<%BANNER%>

Elucidating the Genetic Influences in Pain Sensitivity and Analgesic Effect

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110330_AAAALH INGEST_TIME 2011-03-30T13:46:27Z PACKAGE UFE0012884_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 4435 DFID F20110330_AABBMK ORIGIN DEPOSITOR PATH kaplan_l_Page_074thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
9e02cb93695e603b937f4c20088a1169
SHA-1
d4f693eed9b9669537fa297fd50dd67b1771091b
104694 F20110330_AABAJI kaplan_l_Page_038.jpg
e49d44a975bab80eea2cdc1941602ed5
5bf9e65f0836a65c307324086a72ee53a5ad8a81
32945 F20110330_AABAIT kaplan_l_Page_018.QC.jpg
856ef19ac5614b537f7e84680f8ed207
192909acfe16a6db71cc8b2a1cfbf1e2e8133be3
8386 F20110330_AABBLV kaplan_l_Page_052thm.jpg
83ac72b808bb05e892ec01b6f3260647
5345721f5fcd5935bc3f09278fb2cf6ee8161e75
7380 F20110330_AABBML kaplan_l_Page_075thm.jpg
e995883da4409494a8dcf614c0432e71
633a4c933093b5afda3b27986f1c44cb8d1ddada
30165 F20110330_AABAJJ kaplan_l_Page_054.QC.jpg
2aee987f6a680e642d384a961632eb3c
8165b7598bef53d90472197d895db0fbc1e7dc38
32724 F20110330_AABAIU kaplan_l_Page_043.pro
dc50e046668835bef2d64cf4423553dd
4ac39e9a9034f3abeb3ba69ae981cda67ba82819
1248 F20110330_AABBLW kaplan_l_Page_053thm.jpg
5aa20e8bc176dbdf13958bd07d7bbc78
acaacb38080daffa51e080c99a94c0f9823354d9
8676 F20110330_AABBNA kaplan_l_Page_105thm.jpg
2a4dc65597b4c3c7dd1dc325eb1b37fc
583909fb4633a9321ca14ddb7139bd5feb7da809
8491 F20110330_AABBMM kaplan_l_Page_078thm.jpg
72a9b638604f4b338287d65607a1d4b0
266391f5258d999e670449b1b3b823969a22fe17
89538 F20110330_AABAJK kaplan_l_Page_090.jpg
d564c9badf1dd20d27bb859c72e526da
10feec7c8acdb935f168967a2d98816a04dd02da
36042 F20110330_AABAIV kaplan_l_Page_112.QC.jpg
d6e70796a9af563a3b4d39dd19d442d3
330f178fe96649f035f0e2a1b6004804801ecaf8
7497 F20110330_AABBLX kaplan_l_Page_054thm.jpg
b876f6fb7fa73d5896e7dd5d6858f022
5d0507f11c10852ccb51ddc5f5dd5a87237d1b78
8704 F20110330_AABBNB kaplan_l_Page_106thm.jpg
1038ec6c4004c3b954d7a40e279b57d8
d96cc0a302eeb103a43bc7f6dd5b24f4bc3fa5e0
8446 F20110330_AABBMN kaplan_l_Page_079thm.jpg
1b3cb582d233a49a42d2606eb7b0b8bc
40b9eccae518a058cdc6880e47d8a8144a03337e
8513 F20110330_AABAJL kaplan_l_Page_058thm.jpg
6b4b1eeabd1e782ab064a359cb74b704
d7a571e945c364f1a9effc975b74cbc8b61d7090
71779 F20110330_AABAIW kaplan_l_Page_032.jpg
8850450a0c5623da85bd3bef4bfdcc8b
590d5e2ac9f3e7f2df2adda4223974bef83b8a3a
8579 F20110330_AABBLY kaplan_l_Page_056thm.jpg
d687378ab8d0ecbff970894f9da5e82c
26583b610e8dc067b82c9cec1e501e04d924858e
8324 F20110330_AABBNC kaplan_l_Page_107thm.jpg
8c915584a65b89032bb0d951c18554f8
db91859020d4115474691904b88704f044dfe668
4770 F20110330_AABBMO kaplan_l_Page_082thm.jpg
8bab303a81c3305a68315f22dfb9beea
bfbd8f2c4bc9090206d13ffeeb2ccdc631f0fd8f
8002 F20110330_AABBLZ kaplan_l_Page_057thm.jpg
8b702599a19892fcfce7f060aa7a9817
207755d56d5a868dd1904748f7d596f4739baaca
33150 F20110330_AABAJM kaplan_l_Page_017.QC.jpg
b9ab63ab5b9a8f17b2d4e04b8d8989a0
03957a8370baaea55cc134838bc12b0210cbc8e0
96644 F20110330_AABAIX kaplan_l_Page_100.jp2
5c0196f130dfcf9998dbe05cc9f7ae87
be2340db4ed2853fd0fbbf8898307522c72e8daa
1053954 F20110330_AABAKA kaplan_l_Page_095.tif
db6217a15369a5a9600fb5ee3a41cf17
4c46d88da4e6a562189855dcd8af64a2d4ac21c4
8872 F20110330_AABBND kaplan_l_Page_108thm.jpg
4a441c3479d699c01cefc9e19a4c3db7
289ea27feae0b21b9bb16e2125de7d1f399606f1
5169 F20110330_AABBMP kaplan_l_Page_087thm.jpg
6f2a5076ba73764a41e5745505055a23
0bdbd8181d92ed03203912cf4302d1facbc1b57d
125921 F20110330_AABAJN kaplan_l_Page_114.jpg
052eb2972b597b0db4f93adfd1d7a4ab
c23739ad0432ede5bd29193376c33d0b4ee3fd82
1937 F20110330_AABAIY kaplan_l_Page_059.txt
bdaa164848bdd981ad7a296133493151
781f450761135a182a55a71766e4d655666e22c5
346809 F20110330_AABAKB kaplan_l_Page_063.jp2
fc845a9e17e5888c975d594b7261fc0c
2bc66931ba94097b76a87b30815734e398f03ff7
8759 F20110330_AABBNE kaplan_l_Page_109thm.jpg
e36df057966107d0a617710484cc1711
f0531f103cd53ac795abae30f5a37c3a20c44b94
5579 F20110330_AABBMQ kaplan_l_Page_088thm.jpg
611c906dcf2125d82ae09dd598aa6606
bbe6d1cd8c4b5e6275fa3801e592660a6b02c9e9
893 F20110330_AABAJO kaplan_l_Page_072.txt
4a3a9b5544dfa927429ce4601647e199
efa6397e6de29209d2048e7f9145057c46eb6bc5
45849 F20110330_AABAIZ kaplan_l_Page_004.pro
f10cd692bc91b617b3b818e11fcbecd1
b66c137725b44d7cc12ce9e641ecfc8f85f108d5
107067 F20110330_AABAKC kaplan_l_Page_018.jp2
5f426a743803b13bcfcaedd3e3b40407
0cf1b86f06266909c8a696fef44bc373a19fc956
8916 F20110330_AABBNF kaplan_l_Page_110thm.jpg
aaf8630e366ac64ce16d3fa3d4a01409
23a731a3c0902b7daa898d73a3512ec83d3df749
2801 F20110330_AABAKD kaplan_l_Page_110.txt
a9092f6036a47eb3a863aba894a788e0
5063115a736928855617d9c52d7e4b921c13d85f
8461 F20110330_AABBNG kaplan_l_Page_111thm.jpg
a9ecf9f68c4bfbf547959cdadafe481d
e8412ebb1e6cb14194b21f13b2b8e102c42d27c1
3078 F20110330_AABBMR kaplan_l_Page_089thm.jpg
7a916105785b72cfaf0ae4e4342b3932
ee2816df1b89644043db997875beb0fdf85011bc
8305 F20110330_AABAJP kaplan_l_Page_077thm.jpg
67b63b0bdf32897e2373ce1bfa2b06fd
01ccd167fca6df19b29ac6f119028a0ee41a93f0
687114 F20110330_AABAKE kaplan_l_Page_008.jp2
3bdd61405cf1c9ba2b764eebfe05285d
f5ad4a8f3ceeafa140ab84e6f143e2f352139b38
8777 F20110330_AABBNH kaplan_l_Page_112thm.jpg
2db9725497b2101305b1a1687c70127f
491744b77c0b16010cfa0c2a7c9b66d41e451ebb
7525 F20110330_AABBMS kaplan_l_Page_092thm.jpg
6d269c715a423394c94b8406f56e34f9
fd60c4dff10d547f64f240163e32860309382213
1013 F20110330_AABAJQ kaplan_l_Page_097.txt
a67d7e3ceff9d09448f8dfe841308a7d
ee5cb5aded15540f5f1c47a8160f73e3a460902a
101848 F20110330_AABAKF kaplan_l_Page_016.jpg
ba1ea7965ccf09354cf2cbfd590ea387
60d9524ecc80fc433d1f01d82b402f832da64c06
8357 F20110330_AABBNI kaplan_l_Page_113thm.jpg
18f6636a23396114689c8a86c7ed434a
086b3f6149cc7de73fb3c70eecb3405f4047a555
8470 F20110330_AABBMT kaplan_l_Page_095thm.jpg
28192819764acc8d873549a3d17bf274
d7a6d965588b11cde13e253b7fb74b08ebe23169
45506 F20110330_AABAJR kaplan_l_Page_092.pro
a75dc1de808a35e4d2cdf653c69b17c5
d36853563f394a14b304fd2d10b1e5f81efa2078
4617 F20110330_AABAKG kaplan_l_Page_084thm.jpg
65a31c67e9168ba47e06be9330baca37
b576701b2876dbae4579075a0ac6fe2bc865e6da
8487 F20110330_AABBNJ kaplan_l_Page_115thm.jpg
87393f253a1832ad5508802a88a243eb
bf3c21182320ea5ff66b4f817b27a8efb135bf54
6324 F20110330_AABBMU kaplan_l_Page_096thm.jpg
c8020d803e41f6f7e0ce12535c719779
c6d90312cf2716f17a8e99328ea9e94d8b407ccc
99569 F20110330_AABAJS kaplan_l_Page_036.jpg
9400cc256e9e7d37f5a9f43005e67513
0b31c6a7d3667e6a3ba82729d26c90dbfd56056b
112993 F20110330_AABAKH kaplan_l_Page_056.jp2
ec5ff8c8e085c9ab02e606e5478f4570
1c34de3cdadba9147a6f0d331001711c955c64dc
4119 F20110330_AABBNK kaplan_l_Page_117thm.jpg
dc5e6fb79164fddb25a472e9df3de173
656a54e29f94db0618b734762752e21e22ffa20a
3328 F20110330_AABBMV kaplan_l_Page_097thm.jpg
9714672a8d0a73a9904f474e36caec1b
f3407bd82de5a530df08425c6c376ba0161ece30
22814 F20110330_AABAJT kaplan_l_Page_006.QC.jpg
f5c9351f80e6630b06ec114052d7489f
0e21f30a853324724218ec19ad05916264e99b85
91549 F20110330_AABAKI kaplan_l_Page_075.jpg
e0cafe2b84639a43512d32cd8aa6dbba
d3700fb98dc168211b69ad2d4f29673903668fd1
137754 F20110330_AABBNL UFE0012884_00001.mets FULL
02fd107cf4d7f96783da3c7bbb1d234f
91561e3404c81a5409325b9d03b44b693fa4fb9b
2142 F20110330_AABBMW kaplan_l_Page_098thm.jpg
487416a72f4c9c09a52233818ee6f0de
c683bc0be39b526613b253b2a017aac9baf1bfe3
7714 F20110330_AABAJU kaplan_l_Page_026thm.jpg
fd8ed203c9b9c26d9be8065273261d2d
c65ecd6274651cb579d5118b50c5f532e5bdd2f2
F20110330_AABAKJ kaplan_l_Page_099.tif
9c4c4735d86fa751b645c2a88729fa05
e396bf06e8987efbde278af62ce5687d1948ef44
4802 F20110330_AABBMX kaplan_l_Page_100thm.jpg
3d646cea4cfb0fe1d6b9ddaa957bb507
553beb9dc5ff1a350beb24e33dad347aaa6d641c
107293 F20110330_AABAJV kaplan_l_Page_052.jp2
961475d3c4793fa2f96bfded0aa259df
ea88b7b2a3b8e9bf65cd58875bdd4678ad609d50
67587 F20110330_AABAKK kaplan_l_Page_042.jp2
edf06cc62bef626066ef9abc046e6752
d1b4d2332d26bb30f728e7662d58049cb40373a8
8596 F20110330_AABBMY kaplan_l_Page_103thm.jpg
e1c2363bc6b1ac952852780cdc5349b9
5f54c362166a6d0c7f1bfa9826e90cc197ca658d
7905 F20110330_AABAJW kaplan_l_Page_028thm.jpg
3e6c32ebad07d9b3af0e184c8c49f37e
aa597d93dbf4c01d7044399618899f65899af90e
9875 F20110330_AABAKL kaplan_l_Page_065.QC.jpg
8ad4f01c825a1b0aa217e50190018f5d
61e7f32c24d58fed4f5242c13d2af20030d43f39
8748 F20110330_AABBMZ kaplan_l_Page_104thm.jpg
5422668e5fe104fa9944207e9b02860d
e82f222183bdfd56b745b3707c199e0a14ea5f94
5338 F20110330_AABAJX kaplan_l_Page_002.jp2
04dc2854ccd346e023ba5da182206690
b54608251e88d08b0fdcf591974fa97eee3696d0
95395 F20110330_AABALA kaplan_l_Page_090.jp2
c927221c4a2eb873fcf0a237de0b71ac
46962ee1729a2fde0ad0179f9b29612fba1a39b1
41635 F20110330_AABAKM kaplan_l_Page_066.jpg
657714357e66b21d2231a456d5055564
dedcab900666ccf5a2e64dec03650b6ef0f709d9
4923 F20110330_AABAJY kaplan_l_Page_085thm.jpg
9ab7cbe84a9e40ec2591ada2b62cc4aa
432032111442bdbe0ffc2200c524be6cb6747f40
101720 F20110330_AABALB kaplan_l_Page_052.jpg
0051acec781c78e79ab9cd0f88e62859
130e04ad2c1d30731cc399dbd1d717bf95421983
105428 F20110330_AABAKN kaplan_l_Page_048.jpg
902d7ef654f587e5c2062075caf14548
381062934a9a36937f51085b3225b94a19ec9efb
1051970 F20110330_AABAJZ kaplan_l_Page_009.jp2
bc8e958721b93305173a05f0ae1149b4
99b86b386f87a681489c08039a8619ccef650d6e
25271604 F20110330_AABALC kaplan_l_Page_062.tif
8728490d1cd6a7418deb83a9644879f5
5759575002f08c66c4dacd491217847ea4f419c4
34397 F20110330_AABAKO kaplan_l_Page_020.QC.jpg
7d62fb4d57d5a1751159ce97c12c982f
8f2c1d7d03a797f1fe6ae9a18727795d2d884e57
24879 F20110330_AABALD kaplan_l_Page_011.jpg
b7980a2df53817e2899b7982336e6f12
497ae0c2d31d02bef2b8e18228fce4b83c4136ee
2640 F20110330_AABAKP kaplan_l_Page_105.txt
8f92c7e57933bdb5737a46895f012acd
d03cbdf853d38a3239a5ac673485fd1a76f56de7
34462 F20110330_AABALE kaplan_l_Page_056.QC.jpg
bf7fcdd6518734e597eda8d8e7bebf53
db0ca56aee195a21738fe2d4f8344f23f0b3bcd5
21469 F20110330_AABALF kaplan_l_Page_117.pro
5e4ebd708b949773bdbcc3121123e3da
3730ef40007d8da3cfdb7e4cf97d5317041795e6
2674 F20110330_AABAKQ kaplan_l_Page_008thm.jpg
46dd769d676d22513e064a4da53ce82c
f796062bac7f7e82f3793186da58a704ba38b49f
103952 F20110330_AABALG kaplan_l_Page_027.jpg
65bfb26023ebeb54ce96c1e109a78b55
5b77d3023119beb17febeb94c268216c076177d0
8594 F20110330_AABAKR kaplan_l_Page_093thm.jpg
40586523e6583c37c2caa0983089bb44
3fcb4a128b6f95c006aaba3468afb7cb190e911f
8296 F20110330_AABALH kaplan_l_Page_080thm.jpg
449c9b5a81ae0da3d24b208802c1ef57
05151efadd6e9f4e0f18695c2702858a1eb6e74f
1791 F20110330_AABAKS kaplan_l_Page_075.txt
0c5df8ddf76e8b4cf4a703e4442e4f27
7513557805f59d0fa1ee7182c7b9668b1d0b174c
F20110330_AABALI kaplan_l_Page_075.tif
e93b23082268cbe260eca51fe262371d
2edc694394ae8ba0031d8350f2217f328dabdd79
431 F20110330_AABAKT kaplan_l_Page_066.txt
a29881f364a4438cbf225e566fa0df36
cb4beb457f56d3abaea4d4f06e09905522506a53
34231 F20110330_AABALJ kaplan_l_Page_063.jpg
09906b6090f269c2948fb7e5d71dfc0e
9b7dff12b38be3bc42099a0efabaa4377436f302
4334 F20110330_AABAKU kaplan_l_Page_073thm.jpg
9725cbcd6e8b7acbaf455e2bcb6c89e6
af76b9252a11f9d351ff89fc4578612f975b05b8
2732968 F20110330_AABALK kaplan_l.pdf
8cddd13f6ab662eb0362bc1c51353d8e
3c2306136530e4b6b8832b8cd2e4f36bcf1c91b1
BROKEN_LINK
object1.xls
object1.xls
object1.xls
object1.xls
129006 F20110330_AABAKV kaplan_l_Page_109.jpg
c4cce4e82b5d26b54f68f06ae0ebb800
a03bee4ab66febedc0e6bc205d0711e69b9bad7b
28934 F20110330_AABALL object2.csv
e52bef60e023ada4f43f2e2449a9c14b
339605326827d9dfb05aaa50d747a05c87653a2a
3742 F20110330_AABAKW kaplan_l_Page_066thm.jpg
04a30c473d033a9826bd6532f2b098ab
bf3099b936b6aba5ab2b965ce7280886597140cf
42945 F20110330_AABAMA kaplan_l_Page_067.jpg
a8592e260441fafe4a70a0a6fb1bd396
ca62e5f81ec8d708708a818df60a9c7deb75299b
1916 F20110330_AABALM kaplan_l_Page_057.txt
1c6b40db130d2c17955d1f95d029e4c0
9b8817515f64756f227c9f8e5daae670b33ae398
97729 F20110330_AABAKX kaplan_l_Page_054.jp2
de3fa57a5a904b65a7d31c5fb345ccba
d55645a644b7a36986bea43ea0791ee5a148893b
111013 F20110330_AABAMB kaplan_l_Page_030.jp2
bac52fd61b703066fdefa5671036904f
53f5fa2943318cad1ea015e6a0794bd2aba7ceca
2048 F20110330_AABALN kaplan_l_Page_056.txt
2164c5f775f61d343965ffac568027fe
55ca8de350e4a6cec42c96e3783a8dc8d8c32f5c
48546 F20110330_AABAKY kaplan_l_Page_039.pro
cf8ace1729f4baf6340a9172278f325e
d452ea1fcdaf5b238cefc0c37dca5edafee6b47a
1051982 F20110330_AABAMC kaplan_l_Page_006.jp2
0910c7043466d85ad9fe4682b8f9c3a8
53db7ddb527d57fc72c76f7df1d714ddc433fcb3
8213 F20110330_AABALO kaplan_l_Page_034thm.jpg
f782c5ca39c07116200e4e646c95985a
74ff550f7544fb52fe92d45e8a93d886dff84a48
F20110330_AABAKZ kaplan_l_Page_077.tif
b10c9a5c2444f3f4c3e9d9dd9c9294a5
16a38d6afd0895fc53b2fd9d9f14364fa1e0bcc9
103637 F20110330_AABAMD kaplan_l_Page_040.jpg
bd5ed59946eebace56acbdf7e6d77db3
9e2f1c17746e83dd0b39415a4a0609be1707aeb1
F20110330_AABALP kaplan_l_Page_085.tif
03673ded7ed582da6432b61c4efe962f
8d1118989c3121803bb0d4c2210fc6cdcc741bc3
129854 F20110330_AABAME kaplan_l_Page_103.jp2
c134a94f43aea76fcc06dd0ab22deac2
c25134fb23e2f84c44f86eb0224dbd95abb55e04
7952 F20110330_AABALQ kaplan_l_Page_023thm.jpg
7ab04c49f99dff88f35a3c31482f43f1
d82b739ab66b8fe2d0036b159b278ef6c46ddf23
1790 F20110330_AABAMF kaplan_l_Page_090.txt
7335310152a3d4a0ad9e6a486b6ee5c0
d87d6c668956284165082462fb6c0c299ec9221c
F20110330_AABAMG kaplan_l_Page_089.tif
1cc9ea836731bd0db7b7fe85fc18783e
b18f599f93389da113c3cf5b3097259da67da9e9
F20110330_AABALR kaplan_l_Page_002.tif
e44b6be6a69b46880be9779fb92e7936
1965ddf1542327db25a350d8c5754c915428f173
6903 F20110330_AABAMH kaplan_l_Page_098.QC.jpg
e8c52e8f50188aedbae2a0159cf83846
405d36530cba8d66cb2a13972e69f8d82693cdb5
117710 F20110330_AABALS kaplan_l_Page_115.jpg
b6d8e156f0099dc379f1cf9d81208e90
8d6275aaa1a97c0d2dc037ed536d2c3a402a884e
409205 F20110330_AABAMI kaplan_l_Page_067.jp2
d29e2e2573db4909c79e036cb7887c2e
8a90011490c1e1229449f221fcd28ec16f62be8f
8432 F20110330_AABALT kaplan_l_Page_029thm.jpg
9f59e7f5f13ea96b534507108ef2113b
e8007d057d069e7013f835f45b43f65ba27cb8db
9682 F20110330_AABAMJ kaplan_l_Page_008.QC.jpg
742b1566a18b20b41d9d80ca064487e3
db37a9ebb498ecd65f5bf97138291202611e4188
51334 F20110330_AABALU kaplan_l_Page_072.jp2
c64ce91590f944f980609ed4705ebfe9
67ba8a1012101303a03ee6dad449fa50de81e04a
51888 F20110330_AABAMK kaplan_l_Page_095.pro
c2b34d2f152e160744687d39d03fa2fb
9919e6785b654a908dcdcf0565dacbea88075936
10346 F20110330_AABALV kaplan_l_Page_089.QC.jpg
a77797053e8a8f1813a5f6df97d5296e
85c0a2c21c26a89fead292c9cee03f4d601c1cef
1555 F20110330_AABAML kaplan_l_Page_043.txt
41ffd8e0c91099a4ff66991cc40486ec
60704224540c6d2f07a8df28dee16e234579cdaa
8163 F20110330_AABALW kaplan_l_Page_049thm.jpg
0074bdc6727237dff0626291c2284fa7
e6477d9cc1611a5964a5070d19acc691ff9cfcef
95480 F20110330_AABAMM kaplan_l_Page_005.jpg
93c208c1a69cd849846a4295ac4ab402
756616b9398bd690c6cfc9f6e8aabdeeca2da257
F20110330_AABALX kaplan_l_Page_090.tif
92d8c8b4cfca48daa772d199e96e1b1f
f1a59c19a3bc9f7218f96dbd15b72beaa2c09c96
8268 F20110330_AABANA kaplan_l_Page_094thm.jpg
dc8775b1e146a4293f3d481aa9017507
e875680d804782e8a62c856fbfbbefb996a2c4a1
F20110330_AABAMN kaplan_l_Page_032.tif
6cc21b375a96b671d1163debc537c016
83e0b3291c6c9c817dbc836146f89156cd39bfee
754364 F20110330_AABALY kaplan_l_Page_083.jp2
4f33cf98c857d3767bc51da697e36a73
138749fd252f43ffaebf0fcd5ccea0459765eb8d
34598 F20110330_AABANB kaplan_l_Page_031.pro
dc0aa5ccfc5a22565e5e75e3a537a8e4
24f1188ecd5a4da208d729cf8e396640f6a7e991
66303 F20110330_AABAMO kaplan_l_Page_112.pro
817cb1f1fd1fe82550148badcdc24e2d
c15a26c60dd581767630d603721c272262e9e4c6
82910 F20110330_AABALZ kaplan_l_Page_012.jpg
db21fa43a23eae791ab411c0aed66b36
7d1176d9a78dbcbca55e216c7be1bf5cf5eb6dc6
3039 F20110330_AABANC kaplan_l_Page_086thm.jpg
4fb93143dc65baa9f75cfa8428209fcd
19c218f88e6cf3c25173152678157ca638ef72e6
29863 F20110330_AABAMP kaplan_l_Page_092.QC.jpg
76bcc75e70814afff17db1fc6c076ed8
20468e2f4361d723e597f4a0b0b83a7be22faabf
8441 F20110330_AABAND kaplan_l_Page_021thm.jpg
a453417060d852d3d415209ff08672d5
610bf7ac3c6f1185d9f0a8a34ce6746ed8f02e75
2523 F20110330_AABAMQ kaplan_l_Page_013thm.jpg
188724e83d7b6f0176bfa2d25fbf0a98
9e17c739b7da9c8cf1e8d8dc2dfd7cfff74e07c0
93861 F20110330_AABANE kaplan_l_Page_054.jpg
3a7f92d1ef80789d4011b54b3b008ea7
b6ae2fdc4feab06d0a796ca5e06cc64afb04365d
81936 F20110330_AABANF kaplan_l_Page_096.jp2
3709e219393e286d75ec00ad5dda7bf0
eb761302da857413926fee87e03e51e958a52234
11533 F20110330_AABAMR kaplan_l_Page_011.pro
22b882e707fabd3e53be2cb3effb60a5
cc59e8de375ac5809d714850be1f1923e24f5567
110263 F20110330_AABANG kaplan_l_Page_080.jp2
3a3e160982394002c68a362529255fed
a91046210dd3ca6491b93c09606c30c4800e762b
127852 F20110330_AABANH kaplan_l_Page_106.jpg
3acd4cfde657bbcace751ae84d791fee
76afefb9e4965afd28f45b164e407c40d5bfd671
695 F20110330_AABAMS kaplan_l_Page_061.txt
716bd20ad17a4aef6887032dcd429a85
b9bdec9b7421cff8a9c2fc53cf534b5e31c6aca2
66 F20110330_AABANI kaplan_l_Page_099.txt
a93f88c89d79ff53c2f47bcce2f5a14b
2e0a951f54cfbabc36aff4545dd5f677beaf0ec6
F20110330_AABAMT kaplan_l_Page_001.tif
15124d79f394254c038876fe430c538c
d49ac747cfa9ba652c120ad36f9af0a120f2c404
F20110330_AABANJ kaplan_l_Page_057.tif
b687ed96113fcd7efe11d47a6f377577
41565841582008821d7cb3a6b728e8f84ae7a43d
414162 F20110330_AABAMU kaplan_l_Page_066.jp2
56099c86e5b3af65b061c4f2e56465db
3cf77ce93787da07503f7ce835e9031b17d5c63d
F20110330_AABANK kaplan_l_Page_110.tif
0aec9f0f43814ab5a4b8ad182a50db36
eb50ffb98d9cd08e0fd0095aeeee3a04fcf5a02e
8593 F20110330_AABAMV kaplan_l_Page_076thm.jpg
fb496d771e221065f87439a17dc26489
d06cb0dd772995bf113aa93c204721bb5a888dfb
25078 F20110330_AABANL kaplan_l_Page_116.pro
91cc4f960d5ae88e95c84a623cac83bc
e22378ff862b618e6d60b4adc6f1dfb7df35a340
5694 F20110330_AABAMW kaplan_l_Page_099.jp2
5b2ba95fa205fa99947a7006791cf8eb
78056317ec05de74ed648ac376ccb1939c4cdc3c
35162 F20110330_AABAOA kaplan_l_Page_058.QC.jpg
4a2f79c32d1c1f8573d4b87a8db7b6d5
586f6f76c80fb5f28a8ab968ebf64d0cf6ce6c7b
6469 F20110330_AABANM kaplan_l_Page_083thm.jpg
fe65d6618283bcb15b76ed85e9f10d20
f25a3a9b8349ef8ec37adb7decd50f38db28d269
1051891 F20110330_AABAMX kaplan_l_Page_007.jp2
8c8543f5d64a2a717d93e0245c8c6acb
9653582b792fee58e00586d772fd6a09cb42eca6
791710 F20110330_AABAOB kaplan_l_Page_088.jp2
a9bb6ce2a72f11deaad00a0598defdd2
9dfe63a4164db85da68a115cd0dc23028cc6cdb2
2403 F20110330_AABANN kaplan_l_Page_111.txt
4c54796aed9a53732706f27cf7caee99
1683abacfd1635649863ae674cf1089140f21765
8563 F20110330_AABAMY kaplan_l_Page_070thm.jpg
a61818a327440cdcdeb5ba1747680ece
e4a15c58b2ed8730f9da77615f49c306a07bca9c
F20110330_AABAOC kaplan_l_Page_051.tif
7cedae2914e1d5ba431a9e38be268fc5
b4f6f382eaf4dab2ca1f24bd0805dc7ca37ad144
F20110330_AABANO kaplan_l_Page_025.tif
209226e85634e516a16f0765636f674d
9d7773f348b2c93d25d5c6450fbef41efc937b23
107224 F20110330_AABAMZ kaplan_l_Page_057.jp2
57935595c4f0fa0e7c8414a46756d1a4
a89333a172721bfda1f74ff3fd1b31aac995d277
1965 F20110330_AABAOD kaplan_l_Page_037.txt
9d4718e456590087b56af308a58279c2
76958aa7dad30bdffca662a715f81d149c458d5c
F20110330_AABANP kaplan_l_Page_093.tif
5153feb2a94e167b9cb2ad1ec693b9fa
6dc34d48c77263f9c4c8db8e9b001548ef83bafe
F20110330_AABAOE kaplan_l_Page_047.tif
23eac93b2e12b010d7c854fc04de4c93
86b6e7e34a8e749c6ff79b4c1ce2ca58cf49e7a1
123241 F20110330_AABANQ kaplan_l_Page_111.jp2
985ba74e0a09c7c593db2fd33e4e322d
1cf22f26e86620ea149a46df708d14c67ce7e3b3
105315 F20110330_AABAOF kaplan_l_Page_069.jpg
2d8ddc09218c989416142fbf507e2ed0
06f206221fa670fbff11766c7d24b62a11a8a53f
F20110330_AABANR kaplan_l_Page_038.tif
28ddd008cf9ad150623a8bd0b1262a3b
91d4ff2cd663465c59c804502cc8d304b7098623
F20110330_AABAOG kaplan_l_Page_019.tif
fe4096237d0e2b05bb6c2a86cbfb0c26
6d026ede8d25789d259683cfa772a8e924a1e99a
2557 F20110330_AABANS kaplan_l_Page_114.txt
a70b77fe2efb90decec821d809489625
83d4971204d04441286eecd39205c733f4ce7ab2
47011 F20110330_AABAOH kaplan_l_Page_028.pro
9691d4c4e0e7acc398b3f9073341a67e
afc687d65fd08dade0d821360d6dea36bed0fa45
1836 F20110330_AABAOI kaplan_l_Page_092.txt
87247ced169e114ecfa19592103030ef
becc98bb450c6ae6c0775721a4572a503211d860
100494 F20110330_AABANT kaplan_l_Page_007.pro
d8d0f893434df510d6d8889ccf671683
f9198e9afa5a2b3a1e99a3292b4d0225b406ad80
77259 F20110330_AABAOJ kaplan_l_Page_096.jpg
4396e53eb9c8051629ab7efbc86894f0
bbb56f0b6593c238833931982e3cdcc5c6cfaec7
2026 F20110330_AABANU kaplan_l_Page_025.txt
ee814a2e05bb303151c786308554cb46
5ff1cec3bb9541b4fc2d182bc1b89f70a1c41d78
32411 F20110330_AABAOK kaplan_l_Page_036.QC.jpg
7ec7006a4715c97cb0bf200a98782ec1
9041bc0c1b95d41596cdf352875ac6b3953d75ae
49968 F20110330_AABANV kaplan_l_Page_019.pro
d8d68508aa8b4584396e666eefe6015a
84d6560a1d7c1d06888a686fef9737cdd986d983
F20110330_AABAOL kaplan_l_Page_049.tif
01d357d188502e56ca07a9bf9d20f325
9a4924f28a332d63d88ff4fb9cff43bbe31a6633
100715 F20110330_AABANW kaplan_l_Page_057.jpg
395cf9f49c9c1877eb8f09c6bbf1fc90
7b795a0c1ea68026b4c056cd2af1676ff0fc5b69
F20110330_AABAOM kaplan_l_Page_108.tif
30ed25ce3d2098c218a03b8652852460
2b622295e02479e1ed5f2a87fa407ca7ee0c2689
7745 F20110330_AABANX kaplan_l_Page_098.pro
0ec50d6dd449391cc36f80ce2323ec71
f586b032449ee8cfcb0e67f9de542fc1cb8c05e3
2051 F20110330_AABAPA kaplan_l_Page_071.txt
b6d27a67317e172e274fd32b36e717ce
0f73191b7b461f0f077534ac012cd65c64c9f8fb
34521 F20110330_AABAON kaplan_l_Page_091.QC.jpg
22349e58be1c34250956aef86dedb4ae
9f3a6718e0f83b0e894f417ab2d33d5af1be77d1
F20110330_AABANY kaplan_l_Page_020.tif
97ae7e429625d234e85622bb2a848c3a
7140c3cb03ad7d3564f816f1733e0fae68b0aa4b
3771 F20110330_AABAPB kaplan_l_Page_116thm.jpg
950e750bfb644678be1d406463e3021a
5c9fb680215c5832b394f8480a855e27aa7c4900
8107 F20110330_AABAOO kaplan_l_Page_018thm.jpg
ed347a5b3a19f292766d546266012288
d31de2f7281c0ea09cbd4b6ad5645979a5d9f699
25535 F20110330_AABANZ kaplan_l_Page_003.jpg
692bdc9b3b6f573143780f62f94354ff
e79440dcdbdd08f0815c2184273462ffe7d05bd1
126456 F20110330_AABAPC kaplan_l_Page_007.jpg
d80e4c0f3163b2b3cfa247ef15e8906b
436db4f473b7e09baa99e6a70bc42122611ef771
129648 F20110330_AABAOP kaplan_l_Page_112.jpg
e8176936ae18af0b8f49a74395e9d358
e1e5c93adcb07ca3f2b6064377252f2940875189
6839 F20110330_AABAPD kaplan_l_Page_081thm.jpg
33d8bc92c675af552c362d58bfc1ec36
cb57d0b61b0f108a53c2630370e5be4592792c23
50840 F20110330_AABAOQ kaplan_l_Page_024.pro
3eb17b44d8ba13f01be8094367d1eb2f
04e4d0a40b682937088f5846c236557831b106dd
108262 F20110330_AABAPE kaplan_l_Page_058.jpg
dfe804ed77ed18036ef4bbe290d1b578
005fd5849f68d0535227c0e8d3234286fa3e4615
103611 F20110330_AABAOR kaplan_l_Page_070.jpg
9ba2987ee6c15b61dde6c584f8077eda
f2ea9be07821e25d497d64064c5f21e6c84c806d
7625 F20110330_AABAPF kaplan_l_Page_014thm.jpg
008511d811401b7c8ade10cce01b3449
5a16f5fe9f8bbe65f72d7776412d14c7e73b00d9
101266 F20110330_AABAOS kaplan_l_Page_024.jpg
734a47c2072c763fa46ae8972adc8c85
9d36793a6620e9ec18a1e3959d07b8bf0bf5f10b
29752 F20110330_AABAPG kaplan_l_Page_042.pro
c94d8be7356a44001842e86e01c5f6dd
863504e85d7ee90f9f7881b42355e370d82d6821
78185 F20110330_AABAOT kaplan_l_Page_031.jp2
98f251b3b21ba65fe4af2546bee8f763
e40083fa853a8c9c704ec800dcdf17819ea7804a
55424 F20110330_AABAPH kaplan_l_Page_084.jpg
56a5d9af2cb45644114dd8ae64cf9bc5
ce21da315bc6ef3a5d3abc2940bad12bcaf866ee
36394 F20110330_AABAPI kaplan_l_Page_097.jpg
f9f0638f7e488df67fe81923d41eb5bb
6613cff8a935c837ae507e66b25fb98041754ff9
48646 F20110330_AABAOU kaplan_l_Page_018.pro
c5d9d27fd6e0c96528b3b959ad317fde
df5274eff2877f3f5f5b1dcb4cf4e1e10ebf2f4e
49662 F20110330_AABAPJ kaplan_l_Page_052.pro
6fdadf7b9cb8d86effb4f2a75c7a9e7b
2ab43d2ffce18f0253dcb4cba8f0f15122d73082
F20110330_AABAOV kaplan_l_Page_018.tif
e5a8430d4a177e27e47b0b313c01eff2
d4e7800c20409effc6ff6b3e59cbf56b4703dece
8366 F20110330_AABAPK kaplan_l_Page_030thm.jpg
4498f5b33237fd0d1c38b43bf9d71c03
7183129d4cc61876654e23248688bbed833b88f9
39568 F20110330_AABAOW kaplan_l_Page_012.pro
abd945d2703ef83608f3afb0602221b4
66c5ddc59a7625f5e7995ad0996fe2ef1f2cb14e
1663 F20110330_AABAPL kaplan_l_Page_099.QC.jpg
dcec68db5b1395e762a1c0b3ab8e20c4
c6a7ec9e790334a5f69c29d95122f485c41832f4
35152 F20110330_AABAOX kaplan_l_Page_102.QC.jpg
8c8b5e9e1e57098906382873122d5bc6
5c10ae630a828efcdc15f7379cd2cb8481a0ac25
80204 F20110330_AABAQA kaplan_l_Page_006.pro
3f4fa1731521f086f90a35b542924b9e
6bf70b6919a2f2932ab0a3967ec89b34ea2fb15a
1930 F20110330_AABAPM kaplan_l_Page_034.txt
63a61564a71019d817e9769766f60917
9cc8b43082cf8719e0456343073365babd4108a0
1308 F20110330_AABAOY kaplan_l_Page_008.txt
52008b6269e096c798e3206daf36e87e
ce6cf625dba1e7c2cb6e6a9319788297ad96cbb5
6917 F20110330_AABAQB kaplan_l_Page_090thm.jpg
01e7f5640a0d7fd741cee578a7ebf33c
3ea73d8cfef6e7fe794e7e7e1265abf7ad856d34
104758 F20110330_AABAPN kaplan_l_Page_028.jp2
3f8418dafa409c5aaa15a9a38c15be1b
2f742dafc91c38e7d04e95f0b55a374997e9a5a8
4635 F20110330_AABAOZ kaplan_l_Page_053.QC.jpg
c6ef91f89f03e84f997e60fd0a4a189c
75540ab4bf4e0cb81e10bbc8fedca4aa50c61ec3
1865 F20110330_AABAQC kaplan_l_Page_033.txt
8fc8928d91423c118ae13644b50e577c
6e32297eccfcafbff2353297cc1c9e3c898e003f
6137 F20110330_AABAPO kaplan_l_Page_031thm.jpg
39911048c18760a21b3d8aaa682edd92
e5affe41c969cc3ed77b93d7a88c8489fc791e0f
34807 F20110330_AABAQD kaplan_l_Page_025.QC.jpg
a37be05f27297b2c443165b2db0020a4
12d77681fb87df677cb068c761cd3db0a3131b04
6602 F20110330_AABAPP kaplan_l_Page_012thm.jpg
dfc8faf93d7537ea7367f9da8f6b18f1
a7f7641ebb54a730fd7d7310f7e9f8b02dec0322
8384 F20110330_AABAQE kaplan_l_Page_060thm.jpg
e86a790b8bd3a6a68c38c8b34ca310f9
1fd59e9b57d5a54da4babbeeaaed3789b65691c2
2555 F20110330_AABAPQ kaplan_l_Page_009.txt
af2e5f94aaecf42372b0dbe1b6f0677a
80fe2aaae72dbaca220113a003a87a0aa449f881
F20110330_AABAQF kaplan_l_Page_012.tif
5c186216800c974bbe0ab1aca55a8fa6
19adbbfcbbac15ff215db4268a45d9ee7367798b
105497 F20110330_AABAPR kaplan_l_Page_091.jpg
c8800d16a8250f3bf41f401bf7c66e8f
caabbcff515adba81da52119fa2029b79eec3915
109712 F20110330_AABAQG kaplan_l_Page_101.jp2
29d62144193693a19093a59bd0734074
f31689c5de2c088675eec391a565f6d88f646e12
104958 F20110330_AABAPS kaplan_l_Page_029.jpg
2e66230a74bdeb96250c0e5fff698dee
ff556a7b2bdb2d7b6237fb994f8b559ba384635e
F20110330_AABAQH kaplan_l_Page_054.tif
95d294e10f6bc9ad02edfd7ed38ca29f
0a5303f3355ee26e772fd567b8368be38720a7db
33387 F20110330_AABAPT kaplan_l_Page_077.QC.jpg
b0254c8f274a5bf3297e929970b9307e
f6115f3541a640397cdd6d8c864a47ab7dd1f760
104793 F20110330_AABAQI kaplan_l_Page_037.jpg
1903be6c1f68fd1b6570bb359756984a
c671bee47122a499ed9473b1280c3aec40ac19a9
106130 F20110330_AABAPU kaplan_l_Page_039.jp2
8de83a3ba3b494da51431d0609eeee84
c3b19963c783cd207e78df731e0945e7e51780d0
1828 F20110330_AABAQJ kaplan_l_Page_054.txt
67f511bcc8f1179e75656fd0ab07f2eb
7aad327001bb990ec745a0546a36edf49b7e1ba9
F20110330_AABAQK kaplan_l_Page_027.tif
f7810f87cfffaa9e595f24984ba0539f
12f23cd597282bb4b8a4d93fd76c31e4e237c4bf
43994 F20110330_AABAPV kaplan_l_Page_054.pro
fd93e1511546e057e3cd3e542d3665d8
3cffcfddf50685017a0e6b610a80f69b43c7012c
44671 F20110330_AABAQL kaplan_l_Page_068.pro
d69eaf9e73dd8647248526cc55467bba
297a3ed8d7a58ffc786a2967c53ad5204a03afe6
35888 F20110330_AABAPW kaplan_l_Page_105.QC.jpg
7c5c261bdd0c9ea1c00d8a93352decb3
1d80032dfa2100f5d1fd2f7495190ea37baa7a46
38388 F20110330_AABARA kaplan_l_Page_061.jpg
b7afbf02b294658ac8bcdfc4e5d3e23c
e562a1fdec80d8bb6ecca17db73c31878035eeaf
5034 F20110330_AABAQM kaplan_l_Page_099.jpg
78dd1a69a772c433c90e472394ebb6bc
c3ac26b767d32d23277b9dd0d15f4b6c6a5255a4
5405 F20110330_AABAPX kaplan_l_Page_006thm.jpg
16e074d1613a8c7c92f4166e620f69b1
887d656112af2c07cf83324d3de6b3856270cab3
F20110330_AABARB kaplan_l_Page_101.tif
17944bcfb11a5e5822cb66b21ed4b46a
ab6d2cf147cb10630d35422afdbb8dad9aebb2c3
47531 F20110330_AABAQN kaplan_l_Page_100.pro
47a66bbaf659597db3a06b10555aaf64
2352fb75ca6f70938b2091cb562e79f7e23568f0
1989 F20110330_AABAPY kaplan_l_Page_015.txt
4760e9cc27a8dc4d7736cf63fde87120
614da9062abf327be24d71185a66e2c726849400
129632 F20110330_AABARC kaplan_l_Page_114.jp2
e2595b9cdeed47d441b0e8b2a3b16563
4c215ffaae56694ae3db934f9f54b0ad6c50e228
1752 F20110330_AABAQO kaplan_l_Page_012.txt
8e7eb7f25c7078c3a494d002441d3e84
6771e707766b78178f407dd58e0ba8ddc344f03c
52454 F20110330_AABAPZ kaplan_l_Page_071.pro
8c5cf7dac210b923eebab9e1d4c5ff78
9e70efac8812f3a73bc78e9d0b59f07b96c371cf
110785 F20110330_AABARD kaplan_l_Page_038.jp2
2240118d23124b9831242cfc9dfc4536
524447e2f253bfbad336384145d67ee801a879de
F20110330_AABAQP kaplan_l_Page_081.tif
84ac5b1097cb9d61b389af5a4db4cd87
e3d04d76b1c22297fdcdc8c532d538721270b716
1952 F20110330_AABARE kaplan_l_Page_049.txt
5579904250a24de8eb185e5ec2710d5b
83bebb86943dc30d5a0abffbde1ae227f932bcf7
400 F20110330_AABAQQ kaplan_l_Page_098.txt
840c28e93f83c7af1c8f5d06f318f9b0
55fec8a1f840d9d6a4d8cd7562206ba9c66148f3
28928 F20110330_AABARF kaplan_l_Page_090.QC.jpg
8827267210299eb8c84283e73ab1422d
084fe43eaf17ada29bf0095aaf088519ea0bdc73
43421 F20110330_AABAQR kaplan_l_Page_075.pro
901713f6bb2460611c40341df7cda2b2
c85f766010ade3d763412d2f305b2f32bf7b17eb
63097 F20110330_AABARG kaplan_l_Page_009.pro
a3f5f717ba176a481d2d0d5848bedc04
1200d3a5f04f253fc1e1bb5902d91d5a1779c927
1437 F20110330_AABAQS kaplan_l_Page_002.QC.jpg
46245786f5e8c0b7aa8c855d13b98b89
35a679ddb3a60098a771ded4f17fd42bcb508f42
562596 F20110330_AABARH kaplan_l_Page_073.jp2
7a7f05b67ba89e97bd59993a91ce01e6
ce62e30a193da8a6d1c7bb0c6c997205c07b0430
130343 F20110330_AABAQT kaplan_l_Page_105.jpg
42a0c16970a49d3a2df3d6e461a3e045
983f7dcc8c013e2595bde5a30dcd0343d717f4c5
32063 F20110330_AABARI kaplan_l_Page_059.QC.jpg
f95ebd8c977ece691458356c0b989251
480e239673b6aa94d6ca6e15a0df16b144bd74ec
30703 F20110330_AABAQU kaplan_l_Page_068.QC.jpg
582b9ebb83468ab605015009b73ba2bb
dcc7d12739e9d1e9c5ff0ecce2ff52af99a1b246
4053 F20110330_AABARJ kaplan_l_Page_007.txt
13a05fa11ee9a4ed276b0defbec120c2
c51eae57618a9f1fe9329ae0c35b8ba82dd80b28
49803 F20110330_AABAQV kaplan_l_Page_035.pro
c054d45292175296417f72592f797b02
280b739d0013127b20f1bb916dc2ac2541fb5d01
36537 F20110330_AABARK kaplan_l_Page_104.QC.jpg
acfd6086d3824732a8ad5b29d927f35b
e1f7d8cb2d475f575a15feb06b91ae0a4e6f6227
2088 F20110330_AABARL kaplan_l_Page_045thm.jpg
04658fc94c8226a2a7a6343b4e0e456b
020fdddf3c31e736777aee3addf078edbf2d9cd3
8397 F20110330_AABAQW kaplan_l_Page_020thm.jpg
07d7cfcdd3111706dd827257c25246b7
7cd43c0a5ab7b533df922a4d285c8b19484ffb11
F20110330_AABARM kaplan_l_Page_059.tif
3603ae1fc111f19810a2a9772d7a5c18
de415b8cfaf4c8d1ea3303bc57e70d7eb8473398
104934 F20110330_AABAQX kaplan_l_Page_025.jpg
82aa2375803378cbfc249c3de4d1bb85
2912a71093d8a617c06c255e8d24bc8611891581
102429 F20110330_AABASA kaplan_l_Page_019.jpg
467dc057e579790335342de4882bbca0
48b6a2c5a70d592b42b2020bb9760ef04cbe5d90
51614 F20110330_AABARN kaplan_l_Page_069.pro
e3473a4b43e5d3a1de9902d4a8299aa8
4af5c7de3ccd8ffd79d1b7d26ed2f765c6228556
414118 F20110330_AABAQY kaplan_l_Page_011.jp2
4889f39b6237d0c3e8d40ad79cf47d89
2135c1e270dbb2ecaff325d4cab320c048b8e230
51529 F20110330_AABASB kaplan_l_Page_073.jpg
09d759bd779993b9464ee0fa96b3ddb7
c85fff64d0e4dd9de737b70a1cd47289dd890e34
36705 F20110330_AABAQZ kaplan_l_Page_108.QC.jpg
52b4ce0ba9a4c18d87fee90a8e90e5fd
8821686ae2bc1418528f98a65cef29874877efe8
27919 F20110330_AABASC kaplan_l_Page_081.QC.jpg
096a585ec76da9525a7c2df70f374ae3
1bb70e0aaf6d1c14748f902a4808350a08f32463
8349 F20110330_AABARO kaplan_l_Page_019thm.jpg
32ee59f67af847a0cf3e4b99df6c1c03
6befda634b3c192858c7493de04218d0d5f0f3a5
18941 F20110330_AABASD kaplan_l_Page_100.QC.jpg
4d5c574b8c5273b3b5f297f454f38b94
5e7fb753f673b9ac01219c4b3ef302f15917a4f8
1953 F20110330_AABARP kaplan_l_Page_091.txt
cd224e67677d79c2b88c5146cba9f616
07e2ffd320906def36858eff9953fd1bb21d33dd
F20110330_AABASE kaplan_l_Page_041.tif
7962708d49940ad3afa80ac7b9d6e390
6b56724bf2e0fd19a62227c5b2534e77588089e3
98795 F20110330_AABARQ kaplan_l_Page_049.jpg
953bb20eff10556d3ee4b16cef1cc795
d22f507390e70f42a44c6d38e2df04cbfb32d22d
2666 F20110330_AABASF kaplan_l_Page_104.txt
3c7a687d442adfc11f5cb8d13adb2873
3c0dfcc701177e38309045bb809384d86d942001
2091 F20110330_AABARR kaplan_l_Page_051.txt
b521ca30cdf951c74292a9bd024c4dcc
cf9aaaf071f278b38090dffb4b6922076a2dfc55
4356 F20110330_AABASG kaplan_l_Page_002.jpg
e6744223ff01805806c5d96e950f2817
fef59ca8bad8cbf7a6e30b17830afe819aab5a57
31964 F20110330_AABARS kaplan_l_Page_026.QC.jpg
06935f28834fc087363c7351f50df8e4
733ddd324fefb3b8f9c5db798d077267f5d5b40f
34642 F20110330_AABASH kaplan_l_Page_115.QC.jpg
5cacecfff8ec6205281fac4cfdf31673
683da678dd36d06533396a065abafda24ac9d17e
99137 F20110330_AABART kaplan_l_Page_068.jp2
e1ea7dabac5c8728e80ab8a4a3f977ce
1ce7ca2dff04ad9fd26d5a8d8624075cecdf47c5
27913 F20110330_AABASI kaplan_l_Page_044.pro
88b79a93f3f19b950e5d5f13579d7f23
f6f3e49d6873314ea42a627a66886794d8f61b23
8230 F20110330_AABARU kaplan_l_Page_027thm.jpg
62614bdc396eb74f9730285b48948d6a
8cb8696ded53f341ad7a0d44701ce4c4e6206e35
49892 F20110330_AABASJ kaplan_l_Page_022.pro
319874b54830f924c1d8b69604889ab9
85921f9c8ac06f9abcf3208198973bb4245724f8
F20110330_AABARV kaplan_l_Page_021.tif
