had decreased conception rates (Downer et al., 1993), reduced pregnancy rates (Cole et al., 1991; Esteban et al., 1994), increased incidence of cystic ovaries, increased number of days to first insemi nation (Esteban et al., 1994), increased days in anestrus (Waterma n et al., 1993; Esteban et al., 1994), and increased services per concep tion (Cole et al., 1991). Othe r studies found no effect of bST on the number of days not pregnant fo llowing parturition (Zhao et al., 1992), length of the estrous cycle (Gong et al., 1991), or services per conception (Zhao et al., 1992; Downer et al., 1993; Esteban et al., 1994). One possible explanation for the decreased reproductive performance is through the inhibition of behavioral estrus in cows treated with bST. A decrease in estrus detection was observed in lactating dair y cows treated with bST (Mor beck et al., 1991; Waterman et al., 1993). In addition, Cole et al. (1992) reported an increase in the interval from first estrus to first insemination and attributed th is effect to a reduced estrus expression. Furthermore, the reduced estrus expression wa s associated with an increased negative energy balance. However, in dairy heifers that were ovariectomized and steroid-primed, bST treatment reduced estrus expression (Lef ebvre and Block, 1992). It was concluded that bST affected behavioral centers within the brain that contro l estrus expression.

PAGE 85

63 Kirby et al. (1997b) detected a reduction in estrus expression and an increase in the percentage of undetected ovulat ions. Furthermore, neither progesterone nor estradiol concentrations were affected by bST treatment. With the advent of TAI, the deleterious effects of bST on reproduction can be bypassed. Since bST decreased estrus expression that contributed to an increase in days open, elimination of estrus detection thr ough TAI alleviated this problem. When lactating dairy cows were injected with bS T at the initiation of the Ovsynch protocol, pregnancy rates were greater than controls at d 27 and d 45 after AI (Moreira et al., 2000b). In addition, when cyclic-lactating dairy cows were injected with bST at either the initiation of the Ovsynch program or at th e time of AI pregnanc y rates were increased compared to controls (53.2, 44.9, and 38.8%, respectively; Moreir a et al., 2001). Additional studies have documented the benefici al effect of bST on pregnancy rates when injected during the period approaching AI (S antos et al., 2004b) and in sub-fertile cows detected in estrus and injected with bST at insemination (Morales-Roura et al., 2001). In a review by Lucy et al. (2000), bST was shown to have numerous effects on ovarian function in dairy cattle. The major ity of GH receptors within the bovine ovary are localized in the large luteal cells of th e CL; however, there are low levels of GHR in the follicles. The increase in peripheral IGF-I released in response to bST injections may be the primary regulator of follicular devel opment in cattle (Lucy et al., 1995; Gong et al., 1997). Heifers treated with increasing doses of bST failed to have greater growth of antral follicles when the bST dose was belo w the threshold for increased IGF-I (Gong et al., 1997). Also, miniature cattle (i.e., defi cient in GH receptors) with high blood GH but low blood IGF-I concentrations had one-thi rd the number of small antral follicles

PAGE 86

64 compared with control cattle in the same herd (Chase et al., 1998). The IGF-I may either have synergistic effects with gonadotropin recep tors to increase follicle number and size, and (or) decrease atresia of growing follicles leading to a greater number of healthy antral follicles (Lucy et al., 2000). The number of recruited follicles increased in both cows and heifers that were either injected daily with bST or with the sustained release formulation bST (de La Sota et al., 1993; Gong et al., 1991, 1993, and 1997; Kirby et al., 1997a). In addition, lactating dairy cows injected with bST had a greater num ber of medium (6 to 9 mm; De La Sota et al., 1993) and large (> 10 mm; Lucy et al., 1995 ; Kirby et al., 1997b) follicles while small follicle numbers were similar to control. In dairy heifers, the increased number of small follicles in response to bST was correlated with plasma GH and IGF-I (Gong et al., 1991 and 1997). Dominant and second largest follicle s are also responsive to bST injections. The method or amount of bST administration ma y be important to follicular responses since Jimenez-Krassel et al. (1999) reported increased numbers of dominant follicles and increased ovulation rate in dairy cattle infu sed for 63 d with pulsatile doses of bST. Kirby et al. (1997a) found that l actating dairy cows injected with bST had a larger second wave dominant follicle than controls. In th e same study, the first wave dominant follicles in bST-treated cows regressed faster than c ontrols which led to an earlier emergence of the second follicular wave (Kirby et al., 1997a, 1997b). Lucy et al. (1994) also reported earlier emergence of the second follicula r wave in bST-treated heifers. An effect of bST on follicular growth al so was shown in earlier studies in which bST increased twinning rates (Butterwick et al., 1988; Wilk inson and Tarrant, 1991; Cole et al., 1992). Earlier studies speculated that greater blood IGF-I concentrations in bST-

PAGE 87

65 treated cows may be the reason for increased twinning since IGF-I is increased in cows selected for twinning (Echternkamp et al., 1990). However, although follicular recruitment is stimulated by bST, only a si ngle follicle is select ed and only a single follicle is ovulated (Kirby et al., 1997a). Thus, the reported increase in twinning rates among bST-treated cows may not be related to an increase in ovulation rate, but to an increased likelihood of embryonic survival in cows with double ovula tions (Kirby et al., 1997a). Also, other studies re ported no effect of bST on ovulation rate (Lucy et al., 1993a), numbers of Class 1 or Class 3 follicle s, size of subordinate follicle, size of dominant follicle (Kassa et al ., 2002) or twinning rate (Downe r et al., 1993). Lucy et al (2000) stated that failure to observe consistent results of bST on twinning in dairy cattle may reflect an interaction of bST with e ither genetic or environmental factors. The large luteal cells of the CL contai n the majority of GH receptors. Heifers injected with bST developed la rger CL during the early luteal phase (Lucy et al., 1994). Increased progesterone concentrations were repo rted in cows treated with bST (Gallo and Block, 1991; Lucy et al., 1994). A slower d ecline in progesterone following luteolysis was observed in bST-treated cows perhaps be cause of an increase in the proportion of large luteal cells (L ucy et al., 1994). Other studies have shown a decrease in progesterone (Jimenez-Krassel et al., 1999; Kirby et al., 1997a) or no diffe rences in progesterone after bST treatment in dairy cows (Gong et al., 1991; De La Sota et al., 1993). Lactating Holstein cows treated with bST had a decrease in the size of the CL and a decrease in progesterone concentrations compared with controls (Jimenez-Krassel et al., 1999). Injections of bST lowered progesterone concentrations (K irby et al., 1997a) in dairy co ws possibly due to decreased

PAGE 88

66 CL function perhaps by reducing the number of LH receptors (Pin to Andrade et al., 1996), by down-regulating somatotropin receptor mRNA in luteal cells (Kirby et al., 1996), and (or) by increasing overall metabolism a ssociated with increased DMI and milk production (Etherton and Bauman, 1998) ther eby increasing proge sterone clearance (Sangsritavong et al., 2002). Previous studies have repor ted beneficial effects of GH and IGF-I on oocyte and embryonic development both in vitro and in vivo. Izadyar et al (1997) detected GH receptors in cumulus cells and demonstrated greater in vitro maturation of bovine oocytes treated with GH. In addition, Izadyar et al. (2000) also reported an enhanced proportion of > 8 cell stage embryos on d 3 postfertili zation, increased percent of blastocysts formation and percent of hatched blastocysts on d 9 postfertilization. Recent studies by Moreira et al. (2002a, 2002b) confirmed these earlier observations wi th the addition of GH and IGF-I increasing development to the blastocysts stage and cell number in vitro and in vivo. In addition, IGF-I has been show n to increase total cell number and reduce the number of blastomeres that become apoptotic in bovine embryos (Jousan and Hansen, 2004). Another way in which bST may incr ease blastocyst development may involve inhibition of apoptosis. These results imply that manipulation of the IGF-I system may enhance embryonic survival in cows exposed to heat stress or other stresses which induce apoptosis. Although bST has direct effects on the ovi duct (Pershing et al., 2002), uterus, and early embryo development (Lucy et al., 1995; Kirby et al., 1996; Mo reira et al., 2002a, 2002b), little is known of bSTs effects after d 7 and before d 32 post AI, which appears to be a critical period for bST to exert di rect embryonic or indi rect effects via the

PAGE 89

67 maternal unit (i.e., uterus) and (or) circulat ing hormones such as IGF-I (Moreira et al., 2001). Another important event within this critical window, on d 16 to 17 after estrus, is maintenance of the CL. Treatment with bST both in vivo and in vitro affected the genes regulating production of PGF2 Badinga et al. (2002) demonstrat ed in a bovine endometrial cell line that both bovine GH and IFNsuppressed PGF2 production induced with phorbol 12,13dibutyrate. When added in combination there was an additive effect in reducing PGF2 secretion. In addition, when endometrium was collected on d 3 and 7 following a synchronized ovulation in lacta ting cows injected with bST, endometrial concentrations of PGHS-2 protein were decreased compared to untreated contro ls (Balaguer et al., 2005). Also, evidence exists for cross-ta lk between hormone signal-transduction systems such as ER with IGF-I (Klotz et al., 2002). Effects of bST on fertility may involve an interaction between bST and IFNsignaling pathways to regulate PG secretion or other components of the PG cascad e critical for maintenance of pregnancy. Kolle et al. (1997) found GHR mRNA in d 13 embryos. Their data suggest that GH may act along with other growth factor s (IGF-I and IGF-II) to increase the development of preimplantation embryos (Kay e, 1997). Furthermore IGF-I receptor is found in all stages of bovine preimplantat ion embryos (Yaseen et al., 2001). Because supplemental bST increases the rate of embr yo development to the blastocyst stage and cell numbers, both in vitro and in vivo bST may subsequently enhance conceptus development that allows for a greater secretion of IFNat d 17 of pregnancy. An increase of IFNmay contribute to an increase in the number of animals establishing pregnancy and a decrease in those experiencing early embryonic loss.

PAGE 90

68 In summary, the previous observations provide definitive evidence that bST increases pregnancy rates when dairy cows are submitted to a TAI synchronization program. Previous studies report benefici al effects on the early embryo through d 7 following TAI, however little is known of bS T effects after d 7 through d 17 which is the critical time for CL maintenance. In addition, supplemental FO feeding may modulate endocrine function, PG cascade, and uterine e nvironment during and before this critical time. Among other objectives, this disserta tion aims to elucidate the mechanism(s) by which both bST and supplemental FO can increas e pregnancy rates with particular focus on d 17 following a synchronized ovulation (C hapters 3-5). In addition, Chapter 6 explores the effects of both bST and FO on fatty acid distri butions among various tissues. The objective of Chapter 7 is to explore effect s of diets enriched in different fatty acids on oocyte quality and ovarian func tion in lactating dairy cows.

PAGE 91

69 Figure 2-1. Pathway of desaturation and elongation of linoleic and linolenic acids sequentially acted upon by -6 desaturase, elongase, and -5 desaturase enzymes.

PAGE 92

70 CHAPTER 3 PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING DAIRY COWS: RESPONSES OF THE OVARIAN, CONCEPTUS AND IGF SYSTEMS Introduction Since approval of bST for use in dairy co ws to increase milk production, the effects of bST on reproductive function have gained considerable interest. An increase in pregnancy rate was detected when bST wa s administered in c onjunction with a TAI program. When lactating dairy cows were treated with bST at the initiation of the Ovsynch protocol, pregnancy rates were gr eater than controls at d 27 and 45 after insemination (Moreira et al., 2000b). In addi tion, when bST was injected at either the initiation of the Ovsynch program or at the time of insemination, lactating dairy cows had greater pregnancy rates than controls (53.2, 44.9, and 38.8%, re spectively; Moreira et al., 2001). Additional studies documented the bene ficial effect of bST on pregnancy rates when given during the period approaching inse mination and to cows considered to be sub-fertile (Santos et al., 2004b; Morales-Roura et al., 2001). In an in vitro study (Moreira et al., 2002b), GH added to the maturation media increased cleavage rates of fertilized ova, but had no significant effect on blastocyst development. Culturing bovine embryos in the presence of GH or rhIGF-I, however, accelerated embryo development by d 8 post-fe rtilization and increased the number of cells per embryo. Moreira et al. (2002a) repo rted that bST treatm ent of superovulated donor cows reduced the number of unfertilized oocytes, increased the number of embryos that developed to the blastocyst stage, and in creased the number of transferable embryos.

PAGE 93

71 Although several studies examined bST eff ects on pregnancy rates and early embryonic development, little is known regarding the physiological mechanisms altered by bST that may increase embryo development up to d 7. Recently, Pershing et al. (2002) examined the effects of bST, when given at the tim e of synchronized ovulation of the Ovsynch protocol, on expression of ovi ductal and uterine genes encoding components of the IGF system. Lactating dairy cows were sla ughtered at either d 3 or 7 following a synchronized estrus (d 0), and oviductal and uterine tissues were analyzed. Steady-state concentrations of IGF-II mRNA were greater in oviducts collected from bST-treated cows than from control cows. Uterine IGFB P-3 mRNA concentrations were greater in bST-treated cows than controls both on d 3 and 7 of the es trous cycle. The mRNA for GHR was decreased in bST-treated cows by d 7. This study revealed the bST regulatory complexity in tissue specific gene expressi on during early pregnancy in lactating dairy cows. These findings, as well as others, give conclusive evidence that bST has direct effects on the oviduct, uterus, and early embryo development (Spicer et al., 1995; Lucy et al., 1995; Kirby et al., 1996; I zadyar et al., 1996; 1997). Howeve r, little is known of bST effects after d 7 and before d 32 post inse mination, which may be a critical period for bST to exert a direct embryonic or indirect effect via the mate rnal unit (i.e., uterus) and/or peripheral responses (Moreira et al., 2001). Another important event within this critical window, on d 16 to 17 after estrus, is maintenan ce of the CL. This process is established by the ability of the conceptus to secrete IFNwhich regulates secretion of PGF2 in the uterine endometrium (Thatcher et al., 2001). At least 40% of total embryonic losses have been estimated to occur between d 8 and 17 of pregnancy (Thatcher et al., 1994). This

PAGE 94

72 high proportion of embryonic losses seems to occur around the same time as the inhibition of PGF2 secretion by the conceptus. Because bST increases rate of embryo de velopment to the blastocyst stage and increases cell number in vitro bST may subsequently enhance conceptus development, allowing for a greater secretion of IFNat d 17 of pregnancy. This increase of IFNmay contribute to an increase in the numb er of animals establishing pregnancy and decrease the percentage of early embryonic loss. The objective of this stu dy was to characterize the effects of exogenous bST on ovarian function, conceptus development, and re gulation of the IGF system in the uterus on d 17 of the estrous cycle in nonlactating Holstein cows as an experimental model. Materials and Methods Materials Gonadotropin-releasing horm one ([GnRH] Fertagyl; In tervet Inc., Millsboro, DE), PGF2 (Lutalyse; Pfizer Anim al Health, Kalamazo, MI), and recombinant bST (Posilac; Monsanto Co., St. L ouis, MO) were used for s ynchronization of ovulation and experimental treatment. Recombinant bIFN(1.08 x 107 units of antiviral activity per mg used as a standard) for the antiviral as say was a generous gift from Dr. Michael Roberts (University of Missouri, Columbia, MO). The cDNAs of GHR-1A, IGF-I, IGFII, IGFBP-2, and IGFBP-3 were a generous gi ft from Dr. Mathew Lucy (University of Missouri, Columbia, MO). All other materi als were purchased from various companies such as: Trizol, Random Primers DNA La beling System (Invitrogen Corporation, Carlsbad, CA), Taq polymerase (cat # M166A ; Promega, Madison, WI), ultrasensitive hybridization buffer (ULTRAhyb, Cat # 8670; Ambion Inc., Austin, TX), dCTP -32P

PAGE 95

73 (cat # 33004x01), Biotrans Nylon membrane (IC N, Irvine, CA), Centriprep Centrifugal Filter Devices (Millipore, Bedford, MA), nitrocellulose membranes (Hybond, Amersham Biosciences Corp., Piscatawa y, NJ), recombinant human IGF-I and IGF-II (Upstate Biotechnology, Lake Placid, NY) and Modified Eagles medium, Vesicular Stomatitis virus, and immortalized bovine kidney cells (MDBK) were purchased from American Type Culture Collection (Manassas, VA). A ll other general materials used were from Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO). Animals and Experimental Design The experiment was conducted at the Univ ersity of Florida Dairy Research Unit (Hague, FL) during the months of Oct ober 2001 through February 2002. Nonlactating Holstein cows in good body condition ( 3.0) were housed together in a free-stall facility with grooved concrete floors and fed a tota l mixed ration twice daily throughout the experiment. The barn was equipped with fans and sprinklers that were operated when the temperature exceeded 25 C. Estrus was presynchronized (P resynch) in 78 cows starting on d 27 (d 0 = TAI) with a GnRH (2 mL, 86 g, i. m.) injection and with an injection of PGF2 (5 mL, 25mg; i.m.) on d 20 (DeJarnette and Marshall, 2003; Figure 3-1). Estrus was detected between d 20 and 10 using the Heatwatch el ectronic estrus-detection system (DDx Inc., Denver, CO; Rorie et al., 200 2). The Ovsynch protocol (Pursley et al., 1997a) was administered beginning on d 10 GnRH (2 mL, 86 g, i.m.) followed 7 d later (d 3) by an injection of PGF2 At 48 h after injection of PGF2 GnRH (d 1) was administered, and 55 cows were inseminate d 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sires; 7H05379). The cycli ng group (n = 23) was not inseminated. Cows

PAGE 96

74 received either a recommended commercia l dose of bST (500 mg) or no bST on d 0 (when cows were either inseminated or not) and again on d 11. The bST injections were given 11 d apart, instead of 14 d, to allow sustained continual exposure to GH until d 17 of slaughter. The bST injections were give n subcutaneously in the space between the ischium and tail head. Ovaries were evalua ted by real-time ultr asonography (Aloka SSD500, Aloka Co., Ltd., Tokyo, Japan) with a 7.5-MH z linear-array transr ectal transducer on d 0, 7, and 16. Follicular responses examined were: numbers of class 2 (6 to 9 mm) follicles, class 3 (> 10 mm) follicles, CL, diam eters of the largest follicle (mm), and the CL tissue volume (mm3). The tissue volume (V) was cal culated using th e length (L) and width (W) of the CL to calculate the averag e diameter and volume (V), with the formula V = 4/3 R3 using a radius (R) calculated by the formula R = (L/2 + W/2)/2. For CL with a fluid filled cavity, the volume of the cavity was calculated and subtracted from the total volume of the CL. Blood samples were collected daily from d 0 to 17 to be analyzed for various hormone concentrations. A follicular cyst was detected on d 7 in 5 cows and CL regression prior to d 16 was observed in 2 cows. These 7 cows were excluded and not slaughtered. Cows (n = 71) were slaughtered on d 17 after TAI to collect tissue samples and verify presence of a conceptus. Pregnancy rates were defined as number of cows classified pregnant base d upon visualization of a conceptus in the flushing at slaughter divided by num ber of cows inseminated. Tissue Sample Collection All cows were sacrificed in the abattoir of the Meats Laboratory at the University of Florida. Reproductive tracts were collected within 10 min of slaughter, placed on ice, and taken to the laboratory. Conceptuses and uterine secr etions were recovered as

PAGE 97

75 described by Lucy et al. (1995) Briefly, 40 mL of PBS was in jected into the uterine horn at the uterotuberal junction contralateral to the CL and massaged gently through the uterine horns, exiting through an incision in the horn ipsilateral to the CL. Uterine luminal flushings (ULF) and the conceptus were recovered into 250-mL beakers. The CL were removed from the ovaries, weighed, a nd their diameter (mm) was measured to calculate total tissue volume as described above. The uterin e horn ipsilateral to the CL was cut along the mesometrial border, and the endometrium was dissected from the myometrium. Endometrial tissue from the anti -mesometrial border of the ipsilateral horn was cut (1 cm 1cm) and frozen in liquid nitrogen for Northern blot analyses. Endometrial tissues were collected from 14 cy cling (7 C and 7 bST-C) and 16 pregnant (7 P and 9 bST-P) cows. The ULF was rec overed from 19 cycling (12 C and 7 bST-C) and 18 pregnant (9 P and 9 bST-P) cows. Interferon-tau Antiviral Assay Activity is expressed in terms of antiviral units per mL as assessed in a standard cytopathic effect assay (Familletti et al., 1981). Three-fold dilutions of ULF from pregnant cows were incuba ted with MDBK cells in 96 well plates for 24 h at 37 C. Following incubation, inhibition of viral replication was determin ed in a cytopathic effect assay using vesicular stomatitis virus as chal lenge. Antiviral units/mL (defined as the dilution causing a 50% reduction in destruction of the m onolayer) was converted to g/mL IFNby using a standard curve with kno wn amounts of recombinant bovine IFN. Total amount of IFN(g/total volume) in the ULF was calculated by multiplying the IFNconcentration by total amount of flushing fl uid recovered for each pregnant cow.

PAGE 98

76 Ribonucleic Acid Isolation and Northern Blotting Total RNA was isolated from endometria l tissues (300 mg; n = 30) with Trizol according to the manufacturers specifications. Total ce llular RNAs (30 g) were resolved into 1.0% agarose-formaldehyde gels and blotted to nylon membranes. Following blotting, RNA was crosslinke d by UV irradiation and baked at 80oC for 1 h. The blots were prehybridized with ULTRAhyb buffer for 1 h at 42 oC. Filters were then hybridized with random primer-P32-labelled bovine specific cDNAs (GHR-1A, IGFI, IGF-II, IGFBP-2, IGFBP-3 and GAPDH; Feinberg and Vogelstein, 1983) overnight at 42oC. The next day, the blots were washed once in 2X SSC/0.1% SDS for 20 min and twice in 0.1X SCC/0.1% SDS for 20 min each at 42oC. The blots were gently patted dry with kimwipes and exposed to X-ray film at -80oC. The autoradiographs were quantified using densitometric analysis (AlphaImager, Alpha Innotech Corp., CA). Once all blots had been labeled with their respective pr obes, blots were stripped, probed for GAPDH, and quantified. Analysis of Hormones in Plasma and ULF Blood samples (7 mL) were collected daily from TAI (d 0) until slaughter (d 17) using a 20-g Vacutainer blood collection needle (Benton Dickinson and Company, Franklin Lakes, NJ) from the coccygeal vein in 3 different locations which were rotated at each bleeding to minimize irritation. Sample s were collected in evacuated heparinized tubes (Vacutainer; Becton Dickson, East Ruth erford, NJ). Immediately following sample collection, blood was stored on ice until it was returned to the laboratory for centrifugation (3000 g for 20 min at 4 C) for collection of plasma within 6 h. Plasma was stored at C until assayed for GH, IGF-I, insulin, and progesterone. Concentrations of progesterone were analyzed using a solid phase RIA kit (Coat-a-count,

PAGE 99

77 DPC, Diagnostic Products Co, Los Angeles, CA ). Plasma samples were analyzed for GH (Badinga et al., 1991), insulin (Malven et al., 1987; Badi nga et al., 1991), and IGF-I (Badinga et al., 1991) by speci fic RIAs. The extraction procedure used for the IGF-I assay (Badinga et al., 1991) was modifi ed slightly using a 6:3:1 ratio of ethanol:acetone:acetic acid. The ULF was c oncentrated from 15 ml to approximately 2 ml with a Centriprep Centrifugal Filter Devi ce fitted with a 3000-MW filter (M illipore, Bedford, MA) and then analyzed for IGF-I and GH using the same RIA procedures. Values for immunoreactive IGF-I and GH were e xpressed as total ng in ULF. Protein concentrations in ULF were determined using the Bradford method (Bradford, 1976). The minimum detectable concentrations for GH, IGF-I, insulin and progesterone were 0.1 ng/mL, 10 ng/mL, 0.02 ng/mL, and 0.1 ng/mL, resp ectively. The intraand inter-assay coefficients of variation for plasma GH, IGF-I, and insulin were 9.7% and 5.4%, 5.3% and 1.9%, 1.7% and 3.5%, respectively. Plas ma concentrations of progesterone were completed in one assay with intra-assay co efficients of variation calculated from duplicated samples in 3 ranges of low (0.5-1 ng/mL; 12.0%), medium (1-3 ng/mL; 8.24%) and high (>3 ng/mL; 7.27%) progesteron e concentrations. The intra-assay coefficient of variation was 9.7% for the lu teal phase plasma reference sample (5.8 ng/mL). A reference pool for ULF resulted in intra-assay coefficien ts of variation of 15.8% and 10.8% for GH and IGF-I, respectiv ely. The intra-assay coefficients of variation for duplicate samples within the complete assay for the ULF GH and IGF-I were 10.0% and 11.5%, respectively. Analysis of Uterine Luminal IGFBPs Ligand blot analysis (De la Sota., 1996) determined the relative abundances of IGFBPs in the ULF. Con centrated ULF proteins (100 g) were subjected to a 12.5%

PAGE 100

78 SDS-PAGE under non-reducing conditions. Pr oteins were then transferred to a nitrocellulose membrane by electrotransfer. The filters were blocked for 1 h with Trisbuffered saline (TBS, pH 7.4) which contai ned 1% non-fat dry milk. The membranes were washed and then incubated in 30 mL of TBS containing 1 106 cpm/mL of [125I]labeled rhIGF-II for 24 h at 4 C. Filters were washed with 5 changes 10 min each in TBS, blotted dry, and exposed to X-ray film for 48 to 72 h. Signals for IGFBPs were quantified by densitometric analysis and the total content of IGFBPs in ULF calculated. The IGFBPs (arbitrary units/100 g) were calcu lated back to the total amount of protein in the ULF recovered, and units expressed as arbitrary units of IGFBPs/total ULF. Statistical Analyses Pregnancy rates were analyzed using th e Chi-square and Logistic Regression procedure examining the main effect of bST. The main effect of bST was also tested for conceptus size (cm) and IFNcontent of ULF utilizing the GLM procedure of SAS (SAS Inst. Inc, Cary, NC). The ovarian responses on d 17 at slaughter were also analyzed using the GLM procedure of SAS te sting the main effect of bST, pregnancy status, and the interaction of bST-pregnancy status. Numb er of CL was used as a covariate for analysis of CL volume on d 17. Numbers of class 2 (6 to 9 mm) and class 3 (> 10 mm) follicles, and CL, as well as largest follicle size, and CL tissue volu me were analyzed using the Mixed Model procedure of SAS (Littell et al., 1996). Cow within bST and pregnancy status was a random effect in the model. The model incl uded fixed effects of bST, pregnancy status, day and the higher order interactions. The CL tissue volume was adjusted for CL number as a covariate.

PAGE 101

79 Plasma hormone concentrations were anal yzed using the homogeneity of regression procedure and the repeated measures analys is in the Mixed Model of SAS. This procedure applies methods based on the mixe d model with special parametric structure on the covariance matrices. The dataset was te sted to determine the covariance structure that provided the best fit for the data. C ovariance structures te sted included compound symmetry, autoregressive order 1, and unstruc tured. The covariance structure used was autoregressive order 1. The model included effects of bST, pregnancy status, and day with the higher order intera ctions using a statement sp ecifying cow within bST and pregnancy status as being random. Day 0 plas ma hormone concentrations were used as a covariate for all respective pl asma hormone concentrations. The PDIFF statement was used for bST-pregnancy status-day to obt ain the probability values for differences between treatments on a particular day. Abundances of IGF-I, IGF-II, IGFBP-2, IG FBP-3 mRNAs in Northern blots were analyzed using the GLM procedure of SAS. Th e main effects of treatment (C, P, bST-C and bST-P), gel and the interaction of trea tment-gel were examined with the abundance values for GAPDH mRNA used as a covariate to adjust for loading gel differences. Predesigned orthogonal contrasts were used to compare treatment means (bST, pregnancy status, and bST-pregnancy status). Total contents of GHIGF-I, IGFBP-3, IGFBP-4 and IGFBP-5 in ULF were analyzed using the GLM procedure of SAS. The mathematical model included the main effects of treatment (C, P, bST-C, and bS T-P) and orthogonal contrasts were used to compare treatment means (pregnancy status, bS T and bST-pregnancy status interaction).

PAGE 102

80 Results Pregnancy Rates, Conceptus Sizes, and Total Amount of IFNin ULF Pregnancy rate at d 17 of nonlactating dairy cows was decreased ( P < 0.01) by bST (27.2%; 9 of 33) compared with control ( 63.6%; 14 of 22) cows. Although pregnancy rates were decreased in bST-treated cows, th e conceptuses that surv ived to d 17 in the bST-P cows had a greater ( P < 0.01) average conceptus lengt h (n = 8; 39.2 4.8 cm) than P cows (n = 10; 20.0 4.3 cm). Furthermore, the amount of IFNin the ULF from bSTP (n = 8) cows was almost three times greater ( P < 0.05) at 7.15 g/total ULF compared with 2.36 g/total ULF in P (n = 10) cows (T able 3-1). However, differences in IFNwere not significant when adjusted for conceptus length as a covariate. Ovarian Responses on Days 7, 16, and 17 Ovarian responses were measured by u ltrasonography on d 7 and 16 in 7 C, 6 P, 7 bST-C and 4 bST-P cows. No significant diffe rences among treatments were detected for the number of class 3 follicles (1.7 0.2), size of the largest follicle (18.0 1.1mm), number of CL (1.2 0.2), and CL tissue volume (8667 2069 mm3). An interaction ( P 0.05), however, was detected between bST and pregnancy status for number of class 2 follicles that decreased in bST-C cows compared with C, P, and bST-P cows on both d 7 and 16 (2.4 < 4.9, 4.2, and 5.5, respectively). On d 17, at the time the reproductive tract was recovered, CL (15 C, 10 P, 5 bST-C, and 9 bST-P) were counted, measured, and weighed. No significant differences were detected between treatment groups for the number of CL and the volume of the CL. However, CL tended ( P 0.10) to be heavier in bST-treated animals than non-bST treated animals (Table 3-1).

PAGE 103

81 Plasma and ULF Hormone Concentrations Daily blood samples were collected from d 0 (day of synchronized estrus) to d 17 after estrus from 22 cows (5 C, 6 P, 7 bSTC, and 4 bST-P). No main effect of bST on progesterone concentrations in plasma wa s detected, but there was a tendency ( P < 0.10) for a treatment day inter action with C cows having gr eater progesterone on d 12, 14, and 16 ( P <0 .05) and a tendency ( P < 0.10) to have greater progesterone on d 11 and 15 (Figure 3-2) compared with P cows The bST injections increased ( P < 0.01) plasma GH concentrations in both bST-C and bST-P co ws compared with the non-bST injected C and P cows (8.5 0.6 and 7.9 0.8 ng/mL vs. 3.1 0.7 and 2.9 0.8 ng/mL, respectively; Figure 3-3). Associated with an increase in plasma GH was an increase ( P < 0.01) in IGF-I in both bST-C and bST-P groups in contrast with C and P groups (601 42 and 635 55 ng/mL vs. 413 50 and 345 45 ng/mL respectively; Figure 3-4). Concentrations of plasma insulin increased ( P < 0.01) in both bST-C and bST-P compared with C and P animals (3.68 0.3 and 3.76 0.4 vs. 1.85 0.4 and 1.97 0.3 respectively; Figure 3-5) with a tenden cy for a bST-status-day interaction ( P 0.10; Figure 3-5.) with th e quadratic curves being different ( P 0.05) for bST-C and bST-P cows. Inspection of the curves indicated in sulin concentrations of bST-C cows were greater before d 9 compared with bST-P, and insulin concentrations were greater after d 9 in bST-P, compared with bST-C animals. Uterine luminal flushings were collected at the time of slaughter on d 17 from 37 cows (12 C, 9 P, 7 bST-C and 9 bST-P) for analysis of GH and IGF-I concentrations. Volumes and protein content of ULF did not differ due to pregnancy status or bST treatment. Total amount of GH in the ULF did not differ. A tendency ( P = 0.07) for an increase in ULF content of IGF-I in bST-C and bST-P cows was detected compared with

PAGE 104

82 C and P cows (202 32 and 161 28 vs. 157 25 and 101 28 ng, respectively; Table 3-2). There was also a tendency ( P < 0.10) for an increase in ULF content of IGF-I in C cows compared with P cows (Table 3-2). Endometrial mRNA Expression of the GH/IGF-I System Northern blot analysis was used to probe the endometrial tissue from d 17 cows for GHR-1A, IGF-I, IGF-II, IGFBP-2, and IG FBP-3 (Figure 3-6). The GHR-1A was undetectable in the endometriu m of all animals. The mRNA transcript sizes (Kb) for IGF-I, IGF-II, IGFBP-2 and IGFBP-3 were 7.5, 4.6, 1.7, and 2.8 Kb, respectively. There were significant interactions ( P < 0.01) between status (P vs C) and bST (+/-) for IGF-I, IGF-II, and IGFBP-3 mRNAs and a comparable ( P < 0.10) trend for IGFBP-2 (Table 32). In general, a slight incr ease in expression was detected for P cows in the absence of bST. In contrast, bST treatment stimula ted the respective responses of C cows. However, the bST induced increases were atte nuated in P cows to a level of expression comparable to P cows not injected with bST. Analysis of ULF for IGFBPs Ligand blot analyses for IGFBPs we re conducted on d 17 ULF from 37 cows (Figure 3-7). Total ULF protein did not di ffer among treatment groups. Five distinct IGFBP bands were detected from 44 to 24 kDa. There was no significant treatment affect on IGFBP-4 (28 and 24 kDa) and IGFBP-5 ( 29 kDa). There was an interaction ( P < 0.10) between status and bST with pregnanc y decreasing IGFBP-3 (44 and 40 kDa), but bST blocked this decrease in bST-P cows (Table 3-2). Simple and Partial Correlatio ns for the GH-IGF System There was no correlation between IGF-I in ULF and circulating concentrations of IGF-I at d 17 (r = 0.17). A series of positive correlations were detected ( P < 0.05).

PAGE 105

83 Plasma concentrations of GH were correlate d with IGF-I in plasma (r = 0.81), IGF-I in plasma was associated with insulin in plasma (r = 0.51), and IGF-I in plasma was associated with GH in ULF (partial correla tion adjusted for treatment [pr = 0.55]). Concentration of GH in ULF was associ ated negatively with IGF-I mRNA ( 0.38), and low expression of IGF-I mRNA was related to enhanced expression of IGF-II mRNA (r = 0.68; pr = 0.77). Growth hormone in the intraute rine environment (i.e., GH in ULF) was correlated with the relative abundan ce of IGFBP-3 (r = 0.59) IGFBP-4 (r = 0.63), and IGFBP-5 (r = 0.63) in the ULF. Alt hough correlations are not proof of causative effects, significant associations were de tected among hormonal components and uterine gene expression of the GH-IGF system at d 17 in cyclic and pregnant animals treated differentially with bST. Discussion In the present study, bST significantl y decreased pregnancy rates when administered at the time of insemination in nonlactating dairy cows following an Ovsynch protocol. Nonlacta ting cows were chosen as the model to eliminate the homeorhetic state of lactati on in evaluating bST effects a nd to reduce the expense. Previous studies have shown that pregnancy ra tes were increased in cyclic, lactating dairy cows when bST was injected at the initiati on of the Ovsynch protocol or near the TAI (Moreira et al., 2000b, 2001; Morales-Roura et al., 2001; Santos et al., 2004b). This difference in response may reflect a complex relationship between the physiological and nutritional st atus (i.e., lactating vs. nonl actating) and reproduction in dairy cows. In dairy heifers receiving eith er a 500 mg dose of bST at 14 d following AI or on both the day of AI and d 14 after AI, pr egnancy rates were reduced compared with

PAGE 106

84 controls that did not receiv e bST (66.7, 66.1, and 94.4%, respectiv ely; Rorie et al., 2004). However, in that study when bST was only gi ven at the time of AI, pregnancy rates did not differ from untreated controls (84.2 vs. 94.4 %). This may have been due to timing of bST injections and (or) the amount of IGF-I stimulation after bST injection. Amount of IGF-I stimulation seemed to have detrim ental effects when bST was administered immediately before the initiation of CL mainte nance for establishment of a pregnancy. In other studies using lactating beef cows and heifers (Bilby et al., 1999), which may have more closely mimicked the physiological status of a nonlactating dairy cow, no effect of a low dose (167 mg) of bST (P osilac) on pregnancy rates wa s detected. In these latter studies, conception rates for bST-treated and control cows were 54.4 and 49.5% (n = 617) for lactating beef cows, and 46.0 and 46.3% for heifers (n = 1123), respectively. Dose of bST may determine the ultima te outcome of reproductive responses because administration of a daily reduced dos e of bST (5 mg/d) improved first-service conception rates and pregnancy rates in cows (S tanisiewski et al., 1992). In contrast, in that study, cows injected with more bST (14 mg/d) had a significant decrease in conception and pregnancy rates compared with those treated with less bST (5 mg/d). Other dose titration studies reported a reduction in estrus detection rate (Morbeck et al., 1991) and an increase in number of cows not-conceiving (Downer et al., 1993) when treated with high doses of bST. Dose and (or) timing of bST in which a pos itive or negative reproductive response occurs may depend upon the stimulatory respon ses of IGF-I and IGFB Ps after injection of bST. The primary determinants of plas ma IGF-I concentrations are nutrition and body condition (Vicini et al., 1991; Mc Guire et al., 1992). Plasma concentrations of IGF-I are

PAGE 107

85 positively associated with body condition and nutrient intake (Housekneckt et al., 1988; Yelich et al., 1996), and low concentrations of IGF-I are associated with an extended postpartum interval to estrus in beef cows and with delayed pubert y (Rutter et al., 1989; Nugent et al., 1993; Roberts et al., 1997). On ce IGF-I concentrations increase in plasma to reach a threshold concentr ation, follicular sens itivity to LH may increase due to an IGF-I induction of LH receptors (Beam and Butler, 1999). With increases in estradiol output by the preovulatory follicle that induces a LH surge, cows resume estrous cycles and can potentially become pregnant. These changes illustrate a positive threshold response of IGF-I on reproduction. The opposite, however, may be true when IG F-I concentrations are overstimulated. Well-fed cows and heifers have greater blood IGF-I concentrations, whereas undernourished cows have reduced plasma concentr ations of IGF-I. The same association exists for nonlactating versus lactating co ws in which nonlactating cows have greater IGF-I concentrations than lacta ting cows (De la Sota et al., 1993; Bilby et al., 1999). In the present study, IGF-I concentr ations may have been hypers timulated with a standard dose of bST (Figure 3-4). It is important to recognize, that in addition to using experimental cows that were nonlactating, cows also were inj ected twice with bST at an interval of 11 d. This was done to ensure a high concentration of bS T for the entire 17-d period to slaughter. Although IGF-I concentrations were sustained throughout the experimental period, the concentrations for both bST-C (601 ng/mL) and bST-P (635 ng/mL) cows were substantially greater th an normally seen in untreated nonlactating cows (214 ng/mL) or bST-treated lactating cows (306 ng/mL; De la Sota., 1993) and growing heifers (117 ng/mL; Lucy et al., 1994). Collectively these studi es indicate that a

PAGE 108

86 critical threshold of GH a nd (or) IGF-I concentrations may exist that stimulates reproductive performance, and exceeding that threshold may decrease reproductive responses. In the present study, a hyperstimulation may have had deleterious effects on embryo development, uterine environment a nd (or) gene expression on or before d 17 (Guzeloglu et al., 2004a). The reason for the deleterious effects of bST in some inseminated cows, and not others, may reflec t differences in among cow sensitivity to GH regarding IGF-I secretion. Another possibl e deleterious effect of bST on pregnancy rates in non-lactating dairy cows may be due to the hyperstimulation of blood insulin secretion. High concentrations of insulin, GH, and IGF-I may be detrimental to early embryo growth. Over stimulation of IGF-I (Armstrong et al., 2001) and probably insulin (Armstrong et al., 2003) is detrimental to foll icle and oocyte development. Excess IGF-I either in vivo or in vitro had deleterious effects on the preimplantation embryo in rats (Katagiri et al., 1996, 1997). In mice, high conc entrations of IGF-I and insulin induced a down regulation of the IGF-I receptor on the bl astocyst, with a subsequent decrease in signaling of IGF-I receptor associated pathways (Chi et al., 2000). This decrease in IGFI receptor reduced glucose upt ake and triggered apoptosis. Women with polycystic ovary syndrome exhibit elevated concentrations of insulin and IGF-I and also experience more pregnancy losses (Sagle et al., 1988; Balen et al., 1993; Tulppala et al., 1993). A threshold may exist in which GH, IGF-I and (o r) insulin goes from being beneficial to detrimental on oocyte and embryo development. Plasma concentrations of progesterone we re greater in C compared with P cows after d 11 following a synchronized induced ovula tion (Figure 3-2). This is contradictory

PAGE 109

87 to earlier reports where uninseminated and inseminated, but not pregnant nonlactating dairy cows, had a slower rise of progesterone compared with pregna nt nonlactating dairy cows during the first 16 d following insemi nation (Mann and Lamming, 2001). In their study, however, cows were administ ered two injections of PGF2 11 to 13 d apart, and inseminations occurred 72 or 96 h after the second inje ction. Their reproductive management system probably did not induce as precise a timing of ovulation as the system used in the present study. A reduced synchrony in CL formation may have contributed to differences in progesterone concentrations between pregnant cows and non-pregnant cows. Even though progesterone concentrations were less in pregnant cows of the present study, no differences in CL tissue volume were detected on d 7, 16, and 17, or CL weight on d 17. Reduced plasma concentrations of progesterone may reflect a greater clearance rate of progesterone by the uterus of pregna nt cows. However, a tendency existed for bST-treated cows to have a heavier CL on d 17. Lucy et al. (1995) also showed that CL weight was increased when lactating dairy co ws were treated with 25 mg/d for 16 d after estrus compared with saline treated controls. Greater CL weight may be due to either GH and (or) IGF-I increasing diffe rentiation of luteal cells (D onaldson and Hansel, 1965) and (or) increased DNA synthesis of luteal cells as shown in vitro (Chakravorty et al., 1993). Although pregnancy rates were decreased in bST-treated cows, the bST-P cows that maintained a conceptus until d 17 had longer embryos (i.e., 2 fold) than non-bST treated cows. Furthermore, with an incr eased conceptus lengt h, the amount of IFNalso was increased threefold. Longer conceptuse s confirm observations of Hansen et al., (1988), who stated that elongation of the embryo is associated with in creased secretion of

PAGE 110

88 IFN, and that most of the increased output of IFNis due to the increased size of the embryo and not increased synthesis per unit weight. In combination with high IFNand IGF-I concentrations of bSTtreated cows, profound effects on the luteolytic mechanisms involved with maternal rec ognition of pregnancy were obs erved (Guzeloglu et al., 2004a). With the substantial differences between conceptus lengths of bST-treated and nonbST treated cows, it is possible that bST a dvanced uterine development such that an asynchronous uterine environment was create d (Guzeloglu et al., 2004a). Change in intrauterine environment could have occu rred by advancing gene expression or by advancing embryonic growth that in turn altered the uterine environment. An asynchronous environment is detrimental to embryo survival as shown in an embryo transfer model (Moore and She lton, 1964). Transfer of embryos to recipients that are not in estrus at the same time as the donors re sulted in altered embr yo development (Lawson et al., 1983). In these studies, embryo de velopment was retarded when embryos were transferred to a less advanced uterus, whereas development was accelerated when embryos were transferred to a more advanced uterus. Perhaps in the present study, bST stimulated a more advanced uterus. Advancement of the uterus and (or) con ceptus may not only be due to the amount of IGF-I in the blood, but may be related clos er to the amount of IGF-I in the uterine lumen and its association with regulato ry binding proteins. In our study, IGF-I concentrations in the ULF tended to be grea ter in bST-treated cows, and particularly stimulated in cyclic cows versus pregnant cows. However, IGFBP3 was greater in bST pregnant cows versus non-trea ted pregnant cows. This increase of IGFBP-3 may be due

PAGE 111

89 to maternal mechanisms compensating for high IGF-I concentrati ons and alleviating some of the IGF-I actions on the developing conceptus. Amount of IGF-I, IGF-II, IGFBP-2, and IGFBP-3 mRNAs in the endometrium had consistent interactions betw een status and bST such that expression was increased in pregnant endometrium versus cyclic endometrium, and bST stimulated a comparable increase in cyclic cows, but not in pregnant cows treated with bST. This appears to be another example in which treatment w ith bST in pregnant cows caused a hyperstimulation in plasma IGF-I that appe ared to induce a local endometrial down regulation in components encoding the IGF sy stem (i.e., IGF-I, IGF-II, and IGFBP-3 mRNAs). This may be a coordinated respons e to possibly maintain homeostasis and (or) a suitable environment for embryo growth. This effect in pregnant cows is likely due to products of the conceptus such as IFN. Bovine IFNregulates gene transcription of endometrial cells via induction of STATs and IFN regulatory factors (i.e., IRF1; Binelli et al., 2001a). Bovine IFNregulates expression of various endometrial proteins such as suppression in transcription of oxytocin and estrogen receptors (Spencer et al., 1995), enhanced expression of Mx (Ott et al., 1998), and ubiquiti n cross-reactive proteins (Johns on et al., 1999). Spencer et al. (1999) demonstrated that pr etreatment of ewes with IFNwas necessary to induce endometrial responsiveness to placental lactogen and GH. Although GHR-1A mRNA was not detected in the present experiment, bST stimulated gene expression of the IGF family within the endometrium of cyclic cows In endometrial tissu es of pregnant cows, however, the bST stimulation was blocked. Lo cal regulatory effect s of the conceptus on

PAGE 112

90 endometrial responsiveness to exogenous hormones such as bST warrant further investigation (i.e., in lactat ing dairy cows whereby bST s timulates pregnancy rates). Conclusions Treatment with bST significantly decreas ed pregnancy rates in nonlactating dairy cows. This appeared to be due to a hypers timulation of IGF-I in nonlactating dairy cows. As a consequence, the uterus and embryo s eem to be advanced in development as reflected by stimulation in conceptus growth. The IGF system within the intrauterine environment (as characterized by gene expr ession in the uterine endometrium and proteins in the uterine lumen) is responsive to treatment with bST. Since previous reports have shown that pregnancy rates are increas ed due to bST in lactating dairy cows, Chapter 4 explores the mechanisms by which bST increases pregnancy rates in lactating dairy cows during the critical period of CL maintenance necessary to sustain a pregnancy.

PAGE 113

91 Figure 3-1. Experimental prot ocol illustrating the sequence of injections, collection of samples, and day of ultrasonography. Day 0 represents the time of ovulation from an induced LH surge. PG = PGF2 TAI = timed AI Dail y blood sam p les 27 20 10 3 107111617 Presynch Ovsynch Ultrasound Detect estrus 16 h GnRH PG GnRH PG GnRH TAI bST Sacr ifice

PAGE 114

92 Table 3-1. Least squares means and pooled SE for conceptus length, IFN(g/total uterine luminal flushing), number of corpora lutea (CL), CL tissue volume (mm3), and CL weight (g) on d 17 after a synchronized es trus (d 0) in nonlactating cyclic (C) and pregnant (P) cows injected with bST (+/-) on d 0 and 11. Treatments1 Contrasts2 Response C P bST-C bST-P S.E. Pregnancy status (P) bST bST P Pregnancy rate 64% (14/22) 27% (9/33) ** Conceptus size2, cm 20.0 39.2 4.6 ** IFN2, g/total ULF 2.36 7.15 1.7 Number of CL3 1.1 1.1 1.2 1.0 0.1 NS NS NS CL volume3, mm3 6555 7474 7669 7773 761.5 NS NS NS CL weight3, g 5.7 5.5 7.2 5.9 0.5 NS NS 1 bST-C = bST-cyclic, bST-P= bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 n = 18. 4 n = 39.

PAGE 115

93 0 1 2 3 4 5 6 7 8 01234567891011121314151617 Days after GnRH (i.e., estrus)Plasma Progesterone (ng/mL ) a * a Figure 3-2. Profiles of plasma progesterone concentrations of cyclic (C) cows ( ) and pregnant (P) cows ( ) from d 0 to 17 of a synchronized estrous cycle (* P < 0.05; aP < 0.10). bST bST

PAGE 116

94 0 2 4 6 8 10 12 14 16 18 20 01234567891011121314151617 Days after GnRH (i.e., estrus)Plasma GH (ng/mL ) Figure 3-3. Profiles of plasma growth hormone (GH) concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchronized estrous cycle. Both bST-C and bST-P cows had greater GH concentrations when injected with bST on d 0 and 11 than C and P cows ( P < 0.01). C = cyclic with bST injection; bST-P = pregnant with bST injection. bST bST

PAGE 117

95 Figure 3-4. Profiles of plasma IGF-I concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchr onized estrous cycle. Both bST-C and bST-P cows had greater IGF-I concen trations when injected with bST on d 0 and 11 than C and P cows ( P < 0.01). C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST in jection; bST-P = pregnant with bST injection. 0 100 200 300 400 500 600 700 800 900 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (i.e., estrus)Plasma IGF-I (ng/mL)) bST bST

PAGE 118

96 0 1 2 3 4 5 6 7 01234567891011121314151617 Days after GnRH (i.e., estrus)Insulin (ng/mL) Figure 3-5. Profiles of plasma insulin concentrations of C ( ), P ( ), bST-C ( ), and bST-P ( ) cows from d 0 to 17 of a synchr onized estrous cycle. Both bST-C and bST-P cows had greater insulin con centrations when injected with bST on d 0 and 11 than C and P cows (P < 0.01). A tendency for bST-pregnancy status-day interaction oc curred, with bST-C animal s having greater insulin concentrations before d 9 than bST-P animals, and bST-P animals having greater insulin concentra tions after day 9 compared with bST-C cows ( P 0.10). C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bST-P = pregnant with bST injection. bST bST

PAGE 119

97 IGF-II mRNA 4.6 Kb C P bST-C bST-P IGF-I mRNA 7.5 Kb C P bST-C bST-P IGFBP-2 mRNA 1.7 Kb C P bST-C bST-P IGFBP-3 mRNA 2.8 Kb C P bST-C bST-P Figure 3-6. Representative Northern blots of IGF-I, IGF-II, IGFBP-2 and IGFBP-3 mRNA. Thirty g of total RNA from 30 cows (7 C, 7 P, 7 bST-C, and 9 bST-P) were used. C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bSTP = pregnant with bST injection.

PAGE 120

98 bST-C C bST-P P KDa 44 40 29 28 24 IGFBP-3 IGFBP-5 IGFBP-4 Figure 3-7. Representative Li gand Blot detected IGFBP-3, IGFBP-4 and IGFBP-5 in the uterine luminal flushings (ULF) of co ws on d 17 after a synchronized estrus (d0). Two hundred g of ULF protein from 37 cows (12 C, 9 P, 7 bST-C and 9 bST-P) were used for Ligand blot analysis. The blots were probed with 125I-IGF-II. Five IGFBP bands were detected with a molecular mass (KDa) of 44, 40, 29, 28 and 24. C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bS T-P = pregnant with bST injection.

PAGE 121

99 Table 3-2. Least squares means and pooled SE for uterine endometrial mRNA, uterine luminal flushings (ULF) protein expre ssion, and hormone concentration at d 17 after a synchronized estr us (d 0) in nonlactating cyclic (C) and pregnant (P) dairy cows injected with bST (+/ -) on d 0 and 11. Arbitrary units (AU) were generated by densitometry a nd mRNA results are adjusted for glyceraldehydes-3-phosphate dehyd rogenase as a covariate. Treatments1 Contrasts2 Response3 C P bST-CbST-P SE Pregnancy status (P) bST bST x P Endometrium (n = 30) IGF-I mRNA, AU 5861 66 58 1.1* ** IGF-II mRNA, AU 5761 62 60 1.1NS ** IGFBP-2 mRNA, AU 5763 67 65 2.2NS ** IGFBP-3 mRNA, AU 5054 60 50 1.1** ** ** ULF (n = 37) GH, ng/ULF 1010 11 12 1.3NS NS NS IGF-I, ng/ULF 157101201 161 28 NS IGFBP-3, AU 2114 20 24 2.7NS NS IGFBP-4, AU 1814 20 19 2.3NS NS NS IGFBP-5, AU 1814 20 19 2.4NS NS NS 1 bST-C = bST-cyclic, bST-P= bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 IGFBP = Insulin-like growth factor binding protein; GH = growth hormone.

PAGE 122

100 CHAPTER 4 PREGNANCY, BOVINE SOMATOTROPIN AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: I. OVARIAN, CONCEPTUS, AND GROWTH HORMONEIGF SYSTEM RESPONSES Introduction Exogenous injections of bST improve lactational performance, increasing milk production by an average of 3 to 5 kg/d (Bau man et al., 1999b). When lactating dairy cows were injected with bST (500 mg) at the initiation of the Ovsynch protocol, pregnancy rates were greater than controls at d 27 and 45 afte r AI (Moreira et al., 2000b). In addition, when bST was injected at either the initiation of the Ovsynch program or at the time of AI, lactating dairy cows, that we re cycling, had greater pregnancy rates than controls (53.2, 44.9, and 38.8%, re spectively; Moreir a et al., 2001). Additional studies have documented the beneficial effect of bST on pregnancy rates when injected during the period approaching AI (Santos et al., 2004b) and to cows considered to be sub-fertile (Morales-Roura et al., 2001). The beneficial effects of bS T on fertilization and embryonic development both in vitro and in vivo of lactating dairy cows are associ ated with the rise in circulating concentrations of GH and IGF-I (Moreira et al ., 2002a, 2002b). Furthermore, bST and IGF-I influence follicle de velopment (Kirby et al., 1997a), uterine luminal fluid composition (Chapter 3), luteal function (Lucy et al., 1998b), and endometrial secretion of PGF2 (Badinga et al., 2002). Pershing et al (2002) examined the effects of bST, given at the time of synchronized ovulation of the Ovsynch protocol, on expression of oviductal and uterine genes encoding com ponents of the IGF system on d 3 and 7

PAGE 123

101 following a synchronized ovulati on. This study revealed the regulatory complexity of bST on tissue specific gene expression of the IGF system during early pregnancy in lactating dairy cows. Although bST has direct effects on th e oviduct, uterus, and early embryo development (Lucy et al., 1995; Kirby et al ., 1996; Moreira et al ., 2002a, 2002b), little is known of bSTs effects after d 7 and before d 32 post AI, which appears to be a critical period for bST to exert direct embryonic or i ndirect effects via the maternal unit (i.e., uterus) and (or) circulating hormones such as IGF-I (Moreira et al., 2001). Another important event within this critical window, on d 16 to 17 after estrus, is maintenance of the CL. This process is established by th e ability of the conceptus to secrete IFNwhich regulates secretion of PGF2 by the uterine endometrium (Tha tcher et al., 2001). At least 40% of total embryonic losses have been es timated to occur between d 8 and 17 of pregnancy (Thatcher et al., 1994). This high proportion of embryonic losses seems to occur around the same time that the conceptus inhibits pulsatile PGF2 secretion. Because supplemental bST increases the rate of embryo development to the blastocyst stage and cell numbers in vitro and in vivo (Moreira et al., 2002a, 2002b), bST may subsequently enhance conceptus development by allowing for a greater secretion of IFNat d 17 of pregnancy. An increase of IFNmay contribute to an increase in the number of animals establishing pregnancy and a decr ease in those experiencing early embryonic loss. An additional strategy to potentially increase embryo survival is the addition of FO to the diet (Mattos et al., 2000) Menhaden fish meal can be used in dairy cow diets as a source of ruminally undegradable protein. Fi sh meal contains oil (8% of DM) with

PAGE 124

102 relatively high concentrations of two PUFAs of the n-3 family, EPA (C20:5) and DHA (C22:6). Feeding fish meal (Mattos et al., 2002) or fish oil (Mattos et al., 2004) to Holstein cows resulted in reduced circulating concen trations of PGF2 when PGF2 release was induced. Also production of PGF2 was reduced by bovine endometrial cells incubated with EPA and DHA (Mattos et al ., 2003). Thus EPA and DHA may contribute to the antiluteolytic effect of early pregnancy and increase embryo survival. Supplemental feeding of LCFA increased preg nancy rates (Son et al., 1996; Sklan et al., 1991), progesterone concentration in plasma (S klan et al., 1991), CL longevity (Williams, 1989), embryo development and quality (Cer ri et al., 2004), and regulated gene expression (Sessler and Ntambi 1998). However, few studi es have investigated the effects of LCFA, bST, and their inter action on the uterine environment. The objective of this stu dy was to characterize the effects of exogenous bST, dietary fatty acids enriched in FO, a nd pregnancy on ovarian function, conceptus development, and regulation of the GH-IGF sy stem in the uterus on and before d 17 of the estrous cycle in lactating Holstein cows. Materials and Methods Materials GnRH (Fertagyl; Intervet Inc., Millsboro, DE), PGF2 (Lutalyse; Pfizer Animal Health, Kalamazo, MI), and bST (Posilac; Mo nsanto Co., St. Louis, MO) were used for synchronization of ovulation and experime ntal treatment. Recombinant bIFN(1.08 x 107 international units [IU] of antiviral activity per mg used as a standard) for the antiviral assay was a generous gift from Dr. Michael R oberts (University of Missouri, Columbia, MO). The cDNAs of GHR-1A, IGF-I, IGFII, IGFBP-2, and IGFBP-3 were a generous gift from Dr. Mathew Lucy (University of Mi ssouri, Columbia, MO). All other materials

PAGE 125

103 were purchased from various companies su ch as: Trizol, Random Primers DNA Labeling System (Invitrogen Corporation, Carlsb ad, CA), Taq polymerase (cat # M166A; Promega, Madison, WI), ultrasensitive hybridization buffer (ULTRAhyb; Ambion Inc., Austin, TX), dCTP -32P (MP Biomedicals, Irvine, CA), Biotrans Nylon membrane (MP Biomedicals, Irvine, CA), RNAqueous-4 P CR kit and RNase-free DNase (Ambion Inc, Austin, TX), real-time PCR probes (Biosear ch Technologies; Novato California), TAQ Gold polymerase, Moloney murine leukemia virus reverse transcriptase, and 18S RNA control Reagent (Applied Biosystems; Foster City, CA), Centriprep Centrifugal Filter Devices (Millipore, Bedford, MA), nitrocellulose membranes (Hybond, Amersham Biosciences Corp., Piscatawa y, NJ), recombinant human IGF-I and IGF-II (Upstate Biotechnology, Lake Placid, NY) Modified Eagles medium, and immortalized MadinDarby bovine kidney cells were purchased from American Type Culture Collection (Manassas, VA). All other general materi als used were from Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO). Animals and Experimental Diets The experiment was conducted at the Univ ersity of Florida Dairy Research Unit (Hague, FL) during the months of October 2002 through February 2003. All experimental animals were managed according to the guidelines approved by the University of Florida Animal Care and Use Committee. Forty multiparious Holstein cows in late gestation were housed in sod-based pens and fe d diets formulated to contain 1.51 Mcal NEL/kg, 13.1% CP, and a cation anion diffe rence of -90 meq/kg (DM basis) beginning approximately 3 wk prior to expe cted calving date. U pon calving, cows were moved to a free-stall facility with grooved concrete floors equipped with fans and sprinklers that operated when the temperature exceeded 25 C. All experimental cows

PAGE 126

104 were offered ad libitum amounts of a total mixe d ration to allow 5 to 10% feed refusals daily. Two dietary treatments were fed cont aining 0 or 1.9% calcium salt of a fish oil enriched lipid (FO) product (EnerG-II Reproduction formula, Virtus Nutrition, Fairlawn, OH). The fatty acid profile of the fat s ource as given by the manufacturer was 2.2% C14:0, 41.0% C16:0, 4.2% C18:0, 30.9% C18: 1, 0.2% C18:1 trans, 8.0% C18:2, 0.5% C18:3, 0.4% C20:4, 2.0% C20:5, 2.3% C22: 6, and 2.7% unknown. The control diet contained a greater concentr ation of whole cottonseed a nd therefore was similar in concentration of ether extract and NEL (Table 4-1) to that containing FO. The control diet was fed to all cows during the first 9 DIM. Thirty cows were a ssigned to the control diet for the duration of th e study. From 10 to 16 DIM, ten cows were assigned to consume a FO diet containing half the final concentration of the fat product (0.95% of dietary DM) in order to adjust the cows to a new fat source. Starting at 17 DIM, these cows were switched to the 1.9% FO diet and continued on that diet until the end of the study. Cows fed the ruminally protected FO consumed approximately 14.8 g/cow per day of EPA and DHA. Dry matter of corn silage was determined weekly (55C for 48 h), and the diets were adjusted accordingly to maintain a constant forage:concentrate ratio on a DM basis. Samples of forages and concentr ate mixes were collected weekly, composited monthly and analyzed by wet chemistry methods for chemical composition (Dairy One, Ithaca, NY; Table 4-1). Cows were milked three times per day and milk weights were recorded by calibrated electro nic milk meters at each milking. Body weights were measured and BCS (Wildman et al., 1982) assigned weekly by the same two individuals.

PAGE 127

105 Estrus Synchronization, Ultrasonogra phy of Ovaries, and bST Treatment Estrus was presynchronized starting at 44 5 DIM (d 27 in relation to day of TAI using an injection of GnRH (2 mL, 86 g, i.m.) followed 7 d later with an injection of PGF2 (5 mL, 25 mg, i.m.) on d 20 (DeJarnette and Marshall, 2003; Figure 4-1). Estrus was detected during the next 10 d using the Heatwatch electronic estrus-detection system (DDx Inc., Denver, CO; Rorie et al., 2002). At the end of 10 d, the Ovsynch protocol (Pursley et al., 1997a) was initiated using a GnRH injection (2 mL, 86 g, i.m.) followed 7 d later by an in jection of PGF2 (5 mL, 25 mg, i. m.). At 48 h after injection of PGF2 GnRH (2 mL, 86 g, i.m.) was administere d, and 16 cows fed the control diet were inseminated 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sire s, Plain City, OH; 7H05379). The cycling group (n = 19) was not inseminated. Inseminated and non-inseminated cows received either an injection of bST (500 mg) or no injection on d 0 (when cows were either inseminated or not) and again on d 11. The bST injections were given 11 d apart instead of 14 d, to allow for a sustained continual exposure to GH until d 17 at which time cows were slaughtered. The bST injecti ons were given subcutaneously in the space between the ischium and tail head. Ovar ies of both inseminated and non-inseminated cows were evaluated by real-time ultr asonography (Aloka SSD-500, Aloka Co., Ltd., Tokyo, Japan) using a 7.5-MHz linear-array transrectal transducer on d 0, 7, 9, 11, 13, 15, 16, and 17. Follicular responses examined the following: numbers of class 1 (2 to 5 mm), class 2 (6 to 9 mm), and class 3 ( 10 mm) follicles, number of CL, diameter of the largest follicle (mm), a nd volume of CL tissue (mm3). The volume of CL tissue was calculated using the following equation: volume = 1.333 x x radius3, where radius =

PAGE 128

106 (length/2 + width/2)/2. For CLs with a fluid-filled cav ity, the volume of the cavity was calculated and subtracted from the total volume of the CL. Three cows were excluded for various health concerns, and CL regression prior to d 17 was observed in two cows. These five cows were excluded from the study. Cows (n = 35) were slaughtered on d 17 after TAI to collect tissue samples and verify presence of a conceptus. Pregnancy rates were defined as number of cows classified pregnant based upon visualization of a conceptus in the uterine flushing at slaughter divided by number of cows inseminated. From the inseminated cows that were slaught ered, 6 cows not treated with bST and 1 cow treated with bST were not pre gnant. These 7 cows were not used for any analyses from d 0 to 17 following TAI. Number of cows used for analyses from d 0 to 17 in each group was as follows: control diet had 5 bST-treated cyclic (bST -C), 5 non bST-treated cyclic (C), 5 bST-treated pregnant (bST-P), and 4 non bST-treated pregnant (P) cows; FO diet had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows. Tissue Sample Collection All cows were sacrificed in the abattoir of the Department of Animal Sciences at the University of Florida. Reproductive tracts were collected within 10 min of slaughter, placed on ice and taken to the laboratory. Conceptuses and uterine secretions were recovered as described by Lucy et al. (1995). Briefly, 40 mL of PBS were injected into the uterine horn at the uterot uberal junction contralateral to the CL and massaged gently through the uterine horns, exiti ng through an incision in the ho rn ipsilateral to the CL. Uterine luminal flushing media and conceptus were recovered in 250-mL beakers. The CL were removed from the ovaries, weighed, and diameter (mm) measured to calculate total tissue volume. The uterine horn ipsilate ral to the CL was cu t along the mesometrial border, and the endometrium was dissected from the myometrium. Endometrial tissue

PAGE 129

107 from the anti-mesometrial border of the ips ilateral horn was sectioned (1 cm 1 cm) and frozen in liquid nitrogen for Northern blot analyses. Endometrial tissues and ULF were collected from 11 cycling (5 C and 6 bST-C) cows fed the control diet, 8 cycling cows fed a FO diet (4 FO, and 4 bST-FO) and 9 pregnant (4 P and 5 bST-P) cows fed the control diet. Interferon-tau Antiviral Assay Activity is expressed in terms of antiviral units per mL as assessed in a standard cytopathic effect assay (Familletti et al., 1981). Three-fold dilutions of ULF from pregnant cows were incubate d with Madin-Darby bovine kidn ey cells in 96 well plates for 24 h at 37 C. Following incubation, inhibition of viral replication was determined in a cytopathic effect assay using the vesicular st omatitis virus. Antiviral units/mL (defined as the dilution causing a 50% reduction in dest ruction of the monolayer) were converted to g/mL of IFNby using a standard curve with known amounts of recombinant bovine IFN. Total amount of IFN(g/total volume) in the ULF was calculated by multiplying the IFNconcentration by total amount of flushing fluid recovered for each pregnant cow. Quantitative Real-Time Reverse Transcription-PCR Quantitative real-time reverse transcriptio n-PCR was used to measure the relative abundance of IFNmRNA in conceptuses. Total cellular RNA was extracted from conceptuses with the RNAqueous-4 PCR kit. All samples were incubated with RNasefree DNase at the end of RNA extraction and again immediately before reverse transcription. The total cellular RNA (20 ng) was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase. Reactions that were not exposed to reverse

PAGE 130

108 transcriptase were included on a subset of sa mples to verify that samples were free of genomic DNA contamination. Specific primer s and probe sets were used for amplifying reverse transcription product from con ceptus samples (Table 4-2). The IFNprimers and probe were developed to recogn ize every known bovine and ovine IFNisoform. The IFNprobes were labeled with a fluorescent 5' reporter dye (FAM) and 3' quencher (BHQ-1). Forty-five cycles of PCR were completed using TAQ Gold polymerase and the ABI PRISM 7700 Sequence Detection System. Abundance of 18S RNA was used as a loading control by adding 18S primers and an 18S probe containing a VIC-labeled 5' fluorescent reporter and 3' TAMRA quencher wi thin the Real-Time PCR reactions. Each RNA sample was analyzed in triplicate reactions. The comparative threshold cycle (CT) method was used to quantify the abundance of bovine IFNmRNA relative to that of 18S R NA (ABI Prism Sequence Detection System User Bulletin No. 2; Applied Biosystems). The CT number for FAM (IFNmRNA) and VIC (18S RNA) fluorescence was calc ulated within the geometric region of the plot generated during PCR. The CT value was determined by subtracting the 18S CT value from the bovine IFNCT value of the same sample. The CT for each sample was calculated by subtracting the highest sample CT value (i.e., the sample with the lowest target expression) from the re maining values. Since each unit of CT difference is equivalent to a doubling in the amplified PCR product, fold change s in relative bovine IFNmRNA abundance was determined by solving for 2CT. Ribonucleic Acid Isolation and Northern Blotting Total RNA was isolated from endometrial tissues (300 mg of fr esh weight; n = 28) with Trizol according to the manufacturers specifications. Tota l cellular RNA (30 g) was loaded into 1.0% agarose-formaldehyde gels and blotted to nylon membranes.

PAGE 131

109 Following blotting, RNA was crosslinke d by UV irradiation and baked at 80oC for 1 h. The blots were prehybridized with ULTRAhyb buffer for 1 h at 42oC. Filters were then hybridized with random primed-P32-labelled bovine specific cDNAs (GHR-1A, IGF-I, IGF-II, IGFBP-2, IGFBP-3 and GAPDH; Feinbe rg and Vogelstein, 1983) overnight at 42oC. The next day, the blots were washed once in 2X SSC/0.1% SDS for 20 min and twice in 0.1X SSC/0.1% SDS for 20 min each at 42oC. The blots were patted dry gently with kimwipes and exposed to X-ray film at -80oC. The autoradiographs were quantified using densitometric analysis (AlphaImager, Alpha Innotech Corp., CA). Once all blots had been labeled with their respective probes, blots were stripped, probed, and quantified for GAPDH. Analysis of Hormones in Plasma and Uterine Luminal Flushings Blood samples (7 mL) were collected just after the afternoon feeding (1300 h) twice weekly from 14 DIM until 44 5 DIM and daily from TAI (d 0; 77 12 DIM) until slaughter (d 17; 94 12 DIM) from the co ccygeal vein or artery in three different locations, which were rotated at each bleeding to minimize irritation. Vacutainer blood collection needles (20 g; Benton Dickinson and Company, Franklin Lakes, NJ) were used. Samples were collected in evacua ted heparinized tubes (Vacutainer; Becton Dickson, East Rutherford, NJ). Immediat ely following sample collection, blood was stored on ice until it was returned to the laboratory for centrifugation (3000 g for 20 min at 4 C) for collection of plasma within 6 h. Plasma was stored at C until assayed for GH, IGF-I, insulin, and pr ogesterone. Concentrations of progesterone were analyzed using a solid phase RIA kit (Coat-A-Count Progesterone, DPC, Diagnostic Products Co., Los Angeles, CA) validated in our laborator y (Garbarino et al., 2004). Plasma samples were analyzed for GH (Badinga et al., 1991), in sulin (Malven et al., 1987; Badinga et al.,

PAGE 132

110 1991), and IGF-I (Badinga et al., 1991) by speci fic RIA. The extraction procedure used for the IGF-I assay (Badinga et al., 1991) was modified slig htly using a 6:3:1 ratio of ethanol:acetone:acetic acid. The ULF was c oncentrated with a Centriprep Centrifugal Filter Device fitted with a 3000MW filter and then analyzed for IGF-I and GH using the same RIA procedures. Values for immunoreactive IGF-I and GH were expressed as total ng in ULF. Protein concentr ations in ULF were determined using the Bradford method (Bradford, 1976). The minimum detectable co ncentrations for GH, IGF-I, insulin, and progesterone were 0.1, 10, 0.02, and 0.1 ng/mL, resp ectively. The intraand interassay coefficients of variation for plasma progesterone, GH, IGF-I, and insulin were 7.7 and 6.0%, 9.1 and 4.9%, 7.0 and 4.9%, and 4.8 and 7.8%, respectively. Plasma concentrations of progesterone had intraassay coefficients of variation calculated from duplicated samples in three ranges of low (0.5-1 ng/mL; 6.8%), medium (1-3 ng/mL; 7.4%) and high (>3 ng/mL; 4.3%) progesterone concentrations. A reference pool for ULF resulted in intraassay coefficients of variation of 5.3 and 8.3% for GH and IGF-I, respectively. The intraassay coefficients of variation for duplicate concentrated samples within the complete assay for the total amount of GH and IGF-I in the ULF were 11.5 and 17.4%, respectively. Analysis of Uterine Luminal IGFBP Ligand blot analysis (De la Sota., 1996) determined the relative abundances of IGFBP in the ULF. One hundred g of concen trated ULF proteins were subjected to a 12.5% SDS-PAGE under non-reducing conditions. Proteins were transferred to a nitrocellulose membrane by electrotransfer. The filters were blocked for 1 h with Trisbuffered saline (TBS, pH 7.4) which cont ained 1% [w/v] non-fat dry milk. The membranes were washed and then incuba ted in 30 mL of TBS containing 1 106

PAGE 133

111 cpm/mL of [125I]-labeled recombinant human IGF-II for 24 h at 4 C. Filters were washed with five changes, 10 min each in TBS, blo tted dry, and exposed to X-ray film for 48 to 72 h. Signals for IGFBP were quantified by de nsitometric analysis and the total content of IGFBP in ULF calculated. The IGFBP (arbit rary units/100 g) were calculated back to the total amount of protein in the ULF recovered, and units expressed as arbitrary units of IGFBP/total ULF. Statistical Analyses All variables analyzed prior to the start of presynchronization as well as BCS, body weight, and milk production for the entire study were analyzed using homogeneity of regression analyses for polynomial response cu rves utilizing the GLM procedure of SAS (SAS Inst. Inc, Cary, NC). Regression analys es were performed to determine the best-fit curves among treatments in relation to DIM, and the regressions that did not differ among treatments were pooled to char acterize the response as relate d to DIM. Linear, quadratic, cubic, quartic and quintic curves were tested. All variables were analyzed with the main effects of treatment, DIM and the intera ction of treatment-byDIM. Milk production response was adjusted for parity. Cow with in treatment or treatment-parity were considered as a random variable. Pregnancy rates were analyzed using th e Chi-square and Logistic Regression procedures to examine the main effect of bST. The main effect of bST injection on conceptus size (cm), IFNprotein content of ULF and IFNmRNA concentration in the conceptuses were evaluated utilizing the GLM procedure of SAS. The ovarian responses were analyzed using the GLM procedure of SAS testing the main effects of bST, pregnancy status, and the inte raction of bST-pregnancy stat us. A separate series of

PAGE 134

112 analyses examined effects of bST, FO, and th e interaction of bST by FO. Number of CL was used as a covariate for analysis of CL volume on d 17 post AI. During the post-ovulation period, numbers of follicles and CL, as well as diameters of the largest follicle, and volume of CL tissue were analyzed using the Mixed Model procedure of SAS (Littell et al., 1996). Th is procedure applies methods based on the mixed model with special parametric structur e on the covariance matrices. The data set was tested to identify the covariance structur e that provided the be st fit for the data. Covariance structures tested included compound symmetry, au toregressive order 1, and unstructured. The covariance structure used was autoregressive order 1. Cow within bST and pregnancy status or bST and FO were random effects in the model. Two mathematical models used to evaluate trea tment effects were the following: 1) bST, pregnancy status, day and higher order interac tions and 2) bST, FO, day and higher order interactions. The volume of CL tissue was adjusted for CL number as a covariate. Plasma hormone concentrations were anal yzed using the homogeneity of regression procedure (Proc GLM, SAS, Wilcox et al., 199 0) and the repeated measures analysis in the Mixed Model of SAS as described previo usly. The model included effects of bST, pregnancy status, and day or bST, FO and da y with the higher order interactions using a statement specifying cow nested within bST a nd pregnancy status or cow nested within bST and FO as being random. Concentration of plasma hormone at TAI was used as a covariate for all respective plasma hormone concentrati ons during the post-ovulatory period. The PDIFF statement of SAS was us ed to obtain the probability values for differences between treatments on a particul ar day when tests were significant for bSTpregnancy status-day and fo r bST-FO-day interaction.

