<%BANNER%>

The Design and Synthesis of a Genetic System for a Synthetic

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110330_AAAALZ INGEST_TIME 2011-03-30T18:17:21Z PACKAGE UFE0012925_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 25271604 DFID F20110330_AABQLZ ORIGIN DEPOSITOR PATH sismour_a_Page_083.tif GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
fe742be1598980fb25c2c6816f712cc4
SHA-1
98bc4ea335e8be4313aca5e1eea1d01e003b6ab7
1924 F20110330_AABQNC sismour_a_Page_054.txt
e2913ebf91f8043897d40dfde76b1110
983fb1cd7500dd913f544e32bf702f74fa2feef6
1053954 F20110330_AABQMN sismour_a_Page_136.tif
e837476e65297ae634df7e23427c6e50
f238805d476cee224614f37e6023dc9e0ede4ca3
F20110330_AABQMO sismour_a_Page_139.tif
68e30b2fcd804b5d8cfad28fb133cba8
1a03a6ed4d66bf840b1ea9b2b5fff036f4c31a89
1939 F20110330_AABQND sismour_a_Page_055.txt
dddaaeff13df6f97db68fbc2edb36402
0b1885f6ee2f3d768a20dfee4ff7c260727feb17
F20110330_AABQMP sismour_a_Page_140.tif
1ed1735f4a8ddb57be30d67a0f835416
9151e40bf20d7474cb933a14a5ccac2f657ab573
1812 F20110330_AABQNE sismour_a_Page_056.txt
20389eb7727d9e89fcccfda0d7a6ea94
8f510a01b0a26397fc7a73e330cfa51e7c8c2ac6
F20110330_AABQMQ sismour_a_Page_141.tif
ff2e3068df2994c05a15a51c1585ab7c
67a30a23e0d8a04014b5d28fa0b5ecd034252f2a
1979 F20110330_AABQNF sismour_a_Page_057.txt
ec9df7c2aa1e9ebdb3f46707c5722d2e
342fb473fe1944fda78ae9611ee91a5659bf63cd
452 F20110330_AABQMR sismour_a_Page_003.txt
2430030cf2c8beb3e62d804387438dec
790b2525ff395d56b8a9123a0fa7ebe7213f4866
1729 F20110330_AABQNG sismour_a_Page_058.txt
d204ee3f578e990213706221c700cf0b
a65a746281f5c15330b5103e5ed2a68c5aaaec1a
2344 F20110330_AABQMS sismour_a_Page_009.txt
038ccf074ea858138fa3eff388a40f50
627eedc142a8f02ca783c07670d4bc51d8ce4e02
1789 F20110330_AABQNH sismour_a_Page_059.txt
5547e9653ee33493c9476a9eb0a7ba0d
8373d3beb4d4914c90445b8472db17f10bae20b4
1903 F20110330_AABQMT sismour_a_Page_017.txt
30355a3e3e2101d09f4c34ef77701449
32ab17eeb410167741f0a0262be84cf833fcd6b7
2051 F20110330_AABQNI sismour_a_Page_060.txt
5f2ddf91e03203d4d4d3616272eaedfd
b7c13fe986e7da8fc1625eef4656e90bf026b132
205 F20110330_AABQMU sismour_a_Page_027.txt
68de09a0a37c09b658ef60049174d909
b20256ccbcb384f25cb1dca30a30345e43d8bd83
1854 F20110330_AABQNJ sismour_a_Page_062.txt
c2c4fda55fe855bfa3bac032f69e608b
f1183d5ac6696feb5e7e689a87a4b3330301a970
F20110330_AABQMV sismour_a_Page_029.txt
e76740848f16c6b56c42a7771bdde505
3b19498c39eaaa7187cb9feb68bd2f64a28af9ac
140076 F20110330_AABPKI sismour_a_Page_136.jp2
df572ed8a12c3006a74ad0431b703778
4be7208985d348950619e890adb4884cca8f9cb4
1738 F20110330_AABQNK sismour_a_Page_066.txt
ffe4a263f71e020b13daaafcea308c1c
475053cd54818931f3b426c5938fbdb2e9c2dd23
2171 F20110330_AABQMW sismour_a_Page_033.txt
ec375cafaa42d3fd31a21cd6e1531171
83f6acd002c3184c629763fe1bac7385252c0bd2
1666 F20110330_AABQOA sismour_a_Page_114.txt
fdb68ee754cd0ae451dd8ca73e0e21e8
2baa3e6e4d290c11040f4be3a25243b05b46b89d
45373 F20110330_AABPKJ sismour_a_Page_099.pro
2ef6cf59ac7f5a593c10ad71e741c9e2
dbd0287be2a9f092c8b4f8eb46b9b733e49e2046
2146 F20110330_AABQNL sismour_a_Page_068.txt
3c10f8b4090763cceecc80f408fc6875
25e382da3818edbef67e2864ef3f635170017157
1891 F20110330_AABQMX sismour_a_Page_041.txt
e0b3cd5c948aaf90181a1050ff9c4688
74673574ee3a27d6886fd0d53a2922b169b88646
2054 F20110330_AABQOB sismour_a_Page_122.txt
b7355d74e52e45dd770f23bcbf3522ff
761a54fd3617a757de868f31dfc63db01cadef04
6497 F20110330_AABPKK sismour_a_Page_122thm.jpg
d22a66fd57fb31bd12c9b77a8a716d2f
ec250facc5c37389f3a00af6203d627899638e18
1556 F20110330_AABQNM sismour_a_Page_071.txt
380037c662eb83bd9443bf1104a91fe6
6d531d79f98158e5ea75c494c075b8e1680be204
1866 F20110330_AABQMY sismour_a_Page_045.txt
447a68135f4f16e837e668a88a3e521c
e2fc5ac9e04734d31fe958bd669505decb2faa87
2068 F20110330_AABQOC sismour_a_Page_123.txt
d1674046a611ec2d3c86541f8ca588f9
cf2e2d0854550cff6448922678343c48195c8c57
80424 F20110330_AABPKL sismour_a_Page_012.jp2
988b4414e97a201e7fe2e24e3b9f006f
5dc162c2f9a2516164a2bac3101aa1855b97aa2d
1882 F20110330_AABQNN sismour_a_Page_073.txt
21368023db063b0d5d6257ede2545182
4a571a31233f43cd70b40b45977033d8ce4d514f
1977 F20110330_AABQMZ sismour_a_Page_046.txt
2d0bc3dd3db1582cf31958e1de198964
1188617c90bdd9fca5c0d7e8e370be30e1137f7f
24189 F20110330_AABPLA sismour_a_Page_103.QC.jpg
8d651a1282cc77c009fc79e17a16c408
227f891e430aaa41050f47478b1f07870f1fc1d7
1716 F20110330_AABQOD sismour_a_Page_124.txt
5bd27c3f53675734cb51387bac50d94d
0533dded918b3779cff1e5d1351d583a2b5067b0
86169 F20110330_AABPKM sismour_a_Page_122.jpg
68468d848b3c5c966fa6e9946f3fde46
c78fb005bc75c8f403327acff67d3f7a9bb1ec87
1846 F20110330_AABQNO sismour_a_Page_076.txt
ae8a84fa09666d586a32bc9820fc8958
cf586196301390cbbcb5d3ffcabc7014fed7d7a3
80185 F20110330_AABPLB sismour_a_Page_072.jpg
676be9643dec3494270dba72b85047e0
03f0c272c46bf31a59d087c6abf60c24d7f1a6db
80130 F20110330_AABPKN sismour_a_Page_111.jpg
71c82a9306c1a76e4f9e6d387fef8054
9d1ddc17bcc14a32e83699b991972f800dcdcba6
1906 F20110330_AABQNP sismour_a_Page_078.txt
f0ba273863056b88cf861edd21e27d91
93357c4219da5d93c25d7a8b4c20d718b8e028f6
2751 F20110330_AABQOE sismour_a_Page_136.txt
f60bf9481fdf90ec002f3e5c749d833b
875eff789a446c572bdf5a6c4873c8088725a833
46414 F20110330_AABPKO sismour_a_Page_084.pro
c60e2d5d40fa157fb37ce2648eab81bb
1d2dcd1aa36cd40cae226f14b4ff3a6ac7ca9b85
2077 F20110330_AABQNQ sismour_a_Page_079.txt
04e208fc61e307982d096ff795f9d394
2dcd66e311c4745dd2befbbf6157a415d6a6708c
F20110330_AABPLC sismour_a_Page_106.tif
de61ae300cc7814d2f56103d48d4492d
b92f52025c2097464dc0e056da7af84194dc9295
2570 F20110330_AABQOF sismour_a_Page_137.txt
44323be8a105ee0a70ac697f1f5f2b24
1caa88ebe9260ea73040c7594e32d4404f18eae2
949041 F20110330_AABPKP sismour_a_Page_093.jp2
88541c2b0b135f40a05f955fd406f0c3
efe7b401acc31a5305e24b883847b49104fded30
1905 F20110330_AABQNR sismour_a_Page_084.txt
b9ba4931fe1ae214fd4567fde399a74f
e70f280126cb30ea0957903be879eab7e8cc87e8
48136 F20110330_AABPLD sismour_a_Page_029.pro
75326a9a26d0bbb642bef4390959f0ba
0ffb9f9ad5bc14c50e0dcd2a97604bbda89b6d4c
2296 F20110330_AABQOG sismour_a_Page_140.txt
83f0b64c7166bdc10c846eab614e23d5
88e6584fc79de77f05c115967c38373787b4dd51
23398 F20110330_AABPKQ sismour_a_Page_116.QC.jpg
db9681ed0b44e3c5915036b60954f791
286d881bc991a84df2a6098ee4af9efccaf008ce
1740 F20110330_AABQNS sismour_a_Page_087.txt
1b46a4e3d7332054e52f7653dd901d1b
34020418b2b0216c97e8d486c30b5a99b6dff756
F20110330_AABPLE sismour_a_Page_127.tif
7950f3962f51a1277a12e7b08ff30d97
195b2cc5e14b0c1d05a963671fe0dcb8446daaf8
771 F20110330_AABQOH sismour_a_Page_141.txt
dc003269961e9834eeab3346449feba9
33fbf3c27a9f1fb24e4ad0daaa725344060466d5
6020 F20110330_AABPKR sismour_a_Page_010thm.jpg
cbdb5320905d9abf3062e4fad18f4cb1
02cc92bf97e7f52ce4fb75cbced1b099ffbe7f59
2294 F20110330_AABQNT sismour_a_Page_088.txt
e82181bc57d5da03bf7e43144a74b3ba
52d9d2049dcbab8f65c290907f5b51682575865f
5192 F20110330_AABPLF sismour_a_Page_124thm.jpg
467614e4f1090f187f6bd9f44ea849ca
d4442ab55514d344f701684b2f61e8112cdd7cc5
1253 F20110330_AABQOI sismour_a_Page_002.pro
ec3dfbc4181598b1156b2e13072fb0fc
21f9fa1f1a24d071442f577b177bbc3a272e6704
5129 F20110330_AABPKS sismour_a_Page_006thm.jpg
d68be53fc58d8e7ba5c3f22b34a41cb5
3fb1a70df8a5c7f1132fcaa32ff2103d9cf7b8f9
1950 F20110330_AABQNU sismour_a_Page_096.txt
d7c758ed9dbd2f4407a3ed93ce15e73e
2d73c12e29cda89a66ad128ee96d26765c1ca096
19147 F20110330_AABPLG sismour_a_Page_075.QC.jpg
ed09dc2360d302ed8b2493902430f0f4
67e0c98be3992423b776be2ce25a41c7680c2b9c
36826 F20110330_AABQOJ sismour_a_Page_012.pro
7637c1b1a981e056ed09138a15805a22
9a824374eb4e4175e5a033a262b271b3913e2713
1766 F20110330_AABPKT sismour_a_Page_126.txt
5b26b28f048dfbd2c4e31d16e185f445
12626cf665f9cc12950d8b064fff61be3464b1e3
2239 F20110330_AABQNV sismour_a_Page_099.txt
c799213d39c889fb5138393713329f04
ac56755d14f8a5b10aa93519706cf7bbc6337c78
23436 F20110330_AABPLH sismour_a_Page_046.QC.jpg
85dd8ede71776a5d4facc95c9b2d6aa3
24275fbc7c6f2a06686d161baa627b8188379c7d
18191 F20110330_AABPKU sismour_a_Page_141.pro
821ea59765b570f4821f636886c7b5d8
84b41c7ac7fb60fc29d0d37c64d45a5f0c635539
1911 F20110330_AABQNW sismour_a_Page_101.txt
53fe8877d827eb871155f19d6a5529db
a2e4765a38ce4f566628c833f1e73f941bdd346f
24920 F20110330_AABPLI sismour_a_Page_095.QC.jpg
112029773bfb4bd01bb027d43be027cb
7c9373bcfe887b645f1cbc229747b0a0a45bb065
39943 F20110330_AABQOK sismour_a_Page_014.pro
b851211cede567650975db2582f09170
03f526091dcdcab16a2cae58087b73aac7de8ded
41617 F20110330_AABQPA sismour_a_Page_066.pro
df09bcf82d6fdbbcda7299e8dd72d5ef
48aa0f421731a788633f49520eed5a270f82a7ab
24333 F20110330_AABPKV sismour_a_Page_087.QC.jpg
e8ec13c3aa83c5550938e39d4344f303
503f9cc1e6a753bbfd00451314d0b1f8d3eeb557
1762 F20110330_AABQNX sismour_a_Page_102.txt
905ec7f8dbddc179149d8f2bf874bbc7
76b6d27940d3844240e25c6724459122e91cd8e9
6432 F20110330_AABPLJ sismour_a_Page_053thm.jpg
3dd91b7b7b0355139b2ca477c646e9b0
cedcd49d3578aeeb45a070fcfcb31caf90df0f2f
48940 F20110330_AABQOL sismour_a_Page_018.pro
58b2ab63b39c31eb593d1aef9fb15817
e0aa85980e409fd8b62bbc7a4b80c6ae22f81fd8
44745 F20110330_AABQPB sismour_a_Page_068.pro
09da42c3ab0fb6bad5e8498c2a181599
ead8b29455762003d526e08de2b621bd448cb57d
66737 F20110330_AABPKW sismour_a_Page_039.jpg
ac1205ec90e9aeceafa3a312bdb34135
18c114ccc4a2294fff0757ad662edec210b8f097
1700 F20110330_AABQNY sismour_a_Page_108.txt
8edbe6b2c450fe3af726dd401b2fde48
36ac63d4908138c60faf3c140b64f1875ee05645
106851 F20110330_AABPLK sismour_a_Page_096.jp2
2369d2930ef4c246c0eb6e26acb8e673
3cc5e6b9f9dec6280cfe39bdff536cf0826f7d8b
47593 F20110330_AABQOM sismour_a_Page_020.pro
f58632077e9eac8aaf0cc9a37fe4680e
ce6c323bd24e27a3088ead0c31248cfceec3ac45
38929 F20110330_AABQPC sismour_a_Page_070.pro
ca78f2abcfeebf14354d13216f44340a
9034d75e19abeaab355b113690a1c9c8290dba00
21321 F20110330_AABPKX sismour_a_Page_039.QC.jpg
2b0dad662452f694cc8eeaf2223b7ccf
d6c28ccd2059aa750dbf9f3721e8245a85ba769a
1792 F20110330_AABQNZ sismour_a_Page_110.txt
ed72da88ca5b610618820aca0ae9109e
c53dd80a0a98feba7beaf53be733f2f9b1499fee
6667 F20110330_AABPMA sismour_a_Page_139thm.jpg
6124d5d2d679ea0b720e15f070f47a2d
9734b04ba0d8f421bc456eda6091600dfdc99545
5990 F20110330_AABPLL sismour_a_Page_104thm.jpg
00bc4082ca0704e51f0632cb9b79e59c
712b9b05e34f77e9775417ad48c773f004ea75e7
48696 F20110330_AABQON sismour_a_Page_022.pro
0595d32d4c425452ad9ad92e9737db5a
61180ec6879aa0c206994745454c2980652db51a
34978 F20110330_AABQPD sismour_a_Page_075.pro
193998c202b75d541812733278c89b97
a313a689f047a374394fc1e60bb7f9bbfe4ec5f2
40941 F20110330_AABQOO sismour_a_Page_028.pro
4b0f3bda75bf810a7fd335c15aec870e
3578919351429aad4b712f300f67e89f95d57706
103815 F20110330_AABPKY sismour_a_Page_023.jp2
587a42284173c24af698a50dd3c69be4
11d62ff2d8f877df57365b383619115dd2aab0f0
100228 F20110330_AABPMB sismour_a_Page_026.jp2
30ebebaf0a950f389f87a528955d4e70
0d459fc3f45a7a324fb95e3573f0c062de6ca216
22140 F20110330_AABPLM sismour_a_Page_028.QC.jpg
21d71b86bacd54c54d590f55695bbf8b
ad19d354a9392d358ccc288e30e3e245d4443ccc
49718 F20110330_AABQPE sismour_a_Page_077.pro
f242d072f78e1a8448df2ee2d9b35825
5cb7273ec0b985991e1ffcc424e4c3b07f92eecf
33583 F20110330_AABQOP sismour_a_Page_034.pro
f8d888ae498b57cf763003ca5639bcdb
875486638106fbdc871aa753e9b53fe671738ce0
59025 F20110330_AABPKZ sismour_a_Page_075.jpg
90a4e4f8950e428d83ba7a0e8d3d0a6c
e4afe576157ca2ed6476d526d84a73479c0742d8
5632 F20110330_AABPMC sismour_a_Page_061thm.jpg
f64fb6076ee05da31856b05aa4e800e9
48909161dda686af28bc9fdb306d11162b598c9e
75253 F20110330_AABPLN sismour_a_Page_049.jpg
18968b1050bc916e385d61ef1fdfd463
063805c06c8d0d887d63a87991e7d4a7fb3d9bc8
37643 F20110330_AABQOQ sismour_a_Page_035.pro
b36f25d83658ed7f63476783507c47be
276a2c20f9ce059b1d6441bea2d0535ce143e28b
6290 F20110330_AABPLO sismour_a_Page_029thm.jpg
e3b5790d047bcd966e435f17b4e977dd
9ccd24e78dc91298fc99af14f263702485406bfe
50985 F20110330_AABQPF sismour_a_Page_081.pro
102c7c7da5a494bd9c6b729641cff329
40f2bda6d85cc88d71a1c42b7631cb6e701fdf47
38310 F20110330_AABQOR sismour_a_Page_037.pro
99c4726de39a16673a5e1cefcd2bfd9b
37e19cfefb0e230258d52c2ace68e592e80945c3
6177 F20110330_AABPMD sismour_a_Page_067thm.jpg
f32ac5c0b91c40b61d601fb532622479
42a0993db7cb38d04442a43ece1fb20319f6e8c8
F20110330_AABPLP sismour_a_Page_134.tif
cbe2c8fdaa5bc231e61d04ea02a207dd
e57989903077692d771f8ecf2d2a6ea966ff4406
45149 F20110330_AABQPG sismour_a_Page_086.pro
efe664b0a8cbe1e74e5395cfff3854b6
c099fc55ac3e3a60fc721d2468c1bc2ed51b3e01
47054 F20110330_AABQOS sismour_a_Page_042.pro
4e8835f2817744f2f449886c7bcaf47f
4bb9daa2285899d5d91af77171115bd9ba7f4068
106693 F20110330_AABPME sismour_a_Page_054.jp2
250958e43ebe210c15b458b7cce36dd9
28f0ec42995a9fc02d063a471b31a525bec4037f
2045 F20110330_AABPLQ sismour_a_Page_082.txt
08c56f67e3fb8aaeb10dc237df86a24d
1f648e56abeef1aefd15259040a66ecf79cac1d4
26200 F20110330_AABQPH sismour_a_Page_090.pro
bc2db54b138ee028d0a4754e37383730
bba5e26464dff18ac7f98a34419e8288385e277b
40855 F20110330_AABQOT sismour_a_Page_043.pro
b6042206518e484cb406a4a0f02703a3
2848030c6bb98746e60a8c2eb4ba3dcc393d6efd
44774 F20110330_AABPMF sismour_a_Page_100.pro
96a4b2a2bb09cebc0731bc765854fb1f
642b12f0477c1e95a74cf13230f27ebfe634b35c
6863 F20110330_AABPLR sismour_a_Page_133thm.jpg
9e27642ccd22bc876019a13bdbecc57f
fc2b74308f53821816a3b892e708feddb4949f7a
26616 F20110330_AABQPI sismour_a_Page_093.pro
ed988abc29d2d3a28a823c55f43b4163
ec83290c1e3388d16cb81dd656912169f7f514ff
48953 F20110330_AABQOU sismour_a_Page_054.pro
e4962117ea60f84172c80d1184a18e18
ee2163cf251dcc099a46c1784cb6a15996ac4568
913713 F20110330_AABPMG sismour_a_Page_089.jp2
888b4121a21e207a8bab3babf53c9a08
12ee96d507c8b1259eb759102ef9e167019ddd86
1757 F20110330_AABPLS sismour_a_Page_091.txt
792927be8028c1f9c6c37e189a3988a6
8e44399073cc2677639fac9a1890689a81620450
48020 F20110330_AABQPJ sismour_a_Page_094.pro
ec02876a38d2730a17aa66851ab62441
dca0273cf1c207e312fc76edafe961bacdd47c5e
49175 F20110330_AABQOV sismour_a_Page_055.pro
607f94f3a7cf4395c03cded88da94998
6c408645724186d31a98145222f2242e02356001
44571 F20110330_AABPMH sismour_a_Page_109.pro
f551a13a6abff02f51246bf63e7b25db
f3e8f9a1f40def11dd7302c66aec1174ea71b77a
127878 F20110330_AABPLT sismour_a_Page_135.jp2
9b52baabc0dc4ddcc789b3a016eb8113
e398031de53abd72784e286f285a29bfc2465f40
41273 F20110330_AABQPK sismour_a_Page_101.pro
27c4a4a3be122847c20eb45e9a6f88ea
c5aff5696f22808d1dd217c580a5bc6781b9af74
50140 F20110330_AABQOW sismour_a_Page_057.pro
e22dd52b72777a0f1f5738cabc1990ea
15c7d1298e63422871baadd154a6ce2dcc32eef0
F20110330_AABPMI sismour_a_Page_060.tif
00909d636d128ab9ffafe948d4dcb9b3
886cf2e4e777d3cc937db087084238bb7c94e928
84514 F20110330_AABPLU sismour_a_Page_080.jpg
aa47d577e413faf8527fee44d5f1ca4e
963ea9641009fa79f49300f572e3deddeb2f5067
6558 F20110330_AABQQA sismour_a_Page_001.QC.jpg
d0169776f5414bbb004c1afc1cff1177
5adc9bf17b8d953ada6c761c990e27b39e25a790
52184 F20110330_AABQPL sismour_a_Page_107.pro
8018687ecde7a58cccae9bc85735ca1b
815174a97bdfd01f616bc939b7bd6a690abc80ab
42554 F20110330_AABQOX sismour_a_Page_058.pro
c76e0ddc1bedec56f6a124bd28875721
c28e2e019b88bf02085ffac69610e9f0c5d7f160
105108 F20110330_AABPMJ sismour_a_Page_137.jpg
67c83f8419ca4866f89435ff2296a712
372fea141a6e0ff978c487e097d48c6538ee01b1
80932 F20110330_AABPLV sismour_a_Page_106.jpg
54787e0fb3b90abe227ec5dce675c3da
bcf41b2d5d40af2ed140c4988033e572d096a694
19738 F20110330_AABQQB sismour_a_Page_003.jpg
d0bc7b1cdfbb15db50a16c5fdf3c4f11
dcfa02e3edb06fbacce1324448c46c80f090aae1
35221 F20110330_AABQPM sismour_a_Page_108.pro
7e21d6f4c23cffd850abb2f0e07196af
f7c2a3e27bebb1f9a16eed7d1d184f95708e6b2e
50522 F20110330_AABQOY sismour_a_Page_060.pro
cc0a56a894a7a93a9a367b4addeb58b0
8c40aeb8b25c745cd1702cb2fcaa1736a345f1e4
F20110330_AABPMK sismour_a_Page_047.tif
9993384299699eaf2d9594b572b9ebea
c32f731c10612b95d7174c4336b4863d2be96ee0
F20110330_AABPLW sismour_a_Page_118.tif
5042594cb5c0ffa506b3527130ab64bb
4621718e2dd6a4c097ad2334122e4c52213c11d3
22348 F20110330_AABQQC sismour_a_Page_006.QC.jpg
1eec244e7fddc7a3b1cf505f727c4ec9
908bf9e2f51596f996431e29e496767d76e0ad47
47874 F20110330_AABQPN sismour_a_Page_111.pro
2f6e53e891f8ed9528a248032e402dc4
cb9e5e1fb4345ecbc8ab2c5b6d26b49ec92f973c
41041 F20110330_AABQOZ sismour_a_Page_063.pro
f9643fc11f726946148b08b5bbfa045e
e5e512018a7da3f56bb0cfa081692e5832869bce
11478 F20110330_AABPNA sismour_a_Page_027.jp2
95ac353f99c5aac1a552577b9bee4e1a
77e29c2a26d5f6b4398ce3b1349573b92f691ce1
23752 F20110330_AABPML sismour_a_Page_048.QC.jpg
55bbd75508497cc5d6c3d692d01d121c
3f8a663f603843434e002e0c1dc62b318e3e7ff9
1862 F20110330_AABPLX sismour_a_Page_104.txt
4c7c841f3677f45e1ea783b854240938
5480cbf3b6d22ffee94bb6dd497ea99103eb47ac
15655 F20110330_AABQQD sismour_a_Page_007.QC.jpg
cf4c340db4408ab2c2b129f0f328f5c8
0c3b24edd76a91adbe4fcb8b97afe7d91bb4c362
33379 F20110330_AABQPO sismour_a_Page_113.pro
babd4cfc74da2f13326b2fdb21dfaf69
a51590655b082f92787af48057215f2df5c59ea6
F20110330_AABPNB sismour_a_Page_024.tif
fadedb5f43c6335f900fe8a380c67606
ee709fd468235d5bdf5087fff0f931657c1072b6
84830 F20110330_AABPMM sismour_a_Page_060.jpg
842de53c636b5315f74c0e11ce3e7020
dcd169c86bdd0431ee5ec701be814d129bf250af
112812 F20110330_AABPLY sismour_a_Page_131.jp2
7d0a33ab81ff5c62f153e755939aa93b
dcb244692b041638fa5ad8709247ea2bc3c94efa
11488 F20110330_AABQQE sismour_a_Page_008.QC.jpg
c6fdb1fe1adb2833c45cfd15776ca56d
a914650e75adf5185e0612f30613989b21c5f025
50711 F20110330_AABQPP sismour_a_Page_115.pro
6e49fbd3dc34c2958da3883a7fa25b51
3a76ee08ac078daad63ca6c387d9e54e7fe892bc
1051967 F20110330_AABPNC sismour_a_Page_050.jp2
a060e9c9e2bb0358aa06442413f47383
147bd67bee2c813370341e5c1bb7e478bd46813b
F20110330_AABPMN sismour_a_Page_137.tif
9582562d781060b8a4bcb9fb3bd8a79a
dc8d9b1c56d09fbf94abceb6c2548b1d9292740d
1896 F20110330_AABPLZ sismour_a_Page_044.txt
027aab1ed5a9557b465e7c3687bde43a
f5bd6c2e8fcc502174cb3c0ba1b99999eb93a321
81760 F20110330_AABQQF sismour_a_Page_009.jpg
20852ada3943c3f513e2401a2815de67
5a0be1b28b0013c9ede7fdb789353b443b060c26
43708 F20110330_AABQPQ sismour_a_Page_116.pro
37f4c0fb755b043bd05674de8ec20345
c2862363467b4d1b448d938b9f4ea0392507fce3
F20110330_AABPND sismour_a_Page_098.tif
eaf8d3b53535c74e0b5e1e5c55a7b739
717aee4f4bac4de7b46de902c1c0af5ea64a90e7
F20110330_AABPMO sismour_a_Page_010.tif
1e580985ec581bae4afe4556bb7b2e35
35ebf22fb7d719bb4da401a06d073ecaffb08bee
39920 F20110330_AABQPR sismour_a_Page_117.pro
a3af33ba2f7ccad08803d8d45c3358f2
185eed32085525df8dc40ce79924b41e5cc1945e
1632 F20110330_AABPMP sismour_a_Page_125.txt
a05fe2696d0df05bd9c8554c1be901fa
efdf9cad1748b69e66799b6687f80443d674dad1
21358 F20110330_AABQQG sismour_a_Page_009.QC.jpg
3f236b76440497d25d6aefbbc3d96034
3856a087b7431aad27cb4fbeaa5e65392f2c4175
47003 F20110330_AABQPS sismour_a_Page_118.pro
d86e88058a9c09a4360385249efb6ac5
b7b5dc7ec4ca3f4c4958074b1f7eed6885c2c663
6026 F20110330_AABPNE sismour_a_Page_023thm.jpg
c143e8329043dc8931df26a76fe98bd5
d9d257e875dc4dda56d99fca6b0f19f5e9cc81c8
61308 F20110330_AABPMQ sismour_a_Page_135.pro
342d3e7e57b45092e39fd4ed0283535a
5990250d98bfa48f3ff0c6aaf531544243ab32dc
94470 F20110330_AABQQH sismour_a_Page_010.jpg
67dbdfc9f204453741f9f556ce872a03
7d718f5fba94c2f542496857cc0426077d7da4bd
58336 F20110330_AABQPT sismour_a_Page_119.pro
5b0b4d1e488b810e0c6a40f59c356393
a0e1d212655fa19839552d25e3f9d9d9e666edd6
71093 F20110330_AABPNF sismour_a_Page_098.jpg
afb57c81bef1ffebb26a48d7f6b6e38a
7239f09bbf294db027b6df1276159cc7a029cb67
F20110330_AABPMR sismour_a_Page_028.tif
03baecd2a27127909836642b52e1eaa5
aeb489a539c36f5093257ae15c72a5cdf4745d5e
62433 F20110330_AABQQI sismour_a_Page_012.jpg
c65968d4c748ea4bdd415d085713a063
ff4fce75ef70303dc0776d00d5a21ec867a1ed5a
52104 F20110330_AABQPU sismour_a_Page_122.pro
2ce2ff9adeef4ae73367f5d6229fda96
2b213622e0d9964354b9b52b1a7157654233c10b
2787 F20110330_AABPNG sismour_a_Page_010.txt
a33481e59c03d3de8d2109aa44d1c75b
61aba0e728d888ec8e5c4ad38f910c0b650a48ae
63825 F20110330_AABPMS sismour_a_Page_037.jpg
a9fa098d6d6c82776e9c9df1cd014b78
da0b7bf169e9bb35de7583526f89802f5e566052
18323 F20110330_AABQQJ sismour_a_Page_012.QC.jpg
6fd172f8f4ee7eb9f8a12cdf7e6cce4e
556ac8b18173c98951433db9f6567614a58a0a59
23708 F20110330_AABQPV sismour_a_Page_130.pro
a36c60b04dc59c742708020c6c6fac39
3c9ebb6de0a604b2267cc4a3f5d2d4f431247661
80012 F20110330_AABPNH sismour_a_Page_115.jpg
96014663fd2bc035783b8e6346e3108e
4655002c2f94ada0c5a7a7cfa42bc5ebb834e722
50603 F20110330_AABPMT sismour_a_Page_015.pro
56b27b801f72b2a9df153a42a3a67efd
65207694b3f3e81bede0ef83ded16bc20cee7f18
83839 F20110330_AABQQK sismour_a_Page_015.jpg
6c5f2a096be192eb84dae593d733bdc0
e76954be7cfe080908201ec08859c39a3eeffe91
52454 F20110330_AABQPW sismour_a_Page_131.pro
e8064df38fb9707bde63ccbdf663235f
ee20ce2322d72d34928168f814bf299b131c86f9
5975 F20110330_AABPNI sismour_a_Page_041thm.jpg
0e510e76502f99372e65790160f34bb3
685a699a619bd6ab3c4b2155ef675487f2f10706
1309 F20110330_AABPMU sismour_a_Page_003thm.jpg
58d472084dc72647f8c8003a86d4aaff
8f37988246c0df6d3f5fe9589be6f074e6adc58d
107972 F20110330_AABQRA sismour_a_Page_040.jpg
4684c9ba69856b54dee6ad2223af8009
410837b943f4d1502433e9c60abecd62c2ef536c
83276 F20110330_AABQQL sismour_a_Page_016.jpg
126ee87f19fca6e37b147c33f003c942
dabf95e92aef131107067b6b0289e80388ca518c
59687 F20110330_AABQPX sismour_a_Page_132.pro
d680900a097f011fadd920be4a4f7bc3
0ca18e114cbd53c6c03c6f496ddc36c4a5c8a4db
21131 F20110330_AABPNJ sismour_a_Page_092.QC.jpg
6f5fb8c5f03b96a6225b4576d4613b5e
d8656f22b50f88f7df76e1b8ca318b038397a200
618843 F20110330_AABPMV sismour_a_Page_112.jp2
9f84abc4016b44bd73ecc71a2cb068e2
6b3bfe24d3aba9340528233adcc4c55dc00738ba
30388 F20110330_AABQRB sismour_a_Page_040.QC.jpg
db3dd986eb54c040f4c953e2d997de19
cac2f441eac7bcf9dc91b0b9b81884d63ea7b9d6
23607 F20110330_AABQQM sismour_a_Page_017.QC.jpg
f4935940dc87a84d626578a4a3cddf1b
707286bae517d81ba5b8a228a7d173b19d046ffb
67982 F20110330_AABQPY sismour_a_Page_136.pro
c8cff108e5cf488cef20c47177fa240e
575b6dd6f3100622bdfa1f89343bfd39390081ef
539 F20110330_AABPNK sismour_a_Page_002thm.jpg
343d07e420ef95d1e0983cad8b98547f
3fae5d7e487ece1f5346f346a72abbac5f1235e0
462 F20110330_AABPMW sismour_a_Page_001.txt
263588ab9edb71c550e44102d4d3c077
9436934ad47d05e8a48bf8e4dbbd2da0355b1d55
25037 F20110330_AABQRC sismour_a_Page_041.QC.jpg
e8169bde87d6a2fd8c39ca223c119740
92ffeeebfa1b140b21484409e5739d9a3213a81f
25426 F20110330_AABQQN sismour_a_Page_018.QC.jpg
93c8e3dedd0f4be7fa20d95079c5feb9
1bce2dc9165a5ac446da74a13fdc03e86fe084bd
63620 F20110330_AABQPZ sismour_a_Page_137.pro
bb3956f420af4abd8f811e26167e6279
99785e78d149194a31cd94a13c39f3148e56c2a2
1051944 F20110330_AABPNL sismour_a_Page_062.jp2
0ae3d60e44522c71e727aabbc6037162
00acefd9824e0a5c8c4eb111d7393a584e4b9876
48706 F20110330_AABPMX sismour_a_Page_050.pro
ed5a8bc779c0acfd5df3e438e9f4272c
39aa1c74a8532d19b36de4351f5e856eb2298792
1763 F20110330_AABPOA sismour_a_Page_043.txt
062140514a8eabbd96e90f38228ef4d2
3d30727b0a686dfeef8c2a47812d7d1b85f30e67
76827 F20110330_AABQRD sismour_a_Page_042.jpg
a2d1dc246fbf8ad5b22eb9454a783eec
e847664e1844016e0119e732c7e3ce47f102341f
82288 F20110330_AABQQO sismour_a_Page_021.jpg
fef17d9a27868b1d7071d28324d7e168
ca1e67992f3d961119039cfb4393f228764dfd42
81600 F20110330_AABPNM sismour_a_Page_022.jpg
91a7d593bf16dcd4cfd50f601f19acac
037e3c87005b2ae4ca972a273f26420a5c6cdcb6
92284 F20110330_AABPMY sismour_a_Page_140.jpg
8ed49a881a68ce5aeb8da97c9a0e7763
330f433b6aebfab39ad2bf081f58f058b5021b8b
F20110330_AABPOB sismour_a_Page_031.tif
96ae82cea707449442c557552ef03384
987090a577c7176e282fa2bf782fe1dccf16fd85
24495 F20110330_AABQRE sismour_a_Page_042.QC.jpg
f22f487c197af6f16012471a7e829dc0
54e0a48f6bca518dd639eef99f26f48a02d4de74
25232 F20110330_AABQQP sismour_a_Page_022.QC.jpg
53a6929eef212dcca078214f40a55576
9eafffff9a837b74db60fd60e35592b3f11ef75f
F20110330_AABPNN sismour_a_Page_038.tif
09adc938de006d9255362ccc1444dda3
520652c834dde1c6d16a7c705b05829ce33c989b
6111 F20110330_AABPMZ sismour_a_Page_022thm.jpg
4f464684d6d45af052d4d53fb3a173e2
4b3dda9eea7c9a12b45bb05e5c322c6d724b296b
46868 F20110330_AABPOC sismour_a_Page_024.pro
f631c434a4350cecf22296433b0af14d
d75a4039aff11da39b2d208e08f2fc95369d88e8
21592 F20110330_AABQRF sismour_a_Page_043.QC.jpg
987777698caf8737ae46887159130973
8cb35a319f0e6919f269f9661f0f713262412e36
79913 F20110330_AABQQQ sismour_a_Page_023.jpg
0d7a115d6d2b3648a6e76a4bb49cb5af
e97ee15530ccb3e80db4ea88e7bd3711bc9d66c1
5155 F20110330_AABPNO sismour_a_Page_101thm.jpg
7355b33208af68242c390dfbc782afd5
a870f1e86104ec0d61e95ec146858a5ecdd433e7
91890 F20110330_AABPOD sismour_a_Page_033.jp2
35532a3bd3052d8671450b647619c05a
16a96c45edfe3af7908f7de0f2e7f427d5fded7d
78439 F20110330_AABQRG sismour_a_Page_044.jpg
082dce66be512f415ba5b6a026aa78e9
cd028c2ec07fceef551db8fcbaf323a95a035fd4
78180 F20110330_AABQQR sismour_a_Page_024.jpg
70f14fa58fc427fa1c2cd86242cba5a2
1af49bbce6477edad5e8189cf855a0e14a36a3ec
1486 F20110330_AABPNP sismour_a_Page_004.txt
30daf55efc03fd807ec7a270c9cad503
8941d0dfed7515bdea8710337ebc867639fafc0e
1420 F20110330_AABPOE sismour_a_Page_002.QC.jpg
1fc68415999a5da810529185502bdfea
8bb21b405eacc7870998afeac7c65eb4ef05f467
25952 F20110330_AABQQS sismour_a_Page_025.QC.jpg
73e36dec19d46159cf44ba7d7a2b91de
be8ecc1055f6a512227a274a1c5963f661d3c912
F20110330_AABPNQ sismour_a_Page_051.tif
da3be18668c826bfe0af44d1578ee6aa
5c5f25a72daf8607da4e4cde2e9f2f78f1896050
85110 F20110330_AABQRH sismour_a_Page_050.jpg
d02cdc838fe4a46756629dc2967a5d6f
00bb7d7be196c3d7d589dae8ad0cdebfb8edb851
8902 F20110330_AABQQT sismour_a_Page_027.jpg
cfb8e97db595ba29e5f3ee6adcebad23
eea9f26c4d5fbe316100050a4eea3f1b95fff974
45418 F20110330_AABPNR sismour_a_Page_026.pro
8f3cabb39077f9642d7476bf0d2741ef
55f13d641ee5e8eab8dbb77c58b2a7f360a9e275
5419 F20110330_AABPOF sismour_a_Page_043thm.jpg
9c38d5365416018871e17f85eb1326bf
864620d798848b0b5ac3dbe30703a71d1bc2b1a5
27134 F20110330_AABQRI sismour_a_Page_054.QC.jpg
08d50d12961788bea551eda440d5bd75
4988f846a248c768db363887e6cb0d46c4707efd
23903 F20110330_AABQQU sismour_a_Page_030.QC.jpg
2ef0131e742633777eed871262261124
db72d05513968e6f9261254aab4a881c5d3ead8c
25902 F20110330_AABPNS sismour_a_Page_084.QC.jpg
8edf6ceee03c219cc6c1ce391ce99066
51a172b7d1325e5685375042562e13b6ae5e9378
5075 F20110330_AABPOG sismour_a_Page_070thm.jpg
f8f2a2e83eee1c32a5f976f2fb8d0a84
9fb919b6f41f1f263a49f5dd42a9dd56521756bc
84576 F20110330_AABQRJ sismour_a_Page_055.jpg
1f625a771e97a82047376924c0825e4c
2c37ea018ad39ce85030d96ac70825619804fca2
26846 F20110330_AABQQV sismour_a_Page_031.QC.jpg
e232644caec9afb5baf255522bcde543
8e428e0c8e149b873acdd57b86dcdbc38fc9f505
48139 F20110330_AABPNT sismour_a_Page_017.pro
3fa07a97b93aae14148fdc7db6845df9
7de20d4d6258f54d8530f140f8101b31697bab70
1936 F20110330_AABPOH sismour_a_Page_018.txt
db9c4fd255124fc403e7c0834a11a78e
393df2087a4edd251663964624d273c2e55b213d
26632 F20110330_AABQRK sismour_a_Page_055.QC.jpg
11abceb3303ddb618a182fa7a4e0cc6b
1949ea5fda722d81143cdb14ae2748372e8e8387
25222 F20110330_AABQQW sismour_a_Page_032.QC.jpg
31b1aba8d6bf6c0a48d104d22c5fff62
3597fa1a94eae892e8ea5216a64d31cabc71bc0b
F20110330_AABPNU sismour_a_Page_046.tif
1fcbeb3194a996ec815e7209e1fe0df6
0a330eb2e33e2c586b064c7f6c8221e18f102e92
101321 F20110330_AABPOI sismour_a_Page_073.jp2
5e59cb974e4f17f15661a199b99808fb
ceba8f9cb16ffdc33c428999f95e23ffbe60d79a
19108 F20110330_AABQSA sismour_a_Page_085.QC.jpg
ee497315bfcadc3b69dc623b66af038b
923ff8248c3298c56521b5e55f7c775179725f64
95438 F20110330_AABQRL sismour_a_Page_064.jpg
764fc0e161fe61898efd862cb4568a91
beac2ae02c5b0c028266e46cad6538993cec310c
20786 F20110330_AABQQX sismour_a_Page_035.QC.jpg
3f128f3b62c98921f55d5cf697faa66a
df1dd3bebb1065202c9ef655c57030857456da02
49355 F20110330_AABPNV sismour_a_Page_096.pro
697aaf7b8136d5490a5609d7ebef4526
86914fcfc2ae77616a66637737352ecb4d2fbaee
1934 F20110330_AABPOJ sismour_a_Page_067.txt
599c767c94fb5f76651f7697f08dbd57
ff836dbf005a8f93e50b3e53fd346283307e7d25
79891 F20110330_AABQSB sismour_a_Page_086.jpg
2f3f25d5f7255e025f13f6941dfc6aaf
71ce80e41695fe64ff5bda611f8171ec22ca1cda
27388 F20110330_AABQRM sismour_a_Page_064.QC.jpg
99ab995f6a38212d6ba302e6551d5765
1ee5a294c3889af80d71a328365f4bf813b52699
21893 F20110330_AABQQY sismour_a_Page_036.QC.jpg
3612548d14d2b0aa24cce6f8f9900109
468d724cc3c3a91bf94597e3026e4a31cb1115f6
110290 F20110330_AABPNW sismour_a_Page_019.jp2
0e4e2d0b460c8fe8f522bfd2f8684515
7476826eaac1ffcc32e7780f81bd6fc484353e35
102348 F20110330_AABPOK sismour_a_Page_127.jp2
143c11a1018ccc52526fd37c3632159d
44b5aaadf7a5b356ca1470bace634ba5ac744b3d
25538 F20110330_AABQSC sismour_a_Page_086.QC.jpg
6151d97545fe3f45103d11e2f9876bef
7aa8393fbd0ecd0937352dc887cb48f037896283
21715 F20110330_AABQRN sismour_a_Page_065.QC.jpg
1da8e81e763a0086a23d119e65e4406b
fbf50fbe92fcdf071e80a37a515bf73edce081f0
19774 F20110330_AABQQZ sismour_a_Page_037.QC.jpg
7379007ab30ef3b0810260b1f529a4b3
fe85c232f6392c8e3cee99819e725da2e2a223e3
70334 F20110330_AABPNX sismour_a_Page_125.jpg
86f3b49c888414279aeffa7fd32787df
4197b0c6ce1b4f3d9f231799ab42bd3dcba04f5b
26975 F20110330_AABPPA sismour_a_Page_079.QC.jpg
55de414e3d85b6aee5528c0b4760bece
d2316d2e1762fb2546bf2e6636963cfbc2afbe16
25987 F20110330_AABPOL sismour_a_Page_015.QC.jpg
4f710f5265c1f09688be8b26b3833281
db09cc306cae3b9977cd09a89acebcf6d7bd2135
67135 F20110330_AABQSD sismour_a_Page_088.jpg
25cadb0e4b9352cbfcec2342090d5753
ca181d5313680c73f709ad37db08408ceb582256
70369 F20110330_AABQRO sismour_a_Page_066.jpg
514bc4eab4bd63d152679970edbfd7cc
4b02777b0cc0b0859e9f0e4abc3b93daa4a2683e
25539 F20110330_AABPPB sismour_a_Page_010.QC.jpg
91cf9e12a350fb7c59169ba2a474badf
17b8844e284c1dbb2fc7701a67ec291f7dd05f2b
6144 F20110330_AABPOM sismour_a_Page_084thm.jpg
40768444e0b2dcaa8a1cff421ff1a121
e997d981143b019250c02e1ed09884fccde33b95
5915 F20110330_AABPNY sismour_a_Page_127thm.jpg
bf1077ee0f4906f3be421c7080ca9e39