d67dcc3a31edf43b8b9803814bd4ec9f
d15ea484aad13428e158575f5bb98bb12e7a8b6a
F20110330_AABASK kaplan_l_Page_066.tif
7c6c7da8aa5bc0fb597e1c5373a18312
b37da7d7dc3db4ded79e563d8365fa5ff7231072
8543 F20110330_AABARW kaplan_l_Page_114thm.jpg
caee11ced7b51c227e5c385b0fe5cb21
31b8a75ff4cb0f347e6cf7eaaf66a194333cffed
98086 F20110330_AABASL kaplan_l_Page_004.jp2
d308deaeb7874f29a3205be94cec2516
0e51500a63ef49c87f7f3e40c783713835c5b36f
72039 F20110330_AABATA kaplan_l_Page_031.jpg
46d779c032bff8b51dce93775da5dfe8
739ec8b8ce8a84575d4064d5cd4a09d19ac96912
8372 F20110330_AABASM kaplan_l_Page_055thm.jpg
694084abf70611366b7efc81fe83da09
7bb178ebdfbd1d8a9f0638188912ecb6a59caddd
881 F20110330_AABARX kaplan_l_Page_088.txt
05ca333e2192b6e1cc9fcead093e6d88
7053b2196d30fb35ebc84de6c7997993bf7e607d
111060 F20110330_AABATB kaplan_l_Page_069.jp2
70c12b203b7f7786341748f6ff9c4993
d4285f143ce7d826e3602469a8d74579179b60a9
7394 F20110330_AABASN kaplan_l_Page_101thm.jpg
0b43801a520747f6985ce0ab7bf110bf
7a7e28afcf26039d3e4db201ce056af1dc56b4f7
15540 F20110330_AABARY kaplan_l_Page_117.QC.jpg
f4bc15d8d04d1cf3567a3bb0d9f9d374
36106ab15ca56535cdfdb0576938cd1077aefcf3
34132 F20110330_AABATC kaplan_l_Page_079.QC.jpg
92d69b322c0ed4a01567113cb4cdc132
c3bf9d4ec7f68b7b615b8d0114b0d95b04fd8a3c
768042 F20110330_AABASO kaplan_l_Page_087.jp2
f4bf09312645c0846fb8e7d855ab2f8d
7d4e57583d49deab1d2ed2cfa775e2e9f25a0cab
524 F20110330_AABARZ kaplan_l_Page_099thm.jpg
cabd8ff5ed5146aecd518ca864d10f91
9b1226c381a4cc8781d85d78e233a839f8181fb2
2001 F20110330_AABATD kaplan_l_Page_019.txt
4f5520b6644ef18c1bcaabf95d1ea15d
36ae3e3e9e29ad822621820dd8be1a278acdc9ea
108797 F20110330_AABASP kaplan_l_Page_016.jp2
0b2006a865bc5cfdb113d121425916e0
9fe378f3ba9d5578216d8f8627cc9961668347e3
1969 F20110330_AABATE kaplan_l_Page_027.txt
3658476803d640eff80968676f103b08
c00cf04f3bc08ddb9dfe0689a2db4c30c135333c
17024 F20110330_AABASQ kaplan_l_Page_084.QC.jpg
99190d38f442ff8207dc58e6df747da6
db3f4603a5d2c734180983757b8ae6fdfce4dc78
32924 F20110330_AABATF kaplan_l_Page_027.QC.jpg
c06d6edf74014f056adcbed52a2b66d7
007f72d7883b46a83cf93752895201a7ed2c50aa
26075 F20110330_AABASR kaplan_l_Page_012.QC.jpg
a2e03098b469b0df535386656e18e517
ef4655f35a2458d233a214c707a1da9904a9a046
11786 F20110330_AABATG kaplan_l_Page_003.pro
7ddf7ee7c35e4632792ea242379ffdb7
37a0fe71ec73d9378de38f22193bd5bb4cbf3cec
F20110330_AABASS kaplan_l_Page_058.txt
a0776d35af0a4262098d851198996653
059e8dc16ff54887510506a58f51d381f1e21091
112535 F20110330_AABATH kaplan_l_Page_093.jp2
4d04f8056bd4986ff424c805cfef7d07
38f54fb6704dee9049d3bf9ea4e5c85913c5cd7d
61087 F20110330_AABAST kaplan_l_Page_113.pro
452399ada775ef6129a46e44504c2e35
b79943dd528f507eb2c3d88808a41d2b0b7ad3b8
13865 F20110330_AABATI kaplan_l_Page_074.QC.jpg
8109ccc9cc8854f4f1dd5cd179e5f8a3
a05affaf4c31ca72f418160e38d4147a3c74b68f
651 F20110330_AABASU kaplan_l_Page_067.txt
4818a1ef3bc49a94db82613eccc370bb
bd8e3c79f1789c32c43280af0ce93ccec77d6482
21835 F20110330_AABATJ kaplan_l_Page_042.QC.jpg
7c88cfb2c87a98a1a992fa16bdee4f8d
9ee7f78ba3d24a444341fb6c7059288de5f24d99
16129 F20110330_AABASV kaplan_l_Page_082.QC.jpg
17d9593d03db876653e6a9b9ec67662e
07ea569ea73b324246daa5460638780afe42ece1
1746 F20110330_AABATK kaplan_l_Page_046.txt
747da57cda2ce1c1c0e281558fdecdd1
3b5bc52caf6f4f968c38b0ff2c760f43bc0f567d
261221 F20110330_AABASW kaplan_l_Page_065.jp2
7b5552b586b7d1ab948db30bae448857
6d03f524495c78ccbe82e5e48d0fe7808e66a9ce
133492 F20110330_AABATL kaplan_l_Page_109.jp2
888aa3ff4a93473804f20c642315d76f
77e337896cb56afea51bc40d730479910c35f77d
8168 F20110330_AABASX kaplan_l_Page_059thm.jpg
ff02fa0df2d566828338951af0c855d5
647dcb86858357e83cb0e7ffb8e51a09223aea83
98989 F20110330_AABATM kaplan_l_Page_005.jp2
35899406713afd9962817b003ecc5d59
c58d136bcdc82f4257c6e2ad81c3939e1e2a5c0f
F20110330_AABAUA kaplan_l_Page_007.tif
cd1ad2159900f2e8a748a8c229508065
0f25186ea513d2ad8294466325f9db340bc12f63
8856 F20110330_AABATN kaplan_l_Page_102thm.jpg
4da3892a22a89b2e9f3f1a2509a68139
8730f8a7bc3fdc72f8d3269f8660ae70cecedc2d
F20110330_AABASY kaplan_l_Page_011.tif
0aa2e61fd51ac9375a6a3f4dbd7eb299
ecf78d72d7978c7225e82fbfda68e2e85b85a483
F20110330_AABAUB kaplan_l_Page_008.tif
4e31803e05c2b46b74496415ae9e8952
0479510051eb43385ddee0c2281f6c6c7ad3b5ba
126082 F20110330_AABATO kaplan_l_Page_103.jpg
5f35e92453c54d60818fa3abcdc43a4b
8b5aced06bee61e5a6efe364514ebdb39e30f574
30611 F20110330_AABASZ kaplan_l_Page_004.QC.jpg
d76707a45df874f0c9cd0c935806bb8f
bc9105dc883af511012747143a11c1453cf5836a
F20110330_AABAUC kaplan_l_Page_009.tif
cc440b774ab57194c1d553347a88c4ad
61b18937412dfb2bbbcc719754a6f75d987ce384
114950 F20110330_AABATP kaplan_l_Page_021.jp2
620afb2332b422911d23437863a57b6c
fa46b7a95e2e4728554be22a8d2dac68c48aa6ed
F20110330_AABAUD kaplan_l_Page_010.tif
b1b5475b3ad8916fc03a3a74f9a5e122
e9b8803e84be0424f86900b061643a5493d62339
F20110330_AABATQ kaplan_l_Page_015.tif
f9e9e6d8484fe76c5da2c8073e48774e
165cdde427983d2dc060393c706c54e51c68b3cd
F20110330_AABAUE kaplan_l_Page_013.tif
9909bdb75e767bd29696aabf278bc461
197105e9ed6bf999d38f8e3bf2b8ebeece243ed9
F20110330_AABATR kaplan_l_Page_056.tif
9a91a3976ef677eacc81d613be780820
fa9cae70cbe51f075fb71688ea590af78a87be83
13465 F20110330_AABBAA kaplan_l_Page_013.pro
237734d3395a625a64c6a9997d412378
4f5a8275182adea998c2da5a8024a22748e43c35
F20110330_AABAUF kaplan_l_Page_014.tif
09f55054849c1396acf922ec432d2c55
0d36c88cae4b744fcf8775a4dbd26dad841c0089
121730 F20110330_AABATS kaplan_l_Page_111.jpg
07dd48b2107f087b099c4cddb7324ad7
60fa09192e0ff6a9ffd5dc9feac82884a7b656ca
44368 F20110330_AABBAB kaplan_l_Page_014.pro
06b200cbae57c3c824a39759285fc381
d7721d3dbdc0fe4d76915b9cb06cfee854fa31ac
F20110330_AABAUG kaplan_l_Page_016.tif
604ecae90c06060e612ec065f13275e9
b58d85ea8a5b2a316515b06d723bfb78e934c2bf
189536 F20110330_AABATT UFE0012884_00001.xml
f7a39d21576b39a9f7bb1a1972e8632c
ef3164a848dd7dd365a0448284d2d824b5898fef
50538 F20110330_AABBAC kaplan_l_Page_015.pro
fb286186cf5e85d51d480802e80bbb3e
865102312afc6bb58c6dbdc7f187fb503bf8530c
F20110330_AABAUH kaplan_l_Page_017.tif
b1c80bb66ae3409c375cacccba06f4d0
33ea505cf832377d1f9ba39f8476df3cc68e04d3
50948 F20110330_AABBAD kaplan_l_Page_016.pro
882fb9d45e95d989c940c69617526c91
4311b885b9d4929586b1de9ab5c0ae64bdccc68f
F20110330_AABAUI kaplan_l_Page_022.tif
061063ff9488d9628cad24bfcfd8538f
1ca3c532886f230d5242bc30ae983596ef024c79
49313 F20110330_AABBAE kaplan_l_Page_017.pro
6ad43412c611c4528590d4ee7b4ca0da
8185333804bdeaa110aec456a71f404d17ed0e21
F20110330_AABAUJ kaplan_l_Page_023.tif
56a1db4fe066f080802c42ec97cbd090
cf18480f8ee65360c9e64806fb31cf48b2c00abb
F20110330_AABATW kaplan_l_Page_003.tif
12ce0bbaea9b1eab0f653276591e9ee5
d176b2b1d55c49fea6227a313a8d6a2e9415d524
F20110330_AABAUK kaplan_l_Page_024.tif
e574e06db341d83d89ee5ff8c8a6b073
2a1556debc7600afed5abd97b872da7873a1508b
F20110330_AABATX kaplan_l_Page_004.tif
96e9314542c8a252e9e71dd04030253c
9f7a67ef48b5e1155fe3010c16b1398f443e61da
51435 F20110330_AABBAF kaplan_l_Page_020.pro
84ffc009e435e00a7be25e722fcedda1
380e3a8f6b093820c5cda0f7f3a5a65fc228aacc
F20110330_AABAUL kaplan_l_Page_026.tif
02c5b0975078ca974daf6e987a88be54
ef29e361cdb6c8e7cef7b04a52ef31422fe33654
F20110330_AABATY kaplan_l_Page_005.tif
4679dd1bdef75a5e4f1397718bd5585e
e407e9d77ded55c9411ab7d04c8992e3d2c5740d
53076 F20110330_AABBAG kaplan_l_Page_021.pro
e402b9e059c82dc20a943bd2332804ab
b4987fcaf67cfd7514623f86102028442ca0eb4b
1054428 F20110330_AABAVA kaplan_l_Page_045.tif
af43901bf62694226c6ef44d373426a8
fb20ca2e96151b956c53ea67d4132c12037331d8
F20110330_AABAUM kaplan_l_Page_028.tif
847a6f3d0cbe37073cb91d46042cd10b
15b133be6002e76e043303cf26f0f0fbb0cf5efe
49266 F20110330_AABBAH kaplan_l_Page_023.pro
6b69c103f4e24ed0f9f37c2318f2db35
94774e585cac89577afdd9db34e358a70bd76b30
F20110330_AABAVB kaplan_l_Page_046.tif
024b4412a9ed42b3792c1d611f9f60e1
f3f734baace71373fc6f80e89751e7c76cf953b9
F20110330_AABAUN kaplan_l_Page_029.tif
517713d4bbd050f5f873406b5f37eb82
8fe591fb51a0f0fd01ff834ae02165aa76a8c77b
F20110330_AABATZ kaplan_l_Page_006.tif
66cd67dc3b6224d1b2fbb013e2ca435e
74c858737b01acc96143a3ebd15d37b568f97362
51504 F20110330_AABBAI kaplan_l_Page_025.pro
a86eb290f9e88c341a51c7dfc910b845
9af67064f3250ea85de51a90440825bcb5f90237
F20110330_AABAVC kaplan_l_Page_048.tif
bf2a462910ca506470da88ab27aa27e1
c40ea75432df1c89515a61a26973f092d1a24d01
F20110330_AABAUO kaplan_l_Page_030.tif
3dba5d524242aa18f7bab4479765b36a
e940ab790fe0b95f2cd0dc3685fe4eb64aeeaf60
46301 F20110330_AABBAJ kaplan_l_Page_026.pro
f8bc4f8e96a8b983c71e486e3cf93f8d
eb570ae25275c758ae3d00ead41e64b7b99e2e31
F20110330_AABAVD kaplan_l_Page_050.tif
e578d5bc3c4e8299d97b6d04eeac5af3
d73c47763585696aa88334229684fd68f68e9945
F20110330_AABAUP kaplan_l_Page_031.tif
5e06dc12dd48410db43c60fb28ed1bd5
ff6c493f25761a487d80d140c3c8fe33aaee16a4
50162 F20110330_AABBAK kaplan_l_Page_027.pro
82477d3eb56be640b2f4fb33db2e257e
b9d42648ae91213ee3a5ea0fe29f1e1dc3b558d8
F20110330_AABAVE kaplan_l_Page_052.tif
b970d9ac7dfe3b24b7e061dddae85e51
a479b8dabf59a005418aa70a7f6d07d38051b2ee
F20110330_AABAUQ kaplan_l_Page_033.tif
1ea274ef348ead6e07198fdb376ab47d
463f1f270b51078e941bfd1d8630ffa23927d6ad
50905 F20110330_AABBAL kaplan_l_Page_029.pro
8beae4f6f9f53c28319fd9ba05d26dd9
0bf14d4891cd09b7fca23a271b436f9ffceff818
F20110330_AABAVF kaplan_l_Page_053.tif
77f4c174c7747db03372e6d50aaed094
279f59394071fc17a2cdfd4bef4d069f20a609cc
F20110330_AABAUR kaplan_l_Page_034.tif
a8888c5915c3c7466284f590f2fa5198
60b43960b140547916345dafd2c201c664e5179c
52798 F20110330_AABBBA kaplan_l_Page_051.pro
4726ee4534b92b139a8d1dea8cd261f6
42414b17fe17fc5affcd5f12d95b70ed2a5c9958
50783 F20110330_AABBAM kaplan_l_Page_030.pro
91e1fdb7b6eb9910b23e4970a97790ba
a5ae26061a741cb362abdbad179073be66508767
F20110330_AABAVG kaplan_l_Page_055.tif
199b587a060a06e2a04ed51c8651c132
2b0c5cbb4b78841c6345e3857df48c5fbabfaca1
F20110330_AABAUS kaplan_l_Page_035.tif
31bee2b7c7a45509206cf3544335f061
9a22c650c0a24b373f5119587c9c4ff0c9ec42b3
4781 F20110330_AABBBB kaplan_l_Page_053.pro
4418116514ece7cd8409644dc72772da
19273248611e7453d985e661ad9259e0e81d940c
33011 F20110330_AABBAN kaplan_l_Page_032.pro
1aabbfae50ad868ce2681b766af69fca
3ecaad17195d046adf993fa0e2ed89816810885c
F20110330_AABAVH kaplan_l_Page_058.tif
904cbb3bd566e3d60f855d0dc3088d15
3ac1b2576ab7cb865b263940855831b17032069e
F20110330_AABAUT kaplan_l_Page_036.tif
a1e3961eca88305ce9f574dd2e114884
ca92e53d60ce76f130687159a04043a91a7e8cf1
50378 F20110330_AABBBC kaplan_l_Page_055.pro
04ccdeabe598e7e0681c0fb574de275d
106eb9a41dd00fff188f64d629f2ebdd949ebf4a
47332 F20110330_AABBAO kaplan_l_Page_033.pro
32485e191e60683203259a0844a7097a
c52866f3e6a92a900e672359f6a819b354a4c365
F20110330_AABAVI kaplan_l_Page_060.tif
d55bab09f9f4670ee58df33acf7f5d57
296765ddf8244bac65b630cf62678936276591a8
F20110330_AABAUU kaplan_l_Page_037.tif
1e222289c441c4fa105029ac4d7b570a
d91c8339665258e135005087ae46cc57b50d4e8a
52249 F20110330_AABBBD kaplan_l_Page_056.pro
f90489dc41642acb66dfe802049d6166
0f3758da3c0e07dd2bd6d31c42c6be3bf1f9d174
48107 F20110330_AABBAP kaplan_l_Page_034.pro
b1ea3656e54391c59406cce50b86425b
e6743fef9e687840a8de34740451b56ab823003d
F20110330_AABAVJ kaplan_l_Page_061.tif
fc95e5ae4f4bc544653e8b95ef461e1e
087477f464334fb6f1b9e18adcd70f4fc0582fb7
F20110330_AABAUV kaplan_l_Page_039.tif
87c37b139e87b963dc76374495fc4a31
8328489dd25a5ea68f33477d2d036205fad38965
48711 F20110330_AABBBE kaplan_l_Page_057.pro
634e0737c596e6f64b5416d7fe4bac08
acbf6db0bc76bf77e8e3b1dbeec9b785f828ccdc
47089 F20110330_AABBAQ kaplan_l_Page_036.pro
cefe584f6444cac2811cbd765fc18d15
061af20f7dc60845ce0189cf30f085e23605b0c2
F20110330_AABAVK kaplan_l_Page_063.tif
ae6acd4f72d394268982b2541f1be7cd
6bc5c76fabc9f042187b2efcf0e23907b6b5cbe4
F20110330_AABAUW kaplan_l_Page_040.tif
16f22ce13eb548974068f124f5ed8d1b
e34ab8936bba81b474f828a97ea8960c1c479704
53214 F20110330_AABBBF kaplan_l_Page_058.pro
80d1967eb234d69a4e19dca2c1e8ad40
2092fe2610d0bddc5e0a16dca5387d33cee2f9a9
49767 F20110330_AABBAR kaplan_l_Page_037.pro
1a25c8d7d453e1f4f722a667b4cd49eb
c489434f12ff72a89e9c306e78503c7a3c721518
F20110330_AABAVL kaplan_l_Page_064.tif
55c79acaa126e5589f07986bf59a3554
f5beaa7a0b0246bf31a254248a55a11e86aad75b
F20110330_AABAUX kaplan_l_Page_042.tif
d371e6c25d205c71a07446148ce283e4
87198ee20f8ba7400ea9d64c61e56f3e33318f82
F20110330_AABAWA kaplan_l_Page_083.tif
4d8ce73a1c439e810d2eeb7e9a6f8522
6d5b7aa2062fdc524b8f78b86c955bd068c5340d
50088 F20110330_AABBAS kaplan_l_Page_038.pro
e5e114e3a567e4eb05da47ce331c9f54
932e3c587e99055c18140fa6f9ba61079b0c5f3a
F20110330_AABAVM kaplan_l_Page_065.tif
89fe53dc13f7c2a7c28b9ee735f0ec18
7642e2f6925b06452431e3812991c55e0796eda7
F20110330_AABAUY kaplan_l_Page_043.tif
1653f0f843ec590c0ad32c64053c4424
eec6ebfae76c81173ad07c6c65a869809cd0ac88
48359 F20110330_AABBBG kaplan_l_Page_059.pro
006d5d294eb50af9965eacecfea0f92a
328cfa0387e34d8924b390be2b9dbe0248287c70
F20110330_AABAWB kaplan_l_Page_084.tif
f8c2ee545b92de2acbed55859b5fb26e
30ca7a0936ea47afabc70e29d28a002f251a787e
49991 F20110330_AABBAT kaplan_l_Page_040.pro
978c4c928e898ab4291930d311847299
79f28c80c7fdad09e8bf4c6a6bb89ed25870eab1
F20110330_AABAVN kaplan_l_Page_067.tif
e170ab18b782a7aec37e54ac1c56f953
e4fd6557cb070c0c486b4fa1f449de46de05a4cd
25265604 F20110330_AABAUZ kaplan_l_Page_044.tif
3c6c3c0ff3f6f2604b86c664286269d3
40ceb9b299c92277201d29c6c9fa932de8b3ed06
49558 F20110330_AABBBH kaplan_l_Page_060.pro
71c2d6f01c1510b6c2754aad8f743a32
c2fe08d3227eb7fa2b9d347f5ec1cebca0bda9d6
F20110330_AABAWC kaplan_l_Page_086.tif
ecff9d8d2cc58ced52a6fdb3d72dfc5e
8e56134a0b4686a57f0ccb1e79d2a3121947592b
47855 F20110330_AABBAU kaplan_l_Page_041.pro
9741e3ed851ba5dc7fbd41143ded3c09
8e7443604bfceea150c0628f1e0af66c5e675c82
F20110330_AABAVO kaplan_l_Page_068.tif
5ef182d730b72456996d34b630f2d18f
2dfd168a8049d1929a56805cd72e13ed1693e8a7
17472 F20110330_AABBBI kaplan_l_Page_061.pro
65b3bd5204aaf99b81b2834827d9a692
6bb99c8f567a8482775124086eed71f2efdff902
F20110330_AABAWD kaplan_l_Page_087.tif
125f947f190b0c25c243cc546b2a8ca3
03bc50c3ce19442f61a86e76157c73403128ec38
22095 F20110330_AABBAV kaplan_l_Page_045.pro
c5b5a4d89547f0e7c4eee7b9ecd9e065
51d38d15209c11125e9ec98425f6628d3e77674a
F20110330_AABAVP kaplan_l_Page_069.tif
28a901bb47aa2e971c698f59ee87ccf6
d0c0a70e423015a50a848782da10db8b0cb16823
95526 F20110330_AABBBJ kaplan_l_Page_062.pro
e50e72d96d58bde3578a436a603b7bd1
71a9ae1b05181b21a4d987e40aefc1e1f965e175
F20110330_AABAWE kaplan_l_Page_088.tif
bfd3759697a04bb883dbc69b92c09162
ae41df52ebb782790f43eccfdc075f0b80611529
41776 F20110330_AABBAW kaplan_l_Page_046.pro
4f394e225cb053abf45f08f86d591a30
83a811793fc0b3e8369815fadd132120eeba9ad3
F20110330_AABAVQ kaplan_l_Page_070.tif
df649fe9bfc2f487f7c16fe8625b687b
4d3ea0fbeec093c229c92baea9f233552b181406
14033 F20110330_AABBBK kaplan_l_Page_063.pro
22011d39a84a207daa72885b45e34cd5
99baedb257c94ead03cdf9d2c772afb281adfe8f
F20110330_AABAWF kaplan_l_Page_091.tif
784f22ed501404e742d9776613f92b70
9aa40cfe82835a83ef494ee77910523984cac097
52183 F20110330_AABBAX kaplan_l_Page_048.pro
33adb007c5278910f6233ebd4ea161ff
811ca2a3f50c6623eaea020b8d0e3446d3f779d9
F20110330_AABAVR kaplan_l_Page_071.tif
dea6b2f833d938d43919235319c10323
a0ac7792b8c1c932a3a66f51c0dbd62a84e66069
10587 F20110330_AABBCA kaplan_l_Page_083.pro
d58ca373378e68aba136402d1a311ec3
33f8505d04bd9a1c78852e2b1d3900d248f61946
75837 F20110330_AABBBL kaplan_l_Page_064.pro
9a465bb7e3a99a2e2e2e1b2e2df1dce7
ff16672ed5ad8e8283f983f81a8450649fde5205
F20110330_AABAWG kaplan_l_Page_092.tif
5ced5d20be3471632d9716d336265bdc
9c8b38cc1dcd217c59d6b84e5c5e4d0ca79e0415
48544 F20110330_AABBAY kaplan_l_Page_049.pro
0161f1975167d70daa054cc3d35d5a2c
bf2e9c4b219832668d19cee306883cf8d3a0ca8d
F20110330_AABAVS kaplan_l_Page_072.tif
5fa44764e2ce7e0dd57a540a93742cae
b315115466d89dc6a583fbb68b32b0afc8341fc6
30077 F20110330_AABBCB kaplan_l_Page_084.pro
b9e7c6a85b57055f065225a2e9e40b8f
73f3ef619853bebff663f99e2d1613ea63afc3a8
9937 F20110330_AABBBM kaplan_l_Page_065.pro
9554717045a182a0306259704516cbce
b808f213e7c3111fd0a7305c80db49c291de0643
F20110330_AABAWH kaplan_l_Page_094.tif
3b3548192349aa41734fceab99c3412c
e95cd57270a570d24f4948ed704a9e5648428a8d
47954 F20110330_AABBAZ kaplan_l_Page_050.pro
51e3442aedb14b7f8cfe006cd1930ce1
4efbf4130d185f8256b95e77e15bb8089c3c62bb
F20110330_AABAVT kaplan_l_Page_073.tif
7e48440793c4a940a1f7a36556cade88
39e1d8534587ccc41ec46d5d3fc6c95af2365255
1721 F20110330_AABBCC kaplan_l_Page_086.pro
c2663786c9ae52f9bf0a7f3d50902f8e
a4e7d0b7fa71e84116de0a239d45a7ef1aa22b2f
9829 F20110330_AABBBN kaplan_l_Page_066.pro
e0eabdf6823855f88d62a59278f20541
52c070b290e88fe4cdaa02d25cf1a7b177586201
F20110330_AABAWI kaplan_l_Page_096.tif
6b9dfc36da443d0e284ed37228ba473e
30c80d10bc062bf26ef06b513477fdb4a29811b3
F20110330_AABAVU kaplan_l_Page_074.tif
48011449bfdd030b1d283aba3dbfe008
aff0f558234926c7f7ebc871c2f7ac89daadc742
14040 F20110330_AABBCD kaplan_l_Page_087.pro
dff54ec2168c4ffb2d7a48a6c7998f3c
72bc7cbe3d87fa309a855b4db331789b64bed408
13441 F20110330_AABBBO kaplan_l_Page_067.pro
6333f3fc4de46cece163d8cc33925615
b4eafe2f52661c62e840a9d972b0fd0d4937e55a
F20110330_AABAWJ kaplan_l_Page_097.tif
9afa850bbbf3274cfefc28acc6f60f31
2e54b63a73283e84d299b709d5c3a2059a5315df
F20110330_AABAVV kaplan_l_Page_076.tif
989cfcc3bc4e646b968e06459ed1520d
265bed9425ea3d26c65e10a454fba8cb828c94ff
16386 F20110330_AABBCE kaplan_l_Page_088.pro
b6a0d918bca9d08866a95806d2d4f26b
2997af0174131ff606db3433815015d083b50632
50288 F20110330_AABBBP kaplan_l_Page_070.pro
ebcc0d9d12ad9d6e3a38b8fcab39e91d
4204982b87186ad54795979250c2dd7dc4833138
F20110330_AABAWK kaplan_l_Page_100.tif
b9e354dac8a1e0bb7ffd51953b841f1c
94437f0d9871e187d16546fe8a02206db8b45909
F20110330_AABAVW kaplan_l_Page_078.tif
4daa4411177d8fa55227f4902c1eff74
84757609ba3f268ce80dc188cfc17d6421113d9e
F20110330_AABBCF kaplan_l_Page_089.pro
c1d2e745f217bf3281cc530c250a3274
2ab9a6466c3fd20968b8a41cd5720ec9f286e577
22496 F20110330_AABBBQ kaplan_l_Page_072.pro
54f2880d21837f5276ce2a88a164d763
6e9a169c05e345d1552a921cadb98c4d95ece9f8
F20110330_AABAVX kaplan_l_Page_079.tif
8cc2991e3411486cf5c6b12ac06044c8
9ccf2c298df6736d09a1b5568a99d1d134a73ea0
43054 F20110330_AABBCG kaplan_l_Page_090.pro
71b0edf983a88125ae58753787c59bd1
6ce36bd7f3c25003a2dc61fc8fbad39f1a99ec48
55485 F20110330_AABBBR kaplan_l_Page_073.pro
9d2946eeccad6ca103da74ca3905c7fa
29f9fcf21c9b7559bb21ba65ba2b70079fe012d3
F20110330_AABAWL kaplan_l_Page_102.tif
ba7fb4814cc375cfb2d1dd3b4eece073
bcac6c70785cfea1c5e7cc9f2d445bebdcdd2b1f
F20110330_AABAVY kaplan_l_Page_080.tif
85ab1ddb141c16a6ab5ce13edc824350
0f8f5e86911d62f72406885c21c80aafdc294083
511 F20110330_AABAXA kaplan_l_Page_003.txt
811462592a84bf6d18e387bc3d4a2de8
ec8bf5b6468779a999fb8847b016e3e31fa233b2
15330 F20110330_AABBBS kaplan_l_Page_074.pro
4eb2ee43d9f953015ba8b3c42981c4fc
37ceb5af5e9c7d59bd94d34d53b03b6f6d400551
F20110330_AABAWM kaplan_l_Page_103.tif
4ef2a5247ec0cf179b8d0073df43c018
8c3f7876cdaec5fd61822e3ca7818223938c3ff2
F20110330_AABAVZ kaplan_l_Page_082.tif
78445819becab73517ae77af09a11139
9e561acb1e40168f657bfa497cd235736731ac4f
49632 F20110330_AABBCH kaplan_l_Page_091.pro
e84847c4fdaae226dfa600cf0c8e2470
bc3b5eb85228cd6ec2e8de56c26c53febab7aa69
1833 F20110330_AABAXB kaplan_l_Page_004.txt
5860b64a5b2b221699bdeb0ea06320a9
4f045272a115002abe714b193ba05390119d15e8
52687 F20110330_AABBBT kaplan_l_Page_076.pro
2042c4bad257bc7d6177eccd2bec7fbb
a7729b68e9d91f497c2a88d6be027665ba771af0
F20110330_AABAWN kaplan_l_Page_104.tif
de2f7be578d13312f18f5d3f4fce5497
3c92be30c7fda17715d80767cab0134d06f72367
53286 F20110330_AABBCI kaplan_l_Page_093.pro
9fb6d11fcc154da457ada8d0e075a894
6ce7d92b2eb725b4650364006dbd429d5cb5a07c
1834 F20110330_AABAXC kaplan_l_Page_005.txt
2bf1418cb1c45492d2ee1b29af17ca82
b154429bc404f0e2b0127563bc16428a2b22454a
49743 F20110330_AABBBU kaplan_l_Page_077.pro
f307d0aaf294f1c96f54a5b97ce67d76
185275cc37e91379ca87dfea601b217bab2701f5
F20110330_AABAWO kaplan_l_Page_105.tif
2536abadbfa1a3c1a1bbfba7599dd849
15cd248c2735d24740c1eb0abec1aecb3cb5f85b
51120 F20110330_AABBCJ kaplan_l_Page_094.pro
edb74c7e88abd2c3f84da1954d1c3282
9072a19a157b13fa62508915e77a1a839bc74e97
3246 F20110330_AABAXD kaplan_l_Page_006.txt
601d5190a54abaa6e0d2ac57480244dd
3212e26f9fba4a3e4f9ec74fc8174dff4645935d
51967 F20110330_AABBBV kaplan_l_Page_078.pro
0b837a832e52a3263da96349c74ca402
10ddd93f6c584272c31c59996f4022b6c64e4dd1
F20110330_AABAWP kaplan_l_Page_106.tif
be4e9a52ceca94db15f338abcac99679
d2ebc4d0e79c98386300b0969180b4a971654afa
37306 F20110330_AABBCK kaplan_l_Page_096.pro
47cd42444bda157903f11cd69fe25301
a080693dcf906d457ebcf14433196fb1c8e5b731
486 F20110330_AABAXE kaplan_l_Page_010.txt
f9fb62181751dc168f28025c5d54ba1e
ea868983d5fbe88feaf7e6930a25e8f35b49d35c
51432 F20110330_AABBBW kaplan_l_Page_079.pro
4f6b64248358e31d705b1339b093c888
3ed8358b6a15f1f2dd3dca1b9909e634ab13ad7b
F20110330_AABAWQ kaplan_l_Page_107.tif
c3b75c4519ce69a6e8e4004ed7e8d63f
bf44998e41c9a2a8a5aa17654fcbcc572255e3bf
6660 F20110330_AABBDA kaplan_l_Page_003.QC.jpg
04b365d24c49aec0ece257725b36db25
7f528f3e5313bd1928259ce028f7e41ec7949d5a
20350 F20110330_AABBCL kaplan_l_Page_097.pro
00caa870c1349b6fc23d38b7e6539012
29aa62cc5399f479c384011994ed44743eeb3630
545 F20110330_AABAXF kaplan_l_Page_011.txt
b65a28ad53b59727d0874d3811c9b20f
eb7209f90b22187f0a1963d3db36960e6ae2736b
51085 F20110330_AABBBX kaplan_l_Page_080.pro
ec18e38d45f51360389e0c8ae555719e
1aa7777780d2756c4692543bf085406464fb6910
F20110330_AABAWR kaplan_l_Page_111.tif
088bfb63d6ac3106c619f50c8567d338
a18aee92cdf05d1134400fa0b4ba9f8e22e1b5ee
94458 F20110330_AABBDB kaplan_l_Page_004.jpg
e13ada94b04ab764ad26142fcc72f0fb
f1023263eee032c3bc4e7d555394585ff49d571b
1107 F20110330_AABBCM kaplan_l_Page_099.pro
88a1570cb0a44c8cb2587d9791f7bb3d
98fc903a67e13560c19a372bc663ae17896516cb
536 F20110330_AABAXG kaplan_l_Page_013.txt
ad8a418ba56e4d1f92ef7acccc365c20
5977c646556bf65ed502c865cb46552a1bf602bb
41793 F20110330_AABBBY kaplan_l_Page_081.pro
5231d16bdd31d6b1f881b5d44d14b396
fdaf7e053748a87847e5e7e18839d9515fba404b
F20110330_AABAWS kaplan_l_Page_112.tif
2c708182c46c96abb3a6ee2659d41d4a
4d2bf3cc518ca2b1d79ab267540b2242848c8913
31657 F20110330_AABBDC kaplan_l_Page_005.QC.jpg
9c00f805a5b07c82f41b7e4bb63cd349
da7f0f1706f97172dc58eb843f9ef3a547eb9368
52465 F20110330_AABBCN kaplan_l_Page_101.pro
12a267a1642f80fcc10bbe6aae86463f
73c17ce31fb39969ba3e30fadb7fab3590885cef
1840 F20110330_AABAXH kaplan_l_Page_014.txt
b68a8b22debb8f0d10dc513b2f258a01
ae8458bd3ef8e90210d51fe73969eaeb57f6174c
7949 F20110330_AABBBZ kaplan_l_Page_082.pro
b804464a3102cebcc8302cffde621c5c
fa07b2f2039322755c560308b0a3e9f6af304c08
F20110330_AABAWT kaplan_l_Page_113.tif
8be6a1b48c10c5a13e0ebfdf45401662
1b41bba587598854d4db2435210b3cc45e0df250
99653 F20110330_AABBDD kaplan_l_Page_006.jpg
09d20cef7af5170ff12bbf57e4b7fc04
3b48cdf89c94be04edbe75d4559ceb39446c9f63
65762 F20110330_AABBCO kaplan_l_Page_102.pro
d25a23d7b85ddfb76ad49d6cd8b69881
7a8ec138e4161b8bd26b4cee06e91fce96270e33
2020 F20110330_AABAXI kaplan_l_Page_016.txt
680755d4b090cf63a117ff78a148fe0f
1e6b6867f6846411d0d52042aade07d42ad3c2af
F20110330_AABAWU kaplan_l_Page_114.tif
d9195ecf06c5fa89ff0e88d129ded809
407da31d699fe13775d826ce3e35d0d353ac4423
40469 F20110330_AABBDE kaplan_l_Page_008.jpg
2dd87d99b43b375d454412e28c14bce3
9eca830920e716ebc499cc99cb824eb2d966372d
65513 F20110330_AABBCP kaplan_l_Page_104.pro
4c9c4fddcc50326098d314d125278ec3
6aaff2059a0f9e1452bca66a76b665a688cdf92c
2004 F20110330_AABAXJ kaplan_l_Page_017.txt
4ff8b94e39daf3210cfb380a88b557ef
b1b74d625e1cd1aaf683d0feca90507ab1b1afdf
F20110330_AABAWV kaplan_l_Page_115.tif
8beb40060c83a0f57cab3bff08bcc032
75dd8074c563e8cb6b6703afb556c59379e65e37
115370 F20110330_AABBDF kaplan_l_Page_009.jpg
ebc8d40eded9790d1d01064747f2a926
108c466c09cecbbc73398336007ec58e845f5fe2
64893 F20110330_AABBCQ kaplan_l_Page_105.pro
b50811395b2e1be2de03f3ce32fe5555
1929f21b67c8177a56d1ed7d15961fb06fa783d0
1914 F20110330_AABAXK kaplan_l_Page_018.txt
5ba839f4a8016e8304742937111c2e18
df2150b0bd0cc51cf5c7a9a6e00cd8c3e77f94b7
F20110330_AABAWW kaplan_l_Page_116.tif
d67b5b3a4ccc62791aa37e1ac84d57fc
8049c6ba7b6323878114a2bcffa73cdd66817997
32221 F20110330_AABBDG kaplan_l_Page_009.QC.jpg
2cc62455c4d6a5d1d204aba0f6fbe535
e355f7735e955f8af4519f2de5a5de1273681450
59489 F20110330_AABBCR kaplan_l_Page_107.pro
1995a6c0684c97356884b5d95a525369
3a6a908b60cc92955b3efe2dc57d9cc2175a9775
2013 F20110330_AABAXL kaplan_l_Page_020.txt
2a72c304cb88316aa68b8ceac7718f38
f663aef634ea7387f370b62ec5bce48b656d74b9
F20110330_AABAWX kaplan_l_Page_117.tif
9843ced51f468868bc4365ad75b0e8ca
336a26f203dedf5f8434b207b7e0614861605bec
31404 F20110330_AABBDH kaplan_l_Page_010.jpg
bd5f4115b619ac5f78308c706e737c38
02736e9cba67a88b3bbd852974954ec7bd55651a
1917 F20110330_AABAYA kaplan_l_Page_041.txt
cd07cd9c3ca14681d3ac0fd1ec6ac28f
cf731c67b1013d571530532e99343cb0127382a8
67842 F20110330_AABBCS kaplan_l_Page_108.pro
88a04e69fadb600215ec1c7ea60c9cbe
ca5ba312da34b6033489d3fc0b70013f1a7bbf9a
2077 F20110330_AABAXM kaplan_l_Page_021.txt
933593151725b09ceb484c54d580dcd7
4463e25ccf82732c7dd845a95ec0d91faa3997f2
454 F20110330_AABAWY kaplan_l_Page_001.txt
90b035961471701f9012d96183f70820
d12d96ee2f7d295016a0d688ef211b1b3d51a467
1184 F20110330_AABAYB kaplan_l_Page_042.txt
5c22e67a5c7fcc872f9fe1c07c2f4729
60e6f1abd5038b6155311328a28391a55f4519da
65242 F20110330_AABBCT kaplan_l_Page_109.pro
24c66229c872a0dc0b27ec01eedac8ad
5bf2baddc97e0030b64cae3510714c30bb5e7f4a
1940 F20110330_AABAXN kaplan_l_Page_023.txt
bf715c1ead9e17c5283224fa8d0be136
707c48db02f01896662c7623810fed834c87dee4
106 F20110330_AABAWZ kaplan_l_Page_002.txt
4b4a0ee095c5ba32f1b04acbb651cf4a
bf5dde9edc3ef4b6c0d3b74eed69c106466f69c2
1509 F20110330_AABAYC kaplan_l_Page_044.txt
f5c3ddfbef9c7aa63ed86248f5f1dfd0
91474406ac53a866c56705fe2e4e4b3815052799
69265 F20110330_AABBCU kaplan_l_Page_110.pro
f844608231b170157b5e9c97d34d5c65
d5fb4e2b3b786828d14c2d3d38f30ea1c94bef71
2037 F20110330_AABAXO kaplan_l_Page_024.txt
03253efdcc28864db1234e260d35f7ae
36df4a8397d0839cacd4603acd6676f7bd088a8c
9351 F20110330_AABBDI kaplan_l_Page_010.QC.jpg
5a11a65c02908012866fcf59dd573154
2ee190a4dddd671ee6c41dc7718e6cabdb1f3102
978 F20110330_AABAYD kaplan_l_Page_045.txt
a3285ddfdd723583f7cec27458677bbf
23ca977a47f55443a2b1cc47cd0e15397b8aa2c4
58761 F20110330_AABBCV kaplan_l_Page_111.pro
a52c781be6f6141dfd530b17e5785f46
535a4998c0711f665a5e0f57cb76652befd0e4f7
1832 F20110330_AABAXP kaplan_l_Page_026.txt
d9fff28e38e54c6d105a94fd331b275e
dd475142295b6be5fa59048a0ae0d1975b0ee973
7243 F20110330_AABBDJ kaplan_l_Page_011.QC.jpg
1f00cf05e0f8dc98346edc789ea9b28d
37c72cadc8842c24c27d5f636a67406938e4c0f1
2034 F20110330_AABAYE kaplan_l_Page_047.txt
32f1d80398ae2bf6134ea0bac8ed9daa
bfa5687f55081880f37942c54166ea407e819d46
63080 F20110330_AABBCW kaplan_l_Page_114.pro
3012eeeaeb16f0d51dd26a42d6667fb6
9832432bc25f23a7749b82b1d0c3d256ea39f6c6
1851 F20110330_AABAXQ kaplan_l_Page_028.txt
b19de5d8be4e5e330ca18a6a3dfd392a
2120fc5b92cf9319486169a7491b5285e6a601a4
29653 F20110330_AABBDK kaplan_l_Page_013.jpg
0cdef7510d89027cf8a410494260094b
9c0bf0a8af070f4ae5144158345ffb20a632033d
2047 F20110330_AABAYF kaplan_l_Page_048.txt
224038c5ff6893605fdc98f146ef9cea
9138fcdc3dcbfe15ca1104a3eca5927af58bffc5
60247 F20110330_AABBCX kaplan_l_Page_115.pro
633cc399d7715197d8ff2057b2741385
6c674362dff2611b966565058316ce9c07d78bca
2024 F20110330_AABAXR kaplan_l_Page_029.txt
26554ae06da5924da25f1c93a04b005d
5eead7de754964fdaac18a6d410833f93d335964
95974 F20110330_AABBEA kaplan_l_Page_026.jpg
66f00d9d0f263ce049d886040fd524d5
3a774f59d14baa8d4354c246a52860cea74bd297
10104 F20110330_AABBDL kaplan_l_Page_013.QC.jpg
98c2aaf2aed252bf58f2a012fa384a51
4b6303235ac1ce5ed57e53e0fde5eedde811e4ea
1888 F20110330_AABAYG kaplan_l_Page_050.txt
6df020b9ff1ee8fd804a3105f4a24bbc
d0b36fd6e3831056592fe4c34ec430b01eafeb11
25012 F20110330_AABBCY kaplan_l_Page_001.jpg
7e02f7cc1a1caebf09d6c9a828561135
2aa16e3f56f48742c1e30ccc992c154546198ecd
1994 F20110330_AABAXS kaplan_l_Page_030.txt
89f04cb5e9b2460803c04882cb72337e
2e13b46162dd5e88997161e348ff3eadb8f98858
97043 F20110330_AABBEB kaplan_l_Page_028.jpg
f6d4c75db645083b092b6d20548f58c2
36d66bfa4599e512e0e5bb1071f852578281addb
94229 F20110330_AABBDM kaplan_l_Page_014.jpg
67423bca3a2f7bbee1bfc64b6c0d738a
870b767d211ae457c22be4ac633297ec6d1e9579
1954 F20110330_AABAYH kaplan_l_Page_052.txt
53c62594fd9417b424849339b56ac372
ac7743cb8bb39cfeb3bcda2209f816de3a6b8a58
7750 F20110330_AABBCZ kaplan_l_Page_001.QC.jpg
df41c40b11318f3339260a6da38400a5
b1cc3422113379042149bbed5b179a8a1308ead1
1379 F20110330_AABAXT kaplan_l_Page_031.txt
10e6b61b90466f2922ba8b11e3c26fb0
203657776816ab1dd29c1af1b1d3077b6935f97d
32629 F20110330_AABBEC kaplan_l_Page_028.QC.jpg
f12d3dfa99aaae0336d86987950a82f4
05f0483266ff114ce800ff23144419ea41375c09
30355 F20110330_AABBDN kaplan_l_Page_014.QC.jpg
21923fbe345e1e68a624dd293186dc36
024f9ffb39705b6097e4fdfe9c15aa1a436b2a58
233 F20110330_AABAYI kaplan_l_Page_053.txt
69bc337bf59aaf80bff49d0448d9853e
5c25a57d5a3f98ca6c8adbde3a3cfdd9093c01af
1452 F20110330_AABAXU kaplan_l_Page_032.txt
8aa5b737bde8664ba2cc2f323132f20f
237d6fd314dfd56449c2effc6c928b10da85d843
34475 F20110330_AABBED kaplan_l_Page_029.QC.jpg
454f263cd297a464f4cd506e9830fd5f
75e6207684076ef5db54348c5cb25c29981a6d51
99985 F20110330_AABBDO kaplan_l_Page_015.jpg
e0819aa57cfaa2723bb54dd1a60be2ef
aad7904b055baa232ea1216645362d7c097fdde2
F20110330_AABAYJ kaplan_l_Page_055.txt
b71a969abcda4f8dca74fa20b69bf33a
338a0492acc6ca24e0c67f62675c205f1dc3e97a
1983 F20110330_AABAXV kaplan_l_Page_035.txt
3e90c5ed26b9120235c64441d7afcce2
52d8087e9b99e1f14a7eb4a3c24f388ba609b946
104884 F20110330_AABBEE kaplan_l_Page_030.jpg
74514ad7f68e83f8cbd9fb40dcd7b811
f2a5da8e2fe33283e0d83d9b9b5e1e791c1aa1c0
32260 F20110330_AABBDP kaplan_l_Page_015.QC.jpg
0e015519e0d8646a9b803968644b3f6c
646efd3a7601f1bd184e7a7ebff56fce11ab81f2
1945 F20110330_AABAYK kaplan_l_Page_060.txt
b870be926fe9506f2899aa840c762680
497d60d469d0031ebd3cefc80c29b05a47a74a38
1883 F20110330_AABAXW kaplan_l_Page_036.txt
20e204bca6d0b647fd02483e9d7370b2
7f16e7e2b5fe4e7814d1b7c60efa51565bbf5e0d
33684 F20110330_AABBEF kaplan_l_Page_030.QC.jpg
e5f908615944b17c0f8c922c8890efb9
044b761b1cdf2a43f84a78add767690958b26c2e
33364 F20110330_AABBDQ kaplan_l_Page_016.QC.jpg
033cfcad626b7dc3b4aa2e0aa210bb9a
37f0852726bebce95b3f09c44e183ff8409f3f71
871 F20110330_AABAYL kaplan_l_Page_063.txt
118efaaf795885a348aa89dac9aa2027
d9bdd2aba5e6739850d3b984c68b8cc6b9b25469
1964 F20110330_AABAXX kaplan_l_Page_038.txt
0abb79588a61f95e968381438058d26e
3d90a831a4fa86635e73c7437d1b130a68a49e82
23784 F20110330_AABBEG kaplan_l_Page_031.QC.jpg
89126d719dc41b558aa8015b10244f26
790d2f0b84f9dee4a8d0ba95632a808559e8c2c4
101859 F20110330_AABBDR kaplan_l_Page_017.jpg
d2bfc15e16fe4ab99ce6d720a801ca0b
7bd767350a6eb2fab6faf1dd343d9c61ecea8e3a
3007 F20110330_AABAYM kaplan_l_Page_064.txt
984564f4e5f31b766da56903f4f8ea86
74fdbfc36e6f5ad20f66168c491afa9297d0faa8
1915 F20110330_AABAXY kaplan_l_Page_039.txt
5cc031cb4a02341578d4ae1cbdab55c0
5d2aefc23cbb3b4f7b3f419033db9df731505592
24005 F20110330_AABBEH kaplan_l_Page_032.QC.jpg
16477abebe5ed2531b14463671ef7efb
88f1bda0fb0b801ecc0027feffd1666111e2e2f5
1642 F20110330_AABAZA kaplan_l_Page_084.txt
67fc356598dee681eaa086fd1051a008
4c968717cbf40700a45e003a00005fa2a39b37d6
100793 F20110330_AABBDS kaplan_l_Page_018.jpg
46983f511314725843f9365fa6ec3e5d
c7250009b8c126d2376b09bdf7ce41456ee6dad9
483 F20110330_AABAYN kaplan_l_Page_065.txt
a1965a0934746b1e5185d5b11cb32fa8
7c34157423a177e82f4c6944a500238a3844471b
1962 F20110330_AABAXZ kaplan_l_Page_040.txt
9eb563d3c710da773ef9abe8068e49e1
968799e6a68c86fe0b55af99b43afc818138bd95
99075 F20110330_AABBEI kaplan_l_Page_033.jpg
27531cba069ffdca7f5929114db72ca2
18005c9e790dba87354a2ee8801f0a5457dad996
622 F20110330_AABAZB kaplan_l_Page_085.txt
31778d4acbe70ef00a9a0942c2f6a862
250bc13c826bef4d5312965c349daeaeb29407a6
32832 F20110330_AABBDT kaplan_l_Page_019.QC.jpg
15c4aed2247d63d5fa91d53f902d2f65
3bfe1c4d58914a4c3989cd18b8cc986f24920955
1838 F20110330_AABAYO kaplan_l_Page_068.txt
f11f354b5636d1f38d18446a0d4ca06d
159825803078cf740597c704da9dc1f62596d9c1
164 F20110330_AABAZC kaplan_l_Page_086.txt
2879d35ab5ae17ec885229e7d663f189
73c6d867f0040ee7427becee472fad219ee986a2
104790 F20110330_AABBDU kaplan_l_Page_020.jpg
f0e5bc6a5d4b5b1dfb584ec1d903ae9b
59cb6d75d1ae9f0d0e306f03f444c41488536c36
2058 F20110330_AABAYP kaplan_l_Page_069.txt
e59821b1edbfc41a94ecc5d99547c921
e20d5be21dfbe08d0bf73326f8c5353b22b7e2a6
32959 F20110330_AABBEJ kaplan_l_Page_033.QC.jpg
16949f4893260031c789915250cb9b3f
57d3126df0c3a2e3aa5af2d007610ae6dce56dc6
663 F20110330_AABAZD kaplan_l_Page_087.txt
89a287270974ac94d720546ce046d686
6712d1e9ecec929d33f1bc4210c2475d67aeaa3c
108817 F20110330_AABBDV kaplan_l_Page_021.jpg
2a1f2ff39f8cc7357c68924bc664f156
9eb846479c770c3de32383382bc3e80cc8deedd3
2010 F20110330_AABAYQ kaplan_l_Page_070.txt