PAGE 135

113 Abundances of IGF-I, IGF-II, IGFBP-2, IG FBP-3 mRNA in Northern blots were analyzed using the GLM procedure of SAS. The main effects of treatment (C, FO, P, bST-C, bST-FO, and bST-P), gel and the inter action of treatment-gel were examined with the abundance values for GAPDH mRNA used as a covariate to adjust for loading gel differences. Pre-designed or thogonal contrasts were used to compare treatment means (bST, pregnancy status, and bS T-pregnancy status interaction or bST, FO, and bST by FO interaction). Total contents of GH IGF-I, IGFBP-3, and IGFBP-4 in ULF were analyzed using the GLM procedure of SAS. The mathemati cal models included the main effects of treatment (C, FO, P, bST-FO, bST-C, and bSTP) and orthogonal contrasts were used to compare treatment means (bST, pregnancy stat us, and bST-pregnancy status interaction or bST, FO, and bST by FO interaction). Results Weight, BCS, and Milk Production before the Start of Synchronization Weekly measurements of BCS and body wei ght and daily measurements of milk production were recorded starting at 10 DIM until cows were sacrificed. Regression analysis did not detect a difference between treatments for body weight or BCS. Body weight followed a cubic pattern as described by the following equation: = 630.87 1.999x + 0.0443x2 0.00025x3, where = body weight and x = DIM; P < 0.01, R2 reg = 0.18. The BCS followed a quartic pattern as described by the following equation: = 3.35 0.036x + 0.0012x2 0.000015x3 + 0.000000065x4, where = BCS and x = DIM; P < 0.01, R2 reg = 0.28. Third order milk production curves between cows fed the FO and control diets differed with cy cling cows fed FO producing as much as 3 kg more milk than cyclic control-fed cows (FO: = 13.12 + 0.923x 0.0117x2 + 0.000045x3; Cyclic

PAGE 136

114 control-fed cows: = 16.51 + 0.808x 0.0137x2 + 0.000085x3, where = milk production and x = DIM; P < 0.01, R2 reg = 0.46; Figure 4-2). Ovarian and Uterine Responses before the Start of Synchronization The number of class 1 follicles was greater ( P < 0.05) in cows fed FO compared to cyclic control-fed cows (34.5 2.4 vs. 28.0 1.2, respectively). The number of class 2 follicles (3.9 0.3), class 3 follicles (2.3 0.2), number of CL (0.5 0.1) CL size (199 19 mm3), size of the largest foll icle (15.1 0.8 mm), size of the nonpregnant uterine horn (2.9 0.1 cm) and size of the previous pre gnant uterine horn ( 3.1 0.1 cm) were not affected by FO. As expected, the number of follicles, number of CL, CL size, size of largest follicle, size of nonpre gnant uterine horn, and size of previous pregnant uterine horn differed according to DIM ( P < 0.01). However, regression curves did not differ between treatments in relation to DIM (i.e., x) so the overall pooled regression equations and R2 values are presented for the respective variables (i.e., ). The number of class 1 follicles ( = 25.02 + 0.263x, P < 0.01, R2 reg = 0.08) and class 2 follicles (y = 2.51 + 0.0496x, P < 0.01, R2 reg = 0.05) increased linearly with DIM. Regression analysis revealed second order curvil inear relationship for number of class 3 follicles ( = -0.03 + 0.135x 0.0019x2, P < 0.01, R2 reg = 0.05), number of CL ( = -1.11 + 0.096x 0.0014x2, P < 0.01, R2 reg = 0.13), CL size ( = -496.60 + 40.356x 0.5372x2, P < 0.01, R2 reg = 0.17), and size of largest follicle ( = 9.12 + 0.297x 0.00242x2, P < 0.01, R2 reg = 0.08) in relation to DIM. The size (cm) of the previous pregnant ( = 4.25 0.044x, P < 0.01, R2 reg = 0.19) and nonpregnant uterine horns ( = 3.46 0.023x, P < 0.01, R2 reg = 0.08) decreased linearly with DIM.

PAGE 137

115 Concentrations of Plasma and ULF Hormon es before the Start of Synchronization Beginning on d 14 3 until d 44 3 postpartum, blood samples were collected twice weekly from 36 cows (9 FO and 27 cont rol-fed). Insulin con centrations increased linearly with increasing DIM, with the cyclic co ntrol-fed cows increasing at a faster rate ( = 0.56 + 0.011x, P < 0.01, R2 reg = 0.14) compared with cows fed FO ( = 0.75 + 0.0012x, P < 0.01, R2 reg = 0.14; Figure 4-3). Regression analysis of plasma GH, IGF-I, and progesterone concentrations over DIM di d not detect differences between dietary treatments. The overall pooled regression e quations with DIM (i.e ., x) are presented. Both GH and IGF-I concentrations had a linear relationship to DIM with GH concentrations decreasing ( = 7.46 0.042x, P < 0.01, R2 reg = 0.04; Figure 4-4) and IGFI concentrations increasing over time ( = 85.27 + 0.922x, P < 0.01, R2 reg = 0.05; Figure 4-4). A second order curve was detected for progesterone concentrations in relation to DIM (progesterone: = -3.54 + 0.281x 0.0036x2, P < 0.01, R2 reg = 0.19). Pattern for accumulated progesterone concentrations ( = 4.90 0.714x + 0.0287x2 0.00017x3, P < 0.01, R2 reg = 56.04), days to first ovulation (23.5 2.4 d) and percent of cows cycling before the start of presynchronization (51.9 13.3%) were not different between cows fed diets of 0 or 1.9% FO. Milk Production after an Induced Ovulation Treatment with bST increased milk production ( P < 0.01) described by second order curves (i.e., bST vs. C) during da ys of the synchronized estrous cycle ( = 33.30 0.125x 0.0029x2, = bST and x = days of the estrous cycle; R2 reg = 0.06; Figure 4-5). The bST given on d 0 and 11 relative to AI, in creased milk production as much as 7 kg/d compared with cows not injected with bST.

PAGE 138

116 Ovarian Responses after an Induced Ovulation Ovarian structures were measured by u ltrasonography on d 0 (day of synchronized ovulation), 7, 9, 11, 13, 15, 16, and 17 in 5 C, 4 FO, 4 P, 6 bST-C, 4 bST-FO, and 5 bSTP cows, respectively. No differences among treatments were detected for the mean number of class 3 follicles (2.6 0.4), size of the largest follicle ( 19.1 1.0 mm), size of the second wave follicle (10.8 1.3 mm), and number of CL (1.1 0.1). Pregnant cows tended (P < 0.10) to have greater volume of CL tissue compared with cyclic cows fed the control diet (10742 722 vs. 8803 681 mm3). From d 9 to 16 post AI, the number of class 1 follicles was influenced by bST injecti on and pregnancy status. Of those cows fed the control diet, giving bST to cows that were pregnant resulted in an increase in the number of class 1 follicles whereas those that were pregnant without a bST injection had a decrease in the number of class 1 follicles ; cyclic cows had no change in this number (bST by pregnancy by day interaction, P < 0.05) Pregnant cows tended to have more class 2 follicles on d 13 and 16 compared with cyclic cows fed the control diet (6.3 0.8, 5.3 0.8 vs. 3.2 0.7, 3.4 0.7, respectively) but nu mbers were not different at the other days (pregnancy status by da y interaction; P < 0.10). Plasma and ULF Hormone Concentrations after an Induced Ovulation Daily blood samples were collected from d 0 (day of synchronized ovulation) to d 17 after estrus from 28 cows (n = 5 for C, 4 for FO, 4 for P, 6 for bST-C, 4 for bST-FO and 5 for bST-P). Feeding FO did not alte r progesterone concentrations in plasma. Pregnant cows tended ( P < 0.10) to have lower progester one concentration between d 0 and 11 compared to cyclic control-fed cows (pregnancy by day intera ction; Figure 4-6). Also bST ( P < 0.05) lowered progesterone concentr ations in plasma for cyclic and

PAGE 139

117 pregnant cows fed the control diet relative to comparable cows not injected with bST (Figure 4-7). The bST injections increased ( P < 0.01) mean concentrati on of plasma GH in bSTC, bST-FO, and bST-P cows compared with the non-bST injected C, FO, and P cows (14.2 1.1, 20.0 1.2 and 20.5 1.2 ng/mL vs. 6.0 1.1, 6.7 1.2 and 5.9 1.3 ng/mL, respectively; Figure 4-8). There were significant ( P < 0.05) interactions between cyclic cows fed the control or FO diet and also be tween cyclic cows fed the control diet and pregnant cows. Administrati on of bST increased mean GH c oncentrations in bST-C but not to the extent of bST-FO and bS T-P cows (14.2 1.1 vs. 20.0 1.2, 20.5 1.2, respectively; Figure 4-8). Associated with increases in plasma GH were increases ( P < 0.01) in IGF-I for both bST-C and bST-P groups in contrast with C and P groups (211 17 and 261 18 ng/mL vs. 152 17 and 150 19 ng/mL respectively; Figure 4-9). The curves of the concentration of plasma IG F-I for the bST-P and bST-C groups followed different fourth-order patterns with th e pregnant cows maintaining their peak concentration the last wk of measur ement (pregnancy by day interactions; P < 0.05; Figure 4-9). In addition, injecting bST into cows fed the control diet resulted in a gradual rise in concentration of plasma IGF-I fr om d 0 to d 8 followed by a gradual decrease compared to a fairly constant and lower c oncentration of circulating IGF-I in cows injected with bST and fed FO (bST-C vs. bST-FO by day interaction, P < 0.05; Figure 410). Mean concentrations of plasma insulin decreased ( P < 0.01) in both FO and bST-FO treatments compared with both C and bS T-C cows (0.9 0.1 and 1.0 0.1 vs. 1.5 0.1 and 1.2 0.1 respectively) with a tenden cy for a bST-by-fish oil interaction ( P 0.10; Figure 4-10).

PAGE 140

118 Ovarian and Uterine Responses at Day 17 On d 17, at the time the reproductive tract was recovered, CL (n = 5 for C, 4 for FO, 4 for P, 6 for bST-C, 4 for bST-FO, a nd 5 for bST-P) were counted, measured, and weighed. No differences were detected among treatment groups for the weight of the CL. Injecting bST tended to reduce the number of CL in the cyclic control-fed cows while increasing the number of CL in the fish oil-fe d cows and in the pre gnant control-fed cows (Table 4-3). Volume of the CL was increased ( P < 0.01) in pregnant compared with cyclic cows fed the control diet (11,171 vs. 7686 mm3; Table 4-3). Uterine luminal flushings were collected at the time of slaughter on d 17 from 28 cows (n = 5 for C, 4 for FO, 4 for P, 6 fo r bST-C, 4 for bST-FO and 5 for bST-P) for analysis of GH and IGF-I concentrations. Volumes and protein content of ULF did not differ due to pregnancy status, diet or bST treatment. Total amounts of GH or IGF-I in the ULF did not differ (Table 4-3). Pregnancy Rates, Conceptus Sizes, IFNmRNA and Protein, and ISG-17 Protein at Day 17 Pregnancy rate at d 17 tended to increase ( P < 0.09) due to bST (83.3%; 5 of 6) compared with non-bST-treatment (40.0%; 4 of 10). Not only were pregnancy rates increased in bST-treated cows, the conceptuse s that survived to d 17 in the bST-P cows tended to have a greater ( P < 0.09) mean length (45.4 4.5 cm) than P cows (34.3 5.1 cm). Furthermore, the amount of IFNin the ULF from bST-P cows was almost two times greater ( P < 0.05) at 9.4 g/total ULF compared with 5.3 g/total ULF in P cows (Table 4-3). However, differences in IFNamount were not differe nt when adjusted for conceptus length as a covariate. The relative abundance of IFNmRNA in conceptus

PAGE 141

119 tissue and the amount of interferon stimulated gene-17 prot ein in the endometrial tissue on d 17 was not affected by bS T injections (Table 4-3). Endometrial mRNA Expression of the GH-IGF-I System at Day 17 Northern blot analyses were used to probe the endometrial tissue from d 17 sacrificed cows for GHR-1A IGF-I, IGF-II, IGFBP-2, a nd IGFBP-3. The GHR-1A was undetectable in the endometrium of all animals. The mRNA transcript sizes for IGF-I, IGF-II, IGFBP-2 and IGFBP-3 were 7.5, 4.6, 1.7, and 2.8 Kb, respectively. The IGF-I mRNA was lower ( P < 0.01) in pregnant cows and tended to be lower ( P < 0.06) in cycling cows fed FO compared with cows fe d the control diet (Table 4-3). Within control-fed animals, pre gnancy and bST increased ( P < 0.01) IGF-II mRNA. Injecting bST caused an increase in endometrial IGFII mRNA for cycling cows fed the control diet but not for those fed th e FO (diet by bST interaction, P < 0.01). When only cycling cows were considered, those injected with bST had less IGFBP2 mRNA in their endometrial tissue than those not injected with bST (54 vs. 99 AU, respectively). Treatment of bST in cows that became pregnant resulted in greater IGFBP-2 mRNA in endometrium (121 vs. 79 AU) which bST treatment in cycling cows caused lower IGFBP-2 mRNA (51 vs. 80 AU; bST by pregnancy interaction, P < 0.05). There was a significant decrease ( P < 0.05) in IGFBP-2 mRNA among bST-treated cyclic cows fed a control or fish oil diet; however, there was an interaction ( P < 0.05) between pregnant cows and cyclic cows fed a contro l diet with bST increas ing IGFBP-2 mRNA in pregnant cows but decrea sing IGFBP-2-mRNA in cyclic control-fed cows. No differences among treatments were detected for IGFBP-3 mRNA.

PAGE 142

120 Analysis of ULF for IGFBP at Day 17 Ligand blot analyses for IGFBP were c onducted on ULF from 28 cows at d 17 post AI. Total ULF protein did not differ among treatment groups. Four distinct IGFBP bands were detected from 44 to 24 kDa (Figur e 4-11). Treatment did not affect IGFBP-3 (44 and 40 kDa) or IGFBP-4 (28 and 24 kDa; Ta ble 4-3); this may have been due to great variability among cows as shown in Figure 4-11. Simple and Partial Correlations for the GH-IGF System at Day 17 Correlations were not detected betw een IGF-I in ULF and circulating concentrations of IGF-I or between GH in the ULF and circulating concentrations of plasma GH at d 17. However, a series of si mple (r) and partial (pr) correlations were detected ( P 0.05). Concentrations of plasma GH were correlated positively with IGF-I in plasma (r = 0.37; partial corr elation adjusted for treatment [pr = 0.51]). The IGF-I in plasma was associated positively with insulin (r = 0.38; pr = 0.46) and plasma progesterone (r = 0.36; pr = 0.72). Progesterone concentr ations in plasma were correlated positively with plasma insulin concentrations (r = 0.42; pr = 0.56) and negatively correlated with IGFBP-4 in the ULF (pr = -0.44). The GH in the ULF was associated positively with IGF-I in the UL F (r = 0.94; pr = 0.94). The IGFBP-2 mRNA was positively correlated with IGF-I (pr = 0.49), IGF-II (r = 0.53; pr = 0.50), IGFBP-3 mRNA (r = 0.53; pr = 0.57) and concentrations of plasma insulin (r = 0.51; pr = 0.62). Amount of IGFBP-3 protein was associated pos itively with IGFBP-4 protein in the ULF (r = 0.60; pr = 0.57). The IGF-I mRNA expressi on was associated positively with IGF-II mRNA expression (r = 0.59; pr = 0.88). Alt hough correlations are not proof of causative effects, significant associations were de tected among hormonal components and uterine

PAGE 143

121 gene expression of the GH-IGF system at d 17 in fish oil fed, control-fed, and cyclic and pregnant animals treated di fferentially with bST. Discussion Dietary supplementation with FO increas ed milk production compared with cows fed lipid in the form of whole cottonseeds during the postpartum period before TAI or bST treatment (Figure 4-2). Previous studies reported an increa se (Keady et al., 2000; Donovan et al., 2000) or no effect on milk pr oduction (Jones et al., 2000; Petit et al., 2004) when FO-enriched diets were fed. A lthough milk yield increased, BCS and BW were not influenced by diet. Pregnancy rate, length of conceptus and amount of IFNin ULF were increased by bST administration at TAI and again 11 d late r following an Ovsynch protocol (Table 43). Previous field experiments reported that pregnancy rates were increased in cyclic, lactating dairy cows when bST was injected at the initiation of the Ovsynch protocol or at the time of insemination (Mor eira et al., 2000b, 2001; Morale s-Roura et al., 2001; Santos et al., 2004b). Both GH and IGF-I had be neficial effects on embryo development in vitro (Moreira et al., 2002b) and inje ction of bST at insemination in superovulated donor cows advanced embryo development (Moreira et al., 2002a). The beneficial effects of bST on early embryo development appear to be extended to latter stag es of development approaching the critical period when the conceptus secretes IFNfor maintenance of the CL. Due to the bST-induced increas e in conceptus length, amount of IFNin ULF increased which may have contributed to the bST-induced increase in pregnancy rate. Injections of bST increased IGF-I concentr ations in plasma (Figure 4-9) and this increase may have compensated for an inadequate concentration of IGF-I in highproducing dairy cows resulting in improved fert ility. In chapter 3, pregnancy rate was

PAGE 144

122 decreased in nonlactating dairy co ws when bST was injected at TAI and 11 d later. This negative effect appeared to be due to a hyperstimulation of IGF-I concentrations. Pregnancy rate was high in the non bST-treate d control group whose basal concentrations of plasma IGF-I approximated those observe d in the present study in lactating cows injected with bST. In contrast, the lacta ting control cows with lower fertility had low concentrations of IGF-I. In other target populations of cattl e, such as nonlactating dairy heifers (Rorie et al., 2004) and lactating b eef cattle (Bilby et al., 1999), in which plasma IGF-I would be at greater concentrations than in lactating dairy cat tle (Bilby et al., 1999), exogenous bST appears to have no benefici al effect or even negative effects on pregnancy rate. There appears to be a threshold concentra tion of IGF-I associat ed with increased fertility, and elevation of IGF-I beyond this threshold concentration may have a negative impact on pregnancy rate. The reason for the be neficial effects of bST injections in some inseminated cows and not others, may reflect differences in among-cow sensitivity to bST regarding IGF-I secretion. This sensitiv ity is likely influenced by physiological (i.e., lactation) and nutritional statuses. The comb ination of increased IGF-I concentrations and localized production of IFNin bST-treated cows have profound effects on the antiluteolytic mechanisms involved with ma intenance of the CL (Chapter 5). Injections of bST twice at an interval of 11 d sustained concentration of plasma GH for the entire 17-d period until slaughter as anticipated. Concentrations of GH were greater in P cows and those fed FO compared to cycling cows not fe d FO (Figure 4-8). Growth hormone has been shown to crosstal k via signal transduction systems with PPAR which is a nuclear transcri ption factor found in hepatocytes that can be activated

PAGE 145

123 by PUFAs to activate or repress expression of various genes (Khan and Vanden Heuvel, 2003). Through PPAR dietary FO may decrease GH receptor expression such that basal concentrations of plasma GH remain great er in bST-injected cows. Such an effect may be reflected in a differential resp onse of IGF-I concentrations. Indeed concentrations of plasma IGF-I in FO-fed cows was lower than either pregnant or cyclic cows when injected with bST (Figure 4-9). This may reflect a decreased sensitivity of the liver to GH in cows fed FO and injected with bST. Milk yield increased due to bST injections as a main effect during the 17 d period before sacrifice (Figure 4-5). Not only did feeding FO have interacti ng effects on the GH-IGF-I system but it also chronically reduced insulin concentra tions in plasma throughout the experiment beginning approximately 2 wk after initiating fu ll feeding of the FO diet (Figure 4-3). Feeding increasing amounts of calcium salts of LCFA (Choi et al ., 1996) caused a linear decrease in plasma insulin concentrations. In a review by Staples et al. (1998), 7 of 9 studies that fed fat reported d ecreased plasma insulin concentrations. In rodents, feeding n-3 long chain PUFA, as compared to a high fa t diet, lowered concen trations of plasma insulin by sustaining glucose transporter protein GLUT4 receptors in the muscle, by preventing decreased expressi on of GLUT4 in adipose ti ssue, and by inhibiting both activity and expression of liver glucose-6-phosphatase that increased gluc ose uptake and metabolism (Delarue et al., 2004). Increased insulin levels stimulate a subs equent increase in th e amount of GHR in both the liver and adipose ti ssue of lactating dairy cows (Rhoads et al., 2004). Continuous intraperitoneal infusions of insu lin into diabetic human patients increased plasma GH binding protein and restored the responsiveness of GH to normal levels

PAGE 146

124 (Hanaire-Broutin et al., 1996). In rats, diab etes leads to reduce d liver GH binding, and insulin therapy restores GH binding to normal le vels (Baxter et al., 1980). Since plasma insulin was reduced due to FO in the pr esent study, GHR, GH binding protein and GH binding sensitivity may be reduced compared with control-fed cows accounting for the increase in plasma GH without a subsequent rise in plasma IGF-I in FO versus controlfed cows. The reduction in insulin may also account for the increase in the number of class 1 follicles in FO-fed cows prior to sync hronization. Insulin-like growth factor-I is a potent stimulator of bovine granulosa cells in vitro (Spicer et al., 1993) and bovine granulosa cells tended to produce less IGF -I when cultured with insulin and GH. Therefore, suppression of insulin through the feeding of FO may allow IGF-I to positively affect follicle development and possibly other reproductive responses. Progesterone concentrations in plasma we re unaffected by feeding FO both before and after synchronization. However, bST treatment lowered progesterone from d 6 through d 17 post AI (Figure 4-7). Injections of bST are reported to lower progesterone concentrations (Kirby et al., 1997a) in dairy cows which may be due to decreased CL function perhaps by reducing the number of LH receptors (Pinto Andrade et al., 1996), by down-regulating somatotropin receptor mRNA in luteal cells (Kirby et al., 1996), and (or) by increasing overall metabolism asso ciated with increased DMI and milk production (Etherton and Bauman, 1998) ther eby increasing proge sterone clearance (Sangsritavong et al., 2002). Not only did bST treatment lower progest erone concentration but pregnancy was associated with lower progesterone concen tration for the first 11 d following Ovsynch (Figure 4-6). This same phenomenon was seen in nonlactating dairy cows utilizing the

PAGE 147

125 same synchronization protocol (C hapter 3) except the reducti on in progesterone was from d 11 to 17 and was attributed to a possibly greater clearance rate of progesterone by the uterus of pregnant cows. This is contradictory to earlier reports where uninseminated and inseminated, but not pregnant, nonlactating da iry cows had a slower rise in plasma progesterone compared with pregnant, nonl actating dairy cows during the first 16 d following insemination (Mann and Lamming, 20 01). In their study, however, cows were administered two injections of PGF2 11 to 13 d apart, and inseminations occurred 72 or 96 h after the second injection. Their reprodu ctive management system probably did not induce as precise a timing of ovulation as the system used in the present study. Lack of follicular synchronization and reduced synchrony in CL formation may have contributed to differences in progesterone concentrati ons between pregnant cows and non-pregnant cows. Even though progesterone concentrations were less in P cows of the present study, CL tissue volume was increased from d 7 to 17 and CL tissue volume was increased at the time of slaughter in P cows (Table 4-3). This could be a result of luteotrophic effects of PGE2 produced from the embryo/conceptus on CL tissue growth (Arosh et al., 2004). Components of the GH-IGF system can stim ulate early embryo (Moreira et al., 2000a, 2000b) and fetal development (Gluckman, 1995), and regulate both preimplantation (Wathes et al., 1998) and pl acental development (Baker et al., 1993). Most components of the GH-IGF system can in turn be regulated through nutrition (Thissen et al., 1994). In this study, genes of the GH and IGF-I family were investigated to examine the effects of bST, pregnancy a nd FO (Table 4-3). Because the study had no pregnant cows fed FO, statis tical comparisons could not be made between FO-fed cows

PAGE 148

126 and pregnant cows. Differenti al responses between FO and cyclic control-fed cows can be made, and whether such differences reflec t a pregnancy like response can be inferred and warrant further investigation. The IGF -I mRNA in endometrial tissue decreased in pregnant cows fed the control diet and tended to decrease in cows fed FO compared with cyclic cows fed the control diet. In contra st, IGF-II mRNA was increased in control-fed cows that were either pregnant or injected with bST, and feeding FO increased IGF-II mRNA without an additive effect of bST. The IGF-I and -II gene responses to FO mimicked those of the pregnant state. Perhaps FO provides a more conducive intrauterine environment for embryo developm ent that enhances embryonic survival. Both IGF-I and IGF-II can stimulate the development of cultured preimplantation blastocysts (Kaye et al., 1992) and embryonic production of IFN(Ko et al., 1991), and are important for fetal development (Gluckman 1995). Geisert et al. (1991) also showed that endometrial IGF-II mRNA increases in pr egnant cows during this time as the uterus is prepared for ensuing implantation. Pre gnant cows in the curre nt study had elevated IGFBP-2 mRNA when injected with bST but nonpregnant cows had reduced IGFBP-2 mRNA when injected with bST. The incr ease in IGF-II mRNA was correlated with the increase in IGFBP-2 mRNA wh ich may be associated with an increase in IGFBP-2 protein in the endometrium to increase de livery of newly synthesized IGF-II to the overlying developing conceptus in prepara tion for implantation and placentation. The differential dynamics of IGF-I, IG F-II, and IGFBP-2 expression of mRNA between cyclic and pregnant cows, in additi on to responsiveness to bST injections, may reflect direct conceptus-induced alterations in regulation of gene expression due to such agents as IFN, or indirect conceptusinduced alterations within the endometrium (i.e.,

PAGE 149

127 ISG-17, STAT factors 1 and 2 [Stewart et al., 2001], 2 microglobulin [Vallet et al., 1991] interferon regulatory fact or -1 [Spencer et al., 1998], Mx protein [Ott et al., 1998], ubiquitin cross reactive protei n [Johnson et al., 1999] granul ocyte-chemotactic protein-2 [Teixeira et al., 1997] and 2`, 5` oligoadenylate synthase [Johnson et al., 2001]) that effect responsiveness to FO and bST injections Spencer et al. (1999) demonstrated that injection of ewes with IFNwas necessary to induce e ndometrial responsiveness to placental lactogen and GH. Treatments did not differ in endometrial IGFBP-3 mRNA. Th is result was not unexpected since IGFBP-3 is produced mainly in the liver and is a major transporter of IGF-I in the periphera l circulation. Not only were th ere no treatment differences for IGFBP-3 mRNA expression but there were also no differences in IGFBP-3 or IGFBP-4 protein abundance in the ULF. This was a ttributed to the large among cow variation and due to the fact that IGFBP may be reduced due to prolonged proge sterone exposure. Pershing et al. (2003) reported substantial amounts of IGFB P in the ULF of lactating dairy cows on d 3 but not on d 7 of a synchr onized estrus. Lee et al. (1998) suggested that the loss of IGFBP during diestrus was lik ely a result of lumina l proteolytic cleavage rather than decreased endometr ial gene expression of IGFBP. Also, since in this study IGFBP-3 and IGFBP-4 were positively corr elated with each other and IGFBP-4 was negatively correlated with plasma progester one, one may infer that with increasing concentration of progesterone th ere is a subsequent decrease in IGFBP in the ULF. The observed effects of consuming FO on endometrial responses suggest that the uterus does indeed respond to the EPA and DHA fatty acids as candi date ligands that regulate gene expression. Feeding FO in creased the amount of EPA and DHA in the

PAGE 150

128 endometrium, liver, and mammary tissue a nd DHA was significantly increased in the milk fat compared with control-fed cows (Chapt er 6). Thus these ligands are available to target tissues once absorbed from the digestive tract. Conclusions High-producing dairy cows appeared to be deficient in IGF-I which is a potent stimulator of embryo/conceptus growth. Tr eatment with bST increased plasma IGF-I concentrations to possibly optimal concentrati on resulting in an increased pregnancy rate due to an increase in concep tus length and enhanced produc tion of the anti-luteolysin, IFN. Treatment with bST caused a co-stimula tion in steady state concentrations of endometrial IGF-II mRNA that may ultimat ely support continued development of the conceptus and prepare the endometrium for implantation and placentation. Delivery of supplemental UFA to the lower gut for abso rption may target re productive tissues to regulate reproductive function and fertility. No t only did feeding calcium salts of FO increase milk production but also altered gene expression of IGF-I and IGF-II in the endometrium and metabolic hormones (insulin, GH, and IGF-I) in a manner that may be beneficial to pregnancy. Interactions between a pharmaceutical (i.e ., bST) and a nutraceutical (i.e., FO) in which differential bST responses were observe d in the uterus and the peripheral system warrants further investigation. The obj ective of Chapter 5 was to explore the mechanisms by which bST, FO, and pregnancy effect components of the PG cascade.

PAGE 151

129 Table 4-1. Ingredient and ch emical composition of diets c ontaining 0 or 1.9% calcium salts of fish oil enri ched lipid product (FO). Composition 0% FO 1.9% FO Ingredients,% of DM Corn silage 30.2 30.2 Alfalfa hay 7.5 12.0 Cottonseed hulls 4.9 4.9 Citrus pulp 5.2 Soy plus 6.3 5.8 Corn meal 23.9 18.5 Soybean meal 7.6 11.0 Whole cottonseeds 14.8 5.8 Mineral and vitamin mix1 4.8 4.8 Ca salt of FO2 1.9 Chemical composition NEL Mcal/kg of DM3 1.66 1.68 CP,% of DM 16.8 17.1 CP-RDP,% of DM 10.7 10.9 CP-RUP,% of DM4 6.1 6.2 ADF,% of DM 22.6 21.4 NDF,% of DM 33.7 31.2 Lignin,% of DM 5.4 4.7 Ether extract,% of DM 6.0 5.2 NFC,% of DM5 34.4 35.8 Ash,% of DM 9.1 10.7 Ca,% of DM 1.29 1.9 P,% of DM 0.41 0.38 Mg,% of DM 0.53 0.5 K,% of DM 1.34 1.45 Na,% of DM 0.93 0.98 S,% of DM 0.26 0.3 Fe, mg/kg of DM 109 131 Zn, mg/kg of DM 194 199 Cu, mg/kg of DM 56 68 Mn, mg/kg of DM 103 133 1 Mineral mix contained 26.4% CP, 1.74% fa t, 10.15% Ca, 0.90% P, 3.1% Mg, 8.6% Na, 5.1% K, 1.5% S, 4.1% Cl, 2231 mg/kg of M n, 1698 mg/kg of Zn, 339 mg/kg of Fe, 512 mg/kg of Cu, 31 mg/kg of C o, 26 mg/kg of I, 7.9 mg/kg of Se, 67,021 IU/kg of vitamin A, 19,845 IU/kg of vitamin D, and 357 IU/kg of vitamin E (DM basis). 2 EnerG II Reproduction Formula, Vi rtus Nutrition, Fairlawn, OH. 3 Calculated using NEL values published by NRC (2001). 4 Calculated using ruminally unde gradable protein values for individual feedstuffs as given by 2001 NRC. 5 Calculated as (% NFC = 100% -% CP -% NDF -% fat -% ash).

PAGE 152

130 Figure 4-1. Experimental prot ocol illustrating the sequence of injections, collection of samples, and day of ultrasonography. Day 0 represents the time of ovulation from an induced LH surge. Presynch = Presynchronization, PG = PGF2 TAI = timed AI 27 20 10 3 10 791113151617 Presynch Ovsynch Ultrasound Dail y blood sam p les Detect estrus 16 h GnRH PG GnRH PG GnRH TAI bST Sacrifice (d94 12 DIM) (d44 5 DIM) (d77 12 DIM)

PAGE 153

131 Table 4-2. Bovine IFNprimers and probe sequences us ed for quantitative real-time reverse transcription-PCR. Primer/ Probe* Sequence (5' to 3') IFNSE TGCAGGACAGAAAAGACTTTGGT IFNAS CCTGATCCTTCTGGAGCTGG IFNProbe TTCCTCAGGAGATGGTGGAGGGCA *SE = sense primer (5' primer), AS = antisense primer (3' primer), Probe was synthesized with a FAM reporter dye and BHQ-1 quencher.

PAGE 154

132 0 5 10 15 20 25 30 35 40 1013161922252831343740434649525558616467 DIMMilk production (kg) ) Figure 4-2. Regression analysis (third order curves) of da ily milk produc tion starting 10 DIM until the start of bST treatment and timed AI for cows fed either 0 (Least squares means: ) or 1.9% (Least squares means: ) calcium salt of fish oil enriched lipid diets. Pattern of regression curves were different ( P < 0.01).

PAGE 155

133 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 1417202326293235384144475053 DIMPlasma insulin (ng/ml) Figure 4-3. Linear regression of plasma insulin concentrations for cows fed fish oil enriched lipid (FO) at 0 (Least squares means: ) or 1.9% (Least squares means: ) of dietary DM from 14 to 53 DIM. Feeding FO decreased plasma insulin concentrations compared with control cows in relation to DIM ( P < 0.01).

PAGE 156

134 0 1 2 3 4 5 6 7 8 9 1417202326293235384144475053 DIM Plasma GH concentrations (ng/ml)0 20 40 60 80 100 120 140 160Plasma IGF-I concentrations (ng/ml) ) Figure 4-4. Overall pooled linear regressi on equations of GH (Least squares means: ) and IGF-I (Least squares means: ) plasma concentrations from 14 to 53 DIM for all cows fed either 0 or 1.9% cal cium salt of fish oil enriched lipid diets. No effect of fish oil feedi ng on plasma GH or IG F-I concentrations, however, a positive linear relationship was detected for IGF-I ( P < 0.01) and a negative linear relationship for GH ( P < 0.01) in relation to DIM.

PAGE 157

135 0 5 10 15 20 25 30 35 40 45 01234567891011121314151617 Days After GnRH (estrus)Milk Production (kg) ) Figure 4-5. Regression analysis (second order curves) of daily milk production from d 0 to 17 of a synchronized estrous cycle (d 0) for cyclic and pregnant cows fed the control diet and injected with bST (Least squares means: ) or not (Least squares means: ) on d 0 and 11. Pattern of re gression curves were different (P < 0.01).

PAGE 158

136 0 1 2 3 4 5 6 7 8 01234567891011121314151617 Days after GnRH (estrus)Plasma progesterone (ng/ml) Cyclic Pregnant Figure 4-6. Concentrations of plasma progesterone of cyc lic cows injected or not injected bST (n = 11) ( ) and pregnant cows inject ed or not injected with bST (n = 10) ( ), measured from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05) between d 0 and 11. A ll cows were fed the control diet. Concentration of progesterone at the day designated with a ** differed at P < 0.05 using PDIFF option of PROC MIXED. bST bST **

PAGE 159

137 0 1 2 3 4 5 6 7 8 01234567891011121314151617 Days after GnRH (estrus) Plasma progesterone (ng/ml ) Figure 4-7. Concentrations of plasma progesterone of cyc lic and pregnant cows not given bST (n = 10) ( ) and those given bST (n = 11) ( ) collected from d 0 to 17 of a synchronized estrous cycle differed ( P < 0.05). All cows were fed the control diet. Concentrations of pr ogesterone at days designated with differed at P < 0.10 or with ** differed at P < 0.05 using PDIFF option of PROC MIXED. ** ** ** *

PAGE 160

138 0 5 10 15 20 25 30 35 01234567891011121314151617 Days after GnRH (estrus)Plasma GH (ng/ml ) Figure 4-8. Profiles of plasma GH concentratio ns of cyclic cows fed control diet (no bST) ( ), cyclic cows fed control diet with bST injections ( ), cyclic cows fed FO (-x-), cyclic cows fe d FO with bST injections (-o-), pregnant cows fed cont rol diet (no bST) ( ), and pregnant cows fed control diet with bST injections ( ) from d 0 to 17 of a synchronized estrous cycle. All three groups of cows given bST had greater mean GH concentrations than cows not injected with bST ( P < 0.01). Of those given bST, cows fed FO and pregnant cows had greater mean GH concentrations than cyclic cows fed the control diet ( P < 0.05). Pooled standard erro rs for bST-treated cows = 3.31 and non-bST treated cows = 1.13. bST bST

PAGE 161

139 0 50 100 150 200 250 300 350 01234567891011121314151617 Days after GnRH (estrus)Plasma IGF-I (ng/ml) ) Figure 4-9. Profiles of plasma IGF-I concentrat ions of cyclic cows fed control diet (no bST) ( ), cyclic cows fed control diet with bST injections ( ), cyclic cows fed FO (-x-), cyclic cows fe d FO with bST injections (-o-), pregnant cows fed cont rol diet (no bST) ( ), and pregnant cows fed control diet with bST injections ( ) from d 0 to 17 of a synchronized estrous cycle. All three groups of cows given bST ha d greater mean IGF-I concentrations than cows not injected with bST ( P < 0.01). The FO-fed cows injected with bST had less IGF-I plasma concentrations ( P < 0.05) and pregnant cows injected with bST had greater IGF-I plas ma concentrations than cyclic cows fed the control diet with bST injections ( P < 0.05) as detected by Homogeneity of Regression. Pooled st andard errors for bST-treated cows =29.9 and non-bST treated cows = 22.2. bST bST

PAGE 162

140 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 CFOPPlasma Insulin (ng/ml) ) No bST bST Figure 4-10. Plasma insulin concentrations of cyclic cows fed a control diet (C), cyclic cows fed the fish oil enriched diet (FO), and pregnant cows fed the control diet (P) from d 0 to 17 of a synchroni zed estrous cycle. Cows fed FO had less insulin concentrations than cy clic cows fed a control diet ( P < 0.05).

PAGE 163

141Table 4-3. Least squares means and pooled SE for conceptus size, interferon tau (IFN) mRNA (mean fold effect), IFN(g/total uterine luminal flushing [ULF]), IFN stimul ated gene-17 (ISG-17) prot ein, number of corpora lut ea (CL), CL tissue volume (mm3), CL weight (g), uterine endometrial mRNA, ULF prot ein expression, and hormone c oncentration at d 17 after a synchronized estrus (d 0) in lactating cycl ic (C) cows fed a control diet, pregnant (P ) cows fed a control diet, and cyclic cow s fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 a nd d 11. Arbitrary units (AU) were generated by densitometry. The mRNA results were adjusted using glyceraldehydes-3-phosphate dehydr ogenase as a covariate. Treatments1 Contrasts2 Response3 C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P Pregnancy rate, % 40 (4/10) 83 (5/6) Conceptus size, cm 34.345.4 4.8 IFNmRNA 1.81.6 0.5 NS IFN, g/total ULF 5.39.4 1.2 ISG-17 protein 11.010.0 3.0 NS Number of CL 1.4 1.01.01.3 1.01.2 0.2NS NS NS NS CL volume, mm3 7242 8130 8641 10507 12568 9775 1404 NS NS NS ** NS NS CL weight, g 5.5 5.96.76.6 7.16.2 0.7NS NS NS NS NS NS Endometrium IGF system IGF-I mRNA, AU 75 767171 6767 2.1 NS NS ** NS NS IGF-II mRNA, AU 76 828280 8186 1.3 NS ** ** ** NS IGFBP-2 mRNA, AU 80 51 11858 79 121 10.0NS NS NS IGFBP-3 mRNA, AU 18 181715 1417 1.8NS NS NS NS NS NS ULF IGF system GH, ng/ULF 8 91317 98 4.7NS NS NS NS NS NS IGF-I, ng/ULF 296 244396496 219145 164 NS NS NS NS NS NS IGFBP-3, AU 43 3712460 5814 41NS NS NS NS NS NS IGFBP-4, AU 31 328457 7113 30NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 IGFBP = Insulin-like growth factor binding protein; GH = growth hormone.

PAGE 164

142 Figure 4-11. Representative autoradiograph from ligand blot analysis of uterine luminal IGFBP at d 17 following an induced ovul ation. In decreasing mass order, two forms detected were IGFBP-3 (44 and 40 kDa) and IGFBP-4 (28 and 24 kDa). Lanes 1 and 2 were from bS T-treated pregnant cows, lanes 3 and 4 were from pregnant co ws (no bST), lanes 5 and 6 were from cows fed a fish oil enriched lipid (FO) and inject ed with bST, lanes 7 and 8 were from cyclic cows fed FO (no bS T), lanes 9 and 10 were from a bST-treated cyclic cow fed a control diet, and lane 11 was from a cyclic cow fed a control diet (no bST). 1 2 3 4 5 6 7 8 9 10 11 44 kDa 40 kDa 28 kDa 24 kDa

PAGE 165

143 CHAPTER 5 PREGNANCY, BOVINE SOMATOTROPIN AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: II. GENE EXPRESSION RELATED TO MAINTENANCE OF PREGNANCY Introduction Early pregnancy loss in lactating dairy cat tle can have devastating effects on the economic success of dairy farms (Santos et al., 2004a). Nearly 40% of pregnancy losses have been estimated to occur be tween d 8 to 17 following estrus. This is the critical time period during which the conceptus must produce sufficient quantities of IFNto prevent pulsatile PG secretion and maintain the CL (Thatcher et al., 1995). Changing from a cyclic to a pregnant state not only depends on the production of antiluteolytic signals from the developing conceptus but also the capacity of the endome trium to respond to these signals, thus bl ocking pulsatile PGF2 production (Binelli et al., 2001b). Such communications between the conceptus and ma ternal units are not always successful, thus leading to early embryonic loss. The endometrium plays a critical role in regulating the estrous cycle and establishment of pregnancy. Elevated concen trations of plasma progesterone during the late luteal phase of the estrous cycle caused down regulation of PR in the uterus (Spencer and Bazer, 1995; Wathes and Lamming, 1995; R obinson et al., 2001). Loss of PR in the uterus may activate OTR expression and subs equent luteolysis (Wathes and Lamming, 1995). However, an effect of pregnancy on ep ithelial PR expression prior to the time of luteolysis could not be dete cted in either ewes (Spencer and Bazer, 1995) or cows (Robinson et al., 1999), probably because PR expression was very low. Conversely, ER

PAGE 166

144 concentrations are upregulated during luteol ysis in sheep. However, it is not clear whether this upregulation begins before or after the increase in OTR in the luminal epithelium (Cherny et al., 1991; Wathes and Hamon, 1993). In pregnant ewes, the expression of ER also is suppressed during early pregnancy, and it has been hypothesized that IFNinhibits OTR upregulation by inhibiting a preceding increase in ER expression (Spencer and Bazer, 1995). Although the role of PR and ER in regards to OTR regulation is obs cure, OTR certainly are suppressed by IFNsecreted from the conceptus (Flint et al., 1992; Wathes and Lamming, 1995; Mann et al., 1999). Intrauterine infusions of recombinant IFNin cyclic ewes from d 11 to 16 post estrus had no effect on PGHS-2 expression in the endometrial epithelium (Kim et al., 2003). In this latter study, it was sugges ted that antiluteolytic effects of IFNare to inhibit ER and OTR gene transcription, there by preventing endometrial production of luteolytic pulses of PGF2 In the uterine luminal epithelium, AA is released from phospholipids by hydrolysis and acted upon by PGHS-2 to form PGH2, which is converted to either PGF2 and (or) PGE2 through two reductases, PGFS and PGES, re spectively. Kim et al. (2003) reported that PGHS-2 mRNA concentrations were gr eater in endometrium from pregnant than cyclic ewes by d 16 post estrus It is unknown whether rela tive expression of the 2 synthetic enzymes, PGFS and PGES, change s during the period of CL maintenance in pregnant lactating dairy cattle. Programs to optimize reproductive perfor mance in dairy cattle have received considerable attention. R ecently, recombinant bST, a co mmercially available product used to increase milk production, was shown to increase pregnancy rates when given as

PAGE 167

145 part of a TAI protocol in lactating dairy co ws (Moreira et al., 2000b, 2001). Santos et al. (2004b) showed that bST increased pregnanc y rate through reduci ng pregnancy loss. Evidence exists for cross-talk between hor mone signal-transduction systems such as ER with IGF-I (Klotz et al ., 2002), or direct affects such as bST increasing IFN(Badinga et al., 2002). Effects of bST on fe rtility may involve an interaction between bST and IFNsignaling pathways to regulate PG s ecretion or other components of the PG cascade critical for maintenance of pre gnancy. However little is known about the molecular and cellular effects of bST on endometrial ge ne expression at the time of pregnancy recognition. Another commercially available product that may benefit fertility of lactating dairy cows is a calcium salts of FO supplement containing omega-3 fatty acids such as EPA and DHA. Previous studies indicated that omega-3 fatty acids can decrease PGF2 secretion by bovine endometrial cells in vitro (Mattos et al., 2003) and supplementation with fish meal, enriched in these omega-3 fatty acids, reduced oxyt ocin-induced uterine synthesis of PGF2 in lactating dairy cows (Mattos et al., 2002). Little is known about the effects of a FO-enriched supplement and its interaction with bST treatment on endometrial function at th e molecular level. The objectives of the present study were to examine the effect s of pregnancy, bST treatment, and a FOsupplemented diet on the regulatory enzymes of the PG cascade and how they may regulate genes and proteins in the uterine environment, which are known to influence pregnancy recognition.

PAGE 168

146 Materials and Methods Materials GnRH (Fertagyl; Intervet Inc., Milsboro, DE), PGF2 (Lutalyse; Pfizer Animal Health, Kalamazoo, MI), and bST (Posilac; Monsanto Co., St. Louis, MO) were used for experimental treatments of cows. Othe r purchased materials included: Trizol, cDNA Cycle kit, TOPO vector (TOPO TA Cl oning Kits), Random Primers DNA Labeling System (Invitrogen Corp., Carlsbad, CA), Taq polymerase (cat # M166A; Promega, Madison, WI), PR (cat# 18-0172; Zymed, S outh San Francisco, CA), and PGHS-2 blocking peptide (cat# 360106; Cayman Chemi cals, Ann Arbor, MI). Also purchased was biotin conjugated anti-ra bbit IgG (cat# sc-2040; Santa Cruz Biotechnology), normal horse serum, biotinylated horse anti-mouse IgG, horseradish per oxidase-avidin-biotin complex, 3, 3-diaminobenzidille (DAB k it; Vectastain; Vector Laboratories, Burlingame, CA), enhanced chemiluminescence (ECL) kit (Renaissance Western Blot Chemiluminescence Reagent Plus; NEN Life Science Products, Boston, MA), the ultrasensitive hybridization buffer (ULTRAhybTM;Cat # 8670; Ambion Inc., Austin, TX), dCTP -32P (MP Biomedicals, Irvine, CA) a nd Biotrans Nylon membrane (MP Biomedicals, Irvine, CA), isotopically labeled [5, 6, 8, 11, 12, 14, 15-3H]-PGF2 and PGE2, nitrocellulose membranes (Hybond-ECL), HRP-linked anti-mouse IgG (NA931V), and anti-rabbit IgG (NA934V; Amersham Biosci ences Corp., Piscataway, NJ). All other laboratory materials were from Fisher Scientific (Pitts burgh, PA) and Sigma Chemical Co. (St. Louis, MO). Animals and Experimental Diets A more detailed description of animals, management, and collection of samples is in Chapter 4. Briefly, forty multiparious Holstein cows in late gestation were fed diets

PAGE 169

147 formulated to contain 1.51 Mcal NEL/kg, 13.1% CP, and a cation anion difference of -90 meq/kg (DM basis) beginning approximately 3 wk prior to expected calving date. Upon calving, cows were fed two dietary treat ments containing 0 or 1.9% FO (EnerG-II Reproduction formula, Virtus Nutrition, Fairla wn, OH). The fatty acid profile of the fat source as given by the manufacturer wa s 2.2% C14:0, 41.0% C16:0, 4.2% C18:0, 30.9% C18:1, 0.2% C18:1 trans, 8.0% C18:2, 0.5% C18:3, 0.4% C20:4, 2.0% C20:5, 2.3% C22:6, and 2.7% unknown. The control diet cont ained a greater con centration of whole cottonseed and therefore was similar in concen tration of ether extract and NEL to that containing FO. The control diet was fed to a ll cows during the first 9 DIM. From 10 to 16 DIM, ten cows were assigned to consum e a FO diet containing half the final concentration of the fat product (0.95% of dietary DM) in orde r to adjust the cows to a new fat source. Starting at 17 DIM, these co ws were switched to the 1.9% FO diet and continued on that diet until the end of the study. Cows fed the ruminally protected FO consumed approximately 14.8 g/cow per day of EPA and DHA. Thirty cows were assigned to the control diet for the duration of the study. Cows were milked three times per day and milk weights were recorded by calibrated electronic milk meters at each milking. Body weights were measured and BCS (Wildman et al., 1982) assigned weekly by the same two individuals. Estrus Synchronization and Tissue Collection Estrus was presynchronized st arting at 44 5 DIM or on d 27 (d 0 = TAI) using an injection of GnRH (2 mL, 86 g, i.m.) fo llowed 7 d later with an injection of PGF2 (5 mL, 25 mg, i.m.) on d 20 (DeJarnette and Marshall, 2003 ; Figure 5-1). Estrus was detected during the next 10 d using the H eatwatch electronic estrus-detection system

PAGE 170

148 (DDx Inc., Denver, CO; Rorie et al., 2002). At the end of 10 d, the Ovsynch protocol (Pursley et al., 1997a) was initiated using a GnRH injection (2 mL, 86 g, i.m.) followed 7 d later by an in jection of PGF2 (5 mL, 25 mg, i. m.). At 48 h after injection of PGF2 GnRH (2 mL, 86 g, i.m.) was administere d, and 16 cows fed the control diet were inseminated 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sire s, Plain City, OH; 7H05379). The cycling group (n = 19) was not inseminated. Inseminated and non-inseminated cows received either an injection of bST (500 mg) or no injection on d 0 (when cows were either inseminated or not) and again on d 11. The bST injections occurred 11 d apart, instead of 14 d, to allow for a sustained continual exposure to GH until d 17 at which time cows were slaughtered. The bST injecti ons were given subcutaneously in the space between the ischium and tail head. Thr ee cows were excluded for various health concerns, and CL regression prior to d 17 wa s observed in two cows. These five cows were excluded from the study. Cows (n = 35) were slaughtered on d 17 after TAI to collect tissue samples and verify presence of a conceptus. From the pregnant cows that were slaughtered, 6 cows not treated with bST and 1 cow treated with bST were not pregnant. These 7 cows were not used for any analyses on d 17 following TAI. Number of cows used for analyses on d 17 in each group was as follows: control diet had 5 bSTtreated cyclic (bST-C), 5 non bST-treated cyc lic (C), 5 bST-treated pregnant (bST-P), and 4 non bST-treated pregnant (P) cows; FO diet had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows. Conceptuses and uterine secretions were recovered as described by Lucy et al. (1995). Briefly, 40 mL of PBS was injected into the horn contralateral to the CL from the uterotuba l junction and massaged gently through the

PAGE 171

149 uterine horn ipsilateral to th e CL. Flushing media and conceptus were recovered through an incision of the ipsilateral horn. Endometria l tissue from the anti-mesometrial border of the ipsilateral horn of all endometria was cut and frozen in liqui d nitrogen for Western and Northern blots, or fixed in 4% pa raformaldehyde for immunohistochemistry. Ribonucleic Acid Isolation and Northern Blotting Total RNA was isolated from endometrial ti ssues (n = 28) with Trizol according to manufacturers specifications. Total RNA (30 g) were elect rophoresed in 1% agaroseformaldehyde gels and blotted to nylon memb ranes. Membrane RNA was crosslinked by UV radiation and baked at 80oC for 1 h. Probes were obtained using a reverse transcription PCR procedure. Complementar y DNA was reverse-transcribed from total RNA (5 g) prepared from the bovine CL following th e manufacturer's protocol with the cDNA Cycle kit, utilizing es tablished primer sets for bovine OTR, PR, and PGES (Guzeloglu et al., 2004a). The primers were employed in PCR amplification usi ng an Eppendorf Mastercycler Gradient Thermocycler (Eppendorf Scientific Inc., Westborg, NY) in a total reaction volume of 50 l containing 1 l cDNA temp late, 300 ng of each primer, 10 nM dNTPs, 1 PCR buffer (2 mM MgCl2, pH 9.0), and 1 unit of Taq polymerase. The PCR products were electrophoresed in 1.5% agarose gels and cDNA fragments of the expected size were subcloned into TOPO vector. The nucleotide sequences of the generated clones were determined at the nucleotide sequencing facility of the Interdisciplinary Center for Biotechnology Research of the University of Florida, and compared with respective gene sequences reported in GenBank. The ER cDNA was a gift from Dr. N.H. Ing (Texas A&M University, College Station, Texas). The PGFS (Xiao et al., 1998) and PGHS-2

PAGE 172

150 (Liu et al., 2001) cDNAs were a gift from Dr. J. Sirois (University of Montreal, St. Hyacinthe, Canada). The blots were prehybridized with ULTRAhyb buffer for 1 h at 42oC and hybridized with one of the random primed-32P-labelled probes (ER OTR, PR, PGHS-2, PGES, PGFS or GAPDH) overnight at 42oC. The next day, the blots were washed in 2X SSC/0.1% SDS and twice in 0.1X SSC/0.1% SDS for 20 min each at 42oC. The blots were then exposed to X-ray film at 80oC. The autoradiographs were quantified using densitometry. Immunohistochemical Analyses Paraffin sections (5 m) from the anti-m esometrial border of the uterus from 27 cows (5 C, 5 bST-C, 4 FO, 4 bST-FO, 4 P, and 5 bST-P) were prepared. After deparaffinization, an antigen retrieval proced ure was performed by he ating sections in a microwave oven at high power for 5 min in 0.01 M sodium citrate buffer (pH 6.0). Sections were allowed to cool in microwav e for 28 min, and then washed in distilled water and in phosphate buffered saline (0.01 M PBS, pH 7.2). Nonspecific endogenous peroxidase activity was blocked by treatment w ith 3% hydrogen peroxide in methanol for 10 min at room temperature. After a 10min wash in PBS, non-specific binding was blocked using 2% bovine serum albumin in PBS for ER 5% (v/v) normal horse serum in PBS for PR, and 5% normal goat serum in PBS for PGHS-2 in a humidified chamber at room temperature for 1 h. Tissue sections were then incubated in the dark at room temperature with the primary an tibody: 1) Monoclonal anti-ER (NeoMarkers, Medicorp, Montreal, Quebec) or the nega tive control mouse IgG at equivalent concentration diluted 1:500 in 2% BSA, a nd incubated overnight; 2) Monoclonal anti-PR

PAGE 173

151 (NeoMarkers, Lab Vision, Fremont, CA) or th e negative control mouse IgG at equivalent concentration diluted 1:500 in 5% horse serum and incubate d for 2 h; 3) Polyclonal antiPGHS-2 (Cayman Chemical, Cedarlane Lab., Ho rnby, Ontario) or the negative control, anti-PGHS-2 preincubated with PGHS-2 bloc king peptide (1:5 v/v ratio) for 1 h, diluted 1:200 in PBS and incubated for 2 h. After thr ee 5 min washes in PBS, the sections were incubated in the dark for 1 h at room temp erature with a biotinylated horse anti-mouse IgG for ER (diluted 1:200 in 2% BSA) and PR (diluted 1:800 in 5% horse serum) antibodies, or biotinylated goat anti-rabbit IgG for the PGHS-2 antibody (diluted 1:200 in 5% goat serum). Thereafter three 5 min washes in PB S were performed and tissue sections were incubated for 30 min at room temperature with horseradish avidin-biotinperoxidase complex. Site of the bound enzyme was visualized by th e application of 3, 3-diaminobenzidine in H2O2. Sections were counterstained with hematoxylin and dehydrated before they were mounted with Permount. Microscopic Image Analysis Subjective image analysis was performed to estimate the relative abundance of ER PR, and PGHS-2 staining in different cell types. One evaluator assessed immunostaining on 10 randomly selected fields of intercaruncular endometrium in 3 pieces of endometrium from each cow. Carunc ular endometrium was not evident in all cows. Five uterine compartments were eval uated: luminal epithelium (LE), superficial glandular epithelium (SGE; close to the uter ine lumen), deep glandular epithelium (DGE; close to the myometrium), superficial intercaruncular stroma (SS; just beneath the luminal epithelium layer) and deep intercar uncular stroma (DS; between superficial stroma and the myometrium). Because specific staining for PGHS-2 protein was detectable exclusively in the cytoplasm of e ndometrial luminal epithelial cells, only those

PAGE 174

152 cells were scored. Intensity of staining was scored on a 4-point scale, where 0 = no staining (no brown), 1 = less ( light brown), 2 = moderate (brown), and 3 = heavy (dark brown), and the staining intens ities were expressed as perc entage of positively stained cells for each point in the scale (Boo s et al., 2000; Guzeloglu et al., 2004a). Western Blotting for ER and PGHS-2 Proteins Endometrial tissues (300 mg) from 27 cows were sonicated 3 times for 5 s each in 2 mL of whole cell ex tract buffer (50 mM Tris, pH 8.0, 300 mM NaCl, 20 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, 1 mM EDTA, 1 mM EGTA 0.5 mM PMSF; 10% v/v glycerol, 1% v/v NP-40, and 10 g/mL each of aprotinin, leupeptin, and pepstatin). Lysates were then processed by centrif ugation (14,000 g for 10 min), and protein concentrations determined in supernatan ts (Bradford, 1976). Volumes of whole cell extract from each cow corresponding to 200 g of protein were loaded onto 7.5% denaturing (for ER ) or nondenaturing (for PGHS-2) acr ylamide gels, submitted to SDSPAGE, and electrophoretically transferred to nitrocellulo se membranes. Membranes were blocked for 2 h in 5% (w/v) nonfat dried milk in Tris-buffered saline (TBS) containing 0.1% Tween-20 (TBST), washed fo r 15 min in TBST, and probed with mouse ER antibody (cat# sc-787; Santa Cruz Bi otechnology, Santa Cruz, CA) (1:1000) or rabbit PGHS-2 antibody (cat# 160106; Caym an Chemicals, Ann Arbor, MI) (1:500) diluted in 5% nonfat dried milk in TBST for 2 h. Secondary antibodies were HRPconjugated anti-mouse IgG or anti-rabbit IgG (1 :5000 dilutions in 5% nonfat dried milk in TBST). Proteins were detected using a chemiluminescent substrate and analyzed by densitometry (Alpha lmager 2000).

PAGE 175

153 Radioimmunoasssay Concentrations of PGF2 and PGE2 were measured in uterine flushings by direct RIA as described by Danet-Desnoyers et al. ( 1994) and Gross et al. (1988), respectively. Both antisera were characterized by Dubois and Bazer (1991). The anti-PGF2 antiserum was diluted 1:5000 and the anti-PGE2 antiserum was diluted 1:1000 in Tris buffer. Intraassay coefficients of variation for PGF2 and PGE2 assay were,11.8 and 8.7%, respectively. Statistical Analyses Abundances of ER and PGHS-2 proteins in Western blots as well as ER PR, OTR, PGFS, PGES, and PGHS-2 mRNAs in No rthern blots were analyzed using the GLM procedure of SAS. Main effects of tr eatment (C, P, FO, bST-C, bST-FO, bST-P), gel, and treatment gel interaction were examined, and for mRNA responses, band intensities of GAPDH mRNA were used as a covariate to adjust for loading differences. If treatment gel effects were not signifi cant they were removed from the model. Predesigned orthogonal contrast s were used to compare treatment means for bST, pregnancy status and bST x pregnancy status, and bST, FO, and bST x FO. Total contents of PGF2 and PGE2 in uterine flushings were analyzed using the GLM procedure of SAS. The model included the main effect of treatment (C, P, FO, bST-C, bST-P) and orthogonal contrasts were constructed to test treatment means (bST, FO, pregnancy status and hi gher order interactions). Data generated from immunohistochemistry of ER PR, and PGHS-2 were analyzed by the mixed model pr ocedure of SAS (SAS Inst. In c., Cary, NC) for each type of cell. The model included treatment (C FO, P, bST-C, bST-FO and bST-P), class

PAGE 176

154 (none, less, moderate, and heavy staining inte nsity) and treatment class interaction. Cow within treatment was the error term used to test for treatment effects. A series of orthogonal contrasts were constructed to test effects of bST, FO, pregnancy status, class (none, less, moderate, and heavy staining intensity) and the treat ment class interactions. Results Endometrial PR Expression A 4.3 kb PR mRNA transcript was detected in the endometrium at d 17 following an induced ovulation, consistent with published reports of PR transcript size (Meikle et al., 2001). A significant interac tion occurred between bST and fish oil effects (Table 51). The bST increased steady state concentr ations of PR mRNA in cyclic control-fed cows as did fish oil alone with no additive effect of bST (Table 5-1). Also, bST increased steady state concentrations of PR mRNA in cyclic but not pregnant cows (interaction P < 0.01; Table 5-1). Immunohistochemical staining of PR was ex clusively in the nuclei of the SGE, DGE, SS, and DS, with little or no staining in the LE. Although overall staining was very little in LE for PR, th e proportion of cells with mode rate and heavy staining was enhanced in response to bST in jections of cows fed FO ( P < 0.05; Tables 5-2 and 5-3). Within the SGE, presence of a conceptus or FO ( P < 0.05; Figure 5-1C) increased the amount of moderate and heavy staining ( P < 0.01; Tables 5-2 and 5-3). In the DGE, bST reduced ( P < 0.01) moderate and heavy staining in both cyclic and pregnant cows; however bST did not reduce moderate and he avy staining in FO-fed cows (bST x FO interaction; P < 0.01; Tables 5-2 and 5-3). The bST reduced PR staining of SS in the less category and increased the no staining category, in cyclic control-fed cows but pregnancy and feeding FO blocked the bST reduction ( P < 0.01; Tables 5-2 and 5-3). In the DS,

PAGE 177

155 bST increased ( P < 0.01) PR moderate and heavy staining when cows were exposed to IFN(i.e., pregnancy) but had no effect in cyclic control-fed cows; however FO reduced PR moderate and heavy staining and bST blocked this reduction ( P < 0.05; Tables 5-2 and 5-3). Endometrial ER Expression As observed in sheep (Ing et al., 1996) and cattle (Meikle et al., 2001), a 6.8 kb ER mRNA transcript was detected in the endometrium at d 17 following an induced ovulation. Steady state concentrations of ER mRNA in endometrial tissues tended to be reduced in pregnant cows compared w ith cyclic cows fed a control diet ( P < 0.10; Table 5-1). Pregnancy induced a decrease in abundance of ER protein in the endometrium ( P < 0.05; Table 5-1) as detected by Western blotting. Immunohistochemistry was used to localize ER in the endometrium, and staining was detected exclusively in the nuclei of LE, SGE, DGE, SS, and DS cells. Pregnancy (Figure 5-1F) and FO decreased ER abundance in LE ( P < 0.01), and pregnancy decreased ER abundance in the SGE (Figure 5-1F) compared with cyclic control-fed cows ( P < 0.05; Tables 5-2 and 5-3). Also, in the SGE, bST blocked the reduction in heavy to moderate staining in FO-fed cows w ith no effect of bST in cyclic control-fed cows ( P < 0.01; Tables 5-2 and 5-3). Pregnancy and FO increased ER heavy staining in the DGE and these responses were reduced by bST ( P < 0.01; Tables 5-2 and 5-3). In the SS, pregnancy reduced ER heavy staining but bST increased the heavy staining back to the levels in cyclic control-fed cows ( P < 0.01); however, bST increased ER heavy staining in FO-fed cows ( P < 0.01; Tables 5-2 and 5-3). The ER heavy staining was stimulated in the DS by bST in cyclic contro l-fed cows but when a conceptus was present

PAGE 178

156 bST did not have additive effects ( P < 0.05); however, within cyclic cows both FO and bST stimulated ER heavy staining ( P < 0.01; Tables 5-2 and 5-3). Endometrial OTR Expression Four transcripts of OTR (5.6, 3.3, 2.1, and 1.5 kb) were detected in endometrial tissue from a cow in estrus (Guzeloglu et al., 2004a). All four transc ripts were present at relatively low levels in endo metrial tissue at d 17, and the most prominent (5.6 kb) transcript was quantified. Among cyclic cont rol and fish oil fed cows, bST tended to increase OTR mRNA ( P < 0.10; Table 5-1). Steady stat e concentrations of OTR mRNA in pregnancy were decreased compar ed to cyclic control-fed cows ( P < 0.01; Table 5-1). Endometrial PGHS-2 Expression A PGHS-2 transcript of 4.4 kb, shown by Liu et al. (2001), and specific 72 kDa PGHS-2 protein bands were de tected in all samples of endometrium at d 17 following an induced ovulation. No differences were det ected in steady state concentrations of PGHS-2 mRNA due to treatments (Table 51). In contrast, PGHS-2 protein was increased in response to pregnancy ( P < 0.05) as detected by We stern blotting (Table 51). Staining for PGHS-2 protein was localized specifically to the cytoplasm of endometrial LE cells as dete cted by immunohistochemistry. When primary antibody was first incubated with PGHS-2 blocking peptide, the absence of staining demonstrated the specificity for PGHS-2 (Figure 5-1G). Some light staining also was detected in SGE, DGE, SS, and DS. However, the staining in th ese endometrial cell types was inconsistent and not evaluated. Within the LE, pregnanc y increased heavy staining (Figure 5-1H) and bST treatment blocked this response ( P < 0.01). Feeding fish oil decreased the amount of PGHS-2 heavy staining in cyclic cows ( P < 0.01; Tables 5-2 and 5-3).