968930ca2b134caf76a8a5d739831f664705edb5
19952 F20110330_AABQSE sismour_a_Page_088.QC.jpg
536d05c96e3e0af1d3dd0bc2dcf52683
7a84ff973e0088cbd00c06d796c2a2f5aef8e824
20283 F20110330_AABQRP sismour_a_Page_066.QC.jpg
0c31ed14edf0230dee76d192b1a136dc
2cbb08b3871162eabb326a703c59c4f1a0c1bdc0
44914 F20110330_AABPPC sismour_a_Page_059.pro
b3c5b5e876e314710e24b65c336c204b
2854cc506aa65f84b69f19711d3d6556cb8284a1
1844 F20110330_AABPON sismour_a_Page_052.txt
3c40f245abf61e39c6a68557f81307b2
aa0e056b8bcd41f62c569e669c3ab0ef22d4227b
41098 F20110330_AABPNZ sismour_a_Page_076.pro
09122136e5c04480801958e15be1d920
78e86b742637f189719c4e0049b82c2434be7a20
50853 F20110330_AABQSF sismour_a_Page_090.jpg
d3881dfc09140aba325ed6dd544accec
20324c7686c8313b8bc6d6838c44d61da3029fd6
82475 F20110330_AABQRQ sismour_a_Page_067.jpg
1feead1ba7786e252a2f36cfc6c4f5e8
4a0dc09465a0d621a05c887a0744ecb7353574a3
41288 F20110330_AABPPD sismour_a_Page_036.pro
338897c3fcf68fd21a6f80a9e9ca5878
e02becc8546452d53573b0c2dcebf5a6ff67b9c9
24731 F20110330_AABPOO sismour_a_Page_104.QC.jpg
b05d86874be76b5ac76d022b6fb75cca
8c2b69fc6cda50f3eee27e842c3064867b85b885
73394 F20110330_AABQSG sismour_a_Page_091.jpg
0a8ef0fbf71c1ed1559a18c2d1fbc580
bb79767f5a84691861b69190a108b75e840edf5d
25374 F20110330_AABQRR sismour_a_Page_067.QC.jpg
a1fcf82fdc367b102690f6e031c1ab8b
6e4ef4d585d40451b81a0cc3d1231ba762bb53fe
49511 F20110330_AABPPE sismour_a_Page_120.pro
cd0aa3d30e0a9b8ca67f09414d1e74a7
1aa63af23e2a266f0ab51e5dc24d1dca19db52a1
44865 F20110330_AABPOP sismour_a_Page_030.pro
0d808eb10edbbcaa30be604324f492bf
302e0c8af7213184381ba10c192aea3aaaef9a76
68664 F20110330_AABQSH sismour_a_Page_092.jpg
5af88c638066d0006ba8f534b86e74dd
27dab7049c3528d87b73ad4c3632878ad8420202
23559 F20110330_AABQRS sismour_a_Page_068.QC.jpg
c18c486ed6e3fcd7e1e660cfbed9069a
d27afb5d9b29499812c7f51deab356ed86b8cc93
50415 F20110330_AABPPF sismour_a_Page_019.pro
18acc6cb8d6a26c035e2de5c963daea3
dc890eeeb789de38dfb17c40fcd1bccc5618786d
79063 F20110330_AABPOQ sismour_a_Page_118.jpg
b1594dcee49d4d9d338dea1727920209
81b1a44f1570d620b244089b8d6185032cdd602e
20724 F20110330_AABQRT sismour_a_Page_071.QC.jpg
c876d0e47896c1299b660b44dc3341ab
17c809d256d0c4f6efcbb8e7b87690e09cdace52
46360 F20110330_AABPOR sismour_a_Page_046.pro
ce4a21b1d0ee475e52c98449609e4b02
7d0f7202c978aa9fcd708b233f01cdf41dae7075
51725 F20110330_AABQSI sismour_a_Page_093.jpg
c77c5baa5babcf92e9d11d301ba47360
cc2a1f5fec59123657d38e1ab9fa7d74feb94b99
24812 F20110330_AABQRU sismour_a_Page_074.QC.jpg
72743460f46f93a0beb0430fca572287
afb790a611c7df05d4ed97712ea32389a9987ce2
5911 F20110330_AABPPG sismour_a_Page_033thm.jpg
e1dccbc7a8e6b7db8e44bec18140c784
2a9e5ee6e5b4b958afad5509cbe82713fee54f07
69363 F20110330_AABPOS sismour_a_Page_014.jpg
4fd2104b6eea53f6cb12376bdac0bdd6
238f2095771c78459773174a3614c102e92b09e5
81403 F20110330_AABQSJ sismour_a_Page_096.jpg
a506548b995d61333a06b7d2c9977fb9
9affa03c9199933ff87641996a56c4a777f17e96
21692 F20110330_AABQRV sismour_a_Page_076.QC.jpg
c8aed43b21ae04d5f6653a04ab3802b9
effb0ddeacc0acc88f4435f9091ba1404bf03d88
1024197 F20110330_AABPPH sismour_a_Page_047.jp2
f15662650deb46ac820712a6da3e6a3b
1051a4d180f8403407e4e9bcd91124faf26f8f8c
F20110330_AABPOT sismour_a_Page_048.tif
7be8b0a982211afa6504791bd287d110
c36fb0da289bb1319919d9eded0ff690b9b01ade
25040 F20110330_AABQSK sismour_a_Page_096.QC.jpg
ac420645faabd70a03bb68fae74a2ebb
2b66a6d6b1e0ea941c0e4826d4dacf02658cadc8
81931 F20110330_AABQRW sismour_a_Page_077.jpg
1cefe09c7f7501a38ffc9b2dd63febb6
3276b68b815a2dd1bcaf30edd4871cf66cfd50b5
F20110330_AABPPI sismour_a_Page_008.tif
9e1fd985fa69585ef04b1a82a0c49461
e1e613b440ceeb04df23dc14128715fa96f26676
23072 F20110330_AABPOU sismour_a_Page_062.QC.jpg
eaf055dd59bcfb397dc43177e1532299
8f995fc9407c959f93f4cdf690c65cdec2ae8151
40118 F20110330_AABQTA sismour_a_Page_130.jpg
ea83e34f3df80bf3cc526e49ae6bb8f5
3ee5c284dfe58bef1d8cda2006187384620887a4
21520 F20110330_AABQSL sismour_a_Page_098.QC.jpg
9469fe37deae9fbe89ff671b5ba463c9
867b3edd4d96cea2d112b9fc3626b25aaa27c95b
25237 F20110330_AABQRX sismour_a_Page_077.QC.jpg
93979a8f7048d50e188ac5dd599a1973
ce8f9184d22df9d613eb02a33e36c0733655917a
4985 F20110330_AABPPJ sismour_a_Page_117thm.jpg
362483efdf3ffcfe367c25ccc48223f5
f4bb70cd88b2a9237ac418a67758adbb5dac749a
107275 F20110330_AABPOV sismour_a_Page_133.jpg
2c00f809aca0ba1ab8aec36e7381f5f8
edd9d7859522c318ef9491f9b945a60719cd17b8
85943 F20110330_AABQTB sismour_a_Page_131.jpg
79fbc948f56dffd09529ac059a29f3e4
44204b8ef55ec532799f5476821ecfd6f8a427d0
61886 F20110330_AABQSM sismour_a_Page_100.jpg
61256694b2e054782fa224fc8e5ea5b0
bf7db91b103c52a213136432eb17f4eddcd28e54
25937 F20110330_AABQRY sismour_a_Page_081.QC.jpg
91e8fca4813c3a56e94680b78f4b3a0c
345a1e202179d46a4d945803db0b08f1ac800fbf
56666 F20110330_AABPPK sismour_a_Page_138.pro
d523d553bf1b077c8e7dfa06008fc651
5d6fe08a81046832e8fff10fb71b746f29d55e3c
2845 F20110330_AABPOW sismour_a_Page_007.txt
80556e779e6b090be27d8c61a318f0fc
1a1b9f511a933d00fdb6c86806fc9916cf7a1ea8
103463 F20110330_AABQTC sismour_a_Page_134.jpg
cc0a7c7aca7213403244eaf2c021460b
fba2bae17cfa7c3a573dcc95f3ca8061c63ee74c
20861 F20110330_AABQSN sismour_a_Page_101.QC.jpg
112927f6ba539124ce6873e2f724c3ab
2803637f8783a5b6bd6089ea5297023b0eaca9ed
86970 F20110330_AABQRZ sismour_a_Page_082.jpg
b122811ec345d815fabe50a587171af5
fc68bcc71698c44203f16620b9bd886786be630b
25346 F20110330_AABPPL sismour_a_Page_059.QC.jpg
6234c2277c26aa73214a70d827dde514
4f98e1ddebdc72c64ab0f79a22418c892afff95d
2031 F20110330_AABPOX sismour_a_Page_105.txt
42d88e52f1aadb6be453ae8e14902253
84f0c7552059f160eb6939172f44ca15c72884cc
F20110330_AABPQA sismour_a_Page_131.tif
688aa6208257a1d160d7679deafe094b
bfe9beb86fe1e9433bda4b60f903b67ad66b7408
27168 F20110330_AABQTD sismour_a_Page_135.QC.jpg
d9d606d822196439bf2706b61b6218fc
f01fb390fd6d542aff22358172018a49f6761983
69638 F20110330_AABQSO sismour_a_Page_102.jpg
d2837b355835ec3378678a338e7cc893
2a46dbb8bfb0d8debc4967016f7b8cf30be3f93c
83170 F20110330_AABPPM sismour_a_Page_005.pro
78c9e3f215f2ee7a67a33b174b7ef6e0
8e62f65ec2c2a06005583b7cc8c628fbfb7e48fb
102606 F20110330_AABPOY sismour_a_Page_044.jp2
c1dadca23399af07ca0e6fce3c08b857
697558c61e0a7b5c3e648398f7709808e5c1b3b3
4589 F20110330_AABPQB sismour_a_Page_006.txt
86ac213f06ce5103c7b6daeaf686c2e0
1bc5db19addf02eaaf4532007ed57f81ffc85c2a
29384 F20110330_AABQTE sismour_a_Page_136.QC.jpg
2873cb27ef5e52fbf80dfe21fd37ebf6
951ee1ab6577a28d52d37abcd139d864c9464253
22901 F20110330_AABQSP sismour_a_Page_102.QC.jpg
9975de9b54642e5e202c864d6fe361e3
55b8d0c4eb76d62e3ca0d3b43396d7d165b3f734
41923 F20110330_AABPPN sismour_a_Page_062.pro
76a511dcd8baeffe46a3b4823d3ce3ea
a23620aeede8fbcd8e63f5ebb09792f18adebc71
5981 F20110330_AABPOZ sismour_a_Page_114thm.jpg
7e744c1a26994d5da9bd8906581dd48e
653161831eaeed7acd41106dcf797817b412ddd7
25505 F20110330_AABPQC sismour_a_Page_121.QC.jpg
9c6ae6d5223e6ae9ad0ff9e044897cb4
d48ff5eb02730d48ab0432752e77fbff1acc4051
99290 F20110330_AABQTF sismour_a_Page_138.jpg
3dcdecd5a9d7cd034ff7a41e06871b2e
619cf9c0d81314cc948e5b65104f206f426f77bf
80021 F20110330_AABQSQ sismour_a_Page_109.jpg
24c685db5aa1fefebdd8983d445fa922
a2b1bd9c7c997ccf3e3d89b4a1e597f24313f598
139632 F20110330_AABPPO sismour_a_Page_139.jp2
e9ad882f05b8689c9f3552266a26d53c
221922be0044a6332aa85ef9cc528b5461fd707b
4028 F20110330_AABPQD sismour_a_Page_027.pro
f5de006496cd4ccef53e84f782d002ca
c5e2c58c3028099bf9b9911e5689857473814db6
33859 F20110330_AABQTG sismour_a_Page_141.jpg
1627d1eaf3f8edd5b63386cbcd729314
3e5b4948976b53b548d6cf0727eb20c2b7315252
60187 F20110330_AABQSR sismour_a_Page_112.jpg
fb95b5ecf60b10f19000fa54708267ae
867c4736a19c64e92b02296b7b966cc636df3d29
F20110330_AABPPP sismour_a_Page_049.pro
c28febdac242e97dbca0a9e5fa305a9c
ad3fcb33fa0bb9a4b42d0f1c1b45527cbf3c3de6
5946 F20110330_AABPQE sismour_a_Page_017thm.jpg
f2c47a52c32223c6861dc2401bb4a3f5
d107248307b750ddd9094311f36b7075c100c3bf
78690 F20110330_AABQTH sismour_a_Page_004.jp2
407a3d5336efe51479567f733b94d57b
c0fe5b0c811957665c0c610f142115fcfd180f5d
73629 F20110330_AABQSS sismour_a_Page_114.jpg
f1d5a2b87c7bf58234b912a62a7125df
ee0d69c3641b5a2eef28276e7694db7c20010e13
23164 F20110330_AABPPQ sismour_a_Page_026.QC.jpg
6894c4c6dfd98d75fe7fec025eef31ad
38d048e0985f4b334b1f3be33c42b83cb7fd8587
2093 F20110330_AABPQF sismour_a_Page_089.txt
f0854d1c211bbac85b5461bddeb27758
799e423c90f13375d1600f76447bf3261c34660a
1051972 F20110330_AABQTI sismour_a_Page_007.jp2
fa11db281f85c2fed7e7cc35c841f80f
7e4d0dd1d7dc0918916d60b4a7258ede465ba444
75379 F20110330_AABQST sismour_a_Page_116.jpg
84e6a00d42414f7e8533992ff5edf7e2
58401d550a5014114c1ca8ec9b7b9a49fbe43daf
F20110330_AABPPR sismour_a_Page_067.tif
7eff16ea5cb6ba876b14c114acd7e146
c9c305349e29aa5a51112a006c779507f7bfbbbb
123807 F20110330_AABPQG sismour_a_Page_053.jp2
00194d37105ab831e81c710d15681a36
111211f0b94603d6055bd84d23ef6a46378180f6
68161 F20110330_AABQSU sismour_a_Page_117.jpg
da79fdf26a3d834a5b3062ad51d594fd
510162f682446bef7d0facf09ed481bd89afc4c1
6000 F20110330_AABPPS sismour_a_Page_068thm.jpg
7d758ca795fad6158def1d8ee1540a5e
9a8fbdbcc3be67c9f2529d27edbc9a75ccd19d78
1051986 F20110330_AABQTJ sismour_a_Page_010.jp2
91ffb37be242c517e7e800786ca0a3a8
3108d41060d10003bdda2ee55a7ae42ce9688af4
22480 F20110330_AABQSV sismour_a_Page_118.QC.jpg
ebde62510549e82f16babfb1766ef4bd
341299d133efcd21232463232d63da786d908f09
F20110330_AABPPT sismour_a_Page_097.tif
d3cefaef4d4d70dbdaa51fa926c67381
e9f5337af97b903fc1601a79aa62be9cd18ecdef
58221 F20110330_AABPQH sismour_a_Page_064.pro
ef9064ee07109bbbc626d4eb05d24f8b
52475be06f8dcdb181862a25ba7c1a28a507ddd0
89258 F20110330_AABQTK sismour_a_Page_014.jp2
bcf02c32d86d0fd67019ced70048537c
7f7bfa0f7a2f092cb4913368c0d688c39c3b4a19
27432 F20110330_AABQSW sismour_a_Page_119.QC.jpg
64b7f9fdb9788b3980b2397fc7757d23
7200bba895a419e65f618c9fdb8fcb6ca6bfd2e9
5973 F20110330_AABPPU sismour_a_Page_113thm.jpg
e87c2fa04b21a74413400a2d7eb0043d
23f8b4ee9b32d1d33f45b6d751bc9df2765d5459
81266 F20110330_AABPQI sismour_a_Page_052.jpg
14ae14627821485a88b0c5d740eb6ed8
99d5f0f7388c96719ef2399f2e3c081813ca75e6
1051953 F20110330_AABQUA sismour_a_Page_051.jp2
196352d8ce6d66f2164aad539a53129e
ac54985a025c2b04291573387afca6d30d3c18fb
108720 F20110330_AABQTL sismour_a_Page_016.jp2
b8732927a4d73cfa1b933f07a5cdd9ac
37e5cdbbe1f0a4c9d76d854c9f9d57f92b2d5db8
24814 F20110330_AABQSX sismour_a_Page_123.QC.jpg
2617282dc7833a0a14a3a83233cd9052
6854960ac140c78a4428df880052bdbcabda5302
4213 F20110330_AABPPV sismour_a_Page_011.QC.jpg
5b36c815dc0d0620fe0232b5b02fcee9
e912d7dce3940c4353687cae1616f9a0ccd8bbe3
50013 F20110330_AABPQJ sismour_a_Page_021.pro
a43e829cd88560c265f510cdf0eb6955
56166985965991df4991cfa28c30df153de16380
102300 F20110330_AABQUB sismour_a_Page_056.jp2
c0035f45d91446c87f53d5f41d227226
294796543d1286ffc36d1f78622133200a52d3d8
102611 F20110330_AABQTM sismour_a_Page_017.jp2
1fd63484d2cd16756b094dc6ff00de01
ea4b649472bef2053bc7dfef4ce7b8fa23e9f56f
16632 F20110330_AABQSY sismour_a_Page_126.QC.jpg
ea8e18f47b6a1c4c0eeb84fc3fc40efb
e580a25667441047d8be93c06933d8fb10401d77
F20110330_AABPPW sismour_a_Page_125.tif
e622ea54f693b6cdc6575423632949df
f7ba36ed7a1306b9a0cd90f23a3d2d081fdc57e3
5776 F20110330_AABPQK sismour_a_Page_074thm.jpg
90c5aa9ab33901869b76510003bbd8aa
1b3f494c540f67ff625169e6f12241336a315f8e
97145 F20110330_AABQUC sismour_a_Page_058.jp2
afbbf36557b2b300e064bb4d2896f67a
1b1d48b20ce0446252e4c08dbe6b23d31068025f
104574 F20110330_AABQTN sismour_a_Page_020.jp2
cbfd5b9d25b53a5dc56ccc410d99027c
af07978cfa96649a954b6aa7217d3c1aa83b4767
F20110330_AABQSZ sismour_a_Page_127.QC.jpg
953d1f07ef1ce69d6fc26a3bfdc68a1f
cec0bf0d54b0551400cf009513daf241956f3bda
77110 F20110330_AABPPX sismour_a_Page_085.jp2
8a07b4e0c219d906592b1a88ca09cdfe
0e4c472e706a3d7546fe21b71623ebd49206a6f5
5989 F20110330_AABPRA sismour_a_Page_078thm.jpg
1844efc8bc9c654872841bf375715e8a
48da5c2cfa66c805c630616ade962f5dc64c8739
F20110330_AABPQL sismour_a_Page_050.tif
bc9066ae191ffe87ab76072c153b3367
08c9d3cb7137c18ec90350424c4cb14a79c21e09
99972 F20110330_AABQUD sismour_a_Page_059.jp2
2f215f888da6cd71dd0152d371385138
f37779009c8f370d754aedb914f408cd7f4ac4df
109669 F20110330_AABQTO sismour_a_Page_021.jp2
619a8d40b4b8e2996e5b9fe5fdce7bb3
5fac39560f5afef7a73ac8cdb26b205798d661bb
77211 F20110330_AABPPY sismour_a_Page_129.jpg
dda098a575ca86a1ad54add975d85577
8276062ce553ef8946c8ca05b7ecd2fd59e13af6
100300 F20110330_AABPRB sismour_a_Page_132.jpg
8160ed1989abe41626c96aac348cc601
06e3cc1657c1f887e9f488d16a7d41c190b4b9ec
72292 F20110330_AABPQM sismour_a_Page_028.jpg
99b55998406f023b66f227d24914c1d4
77225294bd38473f911f19599e4dca1224f7cac1
107322 F20110330_AABQUE sismour_a_Page_060.jp2
13b9d94de229b36fe59964b9448d27b8
9c80e5e2355e94e5013ae717e59fe1559c646ba5
103077 F20110330_AABQTP sismour_a_Page_024.jp2
4b37a1fbdb49f647a1fed8c2139af573
e6fbb54821ce0a639652699de364e7465b2b0f1e
7807 F20110330_AABPPZ sismour_a_Page_011.pro
f2570a87461613e078145fee8308a676
b6e75cd9064110d7c0e7195cf636974c84763cfa
2434 F20110330_AABPRC sismour_a_Page_132.txt
3d6cef73607c687a953d6c3251d181b3
8d705923bdd2781bc8ebfd1c6278e2ed1c75450a
16475 F20110330_AABPQN sismour_a_Page_093.QC.jpg
dbf4f47bd32a20a82d9ea4e0f8d50413
bb7f007ef7c0e07fa28731cd944687b002af5474
91626 F20110330_AABQUF sismour_a_Page_061.jp2
02b170b55dc23ff04f00d1ae4a989430
6c6084fd69d3434a8e7c10a62bb142ba5cf97f35
107565 F20110330_AABQTQ sismour_a_Page_025.jp2
7d8aead4142fbf1845b87e9e2d7a7c98
9ab5f915a8397f9dd2c8fea53ebe545e9b7afa0b
4966 F20110330_AABPRD sismour_a_Page_088thm.jpg
1b73c40afc1aa876c238267c6dbdaa95
bb851e2dc14bb82a8adf4eeca668dd58146beedb
F20110330_AABPQO sismour_a_Page_009.tif
26756fd8d9b9065e3bd2dfdc1c487fa8
fbed87c2a851a0b5461d705f031f6639e2257f7e
107146 F20110330_AABQUG sismour_a_Page_067.jp2
4da26f7231e11ea8f52b035d8d931232
6fb2546c0e0161a3d6b2fb5829281ae461f4a925
90926 F20110330_AABQTR sismour_a_Page_028.jp2
1f2ef7a8a1965e9d136c2d9b58d2e6a8
a192d333fc2469467292f4917181da79f1f66559
109813 F20110330_AABPRE sismour_a_Page_123.jp2
b2cf04690f9cb14db43eb4405c584fcc
83e9133ce5d603aeabc51e41caf7596ce58a1596
23233 F20110330_AABPQP sismour_a_Page_047.QC.jpg
24ff3f9819205b8fa7cc1f9cde48233e
0ce1d7ab1cecf4b469d154f00165674f88d91422
1000209 F20110330_AABQUH sismour_a_Page_068.jp2
61f804d0b69369d178d72929ec162b17
fc8607911daa119fa5dbb4ff99e8182516cd8075
105058 F20110330_AABQTS sismour_a_Page_029.jp2
99d6607c6b7774c20c92502eae5aac20
699598c66e5885eadaedb13ce550e91798b11207
107113 F20110330_AABPRF sismour_a_Page_077.jp2
033ded47f0a0cacfaa937b9f22f5ffe1
38baf235e32c8a1d62b2f58f790417b27020f68c
6224 F20110330_AABPQQ sismour_a_Page_121thm.jpg
1200c371faeefcf612f283479df8eff7
6793d4c8898dddba2ab2094c15d704af556dca94
83315 F20110330_AABQUI sismour_a_Page_071.jp2
905c5758d089e7fa99420444f55e3462
0413e339e79e25ab63c5a432b696ccdb6b2ab8b7
99245 F20110330_AABQTT sismour_a_Page_030.jp2
2e6155f45f38fed64395c71ba7d57fa2
03c13e30b1d83eff001b2acfb7bdb886c4f0f08d
28284 F20110330_AABPRG sismour_a_Page_057.QC.jpg
803bbf8b4b584125e36ea65efca2a246
ec1115982391813fd75c858eb1fd0856c0b7d9a2
1051982 F20110330_AABPQR sismour_a_Page_069.jp2
5fa0ca93eb7b98eb15bb92ed0f37eb48
ed071a0c899d342a8607a59c6e661dd2d9842482
78931 F20110330_AABQUJ sismour_a_Page_075.jp2
1f30a650e906d9bbd1750d0883ee1300
178103faede21479d4eb322f34150c7ed0695c5e
843298 F20110330_AABQTU sismour_a_Page_035.jp2
19cedeaccaad83329e40de45191ed5e6
47de9bf9a6609cd8af1eedd2d7dcb4be38fb81cf
47479 F20110330_AABPRH sismour_a_Page_047.pro
56669c5dec526cc426c622661b66d314
fd7feb7e89fe35c8eef3ed49a8da0f9770ab7320
6801 F20110330_AABPQS sismour_a_Page_032thm.jpg
944d11a642efb55498941a7c7a52a84b
2067f5b793e48a29603919ef433bb6e6310f0cb8
81876 F20110330_AABQTV sismour_a_Page_037.jp2
d7fa26c4b1d6d592e4b5c7e25ffa1d4c
4c762e5accdcd211ccf1a9e2f8d37c3688682891
24068 F20110330_AABPQT sismour_a_Page_001.jp2
be744e178804423a0b5941358cabe906
a834b01c13fc225e37b905782c64190f693554b4
105534 F20110330_AABQUK sismour_a_Page_078.jp2
6a74e93d0354cc8cccd74cbac1cb08ed
5c5d104b9d5bde14f43de985cd42421f1a4aa0e7
103776 F20110330_AABQTW sismour_a_Page_041.jp2
0e49114fbed403b66ace6b18025df96c
d90eb99186cfb30c6ba6248f36cda43f24605ed3
909 F20110330_AABPRI sismour_a_Page_112.txt
26ed5eeaf9faaff1ec7303f970e21521
616dd6df8d187499fbf6993c2dabc3cb4146f002
24465 F20110330_AABPQU sismour_a_Page_023.QC.jpg
a96edfc38b709073e5350d8fd9811508
944df829b9fce0540f3281308cd5dfb4e9450ef6
121135 F20110330_AABQVA sismour_a_Page_140.jp2
145bf9ac92ab9960ed66279565b86706
a6cc03a50a528be1262a0dfe41616d4911805437
112760 F20110330_AABQUL sismour_a_Page_082.jp2
cc70b4631355032d7a7583654764628e
bdfa44aad5ddaee6c90a6750b76e7ca1a1fcdf1e
1020062 F20110330_AABQTX sismour_a_Page_042.jp2
9366589c46c0cb10a758afcd502c840d
dfffebefcdda0118f53fcae3d640decc9d90a9db
F20110330_AABPRJ sismour_a_Page_025.tif
23f244bcb3fca821a9f9339e1b8fcae1
7a43c7d103863e00d7e61378f17eeda1dbd3e07f
21439 F20110330_AABPQV sismour_a_Page_097.jp2
44c7732014cf174919c3331873b0c463
78e4d7768fbd51e6e52c4911dab727a119f29119
43136 F20110330_AABQVB sismour_a_Page_141.jp2
36c7a401e9ecc960f1bb462a8f7925d0
eeafd082336627f4df6a9d125007c9cca2531d48
1051979 F20110330_AABQUM sismour_a_Page_090.jp2
5b0d235201ec317a4580d5dcaa1a4e31
1492dc42dba7e6ef9c5cf5fded4294975140ee8b
86581 F20110330_AABQTY sismour_a_Page_043.jp2
0acc7f2cb1dc9975c3b7b24a9cdc0d6c
bfed37ada0c1794580cf66fe302afe9b2b901a5d
27004 F20110330_AABPRK sismour_a_Page_082.QC.jpg
65de06586b05a6328527d21087fad7ca
3937925fa33737720800fd215bc1bc7d3b9226fc
86913 F20110330_AABPQW sismour_a_Page_031.jpg
0e8dfe534c2b3806101bd9d272e00dea
7943066d956b89bec6dd37cece658e26efb0b7c3
3929 F20110330_AABQVC sismour_a_Page_007thm.jpg
358e378801a9a316136816c7b5341d48
425e1dd7015d08c1f2a7b28d39250aaaac1a5436
95303 F20110330_AABQUN sismour_a_Page_091.jp2
3cd6d917cb6097414c95743e705b7560
3d7bcab606d1f9f2f8b5eef6e3755d080c27df2b
961262 F20110330_AABQTZ sismour_a_Page_049.jp2
61c104ac57db76aea3aacb26540bd63d
33c355b920ed9671d1d1c71589b7a69e130600fb
79832 F20110330_AABPSA sismour_a_Page_056.jpg
a1f22a9f1440a92836aebe8d32a281a5
54b114b694ccec4e1d885af3238f357cd9fc654e
F20110330_AABPRL sismour_a_Page_044.tif
0fe4c9aa356fced913f04b36e5b39cf9
bdbb7dd392e596e1ff1bcd5e6e85a1c3fab75c39
F20110330_AABPQX sismour_a_Page_070.tif
4f41eb99608364afc59d8276e7caf12f
9ffcfa913e1ab28ad02605e49fd405e73fa3d3eb
1274 F20110330_AABQVD sismour_a_Page_011thm.jpg
0dcec6b91e7d32983c96c40fede1e958
2720a63d9ff994bd13ba9fbb974f16daa13b9d5e
104319 F20110330_AABQUO sismour_a_Page_094.jp2
ecb4419c9db29b4bad9045f4bb3a60e9
2fd56e077ba9aca164b67ae5bd023d3cc6292267
86427 F20110330_AABPSB sismour_a_Page_084.jpg
d20fca0233a98467ff868651b1088961
0c06c8802172da2253aef1a70eeab8af7f25ffc7
85470 F20110330_AABPRM sismour_a_Page_054.jpg
b143f98e2a8c8f877cea9e8cccbc8054
1bebc4e85dbaee956c6358fd36e984af1086ec8f
5549 F20110330_AABPQY sismour_a_Page_034thm.jpg
9deb98aca753bbe3c67d5d527d930399
67789d3a278401ca4dc563006adf8150c04d08d5
4205 F20110330_AABQVE sismour_a_Page_013thm.jpg
30d86c56e3d33d1743adc328f53f7bb5
b11c9fe8b1f21081adf80b53dd6f68a45e52c8b4
89947 F20110330_AABQUP sismour_a_Page_098.jp2
f1c7f86d180d83aff67bd83d12e31612
aae25e824b42baeff587d983f346dc28423315bd
5320 F20110330_AABPSC sismour_a_Page_076thm.jpg
e6c1d4a30c6c1fcb0b809920bcea5354
cc7536398c7cb7c2c5a1bdea45d95cea64c7f8cb
56582 F20110330_AABPRN sismour_a_Page_140.pro
59f3a6a97a6b453b4aabe1f2aa257cc7
72f57bd0a5380183cb347c1bff0354e8a95585cc
76817 F20110330_AABPQZ sismour_a_Page_074.jpg
89eee8792a4d766eb579c360d90b243f
5105f5e723e6d2579c1ed0cf1204dc675d298391
6392 F20110330_AABQVF sismour_a_Page_015thm.jpg
44d9838267f7d94740b5456ffca0922d
34ee2d47b183b833667904c27b7819b782bd309d
949698 F20110330_AABQUQ sismour_a_Page_099.jp2
ed4e578ee295211bc8877eca1c2583f3
3af37d043e4852faa581932c92583c21d2227723
89073 F20110330_AABPSD sismour_a_Page_092.jp2
daf4687dce28d4234d4f5da08d7e489d
246e99003619543569387764d6f36affd242bf14
5700 F20110330_AABPRO sismour_a_Page_062thm.jpg
cf0210f5a9514db082137bc763102a37
461a0286f44d84324f8b90d20ca4a4714a2b7dec
6202 F20110330_AABQVG sismour_a_Page_019thm.jpg
00db38cbee906dd4411332eec92dd2b7
a94f483b39b18582c5caf6d432fd3527f7569a18
901223 F20110330_AABQUR sismour_a_Page_101.jp2
5ce6aa9ae1eae0c1fb18c7a2f74e0043
162f2cbc7b37a23edfac3998568d75a71772be1b
6017 F20110330_AABPSE sismour_a_Page_059thm.jpg
ad29c63783acb7302a7be16ba433f7f1
28252922dc1e1a4659aa12aa68a87299e855ad50
F20110330_AABPRP sismour_a_Page_064.jp2
c7cfecabcc1a342a2e248bce99b2f3e9
42625357488949a9a9d766629cea6063e165b271
5898 F20110330_AABQVH sismour_a_Page_020thm.jpg
f5e35f0fbc8689a6bf66a23c512caafb
c0c6f7acd35bbfa529c8d4212ae40fb2be63b0c9
103543 F20110330_AABQUS sismour_a_Page_104.jp2
30abf0e00b202e643a70cffa009e0132
a05829659cf95f0b4f0bf8308bcffccd4a11937f
84648 F20110330_AABPSF sismour_a_Page_105.jpg
846743dd747b6198b7f399b9e2ae36d2
6d02c21c95a9336df68d7aad7f55d77a3392e386
68812 F20110330_AABPRQ sismour_a_Page_043.jpg
a70b068113f86d036dc9b87772df5b1d
804a7460eb5d0870f0ddf8dc1887975dd556dd7a
6018 F20110330_AABQVI sismour_a_Page_024thm.jpg
96ac3d7d9b53ddd7b22daa91312095f2
67f30b7484b423a2c4df51ca7ca2e2d3d2357ba9
79056 F20110330_AABQUT sismour_a_Page_108.jp2
86fcf4a6859bb9e830ac4e0b99870c41
060bd5871085af4011b865814511aa260c981f9b
F20110330_AABPSG sismour_a_Page_069.tif
1ee73b957ced05b594b6f771f15f50cc
cf90b62593c4340e0e13bdd0286d1fb179f6c9b5
F20110330_AABPRR sismour_a_Page_133.tif
58981f51ed6827781a2e41f7cc786aeb
94fc2fecc49579ec4ea4bb4502b6db7b5a693c8e
5829 F20110330_AABQVJ sismour_a_Page_030thm.jpg
3b2777c7d8f3bd1a86b04044b816cb23
12c6dd7cd2345feb1ecd905cb3ff61c4356d6296
101240 F20110330_AABQUU sismour_a_Page_109.jp2
b0cf9cc7047ffe16c7fb46258e737b2e
525c0095e98051bfbd7102bf4bcbd4b44a981a6c
70697 F20110330_AABPSH sismour_a_Page_089.jpg
060cf145eba451b4d30ed2557404cacf
f0ecd716aa44882aa9002fc33c3abf61bda53cd6
49544 F20110330_AABPRS sismour_a_Page_121.pro
60ef3d212d1ec979d1b93d6f75baa5c0
2d1f7b0f8d084aae23576b25f691b48dd5d0c9fa
6394 F20110330_AABQVK sismour_a_Page_031thm.jpg
e803f7d0b8dd280f82bdbf1d8c6b918f
c39f0de5d7bcd4f1772b7a950ea3f4684454de52
1022553 F20110330_AABQUV sismour_a_Page_114.jp2
825bf4724800dffb9889338afd3d977d
1b1ad692e40d62523600841472ef0d97341d51c6
4381 F20110330_AABPSI sismour_a_Page_002.jpg
3c37d4ed85b34f64b946b583f7b6ed6a
08bc6aa45010bc30e421af5345243691b800ede8
52850 F20110330_AABPRT sismour_a_Page_013.jpg
7357e987a11148cf6c506d4122ac9282
ba6c6d4d1ef9c835468c69b39e189d92b85c127d
95214 F20110330_AABQUW sismour_a_Page_116.jp2
a382df7c9bda2808cda6cc4215be2b54
b25d8176f89e54da52dba4269f880140fe59a52e
2902 F20110330_AABPRU sismour_a_Page_008thm.jpg
d636547670f97d6eed4aabf1b3b91ad7
b687c3b92b2dfb4c8a8592e13b07f2a5a49c5fb4
6188 F20110330_AABQWA sismour_a_Page_099thm.jpg
14c32069755b7d0fa88b6171615b57a9
bd96dc95bd8a1b62183d29ec99b9a47c3bde9734
5222 F20110330_AABQVL sismour_a_Page_039thm.jpg
31bf4138b9db67bced4b12742f3d5f55
c8202fee715b041a820b10a016cf08ade14c9d1c
101188 F20110330_AABQUX sismour_a_Page_118.jp2
800dc539ec384457647b72f8518f017e
7973ec0cffb0569f43523249a571855d1bfdf799
2337 F20110330_AABPSJ sismour_a_Page_119.txt
43825ea6fa6c75dfefd45fffe05f76e9
591e38d678aea11bfbb34f1999cb0eecfe19f257
6304 F20110330_AABPRV sismour_a_Page_079thm.jpg
3c0a6c9847c9794ab62d4e0cda7dcfa6
d7bdedb20c19019c7619bd1dc9b0acf38142d79a
6063 F20110330_AABQWB sismour_a_Page_105thm.jpg
2296b6f607d84ce21aebc66eb90a8661
f82936c2b9ca0a82487fbdea6fde7ba5109cf2f1
5793 F20110330_AABQVM sismour_a_Page_042thm.jpg
edafd49c0a9fec7a4afc941cae9edacb
219d549099282349fe84d2392bbc4fc929d84231
97246 F20110330_AABQUY sismour_a_Page_128.jp2
98afb382c078506b19a90317a8e797db
6121c8de221648aea0f6728238a28a9eb1f80f97
44153 F20110330_AABPSK sismour_a_Page_103.pro
ec26b4ea5ca5874651da75e12e6ee23c
3905fa39dfdac8ca2c903ad124763ec7cac02226
6308 F20110330_AABPRW sismour_a_Page_103thm.jpg
2c1052ff933d9d40a26eb34c49cf1fb6
93017895f4d6c1065897a2cf40369d383cbfde04
5714 F20110330_AABQWC sismour_a_Page_110thm.jpg
68f060fb517fec126dfd476a28155a2d
56a61bd11244f79c17719ed6742a7f93f05eb74a
5741 F20110330_AABQVN sismour_a_Page_046thm.jpg
c74c4ab00aa77209bd0481903aa42d6e
9f66dafed2a1186eefff324cb5621977e2d5c735
135271 F20110330_AABQUZ sismour_a_Page_134.jp2
ed732fcc9f2a9ed0b185a144c487bdb6
4b0ab641f38edfe84a2c2e8eba656f44985be3c2
23074 F20110330_AABPSL sismour_a_Page_049.QC.jpg
c8e6eb7e45c266a96fa86c6413f26263
e2b5c44954c593cb56c1d1e381c88cbf8ceff990
25350 F20110330_AABPRX sismour_a_Page_131.QC.jpg
6ea4ad68cf1859c4c86cf644f8ba6420
ecf53068934dea3c59654d12aa0428c0c64cf58f
25898 F20110330_AABPTA sismour_a_Page_021.QC.jpg
a779ec78036b5360541e8d74a4cfddb6
2c6f36d9c63878f4595b181067214d9847b82e9a
5965 F20110330_AABQWD sismour_a_Page_115thm.jpg
8ce28cefc21b945522541bdcc005684c
5cbbfa46ae53d28491bde4bfd90f41abf9eefc1d
6005 F20110330_AABQVO sismour_a_Page_056thm.jpg
1c3d90b550972e7f0c40d00c31c5daa3
117df7ef4f44978163d738e64f33d1331af66ff3
5144 F20110330_AABPSM sismour_a_Page_037thm.jpg
54d691468efd22e5cdc24bd8e9769659
e7a838ad11c60812a05667f4a0b94ef0c73e7cb5
47750 F20110330_AABPRY sismour_a_Page_023.pro
b0bee955bd56274d9acf8c12c05d02a0
a0d484974a71ca0377d30c1d6612a3545838021c
6091 F20110330_AABPTB sismour_a_Page_109thm.jpg
56b5ba2f8c7af114f298f56d9c9fad13
1fa05f1605a9d92afd0b7329f424b6330920aa10
5620 F20110330_AABQWE sismour_a_Page_116thm.jpg
cf3d159e0ff2ac88a068b7bd5fda4455
d4b476514c0c4f0a2eb18c56fde86f885ce23d9a
5681 F20110330_AABQVP sismour_a_Page_058thm.jpg
271940a79629453dc9dc2ca02ddf744c
c461f3911192eef501553dc7d6cdcb5eb5961f25
25956 F20110330_AABPSN sismour_a_Page_078.QC.jpg
f427a7b4e62c4baca942b52c85922d5b
dc0ae65f979ea043e4e4783e8c09f81fc975cdf3
1710 F20110330_AABPRZ sismour_a_Page_028.txt
bd689ebc613c98f9d36bc4610421dd58
b7b72e0504675aba8918d587eb367e65bdef7c79
110321 F20110330_AABPTC sismour_a_Page_006.pro
bf41f992e7305f7793ebe7ae0c634cd2
a194cca092d0ab3d06237573497983b03b2903f2
5528 F20110330_AABQWF sismour_a_Page_118thm.jpg
fdcb105a111c3eca253175ba3ad6f92a
e1833351209b550a137755bd890fa13daae39357
6700 F20110330_AABQVQ sismour_a_Page_064thm.jpg
3384dc0ff2ce181753a9e46eb746c9c1
d60e005e285226bc9793c3ece1a21dc8a11c56b5
F20110330_AABPSO sismour_a_Page_091.tif
076e23fc6c83b5eab6c2b4be6989e408
b1a57aa44615fcf00ec980a2fa8ab71c5c6bb5f7
1967 F20110330_AABPTD sismour_a_Page_065.txt
ba1b8495e7af7189286ecea20460b919
ef0f4f77f9126b8591981f6d2a6cfc6cb1fd33f8
5216 F20110330_AABQWG sismour_a_Page_125thm.jpg
f42fad0b7401c41014d7e4334ff6192b
1c8a8888f1efc5164d0f76d44e5bd9c662fc6804
5665 F20110330_AABQVR sismour_a_Page_069thm.jpg
4880530bd3b35364041bab411674c8f9
508237437e6175fb25ecbb3292c6093ee7080218
F20110330_AABPSP sismour_a_Page_085.tif
dfdd75c1fc15dfbaa10d700537dc77dc
9cfe85e6c18cdefb4ba7fb63ba96b9ba903a111b
F20110330_AABPTE sismour_a_Page_118.txt
661b73755faeb8b54371b46261a131a3
b4df2785fa74fef495fadacbd3ac04aa1d88ada4
5641 F20110330_AABQWH sismour_a_Page_128thm.jpg
680aef4939e2dcee8854611775cd89f2
3f48d37c8b92dd80c8ef412cdfd8cf7f14dd7a0f
4917 F20110330_AABQVS sismour_a_Page_072thm.jpg
352a5dad9e7b3fb83005cff075daf1e9
465c5b8958f24aa8bb8211b901f46c7a33b0f8fe
6001 F20110330_AABPSQ sismour_a_Page_095thm.jpg
f3759231ec1b808089bc2c4af0b5f56c
05534c88843bedf2629d959297bcd469d267d327
90514 F20110330_AABPTF sismour_a_Page_124.jp2
a97cbef0a8a3d6dc7f27286639e22801
d1b50d18853761981d63cda02d6aab5912c511e1
3008 F20110330_AABQWI sismour_a_Page_130thm.jpg
4bc91bb4eaefefaf9229da738ed533bc
b6accf6e9ef160f196b37c1b7f675101763868c4
5740 F20110330_AABQVT sismour_a_Page_073thm.jpg
4d944fd5054dce23c9635aa2b79e9dd2
b78e72333386821661330dd34ec8528fd7eb3d3f
94377 F20110330_AABPSR sismour_a_Page_119.jpg
fbd12873e32ce67dcf9168ba86d79202
432d402456878954ecb0624bea6365521b65107e
1956 F20110330_AABPTG sismour_a_Page_121.txt
30d64dfd2b1efa775a7a8478e0a3b716
478056349694d3a36df0d7044b0392214ae1dbee
6448 F20110330_AABQWJ sismour_a_Page_132thm.jpg
5a358675feae7c0250779fcda4b4663d
08468eda8a10c1d79af7eb37eac377bda5690c22
4602 F20110330_AABQVU sismour_a_Page_075thm.jpg
ed2a744f531f690ef6b68936d8fb2196
500be9caf1688c2c159097f7f527617f056f9d12
F20110330_AABPSS sismour_a_Page_132.tif
ea3a230bab93961378db0c4a36956ed7
d6ffa3f51b4f335c29b1b74904759c2bb5457eb1
F20110330_AABPTH sismour_a_Page_020.tif
2308b78792da624a53ef3f1ecee27559
dbc2c97253a08f59ec94ff54b10eafd826dd7e3b
166092 F20110330_AABQWK UFE0012925_00001.mets FULL
8a2b084be51ef02050978b5b2824b833
45bfc0d121b340a6ae43133752e6e2e0625dd058
6158 F20110330_AABQVV sismour_a_Page_081thm.jpg
a2932f6224435962a97eb188a4468571
759068df74139cd4562dd2ab298e243276dfb5c0
40852 F20110330_AABPST sismour_a_Page_008.jpg
9fea5ade65428f46ddb4ded942b4c10e
3b433c796306d0f7abedae28589e7c74c7f328a4
49854 F20110330_AABPTI sismour_a_Page_106.pro
1868599136f695bc1f00b1bb58dd052f
c3c102a0100c8280454fa82357e21592a966c3fa
5124 F20110330_AABQVW sismour_a_Page_083thm.jpg
1db1b451367005696b093e0a312ce2dc
550c255bd6b1591eb3cb4bda50443ec1ec7b1ed2
34284 F20110330_AABPSU sismour_a_Page_085.pro
50f336c4b082751fd323055baf8d69a8
b9dae63481562abcba272c1667dccfaa28159dcd
37879 F20110330_AABPTJ sismour_a_Page_071.pro
25b7655184a261ab4961d11d1803df73
58f6b038a31032db0bfbc41e2f5afaae85b4587e
5078 F20110330_AABQVX sismour_a_Page_085thm.jpg
01225e7d79eeaa4a374e6dd6ec1e26dd
d613c41e20496d5ec802130558d3b04d0aa6f6fd
F20110330_AABPSV sismour_a_Page_112.tif
42aaaf27062394d40c04663c7554e650
f4320538bd9c138d661e140bf8c8f6f2d55af502
6206 F20110330_AABQVY sismour_a_Page_094thm.jpg
e656787c18d98a148aeb945f21a3f139
899097d8819a4ccf8c122dcedb8335d375c36743
2133 F20110330_AABPTK sismour_a_Page_053.txt
cdb759dfef94367b257d370b08f5caba
ab14cf9707bd9ba7d38c68c9c4dc6718b0e58d29
F20110330_AABPSW sismour_a_Page_096.tif
a2ba9f0bea3612e0c1b4a5a7e50ef9e9
cc32cfb088cd36b81153d40c059a9f26ab9cf028
6058 F20110330_AABQVZ sismour_a_Page_096thm.jpg
9380af6e11aafbb6d3e24dd44be39421
73ea7ad274ea1be620d8cd60cb5ce976057c6f35