89aa87a1adb0fd656af90b7b69b5a56e
65a85dd4d98c539a4b31cbf3ebbae6f5ebd18931
33256 F20110330_AABBEK kaplan_l_Page_034.QC.jpg
037ca0a3f4767672217103511ee025c5
e8f6115bbecc446e1db4ec706af95efe028f40b9
472 F20110330_AABAZE kaplan_l_Page_089.txt
9064bb0683b40d245a4c58273cada7a9
475495d46bd1aad53db51922256ead89ebe63ca2
35681 F20110330_AABBDW kaplan_l_Page_021.QC.jpg
4c670db841b7c8e9a53df1567f3890d4
b5d6b3c17627e0336ef1abaaa5b9d968b21f674f
2589 F20110330_AABAYR kaplan_l_Page_073.txt
9050a33821727cf4bc87a21c20a10c46
78dbaf04952148a771dec25f668e6f7bfd4b5902
86151 F20110330_AABBFA kaplan_l_Page_046.jpg
47242b51a68d495590ee0ec88288f5ec
51d20a5da539cf6deadb005c8d7950adfc027072
104116 F20110330_AABBEL kaplan_l_Page_035.jpg
fb2b0f06181a787cade3b5209cfa1f9b
2cae213e566033069020a006830992183e410cd1
2082 F20110330_AABAZF kaplan_l_Page_093.txt
dd68773dc6c5ab59e4a4a44a2dcaccb9
e381d6655c5d262efe89edf77711995c4a89b1af
33398 F20110330_AABBDX kaplan_l_Page_022.QC.jpg
13d2b80f42bcff6ce29e15b506455a70
daacdf097fa2235199e78cac11df1f31917327aa
655 F20110330_AABAYS kaplan_l_Page_074.txt
56b5e1fa7234e86a0d7a5761e2b20652
d610e61c085dce30d4baf1ec2224bb16abaf0e63
33781 F20110330_AABBFB kaplan_l_Page_047.QC.jpg
66ecde1395a06c5aedeb53a116bc86a7
61d6bc19b24e62e67a58f237c32137f4620bbe5c
33462 F20110330_AABBEM kaplan_l_Page_035.QC.jpg
a0e9317a69c6f3686153e241f6417982
19ccb269a3b672484438e581977426388099f64e
F20110330_AABAZG kaplan_l_Page_094.txt
5984d538dec82980a4820dcf9ca8b68e
89adbf3630d9866f0b0bd2785e2172eb1fa8c76e
100781 F20110330_AABBDY kaplan_l_Page_023.jpg
beba02baa12affda2ef97cbd2c918ad7
199e5513839d90d5eab81408110b263c3519ec60
2066 F20110330_AABAYT kaplan_l_Page_076.txt
9b59eb4ce222948524acade41a7f91d7
f39cf8645a502d2d804cd1b021241f4017f85172
34238 F20110330_AABBFC kaplan_l_Page_048.QC.jpg
4402d2c3dd1821d645494debbb893a16
f97f0f427c3d38928c1fdb66013fd07a9a8c574a
34192 F20110330_AABBEN kaplan_l_Page_037.QC.jpg
7e9ee2efa4153bae5350bc8b069469ba
465f140fdb5ddcc2c08cd82dc4ada687275641a0
2068 F20110330_AABAZH kaplan_l_Page_095.txt
5bb0f11bf699ad196f53f929f120b9c3
61e95bc28ba7f26c95ccf319ea917ba9377279de
32299 F20110330_AABBDZ kaplan_l_Page_023.QC.jpg
1fe3bec671fb72d6d1f8004884998814
f5781a108bd6e2e0b942f0e30a4febf9a256d381
F20110330_AABAYU kaplan_l_Page_077.txt
3f17c969086eb145d2fef966867453fd
4e03e1220da899c61c3a50a567db36e753400031
31805 F20110330_AABBFD kaplan_l_Page_049.QC.jpg
42fd444f52a30ea5faa7227eef841d2e
a6c1bf2cf3d8a2de57bd81281419bba8be2f21f0
34915 F20110330_AABBEO kaplan_l_Page_038.QC.jpg
be0dacce0d5fe1bf2fff79b36f77ab6b
55782b2dcaad80c2d48b706685ad2f89784c76f0
1526 F20110330_AABAZI kaplan_l_Page_096.txt
31c8c4c14f81df9247e02b6e7ffbe284
da68281cefeec0d28e2e86082d067c32d55cc5c5
2072 F20110330_AABAYV kaplan_l_Page_078.txt
00d29498a919b5b1225662a45fbf11b1
1c1eb176648ca92547a14702e7035e9b817af415
98190 F20110330_AABBFE kaplan_l_Page_050.jpg
85d540587a9278b59d6b08df3b78ca54
8875edc3c919f008e3b6e7e818623d5d863d46ae
100208 F20110330_AABBEP kaplan_l_Page_039.jpg
db033ce9a0bb29911c534d535869a5da
cc1018965d6064c7ab2bdc39d931173defa468be
2466 F20110330_AABAZJ kaplan_l_Page_100.txt
71a174b46761238fdf70ec3a62227d16
85f0b73fb79b5eaa973f8651f24225c1cb281ead
2018 F20110330_AABAYW kaplan_l_Page_079.txt
f69396c5a02409b8b93c561c9e74209b
00a0622d80ccafa0609310fb2a871fdcc0ff085b
32074 F20110330_AABBFF kaplan_l_Page_050.QC.jpg
8b178413e73c13b8b4391f629118d9a6
38db4b9e6f734bc7926e46dc62aed30fe5d71f80
33036 F20110330_AABBEQ kaplan_l_Page_039.QC.jpg
72ac0aeb17f790d1d9db465c4c07a5e9
7bca17eb7c8049c7a47b69f4910f3d2719c78aa4
2137 F20110330_AABAZK kaplan_l_Page_101.txt
5d2c156ffe8196fa57ef3d37a86cddb7
277e3b23fe4529f7c4bdfee65894c34d055e3a10
1657 F20110330_AABAYX kaplan_l_Page_081.txt
7c39947f36a6092811ad9110e809a029
55a3ae6815f149ec36a9ae536bf7ac102648d059
36386 F20110330_AABBFG kaplan_l_Page_051.QC.jpg
1c69fceebff7891207c17126578a3990
5776a4bb10bacabbdcc72251c10892809ec576e7
34014 F20110330_AABBER kaplan_l_Page_040.QC.jpg
3c1c1a73ab42ca7305c09d13d62d20eb
3e4d635d087d8614d5cb5af6af969c0b86b012b3
2680 F20110330_AABAZL kaplan_l_Page_102.txt
1d92f142f06cbb710a78b206b8d626f3
9ca3349d12109c57fc385cc1c132e0d4a265af73
398 F20110330_AABAYY kaplan_l_Page_082.txt
db7d2962ab52466a92f380ae041b8fd6
f8e1d24c236c36d471d511eaf391c8d4e0612caa
32977 F20110330_AABBFH kaplan_l_Page_052.QC.jpg
2772589ccc16cb6278d7381fe0c4c6aa
0b4c2fe619b5195788be53051e4ad5e326135f57
100302 F20110330_AABBES kaplan_l_Page_041.jpg
a99953830caefe901540d24824f3428b
ffe0a421e6054df0b2fdc7bb167dc14a4ce11628
2530 F20110330_AABAZM kaplan_l_Page_103.txt
5c997796e7f00be3f90d31a26ca94340
915abbd380173bf89ca0882c7c18a3d2697661a3
451 F20110330_AABAYZ kaplan_l_Page_083.txt
90d4628d979a3bfeace6f88a5a687328
fe30d976db02ef6d4960c4bd3777d25ebcb14757
12340 F20110330_AABBFI kaplan_l_Page_053.jpg
6c10f8cde872fc654f440ef76c60c0f7
07a45a04d3e4bb0a4e9a4b6bae309a9657fc1bb1
33754 F20110330_AABBET kaplan_l_Page_041.QC.jpg
c0559157e5480218bebe34296387cd8e
92e130d386d0789b3c9cf9e57d87252de22fe042
2575 F20110330_AABAZN kaplan_l_Page_106.txt
bb4daa81926254a9d549a78687688220
bcd0053e86aacb7de7d3f99b91825b5d57a090c1
104180 F20110330_AABBFJ kaplan_l_Page_055.jpg
89dd36ed4c04fedd5cd34804d512b044
948bb1eee369167439346694c6eca5dc49050d10
53124 F20110330_AABBEU kaplan_l_Page_043.jpg
6e88f93890d990ba1d908d5e73aaf3bf
5bad1b554c929be25dfd9201d17a5f138a1e9d93
2432 F20110330_AABAZO kaplan_l_Page_107.txt
06d0957a5c216c6a6ce240b3adb07508
6575a9e2cbf43366ea0b43238b402a84b7119483
15651 F20110330_AABBEV kaplan_l_Page_043.QC.jpg
a82d9239c3470bc369385d2ec104fd19
5c25e263d61197f321b0c9df8d605c6338f13547
2737 F20110330_AABAZP kaplan_l_Page_108.txt
5c96c5e38417b8dda149544ddee69b7d
bf29a6010a48df8340623c69ddc6d636afda5844
33706 F20110330_AABBFK kaplan_l_Page_055.QC.jpg
de201bf4ce02d6afe482576a8423ca93
1f028ab5fbcde2a4930e589906aeda68a9433600
39977 F20110330_AABBEW kaplan_l_Page_044.jpg
ce6913dbb066fcdf34357b32bfcee93f
f5164f62743bf2aadfbdf86b72caafb5dec24ce1
2642 F20110330_AABAZQ kaplan_l_Page_109.txt
81414dc80e79d24101c4d57a3887243e
96f7eb054782da5b2ebaee499fd00c164b5747a4
106099 F20110330_AABBFL kaplan_l_Page_056.jpg
c25f11ec2ad1935b5acb88720d470655
27fc6a7808556ecf2ec02ee207f91427ca8c986d
12473 F20110330_AABBEX kaplan_l_Page_044.QC.jpg
24bdd80f292d01d8c0d4660dea3d70b7
0dc9d9eece596c9281700305dc67bb8562da69e2
2696 F20110330_AABAZR kaplan_l_Page_112.txt
435d680e6bb9c3ca76af9083a6102c7a
a2205f79f38b7dff45cf22717bd574464b7c540b
35234 F20110330_AABBGA kaplan_l_Page_069.QC.jpg
ef7c8738352b6b720cba857e41e81d98
2f2660dbc71cde2c6f46a21510fbeb98cdab51b0
32806 F20110330_AABBFM kaplan_l_Page_057.QC.jpg
3cdf233824eaa3a9a9ea3d5aa2f6aa02
3af8e4ae7e4a1f20debb70f261c5286ca23445a7
31228 F20110330_AABBEY kaplan_l_Page_045.jpg
4d3e059ea1e73a4027007cc4839ab266
d16a1782d1d3bbf9879e99b917a4794d592f59c9
2480 F20110330_AABAZS kaplan_l_Page_113.txt
8bfbdcea1b590600bc87c3aae968c946
007c196ca56274f610549901fde77edce9ea8917
32417 F20110330_AABBGB kaplan_l_Page_070.QC.jpg
adf02ac6581c420b7afbb3bb0f552811
0a7d3417b534fd26fe23659613f015a4e8b2ec36
100222 F20110330_AABBFN kaplan_l_Page_059.jpg
62c9850dea31a800ddc84f1d327af8be
3f21353a50f50694b423e409def020ef51d6fe80
8312 F20110330_AABBEZ kaplan_l_Page_045.QC.jpg
dee7a2f8116cfd673b6b52d4b2e4fca1
9c3aa37c1c4d99ab409980f6efcf512ea1a5d31b
F20110330_AABAZT kaplan_l_Page_115.txt
e2787c0cd738537532554d5490dee299
a979115e41e898e343e341380256223a60f6a0c2
107534 F20110330_AABBGC kaplan_l_Page_071.jpg
d6f9569541c4697bd2fcb54b8d125241
5ee3fa1c2b1013dbbf24adad67ec44dcec478193
102252 F20110330_AABBFO kaplan_l_Page_060.jpg
21d9492a7da3a6ee4b5c390c182bb63e
5e5d0c57584b012721cffb84b46c17cb4c27de44
1032 F20110330_AABAZU kaplan_l_Page_116.txt
82592fac63a5bdd0e521f3c25df134f7
0110dedcc2817cc671ad8664d8e92ed5ab5f78cb
34884 F20110330_AABBGD kaplan_l_Page_071.QC.jpg
ed541e489502817edfdae097827511e7
056bb4137273c1430e89426e7de7197800e260e5
32843 F20110330_AABBFP kaplan_l_Page_060.QC.jpg
89003691c8b087f076c207a4e5d0b2e3
f891589b5717b5b9cfef859b8cd39fc83b0463e2
901 F20110330_AABAZV kaplan_l_Page_117.txt
8ffc9fb89c0bf024c9f24eaf242edab2
a5b2040901ad3c8ff6c86ede1e804715c354a5ba
47906 F20110330_AABBGE kaplan_l_Page_072.jpg
5c414339f24f8ec0183436b6d3aae029
ec7afc6097e2afdbb6687ed08690460867655dca
13049 F20110330_AABBFQ kaplan_l_Page_061.QC.jpg
2214aa78965dfc69cb47008555457468
ca6fc4645c36b015ba8643a386cedc5ba7412a08
1044 F20110330_AABAZW kaplan_l_Page_002.pro
fd90f6854f8e3ca48976a3c7080ac0c9
18c7e60200f6d450dfca0cd6cfcf15d2d04479a1
15637 F20110330_AABBGF kaplan_l_Page_072.QC.jpg
5cbf9f153d924e0594bced05ef9dcb2a
070e28814e9e021a27c57d356cd65bd803ec7857
76227 F20110330_AABBFR kaplan_l_Page_062.jpg
e083874972dcc2e798f83541371d29fd
d18981f3bdd69c617f91f5c16081c2b37fcd3e4e
46365 F20110330_AABAZX kaplan_l_Page_005.pro
110050df9e4d2ee49b8742e1633c112f
f464bd0c13469dee6d7abe5599d91c9027db2055
15546 F20110330_AABBGG kaplan_l_Page_073.QC.jpg
5ce253af6048610eff687f73d086c4af
093b7a49a8f816a6f376a285e0fc0f3c4897a6b1
21236 F20110330_AABBFS kaplan_l_Page_062.QC.jpg
ec3a5fa0f5b5bb57ec940f0762d74747
3c511faab3ed76e9aae003aeef7b64c39961f41d
30300 F20110330_AABAZY kaplan_l_Page_008.pro
3a81406eeeb255ad365f9982d562f156
6ff65aca6ffd7ccef30fd06e5bcf0fee264ff636
42630 F20110330_AABBGH kaplan_l_Page_074.jpg
57703f7780ce922e46258dbfe8c80371
7e58d2249aea4a5c5f8c942dbd153114a147ffb1
10126 F20110330_AABBFT kaplan_l_Page_063.QC.jpg
47a980de0409016312b7867669778457
f7774092cb7eeec69a5fcf4a0163bca494bb8472
12150 F20110330_AABAZZ kaplan_l_Page_010.pro
0464f03f7d23bf8c9ac322c9c28d5ad8
5695782d52eb7dcc5fdcacde76610aea143f0b59
106733 F20110330_AABBGI kaplan_l_Page_076.jpg
d0893bd5f1fba743f2f73c40b2f7ad37
b2f3b5036cbc428d2109891b69b68f1e12d11a56
97200 F20110330_AABBFU kaplan_l_Page_064.jpg
35e3fa0c366ead14431971aebdff0fa1
7e01c967982b7fd95cd2984d3473391b0d4dd32d
34510 F20110330_AABBGJ kaplan_l_Page_076.QC.jpg
73dcc7b81e609f3ce8e7d8a524594a94
e101a5c362afbe884c521a9e3f9db9666581c6f3
27308 F20110330_AABBFV kaplan_l_Page_064.QC.jpg
99f33e8338d25c5f54c4d413631275f1
2681623a148acdaaea38439be294a036729a62fb
102438 F20110330_AABBGK kaplan_l_Page_077.jpg
bc9c445460b379272d5be65d5d8b6c2e
1c5881d81a79e05405c868e1ee14bc2b48792adc
28498 F20110330_AABBFW kaplan_l_Page_065.jpg
d8ec393cc6c757361f9096fe8777a404
b12e1424de1ff44381ccce08f918300398d0d777
12735 F20110330_AABBFX kaplan_l_Page_066.QC.jpg
c3751509387bacc0430e4d7390080bb1
8821770c9e046b890cb139abe15e322520fb7ed0
35661 F20110330_AABBHA kaplan_l_Page_089.jpg
91822e84aed6c157a9f2c165d5d48cef
b66a053053d69845c780437b5c2b395803b225e5
105953 F20110330_AABBGL kaplan_l_Page_078.jpg
f27f662f52137efaa930f75e54c36ba7
82fad25bd9e59d55b5189e0bd9a05a9ebac4aadc
14282 F20110330_AABBFY kaplan_l_Page_067.QC.jpg
3324465a66b93be29f87f2277ce82369
2ccc0c2d298e8e01a3eba74dcb156406f6b8eea3
92123 F20110330_AABBHB kaplan_l_Page_092.jpg
8301eb04a65ea457748dbf4765820da3
933a5b90d1e4704b824684b7cde3bdfbfe8fcdd2
35210 F20110330_AABBGM kaplan_l_Page_078.QC.jpg
98e555b7757ef1fee8b11e9096a3f2bf
405352d2184e2b6e3940c82c306882dd132ccc1f
95464 F20110330_AABBFZ kaplan_l_Page_068.jpg
3699e0b5e052fba1349b4d3157b798f9
3cc56432bcc7cc8d09f6314608a1d9f62570108a
106936 F20110330_AABBHC kaplan_l_Page_093.jpg
faace6c6242f3fc4f1fb1582671345ab
ad6121b92e8d0e23b1bfd513631ee8f46cf1dcc7
103545 F20110330_AABBGN kaplan_l_Page_080.jpg
261fa053abefbeb6359d6fafa7fd5634
9f5cebfb3ca99bc9f84f90e3c74e865762ce25a0
35182 F20110330_AABBHD kaplan_l_Page_093.QC.jpg
14e10d1316a843a6528b2d6b8f3146e3
5891a94702dadf0be8618aef7eb8beb786022f64
34328 F20110330_AABBGO kaplan_l_Page_080.QC.jpg
ff9b49ff387c05b1ca2268d0af8c3911
4467d619aabab89ebebda70ac5c4400d0219b174
103303 F20110330_AABBHE kaplan_l_Page_094.jpg
0207ad9cbd73cd3daea958b352fc9cc6
e6c0aefc987c3a8af9852ad61530c865964213a6
86671 F20110330_AABBGP kaplan_l_Page_081.jpg
e5cf96a8db03d2a828402935cc6cfe61
2501dd5010c12014d2db0c60bf22d7feedc1c534
33626 F20110330_AABBHF kaplan_l_Page_094.QC.jpg
45f9cfa643fdff451aaa663b3dff71c5
04b5cd0116105c32c977a5abb6b19165b0c68796
52650 F20110330_AABBGQ kaplan_l_Page_082.jpg
1fdb01c816308027a48e156e4ccb03cd
a19153e0f936cef37e257feff714507ead74c83b
102826 F20110330_AABBHG kaplan_l_Page_095.jpg
adbbb9f4677714726e884f87e0979801
2a832455451ee480262aaf6346b98f36373ad8cb
61170 F20110330_AABBGR kaplan_l_Page_083.jpg
2ed17eb63bdd71997084acfaa778d50c
61bfc6706322e91b53a0d4d5a8cea39672e1b7e3
33302 F20110330_AABBHH kaplan_l_Page_095.QC.jpg
6bce1b84cc87d2cf48bac49c6d5fbb57
f1a0db64e9ee2b2aa01e27c2f67bd356bb6bb0c5
21046 F20110330_AABBGS kaplan_l_Page_083.QC.jpg
65aaac4bb9988971265e3b9708ee656f
6d6848f7e6bd9f485b8a0f62e96392308626452b
24966 F20110330_AABBHI kaplan_l_Page_096.QC.jpg
6f05aeb142e91dbeb93da8d959a51613
816e14aba650fee5581115746d035533c5f0c467
57713 F20110330_AABBGT kaplan_l_Page_085.jpg
680e099be7862f8d17010a8f0dbc7791
3731c4b19a4aef51f37e2a11285ea4cc9d8f75aa
11217 F20110330_AABBHJ kaplan_l_Page_097.QC.jpg
6da5e2abbec1e3c1cef48075a0638dc7
1488070abcabb3ad3e3269ccb234e46141755310
16606 F20110330_AABBGU kaplan_l_Page_085.QC.jpg
2c087eed9bb8599bff8f2cf8dcee5ce8
9337f4819918c622be3bc0bec6e7bdeb00bcdad0
22871 F20110330_AABBHK kaplan_l_Page_098.jpg
88702314718011190333590a2c3f402e
912e8bfd22748c60605338ffbb01c58c4b0f2836
25690 F20110330_AABBGV kaplan_l_Page_086.jpg
4ff5926eebdce35b6cd1a685a3b614ef
8aaa5183af31b616c64e7649a26d2cd8c437d788
64324 F20110330_AABBHL kaplan_l_Page_100.jpg
15e498b0e5916155ea45cc0990d1872d
59482f8f1bd005302394d433f24c4e2a28a61911
60116 F20110330_AABBGW kaplan_l_Page_087.jpg
7b50a0022bda9941dc49ec5f9ac5f42b
e720dc90bf2caee532e2396f3ba65fdd358486df
34260 F20110330_AABBIA kaplan_l_Page_113.QC.jpg
24cec05db6cb639ae67f101513c290a5
7efe5c4079c5e4bfb80b0a13813418732124fab6
17703 F20110330_AABBGX kaplan_l_Page_087.QC.jpg
1a4c91be712dd1bb9375a45293c0aae1
074af662f8cf5753fb401dd1660e7c5416987ef9
35312 F20110330_AABBIB kaplan_l_Page_114.QC.jpg
2c2efbce9c86dff1c6d45842da0bfd0d
51603bae785a65f24b94291a4f980104f9306153
104167 F20110330_AABBHM kaplan_l_Page_101.jpg
1eb55bf7d9325fd73b9c47f8fa15e6c0
b3585d40fa910e3f7162a9b09d9552925e4bd4b2
66682 F20110330_AABBGY kaplan_l_Page_088.jpg
52ef3898c57924f6db4324c0342cd948
f3bef0d2c05011e2f2ac9f10095fa95b6ba35986
53691 F20110330_AABBIC kaplan_l_Page_116.jpg
185bf6d48d0ab8569dd5077f177954a1
c26b42ed11ee3d45ea6694520664059e1096d124
29338 F20110330_AABBHN kaplan_l_Page_101.QC.jpg
2e4f384cb541df37b4492437578b7911
3d8c4a12af4f70af59c68e7bac71730e08e4ec9f
19921 F20110330_AABBGZ kaplan_l_Page_088.QC.jpg
7c63b6491a5afa991ed91224b87f43a2
2049ac96df2c6102f40f763d34bf3d9b95020e83
15456 F20110330_AABBID kaplan_l_Page_116.QC.jpg
159aebdc7688812091cc29b20545af1d
c12ffc1797398dde15a93c228c935b870149a115
127453 F20110330_AABBHO kaplan_l_Page_102.jpg
72f05d54c06cfa6a5f922e93ee2be7e9
109af8301bbe88999612c0ccbabec201e37ffc4c
47270 F20110330_AABBIE kaplan_l_Page_117.jpg
b9798f6ab80aafbabf7e893430072ab6
b846194b1f95f1f5ee0c6af64ad903589c842e01
35211 F20110330_AABBHP kaplan_l_Page_103.QC.jpg
4113527a995f87823d8daae232b199ab
edd83a4479c7ee1df854337d070e53aea4f2acf1
22890 F20110330_AABBIF kaplan_l_Page_001.jp2
e4f025fedc9aa7a4a11dc7d4e954bcae
06ec52019ae62c76adf1f7c8980d6b2692d8d729
132922 F20110330_AABBHQ kaplan_l_Page_104.jpg
7bfa677312d68b967343784317d4754c
5b43fbea88d4aabe62c2e7b73a8cd1d80641894b
36045 F20110330_AABBHR kaplan_l_Page_106.QC.jpg
eac7497cb1c980c6dd8ab81c6c56bce9
5791ab55f2b0c1dcef8d4fdb023a47df1b8268b6
25827 F20110330_AABBIG kaplan_l_Page_003.jp2
3379622bf055aed14be762778220fbce
5074f48b1aa879254f32d09877dd84ba357aea41
119099 F20110330_AABBHS kaplan_l_Page_107.jpg
ecb1e794de6d5912062d89e22bc0d254
1df402ffe9f7f73c1432e131df82654dfe2f43bb
524931 F20110330_AABBIH kaplan_l_Page_010.jp2
aefeefb0eb334bf9cfc1e11d707facac
568cbfef56d4a76240cab8b2096f87f2fa6bd613
33852 F20110330_AABBHT kaplan_l_Page_107.QC.jpg
e8955af4842f0e758dc8302b2452e01d
89754fee6b38722208c3f2a84b619a006e6b45e7
86702 F20110330_AABBII kaplan_l_Page_012.jp2
13af7d9d87ff7a5128de83709e8b30ca
37544f06d2450ddb9fa5efa105d8025a255f055f
132673 F20110330_AABBHU kaplan_l_Page_108.jpg
8f479ccb943d33ca07bca8716d2cc5ff
353b437d3709dff0a468df3f75b891b4279b5a04
31704 F20110330_AABBIJ kaplan_l_Page_013.jp2
e77e59ea9e2de4a7bc7df674704aa06f
f8d1e601ba2528fd33bf69c72d5f8c14088d48cc
36633 F20110330_AABBHV kaplan_l_Page_109.QC.jpg
59429e947f12fcb209de5ad6f822ae43
1bf94ad88fe6e71985ad13541a3e7ae98336028f
107074 F20110330_AABBIK kaplan_l_Page_015.jp2
64ea9b0243af2cc1839de45d24e8a8d1
c6d8ef18eac38fa18d66496b5f6fc18bd89b718b
135866 F20110330_AABBHW kaplan_l_Page_110.jpg
8c6283d5770b727ce31d5736e913a113
51ec1900d3094d1c69098dcecf0e35ba31e148b9
107588 F20110330_AABBIL kaplan_l_Page_017.jp2
a40c77422adae445fc8b64d35958fb29
f6d29e3dc2ae5a73a01bacac182959e33ef59e07
37216 F20110330_AABBHX kaplan_l_Page_110.QC.jpg
b5d7c3d9ac0539f53d49da870a73797d
7c506febf583f12377c53fe61e3e22d7cb5d7498
105393 F20110330_AABBJA kaplan_l_Page_041.jp2
932fa4b5a33cb9a5f29eb9dce4085d96
bee8fcdcea860948a266af19de86c0a2fa3c20ad
109802 F20110330_AABBIM kaplan_l_Page_019.jp2
579dff1ab073bcd4ae3cfc13bb66cf5e
d2c7a0838ba8ec24659716479ec43726c9d37d2c
34508 F20110330_AABBHY kaplan_l_Page_111.QC.jpg
e5319ed1242140d3919cd1358b63553e
784a6b8eb9c08771ef0e5cbdca6a903a7f3fbace
80353 F20110330_AABBJB kaplan_l_Page_043.jp2
edbb861f263e41dba86a27b821ecf86f
e9cb354f71d1cf319188b0e3339a8e61484967d5
122629 F20110330_AABBHZ kaplan_l_Page_113.jpg
f4c6cf19353c55f628222d55ae56fbc0
463ef57a5df073374e67e4fc6c0689814fd5329f
789226 F20110330_AABBJC kaplan_l_Page_044.jp2
977c033e41d463d25f52dc7bc6409dba
03af3fbd2ce8dc6f4e2622265468833314d15c68
111144 F20110330_AABBIN kaplan_l_Page_020.jp2
e56b82feaeabcd53b07c9a02db439cd2
f30332c18d8b3b908168d05a95696ce5ddc445bc
51489 F20110330_AABBJD kaplan_l_Page_045.jp2
5935b909d6e6de2bf3d30a43abd4fe65
81680edca646662678c2def606d9b765c9c936b8
108691 F20110330_AABBIO kaplan_l_Page_022.jp2
7d4fabf8e51884c6e6ddf49167ae4780
5300a4702002874ac798fa42b84a2342bae1e500
92411 F20110330_AABBJE kaplan_l_Page_046.jp2
39de5966a04f7fa8ce623f646da51146
2ac415cc77b0a02b730a9169c1fc95cc66cd6b7b
106811 F20110330_AABBIP kaplan_l_Page_023.jp2
67ce080d65ed96f99e8c1ee03ad4e34c
9ea00710ce8039ef33c811991acb485152c1b5a1
111420 F20110330_AABBJF kaplan_l_Page_047.jp2
8441526064fa613c1b5a4424058e4f95
3cbfa31d7cec8178d64b1d8fb0fe7411a8ec80d8
111248 F20110330_AABBIQ kaplan_l_Page_025.jp2
80fe4bcbe5b67743daf45424850b999e
b6cbd97ad65813f71ca49a9d51f7f765246045fa
F20110330_AABBJG kaplan_l_Page_048.jp2
6cc6aaa7a8ebfc0aa90cadaa2cee6b4f
93febb3907e9fc2a34042f05fa4f3fa067be05e7
101285 F20110330_AABBIR kaplan_l_Page_026.jp2
cdc8a50ebd5cd50c6f0c52b2f0ee9c32
16180998c85fa2ae35c00255cacecb1b6777a57d
106974 F20110330_AABBJH kaplan_l_Page_049.jp2
e557a1fdd6c474a69783bd9d839ffd93
33fcbe46193976b184d951ded3442b352a20e45f
109777 F20110330_AABBIS kaplan_l_Page_027.jp2
0ce9dfe6c0e0aef4d82434290d9d1bf7
3ab161ff60b7898f87b122f847674813e6ba71eb
13207 F20110330_AABBJI kaplan_l_Page_053.jp2
1b55b6607977e39efee7d79c7cb9a164
9e00859eccb1ca095fcf51c821873b67da50e3ef
111756 F20110330_AABBIT kaplan_l_Page_029.jp2
9941b3da1d83ca988f85f568054b463f
2b6f5dd1f21431a05ee9a7ecad5418bff47850da
109457 F20110330_AABBJJ kaplan_l_Page_055.jp2
413805e05ab1cd157d127197fd5117da
df145cab5d0e77a24faaf3f652f8d41693ac8e6e
76924 F20110330_AABBIU kaplan_l_Page_032.jp2
8768b8ee8d6ca61475a23fa674030d59
e12f01a4da435f9f1024433b87ca6c270e72cce6
114108 F20110330_AABBJK kaplan_l_Page_058.jp2
aa6d1ad62b7ee7dc72e2019a847d722c
a0b2a24f6947b7e00081a5c78ecb1c787d4c01f2
105554 F20110330_AABBIV kaplan_l_Page_033.jp2
18b01eb27b73f0a54a670ceb5f8ac38f
c0d76e03358f5931fcca940cdd0accba8ec7960d
105984 F20110330_AABBJL kaplan_l_Page_059.jp2
a48324424d31ecb727d262f1539d21b0
1536b723fc2e3461c49d4f8962119eea00692c36
107445 F20110330_AABBIW kaplan_l_Page_034.jp2
ed6aa7c64b11cb7ce334784f552c6e41
207e61f87ef1fe58b3005d88799c560191796b7e
638090 F20110330_AABBKA kaplan_l_Page_085.jp2
2b48a707572a09df6c86559cd84fa599
e79a66fc8fbd133331458ee8a625c7c01cf22117
107938 F20110330_AABBJM kaplan_l_Page_060.jp2
00dc153912eda1051e4eec776034ee85
eb49891b6ce5358745d9a0ecc673a3b73c518f7e
110398 F20110330_AABBIX kaplan_l_Page_035.jp2
cb3bf279c7e94ca4e3005278a5ae16a2
923e11495b6b908e67e8129fff7e4234ebc14edc
273013 F20110330_AABBKB kaplan_l_Page_086.jp2
51cae3ea647543bb92546baa58fc796a
800b5c5ac6b3d013c44d84cb418f948ff9fc737f
41338 F20110330_AABBJN kaplan_l_Page_061.jp2
8331cefaff6205c8a58add13780ad324
7b39597375d0439454f510561d45c49f6c1d0ee3
103956 F20110330_AABBIY kaplan_l_Page_036.jp2
4948db833b6d460f08abc3b19e412100
f7dc7e5fc3e8ca810351621e4a58cc7e28a96f7d
372952 F20110330_AABBKC kaplan_l_Page_089.jp2
95d18e96fc0802b9978880292966c939
76d9399a261e4c705ec629857661e8012a6e0717
109467 F20110330_AABBIZ kaplan_l_Page_040.jp2
6e9edd068f6f96391e8af6d5ddedfd35
ab93619f11f01a0610683dec3decb22a952058e4
1051975 F20110330_AABBKD kaplan_l_Page_091.jp2
86c78e42a3c4686165f17bad26b6acce
0f7a0e8c63a4219eec08f97fe108bdb6c69754f8
1051971 F20110330_AABBJO kaplan_l_Page_064.jp2
e6bdbe7c8712e73cf733e65a94425745
40dc309a4743b094a9b811a32b7a13e2e46d9701
110260 F20110330_AABBKE kaplan_l_Page_094.jp2
aeb8e1205224d2d1dd3c014d816ef34a
0b0d01303842b92629d74f9fa3350e31dfb46025
108780 F20110330_AABBJP kaplan_l_Page_070.jp2
c2fb3a4d6fd2fd056d946de5847c27f6
7e654059b5c04bbffe8e3f21f1d9274c94162fb1
111098 F20110330_AABBKF kaplan_l_Page_095.jp2
217ddd1e0dcafc9e7e6ee5df786a1002
1b2005a7c903695fcef88bd6353e0a87066f8a25
113646 F20110330_AABBJQ kaplan_l_Page_071.jp2
a321fdd0d63c65b574e63f304a1be8e5
cb3b45b35d382a91e77b862b91e66ca1a162456b
325282 F20110330_AABBKG kaplan_l_Page_097.jp2
01cb4fe504b813acedb769ead30f7037
bfedf0df6d73365b0668ac53424952595c12d2ce
439071 F20110330_AABBJR kaplan_l_Page_074.jp2
127ca36c4c350189cc5f5a938a10f0a4
9fae11ab37aa2bd6a7c8d9af2da3f435d007f830
387175 F20110330_AABBKH kaplan_l_Page_098.jp2
3b9c432b34a2439ff2e6c1b270766e76
7c904af6c19895f879235837adba534e990e7e4f
94246 F20110330_AABBJS kaplan_l_Page_075.jp2
25ce217d98194b8d7d6f8fe72aac4f94
798b94c3ccdccec66c749c0ff3e96b4f404a4b6f
133888 F20110330_AABBKI kaplan_l_Page_102.jp2
2da6d82d0f7b849911cc04cabb742fe5
59d9c4b6cf00602cd6fecd0a61b296b495a44bbc
113191 F20110330_AABBJT kaplan_l_Page_076.jp2
61137aa5868d7145682ecae5aee688bc
5a6bb0f6b92a183071d862779334614fb1b26dff
133639 F20110330_AABBKJ kaplan_l_Page_104.jp2
3924378331edfd857c2806eeb44ada35
24870984939e8e76d505a30e75a65c5eadfd53da
108838 F20110330_AABBJU kaplan_l_Page_077.jp2
7123419e9160b081bc4c334e8bdfc785
e6c45afd8cfbe54045b6febdc6f5755d4747ecb9
134075 F20110330_AABBKK kaplan_l_Page_105.jp2
8c42e157c24969462c295b3e3cdeaf10
26d915266ba8f32f428d1bd4933029bec92eb8b1
112437 F20110330_AABBJV kaplan_l_Page_078.jp2
19366701ad038a883823051e217e83a9
54d65e3657bad05bfe9015a55f6559bcc5aed5e3
131554 F20110330_AABBKL kaplan_l_Page_106.jp2
1d59e1b7ff35ea88d147d7fadb4447af
9684a1efefbc43b68069367e9b311d05e59b19f6
112477 F20110330_AABBJW kaplan_l_Page_079.jp2
3e31a0112b69512f11f91fae3e38dabd
6ae492956d06d315ce81fa6cc66ac7acce5eda67
123992 F20110330_AABBKM kaplan_l_Page_107.jp2
b79f557f04ca80fafa65c273a0d74301
aa290a088f49e35f4035435085d77c3935d89e6d
91807 F20110330_AABBJX kaplan_l_Page_081.jp2
4b4b1117fdf81aaacdd1d68efb3a5912
484c59680b608edef920b9631f879ef86e17c0e1
2212 F20110330_AABBLA kaplan_l_Page_011thm.jpg
a10a94cb017e6acd6e447ddcfdde200a
a78f00bc69a9b2f3ff21d5aa0f4b5ace7e6f9f9e
137894 F20110330_AABBKN kaplan_l_Page_108.jp2
10261ce73b96989d9905300c4e45e3d6
9ce7dc06216e950930eccd6f7015ac88d2c48c84
736188 F20110330_AABBJY kaplan_l_Page_082.jp2
707e3f18d86f398ba8a978a958a624eb
0a7a9b9b8ba0f1ece53a1e433aa547521545492e
8159 F20110330_AABBLB kaplan_l_Page_016thm.jpg
d0895b5982769bbae60e186f4abb1704
a0cf9e7b8254777aa290436bbe681c244952cd2f
139365 F20110330_AABBKO kaplan_l_Page_110.jp2
1e86f55cba6cb572d8f56f7cbc5abd9a
d3f27b8bd2119e769c515cda6f6f07040675c66d
516201 F20110330_AABBJZ kaplan_l_Page_084.jp2
37e08b961ab21be5aca7632844b44b71
aa5b5beba83d1a6ab86986ab00ff3aa2a00301bc
104273 F20110330_AABAIA kaplan_l_Page_079.jpg
b197c04ff02a4bb13f40f7e7024607ca
1deae359315eb2235f8ce11f8e24579475a41d85
8449 F20110330_AABBLC kaplan_l_Page_022thm.jpg
ca6e1cf61ee5e659bb1f323c908e1be0
78367cea3d0cdb93c5f49eaba0ce845eef5af0ad
33769 F20110330_AABAIB kaplan_l_Page_024.QC.jpg
c84284ae2779cb386a6051670bb69a18
e931d6883b1b17ced571b8039407efd00c94b538
8150 F20110330_AABBLD kaplan_l_Page_024thm.jpg
f7608197ee14eff979c0ad517298eef5
d6df22c2d158c3cc913b1c9b61e398557aed083c
135510 F20110330_AABBKP kaplan_l_Page_112.jp2
3127026f2542125ee68f97b88aa2e959
bf38d2b4d0c09f97d6155bb9d0722c84d3004082
2071 F20110330_AABAIC kaplan_l_Page_001thm.jpg
e7bc0cf604f1dfd0f3a887666d71b106
030e2a70fcc01af1b8b3f3d364eefec57305f276
8416 F20110330_AABBLE kaplan_l_Page_025thm.jpg
1d5441e847f7341337e147041a9b2f36
55cf2b534532cb4c616ed1edbcb5339149e44ae3
128275 F20110330_AABBKQ kaplan_l_Page_113.jp2
ff9b2b2a77392dc93c2cb81fa31acc3c
c93c001d342222fbe3fc06f7b6af33df1c9e8928
98591 F20110330_AABAID kaplan_l_Page_092.jp2
97848e81107f1349ceb1df9f99e1a0eb
8b32f28cf3629b356298836c9944c046ec9265c0
6143 F20110330_AABBLF kaplan_l_Page_032thm.jpg
03c41da1b2d1777df99238791e17ad89
b8f5992a28c45002e73ddc295b19212573567bb9
125772 F20110330_AABBKR kaplan_l_Page_115.jp2
bc7e15b6d38912b28d41af13bbbd80c0
2ad58dd15295692125433d44783e5dbc1c2ecaab
110939 F20110330_AABAIE kaplan_l_Page_051.jpg
37dcaa917a8ebc5dfcfd42e8782ec7bc
2697f2287a62e4c88ace1be4bb91279649a59be9
8327 F20110330_AABBLG kaplan_l_Page_033thm.jpg
a362b8894144c8c87e75a37653c7bc87
f336f161a1e0ca3e330359743c1f29b4da081bba
55039 F20110330_AABBKS kaplan_l_Page_116.jp2
07a747035f4c820b72fae8a01a88bea7
f6b4655ea96a35f8a571ebc7ec5ff0ea9c0f80de
929330 F20110330_AABAIF kaplan_l_Page_062.jp2
6c244dec67d06a2d01121f71249892d1
f7bff3ec18ac6e2eb9abc5ff03dc20966499b069
8540 F20110330_AABBLH kaplan_l_Page_035thm.jpg
0f3797f32d94f608d2b2c38b61cf5a99
c3feaab71df07b144bfa0206c96dfe29982add94
50107 F20110330_AABBKT kaplan_l_Page_117.jp2
a1d76c6baa1f11a653465ef2edf919ac
5f0d63b9fc281df0143c49c69b394b3c9f00bec2
29681 F20110330_AABAIG kaplan_l_Page_075.QC.jpg
532ae59c0ba03088572c047f711446a6
4d06c995e2f1971d2564a765592ce60c8b9a5385
8120 F20110330_AABBLI kaplan_l_Page_036thm.jpg
313ddca28c527942b491e1c46a91311a
6e8249d22625898223838cb35bcbc35cf4920045
561 F20110330_AABBKU kaplan_l_Page_002thm.jpg
5cd81b371c630ae8a49d84e80e087cf1
bd8e59f831400018c4e214f9ef45bacda8d0da9d
F20110330_AABAIH kaplan_l_Page_109.tif
808385d98304fbe97f0d10d0dc881e03
a5b06315b302221ac1a8f52b74da2286e211c1f1
F20110330_AABBLJ kaplan_l_Page_037thm.jpg
e16ffbe38c2f198d173b2bbdcbd7d8fd
a812b90929b4b17b0f15f48443b3fa3eccc85152
1768 F20110330_AABBKV kaplan_l_Page_003thm.jpg
6b0f3dad2aeed305c6f150d4100f68c2
ba577901f7072e0a6dbf99ca886d8290d018861d
62415 F20110330_AABAII kaplan_l_Page_103.pro
0b72fd2e4b560760e258f822898dead5
93d7fe8747f4d47756d49ff4f8adfd372ad4a97f
F20110330_AABBLK kaplan_l_Page_038thm.jpg
a077307d2eee00757c70a99a10711555
7b9b3b725788379f41e7c2e492389d25647a0c41
13025 F20110330_AABAHT kaplan_l_Page_085.pro
f7b2604eb604654982d9d2b379378a0f
66d019a0d43604196dae0dd250e8e8911663dc95
7617 F20110330_AABBKW kaplan_l_Page_004thm.jpg
1176e341fce1d1c64f6ad132db1585bf
09cf227586334a06418d2c3abbd36649291bdb24
103764 F20110330_AABAIJ kaplan_l_Page_047.jpg
6fd07c0a53d34f2f04313062bae2a9a6
6fb924e5844a83ddc173fb73dc6a17419199e2ee
8187 F20110330_AABBLL kaplan_l_Page_039thm.jpg
83028d6cb67f7497ffcff038297154c3
58b102968e9b829bba8705c9837e3cd3f57aaadb
63373 F20110330_AABAHU kaplan_l_Page_106.pro
e57aa5e9ce42abc7960d9883b954098f
dafaaaacc2d0604c7eba926bd4fe7bf68d73331e
3278 F20110330_AABBMA kaplan_l_Page_061thm.jpg
07345c83100e28260850f31c34d772b7
a73123ce716579c32806004246a326127db71b59
7682 F20110330_AABBKX kaplan_l_Page_005thm.jpg
09f19639b09156bb75e6bf65efa2ed19
844f5d6a64fa3f4a41cd4f4e23980235a0ecee80
8200 F20110330_AABAIK kaplan_l_Page_017thm.jpg
31fbdc4127acbffb987e9052330bb928
1a6ed196a4391cf6da1ee093db7f45f6ad93026c
8659 F20110330_AABBLM kaplan_l_Page_040thm.jpg
6c46cd4dc75b46a82e434dd058f32a8a
ec452ce1c3e1bb9384780bed39e0234ed9825998
108413 F20110330_AABAHV kaplan_l_Page_024.jp2
8ff5f61e456a5f0f6b1881cc376ac2d3
71206477398a5631c4b6c8ea0590058ea95d3ee7
5449 F20110330_AABBMB kaplan_l_Page_062thm.jpg
9b60aba19691b48b4f8f5cd25983e28f
3e74e522d8005877bae139b51d647cd57a087847
6925 F20110330_AABBKY kaplan_l_Page_007thm.jpg
5200aecab33415c9e6b81fe8530c54c7
a529276c366a3ee6d94973006a21428e2c0c5cf3
65260 F20110330_AABAIL kaplan_l_Page_042.jpg
b04f441b718516d7d41836869c4bc010
259ffe7fac1ff1379ce4bd0646e5384dfc4ba6ab
8144 F20110330_AABBLN kaplan_l_Page_041thm.jpg
d8072f59665e2bb3ac113b3f324962c5
04d90df29609698b63333a831becbd6fab662d06
8154 F20110330_AABAHW kaplan_l_Page_050thm.jpg
d3fe3f80222de67ca5ee265209077853
93bd388ea14a4dbda8d1007323f8864e5f2608d5
3013 F20110330_AABBMC kaplan_l_Page_063thm.jpg
814a96cfe95832b3b8dbd8f541cdaf38
d68a358bcefd4f0cae7f5d5b8fa219c828e5da71
7787 F20110330_AABBKZ kaplan_l_Page_009thm.jpg
c5d53e5cfb39b429238760fa48a8386d
a921b47c95c7d60a70c80ea99272eca68b6122e7
27824 F20110330_AABAJA kaplan_l_Page_046.QC.jpg
4dc1696515b587d8b51609ca26715be5
07a85c4312dcc7262f6017c9ab1b4700980f2afd
109316 F20110330_AABAIM kaplan_l_Page_037.jp2
f84649d32b15c69b7acd554ceb9914bc
c65a6a44ff0d913cca17dce1cf465a38f834fed1
5281 F20110330_AABBLO kaplan_l_Page_042thm.jpg
34678ff766aee1e1bf5e1fcb6381d526
2d6a652bc000450dcb26ebb5fee984d8f35c2dd9
2415 F20110330_AABAHX kaplan_l_Page_010thm.jpg
32bdf8d4918438054d7f990065c97056
7dec6a6bf1e0e25d3e33d554e09519b0c9ee2b64
6654 F20110330_AABBMD kaplan_l_Page_064thm.jpg
1288f4bcf224a6db07358ff6160176f9
126acd74100a61487a944a45f7d476d64ace2024
5458 F20110330_AABAJB kaplan_l_Page_062.txt
049ec7da4d1ee6fe62ebba7b8fcfec17
f4e16bae3338f52ab41f799286493982b334c4ce
51848 F20110330_AABAIN kaplan_l_Page_047.pro
0d9663d8379395cda90fe5b20c13b8d1
9ea36a0e581f5625a9d9d209c8c6ffbaaabc0210
3914 F20110330_AABBLP kaplan_l_Page_043thm.jpg
3e3f43c17686ee5062bfeb66b43f6f8e
0f2aa5f18f6db7aeb5ff4c25521ec8203142effa
28849 F20110330_AABAHY kaplan_l_Page_007.QC.jpg
8d7f58e1b51b902047b4868e1baf3750
0154b0f2c9253211f8949047dae85d03daf0319b
2789 F20110330_AABBME kaplan_l_Page_065thm.jpg
6da809099f99289eafa6de8b0109bde7
cdcf7e421eb652edcc7f0b45426921864174e08c
8383 F20110330_AABAJC kaplan_l_Page_086.QC.jpg
a347b063d9c823a5b01e35568c72f97c
6b5b3c83b3c58029e44f9ebd241ed6b9b0e4ff9d
8681 F20110330_AABAHZ kaplan_l_Page_091thm.jpg
cd2141ce10d98ccc33c82c101228fbff
ec4a4c6489a4ce631ce7663542f456b87a12cbbd
4604 F20110330_AABBMF kaplan_l_Page_067thm.jpg
8097b57f8bbcc8be43bf724d0a7a07ee
1882eb5e6caecd1d188b1f14c783128181849402
105343 F20110330_AABAJD kaplan_l_Page_050.jp2
8a2481b457a47a30a0723305f7187a16
b50d058304d3ed56c1d74fdd1224474853eaed96
1026799 F20110330_AABAIO kaplan_l_Page_014.jp2
8d477eabcfdd30f0ca5a6f4e3d49e032
a462ebb27545c53d56728c425acb6d4e54070933
4144 F20110330_AABBLQ kaplan_l_Page_044thm.jpg
7899a6d5f006770df87519f144bb53ba
6f12c159dd2da64891b840253343e059c3201e17
7742 F20110330_AABBMG kaplan_l_Page_068thm.jpg
2355f31021c3f3c9d36a0d4ca56d8623
d4314089be20e17d4213deaf096f05fe9f432951
101590 F20110330_AABAJE kaplan_l_Page_022.jpg
aeac6c62ca2c24bf2e663accb647c757
284c6dd866dcf06b49b5adadd93c19a8c4bccd4c
8146 F20110330_AABAIP kaplan_l_Page_015thm.jpg
3a1dccb3efc19c93e5f9846f0b40a295
db5cb17cf73dcd1c2f3631c06af30651feee890a
7198 F20110330_AABBLR kaplan_l_Page_046thm.jpg
073ef083102bd83b7e2b96e3345e384a
55d7c3759c6e33ee7c2c92de60ea7f843b957734
8300 F20110330_AABBMH kaplan_l_Page_069thm.jpg
f6dbe3186a0b155fa3681514054d62cd
fbff4112f337567b1f278703e7eb1751dde5526e
102598 F20110330_AABAJF kaplan_l_Page_034.jpg
b1be5518c35da3db4cdd711b4355302c
b966a21e0d9b2e1566ef7ed3a43a06bce2a6a5e5
8033 F20110330_AABAIQ kaplan_l_Page_001.pro
45e049d8e465167626de7e9b69040698
50bf0e6cd68257a4179712a2dc2b87f9b4a918ca
8433 F20110330_AABBLS kaplan_l_Page_047thm.jpg
b89e1cb5536cc8c822a548137a628cb1
b89b9f4ca05cb8e0dc7f5dd6c9c9684b55445eae
8600 F20110330_AABBMI kaplan_l_Page_071thm.jpg
a293378eaa8b507c4fa623eae8626659
3fdb6086f008878eae96f68dde4b256ac50795c6
1051957 F20110330_AABAJG kaplan_l_Page_051.jp2
eabb33a89382947bb9e75792ef292e5f
db74125a0d15f60312f92783db58d0b7009576d2
F20110330_AABAIR kaplan_l_Page_098.tif
9cce831c327d4e4f6c66c75cb791f2d8
9e5a3f5ff1a246d6408b55d7fe909e4e7e9dd7cc
8497 F20110330_AABBLT kaplan_l_Page_048thm.jpg
dc1f2759b25ec669e3c3b36beb32bd92
67f37a8ce65b6f221481dca71d67f7f871c52786
4029 F20110330_AABBMJ kaplan_l_Page_072thm.jpg
ced70193c4f799d9aa6040e55e4c55f9
a0d374314b7d6e2ee18edf2800fa3418379e047a
1959 F20110330_AABAJH kaplan_l_Page_022.txt
28097e587c1294b8bc1f09147129a67b
3a7694b5777c2b848fba55ce45c43bbf00e612ea
2050 F20110330_AABAIS kaplan_l_Page_080.txt
a5d9152c9ba9d5c9bc3bab503203222e
817d1366e841ec3844ff6bf6509134d0852f7af9
8887 F20110330_AABBLU kaplan_l_Page_051thm.jpg
0dfd9268513c8974be96313352207f41
786a905d1c936632b0a6a64984faabc5a59699ab



