<%BANNER%>

The Role of Jak2 Tyrosine Kinase in Regulating Angiotensin II-Mediated Cellular Transcription

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110330_AAAALL INGEST_TIME 2011-03-30T14:18:26Z PACKAGE UFE0012904_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 83628 DFID F20110330_AABDTC ORIGIN DEPOSITOR PATH wallace_t_Page_035.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
05c3b228d824a0ecf967a7705cb7dc0c
SHA-1
7cb2b9a4e3dbfedc95b344ceba84b6040d6613b3
84703 F20110330_AABDSO wallace_t_Page_015.jpg
c49f74edc7a8dc7bf52c82c8a21af7ad
3b91001e68fdd2aedf376ed303c63627492a13ea
64319 F20110330_AABDRZ wallace_t_Page_152.pro
207ee26977d310226edeac9a978cc25f
8b31a6f04365a05752e7153bacc36ccd20d6135d
97046 F20110330_AABDTD wallace_t_Page_036.jpg
727437407d97985073fe317bc218c030
cfa08884a2ffe3926716eb45d6ff432d5d3140d0
99068 F20110330_AABDSP wallace_t_Page_016.jpg
d0ba32cd7a7f0128d0cfdf14435f4d97
12ba726cf70f99e0607880f0cd33f6894f1b0bdd
103032 F20110330_AABDTE wallace_t_Page_038.jpg
c08075809317d35340ba8acd12911d28
2eac03b667bb86b99d42cecda05f577b8ad4e7ed
90439 F20110330_AABDSQ wallace_t_Page_017.jpg
dba97acb5b0fcde7a6650c9de806d5dd
ff8e32c7f43c4a21e7c14a6b26956d1072e80194
97826 F20110330_AABDTF wallace_t_Page_039.jpg
485aac0cff4349fb0d6bd0904572c48f
7f78c582252cafe644fd43f8e1466539ddd044dc
74747 F20110330_AABDSR wallace_t_Page_019.jpg
fd4975d653fd8563f63c58fff6e92091
432daa53044f06f9269e030f4374ba60755a43b5
98408 F20110330_AABDTG wallace_t_Page_041.jpg
37e858c6d309a25f45a90f66d8ab6564
418f4d708aee8af65f7f9413aa7e4885ca6ddd83
105883 F20110330_AABDSS wallace_t_Page_020.jpg
d6aba4824fcf389d254c7ea08bc0ca17
a3820975a48f0c070fc00daeeb315db1a5693050
97594 F20110330_AABDTH wallace_t_Page_042.jpg
5f139abfd20c69209e47b35a7747f3d1
fe9d2b4d1317e7fbbea7aa873bff3f8f69c89b3c
103844 F20110330_AABDST wallace_t_Page_021.jpg
24600c1474aef035d0c6e3cb560115f9
a1b6d9b4ebab18cd6960d70d5045e64e9886c5cf
90593 F20110330_AABDTI wallace_t_Page_043.jpg
307c304461705f0525a19ee0c1346425
6ae01cb51944c23e9918dbb9f2bd6e261227d16b
98806 F20110330_AABDSU wallace_t_Page_023.jpg
ef39e121bb1190a32cf8d6a55cea0b8c
d5c2296bbf2cb3134883424981abaa96c06b3e33
105547 F20110330_AABDTJ wallace_t_Page_044.jpg
d21cc7dd43e3cacd6e52be6b2ef526f5
dbca882a31615d7cd4785b88cfb230ce7d984934
101915 F20110330_AABDTK wallace_t_Page_046.jpg
73e163247bb48ed2e9a5e86ee2342ff2
e9cf7e398b86b00dc9bf37ae7072678c22c8e7c7
89052 F20110330_AABDSV wallace_t_Page_024.jpg
aaae88948dacc85d235886337626d17c
5e0a058a1716a6ec9468bd14dd687acf302c1140
94120 F20110330_AABDTL wallace_t_Page_048.jpg
2a870993e84bcb50623f4c86c0f76fd9
c03810d3def3b9bb20881df41f3b33838218ab09
94523 F20110330_AABDSW wallace_t_Page_026.jpg
6b9dfb725eb1bc9df434bc21af3a672c
1e866056dc27226c10f262f8f1cedefda301c622
88352 F20110330_AABDTM wallace_t_Page_050.jpg
fdfa4fbeb8052202a5c5b5de4d4452fc
f7a6b45fdd8182968601d121c030be4bcdef970b
102139 F20110330_AABDSX wallace_t_Page_027.jpg
885c2ed3b2de7007d1440f7e4b9d0ba9
f9d83efc0473b1d1e9304de54512f92598c2e9cb
98580 F20110330_AABDUA wallace_t_Page_068.jpg
224ae8d17c6998e5ef7e918fa06fe249
bff677c94b6794dc2667f480fa1afbc14722005d
92056 F20110330_AABDTN wallace_t_Page_051.jpg
9af7c76e09f64fb5e724ac828f855bcb
846336186eef7c5091892ef73754dae3d03e0701
101897 F20110330_AABDSY wallace_t_Page_028.jpg
f7a5e7da7cbcb371c6b1990cb0fb0fb1
8fe985027c1ea8079d9f593dbc7a801bb78fa032
95406 F20110330_AABDUB wallace_t_Page_069.jpg
e49cd068a286d74ff80e40fdb8fd2990
2752ae7fa0712879de833a52869eb78fb9274f62
80246 F20110330_AABDTO wallace_t_Page_053.jpg
cc64489ef72d073b776fa1cfa7e0355a
883223949a132cddc83844106d059d74c4158187
102367 F20110330_AABDSZ wallace_t_Page_030.jpg
0478b004a9289f49d0f3fe10e62ab0d6
1dc4055a399e4a62222ab261cfd08640d198334d
101542 F20110330_AABDUC wallace_t_Page_070.jpg
e55bfaac3f9037de1b43a611ca11341b
c60207345be349337beb9a0260c3e625e20e8a61
95276 F20110330_AABDTP wallace_t_Page_054.jpg
94744be5da6eb218411a725081832bbd
585f5316a8baea3128dc66ae4a55a63d50e4cd86
85960 F20110330_AABDUD wallace_t_Page_072.jpg
da4bc69fe931edac5fc522e017dab141
6e64a9514502302cfba47c1c6be2e7e32b803f66
104319 F20110330_AABDTQ wallace_t_Page_055.jpg
1e93ed8039c61b4056679099896a9c50
8aa465abbcca066123981d360d1d30fddc5aca0a
90543 F20110330_AABDUE wallace_t_Page_073.jpg
b4ba296d576d27425e78e3ca678a4447
6e40d8b9711c950447ea5db2b6ecb181c9c5c795
99341 F20110330_AABEAA wallace_t_Page_116.jp2
a89312ca14ca8ba8873fb9b3b35c6193
b58d1d3f3ef1b1cbfa9368a8e26863102e2c4fdd
106569 F20110330_AABDTR wallace_t_Page_056.jpg
8893509c9f79eae1b0f0fc08c8b0de61
e25b577cbc6d9245d340c4196136203485795894
105717 F20110330_AABDUF wallace_t_Page_074.jpg
27ac6756f1624db2b6e4d6b7549a8e3d
fa39c93c03e5061a107015f539e0ae2319475d73
109910 F20110330_AABEAB wallace_t_Page_117.jp2
37cb21a1f36b5d7d4a279a582087897a
e6e8b57c51a39eeeab252210df6237900a904e23
101978 F20110330_AABDTS wallace_t_Page_057.jpg
912bf4a87a36f6ef9def38eee4732e9f
9d0a9269a5a35cfdcd3c45e4b933a6ed2b6e5432
100180 F20110330_AABDUG wallace_t_Page_075.jpg
3437207bcfe323f1b0080e50029dc470
c84ade16750bbd841355a0e24c425c5a9bc74b80
110538 F20110330_AABDTT wallace_t_Page_059.jpg
ceef6b08d9c204ea4c3251f234e889b2
b8f04193d7426bcc79a29051513f62118f801416
110292 F20110330_AABDUH wallace_t_Page_076.jpg
8dea304bafe595ce0b154638f0ab10fb
ea8f13776a8218dec8767443ada06d9bef221d29
1051869 F20110330_AABEAC wallace_t_Page_118.jp2
b2748a25dec4ff84ee3811765306e5f9
72fd6a7e9a09ca5a43f6a81689c219d81ee906f4
101558 F20110330_AABDTU wallace_t_Page_060.jpg
df0cb5c28195a523caad383d008b33cf
59c70f483b05eb200b5558ff6979fc640cee34ee
100043 F20110330_AABDUI wallace_t_Page_077.jpg
512ff9e441ac6192d5570fca83d5c23f
32e9b2606887f06a841dbd2ea0799e3a93e7bfc4
113866 F20110330_AABEAD wallace_t_Page_120.jp2
5e2465ce66c96b5c5399601f8d94f06f
8e9c862710e79caed02f3f1b00168d39f306011a
100922 F20110330_AABDTV wallace_t_Page_062.jpg
e4b3b580e587ee005ef2f6bc27a60a99
0490b359dfde58eab0205c90ec74d0b73b35ad57
34322 F20110330_AABDUJ wallace_t_Page_078.jpg
450cfb9badc3e50355c35c295b9605f4
0dfa6b5965b3f8f7a17a87d4aceb79c0e4ebf43d
110635 F20110330_AABEAE wallace_t_Page_121.jp2
180e5582e87013187b5ae8261d09f49e
0777c7c5ac27a9283f8e7bbdf830de870e56a533
82519 F20110330_AABDUK wallace_t_Page_079.jpg
5db16e80c453592f9d7b3924786dbb7d
8df6eeb9e5fe5074d838c3eb3f8439cc2979a37f
111290 F20110330_AABEAF wallace_t_Page_123.jp2
2fa2c0afbb2b18b9946a65c80a344a12
eb7798b3326aa13fb8dfd5983022cd89861cd3be
101787 F20110330_AABDTW wallace_t_Page_064.jpg
ffd4abd72399db4bd4ea66b1be1965fe
3b00a1163f32407ea1bd42c2f88c24ba871e765d
100146 F20110330_AABDUL wallace_t_Page_080.jpg
6b2868b4eda25cc8d55f43d92cdd10c1
6cd970357a47cfe42e5a700f587ef2b6c1e237ff
12762 F20110330_AABEAG wallace_t_Page_124.jp2
3b19f343bb5576c1f9bcc07033ea6063
f460c1a81a04f6024f6931121958d10b1e2cb74c
30119 F20110330_AABDTX wallace_t_Page_065.jpg
2f9d7be6d65b1add4b0efe404fdddf11
968087587d40a68ed92a0998ce87214f67f300dc
98628 F20110330_AABDVA wallace_t_Page_103.jpg
d3394e45c5fbdd020f21450ab78bc6ee
669e038b561436802730382db8d2f0788642905a
98341 F20110330_AABDUM wallace_t_Page_081.jpg
564f175ce0e6efb59f2863510f7a70af
0f5ffe853cbba0bbe4cd00db3284e29623dd68c7
899416 F20110330_AABEAH wallace_t_Page_125.jp2
c6806d1e8627b1a4a2070ed91fbb2646
5f30d0a1d8cad0d26c65b8d3dbefdf8db52b178e
90694 F20110330_AABDVB wallace_t_Page_104.jpg
97d551f3e8d664f5f1066a35d00ff413
c67ff787d9a9bac03b5f4de1f61105d3dc4d3b15
85161 F20110330_AABDUN wallace_t_Page_082.jpg
f2d12fb002aa3382d39fdd6d1fa7bc31
abdf1315f1323f790a275c4ab17d086e0a1df8e2
72277 F20110330_AABDTY wallace_t_Page_066.jpg
ab380342b3cc5a18c722119695162371
79157e6406b48e90207fff672dd178d4f0638455
110909 F20110330_AABEAI wallace_t_Page_126.jp2
0f5a5f118804b616e9923840b99ccd59
37f5e27e33e53c5bde32fa8c233c589dbc0abf09
86218 F20110330_AABDVC wallace_t_Page_105.jpg
93b6cb2c6b3b851a3301e4e06bd7b68d
53d806f93490c06efd405219efc57b2c899f783f
82139 F20110330_AABDUO wallace_t_Page_086.jpg
c291df29fed1c669fc8f89fc3f9f3632
cfd71069cc23eb28d1232b1991344028a87bcf2d
97710 F20110330_AABDTZ wallace_t_Page_067.jpg
1fd463d6fc80006ecfcb69868a496aad
656f38c6732382f4de433ebfa195a7883c0fef8f
110226 F20110330_AABEAJ wallace_t_Page_127.jp2
dd71e60e1fd2ca73c3f4f8059b53d1ec
8fd81aa9a9d1e3e2241a1a3f77d3f77531d6c389
85705 F20110330_AABDVD wallace_t_Page_106.jpg
d01b8e4e88972a53d29907f93cb49d4e
de75f929fa90aa5ac6479a5169d0e189dcbbf874
92808 F20110330_AABDUP wallace_t_Page_087.jpg
9ea7ce8bb469f44609174c2d1cb09bbe
2dcda08c88bdeca51c078147089863822a8d66a8
111600 F20110330_AABEAK wallace_t_Page_129.jp2
5c8af87ccb05a511aae7790479ddb286
4391339f64d279a13e8ca499e9784fcce09aab76
100942 F20110330_AABDVE wallace_t_Page_107.jpg
9ebc0cc75da8e8868ee094aea6bd8065
c71db26cd4570a89016078465f5465a8a5b371a5
102793 F20110330_AABDUQ wallace_t_Page_088.jpg
d870512020954567c233c0bc44a49a95
33347b35aadca6ce1da9ea5ce634ddb0bfed86f8
141964 F20110330_AABEBA wallace_t_Page_150.jp2
f253ffbc9fdaf9541322b39e3fcfa3af
3930f07590ede75346b651c5d1dc3503f08bbb10
105860 F20110330_AABEAL wallace_t_Page_130.jp2
22594cce0dedd957a8f6888923c3b62c
3b1ae42b15519a00b1216b79d79d0e0105833a17
104116 F20110330_AABDVF wallace_t_Page_108.jpg
77aa838a4ea5a5d7e9a1c6bddac143ce
07aa9c3d759e97446d2a32b3b8c80a356623267e
61018 F20110330_AABDUR wallace_t_Page_089.jpg
4b3723b3ca59719f16fd496a229284ea
b47ac4591ca676a6335c25b32c5cd2a0cf6f3289
139116 F20110330_AABEBB wallace_t_Page_151.jp2
add16dc98dd6ab7963b2ed65911f1e1b
c3bf319deb5553f950a8068c373ab1c7835ab7c3
109647 F20110330_AABEAM wallace_t_Page_131.jp2
d0a5b002a5bce4d119b8e04e18132f99
98c987cbca1e266e3aded0560e3291f4fd626927
99163 F20110330_AABDVG wallace_t_Page_109.jpg
809110ff5a40b56c528154d6c7cf0074
b880b3482ef7ee6cc0794110be6b5e3a95e0a109
97319 F20110330_AABDUS wallace_t_Page_090.jpg
64a3a928350ceebb91f9786c25120f23
c888ed63ea78a54c7500528efe236ebd1270e05d
139663 F20110330_AABEBC wallace_t_Page_152.jp2
94bde8fe9622db6c8c2612cd2e7257e6
e1e92c5f66bf7bd538f871423f4e1638c1beec82
113239 F20110330_AABEAN wallace_t_Page_133.jp2
cdadd68028207ff36554b1585f2e47cf
cef663b2991197a8cca47d432fd2c08bc7201913
86166 F20110330_AABDVH wallace_t_Page_110.jpg
ab6933432f9da6e14d1653f057c0607d
cb01a638463721a3b4880cf2399bb10e291d5a00
101357 F20110330_AABDUT wallace_t_Page_092.jpg
aea996b6bd40b4a1f46d03a89564542e
fc67c0cd70ad0a3b838e5b152658a8d197c3fef6
112995 F20110330_AABEAO wallace_t_Page_134.jp2
926edb0085a9da66e16f376603a1998d
86826877d1e5d4c144899ff0326f0acfa81e233b
77352 F20110330_AABDVI wallace_t_Page_111.jpg
94842389a7e0938f919c9d50db67f716
a84dbf47ac2e4a2f430dd977024487d7531cf839
89738 F20110330_AABDUU wallace_t_Page_094.jpg
03536430983b87b901cc9ed6423b0ce9
26ccbe1d2a138ef2f2eb6a94b79cb74e4c3f088f
130890 F20110330_AABEBD wallace_t_Page_153.jp2
0acb179f8dc058790ee21821d21b807d
548e378cc3b7380ec76fed02aa3517c08215653d
105828 F20110330_AABEAP wallace_t_Page_137.jp2
271e1ae2a792eda36d984c652667eb2b
2791c4c555e163bfc83598370d39432588ac50f6
103129 F20110330_AABDVJ wallace_t_Page_113.jpg
d373aa91ef7f8c934138643903bc8caa
fa48e4071ab38de7467323ea619c1fcb6cdbf6af
99801 F20110330_AABDUV wallace_t_Page_096.jpg
44089027f6c584a3ffe1fce31e7d8506
a5d6e2ec3c988f23d0cf0a0f16926a79b7a373dc
141280 F20110330_AABEBE wallace_t_Page_154.jp2
683e2b13e1a3b9684d81615662783493
92bb2d82cf3b21b18af0309caf7562d53ab14624
51732 F20110330_AABEAQ wallace_t_Page_138.jp2
c84f798855b70616492939d02a17dd26
ebcab7ee852b5ccee14b62ee3d90e83ca2b4a163
98239 F20110330_AABDVK wallace_t_Page_114.jpg
4e4f82905aa2a62a838e970310313d3e
61a25a230ec925133b1d2e39cb757ce095602cc9
96116 F20110330_AABDUW wallace_t_Page_097.jpg
b4dc7e6b8390ed7e6570b439c9c86b54
678fe9bbe97ee09e5370e9386693370d1f18f451
134662 F20110330_AABEBF wallace_t_Page_156.jp2
892ec7245d4b7b7d96eed1a1b0150011
1911815c1e8bddd0d07e5284d0ccaeefd002ac8e
66513 F20110330_AABEAR wallace_t_Page_140.jp2
a6d52341940772b2d24e55fcf67a38ee
39ac07db1f9dbc1d832f9b18962ab9902b167b2b
67218 F20110330_AABDVL wallace_t_Page_115.jpg
b919145a3ba165625c321eb9fac234fd
d76767f856ae5715f76af3a4529f8309faa9e852
138841 F20110330_AABEBG wallace_t_Page_157.jp2
4765dc58902223d7e6841d61ff02d9ac
aaa775115f5b7d7b6e875f8d1f3d38e381874879
106763 F20110330_AABEAS wallace_t_Page_141.jp2
860e1befc3f9e1d2bbe849794d46160d
e5df3edcb8edda510dd662b9b9b99772d0fe6fa0
92819 F20110330_AABDVM wallace_t_Page_116.jpg
5cfb8fcbeee4da91fe89f1c47863c1af
a047bad3cc29d50b7d0a2d81515dd559f920aa26
96167 F20110330_AABDUX wallace_t_Page_098.jpg
327e1f1049dea12b00c276d4683cde06
b39c94d422d5b907c856c0ccf613707328bae826
105638 F20110330_AABDWA wallace_t_Page_134.jpg
f80281d717d7f2443d23ed2f364b7da3
fd8f99187d97a952bab45bbe0334ffcbf793a172
63561 F20110330_AABEBH wallace_t_Page_158.jp2
e348f33cdfa8d4aed19545cd7e75a6f4
25afe995381dbfa2eb3dede2384f2827616d5356
131494 F20110330_AABEAT wallace_t_Page_142.jp2
7dd8324fa506df752db16bd03d734951
e21664e16520f810fabc0c633f16993a418c8c07
102654 F20110330_AABDVN wallace_t_Page_117.jpg
3c620decbd8d32f86c2920dd86624b28
724cf24c01615db5b0767145f9e40eb7071df019
100513 F20110330_AABDUY wallace_t_Page_099.jpg
63382b6668dbfc2f441bf08ba5cda0d1
723a08edf72862a6001161c7791fc82f117e3e8f
109423 F20110330_AABDWB wallace_t_Page_135.jpg
83da9d2221cf4abfcb2b60787a4592bb
fd8b9edc0667ca1c30971b718dc2637f02948861
8491 F20110330_AABEBI wallace_t_Page_063thm.jpg
d6f3e4274e190758daa158d231d368f0
fd4b7b72dbec868183a6827e78faa7800cbf6b70
136632 F20110330_AABEAU wallace_t_Page_143.jp2
5277bd03217ae810b82710ecdf4c9d4b
46d224b86a416e67540b7a420aea222d679b4684
106687 F20110330_AABDVO wallace_t_Page_118.jpg
16a9f02f07cf8d1a2ccd054b2ef1df1b
bfd16d18326116f3d53155415ba1dc4e81ee75a2
101268 F20110330_AABDUZ wallace_t_Page_101.jpg
80e7d95d67b87f904bf8a9920c33caca
cc6b8e1e09620a74dac504cc1416882663012921
102359 F20110330_AABDWC wallace_t_Page_136.jpg
29902563c0332e0af7337a7f7d42e2ef
2b87a2080b8c324d602ce2a5c411db41897bbb1c
8330 F20110330_AABEBJ wallace_t_Page_030thm.jpg
452d855e3bb1a97ba3ac58b10e801e5d
22f4599d87a339ce2fb38591465127f6120bb537
131463 F20110330_AABEAV wallace_t_Page_144.jp2
0b4f624e24e01aa267d062ccc7179f52
ba5a0b03a08b83655e6f58ab799cdad2057cfcb3
105718 F20110330_AABDVP wallace_t_Page_120.jpg
741099b9469a7bb0bdc08d0760deed98
b82ce89784e9cedad4c4094688a32b1f179949a7
99929 F20110330_AABDWD wallace_t_Page_137.jpg
c3f3f4d6a91d92ae3abf556b8e92b3a9
ae572b1a30ad59f6ce2528e558fe459c6771422b
16772 F20110330_AABEBK wallace_t_Page_158.QC.jpg
d093b808c745bc69b5446ba9b22b4568
1e1de65e763bca3ea8350ac65191d0b048f42516
134020 F20110330_AABEAW wallace_t_Page_146.jp2
83112a81be901590d200315874118646
f5859195aa8fe98d7b8f0453037a00aec6d7c29d
104109 F20110330_AABDVQ wallace_t_Page_121.jpg
e7af4270ee64cd42b7fdae04e60bc865
d3658c999729a2e188993865203e12f054aa58e3
97758 F20110330_AABDWE wallace_t_Page_139.jpg
f7e881867dee0cbd7437dd76152ac4ed
8d5390ba77196fca1ab095338e923185fef62be9
31211 F20110330_AABECA wallace_t_Page_097.QC.jpg
f38e080250cfb380e272968b57302cbb
db661a1db7357de8f9aa2f9b5c98b968d6e4722f
34380 F20110330_AABEBL wallace_t_Page_055.QC.jpg
161e934ca5819fe9567b36f8b9e88d8d
23f45b4d2669df2945cf775becd4d670a8d1a112
139335 F20110330_AABEAX wallace_t_Page_147.jp2
ba142f46d1269da81caf64163053b623
ad638f9e8f3d3abe1e52b41e105a850b9f03bbbb
103670 F20110330_AABDVR wallace_t_Page_122.jpg
e91691aece65881e8b609eebf06a63a6
5fae6e4cf2630b26c071686f09921f9168ce8057
63116 F20110330_AABDWF wallace_t_Page_140.jpg
5ec89190229a4d877975552e5531e06f
1fbdf60b23498d0bd3f814a7fa292db28f8a8a72
8368 F20110330_AABECB wallace_t_Page_040thm.jpg
a898d78bd14de207985498785967022d
ffd998457bdb7824762347d2787b2c1147c032b3
34793 F20110330_AABEBM wallace_t_Page_052.QC.jpg
9bfeac78e078ade21529852ad797e6be
7410feee04586393d30e245cbf6dca869ad3c377
133519 F20110330_AABEAY wallace_t_Page_148.jp2
503346445911e097fd19a19515651620
5f651e24a409f9f381eb18c66fb02100882736d0
104300 F20110330_AABDVS wallace_t_Page_123.jpg
5937d07ec77444fa037725c95cd4efab
f12c3efe019d3fb22bfe7fd22acfadec165ede56
122080 F20110330_AABDWG wallace_t_Page_142.jpg
c54d9220186fd3946179e400c167e515
3c2784cf61cddf975cecc0339893c8e5c1aef2fd
18571 F20110330_AABECC wallace_t_Page_089.QC.jpg
1365eb362705e016c64f5d6861a4617c
9a9fef0839ff64837626e149360fb2e6a2ff92d5
31020 F20110330_AABEBN wallace_t_Page_127.QC.jpg
5d9f53d2f058bac461e6eeb94770f66e
e453c4d487f68f0f65e48c05d5c39e1d2154dd2f
137783 F20110330_AABEAZ wallace_t_Page_149.jp2
052e285a21695269d96925f572bd8c9a
1254842cf9ac1ec92e59b24c27e9d5c95893849a
103412 F20110330_AABDVT wallace_t_Page_126.jpg
637784fd431bb017151d9ab6f4533fdd
9cfda3ea9645f3a3d22659fe3df489d9e51c3c41
130122 F20110330_AABDWH wallace_t_Page_143.jpg
5b5e3e22356e3a8770961af55d54c3c3
bc01641a63bbe6bd3e8bfa956b5b7261736fa87a
33587 F20110330_AABECD wallace_t_Page_145.QC.jpg
1869ccbe15d0bfded65f151ed4679c07
729f2f136107dc28e5cd6f684cfebf08e7a77479
6958 F20110330_AABEBO wallace_t_Page_079thm.jpg
3839ff0e4385d03a70c0e4b79b9fcec2
c607e9692b3f0ff5543a6e995d00a604c110260a
103171 F20110330_AABDVU wallace_t_Page_127.jpg
f0e90278ca4ab325c0e226b0d6aaf8de
914193a63de27894bea977161cbc3039c9ebd7e4
118945 F20110330_AABDWI wallace_t_Page_145.jpg
052ab8017a9b07277826fd1809a8988b
8a5a5e3c62fe6c161d45e9d2eb825bd0b4f4ce74
9847 F20110330_AABEBP wallace_t_Page_065.QC.jpg
c482001b7faa6d143c2bae8b559cdfc8
8ce6925af4ee4c4b0c0908184486958de984e336
104565 F20110330_AABDVV wallace_t_Page_129.jpg
6c4379a045ac64bed730d9593fa2ea3c
2ca163a1c2e40b1a9f3ea0c7563669e04f7afb50
129582 F20110330_AABDWJ wallace_t_Page_146.jpg
ab5e4ba8dc921250f389384527ba61af
d5e554d82c387e14cd7b3822a39d2092a2b59d40
8774 F20110330_AABECE wallace_t_Page_146thm.jpg
00441aaf846aa63754d56183e182f4f5
4993ec4e4ea44bb156bff7d4365643eca0818c26
8054 F20110330_AABEBQ wallace_t_Page_016thm.jpg
fc4017359e3638bc2b85c1be5bbf8f1c
48bd37bd8cbb268bd4198a8d917a37a104377878
99182 F20110330_AABDVW wallace_t_Page_130.jpg
1a2b4d5045a212aef954dd96b1852bd5
36b61d03ff33986b0b5019f68780c4b1772e0e76
131398 F20110330_AABDWK wallace_t_Page_147.jpg
6d18f5bffc874594502031b0506ea349
247d9178bce108c0a993b6c9edc0936950205cd3
4247 F20110330_AABECF wallace_t_Page_158thm.jpg
00fe4aae5d492814c55fdba1ab5d496e
680bf81d69b732267c18b2e4693b5b2aeab6b418
6620 F20110330_AABEBR wallace_t_Page_013thm.jpg
116e402574853bd80efd59fb280a9219
58e62fe3ea35acb72f125b2b471a31ec4c58c7ea
101378 F20110330_AABDVX wallace_t_Page_131.jpg
8afcaca9d8de0d20f5db4cc2243721ba
69166f4173bf576a060f88d9d336e50708faea9e
131303 F20110330_AABDWL wallace_t_Page_148.jpg
e898d9d19f2c81b79bb99e9a01fc4d07
0948f58de9d0598501fe92e473de33747b557c3f
8085 F20110330_AABECG wallace_t_Page_025thm.jpg
8452057fff086a2bf4eb4987deecf50c
cac12e006ae1922acb88ed36da8e94a2da8b9688
7423 F20110330_AABEBS wallace_t_Page_094thm.jpg
fee4ba644e41d7f932c090ecaf4aceb7
fa134fdbfb530a420ba12116188bcac38ca2023f
1051983 F20110330_AABDXA wallace_t_Page_006.jp2
adb8f79f8a239650e18a0bdcd9626be4
f930aed6387d437304995230cd8b42f4ab9516ce
132334 F20110330_AABDWM wallace_t_Page_149.jpg
a3d8cfc6efd17cb063b9973bcd2a0365
51999110f34e72082c3bfda52234be6a387d2a5c
31744 F20110330_AABECH wallace_t_Page_090.QC.jpg
24e38955983274fe6c4fbfc122031570
78ad40fe11300132e54d9406b7c284d0a0a46675
32269 F20110330_AABEBT wallace_t_Page_063.QC.jpg
5ffab85015abb5ffa9879be98ea64473
9fef12f6a6830e4bc2bd80499e5b7df8714b002e
101107 F20110330_AABDVY wallace_t_Page_132.jpg
605e7334be7aa54ec4ff62bc22bb65c8
bc8a2bb1c66d05892930611e1c3f06e989c8cf1e
1051950 F20110330_AABDXB wallace_t_Page_007.jp2
ec66c2c3c952c1aae52c7eddd8b0e46b
8d6194a1ead57722464f88762194f5e2ece6adeb
135794 F20110330_AABDWN wallace_t_Page_150.jpg
c87e9eb98c5412bec4dd11ed97af4ca1
248d11c90899a732956b6ed1da80f9d85a0e7dd8
8270 F20110330_AABECI wallace_t_Page_096thm.jpg
8592523e5f2afd89bdac15a0689ba7f8
4b3ac7d76eba86356ee46bb2dcbffebcb285213d
33919 F20110330_AABEBU wallace_t_Page_121.QC.jpg
a887394d88a229153348eda8144c0c89
aaa285cd2854bd64bcdee5181f73cf2be7ec0d9b
106227 F20110330_AABDVZ wallace_t_Page_133.jpg
90a53a90222398583e0e7661f4e0f7f6
76c0b74ba6b92f896bd65062df8252901483250f
7952 F20110330_AABCUA wallace_t_Page_069thm.jpg
a6f04f0500ab3401cf08baaf72b31040
80192e188b6a2dca0b56e8f9eec9ab3938d1e381
1051970 F20110330_AABDXC wallace_t_Page_008.jp2
3b435f4d69c5ce2af8b1413d9c092958
c3f31b4b841b451c5b73c8a75f85be46481b84e7
131373 F20110330_AABDWO wallace_t_Page_151.jpg
d43bc870b13e085f4ca0dc6f986821b0
619edddbd89c78e9d03388ea0d8eac7526bd6684
8044 F20110330_AABECJ wallace_t_Page_109thm.jpg
bb9734e81d130a712c0124335bc7f7b3
870ec823ec3dafb1d1337af8ea77526470741dfa
8210 F20110330_AABEBV wallace_t_Page_059thm.jpg
2908da4005b3f54404659d5ba26a59b1
bf2a36f0c470de21e0e943718d2b67ae3b8f8b65
106814 F20110330_AABCUB wallace_t_Page_052.jpg
36a6e025a4c88a3ab91963132dba7b78
acd7eb120ebee4f0d27257f05bb533d724f1bb47
338500 F20110330_AABDXD wallace_t_Page_009.jp2
6d21b9b57985ad215e547b8c8df2f0a1
2c4a7ff38a02bf66432cb8f434cec28902df0f35
97625 F20110330_AABCTN wallace_t_Page_100.jpg
e463fbc53b4d9e5aab3e038d9fbb3f6d
7796afeabac5c4d6fc071a4b18d79806de7bb4d8
130611 F20110330_AABDWP wallace_t_Page_152.jpg
43598aa0f94fa594b526f1c4472366d8
4dc5c9a4d9f9d3ea8ede3888fe3ebce537e48680
8640 F20110330_AABECK wallace_t_Page_155thm.jpg
12029d006a596dae87ec1a2db29a9ae4
c0a0a995e6ebfb46452680e7ad88421ff9e748b1
7858 F20110330_AABEBW wallace_t_Page_036thm.jpg
9d5ca5dfd6903a4759f0d8e8eb57e8bf
f482190670f24b286d07be6bb7ba84ae019e49d6
8660 F20110330_AABCUC wallace_t_Page_143thm.jpg
b416e8f423020cf827f329b42c7c4a64
94933fe6b50a3dc948d162acd45ee66346b146bb
479867 F20110330_AABDXE wallace_t_Page_010.jp2
ccc963f040bb990599f32ddfcb63d58e
34521430669457c7be380a183a216f5e39415f6e
8257 F20110330_AABCTO wallace_t_Page_028thm.jpg
5fdad0bda9195af3de0637f4ad8c2924
d06dac26f15cbc31e1f57c66314488bed77d66cb
125669 F20110330_AABDWQ wallace_t_Page_153.jpg
9048f6be9bb00bb75a1334cfb8b6b29f
ab933a24bd46e4337c928c373b09a29b87a73e6a
8683 F20110330_AABEDA wallace_t_Page_056thm.jpg
46d6f33bab6a356455120b1cb33d64ed
a4e7c04876ae8c8cbc41b7c42870831fdb1fc7c1
7966 F20110330_AABECL wallace_t_Page_007thm.jpg
c67667e616798082053ac3d57527e143
d40b8fa5c537840e5dedc84e64256633440b33a6
27224 F20110330_AABEBX wallace_t_Page_139.QC.jpg
082989331a6b79fd4d10a8d75fe35e3e
69f339b5521d6b3e7a8b361daeee59777d6606a9
33082 F20110330_AABCUD wallace_t_Page_047.QC.jpg
9f8de2d2c73734991d09b9e536dab21c
c3118ee219ef79d79a045dcc2977615e4d4c15ae
1051985 F20110330_AABDXF wallace_t_Page_011.jp2
4f03ebf91c8c0188d65c5e6937564d26
f0eac668bfc1127bb1e0989e749f8a95067bc2d8
113607 F20110330_AABCTP wallace_t_Page_056.jp2
1a397f51872a82d7f2f936e46e1f716a
344a43d10303b69a48c9469461b392587874a7fd
127179 F20110330_AABDWR wallace_t_Page_155.jpg
b90bb6a66ffa3a856c2ae75f700e70e8
99721d5ba435abc637538dd96ba592b7042da84b
32584 F20110330_AABEDB wallace_t_Page_025.QC.jpg
7811bec5e9970b7dd59eafc487a9c7b3
39bc079724449e3ad4e555212b9e6d719990f627
6661 F20110330_AABECM wallace_t_Page_086thm.jpg
b8a903ea52776d1589690a1dda6552cf
6976095f73fed20fb1781dadd0dfad5588393366
7408 F20110330_AABEBY wallace_t_Page_073thm.jpg
bf827e013c11df6e9d7b8ba609db045d
c5da7528beb71dc9c03ba31d39b2cda35c11a2f2
111343 F20110330_AABCUE wallace_t_Page_044.jp2
76ef2efd9378fb96ab52a0478fffcedd
b4388673f31c9a4fa47e17b080cf83fff6b34593
84650 F20110330_AABDXG wallace_t_Page_013.jp2
36b0ef3cd783225bf09000425eb589a4
212e524e29352fb083a4f607a8a833834c25ed5d
99572 F20110330_AABCTQ wallace_t_Page_048.jp2
730c3d0668bc6ed67d568d2541adc05c
163f69cf2930fb7361001ee628e5f228ab07605c
126054 F20110330_AABDWS wallace_t_Page_156.jpg
0898d317c7ef0803cabd80753808972a
4cde250686b607e9b6e26edd9431ee6b63161cac
8554 F20110330_AABEDC wallace_t_Page_029thm.jpg
629439f57f5e3ca9895391839e8e624e
683804923f5519d2ee636f2bec1f967cf4ce405a
31189 F20110330_AABECN wallace_t_Page_093.QC.jpg
4e4cc97100d9604f5e95513f0fe35aab
0a804be2583f68c9a6059471415f5338f294dd5b
14629 F20110330_AABEBZ wallace_t_Page_138.QC.jpg
c45d747273a364ea4ad5d3a264bec2b5
8387b43e66d3ebcfd90dc489d3eced6dbd3a4de3
27150 F20110330_AABCUF wallace_t_Page_015.QC.jpg
a1472e8719b5508e61ebd9663acdac23
c5ea6b83a7c39893f326f4de998d2d739d1a9138
88811 F20110330_AABDXH wallace_t_Page_015.jp2
ed8881b5186efce03bd973a800f4853a
a236b2789d9f87a32fca0cba45240289f65c9046
28518 F20110330_AABCTR wallace_t_Page_043.QC.jpg
1141134985de1af4f4bf60f32d3c2770
587e776077fcfa48d259abb6fa7d628e4ce5b3e0
132936 F20110330_AABDWT wallace_t_Page_157.jpg
41fde0c2c881a2b0eeb304ad8f458a63
c69c9eb10b80cb4cefea4672475d1f8a439958b0
8720 F20110330_AABDAA wallace_t_Page_151thm.jpg
6e2530743e9a5c0e87310caa99f4c360
9869dfd53a1151303993bfea4027f9afa8d5aec6
8176 F20110330_AABEDD wallace_t_Page_060thm.jpg
7ae29cadcdd1ab4db29159c5c6792544
8c45134daa11edc5bf413b7cad85737a0a2bed47
8283 F20110330_AABECO wallace_t_Page_075thm.jpg
58814994b912b4bdf803662bf57a02c2
38ee999e0acd3a3ea252d294466d32a993204e28
52977 F20110330_AABCUG wallace_t_Page_125.pro
2a6d0d268032aa2a9e4308a257382caa
9fe8238a722ae350d5519456e41ec9bac4162edb
105823 F20110330_AABDXI wallace_t_Page_016.jp2
415f723082b10cce35927449c5900bde
82d564feee5df7f1fa632f4b880d362ccc784ffd
30181 F20110330_AABCTS wallace_t_Page_081.QC.jpg
3b9b78a9ea58521a7f3110c8d5e3dde2
1e3ae474d16e545f5738fd716de76e881d724090
62314 F20110330_AABDWU wallace_t_Page_158.jpg
e8897ae9aa64b1d1c3c44a1770016897
400a9c18c2cde023fc1efe1902024de4bc752663
98841 F20110330_AABDAB wallace_t_Page_006.jpg
d5d7da48ee47a606ebba3b69a965560b
e2bbff9ce941e7ec13c2b2f920bc438f29d57c2b
8238 F20110330_AABEDE wallace_t_Page_081thm.jpg
3392347b79e9283e4e929ef2f4b60315
b60db146682f58c4d2881630d19ea2f7e2236d98
6410 F20110330_AABECP wallace_t_Page_014thm.jpg
79eca66770f8236bd2f12e7887c2b8d8
55355c6dffe4d81444fe6ed29d453b2af6a534a6
3076 F20110330_AABCUH wallace_t_Page_127.txt
4762b0dc705ed1f507b8ec65548501d8
db6c357be59ab745a4ac77db89c10ee8a4f047fb
102441 F20110330_AABDXJ wallace_t_Page_018.jp2
f594970e946151c8a3c16038e8ce3152
da79f833f34e03f1741b0082f6a7279bdced5400
1864 F20110330_AABCTT wallace_t_Page_018.txt
7011c675116eb85670b960594c40683c
7b4be54b889b39737eecf9d44e52fa768c44d55c
24901 F20110330_AABDWV wallace_t_Page_001.jp2
d2433d781e564fcc036b43eb4f86702d
175fee0686a066e7b931b12cd8ac771f2bb50720
1053954 F20110330_AABDAC wallace_t_Page_082.tif
310e154bda84ed375fd5100b94e514d3
e3439f8c8512dd2cf4b5d9b8a6156903bb487c47
35687 F20110330_AABECQ wallace_t_Page_148.QC.jpg
1a3b927c2fc3c4c8be5b241bcfdfd344
9da8311cf8cd33e44bd44e3a730d2a5a3f958a61
6911 F20110330_AABCUI wallace_t_Page_035thm.jpg
ad7f32824e8aa57c44ac285ecd361366
e7e8b62f0e6afd1e09ab7b706ed48b95537e2fce
111149 F20110330_AABDXK wallace_t_Page_020.jp2
d70c7822e1e9aa37354b0b266d980448
ffd31d8adc8eaf27a3666399dd7c6779bf5baa9e
F20110330_AABCTU wallace_t_Page_069.tif
4c28cd2a8f55ab6aa88ecdccba8353d4
0c9642053ad8d02053b6fe9d601917baf821648c
5923 F20110330_AABDWW wallace_t_Page_002.jp2
69de2373af18d51aca6a84e067714ada
582824e70b96f94e6c69b13ca61cc45d16699e56
31991 F20110330_AABEDF wallace_t_Page_067.QC.jpg
676e5a9341055aa376574690a4444c56
93cdea93769929d4f2d99cb8231abb749d186050
7424 F20110330_AABECR wallace_t_Page_072thm.jpg
60d67deacb58e1eb2eb30ca0f13284e2
9cab68b87cf2b17b6085798d26e7c9232e2f01b1
46852 F20110330_AABCUJ wallace_t_Page_018.pro
d062d09f3ae04262dca13f05a80996d3
4eabe8649e4738496c33811f8ca4a7caec4fa52f
111753 F20110330_AABDXL wallace_t_Page_021.jp2
9f911e6d9771af532c9cbdf9aaf82c7b
bcf55cd6d0796c87043b45c7e6175c565f4627ed
71765 F20110330_AABCTV wallace_t_Page_159.jp2
39e0b2c05b6c47be4f6bc5dc5b83be54
e4cb9872d61d0cc2421fd0c2904c80c1193f89e1
8842 F20110330_AABDWX wallace_t_Page_003.jp2
dc4473780eb979997a6c7f2d823633ca
28d8654d69d21ef513e2d1451cc3b3781653d865
47196 F20110330_AABDAD wallace_t_Page_103.pro
e6cd49680f45a6cb0f10cf649b757dc9
123d2b8e2faacc011851348d19e1a07bd58d3c04
6085 F20110330_AABEDG wallace_t_Page_012thm.jpg
8cb9d48b442722c514b1960234d9209d
6cf2a9142a2ff66719b72db8c73743d9c9122caf
7893 F20110330_AABECS wallace_t_Page_130thm.jpg
c951081780c6e13954268d0f1b617351
aebb68962e61ee3beb24fe692e94623ce716a075
105006 F20110330_AABDYA wallace_t_Page_041.jp2
9d7f7730475ab51fb9dd1f4a0b136a23
6d5859427b12a5211d61e7d2adc2e5e4a80ee9dd
6653 F20110330_AABCUK wallace_t_Page_053thm.jpg
59bbc221571625fc645f2886b6345fa3
a6899abff390fc7f2f2f5212c4bba6302fbe7e30
107632 F20110330_AABDXM wallace_t_Page_023.jp2
edd31163aa5b4adc72014fee44f3386d
aeab97cce00d3302c874d2c4ddc16a45dc8931b5
68780 F20110330_AABCTW wallace_t_Page_159.jpg
d5ce45653a7ac33828d1cf95e9effd83
836eee73a2f53fe92405d5e4ae4ca870eee29b97
84052 F20110330_AABDWY wallace_t_Page_004.jp2
410e0b1ee688c9240e08261b079bf28a
d0501a9e8947b2bb994c61674928e3d4f67b7b3b
1863 F20110330_AABDAE wallace_t_Page_093.txt
ce365e36548e07d13623c4d187f76cc7
7518bcf5d989c223c2a9de3d1f4ef615fecb97b3
2368 F20110330_AABEDH wallace_t_Page_010thm.jpg
f5135b220d15355532882e74a5028438
c198f126a314ec43f45d0a8fe548b073ee0573d6
30460 F20110330_AABECT wallace_t_Page_129.QC.jpg
36d3908bb07f5c761e6b1bad3a3443a9
85827d9dee8e650e5bd86f2817878c0a90c08e89
102275 F20110330_AABDYB wallace_t_Page_042.jp2
e7d747d9c2f86e3188d9204d99360e59
0115a9edf0cc3bad2b46f984c69c6661e1b4855f
1974 F20110330_AABCUL wallace_t_Page_047.txt
483e693f72e403ce31b767777b7368fe
da8eb4e35ec54dfe3822ac50c961f61e14c224ca
107399 F20110330_AABDXN wallace_t_Page_025.jp2
08caf8d526a65c88bcf2109610b2fde4
eff140cae403b67d6d0fa347b404a1bb1ce09791
8383 F20110330_AABDAF wallace_t_Page_120thm.jpg
9a2b1345b0b67e396ab33fc816bd63b0
b3874a6000f9698344f4875d26d851cd78540073
29438 F20110330_AABEDI wallace_t_Page_130.QC.jpg
5a1c8af9d922cffb42210da7b0ed4e3c
2bdb01f02ad04bdd909689d94a7b0b7925c08221
8781 F20110330_AABECU wallace_t_Page_154thm.jpg
4731b58748aa011628e97cb7ee614107
135289707f97ca42b6973edafa39e30f2c736cae
973558 F20110330_AABDYC wallace_t_Page_043.jp2
76d3b0276250a78a815b9fd15495182b
376b109edfaf95fddd6a3da5ade96c45f94f193d
8130 F20110330_AABCVA wallace_t_Page_100thm.jpg
b4a9b3d2d6b2ac5ea0ec3ae918929a91
9b77b22ebba3e02e19e68a9663fac91ea794d26a
58074 F20110330_AABCUM wallace_t_Page_145.pro
52d7618e0f853a42e42207247ed7c2bf
d1d60f408416cb98900f8010933f3f4feebce431
102358 F20110330_AABDXO wallace_t_Page_026.jp2
978b6f7d805b3e4a6f1742aea793e025
4896f0d0432abe50b50bc2ae479238a58962da22
F20110330_AABCTX wallace_t_Page_040.tif
f9bb031e8f10769ed1c53cc69e45c9b9
0a025e3e36451bbe8099de3ed4737e91cd38b6e1
46481 F20110330_AABDWZ wallace_t_Page_005.jp2
094b5919756fd46ff545db7ec7030238
910dc9ea520465cf43f2ec59c940c859c1642739
77381 F20110330_AABDAG wallace_t_Page_066.jp2
a9e2f89f2b2aa2e7ce4d21bcaaa2800d
d35c67929cb0666aedd30a06c2ae37ba3e586398
32288 F20110330_AABEDJ wallace_t_Page_039.QC.jpg
4951334bc12ac7c2b4c92f4fc055e835
29d9013939431f73c58a0159cefccccdd0588f55
31590 F20110330_AABECV wallace_t_Page_016.QC.jpg
e1c040fb1ddbeeebf1718d2b0faa0b04
18ff0067f9bcc2451f85f443c70a05a5a01c8a7a
109169 F20110330_AABDYD wallace_t_Page_046.jp2
f2577b76e3ac09edf19942b9b63e8fc9
afdc0f76a9016b5424b611398db6d3070416ea93
14892 F20110330_AABCVB wallace_t_Page_010.pro
ff65480ec8fb7b4c1954b7861cf19671
55d2d1519eb2c135e82dbe2c6c39ec2246ebc8ff
113527 F20110330_AABCUN wallace_t_Page_119.jp2
283cf5bdcb977a43919f812fe92cc16c
518084b6ec4cd39b2ce3439d17bec64b854cd8e9
106602 F20110330_AABDXP wallace_t_Page_027.jp2
bfb76b90c7991583bd27d91faf7cdae9
3fae601bfbbc9a416f523826e078706d949f80f0
1903 F20110330_AABCTY wallace_t_Page_107.txt
54fd14036b63bbbc2b793e87c93c0acf
0b9f440eb9ada9fd669dd135be7e1024590fe963
25271604 F20110330_AABDAH wallace_t_Page_009.tif
bd35e60c37297988f21a7b3aa1af3a1c
bbe318251dd16b32a773cb6dd25afd8412d75910
32273 F20110330_AABEDK wallace_t_Page_080.QC.jpg
1f55f8fb7d238b99712d42813156442a
2b157e6f8921681c970ca7fd4bf83aef7bc14ef9
21860 F20110330_AABECW wallace_t_Page_115.QC.jpg
eb1c9788dbadc9b681d1f472160fab6a
292c9258dee6deb11731718a9e61115198e41088
108257 F20110330_AABDYE wallace_t_Page_047.jp2
137ceabb63d921b2e2de1475a1d88013
1d8cdbc5373f1709105cbacf32cd2798c5c413f5
F20110330_AABCVC wallace_t_Page_058.tif
7b92d35a0b2bf4ba9999ca329bd92bcf
bcdc3ecd92be7e49032d6da66ec9852845ed0da1
23161 F20110330_AABCUO wallace_t_Page_066.QC.jpg
db703d5ae15e99c241b59861048e9f5e
021e40dfea65c610a85bdd6f724d842190ce8862
107667 F20110330_AABDXQ wallace_t_Page_028.jp2
90263e99803be410584487ed11c26df8
db53b08eae99f5754eaf64a38ffcd45c3a396787
100859 F20110330_AABCTZ wallace_t_Page_084.jpg
daebad2f3c328fc459cf10f58efee4da
91c09ea8f18a8b10c262e47bd5776a2bd1224c7d
100807 F20110330_AABDAI wallace_t_Page_071.jpg
7b967190383beb808efba24ca37b8090
a22f6f4e5387424116ef67381c349b55e03810c3
6854 F20110330_AABEEA wallace_t_Page_015thm.jpg
fd25c7692fabe07a66e2a8af48514837
2b5357c19a69a2f7f4ae7ba435312293ebb150fe
4584 F20110330_AABEDL wallace_t_Page_140thm.jpg
f2761e2ff830c501869105f1a6137cd7
7eea48cb5523152ee7181e8d54fa3b944a38e56d
5635 F20110330_AABECX wallace_t_Page_159thm.jpg
3f754d99b8b307ca79c5d06e379e2ef2
649698448467d031245beb0bb5d6e62484ceb3c3
113213 F20110330_AABDYF wallace_t_Page_049.jp2
7b38ed7d2dfeb07042487bc8272b80b0
d777ae818ca62aa624d82d22cbee349b1c96be3a
F20110330_AABCVD wallace_t_Page_050.tif
498bcf45e3e378d54ed812557e067f23
d3336229480d14003a0f089273a333e722629117
5370 F20110330_AABCUP wallace_t_Page_006thm.jpg
cb0a57c652ff08326a57d0a97ed03c63
0982f6154fa031b1ce785521a7bd12e04d9a51fd
110742 F20110330_AABDXR wallace_t_Page_029.jp2
81f223fd9dd54bd7f4b15fc038ba6408
69892be008cc1372d7585e48c6db9934c72f0c33
102018 F20110330_AABDAJ wallace_t_Page_128.jp2
d06974eaa949d4a6c856414e419206ee
7d52cb6e77e0f0bb665a652ac9610f680f078d07
30880 F20110330_AABEEB wallace_t_Page_133.QC.jpg
015ad3c12f9b000d88424f50e5643403
f286dfc709932ba76cd3ad78d1c09e5deb04aa83
30826 F20110330_AABEDM wallace_t_Page_069.QC.jpg
01c145dad00634d8198c563d1142e1b3
3d5b52d7b07422488c53502eeb2e26da276fc723
8457 F20110330_AABECY wallace_t_Page_157thm.jpg
d49cf4b78d27aec2e1c30ced0b2cb6a5
28ab0e0ae651239886078a443583ada965d3e5d7
956769 F20110330_AABDYG wallace_t_Page_050.jp2
0709ef94b045bef4273126fe5ca11bb4
d372d23b607dec2468a9694f016a54dcafa2871d
96634 F20110330_AABCVE wallace_t_Page_093.jpg
36bb12e2da7278d2b687985a7e5c127e
77809cf89549a253853d69aaf908c793c156d92e
22581 F20110330_AABCUQ wallace_t_Page_006.QC.jpg
1c87b6499ca21c7bdf176ca9ab46b686
3bea6d9df2a3218a2bcafc3a3bd99663da2f2af1
109167 F20110330_AABDXS wallace_t_Page_030.jp2
43e72ba6394fbefb06e35bdc6e9bdc9d
ef20bb307d9a75e479dda82be215c2d707fc0da1
F20110330_AABDAK wallace_t_Page_136.tif
b2c6055c176895ad1de7572a40d9d0cf
30e8b204adc9837170bd0a49d0d26c21a9e30648
36552 F20110330_AABEEC wallace_t_Page_157.QC.jpg
c1b19bba3a0580ffc4f8ca36f2842aed
dcaf634b948416d692e89114670bf0b46e31f5dd
819 F20110330_AABEDN wallace_t_Page_003thm.jpg
bdfcd20be119feb27603999ef32fe21b
4798b1bec683c5b4ae6eaeba15366bdc07559299
32367 F20110330_AABECZ wallace_t_Page_109.QC.jpg
2d2219434c6c4bfcf7623e1926327b52
b10ccff52ec64a7364a19755ac1a778c7e276d45
90961 F20110330_AABDYH wallace_t_Page_051.jp2
341565f1643d07798ba53ebf3cc342f7
dba34e21860fc56b1823054c6d48c0193b518c0e
111786 F20110330_AABDXT wallace_t_Page_031.jp2
2a6a7896acedccbec3cc1649f59cc8a6
0fdb02f49403e5b7c2f2d1a9296513f1cc66ed4e
943327 F20110330_AABCVF wallace_t_Page_017.jp2
fc619be02af4eb6c9b92c18135cad2f8
4dc2afbb3168dfaaa543c2998747ec9af9cfb684
39907 F20110330_AABCUR wallace_t_Page_108.pro
9725f555b8af3505eac90aaaafbe49f6
47afbdb84ab124d2f1d4248806aaf9ecf7d31ff1
7031 F20110330_AABDBA wallace_t_Page_024thm.jpg
6208b8e65bda9f9d1703219fe21d95f2
0f9fe8796df8abf55896f967cb38f56ad568fc56
F20110330_AABDAL wallace_t_Page_095thm.jpg
0ea4ad32a2a42337339abc4452e85352
ad93bd5b1a2e6193796b90c315931b162a7291c2
28371 F20110330_AABEED wallace_t_Page_050.QC.jpg
bb1981f4ae2149159a6b49da256628a8
fb6d279c96ce61ce9ea32c76b426aed926ff0501
8332 F20110330_AABEDO wallace_t_Page_008thm.jpg
4f4fbecd0937f393739364c883ee24d5
61bf0cd7510926a09079e512e127cede64a9869c
111281 F20110330_AABDYI wallace_t_Page_052.jp2
6ca2fdd6e039dac634f8cc9c756e6390
cea417dd2a8f058bdb49205728d71cf2de22c706
1051969 F20110330_AABDXU wallace_t_Page_033.jp2
8a4dad4ca09cff3537a5ad467c190558
ebee08223ff311a1b1f3528f57c28f9db3904389
8183 F20110330_AABCVG wallace_t_Page_067thm.jpg
3e34fecf694c109e76b0365c6ef71ea4
2d881745f827906192beeca001cd52dac395f7bc
5032 F20110330_AABCUS wallace_t_Page_102thm.jpg
60853454ecdac041dca544a9c450a9d5
380444093249e27e5ece55270c6761c6f0fd610e
F20110330_AABDBB wallace_t_Page_047.tif
bfa6dda2f37aaf224b245f76b4f50963
8e7d8274b97d206e3878d9bd003a9443e94e48aa
31447 F20110330_AABDAM wallace_t_Page_018.QC.jpg
7107cfcc1480984922748fa7c7d740e3
a50a6b916d7b995b2f94fcba7dec1f36ab7aeb9a
7737 F20110330_AABEEE wallace_t_Page_011thm.jpg
97e2f9d5bd61be5e0ac6ff6aa49456d7
65aceb72ce2db2223c2baa8907d9b0c3aec249a9
29378 F20110330_AABEDP wallace_t_Page_061.QC.jpg
51cacfb9a5200ad0a914077c428b582b
014f74d8d6b736b5a2faa4c1073d20e200bfafff
79680 F20110330_AABDYJ wallace_t_Page_053.jp2
e324b5f07accc1f6b9bb329e8fe1279b
d66a3e76443b01772f163a002bf1ef57795ca770
79193 F20110330_AABDXV wallace_t_Page_034.jp2
926720f599dc3d95333000ad06b68ba0
6b46404d8da53c243c9757b6a8b3244d4e9e9ae2
F20110330_AABCVH wallace_t_Page_073.tif
cb4b357b34bbb9c58fccbfc1c0063ef0
395e4f7a4d47e27df3cfa8407ebf18880264730c
46781 F20110330_AABCUT wallace_t_Page_095.pro
aefc40df8b69a9a1ad5c3223419a6517
00a5b741612f74005c80d88a734930b7ed127213
830470 F20110330_AABDBC wallace_t_Page_019.jp2
c35ae33dfd8b465f4400b1a4bdb401c1
393127384ad464d87b4516eb85fd2d5b6bfc7b8e
1051935 F20110330_AABDAN wallace_t_Page_061.jp2
c9f13653245010ded7dad71d8c658459
62608fc7140715a8ae426d73431fea3082646fcd
33066 F20110330_AABEEF wallace_t_Page_060.QC.jpg
7f3b04a4b6cfd38816efdb16beda55e3
5f3020cbb3aea679ff1d072eb64878afaf8be8c0
24238 F20110330_AABEDQ wallace_t_Page_034.QC.jpg
8891b814fc61ac1834967321455189fa
224ca487750fe292e4b1be504b65dcf00d02ff8a
109240 F20110330_AABDYK wallace_t_Page_055.jp2
eda9d7bfb1745398871a78fbcc4ee496
5c99449849424c342f8cea524ceb4ac6a74c35e6
104852 F20110330_AABDXW wallace_t_Page_036.jp2
20cc975602c74a957fed85a8623c6d5a
181bae7d1a8e0661c22e15e34dfe65c9dfe5f521
100594 F20110330_AABCVI wallace_t_Page_047.jpg
0aef29d8f2647fde3d343afdf0d1edb5
5cfe1f25994f0ba5e06054181d88b564323fe2fc
43185 F20110330_AABCUU wallace_t_Page_024.pro
e58f8bc7ee421b2d15b4e0b40d166bc9
874312a1d57e8a71a2250163ec390d4599b5031f
34938 F20110330_AABDBD wallace_t_Page_156.QC.jpg
8eb258cab507a857c0632948908d8739
7abdec2f0dc6990c0a302353f37cf82a6775eadb
106917 F20110330_AABDAO wallace_t_Page_077.jp2
1226042434f7b9c5932d785256c55e84
7a1fc03742279f7be3aaebf922f685b21e4d470b
8255 F20110330_AABEDR wallace_t_Page_099thm.jpg
3ec1e1ba4b515a6fadd03acc5fad3818
b02b3762913fd3d6692058cf8a25f19aa171b46f
109055 F20110330_AABDYL wallace_t_Page_057.jp2
c80efa1118c5a89579f1f78052238ffb
d9602b2b9dbac22a14813cdb3c9f33dd6aaec219
108531 F20110330_AABDXX wallace_t_Page_038.jp2
3fce5eae9f285e5684bd5a30950088a8
4e397ee43eecab2e0cafb1bf0c4454c5011375e9
94806 F20110330_AABCVJ wallace_t_Page_128.jpg
94b312ce70c023abf82dd8057024f1c1
723f61c6ee0432f9c64fb389c852bca111fd2e1f
128793 F20110330_AABCUV wallace_t_Page_144.jpg
01e716ef91974816aac73a67bc5e4138
8e196e45691ce30d540b97f0050eae5bff0888ad
33129 F20110330_AABDAP wallace_t_Page_027.QC.jpg
1cd90542ccb5b4abfbc9db75ab1e1308
893689f6aa67743650a6ec6645fa75d0385196c4
257531 F20110330_AABEEG UFE0012904_00001.xml FULL
e2acb9a4981666250706f43f43e6ba49
71c193e329e7c0cf7cc398ef3d099424c17fb552
BROKEN_LINK
wallace_t_Page_001.tif
6366 F20110330_AABEDS wallace_t_Page_009.QC.jpg
329d19d3e9fcb71d3c89f04ea607fc28
365dd0132cd680cf75703197f96adc7ecc5d6656
87899 F20110330_AABDZA wallace_t_Page_079.jp2
0a0d9f6d0e64879ce9e2629bff0db2c6
858f0762dbb861f1803454a1ee1d7c1fe6860e30
118805 F20110330_AABDYM wallace_t_Page_059.jp2
99abc5be0d31ada308aa52117e6b64a3
833df29b2797d34dda35f460d7bce508d0a4db0e
104358 F20110330_AABDXY wallace_t_Page_039.jp2
0adafa7f7e731e5e599a726de8b3a01a
ced57dc6397918ad83e320bca5fec3133af16dd3
2165 F20110330_AABCVK wallace_t_Page_074.txt
a7c89a7c1363764be1eb06175da47a32
3a922a5d3791759e1a5490ba119b7b1ab9081869
51727 F20110330_AABCUW wallace_t_Page_029.pro
d0742fcaed55c184da60dca77232bcca
289dfa600e49c51fd1872f82dd801a5928871df8
F20110330_AABDBE wallace_t_Page_083thm.jpg
08942016cf55f57d450aebe720c6f8d1
ad66f068dd25aa865d79063cac28236e22f34cd1
F20110330_AABDAQ wallace_t_Page_147.tif
37e3702ed0be69dd66cc7c446abd35d7
bf6dcfe6d5df18cb7286d6cbda7667dc43242996
8542 F20110330_AABEEH wallace_t_Page_001.QC.jpg
ac1f31660235471eb2e39fbe00a4d462
c2765a18f44863cb5d36483a9ae5e661912e3769
30271 F20110330_AABEDT wallace_t_Page_054.QC.jpg
2c8e433f33ff143d7b1dcddeac1fff92
703964ab42541dc8f86e6de851646242ba8fc6cf
1051984 F20110330_AABDZB wallace_t_Page_081.jp2
ea42e66e7a8014fb2db39c658fb51a7f
82a507617dfa17f799290cf538c5a85733b20c7c
107366 F20110330_AABDYN wallace_t_Page_060.jp2
49244897f57c54f8345d2863dab1176d
22d7485c47454590dc84291b1da53603c99734bb
104251 F20110330_AABDXZ wallace_t_Page_040.jp2
98fb1bd5dc9a00e0857e293f286903d5
2e49390f71e6d0f1e2b5d8663717fe4c132fe373
F20110330_AABCUX wallace_t_Page_036.tif
98bf482f3e426925d0aea99fc3595fae
e05125bdf5caa0c098f326bce3ab7c26d882a97a
3328 F20110330_AABDBF wallace_t_Page_133.txt
fede1b7ad02d0de3deaf1c6663a895bd
d0c9f64b2732c08c8deffbbc22a2400cb0b41121
83647 F20110330_AABDAR wallace_t_Page_014.jp2
e28aac49390d65bd2d73d4e417bce383
11f1374fd3fa95ecd559325f4203b1cb9fc0bfe6
2022 F20110330_AABCVL wallace_t_Page_070.txt
3c093b55fcdfcbcd7a4f3436eebcf97b
522430785856500b690aee1911b82b0527f72546
1931 F20110330_AABEEI wallace_t_Page_003.QC.jpg
f6c1420d116c0aaad7c3cff461f5f583
078aa545319f81740b67ccdf7ca10691f6483950
34971 F20110330_AABEDU wallace_t_Page_029.QC.jpg
7bc03629262ab9a60c37f2dc840c11aa
7474cde2c0d9a913ad2735b22501953e2fd406dd
92092 F20110330_AABDZC wallace_t_Page_082.jp2
47ee5765daafd2440919735843f56ffb
e19b04fb33ea6207dc5b9195e03538343fab25ba
109492 F20110330_AABDYO wallace_t_Page_062.jp2
b82057c762769babb302fc402e5e2ea7
e045b56cbaa2219db3c1b2fb0837fa0723a841d3
F20110330_AABDBG wallace_t_Page_135thm.jpg
b5f284258db2310769bb7a46ba7c4f76
461c8cc4c6a33687b752f45f95a05e12ce4e111d
50046 F20110330_AABCWA wallace_t_Page_047.pro
f0954d921e3bcde76fa6fc06f5a72d5e
dcce81ae74ebc336e00de520682891b0c92bd12a
F20110330_AABDAS wallace_t_Page_005.tif
902e80bbc93dc3b9b517f60008f80a70
8d8eec5a527b958bb0f39271df0f06175dff61bf
2006 F20110330_AABCVM wallace_t_Page_031.txt
509a770ed77f8eeaafa9444f88883e9a
e09a33a0ebe49edfd3a01bd8ae05a1376fe1a65f
25522 F20110330_AABEEJ wallace_t_Page_004.QC.jpg
fe218fd85b4ab20561049107918aed7c
e97ef76c79f65383035059c384b09d22278f3fe9
33526 F20110330_AABEDV wallace_t_Page_007.QC.jpg
d2550da4acf651ba9cbca666110cd522
e81602310391333d6301a8923ebef5f643c3b204
106972 F20110330_AABDZD wallace_t_Page_084.jp2
4a61e904a16791e682947fedf30a5445
a5f4c4c1d9a8d651071536b0d5aef79dbe20868b
106903 F20110330_AABDYP wallace_t_Page_063.jp2
b368a29ef19696d7eaa37efca516ecd2
407cb1ab6ebdd1d55c66f3b86ac30ffe80ccf0f9
72968 F20110330_AABCUY wallace_t_Page_085.jpg
236cef800518329cbd3b5b809dc53d83
5a7f6a128d0344b03aa07c5bb307473b6cca38d7
8600 F20110330_AABDBH wallace_t_Page_122thm.jpg
376c741d9a90b2e517baddbbed76d453
340a7de813d7df8261cbddb93d9e02e3bd6d752f
2033 F20110330_AABCWB wallace_t_Page_052.txt
92b3a0e68788625a1760e1823c2bb5ad
12accb284e053d745cf2fdec012fac33f9ed0711
F20110330_AABDAT wallace_t_Page_112.tif
f3f4fd531db65a41793f0b8274a32abc
53ee02304ae2a0417fb63483486be559283dbf77
28552 F20110330_AABCVN wallace_t_Page_141.QC.jpg
c79612b22c9fe5492c22ce0a7a27a28c
fa792c46adb3dfa0b384ffb1a1aa1485da21abf4
14723 F20110330_AABEEK wallace_t_Page_005.QC.jpg
5a5cbff840e2e384386eaf0215f22d2e
c268af9cec770c21289acff2d0e9c0a4d9eed79f
8084 F20110330_AABEDW wallace_t_Page_101thm.jpg
70a7346610a9ebdd7a3bf8c8722caf6a
595e79a70fcbd900d588cda2ab7f0ff749a8d321
891913 F20110330_AABDZE wallace_t_Page_086.jp2
235deb9afd59e2b92c80f4ad1752d321
5f1e8050369ae17a31baee13ff1fa0151994f593
108546 F20110330_AABDYQ wallace_t_Page_064.jp2
2c1fc9b253f85fd93b2fac81e001de1c
85a37a1ec8071e539b78a46299c13bd369109d45
2525 F20110330_AABCUZ wallace_t_Page_148.txt
3d00a62f0edd8b38681cab2825e97de4
73c671dde5db7dd4fe4aae0cd3555a084d2c9e21
1051954 F20110330_AABDBI wallace_t_Page_091.jp2
cd305fec1715509d9987d2cce10ec985
e63c9218498d90948c8fd4e7e2f9b1f84103060f
103304 F20110330_AABCWC wallace_t_Page_068.jp2
8081e2c8a14df1c923452585cc77734b
3de24bac7ef0ae15b96d70ec12fad44c4bebbc71
819235 F20110330_AABDAU wallace_t_Page_085.jp2
d6132d79174d60eb22ebca2ae9c8d24f
5eca0f8dc0ff624e7b9c6e2fe2f90f7157201584
8140 F20110330_AABCVO wallace_t_Page_039thm.jpg
b0256ce8ce195c1d4eb2377ec77bb20b
e771e5969c76252e8d199ace970a7b3a7ed72135
30750 F20110330_AABEFA wallace_t_Page_042.QC.jpg
0c82e472cfb0c4d06d2a2a81ca633f3a
fdfb14ca3096a3c54e42d730759c454491257e82
31198 F20110330_AABEEL wallace_t_Page_011.QC.jpg
1968f03d4b44fd00c526f54215eb8618
ca2fa90406b6ef9a8b1881ac77b2587235801c44
1217 F20110330_AABEDX wallace_t_Page_124thm.jpg
cb083e1e6d87e69f0bf522536706b500
d894c2eb1751ab8f5a80d7985f6be791ba663d83
978078 F20110330_AABDZF wallace_t_Page_087.jp2
b13ce58938088be6ff7ffa685059522b
da0dd62812deb04ac30a331910fbaf99739c4fc2
31169 F20110330_AABDYR wallace_t_Page_065.jp2
9f9427e9838689e23c7d4abbf777151e
d660ffc640e7f3131ede33cefaa8ef87e13648ee
F20110330_AABDBJ wallace_t_Page_097.tif
ba48999dc5404e35954ab0fd98c69aa3
57db9ef78803eddc501542811af2ef20aa16f1f5
3164 F20110330_AABCWD wallace_t_Page_131.txt
fe903c833ebe34ad826a90defcde5839
37448ab9f9ef802cc12cac105d7ce7046135ee9c
1963 F20110330_AABDAV wallace_t_Page_060.txt
f12ff44621cc1565dfe939223ca7cf05
6cf7ef411bd3d277bebceca7399db9075443ed18
29851 F20110330_AABCVP wallace_t_Page_112.QC.jpg
b65c8a1719854736a9565866b1b91c2f
3cf0016f5eab54c5e4aae53bc30dba51c7c13894
35004 F20110330_AABEFB wallace_t_Page_044.QC.jpg
89da07a13ea312ac698568e0413c5e09
1e9eb2fbb61cebe06b81ce047eaa76ec933b5086
25092 F20110330_AABEEM wallace_t_Page_013.QC.jpg
a9ebfa713d2f684b2aced0dac1cd907d
88b69403fb00f8868814463c6fba5f63d6c4f197
1343887 F20110330_AABEDY wallace_t.pdf
b462465cdc6e40b9db4de8d5c6e7e407
894248b1b0b508483be15da31b1faf8296e0f7b4
110066 F20110330_AABDZG wallace_t_Page_088.jp2
f0cd402d72fe1f01aea8d42a04928f66
486a6f3dfc6bffb07c731a99994b5b997b476e9d
105641 F20110330_AABDYS wallace_t_Page_067.jp2
705563c9b67f860f0b3b0e5de513e9b7
fcce8d9f763f0e9c46ea8aade22a077cb8ee7ca9
51252 F20110330_AABDBK wallace_t_Page_052.pro
e9aae51f8e343aedc2066f17c413605a
5e874d13a9ae1540dade3bc48bd1e3faa05530a7
47934 F20110330_AABCWE wallace_t_Page_016.pro
8d7dc575004a0d8637526fd6d7b7ca32
f0104b7d8eccb01c9ba6ac8b4bed08703744d683
8331 F20110330_AABDAW wallace_t_Page_027thm.jpg
4f65e6cc078a52b5ef59e0a6aea3cdbc
97858fe071553e00d1d59cfe98a82b3ef01906fa
99259 F20110330_AABCVQ wallace_t_Page_063.jpg
14de705d148d07775201ec49c69654a0
ee7c04aebe3392d1863bd56d16e224c83be3e11a
26521 F20110330_AABEFC wallace_t_Page_045.QC.jpg
c171417811be2ba1701ab476864e3af1
e848952ae8b30b4181efd1a72b622b937ce4f41f
25600 F20110330_AABEEN wallace_t_Page_014.QC.jpg
fd952c1d1558a9a5aa55c474e9a69136
c5ca3e2040d16924514bc5c5da966c9e79c43c1d
26080 F20110330_AABEDZ wallace_t_Page_125.QC.jpg
a55b63dade5010be0bb889668ce10916
4f07516c1a34ff93a2bb581850d106c9eb009672
639609 F20110330_AABDZH wallace_t_Page_089.jp2
50fb90923ea3cfb01cd48098cd1923e2
d98faac415a7b5002fc664deded12c6f68ba9774
101425 F20110330_AABDYT wallace_t_Page_069.jp2
4991cd6eb1e21c32a95d4b6db51c5a23
4fd8107b56e31afd92955b8922b4e34500009966
7021 F20110330_AABDCA wallace_t_Page_104thm.jpg
106e04d88a4ae0236657eadac1648cbe
6eb8bb180ea32206fb3ee20c85fc17ab6d3c44e1
1732 F20110330_AABDBL wallace_t_Page_012.txt
9149cf43edc81450ab68a29db1e689e9
6d7db2fa9606554b2177923930a20101d110e23c
66636 F20110330_AABCWF wallace_t_Page_135.pro
a8e3fa104e73c0ecc1d6f614d224813f
9913dd6e7ddc1084c5dc57fcee35fbce63b597a3
107137 F20110330_AABDAX wallace_t_Page_083.jp2
8d343a829aa15d0014ac5145759a4d6b
73dd36d73d1430856cd333c139087bcef1077753
50006 F20110330_AABCVR wallace_t_Page_060.pro
92ab08692fc238c274cd4ca3f8f66b1b
8e18d373bc6a29553ed48699009356a93f25d14b
29732 F20110330_AABEFD wallace_t_Page_046.QC.jpg
c34787220831db90548f9b6055b10dd7
107b48b625dd0d7b0cb5f4402ed95d9309bf7c46
29314 F20110330_AABEEO wallace_t_Page_017.QC.jpg
8cdfbf26ff4df39b6708b7cadcd2a8b4
5a2a5e78957b59e16ed2e569735b861b30bfd4d4
108306 F20110330_AABDZI wallace_t_Page_092.jp2
d6dbf496d6d1981263925c3a30dd98fe
54a0f72057e884e0c256e7837dbfca1cb7436967
108816 F20110330_AABDYU wallace_t_Page_070.jp2
31380ef2ba57fb3bd0ba22bb7a49cac5
3f36395d7a4cd8b03777c6a279c910b6edbaf481
F20110330_AABDCB wallace_t_Page_092.tif
16895d1648a5f9fb3d57bbf662d5a999
b8725c46bbeb47f2abc4c03ae47a0fac178ad3c5
36947 F20110330_AABDBM wallace_t_Page_143.QC.jpg
40ea3afdbd6f9aae9e408b601568d510
8e443919e5f211a7ab710c1a38f73267701c0ae8
7686 F20110330_AABCWG wallace_t_Page_018thm.jpg
3e2203a23580d645ff047be31c2ae07a
c57d5bbb7152aade2e7c1cf5fe5e45abe5750006
108779 F20110330_AABDAY wallace_t_Page_136.jp2
336f049cf5d4f69722cb56998c2c66ca
fdd621b06e4c67dd7a78c4f1f96655135c3158e2
3936 F20110330_AABCVS wallace_t_Page_005thm.jpg
c45bc12f9dc6b5bc8b80cb7d322af0e3
e4c4b1685809255ca9eee64182ac71319532db48
26896 F20110330_AABEFE wallace_t_Page_048.QC.jpg
b359d96c71b0cb5767f827fd96c684f5
c32a6b0491aea5953523abdfb912fc6226eab294
35222 F20110330_AABEEP wallace_t_Page_022.QC.jpg
7c386ac7d9e5b600948f70918ad40dd2
6f125f9922e71c567b5cd9ceee6478986454be26
103329 F20110330_AABDZJ wallace_t_Page_093.jp2
03d6e40775bfecd84f2749cb673a56dd
ad8cb52fb74f116d124900938d8bdd22f4b6ea16
109327 F20110330_AABDYV wallace_t_Page_071.jp2
5eda5b7fb65fda8e4216ac4f442673b1
9afe4ae51e4e554130048a97a831aad572d0aefd
134905 F20110330_AABDCC wallace_t_Page_154.jpg
29f61744f90b7812ee695c890f58157a
677b25f94bbf238f6172a174673c3926ce9c4d93
F20110330_AABDBN wallace_t_Page_145.tif
e7b123411ede91149580b77070441235
6b4313426f0007f43124e3dc56192155968bf593
31108 F20110330_AABCWH wallace_t_Page_036.QC.jpg
ed032e64f3f5402df7708a59c4e304ff
5576d1f9a2403a7ebc9bd78fa657fe2a7094479e
F20110330_AABDAZ wallace_t_Page_011.tif
268976c25a83f18840e10d446cc04084
1c958543e983bea99d0d1e8dd86fa1d0dc3300f4
33621 F20110330_AABCVT wallace_t_Page_076.QC.jpg
48456b68be9be37e1c46c77c32fb6ba4
0462b90295000138abbd68efbed416c1f7b8181e
35313 F20110330_AABEFF wallace_t_Page_049.QC.jpg
f2999f1d10be18445c18e9d4bf9d66a5
a9310bc48714c7d75c00f751b7825eeb93256d44
31922 F20110330_AABEEQ wallace_t_Page_023.QC.jpg
3647be86af9907f51f0d5796864a71d5
78adb7dec41f863900fc94e1ccd702d12005267f
93032 F20110330_AABDZK wallace_t_Page_094.jp2
cc292fad531a881de32d29153da13df4
e3bcced335a5232492b4e1668d345b8d89984211
88812 F20110330_AABDYW wallace_t_Page_072.jp2
cb6ece10cc75c7241e56450e4ded8878
f7d7d548935e4d12ef5c21a9c45a32b5147bf694
99575 F20110330_AABDCD wallace_t_Page_033.jpg
50d4edf47e33f3874d07b161ff908ce2
2c862e6193a1dd1b63809d1d94eff57741ec72f7
6995 F20110330_AABDBO wallace_t_Page_125thm.jpg
456a2b7d31001464a14a187cfd692566
c5d3b8166107ba8d61d2abddd810c29f43bef8c8
34837 F20110330_AABCWI wallace_t_Page_053.pro
998faa8af2652a38994fc4326ee73bb9
95f0be8cfbb35b3d4be508ce2fd0ce7bd672237a
1788 F20110330_AABCVU wallace_t_Page_097.txt
d7da54ef2363a31a6d2476a6b33d5c88
29c111829b371267be7382a5daac27969dc6ba37
29645 F20110330_AABEFG wallace_t_Page_051.QC.jpg
ac33d9fd8fcf983ffed6aee54ffe2a0e
9e888c3dc922eb693741afa27fc24cae2e4d6c10
28800 F20110330_AABEER wallace_t_Page_024.QC.jpg
5296ab0824424977d19a730b65df7117
4db4369261796add2fe71d234bf8f8bf00b8c19d
1051958 F20110330_AABDZL wallace_t_Page_096.jp2
b3468d46de8f18702f1eb528f61b12b1
863d20b0f5402e9ef0321e55c4a7997636c8e9f3
1007211 F20110330_AABDYX wallace_t_Page_073.jp2
905ec6fd22e2ff8921960ffd32a78289
34d27fd650b0772b47f9000c25e4a9cb97bb5f8c
F20110330_AABDCE wallace_t_Page_156.tif
59494e4e829544d60897608c32e22612
8ee061f1a49a6367a45ae40268c9099af7329fcd
31672 F20110330_AABDBP wallace_t_Page_159.pro
8df57e3efc5875f0e5efe72675d849b4
cb3aff8ffda73b58c2815eb326e56d3a5d7fee1e
93808 F20110330_AABCWJ wallace_t_Page_058.jpg
649f0784b3df1b0ac00525d075ecc6d3
d88694e52373aec210f3935843931d7806983009
8608 F20110330_AABCVV wallace_t_Page_149thm.jpg
ef264ac29ad902344c4e83002e8d0419
6bd5c595264ce4428d83f9df64b72be7e8e05a9e
33371 F20110330_AABEES wallace_t_Page_028.QC.jpg
318f382a444843f0045962e1feed820c
0224e3ff5ff5570d5cb26a5e83e32ae2306f3f14
107648 F20110330_AABDZM wallace_t_Page_099.jp2
7afa57bb9e68759d33b412bb0928275f
a77ab26bde7bdbf957344e81b62b43c06a87ec8b
1051949 F20110330_AABDYY wallace_t_Page_074.jp2
0b78419abb6813d5df1fa5469a9ad217
7339270c59af6fa0413bd86cb54e739a70f1f66b
F20110330_AABDBQ wallace_t_Page_155.tif
5a05a6d8c4e8427502851d6dedce5b18
cb7db961ebd8b4141d1ee649b54a3987601bce52
47978 F20110330_AABCWK wallace_t_Page_048.pro
8579fb15468a37fd955a408cf7535b37
2e7d2ed60e175436e73e478653e9d991646cd469
135823 F20110330_AABCVW wallace_t_Page_155.jp2
e058981f7b84f828c195faa222c16b29
1f1f0500142e6092bfe67de3a5fd681a965ef4d2
25141 F20110330_AABEFH wallace_t_Page_053.QC.jpg
9c95c7321e4bd9102bf422bc980dfc71
341dafbeab37dbd4318b2d4f4935c1883236f5a1
34595 F20110330_AABEET wallace_t_Page_031.QC.jpg
1a7b3c21e3447a74b7a56a2dbb0c61b9
e631607e45014ca6faebc7fa27b7055b81f74f53
98856 F20110330_AABDZN wallace_t_Page_100.jp2
ca78bf99d9d41cda7910224f4b92efaf
15f2144800ccb44041f45e95ab5cabbd95dad8e5
107256 F20110330_AABDYZ wallace_t_Page_075.jp2
617dbde729fab17ce381285f82da610b
21ae57815510e66f706686fea2e8b9493ec25be8
F20110330_AABDCF wallace_t_Page_028.tif
08c4cf512ad56d510babe249b6d3b871
114e20d4c9b60c4e651799ba92ec4cbeecd9aa93
F20110330_AABDBR wallace_t_Page_089.tif
45ceba9e1cfe72792c791b6a8090124f
d911bc1a29b0011a305847daa808ade75ef5bae8
F20110330_AABCWL wallace_t_Page_030.tif
b59ae637e253e7dcacc269574bcc0b33
d2f4a95e98ae4dcdc28d810d1be53ca544f9dbeb
F20110330_AABCVX wallace_t_Page_083.tif
aa59e4ea19c36fbaf3209f9f60d91416
cebb81d5de80e29bee0540e43653bc20e1701805
34417 F20110330_AABEFI wallace_t_Page_056.QC.jpg
8252e0b9d69d1378050a6d93c5f4b7a5
a2c2a992cfef3f8d7fbe86571d641adb4b32c9e6
33818 F20110330_AABEEU wallace_t_Page_032.QC.jpg
dc3e14db02575b3cf6ccbca020f9695b
5124a5c95414bc3f2768176f2493e77d3764fb44
105681 F20110330_AABDZO wallace_t_Page_101.jp2
cd3ea6d14f1466155b821df83bfda2bc
057e1abc16a5729f1ee241703ebde32e378fae1a
37961 F20110330_AABDCG wallace_t_Page_013.pro
6aa24265c69abaad728e37f5b34a4745
66152e7ecc863e2e340cf4642d61636aa542eef0
98623 F20110330_AABCXA wallace_t_Page_112.jpg
0ae4bc099db14e2772afe05e0227ac32
d552969c15238ce3e0ddd6fc24b683296e546189
4702 F20110330_AABDBS wallace_t_Page_002.jpg
d51e53db9173bf527016ca0054d93321
aa483fde15b6dd42e6144f2e5916a959a79b0211
8179 F20110330_AABCWM wallace_t_Page_129thm.jpg
52bcd4016023bc73e2b2e5d00999af05
1990e618ef02b966e3f57845847c6f64ddc99a65
32895 F20110330_AABCVY wallace_t_Page_101.QC.jpg
be8afd7c22f9ab654cb5cb66c6613de0
fc91c6a97f00d8a6fb9c5539b4346bb84ede6835
33733 F20110330_AABEFJ wallace_t_Page_057.QC.jpg
9e92293cdcad7aa9ae67a2ae015a5968
6905ecb1521ef6d2e7cb86bf0e09ae28fd0a75ba
29431 F20110330_AABEEV wallace_t_Page_033.QC.jpg
eb0bceed3a78d8b62c5bc20e98eadb75
a735f5dfaa0fcc616cb2ff57e23952cb0ae9702b
918954 F20110330_AABDZP wallace_t_Page_105.jp2
1b2a1777841f08171d863f34fd80549e
de73837a8c8d234b7a51ae61fbc5daba9040973a
685977 F20110330_AABDCH wallace_t_Page_102.jp2
3cbbf7a296487bd33caf441e46089ad1
21c5715258d448379859a80260492e78d7c8bb4c
1375 F20110330_AABCXB wallace_t_Page_102.txt
fb6b949aa8e272641a6227a51cb4419f
e9cfa56ef7dfa062b0a40f9a43474eceb39e9dfa
26581 F20110330_AABDBT wallace_t_Page_079.QC.jpg
5e1ca0d9c0eccb1b753f5db178592a90
95bfd7fc30028945d31b6d0ee417945e5296f8f8
115219 F20110330_AABCWN wallace_t_Page_135.jp2
36f244563209165e94e3f096703edd0e
cac0b53497dfd0a81aa0b79c702cb531f29c06f4
27156 F20110330_AABEFK wallace_t_Page_058.QC.jpg
1165694293acbc73df63cd8e3e3b6594
8d2aebc07d8bfd5ef64901c32f6355b145922429
26997 F20110330_AABEEW wallace_t_Page_035.QC.jpg
84db7e8d06a9005a5820f81d5af6131d
ca4b7a99ccd9ef1e79876448c119b73cae0c6e7e
964257 F20110330_AABDZQ wallace_t_Page_106.jp2
210905461a05749bf85b11966ba1f398
cc28542a42d32067b2f7519942e90c5ca01e0b4d
67224 F20110330_AABCXC wallace_t_Page_132.pro
d0721ba3edd9f5fc80667707f24b542e
eed5f46ae3f465dff252728eb939fa2656ecfd0f
30827 F20110330_AABDBU wallace_t_Page_126.QC.jpg
bc331215be9b38d3c4a1e80c348350bd
e756108f46da0814c426ff72810e0f211d8f97e1
F20110330_AABCWO wallace_t_Page_053.tif
d610684da9684b1e2a5780ec14f8c12d
76510d236331dfb662c8d6f38d788b1fccfff45a
41504 F20110330_AABCVZ wallace_t_Page_106.pro
63bb10dafc5006251471d498db68492e
64ec43166c43948ae79770476abae8c603c180f8
1652 F20110330_AABDCI wallace_t_Page_002.QC.jpg
2d5508a04e11819acfe4364b407e8979
54cbdae3e66583befaf8019679966eaabaef897c
22482 F20110330_AABEGA wallace_t_Page_085.QC.jpg
273ff8cfb7edd7e3f199aa2e552509d1
316cdaac950fa84eac9d03e9f133a6ad7a0e764b
34217 F20110330_AABEFL wallace_t_Page_059.QC.jpg
365cfed890b2fe56001e51bcca120df7
05402d69b26c670ca4661100dc443b42723b3f41
31426 F20110330_AABEEX wallace_t_Page_037.QC.jpg
a2a05643692f9e59b7974b903123089d
ee0e8c1144947feff8932463741af22c6f942a33
105600 F20110330_AABDZR wallace_t_Page_107.jp2
5c8eee6c319e73223c6d28b4499932a0
96bda2f687474d94ec03e22508a712e58c6f79b6
27314 F20110330_AABCXD wallace_t_Page_001.jpg
ed1554f2371efd5d5b95fa98d2b14aa8
5aeb97d967af049466f9508ba0c40d1b2a47f08d
8628 F20110330_AABDBV wallace_t_Page_074thm.jpg
b2a4806804600171fa9f0ae573af11ec
0fb961cbb02d9fd28c8101837ffdfe2f8c7fbba4
1758 F20110330_AABCWP wallace_t_Page_069.txt
d1eb3c2c1a169aea4959debf0efa576b
45d72e237e52e4ccdaba27fbad8569cca5d77ac1
106732 F20110330_AABDCJ wallace_t_Page_080.jp2
b3750252a4cde5b66955327cb36e22e6
918d134d7c4c7fccb59a097b28bac433c33abb59
27100 F20110330_AABEGB wallace_t_Page_086.QC.jpg
d7a7a75d476a93c8eb2d1d0b423d3ccc
a1d15462d18d4194572fbd38cf27c4d9ac600bb4
32508 F20110330_AABEFM wallace_t_Page_062.QC.jpg
18883ca8969d893ead47c883569547fa
404e7c37bb3322e343f7201bd096a30c982bd634
34335 F20110330_AABEEY wallace_t_Page_038.QC.jpg
93077467c7f20502b7c6ba45c9cb246f
9449e65e942d7104a3773c99faa8a2093c4ebabe
1051982 F20110330_AABDZS wallace_t_Page_108.jp2
bd0572be38d86410e614860e6b9d1d7b
ca39123d218dde4f0918ca523e3aa2e9f41c91de
20677 F20110330_AABCXE wallace_t_Page_005.pro
3b690a5b3606d473c23547b80643c828
ba2ec1d4fa4abe4aa4f246e912ff040e4b711aad
6069 F20110330_AABDBW wallace_t_Page_066thm.jpg
a4bb0d769923fbb14fec4be35ee74402
df51fabb22df8e138b0ba27c575be7e44b3c9372
101708 F20110330_AABCWQ wallace_t_Page_097.jp2
1c04998bedfd26354443b4916da483af
560a6e3a0f2b3d64f048b69a15e49da81aff06f6
32183 F20110330_AABDCK wallace_t_Page_026.QC.jpg
8f2423d5e614ae2e0d210a8d79a6ada1
ecd5b7e4c3b001edc1833dcbdd4fe4bd2eb82e47
28845 F20110330_AABEGC wallace_t_Page_087.QC.jpg
21ad929927fefb07ab8a8ec832feb194
6a0144a2ee1075f0f056b46d391dba66d39a2c63
33572 F20110330_AABEFN wallace_t_Page_064.QC.jpg
88198a5909195a281bf490d987538b89
5555604675933e2f2bff25354b4c5c03ae26b11f
32316 F20110330_AABEEZ wallace_t_Page_040.QC.jpg
b28b3dcf149ac2f23ac377cabf8a0fc1
9c2a1cda155d2dfae56cf2c36829749e1d9c84d1
103868 F20110330_AABDZT wallace_t_Page_109.jp2
6d3afd20f6440e08c4273e19b371f5aa
cf1461d489e84d4320f59af3bad1122b7bbe1bf8
7217 F20110330_AABCXF wallace_t_Page_141thm.jpg
f2d4bd6aad84a5768a2f1f09975e5163
6bdf9418f1bafce712285fddcda5c8ccea0493a7
8611 F20110330_AABDBX wallace_t_Page_152thm.jpg
e2bc578da2aaeffceb6589f82f25d892
0ca29bfcb465e3a3260c8cdfa39b53fa46447f92
102383 F20110330_AABCWR wallace_t_Page_032.jpg
5198158def4d9c5b8c04566ea9adb7af
3c382f97bc0d1584bec5a995103bc59322eb865c
126222 F20110330_AABDDA wallace_t_Page_145.jp2
2422d38148277a8e1788aabfaa938900
33467a9520725141489b96fd2d5a16abc0eed5f0
2602 F20110330_AABDCL wallace_t_Page_147.txt
fec025443ae261493e05e7e8e0b7bf43
d9d96dcb7a49d78d6b89fb84056f85a04cdc573f
33987 F20110330_AABEGD wallace_t_Page_088.QC.jpg
6bfd93904fdbec68cf7d10771087a825
2c17fb9be9bb7e058c23fa4981d76795685ffa4f
31648 F20110330_AABEFO wallace_t_Page_068.QC.jpg
d106c7f71112f7fdb857f5c286dc6c8d
bdd1d322bf5396665c2248420041a707946012f4
87857 F20110330_AABDZU wallace_t_Page_110.jp2
a7dbbc75bb3aef2fa1677f8322c92532
5ff9ae35e3841ec76cd3d6f1848a2c611d4f7817
F20110330_AABCXG wallace_t_Page_070.tif
9053c8468127d4539fb5bf88c68a6827
cea7c5a71800fe48468a3dcb32c9735c8052a160
1926 F20110330_AABDBY wallace_t_Page_080.txt
847001acd5283ef7a9397d6a258df639
40c530d03ca8c5d8cd356c9a788958aa3621b0a8
33923 F20110330_AABCWS wallace_t_Page_041.QC.jpg
ffc8860df108952bf6a3e8dc2981a760
b04c83cd57fd7c8f27591f3501259bf269fdd346
F20110330_AABDDB wallace_t_Page_148.tif
2ac1b50c260afedf8f0ed160f3d89674
79b9ee2113a7d4b1f06b23f2b643fe1496701732
34735 F20110330_AABDCM wallace_t_Page_122.QC.jpg
8a45c7ad8b8dabfecc02512ebe9f5b0a
d20dead630925aa271a8aae2e43a2403846d26e8
28710 F20110330_AABEGE wallace_t_Page_091.QC.jpg
5686b5192e5a2a68fbb3d8a75637d4e8
3ed5fed7f093285879d10fd853fc6c84ee41dccb
34071 F20110330_AABEFP wallace_t_Page_070.QC.jpg
2657d72ee10dda2319060fb40b38f34e
70dd3414d5be831c2df9b0316a38aac2854df9ae
863006 F20110330_AABDZV wallace_t_Page_111.jp2
4435b27256851a863dd8d11166a77d9a
072171cf6b3e88fb835fa4dfcac0a61564f5b514
44840 F20110330_AABCXH wallace_t_Page_005.jpg
4c56361792f3705c83b47c207ff328b1
2510c8bdd41223addc5f11fed95b205d0f83bbe5
F20110330_AABDBZ wallace_t_Page_111.tif
2e60ffa3043454b635c59fce34765ec0
3aae8b7b9b8773f9ac2006117e1106b9ed56b75b
7301 F20110330_AABCWT wallace_t_Page_046thm.jpg
a4aab4e18bd8472d3a2d8be22fdbb2b9
b73a63868955852dc3a2b9c8944f3a161ce189ea
2003 F20110330_AABDDC wallace_t_Page_113.txt
225147f0016be9c1c618e4d6889b1dea
fb572e264cd0bf171b56eaebfb16d5beff975b82
F20110330_AABDCN wallace_t_Page_077.tif
b04882ae1023a954d57667793dfac56f
557ed5539e2cc3950b35aa9df463ce8affcb7c1a
28529 F20110330_AABEGF wallace_t_Page_094.QC.jpg
7274adae74ce180c846aae7701d28ed2
b9c55bb308aa93cb905edff371935fc39d1e5e9b
33742 F20110330_AABEFQ wallace_t_Page_071.QC.jpg
a302f2d8567f1681c258d67307e1c544
7027268df4c86282fa6559e839f224608958ca54
1051966 F20110330_AABDZW wallace_t_Page_112.jp2
fc3850af3a507e9e463fa0e2fd16c6c8
402df1715c32cb9fa3ce9715c083dd64f2abd66e
34080 F20110330_AABCXI wallace_t_Page_021.QC.jpg
5bdc813d75bc8c36d22ca623e76db506
47b49351fbb63864b16138a5cab3173cf1eee1fd
2426 F20110330_AABCWU wallace_t_Page_142.txt
1644823626c20346c0c7eb7357fcb5b0
b38b3a0a03a89d7c8b6bc46e4998b2450afdfb7d
1001031 F20110330_AABDDD wallace_t_Page_104.jp2
b469ef2acf597f29d8a34b8642ae9ce1
595f01eddf51ffc20691158ce28f371bcf8623a2
F20110330_AABDCO wallace_t_Page_144.tif
be79dba3456b60b1840e7bd2f0ada60a
641660b8ac144701ea877e5199b03dd0b8f5cd3f
32115 F20110330_AABEGG wallace_t_Page_096.QC.jpg
fdea95a4626cb7651f97b0371cc41deb
a2d19f70fbd2e9db903b3aa6f2ab03f3cf0e8a74
27995 F20110330_AABEFR wallace_t_Page_072.QC.jpg
fe4b90ddb259c083119382369e782a11
b9d255a2892bb1663cb096dca06d590a0eb58263
108897 F20110330_AABDZX wallace_t_Page_113.jp2
6852c22b0af33f9270a5108f41c9f0cd
271aed9ec993bcfa3b3840b7408aea7383c44e45
3104 F20110330_AABCXJ wallace_t_Page_033.txt
75a002a93e93e0a4b97db2bf2c958723
9ffad4bb8081e3ff60c9d429cb37fe1af4f698f1
F20110330_AABCWV wallace_t_Page_153.tif
396e67a343034d7628891c0768149c9f
94392647ca9ffbd98f22bba7052f9403a3748308
86240 F20110330_AABDDE wallace_t_Page_045.jpg
131c3f305f34ed2f2665b4081c18e039
230754429d8a6476f8155ad711a8807a5dceb67f
2451 F20110330_AABDCP wallace_t_Page_144.txt
0939ecb390d620410e80662b4811ef1e
57b99b66aa9a53ab86052ba27a061f6a7b9b6fb1
30882 F20110330_AABEGH wallace_t_Page_098.QC.jpg
a0f36e5d7316e5af1db8e0d187c22370
c34c01de206302cbc7cf0d83667c96b44f6afede
28348 F20110330_AABEFS wallace_t_Page_073.QC.jpg
a188432909c5447d5df5c92d1b6bf249
601dfcf56f567a06b56a6c69348856d20ad1c5da
103909 F20110330_AABDZY wallace_t_Page_114.jp2
bad7648c4c94695e62bf9b22973d5962
ab0c12d1da569af26fa43ba4555fdab29cec53c6
3210 F20110330_AABCXK wallace_t_Page_136.txt
77192a47ebd30a236bdf501e7c12942d
4564c647e091c483ab1ce0387c9f262daca3043c
105889 F20110330_AABCWW wallace_t_Page_119.jpg
a7997fba00938aedcdd95e164a962b76
efe88ccbd866b5b31488103013ff9e6e0a8cd284
33732 F20110330_AABDDF wallace_t_Page_030.QC.jpg
49c91ee4beda0be63b85658d26ce7568
fa64b9635262390675d6ce3f73d1451219d2cec0
8377 F20110330_AABDCQ wallace_t_Page_020thm.jpg
aaa9c998ce45b188b5f7e47cb22eae54
471bec190c645a8b828d5fe247195ccf5ece8316
33539 F20110330_AABEFT wallace_t_Page_074.QC.jpg
32347cd84362d0d1cba445c189846224
fbc27fce2220ec137a0325062c890841798dc3c5
71767 F20110330_AABDZZ wallace_t_Page_115.jp2
0ae847762ac83b943183ce9194cb84d8
9b1017f99052c74b3428714d9adf1f13f0b0c035
1930 F20110330_AABCXL wallace_t_Page_063.txt
97313e0fdfcf8c2d13223f61b1665d61
9e3337334b66d776d3974ca20e76f929bb644959
101567 F20110330_AABCWX wallace_t_Page_141.jpg
7eae492a7fdd4293232b294c959cc8c9
9a074728d6e337f8c9c5209c9611254b4073bd50
1995 F20110330_AABDCR wallace_t_Page_091.txt
d131a68dacdf8e919dedc49723fb3507
86db5471ac3205607f1117bc2288af5ab66f6397
32967 F20110330_AABEGI wallace_t_Page_099.QC.jpg
6248a339228a0d54e2a786dafff00419
4d8ad431a11c48a360d10db21810b7063ad8a618
33489 F20110330_AABEFU wallace_t_Page_075.QC.jpg
169bb0dc0844808f5de23e8ce0ebaf75
fe014e5aa60916a2af894435b9bcf4620e34a1ed
95048 F20110330_AABCXM wallace_t_Page_024.jp2
08cbf177e1efcd63be75a8e42a1cd769
14ed3a77445694bfe20634d8207739d944888ccf
2993 F20110330_AABCWY wallace_t_Page_130.txt
c70303c3a53317ef2f2e68a4d185a0ed
c16e792ab78d567e0d06487a407c62c80d0967f4
86426 F20110330_AABDDG wallace_t_Page_125.jpg
28275290c48ed1521fafc06901ee94e8
86e14ea60784dcf357ba3121a341c7128fc227ad
8423998 F20110330_AABCYA wallace_t_Page_054.tif
88c38944df930595f175e081bd76260c
edee4a61e6813d74a71490132b564ab9ffc91ff0
2493 F20110330_AABDCS wallace_t_Page_146.txt
709269b6ae1322b8bf21c3c8553df74f
7d96d10cfbbd9f948b4ee3216144d93539d8216f
F20110330_AABEGJ wallace_t_Page_100.QC.jpg
cd6c4a16bcff0972feb15e6d1b0dd5e2
09043ffbea3c4397f546e6e1360e15ceb5dda4ad
32595 F20110330_AABEFV wallace_t_Page_077.QC.jpg
0d9f1feb38ad1c984bbc04a29f2c3231
057a5ea943fad28df12cb6463db6f063c4a6e4ac
88783 F20110330_AABCXN wallace_t_Page_035.jp2
1a0c5d75a2c362a516b291986fb71dfa
e311edabec2cdff17c33b6a5316c05bf2b63d42d
1051891 F20110330_AABCWZ wallace_t_Page_139.jp2
72c94508ce74564a01080c2031e1418d
115425a942abb2d732105324a64d1ae2e0a384fe
F20110330_AABDDH wallace_t_Page_129.tif
44ceb4f61c41febd7b2b3b2ada9a5a9d
21a8436e372f3f30074889fb263c5d95d3c01f93
36512 F20110330_AABCYB wallace_t_Page_008.QC.jpg
61ed9941376fa526e323f5f36fe2a2bb
ca03bf09302d74e43401ab96794ab6b48b99ca62
F20110330_AABDCT wallace_t_Page_158.tif
ae7f15b74a83894eff902916062d694c
a35be3347fc14020d0160fa903e1cf4b380373ac
18539 F20110330_AABEGK wallace_t_Page_102.QC.jpg
a9af52ccb737bd0482bd00b715ec5f7d
6f5442ea3f539ac531f68886ddf473efbc7c81ff
11976 F20110330_AABEFW wallace_t_Page_078.QC.jpg
efaf489db7ae69f4660ed70fe9ffdd8c
8948c7576c3c154a562be453a08cf3d237469ed4
1497 F20110330_AABCXO wallace_t_Page_014.txt
2c90e058437b4a2fd6b2a3148d42ea12
8a5771259b951086b532389e6a22a274e864d9c8
33099 F20110330_AABDDI wallace_t_Page_117.QC.jpg
9d0714ac55c3142cf2b1231f568cf4dc
b63c35300b9a08776be755e6897f4ca2b582668f
99200 F20110330_AABCYC wallace_t_Page_025.jpg
8d54703c50face0db60d0da7b98f3ea6
e374d9feb98c1a16d6070f920a564e31bd82e138
F20110330_AABDCU wallace_t_Page_100.tif
cee847bfdce63091d91460cad7ad006a
4f5587a83dec3cd562bd89ee2c862e7a24679227
31265 F20110330_AABEHA wallace_t_Page_134.QC.jpg
9e3ccdf9c1de29d1f284eb82e70adaec
9d57d2e3d7d03274fda778b74ee6d6483e55a951
32082 F20110330_AABEGL wallace_t_Page_103.QC.jpg
93a059e2b9b9ddbb175d529fd77b5a6e
5cd3def00eddece8f68faf3591ff062f664c39fc
29599 F20110330_AABEFX wallace_t_Page_082.QC.jpg
51be095cd55d8f2bea7ac0b2c7e58da3
1d5a94c41d543a4ffdc3564facdda0c788247e5a
102727 F20110330_AABCXP wallace_t_Page_095.jp2