34435 F20110330_AABPUA sismour_a_Page_114.pro
f58738c5e485a4f9870d1c48035f408a
246d0d78c722a2a107c3c138d9469102823ef008
1889 F20110330_AABPTL sismour_a_Page_020.txt
3802bfba9a95763971e135f2fc2e3f7c
9e512cef3f9bc7a22cca826738b70197b8ddaa28
106027 F20110330_AABPSX sismour_a_Page_055.jp2
7159b0b102e3d628c91b74ab57faaf03
aea4976207c81d7e3ab3de6b6b45013995f6f1e4
27595 F20110330_AABPUB sismour_a_Page_132.QC.jpg
5368bdd7290c9d2ddfa5571d15303df3
93a2d1fdc22fb41df6ee8ab1437c1810104ef78c
104180 F20110330_AABPTM sismour_a_Page_052.jp2
7c1e5958c579cfbd1ac04dc3a965a784
de423e3beb57263500fe0baf30b634a7f38282ae
2729 F20110330_AABPSY sismour_a_Page_040.txt
f1ba4da9c9b34d7f55c02bf29da023c7
8688ccd326f0161eb87b47f53fc243e989629e95
67733 F20110330_AABPUC sismour_a_Page_076.jpg
d2173b6a96fdfbc0ab453ee7e55e24f7
4bea6551afe40fc782d74c620d342eedae45c5ba
23855 F20110330_AABPTN sismour_a_Page_045.QC.jpg
ab20190a700e601c7f635dbe7d954ec5
57d26e81821367f76d05d0253ad1b3f0bc2f15bd
5251 F20110330_AABPSZ sismour_a_Page_063thm.jpg
ca5a1c0a8986049c167569dc7ff57709
213f3c1206cbf4701b9b4c597104b92810403765
5358 F20110330_AABPUD sismour_a_Page_028thm.jpg
ea8b92c2deb188d9ad527bdf8ce85965
42e6540a1b10feaef77802e64fa3f56a33d91c58
23070 F20110330_AABPTO sismour_a_Page_114.QC.jpg
d4e4a535c6d612cdf62746b39eec5fc2
14283101a6ada68689f8874929368d75399fa4a2
88517 F20110330_AABPUE sismour_a_Page_117.jp2
9dcd5153293d672b39b3e82c399c5208
8e772cf1bf21827847833672fc09cf2eb951a31c
5467 F20110330_AABPTP sismour_a_Page_092thm.jpg
cd2aa5812f55a1f04a8887087aaf5a8e
30aaa8128c19adf26db077f8c5c9ad33ce3dd260
90092 F20110330_AABPUF sismour_a_Page_102.jp2
0df6b4c9c3fb35867b7c8d2c7744be77
42222d2b556bff6325d5bfa20f0fc9dbde368e6c
954 F20110330_AABPTQ sismour_a_Page_130.txt
7e6970065400d588bfeac31ed362321b
3c86623cb36447b79b5ff226f68129c1a84e4b55
45456 F20110330_AABPUG sismour_a_Page_048.pro
38ab1caf345826b582841d5819fd56b2
c184638702c50581d553878fc0b778d6a09d41ab
923580 F20110330_AABPTR sismour_a_Page_100.jp2
a3d0746d444e83e88606725176fd122f
6c0d6655861394dbb39831c66be12bde4d413fb0
6311 F20110330_AABQAA sismour_a_Page_138thm.jpg
9451e3540bdd52e112475dd6fa752166
f95f355c6d47eae7b83c7db3699ae859647d6e61
79098 F20110330_AABPUH sismour_a_Page_104.jpg
b9652590b55ddc5ab9db2f6e552a3798
fe93710f6c6068f11f6b69ea5087dd81f71663ad
18862 F20110330_AABPTS sismour_a_Page_112.pro
61b544a3660bada5a00e0562e27941ca
fb929fd80d16708e5f7a423904ef8410c7f8401d
24682 F20110330_AABQAB sismour_a_Page_094.QC.jpg
65a144d70844487d517954d2a502198f
635c532c66596971200b5d9746a76a0e60542c4f
99236 F20110330_AABPUI sismour_a_Page_053.jpg
eaaae6561011ad027eb0aebb9ec43f8b
fbe0e92578f28d521736a8000167493aa64f7d28
76674 F20110330_AABPTT sismour_a_Page_045.jpg
193b903ed16682b2510ffe5d4fe80e41
ddf794f81a2d60da4104e60d7be663ce3549b54b
2081 F20110330_AABQAC sismour_a_Page_042.txt
5a21cbdfd564e046ae717e2363b62d29
8f3477e5c4b13160895b8c1354f000a56c1a55a9
48024 F20110330_AABPUJ sismour_a_Page_078.pro
04d562ecc2c75766b7aa83ce17710d0d
7e794dc945002643a91fb87ab63a3c04483f328a
22991 F20110330_AABPTU sismour_a_Page_073.QC.jpg
3aaa67e81ee8ea7427f1525edf99f3bc
abfefad67df012f238045433493fd49add44b313
1498 F20110330_AABQAD sismour_a_Page_097thm.jpg
31bca0c310849683f393e676e7a56633
509523c7d5a34a1a354596a79845acd88fa819d7
1784 F20110330_AABPUK sismour_a_Page_070.txt
547fd8641ff02cce6d3b9a86b4e924dc
9998fc4be797716e756d8d06d8f31795d4216069
71998 F20110330_AABPTV sismour_a_Page_061.jpg
736c1b672f603e1c7e1dc3dc7af1b36b
80b0fabf0a39b86a730643ee5463f704499e2914
104918 F20110330_AABQAE sismour_a_Page_018.jp2
e1950794f69c42521c953cbf09b6df11
f759c8c9c823ca5b06dfe645774aab7ba86a0a52
84698 F20110330_AABPTW sismour_a_Page_107.jpg
b597e19fb2b60ece9fcb070b45cc65c5
71504e14e2f6a864caaa354737298f8b325b31a7
2539 F20110330_AABQAF sismour_a_Page_038.txt
284a95bf9502c3dda48c11a2269428cf
d43b0b13e4a05dc66b1bba10b8846339a6e2e3c7
5779 F20110330_AABPUL sismour_a_Page_129thm.jpg
f2533442104f8d002b6ef036e9972c72
bf6d6383ddc25209f4f01e7a063f5414309b2ac3
51968 F20110330_AABPTX sismour_a_Page_082.pro
0bf28e93c7fe7eeee2573ce663573456
eb9653c97df996808f91c8a45db0fc68e68f1010
F20110330_AABQAG sismour_a_Page_037.tif
8dec33690bfce1d8f862606645a674d4
8d7d54373b5b880eb0317fc220a3acd684cdcc43
105954 F20110330_AABPVA sismour_a_Page_006.jpg
3aa49647ad6ef676604f605127a451cb
b5fa356995a20be9868928ef43c56b5eb5aa98e0
4794 F20110330_AABPUM sismour_a_Page_004thm.jpg
4024da79dec5f42ce5dbd44fe40e9215
777c1430e6991d50fd5ff91fbc0b6cdfbd124225
F20110330_AABPTY sismour_a_Page_063.tif
c085974d8b3014ca9080c271cfe82484
44e531466c56227475b82a82f818e587e7efa335
F20110330_AABQAH sismour_a_Page_055.tif
eeba4eb885326d19b91f1ef840cd7624
353226226fef8bb224d806462905f78f17a52998
4369 F20110330_AABPVB sismour_a_Page_093thm.jpg
616c34a20520ef2a68faf939776dbe23
2905ab215c4c4dbb36824db2a0eccf93241bb226
5848 F20110330_AABPUN sismour_a_Page_123thm.jpg
afc9b0f7783e437e36f3ab48420cf9a2
9de9a78a9948acec5b49a083e9c6acbdb6389f4e
2006 F20110330_AABPTZ sismour_a_Page_021.txt
ca2a9792a913ac05aba67ae7b52357e4
e62bec0a9ecb8d920c15ffb322e26482f7185235
6035 F20110330_AABQAI sismour_a_Page_131thm.jpg
debb0e74022bd49b9426ff66c5da48fa
a6cade7980b09feb6575dad84cefc0f3ccda449c
37251 F20110330_AABPVC sismour_a_Page_051.pro
06e0ff13f2800d815181a4c9fc4f6660
5b00d9bfa2e70bf502c66a8cd76525fbed7421dd
6727 F20110330_AABPUO sismour_a_Page_137thm.jpg
6b9cfaf26fab2da158d914b00920fd5d
6889ac65c95ada3ddcabf50c35d0de255cddbbb9
49759 F20110330_AABQAJ sismour_a_Page_016.pro
bef470be3cf657fe521db3b6f47079ab
ebb0fec73f6104481256b7518ee9c58d3e58d591
F20110330_AABPVD sismour_a_Page_058.tif
cd254d58be7987973bf66521b5537cfb
8c7ee45878027a460c23a21b69eb72c9558ff189
108255 F20110330_AABPUP sismour_a_Page_081.jp2
0c72d3354f676585521d497ab418e84c
6f575e82e01b95e4fa0054943e61d7833fb4e234
1164 F20110330_AABQAK sismour_a_Page_008.txt
99557d68923c2a5dac5fdc3f03dcdac0
147172dc77ac299f54c9d3ccfd802673a8524ee8
F20110330_AABPVE sismour_a_Page_100.tif
db4a1748989c631eb5017dbe397a34da
028fe0555f7b9fcb9ea37da464740ee670bc78ae
79783 F20110330_AABPUQ sismour_a_Page_020.jpg
58f7668eea108d604a2984181170192c
4c0d41bab991c788932e7dcd89e989a2ddbfb5b8
68030 F20110330_AABQAL sismour_a_Page_036.jpg
f606739e04dc9f2f735e9ba57aab33a1
a99625a6c32fd450c35906e50cf0d3ba2a5528e0
77530 F20110330_AABPVF sismour_a_Page_068.jpg
734441d4d23b8d6d77643699abbf7303
2fea3352752477756bd0937da3c81742b8d314e6
110120 F20110330_AABPUR sismour_a_Page_105.jp2
8d995547be5aafb8748a2a0590e9d5e9
38df9ea241b3c5055614a43e7a4dfa033dd1fea8
1966 F20110330_AABQBA sismour_a_Page_016.txt
a395a7f7e4f54f027a01a32f26974af0
890241b7d718310346eca9fb4b8dbad055180284
21099 F20110330_AABQAM sismour_a_Page_072.QC.jpg
90adc5b3c298828dbd503746d03953ed
0092ecced0c64dd76c681d7aad92ae698eb5f9bc
46720 F20110330_AABPVG sismour_a_Page_052.pro
b2d7e91f5ce8cb739c6a53786a3f1532
0fac2afa70ed84e7d9e0e92695bec7303c23dd21
F20110330_AABPUS sismour_a_Page_092.txt
4f8b680a0409254a69c8f681cf07b6c4
5c181bd1a54a7254ce2718811f42990b005fc0a9
26332 F20110330_AABQBB sismour_a_Page_105.QC.jpg
f2ad284cafac63e5baf7a8a19c40ab68
c2fadc571ce2c362d1005a92284276ba16f9adc9
F20110330_AABQAN sismour_a_Page_101.tif
c53c73813796bdf74840dc9d8e6c29e6
0221d0bb8e3340d8ff191395b987af678bdfb287
6066 F20110330_AABPVH sismour_a_Page_140thm.jpg
c2a104017c130238b49d756b13270770
d922a9b8889a603bf2dc5f18c6f925672cb131bc
856052 F20110330_AABPUT sismour_a_Page_039.jp2
4fba74a584f0491c34203ed880093d36
2670a387b46bc51d292be03f311d8c12a8c806d7
2768 F20110330_AABQBC sismour_a_Page_141thm.jpg
50c53bff1e9d505b212358de93c42ae5
68497063ffeb7527f961d8774f15dc988ea51d43
47035 F20110330_AABQAO sismour_a_Page_127.pro
a44e039c913926d51a597af784ad24bb
5978270d98943f695e8eaa172d02531f2bf9d803
24512 F20110330_AABPVI sismour_a_Page_020.QC.jpg
8cae7c94b1eda96f2ffa7916bcd39a51
1dd6a3051afb7b8d57f21cf2f0945bcb2a25e8cb
2219 F20110330_AABPUU sismour_a_Page_072.txt
ab459eac072c28fef0111557405fdcee
f89e8713b33293bdbf967274b95ff37fa188b9b0
1640 F20110330_AABQBD sismour_a_Page_085.txt
635fedba8b43865654d1e303cb1274c9
11d149b1f1a5560241aa00549d0ea1e0f3764dee
1886 F20110330_AABQAP sismour_a_Page_023.txt
ae0d61336e2534102c158e9790d83e36
da5a7049f5d971c29bcd85e584dd9e019873894d
F20110330_AABPVJ sismour_a_Page_013.tif
61678b54b9c05453784bd282bacf4024
d66471d3ea208f3dda193e11131c01bebee02d06
2114 F20110330_AABPUV sismour_a_Page_131.txt
cfbccff7c74284394f4b913bee583db9
8e0ecb173ccd1c1aba24824c3de3885e945eb2c5
6222 F20110330_AABQBE sismour_a_Page_107thm.jpg
14739b67434a31e45eb772114aa916ea
9c923e9d44a92a582dae60c124304e2fff3c91d7
40607 F20110330_AABQAQ sismour_a_Page_098.pro
512ea1bcb135349dd48ab2031562c92a
2675102a37ce789b787aa0f92db6f9749776dc9e
19727 F20110330_AABPVK sismour_a_Page_100.QC.jpg
daf89dd701579be5dd5d06ba299ea910
74c1f112ca15c9c7fe8e7949ce8b25909eff5022
10513 F20110330_AABPUW sismour_a_Page_003.pro
190cdf1206282ce415c40919a8026a32
9cb0ca8bb23b534e6118b515ab7947c055d482f6
6217 F20110330_AABQBF sismour_a_Page_082thm.jpg
77b7f3fd226fd91182c6a903b5fbf718
d86403bbb242eb2a1f061b9d8180838c580386b5
2236 F20110330_AABQAR sismour_a_Page_069.txt
5e2810e05cbca0377f44c9aa8ffbb6ca
39c6a9215a4b348769eca2e28477aa87495a0223
2568 F20110330_AABPVL sismour_a_Page_100.txt
c83e1e6a517b2f320eeb6a737c493324
1b05254182efd921697889ea55cdc98c85a22ebf
107313 F20110330_AABPUX sismour_a_Page_022.jp2
ad82bb2e31ebfd4f82f4ef9d7d7ad7df
5365ef602e47abdbf3683dc5c5a860f71ccb3f1a
1786 F20110330_AABQBG sismour_a_Page_051.txt
b72ddd80a53cdb3b56f4c857276acbe9
4e43354f3cf108ec184a46aab958e45a890a4da4
F20110330_AABPWA sismour_a_Page_057.tif
99aa571e8f82107432f529351133a510
107cd92b7ef2ae2d919515f7c42f36497b7b2d27
8423998 F20110330_AABQAS sismour_a_Page_042.tif
5012c3969d4cdd27285cebb282a041dc
512d2a01540181b3e8aef4e428e2ca69f10b9153
1779 F20110330_AABPUY sismour_a_Page_032.txt
43e459291fe20ede377658004a0753d7
95c7a693465c92d7b9d0b5fd8b56c10dde95dabd
5737 F20110330_AABQBH sismour_a_Page_102thm.jpg
396e2df680117a79d81354283577dae8
d7cee96a470e469c65b0239d1959d15d65ec441e
F20110330_AABPWB sismour_a_Page_088.tif
22be1ffcd503fd519018bd8b4e8f1569
ac68cdfec3d21c907ea49fe450dcfd2ba342b413
107516 F20110330_AABQAT sismour_a_Page_121.jp2
c387d2cc5e2a551bd317ad8036d900f5
e2338abfb34da562b373ff59aeaf873d2490d05e
4855 F20110330_AABPVM sismour_a_Page_108thm.jpg
9266808e71122342ee394d5a7b539a4e
b3099560ec7531a9bc6f2f874be82b30cb0d57b3
5409 F20110330_AABPUZ sismour_a_Page_065thm.jpg
8155c26cb315d7c0d1e56a51fa5256fe
d32b00704f380a15645bbe8f792b7bc8ed217cce
384 F20110330_AABQBI sismour_a_Page_097.txt
6a9b1fb00a94e8403931caeda75ee9d5
a2032910fd1b21dd7f39c1c6c0e38e9083d048a5
F20110330_AABPWC sismour_a_Page_135.tif
29cedd9d96e2dfba13a6053d67048b3f
71f905bedcc91fdc1cd8d4bf96d00b48567ddbf6
F20110330_AABQAU sismour_a_Page_103.tif
cee88994f3d7703d9cd44d748960f20b
11204c90188ab01bf8db29d40f58a53b7bed3bcb
1021148 F20110330_AABPVN sismour_a_Page_103.jp2
65f902a99ed46e596d132148df0bda69
b69ce6a5f348dde31e3f5f9c955a1f749a53b900
1603 F20110330_AABQBJ sismour_a_Page_117.txt
225c330bb678c658841c2c416e5f7f5b
ca5f0897b3330eb347acb254f5043fa86b84df34
1687 F20110330_AABPWD sismour_a_Page_098.txt
9e77ddaff4528cc18a842a59aa47de0d
bc0bfb5af716b4520ee2f6ba7d8ade35864ddc41
1828 F20110330_AABQAV sismour_a_Page_074.txt
29ba2f3f1e11e9cb9ab93cfec54e8eef
7ebf3c66c2d1ed17285e2f4b1f40e96ee76d260d
24829 F20110330_AABPVO sismour_a_Page_029.QC.jpg
9d8e628300e6d2dca99348d2a90d5fe7
ed7c3cec9e26e397fd626949b9bd46fec5f481ed
5484 F20110330_AABQBK sismour_a_Page_038thm.jpg
ed3484ef6530dd05f37ad93380e06231
b75c3f94909d40a5ca10339468f482fc4f5b537f
45914 F20110330_AABPWE sismour_a_Page_074.pro
3e87777a730fc81ee7ef11512702a4d4
e09c29bd46498e0d829e4aa0418363032b304b92
45557 F20110330_AABPVP sismour_a_Page_056.pro
f5441e017bf0b530d00a395ff20234fb
2f969705234110461f9fc9c80afed21b73f9ee92
6232 F20110330_AABQBL sismour_a_Page_054thm.jpg
2296ded717f463bdbe24668714dee561
e2f21cdd4e3f2c0149e7cc1cec5094114784560c
1022165 F20110330_AABPWF sismour_a_Page_046.jp2
f0834fa4a379b3214961219d8ec16660
e0e62f106e8ac7bd168817d3480ac6535233787f
77328 F20110330_AABQAW sismour_a_Page_073.jpg
e0fe662243881b0d7513cb066952dec9
44428239cc48546c70a5f46dba11f44b08a205d1
1769 F20110330_AABPVQ sismour_a_Page_063.txt
ef0c39185253ff5d754ea3d7aeb1ad46
aaf7cf24f0a8938b7f9625ea9554f94a8bafa60c
87251 F20110330_AABQBM sismour_a_Page_076.jp2
088458f6da17cc7b6aff5e05c8833fe6
b67c126bb10aa530f395edfef9edcc29c53f2e16
62387 F20110330_AABPWG sismour_a_Page_108.jpg
54dc033c9f153ee7a162f82541c2f3f9
a720ce1257c1e6088b696f6044564553cfb41e6c
19721 F20110330_AABQAX sismour_a_Page_083.QC.jpg
438e63b815cf75b68ef2754bdd56b671
2647b34fd6a6ef9f6e6398207cc2413b9ce7b7c7
36161 F20110330_AABPVR sismour_a_Page_004.pro
21c6205a0b76667f00e868dd3db86580
afabb9c3eeac11348f6c488c31f452589a6ee3fe
F20110330_AABQCA sismour_a_Page_056.QC.jpg
79bfe7fa568fb065a320df1b56a4a5a5
24ae4ec6f0d89fca92216f9cd871b45a960bb8c8
2612 F20110330_AABQBN sismour_a_Page_133.txt
09f09b0e85ff2efe1ca99d3f00fe99e1
4ea7481b05c2c9fb470263f2c11c6a6f53e369bd
1051983 F20110330_AABPWH sismour_a_Page_005.jp2
ff8c9413e5b5cff3c97db4e3dc5fc27f
7e69c6a2817e0db17fbdaadf397bf3e36435d652
938277 F20110330_AABQAY sismour_a_Page_066.jp2
bd98b3d294eb189052bf88b01be7f26e
13f021e72799b75ab66475b49817c486bea52883
F20110330_AABPVS sismour_a_Page_027.tif
ec132acf11ebbc3cdbbf659e81dd3584
2b31a44d171fb303963bc94c923f2bc489c384bd
29310 F20110330_AABQCB sismour_a_Page_139.QC.jpg
f1423594e3d12a03a210ec5d9ddf73de
abc6554b5a90cc7aa2c5c04adc187589188a6bba
81923 F20110330_AABQBO sismour_a_Page_120.jpg
7d1ef28f66314e3c3f4aef76fa31b16f
141e53c7b88d047f78690e99807c204e22f744dd
23552 F20110330_AABPWI sismour_a_Page_069.QC.jpg
b2bee094f31fd38400eaaf7cef0d280b
50480e09e430faa8b2d1bed488909459a6dd708f
51396 F20110330_AABQAZ sismour_a_Page_105.pro
72725a3ac4760cccb440d15a306c3c42
3811a5aa8089bbc5771ecb0106e2ded1edda6b37
68582 F20110330_AABPVT sismour_a_Page_007.pro
a1ce42c4c4bea5be0d44c5d77149b0fa
197b0b3fc7e68ff505541ae76a93fb814c2346b7
24497 F20110330_AABQCC sismour_a_Page_044.QC.jpg
1f8e392309ac93993aab0c5ed8593872
0de37fb9ea4e22807fc7663910ff0d0d82f7f775
F20110330_AABQBP sismour_a_Page_086.tif
dbef4eea8a621a4e93a94a4d15f9da90
f58e0cea4730b7612d497c2e1cca9f7ad14dbad7
2010 F20110330_AABPWJ sismour_a_Page_081.txt
24aa6e8532fc6b1b5a5705f91abf0c08
f35b617ad58cc0896aae6a8423bd62d324ade504
23793 F20110330_AABPVU sismour_a_Page_091.QC.jpg
fa0c9660ff8130e145b0b513007320b8
d70fd49921baee293676fa53838c68f806d139b0
52982 F20110330_AABQCD sismour_a_Page_053.pro
392797b10f3b43d4762b79243381e2f5
0c694365ed79da06c2792aef9a8ab44d6d7adeec
6417 F20110330_AABQBQ sismour_a_Page_025thm.jpg
60158d5f362151642c9490818046997c
616428919359698a825c5370aa45d165eb5fa89b
F20110330_AABPWK sismour_a_Page_082.tif
71e20cb3b1b270e4e1440819f6c785c6
eaf2c656edcdc67255e756fa1a3b0a2d591f892a
1051957 F20110330_AABPVV sismour_a_Page_107.jp2
2e43e2a0caca545c92544aa6ab88cb48
179d996ee9c0f3d1a60d58c2d04c5b3928c76d67
40894 F20110330_AABQCE sismour_a_Page_124.pro
011016cf6ddc63bee88ae1d06023c0e3
c59e414269a34af2953009d78d118b310e5c1d3b
F20110330_AABQBR sismour_a_Page_052.tif
6fb9124eeb2e08219e2fbc8a393b2ae4
f0eb006c85366e1c87452872b1351b71a0037493
80349 F20110330_AABPWL sismour_a_Page_029.jpg
9bb8e61e056aa21bbafd3e358f39d32d
42c9276ca711059fe24919e054443e14b83d6234
F20110330_AABPVW sismour_a_Page_032.tif
c81d31d759d92ce047e18cf06783b867
ab41f4b258ef7167206bb09fd7740dad42f4df03
79031 F20110330_AABQCF sismour_a_Page_041.jpg
13f9da99eb880054c66a0cec460cdf8e
2391829c4cdcfc6eb6fb7fe12b02d2ac3ae28471
29219 F20110330_AABPXA sismour_a_Page_053.QC.jpg
cca53263369103db8485770374e38180
917702a82e08e16a52c351f947f31e8141059170
62609 F20110330_AABQBS sismour_a_Page_004.jpg
73902e1470fa2b6a2996551a74a7ef52
5279a4b541b04ca830cba48ee4aa4517e874c7a4
62167 F20110330_AABPWM sismour_a_Page_085.jpg
64094abf5e635d85b217e2613fa644c8
b859a4bb6a9872f34d303a3c2bea497b3a60d3e7
74714 F20110330_AABPVX sismour_a_Page_110.jpg
24d74f5c95005b967a30396a1ed289d9
bff660eb77371e9579970b3bca9f1da8ca85dd32
23755 F20110330_AABQCG sismour_a_Page_058.QC.jpg
45e31f466289968e0953909ea2a4cef4
43cc407b2725e889864e73e8ac46b860ea9fb825
F20110330_AABPXB sismour_a_Page_077.txt
f44148c151f623c2ed2efffc756524f6
90bc2b545b671d24442a3b44df470a92e419fb44
F20110330_AABQBT sismour_a_Page_128.tif
f9a2e57f20edc898331128617e162ee4
103c286e8dbb2825197d378b5120c75041dc21e3
74890 F20110330_AABPVY sismour_a_Page_128.jpg
d796d4d06cddbd31c85308a4c072356c
a8099db21a4b66bb5e995db0d2a8425ed8e53962
29352 F20110330_AABQCH sismour_a_Page_133.QC.jpg
16e69f844581e7cbdce6332387663243
711e22303fbd2bcd6943a54300d1a5515567170e
F20110330_AABPXC sismour_a_Page_035.tif
2172d0bb020b9def78e4fbabc0a80ec2
335f46731051ce63e3b04853d2958c8edd673c65
71268 F20110330_AABQBU sismour_a_Page_007.jpg
6c4ae836b96b4e1de757e9f7ae80e5d1
e7521a528eb7d41121f2c785f8ee4624e0c37659
24051 F20110330_AABPWN sismour_a_Page_129.QC.jpg
a92e6e51c3cd1e93e441852b3687b5c7
d4cada28be4c12e96ca38a6c2c1370642a51f690
47043 F20110330_AABPVZ sismour_a_Page_045.pro
c15a3cffda6c16ed4049a02a785b7e6b
2d47d9349b701c07c351cff8c405929173039594
109768 F20110330_AABQCI sismour_a_Page_015.jp2
2806bf86b680e8de926187ebfab45d54
7c71ecce26cec96b22f20f2975bee73ae9cd4017
939677 F20110330_AABPXD sismour_a_Page_008.jp2
c26e75466544086377dadaefbacf178e
a64eca7875e2c40689892a7387a5ecceaca14d40
48903 F20110330_AABQBV sismour_a_Page_067.pro
acf6e591bdce216292477e9d76248e28
20c664c6f5a46f2da02970beb804ce1b2b091ecf
75024 F20110330_AABPWO sismour_a_Page_026.jpg
4baa9d5eb56b2b8862cdd83cc0594741
c46409e50d5c6dec5f2881fb5a984d63f1217e7a
5037 F20110330_AABQCJ sismour_a_Page_003.QC.jpg
e946f2c577e071af4f8788d2301e933a
07bacdc4194b2ebdd7d4f5f34a175b57cc5d84a0
5780 F20110330_AABPXE sismour_a_Page_049thm.jpg
6bda6f02087fa304ce625b2a7516890c
8bb7b71d47fb872799c7484928eeffcccdc44e78
75372 F20110330_AABQBW sismour_a_Page_048.jpg
a82d45b6b688519b73ef7a1e3caada13
5427bec0a9be1239310a88b8525b3b45137412b6
77727 F20110330_AABPWP sismour_a_Page_127.jpg
a21238ec4ad349e76fac91eda09fb879
854ac2cb19400c1229953b631218823d6da2619b
84784 F20110330_AABQCK sismour_a_Page_034.jp2
8b16c644fe0d64bd72f2e9e974803a9a
9e1d109b0ac60d45812b85fc72c901ce6dbf01ea
77889 F20110330_AABPXF sismour_a_Page_062.jpg
3eed13ed836fcca5aae5a547291600da
b86e8a51a6984c3efb611c796684882e1ff24958
91286 F20110330_AABPWQ sismour_a_Page_125.jp2
9a33acfa582053cce05ec54439e9724a
8f45e92305d093bfe54b2fd93107ce837c545976
5574 F20110330_AABQCL sismour_a_Page_026thm.jpg
df89b08a2fe1da6568875787221c71dd
c02cc93b5510242337f0b3c714f0fafebfae8519
2229 F20110330_AABPXG sismour_a_Page_115.txt
c2f5cb93eb345f4972222d2374c03403
346be6614de98a0a4e1abbb06c4e08a0f988713f
2495 F20110330_AABQBX sismour_a_Page_135.txt
cbca8d8835369946e8178c1fe5a31592
72ea581a9da6b2d0033f3229925ef8f46feee0a9
100495 F20110330_AABPWR sismour_a_Page_074.jp2
ea5411935cbcdbe695d42b9f80ef8433
d5608e57dc0e2caea33a8a93940066d16aae05fe
44057 F20110330_AABQDA sismour_a_Page_065.pro
dedd737d158e62de99786d5c7c41b659
6be1b4e5fdd10233c15a07b6140cc41c73417761
5708 F20110330_AABQCM sismour_a_Page_036thm.jpg
07ee6d0824d2f7a2704e0319d7bb628c
de8dacb485219e878c34a3eb5a0b3166408c0bbd
F20110330_AABPXH sismour_a_Page_004.tif
02bdf9f58037b179d34617eb80a14d0e
86b9254a4810a0d8c20d154cc9591f4ff1688fee
108113 F20110330_AABQBY sismour_a_Page_084.jp2
285a61e0ee859123b95c0df68cdb4c77
9301f4011f847c0359430dc8af5d8ce66cdb75b8
26690 F20110330_AABPWS sismour_a_Page_122.QC.jpg
9f79ccd96999276292309713f88bffd7
0a7e26d1b21ee49d1aba61c5bf24c2d878248740
64777 F20110330_AABQDB sismour_a_Page_133.pro
5bd7b0e2c4069925184e7e44ae7cd01e
80c58b195e57308fd63f49e5a4743b4e7d222891
F20110330_AABQCN sismour_a_Page_119.tif
a68afc692fd63c420ba549b20013eedb
6868b13f61c9d4b74d12449a75e1694077e2be11
F20110330_AABPXI sismour_a_Page_129.tif
aa1e2b790b03b0a566b0be934a8020da
745245c76fae7606c657fc7508dc1a0b0ddac4c8
1650 F20110330_AABQBZ sismour_a_Page_012.txt
6a30d6fdd22cba2b61f2e126a4027df7
ac60cda95cdf1d50e95612b2890e78cbe9e7be31
5351 F20110330_AABPWT sismour_a_Page_100thm.jpg
831f17993ce9415af88382d31cef4743
633d2ffcd626c4e6cc0540794de3e6db8f11676c
77314 F20110330_AABQDC sismour_a_Page_017.jpg
077cb5b70cbf13f041b3fe1426fe9797
4312d7848af14c302f876b551ded523636249f73
40772 F20110330_AABQCO sismour_a_Page_125.pro
b743b46170ff47150cbf5c3d87dfcf38
377b182132fc029e231652847e1dbd20bdd61303
F20110330_AABPXJ sismour_a_Page_018.tif
e8c24079ccd5f8fcfaa4cfb1739d202f
359b2b2b66c88ae93255b3ade2d5f317d35a5eb9
F20110330_AABPWU sismour_a_Page_102.tif
5cb7ede4b9796bb8ca33a07918e8eab4
dae1bec79b64f7b96a087c416bac45a5122b0f3c
71635 F20110330_AABQDD sismour_a_Page_113.jpg
b236a35aaa248102d5a764866f7a551b
0fb80dd2984c5cb8b8263d17cbadc1582b6d164d
79418 F20110330_AABQCP sismour_a_Page_018.jpg
eb4698f6e4914ad46b00693c0439caf5
1e34d05b12a26c231228f79301e05addba965f68
917725 F20110330_AABPXK sismour_a_Page_083.jp2
88d0abc103a2225c5cfab834569ddecf
78e69a021bd9f35c788a407011b3f1b9d546a330
28286 F20110330_AABPWV sismour_a_Page_137.QC.jpg
c24d2ec1ed9d16033d7f49ce193a3cd0
7646a8d5a713d4d7d96421fae3697747fde0d0ed
1995 F20110330_AABQDE sismour_a_Page_116.txt
b3238fd6a1fd1d36ff76d93c16ea10de
a34cf5cdbaccbc176a78bd73cab00291e5871b34
45842 F20110330_AABQCQ sismour_a_Page_072.pro
26d7334195762008401b8ccbd176e286
66005746e7dbf921e7f706f36c108860c4994060
77638 F20110330_AABPXL sismour_a_Page_032.jpg
be7c4ca600b9f6d82a0a62d60c0eb290
d3fbeadaec21a440edc64eff85c6e92ca12ed5d6
1500 F20110330_AABPWW sismour_a_Page_034.txt
c15946f71d85e56d32856e5562982a52
d004043e02a1ec84aec5b100e6eb404a8c577a82
20693 F20110330_AABQDF sismour_a_Page_112.QC.jpg
b7862aa267430a08dde9222227e88944
f0608f8af47dc6dbf6b140520dab51ad790acf73
22495 F20110330_AABQCR sismour_a_Page_038.QC.jpg
0f9db4bf3920429c88e1e5944d63ecc3
171bf3945aa7f3eac621fbe31156b7945084a171
70618 F20110330_AABPXM sismour_a_Page_101.jpg
bbc0e05254254171f6173595c2658644
6212d34fd27e0570dfa832e0efdebb915ee01cd2
1928 F20110330_AABPWX sismour_a_Page_022.txt
96be18b1c5e2a1da367b24005047c7d7
23aea9f44e183df0e1fe1c239bbfe1a2b5829111
71887 F20110330_AABQDG sismour_a_Page_013.jp2
3ccd414f0e148ae199724905ab59c7a7
02a1fe1d203ffe89a45dfcec03df088f4b96b908
5242 F20110330_AABPYA sismour_a_Page_097.QC.jpg
b7db797f0f235306638be2a880d2f35c
b930a09eef3f1a14908967e4b5486c2ab9fede1e
845611 F20110330_AABQCS sismour_a_Page_088.jp2
1d782089708162b1937f2f09cf4667bd
a64c3d40f531f39a4b77d50e05ebe1e207e34ccc
13098 F20110330_AABPXN sismour_a_Page_130.QC.jpg
6e61098afd8d8b4015692e5224e207e6
e64e8838a5919bda51f478ce2b9fd2f556e71193
25711 F20110330_AABPWY sismour_a_Page_019.QC.jpg
b9410ee5d7b5b2f4e325d4f2c1aa80db
64d2708460d5d0c4e247cfb1cbeb4038242d721a
36538 F20110330_AABQDH sismour_a_Page_039.pro
268527560bd9a76e427c9c140e8d1182
dd9e789967e88b069ffc4b52933108d94ec3ab5b
46363 F20110330_AABPYB sismour_a_Page_073.pro
b042accf42a0386925e9ef22ae5a8312
00e51e14d2a8f6c8aa0dde2efc789a95d3d5fac1
24475 F20110330_AABQCT sismour_a_Page_115.QC.jpg
cc863e7c98eb9e3f59c0f284380394d8
0d63c46b9a5796f0e9749da14e7d46bae234de4f
53809 F20110330_AABPWZ sismour_a_Page_126.jpg
6a1690fec099a81ea969763a39febda4
3b67cc814df7fdb79d189e77950a314b755b0988
47722 F20110330_AABQDI sismour_a_Page_044.pro
07cc369e279395e1e5153527c43bcc1e
f4359b5d723b6e723276e7107c3ef031fa901a71
3201 F20110330_AABPYC sismour_a_Page_027.QC.jpg
3cc54bdb2850be57476207889d399276
31a854d680802603f074085c13118fb14c6ca7e7
86821 F20110330_AABQCU sismour_a_Page_057.jpg
3e98c68ed84539c8de6882b4d7893fb4
e0ad4136716faf6019153d710765dea4cc4ea309
50605 F20110330_AABPXO sismour_a_Page_069.pro
19d77d08ff8babba6d793f208cdf9bc6
9c3a8e64117553f155eeb0c7b55abd4ef010a990
F20110330_AABQDJ sismour_a_Page_029.tif
eafeef9e11bf25388e4c969fd898332a
32f55fa55abd772310f8b55d84f0a1dedf4c07ef
41290 F20110330_AABPYD sismour_a_Page_061.pro
792ffde288dd0e973f2277a2d186c67b
01f3bb18a20c7c2b9df27ad14b56d43f3d48c52b
3525 F20110330_AABQCV sismour_a_Page_005.txt
48dcbd272687a25cb24f7dbe75118a86
81d0e4d93600712679c15d97e89c3ac8ddef8354
F20110330_AABPXP sismour_a_Page_061.tif
d130d8a602de2ab3757649401904655a
9241af3f8a3591bb65c3293072cde061ba2b2d81
F20110330_AABQDK sismour_a_Page_121.tif
9a7d994779925b55b6de425a10ad35cf
18df4def16021e46fcda1da3af3e2a7ac6a1749a
F20110330_AABPYE sismour_a_Page_021.tif
e0c07f9a06bb84bf5c50fa7f4f1b76f3
e48b08856139ca0fade0b7aa031006e5c4d39567
21648 F20110330_AABQCW sismour_a_Page_124.QC.jpg
a83d00c54c6e67e1dffaa1ad80e32919
ffe44c07d04566f6b2cb90c4e45a89d33df2f686
991478 F20110330_AABPXQ sismour_a_Page_070.jp2
994a838997fd43e123abd8df76b3cd35
4917d928c7cb2dbbf5d7654ceacc6eeb1ab4e443
42126 F20110330_AABQDL sismour_a_Page_089.pro
0d885f9f9c53a5741212fdbab1d7c416
fdb734a4af905b06d9c2866c717bfa5d4d736e3d
1051963 F20110330_AABPYF sismour_a_Page_032.jp2
68bd2c9888cb320bd1ad31c7afa815cb
b1aa638ca31f98f866a9174a2edffe0888a63c5d
2596 F20110330_AABQCX sismour_a_Page_134.txt
82724e175c3bedc5282bf49d9b95cce8
ef063eaa1313f6f4ac34adbccd804fb45bea85a8
31661 F20110330_AABPXR sismour_a_Page_013.pro
8e01162fabb7f71ed13746113e220a35
06636edda7e07cbfff2d476a1690b3121f50d306
F20110330_AABQEA sismour_a_Page_111.txt
4615f93d5b445080917a0f7e3fd30c3f
be1d04b827f1e8a579ff528b8254b6c54203f046
35532 F20110330_AABQDM sismour_a_Page_083.pro
d6f1f003f25f9af28afeac7e881a8bf1
913e3fb25f48fa829210eabb0174d0d719d1e8e3
1781 F20110330_AABPYG sismour_a_Page_030.txt
aff7321b5be7d112849cd81b9867ce6f
b43a5713475c33bcf9a1b4e92aafd3758924a787
1904 F20110330_AABQEB sismour_a_Page_036.txt
6742a59c0f503d166a87945db4f1addb
dc470f5781f668dbf90085fd8de5532d760c5cbd
1408 F20110330_AABQDN sismour_a_Page_075.txt
9c96c4b67ef29ba28ecfc661bdd78885
8b67f0df195a3afdb0845d5b4b9e52e029c941f6
F20110330_AABPYH sismour_a_Page_120.tif
473e636e9a86c0f6e8f60d793fd6e39e
6d33ee32ef2f740b3e5dc8db5b299431889cc454
F20110330_AABQCY sismour_a_Page_077.tif
d0246cec8e0260a8f8dfe0b0d59a22a7
ab0a636d60d6e5eac2a57f22702665605752ef0e
1645 F20110330_AABPXS sismour_a_Page_113.txt
a97dbc7bb5be78322a1e5b7e2f106748
53dcea76f50e90927fddcf3cff68d8d69b17b125
19276 F20110330_AABQEC sismour_a_Page_108.QC.jpg
dd5b49b7f98b58bf6ae773a314a5631d
86a67a9f270bc44f0698207c3f9eb3401c3c302d
6619 F20110330_AABQDO sismour_a_Page_040thm.jpg
ded62b725a58cd81d9e04e17ec17e556
c1a49e1e29affc522963b87d84379422e9333387
5838 F20110330_AABPYI sismour_a_Page_045thm.jpg
ad4a9d3b5dcfa91251f05dd03ebfcbf3
b801a058b554043b72df9476e65956ef7ac3e6ed
25545 F20110330_AABQCZ sismour_a_Page_120.QC.jpg
015b804ca426359103dd3d69d26bcba6
d891e03bdb247edbf82764ecd4e7e0173b3df1ba
4129 F20110330_AABPXT sismour_a_Page_005thm.jpg
14c217e5dbc7e824fdcf604532bfd8b2
07c6247e426ea9ad1e86def3b0eb038629cde4d4
6500 F20110330_AABQED sismour_a_Page_057thm.jpg
107cace3f2dec1d862432afc2fef8c10
16ef034b13c834e6b3afe7d4c4d545b9178d822e
75645 F20110330_AABQDP sismour_a_Page_038.jpg
dc9f78b3758fd4f99922d2524751a72e
21c9f73c0f7a00555f8937e9b317f99e90ba87aa
17173 F20110330_AABPYJ sismour_a_Page_013.QC.jpg
921713fefe7ce4adbff86a0962475c56
2f7f401e12b168f412b65a129c8899f352a157ef
4880 F20110330_AABPXU sismour_a_Page_090thm.jpg
645701efd8fdd11d625d5a2d275006af
486de8adaf0a182bd623f4bb5613d5b324a1c027
1972 F20110330_AABQEE sismour_a_Page_106.txt
69e0b82a26836afac87663c6a2e30331
ab27b13d7fca6baf588b42dde983236e56dc7328
86901 F20110330_AABQDQ sismour_a_Page_079.jpg
2cc7c87cadc38d3ca6a4544145fb5977
376b9efdb21f94365be1a6f761d10619aaf19677
124990 F20110330_AABPYK sismour_a_Page_040.jp2
6243ef5800ac5363583a5eaa2c2b84e6
d47a6e24798dd7cb55ab71d005668ffdc0f7bd22
1612 F20110330_AABPXV sismour_a_Page_083.txt
185ed98db66cf2e4825249ec1731f68f
9f0a5216f5986be86ffc1f9476ef8aeaecd83f59
80234 F20110330_AABQEF sismour_a_Page_078.jpg
a160b9f1642b2f8b44ac9c491d3b8be4
2fab4b0e7f6862bde24579e625ea011009c402d9
F20110330_AABQDR sismour_a_Page_016.QC.jpg
5c2f813301bd938714af0fdd247d74a4
a278ca3bd406e6ca920f932057a718cd563703b4
75079 F20110330_AABPYL sismour_a_Page_065.jpg
b17c967b1067c458c7b792965bd922a9
380f8a5df7b0ccb84c62e2c9248a8f32c6e89b5c
47729 F20110330_AABPXW sismour_a_Page_041.pro
d7dd925941bed312e66cd58d695e2208
d3177b70c9752f4f23f9d5c7a5b4936acb6972d2
71918 F20110330_AABQEG sismour_a_Page_033.jpg
fbdb7586192ab23c57dfaa03495f85aa
5652dded93f92dcf346d3ade480e7b0839f0ffc0
68594 F20110330_AABPZA sismour_a_Page_126.jp2
0e8884ac7fd8d4e9b977252fc4792d67
2d5c85eb69ad35559716c13340dc01ec688660f1
134885 F20110330_AABQDS sismour_a_Page_137.jp2
c055a53bdbdec703fba7d616cf7a8296
724896fbc76bbf85b471bd9443416bf57431292f
95940 F20110330_AABPYM sismour_a_Page_110.jp2
eeac31f72306eeb61cce69305fbf5553
aa3c54d68808c059e7aa1bb62c6897e481b51cb2
F20110330_AABPXX sismour_a_Page_138.tif
41459078ea989f814992f3eb3d615800
f6c5ffea9ec8c793d1882887decee49aead31db5
79188 F20110330_AABQEH sismour_a_Page_094.jpg
d27bd745d77b15ecfd3493d6a00fc18e
46a3c15dedda58e998824f980371976d0e643c0c
5692 F20110330_AABPZB sismour_a_Page_087thm.jpg
c1f8b8e6676272185a90c45ad4243007
7add5bf2d19979bdeee4922673e84af18c056984
F20110330_AABQDT sismour_a_Page_023.tif
b19a33859847528a6565f0b1aaff4549
2c9c56d37a39d033550666269e6ad4616288b520
43973 F20110330_AABPYN sismour_a_Page_110.pro
8e8f517defc4d4c7e4e3841c960f5428
62b24cb5030ada242367682694278393a325f8c7
110178 F20110330_AABPXY sismour_a_Page_136.jpg
03328039590c0cd0cbbc6585268c834a
bfeecd091f69f334eff063956f448c0753209e2b
49229 F20110330_AABQEI sismour_a_Page_095.pro
3eed81104dee5b2de4573ff77e1c1901
4290a491c1865c794f44c93bd7c17c7325c39c6b
21314 F20110330_AABPZC sismour_a_Page_089.QC.jpg
c30f8ec38de48be485b0ea8a67f4d1a3
082210ae93b2b5feab5eeea7cfba9c1b98d1c20c
25369 F20110330_AABQDU sismour_a_Page_109.QC.jpg
1d87cd846c5e0f3578262f0ccc965b5c
9c545362dc91f28ef11b315f75d548746535f02e
127265 F20110330_AABPYO sismour_a_Page_132.jp2
7ac6a716b38e9c1349b383a3123d1d74
bb75c912ce9c27694215a589adf4604525a7c556
73480 F20110330_AABPXZ sismour_a_Page_063.jpg
05eaa2221cf07b7b2ea8c25edd5274d5
9accfb5b1657ac09e0ccd170437de2201806cb30