PAGE 1

ELUCIDATING THE GENETIC INFLUENCES IN PAIN SENSITIVITY AND ANALGESIC EFFECT By LEE KAPLAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Lee Kaplan

PAGE 3

I would like to dedicate this di ssertation to my parents, for whom I am truly grateful. If it were not for your guidance, encouragement and world wisdom, I would not have been able to do this. I recognize a nd appreciate all you have give n up in life to make education a priority for me. Thank you and I love you. Y ou will never know what you mean to me. Also, I would like to dedicate this document to my brother Albert and my grandparents.

PAGE 4

iv ACKNOWLEDGMENTS First of all, I would like to thank my me ntor, Dr Margaret R. Wallace for being not only a mentor, but also a friend and confidant. I am truly lucky to have landed up in a wonderfully encouraging environment both profe ssionally as well as pe rsonally. It is an amazing feeling to know that someone is always looking out for my best interests. I would like to express thanks to my lab mates who have helped me along the way, especially my lab manager, Beth Fisher, w ho always offered to help in any way she could, and my fellow graduate students in the lab who helped brainstorm, especially Lauren Fishbein and Jessica Walrath, and my undergraduate, Brandon Sack, who is just awesomely intelligent hard worker. I woul d like to thank my favorite IT lab mate Frederick Kweh for rushing to my aid at th e hint of computer issues while writing. Without him, this dissertation would not be in one piece. I would like to thank my committee members who have all been mentors to me, and each has assisted me in different aspects of my project and my career. These five people really care not only about my professional progress but also about my personal happiness. Each has made me a part of his lab and taught me different techniques. My committee members are John Aris, Daniel Driscoll, Roger Fillingim, Jame s Resnick and Colin Sumners. I would also like to thank their labs and especially Dr. Ka ren Johnstone for the guidance. I would like to thank my collaborators Dr. Roger Fillingi m and Dr. Nicholas Verne for their financial support throughout my graduate career and for being friends as well as teachers and collaborators. I would also like to thank Dr. Roland Staud for his ongoing collaboration

PAGE 5

v and input. I am thankful to have had tremendous help and advice from Dr. Carrie Haskell-Leuvano and her lab, for the functi onal project. Dr. Mavis Agbandje-McKenna provided great help with the pr otein modeling. I also thank the faculty and staff of the Pediatrics Division of Genetics for allowing me to participate in clinical conferences, and their collaboration on other projects I studi ed. Dr. Roberto Zori was paramount in helping me find my niche as a future c linical cyto and molecular geneticist. I thank my friends who have been there for the laughs and the tears and everything in between. I am fortunate to have many fr iends who have supported me through the past five years, I would like to mention Robyn Ma her, Dr. Baharak Moshiree, Dr. Hazel Levy, Dr. Rita Hanel and Dr. Amy MacNeill, and I would also like to thank my friends Dr. Jaqueline Teusner, Dr. Karen Johnstone and Dr Stuart Beatty for help and guidance with this manuscript. There are so many more friends to mention and you know who you all are. I love you. I appreciat e everything Dr. McCormack has done for me as it has not been an easy road for me, but it is nice to ha ve someone there to help and advise. Also, I would like to thank the staff in the graduate education office as th e ladies have always been ready to do anything possible at the ot her end of the phone. I thank my department administration for all the support offered thr oughout my graduate career and especially Joyce Conners without whom my life would be a disorganized mess. Also, I don’t think I could have made this manuscript whole withou t the help of the electronic thesis and dissertation office and days spent at Coffee Cultu re. If there is anyone I have forgotten to thank, I apologize and thanks.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF FIGURES...........................................................................................................ix LIST OF OBJECTS...........................................................................................................xi ABSTRACT......................................................................................................................x ii CHAPTER 1 BACKGROUND AND SIGNIFICANCE....................................................................1 The Afferent Nociceptive System................................................................................1 Central Processing of the Noxious Stimulus................................................................3 Descending Anti-Nociception......................................................................................4 Two Receptor Systems.................................................................................................4 Genetics In Pain............................................................................................................6 Mouse Models of Pain...........................................................................................7 Human Studies.......................................................................................................8 Gender Differences and Ps ychosocial Influences.................................................9 Candidate Genes.........................................................................................................11 The Opioid Receptor Family...............................................................................11 The Melanocortin Receptor Family.....................................................................14 CALCA1/ CGRP Receptor................................................................................15 Chronic Pain Conditions.............................................................................................16 Irritable Bowel Syndrome...................................................................................16 Fibromyalgia........................................................................................................17 2 MATERIALS AND METHODS...............................................................................19 Candidate Gene Selection...........................................................................................19 Literature Search.................................................................................................19 Single Nucleotide Polymorphism (SNP) Selection.............................................19 Genotyping.................................................................................................................19 Primer Design And Synthesis..............................................................................19 Polymerase Chain Reaction (PCR).....................................................................20 SNP Analysis.......................................................................................................20 Cloning.......................................................................................................................2 1

PAGE 7

vii Opioid Clones......................................................................................................21 Site Directed Mutagenesis..........................................................................................22 Tissue Culture.............................................................................................................23 Stable Transfections............................................................................................23 Characterization and Verification of Stably Transfected Cell Lines..........................24 Gene expression levels........................................................................................24 Protein expression levels.....................................................................................27 Functional Analysis....................................................................................................28 Immunocytochemistry.........................................................................................28 3 INTRODUCTION TO ASSOCIATION STUDIES...................................................33 Candidate Gene Approach..........................................................................................33 Statistical Analysis......................................................................................................36 QTL..............................................................................................................37 ANOVA.......................................................................................................37 Negative Association Studies.....................................................................................38 4 THE MELANOCORTIN-1 RECEPTOR GENE MEDIATES SEX-SPECIFIC MECHANISMS OF ANALGESIA IN HUMANS....................................................41 MC1R.........................................................................................................................41 Results........................................................................................................................ .42 Pentazocine Studies.............................................................................................42 M6G Data............................................................................................................45 Discussion...................................................................................................................46 Pentazocine Studies.............................................................................................46 M6G study...........................................................................................................47 5 THE A118G SINGLE NUCLEOTIDE POLYMORPHISM IN THE -OPIOID RECEPTOR GENE IS ASSOCIATED WI TH PRESSURE PAIN SENSITIVITY..55 Introduction.................................................................................................................55 Results........................................................................................................................ .56 Discussion...................................................................................................................57 6 FUNCTIONAL ANALYSIS OF SING LE NUCLEOTIDE POLYMORPHISMS...62 Introduction.................................................................................................................62 The Delta Opioid Receptor and T80G (F27C)....................................................62 The Kappa Opioid Receptor and G36T...............................................................64 Results........................................................................................................................ .65 Discussion...................................................................................................................67 7 CONCLUSIONS AND FUTURE DIRECTIONS.....................................................77 Conclusions.................................................................................................................77 MC1R..................................................................................................................77

PAGE 8

viii OPRM1................................................................................................................78 OPRD1................................................................................................................79 Clinical Testing...................................................................................................79 Future Directions........................................................................................................79 Association Studies.............................................................................................79 Functional Analysis....................................................................................................82 General........................................................................................................................ 83 APPENDIX A GENOTYPING RESULTS........................................................................................85 B GENOTYPE FREQUENCIES……………………………………………………...86 LIST OF REFERENCES...................................................................................................88 BIOGRAPHICAL SKETCH...........................................................................................104

PAGE 9

ix LIST OF FIGURES Figure page 2-1 Vector maps made usi ng the Vector NTI software....................................................31 2-2 List of primers used for the site directed mutagenesis...............................................32 4-1 The measures of pentazocine analge sia in humans by sex, hair and skin phenotypes, as well as MC1R genotypes.................................................................49 4-2 Change in pain ratings after pentazoci ne analgesia separated by sex and genotype..50 4-3 The grouping of subjects by the location of the SNP in the MC1R gene and a description of their phenotypic char acteristics (Mogil et al. 2005)..........................51 4-4 Effects of MC1R functionality on baseline nociceptive and pain sensitivity in humans.....................................................................................................................52 4-5 The change in pain tolerance over tim e after the administration of M6G at a dose of 0.3mg/kg..............................................................................................................53 4-6 M6G analgesia expressed as the area under the time effect curve.............................54 4-7 Concentrations of M6G plasma levels in participants at time points after M6G administration at a dose of 0.03mg/kg (Mogil et al. 2005)......................................54 5-1 This figure illustrated the detail s of the subjects in this study................................... 60 5-2 Pressure pain threshold at all three sites tested (tra pezius at the top, masseter in the middle and ulna at the bottom)...........................................................................61 6-1 Model of the delta opioid receptor (B), based on the bovine rhodopsin receptor (A) with the ball representing the conserved phenylalanine residue...................... 69 6-2 The local environmet of the hydr ophobic pocket where the phenylalanine is located......................................................................................................................70 6-3 Activation assay results show that th ere was no dose response in the activation of the stably transfected cell lines. …………………..........................……………….71 6-4 Northern blot analysis of the huma n deltaand kappa opioid receptor stably transfected cell lines.................................................................................................72

PAGE 10

x 6-5 The western blot comassie stained is on th e left and the ECL blot is on the right.....74 6-6 Western blot of COS-7 transiently tr ansfected cells, 48 hours post-transfection.......75 6-7 RT-PCR of the OPRD1 cDNA from stably transfected colonies after 25 extension cycles........................................................................................................................7 6 7-1 A transient transfecion with the original vectors received from collaborators. ........84

PAGE 11

xi LIST OF OBJECTS Object page A-1. Excel spreadsheet containing the list of genotype results in all polymorphisms studied. (object1.xls, 118KB)..................................................................................85 A-2. Comma separated variable (CSV) versi on of the list of genot ype results in all polymorphisms studied. (object2.csv, 28 KB).........................................................85

PAGE 12

xii Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ELUCIDATING THE GENETIC INFLUENCES IN PAIN SENSITIVITY AND ANALGESIC EFFECT By Lee Kaplan December 2005 Chair: Margaret R. Wallace Major Department: Molecular Genetics and Microbiology Pain impacts the quality of lif e for millions of people each year and is a significant drain on the country’s health care resources. Pain is an innate response to a noxious stimulus indicating damage in a region of the body. This response elicits various reactions from the body including autonomic, inflammation, as well as stimulation of growth and repair. Under some conditions, often associated with plasticity in the nociceptive system, pain may become prolonged and lose its adaptive function. In this study, we are using data from human volunt eers, which makes our findings directly clinically applicable compared to animal mode ls. The clinical aspect s of pain have been vastly studied but there is a deficiency of information regarding genetic influences on pain responses. There is new evidence suppor ting the notion that ge netics contributes to pain sensitivity and re sponse to analgesics. We have unde rtaken a scientific study to test the effects of candidate molecular receptor va riants in this process. We have found positive associations of some single nucleotid e polymorphisms with pain sensitivity and

PAGE 13

xiii analgesia, although no polymorphisms were implic ated in case-control studies of chronic pain conditions with the current cohort of subjec ts. It is the dawning of a new era in pain research, in which our enhanced understandi ng of the molecular mechanisms contributing to pain may help elucidate the individual di fferences in pain responses. By improving our understanding of molecular contributions to pain, it will be possible to tailor treatment to individual patients, thus improving clinical outcomes.

PAGE 14

1 CHAPTER 1 BACKGROUND AND SIGNIFICANCE Pain impacts the quality of lif e for millions of people each year and is a significant drain on the country’s health care resources. It is the primar y motivator for the utilization of health care (Knapp and Koch 1984), and a pproximately 1 in 5 Americans experiences chronic pain (Joranson and Lietman 1994). Pain medications are the second most prescribed medications (Schappert 1998) and th e direct and indirect costs of treating pain is estimated to be over $125 billion annually (Turk et al. 1999). No ciception is the term used to describe the neural transmission of signals that may lead to the experience of pain. According to the Interna tional Association for the Study of Pain, pain is defined as “an unpleasant sensory and emotional experi ence associated with actual or potential tissue damage, or described in terms of such damage” ( www.iasp-pain.org/termsp.html#Pain ). On this website is described the su bjectivity of pain and that each person has unique parameters of experience to wh ich pain is rated. Although pain is an emotional experience, this definition also ac knowledges the role that biology plays in the pain process, as the noxious stimulus has an ability to cause tissue damage and thus incorporates physiological pathways. The Afferent Nociceptive System A pain response elicits various reac tions from the body including vasodilation, inflammation, and the stimulation of growth and repair. Under some conditions, often associated with plasticity in the nociceptive system, pain may become prolonged and lose its adaptive function. Once th e pain pathway has become sensitized, the nociceptive

PAGE 15

2 pathway is more primed to sensation and this leads to a chronic pa in state. Noxious stimuli are detected by specialized receptors in the nervous system called nociceptors. Nociceptors innervate all peri pheral systems of the body to a llow for the perception of a noxious stimulus. They make up part of the sensory system of the nervous system and allow the brain to analyze the nature, lo cation, intensity and duration of the noxious stimulus (Riedel and Neeck 2001). There are two main types of nociceptors, A fibers and C fibers\. A fibers are myelinated and are thought to contribute to the experience of sharp shooting pain. This is usually the first sensation a person feels after the experien ce of a noxious stimulus. Cfibers are unmyelinated, and their activation can lead to the sensa tion of a dull throbbing pain, which tends to last for a longer duration of time. In a chroni c pain condition, it is believed that prolonged C-fibe rs activation can cause sec ond order spinal neurons to become sensitized and cause long-term pain. Tissue damage and peripheral nerve injury may cause an expansion of the dorsal horn re ceptor field, thereby increasing the input region from the periphery. The cell body of the nociceptor is located in dorsal root ganglia and enter the central nervous system in th e dorsal horn of the spinal co rd. The C fibers synapse on spinal neurons in superficial region of the dorsal horn and are found in laminae I and II, while the A fibers are located in lamina V (Rex ed 1952). There is a high concentration of excitatory amino acids found in the superf icial region of the dorsal horn, which include glutamate, aspartate, substance P (SP) and calcitonin gene related peptide (CGRP). These molecules represent the main nociceptiv e transmitters as they co-localize to the nociceptive neurons and have been found to be elevated, along with their receptors, in a

PAGE 16

3 chronic pain situation (Riedel and Neeck 2001) The stimulus is routed through the cell body up the primary afferent axons to multiple re gions of the neuraxis. The thalamus is a primary brain region involved in nociceptive processing. The thalamus is responsible for the propagation of the stimulus and routing of the impulse to the somatosensory cortex where the sensation is interpreted, as well as to other cortical re gions for higher order processing. Central Processing of the Noxious Stimulus Exactly where pain is processed in the brai n remains an enigma. Pain is regarded to be perceived in the subcor tical structures of the brain. The first receiving unit is the thalamus and then the message is transmitted to the somatosensory cortex, as well as other cortical structures, and e ffector processes are initiated. This is supported by the fact that patients with cortical lesions do not lose the sensation of pain (Shibasaki 2004). A positron emission tomography-regional cerebr al blood flow (PET-rCBF) activation study concluded that the primary and secondary soma tosensory cortex (SI and SII respectively) are activated during a painful stimulus, as well as the cingulate cortex, contralateral to the side where the pain is being delivered (T albot et al. 1991). Us ing functional magnetic resonance imaging (fMRI), researchers have sh own that activation occurs in the SI not only during the actual stimulati on, but also in anticipation of the noxious stimulus (Porro et al. 2002). A few groups de monstrated that central neur oplasticity and pain memory play a considerable role in clinical symp toms such as central neuropathic pain and phantom pain (Melzack et al. 2001; Garcia-Larrea et al. 2002). The SI seems to play a role in basic pain processing, while the SII and insula are involved in more intricate pain perception and sensitization. The emotional aspects of pain processing are controlled by

PAGE 17

4 the anterior cingulate cortex and the posterior insula/par ietal operculum structures (Shibasaki 2004). Descending Anti-Nociception Gamma-amino butyric acid (GABA) is a ma jor inhibitory transmitter in the CNS. This compound has been implicated in the inhibition of acute and persistent pain (Malcangio and Bowery 1996; Schadrack and Zieglgansberger 1998). Anti-nociception has been attributed to chol ernergic interneurons acting on opioidergic interneurons through the mu, delta and kappa opioid rece ptors, via enkephalins and dynorphins. Along with pain relief via the efferent pain pathway, inflammation and redness may occur at the site of the stimulus, if there has been an immunological response to allow wound healing. During the inflammatory pr ocess, there is an actual disruption of the perineurial barrier around the primary af ferent fibers, which allows endogenous and exogenous opioids released from immune cells to inhibit the nociceptive stimulus at the peripheral ending (Antonijevic et al. 1995). This is an additi onal system of pain relief. Two Receptor Systems Two important receptor system s known to be integral to the process of nociception and anti-nociception are the N-methyl-D-asp artic acid (NMDA) and the opioid receptor systems respectively. Opioid receptors are s ynthesized in the peripheral neurons and then are transported to the periphery and centra l endings of the nociceptive fibers. NMDA receptors can be found highly represented in the dorsal horn in lamina II along with the opioid receptors, which suggests that these receptors may be functionally related. Opioids have been shown to directly or indirectly modulate NMDA receptor mediated events within the CNS by either inhibition or potentiation of the electrophysiological message (Chapman et al. 1994; Sivilotti et al. 1995; Zhang et al. 1996; Vaughan and

PAGE 18

5 Christie 1997). Research (Chen et al. 1995) has shown that the kappa opioids, such as dynorphin, are NMDA receptor antagonists and that the kappa opioid peptides have been found in the dorsal horn during inflammation, associated with a disruption of nociceptive transmission at the leve l of the spinal cord. Opioids, in fact, have been found to regulate NMDA receptors by inhibiting the calcium cha nnel activity of these receptors (Basbaum and Fields 1984; Mao et al. 1995). One affecti ng the influence of spinal opioid receptors in anti-nociception (especially that of the mu opioid receptor) is the amount of spinal cholecystokinin (CCK), whose action is inhib itory on spinal opioid efficacy (Stanfa and Dickenson 1995). Nitric oxide (NO) acts as a negative feedback regulator of NMDA receptors. This feedback loop is initiated by the release of calcitoni n gene related peptide (CGRP) and substance P (SP), which is increas ed in the dorsal hor n during hyperalgesia. A prolonged release of these factors from th e primary afferent neurons activates the NMDA-NO cascade (McMahon et al. 1993). Hype ralgesia is defined as an increased response to a painful stimulus. NMDA activ ation, which is mediated by NO, has been implicated in the maintenance of hyperalges ia in chronic pain models (Meller and Gebhart 1993). This hyperexcitability of the spinal cord is known as central sensitization. This phenomenon is known as “windup” and is caused in part by the involvement of the C-fiber activity with the c onstant release of the neurotransmitters in the dorsal horn region, which affects post-synap tic transmission of the nociceptive signal (Mendell and Wall 1965; Basbaum and Fields 1984; Urban et al. 1994; Mao, Price et al. 1995). “Windup” is also known as temporal summation of pain and was first described by Mendell and Wall in 1965.

PAGE 19

6 The clinical aspects of pain have been gr eatly studied but there is a deficiency of information regarding genetic influences on pain responses. There is direct evidence supporting the notion that gene tics contributes to pain sensitivity and response to analgesics (Mogil et al. 2003; Zubi eta et al. 2003). It is the dawning of a new era in pain research in which our enhanced understandi ng of the molecular mechanisms contributing to pain may help elucidate the well-document ed and substantial individual differences in pain responses. By improving our understand ing of molecular contri butions to pain, it will be possible to tailor treatment to indivi dual patients, improving clinical outcomes. A few genes stand out in the search for the ge netic component of pain. These candidate genes are discussed below and ar e the major focus of my work. Genetics In Pain Two main influences in many life experi ences are environment and genetics. The environmental influences in pain are discusse d below. There is concrete evidence that genetics plays a role in pain susceptibility as well as analgesic effect. This is evident in twin studies of lower back pain and neck pain, examining dizygotic twins as well as monozygotic twins (MacGregor et al. 2004). In this extensive study, which included 181 monozygotic (MZ) and 351 dizygotic (DZ) twin pairs, the range of concordance found was 52%-68% for lower back pain and 35%58% for neck pain. These numbers are considered strong indicators of genetic cont ribution. Association studies of candidate genes and pain have become common in the past five years, given that pain is a complex trait with genetic influences Pain genetics studies were initially done using mouse models. Comprehensive mouse studies have been undertaken, and only in the past decade have human participants been the obj ect of genetic candidate gene association

PAGE 20

7 analysis of pain. We have based our human studies in part on data generated by murine QTL analysis. Mouse Models of Pain Human traits can often be mirrored and manipulated in the murine laboratory system, in which systems can be broken dow n into simpler events in inbred mice to control for genetic background. Classic tools include transgenic mi ce, which express an exogenous gene, and knock-out mice, in which an endogenous gene of interest is made non-functional by homologous recombination in embryonic stem cells. Genetically speaking, there are also differences between laboratory mouse strains. There are two main strains that have been bred to select fo r pain sensitivity in mice. One is the HA/LA mouse line, which displays high and low anal gesia respectively (Pa nocka et al. 1986), which is induced during swimming in cold water. The second useful strain in the pain paradigm is the HAR/LAR mouse line, which was bred by Belknap and colleagues in 1983. These mice display high or low analge sia in response to the opioid analgesic levorphanol. These strains are theorized to have mutations which control response in a Mendelian fashion. Quantitative trait loci mapping has been undertaken in these and other strains, using microsatellites and ca ndidate gene polymorphisms involved in pain sensitivity, in association with measured analgesic response (Mogil et al. 1997a, 1997b). In terms of mouse knock-out models, all the opi oid receptors have be en disrupted as well as all their identified endogenous ligands. From these studies, we have learned that there is great redundancy within th e opioid system although the different knock-out mice have various behavioral deficits. The knock-out mi ce have been made by various laboratories including Zhu et al. 1999 and Filliol et al 2000, who made a delta opioid receptor knockout. The first few mu opioid receptor knock-ou ts were made in 1996-7 (Sora et al. 1997;

PAGE 21

8 Tian et al. 1997; Matthes et al. 1998). The only kappa opioid receptor knock-out was made by Simionin et al. in 1998. In all thes e knock-out mice, homozygotes were viable and fertile. Absence of the receptor was shown by lack of bindi ng of the selective agonist, but there was no majo r compensatory effect with respect to the anatomical expression of the other two receptors. Th ere is a hypothesis that there may be an adaptation at the level of coupling efficiency instead of the difference being seen at the level of ligand binding (Matthes et al. 1998; Narita et al. 1999; Hosoha ta et al. 2000). Mice lacking the opioid peptide components have also been reported to be phenotypically normal for pain modalities. These mouse data have been extensively discussed in a comprehensive review by Kieffer and Gavriau x-Ruff (2002). In this review they also describe efforts to make double and trip le knock-out mice through cross breeding. Human Studies One of the first studies to implicate geneti cs in pain was a study by Morris-Yates et al. in 1998, which showed that 56.9% of twin s were concordant for irritable bowel syndrome symptoms. In 1999,Yunus et al. pr esented a genetic linkage analysis of families with fibromyalgia to the human leukocyte antigen (HLA) locus, which is a group of genes in the human histocompatiblity complex that encodes for cell surface antigen presenting proteins. In the early part of this decade, researchers examined candidate genes in relationship to pain sensitivity and the therapeutic effect of analgesics. In 2003, Zubieta et al showed that there were three different states (effici ent enzyme, non-efficient enzyme and non-functional enzyme) of the pr otein involved in catecholamine metabolism depending on specific polymorphisms found in the catechol-O-methyltransferase gene ( COMT ) (Zubieta et al. 2003). In the same year Mogil et al found that a gene originally involved in skin pigmentation was in fact al so involved in the me diation of analgesic

PAGE 22

9 effect of a kappa opioid agonist in mice (Mogil et al. 2003). The human data from this paper will be discussed in chapter 4, as I ha ve been involved in the human analysis of susceptibility genes for both acute pain as we ll as chronic pain as part of a large collaboration. Gender Differences and Psychosocial Influences The differences that have been found between men and women with regard to pain are now well documented (Maixner and Hum phrey 1993; Fillingim et al. 1999). Women have a significantly lower pain threshold and tolerance than men, and also rate the same noxious stimulus more highly than men. There are also clinical data indicating that women suffer more from pain and chronic pa in syndromes than men (Dao and LeResche 2000; Heitkemper and Jarrett 2001 ). There are many possibl e implications of this information. First, it is possible that men and women experience and respond to pain in a different manner. Also, a so ciety stereotype mandates that men are supposed to be the stronger sex and not admit pain. Thus, ther e may be different nociceptive pathways in the different sexes, but psychosocial factors ma tter as well. Gender ro le expectations are, in fact, significant predictors of pain threshold, tolerance and unpleasantness (Rollman et al. 2004), though gender roles typi cally do not fully account for sex differences in pain perception. Animal studies have shown that there are differences in the pain response and analgesic effects of morphine between ma le and female mice of certain strains (Kest et al. 1999). Gene expression and hypophyseal portal artery (HPA) regulation in the hippocampus have also been found to be diffe rent between the sexe s in a mouse chronic stress model (Karandrea et al. 2002). A review (Craft 2003) highlighted the numerous studies that have been conduc ted in rodents to indicate th at mu opioid receptor agonists

PAGE 23

10 (which often cross-r eact with kappa opioid receptors) have a more powerful effect on males compared to females, an effect which is reversed in humans. Gonadal hormones (estrogens and andr ogens) also have a pronounced effect on pain thresholds in male and female rats (L iu and Gintzler 2000; Aloisi 2003). Women exhibit a significantly lower to lerance time compared to their male counterpart, as well as rate the predicted pain tole rance lower at the start of the study, suggesting a lower capacity to withstand pain than males (Rollman et al. 2004). It is hypothesized that due to the different biological demands on the ma le and female body, women experience pain earlier (e.g. at the onset of menses) and experience more pain more often due to the menstrual cycle. This cycling painful experi ence is the reason women are more vigilant about pain and seek healthcare more often than men (Stenberg a nd Wall 1995; Crombez et al. 1999; Aldrich et al. 2000). This theory extrapolates that because of this continuing cycle of pain, the nervous system becomes plastic and that more women undergo peripheral sensitization, which may alter the activity of the primary afferent neurons (Taddito et al. 1997, Craig and Andrew 2002, Woolf and Salter 2000). Many chronic pain conditions not involving the sex organs are more predominant in females, such as irritable bowel syndrome, biliary colic, oesoph agitis, interstitial cy stitis, fibromyalgia, rheumatiod arthritis, and temporomandibular disorder (Unruh 1996). Females rate an injection of intramuscular glutamate more pain ful than males (Cairns et al. 2001) and this may be attributed to the finding of differe nces in the descendi ng inhibitory control pathways in the two sexes after experimental muscular pain inducti on (Ge et al. 2003). Men may be able to better inhibit the muscle pain compared to females.

PAGE 24

11 An increase in pain sensitivity may also be attributed to psychological problems such as depression and panic disorders, as thes e patients have an increase of clinical pain complaints (Lautenbacher et al. 1999). In one study (Stephan et al. 2002), researchers using rats demonstrated that postnatal experiences such as maternal deprivation lead to differences in adult pain sensitivity, with ther e being an effect depe nding on the rat strain studied, as well as a sex differe nce. Female rats display an increase in pain sensitivity due to maternal deprivation across the strains, compared to their male counterparts. This increased sensitivity was shown to be reversib le in adulthood with chronic antidepressant treatment or by additional stimulation directly after maternal deprivation as a neonate. A positive family history of pain has been associated with increased pain complaints as well as greater experimental pain ratings in females, but not in males (Fillingim 2000). This study indicates a phys iological difference between the sexes, which is related genetically to family pain history. The extent to which this association between pain sensitivity and family history is driven by genetic versus environmental factors is not known. Candidate Genes The Opioid Receptor Family The opioid receptor family is paramount in analgesia. There are three classes of opioid receptors: , and Each family has distinct but also interactive functions and each is a product of a single gene, with so me alternative splicing resulting in several different isoforms (Pan et al. 1998; Pan et al. 2001). The receptors all have conserved transmembrane domains as well as intracellula r loops, with class differences found in the extracellular loops, and the amino and the car boxy ends of the protein (Chaturvedi et al. 2000). Opioid receptors are found in non-neurona l cells as well as the CNS. The three

PAGE 25

12 receptor types, although they are conserved in structure, have divergent expression patterns and regulatory mechanisms (Wei and Loh 2002). Heteroas well as homodimers of the receptors are formed in the plasma membrane of peripheral neurons. A gene on chromosome 6, containing f our exons, encodes the (mu) opioid receptor. It is involved in the targeting and preferential binding of morphine. It has been previously reported that allelic variations in th e opioid receptor lead to alterations in the endogenous system related to addiction suscep tibility (Liu and Pr ather 2001). The two best characterized polymorphisms are in exon one of the opioid receptor gene ( OPRM1 ), which encodes the extracellular domain of this G protein coupled transmembrane receptor. These polymorphism s are A118G (N40D at the protein level) and C17T (A6V). All the other known variants have a rare allele frequency of <5%, and no functional analysis has been attempted. Va riations in the 5’ regulatory region have also been found, but they do not appear to a ffect gene regulation (Mayer and Hollt 2001). The A118G SNP (single nucleotide polymor phism) has been functionally shown to specifically affect endorphin binding (ligand of the endogenous opioid analgesic pathway) to the receptor, and eliminates the putative N-glycosylation site that the asparagine provided in the extracellular domain (Bond et al. 1998; Mayer and Hollt 2001). The endorphin binding affi nity is increased three fold for protein encoded by the G allele. Binding of endorphin to the opioid rece ptor activates the receptor, which leads to activation of potassium channels (Bond, LaForge et al. 1998). The genetic variants of the (delta) opioid receptor (gene OPRD1 ) have been linked to the heredity of pain sensitivity in mice (Mogil et al. 1997) and humans (Kim et al. 2004). It has been shown that activity of the receptor is receptor mediated and that

PAGE 26

13 the receptor is found in the inactivated stat e intracellulary. Once the opioid receptor is activated, the opioid receptor is recruited to the membrane, and the and receptors have similar mechanisms of si gnaling (Cahill et al. 2001). The -opioid receptor can also heterodimerize with the and -opioid receptors (George et al. 2000; Gomes et al. 2000). The most frequent of the OPRD1 gene variants is T80G (F27C ), which is located in exon one and has a G allele frequency of 9% (Mayer and Hollt 2001).. The other predominant known variant is a silent polymorphism found in exon three, T921C. Although this is a silent mutation and the protein sequence is pr edicted to remain unaffected, this SNP has been linked to heroin abuse in the German population (Mayer and Hollt 2001). This suggests that either the silent variant might affect RNA splici ng/stability, or it could be in linkage disequilibrium with another variant that carries a functional effect. The (kappa) opioid receptor, whose gene ( OPRK1 ) is found on the q arm of chromosome 8, has been linked to sex differe nces in analgesia (Gear et al. 1996). The kappa opioid receptor has been shown to heterodimerize with the delta opioid receptor, having a binding affinity different to that of each homodimer (Wessendorf and Dooyema 2001) The most common variants known appear to be silent polymorphisms, which are not predicted to affect th e protein level. I am examin ing three of the most common SNP sites: G36T in exon one, and A843G and C846T in exon three (Mayer and Hollt 2001). These silent variants have proven negative in a few association studies of addictive disorders (Mayer a nd Hollt 2001), but there are no st udies of these variants in pain or analgesic responses.

PAGE 27

14 The Melanocortin Receptor Family The melanocortin receptor family is ve ry interesting because its members have diverse and distinct functions They are G protein coupled receptors (GPCRs) and belong to the rhodopsin group of receptors (Fredrik sson et al. 2003). Melanocortin 1 receptor (MC1R) has historically been known to be i nvolved in coat color and pigmentation. This receptor is involved in the activation of eu melanin synthesis by the binding of this receptor to its endogenous ligand ( melanocyte stimulating hormone, MSH) and adrenocorticotropic hormone (ACTH) (Mountjoy et al. 1992). MC1R is spliced from a precursor gene called proopiomelanocortin ( POMC ). Upon activation of the receptor, activation of adenyl cyclase occurs and th ere is an elevation of cAMP levels in melanocytes, leading to increased melanin and pigmentation. Human mutations in the MC1R gene are associated with red hair and fa ir skin (type I and II in the Fitzpatrick Clinic Scale) (Valverde et al 1995; Box et al. 1997). Rare individuals who are null at POMC have red hair, adrenal insufficien cy and are obese due to lack of MSH and also the lack of ability to stim ulate the whole melanocortin r eceptor family (Krude et al. 1998). Loss of function of the MC1R gene results in a yellow coat color in mice (Robbins et al. 1993; Jackson 1997) In rodents, there are tw o loci that control pigment colorextention and agouti Extention is also called MC1R and its endogenous antagonists are the agouti protei n (ASIP) (Lu et al. 1994) an d the agouti-related peptide (AGRP). A rescue study has been done in which the researchers expressed a MC1R containing bacterial artificial chromosome (BAC) transgene in Mc1r knock out mice and observed a darkening of the coat color in a copy number dependent ma nner (Healy et al. 2001). MC1R is expressed in a number of peri pheral tissues and cells including

PAGE 28

15 leukocytes, where it mediates anti-inflamatory actions as an inhibito r of pro-inflamatory cytokines (Chhajlani 1996; Lipton and Catani a 1998). MC1R has been shown to be expressed in the ventral periaqueductal grey (PAG) as well as in glial cells involved in the pain pathway (Xia et al. 1995; Wi kberg 1999). Futhermore, our group and collaborators recently showed that MC1R variants affect analgesic efficacy and that this system is mediated by the kappa opioid re ceptor and influenced by cycling estrogen (Mogil et al. 2003). This work will be further discussed in chapter 4. CALCA1/ CGRP Receptor CALCA1/ CGRP receptors are synthesized in the thyroid by the parafollicular cells and can mediate a reducti on in serum calcium levels. CALCA1/CGRP is a polycystronic gene, which is alternatively sp liced depending on the cell and tissue type into calcitonin (CALCA1), or the receptor for calcitonin ( CGRP). CGRP is a 6 exon gene product, which is only neuronally expr essed, and is an im portant regulator of vascular tone and blood flow. The CALCA1 gene product includes exon 4 while the CGRP product instead includes exon 5. The fi rst three exons are common in both gene products but exon 1 contains 5’ untranslated se quence. There are two other genes that are similar: CALCB which produces a second CGRP without alternative splicing, and CALCP which is a pseudogene. Elevated cerebr ospinal fluid CGRP levels have been found in patients with depre ssion (Mathe et al. 1994) and fibromyalgia (Vaeroy et al. 1989). Thus CGRP is a reasonable pain candidate gene as it is stimulated by the activated delta opioid receptor inhibited by kappa and mu opi oid receptor activation, and colocalizes in vesicles with Substance P (anot her neurotransmitter i nvolved in the pain

PAGE 29

16 pathway via the NMDA receptor) (Bao et al. 2003). CGRP causes vasodilation as a result of binding to CALCA1 receptors (Sato et al. 2000). Chronic Pain Conditions Irritable Bowel Syndrome Irritable bowel syndrome (IBS) is a common and often debilitating gastrointestinal disorder affecting up to 15% of the US popul ation, predominantly adult females (Talley 1999). It is characterized by recurrent abdominal discomfort or pain associated with altered bowel habits with diarrhea/constip ation, and is more common among women than men. There are specific crit eria associated with the di agnosis of IBS and these are reviewed by Talley (Talley 1998). A hallmark of IBS is enhanced sensitivity to visceral stimulation, and some patients have reporte d enhanced pain sensitivity in remote anatomical regions (Verne et al. 2001). Th e pathophysiology of IBS remains an enigma. Heredity has been shown to play an important role in this disorder through twin studies (Levy et al. 2001), and thus IBS is considered a multifactoral trait. A review of the literature indicated that there is a high como rbidity of irritable bowel syndrome with other functional gastrointestinal disorders and it is suggested that there may be a common pathophysiology. The review also mentions that IBS patients also suffer from other comorbid disorders such as depression, anxiety, fibromyalg ia (49% of IBS patients), chronic fatigue syndrome (51%), temporoma ndibular disorder (TMD ) (64%) and chronic pelvic pain (50%) (Whitehead et al. 2002). There is some evidence of generalized enhancement of pain sensitivity in IBS (Verne and Cerda 1997; Verne and Price 2002). Research has also examined the effects of sex hormones on visceral function and pain, there is a pronounced difference in pain sensit ivity across the menstrual phases (Bajaj et al. 2002). Men display a shorter gastrointestinal (GI) transit time especially in the right

PAGE 30

17 colon (Meier et al. 1995), and postprandial gastric relaxation is longer in females (Mearadji et al. 2001). It has been shown that bowel movements in females are altered during the menstrual cycle with prolonged GI transit times in the leuteal phase of the cycle (when progesterone is in creased). Progesterone is a smooth muscle relaxant which might explain the gender differences in viscer al pain (Wald et al. 1981; Waliszewski et al. 1997). It is interesting that IBS patie nts report an increase in symptoms during menses (Heitkemper et al. 1993). There is a ra t model of the pathogene sis of this disease, which is achieved by the rectal injection of mustard oil which persists to cause a state of chronic visceral hypersensitivity (Al-Chaer et al. 2000). There is a mouse model of post infectious gut dysfunction, which leads to muscle hypercontractility and this study implicates a few genes in gut dysfunction. The investigators believe that post infectious irritable bowel syndrome may be a result of Th2 cytokine induced expression of TGF 1 and an up-regulation of the COX-2 and PGE2 in smooth muscle cells (Akiho et al. 2005). Fibromyalgia Fibromyalgia syndrome (FMS) is a rheumatological condition characterized by chronic widespread muscle pain, which aff ects women disproportiona tely (Staud 2002). FMS is associated with gene ral soft tissue sensitivity in the body, lack of REM sleep, fatigue, parethesia, numbness, headache, swelli ng, and some patients may have other pain syndromes such as IBS. Ninety percent of patients are women and about half of them suffer with IBS in addition to their FMS sy mptoms (Wallace 1997). A specific diagnosis is usually made by excluding other diseases based on symptoms. FMS is characterized by a generalized heightened pain sensitiv ity to mechanical and non-mechanical stimulation, and its pathogenesis remains uncl ear. These patients display quantitative

PAGE 31

18 abnormalities in pain perception under experime ntal conditions, in the form of allodynia (pain with innocuous stimuli) as well as hypera lgesia (increased sens itivity to a painful stimulus) (Staud and Smitherman 2002). Ma ny FMS patients also meet Diagnostic and Statistical Manual of Mental Disorders VI (D SM VI) criteria for mood disorders such as depression. The precursor to serotonin, a molecule called 5-hydroxy-tryptophan (5HTP), has been the subject of heated debate as to it s role in the pathology of this disease but the data remain inconclusive (Wolfe et al. 1997; Juhl 1998; Alnigeni s and Barland 2001). This leaves the pathology of this debili tating syndrome open to other incriminating molecules, which we are investigating. In one study, 46% of affected patients reported a positive familial history of FMS (Offenbaecher et al. 1998), also implicating a genetic predisposition. In the subsequent chapters, I describe my work as part of a collaborative group of human and mouse geneticists, pain researcher s and physicians. Our goal has been to test candidate gene polymorphisms for a role in pa in sensitivity, chronic pain, or response to pain medication. Furthermore, I undertook a laboratory investigation to study whether delta or kappa opioid receptor polymo rphisms might have altered function.