PAGE 179

157 Endometrial PGFS and PGES mRNA Expression Transcripts of 1.3 kb for PGES (Arosh et al., 2002) and 1.4 kb for PGFS (Xiao et al., 1998) were detected in the endometriu m at d 17 following an induced ovulation. An interaction was detected between cyclic and pr egnant control-fed cows with bST slightly increasing PGFS mRNA in cyclic but decreas ing in pregnant c ontrol-fed cows ( P < 0.01; Table 5-1). Relative steady state concentra tions of PGES mRNAs were increased in response to bST for cyclic control and fish oil fed cows ( P < 0.05; Table 5-1). Likewise, bST stimulated PGES mRNA for cyclic control-fed and pregnant cows ( P < 0.01; Table 5-1). Total Contents of PGF2 and PGE2 in ULF Volumes of recovered flushing fluids ( 36.2 mL) and percent r ecovered (90.4%) did not differ among treatments. Total PGF2 (645 93 versus 58 87 ng; P < 0.01) and PGE2 (303 37 versus 39 35 ng, P < 0.01; Table 5-1) contents were greater in ULF of pregnant cows compared with cyclic contro l-fed cows, respectively. Treatment with bST or FO had no effect on uterine flushing PG cont ent in cyclic cows. Within the pregnant cows, bST significantly increased PGE2 (250 39 versus 357 35 ng; P 0.05). Simple and Partial Correlations for the PG Cascade at Day 17 A series of simple (r) and partial (pr) co rrelations of measurements taken at d 17 were found to be significant ( P 0.05). Significant associ ations among treatments were detected for endometrial gene expression, protein abundance and PGs within the uterine flushings at d 17. Endometrial PR mRNA c oncentration was correla ted negatively with ER protein (r = -0.71; partial correlation adjusted for trea tment [pr = -0.8]), PGHS-2 protein (r = -0.35 [ P < 0.10]; pr = -0.56), and positivel y correlated with PGES mRNA (r = 0.74) and PGFS mRNA (r = 0.58; pr = 0.74). Endometrial ER mRNA expression was

PAGE 180

158 positively correlated with OTR mRNA (r = 0.41), PGHS-2 mRNA (r = 0.44), and negatively correlated with PGHS-2 protein (r = -0.34 [ P < 0.10]) and PGF2 in the ULF (r = -0.44). The ER protein abundance was positively correlated with PGHS-2 mRNA (r = 0.34 [ P < 0.10]) and PGHS-2 protein (r = 0.42; pr = 0.54), and negativel y correlated with PGES mRNA (r = -0.58; pr = -0.69) and PG FS mRNA (r = -0.45; pr = -0.73). The OTR mRNA expression was positively corr elated with PGHS-2 mRNA (r = 0.34 [ P < 0.10]) and PGFS mRNA (r = 0.37), and nega tively correlated with PGE2 (r = -0.49) and PGF2 (r = -0.52) in the ULF. The PGHS-2 mRNA was positively correlated with PGHS-2 protein (r = 0.41; pr = 0.57). Abundance of PGHS-2 protein was negatively correlated with both PGES (r = -0.45; pr = -0.51) and PGFS (r = -0.32 [ P < 0.10]; pr = -0.42) mRNA. Expression of PGES mRNA tended to be positively correlated with PGFS mRNA (r = 0.35 [ P < 0.10]; pr = 0.41 [ P < 0.10]). The PGFS mRNA expression was negatively correlated with PGE2 (r = -0.40) and PGF2 (r = -0.41) in the ULF. The total amount of PGE2 was positively correlated with total amount of PGF2 (r = 0.77) in the ULF. Discussion An understanding of the differential regulat ion of PG secretion in cyclic and pregnant animals is pivotal to our underst anding of pregnancy establishment and the endometrial response to factors such as bST and FO. In this study, bST tended to increase pregnancy rates at d 17 (Chapter 4), consistent with previous studies utilizing large numbers of lactating dairy cows (Mor eira et al., 2001; Sant os et al., 2004b). Effects of pregnancy, bST, and FO on st eady state concentrations of mRNAs (ER PR, and PGHS-2) and their respective proteins were examined in uterine endometrium. The PR mRNA was elevated in FO-fed cows and bST did not further stimulate PR

PAGE 181

159 mRNA expression compared with cyclic contro l-fed cows. In contrast, bST stimulated PR mRNA in cyclic control-fed cows, but in pregnant cows bST had no effect. Consistent with previous studies (Kimmi ns and MacLaren, 2001; Robinson et al., 2001), immunohistochemistry indicated the PR was localized mainly in the stroma and the glandular epithelium. More specifica lly, immunhistochemistry showed that the heaviest PR staining was in the SGE and DGE. In the SGE, FO appeared to increase PR abundance which would agree with PR mRNA expression. Pr ogesterone not only prepares the uterus for implantation of the embryo but also helps maintain pregnancy by stimulating uterine secretions for nourishme nt to the developing conceptus. By FO elevating endometrial PR mR NA and PR protein in the SG E, progesterone may have a greater effect on the uterus of cows fed FO. The PR protein also was detected in the deep glands on d 16 in the bovine endometrium of pregnant cows (Robinson et al ., 1999). Previous studies showed that GH treatment in ovariectomized ewes r eceiving ovarian steroid replacement therapy did not alter expression of PR in the uterus (Spencer et al., 1999). However, in the present study bST appeared to have differential effects on PR protein localiza tion staining intensity depending on the pregnancy status and diet. On d 17 after GnRH, ER mRNA and protein concen tration were reduced in pregnant compared with cyclic cows, regard less of whether cows received bST or not. In addition, bST stimulated ER mRNA in cyclic control and FO-fed cows. When examining staining intensity within the different cell types, bST appeared to either block the pregnancy induced reduction (i.e., SGE) or increase (i.e., SS, DS) ER abundance differentially depending on pregnancy status and FO diet. Spencer et al. (1999) failed to

PAGE 182

160 detect any regulatory role of GH on endometrial ER mRNA expression, or on PR and OTR gene expression, in sheep. Growth hormone may exert its effect indirectly through IGF-I, because bST treatment increased serum concentrations of IGF -I in these lactating cows (Chapter 4). The IGF-I increased ER expression in mammary and pituitary tumor cells (Newton et al., 1994; Lee et al., 1997). Also in othe r systems, IGF-I induces ERdependent gene expression (Klotz et al., 2002). Endometrial IGF-I mRNA levels are increased during the bovine estrous cycle when circulating concentratio ns of estradiol are high (Meikle et al., 2001). Immuno histochemistry indicated that ER receptor of the LE, SGE, and DGE of the endometrium of cyclic cows was greater than that of pregnant cows. Similarly, an upregulation of ER mRNA and protein in the luminal epithelium was detected around d 14 to 16 of the estrou s cycle in cyclic cows and expression was very low in pregnant cows at the same st age (Kimmins and MacLaren, 2001; Robinson et al., 2001). Pulsatile secretion of PGF2 from endometrial tissue, that initiates luteolysis, is thought to be dependent upon an increase in OTR concentration within the luminal epithelium (McCracken et al ., 1999). In the present st udy, pregnancy decreased steady state concentrations of OTR mRNA and bS T stimulated OTR mRNA in both cyclic control and FO-fed cows. The decrease in the OTR mRNA concentration in the pregnant cows treated with or without bST may be due to a concurrent decrease in ER mRNA and protein expression in pre gnant cows, as reported in sheep (Spencer et al., 1995). Indeed OTR mRNA was partially correlated with ER mRNA. The bST stimulation in OTR mRNA was associated with a concurrent increase in ER mRNA stimulation in cyclic control and FO-fed cows. In sheep a nd cattle, an upregulation of OTR is inhibited

PAGE 183

161 by pregnancy, likely due to secretion of IFNby the conceptus (Far in et al., 1990). The OTR is undetectable in the bovine endometr ium during much of the luteal phase, but increases on or after d 15 of the estrous cycle (Fuchs et al., 1990; Mann and Lamming, 1994; Robinson et al., 1999; 2001). On d 17, at the time of expected initiation of luteolysis, OTR concentrations were about 10% of what was seen duri ng estrus (Fuchs et al., 1990). Injection of oxytoc in into nonpregnant cows i nduced the release of PGF2 on d 16 (Lamming and Mann, 1995). These findings indicate that only su btle increases of OTR concentrations are needed to induce a luteolytic release of PGF2 Conversely, small but significant reduction in OTR mRNA, as detected in the present study, due to pregnancy may have profound inhibitory effects on pulsatile secretion of PGF2 In the endometrium, PGHS-2 protein was lo calized to the luminal epithelium. This observation is consistent with previous repor ts, although others have suggested there is some stromal expression (Charpigny et al., 1997a; Boos, 1998; Kim et al., 2003). Endometrial expression of PG HS-2 mRNA did not differ in response to pregnancy, bST treatments, or FO. However, PGHS-2 protei n was increased in endometrium of pregnant cows. The increase in pregnancy was detected both by Western blotting and immunohistochemistry. Immunohistochemistry responses revealed an interaction between bST and pregnancy with bST injectio ns attenuating the pr egnancy increase in PGHS-2 protein in the LE. This attenuati on was not statistically significant when quantified with Western blotting although there was a 22% reduction. Immunohistochemistry allows for a spatial eval uation of PGHS-2 protein that was mainly present in the LE and showed inhibitory eff ects of bST in pregnant cows and FO-fed cows. Such differences cannot be detect ed in an endometrial protein homogenate

PAGE 184

162 comprised of all cell types. Emond et al (2004) also reported that endometrial expression of PGHS-2 protein was increased during early pr egnancy and in response to intrauterine infusions of IFN. Arosh et al. (2002) show ed that the PGHS-2 protein concentrations peaked around d 16 to 18 of the cycle without any changes in PGHS-2 mRNA concentrations. In sheep, PGHS-2 mR NA levels were similar in cyclic and pregnant ewes, although PGHS-2 protein expression was maintain ed at greater levels in the pregnant rather than cyclic ewes af ter about d 15 (Salamonsen and Findlay, 1990; Charpigny et al., 1997a). The expression of PGHS-2 mRNA was found to be greater in pregnant ewes between d 10 and 18, with c oncentrations decreasi ng by d 16 in cyclic ewes (Kim et al., 2003). The present study detected no changes in PGHS-2 mRNA. Collectively, these findings are consistent with an upregula tion of endometrial PGHS-2 protein during pregnancy, and support the hypothesis of Charpi gny et al. (1997a) that pregnancy may be associated with increased translation effici ency and (or) increased stability of PGHS-2 protein in the absence of changes in stea dy state concentrations of PGHS-2 mRNA. Interestingly, this increased expression of PGHS-2 protein in the endometrium of early pregnancy could explain the gr eater basal concentrations of PGFM reported in pregnant cows (Williams et al., 1983), ewes (Zarco et al., 1988; Payne and Lamming, 1994), and water buffalo (Mishra et al., 2003). However, increased basal con centrations of PGFM reflects a secretion pattern that is not luteolyt ic or pulsatile in na ture (Thatcher et al., 1984). An absence of luteolytic pulses, but gr eater basal conc entrations of plasma PGFM indicate that pregnancy does not suppress completely the endometriums ability to synthesize PGs, but rather alters the pattern of secretions.

PAGE 185

163 Pregnancy-induced expression of PGHS-2 pr otein in the uterus might indicate that the anti-luteolytic action of IFNto suppress pulsatile secretion of PGF2 is not likely at the level of PGHS-2 expression. A d ecline in the concentrations of ER mRNA, ER protein, and OTR mRNA of pregnant cows tr eated with or without bST may have caused a suppressive effect on pul satile secretion of PGF2 by endometrium that would normally initiate luteolysis. In early pregnanc y, constant increases in production of IFNby welldeveloped embryos would inhib it the luteolytic pulse generator for secretion of PGF2 The increase in PGHS-2 protein of pregna ncy could contribute to the greater basal concentrations of PGFM detected in the ci rculation during early pregnancy (Williams et al., 1983; Mishra et al., 2003). When poorly developed embryos produce small amounts of IFNat the time of pregnancy recogniti on (Mann and Lamming, 2001), pulsatile secretion of PGF2 may occur leading eventually to lute olysis as a conseq uence of a lack in attenuation of OTR and ER expressions. Furthermore, pregnancy-associated events such as regulation of local immune function, angiogenesis, regulation of blood fl ow, and development of implantation sites require presence of PGHS-2 (Lim et al., 1997; Marions and Danielsson, 1999; Matsumoto et al., 2001; 2002). Increased P GHS-2 in pregnancy may support their localized response but the affe rent regulators of PGHS-2 fo r pulsatile secretion of PGF2 have been suppressed. Low concentrations of IFNhave been shown to be inhibitory to PGF2 secretion and PGHS-2 mRNA e xpression by endometrial cells in vitro (Guzeloglu et al., 2004c; Parent et al., 2003). The reduction in PGF2 secretion may be through degradation of PGHS-2 mRNA transc ripts by low concentrations of IFN(Guzeloglu et al., 2004b). Therefore underdeveloped embr yos, which would produce reduced amounts

PAGE 186

164 of IFN, may not survive the process of implanta tion due to a possible negative effect of reduced IFNconcentrations on PGHS-2 mRNA. However, these responses would contribute to extended interestrus intervals for cows losing embryos. It is important to determine the response s of PGFS and PGES mRNAs (i.e., relative gene expression that may or may not be re lated to enzymatic protein and (or) activity) regarding potential downs tream metabolism of PGH2. It is hypothesized that downstream metabolism of PGH2 to PGF2 could be decreased or conversion of PGH2 into PGE2 increased since luteolytic peaks of PGF2 are reduced in pregnancy. An interaction between bST and pregnancy occurred in which bST increased PGFS mRNA expression in cyclic control-fed cows but bST decreas ed PGFS mRNA expression in pregnant cows. Also, bST increased PGES mRNA expression in pregnant, cyclic control and FO-fed cows. Since bST decreased PGFS mRNA and increased PGES mRNA in pregnant cows this may be potentially associated with more PGE2 and less PGF2 secretions creating a stronger antiluteolytic signal to maintain pre gnancy. This may be another explanation for an increase in pregnancy rates beyond th at of increased conceptus development contributing to a decrease in early embryoni c loss as reported in previous studies (Moreira et al., 2000b, 2001; Sa ntos et al., 2004b). Also, the reduction in PGFS and PGES mRNA due to pregnancy may be due to the overall reduction in the hormonal afferent component regula ting the PG cascade (i.e., ER mRNA and protein, and OTR mRNA). However, presence of the concep tus differentially modulates endometrial responsiveness to bST to reduce PGFS mRNA a nd increase PGES mRNA in a manner to support pregnancy. When the conceptus was not present, bST stimulated ER and OTR mRNA, and this was associated with an increase in PGFS and PGES.

PAGE 187

165 Indeed the amount of PGE2 in uterine flushings was el evated in pregnant cows treated with bST. In our study, pregnant co ws had far greater concentrations of PGF2 and PGE2 in uterine flushings than cyclic animals. Others also have reported a greater PG content in uterine flushings from pregna nt than cyclic cattle on d 16 and 19 postestrus (Lewis et al., 1982; Bartol et al., 1985). Conceptuses recovered from those cattle were able to convert radiolabelled AA into PGs (Lewis et al., 1982). The trophoblastic cells of the ovine conceptus contained large amounts of PGHS-2 during d 10 to 17 of gestation (Charpigny et al., 1997b). Thus, high luminal content of PGs in pregnant ruminants may be, at least in part, because of production and release by the conceptus. Also, bST increased endometrial PGES mRNA expression in pregnant cows possibly accounting for some of the PGE2 which was increased in bST-treated pregnant cows compared with no bST-treated pregnant cows. Effect of bST treatment on uterine OTR, ER and PR genes, and ER and PGHS-2 proteins of lactating Holstein cows, was si gnificant and diverse. Critical regulatory components such as mRNAs for OTR, ER PGES and PGFS were stimulated in cyclic cows due to bST. However, different res ponses occurred in pre gnant cows which may reflect direct conceptus induced alterations in regulation of gene expression due to such agents as IFN, or indirect conceptus induced alte rations within the endometrium (i.e., ISG-17, STAT factors 1 and 2 [Stewart et al., 2001], 2 microglobulin [Vallet et al., 1991] interferon regulatory fact or -1 [Spencer et al., 1998], Mx protein [Ott et al., 1998], ubiquitin cross reactive protei n [Johnson et al., 1999], granul ocyte-chemotactic protein-2 [Teixeira et al., 1997] and 2`, 5` oligoadenylate synthase [Johnson et al., 2001]) that effect responsiveness to bST. Spencer et al (1999) demonstrated that pretreatment of

PAGE 188

166 ewes with IFNwas necessary to induce endometrial responsiveness to placental lactogen and GH. Badinga et al. (2002) dem onstrated in a bovine endometrial cell line that both bovine GH and IFNsuppressed phorbol 12,13-dibutyrate induced PGF2 production. When added in combination ther e was an additive effect in reducing PGF2 secretion. The need for IFNpriming for a GH response also appears to be true for responses of the GH-IGF family (Chapter 4). The FO had little effect on the endometrial components that dir ectly regulate the PG cascade. This was not unexpected sin ce EPA and DHA exert their regulatory effects as alternative substrates that reduce the lipid pool of AA in the endometrium (Chapter 6). Such a displacement reduces the overall amount of AA precursor for PGs of the 2 series and increases the precursor pools of EPA a nd DHA for biosynthesis of 3 series PGs (Mattos et al., 2003). This in turn may decr ease the induced pulsatile release of PGF2 as shown in a previous study (Mattos et al., 2002). Conclusions At d 17 of the cycle, the potential luteol ytic cascade was affected as pregnancy decreased steady state concentrations of ER mRNA, ER protein, OTR mRNA and increased PGHS-2 protein. A dec line in the concentrations of ER and OTR would contribute to attenuation in the endo metrial pulsatile secretion of PGF2 that would initiate luteolysis in cyclic lactating cows. Increased PGHS-2 protein in early pregnancy could contribute to the greater basal concentrat ions of PGFM detected in the circulation and support developmental processes of the conceptus endometrial unit. Collectively, this study shows the diffe rential responses (i.e., PGFS) to bST depending on pregnancy status The bST may regulate enzy mes (i.e., PGES) downstream

PAGE 189

167 of PGHS-2 to decrease PGF2 and increase PGE2 thereby maintaining pregnancy. Pregnancy appears to attenua te gene expression and prot ein secretion of hormonal components regulating the PG cascade thereby reducing pulsatile release of PGF2 Feeding FO not only increased PR mRNA expr ession but also had differential cell type responses, with FO increasing PR in the SGE and DGE which may be beneficial for preparation of the uterus to establish and ma intain pregnancy. Also, feeding FO reduced localization of ER (i.e., LE, DGE, and SS) and PGHS-2 (i.e., LE), which may contribute to a reduction in pulsa tile release of PGF2 In summary, the use of both a pharmaceutical such as bST, to directly modulate the PG cascade in concert with increased IFN(Chapter 5), and a nutraceutical, such as FO, to reduce components of the PG cascade as well as increasing PR provides a uterine environment conducive for embryo developmen t. In addition, FO may reduce the precursor for PG of the 2 series, there by decreasing the pulsatile release of PGF2 Furthermore, FO may provide a healthier product for consumers. The objective of Chapter 6 is to elucidate how bST, FO, and pregnancy regu late fatty acid distribution among various tissues including milk fat.

PAGE 190

168Table 5-1. Least squares means and pooled SE for uterine endometrial mRNA and prot ein, and uterine luminal flushings (ULF) protein expression at d 17 after a synchroni zed estrus (d 0) in lacta ting cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fe d a fish oil enriched lipid (FO) diet a nd injected with or without bST on d 0 and 11 (n = 28). Arbitrary units (AU) were generated by densitometry and mRNA results are adjusted using glyceraldehyde-3phosphate dehydrogenase as a covariate. Treatments1 Contrasts2 Response3 C bST-CFObST-FOPbST-PS.E. FO bST bST x FO P bST bST x P PR mRNA, AU 60 69 6867 61592.1 NS * NS ** ER mRNA, AU 11 15 1216 1182.1 NS NS NS NS ER protein, AU 70 71 7073 67 701.2 NS NS NS NS NS OTR mRNA, AU 45 50 4952 39411.3 NS NS ** NS NS PGHS-2 mRNA, AU 84 83 8583 78823.3 NS NS NS NS NS NS PGHS-2 protein, AU 39 48 7070 91801.8 NS NS NS NS NS PGFS mRNA, AU 27 28 2828 27250.6 NS NS NS ** PGF2 ng/ULF 57 60 13050 61867292 NS NS NS ** NS NS PGES mRNA, AU 45 48 4647 43460.9 NS NS ** NS PGE2, ng/ULF 39 39 8215 25035738 NS NS NS ** NS NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 PR = Progesterone receptor; ER = estradiol receptor ; OTR = oxytocin receptor; PGHS-2 = prostaglandin H synthase-2; PGFS = prostaglandin F synthase; PGES = prostaglandin E synthase.

PAGE 191

169Table 5-2. Least squares means and pooled st andard error (SE) for uterine endometrial protein expression re sponses at d 17 aft er an induced ovulation (d 0) in lactating dairy cows injected with or without bST on d 0 and 11. Treatments1 Stat2 C bST-C FO bST-FO P bST-P S.E.Code Response3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 Progesterone Receptor LE 97 3 0 0 83 170 0 8614 0 0 75 166 3 90100 0 8218 0 0 3 1, 12 SGE 33 55 10 2 42 526 0 4039 165 45 35145 384813 0 3060 100 3 2, 13 DGE 8 42 42 8 17 5924 0 1940 329 14 50288 7 3543 151050 328 3 3, 14 SS 35 56 9 0 45 4312 0 3260 8 0 33 616 0 38556 0 3059 110 3 4, 15 DS 33 52 14 0 45 4411 0 4054 5 1 27 61130 415010 0 2854 190 2 5, 16 Estrogen Receptor alpha LE 8 19 40 32 10 1536 391237 381310 283823 106025 5 1661 194 5 6, 17 SGE 1 20 46 33 1 2248 287 29 51141 124542 4 2753 152 22 52234 7, 18 DGE 1 13 38 48 0 7 30 613 6 35566 144337 1 3 19 780 12 31573 8, 19 SS 22 34 35 10 29 2728 162628 301623 183227 323726 4 1835 37102 9, 20 DS 29 44 25 2 33 2921 173027 281521 173329 312931 9 2227 36153 10, 21 Prostaglandin H Synthase-2 LE 4 13 30 53 3 2229 463 19 37415 294026 1 4 23 721 19 41397 11, 22 1C = Cyclic control-fed, bST-C = bST-cyclic control-fed, FO = cyc lic fish oil fed, bST-FO = bST-cyclic fish oil fed, P = pregnan t, bST-P = bST-pregnant; Staining intensity weighted average (0 = none, 1 = less, 2 = moderate, 3 = heavy staining). 2Numbers match row for statistical values in following table. 3LE = luminal epithelium, SGE = superficial glandular epithelium, DGE = deep glandular epithelium, SS = superficial stroma, DS = deep stroma.

PAGE 192

170 Table 5-3. Statistical analyses of uterine endometrial protein expr ession for Table 5-2. Sources of Variation1,2 Statistics Fish Oil (FO) bST: C vs. FO bST x FO interaction Code3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 PR LE (1) ** NS ** NS NS NS SGE (2) ** ** NS ** NS NS NS NS NS DGE (3) NS NS ** NS NS ** NS SS (4) ** NS ** NS NS ** NS NS DS (5) ** NS NS NS NS NS ** NS ER LE (6) ** ** NS NS NS NS SGE (7) NS NS NS NS ** ** NS ** ** DGE (8) NS NS ** NS NS NS NS ** ** SS (9) ** ** ** ** NS ** NS DS (10) ** NS ** ** ** NS NS PGHS-2 LE (11) NS NS ** NS NS NS NS NS Statistics P bST: P vs. C bST x P interaction Code3 0 vs. 1 0,1 vs. 2,3 2 vs. 30 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 PR LE (12) NS NS ** NS NS NS NS NS SGE (13) ** ** NS ** NS NS NS NS NS DGE (14) ** NS ** NS NS NS NS SS (15) ** NS NS NS NS ** NS NS DS (16) NS NS NS NS NS ** ** NS ER LE (17) ** ** NS NS NS NS NS NS SGE (18) NS NS ** NS NS NS NS NS NS DGE (19) NS NS ** NS NS NS NS ** ** SS (20) * NS ** NS ** ** ** DS (21) NS ** NS ** ** NS PGHS-2 LE (22) NS NS NS NS NS ** NS NS ** 1 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 2 Two and three way interactions: FO = fish oil vs. cyclic control-fed cows x staining intensity; bST (FO) =bST vs. no bST-treated fish oil and cyclic control-fed cows x staining intensity; bST x FO = bST (FO) x FO x staining intensity; P = pregnant vs. cyclic control-fed cows x staining intensity; bST (P) = bST vs. no bST-treated pregnant and cyclic control-fed cows x staining intensity; bST x P = bST (P) x P x staining intensity. 3 Statistical analyses for data in Table 2.

PAGE 193

171 Figure 5-1 Expression of PR (A, B, C), ER (D, E, F), and PGHS-2 (G, H, I) in bovine endometrium at d 17 following an induced ovulation. No immunopositive staining was detected when primary antibody was replaced by mouse IgG (A for PR and D for ER ) and when primary antibody was first incubated with PGHS-2 blocking peptide (G for PGHS-2). Staining for ER and PR was detected exclusively in the nuclei of the epithelial and stromal cells. Fish oil (C) increased ( P < 0.05) abundance of PR in the superficial glandular epithelium compared with the cyclic control-fed cows (B). Pregnancy decreased ( P < 0.05) ER staining in the luminal and superficial glandular epithelium (F) compared with the cyclic control-fed cows (E). Staining for PGHS-2 was observed in the cytoplasm of endometrial luminal epithelial cells. Pregnancy (I) increased ( P < 0.05) the intensity of staining for PGHS-2 protein in the luminal epithelial cells compared with the cyclic control-fed cows (H). Magnification x 20. A BC D EF G H I

PAGE 194

172 CHAPTER 6 PREGNANCY, BOVINE SOMATOTROPIN AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: III. FATTY ACID DISTRIBUTION Introduction Some UFA have anticarci nogenic effects and other human health-promoting properties (Bauman et al., 2001). Supplemen tation of dietary UFA to food-producing animals may increase the concentration of UFA in meat and milk which may be beneficial for human health. Increasing the am ount of lipid in the diet of dairy cows improved immune status (Amaral et al., 2005), energy balance (Stapl es et al., 1998), and fertility (Son et al., 1996; Sklan et al., 1991) In ruminants, biohydrogenation reduces the amount of UFA reaching the small intestine for absorption due to reduction of double bonds and altering isomeric orientation (H arfoot and Hazelwood, 1998). Protection of UFA from ruminal microbes increases amounts of fatty acids that escape biohydrogenation and their availability fo r absorption in the small intestine. Feeding fish oil increased concentrations of the n-3 PUFA, EPA (C20:5), and DHA (C22:6) in the milk fat and caruncles, and reduc ed circulating concentrations of PGFM in dairy cows (Mattos et al., 2004). This reducti on was attributed to a possible displacement of AA (C20:4), the precursor for PGF2 synthesis, with EPA and DHA. The EPA is a precursor for PGs of the 3 series which are less biologically active than those of the 2 series (Needleman et al., 1979) and may contri bute to enhancing the antiluteolytic effect of the conceptus to maintain pregnancy in dairy cows.

PAGE 195

173 Not only can FO elevate n-3 fatty acids, but FO also increases concentrations of CLA in milk fat (Donovan et al., 2000). Conj ugated linoleic acid refers to a mixture of positional and geometric isomers of linoleic acid (C18:2) that contain conjugated unsaturated double bonds (i.e., ci s-9, trans-11 CLA, trans-10, cis-12 CLA, trans-9 trans11 CLA). Both CLA and PUFA, such as EPA and DHA, have been shown to activate PPAR which can affect GHR expressi on (Khan and Vanden Heuvel, 2003), PG production (Lim et al., 1999), insulin sens itivity (Berger and Moller, 2002), and implantation (Lim et al., 1997). In various animal models, dietary CLA supplementation has been shown to reduce tumorigenesis (Ip, 1997), decrease atheroge nesis (Nicolosi et al., 1997), enhance immune response (Cook et al., 1993), increase feed efficiency (Chin et al., 1994), and reduce body fat (DeLany et al., 1999). The cis-9, trans-11 CLA is considered to be the most biologically active and predominant isomer, comprising approximately 84% of the isomers of CLA in m ilk fat from dairy cows fed no fish oil or 88 to 92% in cows fed fish oil (Donovan et al ., 2000). Ip et al. (1999) showed that this isomer is anticarcinogenic in rats when s upplemented in the diet as butter fat. Fatty acid composition is quite diverse between tissues, and certain tissues may preferentially uptake particular fatty acids which are functional characteristics for that tissue (Abayasekera and Wathes, 1999). Change s in the physiological state (i.e., lactation and (or) pregnancy) of the dairy cow can lead to the partitioning of essential nutrients (i.e., fatty acids) to partic ular tissues to sustain a ho meorhetic response (Bauman and Currie, 1980). Understanding what fatty ac ids are preferentially sequestered during pregnancy in certain tissue pools would allow formulation of diets enriched in the fatty

PAGE 196

174 acids of interest to replenish depleted fatty acid stores in late lact ation and pregnancy in order to increase partitioning from these tissues in early lactation. Exogenous bST is used to increase m ilk production (Bauman et al., 1999b). Bovine somatotropin stimulates the release of IGF-I from the liver which can mobilize fatty acids from adipose tissue to increase milk secretion by the mammary gland (Cohick, 1998). Consequently, the fatty acid composition of these tissues is reduced. Whether the fatty acid profile is altered is unknown. The objective of this study was to ev aluate the effects of exogenous bST, pregnancy and a diet enriched in FO, as well as their interactions, on the distribution and concentration of fatty acids within the endometrium, liver, milk fat, mammary tissue, muscle, subcutaneous adipose tissue, and inte rnal adipose tissue. Information gained could benefit the management approach of co ws during critical bi ological windows (i.e., transition period, lactogenesis, energy partitioning and pregnancy) while also used to help provide an improved nutritiona l product and (or) functiona l food for consumers. Materials and Methods Animals and Experimental Diets For a more detailed description of animal s, management, and collection of samples see Chapter 4. Briefly, forty multiparious Holstein cows in late gestation were fed diets formulated to contain 1.51 Mcal NEL/kg, 13.1% CP, and a cation anion difference of -90 meq/kg (DM basis) beginning approximately 3 wk prior to expected calving date. Upon calving, cows were fed one of two dietary treatments contai ning 0 or 1.9% calcium salt of a FO-enriched lipid product (E nerG-II Reproduction formula, Virtus Nutrition, Fairlawn, OH). The fatty acid profile of the fat s ource as given by the manufacturer was 2.2% C14:0, 41.0% C16:0, 4.2% C18:0, 30.9% C18: 1, 0.2% C18:1 trans, 8.0% C18:2, 0.5%

PAGE 197

175 C18:3, 0.4% C20:4, 2.0% C20:5, 2.3% C22: 6, and 2.7% unknown. The control diet contained a greater concentr ation of whole cottonseed a nd therefore was similar in concentration of ether extract and NEL (Table 6-1) to that containing FO. The control diet (0% FO) was fed to all cows during the first 9 DIM. From 10 to 16 DIM, ten cows were assigned to consume a FO diet contai ning half the final concentration of the fat product (0.95% of dietary DM) in order to adjust the cows to a new fat source. Starting at 17 DIM, these cows were switched to the 1.9% FO diet and continued on that diet until the end of the study. Cows fed the FO consumed approximately 14.8 g/cow per day of EPA and DHA combined. Thirty cows were as signed to the control diet for the duration of the study. Cows were milked three times per day and milk weights were recorded by calibrated electronic milk meters at each m ilking. Body weights were measured and BCS (Wildman et al., 1982) assigned weekly by the same two individuals. Estrus Synchronization, Ultrasonogra phy of Ovaries, and bST Treatment Estrus was synchronized as described in detail in Chapter 4. Briefly, cows were presynchronized starting at 44 5 DIM (d 27 in relation to day of TAI using an injection of GnRH (2 mL, 86 g, i.m.) follo wed 7 d later with an injection of PGF2 (5 mL, 25 mg, i.m.) on d 20 (DeJarnette and Marshall, 2003 ). At the end of 10 d, the Ovsynch protocol (Pursley et al., 1997a) was initiated usi ng a GnRH injection (2 mL, 86 g, i.m.) followed 7 d late r by an injection of PGF2 (5 mL, 25 mg, i. m.). At 48 h after injection of PGF2 GnRH (2 mL, 86 g, i.m.) was ad ministered, and 16 cows fed the control diet were inseminated 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sires, Plain City, OH; 7H05379). The cycling group (n = 19) was not inseminated. Inseminated and

PAGE 198

176 non-inseminated cows received either an inject ion of bST (500 mg) or no injection on d 0 (when cows were either inseminated or not) and again on d 11 post TAI. The bST injections were given 11 d apart instead of 14 d, to allow for a sustained continual exposure to GH until d 17 at which time cows were slaughtered. The bST injections were given subcutaneously in the space betw een the ischium and tail head. Three cows with various health concerns, and two that underwent CL regression prior to d 17 were excluded from the study. On d 17 after an induced ovulation cows (n = 35) were slaughtered to collect tissue sa mples and verify presence of a conceptus. Pregnancy rates were defined as number of cows classified pregnant based upon visualization of a conceptus in the uterine flushing at slaughter divided by number of cows inseminated. From the inseminated cows that were sla ughtered and not pregnant, 6 cows were not treated with bST and 1 cow was treated with bS T. These 7 cows were not used for fatty acid analyses. Numbers of cows used for tissue analyses on d 17 in each group were as follows: control diet had 5 bST-treated cyclic (bST-C), 5 non bST-treated cyclic (C), 5 bST-treated pregnant (bST-P), and 4 non bS T-treated pregnant (P) cows; the group fed FO had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows. Tissue Sample Collection For each cow, a sample of milk from the morning (1000 h) milking was collected at 75 5 DIM, refrigerated at 4C, and fat extracted using a detergent solution containing 3% Triton X-100 (wt/vol) and 7% sodium hexametaphosphate in distilled water. Milk fat was stored in -20C until fatty acid analysis. All cows were sacrificed (94 12 DIM) in the abattoir of the Animal Sciences Department at the University of Florida. Reproductive tracts were collected within 10 min of slaughter, placed on ice and taken to the laboratory. The uterine horn ipsilateral to

PAGE 199

177 the CL was cut along the mesometrial border, and the endometrium was dissected from the myometrium. Endometrial tissue from the anti-mesometrial border of the ipsilateral horn was removed, frozen in liquid nitrogen and stored at -80C. Liver, muscle, mammary, subcutaneous adipose, and internal adipose tissues were collected at slaughter and immediately placed in liquid nitrogen, a nd stored at -80C. Two sections of approximately 7 g of each collected tissue we re freeze-dried for 24 h using a lyophilizer (Labconco, Kansas City, MO) to obtain a fina l mass of approximately 1.5 g of DM. Fatty acids in dry tissue and milk fa t were methylated and separa ted by gas chromatography as described below. Milk Fat Isolation and Analyses of Fatty Acid Composition Fatty acids in freeze-dried tissue and milk fat samples were converted to methyl esters in 0.5 M sodium methoxide in meth anol followed by a second methylation in acetyl chloride:methanol (1:10, vol/vol) based on a procedure described by Kramer et al. (1997) to prevent epimerization and is omerization of conjugated acids. Methyl esters were separated by GLC (H P 5890, Agilent Technologies, Palo alto, CA) on a 30 m x 0.25 mm x 0.2 m-film thickne ss SP2380 capillary co lumn with split (100:1) injection. Temperature program used for the tissue fatty acids was 140oC initially (held for 3 min), and then raised 3.7oC/min to a final temperature of 220oC (held for 20 min). Milk fatty acid methyl esters were run using an initia l temperature of 50oC (held for 2 min) and increased 4oC/min to a final temperature of 250oC (held for 15 min). Peak identities were done by comparison of retention times to reagent-grade fatty acid standards. Additional structural identification of the 20:3 peak in liver samples was done on an Agilent 5975 GC/MS (Agilent Tec hnologies, Palo alto, CA) equipped with a CP Sil 88 column operated at an initial temperature of 120oC for 5 min, and increased

PAGE 200

178 2oC/min to a final temperature of 220oC. The liver peak had a retention time and distinctive ion fragment at 150 that matc hed that of a 20:3 c8,c11,c14 methyl ester standard, but did not match retention times or ions at 108 and 192 that were distinctive for the 20:3 c5,c8,c11 and 20:3 c11,c14,c17 meth yl ester standards. Geometries of double bonds (cis or trans) were not determined. Identifiable fatty acids for each tissue s ource and milk fat were as follows: C4:0, C6:0, C8:0, C10:0, C12:0, C14:0, C14:1, C15:0, C16:0, C16:1, C17:0, C18:0, C18:1trans, C18:1, cis-9 C18:1, cis-11 C18:1, C18: 2, cis-9 trans-11 CLA, cis-12 trans-10 CLA, trans-9 trans-11 CLA, C18:3, C20:0, C 20:3n-6, C20:4, C21:0, C22:0, EPA (C20:5), DHA (C22:6), and C24:0. The desaturase index (DIX) was used as a proxy for 9-desaturase activity previously defined as: (product of 9-desaturase)/(product of 9-desaturase + substrate of 9-desaturase) (Malau-Aduli et al., 1997; Kelsey et al., 2003). For all tissues except the endometrium, C14:1 was used as the 9-desaturase product and C14:0 as 9-desaturase substrate. In the endometrium, C16:1 was used as the 9-desaturase product and C16:0 as 9-desaturase substrate sin ce C14:1 was undetectable. Statistical Analyses Percentages of fatty acid compositions from each tissue source and milk fat were analyzed using the general linear model proc edure of SAS (SAS Inst. Inc, Cary, NC). The mathematical models included the main effects of treatment (C, FO, P, bST-FO, bST-C, and bST-P) and orthogonal contrasts were used to compare treatment means (bST, pregnancy status, and bST x pregnancy status interaction or bST, FO, and bST x FO interaction). Because the study had no preg nant cows fed FO, statistical comparisons could not be made between FO-fed cows and pr egnant cows. Analysis of concentrations

PAGE 201

179 of LCFA ( C18:0) among all tissue and milk fat s ources were analyzed using the general linear procedure of SAS. The mathematical model included the main effect of treatment (C, FO, P, bST-FO, bST-C, and bST-P), tissue source (endometrium, liver, muscle, mammary, subcutaneous adipose, internal adi pose tissue, and milk fat) and treatment x tissue source. Orthogonal cont rasts were used to compare tissue sources as follows: 1) milk fat and mammary tissue versus endometri um, liver and muscle; 2) milk fat versus mammary tissue; 3) endometrium, liver and muscle versus subcutaneous and internal adipose; 4) subcutaneous versus internal adipose; 5) endometrium versus liver and muscle; 6) liver versus muscle. Fatty acid composition (Tables 6-1 through 610) was analyzed in all tissue sources for all treatment groups (5 C, 4 FO, 4 P, 5 bST-C, 4 bST-FO, and 5 bST-P) and responses with a P 0.05 are described in the text. Results Long Chain Fatty Acid Composition among Tissues Proportions of fatty acid dist ribution are shown for the endometrium (Table 6-1), liver (Table 6-3), mammary (Table 6-4), m ilk fat (Table 6-6), muscle (Table 6-7), subcutaneous (Table 6-9) and internal adi pose (Table 6-10) tissues. Many differences were detected in composition of LCFA am ong tissues. For instance, C18:2 differed ( P < 0.01) among milk fat, mammary gland, e ndometrium, liver and muscle (3.38, 5.42, 12.86, 14.43, and 9.58 0.29%, respectively) with endome trium and liver having the greatest percent of C18:2. No difference in C18: 2 was detected between subcutaneous and internal adipose tissues ( 1.97 vs. 2.10 0.29%, respectively). The C18:3 fatty acid differed ( P < 0.01) among endometrium, liver, and muscle (0.90, 0.49, and 0.33 0.01%, respectively) with no differences between milk and mammary gland (0.28 vs. 0.28

PAGE 202

180 0.01%, respectively) an d between subcutaneous and in ternal adipose (0.16 vs. 0.17 0.01%, respectively) tissues. Arach adonic acid (C20:4) differed ( P < 0.05) among milk fat, mammary gland, endometrium, liver, and muscle (0.16, 0.78, 14.62, 8.10, and 3.86 0.25%, respectively) with the greatest percen tage in the endometrium. There was no difference in C20:4 concentrations between th e subcutaneous and inte rnal adipose tissues (0.06 vs. 0.04 0.25%, respectively). Bo th EPA and DHA percentages were not different between milk fat and mammar y gland (0.02 vs. 0.06 and 0.01 vs. 0.03 0.02%, respectively). The EPA was not detected in th e subcutaneous or internal adipose tissues; however, DHA was different (0.004 vs. 0.03 0.02% respectively). Endometrium, liver and muscle differed ( P < 0.01) in both EPA (0.04, 0.76, and 0.19 0.02%, respectively) and DHA (1.16, 0.85, and 0.05 0.05%, respectively). Due to these striking differences in proportions of LCFA among tissues, proportions of individual fatty acids were examined on a per tissue basis. Fatty Acid Composition in Endometrium at Day 17 In endometrial tissue, an in teraction was detected betw een bST-treated and FO-fed cyclic cows with bST reducing C14:0 in bST-C but increasing C14:0 in bST-FO ( P 0.01; Table 6-1). The FO increased concentrations of C15:0, C16:0 ( P 0.05), and C18:1-trans ( P 0.01) and reduced C16:1 ( P 0.05) and C18:0 ( P 0.01; Table 6-1). Importantly, concentrations of EPA and DHA were increased ( P 0.01) in FO-fed cows with a concurrent decrease ( P 0.01) in AA (C20:4, Table 6-1). Interestingly, bST treatments within cyclic control and FO-fed cows increased concentrations of C18:1 ( P 0.01) and DHA ( P 0.01) but decreased concentration of C18:2 ( P 0.05; Table 6-1). Also, bST injections decreased C18:2 and in creased DHA in cyclic control-fed cows but increased them in pregnant cows (bST by P interaction P 0.05; Table 6-1).

PAGE 203

181 The bST increased the proportion of MU FA with a subsequent decrease ( P 0.01) in PUFA (Table 6-2). The n-6:n-3 ratio was reduced ( P 0.01) due to both FO and bST in cyclic cows. However, if a conceptus was present, bST increased the n-6:n-3 ratio whereas it was decreased in cyclic cows (bST by P interaction P 0.01; Table 6-2). Fatty Acid Composition in Liver at Day 17 Among control-fed cyclic and pregna nt cows, bST increased C14:1 (P 0.05; Table 6-3) in liver. The FO diet increased (P 0.01) concentrations of C18:3, EPA and DHA but decreased C20:3 (P 0.05; Table 6-3). There was an interaction between FO and bST treatment with bST in creasing C21:0 in cyclic cont rol-fed cows but decreasing C21:0 in FO-fed cows (P 0.01; Table 6-3). Another inte raction was detected between bST and FO with bST increasing C22:0 in cyc lic control-fed cows but FO elevated C22:0 and bST injections did not ha ve any additional effect (P 0.01; Table 6-3). The n-6:n-3 ratio was reduced ( P 0.01) when cyclic cows were fed FO (Table 62). The bST reduced the concentration of PUFA ( P 0.05; Table 6-2) among pregnant and cyclic control-fed cows. The DI X was decreased due to pregnancy ( P 0.01). Fatty Acid Composition in Mammary Tissue at Day 17 In mammary tissue, FO decreased C14: 1, but increased C16:0, C18:3, C20:0, CLA t9t11, EPA, DHA and C24:0 ( P 0.05; Table 6-4). The bST decreased (P 0.01) C18:3 in FO and control-fed cyc lic cows but increased ( P 0.05) C16:1 within pregnant and cyclic control-fed cows (Table 6-4). The FO diet decreased drama tically the n-6:n-3 ratio ( P 0.01; Table 6-5). Between cyclic FO and contro l-fed cows, bST injection increased the DIX in cyclic control-fed cows but reduced the DIX in FO-fed cows (bST by FO interaction P 0.05; Table 6-5).

PAGE 204

182 Fatty Acid Composition in Milk at Day 17 Within the short chain fatty acids, FO increased (P 0.01) C4:0 and decreased (P 0.05) C12:0 (Table 6-6). Pregnancy increased C4:0 compared to cyclic cows, but not when cows were injected with bST (bST by P interaction P 0.05; Table 6-6). Also, bST increased C6:0 in cyclic cont rol-fed and pregnant cows ( P 0.05; Table 6-6). The FO treatment increased C16:0, C18:3, C20:0, CLA c9t11 and DHA but decreased C18:0, C20:3, C20:4 and C21:0 ( P 0.05; Table 6-6). Interesti ngly, pregnancy decreased EPA (P 0.05; Table 6-6). The bST injections increased SFA and d ecreased PUFAs in pregnant and cyclic control-fed cows ( P 0.05; Table 6-5). The FO diet decreased the n-6:n-3 ratio ( P 0.01; Table 6-5). Fatty Acid Composition in Muscle at Day 17 The FO diet decreased C14:1, C18:1 c11 and CLA c9t11 (P 0.05; Table 6-7). Both the FO diet and pregnancy increased SFA with a subsequent decrease in UFA when compared with cyclic control-fed cows (P 0.05; Table 6-8). The FO diet decreased both the n-6:n-3 ratio and the DIX (P 0.01; Table 6-8). In addition, pregnancy decreased the DIX (P 0.01; Table 6-8). Fatty Acid Composition in Subcut aneous Adipose Tissue at Day 17 In subcutaneous adipose tissue, FO diet increased C16:0 and C18:0, and decreased C18:1 and CLA c9t11 (P 0.05; Table 6-9). Also, bST increased C16:0 among FO and control-fed cyclic cows (P 0.05; Table 6-9). The FO di et alone decreased CLA t9t11 and when bST was injected, CLA t9t11 was increased back to the same concentration as control-fed cows (P 0.05; Table 6-9). Several interac tions were detected between bST and pregnancy status. The bST injections decreased C14:1, C16:1, C18:1 and CLA c9t11

PAGE 205

183 concentrations in cyclic cont rol-fed cows but increased thes e concentrations in pregnant cows (P 0.05; Table 6-9). However, bST treatmen ts increased concentrations of C16:0 and C18:0 in cyclic control-fed cows but decr eased concentrations in pregnant cows (P 0.05; Table 6-9). The EPA was undetec table and DHA was barely detectable. The FO diet increased SFA and decreased UFA and MUFA when compared with cyclic control-fed cows (P 0.01; Table 6-8). Also, FO decreased (P 0.05) the DIX within cyclic cows. The bST treatments decr eased SFA in pregnant but increased SFA in cyclic control-fed cows (interaction P 0.01). Another interact ion occurred between bST and pregnancy in which bST increased UFA, MUFA, and DIX in pregnant cows but decreased in cyclic control-fed cows (P 0.01; Table 6-8). Fatty Acid Composition in Internal Adipose Tissue at Day 17 In internal adipose tissue, the FO increas ed concentrations of C15:0 but reduced concentrations of DHA in the internal adipose tissue (P 0.05; Table 6-10). The bST injections increased concentr ations of C14:1 in cyclic control-fed cows but reduced concentrations in FO-fed cows (P 0.01; Table 6-10). The bST injections increased the n-6:n-3 rati o in internal adipose tissue of pregnant cows and decreased the ratio in cyclic control-fed cows (P 0.05; Table 6-8). In addition, bST injections increased the DIX in cyclic control-fed cows with no change in FO-fed cows (interaction P 0.01; Table 6-8). The same interaction occurred for pregnant and cyclic control-fed cows with bST increasing the DIX in cyclic control-fed cows with no effect in pregnant cows (P 0.05; Table 6-8). Discussion Cows fed FO had an increased propor tion of EPA and DHA in the endometrium (Table 6-1), liver (Table 6-2), and mammary tissue (Table 6-4), and DHA was increased

PAGE 206

184 in the milk fat (Table 6-6) compared with those not fed FO. However, proportions of DHA and EPA were not increased in subcutaneo us and internal adipose tissues. Thus these fatty acid ligands are av ailable differentially to target tissues once absorbed from the digestive tract. Within the endometri um, concentrations of EPA and DHA were increased whereas that of AA was decreased. Consequently, slightly less AA would be available for PGF2 production and other products of the PG 2 series, thereby potentially reducing secretion of PGF2 and maintaining the CL. Increasing EPA and DHA in the endometr ium increases the amount of precursor available for PG production of the 3 series which are less biological ly active (Needleman et al., 1979). Burns et al. (2003) reported an increase in EPA with a decrease in AA in caruncular endometrial tissue on d 18 post estr us from beef cows fed fish meal. In addition, Mattos et al. (2004) observed an in crease in EPA and DHA in caruncular tissue at parturition in Holstein cows fed fish oil ve rsus olive oil. Also, in the present study, incorporation of these fatty ac ids into the endometrium result ed in differential effects on gene and protein expression of enzymes i nvolved in the PG cascade regardless of bST injection (Chapter 5). The injections of bST reduced C18:2 and the n-6:n-3 ratio and increased DHA in the endometrium of the cyclic cows but not in pregnant cows. It is possible that the secretions from the growing conceptus can alter the uterine responsiveness to bST injections. The n-6:n-3 ratio was reduced by FO in tissues and milk fat except for subcutaneous and internal adipose tissue. D ecreasing the ratio of n-6 to n-3 may not only improve pregnancy maintenance but also immu ne function. In mice fed an enriched n-3 PUFA diet, inflammatory reactions were reduced, and different types of antibody

PAGE 207

185 response to antigenic stimulations were de veloped compared with mice fed an n-6 enriched diet (Albers et al ., 2002). Reducing n-6 fatty acids such as C18:2 and C20:4, which are not only precursors for the luteolytic PGF2 but also are the precursor of the pro-inflammatory mediators, PGE2 and leukotriene B4, may improve immune function. Increasing n-3 fatty acids such as EPA would reduce PGF2 and PGE2 but increase PGE3 and leukotriene B4 which cause less severe inflamma tory reactions (Yaqoob and Calder, 1995). Lessard et al. (2004) reported the ly mphocyte proliferative response was reduced in dairy cows fed n-6 PUFA-enriched diet co mpared with cows receiving the n-3 PUFA diet during the transition period. Since FO re duced the n-6:n-3 ratio in most tissues, FO may improve immune function in additi on to CL maintenance in dairy cows. Similar to endometrial tissue, the FO di et also increased C18:3, EPA, and DHA in the liver. These PUFAs are ligands for PPA Rs which are nuclear transcription factors that can affect gene transcription. Th e following three PPAR isoforms, encoded by separate genes, have been identified thus far: PPAR PPAR and PPAR The PPAR is expressed in a broad range of tissues including heart, sk eletal muscle, colon, small and large intestines, kidney, pancreas, adipose, and spleen. The PPAR is necessary and sufficient to differentiate adipocytes, and regulate genes that control cellular energy homeostasis and insulin acti on (Berger and Moller, 2002). In rodents and humans, PPAR is expressed in numerous metabolically active tissues includ ing liver, kidney, heart, skeletal muscle, ovary and brown fa t (Nunez et al., 1997; Braissant et al., 1996; Auboeuf et al., 1997). It is also present in monocytic (Chinetti et al., 1998), vascular endothelial (Inoue et al., 1998) uterine epithelial (Nunez et al., 1997) and vascular smooth muscle cells (Stael s et al., 1998). The PPAR has been shown to play a critical

PAGE 208

186 role in the regulation of ce llular uptake, activation, and -oxidation of fatty acids (Berger and Moller, 2002). Long-chain UFA such as linoleic acid, PUFA, including AA, EPA, and linolenic acid, as well as the branched-c hain fatty acid phytanic acid, bind to PPAR with reasonable affinity (Willson et al., 2000). Also, GH reduces PPAR expression in COS-1 cells (Zhou and Waxman, 1999), and both PPAR and PPAR decrease expression of GH-activated genes in COS-1 cells (Shipley and Waxman, 2003). In addition, PPAR decreased expression of GH-activated genes in rat liver (Corton et al., 1998). The crosstalk between the PPA R isomers and GH may reduce the IGF-I response to exogenous bST injections as repo rted in Chapter 4. In contrast to PPAR PPAR has a preference for PUFAs over MUFA s (Khan and Heuvel, 2003). The PPAR is expressed in a wide range of tissues a nd cells, with relative ly higher levels of expression noted in brain, adipose, and skin (Braissant et al., 1996; Amri et al., 1995). Importantly, in the endometrium, PPAR is vital for normal fertility serving as a regulator of PG production and v ital to embryo implantation in rodent models (Lim et al., 1997; Lim et al., 1999). The PPARs appear to be one possible route via which PUFAs can have beneficial effects in humans th rough regulation of athe rosclerotic plaque formation and stability, va scular tone, angiogenesis, anti-inflammation, cellular differentitiation, and anti-carcinoge nic (Berger and Moller, 2002). Proportions of fatty acids were different among tissue sources. Milk fat and mammary tissue appeared to be similar in several fatty acids such as C18:3, EPA and DHA. This could be due to the amount of m ilk still in the mammary tissue cells. Also subcutaneous and internal adipose were si milar for several LCFA. Although there are some tissues that are similar, a wide varia tion exists in proportions of PUFAs, MUFAs,

PAGE 209

187 and SFA across all tissues. These large tissu e differences in proportions of fatty acids could be an indication of the particular fatty acid(s) needed for proper tissue functionality. Both MUFAs and PUFAs may reduce cardiac disease in humans by lowering serum cholesterol concentration. In contra st, increased intake of SFA have been associated with an increased concentrati on of both serum cholesterol and low density lipoprotein cholesterol which are factors associat ed with increased risk of coronary heart disease (Nestel, 1995; Menotti, 1999). Stearoyl-CoA desaturase enzyme, also known as 9-desaturase, is responsible for the oxidation reaction converting SFA to MUFA by the addition of a cis double bond between carbons 9 and 10 of some mediumand long-chain fatty acids (Tocher et al., 1998). The DIX has previously been used to measure the amount of 9-desaturase activity in the mammary gland, which has been reported to be correlated positively with 9-desaturase mRNA levels (Singh et al., 2004). Endogenously, one of the fatty acids that 9-desaturase enzyme converts is vaccenic ac id (trans-11 18:1) into cis-9, trans-11 CLA which is the predominant CLA found in the rumen (Bauman et al., 2003). The benefits of cis-9, trans-11 CLA and MUFAs on human health have led to widespread interest in increasing their concentrati on in the human diet. By evaluating the 9desaturase enzyme activity in various tissues the concentrations of cis-9, trans-11 CLA and MUFAs within the meat and milk for human consumption may be increased. The DIX index has been previously defined using the following equation: [product of 9desaturase]/[product of 9-desaturase + substrate of 9-desaturase](Malau-Aduli et al., 1997; Kelsey et al., 2003). Kels ey et al. (2003) calculated a DIX for four pairs of fatty

PAGE 210

188 acids that represented pr oducts and substrates for 9-desaturase and reported that all four 9-desaturase indexes were highly correlated to 9-desaturase enzyme activity. The lower the DIX, the less active the 9-desaturase is thought to be. In this study, C14:1/(C14:1 + C14:0) was used as the DIX in all tissues except the endometrium which had undectable levels of C14:1. Therefore, C16:1/(C16:1 + C16:0) was used to calculate DIX in endometrial tissue. The FO diet decreased the 9desaturase activity in the muscle and subc utaneous adipose tissue with a concurrent increase in SFA percent and a decrease in UFA percent. In addition, the FO diet decreased the 9-desaturase activity in the endometri um. In the mammary and internal adipose tissues when bST was injected into cyclic control-fed cows, the DIX increased whereas bST injected into FO-fed cows, resulted in a decreased DIX with no difference in the proportions of SFA and UFA. This illu strates that bST injections can influence the effects of FO on the 9-desaturase activity in some bovine tissues. Previous studies have shown that insulin can increase 9-desaturase mRNA expression (Daniel et al., 2004; Ntambi et al ., 1996). In this study, FO reduced insulin concentrations in plasma with no additive eff ects of bST. In addition, cyclic control-fed cows given bST had reduced insulin concentratio ns (Chapter 4). It appears that FO and bST effects on 9-desaturase enzyme activity may not be acting through insulin but possibly through directly regulating enzyme ex pression. In rodents, dietary PUFAs have been shown to directly repre ss a variety of genes at the le vel of transcri ption, including stearoyl CoA desaturase (Sampath and Ntambi, 2005). The cis-9, trans-11 CLA was increased in the milk fat by feeding the FO-enriched lipid but decreased in the muscle and subcutan eous adipose tissue. Also trans-9, trans-11

PAGE 211

189 CLA was increased in mammary tissue and milk fat in FO-fed cows, and decreased in subcutaneous fat in FO-fed cows not injected with bST. This increase in milk CLA may not be due only to both modified gene expr ession and enzymatic protein synthesis but also due to regulation of enzyme activity si nce DIX was decreased in the mammary gland tissue. Furthermore, mobilizat ion of CLAs from other tissu e sources (i.e., muscle and subcutaneous adipose) or via the fatty acids in the FO supplemented diet may increase CLA. Previous studies demonstrated that th e CLA concentration of milk fat was dependent partially on the proporti on of UFA in the diet (Gr iinari et al., 1996) and that CLA concentrations in milk fat increased as dietary concentration of corn oil increased (McGuire et al., 1996). In cont rast, Kelly et al. (1988) reporte d that lactating dairy cows fed peanut oil (high in oleic acid), sunflower oil (high in linoleic acid), or linseed oil (high in linolenic acid) did not affect CLA concentration in milk fat. Although CLA concentration was increased in the milk of the present study, this may be at the expense of mobilizing CLAs from subcutaneous adipose and muscle tissue. Recently Beaulieu et al. (2002) reported increased total C18:1-trans con centrations in tissues of Angus-Wagyu heifers fed a high corn diet supplemented with soybean oil (hi gh in linoleic acid); however cis-9, trans-11 CLA content was highe st in the subcutaneous fat but was not altered in any tissue of animals supplemented with soybean oil at 2.5 and 5.0% of dietary DM. Madron et al. (2002) found greater proportions of cis-9, trans-11 CLA in the intramuscular, intermuscular, and subcutaneous fat in crossbred Angus steers fed diets containing 12.7 to 25.6% extruded full-fat soyb eans. However, diets containing a high proportion of linolenic acid, su ch as fresh grass, grass s ilage, concentrate containing

PAGE 212

190 linseed, and pasture feeding during the finishing period, re sulted in an increased deposition of cis-9, trans-11 CLA in muscle (French et al., 2003; Scollan et al., 2003; Enser et al., 1999; Poul son et al., 2001). Biohydrogenation of C18:3 by ruminal micr oorganisms do not in clude cis-9, trans11 CLA as an intermediate (Harfoot et al., 1998). Griinari and Bauman, (1999) concluded that a relatively small proportion of cis-9, trans-11 CLA formed in the rumen escapes and is available for deposition in th e muscles. Therefore, the conversion of C18:2 to cis-9, trans-11 CLA by ruminal microorganisms does not appear to be the major source of cis-9, trans-11 CLA in meat. Thus the activity of the desaturase enzyme and mobilization from tissues to support physiologi cal functions may play important roles in the distribution of CLAs in various tissues and milk. The fatty acid composition of ruminal ba cteria is characterized by a large proportion of odd and branched chain fatty aci ds in their membrane lipids (Kaneda, 1991). Microbial odd chain fatty acids (C15: 0 and C17:0) are formed through elongation of propionate or valerate (Kaneda, 1991). Keeney et al. (1962) and Dewhurst et al. (2000) suggested that odd and branched chai n fatty acids in duodenal digesta and milk could provide a qualitati ve description of the proportions of different classes of microbes leaving the rumen. The amount of odd and br anched chain fatty ac ids leaving the rumen could be an indicator of micr obial metabolism. In this study, FO increased the amount of C15:0 in the endometrium and internal adipos e but tended to decrease C15:0 in the milk fat. This could be due to FO affecti ng ruminal microbes and metabolism along with tissue specific uptake.

PAGE 213

191 Milk fatty acids originate from two sources de novo synthesis (C4:0 to C14:0 plus part of C16:0) and uptak e of preformed lipids ( C18:0 plus part of C16:0) from the circulation (Bauman and Davis, 1974). Dietary FO has resulted in decreased milk fat synthesis in dairy cows mainly due to a decr ease in the synthesis of short-chain fatty acids, and depressed expressi on of key enzymes in the lipogenic pathway, such as stearoyl-CoA desaturase (Ahnadi et al., 2002). In this study, FO had differential effects on the amount of both short-chain and long-chai n fatty acids with no apparent pattern. The DIX was reduced due to FO feeding in several tissues but not all tissues possibly indicating that FO may both al ter rumen metabolism to change the type of fatty acids leaving the rumen, influence the mobilization of fatty acids among tissues, and (or) alter lipogenic enzymes to change de novo synthesi s. These effects appear to be tissue specific. Increases in milk yield of dairy cows trea ted with bST are the re sult of coordinated metabolic adaptations in various tissues (La nna et al., 1995). The overall effects of bST are to enhance growth and (or) lactation by utilizing nut rients while simultaneously coordinating other physiological processe s in a manner that supports enhanced performance (Etherton and Bauman, 1998). Trea tments with bST have shown to affect directly both lipogenesis and lipolysis, and this may be via the actions of IGF-I, insulin or directly by GH (Etherton and Bauman, 1998). The bST injections in the present experiment may have increased stearoyl-CoA desaturase expression. In the rat, GH treatment increased fatty-acid synthase, stear oyl-CoA desaturase, a nd sterol regulatory element-binding protein c in the liver (F rick et al., 2002). When insulin and GH treatment were used in combination, effects were not additive and instead, insulin blunted

PAGE 214

192 the effects of GH on expression of these genes. In contrast to the liver, adipose tissue gene expression was not influenced by GH. Th is could explain the in teracting effects of bST injections with FO feeding seen in this experiment since FO lowered insulin concentrations in the plasma (Chapter 4) Also, this could explain tissue specific variation in effects by bST in jections and FO feeding. In the present study, bST reduced the am ount of PUFAs in the endometrium in cyclic cows and reduced PUFAs in the mammary tissue and milk fat in pregnant cows. Also in the subcutaneous adipose tissue there were interactions between bST and pregnancy with bST treatment increasing the proportion of MUFAs in pregnant cows but decreasing them in nonpregnant cows. It is unknown how the pres ence of a conceptus may be regulating various tissu es outside the reproductive tract. However, the conceptus does secrete proteins that induce holistic phys iological changes in the endometrium and systemically via such proteins as IFNto maintain the CL and sustain progesterone concentrations. Perhaps the conceptus secretes proteins that may di rectly or indirectly affect fatty acid biosynthesis, metabolis m, mobilization, lipogenesis, lipolysis and distributions within variou s tissues throughout the body. Th e bST injections increased conceptus sizes and secretions (Chapter 4) which may be the cause for the bST by pregnancy interactions on fatty acid distributions in various tissues. Conclusions Dietary supplementation of a FO-enric hed lipid, bST treatment, and early pregnancy can have altering effects on fa tty acid percentages and distribution in reproductive and other tissues such as adi pose, muscle, liver and mammary gland. Feeding FO altered the endometrium by pa rtially replacing AA with EPA and DHA which may aid in decreasing luteol ytic pulsatile secretion of PGF2 The FO also reduced

PAGE 215

193 the n-6:n-3 ratio which may improve immune function. Cows fed FO also had increased CLA concentrations in the milk fat whic h may provide a more nutritional product for consumers. Influence of bST injections on th e fatty acid profile of tissues was influenced by pregnancy state. Further i nvestigation is needed to el ucidate the action of bST and pregnancy on fatty acid metabolism and tissue di stributions in lactating dairy cows. In addition, understanding which fa tty acids have beneficial effects on reproductive function would allow for the formulation of diets enriched in those particular fatty acids. Chapter 7 explores the effects of 4 diets enriched in different fatty acids on oocyte quality and follicular function in lactating dairy cattle.

PAGE 216

194Table 6-1 Least squares means and pooled SE of the endometrium fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pr egnant (P) cows fed a control di et, and cyclic cows fed a fish oil enriched lipid (FO) di et and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-PS.E. FO bST bST x FO P bST bST x P C12:0 0.48 0.52 0.420.41 0.46 0.470.05 NS NS NS NS NS C14:0 0.32 0.25 0.290.38 0.26 0.270.03 NS NS ** NS NS NS C15:0 0.30 0.30 0.410.42 0.27 0.280.04 NS NS NS NS NS C16:0 12.57 13.00 13.4013.7712.3312.810.34 NS NS NS NS NS C16:1 0.31 0.35 0.240.28 0.33 0.310.04 NS NS NS NS NS C18:0 20.49 20.14 19.4519.2420.5020.370.32 ** NS NS NS NS NS C18:1,trans 0.55 0.49 0.710.89 0.62 0.620.10 ** NS NS NS NS NS C18:1 12.73 14.65 13.0815.2813.8713.870.72 NS ** NS NS NS NS C18:2 13.61 10.94 14.5411.9912.6413.460.81 NS ** NS NS NS C18:3 0.91 0.88 0.940.90 0.88 0.880.06 NS NS NS NS NS NS CLA c9t11 0.19 0.17 0.150.21 0.20 0.130.03 NS NS NS NS NS NS C20:3 3.99 3.54 3.453.55 3.65 3.810.22 NS NS NS NS NS NS C20:4 14.81 15.85 13.5514.0015.0014.500.51 ** NS NS NS NS NS EPA C20:5 <0.01 <0.01 0.100.15<0.01 <0.010.03 ** NS NS NS NS NS DHA C22:6 0.92 1.14 1.421.59 1.01 0.890.07 ** ** NS NS NS Other 17.81 17.76 17.8916.9617.9817.350.63 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant

PAGE 217

195Table 6-2. Least squares means and pooled SE for different fatty acid percentages in endometrium and liver tissue at d 17 afte r a synchronized estrus (d 0) in lactating cy clic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response3 C bST-CFO bST-FOP bST-PS.E. FO bST bST x FO P bST bST x P Endometrium SFA 41.57 41.6241.3641.2041.2341.380.32 NS NS NS NS NS NS UFA 58.43 58.3858.6558.8058.7758.630.32 NS NS NS NS NS NS MUFA 16.54 18.8617.0719.8018.0817.890.87 NS ** NS NS NS NS PUFA 41.89 39.5241.5739.0040.7040.740.91 NS ** NS NS NS NS N6:n34 15.63 13.3111.569.8714.6615.980.70 ** ** NS NS NS ** DIX5 0.02 0.030.010.020.030.02<0.01 ** NS NS NS NS NS Liver SFA 49.21 49.5149.4549.9048.3750.790.70 NS NS NS NS NS UFA 50.78 50.5050.5450.1051.6249.230.69 NS NS NS NS NS MUFA 16.36 18.4117.3319.6115.6721.452.11 NS NS NS NS NS PUFA 34.43 32.0933.2130.4935.9627.772.52 NS NS NS NS NS N6:n34 16.70 17.506.827.6013.8316.431.65 ** NS NS NS NS NS DIX6 0.08 0.110.080.100.040.070.02 NS NS NS ** NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsatur ated fatty acids, MUFA = m onounsaturated fatty acids, PU FA = polyunsaturated fatty acids. 4 N6:n3 = (C18:2 + C20:4)/(C 18:3 + C20:5 + C22:6). 5 DIX = desaturase index (C16:1/(C16:0 + C16:1)). 6 DIX = desaturase index (C14:1/(C14:0 + C14:1)).

PAGE 218

196Table 6-3. Least squares means and pooled SE of the liver fatty acid profile (% to tal fatty acids) at d 17 after a synchronize d estrus (d 0) in lactating cyclic (C) co ws fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-PS.E. FO bST bST x FO P bST bST x P C12:0 0.32 0.28 0.280.400.310.280.04 NS NS NS NS NS C14:0 1.62 1.43 1.701.751.362.150.23 NS NS NS NS NS C14:1 0.14 0.17 0.150.160.060.150.03 NS NS NS NS C15:0 0.30 0.29 0.320.310.260.420.06 NS NS NS NS NS NS C16:0 18.59 19.24 20.4123.0616.8323.681.67 NS NS NS NS NS C16:1 0.83 1.12 1.071.090.831.550.31 NS NS NS NS NS NS C18:0 27.48 27.09 25.8223.5528.4323.121.81 NS NS NS NS NS NS C18:1,trans 1.32 1.23 1.431.481.341.520.15 NS NS NS NS NS NS C18:1 14.07 15.89 14.6816.8813.4418.231.76 NS NS NS NS NS C18:2 14.78 14.06 15.1814.6715.3413.130.93 NS NS NS NS NS NS C18:3 0.46 0.42 0.630.550.440.460.04 ** NS NS NS NS NS C20:0 0.65 0.79 0.660.690.840.840.13 NS NS NS NS NS NS CLA c9t11 0.31 0.28 0.280.290.290.300.03 NS NS NS NS NS NS C21:0 0.20 0.27 0.170.080.220.180.03 ** NS ** NS NS C22:0 0.06 0.13 0.100.070.110.130.02 NS NS NS NS C20:3 8.68 7.75 6.925.048.966.490.97 NS NS NS NS C20:4 8.85 8.71 7.507.549.326.651.02 NS NS NS NS NS NS EPA C20:5 0.57 0.67 1.100.950.710.110.10 ** NS NS NS NS NS DHA C22:6 0.78 0.21 1.621.460.900.140.35 ** NS NS NS NS Other 17.31 16.69 17.1216.2417.5916.410.91 NS NS NS NS NS NS 1bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 219

197Table 6-4. Least squares means and pooled SE for the mammary tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) di et and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C8:0 0.67 0.57 0.65 0.61 0.74 0.75 0.13 NS NS NS NS NS NS C10:0 1.50 1.38 1.38 1.16 1.77 1.68 0.28 NS NS NS NS NS NS C11:0 0.12 0.12 0.12 0.08 0.10 0.12 0.02 NS NS NS NS NS NS C12:0 1.85 1.60 1.55 1.30 2.15 1.94 0.29 NS NS NS NS NS NS C14:0 6.99 5.96 6.07 5.60 6.89 6.60 0.71 NS NS NS NS NS NS C14:1 0.40 0.43 0.39 0.24 0.35 0.38 0.05 NS NS NS NS C15:0 0.75 0.61 0.66 0.61 0.68 0.81 0.07 NS NS NS NS NS C16:0 29.00 28.54 29.55 30.64 28.62 27.74 0.65 NS NS NS NS NS C16:1 1.04 1.53 1.22 1.28 1.19 1.27 0.15 NS NS NS NS C18:0 18.78 18.26 17.54 17.40 18.33 18.88 1.08 NS NS NS NS NS NS C18:1,trans 3.17 2.51 3.25 3.22 3.11 3.01 0.35 NS NS NS NS NS NS C18:1 25.83 29.50 27.00 27.75 27.17 27.60 1.59 NS NS NS NS NS NS C18:1 c11 1.20 1.13 1.10 1.17 1.04 1.21 0.09 NS NS NS NS NS NS C18:2 6.14 5.38 6.57 6.13 5.54 5.56 0.45 NS NS NS NS NS C18:3 0.31 0.25 0.38 0.34 0.28 0.28 0.02 ** ** NS NS NS C20:0 0.14 0.17 0.26 0.24 0.21 0.18 0.02 ** NS NS NS NS CLA c9t11 0.50 0.44 0.52 0.47 0.46 0.47 0.04 NS NS NS NS NS NS CLA t9t11 0.08 0.08 0.11 0.11 0.09 0.09 0.01 NS NS NS NS NS C21:0 0.02 0.01 0.02 0.01 0.02 0.03 <0.01 NS NS NS NS NS NS C20:3 0.50 0.49 0.50 0.46 0.39 0.46 0.04 NS NS NS NS NS NS C20:4 0.82 0.90 0.89 0.92 0.73 0.83 0.13 NS NS NS NS NS NS C22:0 0.07 0.06 0.09 0.08 0.07 0.06 0.01 NS NS NS NS NS EPA C20:5 0.05 0.05 0.10 0.10 0.05 0.05 0.01 ** NS NS NS NS NS DHA C22:6 0.04 0.00 0.07 0.06 0.01 0.00 0.02 ** NS NS NS NS NS C24:0 0.03 0.03 0.04 0.03 0.04 0.03 <0.01 NS NS NS NS NS Other 5.31 5.62 6.11 5.45 6.07 5.89 0.52 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 220

198Table 6-5. Least squares means and pooled SE for different fatty acid percentages in mammary ti ssue and milk fat at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) di et and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response3 C bST-C FObST-FO P bST-PS.E. FO bSTbST x FO P bST bST x P Mammary Tissue SFA 59.91 57.29 57.9057.7459.5858.781.77NS NS NS NS NS NS UFA 40.09 42.70 42.1142.2640.4241.221.77NS NS NS NS NS NS MUFA 31.65 35.12 32.9733.6632.8833.481.71NS NS NS NS NS NS PUFA 8.44 7.59 9.138.607.557.740.61NS NS NS NS NS NS N6:n3 18.64 20.91 13.5613.7818.7019.561.46** NS NS NS NS NS DIX 0.05 0.07 0.060.040.050.05<0.01* NS NS NS Milk Fat SFA 67.43 69.71 67.8168.8268.0169.971.29NS NS NS NS NS UFA 32.57 29.29 32.1931.1831.9930.031.15NS NS NS NS NS MUFA 26.31 24.49 26.3125.3826.1825.630.98NS NS NS NS NS NS PUFA 6.26 4.80 5.885.805.464.400.36NS NS NS NS NS N6:n3 12.62 13.28 9.639.9613.8613.410.50** NS NS NS NS NS DIX 0.09 0.09 0.100.080.080.09<0.01NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsat urated fatty acids, MUFA = monounsaturated fatty acid s, PUFA = polyunsaturated fatty acids, DIX = desaturase index (C 14:1/(C14:0 + C14:1)), N6:n3 = (C18: 2 + C20:4)/(C18:3 + C20:5 + C20:6).