84630 F20110330_AABQEJ sismour_a_Page_123.jpg
bd687d955b372978f74a654a88225230
5ae2304e54a04744f800bfcd68bcb1ac0cc77891
2072 F20110330_AABPZD sismour_a_Page_080.txt
9efa542890c7d8acd2f7362f76d4b28f
68e986daf4b1691c0d83ed841b6cbded335069ff
F20110330_AABQDV sismour_a_Page_111thm.jpg
120cbf6c226b987e684c396d96aa15d1
d3c96eea3ed1aab052165bd450fa79aaef97396a
1816 F20110330_AABQEK sismour_a_Page_039.txt
d74e2a95dbbffeaa81791a794ae7a19a
1967e19ccfcfef9beb10ced9fdc891f99d10d153
F20110330_AABPZE sismour_a_Page_120.txt
a2d5142541c9aa2c4d9bf4ec1f115fa8
7c6979443df6fb6ee4762bf77e7ac9c8a64d74f8
112058 F20110330_AABQDW sismour_a_Page_122.jp2
6653b3792644588977ca8daf7601dd3f
b565d364f529b384aa8231d383f3180f91ec649a
1312 F20110330_AABPYP sismour_a_Page_093.txt
b5d22d78418c294806a6f91a2d425cf8
45a1110e50ef77ee580269940a2ce8351d3f72f0
F20110330_AABQEL sismour_a_Page_016.tif
b086f1cf88cc151b79c9150beebf0c0a
0c821fbfd9d6743fb647357010a84e4ca66959d6
66521 F20110330_AABPZF sismour_a_Page_034.jpg
b7e533a63fae6c39b217b392c4e46676
cb0f2e7a72039bd1819e0dc2ee300526526b92ed
1051985 F20110330_AABQDX sismour_a_Page_009.jp2
e85447921e531bce36d9a7a407f3706a
1ca9b756f1329602d2f26f2b6e04bc25cce27787
16400 F20110330_AABPYQ sismour_a_Page_090.QC.jpg
0e4a46898326f798d9ead7deee130075
fb9313c1501800eceb34ff98c22ca30552344de9
21513 F20110330_AABQEM sismour_a_Page_034.QC.jpg
c372685a01a52186bda2ac0c782639d1
e8c68bb94498f59a014cf69385a80de50e4ffea5
F20110330_AABPZG sismour_a_Page_043.tif
28f3e7ebd2c8e66960b07490acdac087
914d8680ecb98a8d694f0a4eda959954492ddf55
5699 F20110330_AABQDY sismour_a_Page_091thm.jpg
72592ddb13c43c9c2523f9ab3ef5671f
7ea30f5b1243abca73e03a4fc0bc39dce0fe497e
F20110330_AABPYR sismour_a_Page_026.tif
caff26124f4dfa50271e3fc2b0528b15
2bc6dafb10d2c20dd8f1f45230d1fe0e85635bc1
F20110330_AABQFA sismour_a_Page_053.tif
e294aac6423ba43c9f4f64ace65c9758
a6da9da125b1367b6031c39af79580ddf415d097
23509 F20110330_AABQEN sismour_a_Page_110.QC.jpg
ea904747e6f16332b13e7d73f826027d
bd1b4f701d2083ff417c50fa50d88b773bedc087
52949 F20110330_AABPZH sismour_a_Page_079.pro
3b265023a7c3960a8654b65807ae04d8
b48d383de5408a4f9fb76cc699d5862b3b9ff8d5
5425 F20110330_AABPYS sismour_a_Page_098thm.jpg
be68ea199ebf76f149392d455cde360d
b9d90b212f679ec543848d5e9c76861fbc473df8
21352 F20110330_AABQFB sismour_a_Page_117.QC.jpg
e83e5714240c9fb76880425730d0a2e1
7fa635f824dffc14c32ea4d2e346155a5aa63e58
28100 F20110330_AABQEO sismour_a_Page_134.QC.jpg
41079847815468548683d024711ccaf1
bdc87531c7c33daa4cf6dd6e6a344b5158086d14
F20110330_AABPZI sismour_a_Page_107.tif
e71bec112380fb65a699f34f3041cbd1
98fd2f088daeaf52934d967ee2c75b80aae8ecaf
96930 F20110330_AABQDZ sismour_a_Page_129.jp2
2027de332f5c186f593d232d0d99afee
4c763c7b3b3b918d1248132cbf8fbd915c6bf14f
F20110330_AABPYT sismour_a_Page_095.tif
80f5daf3e30b8278a8b9503edfc07180
caaf244dc27cbd23f5db9b5c6b53edf15f7b4a5d
83813 F20110330_AABQFC sismour_a_Page_019.jpg
c8132d8d8579fa9cc6cffa12339b3bf2
89e9ee392d191e7d828d0076ff955a0d7105504b
6322 F20110330_AABQEP sismour_a_Page_052thm.jpg
eb4a0651798671972511dde50c9696d6
55c5502c6a1510e875a5c800dda333e870a2f87e
82099 F20110330_AABPZJ sismour_a_Page_025.jpg
460b0eddc8e8eab34d447308a2e8a16f
72cac1c9924a040676f9832e395a7d50737fb217
F20110330_AABPYU sismour_a_Page_001.tif
28eefd2403ec06ccdbed4542fedf8dcb
f37ce9629c8f27cd6a7c8e335d3fbf61b85cedf2
F20110330_AABQFD sismour_a_Page_087.tif
3125a4275cfe8da91bc44d11a6992af7
1f51412bc27e9308c6b5cb378e70d3124e8e5b5c
25004 F20110330_AABPZK sismour_a_Page_106.QC.jpg
afb709297c1fc067764dfb08bd1b8daf
e4eb51f1152203fc6c0f0c73b3d4365727f2fa01
101311 F20110330_AABPYV sismour_a_Page_045.jp2
6fa46eec6910c73806405f45cb1f2c80
cb7509097fe995d17166600af44f35421b7e60b3
F20110330_AABQFE sismour_a_Page_122.tif
9925159d34efe1609314e92645c099bf
3572e0081930e0300d9e77e54fd2b611a302df94
49083 F20110330_AABQEQ sismour_a_Page_038.pro
3c6b3555d2e3b9c783f4fe053eba3482
16047c0f2c7d8ca15ea9bb434f95a5f90505566f
21881 F20110330_AABPZL sismour_a_Page_125.QC.jpg
fda69b57a5cb843849563d4d75b04917
28763a8b69313af3e670429a33242a0f68fc9f7e
7952 F20110330_AABPYW sismour_a_Page_001.pro
8edd0440cf6b19bfeb4bcac79f0952fe
906540dbd8c5a97c5dd74e9acd1624a65866d055
F20110330_AABQFF sismour_a_Page_019.tif
58307f58f87af2b3ef0f1fef515c7ed9
7927d2029d6266b1d5f76ff08c27a98df090f648
F20110330_AABQER sismour_a_Page_127.txt
7a439dbd801698da6ddabfd962972940
0ed16920ee2fca8fd43c2a3bd929d9951c4f2196
16684 F20110330_AABPZM sismour_a_Page_097.jpg
6c22bd07f1f33d6181c51f824ea48ee0
793dc057ff531e14b50c48efedd638a12fba023a
6365 F20110330_AABPYX sismour_a_Page_055thm.jpg
63c932d118d95ef88923cc42a673fc44
8c0a317317d801d26fa4fc89dfb4a0bc0771b18c
4665 F20110330_AABQFG sismour_a_Page_012thm.jpg
6368d2dac27f90166c58c0704502baa4
a7e6f6bd53b30fa4bd30e2720421f6259ebcd50e
1772 F20110330_AABQES sismour_a_Page_061.txt
a5e5690db1e5afa79939b6009f6319f8
1a5c5303e36ba787f9202ab214dc1177c3523091
24247 F20110330_AABPZN sismour_a_Page_024.QC.jpg
13804ba4a4a425eca4e5ce5299140329
c9f356f5bfbf2ae331b98de9156c25dfb0586292
69189 F20110330_AABPYY sismour_a_Page_124.jpg
7ee4f8017af125a3c4e2022e4653d2e1
0797fbd41c59272e6739aac831f85f01853d0b3b
24758 F20110330_AABQFH sismour_a_Page_051.QC.jpg
047119736f2d1232087a0c84c37d8cac
b309011ef2f1e4d86fe23723d2ef67491ae49dd7
2039 F20110330_AABQET sismour_a_Page_031.txt
29b790230f39ccb54fcc85ba3092cc58
18e0242b62f6bf7c3e04812fc63f6f9de6079332
1278 F20110330_AABPZO sismour_a_Page_013.txt
bdf4fc64988dd3cbc353fcb59b77f9b1
18e28aef89f6c7b0c953fe496d9db87413ce8747
53091 F20110330_AABPYZ sismour_a_Page_130.jp2
6a6e6dcf18b44ca8b199c809022fb762
13ac8084577d8cb003b8c648dd51c80faafd72be
5872 F20110330_AABQFI sismour_a_Page_050thm.jpg
d16e0c0f1d042c38d9da970b245684f6
7467622ca4d8dfefe6703818c67db62e6e6b4cc5
F20110330_AABQEU sismour_a_Page_094.txt
f4bcf72046899a842ba4bdfed710c01c
088df103ece313aafc754dde1a67bec5093d6853
1999 F20110330_AABPZP sismour_a_Page_025.txt
f323c8bdbf522d8c993a84449d9fd07d
729b7565a6055016ba572881e679b2d86afc02a2
F20110330_AABQFJ sismour_a_Page_075.tif
2723356010f610529cbc0aa501ddd5a4
56055ead854a9e7a2ac1367629e92f431f48a15f
1800 F20110330_AABQEV sismour_a_Page_086.txt
45665b34b4c7c227b8497345b867ef84
c05925175b066ef3e4973d38bf86d8b5c612a5ed
F20110330_AABQFK sismour_a_Page_071.tif
cacbdc63c6aa813bd8556491f3d4b53b
6aca3267ab16a120974f2b37b462b00d6341c443
F20110330_AABQEW sismour_a_Page_009thm.jpg
17d7f82419bee245770030877bce93f8
301215ab825e2c1a272549ec802344198d782872
F20110330_AABPZQ sismour_a_Page_036.tif
cf63db771890da9d857bd7d98e9d3ee3
54016a1b935a9627db9d57430cd12d685c266afd
F20110330_AABQFL sismour_a_Page_015.txt
6e1c076a34f6ba8ce0c4425ff475980a
11d7d09c79aeedef2cd9b581a2a8477869e11cdd
71371 F20110330_AABQEX sismour_a_Page_010.pro
c6d2c28de8f428ff17ee309182f29239
64240a370af13b538a908d14510cea6f5ef7db50
F20110330_AABPZR sismour_a_Page_090.tif
c16e46ef0cc5a0d76553287844d0687e
a0cf2a97b1af6a6d984e290a05905fc99b0dfd19
74857 F20110330_AABQGA sismour_a_Page_087.jpg
cde42c67c0aeff9f3476c1ad4851a568
d92c591de2df4f901e0c6e96d447cc3fd3b8df96
25405 F20110330_AABQFM sismour_a_Page_140.QC.jpg
15c46dfd161a5565cb786018cd344b4e
be1959c253f70d5857131d946a16ea0d538d19b3
80858 F20110330_AABQEY sismour_a_Page_047.jpg
1596015d5835b975b322e919b40682ab
339b560058672819396348fe8087ac280927992d
22090 F20110330_AABPZS sismour_a_Page_061.QC.jpg
0e8da9518639f32fc1bb8e62551e674f
ec94f398d159fb4c779086b7dd7368ac0a4944c2
100168 F20110330_AABQGB sismour_a_Page_086.jp2
6046b12ec853df1451110ec88188ee1c
bed4c85c99c22d6ed79ed7bdeb0a3db312f32bd0
51362 F20110330_AABQFN sismour_a_Page_123.pro
3d5d9976ac43e9f65f9ebd617f00735a
d9f385df2830cb1834b9fcc493e80ea4c153c43b
65972 F20110330_AABQEZ sismour_a_Page_083.jpg
6b6971c0bf940fbd560128c47ee8ffd8
ac5a5e9f9e7fb6137af8abed2010857619483133
2069 F20110330_AABPZT sismour_a_Page_103.txt
5efb0039c62f6bc21e4ac94c7ee45997
32e6d79f48284bdb9a055de12ebae2747b87f3f3
26946 F20110330_AABQGC sismour_a_Page_080.QC.jpg
cda4c187690627142b4719ee931e51a7
00adefab786361f9c0449c87a85922ddd07ab14b
74686 F20110330_AABQFO sismour_a_Page_099.jpg
9270a15e8514546b00ef77f302e9ab8e
01cd2b406515f03d827741dd195bfa8020448ca6
82750 F20110330_AABPZU sismour_a_Page_121.jpg
c8b642ec13082aad53503594b600c0e7
1cd4e7151e281ddfc81e94b6b0fdb21f78be081f
5642 F20110330_AABQGD sismour_a_Page_048thm.jpg
0c83b901a8e794218f639a0d5dc4a4fb
1d689cdef6838b1bd11c2a822c902f62a506d73c
66151 F20110330_AABQFP sismour_a_Page_035.jpg
655025228fa77b2b902a7b8196e8772e
9202fe0eaa786933f211610e049edc419abfcd27
118 F20110330_AABPZV sismour_a_Page_002.txt
009ee319015788f279a9b2bf2a27f3b3
599b5717698294dae462e9aa4b740df0d1e0a66b
64260 F20110330_AABQGE sismour_a_Page_134.pro
6aa1ea6c651a4f7fe96810b387e701d8
8aa47a567af7af0d465b7d7bcd51623524cc9d62
1853 F20110330_AABQFQ sismour_a_Page_024.txt
f7bffb8eba54f057947d22eb295eabcd
8c87c2c39432a4a5b09366cce923d2e31edb36a5
75755 F20110330_AABPZW sismour_a_Page_030.jpg
8ef51f8f9ff661e88548107e44d245bc
7980b7acc65c06e884e6e3a0ee5d6eb38ac13d24
2302 F20110330_AABQGF sismour_a_Page_107.txt
acb286458d84bd638bb7bdcfb6df7343
1e986d70102504acb31938b1b77c9c2c32a44027
852029 F20110330_AABQFR sismour_a_Page_113.jp2
bea885fb8886ff25da64f57346f27370
f9a4e7374ca63564b7b36ed399e542ed331f1f5f
6324 F20110330_AABPZX sismour_a_Page_119thm.jpg
b0e19ef5b86c5487bce7366179eb1db0
e9bc95b5f91c731de6686c2c6f3976518f1fe299
95374 F20110330_AABQGG sismour_a_Page_087.jp2
74da7b5e93f3da91e316cb325aafef96
ac14560c892091d654e590fb20edce77a2c8696b
111409 F20110330_AABQFS sismour_a_Page_080.jp2
c428dd756125c6fa8c4150e5917d1216
bd87e2048ad3e34b67f2b9173a9ec46c2496bbd3
F20110330_AABPZY sismour_a_Page_109.txt
859e69bb05151f4c6fd0587a6ba7526b
f0dba7f66d14842205fc9c3220ed7e5b32353259
23810 F20110330_AABQGH sismour_a_Page_003.jp2
e2808daa48699e462546208bc861fa0b
19d03d13997265b2cdf3272bfb82f0d625171d13
1990 F20110330_AABQFT sismour_a_Page_019.txt
b9bb3768d6dc756b1b1a0ee44145fb04
d3d8f33157b53ba5e98fa2bf10825d7c4ab52e79
1998 F20110330_AABPZZ sismour_a_Page_035.txt
e1f546de503f7584e557ce71a990655c
038b6275a7bdb573dab30dd733b02e3014f057e3
69990 F20110330_AABQGI sismour_a_Page_070.jpg
2c77d500ff4e4f1349032313388e86f8
c1388dc8b67bdb7c93308405d9e2a40d1804253a
40494 F20110330_AABQFU sismour_a_Page_092.pro
078710da13b5dd6418d9a6e558bf665e
b015ca5e2b789da18ed2df0513332946fc366c36
6171 F20110330_AABQGJ sismour_a_Page_086thm.jpg
500e1666aa1de05da1f0b4f012b6c114
83b7e336f462bd3b8e1a4fe06b6c2b3d21b628d3
23799 F20110330_AABQFV sismour_a_Page_128.QC.jpg
55ab28b9144ad857672f200e01ec728b
6222470db060e69ddf6f943b051d0e35139f1ba1
22076 F20110330_AABQGK sismour_a_Page_001.jpg
61354e5d9427d0fe8e32842f6d18d839
740c5e6075c605ca82deb3e943c118c4b3be7d58
95944 F20110330_AABQFW sismour_a_Page_048.jp2
6b19fe022a8936f4f54b084ae24e932e
394279c5851a97aaeb3b81677930d9a6bfdea53c
120574 F20110330_AABQGL sismour_a_Page_138.jp2
fff06cff136002942c60dfb6418bc4b2
6ba6231270fef17b1be86f7ad3da211b1d1bc02a
6095 F20110330_AABQFX sismour_a_Page_120thm.jpg
b93e05a11bda24d31ff9df8f19d61919
f5b59fc9d6e0a79b28fef33aac4bc9b7266a2796
107858 F20110330_AABQGM sismour_a_Page_120.jp2
8d0fa98c4df5b5dd4524cde92ca9a5ab
91892330096f759440967290a10632763d817fe6
80823 F20110330_AABQFY sismour_a_Page_005.jpg
6425aeb71e76e4a570b7766813b4f5f7
7ddb81bfebe20fad8b50bf5f5b2152252e7fe676
5428 F20110330_AABQHA sismour_a_Page_089thm.jpg
067ae9f335692033e8beb58efe20641d
be0670cfe227c79cc6febbbcf02e2fb665084c2d
F20110330_AABQGN sismour_a_Page_113.tif
672231d41cb8d2d9094666544a51e578
574ee978ceafdce95665f1ee5158922c0e0deb35
77340 F20110330_AABQFZ sismour_a_Page_103.jpg
ae86dfc367866675995424f8c3a4e239
4ef2482c5309f787bdf85b5098c0bc2b8a1d1d98
1952 F20110330_AABQHB sismour_a_Page_095.txt
b50d190b34f92473e83f5106fde7eebb
3cd7dc57f9c9f3252ed91549fe50e2ce488b5291
F20110330_AABQGO sismour_a_Page_089.tif
47711e2623b39b3e22c342ed3f527ff2
cb206dc47f480f5f5a9ddbe3847c3beb03ca2049
14120 F20110330_AABQHC sismour_a_Page_011.jpg
2774df598ea3dc88680d57464d974122
34e7f17d4412d71b2f42d5c49128dba2e69c5b01
2145 F20110330_AABQGP sismour_a_Page_050.txt
fb18790f5b0c20baac4e08d14b8b8d2b
979b8faa1e12759aa26d657f6babc1ff2d7a336b
F20110330_AABQHD sismour_a_Page_130.tif
fc6d8bf3b2435b4d65fa4a1ffcb00d1d
a9247f5044512be67f6b2b0edbbe4d0343cbe8ab
77947 F20110330_AABQGQ sismour_a_Page_058.jpg
7fa1acf161bcf6b6ca9764eb65db0348
65ec73f334aedabd9b469513544924e3ad93442e
25647 F20110330_AABQHE sismour_a_Page_107.QC.jpg
2317433ed51940a6969c41548890a52d
838a627964421c482665392b7e6f579e03ba67a0
78800 F20110330_AABQGR sismour_a_Page_059.jpg
8e50820ca9f1976f4037929e1c53726a
3b71b74dfd1ed8ca39b148a6754f4ad780401a2e
22749 F20110330_AABQHF sismour_a_Page_113.QC.jpg
cd075af6d45d6465ba0be84e2aca2b8d
084d2219c4c114becff2a7161ad47ed99d27c6b3
F20110330_AABQGS sismour_a_Page_059.tif
5538ffdf50bec60492f2d162f0f54f3e
a9f2b6684319f88fc1c233486c8da5fdb9fbeb75
5253 F20110330_AABQHG sismour_a_Page_035thm.jpg
85eb4cb5d764dc45562d20422bfca8a3
6b9e8356886425e286f6a75eedaf56eb3328806b
F20110330_AABQGT sismour_a_Page_104.tif
4883bb77822329c9bd687af2bc3c3650
768c5197c8e4fc89aeaccda8a5bddbf48a42d7eb
F20110330_AABQHH sismour_a_Page_054.tif
27ed5d67318bdd11fe4ccae1feea2275
aa3dea50549855574d7840052e43b5dbe61c2efa
136858 F20110330_AABQGU sismour_a_Page_133.jp2
039a3c12d5f2b868f98f7464c45abfdc
2db2891e7084ed0107d10b8b96026f9ea7aa5330
19485 F20110330_AABQHI sismour_a_Page_004.QC.jpg
252a23babb1e141a0c95cec71df70698
eb8a4b25fb40ff26027fdee2091efb6df65a994d
4970 F20110330_AABQGV sismour_a_Page_066thm.jpg
d5bb4e7c273cfc03727b7335f7fbbb47
89336f6bdf6d942021bab6c2c434544d4af0d0ea
F20110330_AABQHJ sismour_a_Page_014.tif
7b35c3df023f20823267f21344113c2a
4b4f9479c9963b7f192f56ce98a0db729736766e
1982 F20110330_AABQGW sismour_a_Page_037.txt
3215640e6d19bafa7859b3ff6b77a281
0b588c2acb2152b0432f7568fd24f02eed204ff2
62897 F20110330_AABQHK sismour_a_Page_040.pro
e72f6046e613f58fb74109fceaa98527
a6a40b6b319dcbb4665f2a60c274630ce6a4e97c
59049 F20110330_AABQGX sismour_a_Page_009.pro
06d63509b9180ffd22489e6d1322fc1d
8c3c144c6888a26f6c85a44b110f6661d5657dbf
6366 F20110330_AABQHL sismour_a_Page_060thm.jpg
f44c3f55ff28f1430781bdb289ac655e
78ce51d0f14f87258e6816c2aa15845047ad1c90
5372 F20110330_AABQGY sismour_a_Page_014thm.jpg
1a87c265b86cf62ed7529132b5187cf3
1789bd213ed26511808d5ab0a6d7adc960d0e8f7
6561 F20110330_AABQIA sismour_a_Page_136thm.jpg
be1533272ea5526ed0f12b7ee592eef5
33eb690eff4633a14665fdad7726550975924eb8
18355 F20110330_AABQHM sismour_a_Page_005.QC.jpg
969c53a7680d1894e0c04647f830b9e7
cf8ca4a8b80b301845640c75966909100327a264
5979 F20110330_AABQGZ sismour_a_Page_018thm.jpg
cd419f0fcceabaf2df72dface3e8ac47
813a5fe1e3b986e198171a6d00cdfa24fda06ff2
1843 F20110330_AABQIB sismour_a_Page_026.txt
bec05af11a248ec9fea1da95042a0c91
4cdfd81241dda2c11de69d149f3eebb8f6363c4c
97438 F20110330_AABQHN sismour_a_Page_135.jpg
4a7a06ec14b0e818d6096ce95bb06189
37baa551d4aea2d3d268aa0e7608e4e73b115947
40418 F20110330_AABQIC sismour_a_Page_102.pro
c33c3a74728c741333a50ef1fdcc2d03
8105305e7acc475688b7dbfb9e7c3f01beaa671b
20961 F20110330_AABQHO sismour_a_Page_070.QC.jpg
6b9f4337b01be8c08a4886f234f0ba5a
1345a1124d0f23f9ac3da95d98a98bd9011cc851
1918 F20110330_AABQID sismour_a_Page_128.txt
c22f1ba83feb88a65701b7f2bdb2f4d0
16cd855c10261a094cb5d0dbf3227b858e37d335
F20110330_AABQHP sismour_a_Page_062.tif
43e8c126b2501c0e3d49e6528df10bb9
4dabc52502b20e9431f7485937eed3b24f8d4842
24959 F20110330_AABQIE sismour_a_Page_050.QC.jpg
b55bed08618b73214fef9fbbf8a8d3cf
6649a0f3c2fdd897a9907eabace7a967d9620675
F20110330_AABQHQ sismour_a_Page_006.tif
0fefa36c364bed99490db2bc3c46965a
eb02783442adff7b9abe719a8c8afeb40d51f4ee
F20110330_AABQIF sismour_a_Page_116.tif
93005b5be144e3c70e4a2c42686ce2b2
711a19bf54bc7f0432ff0192425d2a90b50a0196
28214 F20110330_AABQHR sismour_a_Page_008.pro
f9a06bdbaaadce53cbcd770b7edb8a0d
8e6b357a958b24507218904545b8278e060c130c
316 F20110330_AABQIG sismour_a_Page_011.txt
0dbc4a32c65779ea9f90ce0e20bbe699
d91f6694f91aff504743ca9a08eb1e9da793f01f
51919 F20110330_AABQHS sismour_a_Page_031.pro
7fd4215ecc8973107fc92f5bab651d65
07ea91e3f3a98902d606db51de3df884277cb98e
26683 F20110330_AABQIH sismour_a_Page_138.QC.jpg
1b19ac8d6d10aaf9fde0214cd8043259
1b21839c60ec2ba5578d2519ceec5ce0ac992e69
F20110330_AABQHT sismour_a_Page_040.tif
6588851200adad23b8b314027debf84c
58cc3b35d16e91e1c7651acf478610856fbbc61c
21354 F20110330_AABQII sismour_a_Page_063.QC.jpg
36830b7508675ac6caca6b60e31f8794
3c54bea90f1494c9315f59336ee39ee95e88d740
44833 F20110330_AABQHU sismour_a_Page_128.pro
99fd8a8817f63100c849dd90d103329e
44674e46eb24268d1353f45aec0c6063b70b7421
2297 F20110330_AABQIJ sismour_a_Page_138.txt
409f18af490a9501e09c9980cc078400
3e0ce0621e9dda00b4341860f9b73656dd4ff615
25315 F20110330_AABQHV sismour_a_Page_052.QC.jpg
4ab4c74f4884bff4b289b3571e2dfd62
78292e99a1a33947f73bdfa47eb53f4d295ceb91
50486 F20110330_AABQIK sismour_a_Page_025.pro
38665a61b898009065d22bd8fa603acf
4e4b7cf702c3523e9198a71fc324435910bf1bc1
41638 F20110330_AABQHW sismour_a_Page_032.pro
e744dd51a9a2f31548c8712d70ee5b03
8276ae18e9efeb3f5e8f74461e78b199c7f49d96
5930 F20110330_AABQIL sismour_a_Page_021thm.jpg
60f9b45d8a8b0a03bac91cff74d15577
a89bb6746f98c56831ec86d2dc1e3f0ecc902915
99199 F20110330_AABQHX sismour_a_Page_115.jp2
8f17c521522419eda210dae5cb1f2931
70b6fec87162670600667178616478b30e0a2049
102691 F20110330_AABQJA sismour_a_Page_111.jp2
b1228b8562d0334761fc5a86aed2066a
1bb56112660936b75df36db0b0d8dfd207f197a2
52666 F20110330_AABQIM sismour_a_Page_080.pro
fb0b7197b41bcaf118f2d0b4ffbc518f
7aae8f72c518f337d348cc66f34f1e4f66a16bc6
1051958 F20110330_AABQHY sismour_a_Page_006.jp2
290e7acf14a3d10cc30ad63c13b23ae5
ac693abaff47f67d5f87054975da4346271c4501
31605 F20110330_AABQJB sismour_a_Page_126.pro
bfeb9aad79f768b249909f570b7652ca
b40bbd9506da2f09679b560f902b27da271cf38b
2681 F20110330_AABQIN sismour_a_Page_139.txt
1bf70bdaccf1dad6aecc99788d721d28
f5e3e56924225d16744daae163ab8a64bf305692
1851 F20110330_AABQHZ sismour_a_Page_129.txt
377099ed143c84ee67a318a8bcb7c2a9
96b9b3ca94ccb0d73ab4c86dc8c2fcb87f3af5ec
22598 F20110330_AABQJC sismour_a_Page_033.QC.jpg
917754246b83669e6ce12bdf204970f3
942d4f3bc763207f0311ea6389c6b438dbf85da2
6296 F20110330_AABQIO sismour_a_Page_016thm.jpg
d348c3d971a80f4ea8cfbdf698c365fe
c4e44b4a8e92dd5541da3404d11dd74219478970
64919 F20110330_AABQJD sismour_a_Page_071.jpg
51c6a64c914ac248f1844fbf1a74ad55
3f2bf86b19e36b19b9017c310101274b9e538d36
26256 F20110330_AABQIP sismour_a_Page_060.QC.jpg
94537bdd7d0dfac60b4c0510eb939660
b790d3cbed0350fb1158a416cd4d3a70cc56729d
81615 F20110330_AABQJE sismour_a_Page_081.jpg
d5805937dd55016410240929a66f6735
7b018988e94b8cef31e0e93a58a64cec19f9f3c3
6772 F20110330_AABQIQ sismour_a_Page_134thm.jpg
f954f06f3195def08867b11c032dd205
e593bf21467ba4e2752919bada9cea613227cb6f
66138 F20110330_AABQJF sismour_a_Page_139.pro
6455cc46f11655da79ad70cebf7a1883
c9d9e65d330f08dd260a3fac884c1af4a5fc756c
1833 F20110330_AABQIR sismour_a_Page_049.txt
81d79a21dafcb7dc4162add0e16f234c
10c5779f8f38475d640a5f97572a8404030b7b9c
43418 F20110330_AABQJG sismour_a_Page_033.pro
a8d4e1a3984ec5f8b8ea44736e2fd0a3
30cf762bc23f7c381bea961f34a6453d90309769
6221 F20110330_AABQIS sismour_a_Page_080thm.jpg
20a4cbd285998b40d42b66c65e1471af
b3d22999f6bfcfa96529ccc38359ad8d7b3c996a
81167 F20110330_AABQJH sismour_a_Page_095.jpg
70997ec249b1ddb5f58e127567e36626
44dcd244be5957a577879e2d4902e22d3d6c3b42
5600 F20110330_AABQIT sismour_a_Page_112thm.jpg
145aab138095f03fe920e1841c9ab566
9d40d461dead9f70e7b651cddeecfefbfab6bb78
85715 F20110330_AABQJI sismour_a_Page_069.jpg
ee012517e76fce058a6b29761bab442b
ade84a622b409d726b679e645c854e69eed31baf
2474 F20110330_AABQIU sismour_a_Page_064.txt
1670f0cef76dc319481ebb969705a5cf
93347c48490fb2866cece0567431248609058304
5781 F20110330_AABQJJ sismour_a_Page_002.jp2
aa3597ac35cf07b67bdf949879b8cf1b
de34e2a579d8ce076290fae4e70b42c14da1c78f
6210 F20110330_AABQIV sismour_a_Page_106thm.jpg
5a4c681436028e81fea13e5f0c045b7d
e9edf487658fdf7d7d5d26d2c635ca5e9139c460
47130 F20110330_AABQJK sismour_a_Page_104.pro
13acef4b29be81f7c4de0b9c875174fb
faa06fa6e217023098bf25d4a2f3f317d1798789
5864 F20110330_AABQIW sismour_a_Page_044thm.jpg
e606fbc35379d2ecce9fc31ceb496b7c
79cdca7029776eb54a50e122bbe427669a4066e5
4318 F20110330_AABQJL sismour_a_Page_126thm.jpg
deda63c121402dac1992b2e7156c7552
92a751d94b802c2048189f5fa960799e88ada986
89595 F20110330_AABQIX sismour_a_Page_036.jp2
f1ae85da9db4b6969b902209e32460c5
cd26b18f659a1a50321dd9593001811990007a52
986669 F20110330_AABQJM sismour_a_Page_065.jp2
04138d7eccf720af38358e9009e41872
7a0b7eb7abaf4e15fd50f4ca53cacd4f32804c05
25078 F20110330_AABQIY sismour_a_Page_111.QC.jpg
22c33a8ef22ebdf7ce9bd2fc5d7e46ba
3c8aecab289938ddee5a3070a3e7ea1816793038
6441 F20110330_AABQKA sismour_a_Page_135thm.jpg
bd1df15dfc60d47347e83b6f859d7b13
658b817214f1202091119284166d902c7902d2c3
F20110330_AABQIZ sismour_a_Page_109.tif
b5b4a2002e6f00befaf147929566c7eb
f6f9fbb18a764882b9f3662b4727b56fb9e6e215
F20110330_AABQKB sismour_a_Page_041.tif
de7e69f53a730b4393907c08caf395a9
9ababc781e201189ab80d0e9bd58573358827e4e
F20110330_AABQJN sismour_a_Page_030.tif
d0bb5b26ca8854264eb8bc3749c8c394
09712cb81379621b4751e4f3da2a5b694f5270e1
44288 F20110330_AABQKC sismour_a_Page_129.pro
eb28337befe6f4a7bacb514fd10e67af
357ce4dcd63ecca23c72cffe43e9b00cb42f5395
1733 F20110330_AABQJO sismour_a_Page_001thm.jpg
1619e180f3adc11c6c62d06bd1ba72f2
bbccb9809134ee5ca51503a977e6465393993d17
F20110330_AABQKD sismour_a_Page_108.tif
71c6dff571d5578dd1fc7b6e70dc6a68
f33983ec6ca712c9bce4a6389c0ed4193d95aecd
123087 F20110330_AABQJP sismour_a_Page_119.jp2
c2e342b10fa156eaac2c64280dbd0989
7de7c496aa0c039bfb1377b35284e1fe43f0a143
8582 F20110330_AABQKE sismour_a_Page_097.pro
30efa7d371434bff5b80d2186b54e4af
c3038fc8ebfa24b8f93d497bac0060a2064c7f86
F20110330_AABQJQ sismour_a_Page_111.tif
315f433bbb8e7d3bc38a0da982d0579f
4f1cae9cea99893b6c2cc5699475acc364719eaa
890 F20110330_AABQKF sismour_a_Page_027thm.jpg
ad85ee3ce2db8161a8a2edb1b1f16255
7f7be8cdc460df7958f487fd2de56b20ed6cf17e
6157 F20110330_AABQJR sismour_a_Page_051thm.jpg
dc29cba748d5858d11bef2517ab0e041
9141adcc3bd42ddf9820bf01e5df6f8df335a061
1697 F20110330_AABQKG sismour_a_Page_014.txt
0c32369f82e402e739b228bb51f5eb04
3d35c5410ff2eff4e0b9cccb934c29a3b2ea3cd2
1051977 F20110330_AABQJS sismour_a_Page_072.jp2
2ac92f89589c99232a667a2286c381e4
fac7e15ecc919103e3870abd378a9d8934c37674
1000878 F20110330_AABQKH sismour_a_Page_038.jp2
2a32172cd403606e332f516069cce234
0b7c18eb99c17bc45c62a1e49cfc47bf1e76b72d
106815 F20110330_AABQJT sismour_a_Page_106.jp2
ee2711dc3b884ee44b329b355c3143ea
de7d0939b806d9ba167bbb72041404a85f8f4458
10577 F20110330_AABQKI sismour_a_Page_141.QC.jpg
6a990ce62aa904827d03f972412626d0
9de092c8a1847f2c54d09f46e9692c7b7ff54f2a
21081 F20110330_AABQJU sismour_a_Page_014.QC.jpg
ff465b9b2c123356a1449682fd714f00
a59a7bf9be4a3b8e5b329870c552b5f9eb569fec
105220 F20110330_AABQKJ sismour_a_Page_095.jp2
5e9b528976d46d9d08c26b7b5f6f0e92
9e4ebc38a598f44c3254d0c10fa46063bc9d05a5
108581 F20110330_AABQJV sismour_a_Page_139.jpg
ed1b552bbe2d8346d9c634872478a439
464139a6576b4c257296087e3282c6eb0ec564d3
22992 F20110330_AABQKK sismour_a_Page_099.QC.jpg
685d6a1ce852597a108f44bd33041e94
2916578557854aa9b99d22a65d37df05b791fcb7
42232 F20110330_AABQJW sismour_a_Page_088.pro
ba2b97f18687515434f4b9f8b0f751ae
c5c8eefcaee6c6f419cb7159e96c1c78acbdb8ac
F20110330_AABQLA sismour_a_Page_002.tif
27bea15ca6f4c4c9734eb1710020c418
a582882a4ec695f5e539d0a34d55ba9be5af2192
42904 F20110330_AABQKL sismour_a_Page_087.pro
0f8f89e128a5f770ce8ffeff586d5671
cedb7cc4b5811b2bf71726a983cb6379ea39c7e7
81544 F20110330_AABQJX sismour_a_Page_051.jpg
f3e294cf888f93c8468f4ad591238225
1988fdf50e1b7ab09810f74f33d00f6c20495937
76892 F20110330_AABQKM sismour_a_Page_046.jpg
02b67f3edaab0863ab6f3afbdec3fec3
a0a1e2addfe8dd06a51c9bd8fd670e4808379863
F20110330_AABQJY sismour_a_Page_079.tif
68acae35440178857d02c47680dd6bb6
4bc021008d0a9b69b2cd293d09894e36df201365
F20110330_AABQLB sismour_a_Page_003.tif
0067da712fb725e99ce90bccccdc8ed7
6c1b3757a43295d9f3cb63dd85e645c237c7b025
274691 F20110330_AABQKN sismour_a_Page_011.jp2
5075180b87bed9b45b2263a5dd841fb3
d064c26c0320f202f77ad867f0ad45cccf64b32a
5727 F20110330_AABQJZ sismour_a_Page_047thm.jpg
fd3c8d4ae9eb1813cd883121de9fb75a
be293294ca998a59515f6f348ec3e00a401d3f64
F20110330_AABQLC sismour_a_Page_005.tif
a5daebd53a8d6025d1cb4b2df2f65f89
c505eafd6cc4498ea37465ad0440f1bc9444b999
6127 F20110330_AABQKO sismour_a_Page_077thm.jpg
d80ab4f33d430273e5e050b271ddfd94
02407da103805362a22c9745fece70302e61d3fb
F20110330_AABQLD sismour_a_Page_011.tif
ee3f9c3b00e28f40ccbccb977dd6e5fb
fa8e01989888e9dce2ef10bff679073ba326a149
114066 F20110330_AABQKP sismour_a_Page_079.jp2
2d5cc8ab1c298cabf64e3d055cabe546
edd55e852a7a3cac5aa9bb7368c960aad1b1eb99
F20110330_AABQLE sismour_a_Page_012.tif
851e0afe84cbfc29389e3d9d9bd72735
295ae8908f93a19a0eac672df8add529d6dcd639
108986 F20110330_AABQKQ sismour_a_Page_057.jp2
0af731fb5282326429a7772005050140
8ea1ad57eb736efa6f1d34dc92cc411d954f131b
F20110330_AABQLF sismour_a_Page_015.tif
5bc2560ce0c9f0dfcc59ce5638595f4c
3d59e90b5e9424e8a4272ee322c478463c2e027b
1352 F20110330_AABQKR sismour_a_Page_090.txt
d185771a8e69535fbc8ff136e153ea3d
f073aa4222a759920f62632aae75fc2eca1acbfa
F20110330_AABQLG sismour_a_Page_017.tif
bcf9ac098089012e8f54049904fe6c8b
1a3d32a069eef3834618f59ccfc873acecdef5a2
F20110330_AABQKS sismour_a_Page_007.tif
4aeb994550584aefbf1362a6a9e5daf0
f263ec231338dbc52c66c410a2503313a8ea0443
F20110330_AABQLH sismour_a_Page_022.tif
16639614b45abe6dbf30e8901ab98525
50a80253dff66b6bde437274cc98a151d9c398b8
1051923 F20110330_AABQKT sismour_a_Page_063.jp2
45b728e042ca8e4b6dd334de25c6e777
43c445d9ece4e93bdb84f8dc0eca1e20a17f592e
F20110330_AABQLI sismour_a_Page_033.tif
2cd70e439f3cf408ee7ed37a7e075906
d5ca18d1fcdd1680c8fc315c079aac2118184fc5
5098 F20110330_AABQKU sismour_a_Page_071thm.jpg
d1f7606b8b6055d05709df823d871bbf
db10b1021744e0b51f6f1f9c3d2620a320c66e9b
F20110330_AABQLJ sismour_a_Page_034.tif
2ae3eab7590c5511c34b7ba03ebef239
9ebbb5147917d1e2fd65301b01b6edcd0e8102f4
43915 F20110330_AABQKV sismour_a_Page_091.pro
0ed454f6f63a8888ad4ed1b21ee12562
1172ea3d33386d4b6f6fee217461ae5efc57f25d
F20110330_AABQLK sismour_a_Page_039.tif
2995f3d89a245ccbf36ae0002b909912
64fa186b87f80facd35e5cd91a2c396168172bbb
112468 F20110330_AABQKW sismour_a_Page_031.jp2
5bd8b5de120b4bcb493dc7aa24b2505d
7371eecb5b1d4f28b924b3891d339c82bf914b7d
F20110330_AABQLL sismour_a_Page_045.tif
7ca44702058679278f2584c502e26b48
5e44e31a5d72c8a1e1574f46af1dfab122a5ebb2
228134 F20110330_AABQKX UFE0012925_00001.xml
7c1b2296b7c18a121375dc562e776d2f
bf71a4bf653293af75146014ebf10b0e472bd435
F20110330_AABQMA sismour_a_Page_084.tif
26b809697030b7388a499bad715560ae
91405bea1c5b76dd06bfc5d385e82def7372f5d4
F20110330_AABQLM sismour_a_Page_049.tif
3a484979bf2564f538bb38f62f2005f7
07a4eb2c8e4ff73e4467d7d7c72192753b494235
F20110330_AABQMB sismour_a_Page_092.tif
b8d980cc43599b7287ddaad30a1c78fa
90f556379e667de42fbfa764f50765615225eb6b
F20110330_AABQLN sismour_a_Page_056.tif
b2a8d11371c0262f44dafd854e139ab5
b1c98a0b511666364695e973c8a6c29d6b9c2c0f
F20110330_AABQLO sismour_a_Page_064.tif
5b04594f27b8b1d412dccceab00d056f
7de0779ee010d062a3e99317a1aff7b3927ea8ca
F20110330_AABQMC sismour_a_Page_093.tif
b96d086f45c9f85dab0b1ae9c80a7015
09df9e6de88602805e644a2e804fbeaab4c4ac0f
F20110330_AABQLP sismour_a_Page_065.tif
eff7f34a003a2a1e111091e8622447ba
b2a67437e24e8622913985ca76d5139888dfe8f9
F20110330_AABQMD sismour_a_Page_094.tif
c8bda8fe5cb703701c05a316f62dec20
2fbf75cda7402642cf923046b58d19e09ad095ff
F20110330_AABQLQ sismour_a_Page_066.tif
f5174eb507eac869f5324866ff5e5f13
aba5ff2ef9e383100eb419280699c13a3def69af
F20110330_AABQME sismour_a_Page_099.tif
41c80629d1765fb34566147711844921
61887e9ed6cb9eccf0aa02844c522e32cd5da533
F20110330_AABQLR sismour_a_Page_068.tif
7307d9e9e50e601a70932c6b3052d365
0d57fb29600c30fd4b19fa630fdfc9cc01ec972c
F20110330_AABQMF sismour_a_Page_105.tif
a803d82171ae4dfe266c8e42fbc8b413
09dbe2028d309b3e4048ff1e4553cd96cadfcbb9
F20110330_AABQLS sismour_a_Page_072.tif
5fe346dd74a35d1925587f2f28db6121
53066e2a62a5cb490f827064941705c98eb341e2
F20110330_AABQMG sismour_a_Page_110.tif
a64a6d4f90505296d96bafcd4961744b
751c57511315fafb192ea9ee74a4cdf016130978
F20110330_AABQLT sismour_a_Page_073.tif
2964ef533124b3ea380e2cebbf3d2136
5b9dc5c1dc4e9632e9a5ebbbf2cf100bf5a59350
F20110330_AABQMH sismour_a_Page_114.tif
f290eca336746e37744a70f6b70f60eb
68620542f61787a48169f8ff2c5d7c3bd88fe870
F20110330_AABQLU sismour_a_Page_074.tif
07822d8bbdd437c1d9be90570c4e82d4
9fa1160e1eb3ad779531d5394f3946ebc814b3db
F20110330_AABQMI sismour_a_Page_115.tif
40e0aa25c3ae2fa50bfdc4825afa3c15
e95ab387f970c69cdadc1f9466a79ad33f62b0ab
F20110330_AABQLV sismour_a_Page_076.tif
bbd28dfed1b3a567a8971b5fb308b645
569ebd889f06aa14e4219733f1eaae14f47abbbb
F20110330_AABQMJ sismour_a_Page_117.tif
d0deef4ce9bc679a5aa9aa77ec75a38e
b92c4582aca8bdbe9b67b072f08b14f665bcb622
F20110330_AABQLW sismour_a_Page_078.tif
f1537063186760826258c8b1bb4fbb79
22c8928752a19766cd452d924aac3504e3e96e26
F20110330_AABQMK sismour_a_Page_123.tif
7ea80458da395d5986a34a0257722627
ef26f6b683ad10b8e7eaaf6925e13bef2f9664dc
F20110330_AABQLX sismour_a_Page_080.tif
d9e7caf38b80e64385170e4f09d5baaf
6809eaf571b25f3f90bb465254c8b3d6e7b34d32
2248 F20110330_AABQNA sismour_a_Page_047.txt
7442e30792f364f2d61f8c5817b4bee5
7cd247c3239e3ebd3a8dbd1b7e3bea7ecdb20fbc
F20110330_AABQML sismour_a_Page_124.tif
8d6dedce4d99882b0ccc4d158e5fe73b
8b12cf61fb3841fec0e3fdfaa1648ad00717b63b
F20110330_AABQLY sismour_a_Page_081.tif
0c61fa76267f7e22c1ed9fa624149fa6
b91981eccc350835d9e2ba0fbfa11d10d84677b5
2002 F20110330_AABQNB sismour_a_Page_048.txt
844aa927e25e1d41db5e4f37f7d647e1
b5b08c70a37ebfb75e296c66763b6a0cf7d341ce
F20110330_AABQMM sismour_a_Page_126.tif
a101a82d06c2e9cf151b665be580ea26
9589023af1c69782a76851bc611eaa936f444aab