4e624f63b092b60d913fdf9a82774f93
076f7c0d97a47b7bfdeb8118b962a32f0a979b8d
80829 F20110330_AABDDJ wallace_t_Page_013.jpg
6df265a0e76c3d4d3264efe8418af969
77fa0a65bfbc1449698c9867f950f7e5d5a801da
2710 F20110330_AABCYD wallace_t_Page_058.txt
e4f6d6051fc6d6a61a99459fbd84c0d8
53a37cb6e0ebb54e20198ac1567a331ac8c9cf5c
103262 F20110330_AABDCV wallace_t_Page_103.jp2
31a2b70952d02f7565eacdbbee93ea19
76fe753513bacc111249077a20b4abd06703e484
31969 F20110330_AABEHB wallace_t_Page_135.QC.jpg
14d90d5878e7d93019527b5fc43c2349
ddf73f2ebd2301e7ddb91c0c9b98dc067bdb61b0
29467 F20110330_AABEGM wallace_t_Page_104.QC.jpg
2501dfbc765278abb2f38194456554f6
88677e48dc9339cc27d99d95c274c9c1f7192b7e
33775 F20110330_AABEFY wallace_t_Page_083.QC.jpg
887e51029cdfc537c18f51e3b40ae6e3
0521ff9e4b9ca702f8a5d95ad2bc858c1e208e1a
32114 F20110330_AABCXQ wallace_t_Page_115.pro
6b80e1b306adfb331d8355464ed188f4
df8378a2526ec2dc1319d91303d6409d93c6fbfb
98614 F20110330_AABDDK wallace_t_Page_040.jpg
edff7c92f2459949b2b90b960aa1e683
924229c3704f71f4be421beb9e579fcb5302f97c
F20110330_AABCYE wallace_t_Page_039.tif
2dea75d67e30d62b6e899fe728ade145
775e04ddfd1ed652b7c8e4052e7112ee247391b3
7766 F20110330_AABDCW wallace_t_Page_042thm.jpg
505bc7162beb3a9a2ff647e2b56a0e77
65830e2da4b2eec0b3172eec336d1c68441b3dde
30368 F20110330_AABEHC wallace_t_Page_136.QC.jpg
b2fbd695da43e6bca2c7125cc9b2af9d
62fe3eb8eb19a701f3d0cd486168777aea25f9a1
26684 F20110330_AABEGN wallace_t_Page_105.QC.jpg
f534c2cce2a210424e85f18335e10920
5db05490b449f58de5214395de3b1e0543d2d719
33745 F20110330_AABEFZ wallace_t_Page_084.QC.jpg
27e9efa4fd331e10a5cd693b89a97f38
708cc7181ba5c9570e94d4a93fbecfa8d157e1e4
48801 F20110330_AABCXR wallace_t_Page_083.pro
0662bc907c1d9fc4e022936013f824c8
adec573ca1d9c1cc4e0cb53da219085417fc0fd1
111855 F20110330_AABDEA wallace_t_Page_122.jp2
ebda541b61f2150b78944f6dedf32f79
0a39bcd677f8dc988ac3b4070136b85435228132
8173 F20110330_AABDDL wallace_t_Page_132thm.jpg
3e5f0ff968925376b06257a85bfd28d6
9c0028ea8928195bd4cbb01bc145a48d6538a6d1
101403 F20110330_AABCYF wallace_t_Page_090.jp2
bd4951970c84ce91daef68498e526353
27a8fa169febcf81552169135ac20ffe742d1fac
7911 F20110330_AABDCX wallace_t_Page_026thm.jpg
c3b412a556a7e18de9841ef56ab5a812
0c67f959abaa0186d6e3ebda88ec3776e59425b6
29666 F20110330_AABEHD wallace_t_Page_137.QC.jpg
28a58eb3eedfb9c1d8292d08c3af1821
c8b1bee77258cd18ef4179abf601c87f8c7d8d0b
25893 F20110330_AABEGO wallace_t_Page_106.QC.jpg
0ed30348594152b44e49eca0f986b364
35c5df972a4d25e9df8de07671120a204eade641
1051916 F20110330_AABCXS wallace_t_Page_076.jp2
4037804c73b8beaace7d97635dd9c9be
d2445b917a210a683ffd92ad6b9dbb7f01408f36
110551 F20110330_AABDEB wallace_t_Page_032.jp2
ee058533b07f20684daa53fa5ee7be07
c7dd2c4427e3ab9cc6d00773824afeba4866efdf
5988 F20110330_AABDDM wallace_t_Page_085thm.jpg
99e48b70b91b4c8c6a5591ca06e674cc
9aa17259ae8cac7bdb0e07d44f3171245b398fe4
F20110330_AABCYG wallace_t_Page_037.jp2
18982f7ac2a7ee2303361aac4c2a6c79
c8a73bbf0a16a1eb3729a9af80e2cfa49bd7ff77
2632 F20110330_AABDCY wallace_t_Page_157.txt
a7df1dd362c92e4f5f425de93c5ab08d
e0db51abb7c62c15a30a5f78f2c054bfc08461b8
18273 F20110330_AABEHE wallace_t_Page_140.QC.jpg
03349080449d0d13958bc350c43bc29e
94ead3581bf16103fc62ac0f042154333b7035d2
32670 F20110330_AABEGP wallace_t_Page_107.QC.jpg
46c63a4a64fc786e6a3230e8125c9a07
ddad3eb9650247bc4dbabe3f4d660904f81d5a16
1688 F20110330_AABCXT wallace_t_Page_013.txt
0c25be2e2de2fd4aad8bcbabe3eafd41
3f49d948bc3bb91dbb1b83e36f1b9a7c56cc5d0e
8424 F20110330_AABDEC wallace_t_Page_010.QC.jpg
2237d45988406c0aea60739d72964de8
117aa6cdc8701a948e89d40ea894eaa9e6d79d75
64183 F20110330_AABDDN wallace_t_Page_147.pro
4270d7f071f8fa13a7eded5426cdb282
2f8ee0544fa92a83faa8aab38b083b5766ad917a
37496 F20110330_AABCYH wallace_t_Page_078.jp2
3adf9eda4e72de7f10ac6c1f711f426e
7f202c732b8b503cfab5d79a4ec3b93f92f9fed4
43074 F20110330_AABDCZ wallace_t_Page_051.pro
3bfd09b487dc570f95bf2e3e896a6ad3
928b9d11f87c590b7a43906d40614ceac8169dc3
34499 F20110330_AABEHF wallace_t_Page_142.QC.jpg
f586edfae9596c096458d14f3cf72b0b
a86385dd4080f966b8746e74582491397f6cfcad
31899 F20110330_AABEGQ wallace_t_Page_108.QC.jpg
c5994ad711b21e92035572c4f63f1608
b53098018a350fb9b88bb71ce2c26e6ea851b774
F20110330_AABCXU wallace_t_Page_042.tif
68e601a4fe1d37f4fc43403d328b367a
ea536b11556980d4e32e7bfe0562c08ba7ac7915
1019070 F20110330_AABDED wallace_t_Page_054.jp2
f5b6fe2133eca68ec7ab0d00b726f62d
17174ce2bc4387c80da7187ca48b4d396bf14836
12137 F20110330_AABDDO wallace_t_Page_124.jpg
b54612b09a38ce953a7f9cbacd338080
4e544dcfdc29678ed7a9e3250eb1f0c0ef5606ce
991956 F20110330_AABCYI wallace_t_Page_045.jp2
fdbdbc14fcd86dad56c2eec19fd556e4
fead70de4c78f68ff64499c77ba6cda844483559
35571 F20110330_AABEHG wallace_t_Page_144.QC.jpg
8c66f7834043f09ff7d863db0ed8105a
bdcc67066c68a4d21fd58a396bdf1fcbf596e6d0
24429 F20110330_AABEGR wallace_t_Page_110.QC.jpg
7db7832bfe845da916581bfe45a52671
f369e7f5b202778e051fff1db42ab27fc8a57e26
8068 F20110330_AABCXV wallace_t_Page_118thm.jpg
6d7f5ca6ab203c99c38e2e6b757a3051
5ab317db277af88b405bda745a12ee673db564ce
43150 F20110330_AABDEE wallace_t_Page_104.pro
bcfe1fd091bc8be8c904735f5783ab5c
24ae69cde393bbcbcb1838c681e62bff3ae9716b
22411 F20110330_AABDDP wallace_t_Page_159.QC.jpg
56867a6f0d504a06ebb1728f580b0a0c
e50cc7670158e0dcda33ddd65b5487c8ec526e48
37705 F20110330_AABCYJ wallace_t_Page_150.QC.jpg
e2d382c5490ea82ab5b1a9b7b9f14de5
9cb2a33395a1a7de5b84fc6e95dc2b07bcefd038
36212 F20110330_AABEHH wallace_t_Page_146.QC.jpg
0ab2e63d690b8c67c13d57ef8e529306
681bd33611dee202b7aeb0bf4d1af90b09f4a72e
23927 F20110330_AABEGS wallace_t_Page_111.QC.jpg
2a5b1d0d3363854f446ef07ff1125cb1
607df24aafde65feed358bfdde51d9fa7e0648db
8245 F20110330_AABCXW wallace_t_Page_047thm.jpg
f41b37fb23aed9e632dc757a79f21d9e
93b4274aebd7531547f5d44b64f3bab82df7ba65
106782 F20110330_AABDEF wallace_t_Page_049.jpg
510c75811f439005668eaafbc555aa71
b73e3e4fa28e45e08599f01bb79eccb532dd0fae
61273 F20110330_AABDDQ wallace_t_Page_128.pro
8d376a8e9881197408552e9e5c21175a
8665fa96c9ce0b2f0bca24ae93f937795fc72655
30941 F20110330_AABCYK wallace_t_Page_095.QC.jpg
7e064fe49d9e73e0e14dd2e296fbd1f3
22f16bdd23feb9e548c8fb4fc0fb692f6e742d0a
36543 F20110330_AABEHI wallace_t_Page_147.QC.jpg
3db32112e8847ba332270d693ff5954a
1099f5fe94d33c1c0291cae20d2147fb8c99abdf
31755 F20110330_AABEGT wallace_t_Page_114.QC.jpg
8ce71bd532dcd21d5457ccbd1903dfd1
29f0499d3b21f92b38e68f5f1cd0533dbb702e68
96569 F20110330_AABCXX wallace_t_Page_037.jpg
ef1ed90adb0fac75e55a69b1aeca3998
7c130ba818f1569284ec41d9a43f881116e183e8
F20110330_AABDEG wallace_t_Page_093.tif
5cb8f3b94cbf1fe08d8b3ab26d8a9e5b
3d76e69141e1f3be2f3d758669cc86171c7e6384
8342 F20110330_AABDDR wallace_t_Page_117thm.jpg
7c8f832f2650eec3f4951d9cb0c5fb29
e24e6ecb11e6827809f436214567651d2eeb66e7
50822 F20110330_AABCYL wallace_t_Page_113.pro
77832bc76cba411d93ee5559b2f6718a
ad12a9e3291985af29b8cecba52555bef546ead5
30454 F20110330_AABEGU wallace_t_Page_118.QC.jpg
58ce75bbff40b6a478bddf7bb9c858fe
ee5d6f1e76bb4e4593dec31569aedde2e3da7bdd
95822 F20110330_AABCXY wallace_t_Page_095.jpg
ddcfee3a58a6782f5703e27f0d91448b
94b989f78c0435e51e7746dd5fc43c5ec5b0bdff
1681 F20110330_AABCZA wallace_t_Page_079.txt
5bcac760130a84927b64276333299183
a55ddb04694bda31beb99c319dda7aa4ca710aef
1937 F20110330_AABDDS wallace_t_Page_023.txt
3093e0e23f135ae77bdf324d7b04a99e
12748f8e5fdedaae3b40a794fef8eac3b309a1a9
102400 F20110330_AABCYM wallace_t_Page_091.jpg
3568d19d0ebcd8f1584b8d28e75b8828
cd0cafd4044dd1e8457f140c18535482f369bbc9
36206 F20110330_AABEHJ wallace_t_Page_149.QC.jpg
a5324dbb88c74ae45d51cdf2514c24ca
2b0819e387c0ae491556055fcedccf0cb5f2d82b
35131 F20110330_AABEGV wallace_t_Page_120.QC.jpg
090d9c97d829e45a6cd14850fb26807d
fc42e447b6a92a5e66671cd17b33e76943e10eec
49599 F20110330_AABCXZ wallace_t_Page_138.jpg
92a0c5719eb0504312d41b8d777d93ff
540fe3d726e77bf74c3cd0d7dbc3555b58085a55
34110 F20110330_AABDEH wallace_t_Page_119.QC.jpg
aa2a9d1533b89c351b0e6acdce6523a4
68002db0a6f292ffa7e3b43e90df74672de7f01e
8155 F20110330_AABCZB wallace_t_Page_126thm.jpg
f51cbf19fcf032334c30506ef13ce309
c67af2964b21ab9841b47668151a67094dc76d51
8051 F20110330_AABDDT wallace_t_Page_127thm.jpg
a1a12d0ff02c1cd98a3a8b486d4e195e
6251c1355c352c8a092318c2efa979b9e9d0f355
F20110330_AABCYN wallace_t_Page_094.tif
d4de53ad0bf1526391d0fda9d74d13de
fe33b25ae99358667fe9517dd585b8f9dbb3f833
36697 F20110330_AABEHK wallace_t_Page_151.QC.jpg
d7f0cc6bd518accbfa12f3e306ab9a19
7a7e14b7ccef4737ba8c17fac55e05a28bb8b3f5
34189 F20110330_AABEGW wallace_t_Page_123.QC.jpg
ca91026d2138ea4a7ed76379db0d2e27
f4c7cea66ce831de45cf2fa8c32d3cf171613fc5
F20110330_AABDEI wallace_t_Page_019.tif
6bb12aaca36c59d757575bc9672f27d4
2ec0fdb048a79e85bdb02002b5010b31964f676a
F20110330_AABCZC wallace_t_Page_049.tif
9a30010f0f5de7fed5bb9fad12d7148e
f4e81f68a7bffc987a64665af905d1ea7208e249
2112 F20110330_AABDDU wallace_t_Page_043.txt
e9ab01b85947640b26ef78a9b21d4da5
b7ad625c3e1e6f0253de5c6cc863577eec9525b7
2296 F20110330_AABCYO wallace_t_Page_046.txt
04b4870b449f3d9a4ad7733ecba9f4cb
c158dad350fcfdc4986005003abaf837c5124b1d
6152 F20110330_AABEIA wallace_t_Page_034thm.jpg
a9a82a69817958020520b9d8a5b1b10b
746f217247a33a68633057bc96837f4549f2579e
36578 F20110330_AABEHL wallace_t_Page_152.QC.jpg
dd3c6f83e41b26761fdc972b7f5b3e2e
0982dbd9c3bb8e5943ab6dabe82c0fafb521236b
28428 F20110330_AABEGX wallace_t_Page_128.QC.jpg
9b46ec4eeb9f7a98eed62399f0871752
957d5cbdf3653f63ca70de3a39cd2f3448f26278
187121 F20110330_AABDEJ UFE0012904_00001.mets
264f45727464a1faaa74802ad707df2e
d65bc9e27edbc49436bd3f101580d424278df83d
wallace_t_Page_001.tif
F20110330_AABCZD wallace_t_Page_080.tif
5004c515c518172e68165cd72052b067
c012337332444126da7581a137255d7d3032d7cc
1559 F20110330_AABDDV wallace_t_Page_004.txt
c5ac8a8cae2ac15a5567b6e990041853
e56cd9ae7169912e21e4fb78649ddddfa58d5f3b
7678 F20110330_AABCYP wallace_t_Page_061thm.jpg
e1f82453c8f65a0b3da42b50dd65b255
0a891115a67cdf7c6e016c1ce76558af1c6df504
7898 F20110330_AABEIB wallace_t_Page_037thm.jpg
0086608b73e623ae2559850cd64ddefa
643a8719945bd88cbfd96bb378d4056e150d3324
34551 F20110330_AABEHM wallace_t_Page_153.QC.jpg
c4b55fcefb2c480162de85f168b5a69d
669dcce301f3552435268c1f6ef334c5dd4c5fb3
30011 F20110330_AABEGY wallace_t_Page_131.QC.jpg
106925879ab3232308e6e701f36ea7eb
0df8a5e15bcf3ea468ebdee4ba2afa7eb2ab8d18
94600 F20110330_AABCZE wallace_t_Page_018.jpg
a4bdb65a8f0290af24d41dc50101b30f
f04b720c6f65d1d99af024553231a65b26252974
41004 F20110330_AABDDW wallace_t_Page_015.pro
009159994131284a71172f5e6d0cf4a8
fe00f3a09320199483b9836b6364b07712e56204
F20110330_AABCYQ wallace_t_Page_012.jp2
4185444ab620daa62ed072eaca3f5de6
c4c04052af2f9170e79d286be23b66c7de0fa125
7706 F20110330_AABEIC wallace_t_Page_041thm.jpg
1ab0748a9587639a10dcbd0912da9f94
099b17971c0ccac489a4de612da2785dde7e4d7d
37619 F20110330_AABEHN wallace_t_Page_154.QC.jpg
c1b946273fe8be5924a562451e77775b
242e1370134431c102dd27cacc49a749102ca59f
30053 F20110330_AABEGZ wallace_t_Page_132.QC.jpg
a2aa2a1f93cb65d01aec8457b0a6c9cc
34d93b272765d62e0859d4bc2f03bf9b55a6b7ff
2227 F20110330_AABCZF wallace_t_Page_001thm.jpg
22f38bd18569020e99522cae4a1a4f94
dd0e523f5348d955e9acf6d251bf69200281bbf2
2442 F20110330_AABDDX wallace_t_Page_065thm.jpg
a81bdbfa3eeabf20c54069325fea7e8f
378640d56f6a1bfca5015fff6eaf23b2f696d121
1907 F20110330_AABCYR wallace_t_Page_114.txt
dc6494a96fb232552657fce47b14b3fb
beae284487a19e305c5b8bc0f790bee6b91cb8fe
F20110330_AABDFA wallace_t_Page_020.tif
9fd73affe0b1334cff89498a423fc862
8369fc461c6c2372c8cad9b2e09e0f1e907b4f73
7219 F20110330_AABEID wallace_t_Page_043thm.jpg
8a75acc9ba73937e9af0dded82b4180d
2f8409f8ce7a33c5630b052dc10c37575f636590
35387 F20110330_AABEHO wallace_t_Page_155.QC.jpg
6e7d6925eccfab2a14a9da447ac46aa4
78c976e3ab87352134fa05f7c29e0dbfe4345125
F20110330_AABDEM wallace_t_Page_002.tif
6bbb319cd4f24f5a03b39489c2b137d8
6b2e101da6a67ddeaf3c3ef79cd3a4163c0487ed
995419 F20110330_AABCZG wallace_t_Page_058.jp2
d4e301d891645cbd3ac956127c3ef03d
adfbec93966a275324edf3aa65dbe1e5f8e22ba1
1971 F20110330_AABDDY wallace_t_Page_025.txt
a54872a50d2fef2fe351d528a32bc4eb
128fb722e3e06e4262083122c0e153dced0066e8
4468 F20110330_AABCYS wallace_t_Page_124.pro
e3af2d1cd857eb0d1bdccb64f69479d9
903c05ad9923b9965964eb4cc91fbce4bbefc528
F20110330_AABDFB wallace_t_Page_021.tif
929f2f7e906b37a88f5b819ece27c723
73ec4cc14d0704c3303193fc7c5b810a9162880b
8556 F20110330_AABEIE wallace_t_Page_044thm.jpg
c76809fe6dc2b0067d13641dad2481a4
1839ac0f04f1c43ea030f9cae99f8f456dc6634e
662 F20110330_AABEHP wallace_t_Page_002thm.jpg
20bfd6981f2214a20434e3bc9a80b940
abc6a37ba2ab7e2374841f5d5d18b5b3050e1081
F20110330_AABDEN wallace_t_Page_003.tif
3d3a7237b97cd69efe2ccee7fcf1c691
f5a4ee9923e3534335b1daa6f31e2ecd8d9ed37c
F20110330_AABCZH wallace_t_Page_038.tif
fd9302e526815147e3294715182a4173
d0816fa1aa44e15558a76aa0bb7f9d720169d16e
F20110330_AABDDZ wallace_t_Page_115.tif
bcef8c83c5906387e2e60620e5d3080a
e462cd2ae3b1f24e1e7d1874386352d70c7874c8
33265 F20110330_AABCYT wallace_t_Page_092.QC.jpg
fa3f1f1d966e982f94029e468439564e
8a2f1cbcb17858c8a8a02876446aa669eb67ede9
F20110330_AABDFC wallace_t_Page_022.tif
ba35132c6cc409f06e9eeafc5b8459c6
f34e76ecdd5b55b3246a664e631d5e3f46283873
6647 F20110330_AABEIF wallace_t_Page_045thm.jpg
0c289952f4b518598896d88c5fe1a185
2c773ef6ee8d84d0599d56bc4ee1849084947688
6692 F20110330_AABEHQ wallace_t_Page_004thm.jpg
20134aaad12f4bca2a0d5fc47c3899d3
8b43ad19f161f9d307e616e6a27463a4bd4060ba
F20110330_AABDEO wallace_t_Page_004.tif
0c6c36037b0de6551b77f3b5940d4121
e36aae9f47757323cc68e61275fd5f3a7579d22d
110193 F20110330_AABCZI wallace_t_Page_132.jp2
ca9b8feedec49d83c1b1cb28e2586bd3
f7363710918914f6aea4ec0099c1751f9797b4af
F20110330_AABCYU wallace_t_Page_098.tif
b99e01a18e42b46ae5d17cfd32e88a06
df9ca0d66d564c445a1fd122ce1356231910e797
F20110330_AABDFD wallace_t_Page_023.tif
e650fa62c221ba1bc2a98f0bbce04e37
90629579764a612761ad53fd1126aa360cc0bdb1
7317 F20110330_AABEIG wallace_t_Page_048thm.jpg
46530f7feced31cee3bb9f50d6ff71f9
3d0c5e859b4c866d22c02af886153d248105ce56
1873 F20110330_AABEHR wallace_t_Page_009thm.jpg
92fb19611481e9fe4b7f67d03c5115ee
61f0ee90a0706a7e66c8352f2ded54f8ec02008f
F20110330_AABDEP wallace_t_Page_006.tif
54c731014f228b8bb48dfb68eddf38c3
470b7279a268fe1323b2b4a4c5a806408062003e
62048 F20110330_AABCZJ wallace_t_Page_156.pro
bb4b106f80c81d9c38ac3df576c9daee
14c21039c67250a6f6e13644040031ba704f9a90
105076 F20110330_AABCYV wallace_t_Page_022.jpg
4fb8a540dc3f43940bac89fb4889bbb9
f845f32197a6c76a79b480dad9124fbb670a427b
F20110330_AABDFE wallace_t_Page_024.tif
74826d4e2e16215c0906675ece1168e0
46dce5a79b68d94d28cd29061edf0ea5ee917deb
8442 F20110330_AABEIH wallace_t_Page_049thm.jpg
4c3347741c5ec826210e2b79717c6da3
400473ac45cde230dd72736733bcf306d26cc05b
7505 F20110330_AABEHS wallace_t_Page_017thm.jpg
5fb7e9bfb9ba69fc2722e5e450772583
e17670f5dc9da55d8fb66fba843b663f9dc3df8c
F20110330_AABDEQ wallace_t_Page_007.tif
385bf1e84f36136c68c9b6e458c19844
d496e166afd6a2f4a9095efa79f1cbebb181c347
101391 F20110330_AABCZK wallace_t_Page_083.jpg
a71e9d5a2a23419ca645e5ebd4d0f5cd
22e41532ad54fdd39dab98e695cf42024de512b0
105279 F20110330_AABCYW wallace_t_Page_029.jpg
af642ff4da41e29d344baf9791e1b99a
9776b8c4770cd8a4004f57353cf3581a6eeb1490
F20110330_AABDFF wallace_t_Page_025.tif
fe35b01510714c56574780fb463df179
88fad6f8d241a14095b0b7513fbf30b944fda06f
7608 F20110330_AABEII wallace_t_Page_050thm.jpg
13e868f93095c6548a476d4526f1a22c
b99dd5f536652b17d4379d2556984d81fda6b817
7437 F20110330_AABEHT wallace_t_Page_019thm.jpg
53ca85bade4c9b39ddbd385a4bce4341
543791677d223dcbd2cb9e522e8d72e0a20e3f7a
F20110330_AABDER wallace_t_Page_008.tif
9f036a776edd71a43ed793fe46679426
e851346e708908509ab01ce022ce8d5daf1ca668
112863 F20110330_AABCZL wallace_t_Page_022.jp2
50f74e4abcfcc480085e9545e52b43d5
31f0309aa16648287cfe340626186b86c2ae8cd6
100366 F20110330_AABCYX wallace_t_Page_061.jpg
35a5e07a8df4b25d3ebd96038208ae0f
8dda2e3db8909a5791eb9af61c4d015b71d014c4
F20110330_AABDFG wallace_t_Page_026.tif
d45f59475df3429f87c8c8797d94ad29
60651275826f9192a1fe53b6bd75015a6b71eee8
7685 F20110330_AABEIJ wallace_t_Page_051thm.jpg
d56ff4a15685e9abf39375589c1e375d
74b35acd1558efb496dda6b2ea8629ad00eb0206
8461 F20110330_AABEHU wallace_t_Page_021thm.jpg
6c076ba3531a8b47d035fe1b8ad0c4a5
13f6b3a1916ba551fbb9b804a168559f0ba7db81
F20110330_AABDES wallace_t_Page_010.tif
e42896846181255ab5753b63a27277d7
8d962d30074a94d8710f752c491ec3305d57a920
29485 F20110330_AABCZM wallace_t_Page_116.QC.jpg
be85df79784045b43b4e9c6bb7795515
e7a93a118173486f9078766860910a7ccc7b8f53
25089 F20110330_AABCYY wallace_t_Page_019.QC.jpg
f8355573c32f3b7c1d3ae51bcadf82a8
df99e189a9fc142c4617a22a0b6b5d48a32a21e8
F20110330_AABDFH wallace_t_Page_027.tif
b46510422581951ce1bf473bc13a8868
92b91416e410aa85c77e3786d8621ae2d8f45394
8469 F20110330_AABEHV wallace_t_Page_022thm.jpg
702a2b242f1be42f3977c3541e3607e0
0f2b5e01e705060d012f4fa456861046468e7080
F20110330_AABDET wallace_t_Page_012.tif
70ba2b5773f1b34443ecb9271cd148f9
c9dd7d16f7852e8cc2b22213230d34a2e056cfdf
34342 F20110330_AABCZN wallace_t_Page_020.QC.jpg
5873fda9f67eebaf90f2006c6c5ec22d
70817db9c80b4649e8670c43227f5a15d086e803
8144 F20110330_AABCYZ wallace_t_Page_038thm.jpg
1026a29722705607908961452ea7a548
d857325ec9d76cc83829ed29ec1bdb0a66b6c198
8605 F20110330_AABEIK wallace_t_Page_052thm.jpg
8b724b65e7091ce427114c10d802fa57
a78294891bd66b37ca3c1b222eae8cdbc1b64adc
8116 F20110330_AABEHW wallace_t_Page_023thm.jpg
06e7c0fa125cc6846809ecf233968d3b
bb6f00520bdec1aa11f0b6c35472e5b1c73faa89
F20110330_AABDEU wallace_t_Page_013.tif
66bdb7f39c6ffa31562e6d84e6b72e98
5f53f10c45ae9ff35fe0ce19fe00d58b7c3eab2a
8011 F20110330_AABCZO wallace_t_Page_093thm.jpg
344b3e9952155299173dd66f8d75aa74
561205c81a11aa3038b062ca0d9c4c4d7539c7b0
F20110330_AABDFI wallace_t_Page_029.tif
952637477b883879b4ce89315ce13ac6
2d20f235f10ae92fc3f601158cd374a28859547c
7514 F20110330_AABEJA wallace_t_Page_087thm.jpg
d29538ce97b9217219dcae601bbd68ea
07393f15a417b366f73e46bcb0a9b6112ed4f73a
8059 F20110330_AABEIL wallace_t_Page_054thm.jpg
db7109eb8b2259a56f9c60089dcf1741
1f6e0ef89a57e29add76a3cf7389bdc05467359e
8504 F20110330_AABEHX wallace_t_Page_031thm.jpg
2a1a5ef4012b2ea20036af9e7d940a36
de4430ca36ccb08f72c42790b3a1eae04187ee62
F20110330_AABDEV wallace_t_Page_014.tif
b57e7b5c6a75088cc9337e02818330a5
d2fb753655e25cfc322ee1684c594daca50b6cea
13240 F20110330_AABCZP wallace_t_Page_065.pro
865acaee89e1e9ccfd2c6865d0cc6af5
ca117912cf92e6fd34e2e6fce1a1dd72b40d012d
F20110330_AABDFJ wallace_t_Page_031.tif
e7b2818fa17dba9e30f0521e73fe9d37
b420c24cf2f437feab9eb37d0baa0cb6f9b9f624
8451 F20110330_AABEJB wallace_t_Page_088thm.jpg
a462200394cc57b3067ad7e6a27a4125
ac8b88baeda9c06ec541c0dd6d896ff59d5e0e3a
8528 F20110330_AABEIM wallace_t_Page_055thm.jpg
23f3a976ab66d80e26ca7ece1f9f772d
c7f33a8b6363903b08fde9633eed621f6e22e918
8076 F20110330_AABEHY wallace_t_Page_032thm.jpg
0c5daadfef9dbf4663645c6810189279
8c797320bc25883829aba4a7db30d647539160b2
F20110330_AABDEW wallace_t_Page_015.tif
d5ada330f4ea3f5ce23ecb30641279ee
4e60745b3c3ce833b3cb0cdfe1cd012897252216
33460 F20110330_AABCZQ wallace_t_Page_113.QC.jpg
37e0d99a506dc93ab87b38b1b5a7b528
e9e88d9840f24d66ab1362a6d34acfc77cca3165
F20110330_AABDFK wallace_t_Page_032.tif
e8b24d4f55ea8eaeb0d5424cace84193
5253266097354c79376864df4c06ed2e1b2d6e48
7968 F20110330_AABEJC wallace_t_Page_090thm.jpg
d312c055473eb0d55974e770c15f584c
620bb2b9d58ddec14b60e1e57b5dbf904583b7cb
F20110330_AABEIN wallace_t_Page_057thm.jpg
e19f66e368f6bbe4560f5c3e7f758dec
f96658a5e684da601cc5a582501a1304b07830bd
7773 F20110330_AABEHZ wallace_t_Page_033thm.jpg
d7bfd7b8f0b8774bcb5c3c590bb35933
c753b8340fb0c554b41b35b65ae8e879e0b4c348
F20110330_AABDEX wallace_t_Page_016.tif
8ddefbeb0ee573d9e6a1115fc77d2b03
cba9dde46874a6b1e18f9444e9863f2c12f9949d
62542 F20110330_AABCZR wallace_t_Page_102.jpg
7378415b4595dfd0a4f01d976abcc10f
98cdd67ed93a263f49ee46b910858e7f6d221416
F20110330_AABDGA wallace_t_Page_059.tif
b0c36fa459bd60b4da4f3432525a6a57
2a8ea93d195f24fcaca705c33254ded5b602f42b
F20110330_AABDFL wallace_t_Page_033.tif
0556bb8368d604e40ef3b4cfa6384441
2e01048a4d9e1d7ddf8741168bf5e6edbf2e828d
7458 F20110330_AABEJD wallace_t_Page_091thm.jpg
10409011aa68cd8a7ff0a7b8b13602b1
a47e8203a7aa00652aaf78afa984f16e96848c26
6942 F20110330_AABEIO wallace_t_Page_058thm.jpg
b93c75a4895a46b6fd1e49526ebda3ec
5bdd7a728539e07f92e180e4474b262290dc2650
F20110330_AABDEY wallace_t_Page_017.tif
ee7bc07f0ce6bf6a24c68c5e4672f99e
df7645ffbbbed04cc2eb0f38a6564f95e808d26a
5134 F20110330_AABCZS wallace_t_Page_089thm.jpg
48bcbd68fa4decfb507ab3f82bece7e8
7088d722c69983d323c95b388a47ed0ba15f6f11
F20110330_AABDGB wallace_t_Page_060.tif
6180f9b9fe5278bbce69e4c2ab6ac445
313d36bd954350d6e887fc7ae2b0f2c72ce5d3d7
F20110330_AABDFM wallace_t_Page_034.tif
8abc801d1626a1055e6116faaea0b396
8a9a6b98f3e364484d1e0a0d40bf2b14e3fd04df
F20110330_AABEJE wallace_t_Page_092thm.jpg
958383209bb72742c1c141bf6b31e7d5
51bed00dfef4167533a7669a10b9cd19de7002be
8387 F20110330_AABEIP wallace_t_Page_062thm.jpg
34dff0629b471e6c6f11190d4bfb6ba5
4299c66b33e6690eaf17118104845c697e1e846f
F20110330_AABDEZ wallace_t_Page_018.tif
ec27a32ac05f4d1fee4e4533078f2d73
af2b193c95d560619405519f6cef189e171ac5c9
F20110330_AABCZT wallace_t_Page_117.tif
25e155c682be566fde832f227f04115c
9e71dfe9d4fb8122da75340844e270cda891f8d5
F20110330_AABDGC wallace_t_Page_061.tif
69b270074e80db28ac8fa18c851e89ac
24284bbcd707dc2431b695f149e67b5ef0f20779
F20110330_AABDFN wallace_t_Page_035.tif
7e523e16c71c9ebfde7392a51e05af8b
ee119d66bbea0026302b8de15cd2a8cc8c569978
7848 F20110330_AABEJF wallace_t_Page_097thm.jpg
0b29f2d33d0eb1b96a105d220867371f
035b2525566cd47cdf8ec8420fb0528db83bef1c
8102 F20110330_AABEIQ wallace_t_Page_064thm.jpg
5d5f20cbb47bd6f51e55fa121abbfb14
ae8d4678111fc5a0c552627bc091c8c8a033c602
100587 F20110330_AABCZU wallace_t_Page_098.jp2
185d0c2af5295298de8b52d82b4bebe3
9b2d89b4165a7a796474d976ddf1b9b2943ff413
F20110330_AABDGD wallace_t_Page_062.tif
9ff2635d1b9d15ca88390ee9b3035edc
c70c5175a8aeb058a79dd1d93b92067697480eec
F20110330_AABDFO wallace_t_Page_037.tif
65172e9ae88ed9e07bcdadb1bafa4fd8
3e457262340b3ff21f3a9dc89b9d1854355dca98
8072 F20110330_AABEJG wallace_t_Page_098thm.jpg
6e6815ec0f7390158c73981869ff0bc6
148d35228405542d9771ca9cc8b779989c887881
7914 F20110330_AABEIR wallace_t_Page_068thm.jpg
9d702829f1f06ebf20729c36d28af95e
55561308a06a5d8548e7acbe8b6bc3a1a26c9a49
2653 F20110330_AABCZV wallace_t_Page_003.pro
40e415de7266d904974518a9497cb4ae
c8bc40acb09ac59ad5001a46f335523bafdd45f1
F20110330_AABDGE wallace_t_Page_063.tif
034434fc6b0a6fe9d7061d97ded0ab0c
47eb60b0d250701321a345210a8ab5e091f66f4a
F20110330_AABDFP wallace_t_Page_041.tif
8115ca1e66a8f7aee1f603f1b1e823de
91a394668cfcdc868b1174e6d0f0a0edca40c19f
8202 F20110330_AABEJH wallace_t_Page_103thm.jpg
4b659f0926e4939b6f8b7baec29af694
19d4f5bff6a33acf8ad5230f8231c1daa638a81a
8263 F20110330_AABEIS wallace_t_Page_070thm.jpg
56ddb8dcb82b702ed53c8795ca953ca1
c8ed8b080a9def94203f3034e4086dcbaaa51587
4534 F20110330_AABCZW wallace_t_Page_124.QC.jpg
2456ef0414e02b4513fabf23fc719b02
06a19653c7718f6c16216b203f048b99393816c4
F20110330_AABDGF wallace_t_Page_064.tif
ac6a3c793429f28de2864f96874b6469
5535c7439fd501af18a02ce659bd91978315cfe3
F20110330_AABDFQ wallace_t_Page_043.tif
754880f2512c0cffc81c79e3eb01590b
1862a5994e96781f3a81f380ebbb62044ec698f7
6955 F20110330_AABEJI wallace_t_Page_105thm.jpg
26f5b0aed8f0abbc218c5c939443412e
3fe0a49f5d555884b4f59da4b8df0e009cd5c119
8110 F20110330_AABEIT wallace_t_Page_071thm.jpg
13638aa08e35392462cd3a95ea35d4ab
ebdbee28d266946a2318e35b41e2da724a1ca6a5
25302 F20110330_AABCZX wallace_t_Page_012.QC.jpg
cedfa571dfdd8bf883857bd86ab73f6f
69791125b4ba7ff02d51069be7e822585c0df8a9
F20110330_AABDGG wallace_t_Page_065.tif
ae52d3ad28d432ed52dc745402bec9b0
c0585f4fa24a2c670890ec52c6b0401217564785
F20110330_AABDFR wallace_t_Page_044.tif
3baeb4604de149c7efb17abc1449d4b9
317290134393ae249d433fefe6617eb0b8e3d422
6741 F20110330_AABEJJ wallace_t_Page_106thm.jpg
9d6bd76e9c0eaa8939452f9b3e313008
9bc9447a09b87e6b58150a60cb9d999e47429953
8381 F20110330_AABEIU wallace_t_Page_076thm.jpg
21b22bf0f195982934af5cc267fe0d91
9ae088e1d3c7ac1f418b3f55a846bb33be1142e7
F20110330_AABCZY wallace_t_Page_138.tif
aba952cc7527e22862e5e4e72fd23f0d
82ca90312d2603e6b2f26a5bfd9df472b66db83d
F20110330_AABDGH wallace_t_Page_066.tif
bbe0c7ac9d0d37147abe41f38d947dd6
1fa5e954868563a8661f0e9a4696be69c89be58c
F20110330_AABDFS wallace_t_Page_045.tif
7b503d263f6d1712fec6f72dee989507
309a46fee1b647a72a1e2bb76b10d617a9471017
F20110330_AABEJK wallace_t_Page_107thm.jpg
c44a4ffb9ffa7dbcbdda58c3d885159f
dd19da2a37fd9ff0a1da40c097139c6e1b98a2ab
8078 F20110330_AABEIV wallace_t_Page_077thm.jpg
f0c394cbf140d6078c69f2774afc3bcc
4b2421e4ae3b37276895150dd885432d8ff22cd1
62147 F20110330_AABCZZ wallace_t_Page_148.pro
1ea0730a834f72383df1702a9f3a8689
a68a04a43940015bd33dea9bd72fcc419559db43
F20110330_AABDGI wallace_t_Page_067.tif
d50c8a6383b58d5c46eea8818bf6b14b
09d0af62f88a8b0d3c3ce5204fb15de6b209012a
F20110330_AABDFT wallace_t_Page_046.tif
e1e5be872276ee65b633bd86deb10014
06a43efb2f9ed3e40eb2a4b6d34d2911cbcf2f69
2954 F20110330_AABEIW wallace_t_Page_078thm.jpg
440f48b65f68d2d50b0c4d95b94e765a
dd5d85575f70f1cc73cdff97960d2a2299ddbb5f
F20110330_AABDFU wallace_t_Page_048.tif
f8d1de4373caabaf23885ead239de203
50a0432f9aae03e7afde708dbe31471deb9ada16
8092 F20110330_AABEKA wallace_t_Page_136thm.jpg
fd30dd867e4bc0557a5d41030b942998
21370898fa894f8fbca6c85faf5240454a0eda7e
8417 F20110330_AABEJL wallace_t_Page_108thm.jpg
ddd0f3c3ffb6ff96a15c74e920b37f13
5b75c2d131b519b44546f1812630bc002a4e46c7
8087 F20110330_AABEIX wallace_t_Page_080thm.jpg
e071c74f271a5107d0e89d037289e51f
a70c5d864d6d5fe7ff55a7e0d5c87979f4bc425c
F20110330_AABDGJ wallace_t_Page_068.tif
622a79bc6ffc6bf0bd5711191df3b2cc
530ebd428bae7595d8d119b1e26f7d35e8667af6
F20110330_AABDFV wallace_t_Page_051.tif
54ccdefe4e5dd76e13e972ca5a445e18
3ae02cc56e5a350d3d3516b16110f4151e9b741e
8157 F20110330_AABEKB wallace_t_Page_137thm.jpg
c9922b298a4b47d33cede96ee328f027
6b5dc43a44caab9307612dc2c8d255c0a5765eca
6424 F20110330_AABEJM wallace_t_Page_110thm.jpg
5775d830195a924b80a70ffef875e5dd
a53a8b5d9b6fe56d003900b844746ef5d5b6cb1c
7161 F20110330_AABEIY wallace_t_Page_082thm.jpg
51b717ba3791cea643698592eb4e97db
e3a4f2f4a67878836e22deb2b034ef04f3abc8d1
F20110330_AABDGK wallace_t_Page_071.tif
417c627f0856c146645d98e96c238c07
040c6b0c08962591f2255d7abea3c2c9f1d0d875
F20110330_AABDFW wallace_t_Page_052.tif
271e13842f97016b89b8da6251330e62
bcef8ddebc3349a02321c48cd69bfbfd80a43223
4194 F20110330_AABEKC wallace_t_Page_138thm.jpg
8059410904a33789367eaef24ad2ee69
03cbc1f1f67fae7c862c4331f61816b391a5cbe8
6246 F20110330_AABEJN wallace_t_Page_111thm.jpg
ca33c517e3b5347e71b7f171b3029038
214859fbd69d0244265166b81055e77d89b49a6d
8455 F20110330_AABEIZ wallace_t_Page_084thm.jpg
6cd891d5212b41a6d7c1dab074cd29fc
d5105c845d23bbeca24cd1d55e0dbe5f99d497eb
F20110330_AABDHA wallace_t_Page_096.tif
1e713013a2d8f7888dfff55c9a72cb44
b4daacb22525104692d0cc95266198eb6f7699ec
F20110330_AABDGL wallace_t_Page_072.tif
07becf7f349b6702cb29008db9a220bc
2e6bde034cdaf76da4c97695a72a930c86bd8329
F20110330_AABDFX wallace_t_Page_055.tif
b32c7ccd68f0721a5f94ce442893416c
4c0a99fcf6c22046107f034ff4e62fe43ca0cc9c
6557 F20110330_AABEKD wallace_t_Page_139thm.jpg
e3de94c7f8a974b526515692eb3cb971
4b57fec5ed1b7248a844eb33766ff20588f79a82
7757 F20110330_AABEJO wallace_t_Page_112thm.jpg
50b649df3113397f4a992ce79a6c1b48
ffdcaf7cf4a8be7f1da47d7bae0e1e6083d15485
F20110330_AABDHB wallace_t_Page_099.tif
a1f0c259e0fd5b8866d6b58ae85fd0ce
7d7be589418529fa5bf8b7c8b99af741cc2cbe09
F20110330_AABDGM wallace_t_Page_074.tif
20f8f8ce7ac2af0e430d67004db64aa6
dbd63d65ff06911f51598a40a6c7a759d2c041f4
F20110330_AABDFY wallace_t_Page_056.tif
299a93652644b37aaf1b6e7ac357d7fd
2904f982d4af26531fbc2077f8bedeb6be0642d2
8474 F20110330_AABEKE wallace_t_Page_142thm.jpg
e1ecd0ae33898e5064aef8525e98f3b2
8fd5016ae1427e7c04c372cf4e9ebbb6f1d3ab9e
8438 F20110330_AABEJP wallace_t_Page_113thm.jpg
61fa483578c417bd365252d43daa8b1c
16c51e770cfd2a16087a0cd24ac31ba7af0eb62d
F20110330_AABDHC wallace_t_Page_101.tif
fa8a6b9dc2946eac916ac5c4cf745fec
ef266c9e8fd60a9f0b48d84c57f50b6254ad1a6f
F20110330_AABDGN wallace_t_Page_075.tif
db6eaf262a39ad7dc196da1637024880
0373b08b1164e04f720bb57d4e6c9fef203ab176
F20110330_AABDFZ wallace_t_Page_057.tif
fd0f5b3d7a6eda9f4f2ecde15f27d00d
d0e87865f8adcbdb95f90bea1c897acaa1ee542f
8366 F20110330_AABEKF wallace_t_Page_144thm.jpg
470b578b27c489fc19d9f6942e2fb5ed
86a891175275bd42c124b8843a355ac656b045a3
7998 F20110330_AABEJQ wallace_t_Page_114thm.jpg
7d98e82a6950ce83209c34b75aacc7b1
5e92896d8edeacc3f18e8a16d18c2de22e90e3a0
F20110330_AABDHD wallace_t_Page_102.tif
1dc1e6f1e00d2d4b4a0bfea62698076e
5c827e04cb872baa93040a365e0f9efaef584135
F20110330_AABDGO wallace_t_Page_076.tif
a810a4f83ec281a0020711d0ffef05ae
f042b2ddc58bbdb18fb642a308a947e259bf8bc2
8436 F20110330_AABEKG wallace_t_Page_145thm.jpg
f4adbed1ee1531d2de3300c9e4ad921c
2a969466b89269e70c0f9478ffd54fc228008a43
5433 F20110330_AABEJR wallace_t_Page_115thm.jpg
57c3968d8afd63321b6f92e0fd693534
8a878645f1a190f5415ba148eaf04b57a5af9c4c
F20110330_AABDHE wallace_t_Page_103.tif
30d0aa9b23bbfde9e4034c92de9edcc5
4859e53e124934bec281f902a0ddaf4920af3d04
F20110330_AABDGP wallace_t_Page_078.tif
a1072b7ce4dc5546b41e3903a0fddade
e0ec344d7c1155b5681d4f34b361c7d5bf967b17
8927 F20110330_AABEKH wallace_t_Page_147thm.jpg
f617fb459c77f319b93905f7d476df78
286fdf521bcefc4fdeca7ffe7296f2b65dbc05b9
7428 F20110330_AABEJS wallace_t_Page_116thm.jpg
fc3acc82a5e28878e3ca3f384afb5333
c7dc0d0113d007a84c94ef1378670afc1ac9afe6
F20110330_AABDHF wallace_t_Page_104.tif
106bd778911e768bb793be42d1e8d75e
cd87ff24d45ea6cc4eb2d7f8f231c6075509f668
F20110330_AABDGQ wallace_t_Page_079.tif
6252c53f134d2526c3acbcc06c35ac9a
746d7b95ab06e47b2ecbae897cb143175431f5ce
8447 F20110330_AABEKI wallace_t_Page_148thm.jpg
928e3045d2c12b9ef7f66c4d8c97f6fa
4770b385aa33561e1f25d1581159bc8ef5013628
8609 F20110330_AABEJT wallace_t_Page_119thm.jpg
5ee3b61231a3daacfe4ea30abf60f521
ae70db385766ddb4120f6845809ad71ddb70c83b
F20110330_AABDGR wallace_t_Page_081.tif
98eeef521cda41da350a4abb9cc16362
1800188cbc67e63ffad0bed7156092fb0c6c1ffe
F20110330_AABDHG wallace_t_Page_105.tif
e712613a78442ca7345cad2ec94906a1
f4063f02dc17fcf009988f2672c46414a2de775e
8977 F20110330_AABEKJ wallace_t_Page_150thm.jpg
67e84c96c190dd8586e7485646413f65
6af2f1d75673ff1789637722e6b7346af7e006f1
8188 F20110330_AABEJU wallace_t_Page_121thm.jpg
d55cc9b1810fc89fd0f38145e91f986a
28b522d2ffd4503176bd695e5ee9f5c3018cf431
F20110330_AABDGS wallace_t_Page_084.tif
a9c11e7dab333f7442e2b7d4b196cee6
b313b106d9584f8f83a6e1916264c01b19aeef8a
F20110330_AABDHH wallace_t_Page_106.tif
91c6bee31290eec53a963b60a13c277e
2395fd1b5bd96055c532021833c43b5b6fe134b5
8512 F20110330_AABEKK wallace_t_Page_153thm.jpg
cc90c2403c15bbb466dff4e50bb998a6
de0d9268454de2ed70a2c5c9256b2bf690c27c95
8435 F20110330_AABEJV wallace_t_Page_123thm.jpg
4036c8d0419b65909602544be2fb6827
3726777169f8741a6aee903c38fba70db5f8f6a6
F20110330_AABDGT wallace_t_Page_085.tif
371596cda55f58089decb7e982086651
3bfc2b23b28a67ad86e11239d8ba2d4d603730d1
F20110330_AABDHI wallace_t_Page_107.tif
83d2317395ae2d54ded4b0a5691e9ba9
8ef1d5b84f02ebac83d201b53dd3987441548029
F20110330_AABEKL wallace_t_Page_156thm.jpg
ff9b76b1ef7de022266b5722b5eb75c1
1889cd98a38f3cb7c8654ff1f23100cf7b1fa04a
7890 F20110330_AABEJW wallace_t_Page_128thm.jpg
35acf266cda96c11d07c5dcf5c998eeb
7cbe2d9be206b573128e0de6a0c92b987759c03a
F20110330_AABDGU wallace_t_Page_086.tif
02e1fc7c378269bd008dc9514d58c3c1
f23b8d882c3a86c6de384b78141fb04658ca99f1
F20110330_AABDHJ wallace_t_Page_108.tif
596561923def757f52bc7dd67292c60b
016c68d46605fe1f0c18baee615f9b6b44a8f920
7965 F20110330_AABEJX wallace_t_Page_131thm.jpg
d81b81d7a9803ea1a2eb767d9caf2c76
53fc7af0f6d4f3033166ee2f543fa846e17cb0d0
F20110330_AABDGV wallace_t_Page_087.tif
9c7e78d44b28d13f790862f02dc1ac73
bf187bf887527cb70aaba14643a3de2fdc9ea2b1
8297 F20110330_AABEJY wallace_t_Page_133thm.jpg
13c85315bd5bff154ad3e5c913c2718f
22a9c5e11a90cd1c3aba93f9a215b39a4415d1fd
F20110330_AABDGW wallace_t_Page_088.tif
87a4f1eca1ecde75a830d9cab096ef00
fde0109c4c60e0d64628fd1c797c90b7638bb58c
F20110330_AABDHK wallace_t_Page_109.tif
a5ab427340b735bb43b862be52ea7d13
486385cbbc0ff0728a8889f57b36df72fba6b201
8401 F20110330_AABEJZ wallace_t_Page_134thm.jpg
0eec03d55076b1e2183e03478b4abf2a
895afbab3c2ffcdf12d5d1ef41d0a4447b539009
F20110330_AABDGX wallace_t_Page_090.tif
7b163afbee55a1616062d8d8dfb6889d
a2a942b10b55e3e1bf53fdb7402171b575e89a7e
F20110330_AABDIA wallace_t_Page_130.tif
718e4046c0a2224e5e34748504949c52
275d0864bb2e3d970d5c6756cc6c67fcbfb13623
F20110330_AABDHL wallace_t_Page_110.tif
dcdafa524b02dfea9b27a6bc259a4080
c1fcd1c7c88af9924ad7735afda876cc16cccec4
F20110330_AABDGY wallace_t_Page_091.tif
702100e8c30b7cdd16a8ba35d49aa31e
34c02d4f9ce0bd43bdfd193ad4d02d36e4fc06cb
F20110330_AABDIB wallace_t_Page_131.tif
605c4720aa418f0351cc294201837878
0117c66721ca3c4c49357f43aa75d56fe4337140
F20110330_AABDHM wallace_t_Page_113.tif
af5698242a52dd0d4537bb70560f9435
f6325eaae83c97fcfc191ddb0cb6be2633d26576
F20110330_AABDGZ wallace_t_Page_095.tif
4e70d398e7c2d12eb691922fb132540a
e331ba7622d4c07669064a42cb1dc1986d350088
F20110330_AABDIC wallace_t_Page_132.tif
140c9c232b757fe1932619c26b1becf2
a01e4144bb9cc39521851cfa2773c054db765a6e
F20110330_AABDHN wallace_t_Page_114.tif
29513e79ee5690f0f3a471f61ffa8143
4cbe8103d60725d093bb8fb7d10deccd4cb15475
F20110330_AABDID wallace_t_Page_133.tif
00b54fa0633cb17f97937b6f9899af8a
c902b9e77f2182d9b56ae9127cab8e9d7fcb2a43
F20110330_AABDHO wallace_t_Page_116.tif
e28ad89936b53d087c010ca527e07790
4a0d7f51fc37f71588a6da35e9cf4853bcf606c3
F20110330_AABDIE wallace_t_Page_134.tif
235cde3a9e2eccce68d509f947db8212
abccf2ce52c5c003a394a086d3e9940fc8b0b832
F20110330_AABDHP wallace_t_Page_118.tif
1e1ae2a6aa9c2b7beec3170b0927eb15
438374fd9103667f36d0b6bd5652be3d5c9a02a2
F20110330_AABDIF wallace_t_Page_135.tif
dd1934f2751b0a574394abf1744c79eb
9301be9797c82eaa85d57d722156efca50290aad
F20110330_AABDHQ wallace_t_Page_119.tif
a21ac4cb6253a0ea6c0c991cc9783485
97f1999a7e3e209ba79427c4c769b15563e84918
F20110330_AABDIG wallace_t_Page_137.tif
f2072269931de1bcc2c335a4d6f0fa37
42a4076a3d1b2aaf4f97b4103e79df1da9b24686
F20110330_AABDHR wallace_t_Page_120.tif
9eec5a6671fea174343420d17bae7a0e
0d9270cec718b1aedb04782c245e44c234e20a32
F20110330_AABDIH wallace_t_Page_139.tif
772faa5af5b97eae3935392e6ba1f7bb
97b465615a93e5072a833bad0c3a387dead44305
F20110330_AABDHS wallace_t_Page_121.tif
78c94e48fcdb3735b320931de3764cf7
d4ebd4fafc0a0b030222884f6e2dbb59a0d57e4f
F20110330_AABDII wallace_t_Page_140.tif
6a0730ab9ccdafc86eb93f2e1471692a
a4923089775e5e6a747fc7bfe841c5c78f875835
F20110330_AABDHT wallace_t_Page_122.tif
9384827fa53e9adadfa656963b3dc7fe
c83498b9c8904d9e40f911dcf254d7811d1b1cf0
F20110330_AABDIJ wallace_t_Page_141.tif
3f97a65b85170d3fb22ecc8e2ec0dcf4
4a986217720b7f8772e03d896427572f3f937817
F20110330_AABDHU wallace_t_Page_123.tif
76b1f06e45b76abfe250e7f7cd6e0170
f51fed331a15a43fff36ef5a3def4f12ff21c448
F20110330_AABDIK wallace_t_Page_142.tif
f9f7485fd024535e29bd84430873a7c4
657d0daa67c45b3b73773f3e01a3338d7bfaf78f
F20110330_AABDHV wallace_t_Page_124.tif
8517cae1a7b09af2e605efc3faa0a228
a7af622029d36a175b308316eca3eb68f2bbfebc
F20110330_AABDHW wallace_t_Page_125.tif
d563d6e4649ebdb8a1ec5cf02c80be75
f859a5a123e85118ac001bfdd993d428d6a4ff1c
4153 F20110330_AABDJA wallace_t_Page_008.txt
8f1c69df26c7e85c6fd0726cd945b3ff
ad005ce9e640ccfd14602a770abede3c55bb461a
F20110330_AABDIL wallace_t_Page_143.tif
690bbb925d774cad77e07bcd5f49c232
e428491358c626eaa069740e1cd1541528803ef3
F20110330_AABDHX wallace_t_Page_126.tif
4e242ae502ea3791c6797295021fb4a6
6b5e6a205c3458d5b3b780640ef69ac7986188bd
481 F20110330_AABDJB wallace_t_Page_009.txt
ddb883a1b4089098a1434b98c1b5b98d
e1c5ee66701f5a962aa272f68d7b2a971609c385
F20110330_AABDIM wallace_t_Page_146.tif
f39a4226508e21a107af9eb1852a4f74
cb70974b9bdc602c9da6691f7312fd14d9dba202
F20110330_AABDHY wallace_t_Page_127.tif
6cf3eb293ef0c9fabd21cfa6d4f2eb22
e293ce360e9e600927cf4af6b9d71ac635b8d49d
634 F20110330_AABDJC wallace_t_Page_010.txt
474bddf5d8641a603cd975faf4831add
96476a564ed28cd943317154d712732aa482f1eb
F20110330_AABDIN wallace_t_Page_149.tif
e8e61a0a1eb9c9fcff3db183209f93d8
0ce8ac7e364747053e94998b2dffc3db5bd62d1e
F20110330_AABDHZ wallace_t_Page_128.tif
b4ac0cb754feabffa967915568ae8cc5
bca68c94998f9626858d8d7b1e594c857be9ef1f
2462 F20110330_AABDJD wallace_t_Page_011.txt
699a9081798ac8b7f97f6f35c12e2389
c3026bd9a15b533506f72341b75f49505946c623
F20110330_AABDIO wallace_t_Page_150.tif
c753bf6a370547b068d35ee85710c847
698cbf619e623fffb3de8678fdb1f2657fe8df00
1725 F20110330_AABDJE wallace_t_Page_015.txt
970acb14095756c2b7392cb9dd72f850
7eaa7a6de5745b8a5aed05cef5232185ec74227e
F20110330_AABDIP wallace_t_Page_151.tif
579810a6542ab59ecfd5af74e6b06ecf
7c033e2397827da01c493221dcb2d785f7505ee1
1896 F20110330_AABDJF wallace_t_Page_016.txt
44a31c8f115b01e9429860e7cf569b67
7a56f4e31980f89689d6bd8bb815479cf6ef297f
F20110330_AABDIQ wallace_t_Page_152.tif
d5c496c326a1bd862bd57637afbcf44f
907644468827cab7e445991129b1e3ca968f7e76
2004 F20110330_AABDJG wallace_t_Page_017.txt
43d267a679bfc87ff49cadb0894861ed
208ce2985eca0f14804e2d592656771be86564d7
F20110330_AABDIR wallace_t_Page_154.tif
99bc33bcc63649e25fda20abbae8bad7
91460157095afd04f8faae27446ee524aad17c3e
446 F20110330_AABDJH wallace_t_Page_019.txt
b510c8c698506a97ab20775eca43309e
3dece7544670892b83c8acc93f5eec9e4b49287c
F20110330_AABDIS wallace_t_Page_157.tif
aa274f92c5ec879dc0705dc64fef00a8
feaa05260179991cf89a98e96c0e21c73d568563
2036 F20110330_AABDJI wallace_t_Page_020.txt
c7fd7e673d8e34b86de783ae21913b75
287ece5dfe6bdb53cbfdd7effcef18be6db0c648
F20110330_AABDIT wallace_t_Page_159.tif
9f12a48cc35268d05165ceb2e74998da
f4873e9c61c794d08af0d3730de8393c8d48ecdd
2037 F20110330_AABDJJ wallace_t_Page_021.txt
aab2d6718d7a29dc2f6f4c166fa3b076
0419a081132e3edf08255be84ba20b2247f3c099
476 F20110330_AABDIU wallace_t_Page_001.txt
13d14e8b3fc5025f475ee2969592bd08
6c66f19af2b3039c0c829c01bb28ff18121e9034
2053 F20110330_AABDJK wallace_t_Page_022.txt
fc2de4c708ecbaaefc8ac8006885623f
fb96e9d3c4d00b160fb9e6a6dd13b437e9683d8e
108 F20110330_AABDIV wallace_t_Page_002.txt
90fb12ec2b0318655bbdb20c287e8260
7a135b74ec6733b83d68d6e1ba9dfd5deb416b8a
1721 F20110330_AABDJL wallace_t_Page_024.txt
4dee507a13ca54f5952786c37b0b9e82
4a5e4cadb89bed121067b3bdf7193b70d1bfbd8b
156 F20110330_AABDIW wallace_t_Page_003.txt
8d77d7933dd18e1e73cf69948e8f72fd
01255dd9f4cc7ad60a71ed852896c3b589feb7a0
837 F20110330_AABDIX wallace_t_Page_005.txt
f9a8b66ec59b40bef70e902752dd04e1
889edc6985717dc19d554e297dae4b0b21d34394
1856 F20110330_AABDKA wallace_t_Page_042.txt
b685cb1231d29ced00ca797ae66859b6
3326c901d95f6d478bf2c0cc72538179a76a871d
1849 F20110330_AABDJM wallace_t_Page_026.txt
4316cc4fc08ce75d8a4cb086b1d69b18
3d20e2b915eeb41b7687957ae01dd015b1f9e3a4
3100 F20110330_AABDIY wallace_t_Page_006.txt
a3d5dcbbbfb1944a233341632dd4c508
f6432e4706bdb4b3283b01147662dcea4d8da882
F20110330_AABDKB wallace_t_Page_044.txt
b0ffb9c908878efa9b449e1b574ff5ad
12d3cb8452e5fa699073392c9cd9b7072f5cb186
1978 F20110330_AABDJN wallace_t_Page_027.txt
af77151f993d2be46fade78c6637f37e
a6066756aaa66e0eaeb465efa5627f5a4c53d4ee
4596 F20110330_AABDIZ wallace_t_Page_007.txt
4ed63142c6e8014aebd12344ad185979
fc84dea7a82291128f24f331bc6de13dd6394343
1544 F20110330_AABDKC wallace_t_Page_045.txt
a85da4c99e7bd4052e0cce0a1acb434d
420a2c69a58b96094790118686f4439390472241
1952 F20110330_AABDJO wallace_t_Page_028.txt
e2eb451c6fca3b5a88d09ad92dddb506
025a133c462b4a71a9bd3a2186e8bf1f39abe7f2
2177 F20110330_AABDKD wallace_t_Page_048.txt
477f8977860f84181e65ed68d57fd102
e9e44b341e224429ec52f8122efad1afb3c0aff9
2055 F20110330_AABDJP wallace_t_Page_029.txt
3d92462771568338e73a0bccf226e75b
d89eab4907e53bfd774647f86a6759bb9d54016c
2046 F20110330_AABDKE wallace_t_Page_049.txt
ab30e0de9ee7bdb0fabc70c4b0fdc463
eb7b0a9c3c991b46297df50b14f635c9ca77ea02
1973 F20110330_AABDJQ wallace_t_Page_030.txt
d77f6df1c61b1c66023fdf56a7cefcf5
8e6f06ebdb59c87afcb1d482a9c8c558f7510c70
1719 F20110330_AABDKF wallace_t_Page_050.txt
d157621216788cb3b49ec67059ff7b89
72be21ead5a1462a374c0983e833c73d0c99b3c9
1996 F20110330_AABDJR wallace_t_Page_032.txt
ad1edc7d8cf0a93c6f42f005733e0175
d7a4baecd5b366821bf4d978efabef4afa321b66
2175 F20110330_AABDKG wallace_t_Page_051.txt
00a63fe8ab4c8b74f9749982db334985
0e8d5590818374cc07094d03fa033cf38a67809f
1438 F20110330_AABDJS wallace_t_Page_034.txt
a1f5241691c5d6f90a0ec495f6bd1db0
323fab6c3ebabccf7481e09b302932991f203971
1581 F20110330_AABDKH wallace_t_Page_053.txt
fed70aadd53127b7fb461536aa05dbec
66d5ea67441359c63d7175b8d5895fa7b282729d
1701 F20110330_AABDJT wallace_t_Page_035.txt
6f7c1ad22bbe7848250d77c0cf589f7f
d6d667707122a00575bc58076286105c37f85567
2246 F20110330_AABDKI wallace_t_Page_054.txt
30d53f5d3c9dc4672f4c59f398b0db6d
8b09c56b2caf4f0fc26ffd376b3531121a08acad
1908 F20110330_AABDJU wallace_t_Page_036.txt
59edff63bc2bf63c55b87eca87b7c698
1b807100356ec59a01dbb98537ac38e7cd48d037
1997 F20110330_AABDKJ wallace_t_Page_055.txt
5ead0355a8bfc30c146ef671312ef8b6
e20f5b6a8af05378bd0c9d7fda333e1e6cc0454d
1915 F20110330_AABDJV wallace_t_Page_037.txt
99e3113b6b9f148eb88b74a58f37ae75
9e8eba9aea63ea80d483a0bbe1dcc88274cbf726
2081 F20110330_AABDKK wallace_t_Page_056.txt
19c915274e4826edf7382c98429c3a50
02e046ef2c211148992e6671c37b8acc5f1fcc91
1904 F20110330_AABDJW wallace_t_Page_038.txt
2899cd91c10716b972b295779a7dc989
97bfebad46f422b7a2b611ede685ee908a775d62
1989 F20110330_AABDKL wallace_t_Page_057.txt
8563d5715373c183b7f6c9ff22f58931
1e11b0ecc38cbc16e4da2b970916682abb52f404
1823 F20110330_AABDJX wallace_t_Page_039.txt
d22a3b005f286babafa7afbc515797b0
61f467b491e8aecbe6e6e1637ca1728289690e42
673 F20110330_AABDLA wallace_t_Page_078.txt
de624355a5a6b779cb5556dbee29d9e4
81d512736e59a64b2cbae341fb1d5baecc506bd0
2279 F20110330_AABDKM wallace_t_Page_059.txt
cc9794d985036540cd1b90e75232e6f4
cee617c6f159e5a0f34c69e4b9c045d3e18e16d1
1831 F20110330_AABDJY wallace_t_Page_040.txt
5e2b4a26f5d824b4c8e572117aaf6733
aec1f75819dc20075374af64fc218e9a40f60ac4
1767 F20110330_AABDLB wallace_t_Page_081.txt
2ec5429e25cab60c9edac6ae960a8cf9
236c4f3dddbd09c833ae306daa6d50a2675d8392
1822 F20110330_AABDJZ wallace_t_Page_041.txt
cbc52d4231ea531f78d346830f2657bd
b27b293834c2e23a6071489ef8818d4ccd3c7a1b
1591 F20110330_AABDLC wallace_t_Page_082.txt
6d4162d858c1394b0216e62c3b6a4716
06ed7113a9cb4283fa7e4d2f657b4b477b168226
2438 F20110330_AABDKN wallace_t_Page_061.txt
7adc44e0866cc9a826608b42b94ffe95
3c5be6c263bdc7045de76e9322ba2bc7bc4a1e80
1922 F20110330_AABDLD wallace_t_Page_083.txt
d49e92cda4c1d075af06040533fcf3e3
aa565f8fa42d3cafe089f96128e2fbec61badd53
2005 F20110330_AABDKO wallace_t_Page_062.txt
43264b272b921aa17250b91b3a3170f2
9ec709160dc18072afa5ca6cb9fdfef3f83ff5b0
1905 F20110330_AABDLE wallace_t_Page_084.txt
e6055a82d799bdeebae3f782a94d781e
2045dd51014d551a1ea3552c5103079a9cdd586b
1969 F20110330_AABDKP wallace_t_Page_064.txt
92dd1b783017cab0eabd8cb1d2633309
33b1557bdd6bf2fde2fb90df6690811b833f8719
1889 F20110330_AABDLF wallace_t_Page_085.txt
7f6c654a50fca2e244c5e0dcfa275208
f18a5c5b12b909744d5b4b507862b8660327ff5d
575 F20110330_AABDKQ wallace_t_Page_065.txt
dad6b965c4770473202747ce37f039a3
618c528c76ecc12fbd8f2dff876adb4b8336fb4d
1875 F20110330_AABDLG wallace_t_Page_086.txt
71c41b69ca4eeb95fbc7abff75820252
c913f8213acb31b5196a43dad9dfa73d791be416
1502 F20110330_AABDKR wallace_t_Page_066.txt
427125ff2d323ec79a97e02b7d934c46
ce8cbf8de69082af3b9db67da8f21c81e5af4fdd
1947 F20110330_AABDLH wallace_t_Page_087.txt
8e5feee2c93fcb60753201a2161604a3
644ca4e5267e794a78593aa1f3c1e1fee9ced07b
1919 F20110330_AABDKS wallace_t_Page_067.txt
08faf621ef862f50c67682227c77ef36
e573d4c0e17988c2fb221230f2facb0878b7f36b
F20110330_AABDLI wallace_t_Page_088.txt
c2b555887a024b31a384dd4b70acd1ed
518c845166ec6a5d54706fcf422821e8f6d10b23
1852 F20110330_AABDKT wallace_t_Page_068.txt
b970d874c11a568c01d423c9483cf4d6
0fcaea5ed194eb548a6e8452a67d2666818856fb
1140 F20110330_AABDLJ wallace_t_Page_089.txt
d4a7ca8dc8cfa9cbc9b5f2b45a74ecdd
bdf8ec44297e2485bdac6481640a7d24a0f6ca92
F20110330_AABDKU wallace_t_Page_071.txt
2b57d0c4060512f37b7f9c899cee0997
2c2a0bee9fa229848f17de1b34e762976ff78502
1846 F20110330_AABDLK wallace_t_Page_090.txt
825b66d0beec2489be317df2272e16ba
62644811a9e84b5a4212fa291ee15255de8ac292
1704 F20110330_AABDKV wallace_t_Page_072.txt
edcfb63a058d4b197452ee3ba5e9edf4
66b9e55229218ab5315290ace35ac7806bc77b89
1964 F20110330_AABDLL wallace_t_Page_092.txt
bdbb4ea644837624b35a98bfd2426f18
257bd6dc39802933f0380db2653a61e62c3e3887
F20110330_AABDKW wallace_t_Page_073.txt
4f2ba3c9066942a83ffd10fa9377fec6
382ca2cf9377271829600763708b4fba672942d9
1826 F20110330_AABDMA wallace_t_Page_111.txt
64500c0d34dd2c9b44f2b04570ab3cb1
7f217c13b03961037a39bff399c55410ef47b703
1799 F20110330_AABDLM wallace_t_Page_094.txt
08763dd41275022e60f23575436d9feb
c3f2798b9e5cb44ef3a52f86c89383409faf4041
1913 F20110330_AABDKX wallace_t_Page_075.txt
d831341d33621aed3c70988fa113525f
3a5d664c2b300f3f9097df5cc70c1d470bd6797f
2382 F20110330_AABDMB wallace_t_Page_112.txt
4bdeaa7db7ba264038467d63092bbbcd
46c73f49fd818f8bf3f96b0ee7f531483dba2bcb
1881 F20110330_AABDLN wallace_t_Page_095.txt
cc65130497b021cf4da5b9d4411c2056
d7a5b81127a5ed0de8decfd2313f86d36853fa3c
2193 F20110330_AABDKY wallace_t_Page_076.txt
621b42a13fb79f52edb4ed7de70999b4
66e1fc9a8c05c6b22db35f5a6f19d99d67949edb
1282 F20110330_AABDMC wallace_t_Page_115.txt
38d38dc0f54e1f695af541ab68e1d26d
c994074360c4af0548556e5d159d65593e08f97c
1925 F20110330_AABDKZ wallace_t_Page_077.txt
05f9d7effb80739c1ad6c456b7a20ff1
cdb720366c32d428df75137d3ba0cb94f64ae019
1800 F20110330_AABDLO wallace_t_Page_096.txt
cbb586b1b20e76301d2e8a4602d3de84
3382b72633f647d2b21c3021fe879388e4f9989b
1891 F20110330_AABDMD wallace_t_Page_116.txt
db45add57d6ef013f2f2591cefce85c8
0f5e71c8c111afa9657ca87c8321e308095281dc
1796 F20110330_AABDLP wallace_t_Page_098.txt
a1c95ea40572cd9071edac6ee79b9915
87208580f12ebb6b6eec3f99224917a4a6495cb2
2031 F20110330_AABDME wallace_t_Page_117.txt
e9f5d34f136c07a19324f26463823465
c6b630ef869a4a7ce0115065ee79834715d4597b
1983 F20110330_AABDLQ wallace_t_Page_099.txt
52d3f10823f2e6830a997834f58bdce4
9b7b4f89282a06d9f24b8728992b0de8de9415eb
2459 F20110330_AABDMF wallace_t_Page_118.txt
1e0d6c2669c26e987d42fdfd9020647c
1265635c067f3e5211e543be1ef1a703acd6ef8c
2077 F20110330_AABDLR wallace_t_Page_100.txt
02e1deb6d8bb9d6f93805bb290be3f6c
0e298646457dee5e64c5a821b52d20c83f1a70be
2061 F20110330_AABDMG wallace_t_Page_119.txt
a888250d1aedd303ff9a1b428f310ce9
326458f7302e25ce964f963d8ed05bfda59fb86a
F20110330_AABDLS wallace_t_Page_101.txt
7d2d41eb74ef3cd11e84448b84563e17
348a9a1e0edfbb50449ba03adb1666d991f0d1ed
2094 F20110330_AABDMH wallace_t_Page_120.txt
c07cb28c8e952b35d6d8e6b4129f910a
db53d86181ff8b1eb88526bd70a6195341e5d146
F20110330_AABDLT wallace_t_Page_103.txt
970a85f02860f711076ec0450fa454f7
f6d53c2e79ccdfbc8728806869494ef512e7a709
2002 F20110330_AABDMI wallace_t_Page_121.txt
429476d3f348ac39a23c50d7e5005ef8
38fccc77be938561908bfdbbbf09cc7c3b4dd7e6
1932 F20110330_AABDLU wallace_t_Page_104.txt
dcec356fdc67e1aed203aceae1a79687
5b34016ca68a5df5fa95adc152d914947b111533
F20110330_AABDMJ wallace_t_Page_122.txt
493bae5e78fbeb51f32ed1e53776477a
c2b36b00737092ee80bd073cce98c6a42098869e
1839 F20110330_AABDLV wallace_t_Page_105.txt
73c4ec14102504f864f81e090c2148e0
6714791708d166fd469bca0381478aa631bfd50b
2044 F20110330_AABDMK wallace_t_Page_123.txt
a1bd8dbb73abe64950975a2d77d9c9b2
ed2f4b719db95807a9c54bef23bcfa3d1fe9b248
1994 F20110330_AABDLW wallace_t_Page_106.txt
71673fa3e1c564e6ff1f1a433864fef7
542cf11d75b460e373aee27979d39cd6bc7c154c
220 F20110330_AABDML wallace_t_Page_124.txt
412e8668f038eff2b9d529711c1fb23e
0d5304d38cfa081ce84d119c1e29f41a929801f1
F20110330_AABDLX wallace_t_Page_108.txt
a85de6e77d6e5e30c67d492b896b05fa
94ebb4a7a30ed6f016317f12e9ec75698e93e457
2563 F20110330_AABDNA wallace_t_Page_149.txt
6f2919a7c3663bd9cee37e5f4c5824ef
8688572229c28ad261eab67bf2e1b92305366f35
2482 F20110330_AABDMM wallace_t_Page_125.txt
af45fb7e130152add575885b945d4387
25635360795f80ee3553f2d41dee419eb65a46ae
1899 F20110330_AABDLY wallace_t_Page_109.txt
981a4c8369971fca90ea8c518098576e
dedf6a6c1a26ea7086843ee9e19f84f953e8bed8
2675 F20110330_AABDNB wallace_t_Page_150.txt
d44e0c9906ab24c9ca3cb4a65c6cb362
8c009918ee392f6b49d0eceffb9cb60c6df7c286
2470 F20110330_AABDMN wallace_t_Page_126.txt
16abdd49a1ea2f28889c5941b4e92b64
3b6ef9126aada1b74c7e3c78c9b9230ed739a468
1834 F20110330_AABDLZ wallace_t_Page_110.txt
77222fdee3f94bd8e18340b3c8190399
f165318b8ad94218a6beedc5566f7da1b2849506
2615 F20110330_AABDNC wallace_t_Page_151.txt
7673ad472fefcf97cdfbb7e4a2808ec4
5a29c84800d3cbec13ca7c7a749167e21643c9d7
3095 F20110330_AABDMO wallace_t_Page_128.txt
8cc9762d4a6cc719a15aca04657339f4
645f01bd2c4e6af27c3b853fd534bc1762aa71e0
2600 F20110330_AABDND wallace_t_Page_152.txt
299c48b2f93362eae8444f092483aa13
0fdd7e443812648584ed8ac106e6c7c0baba4f4b
2496 F20110330_AABDNE wallace_t_Page_153.txt
9b837977e1cf36636bbf41e150b6a523
a5a783586ffe3a755a3c76e9eab2dfec750a2f53
F20110330_AABDMP wallace_t_Page_129.txt
c490960827b3df9f695594d324829e54
5b1bc96d264b79e2532a35f7c880c9389dceb9f7
2635 F20110330_AABDNF wallace_t_Page_154.txt
466c58368c18ce7715385278070c4211
1b7163726979391e2d469685940dba515a38632d
3173 F20110330_AABDMQ wallace_t_Page_132.txt
f1a17f188adf00da6464093300b8b18f
50a535e69aacd5b80365c405f6abaaaaa2dbd802
2573 F20110330_AABDNG wallace_t_Page_155.txt
2aa88d36cdd54a5d4174dbc8ca7d1799
d9838e37998f40d923a892b6897fde9ac5c24266
3229 F20110330_AABDMR wallace_t_Page_134.txt
dadf394c1b18c8515ba022e4be670d49
96aaba26493c964ac75924bdb9d4c877ba8838ed
2529 F20110330_AABDNH wallace_t_Page_156.txt
9635337942c203b69f21a9a0af2b6f98
6b7253a648387ce86b0957a6d6255bbefba4974e
2952 F20110330_AABDMS wallace_t_Page_135.txt
66cedf3e130e85bc0693311071d72c3f
da0ad7be86a6a9b80e92075c1583e68a812140c3
1161 F20110330_AABDNI wallace_t_Page_158.txt
34a010e35de6319a32a7329d4eb934c9
322b876b293f61500333804a94ba2fe01ca14efd
3058 F20110330_AABDMT wallace_t_Page_137.txt
e39674870405332ed31bf35a8eb0d3fa
ac3c3ec41d635a4debeb3375109d29f096e836ec
1304 F20110330_AABDNJ wallace_t_Page_159.txt
8ab2e144ba5f209f318c30a2d9ee3ba6
b9f81f5f72c340689018791608411e4ffa82bce7
1373 F20110330_AABDMU wallace_t_Page_138.txt
32d3ff7b8c3bd4dbce3af331bf1f371b
a880989358d25b7ae2e77847d8bf866bf536dd5a
8736 F20110330_AABDNK wallace_t_Page_001.pro
76143d2a2ee7d28170b50c605276a359
7b39faca3df6ec1c4aa056a07644e3125b6aaf0d
3649 F20110330_AABDMV wallace_t_Page_139.txt
04993693992b5bd56d01a3acfa845cdc
80700c9668e4e4ac86ce9a04336bfcaf07ea4ecb
1253 F20110330_AABDNL wallace_t_Page_002.pro
b501d8b5a815541cac64a15dd37dcc61
f7516c94951cc0a62d9b03643a09e238b84bf80e
2366 F20110330_AABDMW wallace_t_Page_140.txt
694438677e8303fdc5e94d865b58af06
3dbbb4e4f858677d0055adadfa669187e1930cf4
49101 F20110330_AABDOA wallace_t_Page_025.pro
3545e2f4909b28294b358b03e91eebd8
7ee6125739668ee4a41ae1a301afaddef239544a
37913 F20110330_AABDNM wallace_t_Page_004.pro
3bbd1ec39720faef60b66cf780ec38e7
887ad69912dbe6b607a43deaf4da28346bf768c4
2008 F20110330_AABDMX wallace_t_Page_141.txt
8ef47b491c5d488a6d57c91635f5e5cb
9d0bbf417e9c2c9ba73cfa9029f41503526c43ea
46670 F20110330_AABDOB wallace_t_Page_026.pro
d17427b9e73b7ea8dea0be346ac69e5e
245f0a66cae444612b2d58fdf153a774dc8726eb
75590 F20110330_AABDNN wallace_t_Page_006.pro
fab5d0b7bea7c7651824f7b36ac4edd8
a083f27401becb5731fc6a82b13908d255992776
2556 F20110330_AABDMY wallace_t_Page_143.txt
3d3e00d3b8e0ff0dfecfbcef2f307998
00032b994772892feedf274f5a8fcadc2ccf2862
49816 F20110330_AABDOC wallace_t_Page_027.pro
7bf5935b4ea6ad16b0d1826082a2dc9b
947d15160031cda5a87313ba7549a5cd2f1cd949
112248 F20110330_AABDNO wallace_t_Page_007.pro
07110a9cb94304ce7fff9c9b2affe3ae
4176f829f223c609f0feeff39d8a479fdc18c62e
2362 F20110330_AABDMZ wallace_t_Page_145.txt
bca2a762176d6961b6404f868cc24acf
7697e700a553256b52be0fbaf45d6a46bb2193c6
49365 F20110330_AABDOD wallace_t_Page_028.pro
3c540569ce7f4b27ec4470585e67b5b3
37a31452f0c44ab5dfca5f705cf0fd9d1062a0e0
100279 F20110330_AABDNP wallace_t_Page_008.pro
e72969e62832d5904119a06ed7aa6ad1
82c453cbd45f873529bfb8d549f78bc9e3b2e08c
49763 F20110330_AABDOE wallace_t_Page_030.pro
390580adf9c0237e93c54be719efd443
d2ed9437123233fbe8ca6ecd103f7dd323048a0b
51109 F20110330_AABDOF wallace_t_Page_031.pro
9bd52bc8e226d49e85f53b7804c79df5
196719a30743c803ab1d5aa5cbb815011c7c2f6b
12109 F20110330_AABDNQ wallace_t_Page_009.pro
7bc54ae264ae7255acfb30d9edbdef1a
3add2810c0c973d2ccac7f969656a5b3aa75892d
50718 F20110330_AABDOG wallace_t_Page_032.pro
d16411bb770564fcc99935b8edce8126
81622fa01e7fec35df9e1c997773e0c49412cff9
60727 F20110330_AABDNR wallace_t_Page_011.pro
e7c66f1c86f3015aa33c31432f1b8840
f44c735d87bb93d82f02733ee79a243d830e9ee7
65324 F20110330_AABDOH wallace_t_Page_033.pro
4b1268b682f4217994653eb32f82b660
9b4a2413beec9ab1b6c52a51679eba66011a400d
43083 F20110330_AABDNS wallace_t_Page_012.pro
4909da764d0ba198515dbc0181d15919
335f5974093f908fad32e1f2226437400dd22c14
35019 F20110330_AABDOI wallace_t_Page_034.pro
eb379338b7f6f8d7ab913a2e382a9428
eedcfe31ad90e8f127c0d9d1a4fa41b167abcce4
37385 F20110330_AABDNT wallace_t_Page_014.pro
59542289627bebe255197d043024ae59
6800249d30333a83acaaad1dfef46b7db81ec7a6
40175 F20110330_AABDOJ wallace_t_Page_035.pro
98a1e5f048c8c9eb4d2590fdbf68da9a
4738b073e32c94faa771e84ae107d70c854a2126
41772 F20110330_AABDNU wallace_t_Page_017.pro
3b2f33467f01e1efd4b39695ed1f128c
73bd57d47b9cdde20a2b36762846c88bfa370f98
48096 F20110330_AABDOK wallace_t_Page_036.pro
98f34f155423ce69f6f977d3b5b79bc7
b8345c19b13fbc89ec927d6ae9fafe581c127f4f
10075 F20110330_AABDNV wallace_t_Page_019.pro
88b06e42eadda5f3d635211c030bcd53
a5bae4ed683aea316854466f5f0b59877f1122ae
47785 F20110330_AABDOL wallace_t_Page_037.pro
bbdd2062cec2fe46af28169df7a59687
02359f4b295b9c5f89eae642e173716d4ee7f135
52005 F20110330_AABDNW wallace_t_Page_020.pro
9c2dfaf8a4ae803e20f88eb0da5122e0
d113b7979ce7cbdff79f4f630a7705ad4590a676
48115 F20110330_AABDOM wallace_t_Page_038.pro
5da29e02f5e01892b5a46717179e2b22
e53a0836be60833979ede8023bf7285b284b29cb
51733 F20110330_AABDNX wallace_t_Page_021.pro
851c4b2afb69383c9b549ffc4ea5fa26
d1de4da70ca9a5e085bb771b530784f3d18fc538
50523 F20110330_AABDPA wallace_t_Page_057.pro
dc95e44a6156cb44b49401750c1fa5ba
d86e46b11add461ea895d8d732ceacf35411d0ab
46073 F20110330_AABDON wallace_t_Page_039.pro
cb8fbe156de4ae623bce433ef7af7ae5
8f0488760a1bf2bcf353b101f1f81d9f1ed6e809
52120 F20110330_AABDNY wallace_t_Page_022.pro
8df63193e51d6c8b277cee4461e8c2b2
7ee4374078f364b346415c108bcc3c898c59cc6f
50525 F20110330_AABDPB wallace_t_Page_058.pro
21953ad98d84196052e1baa85bc1b1db
e92eda6682e14a2da41297d94474fdcca045c347
46361 F20110330_AABDOO wallace_t_Page_040.pro
3a6a60bcc86bed288704c1aa174da4e7
ea0825abc9b5eef31bbfac0a66a945e8dfa25606
49128 F20110330_AABDNZ wallace_t_Page_023.pro
652ec7cb6cd41c96464896810880c70e
482cb09fcef6bf25ee2c870d7de89c0e79c3046c
55851 F20110330_AABDPC wallace_t_Page_059.pro
99a054af52c559c77560917b8a9835a9
719b999f4797c899332d5037bc1acfa71e9b7a81
46249 F20110330_AABDOP wallace_t_Page_041.pro
a215f8f3848361cff8d18fdde18cccf1
60479fa3835edbad85d91bb71304b184b39f5ccf
51657 F20110330_AABDPD wallace_t_Page_061.pro
e2625e50bcbc8b689e40b30265779044
9bc7469b290c3c0904ad866279bcd88f9c6e60f5
45965 F20110330_AABDOQ wallace_t_Page_042.pro
1e188d70d607d7115e2d115257d16845
c6c90878132a1f5b9d436d5e9de1e7fe8555f838
50692 F20110330_AABDPE wallace_t_Page_062.pro
2d44458b415a4cc76f2d4895913ec812
c7fde80dd475914160064c793b01c25ad4559062
48765 F20110330_AABDPF wallace_t_Page_063.pro
0682a42396f07c9b7f5d8010c74fc814
b05be1e8fb4c20c0e6bec9fb46d70d0c79166076
44219 F20110330_AABDOR wallace_t_Page_043.pro
fbb9f343c536e08df5036ca2ae260e15
adacd0bd440585e6e24a535493542510cfc28cc9
50144 F20110330_AABDPG wallace_t_Page_064.pro
4b44a8a1ce65bf801a6cb5f27267d720
4069b649c91616192a67c09740e7008cb2995678
50933 F20110330_AABDOS wallace_t_Page_044.pro
892d27a35ae68f298914b614fd092e41
d4263397a2ee7c7172369e8cf46504dda14a1565
34610 F20110330_AABDPH wallace_t_Page_066.pro
54316cae4f89234f237da69533eaed58
bbca7b292f4ed8c01527431e4e3cca344c2c5e8a
34272 F20110330_AABDOT wallace_t_Page_045.pro
a2fcb19930345868b678585dcca604bb
a4af2cf99ca6bf80a51a297bf12bbd404e5f5bf1
48281 F20110330_AABDPI wallace_t_Page_067.pro
9433e73dd172aa2c115d2920f4232b5c
7d9924316d4ab1ce237358d1b779d8a13e51b4e2
49013 F20110330_AABDOU wallace_t_Page_046.pro
240fb76f1ca46d8671a9a9aa3dcb1124
1e5208eca09499466372925b110a378568a60d2f
45838 F20110330_AABDPJ wallace_t_Page_068.pro
bd331d3587193dd797ef28f958ebe20d
fed3dd9656d543f471a82b09b34a66a8fdf2a018
51948 F20110330_AABDOV wallace_t_Page_049.pro
b7060f6ec764a716de3a83364a3b7725
567d56830dc14c45d20702cdbf6b6d270e4b9441
44409 F20110330_AABDPK wallace_t_Page_069.pro
aa3852c3b2c7c0cd6a83cd4aa0c3bf2c
c1f7014eb15557adca7665ab5f63df22fae86639
38983 F20110330_AABDOW wallace_t_Page_050.pro
8127cdd50c04247f0bbecc2fc8bccd0a
e0a1aaf6e6fbee3b7c5f896db7558f63c0220be1
50279 F20110330_AABDPL wallace_t_Page_070.pro
edd77f626a829e8a4d3fc5e195c1abf8
369453ed9fe6de68e821a20b57a0fdc9807ac74d
50035 F20110330_AABDOX wallace_t_Page_054.pro
923129f84245dd6ee95542c191cde541
a445cc6d976f32ead430f9fa4afe06dbd27c0989
39045 F20110330_AABDQA wallace_t_Page_086.pro
4f31d3e1635e99726fa958102d594034
6f928135ca0b884fe521c6ade4839fa040467e78
49915 F20110330_AABDPM wallace_t_Page_071.pro
cf7e12ba09762c1911d1a8567a25b7fa
d68efcd71254fb493046116fbdff2370ebefbcaa
50665 F20110330_AABDOY wallace_t_Page_055.pro
3c1b4c29d8eb8a04eec9de1d2c12d284
68e8d8d158d8fe895e2ae717b5fd93dcfe73ef6b
43709 F20110330_AABDQB wallace_t_Page_087.pro
623e6e819ba3a3deb287ae676b38a98f
dbdf4156e71ba4810f32a6a96040fef43b53770c
38550 F20110330_AABDPN wallace_t_Page_072.pro
c3108785db72bbb46a1497e333e048ad
f23d29b6286479b7d4efa1b817464b938fdb93eb
53081 F20110330_AABDOZ wallace_t_Page_056.pro
97f5e199fe00e6e5a2e8eb2dba60f132
5811291cb4e0871ed1df4ea22b4e45220b8483dc
50089 F20110330_AABDQC wallace_t_Page_088.pro
f4c11f9334b5420248b6b59de923eb7f
936441d94c8092c36ae59c39e67e7637108a8d82
39232 F20110330_AABDPO wallace_t_Page_073.pro
fa96381a8e032296362c6d1b688f3d96
b6e58bf50c8cd83b002adc3a4001e31bc4f21466
24903 F20110330_AABDQD wallace_t_Page_089.pro
6ea5901be0d4ce4cc8428d88a7de7770
a701c88f9f4052db7f209f9d2f2a4267dc70f84c
52157 F20110330_AABDPP wallace_t_Page_074.pro
56d3fad3f58e9153ad27bf7326e7fcc1
b883628f9431599991d8afe1f22b66d583cbf439
45786 F20110330_AABDQE wallace_t_Page_090.pro
c69d54ebb2dc027435f25b4fe77c6f42
3d5a66768505e50eabb6414ad00aab5c9ea8e6d3
48263 F20110330_AABDPQ wallace_t_Page_075.pro
37d9b788a7c6c80c02335c7a12393a96
881a7041555ff2a2f548c226e84301c0658d3efd
47177 F20110330_AABDQF wallace_t_Page_091.pro
15e7e4d9572151fc26d63ca796dce157
ad0e6c3f0d544d2c0a80293eb3577aff7cb64074
53459 F20110330_AABDPR wallace_t_Page_076.pro
df89f040ee3464c806098309bca8a2d8
3d4740437a8579faa52be7c4d5168debdd599658
49708 F20110330_AABDQG wallace_t_Page_092.pro
17239f98144e80f1233fa1af2515bfe2
62ad6a68437da1a1f3834e08510ae34830af1fce
46964 F20110330_AABDQH wallace_t_Page_093.pro
92ba0b32a71e05b1a519970b3e60930f
06518aff6ee77deec576963a5ac035126247a191
48758 F20110330_AABDPS wallace_t_Page_077.pro
82e97429066371d5a83c150f2a553203
bb28139e8037ee8bcf52323a54a3774c600ebf32
42760 F20110330_AABDQI wallace_t_Page_094.pro
958f5203025db6b3e27895afcb9d6153
cfcafae24c0059a83a61d45192be924a9c9e20e1
15688 F20110330_AABDPT wallace_t_Page_078.pro
253bc4ff99ad66def2f11c826b18624c
6260bf06e0f68a822bccd83df1f82ab013b3cd4b
45309 F20110330_AABDQJ wallace_t_Page_096.pro
21706ce1b25209fe7dc92163ed3aeafb
ab70f80125783c8e58d583c5a9000694581790c7
39719 F20110330_AABDPU wallace_t_Page_079.pro
062a3b1e70776326c5c6bb854b5dc844
b5421df41bfceedfbd73ff4681c7e300d5822851
45296 F20110330_AABDQK wallace_t_Page_097.pro
b3ebb5ad8554bfcc616be4cc51ab394b
b34a5b9d7b2bbd8101f09c85841cd6b2cf10c028
48609 F20110330_AABDPV wallace_t_Page_080.pro
5ccb0356514ebe7edeb0703af894c212
e5b4ca2c101e771f3564af2ffda84bd50e090531
45328 F20110330_AABDQL wallace_t_Page_098.pro
31cdfc9a9c4665ef541584943cdc6cc2
9807aa31b457eed2617e4c48f62c07ee9a5e302c
43975 F20110330_AABDPW wallace_t_Page_081.pro
d574eaf3afacffc2a4a50611c60d7ad7
9faaab39cf65612fddb8377e94ea845134d157c3
49209 F20110330_AABDQM wallace_t_Page_099.pro
3811ac9663877b224b44d6a897b6d856
a7cdfffee68378675c5c36b3a34a49816887bbe0
39976 F20110330_AABDPX wallace_t_Page_082.pro
720fea9172028498159c46b05ecdd74f
5da852f8e9ccfa7b87f368017a84c7a68e1b5971
52565 F20110330_AABDRA wallace_t_Page_119.pro
f81fad4cecf6098dab77b3c0cc4e2343
e7a6ad7ede0e99fcacecddfb3e711b28606e4075
46140 F20110330_AABDQN wallace_t_Page_100.pro
ccd4d1b43db8c6eae4a03bb9762651f8
50c678567e60e6427aeec54795b1d40529a8c5d9
47517 F20110330_AABDPY wallace_t_Page_084.pro
1eec30c1bd10f74cd9a1f94528a76eb7
4b55c1a1c9172d484d7c23f8360cea7e697d875f
52632 F20110330_AABDRB wallace_t_Page_120.pro
e2b54a97410c78a9d878a0d0e147b560
a77d5c31cb46a82af155abcea3252424c3e0eb7c
48233 F20110330_AABDQO wallace_t_Page_101.pro
6824386570494d35ea33efad27f8601c
cc263df16f115f9e481c046919e6012d1bec4a8c
34594 F20110330_AABDPZ wallace_t_Page_085.pro
0e608ff9601f6a3d4dc915fdbfca7291
973c1a12f0de5eafb0e704c2669516995c1fce74
50952 F20110330_AABDRC wallace_t_Page_121.pro
3853be3eb5f1d7748274176810f71ceb
cfc98e736a141c84b58b4ed115187fc77e529dde
29584 F20110330_AABDQP wallace_t_Page_102.pro
00cdc6c08570e6541a24e56f5e92f0e1
0dbf0c5e8732eff86de4e4c32d431e50ee93e283
51547 F20110330_AABDRD wallace_t_Page_122.pro
172e1236c65245e422dec9c181104a81
bd480d219c2be1b0bc1eeab7513b62f876e43d03
40781 F20110330_AABDQQ wallace_t_Page_105.pro
317e458660ac2770c4059aab2b276700
e230c2dac81ae616e96118661641dd7627dadc6b
51865 F20110330_AABDRE wallace_t_Page_123.pro
e4ea8286817038525be451123b2f4346
87163ea4490e4fd193cd1af5a8d255367d1edcce
48063 F20110330_AABDQR wallace_t_Page_107.pro
0fb529047d87ee4408f3281bb3bed450
7dc95533ca646d2a183019475ead1f7708682300
56495 F20110330_AABDRF wallace_t_Page_126.pro
c64f7ebe4b68f12d350e06feeec0434a
cb3c9eeb1168bb7888c1ee8214bf9749b47b69e5
47926 F20110330_AABDQS wallace_t_Page_109.pro
a2a4fbbf74439c8e7c87f844343829e3
c43cec828ab3eca4442a1ddd546d006d72c8bced
67505 F20110330_AABDRG wallace_t_Page_127.pro
439d8dd4fcdb889b4c648e0453686355
a32285eeb9534cfc37b89e9cf83d4dda2a77e1f4
65037 F20110330_AABDRH wallace_t_Page_129.pro
0962143970674f5e972adc639de4ba98
f98ae28057be44483eb52837c70ba8ca14098e29
40754 F20110330_AABDQT wallace_t_Page_110.pro
420778948f11e3572663403e769c6c84
2f97789c1997d3a4d1f061fb024722703bae0d38
65225 F20110330_AABDRI wallace_t_Page_130.pro
e6bd7ef61192644d384d3a9b9d5c8b5a
8a5297a9111a5de2b78b3feea556477d27fe23fe
37309 F20110330_AABDQU wallace_t_Page_111.pro
7bd3865c33f5c79e9f5a605e3bb740a5
8064499fa0370de34b1de5812a9d0e9a27a91b28
64107 F20110330_AABDRJ wallace_t_Page_131.pro
cf075f4676ad8938b2c5b24e68190fff
315678554caaa7c444a7a5d04ec45e400cd23cb1
47760 F20110330_AABDQV wallace_t_Page_112.pro
f98c825a4914adfb2f7baabbb429a85f
d45aac5ca48ee34c0e24b374f24235eea1a1a5aa
71116 F20110330_AABDRK wallace_t_Page_133.pro
355abe337a9017b4069e8f59b9924732
72d1da8a02a64caa14ca65d7f653de7a9abcf61a
48355 F20110330_AABDQW wallace_t_Page_114.pro
aff5c4a86557751440becba1b621db1f
39e2edd555377aee8118c97baa60bd4c63b88372
67337 F20110330_AABDRL wallace_t_Page_134.pro
8c1bb877ed016a49ce816e1dc136d8fa
759e3a642522c5b4834864e361ba15c26dc20e6d
45534 F20110330_AABDQX wallace_t_Page_116.pro
15d6dc14487d7c608196443b721fa91f
0ca95cebec342c0af3881d85f6406a1177bcd7d3
61208 F20110330_AABDSA wallace_t_Page_153.pro
9f70c176cf609fb031a23d4aa411ad34
b3589a6efcb4f27bccfc8337da8590b9d126cccc
65429 F20110330_AABDRM wallace_t_Page_136.pro
369563ec1b2e13b070a02cc729f824c1
1228fc8b1755dfe2522fb84a62e303a9e4aff3fa
51655 F20110330_AABDQY wallace_t_Page_117.pro
ab14e8ea7b325d5f501c4c9fc600401d
1baf0b80ac502eb80e48cbd325e9c61f72e297f6
64966 F20110330_AABDSB wallace_t_Page_154.pro
a14f43b6b62a204d906c4c936ce49579
a023a515dd3b1cd83701a0df1785879ce4e43b32
62622 F20110330_AABDRN wallace_t_Page_137.pro
fc69b1679085f4d6612020a103bc782b
8f980c1af8f2fdc6e0bd901ae06b781fdf5abd74
52734 F20110330_AABDQZ wallace_t_Page_118.pro
998ddb61d120d0c431b38ac3324a5c31
b832fae0231a9bbd981284ff18c4f78ff904dec1
63430 F20110330_AABDSC wallace_t_Page_155.pro
57acaf10f680a6c878db2ffd05586587
c49943f5a825e3efed4e28e202eeb978c1e1c419
29313 F20110330_AABDRO wallace_t_Page_138.pro
f1083bc0268dd52b47c0144b2d02cb90
12ca0af3eaeb7993c15b90ac8993a889baac9a95
64964 F20110330_AABDSD wallace_t_Page_157.pro
c37759f88c19ca8c13ee5517d85ff249
d424b1589baa31740162c45d8c26891535fd4aa0
71630 F20110330_AABDRP wallace_t_Page_139.pro
73f904ee3f04e6cf6eec91ea3f370ed7
e520ae7263382264646849b2be65ea626e14c3c7
28088 F20110330_AABDSE wallace_t_Page_158.pro
c13212ac0c11ee9b4139cce42c3c3ed6
4d7a733def62007d0d429aadc1bb8d5da1a0a878
45394 F20110330_AABDRQ wallace_t_Page_140.pro
9c71445a25f8524452939e578ceace7a
9a5296b57851b74c343bc2b7dd8ce34c6faba97f
7835 F20110330_AABDSF wallace_t_Page_003.jpg
522d6835523a25b47f9d699150398bd1
306b435bce2d114c7f61e7b1bcc53b99c267f2a4
48935 F20110330_AABDRR wallace_t_Page_141.pro
2b289f6b00364ae1721030d69036e8a1
80d7c6e8fcd9b786da4667a1c7904929e4bfeb2e
79110 F20110330_AABDSG wallace_t_Page_004.jpg
e9ca6fd5378ef3c85bc29a2447e35fd0
8d64226a0eb7abbf67421e7b893b50bd71201688
59678 F20110330_AABDRS wallace_t_Page_142.pro
6de550d00dc072d67aaad9bdd09a46f1
7db6385952abdcb6d2acc311f0859b0a3a36ac0a
149435 F20110330_AABDSH wallace_t_Page_007.jpg
fa11520aae740d6383310a0d0698f693
c3826b5a4d682bd026367fa658bacdb5a9f33cdc
63017 F20110330_AABDRT wallace_t_Page_143.pro
71f7f4147d6dd80fadf54aed4925af0b
85cb5e6e2f84f98dc2364744454e79ec9fb5a4de
154365 F20110330_AABDSI wallace_t_Page_008.jpg
2b9bd1d1cf61436432d3e638b6b7855e
5c8d4323570b0b6efe0dd924a939db21b33a8804
22396 F20110330_AABDSJ wallace_t_Page_009.jpg
a3fdc11be5b1b677fbe3d140edf13549
756932faea4866b42c95f95917060268c1b2e514
60340 F20110330_AABDRU wallace_t_Page_144.pro
606a276db889caeb74b7eb8988b1040f
7c6d23fcb3c4199ec7d9547b10609b0349c141e7
28317 F20110330_AABDSK wallace_t_Page_010.jpg
4654fdebd3b0a27f8e18270243044b38
486da92e813050fbcb60be77332b5ad9d9dcb7ba
61312 F20110330_AABDRV wallace_t_Page_146.pro
f44ff8b23eb1a80ee8d7d2bb0a254fd2
285f3110b8507c986e1d47dbac7261da75c604c2
113049 F20110330_AABDSL wallace_t_Page_011.jpg
43940b19282d5159cd86beffed27f188
9b1e752d64425da383fca10a568fefed8fa782eb
63297 F20110330_AABDRW wallace_t_Page_149.pro
8cc12419a66928781756b2a74abe151d
156c20deb51ae51b172ccb3044800faa313350eb
106350 F20110330_AABDTA wallace_t_Page_031.jpg
ca0a4e0d2c1ad5280426d2b2677ac15b
149e4b1a12224a59a72fd4679f3cf75c6717e585
87290 F20110330_AABDSM wallace_t_Page_012.jpg
0e87fa1f161fdc20c6cb26f823155e6d
cd97c8aae149f597e10d5b32c20bf40aa85c89d3
66184 F20110330_AABDRX wallace_t_Page_150.pro
1562be4c6c14d7c0e40b3eb5b45ff35c
79e5b74c61e14e5ac8943fcca7bd80795559161b
73590 F20110330_AABDTB wallace_t_Page_034.jpg
d7cd9723f04d0fd77271b5d335b27465
96a1a8e419545280df58c60e5d49f7c7ca447dcd
78083 F20110330_AABDSN wallace_t_Page_014.jpg
c6cb029b77294134d761e105ba14368b
d7537821c869b9662f613c21124ac374d07fff20
64526 F20110330_AABDRY wallace_t_Page_151.pro
286274ed6e00298ac9fed8e8b2621801
630892e52fc014e3e3a50a2b126ba715f605f6c8