PAGE 32

19 CHAPTER 2 MATERIALS AND METHODS Candidate Gene Selection Literature Search Pubmed (NCBI) was used to search current literature to identify genes involved in the pain pathway that might play a role in pa in sensitivity and analgesia. The literature was examined and candidate genes were selected. Single Nucleotide Polymorphism (SNP) Selection Single nucleotide polymorphisms for candi date genes were identified using the NCBI websites Entrez SNP or Entrez Nucleoti de databases. Only SNPs with a minor allele frequency of 5% were used, based on the probabl e final sample size we expected to have (200 people per patient population). Th is was to ensure we would have sufficient power to detect association. Genotyping Primer Design And Synthesis PCR primers were designed using seve ral different methods. The primer 3 program (Whitehead Institute, MIT http://frodo.wi.mit.edu/cgibin/primer3/primer3_www.cgi) was used in selection of primers flanking some SNPs using nucleotide sequence obtained from the NC BI website. Primers reported in current literature were also used for some SNPs. Primers were synthesized by the Qiagen Operon company (Valencia, California). Prim er sequences and PCR conditions are listed in table 2-1.

PAGE 33

20 Polymerase Chain Reaction (PCR) Primer annealing temperatures were optim ized using a gradient PCR machine (MJ Research). Conditions varied for each speci fic primer set (see table 2-1). Either Hotmaster Taq (Eppendorf) or home-made Taq polymerase (made using Qiagen protocol) was used in polymerase chain reac tion at a concentrati on of 0.62U per reaction (initial concentration of stock is 5U per microliter). For the Hotmaster reactions, the buffer provided was used at a concentration of 1X (2.5L per reacti on for a total reaction volume of 25L). For the home-made Taq polymerase, Roche Applied Science (Indianapolis, Indiana) PCR buffer was use d. dNTPs (Invitrogen) were used at a concentration of 10mM and th e primer concentration was 10n g per reaction. Some PCR reactions required the addition of DMSO to abate the nonspecific binding of the primers to the genomic DNA. The genomic DNA for each subject was added at a quantity of 50100ng per reaction. The amplification was performed on either a MJ Research PCR machine (PTC 200) or a Hybaid (Thermo) PCR machine as follows: 95 C for an initial 5 minutes, then cycling (35X) at 95 C for 30 seconds, the specific annealing temperature for 30 seconds and then an extension at 72 C for 45 seconds. A final extension was performed for 10 minutes before the PCR was completed. SNP Analysis PCR products were visualized by electrophor esis and ethidium bromide staining on a 1.2% agarose gel (Bio-Rad). These products we re either sequenced or digested to allow SNP detection, depending on the SNP as outlined in table 2-1. For restriction enzyme digests, 5L of PCR product was used with 2L of the appropriate restriction enzyme buffer, along with 0.5L of enzyme in a final volume of 20L (the reaction was spiked

PAGE 34

21 with 0.5L of enzyme after the first hour of digestion at the manufacturer’s recommended temperature, to maximize the digestion efficiency). Digests were separated on a 1.6mm 8% native polyacrylam ide gel (10mL 40% acrylamide, 5mL Tris buffer, 34.7mL dH2O, 40 L temed and 300L ammonium persulfate) for two hours at 200V and were visualized by ethidium br omide staining. Cycle sequencing of PCR products utilized an ABI Prism R310 sequencer and Big Dye chemistry 2.0 at a dilution of , using the PCR primers as sequencing pr imers. PCR products were purified using Millipore microcon filters (Fisher Scientif ic) and sequencing reactions were purified using Edge Biosystem sephadex columns (G aitherburg, Maryland). Sequence data analysis was done using the Sequencher pr ogram (Gene Codes Corporation, Ann Arbor, Michigan). Some of the genotyping was done using the pyrosequencing core at the University of Florida, once the sample size became unmanageable for manual sequencing. The full list of genotyping is depicted in the appendix. Cloning Opioid Clones The delta opioid cDNA clone was a gener ous gift from the lab of Dr. Brigitte Kieffer at the Louis Pasteur Institute in Paris, France. The kappa opioid receptor cDNA was a gift from Dr. Liu-Chen at Temple University in Philadelphia, USA. Upon receiving the clones, primers with a Kozak sequence at the 5’ end and restriction sites specific fo r the multiple cloning site of the pcDNA3.1v5/his (Invitrogen) were synthesized (figure 2-1) (Qiagen Op eron) and PCR was performed using the high fidelity Taq polymerase Discoverase (Invitroge n). The PCR products were cloned into the TOPO4 vector (Invitrogen) a nd were transformed into TOP10 E. coli cells using the manufacturer’s protocol. Cells were plated on LB agar plates containing 100 g/mL

PAGE 35

22 ampicillin. Single colonies were selected after 16 hours at 37 C, and grown in 4mL of LB broth with ampicillin at a fi nal concentration of 100g/ml ove rnight. Plasmid mini preps were performed the next day using the Qi agen mini prep kit, following the manual provided in the kit. The clones were scr eened for an insert using single and double restriction digests, and positive clones were then sequenced with Big Dye 2.0 chemistry as described above except for that Big Dye wa s used at a dilution. The sequences were generated by the Center for Mammalian Genetics (CMG) core. Once the correct sequence was identified, glycer ol stocks of this clone were made using 1mL of the overnight culture mixed with 1mL of a 60% glycerol solution, and stored at -80 C. Site Directed Mutagenesis Four inconsistencies were found in our OPRD1 cDNA sequence compared to the NCBI entry (NM_000911.2). We set out to co rrect our sequence a nd also create the more common T allele (the original construc t from France had a G at this SNP location) by using the Stratagene QuikChange Multi Site-Directed Mutagenesis Kit. Four 5’ phoshorylated primers were synthesized (Qia gen Operon) to incorporate the desired change into the plasmid seque nce (see Table 2-2). For OPRK1 changes were introduced with site-directed mutagenesis. After the PCR and parental strand digestion with DpnI was performed, the single stranded plasmid was transformed into Stratagene XLgold ultracompetent E. coli cells. Single colonies were se lected and grown in liquid media under ampicillin selection as described above. Mini preparations we re performed and the colonies were screened for the correct seque nce by using the cloning primers. Once the desired clone was found, inserts were then digested using the specified restriction enzymes (method described above). The mammalian expression vector (pcDNA.1

PAGE 36

23 v5/his) was digested with the same enzymes. In the case of the delta opioid receptor, the restriction sites were HindIII on the 5’ site and BstB1 (isoschizomer of Sfu1) at the 3’ end of the insert. For OPRK1 HindIII was designed into the 5’ primer and AgeI on the 3’ primer. The digested plasmids were r un on a 1.2% low melt agarose gel and excised and extracted using the Qiagen gel extraction k it. The inserts were subsequently ligated into the expression vector using DNA T4 ligase (1l emzyme, 2l ligase buffer, 3 l insert, 1l vector and 13l d2H2O) and this was incubated at 4 C overnight. After incubation, 10l of the ligation reaction was transformed into Stratagene XL1-Blue E. coli cells and incubated on LB agar with 100g/ml ampicillin at 37 C overnight. Single colonies were selected and grown in liquid LB ampicillin media for 16 hours at 37 C. mini preps were done as described above and th e plasmids were screened as above. Once positive clones were identified they were sequenced by using the forward flanking primer on the mammalian expression vector and the reverse cloning primer. Once sequence was confirmed, a maxi plasmid prep was performe d using the Qiagen Maxi prep kit from a 500ml culture of a desired colony. The ma xiprep plasmid DNA was quantified with a spectrophotometer (Bio-Rad). Tissue Culture Stable Transfections HEK 293 cells (human embryonic kidney immort al cell line) were transfected with recombinant pcDNA3.1 vectors (OPRD1, OPRK1) as follows. In a 1ml transfection reaction, I added 20g of plasmid DNA, 50l 2.5M calcium chloride (CaCl), 450 l N-Nbis(2-hydroxylethly)-2-aminoethane-sulfoni c acid(BES) buffered saline (BBS), and 500 l autoclaved deionized water. This reac tion was incubated for 10 minutes at room

PAGE 37

24 temperature and then was added to a 10cm ti ssue culture plate with HEK 293 cells at ~60% confluency. The plates were incubated for 24 hours at 33 C with 3% CO2. The 293 media (Dilbecco Modified Eagle Medium -DMEM) with 10% neonatal calf serum (NCS), 1% penicillin, 1% streptomycin (Gib co-BRL) was changed after this time and the plates were then incubated for a further 24 hours at normal incubation parameters (37 C and 5% CO2). After the next 24 hours the cells were split if they were at 90% confluency and then put under selection using 0.31g Gene ticin (SigmaRBI), in 500ml DMEM (10% Fetal Bovine Serum (FBS)) which was filter ster ilized. The transformed cells were kept under selection conditions for th ree to five weeks and were then frozen in DMEM with 10% FBS and 10% DMSO. The cells were kept in liquid nitrogen. Characterization and Verification of Stably Transfected Cell Lines Gene expression levels Transformed HEK 293 cells were defroste d from liquid nitrogen and grown in 293 media until confluent. The media was change d after 24 hours post defrost to remove the DMSO from the cells. These cells were no longer under selection conditions. Once confluent, the cells were count ed and then plated out at co ncentrations that included 200 cells per 10cm dish as well as 1000 cells pe r dish, 5000 cells per dish and 10,000 cells per dish. These cells were monitored to detect single cell colonies. Cloning rings (Fisher) and silicone grease was used to isolate thes e single cell colonies by trypsinization (Gibco 0.25%) and moved into a 24-well plate to grow until confluent. Once these single cell colonies were confluent, the cells were split into two 6 well plates a nd allowed to grow to confluency once again. One of the plates was washed with 1mL phosphate buffered saline pH 7.4 (PBS, Gibco) followed by lysi s with 750l Trizol (Invitrogen) for RNA

PAGE 38

25 extraction. The RNA was resuspended in 50l of DEPC treated water (Ambion), and 1l of the RNA was run on a 1.2% TAE agarose gel with ethidium bromide to observe general quality and quantity under UV illumi nation. Another microliter was used for spectrophotometric quantification. For northern blot, the RNA was subjected to electrophoresis on a 1% agarose gel made with 1X MOPS buffer and 6% formaldehyde (Fisher Scientific). The appropriate amount of RNA was added to an individuall y wrapped RNAse free eppendorf tube along with 16 l loading buffer (300l formamide, 105l filter sterilized 37% formaldehyde solution, 60l tracking dye, 60l 10X filter sterilized MOPS buffer and 3l ethidium bromide). The samples were incubated at 65 C for 10 minutes and then electroporated on the formaldehyde gel at 4 C in 1xMOPS at 105V for one hour and fifteen minutes. An RNA ladder was run with the samples (I nvitrogen). The gel was then photographed using the Eagle Eye photo documentation system. The 28S, 18S and 5S ribosomal subunits were marked on the gel using India ink, and the molecular weight markers from the ladder were measured using a ruler relative to the wells of the gel. The gel was then blotted overnight using two pieces of Whatma nn 3MM paper as a wick to allow the 20x SSC to be absorbed through the gel. Th e Gel was placed upside down, with the Hybond N+ (Amersham Biosciences/GE Healthcare, Piscataway, New Jersey) nylon membrane placed on top of the gel. Two pieces of Whatmann 3MM paper and a stack of paper towels were placed on top of the membrane. A plate was applied to the top and then it was all weighted down for an overnight transf er. The next day, the blot was dismantled, and the wells were marked on the membrane using a pencil and writing directly through the gel. The 28S, 18S and 5S subunits were also marked on the gel at this time and the

PAGE 39

26 lanes were numbered. The membrane was then placed in the vacuum dryer for 2 hours to allow cross-linking of the RNA to the membrane. The full-length cDNA PCR products were used as a probe for the Northern blot. A actin PCR product was used as a probe in a separate hybridization to control for loading. Approximately 20ng of the products were used for radiolabeling. Five microliters of random primers were added to the product in 11.5 l, boiled for 5 minutes and then put on ice. To the cooled tube, 5 l of dCTP buffer was added as well as 2.5l [P32]dCTP (25Ci) (Amersham Biosciences/GE healthcare, Piscataway, New Jersey) and 0.8l Klenow polymerase fragment (Stratagene PrimeIt II labeling kit). This was gently mixed and incubated at 37 C for at least 15 minutes. Th e labeling reaction was purified using a Quiagen kit. The manufacturer’s pr otocol was followed and then the probe was boiled for 5 minutes. The blot was briefly so aked in 2xSSC and then allowed to prehybridize in 20ml Church and Gilbert hybrid ization solution (500mM sodium phosphate pH7.2, 7% SDS) for 30 minutes in a glass hybridization tube in a 65 C rotator. After the pre-hybridization step, the solution was rem oved and another 5ml of the hybridization solution was added to the blot as well as the 200 l of the probe. This was returned to the 65 C rotator to hybridize overnight. The next day, the hybridization solution was removed and the blot was washed twice with 65 C 1xSSC, 0.1%SDS for 15 minutes each. The blot was then wash ed with 0.1xSSC, 0.1%SDS at 65 C for 20 minutes. The blot was then allowed to dry slightly, wr apped in saran wrap, and placed between two screens in an x-ray cassette. An x-ray film (Kodak XAR)was exposed to the blot at 80 C for 2-7 days, and the film then developed in an automated film developer. The blot

PAGE 40

27 was then stripped in 0.1xSSC, 0.1%SDS by mi crowaving until the solution boiled, and re-probed using the -actin probe in the same manner as described above. Protein expression levels A western blot was performed to see the re lative expression from the plasmids at the protein level. Stably transfected cells we re grown on a plate to confluency. The cells were trypsinized, 5ml of PBS was added and th e cells were transferred to a 15ml conical tube. They were then spun down at 500g for 5 minutes and the supernatant was removed by aspiration. 5ml of PBS was added and th e cells were resuspended and then recentrifuged for a further 5 minutes. After the PBS was decanted, 1ml of RIPA protein lysis solution (250mM NaCl, 50mM Tris -HCl pH7.4, 1% Nonident NP-40, 0.25% Na deoxycholate in H20 with 1x complete protease inhib itor cocktail (Boehringer-Mann) added right before use) was added to the ce lls. The lysate was transferred to a 1.5mL microfuge tube kept on ice. The cells were further mechanically disrupted by sonication 2x for 5 second bursts from the probe sonicator set at 30. The lysate was centrifuged at 10,000g for 5 minutes at 4 C, and the supernatant was then transferred to a new tube. Samples were then mixed with sodium dod ecyl sulfatecontaining electrophoresis loading buffer containing 2mol/L urea and 5% 2-ME to denature the proteins, and then the samples were boiled for 10 minutes. 50g of each cell lysate were loaded onto a precast 12% mini SDS-acrylamide gel and run at 4 C overnight at 45mA run in a MOPSSDS running buffer. The next day, the sample s were electroblotted to nitrocellulose sheets in transfer buffer contai ning 0.1%SDS. The blot was rinsed in 1X Tris buffered saline (TBS) 3x for 5 minutes each and then the blot was blocked in 1% BSA/5% milk for one hour. After blocking, the blot was washed once again in TBS 3x for 5 minutes

PAGE 41

28 and then I added a 1:2000 dilution of Alka line Phosphatase conjugated anti-his antibody (Invitrogen, Calsbad, California) along with 0.1% Tween-20 and 1% non-fat dry milk. The primary antibody was left on the blot overn ight. The next day, the primary solution was removed and the blot was washed. Ne xt, a chemiluminescent developing solution was added, which consisted of NBT, BCIP, in NTMT (5M NaCl, Tris-HCl pH 9.2, 1M MgCl2, 10% Triton-X). After the blot had developed sufficiently, the solution was removed and the blot was analy zed by exposure to x-ray film. Functional Analysis Immunocytochemistry Stably transfected HEK 293 cells were gr own on an 8 well chamber slide (Fisher) until about 50% confluent. The media was then removed and the cells were washed with 200l of PBS per well. This was removed 5 minutes later, and 200l of 100% methanol was added for 5 minutes to allow the fixing of the cells. After this incubation the cells were washed twice for 5 minutes each, with PBS. The cells were then blocked by the addition of 200l of PBS with 10% FBS and were incubated for 20 minutes at room temperature. After the blocking solution was removed, a PBS/10% FBS solution with either a 1:250, 1:500 or a 1:1000 dilution of the FITC conjugated anti-his antibody was added. Analysis of the slides wa s done using fluorescent microscopy. cAMP Activation Assays The Stable cell lines were transfected as described above with a pCRE plasmid containing the -galactosidase gene. This transfecti on was transient, so the cells were left to grow for 48 hours and then stimulate d by the addition of a sequential dilution of agonists ( -endorphin, DPDPE for OPRD1 and D ynorphin A, U69593 and Tan 67 for OPRK1-Sigma Aldrich, St. Louis, Missouri). These serial dilutions of agonists were

PAGE 42

29 made starting at 10-4 or 10-6 depending on the stock concentration. The dilutions were made in media containing 1X 3 isobutyl-1 -methylxanthine (IBMX), which inhibits intracellular phosphodiesterase and allows for the accumulation of cAMP. Included also in half of the dilutions was forskolin, which activates the receptor in the absence of ligand as the opioid receptors decrease the cAMP levels in the cell. The dilutions were added to the wells in duplicate (150 l/well), in a dose dependent manner and were incubated at 37 C with 5% CO2 for 6 hours and then lysed using 50 l/well cell lysis buffer (250mM Tris-HCl pH=8.0, 0.1% Triton X-100 in H20). A protein assay was performed on 1020% of the lysate by Bradford analysis usi ng a commercial protein dye (Bio-Rad), while the rest of the lysate was mi xed with an ortho-nitro-phenyl-D-galactopyranoside (ONPG) solution (for 100mL: 84.05mL dH20, 15mL 0.4M Na2HPO4, 100 l 1M MgCl2, 500 l 2M KCl, 200mg ONPG). Afte r addition of this solution, the plates were incubated at 37 C to aid in developing, and samples were measured at a wavelength of 405nM at various intervals.

PAGE 43

30Table 2-1 Primer sequences and PCR conditi ons as well as genotyping detection strategy. Gene (SNP) PCR Primers Strategy Annealing temp. MC1R (V60L, K65N, D84E, V92M) 5’-cct ggc agc acc atg aac ta 3’aga ggc tgg aca gca tgg Sequence (494 bp) 62 C MC1R (R151C, R160W, R163Q ) 5’-tgc agc agc tgg aca aat g 3’atg tgg acg tac agc acg g Sequence (292 bp) 62 C MC1R (D294H ) 5’-tgc atc tca cac tca tcg tcc 3’-ata tca cca cct ccc tct gcc Digest 228 bp PCR product with TaqI restriction enzyme 62 C OPRM1 (C17T, A118G) 5’-gaa aag tct cgg tgc tcc tg 3’-gca cac gat gga gta gag gg Sequence (302 bp) 61 C OPRD1 (T80G ) 3’-cgc cgg ccc gca gcg gac tca 5’-gcg gcg gag ccg gcc ggc agc c Sequence (272 bp) 75 C OPRK1 (G36T) 3’-gag tag acc gcc gtg atg at 5’-atc ccc gat tca gat ctt cc Digest 203 bp product with PspOM1 60 C OPRK1 (A843G, C846T) 3’-ggc gta gag aat ggg att ca 5’-tga cta ctc ctg gtg gga cc Sequence (358 bp) 62 C CALCA1 (G855A, T-624C, C590G) 3’-ctc gtg gga aac aag aga cg 5’-agt aga gga ctg aag tgc ggg Digest 547 bp with BsmAI and AciI 65 C CALCA1 (Leu66Pro ) 3’-cct tcc tgt gta tga tgc tgc g 5’-gcc ctg tcc cct agg act c Digest 332 bp with AluI 65 C

PAGE 44

31 Figure 2-1 Vector maps made using the Vect or NTI software. A) illustrates the empty vector highlighting the features of the vector including the multiple cloning site. B) represents the OPRD cDNA inserted into the HindIII and SfuI sites. There were two vectors made for this gene, one representing each allele. C) depicts the OPRK1 gene in the HindIII and AgeI sites, which removed the V5 epitope tag from thes e constructs as there were al so two different constructs made in order to represent the two al leles of the OPRK G36T polymorphism

PAGE 45

32Name of Primer Primer Sequence (5’-3’) hDOR sense G80T [phos]ccctagcgccttccccagcgctgg hDOR sense T462C [phos]ctgccaccctgtcaaggccctggact hDOR sense A892G [phos]cgctggtggtggctgcgctgcacc hDOR sense G1108C/C1109G [ phos]ccggcggtggccgtgccgccttcg hKOR G36T-T ttccgcggggagcctggccctacctgcgccccgagc hKOR G36T-T rev gctcggggcgc aggtagggccaggctccccgcggaa Figure 2-2 List of primers used for the site directed mutagenesi s. The hDOR primers were 5’ phosphorylated as a multi change kit was used and all these primers were used in one reaction. For the T allele, the first primer on the list was left out as the original cDNA had a T allele in base pair positi on 80. For the hKOR vector, there were no other sequencing errors so a single change kit was used.

PAGE 46

33 CHAPTER 3 INTRODUCTION TO ASSOCIATION STUDIES Candidate Gene Approach Association studies have become the most popular method used today in the search for genes involved in complex genetic dis ease. The most common cause of Mendelian diseases is a single mutation resulting in a non-synonomous change in a codon, leading to an amino acid substitution or stop codon. Complex traits are mo re involved as both genetics and environment play a ro le in the pathogenic mechanism. Some consider association studi es to be a “fishing expedi tion,” without justification or a testable hypothesis (Eisenach 2004). Clinical pain genetics studies in humans are now underway, with justification based on recen t findings of differences in thermal and chemical stimulation to induce acute and chronic pain as well as nerve injury models in various inbred mouse strains (M ogil et al. 1999; Seltzer et al. 2001; Lariviere et al. 2002). These results suggest common genetic entities involved in pain pro cessing are conserved throughout the mammalian species. The unders tanding of genetic fa ctors involved in pain has been successfully approached from tw o different angles: 1) genetic screening of individuals with and without pain in order to identify nove l proteins involved in the development of pain or pain processing, and 2) the identification of high risk populations who may develop chronic pain (Eisenach 2004). Many association studies may lack power if the sample size is too small to elucidate a significant result, depending on the allele frequencies of the polymorphisms

PAGE 47

34 examined. The greater the heterozygosity, the smaller the sample size needs to be in order to observe a true asso ciation. One test of associ ation is to compare allele frequencies between cases and controls to a llow the ascertainment of any change in the relative risk based on genotype (Belfer et al. 2004). In addition to this important predictive benefit, a goal of association studies is to ultimately lead to identification of the actual genetic changes that effect susceptibility, therefore providing improved prediction and targets for therapy. Two recent successes in this area involve identifying culprit genetic changes in Type 1 Diabetes (Onengut-Gumuscu et al. 2004) and macular degeneration (Esfandiary et al. 2005). Because association studies lack a long-distance power like linkage analysis, it is importan t to test multiple SNPs in a gene (when possible) since an effect may not be revealed unless a genotyped SNP is very close to (or is) the actual pa thogenic change. As technology is still relatively expensiv e in performing association studies, we had to restrict the number of candidate genes to be studied, and these were chosen with the following criteria in mind: evidence of the gene being involved in pain processing, allele frequencies, and the lik elihood that the SNP may have a functional effect (Belfer et al. 2004). There are several different methods to predict the possible functional impact of a polymorphism based on whether it is locate d in the promotor re gion, the coding region, intronic regions or untranslated regions of the gene. If the polymorphism is located in the coding region, one can predict if the change is synonymous (silent) or non-synonymous, and how a non-synonymous change would affect the local environment of the protein. Protein prediction programs can ascertain if the change in the amino acid at the polymorphic position will have an effect on th e protein structure or function, but the

PAGE 48

35 caveat is that there has to be a structurally similar protein already in the database, which can act as a backbone for the assembly of the protein structure. In addition, even if an amino acid change does not affect structure significantly, it could be a key residue for post-translational modifications such as phosphorylation or glycosylation. Polymorphisms located within promoters may a ffect the structure of the promoter region, which may have an effect on how accessible this region is to transcri ption factors. They may directly affect binding affinity of thes e transcription factors or RNA polymerase to the promoter. Intronic polymorphisms may al so confer regulatory alterations to the RNA, as splicing motifs may be altered as a result (Mendell and Dietz 2001). SNPs in the untranslated region of the gene may a ffect RNA stability. Because finding genes involved in pain is still in its relative infa ncy, association studies are paramount to the progress in the pain field, to be followed by functional analysis. In the association studies done to date Quantitative Trait Locus (QTL) mapping has suggested to the researchers that most SN Ps involved in complex trait disease will be in the regulatory regions of the gene (Ki ng and Wilson 1975; Mackay 2001) even though most reported SNPs are in gene introns (Glazier et al. 2002). The Catechol-OMethyltransferase ( COMT ) gene, which has some SNPs in the promotor region of the gene, has been comprehensively researched with in the past few years and it has shed light on pain sensitivity as it relates to genetics (Zubieta et al. 2003). Recently, this gene’s effect has been examined using different potential haplotypes that are based on five common polymorphisms within the gene. Researchers identified three different haplotypes that encompass 96% of the human population, and these haplotypes were able to predict pain sensitivity as well as predic t individuals at risk for developing a chronic

PAGE 49

36 pain condition called myogenous temporomandibul ar disorder (Diatche nko et al. 2005). Haplotypes can be more powerful than single SNPs for some analyses. Silent coding-region SNPs have also been implicated in the pathogenesis of a disease state, which may reflect a linkage to a nearby functional SNP, or a haplotype effect, or an effect on RNA. For example, significant association was reported between a silent mutation in the FAS coding region and papillary thyroid carci noma (Basolo et al. 2004). Our laboratory examined the most pl ausible candidates involved in human pain sensitivity and analgesic effect as determin ed from mouse data, and inferences from literature. We assessed three different populations of partic ipants: a healthy subset of individuals, and two chronic pain groups who have either been diagnosed with fibromyalgia (FMS) or irritable bow el syndrome (IBS) but not both. As discussed in greater detail in chap ters 4 and 5, we measured a number of phenotypic variables in our subj ects. This included obvious items such as gender, age, ethnic background, and diagnosis. However we also attempted to gather data particularly helpful relative to certain candida te genes (skin tone/hair color for MC1R ), other clinical parameters and experimental pain test result s. Thus we had the possibility of finding significant associations of certain SNPs with only some variables, which could help shed some light on actual biochemical mechanisms. Statistical Analysis Two different types of anal yses are commonly used in the interpretation of an association study such as ours. These two st atistical methodologies are quantitative trait locus analysis (QTL) and analysis of vari ance (ANOVA). Although it is a characteristic of statistics to make certain assumptions with different algorithms, these have been

PAGE 50

37 considered and taken into acc ount in our analyses. ANOVA and QTL are being used to screen for relationships between the SNPs and the phenotypic data. QTL In order to perform QTL linkage of a mark er to a disease state, one must have a large experimental population. A QTL is the inferred location of a gene that affects a trait measured on a linear scale. These trai ts may be complex traits, being affected by more than one gene. This type of mapping has become commonplace due to the commercialization of molecular markers, which are highly polymorphic and easily genotyped, as well as the sequencing of the hum an and mouse genomes. QTL analysis is actually just a specific model of regre ssion and likelihood analysis (Henshall and Goddard 1999). This allows one to compar e marker genotype classes for different phenotypes instead of having to look at the ph enotype first. The regression model of statistics makes the assumption that there is a linear relations hip between the two variables of interest. ANOVA The analysis of variance is de signed to be used when one is comparing two or more different groups and there are multiple variables being examined. This statistical method is used to determine if the observed differences can be attributed to something other than just chance variation in the population. Wh en necessary, potential confounding variables (e.g. age ethnicity) can be controlled for us ing analysis of co-variance (ANCOVA). Usually from these statistics, a main effect is analyzed as well specific interactions in the population under analysis. ANOVA is more in tricate t-test and therefore has similar assumptions in its usage, which are that the standard deviations in the different populations are equal. This statistic also assumes that samples are randomly selected

PAGE 51

38 from the population ( http://www.ccnmtl.columbia.edu/projects/qmss/anova_about.html ). If we accept that each statistic has its own short-coming, we can proceed with analysis and lay a foundation for the unraveling of the comp lexity of the role of genetics in pain. ANOVA can help determine which variable s (such as genotype) account for what percentage of the variation in each phenotype measured. Negative Association Studies We examined a total of six different ge nes encompassing fifteen different SNPs. These 15 SNPs were genotyped in 347 hea lthy controls, 74 IBS patients and 97 FMS patients. The positive associ ations found are described in the following two chapters but here we will impart some of the negative re sults we have found, which can be almost as important. The raw data of our three different groups have been compared to each other. The OPRM1 SNPs do not have significantly diffe rent allele or genotype frequencies between the IBS patients, the FMS patients a nd the healthy subjects. The p values for C17T and A118G are 0.55 and 0.155 respectively, indicating that ther e is no significant difference between these groups of participants For OPRD1, the p value with respect to the T80G polymorphism between the diffe rent groups is 0.64, again indicating no significant difference between the three popul ations. 0.38 and 0.98 are the p values for the OPRK1 polymorphisms G36T and A843G, ho wever, the C846T polymorphism appears to be significantly different between the three populations, but upon examining the raw data, this significance seems to likely du e to rare allele effects, which may violate assumptions of our statistical test. The di fferent genotypes are divided up into three different groups; the homozygotes for the majo r allele (CC), the heterozygotes (CT), and the homozygotes for the minor allele (TT). In the healthy populati on, as well as the FMS patients, there are no individuals who are hom ozygous for the minor allele (TT), whereas,

PAGE 52

39 3.3% of the IBS patients have this genotype. Th is actual number of patients is 2. This is the only field where there is more than a 1% change in the allele frequency between genotypes and between groups, so this significant p value, in fact is not likely clinically significant and may be attr ibuted still to chance. The CALCA gene also showed in no convincingly positive results, as we found a p value of 0.42 for P4 and again we had a false positive for P2 (which includes two linked SNPs located 3 base pairs apart from each other) at 0.016. In this SNP analysis, we found that 2 people had the TTCC genotype in the normal population (constituting 0.58% of the group), and 3 individuals with IBS ha d this genotype (making up 4.1% of this group). However, given the implication of calcium metabolism in gut function, we hope additional subjects may strengthen this possi ble association. Ther e were a total of 514 individuals genotyped in this analysis. MC1R was not anal yzed in this case-control manner as we have shown that the minor allele s in this gene are associated with fair skinned people and this was not reported in th e medical files of the chronic pain patients. Our studies are ongoing, and due to the low numbe r of chronic pain patients we have at the moment, it may explain the lack of st atistical significance we have found in our populations. As our patient numbers grow, our results may change. In addition, further phenotypic data are being gathered, such that we can perform association analyses within each group to see if any clinical parameters rela te to genotype. Such data could be very helpful to understanding va riability in phenotype (e.g. why some IBS patients have diarrhea and others constipati on). A novel QTL algorithm is being developed for us by Dr. Rongling Wu (Dept. of Statistics) to he lp analyze our data using this method, which

PAGE 53

40 will also screen for haplotype effects. Thus the future may reveal additional discoveries from our work, based on new statistical analysis and additional clinical data.

PAGE 54

41 CHAPTER 4 THE MELANOCORTIN-1 RECEPTOR GENE MEDIATES SEX-SPECIFIC MECHANISMS OF ANALGESIA IN HUMANS MC1R We decided to investigate the melanocorti n-1 receptor gene because it has been implicated in pain sensitivity by QTL mappi ng in mice, which localized to the region where the MC1R gene is located (distal mouse chromosome 8). This was found to be linked to stress induced analgesia in female mice but not male mice (Mogil et al. 1997). Although this gene has classically only been related to the formation of pigment (Sturm et al. 1998), this QTL explai ned 17%-26% of the overall pa in variance in stress-induced analgesia-treated female mice. By embark ing on a murine study, it was found that the gene in this QTL respons ible was, in fact, the Mc1r gene. It was found that the mouse strain with a recessive yellow mutation (Mc1re/e) (Cone et al. 1996; Tatro 1996), carries a frameshift in the region encoding the sec ond extracellular loop of the protein. This frameshift leads to a completely non-functi onal receptor. When both sexes of these mutant and heterozygous mice were te sted for pain sensitivity by a 49 C hot water tail withdraw assay, both before and after the administrati on of U50,488, (a kappa opioid receptor selective agoni st) latencies were found to be si gnificantly longer in males and were blocked in males by the NMDA antagoni st MK-801 (Mogil et al. 1993). This MK801 blocking action was obliterated in female mice with the Mc1re/e genotype. This difference is related to cycling estrogen, as it was reversed by performing an ovariectomy and reinstated by subsequent hormone repl acement therapy. These data suggest that

PAGE 55

42 Mc1r functions in mediation of U50,488 anal gesia. This was the basis for studying effects of MC1R variants in human pain. This latter mouse research was done by our collaborator Dr. Jeffrey S. M ogil, and published along with our subsequent human data, led by Dr. Roger Fillingim and described below (Mogil, Wilson et al. 2003). Results Pentazocine Studies Redhead humans are analagous to the Mc1re/e mice since most redheads are compound heterozygotes or homozygotes for MC1R rare alleles, which in this context will be called mutant alleles. Three major MC1R variants have been identified in association with red-headedness, which in clude the amino acid substitutions R151C, R160W and D294H (Rees et al. 1999). Our lab examined additional polymorphisms in the gene, which included V60L, V92M, and R163 W. These variants have been shown to cause a loss of the function of the protein (Schioth et al. 1999; Scott et al. 2002). The MC1R gene coding region was sequenced for thes e three mutations and other variants as described in chapter 2. We tested 18 females and 24 males (all healthy) who had different natural skin types as well as hair color (see figure 4-1). The people with type 1 or 2 skin (those who always burn when in the sun and who are usually red headed) were found to have two MC1R variant alleles (5 females and 9 males), while participants with a darker skin type (those less likely to bur n upon exposure to sunlight) (13 females, 15 males) had one or no variant alleles. Thes e participants were tested for thermal and ischemic pain sensitivity and tolerance, bot h at baseline and after the intravenous bolus administration of either 0.5 mg/kg pentazocine or saline in a double blind randomized fashion. The thermal pain testing consisted of the administration of short, repetitive suprathreshold thermal stimuli to the right volar forearm, to assess temporal summation

PAGE 56

43 of pain (Price et al. 1977). These pulses of heat were at 52 C and each pulse lasted for <1 second with a 2.5s interval between pulse s, when the thermode returned to the baseline temperature of 40 C. The participants were asked to rate the pain on a scale of 0-100 and the assay was terminated when they rated the pain at 100 or asked that the assay be stopped. Only the first five pulses were used in the anal ysis, since 28% of the participants terminated the assay before al l 10 intended pulses were administered. The ischemic pain assay was conducted by the submaximal effort tourniquet procedure (Moore et al. 1979). The left arm was ex sanguinated by elevating the arm above the heart for 30s. A standard blood pressure cu ff was then inflated to 240mm of mercury. Participants were then asked to perform 20 handgrip exercises, whic h were performed at 50% of their maximum grip strength. A pain threshold measurement was recorded (when the subject first reported pain) as well as a pain tolerance measure (when the participant asked for the assay to be terminated). The maximum assay length was 15 minutes and subjects were asked also to rate the pain intensity and unpleasantne ss every minute. This clinical pain testing was conducted by our clinical psychology co llaborators under the guidance of Dr. Roger B. Fillingim at the UF/S hands Clinical Research Center. At these sessions, a vial of blood was collect ed for our genetic research. As expected, ischemic pain thresholds a nd tolerances were found to be increased after pentazocine administration, along with d ecreases in ratings of pain intensity and unpleasantness at the same time. There was al so a decrease in thermal pain intensity ratings after the drug bolus, which was not s een after the control saline dispensation (all p values <0.05 in relation to saline admini stration). These results suggest a strong analgesic effect of this drug. For ischemic pain, ANOVA showed th ere was a significant

PAGE 57

44 sex x genotype effect (P < 0.05) and this in teraction approached significance in thermal pain ratings (P = 0.056). In all the measur es, the significant eff ects of genotype were found in females but not males. In fact, ma les reported only modest analgesia at this dose, while females with two of the MC1R muta nt alleles (type I or II skin type and who tended to be redheads) displayed robust anal gesia against ischemic pain, and was the only group to show any noteworthy analgesia against thermal pain (figure 4-2). It is clear from our analyses that MC1R genotype was more reliable when considering skin type than hair color. We found that lighter ski nned people were much more likely have two or more rarer alleles compared to the darker sk inned subjects and this did not hold quite as true for hair color. These results were mirrored in the mouse studies where female mice with the D6/D6 genotype (which during the linkage studies had two copies of the nonfunctional Mc1r gene), had a higher analgesia rating as tested by tail withdrawal latency from a 49 C water bath at different time point s post U50,488 injection. The mice also demonstrated that this analgesic effect wa s mediated by the kappa opioid receptor as the non-functional strain of Mc1r mice was used for subsequent experiments on a B6 background. These Mc1re/e mice were given U50,488, then they were given either a saline injection or MK-801, which is an NMDA receptor antagonist. The analgesic effect was lost in male mice after antagonist injecti on irrespective of the genotype of the mouse, but the wildtype females had no effect afte r MK-801 injection, which was lost in the Mc1re/e mice. This experiment illustrated that the analgesic effect of the Mc1r gene is mediated by kappa opioid receptor activation. These data were published in 2003 (Mogil et al. 2003).

PAGE 58

45 M6G Data Pentazocine is not used as commonly as it once was in th e clinic. Thus, along with another group of collaborators who did the mous e work, we decided to look at the effect of M6G, a metabolite of morphine which acts mainly on the opioid receptor, and the MC1R gene. This agonist was administered su bcutaneously at a dos e of 0.3mg/kg. The pain testing was done slightly differently in this study at the labor atory of Dr. Albert Dahan in the Netherlands. Here acute pain was induced by the app lication of electrical current via two surface electrodes placed on th e skin over the tibial bone (the shin) on the left leg. Ten pulses of a 10Hz each were ad ministered for a duration of 0.1ms. The intensity of the electrical current was increa sed in a stepwise fashion of 0.5mA/s from 0mA to a cut off current of 128mA. The pa rticipants (47 in all: 29 redheads and 18 non redheads) were instructed to press a button when they could no l onger handle an increase in current and this measure became their pain tolerance measure and this also indicated the end of the stimulus. Genotyping showed that all the redheads had two or more MC1R mutant alleles, but none of the non-redheads. One of the redheads had an A insertion at base 27 which caused a frameshift, instead of the previously described alleles. Baseline pain tolerance differed signifi cantly between genotypes, with greater currents being tolerated by the participants with two MC1R mutant alleles (-20.9 (1.7 SEM) mA) compared to those subjects with zero or one mutant allele (-15.8 (1.2) mA) (p= 0.018, see figure 4-3). There was no signifi cant sex by genotype effect. The effect of the M6G analgesic was significantly higher in participants with two mutant alleles compared to those with 0-1 mutations. Th e area under the time effects curves (pain tolerance relative to baseline) was 1.49 (0.09) mA and 1.18 (0.04) mA respectively with p=0.003 (figure 4-6). These numbers suggest that there is an increase in tolerance due to

PAGE 59

46 M6G administration of 18% (4mA) in 0-1 muta nt allele people and 49% (10mA) in two mutant allele people (figure 4-5). Again, th is effect was not based on the sex of the participant, only the genotype, unlike pentazocine. The genot ypic differences seen in the patients can be attributed to the pharm acodynamics of the M6G ligand acting on the opioid receptor, as the plasma M6G concentra tions remained the same at different time points post injection between the two genotypi c groups (figure 4-7). Again, this human study was a translational resear ch project, and these results were mirrored in Dr. Mogil’s study of the Mc1re/e mouse model. In these mouse studies, wildtype B6 mice were used as controls and compared to their Mc1re/e littermates. These mice underwent a battery of pain tests such as withdrawal latencies from water either at 47 C or 49 C, a hotplate test, hot lamp test, binding clip test and a writhing test post 0.09% in ter peritoneal acetic acid injection. We published these da ta in 2005 (Mogil et al. 2005) Discussion Pentazocine Studies After murine QTL mapping and functiona l studies tested a candidate gene hypothesis, support for a female-spe cific role of Mc1r in pain sensitivity was evident. MC1R was tested and found to be the gene for th is phenotypic effect as it is expressed in the peripheral neurons as well as brain glial cells (Wikberg 1999) and neurons of the ventral periacqueductal grey (Xia, Wikberg et al. 1995), a region of the brain which is critical for the modulation of pain. The ex act relevant endogenous ligand of MC1R is unknown but one of the POMC gene splicing products is -MSH (melanocyte stimulating hormone), which is an endoge nous ligand. It has been shown that -MSH acts as an antagonist in thermal nociception (Walker et al. 1980; Ohkubo et al. 1985) and

PAGE 60

47 this ligand has also been reveal ed to have an anti-opioid role wherein it reduces tolerance of opioid ligands (Gispen et al. 1976). The regulation of -MSH release by -opioid receptors seems to be sexually dimorphic in humans (Manzanares et al. 1993), however our group has not been able to reproduce this result in mice. A possible ligand for the role of MC1R in this paradigm is the dynor phrin class, which are classically selective opioid receptor ligands, that bind the melanoc ortin receptors with nanomolar affinity (Quillan and Sadee 1997). Our research set up the hypothesis th at MC1R activation would cause an anti-opioid effect in female s, which red heads (fair skinned females) would lack. Pentazocine, which has activity at the -opioid receptor site, also has an affinity for the receptor as well. Our ne xt study using M6G actually addresses this point. These results suggest that there are qualitative sex differences in processing of pain inhibition. From these data, we can conc lude that females with two mutant alleles need a lower dose of pentazocine for the same analgesic effect that females feel who have zero or one mutations, and men. This wa s a ground breaking st udy, discovering that MC1R accounted for kappa opioid mediated pa in sensitivity in females. The NMDA receptor has long been known to mediate pain response in males, but not females, and we were able to fill this gap in knowledge. M6G study A problem with pain management is the variability between individuals in baseline pain sensitivity and the effects of analgesics (Aubrun et al. 2003). In this study, we have found a positive associ ation between the MC1R gene and pain tolera nce as well as a link to the efficacy of M6G. We have determ ined that there is a greater M6G induced analgesic responses in people w ho have two or more mutant MC1R alleles. We did not

PAGE 61

48 observe a sex dependent result with this drug as we sa w in the pentazocine study. However, the decreased pain sensitiv ity in these people with non-functional MC1R as well as the Mc1re/e mutant mice (compared to the wild type people and mice) implies that endogenous activation of MC1R may have an anti-analgesic effect. The reason we may not see any differences in baseline pain se nsitivity may be due to the different pain modality that was used in this study (electrical pain vs. ischemic and thermal pain used in our pentazocine study). Here, we have again demonstrated the power of direct mouse to human translation in genetic studies of a complex trait.

PAGE 62

49 Figure 4-1 The measures of pentazocine an algesia in humans by sex, hair and skin phenotypes, as well as MC1R genotypes. This is a comprehensive figure of all experimental pain testing compared to people grouped with regard to their hair color, skin type and MC1R genotype (Mogil et al. 2003).

PAGE 63

50 Figure 4-2 Change in pain ratings after pe ntazocine analgesia separated by sex and genotype. a) is the results of the therma l pain testing while b) is the result of ischemic pain testing. There was no difference between the groups in baseline pain measurements or response to saline administration across sex or genotype. The indicates a significant difference found in the sex between the two different genotypic groups (p<0.05) (Mogil et al. 2003).

PAGE 64

51 Figure 4-3 The grouping of subjects by the location of the SNP in the MC1R gene and a description of their phenotypic ch aracteristics (Mogil et al. 2005).

PAGE 65

52 Figure 4-4 Effects of MC1R functionality on baseline nociceptive and pain sensitivity in humans. These data are separated by ge notype only as significant effects of genotypes were observed in both se xes (* p<0.05) (Mogil et al. 2005).