Permanent Link: http://ufdc.ufl.edu/UFE0012925/00001

Material Information

Title: The Design and Synthesis of a Genetic System for a Synthetic
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012925:00001

Permanent Link: http://ufdc.ufl.edu/UFE0012925/00001

Material Information

Title: The Design and Synthesis of a Genetic System for a Synthetic
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012925:00001

Full Text












THE DESIGN AND SYNTHESIS OF A GENETIC SYSTEM FOR A SYNTHETIC
BIOLOGY
















By

A. MICHAEL SISMOUR


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005


































Copyright 2004

by

A. Michael Sismour





























This dissertation is dedicated to my parents, Albert and Linda Sismour, in addition to my
grandparents, Albert and Eleanor Sismour, and Robert and Mary Lou Mayer. These
"precursors of my genome," parents and grandparents alike, have contributed to my
nurture as well as my nature, making me a firm believer in the parity between the two.
My accomplishments would not be possible without you.















ACKNOWLEDGMENTS

I would like to thank Dr. Steven Benner for the guidance, patience, and the research

opportunities he has given me. I am also indebted to Romaine Hughes for her support,

help, and friendship. I would also like to thank Dr. Gerald Joyce for his help, guidance,

and training, in addition to NASA Planetary Biology for the funding my studies under Dr.

Joyce. I could not have completed my research without the help of a very skilled

undergraduate assistant, Nyssa Puskar. I thank her not only for the help with my research,

which was exceptional, but also for her help in making me a better research mentor.

Lastly, I would like to thank all members of the Benner research group for their help,

guidance, and friendship. I especially thank Alonso Ricardo, Theodore Martinot, Photon

Rao and Jeong-Ho Park for their friendship (and many discussions over a beer), guidance

in organic chemistry, friendship, and guidance in molecular biology, respectively.

I would also like to thank all of my friends who shared my matriculation in

graduate school. I would like to specifically thank Jeremiah Tipton and Shannon Green

for their friendship and support. I would also like to thank my family, including my sister

and brother, Katie and Rob Boyd, for their love and support. Lastly, I would like to thank

Caroline Pawlak for her love, support, and understanding.
















TABLE OF CONTENTS
page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES ......... .. ...................................................... .......... viii

LIST OF FIGURES ......... ......................... ...... ........ ............ ix

ABSTRACT .............. ..................... .......... .............. xii

CHAPTER

1 SYNTHETIC BIOLOGY .............................................1

Background and Significance .......... ........ .............. ....... ...............
Methodologies of Biological and Chemical Study.................. ....................
Synthetic Biology D efined ............................................................................ 5
Synthetic B biological System s ............................................... ............................ 8
A artificial G enetic System s......... ............... .................................. ............... 8
A artificial B biological C analysis ................................... ................. ..................11
A artificial L ife ........................................................................................... .... 11
R research O bjectiv es.......... ................................................................. ......... ....... 13

2 DEVELOPMENT OF ARTIFICIAL GENETIC SYSTEMS ..................................15

In tro du ctio n .................. ...................................... ............. ................ 15
Properties of DNA and Genetic Systems .........................................................15
N oncanonical Base Pairs .................................. .....................................18
The pyDAD :puADA Base Pair ......... ... ..................... ........ ................ 21
T he isoC :isoG B ase Pair........................................................... ............... 23
Properties of D N A Polym erases................................... .................................... 26
M echanism and properties ........................................ ....................... 26
K inetics and fidelity ........................... ...... .............. .......... .. .. .... .... 27
Polym erase A says ........................ .... ............ ........ ......... ..... .... 32
Standing start reactions ........................................ .......................... 33
R running start reactions....................................................... .... ........... 34
M inus-E xperim ents ................................................... ........ ............... 35
Polym erase chain reaction (PCR) ..................................... ............... ..37
M materials and M ethods ........................................................ ............ ............ 38
pyDAD:puADA Experimentals............................ ...............................38
Synthesis of non-standard nucleosides............... .................... ...............38


v









O ligonucleotide synthesis ........................ ......... ........................... .... 39
Expression, Purification, and Activity Determination of HIV 1 RT............40
R running start reactions.............. ........................................ ............... 41
Standing start reactions ........................................ .......................... 42
PCR amplification ............. .................... .......................... 43
Fidelity assay ............. ......... ............................. 43
Paused-extension screen......................................... .......................... 44
IsoC :isoG E xperim entals ......................................................................... ..... 45
Oligonucleotides and enzym es.............................................................. 45
Prim er extension reactions ........................................ ........ ............... 45
D irect com petition reactions ............................................. ............... 46
PCR am plification ......... ................... ................. ..... ............... 46
Acid cleavage fidelity assay ............ ... ............ ....................... ............... 47
D ata an aly sis ............................................................4 8
R results ......... .............................. ............... 48
pyDAD:puADA Enzymology ......... ................................................ 48
isoC:isoG Enzymology ............................ ............... 54
D discussion .................... ......... ............. ................................60

3 LINKING GENOTYPE WITH PHENOTYPE.......................... ................... 63

In tro d u ctio n ............................... ................. ........................................................ 6 3
The G enotypic-Phenotypic link......................... ... ......... ............... .... 63
Linking Genotype with Phenotype in Artificial Genetic systems ..............64
N ucleic A cids as Catalysts ............................................................................ 65
In vitro S election .................................................................. .. 6 6
In vitro selection: a tool for generating catalysts. ......................................67
In vitro selection: a method of study ............... ..........................................68
A E G ISzym e Selection................. ......... ........................... ..................69
Linking genotype with phenotype..... .......... .......................................70
M materials and M methods ....................................................................... ..................7 1
O ligonucleotide Synthesis........................................................ ............... 71
D N A zym e Preparation ............................................... ............................. 72
In v itro S ele ctio n ........................................................................................... 7 3
D N A zym e A activity A ssay ........................................................ ............... 73
R e su lts ...........................................................................................7 4
In vitro S election n ........................................................................................... 7 4
In vitro selection .......... ..................................................... .. .... ...... 76
D N A zym e A activity A ssay ........................................................ ............... 80
D iscu ssio n ...................................... .................................................. 8 1

4 FROM SYNTHESIS TO KNOWLEDGE: UNDERSTANDING DNA
POLYMERASE ENZYMES THROUGH THE SYNTHESIS OF GENETIC
S Y S T E M S ......................................................... ................ 8 5

In tro d u ctio n ................ ....................................................... 8 5
What Have We Learned? ........... ................................... 85









Polymerase Substrate Interactions................ ................................87
Interactions with the primer terminus: "minor-groove" scanning ..............89
Enzyme-substrate interactions in artificial genetic systems.........................92
M materials and M methods ............................................................... ....................... 95
O ligonucleotides .................. ........................................... ... 95
Enzymes ............................................. ...............95
Competitive Insertion of Thymidine Analogs...............................................96
D isasso ciation A ssay ........................................ ............................................9 6
R results ..........................................................................................97
D isassociation A says ........................ .......... ........... .... ..............97
Disassociation Assays of 3-deazaadenosine.......................................................99
Competitive Insertion of Thymidine ..........................................102
D iscu ssion ................................................................................................ ..... 103

5 C O N C L U SIO N ......... ....................................................................... ........ .. ..... .. 105


APPENDIX

NON-STANDARD BASE PCR GUIDE ................................................................111

B a c k g ro u n d ......................................................................................................... 1 1 1
Literature ................................................................. ............................. 111
O v e rv iew .................................................................. .................................1 12
P ro to c o l ...........................................................................................1 1 3
Primer/Template Design ...................................................... 113
Picking an enzyme: Initial Screen ............................................................114
Standing start reactions: qualitative incorporation ...................................115
Standing start reactions: extension ............................................................116
Picking an Enzyme: Fidelity ................................................. 117

LIST OF REFERENCES ............. ..................... ........... ..................... 118

BIOGRAPHICAL SKETCH ................ ........................... 128
















LIST OF TABLES


Table page

2-1. Properties of commercially available DNA polymerases. .......................................27

2-2. Oligonucleotides used in experiments with the pyDAD:puADA base pair.............40

2-3. Oligonucleotides used in studies of the isoC:isoG base pair ................................45

2-4. PCR amplicons.........................................................47

4-1. O ligonucleotides used in this study................................... ..................... .. .......... 95

4-2. P olym erases and buffers ............................................................................ ..... ... 95

4-3. The velocity of insertion for 2-thioT and T in direct competition......................102

4-4. The concentration dependence of competition assays. ........................................ 103

A-1. Reaction setup for standing-start qualitative reactions. ........... ...............115

A-2. Standing-start extension assay. ................ ............. ......... ...... ......... 116
















LIST OF FIGURES


Figure page

2-1 A peg-in-hole model of natural and expanded Watson-Crick nucleobase pairs......19

2-2 Chemical structures of the Artificially Expanded Genetic Information System
(A E G IS ).. .................................................................................2 0

2-3 The hydrophobic base pairs, using steric complementarity for specific pairing,
developed by K ool. ....................... ...................... ................... .. .....20

2-4 The self-pairing hydrophobic nucleobase pairs developed by Romesberg .............21

2-5 The acid catalzyed depyrimidinylation of isocytidine. ...........................................23

2-6 The Keto-Enol tautomeric forms ofisoG and G.. .............................................. 24

2-7 Steric exclusion of 2-thioT-isoG base pair.......................... ................25

2-8 Chemical mechanism for addition of a dNTP by a DNA polymerase....................26

2-9 Kinetic mechanism for dNTP incorporation by a DNA polymerase .....................29

2-10 Standing start prim er and tem plate...................................... ......................... 33

2-11 Typical PAGE analysis of a standing start reaction..........................................34

2-12 Running start primer and template. .........................................................................34

2-13 R running start reactions............................................................................. ..... .......35

2-14 Experimental design of a minus experiment.................... ...............................36

2-15 Cartoon depiction of results from a minus experiment .....................................37

2-16 Fidelity of a PCR reaction............................................... ............................. 38

2-17 Primer extension experiments with two HIV-RT variants, Y188L (gel a) and
M 184V (gel b) ............. .. .. ............. .................. ........ 49

2-18 Primer extension experiments with two candidate HIV-RT variants, Y181I (gel a)
and Y 188L (gel b).. .....................................................................50









2-19 Single nucleotide primer extension experiments as a function of pH with Y188L..51

2-20 PCR amplification (from left to right, 0 to 5 rounds, each 24 hours) of template T2-
p y (D A D )......... ........................................................................................ 5 2

2-21 a) Use of Taq and DeepVent (DV) exo+ polymerases as sequencing tools .. b) Proof
that the PCR product (from round 5) contained dX nucleotide. ...........................53

2-22 Primer extension reactions comparing 2-thioTTP and TTP incorporation opposite
isoG ..................................................... ......... .................... .............. 55

2-23 Direct competition studies opposite isoG............................................. ..........56

2-24 PCR amplification using 2-thioTTP................................... .......................... 57

2-25 Comparison of PCR fidelity using 2-thioTTP or TTP.........................................59

3-1 The central dogma of molecular biology..................... ....................... 63

3-2 Hypothetical distribution of DNAzymes in sequence space...................................70

3-3 N onstandard phosphoram idites. ........................................ ......................... 72

3-4 DNAzyme design.. .................................... .. .. ........ ......... ...... 75

3-5 Selection scheme for a DNA molecule acting as a ribonuclease ...........................76

3-6 Analysis of rounds one through three.. ........................................ ...............77

3-7 D N A zym e activity analysis.............................................. ............................ 80

4-1 Electron density in the DNA minor groove.. ....................................................86

4-2 Hydrogen bond positions of natural nucleosides.. ................................................87

4-3 Hydrogen bonding track of DNA polymerases ...................................................88

4-4 Isosteric nucleotide analogs. ............................................ ............................ 89

4-5 Examining hydrogen-bonding contacts of 3-deazaguanidine ................. ............90

4-6 Proposed steric clash between 3-deazapurines and polymerase active site.............94

4-7 Disassociation assays of Family A polymerases...................................................99

4-8 Disassociation assays of Family B polymerases. ................................................99

4-9 Relative kpol/koff rates for extending 3DA containing DNA with Family A
polym erases............................................................................................. 100









4-10 Relative kpol/koff rates for extending 3DA containing DNA with Family B
polym erases.............................................................................................101

A-2 Flow chart to generate a PCR system for artificial DNA ...................................... 113
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE DESIGN AND SYNTHESIS OF A GENETIC SYSTEM FOR A SYNTHETIC
BIOLOGY

By

A. Michael Sismour

December 2005

Chair: Steven A. Benner
Major Department: Chemistry

Chemistry is a broadly powerful discipline in contemporary science because it has

the ability to create new forms of the matter that it studies. By doing so, chemistry can

test models that connect molecular structure to behavior without having to rely on what

nature has provided. This creation, known as "synthesis," began to be applied to living

systems in the 1980s as recombinant DNA technologies allowed biologists to deliberately

change the molecular structure of the microbes that they studied, and automated chemical

synthesis of DNA became widely available to support these activities. The impact of the

information that has emerged has made biologists aware of a truism that has long been

known in chemistry: synthesis drives discovery and understanding in ways that analysis

cannot. Synthetic biology is now setting an ambitious goal: to recreate in artificial

systems the emergent properties found in natural biology. By doing so, it is advancing

our understanding of the molecular basis of genetics in ways that analysis alone cannot.









Synthetic biology is now set to take the next step, to create artificial Darwinian systems

by direct construction.

As the next step in developing artificial Darwinian systems, artificial

deoxyribonucleic acid comprising three orthogonal base pairs have been prepared. These

molecules were developed into a genetic system able to direct the synthesis of its own

replication. The replication of these molecules has the possibility of error, with the errors

themselves being heritable, thus approaching the first artificial chemical system capable

of Darwinian evolution.

The artificial genetic systems were further developed by linking the information in

the molecules, the genotype, with an observed property, the phenotype. Developing this

genotypic-phenotypic relationship, accomplished by placing the artificial genetic

molecules under a selection pressure to act as a catalyst, allowed for the study of

Darwinian processes occurring in artificial systems.

Further, the synthesis of the artificial genetic systems yielded understanding about

the genetic system found in nature, including the chemical structure of DNA, and

interactions between DNA and the enzymes responsible for its replication.














CHAPTER 1
SYNTHETIC BIOLOGY

Background and Significance

The title "synthetic biology" appeared in the literature in 1980, when it was used by

Hobom to describe bacteria that had been genetically engineered using recombinant DNA

technology These bacteria are living systems (hence biology) altered by human

intervention (that is, synthetically). In this respect, "synthetic biology" was largely

synonymous with "bioengineering."

The term "synthetic biology" was again coined by Eric Kool in a lecture given to

the Pfizer Award Symposium at an American Chemical Society national meeting in

2000. Synthetic biology, in Kool's view, is the use of synthetic, nonnatural molecules

that function in biological systems as a way to study the systems that employ them.

Careful tuning of the properties of these molecules can give significant insight into the

intricate workings of the systems under study.

Research of this nature, although lacking the defining rubric, has been underway

for the past decade in the work of Benner and Schultz as well as others. To better

understand how this synthetic approach to biology was developed and what advantages it

can lend to the study of biological systems, we must first look at the historical nature of

chemical and biological study methodologies.

Methodologies of Biological and Chemical Study

The study of biology and chemistry has proceeded for the past few centuries as

separate fields with distinct approaches to conducting research. Although organic









chemistry was born of biology, the reunification of these two disciplines did not begin

until recently-namely, in 1953 when the structure of DNA was elucidated. This

reunification is manifested in synthetic biology as a tool for studying biological systems.

The nature of biological study has been primarily of the deconstructive type.

Biologists poke and probe what nature has provided in order to better understand the

workings of biological systems. On macroscopic and microscopic levels we dissect

organisms to achieve understanding. Likewise, the genetics and molecular levels use

'gene knockouts' and amino-acid substitutions, respectively, to achieve this goal. It can

be stated with some degree of certainty that upwards of 99% of biological knowledge has

come from this deconstructive methodology.

Organic chemistry was born from the need to understand the structure of biological

molecules. The first efforts in this field were to synthesize and characterize small

biomolecules as a method to confirm their structure. From this need, synthetic chemistry

was born. However, synthetic chemistry did employ the deconstructive approach of study

at the beginning. This is clearly observed in the classical functional group theory of

organic chemistry. Once established, this theory paved the way for the synthesis of more

complex biomolecules, which in turn added to the understanding of organic reactivity.

Synthesis offers an approach different from analysis in a fundamental way [Benner

and Sismour 2005]. Instead of a "probe and model" paradigm, synthesis approaches the

biological world following the symmetrical double paradigm: if you understand it, then

you can make it; if you can make it, then you can say that you understand it.

In biological chemistry, this paradigm first emerged in the 1950's with the

construction of enzyme models [Breslow 1957]. Here, the discipline is known as









bioorganic chemistry. Under this rubric, chemists synthesized artificial molecules in the

hope of seeing them reproduce the catalytic activity and specificity of natural protein

enzymes [Breslow 1972]. If they did, then understanding was advanced. If they did not, a

new synthetic effort was attempted.

Nobel prizes (Cram, Lehn) and awards from the American Chemical Society (the

Breslow prize, for example) recognized the accomplishments of this field [Cram 1988;

Lehn 1990]. While few artificial enzymes ever came close to reproducing in magnitude

the catalytic power of natural enzymes, many reproduced the mechanisms of natural

enzymes [Breslow et al. 2002]. As a consequence, our understanding of virtually every

enzymatic reaction is today grounded in the chemical models synthesized by bioorganic

chemists in an effort to reproduce the emergent properties of enzymes, where the whole

is greater than the sum of the amino acid parts [Mildvan 2004].

It was a logical consequence for synthetic biologist to then move to the larger

emergent properties of biological systems. Self-reproduction, reproduction with errors,

and reproduction with errors where the errors themselves are reproducible are the

hallmarks of biological systems [Benner et al. 2004]. The last is, by hypothesis, the

minimum combination of chemical properties necessary for Darwinian processes to be

operative. Darwinian processes, in turn, are the only way that emergent properties are

generated in animate systems, at least those known on contemporary Earth.

About 15 years ago, synthetic biologists set out to recreate these emergent

properties [Joyce et al. 1984; Krauch et al. 1988; Doudna and Szostak 1989]. While

artificial Darwinian systems are not yet in hand, considerable progress has been made

towards getting them [Sismour et al. 2004]. At the same time, as spin-offs, tools and









technologies that benefit humankind have emerged; just as they did over the past century

in chemistry.

Moreover, the "scientific method" captures the full range of human activities. Life

scientists can observe the foraging strategies of moose, or use X-ray crystallography to

determine the molecular structure of the ribosome. The intellectual procedures involved,

however, share little in common.

One theme is universal, however: It is easy for human scientists to convince

themselves that data contain patterns that they do not, conclude that patterns compel

models when they need not, and believe models are truth, which they are not. These

observations are not pejorative. They reflect the same workings of the human mind that

enable it to be effective and creative. Thus, while the "scientific method" should ideally

emphasize unfiltered observations, data analysis with an open mind, and value-neutral

experiments, the outcome of science does not depend on how well it meets this largely

fictional ideal, but rather how well scientists manage the values and filters that come

naturally with human thought.

Synthesis offers one way to manage these. Synthesis defines an ambitious "put-a-

man-on-the-moon" goal. By doing so, it forces scientists and engineers to cross uncharted

terrain in pursuit of the goal. This requires the solution of unscripted problems not

normally encountered through either observation or analysis. Furthermore, the problems

cannot be ignored if they contradict a paradigm. With analysis, if the data contradict the

theory, the data are (as often as not) discarded to protect the theory. If one does this when

putting an orbiter around Mars, however, the orbiter crashes. For this reason, synthesis

drives the evolution of paradigms, however this elusive term is defined.









This is well illustrated in chemistry, which has long had powerful synthetic tools.

For example, the late Robert Woodward credited the discovery of the rules of orbital

symmetry, for which Roald Hoffmann and Kenichi Fukui won the Nobel Prize in

Chemistry in 1981, to problems encountered during the synthesis of vitamin B12. The

synthesis of B 12 was, for chemistry at that time, the equivalent of a "man-on-the-moon"

goal.

Similarly powerful synthetic tools are not available for many other fields. Planetary

scientists and stellar physicists cannot, today, synthesize new planets or new stars to test

theories and models about these systems.