PAGE 1

THE ROLE OF JAK2 TYROSINE KINAS E IN REGULATING ANGIOTENSIN IIMEDIATED CELLULAR TRANSCRIPTION By TIFFANY A. WALLACE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Tiffany A. Wallace

PAGE 3

This dissertation is dedicated to my parents, for their constant l ove, support, and wisdom.

PAGE 4

iv ACKNOWLEDGMENTS I would like to acknowledge the many peopl e who have helped me along the way. First, I would like to tha nk my mentor, Dr. Peter Saye ski. Peter has exhibited extraordinary patience and guida nce throughout my time as a graduate student. Peter’s constant encouragement pushed me to achieve my goals and his wisdom proved invaluable to my graduate career. I thank him for sharing in the laughter, helping through the tears, and providing answers to my coun tless questions. Peter has superceded the roles of a mentor to become somethi ng even more valuable, a friend. Next, I would like to thank the member s of my supervisory committee: Dr. Hideko Kasahara, Dr. Sally Litherland, and Dr. Colin Sumners. Their advice and guidance were invaluable to my successes in graduate school. For technical assistance, I would like to extend warm th anks to Dr. Shen-Ling Xia for his collaboration with my calcium st udies. I could not have completed my IP3 receptor experiments without his expertise in calcium signaling and his determination for success. In addition, I would like to th ank the members of the Sayesk i Lab, past and present: Michael Godeny, Melissa Johns, Xianyue Ma, Issam McDoom, Eric Sandberg, Jacqueline Sayyah, and Dannielle VonDer Linden. I thank them for providing an environment that encouraged success. I am gr ateful for the lifelong friendships I have established throughout my time in this lab.

PAGE 5

v I would next like to express my heartfelt gratitude to my closest friends. I thank them for allowing this chapter of my life to be filled with countless memories. Thanks to them, there has proven to be no better remedy for stress than comic relief. And lastly, I would like to thank my loving parents, Joseph and Catherine Wallace. Specifically, I thank my Mom for t eaching me how to laugh at myself when I take life too seriously, and for being a pillar of support through the difficult times. She is truly my best friend. And I thank my Dad, w ho raised me to always believe that I can achieve beyond what I thought to be within my grasp. His constant encouragement and promise of a wonderful “payoff” have help ed me to not only set my goals but, more importantly, achieve them.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...............................................................................................................x LIST OF FIGURES...........................................................................................................xi ABSTRACT.....................................................................................................................xi ii CHAPTER 1 INTRODUCTION........................................................................................................1 Jak2 Tyrosine Kinase....................................................................................................1 History...................................................................................................................1 Structure................................................................................................................2 Jak/STAT Signaling Paradigm..............................................................................4 Cytokine and growth factor receptors............................................................4 Seven transmembrane spanning receptors.....................................................6 Downstream Targets of Jak2.................................................................................7 Jak2 and Cardiovascular Disease..........................................................................8 The Renin Angiotensin System..................................................................................11 Angiotensin II......................................................................................................11 AT1 Receptor.......................................................................................................12 Structure and function..................................................................................12 Tyrosine kinase signaling cascades..............................................................12 Inositol 1,4,5 Trisphosphate (IP3) Receptor...............................................................13 Structure and Function........................................................................................14 Regulation of the IP3 Receptor............................................................................15 Serumand Glucocorticoid-R egulated Kinase 1 (SGK1)..........................................16 Background and Function....................................................................................16 Transcriptional Regulation of sgk1 .....................................................................18 Summary and Rationale..............................................................................................20 2 JAK2 TYROSINE KINASE IS A KEY MEDIATOR OF LIGANDINDEPENDENT GENE EXPRESSION....................................................................21 Introduction.................................................................................................................21

PAGE 7

vii Materials and Methods...............................................................................................23 Creation of Stable Cell Lines/ Cell Culture.........................................................23 Immunoprecipitation/ West ern Blot/ Analysis....................................................24 Preparation of Total and Poly (A)+ mRNA.........................................................25 Probe Preparation and Affyme trix Chip Hybridization.......................................26 Microarray Data Analysis....................................................................................27 Northern Analysis................................................................................................27 Quantitative RT-PCR..........................................................................................27 Luciferase Assay.................................................................................................28 Results........................................................................................................................ .28 Characterization of Jak2 Expressi on in the Stably Transfected 2A Cells.........28 Microarray Analysis Demonstrates th at Jak2 Mediates the Expression of Many Diverse Genes........................................................................................30 Validation of Jak2-depende nt Gene Expression in 2A and 2A/Jak2 Cells......35 Suppression of Endogenous Jak2 Kinase Activity via Over Expression of a Jak2 Dominant Negative Allele Sim ilarly Inhibits Jak2-dependent Gene Expression........................................................................................................38 Jak2 is a Critical Mediator of Both Basal Level and Ligand-induced Gene Transcription....................................................................................................40 Discussion...................................................................................................................47 3 IDENTIFICATION OF JAK2 TARGETS IN RESPONSE TO ANGIOTENSIN II SIGNALING...............................................................................................................52 Introduction.................................................................................................................52 Materials and Methods...............................................................................................54 Cell Culture.........................................................................................................54 Preparation of Total RNA...................................................................................54 Microarray Expression Profiling.........................................................................54 Results........................................................................................................................ .56 Microarray Analysis of Jak2-depend ent Gene Transcription Following 4 hours of AngII Treatment................................................................................56 Statistical Analysis of the Affymetrix Microarray Replicated Experiments.......60 Microarray Analysis of Jak2-dependen t Gene Transcription Following 1 hour of AngII Treatment..........................................................................................60 Discussion...................................................................................................................62 4 ANGIOTENSIN II INDUCES SGK1 GENE EXPRESSION VIA A JAK2DEPENDENT MECHANISM...................................................................................65 Introduction.................................................................................................................65 Materials and Methods...............................................................................................67 Cell Culture.........................................................................................................67 Quantitative RT-PCR..........................................................................................67 Northern Analysis................................................................................................68 Western Blot Analysis.........................................................................................68 Luciferase Assay.................................................................................................69

PAGE 8

viii Chromatin Immunoprecipitation (ChIP) Assay...................................................69 Results........................................................................................................................ .70 AngII Induces sgk1 Gene Expression in a Jak2-dependent Manner...................70 Jak2 is Critical For AngII-mediated Increases in SGK1 Protein Levels.............72 AngII, but not Growth Hormone, Causes Activation of the sgk1 Promoter in Jak2-expressing Cells.......................................................................................73 AngII Causes STAT1 Association with the sgk1 Promoter Region in 2A/Jak2 Cells.................................................................................................74 Discussion...................................................................................................................76 5 JAK2 PREVENTS ANGIOTENSI N II-MEDIATED INOSITOL 1,4,5 TRISPHOSPHATE RECEPTOR DEGRADATION.................................................80 Introduction.................................................................................................................80 Materials and Methods...............................................................................................81 Cell Culture.........................................................................................................81 Quantitative RT-PCR..........................................................................................82 Western Blot Analysis.........................................................................................82 Immunofluorescence...........................................................................................83 Calcium Studies...................................................................................................84 Results........................................................................................................................ .85 Jak2 Regulates IP3 receptor Gene Expression Following Treatment With AngII................................................................................................................85 Cells Lacking Functional Jak2 Undergo AngII-mediated Degradation of the IP3 receptor.......................................................................................................87 RASM-WT Cells Treated With AG490 Recapitulate AngII-mediated IP3 receptor Degradation in RASM-DN Cells.......................................................89 AngII-mediated IP3 receptor Degradation is Reve rsible Following Recovery From AngII......................................................................................................91 AngII-inducible Degradation of the IP3 receptor Occurs via the AT1 receptor and Through a Proteosome-dependent Mechanism.........................................92 Immunofluorescence Experiments Demonstrate that IP3 receptor in RASMDN Cells is Rapidly Degraded Following AngII Treatment...........................93 RASM-DN cells Have a Reduction in AngII-induced Calcium Mobilization When Compared to RASM-WT Cells.............................................................94 Inhibition of Fyn Tyrosine Kinase Results in a Reduction of IP3 receptor Expression........................................................................................................95 Discussion...................................................................................................................97 6 CONCLUSIONS AND IMPLICATIONS...............................................................102 Ligand-Independent Activation of Jak2...................................................................102 Transcriptional Roles of Jak2 in Re sponse to Angiotensin II Signaling..................104 AngII Induces sgk1 Transcription............................................................................106 Jak2 Regulates AngII-mediated IP3 receptor Degradation.......................................108

PAGE 9

ix APPENDIX A JAK2-DEPENDENT GENES..................................................................................111 B CYTOKINE-INDUCIBLE J AK2-DEPENDENT GENES......................................125 LIST OF REFERENCES.................................................................................................127 BIOGRAPHICAL SKETCH...........................................................................................145

PAGE 10

x LIST OF TABLES Table page 1-1 Activators of sgk1 gene transcription.......................................................................19 2-1 Summary of Jak2-dependent genes..........................................................................34 2-2 Summary of microarray validations.........................................................................40 3-1 Jak2-dependent genes following 4 hours of AngII treatment..................................60 3-2 Jak2-dependent genes following 1 hour of AngII treatment....................................62

PAGE 11

xi LIST OF FIGURES Figure page 1-1 Summary of the Ja k2 structural domains...................................................................3 1-2 Jak/STAT signaling paradigm....................................................................................5 2-1 Characterization of Jak2 expression in 2A-derived cells.......................................29 2-2 Global Analysis of Jak2-dependent gene expression. .............................................31 2-3 Venn Diagrams illustrating the number of up and down regulated genes consistent between the two replicated experiments.................................................32 2-4 Confirmation of Jak2-dependent gene expression in the 2A and A/Jak2 cells via Northern blot analysis........................................................................................36 2-5 Confirmation of Jak2-dependent gene expression in the 2A and 2A/Jak2 cells via quantitative RT-PCR..........................................................................................37 2-6 Confirmation of Jak2-dependent gene e xpression in the RASM DN and RASM WT cells via quantitative RT-PCR...........................................................................39 2-7 Jak2 plays a key role in basal, as well as ligand activated, gene transcription........44 2-8 A Jak2 mutant that possesses only basa l level kinase activity, significantly influences gene transcription....................................................................................47 3-1 Summary of the number of differentially expressed genes identified by the microarray experiments following 4 hours of AngII treatment...............................58 3-2. Scatter plot analysis of all genes identified during microarray expression profiling of 2A cells verse 2A/Jak2 cells treated for 4 hours with AngII.............59 4-1 Activation of sgk1 transcription by AngII requires Jak2.........................................71 4-2 Jak2-expressing cells have a greater increase in sgk1 gene expression than Jak2deficient cells............................................................................................................72 4-3 Western blot analysis of SGK1 protein expression in 2A cells compared to 2A/Jak2 cells following treatment with AngII.......................................................73

PAGE 12

xii 4-4 AngII activates the sgk1 promoter in a ligand specific manner...............................75 4-5 AngII causes STAT1 association with the sgk1 promoter in 2A/Jak2 cells...........77 5-1 Cells having little to no f unctional Jak2 protein have a greater increase in IP3 receptor gene expression than when compared to cells expressing Jak2.................86 5-2 Cells lacking functional Jak2 undergo AngII-mediated degradation of the IP3 receptor ..................................................................................................................88 5-3 RASM-WT cells treated with AG 490 recapitulates AngII-mediated IP3 receptor degradation seen using RASM-DN cells.................................................................90 5-4 AngII-mediated IP3 receptor degradation is revers ible following recovery from AngII……................................................................................................................91 5-5 IP3 receptor degradation is depende nt upon AngII and occurs through a proteasome-dependent mechanism..........................................................................92 5-6 The IP3 receptor is rapidly degraded following AngII treatment.............................94 5-7 Functional difference of RASM-WT and RA SM-DN cells in response to AngII...96 5-8 Inhibition of Fyn tyrosine kinase results in a reduction of IP3 receptor expression.................................................................................................................97 5-9 Proposed model for regulation of IP3 receptor via Jak2...........................................98 6-1 Comparison between previous and cu rrent signaling paradigms of Jak2..............104

PAGE 13

xiii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF JAK2 TYROSINE KINAS E IN REGULATING ANGIOTENSIN IIMEDIATED CELLULAR TRANSCRIPTION By Tiffany A. Wallace December 2005 Chair: Peter P. Sayeski Major Department: Physiol ogy and Functional Genomics Jak2 tyrosine kinase is activated by angiotensin II (AngII) via the AT1 receptor. This activation has been implicated in the progression of various cardiovascular disease states. Unfortunately, the prec ise downstream targets of Jak2, when activated via the AT1 receptor, remain elusive. Here, we used gene-profiling technology to determine AngII-inducible genes that require Jak2 for their regulation. Specif ically, microarray experiments compared jak2 -/cells with wild type cells and identifi ed over 400 AngII-inducible genes as being differentially expressed as a function of Ja k2. Two specific gene targets that were identified and then further investigated in this study were the serum glucocorticoidregulated kinase and the i nositol 1,4,5 trisphosphate (IP3) receptor. Serum glucocorticoid-regulated kinase ( sgk1) maintains proper Na+ homeostasis in the kidney, and therefore is an impo rtant regulator of blood pressure. Here, the data show that sgk1 mRNA and protein levels are increase d by AngII treatment in Jak2-expressing

PAGE 14

xiv cells. Conversely, we did not observe a significant increase of sgk1 expression in Jak2deficient cells. Furthermore, when the sgk1 promoter was transfected into cells, only cells expressing Jak2 protein had an increase in sgk1 promoter activity when treated with AngII. We hypothesize that upon activation via the AT1 receptor, Jak2 initiates a Jak/STAT signaling cascade that results in transcription of sgk1 This hypothesis was supported by evidence of STAT proteins binding within the promoter region of sgk1 The IP3 receptor was another gene identifie d by the microarray as regulated by Jak2. As opposed to the transc riptional effects of Jak2 on sgk1 mRNA regulation, these studies suggest that Jak2 is regulating the IP3 receptor protein th rough direct signaling cascades within the cytosol. Specifically, the data show that Jak2 activation protects the IP3 receptor from rapid AngII-induced ubi quitination. Conversely, the loss of a functional Jak2, either by pharmacological inhi bition or through the stable expression of a Jak2 dominant negative mutant, causes rapid AngII-induced degradation in vascular smooth muscle cells within 1 hour. In conclusion, these studies identified many import ant targets of Ja k2 in response to activation by AngII. Identifying the dow nstream signaling mechanisms of Jak2 may better elucidate its physiological and pathophysio logical effects within the cardiovascular system.

PAGE 15

1 CHAPTER 1 INTRODUCTION When first discovered in the early 1990’s, members of the Jak tyrosine kinase family were given the nickname of “J ust A nother K inase.” Now, nearly 15 years after their identification, it is clear that the Jaks have surp assed expectations, and are anything but “just another kinase”. For example, of the four members belonging to the Jak tyrosine kinase family, Jak2 al one is essential for normal de velopment and function. In addition, studies have demonstrat ed a potential role for Jak2 in the progression of various cancers and cardiovascular pathologies. This ch apter will serve as an introduction into the background and functions of Jak2. Furthermore, the specific relati onship of angiotensin II (AngII) and Jak2 will be expl ored as an attempt to link the signaling cascades of Jak2 to vascular diseases associated to the reninangiotensin system. Lastly, the later chapters of this work identify two novel downstream targets of Jak2 as a function of AngII signaling. As such, the function and regulati on of these two genes, the inositol 1,4,5 trisphosphate (IP3) receptor and the serum glucocorticoid kinase 1 (SGK1), will be introduced. Jak2 Tyrosine Kinase History Tyk2 was the first member of the Janus tyrosine kinase family (a.k.a. Just Another Kinase Family) to be discovered (Firmbach-Kraft et al., 1990). It was cloned and identified in 1990 and by 1994 the three other members of the Janus family were found (Jak1, Jak2, and Jak3) (Wilks et al., 1991; Harpur et al., 1992; Duhe et al., 1995;

PAGE 16

2 Kawamura et al., 1994; Takahashi and Shirasawa, 1994). The Jaks were unique in that all four members of the family shared a hi ghly conserved C-terminal tyrosine kinase domain that was immediately adjacent to a “kinase-like” or “pseudokinase” domain. These contrasting tandem domains were remi niscent of Janus, the Roman God of Two Faces who is the namesake of the Jaks. Interest in Jak2 specifically was height ened when Jak2 was discovered to be a critical mediator of cytokine-dependent signa ling. Concurrent studies found that Jak2 was activated in response to erythropoietin and growth hormone binding to their obligatory receptors (Argetsinger et al., 1993; Witthuhn et al., 1993). In the years to follow, many additional cytokines and growth factors were associated with the activation of Jak2 (Silvennoinen et al., 1993; Rui et al., 1994; Narazaki et al., 1994; Watling et al., 1993). As the activators of Jak2 were being discovered, simulta neous work identified a correlation between the cytokine-induced activation of Jak2 and increased gene transcription. These studies were the first to identify cy tokine-responsive transcription factors, which were termed the S ignal T ransducers and A ctivators of T ranscription (STAT) proteins (Schindler et al., 1992; Shuai et al., 1992). These latent transcription factors were found to mediate gene transcri ption when phosphorylated by active Jak2 in the cytoplasm. Thus, within two years of their identification, the basic signaling mechanisms of the Jak/STAT signaling paradigm were uncovered. Structure Structurally, the members of the Janus Tyrosine Kinase family are highly homologous and relatively large in size, ha ving a mass of roughly 130 kDa. To date, no three-dimensional structure has been obtained but much has been elucidated about Jak2’s

PAGE 17

3 structure through analysis of the primar y nucleotide and amino acid sequence. Specifically, Jak2 is ubiquitously expressed throughout most tissues and is highly conserved amongst species. Si milar to other Jaks, Jak2 cont ains seven highly conserved Jak homology (JH) domains, termed JH1 throug h JH7 (Figure 1-1). The carboxyl half of the protein is composed of the JH1 and JH2 regions, which encode the kinase and pseudokinase domains, respectively. The kina se activation loop, wh ich is known to be required for ligand-dependent ac tivation of the Jaks, resides within the JH1 domain. For a long time, the function of the pseudokinase domain remained unresolved. Recent work, however, suggests that specific regions of JH2 interact with JH1 to negatively regulate kinase activity (Saharinen et al., 2000; Saharinen and Silvennoinen, 2002). Figure 1-1 Summary of the Jak2 structural domains. Shown are the seven Jak homology (JH) domains and their relative posit ions within Jak2. The corresponding amino acid sequence of each domain is also shown. The amino half of Jak2 contains dom ains JH3 through JH7. Although the Jak family members are thought to lack a ca nonical Src Homology 2 (SH2) domain, it was noted that in Tyk2, the second half of the JH 4 domain plus the whole of the JH3 domain weakly resembled an SH2 domain (Bernard s, 1991). Upon the cloning of the murine JH7 JH6 JH5 JH4 JH3 JH2 JH1 Domain Amino Acid JH7 38-122 JH6 144-284 JH5 288-309 JH4 322-440 JH3 451-538 JH2 543-824 JH1 836-1123 N-Terminal C-Terminal JH7 JH6 JH5 JH4 JH3 JH2 JH1 Domain Amino Acid JH7 38-122 JH6 144-284 JH5 288-309 JH4 322-440 JH3 451-538 JH2 543-824 JH1 836-1123 N-Terminal C-Terminal

PAGE 18

4 Jak2 cDNA, it was similarly noted that the sequence GLYVLRWS bore weak homology to the core sequence element of SH2 domains (FLVRES) (Harpur et al., 1992). However, studies have reporte d conflicting findings as to wh ether this domain is truly functional (Higgins et al., 1996; Kampa and Burnside, 2000; Giordanetto and Kroemer, 2002). Clearly, additional studies are required in order to elucidate what role, if any, this SH2-like domain has within Jak2. Immediately N-terminal to the putative SH2 domain lies the FERM domain which spans from the middle of the JH4 domain through the JH7 domain. This domain is involved in mediating stable interactions with other cellular proteins (Girault et al., 1998; Yonemura et al., 1998). Furthermore, the amino termin al region of Jak2, especially the JH6 and JH7 domains, has been shown to be crucial for Jak2/cell surface receptor interactions (Frank et al., 1994; Tanner et al., 1995; Zhao et al ., 1995). In summary, the early collective molecu lar dissection of Jak2 suggested that it possessed the appropriate structural featur es to bind other cellular proteins and phosphorylate those proteins on tyrosine residues. Jak/STAT Signaling Paradigm While traditionally the Jak/STAT si gnaling pathway has been activated via cytokines and growth factors, Jaks are al so activated by numerous seven transmembrane receptors, such as the AT1 receptor. Cytokine and growth factor receptors The signaling mechanisms surrounding Jak2 activation and the subsequent regulation of gene transcription have been extensively studied. A summary of the Jak/STAT pathway is depicted in Figure1-2A. As is typically done in literature reviews, this overview uses the activati on of Jak2 via a cytokine recept or as an example of how

PAGE 19

5 Figure 1-2 Jak/STAT signaling pa radigm A) Activation of Ja k2 via a cytokine receptor. B) Activation of Jak2 via the AT1 receptor. Jak2 activation via Cytokine Receptor Jak2 activation via AT1Receptor Jak2 Jak2 Jak2 Jak2 Prior to ligand binding Jak2 Jak2 Jak2 Jak2 p pActivation Steps Jak2 Jak2 Jak2 Jak2 p p p p Jak2 Jak2 Jak2 Jak2 p p p p STAT STAT p p Jak2 Jak2 p p STAT p p STAT p p Jak2 Jak2 Jak2 Jak2 p p STAT STAT Target Gene Promoter Nucleus Nucleus p p p p Jak2 Jak2 STAT STAT Target Gene Promoter Nucleus Nucleus p p p p A.B.Jak2 activation via Cytokine Receptor Jak2 activation via AT1Receptor Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Prior to ligand binding Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 p p p pActivation Steps Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 p p p p p p Jak2 Jak2 Jak2 Jak2 p p p p STAT STAT p p Jak2 Jak2 p p STAT p p STAT p p p p p p Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 p p p p p p p p STAT STAT STAT p p STAT STAT p p Jak2 Jak2 Jak2 Jak2 p p p p p p STAT p p STAT STAT p p STAT p p STAT STAT p p Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 Jak2 p p p p STAT STAT STAT STAT STAT STAT Target Gene Promoter Nucleus Nucleus p p p p p p p p Jak2 Jak2 Jak2 Jak2 STAT STAT STAT STAT STAT STAT Target Gene Promoter Nucleus Nucleus p p p p p p p p A.B.

PAGE 20

6 Jak2 acts in a receptor-based signaling paradi gm. The first event in the Jak/STAT pathway is ligand binding to its cell surface rece ptor, resulting in receptor dimerization. The dimerization event triggers a phosphoryla tion cascade by the recep tor that results in the activation of constitutively bound Jak2 mol ecules. These activated Jak2 molecules subsequently phosphorylate tyrosi ne residues on the cytosolic ta il of the receptor, thereby creating docking sites for the STAT protei ns. In turn, STATs are phosphorylated on tyrosine residues by Jak2 and then released from the complex. Phosphorylated homoor heterodimeric STATs translocate into the nuc leus, where they bind to STAT recognition sequences, such as GAS elements, and initiate transcription of specific downstream target genes. Seven transmembrane spanning receptors In addition to cytokine receptors, Ja k2 is also activated by various seven transmembrane spanning receptors, such as the AT1 receptor (Marrero et al., 1995). Figure 1-2B illustrates the general differen ces in activation of Jak2 for a cytokine receptor versus the AT1 receptor. For the most part, activation of Jak2 via the AT1 receptor propagates a similar signaling cascade as when Jak2 is activated by cytokines. However, there do exist a number of impor tant differences in the method of Jak2 activation depending on the recepto r that is propagating the extracellular signal. First, it appears that Jak2 molecules are not constitutively associated with the AT1 receptor in the absence of activation, but rath er reside unbound within the cy toplasm. Furthermore, Jak2 must be catalytically active and autophosphoryl ate prior to recruitmen t to and association with the AT1 receptor (Ali et al., 1998). To date, the intermediate mechanisms responsible for activa tion of the Jak2 molecules within the cytoplasm, as well as the mechanisms for recruitment to the receptor, remain to be el ucidated. Once activated and

PAGE 21

7 bound to the receptor, Jak2 then acts as a mol ecular bridge between the receptor and the STAT proteins. Catalytically active Jak2 binds the SH2 domain of the STATs and thereby recruits the STATs to the receptor complex (Ali et al., 2000). From this point, the remainder of the Jak/STAT pathway remains si milar to activation via cytokine receptors, resulting in STAT nuclear tran slocation and transcri ptional regulation within the nucleus. Downstream Targets of Jak2 Jak2 plays an expansive role in the regul ation of gene transcription. Given its ability to be activated by such a wide array of ligands, it is not surprising that Jak2 is responsible for the transc riptional regulation of many diverse genes. Previous work has identified the gene ta rgets of Jak2 in response to activation by one specific agonist, growth hormone (GH). Using a combination of both mutated GH receptors and cells lacking Jak2, it was show n that Jak2 is necessary for GH-dependent STAT activation (Smit et al., 1996; Smit et al., 1997; Han et al., 1996; Hackett et al., 1995). To date GH is known to cause activation of STATs 1, 3, 5A, and 5B in a variety of cell types (Smit et al., 1996). Gene targets of GH-activated STATs 5A and 5B include spi 2.1, genes in the CYP 2/3 families, the acid labile subunit of the circulating insulinlike growth factor-bi nding protein complex, insulin 1 and igf-1 genes (Ooi et al., 1998; Bergad et al., 1995; Galsgaard et al., 1996; Subramanian et al., 1995; Menton et al., 1999; Waxman et al., 1995; Gebert et al., 1997). Furthermore, STATs 1 and 3 bind to the Sis-Inducible Element (SIE) of the c-fos promoter to activate additional genes (Meyer et al ., 1994; Campbell et al ., 1995). As clearly demonstrated by GH, Jak2 can mediate a wide array of genes in response to just one ligand. Other Jak2-activating ligands can similarly activate different STATs in the cytoso l, leading to a pletho ra of transcriptional targets.

PAGE 22

8 In addition to mediating transcriptiona l events through the ac tivation of STAT’s, Jak2 can also phosphorylate other cytosolic prot eins. For example, when activated via the AT1 receptor, Jak2 forms a complex with the Sr c family tyrosine kinase, Fyn (Sayeski et al., 1999a). Following the formation of th e complex, Jak2 activates Fyn, thereby resulting in a conformational change within F yn that permits its kinase domain to become assessable to substrate. To date however, the functional conseque nce of Jak2-dependent activation of Fyn has not been elucidated. Fyn is not alone. Many other cytosolic proteins have been found to form a complex with activated Jak2. Some of the mo lecules that are recr uited to Jak2 signaling complexes include c-Src, Grb2, PI3 kinase, Yes, Raf-1, Shc, Syp, and FAK (Sayeski et al., 1999b; Chauhan et al., 1995; Fuhrer and Yang, 1996; Xia et al., 1996; Vanderkuur et al., 1995; Fuhrer et al., 1995; Zhu et al., 1998). In conclusion, th ere exist various levels of crosstalk between Jak2 a nd other signaling pathways. St udies have shown that Jak2 coordinates a complicated array of signaling ca scades within a cell. Although the precise functional consequences of these signaling co mplexes have not been elucidated, it is logical to assume that each interac tion has a specific biological purpose. Jak2 and Cardiovascular Disease Jak2 has been implicated in diverse cardiovascular pathologies, including hypertrophy, heart failure, and ischemia/reper fusion injury. The precise roles of the Jak/STAT pathway in the heart remain elusiv e and, to some degree, contradictory. For example, some studies have found that the Ja k/STAT pathway increases apoptosis within the heart, thereby leading to detrimental effects (Mascareno et al., 2001; Stephanou et al., 2000). However, other studies have c onflicted these findings by suggesting a cardioprotective function of Jak2 (Bolli et al., 2001; Hattori et al., 2001; Negoro et al.,

PAGE 23

9 2000; Xuan et al., 2001). Needless to say, the as sociation of Jak2 to various cardiovascular insults remains an ongoing area of research. Cardiac hypertrophy, which is defined as an abnormal increase in cardiac muscle mass, is a major cause of morbidity and mo rtality worldwide. While cardiac hypertrophy alone has no symptoms, if left untreated it can lead to a number of serious cardiovascular diseases, such as heart failure and myocardial ischemia. The mechanisms governing the development of cardiac hypertrophy are not completely understood. Evidence has accumulated over the years indicating that ca rdiac hypertrophy is induced by pressure overload (Mann et al., 1989; Sadoshima et al., 1992; Baker et al., 1990) and/or secretion of numerous humoral factor s such as Ang II (Schunkert et al., 1995; Sadoshima et al., 1993). Interestingly, many of the stimuli known to initiate hypertr ophy have also been shown to activate Jak2. For example, acute pressure overload in rats increases Jak2 tyrosine phosphorylation levels through the pa racrine/autocrine secretion of AngII as well as via members of the interleukin-6 family of cytokines (Pan et al., 1997; Pan et al., 1999). Jak2 has also been associated with cardiac damage typically found in diabetic patients. Diabetes and abnormal glucose tolerance typically lead to diabetic cardiomyopathy, a condition characterized by severe left ventricular hypertrophy (Galderisi et al., 1991; Devereux et al., 2000). As a result, diabetic patients often suffer from heart failure (Kannel et al., 1974). Recent studies sugges t that Jak2 contributes to the hypertrophy of ventricular myocytes in response to high glucose levels. Mechanistically, the hyperglyc emia enhances AngII generation in myocytes, thereby causing phosphorylation of Jak2. Therefore, these studies suggest that activated Jak2

PAGE 24

10 may contribute to the deleterious growth eff ects of the heart that are associated with abnormal glucose levels (Modesti et al., 2005). Additionally, studies have identified a pot ential role for Jak2 in cardiac injury during ischemia-reperfusion (Mascareno et al., 2001). The first evidence of the Jak/STAT pathway being activated in re sponse to an ischemic event was the identification of STAT3 phosphorylation at 1-24 hours following cor onary occlusion in rats. Furthermore, when the Jak2 pharmaco logical inhibitor, AG490, was administered, the STAT3 phosphorylation was suppressed, indi cating a critical role for Jak2 (Negoro et al., 2000). Since then, additiona l studies have emerged show ing that treatment with AG490 leads to a dramatic reduction in cardi ac infarct size and a re duction in apoptotic cell death of cardiomyocytes following ischem ia-reperfusion in isol ated perfused rat hearts (Mascareno et al., 2001). Despite the evidence s upporting Jak2’s activation in response to ischemia/reperfusion, there re mains no elucidatio n of the functional significance of the activation. While much still remains to be elucid ated about Jak2’s functional effects in various cardiovascular insults it is clear that Jak2 and its downstream targets are activated in a number of disease states. Interestingly, many of the cardiovascular pathologies associated with Jak2 have previ ously been linked to AngII, suggesting that AngII may signal through Jak2 to elicit its deleterious effects in the cardiovasculature. If so, identification of the downstream targets of Jak2, in response to AngII, may have therapeutic merit in the future.

PAGE 25

11 The Renin Angiotensin System Angiotensin II The renin angiotensin system (RAS) is a critical regulator of blood pressure, electrolyte balance, and endoc rine function. The majority of these classic actions are mediated through angiotensin II (AngII), the pr incipal effector peptide of the RAS. The RAS was first discovered over a centu ry ago by Tigerstedt and Bergman, when they identified a pressor co mpound produced by the kidneys they named renin. Renin is a well-defined aspartyl proteas e that triggers the conversi on of angiotensinogen to the decapeptide angiotensin I. AngII, an octapep tide, is then generated by the cleavage of 2 amino acids from angiotensin I by angi otensin converting enzyme (ACE). AngII, a potent vasoconstrictor, elicit s its effects through G-protein coupled receptors that can be separated into two distinct classe s, the type 1 (AT1) and the type 2 (AT2) receptors (Timmermans et al., 1993). While both receptors are expressed in cardiovascular tissues, the AT1 receptor predominates in most organs (Gasc et al., 1994). Generally, the classical effects on vascular tone and fluid homeostasis by the RAS occur via the AT1 receptor. Conversely, the AT2 receptor has been found to counterbalance the actions of the AT1 receptor with respect to blood pr essure and cellular proliferation (Horiuchi et al., 1999). Beyond contributing to maintaining proper bl ood pressure and electrolyte balance, AngII can additionally lead to the developm ent of various cardiovascular diseases. Amongst these vascular pathologies are primar y hypertension, heart failure, neointimal formation, and vascular abnormalities commonly associated with diabetes (Gavras and Gavras, 2002; Kennefick and Anderson, 1997; Ba rnett, 2001). In recent years, great advancements have been made in control ling the deleterious e ffects of AngII using

PAGE 26

12 diverse methods such as AT1 receptor blockade, inhibition of ACE, -adrenergic receptor blockade, and gene targeting (Timmermans et al., 1999). AT1 Receptor Structure and function The AT1 receptor has been extensively studi ed since its successful cloning in 1991 (Murphy et al., 1991; Sasaki et al., 1991). As is common to all G-protein coupled receptors, the AT1 receptor is a seven transmembrane spanning receptor. Composed of 359 amino acids, the third intracellular loop is responsible for coupling to G-proteins, and thereby initiates propagation of signaling cascades (Shirai et al., 1995). These classically defined G-protein signaling casca des result in the activation of various intermediate signaling molecules such as adenylate cyclas e, phospholipase C and protein kinase C. Interestingly, two AT1 receptor isoforms exis t in rodents, the AT1A and AT1B receptor. These isoforms are highly homologous and are products of separate genes (Iwai et al., 1992). Conversely, only a single isoform of the AT1 receptor has been confirmed in humans. Tyrosine kinase signaling cascades In addition to its classic haemodynamic effects, the AT1 receptor can also act as a growth factor by activating various tyrosine kinases such as Jak2, Tyk2, c-Src, Fyn, Fak, and Pyk2 (Marrero et al., 1995; Sadoshima and Izumo, 1996; Ishida et al., 1995; Li and Earp, 1997). In pathological conditions, these growth-promoting responses can lead to various vascular diseases, su ch as neointimal formation. Currently, Jak2 is the only tyrosine kina se that has been shown to physically associate with the AT1 receptor directly. As previous ly described, upon AngII binding to the AT1 receptor, Jak2 becomes activated within the cytosol. Following this activation,

PAGE 27

13 Jak2 is recruited to the AT1 receptor and binds to the receptor tail at amino acids 319322. These four amino acids form the YIPP mo tif and are necessary for the association of Jak2 to the AT1 receptor (Ali et al., 1997). Once bound to the receptor, Jak2 acts as a molecular bridge between the receptor and the STAT proteins. Upon the formation of the complex at the AT1 receptor, Jak2 is able to phosphorylate the STATs. Activated STATs subsequently dimerize and translocate into th e nucleus where they regulate transcription of various genes. To date, the downstream target genes of Jak2 activation via the AT1 receptor remain largely undetermined. Given that Jak2 is activated in a number of AT1 receptor-induced cardiovascular diseases, we believe that iden tification of these downstream targets could potenti ally elucidate the role of Jak2 in the progression of various pathologies. Inositol 1,4,5 Trisphosphate (IP3) Receptor The finely tuned regulation of cytosolic calcium is responsible for many essential biological processes within the cell. The sp ecific control of intracellular calcium is achieved through the involvement and maintena nce of various receptors, transporters, pumps, and binding proteins The inositol 1,4,5 trisphosphate (IP3) receptors are intracellular calcium channels expressed on the membrane of the endoplasmic reticulum (ER). When activated, the IP3 receptors undergo a conformati onal change that leads to the release of calcium from internal stores within the ER. The sudden increase in cytosolic calcium within the ce ll can cause a wide array of biological processes such as muscle contraction, cellular secretion, metabolism, cell growth and differentiation. As such, understanding proper func tion and regulation of the IP3 receptors can be very useful in determining their contribution to various pathophysiological conditions.