PAGE 221

199Table 6-6. Least squares means and pooled SE for the milk fatty acid profile (% total fatty aci ds) at d 17 after a synchronize d estrus (d 0) in lactating cyclic (C) co ws fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C4:0 4.15 4.62 5.09 5.23 4.76 4.37 0.20 ** NS NS NS NS C6:0 1.86 2.27 2.02 2.07 2.06 2.14 0.12 NS NS NS NS C8:0 0.72 0.92 0.68 0.72 0.80 0.86 0.08 NS NS NS NS NS C10:0 2.22 2.56 1.77 2.10 2.32 2.55 0.22 NS NS NS NS NS C12:0 2.68 2.88 2.08 2.44 2.70 2.94 0.24 NS NS NS NS NS C14:0 9.45 9.46 8.75 9.48 9.00 10.04 0.44 NS NS NS NS NS NS C14:1 0.91 0.90 0.93 0.77 0.83 0.94 0.07 NS NS NS NS NS NS C15:0 0.89 0.83 0.67 0.72 0.78 0.86 0.09 NS NS NS NS NS C16:0 28.30 28.98 31.81 32.03 27.70 28.61 0.84 ** NS NS NS NS NS C16:1 1.22 1.31 1.41 1.40 1.22 1.19 0.07 NS NS NS NS NS C17:0 0.49 0.45 0.43 0.44 0.45 0.45 0.02 NS NS NS NS NS NS C18:0 13.70 14.13 11.88 10.98 14.65 14.50 0.95 ** NS NS NS NS NS C18:1,trans 3.74 2.75 3.41 3.78 3.36 2.99 0.45 NS NS NS NS NS NS C18:1 19.06 18.82 19.36 18.22 19.48 18.27 0.82 NS NS NS NS NS NS C18:2 3.70 3.11 3.50 3.34 3.45 3.20 0.21 NS NS NS NS NS C18:3 0.29 0.23 0.34 0.31 0.25 0.25 0.02 ** NS NS C20:0 0.16 0.14 0.18 0.17 0.15 0.16 0.01 NS NS NS NS NS CLA c9t11 0.44 0.34 0.49 0.51 0.39 0.38 0.04 ** NS NS NS NS NS CLA c12t10 0.01 0.01 0.01 0.01 0.01 0.01 <0.01 NS NS NS NS NS NS CLA t9t11 0.01 0.05 0.07 0.09 0.06 0.05 0.01 NS NS NS NS C20:3 0.17 0.17 0.11 0.14 0.17 0.13 0.02 NS NS NS NS NS C20:4 0.17 0.17 0.12 0.15 0.17 0.15 0.01 NS NS NS NS NS C21:0 0.02 0.02 0.01 0.00 0.01 0.01 <0.01 NS NS NS NS NS C22:0 0.00 0.00 0.03 0.00 0.01 0.01 <0.01 NS NS NS EPA C20:5 0.02 0.02 0.02 0.03 0.01 0.01 <0.01 NS NS NS NS NS DHA C22:6 0.00 0.00 0.02 0.02 0.00 0.00 <0.01 ** NS NS NS NS NS C24:0 0.01 0.02 0.01 0.01 0.02 0.01 <0.01 NS NS NS NS NS NS Other 5.56 4.87 4.85 4.89 5.18 4.95 0.26 NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 222

200Table 6-7. Least squares means and pooled SE for the muscle fatty acid profile (% total fatty ac ids) at d 17 after a synchroni zed estrus (d 0) in lactating cyclic (C) co ws fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and in jected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-PS.E. FO bST bST x FO P bST bST x P C12:0 0.12 0.14 0.090.190.110.060.04 NS NS NS NS NS C14:0 1.95 1.75 1.761.912.202.200.31 NS NS NS NS NS NS C14:1 0.43 0.47 0.210.210.330.380.08 ** NS NS NS NS NS C15:0 0.24 0.23 0.270.270.280.270.04 NS NS NS NS NS NS C16:0 23.50 22.25 23.8923.8423.7924.781.17 NS NS NS NS NS NS C16:1 2.55 2.65 1.671.852.392.510.49 NS NS NS NS NS C18:0 17.34 17.12 19.4120.2419.3919.111.45 NS NS NS NS NS C18:1,trans 1.79 1.49 1.661.901.871.700.22 NS NS NS NS NS NS C18:1 c9 33.13 31.32 28.1827.7332.0732.712.70 NS NS NS NS NS NS C18:1 c11 1.83 1.85 1.451.511.641.580.16 NS NS NS NS NS C18:2 10.86 12.06 13.0612.169.748.861.93 NS NS NS NS NS NS C18:3 0.36 0.39 0.440.440.330.340.04 NS NS NS NS NS NS C20:0 0.13 0.15 0.090.170.140.090.03 NS NS NS NS NS NS CLA c9t11 0.31 0.29 0.200.230.280.210.04 ** NS NS NS NS NS C22:0 0.14 0.04 0.020.030.020.020.07 NS NS NS NS NS NS C20:3 0.09 0.09 0.040.060.020.040.04 NS NS NS NS NS NS C20:4 1.56 1.90 1.861.701.291.330.51 NS NS NS NS NS NS EPA C20:5 3.64 5.61 5.305.123.933.651.50 NS NS NS NS NS NS DHA C22:6 0.15 0.25 0.290.280.170.190.08 NS NS NS NS NS Other 0.00 0.00 0.170.170.040.000.03 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 223

201Table 6-8. Least squares means and pooled SE for different fatty acid percentages in muscle, subc utaneous adipose, and interna l adipose tissue at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response2 C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P Muscle SFA 43.39 41.73 45.53 46.69 45.94 46.54 1.71 NS NS NS NS UFA 56.62 58.26 54.47 53.30 54.06 53.45 1.69 NS NS NS NS MUFA 39.73 37.77 33.17 33.20 38.29 38.88 3.38 NS NS NS NS NS NS PUFA 16.88 20.50 21.30 20.10 15.77 14.57 3.87 NS NS NS NS NS NS N6:n3 29.41 27.67 20.57 19.29 25.71 24.03 3.20 ** NS NS NS NS NS DIX 0.17 0.22 0.11 0.10 0.13 0.15 0.02 ** NS NS ** NS NS Subcutaneous Adipose SFA 48.79 55.31 58.17 61.49 58.89 47.50 2.82 ** NS NS NS ** UFA 51.21 44.69 41.83 38.51 41.11 52.50 2.81 ** NS NS NS ** MUFA 47.96 42.05 38.07 35.63 38.71 49.82 2.69 ** NS NS NS NS ** PUFA 3.25 2.63 3.76 2.88 2.40 2.68 0.37 NS NS NS NS NS N6:n3 12.59 11.56 12.85 10.51 13.09 12.50 1.05 NS NS NS NS NS NS DIX 0.21 0.13 0.07 0.06 0.08 0.25 0.04 NS NS NS NS ** Internal Adipose SFA 63.73 63.06 64.60 66.10 64.29 65.87 2.06 NS NS NS NS NS NS UFA 36.27 36.93 35.41 33.88 35.72 34.14 2.06 NS NS NS NS NS NS MUFA 33.12 33.80 32.37 30.90 32.97 31.71 2.20 NS NS NS NS NS NS PUFA 3.14 3.13 3.04 2.98 2.75 2.43 0.31 NS NS NS NS NS N6:n3 11.67 9.99 11.95 12.23 9.08 13.63 1.40 NS NS NS NS NS DIX 0.06 0.10 0.06 0.04 0.05 0.04 0.01 ** NS ** ** 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsaturated fatty acids, MUFA = monounsaturated fatty acids, PUFA = polyunsaturated fatty ac ids, DIX = desaturase index (C14:1/(C14:0 + C14:1)), N6:n3 = (C18:2 + C20:4)/(C18:3 + C20:5 + C22:6).

PAGE 224

202Table 6-9. Least squares means and pooled SE for subcutaneous adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lact ating cyclic (C) cows fed a control diet pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-PS.E. FO bST bST x FO P bST bST x P C12:0 0.08 0.08 0.070.080.080.100.01 NS NS NS NS NS NS C14:0 3.10 3.52 2.953.263.233.510.30 NS NS NS NS NS NS C14:1 0.98 0.52 0.240.230.301.330.28 NS NS NS NS ** C15:0 0.35 0.35 0.300.370.360.320.05 NS NS NS NS NS NS C16:0 24.81 28.54 28.5229.4227.5725.761.02 * NS NS NS ** C16:1 3.88 2.23 1.811.671.845.641.00 NS NS NS NS NS C18:0 16.97 19.71 22.9324.8224.2114.502.58 NS NS NS NS C18:1,trans 2.21 2.14 2.212.812.701.830.27 NS NS NS NS NS C18:1 37.45 34.88 31.7028.9831.7737.381.42 ** NS NS NS ** C18:2 2.15 1.80 2.542.081.631.610.22 NS NS NS NS C18:3 0.17 0.16 0.130.200.140.140.02 NS NS NS NS NS C20:0 0.14 0.11 0.130.130.210.120.05 NS NS NS NS NS NS CLA c9t11 0.45 0.32 0.200.260.310.480.07 NS NS NS NS CLA t9t11 0.06 0.05 0.030.070.050.050.01 NS NS NS NS C20:3 0.12 0.10 0.600.070.080.120.20 NS NS NS NS NS NS C20:4 0.06 0.05 0.050.050.060.090.02 NS NS NS NS NS NS C22:0 0.02 0.02 0.030.050.030.010.01 NS NS NS NS NS NS DHA C22:6 0.00 0.01 0.000.000.000.00<0.01 NS NS NS NS NS NS Other 6.99 5.42 5.575.475.457.040.60 NS NS NS NS NS ** 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 225

203Table 6-10 Least squares means and pooled SE for internal adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pre gnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) di et and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-PS.E. FO bST bST x FO P bST bST x P C12:0 0.07 0.08 0.080.070.080.070.01 NS NS NS NS NS NS C14:0 2.56 2.55 2.732.423.012.650.20 NS NS NS NS NS NS C14:1 0.15 0.24 0.180.100.150.120.04 NS ** NS C15:0 0.28 0.33 0.360.360.310.280.03 NS NS NS NS NS C16:0 24.32 25.45 27.0326.3625.9924.891.01 NS NS NS NS NS C16:1 0.93 1.03 1.050.921.220.850.13 NS NS NS NS NS C18:0 32.78 31.56 30.5632.8930.7934.352.35 NS NS NS NS NS NS C18:1,trans 2.68 2.62 2.933.232.992.670.30 NS NS NS NS NS NS C18:1 27.66 27.40 26.4824.9726.7226.542.14 NS NS NS NS NS NS C18:2 2.32 2.06 2.242.191.891.770.24 NS NS NS NS NS NS C18:3 0.19 0.17 0.190.180.170.130.03 NS NS NS NS NS NS C20:0 0.29 0.33 0.280.330.370.340.05 NS NS NS NS NS NS CLA c9t11 0.22 0.24 0.220.240.250.190.02 NS NS NS NS NS CLA t9t11 0.09 0.13 0.080.090.130.090.02 NS NS NS NS NS C20:3 0.09 0.09 0.100.080.060.090.03 NS NS NS NS NS NS C20:4 0.04 0.04 0.040.040.040.040.01 NS NS NS NS NS NS C22:0 0.06 0.08 0.060.070.080.070.02 NS NS NS NS NS NS DHA C22:6 0.04 0.06 0.000.000.060.000.02 NS NS NS NS Other 5.27 5.56 5.405.505.694.870.35 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bSTfish oil, bST-P = bST-pregnant. 2 P 0.10, P 0.05, ** P 0.01, NS = non-significant.

PAGE 226

204 CHAPTER 7 EFFECTS OF DIETS ENRI CHED IN DIFFERENT FATTY ACIDS ON OOCYTE QUALITY AND FOLLICULAR DEVELOPMEN T IN LACTATING DAIRY COWS IN SUMMER Introduction Dietary supplementation of fat can improve reproductive function of lactating dairy cows. In particular, supplementation of diets with calcium salts of LCFA (Staples et al., 1998), calcium salts of palm and soybean oil (Cullens et al., 2004), tallow (Son et al., 1996), rolled and cracked safflower seeds, soybe ans, or sunflower seeds (Bellows et al., 1999), and protein-aldehyde protected dehulled cottonseeds (Wilkins et al., 1996) improved overall pregnancy rates. Collectiv ely, these findings support the concept that feeding of supplemental fats enhances repr oductive performance in cattle. Previous studies have shown that fat supplementation can have beneficial e ffects on the follicle (Lucy et al., 1992), oocyte (Zeron et al., 2002) embryo (Cerri et al., 2004) and uterus (Mattos et al., 2000) in dairy cattle. However, the precise fatty acids and mechanisms, by which fat supplementation increases pregnanc y rate, has yet to be determined. Fatty acids play an important role in changing the biophysical properties and activity of biological membranes including fl uidity and cell proliferation (Shinitzky, 1984). Lipids make up a large portion of cellula r membranes, and length of the fatty acid acyl chain, number, and position of double bonds influences membrane properties (Stubbs and Smith, 1984). Zeron et al. (2001) examined the effects of seasonal changes in fatty acid composition of phospholipids fr om follicular fluid, granulosa cells, and oocytes collected from dairy cattle in both the summer and winter. Percentages of SFA

PAGE 227

205 in oocytes and granulosa cells were greater in the summer, and percentages of MUFA and PUFA were higher in oocytes and granul osa cells during the winter. Furthermore, relationships between PUFA content, em bryonic development, and fertility were detected. The PUFA content of follicular fl uid decreased in the summer in association with a decrease in embryo development and da iry cow fertility. Fo llicle number, oocyte quality, chilling sensitivity, lipid compositi on in follicular compone nts and lipid phase transition in oocytes were examined in ewes fed a diet supplemented with PUFAs for 13 weeks (Zeron et al., 2002). The PUFA fed ew es had more follicles and oocytes, better quality oocytes, improved integrity of oocyt e membranes, and increased proportion of long chain UFA in plasma and cumulus cells. Feeding a diet high in calcium salts of palm and soybean oil to lactating dairy cows increased the number of blastocysts produced in vitro following transvaginal ovum pickup (OPU) compared to a diet low in calciu m salts of palm and soybean oil (FouladiNashta et al., 2004). Concepti on rate to first service was in creased when lactating dairy cows were fed a mixture of calcium salts of linoleic and trans fatty acids compared to palm oil (Juchem et al., 2004). In a sub-sample of the cows, fertilization rate, number of total cells, percentage of live cells, and pe rcentage of embryos graded 1 and 2 were greater for linoleic and trans fatty acids ve rsus palm oil fed cows. In addition, the number of accessory sperm cells attached to th e zona pellucida was greater (Cerri et al., 2004). Whether the beneficial e ffects are due to an enrichme nt of linoleic and (or) trans fatty acids cannot be determined. Fatty acid composition of the diet may also affect PG metabolism. Mattos et al. (2003) observed that addition of specific LCFA to a bovine endometrial cell line in vitro

PAGE 228

206 had different effects on the PG cascade. Furthe rmore, feeding a diet enriched in omega-3 fatty acids to lactating dairy cows resulted in reduced plasma PGFM concentrations early postpartum (Mattos et al., 2002) and followi ng an oxytocin challe nge (Mattos et al., 2004). Diets enriched in omega-6 (C18:2) fa tty acids increased plasma PGFM in beef heifers (Filley et al., 2000). Collectively, these studies indicate that va rious fatty acids have differential effects on reproductive responses and can also e ffect oocyte and embryo development. Understanding which fatty acids have be neficial effects on oocyte and embryo development may permit feeding of diets enri ched in certain fatty acid(s) to enhance fertility. The objective of this experiment was to examine the effects of feeding four different sources of supplemental fats enrich ed in either omega-9 cis (C18:1c), omega-9 trans (C18:1t), omega-6 (C18:2), and omega3 (C18:3) fatty acids on oocyte quality and follicular development in lactating dairy cows during the summer. Materials and Methods Materials The media HEPES-Tyrodes Lactate, IVFTyrodes Lactate, and Sperm-Tyrodes Lactate were purchased from Caisson (Sugar Cit y, ID) and used to prepare HEPESTyrodes albumin lactate pyruvate (TALP), IVF-TALP, and Sperm-TALP as previously described (Parish et al., 1986). Oocyte co llection medium (OCM) was Tissue Culture Medium-199 with Hanks salts without phe nol red (Atlanta Biologicals, Norcross, GA) supplemented with 2% (v/v) bovine steer serum (Pel-Freez, Rogers, AR) containing 100 U/mL heparin, 100 U/mL penicillin-G, 0.1 mg/mL streptom ycin, and 1 mM glutamine. Oocyte maturation medium (OMM) wa s Tissue Culture Medium-199 (Gibco; Grand Island, NY) with Earle salts supplement ed with 10% (v/ v) bovine steer serum, 2 g/mL

PAGE 229

207 estradiol 17-, 20 g/mL bovine FSH (Folltropin-V; Ve trepharm Canada, London, ON), 22 g/mL sodium pyruvate, 50 g/mL gentamicin sulfate, and 1 mM glutamine. Percoll was from Amersham Pharmacia Biotech (Uppsala, Sweden). Frozen semen from various Angus bulls was donated by Southeastern Semen Services (Wellborn, FL). Potassium simplex optimized medium (KSOM) cont aining 1 mg/mL BSA was obtained from Caisson (Sugar City, ID). On the day of use, KSOM was modified for bovine embryos to produce KSOM-BE2 as described elsewh ere (Soto et al., 2003). Essentially fatty-acid free BSA was from Sigma (St. Louis, MO) and fetal bovine serum was obtained from Atlanta Biologicals (Norcross, GA). The In Situ Cell Death Detection Kit (tet ra methyl rhodamine red) was obtained from Roche (Indianapolis, IN). Hoechst 33342 and glycerol were purchased from Sigma. Polyvinylpyrrolidone (PVP) was purchased from Eastman Kodak (Rochester, NY) and RQ1 RNase-free DNase was from Promega (Madison, WI). All other reagents were purchased from Sigma or Fish er Scientific (Pittsburgh, PA). Animals and Experimental Diets The experiment was conducted at the Univ ersity of Florida Dairy Research Unit (Hague, FL) during the mont hs of May 2004 through November 2004. All experimental animals were managed according to the guideli nes approved by the University of Florida Animal Care and Use Committee. Primip arous (n = 22) and multiparous (n = 32) Holstein cows in late gestation were a ssigned randomly to experimental treatments according to mature milk equivalent and (or) body weight. Before calving, cows were housed in sod-based pens and fed individua lly utilizing shaded Calan gates (American Calan Inc., Northwood, NH) beginning 5 weeks prior to expected calving date. Upon calving, cows were moved to a free-stall barn equipped with fans, sprinklers, and Calan

PAGE 230

208 gates. All cows received their respective diet ary treatment for at least 3 weeks prior to actual calving date and continued until appr oximately 107 DIM. The four diets, each enriched with a different omega fatty acid, we re as follows: 1) high oleic sunflower oil (Trisun, Humko Oil, Memphis, TN) enriched in omega-9 cis (C18:1c; n = 8 multiparous cows and 6 primiparous cows), 2) calcium sa lts of trans fatty acids (Virtus Nutrition, Fairlawn, OH) enriched in omega-9 trans (C18:1t; n = 8 multiparous cows and 6 primiparous cows), 3) calcium salts of pa lm and soybean oil (Megalac-R, Church & Dwight Co., Princeton, NJ) enriched in omeg a-6 (C18:2; n = 8 multiparous cows and 5 primiparous cows), 4) linseed oil (Arc her Daniels Midland, Red Wing, Minnesota) enriched in omega-3 (C18:3; n = 8 multiparou s cows and 5 primiparous cows). Diets were formulated to meet or exceed NRC (NRC, 2001) recommendations for Holstein cows in either late gestat ion or early lactation that weigh 650 kg and produce 35 kg of 3.5% fat corrected milk (FCM). Diets prepar tum were formulated to have a cation-anion difference of -9 meq/kg (DM basis). The i ngredient composition for the prepartum diets consisted of corn silage, bermuda hay, ground corn, citrus pulp, mi neral, soybean meal and trace mineralized salt. The ingredient compositions for the postpartum diets were corn silage, alfalfa hay, ground corn, citrus pulp, cottonseed hulls, mineral, soyplus (West Central Soy; Ralston, IA) and soybean meal. The ingredient composition for both prepartum and postpartum diets were si milar between treatments. Chemical compositions were formulated for the four di etary treatments to have a net energy of lactation of 1.74 Mcal/kg DM, a crude prot ein of 15.33% DM, and a neutral detergent fiber of 34.54% DM. Prepartum rations were formulated to provide approximately 151 g/d of sunflower oil, 76 g/d of calcium salts of trans fatty acids, 152 g/d of calcium salts

PAGE 231

209 of palm and soybean oil, and 89 g/d of lin seed oil. Assumed average DMI was 10 kg/d for the prepartum diets and 15 kg/d for the pos tpartum diets. Postpartum rations were formulated to provide approximately 320 g/d of sunflower oil, 181 g/d of calcium salts of trans fatty acids, 367 g/d of calcium salts of palm and soybean oil, and 189 g/d of linseed oil. Because of anticipated lower DMI in the prepartum period, nonlactating cow rations were formulated to contain 1.35% oil (DM basi s). Postpartum lacta ting cow rations were formulated to contain 1.5% oil (DM basis) for the sunflower and linseed oil. As a result, two of the four diets containing calcium salts were formulated to contain 1.75% for the calcium salts of trans fatty aci ds and calcium salts of palm and soybean oil to make the diets isolipid. This allowed equal energy dens ities of the diets since the calcium soaps contain approximately 88% of the energy of the oils (NRC, 2001). Fatty acid compositions of the four experimental diets are presented in Table 7-1. The concentrate portions of the diets were mixed and stor ed in metal bins of 1.8 ton capacity. Oils were premixed using ground corn as a carrier. Concentrate mixtures and forage sources were mixed in a weighing and mixing unit (American Calan, Inc.) and offered three times daily to allow 5 to 10% orts (as-fed basis). Cala n gates were used to monitor individual feed intake of cows. Orts from each diet were collected once daily and weighed. The DM concentration of silage wa s monitored once weekly (55C for 48 h) to maintain the proper forage-to-concentrate ratio of diets. Cows were milked 3 times per d, and calibrated electronic milk meters were used at each milking to record milk weights. Body condition scores and BW were assesse d weekly by the same individual. Synchronization for OPU and TAI Multiparous and primiparous cows were grouped on a weekly basis and synchronized for OPU using a modified Ovsync h protocol (Bartolome et al., 2005). An

PAGE 232

210 injection of GnRH (Cystorelin, Merial, Athens, GA; 2 mL, 100 g, i.m.) was administered along with the in sertion of a CIDR (CIDR-B, Pharmacia, Kalamazoo, MI; 1.38 g of progesterone) at 47 3 DIM followe d 7 d later (54 DIM) by an injection of PGF2 (Lutalyse, Pfizer, Kalamazoo, MI; 5 mL, 25 mg, i.m.) and removal of the CIDR insert (Figure 7-1). Approximately 48 h following PGF2 a second injection of GnRH (56 DIM) was administered to induce ovulat ion at 57 DIM. Begi nning 4 d following the second GnRH injection (3 d following ovulati on), OPU was conducted every 3 to 4 d for 5 consecutive sessions (60, 63, 66, 69, and 72 DIM or d 3, 6, 9, 12, and 16 of the synchronized estrous cy cle; Figure 7-1). The TAI was conducted as follows. Following OPU, a PGF2 injection was given 3 d following the last OPU session (75 DI M) followed by a GnRH (5 mL, 100 g, i.m.) injection 72 h later (78 DIM). Approximat ely 16 to 20 h following GnRH injection, all cows were inseminated (79 DIM) with semen from a single Holstein bull of good fertility. All cows received a reco mmended commercial dose (500 mg) of bST (Posilac; Monsanto Co., St. Louis, MO) at TAI and biweekly thereafter. The bST injections were given subcutaneously in th e space between the ischium and tail head. Blood and Temperature Sampling Blood samples (7 mL) were collected just pr ior to all synchroni zation injections (d 47 3, 54, 56, 75, and 78 DIM), prior to each OPU session (d 60, 63, 66, 69, and 72 DIM) and on d 7 following TAI (d 0). Blood samples were collected using 20-g Vacutainer blood collection needles (Benton Dickinson and Company, Franklin Lakes, NJ) from the coccygeal vein or artery in th ree different locations, which were rotated at each bleeding to minimize irritation. Sample s were collected in evacuated heparinized

PAGE 233

211 tubes (Vacutainer; Becton Dickson, East Ruth erford, NJ). Immediately following sample collection, blood was stored on ice until cen trifugation (3000 g for 20 min at 4 C) and collection of plasma within 6 h. Plasma was stored at C until assayed for progesterone. Rectal temperat ures were taken from all cows prior to each OPU session. Ultrasonography and OPU Procedure Ovaries were evaluated by real-time ultrasonography (Aloka SSD-500, Aloka Co. Ltd., Tokyo, Japan) with a 5-MHz linear-array transrectal transducer at 54 and 56 DIM during synchronization for OPU, 75 and 78 DIM of synchronization for TAI, 79 DIM of TAI, 86 DIM after ovulation, and 107 and 124 DIM for d 28 and d 45 pregnancy diagnoses, respectively. Pregnancy rate was defined as the number of cows confirmed pregnant based on ultrasonography of fetal heartbeat divided by the number of cows inseminated. An ovarian map was ma de to measure the tissue volume (mm3), number of CL, and the largest follicle (mm). The vol ume of CL tissue was calculated using the following equation: volume = 1.333 * radius3, where radius = (length/2 + width/2)/2. For CL with a fluid-filled cavity, the volume of the cavity was calculated and subtracted from the total volume of the CL. At the time of OPU, animals were restrained in a squeeze chute and given anesthesia via a caudal epidural injection of 5 mL of 2% lidocaine (AgTech Inc., Manhattan, KS) to provide relaxation to the rectovaginal region. Follicles were aspirated with the aid of an Aloka 500 portable ultr asound scanner equipped with a needle guide and connected to a 5 MHz vaginal sector tran sducer probe. The 4 cm 17 gauge needle (COOK, Queensland, Australia) with echogenic tip was connected to a regulated vacuum pump (Pioneer Medical Inc., Melrose, MA) wh ich created a constant vacuum pressure of 75 mmHg when pressure was applied to the att ached foot pedal. For each cow, in each

PAGE 234

212 OPU session, the number of visibly aspirated follicles and size and number of CL were recorded. Follicular contents from all visi ble 3-12 mm follicles were collected into a single 50-mL conical tube cont aining 10 to 15 mL of OCM. Following OPU, the aspirate from each donor animal was filtered through a 100 m cell strainer into a petri dish and the petr i dish searched with a dissecting microscope for cumulus oocyte complexes (COC). Recovere d COCs were graded on a scale of 1 to 3 with the following criteria: Grade 1 COCs ha d 3 or more layers of cumulus cells with a homogeneous ooplasm uniform in size, color, a nd texture; Grade 2 CO Cs had 13 layers of cumulus cells with a homogeneous or sl ightly degenerated ooplasm; Grade 3 COCs had a completely degenerated ooplasm, expanded cumulus cells, or were denuded. For the first 4 OPU sessions, Grades 1 and 2 COCs from each individual donor were washed three times in OCM and placed into 2 mL microcentrifuge tubes containing approximately 2 mL of OMM which had been pre-warmed and equilibrated at 38.5C in 5% CO2 in humidified air. For the 5t h OPU session, Grades 1, 2, and 3 COCs were selected and processed as described above except that COCs from each individual donor were also separated by grade. The tubes c ontaining the collected oocytes were placed into a portable incubator (M initube, Verona, WI) set at 39 C and held at the farm until collections from all donor animals were complete (~ 3 h). Following the collection of all donor animals, COCs were transported to the laboratory. In Vitro Production of Embryos from Oocytes Collected by OPU Upon arrival at the laboratory, COCs were washed 3 times in OMM and placed into 50 uL drops of OMM (1-5 COCs/drop) overlai d with mineral oil. The recovered COCs were allowed to mature for 21-24 h at 38.5 C in 5% CO2 in humidified air. Following

PAGE 235

213 maturation, COCs from the 5th aspiration were denuded of cu mulus cells by vortexing in HEPES-TALP containing 1000 units/mL hyaluronidase type IV for 5 min. After vortexing, denuded oocytes were processed as described below for the assessment of meiotic maturation, caspase activity, and (TUNEL) terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling). For the first four OPU aspirations, COCs were washed once in HEPES-TALP after maturation and placed in their respective groups in 4-well plates (1-5 oocytes per well) containing 600 l IVF-TALP per well. Semen from three random Angus bulls was Percoll-purified and added to each well at a concentration of 1 x 106 spermatozoa/mL. Following addition of sperm, 25 L of a solution of 0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine in 0.9% [w /v] NaCl was added per well. Sperm and COCs were coincubated for 8 h at 38.5 C in 5% CO2 in humidified air. After coincubation, putative zygotes were denuded of cumulus cells by suspending them in HEPES-TALP medium containi ng 1000 units/mL hyaluronidase type IV and vortexing for 5 min. Following vortexing, presumptive zygotes were washed three times in HEPESTALP and once in KSOM-BE2. Presumptiv e zygotes were then placed into 22.5 l culture drops of KSOM-BE2 (1-5 oocytes /drop). Oocytes were cultured at 38.5 C in 5% O2, 5% CO2, and 90% N2 in humidified air until d 8 postinsemination. The proportion of oocytes that cleaved as well as the proportion of embryos at eith er the 2 to 3, 4 to 7 or > 8 cell stage were recorded at d 3 postinseminati on and 2.5 uL of fetal calf serum (to a final concentration of 10% v/v) was added to each culture drop. The proportion of oocytes that developed to the morulae (compacted cell mass), early blastocyst (rudimentary

PAGE 236

214 blastocoel cavity), blastocyst (fully formed blastocoel cavity) and advanced blastocyst stages such as expanded (thinned zona pellu cida with stretched blastocoel cavity), hatching (zona pellucida breaks and the blastocy st begins to protrude ) or hatched (empty zona pellucida with free blastocyst) were recorded on d 8 postinsemination. The TUNEL assay was performed, and number of cells was counted on all morulae and blastocysts. In Vitro Production of Embryos from Ovaries Collected from an Abattoir During the same months as the OPU aspi rations, ovaries from Holstein and nonHolstein cows were obtained from a local abattoir (approximately 1.5 h from the laboratory) and transported to the laboratory in 0.9% (w/v) Na Cl at room temperature. The ovaries were sliced and COCs were colle cted into a beaker containing OCM (which contained 2 U/mL of heparin). All grades 1 and 2 COCs were separated by breed and matured, fertilized and cultured as described above for OPU oocytes. Group II Caspase Activity Group II caspase activity (i.e., caspases2, -3, and -7) was measured based on cleavage of a synthetic subs trate specific for group II caspases (those recognizing the amino acid motif DEXD) and the resultant emission of green fluorescence. Denuded oocytes were washed three times in 50-l drops of prewarmed HEPES-TALP. Oocytes were then incubated in 25-l microdrops of HEPES-TALP containing 5 M PhiPhiLuxG1D2 at 39C for 40 min in the dark. Negative cont rols (oocytes recovered from the abattoir) were incubated in HEPES-TALP only. Following incubation, oocytes were washed three times in 50-l drops of HEPES-TALP a nd placed on two-well glass slides containing 100 l of prew armed HEPES-TALP. Fluores cence was observed using a Zeiss Axioplan 2 epifluorescence microscope (Zeiss, Gttingen, Germany). Digital

PAGE 237

215 images were acquired using AxioVision software (Zeiss) and a high-resolution black and white Zeiss AxioCam MRm digital camera. The TUNEL Assay, Assessment of Tota l Cell Number, and Progression to Metaphase II The TUNEL assay was used to de tect DNA fragmentation associated with late stages of the apoptotic cascade as descri bed previously (Jousan and Hansen, 2004). Embryos were removed from KSOM-BE2 and washed three times in 50-l drops of 10 mM KPO4 pH 7.4 containing 0.9% (w/v) NaCl (PBS) and 1 mg/mL PVP (PBS-PVP) by transferring the embryos from dr op to drop. Zona pellucida-intact embryos and oocytes (after measurement of caspase activity as desc ribed above) were fixed in a 50-l drop of 4% (w/v) paraformaldehyde in PBS for 15 min at room temperature, washed three times in PBS-PVP, and stored in 500 l of PBS-PVP at 4C until the time of assay. All steps of the TUNEL assay were conducted using microdrops in a humidified box. On the day of the TUNEL assay, embryos and oocytes were transferred to a 50-l drop of PBS-PVP and then permeabilized in 0.1% (v/v) Triton X-100 containing 0.1% (w/v) sodium citrate for 10 min at room temperature. Positive controls for the TUNEL assay (oocytes from ovaries obtaine d at the abattoir) were incubated in 50 l of RQ1 RNase-free DNase (50 U/mL) at 37C in the dark for 1 h. Positive controls and treated oocytes and embryos were washed in PBS-PVP and incubated in 25 l of TUNEL reaction mixture containing tetra methyl rhodamine red conjugated dUTP and the enzyme terminal deoxynucleotidyl transferase as prepared by and following the guidelines of the manufacturer) for 1 h at 37C in the dark. Negative controls were incubated in the absence of terminal deoxynucleotidyl transferase. Oocytes and embryos were then washed three times in PBS-PVP and incubated in a 25-l drop of Hoechst 33258 (1

PAGE 238

216 g/mL) for 15 min in the dark. Oocytes and embryos were washed three times in PBSPVP to remove excess Hoechst 33258 and mounted on 10% (w/v) poly-L-lysine coated slides in glycerol. Total cell number (embryos ), completion of metaphase II (oocytes; based on observation of two polar bodies), and TUNEL positive nuclei (embryos and oocytes) were assessed using a Zeiss Ax ioplan 2 epifluorescence microscope (Zeiss, Gttingen, Germany). Digital images were acquired using AxioVision software and a high-resolution black and white Zeiss AxioCam MRm digital camera. Statistical Analyses All oocyte and embryo responses were anal yzed using the GLIMMIX procedure of SAS (SAS Inst. Inc., Cary, NC). The mode l included treatment (C18:1c, C18:1t, C18:2, and C18:3), parity (primiparous and multiparou s), and experimental day (d 3, 6, 9 and 12) with the higher order interac tions. If the higher order inte ractions were not significant, they were removed from the model. Cow w ithin treatment or cow within treatment x parity were random effects specified in the m odels. The covariance structure used was an autoregressive order 1. Pred esigned orthogonal contrasts were used to make comparisons between groups of treatments and probability differences (PDIFF) were used to compare individual treatment means. A maximum of 50 was used fo r the number of iterations to be performed in order to meet convergence cr iteria. An error statement was used to specify the data distribution as either poisson for continuous non-normally distributed data and binomial for discreet non-normally distributed data. Als o, a link statement was used to specify that a log calculation was us ed for a poisson distribution and logit for a binomial distribution. Pregnancy rates, maturation to metaphase II, group II caspase activity, and TUNEL analysis from oocytes collected on the 5th OPU session were analyzed using the Logistic

PAGE 239

217 Regression procedure of SAS to examine the main effects of treatment, parity and treatment x parity. During the OPU aspirations, progesterone concentration, number of CL and follicles, and CL tissue volume were analyzed using the Mixed Model procedure of SAS (Littell et al., 1996). This procedure applies methods based on the mixed model with special parametric structure on the covarian ce matrices. The dataset was tested to determine the covariance structure that provid ed the best fit for th e data. Covariance structures tested included co mpound symmetry, autoregressive order 1 and unstructured. The covariance structure used was autoregressi ve order 1. Cow within treatment x parity was specified as a random effect in the model. The model consisted of treatment, parity and day with the higher order interactions. If the higher order interaction were not significant they were removed from the model. The CL tissue volume was adjusted using CL number as a covariate. Size of the largest follicle on d 0 and 7, CL number and volume on d 7, and plasma progesterone concentration on d 7 followi ng TAI were analyzed using the GLM procedure of SAS. The main effects of treatment (C18:1c C18:1t, C18:2, and C18:3), parity and the interaction of treatment x parity were examined with the number of CL used as a covariate for CL volume. Predes igned orthogonal contrasts were used to make comparisons between groups of treatments, and probability differences (PDIFF) were used to compare individual treatment means. Results Dry Matter Intake, Body Weight, and Milk Yield There were no differences among treatme nts for individual DMI prepartum (8.8, 9.2, 8.7, and 9.4 0.5 kg/d) and postpartum (16.6, 16.2, 15.8, and 16.6 0.6 kg/d), milk

PAGE 240

218 yield (34.5, 34.7, 32.2, and 34.0 1.4 kg/d), milk tr ue protein concentration (2.8, 2.8, 2.8, and 2.8 0.1%), and BW postpartum (586, 575, 555, and 558 15 kg) for diets enriched in C18:1 cis, C18:1 trans, C18:2 and C18:3 fatty acids, respectively (Amaral et al., 2005). Follicle and Oocyte Responses to Different Diets Body temperatures and number of follicles aspirated per cow were not different among treatment groups (Table 7-2). There were more visible follicles aspirated in primiparous cows compared with multiparous cows (4.2 vs. 5.1 0.3, respectively; P < 0.01). A total of 316, 236, 191, and 268 oocytes were collected from cows fed diets enriched in C18:1 cis, C18:1 trans, C18: 2 and C18:3 fatty acids, respectively. An average of 4.6 0.4 follicles per cow were as pirated with an average of 3.7 0.3 oocytes per cow recovered (80% recovery rate ). More oocytes were collected ( P < 0.05) and recovery rate was greater ( P < 0.05) from cows fed C18:1 cis than all other diets (4.7 vs. 3.5, 3.1, 3.7 0.5 and 96.4 vs. 70.8, 70.5, 80.8 9.1%, respectively; Table 7-2). Of the oocytes collected, there was no interaction be tween diet and grade on the distribution of oocytes graded 1, 2, or 3. The average pe rcent of grades 1, 2 or 3 oocytes among all treatments were 36.5% (77/211), 49.8% (105/211), and 13.7% (29/ 211), respectively. Diet did not affect cleavage rate (Table 7-2) or the stage of embryonic development at d 3. The number of oocytes that became morula or blastocysts and the number of oocytes that became blastocysts were not diffe rent among treatment groups (Table 7-2.). However, when individual treatments were compared, oocytes from cows fed the diet enriched in C18:1 cis compared with oocytes from cows fed the diet enriched in C18:2 had lower development to morulae or blastocyst stage ( P < 0.10) and lower development to the blastocyst stage ( P < 0.05). This was apparent whether development was expressed as a percentage of oocytes (14.0 vs. 5.2 3.5% and 8.4 vs. 2.0 2.4%,

PAGE 241

219 respectively; Table 7-2) or cleaved embryos (19.7 vs. 6.7 5.3% and 13.1 vs. 3.0 3.6%, respectively; Table 7-2). The number of blastomeres in morulae a nd blastocysts on d 8 were not different among treatment groups. When individual mean s were compared for the percentage of blastomeres that were TUNEL positive, oocytes from cows fed the C18:1 trans enriched diet resulted in embryos with reduced ( P < 0.05) percentage of TUNEL-positive blastomeres compared with embryos produced from oocytes obtained from cows fed the C18:1 cis enriched diet (5.9 vs. 2.7 1.6%, respectively; Table 7-2). Oocytes from primiparous cows tended ( P < 0.10) to result in embryos with a reduced number of TUNEL positive cells compared with oocytes from multiparous cows (3.1 vs. 5.5 1.2%, respectively). Follicle and Oocyte Responses to Different Days of the Estrous Cycle The number of visible follicles was gr eater on d 3 following induced ovulation versus all other days of aspiration ( P < 0.01; Table 7-3). Number of oocytes collected was also greater on d 3 and 6 as compared with d 9 and 12 ( P < 0.01; Table 7-3). However, the recovery rate was greater for d 6 compared with d 9 and 12 ( P < 0.05; Table 7-3). There was no interaction between oocyte grade and day of the estrous cycle on the distribution of oocytes that graded 1, 2, or 3. The percent of cleaved embryos tended to be greater on both d 3 and 6 compared with d 9 and 12 ( P < 0.10; Table 7-3). Oocyte Quality for the 5th OPU session On the 5th OPU session (approximately d 16 of th e estrous cycle), 151 oocytes were collected and proportions exhibiting caspase activity, TUNEL positive, and progressed to metaphase II was assessed. There was no effect of C18:1 cis, C18:1 trans, C18:2 or C18:3 enriched diets on percent of oocytes with caspase activity (9.4% [3/32], 7.7%

PAGE 242

220 [2/26], 9.1% [5/55], and 2.6% [1/38], re spectively), percent TUNEL positive (33.3% [10/30], 8.3% [2/24], 7.3% [4/55], and 18.9% [7 /37], respectively), or percent that progressed to metaphase II (65.5% [19/ 29], 77.8% [14/18], 76.9% [40/52], and 80.6% [29/36], respectively). However, the per cent of oocytes with caspase activity was decreased in grades 1 and 2 versus grade 3, a nd the percent that matured to metaphase II was increased in grades 1 and 2 compared to grade 3 ( P < 0.01; Table 7-4). No difference among grades for the percent oocytes that were TUNEL positive (Table 7-4). Internal IVF Control from Slaughterhouse Ovaries Holstein (n = 115) and non-Holstein (n = 112) oocytes were collected from slaughterhouse ovaries and those of grades 1 and 2 were fertilized in vitro There was no effect of breed on the proportion of oocytes that cleaved (non -Holstein 78.9 6.7% [88/112] vs. Holstein 68.0 6.7% [76/115]) by d 3. At d 3 postinsemination, there was a tendency for an increase in the percent cleave d embryos that reached the >8 cell stage for embryos from non-Holstein oocytes compared with embryos from Holstein oocytes (breed x stage interaction, P < 0.10; Figure 7-2). The percen tage of oocytes that became blastocysts on d 8 tended to be reduced fo r Holstein oocytes (21.2 11.4% [22/115]) as compared with non-Holstein oocytes (35.1 12.3% [41/112]; P < 0.10). There was no breed difference in the proportion of cleaved embryos that were blastocysts on d 8 (nonHolstein 40.2 15.0% [41/88] vs. Holstein 33.3 14.9% [22/76]). However, the stage of blastocyst development was more advanced in the non-Holsteins ( P < 0.05; Figure 7-3). Progesterone, Ovarian, and Pregnancy Responses No difference in plasma progesterone was detected among treatments at 47 3 DIM (at the start of synchronization ; 3.0 0.7 ng/mL) and during each OPU session (4.0 0.4 ng/mL). There was no main effect of di et on CL number (1.0 0.1), or CL volume

PAGE 243

221 (8497 mm3). There was, however, an effect of parity on CL number with primiparous cows having less CL than multiparous cows (0.9 vs. 1.2 0.1) during the first 4 OPU aspirations. As expected, there was a main effect of day with both CL volume and progesterone increasing from d 3 to d 16 following a synchronized estrus ( P < 0.01; Figure 7-4). At TAI, the largest follicle wa s increased in cows fed diets enriched in C18:2 or C18:3 ( P < 0.05; Table 7-5). Subsequently, CL volume was larger in cows fed diets enriched in C18:2 or C18:3 ( P < 0.05; Table 7-5). There was, however, no effect of treatment on plasma progesterone concentrati on on d 7 (Figure 7-4). CL number tended to be greater for cows fed a C18:1 transenriched diet (diet x parity interaction, P < 0.10; Table 7-5). The largest follicle on d 7 was reduc ed in cows fed a diet enriched in C18:1 cis compared with all other diets ( P < 0.05; Table 7-5). Pregna ncy rate did not differ on either d 28 or d 45 following TAI (Table 7-5). Discussion In this study, the source of supplemental fa t enriched in different omega fatty acids affected oocyte quality as determined by subsequent capacity to form a developing embryo after in vitro fertilization, and aff ected follicle and CL sizes in lactating dairy cows during summer. When individual diets were compared, the proportion of oocytes and cleaved embryos that developed to the moru lae and blastocyst stages were reduced in cows fed a diet enriched in C18:2 versus C 18:1 cis. In a study by Hochi et al. (1999), embryos cultured in 0.3% linoleic acid-BSA had a reduced development to the morulae stage and further reduced development to th e blastocyst stage compared to embryos cultured in 0.3% BSA. Possi bly increasing the linoleic aci d in the diet would have increased the amount of linol eic acid in the oocyte subs equently decreasing embryo development in vitro as shown in the present study.

PAGE 244

222 The detrimental effect of a high concentr ation of linoleic ac id (C18:2) on oocyte capacity for development following in vitro fertilization may be related to damage to the oocyte (or possibly the resultant embryo) cause d by lipid peroxide radicals derived from linoleic acid. Linoleic acid inhibited the in vitro development of 1or 2-cell stage mouse embryos, and the inhibitory effect was reve rsed by addition of an tioxidants (Nonogaki et al., 1994). Homa and Brown, (1992) cultured bovine oocytes, from slaughterhouse ovaries, with linoleic acid and noticed a sign ificant reduction in spontaneous germinal vesicle breakdown compared with oocytes cu ltured without fatty acids. In addition, follicular fluid from small versus larg e follicles was analyzed for fatty acid concentrations, and linoleic acid was the only fatty acid significantly reduced in large but not small follicles. It is only after the follicle has grown to the large preovulatory stage that the inhibitory influence on resumption of meiosis in oocytes is released, under the influence of LH (McGaughey, 1983). In the study by Homa and Brown, (1992), lin oleic acid inhibited germinal vesicle breakdown and progression to metaphase II co mpared to unsupplemented oocytes (35 vs. 81%) illustrating that linoleic aci d can affect nuclear maturation. However, in the present study, diet did not effect nuc lear maturation as measured by caspase activity, TUNEL labeling and progression to metaphase II but po ssibly exerted its affects on cytoplasmic maturation owing to the decrease in em bryo development to both the morulae and blastocysts stage. Holstein and non-Holstein oocytes from sl aughterhouse ovaries were used as an internal IVF control relative to OPU collect ed lactating Holstein oocytes. Development to the blastocyst stage from Holstein ve rsus non-Holstein slaughterhouse oocytes was

PAGE 245

223 reduced on d 8 (21.2 vs. 35.1%). In addition, the average blastocyst development from all diets of OPU collected oocytes (5.6%) was lower than the Holstein slaughterhouse oocytes on d 8. Reduction of blastocysts development in OP U oocytes appears to not only be due to the effect of breed but may be due to many factors. Lactation may play a large part in the reduction of embryo development in OPU collected lactating dairy cow oocytes versus slaughterhouse oocytes which were most likely from nonlactating cows. Gwazdauskas et al. (2000) collected oocyt es throughout lactation by twice weekly OPU and concluded that stage of l actation and dietary energy infl uenced oocyte quality. They also reported reduced oocyte quality and embryo development in lactating versus nonlactating cows. Recently, Sartori et al. (2002b) showed that embryos flushed from lactating cows were of lower qua lity than nonlactating cows. Another possibility is that slaughterhouse oocytes underwent a 4 h period before their removal from follicles and placement into maturation media; whereas OPU oocytes were placed into maturation media within 30 min following removal from the follicle. Blondin et al. (1997) collected slaughterhouse ovaries and held them in warm saline for different times post slaughter. The immature oocytes were then collected and IVF was performed. The maximum number of blastocy sts obtained was after 4 h of incubation in warm saline (30%) compared to half of that at 2 h (15%). Oocytes collected from slaughterhouse ovaries undergo a post-mor tem effect where the COC becomes less tightly connected to the follicle wall and ther efore is collected with a more complete morphology (Blondin et al., 1997). The post-mortem effect induces prematuration events

PAGE 246

224 which have beneficial eff ects on oocytes collected from slaughterhouse ovaries since embryo development was increased in vitro Competence of the oocyte and embryo is related to fatty acid composition; specifically, phospholipid conten t of the cellular membrane plays a vital role in development during and after fertilization (M cEvoy et al., 2000). Previous studies showed that C16:0 and C18:1 acids were the most abundant fatty acids in the phospholipid fraction of oocytes from cattle an d may function as energy reserves (Kim et al., 2001; Zeron et al., 2001). However, most studies on fatty acids in the oocytes or embryos of ruminant species address their accumulation in culture or highlight their damaging influence during cryopreservation rather than the im portance of their composition or contribution to cell structure, function and metabolism. Temperature modulates the physical propertie s of the lipids in cell membranes and changes lipid composition of the membrane (Quinn, 1985). Zeron et al. (2001) showed that oocyte membrane fluidity is affected by temperature alterations between seasons, as well as by changes in fatty acid compos ition. Furthermore, a relationship was documented between decreased PUFA content, a change in biophysical behavior of oocytes, and low fertility of dairy cows dur ing summer. The number of high quality oocytes was higher in ewes fed PUFAs than in control ewes (74.3% and 57.0%, respectively), and PUFA supplementation increa sed the proportion of long chain UFA in the plasma and cumulus cells (Zeron et al., 2002 ). However, these changes in fatty acid composition were relatively small in oocytes indicating that uptake of PUFAs to the oocyte is either selectiv e or highly regulated.

PAGE 247

225 A major difference between the study in ewes and the present study, in which oocyte quality was reduced by the diet enri ched in C18:2 as illustrated by reduced embryo development in vitro is that lactating dairy cows have a high utilization of fatty acids for lactation. An additional point in the present study was that dietary differences reflected different degrees of desaturation, is omerization and classifi cation of C18 fatty acids and there was no treatment group without supplementation of fatty acids. Perhaps oocyte quality may have been reduced from those harvested from cows not supplemented with fatty acids in comparison with cows s upplemented with fatty acids. This study was conducted during the summer heat stress season and is a season in which Zeron et al. (2001) showed that MUFA and PUFA contents are lower in oocytes and granulosa cells compared to the winter season in dairy cattle. In the lactating cows of the present study, there may have been a preferential uptake and utilization of fatty acid s by tissues such as the mammary gland that did not permit a ch ange or sustained the reduced follicular contents of MUFA and PUFA. Consequently, the MUFA or PUFA enriched diets did not have profound effects on oocyte quality in vivo as measured by subsequent embryo quality in vitro The UFA may have a more profound eff ect on the environment surrounding the oocyte which provides essential nutrients for oocyte/embryo survival post ovulation. During the periovulatory period, oocytes go through nuclear and cy toplasmic maturation and fatty acids are acquired for cell structure, function and metabolism. Storage of fatty acids, proteins and mRNA are critical to an early embryos survival before activation of its own genome. Since in this study, diet s enriched in PUFAs had effects on the dominant follicle with the largest follicle at TAI being increased in cows fed diets rich in

PAGE 248

226 PUFA versus cows fed diets rich in MUFA (Table 7-5). A majority of the oocyte maturation occurs during its time in the dominant follicle. The present experimental approach of targeting oocytes from smaller follicles may not reflect the environment and control systems of the dominant periovulatory fo llicle. In smaller follicles, the fatty acids may not have been in sufficient amounts to have a beneficial affect on both the oocyte, cumulus cells and (or) follicular fluid. For example, oocytes were aspirated from 3 to 12 mm follicles which would not be pre-ovulatory fo llicles in a lactating dairy cow (Sartori et al., 2002a). Other studies have shown that supplemental fat increases the average size of the dominant follicle in lactating dairy cows (Lucy et al., 1991b; Lucy et al., 1993b; Beam and Butler, 1997). Dominant fo llicle size was increased in cows fed diets enriched in PUFAs compared with cows fed a diet enri ched in MUFAs indicating that it was PUFAs that were most effective (Staples et al., 2000) In the present experiment, the first wave dominant follicle was increased in cows fed diets enriched in C18:1 trans, C18:2 and C18:3 when compared with the diet enriched in C18:1 cis. Oldick et al. (1997) infused abomasally lactating dairy with water, glucos e, tallow or yellow grease and observed that first wave dominant follicles grew faster a nd were larger in cows infused with yellow grease versus tallow. It appears that diets enriched in different fatty acids can have differential effects on follicle development. Larger ovulating dominant follicles in he ifers, nonlactating, and lactating dairy cows resulted in larger CLs (Sartori et al., 2002a; Moreira et al., 2000a). The CL volume was increased in cows fed PUFA enriched di ets compared with cows fed MUFA enriched diets. Lactating dairy cows fed an enrich ed diet of C18:2 had CL 5 mm larger than

PAGE 249

227 control-fed cows (Garcia-Boja lil et al., 1998). Larger CL s were found with lactating dairy cows that received high levels of omega-3 fatty acids through the diet as formaldehyde-treated linseed or as a mixture of formaldehydetreated linseed and fish oil (Petit et al., 2002). Larger CL s may not only be due to ovulation of a larger follicle but also through direct effects on the CL. El ectron microscopic examination of CL tissue revealed that lipid content was greater in lute al cells from beef heifers fed calcium salts of LCFA compared with unsupplemente d controls (Hawki ns et al., 1995). Although there were larger CL volumes in PUFA fed cows during the aspiration cycle (d 3-16 of the synchronized estrous cycle), progesterone c oncentrations did not differ between diets and did not differ on d7 after TAI. Previous studies have reported an increase (Staples et al., 1998), no effect (C hapter 4; Mattos et al., 2002), or decrease (Robinson et al., 2002) in plasma progesterone in dairy cows supplemented with LCFA. Another biological window in which fatty aci ds may have a benefi cial effect is on the follicular, oviductal and (o r) uterine environments. Cerri et al. (2004) fed lactating dairy cows a diet enriched in a mixture of linoleic and 18:1 trans fatty acids and found an increase in fertilization rate, accessory sp erm per structure, amount of high quality embryos and cell number when cows were flushed on d 5 following TAI. In their model, oocyte maturation, fertilization, and embryo development occurred in vivo Unsaturated fatty acids have been shown to have benefici al effects on the uterine environment. In Chapter 4 and 5, feeding calcium salts of fish oil to lactating dairy cows altered gene expression in the endometrium of cyclic cows in a manner that mimicked gene expression of pregnant cows. Also, the fish oil changed the fatty acid composition of the endometrium (i.e., increased EPA and DHA, and reduced AA; Chapter 6) in a manner

PAGE 250

228 that would reduce secretion of PGF2 as reported in lactating dairy cows (Mattos et al., 2002). By modulating PG production through fat f eeding, it may be possible to change the follicular, oviductal, and uterine environments in a manner that alters both oocyte and embryo development. Prostaglandins E2 and F2 are important mediators of the ovulatory process. Their concentration in follicular fluid increases sharply before ovulation at a time when the oocyte is going through its final maturation process. Scenna et al. (2004) cultured bovine embryos with PGE2 or PGF2 and observed that PGF2 reduced development to the blastocyst stage and PGE2 had no effect. In addition, results from Lozano et al. (2003) indicated th at a diet that increased PGF2 production by the uterine tissue in sheep also decreased oocyte quality and early embryo development. In mouse oviducts, maximal PGI2 was produced on d 2 to 3 after conception and was shown to enhance embryonic development (Huang et al., 2004) Thus, alterations in PG classes via dietary manipulation may change oocyte and embryo quality. Stage of the estrous cycle effected oocyte responses with the first two aspirations (i.e., d 3 and 6 of the estrous cycle) generally being better than the last two aspirations (i.e., d 9 and 12). When dairy cow follicles were aspirated on d 2, 5 or 8 of an induced follicular wave, the proportion of oocytes competent to develop a blastocyst was increased on d 2 and 5 compared with d 8 (Hendriksen et al., 2004). Lower rates of blastocyst development were reported when OPU was performed once a week in comparison with OPU every 3 to 4 d (Goodhand et al., 1999; Hanenberg and van Wagtendonk-de Leeuw, 1997). Presumably, th e higher frequency of OPU prevents the establishment of a dominant follicle. A dominant follicle clearly reduces the competence

PAGE 251

229 of oocytes from subordinate follicles. Th is impairment occurs, however, rather late during the non-growing phase of the dominant follicle (H endriksen et al., 2004). In addition, Hendriksen et al. (2000) reported follicles in the beginning of atresia had more competent oocytes that developed into a blas tocysts compared with oocytes from follicles that are not beginning atresia. Also when an LH surge is induced prior to oocyte collection, prematurational events occur in the oocyte and further maturation of the follicle allowing for an increased oocyte competence and subsequent embryo development (Hendriksen et al., 2000). In our study, cows were synchronized before OPU with an Ovsynch protocol plus a CIDR insert. Aspirations bega n 3 to 4 d following the last GnRH injection that ovulated the dominant follicle leaving the slightly at retic subordinate follicles with oocytes undergoing prematurational events possibly owin g to better oocyte quality, recovery and cleavage rate on the first OPU session versus th e other four sessions. Bols et al. (1998) showed, using OPU sessions of 3 and 4 d inte rvals, a decline from 9.6 oocytes per first OPU session to 3.9 in the second and an averag e of 6.2 oocytes from the fourth session onwards. In addition, Merton et al. (2003) used a similar OPU scheme with the first session performed at random stages of the cy cle without prior rem oval of the dominant follicle. First collection averaged 14 oocytes pe r pregnant heifer declining thereafter to about 9 per session. Also, Petyim et al. (2003) found that presence of CL producing progesterone had no influence on oocyte yi elds and quality, whereas presence of dominant follicles appeared to decr ease the number of recovered oocytes. Conclusions Type of fat with respect to specific composition of omega fatty acids of the 18 carbon series can alter oocyte quality and follic ular dynamics in lactating dairy cows.

PAGE 252

230 Effect of feeding PUFAs as compared to MUFAs affected oocyte quality demonstrated by subsequent embryo development in which the C18:2 enriched diet reduced embryo development compared to C18:1 cis enriched diet. This suggests the previously documented benefits of PUFAs reflect actions at alternative biological windows. In this study, only small follicles (3-10 mm) were aspirated so effects on periovulatory follicles would not be observed. Possible beneficial effects of PUFAs on the periovulatory follicle and CL are evident by the increase in domi nant follicle size and CL volume due to feeding PUFAs (i.e., 18:2 and 18:3). Also, lo cal effects of the fa tty acid environment during nuclear and cytoplasmic maturation were eliminated because maturation occurred in vitro Fatty acid composition of the diet c ould also alter the oviductal or uterine environment (i.e., gene expression) to promot e embryo development. Further research is warranted in isolating particul ar fatty acids that may have beneficial effects on various biological windows that may alter fe rtility in lacta ting dairy cows.

PAGE 253

231 Table 7-1. The percent of fatty acids from th e total fatty acids in the supplemental fat sources.ab Treatment Fatty Acid High oleic sunflower oil Ca salts of trans fatty acids Ca salts of palm and soybean oil Linseed oil C16:0 3.7 12.2 17.4 5.8 C18:0 5.4 6.7 2.1 3.4 C18:1 transc < 1.0 57.5 1.5 18.0 C18:1 cisc 81.3 10.0 32.1 < 1.0 C18:2 9.0 2.0 30.5 16.4 C18:3 < 1.0 < 1.0 2.4 55.9 a Data are percent of total fatty acids (w/w). b Ca = calcium. c The different C18:1 trans and cis isomers could not be identified.

PAGE 254

232 Figure 7-1. Experimental protoc ol illustrating the days in milk (DIM) for synchronization injections, ultrasonography, ovum pick-up, a nd timed artificial insemination (TAI; d 0). G = GnRH, PG = PGF2 CIDR = controlled internal drug releasing insert containing 1.38 g of progesterone. 47 DIM 54 56 60 63 66 69 72 75 78 79 86 107 124 Estrous cycle d 3+1 6 9 12 16 G PG G 1st 2nd 3rd 4th 5th PG G TAI d 7 d 28 d 45 CIDR Ovsynch Ovum Pick-up Ultrasound

PAGE 255

233 Table 7-2. Body temperature, and follicu lar and oocyte responses of lactating multiparous and primiparous cows fed di ets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13).a Treatments Contrasts Response Trt. 1 C18:1c Trt. 2 C18:1t Trt. 3 C18:2 Trt. 4 C18:3 S.E. 1 vs. 2,3,4 2 vs. 3,4 3 vs. 4 Temperature,C 38.7 38.8 38.8 38.7 0.1 NS NS NS Follicle number 4.9 4.9 4.2 4.6 0.4 NS NS NS Oocyte number 4.7b 3.5 3.1c 3.7 0.5 NS NS Oocyte recovery,% 96.4b 70.8c 70.5c 80.8 9.1 NS NS Cleaved,% of oocytes 51.6 (117/227) 61.3 (104/171) 53.2 (76/144) 52.9 (101/186) 5.3 NS NS NS M + BL,% of oocytes 14.0x (36/192) 10.5 (20/148) 5.2y (8/126) 10.4 (22/157) 3.5 NS NS NS M + BL,% of cleaved embryos 19.7x (36/117) 14.0 (20/104) 6.7y (8/76) 16.2 (22/101) 5.3 NS NS NS M + BL cell no. 111.3 101.8 82.5 110.7 11.9 NS NS NS BL,% of oocytes 8.4b (32/192) 6.9x (18/148) 2.0c,y (4/126) 5.2 (19/157) 2.4 NS NS NS BL,% of cleaved embryos 13.1b (32/117) 9.2 (18/104) 3.0c (4/76) 9.1 (19/101) 3.6 NS NS NS TUNEL + blastomeres,% 5.9b 2.7c 5.0 3.6 1.6 NS NS NS a Data outside of parentheses represent leas t-squares means and pooled SE. Data in parentheses represent the fraction of follicles that yielded a recoverable oocyte (recovery), or the fraction of oocytes or cleaved embryos that became morulae (M) and (or) blastocysts (BL). b,c P < 0.05, x,y P < 0.10, P < 0.05, NS = non-significant.

PAGE 256

234 Table 7-3. Follicular and embryonic responses of lactating multiparous and primiparous cows fed diets enriched in either C 18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13) and tr ansvaginaly aspirated on d 3, 6, 9 and 12 of a synchronized estrous cycle.a Day of Estrous Cycle 1 Contrasts Response 3 6 9 12 S.E. 3 vs. 6 9 12 6 vs. 9 12 9 vs. 12 Follicle number 5.3b 4.6c 4.1c 4.5c 0.3 ** NS NS Oocyte number 4.7b 4.1b 3.2c 3.0c 0.4 ** ** NS Oocyte recovery,% 87.8b 88.4b 75.4b,c 66.5c 7.5 NS NS Cleaved,% of oocytes 60.6b (135/224) 58.3b (113/195) 47.7c (71/154) 52.4b,c(79/155) 6.2 NS a Data outside of parentheses represent leas t-squares means and pooled SE. Data in parentheses represent the fraction of cleaved embryos from total oocytes. b,c P < 0.05, x,y P < 0.10, P < 0.05, ** P < 0.01, NS = non-significant.

PAGE 257

235 Table 7-4. Oocyte quality responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 ci s (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13). a Grade of Oocytes Contrasts Response 1 2 3 1 vs. 2,3 2 vs. 3 Caspase activity,% 1.5b (1/65) 1.6b (1/62) 37.5c (9/24) ** TUNEL labeling,% 14.5 (9/62) 13.6 (8/59) 24.0 (6/25) NS NS Metaphase II,% 76.3 b (45/59) 80.7 b (46/57) 57.9c (11/19) NS ** a Percent of oocytes, transvagin ally aspirated on d 16 of the synchronized estrous cycle, with group II caspase activity, TUNEL labe ling in the pronucleus, and that completed nuclear maturation to metaphase II after maturation in vivo b,c P < 0.05, P < 0.05, ** P < 0.01, NS = non-significant.

PAGE 258

236 0 5 10 15 20 25 30 35 40 45 50 2 to 34 to 7> 8 Cell NumberCleaved Embryos on d 3 (%) Holstein Non-Holstein Figure 7-2. Percent of cleaved embryos at either the 2 to 3, 4 to 7 or > 8 cell stage on d 3 following insemination of either Holstein (n = 115) or Non-Holstein (n = 112) oocytes collected from slaughter house ovaries with semen from Angus bulls. Percent of > 8 cell stage embryos were reduced for embryos from Holstein oocytes compared with embryos from Non-Holstein oocytes (breed x stage interaction, P < 0.10).

PAGE 259

237 0 5 10 15 20 25 30 35 Morula & Early Blastocyst Blastocyst & Expanded Blastocyst Hatching & Hatched BlastocystStage of Embryos on d 8 (%) Holstein Non-Holstein Figure 7-3. Percent of embryos on d 8 following insemination based on stage of development as affected by oocyte genot ype. Stages of development were as follows: morula, early blastocyst, blas tocyst, expanded blastocyst, hatching blastocyst, or hatched blastocyst. Embryos were produced from either Holstein (n = 115) or non-Holstein (n = 112) oocytes collected from slaughterhouse ovaries. Stage of blas tocyst development on d 8 was more advanced in embryos from non-Holstein embryos (breed x stage interaction, P < 0.05).

PAGE 260

238 0 2000 4000 6000 8000 10000 12000 3691216 Days After Induced Ovulation (+/1)CL Volume (mm )0 1 2 3 4 5 6 7 8Progesterone (ng/ml) CL Volume P4 Figure 7-4. Plasma progesterone concentrati on (ng/mL) and corpus luteum (CL) volume (mm3) collected on d 3, 6, 9, 12, and 16 of a synchronized estrous cycle from lactating multiparous and primiparous co ws fed diets enriched in either C18:1 cis (n=14), C18:1 tr ans (n = 14), C18:2 (n=13) and C18:3 (n =13). The CL volume and progesterone concen tration increased from d 3 to d 16 following an induced ovulation (d 0; P < 0.01). 3

PAGE 261

239 Table 7-5. Follicle, corpus luteum (CL) and pregnancy responses from lactating multiparous and primiparous cows fed di ets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13) and transvaginally aspirated.a Treatments Contrasts Response Trt. 1 C18:1c Trt. 2 C18:1t Trt. 3 C18:2 Trt. 4 C18:3 S.E. 1 vs. 2 3 4 2 vs. 3 4 3 vs. 4 Response on d 0 Diameter, largest follicle, mm 15.0x 14.9x 16.8y 16.2x,y 0.7 NS NS Response on d 7 CL number 1.7 1.6 1.8 1.9 0.3 NS NS NS CL volume,mm3 6033x 5495x 7323x,y 8208y 644 NS NS Progesterone, ng/mL 3.6 3.4 3.6 3.8 0.4 NS NS NS Diameter largest follicle, mm 17.4b 20.1c 18.7b,c 19.5c 0.6 NS NS Pregnancy rate D 28 28.6 30.8 16.7 23.1 NS NS NS D 45 28.6 23.1 16.7 23.1 NS NS NS a Least squares means and pooled SE for the largest follicle (mm) on d 0 and 7, CL number and volume (mm3) on d 7, plasma progesterone concentration (ng/mL) on d 7, and pregnancy rate on d 28 and 45 following timed AI (d 0). b,c P < 0.05, x,y P < 0.10, P < 0.05, NS = non-significant.

PAGE 262

240 CHAPTER 8 GENERAL DISCUSSION AND CONCLUSIONS Changes in dairy farms in the United States toward increased herd sizes and milk production has been associated with incr eased reproductive inefficiencies. One component for the decline in fertility is a large amount of early embryonic loss. Early embryonic loss in lactating dairy cows has been estimated to be as high as 40% between d 7 and 19 after insemination which coincides with the time in which the conceptus must secrete sufficient amounts of IFNto inhibit PGF2 secretion and sustain the CL to maintain pregnancy. Decreasing early embryonic loss without compromising milk production would be beneficial to the economic success of commercial dairy enterprises. A widely used practice of increasing milk production is through the use of exogenous bST. Recent reports indicate th at bST can increase pregnancy rates in lactating dairy cows (Moreira et al., 2000b, 2001; Santos et al., 2004b; Morales-Roura et al., 2001). However, the mechanisms via wh ich bST enhances pregnancy rates are not fully documented. The first experiment (Chapter 3) utilized nonlactating dairy cows as a model to eliminate the homeorhetic drive of lactation in evaluating bST effects on d 17 after estrus on reproductive a nd conceptus tissues, and endocri ne responses of cyclic and pregnant cows. To our dismay, bST reduced pregnancy rates but increased conceptus lengths and IFNconcentrations. The 2 fold increas e in conceptus lengths and 3 fold increase in IFNconcentrations may have caused an asynchronous uterine environment as reflected by a decrease in pregnancy rate This advanced embryonic growth may have been due to bST injections causing a hyperstimu lation in IGF-I concentr ations of plasma.

PAGE 263

241 The IGF-I concentrations are already at suffici ent levels in nonlactating cows to sustain embryonic growth as seen by a greater preg nancy rate in the non-bST treated cows. However, in our second experiment with la ctating cows (Chapter 4), bST increased plasma concentrations of IGF-I to the basal concentrations of nonlact ating dairy cows not treated with bST and the lacta ting cows (Figure 8-2) had an increased pregnancy rate. In addition, conceptus lengths and IFNconcentrations were increased but not to the extent of the nonlactating cows. There appears to be an optimal level in which IGF-I levels can exert beneficial effects on embryo developmen t and survival that increases pregnancy rate. Another possibility for the decreased pr egnancy rate in nonlactating dairy cows may be due to the hyperstimulation of plas ma insulin caused by bST (Figure 8-3). Previous reports indicate that high insulin concentrations can e ffect negatively both oocytes and embryos in dairy cattle (Armst rong et al., 2003), mice (Chi et al., 2000) and humans (Sagle et al., 1988). This differen ce in response to bST illustrates the complex relationship between physiologi cal and nutritional status (i .e., lactating vs. nonlactating states) and reproduction. The increase in fertil ity seen in dairy cows injected with bST appears to be specific for cows during lacta tion. Injecting bST into nonlactating cows or other target populations such as heifers or beef cows with sufficient production of IGF-I may have no effect or possibly reduce fertility as documented in chapter 3. Another way in which bST may be decr easing early embryonic loss in lactating dairy cows is through regulation of com ponents of the PG cascade (Figure 8-4). Downstream metabolism of PGH2 to either PGF2 or PGE2 is regulated by PGFS and PGES enzymes, respectively. In chapte r 5, bST reduced PGFS mRNA and increased

PAGE 264

242 PGES steady state concentra tions of mRNA in the endometrium. This may favor a decrease in PGF2 and a subsequent increase in PGE2 secretion that would support maintenance of the CL. Furthermore, bST increased PGE2 in the uterine flushing fluids of pregnant lactating dairy cows without an increase in PGF2 Although it is not possible to identify whether PGE2 is coming from the conceptus or endometrium, it is reasonable to assume that an increased amount of PGE2 is coming from the endometrium since PGF2 was not increased. Moreover, the pres ence of a conceptus and its secretions influenced the endometrium so that it responds differentially to bST in a manner that may benefit pregnancy. For example, in lactating pregnant cows injected with bST, the bST decreased steady state concentrations of PGFS mRNA and increased steady state concentrations of PGES, IGF -II, and IGFBP-2 mRNA compared with lactating pregnant cows not injected with bST. In addition, in some gene and protein responses bST had differential effects in cyclic cows compar ed to pregnant cows. For example, bST increased steady state concentrations of PR mRNA in cyclic cows but had no effect in pregnant cows. Furthermore IGFBP-2 mRNA was decreased in bST-treated cyclic cows but increased in bST-treated pregnant cows. This reflects direct conceptus induced alterations in regulation of gene expr ession due to secretions such as IFN, or indirect induced alterations within the endometrium that effect responsiveness to bST. Pregnancy attenuated gene expression and pr otein secretion associated with the PG cascade which most likely reduces the pulsatile release of PGF2 (Figure 8-5; Chapter 5). The PGHS-2 mRNA was unaffected by pre gnancy. However PGHS-2 protein was increased illustrating that pre gnancy may regulate the activity of the PGHS-2 enzyme in a manner to decrease pulsatile PGF2 secretion through a reduc tion in upstream regulatory

PAGE 265

243 components such as ER and OTR that were indeed re duced in the endometrium of pregnant cows. The PGHS-2 appears to be important for basal production of PGs which are beneficial for pregnancy. An earlier study sh owed that basal levels of PGFM increase in pregnant versus cyclic cows (Williams et al., 1983), ewes (Payne and Lamming, 1994), and water buffalo (Mishra et al., 2003). Fu rther research is warranted in developing strategies to inhibit only pulsatile release of PGF2 without decreasing basal concentrations of PGs. The diet enriched in calcium salts of fi sh oil increased milk production but lowered plasma insulin compared to cows fed a diet of equal energy density. Furthermore, in cows fed the fish oil enriched diet, plasma concentrations of GH we re elevated due to bST injections, but subsequent concentrations of IGF-I were not elevated to the same extent as control cows receiving bST. Increa sed concentrations of insulin in the blood are known to increase GHR expression in liver and adipose ti ssues and to double concentrations of IGF-I in pl asma of lactating dairy cows (Rhoads et al., 2004). Since insulin was decreased due to FO feeding, GHR expression may have been reduced and contributed to the elevated concentrati ons of GH without s ubsequent elevated concentrations of IGF-I in plasma. This wa s also apparent when examining the endocrine response of nonlactating cows (Chapter 3). Nonlactating cows treated with bST had elevated levels of insulin and IGF-I and low concentrations of GH (Figure 8-1) as compared to the lactating dairy cows. Formul ating diets that increase insulin levels may possibly increase liver responsiveness to bS T allowing for a greater IGF-I output. A greater IGF-I output may, in turn, increase em bryonic survival and promote an increase

PAGE 266

244 in milk production. This could also be a reason for farm-to-farm differences in bST milk response due to different types of fat in the diet. The fish oil enriched diet altered gene expression of IGF-I and IGF-II in the endometrium in a manner that mimicked pre gnancy (Chapter 5). Around d 17 there is a transition from growth of the conceptus to a coordinated switch that focuses on preparation of the uterus for implantation. Th e fish oil enriched dietary effect to reduce steady state concentrations of IGF-I mRNA (which promotes embryo development) and stimulation of steady state concentrations of IGF-II mRNA (whi ch may prepare the uterus for implantation), may be a coordinate d response that mimics the pregnancy state and was evident in the endometrium of pregnant cows versus cyclic control cows at this time. The fish oil enriched diet decrease d steady state concentr ations of IGF-I mRNA and stimulated steady state concentrati ons of IGF-II mRNA which mimicked the pregnancy response when comparing cyclic a nd pregnant control cows. Furthermore in cyclic cows fed FO and pregna nt cows injected with bST, steady state concentrations IGF-II mRNA and IGFBP-2 mRNA were increas ed compared with control-fed cows. Increasing steady state concentrations of IG FBP-2 mRNA may be a ssociated with an increase in IGFBP-2 protein that could targ et localization and deliv ery of IGF-II to the overlying conceptus that is undergoing de velopmental changes in preparation for implantation and placentation. Feeding a FO enriched diet may help to reduce the pulsatil e secretion of PGF2 In chapter 5, FO increased PR in the SGE and DG E which may be beneficial for preparation of the uterus for establishment and maintena nce of pregnancy. Furthermore FO reduced ER protein in the LE, DGE, and SS, and PGHS-2 protein in the LE. In chapter 6, FO

PAGE 267

245 reduced the amount of AA a precursor for the biosynthesis of the prostaglandin 2 series. The FO reduction in regulatory components a nd precursor fatty acid of the PG cascade may be beneficial to maintain the CL (Fi gure 8-6). Since one po ssible reason for early embryonic loss is reduced development of conceptuses that are unable to secrete sufficient amounts of IFN, then a nutritional management scheme such as feeding a FO enriched fat supplement may provide an additi ve or synergistic anti luteolytic signal to maintain pregnancy. This strategy is util izing dietary supplementation of functional nutrients or nutraceuticals as a means to improve reproductive performance. In addition to providing a more conduc ive environment for establishing and maintaining pregnancy, FO may provide a nutri tional product for consum ers. In chapter 6, FO increased CLA concentrations in the m ilk fat and decreased th e n-6:n-3 ratio. The CLA and omega-3 fatty acids have been shown to have human health promoting properties (Bauman et al., 2001). Furthermore, FO may replenish depleted stores of fatty acids in various tissues that were preferentia lly utilized for lactation. This may improve functionality of these tissues. Fatty acids appear to have profound effects on reproductive responses. Understanding which fatty acids are having be neficial effects and formulating diets enriched in those particular fatty acids may improve reproductive performance. In chapter 7, a diet enriched in C18:2 reduced oocyte quality in vivo demonstrated by subsequent reduced embryo development in vitro compared to a diet enriched in C18:1 cis. However previous studi es have shown that diets en riched in C18:2 increased pregnancy rates (Cullens et al., 2004; Boke n et al., 2005). This suggests that the beneficial effects of fatty acids are acting via a variety of biological windows. For

PAGE 268

246 example, in chapter 7 the oocytes were aspirated from small follicles that would not ovulate in a lactating dairy cow. This syst em eliminated the effects of fatty acids on in vivo nuclear and cytoplasmic maturation, which occur during the periovulatory period. In the present study maturation processes were examined in vitro However, PUFA enriched diets increased the periovulatory foll icle and subsequent CL size in comparison with MUFA. Furthermore PUFA increased the size of the first wave follicle. The PUFA may improve fertility by providing beneficial effects on the dominant follicle as shown herein and in other studies (S taples et al., 1998). In addi tion the PUFA may modulate the uterine environment, as shown in chapte rs 4 and 5, to provide a more conducive environment for embryo establishment and maintenance of pregnancy. Particular fatty acids appear to have different effects on various physiological processes in the lactating dairy cow. It may be beneficial to feed certain fatty acids at particular times during a cows life in order to improve specific responses. For example, feeding a diet enriched in C18:2 which can be converted to AA, the precursor for PGE2 and leukotriene B4 (which are proinflammatory mediators) and PGF2 (which is luteolytic), may contribute to increased immuno-competence in the early postpartum period. However, feeding a diet en riched in EPA and DHA decreases PGF2 which would be beneficial for CL maintenance and embryo survival around 60 DIM when the producer begins breeding. Furthe r investigation is warranted in elucidating the effects of particular fatty acids on physiological respons es of the lactating dairy cow. Coupling both nutritional and reproductive manage ment schemes may improve reproductive efficiency, herd health, milk production and m ilk composition that would have an overall benefit to producers and consumers. In addi tion, injecting bST into lactating dairy cows

PAGE 269

247 will stimulate sufficient growth factor pr oduction in order to improve both milk production and fertility in a well ma naged TAI synchronization program.