Biology, in contrast, developed those tools over the last quarter century. In

Hobom's sense of the term, biologists have been synthesizing parts of living systems to

test their ideas for some time. The combination of chemistry, biology, and engineering is

now at the point where the "man-on-the-moon" goal is approachable: creating artificial

Darwinian systems. One of the metrics of the success of synthetic biology will be how

well the effort to assemble existing biological parts into machines, and how well the

effort to create artificial systems that reproduce the emergent properties of living system,

drives new discovery and new theory.

Synthetic Biology Defined

Synthetic biology, being a relatively new field, must have a succinct definition.

Defining synthetic biology, however, may not be an easy task as two distinct disciplines

are currently operating under this rubric. One discipline, dating back to the 1980s,

concerns synthesizing unnatural molecules that function in natural systems, eventually

becoming the basis of artificial forms of life. The second, emerging more recently,

concerns the assembly of natural biological parts in unnatural ways. Although it may









seem peculiar to place both of these disciplines under a common heading, it must be

realized that they share a very fundamental goal and approach to knowledge.

More broadly in this sense, the term has been used to capture efforts to "redesign

life" [Benner 1987; Szostak et al. 2001; Benner 2003]. This usage is an extension of the

concept of "biomimetic chemistry", which uses organic synthesis to create artificial

molecules that reproduce the behavior of parts of biology, typically enzymes [Breslow

1972]. Synthetic biology reaches more broadly, however, attempting to recreate in

unnatural chemical systems the emergent properties of living systems [Salt 1979],

including inheritance, genetics, and evolution [Benner 1987; Benner and Ellington 1988;

Szostak et al. 2001; Benner 2003]. Thus, synthetic biologists seek to assemble

components that are not natural (hence synthetic) to generate chemical systems capable

of supporting Darwinian evolution (hence biology). By doing the assembly in a synthetic

sense, these scientists hope to understand non-synthetic biology, that is, natural biology.

This motivation is similar in biomimetic chemistry, where synthetic enzyme models

proved important for developing an understanding of natural enzymes.

More recently, an engineering community has given further meaning to the title.

This community seeks to extract from living systems interchangeable parts that might be

tested, validated as construction units, and reassembled to create devices that might (or

might not) have analogs in living systems [Gibbs 2004]. The parts come from natural

living systems (hence biological). Their assembly is, however, unnatural (hence

synthetic). Thus, one engineering goal might be to assemble biological components (such

as proteins that bind DNA and the DNA sequences that they bind) to create (for example)

outputs analogous to those from a computer.









A common ground between these communities lies within the global strategy by

which scientists come to understand their subject matter, make discoveries, and overturn

paradigms. Synthesis offers opportunities for these that observation and analysis do not.

Synthetic biology already has many accomplishments to its credit. The effort to

generate synthetic genetic systems has yielded diagnostics tools, such as Bayer's

branched DNA assay, which annually helps improve the care of some 400,000 patients

infected with HIV and hepatitis viruses [Benner 2004a; Elbeik et al. 2004a; Elbeik et al.

2004b]. These and other artificial genetic systems now support primitive genetic

processes, including replication with the possibility of mutation [Latham et al. 1994;

Sismour et al. 2004], selection [Battersby et al. 1999], and evolution. Synthetic biology

has also generated some interesting toys from biomolecular parts, including systems that

oscillate [Elowitz and Leibler 2000] and do simple computations [Ruben and Landweber

2000].

For engineering purposes, parts are most suitable when they contribute

independently to the whole. This "independence property" allows one to predict the

behavior of an assembly. In molecular science, the simplest building units (the atomic

parts) are well known not to contribute independently to the behavior of a molecular

assembly (the whole). In the macroscopic physical world, building units often do,

especially if they are designed to do so (as in modular software assembly, for example).

Ultimately, synthetic biology succeeds or fails as an engineering discipline depending on

where independence approximations become useful in the continuum between the atomic

and macroscopic worlds. Here we ask whether the synthetic exercise has contributed in a









way inaccessible by analysis alone, by measuring the insights, discoveries and paradigm

shifts that it drives.

Understanding the focus of the two disciplines operating under the synthetic

biology rubric is imperative to developing a succinct definition. Synthetic biology is not a

fielder se, but rather is an approach to study. This approach comprises the

rearrangement of biological components to redesign, and hence better understand, natural

biological systems. The type of biological components used in synthesis are dependent on

how far one pushes the reductinst viewpoint; whole cells, biological networks, individual

genes, monomeric building blocks (i.e. nucleosides, amino acids, lipids), and atoms all

represent independent biological components, with sequential items in the list requiring a

deeper level of reductionalism. Synthetic biology is thus open to the imagination of the

researcher in the pursuit of knowledge and understanding by a synthetic paradigm.

Synthetic Biological Systems

Having defined Synthetic Biology and its goals, we must now discuss the

development of each genera of biological property. As the basis of any organism is a

genetic system, loosely defined as a way to carry inheritable information, we will begin

by discussing the constraints of synthetic genetic systems. We will then explore some of

the research investigating synthetic protein and nucleic acid catalysts. Lastly, we must

discuss the properties of synthetic networks and investigations into synthetic life.

Artificial Genetic Systems

Developing artificial genetic systems has relied heavily on restructuring the

components of natural genetics, DNA. Synthesis focusing on the molecular recognition

part of a nucleotide, the nucleobase, has generated many discoveries concerning both

synthetic and natural genetic systems. The Watson-Crick pairing rules arise from two









rules of chemical complementarity. The first, size complementarity, pairs large purines

with small pyrimidines. The second, hydrogen bonding complementarity, pairs hydrogen

bond donors from one nucleobase with hydrogen bond acceptors from the other.

If nucleobase pairing were indeed so simple, it should be possible to move around

atoms within the nucleobases (on paper) to synthesize unnatural nucleobases that would

still pair following rules of size and hydrogen bonding complementarity, but differently

from the natural nucleobases. Indeed, by shuffling hydrogen bond donating and accepting

groups, one can easily generate eight additional synthetic nucleobases, forming four

additional base pairs.

In this case, synthesis showed that nucleobase pairing is as simple as the Watson-

Crick model implies. A synthetic genetic alphabet with up to 6 independently replicatable

nucleobase pairs supported by an extended set of Watson-Crick rules [Geyer et al. 2003].

Furthermore, a small amount of protein engineering converts natural polymerases into

polymerases that accept components of an expanded genetic alphabet in a polymerase

chain reaction [Sismour et al. 2004]. This created, for the first time, a synthetic genetic

system that can be repeatedly copied with mutations to support adaptation and evolution.

In searching for synthetic systems to recreate such emergent properties, synthetic

biologists have discovered much. For example, it was proposed that DNA polymerases

scan the minor groove of a DNA duplex looking for unshared pairs of electrons as a

recognition feature [Meyer et al. 2004]. It was likewise proposed that this minor groove

scanning was essential for high fidelity of DNA replication. Efforts to obtain polymerases

to support the evolution of the artificial genetic system discovered that minor groove









scanning is not an essential feature for some polymerases. This will be discussed in

greater detail in chapter 4.

Today, the effort to make a synthetic chemical system capable of Darwinian

evolution is a major focus of the National Science Foundation's Chemical Bonding

program. Here, the details of the chemical structures of nucleobases that are essential to

support genetics have been dissected, with the goal of repairing specific chemical

problems that limit the utility of specific components of an expanded genetic alphabet.

For example, several components of an artificial genetic system suffer epimerization; this

has been rectified by adding nitro substituents to the nucleobases [Hutter and Benner

2003]. Another component, iso-guanosine, had a significant contribution of a minor

tautomeric form that cross-bonded with thymidine, creating mutations in polymerase

chain reactions. This defect was solved by replacing a nitrogen in the structure by a

carbon atom [Martinot and Benner 2004]. Another solution to this defect was the use of a

thymidine analog, namely 2-thiothymidine, which did not form the mispair with iso-

guanosine. Thus, it is seen that man, and presumably nature, can solve these problems in

multiple fashions, one via synthesis of a particular genetic component with altered

properties, and one by the alteration of the system as a whole.

Researchers such as Benner, Kool, and Schultz (succeeded later by Romesberg)

have investigated artificial genetic systems based on the properties of DNA for some

time. The main premise of their work has been based on exploiting the interchangeable

parts involved in the molecular recognition of a genetic system and developing chimeras

of natural and nonnatural DNA into passively functional molecules. As will be discussed,









this has led to a paradigm shift concerning the chemical constraints on these

interchangeable parts.

Artificial Biological Catalysis

Biomimetic chemistry, the field pioneered by Breslow, has been very successful at

developing synthetic molecules that mimic biological catalysts. In an extension of this

field, synthetic biology is attempting to develop artificial catalysts that are derived from

biological molecules. In this respect, one often mimics biological processes, such as

evolution, in the search for new biologically based catalysts. The goal of such searches is

typically to generate biomolecules capable of catalyzing reaction atypical for those

molecules.

Towards this end, the generation of DNA based catalysts (DNAzymes) and RNA

based catalysts (ribozymes) capable of catalyzing reactions atypical, and often more

complex, than those catalyzed in biological systems is a goal that has received much

attention. For example, the catalytic properties of nucleic acids have been exploited in

attempts to develop DNA based ribonucleases, ligases, and automatons, all reactivities

not typically associated with DNA. In addition, RNA polymerase, RNA ligase, and

ribonuclease ribozymes have been obtained and studied.

Artificial Life

A discussion of artificial life must begin, of course, by developing a definition of

"Life". For this purpose, we will adopt the definition used by the National Aeronautic and

Space Administration (NASA): "A chemical system capable of Darwinian evolution."

The two defining clauses in this definition, "chemical system" and "Darwinian

evolution", should be examined more closely. "Chemical system" restricts life to matter;

artificial intelligence or computer programs capable of Darwinian evolution are not









included in the definition. The next clause, Darwinian evolution, can be defined as "a

replicating system capable of mutation where the mutations are themselves heritable".

Thus, salt crystals, although imperfect and capable of seeding the nucleation of other salt

crystals, cannot pass on their imperfections, and are thus not life.

Artificial life can easily be defined by adding another stipulation to the definition of

life, non-terrean or synthetic. Thus, the definition of artificial life is: A man-made

chemical system capable of Darwinian evolution, one not found previously on Earth.

This definition allows speculation that is beyond the scope of this discussion;

determining the amount of "synthesis" necessary to classify an entity as artificial is

debatable. For example, is E. coli expressing a single non-native gene a form of artificial

life? It is certainly a chemical system capable of Darwinian evolution, and it is man-

made. As a contrasting example, is a self-replicating DNA molecule a life form?

The difference between the above examples is the severity of deviation from what

we would find in Nature. One would expect to discover a new E. coli containing a gene

not typical for that organism; this discovery would generate a publication. One does not

expect to discover a natural, self-replicating DNA molecule; this discovery could well be

awarded with a Nobel prize.

Examining more closely the self-replicating DNA molecule, one then must

question metabolism. Is a self-replicating molecule using dNTPs as the "food" to

generate its progeny different than one using two oligonucleotides? In the first case, the

DNA molecule would be acting as a DNA polymerase, in the second case it would be

acting as a ligase. In a broad sense, both molecules conform to the definition of artificial

life; they are both man-made chemical systems capable of Darwinian evolution. The









difference between the two molecules is the complexity of the substrates used for primary

metabolism.

We may find that artificial life is best defined by a "we will know it when we see

it" type of definition. Such a definition, based on human expectation, is fundamentally

flawed as a scientific definition.

Research Objectives

The development of synthetic genetic systems capable of Darwinian evolution is

the subject of this work. The synthetic genetic system, oligonucleotides comprising three

orthogonal base pairs have previously been described. These molecules are known to

undergo sequence specific hybridization and can thus serve the role of information

storage. Complex biological processes such as reproduction and evolution will be applied

to these molecules.

Facilities to replicate the artificial genetic systems in vitro must be developed. The

replication of the artificial genetic molecules is equivalent, in terms of life, to the

production of progeny, reproduction.

Artificial genetic systems capable of producing progeny will be subjected to natural

selection processes in vitro. The application of selection pressures to the artificial genetic

systems not only mimics complex biological processes, such as natural selection and

evolution, but also represents the formation of a biological system with both a genotype

and a phenotype.

The synthesis of artificial genetic systems that mimic complex biological processes

is expected to bring forth knowledge that is unattainable by simple observation. The

knowledge gained by approaching biology from a synthetic paradigm will be discussed.

Properties of genetic molecules themselves and the replication of genetic molecules are






14


of principle interest. Further, basic principles regarding the processes of natural selection,

evolution, and replication will be discerned.














CHAPTER 2
DEVELOPMENT OF ARTIFICIAL GENETIC SYSTEMS

Introduction

Properties of DNA and Genetic Systems

As described by Watson and Crick 52 years ago, DNA has a modular structure. In a

reductionist sense, DNA can be described as two antiparallel strands. Each strand is

assembled from four different nucleotide building blocks, which are themselves

assembled from sugars, phosphates, and nucleobases. These are, in turn, assembled from

carbon, nitrogen, oxygen, phosphorus and hydrogen atoms.

In the Watson-Crick model, nucleotide pairs contribute independently to the

stability of a duplex. In reality, this is a good approximation. DNA duplexes can be

designed with considerable success by applying just two rules: A pairs with T, and G

pairs with C. A second order model does very well by adding only the effect of adjacent

base pairs into the calculation [SantaLucia and Hicks 2004]. Although some diversity in

nucleic acid structure and function is not captured by such simple rules (for example, that

of Z-DNA [Rich and Zhang 2003], G QUARTETS [Sen and Gilbert 1992], and catalytic

RNA [Kazakov and Altman 1992]), most molecular biologists only use this diversity

occasionally.

The elegance of the Watson-Crick model has caused most molecular biologists to

overlook the chemical peculiarity of such rules. No other molecular system can be

described so simply. For example, the behavior of a protein is generally not a transparent

function, linear or otherwise, of the behaviors of its constituent amino acids, even as an









approximation. The power of the Watson-Crick rules was nevertheless sufficient to lead

to complacency by most of those who learned the double helix structure; molecular

recognition in DNA was a "solved problem".

This complacency was only dislodged through synthesis of nucleic acids. Starting

in the 1980s, some synthetic biologists began to wonder whether DNA and RNA were

the only molecular structures that could support genetics on Earth or elsewhere [Benner

1987; Ball 2004; Benner 2004b]. Other biologists, seeking technological goals, attempted

to replace modules in the DNA structure to create DNA analogues that would, for

example, passively enter cells, but could still support the "A pairs with T, G pairs with C"

rule, with the aim of disrupting the performance of intracellular nucleic acids in a

sequence-specific "antisense" way.

This antisense idea was simple in cartoon form. The phosphate backbone was

thought to be largely responsible for the unsuitability of DNA as a drug: the repeating

backbone phosphates prevented nucleic acids from partitioning into lipid phases, an event

believed to be essential for molecules to enter cells passively. The phosphate-ribose

backbone is also the recognition site for nucleases. This knowledge, and the fact that the

Watson-Crick model proposed no particular role for the phosphates in molecular

recognition, encouraged the inference that the backbone could be changed without

affecting pairing rules.

The effort to synthesize non-ionic backbones changed the established view of

nucleic acid structure. Nearly 100 linkers were synthesized to replace the 2-deoxyribose

sugar, starting with the first by the Pitha [Pitha et al. 1970] and Benner [Schneider and

Benner 1990] laboratories. Nearly all analogues that lacked the repeating charge showed









worse rule-based molecular recognition. Even with the most successful uncharged

analogues (such as the polyamide-linked nucleic-acid analogues (PNA) created by

Nielsen and his group [Nielsen 2004]) molecules longer than 15 or 20 building units

generally failed to support rule-based duplex formation. In other uncharged systems, the

breakdown occurs earlier [Benner and Hutter 2002].

This discovery was unfortunate for the antisense industry, but it had a marked

effect on our understanding of DNA. The repeating charge in the DNA backbone could

no longer be viewed as a dispensable inconvenience. The same is true for the ribose

backbone of RNA: although several backbones (such as Threose DNA or locked nucleic

acids) work as well or better than ribose [Wengel 1999; Wilds et al. 2002], most of the

replacements work less well. The backbone is not simply scaffolding to hold the

nucleobases in place; it has an important role in the molecular recognition that is central

to genetics.

The above example illustrates how synthesis drives discovery and paradigm

change. The failure to obtain non-ionic DNA analogues that retain rule-based pairing led

scientists to think about the chemical structures that might be needed to support

Darwinian evolution.

In particular, a genetic molecule must be able to suffer change (mutation) without

markedly changing its overall physical properties. Again, this feature is infrequent in

chemical systems (in proteins, for example). But because charge dominates the physical

properties of a molecule, a repeating charge should allow appendages (the nucleobases, in

the case of DNA and RNA) to be replaced without changing the dominant behavior of a









genetic system [Hutter et al. 2002]. This has led to the suggestion that a repeating charge

might be a universal feature of genetic molecules that work in water [Hutter et al. 2002].

Furthermore, the discovery that ribose was one of the better backbone sugars for

supporting molecular recognition [Declercq et al. 2002] had implications for the origin of

life on Earth. In the mid 1990s, Miller had commented that because of the ease with

which ribose decomposes as a sugar on heating [Larralde et al. 1995], ribose could not

have supported the first genetic system on Earth. The results from synthesis, which

indicated that ribose is especially good for genetics, drove efforts to find prebiotic routes

to ribose that would overcome its intrinsic instability [Eschenmoser 1999; Ricardo et al.

2004].

Noncanonical Base Pairs

The development of artificial genetic systems has long relied on the nucleobase as

the "interchangeable parts" in the engineering effort. The first of these artificial genetic

systems to be developed used noncanonical nucleobases conforming to both properties of

Watson-Crick base pairing: hydrogen bond complementary and size complementarity.

One can view the fully implemented base pairs of natural nucleotides (G:C, and T:amino-

A) as a pyrimidine or purine scaffold holding 3 positions for hydrogen bond acceptors or

donors. One can rearrange the hydrogen bonding pattern on these scaffolds to increase

the number of orthogonal base pairs. There are three hydrogen bonding positions on each

scaffold, two possibilities-a hydrogen bond donor or a hydrogen bond acceptor-at

each position, allowing for 23, or eight, possible hydrogen bonding patterns for each

scaffold (Figure 2-1). However, two of the hydrogen bonding patterns, Donor-Donor-

Donor and Acceptor-Acceptor-Acceptor, are not chemically possible, allowing for a total

of six orthogonal base pairs. This Artificially Expanded Genetic Information System








(AEGIS), depicted in Figure 2-2, contains the building blocks used in this study to

develop a "functional" genetic system. In the following section, the chemical properties

each of these base pairs will be discussed separately.




EFU AT AL U


pyDDA puAAD pAfl ""-
(Z) (Y)



Figure 2-1. A peg-in-hole model of natural and expanded Watson-Crick nucleobase pairs.
Each size complement pairs a big structure with a little structure, while
hydrogen bond donors, shown as pegs, pair with hydrogen bond acceptors,
shown as holes.

Another effort to generate an orthogonal DNA base pair focuses on the

development of the self-complementary base pairs shown in Figure 2-4[McMinn et al.

1999; Wu et al. 2000; Henry et al. 2004]. Although these base pairs deviate significantly

from the structure of the natural purines and pyrimidines, these base pairs rely on both

steric and hydrogen bonding complementarity.

Other efforts to generate orthogonal base pairs in DNA have relied on only the size

complementarity aspect of Watson-Crick base pairing in the design of extra nucleobases.

The noncanonical nucleosides developed by Kool and coworkers relies on the pairing of

a large purinee" with a small pyrimidinee", with steric complementarity being

responsible for the specificity of base pairing [Schweitzer and Kool 1994]. As shown in

Figure 2-3, the steric complements place a large entity opposite a small entity in a base

pair. This concept was first investigated to determine if hydrogen bonds between











nucleotides were required for the formation of a base pair, and the specificity of DNA


hybridization. While these studies have, in fact, shown that hydrogen bonds are not


necessary for DNA hybridization, the development of an enzymology to faithfully


replicate a synthetic genetic system containing these components has yet to be developed


[Moran et al. 1997].

a. Standard nucleobases


H
Acceptor 0--H-N N

Donor N-H--N
NAce N
Acceptor 0


pyADA T


Donor

Acceptor

Donor


A puDAD


H
Donor N-H--O N

Acceptor --H-N\-N
N-<\ =N
Acceptor / O--H-N
H
pyDAA C G


Acceptor

Donor

Donor

puADD


b. Synthetic nucleobases


H
O 0--H-N N
.N HN


/ N-H--O
H


Donor

Donor

Acceptor

puDDA


H
Donor N-H--O AccepI

Acceptor N--H-N N Donor
/>N N
Donor / N-H-- AccepI
H


H
Acceptor --H-N

Donor N N-H--N />- N
,)-N
Donor N-H--O
H
pyADD

H
Donor N-H--O

Donor N-H--N /- N

Acceptor 0--H-N
H


tor



tor


puADA


pyDDA


Figure 2-2. Chemical structures of the Artificially Expanded Genetic Information System
(AEGIS). Hydrogen bond donors are shown in red, while their complementary
H-bond acceptors are shown in blue. Common names for each nucleotide are
indicated under each structure. Py = pyrimidine, pu = purine, A = hydrogen
bond acceptor, D = hydrogen bond donor. Donor on A is missing.


F

F
F


N



Z


P


"


AP


Figure 2-3. The hydrophobic base pairs, using steric complementarity for specific pairing,
developed by Kool.


Acceptor

Acceptor

Donor

pyAAD


pyDAD


Donor

Acceptor

Acceptor

puDAA


Acceptor

Acceptor

Donor

puAAD














00 0


ICS self-pair BFr self-pair





S S NH HN


BTp self-pair IN self-pair

Figure 2-4. The self-pairing hydrophobic nucleobase pairs developed by Romesberg.

The pyDAD:puADA Base Pair

The pyDAD and puADA nucleosides were among the first alternative building

blocks to be incorporated into DNA as a third base pair (Figure 2-5). These molecules

have some important properties that contribute to, and detract from their value as

components of a genetic system.

At first glance, one observes that the puADA molecule retains the ring structure of

a purine. In fact, the ribose form of the puADA nucleoside, xanthosine, is actually found

in living systems as a metabolite in the de novo purine biosynthesis pathway. However,

the heterocycle of puADA is an acid with a pKa of ca. 5.7 [Ricardo et al. 2004], thus

placing a negative charge on N3 of the heterocycle. This negative charge present on the

heterocycle under physiological conditions is not observed in any other nucleosides. The

effect that the negative charge has on the function of the nucleoside is unknown.

The pyDAD molecule retains the pyrimidine ring structure typically found in DNA.

However, this nucleoside is joined to the deoxyribose via a carbon-carbon bond (C-









glycosidic bond) rather than the typical N-glycosidic bond. Thus, this noncanonical

nucleotide has properties similar to a C-glycoside found in nature; pseudo-uridine.

Nucleosides containing C-glycosidic bonds are known to have 3'-exo sugar pucker rather

than the 2'-endo sugar pucker found in natural nucleosides. This alteration in sugar

pucker, although not well studied, will most likely contribute to altered helical structure

of DNA duplexes (Stephanie Havemann, personal communication). In addition, pyDAD

is partially protonated at physiological pH, with its conjugate acid displaying a pKa = 6.7

[Williams and Bartel 1995].

H
N-H ------- N
N=( --- / PAP
ND -------H-N dR
dR N-H-------O H pKa = 5.7
/
H


1' 1
H


\ \dR
pKa =6.7 N
/N-H H-N N dR

dR N-H O
H

Figure 2-5. Acid-base properties of the pyDAD:puADA base pair. puADA is
deprotonated at N3 under physiological conditions. pyDAD is partially
protonated at N1 under physiological conditions.

DNA duplexes containing the pyDAD:puADA base pair display interesting

hybridization properties. As was studied by Geyer et. al., replacing a single G:C or A:T

base pair in a DNA duplex with a pyDAD:puADA base pair decreases the melting

temperature of the DNA[Geyer et al. 2003]. Thus, the pyDAD:puADA base pair is a

weaker base pair than even an A:T pair having only two hydrogen bonding interactions










involved in base pairing. As the pyDAD and puADA nucleosides have acid-base

properties, it has been hypothesized that a base pair between these two molecules may

exist in a zwiterionic form. However, evidence of such a zwiterionic form has not been

directly displayed.

The isoC:isoG Base Pair

The isocytidine (isoC) and isoguanosine (isoG) nucleosides are another set of

complementary noncanonical nucleosides that have been under study for some time. The

isoC nucleotide has long been known to suffer from a chemical stability problem; the

isoC nucleoside undergoes depyrimidinylation under acidic conditions (shown in figure

2-5). This chemical stability problem has been solved, however, as the 5-methyl

derivative of isoC shows increased stability towards depyrimidinylation than its

predecessor[Switzer et al. 1993]. Following this discovery, all subsequent work with

pyrimidines presenting an Acceptor-Acceptor-Donor hydrogen bonding pattern (i.e. isoC)

has used the 5-methyl version of isoC. Thus, all reference towards isoC in this body of

work is actually regarding 5-methyl-isocytidine.

H O

0 OH N

NN Nf NH2
H
HO-- N NH2 HO-N--- N NH2 HOo



OH OH /Y OH
H

Figure 2-5. The acid catalzyed depyrimidinylation of isocytidine.

As is with isoC, the isoG nucleoside also displays properties that detract from its

ability to function in a synthetic genetic system. Most notably is the presence of two









tautomeric forms in aqueous solution: the keto and enol forms (Figure 2-6). The

equilibrium between these two forms is roughly 10 to 1 in favor of the keto form

[Martinot and Benner 2004]. Guanosine also interconverts between two tautomeric

forms, although the tautomeric equilibrium favors the keto form much more readily (ca.

10,000 to 1) than does isoG.

a) isoGuanosine (isoG)
NH2 NH2

H
H N


N N O N N OH


Keto Form Enol Form



b) Guanosine (G)
0 OH

NH N
N N /N


N NH2 N NH2

Keto Form Enol Form

Figure 2-6. The Keto-Enol tautomeric forms ofisoG and G. a) The tautomeric
interconversion between the 2-keto and 2-ol forms of isoG. The keto to enol
ratio is 10:1 under physiological conditions. b) The tautomeric interconversion
between the 6-keto and 6-ol forms of G. The keto to enol ratio is 10,000:1
under physiological conditions.

Synthetic biology based on a six letter genetic alphabet that includes the two non-

standard nucleobases isoguanine and isocytosine as well as the standard A, T, G, and C,

is known to suffer as a consequence of a minor tautomeric form of isoguanine that pairs

with thymine, and therefore leads to infidelity during repeated cycles of the polymerase

chain reaction (PCR). Although the natural inclination to solve this problem leads one to










develop a system in which the polymerase favors the formation of the correct base pairs,

we believed that inhibiting the formation of the mispair between thymidine and the

minor-tautomer of isoG would also correct this problem.

H
/
0----- H-N N


N N dR
dR 0-----H-O
T isoG minor tautomner

H H
/ /
0 -----H-N N 0 -----H-N N

-H --H--- }^q ( -H--o N N
N \ dR N \ N dR
dR H-N dR S)H-0
H 2-throT isoG minor tautomer
2-thioT 2 amnoA
Steric Clash Steric Clash

Figure 2-7. Steric exclusion of 2-thioT-isoG base pair. Shown is the mis-pair between
thymidine (T) and the minor tautomer of isoG, resulting in replication
infidelity. Also shown is the pair between 2-thiothymidine (2-thioT) and 2-
aminoadenine, known to destabilize DNA duplexes due to the steric clash in
the minor-groove. Similarly, a steric clash between 2-thioT and the minor
tautomer of isoG is expected to inhibit formation of this mispair.

It has long been known that thiones (as in thioT) do not serve effectively as

hydrogen bond acceptors in Watson-Crick pairing[Lezius and Scheit 1967; Darlix et al.

1973; Vormbroc.R et al. 1974; Rackwitz and Scheit 1977]. For example, while a

nucleobase pair between 2-thioT and adenine contributes to duplex stability (as measured

by AG) as well as a pair between T and A, each pair between 2-thioT and 2-


aminoadenine destabilizes the duplex by 0.8 kcal/mol (corresponding to a 2.4 oC decrease

in Tm in a 20 nucleotide duplex) [Kutyavin et al. 1996]. This effect was attributed to the

increased steric bulk of the C=S H-NH- unit in the minor groove of the DNA helix. As

the minor tautomer of isoG, responsible for its mispairing with thymidine, displays a

hydroxy group into the minor groove (2-position), we reasoned that the 2-thiothymidine-









isoG (minor tautomer) base pair may also be disfavored relative to the thymidine-isoG

(minor tautomer) pair as well in the polymerase active site (Figure 2-7).

Properties of DNA Polymerases

Mechanism and properties

DNA polymerases come in many "flavors." In bacteria and archea, there are 3

known types of DNA polymerases, Pol I, Pol II, and Pol III. DNA Pol III is a

holoenzyme responsible for replicating genomic DNA. In contrast, the single protein Pol

I and Pol II enzymes are responsible for processing Okazaki fragments and error

correction. The most commonly used polymerases for biotechnology applications are of

the Pol I variety, and will be the topic of the following discussion.

d< growing strand
0 B
0
enzyme

H-O
g P-O\ H-O
g P-



OH

incoming dNTP

Figure 2-8. Chemical mechanism for addition of a dNTP by a DNA polymerase. The
Mg2+ cofactor acts as a Lewis acid when coordinating the phosphate oxygens.
The 3'-OH of the growing strand does a nucleophilic attack on the ca-
phosphate of the incoming dNTP.

Many polymerases have catalytic activities beyond the synthesis of DNA Figure 2-

8). Some polymerases have a 5'-3' nuclease activity that serves to degrade DNA in the

direction of DNA synthesis. Some DNA polymerases display 3'-5' exonuclease activity

serving as a proofreading mechanism. This mechanism serves to excise newly









synthesized mismatched base pairs, resulting in increased fidelity of replication. Both of

these activities exist in a separate domain of the polymerase than the 5'-3' DNA synthesis

activity, and thus proceed by a different chemical mechanism. Although the details of

these activities are beyond the scope of this discussion, the properties of many

commercially available polymerases are described in Table 2-1.

Table 2-1. Pro erties of commercially available DNA polymerases.
Family Exo Exo Error rate Thermal Km dNTP Km DNA
(3'>5') (5'>3') (X 10-6) stability (tM) (nM)
Bst A No No Unknown Yes (65) Unknown Unknown
T7 A Yes No 15 [1] No (37) 18 [7] 18 [7]
Pol I (E. coli) A Yes Yes 9 [3] No (37) 1 [6] 5 [6]
Klenow A Yes No 18 [3] No (37) 2 [8] 10 [8]
Klenow exo- A No No 100 [3] No (37) 3 [8] 10 [8]
Tag A No Yes 285 [4] Yes (72) 13 [4] 2 [4]
KlenTaq A No No unknown Yes (72) unknown unknown
Tfl A No unknown Yes (72) unknown unknown
Tth A No unknown Yes (72) unknown unknown
90N B Yes (-) No unknown Yes (72) 80 [9] 0.05 [9]
Therminator B No No unknown Yes (72) unknown unknown
Deep Vent B Yes No unknown Yes (72) 50 [5] 0.01 [5]
D. Vent exo- B No No unknown Yes (72) unknown unknown
Vent B Yes No 57 [1] Yes (72) 60 [5] 0.1 [5]
Vent exo B No No 190 [1] Yes (72) 40 [5] 0.1 [5]
Pfu B Yes No 1.3 [10] Yes (72) unknown unknown
Pfu exo B No No unknown Yes (72) unknown unknown
[1] [Mattila et al. 1991]; [2] [Kunkel et al. 1984]; [3] [Bebenek et al. 1990]; [4][Tindall
and Kunkel 1988]; [5] [Kong et al. 1993]; [6] [McClure and Jovin 1975]; [7] [Patel et al.
1991]; [8] [Eger and Benkovic 1992]; [9] [Southworth et al. 1996]; [10] [Kroutil et al.
1996]

Kinetics and fidelity

Inherent in biological systems is both the need to copy the genetic material and

more importantly, to copy the material in a faithful way. The faithfulness of replication,

termed fidelity, corresponds with a polymerase's ability to discriminate among the four

available substrates (dNTPs), incorporate only the correct dNTP, and thus abide by the A

pairs with T, G pairs with C rules of DNA complementary base pairing. DNA









polymerases have evolved to make very few errors (ca. 1 in 104 105 incorporations)

when selecting and incorporating the correct dNTP from a pool of possible substrates.

Even today, our theories of enzyme structure-function relationships are not

complete enough to understanding the interactions between the polymerase and its

substrates required to achieve high level fidelity. Although it has been the subject of

much study and speculation, the mechanism by which polymerases achieve this level of

fidelity remains elusive.

The earliest theories concerning polymerase fidelity proposed that hydrogen bond

complementarity accounted for the high-level of fidelity. This proposal has been refuted

by observing that the thermodynamic stability difference (i.e. the difference in AG)

between a cognate and a mismatched base pair is too low to account for such a level of

discrimination. It should be noted, however, that the AG values for the formation of

cognate and mismatched base pairs are measured in aqueous solution. As the active site

of a DNA polymerase excludes water, the difference in AG values may be enhanced.

It was then argued, by Kool and others, that fidelity arose solely from size

complementarity[Delaney et al. 2003]. Kool has shown that polymerases are able to

incorporate isosteric nucleotide analogs opposite their steric complement. However, such

work only truly displays that hydrogen bonds are not a necessary component for the

replication of DNA base pairs. In addition, as such a fidelity mechanism would require

the polymerase binding pocket to be a "perfect" match for a correct base pair, so much so

that a mispair altering the base pair geometry by as little as 1 A would not be

accommodated, has little support considering the number of dNTP analogs (i.e. dNTPs










with exocyclic fluorescent molecules, biotins, etc.) that are readily incorporated by

polymerase enzymes.

Although we cannot currently pinpoint the exact mechanisms responsible for the

fidelity of DNA replication, kinetic constants can be used to better understand and

measure fidelity. Although kinetic constants are observed rather than innate properties,

one could say that kinetic discrimination between substrates is the resulting property by

which polymerases achieve fidelity for DNA replication.

Just as kinetic constants can impart information concerning DNA replication

fidelity, they are also indicators of replication infidelity. As unfaithful replication of non-

standard nucleotides has been the primary barrier to the generation of a replicatable

synthetic genetic system, understanding the kinetics of polymerases is important not only

for achieving this synthetic goal, but also for assay design and interpretation. In this

respect, the kinetic dependence of nucleotide incorporation fidelity cannot be overlooked.

The kinetic scheme for a polymerase, shown in figure 2-9, illustrates the general

kinetic profile for a DNA polymerase. Included in this scheme are all binding, catalytic,

and conformational change steps involved for the addition of a single dNTP [Bryant et al.

1983].

dNTP
k k,2 k3 kol
Pol + DNAo PolODNAo PolDNAodNTP Pol'*DNAo.dNTP Pol' DNA,
k_ ,1 k-_2 k3 k-pol
k4
k-4

Figure 2-9. Kinetic mechanism for dNTP incorporation by a DNA polymerase.

Fidelity of DNA replication is defined as the number of misincorporations made by

a polymerase when copying DNA. Fidelity is typically measured using aM131acZox

nonsense codon reversion assay [Kunkel et al. 1987]. However, this assay is not









amendable to noncanonical nucleic acids as it requires in vivo replication of DNA

containing the nucleotides of interest.

Kinetically, the fidelity is related to the ratios of the velocities for insertion of the

correct (VR), dRTP, and incorrect (vw), dWTP, nucleotide triphosphates [Goodman et al.

1993]. The frequency of misinsertion (fins), defined as the inverse of the fidelity, is

represented by the equation:

vw
fins = when [dWTP] = [dRTP] (2.1)
VR

By definition, the velocity (vw and vR) is defined as v= (kcat/Km)[pol-DNA][dNTP].

Since kat = Vmax /[pol-DNA], the velocity equation reduces to:

v= (Vmax/Km)[dNTP] (2.2) VR= (Vmax/K)R[dRTP]

Vw= (Vmax/Km)w[dWTP]

Substitution of equation 2.2 into equation 2.1 gives another equation for fins:

vw (Vmx/Km)w [WTP]
fins = = (2.3)
vR (Vmax/Km)R [RTP]

As polymerases typically operate under conditions where [dWTP] = [dRTP], the

frequency of misinsertion, and hence the fidelity, is simply the ratio of Vmax/Km for the

two substrates. Thus, one is also able to determine fidelity of DNA replication by simply

measuring the kinetic constants of a polymerase for each base pair [Bloom et al. 1993].

It should be noted that fidelity is said to follow a Km discrimination model. Simply,

the relative Km values of 2 substrates have a larger impact on fidelity than does Vmax (or

Kcat). This is an important factor that is often overlooked in the design and interpretation

of experiments investigating the fidelity of non-standard base (NSB) replication.









Scientifically, the kinetic model of DNA replication fidelity allows one to both

understand and predict the generation of mutations during the polymerase-dependent

copying of DNA (although not by first principles such as structure-function

relationships). However, it is also useful for one to use a more qualitative view of fidelity

in conjunction with the quantitative kinetic model; mainly as a tool to understand what

fidelity is not.

Qualitatively, fidelity is how often a polymerase "chooses" (i.e. incorporates) the

correct dNTP, rather than "choosing" (i.e. incorporating) the incorrect dNTP opposite a

certain site in a DNA template. Although "choosing" is an incorrect word in this context

as it implies cognition, the semantic implications of this word make its usage a requisite.

"Choose" implies that the polymerase can select from a number of possible dNTPs. This

property can be seen in the kinetic definition of fidelity; the equation requires values from

multiple substrates.

Fidelity is often confused with the ability of a polymerase to preclude an incorrect

dNTP from being misincorporated opposite a noncomplementary nucleotide. This

confusion is easily observed in some of the earlier investigations of 6-letter DNA

enzymology, wherein the measure of fidelity with a base pair was estimated by

comparing those reactions containing the correct base to those that did not. As the

polymerase was unable to "choose" the correct dNTP, such reactions do not conform to

the conditions required of the kinetic equation of fidelity.

Although a lengthy, semantic argument was used to justify a property of fidelity,

the subtle point is one of the most important pieces of knowledge needed when studying

nonstandard DNA replication. Stated bluntly, Just because a polymerase can









misincorporate the wrong dNTP in the absence of the correct dNTP, does not mean that

the polymerase will misincorporate the worng dNTP in the presence of the correct dNTP.

This statement is based on the kinetic equation for fidelity, which requires Vmax/Km

values for multiple substrates.

Polymerase Assays

Polymerases are typically used and tested in in vitro primer extension assays and

the polymerase chain reaction (PCR). Primer extension reactions are typically used in

studies of polymerase activity such as dNTP insertion, extension, and kinetic analysis,

while PCR is typically employed to amplify a particular DNA sequence in vitro.

Primer extension reactions typically fall into two categories, running start (RS) and

standing start (SS) reactions. Standing start reactions are, by definition, those reactions in

which the first dNTP to be incorporated is either the nucleotide, or at the template site of

interest. In contrast, running start reactions typically require the polymerase to

incorporate one or more dNTPs prior to incorporating the substrate of interest.

As these two variations of primer extension reaction differ in technique, they also

differ in their potential as an assay system, each with their own advantages, and hence

disadvantages, compared with the other for each system studied. For example, standing

start reactions are typically used to investigate the ability of a polymerase to extend a

particular base pair, although the facilities to incorporate a dNTP opposite a particular

site in the template can also be explored. In contrast, running start reactions are typically

used to study dNTP incorporation at a particular site in the template, albeit with the

resulting information being different than with their SS counterparts.









Standing start reactions

A standing start reaction is a primer extension reaction defined as a reaction where

the first dNTP is either the nucleotide of interest, or is incorporated opposite the template

position of interest. The primer/template complex serving as the substrate in such

reactions is described in Figure 2-10.

P

5'-GCG TAA TAC GAC TCA CTA TGG ACG
3'-CGC ATT ATG CTG AGT GAT ACC TGC XCT GTG CTT CTG

N

Figure 2-10. Standing start primer and template. During a primer extension, the first
dNTP is added to the primer opposite the template base of interest (X).

As stated earlier, standing start reactions are typically used to investigate the ability

of a polymerase to extend a particular base pair. The facilities to incorporate a dNTP

opposite a particular site in the template can also be explored, however. Depending on the

exact experimental design, these experiments can be employed to measure kinetic

constants, or answer more qualitative "yes or no" type questions.

The study of DNA replication of artificial genetic systems comprising extra base

pairs often uses standing start reactions as a metric for testing the viability of the

noncanonical dNTP as a substrate for a polymerase (for determining kinetic constants

using standing start reactions, please see [Goodman et al. 1993]). These qualitative

reactions are advantageous because they are simple to perform. They do, however, have a

major disadvantage; unextended primer cannot solely be attributed to the inability of a

polymerase to incorporate the dNTP (Figure 2-11). Unextended primer can indicate that

either the polymerase was unable to incorporate the dNTP of interest, or that the

polymerase never associated with the primer/template complex.