PAGE 28

14 Structure and Function Three structurally distinct IP3 receptor isoforms have been identified and are differentially expressed in a cell specific manner (Nakagawa et al., 1991). Of the three subtypes, Type 1 was the first to be clone d and has the highest expression throughout all cell types studied (Mignery et al., 1989; Furuichi et al., 1989; De Smedt et al., 1994). Types 2 and 3 have lower expression levels overall, typically show ing highest expression in many non-neural cell types (De Smedt et al., 1994; Wojcikiewicz, 1995). The widespread expression of thes e receptors underscores their im portant role in cellular signaling. However, little is known of the f unctional differences be tween the isoforms. The IP3 family of receptors exists as tetramers and is composed of 3 main domains; a C-terminal channel region, a large re gulatory domain, and an N-terminal IP3 binding domain (Mignery et al., 1990). The channel region of the IP3 receptor is characterized by six-membrane-spanning helices w ith the C-terminus extending into the cytoplasm. When IP3 binds within the binding domain at the N-te rminal end of the receptor, the receptor undergoes a conformational change that regulates the gating of the channel, allowing the rapid release of calcium from internal stores (Mignery et al., 1990; Yoshida and Imai, 1997; Patel et al., 1999). IP3 is a second messenger produced thr ough the stimulation of phosholipase CPLC)-coupled receptors, such as the AT1 receptor. Specifically, the binding of ligand to a G-protein-linked receptor activat es the plasma-membrane-bound enzyme PLC. Activated PLCthen causes the hydrolysis of the membrane-bound phosphatidylinositol 4,5-bisphosphate, thereby ge nerating two cleaved produc ts: diacylglycerol and IP3. Following its production, IP3 leaves the plasma membrane and rapidly diffuses through

PAGE 29

15 the cytosol. Once at the membrane of the ER, IP3 binds to and opens the IP3 receptors, resulting in a rapid releas e of calcium into the cytoplasm (Berridge, 1993). Regulation of the IP3 Receptor Maintaining precise regulation of calcium signaling within a cell is critical for normal cellular functions. Regul ation of calcium is maintained via a complex interplay between changes in IP3 concentration and the various levels of IP3 receptor expression on the membrane of the ER. Amongst the various regulatory processes th at mediate receptor expression is phosphorylation. The IP3 receptor is phosphorylated by multiple kinases including cyclic-AMP-d ependent protein kina se (PKA), protein kinase C (PKC), and Fyn tyrosine kinase (Ferris et al., 1991a, 1991b; Jayaraman et al., 1996; Harnick et al., 1995). Fyn is a member of the Src-family of tyrosine kinases. Studies investigating calcium signaling during lymphocyt e activation identified the IP3 receptor as a target of phosphorylation by Fyn in T lymphocytes. Th ese initial studies identified that Fyn activated the IP3-gated calcium channel in vitro Furthermore, it was determined that fyn -/mice demonstrate a significant reducti on in tyrosine phosphorylation of the IP3 receptor during T cell activation (Jayaraman et al., 1996). Recently, studies determined that the precise residue with in the receptor that is phosphor ylated by Fyn is tyrosine 353 (Y353), which is found within the IP3 binding domain of the receptor. Furthermore, evidence suggests that the phosphorylation of Y353 via Fyn increases the binding affinity of IP3 to its receptor at lo w concentrations of IP3. However, the effect of Y353 phosphorylation in response to ligand treatment (i.e., high IP3 levels) has not yet been defined (Cui et al., 2004). In addition to phosphorylation, the IP3 receptor is also regulated through degradation events that redu ce expression of the receptor fr om the membrane of the ER

PAGE 30

16 following agonist treatment. The IP3 receptor is degraded in WB liver cells in response to AngII. This degradation event occurs at a minimum of six hours with maximal degradation at 24 hours (Bokkala and Jo seph, 1997). To date, AngII-mediated degradation of the IP3 receptor has not been shown in smooth muscle cells (Taylor et al., 1996; Sipma et al., 1998). Serumand Glucocorticoid-Regulated Kinase 1 (SGK1) Aldosterone is a key regulator of Na+ balance and thereby plays a large role in the regulation of blood pressure. Aldosterone me diates sodium reabsorption by increasing the activity of the epithelial Na+ channel (ENaC) in the aldosterone-sensitive distal nephron (ASDN). Aldosterone is unable to regulate ENaC di rectly however, and thereby elicits its effects through transcriptional events. An exciting development in the elucidation of aldosterone targ ets was the identification of serum-glucocorticoid-induced kinase 1 ( sgk1 ) (Webster et al., 1993a). Not long after it s identification as a glucocorticoid-induced gene, sgk1 was recognized to be an aldosterone-induced early response gene and has provided researcher s the link between aldosterone action and ENaC regulation (Chen et al., 1999, Naray-Fejes-Toth et al., 1999). Background and Function sgk1 was initially identified as a gene w hose transcription was rapidly induced by glucocorticoids in rat mammary tumor cells (W ebster et al 1993a). Therefore, unlike other kinases that are constitutively present in cells and are activated by post-translational mechanisms, sgk1 and its other family members are ra pidly transactivated in response to specific hormonal and environmental stimuli. sgk1 induction therefore requires new transcription. sgk1 is a member of the AGC subfam ily of serine/threonine protein kinases. To date, three isoforms of sgk have been identified, sgk1, sgk2 and sgk3 ;

PAGE 31

17 however, only sgk 1 is responsive to aldosterone or gl ucocorticoids at the transcriptional level. Transcriptional regulation of sgk1 via aldosterone occu rs through a classic canonical pentadecamer, cis -acting steroid response elemen t found in the promoter region of sgk1 (Webster et al., 1993b). Of the members of th e AGC subfamily, SGK1 most resembles protein kinase B (PKB), although it lacks the characteristic PtdIns(3,4,5)P3binding pleckstrin homology (PH) domain. The catalytic domain of SGK1 is 54% identical to that of PKB and although it l acks the PH domain, SGK1 retains the same residues in PKB that are phosphorylated by prot ein kinase 1 (PDK1) and protein kinase 2 (PDK2). Studies have shown that following tr anscription, SGK1 is activated by PDK1 at Ser422 and/or Thr256 depending on cell type (Kobayashi and Cohen, 1999). While the activated form of SGK1 ha s been found to interact with the -and subunits of ENaC in vitro (Wang et al., 2001), this association doe s not appear to result in phosphorylation of ENaC. Instea d, SGK1 mediates ENaC function by phosphorylation of an intermediate target termed Nedd4-2 (Debonneville et al., 2001; Snyder et al., 2002). Nedd4-2 is an ubiquitin ligase th at binds prolinerich motifs (PY) located in the carboxy terminus of the three ENaC subunits (Kamynina and Staub, 2002). In its unphosphorylated form, Nedd4-2 catalyz es the ubiquitination of residues in the amino terminus of the subunits, thereby provi ding a signal for the endocytosis of the channel (Staub et al., 1997). When Nedd4-2 is phosphorylat ed via SGK1, the affinity of Nedd4-2 for the PY motifs is diminished lead ing to a decrease in the endocytosis of ENaC (Debonneville et al., 2001). The disassociation of Nedd4-2 from ENaC results in an increase in both the activity of the channe l as well as the number of channels on the surface of the plasma membrane (Alvarez de la Rosa et al., 1999).

PAGE 32

18 Transcriptional Regulation of sgk1 In addition to glucocorticoids and aldos terone, many other agonists, acting through a variety of signal tran sduction pathways, have been shown to induce sgk1 gene transcription in cells and tissues. Fo r example, increased transcription of sgk1 in response to osmotic shock appears to be medi ated by stress-activated protein kinase 2 (p38) (Bell et al., 2000; Waldegger et al., 2000). Additionally studies have shown sgk1 transcription can also be regulated by follicle stimulating hormone (FSH) in ovarian cells through signaling cascades that involve p38 as well as PI3K and cAMP (GonzalezRobayna et al., 2000). Overall, however, very little is currently known about the specific signaling pathways that mediate th e transcriptional regulation of sgk1 Table 1-1 shows a comprehensive list of agonists that have been shown to increase tran scriptional activation of sgk1 To date, the molecular mechanisms that regulate transcription of the sgk1 promoter are largely undetermined. Neverthe less, studies have identified a number of interesting response elements within the promoter region. For example, a DNA binding site for the p53 tumor suppressor protein has be en identified within a 35-base pair region of the promoter. Studies show this re gion is sufficient to permit p53-dependent transactivation on a heterologous promoter (Maiyar et al., 1997). Additionally, a 20-base pair G/C-region between –63 and –43 of the sgk1 promoter has been identified and confers sensitivity to FSH and forskolin. Specif ically, this region binds the transcription factors Sp1 and Sp3 and this binding is a bolished following mutation of two base pairs within this region (Alliston et al., 1997). Interestingly, this same Sp1 binding region within the sgk1 promoter confers sensitivity to high osmolarity, which, as mentioned previously, is mediated by p38 (Bell et al., 2000).

PAGE 33

19 Despite its many activators, sgk1 remains best known for its physiological contributions to Na+ retention in response to aldoster one secretion. Al though clearly an important contributor of blood pressure regulation, current studies have not determined SGK1 to be directly regulated by AngII, which is regarded as a critic al mediator of blood Table 1-1: Activators of sgk1 gene transcription Activators Tissues/cells References Conditions Brain Injury Brain Hollister et al., 1997; Imaizumi et al., 1994 Hypertonic stress Hepatcytes Waldegger et al., 1997 Xenopus Collecting Duct Cells Rozansky et al., 2002 High Glucose Kidney, fibroblasts Lang et al., 2000; Kumar et al., 1999 Increased [Ca2+] CHO-IR cells Imai et al., 2003 Agonists Serum Mammary tumor cells Webster et al., 1993a Fibroblasts Webster et al., 1993b Glucocorticoids Mammary tumor cells Webster et al., 1993a; Maiyar et al., 1996; Maiyar et al., 1997 Fibroblasts Webster et al., 1997b Rat kidney and distal colon Brennan and Fuller, 2000 Mineralcorticoids Renal epithelial cells Chen et al., 1999; Neray-Fejes-Toth et al., 1999; Shigaev et al., 2000; Cowling et al., 2000a FSH Ovarian granulosa cells Alliston et al., 1997; Gonzalez-Robayna et al., 2000 LH Ovarian granulose cells Lang et al., 2000 VIP Shark rectal gland Waldegger et al., 1998 Carbachol Shark rectal gland Waldegger et al., 1998 TGFMacrophages Waldegger et al., 1999 HepG2 liver cells Waldegger et al., 1999 Thrombin Kidney Kumar et al., 1999 Lipopolysaccharides Granulocytes Cowling et al., 2000b fMLP Granulocytes Cowling et al., 2000b TNFGranulocytes Cowling et al., 2000b GMCSF Peripheral blood granulocytes Cowling et al., 2000b PPARgamma Renal cortical collecting ducts Hong et al., 2003 Endothelin-1 Smooth muscle cells Wolf et al., 2004 FSH follicle stimulating hormone, LH luteinizing hormone, VIP vasoactive intestinal polypeptide, TGFtransforming growth factor, fMLP -formyl methionyl leucyl phenylalanine, TNFtumor necrosis factorGMCSF granulocyte-macrophage colony-stimulating factor.

PAGE 34

20 pressure. The current studies investigat e the direct relations hip, if any, between sgk1 and AngII. As such, the role of SGK1 in regulating blood pressure, as well as other biological processes, may be expanded. Summary and Rationale Jak2 is an important mediator of gene transcription within the cell. Beyond mediating normal physiological functions in ce lls, Jak2 can also contribute to numerous pathologies, including various cancers and cardiovascular diseases. In addition to its traditional effects on transcriptional re gulation, Jak2 has been found to mediate phosphorylation effects on various cytosolic prot eins. While the precise consequences of these post-translational effects remain uncerta in, these signaling events are believed to have important biological merit. The goal of the study presented in the following chapters is to elucidate the regulatory effects of Jak2 within the nucleus as well as clarify its role in initiating previously undefined signaling cascades with in the cytosol. Specifically, this study’s focus is to identify the downstream targets of Jak2 in response to AngII. By elucidating the signaling cascades and downstream targets of Jak2 in response to AngII, it may be possible to better understand the physiological and pathophysiological effects of Jak2 within the cardiovascular system.

PAGE 35

21 CHAPTER 2 JAK2 TYROSINE KINASE IS A KEY MEDIATOR OF LIGAND-INDEPENDENT GENE EXPRESSION Introduction Jak2 tyrosine kinase is a ke y mediator of gene transcri ption. It is activated by a variety of cytokine, growth factor, and seven transmembrane spanning receptors, resulting in signaling cascades that facilitate the activation of various downstream target genes (Buggy, 1998; Gadina et al., 2001; Ju et al ., 2000; Lukasova et al., 2003; Marrero et al., 1995; Park et al., 1996; Peeler et al., 1996; Sasaguri et al., 2000). Upon binding of ligand, Jak2 mediates gene transcription thr ough the activation of cy tosolic transcription factors, termed STAT proteins. Thus, to date, Jak2 is regarded as an important regulator of ligand-dependent gene activation. Early studies have dissected the cellular a nd biochemical mechanisms that lead to the activation of Jak2. Specifi cally, when agonists of Jak2 bind to their obligatory receptors, Jak2 molecules undergo a juxtapoistioning that permits the transphosphorylation of one another. Some of this transphosphorylation occurs on tyrosine residues within the activation loop, leadi ng to full kinase activation. Jak2 has three tyrosine residues within the acti vation loop located at positions 1007, 1008 and 1021. The tyrosine residue at position at 1007 has been shown to be critical for activation, since it is phosphoryl ated in response to the va rious agonists of Jak2 (Feng et al., 1997). Furthermore, mutagenesis studies have determined that ligand-induced

PAGE 36

22 activation and signaling is lo st when this tyrosine residue is substituted with phenylalanine (Feng et al., 1997). Previous studies demonstrated that mice lacking a functional Jak2 allele die during early embryonic development (Neubauer et al., 1998; Parganas et al., 1998). These knockout mice are deficient in mandatory cytokine signaling as well as severely anemic, demonstrating a complete lack of eryt hropoiesis. The lethal effects associated with Jak2 knockout mice indicate the importa nt physiological role Jak2 has in normal embryonic development. In this study, microarray technology was used to iden tify and characterize Jak2dependent genes that are differentially expr essed as a function of the presence, or absence, of Jak2 in cells. By using cells that lack Jak2 expression, we were able to determine the contribution of Jak2 in regul ating cellular transcription. Gene profiling experiments identified 621 genes that had a gr eater than 2-fold change in expression as a function of basally expressed Jak2. Surprisingly, this diffe rential expression pattern did not require the addition of exogenous ligand to activate a cell surface receptor, but merely a basal level of Jak2 kinase function within the cell, as measured by a combination of Northern blot analysis, RT-PCR and lucifera se reporter assays. Cellular transcription was even further increased in Jak2-containing cells when treated with a ligand, indicating that these cells were capable of initiati ng proper Jak/STAT signaling cascades in a ligand-dependent manner. Additionally, we found that the large number of genes activated by the basal level of Jak2 represent a wide range of ontological functions incl uding transcription factors, signaling molecules, and cell surface receptors. Interestingly, of the 621 genes identified

PAGE 37

23 in this study, 56 have already been shown to be cytokine responsive, thereby suggesting that these genes are true ta rgets of Jak2 action. Lastly, we found that a Jak2 mutant containing a tyrosine to phenylalanine substi tution mutation at position 1007 maintained a basal level of transcription th at was consistent to wild type controls, suggesting that the basal regulation of transcript ion is completely independe nt of active activation loop phosphorylation. As such, this work demonstrates for the first time that, in ad dition to being a key mediator of ligand-activated ge ne transcription, Jak2 is also a critical mediator of basal level gene expression. Additi onally, the large numbers of genes found to be dependent upon Jak2 for their transcriptional regulation i ndicate the critical a nd encompassing role that Jak2 has in transcriptional processes within the cell. Materials and Methods Creation of Stable Cell Lines/ Cell Culture Creation of the Jak2 null cell line, termed 2A, has already been described (Kohlhuber et al., 1997). Briefly, the 2A cells are a human fibr oblast cell line that is devoid of Jak2 protein. Using this background, the cells were stably transfected with either a Jak2 expression plasmid a nd a Zeocin selectable vector ( 2A/Jak2 cells) or the Zeocin selectable marker alone ( 2A). Cells transfected with the Zeocin selectable marker alone ( 2A), were used as controls. Both cel ls lines were also stably transfected with an AT1 receptor to establish its expression on the plasma membrane. The AT1 receptor used for transfection had an HA-tag inse rted just after the in itiation methionine. Two days after transfection, cells were tr ansferred to medium supplemented with 250 g/ml Zeocin. Two weeks later, individual colonies were ring cloned as previously

PAGE 38

24 described (Sayeski et al., 1999a). AT1 receptor-binding assays were conducted on the stable cell lines using 125 I –labeled AngII and respective 2A-derived clones that had nearly identical binding pa rameters were identified. 2A (clone #4) had a Kd of 0.44 nM and a Bmax of 201 fmol/mg protein while 2A/Jak2 (clone #1) had a Kd of 0.41 nM and a Bmax of 226 fmol/mg protein (Sandberg et al., 2004). The relative Jak2 expression of each clone was then determined using Western bl ot analysis as described in the Results. The rat aortic smooth muscle (RASM) cel ls stably over-expressing either a Jak2 dominant negative allele (RASM DN) or th e neomycin resistant cassette (RASM WT) have been described previously (Sayeski et al., 1999a). The 2A cells stably expressing either the growth hormone receptor alone ( 2A/GHR) or the growth hormone receptor along with wild type Jak2 ( 2A/GHR/Jak2) have also been described (He et al., 2003). Cells were grown in DMEM +10% FBS at 37C in 5%CO2 humidified atmosphere. All cells were made quiescent by washing them extensively with phosphate-buffered saline and then placing them in serum free media for either 20 ( 2A cells) or 48 (RASM cells) hrs, prior to use. Immunoprecipitation/ Western Blot/ Analysis Immunoprecipitation/Western blot analyses were performed to determine Jak2 expression and phosphorylation in the 2A cells. Briefly, to prepare 2A and 2A/Jak2 protein lysates, cells were washed with tw o volumes of ice-cold PBS containing 1 mM Na3VO4 and lysed in 800 L of ice-cold RIPA buffer (20mM Tris [pH 7.5], 10% glycerol, 1% Triton X-100, 1% deoxycho lic acid, 0.1% SDS, 2.5 mM EDTA, 50 mM NaF, 10mM Na4P207, 4 mM benzamidine, 1 mM phenylmethylsulfonyl fluride, 1 mM Na3VO4, and 10 g/mL aprotinin). The samples were then sonicated and incubated on

PAGE 39

25 ice for 30 min. Samples were subsequently spun at 13,200 rpm for 5 min at 4C, and supernatants were normalized for pr otein content using the Bio-Rad Dc assay. Normalized lysates (approx. 400 g/ml) were then either directly resuspended in SDS sample buffer and separated by SDS-P AGE for Western blot analysis or immunoprecipitated. Immunoprecipitations were perfor med for 4 hrs at 4C with 2 g of monoclonal anti-phosphotyrosine antibody (BD Transduction Laborator ies, clone PY20) and 20 L of Protein A/G Plus agarose beads (Santa Cruz Biotechnology). After centrifugation, protein complexes were washed 3 times w ith wash buffer (25 mM Tris, pH 7.5, 150 mM NaCl, and 0.1% Triton X-100) and resuspende d in SDS sample buffer. Bound proteins were boiled, separated by SDS-PAGE, and tran sferred onto nitroce llulose membranes. For determination of Jak2 protein expre ssion, whole cell lystates were Western blotted with polyclonal anti-Jak2 antibody (Ups tate Biotechnology) in 5% milk/TBST. Membranes were subsequently stripped and re-probed with polyclonal anti-STAT1 antibody (Santa Cruz Biotechnology ) to confirm equal protein lo ading of all samples. To determine Jak2 phosphorylation levels, immunopr ecipitated lysates were Western blotted with polyclonal anti-J ak2 antibody (Upstate Biotechnology) in 5% milk/TBST. Proteins were visualized using enhanced chemilu minescence (ECL) following the manufacturers instructions (Amersham). Preparation of Total and Poly (A)+ mRNA Cells were serum starved for 20 hrs and tota l RNA was then isolated using the acid guanidine thiocyanate/phenol/chloroform method of extraction (Chomczynski and Sacchi, 1987). Briefly, 2A and 2A/Jak2 cells were serum st arved for 20 hours and then

PAGE 40

26 washed with 2 volumes of ic e-cold phosphate-buffered salin e and lysed in 3 mL of 4M guanidine thiocyanate (GnSCN). Genomic DNA was then sheared using a 20G needle fitted to a 10 cc syringe until viscosity of the samples was reduced. Cell homogenates were then transferred to a fresh tube and 0.1-vol 2M NaOAc, pH 4.0, 1.0-vol aqueous phenol, and 0.2-vol chloroform/isoamyl alcohol were added sequentially. Following a 15-minute incubation on ice, samples were sp un at 1,500 x g for 20 minutes at 15C. The aqueous layer was subsequently precipitated and the pellet was resuspended in 0.5mL 4M GnSCN. RNA was precipitated and re suspended in a final volume of 200 L in DEPCtreated water and quantitated. Three confluent 100-mm culture dishes of 2A or 2A/Jak2 cells were pooled togeth er in order to avoid artifact that was unique to any one individual plate. Poly (A)+ mRNA was isolated from both the 2A and 2A/Jak2 cells using the Amersham Pharmacia Quick Prep mRNA Pu rification Kit. Three plates for each condition were again pooled in order to reduce the possibility of any artifact. Total and poly (A)+ mRNA was then used for Affymetrix analys is and/or Northern blot analysis as described below. Probe Preparation and Affymetrix Chip Hybridization cRNA probes were prepared for hybridi zation to microarrays following the manufacturer’s instru ctions (Affymetrix GeneChip E xpresssion Analysis Manual). Briefly, double stranded DNA was prepared from 10 g of total RNA isolated from both cell lines using the Superscript Double St randed cDNA Synthesis kit (Invitrogen). Newly synthesized double stranded DNA was subsequently cleaned using Phase Lock Gels (PLG)-Phenol/Chloroform Extraction. 5 L of double stranded DNA was then

PAGE 41

27 Biotin-labeled following the Enzo Bioarra y High Yield RNA Tran script Labeling Kit protocol (Affymetrix). Bio tinylated cRNA was subsequently cleaned using a Qiagen RNeasy column and quantitated. 20 g of unadjusted cRNA was then fragmented and hybridized to Affymetrix Test3 chips in order to verify the quality of each preparation. Samples having similar metrix values were th en hybridized to U95A gene chips at the University of Florida ICBR MicroArray Core Laboratory. Microarray Data Analysis The data was analyzed using the Affymetrix Software Package, Microarray Suite Version 4.0. Probe intensities for both cellula r conditions were compared and reported in both tabular and graphical formats. The da ta was deposited in the Gene Expression Omnibus (GEO) repository under accession # GSM16418. Northern Analysis Northern Blot analysis was performed as previously described (Sayeski and Kudlow, 1996). Briefly, 25 g of total or 4 g of poly (A)+ mRNA was separated on a 1% agarose-6% formaldehyde-containing gel. RNA samples were transferred onto nylon membranes and then hybridized to 32P-labeled cDNA probes. Probes were labeled using the Random Primers DNA Labeling System Kit (Invitrogen). The cDNA’s encoding for Pak1(Sells et al., 1997), 4-1BBL (Wen et al., 2002), USA-CyP (Horowitz et al., 2002) and EphB6 (Matsuoka et al., 1997) have been described. Quantitative RT-PCR The two-step quantitative RT-PCR method was also used to confirm the differential expression results generated by the microarray experiments. Specifi cally, total RNA was extracted from either the 2A or the RASM-derived cell lin es and subsequently reverse transcribed using the SuperScript II RNase HReverse Transcriptase Kit (Invitrogen).

PAGE 42

28 Primers were designed for each gene using the Primer3 program (http://wwwgenome.wi.mit.edu/cgi-bin/primer/primer3_www .cgi/). PCR reactions were prepared using the SYBR Green PCR Core kit (Applied Biosystems) and performed on the GeneAmp 5700 Sequence Detector machine (Applied Biosystems). 18s primers were used as a standard internal reference and analyses were accomplished by calculating the 2Ct values for each gene (Giulietti et al., 2001; Livak and Schmittgen, 2001). Luciferase Assay Cells were transfected with a luciferase reporter construct containing four tandem repeats of the GAS element, upstrea m of a minimal TK promoter, in 10 L Lipofectin (Invitrogen). Where indicate d, cells were additionally co -transfected with both a luciferase construct as well as cDNA plasmi ds encoding 1) an empty vector for Jak2 2) wild type Jak2 cDNA 3) a Jak2 Y1007F mutant or 4) a Jak2 K882E mutant. All four Jak2 expression plasmids were kind gifts from Dr. James Ihle (St. Jude’s Children Hospital). Following transfection, the cells we re seeded in 12-well plates at 2.5 x 105 cells per well, serum starved for 20 hrs, and th en treated as indicated. Luciferase activity was measured from detergent extracts in the presence of ATP and luciferin using the Reporter Lysis Buffer System (Promega) and a luminometer (Monolight Model 3010). Luciferase values were recorded as relative light units (RLU)/ g protein. Each of the conditions were measured in replicates of six (n=6). Results Characterization of Jak2 Expre ssion in the Stably Transfected 2A Cells The 2A-derived stable cell lines were crea ted as described in the Methods. In order to verify the relative expression of Jak2 in each cell line, 25 g of whole cell

PAGE 43

29 protein lysate from each cell line was separa ted by SDS-PAGE and subsequently Western blotted with anti-Jak2 polycl onal antibody (Fig. 2-1A, top). The results show that Jak2 protein expression is comp letely lacking in the 2A cell line, but is readily detectable in the 2A/Jak2 cell line. In order to demonstrate that both lane s were loaded equally, the same membrane was stripped and Western bl otted with anti-STA T1 polyclonal antibody to detect endogenous STAT1 protein (Fig. 21A, bottom). The results show that both lanes had roughly equal leve ls of STAT1 protein. 172 111 A. 2 A / J a k 2 2 A Jak2 79 61 49 STAT1 B. 172 111 79 61 2 A / J a k 2 2 AIP: Tyr-(P) mAb IB: Jak2 pAb Jak2-(P) 172 111 A. 2 A / J a k 2 2 A Jak2 79 61 49 STAT1 B. 172 111 79 61 2 A / J a k 2 2 AIP: Tyr-(P) mAb IB: Jak2 pAb Jak2-(P) Figure 2-1. Characterizati on of Jak2 expression in 2A-derived cells. A) Whole cell protein lysates from the 2A and 2A/Jak2 cell lines were Western blotted with anti-Jak2 antibody to detect expre ssed Jak2 protein (top). The blot was subsequently stripped and re-blotted with anti-STAT1 antibody to ensure equal loading (bottom). B) 2A and 2A/Jak2 whole cell lysates were immunoprecipitated with anti-phosphot yrosine antibody and then Western blotted with anti-Jak2 antibody to measure Jak2 tyrosine phosphorylation levels. Shown is one of two (A) or th ree (B) representative results. Printed with permission of publisher Jak2 has a basal level of tyrosine kinase ac tivity that is significantly increased in response to ligand treatment (Duh and Farrar, 1998). The relative kinase activity of Jak2 is directly proportiona l to its own tyrosine phosphorylation levels (Feng et al., 1997;

PAGE 44

30 VonDerLinden et al., 2002). To determine whether the Jak2 protein expressed in the 2A/Jak2 clone had proper basal level tyro sine phosphorylation, equal amounts of whole cell lysate from each clone were immunopreci pitated with anti-phosphotyrosine antibody and then Western blotted with anti-Jak2 anti body (Fig. 2-1B). The re sults show that the Jak2 protein expressed in the 2A/Jak2 clone does have detect able levels of tyrosine phosphorylation, which is consistent with cells that endogenously express Jak2. Collectively, the results in Fi g. 2-1 demonstrate that while the 2A cell line completely lacks Jak2 protein expression, the 2A/Jak2 cell line has readily detectable levels of this protein. Furthermore, the e xpressed Jak2 protein shows normal, basal level tyrosine phosphorylation. Microarray Analysis Demonstrates that Jak2 Mediates the Expression of Many Diverse Genes We next wanted to determine whether the basal level expression of Jak2 in a cell, independent of exogenous ligand addition, has a measurable effect on gene expression. To do this, we compared gene expression profiles in 2A versus 2A/Jak2 cells. Total RNA was harvested from both cell lines and then prepared for Affymetrix microarray analysis as described in the Methods. The Affymetrix U95A GeneChip was used as the differential expression platform. This chip contains the probe sequences representing ~12,000 fully sequenced human genes. The expression signals generated from the hybridization of probes from both cell lines we re then compared and analyzed. Fig. 2-2 shows a graphical illustration of the mRNA expression leve ls from this experiment (Experiment #1). Each dot on the plot repres ents one of the 12,000 different genes on the chip. Genes falling outside the two parallel lines had a greater than 2.0-fold change in gene expression as a result of the presence of Jak2. Genes falling above the two parallel

PAGE 45

31 lines had increased gene expression while t hose falling below the tw o parallel lines had decreased gene expression. The data indi cated Jak2 expression in a cell, devoid of exogenously added ligand, altere d the expression of 1,251 ge nes by at least 2-fold. This entire procedure was then repeated a second independent time. The results of this experiment are shown (Fig. 2-2, Experi ment #2). This time the analysis indicated that 1,042 genes had at least a 2-fold cha nge in gene expression as a function of expressed Jak2. Figure 2-2. Global Analysis of Jak2-Dependent Gene Expression. Gr aphical illustration of the mRNA expression levels from two replicated experiments using Affymetrix MicroArray Suite, Versi on 4. The plots compare hybridization signal intensities from arrays probed with cRNA from the 2A and 2A/Jak2 cell lines. Each dot on the plot corres ponds to a different gene. The two parallel dashed lines represent the leve l for a 2-fold change in expression. Printed with permission of publisher The results gathered in Fig. 2-2 were further analyzed using Venn Diagram analysis. This analysis allows for the identi fication of genes that were present in both Experiment #1 Experiment #2

PAGE 46

32 experiments. The results demonstrated that 621 genes were consistently differentially expressed greater than 2-fold in both e xperiments. These 621 genes were further analyzed to distinguish up-regulated genes fr om down-regulated genes (Fig. 2-3A). The analysis showed that 474 genes were up regulated and 147 genes were down regulated. Notably, the range of fold changes of these genes was quite impre ssive, spanning from 2to 78-fold. Not surprisingly, the majority of genes found to be present in only one of the two experiments had induction numbers falling cl ose to the 2-fold cutoff. In this case, they were identified in one experiment with a value that was at 2-fold or higher, but not in the other experiment because the value wa s just under the 2-fold cutoff threshold. 422 474281147 208 140 Up Regulated Genes Exp 1Exp 2Exp 2 Exp 1 Down Regulated Genes A. B. 4531 22 Exp 1Exp 2 Number of genes having at least a 7.0-fold change in expression 422 474281147 208 140 Up Regulated Genes Exp 1Exp 2Exp 2 Exp 1 Down Regulated Genes A. B. 4531 22 Exp 1Exp 2 Number of genes having at least a 7.0-fold change in expression Figure 2-3. Venn Diagrams Illustrating the Number of Up and Down Regulated Genes Consistent Between the Two Replicated Experiments. A) The data for Exp. #1 and #2 were merged so genes common to both experiments could be identified as having at least a 2-fold change in gene expression. A total of 621 genes were differentially expressed in bot h experiments. These 621 genes were further analyzed to distinguish up regul ated from down regulated genes. The hatched lines indicate the area of overlap between the two experiements. B) The data for experiments #1 and #2 were analyzed so that genes having at least a 7-fold change in expression c ould be identified. A total of 31 genes were identified as being common to bot h experiments and having at least a 7fold change in expression. Prin ted with permission of publisher

PAGE 47

33 The full list containing all 621 genes is found in Appendix A. Of the 621 genes on this list, 390 have a known ontological functi on. When these 390 genes were queried as to whether any were cytokine regulated, 56 genes were iden tified. Appendix B contains this list of 56 genes. Several examples include the interferon inducible protein (Fan et al., 1989), the Type 1 and 3 IP3 receptors (Rozovskaia et al ., 2003) and the inhibitor of activated STAT protein (Liu et al., 1998). Collectively, the identification of genes that have previously been shown to be cytokine and/or Jak2regulated suggest that the microarray experiments had in fact identifie d genes that are Jak2 targets and not genes that are differentially expresse d due to clonal artifact. For our initial analysis, we shortened th e list of 621 genes to include only those genes that were differentially expressed by at least 7-fold. Again, Venn Diagram analysis was performed to identify those genes that had at least a 7-fold change in gene expression, in both experiments (Fig. 2-3B). The results show 76 genes in experiment #1 and 53 genes in experiment #2 had at least a 7fold change in expression. Of these genes, 31 were common to both groups. Table 3-1 lists these 31 genes. As previously explained, for the genes found to be present in only one of the two experiments, the majority had induction numbers falling close to the 7-fold cutoff. As such, they were detected in one experiment with a value that wa s 7-fold or greater, bu t not detected in the second experiment because the value was just below the 7-fold cutoff threshold. Overall however, there was a strong concordance betwee n the genes on both lists. Interestingly, when ontological functions of these genes we re classified, they were found to encompass diverse categories of cellular function including transcription factors, cell cycle control

PAGE 48

34 Table 2-1 Summary of Jak2-dependent genes. The 31 genes having at least a 7-fold change in gene expression in both ex periments are represented. Shown are the accession number, gene name, relative fold changes and a brief description of cell function. (NF = Cu rrently, no known function). Printed with permission of publisher Accession Number Gene Name Induction #1 Induction #2 Average Induction CategoryW2584513h9 -78.4-78.1-78.25NFW2678715d8 -39.2-25.3-32.25NFW2747431d8 -23.7-21.3-22.5NFW2817043a12-22.5-17.3-19.9NFW2799743 e3-7.5-8.1-7.8NF U24152Pak1 77.67.3Signaling Y09616putative intestinalcarboxylesterase7.27.67.4Serine EsteraseU18271Thymopoietins(TMPO) 7.57.47.45Cell Cycle AL080203DKFZp434F222 8.67.68.1NFL47345ElonginA 8.37.27.75Transcription U68485Bridging integrator protein-1 (BIN1)8.39.48.85Tumor suppressor AF016371U4/U6snRNP-associated cyclophilin8.414.511.45Cyclophilin W2823543h8 8.58.68.55NFS78187CDC25 Hu2 8.610.69.6Cell Cycle AB017430Kid-kinesin-like DNA binding protein 8.98.98.9Cell Cycle AD001530XAP-5 9.29.19.15NF AF03529223584 clone 10.88.99.85NF M68864Human ORF mRNA 12.110.411.25NF X79865Mrp17 12.28.310.25Cell growth X71345Trypsinogen IV-b form 12.317.815.05Proteolyticenzyme AL096723DKFZp564H2023 12.614.313.45NFX96484DGCR6 gene 13.711.712.7Development AF026031hTOM15.115.815.45Mitochondrial transportL23959E2F-releatedtranscription factor15.911.213.55Transcription N53547yv43b12.s115.918.217.05NF X03656G-CSF 17.215.816.5Cell DefenseD83492EphB6 18.512.715.6AngiogenesisD64142HistoneHI subtype19.58.113.8Transcription U66061Trypsinogen-C 2328.625.8Proteolyticenzyme AF026977Microsomalglutathione S-transferaseIII3136.833.9PeroxidaseL37127RNA polymerase II subunit 43.95348.45Transcription Accession Number Gene Name Induction #1 Induction #2 Average Induction CategoryW2584513h9 -78.4-78.1-78.25NFW2678715d8 -39.2-25.3-32.25NFW2747431d8 -23.7-21.3-22.5NFW2817043a12-22.5-17.3-19.9NFW2799743 e3-7.5-8.1-7.8NF U24152Pak1 77.67.3Signaling Y09616putative intestinalcarboxylesterase7.27.67.4Serine EsteraseU18271Thymopoietins(TMPO) 7.57.47.45Cell Cycle AL080203DKFZp434F222 8.67.68.1NFL47345ElonginA 8.37.27.75Transcription U68485Bridging integrator protein-1 (BIN1)8.39.48.85Tumor suppressor AF016371U4/U6snRNP-associated cyclophilin8.414.511.45Cyclophilin W2823543h8 8.58.68.55NFS78187CDC25 Hu2 8.610.69.6Cell Cycle AB017430Kid-kinesin-like DNA binding protein 8.98.98.9Cell Cycle AD001530XAP-5 9.29.19.15NF AF03529223584 clone 10.88.99.85NF M68864Human ORF mRNA 12.110.411.25NF X79865Mrp17 12.28.310.25Cell growth X71345Trypsinogen IV-b form 12.317.815.05Proteolyticenzyme AL096723DKFZp564H2023 12.614.313.45NFX96484DGCR6 gene 13.711.712.7Development AF026031hTOM15.115.815.45Mitochondrial transportL23959E2F-releatedtranscription factor15.911.213.55Transcription N53547yv43b12.s115.918.217.05NF X03656G-CSF 17.215.816.5Cell DefenseD83492EphB6 18.512.715.6AngiogenesisD64142HistoneHI subtype19.58.113.8Transcription U66061Trypsinogen-C 2328.625.8Proteolyticenzyme AF026977Microsomalglutathione S-transferaseIII3136.833.9PeroxidaseL37127RNA polymerase II subunit 43.95348.45Transcription

PAGE 49

35 genes, cell surface receptors, and intermediate signaling molecules. As such, the data indicates that Jak2 strongly regulates an important, but diverse, set of genes. Validation of Jak2-dependent Gene Expression in 2A and 2A/Jak2 Cells We next wanted to validate the appa rent changes in Jak2-dependent gene expression identified via the microarray experime nts. In order to obtain a representative sample from the list, we selected genes that represented a diverse set of fold changes and ontological functions. Northern blot analys is was then performed on several of these genes. For the intermediate signaling mo lecule, Pak1, Affymetrix predicted that Jak2expressing cells would have 7.3-fold more mRNA when compared to non-Jak2expressing control cells. Northe rn blot analysis indicated th at of the two splice variants of Pak1, the smaller transcript was ~4-fold higher in the Jak2-expr essing cells (Fig. 24A). Similarly, for the 4-1BBL gene, Affy metrix analysis indicated that the Jak2expressing cells would contain 9.6-fold more mRNA when compared to the cells lacking Jak2. Northern blot analysis actually found the level closer to ~5 -fold (Fig. 2-4A). Similarly, for the RNA splicing enzyme, USA-CyP, Affymetrix analysis predicted the Jak2-expressing cells would have 11-fold mo re mRNA when compared to the cells lacking Jak2. Again, densitometric analysis of the Northern blot found it to be ~7-fold greater (Fig. 2-4B). Finally, for the a ngiogenic cell surface receptor, EphB6, the Affymetrix prediction and the Northern blot were in close agreement, as both analyses found Jak2-expressing cells c ontained ~15-fold more EphB6 mRNA than the cells lacking Jak2 (Fig. 2-4C). Collectively, the data in Fig. 2-4 dem onstrate a reasonable correlation between the differential expression pattern predicted by the Affymetrix mi croarray analysis and the validation of the mRNA levels by Northern blot analysis. For some genes, the magnitude

PAGE 50

36 of the prediction made by the Affymetrix analysis was higher than the actual measurement determined by Northern blot an alysis. However, without exception, the genes that Affymetrix predicted to be differe ntially expressed were in fact differentially expressed in the same direction. Table 2-2 s hows a complete summary of the validations. Pak1 4-1BBL GAPDH 2 A / J a k 2 2 A 2 A / J a k 2 2 A GAPDH USA-CyP EphB6 GAPDH 2 A / J a k 2 2 AA.B. C. Pak1 4-1BBL GAPDH 2 A / J a k 2 2 A 2 A / J a k 2 2 A GAPDH USA-CyP EphB6 GAPDH 2 A / J a k 2 2 AA.B. C. Figure 2-4. Confirmation of Jak2-de pendent gene expression in the 2A and A/Jak2 cells via Northern blot analysis. Nort hern blot analysis of mRNA extracted from 2A and 2A/Jak2 cells. The blots were probed with cDNA’s encoding either Pak1 and 4-1BBL (A), USA-CyP (B ), or EphB6 (C). All blots were subsequently stripped and re-probed with GAPDH to control for loading. Printed with permission of publisher To further validate the differential expr ession data generated by the microarray experiments, quantitative RT-PCR was also em ployed. Six separate genes were analyzed via quantitative RT-PCR. Graphs illustra ting the derived fold changes between the 2A and 2A/Jak2 cell lines are shown in Fig. 2-5. For the EphB6 gene, quantitative RT-PCR found the level of differential expression to be ~12-fold gr eater in the Jak2-expressing cells (Fig. 2-5A). This was in close agr eement with both the Affymetrix prediction and the Northern blot analysis shown in Fig.2-4C For the protein tyrosine kinase gene

PAGE 51

37 termed, FBK III16, Affymetrix predicted that the Jak2-expressing cells would have 12fold less mRNA when compared to the non-Ja k2 expressing controls Quantitative RT0 2 4 6 8 10 12 14 Fold change, 2CtA. EphB6 2A 2A/Jak2B. 0 1 2 F o ld c h a n g e 2C tFBK III16 2A 2A/Jak2 0 1 2 Fold change, 2Ct13h9 2A 2A/Jak2C. 0 2 4 6 8 10 12 14 16 18 20 22 24 26 Fold change, 2CtTrypsinogen IV-B D. 2A 2A/Jak2 0 2 4 6 8 10 12 Fold change, 2CtMGST III E. 2A 2A/Jak2 0 50 100 150 Fold change, 2CtG-CSF F. 2A 2A/Jak2 0 2 4 6 8 10 12 14 Fold change, 2CtA. EphB6 2A 2A/Jak2B. 0 1 2 F o ld c h a n g e 2C tFBK III16 2A 2A/Jak2B. 0 1 2 F o ld c h a n g e 2C tFBK III16 2A 2A/Jak2 0 1 2 Fold change, 2Ct13h9 2A 2A/Jak2C. 0 2 4 6 8 10 12 14 16 18 20 22 24 26 Fold change, 2CtTrypsinogen IV-B D. 2A 2A/Jak2 0 2 4 6 8 10 12 Fold change, 2CtMGST III E. 2A 2A/Jak2 0 50 100 150 Fold change, 2CtG-CSF F. 2A 2A/Jak2 Figure 2-5. Confirmation of Jak2-de pendent gene expression in the 2A and 2A/Jak2 cells via quantitative RT-PCR. Qu antitative RT-PCR analysis of RNA extracted from 2A and 2A/Jak2 cells. Primers were designed for the genes encoding EphB6 (A), protein tyrosi ne kinase FBK III16 (B), 13h9 (C), trypsinogen IV-B (D), microsomal GST III (E) and G-CSF (F). Fold changes were derived from the 2Ct value and are indicated on each graph. Values are represented as the mean +/SD. Printed with permission of publisher PCR found the difference to be ~17-fold less (Fig. 2-5B). For the 13h9 gene, Affymetrix predicted a 78-fold decrease in mRNA levels in the Jak2-expressing cells. Quantitative RT-PCR actually found the level to be ~10-fold less in these cells (Fig. 2-5C). For the trypsinogen IV-B gene, Affymetrix predicte d a 15-fold increase in mRNA levels in the Jak2-expressing cells. Quantitative RT-PCR found the level to be ~17-fold higher (Fig. 2-5D). For the microsomal GST III gene, the microarray studies predicted a 34-fold

PAGE 52

38 increase in the mRNA levels in the Jak2expressing cells. Quantitative RT-PCR found the level to be ~10-fold higher (Fig. 2-5E). Finally, for the G-CSF gene, Affymetrix predicted a 17-fold increase in mRNA levels in the Jak2-expressing cells when compared to the non-Jak2 expressing controls. Quantita tive RT-PCR actually found the level to be ~107-fold higher in the Jak2 expressing cells (Fig. 2-5F). Collectively, the quantitative RT-PCR data in Fig. 2-5 show similar trends in gene expression as was predicted by the micr oarray experiments. (Table 2-2) Suppression of Endogenous Jak2 Kinase Acti vity via Over Expression of a Jak2 Dominant Negative Allele Similarly Inhi bits Jak2-dependent Gene Expression One interpretation of the data in Figs. 2-4 and 2-5 is that basal level Jak2 tyrosine kinase activity within a cell, independent of exogenous ligand addition, can significantly alter cellular gene expression. However, othe r interpretations might be that the results are due to artifact inherent to the 2A-derived clones or that the effect might be unique only to 2A-derived cells. To eliminate these alte rnate possibilities, we utilized rat aortic smooth muscle cells that stably express a Jak2 dominant negative cDNA (RASM DN). Expression of the dominant negative protein bl ocks function of wild type Jak2 normally found in these cells (Sayeski et al., 1999a). In short, Jak2-d ependent signaling in the dominant negative expressing ce lls is reduced by about 90% wh en compared to wild type controls. The control cells are rat aortic smooth muscle cells that express only a Neomycin resistant cassette (RASM WT). T hus, these cells allow for a determination of Jak2-dependent gene expression via a mechan ism that is independent of the Jak2 null mutation. Here, both sets of cells were serum st arved for 48 hrs and then total RNA was harvested. Quantitative RT-PCR was subsequently performed on the several of the genes

PAGE 53

39 shown in Figs. 2-4 and 2-5. Overall, the re sults were consistent with the Affymetrixderived data as well as the Northern and quantitative RT-PCR experiments done in the 2A cells (Table 2-2). Specifically, USA-Cy P and 4-1BBL gene expression was ~10-fold higher in the RASM WT cells when compared to the RASM DN cells (Figs. 2-6A and 26B, respectively). 13h9 gene expression was ~8-fold less in the RASM WT cells when compared to the RASM DN cells (Figs. 2-6C). Finally, trypsinogen IV-B gene expression was ~7 fold greater in the RASM WT cells when compared to the RASM DN cells (Figs. 2-6D). Fold change, 2 CtA. USA-CyP RASM DN RASM WTB. F o l d c h a n g e 2 C t4-1BBLRASM DN RASM WT 0 5 10 15 Fold change, 2Ct13h9 RASM DN RASM WTC. Fold change, 2 CtTrypsinogen IV-B D.RASM DN RASM WT 0 1 2 0 1 2 3 4 5 6 7 8 9 10 0 5 10 15 Fold change, 2 CtA. USA-CyP RASM DN RASM WTB. F o l d c h a n g e 2 C t4-1BBLRASM DN RASM WT 0 5 10 15 Fold change, 2Ct13h9 RASM DN RASM WTC. Fold change, 2 CtTrypsinogen IV-B D.RASM DN RASM WT 0 1 2 0 1 2 3 4 5 6 7 8 9 10 Fold change, 2Ct13h9 RASM DN RASM WTC. Fold change, 2 CtTrypsinogen IV-B D.RASM DN RASM WT 0 1 2 0 1 2 3 4 5 6 7 8 9 10 0 5 10 15 Figure 2-6. Confirmation of Jak2-dependent gene expression in the RASM DN and RASM WT cells via quantitative RT-PCR. Quantitative RT-PCR analysis of RNA extracted from RASM DN and RASM WT cells. Primers were designed for the genes encoding USA-Cy P (A), 4-1BBL (B), 13h9 (C), and trypsinogen IV-B (D). Fold ch anges were derived from the 2Ct value and are indicated on each graph. Values ar e represented as the mean +/SD. Printed with permission of publisher

PAGE 54

40 Collectively, the data in Fig. 2-6 indi cate that when endoge nous Jak2 tyrosine kinase activity is reduced via expression of a Jak2 dominant negative allele, there is a corresponding change in gene expression th at is similar to that seen in the 2A-derived cells. As such, the data suggest that basal level Jak2 tyrosine kinase activity within a cell, independent of exogenous ligand addition, signifi cantly alters cellular gene expression. Table 2-2 Summary of microarray validations 2A cells RASM cells Gene Name Affymetrix Northern RT-PCR RT-PCR Pak1 7.3 ~4 4-1BBL 9.6 ~5 10 USA-CyP 11 ~7 10 EphB6 15.6 ~15 12 FBK III16 12 17 13h9 78 10 8 Trypsinogen IV-B 15 17 7 M-GST III 34 10 G-CSF 17 107 Shown are the gene expression fold change s predicted for each gene via Affymetix, Northern blot, and RT-PCR analysis in both 2A and RASM cells. Jak2 is a Critical Mediator of Both Basal Level and Ligand-induced Gene Transcription The data in the preceding figures suggest that Jak2 is capable of significantly mediating gene transcription independent of exogenous ligand addition. This is a novel concept in that Jak2 has classically been vi ewed as a mediator of ligand-induced gene expression. We therefore hypothe sized that Jak2 can act as a critical mediator of both basal level and ligand-induced gene transcription. To test this we investigated the ability of angiotensin II (AngII) to further me diate mRNA gene expression. Numerous independent laboratories, including our own, ha ve shown that AngII is a potent activator of Jak2, both in vitro and in vivo (Frank et al., 2002; Marrero et al., 1995; Sandberg et

PAGE 55

41 al., 2004; Sayeski et al., 1999; Seki et al., 2000). Both 2A-derived cell lines utilized in this study stably express the AngII type 1 (AT1) receptor via the stab le integration of cDNA expression plasmids (Sandberg et al., 2004). In short, the 2A cell line expresses the AT1 receptor on a background that is devoid of Jak2. However, the 2A/Jak2 cell line expresses the AT1 receptor with similar affinity and abundance as the 2A cell line, but also expresses wild type Jak2 protein. Thus these cells allow for a determination of the role of Jak2 in gene expression, under both th e basaland ligand-act ivated states. We first investigated the ability of Ja k2 to become phosphorylated in response to AngII treatment. To characterize both the basal and ligand-induced tyrosine phosphorylation levels of Jak2, both sets of cells were either left untreated (-) or treated for 5 min with 100 nM AngII (+). Equal amounts of whole cell lysate from each condition were then immunoprecipitated with anti-phosphotyrosine antibody and subsequently Western blotted with an ti-Jak2 antibody (Fig. 2-7A). Since the 2A cells lack Jak2, AngII treatment failed to increase the tyrosine phosphorylation levels of the protein (lanes 2 vs 1). However, in the 2A/Jak2 cells, Jak2 was found to be tyrosine phosphorylated prior to AngII treatment (lane 3), and ligand treatment further increased its tyrosine phosphorylation levels (lane 4). Thus, the data in Fig. 2-7A suggest that these cells appear to be suitable vehicles for studying gene expre ssion that is both Jak2and ligand-dependent. One gene that showed remarkable consis tency in its Jak2-dependent regulation in the microarray studies was EphB6. Speci fically, Affymetrix, Northern blot, and quantitative RT-PCR analyses a ll indicated that the levels of EphB6 mRNA were about 15-fold higher in the Jak2-expressing cells (Figs. 2-4 & 2-5 and Table 2-1). To

PAGE 56

42 determine the role of basaland ligand-activated Jak2 on EphB6 gene expression, both sets of cells were either left untreated (-) or treated for 4 hrs with 100 nM AngII (+). RNA was then extracted and Northern blot an alysis was performed (Fig. 2-7B, top). The results show that in the cells lacking Jak2, ther e is little to no EphB6 message, either with or without ligand treatment (lan es 1 and 2). However, in the Jak2 expressi ng cells, there was a marked increase in EphB6 mRNA leve ls that was completely independent of ligand treatment (lane 3). This result recap itulates the observation seen in Figs. 2-4C and 2-5A as it once again demonstrates that basal level Jak2 tyrosine kinase activity in a cell is sufficient to significantly increase expres sion of this gene. Finally, when the Jak2 expressing cells were treated with AngII, there was a further increase in EphB6 mRNA levels (lane 4). The nylon membrane was subs equently stripped a nd re-probed with the cDNA encoding GAPDH, in order to demonstrate similar loading across all lanes (Fig. 27B, bottom). Interestingly, the most striking increase in EphB6 gene expression does not occur in response to AngII trea tment (i.e. ligand-activated Ja k2), but rather occurs when Jak2 is simply expressed in the cell (i .e. basal activation state of Jak2). To determine whether this effect co uld be conferred onto a heterologous Jak2responsive promoter, we transfected these same 2A and 2A/Jak2 cells with a luciferase reporter construct containing four tandem rep eats of the Jak2-responsive, GAS element, upstream of a minimal TK promoter. The cells were subsequently serum starved for 20 hrs, treated with 100 nM AngII for 0 or 24 hours and then luciferase activity was measured (Fig. 2-7C). In the cells lacking Jak2, there was minimal basal level luciferase activity that increased modestly with the addi tion of ligand (lane 2 vs. 1). However, in the Jak2-expressing cells, there was substantial luciferase activity measured at basal

PAGE 57

43 levels (lane 3 vs. 1) that wa s significantly increased followi ng AngII treatments (lane 4 vs. 3). Clearly however, of the four conditions the largest increase in luciferase activity was seen in lane 3, where Jak2 expression si gnificantly increased luciferase activity, independent of exogenous ligand addition. To demonstrate that this observati on is not an artifact unique to the 2A/AT1 receptor expressing cell lines, we transfected the same luciferase re porter construct into 2A cells stably expressing either the growth hormone receptor alone ( 2A/GHR) or the GHR along with Jak2 ( 2A/GHR/Jak2). The creation and characterization of these cells has been previously described (He et al., 2003). In short, both cell lines express the GHR at similar affinity and abundance, but only the second cell line expresses Jak2. In the absence of growth hormone, Jak2 displays low level, basal tyrosine phosphorylation. Upon treatment with growth hormone however there is a marked increase in Jak2 tyrosine phosphorylation levels. The luciferase activity in the 2A cells expressing the GHR were similar to that seen in the 2A cells expressing the AT1 receptor. Specifically, the 2A cells lacking Jak2 again demonstrated little luciferase activ ity, which did not incr ease upon treatment with GH (lane 1 and 2). Conversely however, in untreated Jak2-expressi ng cells, there was a dramatic increase in luciferase activity, roughl y 2.5-fold higher than found in equivalent cells lacking Jak2 (lane 3 vs 1). Furtherm ore, as with AngII treatment, GH further increased luciferase activity in cells e xpressing Jak2. In this case, addition of GH increased luciferase activity ~3-fold above th e untreated cells (lane 4 vs. 3). Thus, the data demonstrate that the magnitude by which Jak2 increa ses ligand-dependent gene transcription (~3-fold) is nearly equivalent to the magnitude by which Jak2 increases

PAGE 58

44 ligand-independent gene transcri ption (~2.5-fold). As such, these data help strengthen the argument that Jak2 may act as a mediat or of both ligand-independent and liganddependent gene transcription. A. 2A 2A/Jak2Ang II + + 172 111 79 61 Jak2-(P)IP: Tyr-(P) mAb IB: Jak2 pAbB. 2A/ Jak2Ang II EphB6 GAPDH + +2A Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+5 1.0e+6 1.5e+6 2.0e+6 2.5e+6 3.0e+6 3.5e+6 Ang II + + 2A 2A/Jak2 C. Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+6 1.0e+7 1.5e+7 2.0e+7 2.5e+7 3.0e+7 3.5e+7 GH + + 2A/GHR 2A/GHR/Jak2 D. ** A. 2A 2A/Jak2Ang II + + 172 111 79 61 Jak2-(P)IP: Tyr-(P) mAb IB: Jak2 pAbB. 2A/ Jak2Ang II EphB6 GAPDH + +2A Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+5 1.0e+6 1.5e+6 2.0e+6 2.5e+6 3.0e+6 3.5e+6 Ang II + + 2A 2A/Jak2 C. Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+6 1.0e+7 1.5e+7 2.0e+7 2.5e+7 3.0e+7 3.5e+7 GH + + 2A/GHR 2A/GHR/Jak2 D. ** Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+5 1.0e+6 1.5e+6 2.0e+6 2.5e+6 3.0e+6 3.5e+6 Ang II + + 2A 2A/Jak2 C. Luciferase Activity: Relative Light Units/ug protein 0.0 5.0e+6 1.0e+7 1.5e+7 2.0e+7 2.5e+7 3.0e+7 3.5e+7 GH + + 2A/GHR 2A/GHR/Jak2 D. ** Figure 2-7. Jak2 plays a key role in basal, as well as ligand activat ed, gene transcription A) Quiescent 2A and 2A/Jak2 cells were either le ft untreated (-) or treated for 5 min with 100nM AngII (+). Lysa tes were immunoprecipitated with antiphosphotyrosine antibody and subsequently Western blotted with anti-Jak2 antibody to measure Jak2 tyrosine phosphor ylation levels. Shown is one of 3 representative result s. B) Quiescent 2A and 2A/Jak2 cells were either left untreated (-) or treated for 4 hrs with 100nM AngII (+). Poly (A)+ mRNA was then isolated from the cells and subse quently Northern blotted with the cDNA encoding for either EphB6 (top) or GAPDH (bottom). C) 2A and 2A/Jak2 cells were transfected with 0.5 g of a luciferase reporter construct containing four tandem repeats of a GAS element. Cells were treated for 24 hrs with either vehicle control (-) or 100nM AngII (+) and then luciferase activity was measured. Values are plotted as the mean +/SD. The difference in luciferase values between lanes 1 an d 3 was statistically significant as determined by Student’s t -test. *, p = 1.23 x10-13. Shown is one of three

PAGE 59

45 independent results. D) 2A/GHR and 2A/GHR/Jak2 cells were transfected with 5.0 g of the same luciferase reporte r construct described above. The cells were subsequently treated for 24 hrs with either vehi cle control (-) or 600ng/ml GH (+) and then luciferase activity was measured. Values are plotted as the mean +/SD. The differ ence in luciferase values between lanes 1 and 3 was statistically signifi cant as determined by Student’s t -test. **, p = 2.94 x10-7. Shown is one of three indepe ndent results. Printed with permission of publisher To further investigate the precise m echanism of Jak2 in mediating ligandindependent transcription, we utilized various Jak2 mutants. The mutants selected for investigation were chosen based upon a recent paper by Chatti and colleagues, in which they demonstrated that kinetically, the tyrosine kinase function of Ja k2 exists in at least two independent states; namely, a basal state and a ligand-activated state (Chatti et al., 2004). Specifically, the author s generated an activation l oop mutant of Jak2 by changing the conserved tyrosine at position 1007 to phe nylalanine. While this Jak2 mutant was unable to propagate cytokine-dependent si gnaling, it was nonethele ss able to bind ATP and autophosphorylate, albeit le ss efficiently than wild t ype protein. As such, they concluded that Jak2 exists in at least two ki netically distinct states of activity; a highactivity catalytic state and a low-efficiency basal catalytic state. However, what remained uncertain was whether this lowefficiency basal state had any biological consequence. In an attempt to investigate if perhaps the “low activation state” described by Chatti was mediating the ligand-independent ac tivation of Jak2, we utilized a number of Jak2 mutant expression plasmids. Along with the STAT-responsive luciferase reporter construct previously described, 2A/GHR cells lacking Jak2 expression were cotransfected with cDNA plasmids encoding either 1) an empty vector for Jak2 2) a plasmid containing wild type Jak2 3) a Jak2-Y1007F mutant which has low level ATP utilization,

PAGE 60

46 but cannot activate in response to ligand treatment or 4) a Jak2-K882E mutant which has absolutely no kinase activity as it is unable to bind ATP. After transfection, the cells were treated with GH to activate Jak2 and luciferase activity was subsequently measured (Figure 2-8A). For the cells transfected w ith empty vector control, there was a minimal level of luciferase activity that did not change with ligand addition. The Jak2-K882E mutant, which has absolutely no kinase ac tivity, had virtually the same luciferase expression pattern as the empty vector cont rol. However, for the Jak2-Y1007F mutant, there was an 8-fold increase in luciferase activity at the 0 hr time point over both the empty vector control and the Jak2-K882E transf ected cells. These data indicate that a Jak2 protein that possesses ba sal level kinase activity, but cannot activate in response to exogenous ligand addition due to mutation of tyrosine 1007, can greatly increase gene transcription in the basal catalytic state. Not surprisingly, cells expressing the Jak2Y1007F mutant do not exhibit in creased luciferase activity in response to GH treatment. Finally, for cells expressing Jak2-WT, prior to ligand addition, there was luciferase activity that was similar to the Jak2-Y1007F mu tant. However, 6 hrs of growth hormone treatment resulted in a 2.5-fold increase in luciferase activity presumably due to phosphorylation of tyrosine 1007. The data show that simply expressing a Jak2 protein which possesses only basal level kinase activit y (i.e. the Jak2-Y1007F mutant) results in an 8-fold increase in gene expression wh ereas ligand-dependent activation of Jak2-WT only results in a further 2.5-fo ld increase in gene transcri ption. Thus, the degree by which Jak2 influences basal level gene transc ription is much greater than the degree by which it influences ligand-dependent gene transcription.

PAGE 61

47 The relative levels of expressed Jak2 pr otein for each condition were determined via anti-Jak2 Western blot analys is (Figure 2-8B). In summar y, the data indicate that the transcriptional effect of Jak2 in the basal catalytic state (i.e. ligand-independent) is greater than that seen in th e ligand-activated state. Hours of Growth Hormone 01234567Luciferase Activity: Relative Light Units 0 1e+5 2e+5 3e+5 4e+5 5e+5 WT Y1007F K882E Empty Vector A. B. 111 C o n t r o lJ a k 2 W TJ a k 2 K 8 8 2 EJ a k 2 Y 1 0 0 7 FIB: anti-Jak2-pAb Jak2 Hours of Growth Hormone 01234567Luciferase Activity: Relative Light Units 0 1e+5 2e+5 3e+5 4e+5 5e+5 WT Y1007F K882E Empty Vector A. * B. 111 C o n t r o lJ a k 2 W TJ a k 2 K 8 8 2 EJ a k 2 Y 1 0 0 7 FIB: anti-Jak2-pAb Jak2 Figure 2-8. A Jak2 mutant that possesses onl y basal level kinase activity, significantly influences gene transcription. A) 2A/GHR cells were co-transfected with 5.0 g of a luciferase reporter construct containing four tandem repeats of a Jak2-responsive GAS element and either empty vector for Jak2 (Control), the Jak2-K882E mutant, the Jak2-Y1007F mu tant, or Jak2-WT. The cells were serum starved and subsequently treate d for either 0, 3, or 6 hours with 250 ng/ml GH and then luciferase activit y was measured. Each condition was measured in replicates of six (n=6). Values are expressed as the mean + SD. The difference in luciferase values be tween the Jak2-WT tr ansfected cells at time 0 hr versus 6 hrs was significantly different as determined by Student’s t test. *, p < 0.05. B) Lysates from each of the four transfected conditions were Western blotted with anti-Jak2 antibody to assess Jak2 expression levels. Printed with permission of publisher Discussion Jak2 is a key mediator of cellular gene expression. A variety of ligands that bind cytokine, tyrosine kinase growth factor a nd G protein-coupled receptors, are all known to signal through Jak2. This study was therefore de signed to help elucidat e the critical role that Jak2 has in regulating cellu lar gene transcription. Here, we found that when Jak2

PAGE 62

48 was expressed in a cell, 621 genes had a greate r than 2-fold change in gene expression when compared to non-Jak2 expressing control cells. This work is significant for several re asons. First, in th e realm of cellular transcription, genes can be e xpressed at either basal levels or under activated conditions such as when a ligand binds its receptor. Ja k2 has long been regarded as a key mediator of this ligand-activated state of transcription and has never thought to be important in basal transcriptional regulation. This dissertation shows for the first time that, when Jak2 is expressed in a cell at basal level conditions, it appears to play a central role in cellular transcriptional regulation that is independent of e xogenous ligand addition. Second, a classification of these differe ntially regulated genes was done in an attempt to discover prominent classes of Ja k2 signaling targets. Uncovering functional classes of genes could potentially lead to predictions about genomic targets of Jak2. Interestingly however, no prominent class of ge nes appeared evident. The classification revealed a large assortment of genes encoding many diverse proteins su ch as transcription factors, intermediate signaling molecules a nd cell surface receptors. The data suggest that Jak2 shows no single prominent function at the basal level, but rather maintains a global influence within the cell. Third, the Jak2 knockout mouse dies during development therefore indicating that this tyrosine kinase is re quired for survival (Neubauer et al., 1998; Parganas et al., 1998). These same studies showed that Jak2 is re quired for proper signaling through a variety of cytokine receptors. Subse quent studies further demonstrat ed that Jak2 is a critical mediator of growth factor and G proteincoupled receptor signaling. However, the downstream target genes of Jak2 tyrosine kinase remain largely unknown. Here, we

PAGE 63

49 identified 621 genes that have at least a 2-fold change in ge ne expression as a function of expressed Jak2. As such, additional downs tream target genes of Jak2 may now be known. As mentioned previously, the major focus of this study did not include the genes falling within the differential signal expressi on range of 2to 7-fold. This does not suggest these genes are not bi ologically important. To th e contrary, genes having a 2fold change in gene expressi on have previously been shown to have important biological consequences (Cook et al., 2002; Rome et al., 2003). However, given the vast number of genes that were identified in this study, we narrowed our focus and chose to study genes having larger fold changes. Interestingly, Jak2 has been regarded as an activator of ligand-dependent gene transcription. However, this study revealed that nearly one-quarte r of all Jak2-dependent genes were down regulated. One possible explanation for this is that Jak2 is having an indirect effect on these gene promoters via the activation of tran scriptional repressor genes. Once expressed, the repressors woul d subsequently bind other promoters and, in turn, reduce gene transcrip tion. Alternatively, recent st udies have shown that the Jak/STAT pathway itself is capable of dir ectly inhibiting expression of specific gene promoters. Specifically, recent work demonstrated the -globin gene promoter is inhibited by STAT3 (Foley et al., 2002). Currently, further experiments are required in order to determine which of these scenarios might be happening in the 2A-derived cells. As indicated above, a major finding of th is work is that Jak2 may function as a critical mediator of ligandindependent gene transcrip tion. An important concern however, is whether Jak2 is already in a “ligand-activated” stat e prior to exogenous

PAGE 64

50 ligand addition. For several reasons, we believe the answer is no. Fi rst, the level of Jak2 protein that is expressed in the 2A-derived cells used in these studies is at a level that is similar to cells that endogenous ly express Jak2, such as Jurkat cells. As such, this would tend to minimize Jak2 autophosphorylation in the absence of exogenously added ligand. Second, the cells were washed extensively with phosphate-buffered saline and serum starved prior to use. This made the cells quiescent and in turn minimized the tyrosine kinase activity of proteins such as Jak2, prio r to any ligand treatment. Third, the addition of exogenous ligand subsequently activated Jak2 suggesting that Jak2 was not fully activated prior to ligand addition. Fourt h, the phenomena of Jak2 mediating ligandindependent gene transcription was observed in multiple independent cell lines ( 2A/AT1, 2A/GHR, and RASM) therefore suggesting that th e effect is not due to clonal artifact. Fifth, in the case of the RASM-derived cel ls, when endogenous Jak2 tyrosine kinase activity was reduced via the e xpression of the dominant negative Jak2 allele, there was a subsequent alteration in gene expression that correlated with the microarray predictions. This demonstrates that when the tyrosine kinase function of endogenously expressed Jak2 (i.e. non-transfected) is reduced from its basal state, there is a significant corresponding change in Jak2-dependent gene transcrip tion. And sixth, recent work by Chatti and colleagues identified that the tyrosine kinase function of Jak2 exists in at least two independent states; namely, a basal stat e and a ligand-activated state (Chatti et al., 2004). Our data here suggest that th e basal state of Jak2, previously characterized biochemically as being capable of binding ATP and tyro sine autophosphorylating, is in fact an important mediator of gene transcription.

PAGE 65

51 In conclusion, this study showed th at expression of Jak2 can alter the transcriptional regula tion of 621 genes in 2A-derived cells. These numbers are indicative of the critical role that Jak2 tyro sine kinase has within a cell and suggest that Jak2 plays a key role in basal, as well as ligand-activated, cellular gene transcription. Therefore we believe these studies suggest that Jak2 can signifi cantly regulate gene expression outside of the classical, ligand-activated signaling paradigm.

PAGE 66

52 CHAPTER 3 IDENTIFICATION OF JAK2 TARGETS IN RESPONSE TO ANGIOTENSIN II SIGNALING Introduction Angiotensin II (AngII) is a major regul ator of cardiovascular and renal homeostasis. In addition to its role as a vasoconstrictor, AngII also acts as a potent growth factor by activating several non-receptor tyrosi ne kinases through the AT1 receptor (Leduc et al ., 1995; Schieffer et al ., 1996). Jak2 is one example of a nonreceptor tyrosine kinase that is activated by AngII (Marrero et al ., 1995). Activated Jak2 is recruited to the AT1 receptor upon treatment w ith AngII where it subsequently initiates signaling cascades that result in the regul ation of gene transcription (Marrero et al ., 1995; Ali et al ., 1997). While Jak2 is traditionally known to be an important mediator of cytokine signaling, recent studies have s uggested it also contributes to various cardiovascular pathologies, such as neointimal formation and cardiac hypertrophy (Seki et al. 2000; Mascareno et al. 2001; Kodama et al ., 1997). Interestingly, increased circulating levels of AngII correlate to simila r cardiovascular pathologies as recently shown to be associated with Jak2. Given the link be tween these two signaling molecules, we hypothesize that Jak2 has a significant ro le in mediating AngII-induced gene transcription.

PAGE 67

53 To date, the downstream target s of Jak2 activation via the AT1 receptor remain largely unknown. By identifying these targets, we will be better e quipped to determine the specific contributions of Jak2 in va rious cardiovascular pathologies. Here, similar to the study detailed in Chapter 2, we utilized microarray technology to compare the gene expression of Jak2-defici ent cells with the gene expression of Jak2expressing cells. In this st udy however, we sought to compar e the expression profiles of both cell lines in response to AngII treatment. We hypothesize that since Jak2 is recruited to and activated by the AT1 receptor, it has a large role in mediating AngII-dependent gene transcription. Furthermore, we believe the identification of AngII-inducible genes that require Jak2 for their expression may pr ovide meaningful insight on the specific roles of Jak2 within the cardiovascular system. Microarray experiments determined th at a large number of genes were differentially expressed great er than 2-fold in respons e to 1 and 4 hours of AngII treatment, when comparing the human fibroblast 2A and 2A/Jak2 cells. Amongst the many genes identified, some had been previ ously associated with Jak2 and/or AngII signaling. Conversely however, many of the genes identified by the microarray experiments were novel targets of both AngII and/or Jak2. These genes therefore offered novel insight into the effects of A ngII-mediated cellular transcription. In conclusion, using gene-profiling tec hnology, we identified a large number of AngII-inducible genes that require Jak2 for regulation. By identifying the downstream targets of Jak2 activation via the AT1 receptor, we may now be ab le to better elucidate of the role of Jak2 in the progression of cardiovascular diseases through AngII-dependent signaling.

PAGE 68

54 Materials and Methods Cell Culture The 2A and 2A/Jak2 cell lines were described pr eviously in Chapter 2. Cells were grown in DMEM +10% FBS at 37C in 5% CO2 humidified atmosphere. All cells were made quiescent by washing them exte nsively with phosphate-buffered saline and then placing them in serum-free media for 20 hours prior to use. Preparation of Total RNA 2A and 2A/Jak2 cells were serum starved for 20 hrs and then treated for either 0, 1, or 4 hours with 100nM AngII. Total RNA was subsequently isolated using the acid guanidine thiocyanate/phenol/chloroform method of extraction (Chomczynski and Sacchi, 1987) exactly as described in Chap ter 2. For each of the conditions, three confluent 100-mm culture dishes of cells we re lysed and extracted RNA was then pooled together in order to avoid artifact that was unique to any one individual plate. Microarray Expression Profiling For the 0and 4-hour conditions, cRNA probe s were prepared for hybridization to Affymetrix microarray chips following the ma nufacturer’s instru ctions (Affymetrix GeneChip Expresssion Analysis Manual). Briefly, double stranded DNA was prepared from 10 g of total RNA isolated from both cell lines using the Superscript Double Stranded cDNA Synthesis kit (Invitrogen) Newly synthesized double stranded DNA was subsequently cleaned using Phase Lock Gels (PLG)-Phenol/Chl oroform Extraction. 5 l of double stranded DNA was then Biotin-l abeled following the Enzo Bioarray High Yield RNA Transcript Labeli ng Kit protocol (Affymetrix). Biotinylated cRNA was subsequently cleaned using a Qiagen RNeasy column and quantitated. 20 g of unadjusted cRNA was then fragmented and hybrid ized to Affymetrix Test3 chips in order

PAGE 69

55 to verify the quality of each preparation. Samples having similar metrics values were then hybridized to U95A GeneChips at the University of Florida ICBR MicroArray Core Laboratory. For the 0and 1-hour conditions, total RNA was isolated as described. The resulting total RNA was shipped on dry i ce to GenUs Biosystems, Inc (Chicago, IL) where the microarray hybridi zation was performed. Briefl y, total RNA samples were quantitated by UV spectrophotom etry at OD260/280 and the quality was assessed using an Agilent Bioanalyzer (Agilent Technologies ). Once the quality and concentration was confirmed, double stranded DNA was prepar ed. Biotinylated cRNA targets were subsequently prepared from the DNA template and again verified on the Bioanalyzer. The appropriate amounts of cRNA were ne xt fragmented to uniform size. The fragmented cRNA samples were hybridized to CodeLink Human Whole Genome Bioarrays (GE Healthcare, Amersham Biosci ences) and stained with Cy5-streptavidin. Slides were scanned on an Axon GenePI X 4000B scanner (Molecular Devices, Axon Instuments). Microarray Data Analysis Affymetrix data was analyzed using the Affymetrix Software Package, Microarray Suite Version 5.0. Probe intensities for both cellular conditions were compared and reported in both tabular and gr aphical formats. GenUs data was analyzed with CodeLink and GeneSpring software pack ages. To compare individual expression values across arrays, raw intensity data from each probe was normalized to the median intensity of the array. Only genes with normalized expression values greater than background intensity in at least one condi tion were used for further analysis.

PAGE 70

56 Results Microarray Analysis of Jak2-dependent Ge ne Transcription Following 4 hours of AngII Treatment The 2A and 2A/Jak2 cells used in this study have been stably transfected to establish expression of the AT1 receptor on the plasma membrane. Since we are examining Jak2 signaling in response to AngII, it was necessary to ensure that these cells have the proper machinery to propagate AT1 receptor-induced Jak/STAT signaling cascades. Previous studies from our lab investigated the ability of 2A and 2A/Jak2 cells to function normally in res ponse to AngII treatment (Sandberg et al., 2004). Experiments were conducted in these cel ls that established the following three parameters: 1) Jak2 is able to become tyrosi ne phosphorylated in response to AngII, 2) Jak2 forms a physical co-association with the AT1 receptor following AngII treatment, and 3) STAT1 and STAT3 (downstream targets of Jak2) are able to become tyrosine phosphorylated in response to AngII treatment (Sandberg et al., 2004). As expected, these parameters were only identified in the 2A/Jak2 cells and not the control cells, which lack Jak2 expression. Furthermore, both cell lines were shown to tyrosine phosphorylate paxillin in respons e to AngII, which is a Jak2 -indepndent target of the AT1 receptor. Paxillin phosphorylation thereby c onfirms that the loss of Jak/STAT signaling in the 2A cells is due to the specific loss of Ja k2 function and not due to a clonal artifact inherent in these cells. Thus, th ese studies determined that the 2A/Jak2 cell line is a good model for elucidating AngII sign aling effects through Jak2 (Sandberg et al., 2004). We next sought to identify AngII-induc ible genes that require Jak2 for their regulation. To do this, four different cellular conditions were created. First, two control conditions were prepared from the 2A and the 2A/Jak2 cell lines. These conditions

PAGE 71

57 received no ligand, and therefor e served as reference conditions. Next, both cell lines were treated for 4 hours with 100nM AngII. Pr evious work has determined that AngII is able to induce gene transcrip tion in as little as 15 minut es and for as long as 24 hours after treatment (Taubman et al., 1989; Sadoshima et al., 1997). Given this wide range of transcriptional activation, we decided to examine 4 hours of AngII treatment in an attempt to identify the major ity of AngII-responsive genes that would be differentially expressed. Total RNA was harvested from the four experimental conditions, pooling three plates from each condition to minimize any artifacts. The extracted total RNA was reverse transcribed and biotin-l abeled in preparation for hybr idization to the Affymetrix U95A microarray chip. The Af fymetrix U95A GeneChip c ontains probe sequences for ~12,000 fully sequenced human genes. Afte r the RNA probes were hybridized to the Affymetrix microarray chips, pair-wise anal yses identified genes having a greater than two-fold change in expression between each condition. The summary of this data is shown as Fig 3-1. For the cells lacking Jak2 ( 2A), 68 genes showed a greater than twofold change in expression after 4 hours of AngII treatment. However, for the Jak2expressing cells ( 2A/Jak2), 482 genes had a greater than two-fold change in expression after the same 4-hour AngII treatment. Thes e numbers suggest that the majority of the 482 genes that are differentia lly expressed in response to AngII are dependent upon Jak2 for regulation. Similar to as was expected, wh en the two different AngII-treated cell lines where compared to each other, the microarr ay experiments identified 364 genes to be differentially expressed. Ideally, these 364 genes were identified as AngII-inducible genes that require Jak2 for th eir transcriptional regulation.

PAGE 72

58 364 genes 482 genes 2A/AT1+ Jak2 0 hr 2A/AT1 4 hr AngII 2A/AT1 + Jak2 4 hr AngII 2A/AT10 hr68 genes 364 genes 482 genes 2A/AT1+ Jak2 0 hr 2A/AT1 4 hr AngII 2A/AT1 + Jak2 4 hr AngII 2A/AT10 hr68 genes Figure 3-1 Summary of the number of differe ntially expressed genes identified by the microarray experiments following 4 hours of AngII treatment. Since there was a possibility that some of the 364 AngII-inducible genes were not dependent upon Jak2, we conducted further an alyses. To ensure the genes we had identified where in fact AngII-inducible gene s that required Jak2 for their regulation, we combined the lists that represented genes th at were regulated by AngII, irrespective of Jak2 (i.e. the lists of 64 and 482 genes). We next compared the 364 genes to this new combined list of AngII-inducible genes and subt racted any gene that was duplicated. By doing this, we ensured that the genes we identi fied in the microarray experiments were in fact regulated by both AngII treatment and Jak2 expressi on. We assumed that any gene that was duplicated was not dependent upon Jak2, but simply regulated by AngII. The final list of AngII-inducible genes found to be regulated through Jak2 was 254 genes. Fig 3-2 shows a graphical illustration of mRNA expression levels from the AngIItreated conditions. Each dot on the graph re presents one of the 12,000 different genes on the U95A chip. Genes falling outside the tw o parallel lines demons trate a greater than 2.0 fold change in gene expression between the two conditions; genes falling above the

PAGE 73

59 two parallel lines had increased gene e xpression, while genes falling below the two parallel lines had decreased ge ne expression. The further away from the 2-fold cut-off line that a gene lies, the greater the differe ntial expression that ge ne displayed between the two conditions. In addition, the farther up the slope a gene la ys, the greater the significance of differential gene expressi on. For example, Trypsinogen IV-B and Trypsinogen C both demonstrate large i nduction folds (67fold and 308-fold, respectively). These genes both fall noticeably far from the 2.0 fold cut-off line and relatively high up the slope, away from the origin of the graph. 2A cells 2A/Jak2 cells Trypsinogen IVb Trypsinogen C 2A cells 2A/Jak2 cells Trypsinogen IVb Trypsinogen C Figure 3-2. Scatter plot anal ysis of all genes identified during microarray expression profiling of 2A cells verse 2A/Jak2 cells treated for 4 hours with AngII. Each dot is the mean value for an individual gene from two arrays. The parallel lines indicate the two-fold differential expression levels. In summary, these data suggest that Ja k2 is responsible for regulating 254 genes by at least 2-fold when activated by AngII. More importantly, this entire procedure was repeated a second, independent time, and very similar results were obtained.

PAGE 74

60 Statistical Analysis of the Affymetrix Microarray Replicated Experiments The data obtained from both replicates we re then further analyzed using various statistical comparisons. Amongst these statistical methods performed were t -test comparisons and identification of genes cons istent between replicates. Statistical calculations of the microarray data were performed using both Affymetrix MAS5 software as well as Cormibia software. The Co rmibia program is a software package that uses more stringent parameters in determin ing statistical signifi cance of hybridization intensities. Table 3-1 provi des a list of five representa tive genes all demonstrating statistical significance between the 2 indepe ndent microarray repli cates. These genes represent an important set of cellular functions including an giogenesis, hematopoesis, and Ca2+ mobilization. Table 3-1 Jak2-dependent genes foll owing 4 hours of AngII treatment Accession # Fold Change Gene Name Category U23850 5.2 Type 1 IP3 receptor Calcium Signaling D11151 3.5 Endothelin-A Receptor Vasoconstriction X03656 13.0 G-CSF Cell Defense D83492 5.5 EphB6 Angiogenesis U66061 308.1 Trypsinogen C Proteolytic Enzyme Shown are the gene accession numbers, the dire ction and magnitude of the fold change, the gene name, and a brief categor y summarizing the gene’s function. Microarray Analysis of Jak2-dependent Ge ne Transcription Following 1 hour of AngII Treatment The previous microarray experiments exam ined genes regulate d after 4 hours of AngII treatment. However, AngII can modulat e the expression of some genes, such as cfos in as little as 15 minutes (Naftilan et al., 1990; Viard et al., 1992). The preceding microarray experiments failed to identify c-fos as being differentially expressed, either with or without Jak2. Clearly, we know that this gene is AngII-responsive. Therefore,

PAGE 75

61 we hypothesized that there may be a significant number of genes that are expressed prior to the 4 hour time point we analyzed. Thus we repeated the above experiments as before, this time shortening the AngII treatment to 1 hour. 2A and 2A/Jak2 cells were treated exactly as described above, only this time cells were treated for one hour with AngII. Total RNA was extracted and prepared for hybridization to microarray gene chips. Th e cRNA probes, representing each of the four conditions, were hybridized to the CodeLink Human Whole Genome Bioarray (GenUs Biosystems). This particular expression pl atform targets ~57,000 transcripts and ESTs, including ~45,000 well characterized huma n genes and transcript targets. The data from the four treatment groups was analyzed using CodeLink™ and GeneSpring software packages. Genes having a greater than 2-fold change in expression between the AngII-treated 2A and 2A/Jak2 cells were tabulated. The original statistical parameters predicted the expr ession of over 400 genes as being different between the AngII-treated cell lines. These 400 genes were further filtered down using an array of statistical measures, incl uding the Cross-Gene Error Model algorithm offered by GeneSring software. This Cross-Gene Error Model generates t -test p -values for each gene as well as standard deviat ion and standard error. As be fore, the entire procedure was repeated a second independent time, and in to tal 65 genes were identif ied as statistically regulated in both replicates. Overall, 65 AngII-inducible genes were found to be dependent upon Jak2. Table 3-2 provides a list of three representative ge nes all demonstrating st atistical significance between the 2 independent microarray repli cates. Again, a diverse set of genes was identified as being regulated by Jak2.