PAGE 270

248 0 5 10 15 20 25 30 35 01234567891011121314151617 Days after GnRH (i.e.estrus)Plasma GH (ng/ml) Figure 8-1. Plasma GH (ng/mL) of pregnant cows that were nonl actating or lactating. Cows received injections of bST (+/; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemina tion (Days 0 to 17). Nonlactating pregnant no bST ( ; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST ( ; n = 4); Lactating pregnant bST ( ; n = 5). bST bST

PAGE 271

249 Figure 8-2. Plasma IGF-I (ng/mL) of pregnant cows that were nonl actating or lactating. Cows received injections of bST (+/; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemina tion (Days 0 to 17). Nonlactating pregnant no bST ( ; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST ( ; n = 4); Lactating pregnant bST ( ; n = 5).

PAGE 272

250 Figure 8-3. Plasma insulin (ng/mL) of pregna nt cows that were nonlactating or lactating. Cows received injections of bST (+/; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemina tion (Days 0 to 17). Nonlactating pregnant no bST ( ; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST ( ; n = 4); Lactating pregnant bST ( ; n = 5). 0 1 2 3 4 5 6 01234567891011121314151617 Days of GnRH (i.e., estrus)Plasma Insulin (ng/ml) bST bST Detrimental to Pre g nanc y

PAGE 273

251 Blood OT E2 ER P4 PR P4 P4 E2 E2 ISG OTr PLA2 PLC DAG PGH2 AA PGHS-2 PGES PGFS PGE2 PGF2 AA AA AA Uterine Lumen PPAR Ligand RXR PPAR Ligand RXR ? INFJAK TYK ? Decrease pulsatile release of PGF2 Figure 8-4. Model diagram representing the e ffects of bST on genes and proteins of the prostaglandin cascade in the endometrial cell of pregnant lactating dairy cows. The bST increased conceptu s lengths thereby increasing IFN. In addition, bST reduced PGFS mRNA a nd increased PGES mRNA, which may reduce the amount of PGF2 produced.

PAGE 274

252 Blood OT IFNJAK TYK E2 ER P4 PR P4 P4 E2 E2 ISG OTr PLA2 PLC DAG PGH2 AA PGHS-2 PGES PGFS PGE2 PGF2 AA AA AA Uterine Lumen PPAR Ligand RXR PPAR Ligand RXR Decrease pulsatile release of PGF2 ? ? Figure 8-5. Model diagram representing the e ffects of pregnancy on genes and proteins of the prostaglandin cascad e in the endometrial cell of lactating dairy cows. Pregnancy decreased ER protein, OTR mRNA, PG ES mRNA and PGFS mRNA, which would ultimately d ecrease pulsatile release of PGF2

PAGE 275

253 Blood OT E2 ER P4 PR P4 P4 E2 E2 ISG OTr PLA2 PLC DAG PGH2 AA PGHS-2 PGES PGFS PGH3 EPA PG3 PGE2 PGF2 AA AA AA EPA EPA EPA Uterine Lumen PPAR Ligand RXR PPAR Ligand RXR Decrease pulsatile release of PGF2 Enriched EPA ? ? Figure 8-6. Model diagram representing the eff ects of an enriched fish oil diet on genes and proteins of the prostaglandin cascad e in the endometrial cell of lactating cyclic dairy cows. The fish oil increased PGHS-2 protein mimicking pregnancy effect. Fish oil also increased PR mRNA which may improve uterine environment. In addition, fish oil enriched the cell membranes with EPA and DHA which may reduce the prec ursor for prostaglandins of the 2 series. However, EPA is a precursor fo r prostaglandins of the 3 series which are less biologically active.

PAGE 276

254 LIST OF REFERENCES Abayasekara, D. R. E., and D. C. Wathes. 1999. Effects of altering dietary fatty acid composition on prostaglandin synthesis and fertility. Prost. Leukot. Ess. Fatty Acids 61:275-287. Ahmad, N., E. C. Townsend, R. A. Dailey, a nd E. K. Inskeep. 1997. Relationships of hormonal patterns and fertility to occurre nce of two or three waves of ovarian follicles, before and after breeding, in beef cows and heifers. Anim. Reprod. Sci. 49:13. Ahnadi, C. E., N. Beswick, L. Delbecchi, J. J. Kennelly, and P. Lacasse. 2002. Addition of fish oil to diets for dairy cows. II. Effects on milk fat and gene expression of mammary lipogenic enzymes. J. Dairy Res. 69:521-531. Albers, R., M. Bol, R. Bleumink, A. Willems, C. Blonk, and R. Pieters. 2002. Effects of dietary lipids on immune function in a mu rine sensitization model. Br. J. Nutr. 88:291-299. Al-Katanani, Y. M., D. W. Webb, and P. J. Hansen. 1999. Factors affecting seasonal variation in non-return rate to first serv ice in lactating Holstein cow in a hot climate. J. Dairy Sci. 82:2611. Allen, M. S. 2000. Effects of diet on shortterm regulation of feed intake by lactating dairy cattle. J. Dairy Sci. 83:1598-1624. Almier, M., G. De Rosa, F. Grasso, F. Napolitana and A. Bordi. 2002. Effect of climate on the response of three oestrus synchroni zation techniques in la ctating dairy cows. Anim. Reprod. Sci. 71 : 157. Amaral, do B. C., C. R. Staples, O. Sa Filho, T. R. Bilby, J. Block, F. Silvestre, F. M. Cullens, L. Badinga, P. J. Hansen, and W. W. Thatcher. 2005. Effect of supplemental fat source on productio n, immunity, and reproduction of periparturient Holstein cows in summer. J. Dairy Sci. 88:(Suppl.1):178. (Abstr.) Amri, E. Z., F. Bonino, and G. Ailhand. 1995. Cloning of a prot ein that mediates transcriptional effects of fatty acids in preadipocytes. Homology to peroxisome proliferator-activated receptor s. J. Biol. Chem. 270:2367-2371. Andrew, S. M., H. F. Tyrrell, C. K. Reynol ds, and R. A. Erdman. 1991. Net energy for lactation of calcium salts of long-chain fatty acids for cows fed silage-based diets. J. Dairy Sci. 74:2588-2600.

PAGE 277

255 Arbel, R., Y. Bigun, E. Ezra, H. Sturman, and D. Hojman. 2001. The effect of extended calving intervals in high lactating cows on milk production and profitability. J. Dairy Sci. 84:600-608. Arechiga, C. F., A. D. Ealy, and P. J. Ha nsen. 1995. Evidence that glutathione is involved in thermotolerance of preimp lantation mouse embryos. Biol. Reprod. 52:1296-1301. Armstrong, D. G., J. G. Gong, and R. Webb. 2003. Interactions between nutrition and ovarian activity in cattle: physiological, cellu lar and molecular mechanisms. Reprod. Suppl. 61:403-414. Armstrong, J. D., E. A. Goodall, F. J. Gor don, D. A. Rice, and W. J. McCaughey. 1990. The effects of levels of concentrate offere d and inclusion of maize gluten or fish meal in the concentrate on reproductive a nd blood parameter of dairy cows. Anim. Prod. 50:1-10. Armstrong, D. G., T. G. McEvoy, G. Baxter, J. J. Robinson, C. O. Hogg, K. J. Woad, R. Webb, and K. D. Sinclair. 2001. Effect of dietary energy and protein on bovine follicular dynamics and embryo production in vitro: associations with the ovarian insulin-like growth factor syst em. Biol. Reprod. 64:1624-1632. Arosh, J. A., S. K. Banu, S. Kimmins, P. Chapdelaine, L. A. MacLaren, and M. A. Fortier. 2004. Effect of interferon-tau on prostaglandi n biosynthesis, transport, and signaling at the time of ma ternal recognition of pregnanc y in cattle: evidence of polycrine actions of prostaglan din E2. Endocrinology 145:5280-5293. Arosh, J. A., J. Parent, P. Chapdelaine, J. Si rois, and M. A. Fortier. 2002. Expression of cyclooxygenases 1 and 2 and prostaglandin E synthase in bovine endometrial tissue during the estrous cycle. Biol. Reprod. 67:161-169. Ashes, J. R., B. D. Siebert, S. K. Gulati, A. Z. Cuthbertson, and T. W. Scott. 1992. Incorporation of n-3 fatty acids of fish oil into tissue and serum lipids of ruminants. Lipids 27:629-631. Auboeuf, D., J. Rieusset, and L. Fajas. 1997. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-ac tivated receptors and liver X receptor in humans. Diabetes 46:1319-1327. Ayalon, N. 1978. A review of embryonic mortal ity in cattle. J. Reprod. Fertil. 54:483493. Badinga, L., R. J. Collier, W. W. Thatcher, and C. J. Wilcox. 1985. Effect of climatic and management factors on conception ra te of dairy cattle in subtropical environment. J. Dairy Sci. 68:78.

PAGE 278

256 Badinga, L., R. J. Collier, W. W. Thatcher, C. J. Wilcox, H. H. Head, and F. W. Bazer. 1991. Ontogeny of hepatic bovine growth hor mone receptors in cattle. J. Anim. Sci. 69:1925-1934. Badinga, L., A. Guzeloglu, and W. W. Thatch er. 2002. Bovine somatotropin attenuates phorbol ester-induced prostaglandin F2 production in bovine endometrial cells. J. Dairy Sci. 85:537. Baker, J., J.-P. Liu, E. J. Robertson, and A. Efstratiadis. 1993. Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73-82. Balaguer, S. A., R. A. Pershing, C. Rodri guez-Sallaberry, W. W. Thatcher, and L. Badinga. 2005. Effects of bovine somato tropin on uterine genes related to the prostaglandin cascade in lactating da iry cows. J. Dairy Sci. 88:543-552. Balen, A. H., S. I. Tan, J. MacDougall, and H. S. Jacobs. 1993. Miscarriage rates following in-vitro fertilization are increased in women with polycystic ovaries and reduced by pituitary desensitization w ith buserelin. Hum. Reprod. 8:959-964. Banni, S., C. S. D. Heys, and K. W. J. Wahle. 2003. Conjugated linoleic acid as anticancer nutrients: studies in vivo and cel lular mechanisms. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2. pp:267-281. AOCS Press. Bartol, F. F., R. M. Roberts, F. W. Bazer G. S. Lewis, J. D. Godkin, and W. W. Thatcher. 1985. Characterization of protei ns produced in vitro by periattachment bovine conceptuses. Biol. Reprod. 32:681-693. Bartolome, J. A., A. Sozzi, J. McHale, K. Sw ift, D. Kelbert, L. F. Archbald, and W. W. Thatcher. 2005. Resynchronization of ovulation and timed insemination in lactating dairy cows III: administ ration of GnRH 23 days post AI and ultrasonography for nonpregnancy diagnos is on day 30. Theriogenology 63:16431658. Bauman, D. E. 1992. Bovine somatotropin: review of an emergi ng animal technology. J. Dairy Sci. 75:3432-3451. Bauman, D. E. 1999. Bovine somatotropin and lactation: from basic science to commercial application. Dome st. Anim. Endocrinol. 17:101-16. Bauman, D. E., L. H. Baumgard, B. A. Corl, and J. M. Griinari. 1999a. Biosynthesis of conjugated linoleic acid in ruminants. Proceedings of the American Society of Animal Science. Bauman, D. E., B. A. Corl, L. H. Baumga rd, and J. M. Griinari. 2001. Conjugated linoleic acid (CLA) and the dairy cow. Pages 221-250 in Recent Advances in Animal Nutrition. P. C. Garnsworthy and J. Wiseman, ed. Nottingham Univ. Press, Nottingham, U. K.

PAGE 279

257 Bauman, D. E., B. A. Corl, and D. G. Pete rson. 2003. The biology of conjugated linoleic acids in ruminants. Pages 146-173 in A dvances in Conjugated Linoleic Acid Research, Volume 2. Sebedio, J.-L., W. W. Christie, and R. O. Adlof, ed., AOCS Press, Champaign, IL. Bauman, D. E., and W. B. Currie. 1980. Pa rtitioning of nutrients during pregnancy and lactation: a review of mechanisms invol ving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-1529. Bauman, D. E., and C. L. Davis. 1974. Biosynthesis of milk fat. Pages 31-75 in Lactation: A Comprehensive Treatise. Vol. 2. B. L. Larson and V. R. Smith, eds. Academic Press, New York. Bauman, D. E., M. J. Degeeter, C. J. Peel, G. M. Lanza, R. C. Gorewit, and R. W. Hammond. 1982. Effect of recombinantly derived bovine growth hormone (bGH) on lactational performance of high yielding dairy cows. J. Dairy Sci. 65(Suppl.1):121. (Abstr.) Bauman, D. E., P. J. Eppard, M. J. DeGeeter, and G. M. Lanza. 1985. Responses of high-producing dairy cows to long-term tr eatment with pituitary somatotropin and recombinant somatotropin. J. Dairy. Sci. 68:1352-1362. Bauman, D. E., R. W. Everett, W. H. Weiland, and R. J. Collier. 1999b. Production responses to bovine somatotropin in northeas t dairy herds. J. Dairy Sci. 82:2564 2573. Bauman, D. E. and J. M. Griinari. 2003. Nutr itional regulation of milk fat synthesis. Annu. Rev. Nutr. 23:203-227. Baumann, G. 1991. Growth hormone heteroge neity: genes, isohormones, variants, and binding proteins. Endocrine Rev. 12:424-449. Baumgard, L. H., B. A. Corl, D. A. Dwyer, A. Saebo, and D. E. Bauman. 2000. Identification of the conjugated linoleic acid isomer that inhibits milk fat synthesis. Am. J. Physiol. 278:R179-184. Baumgard, L. H., E. Matitashvili, B. A. Corl, D. A. Dwyer, and D. E. Bauman. 2002. Trans-10, cis-12 conjugated linoleic acid decreases lipog enic rates and expression of genes involved in milk lipid synthesi s in dairy cows. J. Dairy Sci. 85:21552163. Baumrucker, C. C., and B. H. Stemberger. 1989. Insulin and insulin -like growth factor-I stimulate DNA synthesis in bovine mammary tissue in vitro. J. Anim. Sci. 67:3503. Baxter, R. C., J. M. Bryson, and J. R. Turtle 1980. Somatogenic receptors of rat liver: regulation by insulin. Endocrinology 107:1176-1181.

PAGE 280

258 Beal, W. E., R. E. Short, R. B. Staigmiller, R. A. Bellows, C. C. Kaltenbach, and T. G. Dunn. 1978. Influence of dietary energy intake on bovine pituitary and luteal function. J. Anim. Sci. 46:181-188. Beam, S. W., and W. R. Butler. 1994. O vulatory follicle development during the first follicular wave postpartum in cows differing in energy balance. J. Anim. Sci. 72(Suppl.1):77. (Abstr.) Beam, S. W., and W. R. Butle r. 1997. Energy balance and ovarian follicle development prior to the first ovulation postpartum in dairy cows receiving three levels of dietary fat. Biol Reprod. 56:133-142. Beam, S. W., and W. R. Butle r. 1998. Energy balance, me tabolic hormones, and early postpartum follicular development in dairy cows fed prilled lipid. J. Dairy Sci. 81:121-131. Beam, S. W., and W. R. Butler. 1999. Effects of energy balance on follicular development and first ovulation in post partum dairy cows. J. Reprod. Fertil. 54:411-424. Beaudeau, F., H. Seegers, V. Ducrocq, C. F ourichon, and N. Bareille. 2000. Effect of health disorders on culling in dairy cows : a review and a critical discussion. Annales de Zootechnie, 49:293. Beaulieu, A. D., J. K. Drackley, and N. R. Merchen. 2002. Concentrations of conjugated linoleic acid (cis-9, trans-11-octadecadienoi c acid) are not increased in tissue lipids of cattle fed a high-concentrate diet supplem ented with soybean oil. J. Anim. Sci. 80:847-861. Beede, D. K., and R. J. Collier. 1986. Potential nutritional strategies for intensively managed cattle during heat stress. J. Anim. Sci. 62:543-554. Bell, A. W. 1995. Regulation of organic nut rient metabolism during transition from late pregnancy to early lactati on. J. Anim. Sci. 73:2804-2819. Bellows, R. A. 1999. Some effects of feeding supplemental fat to beef cattle. Proc. Range Cow Symp. XVI. Greeley, CO. C oop. Ext. Serv. of CO, SD, WY, and NE. Belury, M. A., 2003. Conjugated linoleic acids in type 2 diabetes mellitus: implications and potential mechanisms. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Resear ch, Vol. 2. pp:302-315. AOCS Press. Berger, J., and D. E. Moller. 2002. The mechanism of action of PPARs. Ann. Rev. Med. 53:409-435. Bichell, D. P., K. Kikuchi, and P. Rotwei n. 1992. Growth hormone rapidly activates insulin-like growth factor I gene transcription in vivo. Mol. Endocrinol. 6:18991908.

PAGE 281

259 Biggers, B. G., R. D. Geisert, R. P. Wette mann, and D. S. Buchanan. 1987. Effect of heat stress on early embryonic developmen t in the beef cow. J. Anim. Sci. 64:1512-1518. Bilby, C. R., J. F. Bader, B. E. Salfen, R. S. Youngquist, C. N. Murphy, H. A. Garverick, B. A. Crooker, and M. C. Lucy. 1999. Plas ma GH, IGF-I, and conception rate in cattle treated with low doses of recomb inant bovine GH. Theriogenology 51:12851296. Binelli, M., P. Subramanian, T. Diaz, G. A. Johnson, T. R. Hansen, L. Badinga, and W. W. Thatcher. 2001a. Bovine interferontau stimulates the Janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol. Reprod. 64:654-665. Binelli, M., W. W. Thatcher, R. Mattos, and P. S. Baruselli. 2001b. Antiluteolytic strategies to improve fertility in cattle. Theriogenology 56:1451-1463. Binelli, M., W. K. Vanderkooi, L. T. Chapi n, M. J. Vandehaar, J. D. Turner, W. M. Moseley, and H. A. Tucher. 1995. Co mparison of growth hormone-releasing factor and somatotropin: body growth and la ctation of primiparous cows. J. Dairy Sci. 78:2129-2139. Blondin, P., K. Coenen, L. A. Guilbault, and M. A. Sirard. 1997. In vitro production of bovine embryos: developmental competen ce is acquired before maturation. Theriogenology 47:1061-1075. Boken, S. L., C. R. Staples, L. E. Sollenberger T. C. Jenkins, and W. W. Thatcher. 2005. Effect of grazing and fat supplementa tion on production and reproduction of Holstein cows. J. Dairy Sci. (in press) Boland, M. P., P. Lonergan, and OCallagha n. 2001. Effect of nutrition on endocrine parameters, ovarian physiology, and oocyte and embryo development. Theriogenology 55:1323-1340. Bols, P. E. J., M. T. Ysebaert, A. Lein, M. Coryn, A. Van Soom, and A. de Kruif. 1998. Effects of long-term treatment with bovine somatotropin on follicular dynamics and subsequent oocyte and blastocy sts yield in an OPU-IVF program. Theriogenology 49:983-995. Boos, A. 1998. Immunohistoc hemical assessment of prostagl andin H-synthase in bovine endometrial biopsy samples collected thr oughout the estrous cycle. Anim. Reprod. Sci. 51:261-273. Boos, A., J. Kohtes, A. Stelljes, H. Zerbe, and H. H. Thole. 2000. Immunohistochemical assessment of progesterone, oestrogen and glucocorticoid receptors in bovine placentomes during pregnancy, induced partur ition, and after birt h with or without retention of fetal membranes. J. Reprod. Fertil. 120:351-360.

PAGE 282

260 Bradford, M. M. 1976. A rapid and sens itive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. Bradley, R. 2000. 1000 years of clim ate change. Science 288:1353-1355. Braissant, O., F. Foufelle, and C. Scotto. 1996. Differential expr ession of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and gamma in the adult ra t. Endocrinology 137:354-366. Braulke, T., S. Tippmer, E. Neher, and K. von Figura. 1989. Regul ation of the mannose6-phosphate/IGF-II receptor expression at the cell surface by mannose 6-phosphate, insulin-like growth factor s and epidermal growth factor. J. Embo. 8:681-686. Bremmer, D. R., L. D. Ruppert, J. H. Clar k, and J. K. Drackley. 1998. Effects of chain length and unsaturation of fatty acid mixt ures infused into the abomasums of lactating dairy cows. J. Dairy Sci. 81:176-188. Bruckental, I., D. Dori, M. Ka im, H. Lehrer, and Y. Folma n. 1989. Effects of source and level of protein on milk yield and repr oductive performance of high-producing primiparous and multiparous dairy cows. Anim. Prod. 48:319-329. Burke, J. M., C. R. Staples, C. A. Risco, R. L. De La Sota, and W. W. Thatcher. 1996. Effect of ruminant grade menhaden fi sh meal on reproduc tive and productive performance of lactating dairy cows. J. Dairy Sci. 80:3386-3398. Burns, P. D., T. E. Engle, M. A. Harris, R. M. Enns, and J. C. Whittier. 2003. Effect of fish meal supplementation on plasma and endometrial fatty acid composition in nonlactating beef cows. J. Anim. Sci. 81:2840-2846. Burton, J. H., G. K. MacLeod, B. W. McBride, J. L. Burton, K. Bateman, I. McMillan, and R. G. Eggert. 1990. Overall efficacy of chronically administered recombinant bovine somatotropin to l actating dairy cows. J. Dairy Sci. 73:2157-2167. Burton, J. L., B. W. McBride, E. Block, D. R. Glimm, and J. J. Kennelly. 1994. A review of bovine growth hormone. Can. J. Anim. Sci. 74:167-201. Butler, W. R. 1998. Review: effect of protein nutrition on ovarian and uterine physiology in dairy cattle. J. Dairy Sci. 81:2533-2539. Butler, W. R. 2000. Nutritional interactio ns with reproductive performance in dairy cattle. Anim. Reprod. Sci. 60-61:449-457. Butler, W. R., J. J. Calaman, and S. W. Be am. 1996. Plasma and milk urea nitrogen in relation to pregnancy rate in lactatin g dairy cattle. J. Anim. Sci. 74:858-865. Butler, W. R., and R. D. Smith. 1989. Inte rrelationships between energy balance and postpartum reproductive function in dair y cattle. J. Dairy Sci. 72: 167-178.

PAGE 283

261 Butterwick, R. F., P. Rowlinson, T. E. C. Weeks, D. S. Parker, and D. G. Armstrong. 1998. The effect of long-term daily admi nistration of bovine somatotropin on the performance of dairy heifers during th eir first lactation. Anim. Prod. 46:483 (Abstr.) Calder, P. C., P. Yaqoob, F. Thies, F. A. Wallace, and E. A. Miles. 2002. Fatty acids and lymphocyte functions. Brit. J. Nutr. 87:S31-S48. Capuco, A. V., D. L. Wood, R. Baldwin, K. Mcleod, and M. J. Paape. 2001. Mammary cell number, proliferation, and apoptosis dur ing a bovine lactation: relation to milk production and effect of bST. J. Dairy Sci. 84:2177-2187. Carroll, D. J., F. R. Hossain, and M. R. Kelle r. 1994. Effect of supplemental fish meal on the lactation and reproductive performan ce of dairy cows. J. Dairy Sci. 77:3058-3072. Carter-Su, C., A. P. J. King, L. S. Smit, J. A. Vanderkuur, L. S. Argetsinger, G. S. Campbell, and W. Huo. 1997. Molecular m echanisms of growth hormone action. J. Anim. Sci. 75:1-10. Carter-Su, C., J. Schwartz, and L. S. Sm it. 1996. Molecular mechanism of growth hormone action. Annu. Rev. Physiol. 58:187-207. Casida, L. E. 1961. Present status of the repeat-breeder cow problem. J. Dairy Sci. 44:2323-2329. Cavestany, D., A. B. El-Whishy, and R. H. Foot. 1985. Effect of season and high environmental temperature on fertility of Holstein cattle. J. Dairy Sci. 68:1471 1478. Cerri, R. L. A., R. G. S. Bruno, R. C. Chebel K. N. Galvao, H. Rutgliano, S. O. Juchem, W. W. Thatcher, D. Luchini, and J. E. P. Santos. 2004. Effect of fat sources differing in fatty acid profile on fertiliza tion rate and embryo quality in lactating dairy cows. J. Dairy Sci. 87(Suppl. 1):310. (Abstr.) Chakravorty, A., M. I. Joslyn, and J. S. Da vis. 1993. Characterization of insulin and insulin-like growth factor-I actions in th e bovine luteal cell: re gulation of receptor kinase activity, phosphatidylinositol-3-kinase and deoxyribonucleic acid synthesis. Endocrinology 118:888-890. Charpigny, G., P. Reinaud, J. P. Tamby, C. Creminon, and M. Guillomot. 1997b. Cyclooxygenase-2 unlike cycl ooxygenase-1 is highly expr essed in ovine embryos during the implantation peri od. Biol. Reprod. 57:1032-1040. Charpigny, G., P. Reinaud, J. P. Tamby, C. Creminon, J. Martal, J. Maclouf, and M. Guillomot. 1997a. Expression of cyclooxyge nase-1 and -2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 138:2163-2171.

PAGE 284

262 Chase, Jr., C. C., C. J. Kirby, A. C. Hammond, T. A. Olson, and M. C. Lucy. 1998. Patterns of ovarian growth and developm ent in cattle with a growth hormone receptor deficiency. J. Anim. Sci. 76:212-219. Chi, M. Y., A. L. Schlein, and K. H. Moley. 2000. High insulin-like growth factor I (IGF-1) and insulin concentr ations trigger apoptosis in the mouse blastocyst via down-regulation of the IGF-1 receptor. Endocrinology 141:4784-4792. Chillard, Y. 1989. Long-term effects of recombinant bovine somatotropin (rBST) on dairy cow performances: a review. In: Use of Somatotropin in Livestock Production, edited by K. Sejrsen, M. Vesterga ard, and A. Neimann-Sorensen. New York: Elsevier Applied Science. p. 61-87. Chilliard, Y., J. M. Chardigny, J. Chabrot, A. Ollier, J. L. Sebedio, and M. Doreau. 1999. Effects of ruminal or postruminal fish o il supply on conjugated linoleic acid (CLA) content of cows milk fat. Proc. Nutr. Soc. 58:70A. (Abstr.) Chin, S. F., J. M. Storkson, K. J. Albri ght, M. E. Cook, and M. W. Pariza. 1994. Conjugated linoleic acid is a growth factor for rats as shown by enhanced weight gain and improved feed e fficiency. J. Nutr. 124:2344. Chinetti, G., S. Griglio, and M. Antonucci. 1998. Activation of peroxisome proliferatoractivated receptors alpha and gamma induces apoptosis of human monocytederived macrophages. J. Biol. Chem. 273:25573-25580. Choi, B.R., and D. L. Palmquist. 1996. High fat diets increase plasma cholecystokinin and pancreatic polypeptide, and decrease plas ma insulin and feed intake in lactating cows. J. Nutr. 126:2913-2919. Chouinard, P. Y., L. Corneau, M. L. Kelly, J. M. Griinari, and D. E. Bauman. 1998. Effect of dietary manipulation on milk conj ugated linoleic acids in dairy cows. J. Dairy Sci. 81(Suppl.1):233. (Abstr.) Chouinard, P. Y., V. Girard, and G. J. Briss on. 1997. Lactational response of cows to different concentrations of calcium salts of canola oil fatty acids with or without bicarbonates. J. Dairy Sci. 80:1185-1193. Chow, J. C., P. R. Ling, Z. Q. L. Laviola, A. Ciccarone, B. R. Bistrian, and R. J. Smith. 1996. Growth hormone stimulates tyrosi ne phosphorylation of JAK2 and STAT5, but not insulin receptor substr ate-1 or SHC proteins in liv er and skeletal muscle of normal rats in vivo Endocrinology 137:2880-2886. Clarke, S. D. 2001. Polyunsaturated fatty acid regulation of gene transcription: a molecular mechanism to improve the me tabolic syndrome. J. Nutr. 131:11291132. Cohick, W. S. 1998. Role of the insulin-like growth factors and their binding proteins in lactation. J. Dair y Sci. 81:1769-1777.

PAGE 285

263 Cole, W. J., P. J. Eppard, B. G. Boysen, K. S. Madsen, R. H. Sorbet, M. A. Miller, R. L. Hintz, T. C. White, W. E. Ribelin, B. G. Hammond, R. J. Collier, and G. M. Lanza. 1992. Response of dairy cows to high doses of a sustained-release bovine somatotropin administered during two lact ations. 2. health and reproduction. J. Dairy Sci. 75:111-123. Cole, W. J., K. S. Madsen, R. L. Hintz, and R. J. Collier. 1991. Effect of recombinantlyderived bovine somatotropin on reproduc tive performance of dairy cattle. Theriogenology 36:573-595. Cook, M. E., C. C. Miller, Y. Park, and M. W. Pariza. 1993. Immune modulation by altered nutrient metabolism: nutritional control of immune-induced growth depression. Poult. Sci. 72:1301. Cook, H. W. Fatty acid desaturation and chain elongation in eukaryotes. In Biochemistry of lipids, lipoproteins and membranes. 1996. pp. 129-152. Ed. Vance and J. Vance. Elsevier, Amsterdam. Corl, B. A., L. H. Baumgard, D. A. Dwyer, J. M. Griinari, B. S. Phillips, and D. E. Bauman. 2001. The role of delta (9)-desatu rase in the production of cis-9, trans-11 CLA. J. Nutr. Biochem. 12:622-630. Corton, J. C., L. Q. Fan, S. Brown, S. P. Anderson, C. Bocos, R. C. Cattley, A. Mode, and J. A. Gustafsson. 1998. Down-regulation of cytochrome P450 2C family members and positive acute-phase response gene expression by peroxisome proliferator chemicals. Mol. Pharmacol. 54:463-473. Cullens, F. M., C. R. Staples, T. R. Bilby, F. Silvestre, J. Bartolome, A. Sozzi, L. Badinga, W. W. Thatcher, and J. D. Arthington. 2004. Effect of timing of initiation of fat supplementation on milk production, plasma hormones and metabolites, and conception rates of Holste in cows in summer. J. Dairy Sci. 86(Suppl.1):308. (Abstr.) Cunningham, B. C., and J. A. Wells. 1989. High-resolution epitope mapping of hGHreceptor interactions by alanine-scanning mutagenesis. Science 244:1081-1084. Cuttler, L. 1996. The regulation of grow th hormone secretion. Endocrinol. Metab. Clinics of North America 25:541-571. DErcole, A. J., A. D. Stiles, and L. E. Underwood. 1984. Tissue concentrations of somatomedin C: further sites of synthesi s and paracrine or autocrine evidence for multiple mechanisms of action. Proc. Natl. Acad. Sci. U. S. A. 81:935-939. Danet-Desnoyers, G., C. Wetzel s, and W. W. Thatcher. 199 4. Natural and recombinant bovine interferons regulate basal an d oxytocin-induced secretion of PGF2 and PGE2 by endometrial epithelial and stroma l cells. Reprod. Fertil. Dev. 6:193-202.

PAGE 286

264 Daniel, Z. C., S. E. Richards, A. M. Sa lter, and P. J. Buttery. 2004. Insulin and dexamethasone regulate stearoyl-CoA desa turase mRNA levels and fatty acid synthesis in ovine adipose tissue explants. J. Anim. Sci. 82:231-237. Darnell Jr., J. E. 1997. STATs a nd gene regulation. Science 277:1630-1635. Darwash, A.O. and G. E. Lamming. 1998. The importance of milk progesterone concentrations during early pregna ncy in the cow. J. Anim. Breed 2:41-43. Daughaday, W. H., and P. Rotwein. 1989. Insuli n-like growth factors I and II. Peptide messenger ribonucleic acid and gene structur es, serum, and tissue concentrations. Endocr. Rev. 10:68-91. Dawson, R. M. C., N. Hemington, and G. P. Hazlewood. 1977. On the role of higher plant and microbial lipases in the ruminal hydrolysis of grass lipids. Br. J. Nutr. 38:225-232. Dawson, R. M. C., and P. Kemp. 1970. Biohydr ogenation of dietary fats in ruminants. In A. T. Phillipson (Ed.) Physiology of Di gestion and Metabolism in the Ruminant. Pp 504-518. Oriel Press, Newcastle upon Tyne, U. K. De la Sota, R. L., M. C. Lucy, C. R. Stap les, and W. W. Thatch er. 1993. Effects of recombinant bovine somatotropin (sometri bove) on ovarian function in lactating and nonlactating dairy cows. J. Dairy Sci. 76:1002-1013. De la Sota, R. L., F. A. Simmen, T. Diaz, and W. W. Thatcher. 1996. Insulin-like growth factor system in bovine first-wave dominant and subordinate follicles. Biol. Reprod. 55:803-812. DeJarnette, J. M., and C. E. Marshall. 2003. Effects of pre-synchronization using combinations PGF (2alpha) and (or) GnRH on pregnancy rates of Ovsynchand Cosynch-treated lactating Holstein cows. Anim. Reprod. Sci. 77:51-60. DeLany, J. P., F. Blohm, A. A. Truett, J. A. Scimeca, and D. B. West. 1999. Conjugated linoleic acid rapidly reduces body fat c ontent in mice withou t affecting energy intake. Am. J. Physiol. 276(Suppl.):R1172R1179. Delarue, J., C. LeFoll, C. Corporeau, and D. Lucas. 2004. N-3 long chain polyunsaturated fatty acids: a nutritional tool to pr event insulin resistance associated to type 2 diabetes a nd obesity? Reprod. Nutr. Dev. 44:289-299. Dematawewa, C. M., and P. J. Berger. 1998. Genetic and phenotypic parameters for 305-day yield, fertility, and survival in Holsteins. J. Dairy Sci. 81:2700-2709. Desvergne, B., and W. Wahli. 1999. Cont rol of metabolism by PPARs. Endocr. Rev. 20:649.

PAGE 287

265 Dewhurst, R. J., D. R. Davies, and R. J. Merry. 2000. Microbial pr otein supply from the rumen. Anim. Feed Sci. Technol. 85:1-21. Dey, B. R., K. Frick, W. Lopaczynski, S. P. Nissley, and R. W. Furlanetto. 1996. Evidence for the direct interaction of the in sulin-like growth fact or I receptor with IRS-1, Shc, and Grb10. Mol. Endocrinol. 10:631-641. Diskin, M. G., and J. M. Sreenan. 1980. Fe rtilization and embryonic mortality rates in beef heifers after artif icial insemination. J. Reprod. Fertil. 59:463-468. Dobson, H., J. E. Tebble, R. F. Smith, and W. R. Ward. 2001. Is stress really all that important? Theriogenology 55:65. Donaldson, L. and W. Hansel. 1965. Histol ogical study of bovine corpora lutea. J. Dairy Sci. 48:905-909. Donovan, D. C., D. J. Schingoethe, R. J. Baer, J. Ryali, A. R. Hippen, and S. T. Franklin. 2000. Influence of dietary fish oil on c onjugated linoleic acid a nd other fatty acids in milk fat from lactating dair y cows. J. Dairy Sci. 83:2620-2628. Downer, J. V., D. L. Patterson, D. W. Rock, W. V. Chalupa, R. M. Cleale, J. L. Firkins, G. L. Lynch, J. H. Clark, B. O. Brodie, B. F. Jenny, and R. DeGregorio. 1993. Dose titration of sustained-release reco mbinant bovine somatotropin in lactating dairy cows. J. Dairy Sci. 75:111-123. Dransfield, M. B., R. L. Nebel, R. E. Pearson, and L. D. Warnick. 1998. Timing of insemination for dairy cows identified in estrus by a radiotelemetric estrus detection system. J. Dairy Sci. 81:1874-1882. Drew, B. 1999. Practical nutri tion and management of heif ers and high yielding dairy cows for optimal fertility. Cattle Practice 7:243-248. Drost, M., J. D. Ambrose, M. J. Thatcher, C. K. Cantrell, K. E. Wolsdorf, J. F. Hasler, and W. W. Thatcher. 1999. Conception rates after artificial insemination or embryo transfer in lactating dairy cows during summer in Florida. Theriogenology 52:1161. Dubois, D. H., and F. W. Bazer. 1991. Effect of porcine conceptus secretory proteins on in vitro secretion of prostaglandin-F2 and -E2 from luminal and myometrial surfaces of endometrium from cyclic and pseudopregnant gilts. Prostaglandins 41:283-301. Dunne, L. D., M. G. Diskin, and J. M. Sr eenan. 2000. Embryo and fetal loss in beef heifers between day 14 of gestation a nd full term. Anim. Reprod. Sci. 58:39-44.

PAGE 288

266 Echternkamp, S. E., K. E. Gregory, G. E. Di ckerson, L. V. Cundiff, R. M. Koch, and L. D. VanVeleck. 1990. Twinning in cattle: genetic and environmental effects on ovulation rate in pubertal heifers and postp artum cows and the effects of ovulation rate on embryonic survival. J. Anim. Sci. 68:1877-1888. Eckery, D. C., C. L. Moeller, T. M. Nett, and H. R. Sawyer. 1997. Localization and quantification of binding sites for folli cle-stimulating hormone, luteinizing hormone, growth hormone, and insulin-like growth factor I in sheep ovarian follicles. Biol. Reprod. 57:507-513. Edwards, J. L., A. D. Ealy, V. H. Monterroso, and P. J. Hansen. 1997. Ontogeny of temperature-regulated heat shock protei n 70 synthesis in preimplantation bovine embryos. Mol. Reprod. Dev. 48:25-33. Edwards, J. L., and P. J. Hansen. 1997. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol. Reprod. Dev. 46:138-145. Elsasser, T. H., T. S. Rumsey, and A. C. Hammond. 1989. Influence of diet on basal and growth hormone-stimulated plas ma concentrations of IGF-I in beef cattle. J. Anim. Sci. 67:128-141. Elwood, P. C. 1991. Epidemiological studies of cardiovascular dis eases. Progress report VII Llandough Hospital, Penarth, South Glam, Wales CF6 1XX. Emond V., L. A. MacLaren, S. Kimmins, J. A. Arosh, M. A. Fortier, and R. D. Lambert. 2004. Expression of cyclooxygenase-2 and granulocyte-macrophage colonystimulating factor in the endometrial ep ithelium of the cow is up-regulated during early pregnancy and in response to in trauterine infusions of interferon. Biol. Reprod. 70:54-64. Enser, M., N. D. Scollan, N. J. Choi, E. Kurt K. Hallet, and J. D. Wood. 1999. Effect of dietary lipid on the content of conjugated linoleic acid (CLA) in beef muscle. J. Anim. Sci. 69:143-146. Erickson, P. J., M. R. Murphy, and J. H. Clark. 1992. Supplementation of dairy cow diets with calcium salts of long-chain fa tty acids and nicoti nic acid in early lactation. J. Dair y Sci. 75:1078-1089. Espey, L. L. 1980. Ovulation as an inflamma tory reaction--a hypothe sis. Biol. Reprod. 22:73-106. Esteban, E., P. H. Kass, L. D. Weaver, J. D. Rowe, C. A. Holmberg, C. E. Franti, and H. F. Troutt. 1994. Reproductive performan ce in high producing dairy cows treated with recombinant bovine somatotr opin. J. Dairy Sci. 77:3371-3381. Etherton, T. D., and D. E. Bauman. 1998. Biology of somatotropin in growth and lactation of domestic anim als. Physiol. Rev. 78:745-761.

PAGE 289

267 Familletti, P. C., S. Rubinstein, and S. Pets ka. 1981. A convenient and rapid cytopathic effect inhibition assay for inte rferon. Methods Enzymol. 78:387-394. Farin, C. E., K. Imakawa, T. R. Hansen, J. J. McDonell, C. N. Murphy, P. W. Farin, and R. M. Roberts. 1990. Expression of tr ophoblastic interferon genes in sheep and cattle. Biol. Reprod. 43:210-218. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiol abeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 32:6-13. Ferguson, J. D., D. Sklan, W. V. Chalupa, and D. S. Kronfeld. 1990. Effects of hard fats on in vitro and in vivo rumen fermenta tion, milk production, and reproduction in dairy cows. J. Dairy Sci. 73:2864-2879. Filley, S. J., H. A. Turner, and F. Stormsha k. 2000. Plasma fatty acids, prostaglandin F2alpha metabolite, and reproductive res ponse in postpartum heifers fed rumen bypass. fat.J. Anim. Sci. 78:139-44. Firth, S. M., and R. C. Baxter. 2002. Cellula r actions of the insulin -like growth factor binding proteins. Endocr. Rev. 23:824-854. Flint, A.P.F., H. J. Stewart, G .E. Lamming, and J. H. Payne. 1992. Role of the oxytocin receptor in the choice between cyclicity a nd gestation in ruminants. J. Reprod. Fertil. Suppl. 45:53-58. Foncea, R., M. Anderson, A. Ketterman, V. Blakesley, M. Sapag-Hagar, P. H. Sugden, D. LeRoith, and S. Lavandero. 1997. Insulin -like growth factor-I rapidly activates multiple signal transduction pathways in cu ltured rat cardiac myocytes. J. Biol. Chem. 272:19115-19124. Formigoni, A., and E. Trevisi. 2003. Transition cow: interaction with fertility. Vet. Res. Comm. 27:143-152. Fouladi-Nashta, A. A., C. G. Gutierrez, H. F. Russell, P. C. Garnsworthy, and R. Webb. 2004. Effects of dietary fatty acids on ooc yte quality and development in lactating dairy cows. Biol. Reprod. Special Issue 107. (Abstr.) French, P., E. G. ORiordan, F. J. Monaha n, P. J. Caffrey, and A. P. Moloney. 2003. Fatty acid composition of intramuscular tr iacylglycerols of steers fed autumn grass and concentrates. Live st. Prod. Sci. 81:307-317. Frick, F., D. Linden, C. Ameen, S. Eden, A. Mode, and J. Oscarsson. 2002. Interaction between growth hormone and insulin in th e regulation of lipoprotein metabolism in the rat. Am. J. Physiol. Endocrinol. Metab. 283:E1023-E1031. Fuchs, A. R., O. Behrens, H. Helmer, C-H. Liu, C. M. Barros, and M. J. Fields. 1990. Oxytocin and vasopressin receptors in bovine endometrium and myometrium during the estrous cycle and early pregnancy. Endocrinology 127:629-636.

PAGE 290

268 Fuquay, J. W. 1981. Heat stress as it aff ects animal production. J. Anim. Sci. 52:164174. Gallo, G. F., and E. Block. 1991. Effect s of recombinant bovine somatotropin on hypophyseal and ovarian functions of lactati ng dairy cows. Can. J. Anim. Sci. 71:343-353. Garbarino, E. J., J. A. Hernandez, J. K. Shear er, C. A. Risco, and W. W. Thatcher. 2004. Effect of lameness on ovarian activity in pos tpartum Holstein cows. J. Dairy Sci. 87:4123 4131. Garcia-Bojalil, C. M., C. R. Staples, C. A. Risco, J. D. Savio, and W. W. Thatcher. 1998. Protein degradability and calcium salts of long-chain fatty acids in the diets of lactating dairy cows: productive re sponses. J. Dairy Sci. 81:1374-1384. Garnsworthy, P. C. and R. Webb. 1999. The influence of nutrition on fertility in dairy cows. In: P.C. Garnsworthy and J. Wiseman (eds), Recent Advances in Animal Nutrition, 1999, (Nottingham University Press, UK), 39-57. Garret, J. E., R. D. Geisert, M. T. Zavy, and G. L. Morgan. 1998. Evidence for maternal regulation of early conceptus growth and development in beef cattle. J. Reprod. Fertil. 84:437. Geisert, R. D., C.-Y. Lee, F. A. Simmen, T. Za vy, A. E. Fliss, F. W. Bazer, and R. C. M. Simmen. 1991. Expression of messenger RNAs encoding insulin-like growth factor-I, -II, and insulin-like gowth fact or binding protein-2 in bovine endometrium during the estrous cycle and early pregnancy. Biol. Reprod. 45:975-983. Geisert, R. D., G. L. Morgan, E. C. Shor t, and M. T. Zavy. 1992. Endocrine events associated with endometrial function and conceptus development in cattle. Reprod. Fertil. Dev. 4:301. Gillies, G. 1997. Somatostatin: the neuroe ndocrine story. Trends Pharmacol. Sci. 18:87-95. Ginther, O. J., L. Knopf, and J. P. Kastelic 1989. Temporal associations among ovarian events in cattle during oestr ous cycles with two or th ree follicular waves. J. Reprod. Fertil. 87:223. Giudice, L. C. 1992. Insulin-like growth f actors and ovarian follicular development. Endocrine Rev. 13:641-669. Gluckman, P. D. 1995. The endocrine regulatio n of fetal growth in late gestation: the role of insulin-like grow th factors. J. Clin Endocrinol. Metab. 80:1047-1050. Gluckman, P. D., B. H. Brei er, and S. R. Davis. 1987. Physiology of the somatotropic axis with particular reference to th e ruminant. J. Dairy Sci. 70:442-466.

PAGE 291

269 Gong, J. G., G. Baxter, T. A. Bramley, a nd R. Webb. 1997. Enhancement of ovarian follicle development in heifers by treatment with recombinant bovine somatotropin: a dose-response study. J. Reprod. Fertil. 110:91-97. Gong, J. G., T. Bramley, and R. Webb. 1991. The effect of recombinant bovine somatotropin on ovarian function in heifer s: follicular populations and peripheral hormones. Biol. Reprod. 45:941-949. Gong, J. G., T. A. Bramley, and R. Webb. 1993. The effect of recombinant bovine somatotropin on ovarian follicular growth a nd development in heifers. J. Reprod. Fertil. 97:247-254. Goodhand, K. L., R. G. Watt, M. E. Staines, J. S. M. Hutchinson, and P. J. Broadbent. 1999. In vivo oocyte recovery and in v itro embryo production from bovine donors aspirated at different fr equencies or following FSH treatment. Theriogenology 51:951. Griinari, J. M., and D. E. Bauman. 1999. Bi osynthesis of conjugated linoleic acid and its incorpotation into meat and milk in ruminants. In M. P. Yurawecz, M. M. Mossoba, J. K. G. Kramer, M. W. Pari za and G. J. Nelson (ed) Advances in Conjugated Linoleic Acid Researc h. Vol. 1., pp: 180-200. AOCS Press, Champaign, IL. Griinari, J. M., D. A. Dwyer, M. A. McGuire, and D. E. Bauman. 1996. Partially hydrogenated fatty acids and milk fat depr ession. J. Dairy Sci. 79(suppl. 1):177. (Abstr) Griinari, J. M., D. A. Dwyer, M. A. McGuire, D. E. Bauman, D. L. Palmquist, and K. V. Nurmela. 1998. Transoctadecenoic acids a nd milk fat depression in lactating dairy cows. J. Dairy Sci. 81:1251-1261. Grohn, Y. T., and P. J. Rajala-Schultz 2000. Epidemiology of reproductive performance in dairy cows. Anim. Reprod. Sci. 60-61:605-614. Gronowski, A. M., and P. Rotwein. 1995. Ra pid changes in gene expression after in vivo growth hormone treatment Endocrinology 136:4741-4748. Gross, T. S., W. W. Thatcher, P. J. Hans en, and S. D. Helmer. 1988. Presence of an intracellular endometrial inhibitor of prostaglandin synthesis during early pregnancy in the cow. Prostaglandins 35:359-378. Grummer, R. R. 1993. Etiology of lipid-rela ted metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882-3896. Grummer, R. R., and D. J. Carroll. 1991. Effects of dietary fat on metabolic disorders and reproductive performance of dair y cattle. J. Anim. Sci. 69:3838-3852.

PAGE 292

270 Gustafsson, H., and K. Larsson. 1985. Embr yonic mortality in heif ers after artificial insemination and embryo transfer: differen ces between virgin and repeat breeder heifers. Res. Vet. Sci. 39:271-274. Guzeloglu, A., T. R. Bilby, A. Meikle, S. Ka mimura, A. Kowalski, F. Michel, L. A. MacLaren, and W. W. Thatcher. 2004a. Pregnancy and bST in nonlactating dairy cows: II. endometrial gene expression re lated to maintenance of pregnancy. J. Dairy Sci. 87:3268-3279. Guzeloglu, A., F. Michel, and W. W. Thatcher. 2004c. Diffe rential effects of interferontau on the prostaglandin synthetic pathway in bovine endometrial cells treated with phorbol ester. J. Dairy Sci. 87:2032-2041. Guzeloglu, A., P. Subramaniam, F. Michel, and W. W. Thatcher. 2004b. Interferoninduces degradation of prostaglandin H synthase-2 mRNA in bovine endometrial cells through a transcription dependen t mechanism. Biol. Reprod. 71:170-176. Gwazdauskas, F. C., K. W. Kendrick, A. W. Pr yor, and T. L. Bailey. 2000. Impact of follicular aspiration on folliculogenesis as influenced by dietary energy and stage of lactation. J. Dair y Sci. 83:1625-1634. Hanaire-Broutin, H., B. Sallerin-Caute, M. F. P oncet, M. Tauber, R. Bastide, J. J. Chale, R. Rosenfeld, and J. P. Tauber. 1996. E ffect of intraperitone al insulin delivery on growth hormone binding protein, insulin -like growth factor (IGF)-I, and IGFbinding protein-3 in IDDM Diabetologia 39:1498-1504. Hanenberg, E. H. A. T. and A. M. van Wagtendonk-de Leeuw. 1997. Comparison of 3, 4 or 7 day interval between oocyte co llections for in vitro embryo production results. Theriogenology 47(Suppl. 1):158. (Abstr.) Hansen, L. B. 2000. Consequences of sel ection for milk yield from a geneticists viewpoint. J. Dairy Sci. 70:712-715. Hansen, T. R., K. Imakawa, H. G. Polities, K. R. Marotti, R. V. Anthony, and R. M. Roberts. 1988. Interfer on RNA of embryonic origin is expressed transiently during early pregnancy in the ewe. J. Biol. Chem. 263:12801-12804. Hansen, P. J., P. Soto, and R. P. Natzke. 2004. Mastitis and fertility in cattle possible involvement of inflammation or immune ac tivation in embryonic mortality. Am. J. Reprod. Immunol. 51:294-301. Harfoot, C. G., and G. P. Hazlewood. 1988. Lipid metabolism in the rumen. In: P. N. Hobson (Ed.) The Rumen Microbial Ecos ystem. pp 285-322. Elsevier Applied Science Publishers, London. Harrison, J. H., J. P. McNamara, and R. L. Kincaid. 1995. Production responses in lactating dairy cattle fed rations high in fat. J. Dairy Sci. 78:181-193.

PAGE 293

271 Hauser, S. D., M. F. McGrath, R. J. Collier, and G. G. Krivi. 1990. Cloning and in vivo expression of bovine growth hormone receptor mRNA. Mol. Cell. Endocrinol. 72:187-200. Hawkins, D. E., K. D. Niswender, G. M. Oss, C. L. Moeller, K. G. Odde, H. R. Sawyer, and G. D. Niswender. 1995. An increas e in serum lipids incr eases luteal lipid content and alters the disappearance rate of progesterone in cows. J. Anim. Sci. 73:541-545. Heap, D., R. J. Collier, C. K. Boyd, and M. C. Lucy. 1996. Expression of alternate growth hormone receptor messenger RNA in ovary and uterus of cattle. Domest. Anim. Endocrinol. 13:421-430. Hendriksen, P. J. M., W. N. M. Steenweg, J. C. Harkema, J. S. Merton, M. M. Bevers, P. L. A. M. Vos, and S. J. Dieleman. 2004. E ffect of different stages of the follicular wave on in vitro developmental compet ence of bovine oocytes. Theriogenology 61:909-920. Hendriksen, P. J. M., P. L. A. M. Vos, W. N. M. Steenweg, M. M. Bevers, and S. J. Dieleman. 2000. Bovine follicular devel opment and its effect on the in vitro competence of oocytes. Theriogenology 53:11-20. Hightshoe, R. B., R. C. Cochran, L. R. Cora h, G. H. Kiracofe, D. L. Harmon, and R. C. Perry. 1991. Effects of calcium soaps of fatty acids on postpartum reproductive function in beef cows. J. Anim. Sci. 69:4097-4103. Hochi, S., K. Kimura, and A. Hanada. 1999. Effect of linoleic acid-albumin in the culture medium on freezing sensitivity of in vitro-produced bovine morulae. Theriogenology 52:497-504. Holmann, F. J., C. R. Shumway, R. W. Blake, R. B. Schwart, and E. M. Sudweeks. 1984. Economic value of days open for Holste in cows of alternative milk yields with varying calving intervals. J. Dairy Sci. 67:636-643. Homa, S. T. and C. A. Brown. 1992. Cha nges in linoleic acid during follicular development and inhibition of spontaneous breakdown of germinal vesicles in cumulus-free bovine oocytes. J. Reprod. Fertil. 94:153-160. Horseman, N. D., and L. Yu-lee. 1994. Tr anscriptional regulati on by the helix bundle peptide hormones: growth hormone, prol actin, and hematopoietic cytokines. Endocrine Rev. 15:627-649. Housekneckt, K. L., D. L. Campion, D. R. Sar tin, J. L. Kiser, J. B. Rampacek, and H. E. Amos. 1988. Effect of dietary energy s ource and level of se rum growth hormone, insulin-like growth factor-I, growth and body composition in beef heifers. J. Anim. Sci. 66:2916-2923.

PAGE 294

272 Howard, J. J., R. G. Scott, and J. H. Britt. 1990. Associations among progesterone, estradiol-17 and prostaglandin in cattle treated with hCG during diestrus to extend corpus luteum functi on. Prostaglandins 40:51-70. Huang, J. C., J. S. Goldsby, F. Arbab, Z. Melhem, N. Aleksic, and K. K. Wu. 2004. Oviduct prostacyclin functions as a paracrine factor to augment the development of embryos. Hum. Reprod. 19:2907-2912. Huber, J. T., S. Willman, K. Marcus, C. B. Theurer, D. L. Hard, and L. Kung. 1988. Effect of sometribove, USAN (recomb inant methionyl bovine somatotropin) injected in lactating cows at 14-day in tervals on milk yield, milk composition and health. J. Dairy Sci. 71(Suppl.1):207. (Abstr.) Humbel, R. E. 1990. Insulin-like growth f actors I and II. Eur. J. Biochem. 190:445-462. Ing, N. H., T. E. Spencer, and F. W. Bazer. 1996. Estrogen enhances endometrial estrogen receptor gene expression by a posttranscriptional mechanism in the ovariectomized ewe. Biol. Reprod. 54:591-599. Inoue, I., K. Shino, and S. Noji. 1998. Expre ssion of peroxisome proliferator-activated receptor alpha (PPAR ) in primary cultures of human vascular endothelial cells. Biochem. Biophys. Res. Commun. 246:370-374. Inskeep, E. K. 2004. Preovulatory, postovul atory, and postmaternal recognition effects of concentrations of proges terone on embryonic survival in the cow. J. Anim. Sci. 82(E. Suppl.):E24-E39. Ip, C. 1997. Review of the effects of trans fatty acids, oleic aci d, n-3 polyunsaturated fatty acids, and conjugated linoleic acid on mammary carcinogenesis in animals. Am. J. Clin. Nutr. 66:15235. Ip, C., S. Banni, E. Angioni, G. Carta, J. McGinley, H. J. Thompson, D. Barbano, and D. Bauman. 1999. Conjugated linoleic acid-enri ched butter fat alters mammary gland morphogenesis and reduces cancer risk in rats. J. Nutr. 129:2135-2142. Izadyar, F., B. Colenbrander, and M. M. Bevers. 1996. In vitro maturation of bovine oocytes in the presence of growth hor mone accelerates nuclear maturation and promotes subsequent embryonic devel opment. Mol. Reprod. Dev. 45:372-377. Izadyar, F., H. T. A. Van tol, B. Colenbra nder, and M. M. Bevers. 1997. Stimulatory effect of growth hormone on in vitro maturation of bovine oocytes is exerted through cumulus cells and not mediated by IGF-I. Mol. Reprod. Dev. 45:175-180. Izadyar, F., H. T. A. Van tol, W. G. Ha ge, and M. M. Bevers. 2000. Preimplantation bovine embryos express mRNA of growth hormone receptor and respond to growth hormone addition during in vitro deve lopment. Mol. Reprod. Dev. 57:247-255. Jenkins, T. C. 1993. Lipid metabolism in the rumen. J. Dairy Sci. 76:3851-3863.

PAGE 295

273 Jenkins, T. C., and B. F. Jenny. 1989. Effect of hydrogenated fat on feed intake, nutrient digestion, and lactation performance of dairy cows. J. Dairy Sci. 72:2316-2324. Jimenez-Krassel, F., M. Binelli, H. A. Tu cker, and J. J. Ireland. 1999. Effect of long term infusion with recombinant bovine somatotropin on development and function of dominant follicles and corpora lutea in Holstein cows. J. Dairy Sci. 82:19171926. Johnson, G. A., T. E. Spencer, T. R. Hansen, K. J. Austin, R. C. Burghardt, and F. W. Bazer. 1999. Expression of the interfer on-tau inducible ubiquitin cross-reactive protein in the ovine uter us. Biol. Reprod. 61:312-318. Johnson, G. A., M. D. Steward, C. A. Gray, Y. Choi, R. C. Burghardt, L. Y. Yu-Lee, F. W. Bazer, and T. E. Spencer. 2001. Effect s of the estrous cycle, pregnancy, and interferon-tau on 2`, 5`-oligoa denylate synthetase expres sion in the ovine uterus. Biol. Reprod. 64:1392-1399. Jones, D. F., W. P. Weiss, and D. L. Pa lmquist. 2000. Short communication: influence of dietary tallow and fish oil on milk fat composition. J. Dairy Sci. 83:2024-2026. Jones, J. I., and D. R. Clemmons. 1995. Insulin-like grow th factors and their binding proteins: biological actions Endocrine Rev. 16:3-34. Jousan, F. D., and P. J. Hansen. 2004. Insulin -like growth factor-I as a survival factor for the bovine preimplantation embryo e xposed to heat shock. Biol. Reprod. 71:1665-70. Ju, J-C., J. E. Parks, and X. Yang. 1 999. Thermotolerance of IVM-derived bovine oocytes and embryos after short-term heat shock. Mol. Reprod. Dev. 53:336-340. Juchem, S. O., R. L. A. Cerri, R. Bruno, K. N. Galvao, E. W. Lemos, M. Villasenor, A. C. Coscioni, H. M. Rutgliano, W. W. Thatch er, D. Luchini, and J. E. P. Santos. 2004. Effect of feeding Ca salts of palm oil (PO) or a blend of linoleic and monoenoic trans fatty acids (LTFA) on uterine involuti on and reproductive performance in Holstein cows. J. Dairy Sci. 87(Suppl.1):310. (Abstr.) Juengel, J. L., and G. D. Niswender. 1999. Molecular regulation of luteal progesterone synthesis in domestic ruminants. J. Reprod. Fertil. Suppl. 54:193-205. Jump, D. B., and S. D. Clarke. 1999. Regul ation of gene expression by dietary fat. Annu. Rev. Nutr. 19:63-90. Kaneda, T. 1991. Isoand anteiso-fatty ac ids in bacteria: biosynthesis, function, and taxonomic significance. Microbiol. Rev. 55:288-302.

PAGE 296

274 Kamegai, J., H. Tamura, T. Shimizu, S. Ishii, H. Sugihara, and I. Wakabayashi. 2001. Chronic central infusion of ghrelin in creases hypothalamic neuropeptide Y and Agouti-related protein mRNA levels and body weight in rats. Diabetes 50: 2438 2443. Kassa, T., J. D. Ambrose, A. L. Adams, C. Risco, C. R. Staples, M. J. Thatcher, H. H. Van Horn, A. Garcia, H. H. Head, and W. W. Thatcher. 2002. Effects of whole cottonseed diet and recombinant bovine somatotropin on ovarian follicles in lactating dairy cows. J. Dairy Sci. 85:2823-2830. Katagiri, S., Y. S. Moon, and B. H. Yuen. 1996. The role for the uterine insulin-like growth factor I in early embryonic loss after superovulation in the rat. Fertil. Steril. 65:426:436. Katagiri, S., Y. S. Moon, and B. H. Yue n. 1997. A somatostatin analogue decreases embryonic loss following superovulation in rats by normalizing insulin-like growth factor-I action in the ut erus. Hum. Reprod. 12:671-676. Kaye, P. L. 1997. Preimplantation growth factor physiology. Rev. Reprod. 2:121-127. Kaye, P. L., K. L. Bell, L. F. S. Beebe, G. F. Dunglison, H. G. Gardner, and M. B. Harvey. 1992. Insulin and insulin-like gr owth factors (IGFs) in preimplantation development. Reprod. Fertil. Dev. 4:373-386. Keady, T. W., C. S. Mayne, and D. A. Fitzpa trick. 2000. Effects of supplementation of dairy cattle with fish oil on silage intake milk yield and milk composition. J. Dairy Res. 67:137-153. Keeney, M. 1970. Lipid metabolism in the rumen. In: A. T. Phillipson (Ed.) Physiology of Digestion and Metabolism in the Rumi nant. Pp 489-503. Oriel Press, Newcastle upon Tyne, U. K. Keeney, M., I. Katz, and M. J. Allison. 1962. On the probable origin of some milk fat acids in rumen microbial lipids. J. Am. Oil Chem. Soc. 39:198-201. Kelly, M. L., J. R. Berry, D. A. Dwyer, J. M. Griinari, P. Y. Chouinard, M. E. Van Amburgh, and D. E. Bauman. 1988. Dietar y fatty acid sources affect conjugated linoleic acid concentrations in milk fro m lactating dairy cows. J. Nutr. 128:881885. Kelly, M. L., E. S. Kolver, D. E. Bauman, M. E. VanAmburgh, and L. D. Muller. 1998. Effect of dietary intake of pasture on conjugated linoleic acid (CLA) concentrations in milk from lactating dairy co ws. J. Dairy Sci. 81:1630-1636. Kelsey, J. A., B. A. Corl, R. J. Collier, and D. E. Bauman. 2003. The effect of breed, parity, and stage of lactation on conjugate d linoleic acid (CLA) in milk fat from dairy cows. J. Dairy Sci. 86:2588-2597.

PAGE 297

275 Khan, A. S., and J. P. Vanden Heuvel. 2003. Ro le of nuclear receptors in the regulation of gene expression by dietary fatty ac ids. J. Nut. Biochem. 14:554-567. Khanal, R. C., and T. R. Dhiman. 2004. Bios ynthesis of conjugated linoleic acid (CLA): a review. Pak. J. Nutr. 3:72-81. Kiess, W., G. D. Blickenstaff, M. M. Sklar, C. L. Thomas, S. P. Nissley, and G. G. Sahagian. 1988. Biochemical evidence that the type II insulin-lik e growth factor II receptor: distinct binding sites for mannose 6-phosphate and insulin-like growth factor II. Biochem. Biophys. Res. Commun. 150:1287-1293. Kim, B., C. M. van Golen, and E. L. Feld man. 2004. Insulin-like growth factor-I signaling in human neuroblasto ma cells. Oncogene 23:130-141. Kim, J. Y., M. Kinoshita, M. Ohnishi, and Y. Fukui. 2001. Lipid and fatty acid analysis of fresh and frozen-thawed immature and in vitro matured bovine oocytes. Reproduction 122:131-138. Kim, S., Y. Choi, F. W. Bazer, and T. E. Spencer. 2003. Effects of the estrous cycle, pregnancy and interferon-tau on cyclooxyge nase 2 (COX-2) expression in ovine endometrium. Reprod. Biol. Endocrinol. 1:58-67. Kimmins, S., and L. A. MacLaren. 2001. Oe strous cycle and pregnancy effects on the distribution of oestrogen and progester one receptors in bovine endometrium. Placenta 22:742-748. Kirby, C. J., M. F. Smith, D. H. Keisler, and M. C. Lucy. 1997a. Follicular function in lactating dairy cows treated with sustai ned release bovine somatotropin. J. Dairy Sci. 80:273. Kirby, C. J., W. W. Thatcher, R. J. Colli er, F. A. Simmen, and M. C. Lucy. 1996. Effects of growth hormone and pregna ncy on expression of growth hormone receptor, insulin-like growth factor-I, and insulin-like growth factor binding protein-2 and -3 genes in bovine uterus ovary, and oviduct. Biol. Reprod. 55:9961002. Kirby, C. J., S. J. Wilson, and M. C. Lucy. 1997b. Response of dairy cows treated with bovine somatotropin to a luteol ytic dose of prostaglandin F2 J. Dairy Sci. 80:273282. Klotz, D. M., S. C. Hewitt, P. Ciana, M. Ra viscioni, J. K. Lindzey, J. Foley, A. Maggi, R. P. DiAugustine, and K. S. Korach. 2002. Requirement of estrogen receptor-alpha in insulin-like growth factor-1 (IGF1)-induced uterine responses and in vivo evidence for IGF-1/estrogen receptor cr oss-talk. J. Biol. Chem. 277:8531-8537. Knickerbocker, J. J., W. W. Thatcher, D. B. Foster, D. Wolfenson, F. F. Bartol, and D. Caton. 1986. Uterine prostaglandin and blood flow responses to estradiol-17 in cyclic cattle. Pr ostaglandins 31:757-776.

PAGE 298

276 Knight, C. H. 1992. Milk yield responses to sequential treatmen ts with recombinant bovine somatotropin and frequent milking in lactating goats. J. Dairy Res. 59:115122. Ko, Y., C. J. Lee, T. L. Ott, M. A. Davis, R. C. M. Simmen, F. W. Bazer, and F. A. Simmen. 1991. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblas tic protein-1 produc tion during early pregnancy. Biol. Reprod. 45:135-142. Kobayashi, Y., C. K. Boyd, C. J. Bracken, W. R. Lamberson, D. H. Keisler, and M. C. Lucy. 1999. Growth hormone receptor (GHR) messenger ribonucleic acid in liver of periparturient cattle is caused by a specific down-regul ation of GHR 1A that is associated with decreased insulin-l ike growth factor. Endocrinology 140:39473954. Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Matsuo, and K. Kangawa. 1999. Ghrelin is a growth-horm one-releasing acylated peptide from stomach. Nature 402: 656-660. Kojima, M., and K. Kangawa. 2005. Ghrelin : structure and function. Physiol. Rev. 85:495-522. Kolle, S., F. Sinowatz, G. Boie, D. Lincol n, and G. A. Palma. 1997. Expression of growth hormone receptor and its transcript during bovine early embryonic development. Reprod. Dom. Anim. 32:51. (Abstr.) Korbonits, M., and A. B. Grossman. 2004. Ghrelin: update on a novel hormonal system. Eur. J. Endocrinol. 151 (Suppl.)2: S67-S70. Kramer, J. K., V. Fellner, M. E. Dugan, F. D. Sauer, M. M. Mossoba, and M. P. Yurawecz. 1997. Evaluating acid and base catalysts in the methylation of milk and rumen fatty acids with special empha sis on conjugated dienes and total trans fatty acids. Lipids 11:1219-1228. Kris-Etherton, P. M., S. W. Harris, and L. J. Appel. 2003. Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular dise ase. Arterioscler. Thromb. Vasc. Biol. 23:e20-e30. Kris-Etherton, P. M., D. S. Taylor, S. Yu-Pot h, P. Huth, K. Moriarty, V. Fishell, R. L. Hargrove, G. Zhao, and T. D. Etherton. 2000. Polyunsaturated fatty acids in the food chain in the United States. Am. J. Clin. Nutr. 71:179S-188S. Kritchevsky, D. 2003. Conjugated linoleic acid in experimental atherosclerosis. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2. pp:292-301. AOCS Press, Champaign, IL.