PAGE 66

53 Figure 4-5 The change in pain tolerance ove r time after the administration of M6G at a dose of 0.3mg/kg. Here we have char ted the different genotypes of our participants and see a fu nctional difference in tole rance over time depending on the grouping (Mogil et al. 2005).

PAGE 67

54 Figure 4-6 M6G analgesia expressed as the area under the time effect curve. This is a significant measure (p<0.05) (Mogil et al. 2005). Figure 4-7 Concentrations of M6G plasma leve ls in participants at time points after M6G administration at a dose of 0.03mg/kg (Mogil et al. 2005).

PAGE 68

55 CHAPTER 5 THE A118G SINGLE NUCLEOTIDE POLYMORPHISM IN THE -OPIOID RECEPTOR GENE IS ASSOCIATED WITH PRESSURE PAIN SENSITIVITY Introduction In 1999, Uhl et al. suggested that the -opioid receptor gene ( OPRM1 ) may be a likely candidate to be involved in pain se nsitivity in humans. It is located on chromosome 6 at band q24-q25. There is a SN P located at nucleotide number 118 which changes the sequence from an A nucleotide (maj or allele) to a G (minor allele). When this change occurs, it causes an amino acid ch ange from a polar amino acid asparagine to the acidic amino acid aspartate (N40D). The G allele occurs in th e general population at a frequency of 20%-30% (Bond et al. 1998; Gros ch et al. 2001; Szeto et al. 2001). Until our study, no reports of associations with the OPRM1 gene and baseline pain sensitivity in humans had been published. In the past, pres sure pain threshold had been assessed in monozygotic and dizygotic twins and the result s suggested a 10% heritability, but these data may be skewed since th e twins were in the same room at the time of testing (MacGregor et al. 1997). Another group of investigat ors (Kim et al. 2004) found heritability of 22%-46% across three pain m odalities in healthy individuals. Several genetic association studies have been done in analgesic response. The -opioid agonist M6G has been demonstrated to reduce pup il constriction in subjects with a rarer OPRM1 allele (Lotsch et al. 2002), and the rarer G allele was associated with lower M6G potencies (Romberg et al. 2003). OPRM1 polymorphisms have been associated with opioid addiction and abuse in various studies in a case-control experimental design (Bond

PAGE 69

56 et al. 1998; Hoehe et al. 2000; S zeto et al. 2001; Tan et al. 20 03), but there are almost as many studies that have failed to replicate th ese results (Compton et al. 2003; Crowley et al. 2003; Franke et al. 2003). On the eviden ce of previous findings that aspartate in position 40 of the protein increased the bi nding affinity of this receptor’s endogenous ligand (Bond et al. 1998), we hypothesized that people with one or more of the G alleles would have diminished sensitivity to experime ntal pain. This was tested on a set of healthy individuals from Dr. Fillingim (n= 167). Results Genotyping disclosed that 24% of female s and 17% of males had one or two G alleles (24 and 12 individuals respectively). In all, 96 females and 71 males were genotyped and their demographic informati on recorded (figure 5-1). Because AG/GG individuals were older that those with the AA genotype (p < 0.05) and women were slightly younger than the male participants (p = 0.07), age was controlled for in all of our analyses. Our participants unde rwent the same ischemic and thermal testing as described in the previous chapter. These data are represented in figure 5-1. Women had significantly lower heat pain thresholds (HPTh p<0.05) and he at pain tolerances (HPTo p<0.001) compared to men, but there was no effect due to genotype (P>0.05). Individuals in this study a dditionally underwent pressure pain testing in which an algometer was used to apply pressure with a 1cm2 size probe at a rate of 1kg/sec. Pressure was applied to the masseter (appr oximately halfway between the ear opening and the corner of the mouth) the center of the right upper trapezius (posterior to the clavicle) as well as the right ulna (on the dorsal forearm, a bout 8cm distal to the elbow), with this measure taken at three different times For this measure, subjects were asked to report when the pressure first became pain ful (pressure pain threshold (PPT)). The

PAGE 70

57 results from the pressure pain testing are pr esented in figure 5-3 and show that there was a significant main effect of genotype that emer ged for pressure pain threshold (PPT) at all three measured sites. (trapezuis p = 0.002; ma sseter p = 0.023; ulna p = 0.049). At all three sites, individuals with at least one minor allele at th is locus displayed higher PPTs than those with two of the more major alle les. Women reported lower PPTs at all three sites compared to their male counterpar ts (p < 0.001). Women also described significantly higher heat pain ratings during temporal su mmation of pain at both temperatures (49 C and 52 C, p< 0.001), but there was no ov erall genetic effect (p > 0.10). There was, however, a sex by genotype effect for pain ratings at 49 C (p <0.05). No significant associations between the A 118G SNP and ischemic pain threshold (IPTh) or ischemic pain tolerance (IPTo) em erged from these data (p > 0.10). Discussion In this study, we examined a large gr oup of young adults a nd we found an A118G SNP allele frequency similar to those reported previously (Bond et al. 1998; Grosch et al. 2001; Szeto et al. 2001). The results indicate that having one or more OPRM1 G allele is associated with a lower sensitivity to pressu re pain than having the AA genotype. A sex by genotype interaction was observe d for heat pain ratings at 49 C, suggesting that the G allele was associated with lower pain ra tings among men and but a higher rating among women with the same genotype. A similar tre nd was seen in heat pain tolerance but it was not statistically significant (p = 0.08). As previously reported (Fillingim and Maixner 1995; Berkley 1997; Riley et al. 1998 ), women communicated lower heat pain tolerance, higher heat pain ra tings and lower pressure pain threshold compared to the men in our study. A possible explanati on of the associa tion between the OPRM1

PAGE 71

58 polymorphism and mechanical pain sensitivity is the observation that there is a greater binding affinity for -endorphin to the aspartate at amino acid 40 (Bond et al. 1998), which may allow for a more robust effect of endogenous opioid analgesia. This SNP may also be in linkage disequilibrium with other OPRM1 polymorphisms that contribute to this effect (Hoehe et al. 2000). There was a varying pattern of associations across different pain assays, between genotype and pa in perception. This may be explained by the fact that previous findings have only shown low to moderate associations between genotype and responses to diffe rent pain assays, which sugge sts distinct factors may be the culprit for the variability observed in the different pain measures (Janal et al. 1994; Fillingim et al. 1999). Parallel studies conducted in mice supported the genetic association found in our study (Lariviere et al. 2002). The mechanism underlying our association findings may be modulation of mechanical pain, either exclusively or preferentially. There is evidence suggesting that descending opioid systems inhibit deep pain more efficiently than cutaneous pain (Yu et al. 1991), whic h would explain the association we found to mechanical pain and the lack of associati on to thermal pain. There may be underlying associations with pa in modalities other than mechanical pain, but due to the relatively low frequency of the G allele a nd the size of our sample group, we may not have enough power to reach significance. This could explain why we found a marginal significance in heat pain tolera nce (p = 0.08) and the si gnificant association found in heat pain ratings at 49 C (p < 0.05) when examining the sex by genotype interaction of this SNP. These results reflect a marginally higher heat pain sensitivity among the G allele female group compared w ith the AA genotype females. Also, by analyzing the different means and effect si zes, the association of the G allele and

PAGE 72

59 mechanical pain appears to be stronger in men than women. These data advocate the continuing research of genetic contributions of candidate genes in pain sensitivity with special emphasis to be given to sex differen ces and the relative stre ngths of associations as it pertains to gender. Since our study has the potential to have been underpowered, we cannot rule out the possibili ty of an association of OPRM1 variants with heat or ischemic pain. As there are large varia tions in allele frequencies in different ethnic groups, this may affect studies conducted with mixed groups (Crowley et al. 2003), although race was controlled in our study. Our st udy is the first to find such A118G associations in these measures. If these data are reproduced in another group of participants, it would be worthy to investigate possi ble underlying mechanisms.

PAGE 73

60 Figure 5-1 This figure illustrated the deta ils of the subjects in this study. A) Represents the demographic informati on by genotype and sex. B) Shows heat pain and ischemic pain measures for male and female participants divided into OPRM1 A118G genotype (Fillingim et al. 2005).

PAGE 74

61 Figure 5-2 Pressure pain threshold at all thr ee sites tested (trapezi us at the top, masseter in the middle and ulna at the bottom). Men are depicted on the left and women on the right. Effect sizes (C ohen D) for the genotype effects are: trapezius, men=0.89, women=0.38, masseter, men=0.65, women=0.14 and ulna, men=0.61, women=0.11. Significance is presented on figure represents overall genotype effect for each site (Fillingim et al. 2005).

PAGE 75

62 CHAPTER 6 FUNCTIONAL ANALYSIS OF SING LE NUCLEOTIDE POLYMORPHISMS Introduction While our association studies have correlated pain phenotypes with polymorphisms, it would be clinically usef ul to elucidate the mechanisms underlying these associations. Functional studies are a logical method to assess the biochemical manner in which the polymorphism may aff ect the phenotype. Comprehensive studies have been performed on mouse models of Mc1r receptors rendered non-functional by the minor alleles (Cone et al. 1996; Tatro 1996). The mu opioid receptor has already been the subject of these kinds of studies, which s howed that the minor a llele at position 118 reduces receptor function (Bond et al. 1998). Th us, we decided to examine the effects of the different alleles of the delta and kappa opioid receptor. Discussed below is the rationale behind the studies, and our results. The Delta Opioid Receptor and T80G (F27C) The T allele at base number 80 is the more common allele at this position, while the G allele has been observed in this position at a frequency of 0.09 (Gelernter and Kranzler 2000) to 0.12 (Kim et al. 2004). This allele fr equency implies that one in ten alleles will be a G, and as we each have two alleles, this means about one in five people will have one or two G alleles. The T to G change in the nucleotide sequence converts the amino acid residue from a phenylalanine to a cysteine (F27C). Phenylalanine is an aromatic amino acid that is hydrophobic, while cysteine is polar and, because of its sulfhydryl side chain, has the ability to form disulphide bonds and make a sulphur bridge. This is

PAGE 76

63 involved in proteins forming their tertiary and quaternary structure, which confers functionality to the protein. With Dr. Mavi s Agbandje-McKenna, we have modeled this non-conservative change in the amino acid sequence using another G-protein coupled receptor (GPCR) as a basis. The GPCR used in the computer modeling of the delta opioid receptor is the bovine rhodopsin recept or. There is a 19% identity in the amino acid sequence and a further 33% similarity (ClustalW alignmen t). The phenylalanine in position 27 is conserved between the two GPCRs (see figure 6-1) (and in fact this residue is conserved in OPRD1 of rodents as well). In the com puter model, we changed residue 27 to a cysteine (figure 6-2) and have illustrated the potential difference in the local environment between the phenylalanine and cy steine in this position. In the past, research has focused on cloning this gene and functional analysis independent of naturally occurring SNPs (Evans et al. 1992) A mutation study was performed on the delta opioid receptor where all the cysteines we re replaced one by one with either a serine or an alanine, and testing of the expressed mutant protein suggested that the replacement of either extracellular cysteine resulted in a receptor lacking delta agonist or antagonist binding activity (Ehrlich et al. 1998). Thus the fact that the F27C SNP adds a cysteine in the extracellular region of the protein is an interesting aspect of our study. This natural allele variant has the potential for an alternate disulphide bridge formation. Recent studies have found positive associations of the delta opioid receptor F27C SNP and alterations in pain sensitivity (heat pain intensity) in a sex-dependent manner (Kim et al. 2004). These findings were consis tent with mouse studies, which suggested a sex-specific QTL on chromo some 4 (where murine Oprd1 is located), that mediates thermal nociception measured with a hot plat e (Mogil et al. 1997). Hot plate sensitivity

PAGE 77

64 differences have been noted between knock out mice and their w ildtype counterparts (Zhu et al. 1999). These data suggest that ge netic variants do affect the function of the protein. It has been our unde rtaking to elucidate possible functional differences of the delta opioid receptor protein variant F27C. The Kappa Opioid Receptor and G36T The delta opioid receptor is known to heterodimerize with the kappa opioid receptor and thus, modulate the function of each other (Jordan and Devi 1999). The heterodimer has a distinct function, with its ow n set of selective agoni sts. For this reason, we decided to examine the effects of the synonymous G36T polymorphism in the kappa opioid receptor, the most common SNP, since there are no known non-synonymous SNPs. Silent polymorphisms have been implicated in functional consequences in other systems. For example, a silent polymorphism in the delta opioid receptor (T307C), has been associated with biobehavioral phenotypes in heat pain intensities in humans (Kim, et al. 2004). This effect may be mediated through epigenetic mech anisms related to the nucleotide substitution (Dennis 2003). There is also evidence for synonymous SNPs having functional consequences as part of a haplotype, where compound heterozygotes have a different functional consequence from ea ch isolated polymorphism effect (Duan et al. 2003). The kappa opioid receptor has been implicated in visceral pain sensitivity (Simonin et al. 1998). That study found that kappa opioid receptor knock out mice displayed increased visceral wr ithing in response to an agent, compared to their wildtype littermates. Thus OPRK1 is a very intere sting receptor to stu dy in chronic pain conditions such as irritable bowel syndrome, and to study functionally with respect to natural variants. Thus, while the prior expe ctation is that there will be nonfunctional

PAGE 78

65 differences between the two alle les, there is justification to test this scientifically especially given the heterodimerization system with OPRD1 Results After unsuccessful attempts to clone the delta opioid receptor myself by RT-PCR (probably due to multiple amplicons from delta opioid receptor type 2) and low level of expression in leukocytes, we received the full-length receptor OPRD1 cDNA in pcDNA1 (Invitrogen) from the laboratory of Dr. Brigi tte Kieffer at the Louis Pasteur Institute in Paris, France. At the same time we request ed the cloned kappa opioi d receptor gene from Temple University in Philadelphia from the laboratory of Dr Liu-Chen. This cloned cDNA was in the pcDNA3 vector (Invitrogen ). After I performed site directed mutagenesis and sequencing to attain the desi red alleles, the vectors (cDNA inserts in pcDNA3.1 with C-terminal tags ) were transfected into HEK 293 cells (which have no endogenous opioid receptors) and underwent stab le selection using Geneticin (Gibco). Positive pooled colonies were used initially in functional analysis. However, these showed a negative western blot analysis usi ng a tagged antibody to de tect the His tag at the carboxy terminus and were negative for immunocytochemistry. Thus, we proceeded with making clonal populations of transfected cells. Activation assays were also performed on the pooled stable cell lines, whic h were frozen down in different aliquots due to having to split the cells before init ial selection. These da ta suggested that the protein was not being expressed (figure6-3), as there was no dose response curve. After clonal selection, the clones we re frozen and protein and R NA extracted. The clones were screened for expression by northern blot (fig ure 6-4), and 1-3 clone s were chosen from each allele: a low expressing cell line, a medium expressing cell line and a high expressing cell line. Three clones were not always available for each allele, as high

PAGE 79

66 expressing clones tended to die before we could freeze down the colony. The surviving clones underwent western blotting to test for protein expression. Two different antibodies were used for th is purpose: an alkaline phospha tase (AP) conjugated antihistidine antibody (Invitrogen), and a polycl onal anti-histid ine antibody (Covance), with an AP secondary antibody. Two different met hods were used for detection as well: AP development using NBT and BCIP as well as an chemiluminescent (ECL) method (Pierce). A positive control protein consis ted of a his-tagged protein, which was 40.8kDa in size. The ECL method produced the cleare st results, which were negative for opioid receptors but positive for the control protein (figure 6-5). Immunofluorescent analysis of the colonies (immunocytochemistry) revealed only background fluorescence in the cells, and binding assays showed no dose response curv e. Together these data suggest that there is little or no expressed r ecombinant protein in the clones. As a secondary test, the v ectors were transfected in to COS-7 cells, using the Fugene reagent (Roche) in a 3:2 ratio. A total of four 10cm2 plates were transfected with each vector, and a -galactosidase reporter gene was co transfected into two of the four plates. These two plates were subsequently used in binding assays two days later, while in the same time frame, one of the two remaining plates was harvested in Laemli buffer (Bio-Rad) with 5% beta-mercaptoethanol (B ME, Sigma). The last plate was split 24 hours post transfection onto 4-well chamber slides, grown overnight and then fixed, permeabalized and immunostained with the anti-his antibodies. This immunocytochemistry revealed no signal above background, while ther e was a total lack of a dose response curve in the binding assa ys and yet another negative western blot (figure 6-6). In a separate experiment to analyze possible quantita tive or splicing effects

PAGE 80

67 of OPRK1 G36T by itself, RT-PCR of a portion of the cDNA (and GAPDH as a control) was done using leukocyte RNA from individu als who had genotypes GG and GT. There was no difference in expression levels by RT in the GG sample compared to the heterozygote in the kappa RNA, nor any aberra nt bands (data not shown). This indicates that the minor allele does not obviou sly affect expression of the gene. Discussion The vector sequence is normal and in fram e, including the his tag, prior to the stop codon. Planning of the construct included rem oving as much of the multiple cloning site (MCS) as possible as to remove the most extran eous material out of the finished product. In fact, the whole MCS was removed (see figure 2-1 chapter 2), from the first restriction site (HindIII) to the SfuI site in the case of the delta opioid receptor alleles, and the AgeI site in the kappa opioid receptor vectors. A Kozak sequence was added 5’ the translation start site to aid in expression of the gene. The mRNA was about 1.2kb, which is the e xpected size, and this was confirmed via both northern blot analysis and RT PCR. We could even visualize the difference in expression levels of each of th e single clones via RT PCR (f igure 6-7). There were three different bands in the northern blot analys is of the receptor RNAs, using a full-length cDNA probe. The three-band pattern has been reported before, which was explained to be the hybridization of the probe to relate d receptor mRNA, but may represent residual non-specific hybridization in our case as well (Evans et al. 1992). The lack of stable expressed protein in our clones could be due to multiple reasons. The vector might not be as conducive to ma mmalian expression as we had hoped in these cells. Also, protein expression may be be low detectable levels, however the binding assays indicate absolutely no expression, a nd ECL is a sensitive system. The binding

PAGE 81

68 assays should have shown a dose response cu rve in response to the addition of receptor agonist during stimulation. These experime nts have been performed before, with a slightly different experime ntal design (Evans et al 1992; Jordan and Devi 1999; Decaillot et al. 2003), by the addition of fors kolin to the agonist. We also added a varying amount of forskolin to the agonist and planned to observe the change in inhibition depending on the amount of agonist adde d to the well. We did not observe this difference as others had, which may be e xplained by lack of pr otein. The background seen in the immunocytochemistry showed a faint signal around the nucleus, which suggests that the recombinant protein may be expressed but retained in the endoplasmic reticulum (ER). There is evidence from other groups that the majority of an expressed delta opioid receptor does not make it out of th e ER and is subsequently degraded due to protein misfolding or problems in post-transl ational modifications (Petaja-Repo et al. 2000; Petaja-Repo et al. 2001). There may also be a confounding effect of a low level of expression of the vector and post-translational problems that may account for the lack of functional protein. It is in teresting that the high expres sing (RNA) clones tended to die quickly, suggesting that expres sion of the protein is occurr ing but causing cell death in those clones, possibly due to a cytotoxic eff ect in the maturation of the protein. These experiments proved to be a starting point for our functional analyses and will need further troubleshooting in the future.

PAGE 82

69 Figure 6-1 Model of the delta opioid receptor (B), based on the bovine rhodopsin receptor as a homology template (A) with th e ball representing the conserved phenylalanine residue. C is both rece ptor models superimposed on top of each other to illustrate the simila rities between these models. B C A

PAGE 83

70 Figure 6-2 The local environment of the hydrophobic pocket where the phenylalanine is located. (A) is the conserved region in the bovine rhodopsin receptor while (B) is the region in the delta opioid receptor. (C) illustrates the possible change in the region when replaced by a cysteine residue. L110 S25 L1 1 E10 E118 C121 C198 F27 P191 A26 P28 B L110 S25 L11 E10 E118 C121 C198 C27 P191 A2 6 P28 C P107 C11 0 C18 7 N8 P180 F24 F10 3 P9 S22 D25 P23 A

PAGE 84

71 Figure 6-3 Activation assay resu lts show that there was no do se response in the activation of the stably transfected cell lines. Th e forskolin (10mM concentration) is the maximum activation possible as this allows for the cAMP accumulation (or in our case, decrease) without having to si gnal through the recept or. In theory, we should see a dose respons e curve with a decrease in activation as the amount of agonist added increases.

PAGE 85

72 Figure 6-4 Northern blot analysis of the human deltaand kappa opioid receptor stably transfected cell lines. The 293 cells ar e untransfected and since the hKOR G1A4 cell colony produced no mRNA, it wa s used as a mock transfected cell line. There seemed to be substan tial non-specific hybridization of the fulllength cDNA probe, although the 1.2kb mR NA can be observed clearly.

PAGE 86

73

PAGE 87

74 Figure 6-5 The western blot comassie stained is on the left and the ECL blot is on the right. The positive control protein is 40.8KD, which is about the expected size of our protein. There is no differe nce in the banding pattern between the untransfected 293 cells and the stable colonies. 2g of the positive control was loaded on the gel along with 15 l of total cell lysate of each of the cell lines.

PAGE 88

75 Figure 6-6 Western blot of CO S-7 transiently transfected ce lls, 48 hours after transfection using the Fugene transfection kit. Ther e is no difference in protein expression between the mock transfected cells, which received empty vector, and the vectors containing the cDNA of the four di fferent alleles. The left picture is of the ECL autograph of the different cel l lines. There is no difference in the protein expression profiles between the transfected cell lines and the mock transfected cell line indicating that ther e is no OPR protein being expressed. On the right is a duplicate comassie stained blot.

PAGE 89

76 Figure 6-7 RT-PCR of the OPRD1 cDNA from stably transfected colonies after 25 extension cycles. GAPDH expression wa s equivilant in all the samples. These data illustrate the differences of expression levels between the different single colony cell lines used for our analyses, and that the clones are producing RNA from the plasmid, consistent with the northern analysis.

PAGE 90

77 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions MC1R Although our functional studies proved inc onclusive due to the lack of protein expression, we have found some associations be tween candidate genes in pain sensitivity and pain responses at baseline and after the administration of analgesics. We were the first group to elucidate a genetic link between fair skinned females and the response to pentazocine analgesia, where fairer skinned females have a greater analgesic response after the intravenous administ ration of a kappa opioid select ive analgesic. This finding has far reaching implications as it had been anecdotally reported by the anesthesiology field that red head females need less anesth etic than the general population. Our findings have proposed a mechanism for their observation s. This association is mediated through the MC1R gene, which is widely known in its role in the formation of skin pigment. Because pentazocine is not widely prescrib ed clinically anymore, we are currently conducting a study with morphine and examining baseline pain sensitivity and analgesic effect in a similar population. We have pr oposed that there is, in fact, a difference between fair-skinned individuals compared to darker skinned individuals when examining effects of morphine -6-glucoronide (M6G), a morp hine metabolite in which we found that fairer skinned peopl e had a higher analgesic effect via electrical stimulation compared to their darker skinned counterpar ts. M6G, although slow er in its analgesic action, has less of an effect on respiration depression and it seems to have a smaller

PAGE 91

78 sedative effect ( http://www.medicalnewstoday.com /medicalnews.php?newsid=22657 ) than morphine, and may possibly be a better option for clinical use in the future. OPRM1 One of the other candidate genes thus fa r found to have a positive association with baseline pain sensitivity, is the mu opioid receptor (OPRM1). It is the classic pain receptor in the nociceptive response and most analgesics are either directed either selectively or indirectly for this receptor. Our study into the baseline pressure pain sensitivity in different OPRM1 genotypes was the first of its kind. We have linked the mu opioid receptor with mechanical pain sensitivity and th e A118G polymorphism, which has been previously associated with other phenotypes such as the feeling of intoxication and family history of alcohol abuse (Ray and Hutchison 2004). The A118G polymorphism has also been associated w ith heroin dependence in Asian populations (Tan et al. 2003) and the minor allele in this polymorphism has also been shown to elicit an enhanced cortisol response to nal oxone and reduced agonist effect of M6G (Hernandez-Avila et al. 2003). The mu opioid receptor A118G polymorphism is also interesting, because it has been observed that the major allele is mo re highly expressed in post-mortem human brains compared to the G allele. In order to explain this finding, transfections of each allele were made in Chinese Hamster Ov ary (CHO) cells and it was found that the A allele expressed more protein than the G a llele. This research suggests an allelic consequence, which implicates a defect in transcription or mRNA maturation/stability of the minor allele (Zhang et al. 2005). There is also evid ence that the A118G polymorphism is in linkage disequilibrium with the silent C17T polymorphism in the part of the gene encoding the extracellular region (Tan et al. 2003).

PAGE 92

79 OPRD1 Although ANOVA analysis failed to find an a ssociation with pain sensitivity in our population of participants with the delta op ioid receptor and pain sensitivity, another group recently found an association (Kim et al. 2004). Due to the gross amino acid change in the protein sequence and the environm ental difference within the protein that is caused by this change, there is still a possibi lity of a functional implication of this polymorphism. Our lab has only performed three different pain modalities on our subjects, and we may be missing a pain modality associated with pain sensitivity or analgesic effect of this alleli c variation. We are also pursu ing QTL analysis of our data, which may be more sensitive to an underlying association, and enrol ling more subjects. Clinical Testing Different clinical pain testing modalities were used in the different populations in the clinic. This makes it somewhat difficu lt to compare results obtained from these distinct populations. Our cons ortium of researchers and clinic ians have started to use the same tests and facilities, which will make co mprehensive conclusions more plausible in the continuing studies. For example, the IBS patients are now undergoing the same experimental pain testing as our healthy subjects. This could be a very interesting comparison. Future Directions Association Studies Our research can be continued in the fu ture by expanding our profile of candidate genes to analyze. We are currently starting to examine the adenosine receptors in our fibromyalgia patients in collaboration with a group in New York. After genotyping the polymorphism in this receptor, we have f ound that there is a higher frequency of the

PAGE 93

80 minor allele in the FM patients (17%) comp ared to 1.5% in normal controls. This frequency difference warrants further validati on and research into the exact mechanism of the adenosine receptor in th e perception of pain and its ro le in the pathogenesis of a chronic pain syndrome. Also, we should ex amine the IBS chronic pain population and see if there is a difference of allele freque ncies in this population compared to the FM patients and the normal controls. The -2 adrenergic receptor is on our list of future candidate genes as it has been implicated in nociception in the mouse (Bastia et al. 2002). This genotyping is currently be ing undertaken in collaborati on with the Belfer group at the NIH as well as our own fac ilities. In our collaborati on, we are also examining the interleukins (IL), which are a large gr oup of cytokines and are involved in the inflammatory response. The inte rleukins under examination are IL1 IL1 IL2, IL10 and IL13. As calcium levels have been found to be elevated in chronic pain patients (Ai et al. 1998), it is interesting to learn that IL1 is implicated also in the modulation of extracellular fluid calcium homeostasi s (Sabatini et al. 1988). Both IL and IL are released as a result of cell injury independent of the insult (Hogquist et al. 1991). IL1 is the major molecule responsible for the i nduction of cyclooxygenase 2 (COX2), which leads to the release of prosta noids. Prostanoids then invoke peripheral sensitization of nociceptors and causes localized pain hypersen sitivity (hyperalgesia) (Samad et al. 2001). IL2, formerly known as T-cell growth factor, is an immunoregulator y molecule produced by lectinor antigenactivated T cells. IL10 is also known as cytokine synthesis inhibitory factor, and is sugge sted to possibly arre st and reverse the chronic inflammatory response in atherosclerosis (T erkeltaub 1999). It has also been shown that IL10 works synergistically with glucocor ticoids (Franchimont et al. 1999). Mice homozygous for a

PAGE 94

81 disrupted IL10 gene seem to have an altered regulation of an immune response to enteric flora are more prone to inflammatory bowel disease (Kuhn et al. 1993). IL10 has also been connected to cytokine deficiency-indu ced colitis by QTL analysis (Farmer et al. 2001). IL13 is involved in th e inhibition of inflammatory cytokine production, induced by lipopolysaccharides in blood monocytes (Minty et al. 1993). In fact, the c-terminal tail of IL13 (which dimerizes with IL4) inte racts with the tyrosine kinases of the Janus kinase family (JAK), which interact in turn with STAT6 and regulat e gene expression by binding to promoters of genes that are regulat ed by IL13 (and IL4). Differences in the gene sequence due to polymorphisms have b een linked to differen ces in IL signaling (Kelly-Welch et al. 2003). Over-expression of IL13 in the lung of the mouse has been shown to cause inflammation and an accumulation of adenosine, as well as a decrease of adenosine deaminase activity with the simu ltaneous increase of various adenosine receptors (Blackburn et al. 2003). We are also in the process of collabor atively genotyping polymorphisms in the cannabinoid receptor 2, which are involved in response to tetrahydrocannabinol (THC), which is used in some states as a pain re liever and an anti anxi ety medication. Another potential candidate gene is the -1-antitrypsin gene, wh ich is known to modulate inflammation and has been shown to cont rol fibromyalgia symptoms upon infusion (Blanco et al. 2005). Once these receptors have been genotyped, we can test their potential role in pain sensitivity and analge sic responsiveness. We could also use our samples that we have collected and replicat e results found in other studies examining the vallanoid receptor subtype 1 gene (TRPV1) and its association with its increase in cold withdrawal times (Kim et al. 2004 ). I think that we should al so focus our attention on the

PAGE 95

82 NMDA receptor as this receptor is more involved in anti-nociception in males. We have also genotyped all our samples for all the CO MT SNPs and are awaiting analyses, as we are also working on this aspect of the proj ect in a collaborative fashion. Ultimately, strong reproducible associat ions can lead to improved pain management based on genetics, and shed light on biochemical syst ems involved in pain for future research. Functional Analysis If we do not find a positive association in our on-going studies of pain sensitivity with the delta and kappa opioid receptors, it may be difficult to justify future functional analyses of these polymorphisms. Our strate gy needs troubleshooting if it is repeated in the future. For example, it may be helpful to first test this vector expressing a lacZ gene in HEK 293 cells before the effort is made to redo the stable cell lines. Also, others have used HEK cells that grow in suspension in stead of our subpopulation of the HEK-S cells that grow adherently (Decaillot et al. 2003). The 5’UTR may be needed for proper translation of the protein, so next attempt, this region of the gene should maybe included in the vector. I think that the first experime nt that should be attempted is the expression of the original vectors that we re sent to us in a COS 7 cell system to see if we were actually sent cDNA that is translatable. I pe rformed a quick transient co-transfection of the original vectors with -galactosidase (figure 7-1) a nd it seems as though the kappa opioid vctor produces a functional protein. This experiment no only needs to be repeated, but mRNA and western blot anal ysis should be performed. Th e vectors can be expressed transiently, but we would have to then co -transfect a reporter vector to establish transfection efficiency, and we should be careful to make sure how different transient cell transfections express our receptor. It would also be important once we have protein, to

PAGE 96

83 conduct binding assays to examine whether ther e is a difference in ligand affinity for the receptor based on the polymorphism located near the start of the gene, which translates into the extracellular region of the protein. This can be done using radiolabeled ligand and unlabelled ligand and analyze the competitiv e binding of the receptor. It would be worthwhile to look at the affect s of the heterodimerization stat es of the opioid proteins. The polymorphisms in the genes of OPRD1 and OPRM1 confer amino acid substitutions in the encoded protein. The mu opioid rece ptor A118G polymorphism in the gene has already displayed alte red function in the protein, but th is has not been studied in a heterodimer state. General Our collaborations and studies are ongoing in this longterm project. We are currently looking at how differe nces in ethnic backgrounds a ffect pain sensitivity. We have started to standardize the testing amongst ou r three different populations and we plan to examine the evolution of the genetics of pain in the future. Our lab has expanded its collaborations since the in ception of this described proj ect and we are now studying patients with rotator cuff pain as well. This project was just the start of our lab’s entry into the pain genetics field a nd, after four years, we are sti ll one of the few laboratories in the country studying human pain sensitiv ity in the paradigm of genetics.

PAGE 97

84 Figure 7-1 A transient transfecion with the orig inal vectors received from collaborators. The hOPRD1 protein had no receptor act ivity in the activation assay, while the hOPRK1 protein seem to be expre ssed as we have a dose response in the cells where forskolin and agonist were added.

PAGE 98

85 APPENDIX A GENOTYPING RESULTS Object A-1. Excel spreadsheet containi ng the list of genot ype results in all polymorphisms studied. (object1.xls, 118KB) Object A-2. Comma separated va riable (CSV) version of the list of genotype results in all polymorphisms studied. (object2.csv, 28 KB)

PAGE 99

APPENDIX B GENOTYPE FREQUENCIES

PAGE 100

87Genotype frequencies of the different gene polymorphisms between three different pain populations. The actual headcount is followed by the represented genotype frequenc y in the population in parentheses. Th e between group value ids represented under the polymorphism name. OPRM1 C17T ( n=511) p=0.55 OPRM1 A118G (n=506) p=0.155 OPRD1 T80G (n=507) p=0.64 OPRK1 G36T (n=482) p=0.376 population CC CT TT AA AG GG TT TG GG GG GT TT Healthy Subjects 320 (94.12) 18 (5.29) 2 (0.59) 263 (77.81) 67 (19.82) 8 (2.37) 265 (78.4) 64 (18.94) 9 (2.66) 257 (81.07) 51 (16.09) 9 (2.84) IBS patients 68 (95.77) 2 (2.82) 1 (1.0) 54 (76.06) 13 (18.31) 4 (5.63) 57 (82.61) 11 (15.94) 1 (1.45) 61 (85.92) 10 (14.08) 0 (0) FMS patients 97 (97.0) 2 (2.0) 1 (1.41) 73 (75.26) 24 (24.74) 0 (0) 78 (78.0) 20 (20.0) 2 (2.0) 82 (87.23) 11 (11.70) 1 (1.06) OPRK1 A843G (n=410) p=0.98 OPRK1 C846T (n=405) p=0.021 CALCA P1/P2 TC/CG (n=514) p=0.0167 CALCA P4 TC (n=460) p=0.422 population AA AG GG CC CT TT TTCC TCCG CCGG TT CT CC Healthy Subjects 172 (66.41) 78 (30.1) 9 (3.47) 231 (89.53) 27 (10.47) 0 (0) 169 (49.4) 131 (38.3) 42 (12.3) 280 (96.5) 9 (3.1) 1 (0.34) IBS patients 41 (66.13) 18 (29.03) 3 (4.84) 55 (88.71) 5 (8.06) 2 (3.2) 38 (52.8) 30 (41.7) 4 (5.56) 67 (93.1) 5 (6.9) 0 (0) FMS patients 61 (68.54) 25 (28.09) 3 (3.37) 75 (88.24) 10 (11.76) 0 (0) 42 (42.0) 48 (48.0) 10 (10) 96 (97.9) 2 (2.04) 0 (0)

PAGE 101

88 LIST OF REFERENCES Ai, X., S. E. MacPhedran and A. K. Hall (1998). "Depolarization stimulates initial calcitonin gene-related peptide expressi on by embryonic sensory neurons in vitro." J Neurosci 18(22): 9294-302. Akiho, H., Y. Deng, P. Blennerhassett, H. Kanbayashi and S. M. Collins (2005). "Mechanisms underlying the maintenance of muscle hypercontractility in a model of postinfective gut dysfunction." Gastroenterology 129(1): 131-41. Al-Chaer, E. D., M. Kawasaki and P. J. Pasricha (2000). "A new model of chronic visceral hypersensitiv ity in adult rats i nduced by colon irritation during postnatal development." Gastroenterology 119 (5): 1276-85. Aldrich, S., C. Eccleston and G. Cromb ez (2000). "Worrying about chronic pain: vigilance to threat and misdirected problem solving." Behav Res Ther 38 (5): 45770. Alnigenis, M. N. and P. Barland (2001). "F ibromyalgia syndrome and serotonin." Clin Exp Rheumato. 19 (2): 205-10. Aloisi, A. M. (2003). "Gonadal hormones and sex differences in pain reactivity." Clin. J. Pain 19 (3): 168-74. Antonijevic, I., S. A. Mousa, M. Schafer a nd C. Stein (1995). "Perineurial defect and peripheral opioid analgesia in inflammation." J Neurosci 15 (1 Pt 1): 165-72. Aubrun, F., O. Langeron, C. Quesnel, P. Co riat and B. Riou (2003). "Relationships between measurement of pain using visual analog score and mo rphine requirements during postoperative intrav enous morphine titration." Anesthesiology 98 (6): 141521. Bajaj, P., P. Bajaj, H. Madsen and L. Ar endt-Nielsen (2002). "A comparison of modalityspecific somatosensory changes during menstruation in dysmenorrheic and nondysmenorrheic women." Clin J Pain 18 (3): 180-90. Bao, L., S. X. Jin, C. Zhang, L. H. Wang, Z. Z. Xu, F. X. Zhang, L. C. Wang, F. S. Ning, H. J. Cai, J. S. Guan, H. S. Xiao, Z. Q. Xu, C. He, T. Hokfelt, Z. Zhou and X. Zhang (2003). "Activation of delta opioid receptors induces receptor insertion and neuropeptide secretion." Neuron 37 (1): 121-33.

PAGE 102

89 Basbaum, A. I. and H. L. Fields (1984) "Endogenous pain control systems: brainstem spinal pathways and endorphin circuitry." Annu Rev Neurosci 7 : 309-38. Basolo, F., R. Giannini, P. Favi ana, G. Fontanini, A. Patricelli Malizia, C. Ugolini, R. Elisei, P. Miccoli and A. Toniolo (2 004). "Thyroid papillary carcinoma: preliminary evidence for a germ-line single nucleotide polymorphism in the Fas gene." J Endocrinol 182 (3): 479-84. Bastia, E., K. Varani, A. Monopoli and R. Be rtorelli (2002). "Effect s of A(1) and A(2A) adenosine receptor ligands in m ouse acute models of pain." Neurosci Lett 328 (3): 241-4. Belfer, I., T. Wu, A. Kingma n, R. K. Krishnaraju, D. Go ldman and M. B. Max (2004). "Candidate gene studies of human pa in mechanisms: methods for optimizing choice of polymorphisms and sample size." Anesthesiology 100 (6): 1562-72. Belknap, J. K., N. R. Haltli, D. M. Goebel and M. Lame (1983). "S elective breeding for high and low levels of opiate-induced analgesia in mice." Behav Genet 13 (4): 383-96. Berkley, K. J. (1997). "Sex differences in pain." Behav Brain Sci 20 (3): 371-80; discussion 435-513. Blackburn, M. R., C. G. Lee, H. W. Young, Z. Zhu, J. L. Chunn, M. J. Kang, S. K. Banerjee and J. A. Elias (2003). "Adenosin e mediates IL-13-induced inflammation and remodeling in the lung and interacts in an IL-13-adenosine amplification pathway." J Clin Invest 112 (3): 332-44. Blanco, L. E., F. J. de Serres, E. Ferna ndez-Bustillo, D. A. Kassam, D. Arbesu, C. Rodriguez and J. C. Torre (2005). "alpha1Antitrypsin and fibromyalgia: new data in favour of the inflammatory hypothesis of fibromyalgia." Med Hypotheses 64 (4): 759-69. Bond, C., K. S. LaForge, M. Tian, D. Melia, S. Zhang, L. Borg, J. Gong, J. Schluger, J. A. Strong, S. M. Leal, J. A. Tischfiel d, M. J. Kreek and L. Yu (1998). "Singlenucleotide polymorphism in the human mu opioid receptor gene alters betaendorphin binding and activity: possible implications for opiate addiction." Proc Natl Acad Sc i U S A 95 (16): 9608-13. Box, N. F., J. R. Wyeth, L. E. O'Gorma n, N. G. Martin and R. A. Sturm (1997). "Characterization of melanocyte stimulat ing hormone receptor variant alleles in twins with red hair." Hum Mol Genet 6 (11): 1891-7. Cahill, C. M., A. Morinville, M. C. Lee, J. P. Vincent, B. Collier and A. Beaudet (2001). "Prolonged morphine treatment targets delta opioid rece ptors to neuronal plasma membranes and enhances delta-mediated antinociception." J Neurosci 21 (19): 7598-607.

PAGE 103

90 Cairns, B. E., J. W. Hu, L. Arendt-Nielse n, B. J. Sessle and P. Svensson (2001). "Sexrelated differences in human pain and rat afferent discharge evoked by injection of glutamate into the masseter muscle." J Neurophysiol 86 (2): 782-91. Chapman, V., J. E. Haley and A. H. Dicken son (1994). "Electrophysiologic analysis of preemptive effects of spinal opioids on N-methyl-D-aspartate receptor-mediated events." Anesthesiology 81 (6): 1429-35. Chaturvedi, K., M. Shahrestanifar and R. D. Howells (2000). "mu Opioid receptor: role for the amino terminus as a determinant of ligand binding affinity." Mol Brain Res 76 (1): 64-72. Chen, L., Y. Gu and L. Y. Huang (1995). "T he opioid peptide dynor phin directly blocks NMDA receptor channels in the rat." J Physiol 482 ( Pt 3) : 575-81. Chhajlani, V. (1996). "Distribution of c DNA for melanocortin receptor subtypes in human tissues." Biochem Mol Biol Int 38 (1): 73-80. Compton, P., D. H. Geschwind and M. Alar con (2003). "Associati on between human muopioid receptor gene polymorphism, pain tolerance, and opioid addiction." Am J Med Genet B Neuropsychiatr Genet 121 (1): 76-82. Cone, R. D., D. Lu, S. Koppula, D. I. Va ge, H. Klungland, B. Boston, W. Chen, D. N. Orth, C. Pouton and R. A. Kesterson (1996) "The melanocortin receptors: agonists, antagonists, and the hormonal control of pigmentation." Recent Prog Horm Res 51 : 287-317; discussion 318. Craft, R. M. (2003). "Sex differences in opioid analgesia: "from mouse to man"." Clin J Pain 19 (3): 175-86. Crombez, G., C. Eccleston, F. Baeyens, B. van Houdenhove and A. van den Broeck (1999). "Attention to chronic pain is dependent upon pain-related fear." J Psychosom Res 47 (5): 403-10. Crowley, J. J., D. W. Oslin, A. A. Patkar, E. Gottheil, P. A. DeMaria, Jr., C. P. O'Brien, W. H. Berrettini and D. E. Grice (2003). "A genetic association study of the mu opioid receptor and severe opioid dependence." Psychiatr Genet 13 (3): 169-73. Dao, T. T. and L. LeResche (2000) "Gender differences in pain." J Orofac Pain 14 (3): 169-84; discussion 184-95. Decaillot, F. M., K. Befort, D. Filliol, S. Yue, P. Walker and B. L. Kieffer (2003). "Opioid receptor random mutagenesis reve als a mechanism for G protein-coupled receptor activation." Nat Struct Biol 10 (8): 629-36. Dennis, C. (2003). "Epigenetics and disease: Altered states." Nature 421 (6924): 686-8.

PAGE 104

91 Diatchenko, L., G. D. Slade, A. G. Nackle y, K. Bhalang, A. Sigurdsson, I. Belfer, D. Goldman, K. Xu, S. A. Shabalina, D. Shagin, M. B. Max, S. S. Makarov and W. Maixner (2005). "Genetic basis for individua l variations in pain perception and the development of a chronic pain condition." Hum Mol Genet 14 (1): 135-43. Duan, J., M. S. Wainwright, J. M. Comeron, N. Saitou, A. R. Sanders, J. Gelernter and P. V. Gejman (2003). "Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor." Hum Mol Genet 12 (3): 205-16. Ehrlich, G. K., M. L. Andria, X. Zheng, B. Kief fer, T. L. Gioannini, J. M. Hiller, J. E. Rosenkranz, B. M. Veksler, R. S. Zuki n and E. J. Simon (1998). "Functional significance of cysteine residues in the de lta opioid receptor studied by site-directed mutagenesis." Can J Physiol Pharmacol 76 (3): 269-77. Eisenach, J. C. (2004). "Fishing for ge nes: practical ways to study genetic polymorphisms for pain." Anesthesiology 100 (6): 1343-4. Esfandiary, H., U. Chakravarthy, C. Patte rson, I. Young and A. E. Hughes (2005). "Association study of detoxification genes in age related macular degeneration." Br J Ophthalmol 89 (4): 470-4. Evans, C. J., D. E. Keith, Jr., H. Morrison, K. Magendzo and R. H. Edwards (1992). "Cloning of a delta opioid recep tor by functional expression." Science 258 (5090): 1952-5. Farmer, M. A., J. P. Sundberg, I. J. Bristol, G. A. Churchill, R. Li, C. O. Elson and E. H. Leiter (2001). "A major quant itative trait locus on chro mosome 3 controls colitis severity in IL-10-deficient mice." Proc Natl Acad Sci U S A 98 (24): 13820-5. Fillingim, R. B. (2000). "Sex, gender, and pain: women and men r eally are different." Curr Rev Pain 4 (1): 24-30. Fillingim, R. B., R. R. Edwards and T. Powell (1999). "The relationship of sex and clinical pain to experi mental pain responses." Pain 83 (3): 419-25. Fillingim, R. B., L. Kaplan, R. Staud, T. J. Ness, T. L. Glover, C. M. Campbell, J. S. Mogil and M. R. Wallace (2005). "The A 118G single nucleotide polymorphism of the mu-opioid receptor gene (OPRM1) is associated with pressure pain sensitivity in humans." J Pain 6 (3): 159-67. Fillingim, R. B., V. Maddux and J. A. Shackel ford (1999). "Sex differences in heat pain thresholds as a function of asse ssment method and rate of rise." Somatosens Mot Res 16 (1): 57-62. Fillingim, R. B. and W. Mai xner (1995). "Gender differences in the responses to noxious stimuli." Pain Forum 4 : 209-221.

PAGE 105

92 Franchimont, D., H. Martens, M. T. Hagelstei n, E. Louis, W. Dewe, G. P. Chrousos, J. Belaiche and V. Geenen (1999). "Tumor necrosis factor alpha decreases, and interleukin-10 increases, th e sensitivity of human monocytes to dexamethasone: potential regulation of the glucocorticoid receptor." J Clin Endocrinol Metab 84 (8): 2834-9. Franke, P., B. Wendel, M. Knapp, S. G. Schw ab, D. Neef, W. Maier, D. B. Wildenauer and M. R. Hoehe (2003). "Introducing a new recruitment approach to sample collection for genetic association studies in opioid dependence." Eur Psychiatry 18 (1): 18-22. Fredriksson, R., M. C. Lagerstrom, L. G. Lundin and H. B. Schioth (2003). "The Gprotein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paral ogon groups, and fingerprints." Mol Pharmacol 63 (6): 1256-72. Garcia-Larrea, L., P. Convers, M. Magnin, N. Andre-Obadia, R. Peyron, B. Laurent and F. Mauguiere (2002). "Laser-evoked poten tial abnormalities in central pain patients: the influence of s pontaneous and provoked pain." Brain 125 (Pt 12): 276681. Ge, H. Y., P. Madeleine, K. Wang and L. Arendt-Nielsen (2003). "Hypoalgesia to pressure pain in referred pain areas tr iggered by spatial summation of experimental muscle pain from unilateral or bilateral trapezius muscles." Eur J Pain 7 (6): 531-7. Gear, R. W., C. Miaskowski, N. C. Gordon, S. M. Paul, P. H. Heller and J. D. Levine (1996). "Kappa-opioids produce significantly greater analgesia in women than in men." Nat Med 2 (11): 1248-50. Gelernter, J. and H. R. Kranzler (2000). "V ariant detection at th e delta opioid receptor (OPRD1) locus and population genetics of a novel variant affecting protein sequence." Hum Genet 107 (1): 86-8. George, S. R., T. Fan, Z. Xie, R. Tse, V. Tam, G. Varghese and B. F. O'Dowd (2000). "Oligomerization of muand delta-opioid receptors. Generation of novel functional properties." J Biol Chem 275 (34): 26128-35. Gispen, W. H., J. Buitelaar, V. M. Wiegan t, L. Terenius and D. De Wied (1976). "Interaction between ACTH fragments, brain opiate receptors and morphineinduced analgesia." Eur J Pharmacol 39 (2): 393-7. Glazier, A. M., J. H. Nadeau and T. J. Aitman (2002). "Finding genes that underlie complex traits." Science 298 (5602): 2345-9. Gomes, I., B. A. Jordan, A. Gupta, N. Trapaidze, V. Nagy and L. A. Devi (2000). "Heterodimerization of mu and delta opioid receptors: A role in opiate synergy." J Neurosci 20 (22): RC110.