PAGE 76

62 Shown are the gene accession numbers, the dire ction and magnitude of the fold change, the gene name, and a brief categor y summarizing the gene’s function. Discussion Using gene-profiling technology, this study provides new evidence to support the hypothesis that Jak2 tyrosine kina se is a key mediator of AT1 receptor signal transduction. While previous studies have implicated Jak2 activation in a number of cardiovascular pathologies, such as ne ointimal formation, no clear functional consequence of this activati on has been defined (Mascareno et al., 2001). Here, we demonstrate that the recruitment of Jak2 to the AT1 receptor facilitates AngII-mediated signal transduction that result s in the activation of many diverse genes. Some of these genes have previously been identified as targets of AngII signaling. One such example is the IP3 receptor (Alexander et al ., 1985). Through the activation of heterotrimeric G-proteins, AngII causes an increase in the production of the intermediate signaling molecule, inositol 1,4,5 trisphosphate (IP3). Following its production, IP3 binds to the IP3 receptor and thereby causes the activa tion and regulation of the receptor. Furthermore, other genes identified by the microarray experiments have been previously associated with Jak2 signaling, such as the EphB6 gene (Chapter 2). Identifying genes that have been previously established as ta rgets of AngII or Jak2 thereby strengthen the quality of the microarray predictions. The majo rity of genes that were identified however were novel targets of both AngII and Jak2. These genes offer new insights into the possible mechanisms of Jak2 when activated via the AT1 receptor. Table 3-2 Jak2-dependent genes foll owing 1 hour of AngII treatment Accession # Fold Change Gene Name Category NM_000581.1 2.3 Glutathione peroxidase 1 Oxidant Defense NM_005627.2 3.3 SGK1 Na+ Reabsorption NM_002192.1 5.89 Erythroid differentiation proteinCell Differentiation

PAGE 77

63 The number of genes identified as being differentially expressed after 1 hour of AngII treatment differed dramatically when compared to the numbe r of genes regulated after 4 hours AngII treatment. Specificall y, the microarray experiments identified 65 AngII-inducible genes as being Jak2-dependent after 1 hour of treatment. Alternatively, after 4 hours of AngII-treatment, the microa rray experiments identified over 400% more Jak2-dependent genes (254 genes). One possibl e explanation for the dramatic difference in the number of genes identified could be th e alternate time points. After 4 hours of AngII treatment, the potential for activation of secondary and ter tiary genes increases greatly. While these genes may have important biological merit, they may not be directly mediated via Jak2. When the 2A and 2A/Jak2 cells were treated for only 1 hour with AngII, the potential for seconda ry and tertiary genes is dram atically reduced and results in a lower number of gene targets overall. Another plausible explanation for the va riation in the number of differentially expressed genes is the type of expressi on platforms utilized in each experiment. Microarray technology has undergone increas ing popularity over the past decade. Concurrent with the increase in the number of studies using microarray technology, there has been an increase in the development of commercially available analytical software programs. These programs use varying statis tical parameters to reduce the tremendous amount of raw data produced. Here, we used both Affymetrix and CodeLink expression platforms. Furthermore, the statisti cal software used for analysis also varied between experiments. Gene-profiling software is continually changi ng in stringency and methodology to better determine appropriate ch anges in gene expression. As such, the

PAGE 78

64 difference in the amount of genes identified by the microarray experiments could be a result of the different parameters used in the software analysis. In summary, using gene-profiling tec hnology, we identified a large number of AngII-inducible genes that are downstream targ ets of Jak2. The large number of genes identified in this study indicates the cr itical role Jak2 plays in AngII-mediated transcription. Furthermore, the genes identi fied in this study can possibly elucidate our current understanding of the role Jak2 plays in the progressi on of various cardiovascular diseases.

PAGE 79

65 CHAPTER 4 ANGIOTENSIN II INDUCES SGK1 GENE EXPRESSION VIA A JAK2DEPENDENT MECHANISM Introduction The studies presented thus far have focuse d on the global role of Jak2 in mediating cellular gene transcription. In order to draw meaningful conclusions as to the function of Jak2 in a cell, specific genes must be anal yzed. Previous gene profiling experiments identified numerous AngII-i nducible genes that require Jak2 for their regulation. One such gene that was found to be dependen t upon Jak2 for regulation was the serum and glucocorticoid regulated kinase 1 ( sgk1) Here, we sought to determine the precise mechanisms that control th e expression and function of sgk1 in response to AngII treatment. sgk1 was originally identified as a “serum and glucocorticoid-regulated kinase” in rat mammary tumor cells (Webster et al., 1993a). In the kidney, sgk1 is an early-induced aldosterone target gene whose product, a seri ne-threonine kinase, appears to primarily regulate expression and function of the Na+ epithelial channel (ENaC), as well as possibly other ion transporters. In addition to corticosteroids, a variety of other agonists increase sgk1 gene transcription in a cell-type specific manner (Alliston et al., 1997; Cowling et al., 2000b; Kumar et al., 1999; Lang et al., 2000; Webster et al., 1993b; Waldegger et al., 1998). However, the specific signa ling pathways that mediate the activation of sgk1 gene transcription by the different a gonists have not been well defined.

PAGE 80

66 Currently, the functions of sgk1 are best characterized in response to its induction via aldosterone. Aldosterone treatment increases sgk1 gene expression within 15 minutes. Maximum sgk1 induction peaks at 60 minutes a nd then returns back toward basal levels over the ensuing 24 hours (Chen et al., 1999). This activation has been found in multiple cells types in cluding; A6 cells, mpkCCD cells and in the rat collecting duct in vivo (Chen et al., 1999; Neray-Fejes-Toth et al., 1999; Shigaev et al., 2000). Following induction via aldosterone, SGK1 is translated and subsequently phosphorylates its substrate, Nedd4-2. In its unphosphorylated form, Nedd4-2 binds proline-rich motifs (PY) locat ed in the carboxy terminus of ENaC (Kamynina and Staub, 2002). The association of Nedd4-2 with ENaC targets the channel for endocytosis. SGK1 mediated phosphorylation of Nedd4-2 resu lts in its disassociation from ENaC and thereby causes an increase in ENaC abundance and activity at the plasma membrane of epithelial cells. The importance of SGK1 on ENaC regul ation has been corroborated in an SGK1 knockout mouse (Wulff et al., 2002; Huang et al., 2004). The sgk1 -/mice exhibit normal kidney structure and function und er physiological salt intake. However, when dietary salt is restricted, a defect in sodium retention by the kidney leads to a significant decrease in blood pressure (Wulff et al., 2002). Given its ro les in regulating ENaC function and expression, SGK1 is regard ed as an important signaling molecule in blood pressure regulation. Here, we explore the regulation of sgk1 in response to AngII in human fibroblast cells. To date, no direct link has been established between sgk1 and AngII signaling. Furthermore, we explore the specific Jak2dependent mechanisms responsible for AngIIinduced sgk1 transcription.

PAGE 81

67 Materials and Methods Cell Culture The 2A and 2A/Jak2 cell lines were described previously in Chapter 2. The 2A cells stably expressing either the growth hormone receptor alone ( 2A/GHR) or the growth hormone receptor along with wild type Jak2 ( 2A/GHR/Jak2) have also been described (He et al., 2003). Cells were grown in DMEM +10% FBS at 37C in a 5% CO2 humidified atmosphere. All cells were made quiescent prior to experimentation by washing them extensively with phosphate-bu ffered saline and then placing them in serum-free media for 20 hours prior to use. Cell culture reagents were obtained from Life Technologies, Inc Quantitative RT-PCR A two-step quantitative RT-PCR method was used to quantify changes in sgk1 mRNA levels. Specifically, 2A and 2A/Jak2 cells were serum starved then treated for 0 or 1 hour with 100nM AngII. Following tr eatment, total RNA was isolated using the acid guanidine thiocyanate/phenol/chlorofor m method of extraction (Chomczynski and Sacchi, 1987), exactly as described in Chap ter 2. The total RNA was subsequently reversed transcribed using the SuperScript II RNase HTranscriptase Kit (Invitrogen). Primers were designed against the sgk1 gene using PrimerBank, a public resource for PCR primers ( http://pga.mgh.harvard.edu/primerbank/) (Wang and Seed, 2003). The PrimerBank ID number for the primer pa ir used in the experiments was 25168263a1. PCR reactions were prepared using the SY BR Green PCR Core Kit (Applied Biosystems) and performed on the GeneAmp 5700 Sequence Detector machine (Applied Biosystems). 18s primers were used as a standard intern al reference and analyses were accomplished

PAGE 82

68 by calculating the 2Ct values for each condition (Giulietti et al ., 2001;Livak and Schmittgen, 2001). Northern Analysis Northern Blot analysis was performed as previously described in Chapter 2. Briefly, 2A and 2A/Jak2 cells were serum starved and treated for 0 or 1 hour with 100nM AngII. Following treatments, tota l RNA was isolated and quantitated. 25 g of total RNA was separated on a 1% agaros e-6% formaldehyde-containing gel. RNA samples were transferred onto a charged nyl on membrane (Millipore Corporation) and then hybridized to 32P-labeled cDNA probes. Probes were labeled using the Random Primers DNA Labeling System Kit (Invitrogen). The cDNA encoding for sgk1 was a kind gift from Dr. Florian Lang (U niversity of Tubingen, Germany) Densitometrical analysis was performed using the automated digiti zing software, Un-Scan-It, Version 5.1 (Silk Scientific). Western Blot Analysis Western blot analysis was performed ex actly as was previously described in Chapter 2. Briefly, 2A and 2A/Jak2 cells were treated for 0, 30, or 60 minutes with 100nM AngII and whole cell lysates were co llected. Lysates were subsequently separated on an 8% SDS-PAGE gel and tran sferred onto a nitroce llulose membrane. Membranes were Western blotted with an anti-SGK1 polyclonal antibody (Cell Signaling Technology) for 2 hours in 5% milk/TBST. Me mbranes were subsequently stripped and re-probed with an anti-STAT1 polyclonal antibody (Santa Cruz Biotechnology) to confirm equal loading of all samples.

PAGE 83

69 Luciferase Assay 2A and 2A/Jak2 cells were transfected with 5 g of a luciferase reporter construct that contains a ~3,000 bp segment (–3142 to +117) of the sgk1 promoter upstream of the luciferase cDNA (Itani et al., 2002). This construct was a ge nerous gift from Dr. Christie Thomas (University of Iowa). Transf ections were performed using Lipofectin (Invitrogen). Following the transfection, the cell s were seeded into 12-well plates at 2.5 x 105 cells per well, grown for 36 hours, serum starved for 20 hours, and then treated for 0, 4, or 24 hours with 100nM AngII. Lucifera se activity was measured from detergent extracts in the presence of ATP and lucife rin using the Reporter Lysis Buffer System (Promega) and a luminometer (Monolight Mo del 3010). Experiments were repeated exactly as described using 2A/GHR and 2A/GHR/Jak2 cells. These cells were treated with 600ng/ml GH. Each of the conditions were measured in replicates of six (n=6). Chromatin Immunoprecipitation (ChIP) Assay The ChIP assay was performed using the EZ ChIP Kit according to the manufacturer’s protocol (U pstate). Briefly, 2 x 106 2A and 2A/Jak2 cells were treated for 0 or 20 minutes with 100nM AngII and th en cross-linked with 1% formaldehyde at room temperature for 10 minutes. Cells were washed with 2 volumes of ice-cold PBS and then lysed with 1 mL nuclei swelling buffer (5mM PIPES pH 8.0, 8.5mM KCl, 0.5% NP-40). Following a brief centrifugation at 5000 rpm, cells were further lysed in SDS lysis buffer and sonicated using the 60 Sonic Di smembrator (Fisher Sc ientific) at Output 4.5. Cells were sonicated on ice for 4 cycles in 10-second intervals and allowed to cool for one minute between cycles. Chromatin fractions were spun at 12,000 rpm and the supernatants were then diluted ten-fold in a ChIP dilution buffer. Samples were

PAGE 84

70 subsequently “pre-cleared” by adding 60 L of Protein G Agaros e beads (50% slurry) and shook at 4C for 1 hour. Immunoprecipita tions were carried out overnight at 4C using 2 g of STAT1, STAT3, or STAT6 antibodies (Santa Cruz) or adding no antibody as a negative control. Following immune co mplex capture, beads were washed and the complexes were eluted. Cross-links were s ubsequently reversed by adding 5M NaCl and incubating for 5 hours at 65C. DNA was purif ied and subjected to PCR amplification using the following primers which rec ognize the STAT-recognition sequence in the sgk 1 promoter region: forward 5’GTTTGAAAACAAACATGCAAAAGT-3’ and reverse 5’TTTAGGCAATTTCAAATCACAGTAA C-3’. The PCR products were analyzed by electrophoresis on a 2.5% agarose gel stained with ethidium bromide. Results AngII Induces sgk1 Gene Expression in a Jak2-dependent Manner Previous microarray experiments identified sgk1 as a potential downstream target of Jak2 following 1 hour of AngII treatment (C hapter 3). These experiment compared gene expression profiling betw een a human fibroblast cell lin e that is devoid of Jak2 protein ( 2A) and the same cell line with the Jak2 protein expression re stored via stable transfection ( 2A/Jak2). Briefly, the micr oarray experiments predicted sgk1 gene expression to be up regulated by over 3-fold in the 2A/Jak2 cells when treated with AngII for 1 hour. In order to confirm the validity of the microarray experiments, sgk1 mRNA levels were analyzed after AngII treatment in 2A and 2A/Jak2 cells. Specifically, total RNA was isolated from both cell lines following 0 and 1 hour of treatment with 100nM AngII. The sa mples were probed with a 1,300 bp human sgk1 cDNA and analyzed via Northern blot analysis as shown in Fig. 4-1A. Similar to the

PAGE 85

71 microarray experiments, cells expressi ng Jak2 protein showed an increase in sgk1 mRNA levels following treatment with AngII. Conversely, Jak2-defi cent cells showed no increase in sgk1 gene expression. Fig. 4-1B shows a quantitation of sgk1 mRNA levels using densitometrical analysis. Speci fically the data revealed that in 2A/Jak2 cells there was a 3.5 fold increase in sgk1 mRNA expression over the untreated controls, when corrected for loading and transfer efficiency with GAPDH. Thus, it appears that AngII increases sgk1 mRNA levels in a Jak2-dependent manner in human fibroblast cells. sgk1 GAPDH 2A 2A + Jak2 0 1 0 1 AngII (hours) 2A/Jak2 1hr AngII 2A/Jak2 0hr 2A 1hr AngII 2A 0hr0 0.5 1 1.5 2 2.5 3 3.5 4 g2A 0hrg2A 1hr g2A/Jak2 0hr g2A/Jak2 1hrsgk1 mRNA/GAPDH mRNA (relative units)A. B.* sgk1 GAPDH 2A 2A + Jak2 0 1 0 1 AngII (hours) 2A/Jak2 1hr AngII 2A/Jak2 0hr 2A 1hr AngII 2A 0hr0 0.5 1 1.5 2 2.5 3 3.5 4 g2A 0hrg2A 1hr g2A/Jak2 0hr g2A/Jak2 1hrsgk1 mRNA/GAPDH mRNA (relative units)A. B.* Figure 4-1 Activation of sgk1 transcription by AngII requir es Jak2. A) Northern blot analysis was performed usi ng total RNA isolated from 2A and 2A/Jak2 cells. Membranes were pr obed with cDNA encoding for sgk1 Blots were subsequently stripped and re-probed with GAPDH to control for loading. Shown is one of three representative resu lts. B) Densitometr ical analysis of three Northern blots qu antitating changes in sgk1 gene expression. Significance was determined using Student’s t -test.

PAGE 86

72 sgk1 gene expression was further confirme d via quantitative RT-PCR analysis. 2A and 2A/Jak2 cells were treated for 1 hour w ith 100nM AngII. Total RNA was then extracted and samples were reverse transcribed. Quantitative RT-PCR analysis was performed using primers designed for sgk1 (Fig. 4-2). The data confirms that AngII treatment causes an increase in sgk1 gene expression in Jak2 -expressing cells. This induction of mRNA was not seen in cells lacking Ja k2 protein. 2A 1 hr AngII 2A/Jak2 1 hr AngII0 1 2 3 4 Fold difference, 2Ct 2A 1 hr AngII 2A/Jak2 1 hr AngII0 1 2 3 4 Fold difference, 2Ct Figure 4-2 Jak2-expressing cells have a greater increase in sgk1 gene expression than Jak2-deficient cells. Quantitative RT-PCR analysis of total RNA was performed using 2A and 2A/Jak2 cells treated for 1 hour with 100nM AngII. Primers were designed for sgk1 Fold changes were derived from the 2Ct value and are indicated on the gra ph. Values are represented as the mean +/SD. Shown is one of th ree representative results. Collectively, Fig. 4-1 and 4-2 strengthen the argument that AngII causes induction of the sgk1 gene, independent of aldo sterone action. Furthermor e, it appears that AngII regulates sgk1 transcription through a Jak2-dependent mechanism. Jak2 is Critical for AngII-mediated Increases in SGK1 Protein Levels To determine whether the induction of sgk1 gene expression by AngII results in a corresponding increase in cellular SGK1 protein levels, whole cell lysates from 2A and

PAGE 87

73 2A/Jak2 cells were analyzed via Western blot analysis. Cells were treated for 0, 30, and 60 minutes with 100nM AngII and then prot ein content was determined by Western blotting with a polyclonal SGK1 antibody (Fig 4-3). Membranes were subsequently stripped and re-blotted with a STAT1 pol yclonal antibody to ensure equal loading. Similar to the gene expression analysis, the 2A/Jak2 cells showed an increase in SGK1 protein expression after treatment with Ang II. This increase was not seen in the 2A cells, which lack Jak2 protein. Figure 4-3 Western blot analysis of SGK1 protein expression in 2A cells compared to 2A/Jak2 cells following treatment with AngII. Cells were treated with 100nM AngII for 0, 30, and 60 min. Lysates were collected and blotted with an anti-SGK1 polyclonal antibody. The membrane was subsequently stripped and re-blotted with an anti-STAT1 polyclonal antibody to establish equal loading. AngII, but not Growth Hormone, Causes Activation of the sgk1 Promoter in Jak2expressing Cells We next sought to determine if AngII was causing sgk1 induction through activation of the sgk1 promoter. To do this, we transfect ed a luciferase reporter construct that contains ~3,000 bp of the sgk1 promoter upstream of a lu ciferase-coding region into 2A and 2A/Jak2 cells. The cells were subsequen tly serum starved for 20 hrs, and then treated for 0, 4, or 24 hours with 100 nM Ang II. Following cell lysis, luciferase activity was measured (Fig. 4-4A). In cells l acking Jak2 protein, there was no significant 0 30 60 0 30 60 AngII (min) SGK1 STAT1 2A 2A + Jak2 61 49 0 30 60 0 30 60 AngII (min) SGK1 STAT1 2A 2A + Jak2 61 49

PAGE 88

74 increase in luciferase activity in resp onse to AngII treatment. However, the 2A/Jak2 cells showed a nearly 2.5-fold increase in luciferase activity following a 24-hour treatment with AngII. These data suggest that AngII causes a signaling cascade that results in the activation of the sgk1 promoter. Furthermore, th is transcriptional activation is only seen in cells expressing Jak2. To determine whether the tran scriptional activation of the sgk1 promoter was specific for AngII treatment, we used 2A cells that were stably transfected with the growth hormone receptor (GHR). 2A/GHR and 2A/GHR/Jak2 cells were transfected with the same luciferase construct as a bove. Cells were serum starved for 20 hours, treated for 0, 4, or 24 hours with 600ng/mL gr owth hormone (GH) and then luciferase activity was measured (Fig. 4-4B). This time, both cell types showed no increase in luciferase activity, irresp ective of the presence of Jak2. Th ese data indicate that contrary to AngII treatment, activation of Jak2 via GH has no effect on sgk1 induction. AngII Causes STAT1 Association with the sgk1 Promoter Region in 2A/Jak2 cells The preceding data suggests that AngII induces sgk1 transcription via the activation of Jak2. Traditionally, upon activation Jak2 propagates signaling cascades that activate the cytosolic transcription factors, termed STATs. Upon activation by Jak2, STATs will dimerize and translocate into the nucleus where they bind to STAT-recognition sites within the promoter region of a target ge ne. Most commonly, these STAT-recognition sequences are known as GAS motifs (gamma interferon activated sequences). GAS elements are palindromic response elements that share the ge neral sequence motif TTCNmGAA (Lew et al., 1991). In this study we questioned if AngII induction of sgk1 was occurring through a Jak/STAT signaling cascade. Analysis of the ~3kb sgk1

PAGE 89

75 0 0.5 1 1.5 2 2.5 3 0424 Angiotensin II treatment (hours)Fold Change (Luciferase Activity) G2A/AT1 c G2A/AT1 + 2A 2A/Jak2 A. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0424 Growth Hormone Treatment (hours)Fold Change (Luciferase Activity) 2A/GHR 2A/GHR/JAK2B. 0 0.5 1 1.5 2 2.5 3 0424 Angiotensin II treatment (hours)Fold Change (Luciferase Activity) G2A/AT1 c G2A/AT1 + 2A 2A/Jak2 A. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0424 Growth Hormone Treatment (hours)Fold Change (Luciferase Activity) 2A/GHR 2A/GHR/JAK2B. Figure 4-4 AngII activates the sgk1 promoter in a ligand specific manner. A.) 2A and 2A/Jak2 cells were transfected with 5 g of a luciferase reporter construct containing ~3,000 bp of the sgk1 promoter upstream of a luciferase gene. Cells were treated with 100nM AngI I and then luciferase activity was measured. The difference in lucifera se activity between the 0 and 24 hour time points was statistically signifi cant as determined by Student’s t -test. *, p =9.48 x 10-6 Shown is one of three independent results. B) 2A/GHR and 2A/GHR/Jak2 cells were transfected as above and treated with 600 ng/ml GH. Luciferase activity was then measured. Shown is one of three independent results.

PAGE 90

76 promoter sequence revealed multiple GAS elements (Fig 4-5A). To examine whether STAT proteins associate with the sgk1 promoter, 2A and 2A/Jak2 cells were analyzed by ChIP assays. A specific primer set wa s designed to amplify a 209 bp DNA fragment of the sgk1 promoter that contained a GAS elemen t identified at position –725 to -717. 2A and 2A/Jak2 cells were treated with 100nM AngII for 0 or 20 minutes, and subsequently analyzed by a ChIP assay (Fig 4-5B). PCR amplification revealed that STAT1 binds to the sgk1 promoter in 2A/Jak2 cells following treatment with AngII. As expected, this association was not found in the 2A cells. Furthermore, when immunoprecipitations were performed us ing STAT1, STAT3, and STAT6 antibodies, PCR analysis suggested that STAT1 was the preferential STAT binding to the sgk1 promoter in response to AngII (Fig. 4-5C). Th ese data strengthen th e argument that AngII is activating the Jak/STAT pathway to induce sgk1 transcription. Discussion This study provides the first evidence that sgk1 is induced by AngII via an aldosterone-independent mechanism. Specificall y, we suggest that AngII is eliciting its effects on sgk1 transcription through a Jak2-dependent mechanism. To date, sgk1 activation and function are be st understood in response to aldosterone. The series of events leading to sgk1 induction via aldoste rone have been well studied. Traditionally, in response to a drop in blood volume, increased renin levels produce AngII. Amongst the many physiological e ffects of AngII, it acts directly on the adrenal glands to cause th e secretion of aldosterone into the blood. Aldosterone subsequently binds to mineralocorticoid rece ptors within epithelial cells of the kidney

PAGE 91

77 Position GAS element (-2376 --2347) 5’CAAAGTCACA TTCTATGAA GATTCCCTGC3’ (-735 --706) 5’CGGCGGCTCC TTCAAGGAA ACGTCAGTGC3’A. B. 2 A/ J a k 2 sgk1 Input No AbAngII -+ -+ 2 AC. 2 A / J a k 2 c e l l s sgk1 InputS1 S3 S6 Position GAS element (-2376 --2347) 5’CAAAGTCACA TTCTATGAA GATTCCCTGC3’ (-735 --706) 5’CGGCGGCTCC TTCAAGGAA ACGTCAGTGC3’A. B. 2 A/ J a k 2 sgk1 Input No AbAngII -+ -+ 2 AC. 2 A / J a k 2 c e l l s sgk1 InputS1 S3 S6 Figure 4-5 AngII causes STAT1 association with the sgk1 promoter in 2A/Jak2 cells. A.) Identification of GAS elements f ound within the ~3,000 bp region of the sgk1 promoter B.) ChIP assay investigating STAT1 binding to the sgk1 promoter in 2A and 2A/Jak2 cells. Cells were tr eated for 0 or 20 min with 100nM AngII and then subsequently subj ected to formaldehyde cross-linking. Immunoprecipitation were performed us ing an anti-STAT1 antibody or no antibody (negative control). Purifi ed DNA was analyzed by PCR with a primer set specific for the sgk1 promoter region containing a GAS element. Input corresponds to 1/100 of the amount of DNA used in the assay. C.) ChIP assay analyzing which of the ST ATs binds preferentially to the sgk1 promoter region. 2A/Jak2 cells were treated fo r 20 min with 100nM AngII. Immunoprecipitations were performed using STAT1 antibody (S1), STAT3 antibody (S3), and STAT6 antibody (S6). Purified DNA was analyzed by PCR with a primer set specific for the sgk1 promoter region containing a GAS element. Input corresponds to 1/100 of the amount of DNA used in the assay. and directly causes an increase in sgk1 transcription. Therefore, while previous studies have implicated an indirect role of AngII in mediating sgk1 induction, there has been no evidence supporting a direct role. Here, we suggest that AngII is increasing sgk1 transcription, but through an aldosterone-independent mechanism. As opposed to triggering aldosterone secreti on, we propose that AngII is signaling through tyrosine

PAGE 92

78 kinases to elicit its effects on sgk1 transcription. Further inve stigations are required to determine the physiological consequences of this sgk1 induction via AngII. Our data show cells expressing Jak2 protein can increase sgk1 expression following treatment with AngII. Alternatively, Jak2-deficient cells lack increases in sgk1 expression. Therefore these studies suggest a critical ro le for Jak2 in regulating sgk1 transcription. We hypothesi zed that AngII mediates sgk1 transcription through the initiation of Jak/STAT signaling cascades. This hypothesis was supported by two main reasons. First, Jak2 has been well established in th e literature as being activated via the AT1 receptor (Marrero et al., 1995). Spec ifically, AngII binding to the AT1 receptor causes cytosolic Jak2 to become activated and subse quently form a physical association with the intracellular tail of the AT1 receptor. After being recruited to the receptor, Jak2 initiates a tyrosine phosphorylation cascades that result s in the activation a nd dimerization of the STATs. STAT dimers consequently transl ocate into the nucleus where they mediate gene transcription. Thereby, if sgk1 transcription is being induced by a Jak2-dependent mechanism, it is probable that Jak2 is acting through the STATs. Second, we identified multiple STAT-rec ognition sequences within the promoter region of sgk1 Previous work has elucidated the preferential binding parameters for the specific STATs. STAT6 dimers prefer TTC(N)4GAA whereas the remaining STAT dimers will traditionally recognize TTC(N)3GAA motifs (Schindler et al., 1995; Seidel et al., 1995; Horvath et al., 1995). The specific motifs that were identified in this study suggest that a member of the STAT fam ily, other than STAT6, may potentially be binding to the promoter of sgk1 and initiating transcription. These observations further

PAGE 93

79 strengthen the argument that AngII induces sgk1 transcription via the activation of a Jak/STAT pathway When the hypothesis was specifically invest igated using the ChIP assay, we found that STATs were indeed involved in the AngII-induced increases in sgk1 transcription. The data in Figure 4-5 shows that STAT1 is physically binding to the sgk1 promoter region in Jak2-containing cel ls following treatment with AngII. While there was evidence that STAT3 and STAT6 may be having a minor contribution to sgk1 transcription, we hypothesize that STAT1 is the preferential STAT involved in sgk1 induction at position –725 to -717. Interestingly, when cells are stimulated with GH, a well-known activator of Jak2, no significant increase in sgk1 transcription is observed. While Jak2 is activated by a diverse set of ligands, it is unclear whether its downstream targets are ligand-specific. This work suggests that the tr anscriptional effects of Jak2 on sgk1 induction are specific for treatment with AngII. This is in agr eement with previous studies that suggest GH activates different STATs through specific mechanisms (Carter-Su et al 1997). Namely, studies have shown that GH causes robust ac tivation of STAT3 and STAT5b in certain cell types (Yi et al 1996). Given the diversity of GH signaling, we believe activation of Jak2 via GH causes recruitment of different STATs as when AngII activates Jak2. Therefore, we conclude that Jak2 demonstr ates ligand specificity, as evidenced by the lack of sgk1 induction when GH activates Jak2. In conclusion, these studies suggest that AngII mediates sgk1 expression through a Jak2-dependent mechanism. Furthermore, Ang II may now be regarded as a mediator of sgk1 induction, independent of its actions through aldosterone.

PAGE 94

80 CHAPTER 5 JAK2 PREVENTS ANGIOTENSI N II-MEDIATED INOSITOL 1,4,5 TRISPHOSPHATE RECEPTOR DEGRADATION Introduction The Type 1 inositol 1,4,5 trisphosphate (IP3) receptor was amongst the genes identified in Chapter 3 as being a potentia l target of Jak2, when activated via the AT1 receptor. While previous studies have established a relationship between AngII and the IP3 receptor (Alexander et al ., 1985), no such correlation ha s been made linking Jak2 to the IP3 receptor. Therefore, we sought to el ucidate the complex regulation of the IP3 receptor in response to AngII. Specifically, we investigat ed the regulatory effects of signaling cascades initiated by Jak2. As previously described in Chapter 1, the IP3 receptors are in tracellular calcium channels expressed on the membrane of the endoplasmic reticulum (ER). IP3 is a second messenger produced through the st imulation of PLC-coupled receptors, such as the AT1 receptor. IP3 binding to its obligatory receptor results in a rapid release of calcium from internal stores via a non-sel ective cation pore in the C-term inal portion of the channel (Boehning et al ., 2001). Three struct urally distinct IP3 receptors have been identified (Nakagawa et al ., 1991). Of the three subtypes, T ype 1 has the highest expression throughout all cell type s studied (De Smedt et al ., 1994; Wojcikiewicz, 1995). Maintaining precise regulation of calcium signaling within a cell is critical for normal cellular functions. Regulation of calcium is maintained via a complex interplay between changes in cytosolic IP3 concentration and IP3 receptor expression on the

PAGE 95

81 membrane of the ER. Regulation of IP3 receptor expression and function can be mediated via its phosphorylation by multiple kinases such as cyclic-AMP-dependent protein kinase (PKA), protei n kianse C (PKC) and Fyn tyrosine kinase (Ferris et al ., 1991a, 1991b; Jayaraman et al ., 1996). Specifically, Fyn has been shown to bind to and phosphorylate the IP3 receptor at tyrosine 353 (Y353) in activated T-cells (Jayaraman et al ., 1996). Evidence suggests th at the phosphorylation of Y353 via Fyn increases the binding affinity of IP3 to its receptor when there are low concentrations of IP3 within the cytosol (Cui et al ., 2004). However, the effect of Y353 phosphorylation in response to ligand treatment (i.e., high IP3 levels) has not yet been defined. Here, we investigate the role of Jak2 in regulating th e expression and function of the IP3 receptor in response to AngII. Usi ng rat aortic smooth muscle (RASM) cells over-expressing a dominant negative Jak2, we de termined that the loss of a functional Jak2 contributes to AngII-mediated degradation of the IP3 receptor. Since previous data show that Fyn, a downstream target of Jak2, is able to phosphorylate the IP3 receptor at Y353, we believe Jak2 prevents the AngII-mediated IP3 receptor degradation via the activation of Fyn. In conclusion, these data suggest that Jak2 has a protective role in maintaining IP3 receptor expression, poten tially through activation of Fyn and subsequent phosphorylation of the IP3 receptor. Materials and Methods Cell Culture Creation of the 2A and 2A/Jak2 cells have previously been described in Chapter 2. Additionally, creation of the RASM-WT and RASM-DN cells have also been previously described (Sayeski et al ., 1999a). All cells were maintained at 37C in a 5%

PAGE 96

82 CO2 humidified atmosphere. Prior to experi mentation, all cells were made quiescent by washing them extensively with phosphate-buffe red saline (PBS) and then placing them in serum-free media for either 20 hours ( 2A) or 48 hours (RASM). Cell culture reagents were obtained from Life Technologies, Inc AG490, AG-9, PP-2, PP-3, and lactacystin were all purchased from Calbiochem. Losartan was from Merck. Quantitative RT-PCR A two-step quantitative RT-PCR method was used to quantify changes in IP3 receptor gene expression. Specifically, the 2A and the RASM-derived cell lines were serum starved and then treated for 0 or 4 hours with 100nM AngII. Following treatment, total RNA was isolated using the acid guanidi ne thiocyanate/phenol/chloroform method of extraction (Chomczynski and Sacchi, 1987). The total RNA was subsequently reversed transcribed using the SuperScript II RNase HTranscriptase Kit (Invitrogen). Primers were designed against the Type 1 IP3 receptor gene using PrimerBank, a public resource for PCR primers ( http://pga.mgh.harvard.edu/primerbank/) (Wang and Seed, 2003). The PrimerBank ID number for the primer pair used in the experiments was 598181a1. PCR reactions were prepared usi ng the SYBR Green PCR Core Kit (Applied Biosystems) and performed on the GeneAmp 5700 Sequence Detector machine (Applied Biosystems). 18s primers were used as a stan dard internal reference and analyses were accomplished by calculating the 2Ct values for each condition (Giulietti et al ., 2001;Livak and Schmittgen, 2001). Western Blot Analysis Western blot analysis was performed ex actly as was previously described in Chapter 2. Briefly, whole cell lysates from RASM-WT and RASM-DN cells were

PAGE 97

83 collected following the appropr iate treatments described in each experiment. Lysates were subsequently separated on an 8% SDS-PAGE gel and transferred onto a nitrocellulose membrane. Membranes were Western blotted with an anti-Type 1 IP3 receptor polyclonal antibody (Upstate Biotechno logy) for 2 hours in 5% milk/TBST. Membranes were subsequently stripped and re-probed with an anti-STAT1 polyclonal antibody (Santa Cruz Biotechnology) to conf irm equal loading of all samples. Densitometrical analysis was performed us ing the automated digitizing software, UnScan-It, Version 5.1 (Silk Scientific). Immunofluorescence The Type 1 IP3 receptor was visualized using immunofluorescence. Cells were grown on 2-chambered microscope slides composed of #1.0 German Borosilicate Coverglass (Lab-Tek). After treatment with AngII for 0 or 1 hour, cells were washed with K+-free PBS and then fixed at room temp erature with 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, for 30 minutes. Fixe d cells were subsequently washed four times with K+-free PBS, permeabilized for 10 minutes at room temperature with 0.2% Triton X-100 in K+-free PBS, washed an additional four times, and then blocked with 5mg/ml bovine serum albumin in K+-free PBS for 4 hours at room temperature. The cells were then incubated with a primary anti-IP3 receptor antibody (1 :200) overnight at 4C using 5mg/ml BSA in K+-free PBS. The following day, cell s were washed four times and incubated with a goat anti-ra bbit secondary antibody conjuga ted to FITC (1:500) for 4 hours at room temperature. Cells were mounted with Vectashield mounting medium supplemented with Dapi (Vector Laboratories, Inc.). Images were collected using the

PAGE 98

84 Zeiss Axioplan 2 Fluorescence Microscope. Ce lls were visualized using a magnification of 100x (oil emersion objective). Calcium Studies Fura-2/AM loading and intracellular calci um measurements were carried out as previously described (Xia et al., 2004). In short, cells were loaded at room temperature for two hours in HEPES-buffered solution containing 5-10 M Ca2+ indicator fura-2/AM (Calbiochem), then washed three times and incubated for an additional 20 minutes in dye-free solution to reduce the possibility of incomplete hyd rolysis of the acetoxymethyl esters by intracellular esterases. Fura-2 /AM was dissolved in dimethyl sulfoxide (DMSO). The final concentration of DMSO in the loading and e xperimental solution was below 0.5% (v/v). The [Ca2+]i measurements were made with an ratiometric imaging system (InCyt Im2, Intracellular Imaging, Inc., Cincinnati, OH) including a PC computer, a filter wheel of conventional design, a CCD camera, and a Nikon TE 300 microscope with 40 air objective (0.65 N.A.). Cells were continuous ly superfused with Ringer’s solution (in mM, 140 NaCl, 5 KCl, 1.5 CaCl2, 1 MgCl2, 10 glucose, 10 HEPES; pH 7.4 with NaOH) or Ringer’s solution plus AngII through a grav ity-fed system at a rate of 3-4 ml•min-1. Solutions were evacuated by suction. In each experiment, a number of either single cells or a group of cells were selected using the so ftware setting. The fl uorescent emissions as paired signals (F340 and F380) at wavelength of 510 nm from the region of interest were measured accordingly to excitation wavelengths of 340 nm and 380 nm, at a time interval of every three seconds. Background fluorescen ce was subtracted online from F340 and F380 signals.

PAGE 99

85 Changes in [Ca2+]i are reported as the mean fluor escence ratio of F340/F380 over time for a group of cells. The mean fluor escence ratio of F340/F380 was generated offline and expressed as R/R0, with R being the fluorescence ratio change over time and R0 the averaged fluorescence ratio of a peri od of 60-120 seconds before AngII addition. The final results from each group of expe riments (n) are reported as the mean peak response (means SE). Statistical significance was examined using Student’ t -test. A value of P < 0.05 was considered significant. Results Jak2 Regulates IP3 receptor Gene Expression Fo llowing Treatment With AngII Chapter 3 describes gene-profiling expe riments that identified AngII-inducible genes that require Jak2 for their regulation. Briefly, microarray experiments compared a Jak2-deficient cell line ( 2A) to a similar cell line expressing Jak2 ( 2A/Jak2) that had been treated with 100nM AngII for either 0 or 4 hours. Analysis revealed numerous AngII-inducible genes that had a greater than 2.0-fold change in expression as a function of Jak2. Amongst these genes was the Type 1 IP3 receptor. Quantitative RT-PCR was used to validate the mi croarray data using the 2A and 2A/Jak2 cells. The IP3 receptor expression pattern found by the quantitative RT-PCR analysis was similar to that observed in the microarray studies (Fig. 5-1A ). To eliminate the possibility that the increase in IP3 receptor expression was clonal artifact inherent to the 2A-derived cells, we next investigated IP3 receptor expression in rat cultured aortic smooth muscle cells over-expressing a dominant negativ e form of Jak2. Aortic smooth muscle cells were chosen because they have hi gh expression of the Type 1 IP3 receptor (Marks, 1992). In addition, these cells are a more physiologically relevant cell type fo r investigating AngII-

PAGE 100

86 dependent changes since they are highly contr actile cells. Specifically, the cells used in this study were rat aortic smooth muscle cells stably expressing e ither 1) a dominant negative Jak2 protein and the Neomycin sel ectable marker (RASM-DN) or 2) just the Neomycin selectable marker alone (RASM-WT). The RASM-DN cells suppress endogenous Jak2 function by roughly 90% when compared to the RASM-WT cells. The full characterization of these cells has been previously described (Sayeski et al ., 1999a). 0 1 2 3 Ligand -+ -+ Fold difference, 2 DD Ct IP3 Receptor Gene Expression 2A 2A/Jak2 0 1 2 3 2A cells AngII -+ -+Fold difference, 2Ct Rat Aortic Smooth Muscle cells RASM WT RASM DN0 2 4 6 Fold difference, 2 DD Ct -+ -+ IP3 Receptor Gene Expression 0 2 4 6 AngII -+ -+Fold difference, 2CtA.B. 0 1 2 3 Ligand -+ -+ Fold difference, 2 DD Ct IP3 Receptor Gene Expression 2A 2A/Jak2 0 1 2 3 2A cells AngII -+ -+Fold difference, 2Ct Rat Aortic Smooth Muscle cells RASM WT RASM DN0 2 4 6 Fold difference, 2 DD Ct -+ -+ IP3 Receptor Gene Expression 0 2 4 6 AngII -+ -+Fold difference, 2CtA.B. Figure 5-1. Cells having little to no functional Jak2 protein ha ve a greater increase in IP3 receptor gene expression than when compared to cells expressing Jak2 Quantitative RT-PCR analysis of total RNA was performed on either 2A and 2A/Jak2 cells (A) or RASM-WT and RASM-DN cells (B). Primers were designed for Type 1 IP3 receptor. Fold changes were derived from the 2Ct value and are indicated on the graph. Va lues are represented as the mean +/SD. Shown is one of thr ee representative results. Pr inted with permission of publisher Quantitative RT-PCR analysis found an expression profile of IP3 receptor that was similar between the 2A and RASM cells (Fig 5-1B). Specifically, in cells lacking a functional Jak2, there is a marked increase in IP3 receptor gene expression following 4 hours of 100nM AngII (~2-fold in 2A, ~4-fold in RASM-DN). Conversely, cells that do have functional Jak2 demonstrate a significantly lower increase of IP3 receptor

PAGE 101

87 expression in response to AngII (~0.5-fold in 2A/Jak2, ~2-fold in RASM-WT). In summary, the quantitative RT-PCR expe riments suggest that in cells having little to no Jak2, AngII-induced IP3 receptor gene transcription is in creased to a greater degree than in cells that have functional Jak2 protein. Cells Lacking Functional Jak2 Undergo AngII-mediated Degradation of the IP3 receptor Western blot analysis was used to investigate the prot ein levels of IP3 receptor in AngII-treated RASM-WT cells compared to RA SM-DN cells. Cells were treated for 0, 1, and 4 hours with 100nM AngII. Whole cell protein lysates from each condition were then separated by SDS-PAGE and subseque ntly Western blotted with an anti-IP3 receptor antibody (Fig 5-2A, top). Overall, RASM -DN cells have significantly less IP3 receptor protein expression when compared to the RASM-WT cells. To ensure equal protein loading, the membrane was stripped and re -blotted with an anti-STAT1 antibody (Fig. 52A, bottom). Next, this experiment was repeated as before, but this time a 2-fold increase in RASM-DN whole cell lysate was loaded (r elative to the RASM-WT lysate) as means to obtain detectable levels of the IP3 receptor protein. In terestingly, when IP3 receptor expression was visualized in the RASM-DN cells, we found that there was a marked decrease in IP3 receptor protein following 1 and 4 hours of AngII treatment (Fig 5-2B, top). These data suggest the protein is bei ng degraded in response to AngII. However, this did not occur in the RASM-WT cells. To confirm the levels of lysate loaded into each lane, the membrane was stripped and re-probed with anti-STAT1 antibody to confirm the roughly 2-fold increase in STAT1 protein in the RASM-DN cells (Fig 5-2B, bottom). These experiments indica te that while there is less IP3 receptor

PAGE 102

88 C. B. Ang II (hrs) 012345Protein levels; fold change versus unstimulated 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0 RASM-WT RASM-DN p<0.05 p<0.05AngII (hours) IP3R STAT1 RASM-WT RASM-DN 0 1 4 0 1 4 A.AngII (hours) IP3R STAT1 RASM-WT RASM-DN 0 1 4 0 1 4 172 172C. B. Ang II (hrs) 012345Protein levels; fold change versus unstimulated 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0 RASM-WT RASM-DN p<0.05 p<0.05AngII (hours) IP3R STAT1 RASM-WT RASM-DN 0 1 4 0 1 4 A.AngII (hours) IP3R STAT1 RASM-WT RASM-DN 0 1 4 0 1 4 IP3R STAT1 RASM-WT RASM-DN 0 1 4 0 1 4 172 172 172 172 Figure 5-2. Cells lacking functional Jak2 undergo AngII-mediated degradation of the IP3 receptor. A) Western blot analysis of IP3 receptor expression in RASM-WT cells compared to RASM-DN cells following treatment with AngII. Cells were treated with 100nM AngII for 0, 1, and 4 hours. Lysates were collected and blotted with an anti-IP3 receptor polyclonal anti body (specific for Type 1). The membrane was subsequently stripped and re-blotted with an anti-STAT1 polyclonal antibody to establish equal loading. B) Similar Western blot analysis was performed, but with twice as much RASM-DN whole cell lysate. C) Densitometry analysis of IP3 receptor expression of eight representative Western blots. Significance wa s determined using Student’s t -test. Printed with permission of publisher

PAGE 103

89 protein expressed in Jak2-imp ared cells, the protein that is present, is degraded in response to AngII treatment. Densitometry analysis of IP3 receptor protein expression was done on eight representative Western Blots in order to qua ntitate the AngII-inducible degradation of the IP3 receptor (Fig 5-2C). We found that there was a significant reduction in IP3 receptor expression at 1 hour following AngII treatment in the RASM-DN cells when compared to untreated RASM-DN cells (47.05.7%, P <0.05). Conversely, although a mild increase in IP3 receptor expression in RASM-WT cells was evident following 1 and 4 hours of AngII treatment, this was not significantly different when compared to untreated RASMWT cells. In conclusion, Western blot analysis of IP3 receptor protein suggests that, in the absence of functional Jak2, th ere is AngII-mediated degr adation of the receptor. Interestingly, this observation was the inverse of what we observed at the transcriptional level. In other words, in the RASM-DN ce lls, one hour after AngII treatment there is a marked degradation of IP3 receptor protein when compared to the RASM-WT cells. However, 4 hours after AngII treatment in the RASM-DN cells, the mRNA levels are significantly greater than those in the RASM -WT cells, as seen in Fig 1B. Thus, we hypothesize that the increased mRNA levels observed in the RA SM-DN cells 4 hours after AngII treatment is compensatory to th e protein degradation seen after 1 hour of AngII treatment in these cells. RASM-WT Cells Treated With AG490 Recapitulate AngII-mediated IP3 receptor Degradation in RASM-DN Cells In order to eliminate the possibili ty that the degradation of the IP3 receptor was the result of clonal artifact within th e RASM-DN cells, Jak2 was pharmacologically

PAGE 104

90 inhibited using AG490 in RASM-WT cells. RASM-WT cells were pre-treated for 16 hours with 100 M of AG-9, an inactive analogue, or with the Jak2 pharmacological inhibitor, AG490. Following pretreatment with the inhibitor, the cells were treated for 0, 1, and 4 hours with 100nM AngII. Cells from each treatment condition were then lysed and subsequently Western blotted with an anti-IP3 receptor polyclonal antibody (Fig 5-3, top). The data show that pharmacological inhibition of Jak2 function by AG490 induces AngII-mediated IP3 receptor degradation similar to that shown in the RASM-DN cells. The membrane was then stripped and re -blotted using an anti-STAT1 polyclonal antibody to ensure equal protein lo ading (Fig 5-3, bottom). Collectively, the data demonstrate that when Jak2 tyrosine kinase function is blocked with AG490, AngII treatment produces a similar IP3 receptor degradation pattern as is seen when Jak2 function is blocke d via the dominant negative protein. IP3R AG-9AG490 0 1 4 0 1 4 RASM-WT cells STAT1 AngII (hours) 172 IP3R AG-9AG490 0 1 4 0 1 4 RASM-WT cells STAT1 AngII (hours) 172 172 Figure 5-3. RASM-WT cells treated w ith AG490 recapitulates AngII-mediated IP3 receptor degradation seen using RASM-DN cells. RASM-WT cells were pretreated with 100 M of either AG-9 or AG490 for 16 hours. Following pretreatment, cells were treated w ith 100nM AngII for 0, 1, or 4 hours and Western blotted with an anti-IP3 receptor antibody. Membranes were reblotted with an anti-STAT1 antibody to ensure equal protein loading. Shown is one of four representa tive results. Printed wi th permission of publisher

PAGE 105

91 AngII-mediated IP3 receptor Degradation is Reversible Following Recovery From AngII To determine if AngII-mediated IP3 receptor degradation in RASM-DN cells is reversible following recovery from AngII, RASM-DN cells were treated with 100nM AngII for 4 hours. The AngII-containing media was then removed and cells were allowed to recover for 2, 20, and 24 hours in media that lacked AngII. Whole cell lysates were prepared from each condition and Western blotted for IP3 receptor as shown (Fig. 5-4, top). The results show that followi ng 4 hours of AngII treatment, the IP3 receptor undergoes degradation, as previously shown. However, within 2 hours of removal of AngII from the incubation medium, the IP3 receptor expression began rapid recovery and demonstrated full restoration by 24 hours. Th e membrane was eventually re-blotted for STAT1 expression to establish equal load ing across all lanes (Fig. 5-4, bottom). -0 2 20 24 0 4 4 4 4 AngII (hours) Recovery Time (hours) RASM-DN cells IP3R STAT1 172 -0 2 20 24 0 4 4 4 4 AngII (hours) Recovery Time (hours) RASM-DN cells IP3R STAT1 172 Figure 5-4. AngII-mediated IP3 receptor degradation is reve rsible following recovery from AngII. RASM-DN cells were treated with 100nM AngII for 0 or 4 hours. The cells were allowed to recover for 0, 2, 20, or 24 hours in media that was free of AngII. IP3 receptor expression was determined via Western blot analysis. STAT1 expression was analyzed to ensure equal protein loading. Shown is one of four representative We stern blots. Printed with permission of publisher

PAGE 106

92 In summary, these data show that the rapid IP3 receptor degradation in cells lacking a functional Jak2 is reversible once the influe nce of AngII is removed from the culture media. AngII-inducible Degradation of the IP3 receptor Occurs via the AT1 receptor and Through a Proteosome-dependent Mechanism To elucidate the mechanism of Ang IIinducible degradation of the IP3 receptor, RASM-DN cells were treated with losartan, an AT1 receptor blocker, or lactacystin, a specific proteasome inhibitor. Losartan was used to identify the specific Losartan 0 1 4 0 1 4 ---+ + + Ang II (hours) IP3R STAT1 RASM-DN cells A. Lactacystin 0 1 4 0 1 4 ---+ + + Ang II (hours) IP3R STAT1 B. Losartan 0 1 4 0 1 4 ---+ + + Ang II (hours) IP3R STAT1 RASM-DN cells A. Lactacystin 0 1 4 0 1 4 ---+ + + Ang II (hours) IP3R STAT1 B. Figure 5-5. IP3 receptor degradation is depende nt upon AngII and occurs through a proteasome-dependent mechanism. A) RASM-DN cells were pretreated with 10 M losartan for 30 minutes and then treated with 100nM AngII for 0, 1, and 4 hours. Lysates were collected and Western blotted with an antibody against the IP3 receptor. B) RASMDN cells were pretreated with 8 M lactacystin for 13 hours and then trea ted with 100nM AngII for 0,1, and 4 hours. Lysates were collected and West ern blotted with an antibody against the IP3 receptor. The samples were also Western blotted with anti-STAT1 antibody to confirm equal loading. Show n is one of three representative results for each. Printed with permission of publisher

PAGE 107

93 type of AngII receptor that is linked to IP3 receptor degradation. Lactacystin was used to determine the specific mechanism responsible for the IP3 receptor degradation. RASMDN cells were either pretreated with 10 M of losartan for 30 minutes or 8 M lactacystin for 13 hours. Following pretreatment, cells were treated for 0, 1, and 4 hours with 100nM AngII. Whole cell protein lysates were then separated by SDS-PAGE and subsequently Western blotted with anti-IP3 receptor antibody (Fi g. 5-5A and 5-5B). Analysis shows that AngII-dependent IP3 receptor degradation was lost when the cells were pretreated with either losartan or lactacystin, suggesting the degradation of IP3 receptor is dependent upon the AT1 receptor and occurs through the proteaosomedependent pathway. Thus, we conclude that the mechanism by which AngII promotes IP3 receptor degradation requires both the AT1 receptor and a functional proteaosome. Immunofluorescence Experiments Demonstrate that IP3 receptor in RASM-DN cells is Rapidly Degraded Following AngII Treatment We next used immunofluorescence analys is to visualize the changes in IP3 receptor expression in RASM-WT and RASM-DN cells following treatment with AngII. Specifically, RASM-WT and RASM-DN cells were either left untreated or were treated for 1 hour with 100nM AngII. Cells were s ubsequently fixed and stained using an antibody specific for the Type 1 IP3 receptor. The cellula r localization of the IP3 receptor was then visualized using florescent microsc opy (Fig. 5-6). In the RASM-WT cells, prior to AngII treatment there was strong staining throughout the cell and th is pattern did not change with AngII treatment. In the RASM -DN cells however, prior to AngII treatment there was marked perinuclear staining and this was lost following AngII treatment.

PAGE 108

94 Collectively, the data further suggest that the loss of Jak2 within a cell, results in the AngII-dependent degradation of the IP3 receptor. RASM-DN RASM-WT -AngII +AngII A B D C B A RASM-DN RASM-WT -AngII +AngII A B D C B A Figure 5-6. The IP3 receptor is rapidly degraded following AngII treatment The Type 1 IP3 receptor was visualized using im munofluorescence. RASM-WT (A, B) and RASM-DN (C, D) cells were either left untreated or treated for 1 hour with AngII as indicated. Cells were vi sualized using an antibody specific for the Type 1 IP3 receptor. A FITC-conjugated 2 antibody was used to detect IP3 receptor (green) and the nuclei were c ounter stained with DAPI (blue). Images were collected using the Zeiss Axioplan 2 Fluorescence Microscope. Shown is one of three representative results. Printed with permission of publisher RASM-DN Cells Have a Reduction in Ang II-induced Calcium Mobilization When Compared to RASM-WT Cells If the expression of IP3 receptors were reduced in RA SM-DN cells, it could affect the intracellular calcium release from IP3-sensitive calcium stores. To test this hypothesis, we carried out intracellular calcium measurem ents using the calcium indicator fura-2. The ratio of emitted fura-2 fluorescence was used as an index of the increase in intracellular calcium concentration ([Ca2+]i). Figure 5-7A shows that a short time (3 min) exposure of extracellular AngII could induce a transient increase in [Ca2+]i in both RASM-WT and RASM-DN cells. However, the peak response of [Ca2+]i in RASM-DN

PAGE 109

95 cells was significantly reduced than that in RASM-WT cells. Figure 5-7B shows the comparisons of intracellular calcium respons e to 1nM AngII application (DN 27.4 1.1 % vs. WT 42.2 4.7 %; n = 5, respectively; P = 0.002) and to 10nM AngII application (DN 50.0 8.1 % vs. WT 95.8 20.9 %; n = 4, respectively; P = 0.007). These experiments indicate th at the release of Ca2+ from IP3-sensitive Ca2+ stores was affected in the RASM-DN cells. To further verify the role of Jak2 si gnaling pathway in AngII-induced calcium response, we examined RASM-WT cells that were pre-treated with the Jak2 inhibitor AG490 (100 M for 16 hours). Figure 5-7C shows th at the mean peak calcium response was significantly reduced in the AG490-tr eated cells (control 88.3 25.9 % vs. AG490 39.0 6.9 %; n = 3, respectively; P = 0.03). This observation is consistent with the Western blot data in Figu re 5-3 showing that AG490 causes a reduction in the IP3 receptor levels. Inhibition of Fyn tyrosine kina se Results in a Reduction of IP3 receptor Expression Fyn tyrosine kinase phosphorylates the IP3 receptor at Y353 in activated T-cells (Cui et al ., 2004). Furthermore, previous work from our group has shown that in response to AngII, Jak2 promot es Fyn activation (Sayeski et al ., 1999a). The effect of Fyn on IP3 receptor phosphorylation in response to AngII treatment in smooth muscle cells has not yet been determined. To inve stigate the role of Fyn in regulating IP3 receptor expression, RASM-WT cells were pretreated for 16 hours with 8 M of PP2, a Src tyrosine kinase family inhibitor, or PP3, an inactive analogue. Following the pretreatment, cells were treated with 100nM AngII for 0 or 4 hours. Whole cell lysates were then collected and Western blot anal ysis was performed using an antibody against

PAGE 110

96 the IP3 receptor (Fig 5-8, top). RASM-WT cells pr etreated with PP2 showed a dramatic decrease in IP3 receptor expression when compared to control cells. The membranes were subsequently stripped and re-blotted w ith an anti-STAT1 anti body to confirm equal loading amongst all lanes (Fig 5-8, bottom). A. B. 0 20 40 60 80 100 120 WT P = 0.007 (n=4) 10nMAngII DN DN WT P = 0.002 (n=5) 1nMAngIIChange of fluorescence ratio (%)0120240360480600 0.8 1.0 1.2 1.4 1.6 1.8 2.0 2.2 10 nM AngII Fluorescence ratioTime (sec) WT DN 0 20 40 60 80 100 120 P = 0.03 (n=3) 50nMAngII WT + AG490 WTChange of fluorescence ratio (%)C. A. B. 0 20 40 60 80 100 120 WT P = 0.007 (n=4) 10nMAngII DN DN WT P = 0.002 (n=5) 1nMAngIIChange of fluorescence ratio (%)0120240360480600 0.8 1.0 1.2 1.4 1.6 1.8 2.0 2.2 10 nM AngII Fluorescence ratioTime (sec) WT DN 0 20 40 60 80 100 120 P = 0.03 (n=3) 50nMAngII WT + AG490 WTChange of fluorescence ratio (%)C. 0 20 40 60 80 100 120 WT P = 0.007 (n=4) 10nMAngII DN DN WT P = 0.002 (n=5) 1nMAngIIChange of fluorescence ratio (%)0120240360480600 0.8 1.0 1.2 1.4 1.6 1.8 2.0 2.2 10 nM AngII Fluorescence ratioTime (sec) WT DN 0 20 40 60 80 100 120 P = 0.03 (n=3) 50nMAngII WT + AG490 WTChange of fluorescence ratio (%)C. Figure 5-7. Functional difference of RASM -WT and RASM-DN cells in response to AngII. A) Representative traces from RASM-WT (solid line) and RASM-DN (dashed line) cells show the difference of intracellular calcium response to 10 nM AngII application. Each trace represents an aver aged response of at least 5 cells. Bar indicates the dur ation (3 min) of AngII appl ication in the bath. B) Peak calcium responses of RASM-WT cells to 1 nM and 10 nM AngII are compared to the peak calcium responses of RASM-DN cells, respectively. C) Mean peak calcium response to AngII ( 50 nM) in WT cells pre-treated with Jak2 inhibitor AG490 (100 M) was significantly reduced. The number in parentheses represents the number of e xperiments carried out to determine the mean peak increase in calcium signaling and each experiment represents the response from at least 50 cells. Statis tical values are means SE from nonpaired t -test. Printed with permission of publisher

PAGE 111

97 These results suggest that Fyn contributes to IP3 receptor protein expression in wild type RASM cells, potentially through the phosphorylation of Y353 in the IP3 binding domain of the IP3 receptor. IP3RAngII-+ -+ PP2--+ + RASM-WT cells STAT1 172 IP3RAngII-+ -+ PP2--+ + RASM-WT cells STAT1 172 Figure 5-8. Inhibition of Fyn tyrosine kinase results in a reduction of IP3 receptor expression. RASM-WT cells were pretreated for 16 hours with 8 M of PP2. Following the incubation with PP2, cells were treated with 100nM of AngII. Lysates were collected and IP3 receptor expression was determined using an anti-IP3 receptor antibody. The membrane wa s subsequently stripped and reprobed using an anti-STAT1 antibody to confirm protein loading. Shown is one of three independent results. Printed with permission of publisher Discussion In this study we investig ated the role of Jak2 in re gulating the expression and function of the Type 1 IP3 receptor in response to treatm ent with AngII. Using RASM cells over-expressing a Jak2 dominant negative protein, we showed rapid AngII-mediated degradation of the IP3 receptor in cells lack ing a functional Jak2. In terestingly, this loss of IP3 receptor correlated to a reduction in AngII-induced calcium mobilization. These data therefore suggest th at when Jak2 is lacking from a cell, the IP3 receptor is targeted for proteasome-dependent degradation.

PAGE 112

98 RASM DN NOT ACTIVATED NOT ACTIVATED Increased IP3 Fyn Fyn Jak2 DN DN AT1R Absence of tyrosine phosphorylation increases IP3R degradation and reduces Ca2+mobilization ER IP3R RASM WT Jak2 Jak2 Fyn Fyn Tyrosine phosphorylation of Y353 Increased IP3AT1R Phosphorylation reduces IP3R degradation and maintains normal calcium signaling IP3R ER p Ca2+RASM DN NOT ACTIVATED NOT ACTIVATED Increased IP3 Fyn Fyn Jak2 DN DN AT1R Absence of tyrosine phosphorylation increases IP3R degradation and reduces Ca2+mobilization ER IP3R Increased IP3 Fyn Fyn Jak2 DN DN AT1R Absence of tyrosine phosphorylation increases IP3R degradation and reduces Ca2+mobilization ER IP3R RASM WT Jak2 Jak2 Fyn Fyn Tyrosine phosphorylation of Y353 Increased IP3AT1R Phosphorylation reduces IP3R degradation and maintains normal calcium signaling IP3R ER p Ca2+RASM WT Jak2 Jak2 Fyn Fyn Tyrosine phosphorylation of Y353 Increased IP3AT1R Phosphorylation reduces IP3R degradation and maintains normal calcium signaling IP3R ER p Ca2+ Ca2+ Figure 5-9. Proposed model for regulation of IP3 receptor via Jak2. In this model, RASM-WT cells (left) generate high concentrations of IP3 in response to AngII via heterotrimeric G-protei ns that are coupled to the AT1 receptor. In addition to IP3 generation, the AT1 receptor also activates Jak2. Jak2 in turn activates Fyn. Once activated, Fyn is able to phosphorylate the IP3 receptor. Conversely, in the RASM-DN cells (right), the AT1 receptor generates IP3, but fails to activate Jak2, and as a result, Fyn is not activated. We propose that the lack of IP3 receptor phosphorylation via Fyn ma ke the receptor vulnerable to proteosome-dependent degradation. Printed with permission of publisher Figure 5-9 illustrates our propos ed model for AngII-mediated IP3 receptor degradation in RASM cells. Briefly, prior data shows Jak2 is ab le to activate Fyn downstream of the AT1 receptor (Sayeski et al ., 1999a). Fyn in turn has been shown to phosphorylate the IP3 binding domain of the IP3 receptor in activated T cells (Cui et al ., 2004). To date, there has been no functiona l consequence of this phosphorylation in response to AngII treatment. He re, we hypothesize that when the IP3 receptor is phosphorylated by Fyn, possibly at Y353, it is protected from AngII-induced degradation.

PAGE 113

99 In the absence of Jak2, and therefore the absence of F yn activation, the IP3 receptor is unable to be phosphorylated and is theref ore vulnerable to proteasome-dependent degradation events follo wing AngII treatment. Previous microarray studies w ithin our lab identified the IP3 receptor as a potential target of Jak2 downstream signaling (Chapter 3). Quantitative RT-PCR analysis found that, following chronic stimulation with AngII, the gene expr ession profile of the IP3 receptor was different in ce lls that lack Jak2, versus cells that have functional Jak2. The increase in gene expression was signifi cantly higher in cells lacking a functional Jak2. Interestingly, this data directly conflicts with the analysis of IP3 receptor protein expression. Contrary to the increase in mRNA gene expression, our We stern blot data of RASM-DN protein lysates demonstr ate a dramatic decrease in IP3 receptor protein in response to AngII. We belie ve that the increase in IP3 receptor mRNA levels in the Jak2DN cells is a compensatory effect of the rapid degradation of the IP3 receptor protein. Once IP3 receptor protein has recovered to normal levels from the eff ects of AngII, we find that the mRNA expression also return to normal levels. Therefore, we do not believe that Jak2 is having a direct tr anscriptional effect on the IP3 receptor gene. Instead, we believe that Jak2 is mediating the IP3 receptor at the protein level through signaling events within the cytosol, such as the activation of Fyn. Reduced IP3 receptor expression in a cell can correlate to decreases in intracellular calcium mobilizati on. When analyzed for their ability to mobilize calcium, the RASM-DN cells clearly demonstrated a significant reduction in calcium signaling when compared to RASM-WT control cells. Ev en WT cells treated with a Jak2 inhibitor demonstrated a significant decline in A ngII-inducible calcium signaling, thereby

PAGE 114

100 strengthening the critical role Jak2 has in the regulation of IP3 receptor expression, and subsequently, calcium mobilization. Our data summarized in Figure 2 through Figure 6 suggest that cells lacking a functional Jak2 undergo degradation of the IP3 receptor following 1 or 4 hours of AngII treatment. Given our data, we hypothesized that the loss of the IP3 receptor would contribute to a reduction in A ngII-induced calcium signaling. Notably, the cells used in the calcium studies were not pre-treated with AngII for 1 or 4 hours prior to calcium measurements. However, it was not surprising to see a significant difference in calcium handling between the DN and WT cells at baseli ne (i.e., prior to AngII treatment). As shown in Figure 2A and Figure 6, ther e are significantly less amounts of IP3 receptor expressed in the RASM-DN cells prior to any tr eatments with AngII. In addition, Figure 8 shows that when RASM-WT cells are pre-trea ted with PP2, there is a dramatic decrease in IP3 receptor expression, and again this decrea se is prior to AngII treatment. These figures collectively support that there is a reduction of IP3 receptor expression, and thereby calcium signaling, in cells lacking a functional Jak2 (or Fyn) prior to AngIImediated degradation of th e receptor. Due to rapid desensitization of the AT1 receptor, it was difficult to visualize calcium signaling following pre-treatment of AngII for 1 or 4 hours. However, we hypothesize that if we were able disregard the AT1 receptor desensitization and perform calcium measurem ents following AngII treatment for 1 and 4 hours, there would be an even larger difference between RASM-WT and RASM-DN cells. Furthermore, we believe this increas ed difference in calcium handling could be attributed to the degradation of the IP3 receptor in the DN cells.

PAGE 115

101 While the involvement of AngII in cardiovascular disease has been well established, the role of Jak2 in cardiovascular pathology is an ongoing area of research. Numerous examples within the literature have found coinciding roles of the reninangiotensin system and Jak2 activation. For example, Jak2 is activated in response to balloon injury of rat carotid ar teries. This activation of the JAK/STAT signaling cascade leads to increased neointima formation as a result of vascular smooth muscle cell proliferation (Seki et al ., 2000; Shibata et al ., 2003). Additionally, Jak2 is activated in response to both mechanical stretch and acute pressure overload being partially mediated through an AngII-dependent mechanism (Pan et al ., 1997, 1999). Given the numerous examples demonstrating the overlap of Jak2 and AngII in the progression of vascular disease states, we feel it is advantageous to identify the downstream targets of Jak2 via the AT1 receptor. This study highlights one such downstream target of Jak2, the IP3 receptor. Elucidating the precise role of Jak2 in regulating the IP3 receptor in response to AngII may contribute to determ ining the role of Jak2 in the progression of some vascular pathologies.

PAGE 116

102 CHAPTER 6 CONCLUSIONS AND IMPLICATIONS The data presented in this disserta tion investigated the downstream signaling effects of Jak2 tyrosine kinase. This work is significant for a number of reasons. First, we examined the effects of Jak2 expression in cells, independent of its activation via an exogenous ligand. The data suggest that Jak2 has a large regulatory role in a cell that is outside of the traditional ligand-act ivated signaling paradigm (Wallace et al., 2004). Second, we investigated the downstream targets of Jak2 activation via the AT1 receptor. The data provide insight into the specific Jak2-dependent signali ng cascades that are initiated in response to AngII treatment. Thir d, we investigated the specific regulation of sgk1 in response to AngII. The da ta suggest that AngII induces sgk1 expression through a Jak2-dependent mechanism. Lastly, we inves tigated the role of Jak2 in the regulation of IP3 receptor expression and function. Specifica lly, the data suggest that Jak2 protects the IP3 receptor from AngII-mediated degradation (Wallace et al., 2005). A more detailed and intricate discussi on about the specific implications of the data presented within this di ssertation is di scussed below. Ligand-Independent Activation of Jak2 Previously, Jak2 was thought to have a very one-dimensional role within the cell. It was believed to reside inertly within the cytoplasm and/or associated with its respective cell surface receptors (Frank et al., 1994; Ali et al., 1997; Sayeski et al., 2001). Initial biochemical and cellular studies suggested th at only when Jak2 was activated by ligandbinding, could it propagate the Jak/STAT signa ling cascade to the nucleus, resulting in

PAGE 117

103 transcriptional re gulation (Witthuhn et al., 1993; Argetsinger et al., 1993; Rui et al., 1994; Narazaki et al., 1994; Marrero et al., 1995). However, the one-dimensional view of Jak2 activation is beginning to be re-eva luated. Recent studies have suggested the existence of at least two distinct catalytic states of Jak2 (Chatti et al., 2004). Currently, however, no functional consequence has been attributed to these different activation levels. Here, using gene-profiling technology we explored the hypot hesis that Jak2 may in fact have varying degrees of catalytic activation and that these activation levels result in significant changes in gene transcripti on. The microarray experiments detailed in Chapter 2 identified a large numbe r of genes that were differe ntially expressed by Jak2 in the absence of exogenous ligand treatment. Th ese data thereby indi cate the important cellular consequence Jak2 has in it s basal level of activation. In conclusion, the ability of Jak2 to re gulate gene expression through basal level activation is a paradigm shift from previous schools of thought. The data presented in Chapter 2 suggest that the role of Jak2 deviates from the accepted presumption that it functions in a solely ligand-act ivated system, turned on and off as distinctly as one turns on and off a light switch. Inst ead the data presented here, as well as work from others, suggest that Jak2 functions more dynamically via its various catalytic activation states. The cartoon in Figure 6-1 illustrates this poi nt graphically. The switch on the left illustrates the simple binary toggle between “on and off” while the switch on the right illustrates the potentially more dynamic range of Jak2 activation consistent with that seen using a dimmer switch. Overall, while the cartoon is simplistic in nature, it is used to illustrate the point that Jak2 appears to regulate gene transcription much more complexly than previously thought.

PAGE 118

104 OFF OFF OFF ON ON ON Ligandactivated No Ligand (Ligandactivated) ON ON ON OFF OFF OFF Basal Activity Basal Activity Basal Activity . . . No ligand(Kinase Dead Mutant) OFF OFF OFF ON ON ON Ligandactivated No Ligand (Ligandactivated) ON ON ON OFF OFF OFF Basal Activity Basal Activity Basal Activity . . . No ligand(Kinase Dead Mutant) Figure 6-1. Comparison between previous a nd current signaling paradigms of Jak2. The switch on the left depicts the simple ON/OFF model of ligan d-dependent gene transcription. In the absence of ligand, Jak2 is catalytically inactive and thereby is unable to mediate gene tran scription. Conversely, in the presence of ligand, Jak2 becomes catal ytically active and dem onstrates a corresponding increase in gene transcription. The switch on the right depicts a model whereby the multiple catalytic states of Jak2 correspond to different levels of gene transcription. The OFF position is re presentative of a Jak2 that is kinase dead (i.e. Jak2-K882E mutant) and corre sponds to a complete lack of gene transcription. The BASAL ACTIVITY position is representative of Jak2 being a low efficiency tyrosine kinase (i.e. unphosphorylated Y1007). In this state, there is a basal level of gene transcription occurring. The ON position is representative of fully activated Jak2 as that seen with ligand treatment (i.e. phosphorylated Y1007). In this state, gene expression levels are maximally turned ON. Transcriptional Roles of Jak2 in Re sponse to Angiotensin II Signaling The work presented in Chapter 3 used ge ne-profiling technology to investigate the effects of Jak2 activation via the AT1 receptor. The data confirms that Jak2 is an important mediator of AngII-induced gene tr anscription. This is evidenced by the large number of Jak2-dependent genes that were identified by the microa rray experiments. A number of implications can be conc luded from these experiments. First, this work did not merely identify genomic targets of Jak2, as was the original intent. Rather, this work al so provided novel insight into the non-transcriptional effects

PAGE 119

105 Jak2 has within a cell. As discussed previ ously, the microarray experiments identified Jak2-dependent genes following 1 and 4 hours of AngII treatment. The data revealed a dramatic difference in the number of genes that were identified between the two time points. Namely, the 1-hour time point identifie d much fewer genes. We hypothesize that a majority of the genes identified after the 4-hours of AngII treatment may be secondary and tertiary response genes. This hypothesis is strengthene d by the analysis of specific genes identified by the microarray experiments. For our studies, we chose one gene from the 1-hour time point and one gene from th e 4-hour time point for further analysis. ( sgk1 and IP3 receptor, respectively). Ou r data suggests that Jak2 is directly regulating sgk1 transcription after 1 hour of AngII treatment and is indirectly effecting IP3 receptor transcription after 4 hours of A ngII treatment. Therefore, we conclude that after 1hour of AngII treatment the microarray data provide a reliable source of di rect transcriptional targets of Jak2. Conversely, the experiment s identifying Jak2-dependent genes after 4 hours of AngII treatment are a co mpilation of both direct and indirect gene targets. These experiments therefore provide insight on the functional consequences Jak2 has that are independent of regulating gene expression. Next, identification of novel targets of Jak2 may contribute in understanding the role Jak2 has in cardiovascular diseases. Fo r example, glutathione peroxidase-1 (GPx-1) was identified as being down regulated by 3.5-fo ld in cells that express Jak2 following 1hour of AngII treatment. GPx-1 is an antioxi dant that is importan t for protecting cells against oxidative damage. Recently, studies have identified GPx-1 as a biomarker for cardiovascular disease risk. These studies showed that patients with reduced GPx-1 activity demonstrate a significant increas e in cardiovascular risk (Schnabel et al., 2005).

PAGE 120

106 Further studies have implicated a role for GPx-1 in ischemia-reperfusion injury (Toufektsian et al., 2000; Venardos et al., 2004; Venardos et al., 2005). Specifically, when GPx-1 is down regulated, recovery from ischemia-reperfusion injury is impaired. Interestingly, Jak2 activation has also been associated with cardiac injury during ischemia-reperfusion (Mascareno et al., 2001). In vivo studies show that treatment with AG490, an inhibitor for Jak2, leads to a reduction in cardiac infarct size and a corresponding reduction in a poptosis of cardiomyocytes fo llowing ischemia-reperfusion injury. Nonetheless, despite the eviden ce supporting Jak2’s activation in response to ischemia/reperfusion, there remains no elucid ation of the functiona l significance of the activation. Additional studies are necessary to determine the specific relationship between Jak2 and GPx-1, but we hypothe size that Jak2 activation via the AT1 receptor results in the transcriptional down-regulati on of GPx-1. This down-regulation may play an important role in the detrimental effects a ssociated with ischemia reperfusion injury. In conclusion, we believe that further studies investigating the targ et genes of Jak2 may elucidate the role Jak2 has in AngII-induced pathologies. AngII Induces sgk1 Transcription In addition to suggesting a novel role for Jak2 in regulating sgk1 transcription, these data suggest, for the first time, that AngII is directly inducing sgk1 transcription independent of aldosterone production. Our data specifically suggests that AngII is activating a Jak/STAT pathway to regulate sgk1 transcription in human fibroblast cells. While these studies investigated the signaling cascades that cause AngIImediated sgk1 induction, the functional consequences of sgk1 induction remain to be investigated. We hypothesize that th e consequences of AngII-mediated sgk1 induction in fibroblast cells are separate from the we ll-defined roles of aldosterone-mediated sgk1

PAGE 121

107 induction in the kidney. This hypothesis is based upon the dramatic phenotype of the mineralcorticoid receptor (M R) knockout mouse (Berger et al., 1998). As expected, MR knockout mice demonstrate severe pseudohypoaldosteronism. This is a condition characterized by severe loss of Na+ despite evidence of hyponatremia, hyperkalemia, hyperreninemia, and elevated aldosterone levels (Rosler et al., 1973). The aldosterone resistance in these animals is so severe th e mice die within 2 weeks of birth from the effects of sodium wasting (Berger et al., 1998). There is no evidence detailing any significant functions of aldoste rone outside of its transcri ptional actions and, to date, there are few other genomic target s of aldosterone in addition to sgk1 Therefore, it is probable that the sodium wasting in the MR knockout mice is so severe because there are no additional activators of sgk1 transcription that are sufficient to compensate for the loss of aldosterone action. As such, we believe that the effects of AngII on sgk1 induction are distinct from the effects of aldosterone. Recent studies have investigated a numb er of potential physio logical roles for SGK1, including its effects on re gulating apoptosis and its co ntribution in the progression of fibrosing diseases. In addition to Nedd4-2, SGK1 phos phorylates several other proteins. The identification of SGK1 substrates was facilitated by its similarity to the anti-apoptotic protein, protein kinase B (PKB). The catalyt ic domain of SGK1 is 54% identical to that of PKB and studies have identified both protein kinases can phosphorylate similar substrates (K obayashi and Cohen, 1999; Park et al., 1999). For example, similar to PKB, SGK1 phosphorylat es members of the Forkhead Family of transcription factors, termed FKHR, FKHRL1, and AFX (Brunet et al., 2001). Phosphorylation of these transc ription factors inhibits the transcription of apoptotic

PAGE 122

108 signals, and thereby promotes cel l survival. The role of SGK1 in apoptosis was further confirmed by studies that showed a significan t decrease in apoptosis when SGK1 is overexpressed in cells. Furthermore, overexpres sion of a catalytically inactive mutant of SGK1 caused a significant incr ease in apoptosis (Mikosz et al., 2001). Thus, we believe that since AngII can promote cell survival through activation of PKB signaling, it may be having similar effects on cell survival through its activation of SGK1. In addition to its modulation of apoptos is, we hypothesize that SGK1 may be contributing to the progression of various fibr osing diseases. While the precise roles of SGK1 remain to be determined, studies ha ve identified significant increases in SGK1 transcription in various pathologies su ch as diabetic ne phropathy (Hoffman et al., 1998; Kumar et al., 2000; Lang et al., 2000; Waldegger et al., 1999) and fibrosing pancreatitis (Waldegger et al., 1997). While further investigations are requi red to confirm, we suggest that AngII-induced activatio n of SGK1 may be a contributor of these pathologies. In conclusion, sgk1 is an appealing candidate fo r blood pressure regulation and possibility plays a role in essential h ypertension (Busjahn et al., 2002). Therefore, understanding the mechanisms for AngII-mediated sgk1 induction may have therapeutic merit in the future. Jak2 Regulates AngII-mediated IP3 receptor Degradation The studies presented in Chapter 5 investig ated the role of Ja k2 in regulating the expression and function of the IP3 receptor in smooth muscle cells. Understanding the precise role of Jak2 in regulating intracellular Ca2+ levels may elucidat e its contributions to the progression of various cardiovascular pathologies. The precise regulation of intracellular Ca2+ is critical for normal vascular smooth muscle (VSM) function (Santella 1998). VSM cells are a no n-proliferating, contractile

PAGE 123

109 cell type under normal conditions. However, following vascular insu lts such as balloon injury, VSM cells adopt a highly prolifer ative, non-contractile phenotype (Thyberg et al., 1995; Shanahan et al., 1998). This switch in phenotype often exacerbates preexisting pathologies. Currently, the mechanisms i nvolved in regulating the phenotype of the VSM cells are unclear. However, it appears that the initiating signal for the phenotype switch is dependent upon passage through a numbe r of cell cycle checkpoints. These cell cycle events require specific changes in cytosolic Ca2+ concentrations (Ghosh et al., 1991; Short et al., 1993; Waldron et al., 1994). Recent studies hypothesized that an alteration in intracellular Ca2+ signaling is the initiator for VSM cells to enter the cell cycle and begin proliferation (Wilkerson et al., 2005). Specifically, th e data suggests that an increase in IP3 receptor-mediated-Ca2+release is a requiremen t for VSM proliferation. Thus, increased IP3 receptor expression and function may be critical regulators for pathologies associated with VSM cell proliferation, such as neointimal formation. The data presented in Chapter 5 support pr evious studies that suggest a role for IP3 receptor in contributing to cardiovascular pat hologies that result from abnormal VSM cell function. Our data suggest that upon ac tivation by AngII, Jak2 prevents IP3 receptor degradation and leads to increases in cytosolic Ca2+ signaling. These increases in intracellular Ca2+ concentration may be a contributing factor to the proliferation of VSM cells. Therefore, we believe that Jak2 is regulating cytosolic Ca2+ levels and thereby contributing to the proliferation of VSM cells. These data may contribute to the elucidation of Jak2’s role in neointimal formation. In conclusion, the summation of the data presented within this dissertation elucidates the downstream signaling mechanisms of Jak2 within a cell. Specifically, the

PAGE 124

110 data provides insight into the roles of Jak2 in contributing to AngII-induced pathologies both inside and outside the classi cal Jak/STAT signaling paradigm.