PAGE 299

277 Labernia, J., F. Lopez-Gautius, P. Santolaria C. Hanzen, Y. Laurent, and J. Y. Houtain. 1999. Influence of calving season on the in teractions among reproductive disorders of dairy cows. J. Anim. Sci. 67:387. Lambert, M. R., N. L. Jacobson, R. S. Allen, a nd J. H. Zaletel. 1954. Lipid deficiency in the calf. J. Nutr. 52:259-272. Lamming, G. E., and A. O. Darwash. 1995. Effe ct of inter-luteal in terval on subsequent luteal phase length and fertility in postpartum dairy cows. Biol. Reprod. 53(Suppl.1):63. (Abstr.) Lamming, G. E., and G. E. Mann. 1995. Control of endometrial oxytocin receptors and prostaglandin F2 production in cows by progesterone and oestradiol. J. Reprod. Fertil. 103:69-73. Lanna, P. D., K. L. Houseknecht, D. M. Ha rris, and D. E. Bauman. 1995. Effect of somatotropin treatment on lipogensis, lipolys is, and related cellular mechanisms in adipose tissue of lactating cows J. Dairy Sci. 78:1703-1712. Lawson, R. A. S., R. A. Parr, and L. P. Cahill. 1983. Evidence for maternal control of blastocyst growth after async hronous transfer of embryos to the uterus of the ewe. J. Reprod. Fertil. 67:477-483. Lee, A. V., C. N. Weng, J. G. Jackson, and D. Yee. 1997. Activation of estrogen receptor-mediated gene transcription by IG F-I in human breast cancer cells. J. Endcorinol. 152:39-47. Lee, C. Y., M. L. Green, R. C. M. Simme n, and F. A. Simmen. 1998. Proteolysis of insulin-like growth factor-b inding proteins (IGFBPs) with in the pig uterine lumen associated with peri-implantation con ceptus development. J. Reprod. Fertil. 112:369-377. Lefebvre, D. M., and E. Block. 1992. Eff ect of recombinant bovine somatotropin on estradiol-induced estrous behavior in ova riectomized heifers. J. Dairy Sci. 75:1461-1478. Lessard, M., N. Gagnon, D. L. Godson, and H. V. Petit. 2004. Influence of parturition and diets enriched in n-3 or n-6 polyunsat urated fatty acids on immune response of dairy cows during the transition pe riod. J. Dairy Sci. 87:2197-2210. Lessard, M., N. Gagnon, and H. V. Petit. 2003. Immune response of postpartum dairy cows fed flaxseed. J. Dairy Sci. 86:2647-2657. Lewis, G. S., W. W. Thatcher, F. W. B azer, and J. S. Curl. 1982. Metabolism of arachidonic acid in vitro by bovine blasto cysts and endometrium. Biol. Reprod. 27:431-439.

PAGE 300

278 Lewis, U. J. 1992. Growth hormone: what is it and what does it do. Trends Endocr. Metab. 3:117-121. Lim, H., R. A. Gupta, W. G. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. BuBois, J. M. Trzaskos, and S. K. Dey. 1999. Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPAR Gene Dev. 13:1561-1574. Lim, H., B. C. Paria, S. K. Das, K. E. Di nchuk, R. Langenbach, J. M. Trzaskos, and S. K. Dey. 1997. Multiple female reproductive failure in cyclooxygenase 2-deficient mice. Cell 91:197-208. Littell, R. C., G. A. Millike n, W. W. Stroup, and R. D. Wo lfinger. 1996. SAS for Mixed Models. SAS Institute Inc., Cary, NC. pp.633. Liu, J., M. Antaya, A. K. Goff, D. Boerboom, D. W. Silversides, J. G. Lussier, and J. Sirois. 2001. Molecular ch aracterization of bovine pros taglandin G/H Synthase-2 and regulation on uterine stroma l cells. Biol. Reprod. 64:983-991. Lonergan, P., P. Monaghan, D. Rizos, M. P. Boland, and I. Gordon. 1994. Effect of follicle size on bovine oocyte quality and developmental competence following maturation, fertilization, and culture in vitro. Mol. Reprod. Dev. 37:48-53. Lopez-Gatius, F., I. Garcia-Isp ierto, P. Santolaria, J. Yaniz, C. Nogareda, and M. LopezBejar. 2005. Screening for high fert ility in high-producing dairy cows. Theriogenology (in press). Louca, A., and J. E. Legates. 1968. Production losses in dairy cattle due to days open. J. Dairy Sci. 51:573-583. Lozano, J. M., P. Lonergan, M. P. Boland, and D. OCallaghan. 2003. Influence of nutrition on the effectiveness of superovul ation programs in ewes: effect on oocyte quality and post-fertilization de velopment. Reproduction 125:543-553. Lucy, M. C. 2000. Regulation of ovarian foll icular growth by somatotropin and insulinlike growth factors in cattle. J. Dairy Sci. 83:1635-47. Lucy, M. C. 2001. Reproductive loss in high-pr oducing dairy cattle: where will it end? J. Dairy Sci. 84:1277-1293. Lucy, M. C., C. K. Boyd, A. T. Koenigfeld, and C. S. Okamura. 1998b. Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues. J. Dairy Sci. 81:1889. Lucy, M. C., J. C. Byatt, T. L. Curran, and R. J. Collier. 1994. Placental lactogen and somatotropin: hormone binding to the corpus luteum and effects on the growth and functions of the ovary in he ifers. Biol. Reprod. 50:136-44.

PAGE 301

279 Lucy, M. C., R. J. Collier, M. L. Kitchel, J. J. Dibner, S. D. Hauser, and G. G. Krivi. 1993a. Immunohistochemical and nucleic acid analysis of growth hormone receptor populations in the bovi ne ovary. Biol. Reprod. 48:1219-1227. Lucy, M. C., and B. A. Crooker. 2001. P hysiological and genetic differences between low and high index dairy cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:223-234. Lucy, M. C., R. L. De La Sota, C. R. St aples, and W. W. Thatcher. 1993b. Ovarian follicular populations in lactating dairy cows treated with recombinant bovine somatotropin (sometribove) or saline and fed diets differing in fat content and energy. J. Dairy Sci. 76:1014-1027. Lucy, M. C., C. R. Staples, F. M. Michel, W. W. Thatcher, and D. J. Bolt. 1991a. Effect of feeding calcium soaps to early postpa rtum dairy cows on plasma prostaglandin F2 luteinizing hormone, and follicular growth. J. Dairy Sci. 74:483-489. Lucy, M. C., C. R. Staples, F. M. Michel and W. W. Thatcher. 1991b. Energy balance and size and number of ovarian follicle s detected by ultrasonography in early postpartum dairy cows. J. Dairy Sci. 74:473-482. Lucy, M. C., C. R. Staples, W. W. Thatcher, P. S. Erickson, R. M. Cleale, J. L. Firkins, J. H. Clark, M. R. Murphy, and B. O. Brodie. 1992. Influence of diet composition, dry matter intake, milk production, and en ergy balance on time of post-partum ovulation and fertility in da iry cows. Anim. Reprod. 54 : 323-331. Lucy, M. C., W. W. Thatcher, R. J. Collier F. A. Simmen, Y. Ko, J. D. Savio, and L. Badinga. 1995. Effects of somatotropin on the conceptus, uterus, and ovary during maternal recognition of pregnancy in cat tle. Domest. Anim. Endocrinol. 12:73-82. Lucy, M. C., W. J. Weber, L. H. Baumgar d, B. S. Seguin, A. T. Koenigsfeld, L. B. Hansen, H. Chester-Jones, and B. A. Crooker. 1998a. Reproductive endocrinology of lactating dairy cows selected for in creased milk production. J. Anim. Sci. 76(Suppl.1):296. (Abstr.) MacLaren, L. A., A. Guzeloglu, T. R. Bil by, F. Michel, and W. W. Thatcher. 2003. Expression of peroxisome proliferator-a ctivated receptors (PPARs) in bovine endometrium. Biol. Repr od. 68(Suppl.1):264. (Abstr.) MacLaren, L. A., A. Guzelogl u, F. Michel, and W. W. Th atcher. 2005. Peroxisome proliferator-activated recept or (PPAR) expression in cultured bovine endometrial cells and response to omega-3 fatty aci d, growth hormone an d agonist stimulation in relation to series 2 prostaglandin produc tion. Dom. Anim. Endocr. (in press). Madron, M. S., D. G. Peterson, D. A. Dwyer, B. A. Corl, L. H. Baumgard, D. H. Beerman, and D. E. Bauman. 2002. Eff ect of extruded full-fat soybeans on conjugated linoleic acid content of intramus cular, intermuscular, and subcutaneous fat in beef steers. J. Anim. Sci. 80:1135-1143.

PAGE 302

280 Malau-Aduli, A. E. O., B. D. Siebert, C. D. K. Bottema, and W. S. Pitchford. 1997. A comparison of the fatty acid composition of triacylglycerols in adipose tissue from Limousin and Jersey cattle. Aust. J. Agric. Res. 48:715-722. Malven, P. V., H. H. Head, R. J. Collier, and F. C. Buonomo. 1987. Periparturient changes in secretion and mammary uptake of insulin and in concentrations of insulin and insulin-like growth factors in milk of dairy cows. J. Dairy Sci. 70:2254-65. Mann, G. E., and G. E. Lamming. 1994. Use of repeated biopsies to monitor endometrial oxytocin receptors in the cow. Vet. Rec. 135:403-405. Mann, G. E., and G. E. Lamming. 1999. The influence of progesterone during early pregnancy in cattle. Reprod. Domest. Anim 34:269. Mann, G. E., and G. E. Lamming. 2001. Re lationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows. Reproduction 121:175-180. Mann, G. E., G. E. Lamming, and P. A. Fisher. 1998. Progesterone control of embryonic interferon-tau production during ea rly pregnancy in the cow. J. Reprod. Fertil. 21(Suppl.1):37 (Abstr.) Mann, G. E., G. E. Lamming, R. S. Robins on, and D. C. Wathes. 1999. The regulation of interferon-tau production and uterine hormone receptors during early pregnancy. J. Reprod. Fertil. 54:317-328. Mann, G. E., S. H. Mann, and G. E. Lamming. 1996. The inter-relati onship between the maternal hormone environment and th e embryo during the early stages of pregnancy. J. Reprod. Fertil. 17(Suppl.1):55. (Abstr.) Mapletoft, R. J., C. E. Li ndsell, and V. Pawlshyn. 1986. Effects of clenbuterol, body condition, and nonsurgical embryo transfer equipment on pregnancy rates in bovine recipients. Therioge nology 25:172. (Abstr.) Marions, L., and K. G. Danielsson. 1999. Expression of cyclo-oxygenase in human endometrium during the implantation period. Mol. Human Reprod. 5:961-965. Markusfeld, O., N. Galon, and E. Ezra. 1997. Body condition score, health, yield and fertility in dairy cows. Vet. Rec. 141:67. Matsumoto, H., M. Wen-Ge, T. Daikoku, X. Zhao, B. C. Paria, S. K. Das, J. M. Trzaskos, and S. K. Dey. 2002. Cyclooxygenase-2 diffe rentially directs uterine angiogenesis during implantation in mice. J. Biol. Chem. 277:29260-29267. Matsumoto, H., M. Wen-Ge, W. Smalley, J. Trzaskos, R. M. Breyer, and S. K. Dey. 2001. Diversification of cyclooxygenase-2-der ived prostaglandins in ovulation and implantation. Biol. Reprod. 64:557-1565.

PAGE 303

281 Mayo, K. E., P. A. Godfrey, S. T. Suhr, D. J. Kulik, and J. O. Rahal. 1995. Growth hormone-releasing hormone: synthesis and signaling. Recent Progress Horm. Res. 50:35-73. Mayo, K. E., P. A. Godfrey, S. T. Suhr, D. J. Kulik, and J. O. Rahal. 1995. Growth hormone-releasing hormone: synthesis and signaling. Recent Progress Horm. Res. 50:35-73. Mattos, R., A. Guzeloglu, L. Badinga, C. R. Staples, and W. W. Thatcher. 2003. Polyunsaturated fatty acid s and bovine interferonmodify phorbol ester-induced secretion of prostaglandinF2 and expression of pros taglandin endoperoxide synthase-2 and phospholipase-A2 in bovine endometrial cells. Biol. Reprod. 69: 780-787. Mattos, R., C. R. Staples, A. Arteche, M. C. Wiltbank, F. J. Diaz, T. C. Jenkins, and W. W. Thatcher. 2004. The effects of feedi ng fish oil on uterine secretion of PGF2 milk composition, and metabolic status of pe riparturient Holstein cows. J. Dairy Sci. 87:921-932. Mattos, R., C. R. Staples, and W. W. Thatch er. 2000. Effects of di etary fatty acids on reproduction in ruminants. Rev. Reprod. 5:38. Mattos, R., C. R. Staples, J. Williams, A. Amorocho, M. A. McGuire, and W. W. Thatcher. 2002. Uterine, ovarian, and production responses of lactating dairy cows to increasing dietary concentrations of menhaden fish meal. J. Dairy Sci. 85:755-764. McAtee, J. W., and A. Trenkle. 1971. Eff ect of feeding, fasting and infusion of energy substrates on plasma growth hormone le vels in cattle. J. Anim. Sci. 33:612-616. McCracken, J. A., E. E. Custer, and J. C. Lamsa. 1999. Luteolysis: a neuroendocrinemediated event. Physiol. Rev. 79:263-324. McDowell, G. H. 1991. Somatotropin a nd endocrine regulation of metabolism during lactation. J. Dairy Sci. 74(Suppl.2):44. (Abstr.) McDowell, G. H., I. C. Hart, and A. C. Ki rby. 1987. Local intra-arterial infusion of growth hormone into the mammary glands of sheep and goats: effects on milk yield and composition, plasma hormones and meta bolites. Aust. J. Biol. Sci. 40:181189. McEvoy, T. G., G. D. Coull, P. J. Broadbent J. S. M. Hutchinson, and B. K. Speake. 2000. Fatty acid composition of lipids in immature cattle, pig and sheep oocytes with intact zona pellucida. J. Reprod. Fertil. 118:163-170. McGaughey, R. W. 1983. Regulation of oocyt e maturation. Oxford Rev. Reprod. Biol. 5:106-130.

PAGE 304

282 McGuire, M. A., M. K. McGuire, M. A. G uy, W. K. Sanchez, T. D. Schultz, L. Y. Harison, D. E. Bauman, and J. M. Griin ari. 1996. Effect of dietary lipid concentration on content of conjugated lin oleic acid (CLA) in milk from dairy cattle. J. Anim. Sci. 74(Suppl.1):266. (Abstr) McGuire, M. A., J. L. Vicini, D. E. Baum an, and J. J. Veenhuizen. 1992. Insulin-like growth factors and binding proteins in ru minants and their nutritional regulation. J. Anim. Sci. 70:2901-2910. Meikle, A., L. Sahlin, A. Ferraris, B. Masi roni, J. E. Blanc, M. Rodriguez-Irazqui, M. Rodriguez-Pinon, H. Kindahl, and M. Forsberg. 2001. Endometrial mRNA expression of oestrogen receptor progesterone receptor a nd insulin-like growth factor-I (IGF-I) throughout the bovine oest rous cycle. Anim. Reprod. Sci. 68:4556. Menotti, A. 1999. Diet cholesterol and corona ry heart disease: a perspective. Acta. Cardinol. 54:169-172. Mermillod, P., B. Oussaid, and Y. Cognie. 1999. Aspects of follicular and oocyte maturation that affect the developmental potential of embryos. J. Reprod. Fertil. 54:449-460. Merton, J. S., A. P. W. de Roos, E. Mullaart, L. de Ruigh, L. Kaal, P. L. A. M. Vos, and S. J. Dieleman. 2003. Factors affecting oocyte quality and quantity in commercial application of embryo technologies in th e cattle breeding industry. Theriogenology 59:651-674. Mihm, M., A. Bagnisi, M. P. Boland, and J. F. Roche. 1994. Association between the duration of dominance of the ovulatory follicle and pregnancy rate in beef heifers. J. Reprod. Fertil. 102:123. Mihm, M., M. A. Crowe, P. G. Knight, and E. J. Austin. 2002. Follicle wave growth in cattle. Reprod. Domest. Anim 37:191. Mishra, D. P., H. H. D. Meyer, and B. S. Prakash. 2003. Validation of a sensitive enzyme immunoassay for 13,14-dihydro-15-keto-PGF2 in buffalo plasma and its application for reproductiv e health status monitoring. Anim. Reprod. Sci. 78:3346. Moallem, U., Y. Folman, A. Bor, A. Arav, and D. Sklan. 1999. Effect of calcium soaps of fatty acids and administration of so matotropin on milk pr oduction, preovulatory follicular development, and plasma and follicular fluid lipid composition in high yielding dairy cows. J. Dairy Sci. 82:2358-2368. Monty, D. E., and C. Racowsky. 1987. In vitr o evaluation of early embryo viability and development in summer heat-stressed, s uperovulated dairy cows. Theriogenology 28:451.

PAGE 305

283 Moore, N. W., and J. N. Shelton. 1964. E gg transfer in sheep: effect of degree of synchronization between donor and recipient, age of egg and site of transfer on the survival of the transferred e ggs. J. Reprod. Fertil. 7:45-152. Morales-Roura, J. S., L. Zarco, J. HernandezCeron, and G. Rodrguez. 2001. Effect of short-term treatment with bovine somato tropin at estrus on conception rate and luteal function of repeat-breeding da iry cows. Theriogenology 55:1831-1841. Morbeck, D. E., J. H. Britt, and B. T. Mc Daniel. 1991. Relationships among milk yield, metabolism, and reproductive performance of primiparous Holstein cows treated with somatotropin. J. Dairy Sci. 74:2153-2164. Moreira, F., L. Badinga, C. Burnley, and W. W. Thatcher. 2002a. Bovine somatotropin increases embryonic development in superovulated cows and improves posttransfer pregnancy rates when given to lactating recipient cows. Theriogenology 57:1371-1387 Moreira, F., R. L. De La Sota, T. Diaz, and W. W. Thatcher. 2000a. Effect of day of the estrous cycle at the initiation of a tim ed artificial insemination protocol on reproductive responses in dairy heif ers. J. Anim. Sci. 78:1568-1576. Moreira, F., C. Orlandi, C. A. Risco, R. Matto s, F. Lopes, and W. W. Thatcher. 2001. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J. Dairy Sci. 84:1646-1659. Moreira, F., F. F. Paula-Lopes, P. J. Hans en, L. Badinga, and W. W. Thatcher. 2002b. Effects of growth hormone a nd insulin-like growth factor -I on development of in vitro derived bovine embryos Theriogenology 57:895-907. Moreira, F., C. Risco, M. F. A. Pires, J. D. Ambrose, M. Drost, and W. W. Thatcher. 2000b. Use of bovine somatotropin in l actating dairy cows receiving timed artificial insemination. J. Dairy Sci. 83:1237-1247. Morrison, S. R. 1983. Ruminant heat st ress: effect on production and means of alleviation. J. Anim. Sci. 57:1594-1600. Myers Jr., M. G., and M. F. White. 1993. The new elements of insu lin signaling: insulin receptor substrate-1 and proteins with SH2 domains. Diabetes 42:643-650. Nakamura, M. T., and T. Y. Nara. 2004. Stru cture, function, and dietary regulation of 6, -5, and -9 desaturases. Annu. Rev. Nutr. 24:345-376. Needleman, P., A. Raz, M. S. Minkes, J. A. Ferrendeli, and H. Sprecher. 1979. Triene prostaglandins: prostacyc lin and thromboxane biosynt hesis and unique biological properties. Proc. Natl. Acad. Sci. USA 76:944-948.

PAGE 306

284 Nestel, P. J. 1995. Controlling coronary ri sk through nutrition. Can. J. Cardiol. 11:9G14G. Newton, C. J., R. Buric, T. Trapp, S. Brockm eier, U. Pagotto, and G. K. Stalla. 1994. The unliganded estrogen receptor (ER) transdu ces growth factor signals. J. Steroid Biochem. Mol. Biol. 48:481-486. Nicolosi, R., E. Rogers, D. Kritchevsky, J. A. Scimeca, and P. Huth. 1997. Dietary conjugated linoleic acid reduces plas ma lipoproteins and early aortic atherosclerosis in hypercholestero lemic hamsters. Artery 22:266. Nonogaki, T., Y. Noda, Y. Goto, J. Kishi, a nd T. Mori. 1994. Developmental blockage of mouse embryos caused by fatty acids. J. Assit. Reprod. Genet. 11:482-488. Norstedt, G., B. Enberg, C. Moller, and L. S. Mathews. 1990. Growth hormone regulation of gene expression. Acta Paediatrica Scandinavica Suppl. 366:79-83. Ntambi, J. M., A. M. Sessler, and T. Takova 1996. A model cell line to study regulation of stearoyl-CoA desaturase gene 1 expre ssion by insulin and polyunsaturated fatty acids. Biochem. Biophys. Res. Commun. 220:990-995. Nugent, R. A., T. G. Jenkins, A .J. Roberts, and J. Klindt. 1993. Relationship of postpartum interval in mature beef cows w ith nutritional environment biological type and serum IGF-I concentrations. Anim. Prod. 56:193-200. Nunez, S. B., J. A. Medin, O. Braissant, L. Kemp, W. Wahli, and K. Ozato. 1997. Retinoid X receptor and peroxisome prolif erator-activated receptor activate an estrogen responsive gene independent of th e estrogen receptor. Mol. Cell Endocr. 127:27. OCallaghan, D., J. M. Lozano, J. Fahey, V. Gath, S. Snijders, and M. P. Boland. 2001. Relationships between nutrition and fertility in dairy cattle. Brit. Soc. Anim. Sci. Occasional Publ. 26:147-160. Oka, Y., L. M. Rozek, and M. P. Czech. 1985. Direct demonstration of rapid insulin-like growth factor II receptor inte rnalization and recycling in rat adipocytes. Insulin stimulates 125I insulin-like growth f actor II degradation by modulating the IGF-II receptor recycling process. J. Biol. Chem. 260:9435-9442. Okamoto, T., T. Katada, Y. Murayama, M. Ui, E. Ogata, and I. Nishimoto. 1990. A simple structure encodes G protein-ac tivating function of the IGF-II/mannose 6phosphate receptor. Cell 62:709-717. Oldick, B. S., C. R. Staples, W. W. That cher, and P. Gyawu. 1997. Abomasal infusion of glucose and fat-effect on digestion, pr oduction, and ovarian and uterine function of cows. J. Dairy Sci. 80:1315-1328.

PAGE 307

285 Ott, T. L., T. E. Spencer, J. Y. Lin, H-T. Ki m, B. Gerami, F. F. Bartol, A. A. Wiley, and F. W. Bazer. 1998. Effects of the estr ous cycle and early pregnancy on uterine expression of Mx protein in sheep ( Ovis aries ). Biol. Reprod. 59:784-794. Pantoja, J., J. L. Firkins, and M. L. Eastridge 1996. Fatty acid dige stibility and lactation performance by dairy cows fed fats varying in degree of saturation. J. Dairy Sci. 79:429-437. Pantoja, J., J. L. Firkins, M. L. Eastridge, and B. L. Hull. 1994. Effects of fat saturation and source of fiber on site of nutrient di gestion and milk pr oduction by lactating dairy cows. J. Dairy Sci. 77:2341-2356. Parent, J., C. Villeneuve, A. P. Alexenko, A. D. Ealy, and M. A. Fortier. 2003. Influence of different isoforms of recombinant trophoblast interferons on prostaglandin production in cultured bovine endome trial cells. Biol. Reprod. 68:1035-1043. Pariza, M. W. 1999. The biological activitie s of conjugated linoleic acid. In M. P. Yurawecz, M. M. Mossoba, J. K. G. Kram er, M. W. Pariza and G. J. Nelson (ed) Advances in Conjugated Linoleic Acid Research, Vol. 1., pp: 12-20. AOCS Press, Champaign, IL. Parker, K. I., D. M. Robertson, N. P. Groome, and K. L. Macmillan. 2003. Plasma concentrations of inhibin A and follicle-stimulating hormone differ between cows with two or three waves of ovarian follicular development in a single estrous cycle. Biol. Reprod. 68:822. Parodi, P. 2003. Conjugated linoleic acid in food. In. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Li noleic Acid Research, Vol. 2, pp: 101-121. AOCS Press, Champaign, IL. Parr, R. A. 1992. Nutrition-progesterone inte ractions during early pregnancy in sheep. Reprod. Fertil. Dev. 4:297-300. Parrish, J. J., J. L. Susko-Parrish, E. S. Crits er, W. H. Eyestone, and N. L. First. 1986. Bovine in vitro fertilization with fr ozen-thawed semen. Theriogenology 25:591600. Paula-Lopes, F. F., and P. J. Hansen. 2002. Heat-shock induced apoptosis in bovine preimplantation embryos is a develo pmentally-regulated phenomenon. Biol. Reprod. 66:1169-1177. Pavlok, A., A. Lucas-Hahn, and H. Niemann. 1992. Fertilization and developmental competence of bovine oocytes derived from di fferent categories of antral follicles. Mol. Reprod. Dev. 31:63-67. Payne, J. H., and G. E. Lamming. 1994. The direct influence of the embryo on uterine PGF2 and PGE2 production in sheep. J. Reprod. Fertil. 101:737-741.

PAGE 308

286 Peel, C. J., and D. E Bauman. 1987. Somatotr opin and lactation. J. Dairy Sci. 70:474486. Peel, C. J., T. J. Fronk, D. E. Bauman, and R. C. Gorewit. 1983. Effect of exogenous growth hormone in early and late lact ation on lactational performance of dairy cows. J. Dairy Sci. 66:776-782. Pershing, R. A., A. C. Dinges, W. W. Th atcher, and L. Badinga. 2003. Plasma and uterine insulin-like growth factor-I (IGF -I) and IGF-binding proteins in lactating dairy cows treated with bovine somato tropin. J. Anim. Vet. Adv. 2:67-73. Pershing, R. A., M. C. Lucy, W. W. Thatch er, and L. Badinga. 2002. Effects of bST on oviductal and uterine genes encoding com ponents of the IGF system in lactating dairy cows. J. Dairy Sci. 85:3260-3267. Peruzzi, F., M. Prisco, M. Dews, P. Salomoni E. Grassilli, G. Romano, B. Calabretta, and R. Baserga. 1999. Multiple signali ng pathways of the insulin-like growth factor 1 receptor in protection from apoptosis. Mol. Cell Biol. 19:7203-7215. Petit, H. V., R. J. Dewhurst, J. G. Proulx, M. Khalid, W. Haresign, and H. Twagiramungu. 2001. Milk production, milk composition, and reproductive function of dairy cows fed different fats. Can. J. Dairy Sci. 81:263-271. Petit, H. V., R. J. Dewhurst, N. D. Scolla n, J. G. Proulx, M. Khalid, W. Haresign, H. Twagiramungu, and G. E. Mann. 2002. M ilk production and composition, ovarian function, and prostaglandin secr etion of dairy cows fed omeg a-3 fats. J. Dairy Sci. 85:889-899. Petit, H. V., C. Germiquet, and D. Lebel. 2004. Effect of feed ing whole, unprocessed sunflower seeds and flaxseed on m ilk production, milk composition, and prostaglandin secretion in dairy cows. J. Dairy Sci. 87:3889-3898. Petyim, S., R. Bage, T. Hallap, A. S. Bergqvi st, H. Rodriguez-Martin ez, and B. Larsson. 2003. Two different schemes of twice-weekly ovum pick-up in dairy heifers: effect on oocyte recovery and ovarian function. Theriogenology 60:175-188. Pinto Andrade, L. P., S. M. Rhind, I. A. Wri ght, S. R. McMilen, P. J. Goddard, and T. A. Bramley. 1996. Effects of bovine soma totropin (bST) on ovarian function in postpartum beef cows. Reprod. Fertil. Dev. 8:951-960. Postel-Vinay, M-C., and J. Finidori. 1995. Growth hormone receptor: structure and signal transduction. European J. Endocrinol. 133:654-659. Poulson, C. S., T. R.Dhiman, D. Cornforth, K. C. Olson, and J. Walters. 2001. Influence of diet on conjugated linolei c acid content in beef. J. Anim. Sci. 79(Suppl.1):159. (Abstr.)

PAGE 309

287 Prosser, C. G., and S. R. Davis. 1992. M ilking frequency alters the milk yield and mammary blood flow response to intra-ma mmary infusion of insulin-like growth factor-I in the goat. J. Endocrinol. 135:311-316. Prosser, C. G., S. R. Davis, V. C. Farr, L. G. Moore, and P. D. Gluckman. 1994. Effects of close-arterial (external pudic) infusion of insulin-like growth factor-II on milk yield and mammary blood flow in lact ating goats. J. Endocrinol. 142:93-99. Prosser, C. G., S. R. Davis, S. C. Hodgkinson, and M. A. Mohler. 1995. Pharmacokinetics and bioactivity of int act versus truncated IGF-I during a 24-h infusion into lactating goats. J. Endocrinol. 144:99-107. Pursley, J. R., M. R. Kosorok, and M. C. Wiltbank. 1997a. Reproductive management of lactating dairy cows using synchroni zation of ovulation. J. Dairy Sci. 80:301306. Pursley, J. R., R. W. Silcox, and M. C. W iltbank. 1998. Effect of time of artificial insemination on pregnancy rates, calving ra tes, pregnancy loss, and gender ratio after synchronization of ovulat ion in lactating dairy cows J. Dairy Sci. 81:21392144. Pursley, J. R., M. C. Wiltbank, J. S. Stevenson, J. S. Ottobre, H. A. Garverick, and L. L. Anderson. 1997b. Pregnancy rates per artific ial insemination for cows and heifers inseminated at a synchronized ovul ation. J. Dairy Sci. 80:295-300. Putney, D. J., M. Drost, and W. W. Th atcher. 1988a. Embryonic development in superovulated dairy cattle exposed to elev ated ambient temperature between days 1 to 7 post insemination. Theriogenology 30:195. Putney, D. J., M. Drost, and W. W. Thatcher 1989. Influence of summer heat stress on pregnancy rates of lactating dairy cattle following embryo transfer or artificial insemination. Theriogenology 31:765. Putney, D. J., J. R. Malayer, T. S. Gross, W. W. Thatcher, P. J. Hansen, and M. Drost. 1988b. Heat stress-induced alte rations in the synthesis a nd secretion of proteins and prostaglandins by cultured bovine con ceptuses and uterine endometrium. Biol. Reprod. 39:717-728. Quin, J. D. 1992. The insulin-like growth factors. Quarterly J. Med. 298:81-90. Quinn, P. J. 1985. A lipid-phase separati on model of low-temperature damage to biological membranes. Cryobiology 29:255-266. Rabiee, A. R., K. L. Macmillan, and F. Schwarzenberger. 2000. Effect of level of feed intake on plasma progesterone concentrati ons in desorelin-implanted dairy cows treated with a CIDR device. J. Anim. Sci. 78(Suppl.1):221. (Abstr.)

PAGE 310

288 Rajaram, S., D. J. Baylink, and S. Mohan. 1997. Insulin-like growth factor-binding proteins in serum and other biological fl uids: regulation and functions. Endocr. Rev. 18:801-831. Ray, D. E., T. J. Halbach, and D. V. Armstrong. 1992. Season and lactation number effects on milk production and reproduction in dairy cattle in Arizona. J. Dairy Sci. 75:2976. Rechler, M. M., and S. P. Nissley. 1990. Insulin-like growth factors. Handbook Exp. Pharmacol. 95:263. Reynaert, R., S. Marcus, M. De Paepe, and G. Peeters. 1976. Influences of stress, age, sex on serum growth hormone and free fatty acid levels in cattle. Horm. Metab. Res. 8:109-114. Rhoads, R. P., J. W. Kim, B. J. Leury, L. H. Baumgard, N. Segoale, S. J. Frank, D. E. Bauman, and Y. R. Boisclair. 2004. Insu lin increases the abunda nce of the growth hormone receptor in liver and adipose tissue of periparturient dairy cows. J. Nutr. 134:1020-1027. Rinderknecht, E., and R. E. Humbel. 1978. The amino acid sequence of human insulinlike growth factor I and its structural ho mology with proinsulin. J. Biol. Chem. 253:2769-2776. Roberts, A. J., R. A. Nugent, J. Klindt, and T. G. Jenkins. 1997. Circulating insulin-like growth factor I, insulin-like growth f actor binding proteins, growth hormone, and resumption of oestrus in post-partum cows subjected to dietary energy restriction. J. Anim. Sci. 75:1909-1917. Robinson, R. S., G. E. Mann, G. E. Lamming, and D. C. Wathes. 1999. The effect of pregnancy on the expression of uterin e oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. J. Endocrinol. 160:21-33. Robinson, R. S., G. E. Mann, G. E. Lammi ng, and D. C. Wathes. 2001. Expression of oxytocin, oestrogen and progesterone r eceptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 122:965979. Robinson, R. S., P. G. A. Pushpakumara, Z. Cheng, A. R. Peters, D. E. E. Abayasekara, and D. C. Wathes. 2002. E ffects of dietary polyunsaturat ed fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction 124:119-131. Rocha, A., R. D. Randel, J. R. Broussard, J. M. Lim, R. M. Blair, J. D. Roussel, R. A. Godke, and W. Hansel. 1998. High environmental temperature and humidity decrease oocyte quality in Bos Taurus but not in Bos indicus cows. Theriogenology 49:657-665.

PAGE 311

289 Roche, J. F., and M. D. Diskin. 2000. Re sumption of reproductive ac tivity in the early postpartum period of cows. In : Proceedings of Conference on Fertility in the High Producing Dairy Cow, Galway, Ireland. Roche, F., and M. G. Diskin. 2001. Resu mption of reproductive activity in the early postpartum period of cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:31-42. Roenfeldt, S. 1996. BST extended calving intervals pay. Dairy Herd Management 33:36-40. Rorie, R. W., T. R. Bilby, and T. D. Lester 2002. Application of electronic estrus detection technologies to re productive management of ca ttle. Theriogenology. 57: 137-148. Rorie, R. W., C. F. Rosenkrans, and A. J. Aishman. 2004. Effects of bovine somatotropin treatment on A.I. pregnancy ra te in dairy heifers. Reprod. Fertil. Dev. 16:132. (Abstr.) Roth, Z., R. Meweidan, A. Shaham-Albalan cy, R. Braw-Tal, and D. Wolfenson. 2001. Delayed effect of heat stress on st eroid production in medium-size and preovulatory bovine folli cles. Reproduction 121 : 745. Rotwein, P., A. M. Gronowski, and M. J. Thomas. 1994. Rapid nuclear actions of growth hormone. Horm. Res. 42:170-175. Russo, V. C., G. Rekaris, N. L. Baker, L. A. Bach, and G. A. Werther. 1999. Basic fibroblast growth factor induces proteo lysis of secreted and cell membraneassociated insulin-like growth factor binding protein-2 in human neuroblastoma cells. Endocrinology 140:3082-3090. Rutanen, E-M., and F. Pekonen. 1990. Insulin -like growth factors and their binding proteins. Acta Endocrinol. 123:7-13. Rutledge, J. J., R. L. Monson, and D. L. Northey, M. L. Leibfried-Rutledge. 1999. Seasonality of cattle embr yo production in a temperate region. Theriogenology 51(Suppl.1):330. (Abstr.) Rutter, L. M., R. Snopek, and J. G. Manns. 1989. Serum concentrations of IGF-I in post-partum beef cows. J. Anim. Sci. 67:2060-2066. Ryan, D. P., J. F. Prochard, E. Kopel, a nd R.A. Godke. 1993. Comparing early embryo mortality in dairy cows du ring hot and cold season of the year. Theriogenology 39:719. Ryan, D. P., R. A. Spoon, and G. L. Williams 1992. Ovarian follicular characteristics, embryo recovery, and embryo viability in heifers fed high fat diets and treated with follicle-stimulating hormone. J. Anim. Sci. 70:3505-3513.

PAGE 312

290 Sagle, M., K. Bishop, N. Ridley, F. M. Al exander, M. Michel, R. C. Bonney, R. W. Beard, and S. Franks. 1988. Recurrent ea rly miscarriage and polycystic ovaries. Brit. Med. J. 297:1027-1028. Salamonsen, L. A., and J. K. Findlay. 1990. Immunocytochemical localization of prostaglandin synthase in th e ovine uterus during the oe strous cycle and in early pregnancy. Reprod. Fertil. Dev. 2:311-319. Sampath, H., and J. M. Ntambi. 2005. Polyuns aturated fatty acid regulation of genes of lipid metabolism. Annu. Rev. Nutr. 25:317-340. Sangsritavong, S., D. K. Combs, R. Sartori, L. E. Armentano, and M. C. Wiltbank. 2002. High feed intake increases liver blood flow and meta bolism of progesterone and estradiol-17 beta in dairy cat tle. J. Dairy Sci. 85:2831-2842. Sangsritavong, S., D. K. Combs, R. F. Sartori, and M. C. Wiltbank. 2000. Liver blood flow and steroid metabolism are increas ed by both acute feeding and hypertrophy of the digestive tract. J. An im. Sci. 78(Suppl.1):221. (Abstr.) Santos, J. E. P., S. O. Juchem, R. L. A. Cerri, K. N. Galvo, R. C. Chebel, W. W. Thatcher, C. S. Dei, and C. R. Bil by. 2004b. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J. Dairy Sci. 87:868-881. Santos, J. E. P., W. W. Thatcher, R. C. Chebel R. L. A. Cerri, and K. N. Galvao. 2004a. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. An im. Reprod. Sci. 82-83:513-535. Santos, J. E. P., W. W. Thatcher, L. Pool and M. W. Overton. 2001. Effect of human chorionic gonadotropin on luteal func tion and reproductive performance of highproducing lactating Holstein dairy cows. J. Anim. Sci. 79:2881-2894. Sartori, R., G. J. Rosa, and M. C. Wiltbank. 2002a. Ovarian struct ures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. J. Dairy Sci. 85:2813-22. Sartori, R., R. Sartor-Bergfelt, S. A. Merten s, J. N. Guenther, J. J. Parish, and M. C. Wiltbank. 2002b. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating a nd dry cows in winter. J. Dairy Sci. 85:2803-2812. Scenna, F. N., J. L. Edwards, N. R. Rohrbach, M. E. Hockett, A. M. Saxton, and F. N. Schrick. 2004. Detrimental effects of prostaglandin F2alpha on preimplantation bovine embryos. Prostaglandins Other Lipid Mediat. 73:215-226. Schedlich, L. J., T. F. Young, S. M. Firth, a nd R. C. Baxter. 1998. Insulin-like growth factor-binding protein (IGFBP)-3 and IG FBP-5 share a common nuclear transport pathway in T47D human breast carci noma cells. J. Biol. Chem. 273:18347-18352.

PAGE 313

291 Schillo, K. K. 1992. Effects of dietary energy on control of luteinizing hormone secretion in cattle and shee p. J. Anim. Sci. 70:1271-1282. Schrick, F. N., M. E. Hockett, A. M. Saxton, M. J. Lewis, H. H. Dowlen, and S. P. Oliver. 2001. Influence of subclinical mastitis during early lactation on reproductive parameters. J. Dairy Sci. 84:1407. Scollan, N. D., M. Enser, S. K. Gulati, I. Richardson, and J. D. Wood. 2003. Effects of including a ruminally prot ected lipid supplement in the diet of fatty acid composition of beef muscle Br. J. Nutr. 90:709-716. Scott, T. A., R. D. Shaver, L. Zepeda, B. Yandell, and T. R. Smith. 1995. Effects of rumen-inert fat on lactation, reproduction, and health of high producing Holstein herds. J. Dairy Sci. 78:2435-2451. Secchi, C., and V. Borromeo. 1997. Structur e and function of bovine growth hormone: bovine growth hormone as an experimental model for studies of protein-protein interactions. J. Chromatogr. B 688:161-177. Sepp-Lorenzino, L. 1998. Structure and func tion of the insulin-lik e growth factor I receptor. Breast Cancer Res. and Treatment 47:235-253. Sessler, A. M., and J. M. Nt ambi. 1998. Polyunsaturated fatty acid regulation of gene expression. J. Nutr. 128:923-926. Shinitzky, M. 1984. Membrane fluidity and cellular functions. In: Shintzky M, editor. Physiology of membrane fluidit y. Florida: CRC Press Inc. p 1-45. Shipley, J. M., and D. J. Waxman. 2003. Down-regulation of ST AT5b transcriptional activity by ligand-activated peroxisome pr oliferator-activated receptor (PPAR) and PPAR Mol. Pharmacol. 64:355-364. Simopoulos, A. P. 1999. Essential fatty acids in health and chronic disease. Am. J. Clin. Nutr. 70:560-569. Singh, K., D. G. Hartley, T. B. McFadden, and D. D. S. Mackenzie. 2004. Dietary fat regulates mammary stearoyl CoA desaturase expression and activity in lactating mice. J. Dairy Res. 71:1-6. Skaar, T. C., R. R. Grummer, M. R. Dentine, and R. H. Stauffacher. 1989. Seasonal effects of prepartum and postpartum fat and niacin feeding on lactation performance and lipid metabolis m. J. Dairy Sci. 72:2028-2038. Sklan, D., M. Kaim, U. Moallem, and Y. Folm an. 1994. Effect of dietary calcium soaps on milk yield, body weight, reproductive hormon es, and fertility in first parity and older cows. J. Dairy Sci. 77:1652-1660.

PAGE 314

292 Sklan, D., U. Moallem, and Y. Folman. 1991. Effect of feeding calcium soaps of fatty acids on production and reproductive respons es in high producing lactating cows. J. Dairy Sci. 74:510-517. Snijders, S. E., P. Dillon, D. OCallaghan, and M. P. Boland. 2000. Effect of genetic merit, milk yield, body condition and l actation number on in vitro oocyte development in dairy cows. Theriogenology 53:981-989. Son, J., J. Grant, and L. L. Larson. 1996. Effects of tallow and escape protein on lactational and reproductive performance of dairy cows. J. Dairy Sci. 79:822-830. Soto, P., R. P. Natzke, and P. J. Hansen. 2003. Identification of possible mediators of embryonic mortality caused by mastit is: actions of lipopolysaccharide, prostaglandin F2 and the nitric oxide generator, sodium nitroprusside dehydrate, on oocyte maturation and embryonic devel opment in cattle. Am. J. Reprod. Immunol. 50:263-272. Spencer, T. E., G. Allison, G. A. Johnson, K. M. Taylor, A. Gertler, E. Gootwine, T. L. Ott, and F. W. Bazer. 1999. Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol. Reprod. 61:1409-1418. Spencer, T. E., and F. W. Bazer. 1995. Te mporal and spatial a lterations in uterine estrogen receptor and progesterone recep tor gene expression during the estrous cycle and early pregnancy in the ewe. Biol. Reprod. 53:1527-1543. Spencer, T. E., W. C. Becker, P. George, M. A. Mirando, T. F. Ogle, and F. W. Bazer. 1995. Ovine interferon-tau regulates expr ession of endometrial receptors for estrogen and oxytocin, but not prog esterone. Biol. Reprod. 53:732-745. Spencer, T. E., T. L. Ott, and F. W. Bazer 1998. Expression of interferon regulatory factors one and two in the ovine endome trium: effects of pregnancy and ovine interferon tau. Biol. Reprod. 58:1154-1162. Spicer, L. J., E. Alpizar, and S. E. Echter nkamp. 1993. Effects of insulin, insulin-like growth factor I, and gonadotropins on bovine granulosa cell proliferation, progesterone production, estradiol production, and (or) insulin-like growth factor I production in vitro. J. Anim. Sci. 71:1232-1241. Spicer, L. J., and S. E. Echternkamp. 1995. The ovarian insulin and insulin-like growth factor system with an emphasis on domes tic animals. Domest. Anim. Endocrinol. 12:223-45 Spicer, L. J., W. B. Tucker, and G. D. Adams. 1990. Insulin-like growth factor-I in dairy cows: relationships among energy balan ce, body condition, ovarian activity, and estrous behavior. J. Dairy Sci. 73:929-937.

PAGE 315

293 Sreenan, J. M., M. G. Diskin, and D. G. Mo rris. 2001. Embryo survival rate in cattle: a major limitation to the achievement of high fertility. Brit. Soc. Anim. Sci. Occasional Publ. 26:93-104. Staels, B., W. Koenig, and A. Habib. 1998. Activation of human aortic smooth-muscle cells is inhibited by PPAR but not by PPAR activators. Nature 393:790-793. Stanisiewski, E. P., L. F. Krabill, and J. W. Lauderdale. 1992. Milk yield, health, and reproduction of dairy cows given soma totropin (Somavubove) beginning early postpartum. J. Dairy Sci. 75:2149-2164. Staples, C. R., J. M. Burke, and W. W. Thatcher. 1998. Influence of supplemental fats on reproductive tissues and performance of lactating cows. J. Dairy Sci. 81:856871. Staples, C. R., W. W. Thatcher, and J. H. Clark. 1990. Relationship between ovarian activity and energy status during the early postpartum period of high producing dairy cows. J Dairy Sci. 1990 73:938-47. Staples, C. R., M. C. Wiltbank, R. R. Grummer, J. Guenther, R. Sartori, F. J. Diaz, S. Bertics, R. Mattos, and W. W. Thatcher. 2000. Effect of long chain fatty acids on lactation performance and reproductive tissues of Holstein cows. J. Dairy Sci. 83(Suppl.1):278. (Abstr.) Starbuck, G. R., A. O. Darwash, G. E. Mann, and G. E. Lamming. 2001. The detection and treatment of post insemination progester one insufficiency in dairy cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:447-450. Stewart, D. M., G. A. Johnson, C. A. Vyhlidal R. C. Burghardt, S. H. Safe, L. Y. YuLee, F. W. Bazer, and T. E. Spencer. 2001. Interferon-tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142:98-107. Stubbs, C. D., and A. D. Smith. 1984. The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochem. Biophys. Acta. 779:89-137. Sun, X. J., P. Rothenberg, and C. R. Kahn. 1991. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352:73-77. Tamminga, S., P. A. Luteijn, and R. G. M. Meijer. 1997. Changes in composition and energy content of live weight loss in dairy cows with time after parturition. Livest. Prod. Sci. 52:31-38. Teixeira, M. G., K. J. Austin, D. J. Perry, V. D. Dooley, G. A. Johnson, B. R. Francis, and T. R. Hansen. 1997. Bovine granuloc yte chemotactic protein-2 is secreted by the endometrium in response to interfer on-tau (IFN-tau). Endocrine 6:31-37.

PAGE 316

294 Thatcher, W. W., F. W. Bazer, D. C. Sharp, a nd R. M. Roberts. 1986. Interrelationships between uterus and conceptus to mainta in corpus luteum function in early pregnancy: sheep, cattle, pig and horses. J. Anim. Sci. 62:25-46. Thatcher, W. W., A. Guzeloglu, R. Mattos, M. Binelli, T. R. Hansen, and J. K. Pru. 2001. Uterine-conceptus interactions a nd reproductive failure in cattle. Theriogenology 56:1435-50. Thatcher, W. W., M. D. Meyer, and G. Dane t-Desnoyers. 1995. Maternal recognition of pregnancy. J. Reprod. Fertil. Suppl. 49:15-28. Thatcher, W. W., C. R. Staples, G. Danet-Des noyers, B. Oldick, and E. P. Schmitt. 1994. Embryo health and mortality in sheep and cattle. J. Anim. Sci. 72(Suppl. 3):16-30. Thatcher, W. W., D. Wolfenson, J. S. Curl, L. E. Rico, J. J. Knickerbocker, F. W. Bazer, and M. Drost. 1984. Prostaglandin dynamics associated with development of the bovine conceptus. Anim. Reprod. Sci. 7:149-176. Thissen, J.-P., J.-M. Ketelslegers, and L. E. Underwood. 1994. Nutritional regulation of the insulin-like growth fact ors. Endocr. Rev. 15:80-101. Thompson, J. A., D. D. Magee, M. A. Tomaszew ski, D. L. Wilks, and R. H. Fourdraine. 1996. Management of summer infertility in Texas Holstein dairy cattle. Theriogenology 46:547. Thurmond, M. C., J. P. Picanso, and C. M. Jameson. 1990. Considerations for use of descriptive epidemiology to investigate feta l loss in dairy cows. J. Am. Vet. Med. Assoc. 197:1305-1312. Tocher, D. R., M. J. Leaver, and P. A. Hodgson. 1998. Recent developments in the molecular biology and biochemistry of fa tty acyl desaturases. Prog. Lipid Res. 37:73-117. Townson, D. H., P. C. W. Tsang, W. R. Butler, M. Frajblat, L. C. Griel, C. J. Johnson, R. A. Milvae, G. M. Niksic, and J. L. Pate. 2002. Relationship of fertility to ovarian follicular waves before breeding in dairy cows. J. Anim. Sci. 80:1053. Tuggle, C. K., and A. Trenkle. 1996. Cont rol of growth hormone synthesis. Domest. Anim. Endocrinol. 13:1-33. Tulppala, M., U. H. Stenman, B. Cacciato re, and O. Ylikorkala. 1993. Polycystic ovaries and levels of gonadotrophins and androgens in recurrent miscarriage: prospective study in 50 women. Brit. J. Obstet. Gynaecol. 100:348-352. Vallet, J. L., P. J. Barker, G. E. Lammi ng, N. Skinner, and N. S. Huskisson. 1991. A low molecular weight endometrial secretor y protein which is increased by ovine trophoblast protein-1 is a beta 2-microglofulin-like protei n. J. Endcrinol. 130:R1R4.

PAGE 317

295 Van der Walt, J. G. 1994. Somatotropin physio logy: a review. 1994. S. Afr. J. Anim. Sci. 24:1-9. Vandehaar, M. J., B. K. Sharma, and R. L. Fogwell. 1995. Effect of dietary energy restriction on the expression of insulin-li ke growth factor-I in liver and corpus luteum of heifers. J. Dairy Sci. 78:832-841. Vasconcelos, J. L. M., R. W. Silcox, J. A. Lacerda, J. R. Pursley, and M. C. Wiltbank. 1997. Pregnancy rate, pregnancy loss, and re sponse to heat stress after AI at 2 different times from ovulation in da iry cows. Biol. Reprod. 56(Suppl.1):140. (Abstr.) Vega, J. R., C. A. Gibson, T. C. Skaar, D. L. Hadsell, and C. R. Baumrucker. 1991. Insulin-like growth factor (IGF)-I and II and IGF bindi ng proteins in serum and mammary secretions during the dry period a nd early lactation in dairy cows. J. Anim. Sci. 69:2538-2547. Vicini, J. L., F. C. Buonomo, J. J. Veenhuizen, M. A. Miller, D. R. Clemmons, and R. J. Collier. 1991. Nutrient balance and stage of lactation affect responses of insulin, insulin-like growth factors I and II, and insulin-like growth factor-binding protein 2 to somatotropin administration in dairy cows. J. Nutr. 121:1656-1664. Waterman, D. F., W. J. Silvia, R. W. Hemke n, G. Heersche, Jr., T. S. Swenson, and R. G. Eggert. 1993. Effect of bovine somatotr opin on reproductive function in lactating dairy cows. Theriogenology 40:1015-1028. Waters, M. J., S. W. Rowlinson, R. W. Clarks on, C. Chen, P. E. Lobie, G. Norstedt, H. Mertani, G. Morel, R. Brinkworth, C. A. Wells, S. Bastiras, A. R. Robins, G. E. Muscat, and R. T. Barnard. 1994. Signa l transduction by th e growth hormone receptor. Proc. Soc. Exp. Biol. Med. 206:216-220. Wathes, D. C., and M. Hamon. 1993. Loca lization of estradiol, progesterone and oxytocin receptors in the uter us during the estrous cycle and early pregnancy of the ewe. J. Endocrinol. 138:479-491. Wathes, D. C., and G. E. Lamming. 1995. Th e oxytocin receptor, luteolysis and the maintenance of pregnancy. J. Reprod. Fertil. Suppl. 49:53-67. Wathes, D.C., T. S. Reynolds, R. S. Robinson, and K. R. Stevenson. 1998. Role of the insulin-like growth factor system in uter ine function and placental development in ruminants. J. Dairy Sci. 81:1778-1789. White, M. F., and C. R. Kahn. 1994. The insulin signaling system. J. Biol. Chem. 269:1-4.

PAGE 318

296 Wilcox, C. J., W. W. Thatcher, and F. G. Mar tin. 1990. Statistical an alysis of repeated measurements in physiological experiments. In: Proceedings of the Final Research Co-ordination Meeting of the FAO/ IAEA/ARACAL III Regional Network for Improving the Reproductive Management of Meatand Milk-Producing Livestock in Latin America with the Aid of Radioimmunoassay. International Atomic Agency, Vienna 1990; 141 -145. Wildman, E. E., G. M. Jones, P. E. Wagner, H. F. Troutt, and T. N. Lesch. 1982. A dairy cow body condition scoring system a nd its relationship to selected production characteristics. J. Dairy Sci. 65:495-501. Wilkins, J. F., W. D. Hoffman, S. K. Lar sson, B. A. Hamilton, D. W. Hennessy, and M. A. Hilard. 1996. Protected lipid/pro tein supplement improves synchrony of oestrous and conception rate in beef cows. Page 19-2 in Congress Programme of the 13th Int. Congr. Anim. Reprod., Si dney, New South Wales, Australia. Wilkinson, J. I. D., and M. E. Tarrant. 1991. Fertility of cows receiving somidobove in European studies. J. Dairy Sci. 74(Suppl.1):P151. (Abstr.) Williams, G. L. 1989. Modulation of luteal activity in postpartum beef cows through changes in dietary lipid. J. Anim. Sci. 67:785-793. Williams, W. F., G. S. Lewis, W. W. Th atcher, and C. S. Underwood. 1983. Plasma 13,14-dihydro-15 keto PGF2 (PGFM) in pregnant and non pregnant heifers prior to and during surgery and following in trauterine injection of PGF2 Prostaglandins 25:891-899. Willson, T. M., P. J. Brown, D. D. Sternbach, and B. R. Henke. 2000. The PPARs: from orphan receptors to drug disc overy. J. Med. Chem. 43:527-550. Wolfenson, D., F. F. Bartol, L. Badinga, C. M. Barros, D. N. Marple, K. Cummins, D. Wolfe, M. C. Lucy, T. E. Spencer, and W. W. Thatcher. 1993. Secretion of PGF2 and oxytocin during hyperthermia in cyclic and pregnant heifers. Theriogenology 39:1129-1141. Wolfenson, D., B. J. Lew, W. W. Thatcher Y. Graber, and R. Meidan. 1997. Seasonal and acute heat stress effects on steroid pr oduction by dominant follicles in cow. Anim. Reprod. Sci. 47:9. Wolfenson, D., Z. Roth, and R. Meidan. 2000. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim. Reprod. Sci. 60-61:535-47. Xiao, C. W., J. M. Liu, J. Sirois, and A. K. Goff. 1998. Regulation of cycloxygenase and prostaglandin F synthase gene expr ession by steroid hormones and interferontau in bovine endometrial ce lls. Endocrinology 139:2293-2299. Yaqoob, P., and P. C. Calder. 1995. The eff ect of dietary lipid manipulation on the production of murine T-cell derived cytokines. Cytokine 7:548-553.

PAGE 319

297 Yaseen, M. A., C. Wrenzycki, D. Herrmann, J. W. Carnwath, and H. Niemann. 2001. Changes in the relative abundance of mRNA transcripts for in sulin-like growth factor (IGF-I and IGF-II) ligands an d their receptors (IGF-IR/IGF-IIR) in preimplantation bovine embryos derived from different in vitro systems. Reproduction 122:601-610. Yelich, J. V., R. P. Wettemann, T. T. Mars ton, and L. J. Spicer. 1996. Luteinizing hormone, growth hormone, insulin-like gr owth factor-I, insulin and metabolites before puberty in heifers fed to gain at two rates. Domest. Anim. Endocrinol. 13:325-338. Yung, M. C., M. J. VandeHaar, R. L. Fogwe ll, and B. K. Sharma. 1996. Effect of energy balance and somatotropin on insulin -like growth factor-I in serum and on weight and progesterone of corpus luteum in heifers. J. Anim. Sci. 74:2239-2244. Zapf, J., and E. R. Froesch. 1986. Insulin-lik e growth factors/somatomedins: structure, secretion, biological actions and physio logical role. Horm. Res. 24:121-130. Zarco, L., G. H. Stabenfeldt, S. Basu, G. E. Bradford, and H. Kindahl. 1988. Modification of prostaglandin F-2 synthesis and release in the ewe during the initial establishment of pregnancy. J. Reprod. Fertil. 83:527-536. Zeron, Y., A. Ocheretny, O. Kedar, A. Borochov, D. Sklan, and A. Arav. 2001. Seasonal changes in bovine fertility: rela tion to developmental competence of oocytes, membrane properties and fa tty acid composition of follicles. Reproduction 121:447-454. Zeron, Y., D. Sklan, and A. Arav. 2002. Effect of polyunsaturated fatty acid supplementation on biophysical parameters a nd chilling sensitivity of ewe oocytes. Mol. Reprod. Dev. 61:271-278. Zhao, X., J. H. Burton, and B. W. McBride. 1992. Health and reproduction of dairy cows receiving daily injectable or sustai ned-release somatotropin. J. Dairy Sci. 75:3122-3130. Zhou, Y., and D. J. Waxman. 1999. Cross-talk between janus kinase -signal transducer and activator of transcription (JAK-STAT) and peroxisome proliferator-activated recepetor(PPAR ) signaling pathways. J. Biol. Chem. 274:2672-2681. Zulu, V. C., T. Nakao, and Y. Sawamukai. 2002. Insulin-like growth factor-I as a possible hormonal mediator of nutritional re gulation of reproduction in cattle. J. Vet. Med. Sci. 64:657-665.

PAGE 320

298 BIOGRAPHICAL SKETCH Todd Bilby was born on April 15th 1976. He is the younger of two children. He attended elementary and high school at No rth Andrew in Rosendale, Missouri. Todd went on to Northeastern Oklahoma A & M Junior College in Miami, Oklahoma and earned his associates degree in animal scie nce in May 1996. He th en transferred to Oklahoma State University, where he received his bachelors degree in animal science (with a minor in agricultural economics) in May 1999. Todd then received a teaching and research assistantship from the Universi ty of Arkansas (in Fayetteville) to study bovine and porcine embryology. In May 2001, Todd received his masters degree in animal science, with an emphasis in repr oductive physiology. Todd received a research assistantship from the University of Florida (in Gainesville) to pursu e his doctoral degree with Dr. William W. Thatcher. After completing the requirements for a Doctor of Philosophy degree, he will be working for M onsanto as an Area Market Manager in Fresno, California.


Permanent Link: http://ufdc.ufl.edu/UFE0013084/00001

Material Information

Title: Effects of Polyunsaturated Fatty Acids and Bovine Somatotropin on Endocrine Function, Embryo Development, and Uterine-Conceptus Interactions in Dairy Cattle
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013084:00001

Permanent Link: http://ufdc.ufl.edu/UFE0013084/00001

Material Information

Title: Effects of Polyunsaturated Fatty Acids and Bovine Somatotropin on Endocrine Function, Embryo Development, and Uterine-Conceptus Interactions in Dairy Cattle
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0013084:00001


This item has the following downloads:


Full Text












EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE
SOMATOTROPIN ON ENDOCRINE FUNCTION, EMBRYO DEVELOPMENT, AND
UTERINE-CONCEPTUS INTERACTIONS IN DAIRY CATTLE















By

TODD RUSSELL BILBY


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Todd R. Bilby
































To my parents, Ross and Cheryl Bilby, for their endless support















ACKNOWLEDGMENTS

I am deeply indebted to Dr. William W. Thatcher, my supervisory committee chair.

Dr. Thatcher provided endless guidance, encouragement, inspiration, and financial

support. Dr. Thatcher provided me with the skills to be successful and instilled in me a

passion for knowledge. I am proud of the opportunity I had to work with him and will

always consider Dr. Thatcher an excellent mentor and great friend. I extend my

appreciation to my committee members: Dr. Peter J. Hansen, who allowed me to use his

laboratory for my final project and provided endless insight into my projects, curriculum,

and overall professional development; Dr. Lokenga Badinga for his teaching in the area

of nutritional physiology, and for always being willing to answer any questions; and Dr.

Nasser Chegini for the use of his laboratory and invaluable contributions. All committee

members provided continual support throughout my Ph.D. program.

I greatly appreciate Dr. Charles Staples for his patience and guidance in working

with me on my projects, editing papers, and providing knowledge on dairy cattle

nutrition. I would also like to thank Dr. Staples's graduate students: Mr. Bruno Amaral

for his help with my last research project and Mrs. Faith Cullens for her assistance at the

Dairy Research Unit with my projects.

I extend my appreciation to Mrs. Marie-Joelle Thatcher for all her help with

different hormone assays, statistics, excel spreadsheets, and for the excellent French

cuisine.









I would like to express my gratitude to Mr. Jeremy Block for being a great friend,

colleague, and roommate. Jeremy was always willing and able to help me at any time

during my projects at the DRU without complaint.

I owe special thanks to all of the members of the Thatcher Lab (Dr. Flavio

Silvestre, Dr. Julian Bartolome, Dr. Metin Pancarci, Dr. Allessandro Sozzi, Dr. Aydin

Guzeloglu, Mr. Ocilom Sa Filho) for helping with all aspects of my projects, for their

insightful discussions, and for the great camaraderie. I thank the laboratory technicians

who worked in Dr. Thatcher's laboratory (Mr. Oscar Hernandez, Mr. Frank Michel and

Ms. Idania Alverez) for teaching me various molecular biology techniques, and for their

continuous technical support.

I am very grateful to Dr. Shunichi Kamimura, Dr. Ana Meikle, Dr. Leslie

MacLaren, Dr. Maarten Drost, Dr. Tom Jenkins, and Dr. Alan Ealy for their assistance

and guidance with my research papers and projects.

I would like to acknowledge members of the Hansen Lab: Dr. Rocio Rivera, Mrs.

Amber Brad, Mr. Jeremy Block, Mr. Dean Jousan, Mr. Moises Franco, Ms. Maria Padua,

Dr. Luiz de Castro e Paula, Ms. Barbara Loureiro, Dr. Katherine Hendricks, and Dr. Zvi

Roth. I could always find someone in their laboratory to help me at any time, nights or

weekends. They included me in many of their social functions. Words cannot express all

the fun, friendship, and knowledge I gained through knowing each one of them.

I express appreciation to Dr. Herbert Head, Mrs. Joyce Hayen, Dr. Marcio Liboni,

and Dr. Tomas Belloso for their assistance with my radioimmunoassays.

I thank Mr. David Armstrong and Mrs. Mary Russell, and all the staff at the Dairy

Research Unit for their safe care and handling of the cows for all of my projects. I am









also very grateful to the faculty, staff and students of the Animal Sciences department for

creating a positive working environment, and for all their support, discussion, and

friendship.

I would like to extend special thanks to Ms. Myriam Lopez for her endless patience

and continuous support. Ms. Lopez always made herself available to help with my

research projects, no matter the time or day. There are not enough words to express how

thankful I am for her encouragement and meaningful friendship.

Last but not least, I extend my utmost sincere appreciation to my parents, Ross and

Cheryl Bilby. Their never-ending love and unconditional moral and financial support

brought me where I am today. They have always encouraged my brother and me to look

toward the future and experience life. Through them, I learned that hard work, a good

personality, a sense of humor, and a strong education will lead to success and happiness.

For all of that and much more, I thank them. I would also like to thank my brother, Chad

Bilby. His encouragement and excellent advice has proven true, time and time again. To

all my family and friends in both the United States and now in other countries, I give

heartfelt thanks.