PAGE 106

93 Grosch, S., E. Niederberger, J. Lotsch, C. Skarke and G. Geisslinger (2001). "A rapid screening method for a single nucleotide polymorphism (SNP) in the human MOR gene." Br J Clin Pharmacol 52 (6): 711-4. Healy, E., S. A. Jordan, P. S. Budd, R. Suffolk, J. L. Rees and I. J. Jackson (2001). "Functional variation of MC1R alleles from red-haired individuals." Hum Mol Genet 10 (21): 2397-402. Heitkemper, M. M. and M. Jarrett (2001). "Gender differences and hormonal modulation in visceral pain." Curr Pain Headache Rep 5 (1): 35-43. Heitkemper, M. M., M. Jarrett, K. A. Caudell and E. Bond (1993). "Women with gastrointestinal symptoms: implicati ons for nursing research and practice." Gastroenterol Nurs 15 (6): 226-32. Henshall, J. M. and M. E. Goddard (1999). "Multiple-trait mapping of quantitative trait loci after selectiv e genotyping using logi stic regression." Genetics 151 (2): 885-94. Hernandez-Avila, C. A., G. Wand, X. Luo, J. Gelernter and H. R. Kranzler (2003). "Association between the co rtisol response to opioid blockade and the Asn40Asp polymorphism at the mu-opioid receptor locus (OPRM1)." Am J Med Genet B Neuropsychiatr Genet 118 (1): 60-5. Hoehe, M. R., K. Kopke, B. Wendel, K. Rohde, C. Flachmeier, K. K. Kidd, W. H. Berrettini and G. M. Church (2000). "Se quence variability a nd candidate gene analysis in complex disease: association of mu opioid receptor gene variation with substance dependence." Hum Mol Genet 9 (19): 2895-908. Hogquist, K. A., M. A. Nett, E. R. Unanue and D. D. Chaplin (1991). "Interleukin 1 is processed and released during apoptosis." Proc Natl Acad Sci U S A 88 (19): 84859. Hosohata, Y., T. W. Vanderah, T. H. Burkey, M. H. Ossipov, C. J. Kovelowski, I. Sora, G. R. Uhl, X. Zhang, K. C. Rice, W. R. Roeske, V. J. Hruby, H. I. Yamamura, J. Lai and F. Porreca (2000). "delta-Opioid receptor agonists pr oduce antinociception and [35S]GTPgammaS binding in mu receptor knockout mice." Eur J Pharmacol 388 (3): 241-8. Jackson, I. J. (1997). "Homologous pigmenta tion mutations in human, mouse and other model organisms." Hum Mol Genet 6 (10): 1613-24. Janal, M. N., M. Glusman, J. P. Kuhl a nd W. C. Clark (1994). "On the absence of correlation between responses to noxious heat, cold, electrical and ischemic stimulation." Pain 58 (3): 403-11. Joranson, D. E. and R. Lietman (1994). The McNeil National Pain Study. New York, Louis Harris and Associates.

PAGE 107

94 Jordan, B. A. and L. A. Devi (1999). "G-p rotein-coupled receptor heterodimerization modulates receptor function." Nature 399 (6737): 697-700. Juhl, J. H. (1998). "Fibromyalgi a and the serotonin pathway." Altern Med Rev 3 (5): 36775. Karandrea, D., C. Kittas and E. Kitraki ( 2002). "Forced swimming di fferentially affects male and female brain corticosteroid receptors." Neuroendocrinology 75 (4): 21726. Kelly-Welch, A. E., E. M. Hanson, M. R. Boothby and A. D. Keegan (2003). "Interleukin-4 and interleukin-13 signaling connections maps." Science 300 (5625): 1527-8. Kest, B., S. Jenab, M. Brodsky, B. Sadowski, J. K. Belknap, J. S. Mogil and C. E. Inturrisi (1999). "Mu and delta opioid receptor analgesia, binding density, and mRNA levels in mice selectively bred for high and low analgesia." Brain Res 816 (2): 381-9. Kim, H., J. K. Neubert, A. San Miguel, K. Xu, R. K. Krishnaraju, M. J. Iadarola, D. Goldman and R. A. Dionne (2004). "Genet ic influence on variability in human acute experimental pain sensitivity a ssociated with gender, ethnicity and psychological temperament." Pain 109 (3): 488-96. King, M. C. and A. C. Wilson (1975). "E volution at two levels in humans and chimpanzees." Science 188 (4184): 107-16. Knapp, D. A. and H. Koch (1984). "The management of new pain in office-based ambulatory care: National Ambulatory Medical Care Survey, 1980 and 1981." Adv Data (97): 1-9. Krude, H., H. Biebermann, W. Luck, R. Horn, G. Brabant and A. Gruters (1998). "Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans." Nat Genet 19 (2): 155-7. Kuhn, R., J. Lohler, D. Rennick, K. Raje wsky and W. Muller (1993). "Interleukin-10deficient mice develop chronic enterocolitis." Cell 75 (2): 263-74. Lariviere, W. R., S. G. Wilson, T. M. Laughlin A. Kokayeff, E. E. West, S. M. Adhikari, Y. Wan and J. S. Mogil (2002). "Herit ability of nociception. III. Genetic relationships among commonly used assays of nociception and hypersensitivity." Pain 97 (1-2): 75-86. Lautenbacher, S., J. Spernal, W. Schreiber a nd J. C. Krieg (1999). "Relationship between clinical pain complaints and pain sensitivity in patients with depression and panic disorder." Psychosom Med 61 (6): 822-7.

PAGE 108

95 Levy, R. L., K. R. Jones, W. E. Whitehead, S. I. Feld, N. J. Talley and L. A. Corey (2001). "Irritable bowel syndrome in twin s: heredity and social learning both contribute to etiology." Gastroenterology 121 (4): 799-804. Lipton, J. M. and A. Catania (1998). "Mech anisms of antiinflammatory action of the neuroimmunomodulatory peptide alpha-MSH." Ann N Y Acad Sci 840 : 373-80. Liu, J. G. and P. L. Prather (2001). "Chroni c exposure to mu-opioid agonists produces constitutive activation of mu-opioid receptors in direct proportion to the efficacy of the agonist used for pretreatment." Mol Pharmacol 60 (1): 53-62. Liu, N. J. and A. R. Gintzl er (2000). "Prolonged ovarian se x steroid treatment of male rats produces antinociception: identifica tion of sex-based divergent analgesic mechanisms." Pain 85 (1-2): 273-81. Lotsch, J., C. Skarke, S. Grosch, J. Dari mont, H. Schmidt and G. Geisslinger (2002). "The polymorphism A118G of the human mu-opioid receptor gene decreases the pupil constrictory effect of morphine-6-glucuronide but not that of morphine." Pharmacogenetics 12 (1): 3-9. Lu, D., D. Willard, I. R. Patel, S. Kadwell, L. Overton, T. Kost, M. Luther, W. Chen, R. P. Woychik, W. O. Wilkison and et al. ( 1994). "Agouti protein is an antagonist of the melanocyte-stimulating-hormone receptor." Nature 371 (6500): 799-802. MacGregor, A. J., T. Andrew, P. N. Sambr ook and T. D. Spector (2004). "Structural, psychological, and genetic influences on lo w back and neck pain: a study of adult female twins." Arthritis Rheum 51 (2): 160-7. MacGregor, A. J., G. O. Griffiths, J. Bake r and T. D. Spector (1997). "Determinants of pressure pain threshold in adult twin s: evidence that shared environmental influences predominate." Pain 73 (2): 253-7. Mackay, T. F. (2001). "Quantitativ e trait loci in Drosophila." Nat Rev Genet 2 (1): 11-20. Maixner, W. and C. Humphrey (1993). "Gende r differences in pain and cardiovascular responses to forearm ischemia." Clin J Pain 9 (1): 16-25. Malcangio, M. and N. G. Bowery (1996). "GAB A and its receptors in the spinal cord." Trends Pharmacol Sci 17 (12): 457-62. Manzanares, J., E. J. Wagner, K. E. Moore and K. J. Lookingland (1993). "Kappa opioid receptor-mediated regulation of prolac tin and alpha-melanocyte-stimulating hormone secretion in male and female rats." Life Sci 53(10): 795-801. Mao, J., D. D. Price, L. L. Phillips, J. Lu and D. J. Mayer (1995). "Increases in protein kinase C gamma immunoreactivity in the spinal cord dorsal horn of rats with painful mononeuropathy." Neurosci Lett 198 (2): 75-8.

PAGE 109

96 Mathe, A. A., H. Agren, L. Lindstrom and E. Theodorsson (1994). "Increased concentration of calcitonin gene-related pe ptide in cerebrospinal fluid of depressed patients. A possible trait marker of major depressive disorder." Neurosci Lett 182 (2): 138-42. Matthes, H. W., C. Smadja, O. Valverde, J. L. Vonesch, A. S. Foutz, E. Boudinot, M. Denavit-Saubie, C. Severini, L. Negri, B. P. Roques, R. Maldonado and B. L. Kieffer (1998). "Activity of the delta-opioi d receptor is partia lly reduced, whereas activity of the kappa-receptor is maintained in mice lacking the mu-receptor." J Neurosci 18 (18): 7285-95. Mayer, P. and V. Hollt (2001). "Allelic and so matic variations in the endogenous opioid system of humans." Pharmacol Ther 91 (3): 167-77. McMahon, S. B., G. R. Lewin and P. D. Wall (1993). "Central hyperexcitability triggered by noxious inputs." Curr Opin Neurobiol 3 (4): 602-10. Mearadji, B., C. Penning, M. K. Vu, P. J. va n der Schaar, A. S. van Petersen, I. M. Kamerling and A. A. Masclee (2001). "I nfluence of gender on proximal gastric motor and sensory function." Am J Gastroenterol 96 (7): 2066-73. Meier, R., C. Beglinger, J. P. Dederding, B. Meyer-Wyss, M. Fumagalli, A. Rowedder, Y. Turberg and R. Brignoli (1995). "Influ ence of age, gender, hormonal status and smoking habits on colonic transit time." Neurogastroenterol Motil 7 (4): 235-8. Meller, S. T. and G. F. Gebhart (1993). "N itric oxide (NO) and nociceptive processing in the spinal cord." Pain 52 (2): 127-36. Melzack, R., T. J. Coderre, J. Katz and A. L. Vaccarino (2001). "C entral neuroplasticity and pathological pain." Ann N Y Acad Sci 933 : 157-74. Mendell, J. T. and H. C. Dietz (2001). "W hen the message goes awry: disease-producing mutations that influence mRNA content and performance." Cell 107 (4): 411-4. Mendell, L. M. and P. D. Wall (1965). "Res ponses Of Single Dorsal Cord Cells To Peripheral Cutaneous Unmyelinated Fibres." Nature 206 : 97-9. Minty, A., P. Chalon, J. M. Derocq, X. Dumont J. C. Guillemot, M. Kaghad, C. Labit, P. Leplatois, P. Liauzun, B. Miloux and et al. (1993). "Interleuki n-13 is a new human lymphokine regulating inflammato ry and immune responses." Nature 362 (6417): 248-50. Mogil, J. S., S. P. Richards, L. A. O'Toole, M. L. Helms, S. R. Mitchell and J. K. Belknap (1997). "Genetic sensitivity to hot-plat e nociception in DBA/2J and C57BL/6J inbred mouse strains: possible sex-speci fic mediation by delta2-opioid receptors." Pain 70 (2-3): 267-77.

PAGE 110

97 Mogil, J. S., S. P. Richards, L. A. O'Toole, M. L. Helms, S. R. Mitchell, B. Kest and J. K. Belknap (1997). "Identification of a sex-sp ecific quantitative trait locus mediating nonopioid stress-induced anal gesia in female mice." J Neurosci 17 (20): 7995-8002. Mogil, J. S., J. Ritchie, S. B. Smith, K. Strasburg, L. Kaplan, M. R. Wallace, R. R. Romberg, H. Bijl, E. Y. Sarton, R. B. Fillingim and A. Dahan (2005). "Melanocortin-1 receptor gene variants aff ect pain and mu-opioid analgesia in mice and humans." J Med Genet 42 (7): 583-7. Mogil, J. S., W. F. Sternberg, B. Kest, P. Marek and J. C. Liebeskind (1993). "Sex differences in the antagonism of swim stress-induced analgesia: effects of gonadectomy and estrogen replacement." Pain 53 (1): 17-25. Mogil, J. S., S. G. Wilson, K. Bon, S. E. Lee, K. Chung, P. Raber, J. O. Pieper, H. S. Hain, J. K. Belknap, L. Hubert, G. I. Elmer, J. M. Chung and M. Devor (1999). "Heritability of nociception I: responses of 11 inbred mouse strains on 12 measures of nociception." Pain 80 (1-2): 67-82. Mogil, J. S., S. G. Wilson, E. J. Chesler, A. L. Rankin, K. V. Nemmani, W. R. Lariviere, M. K. Groce, M. R. Wallace, L. Kaplan, R. Staud, T. J. Ness, T. L. Glover, M. Stankova, A. Mayorov, V. J. Hruby, J. E. Gr isel and R. B. Fillingim (2003). "The melanocortin-1 receptor gene mediates female-specific mechanisms of analgesia in mice and humans." Proc Natl Acad Sci U S A 100 (8): 4867-72. Moore, P. A., G. H. Duncan, D. S. Scott, J. M. Gregg and J. N. Ghia (1979). "The submaximal effort tourniquet test: its us e in evaluating experimental and chronic pain." Pain 6 (3): 375-82. Mountjoy, K. G., L. S. Robbins, M. T. Mortr ud and R. D. Cone (1992) "The cloning of a family of genes that encode the melanocortin receptors." Science 257 (5074): 124851. Narita, M., H. Mizoguchi, M. Narita, I. Sora, G. R. Uhl and L. F. Tseng (1999). "Absence of G-protein activation by mu-opioid recep tor agonists in the spinal cord of muopioid receptor knockout mice." Br J Pharmacol 126 (2): 451-6. Offenbaecher, M., K. Glatzeder and M. Ac kenheil (1998). "Self-reported depression, familial history of depression and fibromyalgia (FM), and psychological distress in patients with FM." Z Rheumatol 57 Suppl 2 : 94-6. Ohkubo, T., M. Shibata, H. Takahashi and S. Naruse (1985). "Naloxone prevents the analgesic action of alpha-MSH in mice." Experientia 41 (5): 627-8. Onengut-Gumuscu, S., K. G. Ewens, R. S. Spielman and P. Concannon (2004). "A functional polymorphism (1858C/T) in the PTPN22 gene is linked and associated with type I diabetes in multiplex families." Genes Immun 5 (8): 678-80.

PAGE 111

98 Pan, Y. X., J. Xu, L. Mahurter, E. Bolan, M. Xu and G. W. Pasternak (2001). "Generation of the mu op ioid receptor (MOR-1) protein by three new splice variants of the Oprm gene." Proc Natl Acad Sci U S A 98 (24): 14084-9. Pan, Y. X., J. Xu, B. L. Wan, A. Zuckerman and G. W. Pasternak ( 1998). "Identification and differential regional expression of KOR-3/ORL-1 gene splice variants in mouse brain." FEBS Lett 435 (1): 65-8. Panocka, I., P. Marek and B. Sadowski (1986) "Inheritance of stre ss-induced analgesia in mice. Selective breeding study." Brain Res 397 (1): 152-5. Petaja-Repo, U. E., M. Hogue, A. Laperrie re, S. Bhalla, P. Walker and M. Bouvier (2001). "Newly synthesized human delta opioid receptors retained in the endoplasmic reticulum are retrotranslocat ed to the cytosol, deglycosylated, ubiquitinated, and degraded by the proteasome." J Biol Chem 276 (6): 4416-23. Petaja-Repo, U. E., M. Hogue, A. Laperriere P. Walker and M. Bouvier (2000). "Export from the endoplasmic reticulum represents the limiting step in the maturation and cell surface expression of the hum an delta opioid receptor." J Biol Chem 275 (18): 13727-36. Porro, C. A., P. Baraldi, G. Pagnoni, M. Serafi ni, P. Facchin, M. Maie ron and P. Nichelli (2002). "Does anticipation of pain a ffect cortical nociceptive systems?" J Neurosci 22 (8): 3206-14. Price, D. D., J. W. Hu, R. Dubner and R. H. Gracely (1977). "Per ipheral suppression of first pain and central su mmation of second pain evoke d by noxious heat pulses." Pain 3 (1): 57-68. Quillan, J. M. and W. Sadee (1997). "Dynorphin peptides: antagonists of melanocortin receptors." Pharm Res 14 (6): 713-9. Ray, L. A. and K. E. Hutchison (2004). "A polymorphism of the muopioid receptor gene (OPRM1) and sensitivity to the effects of alcohol in humans." Alcohol Clin Exp Res 28 (12): 1789-95. Rees, J. L., M. Birch-Machin, N. Flanaga n, E. Healy, S. Phillips and C. Todd (1999). "Genetic studies of the hu man melanocortin-1 receptor." Ann N Y Acad Sci 885 : 134-42. Rexed, B. (1952). "The cytoarchitectonic organi zation of the spinal cord in the cat." J Comp Neurol 96 (3): 414-95. Riedel, W. and G. Neeck (2001). "Nocicep tion, pain, and antinociception: current concepts." Z Rheumatol 60 (6): 404-15.

PAGE 112

99 Riley, J. L., 3rd, M. E. Robinson, E. A. Wi se, C. D. Myers and R. B. Fillingim (1998). "Sex differences in the perception of noxious experimental stimuli: a metaanalysis." Pain 74 (2-3): 181-7. Robbins, L. S., J. H. Nadeau, K. R. Johnson, M. A. Kelly, L. Roselli-Rehfuss, E. Baack, K. G. Mountjoy and R. D. Cone (1993). "Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function." Cell 72 (6): 827-34. Rollman, G. B., J. Abdel-Shaheed, J. M. G illespie and K. S. Jones (2004). "Does past pain influence current pain: biological and psychosocial models of sex differences." Eur J Pain 8 (5): 427-33. Romberg, R., E. Sarton, L. Teppema, H. W. Ma tthes, B. L. Kieffer and A. Dahan (2003). "Comparison of morphine-6-g lucuronide and morphine on respiratory depressant and antinociceptive responses in wild type and mu-opioid receptor deficient mice." Br J Anaesth 91 (6): 862-70. Sabatini, M., B. Boyce, T. Aufdemorte, L. Bonewald and G. R. Mundy (1988). "Infusions of recombinant human interleukins 1 alpha and 1 beta cause hypercalcemia in normal mice." Proc Natl Acad Sci U S A 85 (14): 5235-9. Samad, T. A., K. A. Moore, A. Sapirstein, S. Billet, A. Allchorne, S. Poole, J. V. Bonventre and C. J. Woolf (2001). "Inter leukin-1beta-mediate d induction of Cox-2 in the CNS contributes to inflam matory pain hypersensitivity." Nature 410 (6827): 471-5. Sato, A., Y. Sato, M. Shimura and S. Uchida (2000). "Calcitonin gene-related peptide produces skeletal muscle vasodilation following antidromic stimulation of unmyelinated afferents in the dorsal root in rats." Neurosci Lett 283 (2): 137-40. Schadrack, J. and W. Zieglgansberger (1998). "Pharmacology of pain processing systems." Z Rheumatol 57 Suppl 2 : 1-4. Schappert, S. M. (1998). "Ambulatory care visi ts to physician offices hospital outpatient departments, and emergency de partments: United States, 1996." Vital Health Stat 13(134): 1-37. Schioth, H. B., S. R. Phillips, R. Rudzish, M. A. Birch-Machin, J. E. Wikberg and J. L. Rees (1999). "Loss of function mutations of the human melanocortin 1 receptor are common and are associated with red hair." Biochem Biophys Res Commun 260 (2): 488-91. Scott, M. C., K. Wakamatsu, S. Ito, A. L. Kadekaro, N. Kobayashi, J. Groden, R. Kavanagh, T. Takakuwa, V. Virador, V. J. Hearing and Z. A. Abdel-Malek (2002). "Human melanocortin 1 receptor varian ts, receptor function and melanocyte response to UV radiation." J Cell Sci 115 (Pt 11): 2349-55.

PAGE 113

100 Seltzer, Z., T. Wu, M. B. Max and S. R. Diehl (2001). "Mapping a gene for neuropathic pain-related behavior fo llowing peripheral neurectomy in the mouse." Pain 93 (2): 101-6. Shibasaki, H. (2004). "Central mechanisms of pain perception." Suppl Clin Neurophysiol 57 : 39-49. Simonin, F., O. Valverde, C. Smadja, S. Slowe, I. Kitchen, A. Dierich, M. Le Meur, B. P. Roques, R. Maldonado and B. L. Kieffer (1998). "Disruption of the kappa-opioid receptor gene in mice enhances sensitivity to chemical visceral pain, impairs pharmacological actions of the selectiv e kappa-agonist U-50,488H and attenuates morphine withdrawal." Embo J 17 (4): 886-97. Sivilotti, L. G., G. Gerber, B. Rawat and C. J. Woolf (1995). "Morphine selectively depresses the slowest, NMDA-independent component of C-fibre-evoked synaptic activity in the rat spinal cord in vitro." Eur J Neurosci 7 (1): 12-8. Sora, I., N. Takahashi, M. Funada, H. Ujik e, R. S. Revay, D. M. Donovan, L. L. Miner and G. R. Uhl (1997). "Opiate receptor knoc kout mice define mu receptor roles in endogenous nociceptive responses an d morphine-induced analgesia." Proc Natl Acad Sci U S A 94 (4): 1544-9. Stanfa, L. and A. Dickenson (1995). "Spi nal opioid systems in inflammation." Inflamm Res 44 (6): 231-41. Staud, R. (2002). "Evidence of involvement of central neural mechanisms in generating fibromyalgia pain." Curr Rheumatol Rep 4 (4): 299-305. Staud, R. and M. L. Smitherman (2002). "P eripheral and central sensitization in fibromyalgia: pathogenetic role." Curr Pain Headache Rep 6 (4): 259-66. Stenberg, B. and S. Wall (1995). "Why do wo men report 'sick building symptoms' more often than men?" Soc Sci Med 40 (4): 491-502. Stephan, M., F. Helfritz, R. Pabst and S. von Horsten (2002). "Postnatally induced differences in adult pain sensitivity depend on genetics, gender and specific experiences: reversal of mate rnal deprivation effects by additional postnatal tactile stimulation or chronic imipramine treatment." Behav Brain Res 133 (2): 149-58. Sturm, R. A., N. F. Box and M. Ramsay (1998). "Human pigmentation genetics: the difference is only skin deep." Bioessays 20 (9): 712-21. Szeto, C. Y., N. L. Tang, D. T. Lee and A. Stadlin (2001). "Association between mu opioid receptor gene polymorphisms and Chinese heroin addicts." Neuroreport 12 (6): 1103-6.

PAGE 114

101 Talbot, J. D., S. Marrett, A. C. Evans, E. Meyer, M. C. Bushnell and G. H. Duncan (1991). "Multiple representations of pain in human cerebral cortex." Science 251 (4999): 1355-8. Talley, N. J. (1998). "Irritable bowel s yndrome: disease definition and symptom description." Eur J Surg Suppl (583): 24-8. Talley, N. J. (1999). "Irritable bowel syndrom e: definition, diagnosis and epidemiology." Baillieres Best Pract Res Clin Gastroentero l 13 (3): 371-84. Tan, E. C., C. H. Tan, U. Karupathivan and E. P. Yap (2003). "Mu opioid receptor gene polymorphisms and heroin depe ndence in Asian populations." Neuroreport 14 (4): 569-72. Tatro, J. B. (1996). "Receptor biology of the melanocortins, a family of neuroimmunomodulatory peptides." Neuroimmunomodulation 3 (5): 259-84. Terkeltaub, R. A. (1999). "IL-10: An "imm unologic scalpel" for atherosclerosis?" Arterioscler Thromb Vasc Biol 19 (12): 2823-5. Tian, M., H. E. Broxmeyer, Y. Fan, Z. Lai, S. Zhang, S. Aronica, S. Cooper, R. M. Bigsby, R. Steinmetz, S. J. Engle, A. Mest ek, J. D. Pollock, M. N. Lehman, H. T. Jansen, M. Ying, P. J. Stambrook, J. A. Tischfield and L. Yu (1997). "Altered hematopoiesis, behavior, and sexual func tion in mu opioid receptor-deficient mice." J Exp Med 185 (8): 1517-22. Turk, D. C., A. Okifuji and D. Kalauokalani (1999). Clinical outcome and economical evaluation of multi-dis ciplinary pain centers Mahwah, NJ, Erlbaum. Unruh, A. M. (1996). "Gender variati ons in clinical pain experience." Pain 65 (2-3): 12367. Urban, L., S. W. Thompson and A. Dray (1994) "Modulation of spinal excitability: cooperation between neurokinin and excitatory amino acid neurotransmitters." Trends Neurosci 17 (10): 432-8. Vaeroy, H., T. Sakurada, O. Forre, E. Kass a nd L. Terenius (1989). "Modulation of pain in fibromyalgia (fibrositis syndrome): cer ebrospinal fluid (CSF) investigation of pain related neuropeptides w ith special reference to calcitonin gene related peptide (CGRP)." J Rheumatol Suppl 19 : 94-7. Valverde, P., E. Healy, I. Jackson, J. L. R ees and A. J. Thody (1995). "Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans." Nat Genet 11 (3): 328-30. Vaughan, C. W. and M. J. Christie (1997). "P resynaptic inhibitory action of opioids on synaptic transmission in the rat periaqueductal grey in vitro." J Physiol 498 ( Pt 2) : 463-72.

PAGE 115

102 Verne, G. N. and J. J. Cerda (1997). Irritable bowel syndrome. Streamlining the diagnosis." Postgrad Med 102 (3): 197-8, 201-4, 207-8. Verne, G. N., M. E. Robinson and D. D. Pri ce (2001). "Hypersensitivity to visceral and cutaneous pain in the irritable bowel syndrome." Pain 93 (1): 7-14. Verne, G. N. and D. D. Price (2002). "Irr itable bowel syndrome as a common precipitant of central sensitization." Curr Rheumatol Rep 4 (4): 322-8. Wald, A., D. H. Van Thiel, L. Hoechstetter, J. S. Gavaler, K. M. Egler, R. Verm, L. Scott and R. Lester (1981). "Gastroi ntestinal transit: th e effect of the menstrual cycle." Gastroenterology 80 (6): 1497-500. Waliszewski, P., M. Blaszczyk, E. Wolinska-Witort, M. Drews, M. Snochowski and R. E. Hurst (1997). "Molecular study of sex st eroid receptor gene expression in human colon and in colorectal carcinomas." J Surg Oncol 64 (1): 3-11. Walker, J. M., H. Akil and S. J. Watson (1980). "Evidence for hom ologous actions of pro-opiocortin products." Science 210 (4475): 1247-9. Wallace, D. J. (1997). "The fibromyalgia syndrome." Ann Med 29 (1): 9-21. Wei, L. N. and H. H. Loh (2002). "Re gulation of opioid receptor expression." Curr Opin Pharmacol 2 (1): 69-75. Wessendorf, M. W. and J. Dooyema (2001). "Coexistence of kappaand delta-opioid receptors in rat spinal cord axons." Neurosci Lett 298 (3): 151-4. Whitehead, W. E., O. Palsson and K. R. Jones (2002). "Systematic review of the comorbidity of irritable bow el syndrome with other diso rders: what are the causes and implications?" Gastroenterology 122 (4): 1140-56. Wikberg, J. E. (1999). "Melanocortin r eceptors: perspectives for novel drugs." Eur J Pharmacol 375 (1-3): 295-310. Wolfe, F., I. J. Russell, G. Vipraio, K. Ross and J. Anderson (1997). "Serotonin levels, pain threshold, and fibromyalgia sy mptoms in the general population." J Rheumatol 24 (3): 555-9. Xia, Y., J. E. Wikberg and V. Chhajlani (1995). "Expression of melanocortin 1 receptor in periaqueductal gray matter." Neuroreport 6 (16): 2193-6. Yu, X. M., M. Hua and S. Mense (1991). "The effects of intracerebr oventricular injection of naloxone, phentolamine and methysergi de on the transmission of nociceptive signals in rat dorsal horn neurons with convergen t cutaneous-deep input." Neuroscience 44 (3): 715-23.

PAGE 116

103 Zhang, K. M., X. M. Wang and S. S. Mokha (1996). "Opioids modulate N-methyl-Daspartic acid (NMDA)-evoked responses of neurons in the superficial and deeper dorsal horn of the medulla (t rigeminal nucleus caudalis)." Brain Res 719 (1-2): 22933. Zhang, Y., D. Wang, A. D. Johnson, A. C. Papp and W. Sadee (2005). "Allelic expression imbalance of human mu opioi d receptor (OPRM1) caused by variant A118G." J Biol Chem 280 (38): 32618-24. Zhu, Y., M. A. King, A. G. Schuller, J. F. Nits che, M. Reidl, R. P. Elde, E. Unterwald, G. W. Pasternak and J. E. Pintar (1999). "Ret ention of supraspinal delta-like analgesia and loss of morphine tolerance in delta opioid recep tor knockout mice." Neuron 24 (1): 243-52. Zubieta, J. K., M. M. Heitzeg, Y. R. Smith, J. A. Bueller, K. Xu, Y. Xu, R. A. Koeppe, C. S. Stohler and D. Goldman (2003). "COM T val158met genotype affects mu-opioid neurotransmitter responses to a pain stressor." Science 299 (5610): 1240-3.

PAGE 117

104 BIOGRAPHICAL SKETCH Lee Kaplan was born in Cape Town South Africa on July 23rd 1976. After taking a few years off after high school, she attende d the University of Stellenbosch in Stellenbosch South Africa and majored in gene tics and psychology. Wanting to pursue a career in human genetics, Lee decided to head to the United States of America and more specifically, to Florida to attain her PhD in human genetics. Afte r meeting Dr. Wallace, Lee knew that she would be able to meet her goals in this lab. Lee plans on going on to a fellowship in clinical cytogene tics and molecular genetics, wh ich will allow her to direct laboratories key to diagnosing human genetic di sease. Although clinical work will be her main focus, Lee plans also to run a basi c science lab research ing the mechanism of human disease.


Permanent Link: http://ufdc.ufl.edu/UFE0012884/00001

Material Information

Title: Elucidating the Genetic Influences in Pain Sensitivity and Analgesic Effect
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012884:00001

Permanent Link: http://ufdc.ufl.edu/UFE0012884/00001

Material Information

Title: Elucidating the Genetic Influences in Pain Sensitivity and Analgesic Effect
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012884:00001


This item has the following downloads:


Full Text












ELUCIDATING THE GENETIC INFLUENCES IN PAIN SENSITIVITY AND
ANALGESIC EFFECT















By

LEE KAPLAN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Lee Kaplan

































I would like to dedicate this dissertation to my parents, for whom I am truly grateful. If it
were not for your guidance, encouragement and world wisdom, I would not have been
able to do this. I recognize and appreciate all you have given up in life to make education
a priority for me. Thank you and I love you. You will never know what you mean to me.
Also, I would like to dedicate this document to my brother Albert and my grandparents.















ACKNOWLEDGMENTS

First of all, I would like to thank my mentor, Dr Margaret R. Wallace for being not

only a mentor, but also a friend and confidant. I am truly lucky to have landed up in a

wonderfully encouraging environment both professionally as well as personally. It is an

amazing feeling to know that someone is always looking out for my best interests. I

would like to express thanks to my lab mates who have helped me along the way,

especially my lab manager, Beth Fisher, who always offered to help in any way she

could, and my fellow graduate students in the lab who helped brainstorm, especially

Lauren Fishbein and Jessica Walrath, and my undergraduate, Brandon Sack, who is just

awesomely intelligent hard worker. I would like to thank my favorite IT lab mate

Frederick Kweh for rushing to my aid at the hint of computer issues while writing.

Without him, this dissertation would not be in one piece. I would like to thank my

committee members who have all been mentors to me, and each has assisted me in

different aspects of my project and my career. These five people really care not only

about my professional progress but also about my personal happiness. Each has made me

a part of his lab and taught me different techniques. My committee members are John

Aris, Daniel Driscoll, Roger Fillingim, James Resnick and Colin Sumners. I would also

like to thank their labs and especially Dr. Karen Johnstone for the guidance. I would like

to thank my collaborators Dr. Roger Fillingim and Dr. Nicholas Verne for their financial

support throughout my graduate career and for being friends as well as teachers and

collaborators. I would also like to thank Dr. Roland Staud for his ongoing collaboration









and input. I am thankful to have had tremendous help and advice from Dr. Carrie

Haskell-Leuvano and her lab, for the functional project. Dr. Mavis Agbandje-McKenna

provided great help with the protein modeling. I also thank the faculty and staff of the

Pediatrics Division of Genetics for allowing me to participate in clinical conferences, and

their collaboration on other projects I studied. Dr. Roberto Zori was paramount in

helping me find my niche as a future clinical cyto and molecular geneticist.

I thank my friends who have been there for the laughs and the tears and everything

in between. I am fortunate to have many friends who have supported me through the past

five years, I would like to mention Robyn Maher, Dr. Baharak Moshiree, Dr. Hazel Levy,

Dr. Rita Hanel and Dr. Amy MacNeill, and I would also like to thank my friends Dr.

Jaqueline Teusner, Dr. Karen Johnstone and Dr. Stuart Beatty for help and guidance with

this manuscript. There are so many more friends to mention and you know who you all

are. I love you. I appreciate everything Dr. McCormack has done for me as it has not

been an easy road for me, but it is nice to have someone there to help and advise. Also, I

would like to thank the staff in the graduate education office as the ladies have always

been ready to do anything possible at the other end of the phone. I thank my department

administration for all the support offered throughout my graduate career and especially

Joyce Conners without whom my life would be a disorganized mess. Also, I don't think I

could have made this manuscript whole without the help of the electronic thesis and

dissertation office and days spent at Coffee Culture. If there is anyone I have forgotten to

thank, I apologize and thanks.
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF FIGURES ......... ......................... ...... ........ ............ ix

L IST O F O B JE C T S .... ......................................... ............. .. .. ...... .............. xi

ABSTRACT .............. ..................... .......... .............. xii

CHAPTER

1 BACKGROUND AND SIGNIFICANCE.................. ........ ....... ...............

The A fferent N ociceptive System ........................................ .......................... 1
Central Processing of the N oxious Stim ulus ............................................................. 3
Descending Anti-N ociception .................................. ......................................4
Two Receptor Systems ................................. ... ....... ................. .4
Genetics In Pain ............ ......... .. ............ ........ 6
Mouse Models of Pain ....................................... ............ ..........7
Hum an Studies...................................................... ... .. ........... 8
Gender Differences and Psychosocial Influences ...........................................9
Candidate G enes ............... .............. ........................ ...... ............. ................ 11
The O pioid R eceptor Fam ily .................................... .......................... ......... .11
The M elanocortin Receptor Family ............... ............................................. 14
CALCA 1/CCGRP R eceptor ...................................................... ............... 15
C chronic Pain C onditions........................ .... ...................................... ............... 16
Irritable Bow el Syndrom e ............................................................................16
Fibrom yalgia .................................................................... .. ........ ........ .......... 17

2 M ATERIALS AND M ETHOD S ........................................ ......................... 19

C candidate G ene Selection........... .................................. ................... ............... 19
Literature Search ............................................................. .............. ......19
Single Nucleotide Polymorphism (SNP) Selection...........................................19
G e n o ty p in g ....................................................................................1 9
Prim er D esign A nd Synthesis......................................... ......................... 19
Polymerase Chain Reaction (PCR) ........................................ ............... 20
SN P A n aly sis ................................................ ................ 2 0
C lo n in g ............................................................................ 2 1









Opioid Clones .......................... ...................21
Site D directed M utagenesis ................................................. ............................. 22
T issue C culture .................................................................................................. .......23
Stable T ransfections ............................ ................................ .. ....... ............ 23
Characterization and Verification of Stably Transfected Cell Lines..........................24
G ene expression levels ............................................... ............................. 24
Protein expression levels ............................................. ............................ 27
Functional Analysis ......................... ..... .................. ..... ..... 28
Im munocytochem istry ............................ ........ .. ...... ..................... 28

3 INTRODUCTION TO ASSOCIATION STUDIES ..............................................33

C candidate G ene A approach ............................................................... .....................33
Statistical A n aly sis............................................................................. ............... 36
Q T L .................................................................... 3 7
A N O V A ................................................................................................. 3 7
N negative A association Studies ............................................................................. 38

4 THE MELANOCORTIN-1 RECEPTOR GENE MEDIATES SEX-SPECIFIC
MECHANISMS OF ANALGESIA IN HUMANS ............................................ 41

M C 1R .............................................................................................. 4 1
R e su lts ......................................................... .................... ................4 2
Pentazocine Studies .............................. ........... .. ... ..... ............... 42
M 6G D ata ................................................... .......... .... ......... . ..... 4 5
D isc u ssio n .................. ................................................... ................ 4 6
Pentazocine Studies .............................. ........... .. ... ..... ............... 46
M 6G study ...................................... ................................ .........47

5 THE Al 18G SINGLE NUCLEOTIDE POLYMORPHISM IN THE it-OPIOID
RECEPTOR GENE IS ASSOCIATED WITH PRESSURE PAIN SENSITIVITY..55

In tro d u ctio n ...................................... ................................................ 5 5
R e su lts ...................................... .......................................................5 6
D iscu ssio n ...................................... ................................................. 5 7

6 FUNCTIONAL ANALYSIS OF SINGLE NUCLEOTIDE POLYMORPHISMS ...62

Introdu action ................... ...................................................................... 62
The Delta Opioid Receptor and T80G (F27C)............................................62
The Kappa Opioid Receptor and G36T........................................ ...............64
R e su lts............................................................................................................. 6 5
D iscu ssio n ...................................... ................................................. 6 7

7 CONCLUSIONS AND FUTURE DIRECTIONS ............................................. 77

C o n clu sio n s..................................................... ................ 7 7
M C 1R ..................................... .................. ............... ......... 77









O P R M 1 .................................................................................. 7 8
O P R D 1 .................................................................................. 7 9
Clinical Testing .................................. ... .. ........ ......... ... 79
Future Directions .................... ........................... ......79
A association Stu dies ......................... .... ..................... ........ .... ............79
Functional A analysis ......................... ............ .... .......... ....... 82
G e n e ra l ........................................................................................................8 3

APPENDIX

A GEN O TY PIN G RESULTS ........................................ ................................. 85

B GENOTYPE FREQUENCIES................................... .............86

L IST O F R E FE R E N C E S ........................................................................ .. ....................88

BIOGRAPH ICAL SKETCH .............................................................. ............... 104





































viii
















LIST OF FIGURES


Figure page

2-1 Vector maps made using the Vector NTI software. .................................................31

2-2 List of primers used for the site directed mutagenesis. ............................................32

4-1 The measures of pentazocine analgesia in humans by sex, hair and skin
phenotypes, as well as MC1R genotypes. ..................................... ............... 49

4-2 Change in pain ratings after pentazocine analgesia separated by sex and genotype.. 50

4-3 The grouping of subjects by the location of the SNP in the MC1R gene and a
description of their phenotypic characteristics (Mogil et al. 2005)..........................51

4-4 Effects of MC 1R functionality on baseline nociceptive and pain sensitivity in
hum ans. .............................................................................52

4-5 The change in pain tolerance over time after the administration of M6G at a dose
of 0 .3m g/kg ....................................................... ................. 53

4-6 M6G analgesia expressed as the area under the time effect curve ...........................54

4-7 Concentrations of M6G plasma levels in participants at time points after M6G
administration at a dose of 0.03mg/kg (Mogil et al. 2005). ................................54

5-1 This figure illustrated the details of the subjects in this study.................................. 60

5-2 Pressure pain threshold at all three sites tested (trapezius at the top, masseter in
the m iddle and ulna at the bottom ) ........................................ ........ ............... 61

6-1 Model of the delta opioid receptor (B), based on the bovine rhodopsin receptor
(A) with the ball representing the conserved phenylalanine residue. ................. 69

6-2 The local environment of the hydrophobic pocket where the phenylalanine is
lo cated ........................................................... ................ 7 0

6-3 Activation assay results show that there was no dose response in the activation of
the stably transfected cell lines ..................................... .... .... ......... 71

6-4 Northern blot analysis of the human delta- and kappa opioid receptor stably
transfected cell lines. ..................................... ... .. ........ .... ............ 72









6-5 The western blot comassie stained is on the left and the ECL blot is on the right.....74

6-6 Western blot of COS-7 transiently transfected cells, 48 hours post-transfection.......75

6-7 RT-PCR of the OPRD 1 cDNA from stably transfected colonies after 25 extension
cy c le s.. ....................................................... .....................7 6

7-1 A transient transfecion with the original vectors received from collaborators. ........84















LIST OF OBJECTS

Object page

A-1. Excel spreadsheet containing the list of genotype results in all polymorphisms
studied. (objectl.xls, 118KB)...................................... ......... ................. 85

A-2. Comma separated variable (CSV) version of the list of genotype results in all
polymorphisms studied. (object2.csv, 28 KB) ............... ............................... 85















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ELUCIDATING THE GENETIC INFLUENCES IN PAIN SENSITIVITY AND
ANALGESIC EFFECT

By

Lee Kaplan

December 2005

Chair: Margaret R. Wallace
Major Department: Molecular Genetics and Microbiology

Pain impacts the quality of life for millions of people each year and is a significant

drain on the country's health care resources. Pain is an innate response to a noxious

stimulus indicating damage in a region of the body. This response elicits various

reactions from the body including autonomic, inflammation, as well as stimulation of

growth and repair. Under some conditions, often associated with plasticity in the

nociceptive system, pain may become prolonged and lose its adaptive function. In this

study, we are using data from human volunteers, which makes our findings directly

clinically applicable compared to animal models. The clinical aspects of pain have been

vastly studied but there is a deficiency of information regarding genetic influences on

pain responses. There is new evidence supporting the notion that genetics contributes to

pain sensitivity and response to analgesics. We have undertaken a scientific study to test

the effects of candidate molecular receptor variants in this process. We have found

positive associations of some single nucleotide polymorphisms with pain sensitivity and









analgesia, although no polymorphisms were implicated in case-control studies of chronic

pain conditions with the current cohort of subjects. It is the dawning of a new era in pain

research, in which our enhanced understanding of the molecular mechanisms contributing

to pain may help elucidate the individual differences in pain responses. By improving

our understanding of molecular contributions to pain, it will be possible to tailor

treatment to individual patients, thus improving clinical outcomes.














CHAPTER 1
BACKGROUND AND SIGNIFICANCE

Pain impacts the quality of life for millions of people each year and is a significant

drain on the country's health care resources. It is the primary motivator for the utilization

of health care (Knapp and Koch 1984), and approximately 1 in 5 Americans experiences

chronic pain (Joranson and Lietman 1994). Pain medications are the second most

prescribed medications (Schappert 1998) and the direct and indirect costs of treating pain

is estimated to be over $125 billion annually (Turk et al. 1999). Nociception is the term

used to describe the neural transmission of signals that may lead to the experience of

pain. According to the International Association for the Study of Pain, pain is defined as

"an unpleasant sensory and emotional experience associated with actual or potential

tissue damage, or described in terms of such damage" (www.iasp-pain.org/terms-

p.html#Pain). On this website is described the subjectivity of pain and that each person

has unique parameters of experience to which pain is rated. Although pain is an

emotional experience, this definition also acknowledges the role that biology plays in the

pain process, as the noxious stimulus has an ability to cause tissue damage and thus

incorporates physiological pathways.

The Afferent Nociceptive System

A pain response elicits various reactions from the body including vasodilation,

inflammation, and the stimulation of growth and repair. Under some conditions, often

associated with plasticity in the nociceptive system, pain may become prolonged and lose

its adaptive function. Once the pain pathway has become sensitized, the nociceptive









pathway is more primed to sensation and this leads to a chronic pain state. Noxious

stimuli are detected by specialized receptors in the nervous system called nociceptors.

Nociceptors innervate all peripheral systems of the body to allow for the perception of a

noxious stimulus. They make up part of the sensory system of the nervous system and

allow the brain to analyze the nature, location, intensity and duration of the noxious

stimulus (Riedel and Neeck 2001).

.There are two main types of nociceptors, A6 fibers and C fibers\. A6 fibers are

myelinated and are thought to contribute to the experience of sharp shooting pain. This is

usually the first sensation a person feels after the experience of a noxious stimulus. C-

fibers are unmyelinated, and their activation can lead to the sensation of a dull throbbing

pain, which tends to last for a longer duration of time. In a chronic pain condition, it is

believed that prolonged C-fibers activation can cause second order spinal neurons to

become sensitized and cause long-term pain. Tissue damage and peripheral nerve injury

may cause an expansion of the dorsal horn receptor field, thereby increasing the input

region from the periphery.

The cell body of the nociceptor is located in dorsal root ganglia and enter the

central nervous system in the dorsal horn of the spinal cord. The C fibers synapse on

spinal neurons in superficial region of the dorsal horn and are found in laminae I and II,

while the A6 fibers are located in lamina V (Rexed 1952). There is a high concentration

of excitatory amino acids found in the superficial region of the dorsal horn, which include

glutamate, aspartate, substance P (SP) and calcitonin gene related peptide (CGRP).

These molecules represent the main nociceptive transmitters as they co-localize to the

nociceptive neurons and have been found to be elevated, along with their receptors, in a









chronic pain situation (Riedel and Neeck 2001). The stimulus is routed through the cell

body up the primary afferent axons to multiple regions of the neuraxis. The thalamus is a

primary brain region involved in nociceptive processing. The thalamus is responsible for

the propagation of the stimulus and routing of the impulse to the somatosensory cortex

where the sensation is interpreted, as well as to other cortical regions for higher order

processing.

Central Processing of the Noxious Stimulus

Exactly where pain is processed in the brain remains an enigma. Pain is regarded

to be perceived in the subcortical structures of the brain. The first receiving unit is the

thalamus and then the message is transmitted to the somatosensory cortex, as well as

other cortical structures, and effector processes are initiated. This is supported by the fact

that patients with cortical lesions do not lose the sensation of pain (Shibasaki 2004). A

positron emission tomography-regional cerebral blood flow (PET-rCBF) activation study

concluded that the primary and secondary somatosensory cortex (SI and SII respectively)

are activated during a painful stimulus, as well as the cingulate cortex, contralateral to the

side where the pain is being delivered (Talbot et al. 1991). Using functional magnetic

resonance imaging (fMRI), researchers have shown that activation occurs in the SI not

only during the actual stimulation, but also in anticipation of the noxious stimulus (Porro

et al. 2002). A few groups demonstrated that central neuroplasticity and pain memory

play a considerable role in clinical symptoms such as central neuropathic pain and

phantom pain (Melzack et al. 2001; Garcia-Larrea et al. 2002). The SI seems to play a

role in basic pain processing, while the SII and insula are involved in more intricate pain

perception and sensitization. The emotional aspects of pain processing are controlled by









the anterior cingulate cortex and the posterior insula/parietal operculum structures

(Shibasaki 2004).

Descending Anti-Nociception

Gamma-amino butyric acid (GABA) is a major inhibitory transmitter in the CNS.