PAGE 125

111 APPENDIX A JAK2-DEPENDENT GENES Accession Number 1st Exp. 2nd Exp. Average Induction Gene Name W25845 -78.4 -78.1 -78.25 13h9 W26787 -39.2 -25.3 -32.25 15d8 W27474 -23.7 -21.3 -22.5 31d8 W28170 -22.5 -17.3 -19.9 43a12 AI701156 -16.7 -13.7 -15.2 we10f09.x1 Homo sapiens cDNA, 3 M57763 -9.9 -4.2 -7.05 ADP-ribosylation factor (hARF6) W27997 -7.5 -8.1 -7.8 43 e3 L07648 -7.5 -6.3 -6.9 MXI1 AF035119 -7.2 -4.7 -5.95 Deleted in liver cancer-1 (DLC-1) AA890010 -6.8 -4.2 -5.5 aj89h08.s1 W27761 -5.7 -6 -5.85 37c5 AJ000644 -5.7 -3.4 -4.55 SPOP W29031 -5.6 -5.7 -5.65 55c6 AW043812 -5.6 -4.9 -5.25 wy81b07.x1 Homo sapiens cDNA, 3 AL009266 -5.5 -3.3 -4.4 Similar to C. elegans RNA binding protein AF065389 -5.1 -5.3 -5.2 Tetraspan NET-4 L07648 -5.1 -5 -5.05 MXI1 AA630312 -4.9 -3.8 -4.35 ac08f05.s1 W28483 -4.9 -2.5 -3.7 47e 11 AF079221 -4.8 -4 -4.4 BCL2/adenovirus E1B 19kDa-interacting protein 3a U59305 -4.8 -2.5 -3.65 Ser-thr protein kinase PK428 D11151 -4.7 -3.8 -4.25 Endothelin-A receptor, exon 8 and 3 flanking region AB004848 -4.6 -6.1 -5.35 Placenta mRNA AF117829 -4.6 -4.5 -4.55 8q21.3RICK gene D50840 -4.6 -2.6 -3.6 ceramide glucosyltransferase W28740 -4.4 -9.1 -6.75 51a5 L06797 -4.4 -4.3 -4.35 Orphan G protein-coupled receptor mRNA U54804 -4.4 -3.8 -4.1 Has2 AB023137 -4.3 -2.9 -3.6 KIAA0920 protein U00943 -4.2 -4 -4.1 A9A2BRB2 (CAC)n/(GTG)n repeat-containing mRNA Y08262 -4.1 -4.3 -4.2 SCA2 protein W27998 -4.1 -4.2 -4.15 43e 5 D50310 -4.1 -3.7 -3.9 Cyclin I L41827 -4.1 -3.6 -3.85 Sensory and motor neuron derived factor (SMDF) U92715 -4.1 -3.1 -3.6 Breast cancer antiestrogen re sistance 3 protein (BCAR3) AF052143 -3.9 -3.6 -3.75 Clone 24466 D26070 -3.9 -3.3 -3.6 Type 1 inositol 1,4,5-trisphosphate receptor

PAGE 126

112 AB002297 -3.8 -4.2 -4 KIAA0299 gene -3.8 -3.9 -3.85 Glial Growth Factor 2 X87949 -3.8 -2 -2.9 BiP protein AF070670 -3.7 -4 -3.85 Protein phosphatase 2C alpha 2 M64349 -3.6 -4.8 -4.2 Cyclin D (cyclin D1) M23263 -3.5 -3.7 -3.6 Androgen receptor AL096752 -3.5 -2.4 -2.95 DKFZp434A012 (from clone DKFZp434A012) AF047438 -3.5 -2.2 -2.85 GOS28/P28 protein W28479 -3.4 -5.4 -4.4 47d8 U48807 -3.4 -3.5 -3.45 MAP kinase phosphatase (MKP-2) M14333 -3.4 -3.3 -3.35 c-syn protooncogene D28118 -3.4 -2.3 -2.85 DB1 D49489 -3.4 -2.3 -2.85 Protein disulfide isomerase-related protein P5 X92098 -3.3 -2.3 -2.8 Transmembrane protein rnp24 U50648 -3.3 -2.2 -2.75 Interferon-inducible RNA-dependent protein kinase (Pkr) M97252 -3.2 -4.2 -3.7 Kallmann syndrome (KAL) AB016789 -3.2 -3.2 -3.2 Glutamine-fructose-6-phos phate amidotransferase U37407 -3.2 -3.1 -3.15 Phosphoprotein CtBP D28118 -3.2 -3 -3.1 DB1 U09510 -3.2 -2.6 -2.9 Glycyl-tRNA synthetase M31166 -3.2 -2.5 -2.85 Tumor necrosis factor-inducible (TSG-14) U43286 -3.2 -2.1 -2.65 Selenophosphate synthetase 2 (SPS2) X78947 -3.1 -3.2 -3.15 connective tissue grow th factor AC004380 -3.1 -3.2 -3.15 Chromosome 16 BAC clone L20859 -3.1 -2.5 -2.8 Leukemia virus receptor 1 (GLVR1) AF016266 -3.1 -2.4 -2.75 TRAIL receptor 2 U43142 -3.1 -2.2 -2.65 Vascular endothelial growth factor protein VRP U09510 -3.1 -2.1 -2.6 Glycyl-tRNA synthetase U83246 -3 -3.3 -3.15 Copine I D87953 -3 -2.9 -2.95 RTP U01062 -3 -2.2 -2.6 Type 3 inositol 1,4,5-trisphosphate receptor Z50022 -3 -2 -2.5 Surface glycoprotein AI097085 -2.9 -3.4 -3.15 oz22c10.x1 D26362 -2.9 -3.2 -3.05 KIAA0043 gene AB012130 -2.9 -2.9 -2.9 Sodium bicarbonate cotransporter2 M81601 -2.9 -2.4 -2.65 Transcription elongation factor (SII) M55630 -2.9 -2.3 -2.6 Topoisomerase I pseudogene 2 D87077 -2.8 -3.6 -3.2 KIAA0240 gene L37043 -2.8 -3.1 -2.95 Casein kinase I epsilon AB014888 -2.8 -3 -2.9 MRJ M23379 -2.8 -2.8 -2.8 GTPase-activating protein ras p21 (RASA) AA996066 -2.8 -2.3 -2.55 os33d01.s1 M13509 -2.8 -2.2 -2.5 Skin collagenase mRNA AF032886 -2.8 -2.1 -2.45 Forkhead protein (FKHRL1) AB018301 -2.7 -4.9 -3.8 KIAA0758 protein AI742087 -2.7 -3 -2.85 wg38g10.x1 AL050164 -2.7 -2.8 -2.75 DKFZp586C1622 (from clone DKFZp586C1622)

PAGE 127

113 AB018259 -2.7 -2.5 -2.6 KIAA0716 protein AF014837 -2.7 -2.3 -2.5 m6A methyltransferase (MT-A70) M24069 -2.7 -2 -2.35 DNA-binding protein A (dbpA) AF038966 -2.6 -2.8 -2.7 Secretory carrier-associated membrane protein (SCAMP) AL050006 -2.6 -2.6 -2.6 DKFZp564A033 (from clone DKFZp564A033) AI052724 -2.6 -2.5 -2.55 oz27a12.x1 AL049954 -2.6 -2.2 -2.4 DKFZp564A1523 (from clone DKFZp564A1523) X63679 -2.6 -2.2 -2.4 TRAMP protein M60278 -2.6 -2.2 -2.4 Heparin-binding EGF-like growth factor D50683 -2.6 -2.1 -2.35 TGF-betaIIR alpha L10284 -2.6 -2.1 -2.35 Integral membrane protein, calnexin, (IP90) Y00970 -2.6 -2 -2.3 Acrosin L06845 -2.6 -2 -2.3 Cysteinyl-tRNA synthetase mRNA AF002697 -2.5 -2.8 -2.65 E1B 19K/Bcl-2-binding protein Nip3 mRNA AI028290 -2.5 -2.7 -2.6 ov84f11.x1 AA133246 -2.5 -2.4 -2.45 zl17h10.r1 AL049957 -2.5 -2.3 -2.4 DKFZp564J0323 (from clone DKFZp564J0323) U60061 -2.5 -2.2 -2.35 FEZ2 W28616 -2.4 -5.1 -3.75 49b9 X55005 -2.4 -4.6 -3.5 Thyroid hormone receptor alph a 1 THRA1(c-erbA-1 gene) AL031290 -2.4 -3.1 -2.75 DNA sequence from clone 774I24 chr. 1q24.1-24.3 X02747 -2.4 -2.8 -2.6 Aldolase B AB011104 -2.4 -2.7 -2.55 KIAA0532 protein D26070 -2.4 -2.5 -2.45 1 inositol 1,4,5-trisphosphate receptor L07956 -2.4 -2.4 -2.4 1,4-alpha-glucan branching enzyme (HGBE) AF070606 -2.4 -2.4 -2.4 Clone 24411 AB018294 -2.4 -2.3 -2.35 KIAA0751 protein L13773 -2.4 -2.3 -2.35 AF-4 AF039656 -2.4 -2.2 -2.3 Neuronal tissue-enriched acidic protein AF070616 -2.4 -2.1 -2.25 Clone 24772 BDP-1 protein AL050021 -2.4 -2.1 -2.25 DKFZp564D016 (from clone DKFZp564D016) U50523 -2.4 -2 -2.2 BRCA2 AB002803 -2.4 -2 -2.2 BACH1 Z29064 -2.4 -2 -2.2 AF-1p AB011155 -2.4 -2 -2.2 KIAA0583 protein AB005293 -2.3 -4.1 -3.2 Perilipin AI743133 -2.3 -2.6 -2.45 wg87f07.x1 AI808712 -2.3 -2.4 -2.35 wf57c05.x1 AL050091 -2.3 -2.4 -2.35 DKFZp586F1918 (from clone DKFZp586F1918) AF039945 -2.3 -2.2 -2.25 Synaptojanin 2B mRNA AF038187 -2.3 -2.2 -2.25 clone 23714 L05424 -2.3 -2.1 -2.2 Cell surface glycoprotein CD44 (CD44) AI743507 -2.3 -2.1 -2.2 wf72a06.x2 AB015051 -2.3 -2.1 -2.2 Daxx D31887 -2.3 -2 -2.15 KIAA0062 gene D86425 -2.3 -2 -2.15 Osteonidogen L16895 -2.2 -2.6 -2.4 Lysyl oxidase (LOX) gene

PAGE 128

114 AB007900 -2.2 -2.6 -2.4 KIAA0440 D50919 -2.2 -2.3 -2.25 KIAA0129 gene AI732885 -2.2 -2.3 -2.25 oe64d04.x5 AI365215 -2.2 -2.2 -2.2 qz41a06.x1 U07806 -2.2 -2.1 -2.15 Camptothecin resistant CEM/ C2 DNA topoisomerase I AJ131245 -2.2 -2 -2.1 Sec24 protein (Sec24B isoform) Z78388 -2.1 -2.1 -2.1 HSZ78388 -2.1 -2 -2.05 Oncogene E6-Ap, Papillomavirus S78771 -2.1 -2 -2.05 CpG island-associated gene U17999 -2.1 -2 -2.05 HSU17999 W28760 -2 -3.7 -2.85 W28760:51c8 X78565 -2 -2.5 -2.25 Tenascin-C N 90755 -2 -2.4 -2.2 zb22c08.s1 M93284 -2 -2.1 -2.05 Pancreatic lipase related protein 2 (PLRP2) M23114 -2 -2 -2 Calcium-ATPase (HK1) D17517 2 2 2 Sky X71973 2 2 2 Phospholipid hydroperoxide glutathione peroxidase U49278 2 2 2 UEV-1 (UBE2V) AF061034 2 2 2 FIP2 alternativel y translated M26683 2 2 2 Interferon gamma treat ment inducible 2 2.1 2.05 Rad2 AI547262 2 2.1 2.05 PN001_AH_H03.r U72514 2 2.1 2.05 C2f AI655015 2 2.1 2.05 wb66a10.x1 AJ245416 2 2.1 2.05 G7b protein M19267 2 2.2 2.1 Tropomyosin AB000449 2 2.2 2.1 VRK1 AL035398 2 2.3 2.15 DNA sequence from clone 796I17 on chr. 22q13.2. M80261 2 2.4 2.2 Apurinic endonuclease (APE) AA926959 2 2.4 2.2 om68h08.s1 L07493 2 2.5 2.25 Replication protein A 14kDa subunit (RPA) U73379 2 2.6 2.3 Cyclin-selective ubiquitin carrier protein AB006624 2 2.6 2.3 KIAA0286 gene U50939 2 2.7 2.35 Amyloid precursor protein-binding protein 1 Y09008 2 2.7 2.35 Uracil-DNA glycosylase AI032612 2 2.7 2.35 ow17e07.x1 AF023462 2 2.9 2.45 Peroxisomal phytanoyl-CoA alpha-hydroxylase (PAHX) N 98670 2 2.9 2.45 yy66d08.r1 AI541308 2 3.1 2.55 pec1.2-4.F11.r AL050050 2 2.5 2.25 DKFZp566D133 (from clone DKFZp566D133) J05448 2.1 2 2.05 RNA polymerase subunit hRPB 33 M69023 2.1 2 2.05 Globin gene L08069 2.1 2 2.05 Heat shock protein, E. coli DnaJ homologue AL120687 2.1 2 2.05 Follistatin-related protein (FRP) D45906 2.1 2.1 2.1 LIMK-2 W28498 2.1 2.1 2.1 W28498:50e2 L07540 2.1 2.1 2.1 Replication factor C, 36-kDa subunit

PAGE 129

115 AF011468 2.1 2.2 2.15 Serine/threonine kinase (BTAK) AF067656 2.1 2.2 2.15 ZW10 interactor Zwint U04209 2.1 2.2 2.15 Associated microfibrillar protein AB011131 2.1 2.2 2.15 KIAA0559 protein U19142 2.1 2.3 2.2 GAGE-1 protein AF067139 2.1 2.3 2.2 NADH-ubiquinone oxidoreductase NDUFS3 subunit D42073 2.1 2.3 2.2 Reticulocalbin AA524058 2.1 2.4 2.25 ng33b12.s1 L03532 2.1 2.5 2.3 M4 protein AI740522 2.1 2.5 2.3 wg16b07.x1 U52112 2.1 2.6 2.35 N-acetyl transferase related protein AF035555 2.1 2.6 2.35 Short chain L-3-hydroxyacyl-CoA dehydrogenase D38076 2.1 2.6 2.35 RanBP1 (Ran-binding protein 1) X06956 2.1 2.9 2.5 HALPHA44 gene for alpha-tubulin U51007 2.1 3.1 2.6 26S protease subunit S5a U03911 2.1 3.2 2.65 Mutator gene (hMSH2) D14697 2.1 3.3 2.7 KIAA0003 gene AA121509 2.1 4.2 3.15 zk88c10.s1 Z69043 2.1 4.3 3.2 Translocon-associated protein delta subunit precursor D50929 2.1 2.3 2.2 KIAA0139 gene AL080088 2.1 2.4 2.25 DKFZp564K2062 (from clone DKFZp564K2062) U20979 2.2 2.1 2.15 Chromatin assembly factor-I p150 subunit AF046798 2.2 2.1 2.15 untitled D80006: 2.2 2.1 2.15 KIAA0184 U92538 2.2 2.1 2.15 Origin recognition complex subunit 5 homolog (Orc5) D26598 2.2 2.2 2.2 Proteasome subunit HsC10-II U18934 2.2 2.2 2.2 Receptor tyrosine kinase (DTK) D79987 2.2 2.2 2.2 KIAA0165 gene L47276 2.2 2.2 2.2 Alpha topoisomerase truncated-form D23662 2.2 2.3 2.25 Ubiquitin-like protein U10860 2.2 2.3 2.25 Guanosine 5-monophosphate synthase L08069 2.2 2.4 2.3 Heat shock protein, E. coli DnaJ homologue Y07846 2.2 2.4 2.3 GAR22 protein D10656 2.2 2.4 2.3 CRK-II AL049365 2.2 2.5 2.35 DKFZp586A0618 (from clone DKFZp586A0618) AC004770 2.2 2.5 2.35 Chromosome 11, BAC CIT-HSP-311e8 (BC269730) D28364 2.2 2.5 2.35 Annexin II, 5 UTR (sequence from 5 cap to start codon) R38263 2.2 2.6 2.4 yc92c11.s1 AL031228 2.2 2.7 2.45 WD40 protein BING4 D11094 2.2 2.7 2.45 MSS1 AA733050 2.2 2.7 2.45 zg79b05.s1 AI345944 2.2 2.8 2.5 Cqp47e09.x1 AA447559 2.2 3 2.6 zw81e11.s1 U61145 2.2 3 2.6 Enhancer of zeste homolog 2 (EZH2) AA570193 2.2 3.3 2.75 nf38c11.s1 X59268 2.2 3.5 2.85 General transcription factor IIB AB028069 2.2 3.6 2.9 Activator of S phase Kinase

PAGE 130

116 AB007893 2.2 2.2 2.2 KIAA0433 mRNA AF030186 2.2 2.4 2.3 Glypican-4 (GPC4) AB007891 2.2 2.4 2.3 KIAA0431 mRNA D89937 2.3 2 2.15 KIAA0116 gene X97548 2.3 2 2.15 TIF1beta zinc finger protein U09759 2.3 2 2.15 Protein kinase (JNK2) H10201 2.3 2.1 2.2 ym02c07.s1 AB023421 2.3 2.1 2.2 Heat shock protein apg-1 D49738 2.3 2.2 2.25 Cytoskeleton associated protein (CG22) AI827793 2.3 2.2 2.25 wf33b11.x1 D14812 2.3 2.2 2.25 KIAA0026 gene U87459 2.3 2.3 2.3 Autoimmunogenic cancer/testis antigen NY-ESO-1 J03824 2.3 2.3 2.3 Uroporphyrinogen III synthase AL050282 2.3 2.5 2.4 DKFZp586H2219 (from clone DKFZp586H2219) U78027 2.3 2.6 2.45 Brutons tyrosine kinase (BTK), a AL050353 2.3 2.7 2.5 DKFZp547C0410 (from clone DKFZp547C0410) X81789 2.3 2.8 2.55 Splicing factor SF3a60 U61837 2.3 2.8 2.55 Putative cyclin G1 interacting protein AF035940 2.3 2.8 2.55 MAGOH M34079 2.3 2.8 2.55 Immunodeficiency virus tat transactivator binding protein-1 L13848 2.3 3.1 2.7 RNA helicase A AA527880 2.3 3.8 3.05 nh86h10.s1 AF047470 2.3 4.9 3.6 Malate dehydrogenase precursor (MDH) AF048731 2.3 2.6 2.45 Cyclin T2a AF065485 2.3 2.9 2.6 Sorting nexin 4 W25866 2.4 2 2.2 14c12 U88871 2.4 2 2.2 HsPex7p (HsPEX7) U33632: 2.4 2.1 2.25 Two P-domain K+ channel TWIK-1 AA628946 2.4 2.1 2.25 af28f05.s1 AF070559 2.4 2.1 2.25 Clone 24463 X90999 2.4 2.2 2.3 Glyoxalase II X70944 2.4 2.2 2.3 PTB-associated splicing factor S68271 2.4 2.3 2.35 Cyclic AMP-responsive element modulator L24804 2.4 2.4 2.4 (p23) AI525633 2.4 2.4 2.4 PT1.3_04_A08.r AF070537 2.4 2.4 2.4 Clone 24606 U01923 2.4 2.5 2.45 BTK region clone ftp-3 D16581 2.4 2.7 2.55 8-oxo-dGTPase U58087 2.4 2.7 2.55 Hs-cul-1 mRNA D00760 2.4 3.1 2.75 Proteasome subunit HC3 Z84718 2.4 3.1 2.75 DNA sequence from clone 322B1 on chr. 22q11-12 AA768912 2.4 3.1 2.75 nz82h06.s1 AB002330 2.4 4 3.2 KIAA0332 gene M60748 2.4 2.4 2.4 Histone H1 (H1F4) AL042733 2.4 2.8 2.6 DKFZp434B2222 AF090988 2.5 2.1 2.3 U5 snRNP-specific 40 kDa protein X98296 2.5 2.1 2.3 Ubiquitin hydrolase

PAGE 131

117 U37012 2.5 2.2 2.35 Cleavage and polyadenylatio n specificity factor AF077953 2.5 2.2 2.35 Protein inhibitor of activated STAT protein PIASx-alpha AF035292 2.5 2.3 2.4 Clone 23584 L04270 2.5 2.4 2.45 Tumor necrosis factor receptor 2 related protein X97544 2.5 2.4 2.45 TIM17 preprotein translocase AF052134 2.5 2.4 2.45 Clone 23585 U90426 2.5 2.6 2.55 Nuclear RNA helicase N 23137 2.5 2.6 2.55 yx67h12.s1 N 23137 2.5 2.6 2.55 C17orf1 protein J03473 2.5 2.7 2.6 Poly(ADP-ribose) synthetase N 90862 2.5 2.7 2.6 zb11b06.s1 D88674 2.5 2.7 2.6 Antizyme inhibitor D50922 2.5 3.1 2.8 KIAA0132 gene AF005392 2.5 3.1 2.8 Alpha tubulin (TUBA2) AF029890 2.5 3.4 2.95 Hepatitis B virus X interacting protein (XIP) AB028639 2.5 2.6 2.55 CAPN7 mRNA for PalBH AI033692 2.6 2 2.3 ow26f02.x1 D82061 2.6 2 2.3 Member of the short-chain al cohol dehydrogenase family AC005329 2.6 2.1 2.35 Chromosome 19, cosmid R34382 AJ243937 2.6 2.1 2.35 G18.1a and G18.1b proteins AF053305 2.6 2.1 2.35 Mitotic checkpoint kinase Bub1 (BUB1) AI417075 2.6 2.3 2.45 tg78e09.x1 U11313 2.6 2.3 2.45 Sterol carrier protein-X/st erol carrier protein-2 M19267 2.6 2.3 2.45 Tropomyosin AB002324 2.6 2.3 2.45 KIAA0326 gene X79882 2.6 2.4 2.5 lrp U79273 2.6 2.5 2.55 Clone 23933 U30872 2.6 2.6 2.6 Mitosin AL037557 2.6 2.7 2.65 DKFZp564H2472_r1 U03911 2.6 2.7 2.65 Mutator gene (hMSH2) AL035304 2.6 2.9 2.75 PAC 295C6, U37426 2.6 3.1 2.85 Kinesin-like spindle protein HKSP (HKSP) X84194 2.6 3.3 2.95 Acylphosphatase, erythrocyte (CT) isoenzyme X92518 2.6 3.4 3 HMGI-C protein AF068180 2.6 2.8 2.7 B cell linker protein BLNK AF086904 2.6 3 2.8 Protein kinase Chk2 (CHK2) AA128249 2.6 3.1 2.85 zl29d09.r1 U90841 2.7 2 2.35 SSX4 (SSX4) AB011542: 2.7 2 2.35 MEGF9 M62762 2.7 2 2.35 Vacuolar H+ ATPase proton channel subunit AA808961 2.7 2 2.35 nw16h03.s1 X04412 2.7 2.3 2.5 Plasma gelsolin AL031681 2.7 2.3 2.5 Splicing factor, arginine/serin e-rich 6 (SRP55-2) isoform 2 AB029001 2.7 2.4 2.55 KIAA1078 protein U67058 2.7 2.4 2.55 Proteinase activated receptor-2 U12022 2.7 2.4 2.55 Calmodulin (CALM1) U90840 2.7 2.6 2.65 SSX3 (SSX3)

PAGE 132

118 AF074723 2.7 2.6 2.65 RNA polymerase transcriptional regulation mediator AJ238096 2.7 2.7 2.7 Lsm4 protein 2.7 2.7 2.7 Rna Polymerase II, 14.5 Kda Subunit J04080 2.7 2.8 2.75 Complement component C1r AI360249 2.7 2.9 2.8 qy84f07.x1 AB007455 2.7 3.1 2.9 P53TG1-A X67155 2.7 3.1 2.9 Mitotic kinesin-like protein-1 L25876 2.7 3.2 2.95 Protein tyrosine phosphatase (CIP2) D84109 2.7 3.9 3.3 RBP-MS/type 3 AF052288 2.7 2.3 2.5 untitled AF091433 2.7 2.6 2.65 Cyclin E2 AF068868: 2.8 2 2.4 TNFR-related death r eceptor-6 (DR6) M69023 2.8 2 2.4 DKFZp762F2110_r1 L34075 2.8 2.1 2.45 FKBP-rapamycin associated protein (FRAP) AL021546 2.8 2.2 2.5 DNA sequence from BAC 15E1 on chromosome 12. AL050089 2.8 2.2 2.5 DKFZp586E0518 (from clone DKFZp586E0518) AL031681 2.8 2.3 2.55 splicing factor, arginine/serine-rich 6 (SRP55-2)(isoform 2) D42040 2.8 2.3 2.55 KIAA9001 gene D15050 2.8 2.2 2.5 transcription factor AREB6 L28821 2.8 2.3 2.55 Alpha mannosidase II isozyme AJ000186 2.8 2.5 2.65 CMAD2 protein AF026939 2.8 2.5 2.65 CIG49 (cig49) W52024 2.8 2.6 2.7 zd13a03.s1 AL080101 2.8 2.6 2.7 DKFZp564L0472 (from clone DKFZp564L0472) W25933 2.8 2.6 2.7 15b2 AA005018 2.8 2.7 2.75 zh96a09.r1 Y11307 2.8 2.7 2.75 CYR61 J03040 2.8 2.7 2.75 SPARC/osteonectin AF059617 2.8 3.1 2.95 Serum-inducible kinase AA203545 2.8 3.3 3.05 zx59a05.r1 AI683748 2.8 3.7 3.25 tw53e07.x1 AF073362 2.8 4.2 3.5 Endo/exonuclease Mre11 (MRE11A) U78722 2.8 2.9 2.85 Zinc finger protein 165 (Zpf165) AI810807 2.8 3.1 2.95 tu26a01.x1 AL120687 2.9 2 2.45 L-iditol-2 dehydrogenase U24389 2.9 2.1 2.5 CLysyl oxidase-like protein X76538 2.9 2.1 2.5 Mpv17 U44378 2.9 2.1 2.5 Homozygous deletion target in pancreatic carcinoma M94250 2.9 2.1 2.5 Retinoic acid inducible factor (MK) Z95118 2.9 2.6 2.75 DNA sequence from clone 354J5 on chr. 6q21-22. 2.9 3.1 3 Calmodulin Type I AB009282 2.9 3.2 3.05 Cytochrome b5 D28423 2.9 3.4 3.15 pre-mRNA splicing factor SRp20 M11058 2.9 3.6 3.25 3-hydroxy-3-methylglutaryl coenzyme A reductase AI375913 2.9 3.6 3.25 tc14c08.x1 AI950382 2.9 3.7 3.3 wp10g06.x1 X98253 2.9 3.8 3.35 ZNF183 gene

PAGE 133

119 M91670 3 2.4 2.7 Ubiquitin carrier protein (E2-EPF) 3 2.7 2.85 Rad2 AF000982 3 2.8 2.9 Dead box, X isoform (DBX) AF053306 3 2.9 2.95 Mitotic checkpoint kinase Mad3L (MAD3L) X96752 3 2.9 2.95 L-3-hydroxyacyl-CoA dehydrogenase D64154 3 3 3 Mr 110,000 antigen L07541 3 3.2 3.1 Replication factor C, 38-kDa subunit U41813 3 3.3 3.15 Class I homeoprotein (HOXA9) AB009398 3 3.4 3.2 26S proteasome subunit p40.5 AW024285 3 3.4 3.2 wt69d06.x1 M87339 3 3.5 3.25 Replication factor C, 37-kDa subunit AF015287 3 3.5 3.25 Serine protease S70154 3 4.1 3.55 Cytosolic acetoacetyl-coenzyme A thiolase X84002 3 4.2 3.6 TAFII20 mRNA for transcription factor TFIID U03877 3 4.4 3.7 Extracellular protein (S1-5) AF064606 3 2.4 2.7 KB07 protein AL050166 3 2.7 2.85 DKFZp586D1122 (from clone DKFZp586D1122) U73960: 3.1 2.1 2.6 ADP-ribosylation factor-like protein 4 AC002073 3.1 2.3 2.7 PAC clone DJ515N1 from 22q11.2-q22 AF060902 3.1 2.6 2.85 Vesicle soluble NSF attachment protein receptor VTI2 AB002360 3.1 3 3.05 KIAA0362 gene AF010187 3.1 3.2 3.15 FGF-1 intracellular bindin g protein (FIBP) J04088 3.1 3.3 3.2 DNA topoisomerase II (top2) S62140 3.1 3.3 3.2 Translocated in liposarcoma U64028 3.1 3.8 3.45 NADH-ubiquinone oxidoreductase subunit B13 AB018283 3.1 3.8 3.45 KIAA0740 protein AB019987 3.1 4 3.55 Chromosome-associated polypeptide-C AL031432 3.1 4.6 3.85 Clone 465N24 on chromosome 1p35.1-36.13. U95006 3.1 4.6 3.85 D9 splice variant A mRNA AB011161 3.1 5.1 4.1 KIAA0589 protein L29218 3.1 2.5 2.8 clk2 mRNA AJ238097 3.1 3.4 3.25 Lsm5 protein U79528 3.2 2 2.6 SR31747 binding protein 1 AB021663 3.2 2.1 2.65 Leucine-zipper protein L09235 3.2 2.5 2.85 Vacuolar ATPase (isoform VA68) M91670 3.2 2.8 3 Ubiquitin carrier protein (E2-EPF) U16954 3.2 3.1 3.15 (AF1q) W27939 3.2 3.2 3.2 39g3 M21154 3.2 3.3 3.25 S-adenosylmethionine decarboxylase AI525379 3.2 3.4 3.3 PT1.1_06_H01.r AF035959 3.2 3.8 3.5 Type-2 phosphatidic acid phosphatase-gamma (PAP2-g) U16261 3.2 4.2 3.7 MDA-7 (mda-7) AF098162 3.2 5.6 4.4 Timeless homolog AF049105 3.2 7.5 5.35 Centrosomal Nek2-associated protein 1 (C-NAP1) U11037 3.2 2.5 2.85 Sel-1 like AB014543 3.2 3.2 3.2 KIAA0643 protein U03109 3.3 2.2 2.75 Aspartyl beta-hydroxylase

PAGE 134

120 AB023205 3.3 2.7 3 KIAA0988 protein X04327 3.3 3 3.15 Erythrocyte 2,3-bisphosphoglycerate mutase X52142 3.3 3.1 3.2 CTP synthetase AF025441 3.3 3.4 3.35 Opa-interacting protein OIP5 U62961 3.3 3.5 3.4 Succinyl CoA-3-oxoacid CoA transferase precursor AL080146 3.3 4 3.65 DKFZp434B174 (from clone DKFZp434B174) AA173896 3.3 4.1 3.7 zp03b02.s1 U59912 3.3 4.4 3.85 Chromosome 4 Mad homolog Smad1 U16261 3.3 4.6 3.95 MDA-7 (mda-7) X66358 3.3 2.5 2.9 KKIALRE for serine/threonine protein kinase Z26317 3.3 3.3 3.3 Desmoglein 2 X78992 3.3 3.5 3.4 ERF-2 D00591 3.4 2 2.7 RCC1 gene, exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 D50930: 3.4 2 2.7 KIAA0140 gene AF047469 3.4 2 2.7 Arsenite translocatin g ATPase (ASNA1) U19796 3.4 2.1 2.75 Melanoma antigen p15 X66899 3.4 2.2 2.8 EWS AB014604 3.4 2.5 2.95 KIAA0704 protein AA845349 3.4 2.6 3 ak01g01.s1 AA631698 3.4 3.1 3.25 np79a08.s1 U74612 3.4 3.2 3.3 Hepatocyte nuclear factor-3/fork head homolog 11A D78275 3.4 3.8 3.6 Proteasome subunit p42, complete cds AF070578 3.4 4.2 3.8 Clone 24674 AF047436 3.4 4.5 3.95 F1Fo-ATPase synthase f subunit mRNA AB014460 3.4 5.4 4.4 TSC2, NTHL1/NTH1 and SLC9A3R2/E3KARP genes AW051579 3.4 3.2 3.3 wy87g03.x1 U79256 3.4 3.3 3.35 Clone 23719 AF006751 3.5 2 2.75 ES/130 X82260 3.5 2.2 2.85 RanGTPase activating protein 1 D87075 3.5 2.6 3.05 KIAA0238 gene L16782 3.5 2.9 3.2 Putative M phase phosphoprotein 1 (MPP1) AB014458 3.5 3.4 3.45 hUBP mRNA for ubiquitin specific protease M13452 3.5 4.1 3.8 Lamin A mRNA, 3end AF073362 3.5 4.4 3.95 Endo/exonuclease Mre11 (MRE11A) X70683 3.5 5.8 4.65 SOX-4 X13482 3.5 8.5 6 U2 snRNP-specific A protein U17163 3.5 2.8 3.15 Transcription factor ETV1 U58970 3.6 2.3 2.95 Putative outer mitochondria me mbrane 34kDa translocase X65550 3.6 2.8 3.2 mki67a mRNA for antigen of monoclonal antibody Ki-67 M12125 3.6 3.4 3.5 Fibroblast muscle-type tropomyosin AL050261 3.6 3.8 3.7 DKFZp547E2110 (from clone DKFZp547E2110) AI023044 3.6 3.8 3.7 ow65c01.s1 L38928 3.6 5.2 4.4 5,10-methenyltetrahydrofolate synthetase AF058918 3.6 2.8 3.2 unknown N 58115 3.6 3 3.3 yv65a01.s1 X81889 3.7 2.4 3.05 p0071 protein AF063020 3.7 3.1 3.4 lens epithelium-derived growth factor

PAGE 135

121 Z48054 3.7 3.7 3.7 Peroxisomal targeting signa l 1 (SKL type) receptor L38696 3.7 3.9 3.8 Autoantigen p542 X12458 3.7 3.9 3.8 P3 gene AF015254 3.7 4.2 3.95 Serine/threonine kinase (STK-1) K03460 3.7 4.4 4.05 Alpha-tubulin isotype H2-alpha gene L07493 3.7 4.5 4.1 Replication protein A 14kDa subunit (RPA) L08835 3.7 2.4 3.05 DMR-N9, partial cds; and myotonic dystrophy kinase M30474 3.8 2.6 3.2 Kidney gamma-glutamyl transpeptidase type II AC002115 3.8 3.4 3.6 R31396, F25451, and R31076 containing COX6B AF038406 3.8 4 3.9 NADH dehydrogenase-ubiquinone Fe-S protein U34804 3.8 4.4 4.1 Thermostable phenol sulfotransferase (STP2) U01038 3.9 2.4 3.15 pLK X51688 3.9 2.7 3.3 Cyclin A AF047432 3.9 3.3 3.6 ADP-ribosylation factor mRNA U82938 3.9 4.2 4.05 CD27BP (Siva) U37139 3.9 4.2 4.05 Beta 3-endonexin D87440 3.9 4.5 4.2 KIAA0252 gene X83928 3.9 2.9 3.4 Transcription factor TFIID subunit TAFII28 AF019612 3.9 3.1 3.5 S2P X66364 4 2.5 3.25 PSSALRE for serine/threonine protein kinase U77949 4 2.5 3.25 Cdc6-related protein (HsCDC6) X69550 4 2.5 3.25 Rho GDP-dissociation Inhibitor 1 AC002398 4 2.6 3.3 DNA from chromosome 19-specific cosmid F25965 J00277 4 2.7 3.35 Clones RS-[3,4, 6]) c-Ha-ras1 proto-oncogene M94362 4 3.8 3.9 Lamin B2 (LAMB2) Y13115 4 3.8 3.9 Serine/threonine protein kinase SAK X54942 4 4.7 4.35 ckshs2 mRNA for Cks1 protein homologue D88460 4.1 3.8 3.95 N-WASP J04131 4.1 4.5 4.3 Gamma-glutamyl transpeptidase (GGT) protein J05614 4.1 5.5 4.8 Proliferating cell nuclear antigen (PCNA) AJ011981 4.1 2.6 3.35 clone 417820 AF002715 4.2 3.4 3.8 MAP kinase kinase kinase (MTK1) AI862521 4.2 5.3 4.75 wj15a06.x1 U57646 4.2 6.8 5.5 Cysteine and glycine-rich protein 2 (CSRP2) AF029669 4.3 4.2 4.25 Rad51C (RAD51C) Z11584 4.3 4.3 4.3 NuMA protein AL080071 4.3 6.5 5.4 DKFZp564M082 (from clone DKFZp564M082) U79266 4.4 2.8 3.6 Clone 23627 AF064093 4.4 3 3.7 KE04p mRNA U10868 4.4 3.2 3.8 Aldehyde dehydrogenase ALDH7 Y10043 4.4 3.5 3.95 High mobility group protein HMG2a X74794 4.4 4.4 4.4 P1-Cdc21 AF098462 4.4 4.5 4.45 Stanniocalcin-related protein AI341574 4.4 4.5 4.45 qq94h09.x1 U76638 4.4 5 4.7 BRCA1-associated RING domain protein (BARD1) U34044 4.4 5.2 4.8 Selenium donor protein (selD) AJ223349 4.5 6 5.25 HIRIP3 protein

PAGE 136

122 D26155 4.5 2.3 3.4 Transcriptional activator hSNF2a U36341 4.6 4.3 4.45 Xq28 cosmid, creatine tr ansporter (SLC6A8) X05360 4.6 4.4 4.5 CDC2 gene involved in cell cycle control AF042083 4.7 4.2 4.45 BH3 interacting domain death agonist (BID) X87176 4.7 4.6 4.65 17-beta-hydroxysteroid dehydrogenase U66619 4.7 5.5 5.1 SWI/SNF complex 60 KDa subunit (BAF60c) AI693193 4.7 9.1 6.9 wd68f02.x1 X57398 4.8 3.3 4.05 pM5 protein W28892 4.8 3.9 4.35 53c11 AF001383 4.8 4.2 4.5 Amphiphysin II AF040707 4.9 3.6 4.25 Candidate tumor suppressor gene 21 protein isoform I J03060 5 3 4 Glucocerebrosidase (GCB) Z36714 5 3.1 4.05 Cyclin F U25975 5.1 2.3 3.7 Serine kinase (hPAK65) U37408 5.1 2.5 3.8 Phosphoprotein CtBP U09759 5.1 3.8 4.45 Protein kinase (JNK2) U52100 5.1 6 5.55 XMP Z97029 5.1 10.1 7.6 Ribonuclease H I large subunit W27050 5.2 3.3 4.25 19f7 U65011 5.2 3.8 4.5 Preferentially expre ssed antigen of melanoma (PRAME) AF041210 5.2 8.5 6.85 Midline 1 fetal kidney isoform 3 (MID1) L35013 5.3 2.1 3.7 Spliceosomal protein (SAP 49) U15655 5.3 2.4 3.85 ets domain protein ERF AC004770 5.3 2.6 3.95 hFEN1 gene U01923 5.3 3.5 4.4 BTK region clone ftp-3 X65873 5.3 3.9 4.6 Kinesin (heavy chain) U25165 5.3 3.9 4.6 Fragile X mental retardation protein 1 homolog FXR1 Y11681 5.3 4.1 4.7 Mitochondrial ribosomal protein S12 AF040958 5.4 3.4 4.4 Lysosomal neuraminidase precursor AF038250 5.4 5 5.2 untitled AB002308 5.4 9.3 7.35 KIAA0310 gene L37747 5.5 2.3 3.9 Lamin B1 AA552140 5.5 2.5 4 ng48e07.s1 AL050015 5.5 3.7 4.6 DKFZp564O243 (from clone DKFZp564O243) W27541 5.5 4.9 5.2 32c12 AF052111 5.5 5 5.25 Clone 23953 M12125 5.5 6.3 5.9 Fibroblast muscle-type tropomyosin J03824 5.6 3.7 4.65 Uroporphyrinogen III synthase M87338 5.6 4.9 5.25 Replication factor C, 40-kDa subunit (A1) W22520 5.7 5.1 5.4 68G3 W28214 5.7 5.7 5.7 45f7 AF038961 5.7 5.8 5.75 SL15 protein AI698103 5.7 6.8 6.25 we20h11.x1 AL096739 5.7 3.1 4.4 DKFZp586H0623 (from clone DKFZp586H0623) U75370 5.8 3.9 4.85 Mitochondrial RNA polymerase AF080561 5.8 5 5.4 SYT interacting protein SIP X71490 5.9 4.6 5.25 Vacuolar proton ATPase, subunit D

PAGE 137

123 U47926 6 6.7 6.35 Unknown protein B X51688 6.1 4.6 5.35 Cyclin A D88357 6.1 5.3 5.7 CDC2 delta T U90842 6.1 5.8 5.95 SSX5 (SSX5) Z49105 6.1 5.8 5.95 HD21 AI961220 6.1 6.1 6.1 wt15b04.x1 X55110 6.2 4.3 5.25 Neurite outgrowth-promoting protein X14850 6.2 6.1 6.15 H2A.X mRNA encoding histone H2A.X Y00630 6.2 6.2 6.2 Arg-Serpin (plasminogen activator-inhibitor 2, PAI-2) AF091080 6.2 7 6.6 Clone 614 unknown AL008583 6.3 4.9 5.6 Ortholog of rat Neuronal Pentraxin Receptor X79200 6.3 5.4 5.85 SYT-SSX protein M13452 6.3 5.9 6.1 Lamin A AJ133769 6.3 8.8 7.55 Nuclear transport receptor AB002328 6.4 2.6 4.5 KIAA0330 gene 6.4 5.4 5.9 Tubulin, Alpha 1, Isoform 44 AA165701 6.4 6.8 6.6 zo75g08.s1 D87435 6.5 2.2 4.35 KIAA0248 gene X75342 6.5 4.8 5.65 SHB U31384 6.6 6.7 6.65 G protein gamma-11 subunit M63167 6.8 2.9 4.85 Rac protein kinase alpha AD000092 6.8 4.3 5.55 EKLF, GCDH, CRTC, and RAD23A genes L04658 6.8 5.8 6.3 untitled L25444 7 3.2 5.1 TAFII70-alpha U24152 7 7.6 7.3 p21-activated protein kinase (Pak1) U66685 7.1 5.4 6.25 HSU66685 Y09616 7.2 7.6 7.4 Putative intestinal carboxylesterase (iCE) AI936826 7.2 8.9 8.05 wp69h10.x1 U07695 7.3 4.8 6.05 Tyrosine kinase (HTK) X56777 7.3 5.6 6.45 ZP3 L78833 7.3 6 6.65 BRCA1, Rho7 and vatI Y18483 7.4 4.6 6 SLC7A8 protein U18271 7.5 7.4 7.45 Thymopoietin (TMPO) AF057297 7.8 5.3 6.55 Ornithine decarboxylase antizyme 2 (OAZ2) AL050019 8.3 6.7 7.5 DKFZp564C186 (from clone DKFZp564C186) L47345 8.3 7.2 7.75 Elongin A U68485 8.3 9.4 8.85 Bridging integrator protein-1 (BIN1) U02566 8.4 5.9 7.15 Receptor tyrosine kinase tif AF016371 8.4 14.5 11.45 U4/U6snRNP-associated cyclophilin (USA-CyP) W28235 8.5 8.6 8.55 43h8 AL080203 8.6 7.6 8.1 DKFZp434F222 (from clone DKFZp434F222) S78187 8.6 10.6 9.6 CDC25Hu2=cdc25+ homolog M64595 8.8 5 6.9 Small G protein (Gx) AB017430 8.9 8.9 8.9 kid-Kinesin-like DNA binding protein AD001530 9.2 9.1 9.15 XAP-5 S76638 9.9 4.5 7.2 p50-NF-kappa B homolog [human, peripheral blood Tcells AA121509 9.9 17.3 13.6 k88c10.s1

PAGE 138

124 S82470 10 4.1 7.05 Malignant cell expression-enhanced gene Y07604 10.2 5.1 7.65 Nucleoside-diphosphate kinase AB028974 10.4 7 8.7 KIAA1051 protein AF035292 10.8 8.9 9.85 Clone 23584 M68864 12.1 10.4 11.25 ORF mRNA X79865 12.2 8.3 10.25 Mrp17 X71345 12.3 17.8 15.05 Trypsinogen IV b-form AL096723 12.6 14.3 13.45 DKFZp564H2023 (from clone DKFZp564H2023) X96484 13.7 11.7 12.7 DGCR6 protein U03398 14.5 4.7 9.6 Receptor 4-1BB ligand AF026031 15.1 15.8 15.45 Putative mitochondrial membrane protein import receptor L23959 15.9 11.2 13.55 E2F-related transcription factor (DP-1) N 53547 15.9 18.2 17.05 yv43b12.s1 X03656 17.2 15.8 16.5 Granulocyte colony-stimulating factor (G-CSF) U15655 17.3 6.5 11.9 ets domain protein ERF D83492 18.5 12.7 15.6 EphB6 D64142 19.5 8.1 13.8 Histone H1x U66061 23 28.6 25.8 Trypsinogen C AF026977 31 36.8 33.9 Microsomal glutathione S-transferase 3 (MGST3) L37127 43.9 53 48.45 RNA polymerase II subunit

PAGE 139

125 APPENDIX B CYTOKINE-INDUCIBLE JAK2-DEPENDENT GENES Accession # Gene Name Average. Induction # W25845 Guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 -78.4 AF035119 Deleted in liver cancer 1 -5.95 AF117829 Receptor-interacting serine-t hreonine kinase 2 -4.55 AF117829 Recepto r-interacting serine-thr eonine kinase 2 -4.55 L06797 Chemokine (C-X-C motif) receptor 4 -4.35 L06797 Chemokine (C-X-C motif) receptor 4 -4.35 M23263 Androgen receptor (dihydrotestosterone receptor -3.6 D26070 Inositol 1,4,5-triphosphate receptor, type 1 -3.6 X55005 Thyroid hormone receptor, alpha -3.5 X78947 Connective tissue growth factor -3.15 M31166 Pentaxin-related gene, rapidly induced by IL-1 beta -2.85 D28118 Zinc finger protein 161 -2.85 D28118 Zinc finger protein 161 -2.85 L20859 Solute carrier family 20 (phosphate transporter), member 1 -2.8 M23379 RAS p21 protein activator (GTPase activating protein) 1 -2.8 AF016266 Tumor necrosis factor receptor superfamily, memb er 10b -2.75 U01062 Inositol 1,4,5-triphosphate receptor, type 3 -2.6 D26070 Inositol 1,4,5-triphosphate receptor, type 1 -2.45 M60278 Diphtheria toxin receptor -2.4 X63679 Translocating chain-associa ting membrane protein -2.4 X78565 Tenascin C (hexabrachion) -2.25 AB015051 Death-associated protein 6 -2.2 U17999 Beclin 1 (coiled-coil, myosin -like BCL2 interacting protein) -2.05 M26683 Chemokine (C-C motif) ligand 2 2 D17517 TYRO3 protein tyrosine kinase 2 M26683 Chemokine (C-C motif) ligand 2 2 U09759 Mitogen-activated protein kinase 9 2.15 U88871 peroxisomal biogenesis factor 7 2.2 U18934 TYRO3 protein tyrosine kinase 2.2 U19142 G antigen 1 2.2 D10656 v-crk sarcoma virus CT10 oncogene homolog (avian) 2.3 L03532 Heterogeneous nuclear ribonucleoprotein M 2.3 AI033692 Breakpoint cluster region protein, uterine leiomyoma 2.3 D38076 RAN binding protein 1 2.35 L04270 Lymphotoxin beta receptor (TNFR superfamily, member 3) 2.45 U67058 Coagulation factor II (thr ombin) receptor-like 1 2.55 D16581 Nudix (nucleoside diphosphate linked moiety X)-type motif 1 2.55

PAGE 140

126 AF068180 B-cell linker 2.7 AF068180 B-cell linker 2.7 AF006751 Ribosome binding protein 1 homolog 180kDa (dog) 2.75 X82260 Ran GTPase activating protein 1 2.85 AB007455 TP53 target gene 1 2.9 U58970 Translocase of outer mitochondrial membrane 34 2.95 X69550 Rho GDP dissociation inhibitor (GDI) alpha 3.25 U74612 Forkhead box M1 3.3 AF073362 MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 3.5 Z48054 Peroxisome receptor 1 3.7 AF002715 Mitogen-activated protein kinase kinase kinase 4 3.8 D88460 Wiskott-Aldrich syndrome-like 3.95 U37139 Integrin beta 3 binding protein (beta3-endonexin) 4.05 U82938 CD27-binding (Siva) protein 4.05 U82938 CD27-binding (Siva) protein 4.05 U09759 Mitogen-activated protein kinase 9 4.45 AF042083 BH3 interacting domain death agonist 4.45 AF098462 Stanniocalcin 2 4.45 M63167 v-akt murine thymoma viral oncogene homolog 1 4.85 X55110 Midkine (neurite growth-promoting factor 2) 5.25 X75342 SHB (Src homology 2 domain containing) adaptor protein B 5.65 X56777 Zona pellucida glycoprotein 3A (sperm receptor) 6.45 U02566 TYRO3 protein tyrosine kinase 7.15 AJ133769 Transportin-SR 7.55 U03398 "Tumor necrosis factor (ligand) superfamily, member 9" 9.6 D83492 EphB6 15.6 AF026977 Microsomal glutathione S-transferase 3 33.9

PAGE 141

127 LIST OF REFERENCES Alexander RW, Brock TA, Gimbrone MA Jr, Rittenhouse SE (1985) Angiotensin increases inositol trisphosphate and cal cium in vascular smooth muscle. Hypertension 7: 447-451 Ali MS, Sayeski PP, Dirksen LB, Hayzer DJ, Marrero MB, Bernstein KE (1997) Dependence of the motif YIPP for the physical association of the Jak2 kinase with the intracellular carboxyl ta il of the angiotensin II AT1 receptor. J Biol Chem 272: 23382-23388 Ali MS, Sayeski PP, Safavi A, Lyles M, Bern stein KE (1998) Janus Kinase 2 (Jak2) must be catalytically active to associate with the AT1 receptor in response to angiotensin II. Biochem Biophys Res Comm 249: 672-677 Ali MS, Sayeski PP, Bernstein KE (2000) Ja k2 acts as both a STAT1 kinase and as a molecular bridge linking STAT1 to the angiotensin II AT1 receptor. J Biol Chem 275 : 15586-15593 Alliston TN, Maiyar AC, Buse P, Firestone GL Richards JS (1997) Follicle stimulating hormone-regulated expression of serum/gl ucocorticoid-inducibl e kinase in rat ovarian granulosa cells: a f unctional role for the Sp1 fa mily in promoter activity. Mol Endocrinol 11: 1934-1949 Alvarez de la Rosa D, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, Canessa CM (1999) The serum and glucocorticoid kinase sgk increases the abunda nce of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834-37839 Argetsinger LS, Campbell GS, Yang X, Witt huhn BA, Silvennoinen O, Ihle JN, CarterSu C (1993) Identification of JAK2 as a growth hormone receptor-associated tyrosine kinase. Cell 74: 237-244 Baker KM, Chernin MI, Wixson SK, Aceto JF (1990) Renin-angiotensin system involvement in pressure-overl oad cardiac hypertrophy in rat. Am J Physiol 259: H324-H332 Barnett AH (2001) The role of angiotensin II receptor antagon ists in the management of diabetes. Blood Press Suppl 1: 21-26

PAGE 142

128 Bell LM, Leong MLL, Kim B, Wang E, Park BA, Hemmings G, Firestone L (2000) Hyperosmotic stress stimulates promoter act ivity and regulates cellular utilization of the serum and glucocorticoid induci ble protein kinase (Sgk) by a p38/MAPK dependent pathway. J Biol Chem 275 : 25262-25272 Bergad PL, Shih HM, Towle HC, Schwarzenbe rg SJ, Berry SA (1995) Growth hormone induction of hepatic serine protease inhi bitor 2.1 transcription is mediated by a Stat5-related factor binding synergisti cally to two gamma-activated sites. J Biol Chem 270: 24903-24910 Berger S, Bleich M, Schmid W, Cole TJ, Pete rs J, Watanabe H, Kriz W, Warth R, Greger R, Schutz G (1998) Mineralcorticoid r eceptor knockout mice: Pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95: 9424-9429 Bernards A (1991) Predicted Tyk2 protein co ntains two tandem protein kinase domains. Oncogene 6: 1185-1187 Berridge MJ (1993) Inositol-tris phosphate and calcium signaling. Nature 361: 315-325 Boehning D, Mak DO, Foskett JK, Joseph SK (2001) Molecular determinants of ion permeation and selectivity in inos itol 1,4,5 trisphosphate receptor Ca2+ channels. J Biol Chem 276: 13509-13512 Bokkala S, Jospeh SK (1997) Angiotensi n II-induced down-re gulation of inositol triphosphate receptors in WB rat liver epithelial cells. J Biol Chem 272 : 1245412461 Bolli R, Dawn B, Xuan YT (2001) Emerging role of the JAK–STAT pathway as a mechanism of protection against ischemia/reperfusion injury. J Mol Cell Cardiol 33: 1893–1896 Brennan FE, Fuller PJ (2000) Ra pid upregulation of serum an d glucocorticoid-regulated kinase ( sgk ) gene expression by co rticosteroids in vivo. Mol Cell Endocrinol 166: 129-136 Brunet A, Park J, Tran H, Hu LS, Hemmi ngs BA, Greenberg ME (2001) Protein kinase SGK mediates survival by phosphorylati ng the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21: 952-965 Buggy JJ (1998) Binding of alpha-melanocyt e-stimulating hormone to its G-proteincoupled receptor on B-lymphocytes activates the Jak/STAT pathway. Biochem J 331: 211-216 Busjahn A, Aydin A, Uhlmann R, Krasko C, Bahring S, Szelestei T, Feng Y, Dahm S, Sharma AM, Luft FC, Lang F (2002) Serumand glucocorticoid-regulated kinase (SGK1) gene and blood pressure. Hypertension 40: 256-260

PAGE 143

129 Campbell GS, Meyer DJ, Raz R, Levy DE, Schwar tz J, Carter-Su C ( 1995) Activation of acute phase response factor (APRF)/Stat3 transcription factor by growth hormone. J Biol Chem 270: 3974-3979 Chatti K, Farrar WL, Duhe RJ (2004) Tyrosine phosphor ylation of the Janus kinase 2 activation loop is essential for a high-activity catalytic state but dispensable for a basal catalytic state. Biochem 43: 4272-4283 Chauhan D, Kharbanda SM, Ogata A, Uras hima M, Frank D, Malik N, Kufe DW, Anderson KC (1995) Oncostatin M induces association of Grb2 with Janus kinase JAK2 in multiple myeloma cells. J Exp Med 182: 1801-1806 Chen S, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D (1999) Epithelial s odium channel regulated by aldosteroneinduced protein sgk. Proc Natl Acad Sci 96: 2514-2519 Chomczynski P, Sacchi N (1987) Singlestep method of RNA isolation by acid guanidinium thiocyanate-phe nol-chloroform extraction. Anal Bio-Chem 162: 156159 Cook SA, Matsui T, Li L, Rosenzweig A ( 2002) Transcriptional effects of chronic Akt activation in the heart. J Biol Chem 277: 22528-22533 Cowling RT, Birnboim HC (2000a) Regulation of sgk by aldosterone and its effects on the epithelial Na(+) channel. Am J Physiol Renal Physiol 278: F613-F619 Cowling RT, Birnboim HC (2000b) Expression of serumand glucocorticoid-regulated kinse (sgk) mRNA is up-regulated by GM-CSF and other proinflammatory mediators in human granulocytes. J Leukoc Biol 67: 240-248 Cui J, Matkovich SJ, deSouza N, Li S, Ro semblit N, Marks AR (2004) Regulation of the Type 1 inositol 1,4,5-trisphosphate recep tor by phosphorylatio n at tyrosine 353*. J Biol Chem 279: 16311-16316 Darnell Jr. JE, Kerr IM, Stark GR (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and ot her extracellular signaling proteins. Science 264: 1415-1421 Debonneville C, Flores SY, Kamynina E, Pl ant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horeisberger JD Pearce D, Loffing J, Staub O (2001) Phosphorylation of Nedd4-2 by SGK1 regul ates epithelial Na(+) channel cell surface expression EMBO J 20 : 7052-7059 De Smedt H, Missiaen L, Parys JB, Bootman MD, Mertens L, Van Den Bosch L, Casteels R (1994) Determination of relativ e amounts of inositol trisphosphate receptor mRNA isoforms by ratio polymerase chain reaction. J Biol Chem 269: 21691-21698

PAGE 144

130 Devereux RB, Roman MJ, Paranicas M, O’Gr ady MJ, Lee ET, Welty TK, Fabsitz RR, Robbins D, Rhoades ER, Howard BV ( 2000) Impact of diabetes on cardiac structure and function: the Strong Heart Study. Circulation 101 : 2271 –2276 Duhe RJ, Farrar WL (1998) Structural and mech anistic aspects of Janus kinases: how the two-faced god wields a double-edged sword. J Interferon Cytokine Res 18: 1-15 Duhe RJ, Rui H, Greenwood JD, Garvey K, Farrar WL (1995) Cloning of the gene encoding rat JAK2, a prot ein tyrosine kinase. Gene 158: 281-285 Fan XD, Stark GR, Bloom BR (1989) Molecular cloning of a gene selectively induced by gamma interferon from human macrophage cell line U937 Mol Cell Biol 9: 19221928 Feng J, Witthuhn BA, Matsuda T, Kohlhuber F, Kerr IM, Ihle JN (1997) Activation of Jak2 catalytic activity requires phosphoryla tion of Y1007 in the kinase activation loop. Mol Cell Biol 17: 2497-2501 Ferris CD, Cameron AM, Bredt DS, Huga nir RL, Snyder SH (1991a) Inositol 1,4,5trisphosphate receptor is phosphorylated by cyclic AMP-dependent protein kinase at serines 1755 and 1589. Biochem Biophys Rres Commun 175: 192-198 Ferris CD, Huganir RL, Bredt DS, Ca meron AM, Snyder SH (1991b) Inositol trisphosphate receptor: phosphorylati on by protein kinase C and calcium calmodulin-dependent protein kinases in reconstituted lipid vesicles. Proc Natl Acad Sci USA 88: 2232-2235 Firmbach-Kraft I, Byers M, Shows T, Dalla-Favera R, Krolewski JJ (1990) Tyk2, prototype of a novel class of non-re ceptor tyrosine kinase genes. Oncogene 5: 1329-1336 Foley H, Ofori-Acquah S F, Yoshimura A, Cr itz S, Baliga S, Pace BS (2002) Stat3 beta inhibits gamma-globin gene expression in erythroid cells J Biol Chem 277: 1621116219 Frank SJ, Gilliland G, Kraft AS, Arnold CS (1994) Interaction of the growth hormone receptor cytoplasmic domain with the JAK2 tyrosine kinase. Endocrinology 135: 2228-2239 Frank GD, Saito S, Motley ED, Sasaki T, Ohba M, Kuroki T, Inagami T, Eguchi S (2002) Requirement of Ca(2+) and PKCdelta for Janus kinase 2 activation by angiotensin II invo lvement of PYK2. Mol Endo 16: 367-377 Fuhre, DK, Yang YC (1996) Complex formatio n of JAK2 with PP2A, P13K, and Yes in response to the hematopoietic cytokine interleukin-11. Biochem Biophys Res Comm 224: 289-296

PAGE 145

131 Fuhrer DK, Feng GS, Yang YC (1995) Syp asso ciates with gp130 and Janus kinase 2 in response to interleukin-11 in 3T3-L1 mouse preadipocytes. J Biol Chem 270: 24826-24830 Furuichi T, Yoshikawa S, Miyawaki A, Wa da K, Maeda N, Mikos hiba K (1989) Primary structure and functional e xpression of the inositol 1,4,5-trisphosphate-binding protein P400. Nature 342: 32-38 Gadina M, Hilton D, Johnston JA, Mori nobu A, Lighvani A, Zhou YJ, Visconti R, O'Shea JJ (2001) Signaling by type I and II cytokine receptors: ten years after. Curr Opin Immunol 13: 363-373 Galderisi M, Anderson KM, Wilson PW, Le vy D (1991) Echocardiographic evidence for the existence of a distinct diabetic ca rdiomyopathy (The Framingham Heart Study). Am J Cardiol 68 : 85 –89 Galsgaard ED, Gouilleux F, Groner B, Se rup P, Nielsen JH, Billestrup N (1996) Identification of a growth hormone-res ponsive STAT5-binding element in the rat insulin gene. Mol Endocrinol 10: 652-660 Gasc JM, Shanmugam S, Sibony M, Corvol P (1994) Tissue-specific expression of type 1 angiotensin II receptor subtypes. An in situ hybridization study. Hypertension 24: 531-537 Gavras I, Gavras H (2002) Angiotensi n II as a cardiovascul ar risk factor. J Hum Hypertens 16: S2-S6 Gebert CA, Park SH, Waxman DJ (1997) Regulation of signal transducer and activator of transcription (STAT) 5b activation by th e temporal pattern of growth hormone stimulation. Mol Endocrinol 11: 400-414 Ghosh TK, Bian JH, Short AD, Rybak SL, Gill DL (1991) Persistent intracellular calcium pool deletion by thapsigargin and its influence on cell growth. J Biol Chem 266: 24690-24697 Giordanetto F, Kroemer RT (2002) Prediction of the structure of human Janus kinase 2 (JAK2) comprising JAK homology domains 1 through 7. Protein Engineering 15: 727-737 Girault JA, Labesse G, Mornon J, Callebaut I (1998) Janus kinases and focal adhesion kinases play in the 4.1 band: a superfam ily of band 4.1 domains important for cell structure and signal transduction. Mol Med 4: 751-769 Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C (2001) An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 25: 386-401

PAGE 146

132 Gonzalez-Robayna IJ, Falander AE, Ochsner S, Firestone GL, Richards JS (2000) Follicle-stimulating hormone (FSH) stimul ates phosphorylation and activation of protein kinase B (PKB/Akt) and serum a nd glucocorticoid-induced kinase (Sgk): Evidence for a kinase-independent signaling by FSH in granulose cells. Mol Endocrinol 14 : 1283-1300 Hackett RH, Wang YD, Larner AC (1995) Mapp ing of the cytoplasmic domain of the human growth hormone receptor required for the activation of Jak2 and Stat proteins. J Biol Chem 270: 21326-21330 Han Y, Leaman DW, Watling D, Rogers NC Groner B, Kerr IM, Wood WI, Stark GR (1996) Participation of JAK and STAT proteins in growth hormone induced signaling. J Biol Chem 271: 5947-5952 Harnick DJ, Jayaraman T, Ma Y, Mulieri P, Go LO, Marks AR (1995) The human type 1 inositol 1,4,5 trisphosphate receptor from lymphocytes. J Biol Chem 270: 28332840 Harpur AG, Andres AC, Ziemiecki A, As ton RR, Wilks AF (1992) JAK2, a third member of the JAK family of protein tyrosine kinases. Oncogene 7: 1347-1353 Hattori R, Maulik N, Otani H, Zhu L, Co rdis G, Engelman RM, Siddiqui MAQ, Das DK (2001) Role of STAT3 in ischemic preconditioning. J Mol Cell Cardiol 33: 1929– 1936 He K, Wang X, Jiang J, Guan R, Be rnstein KE, Sayeski PP, Frank SJ (2003) Janus kinase 2 determinants for growth hormone receptor association, surface assembly, and signaling. Mol Endo 17: 2211-2227 Higgins DG, Thompson JD, Gibson TJ (1996) Using CLUSTAL for multiple sequence alignments. Methods in Enzymology 266: 383-402 Hiroi Y, Hiroi J, Kudoh S, Yazaki Y, Nagai R, Komuro I (2001) Two distinct mechanisms of angiotensin II-induced nega tive regulation of th e mitogen-activated protein kinases in cultured cardia myocytes. Hypertens Res 24 : 385-394 Hoffman BB, Sharma K, Zhu YQ, Ziyadeh FN (1998) Transcrip tional activation of transforming growth facto r-beta 1 in mesangial cell culture by high glucose concentration. Kidney Int 54: 1107-1116 Hong G, Lockhart A, Davis B, Rahmoune H, Baker S, Ye L, Thompson P, Shou Y, O’Shaughnessy K, Ronco P, Brown J (2003) PPARgamma activation enhances cell surface ENaCalpha via up-regulation of SGK1 in human collecting duct cells. FASEB J 17: 1966-1968 Horowitz DS, Lee EJ, Mabon SA, Misteli T. (2002)A cyclophilin functions in pre-mRNA splicing. EMBO J 21: 470-480

PAGE 147

133 Horvath CM, Wen Z, Darnell JE Jr (1995) A STAT protein domain that determines DNA sequence recognition suggest s a novel DNA-binding domain. Genes Dev 8: 984994 Huang DY, Wulff P, Volkl H, Loffing J, Ri chter K, Kuhl D, Lang F, Vallon V (2004) Impaired regulation of renal K+ elimination in the sgk1-knockout mouse. J Am Soc Nephrol 15: 885-891 Ishida M, Marrero MB, Schieffer B, Ishi da T, Bernstein KE, Berk BC (1995) AngII activates pp60c-src in vascular smooth muscle cells. Circ Res 77 :1053-1059 Itani OA, Liu KZ, Cornish KL, Campbell JR, Thomas CP (2002) Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5’-flanking region. Am J Physiol Endocrinol Metab 283: E971-E979 Iwai N, Inagami T, Ohmichi N, Nakamura Y, Saeki Y, Kinoshita M (1992) Differential regulation of rat AT1a and AT1b receptor mRNA. Biochem Biophys Res Commun 188: 298-303 Jayayaman T, Ondrais K, Ondriaove E, Marks AR (1996) Regulation of the inositol 1,4,5-trisphosphate receptor by tyrosine phosphorylation. Science 272: 1492-1494 Ju H, Venema VJ, Liang H, Harris MB, Zou R, Venema RC (2000) Bradykinin activates the Janus-activated kinase/signal trans ducers and activators of transcription (JAK/STAT) pathway in vascular endotheli al cells: localization of JAK/STAT signaling proteins in plasmalemmal caveolae. Biochem J 351: 257-264 Kampa D, Burnside J (2000) Computational a nd functional analysis of the putative SH2 domain in Janus kinases. Biochem Biophys Res Comm 278: 175-182 Kamynina E, Staub O (2002) Concerted action of ENaC, Nedd4-2 and Sgk1 in transepithial Na(+) transport. Am J Physiol Renal Physiol 283 : F377-F387 Kannel WB, Hjortland M, Castelli WP (1974) Role of diabetes in congestive heart failure: The Framingham Study. Am J Cardiol 34: 29–34 Kawamura M, McVicar DW, Johnston JA, Blake TB, Chen YQ, Lal BK, Lloyd AR, Kelvin DJ, Staples JE, Ortaldo JR, O’Sh ea JJ (1994) Molecular cloning of L-JAK, a Janus family protein-tyrosine kinase expr essed in natural killer cells and activated leukocytes. Proc Natl Acad Sci (USA) 91: 6374-6378 Kennefick TM, Anderson S (1997) Role of angiotensin II in diabetic nephropathy. Semin Nephrol 17: 441-447 Kobayashi T, Cohen P (1999) Activation of serum-and glucocorticoid-regulated protein kinase by agonists that activate phosphatid ylinositide 3-kinase is mediated by phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319-328

PAGE 148

134 Kodama H, Fukuda K, Pan J, Makino S, Baba A, Hori S, Ogawa S (1997) Leukemia inhibitory factor, a potent cardiac hypert rophic cytokine, activates the JAK/STAT pathway in rat cardiomyocytes. Circ Res 81: 656-663 Kohlhuber F, Rogers NC, Watling D, Feng J, Guschin D, Briscoe J, Witthuhn BA, Kotenko SV, Pestka S, Stark GR, Ihle JN, Kerr IM (1997) A JAK1/JAK2 chimera can sustain alpha and gamma interferon responses. Mol Cell Biol 17: 695-706 Kumar JM, Brooks DP, Olson BA, Laping NJ (1999) Sgk, a putative serine/threonine kinase, is differentially expressed in th e kidney of diabetic mice and humans. J Am Soc Nephrol 10: 2488-2494 Lang F, Klingel K, Wagner CA, Stegen C, W rntges S, Lanzendrfer M, Melzig J, Moschen I, Steuer S, Waldegger S, Sauter M, Paulmichl M, Gerke V, Risler T, Gamba G, Capasso G, Kandolf R, Hebert SC, Massry SG, Brer S (2000) Deranged transcriptional regulation of cell volume sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci U.S.A. 94: 8157-8162 Leduc I, Haddad P, Giasson E, Meloche S (1995) Involvement of a tyrosine kinase pathway in the growth-promoting eff ects of angiotensin II on aortic smooth muscle cells. Mol Pharmacol 48: 4582-4592 Lew DJ, Decker T, Strehlow I, Darnell JE (1991) Overlapping elem ents in the guanylatebinding protein gene promoter mediate transcriptional induction by alpha and gamma interferons. Mol Cell Biol 1: 182-191 Li X, Earp HS (1997) Paxillin is tyrosinephosphorylated by and pr eferentially associates with the calcium-dependent tyrosine ki nase in rat liver epithelial cells. J Biol Chem 272 : 14341-14348 Liu B, Liao J, Rao X, Kushner SA, Chung CD Chang DD, Shuai K ( 1998) Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci (U.S.A.) 95: 1062610631 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2Ct method. Methods 25: 402-408 Lukashova V, Chen Z, Duhe RJ, Rola-Pleszczy nski M, Stankova J (2003) Janus kinase 2 activation by the platelet-activating f actor receptor (PAFR): roles of Tyk2 and PAFR C terminus. J Immunol 171: 3794-3800 Maiyar AC, Huang AJ, Phu PT, Cha HH, Fire stone GL (1996) p53 stimulates promoter activity of the sgk serum/glucocorticoid-i nducible serine/threon ine protein kinase gene in rodent mammary epithelial cells. J Biol Chem 271: 12414-12422

PAGE 149

135 Maiyar AC, Phu AJ, Huang PT, Firestone GL (1997) Repression of glucocorticoid receptor transactivation and DNA binding in a glucocrticoid response element within the serum/glucocorti coid-inducible protein kinase (sgk) gene promoter by the p53 tumor suppressor protein. Mol Endocrinol 11: 312-329 Mann DL, Kent RL, Cooper G IV (1989) Load re gulation of the properties of adult feline cardiocytes: growth inducti on by cellular deformation. Circ Res 64: 1079-1090 Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontai ne P, Bernstein KE (1995) Direct stimulation of Jak/ STAT pathway by angiotensin II AT1 receptor. Nature 375: 247-250 Marks AR (1992) Calcium channels e xpressed in vascular smooth muscle. Circulation 86: 61-67 Mascareno E, El-Shafei M, Maulik N, Sa to M, Guo Y, Das DK, Siddiqui MAQ (2001) JAK/STAT signaling is associated with cardiac dysfunction during ischemia and reperfusion. Circulation 104: 325–329 Matsuoka H, Iwata N, Ito M, Shimoyama M, Nagata A, Chihara K, Takai S, Matsui T (1997) Expression of a kinase-defective Eph-like receptor in the normal human brain. Biochem Biophys Res Commun 235: 487-492 Menton I, Boot EP, Sussenbach JS, Steenbe rgh PH (1999) Growth hormone induces insulin-like growth factor-I gene transcri ption by a synergistic action of STAT5 and HNF-1alpha. FEBS Lett 444: 155-159 Meyer DJ, Campbell GS, Cochran BH, Arge tsinger LS, Larner AC, Finbloom DS, Carter-Su C, Schwartz J (1994) Growth hormone induces a DNA binding factor related to the inte rferon-stimulated 91-kDa transcription. J Biol Chem 269: 47014704 Mignery GA, Sdhof TC, Takei K, De Cam illi P (1989) Putative receptor for inositol 1,4,5-trisphosphate similar to ryanodine receptor. Nature 342: 192–195 Mignery GA, Newton CL, Archer BT Sdhof TC (1990) Structure and expression of the rat inositol 1,4,5-trisphosphate receptor. J Biol Chem 265: 12679–12685 Mikosz CA, Brickley DR, Sharkey MS, Mora n TW, Conzen SD (2001) Glucocorticoid receptor-mediated protection from apoptosis is associated wi th induction of the serine/threonine survival kinase gene, sgk1. J Biol Chem 276: 16649-16654 Modesti A, Bertolozzi I, Gamberi T, Marc hetta M, Lumachi C, Coppo M, Moroni F, Toscano T, Lucchese G, Gensini GF, Modesti PA (2005) Hyperglycemia activates JAK2 signaling pathway in human failing myocytes via angiotensin II-mediated oxidative stress. Diabetes 54: 394-401

PAGE 150

136 Murphy TJ, Alexander RW, Griendling KK, Rung e MS, Bernstein KE (1991) Isolation of a cDNA encoding the vascular t ype-1 angiotensin II receptor. Nature 351: 233-236 Naftilan AJ, Gilliland GK, Eldridge CS, Kr aft AS (1990) Induction of the protooncogene c-jun by angiotensin II. Mol Cell Biol 10: 5536-5540 Nakagawa T, Okano H, Furuichi T, Aruga J, Mikoshiba K (1991) The subtypes of the mouse Inositol 1,4,5-trisphosphate receptor are expressed in a expressed in a tissuespecfic and developmentally specific manner. Proc Natl Acad Sci USA 88: 62446248 Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, Fejes-Toth G (1999) sgk is an aldosterone-induced kinase in the rena l collecting duct. Effe cts on epithelial Na+ channels. J Biol Chem 274: 16973-16978 Narazaki M, Witthuhn BA, Yoshida K, Silvennoinen O, Yasukawa K, Ihle JN, Kishimoto T, Taga T (1994) Activation of JAK2 kina se mediated by the interleukin 6 signal transducer gp130. Proc Natl Acad Sci USA 91: 2285-2289 Negoro S, Kunisada K, Tone E, Funamoto M, Oh H, Kishimoto T, Yamauchi-Takihara K (2000) Activation of JAK/STAT pathway tr ansduces cytoprotective signal in rat acute myocardial infarction. Cardiovasc Res 47: 797–805 Neubauer H, Cumano A, Muller M, Wu H, Huffs tadt U, Pfeffer K (1998) Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell 93: 397-409 Ooi GT, Hurst KR, Poy MN, Rechler MM, Bo isclair YR (1998) Binding of STAT5a and STAT5b to a single element resembling a gamma-interferon-activated sequence mediates the growth hormone induction of the mouse acid-labile subunit promoter in liver cells. Mol Endocrinol 12: 675-687 Pan J, Fukuda K, Kodama H, Makino S, Taka hashi T, Sano M, Hori S, Ogawa (1997) Role of angiotensin II in activation of the JAK/STAT pathway induced by acute pressure overload in the rat heart. Circ Res 81: 611-617 Pan J, Fukuda K, Saito M, Matsuzaki J, K odama H, Sano M, Takahashi T, Kato T, Ogawa S (1999) Mechanical stretch activ ates the JAK/STAT pathway in rat cardiomyocytes. Circ Res 84: 1127-1136 Parganas E, Wang D, Stravopodis D, Topha m DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, Van Deursen JM, Grosveld G, Ihle JN (1998). Jak2 is essential for signaling through a va riety of cytokine receptors. Cell 93: 385-395 Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, Hemmings BA (1999) Serum and glucocorticoid-inducible kinase (SGK) is a target of PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024-3033

PAGE 151

137 Park OK, Schaefer TS, Nathans D (1996) In vi tro activation of Stat 3 by epidermal growth factor receptor kinase. Proc Natl Acad Sci (U.S.A.) 93: 13704-13708 Patel S, Joseph SK, Thomas AP (1999) Molecular properties of inositol 1,4,5trisphosphate receptors. Cell Calcium 25: 247-264 Peeler TC, Conrad KM, Baker KM (1996) Endot helin stimulates sisinducing factor-like DNA binding activity in CHO-K1 ce lls expressing ETA receptors. Biochem Biophys Res Comm 221: 62-66 Rome S, Clement K, Rabasa-Lhoret R, Loiz on E, Poitou C, Barsh GS, Riou JP, Laville H (2003) Microarray profiling of human skeletal muscle reveals that insulin regulates approximately 800 genes during a hyperinsulinemic clamp. J Biol Chem 278: 18063-18068 Rosler A, Theodor R, Gazit E, Biochis H, Rabinowitz D (1973) Salt-wasting, raised plasma-renin activity, and normal or hi gh plasma-aldosterone: a form of pseudohypoaldosteronism. Lancet 1: 959-962 Rozovskaia T, Ravid-Amir O, Tillib S, Getz G, Feinstein E, Agrawal H, Nagler A, Rappaport EF, Issaeva I, Matsuo Y, Kees UR Lapidot T, Lo Coco F, Foa R, Mazo A, Nakamura T, Croce CM, Cimino G, Domany E, Canaani E (2003) Expression profiles of acute lymphoblastic and myeloblastic leukemias with ALL-1 rearrangements. Proc Natl Acad Sci (U.S.A.) 100: 7853-7858 Rui H, Kirken RA, Farrar WL (1994) Activatio n of receptor-associated tyrosine kinase JAK2 by prolactin. J Biol Chem 269: 5364-5368 Sadoshima J, Aoki H, and Izumo S (1997) Angiotensin II and serum differentially regulate expression of cyclins, activit y of cyclin-dependent kinases, and phosphorylation of retinoblastoma gene product in neonatal cardiac myocytes. Circ Res 80: 228-241 Sadoshima J, Izumo S (1993) Molecular ch aracterization of a ngiotensin II–induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fi broblasts: critical role of the AT1 receptor subtype. Circ Res 73: 413-423 Sadoshima J, Izumo S (1996) The heterotrimeric G protein-coupled AngII receptor activates p21ras via tyrosine kinase-Shc-Grb2Sos pathway in cardiac myocytes. EMBO J 15 : 775-787 Sadoshima J, Jahn L, Takahashi T, Kulik TJ Izumo S (1992) Molecu lar characterization of the stretch-induced adaptation of cultu red cardiac cells: an in vitro model of load-induced cardiac hypertrophy. J Biol Chem 267: 10551-10560 Saharinen P, Takaluoma K, Silvennoinen O ( 2000) Regulation of the Jak2 tyrosine kinase by its pseudokinase domain. Mol Cell Biol 20: 3387-3395

PAGE 152

138 Saharinen P, Silvennoinen O (2002) Th e psuedokinase domain is required for suppression of basal activity of Jak2 and Jak3 tyrosine kinases and for cytokineinducible activation of signal transduction. J Biol Chem 277: 47954-47963 Sandberg EM, Ma X, VonDerLinden D, Gode ny MD, Sayeski PP (2004) Jak2 tyrosine kinase mediates angiotensin II-dependent inactivation of ERK2 via induction of mitogen-activated protein kinase phosphatase 1. J Biol Chem 279: 1956-1967 Santella L (1998) The role of calcium in the cell cycle: facts and hypotheses. Biochem Biophys Res Commun 244: 317-324 Sasaguri T, Teruya H, Ishida A, Abumiya T, Ogata J (2000) Linkage between alpha(1) adrenergic receptor and the Jak/STAT signaling pathway in vascular smooth muscle cells. Biochem Biophys Res Comm 268: 25-30 Sasaki K, Yamano Y, Bardhan S, Iwan N, Murray JJ, Hasegawa M, Matsuda Y, Inagami T (1991) Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature 351: 230-233 Sayeski PP, Ali MA, Harp JB, Marrero MB, Bernstein KE (1998) Phosphorylation of p130Cas by angiotensin II is depend ent on c-Src, intracellular Ca2+, and protein kinase C. Circ Res 82: 1279–1288 Sayeski PP, Ali MS, Safavi A, Lyles M, Kim S, Frank SJ, Be rnstein KE (1999a) A catalytically active Jak2 is required for th e angiotensin II-depe ndent activation of Fyn. J Biol Chem 274: 33131-33142 Sayeski PP, Ali MS, Hawks K, Frank SJ, Bernstein KE (1999b) The angiotensin IIdependent association of Jak2 and c-Src requires the N-terminus of Jak2 and the SH2 domain of c-Src. Circ Res 84: 1332-1338 Sayeski PP, Kudlow JE (1996) Glucose metabolism to glucosamine is necessary for glucose stimulation of tr ansforming growth factor-a lpha gene transcription. J Biol Chem 271: 15237-15243 Schieffer B, Bernstein KE, Marrero MB (1996) The role of tyrosine phosphorylation in angiotensin II mediated intr acellular signa ling and growth J Mol Med 74: 85-91 Schindler C, Darnell JE Jr (1995) Transcri ptional responses to polypeptide ligands: the JAK-STAT pathway. Annual Rev Biochem 64: 621-651 Schindler C, Shuai K, Prezioso VR, Darnell JE Jr (1992) Interfer on-dependent tyrosine phosphorylation of a latent cyto plasmic transcription factor. Science 257: 809-813 Schindler U, Wu P, Rothe M, Brasseur M, McKnight SL (1995) Components of a Stat recognition code: eviden ce for two layers of molecular selectivity. Immunity 6: 689-697

PAGE 153

139 Schnabel R, Lackner KJ, Rupprecht HJ, Espi nola-Klein C, Torzewski M, Lubos E, Bickel C, Cambien F, Tiret L, Munzel T, Blankenberg S (2005) Glutathione peroxidase-1 and homocysteine for cardiovas cular rsik prediction: result from the AtheroGene study. J Am Coll Cardiol 45: 1631-1637 Schunkert H, Sadoshima J, Cornelius T, Kaga ya Y, Weinberg EO, Izumo S, Riegger G, Lorell BH (1995) Angiotensin II–induced gr owth responses in isolated adult rat hearts: evidence for load-independent i nduction of cardiac protein synthesis by angiotensin II. Circ Res 76: 489-497 Seidel HM, Milocco LH, Lamb P, Darnell JE Jr, Stein RB, Rosen J (1995) Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcri ption) DNA binding and tr anscriptional activity. Proc Natl Acad Sci USA 7: 3041-3045 Seki Y, Kai, H, Shibata R, Nagata T, Ya sukawa H, Yoshimura A, Imaizumi T (2000) Role of the JAK/STAT pathway in rat car otid artery remode ling after vascular injury. Circ Res 87: 12-18 Sells MA, Knaus UG, Bagrodia S, Ambrose DM, Bokoch GM, Chernoff J (1997) Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr Biol 7: 202-210 Shanahan CM, Weissberg PL (1998) Smooth mu scle cell heterogeneity : patterns of gene expression in vascular smooth musc le cells in vitro and in vivo. Aterioscler Thromb Vasc Biol 18: 333-338 Shibata R, Kai H, Seki Y, Kato S, Wada Y, Hanakawa Y, Hashimoto K, Yoshimura A, Imaizumi T (2003) Inhibition of STAT 3 prevents neointima formation by inhibiting proliferation and promoting apoptos is of neointimal smooth muscle cells. Hum Gene Ther 12: 601-610 Shigaev A, Asher C, Latter H, Garty H, Reuveny E (2000) Regulation of sgk by aldosterone and its effects on th e epithelial Na(+) channel. Am J Physiol 278: F613-F619 Shirai H, Takahasho K, Katada T, Inagami T (1995) Mapping of G protein coupling sites of the angiotensin II type 1 receptor. Hypertension 25: 26-730 Short AD, Bian J, Ghosh TK, Waldron RT, Rybak SL, Gill DL (1993) Intracellular Ca2+ pool content is linked to control of cell growth. Proc Natl Acad Sci USA 90: 49864990 Shuai K, Schindler C, Prezioso VR, Darnell JE Jr (1992) Activati on of transcription by IFN-gamma: tyrosine phosphorylatio n of a 91-kD DNA binding protein. Science 258: 808-1812