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

L IST O F T A B L E S ............................ ....... ... ....... ...... .......... .... xii

LIST OF FIGURES ............. ............................... ....................... xv

LIST OF ABBREVIATIONS......... .. .... ... .......................... .............. xviii

ABSTRACT .............. .......................................... xxi

CHAPTER

1 INTRODUCTION ............... .................................. ................... 1

2 REVIEW OF LITERATURE ......................................................... .............. 7

Reproductive Challenges of the High-Producing Dairy Cow .............. ................7
Transition Period and Energy Balance ............ .............................................7
F fertility ........................................................................ . 9
F ollicle and E stradiol ................... .......................... .............. .......... 12
Corpus Luteum and Progesterone Production.........................................14
Oocyte Competence and Early Embryo ................................... .................16
Conceptus and Maternal Unit.. .. .............................................19
F atty A cid M etab olism ....................................................................... ..................22
E nzym es ................................................................... 22
B iohydrogenation ...................................... ................. .... ....... 24
Fatty-Acid Intermediates ................................... .... .. ..... ............... 25
Effects of Supplemental Lipids on the High-Producing Dairy Cow........................28
Transition Period and Energy Balance .............. ...... .............. ............ 28
F e utility ................................................................3 2
Follicles and E stradiol ..................................... ...... ......... ..... ..... 34
C orpus Luteum and Progesterone ............................................ .....................36
Oocyte and Early Embryo ............................................................................38
Conceptus and Maternal Unit................. ........... .....................41
Peroxisome Proliferator-Activated Receptors.................................................. 44
Bovine Somatotropin and the Insulin-Like Growth Factor System .........................46
B ovine Som atotropin .............................................. ....... ........................ 46
Structure, synthesis, and secretion .................................... ............... 46
R eceptor and ligand binding ............................................. ............... 50









Second m essengers.......... .................................... ...... ...... ..............5 1
Insulin-like Growth Factor System ........................................ ............... 52
Structure, synthesis, and secretion .................................... ............... 52
Receptors and ligand binding..... .................... ...............54
Second m essengers.......... .................................... ...... ...... ..............56
B in ding protein s ................................................. ............ ...... ............57
E effects on L actation ....... ............................................................. .. .... .. ... .. 58
Effects on Reproduction ........... .. ................ ............... 62

3 PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING
DAIRY COWS: RESPONSES OF THE OVARIAN, CONCEPTS AND IGF
S Y S T E M S ................................................................7 0

Intro du action .....................................................................................................7 0
M materials and M methods ....................................................................... ..................72
Materials .................. ......... ....... ........ 72
Animals and Experimental Design....................... ...............73
Tissue Sample Collection ............. .............. ................... 74
Interferon-tau Antiviral Assay ................ ........ .... ................... 75
Ribonucleic Acid Isolation and Northern Blotting................. ................76
Analysis of Hormones in Plasma and ULF ............. .... .................76
Analysis of Uterine Luminal IGFBPs .............. ........................77
Statistical A n aly ses.......... .............................................................. .. .... .... .. 7 8
R esults................. ... ........ ............................................ ........... 80
Pregnancy Rates, Conceptus Sizes, and Total Amount of IFN-T in ULF ...........80
Ovarian Responses on Days 7, 16, and 17 .................................. ............... 80
Plasma and ULF Hormone Concentrations.................................... ................ 81
Endometrial mRNA Expression of the GH/IGF-I System ............. .....................82
Analysis of ULF for IGFBPs ............. ......... ... .. ....... .....................82
Simple and Partial Correlations for the GH-IGF System ...............................82
D isc u ssio n ................................................... .................. ................ 8 3
C o n clu sio n s..................................................... ................ 9 0

4 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3
FATTY ACIDS IN LACTATING DAIRY COWS: I. OVARIAN,
CONCEPTS, AND GROWTH HORMONE-IGF SYSTEM RESPONSES ......100

Introduction .............. ... .. ........ .............. .............................100
M materials and M methods ........................................... ....................................... 102
M materials ................................ ......... .............. ...............102
Anim als and Experim ental D iets....................................... .......................... 103
Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment ......105
Tissue Sample Collection ............................... .......... ........... 106
Interferon-tau Antiviral Assay............. ......... .................................. 107
Quantitative Real-Time Reverse Transcription-PCR ............... ................... 107
Ribonucleic Acid Isolation and Northern Blotting.............................. 108
Analysis of Hormones in Plasma and Uterine Luminal Flushings.................... 109









Analysis of Uterine Luminal IGFBP................................. ............. ........... 110
Statistical A analyses .......... .......... .......................... .......... .. ........ .. ..111
Results ......... ................. ..... ...................... ......................113
Weight, BCS, and Milk Production before the Start of Synchronization .........113
Ovarian and Uterine Responses before the Start of Synchronization .............114
Concentrations of Plasma and ULF Hormones before the Start of
Synchronization ......................................................................... .. ........ .... 115
Milk Production after an Induced Ovulation................................ ...............115
Ovarian Responses after an Induced Ovulation ............. ........................116
Plasma and ULF Hormone Concentrations after an Induced Ovulation ..........116
Ovarian and Uterine Responses at D ay 17 ................................. .................118
Pregnancy Rates, Conceptus Sizes, IFN-T mRNA and Protein, and ISG-17
P protein at D ay 17 ..................................... .............. ... ...... ...... 118
Endometrial mRNA Expression of the GH-IGF-I System at Day 17 .............19
Analysis of ULF for IGFBP at Day 17................................... ...... ............... 120
Simple and Partial Correlations for the GH-IGF System at Day 17 ...............120
D isc u ssio n ............................ ...................................... ................ 12 1
C o n clu sio n s.................................................... ................ 12 8

5 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3
FATTY ACIDS IN LACTATING DAIRY COWS: II. GENE EXPRESSION
RELATED TO MAINTENANCE OF PREGNANCY ............................................143

In tro du ctio n ................................................................................................ ..... 14 3
M materials and M methods ........................................... ....................................... 146
M materials .............. .... .................. ............................. .... ......... 146
Animals and Experimental Diets .............................................. ...............146
Estrus Synchronization and Tissue Collection...............................147
Ribonucleic Acid Isolation and Northern Blotting.......................................149
Im m unohistochem ical A nalyses.................................... ........................ 150
M microscopic Im age A analysis .................................... ............................ ....... 151
Western Blotting for ERa and PGHS-2 Proteins ...........................................152
R adioim m unoasssay .......................................................... ............... 153
Statistical A n aly ses.......... ........................................................ .. .... .... ... 153
R esu lts ................................................................................................................. 154
Endom trial PR Expression .......................................................... ....... ........ 154
Endom trial ER a Expression ........................................ ........................ 155
Endom trial O TR Expression................................. ................. .. ............. 156
Endometrial PGHS-2 Expression.....................................................156
Endometrial PGFS and PGES mRNA Expression...............................157
Total Contents of PGF2a and PGE2 in ULF.....................................................157
Simple and Partial Correlations for the PG Cascade at Day 17 ......................157
D iscu ssion ................................................................................................ ..... 158
C o n clu sio n s.................................................... ................ 16 6









6 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3
FATTY ACIDS IN LACTATING DAIRY COWS: III. FATTY ACID
D IS T R IB U T IO N ........................................................................... .................... 172

Introdu action ................................................................................................ ..... 172
M materials and M ethods ........................................................ .......... ............... 174
A nim als and Experim ental D iets............................................... ................... 174
Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment ......175
Tissue Sam ple Collection ................................ ... .................. ................... 176
Milk Fat Isolation and Analyses of Fatty Acid Composition..........................177
Statistical A n aly ses.......... ........................................................ .. .... ..... .... 17 8
Results .......... .................... ...................................179
Long Chain Fatty Acid Composition among Tissues................... ......... 179
Fatty Acid Composition in Endometrium at Day 17......................................180
Fatty Acid Composition in Liver at Day 17 ................................................ 181
Fatty Acid Composition in Mammary Tissue at Day 17................................181
Fatty Acid Composition in Milk at Day 17 ................ ............................. 182
Fatty Acid Composition in M uscle at Day 17................................................ 182
Fatty Acid Composition in Subcutaneous Adipose Tissue at Day 17...............182
Fatty Acid Composition in Internal Adipose Tissue at Day 17.......................183
D iscu ssion ................................................................................................ ..... 183
C o n clu sio n s.................................................... ................ 19 2

7 EFFECTS OF DIETS ENRICHED IN DIFFERENT FATTY ACIDS ON
OOCYTE QUALITY AND FOLLICULAR DEVELOPMENT IN LACTATING
D A IRY COW S IN SU M M ER ...................................................................... ......204

Introdu action ................................................................................................ ..... 2 04
M materials and M methods ..................................................................... ..................206
M materials .............. ................................................ .........206
Animals and Experimental Diets .............................................. ...............207
Synchronization for OPU and TAI................................................................ 209
Blood and Temperature Sampling .............. .............................................. 210
Ultrasonography and OPU Procedure .................. ................. ............... 211
In Vitro Production of Embryos from Oocytes Collected by OPU..................212
In Vitro Production of Embryos from Ovaries Collected from an Abattoir......214
Group II Caspase Activity ..................................... ..... .....................214
The TUNEL Assay, Assessment of Total Cell Number, and Progression to
M etaphase II ............ ................. .................. ..................215
Statistical A n aly ses.......... ........................................................ .. .... ..... ... 2 16
R esults........................ ......... ........ .. ........ ........................... 217
Dry Matter Intake, Body Weight, and Milk Yield ........................................217
Follicle and Oocyte Responses to Different Diets ........................................218
Follicle and Oocyte Responses to Different Days of the Estrous Cycle...........219
Oocyte Quality for the 5th OPU session ................................. ............... 219
Internal IVF Control from Slaughterhouse Ovaries .......................................220
Progesterone, Ovarian, and Pregnancy Responses........................... .........220









D isc u ssio n ............................................................................................................ 2 2 1
C onclu sions ............................................ 229

8 GENERAL DISCUSSION AND CONCLUSIONS ............ ............... 240

L IST O F R E FE R E N C E S ........................................................................... ........ .......... 254

B IO G R A PH IC A L SK E T C H ........................................ ............................................298















LIST OF TABLES


Table page

3-1 Least squares means and pooled SE for concepts length, IFN-T (pg/total uterine
luminal flushing), number of corpora lutea (CL), CL tissue volume (mm3), and
CL weight (g) on d 17 after a synchronized estrus (d 0) in nonlactating cyclic
(C) and pregnant (P) cows injected with bST (+/-) on d 0 and 11 ........................92

3-2 Least squares means and pooled SE for uterine endometrial mRNA, uterine
luminal flushings (ULF) protein expression, and hormone concentration at d 17
after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P)
dairy cows injected with bST (+/-) on d 0 and 11........... .................................. 99

4-1 Ingredient and chemical composition of diets containing 0 or 1.9% calcium salts
offish oil enriched lipid product (FO). .............................. ...................................129

4-2 Bovine IFN-T primers and probe sequences used for quantitative real-time
reverse transcription-PC R ............................................ ..................................131

4-3 Least squares means and pooled SE for concepts size, interferon tau (IFN-T)
mRNA (mean fold effect), IFN-T (tg/total uterine luminal flushing [ULF]), IFN
stimulated gene-17 (ISG-17) protein, number of corpora lutea (CL), CL tissue
volume (mm3), CL weight (g), uterine endometrial mRNA, ULF protein
expression, and hormone concentration at d 17 after a synchronized estrus (d 0)
in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control
diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or
w without bST on d 0 and d 11 ............................................................................... 141

5-1 Least squares means and pooled SE for uterine endometrial mRNA and protein,
and uterine luminal flushings (ULF) protein expression at d 17 after a
synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant
(P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO)
diet and injected with or without bST on d 0 and 11 (n = 28). ............................168

5-2 Least squares means and pooled standard error (SE) for uterine endometrial
protein expression responses at d 17 after an induced ovulation (d 0) in lactating
dairy cows injected with or without bST on d 0 and 11............................... 169

5-3 Statistical analyses of uterine endometrial protein expression for Table 5-2.........170









6-1 Least squares means and pooled SE of the endometrium fatty acid profile (%
total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C)
cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed
a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and
11....... ....................................... ......... 194

6-2 Least squares means and pooled SE for different fatty acid percentages in
endometrium and liver tissue at d 17 after a synchronized estrus (d 0) in
lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet,
and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or
w without bST on d 0 and 11 ............................................................................. 195

6-3 Least squares means and pooled SE of the liver fatty acid profile (% total fatty
acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a
control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil
enriched lipid (FO) diet and injected with or without bST on d 0 and 11. ............196

6-4 Least squares means and pooled SE for the mammary tissue fatty acid profile (%
total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C)
cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed
a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and
11....... ....................................... ............... 197

6-5 Least squares means and pooled SE for different fatty acid percentages in
mammary tissue and milk fat at d 17 after a synchronized estrus (d 0) in
lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet,
and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or
w without bST on d 0 and 11 ............................................................................. 198

6-6 Least squares means and pooled SE for the milk fatty acid profile (% total fatty
acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a
control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil
enriched lipid (FO) diet and injected with or without bST on d 0 and 11. ............199

6-7 Least squares means and pooled SE for the muscle fatty acid profile (% total
fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows
fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a
fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. 200

6-8 Least squares means and pooled SE for different fatty acid percentages in
muscle, subcutaneous adipose, and internal adipose tissue at d 17 after a
synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant
(P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO)
diet and injected with or without bST on d 0 and 11 .................. ..................201









6-9 Least squares means and pooled SE for subcutaneous adipose tissue fatty acid
profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating
cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and
cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without
bST on d 0 and 11. .................... ............... .................................. 202

6-10 Least squares means and pooled SE for internal adipose tissue fatty acid profile
(% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic
(C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic
cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on
d 0 and 11. ...........................................................................203

7-1 The percent of fatty acids from the total fatty acids in the supplemental fat
sources. ............................................................... ........ .......... 231

7-2 Body temperature, and follicular and oocyte responses of lactating multiparous
and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans
(n = 14), C18:2 (n=13) or C18:3 (n =13). ................................... ............... 233

7-3 Follicular and embryonic responses of lactating multiparous and primiparous
cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2
(n=13) or C18:3 (n =13) and transvaginaly aspirated on d 3, 6, 9 and 12 of a
synchronized estrous cycle ........................................................ ............... 234

7-4 Oocyte quality responses from lactating multiparous and primiparous cows fed
diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or
C 18:3 (n = 13). ........................................................................235

7-5 Follicle, corpus luteum (CL) and pregnancy responses from lactating
multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14),
C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13) and transvaginally
asp rated ........................................................................ 2 3 9















LIST OF FIGURES


Figure page

2-1 Pathway of desaturation and elongation of linoleic and linolenic acids
sequentially acted upon by A-6 desaturase, elongase, and A-5 desaturase
e n z y m e s .......................................................................... 6 9

3-1 Experimental protocol illustrating the sequence of injections, collection of
samples, and day of ultrasonography. ........................................... ............... 91

3-2 Profiles of plasma progesterone concentrations of cyclic (C) cows (A) and
pregnant (P) cows (o) from d 0 to 17 of a synchronized estrous cycle (*P < 0.05;
aP < 0 .10 ) .......................................................................... 9 3

3-3 Profiles of plasma growth hormone (GH) concentrations of C (A), P (0), bST-C
(A), and bST-P (m) cows from d 0 to 17 of a synchronized estrous cycle .............94

3-4 Profiles of plasma IGF-I concentrations of C (A), P (o), bST-C (A), and bST-P
(m) cows from d 0 to 17 of a synchronized estrous cycle......................................95

3-5 Profiles of plasma insulin concentrations of C (A), P (o), bST-C (A), and bST-P
(m) cows from d 0 to 17 of a synchronized estrous cycle......................................96

3-6 Representative Northern blots of IGF-I, IGF-II, IGFBP-2 and IGFBP-3 mRNA. ..97

3-7 Representative Ligand Blot detected IGFBP-3, IGFBP-4 and IGFBP-5 in the
uterine luminal flushings (ULF) of cows on d 17 after a synchronized estrus
(dO) ................................................................................. 9 8

4-1 Experimental protocol illustrating the sequence of injections, collection of
samples, and day of ultrasonography. ....................................... ............... 130

4-2 Regression analysis (third order curves) of daily milk production starting 10
DIM until the start ofbST treatment and timed AI for cows fed either 0 (Least
squares means: m ) or 1.9% (Least squares means: o ) calcium salt offish oil
enriched lipid diets.. ............................. ..... .......... .. .............. 132

4-3 Linear regression of plasma insulin concentrations for cows fed fish oil enriched
lipid (FO) at 0 (Least squares means:m) or 1.9% (Least squares means: o) of
dietary D M from 14 to 53 D IM ................................................................... .. ..... 133









4-4 Overall pooled linear regression equations of GH (Least squares means:.) and
IGF-I (Least squares means: o ) plasma concentrations from 14 to 53 DIM for
all cows fed either 0 or 1.9% calcium salt offish oil enriched lipid diets. ............134

4-5 Regression analysis (second order curves) of daily milk production from d 0 to
17 of a synchronized estrous cycle (d 0) for cyclic and pregnant cows fed the
control diet and injected with bST (Least squares means: o ) or not (Least
squares means: m ) on d 0 and 11.............. .... ............................ ............ 135

4-6 Concentrations of plasma progesterone of cyclic cows injected or not injected
bST (n = 11) (A) and pregnant cows injected or not injected with bST (n = 10)
(o), measured from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05)
between d 0 and 11................... .................. ..... ..........136

4-7 Concentrations of plasma progesterone of cyclic and pregnant cows not given
bST (n = 10) (o) and those given bST (n = 11) (A) collected from d 0 to 17 of a
synchronized estrous cycle differed (P < 0.05) ..... ........ .... ................. 137

4-8 Profiles of plasma GH concentrations of cyclic cows fed control diet (no bST) (
A ), cyclic cows fed control diet with bST injections ( A ), cyclic cows fed FO (-
-x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed
control diet (no bST) ( o ), and pregnant cows fed control diet with bST
injections ( m ) from d 0 to 17 of a synchronized estrous cycle...........................138

4-9 Profiles of plasma IGF-I concentrations of cyclic cows fed control diet (no bST)
( A), cyclic cows fed control diet with bST injections ( A ), cyclic cows fed FO
(- -x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed
control diet (no bST) ( o ), and pregnant cows fed control diet with bST
injections ( m ) from d 0 to 17 of a synchronized estrous cycle............................139

4-10 Plasma insulin concentrations of cyclic cows fed a control diet (C), cyclic cows
fed the fish oil enriched diet (FO), and pregnant cows fed the control diet (P)
from d 0 to 17 of a synchronized estrous cycle.............. .............. ............... 140

4-11 Representative autoradiograph from ligand blot analysis of uterine luminal
IGFBP at d 17 following an induced ovulation............................... ...........142

5-1 Expression of PR (A, B, C), ERa (D, E, F), and PGHS-2 (G, H, I) in bovine
endometrium at d 17 following an induced ovulation..............................171

7-1 Experimental protocol illustrating the days in milk (DIM) for synchronization
injections, ultrasonography, ovum pick-up, and timed artificial insemination
(T A I; d 0). ....................................................................... 2 32

7-2 Percent of cleaved embryos at either the 2 to 3, 4 to 7 or > 8 cell stage on d 3
following insemination of either Holstein (n = 115) or Non-Holstein (n = 112)
oocytes collected from slaughterhouse ovaries with semen from Angus bulls......236









7-3 Percent of embryos on d 8 following insemination based on stage of
develop ent as affected by oocyte genotype........................................................ 237

7-4 Plasma progesterone concentration (ng/mL) and corpus luteum (CL) volume
(mm3) collected on d 3, 6, 9, 12, and 16 of a synchronized estrous cycle from
lactating multiparous and primiparous cows fed diets enriched in either C18:1
cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13). ....................238

8-1 Plasma GH (ng/mL) of pregnant cows that were nonlactating or lactating. Cows
received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11
after a synchronized insemination (Days 0 to 17)............... ................................. 248

8-2 Plasma IGF-I (ng/mL) of pregnant cows that were nonlactating or lactating.
Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH)
and 11 after a synchronized insemination (Days 0 to 17). .................................249

8-3 Plasma insulin (ng/mL) of pregnant cows that were nonlactating or lactating.
Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH)
and 11 after a synchronized insemination (Days 0 to 17). .................................250

8-4 Model diagram representing the effects of bST on genes and proteins of the
prostaglandin cascade in the endometrial cell of pregnant lactating dairy cows. ..251

8-5 Model diagram representing the effects of pregnancy on genes and proteins of
the prostaglandin cascade in the endometrial cell of lactating dairy cows ...........252

8-6 Model diagram representing the effects of an enriched fish oil diet on genes and
proteins of the prostaglandin cascade in the endometrial cell of lactating cyclic
dairy cow s.. ..............................................................................2 53















LIST OF ABBREVIATIONS


AA Arachidonic acid

AI Artificial insemination

BCS Body condition score

bST Recombinant bovine somatotropin

C Cyclic cows

CT Comparative threshold cycle

CL Corpus luteum

CLA Conjugated linoleic acid

COC Cumulus oocyte complexes

DGE Deep glandular epithelium

DHA Docosahexaenoic acid

DIM Days in milk

DIX Desaturase index

DMI Dry matter intake

DS Deep stroma

EPA Eicosapentaenoic acid

ERa Estradiol receptor a

FO Fish oil enriched lipid

FSH Follicle simulating hormone

GH Growth hormone


xviii









GHR Growth hormone receptor

GHRH Growth hormone-releasing hormone

GnRH Gonadotropin releasing hormone

IFN-T Interferon-T

IGF Insulin-like growth factor

IGFBP Insulin-like growth factor binding protein

IRS-1 Insulin receptor substrate-1

JAK2 Janus kinase 2

KSOM Potassium simplex optimized medium

LCFA Long chain fatty acid

LE Luminal epithelium

LH Luteinizing hormone

MUFA Monounsaturated fatty acid

OCM Oocyte collection medium

OMM Oocyte maturation medium

OPU Ovum pick-up

OTR Oxytocin receptor

P Pregnant cows

PG Prostaglandin

PGES Prostaglandin E synthase

PGFM 13, 14-dihydro-15-keto-PGF2, metabolite

PGF2, Prostaglandin F2 alpha

PGFS Prostaglandin F synthase









PGHS-2 Prostaglandin H synthase-2

PPAR Peroxisome proliferator-activated receptors

PR Progesterone receptor

PUFA Polyunsaturated fatty acid

PVP Polyvinylpyrrolidone

SFA Saturated fatty acid

SGE Superficial glandular epithelium

SS Superficial stroma

STAT Signal transducer and activator of transcription

TALP Tyrodes albumin lactate pyruvate

TAI Timed artificial insemination

TUNEL Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling

ULF Uterine luminal flushings

UFA Unsaturated fatty acid















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE
SOMATOTROPIN ON ENDOCRINE FUNCTION, EMBRYO DEVELOPMENT, AND
UTERINE-CONCEPTUS INTERACTIONS IN DAIRY CATTLE

By

Todd R. Bilby

December 2005

Chair: William W. Thatcher
Major Department: Animal Sciences

A series of experiments were conducted to investigate mechanisms through which

polyunsaturated fatty acids (PUFA) and bovine somatotropin (bST) increase fertility.

The first study used nonlactating dairy cows to examine the effects ofbST on

components of the insulin-like growth factor (IGF) system. Exogenous bST decreased

pregnancy rates. However, concepts length and interferon-tau (IFN-T) in uterine

flushings were increased. The bST may have hyper-stimulated IGF-I and insulin

concentrations, causing detrimental effects on concepts viability.

The second experiment used the same estrous synchronization protocol and bST

treatment as the first study; however, lactating dairy cows were used and effects of a diet

supplemented with a fish oil enriched lipid (FO) were evaluated. Exogenous bST

increased pregnancy rates, concepts size, and IFN-T in uterine flushings. The FO altered

uterine gene expression, proteins, and plasma hormones in a manner that mimicked

pregnancy. Furthermore, FO reduced the n-6:n-3 ratio and increased conjugated linoleic









acid (CLA) concentrations in milk. Pregnancy altered endometrial expression of certain

antiluteolytic associated genes and fatty acid composition, which may attenuate the

luteolytic pulsatile secretion of prostaglandin F2 alpha (PGF2a) contributing to embryo

survival.

In the last experiment, diets enriched in different omega fatty acids altered oocyte

quality and follicular dynamics in lactating dairy cows. The C18:2 enriched diet reduced

oocyte quality, as indicated by reduced in vitro embryo development, versus a C18:1 cis

enriched diet. Previously documented benefits of PUFA on reproductive responses

reflect actions at alternative biological windows other than oocytes from follicles < 12

mm. Possible beneficial effects of PUFA on the periovulatory follicle and corpus luteum

(CL) were evident by the increase in dominant follicle size and CL volume due to feeding

PUFA.

In summary, bST had differential responses on fertility which were dependent on

lactational status. The bST appears to increase pregnancy thru increased concepts

length and subsequent IFN-T production in lactating dairy cows and by altering IGF gene

expression in uterine endometrium. The FO altered endometrial responses and fatty acid

distribution which may benefit pregnancy. Diets enriched in particular fatty acids may

have different effects on oocyte quality and follicular dynamics in lactating dairy cows.














CHAPTER 1
INTRODUCTION

Over the past decade commercial dairy farms have changed dramatically. The

amount of milk produced per cow, larger herd sizes, genetic selection, and improved

management and nutrition are just some of these changes. A shift toward more

productive, large-scale farms has been associated with a decline in reproductive

efficiency. Beam and Butler (1999) reported that conception rates have declined from

66% in 1951 to approximately 40% in 1999. During this same period, yearly milk

production per cow increased 218% (National Agricultural Statistics Service, USDA).

However, Butler and Smith, (1989) indicated no negative genetic trend on fertility

because conception rates after artificial insemination (AI) in nonlactating heifers

remained constant (between 70 and 80%) during this same time period. In addition,

Lopez-Gatius et al. (2005) indicated that high individual milk production can be

positively related to high fertility. In contrast, other studies indicate that there is clearly

an antagonistic relationship between milk production and reproduction in dairy cattle

(Dematawewa and Berger, 1998; Hansen, 2000).

The important determinant of dairy farm profitability is the amount of milk

produced and sold. Earlier studies reported that to increase farm profitability, calving

intervals need to be between 12 to 13.5 months to increase the amount of time cows

spend in peak milk production (Louca and Legates, 1968; Holmann et al., 1984).

However, in recent years, reports recommend extending calving intervals to 14 to 15

months (Arbel et al., 2001; Roenfeldt, 1996). The logic underlying this recommendation









is that there is less need to initiate another lactation in a cow if she is producing at

relatively high levels in the latter days of lactation. The increased calving interval may

depend on variables such as increased milk production, milk prices, parity, and

replacement heifer prices. Cows with greater milk production have a better chance of

staying in the herd longer compared with cows in lower milk production which would

ultimately increase the calving interval. In order for a dairy farm to achieve a calving

interval of 14 months, cows need to become pregnant within the first 140 days of

lactation. Presently pregnancy and parturition are still the only means of inducing

copious secretion and production of milk. Therefore strategies to increase reproduction

would prove beneficial for farm profitability.

Most reproductive inefficiency on dairy farms is due to a high rate of embryonic

mortality, particularly early embryonic losses. Early embryonic loss, as defined by

Santos et al. (2004a), is the loss of a pregnancy before d 24 after fertilization.

Fertilization rate is approximately 76% but pregnancy rate falls to approximately 40% at

30 d after AI. Thurmond et al. (1990) estimated that dairy farms, on average, lose $640

for each pregnancy lost. Decreasing the high amount of early embryonic loss would

increase both reproductive performance and total milk production, and thus improve the

economic success or profitability of dairy farms.

A critical point within the time period constituting early embryonic loss is when the

elongating concepts interacts with the maternal unit to sustain the CL, thereby

maintaining pregnancy. Between d 15 to 17 after estrus, the concepts produces maximal

amounts of IFN-T which leads to the inhibition of episodic pulses of PGF2, (Thatcher et

al., 2001). The PGF2a causes CL regression, which induces a return to estrus in









nonpregnant cows or terminates the pregnancy with a loss of the embryo. Therefore,

some of the embryonic losses in cattle are thought to be mediated by the inability of the

concepts to suppress the luteolytic cascade during the period of CL maintenance

(Thatcher et al., 1986). One potential reason for the inability of the concepts to suppress

PGF2a is due to reduced development and growth of the embryo/conceptus thereby

reducing the amount of IFN-T available to prevent luteolysis. Elongation of the embryo

is associated with increased secretion of IFN-T (Hansen et al., 1988). Therefore

stimulation in concepts length, (thereby increasing IFN-T) may reduce the amount of

embryonic loss. An alternative way to reduce embryonic loss would be through

regulation of endometrial tissue to attenuate mechanisms involved in the biosynthesis of

PGF2a. This later strategy, coupled with IFN-T produced from an underdeveloped

concepts, may provide a strong enough signal to overcome luteolysis and enhance

embryo survival.

Two strategic approaches may be used to decrease early embryonic loss (without

compromising milk production) and to increase milk production. The first strategy is to

use bST. The recombinant bST is produced through fermentation technology and is

coupled with a slow release formulation, allowing bST to be injected biweekly to

increase milk production. The administration ofbST to dairy cows is now an accepted

and widely used management practice (Bauman, 1999). However, in earlier studies, bST

administration was shown to have negative effects on reproductive performance (Cole et

al., 1991; Downer et al., 1993). One of the main negative effects of bST is a reduction in

estrus behavior that contributes to poor reproductive efficiency due to decreased rates of

heat detection. With the advent of timed artificial insemination (TAI) programs such as









Ovsynch, the need for estrus detection was eliminated. Several studies indicated that bST

given at or around TAI increased pregnancy rates (Moreira et al., 2000b and 2001; Santos

et al., 2004b; Morales-Roura et al., 2001). In addition, Moreira et al. (2002a and 2002b)

reported that bST increased embryonic development when measured at d 7 after

fertilization utilizing an in vitro as well as in vivo model with the use of lactating dairy

cows. Furthermore, bST reduced endometrial PGF2, secretion in vitro (Badinga et al.,

2002). However the mechanisms by which bST increases pregnancy rates during the

critical window of CL maintenance are unknown.

The second strategy to increase fertility and possibly milk production is by using

supplemental fats in the diet. Supplemental fats are used as an energy source in the diet

to support the high demands of lactation. One such fat source is fish meal or fish oil

which is relatively high in two fatty acids: eicosapentaenoic acid (EPA) and

docosahexanoic acid (DHA). Fish meal increased pregnancy rates in lactating dairy cows

(Carroll et al., 1994; Bruckental et al., 1989; Armstrong et al., 1990). In addition, feeding

fish meal (Mattos et al., 2002) or fish oil (Mattos et al., 2004) to lactating dairy cows

reduced circulating concentrations of PGF2,. Production of PGF2a was also reduced by

bovine endometrial cells when incubated with EPA and DHA (Mattos et al., 2003).

Several mechanisms by which EPA and DHA can decrease PGF2, have been

hypothesized; however, the precise mechanisms) are unknown.

Another beneficial effect of supplementing diets with long chain fatty acids

(LCFA; such as those found in fish oil) is the health-promoting factors that are increased

in the milk for human consumption. Unsaturated fatty acids (UFA) have

anticarcinogenic effects and other human health-promoting properties (Bauman et al.,









2001). Understanding the mechanisms by which fish oil increases fertility may be

beneficial for the cow; understanding how fish oil regulates fatty acid distribution in meat

and milk for human consumption may be beneficial for humans.

Although supplemental fat feeding has shown to increase fertility, studies have not

been conducted to document which fatty acids are beneficial, which ones have no effect

and which ones have negative effects on reproductive processes. Understanding which

fatty acids are beneficial, and formulating diets enriched in those particular fatty acids,

may enhance reproductive performance.

This dissertation will review the many reproductive challenges facing the modern

day dairy cow and the effects of both supplemental fat feeding and bST administration on

reproduction (Chapter 2). In addition, experiments are described that were conducted to

elucidate the mechanisms by which bST increases pregnancy rates, in particular, at the

time when there is a dialogue between concepts and endometrium to maintain the CL.

The nonlactating dairy cow was used first (Chapter 3) as an experimental model to

evaluate bST effects given at TAI on concepts and endometrial function at d 17 of the

estrous cycle or pregnancy. Ovarian function, concepts development, and regulation of

the GH-IGF system in the uterus were examined. This study was repeated in a second

experiment using lactating dairy cows as the experimental model and also examining the

effects of a supplement containing calcium salts of fish oil enriched lipid. Responses

evaluated were:

Ovarian, concepts and the GH-IGF system (Chapter 4)

Endometrial gene expression related to the maintenance of pregnancy (Chapter 5)

Distribution of fatty acids in tissues and milk (Chapter 6)






6


The last experiment (Chapter 7) evaluated the effects of diets enriched in different UFA

on oocyte quality and follicular development in lactating dairy cows.














CHAPTER 2
REVIEW OF LITERATURE

Reproductive Challenges of the High-Producing Dairy Cow

Transition Period and Energy Balance

A critical time period in the life cycle of dairy cattle is the period 3 weeks before

and after calving (the transition period). Many dramatic physiological changes occur to

both endocrine and nutritional statuses to support milk production. Just before

parturition, nutrient demand increases markedly to satisfy late fetal development at a time

when dry matter intake (DMI) is decreasing. Consequently, body reserves must be

mobilized to meet demand. After parturition, nutritional requirements increase suddenly

with initiation of milk production, and cows enter a negative energy balance. The degree

and duration of tissue mobilization are primarily related to DMI rather than milk yield.

The DMI can be influenced by several factors, such as body condition prior to

calving (Grummer, 1993), environment (Drew, 1999; Fuquay, 1981), diet (Allen, 2000),

management (Drew, 1999), and immune stressors like uterine, hoof, and (or) metabolic

disorders (Formigoni and Trevisi, 2003). Negative energy balance usually reaches its

lowest point or nadir between the second and third weeks of lactation (Butler and Smith,

1989). The DMI needs to increase four to six fold to meet the high nutrient demands of

milk production. However, the dairy cow in early lactation cannot increase DMI fast

enough to meet nutrient demands required for lactation and, as a result, fat and protein

are mobilized from body reserves. Tamminga et al. (1997) found that energy partitioning

in early lactation resulted in mobilization of 42 kg of empty body weight, 31 kg fat, and









5 kg protein. On a per-day basis, cows mobilized an average of 0.7 kg for empty body

weight, 0.56 kg for fat and 0.04 kg for protein; however, the largest part of the

mobilization occurs in the first week of parturition: 37% of empty body weight, 12% of

total fat, and 58% of total protein are mobilized. This further decrease in energy balance

profoundly affects fertility by decreasing luteinizing hormone (LH) pulse frequency,

reducing the diameter of the dominant follicle with low estradiol production, the period

of low concentrations of plasma progesterone, and increasing the interval to first estrus

(Roche et al., 2000).

Metabolic hormones also are altered with an increased concentration of growth

hormone (GH) possibly associated with an uncoupling of the GH receptor (GHR) and

IGF-I production (Kobayashi et al., 1999). The result is decreased systemic

concentrations of IGF-I and possibly intra-follicular IGF-I, decreased body condition

score (BCS), lower glucose and insulin concentrations of plasma, and higher

concentrations of nonesterified fatty acids, P-hydroxy butyrate and triacyl glycerol in

plasma (Beam and Butler, 1999; Roche et al., 2000). Thus high DMI early postpartum in

high-producing dairy cows is critical to normal resumption of ovulation and development

of a normal size CL with sufficient production of progesterone to sustain high fertility

(Vandehaar et al., 1995). Consequently, nutritional management of the high-producing

dairy cow during the transition period has significant carry-over effects on reproductive

efficiency. Staples et al. (1990) reported lower milk production and feed intake resulting

in a more-negative energy balance in anestrous dairy cows compared with cows that

returned to cyclic ovarian activity before d 60 postpartum. Lucy et al. (1992) fed cows a

high-energy diet to achieve a positive energy balance, or fed cows a low-energy diet to









maintain negative energy balance during the early postpartum period. The nonesterified

fatty acid levels were elevated and the IGF-I was reduced in cows fed the low energy

diet. In addition, the growth of the preovulatory follicles in cows fed the low energy diet

was reduced by 50% versus that of cows fed the high energy diet.

Fertility

Milk production per cow increased steadily during the last 20 years, because of a

combination of improved management, better nutrition, and intense genetic selection.

Also, dairy farms have moved toward larger-scale operations: nearly 30% of the dairy

farms in the United States have 500 or more cows (Lucy, 2001). This shift toward more

productive cows and larger herds is associated with a decrease in reproductive efficiency.

Butler (1998) documented a decline in first-service conception rate from approximately

65% in 1951 to 40% in 1996. Cows inseminated artificially at observed estrus typically

had conception rates of approximately 55% (Casida, 1961). However, more recent

studies report conception rates of approximately 45% for inseminations at spontaneous

estrus (Dransfield et al., 1998) and approximately 35% when TAI is used (Burke et al.,

1996; Pursley et al., 1997a, 1997b, and 1998).

During the last 10 years, milk production has increased approximately 20% and

reproductive efficiency has declined (Lucy, 2001). However, an epidemiology analysis

of reproductive performance in dairy cows indicated that the hazard ratio for initial

cumulative 60-d milk yield in US Holstein cattle was near 1.0 (i.e., neutral effect) on

conception rate (Grohn and Rajala-Schultz, 2000). Only at the highest level of milk

production was there a nonsignificant increase in hazard ratio. Other factors such as

postpartum disorders affected conception rate, suggesting that factors such as energy









balance, postpartum disease, embryonic loss, inbreeding, and heat stress are affecting

reproductive performance (Lucy, 2001).

Cows undergo a normal process of nutrient partitioning and adipose tissue

mobilization during early lactation (Bauman and Currie, 1980) associated with negative

energy balance, weight loss, and decreased BCS. This is the time when nutrient

requirements for maintenance and lactation exceed the ability of the cow to consume

energy in the feed. Garnsworthy and Webb (1999) found the lowest conception rates in

cows that lost more than 1.5 BCS units between calving and insemination. In addition,

Butler (2000) reported that conception rates range between 17% and 38% when BCS

decreases 1 unit or more, between 25% and 53% if the loss is between 0.5 and 1 unit, and

is >60% if cows do not lose more than 0.5 units or gain weight.

An inadequate immune status can negatively affect fertility in lactating dairy cattle.

Several epidemiological studies reveal a reduction in fertility for cows affected by

disorders of the reproductive tract (Labemia et al., 1999), mammary gland (Schrick et al.,

2001), feet (Dobson et al., 2001), and metabolic diseases such as ketosis, milk fever and

left-displaced abomasums (Markusfeld et al., 1997; Beaudeau et al., 2000). Retained

placenta, metritis, and ovarian cysts are risk factors for conception. Cows had lower

conception rates of 14% with retained placenta, 15% with metritis and 21% for those

with ovarian cysts (Grohn and Rajala-Schultz, 2000). Mastitis also significantly reduces

fertility in lactating dairy cattle (Hansen et al., 2004).

Embryonic loss is a large problem reducing fertility and farm profitability in

lactating dairy cows. In a recent review (Santos et al., 2004a), lactating dairy cows seem

to be most susceptible to reproductive failure in part due to low fertilization rate (- 76%)









and embryo viability in the first few days of gestation, but also because of extensive

embryonic and fetal death (- 60%). In heifers and moderate yielding dairy cows

(Sreenan et al., 2001) fertilization rates upwards of 90% and calving rates of

approximately 55% indicate an overall embryonic and fetal mortality rate of

approximately 40%. It was concluded that few embryos are lost after fertilization and up

to d 8 of pregnancy, and about 70 to 80% of total embryo loss occurs between d 8 and 18

after breeding. Subsequent losses were estimated to be around 10% between d 16 and 42

and 5 to 8% between d 42 and calving (Sreenan et al., 2001). Beef heifers were used to

determine embryo survival during distinct stages of pregnancy with 93% survival rates to

d 8, 66% to d 16 and 58% to d 42 (Diskin and Sreenan, 1980). Vasconcelos et al. (1997)

reported losses of 20% between 28 and 98 d after insemination in high-producing dairy

cows. Inadequate progesterone concentrations can cause changes in concentrations of

hormones such as LH and estradiol which can negatively affect the oocyte, embryo, and

uterine environment subsequently owing to high rates of embryonic loss (Inskeep, 2004).

Genetic selection for milk production has been optimized at the expense of fertility.

Inbreeding has increased in US Holsteins since 1980 (Lucy, 2001). Present levels of

inbreeding are approximately 5% and some have predicted that levels of inbreeding will

be 10% by 2020 (Hansen, 2000). Each 1% increase in inbreeding led to a 0.17 increase

in services per conception, a 2 d increase in days open, and a 3.3 percentage unit decrease

in conception rate. If these estimates are correct then inbreeding alone could account for

the decline in fertility since the 1980s.

Heat stress is a major contributing factor to the low fertility of dairy cows

inseminated in the summer months (Ray et al., 1992; Thompson et al., 1996). Bradley









(2000) reported the decade of the 1990s was the warmest since the beginning of

instrumental temperature recording capabilities. The decrease in conception rate during

the hot season can range between 20 and 30% compared to the winter season (Cavestany

et al., 1985; Badinga et al., 1985) Reproduction in high-producing dairy cows is

extremely sensitive to heat stress because of the high metabolic rate associated with

increased milk yields (Wolfenson et al., 2000). Al-Katanani et al. (1999) examined 90-d

return rates throughout the calendar year and reported that summer infertility was greatest

in the highest milk producing dairy cattle. Therefore, there are negative additive effects

of heat stress and increased milk production on first-service conception rate in dairy

cattle. There are also clear seasonal patterns in efficiency of estrus detection, day to first

service and conception rate in dairy cows with lower conception rates consistently

observed in summer months (Cavestany et al., 1985; Ryan et al., 1993; Almier et al.,

2002). There appear to be negative carry-over effects of heat stress on fertility into the

autumn months (Badinga et al., 1985; Wolfenson et al., 1997). It is suggested that this

could be an effect of heat stress damage on early antral follicles during the summer that

develop into large less fertile dominant follicles 40 to 50 d later (Roth et al., 2001).

Follicle and Estradiol

A transient increase in follicle stimulating hormone (FSH) at 2 or 3 d after

parturition induces emergence of a cohort of three to six follicles (4 to 6 mm) in diameter

and by d 10 one of these follicles will have achieved dominance (Roche and Diskin,

2001). The LH pulse frequency increases during the first 2 weeks after parturition and is

higher in cows that ovulate their first dominant follicle in comparison with cows that do

not (Beam and Butler, 1999). Cows have ovarian follicular waves with each wave being

7 to 10 d in duration and comprised of distinct phases defined as emergence, deviation,









dominance and atresia or ovulation. The cow's estrous cycle normally has one or two

non-ovulatory waves and a terminal ovulatory wave. Hormonal interactions within a

wave involve pituitary gonadotropins (LH and FSH), proteins and peptides of follicular

origin (inhibin and follistatin), ovarian steroids of follicular (estradiol) or luteal

(progesterone) origin (Mihm et al., 2002), and PGF2a having a critical role within the

ovulatory wave. Follicles generally reach ovulatory size at a diameter of 13 to 20 mm

with the interval between the preovulatory surge of LH and ovulation of 28 h. The LH

surge causes differentiation of the granulose cells from producing estradiol to

progesterone (Juengel and Niswender, 1999). The LH surge also activates an

inflammatory reaction involving both hyperemia and collagen degradation mediated by

increased production of PGE2 and PGF2a, leading to a thinning and eventual rupture of

the follicular wall (Espey, 1980).

Lactating Holstein cows tend to have two-wave cycles (Townson et al., 2002),

whereas beef and dairy heifers tend to have either two- or three-wave cycles (Ginther et

al., 1989). The peak and average plasma concentrations of FSH and inhibin are lower in

the two non-ovulatory waves of a three-wave cycle than in the ovulatory wave, but are

similar in two-wave cycles (Parker et al., 2003). Number of follicular waves in the cycle

preceding estrus did not influence the probability of conception in beef cattle; however,

there were only eight three-wave cycles to characterize conception rate (Ahmad et al.,

1997). Holstein cows with a three-wave cycle preceding insemination had higher

conception rates to first insemination than those with two waves (Townson et al., 2002).

Beef cows with three waves in the cycle following insemination had a higher conception

rate (Ahmad et al., 1997). Thus number of follicular waves in a cycle may increase the









probability of conception in animals with three-wave cycles. This could be because the

ovulatory follicle developed over a shorter period (Mihm et al., 1994; Townson et al.,

2002), or because there was a slightly longer luteal phase after insemination (Ginther et

al., 1989) that may benefit growth of the concepts.

Metabolism may also affect blood concentrations of estradiol. Sartori et al. (2002a)

reported lactating cows had larger preovulatory follicles than did heifers but lower

preovulatory concentrations of estradiol in blood. In a study comparing lactating and

nonlactating dairy cows, plasma estradiol concentrations during the preovulatory period

were several-fold higher in nonlactating compared with lactating cows (de la Sota et al.,

1993). Beam and Butler (1994) compared cows that were either not milked (Dry),

milked twice per day or three times per day following parturition. This resulted in

different energy balance and body weight loss among groups during the first 4 weeks

postpartum. Although peak plasma estradiol was similar among groups, maximum

diameter of the dominant preovulatory follicle from the first follicular wave postpartum

was larger in both the 3x and 2x cows compared with the dry cows. Therefore,

lactational status or large differences in energy balance do not prevent the formation of

follicular waves but apparently alter the growth and ultimate diameter of dominant

follicles.

Corpus Luteum and Progesterone Production

The CL is formed from an ovulated dominant follicle and secretes progesterone

which is critical for establishment and maintenance of pregnancy. Pregnant dairy cows

have greater concentrations of blood progesterone compared with non-pregnant dairy

cows within the first week to 10 d after insemination (Mann et al., 1999). Low plasma

progesterone has been associated with a decrease in fertility possibly due to increased









milk yield in high-producing lactating dairy cows (Lucy, 2001). Sartori et al. (2002a)

found that concentrations of progesterone and estradiol in lactating dairy cows were

lower than in heifers in summer and similar to dry cows in winter, despite the fact that

they had larger ovulatory follicles and larger CL.

Although CL mass of high-producing dairy cows may be larger, progesterone

secretion and clearance may be more important to fertility. Starbuck et al. (2001) showed

that cows with adequate milk progesterone (>3 ng/mL) had pregnancy rates of

approximately 50 to 55%, whereas cows with concentrations of < 1 ng/mL had pregnancy

rates < 10%. Lucy et al. (1998a) found lower plasma concentrations of progesterone in

higher producing cows than controls. Poor nutrition and weight loss in beef cattle causes

a decrease in blood progesterone concentrations (Beal et al., 1978).

Progesterone concentrations in blood are determined by rates of secretion,

metabolism, and clearance. The liver is the primary site of progesterone metabolism, and

progesterone and its metabolites are excreted in the feces, urine, and milk (Parr, 1992). A

study comparing dairy cows implanted with progesterone releasing devices, either

grazing pasture ad libitum or grazing pasture for a restricted period of time, showed that

cows grazing pasture ad libitum had lower plasma concentrations of progesterone

(Rabiee et al., 2000). In addition, Sangsritavong et al. (2000) demonstrated that liver

blood flow (liter/h) and progesterone metabolism (ng/mL) increased by greater than 50%

when feed intake was either acutely or chronically increased. Sheep also demonstrated

an increase in progesterone metabolism with increased level of feeding (Parr, 1992). The

previous studies concluded that the modern day high-producing dairy cow has lower

blood concentrations of progesterone due to an increased metabolic rate associated with









increased consumption of feed to meet energy demands for lactation. During lactation,

luteal phase progesterone concentrations were lower in higher yielding dairy cows, and

there was a delay in the increase of progesterone in the early luteal phase in cows with

peak milk production > 42 kg/day. However, in lower yielding cows no such

relationships are apparent (Lucy and Crooker, 2001). Also, it has been suggested that

lower progesterone concentrations may be related to a greater liver mass and associated

higher catabolic activity when cattle and sheep receive a greater dietary input

(O'Callaghan et al., 2001).

Oocyte Competence and Early Embryo

The ability of an oocyte to mature, be fertilized and finally develop into a viable

embryo is acquired gradually by the oocyte during folliculogenesis. During the period

just prior to ovulation, cytoplasmic and nuclear maturation occurs allowing for

developmental competence of the early embryo. During this long period of follicular

growth up to ovulation, developmental competence of the oocyte is determined. Thus

many diseases and disorders may negatively affect oocytes within follicles that begin

their development during the early postpartum period. For instance, during the early

postpartum period the high-producing dairy cow goes through a negative energy balance

and body weight loss as mentioned previously. Snijders et al. (2000) found that the

ability of an oocyte to be fertilized and develop to the blastocyst stage in vitro was

affected by body condition of the donor dairy cow. Oocytes fertilized in vitro from dairy

cows in low body condition had a lower cleavage rate and lower developmental rate

compared with oocytes from dairy cows in better body condition. They also noted

reduced developmental competence of oocytes collected from high genetic merit and first

lactation cows, suggesting that reproductive efficiency is compromised by genetic









selection as well as first lactation. The exact period of nutritional imprinting of the

oocyte is not known but many have speculated that it occurs during the 2 months that it

takes upon activation for a follicle to progress from the primordial to preovulatory stage.

The possibility that the modern day dairy cow has poor oocyte quality and low

fertilization capacity in vivo has been examined by comparing cleavage stage of embryos

from lactating and nonlactating dairy cattle (Sartori et al., 2002b). The percentage of

normal embryos 4 to 5 d after estrus was low (58%) for lactating cattle and lower than

historical values reported by Ayalon (1978). The percentage of normal embryos for

nonlactating dairy cattle was comparable to historical values for normal lactating cattle

(82%). The percentage of early stage embryos in lactating cows approached that

expected for repeat-breeder cattle (cows with four or more inseminations and failing to

achieve pregnancy) described in the 1970s (Ayalon, 1978). Sartori et al. (2002b)

concluded that high milk production exerts negative effects on oocyte quality and embryo

development that can be detected by 5 d after ovulation. Also the detrimental effect is

augmented by increased environmental temperature due to pronounced heat stress in

lactating cows reducing fertilization rate. Gwazdauskas et al. (2000) collected oocytes

throughout lactation (30 to 100 days in milk [DIM]) by twice weekly follicular aspiration

and concluded that cows on high energy diets produced more high quality oocytes, but

stage of lactation negatively influenced oocyte quality.

During the summer months, heat stress reduces pregnancy and conception rates

which can carry-over into the fall months (Wolfenson et al., 2000). Oocytes obtained

from dairy cows collected during the summer heat stress period had reduced

developmental competence in vitro (Rocha et al., 1998). In this experiment oocytes were









collected from Holstein cows with ultrasound guided aspiration. The proportion of

oocytes classified as morphologically normal and the rate of blastocyst development

following in vitro fertilization was lower in summer versus winter. Rutledge et al. (1999)

also reported a decrease in the number of Holstein oocytes that developed to the

blastocyst stage during July and August compared to cooler months. In both of these

studies, fertilization rate was not affected by season but the lower development following

fertilization during the summer was indicative of oocyte damage. When superovulated

donor heifers were exposed to heat stress for 16 h beginning at the onset of estrus, there

was no effect on fertilization rate. However, there was a reduced number of normal

embryos recovered on d 7 after estrus (Putney et al., 1988a). This illustrates that a brief

heat stress can still affect oocyte competence within the periovulatory follicle. In

addition, exposure of cultured oocytes to elevated temperature during maturation

decreased cleavage rate and the proportion of oocytes that became blastocysts (Edwards

et al., 1997).

Heat stress can also affect the early developing embryo. When a heat stress was

applied from d 1 to 7 after estrus there was a reduction in embryo quality and stage from

embryos flushed from the reproductive tract at d 7 after estrus (Putney et al., 1989). In

addition, embryos collected from superovulated donor cows in the summer months were

less able to develop in culture than embryos collected from superovulated cows during

the fall, winter, and spring months (Monty and Racowsky, 1987). Drost et al. (1999)

demonstrated that transfer of in vivo produced embryos from cows exposed to

thermoneutral temperatures increased pregnancy rate in heat stressed recipient cows

compared to that in heat stressed cows subjected to AI. Embryos appear to have









developmental stages in which they are more susceptible to the deleterious effects of heat

stress as shown in vitro. Heat shock in vitro at the 2 to 4 cell stage caused a larger

reduction in embryo cell number than heat shock at the morula stage (Paula-Lopes and

Hansen, 2002). Earlier studies also showed that heat shock caused a greater reduction in

embryo development when applied at the 2 cell stage than the morula stage (Arechiga et

al., 1995; Edwards and Hansen, 1997) or at d 3 following fertilization than at d 4 (Ju et

al., 1999).

Conceptus and Maternal Unit

High rates of embryonic loss have been observed between the period of conception

and around the time of maternal recognition of pregnancy, which occurs between d 17 to

19 after estrus (Mann et al., 1999). During this time, the concepts must secrete

sufficient amounts of IFN-T to inhibit CL regression in order to maintain both

progesterone production and pregnancy. Discord between the concepts secretions and

maternal unit can cause early embryonic loss. Studies utilizing embryo transfer and early

pregnancy diagnosis indicate that less than 50% of the viable embryos establish

pregnancy by 27 to 30 d after ovulation in lactating dairy cows (Drost et al., 1999; Santos

et al., 2004a), whereas in beef cattle 69 and 83% of frozen and fresh embryos,

respectively, establish pregnancy on d 37 of gestation.

In normal cows, a large percentage of embryos are lost between d 8 and 16 of

pregnancy (Diskin and Sreenan, 1980; Dunne et al., 2000) which is the period of

concepts elongation and IFN-T production to inhibit PGF2a pulsatile release.

Conceptuses (d 17 to 19) from repeat-breeder cows were smaller than normal cows

(Ayalon, 1978) and may be incapable of blocking the luteolytic cascade resulting in

embryonic loss. When reciprocal embryo transfer was performed between repeat-breeder









and normal cattle, the repeat-breeder cattle failed to achieve normal pregnancy rates even

though an embryo from a normal cow was transferred (Gustafsson and Larsson, 1985).

On the contrary, normal cattle had normal pregnancy rates when an embryo from a

repeat-breeder cow was transferred. This suggests that the failure to establish pregnancy

may be due to a suboptimal uterine environment.

One reason for the discord between the concepts and maternal unit may be the

presence of a retarded embryo that cannot sufficiently produce IFN-T. Hansen et al.

(1988) stated that elongation of the embryo is associated with increased secretion of IFN-

T, and that most of the increased output of IFN-T is due to the increased size of the

embryo and not increased synthesis per unit weight. By increasing embryo/conceptus

growth, the antiluteolytic signal (IFN-T) may be strong enough to suppress pulsatile

release of PGF2, such that more animals establish and maintain pregnancy.

Progesterone secretion by the CL is essential for coordinating the histotrophic

environment to nourish the developing concepts. Progesterone plays a vital role in

stimulating the production of several endometrial proteins and growth factors important

for embryo/conceptus growth (Geisert et al., 1992). Concentrations of plasma

progesterone have a marked influence on the development of the embryo (Mann et al.,

1996) and its ability to secrete IFN-T (Mann et al., 1998; Mann and Lamming, 2001).

Dairy cows with early post ovulatory increases and greater concentrations of

progesterone during the luteal phase had larger conceptuses on d 16 that secreted more

IFN-T than cows with late increases in progesterone and lower progesterone

concentrations (Mann et al., 1998). Supplemental progesterone during the first 4 d after

AI increased morphological development and biosynthetic activity of d 14 conceptuses









(Garret et al., 1998). Lamming and Darwash, (1995) observed that a delay in the

postovulatory rise and low progesterone was associated with reduced pregnancy rates.

However, when an accessory CL is induced 5 d following estrus to increase progesterone

concentrations in lactating dairy cows, conception rates were greater at d 28 (46 vs.

39%), 45 (40 vs. 36%), and 90 days (38 vs. 32%) after AI (Santos et al., 2001).

Furthermore, if the high-producing dairy cow has a lower rise in progesterone

concentrations during early diestrus, it could compromise the ability of the concepts to

be large enough to secrete ample amounts of IFN-' to inhibit luteolysis. This could

contribute to the large rate of embryo death (Mann and Lamming, 1999; Darwash and

Lamming, 1998).

Not only can heat stress affect the oocyte and the early embryo, but it can also

reduce growth of the concepts. Biggers et al. (1987) showed that heat stress reduced the

weights of conceptuses recovered on d 17 from beef cows. This reduction in concepts

size would reduce the amount of IFN-T available to inhibit PGF2, pulsatile secretion. In

addition, Putney et al. (1988b) incubated conceptuses and endometrial explants obtained

on d 17 of pregnancy at a thermoneutral (39C, 24 h) or heat stress (39C, 6 h; 43C, 18

h) temperatures. The heat stress decreased protein synthesis and secretion of IFN-T by

71% in the conceptuses. However, endometrial secretion of PGF2z and concepts

secretion of PGE2 increased in response to heat stress by 72%. Wolfenson et al. (1993)

observed that secretion of PGF2, was increased in vivo when heifers were exposed to

high ambient temperatures. Collectively these studies demonstrate that both the

concepts and the uterine environment can be disrupted due to heat stress inhibiting the

conceptuses ability to secrete IFN-T and maintain pregnancy.









A reduction in the amount of growth factors, due to a high level of milk production

and (or) nutritional status, may reduce the amount of embryotrophic growth factors that

are needed for embryo/conceptus growth. Secretion of embryotrophic growth factors into

the uterine lumen may be controlled by nutritional status of the cow since embryo

transfer pregnancy rates were reduced in recipients with low BCS (Mapletoft et al.,

1986). Also GH, IGFs, and their binding proteins may be regulated by nutritional status

and level of milk production which are important for embryo/conceptus growth.

Fatty Acid Metabolism

Enzymes

Enzymes found in the rumen of dairy cows modify dietary fatty acids before they

are absorbed in the small intestine. Lipolytic anaerobic bacteria found in the rumen

secrete enzymes (lipases) which rapidly hydrolyze fats to release the fatty acids and

galactose from their glycerol backbone. Both glycerol and galactose are released and

fermented by the bacteria to volatile fatty acids. The length of the acyl chain, the number

of double bonds in the chain, and the types of isomers formed by each double bond

determines fatty acid structure and function (Mattos et al., 2000). For instance, saturated

fatty acids (SFA) do not have double bonds in the acyl chain. Unsaturated fatty acids

have double bonds in their acyl chain and are classified according to the position of the

first double bond in relation to the methyl end of the molecule (Cook, 1996). For

example, linoleic acid has 18 carbon atoms and two double bonds (C18:2), with its first

double bond located at the sixth position from the methyl end, and is therefore a member

of the n-6 family. In contrast, linolenic acid has three double bonds (C18:3) and belongs

to the n-3 family because the first double bond is at the third carbon position. Rumen









enzymes acting upon fatty acids of one family (i.e., n-3) can only generate fatty acids of

that same family (Jenkins, 1993).

Three different enzymes, designated as isomerases, desaturases and elongases, play

a large role in modifying the configuration around a double bond, number of double

bonds, and length of the acyl chain, respectively. By changing the structure of the fatty

acid, these enzymes also are changing their function and type of fatty acid. Isomerases

change the orientation of the fatty acid molecule around a double bond, converting the

native cis-isomers into trans-isomers. Isomerization also can change the location of the

double bonds in the carbon chain (Khanal and Dhiman, 2004). For example, linoleic acid

(cis-9, cis-12 C18:2) can be isomerized into conjugated linoleic acid (cis-9, trans-11 C18-2)

which has human health promoting properties (i.e., anticarcinogenic, antidiabetic,

antiatherosclerosis etc.; Bauman et al., 2001).

Elongation involves the addition of two carbon units to the acyl chain of the fatty

acid by an elongase enzyme. For example, stearidonic acid (C18:4) is elongated to

eicosatetraenoic acid (C20:4). Fatty acid desaturases are nonheme iron-containing

enzymes that introduce a double bond between defined carbons of fatty acyl chains.

Delta desaturases create a double bond at a fixed position counted from the carboxyl end

of fatty acids. Stearoyl CoA desaturases (also called A-9 desaturase) catalyze synthesis

of monounsaturated fatty acids (MUFAs) from SFA (Bauman and Griinari, 2003). For

example, stearic acid (C18:0) is acted upon by A-9 desaturase to form the UFA, oleic acid

(C18:1). The desaturases are classified according to the position of insertion of the

double bond. For instance, the A-9 desaturase enzymes introduce the first cis-double

bond at the 9, 10 position from the carboxyl end of fatty acids. The A-6 desaturases and









A-5 desaturases are required for the synthesis of highly UFA. The A-6 desaturases are

membrane bound desaturases that catalyze the synthesis of PUFAs. The A-6 desaturases

and A-5 desaturases are classified as front-end desaturases because they introduce a

double bond between the pre-existing double bond (i.e., omega-3 and -6) and the

carboxyl (front) end of the fatty acid (Nakamura and Nara, 2004). The A-6 desaturase

inserts the double bond between the sixth and seventh carbon from the carboxyl end and

A-5 desaturase inserts the double bond between the fifth and sixth position from the

carboxyl end. Examples of A-6 and A-5 desaturase are the conversion of C24:5 into

C24:6 and C20:3 into C20:4, respectively.

In animals, desaturation of fatty acids does not occur at positions in the acyl chain

greater than A-9 (Cook, 1996). This does not allow the animal to produce fatty acids of

the n-3 or n-6 family. However, animals have absolute requirements for some fatty acids

from the n-3 and n-6 families. These fatty acids are considered to be essential fatty acids

since they must be provided by the diet (Lambert et al., 1954). The two essential fatty

acids are linoleic (C18:2, n-6) and linolenic acid (C18:3, n-3). For example, linoleic acid

is essential for the synthesis of AA (C20:4, n-6). Linoleic acid is converted to AA by

both a A-5 and A-6 desaturase and an elongase (Figure 2.1). Linolenic acid is converted

to EPA (C20:5) by both a A-5 and A-6 desaturase and an elongase (Figure 2.1).

Biohydrogenation

The two major components in a dairy cow's diet are forages and concentrates. The

forages consist largely of glycolipids and phospholipids. The major fatty acids in these

two lipid classes are linolenic (C18:3) and linoleic acid (C18:2) which are the essential

fatty acids. In contrast, the main lipids in seed oils used in concentrate feedstuffs are

predominantly triglycerides containing linoleic and oleic acid (cis-9 C18:1). When these









dietary lipids are consumed by ruminants, they undergo two important transformations in

the rumen (Dawson and Kemp, 1970; Keeney, 1970; Dawson et al., 1977). The first step

in the fatty acid transformation is hydrolysis of the ester linkages catalyzed by microbial

lipases. The anaerobic bacteria found in the rumen secrete lipases which rapidly

hydrolyze fats to release the fatty acids and galactose from their glycerol backbone. The

glycerol and galactose released are fermented by the bacteria to volatile fatty acids. The

second step for fatty acid transformation is a process called biohydrogenation.

Biohydrogenation is attained through the addition of a hydrogen ion at the point of the

double bond. Hydrogenation results in the conversion of UFA into SFA. An example of

this would be the conversions of C18:3, C18:2, and C18:1 into C18:0. As a result, the

proportion of SFA reaching the small intestine is greater than that entering the rumen.

This increased amount of SFA occurs at the expense of UFA such as the essential fatty

acids, linoleic and linolenic acid.

Fatty-Acid Intermediates

Biohydrogenation in the rumen is not completely efficient in that some proportion

of a fatty acid molecular class can be completely biohydrogenated, some of the molecules

are partially biohydrogenated, and some remain in the original native state. During the

biohydrogenation of linoleic acid to stearic acid C18:0, eight isomers known as CLA are

formed. Also CLAs can be synthesized in animal tissues from the conversion of

transvaccenic acid (trans-11 C18:1), another intermediate of rumen biohydrogenation of

linoleic or linolenic acid, by the A-9 desaturase enzyme to form cis-9, trans-11 CLA (Corl

et al., 2001; Griinari and Bauman, 1999). Thus, rumen production of trans-11 C18:1 and

mammary tissue A-9 desaturase are important in determining the CLA content in milk.

However, a range of trans C18:1 isomers are produced in the rumen and subsequently









absorbed from the small intestine and incorporated into milk fat (Corl et al., 2001).

These different isomers, specifically trans-10 C18:1 reduced milk fat synthesis, rather

than C18:1 isomers in general (Griinari et al., 1996). In addition Baumgard et al. (2000)

demonstrated that trans-10, cis-12 CLA inhibited milk fat synthesis, whereas the cis-9,

trans-11 CLA isomer had no effect.

The mechanism by which trans-10 C18:1 and trans-10, cis-12 CLA reduce fat

synthesis may be multifaceted. Baumgard et al. (2002) utilized mammary tissue biopsies

obtained on d 5 of treatment with trans-10, cis-12 CLA and observed that the reduction in

milk fat yield corresponded to reductions in mRNA abundance for genes that encoded for

enzymes involved in the uptake and transport of fatty acids (i.e., lipoprotein lipase and

fatty acid binding protein), de novo fatty acid synthesis (i.e., acetyl CoA carboxylase and

fatty acid synthetase), desaturation of fatty acids (i.e., A-9 desaturase), and triglyceride

synthesis (i.e., glycerol phosphate acyltransferase and acylglycerol phosphate

acyltransferase). Two candidates for control of these genes in reducing milk fat synthesis

are peroxisome proliferator-activated receptors (PPAR) and sterol regulatory element

binding proteins which both are regulated by PUFAs (Clarke, 2001; Jump and Clarke,

1999).

An increasing interest in CLA consumption from animal products is attributed to

their potential health benefits such as anticarcinogenic, antiatherogenic, antidiabetic and

antiadipogenic effects (Banni et al., 2003; Belury, 2003; Kritchevsky, 2003; Pariza,

1999). Of the two physiologically important isomers (cis-9, trans-11 and trans-10, cis-12

CLA), cis-9 trans-11 CLA is the most predominate comprising 80 to 90% of total CLA in

milk and meat from ruminants, whereas trans-10 cis-12 is present in small amounts at 3









to 5% of total CLA (Parodi, 2003). Previous studies have demonstrated that the cis-9

trans-11 CLA reduces mammary tumor incidence in rats when added to the diet or

consumed as a natural component of butter (Ip et al., 1999). The estimated average

consumption of CLA is 1 g/d for adults, below the estimated 3.5 g/d intake suggested as a

protective amount. An epidemiological study involving >2300 middle-aged men

reported a decreased incidence of heart disease for men consuming milk and butter

(Elwood, 1991).

A large interest in discovering ways to increase CLAs in milk and meat from cows

has emerged. The CLAs increase due to dietary changes such as supplementation with

unsaturated fats. In a study by Griinari et al. (1998), CLA of the milk fat in dairy cows

increased from 0.35 to 1.98% when the diet was changed from a saturated to an

unsaturated fat diet. Plant oils such as sunflower, soybean, corn, canola, linseed, and

peanut profoundly increase CLA. In particular, plant oils high in linoleic acid give the

greatest response (Kelly et al., 1998), and there is a clear dose dependent increase in milk

fat content of CLA (Bauman et al., 1999a). Addition of dietary fish oils or fish meal also

increases milk fat CLA. In addition, fish oils seem to produce a larger increase in milk

fat CLA than an equal amount of plant oils (Chouinard et al., 1998). Although the rumen

biohydrogenation of the PUFAs found in fish oil is not well understood (Harfoot and

Hazelwood, 1988), neither CLA nor trans-11 octadecenoic acid seem to be intermediates.

Chilliard et al. (1999) demonstrated that feeding of fish oil results in increased ruminal

production of trans-11 octadecenoic acid. The increase in trans-11 octadecenoic acid

could involve inhibition of bacteria that reduce octadecenoic acid (C18:1) since trans-11









C18:1 is not an intermediate. More trans-11 octadecenoic acid increases the amount of

precursor for A-9 desaturases that can be converted endogenously into CLA.

Polyunsaturated fatty acids of the n-3 family such as EPA (C20:5, n-3) and DHA

(C22:6, n-3), have been shown to undergo little biohydrogenation (Ashes et al., 1992).

The EPA and DHA are found typically in diets derived from fish meal or oil which also

increases amounts of CLAs in ruminant products. However, PUFAs themselves can also

be essential for growth and development, prevention and treatment of heart disease,

arthritis, inflammation, autoimmune diseases, and cancer (Simopoulos, 1999).

Accordingly, there are now dietary recommendations and guidelines for omega-3 fatty

acid intakes. For example, in a recent scientific statement, the AHA Dietary Guidelines

suggest Americans consume at least two servings of fish per week, and include in the diet

vegetable oils rich in the omega-3 fatty acids such as C18:3, EPA and DHA (Kris-

Etherton et al., 2003). It also recommends that 1.3 to 2.7 g/d total omega-3 fats be

consumed. Despite these recommendations, it is estimated that actual dietary intakes of

omega-3 fatty acids, and EPA and DHA specifically, are as low as one-tenth of these

levels. It is estimated that to achieve the recommended levels of EPA and DHA, a

fourfold increase in fish consumption in the United States is necessary (Kris-Etherton et

al., 2000). The possible feeding of fish oils to dairy cows will increase human

consumption of PUFAs, specifically EPA and DHA, by increasing their concentration in

meat and milk.

Effects of Supplemental Lipids on the High-Producing Dairy Cow

Transition Period and Energy Balance

The transition period (3 weeks before until 3 weeks after parturition) is a time

marked by physiological changes to accommodate fetal growth, parturition, lactogenesis,









galactopoeisis, and uterine involution. These changes, which are more dramatic than at

any other time during the gestation-lactation cycle, influence tissue metabolism and

nutrient utilization. A reduction in feed intake is initiated during the prepartum transition

period, yet nutrient demands for support of initiation of milk synthesis and reproduction

are increasing. This instills a negative energy status on the high-producing cow, that until

alleviated antagonizes proper immune and reproductive function.

Fat supplementation is commonly used to increase the energy density of the diet of

lactating dairy cows. Previous studies supplementing fat to improve the energy status of

the cow during the transition period have been shown to have differing effects depending

on whether DMI suppression occurred. The type of fat fed as well as the type and

amount of forage will have an effect on the extent to which DMI is affected (Allen,

2000). The mechanisms by which fat can depress DMI are not clear. Intake could be

depressed when supplemental fats are fed due to decreased palatability, ruminal fill due

to decreased fiber digestion, regulation of the gut hormone cholecystokinin on the brain

satiety centers, and increased amount of fatty acid oxidation in the liver that alters signals

generated by hepatic vagal afferent nerves to brain centers signaling satiety (Allen, 2000).

However, other studies have reported that feeding fat can have no effect on DMI (Staples

et al., 1998). In addition, some studies reported DMI was depressed early in the

experiment but had no effect later in the experiment after cows had consumed the diets

for a longer period of time (Beam and Butler, 1998; Chouinard et al., 1997; Garcia-

Bojalil et al., 1998). This indicates there is a period in which cows must become adjusted

to the supplemental fat source. In studies were fat did not depress DMI and did not

change the energy status of the cow, more energy was probably utilized for milk









production. Production of fat-corrected milk was increased by 2.2 kg/d (Andrew et al.,

1991) and by 1.4 kg/d (Harrison et al., 1995) when cows were fed supplemental fats and

neither energy status nor DMI was changed compared to controls.

Supplementation of fat has also resulted in higher DMI in several studies (Allen,

2000). Substitution of fat for grain can reduce the hypophagic effects of propionate by

reducing its flux to the liver. Also, dietary fat has a lower heat increment per unit of

energy than other energy sources and its inclusion in the diet has been advocated as a

possible means of reducing heat stress and increasing DMI of dairy cows (Beede and

Collier, 1986; Morrison, 1983). In a study by Skaar et al. (1989), DMI was increased 7%

in the warm season and was 5% lower in the cool season for cows consuming diets with

added fat compared to diets without supplemental fat. However, in other studies utilizing

lactating dairy cows in heat stress versus thermoneutral environments and fed diets with

or without supplemental fat, there was no interaction of diet and environment on feed

intake.

The fatty acid composition of different fat sources varies widely. For example,

unprocessed plant oils contain a large amount of PUFAs such as linoleic and linolenic

acid. Rendered fats like tallow and yellow grease contain a large portion of MUFAs such

as oleic acid. Granular fats such as calcium salts of palm oil and prilled fats, contain high

amounts of saturated fats palmitic and stearic acids. The hypophagic effects of added fat

has shown to increase with increasing amounts of UFA (Jenkins and Jenny, 1989; Pantoja

et al., 1996; Pantoja et al., 1994) and the mechanisms behind this are unknown. Greater

hypophagic effects of LCFA with increased degree of unsaturation were observed when

LCFA were infused into the abomasum, with no effects of fat source on total tract









digestibility of fatty acids (Bremmer et al., 1998). Drackely et al. (1992) suggested that

unsaturated LCFA reaching the small intestine of dairy cows affects gastrointestinal

motility and DMI. The differences in DMI due to differing types of fatty acids are not

clearly determined and await affordable sources of pure fatty acid products (C18:1, C18:2

etc.) to understand this phenomenon (Bremmer et al., 1998).

Supplemental fats can also affect metabolic hormones such as insulin that would

regulate not only feed intake but also reproductive responses such as interval to first

ovulation. In a review by Staples et al. (1998), out of 17 fat studies that measured

insulin, eight showed a decrease in plasma insulin. Insulin concentrations usually reflect

energy intake. For example plasma concentrations of insulin increased with increasing

DIM and DMI (Lucy et al., 1991b). In addition, when energy status was used as a

covariate in the statistical model, the significant differences of diet and day on insulin

were eliminated, suggesting insulin differences among diets were due to differences in

energy status. Insulin suppression by supplemental feeding of fat may benefit the

development of follicles. Spicer et al. (1993) reported that bovine granulosa cells tended

to produce less IGF-I when cultured with insulin and GH. Because IGF-I is a potent

stimulator of bovine granulosa cells in vitro (Spicer et al., 1993), suppression of insulin

through the feeding of fat may allow IGF-I to affect positively follicle development.

However, several other studies have shown that increased insulin concentration positively

affects interval to first ovulation and resumption of normal estrous cycles (Armstrong et

al., 2003).

As mentioned earlier, an inadequate immune status during the transition period can

negatively affect fertility. Diets differing in type of fatty acids such as n-3 or n-6 PUFAs









have been shown to be important modulators of immune function (Calder et al., 2002).

In mice fed an enriched n-3 PUFA diet, inflammatory reactions were reduced, and

different types of antibody response to antigenic stimulation were developed compared

with mice fed an n-6 enriched diet (Albers et al., 2002). Lessard et al. (2003) fed diets of

calcium salts of palm oil, flaxseed, or soybeans to cows from 6 wks prepartum to 6 wks

postpartum. The lymphocyte response of blood mononuclear cells to mitogenic

stimulation was lower in cows fed soybeans than in those receiving flaxseed or calcium

salts of palm oil. Thus a diet high in linoleic acid (soybeans) may improve immune

function.

A possible explanation of the mechanism behind modulation of immune function

due to different fats may be related to eicosanoid synthesis such as prostaglandins (PG)

and leukotrienes. Omega-6 fatty acids such as linoleic acid (C18:2) and omega-3 fatty

acids such as a-linolenic (C18:3) leads to the formation of arachidonic acid (AA) and

EPA, respectively. Both AA and EPA are precursors of eicosanoids, but those that are

synthesized from EPA, such as PGE3 and leukotriene B5, do not have a strong biological

activity as do those produced from AA, such as PGF2,, PGE2 and leukotriene B5 (Yaqoob

and Calder, 1995). As a result, feeding plant or fish oil rich in omega-3 PUFAs generally

reduces inflammatory reactions and as well as production of interleukin-1, -6, and tumor

necrosis factor-a in different animal species, including human (Yaqoob and Calder,

1995)..

Fertility

Many studies report an improvement in reproductive performance of cows fed

supplemental fat. Staples et al. (1998) reported an improvement in fertility in 11 of 20

reviewed articles and it appeared that it was due to supplementation of a fat source and









not solely due to an improvement in energy status. The average increase in rate of

conception or pregnancy of the studies reporting a positive response was 17 percentage

units. In addition, Scott et al. (1995) conducted a large study in five herds and reported a

greater proportion of cows fed calcium salts of LCFA expressed stronger signs of estrus,

more active ovaries, and required less exogenous PGF2a to induce estrus. First service

conception rate was improved when 253 cows over four herds were fed 2% ruminally

inert fat from 0 to 150 DIM (43 vs. 59%; Ferguson et al., 1990). When lactating dairy

cows were fed either tallow or no tallow as a fat supplement, cows fed tallow tended to

have a better conception rate (62 vs. 44%) by 98 days in milk (DIM; Son et al., 1996).

Petit et al. (2001) fed formaldehyde-treated flaxseed from 9 to 19 weeks of lactation to

dairy cows which experienced a greater first service conception rate than those fed

calcium salts of palm oil (87 vs. 50%). Feeding a calcium salt of palm and soybean oil

(i.e., 26% linoleic acid and 4% linolenic acid) increased first service pregnancy rate of

lactating dairy cows compared to an unsupplemented control (27 vs. 58%; Cullens et al.,

2004). In a study using a calcium salt blend of primarily C18:2 and C18:1 trans versus a

calcium salt blend of primarily palm oil (C16:0 and C18:1), the lactating dairy cows

receiving the calcium salt blend of C18:2 and C18:1 had an improved first service

conception rate (25.6 vs. 33.5%; Juchem et al., 2004). The latter study indicates that the

type of fatty acid can have differential effects on fertility. In Staples et al. (1998) review

of the literature there was an improvement in pregnancy rate for four studies that fed fish

meal to dairy cows. However, in some of these studies the inclusion of fish meal

partially replaced soybean meal such that one can not determine whether a beneficial

effect of fish meal is due to reduced degradable protein or increased fatty acids such as









EPA and DHA characteristic of fish. Burke et al. (1996) fed fish meal to lactating dairy

cows while maintaining ruminally undegradable protein constant. Conception rate was

improved due to the fish meal suggesting a fish oil beneficial effect on fertility.

Several studies reported a decrease in conception rate of cows fed supplemental fat

(Sklan et al., 1994; Sklan et al., 1991; Erickson et al., 1992). However, in each of these

studies the lowered conception rate was accompanied by an increase in milk production.

High milk production has been linked to a decrease in fertility as described previously.

Number of days open was unaffected by fat supplementation with one positive exception

(Sklan et al., 1991), and number of AI per conception was decreased in three studies

(Armstrong et al., 1990; Ferguson et al., 1990; Sklan et al., 1991) in which fat was

supplemented.

Follicles and Estradiol

Many studies reported that number and growth dynamics of ovarian follicles are

altered due to lipid supplementation. Many of the lipid effects on the follicle are due to

the supplemental lipid source and not just energy. Lucy et al. (1991a) replaced corn with

Ca-LCFA in a diet containing whole cottonseeds that was fed to lactating dairy cows

beginning at parturition. The number of small (2 to 5 mm) follicles decreased and

number of medium (6 to 9 mm) follicles increased within 25 DIM in cows fed the Ca-

LCFA. Just after the 25 DIM and during a synchronized estrous cycle, number of small

(2 to 5 mm) follicles and large (> 15 mm) follicles increased in cows fed Ca-LCFA. In

addition, the diameters of the largest (18.2 vs. 12.4 mm) and second largest (10.9 vs. 7.4

mm) follicles were greater in cows fed Ca-LCFA. However, in this study, the two diets

were not of equal energy density and the responses may have been due to either the

supplemental fat source or the increased energy. When this study was repeated, lactating









Holstein cows fed the Ca-LCFA diet had a larger second wave dominant follicle versus

cows fed a diet of similar energy density without Ca-LCFA (16.1 vs. 18.7 mm; Lucy et

al., 1993b).

Dominant follicle size was increased in cows fed diets enriched in PUFAs

compared with cows fed a diet enriched in MUFAs, indicating that it was PUFAs that

were most effective (Staples et al., 2000). In addition, Beam and Butler, (1997) reported

that supplemental fat increased the diameter of the largest follicle of the first wave

follicle from d 8 to 14 of the estrous cycle. Oldick et al. (1997) infused water, glucose,

tallow or yellow grease into the abomasums of lactating dairy cows. The first wave

dominant follicle grew faster to a larger size in cows infused with yellow grease versus

tallow. It appears that diets enriched in different fatty acids can have differential effects

on follicle development.

The increased follicle size may be due to fats affecting plasma LH secretion to

stimulate follicular growth. However, plasma LH during the luteal phase of the estrous

cycle was unaffected by a diet containing Ca-LCFA but was increased during the

follicular phase in primiparous cows (Sklan et al., 1994). Lucy et al. (1991a) reported

that the LH profile was unaffected in dairy cows fed Ca-LCFA in the early postpartum

period. However, as LH pulse amplitude increased, the diameter of the largest follicle

increased, and energy status was less negative. Lipid supplementation is used to increase

the amount of energy consumed to improve the energy status of the cow. Cows in

negative energy status have a prolonged postpartum anestrous (Roche and Diskin, 2000)

and the frequency of LH pulses are reduced which may limit both follicle growth to the









preovulatory stage and ovulation (Schillo, 1992). Lipid supplementation may aid in

increasing energy status and improve LH pulse frequency.