Standing start reactions

Reaction Gel Interpretation

-GG T interaction and reaction
CCTAGG p no interaction + interaction
site PT

Figure 2-11. Typical PAGE analysis of a standing start reaction. The typical standing
start reaction with the primer/template shown on the left, will yield bands on a
gel corresponding to the unextended primer (P) and the primer with an
incorporated dNTP (T). A band at position P indicates that either no
polymerase associated with the primer/template (no interaction), or the
polymerase bound the primer template yet failed to add a dNTP (interaction).
A band at position T indicates that the polymerase bound the primer/template
and incorporated a dNTP.

Running start reactions

In a running start reaction a polymerase is challenged to incorporate one or more

dNTPs, typically referred to as running-start dNTPs (RSdNTP), prior to being challenged

to incorporate the dNTP of interest. These reactions have typically contained only the

necessary RSdNTPs and the dNTP of interest during the reaction; for example, the

dNTPs used in a running start reaction using the primer/template complex in Figure 2-12

would include the dGTP as the running-start dNTP and the dNTP of interest.

P

5'-GCG TAA TAC GAC TCA CTA TGG A
3'-CGC ATT ATG CTG AGT GAT ACC TCC XCT GTG CTT CTG

N
Figure 2-12. Running start primer and template. In a running-start experiment the
polymerase is challenged to incorporate dNTPs, in this case two dGTPs, prior
to encountering the nucleotide of interest.

Running start reactions are typically used to study dNTP incorporation at a

particular site in the template, albeit with the resulting information being different than

with their standing start counterparts. These reactions, especially where only the running-









start dNTP and dNTP of interest are introduced into the reaction, have found little

application in the study of non-standard base replication.

The inclusion of the RSdNTP in a running start reaction is responsible for the

failure of this system when testing nonstandard base incorporation. As the fidelity of

nonstandard nucleotide incorporation is often less than that for natural dNTPs, it cannot

be concluded that the RSdNTP was not misincorporated opposite the site of interest.

When such misincorporation events are not of concern, running start reactions have

an advantage over standing start reactions for quantitatively examining the incorporation

of dNTP. As shown in Figure 2-13, the results from a standing start reaction will include

bands corresponding to unextended primer (P), incorporation of the RSdNTP (N), and

incorporation of the RSdNTP and nucleotide of interest (T). Unlike a standing start

reaction, where "no interaction" and "interaction with no extension" events were

indistinguishable, the running start reaction has no ambiguous outputs; every product

from the reaction has a defined origin. Thus, polymerase incorporation of a dNTP of

interest can be quantitatively examined by comparing the amount of products N and T.

Running Start Reactions

Reaction Gel Interpretation

T interaction and reaction
G
CCTAGG N interaction
site PNT P no interaction

Figure 2-13. Running start reactions.

Minus-Experiments

Minus-experiments are a form of running start reaction that have found application

in studying nonstandard nucleotide incorporation. These experiments compare two

running start reactions, one reaction contains only the four natural dNTPs while the








second contains the four natural dNTPs and the noncanonical dNTP of interest (Figure 2-

14). These reactions qualitatively examine how a polymerase handles an unnatural base

pair.

prin~r 5'
template 3' \INNN


Reaction 1 reReaction reaction 2 ( reaction)

dATP dATP
dNIPs= dGTP dNIPs= dGTP
dCIP dCIP
TIP TIp
dXTP
dXIP

Figure 2-14. Experimental design of a minus experiment. The primer/template is
designed as a running start experiment where the polymerase must incorporate
four dNTPs (N) prior to being challenged to incorporate a dNTP opposite the
non-standard base shown in red (X). Two reactions are performed for each
polymerase examined; reaction one contains the four natural dNTPs and the
unnatural dNTP, while reaction two contains only the natural dNTPs.
The interpretation of the results of a minus experiment must proceed with caution.

Minus-experiments can yield two types of results: a positive result, indicating that the

polymerase incorporates only the noncanonical dNTP opposite its complement; and an

indeterminate result, indicating that the polymerase can misincorporate a natural dNTP

opposite a noncanonical nucleoside (Figure 2-15). The indeterminate results are open to

interpretation, and there are many properties that can be determined from these

indeterminate results. Many failed attempts at replicating DNA containing a nonstandard

base pair are the result of misinterpreting an indeterminate result.









Positive Result indeterminate Negative Result

------- ----


- - - -



mm mm mm

+ + + -
reaction reaction reaction
Figure 2-15. Cartoon depiction of results from a minus experiment. A positive result is
indicated by the production of a full-length product band (shown in green) in
the presence of the unnatural dNTP, and the formation of a product truncated
before incorporation of a dNTP opposite the unnatural nucleoside (shown in
blue) in the reaction without the correct unnatural dNTP. A negative result is
indicated by truncated products in both reactions, indicating the polymerase
cannot incorporate a natural or unnatural dNTP opposite the non-standard
nucleotide in the template. An indeterminate result is illustrated as having full-
length product generated in both reactions.

Polymerase chain reaction (PCR)

The polymerase chain reaction (PCR) is one of the most widely used techniques in

biochemistry and molecular biology. PCR is typically used to exponentially amplify a

segment of DNA using two short oligonucleotides as primers. During this exponential

amplification, the concentration of the DNA being copied is doubled during every round

of PCR. The number of molecules made during a PCR is N = n2r, where n is the number

of DNA molecules being copied, N is the number of DNA molecules made, and r is the

number of rounds of PCR.

If a polymerase enzyme does not replicate a DNA molecule with fidelity, the

number of molecules that are perfect replicas of the original does not follow a perfect

doubling. For a fidelity of 98%, the number of correct molecules made will be a 1.98

base exponential. The equation for the number of correct copies made of a molecule will

be N"= n(1+f)r, where NC is the number of correct molecules, n is the number of template










molecules,fis the polymerase fidelity per insertion at a particular site, and r is the

number of rounds. Thus, the percentage of correct copies made in a PCR is % = 100 (1/2

+f/2)r. The effect of fidelity on a PCR reaction is illustrated in Figure 2-16.

100

90

80

70--

60

50

40

30

20

10


0 5 10 15 20 25 30 35 40
rounds of PCR
---99% -U-95% 90% 85% -=-80%

Figure 2-16. Fidelity of a PCR reaction. Shown is the theoretical overall fidelity at a
single site during PCR amplification as a function of fidelity per round. Due to
the exponential amplification that occurs during PCR, errors introduced by a
misincorporation event are exponentially amplified. This graph represents the
equation for PCR fidelity, y = 100 (1/2 +f/2)r, wherefis fidelity per round
(misincorporation rate at a single site) and r is the number of rounds of PCR.
Values of 99, 95, 90, 85, and 80% fidelity per round was graphed over 40
rounds of exponential amplification.

Materials and Methods

pyDAD:puADA Experimentals

Synthesis of non-standard nucleosides

2,4-Diamino-5-(P -D-ribofuranosyl)pyrimidine (pyDAD) was synthesized via a

route adapted from [Chu et al. 1976], converted to the 2'-deoxygenated nucleoside analog

via the route described previously [Lutz et al. 1998]. 5'-Dimethoxytrityl-2'-

deoxyxanthosine with both heterocyclic ring oxygens protected as p-nitrophenylethyl









ethers was prepared by a procedure adapted from Van Aerschot et al. [Vanaerschot et al.

1989; Jurczyk et al. 2000]. Both were then converted to the phosphoramidite suitable for

automated DNA synthesis [Sinha et al. 1983].

To prepare 2'-deoxyxanthosine-5'-triphosphate d(puADA)TP, 2'-deoxyguanosine

triphosphate (sodium-salt, 10 mg, 16.7 mmol) was dissolved in water (220 ml) containing

sodium nitrite (10 mg, 80 mmol). A mixture of HCl (8.7 ml, 2 M) and acetic acid (glacial,

25 ml) was added and the sample incubated at room temperature for 3 h. The reaction

was quenched with Tris base (400 ml, 1 M). The raw material can be stored at -200C

before being purified by RP-HPLC [Nova Pak C-18 Radial Pak cartridge (Waters), 253

100 mm, TEAA (100 mM, pH 7), linear gradient to 10% acetonitrile over 25 min]. The

combined product fractions were lyophilized and the residue was dissolved in Tris-HCl

(2 ml, 10 mM, pH 7.0). The yield of 16 was determined by UV absorbance (4.2 mg, 42%,

247/277 nm, e = 10 000/9100 M^-cm-1). The purity of the material was >97% as

determined by analytical RP-HPLC and anion-exchange HPLC [Macrosphere 300 A

WAX 7 U (Alltech, Deerfield IL)] 4.6 3 250 mm; solvent A = water; solvent B = TEA-

bicarbonate (0.8 M, pH 7.2); curved gradient (7) from 1 to 50% B in 15 min]. The

triphosphate d(pyDAD)TP was synthesized via published procedures from the nucleoside

[Ludwig and Eckstein 1989].

Oligonucleotide synthesis

The oligonucleotide sequences used in this work are listed in Table 2-2.

Oligonucleotides bearing non-standard bases were prepared by trityl off solid-phase

synthesis using an Applied Biosystems automated DNA synthesizer from the 3-

cyanoethyl protected phosphoramidites. They were purified by PAGE (12-20%). Those









oligonucleotides containing only standard nucleotides were obtained commercially from

Integrated DNA Technologies (Coralville, IA).

Table 2-2. Oligonucleotides used in experiments with the pyDAD:puADA base pair.
P1-RS d(GCG AAT TAA CCC TCA CTA AAG)
P2-RS d(GCG TAA TAC GAC TCA CTA TAG)
P1-SS d(GCG AAT TAA CCC TCA CTA AAG AAC G)
P2-SS d(GCG TAA TAC GAC TCA CTA TAG ACG A)
P2-C6 d(ATGCA-C6C6-GCG TAA TAC GAC TCA CTA TAG)
P2-Rev d(GCG AAT TAA CCC TCA CTA AAG)
P3 d(CAG GAA ACA GCT ATG ACG)
T1 d(GCGTAATACGACTCACTATAGACGTTCGTTCTTTAGTGAGGGT
TAATTCGC)
T2 d(GCGAATTAACCCTCACTAAAGTACGTTCGTCTATAGTGAGTCG
TATTACGC)
TI-puADA d(GCGTAATACGACTCACTATAGACGT(puADA)CGTTCTTTAGTG
AGGGTTAATTCGC)
T2-pyDAD d(GCGAATTAACCCTCACTAAAGTACG(pyDAD)TCGTCTATAGTG
AGTCGTATTACGC)
T3 d(CGTCATAGCTGTTTCCTGGTCC(puADA)CGCATTGCTG)
C6 refers to a linker that contains 3 U of polyethyleneglycol, incorporated to permit the
separation of the two product strands following PCR. puADA is a nucleotide bearing the
xanthine nucleobase. pyDAD is the nucleotide bearing a 2,4-diaminopyrimidine
nucleobase.

Expression, Purification, and Activity Determination of HIV 1 RT

The HIV reverse transcriptases were expressed as p66/p51 heterodimers using a

plasmid that coexpresses the p66 coding region of the HIV-1 RT variant, with a

hexahistidine tag on the C-terminus, and HIV-1 protease. The expression is induced by

the addition of IPTG, and a polycistronic messenger containing both the RT and protease

coding region is produced. In the E. coli, the protease cleaves the p66 homodimer to yield

the p66/p51 heterodimer with a hexahistidine tag only on the p66 subunit.29 The

enzymes were isolated by the procedure of Boyer et al.29

Enzyme activity was determined by incorporation of [3H]-TTP into a poly(rA)-

oligo(dT) template. [Bryant et al. 1983; Reardon and Miller 1990; Kuchta 1996; Stahlhut

and Olsen 1996] All reactions were carried out at 370C in a water bath. An aliquot of the









reverse transcriptase (1-2 [iL) was incubated in HIV-RT buffer (Tris-HCl 50 mM, pH

7.2, MgC12, 5 mM, KC1 100 mM, DTT, 1 mM, EDTA 0.5 mM) in the presence of 5 [g

poly(rA)-oligo(dT)12-18 (Pharmacia) and [3H]-TTP (25 [iM, 6000 cpm/pmol,

Amersham; concentration adjusted with 1 mM TTP). Four aliquots (20 pL) were taken

over a 12 min period and quenched with EDTA (10 pL, 0.5 M, pH 8). The quenched

reaction mixture (20 [iL) was applied to 2.5-cm circles ofWhatman DE-81 filter paper.

The airdried filter papers were washed three times with Na2HPO4 solution (0.15 M),

twice with EtOH, and finally once with Et20. The dry filters were counted by liquid

scintillation counting in ScintiSafe (30%, 5 mL, Fisher). All experiments were repeated

three times and the resulting data averaged. The activity was calculated from the slope of

a time vs. cpm plot and was expressed as units per mL (U/mL). One unit of enzyme was

defined as the amount of polymerase that converts 1 nmol TTP into filter-bound material

in 10 min at 370C.

Enzyme variants had the following specific activities (tested on

poly(rA)/oligo(dT)): HIV-1 RT heterodimer: 8700 units/mg; Variant L74V: 9750

units/mg; Variant K103N: 11300 units/mg; Variant Y181I: 7500 units/mg; Variant

M184V: 10600 units/mg; Variant Y188L: 5100 units/mg; Variant AZT-21 (M41L,

D67N, K70R, T215Y, K219Q): 4150 units/mg; Variant Y188L, E478Q: 5100 units/mg.

Running start reactions

In a typical primer extension experiment, 5'-32P-labeled primer (P1-RS) and

template T1, or P2-RS and template T2 (656 nM of the primers, 920 nM of the templates)

in HIV RT buffer were mixed with dATP, dGTP, dCTP, and TTP (final concentration

130 iM each) in a total volume of 160 IL. In experiments with nonstandard nucleotides,

the concentrations for d(pyDAD)TP and d(puADA)TP were also 130 [M. After heating









the sample to 950C for 1 min, the primer/template complex was annealed by cooling to

room temperature over 1 h. Primer extension was started by addition of the reverse

transcriptase (16 itL). The mixture was then incubated at 370C. Aliquots (25 itL), taken

at various times during the reaction, were quenched by addition of a premixed solution of

sodium acetate (2.5 pL, 3 M, pH 5.2), EDTA (1 pL, 0.5 M, pH 8), and ethanol (50 pL).

After being stored at -200C for 20 min, the samples were centrifuged (14,000 rpm, 40C,

20 min) and the pellets dried in the vacuum concentrator. The residues were redissolved

in PAGE loading buffer and the samples separated on a 10% PAGE gel (7 M urea). The

gel was analyzed using the MolecularImager.

To improve reproducibility in cases where multiple reactions were run in parallel, a

master mixture of primer/template and the dNTPs was prepared by scaling up the listed

procedure. Master mixtures were not stored for more than 24 hours at -20 OC.

Standing start reactions

Primer P1-SS or P2-SS (15 pmol, 5'-32P-labeled) and the appropriate template (T1

or T2, 21 pmol) were incubated with HIV RT at a range of pHs (8 pL, 3x) and the

volume adjusted with water to 21 [tL with water. The DNA was denatured (950C, 1 min)

and cooled to room temperature (1 h). After addition of the appropriate dNTP (1.67 pL,

130 itM final concentration of each) and an aliquot of reverse transcriptase (0.2 U). The

mixture was incubated for up to 30 min at 370C. The reaction was quenched by addition

of a premixed solution of sodium acetate (2.5 pL, 3 M, pH 5.2), EDTA (1 pL, 0.5 M, pH

8), and EtOH (50 itL), the DNA was recovered by centrifugation, and the pellet was dried

in the vacuum concentrator. The DNA was dissolved in PAGE loading buffer

(Bromphenol blue/xylene cyanol mix 0.1 g, water, 1 mL, and formamide, 4 mL) and









analyzed using a 10% PAGE gel (7 M urea). The gel was analyzed with the

Molecularlmager.

PCR amplification

To facilitate strand separation, one of the PCR primers (P2-C6) was designed to

contain a tetranucleotide appended to the 5'-position via two C6 polyethyleneglycol units.

This made the product derived from the primer move slower in a gel electrophoresis

experiment than the product derived from the reverse primer. [Williams and Bartel 1995]

Template T2-pyDAD (50 pmol) was mixed with 5'-radiolabeled primer P2-C6

(750 pmol), primer P2-Rev (750 pmol), dATP, dTTP, dCTP, dGTP, d(puADA)TP,

d(pyDAD)TP (final conc. 200 iM each), HIV RT buffer (333 IL, 3x), and the reaction

volume adjusted to 1 mL with water. The mixture was heated to 950C (10 mi) and

allowed to cool to ambient temperature (1 h). HIV RT (Y188L,E478Q) (10 U) was added

to the reaction mixture, which was then incubated at 37 C for 24 hours. An aliquot (5

IL) was removed and quenched with 20 mM EDTA in formamide (5 IL). The remaining

reaction mixture was heated again to 95 OC for 10 minutes and again cooled to ambient

temperature over 1 hour. Another aliquot of RT was then added. This cycle was repeated

4 times. The products from each round of PCR amplification were resolved using a 12%

PAGE gel (7 M urea). The gel was analyzed using the Molecularlmager software. A

positive control experiment was run under the same conditions while substituting T-2 for

T2-pyDAD.

Fidelity assay

The PCR was quenched with EDTA (final conc. 10 mM) and the DNA isolated via

ethanol (2.5 mL) precipitation and subsequently washed with 70% ethanol in water. The

dry pellet was dissolved in PAGE loading buffer and analyzed by electrophoresis on a









20% PAGE gel (7 M urea). The product generated from full extension of primer P2-C6

was longer, and therefore migrated more slowly, than the product generated from the full

extension of P2-Rev. The product from full extension of P2-C6 was cut from the gel and

extracted by incubating in a crush and soak buffer (0.1% SDS, 0.5 M NH40Ac, 10 mM

Mg(OAc)2) at 37 C overnight. The solution was filtered through a Millipore filter (0.45

lm pore size) and the DNA recovered by ethanol precipitation. The DNA pellet (T1-

puADA-PCR) was dissolved in water to a final concentration of 10 riM.

T1-puADA-PCR (2 pmol, presumably generated by the PCR) was mixed with

radiolabeled P2-Rev (1 pmol), Thermopol buffer (final conc. 20 mM Tris-HC1, pH 8.8,

10 mM KC1, 10 mM (NH4)2S04, 2 mM MgSO4, 0.1% Triton X- 100), dATP, dCTP,

dTTP, dGTP (final conc. 10 |tM each), and the reaction volume was adjusted to 14 itL

with water. Heating (95 C, 10 min) and cooling to ambient temperature (1 hour) the

respective polymerase (reaction 1 with Taq, reaction 2 with Vent exo+) was added (1 itL,

U/[tL) and the mixture was incubated at 72 C for 15 seconds. The reactions were

quenched by addition of PAGE loading buffer containing 20 mM EDTA (15 pL). The

samples were subjected to electrophoresis on a 20% PAGE gel and the gel analyzed using

the Molecularlmager software.

Paused-extension screen

Radiolabeled primer P3 (1 pmol) was mixed with template T3 (2 pmol), Thermopol

buffer (1.5 pL, 10X), dATP, dCTP, dTTP, dGTP (final conc. 10 [M each), and water to a

final volume of 14 .L. The mixture was heated to 95 OC for 10 min. and allowed to cool

to ambient for 1 hour. The respective polymerase (Taq, Vent, Deep Vent, Vent exo-, or

Deep Vent exo- ) was added (1 pL, 2 U/tL) and the reaction incubated at 72 C for 15

seconds. The reaction was quenched with 20 mM EDTA in PAGE loading buffer (15 pL)









and subsequently analyzed by electrophoresis on a 20% PAGE gel. The gel was analyzed

using the MolecularImager software.

IsoC:isoG Experimentals

Oligonucleotides and enzymes

Oligonucleotides (Table 2-3) were synthesized by Integrated DNA Technologies

(Coralville, IA). All oligonucleotides used in this study were purified by PAGE (10-

20%).

Table 2-3. Oligonucleotides used in studies of the isoC:isoG base pair.
T-1 d(GTC TTC GTG TCA CG(isoG) CCA TAG TGA GTC GTA TTA CGC)
T-2 d(GCG AAT TAA CCC TCA CTA AAG TAC G(isoG)T CGT CTA TAG
TGA GTC GTA TTA CGC)
T-3 d(GCG AAT TAA CCC TCA CTA AAG TAC GAT CGT CTA TAG
TGA GTC GTA TTA CGC)
P-1 d(GCG TAA TAC GAC TCA CTA T)
P-2f d(GCG TAA TAC GAC TCA CTA TAG)
P-2r d(GCG AAT TAA CCC TCA CTA AAG)

The "Klenow" fragment of Taq polymerase (TitanuimTM Taq) used in this study

was purchased from BD Biosciences (Mountain View, CA). As TitaniumTM Taq is a "hot

start" enzyme, the enzyme was heated to 95 OC for 2 minutes, followed by rapid cooling

to ambient temperature prior to any primer extension reactions. Similarly, all PCR

reactions included an initial 2 minute 95 C denaturation cycle.

Primer extension reactions

In a typical primer extension reaction (25 ptL total volume), 5'-32P labeled primer

(P-l, 25 pmol) and template (T-1, 30 pmol) were mixed with buffer (10 mM bis-

trispropane-HCl pH 9.1, 40 mM potassium acetate, 5 mM magnesium chloride, 0.1

mg/ml bovine serum albumin), heated (95 C, 5 min), and allowed to cool to ambient

temperature over one hour. Polymerase (1 unit) was added, and the mixture was again









heated (72 C, 10 sec). Each reaction was initiated by adding the appropriate dNTPs

(final concentration 100 pLM). Aliquots (2 [tL) were taken from each reaction at the

appropriate time, and the reaction quenched by dilution into PAGE loading/quench buffer

(2 [tL, 20 mM EDTA in formamide). Samples were the heated (95 C, 5 min) and

resolved by electrophoresis using a 20% PAGE (7 M urea) gel. The gel was analyzed

using Molecularlmagercsoftware.

To improve reproducibility, master mixes of the primer/template in buffer were

prepared in large scale (100 [tL).

Direct competition reactions

Single turnover primer extension reactions were performed by annealing 5'-32P

labeled primer (P-2f, 1 pmol) and template (T-2 or T-3, 1 pmol) in the appropriate buffer

as described above. Polymerase (1 pmol) was added, and the mixture was heated (72 C,

10 sec). The reaction was initiated with the addition of isoCTP (100 pM) and either 2-

thioTTP (100 [LM) or TTP (100 [LM) in the presence of unlabeled trap DNA (P-2f, 100

pmol, T-2, 100 pmol) and the reaction was quenched (20 mM EDTA in formamide) after

20 seconds. The samples were resolved by electrophoresis using a 20% PAGE (7 M urea)

gel containing p-acrylamidophenylmercury chloride (APM, 1 [tg/mL). This permitted the

separation of oligonucleotides containing thiothymidine (which ran slower) from those

that did not. APM was synthesized as described [Igloi 1988].

PCR amplification

For each six-letter nucleotide system investigated, seven parallel PCR mixtures

were cycled (30 rounds, 950C:45 sec. 450C:45 sec. | 720C:1.5 min) with identical

amounts of primers P-2f (32P labeled) and P-2r (1 pmol; 6 x 1011 molecules) and various









concentrations of templates T2. These were obtained by 10 fold serial dilutions (from 6 x

104 6 x 1010 molecules per reaction). As each 10 fold dilution in template was

equivalent to ca. 3.3 rounds of amplification, the fidelity of the isoC:isoG replication

could be monitored on a round-by-round basis, with each amplicon requiring a different

number of exponential amplifications to consume the primers (Table 2.)

Amplicons testing the substitution of 2-thioTTP for TTP in a PCR were generated

as above, using primers P-2f and P-2r (1 pmol each), template T-3 (6 x 104 molecules),

and either all four natural dNTPs (100 [iM each) or by substituting 2-thioTTP for TTP.

Table 2-4. PCR amplicons.
Template molecules 6 x 10106 x 109 6 x 108 6 x 107 6 x 106 6 x 105 6 x 104
Primer molecules 6x 10116 x 10116 x 10116 x 10116 x 10116 x 10116 x 1011
Amplification 10 102 103 104 105 106 107
Doublings (PCR rounds) 3.32 6.64 9.97 13.29 16.61 19.93 23.25

Acid cleavage fidelity assay

Following PCR amplification, the reaction mixtures were treated with an equal

volume of acetic acid (0.1 mM), and incubated (95 C, 30 min), a procedure that

depyrimidinylates the iso-cytidines that have been incorporated. The tubes were then

opened, and the volatiles removed by evaporation at atmospheric pressure. Two volumes

of ammonium hydroxide (0.1 mM) were then added, and incubation was continued (95

C, 5 min). This step cleaves the product DNA strands at the site of where isoC had been

located. The ammonium hydroxide was allowed to evaporate, and the mixtures were

dissolved 2-fold with gel loading buffer (98% formamide, 10mM EDTA, Img/mL

bromophenol blue, Img/mL xylene cyanol FF) and analyzed by denaturing PAGE (17%).

Quantitation of the cleaved (isoC containing) versus full-length (not containing isoC)

product indicated the fidelity ofisoC and isoG replication.









Data analysis

To estimate the percentage of isoC retained per round of the PCR reactions, the

percent of product containing isoC, as determined by the cleavage assay, was graphed

against the number of doublings required to consume all of the primer added. The

r
number of product molecules generated in a PCR reaction is equal to N = n 2 (eqn 1),

where n equals the number of template molecules, N equals the number of product

molecules, and r equals the number of rounds of perfect doubling required to use all

primer molecules. Similarly, the number of product molecules containing isoC is equal to

r
NiC = n (1+R) (eqn 2), where R is the retention of isoC per round. The percentage of the


PCR product containing the isoC:isoG base pair is equal to N/ NiC, which simplifies to


(1/2 + R /2) Data from the PCR amplifications were graphed and fit to the equation y =

x
100 (1/2 + R /2) using the program Kaleidagraph Version 3.5; Synergy Software,

Reading, PA), where Xis the number of doublings (i.e. PCR rounds) as calculated in

table 2 and y is the percent cleaved product from each reaction.

Results

pyDAD:puADA Enzymology

Primer extension experiments were performed for the four variant forms of HIV-

RT (Y181I, Y188L, M184V, and AZT-21). Each was challenged to incorporate a single

d(puADA) nucleotide opposite a d(pyDAD) at position 26 in the template (T2-K), five

nucleobases upstream of the 3'-end of the primer. Experiments were done in parallel, one

containing only standard nucleoside triphosphates (the "minus" control), the other









containing the standard dNTPs plus d(puADA)TP. The progress of the primer extension

reaction was followed by PAGE on samples removed at time intervals.

Results of these experiments suggest that HIV-RT variants Y188L (Fig. 2-17a) and

Y181I (data not shown) both produced more full-length product in the presence of

d(puADA)TP than in its absence, while variants AZT-21 (data not shown) and M184V

(Fig. 2-17b) did not. This made variants Y188L and Y181I candidates for further

polymerase development.

a) b)
I -51nb- m a -"










2, ... m -

0 2 *g -21nb-

PF P F
+ pu(ADA)TP -pu(ADA)TP + pu(ADA)TP pu(ADA)TP

Figure 2-17. Primer extension experiments with two HIV-RT variants, Y188L (gel a) and
M184V (gel b). For each, the variant was incubated, for times ranging from 1
min to 1440 min (left to right, in direction of arrow, with template T2-K,
radiolabeled primer P2-RS, dATP, dGTP, dCTP, and dTTP, and either with
the complementary d(puADA)TP (left panel of each gel) or without
d(puADA)TP (right panel of each gel). Time points are at 1, 30, 60, 120, 240,
480, and 1440 min. P is the unextended primer, 21 nts in length. F is full
length product, following addition of 30 nucleotides to the primer.

Primer extension experiments testing the incorporation of d(pyDAD)TP opposite

d(puADA) in the template were then performed with these candidates. Variants Y188L

and Y181I were incubated (1 to 480 min) with the standard triphosphates with and







50


without the complementary d(pyDAD)TP. The results (Fig. 2-18) suggest that Y188L

produced a slightly higher ratio of full-length product in the presence of d(pyDAD)TP to

full length product in the absence of d(pyDAD)TP, while variant Y181I produced a lower

ratio. This made Y188L the prime candidate for further examination.


gr0 fl a


* ,


P F
-d(pyDAD)TP


M- O 51nb -


-25nb -


- 21nb- *


*aipyDADITP


PF
-d(pyDAD ITP
-dtpyDAD|TP


+d(pyDAD)TP


Figure 2-18. Primer extension experiments with two candidate HIV-RT variants, Y181I
(gel a) and Y188L (gel b). For each, the variant was incubated with template
T1-X, radiolabeled primer P1-RS, dATP, dGTP, dCTP, and dTTP, and either
with the complementary d(pyDAD)TP (left panel of each gel) or without
d(pyDAD)TP (right panel of each gel). Time points are at 1, 15, 30, 60, 120,
240, and 480. The data suggest that HIV-RT variant Y188L both produced a
slightly higher ratio of full-length product in the presence of d(pyDAD)TP to
full length product in the absence of d(pyDAD)TP, while variant Y181I
produced a lower ratio. This made Y188L the prime candidate for further
examination.

Both pu(ADA) and py(DAD) display acid-base chemistry. The heterocycle of

pu(ADA) is an acid with a pKa of ca. 5.7. [Roy and Miles 1983] In contrast, py(DAD) is

protonated, and the conjugate acid was measured to have a pKa = 6.7. [Nar36] A series of

single nucleotide primer extension experiments were therefore performed with Y188L to


Ar
40l


1W W


* W* 4*









identify the nucleotides most likely to compete with the nonstandard nucleotides during

primer extension, and to assess the impact of pH on incorporation.

To determine the optimal pH for d(puADA)TP incorporation, Y188L was

incubated at pH 5.5 to 7.5. The results showed little incorporation at pH < 6.5 (data not

shown). The optimal pH was between 7.0 and 7.5 (Fig. 2-15). While we do not know the

exact pKa of either py(DAD) or pu(ADA) heterocycles when incorporated into an

oligonucleotide, they are likely to be higher than 6.7 and 5.7. Therefore, it is possible that

at the optimal pH for this reaction, the pu(ADA)-py(DAD) pair is an anion-cation pair.



0 a b on
P A C G T ADA R P P A C G T ADA P R P A C G T ADA P R
pH 7.0 pH 7.5 pH 8.0

Figure 2-19. Single nucleotide primer extension experiments as a function of pH with
Y188L. Variant Y188L was incubated for 30 min at the pH indicated, with
template T2-pyDAD, radiolabeled primer P2-SS and one of the four standard
deoxynucleoside triphosphates or d(puADA)TP. Lane P (primer alone); Lane
A, with dATP,; Lane C, with dCTP; Lane G, with dGTP; Lane T, with TTP;
Lane ADA, with d(puADA)TP, Lane R, positive control with substitution of
T2 for T2-pyDAD, thus having dA instead of the non-standard nucleotide.
Noticeable in all experiments is the primer band (labelled P) and a degradation
band (below the primer band); the degradation of the primer was due to a
DNAse activity of the reverse transcriptase itself, an activity that was removed
by the mutation E478Q (see text). The optimal pH was 7.0-7.5. It should be
noted that oligonucleotides containing a puADA residue migrate slightly
faster due to the negative charge on the heterocycle.

Noticeable in all gels is a band below the primer band. This was not due to a failure

in the synthesis of the primer. Rather, the band appeared to arise through degradation

caused by a DNAse activity present in the reaction mixture. The two possible origins of

this activity are contamination, perhaps E. coli DNAse I, or a residual 3'exonuclease

activity of the RT RNAse H domain. The latter activity has not been previously reported.









Assuming that the DNase activity was occurring at the ribonuclease site of RT, we

replaced Glu 478 by Gin at that site. This generated a double mutant Y188L -E478Q.

Preparations of this variant did not degrade the primer.

Although HIV RT has been tested extensively for DNAse activity, the previous

investigations did not use a five day incubation with single stranded substrate. Therefore,

this result may indicate a hitherto undetected trace single stranded 3'-

exodeoxyribonuclease activity associated with the enzyme. We cannot, however, rule out

the possibility of contamination by E. coli DNAse I, which could be more easily

separated from the double mutant than either the single mutant or native RT.


S- FL





25nb
M 4 W 21nb
012345 F

Figure 2-20. PCR amplification (from left to right, 0 to 5 rounds, each 24 hours) of
template T2-py(DAD) using primers P2-C6 and P2-Rev in the presence of
dNTPs, d(puADA)TP, and d(pyDAD)TP (200 jiM each), showing the
appearance of full length product, seen in the positive control labeled F, using
the double variant HIV-RT Y188L E478Q. Note the absence of degradation of
primer due to the knockout of the nuclease activity via the E478Q mutation.
Reverse transcriptase was added at each cycle.

We then asked whether the variant enzyme (Y188L-E478Q) was able to PCR

amplify a DNA duplex containing a py(DAD)-pu(ADA) pair. Because RT is not

thermally stable, the amplification was done at 37 C, where additional RT variant was

added after each heating/annealing cycle. The amplification was performed over 5

rounds, with each elongation step lasting 24 hours to allow sufficient incorporation and









elongation of the NSB. An aliquot (5 pL) was removed from the reaction after each

round and examined by PAGE to trace the progress of the reaction. The results (Fig. 2-

20) display the disappearance of primer and the generation of full length product with

amplification.


% b)


25- a


21 -



PT DV F


- 22 nb

-18 nb


P Taq DV


Figure 2-21. a) Use of Taq and DeepVent (DV) exo+ polymerases as sequencing tools.
Both polymerases were incubated with template T3, primer P3, and
dNTPs.P=primer alone, 19 nts in length. Both polymerases abort elongation
upon encountering dX in the template, but efficiently generate (as expected)
full length products when challenged with templates containing only A, T, G,
and C. b) Proof that the PCR product (from round 5) contained dX nucleotide.
Primer extension experiment with primer P2-Rev and the product of round 5
of the PCR experiment, with Taq and DeepVent polymerases. Pausing at
position 25 demonstrates the presence of neither A, T, G, or C at this position.
Generation of <5% full length product establishes <5% misincorporation of
the standard nucleotides after 5 rounds of PCR amplification.

We then asked whether the PCR-amplified product retained the AEGIS

components. To this end, a novel sequencing technique was developed to determine the

amount of misincorporation at the NSB site. We found that Taq polymerase terminates

the elongation of a primer when the polymerase encounters a d(puADA) in the template

(Fig. 2-21b). Thus, the PCR generated oligonucleotide containing d(puADA), after









isolation from all other PCR products and reactants, was tested for elongation termination

using Taq polymerase, the natural dNTPs, and the appropriate radiolabeled primer (P1-

RS). The results indicate that >95% of the primer extension stopped at position 25 (Fig.

2-21a), establishing that the nonstandard base survived the five rounds of PCR without

being replaced by more than 5%.

isoC:isoG Enzymology

Running start primer extension reactions were performed with KlenTaq polymerase

to examine its ability to incorporate either TTP or 2-thioTTP opposite isoG. For each

reaction, the polymerase was challenged to misincorporate the respective triphosphate

opposite the isoG residue at position 26 in the template (T-l), 3 nucleotides downstream

of the primer (Pf-1) terminus. Reactions were run in parallel, one containing dGTP and

TTP, one containing dGTP and 2-thioTTP, one containing dGTP and isoCTP (positive

control), and one containing only dGTP (negative control). Aliquots of each reaction

were quenched at various times and analyzed by PAGE on a 20% polyacrylamide gel.

In running-start primer extension reactions (Fig. 2-22), KlenTaq polymerase

incorporated all 3 dNTPs tested (isoCTP, TTP, 2-thioTTP) opposite an isoG in the

template, with isoCTP incorporated most efficiently, followed by TTP and 2-thioTTP. It

is noteworthy that after one and three minutes of incubation, the polymerase incorporated

approximately 2 fold more isoCTP than TTP opposite isoG.

This result illustrates the well-known nonspecificity of polymerases challenged

with a template containing isoG. Most polymerases also incorporate T as well as isoC

opposite isoG, either via a wobble base pair or, more likely, opposite the minor tautomer

of isoG that is complementary (in the Watson-Crick hydrogen bonding sense) to T.

[Robinson et al. 1998]










template
base



Bl 4b> 4* Ok a l A lk tC
C
4 bba C


P 0.5 1.0 3.0 0.5 1.0 3.0 0.5 1.0 3.0 0.5 1.0 3.0 Time
GTP i-CTP GTP, TTIP GTP, 2-thioTTP GTP (min)

Figure 2-22. Primer extension reactions comparing 2-thioTTP and TTP incorporation
opposite isoG. Taq polymerase was incubated with template (T-1), primer (P-
1), dGTP, and either isoCTP, TTP, or 2-thioTTP at 72 C. Time points taken
at 0.5, 1.0, and 3.0 minutes show extension up to the template isoG (by
incorporation of two dGTPs), and incorporation of the dNTP of interest
(isoCTP, TTP, or 2-thioTTP) opposite the isoG. The data suggest that TTP is
more readily incorporated opposite isoG than is 2-thioTTP.

These data also show that 2-thioTTP was misincorporated very little opposite isoG

in the 0.5 and 1 min incubations. After 3 min, misincorporation gave rise to a more

obvious band (Fig. 2-22). This establishes that 2-thioTTP is misincorporated opposite

isoG to a much lesser extent than is TTP. This is especially so at incubation times

relevant for a typical PCR elongation step (for DNA < 2Kb) of between 45 and 90

seconds.

In two parallel reactions, one containing equal concentrations of 2-thioTTP and

TTP, and one containing equal concentrations of 2-thioTTP and isoCTP, KlenTaq

polymerase was challenged to choose a nucleotide to incorporate opposite isoG. Affinity

electrophoresis on a polyacrylamide gel (20%) containing p-acrylamidophenylmercury

chloride (APM, 10 [tg/mL) was used to separate those products extended with a 2-thioT

from those extended with a non sulfur-containing dNTP (isoCTP, or TTP). [Igloi 1988]

The gel was analyzed via radioimaging.









Figure 2-23 shows the results of the direct competition experiments, wherein the

DNA containing 2-thioT migrates at a slower rate than a typical oligonucleotide due to

the interaction of its thiol with the mercury in the APM. It is observed that when placed

in direct competition for incorporation, the polymerase incorporates either isoCTP or

TTP opposite isoG, with less than 1% of the extended product resulting from

incorporation of 2-thioTTP. Also notable is the observation that Taq polymerase prefers

2-thioTTP over TTP as a substrate for incorporation opposite adenosine. This unexpected

result was not observed for Family B polymerases (data not shown).

template base A isoG


P+s Ie





P + T/iC

primer (P)

dNTP T S T,S iC,S T,S

Figure 2-23. Direct competition studies opposite isoG. The ratio of incorporation of 2-
thioTTP to isoCTP or TTP was tested in a single-turnover primer extension
reaction by incubating Taq polymerase with primer-template (primer P-2f,
template T-2), and equal concentrations of 2-thioTTP and either TTP or
isoCTP. Control reactions challenged the polymerase to extend a primer-
template with adenosine replacing the non-natural isoG (primer P-2, template
T-3) in the presence of TTP, 2-thioTTP, or both TTP and 2-thioTTP. Reaction
products were separated by denaturing PAGE on a 20% gel containing APM,
allowing for the separation of products containing 2-thioT from those that do
not (see text for details). These data show that while 2-thioTTP is preferred
over TTP for incorporation opposite adenosine, both isoCTP and TTP are
preferred over 2-thioTTP for incorporation opposite isoG. S indicates 2-
thioTTP, iC indicates isoCTP, P + T/iC is the product from the polymerase
adding a single TTP or isoCTP to the primer (P), while product resulting from
the addition of a single 2-thioTTP to the primer is annotated as P + S.









After showing that 2-thioTTP is misincorporated less frequently than TTP opposite

isoG residues, we then established that 2-thioTTP works in a PCR amplification. For this

purpose, replicate PCR reactions with KlenTaq polymerase were performed using the

PCR replicon consisting of primers P-2f and P-2r and template T-3. Three reactions were

run in parallel, one containing the four natural dNTPs (positive control), one containing

dCTP, dGTP, dATP, and 2-thioTTP, and one without TTP (negative control). Each

amplification was cycled for 30 rounds, and the products were analyzed by

electrophoresis on a 2% agarose gel.

As seen in Figure 2-24, the PCR reactions with TTP and 2-thioTTP generated

comparable amounts of product. This result shows that 2-thioTTP is not only a

satisfactory substrate for a polymerase, but can, in fact, be used as a substitute for TTP

with little affect on the yield of products.