PAGE 154

140 Silvennoinen O, Witthuhn BA, Quelle FW, Clevel and JL, Yi T, Ihle JN (1993) Structure of the murine Jak2 protein-tyrosine kinase and its role in interleukin 3 signal transduction. Proc Natl Acad Sci (USA) 90: 8429-8433 Sipma H, Deelman L, Smedt HD, Missiaen L, Parys JB, Vanlingen S, Henning RH, Casteels R (1998) Agonist-induced down-regua ltion of type 1 and type 3 inositol 1,4,5-triphosphate receptors in A7r5 and DDT1 MF-2 smooth muscle cells Cell Calcium 23 : 11-21 Smit LS, Meyer DJ, Billestruo N, Norstedt G, Schwartz J, Carter-Su C (1996) The role of the growth hormone (GH) receptor and JAK1 and JAK2 kinases in the activation of Stats 1, 3, and 5 by GH. Mol Endocrinol 10: 519-533 Smit LS, Vanderkuur JA, Stimage A, Han Y, Luo G, Yu-Lee LY, Schwartz J, Carter-Su C (1997) Growth hormone-induced tyro syl phosphorylation and deoxyribonucleic acid binding activity of Stat5A and Stat5B. Endocrinology 138: 3426-3434 Snyder PM, Olsen DR, Thomas BC (2002) Seru m and glucocorticoid-regulated kinase modulates Nedd4-2-mediated inhi bition of the epithelial Na+ channel J Biol Chem 277: 5-8 Staub O, Gautschi I, Ishikawa T, Breits chopf K, Ciechanover A, Schild L, Rotin D (1997) Regulation of stability and functi on of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J 16: 6325-6336 Stephanou A, Brar BK, Scarabelli TM, Jona ssen AK, Yellon DM, Marber MS, Knight RA, Latchman DS (2000) Ischemia-induced STAT-1 expression and activation play a critical role in cardiomyocyte apoptosis. J Biol Chem 275: 10,002–10,008 Stofega MR, Argetsinger LS, Wang H, U llrich A, Carter-Su C (2000) Negative regulation of growth hormone receptor/Jak2 signaling by signal regulatory protein alpha. J Biol Chem 275: 28222-28229 Subramanian A, Teixeria J, Wang J, Gil G (1995) A STAT factor mediates the sexually dimorphic regulation of hepatic cytoch rome P450 3A10/lithocholic acid 6 betahydroxylase gene expression by growth hormone. Mol Cell Biol 15: 4672-4682 Takahashi T, Shirasawa T (1994) Molecular cl oning of rat JAK3, a novel member of the JAK family of protein tyrosine kinases. FEBS Letters 342: 124-128 Tanner JW, Chen W, Young RL Longmore GD, Shaw AS (1995) The conserved box 1 motif of cytokine receptors is require d for association with JAK kinases. J Biol Chem 270: 6523-6530 Taubman MB, Berk BC, Izumo S, Tsuda T, Alexander RW and Nadal-Ginard B (1989) Angiotensin II induces c-fos mRNA in aortic smooth muscle cells. J Biol Chem 264: 526-530

PAGE 155

141 Taylor CW, Genazzani AA, Morris SA (1996) Expression of inositol triphosphate receptors. Cell Calcium 26: 237-251 Thyberg J, Blomgren K, Hedin U, Dryjsk i M (1995) Phenotypic modulation of smooth muscle cells during the form ation of neointimal thicke nings in the rat carotoid artery after ballon injury: an electro n-microscopic and stereological study. Cell Tissue Res. 281: 421-433 Timmermans PB, Wong PC, Chiu AT, Herblin WF, Benfield P, Carini DJ, Lee RJ, Wexler RR, Saye JA, Smith RD (1993) Angi otensin II receptors and angiotensin II receptor antagonists. Pharmocol Res 45: 205-251 Timmermans PB (1999) Angiotensin II receptor anatagonists: an emerging new class of cardiovascular therapeutics. Hypertens Res 22 : 147-53 Toufektsian MC, Boucher F, Pucheu S, Ta nguy S, Ribout C, Sanou D, Tresallet N, de Leiris J, (2000) Effects of selenium defi ciency on the response of cardiac tissue top ischemia and reperfusion. Toxicol 148: 125-132 VanderKuur J, Allevato G, Billestrup N, Norstedt G, Carter-Su C (1995) Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2. J Biol Chem 270: 7587-7593 Venardos K, Ashton K, Headrick J, Perkins A (2005) Effects of dietary selenium on postischemic expression of antioxidant mRNA. Mol Cell Biochem 270: 131-138 Venardos K, Harrison G, Headrick J, Perk ins A (2004) Effects of dietary selenium on glutathione peroxida se and thioredoxin reductase activity and recovery from cardiac ischemia-reperfusion. J Trace Elem Med Biol 18: 81-88 Viard I, Hall SH, Jaillard C, Berthelon MC, Saez JM (1992) Regulation of c-fos, c-jun and jun-B messenger ribonucleic acids by a ngiotensin II amd corticotrophin in ovine and bovine adrenocortical cells. Endocrinol 130: 1193-1200 VonDerLinden D, Ma X, Sandberg EM, Ge rnert K, Bernstein KE, Sayeski PP(2002) Mutation of glutamic acid residue 1046 a bolishes Jak2 tyrosine kinase activity. Mol Cell Biochem 241: 87-94 Waldegger S, Barth P, Raber G, Lang F (1997) Cloning and characterization of a putative human serine/threonine protei n kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440-4445 Waldegger S, Barth P, Forrest JN Jr, Greg er R, Lang F (1998) Cl oning of sgk serine-threonine protein kinase from shark rect al gland-a gene induced by hypertonicity and secretagogues. Pflgers Arch 436 : 575-580

PAGE 156

142 Waldegger S, Klingel K, Barth P, Sauter M, Lanzendrfer M, Kandolf R, Lang F (1999) h-sgk serine-threonine protei n kinase gene as transcrip tional target of transforming growth factor beta in human intestine. Ga stroenterology 116 1081-1088 Waldegger S, Gabrysch S, Barth P, Fill on S, Lang F (2000) h-s gk serine threonine protein kinase as transcriptional targ et of p38/MAP kinase pathway in HepG2 human hepatoma cells. Cell Physiol Biochem 10: 203-208 Waldron RT, Short AD, Meadows JJ, Ghosh TK, Gill DL (1994) Endoplasmic reticulum calcium pump expression and control of cell growth. J Biol Chem 269: 1192711933 Wallace TW, VonDerLinden D, He K, Frank SJ, Sayeski PP (2004) Microarray analyses identify Jak2 tyrosine kinase as a ke y mediator of ligand-independent gene expression. Am J Physiol Cell Physiol 287: C981-991 Wallace TW, Xia SL, Sayeski PP (2005) Jak2 ty rosine kinase prevents angiotensin IImediated inositol 1,4,5 trisphosphate r eceptor degradation. Vascul Pharmacol 43: 336-345 Wang J, Barbry P, Maiyar AC, Rozansky DJ, Bhargava A, Leong M, Firestone GL, Pearce D (2001) SGK integrates insulin and mineralcorticoid regulation of epithelial sodium transport. Am J Physiol Renal 280: F303-F313 Wang X, Seed B (2003) A PCR primer bank fo r quantitative gene expression analysis. Nucleic Acids Res 31: 1-8 Watling D, Guschin D, Muller M, Silvenno inen O, Witthuhn BA, Quelle FW, Rogers NC, Schindler C, Stark GR, Ihle JN, Kerr IM (1993) Complementation by the protein tyrosine kinase JAK2 of a muta nt cell line defective in the interferongamma signal transduction pathway. Nature 366: 166-170 Waxman DJ, Ram PA, Park SH, Choi HK ( 1995) Intermittent plasma growth hormone triggers tyrosine phosphoryl ation and nuclear transloc ation of a liver-expressed, Stat 5-related DNA binding pr otein. Proposed role as an intracellular regulator of male-specific liver gene transcription. J Biol Chem 270: 13262-13270 Webster MK, Goya L, Ge Y, Maiyar AC, Fi restone GL (1993a) Characterization of sgk, a novel member of the serine/threonine pr otein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13 : 20312040 Webster MK, Goya L, Firestone GL (1993b) Immediate-early transc riptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem 268: 11482-11485

PAGE 157

143 Wen T, Bukczynski J, Watts TH (2002) 4-1BB ligand-mediated costimulation of human T cells induces CD4 and CD8 T cell e xpansion, cytokine production, and the development of cytolytic effector function. J Immunol 168: 4897-906 Wilkerson MK, Heppner TJ, Bonev AD, Ne lson MT (2005) Inositol trisphosphate receptor calcium release is required for cer ebral artery smooth mu scle proliferation. Am J Physiol Heart Circ Physiol [Epub ahead of print] Wilks AF, Harpur AG, Kurban RR, Ralph SJ Zurcher G, Ziemiecki A (1991) Two novel protein-tyrosine kinases, each with a second phosphotransferase -related catalytic domain, define a new cl ass of protein kinase. Mol Cell Biol 11: 2057-2065 Witthuhn BA, Quelle FW, Silvennoinen O, Yi T, Tang B, Miura O, Ihle JN (1993) JAK2 associates with the erythropoietin recept or and is tyrosine phosphorylated and activated following stimul ation with erythropoietin. Cell 74: 227-236 Wojcikiewicz RJ (1995) Type I, II, a nd III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation a nd are expressed in markedly different proportions in different cell types. J Biol Chem 270: 11678-11683 Wolf SC, Schultze M, Sauter G, Risler T, Brehm BR (2004) E ndothelin-1 increases serum-glucocorticoid-regulated kinase-1 expression in smooth muscle cells. J Cardiovasc Pharmacol 44: S304-S306 Wulff P, Vallon V, Huang DY, Volkl H, Yu F, Richter K, Jansen M, Schlunz K, Klingel K, Loffing J, Kauselmann G,Bosl MR, Lang F, Kuhl D (2002) Impaired renal Na(+) retention in th e sgk-knockout mouse. J Clin Invest 110: 1263-1268 Xia K, Mukhopadhyay NK, Inhorn RC, Barber DL, Rose PE, Lee RS, Narsimhan RP, D'Andrea AD, Griffin JD, Roberts TM ( 1996) The cytokine-activated tyrosine kinase JAK2 activates Raf-1 in a p21ras-dependent manner. Proc Natl Acad Sci U S A 93: 11681-11686 Xia SL, Wang L, Cash MN, Teng X, Schw albe RA, Wingo CS (2004) Extracellular ATP-induced calcium signaling in mIMCD3 cells requires both P2X and P2Y purinoceptors. Am J Physiol Renal Physiol 287: F204-214 Xuan YT, Guo Y, Han H, Y Zhu, Bolli R ( 2001) An essential role of the JAK–STAT pathway in ischemic preconditioning. Proc Natl Acad Sci USA 98: 9050–9055 Yi W, Kim SO, Jiang J, Park SH, Kraft AS, Waxman DJ, Frank SJ (1996) Growth hormone receptor cytoplasmic domain differentially promotes tryrosine phosphorylation of signal transducers and activators if transcription 5b and 3 by activated Jak2 kinase. Mol Endocrinol 10: 1425-1443

PAGE 158

144 Yonemura S, Hirao M, Doi Y, Takahashi N, Kondo T, Tsukita S, Tsukita S (1998) Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytopl asmic domain of CD44, CD43, and ICAM-2. J Cell Biol 140: 885-895 Yoshida Y, Imai S (1997) Structure and func tion of inositol 1,4,5-trisphosphate receptor. Jpn J Pharmacol 74: 125-137 Zhao YM, Wagner F, Frank SJ, Kraft AS (1995) The amino-terminal portion of the JAK2 protein kinase is necessary for binding and phosphorylation of the granulocytemacrophage colony-stimulating f actor receptor beta c chain. J Biol Chem 270: 13814-13818 Zhu T, Goh EL, Lobie PE (1998) Growth hormone stimulates the tyrosine phosphorylation and association of p125 focal adhesion kinase (FAK) with JAK2. FAK is not required for STAT-mediated transcription. J Biol Chem 273: 1068210689 Zhuang H, Patel SV, He TC, Sonste by SK, Niu Z, Wojchowski DM (1994) Dominant negative effects of a car boxy-truncated Jak2 mutant on Epo-induced proliferation and Jak2 activation. J Biol Chem 269: 21411-21414

PAGE 159

145 BIOGRAPHICAL SKETCH Tiffany A. Wallace was born on Novemb er 16, 1979, in the small suburb of Vernon, New Jersey. As a child, Tiffany always ma intained a love of science. Her initial career aspirations included becoming a ve terinarian and making documentaries for National Geographic Tiffany’s interest in research specifically was sparked during her undergraduate studies at Monmouth Universit y. While pursuing her degree in biology, she worked under Dr. Dennis Rhoads to inve stigate neurotransmitter release in sea anemones. In the spring of 2001, Tiffa ny graduated with honors from Monmouth University with a B.S. degree in biology and dual minors in chemistry and business. In pursuit of a Ph.D., she moved to Gainesville, Florida in th e summer of 2001 and enrolled in the Interdisciplinary Program in Biomedical Sciences at the University of Florida. Following the completion of her first year, Ti ffany joined the Department of Physiology and Functional Genomics and began her gradua te thesis work under the guidance of Dr. Peter Sayeski. Her primary area of interest included elucidating angiotensin II signaling through the tyrosine kinase, Jak2. She will earn her doctorate in December 2005.


Permanent Link: http://ufdc.ufl.edu/UFE0012904/00001

Material Information

Title: The Role of Jak2 Tyrosine Kinase in Regulating Angiotensin II-Mediated Cellular Transcription
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012904:00001

Permanent Link: http://ufdc.ufl.edu/UFE0012904/00001

Material Information

Title: The Role of Jak2 Tyrosine Kinase in Regulating Angiotensin II-Mediated Cellular Transcription
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012904:00001


This item has the following downloads:


Full Text












THE ROLE OF JAK2 TYROSINE KINASE IN REGULATING ANGIOTENSIN II-
MEDIATED CELLULAR TRANSCRIPTION
















By

TIFFANY A. WALLACE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005





























Copyright 2005

by

Tiffany A. Wallace

































This dissertation is dedicated to my parents, for their constant love, support, and wisdom.
















ACKNOWLEDGMENTS

I would like to acknowledge the many people who have helped me along the way.

First, I would like to thank my mentor, Dr. Peter Sayeski. Peter has exhibited

extraordinary patience and guidance throughout my time as a graduate student. Peter's

constant encouragement pushed me to achieve my goals and his wisdom proved

invaluable to my graduate career. I thank him for sharing in the laughter, helping through

the tears, and providing answers to my countless questions. Peter has superceded the

roles of a mentor to become something even more valuable, a friend.

Next, I would like to thank the members of my supervisory committee: Dr.

Hideko Kasahara, Dr. Sally Litherland, and Dr. Colin Sumners. Their advice and

guidance were invaluable to my successes in graduate school.

For technical assistance, I would like to extend warm thanks to Dr. Shen-Ling Xia

for his collaboration with my calcium studies. I could not have completed my IP3

receptor experiments without his expertise in calcium signaling and his determination for

success.

In addition, I would like to thank the members of the Sayeski Lab, past and present:

Michael Godeny, Melissa Johns, Xianyue Ma, Issam McDoom, Eric Sandberg,

Jacqueline Sayyah, and Dannielle VonDerLinden. I thank them for providing an

environment that encouraged success. I am grateful for the lifelong friendships I have

established throughout my time in this lab.









I would next like to express my heartfelt gratitude to my closest friends. I thank

them for allowing this chapter of my life to be filled with countless memories. Thanks to

them, there has proven to be no better remedy for stress than comic relief.

And lastly, I would like to thank my loving parents, Joseph and Catherine

Wallace. Specifically, I thank my Mom for teaching me how to laugh at myself when I

take life too seriously, and for being a pillar of support through the difficult times. She is

truly my best friend. And I thank my Dad, who raised me to always believe that I can

achieve beyond what I thought to be within my grasp. His constant encouragement and

promise of a wonderful "payoff" have helped me to not only set my goals but, more

importantly, achieve them.
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .............. .................................. ........ ... .... .............

LIST OF FIGURES ......... ......................... ...... ........ ............ xi

A B S T R A C T .............................................. ..........................................x iii

CHAPTER


1 IN TR OD U CTION ............................................... .. ......................... ..

Jak2 Tyrosine K inase .................. ............................. ......... .............. .
H isto ry ............................................................... ..................................... 1
Structure ....................................... ..............
Jak/STA T Signaling Paradigm ................................... .............................. ....... 4
Cytokine and grow th factor receptors ........................................ .................4
Seven transmembrane spanning receptors .............................................6
D ow nstream Targets of Jak2 ........................................ ........................... 7
Jak2 and Cardiovascular D disease ........................................ ....... ............... 8
The R enin A ngiotensin System .................................... .................... ... ............. 11
A n g ioten sin II ............................................................................. 1 1
A T 1 R ec ep to r ................ ............................................................ 12
Structure and function ......... ................. ............................. .... ........... 12
Tyrosine kinase signaling cascades....................... ... .... ........... 12
Inositol 1,4,5 Trisphosphate (IP3) Receptor .................................... ............... 13
Stru cture an d F u n action ........................................... ....................................... 14
Regulation of the IP3 Receptor............... ............................... .................. 15
Serum- and Glucocorticoid-Regulated Kinase 1 (SGK1) .......................................16
Background and Function............................ ................................. 16
Transcriptional Regulation of sgk ........................................ ............... 18
Sum m ary and R ationale........................................... ................... ............... 20

2 JAK2 TYROSINE KINASE IS A KEY MEDIATOR OF LIGAND-
INDEPENDENT GENE EXPRESSION......................................... ............... 21

In tro d u ctio n ...................................... ................................................ 2 1









M materials and M methods ................................ ....................... ............... 23
Creation of Stable Cell Lines/ Cell Culture............................................. 23
Immunoprecipitation/ Western Blot/ Analysis................ .....................24
Preparation of Total and Poly (A)+ mRNA ............................... ............... 25
Probe Preparation and Affymetrix Chip Hybridization .............. ...............26
M icroarray D ata A nalysis......................................................... ............... 27
N northern A naly sis.......... ........................................ ................ .. .... ...... 27
Q uantitative R T -PC R ................................................ .............................. 27
L u ciferase A ssay ......................... ............................ .. ........ .... ...... ...... 2 8
R e su lts ................................ .... ..... .... ... ......... .. ... .. ....... .. ............... 2 8
Characterization of Jak2 Expression in the Stably Transfected y2A Cells .........28
Microarray Analysis Demonstrates that Jak2 Mediates the Expression of
M any D iverse G enes............................... ................................................. 30
Validation of Jak2-dependent Gene Expression in y2A and y2A/Jak2 Cells......35
Suppression of Endogenous Jak2 Kinase Activity via Over Expression of a
Jak2 Dominant Negative Allele Similarly Inhibits Jak2-dependent Gene
E x p ressio n .................. ........... ..... .... .. .......... ...... ...... ................... 3 8
Jak2 is a Critical Mediator of Both Basal Level and Ligand-induced Gene
Transcription ................................ .......................... ... .........40
D iscu ssio n ...................................................................... .................... 4 7

3 IDENTIFICATION OF JAK2 TARGETS IN RESPONSE TO ANGIOTENSIN II
SIG N A LIN G ........................................................................................... ........52

Introdu action ...................................... ................................................. 52
M materials and M methods ....................................................................... ..................54
C e ll C u ltu re ................................................................................................... 5 4
Preparation of Total RN A ............................................................................54
M icroarray Expression Profiling ...................................................................... 54
R esu lts ..................................................................... ............................. 56
Microarray Analysis of Jak2-dependent Gene Transcription Following 4
hours of A ngII Treatm ent ............... ... .. .. ..... ................................... 56
Statistical Analysis of the Affymetrix Microarray Replicated Experiments .......60
Microarray Analysis of Jak2-dependent Gene Transcription Following 1 hour
of A ngII Treatm ent ........................................... .. ............... ............. 60
D discussion ................................... .................. ............... ........... 62

4 ANGIOTENSIN II INDUCES SGK1 GENE EXPRESSION VIA A JAK2-
DEPENDENT MECHANISM ............................................................................65

In tro du ctio n ...................... .. .. ......... .. .. ............................................... 6 5
M materials and M methods ....................................................................... ..................67
C e ll C u ltu re ..................................................................... 6 7
Q uantitative R T -PC R ................................................ .............................. 67
N northern A naly sis............ ............................................................ .... .... .... 68
W western B lot A n aly sis.............................................................. .....................6 8
L u ciferase A ssay ......................... ............................ .. ........ .... ...... ...... 69









Chromatin Immunoprecipitation (ChIP) Assay..........................................69
R e su lts ............... ......... ....... ..... .......... ................................................. 7 0
AngII Induces sgkl Gene Expression in a Jak2-dependent Manner ................. 70
Jak2 is Critical For AngII-mediated Increases in SGK1 Protein Levels.............72
AngII, but not Growth Hormone, Causes Activation of the sgkl Promoter in
Jak2-expressing C ells ................ ................ .... .. .. ......... .. ........ .... 73
AngII Causes STAT1 Association with the sgkl Promoter Region in
y2 A /Jak 2 C ells .....................................................................74
D iscu ssion ......... ........... .......... ................ ............................76

5 JAK2 PREVENTS ANGIOTENSIN II-MEDIATED INOSITOL 1,4,5
TRISPHOSPHATE RECEPTOR DEGRADATION...........................................80

Introduction ............... .... .. ......... ............. ............ ............ 80
M materials and M methods ....................................................................... ..................8 1
C e ll C u ltu re ................................................................................................... 8 1
Q uantitative R T -PC R ................................................ .............................. 82
W western B lot A analysis ................................................. ............. ............... 82
Im m unofl u orescence ........................................ .............................................83
C alciu m Stu dies .............................................. ................. 84
R e su lts ................................................................................ ... .. .. ................. 8 5
Jak2 Regulates IP3 receptor Gene Expression Following Treatment With
A ngII ............... .. ................... ..................... .......... ..... ................ ... 85
Cells Lacking Functional Jak2 Undergo AngII-mediated Degradation of the
IP 3 re c e p to r.......................................... ................ ......... .........................8 7
RASM-WT Cells Treated With AG490 Recapitulate AngII-mediated IP3
receptor Degradation in RASM-DN Cells........................ .................89
AngII-mediated IP3 receptor Degradation is Reversible Following Recovery
F rom A ngII ............................ ................................................. 9 1
AngII-inducible Degradation of the IP3 receptor Occurs via the AT1 receptor
and Through a Proteosome-dependent Mechanism....................... ............92
Immunofluorescence Experiments Demonstrate that IP3 receptor in RASM-
DN Cells is Rapidly Degraded Following AngII Treatment .........................93
RASM-DN cells Have a Reduction in AngII-induced Calcium Mobilization
When Compared to RASM-WT Cells......................................................94
Inhibition of Fyn Tyrosine Kinase Results in a Reduction of IP3 receptor
E x p re ssio n ............................. .................................................. ............... 9 5
D iscu ssio n ...................................... ................................................. 9 7

6 CONCLUSIONS AND IMPLICATIONS .................................... ...............102

Ligand-Independent Activation of Jak2 .......................................... .... ..................102
Transcriptional Roles of Jak2 in Response to Angiotensin II Signaling ................04
AngII Induces sgkl Transcription ....................................... ...................... 106
Jak2 Regulates AngII-mediated IP3 receptor Degradation.............................108









APPENDIX

A JA K 2-D EPEN D EN T G EN E S .................................................................................111

B CYTOKINE-INDUCIBLE JAK2-DEPENDENT GENES ..................................... 125

L IST O F R E F E R E N C E S ...................................................................... ..................... 127

BIOGRAPHICAL SKETCH .............................................................. ...............145
















LIST OF TABLES


Table page

1-1 Activators of sgkl gene transcription.................................................. 19

2-1 Summary of Jak2-dependent genes............ .................... ...............34

2-2 Summary of microarray validations...................................................................... 40

3-1 Jak2-dependent genes following 4 hours of AngII treatment .............................60

3-2 Jak2-dependent genes following 1 hour of AngII treatment................................62
















LIST OF FIGURES


Figure p

1-1 Summary of the Jak2 structural domains ................................................. 3

1-2 Jak/STA T signaling paradigm .......................... ............. ................. ............... 5

2-1 Characterization of Jak2 expression in y2A-derived cells .......... ................... 29

2-2 Global Analysis of Jak2-dependent gene expression. .............................................31

2-3 Venn Diagrams illustrating the number of up and down regulated genes
consistent between the two replicated experiments. ..............................................32

2-4 Confirmation of Jak2-dependent gene expression in the y2A and y2A/Jak2 cells
via N northern blot analysis .............................................. .............................. 36

2-5 Confirmation of Jak2-dependent gene expression in the y2A and y2A/Jak2 cells
via quantitative RT-PCR ........... .. ............... ................. .................... 37

2-6 Confirmation of Jak2-dependent gene expression in the RASM DN and RASM
W T cells via quantitative RT-PCR ...................................... ......................... 39

2-7 Jak2 plays a key role in basal, as well as ligand activated, gene transcription ........44

2-8 A Jak2 mutant that possesses only basal level kinase activity, significantly
influences gene transcription...................... ...... ............................. 47

3-1 Summary of the number of differentially expressed genes identified by the
microarray experiments following 4 hours of AngII treatment. ............................58

3-2. Scatter plot analysis of all genes identified during microarray expression
profiling of y2A cells verse y2A/Jak2 cells treated for 4 hours with AngII.............59

4-1 Activation of sgkl transcription by AngII requires Jak2. ..................................71

4-2 Jak2-expressing cells have a greater increase in sgkl gene expression than Jak2-
d eficien t cells ....................................................................... 7 2

4-3 Western blot analysis of SGK1 protein expression in y2A cells compared to
y2A/Jak2 cells following treatment with AngII. .................. ................... .......... 73









4-4 AngII activates the sgkl promoter in a ligand specific manner. ...........................75

4-5 AngII causes STAT1 association with the sgkl promoter in y2A/Jak2 cells...........77

5-1 Cells having little to no functional Jak2 protein have a greater increase in IP3
receptor gene expression than when compared to cells expressing Jak2................86

5-2 Cells lacking functional Jak2 undergo AngII-mediated degradation of the IP3
recep to r .................................................................................. 8 8

5-3 RASM-WT cells treated with AG490 recapitulates AngII-mediated IP3 receptor
degradation seen using RASM -DN cells ...................................... ............... 90

5-4 AngII-mediated IP3 receptor degradation is reversible following recovery from
A ngII ..... ..................................................................................9 1

5-5 IP3 receptor degradation is dependent upon AngII and occurs through a
proteasom e-dependent m echanism ............................................... ............... 92

5-6 The IP3 receptor is rapidly degraded following AngII treatment.............................94

5-7 Functional difference of RASM-WT and RASM-DN cells in response to AngII ...96

5-8 Inhibition of Fyn tyrosine kinase results in a reduction of IP3 receptor
expression ............................................................................................. .97

5-9 Proposed model for regulation of IP3 receptor via Jak2................ ..................98

6-1 Comparison between previous and current signaling paradigms of Jak2 .............104















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE ROLE OF JAK2 TYROSINE KINASE IN REGULATING ANGIOTENSIN II-
MEDIATED CELLULAR TRANSCRIPTION

By

Tiffany A. Wallace

December 2005

Chair: Peter P. Sayeski
Major Department: Physiology and Functional Genomics

Jak2 tyrosine kinase is activated by angiotensin II (AngII) via the AT1 receptor.

This activation has been implicated in the progression of various cardiovascular disease

states. Unfortunately, the precise downstream targets of Jak2, when activated via the AT1

receptor, remain elusive.

Here, we used gene-profiling technology to determine AngII-inducible genes that

require Jak2 for their regulation. Specifically, microarray experiments comparedjak2-/-

cells with wild type cells and identified over 400 AngII-inducible genes as being

differentially expressed as a function of Jak2. Two specific gene targets that were

identified and then further investigated in this study were the serum glucocorticoid-

regulated kinase and the inositol 1,4,5 trisphosphate (IP3) receptor.

Serum glucocorticoid-regulated kinase (sgkl) maintains proper Na+ homeostasis in

the kidney, and therefore is an important regulator of blood pressure. Here, the data show

that sgkl mRNA and protein levels are increased by AngII treatment in Jak2-expressing









cells. Conversely, we did not observe a significant increase ofsgkl expression in Jak2-

deficient cells. Furthermore, when the sgkl promoter was transfected into cells, only cells

expressing Jak2 protein had an increase in sgkl promoter activity when treated with

AngII. We hypothesize that upon activation via the AT1 receptor, Jak2 initiates a

Jak/STAT signaling cascade that results in transcription of sgkl. This hypothesis was

supported by evidence of STAT proteins binding within the promoter region of sgkl.

The IP3 receptor was another gene identified by the microarray as regulated by

Jak2. As opposed to the transcriptional effects of Jak2 on sgkl mRNA regulation, these

studies suggest that Jak2 is regulating the IP3 receptor protein through direct signaling

cascades within the cytosol. Specifically, the data show that Jak2 activation protects the

IP3 receptor from rapid AngII-induced ubiquitination. Conversely, the loss of a

functional Jak2, either by pharmacological inhibition or through the stable expression of

a Jak2 dominant negative mutant, causes rapid AngII-induced degradation in vascular

smooth muscle cells within 1 hour.

In conclusion, these studies identified many important targets of Jak2 in response to

activation by AngII. Identifying the downstream signaling mechanisms of Jak2 may

better elucidate its physiological and pathophysiological effects within the cardiovascular

system.














CHAPTER 1
INTRODUCTION

When first discovered in the early 1990's, members of the Jak tyrosine kinase

family were given the nickname of "Just Another Kinase." Now, nearly 15 years after

their identification, it is clear that the Jaks have surpassed expectations, and are anything

but "just another kinase". For example, of the four members belonging to the Jak

tyrosine kinase family, Jak2 alone is essential for normal development and function. In

addition, studies have demonstrated a potential role for Jak2 in the progression of various

cancers and cardiovascular pathologies. This chapter will serve as an introduction into the

background and functions of Jak2. Furthermore, the specific relationship of angiotensin

II (AngII) and Jak2 will be explored as an attempt to link the signaling cascades of Jak2

to vascular diseases associated to the renin-angiotensin system. Lastly, the later chapters

of this work identify two novel downstream targets of Jak2 as a function of AngII

signaling. As such, the function and regulation of these two genes, the inositol 1,4,5

trisphosphate (IP3) receptor and the serum glucocorticoid kinase 1 (SGK1), will be

introduced.

Jak2 Tyrosine Kinase

History

Tyk2 was the first member of the Janus tyrosine kinase family (a.k.a. Just

Another Kinase Family) to be discovered (Firmbach-Kraft et al., 1990). It was cloned

and identified in 1990 and by 1994 the three other members of the Janus family were

found (Jakl, Jak2, and Jak3) (Wilks et al., 1991; Harpur et al., 1992; Duhe et al., 1995;









Kawamura et al., 1994; Takahashi and Shirasawa, 1994). The Jaks were unique in that

all four members of the family shared a highly conserved C-terminal tyrosine kinase

domain that was immediately adjacent to a "kinase-like" or "pseudokinase" domain.

These contrasting tandem domains were reminiscent of Janus, the Roman God of Two

Faces who is the namesake of the Jaks.

Interest in Jak2 specifically was heightened when Jak2 was discovered to be a

critical mediator of cytokine-dependent signaling. Concurrent studies found that Jak2 was

activated in response to erythropoietin and growth hormone binding to their obligatory

receptors (Argetsinger et al., 1993; Witthuhn et al., 1993). In the years to follow, many

additional cytokines and growth factors were associated with the activation of Jak2

(Silvennoinen et al., 1993; Rui et al., 1994; Narazaki et al., 1994; Watling et al., 1993).

As the activators of Jak2 were being discovered, simultaneous work identified a

correlation between the cytokine-induced activation of Jak2 and increased gene

transcription. These studies were the first to identify cytokine-responsive transcription

factors, which were termed the Signal Transducers and Activators of Transcription

(STAT) proteins (Schindler et al., 1992; Shuai et al., 1992). These latent transcription

factors were found to mediate gene transcription when phosphorylated by active Jak2 in

the cytoplasm. Thus, within two years of their identification, the basic signaling

mechanisms of the Jak/STAT signaling paradigm were uncovered.

Structure

Structurally, the members of the Janus Tyrosine Kinase family are highly

homologous and relatively large in size, having a mass of roughly 130 kDa. To date, no

three-dimensional structure has been obtained but much has been elucidated about Jak2's










structure through analysis of the primary nucleotide and amino acid sequence.

Specifically, Jak2 is ubiquitously expressed throughout most tissues and is highly

conserved amongst species. Similar to other Jaks, Jak2 contains seven highly conserved

Jak homology (JH) domains, termed JH1 through JH7 (Figure 1-1). The carboxyl half of

the protein is composed of the JH1 and JH2 regions, which encode the kinase and

pseudokinase domains, respectively. The kinase activation loop, which is known to be

required for ligand-dependent activation of the Jaks, resides within the JH1 domain. For

a long time, the function of the pseudokinase domain remained unresolved. Recent work,

however, suggests that specific regions of JH2 interact with JH1 to negatively regulate

kinase activity (Saharinen et al., 2000; Saharinen and Silvennoinen, 2002).


N-Terminal C-Terminal




JH7 JH6 JH5 JH4 JH3 JH2 JH1


Domain Amino Acid

JH7 38-122
JH6 144-284
JH5 288-309
JH4 322-440
JH3 451-538
JH2 543-824
JH1 836-1123


Figure 1-1 Summary of the Jak2 structural domains. Shown are the seven Jak homology
(JH) domains and their relative positions within Jak2. The corresponding
amino acid sequence of each domain is also shown.

The amino half of Jak2 contains domains JH3 through JH7. Although the Jak

family members are thought to lack a canonical Src Homology 2 (SH2) domain, it was

noted that in Tyk2, the second half of the JH4 domain plus the whole of the JH3 domain

weakly resembled an SH2 domain (Bernards, 1991). Upon the cloning of the murine









Jak2 cDNA, it was similarly noted that the sequence GLYVLRWS bore weak homology

to the core sequence element of SH2 domains (FLVRES) (Harpur et al., 1992).

However, studies have reported conflicting findings as to whether this domain is truly

functional (Higgins et al., 1996; Kampa and Burnside, 2000; Giordanetto and Kroemer,

2002). Clearly, additional studies are required in order to elucidate what role, if any, this

SH2-like domain has within Jak2.

Immediately N-terminal to the putative SH2 domain lies the FERM domain which

spans from the middle of the JH4 domain through the JH7 domain. This domain is

involved in mediating stable interactions with other cellular proteins (Girault et al., 1998;

Yonemura et al., 1998). Furthermore, the amino terminal region of Jak2, especially the

JH6 and JH7 domains, has been shown to be crucial for Jak2/cell surface receptor

interactions (Frank et al., 1994; Tanner et al., 1995; Zhao et al., 1995).

In summary, the early collective molecular dissection of Jak2 suggested that it

possessed the appropriate structural features to bind other cellular proteins and

phosphorylate those proteins on tyrosine residues.

Jak/STAT Signaling Paradigm

While traditionally the Jak/STAT signaling pathway has been activated via

cytokines and growth factors, Jaks are also activated by numerous seven transmembrane

receptors, such as the AT1 receptor.

Cytokine and growth factor receptors

The signaling mechanisms surrounding Jak2 activation and the subsequent

regulation of gene transcription have been extensively studied. A summary of the

Jak/STAT pathway is depicted in Figure -2A. As is typically done in literature reviews,

this overview uses the activation of Jak2 via a cytokine receptor as an example of how






A. Jak2 activation via Cytokine
Receptor


B. Jak2 activation via AT1
Receptor


Prior to ligand binding


Activation Steps


/Nucleus


x511
E Hp^
I)HHE


Nucleus


Figure 1-2 Jak/STAT signaling paradigm A) Activation of Jak2 via a cytokine receptor.
B) Activation of Jak2 via the AT1 receptor.


----- --- -
M\ WM1111

CL99c


NEE


EHN


HK J, LA









Jak2 acts in a receptor-based signaling paradigm. The first event in the Jak/STAT

pathway is ligand binding to its cell surface receptor, resulting in receptor dimerization.

The dimerization event triggers a phosphorylation cascade by the receptor that results in

the activation of constitutively bound Jak2 molecules. These activated Jak2 molecules

subsequently phosphorylate tyrosine residues on the cytosolic tail of the receptor, thereby

creating docking sites for the STAT proteins. In turn, STATs are phosphorylated on

tyrosine residues by Jak2 and then released from the complex. Phosphorylated homo- or

heterodimeric STATs translocate into the nucleus, where they bind to STAT recognition

sequences, such as GAS elements, and initiate transcription of specific downstream target

genes.

Seven transmembrane spanning receptors

In addition to cytokine receptors, Jak2 is also activated by various seven

transmembrane spanning receptors, such as the AT1 receptor (Marrero et al., 1995).

Figure 1-2B illustrates the general differences in activation of Jak2 for a cytokine

receptor versus the AT1 receptor. For the most part, activation of Jak2 via the ATi

receptor propagates a similar signaling cascade as when Jak2 is activated by cytokines.

However, there do exist a number of important differences in the method of Jak2

activation depending on the receptor that is propagating the extracellular signal. First, it

appears that Jak2 molecules are not constitutively associated with the AT1 receptor in the

absence of activation, but rather reside unbound within the cytoplasm. Furthermore, Jak2

must be catalytically active and autophosphorylate prior to recruitment to and association

with the AT1 receptor (Ali et al., 1998). To date, the intermediate mechanisms

responsible for activation of the Jak2 molecules within the cytoplasm, as well as the

mechanisms for recruitment to the receptor, remain to be elucidated. Once activated and









bound to the receptor, Jak2 then acts as a molecular bridge between the receptor and the

STAT proteins. Catalytically active Jak2 binds the SH2 domain of the STATs and

thereby recruits the STATs to the receptor complex (Ali et al., 2000). From this point, the

remainder of the Jak/STAT pathway remains similar to activation via cytokine receptors,

resulting in STAT nuclear translocation and transcriptional regulation within the nucleus.

Downstream Targets of Jak2

Jak2 plays an expansive role in the regulation of gene transcription. Given its

ability to be activated by such a wide array of ligands, it is not surprising that Jak2 is

responsible for the transcriptional regulation of many diverse genes.

Previous work has identified the gene targets of Jak2 in response to activation by

one specific agonist, growth hormone (GH). Using a combination of both mutated GH

receptors and cells lacking Jak2, it was shown that Jak2 is necessary for GH-dependent

STAT activation (Smit et al., 1996; Smit et al., 1997; Han et al., 1996; Hackett et al.,

1995). To date, GH is known to cause activation of STATs 1, 3, 5A, and 5B in a variety

of cell types (Smit et al., 1996). Gene targets of GH-activated STATs 5A and 5B include

spi 2.1, genes in the CYP 2/3 families, the acid labile subunit of the circulating insulin-

like growth factor-binding protein complex, insulin 1, and igf-1 genes (Ooi et al., 1998;

Bergad et al., 1995; Galsgaard et al., 1996; Subramanian et al., 1995; Menton et al.,

1999; Waxman et al., 1995; Gebert et al., 1997). Furthermore, STATs 1 and 3 bind to the

Sis-Inducible Element (SIE) of the c-fos promoter to activate additional genes (Meyer et

al., 1994; Campbell et al., 1995). As clearly demonstrated by GH, Jak2 can mediate a

wide array of genes in response to just one ligand. Other Jak2-activating ligands can

similarly activate different STATs in the cytosol, leading to a plethora of transcriptional

targets.









In addition to mediating transcriptional events through the activation of STAT's,

Jak2 can also phosphorylate other cytosolic proteins. For example, when activated via the

AT1 receptor, Jak2 forms a complex with the Src family tyrosine kinase, Fyn (Sayeski et

al., 1999a). Following the formation of the complex, Jak2 activates Fyn, thereby

resulting in a conformational change within Fyn that permits its kinase domain to become

assessable to substrate. To date however, the functional consequence of Jak2-dependent

activation of Fyn has not been elucidated.

Fyn is not alone. Many other cytosolic proteins have been found to form a

complex with activated Jak2. Some of the molecules that are recruited to Jak2 signaling

complexes include c-Src, Grb2, PI3 kinase, Yes, Raf-1, Shc, Syp, and FAK (Sayeski et

al., 1999b; Chauhan et al., 1995; Fuhrer and Yang, 1996; Xia et al., 1996; Vanderkuur et

al., 1995; Fuhrer et al., 1995; Zhu et al., 1998). In conclusion, there exist various levels

of crosstalk between Jak2 and other signaling pathways. Studies have shown that Jak2

coordinates a complicated array of signaling cascades within a cell. Although the precise

functional consequences of these signaling complexes have not been elucidated, it is

logical to assume that each interaction has a specific biological purpose.

Jak2 and Cardiovascular Disease

Jak2 has been implicated in diverse cardiovascular pathologies, including

hypertrophy, heart failure, and ischemia/reperfusion injury. The precise roles of the

Jak/STAT pathway in the heart remain elusive and, to some degree, contradictory. For

example, some studies have found that the Jak/STAT pathway increases apoptosis within

the heart, thereby leading to detrimental effects (Mascareno et al., 2001; Stephanou et al.,

2000). However, other studies have conflicted these findings by suggesting a

cardioprotective function of Jak2 (Bolli et al., 2001; Hattori et al., 2001; Negoro et al.,









2000; Xuan et al., 2001). Needless to say, the association of Jak2 to various

cardiovascular insults remains an ongoing area of research.

Cardiac hypertrophy, which is defined as an abnormal increase in cardiac muscle

mass, is a major cause of morbidity and mortality worldwide. While cardiac hypertrophy

alone has no symptoms, if left untreated it can lead to a number of serious cardiovascular

diseases, such as heart failure and myocardial ischemia. The mechanisms governing the

development of cardiac hypertrophy are not completely understood. Evidence has

accumulated over the years indicating that cardiac hypertrophy is induced by pressure

overload (Mann et al., 1989; Sadoshima et al., 1992; Baker et al., 1990) and/or secretion

of numerous humoral factors such as Ang II (Schunkert et al., 1995; Sadoshima et al.,

1993). Interestingly, many of the stimuli known to initiate hypertrophy have also been

shown to activate Jak2. For example, acute pressure overload in rats increases Jak2

tyrosine phosphorylation levels through the paracrine/autocrine secretion of AngII as well

as via members of the interleukin-6 family of cytokines (Pan et al., 1997; Pan et al.,

1999).

Jak2 has also been associated with cardiac damage typically found in diabetic

patients. Diabetes and abnormal glucose tolerance typically lead to diabetic

cardiomyopathy, a condition characterized by severe left ventricular hypertrophy

(Galderisi et al., 1991; Devereux et al., 2000). As a result, diabetic patients often suffer

from heart failure (Kannel et al., 1974). Recent studies suggest that Jak2 contributes to

the hypertrophy of ventricular myocytes in response to high glucose levels.

Mechanistically, the hyperglycemia enhances AngII generation in myocytes, thereby

causing phosphorylation of Jak2. Therefore, these studies suggest that activated Jak2









may contribute to the deleterious growth effects of the heart that are associated with

abnormal glucose levels (Modesti et al., 2005).

Additionally, studies have identified a potential role for Jak2 in cardiac injury

during ischemia-reperfusion (Mascareno et al., 2001). The first evidence of the

Jak/STAT pathway being activated in response to an ischemic event was the

identification of STAT3 phosphorylation at 1-24 hours following coronary occlusion in

rats. Furthermore, when the Jak2 pharmacological inhibitor, AG490, was administered,

the STAT3 phosphorylation was suppressed, indicating a critical role for Jak2 (Negoro et

al., 2000). Since then, additional studies have emerged showing that treatment with

AG490 leads to a dramatic reduction in cardiac infarct size and a reduction in apoptotic

cell death of cardiomyocytes following ischemia-reperfusion in isolated perfused rat

hearts (Mascareno et al., 2001). Despite the evidence supporting Jak2's activation in

response to ischemia/reperfusion, there remains no elucidation of the functional

significance of the activation.

While much still remains to be elucidated about Jak2's functional effects in

various cardiovascular insults, it is clear that Jak2 and its downstream targets are

activated in a number of disease states. Interestingly, many of the cardiovascular

pathologies associated with Jak2 have previously been linked to AngII, suggesting that

AngII may signal through Jak2 to elicit its deleterious effects in the cardiovasculature. If

so, identification of the downstream targets of Jak2, in response to AngII, may have

therapeutic merit in the future.









The Renin Angiotensin System

Angiotensin II

The renin angiotensin system (RAS) is a critical regulator of blood pressure,

electrolyte balance, and endocrine function. The majority of these classic actions are

mediated through angiotensin II (AngII), the principal effector peptide of the RAS.

The RAS was first discovered over a century ago by Tigerstedt and Bergman, when

they identified a pressor compound produced by the kidneys they named renin. Renin is

a well-defined aspartyl protease that triggers the conversion of angiotensinogen to the

decapeptide angiotensin I. AngII, an octapeptide, is then generated by the cleavage of 2

amino acids from angiotensin I by angiotensin converting enzyme (ACE).

AngII, a potent vasoconstrictor, elicits its effects through G-protein coupled

receptors that can be separated into two distinct classes, the type 1 (ATi) and the type 2

(AT2) receptors (Timmermans et al., 1993). While both receptors are expressed in

cardiovascular tissues, the AT1 receptor predominates in most organs (Gasc et al., 1994).

Generally, the classical effects on vascular tone and fluid homeostasis by the RAS occur

via the AT1 receptor. Conversely, the AT2 receptor has been found to counterbalance the

actions of the AT1 receptor with respect to blood pressure and cellular proliferation

(Horiuchi etal., 1999).

Beyond contributing to maintaining proper blood pressure and electrolyte balance,

AngII can additionally lead to the development of various cardiovascular diseases.

Amongst these vascular pathologies are primary hypertension, heart failure, neointimal

formation, and vascular abnormalities commonly associated with diabetes (Gavras and

Gavras, 2002; Kennefick and Anderson, 1997; Barnett, 2001). In recent years, great

advancements have been made in controlling the deleterious effects of AngII using









diverse methods such as AT1 receptor blockade, inhibition of ACE, P-adrenergic receptor

blockade, and gene targeting (Timmermans et al., 1999).

AT1 Receptor

Structure and function

The AT1 receptor has been extensively studied since its successful cloning in

1991 (Murphy et al., 1991; Sasaki et al., 1991). As is common to all G-protein coupled

receptors, the AT1 receptor is a seven transmembrane spanning receptor. Composed of

359 amino acids, the third intracellular loop is responsible for coupling to G-proteins, and

thereby initiates propagation of signaling cascades (Shirai et al., 1995). These classically

defined G-protein signaling cascades result in the activation of various intermediate

signaling molecules such as adenylate cyclase, phospholipase C and protein kinase C.

Interestingly, two AT1 receptor isoforms exist in rodents, the AT1A and AT1B receptor.

These isoforms are highly homologous and are products of separate genes (Iwai et al.,

1992). Conversely, only a single isoform of the AT1 receptor has been confirmed in

humans.

Tyrosine kinase signaling cascades

In addition to its classic haemodynamic effects, the AT1 receptor can also act as a

growth factor by activating various tyrosine kinases such as Jak2, Tyk2, c-Src, Fyn, Fak,

and Pyk2 (Marrero et al., 1995; Sadoshima and Izumo, 1996; Ishida et al., 1995; Li and

Earp, 1997). In pathological conditions, these growth-promoting responses can lead to

various vascular diseases, such as neointimal formation.

Currently, Jak2 is the only tyrosine kinase that has been shown to physically

associate with the AT1 receptor directly. As previously described, upon AngII binding to

the AT1 receptor, Jak2 becomes activated within the cytosol. Following this activation,









Jak2 is recruited to the AT1 receptor and binds to the receptor tail at amino acids 319-

322. These four amino acids form the YIPP motif and are necessary for the association

of Jak2 to the AT1 receptor (Ali et al., 1997). Once bound to the receptor, Jak2 acts as a

molecular bridge between the receptor and the STAT proteins. Upon the formation of the

complex at the AT1 receptor, Jak2 is able to phosphorylate the STATs. Activated STATs

subsequently dimerize and translocate into the nucleus where they regulate transcription

of various genes. To date, the downstream target genes of Jak2 activation via the ATi

receptor remain largely undetermined. Given that Jak2 is activated in a number of AT1

receptor-induced cardiovascular diseases, we believe that identification of these

downstream targets could potentially elucidate the role of Jak2 in the progression of

various pathologies.

Inositol 1,4,5 Trisphosphate (IP3) Receptor

The finely tuned regulation of cytosolic calcium is responsible for many essential

biological processes within the cell. The specific control of intracellular calcium is

achieved through the involvement and maintenance of various receptors, transporters,

pumps, and binding proteins. The inositol 1,4,5 trisphosphate (IP3) receptors are

intracellular calcium channels expressed on the membrane of the endoplasmic reticulum

(ER). When activated, the IP3 receptors undergo a conformational change that leads to

the release of calcium from internal stores within the ER. The sudden increase in

cytosolic calcium within the cell can cause a wide array of biological processes such as

muscle contraction, cellular secretion, metabolism, cell growth and differentiation. As

such, understanding proper function and regulation of the IP3 receptors can be very useful

in determining their contribution to various pathophysiological conditions.









Structure and Function

Three structurally distinct IP3 receptor isoforms have been identified and are

differentially expressed in a cell specific manner (Nakagawa et al., 1991). Of the three

subtypes, Type 1 was the first to be cloned and has the highest expression throughout all

cell types studied (Mignery et al., 1989; Furuichi et al., 1989; De Smedt et al., 1994).

Types 2 and 3 have lower expression levels overall, typically showing highest expression

in many non-neural cell types (De Smedt et al., 1994; Wojcikiewicz, 1995). The

widespread expression of these receptors underscores their important role in cellular

signaling. However, little is known of the functional differences between the isoforms.

The IP3 family of receptors exists as tetramers and is composed of 3 main domains;

a C-terminal channel region, a large regulatory domain, and an N-terminal IP3 binding

domain (Mignery et al., 1990). The channel region of the IP3 receptor is characterized by

six-membrane-spanning helices with the C-terminus extending into the cytoplasm. When

IP3 binds within the binding domain at the N-terminal end of the receptor, the receptor

undergoes a conformational change that regulates the gating of the channel, allowing the

rapid release of calcium from internal stores (Mignery et al., 1990; Yoshida and Imai,

1997; Patel et al., 1999).

IP3 is a second messenger produced through the stimulation of phosholipase C-3

(PLC-P)-coupled receptors, such as the AT1 receptor. Specifically, the binding ofligand

to a G-protein-linked receptor activates the plasma-membrane-bound enzyme PLC-3.

Activated PLC-3 then causes the hydrolysis of the membrane-bound phosphatidylinositol

4,5-bisphosphate, thereby generating two cleaved products: diacylglycerol and IP3.

Following its production, IP3 leaves the plasma membrane and rapidly diffuses through









the cytosol. Once at the membrane of the ER, IP3 binds to and opens the IP3 receptors,

resulting in a rapid release of calcium into the cytoplasm (Berridge, 1993).

Regulation of the IP3 Receptor

Maintaining precise regulation of calcium signaling within a cell is critical for

normal cellular functions. Regulation of calcium is maintained via a complex interplay

between changes in IP3 concentration and the various levels of IP3 receptor expression on

the membrane of the ER. Amongst the various regulatory processes that mediate receptor

expression is phosphorylation. The IP3 receptor is phosphorylated by multiple kinases

including cyclic-AMP-dependent protein kinase (PKA), protein kinase C (PKC), and Fyn

tyrosine kinase (Ferris et al., 1991a, 1991b; Jayaraman et al., 1996; Harnick et al., 1995).

Fyn is a member of the Src-family of tyrosine kinases. Studies investigating

calcium signaling during lymphocyte activation identified the IP3 receptor as a target of

phosphorylation by Fyn in T lymphocytes. These initial studies identified that Fyn

activated the IP3-gated calcium channel in vitro. Furthermore, it was determined that

fyn-/- mice demonstrate a significant reduction in tyrosine phosphorylation of the IP3

receptor during T cell activation (Jayaraman et al., 1996). Recently, studies determined

that the precise residue within the receptor that is phosphorylated by Fyn is tyrosine 353

(Y353), which is found within the IP3 binding domain of the receptor. Furthermore,

evidence suggests that the phosphorylation of y353 via Fyn increases the binding affinity

of IP3 to its receptor at low concentrations of IP3. However, the effect of y353

phosphorylation in response to ligand treatment (i.e., high IP3 levels) has not yet been

defined (Cui et al., 2004).

In addition to phosphorylation, the IP3 receptor is also regulated through

degradation events that reduce expression of the receptor from the membrane of the ER









following agonist treatment. The IP3 receptor is degraded in WB liver cells in response to

AngII. This degradation event occurs at a minimum of six hours with maximal

degradation at 24 hours (Bokkala and Joseph, 1997). To date, AngII-mediated

degradation of the IP3 receptor has not been shown in smooth muscle cells (Taylor et al.,

1996; Sipma etal., 1998).

Serum- and Glucocorticoid-Regulated Kinase 1 (SGK1)

Aldosterone is a key regulator ofNa+ balance and thereby plays a large role in the

regulation of blood pressure. Aldosterone mediates sodium reabsorption by increasing

the activity of the epithelial Na+ channel (ENaC) in the aldosterone-sensitive distal

nephron (ASDN). Aldosterone is unable to regulate ENaC directly however, and thereby

elicits its effects through transcriptional events. An exciting development in the

elucidation of aldosterone targets was the identification of serum-glucocorticoid-induced

kinase 1 (sgkl) (Webster et al., 1993a). Not long after its identification as a

glucocorticoid-induced gene, sgkl was recognized to be an aldosterone-induced early

response gene and has provided researchers the link between aldosterone action and

ENaC regulation (Chen et al., 1999, Naray-Fejes-Toth et al., 1999).

Background and Function

sgkl was initially identified as a gene whose transcription was rapidly induced by

glucocorticoids in rat mammary tumor cells (Webster et al, 1993a). Therefore, unlike

other kinases that are constitutively present in cells and are activated by post-translational

mechanisms, sgkl and its other family members are rapidly transactivated in response to

specific hormonal and environmental stimuli. sgkl induction therefore requires new

transcription. sgkl is a member of the AGC subfamily of serine/threonine protein

kinases. To date, three isoforms of sgk have been identified, sgkl, sgk2, and sgk3;









however, only sgk] is responsive to aldosterone or glucocorticoids at the transcriptional

level. Transcriptional regulation of sgkl via aldosterone occurs through a classic

canonical pentadecamer, cis-acting steroid response element found in the promoter region

of sgkl (Webster et al., 1993b). Of the members of the AGC subfamily, SGK1 most

resembles protein kinase B (PKB), although it lacks the characteristic PtdIns(3,4,5)P3-

binding pleckstrin homology (PH) domain. The catalytic domain of SGK1 is 54%

identical to that of PKB and although it lacks the PH domain, SGK1 retains the same

residues in PKB that are phosphorylated by protein kinase 1 (PDK1) and protein kinase 2

(PDK2). Studies have shown that following transcription, SGK1 is activated by PDK1 at

Ser422 and/or Thr256 depending on cell type (Kobayashi and Cohen, 1999).

While the activated form of SGK1 has been found to interact with the a-and 3-

subunits of ENaC in vitro (Wang et al., 2001), this association does not appear to result

in phosphorylation of ENaC. Instead, SGK1 mediates ENaC function by

phosphorylation of an intermediate target termed Nedd4-2 (Debonneville et al., 2001;

Snyder et al., 2002). Nedd4-2 is an ubiquitin ligase that binds proline-rich motifs (PY)

located in the carboxy terminus of the three ENaC subunits (Kamynina and Staub, 2002).

In its unphosphorylated form, Nedd4-2 catalyzes the ubiquitination of residues in the

amino terminus of the subunits, thereby providing a signal for the endocytosis of the

channel (Staub et al., 1997). When Nedd4-2 is phosphorylated via SGK1, the affinity of

Nedd4-2 for the PY motifs is diminished leading to a decrease in the endocytosis of

ENaC (Debonneville et al., 2001). The disassociation of Nedd4-2 from ENaC results in

an increase in both the activity of the channel as well as the number of channels on the

surface of the plasma membrane (Alvarez de la Rosa et al., 1999).









Transcriptional Regulation of sgkl

In addition to glucocorticoids and aldosterone, many other agonists, acting through

a variety of signal transduction pathways, have been shown to induce sgkl gene

transcription in cells and tissues. For example, increased transcription of sgkl in

response to osmotic shock appears to be mediated by stress-activated protein kinase 2

(p38) (Bell et al., 2000; Waldegger et al., 2000). Additionally studies have shown sgkl

transcription can also be regulated by follicle stimulating hormone (FSH) in ovarian cells

through signaling cascades that involve p38 as well as PI3K and cAMP (Gonzalez-

Robayna et al., 2000). Overall, however, very little is currently known about the specific

signaling pathways that mediate the transcriptional regulation of sgkl. Table 1-1 shows a

comprehensive list of agonists that have been shown to increase transcriptional activation

of sgkl.

To date, the molecular mechanisms that regulate transcription of the sgkl

promoter are largely undetermined. Nevertheless, studies have identified a number of

interesting response elements within the promoter region. For example, a DNA binding

site for the p53 tumor suppressor protein has been identified within a 35-base pair region

of the promoter. Studies show this region is sufficient to permit p53-dependent

transactivation on a heterologous promoter (Maiyar et al., 1997). Additionally, a 20-base

pair G/C-region between -63 and -43 of the sgkl promoter has been identified and

confers sensitivity to FSH and forskolin. Specifically, this region binds the transcription

factors Spl and Sp3 and this binding is abolished following mutation of two base pairs

within this region (Alliston et al., 1997). Interestingly, this same Spl binding region

within the sgkl promoter confers sensitivity to high osmolarity, which, as mentioned

previously, is mediated by p38 (Bell et al., 2000).










Despite its many activators, sgkl remains best known for its physiological

contributions to Na+ retention in response to aldosterone secretion. Although clearly an

important contributor of blood pressure regulation, current studies have not determined

SGK1 to be directly regulated by AngII, which is regarded as a critical mediator of blood

Table 1-1: Activators of sgkl gene transcription
Activators Tissues/cells References

Conditions
Brain Injury Brain Hollister et al., 1997; Imaizumi et al., 1994
Hypertonic stress Hepatcytes Waldegger et al., 1997
Xenopus Collecting Duct Cells Rozansky et al., 2002
High Glucose Kidney, fibroblasts Lang et al., 2000; Kumar et al., 1999
Increased [Ca2+] CHO-IR cells Imai et al., 2003

Agonists
Serum Mammary tumor cells Webster et al., 1993a
Fibroblasts Webster et al., 1993b
Glucocorticoids Mammary tumor cells Webster et al., 1993a; Maiyar et al., 1996;
Maiyar et al., 1997
Fibroblasts Webster et al., 1997b
Rat kidney and distal colon Brennan and Fuller, 2000
Mineralcorticoids Renal epithelial cells Chen et al., 1999; Neray-Fejes-Toth et al.,
1999; Shigaev et al., 2000; Cowling et al.,
2000a
FSH Ovarian granulosa cells Alliston et al., 1997; Gonzalez-Robayna et
al., 2000
LH Ovarian granulose cells Lang et al., 2000
VIP Shark rectal gland Waldegger et al., 1998
Carbachol Shark rectal gland Waldegger et al., 1998
TGF-B Macrophages Waldegger et al., 1999
HepG2 liver cells Waldegger et al., 1999
Thrombin Kidney Kumar et al., 1999
Lipopolvsaccharides Granulocytes Cowling et al., 2000b
fMLP Granulocytes Cowling et al., 2000b
TNF-a Granulocytes Cowling et al., 2000b
GMCSF Peripheral blood granulocytes Cowling et al., 2000b
PPARgamma Renal cortical collecting ducts Hong et al., 2003
Endothelin-1 Smooth muscle cells Wolf et al., 2004
FSH- follicle stimulating hormone, LH- luteinizing hormone, VIP- vasoactive intestinal
polypeptide, TGF-3- transforming growth factor-P,, fMLP-formyl methionyl leucyl
phenylalanine, TNF-a- tumor necrosis factor-a, GMCSF- granulocyte-macrophage
colony-stimulating factor.









pressure. The current studies investigate the direct relationship, if any, between sgkl and

AngII. As such, the role of SGK1 in regulating blood pressure, as well as other

biological processes, may be expanded.

Summary and Rationale

Jak2 is an important mediator of gene transcription within the cell. Beyond

mediating normal physiological functions in cells, Jak2 can also contribute to numerous

pathologies, including various cancers and cardiovascular diseases. In addition to its

traditional effects on transcriptional regulation, Jak2 has been found to mediate

phosphorylation effects on various cytosolic proteins. While the precise consequences of

these post-translational effects remain uncertain, these signaling events are believed to

have important biological merit.

The goal of the study presented in the following chapters is to elucidate the

regulatory effects of Jak2 within the nucleus as well as clarify its role in initiating

previously undefined signaling cascades within the cytosol. Specifically, this study's

focus is to identify the downstream targets of Jak2 in response to AngII. By elucidating

the signaling cascades and downstream targets of Jak2 in response to AngII, it may be

possible to better understand the physiological and pathophysiological effects of Jak2

within the cardiovascular system.














CHAPTER 2
JAK2 TYROSINE KINASE IS A KEY MEDIATOR OF LIGAND-INDEPENDENT
GENE EXPRESSION

Introduction

Jak2 tyrosine kinase is a key mediator of gene transcription. It is activated by a

variety of cytokine, growth factor, and seven transmembrane spanning receptors,

resulting in signaling cascades that facilitate the activation of various downstream target

genes (Buggy, 1998; Gadina et al., 2001; Ju et al., 2000; Lukasova et al., 2003; Marrero

et al., 1995; Park et al., 1996; Peeler et al., 1996; Sasaguri et al., 2000). Upon binding of

ligand, Jak2 mediates gene transcription through the activation of cytosolic transcription

factors, termed STAT proteins. Thus, to date, Jak2 is regarded as an important regulator

of ligand-dependent gene activation.

Early studies have dissected the cellular and biochemical mechanisms that lead to

the activation of Jak2. Specifically, when agonists of Jak2 bind to their obligatory

receptors, Jak2 molecules undergo a juxtapoistioning that permits the

transphosphorylation of one another. Some of this transphosphorylation occurs on

tyrosine residues within the activation loop, leading to full kinase activation. Jak2 has

three tyrosine residues within the activation loop located at positions 1007, 1008 and

1021. The tyrosine residue at position at 1007 has been shown to be critical for

activation, since it is phosphorylated in response to the various agonists of Jak2 (Feng et

al., 1997). Furthermore, mutagenesis studies have determined that ligand-induced









activation and signaling is lost when this tyrosine residue is substituted with

phenylalanine (Feng et al., 1997).

Previous studies demonstrated that mice lacking a functional Jak2 allele die

during early embryonic development (Neubauer et al., 1998; Parganas et al., 1998).

These knockout mice are deficient in mandatory cytokine signaling as well as severely

anemic, demonstrating a complete lack of erythropoiesis. The lethal effects associated

with Jak2 knockout mice indicate the important physiological role Jak2 has in normal

embryonic development.

In this study, microarray technology was used to identify and characterize Jak2-

dependent genes that are differentially expressed as a function of the presence, or

absence, of Jak2 in cells. By using cells that lack Jak2 expression, we were able to

determine the contribution of Jak2 in regulating cellular transcription. Gene profiling

experiments identified 621 genes that had a greater than 2-fold change in expression as a

function of basally expressed Jak2. Surprisingly, this differential expression pattern did

not require the addition of exogenous ligand to activate a cell surface receptor, but merely

a basal level of Jak2 kinase function within the cell, as measured by a combination of

Northern blot analysis, RT-PCR and luciferase reporter assays. Cellular transcription

was even further increased in Jak2-containing cells when treated with a ligand, indicating

that these cells were capable of initiating proper Jak/STAT signaling cascades in a

ligand-dependent manner.

Additionally, we found that the large number of genes activated by the basal level

of Jak2 represent a wide range of ontological functions including transcription factors,

signaling molecules, and cell surface receptors. Interestingly, of the 621 genes identified









in this study, 56 have already been shown to be cytokine responsive, thereby suggesting

that these genes are true targets of Jak2 action. Lastly, we found that a Jak2 mutant

containing a tyrosine to phenylalanine substitution mutation at position 1007 maintained

a basal level of transcription that was consistent to wild type controls, suggesting that the

basal regulation of transcription is completely independent of active activation loop

phosphorylation.

As such, this work demonstrates for the first time that, in addition to being a key

mediator of ligand-activated gene transcription, Jak2 is also a critical mediator of basal

level gene expression. Additionally, the large numbers of genes found to be dependent

upon Jak2 for their transcriptional regulation indicate the critical and encompassing role

that Jak2 has in transcriptional processes within the cell.

Materials and Methods

Creation of Stable Cell Lines/ Cell Culture

Creation of the Jak2 null cell line, termed y2A, has already been described

(Kohlhuber et al., 1997). Briefly, the y2A cells are a human fibroblast cell line that is

devoid of Jak2 protein. Using this background, the cells were stably transfected with

either a Jak2 expression plasmid and a Zeocin selectable vector (y2A/Jak2 cells) or the

Zeocin selectable marker alone (y2A). Cells transfected with the Zeocin selectable

marker alone (y2A), were used as controls. Both cells lines were also stably transfected

with an AT1 receptor to establish its expression on the plasma membrane. The ATi

receptor used for transfection had an HA-tag inserted just after the initiation methionine.

Two days after transfection, cells were transferred to medium supplemented with 250

pg/ml Zeocin. Two weeks later, individual colonies were ring cloned as previously









described (Sayeski et al., 1999a). AT1 receptor-binding assays were conducted on the

stable cell lines using 125 -labeled AngII and respective y2A-derived clones that had

nearly identical binding parameters were identified. y2A (clone #4) had a Kd of 0.44 nM

and a Bmax of 201 fmol/mg protein while y2A/Jak2 (clone #1) had a Kd of 0.41 nM and a

Bmax of 226 fmol/mg protein (Sandberg et al., 2004). The relative Jak2 expression of each

clone was then determined using Western blot analysis as described in the Results.

The rat aortic smooth muscle (RASM) cells stably over-expressing either a Jak2

dominant negative allele (RASM DN) or the neomycin resistant cassette (RASM WT)

have been described previously (Sayeski et al., 1999a). The y2A cells stably expressing

either the growth hormone receptor alone (y2A/GHR) or the growth hormone receptor

along with wild type Jak2 (y2A/GHR/Jak2) have also been described (He et al., 2003).

Cells were grown in DMEM +10% FBS at 370C in 5%CO2 humidified atmosphere.

All cells were made quiescent by washing them extensively with phosphate-buffered

saline and then placing them in serum free media for either 20 (y2A cells) or 48 (RASM

cells) hrs, prior to use.

Immunoprecipitation/ Western Blot/ Analysis

Immunoprecipitation/Western blot analyses were performed to determine Jak2

expression and phosphorylation in the y2A cells. Briefly, to prepare y2A and y2A/Jak2

protein lysates, cells were washed with two volumes of ice-cold PBS containing 1 mM

Na3VO4 and lysed in 800 ptL of ice-cold RIPA buffer (20mM Tris [pH 7.5], 10%

glycerol, 1% Triton X-100, 1% deoxycholic acid, 0.1% SDS, 2.5 mM EDTA, 50 mM

NaF, 10mM Na4P207, 4 mM benzamidine, 1 mM phenylmethylsulfonyl fluride, 1 mM

Na3VO4, and 10 [tg/mL aprotinin). The samples were then sonicated and incubated on









ice for 30 min. Samples were subsequently spun at 13,200 rpm for 5 min at 40C, and

supernatants were normalized for protein content using the Bio-Rad D, assay.

Normalized lysates (approx. 400 tlg/ml) were then either directly resuspended in SDS

sample buffer and separated by SDS-PAGE for Western blot analysis or

immunoprecipitated.

Immunoprecipitations were performed for 4 hrs at 40C with 2 |tg of monoclonal

anti-phosphotyrosine antibody (BD Transduction Laboratories, clone PY20) and 20 [IL of

Protein A/G Plus agarose beads (Santa Cruz Biotechnology). After centrifugation,

protein complexes were washed 3 times with wash buffer (25 mM Tris, pH 7.5, 150 mM

NaC1, and 0.1% Triton X-100) and resuspended in SDS sample buffer. Bound proteins

were boiled, separated by SDS-PAGE, and transferred onto nitrocellulose membranes.

For determination of Jak2 protein expression, whole cell lystates were Western

blotted with polyclonal anti-Jak2 antibody (Upstate Biotechnology) in 5% milk/TB ST.

Membranes were subsequently stripped and re-probed with polyclonal anti-STAT1

antibody (Santa Cruz Biotechnology) to confirm equal protein loading of all samples. To

determine Jak2 phosphorylation levels, immunoprecipitated lysates were Western blotted

with polyclonal anti-Jak2 antibody (Upstate Biotechnology) in 5% milk/TBST. Proteins

were visualized using enhanced chemiluminescence (ECL) following the manufacturers

instructions (Amersham).

Preparation of Total and Poly (A)+ mRNA

Cells were serum starved for 20 hrs and total RNA was then isolated using the acid

guanidine thiocyanate/phenol/chloroform method of extraction (Chomczynski and

Sacchi, 1987). Briefly, y2A and y2A/Jak2 cells were serum starved for 20 hours and then









washed with 2 volumes of ice-cold phosphate-buffered saline and lysed in 3 mL of 4M

guanidine thiocyanate (GnSCN). Genomic DNA was then sheared using a 20G needle

fitted to a 10 cc syringe until viscosity of the samples was reduced. Cell homogenates

were then transferred to a fresh tube and 0.1-vol 2M NaOAc, pH 4.0, 1.0-vol aqueous

phenol, and 0.2-vol chloroform/isoamyl alcohol were added sequentially. Following a

15-minute incubation on ice, samples were spun at 1,500 x g for 20 minutes at 150C. The

aqueous layer was subsequently precipitated and the pellet was resuspended in 0.5mL 4M

GnSCN. RNA was precipitated and resuspended in a final volume of 200 pL in DEPC-

treated water and quantitated. Three confluent 100-mm culture dishes ofy2A or

y2A/Jak2 cells were pooled together in order to avoid artifact that was unique to any one

individual plate.

Poly (A)+ mRNA was isolated from both the y2A and y2A/Jak2 cells using the

Amersham Pharmacia Quick Prep mRNA Purification Kit. Three plates for each

condition were again pooled in order to reduce the possibility of any artifact. Total and

poly (A)+ mRNA was then used for Affymetrix analysis and/or Northern blot analysis as

described below.

Probe Preparation and Affymetrix Chip Hybridization

cRNA probes were prepared for hybridization to microarrays following the

manufacturer's instructions (Affymetrix GeneChip Expresssion Analysis Manual).

Briefly, double stranded DNA was prepared from 10 [tg of total RNA isolated from both

cell lines using the Superscript Double Stranded cDNA Synthesis kit (Invitrogen).

Newly synthesized double stranded DNA was subsequently cleaned using Phase Lock

Gels (PLG)-Phenol/Chloroform Extraction. 5 IL of double stranded DNA was then









Biotin-labeled following the Enzo Bioarray High Yield RNA Transcript Labeling Kit

protocol (Affymetrix). Biotinylated cRNA was subsequently cleaned using a Qiagen

RNeasy column and quantitated. 20 [tg of unadjusted cRNA was then fragmented and

hybridized to Affymetrix Test3 chips in order to verify the quality of each preparation.

Samples having similar metrix values were then hybridized to U95A gene chips at the

University of Florida ICBR MicroArray Core Laboratory.

Microarray Data Analysis

The data was analyzed using the Affymetrix Software Package, Microarray Suite

Version 4.0. Probe intensities for both cellular conditions were compared and reported in

both tabular and graphical formats. The data was deposited in the Gene Expression

Omnibus (GEO) repository under accession # GSM16418.

Northern Analysis

Northern Blot analysis was performed as previously described (Sayeski and Kudlow,

1996). Briefly, 25 |tg of total or 4 |tg of poly (A)+ mRNA was separated on a 1%

agarose-6% formaldehyde-containing gel. RNA samples were transferred onto nylon

membranes and then hybridized to 32P-labeled cDNA probes. Probes were labeled using

the Random Primers DNA Labeling System Kit (Invitrogen). The cDNA's encoding for

Pakl(Sells et al., 1997), 4-1BBL (Wen et al., 2002), USA-CyP (Horowitz et al., 2002)

and EphB6 (Matsuoka et al., 1997) have been described.

Quantitative RT-PCR

The two-step quantitative RT-PCR method was also used to confirm the differential

expression results generated by the microarray experiments. Specifically, total RNA was

extracted from either the y2A or the RASM-derived cell lines and subsequently reverse

transcribed using the SuperScript II RNase H- Reverse Transcriptase Kit (Invitrogen).









Primers were designed for each gene using the Primer3 program (http://www-

genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi/). PCR reactions were prepared

using the SYBR Green PCR Core kit (Applied Biosystems) and performed on the

GeneAmp 5700 Sequence Detector machine (Applied Biosystems). 18s primers were

used as a standard internal reference and analyses were accomplished by calculating the

2-ct values for each gene (Giulietti et al., 2001; Livak and Schmittgen, 2001).

Luciferase Assay

Cells were transfected with a luciferase reporter construct containing four tandem

repeats of the GAS element, upstream of a minimal TK promoter, in 10 ptL Lipofectin

(Invitrogen). Where indicated, cells were additionally co-transfected with both a

luciferase construct as well as cDNA plasmids encoding 1) an empty vector for Jak2 2)

wild type Jak2 cDNA 3) a Jak2 Y1007F mutant or 4) a Jak2 K882E mutant. All four

Jak2 expression plasmids were kind gifts from Dr. James Ihle (St. Jude's Children

Hospital). Following transfection, the cells were seeded in 12-well plates at 2.5 x 105

cells per well, serum starved for 20 hrs, and then treated as indicated. Luciferase activity

was measured from detergent extracts in the presence of ATP and luciferin using the

Reporter Lysis Buffer System (Promega) and a luminometer (Monolight Model 3010).

Luciferase values were recorded as relative light units (RLU)/[tg protein. Each of the

conditions were measured in replicates of six (n=6).

Results

Characterization of Jak2 Expression in the Stably Transfected y2A Cells

The y2A-derived stable cell lines were created as described in the Methods. In

order to verify the relative expression of Jak2 in each cell line, 25 |tg of whole cell









protein lysate from each cell line was separated by SDS-PAGE and subsequently Western

blotted with anti-Jak2 polyclonal antibody (Fig. 2-1A, top). The results show that Jak2

protein expression is completely lacking in the y2A cell line, but is readily detectable in

the y2A/Jak2 cell line. In order to demonstrate that both lanes were loaded equally, the

same membrane was stripped and Western blotted with anti-STAT1 polyclonal antibody

to detect endogenous STAT1 protein (Fig. 2-1A, bottom). The results show that both

lanes had roughly equal levels of STAT1 protein.



A. B.

1-2-
172-
"2Jak2-(P)
11 Jak2-(P)

h 1I- 79-

q4- 61-

m STAT1 IP: aTyr-(P) mAb
IB: uJak2 pAb

Figure 2-1. Characterization of Jak2 expression in y2A-derived cells. A) Whole cell
protein lysates from the y2A and y2A/Jak2 cell lines were Western blotted
with anti-Jak2 antibody to detect expressed Jak2 protein (top). The blot was
subsequently stripped and re-blotted with anti-STAT1 antibody to ensure
equal loading (bottom). B) y2A and y2A/Jak2 whole cell lysates were
immunoprecipitated with anti-phosphotyrosine antibody and then Western
blotted with anti-Jak2 antibody to measure Jak2 tyrosine phosphorylation
levels. Shown is one of two (A) or three (B) representative results. Printed
with permission of publisher

Jak2 has a basal level of tyrosine kinase activity that is significantly increased in

response to ligand treatment (Duhe and Farrar, 1998). The relative kinase activity of

Jak2 is directly proportional to its own tyrosine phosphorylation levels (Feng et al., 1997;









VonDerLinden et al., 2002). To determine whether the Jak2 protein expressed in the

y2A/Jak2 clone had proper basal level tyrosine phosphorylation, equal amounts of whole

cell lysate from each clone were immunoprecipitated with anti-phosphotyrosine antibody

and then Western blotted with anti-Jak2 antibody (Fig. 2-1B). The results show that the

Jak2 protein expressed in the y2A/Jak2 clone does have detectable levels of tyrosine

phosphorylation, which is consistent with cells that endogenously express Jak2.

Collectively, the results in Fig. 2-1 demonstrate that while the y2A cell line

completely lacks Jak2 protein expression, the y2A/Jak2 cell line has readily detectable

levels of this protein. Furthermore, the expressed Jak2 protein shows normal, basal level

tyrosine phosphorylation.

Microarray Analysis Demonstrates that Jak2 Mediates the Expression of Many
Diverse Genes

We next wanted to determine whether the basal level expression of Jak2 in a cell,

independent of exogenous ligand addition, has a measurable effect on gene expression.

To do this, we compared gene expression profiles in y2A versus y2A/Jak2 cells. Total

RNA was harvested from both cell lines and then prepared for Affymetrix microarray

analysis as described in the Methods. The Affymetrix U95A GeneChip was used as the

differential expression platform. This chip contains the probe sequences representing

-12,000 fully sequenced human genes. The expression signals generated from the

hybridization of probes from both cell lines were then compared and analyzed. Fig. 2-2

shows a graphical illustration of the mRNA expression levels from this experiment

(Experiment #1). Each dot on the plot represents one of the 12,000 different genes on the

chip. Genes falling outside the two parallel lines had a greater than 2.0-fold change in

gene expression as a result of the presence of Jak2. Genes falling above the two parallel










lines had increased gene expression while those falling below the two parallel lines had

decreased gene expression. The data indicated Jak2 expression in a cell, devoid of

exogenously added ligand, altered the expression of 1,251 genes by at least 2-fold.

This entire procedure was then repeated a second independent time. The results

of this experiment are shown (Fig. 2-2, Experiment #2). This time the analysis indicated

that 1,042 genes had at least a 2-fold change in gene expression as a function of

expressed Jak2.











IN-u glad gulk*d i a run rrn kF rA p mi
Experiment #2

















Dolun rquluil pi ne a funumd of um

Figure 2-2.Global Analysis of Jak2-Dependent Gene Expression. Graphical illustration
of the mRNA expression levels from two replicated experiments using
Affymetrix MicroArray Suite, Version 4. The plots compare hybridization
signal intensities from arrays probed with cRNA from the y2A and y2A/Jak2
cell lines. Each dot on the plot corresponds to a different gene. The two
parallel dashed lines represent the level for a 2-fold change in expression.
Printed with permission of publisher

The results gathered in Fig. 2-2 were further analyzed using Venn Diagram

analysis. This analysis allows for the identification of genes that were present in both









experiments. The results demonstrated that 621 genes were consistently differentially

expressed greater than 2-fold in both experiments. These 621 genes were further

analyzed to distinguish up-regulated genes from down-regulated genes (Fig. 2-3A). The

analysis showed that 474 genes were up regulated and 147 genes were down regulated.

Notably, the range of fold changes of these genes was quite impressive, spanning from 2-

to 78-fold. Not surprisingly, the majority of genes found to be present in only one of the

two experiments had induction numbers falling close to the 2-fold cutoff. In this case,

they were identified in one experiment with a value that was at 2-fold or higher, but not

in the other experiment because the value was just under the 2-fold cutoff threshold.

A.
SUp Regulated Down Regulated
aene Gen

422 7 281 208 14 140


Exp 1 Exp 2 Exp 1 Exp 2


B. Number of genes having at least
a 7.0-fold change in expression


45 3 22


Exp 1 Exp 2

Figure 2-3.Venn Diagrams Illustrating the Number of Up and Down Regulated Genes
Consistent Between the Two Replicated Experiments. A) The data for Exp. #1
and #2 were merged so genes common to both experiments could be identified
as having at least a 2-fold change in gene expression. A total of 621 genes
were differentially expressed in both experiments. These 621 genes were
further analyzed to distinguish up regulated from down regulated genes. The
hatched lines indicate the area of overlap between the two experiments. B)
The data for experiments #1 and #2 were analyzed so that genes having at
least a 7-fold change in expression could be identified. A total of 31 genes
were identified as being common to both experiments and having at least a 7-
fold change in expression. Printed with permission of publisher









The full list containing all 621 genes is found in Appendix A. Of the 621 genes on

this list, 390 have a known ontological function. When these 390 genes were queried as

to whether any were cytokine regulated, 56 genes were identified. Appendix B contains

this list of 56 genes. Several examples include the interferon y-inducible protein (Fan et

al., 1989), the Type 1 and 3 IP3 receptors (Rozovskaia et al., 2003) and the inhibitor of

activated STAT protein (Liu et al., 1998). Collectively, the identification of genes that

have previously been shown to be cytokine and/or Jak2- regulated suggest that the

microarray experiments had in fact identified genes that are Jak2 targets and not genes

that are differentially expressed due to clonal artifact.