Estradiol has stimulatory effects on uterine secretion of the luteolytic hormone,

PGF2, (Knickerbocker et al., 1986). In addition, estradiol can increase the sensitivity of

the CL to PGF2a,(Howard et al., 1990) which can cause a more complete regression of the

CL. Thus lowered plasma estradiol may prevent premature CL regression and prevent

early embryonic mortality. Oldick et al. (1997) infused into the abomasum of lactating

dairy cows either water, glucose, tallow or yellow grease and reported that tallow and

yellow grease had lower concentrations of plasma estradiol (2.42 vs. 3.81 pg/mL) on d 15

to 20 of a synchronized estrous cycle compared to cows infused with glucose. When

supplemental lipids were fed to beef cows during the early postpartum period, serum

concentrations of estradiol were lower compared to unsupplemented cows (1.41 vs. 1.61

ng/mL; Hightshoe et al., 1991). Also, concentration of estradiol was lower in the

follicular fluid from beef cows fed soybean oil (Ryan et al., 1992). Other studies have

reported no effect of supplemental fats on estradiol concentrations during either the

follicular or luteal phase of lactating dairy cows (Lucy et al., 1991a; Lucy et al., 1993b;

Sklan et al., 1994).

Corpus Luteum and Progesterone

Since follicle size is increased due to lipid supplementation, the subsequent CL

from the larger follicle may also be larger. Larger ovulating dominant follicles in heifers,

nonlactating, and lactating dairy cows resulted in larger corpora lutea (Sartori et al.,

2002a; Moreira et al., 2000a) which was associated with greater circulating

concentrations of plasma progesterone. When lactating dairy cows were fed either 0 or

2.2% Ca-LCFA starting at parturition and examined weekly by rectal palpation for the









first 60 DIM, the number of CL (0.85 vs. 1.05) and the size of the largest CL (12.2 vs.

17.2 mm) tended to be greater in cows fed Ca-LCFA (Garcia-Bojalil et al., 1998). Larger

CL were detected in lactating dairy cows fed high levels of omega-3 fatty acids through

the diet as formaldehyde-treated linseed or as a mixture of formaldehyde-treated linseed

and fish oil (Petit et al., 2002).

A larger CL may not only be due to ovulation of a larger follicle but also through

direct developmental and steroidogenic effects on the CL. Electron microscopic

examination of CL tissue revealed that lipid content was greater in luteal cells from beef

heifers fed Ca-LCFA compared with unsupplemented controls (Hawkins et al., 1995).

Increased concentrations of progesterone were associated with improved

conception rates of lactating dairy cows (Butler et al., 1996). Previous studies have

reported an increase (Staples et al., 1998), no effect (Mattos et al., 2002), or a decrease

(Robinson et al., 2002) in plasma progesterone in dairy cows supplemented with LCFA.

Moallem et al. (1999) fed Ca salts of palm oil from 0 to 150 DIM to lactating dairy cows

and reported an increase not only in progesterone concentration in follicular fluid (55.4

vs. 33.0 ng/mL) but also in progesterone content of fluid from estradiol-active follicles

(173.9 vs. 68.3 ng). Concentration of progesterone in follicular fluid also was greater for

beef cows fed soybean oil compared to control cows (Ryan et al., 1992).

With a larger CL due to supplemental fat, progesterone concentration in the blood

may be increased; however, this may not be the only reason. Cholesterol is a precursor

for the synthesis of progesterone, and feeding supplemental fat increases plasma

concentrations of cholesterol probably because cholesterol is needed for supplemental fat

absorption (Grummer and Carroll, 1991).









Also, progesterone concentrations may be increased if the clearance rate of

progesterone from the blood is reduced in cows fed supplemental lipids. Hawkins et al.

(1995) fed beef heifers either 0 or 0.57 kg/d of Ca salts of palm oil from 100 d prepartum

through the third estrous cycle postpartum. Average concentrations of plasma

progesterone and cholesterol were elevated in heifers fed fat. Heifers were

ovariectomized on d 12 to 13 of the third estrous cycle, and blood samples were taken

repeatedly thereafter. Increased plasma concentrations of progesterone from repeated

samples taken just before and after ovariectomy in the fat-fed group indicated a greater

half-life of progesterone. This supported the concept that feeding supplemental lipids

caused a slower clearance rate of progesterone from plasma. When liver slices in media

were incubated with progesterone, estradiol, and fatty acids such as C18:2, the half-life of

progesterone and estradiol increased in the C18:2 treatment compared with media

containing no fatty acids (Sangritavong et al., 2002).

Oocyte and Early Embryo

Acquisition of oocyte developmental competence occurs as a continuum

throughout folliculogenesis. This acquisition can be divided into three separate stages

defined by particular physiological events. The first stage is oocyte growth, which takes

place mainly during the beginning of follicle growth. Second stage is oocyte capacitation

(preparation of the oocyte for supporting early embryo development by acquiring

important factors such as mRNAs, proteins, mitochondria, etc.), starting at the end of

oocyte growth in antral follicles. Lastly is oocyte maturation which starts after the LH

surge in preovulatory follicles or after removal of the oocyte from the follicular

environment which inhibits meiotic resumption (Mermillod et al., 1999). The

preovulatory LH surge or removal of the oocyte from its follicular inhibitory environment









triggers resumption of meiosis for maturation to metaphase II and is termed nuclear

maturation. During the entire life of the oocyte and for a distinct period after the LH

surge, the oocyte is going through cytoplasmic maturation. Cytoplasmic maturation is

the accumulation of mRNA, proteins, mitochondria, and many other important cellular

nutrients which are critical for subsequent fertilization and embryo development. Homa

and Brown, (1992) cultured bovine oocytes, from slaughterhouse ovaries, with linoleic

acid and noticed a significant reduction in spontaneous germinal vesicle breakdown

compared with oocytes cultured without fatty acids. This illustrates that fatty acids can

affect nuclear maturation and could possibly affect cytoplasmic maturation with profound

effects on subsequent embryo development.

When bovine follicles are dissected and classified according to size, the oocytes

harvested from larger follicles undergo better development than those from smaller

follicles (Pavlok et al., 1992; Lonergan et al., 1994). Follicle size is stimulated due to

supplemental fat feeding which may increase oocyte competence leading to an increase in

fertility as previously discussed. Nutritional induced changes in endocrine and metabolic

signals that regulate follicular growth also can influence oocyte maturation (Armstrong et

al., 2001; Boland et al., 2001).

Competence of the oocyte and embryo is also related to fatty acid composition;

specifically, phospholipid content of the cellular membrane plays a vital role in

development during and after fertilization. The amount of lipid in the ruminant oocyte is

approximately 20-fold greater than that of the mouse (76 vs. 4 ng) and consists (w/w) of

approximately 50% triglyceride, 20% phospholipid, 20% cholesterol and 10% free fatty

acids (McEvoy et al., 2000). Previous studies showed that C16:0 and C18:1 acids were









the most abundant fatty acids in the phospholipid fraction of oocytes from cattle and may

function as an energy reserve (Kim et al., 2001; Zeron et al., 2001). Polyunsaturated fatty

acids comprise <20% of total fatty acids with linoleic (C18:2n-6) being the most

abundant.

Temperature modulates the physical properties of the lipids in cell membranes and

changes lipid composition of the membrane (Quinn, 1985). Zeron et al. (2001) reported

that oocyte membrane fluidity is affected by temperature alterations between seasons, as

well as by changes in fatty acid composition. Furthermore, a relationship was

documented between decreased PUFA content, a change in biophysical behavior of

oocytes, and low fertility of dairy cows during summer. Zeron et al. (2001) documented

that MUFA and PUFA contents are lower in oocytes and granulosa cells in the summer

compared to the winter season in dairy cattle. The number of high quality oocytes was

higher in ewes fed PUFAs than in control ewes (74.3 and 57.0%, respectively), and

PUFA supplementation increased the proportion of LCFA in the plasma and cumulus

cells (Zeron et al., 2002). However, these changes in fatty acid composition were

relatively small in oocytes indicating that uptake of PUFAs to the oocyte is either

selective or highly regulated.

Few studies have investigated the effects of fat supplementation on oocyte and

embryo quality in lactating dairy cattle. In a study by Fouladi-Nashta et al. (2004),

lactating dairy cows were fed either 200 or 800 g/d of Ca salts of palm and soybean oil,

and follicles were transvaginally aspirated 3 to 4 d apart. A total of 1157 oocytes were

collected from 20 cows, and oocytes were matured, fertilized and cultured in vitro. A

greater percentage of oocytes developed into blastocysts from cows fed the higher fat









diet. In another study, conception rate to first service was increased when lactating dairy

cows were fed a mixture of calcium salts of linoleic and trans fatty acids compared to

palm oil (33.5 vs. 25.6%; Juchem et al., 2004). In a sub-sample of the cows, fertilization

rate (87 vs. 73%), number of total cells, percentage of live cells, and percentage of

embryos graded 1 and 2 (73 vs. 51%) were greater for calcium salt blend of primarily

C18:2 and C18:1 trans versus a calcium salt blend of primarily palm oil (C16:0 and

C18:1; Cerri et al., 2004). Also, the number of accessory sperm cells attached to the zona

pellucida was greater. However, whether the beneficial effects are due to an enrichment

of linoleic and (or) 18:1 trans fatty acids cannot be determined.

Conceptus and Maternal Unit

Although, to date, no studies have investigated the effects of supplemental fats on

concepts development in lactating dairy cows, several studies have investigated the

effects of supplemental fats on the "cross-talk" between the concepts and maternal unit.

The maternal unit constitutes all tissues in the female reproductive tract that directly or

indirectly interacts with gametes or concepts. Appropriate exchange (cross-talk) of

hormonal signals between both units is required for successful establishment and

completion of pregnancy. Discord between the concepts and maternal unit can cause

early embryonic loss and the start of a new estrous cycle.

Early pregnancy loss in lactating dairy cattle can have devastating effects on the

economic success of dairy farms (Santos et al., 2004a). Nearly 40% of pregnancy losses

have been estimated to occur between d 8 to 17 following estrus. This is the critical time

period during which the concepts must produce sufficient quantities of IFN-T to prevent

pulsatile PGF2a secretion and maintain the CL (Thatcher et al., 1995). Changing from a

cyclic to a pregnant state not only depends on the production of antiluteolytic signals









from the developing concepts but also the capacity of the endometrium to respond to

these signals, thus blocking pulsatile PGF2, production (Binelli et al., 2001b). Such

communications between the concepts and maternal units are not always successful,

thus leading to early embryonic loss.

The endometrium plays a critical role in regulating the estrous cycle and

establishment of pregnancy. Elevated concentrations of plasma progesterone during the

late luteal phase of an estrous cycle causes down regulation of progesterone receptors

(PR) in the uterus (Spencer and Bazer, 1995; Wathes and Lamming, 1995; Robinson et

al. 2001). Loss of PR in the uterus activates oxytocin receptor (OTR) expression and

subsequent luteolysis (Wathes and Lamming, 1995). Conversely, estradiol receptor a

(ERa) concentrations are upregulated during luteolysis in sheep. Although the role of PR

and ERa in regulating the OTR regulation is not clearly elucidated, the OTR certainly is

suppressed by IFN-T secreted from the concepts (Flint et al., 1992; Wathes and

Lamming, 1995; Mann et al., 1999).

In the uterine luminal epithelium, AA is released from phospholipids by hydrolysis

and acted upon by prostaglandin H synthase (PGHS-2) to form PGH2, which is converted

to either PGF2a and (or) PGE2 through the two reductases, prostaglandin F synthase

(PGFS) and prostaglandin E synthase (PGES), respectively. It is unknown whether

relative endometrial expression of the 2 synthetic enzymes, PGFS and PGES, changes

during the period of CL maintenance in pregnant lactating dairy cattle.

Previous studies reported that feeding fats, in particular PUFAs, can attenuate

endometrial PGF2, production. In a study by Burke et al. (1996), a higher proportion of

lactating dairy cows fed fish meal had higher plasma progesterone concentrations 2 d









after PGF2a injection indicating attenuation in efficiency of CL regression due to fish oils.

In this study pregnancy rates were increased from 32 to 41%. In a study by Mattos et al.

(2002), cyclic lactating dairy cows fed fish meal, containing EPA and DHA, had reduced

plasma 13, 14-dihydro-15-keto-PGF2a metabolite (PGFM) concentrations compared to

unsupplemented controls when challenged with estradiol and oxytocin injections. Dairy

cows fed diets containing fish oil during the transition period had greater EPA and DHA

concentrations in caruncular tissues collected within 12 h after parturition as compared to

control cows fed olive oil (Mattos et al., 2004). Furthermore, the lactating dairy cows fed

fish oil had reduced plasma concentrations of PGFM just after parturition.

A series of in vitro studies were performed to evaluate the effects of particular

MUFAs and PUFAs on PGF2a secretion (Mattos et al., 2003). An immortalized bovine

endometrial (BEND) cell line was used to test the effects of no fatty acid (control) or

C18:1, C18:2, C18:3, C20:4, C20:5, and C22:6 fatty acids (i.e., 100 [M) on PGF2a

secretion. Only C20:4, precursor for PGF2a, stimulated PGF2a production compared to

control cells. The C18:3, C20:5, and C20:6 fatty acids were the only fatty acids to

suppress synthesis of PGF2a with C20:5 (EPA) and C20:6 (DHA) being the most

suppressive. Also C18:2, which is also a precursor for PGF2a, did not increase PGF2a and

it was hypothesized that perhaps the bend cells were not capable of efficiently converting

linoleic acid (C18:2) to AA (C20:4). Robinson et al. (2002) fed soybeans (high in C18:2)

that were partially protected from biohydrogenation, to lactating dairy cows. The PGFM

plasma concentration was increased, after oxytocin challenge, compared to cows fed

other fat sources. Another study fed whole sunflower seeds, also high in C18:2, to

lactating dairy cows and reported an increase in plasma concentrations of PGFM after an









oxytocin challenge compared to cows fed other fat sources (Petit et al., 2004). Thus

supplemental lipids can either inhibit or stimulate PG secretion depending upon the

specific fatty acids.

The mechanism by which PUFAs inhibit PGF2, secretion may involve decreasing

the availability of AA precursor, increasing the concentration of fatty acids that compete

with AA for processing by PGHS-2, or inhibition of PGHS-2. Reduced availability of

AA in the uterine phospholipid pool for conversion to PGs of the 2 series can occur

through a reduction in the synthesis of AA or through displacement of existent AA from

the phospholipids pool by other fatty acids (Mattos et al., 2000).

Collectively these studies show that different fatty acids can either increase or

decrease PGF2 secretion. Decreasing PGF2, pulsatile secretion through fatty acid

feeding coupled with a concepts producing IFN-T may allow a more effective

antiluteolytic signal so that more cows to establish and maintain pregnancy.

Peroxisome Proliferator-Activated Receptors

The PPARs are a family of nuclear receptors activated by selected LCFA,

eicosanoids and peroxisome proliferators. Three PPAR isoforms, encoded by separate

genes, have been identified thus far: PPARy, PPARa, and PPAR6 which upon ligand

binding, heterodimerize with the retinoid receptor and interact with specific PPAR

response elements in the promoter region of target genes to affect transcription.

Regulation of promoter function is complex, since there is tissue specific expression of

the PPAR and retinoid receptor subtypes, competition for the retinoid receptor binding

partner, and differences in binding affinity among the PPAR subtypes and among the

retinoid receptor subtypes (Desvergne and Wahli, 1999). PPAR activation may be ligand

dependent or independent, and there is also cross-talk with other nuclear receptors and









their response elements, as well as several transcription factors (Desvergne and Wahli,

1999; Nunez et al., 1997). The PPARs are best known for their roles in lipid metabolism,

but they are also involved in development, epidermal maturation, reproduction in several

animal models, and functions of nerve, lung, kidney and cardiac tissues (Desvergne and

Wahli, 1999; Berger and Moller, 2002).

The PPARy is expressed in a broad range of tissues including heart, skeletal

muscle, colon, small and large intestines, kidney, pancreas, adipose, and spleen. The

PPARy is required in adipocyte differentiation, and regulate genes that control cellular

energy homeostasis and insulin action (Berger and Moller, 2002).

In rodents and humans, PPARa is expressed in numerous metabolically active

tissues including liver, kidney, heart, skeletal muscle, ovary and brown fat (Nunez et al.,

1997; Braissant et al., 1996; Auboeuf et al., 1997). It is also present in monocytic

(Chinetti et al., 1998), vascular endothelial (Inoue et al., 1998), uterine epithelial (Nunez

et al., 1997) and vascular smooth muscle cells (Staels et al., 1998). The PPARa has been

shown to play a critical role in the regulation of cellular uptake, activation, and P-

oxidation of fatty acids (Berger and Moller, 2002). Long-chain UFA such as linoleic,

arachidonic, EPA, and linolenic acids, as well as the branched chain fatty acid phytanic

acid bind to PPARa with reasonable affinity (Willson et al., 2000). In contrast to

PPARa, PPARy has a preference for PUFAs over MUFA or UFA (Khan and Heuvel,

2003).

The PPAR6 is expressed in a wide range of tissues and cells, with relatively higher

levels of expression noted in brain, adipose, and skin (Braissant et al., 1996; Amri et al.,

1995). Importantly, in the endometrium PPAR6 is vital for normal fertility serving as a









regulator of PG production and is required for implantation in rodent models (Lim et al.,

1997; Lim et al., 1999). MacLaren et al. (2005) reported similar expression of PPARa

and PPAR6 mRNA levels in BEND cells and endometrium from cyclic and pregnant

Holstein cows (MacLaren et al., 2003, 2005). The PPAR6/a agonist cPGI had a dramatic

stimulatory effect on PGHS-2 mRNA levels and synthesis of PGF2, and PGE2, which

appeared to be mediated at least in part through PPAR6 (MacLaren et al., 2005). They

hypothesized that PPAR6 is involved in the pregnancy recognition process of cattle and

that it mediates at least some of the beneficial effects of long chain omega-3 PUFA

supplementation on fertility. Also Balaguer et al. (2005) reported an inverse relationship

between endometrial PPAR6 mRNA concentration and that of ERa and PGHS-2 within

the first week of the estrous cycle in lactating Holstein dairy cattle.

The inverse relationship between these genes spawned further speculation that

PPARs, PPAR6 in particular, are mediators of uterine PGF2~ biosynthesis in dairy cattle.

In addition, PPARs appear to be one possible route in which PUFAs can have beneficial

effects in humans through regulation of atherosclerotic plaque formation and stability,

vascular tone, angiogenesis, anti-inflammation, cellular differentitiation, and anti-

carcinogenic (Berger and Moller, 2002). Feeding fatty acids that influence PPARs may

regulate PGF2, synthesis and possibly implantation owing to the beneficial effects of

certain fat supplements on dairy cattle fertility.

Bovine Somatotropin and the Insulin-Like Growth Factor System

Bovine Somatotropin

Structure, synthesis, and secretion

In the bovine literature, GH and bST are used interchangeably. For clarity

purposes in this dissertation, GH will be used to illustrate naturally produced GH, and









exogenous recombinant GH will be referred to as bST. In cattle, GH is a 191 amino acid

single chain polypeptide with a molecular weight of 22 kDa (Secchi and Borromeo,

1997). Four cysteines form two disulfide bridges within the GH molecule (Secchi and

Borromeo, 1997). The molecular structure of GH contains four alpha helixes arranged in

an up-up-down-down configuration (Secchi and Borromeo, 1997). Prolactin and

placental lactogen are structurally related to GH because each hormone contains a similar

helix bundle (van der Walt, 1994). The GH, prolactin, and placental lactogen are

members of a larger family of hormones called the hematopoietic cytokines. Other

members of this family include erythropoietin, the interleukins and other growth factor

receptors (Horseman and Yu-lee, 1994).

In humans, two forms of the GH gene are produced by alternative splicing such that

there are two forms of GH found in the peripheral system (Baumann, 1991). The most

common form has a molecular weight of 22 kDa (Lewis, 1992). This form of GH makes

up 70 to 75% of the total GH in circulation. The other less common form makes up 5 to

10% of the circulating GH and has a lower molecular weight of 20 kDa (Tuggle and

Trenkle, 1996) because it lacks 15 amino acids (Baumann, 1991). This less abundant

form was not found in other mammals such as cattle (van der Walt, 1994). The

remaining circulating forms of GH are derivatives of the 22-kDa isoform (Tuggle and

Trenkle, 1996).

The GH gene is located on the long arm of chromosome 17 (Baumann, 1991). The

GH gene is approximately 2.6 to 3.0 kb in length with five exons and four introns

(Tuggle and Trenkle, 1996). Compared to other species, the amino acid sequence of

bovine GH is 66.5 to 99% homologous (Secchi and Borromeo, 1997).









Growth hormone is produced and secreted from cells in the anterior pituitary called

somatotrophs (van der Walt, 1994). Somatotrophs comprise 40 to 50% of the total

number of cells in the anterior pituitary. Two hypothalamic peptides control GH

secretion: growth hormone-releasing hormone (GHRH) and somatostatin (Cuttler, 1996).

The GHRH can stimulate secretion and synthesis of GH by the somatotrophs.

Adenylate cyclase is activated by a stimulatory G-protein when GHRH binds to GHRH

receptors on somatotrophs. Adenylate cyclase causes an increase in cyclic adenosine

monophosphate (cAMP) which ultimately increases intracellular calcium concentrations.

Increases in calcium concentrations stimulate GH secretion (Mayo et al., 1995; Cuttler,

1996). The increase in cAMP also activates kinases that phosphorylate proteins that

activate GH synthesis.

The somatostatin inhibits GH secretion, but does not affect GH synthesis. Both the

short and long forms of somatostatin have the same affect on GH secretion. However, the

shorter form is the most abundant in the circulation. After somatostatin is secreted from

the hypothalamus, it binds to somatostatin receptors on somatotrophs. Activation of the

somatostatin receptor complex stimulates an inhibitory G-protein that suppresses cAMP

production which blocks calcium release and prevents GH secretion (Cuttler, 1996).

However, somatostatin and GHRH collate their effects to replenish GH pools within

somatotrophs before GH release (Gillies, 1997).

Regulation of GH secretion can also occur due to hormones from the gastric lining.

Small synthetic molecules called growth hormone secretagogues stimulate the release of

growth hormone from the pituitary. They act through the GH secretagogue receptor, a G

protein-coupled receptor whose ligand has only been discovered recently (Kojima and









Kangawa, 2005). Using a reverse pharmacology paradigm with a stable cell line

expressing GH secretagogue receptor, the endogenous ligand for GH secretagogue

receptor was purified from rat stomach and named "ghrelin" (Kojima et al., 1999).

Ghrelin is a peptide hormone in which the third amino acid, usually a serine but in some

species a threonine, is modified by a fatty acid; this modification is essential for ghrelin's

activity. The discovery of ghrelin indicates that the release of GH from the pituitary

might be regulated not only by hypothalamic GHRH, but also by ghrelin derived from the

stomach. In addition, ghrelin stimulates appetite by acting on the hypothalamic arcuate

nucleus, a region known to control food intake (Korbonits et al., 2004). Ghrelin is

orexigenic; it is secreted from the stomach and circulates in the bloodstream under fasting

conditions, indicating that it transmits a hunger signal from the periphery to the central

nervous system (Kamegai et al., 2001). Taking into account all these activities, ghrelin

plays important roles for maintaining GH release and energy homeostasis in animals.

Age, body composition, steroids, sleep, nutrition, stress, exercise, and gender are

involved in the regulation of GH secretion. Calves also have greater GH concentrations

compared to 3 to 6 month old cattle (Reynaert et al., 1976). Adiposity is negatively

correlated with GH concentrations. Concentrations of GH in cattle were greater during

negative energy balance compared to the period of positive energy balance (Gluckman et

al., 1987; Vandehaar et al., 1995). Elevated GH is required for normal accelerated

growth when cattle are maturing. Growth hormone secretion is greater during deep sleep

in humans (Cuttler, 1996), but not in cattle (Gluckman et al., 1987). Protein rich diets

can stimulate GH secretion, whereas free fatty acids reduce GH secretion (Cuttler, 1996).

In cattle, infusing glucose resulted in elevated GH concentrations (McAtee and Trenkle,









1971). Stress in cattle decreased GH possibly by increasing circulating free fatty acids

(Reynaert et al., 1976). Lastly, bulls have more pulses of GH secretion whereas cows

have fewer pulses with higher magnitude (Reynaert et al., 1976).

Receptor and ligand binding

The greatest numbers of GHR are found in the liver (Hauser et al., 1990).

However, many reproductive tissues have GHR mRNA. For example, hypothalamus,

pituitary, CL, ovarian follicle, oviduct, endometrium, myometrium, and placenta have

GHR mRNA (Heap et al., 1996; Kirby et al., 1996; Lucy et al., 1998b). In addition

Izadyar et al. (1997 and 2000) was able to detect GHR mRNA in bovine granulosa cells,

cumulus cells, oocyte and embryos at all stages of development up to d 9 post

fertilization.

The bovine GHR has 242 amino acids in the extracellular binding domain, 24

amino acids in the single transmembrane domain and 350 amino acids in the intracellular

domain. The extracellular domain of the GHR has seven N-linked glycosylation sites and

seven cysteine residues. All seven extracellular cysteines and four of the seven

glycosylation sites are conserved between species. An additional seven cysteines are

found in the intracellular region (Hauser et al., 1990). In all mammalian species

examined, except for humans, there is a conserved amino acid sequence proximal to the

membrane in the extracellular portion of cytokine/hematopoietin receptors. The six

amino acid sequence consists oftryptophan, serine, no specific amino acid, tryptophan

and serine (WSXWS motif). Both motifs seem to be important for GH binding. Another

important feature of the GHR is the intracellular Box 1 and Box 2 regions. Box 1 is more

proximal to the cell membrane compared to Box 2. These amino acid sequences are









important for signal transduction (Postel-Vinay and Finidori, 1995; Carter-Su et al.,

1996).

The GH molecule contains two binding sites for the GHR. Site 1 has greater

receptor affinity than site 2 and binds to the receptor first. After binding of site 1, a

second GHR binds to site 2 and forms a complex (one ligand and dimerized receptor).

Receptor dimerization is important for GH signal transduction. High circulating GH

concentrations diminish receptor dimerization because site 1 binds both undimerized

GHR not allowing site 2 binding and inhibiting dimerization (Waters et al., 1994).

Alanine mutations in the GH molecule can decrease GH binding by 400% without

affecting the tertiary structure of the molecule (Cunningham and Wells, 1989).

Second messengers

Several proposed second messenger systems have been reported for GH. One

common protein to all GH second messenger pathways is Janus Kinase 2 (JAK2). The

JAK2 protein is one of four members in the Janus tyrosine kinase family (Carter-Su et al.,

1996). After GH binding and receptor dimerization, JAK2 is activated and binds

intracellular portions of each GHR. The JAK2 binding initiates GH signal transduction.

The JAKs transphosphorylate each other at tyrosine residues and then phosphorylate

tyrosine residues located on the GHR. Phosphorylation of GHR creates docking sites for

the Src homology 2 domain of downstream signal transducers and activators of

transcription (STAT) molecules. Tyrosine phosphorylation of STAT molecules occurs

after STAT binding to the GHR. The STAT molecules then either hetero- or

homodimerize and translocate to the nucleus to effect gene transcription. Although there

are seven STAT molecules (Darnell Jr, 1997), only STATs 1, 3 and 5 are involved in GH

signal transduction (Carter-Su et al., 1996 and 1997).









The second proposed GHR second messenger system involves a more complex

group of intracellular events. Similar to the system above, JAK2 binds and

phosphorylates the GHR. Then a SH2 domain protein called SHC binds to the GHR and

is activated by JAK2 phosphorylation. Once SHC is stimulated, a cascade of

downstream events occurs that activates proteins such as Grb2, SOS, Ras, Raf, MEK and

MAPK. The phosphorylated MAPK enters the nucleus targeting genes that may control

growth and metabolism (Carter-Su et al., 1996 and 1997).

A third GHR second messenger pathway was proposed by Carter-Su et al. (1996

and 1997). This mechanism involved the activation of insulin receptor substrate-1 (IRS-

1). The IRS-1 is a component of insulin and IGF-I second messenger systems. Activated

IRS-1 stimulates phosphatidylinositol 3' (PI-3) kinase. The downstream events that

occur following PI-3 kinase activation are still unclear (Carter-Su et al., 1997).

Activation of IRS-1 or SHC by GH occurs in vitro and not in vivo. Only the JAK-STAT

pathway has been shown to be stimulated in both in vitro and in vivo GH experiments

(Chow et al., 1996).

Growth and metabolism are regulated by GH. Binding of GH to the GHR affects

the transcription of various genes associated with normal growth (Norstedt et al., 1990).

Some of the known genes induced by GH are IGF-I, c-fos, c-jun, JunB, serine protease

inhibitor 2.1 and 2.2 (Rotwein et al., 1994).

Insulin-like Growth Factor System

Structure, synthesis, and secretion

The IGF-I and IGF-II are growth promoting peptides and members of a

superfamily of related insulin-like hormones in mammals (Rinderknecht and Humbel,

1978; Humbel, 1990). The IGF-I and II are related closely to insulin in terms of primary









sequence and biological activity. The IGFs are major growth factors whereas insulin

predominately regulates glucose uptake and cellular metabolism. The IGF-I is a 7.6 kDa

protein made up of 70 amino acids; however, IGF-II is slightly smaller consisting of 67

amino acids and a molecular mass of 7.5 kDa (Rinderknecht and Humbel, 1978; Rutanen

and Pekonen, 1990; Humbel, 1990). The IGFs consist of A, B, C, and D domains. Large

portions of the sequences within the A and B domains are homologous to a and 0 chains

of proinsulin. The sequence homology is 43% for IGF-I and 41% for IGF-II. In

addition, IGF-I is 65% homologous to IGF-II (Rutanen and Pekonen, 1990). All three

hormones (i.e., insulin, IGF-I, and IGF-II) contain a and 0 chains, and a connecting

peptide region (C). However, amino acid sequences are different among the proteins

with no sequence homology between the C domains of IGFs and the C peptide region of

proinsulin (Gluckman et al., 1987). The C domain of the IGFs is not removed during

prohormone processing. Therefore, the mature IGF peptides are single chain

polypeptides (Zapf and Froesch, 1986; Daughaday and Rotwein, 1989). Another region

in the IGFs different than proinsulin is a carboxy-terminal extension called the D domain

(Gluckman et al., 1987; Humbel, 1990).

The gene encoding IGF-I is highly conserved such that 57 of 70 residues from the

mature protein are identical across species (Zapf and Froesch, 1986). Expression of IGF-

I is affected at many levels including gene transcription, splicing, translation and

secretion. Expression of the IGF-I gene is tissue specific and influenced by hormones,

nutrition, and developmental factors (Bichell et al., 1992; Gronowski and Rotwein, 1995;

Thissen et al., 1994). Furthermore, the molecular weight of IGF-I is the same for human,









bovine, porcine, ovine, rat and mouse (Humbel, 1990). Three disulfide bridges within

IGF-I aid in proper folding and stabilization of the protein structure (Quin, 1992).

The IGF-I found in blood is produced primarily by the liver in response to GH

(Gluckman et al., 1987). However, many other tissues produce IGF-I that exert both

paracrine and autocrine effects (D'Ercole et al., 1984). One IGF-I effect is through

stimulation of cell growth and proliferation with IGF-I acting in an endocrine, paracrine

or autocrine manner (Quin, 1992). The GH exerts a dominant endocrine influence on

liver production of IGF-I to increase circulating concentrations of the IGFs (i.e., IGF-I

which is 100% GH dependent). Once IGF-I is released from the liver, it is transported

through the blood to act on distant tissues (Zulu et al., 2002).

Receptors and ligand binding

The biological functions of IGFs are mediated by a family of transmembrane

receptors, which includes the insulin, IGF-I, and IGF-II receptors. Type I IGF receptors

have the greatest affinity for IGF-I, hence the name IGF-I receptor. However, IGF-II can

bind to type I IGF receptors but with lower affinity (Sun et al., 1991).

The IGF-I receptor is a glycoprotein on the cell surface which binds IGF and

activates a highly integrated intracellular signaling system (Sepp-Lorenzino, 1998; Kim

et al., 2004). Expression of the IGF-I receptor gene occurs in many tissues such as

reproductive tissues, and is expressed constitutively in most cells (Spicer and

Echternkamp, 1995; Eckery et al., 1997). The IGF-I receptor is synthesized on the

ribosome as a single polypeptide chain that is post-translationally modified by removal of

a 30-amino acid signal peptide, and the proreceptor undergoes cleavage into a 706 amino

acid extracellular a-subunit and a 626 amino acid transmembrane P-subunit. The two a

and p subunits are linked together by disulfide bonds to form an ap-half-receptor, which









in turn, is linked subsequently to another ap-half-receptor (Humbel; 1990). Ligand

binding occurs in the cysteine-rich extracellular domain of the a-subunit, while tyrosine

kinase activity resides in the cytoplasmic P-domain (Jones and Clemmons, 1995). In

addition, the intracellular domains of the P-subunits contain ATP binding sites. These

sites bind ATP for the tyrosine kinase reaction that occurs after receptor binding and

activation. Activation of the tyrosine kinase causes autophosphorylation of tyrosine

residues on the IGF-I receptor (Rutanen and Pekonen, 1990; Giudice, 1992).

Although the IGF-I receptor preferentially binds IGF-I, it can also bind IGF-II or

insulin (Quin, 1992). However, type II IGF receptors have the greatest affinity for IGF-II

(Rutanen and Pekonen, 1990; Giudice, 1992). Furthermore the IGF-II receptor has a

much lower binding affinity for IGF-I and does not bind insulin (Jones and Clemmons,

1995). The IGF-II receptor is a 250 kDa polypeptide monomer with homology to the

mannose-6-phosphate receptor. The extracellular domain is 90% of the receptor and has

15 conserved repeat sequences (Giudice, 1992). A major difference between the IGF-II

and IGF-I receptors is that IGF-II receptors lack tyrosine kinase activity (Giudice, 1992).

The binding site for IGF-II is distinct from that for mannose-6-phospate, and IGF-II can

bind simultaneously with the mannose-6-phosphate ligands (Braulke et al., 1989).

However, the binding of certain lysosomal enzymes can interfere noncompetitively with

IGF-II binding and vice versa (Kiess et al., 1988). The IGF-II can be cleared from the

blood through binding to mannose-6-phospate receptors, internalization and subsequent

degradation, which can be inhibited by lysosomal enzymes (Oka et al., 1985). In

addition, it is well accepted that IGF-II receptors are scavenger receptors which mediate

the uptake and degradation of IGF-II (Jones and Clemmons, 1995).









Second messengers

Binding of IGF-I to the type I IGF receptor activates autophosphorylation of

tyrosine residues. Therefore, the type I IGF receptor is a tyrosine kinase receptor

(Giudice, 1992). In addition to phosphorylating tyrosine residues, serine residues also are

phosphorylated. Activation of the IGF-I receptor causes phosphorylation of a 185 kDa

protein called insulin receptor substrate 1 (IRS-1), which also can be phosphorylated by

insulin receptors (Foncea et al., 1997). Phosphorylation of IRS-1 occurs by direct

interaction with the IGF-I receptor (Dey et al., 1996). The IRS-1 protein contains 21

tyrosine phosphorylation sites, six of which occur in the YMXM sequence, which is a

recognition motif for binding of proteins containing src homology 2 domains (Myers and

White, 1993; White and Kahn, 1994).

Several second messengers can be activated simultaneously once IRS-1 is

phosphorylated. Therefore, IRS-1 is viewed as a docking protein that after

phosphorylation by IGF-I or insulin receptors forms a large protein complex that

activates multiple signaling cascades (Jones and Clemmons, 1995). Some proteins that

are activated by IRS-1 are the p85/p110 complex (PI-3 kinase), Grb2, Syp and Nck. All

four activated proteins are part of separate intracellular pathways and each contains src

homology 2 domains. Activation of the p85/p110 complex, also known as the PI-3

kinase pathway, is important for cell growth. Another pathway involves activation of

Grb2, which stimulates an exchange protein called Son of Sevenless causing the

phosphorylation of a guanine nucleotide activating Ras. Activated Ras stimulates another

protein called Raf causing phosphorylation of the MAP kinases which activates cell

mitosis and metabolism. The downstream signaling events of the other two IRS-1

activated proteins, Syp and Nck, are unknown (Jones and Clemmons, 1995). Recent









studies demonstrated that IRS-1 is not the only second messenger activated by the IGF-I

receptor. Another molecule activated by the beta subunits of the IGF-I receptor is the

She protein. Activation of She stimulates the Grb2/SOS complex and their respective

downstream intracellular events (Jones and Clemmons, 1995).

The IGF-II receptor signal transduction is different from insulin or IGF-I signaling

since it lacks both serine and tyrosine kinase activities (Okamoto et al., 1990). Binding

of IGF-II to the IGF-II receptor can cause internalization and degradation of IGF-II

(Jones and Clemmons, 1995). Previous studies have associated an inhibitory G-protein

with IGF-II receptor signaling (Okamoto et al., 1990); however, the complete signal

transduction mechanism is unknown.

Binding proteins

A family of six high affinity IGF-binding proteins (IGFBP-1 through IGFBP-6) has

been identified. The IGFBPs coordinate and regulate biological activity of IGFs in

several ways: 1) transport of IGFs in plasma which controls diffusion and efflux from the

vascular space; 2) increase the half-life and regulate clearance of the IGFs; 3) provide

specific binding sites for the IGFs in the extracellular and pericellular space; 4) modulate,

inhibit or facilitate interaction of IGFs with their receptors (Rajaram et al., 1997).

The IGFBPs are regulated by post-translational modifications such as glycosylation

and phosphorylation, and (or) differential localization of the IGFBPs in the pericellular

and extracellular space (Rajaram et al., 1997). In addition to stabilizing and regulating

levels of diffusible IGFs, it has been proposed that IGFBPs may regulate IGF-I cellular

responses by facilitating receptor targeting of IGF-I or modulating IGF-I bioavailability

in the pericellular space (Firth and Baxter, 2002).









The effects of IGFBPs can be regulated further by specific IGFBP proteases, which

cleave the IGFBPs into fragments rendering the IGFBPs incapable of binding the IGFs

(Russo et al., 1999). Some IGFBPs such as IGFBP-2 and -3 can induce direct cellular

effects independent of the IGFs (Rajaram et al., 1997). The IGFBP-3, similar to IGFBP-

5, and more recently IGFBP-2 are reported to contain sequences with the potential for

nuclear localization and possibly can regulate gene function (Schedlich et al., 1998). The

complexity of the IGFBP system in biological fluids is shown by the presence of six

IGFBPs, multiple IGFBP proteases, and the intricate regulation of the two.

Understanding the mechanisms by which the IGFs are regulated by IGFBPs and IGFBPs

by IGFBP proteases may improve our understanding of the physiological function of

IGFs.

Effects on Lactation

Advances in biotechnology beginning in the early 1980s, such as recombinant

DNA technology, allowed for massive production of recombinant GH (bST). The first

study in 1982 demonstrated that bST injected into lactating dairy cows increased milk

production (Bauman et al., 1982). In 1994, bST was commercialized for use in lactating

dairy cows beginning at approximately 60 DIM. The recombinant bST was coupled with

a slow release formulation that allowed for injections of bST (500 mg) to be given

biweekly.

Injections of bST in lactating dairy cows increased milk production from 7 to 41%

above untreated controls (Burton et al., 1990; Stanisiewski et al., 1992; Downer et al.,

1993). The typical milk yield responses are increases of 10 to 15%; however, the greatest

increases occur when management and care of the animals are optimal (Bauman, 1992;

Chilliard, 1989). Variability in milk yield response to bST depends on other factors such









as age, parity (Huber et al., 1988; Downer et al., 1993), energy balance (Peel et al., 1983;

Bauman et al., 1985), nutrition (Elsasser et al., 1989), and milking frequency (Knight,

1992). Injections of bST stimulate the production of IGF-I in the same manner as

endogenous GH. Concentrations of IGF-I increase within 48 h of bST treatment (Gong

et al., 1993).

The major factor affecting the magnitude of milk response to bST is the quality of

management, in particular, nutrition (Etherton and Bauman, 1998). Lucy et al. (1993a)

reported that cows initially loose energy as milk production increases and reach an

energy balance nadir around the third week of treatment. During this time, nutrients are

repartitioned to support energy and nutrient demands for increased milk production.

Supplying adequate amounts of a properly formulated feed ration that provides enough

energy to support the cow and lactation are critical. An increase in milk production is

followed by an increase in feed intake. By the 10th week of treatment, cows generally

consume adequate energy for a positive energy balance (Bauman et al., 1985).

Injections of bST appear to have little effects on the mammary tissue to increase

milk production since very little GHR mRNA has been found in mammary tissue. Binelli

et al. (1995) did not show an effect of GH on mammary epithelial cells. Direct arterial

infusion of the mammary gland with bST had no effect on milk yield (McDowell et al.,

1987), whereas direct arterial infusion of IGF-I or IGF-II stimulated milk yield (Prosser

and Davis, 1992; Prosser et al., 1994, 1995).

The increase in blood IGF-I concentrations that occurs in response to bST

treatment is most likely the method for increased milk production by bST. Capuco et al.

(2001) administered bST to lactating dairy cows and reported an increase in the rate of









cell renewal in the mammary gland thereby reducing the rate of mammary regression

during lactation. One important effect mediated by IGF-I is increased cell proliferation

(Rechler and Nissley, 1990), which is seen in cultured mammary cells obtained from both

pregnant and lactating cows (Baumrucker and Stemberger, 1989). Thus, increased

concentrations of IGF-I in bST-treated cows during the postpartum period might have

positive effects on cell numbers via either epithelial cell proliferation, differentiation, and

(or) maintenance, allowing for a greater milk yield. In addition, IGF-I has been shown to

be a potent inhibitor of apoptosis in a variety of tissues (Peruzzi et al., 1999), which may

contribute to more mammary cells being maintained for lactation.

Blood IGF-I concentrations increase from early to late lactation (Vega et al., 1991).

Lower blood IGF-I during early lactation is most likely due to energy balance and

uncoupling of the GH receptor in the liver. In dairy heifers and cows, serum IGF-I was

correlated positively with energy balance (Yung et al., 1996; Spicer et al., 1990). In

addition, dairy heifers in a positive energy balance had a greater IGF-I response to bST

treatment compared to heifers in a negative energy balance (Yung et al., 1996). The IGF-

I response to bST is also greater during late lactation when most cows are in a positive

energy balance (Vicini et al., 1991).

A main reason for an increase in milk yield due to bST is through the partitioning

of absorbed nutrients to the mammary gland for an increase in milk synthesis (Etherton

and Bauman, 1998). Many metabolic effects are a direct action ofbST involving a

variety of tissues and the metabolism of all nutrient classes: carbohydrates, lipids,

proteins, and minerals.









Lipid metabolism changes drastically after injections ofbST. Lactating dairy cows

in a negative energy balance and treated with bST have decreased lipogenesis and

increased lipolysis, whereas when dairy cows are in a positive energy balance and treated

with bST there is a decrease in lipogenesis without a change in lipolysis (Peel and

Bauman, 1987). The reduction in lipogenesis in bST-treated cows can be as high as 97%

and increased lipolysis can occur within 2 h ofbST treatment (Lanna et al., 1995;

Gluckman et al., 1987). Bell (1995) reported that the changes seen in lipogenesis and

activity of lipogenic enzymes occurs partially through bST increasing insulin. Although

insulin is increased due to bST injections, bST increases the sensitivity of tissues to

insulin (in particular adipose tissue) with no change in maximum response. This leads to

a marked decrease in insulin-regulated events such as glucose transport, lipogenic

enzyme activities, expression of lipogenic enzyme genes, and lipid synthesis (Etherton

and Bauman, 1998). Furthermore, changes in lipolysis and (or) lipogenesis can cause an

increase in nonesterified fatty acid concentrations in dairy cows treated with bST (Binelli

et al., 1995).

Other responses to bST include increased hepatic gluconeogenesis, decreased

amino acid uptake by the liver, and decreased urea excretion (Etherton and Bauman,

1998). Recombinant bST also increased transport and oxidation of glucose which

stimulated lactose synthesis (Peel and Bauman, 1987). Even though nutrient partitioning

to the mammary gland is increased, the gross composition of milk (fat, protein, and

lactose) is not altered by bST treatment (Burton et al., 1994). Therefore the daily

production of major milk constituents is increased by an amount comparable to the

increase in milk yield.









Peak milk production usually occurs between 28 to 56 DIM in lactating dairy cows;

however, bST is not injected until approximately 60 DIM. The bST appears to increase

milk production after bST injections due to a decrease in the normal rate of decline in

milk production. Milk production response to bST is greater during late compared to

early lactation (McDowell, 1991).

Effects on Reproduction

Earlier studies examining the effects of bST on reproduction found negative effects

such that lactating dairy cows treated with bST had decreased conception rates (Downer

et al., 1993), reduced pregnancy rates (Cole et al., 1991; Esteban et al., 1994), increased

incidence of cystic ovaries, increased number of days to first insemination (Esteban et al.,

1994), increased days in anestrus (Waterman et al., 1993; Esteban et al., 1994), and

increased services per conception (Cole et al., 1991). Other studies found no effect of

bST on the number of days not pregnant following parturition (Zhao et al., 1992), length

of the estrous cycle (Gong et al., 1991), or services per conception (Zhao et al., 1992;

Downer et al., 1993; Esteban et al., 1994).

One possible explanation for the decreased reproductive performance is through the

inhibition of behavioral estrus in cows treated with bST. A decrease in estrus detection

was observed in lactating dairy cows treated with bST (Morbeck et al., 1991; Waterman

et al., 1993). In addition, Cole et al. (1992) reported an increase in the interval from first

estrus to first insemination and attributed this effect to a reduced estrus expression.

Furthermore, the reduced estrus expression was associated with an increased negative

energy balance. However, in dairy heifers that were ovariectomized and steroid-primed,

bST treatment reduced estrus expression (Lefebvre and Block, 1992). It was concluded

that bST affected behavioral centers within the brain that control estrus expression.









Kirby et al. (1997b) detected a reduction in estrus expression and an increase in the

percentage of undetected ovulations. Furthermore, neither progesterone nor estradiol

concentrations were affected by bST treatment.

With the advent of TAI, the deleterious effects of bST on reproduction can be by-

passed. Since bST decreased estrus expression that contributed to an increase in days

open, elimination of estrus detection through TAI alleviated this problem. When

lactating dairy cows were injected with bST at the initiation of the Ovsynch protocol,

pregnancy rates were greater than controls at d 27 and d 45 after AI (Moreira et al.,

2000b). In addition, when cyclic-lactating dairy cows were injected with bST at either

the initiation of the Ovsynch program or at the time of AI pregnancy rates were increased

compared to controls (53.2, 44.9, and 38.8%, respectively; Moreira et al., 2001).

Additional studies have documented the beneficial effect of bST on pregnancy rates when

injected during the period approaching AI (Santos et al., 2004b) and in sub-fertile cows

detected in estrus and injected with bST at insemination (Morales-Roura et al., 2001).

In a review by Lucy et al. (2000), bST was shown to have numerous effects on

ovarian function in dairy cattle. The majority of GH receptors within the bovine ovary

are localized in the large luteal cells of the CL; however, there are low levels of GHR in

the follicles. The increase in peripheral IGF-I released in response to bST injections may

be the primary regulator of follicular development in cattle (Lucy et al., 1995; Gong et

al., 1997). Heifers treated with increasing doses ofbST failed to have greater growth of

antral follicles when the bST dose was below the threshold for increased IGF-I (Gong et

al., 1997). Also, miniature cattle (i.e., deficient in GH receptors) with high blood GH but

low blood IGF-I concentrations had one-third the number of small antral follicles









compared with control cattle in the same herd (Chase et al., 1998). The IGF-I may either

have synergistic effects with gonadotropin receptors to increase follicle number and size,

and (or) decrease atresia of growing follicles leading to a greater number of healthy antral

follicles (Lucy et al., 2000).

The number of recruited follicles increased in both cows and heifers that were

either injected daily with bST or with the sustained release formulation bST (de La Sota

et al., 1993; Gong et al., 1991, 1993, and 1997; Kirby et al., 1997a). In addition, lactating

dairy cows injected with bST had a greater number of medium (6 to 9 mm; De La Sota et

al., 1993) and large (> 10 mm; Lucy et al., 1995; Kirby et al., 1997b) follicles while small

follicle numbers were similar to control. In dairy heifers, the increased number of small

follicles in response to bST was correlated with plasma GH and IGF-I (Gong et al., 1991

and 1997). Dominant and second largest follicles are also responsive to bST injections.

The method or amount of bST administration may be important to follicular responses

since Jimenez-Krassel et al. (1999) reported increased numbers of dominant follicles and

increased ovulation rate in dairy cattle infused for 63 d with pulsatile doses ofbST.

Kirby et al. (1997a) found that lactating dairy cows injected with bST had a larger second

wave dominant follicle than controls. In the same study, the first wave dominant follicles

in bST-treated cows regressed faster than controls which led to an earlier emergence of

the second follicular wave (Kirby et al., 1997a, 1997b). Lucy et al. (1994) also reported

earlier emergence of the second follicular wave in bST-treated heifers.

An effect ofbST on follicular growth also was shown in earlier studies in which

bST increased twinning rates (Butterwick et al., 1988; Wilkinson and Tarrant, 1991; Cole

et al., 1992). Earlier studies speculated that greater blood IGF-I concentrations in bST-









treated cows may be the reason for increased twinning since IGF-I is increased in cows

selected for twinning (Echtemkamp et al., 1990). However, although follicular

recruitment is stimulated by bST, only a single follicle is selected and only a single

follicle is ovulated (Kirby et al., 1997a). Thus, the reported increase in twinning rates

among bST-treated cows may not be related to an increase in ovulation rate, but to an

increased likelihood of embryonic survival in cows with double ovulations (Kirby et al.,

1997a). Also, other studies reported no effect ofbST on ovulation rate (Lucy et al.,

1993a), numbers of Class 1 or Class 3 follicles, size of subordinate follicle, size of

dominant follicle (Kassa et al., 2002) or twinning rate (Downer et al., 1993). Lucy et al

(2000) stated that failure to observe consistent results of bST on twinning in dairy cattle

may reflect an interaction of bST with either genetic or environmental factors.

The large luteal cells of the CL contain the majority of GH receptors. Heifers

injected with bST developed larger CL during the early luteal phase (Lucy et al., 1994).

Increased progesterone concentrations were reported in cows treated with bST (Gallo and

Block, 1991; Lucy et al., 1994). A slower decline in progesterone following luteolysis

was observed in bST-treated cows perhaps because of an increase in the proportion of

large luteal cells (Lucy et al., 1994).

Other studies have shown a decrease in progesterone (Jimenez-Krassel et al., 1999;

Kirby et al., 1997a) or no differences in progesterone after bST treatment in dairy cows

(Gong et al., 1991; De La Sota et al., 1993). Lactating Holstein cows treated with bST

had a decrease in the size of the CL and a decrease in progesterone concentrations

compared with controls (Jimenez-Krassel et al., 1999). Injections of bST lowered

progesterone concentrations (Kirby et al., 1997a) in dairy cows possibly due to decreased









CL function perhaps by reducing the number of LH receptors (Pinto Andrade et al.,

1996), by down-regulating somatotropin receptor mRNA in luteal cells (Kirby et al.,

1996), and (or) by increasing overall metabolism associated with increased DMI and milk

production (Etherton and Bauman, 1998) thereby increasing progesterone clearance

(Sangsritavong et al., 2002).

Previous studies have reported beneficial effects of GH and IGF-I on oocyte and

embryonic development both in vitro and in vivo. Izadyar et al. (1997) detected GH

receptors in cumulus cells and demonstrated greater in vitro maturation of bovine oocytes

treated with GH. In addition, Izadyar et al. (2000) also reported an enhanced proportion

of> 8 cell stage embryos on d 3 postfertilization, increased percent of blastocysts

formation and percent of hatched blastocysts on d 9 postfertilization. Recent studies by

Moreira et al. (2002a, 2002b) confirmed these earlier observations with the addition of

GH and IGF-I increasing development to the blastocysts stage and cell number in vitro

and in vivo. In addition, IGF-I has been shown to increase total cell number and reduce

the number of blastomeres that become apoptotic in bovine embryos (Jousan and Hansen,

2004). Another way in which bST may increase blastocyst development may involve

inhibition of apoptosis. These results imply that manipulation of the IGF-I system may

enhance embryonic survival in cows exposed to heat stress or other stresses which induce

apoptosis.

Although bST has direct effects on the oviduct (Pershing et al., 2002), uterus, and

early embryo development (Lucy et al., 1995; Kirby et al., 1996; Moreira et al., 2002a,

2002b), little is known ofbST's effects after d 7 and before d 32 post AI, which appears

to be a critical period for bST to exert direct embryonic or indirect effects via the









maternal unit (i.e., uterus) and (or) circulating hormones such as IGF-I (Moreira et al.,

2001). Another important event within this critical window, on d 16 to 17 after estrus, is

maintenance of the CL.

Treatment with bST both in vivo and in vitro affected the genes regulating

production ofPGF2a. Badinga et al. (2002) demonstrated in a bovine endometrial cell

line that both bovine GH and IFN-T suppressed PGF2, production induced with phorbol

12,13- dibutyrate. When added in combination there was an additive effect in reducing

PGF2, secretion. In addition, when endometrium was collected on d 3 and 7 following a

synchronized ovulation in lactating cows injected with bST, endometrial concentrations

of PGHS-2 protein were decreased compared to untreated controls (Balaguer et al.,

2005). Also, evidence exists for "cross-talk" between hormone signal-transduction

systems such as ERa with IGF-I (Klotz et al., 2002). Effects of bST on fertility may

involve an interaction between bST and IFN-T signaling pathways to regulate PG

secretion or other components of the PG cascade critical for maintenance of pregnancy.

Kolle et al. (1997) found GHR mRNA in d 13 embryos. Their data suggest that

GH may act along with other growth factors (IGF-I and IGF-II) to increase the

development of preimplantation embryos (Kaye, 1997). Furthermore IGF-I receptor is

found in all stages of bovine preimplantation embryos (Yaseen et al., 2001). Because

supplemental bST increases the rate of embryo development to the blastocyst stage and

cell numbers, both in vitro and in vivo, bST may subsequently enhance concepts

development that allows for a greater secretion of IFN-T at d 17 of pregnancy. An

increase of IFN-T may contribute to an increase in the number of animals establishing

pregnancy and a decrease in those experiencing early embryonic loss.









In summary, the previous observations provide definitive evidence that bST

increases pregnancy rates when dairy cows are submitted to a TAI synchronization

program. Previous studies report beneficial effects on the early embryo through d 7

following TAI, however little is known ofbST effects after d 7 through d 17 which is the

critical time for CL maintenance. In addition, supplemental FO feeding may modulate

endocrine function, PG cascade, and uterine environment during and before this critical

time. Among other objectives, this dissertation aims to elucidate the mechanisms) by

which both bST and supplemental FO can increase pregnancy rates with particular focus

on d 17 following a synchronized ovulation (Chapters 3-5). In addition, Chapter 6

explores the effects of both bST and FO on fatty acid distributions among various tissues.

The objective of Chapter 7 is to explore effects of diets enriched in different fatty acids

on oocyte quality and ovarian function in lactating dairy cows.












C-C-C-C-C-C=C12-C-C=Cg-C-C-C-C-C-C-C-COOH C-C-C=C15-C-C=C12-C-C=Cg-C-C-C-C-C-C-C-COOH
C18:2n-6 Linoleic acid C18:3n-3 a-Linolenic acid
A-6 Desaturase

C-C-C-C-C-C= C2-C-C=C9-C-C=C6-C-C-C-C-COOH C-C-C=C15-C-C=C12-C-C=C9-C-C=C6-C-C-C-C-COOH
C18:3n-6 y-Linolenic acid C18:4n-3 Stearidonic acid
SElongase

C-C-C-C-C-C=C14-C-C=C-C-CC-C-C-C-C-C-=CC-C CCC=C17-C-C=C14-C-C=C1-C-C=C-C-C-C-C-C-C -COOH
C20:3n-6 Dihomo-y-Linolenic acid C20:4n-3 Eicosatetraenoic acid
SA-5 Desaturase

C-C-C-C-C-C=C14-C-C=C11-C-C=C8-C-C=C5-C- CC C17 =C14-C-C=C1-C-C= C-C-C= C-C-C-C-CO OH
C20:4n-6 Arachidonic acid C20:5n-3 Eicosapentaenoic acid


Figure 2-1. Pathway of desaturation and elongation of linoleic and linolenic acids
sequentially acted upon by A-6 desaturase, elongase, and A-5 desaturase
enzymes.














CHAPTER 3
PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING DAIRY
COWS: RESPONSES OF THE OVARIAN, CONCEPTS AND IGF SYSTEMS

Introduction

Since approval ofbST for use in dairy cows to increase milk production, the effects

of bST on reproductive function have gained considerable interest. An increase in

pregnancy rate was detected when bST was administered in conjunction with a TAI

program. When lactating dairy cows were treated with bST at the initiation of the

Ovsynch protocol, pregnancy rates were greater than controls at d 27 and 45 after

insemination (Moreira et al., 2000b). In addition, when bST was injected at either the

initiation of the Ovsynch program or at the time of insemination, lactating dairy cows had

greater pregnancy rates than controls (53.2, 44.9, and 38.8%, respectively; Moreira et al.,

2001). Additional studies documented the beneficial effect of bST on pregnancy rates

when given during the period approaching insemination and to cows considered to be

sub-fertile (Santos et al., 2004b; Morales-Roura et al., 2001).

In an in vitro study (Moreira et al., 2002b), GH added to the maturation media

increased cleavage rates of fertilized ova, but had no significant effect on blastocyst

development. Culturing bovine embryos in the presence of GH or rhIGF-I, however,

accelerated embryo development by d 8 post-fertilization and increased the number of

cells per embryo. Moreira et al. (2002a) reported that bST treatment of superovulated

donor cows reduced the number of unfertilized oocytes, increased the number of embryos

that developed to the blastocyst stage, and increased the number of transferable embryos.









Although several studies examined bST effects on pregnancy rates and early embryonic

development, little is known regarding the physiological mechanisms altered by bST that

may increase embryo development up to d 7. Recently, Pershing et al. (2002) examined

the effects of bST, when given at the time of synchronized ovulation of the Ovsynch

protocol, on expression of oviductal and uterine genes encoding components of the IGF

system. Lactating dairy cows were slaughtered at either d 3 or 7 following a

synchronized estrus (d 0), and oviductal and uterine tissues were analyzed. Steady-state

concentrations of IGF-II mRNA were greater in oviducts collected from bST-treated

cows than from control cows. Uterine IGFBP-3 mRNA concentrations were greater in

bST-treated cows than controls, both on d 3 and 7 of the estrous cycle. The mRNA for

GHR was decreased in bST-treated cows by d 7. This study revealed the bST regulatory

complexity in tissue specific gene expression during early pregnancy in lactating dairy

cows.

These findings, as well as others, give conclusive evidence that bST has direct

effects on the oviduct, uterus, and early embryo development (Spicer et al., 1995; Lucy et

al., 1995; Kirby et al., 1996; Izadyar et al., 1996; 1997). However, little is known ofbST

effects after d 7 and before d 32 post insemination, which may be a critical period for

bST to exert a direct embryonic or indirect effect via the maternal unit (i.e., uterus) and/or

peripheral responses (Moreira et al., 2001). Another important event within this critical

window, on d 16 to 17 after estrus, is maintenance of the CL. This process is established

by the ability of the concepts to secrete IFN-' which regulates secretion of PGF2a in the

uterine endometrium (Thatcher et al., 2001). At least 40% of total embryonic losses have

been estimated to occur between d 8 and 17 of pregnancy (Thatcher et al., 1994). This









high proportion of embryonic losses seems to occur around the same time as the

inhibition of PGF2, secretion by the concepts.

Because bST increases rate of embryo development to the blastocyst stage and

increases cell number in vitro, bST may subsequently enhance concepts development,

allowing for a greater secretion of IFN-T at d 17 of pregnancy. This increase of IFN-T

may contribute to an increase in the number of animals establishing pregnancy and

decrease the percentage of early embryonic loss.

The objective of this study was to characterize the effects of exogenous bST on

ovarian function, concepts development, and regulation of the IGF system in the uterus

on d 17 of the estrous cycle in nonlactating Holstein cows as an experimental model.

Materials and Methods

Materials

Gonadotropin-releasing hormone ([GnRH] Fertagyl; Intervet Inc., Millsboro,

DE), PGF2a (Lutalyse; Pfizer Animal Health, Kalamazo, MI), and recombinant bST

(Posilac; Monsanto Co., St. Louis, MO) were used for synchronization of ovulation and

experimental treatment. Recombinant bIFN-T (1.08 x 107 units of antiviral activity per

mg used as a standard) for the antiviral assay was a generous gift from Dr. Michael

Roberts (University of Missouri, Columbia, MO). The cDNAs of GHR-1A, IGF-I, IGF-

II, IGFBP-2, and IGFBP-3 were a generous gift from Dr. Mathew Lucy (University of

Missouri, Columbia, MO). All other materials were purchased from various companies

such as: Trizol, Random Primers DNA Labeling System (Invitrogen Corporation,

Carlsbad, CA), Taq polymerase (cat # M166A; Promega, Madison, WI), ultrasensitive

hybridization buffer (ULTRAhyb, Cat # 8670; Ambion Inc., Austin, TX), dCTP a-32P









(cat # 33004x01), Biotrans Nylon membrane (ICN, Irvine, CA), Centriprep Centrifugal

Filter Devices (Millipore, Bedford, MA), nitrocellulose membranes (Hybond, Amersham

Biosciences Corp., Piscataway, NJ), recombinant human IGF-I and IGF-II (Upstate

Biotechnology, Lake Placid, NY), and Modified Eagles medium, Vesicular Stomatitis

virus, and immortalized bovine kidney cells (MDBK) were purchased from American

Type Culture Collection (Manassas, VA). All other general materials used were from

Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO).

Animals and Experimental Design

The experiment was conducted at the University of Florida Dairy Research Unit

(Hague, FL) during the months of October 2001 through February 2002. Nonlactating

Holstein cows in good body condition (>3.0) were housed together in a free-stall facility

with grooved concrete floors and fed a total mixed ration twice daily throughout the

experiment. The barn was equipped with fans and sprinklers that were operated when the

temperature exceeded 25C. Estrus was presynchronized (Presynch) in 78 cows starting

on d -27 (d 0 = TAI) with a GnRH (2 mL, 86 Gg, i.m.) injection and with an injection of

PGF2a (5 mL, 25mg; i.m.) on d -20 (DeJarnette and Marshall, 2003; Figure 3-1). Estrus

was detected between d -20 and -10 using the Heatwatch electronic estrus-detection

system (DDx Inc., Denver, CO; Rorie et al., 2002). The Ovsynch protocol (Pursley et al.,

1997a) was administered beginning on d -10 GnRH (2 mL, 86 Gg, i.m.) followed 7 d

later (d -3) by an injection of PGF2,. At 48 h after injection of PGF2,, GnRH (d -1) was

administered, and 55 cows were inseminated 16 h later. All inseminations were

administered by the same technician with semen from one Holstein bull of known

fertility (Select Sires; 7H05379). The cycling group (n = 23) was not inseminated. Cows









received either a recommended commercial dose of bST (500 mg) or no bST on d 0

(when cows were either inseminated or not) and again on d 11. The bST injections were

given 11 d apart, instead of 14 d, to allow sustained continual exposure to GH until d 17

of slaughter. The bST injections were given subcutaneously in the space between the

ischium and tail head. Ovaries were evaluated by real-time ultrasonography (Aloka SSD-

500, Aloka Co., Ltd., Tokyo, Japan) with a 7.5-MHz linear-array transrectal transducer

on d 0, 7, and 16. Follicular responses examined were: numbers of class 2 (6 to 9 mm)

follicles, class 3 (> 10 mm) follicles, CL, diameters of the largest follicle (mm), and the

CL tissue volume (mm3). The tissue volume (V) was calculated using the length (L) and

width (W) of the CL to calculate the average diameter and volume (V), with the formula

V = 4/3 x t x R3 using a radius (R) calculated by the formula R = (L/2 + W/2)/2. For CL

with a fluid filled cavity, the volume of the cavity was calculated and subtracted from the

total volume of the CL. Blood samples were collected daily from d 0 to 17 to be

analyzed for various hormone concentrations. A follicular cyst was detected on d 7 in 5

cows and CL regression prior to d 16 was observed in 2 cows. These 7 cows were

excluded and not slaughtered. Cows (n = 71) were slaughtered on d 17 after TAI to

collect tissue samples and verify presence of a concepts. Pregnancy rates were defined

as number of cows classified pregnant based upon visualization of a concepts in the

flushing at slaughter divided by number of cows inseminated.

Tissue Sample Collection

All cows were sacrificed in the abattoir of the Meats Laboratory at the University

of Florida. Reproductive tracts were collected within 10 min of slaughter, placed on ice,

and taken to the laboratory. Conceptuses and uterine secretions were recovered as









described by Lucy et al. (1995). Briefly, 40 mL of PBS was injected into the uterine horn

at the uterotuberal junction contralateral to the CL and massaged gently through the

uterine horns, exiting through an incision in the horn ipsilateral to the CL. Uterine

luminal flushings (ULF) and the concepts were recovered into 250-mL beakers. The CL

were removed from the ovaries, weighed, and their diameter (mm) was measured to

calculate total tissue volume as described above. The uterine horn ipsilateral to the CL

was cut along the mesometrial border, and the endometrium was dissected from the

myometrium. Endometrial tissue from the anti-mesometrial border of the ipsilateral horn

was cut (1 cm x Icm) and frozen in liquid nitrogen for Northern blot analyses.

Endometrial tissues were collected from 14 cycling (7 C and 7 bST-C) and 16 pregnant

(7 P and 9 bST-P) cows. The ULF was recovered from 19 cycling (12 C and 7 bST-C)

and 18 pregnant (9 P and 9 bST-P) cows.

Interferon-tau Antiviral Assay

Activity is expressed in terms of antiviral units per mL as assessed in a standard

cytopathic effect assay (Familletti et al., 1981). Three-fold dilutions of ULF from

pregnant cows were incubated with MDBK cells in 96 well plates for 24 h at 37C.

Following incubation, inhibition of viral replication was determined in a cytopathic effect

assay using vesicular stomatitis virus as challenge. Antiviral units/mL (defined as the

dilution causing a 50% reduction in destruction of the monolayer) was converted to

[g/mL IFN-' by using a standard curve with known amounts of recombinant bovine IFN-

T. Total amount of IFN-' (pg/total volume) in the ULF was calculated by multiplying the

IFN-' concentration by total amount of flushing fluid recovered for each pregnant cow.









Ribonucleic Acid Isolation and Northern Blotting

Total RNA was isolated from endometrial tissues (300 mg; n = 30) with Trizol

according to the manufacturer's specifications. Total cellular RNAs (30 .ig) were

resolved into 1.0% agarose-formaldehyde gels and blotted to nylon membranes.

Following blotting, RNA was crosslinked by UV irradiation and baked at 800C for 1 h.

The blots were prehybridized with ULTRAhyb buffer for 1 h at 42 C. Filters were

then hybridized with random primer-P32-labelled bovine specific cDNAs (GHR-1A, IGF-

I, IGF-II, IGFBP-2, IGFBP-3 and GAPDH; Feinberg and Vogelstein, 1983) overnight at

42C. The next day, the blots were washed once in 2X SSC/0.1% SDS for 20 min and

twice in 0.1X SCC/0.1% SDS for 20 min each at 42C. The blots were gently patted dry

with kimwipes and exposed to X-ray film at -800C. The autoradiographs were quantified

using densitometric analysis (Alphalmager, Alpha Innotech Corp., CA). Once all blots

had been labeled with their respective probes, blots were stripped, probed for GAPDH,

and quantified.

Analysis of Hormones in Plasma and ULF

Blood samples (7 mL) were collected daily from TAI (d 0) until slaughter (d 17)

using a 20-g Vacutainer blood collection needle (Benton Dickinson and Company,

Franklin Lakes, NJ) from the coccygeal vein in 3 different locations, which were rotated

at each bleeding to minimize irritation. Samples were collected in evacuated heparinized

tubes (Vacutainer; Becton Dickson, East Rutherford, NJ). Immediately following sample

collection, blood was stored on ice until it was returned to the laboratory for

centrifugation (3000 x g for 20 min at 4C) for collection of plasma within 6 h. Plasma

was stored at -20C until assayed for GH, IGF-I, insulin, and progesterone.

Concentrations of progesterone were analyzed using a solid phase RIA kit (Coat-a-count,









DPC, Diagnostic Products Co, Los Angeles, CA). Plasma samples were analyzed for GH

(Badinga et al., 1991), insulin (Malven et al., 1987; Badinga et al., 1991), and IGF-I

(Badinga et al., 1991) by specific RIAs. The extraction procedure used for the IGF-I

assay (Badinga et al., 1991) was modified slightly using a 6:3:1 ratio of

ethanol:acetone:acetic acid. The ULF was concentrated from 15 ml to approximately 2

ml with a Centriprep Centrifugal Filter Device fitted with a 3000-MW filter (Millipore,

Bedford, MA) and then analyzed for IGF-I and GH using the same RIA procedures.

Values for immunoreactive IGF-I and GH were expressed as total ng in ULF. Protein

concentrations in ULF were determined using the Bradford method (Bradford, 1976).

The minimum detectable concentrations for GH, IGF-I, insulin and progesterone were 0.1

ng/mL, 10 ng/mL, 0.02 ng/mL, and 0.1 ng/mL, respectively. The intra- and inter-assay

coefficients of variation for plasma GH, IGF-I, and insulin were 9.7% and 5.4%, 5.3%

and 1.9%, 1.7% and 3.5%, respectively. Plasma concentrations of progesterone were

completed in one assay with intra-assay coefficients of variation calculated from

duplicated samples in 3 ranges of low (0.5-1 ng/mL; 12.0%), medium (1-3 ng/mL;

8.24%) and high (>3 ng/mL; 7.27%) progesterone concentrations. The intra-assay

coefficient of variation was 9.7% for the luteal phase plasma reference sample (5.8

ng/mL). A reference pool for ULF resulted in intra-assay coefficients of variation of

15.8% and 10.8% for GH and IGF-I, respectively. The intra-assay coefficients of

variation for duplicate samples within the complete assay for the ULF GH and IGF-I

were 10.0% and 11.5%, respectively.

Analysis of Uterine Luminal IGFBPs

Ligand blot analysis (De la Sota., 1996) determined the relative abundances of

IGFBPs in the ULF. Concentrated ULF proteins (100 tg) were subjected to a 12.5%









SDS-PAGE under non-reducing conditions. Proteins were then transferred to a

nitrocellulose membrane by electrotransfer. The filters were blocked for 1 h with Tris-

buffered saline (TBS, pH 7.4) which contained 1% non-fat dry milk. The membranes

were washed and then incubated in 30 mL of TBS containing 1 x 106 cpm/mL of [1251]-

labeled rhIGF-II for 24 h at 4C. Filters were washed with 5 changes 10 min each in

TBS, blotted dry, and exposed to X-ray film for 48 to 72 h. Signals for IGFBPs were

quantified by densitometric analysis and the total content of IGFBPs in ULF calculated.

The IGFBPs (arbitrary units/100 .ig) were calculated back to the total amount of protein

in the ULF recovered, and units expressed as arbitrary units of IGFBPs/total ULF.

Statistical Analyses

Pregnancy rates were analyzed using the Chi-square and Logistic Regression

procedure examining the main effect ofbST. The main effect ofbST was also tested for

concepts size (cm) and IFN-T content of ULF utilizing the GLM procedure of SAS

(SAS Inst. Inc, Cary, NC). The ovarian responses on d 17 at slaughter were also

analyzed using the GLM procedure of SAS testing the main effect of bST, pregnancy

status, and the interaction of bST-pregnancy status. Number of CL was used as a

covariate for analysis of CL volume on d 17.

Numbers of class 2 (6 to 9 mm) and class 3 (> 10 mm) follicles, and CL, as well as

largest follicle size, and CL tissue volume were analyzed using the Mixed Model

procedure of SAS (Littell et al., 1996). Cow within bST and pregnancy status was a

random effect in the model. The model included fixed effects ofbST, pregnancy status,

day and the higher order interactions. The CL tissue volume was adjusted for CL number

as a covariate.