200 bp

100 bp
50 bp

STP TTP -TTP MM

Figure 2-24. PCR amplification using 2-thioTTP. The use of 2-thioTTP as a substrate for
PCR was tested by performing 30 rounds of PCR in the presence of dATP,
dCTP, dGTP, and either TTP, 2-thioTTP, or no thymidine analog. Following
separation on a 2% agarose gel, it was observed that the reaction containing
no thymidine analog produced no product (-TTP), while both TTP and 2-
thioTTP (STP) containing reactions yielded similar amounts of product. MM
indicates a molecular weight marker.









To analyze the products of a PCR reaction with isoC, isoG, thioT, A, G, and C,

amplification of the nonstandard base pair, we used the acid cleavage method of Johnson

et al. [Johnson et al. 2004] This method exploits the facile depyrimidinylation of

isocytidine upon incubation in acid under conditions where the cleavage of the glycosyl

bonds of the standard nucleotides is slow. The resulting abasic site is then cleaved with

base, and the products are analyzed by PAGE. The relative amount of isoC that was

remaining in a full length PCR product is estimated by the intensity of the cleavage band

at the position where the isoC is expected, and normalized by the amount of full length

product. These are crude estimates, as some cleavage occurs at other sites as well.

Figure 2-26 shows the disappearance of isoC in the PCR product as a function of

rounds of PCR for both reactions containing TTP and those substituting 2-thioTTP. This

diagram shows that isoC is lost from the PCR product much more rapidly when TTP is

used than when 2-thioTTP is used. The loss ofisoC per round was obtained by fitting the

x
data to the theoretical curve y = (1/2 + R /2) (see Data Analysis section for details),


where R is the loss of isoC per round. A PCR containing 2-thioTTP displays a loss of

isoC per round of 98%. In contrast, the loss of isoC per round for PCR containing TTP is

only 93%, under the conditions reported by Johnson et al. (2).









PCR Fidelity



80
100 ---..__.






6 60


20


20 i-- 2-thio TTP
-E- TTP


0 5 10 15 20 25
Rounds of PCR

Figure 2-25. Comparison of PCR fidelity using 2-thioTTP or TTP. To test the ability of
2-thioTTP to increase the fidelity of a PCR amplifying DNA containing the
isoC:isoG base pair, two sets of PCR reactions were conducted: one
containing TTP and one containing 2-thioTTP as the thymidine analog. For
reactions containing TTP or 2-thioTTP, the loss of the isoC:isoG base pair
from the DNA during repeated rounds of PCR was followed by generating a
series of seven PCR amplicons requiring varying amounts of amplification to
extinguish available primer. Each 10-fold difference in primer/template ratio
corresponds to an extra 3.32 doublings (i.e. 3.32 rounds of PCR with "perfect"
doubling) required to use all available primer. Following the cycling of each
reaction for 30 rounds, reaction products were subjected to conditions that
cleave the DNA at sites occupied by an isoC. The amounts of uncleaved
product, containing no isoC, and cleaved product, containing isoC, were
quantified following separation by PAGE. The percent fidelity, defined as the
ratio of cleaved product to total product, was graphed against rounds of PCR,
defined as the number of perfect doublings required to use all available primer
(see Table 2 for details). To determine the fidelity-per-round of replication, f,
data were fit to the equation Y = 100 x (1/2 + R /2) Displayed are the data
from each reaction set and the fitted curves. The series of amplicons
containing 2-thioTTP displayed a loss of isoC per round of 98%, whereas the
TTP series yielded a value of 93%.









Discussion

This work shows that the Y188L-E 478Q variant of HIV reverse transcriptase can

be used to PCR-amplify an oligonucleotide containing a single pu(ADA) or a single

py(DAD). This represents the first example of an enzyme capable of replicating an

artificial genetic system in this way.

The use of Nature to generate variant enzymes capable of altered functionalities

facilitates the finding of new biocatalysts. While the directed (in vitro) evolution of

proteins is often useful in developing variants with new or altered catalytic properties,

[Arnold 1998] it suffers from a major disadvantage in that many (if not most) of the

variant enzymes do not retain any functional behavior at all. Further, it is difficult to

screen for subtle properties of a variant (such as high fidelity and high processivity, as

opposed to simple fidelity and simple processivity) that may be critical to the value of the

polymerase. Thus, combining directed evolution techniques with those described here,

where natural evolution is exploited, may in special cases speed the development of

useful biocatalysts.

From a scientific perspective, it is interesting to note that only two amino acids

must be substituted in a natural polymerase optimized for the four standard nucleotides to

create one that supports repeated PCR cycles for the amplification of an expanded genetic

system. We did not expect that a useful polymerase to be so close in "sequence space" to

that of the wild type polymerase.

From a technological perspective, since mutation of the polymerases of pathogens

is a common process by which pathogens develop resistance to drugs targeting the

polymerase, [Chou et al. 2000; Seigneres et al. 2000; Kinchington et al. 2002] the study









of polymerase variants is becoming an important tool for understanding the development

of drug resistance, one of the most significant emerging challenges in human therapy.

Loeb and his coworkers have shown that HIV-RT complements the polymerase

deficiency in a strain ofE. coli originally developed by Witkin and her coworkers.


[Witkin and Roegnermaniscalco 1992] We have now shown that Y188L complements

this defect as well (Park, unpublished). Thus, the work reported here takes the next step

towards implementing an artificial genetic system in E. coli.

This work also shows that substituting 2-thioTTP for TTP in a PCR reaction

significantly increases the fidelity in a PCR amplification of an oligonucleotide

containing the isoC-isoG base pair. This represents the first chemistry-enzymology

combination that has both sufficient fidelity and thermostability for practical application

as a 6-letter thermocycling PCR reaction.

Direct competition experiments coupled with mercuric gel separations, as exploited

here, should be generally useful in the future to assess the fidelity of incorporation of

different non-standard nucleotides. These experiments allow rapid estimation of the

relative kinetic properties for competing dNTPs [Bloom et al. 1993; Goodman et al.

1993; Creighton et al. 1995]. This technique is superior to the standard single nucleotide

addition (primer extension) reactions or the Scintillation Proximity Assay [Lutz et al.

1999] often used to distinguish those nucleotide triphosphates incorporated opposite a

particular non-natural nucleoside from those that are not. This technique can also be used

to optimize reaction parameters such as relative dNTP concentrations, buffers, and

elongation time.









The combination of the two different approaches used to engineer artificial genetic

systems, manipulating hydrogen bonding and sterically complementary base pairs, has

also been shown to be useful here [Hirao et al. 2004a; Hirao et al. 2004b]. Here, the large

sulfur of 2-thioTTP was used to "sterically steer" the fidelity of replicating a

noncanonical base pair in a more favorable direction. This steric steering approach to

fidelity may find application in the next generation of noncanonical DNA alphabets as 2-

thioCTP, 4-thioTTP, and 6-thioGTP are all known to be readily incorporated into DNA

by polymerases.

These successes illustrate that there are multiple solutions to a common biological

problem. The development of the artificial genetic system comprising the

pyDAD:puADA base pair used a mutant polymerase to gain the fidelity and processivity

necessary to replicate the synthetic components of the artificial genetic system. The work

with the isoC:isoG base pair changed the genetic system itself to achieve the same goal.

The artificial genetic systems developed in this study can now pass their genetic

information onto progeny molecules. These systems are now amendable to further

investigation into the properties of genetic systems necessary for complex processes such

as natural selection and evolution.














CHAPTER 3
LINKING GENOTYPE WITH PHENOTYPE

Introduction

The Genotypic-Phenotypic link

The central dogma of molecular biology describes the link between the genetic

makeup of an organism, its genotype, and the physical traits it presents, its phenotype.

DNA is the genetic material that encodes for a protein, and the protein performs a

function that contributes to the phenotype of the organism. For life on Earth, the link

between genotype and phenotype has an intermediate molecule, mRNA, that functions to

take the information stored in the genome by DNA and convert it into a molecule, a

protein, which alters the chemistry of a cell causing a displayed trait (Figure 3-1).

Genotype Phenotype
transcription translation
DNA I > RNA I > Protein
RNA polymerase Ribosome

Figure 3-1. The central dogma of molecular biology. DNA, serving as the genetic
material, is transcribed into RNA by RNA polymerase. The RNA is then
translated in protein by the ribosome.

In this system, the role of DNA is one of information storage and transfer, while

proteins play a role in the observed phenotype of an organism. The observed phenotype

determines the fitness of the organism, that is, how well the organism survives in its

environment. Those organisms that survive long enough to reproduce pass on their

genetic information, in the form of DNA, to their progeny. Those that are unsuccessful at

surviving do not pass on their genetic material. In this way, natural selection effects the









population of genes in the gene pool. Thus, natural selection acts on the phenotypic,

rather than the genotypic, level.

This illustrates that life, being defined as a chemical system capable of Darwinian

evolution, must not only store genetic information, but must also have a mechanism to

translate that information into a useful form. This is best illustrated by using the analogy

of an electronic document and a computer program. A document written on a word

processing computer program contains information; it is nothing more, and nothing less,

than a string of Os and Is. Similarly, DNA contains information and is nothing more than

a string of As, Gs, Ts, and Cs. However, the string of Os and is in a word processing

document does not have any "meaning" in the absence of the word processing program

that interprets it; the word processing program links the information to a functional

output. Just as the Os and Is encode for letters and words in a word processing document,

the nucleosides of DNA encode for proteins to create an output that has function.

Linking Genotype with Phenotype in Artificial Genetic systems

The artificial genetic system discussed in Chapter 2 is a chemical system capable

of Darwinian evolution; it can function as an information storage molecule and can pass

this information on to future generations of molecules. Because evolution functions on a

phenotypic level, however, these molecules cannot yet evolve.

Developing a link between genotype and phenotype with the artificial genetic

system is the next step in generating a synthetic system that undergoes Darwinian

evolution. Establishing this link is a difficult challenge. Developing the enzyme

machinery necessary for transcription and translation of the artificial genetic system

requires the engineering of RNA polymerase, tRNA molecules, and possibly the

ribosome.









To avoid the labor-intensive process of developing transcription and translation for

the artificial genetic system, a new method for linking genotype and phenotype must be

developed. The catalytic properties inherent in some oligonucleotides offer a solution. By

developing a catalytic DNA molecule comprising the artificial genetic system, one

creates a genotypic-phenotypic link without further enzyme engineering. The molecules

themselves will serve as both the genetic material, the genotype, and the phenotypic trait,

the phenotype.

Nucleic Acids as Catalysts

Nucleic acids have always been viewed as relatively passive molecules for storing

and transferring information. It was not until Tomas Cech discovered a self-splicing

intron from Tetrahymena that the catalytic properties of RNA expanded this view to

include a more versatile role for the biochemistry of RNA [Kruger et al. 1982]. Shortly

thereafter, Altman and coworkers reported one of the first truly catalytic RNA molecules,

the RNA subunit ofRNase P [Guerriertakada et al. 1983]. Cech and Altman shared a

Nobel prize for their discoveries.

While there are relatively few naturally occurring RNA catalysts in living systems,

the discovery of catalytic RNA (ribozymes) revitalized the RNA world hypothesis [Crick

1968; Orgel 1968]. The RNA world hypothesis, a theory stating that RNA was

responsible for the roles of a genetic system and primary metabolism prior to the

adoption of these functions by nucleic acids and proteins respectively, was now a testable

hypothesis.

As the first step in testing the RNA world hypothesis, the repertoire of chemical

reactions catalyzed by nucleic acids must be examined. To differentiate between those

chemical reactions that could be catalyzed by RNA from those that could not required the









development of synthetic ribozymes. This work included investigations into the catalytic

potential of DNA as well. An in vitro technique for developing artificial nucleic acid

based catalysts was developed by Dr. Gerald Joyce [Joyce 1989]. This process, termed in

vitro selection, was exploited by Joyce and others to investigate the catalytic potential of

nucleic acids. Using this technique, scientists have become efficient at producing nucleic

acid catalysts with novel functions including RNases, ligases, replicators, nucleotide

synthesis, polymerases, and molecular [Doudna and Szostak 1989; Tsang and Joyce

1996; Joyce and Santoro 1997; Santoro and Joyce 1997; Bartel et al. 1991; Unrau and

Bartel 1998; Stojanovic and Stefanovic 2003].

In vitro Selection

In vitro selection involves placing a selection pressure, usually the catalysis of a

desired reaction, on a population of random DNA or RNA molecules to separate those

molecules capable of catalysis from those that are not [Joyce 1989]. The population of

molecules that survive the selection pressure are regenerated and the selection pressure is

applied again. As this process is repeated, each resulting population becomes enriched

with molecules that can perform the necessary reaction. The end result of a successful

selection is a population of molecules that are catalysts for the desired reaction.

The many successes of generating populations of molecules with desired properties

demonstrates the power of in vitro selection as a tool for the development of new

catalysts; this technique is derived from natural selection and evolution, processes proven

in nature. In this sense, in vitro selection recreates an evolutionary-type process in a

synthetic system, representing synthetic biology's re-creation of complex biological

process. As such, in vitro selection can be viewed as a means to experimentally study the

processes governing natural selection and evolution. Alternatively, in vitro selection can









be viewed as a technique for the development of molecules with desired properties, with

no interest in the evolutionary-like process responsible for the technique's success.

These two alternative views of in vitro selection represent the goal of the researcher

performing a selection. Those researchers viewing selection as a technique for developing

catalysts are most interested in the outcome of the selection, with success being defined

by the rate of the obtained catalyst. In contrast, those who are interested in applying in

vitro selection to the study of evolution are interested in how the molecular population

changes throughout the selection, as well as selection outcome.

In vitro selection is most often viewed as a combination of both a method for

catalyst development and a method of study. The experimental design, however, often

favors one approach over the other. For example, Drs. Gerald Joyce and Steven Benner

are both interested in applying in vitro selection for the development of catalysts and the

study of evolution. However, the experimental setup of selections performed by Joyce

favor the development of catalysis, while the experimental setup typical of Benner favor

the study of evolution.

In vitro selection: a tool for generating catalysts.

As a technique, the use of in vitro selection as a tool for generating desired

catalysts is a combination of art and science. One must balance the science of

experimental design with the artistry of changing the selection conditions to achieve the

end goal, a catalytic molecule. In Joyce's view, selections aimed at obtaining catalysts

should be a technique that allows flexibility in the selection scheme, with the researcher

applying their experience to alter the conditions of the selection as they see fit. This point

is best illustrated by quoting Dr. Joyce: "Start your selection with the maximum number

of molecules. Do the selection. And see what you get out. Trust in the Force young









Skywalker". Natural selection is a process proven in nature; we must trust that it will

perform well in the laboratory and deliver to us the desired catalyst.

The role of the researcher is to manage the biological process of natural selection in

the synthetic environment. The synthetic environment can cause detriment by introducing

undesired selection pressures into the experiment. For example, properties such as

leakage, amplification bias, and intermolecular interactions all represent additional

selection pressures present in the system. One must control these unwanted selection

pressures to enrich each subsequent population in the best catalysts.

Controlling these unwanted selection pressures is accomplished by conforming the

selection conditions to the progress of the selection. For example, if the selection is

proceeding well, i.e. becoming enriched in catalytic molecules, one will increase the

stringency of the desired selection pressure. If no enrichment is observed, one will

change the selection scheme (i.e. from a column selection to a gel selection, for example)

to change the unwanted selection pressures. Changing the selection conditions in this

manner results in maximizing the desired selection pressure while minimizing the

undesired pressures.

In vitro selection: a method of study

The use of in vitro selection to study the process of natural selection differs in one

fundamental way from its use as a tool for generating catalysts; the selection conditions

often remain constant or are changed at predetermined stages of the selection. By keeping

the selection conditions constant, one can test two different sets of conditions and

determine how the resulting populations correlate with those conditions. Directly

comparing two selections differing in only one property imparts information on the

catalytic potential of the molecules and the process of natural selection.









AEGISzyme Selection

In vitro selection technology has been successfully applied to DNA and RNA

molecules, leading to both new catalysts based on these molecules and a greater

understanding of the catalytic properties of oligonucleotides. This technology has great

potential for exploring the catalytic properties of the artificially expanded genetic

information system (AEGIS) by developing catalytic molecules based on this system, or

AEGISzymes. The application of in vitro selection technology to AEGIS molecules

promises to yield a plethora of knowledge about catalysis in general.

In vitro selections of AEGIS molecules can yield information concerning many

fundamental properties of biomolecules. Of particular interest are studies correlating

sequence space with catalytic potential [Szostak et al. 1995; Kuchner and Arnold 1999].

Sequence space, or the number of possible sequences available to a molecule, is

dependent on the size of the molecule and the number of building blocks used in its

construction. The total number of distinct molecules possible for a biopolymer such as a

protein or oligonucleotide is: molecules = B where B is the number of possible

building blocks and N is the length of the molecule in terms of residues. Thus, a 30 nt

single stranded DNA molecule built from A, G, T, and C will have 430, or 1.15 x 1018

possible sequences. Similarly, a 30 nb oligonucleotide built from six nucleotides will

have 630, or 2.2 x 1023 possible sequences, 100,000 times greater variation being possible.

Joyce and coworkers investigated how limited sequence space effects catalysis by

developing a DNAzyme that lacks cytidine [Rogers and Joyce 1999]. This DNAzyme

catalyzed the template-directed ligation of RNA at a rate 10-fold faster than the

uncatalyzed reaction. This illustrates that nucleic acid based enzymes can function with

rather little diversity in the number of building blocks. It does not, however, make any









statements about the catalytic facilities of RNA when sequence space is increased beyond

the natural building blocks.

The greater variation imparted by a larger number of building blocks leads one to

question how catalysts are populated in sequence space (Figure 3-2). With a larger

number of possible molecules does one find a larger number of catalytic motifs? Is the

proportion of catalytic molecules to uncatalytic molecules the same for both the four-

letter and six-letter populations? Does a larger sequence space offer molecules with faster

catalytic rates for a particular reaction? These questions are all specifics of the larger

question: how does the distribution of catalysts in sequence space differ for differing

population sizes?






4-letter
S6-letter










Number of Molecules
Percentage of Molecules
Figure 3-2. Hypothetical distribution of DNAzymes in sequence space. Shown is a plot
comparing DNAzyme catalytic rates with the number of molecules displaying
that rate. The difference between the curves of the 4-letter and 6-letter
DNAzyme populations tells how diversity contributes to catalysis.

Linking genotype with phenotype

The ability to replicate artificial genetic systems in vitro allows us to perform the

first in vitro selection on a population of molecules comprising six nucleosides. While









such an experiment will begin to reveal answers to the above questions, it also represents

the development of more complex biological phenomena with the artificial genetic

system.

Selection pressure will be placed on the synthetic genetic system comprising A, G,

C, 2-thioT, isoC, and isoG. A parallel selection on DNA comprising A, G, C, and 2-thioT

will be used as a control. Such an experiment, challenging the artificial genetic system to

act as a ribonuclease during an in vitro selection, challenges the artificial system to

undergo the natural biological process of natural selection while developing in that

artificial genetic system a synthetic biocatalyst.

Materials and Methods

Oligonucleotide Synthesis

The oligonucleotide sequences used in this work are listed in Table 3-1.

Oligonucleotides were prepared by trityl-off solid-phase synthesis using an Applied

Biosystems automated DNA synthesizer from the P-cyanoethyl protected

phosphoramidites. An equimolar mixture of all required phosphoramidites was used for

random positions. Phosphoramidites were purchased from Glen research. All

oligonucleotides were purified by PAGE (12+20%).

Table 3-1. Oligonucleotides used in the in vitro selection.
IVS-Lib-4nb d(CGCTGTACGCAACACAAGGCN20CCGATTATTCCTGCTCTAA
TCGGGATAC)
IVS-Lib-6nb d(CGCTGTACGCAACACAAGGCN' 20CCGATTATTCCTGCTCTAA
TCGGGATAC)
IVS-Sub- 1 d(A/iBiodT/GGTACAAGGCGT/rA/TCCCGATTAGAGCAGGAATA
AT)
IVS-Pf d(TCCCGATTAGAGCAGGAAT)
IVS-Pr d(CGCTGTACGCAACACAAG)
IVS-Pr-2 d(ATTAGCGTA/Ab/Ab/Ab/CGCTGTACGCAACACAAGG)
IVS-Sub-2 d(ATGGTACAAGGCGT/rA/TCCCGATTAGAGCAGGAATAAT)
N = dA, dG, T, or dC; N' = dA, dG, T, dC, isoC, or isoG; iBiodT = internal biotin dT; rA
= Adenosine (riboadenosine); Ab = stable abasic site.









0

O O
HN NH
0 0



DMTO DMTOi i i i

0 0






iBiodT Ab

Figure 3-3. Nonstandard phosphoramidites. iBiodT is a thymidine derivative with a biotin
linked to the 5 position of the heterocycle. Ab is used to place a stable abasic
site in an oligonucleotide.

DNAzyme Preparation

For initial round of selection each DNAzyme population was prepared by

incubating mixture containing the appropriate dNTPs (4nb = natural dNTPs, 6nb =

natural and noncanonical dNTPs; natural dNTPs = dATP, dCTP, dGTP, 2-thioTTP, 100

mM each; noncanonical dNTPs isoCTP and isoGTP, 200 mM each), a-32P-dATP, primer

IVS-Sub-1 (32p labeled; 10 pmol) and template (4nb = IVS-Lib-4nb, 6nb = IVS-Lib-6nb;

0.01 pmol), and Titanium Taq (10X) at 72 OC for 10 minutes.

For subsequent rounds of selection each DNAzyme population was prepared by

PCR (15 rounds, 95 OC:45 s|45 OC:45 s|72 OC:1.5 min) containing the appropriate dNTPs

(4nb = natural dNTPs, 6nb = natural and noncanonical dNTPs; natural dNTPs = dATP,

dCTP, dGTP, 2-thioTTP, 100 mM each; noncanonical dNTPs isoCTP and isoGTP, 200

mM each), a-32P-dATP, primers IVS-Sub-1 (32p labeled; 2 pmol) and IVS-Pr (2 pmol),

template (PCR library; 0.1 pmol), and Titanium Taq (10X).









In vitro Selection

Each DNAzyme population (50 [tL) was diluted with wash buffer (100 [tL; 50 mM

Tris pH 7.5, 1 mM NaC1, 0.1 mM EDTA) and a solution of NaCl (12 [tL, 5M). Each

population was added onto a column of Neutravidine (100 ptL slurry in 50% EtOH) pre-

equilibrated with wash buffer. Each DNAzyme population was allowed to bind to the

Neutravidine for 10 minutes, with gentle mixing every minute to promote binding. Each

population was subsequently washed with wash buffer (5 times, 200 [tL). To remove the

complementary DNA strand, the column was washed with ice-cold NaOH (2 times, 200

ItL; 0.2 N). The columns were then washed 5 times with buffer EQ (200 [tL, 50 mM

HEPES pH 7.5, 150 mM NaC1). The reactions were initiated by washing the EQ buffer

from the column with the reaction buffer (100 [tL; 50 mM HEPES pH 7.5, 150 mM

NaC1, 10 mM MgCl2). The reactions were allowed to proceed for the allotted amount of

time, and then the reaction buffer was eluted from the column and collected.

DNAzyme libraries for each ribozyme population were prepared by PCR

amplification of the oligonucleotides eluted from the column. Each PCR was cycled (15

rounds, 95 C:45 s145 C:45 s172 C:1.5 min) containing the appropriate dNTPs (4nb =

natural dNTPs, 6nb = natural and noncanonical dNTPs; natural dNTPs = dATP, dCTP,

dGTP, 2-thioTTP, 100 mM each; noncanonical dNTPs isoCTP and isoGTP, 200 mM

each), primers IVS-Pf (32p labeled; 2 pmol) and IVS-Pr (2 pmol), template (column elute;

5 [tL) and Titanium Taq (10X).

DNAzyme Activity Assay

For each DNAzyme population, a PCR mixture containing the appropriate dNTPs

(4nb+ = natural dNTPs, 6nb+ = natural and noncanonical dNTPs, 6nb- = natural dNTPs;









natural dNTPs = dATP, dCTP, dGTP, 2-thioTTP, 100 mM each; noncanonical dNTPs

isoCTP and isoGTP, 200 mM each) was cycled (15 rounds, 95 C:45 s145 C:45 s172

C:1.5 min) with identical amounts of primers IVS-sub-2 (32p labeled) and IVS-Pr (10

pmol) using the PCR library as template (0.01 pmol).

The products were dissolved in an equal volume of formamide, the strands

separated by PAGE, and the DNAzyme extracted from the gel by incubation overnight in

buffer (0.2M NaC1, 0.01 M Tris ph 7.5, 0.001M EDTA). The oligonucleotides were

further purified using a SepPak. The DNAzyme populations were dissolved in buffer EQ

(100 [tL), heated (950C, 2 min), and allowed to cool to ambient temperature. MgCl2 was

added to initiate the reaction. Aliquots (10 [tL) from each reaction were removed at times

0, 60, and 240 min, and quenched with EDTA (2 [tL, 0.5 M). 2x loading dye (100 [tL;

Bromphenol blue/xylene cyanol mix 0.1 g, water, 1 mL, and formamide, 4 mL) was

added, and the samples analyzed by PAGE.

Results

In vitro Selection

An in vitro selection experiment to select for a DNAzyme having ribonuclease

activity was adapted from the method of Breaker and Joyce [Breaker and Joyce 1995]. A

library was constructed containing the substrate ribo-adenosine flanked on the 5' end by a

constant region (CR1) and on the 3' end by the "selection region" (Figure 3-4a). The

selection region contained a built in stem-loop consisting of two complementary regions

(CR2 and CR2cp) separated by 5 nt, a 20 nt random region, and a constant region

(CRIcomp) complementary to CR1. This design built a predetermined secondary









structure into the molecules, effectively building a base-pair "clamp" that favored

association of the random region and the substrate (figure 3-4b).

a)
CR1 CR2 CR2cp Random CRIcp
5'- -3'




b) GAG
5'-ATGGTACAAGGCGTrATCCCGATTA A
GGCTAAT
G N N AAG
T N N
GT N N
C N N
G N N
T N N
C N N
A N N
G NNNN
C NN
G



Figure 3-4. DNAzyme design. a) The design of the primary structure of the potential
DNAzyme. Regions are distinguished by color, with solid colors being
complementary to their striped counterparts. Blue, conserved region 1 (CR1);
red, ribo-adenosine; green, conserved region 2 (CR2); green stripe, conserved
region 2 complement (CR2cp); orange, random region; blue stripe, conserved
region 1 complement (CRlcp). b) The secondary structure of the potential
DNAzyme. A, adenosine; T, 2-thiothymidine; G, guanosine; C, cytosine; rA,
ribo-adenosine; N, variable (A, G, C, 2-thioT for 4-letter library; A, G, C, 2-
thioT, isoC, isoG for 6-letter library).

The forced association of the substrate riboadenosine with the random region,

resulting from the predetermined secondary structure designed into the molecules, is

rationalized to increase the possibility of finding a catalytic molecule in the random

population.

For each population, a cycle comprising DNAzyme preparation, selection, and

amplification was applied for eight rounds of selection (Figure 3-5). During each round,







76


Following the eighth round, the population of molecules obtained from each selection

was subject to activity analysis.

B- rA-----------------------
S3,
Regenerate DNAzmes Bind to streptavidin column


5' 3'
3 5' rA 3'

PCR amplify Remove complementary strand
w/ 0.1 N NaOH
5'- 3'
3 3 rA 3'






-3'

Figure 3-5. Selection scheme for a DNA molecule acting as a ribonuclease. Each
ribozyme population (blue) is bound to Neutravidine (grey) with an internal
biotin (B). The complementary strand (black) is removed and the reaction
initiated with Mg2+. Those molecules with cis-acting ribonuclease activity
cleave the molecule at the internal ribo-adenosine substrate (rA), thus
removing themselves from the solid support. The cleaved products are then
isolated and amplified by PCR. The PCR-generated libraries then serve as the
template to make more DNAzyme populations. The cycle is repeated.

In vitro selection

Round one of the selection challenged potential DNAzymes to cleave themselves

from a solid support in 60 minutes. This selection time was chosen as the number of

molecules cleaving themselves from the support due to the background cleavage rate of

the riboadenosine under the selection conditions produced sufficient molecules for

amplification in 15 rounds (theoretical) of PCR. The successful molecules were eluted

from the column, precipitated with ethanol, reconstituted in water, and amplified via

PCR. The amplified products were analyzed by PAGE (Figure 3-6a).










These results indicate, from a first approximation, that both the four-letter and the

six-letter libraries contained molecules capable of cleaving themselves from the solid

support.

a) b) c)






100 nt -
DNAzyme
product -
e -
50nt

40 nt


30nt e



primer *
20 nt




**


10 nt

10 bp 6 4 50 bp 10bp P 6 4 50bp 10 bp 6 4 6 4 50 bp
ladder PCR ladder ladder PCR ladder labber DNAzyre PCR ladder
product product product


Figure 3-6. Analysis of rounds one through three. a) The PCR products from
oligonucleotides eluted from the column during round one of selection. b)
PCR products from round two. c) Ribozyme populations and PCR products
from round three of the selection.

Round two of the selection challenged the DNAzymes to cleave themselves from

the solid support in only 10 minutes. Following elution from the column, the cleaved









molecules were amplified by PCR and analyzed by PAGE. These results (Figure 3-6b)

indicate that the four-letter library produced little full-length product. As all primer had

reacted, it was rationalized that the lack of a correct size product was due to over

amplification of the population.

Over amplification of the four-letter population is attributed to a low primer to

template ratio in the PCR. As the PCRs for both the six-letter and the four-letter eluted

populations used the same amount of primer, a different concentration of template

between the two reactions accounted for the difference in amplification products. This

indicates that the over-amplified, 4-letter population contained a higher concentration of

template, and thus more catalytic molecules than the 6-letter population.

To recover the population, the correct size product was cut from the gel and

extracted. The population was then amplified by PCR to generate the library for the next

round of selection.

Round three of the selection challenged potential DNAzymes to cleave themselves

from a solid support in 10 minutes. To avoid problems associated with PCR over

amplification, an aliquot of the eluted population was used as the template for the PCR

amplification. The amplified products were analyzed by PAGE (Figure 3-6c).

Round four of the selection challenged potential DNAzymes to cleave themselves

from a solid support in 10 minutes. Following the selection, the eluted products exhibited

about 400 cpm, as measured by a Geiger counter. An aliquot of the eluted products from

each population was amplified via PCR and the products analyzed by PAGE (data not

shown).









These results indicate that the pools are being enriched in catalytic molecules as the

amount of DNA eluting from the column after the selection, determined by measuring the

amount of radiation present in the samples, is increasing. It was rationalized that the

selection time for the next round should be kept at 10 minutes, thus allowing the amount

of enrichment to be further evaluated.

Round five of the selection challenged potential DNAzymes to cleave themselves

from a solid support in 10 minutes. Following the selection, the eluted products exhibited

about 1200 cpm, as measured by a Geiger counter. An aliquot of the eluted products from

each population was amplified via PCR and the products analyzed by PAGE (data not

shown).

The increase in radiation eluted from the column observed for this round of

selection indicates that enrichment of the population is occurring. The observation of

enrichment was used as an indicator of selection success. To gain further enrichment of

the population, the stringency of the selection should be increased by decreasing the

selection time.

Round six of the selection challenged potential DNAzymes to cleave themselves

from a solid support in 1 minute. The eluted DNA displayed no radiation over

background. This was expected as the number of molecules with catalytic rates sufficient

for cleavage in one minute is likely to be small.

An aliquot of the eluted products from each population was amplified via PCR. The

amplified products were analyzed by PAGE (data not shown).










Rounds seven and eight of the selection also challenged potential DNAzymes to

cleave themselves from a solid support in 1 minute. For these rounds, no radiation was

eluted from the column during the selection.

DNAzyme Activity Assay

The activity of the DNAzymes was assayed in solution rather than on a column.

Each DNAzyme population was prepared by PCR and the desired strand purified by

PAGE. Each reaction tested the amount of cleavage of the DNAzyme population at times

0, 1, and 4 hours (Figure 3-7).








DNAzyme

50 bp
40 bp

30 bp



Product






10 bp

time(min) 0 60 240 0 60 240 0 60 240
6nb+ 6nb 4nb
Figure 3-7. DNAzyme activity analysis. Times (0, 60, 240 minutes) for each population
(6nb+ = 6-letter population; 6nb- = 6-letter population generated with only
natural dNTPs; 4nb = the 4-letter population.

These results indicate that no cleavage is observed over background for either the

4-letter or the 6-letter populations. Thus, the populations of molecules were not









significantly enriched in catalytic molecules. Such results may reflect the rather small

random region of the DNAzyme. Negative results were also observed for a similar

selection for DNAzymes containing the same predetermined secondary structure and a 20

nt random region (Carrigan personal communication).

Discussion

This work represents the first time a selection pressure was applied to a population

of artificial genetic molecules comprising six DNA base pairs. Ultimately, the in vitro

selection of the artificial genetic systems was unsuccessful in developing molecules

acting as a ribonuclease for either the six-letter or the four-letter populations.

The failure to develop catalytic molecules can be attributed to many possible

explanations. Such possibilities, including a relatively small random region for the

establishment of a catalytic motif, detrimental effects of 2-thioT on the catalytic potential

of DNA, or consequences of unfaithful replication of isoC and isoG, can be further

discussed. It is not possible, however, to determine which explanation, or combination of

explanations, is responsible for the failure to develop catalytic DNA molecules using in

vitro selection.

The secondary structure built into the DNAzyme populations, while effectively

giving the random region access to the ribo-adenosine substrate, effectively forces the

random region of the molecule to be responsible for catalytic function. The random

region, being only 20 nt long, is relatively short; DNAzymes with similar secondary

structure have a 25 nt loop corresponding to the 20 nt random region in our design [Joyce

and Santoro 1997; Santoro and Joyce 1997]. Thus, the 20 nt random region may, in fact,

be too small to form an appropriate secondary structure that can act as the catalytic motif.









Alternatively, the catalytic motif may be reduced in function by the substitution of

2-thioT for T in both the 4-letter and the 6-letter populations. This is the first example of

2-thiothymidine being used for the development of a catalytic DNA molecule, and thus

the effect of this substitution on catalysis is unknown. The thioamide functionality in 2-

thioT is responsible for both the decreased hydrogen-bonding potential of the thione and

the increased acidity of H3.

This technique, while routine for natural DNA, suffered consequences due to the

artificial genetic system. Specifically, replication infidelity replacing isoC and isoG

nucleotides with natural bases most likely played a detrimental role in the outcome of the

selection. Thus, in addition to assessing the catalytic facilities of DNA containing isoC

and isoG, these experiments also examined aspects concerning the replication of the

artificial DNA and the selection process themselves.

The loss of isoG and isoC from a potential DNAzyme during PCR changes the

primary structure, and thus the catalytic properties of the DNA molecule. Those

molecules that are good catalysts may become poor catalysts through the process of

mutation. This property, termed anti-enrichment, does just the opposite of in vitro

selection; while in vitro selection is enriching the population of molecules in fast

catalysts, mutation is enriching the population in uncatalytic DNA.

These antipodal processes offer an opportunity for study. By comparing the rates of

enrichment and anti-enrichment, the level of selection pressure necessary for a successful

selection can be determined. In addition, because the main cause of selection failure is

leakage, the most common form of anti-enrichment, the detrimental effects of leakage on

a selection can be better understood [Carrigan et al. 2004].









Aside from explanations concerning the failure of the selection to generate a

catalyst, one can also examine the unscripted obstacles encountered during the selection.

The over-amplification of the 4-letter population in round two of the selection is a

common problem encountered during selections. In this case, the over-amplification

problem was apparent by examining two competing selections: one selection over-

amplified and one did not. Thus, observing how many effective rounds of PCR (i.e.

theoretical doublings) are required to extinguish all primer may be an effective way of

quantitatively comparing two parallel selections.

Methods of quantitatively comparing parallel selections on a round-per-round basis

was the topic of a lengthy discussion in the Joyce lab. The most applicable approach was

the use of real-time PCR during the amplification of the eluted molecules after each

round of selection. Real-time PCR allows one to observe the precise PCR cycle when

amplification becomes non-exponential, indicating that the primer is almost extinguished.

As the concentration of starting template can be easily determined by knowing number of

PCR cycles required to use all primer, one can effectively determine the number of

molecules that cleaved themselves from the column during that round of in vitro

selection. Thus, one can determine the number of catalytic molecules in each round of

selection, follow the enrichment of catalytic molecules, and better control the stringency

of selections.

In a practical sense, the use of real-time PCR can be used to simply determine

when to stop a PCR so that over-amplification, a common problem encountered during in

vitro selections, can be avoided. However, one can also see another practical outcome

from developing such technology. As stated earlier, obtaining a "fast" catalytic molecule






84


from an in vitro selection is part science and part art. By quantitatively correlating the

selection stringency, the enrichment of populations, and the catalytic rate of the

DNAzyme obtained at the end of a selection, one can begin to take the "art" out of

selections by determining a protocol for maximal success.














CHAPTER 4
FROM SYNTHESIS TO KNOWLEDGE: UNDERSTANDING DNA POLYMERASE
ENZYMES THROUGH THE SYNTHESIS OF GENETIC SYSTEMS



Introduction

What Have We Learned?

The successful synthesis of the artificial genetic systems was not without problems.

Most notably were the slow insertion and extension steps for noncanonical dNTPs, rates

that are directly related to replication fidelity. From a first approximation, one expects

polymerases to use these substrates as well as their natural analogs. The substrates match

all requisites for polymerase function: deoxyribonucleotide triphosphate scaffolds

presenting a base pair conforming to Watson-Crick geometry. As the enzymatic activity

of these substrates differ from their natural counterparts we must assume that our first

approximations have not recognized all necessary requites of a polymerase substrate. In

short, polymerase incorporation of a dNTP opposite its complement is dependent on

properties other than just size and hydrogen bond complementarity [Polesky et al. 1990;

Otto et al. 1992; Blandino et al. 2004; McCain et al. 2005].

In principle, there are two explanations for such properties, one concerning

function and one concerning history. A functional explanation states that the natural

nucleosides have an innate property that facilitates faithful replication, a property the

noncanonical substrates do not share. For example, the natural nucleosides all contain N-

glycosidic bonds and a large equilibrium between tautomeric forms; properties that the










pyDAD, having a C-glycosidic bond, and isoG, having relatively small ratio of major and

minor tautomeric forms, do not share. Indeed, we find that, with respect to isoG,

inhibiting the formation of the base pair between the minor-tautomer of isoG and

thymidine can increase the fidelity of replication [Sismour and Benner 2005].

A historical explanation is one that relies on the stochastic process of evolution. If

we assume that DNA was established prior to the evolution of a protein serving as a

replicator of genetic material, then the polymerase may have evolved to interact with

moieties on the natural nucleosides that are absent in their synthetic counterparts. An

example of such a difference is observed in the lone pair of electrons presented into the

minor groove (02 for pyrimidines, N3 for purines) of A, G, T, and C, yet absent in isoC,

pyDAD, and puADA (Figure 4-1).


NH2 0 NH2 0


N N NNO N
SN N N NH N N O
dR dR dR dR
A G isoG puADA

r---------------------------
Missing lone pair of electrons
0 NH2 NH2 0

NH N N W N N

N O" N O NN N NH
dR dR dR H dR H

T C pyDAD isoC
L--_-_----_--_-_---_-----------_--_-------_--_----_-_---_----_--_--J-

Figure 4-1. Electron density in the DNA minor groove. Shown is the lone pair of
electrons (red) protruding into the minor groove of the DNA by the natural
nucleosides and isoG. Also shown is the hydrogen atom protruding into the
minor groove of the DNA by the nonstandard nucleosides puADA, pyDAD,
and isoC.







87


Although it is difficult to conclude if the differences between polymerase activity

with natural and unnatural base pairs is a reflection of functional or historical

consequence, we can examine the DNA-polymerase contacts resulting from the historical

explanation. Distinguishing those interactions that are required for polymerase activity

from those that are not develops an understanding of the variations in substrate structure

tolerated by DNA polymerases, thus allowing for the design of better pharmaceuticals

targeting these enzymes, in addition to better synthetic base pairs [Frieden et al. 1999;

Ogawa et al. 2000; Henry et al. 2003].

Polymerase Substrate Interactions

a)
A:T base pair G:C base pair

Minor groove Major groove Minor groove Major groove
dR dR
N N
N Acceptor J N Acceptor
Acceptor N Accepto Acceptor N

lKN N H Donor Donor H N Ac
N N N N H Acceptor
I I I "
H H H H

Acceptor 0 N Acceptor Acceptor N Donor
1 H Donor

dR dR


b)
Minor groove Major groove

A G T C A G T C
Absent Donor Absent Absent
H Donor Acceptor Absent Absent
Acceptor Acceptor Acceptor Acceptor 0 N Absent Absent Acceptor Donor

SAcceptor Acceptor Absent Absent
dR

Figure 4-2. Hydrogen bond positions of natural nucleosides. a) Minor and major groove
hydrogen bond acceptors and donors for A:T and G:C base pairs. b) The
placement of hydrogen bond acceptors and donors are compared for each
nucleotide.