For our initial analysis, we shortened the list of 621 genes to include only those

genes that were differentially expressed by at least 7-fold. Again, Venn Diagram analysis

was performed to identify those genes that had at least a 7-fold change in gene

expression, in both experiments (Fig. 2-3B). The results show 76 genes in experiment #1

and 53 genes in experiment #2 had at least a 7-fold change in expression. Of these genes,

31 were common to both groups. Table 3-1 lists these 31 genes. As previously

explained, for the genes found to be present in only one of the two experiments, the

majority had induction numbers falling close to the 7-fold cutoff. As such, they were

detected in one experiment with a value that was 7-fold or greater, but not detected in the

second experiment because the value was just below the 7-fold cutoff threshold. Overall

however, there was a strong concordance between the genes on both lists. Interestingly,

when ontological functions of these genes were classified, they were found to encompass

diverse categories of cellular function including transcription factors, cell cycle control











Accession
Number Gene Name


Induction Induction Average


#1


#2


Induction Category


13h9
15d8
31d8
43a12
43 e3


-78.4
-39.2
-23.7
-22.5
-7.5


U24152
Y09616
U18271
AL080203
L47345


U68485
AF016371
W28235
S78187
ABO17430


AD001530
AF035292
M68864
X79865
X71345


AL096723
X96484
AF026031
L23959
N53547


X03656
D83492
D64142
U66061
AF026977
1,37127


-78.1
-25.3
-21.3
-17.3
-8.1


Pakl
putative intestinal carboxylesterase
Thymopoietins (TMPO)
DKFZp434F222
Elongin A


Bridging integrator protein-1 (BIN1)
U4/U6 snRNP-associated cyclophilin
43h 8
CDC25 Hu2
Kid-kinesin-like DNA binding protein


XAP-5
23584 clone
Human ORF mRNA
Mrpl7
Trypsinogen IV-b form


DKFZp564H2023
DGCR6 gene
hTOM
E2F-releated transcription factor
yv43bl2.sl


G-CSF
EphB6
Histone HI subtype
Trypsinogen-C
Microsomal glutathione S-transferase III
RNA polymerase II subunit


W25845
W26787
W27474
W28170
W27997


-78.25
-32.25
-22.5
-19.9
-7.8


7.3
7.4
7.45
8.1
7.75


8.85
11.45
8.55
9.6
8.9


9.15
9.85
11.25
10.25
15.05


13.45
12.7
15.45
13.55
17.05


16.5
15.6
13.8
25.8
33.9
48.45


Table 2-1 Summary of Jak2-dependent genes. The 31 genes having at least a 7-fold
change in gene expression in both experiments are represented. Shown are
the accession number, gene name, relative fold changes and a brief description
of cell function. (NF = Currently, no known function). Printed with
permission of publisher


Signaling
Serine Esterase
Cell Cycle
NF
Transcription


Tumor suppressor
Cyclophilin
NF
Cell Cycle
Cell Cycle


NF
NF
NF
Cell growth
Proteolytic enzyme


NF
Development
Mitochondrial transport
Transcription
NF


Cell Defense
Angiogenesis
Transcription
Proteolytic enzyme
Peroxidase
Transcription


9.1
8.9
10.4
8.3
17.8


14.3
11.7
15.8
11.2
18.2


15.8
12.7
8.1
28.6
36.8
53


I









genes, cell surface receptors, and intermediate signaling molecules. As such, the data

indicates that Jak2 strongly regulates an important, but diverse, set of genes.

Validation of Jak2-dependent Gene Expression in y2A and y2A/Jak2 Cells

We next wanted to validate the apparent changes in Jak2-dependent gene

expression identified via the microarray experiments. In order to obtain a representative

sample from the list, we selected genes that represented a diverse set of fold changes and

ontological functions. Northern blot analysis was then performed on several of these

genes. For the intermediate signaling molecule, Pakl, Affymetrix predicted that Jak2-

expressing cells would have 7.3-fold more mRNA when compared to non-Jak2-

expressing control cells. Northern blot analysis indicated that of the two splice variants

of Pakl, the smaller transcript was -4-fold higher in the Jak2-expressing cells (Fig. 2-

4A). Similarly, for the 4-1BBL gene, Affymetrix analysis indicated that the Jak2-

expressing cells would contain 9.6-fold more mRNA when compared to the cells lacking

Jak2. Northern blot analysis actually found the level closer to -5-fold (Fig. 2-4A).

Similarly, for the RNA splicing enzyme, USA-CyP, Affymetrix analysis predicted the

Jak2-expressing cells would have 11-fold more mRNA when compared to the cells

lacking Jak2. Again, densitometric analysis of the Northern blot found it to be -7-fold

greater (Fig. 2-4B). Finally, for the angiogenic cell surface receptor, EphB6, the

Affymetrix prediction and the Northern blot were in close agreement, as both analyses

found Jak2-expressing cells contained ~15-fold more EphB6 mRNA than the cells

lacking Jak2 (Fig. 2-4C).

Collectively, the data in Fig. 2-4 demonstrate a reasonable correlation between the

differential expression pattern predicted by the Affymetrix microarray analysis and the

validation of the mRNA levels by Northern blot analysis. For some genes, the magnitude









of the prediction made by the Affymetrix analysis was higher than the actual

measurement determined by Northern blot analysis. However, without exception, the

genes that Affymetrix predicted to be differentially expressed were in fact differentially

expressed in the same direction. Table 2-2 shows a complete summary of the validations.



A. B. C.



PakI USA-CyP EphB6


4- 1BBL W GAPDH GAPDH


GAPDH


Figure 2-4. Confirmation of Jak2-dependent gene expression in the y2A and y2A/Jak2
cells via Northern blot analysis. Northern blot analysis of mRNA extracted
from y2A and y2A/Jak2 cells. The blots were probed with cDNA's encoding
either Paki and 4-1BBL (A), USA-CyP (B), or EphB6 (C). All blots were
subsequently stripped and re-probed with GAPDH to control for loading.
Printed with permission of publisher

To further validate the differential expression data generated by the microarray

experiments, quantitative RT-PCR was also employed. Six separate genes were analyzed

via quantitative RT-PCR. Graphs illustrating the derived fold changes between the y2A

and y2A/Jak2 cell lines are shown in Fig. 2-5. For the EphB6 gene, quantitative RT-PCR

found the level of differential expression to be -12-fold greater in the Jak2-expressing

cells (Fig. 2-5A). This was in close agreement with both the Affymetrix prediction and

the Northern blot analysis shown in Fig.2-4C. For the protein tyrosine kinase gene










termed, FBK 1116, Affymetrix predicted that the Jak2-expressing cells would have 12-

fold less mRNA when compared to the non-Jak2 expressing controls. Quantitative RT-


A. EphB6 B. FBK I16 C. 13h9
14 2 2
126 1

8) 8


2 7)-
24
y2A y2A/Jak2 y2A y2A/Jak2 y2A y2A/Jak2

D. Trypsinogen IV-B E. MGST Ill F. G-CSF

22 5 0
20 -
1861 8 -100

12 6
U- 10
8 8 4 5
2 2 -

72A y2A/Jak2 72A y2A/Jak2 72A y2A/Jak2


Figure 2-5. Confirmation of Jak2-dependent gene expression in the y2A and y2A/Jak2
cells via quantitative RT-PCR. Quantitative RT-PCR analysis of RNA
extracted from y2A and y2A/Jak2 cells. Primers were designed for the genes
encoding EphB6 (A), protein tyrosine kinase FBK 11116 (B), 13h9 (C),
trypsinogen IV-B (D), microsomal GST III (E) and G-CSF (F). Fold changes
were derived from the 2-**ct value and are indicated on each graph. Values
are represented as the mean +/- SD. Printed with permission of publisher

PCR found the difference to be -17-fold less (Fig. 2-5B). For the 13h9 gene, Affymetrix

predicted a 78-fold decrease in mRNA levels in the Jak2-expressing cells. Quantitative

RT-PCR actually found the level to be -10-fold less in these cells (Fig. 2-5C). For the

trypsinogen IV-B gene, Affymetrix predicted a 15-fold increase in mRNA levels in the

Jak2-expressing cells. Quantitative RT-PCR found the level to be -17-fold higher (Fig.

2-5D). For the microsomal GST III gene, the microarray studies predicted a 34-fold









increase in the mRNA levels in the Jak2-expressing cells. Quantitative RT-PCR found

the level to be -10-fold higher (Fig. 2-5E). Finally, for the G-CSF gene, Affymetrix

predicted a 17-fold increase in mRNA levels in the Jak2-expressing cells when compared

to the non-Jak2 expressing controls. Quantitative RT-PCR actually found the level to be

-107-fold higher in the Jak2 expressing cells (Fig. 2-5F).

Collectively, the quantitative RT-PCR data in Fig. 2-5 show similar trends in gene

expression as was predicted by the microarray experiments. (Table 2-2)

Suppression of Endogenous Jak2 Kinase Activity via Over Expression of a Jak2
Dominant Negative Allele Similarly Inhibits Jak2-dependent Gene Expression

One interpretation of the data in Figs. 2-4 and 2-5 is that basal level Jak2 tyrosine

kinase activity within a cell, independent of exogenous ligand addition, can significantly

alter cellular gene expression. However, other interpretations might be that the results

are due to artifact inherent to the y2A-derived clones or that the effect might be unique

only to y2A-derived cells. To eliminate these alternate possibilities, we utilized rat aortic

smooth muscle cells that stably express a Jak2 dominant negative cDNA (RASM DN).

Expression of the dominant negative protein blocks function of wild type Jak2 normally

found in these cells (Sayeski et al., 1999a). In short, Jak2-dependent signaling in the

dominant negative expressing cells is reduced by about 90% when compared to wild type

controls. The control cells are rat aortic smooth muscle cells that express only a

Neomycin resistant cassette (RASM WT). Thus, these cells allow for a determination of

Jak2-dependent gene expression via a mechanism that is independent of the Jak2 null

mutation.

Here, both sets of cells were serum starved for 48 hrs and then total RNA was

harvested. Quantitative RT-PCR was subsequently performed on the several of the genes










shown in Figs. 2-4 and 2-5. Overall, the results were consistent with the Affymetrix-

derived data as well as the Northern and quantitative RT-PCR experiments done in the

y2A cells (Table 2-2). Specifically, USA-CyP and 4-1BBL gene expression was -10-fold

higher in the RASM WT cells when compared to the RASM DN cells (Figs. 2-6A and 2-

6B, respectively). 13h9 gene expression was -8-fold less in the RASM WT cells when

compared to the RASM DN cells (Figs. 2-6C). Finally, trypsinogen IV-B gene

expression was -7 fold greater in the RASM WT cells when compared to the RASM DN

cells (Figs. 2-6D).


USA-CyP







3I
ASM RASM
DN WT


13h9


RASM RASM
DN WT


B. 4-1BBL
15

10

5 -


0

DN WT

D. Trypsinogen IV-B
10
< 9
8
7
6
5-
ct4
-= 3
2
0
RASM RASM
DN WT


Figure 2-6. Confirmation of Jak2-dependent gene expression in the RASM DN and
RASM WT cells via quantitative RT-PCR. Quantitative RT-PCR analysis of
RNA extracted from RASM DN and RASM WT cells. Primers were
designed for the genes encoding USA-CyP (A), 4-1BBL (B), 13h9 (C), and
trypsinogen IV-B (D). Fold changes were derived from the 2-**Ct value and
are indicated on each graph. Values are represented as the mean +/- SD.
Printed with permission of publisher


A.
15
10 -

5 -


SR


C.
0 2

&

"O









Collectively, the data in Fig. 2-6 indicate that when endogenous Jak2 tyrosine

kinase activity is reduced via expression of a Jak2 dominant negative allele, there is a

corresponding change in gene expression that is similar to that seen in the y2A-derived

cells. As such, the data suggest that basal level Jak2 tyrosine kinase activity within a cell,

independent of exogenous ligand addition, significantly alters cellular gene expression.

Table 2-2 Summary of microarray validations
y2A cells RASM cells
Gene Name Affymetrix Northern RT-PCR RT-PCR
Pakl 7.3 1 -4
4-1BBL T 9.6 T ~5 T 10
USA-CyP 11 T-7 10
EphB6 15.6 ? 15 12
FBK III16 12 4 17
13h9 1 78 10 4 8
Trypsinogen IV-B 1 15 T 17 7
M-GST III 34 10
G-CSF T 17 f 107
Shown are the gene expression fold changes predicted for each gene via Affymetix,
Northern blot, and RT-PCR analysis in both y2A and RASM cells.


Jak2 is a Critical Mediator of Both Basal Level and Ligand-induced Gene
Transcription

The data in the preceding figures suggest that Jak2 is capable of significantly

mediating gene transcription independent of exogenous ligand addition. This is a novel

concept in that Jak2 has classically been viewed as a mediator of ligand-induced gene

expression. We therefore hypothesized that Jak2 can act as a critical mediator of both

basal level and ligand-induced gene transcription. To test this, we investigated the ability

of angiotensin II (AngII) to further mediate mRNA gene expression. Numerous

independent laboratories, including our own, have shown that AngII is a potent activator

of Jak2, both in vitro and in vivo (Frank et al., 2002; Marrero et al., 1995; Sandberg et









al., 2004; Sayeski et al., 1999; Seki et al., 2000). Both y2A-derived cell lines utilized in

this study stably express the AngII type 1 (AT1) receptor via the stable integration of

cDNA expression plasmids (Sandberg et al., 2004). In short, the y2A cell line expresses

the AT1 receptor on a background that is devoid of Jak2. However, the y2A/Jak2 cell line

expresses the AT1 receptor with similar affinity and abundance as the y2A cell line, but

also expresses wild type Jak2 protein. Thus, these cells allow for a determination of the

role of Jak2 in gene expression, under both the basal- and ligand-activated states.

We first investigated the ability of Jak2 to become phosphorylated in response to

AngII treatment. To characterize both the basal and ligand-induced tyrosine

phosphorylation levels of Jak2, both sets of cells were either left untreated (-) or treated

for 5 min with 100 nM AngII (+). Equal amounts of whole cell lysate from each

condition were then immunoprecipitated with anti-phosphotyrosine antibody and

subsequently Western blotted with anti-Jak2 antibody (Fig. 2-7A). Since the y2A cells

lack Jak2, AngII treatment failed to increase the tyrosine phosphorylation levels of the

protein (lanes 2 vs 1). However, in the y2A/Jak2 cells, Jak2 was found to be tyrosine

phosphorylated prior to AngII treatment (lane 3), and ligand treatment further increased

its tyrosine phosphorylation levels (lane 4). Thus, the data in Fig. 2-7A suggest that these

cells appear to be suitable vehicles for studying gene expression that is both Jak2- and

ligand-dependent.

One gene that showed remarkable consistency in its Jak2-dependent regulation in

the microarray studies was EphB6. Specifically, Affymetrix, Northern blot, and

quantitative RT-PCR analyses all indicated that the levels of EphB6 mRNA were about

15-fold higher in the Jak2-expressing cells (Figs. 2-4 & 2-5 and Table 2-1). To









determine the role of basal- and ligand-activated Jak2 on EphB6 gene expression, both

sets of cells were either left untreated (-) or treated for 4 hrs with 100 nM AngII (+).

RNA was then extracted and Northern blot analysis was performed (Fig. 2-7B, top). The

results show that in the cells lacking Jak2, there is little to no EphB6 message, either with

or without ligand treatment (lanes 1 and 2). However, in the Jak2 expressing cells, there

was a marked increase in EphB6 mRNA levels that was completely independent of

ligand treatment (lane 3). This result recapitulates the observation seen in Figs. 2-4C and

2-5A as it once again demonstrates that basal level Jak2 tyrosine kinase activity in a cell

is sufficient to significantly increase expression of this gene. Finally, when the Jak2

expressing cells were treated with AngII, there was a further increase in EphB6 mRNA

levels (lane 4). The nylon membrane was subsequently stripped and re-probed with the

cDNA encoding GAPDH, in order to demonstrate similar loading across all lanes (Fig. 2-

7B, bottom). Interestingly, the most striking increase in EphB6 gene expression does not

occur in response to AngII treatment (i.e. ligand-activated Jak2), but rather occurs when

Jak2 is simply expressed in the cell (i.e. basal activation state of Jak2).

To determine whether this effect could be conferred onto a heterologous Jak2-

responsive promoter, we transfected these same y2A and y2A/Jak2 cells with a luciferase

reporter construct containing four tandem repeats of the Jak2-responsive, GAS element,

upstream of a minimal TK promoter. The cells were subsequently serum starved for 20

hrs, treated with 100 nM AngII for 0 or 24 hours and then luciferase activity was

measured (Fig. 2-7C). In the cells lacking Jak2, there was minimal basal level luciferase

activity that increased modestly with the addition of ligand (lane 2 vs. 1). However, in

the Jak2-expressing cells, there was substantial luciferase activity measured at basal









levels (lane 3 vs. 1) that was significantly increased following AngII treatments (lane 4

vs. 3). Clearly however, of the four conditions, the largest increase in luciferase activity

was seen in lane 3, where Jak2 expression significantly increased luciferase activity,

independent of exogenous ligand addition.

To demonstrate that this observation is not an artifact unique to the y2A/ATi

receptor expressing cell lines, we transfected the same luciferase reporter construct into

y2A cells stably expressing either the growth hormone receptor alone (y2A/GHR) or the

GHR along with Jak2 (y2A/GHR/Jak2). The creation and characterization of these cells

has been previously described (He et al., 2003). In short, both cell lines express the GHR

at similar affinity and abundance, but only the second cell line expresses Jak2. In the

absence of growth hormone, Jak2 displays low level, basal tyrosine phosphorylation.

Upon treatment with growth hormone however, there is a marked increase in Jak2

tyrosine phosphorylation levels.

The luciferase activity in the y2A cells expressing the GHR were similar to that

seen in the y2A cells expressing the AT1 receptor. Specifically, the y2A cells lacking Jak2

again demonstrated little luciferase activity, which did not increase upon treatment with

GH (lane 1 and 2). Conversely however, in untreated Jak2-expressing cells, there was a

dramatic increase in luciferase activity, roughly 2.5-fold higher than found in equivalent

cells lacking Jak2 (lane 3 vs 1). Furthermore, as with AngII treatment, GH further

increased luciferase activity in cells expressing Jak2. In this case, addition of GH

increased luciferase activity -3-fold above the untreated cells (lane 4 vs. 3). Thus, the

data demonstrate that the magnitude by which Jak2 increases ligand-dependent gene

transcription (-3-fold) is nearly equivalent to the magnitude by which Jak2 increases







44


ligand-independent gene transcription (-2.5-fold). As such, these data help strengthen

the argument that Jak2 may act as a mediator of both ligand-independent and ligand-

dependent gene transcription.


A. B.
A2A y2A/Jak2 y2A y2A/ Jak2
AngII + + Angl + +

172-
EphB6
4 Jak2- (P)
111--


79- GAPDH
61-

IP: aTyr-(P) mAb
IB: aJak2 pAb
C. D.
35e+ 35e+7
30e6 T 30e+7
I I
25e6
S20e46 20+7
15e46 13e+7
10e16 10e+7
50e56 50e
00 00E=-
00
Ang I + + GH + +
y2A y2A/Jak2 y2A/GHR y2A/GHR/Jak2


Figure 2-7.Jak2 plays a key role in basal, as well as ligand activated, gene transcription
A) Quiescent y2A and y2A/Jak2 cells were either left untreated (-) or treated
for 5 min with 100nM AngII (+). Lysates were immunoprecipitated with anti-
phosphotyrosine antibody and subsequently Western blotted with anti-Jak2
antibody to measure Jak2 tyrosine phosphorylation levels. Shown is one of 3
representative results. B) Quiescent y2A and y2A/Jak2 cells were either left
untreated (-) or treated for 4 hrs with 100nM AngII (+). Poly (A)+ mRNA was
then isolated from the cells and subsequently Northern blotted with the cDNA
encoding for either EphB6 (top) or GAPDH (bottom). C) y2A and y2A/Jak2
cells were transfected with 0.5 |tg of a luciferase reporter construct containing
four tandem repeats of a GAS element. Cells were treated for 24 hrs with
either vehicle control (-) or 100nM AngII (+) and then luciferase activity was
measured. Values are plotted as the mean +/- SD. The difference in
luciferase values between lanes 1 and 3 was statistically significant as
determined by Student's t-test. *, p = 1.23 x10-13. Shown is one of three









independent results. D) y2A/GHR and y2A/GHR/Jak2 cells were transfected
with 5.0 |tg of the same luciferase reporter construct described above. The
cells were subsequently treated for 24 hrs with either vehicle control (-) or
600ng/ml GH (+) and then luciferase activity was measured. Values are
plotted as the mean +/- SD. The difference in luciferase values between lanes
1 and 3 was statistically significant as determined by Student's t-test. **,p =
2.94 x10-7. Shown is one of three independent results. Printed with
permission of publisher

To further investigate the precise mechanism of Jak2 in mediating ligand-

independent transcription, we utilized various Jak2 mutants. The mutants selected for

investigation were chosen based upon a recent paper by Chatti and colleagues, in which

they demonstrated that kinetically, the tyrosine kinase function of Jak2 exists in at least

two independent states; namely, a basal state and a ligand-activated state (Chatti et al.,

2004). Specifically, the authors generated an activation loop mutant of Jak2 by changing

the conserved tyrosine at position 1007 to phenylalanine. While this Jak2 mutant was

unable to propagate cytokine-dependent signaling, it was nonetheless able to bind ATP

and autophosphorylate, albeit less efficiently than wild type protein. As such, they

concluded that Jak2 exists in at least two kinetically distinct states of activity; a high-

activity catalytic state and a low-efficiency basal catalytic state. However, what

remained uncertain was whether this low-efficiency basal state had any biological

consequence.

In an attempt to investigate if perhaps the "low activation state" described by

Chatti was mediating the ligand-independent activation of Jak2, we utilized a number of

Jak2 mutant expression plasmids. Along with the STAT-responsive luciferase reporter

construct previously described, y2A/GHR cells lacking Jak2 expression were co-

transfected with cDNA plasmids encoding either 1) an empty vector for Jak2 2) a plasmid

containing wild type Jak2 3) a Jak2-Y1007F mutant which has low level ATP utilization,









but cannot activate in response to ligand treatment or 4) a Jak2-K882E mutant which has

absolutely no kinase activity as it is unable to bind ATP. After transfection, the cells

were treated with GH to activate Jak2 and luciferase activity was subsequently measured

(Figure 2-8A). For the cells transfected with empty vector control, there was a minimal

level of luciferase activity that did not change with ligand addition. The Jak2-K882E

mutant, which has absolutely no kinase activity, had virtually the same luciferase

expression pattern as the empty vector control. However, for the Jak2-Y1007F mutant,

there was an 8-fold increase in luciferase activity at the 0 hr time point over both the

empty vector control and the Jak2-K882E transfected cells. These data indicate that a

Jak2 protein that possesses basal level kinase activity, but cannot activate in response to

exogenous ligand addition due to mutation of tyrosine 1007, can greatly increase gene

transcription in the basal catalytic state. Not surprisingly, cells expressing the Jak2-

Y1007F mutant do not exhibit increased luciferase activity in response to GH treatment.

Finally, for cells expressing Jak2-WT, prior to ligand addition, there was luciferase

activity that was similar to the Jak2-Y1007F mutant. However, 6 hrs of growth hormone

treatment resulted in a 2.5-fold increase in luciferase activity presumably due to

phosphorylation oftyrosine 1007. The data show that simply expressing a Jak2 protein

which possesses only basal level kinase activity (i.e. the Jak2-Y1007F mutant) results in

an 8-fold increase in gene expression whereas ligand-dependent activation of Jak2-WT

only results in a further 2.5-fold increase in gene transcription. Thus, the degree by

which Jak2 influences basal level gene transcription is much greater than the degree by

which it influences ligand-dependent gene transcription.







47


The relative levels of expressed Jak2 protein for each condition were determined

via anti-Jak2 Western blot analysis (Figure 2-8B). In summary, the data indicate that the

transcriptional effect of Jak2 in the basal catalytic state (i.e. ligand-independent) is

greater than that seen in the ligand-activated state.


A. B.
5e+5 -

5 4e+5 W j-,
-o VY1007F
3j.0 K882E
3e+5 Empty Vector

2e+5- Jak

l< e+5 -
| IB: anti-Jak2-pAb
0
-1

0 1 2 3 4 5 6 7
Hours of Growth Hormone
Figure 2-8.A Jak2 mutant that possesses only basal level kinase activity, significantly
influences gene transcription. A) y2A/GHR cells were co-transfected with
5.0 |tg of a luciferase reporter construct containing four tandem repeats of a
Jak2-responsive GAS element and either empty vector for Jak2 (Control), the
Jak2-K882E mutant, the Jak2-Y1007F mutant, or Jak2-WT. The cells were
serum starved and subsequently treated for either 0, 3, or 6 hours with 250
ng/ml GH and then luciferase activity was measured. Each condition was
measured in replicates of six (n=6). Values are expressed as the mean + SD.
The difference in luciferase values between the Jak2-WT transfected cells at
time 0 hr versus 6 hrs was significantly different as determined by Student's t-
test. *, p < 0.05. B) Lysates from each of the four transfected conditions were
Western blotted with anti-Jak2 antibody to assess Jak2 expression levels.
Printed with permission of publisher

Discussion


Jak2 is a key mediator of cellular gene expression. A variety of ligands that bind

cytokine, tyrosine kinase growth factor and G protein-coupled receptors, are all known to

signal through Jak2. This study was therefore designed to help elucidate the critical role

that Jak2 has in regulating cellular gene transcription. Here, we found that when Jak2









was expressed in a cell, 621 genes had a greater than 2-fold change in gene expression

when compared to non-Jak2 expressing control cells.

This work is significant for several reasons. First, in the realm of cellular

transcription, genes can be expressed at either basal levels or under activated conditions

such as when a ligand binds its receptor. Jak2 has long been regarded as a key mediator

of this ligand-activated state of transcription and has never thought to be important in

basal transcriptional regulation. This dissertation shows for the first time that, when Jak2

is expressed in a cell at basal level conditions, it appears to play a central role in cellular

transcriptional regulation that is independent of exogenous ligand addition.

Second, a classification of these differentially regulated genes was done in an

attempt to discover prominent classes of Jak2 signaling targets. Uncovering functional

classes of genes could potentially lead to predictions about genomic targets of Jak2.

Interestingly however, no prominent class of genes appeared evident. The classification

revealed a large assortment of genes encoding many diverse proteins such as transcription

factors, intermediate signaling molecules and cell surface receptors. The data suggest

that Jak2 shows no single prominent function at the basal level, but rather maintains a

global influence within the cell.

Third, the Jak2 knockout mouse dies during development therefore indicating that

this tyrosine kinase is required for survival (Neubauer et al., 1998; Parganas et al., 1998).

These same studies showed that Jak2 is required for proper signaling through a variety of

cytokine receptors. Subsequent studies further demonstrated that Jak2 is a critical

mediator of growth factor and G protein-coupled receptor signaling. However, the

downstream target genes of Jak2 tyrosine kinase remain largely unknown. Here, we









identified 621 genes that have at least a 2-fold change in gene expression as a function of

expressed Jak2. As such, additional downstream target genes of Jak2 may now be

known.

As mentioned previously, the major focus of this study did not include the genes

falling within the differential signal expression range of 2- to 7-fold. This does not

suggest these genes are not biologically important. To the contrary, genes having a 2-

fold change in gene expression have previously been shown to have important biological

consequences (Cook et al., 2002; Rome et al., 2003). However, given the vast number of

genes that were identified in this study, we narrowed our focus and chose to study genes

having larger fold changes.

Interestingly, Jak2 has been regarded as an activator of ligand-dependent gene

transcription. However, this study revealed that nearly one-quarter of all Jak2-dependent

genes were down regulated. One possible explanation for this is that Jak2 is having an

indirect effect on these gene promoters via the activation of transcriptional repressor

genes. Once expressed, the repressors would subsequently bind other promoters and, in

turn, reduce gene transcription. Alternatively, recent studies have shown that the

Jak/STAT pathway itself is capable of directly inhibiting expression of specific gene

promoters. Specifically, recent work demonstrated the y-globin gene promoter is

inhibited by STAT38 (Foley et al., 2002). Currently, further experiments are required in

order to determine which of these scenarios might be happening in the y2A-derived cells.

As indicated above, a major finding of this work is that Jak2 may function as a

critical mediator of ligand-independent gene transcription. An important concern

however, is whether Jak2 is already in a "ligand-activated" state prior to exogenous









ligand addition. For several reasons, we believe the answer is no. First, the level of Jak2

protein that is expressed in the y2A-derived cells used in these studies is at a level that is

similar to cells that endogenously express Jak2, such as Jurkat cells. As such, this would

tend to minimize Jak2 autophosphorylation in the absence of exogenously added ligand.

Second, the cells were washed extensively with phosphate-buffered saline and serum

starved prior to use. This made the cells quiescent and in turn minimized the tyrosine

kinase activity of proteins such as Jak2, prior to any ligand treatment. Third, the addition

of exogenous ligand subsequently activated Jak2 suggesting that Jak2 was not fully

activated prior to ligand addition. Fourth, the phenomena of Jak2 mediating ligand-

independent gene transcription was observed in multiple independent cell lines (y2A/AT1,

y2A/GHR, and RASM) therefore suggesting that the effect is not due to clonal artifact.

Fifth, in the case of the RASM-derived cells, when endogenous Jak2 tyrosine kinase

activity was reduced via the expression of the dominant negative Jak2 allele, there was a

subsequent alteration in gene expression that correlated with the microarray predictions.

This demonstrates that when the tyrosine kinase function of endogenously expressed Jak2

(i.e. non-transfected) is reduced from its basal state, there is a significant corresponding

change in Jak2-dependent gene transcription. And sixth, recent work by Chatti and

colleagues identified that the tyrosine kinase function of Jak2 exists in at least two

independent states; namely, a basal state and a ligand-activated state (Chatti et al., 2004).

Our data here suggest that the basal state of Jak2, previously characterized biochemically

as being capable of binding ATP and tyrosine autophosphorylating, is in fact an

important mediator of gene transcription.






51


In conclusion, this study showed that expression of Jak2 can alter the

transcriptional regulation of 621 genes in y2A-derived cells. These numbers are

indicative of the critical role that Jak2 tyrosine kinase has within a cell and suggest that

Jak2 plays a key role in basal, as well as ligand-activated, cellular gene transcription.

Therefore we believe these studies suggest that Jak2 can significantly regulate gene

expression outside of the classical, ligand-activated signaling paradigm.














CHAPTER 3
IDENTIFICATION OF JAK2 TARGETS IN RESPONSE TO ANGIOTENSIN II
SIGNALING

Introduction

Angiotensin II (AngII) is a major regulator of cardiovascular and renal

homeostasis. In addition to its role as a vasoconstrictor, AngII also acts as a potent

growth factor by activating several non-receptor tyrosine kinases through the ATi

receptor (Leduc et al., 1995; Schieffer et al., 1996). Jak2 is one example of a non-

receptor tyrosine kinase that is activated by AngII (Marrero et al., 1995). Activated Jak2

is recruited to the AT1 receptor upon treatment with AngII where it subsequently initiates

signaling cascades that result in the regulation of gene transcription (Marrero et al., 1995;

Ali etal., 1997).

While Jak2 is traditionally known to be an important mediator of cytokine

signaling, recent studies have suggested it also contributes to various cardiovascular

pathologies, such as neointimal formation and cardiac hypertrophy (Seki et al., 2000;

Mascareno et al., 2001; Kodama et al., 1997). Interestingly, increased circulating levels

of AngII correlate to similar cardiovascular pathologies as recently shown to be

associated with Jak2. Given the link between these two signaling molecules, we

hypothesize that Jak2 has a significant role in mediating AngII-induced gene

transcription.









To date, the downstream targets of Jak2 activation via the AT1 receptor remain

largely unknown. By identifying these targets, we will be better equipped to determine

the specific contributions of Jak2 in various cardiovascular pathologies.

Here, similar to the study detailed in Chapter 2, we utilized microarray technology

to compare the gene expression of Jak2-deficient cells with the gene expression of Jak2-

expressing cells. In this study however, we sought to compare the expression profiles of

both cell lines in response to AngII treatment. We hypothesize that since Jak2 is recruited

to and activated by the AT1 receptor, it has a large role in mediating AngII-dependent

gene transcription. Furthermore, we believe the identification of AngII-inducible genes

that require Jak2 for their expression may provide meaningful insight on the specific

roles of Jak2 within the cardiovascular system.

Microarray experiments determined that a large number of genes were

differentially expressed greater than 2-fold in response to 1 and 4 hours of AngII

treatment, when comparing the human fibroblast y2A and y2A/Jak2 cells. Amongst the

many genes identified, some had been previously associated with Jak2 and/or AngII

signaling. Conversely however, many of the genes identified by the microarray

experiments were novel targets of both AngII and/or Jak2. These genes therefore offered

novel insight into the effects of AngII-mediated cellular transcription.

In conclusion, using gene-profiling technology, we identified a large number of

AngII-inducible genes that require Jak2 for regulation. By identifying the downstream

targets of Jak2 activation via the AT1 receptor, we may now be able to better elucidate of

the role of Jak2 in the progression of cardiovascular diseases through AngII-dependent

signaling.









Materials and Methods

Cell Culture

The y2A and y2A/Jak2 cell lines were described previously in Chapter 2. Cells

were grown in DMEM +10% FBS at 37C in 5% CO2 humidified atmosphere. All cells

were made quiescent by washing them extensively with phosphate-buffered saline and

then placing them in serum-free media for 20 hours prior to use.

Preparation of Total RNA

y2A and y2A/Jak2 cells were serum starved for 20 hrs and then treated for either

0, 1, or 4 hours with 100nM AngII. Total RNA was subsequently isolated using the acid

guanidine thiocyanate/phenol/chloroform method of extraction (Chomczynski and

Sacchi, 1987) exactly as described in Chapter 2. For each of the conditions, three

confluent 100-mm culture dishes of cells were lysed and extracted RNA was then pooled

together in order to avoid artifact that was unique to any one individual plate.

Microarray Expression Profiling

For the 0- and 4-hour conditions, cRNA probes were prepared for hybridization to

Affymetrix microarray chips following the manufacturer's instructions (Affymetrix

GeneChip Expresssion Analysis Manual). Briefly, double stranded DNA was prepared

from 10 atg of total RNA isolated from both cell lines using the Superscript Double

Stranded cDNA Synthesis kit (Invitrogen). Newly synthesized double stranded DNA

was subsequently cleaned using Phase Lock Gels (PLG)-Phenol/Chloroform Extraction.

5 il of double stranded DNA was then Biotin-labeled following the Enzo Bioarray High

Yield RNA Transcript Labeling Kit protocol (Affymetrix). Biotinylated cRNA was

subsequently cleaned using a Qiagen RNeasy column and quantitated. 20[tg of

unadjusted cRNA was then fragmented and hybridized to Affymetrix Test3 chips in order









to verify the quality of each preparation. Samples having similar metrics values were

then hybridized to U95A GeneChips at the University of Florida ICBR MicroArray

Core Laboratory.

For the 0- and 1-hour conditions, total RNA was isolated as described. The

resulting total RNA was shipped on dry ice to GenUs Biosystems, Inc (Chicago, IL)

where the microarray hybridization was performed. Briefly, total RNA samples were

quantitated by UV spectrophotometry at OD260/280 and the quality was assessed using

an Agilent Bioanalyzer (Agilent Technologies). Once the quality and concentration was

confirmed, double stranded DNA was prepared. Biotinylated cRNA targets were

subsequently prepared from the DNA template and again verified on the Bioanalyzer.

The appropriate amounts of cRNA were next fragmented to uniform size. The

fragmented cRNA samples were hybridized to CodeLinkTM Human Whole Genome

Bioarrays (GE Healthcare, Amersham Biosciences) and stained with Cy5-streptavidin.

Slides were scanned on an Axon GenePIX 4000B scanner (Molecular Devices, Axon

Instuments).

Microarray Data Analysis

Affymetrix data was analyzed using the Affymetrix Software Package,

Microarray Suite Version 5.0. Probe intensities for both cellular conditions were

compared and reported in both tabular and graphical formats. GenUs data was analyzed

with CodeLink and GeneSpring software packages. To compare individual expression

values across arrays, raw intensity data from each probe was normalized to the median

intensity of the array. Only genes with normalized expression values greater than

background intensity in at least one condition were used for further analysis.









Results

Microarray Analysis of Jak2-dependent Gene Transcription Following 4 hours of
AngII Treatment

The y2A and y2A/Jak2 cells used in this study have been stably transfected to

establish expression of the AT1 receptor on the plasma membrane. Since we are

examining Jak2 signaling in response to AngII, it was necessary to ensure that these cells

have the proper machinery to propagate AT1 receptor-induced Jak/STAT signaling

cascades. Previous studies from our lab investigated the ability of y2A and y2A/Jak2

cells to function normally in response to AngII treatment (Sandberg et al., 2004).

Experiments were conducted in these cells that established the following three

parameters: 1) Jak2 is able to become tyrosine phosphorylated in response to AngII, 2)

Jak2 forms a physical co-association with the AT1 receptor following AngII treatment,

and 3) STAT 1 and STAT3 (downstream targets of Jak2) are able to become tyrosine

phosphorylated in response to AngII treatment (Sandberg et al., 2004). As expected,

these parameters were only identified in the y2A/Jak2 cells and not the control cells,

which lack Jak2 expression. Furthermore, both cell lines were shown to tyrosine

phosphorylate paxillin in response to AngII, which is a Jak2-indepndent target of the ATi

receptor. Paxillin phosphorylation thereby confirms that the loss of Jak/STAT signaling

in the y2A cells is due to the specific loss of Jak2 function and not due to a clonal artifact

inherent in these cells. Thus, these studies determined that the y2A/Jak2 cell line is a

good model for elucidating AngII signaling effects through Jak2 (Sandberg et al., 2004).

We next sought to identify AngII-inducible genes that require Jak2 for their

regulation. To do this, four different cellular conditions were created. First, two control

conditions were prepared from the y2A and the y2A/Jak2 cell lines. These conditions









received no ligand, and therefore served as reference conditions. Next, both cell lines

were treated for 4 hours with 100nM AngII. Previous work has determined that AngII is

able to induce gene transcription in as little as 15 minutes and for as long as 24 hours

after treatment (Taubman et al., 1989; Sadoshima et al., 1997). Given this wide range of

transcriptional activation, we decided to examine 4 hours of AngII treatment in an

attempt to identify the majority of AngII-responsive genes that would be differentially

expressed.

Total RNA was harvested from the four experimental conditions, pooling three

plates from each condition to minimize any artifacts. The extracted total RNA was

reverse transcribed and biotin-labeled in preparation for hybridization to the Affymetrix

U95A microarray chip. The Affymetrix U95A GeneChip contains probe sequences for

-12,000 fully sequenced human genes. After the RNA probes were hybridized to the

Affymetrix microarray chips, pair-wise analyses identified genes having a greater than

two-fold change in expression between each condition. The summary of this data is

shown as Fig 3-1. For the cells lacking Jak2 (y2A), 68 genes showed a greater than two-

fold change in expression after 4 hours of AngII treatment. However, for the Jak2-

expressing cells (y2A/Jak2), 482 genes had a greater than two-fold change in expression

after the same 4-hour AngII treatment. These numbers suggest that the majority of the

482 genes that are differentially expressed in response to AngII are dependent upon Jak2

for regulation. Similar to as was expected, when the two different AngII-treated cell lines

where compared to each other, the microarray experiments identified 364 genes to be

differentially expressed. Ideally, these 364 genes were identified as AngII-inducible

genes that require Jak2 for their transcriptional regulation.










68 genes




y2A/AT1 y2A/AT



y2A/AT + Jak2 y2A/AT + Jak2g
0hr 4 hr AngII




482 genes


Figure 3-1 Summary of the number of differentially expressed genes identified by the
microarray experiments following 4 hours of AngII treatment.

Since there was a possibility that some of the 364 AngII-inducible genes were not

dependent upon Jak2, we conducted further analyses. To ensure the genes we had

identified where in fact AngII-inducible genes that required Jak2 for their regulation, we

combined the lists that represented genes that were regulated by AngII, irrespective of

Jak2 (i.e. the lists of 64 and 482 genes). We next compared the 364 genes to this new

combined list of AngII-inducible genes and subtracted any gene that was duplicated. By

doing this, we ensured that the genes we identified in the microarray experiments were in

fact regulated by both AngII treatment and Jak2 expression. We assumed that any gene

that was duplicated was not dependent upon Jak2, but simply regulated by AngII. The

final list of AngII-inducible genes found to be regulated through Jak2 was 254 genes.


Fig 3-2 shows a graphical illustration of mRNA expression levels from the AngII-

treated conditions. Each dot on the graph represents one of the 12,000 different genes on

the U95A chip. Genes falling outside the two parallel lines demonstrate a greater than

2.0 fold change in gene expression between the two conditions; genes falling above the







59


two parallel lines had increased gene expression, while genes falling below the two

parallel lines had decreased gene expression. The further away from the 2-fold cut-off

line that a gene lies, the greater the differential expression that gene displayed between

the two conditions. In addition, the farther up the slope a gene lays, the greater the

significance of differential gene expression. For example, Trypsinogen IV-B and

Trypsinogen C both demonstrate large induction folds (67- fold and 308-fold,

respectively). These genes both fall noticeably far from the 2.0 fold cut-off line and

relatively high up the slope, away from the origin of the graph.

1, )000 1,,00000

T- Ti Isinouen C ,.,'
10000l nF'OOO
Ti,| Isinoen I\b .,.




A '10 0


1 1



10 100 10CC I1 :00 110000 l00000C
A cells


Figure 3-2. Scatter plot analysis of all genes identified during microarray expression
profiling of y2A cells verse y2A/Jak2 cells treated for 4 hours with AngII.
Each dot is the mean value for an individual gene from two arrays. The
parallel lines indicate the two-fold differential expression levels.

In summary, these data suggest that Jak2 is responsible for regulating 254 genes

by at least 2-fold when activated by AngII. More importantly, this entire procedure was

repeated a second, independent time, and very similar results were obtained.









Statistical Analysis of the Affymetrix Microarray Replicated Experiments

The data obtained from both replicates were then further analyzed using various

statistical comparisons. Amongst these statistical methods performed were t-test

comparisons and identification of genes consistent between replicates. Statistical

calculations of the microarray data were performed using both Affymetrix MAS5

software as well as Cormibia software. The Cormibia program is a software package that

uses more stringent parameters in determining statistical significance of hybridization

intensities. Table 3-1 provides a list of five representative genes all demonstrating

statistical significance between the 2 independent microarray replicates. These genes

represent an important set of cellular functions including angiogenesis, hematopoesis, and

Ca2+ mobilization.

Table 3-1 Jak2-dependent genes following 4 hours of AngII treatment
Accession # Fold Change Gene Name Category
U23850 5.2 Type 1 IP3 receptor Calcium Signaling
D11151 ,4 3.5 Endothelin-A Receptor Vasoconstriction
X03656 t 13.0 G-CSF Cell Defense
D83492 1 5.5 EphB6 Angiogenesis
U66061 1 308.1 Trypsinogen C Proteolytic Enzyme
Shown are the gene accession numbers, the direction and magnitude of the fold change,
the gene name, and a brief category summarizing the gene's function.


Microarray Analysis of Jak2-dependent Gene Transcription Following 1 hour of
AngII Treatment

The previous microarray experiments examined genes regulated after 4 hours of

AngII treatment. However, AngII can modulate the expression of some genes, such as c-

fos, in as little as 15 minutes (Naftilan et al., 1990; Viard et al., 1992). The preceding

microarray experiments failed to identify c-fos as being differentially expressed, either

with or without Jak2. Clearly, we know that this gene is AnglI-responsive. Therefore,









we hypothesized that there may be a significant number of genes that are expressed prior

to the 4 hour time point we analyzed. Thus, we repeated the above experiments as

before, this time shortening the AngII treatment to 1 hour.

y2A and y2A/Jak2 cells were treated exactly as described above, only this time cells

were treated for one hour with AngII. Total RNA was extracted and prepared for

hybridization to microarray gene chips. The cRNA probes, representing each of the four

conditions, were hybridized to the CodeLinkTM Human Whole Genome Bioarray (GenUs

Biosystems). This particular expression platform targets -57,000 transcripts and ESTs,

including -45,000 well characterized human genes and transcript targets.

The data from the four treatment groups was analyzed using CodeLinkTM and

GeneSpring software packages. Genes having a greater than 2-fold change in expression

between the AngII-treated y2A and y2A/Jak2 cells were tabulated. The original statistical

parameters predicted the expression of over 400 genes as being different between the

AngII-treated cell lines. These 400 genes were further filtered down using an array of

statistical measures, including the Cross-Gene Error Model algorithm offered by

GeneSring software. This Cross-Gene Error Model generates t-testp-values for each

gene as well as standard deviation and standard error. As before, the entire procedure was

repeated a second independent time, and in total 65 genes were identified as statistically

regulated in both replicates.

Overall, 65 AngII-inducible genes were found to be dependent upon Jak2. Table

3-2 provides a list of three representative genes all demonstrating statistical significance

between the 2 independent microarray replicates. Again, a diverse set of genes was

identified as being regulated by Jak2.










Table 3-2 Jak2-dependent genes following 1 hour of AngII treatment
Accession # Fold Change Gene Name Category
NM_000581.1 4 2.3 Glutathione peroxidase 1 Oxidant Defense
NM_005627.2 1 3.3 SGK1 Na+ Reabsorption
NM 002192.1 1 5.89 Erythroid differentiation protein Cell Differentiation
Shown are the gene accession numbers, the direction and magnitude of the fold change,
the gene name, and a brief category summarizing the gene's function.


Discussion

Using gene-profiling technology, this study provides new evidence to support the

hypothesis that Jak2 tyrosine kinase is a key mediator of AT1 receptor signal

transduction. While previous studies have implicated Jak2 activation in a number of

cardiovascular pathologies, such as neointimal formation, no clear functional

consequence of this activation has been defined (Mascareno et al., 2001).

Here, we demonstrate that the recruitment of Jak2 to the AT1 receptor facilitates

AngII-mediated signal transduction that results in the activation of many diverse genes.

Some of these genes have previously been identified as targets of AngII signaling. One

such example is the IP3 receptor (Alexander et al., 1985). Through the activation of

heterotrimeric G-proteins, AngII causes an increase in the production of the intermediate

signaling molecule, inositol 1,4,5 trisphosphate (IP3). Following its production, IP3 binds

to the IP3 receptor and thereby causes the activation and regulation of the receptor.

Furthermore, other genes identified by the microarray experiments have been previously

associated with Jak2 signaling, such as the EphB6 gene (Chapter 2). Identifying genes

that have been previously established as targets of AngII or Jak2 thereby strengthen the

quality of the microarray predictions. The majority of genes that were identified however

were novel targets of both AngII and Jak2. These genes offer new insights into the

possible mechanisms of Jak2 when activated via the AT1 receptor.









The number of genes identified as being differentially expressed after 1 hour of

AngII treatment differed dramatically when compared to the number of genes regulated

after 4 hours AngII treatment. Specifically, the microarray experiments identified 65

AngII-inducible genes as being Jak2-dependent after 1 hour of treatment. Alternatively,

after 4 hours of AngII-treatment, the microarray experiments identified over 400% more

Jak2-dependent genes (254 genes). One possible explanation for the dramatic difference

in the number of genes identified could be the alternate time points. After 4 hours of

AngII treatment, the potential for activation of secondary and tertiary genes increases

greatly. While these genes may have important biological merit, they may not be directly

mediated via Jak2. When the y2A and y2A/Jak2 cells were treated for only 1 hour with

AngII, the potential for secondary and tertiary genes is dramatically reduced and results

in a lower number of gene targets overall.

Another plausible explanation for the variation in the number of differentially

expressed genes is the type of expression platforms utilized in each experiment.

Microarray technology has undergone increasing popularity over the past decade.

Concurrent with the increase in the number of studies using microarray technology, there

has been an increase in the development of commercially available analytical software

programs. These programs use varying statistical parameters to reduce the tremendous

amount of raw data produced. Here, we used both Affymetrix and CodeLinkTM

expression platforms. Furthermore, the statistical software used for analysis also varied

between experiments. Gene-profiling software is continually changing in stringency and

methodology to better determine appropriate changes in gene expression. As such, the






64


difference in the amount of genes identified by the microarray experiments could be a

result of the different parameters used in the software analysis.

In summary, using gene-profiling technology, we identified a large number of

AngII-inducible genes that are downstream targets of Jak2. The large number of genes

identified in this study indicates the critical role Jak2 plays in AngII-mediated

transcription. Furthermore, the genes identified in this study can possibly elucidate our

current understanding of the role Jak2 plays in the progression of various cardiovascular

diseases.














CHAPTER 4
ANGIOTENSIN II INDUCES SGK1 GENE EXPRESSION VIA A JAK2-
DEPENDENT MECHANISM

Introduction

The studies presented thus far have focused on the global role of Jak2 in mediating

cellular gene transcription. In order to draw meaningful conclusions as to the function of

Jak2 in a cell, specific genes must be analyzed. Previous gene profiling experiments

identified numerous AngII-inducible genes that require Jak2 for their regulation. One

such gene that was found to be dependent upon Jak2 for regulation was the serum and

glucocorticoid regulated kinase 1 (sgkl). Here, we sought to determine the precise

mechanisms that control the expression and function of sgkl in response to AngII

treatment.

sgkl was originally identified as a "serum and glucocorticoid-regulated kinase" in

rat mammary tumor cells (Webster et al., 1993a). In the kidney, sgkl is an early-induced

aldosterone target gene whose product, a serine-threonine kinase, appears to primarily

regulate expression and function of the Na+ epithelial channel (ENaC), as well as

possibly other ion transporters. In addition to corticosteroids, a variety of other agonists

increase sgkl gene transcription in a cell-type specific manner (Alliston et al., 1997;

Cowling et al., 2000b; Kumar et al., 1999; Lang et al., 2000; Webster et al., 1993b;

Waldegger et al., 1998). However, the specific signaling pathways that mediate the

activation of sgkl gene transcription by the different agonists have not been well defined.









Currently, the functions of sgkl are best characterized in response to its induction

via aldosterone. Aldosterone treatment increases sgkl gene expression within 15

minutes. Maximum sgkl induction peaks at 60 minutes and then returns back toward

basal levels over the ensuing 24 hours (Chen et al., 1999). This activation has been

found in multiple cells types including; A6 cells, mpkCCD cells, and in the rat collecting

duct in vivo (Chen et al., 1999; Neray-Fejes-Toth et al., 1999; Shigaev et al., 2000).

Following induction via aldosterone, SGK1 is translated and subsequently

phosphorylates its substrate, Nedd4-2. In its unphosphorylated form, Nedd4-2 binds

proline-rich motifs (PY) located in the carboxy terminus of ENaC (Kamynina and Staub,

2002). The association of Nedd4-2 with ENaC targets the channel for endocytosis.

SGK1 mediated phosphorylation of Nedd4-2 results in its disassociation from ENaC and

thereby causes an increase in ENaC abundance and activity at the plasma membrane of

epithelial cells. The importance of SGK1 on ENaC regulation has been corroborated in

an SGK1 knockout mouse (Wulff et al., 2002; Huang et al., 2004). The sgkl-/- mice

exhibit normal kidney structure and function under physiological salt intake. However,

when dietary salt is restricted, a defect in sodium retention by the kidney leads to a

significant decrease in blood pressure (Wulff et al., 2002). Given its roles in regulating

ENaC function and expression, SGK1 is regarded as an important signaling molecule in

blood pressure regulation.

Here, we explore the regulation of sgkl in response to AngII in human fibroblast

cells. To date, no direct link has been established between sgkl and AngII signaling.

Furthermore, we explore the specific Jak2-dependent mechanisms responsible for AnglI-

induced sgkl transcription.









Materials and Methods

Cell Culture

The y2A and y2A/Jak2 cell lines were described previously in Chapter 2. The y2A

cells stably expressing either the growth hormone receptor alone (y2A/GHR) or the

growth hormone receptor along with wild type Jak2 (y2A/GHR/Jak2) have also been

described (He et al., 2003). Cells were grown in DMEM +10% FBS at 370C in a 5%

CO2 humidified atmosphere. All cells were made quiescent prior to experimentation by

washing them extensively with phosphate-buffered saline and then placing them in

serum-free media for 20 hours prior to use. Cell culture reagents were obtained from Life

Technologies, Inc.

Quantitative RT-PCR

A two-step quantitative RT-PCR method was used to quantify changes in sgkl

mRNA levels. Specifically, y2A and y2A/Jak2 cells were serum starved then treated for

0 or 1 hour with 100nM AngII. Following treatment, total RNA was isolated using the

acid guanidine thiocyanate/phenol/chloroform method of extraction (Chomczynski and

Sacchi, 1987), exactly as described in Chapter 2. The total RNA was subsequently

reversed transcribed using the SuperScript II RNase IT Transcriptase Kit (Invitrogen).

Primers were designed against the sgkl gene using PrimerBank, a public resource for

PCR primers (http://pga.mgh.harvard.edu/primerbank/) (Wang and Seed, 2003). The

PrimerBank ID number for the primer pair used in the experiments was 25168263al.

PCR reactions were prepared using the SYBR Green PCR Core Kit (Applied Biosystems)

and performed on the GeneAmp 5700 Sequence Detector machine (Applied Biosystems).

18s primers were used as a standard internal reference and analyses were accomplished









by calculating the 2-AAct values for each condition (Giulietti et al., 2001;Livak and

Schmittgen, 2001).

Northern Analysis

Northern Blot analysis was performed as previously described in Chapter 2.

Briefly, y2A and y2A/Jak2 cells were serum starved and treated for 0 or 1 hour with

100nM AngII. Following treatments, total RNA was isolated and quantitated. 25 |tg of

total RNA was separated on a 1% agarose-6% formaldehyde-containing gel. RNA

samples were transferred onto a charged nylon membrane (Millipore Corporation) and

then hybridized to 32P-labeled cDNA probes. Probes were labeled using the Random

Primers DNA Labeling System Kit (Invitrogen). The cDNA encoding for sgkl was a kind

gift from Dr. Florian Lang (University of Tubingen, Germany). Densitometrical analysis

was performed using the automated digitizing software, Un-Scan-It, Version 5.1 (Silk

Scientific).

Western Blot Analysis

Western blot analysis was performed exactly as was previously described in

Chapter 2. Briefly, y2A and y2A/Jak2 cells were treated for 0, 30, or 60 minutes with

100nM AngII and whole cell lysates were collected. Lysates were subsequently

separated on an 8% SDS-PAGE gel and transferred onto a nitrocellulose membrane.

Membranes were Western blotted with an anti-SGK1 polyclonal antibody (Cell Signaling

Technology) for 2 hours in 5% milk/TBST. Membranes were subsequently stripped and

re-probed with an anti-STAT1 polyclonal antibody (Santa Cruz Biotechnology) to

confirm equal loading of all samples.









Luciferase Assay

y2A and y2A/Jak2 cells were transfected with 5 |tg of a luciferase reporter construct

that contains a -3,000 bp segment (-3142 to +117) of the sgkl promoter upstream of the

luciferase cDNA (Itani et al., 2002). This construct was a generous gift from Dr. Christie

Thomas (University of Iowa). Transfections were performed using Lipofectin

(Invitrogen). Following the transfection, the cells were seeded into 12-well plates at 2.5

x 105 cells per well, grown for 36 hours, serum starved for 20 hours, and then treated for

0, 4, or 24 hours with 100nM AngII. Luciferase activity was measured from detergent

extracts in the presence of ATP and luciferin using the Reporter Lysis Buffer System

(Promega) and a luminometer (Monolight Model 3010). Experiments were repeated

exactly as described using y2A/GHR and y2A/GHR/Jak2 cells. These cells were treated

with 600ng/ml GH. Each of the conditions were measured in replicates of six (n=6).

Chromatin Immunoprecipitation (ChIP) Assay

The ChIP assay was performed using the EZ ChIPTM Kit according to the

manufacturer's protocol (Upstate). Briefly, 2 x 106 y2A and y2A/Jak2 cells were treated

for 0 or 20 minutes with 100nM AngII and then cross-linked with 1% formaldehyde at

room temperature for 10 minutes. Cells were washed with 2 volumes of ice-cold PBS

and then lysed with 1 mL nuclei swelling buffer (5mM PIPES pH 8.0, 8.5mM KC1, 0.5%

NP-40). Following a brief centrifugation at 5000 rpm, cells were further lysed in SDS

lysis buffer and sonicated using the 60 Sonic Dismembrator (Fisher Scientific) at Output

4.5. Cells were sonicated on ice for 4 cycles in 10-second intervals and allowed to cool

for one minute between cycles. Chromatin fractions were spun at 12,000 rpm and the

supernatants were then diluted ten-fold in a ChIP dilution buffer. Samples were









subsequently "pre-cleared" by adding 60 ptL of Protein G Agarose beads (50% slurry)

and shook at 40C for 1 hour. Immunoprecipitations were carried out overnight at 4C

using 2 |tg of STAT1, STAT3, or STAT6 antibodies (Santa Cruz) or adding no antibody

as a negative control. Following immune complex capture, beads were washed and the

complexes were eluted. Cross-links were subsequently reversed by adding 5M NaCl and

incubating for 5 hours at 650C. DNA was purified and subjected to PCR amplification

using the following primers which recognize the STAT-recognition sequence in the sgkl

promoter region: forward 5'- GTTTGAAAACAAACATGCAAAAGT-3' and reverse 5'-

TTTAGGCAATTTCAAATCACAGTAAC-3'. The PCR products were analyzed by

electrophoresis on a 2.5% agarose gel stained with ethidium bromide.

Results

AngII Induces sgkl Gene Expression in a Jak2-dependent Manner

Previous microarray experiments identified sgkl as a potential downstream target

of Jak2 following 1 hour of AngII treatment (Chapter 3). These experiment compared

gene expression profiling between a human fibroblast cell line that is devoid of Jak2

protein (y2A) and the same cell line with the Jak2 protein expression restored via stable

transfection (y2A/Jak2). Briefly, the microarray experiments predicted sgkl gene

expression to be up regulated by over 3-fold in the y2A/Jak2 cells when treated with

AngII for 1 hour. In order to confirm the validity of the microarray experiments, sgkl

mRNA levels were analyzed after AngII treatment in y2A and y2A/Jak2 cells.

Specifically, total RNA was isolated from both cell lines following 0 and 1 hour of

treatment with 100nM AngII. The samples were probed with a 1,300 bp human sgkl

cDNA and analyzed via Northern blot analysis as shown in Fig. 4-1A. Similar to the







71


microarray experiments, cells expressing Jak2 protein showed an increase in sgkl mRNA

levels following treatment with AngII. Conversely, Jak2-deficent cells showed no

increase in sgkl gene expression. Fig. 4-1B shows a quantitation of sgkl mRNA levels

using densitometrical analysis. Specifically the data revealed that in y2A/Jak2 cells there

was a 3.5 fold increase in sgkl mRNA expression over the untreated controls, when

corrected for loading and transfer efficiency with GAPDH. Thus, it appears that AngII

increases sgkl mRNA levels in a Jak2-dependent manner in human fibroblast cells.


A. Y2A v2A + Jak2
AngII (hours) 0 1 0 1


sgk]




-.. A- GAPDH





B.
4
35
3
25

15


0 L
y2A y2A y2A/Jak2 y2A/Jak2
Ohr Ihr AnggH Ohr Ihr AngII


Figure 4-1 Activation of sgkl transcription by AngII requires Jak2. A) Northern blot
analysis was performed using total RNA isolated from y2A and y2A/Jak2
cells. Membranes were probed with cDNA encoding for sgkl. Blots were
subsequently stripped and re-probed with GAPDH to control for loading.
Shown is one of three representative results. B) Densitometrical analysis of
three Northern blots quantitating changes in sgkl gene expression.
Significance was determined using Student's t-test.










sgkl gene expression was further confirmed via quantitative RT-PCR analysis.

y2A and y2A/Jak2 cells were treated for 1 hour with 100nM AngII. Total RNA was then

extracted and samples were reverse transcribed. Quantitative RT-PCR analysis was

performed using primers designed for sgkl (Fig. 4-2). The data confirms that AngII

treatment causes an increase in sgkl gene expression in Jak2-expressing cells. This

induction of mRNA was not seen in cells lacking Jak2 protein.




4 T

3



0
d 2

I


O 0
72A y2A/Jak2
IhrAngII Ihr AngII


Figure 4-2 Jak2-expressing cells have a greater increase in sgkl gene expression than
Jak2-deficient cells. Quantitative RT-PCR analysis of total RNA was
performed using y2A and y2A/Jak2 cells treated for 1 hour with 100nM
AngII. Primers were designed for sgkl. Fold changes were derived from the
2-*t value and are indicated on the graph. Values are represented as the
mean +/- SD. Shown is one of three representative results.

Collectively, Fig. 4-1 and 4-2 strengthen the argument that AngII causes induction

of the sgkl gene, independent of aldosterone action. Furthermore, it appears that AngII

regulates sgkl transcription through a Jak2-dependent mechanism.

Jak2 is Critical for AngII-mediated Increases in SGK1 Protein Levels

To determine whether the induction of sgkl gene expression by AngII results in a

corresponding increase in cellular SGK1 protein levels, whole cell lysates from y2A and









y2A/Jak2 cells were analyzed via Western blot analysis. Cells were treated for 0, 30, and

60 minutes with 100nM AngII and then protein content was determined by Western

blotting with a polyclonal SGK1 antibody (Fig 4-3). Membranes were subsequently

stripped and re-blotted with a STAT1 polyclonal antibody to ensure equal loading.

Similar to the gene expression analysis, the y2A/Jak2 cells showed an increase in SGK1

protein expression after treatment with AngII. This increase was not seen in the y2A

cells, which lack Jak2 protein.


y2A y2A + Jak2
AngII(min) 0 30 60 0 30 60
61-
~- "- SGK1
49-

-... STAT 1


Figure 4-3 Western blot analysis of SGK1 protein expression in y2A cells compared to
y2A/Jak2 cells following treatment with AngII. Cells were treated with
100nM AngII for 0, 30, and 60 min. Lysates were collected and blotted with
an anti-SGK1 polyclonal antibody. The membrane was subsequently stripped
and re-blotted with an anti-STAT1 polyclonal antibody to establish equal
loading.

AngII, but not Growth Hormone, Causes Activation of the sgkl Promoter in Jak2-
expressing Cells

We next sought to determine if AngII was causing sgkl induction through

activation of the sgkl promoter. To do this, we transfected a luciferase reporter construct

that contains -3,000 bp of the sgkl promoter upstream of a luciferase-coding region into

y2A and y2A/Jak2 cells. The cells were subsequently serum starved for 20 hrs, and then

treated for 0, 4, or 24 hours with 100 nM AngII. Following cell lysis, luciferase activity

was measured (Fig. 4-4A). In cells lacking Jak2 protein, there was no significant









increase in luciferase activity in response to AngII treatment. However, the y2A/Jak2

cells showed a nearly 2.5-fold increase in luciferase activity following a 24-hour

treatment with AngII. These data suggest that AngII causes a signaling cascade that

results in the activation of the sgkl promoter. Furthermore, this transcriptional activation

is only seen in cells expressing Jak2.

To determine whether the transcriptional activation of the sgkl promoter was

specific for AngII treatment, we used y2A cells that were stably transfected with the

growth hormone receptor (GHR). y2A/GHR and y2A/GHR/Jak2 cells were transfected

with the same luciferase construct as above. Cells were serum starved for 20 hours,

treated for 0, 4, or 24 hours with 600ng/mL growth hormone (GH) and then luciferase

activity was measured (Fig. 4-4B). This time, both cell types showed no increase in

luciferase activity, irrespective of the presence of Jak2. These data indicate that contrary

to AngII treatment, activation of Jak2 via GH has no effect on sgkl induction.

AngII Causes STAT1 Association with the sgkl Promoter Region in y2A/Jak2 cells

The preceding data suggests that AngII induces sgkl transcription via the activation

of Jak2. Traditionally, upon activation Jak2 propagates signaling cascades that activate

the cytosolic transcription factors, termed STATs. Upon activation by Jak2, STATs will

dimerize and translocate into the nucleus where they bind to STAT-recognition sites

within the promoter region of a target gene. Most commonly, these STAT-recognition

sequences are known as GAS motifs (gamma interferon activated sequences). GAS

elements are palindromic response elements that share the general sequence motif

TTCNmGAA (Lew et al., 1991). In this study we questioned if AngII induction of sgkl

was occurring through a Jak/STAT signaling cascade. Analysis of the -3kb sgkl









A.

3
2.5
2
S1.5


S0.5
5 0


F


Angiotensi n I treatment (hours)


1.4
1.2
1
S0.8
. 0.6
I 0.4
S0.2
0


* y2A/GHR


y2A/GHR/JAK2


0 4 24


Growth Hormone Treatment (hours)

Figure 4-4 AngII activates the sgkl promoter in a ligand specific manner. A.) y2A and
y2A/Jak2 cells were transfected with 5 |tg of a luciferase reporter construct
containing -3,000 bp of the sgkl promoter upstream of a luciferase gene.
Cells were treated with 100nM AngII and then luciferase activity was
measured. The difference in luciferase activity between the 0 and 24 hour
time points was statistically significant as determined by Student's t-test. *, p
=9.48 x 10-6 Shown is one of three independent results. B) y2A/GHR and
y2A/GHR/Jak2 cells were transfected as above and treated with 600 ng/ml
GH. Luciferase activity was then measured. Shown is one of three
independent results.


* 2A
S2A/Jak2









promoter sequence revealed multiple GAS elements (Fig 4-5A). To examine whether

STAT proteins associate with the sgkl promoter, y2A and y2A/Jak2 cells were analyzed

by ChIP assays. A specific primer set was designed to amplify a 209 bp DNA fragment

of the sgkl promoter that contained a GAS element identified at position -725 to -717.

y2A and y2A/Jak2 cells were treated with 100nM AngII for 0 or 20 minutes, and

subsequently analyzed by a ChIP assay (Fig 4-5B). PCR amplification revealed that

STAT1 binds to the sgkl promoter in y2A/Jak2 cells following treatment with AngII. As

expected, this association was not found in the y2A cells. Furthermore, when

immunoprecipitations were performed using STAT1, STAT3, and STAT6 antibodies,

PCR analysis suggested that STAT1 was the preferential STAT binding to the sgkl

promoter in response to AngII (Fig. 4-5C). These data strengthen the argument that AngII

is activating the Jak/STAT pathway to induce sgkl transcription.

Discussion

This study provides the first evidence that sgkl is induced by AngII via an

aldosterone-independent mechanism. Specifically, we suggest that AngII is eliciting its

effects on sgkl transcription through a Jak2-dependent mechanism.

To date, sgkl activation and function are best understood in response to

aldosterone. The series of events leading to sgkl induction via aldosterone have been

well studied. Traditionally, in response to a drop in blood volume, increased renin levels

produce AngII. Amongst the many physiological effects of AngII, it acts directly on the

adrenal glands to cause the secretion of aldosterone into the blood. Aldosterone

subsequently binds to mineralocorticoid receptors within epithelial cells of the kidney











GAS element


(-2376 -2347)
(-735 -706)


AngII

sgkl


Input


No Ab


5' CAAAGTCACA TTCTATGAA GATTCCCTGC 3'
5' CGGCGGC TCC TTCAAGGAA AC GTCAGTGC 3'


2Q-9 __
+ +


y2A/Jak2 cells

S1 S' S6


sgkl



Input


Figure 4-5 AngII causes STAT1 association with the sgkl promoter in y2A/Jak2 cells.
A.) Identification of GAS elements found within the -3,000 bp region of the
sgkl promoter B.) ChIP assay investigating STAT1 binding to the sgkl
promoter in y2A and y2A/Jak2 cells. Cells were treated for 0 or 20 min with
100nM AngII and then subsequently subjected to formaldehyde cross-linking.
Immunoprecipitation were performed using an anti-STAT1 antibody or no
antibody (negative control). Purified DNA was analyzed by PCR with a
primer set specific for the sgkl promoter region containing a GAS element.
Input corresponds to 1/100 of the amount of DNA used in the assay. C.) ChIP
assay analyzing which of the STATs binds preferentially to the sgkl promoter
region. y2A/Jak2 cells were treated for 20 min with 100nM AngII.
Immunoprecipitations were performed using STAT1 antibody (S1), STAT3
antibody (S3), and STAT6 antibody (S6). Purified DNA was analyzed by
PCR with a primer set specific for the sgkl promoter region containing a GAS
element. Input corresponds to 1/100 of the amount of DNA used in the assay.

and directly causes an increase in sgkl transcription. Therefore, while previous studies

have implicated an indirect role of AngII in mediating sgkl induction, there has been no

evidence supporting a direct role. Here, we suggest that AngII is increasing sgkl

transcription, but through an aldosterone-independent mechanism. As opposed to

triggering aldosterone secretion, we propose that AngII is signaling through tyrosine


Position









kinases to elicit its effects on sgkl transcription. Further investigations are required to

determine the physiological consequences of this sgkl induction via AngII.

Our data show cells expressing Jak2 protein can increase sgkl expression following

treatment with AngII. Alternatively, Jak2-deficient cells lack increases in sgkl

expression. Therefore these studies suggest a critical role for Jak2 in regulating sgkl

transcription. We hypothesized that AngII mediates sgkl transcription through the

initiation of Jak/STAT signaling cascades. This hypothesis was supported by two main

reasons.

First, Jak2 has been well established in the literature as being activated via the ATi

receptor (Marrero et al., 1995). Specifically, AngII binding to the AT1 receptor causes

cytosolic Jak2 to become activated and subsequently form a physical association with the

intracellular tail of the AT1 receptor. After being recruited to the receptor, Jak2 initiates a

tyrosine phosphorylation cascades that results in the activation and dimerization of the

STATs. STAT dimers consequently translocate into the nucleus where they mediate

gene transcription. Thereby, if sgkl transcription is being induced by a Jak2-dependent

mechanism, it is probable that Jak2 is acting through the STATs.

Second, we identified multiple STAT-recognition sequences within the promoter

region of sgkl. Previous work has elucidated the preferential binding parameters for the

specific STATs. STAT6 dimers prefer TTC(N)4GAA whereas the remaining STAT

dimers will traditionally recognize TTC(N)3GAA motifs (Schindler et al., 1995; Seidel et

al., 1995; Horvath et al., 1995). The specific motifs that were identified in this study

suggest that a member of the STAT family, other than STAT6, may potentially be

binding to the promoter of sgkl and initiating transcription. These observations further









strengthen the argument that AngII induces sgkl transcription via the activation of a

Jak/STAT pathway

When the hypothesis was specifically investigated using the ChIP assay, we found

that STATs were indeed involved in the AngII-induced increases in sgkl transcription.

The data in Figure 4-5 shows that STAT1 is physically binding to the sgkl promoter

region in Jak2-containing cells following treatment with AngII. While there was

evidence that STAT3 and STAT6 may be having a minor contribution to sgkl

transcription, we hypothesize that STAT1 is the preferential STAT involved in sgkl

induction at position -725 to -717.

Interestingly, when cells are stimulated with GH, a well-known activator of Jak2,

no significant increase in sgkl transcription is observed. While Jak2 is activated by a

diverse set ofligands, it is unclear whether its downstream targets are ligand-specific.

This work suggests that the transcriptional effects of Jak2 on sgkl induction are specific

for treatment with AngII. This is in agreement with previous studies that suggest GH

activates different STATs through specific mechanisms (Carter-Su et al, 1997). Namely,

studies have shown that GH causes robust activation of STAT3 and STAT5b in certain

cell types (Yi et al, 1996). Given the diversity of GH signaling, we believe activation of

Jak2 via GH causes recruitment of different STATs as when AngII activates Jak2.

Therefore, we conclude that Jak2 demonstrates ligand specificity, as evidenced by the

lack of sgkl induction when GH activates Jak2.

In conclusion, these studies suggest that AngII mediates sgkl expression through a

Jak2-dependent mechanism. Furthermore, AngII may now be regarded as a mediator of

sgkl induction, independent of its actions through aldosterone.














CHAPTER 5
JAK2 PREVENTS ANGIOTENSIN II-MEDIATED INOSITOL 1,4,5
TRISPHOSPHATE RECEPTOR DEGRADATION

Introduction

The Type 1 inositol 1,4,5 trisphosphate (IP3) receptor was amongst the genes

identified in Chapter 3 as being a potential target of Jak2, when activated via the AT1

receptor. While previous studies have established a relationship between AngII and the

IP3 receptor (Alexander et al., 1985), no such correlation has been made linking Jak2 to

the IP3 receptor. Therefore, we sought to elucidate the complex regulation of the IP3

receptor in response to AngII. Specifically, we investigated the regulatory effects of

signaling cascades initiated by Jak2.

As previously described in Chapter 1, the IP3 receptors are intracellular calcium

channels expressed on the membrane of the endoplasmic reticulum (ER). IP3 is a second

messenger produced through the stimulation of PLC-coupled receptors, such as the AT1

receptor. IP3 binding to its obligatory receptor results in a rapid release of calcium from

internal stores via a non-selective cation pore in the C-terminal portion of the channel

(Boehning et al., 2001). Three structurally distinct IP3 receptors have been identified

(Nakagawa et al., 1991). Of the three subtypes, Type 1 has the highest expression

throughout all cell types studied (De Smedt et al., 1994; Wojcikiewicz, 1995).

Maintaining precise regulation of calcium signaling within a cell is critical for

normal cellular functions. Regulation of calcium is maintained via a complex interplay

between changes in cytosolic IP3 concentration and IP3 receptor expression on the









membrane of the ER. Regulation of IP3 receptor expression and function can be

mediated via its phosphorylation by multiple kinases such as cyclic-AMP-dependent

protein kinase (PKA), protein kianse C (PKC) and Fyn tyrosine kinase (Ferris et al.,

1991a, 1991b; Jayaraman et al., 1996). Specifically, Fyn has been shown to bind to and

phosphorylate the IP3 receptor at tyrosine 353 (Y353) in activated T-cells (Jayaraman et

al., 1996). Evidence suggests that the phosphorylation of y353 via Fyn increases the

binding affinity of IP3 to its receptor when there are low concentrations of IP3 within the

cytosol (Cui et al., 2004). However, the effect of y353 phosphorylation in response to

ligand treatment (i.e., high IP3 levels) has not yet been defined.

Here, we investigate the role of Jak2 in regulating the expression and function of

the IP3 receptor in response to AngII. Using rat aortic smooth muscle (RASM) cells

over-expressing a dominant negative Jak2, we determined that the loss of a functional

Jak2 contributes to AngII-mediated degradation of the IP3 receptor. Since previous data

show that Fyn, a downstream target of Jak2, is able to phosphorylate the IP3 receptor at

Y353, we believe Jak2 prevents the AngII-mediated IP3 receptor degradation via the

activation of Fyn. In conclusion, these data suggest that Jak2 has a protective role in

maintaining IP3 receptor expression, potentially through activation of Fyn and subsequent

phosphorylation of the IP3 receptor.

Materials and Methods

Cell Culture

Creation of the y2A and y2A/Jak2 cells have previously been described in Chapter

2. Additionally, creation of the RASM-WT and RASM-DN cells have also been

previously described (Sayeski et al., 1999a). All cells were maintained at 37BC in a 5%









CO2 humidified atmosphere. Prior to experimentation, all cells were made quiescent by

washing them extensively with phosphate-buffered saline (PBS) and then placing them in

serum-free media for either 20 hours (y2A) or 48 hours (RASM). Cell culture reagents

were obtained from Life Technologies, Inc. AG490, AG-9, PP-2, PP-3, and lactacystin

were all purchased from Calbiochem. Losartan was from Merck.

Quantitative RT-PCR

A two-step quantitative RT-PCR method was used to quantify changes in IP3

receptor gene expression. Specifically, the y2A and the RASM-derived cell lines were

serum starved and then treated for 0 or 4 hours with 100nM AngII. Following treatment,

total RNA was isolated using the acid guanidine thiocyanate/phenol/chloroform method

of extraction (Chomczynski and Sacchi, 1987). The total RNA was subsequently

reversed transcribed using the SuperScript II RNase IT Transcriptase Kit (Invitrogen).

Primers were designed against the Type 1 IP3 receptor gene using PrimerBank, a public

resource for PCR primers (http://pga.mgh.harvard.edu/primerbank/) (Wang and Seed,

2003). The PrimerBank ID number for the primer pair used in the experiments was

598181al. PCR reactions were prepared using the SYBR Green PCR Core Kit (Applied

Biosystems) and performed on the GeneAmp 5700 Sequence Detector machine (Applied

Biosystems). 18s primers were used as a standard internal reference and analyses were

accomplished by calculating the 2-AAct values for each condition (Giulietti et al.,

2001;Livak and Schmittgen, 2001).

Western Blot Analysis

Western blot analysis was performed exactly as was previously described in

Chapter 2. Briefly, whole cell lysates from RASM-WT and RASM-DN cells were









collected following the appropriate treatments described in each experiment. Lysates

were subsequently separated on an 8% SDS-PAGE gel and transferred onto a

nitrocellulose membrane. Membranes were Western blotted with an anti-Type 1 IP3

receptor polyclonal antibody (Upstate Biotechnology) for 2 hours in 5% milk/TB ST.

Membranes were subsequently stripped and re-probed with an anti-STAT1 polyclonal

antibody (Santa Cruz Biotechnology) to confirm equal loading of all samples.

Densitometrical analysis was performed using the automated digitizing software, Un-

Scan-It, Version 5.1 (Silk Scientific).

Immunofluorescence

The Type 1 IP3 receptor was visualized using immunofluorescence. Cells were

grown on 2-chambered microscope slides composed of #1.0 German Borosilicate

Coverglass (Lab-Tek). After treatment with AngII for 0 or 1 hour, cells were washed

with K+-free PBS and then fixed at room temperature with 4% paraformaldehyde in 0.1

M phosphate buffer, pH 7.4, for 30 minutes. Fixed cells were subsequently washed four

times with K+-free PBS, permeabilized for 10 minutes at room temperature with 0.2%

Triton X-100 in K+-free PBS, washed an additional four times, and then blocked with

5mg/ml bovine serum albumin in K+-free PBS for 4 hours at room temperature. The cells

were then incubated with a primary anti-IP3 receptor antibody (1:200) overnight at 4BC

using 5mg/ml BSA in K+-free PBS. The following day, cells were washed four times and

incubated with a goat anti-rabbit secondary antibody conjugated to FITC (1:500) for 4

hours at room temperature. Cells were mounted with Vectashield mounting medium

supplemented with Dapi (Vector Laboratories, Inc.). Images were collected using the









Zeiss Axioplan 2 Fluorescence Microscope. Cells were visualized using a magnification

of 100x (oil emersion objective).

Calcium Studies

Fura-2/AM loading and intracellular calcium measurements were carried out as

previously described (Xia et al., 2004). In short, cells were loaded at room temperature

for two hours in HEPES-buffered solution containing 5-10 [tM Ca2+ indicator fura-2/AM

(Calbiochem), then washed three times and incubated for an additional 20 minutes in

dye-free solution to reduce the possibility of incomplete hydrolysis of the acetoxymethyl

esters by intracellular esterases. Fura-2/AM was dissolved in dimethyl sulfoxide

(DMSO). The final concentration ofDMSO in the loading and experimental solution

was below 0.5% (v/v).

The [Ca2+]i measurements were made with an ratiometric imaging system (InCyt

Im2, Intracellular Imaging, Inc., Cincinnati, OH), including a PC computer, a filter wheel

of conventional design, a CCD camera, and a Nikon TE 300 microscope with 40x air

objective (0.65 N.A.). Cells were continuously superfused with Ringer's solution (in

mM, 140 NaC1, 5 KC1, 1.5 CaC12, 1 MgC12, 10 glucose, 10 HEPES; pH 7.4 with NaOH)

or Ringer's solution plus AngII through a gravity-fed system at a rate of 3-4 ml*min1.

Solutions were evacuated by suction. In each experiment, a number of either single cells

or a group of cells were selected using the software setting. The fluorescent emissions as

paired signals (F340 and F380) at wavelength of 510 nm from the region of interest were

measured accordingly to excitation wavelengths of 340 nm and 380 nm, at a time interval

of every three seconds. Background fluorescence was subtracted online from F340 and

F380 signals.









Changes in [Ca2+]i are reported as the mean fluorescence ratio of F340/F380 over

time for a group of cells. The mean fluorescence ratio ofF340/F380 was generated

offline and expressed as R/Ro, with R being the fluorescence ratio change over time and

Ro the averaged fluorescence ratio of a period of 60-120 seconds before AngII addition.

The final results from each group of experiments (n) are reported as the mean

peak response (means + SE). Statistical significance was examined using Student' t-test.

A value of P < 0.05 was considered significant.

Results

Jak2 Regulates IP3 receptor Gene Expression Following Treatment With AngII

Chapter 3 describes gene-profiling experiments that identified AngII-inducible

genes that require Jak2 for their regulation. Briefly, microarray experiments compared a

Jak2-deficient cell line (y2A) to a similar cell line expressing Jak2 (y2A/Jak2) that had

been treated with 100nM AngII for either 0 or 4 hours. Analysis revealed numerous

AngII-inducible genes that had a greater than 2.0-fold change in expression as a function

of Jak2. Amongst these genes was the Type 1 IP3 receptor. Quantitative RT-PCR was

used to validate the microarray data using the y2A and y2A/Jak2 cells. The IP3 receptor

expression pattern found by the quantitative RT-PCR analysis was similar to that

observed in the microarray studies (Fig. 5-1A). To eliminate the possibility that the

increase in IP3 receptor expression was clonal artifact inherent to the y2A-derived cells,

we next investigated IP3 receptor expression in rat cultured aortic smooth muscle cells

over-expressing a dominant negative form of Jak2. Aortic smooth muscle cells were

chosen because they have high expression of the Type 1 IP3 receptor (Marks, 1992). In

addition, these cells are a more physiologically relevant cell type for investigating AngII-









dependent changes since they are highly contractile cells. Specifically, the cells used in

this study were rat aortic smooth muscle cells stably expressing either 1) a dominant

negative Jak2 protein and the Neomycin selectable marker (RASM-DN) or 2) just the

Neomycin selectable marker alone (RASM-WT). The RASM-DN cells suppress

endogenous Jak2 function by roughly 90% when compared to the RASM-WT cells. The

full characterization of these cells has been previously described (Sayeski et al., 1999a).

A. B.
IP, Receptor Gene Expression IP, Receptor Gene Expression
C 3- 2 6
< 4-






AngII + + AngII + +
y2A y2A/Jak2 RASM DN RASM WT
y2A cells Rat Aortic Smooth Muscle cells

Figure 5-1.Cells having little to no functional Jak2 protein have a greater increase in IP3
receptor gene expression than when compared to cells expressing Jak2.
Quantitative RT-PCR analysis of total RNA was performed on either y2A and
y2A/Jak2 cells (A) or RASM-WT and RASM-DN cells (B). Primers were
designed for Type 1 IP3 receptor. Fold changes were derived from the 2c**t
value and are indicated on the graph. Values are represented as the mean +/-
SD. Shown is one of three representative results. Printed with permission of
publisher

Quantitative RT-PCR analysis found an expression profile of IP3 receptor that was

similar between the y2A and RASM cells (Fig 5-1B). Specifically, in cells lacking a

functional Jak2, there is a marked increase in IP3 receptor gene expression following 4

hours of 100nM AngII (-2-fold in y2A, -4-fold in RASM-DN). Conversely, cells that do

have functional Jak2 demonstrate a significantly lower increase of IP3 receptor