This compound has been implicated in the inhibition of acute and persistent pain

(Malcangio and Bowery 1996; Schadrack and Zieglgansberger 1998). Anti-nociception

has been attributed to cholernergic interneurons acting on opioidergic interneurons

through the mu, delta and kappa opioid receptors, via enkephalins and dynorphins.

Along with pain relief via the efferent pain pathway, inflammation and redness

may occur at the site of the stimulus, if there has been an immunological response to

allow wound healing. During the inflammatory process, there is an actual disruption of

the perineurial barrier around the primary afferent fibers, which allows endogenous and

exogenous opioids released from immune cells to inhibit the nociceptive stimulus at the

peripheral ending (Antonijevic et al. 1995). This is an additional system of pain relief.

Two Receptor Systems

Two important receptor systems known to be integral to the process of nociception

and anti-nociception are the N-methyl-D-aspartic acid (NMDA) and the opioid receptor

systems respectively. Opioid receptors are synthesized in the peripheral neurons and then

are transported to the periphery and central endings of the nociceptive fibers. NMDA

receptors can be found highly represented in the dorsal horn in lamina II along with the

opioid receptors, which suggests that these receptors may be functionally related.

Opioids have been shown to directly or indirectly modulate NMDA receptor mediated

events within the CNS by either inhibition or potentiation of the electrophysiological

message (Chapman et al. 1994; Sivilotti et al. 1995; Zhang et al. 1996; Vaughan and









Christie 1997). Research (Chen et al. 1995) has shown that the kappa opioids, such as

dynorphin, are NMDA receptor antagonists and that the kappa opioid peptides have been

found in the dorsal horn during inflammation, associated with a disruption of nociceptive

transmission at the level of the spinal cord. Opioids, in fact, have been found to regulate

NMDA receptors by inhibiting the calcium channel activity of these receptors (Basbaum

and Fields 1984; Mao et al. 1995). One affecting the influence of spinal opioid receptors

in anti-nociception (especially that of the mu- opioid receptor) is the amount of spinal

cholecystokinin (CCK), whose action is inhibitory on spinal opioid efficacy (Stanfa and

Dickenson 1995). Nitric oxide (NO) acts as a negative feedback regulator of NMDA

receptors. This feedback loop is initiated by the release of calcitonin gene related peptide

(CGRP) and substance P (SP), which is increased in the dorsal horn during hyperalgesia.

A prolonged release of these factors from the primary afferent neurons activates the

NMDA-NO cascade (McMahon et al. 1993). Hyperalgesia is defined as an increased

response to a painful stimulus. NMDA activation, which is mediated by NO, has been

implicated in the maintenance of hyperalgesia in chronic pain models (Meller and

Gebhart 1993). This hyperexcitability of the spinal cord is known as central

sensitization. This phenomenon is known as "windup" and is caused in part by the

involvement of the C-fiber activity with the constant release of the neurotransmitters in

the dorsal horn region, which affects post-synaptic transmission of the nociceptive signal

(Mendell and Wall 1965; Basbaum and Fields 1984; Urban et al. 1994; Mao, Price et al.

1995). "Windup" is also known as temporal summation of pain and was first described

by Mendell and Wall in 1965.









The clinical aspects of pain have been greatly studied but there is a deficiency of

information regarding genetic influences on pain responses. There is direct evidence

supporting the notion that genetics contributes to pain sensitivity and response to

analgesics (Mogil et al. 2003; Zubieta et al. 2003). It is the dawning of a new era in pain

research in which our enhanced understanding of the molecular mechanisms contributing

to pain may help elucidate the well-documented and substantial individual differences in

pain responses. By improving our understanding of molecular contributions to pain, it

will be possible to tailor treatment to individual patients, improving clinical outcomes. A

few genes stand out in the search for the genetic component of pain. These candidate

genes are discussed below and are the major focus of my work.

Genetics In Pain

Two main influences in many life experiences are environment and genetics. The

environmental influences in pain are discussed below. There is concrete evidence that

genetics plays a role in pain susceptibility as well as analgesic effect. This is evident in

twin studies of lower back pain and neck pain, examining dizygotic twins as well as

monozygotic twins (MacGregor et al. 2004). In this extensive study, which included 181

monozygotic (MZ) and 351 dizygotic (DZ) twin pairs, the range of concordance found

was 52%-68% for lower back pain and 35%-58% for neck pain. These numbers are

considered strong indicators of genetic contribution. Association studies of candidate

genes and pain have become common in the past five years, given that pain is a complex

trait with genetic influences. Pain genetics studies were initially done using mouse

models. Comprehensive mouse studies have been undertaken, and only in the past

decade have human participants been the object of genetic candidate gene association









analysis of pain. We have based our human studies in part on data generated by murine

QTL analysis.

Mouse Models of Pain

Human traits can often be mirrored and manipulated in the murine laboratory

system, in which systems can be broken down into simpler events in inbred mice to

control for genetic background. Classic tools include transgenic mice, which express an

exogenous gene, and knock-out mice, in which an endogenous gene of interest is made

non-functional by homologous recombination in embryonic stem cells. Genetically

speaking, there are also differences between laboratory mouse strains. There are two

main strains that have been bred to select for pain sensitivity in mice. One is the HA/LA

mouse line, which displays high and low analgesia respectively (Panocka et al. 1986),

which is induced during swimming in cold water. The second useful strain in the pain

paradigm is the HAR/LAR mouse line, which was bred by Belknap and colleagues in

1983. These mice display high or low analgesia in response to the opioid analgesic

levorphanol. These strains are theorized to have mutations which control response in a

Mendelian fashion. Quantitative trait loci mapping has been undertaken in these and

other strains, using microsatellites and candidate gene polymorphisms involved in pain

sensitivity, in association with measured analgesic response (Mogil et al. 1997a, 1997b).

In terms of mouse knock-out models, all the opioid receptors have been disrupted as well

as all their identified endogenous ligands. From these studies, we have learned that there

is great redundancy within the opioid system although the different knock-out mice have

various behavioral deficits. The knock-out mice have been made by various laboratories

including Zhu et al. 1999 and Filliol et al. 2000, who made a delta opioid receptor knock-

out. The first few mu opioid receptor knock-outs were made in 1996-7 (Sora et al. 1997;









Tian et al. 1997; Matthes et al. 1998). The only kappa opioid receptor knock-out was

made by Simionin et al. in 1998. In all these knock-out mice, homozygotes were viable

and fertile. Absence of the receptor was shown by lack of binding of the selective

agonist, but there was no major compensatory effect with respect to the anatomical

expression of the other two receptors. There is a hypothesis that there may be an

adaptation at the level of coupling efficiency instead of the difference being seen at the

level of ligand binding (Matthes et al. 1998; Narita et al. 1999; Hosohata et al. 2000).

Mice lacking the opioid peptide components have also been reported to be phenotypically

normal for pain modalities. These mouse data have been extensively discussed in a

comprehensive review by Kieffer and Gaveriaux-Ruff (2002). In this review they also

describe efforts to make double and triple knock-out mice through cross breeding.

Human Studies

One of the first studies to implicate genetics in pain was a study by Morris-Yates et

al. in 1998, which showed that 56.9% of twins were concordant for irritable bowel

syndrome symptoms. In 1999,Yunus et al. presented a genetic linkage analysis of

families with fibromyalgia to the human leukocyte antigen (HLA) locus, which is a group

of genes in the human histocompatiblity complex that encodes for cell surface antigen

presenting proteins. In the early part of this decade, researchers examined candidate

genes in relationship to pain sensitivity and the therapeutic effect of analgesics. In 2003,

Zubieta et al showed that there were three different states (efficient enzyme, non-efficient

enzyme and non-functional enzyme) of the protein involved in catecholamine metabolism

depending on specific polymorphisms found in the catechol-O-methyltransferase gene

(COMT) (Zubieta et al. 2003). In the same year Mogil et al found that a gene originally

involved in skin pigmentation was in fact also involved in the mediation of analgesic









effect of a kappa opioid agonist in mice (Mogil et al. 2003). The human data from this

paper will be discussed in chapter 4, as I have been involved in the human analysis of

susceptibility genes for both acute pain as well as chronic pain as part of a large

collaboration.

Gender Differences and Psychosocial Influences

The differences that have been found between men and women with regard to pain

are now well documented (Maixner and Humphrey 1993; Fillingim et al. 1999). Women

have a significantly lower pain threshold and tolerance than men, and also rate the same

noxious stimulus more highly than men. There are also clinical data indicating that

women suffer more from pain and chronic pain syndromes than men (Dao and LeResche

2000; Heitkemper and Jarrett 2001). There are many possible implications of this

information. First, it is possible that men and women experience and respond to pain in a

different manner. Also, a society stereotype mandates that men are supposed to be the

stronger sex and not admit pain. Thus, there may be different nociceptive pathways in

the different sexes, but psychosocial factors matter as well. Gender role expectations are,

in fact, significant predictors of pain threshold, tolerance and unpleasantness (Rollman et

al. 2004), though gender roles typically do not fully account for sex differences in pain

perception. Animal studies have shown that there are differences in the pain response

and analgesic effects of morphine between male and female mice of certain strains (Kest

et al. 1999). Gene expression and hypophyseal portal artery (HPA) regulation in the

hippocampus have also been found to be different between the sexes in a mouse chronic

stress model (Karandrea et al. 2002). A review (Craft 2003) highlighted the numerous

studies that have been conducted in rodents to indicate that mu opioid receptor agonists









(which often cross-react with kappa opioid receptors) have a more powerful effect on

males compared to females, an effect which is reversed in humans.

Gonadal hormones (estrogens and androgens) also have a pronounced effect on

pain thresholds in male and female rats (Liu and Gintzler 2000; Aloisi 2003). Women

exhibit a significantly lower tolerance time compared to their male counterpart, as well as

rate the predicted pain tolerance lower at the start of the study, suggesting a lower

capacity to withstand pain than males (Rollman et al. 2004). It is hypothesized that due

to the different biological demands on the male and female body, women experience pain

earlier (e.g. at the onset of menses) and experience more pain more often due to the

menstrual cycle. This cycling painful experience is the reason women are more vigilant

about pain and seek healthcare more often than men (Stenberg and Wall 1995; Crombez

et al. 1999; Aldrich et al. 2000). This theory extrapolates that because of this continuing

cycle of pain, the nervous system becomes plastic and that more women undergo

peripheral sensitization, which may alter the activity of the primary afferent neurons

(Taddito et al. 1997, Craig and Andrew 2002, Woolf and Salter 2000). Many chronic

pain conditions not involving the sex organs are more predominant in females, such as

irritable bowel syndrome, biliary colic, oesophagitis, interstitial cystitis, fibromyalgia,

rheumatiod arthritis, and temporomandibular disorder (Unruh 1996). Females rate an

injection of intramuscular glutamate more painful than males (Cairns et al. 2001) and this

may be attributed to the finding of differences in the descending inhibitory control

pathways in the two sexes after experimental muscular pain induction (Ge et al. 2003).

Men may be able to better inhibit the muscle pain compared to females.









An increase in pain sensitivity may also be attributed to psychological problems

such as depression and panic disorders, as these patients have an increase of clinical pain

complaints (Lautenbacher et al. 1999). In one study (Stephan et al. 2002), researchers

using rats demonstrated that postnatal experiences such as maternal deprivation lead to

differences in adult pain sensitivity, with there being an effect depending on the rat strain

studied, as well as a sex difference. Female rats display an increase in pain sensitivity

due to maternal deprivation across the strains, compared to their male counterparts. This

increased sensitivity was shown to be reversible in adulthood with chronic antidepressant

treatment or by additional stimulation directly after maternal deprivation as a neonate.

A positive family history of pain has been associated with increased pain

complaints as well as greater experimental pain ratings in females, but not in males

(Fillingim 2000). This study indicates a physiological difference between the sexes,

which is related genetically to family pain history. The extent to which this association

between pain sensitivity and family history is driven by genetic versus environmental

factors is not known.

Candidate Genes

The Opioid Receptor Family

The opioid receptor family is paramount in analgesia. There are three classes of

opioid receptors: i, 6 and K. Each family has distinct but also interactive functions and

each is a product of a single gene, with some alternative splicing resulting in several

different isoforms (Pan et al. 1998; Pan et al. 2001). The receptors all have conserved

transmembrane domains as well as intracellular loops, with class differences found in the

extracellular loops, and the amino and the carboxy ends of the protein (Chaturvedi et al.

2000). Opioid receptors are found in non-neuronal cells as well as the CNS. The three









receptor types, although they are conserved in structure, have divergent expression

patterns and regulatory mechanisms (Wei and Loh 2002). Hetero- as well as homodimers

of the receptors are formed in the plasma membrane of peripheral neurons.

A gene on chromosome 6, containing four exons, encodes the [i (mu) opioid

receptor. It is involved in the targeting and preferential binding of morphine. It has been

previously reported that allelic variations in the i opioid receptor lead to alterations in the

endogenous system related to addiction susceptibility (Liu and Prather 2001). The two

best characterized polymorphisms are in exon one of the [i opioid receptor gene

(OPRM1), which encodes the extracellular domain of this G protein coupled

transmembrane receptor. These polymorphisms are Al 18G (N40D at the protein level)

and C17T (A6V). All the other known variants have a rare allele frequency of <5%, and

no functional analysis has been attempted. Variations in the 5' regulatory region have

also been found, but they do not appear to affect gene regulation (Mayer and Hollt 2001).

The Al 18G SNP (single nucleotide polymorphism) has been functionally shown to

specifically affect 3 endorphin binding (ligand of the endogenous opioid analgesic

pathway) to the receptor, and eliminates the putative N-glycosylation site that the

asparagine provided in the extracellular domain (Bond et al. 1998; Mayer and Hollt

2001). The 1 endorphin binding affinity is increased three fold for protein encoded by

the G allele. Binding of 3 endorphin to the [i opioid receptor activates the receptor,

which leads to activation of potassium channels (Bond, LaForge et al. 1998).

The genetic variants of the 6 (delta) opioid receptor (gene OPRD1) have been

linked to the heredity of pain sensitivity in mice (Mogil et al. 1997) and humans (Kim et

al. 2004). It has been shown that activity of the 6 receptor is ti receptor mediated and that









the 6 receptor is found in the inactivated state intracellulary. Once the t opioid receptor

is activated, the 6 opioid receptor is recruited to the membrane, and the t and 6 receptors

have similar mechanisms of signaling (Cahill et al. 2001). The 6-opioid receptor can also

heterodimerize with the [t and K-opioid receptors (George et al. 2000; Gomes et al. 2000).

The most frequent of the OPRD1 gene variants is T80G (F27C), which is located in exon

one and has a G allele frequency of 9% (Mayer and Hollt 2001).. The other predominant

known variant is a silent polymorphism found in exon three, T921C. Although this is a

silent mutation and the protein sequence is predicted to remain unaffected, this SNP has

been linked to heroin abuse in the German population (Mayer and Hollt 2001). This

suggests that either the silent variant might affect RNA splicing/stability, or it could be in

linkage disequilibrium with another variant that carries a functional effect.

The K (kappa) opioid receptor, whose gene (OPRK1) is found on the q arm of

chromosome 8, has been linked to sex differences in analgesia (Gear et al. 1996). The

kappa opioid receptor has been shown to heterodimerize with the delta opioid receptor,

having a binding affinity different to that of each homodimer (Wessendorf and Dooyema

2001). The most common K variants known appear to be silent polymorphisms, which

are not predicted to affect the protein level. I am examining three of the most common

SNP sites: G36T in exon one, and A843G and C846T in exon three (Mayer and Hollt

2001). These silent variants have proven negative in a few association studies of

addictive disorders (Mayer and Hollt 2001), but there are no studies of these variants in

pain or analgesic responses.









The Melanocortin Receptor Family

The melanocortin receptor family is very interesting because its members have

diverse and distinct functions. They are G protein coupled receptors (GPCRs) and belong

to the rhodopsin group of receptors (Fredriksson et al. 2003). Melanocortin 1 receptor

(MC1R) has historically been known to be involved in coat color and pigmentation. This

receptor is involved in the activation of eumelanin synthesis by the binding of this

receptor to its endogenous ligand (ocmelanocyte stimulating hormone, -ocMSH) and

adrenocorticotropic hormone (ACTH) (Mountjoy et al. 1992). MC1R is spliced from a

precursor gene called proopiomelanocortin (POMC). Upon activation of the receptor,

activation of adenyl cyclase occurs and there is an elevation of cAMP levels in

melanocytes, leading to increased melanin and pigmentation. Human mutations in the

MC1R gene are associated with red hair and fair skin (type I and II in the Fitzpatrick

Clinic Scale) (Valverde et al. 1995; Box et al. 1997). Rare individuals who are null at

POMC have red hair, adrenal insufficiency and are obese due to lack of oMSH and also

the lack of ability to stimulate the whole melanocortin receptor family (Krude et al.

1998). Loss of function of the MCIR gene results in a yellow coat color in mice

(Robbins et al. 1993; Jackson 1997). In rodents, there are two loci that control pigment

color-extention and agouti. Extention is also called MC1R and its endogenous

antagonists are the agouti protein (ASIP) (Lu et al. 1994) and the agouti-related peptide

(AGRP). A rescue study has been done in which the researchers expressed a MCIR-

containing bacterial artificial chromosome (BAC) transgene in Mclr knock out mice and

observed a darkening of the coat color in a copy number dependent manner (Healy et al.

2001). MC1R is expressed in a number of peripheral tissues and cells including









leukocytes, where it mediates anti-inflamatory actions as an inhibitor of pro-inflamatory

cytokines (Chhajlani 1996; Lipton and Catania 1998). MC1R has been shown to be

expressed in the ventral periaqueductal grey (PAG) as well as in glial cells involved in

the pain pathway (Xia et al. 1995; Wikberg 1999). Futhermore, our group and

collaborators recently showed that MCIR variants affect analgesic efficacy and that this

system is mediated by the kappa opioid receptor and influenced by cycling estrogen

(Mogil et al. 2003). This work will be further discussed in chapter 4.

CALCA1/aCGRP Receptor

CALCA1/aCGRP receptors are synthesized in the thyroid by the parafollicular

cells and can mediate a reduction in serum calcium levels. CALCAl/aCGRP is a

polycystronic gene, which is alternatively spliced depending on the cell and tissue type

into calcitonin (CALCA1), or the receptor for calcitonin (cCGRP). aCGRP is a 6 exon

gene product, which is only neuronally expressed, and is an important regulator of

vascular tone and blood flow. The CALCA1 gene product includes exon 4 while the

CGRP product instead includes exon 5. The first three exons are common in both gene

products but exon 1 contains 5' untranslated sequence. There are two other genes that are

similar: CALCB which produces a second CGRP without alternative splicing, and

CALCP, which is a pseudogene. Elevated cerebrospinal fluid CGRP levels have been

found in patients with depression (Mathe et al. 1994) and fibromyalgia (Vaeroy et al.

1989). Thus CGRP is a reasonable pain candidate gene as it is stimulated by the

activated delta opioid receptor, inhibited by kappa and mu opioid receptor activation, and

colocalizes in vesicles with Substance P (another neurotransmitter involved in the pain









pathway via the NMDA receptor) (Bao et al. 2003). CGRP causes vasodilation as a

result of binding to CALCA1 receptors (Sato et al. 2000).

Chronic Pain Conditions

Irritable Bowel Syndrome

Irritable bowel syndrome (IBS) is a common and often debilitating gastrointestinal

disorder affecting up to 15% of the US population, predominantly adult females (Talley

1999). It is characterized by recurrent abdominal discomfort or pain associated with

altered bowel habits with diarrhea/constipation, and is more common among women than

men. There are specific criteria associated with the diagnosis of IBS and these are

reviewed by Talley (Talley 1998). A hallmark of IBS is enhanced sensitivity to visceral

stimulation, and some patients have reported enhanced pain sensitivity in remote

anatomical regions (Verne et al. 2001). The pathophysiology of IBS remains an enigma.

Heredity has been shown to play an important role in this disorder, through twin studies

(Levy et al. 2001), and thus IBS is considered a multifactoral trait. A review of the

literature indicated that there is a high comorbidity of irritable bowel syndrome with

other functional gastrointestinal disorders and it is suggested that there may be a common

pathophysiology. The review also mentions that IBS patients also suffer from other

comorbid disorders such as depression, anxiety, fibromyalgia (49% of IBS patients),

chronic fatigue syndrome (51%), temporomandibular disorder (TMD) (64%) and chronic

pelvic pain (50%) (Whitehead et al. 2002). There is some evidence of generalized

enhancement of pain sensitivity in IBS (Verne and Cerda 1997; Verne and Price 2002).

Research has also examined the effects of sex hormones on visceral function and pain,

there is a pronounced difference in pain sensitivity across the menstrual phases (Bajaj et

al. 2002). Men display a shorter gastrointestinal (GI) transit time especially in the right









colon (Meier et al. 1995), and postprandial gastric relaxation is longer in females

(Mearadji et al. 2001). It has been shown that bowel movements in females are altered

during the menstrual cycle with prolonged GI transit times in the leuteal phase of the

cycle (when progesterone is increased). Progesterone is a smooth muscle relaxant which

might explain the gender differences in visceral pain (Wald et al. 1981; Waliszewski et

al. 1997). It is interesting that IBS patients report an increase in symptoms during

menses (Heitkemper et al. 1993). There is a rat model of the pathogenesis of this disease,

which is achieved by the rectal injection of mustard oil which persists to cause a state of

chronic visceral hypersensitivity (Al-Chaer et al. 2000). There is a mouse model of post

infectious gut dysfunction, which leads to muscle hypercontractility and this study

implicates a few genes in gut dysfunction. The investigators believe that post infectious

irritable bowel syndrome may be a result of Th2 cytokine induced expression of TGF p31

and an up-regulation of the COX-2 and PGE2 in smooth muscle cells (Akiho et al. 2005).

Fibromyalgia

Fibromyalgia syndrome (FMS) is a rheumatological condition characterized by

chronic widespread muscle pain, which affects women disproportionately (Staud 2002).

FMS is associated with general soft tissue sensitivity in the body, lack of REM sleep,

fatigue, parethesia, numbness, headache, swelling, and some patients may have other pain

syndromes such as IBS. Ninety percent of patients are women and about half of them

suffer with IBS in addition to their FMS symptoms (Wallace 1997). A specific diagnosis

is usually made by excluding other diseases based on symptoms. FMS is characterized

by a generalized heightened pain sensitivity to mechanical and non-mechanical

stimulation, and its pathogenesis remains unclear. These patients display quantitative









abnormalities in pain perception under experimental conditions, in the form of allodynia

(pain with innocuous stimuli) as well as hyperalgesia (increased sensitivity to a painful

stimulus) (Staud and Smitherman 2002). Many FMS patients also meet Diagnostic and

Statistical Manual of Mental Disorders VI (DSM VI) criteria for mood disorders such as

depression. The precursor to serotonin, a molecule called 5-hydroxy-tryptophan (5HTP),

has been the subject of heated debate as to its role in the pathology of this disease but the

data remain inconclusive (Wolfe et al. 1997; Juhl 1998; Alnigenis and Barland 2001).

This leaves the pathology of this debilitating syndrome open to other incriminating

molecules, which we are investigating. In one study, 46% of affected patients reported a

positive familial history of FMS (Offenbaecher et al. 1998), also implicating a genetic

predisposition.

In the subsequent chapters, I describe my work as part of a collaborative group of

human and mouse geneticists, pain researchers and physicians. Our goal has been to test

candidate gene polymorphisms for a role in pain sensitivity, chronic pain, or response to

pain medication. Furthermore, I undertook a laboratory investigation to study whether

delta or kappa opioid receptor polymorphisms might have altered function.














CHAPTER 2
MATERIALS AND METHODS

Candidate Gene Selection

Literature Search

Pubmed (NCBI) was used to search current literature to identify genes involved in

the pain pathway that might play a role in pain sensitivity and analgesia. The literature

was examined and candidate genes were selected.

Single Nucleotide Polymorphism (SNP) Selection

Single nucleotide polymorphisms for candidate genes were identified using the

NCBI websites Entrez SNP or Entrez Nucleotide databases. Only SNPs with a minor

allele frequency of > 5% were used, based on the probable final sample size we expected

to have (200 people per patient population). This was to ensure we would have sufficient

power to detect association.

Genotyping

Primer Design And Synthesis

PCR primers were designed using several different methods. The primer 3

program (Whitehead Institute, MIT http://frodo.wi.mit.edu/cgi-

bin/primer3/primer3_www.cgi) was used in selection of primers flanking some SNPs

using nucleotide sequence obtained from the NCBI website. Primers reported in current

literature were also used for some SNPs. Primers were synthesized by the Qiagen

Operon company (Valencia, California). Primer sequences and PCR conditions are listed

in table 2-1.









Polymerase Chain Reaction (PCR)

Primer annealing temperatures were optimized using a gradient PCR machine (MJ

Research). Conditions varied for each specific primer set (see table 2-1). Either

Hotmaster Taq (Eppendorf) or home-made Taq polymerase (made using Qiagen

protocol) was used in polymerase chain reaction at a concentration of 0.62U per reaction

(initial concentration of stock is 5U per microliter). For the Hotmaster reactions, the

buffer provided was used at a concentration of 1X (2.5iL per reaction for a total reaction

volume of 25 L). For the home-made Taq polymerase, Roche Applied Science

(Indianapolis, Indiana) PCR buffer was used. dNTPs (Invitrogen) were used at a

concentration of 10mM and the primer concentration was 10ng per reaction. Some PCR

reactions required the addition of DMSO to abate the non- specific binding of the primers

to the genomic DNA. The genomic DNA for each subject was added at a quantity of 50-

100ng per reaction. The amplification was performed on either a MJ Research PCR

machine (PTC 200) or a Hybaid (Thermo) PCR machine as follows: 95C for an initial 5

minutes, then cycling (35X) at 950C for 30 seconds, the specific annealing temperature

for 30 seconds and then an extension at 720C for 45 seconds. A final extension was

performed for 10 minutes before the PCR was completed.

SNP Analysis

PCR products were visualized by electrophoresis and ethidium bromide staining on

a 1.2% agarose gel (Bio-Rad). These products were either sequenced or digested to allow

SNP detection, depending on the SNP as outlined in table 2-1. For restriction enzyme

digests, 5 L of PCR product was used with 21tL of the appropriate restriction enzyme

buffer, along with 0.5[ L of enzyme in a final volume of 20[L (the reaction was spiked









with 0.5 IL of enzyme after the first hour of digestion at the manufacturer's

recommended temperature, to maximize the digestion efficiency). Digests were

separated on a 1.6mm 8% native polyacrylamide gel (10mL 40% acrylamide, 5mL Tris

buffer, 34.7mL dH20, 40 [L temed and 300L ammonium persulfate) for two hours at

200V and were visualized by ethidium bromide staining. Cycle sequencing of PCR

products utilized an ABI Prism R310 sequencer and Big Dye chemistry 2.0 at a dilution

of 1/4, using the PCR primers as sequencing primers. PCR products were purified using

Millipore microcon filters (Fisher Scientific) and sequencing reactions were purified

using Edge Biosystem sephadex columns (Gaitherburg, Maryland). Sequence data

analysis was done using the Sequencher program (Gene Codes Corporation, Ann Arbor,

Michigan). Some of the genotyping was done using the pyrosequencing core at the

University of Florida, once the sample size became unmanageable for manual

sequencing. The full list of genotyping is depicted in the appendix.

Cloning

Opioid Clones

The delta opioid cDNA clone was a generous gift from the lab of Dr. Brigitte

Kieffer at the Louis Pasteur Institute in Paris, France. The kappa opioid receptor cDNA

was a gift from Dr. Liu-Chen at Temple University in Philadelphia, USA.

Upon receiving the clones, primers with a Kozak sequence at the 5' end and

restriction sites specific for the multiple cloning site of the pcDNA3.lv5/his (Invitrogen)

were synthesized (figure 2-1) (Qiagen Operon) and PCR was performed using the high

fidelity Taq polymerase Discoverase (Invitrogen). The PCR products were cloned into

the TOPO4 vector (Invitrogen) and were transformed into TOP10 E. coli cells using the

manufacturer's protocol. Cells were plated on LB agar plates containing 100[tg/mL









ampicillin. Single colonies were selected after 16 hours at 370C, and grown in 4mL of LB

broth with ampicillin at a final concentration of 100lg/ml overnight. Plasmid mini preps

were performed the next day using the Qiagen mini prep kit, following the manual

provided in the kit. The clones were screened for an insert using single and double

restriction digests, and positive clones were then sequenced with Big Dye 2.0 chemistry

as described above except for that Big Dye was used at a /2 dilution. The sequences were

generated by the Center for Mammalian Genetics (CMG) core. Once the correct

sequence was identified, glycerol stocks of this clone were made using ImL of the

overnight culture mixed with ImL of a 60% glycerol solution, and stored at -800C.

Site Directed Mutagenesis

Four inconsistencies were found in our OPRD1 cDNA sequence compared to the

NCBI entry (NM_000911.2). We set out to correct our sequence and also create the

more common T allele (the original construct from France had a G at this SNP location)

by using the Stratagene QuikChange Multi Site-Directed Mutagenesis Kit. Four 5'

phoshorylated primers were synthesized (Qiagen Operon) to incorporate the desired

change into the plasmid sequence (see Table 2-2). For OPRK], changes were introduced

with site-directed mutagenesis. After the PCR and parental strand digestion with DpnI

was performed, the single stranded plasmid was transformed into Stratagene XL- gold

ultracompetent E. coli cells. Single colonies were selected and grown in liquid media

under ampicillin selection as described above. Mini preparations were performed and the

colonies were screened for the correct sequence by using the cloning primers. Once the

desired clone was found, inserts were then digested using the specified restriction

enzymes (method described above). The mammalian expression vector (pcDNA. 1









v5/his) was digested with the same enzymes. In the case of the delta opioid receptor, the

restriction sites were HindIII on the 5' site and BstB (isoschizomer of Sful) at the 3'

end of the insert. For OPRK1, HindIII was designed into the 5' primer and Agel on the

3' primer. The digested plasmids were run on a 1.2% low melt agarose gel and excised

and extracted using the Qiagen gel extraction kit. The inserts were subsequently ligated

into the expression vector using DNA T4 ligase (Il1 emzyme, 21l ligase buffer, 3[tl

insert, Ill vector and 131l d2H20) and this was incubated at 40C overnight. After

incubation, 10\Ol of the ligation reaction was transformed into Stratagene XL1-Blue E.

coli cells and incubated on LB agar with 100lg/ml ampicillin at 370C overnight. Single

colonies were selected and grown in liquid LB ampicillin media for 16 hours at 370C.

mini preps were done as described above and the plasmids were screened as above. Once

positive clones were identified they were sequenced by using the forward flanking primer

on the mammalian expression vector and the reverse cloning primer. Once sequence was

confirmed, a maxi plasmid prep was performed using the Qiagen Maxi prep kit from a

500ml culture of a desired colony. The maxiprep plasmid DNA was quantified with a

spectrophotometer (Bio-Rad).

Tissue Culture

Stable Transfections

HEK 293 cells (human embryonic kidney immortal cell line) were transfected with

recombinant pcDNA3.1 vectors (OPRD1, OPRK1) as follows. In a lml transfection

reaction, I added 20g of plasmid DNA, 50pl 2.5M calcium chloride (CaC1), 4501tl N-N-

bis(2-hydroxylethly)-2-aminoethane-sulfonic acid(BES) buffered saline (BBS), and

500[tl autoclaved deionized water. This reaction was incubated for 10 minutes at room









temperature and then was added to a 10cm tissue culture plate with HEK 293 cells at

-60% confluency. The plates were incubated for 24 hours at 330C with 3% CO2. The

293 media (Dilbecco Modified Eagle Medium-DMEM) with 10% neonatal calf serum

(NCS), 1% penicillin, 1% streptomycin (Gibco-BRL) was changed after this time and the

plates were then incubated for a further 24 hours at normal incubation parameters (37C

and 5% CO2). After the next 24 hours the cells were split if they were at 90% confluency

and then put under selection using 0.3 Ig Geneticin (Sigma- RBI), in 500ml DMEM (10%

Fetal Bovine Serum (FBS)) which was filter sterilized. The transformed cells were kept

under selection conditions for three to five weeks and were then frozen in DMEM with

10% FBS and 10% DMSO. The cells were kept in liquid nitrogen.

Characterization and Verification of Stably Transfected Cell Lines

Gene expression levels

Transformed HEK 293 cells were defrosted from liquid nitrogen and grown in 293

media until confluent. The media was changed after 24 hours post defrost to remove the

DMSO from the cells. These cells were no longer under selection conditions. Once

confluent, the cells were counted and then plated out at concentrations that included 200

cells per 10cm dish as well as 1000 cells per dish, 5000 cells per dish and 10,000 cells per

dish. These cells were monitored to detect single cell colonies. Cloning rings (Fisher)

and silicone grease was used to isolate these single cell colonies by trypsinization (Gibco

0.25%) and moved into a 24-well plate to grow until confluent. Once these single cell

colonies were confluent, the cells were split into two 6 well plates and allowed to grow to

confluency once again. One of the plates was washed with ImL phosphate buffered

saline pH 7.4 (PBS, Gibco) followed by lysis with 750[l Trizol (Invitrogen) for RNA









extraction. The RNA was resuspended in 50l of DEPC treated water (Ambion), and 1 Cl

of the RNA was run on a 1.2% TAE agarose gel with ethidium bromide to observe

general quality and quantity under UV illumination. Another microliter was used for

spectrophotometric quantification.

For northern blot, the RNA was subjected to electrophoresis on a 1% agarose gel

made with IX MOPS buffer and 6% formaldehyde (Fisher Scientific). The appropriate

amount of RNA was added to an individually wrapped RNAse free eppendorf tube along

with 16 .il loading buffer (300 l formamide, 105.l filter sterilized 37% formaldehyde

solution, 601l tracking dye, 601l 10X filter sterilized MOPS buffer and 3 pl ethidium

bromide). The samples were incubated at 650C for 10 minutes and then electroporated

on the formaldehyde gel at 40C in IxMOPS at 105V for one hour and fifteen minutes.

An RNA ladder was run with the samples (Invitrogen). The gel was then photographed

using the Eagle Eye photo documentation system. The 28S, 18S and 5S ribosomal

subunits were marked on the gel using India ink, and the molecular weight markers from

the ladder were measured using a ruler relative to the wells of the gel. The gel was then

blotted overnight using two pieces of Whatmann 3MM paper as a wick to allow the 20x

SSC to be absorbed through the gel. The Gel was placed upside down, with the Hybond

N+ (Amersham Biosciences/GE Healthcare, Piscataway, New Jersey) nylon membrane

placed on top of the gel. Two pieces of Whatmann 3MM paper and a stack of paper

towels were placed on top of the membrane. A plate was applied to the top and then it

was all weighted down for an overnight transfer. The next day, the blot was dismantled,

and the wells were marked on the membrane using a pencil and writing directly through

the gel. The 28S, 18S and 5S subunits were also marked on the gel at this time and the









lanes were numbered. The membrane was then placed in the vacuum dryer for 2 hours to

allow cross-linking of the RNA to the membrane.

The full-length cDNA PCR products were used as a probe for the Northern blot. A

3 actin PCR product was used as a probe in a separate hybridization to control for

loading. Approximately 20ng of the products were used for radiolabeling. Five

microliters of random primers were added to the product in 11.5Ctl, boiled for 5 minutes

and then put on ice. To the cooled tube, 51l of dCTP buffer was added as well as 2.5il

[P32]dCTP (25tCi) (Amersham Biosciences/GE healthcare, Piscataway, New Jersey) and

0.8.l Klenow polymerase fragment (Stratagene Primelt II labeling kit). This was gently

mixed and incubated at 370C for at least 15 minutes. The labeling reaction was purified

using a Quiagen kit. The manufacturer's protocol was followed and then the probe was

boiled for 5 minutes. The blot was briefly soaked in 2xSSC and then allowed to pre-

hybridize in 20ml Church and Gilbert hybridization solution (500mM sodium phosphate

pH7.2, 7% SDS) for 30 minutes in a glass hybridization tube in a 65C rotator. After the

pre-hybridization step, the solution was removed and another 5ml of the hybridization

solution was added to the blot as well as the 200l of the probe. This was returned to the

65C rotator to hybridize overnight. The next day, the hybridization solution was

removed and the blot was washed twice with 650C IxSSC, 0.1%SDS for 15 minutes

each. The blot was then washed with 0. xSSC, 0.1%SDS at 650C for 20 minutes. The

blot was then allowed to dry slightly, wrapped in saran wrap, and placed between two

screens in an x-ray cassette. An x-ray film (Kodak XAR)was exposed to the blot at -

800C for 2-7 days, and the film then developed in an automated film developer. The blot









was then stripped in 0.lxSSC, 0.1%SDS by microwaving until the solution boiled, and

re-probed using the P-actin probe in the same manner as described above.

Protein expression levels

A western blot was performed to see the relative expression from the plasmids at

the protein level. Stably transfected cells were grown on a plate to confluency. The cells

were trypsinized, 5ml of PBS was added and the cells were transferred to a 15ml conical

tube. They were then spun down at 500g for 5 minutes and the supernatant was removed

by aspiration. 5ml of PBS was added and the cells were resuspended and then re-

centrifuged for a further 5 minutes. After the PBS was decanted, lml of RIPA protein

lysis solution (250mM NaC1, 50mM Tris-HCl pH7.4, 1% Nonident NP-40, 0.25% Na

deoxycholate in H20 with lx complete protease inhibitor cocktail (Boehringer-Mann)

added right before use) was added to the cells. The lysate was transferred to a 1.5mL

microfuge tube kept on ice. The cells were further mechanically disrupted by sonication

2x for 5 second bursts from the probe sonicator set at 30. The lysate was centrifuged at

10,000g for 5 minutes at 40C, and the supernatant was then transferred to a new tube.

Samples were then mixed with sodium dodecyl sulfate- containing electrophoresis

loading buffer containing 2mol/L urea and 5% 2-ME to denature the proteins, and then

the samples were boiled for 10 minutes. 50[tg of each cell lysate were loaded onto a

precast 12% mini SDS-acrylamide gel and run at 40C overnight at 45mA run in a MOPS-

SDS running buffer. The next day, the samples were electroblotted to nitrocellulose

sheets in transfer buffer containing 0.1%SDS. The blot was rinsed in 1X Tris buffered

saline (TBS) 3x for 5 minutes each and then the blot was blocked in 1% BSA/5% milk

for one hour. After blocking, the blot was washed once again in TBS 3x for 5 minutes









and then I added a 1:2000 dilution of Alkaline Phosphatase conjugated anti-his antibody

(Invitrogen, Calsbad, California) along with 0.1% Tween-20 and 1% non-fat dry milk.

The primary antibody was left on the blot overnight. The next day, the primary solution

was removed and the blot was washed. Next, a chemiluminescent developing solution

was added, which consisted of NBT, BCIP, in NTMT (5M NaC1, Tris-HCl pH 9.2, 1M

MgCl2, 10% Triton-X). After the blot had developed sufficiently, the solution was

removed and the blot was analyzed by exposure to x-ray film.

Functional Analysis

Immunocytochemistry

Stably transfected HEK 293 cells were grown on an 8 well chamber slide (Fisher)

until about 50% confluent. The media was then removed and the cells were washed with

200p l ofPBS per well. This was removed 5 minutes later, and 200p l of 100% methanol

was added for 5 minutes to allow the fixing of the cells. After this incubation the cells

were washed twice for 5 minutes each, with PBS. The cells were then blocked by the

addition of 200pl of PBS with 10% FBS and were incubated for 20 minutes at room

temperature. After the blocking solution was removed, a PBS/10% FBS solution with

either a 1:250, 1:500 or a 1:1000 dilution of the FITC conjugated anti-his antibody was

added. Analysis of the slides was done using fluorescent microscopy.

cAMP Activation Assays

The Stable cell lines were transfected as described above with a pCRE plasmid

containing the P-galactosidase gene. This transfection was transient, so the cells were

left to grow for 48 hours and then stimulated by the addition of a sequential dilution of

agonists (P-endorphin, DPDPE for OPRD 1 and Dynorphin A, U69593 and Tan 67 for

OPRK1-Sigma Aldrich, St. Louis, Missouri). These serial dilutions of agonists were









made starting at 10-4 or 10-6 depending on the stock concentration. The dilutions were

made in media containing 1X 3 isobutyl-1-methylxanthine (IBMX), which inhibits

intracellular phosphodiesterase and allows for the accumulation of cAMP. Included also

in half of the dilutions was forskolin, which activates the receptor in the absence of ligand

as the opioid receptors decrease the cAMP levels in the cell. The dilutions were added to

the wells in duplicate (150[tl/well), in a dose dependent manner and were incubated at

37C with 5% CO2 for 6 hours and then lysed using 50[tl/well cell lysis buffer (250mM

Tris-HCl pH=8.0, 0.1% Triton X-100 in H20). A protein assay was performed on 10-

20% of the lysate by Bradford analysis using a commercial protein dye (Bio-Rad), while

the rest of the lysate was mixed with an ortho-nitro-phenyl-P-D-galactopyranoside

(ONPG) solution (for 100mL: 84.05mL dH20, 15mL 0.4M Na2HPO4, 100Wl IM MgC12,

5001tl 2M KC1, 200mg ONPG). After addition of this solution, the plates were incubated

at 370C to aid in developing, and samples were measured at a wavelength of 405nM at

various intervals.












Table 2-1 Primer sequences and PCR conditions as well as genotyping detection strategy.
Gene (SNP) PCR Primers Strategy Annealing
temp.
MC1R (V60L, 5'-cct ggc age acc atg aac ta Sequence (494 bp) 62C
K65N, D84E, 3'- aga ggc tgg aca gca tgg
V92M)
MCIR (R151C, 5'-tgc agc agc tgg aca aat g Sequence (292 bp) 62C
R160W, R163Q) 3'- atg tgg acg tac agc acg g
MCIR (D294H) 5'-tgc atc tca cac tca tcg tcc Digest 228 bp PCR 62C
3'-ata tca cca cct ccc tct gcc product with acTaqI
restriction enzyme
OPRM1 (C17T, 5'-gaa aag tct cgg tgc tcc tg Sequence (302 bp) 61C
Al 18G) 3'-gca cac gat gga gta gag gg

OPRD1 (T80G) 3'-cgc cgg ccc gca gcg gac tca Sequence (272 bp) 75C
5'-gcg gcg gag ccg gcc ggc age c

OPRK1 (G36T) 3'-gag tag acc gcc gtg atg at Digest 203 bp product 60C
5'-atc ccc gat tca gat ctt cc with PspOM1
OPRK1 (A843G, 3'-ggc gta gag aat ggg att ca Sequence (358 bp) 62C
C846T) 5'-tga cta ctc ctg gtg gga cc

CALCA1 (G- 3'-ctc gtg gga aac aag aga cg Digest 547 bp with 65C
855A, T-624C, C- 5'-agt aga gga ctg aag tgc ggg BsmAI and Acil
590G)
CALCA1 3'-cct tcc tgt gta tga tgc tgc g Digest 332 bp with 65C
(Leu66Pro) 5'-gcc ctg tcc cct agg act c Alul
















pCMV Amp R
HindlI[ (903) B
KpnI (913) d


Amp R









pUC ori







SV40 poly A


pcDNA 3.1 V5-His
5502 bp


BamHI (921)
BstXI(940)
EcoRI (944)
EcoRV(956)
BstXI (966)
NotI (971)
Xhol (977)
Xbal (983)
ApaI (993)
Sful (996)

V5 Epitope


6XHis
Pmel (1076)


pUC ori






SV40 poly A


Nec

Am

C




pUC ori


Neo R


pcDNA 3.1 V5-His OPRD
6537 bp


SR
pR


pcDNA 3.1 His OPRK
6368 bp


SV40 poly A


Neo R


Figure 2-1 Vector maps made using the Vector NTI software. A) illustrates the empty vector highlighting the features of the
vector including the multiple cloning site. B) represents the OPRD cDNA inserted into the HindIII and Sful sites.
There were two vectors made for this gene, one representing each allele. C) depicts the OPRK1 gene in the HindIII
and Agel sites, which removed the V5 epitope tag from these constructs as there were also two different constructs
made in order to represent the two alleles of the OPRK G36T polymorphism


HndII (903)



OPRD



Sful(2031)
V5 Epitope
6 X His






HindIll (903)



OPRK



A*gel(1912)
6 X His


pCMV












Name of Primer Primer Sequence (5'-3')
hDOR sense G80T [phos]ccctagcgccttccccagcgctgg
hDOR sense T462C [phos]ctgccaccctgtcaaggccctggact
hDOR sense A892G [phos]cgctggtggtggctgcgctgcacc
hDOR sense G1108C/C1109G [phos]ccggcggtggccgtgccgccttcg
hKOR G36T-T ttccgcggggagcctggccctacctgcgccccgagc
hKOR G36T-T rev gctcggggcgcaggtagggccaggctccccgcggaa


Figure 2-2 List of primers used for the site directed mutagenesis. The hDOR primers were 5' phosphorylated as a multi change
kit was used and all these primers were used in one reaction. For the T allele, the first primer on the list was left out
as the original cDNA had a T allele in base pair position 80. For the hKOR vector, there were no other sequencing
errors so a single change kit was used.















CHAPTER 3
INTRODUCTION TO ASSOCIATION STUDIES

Candidate Gene Approach

Association studies have become the most popular method used today in the search

for genes involved in complex genetic disease. The most common cause of Mendelian

diseases is a single mutation resulting in a non-synonomous change in a codon, leading to

an amino acid substitution or stop codon. Complex traits are more involved as both

genetics and environment play a role in the pathogenic mechanism.

Some consider association studies to be a "fishing expedition," without justification

or a testable hypothesis (Eisenach 2004). Clinical pain genetics studies in humans are

now underway, with justification based on recent findings of differences in thermal and

chemical stimulation to induce acute and chronic pain as well as nerve injury models in

various inbred mouse strains (Mogil et al. 1999; Seltzer et al. 2001; Lariviere et al. 2002).

These results suggest common genetic entities involved in pain processing are conserved

throughout the mammalian species. The understanding of genetic factors involved in

pain has been successfully approached from two different angles: 1) genetic screening of

individuals with and without pain in order to identify novel proteins involved in the

development of pain or pain processing, and 2) the identification of high risk populations

who may develop chronic pain (Eisenach 2004).

Many association studies may lack power if the sample size is too small to

elucidate a significant result, depending on the allele frequencies of the polymorphisms









examined. The greater the heterozygosity, the smaller the sample size needs to be in

order to observe a true association. One test of association is to compare allele

frequencies between cases and controls to allow the ascertainment of any change in the

relative risk based on genotype (Belfer et al. 2004). In addition to this important

predictive benefit, a goal of association studies is to ultimately lead to identification of

the actual genetic changes that effect susceptibility, therefore providing improved

prediction and targets for therapy. Two recent successes in this area involve identifying

culprit genetic changes in Type 1 Diabetes (Onengut-Gumuscu et al. 2004) and macular

degeneration (Esfandiary et al. 2005). Because association studies lack a long-distance

power like linkage analysis, it is important to test multiple SNPs in a gene (when

possible) since an effect may not be revealed unless a genotyped SNP is very close to (or

is) the actual pathogenic change.

As technology is still relatively expensive in performing association studies, we

had to restrict the number of candidate genes to be studied, and these were chosen with

the following criteria in mind: evidence of the gene being involved in pain processing,

allele frequencies, and the likelihood that the SNP may have a functional effect (Belfer et

al. 2004). There are several different methods to predict the possible functional impact of

a polymorphism based on whether it is located in the promoter region, the coding region,

intronic regions or untranslated regions of the gene. If the polymorphism is located in the

coding region, one can predict if the change is synonymous (silent) or non-synonymous,

and how a non-synonymous change would affect the local environment of the protein.

Protein prediction programs can ascertain if the change in the amino acid at the

polymorphic position will have an effect on the protein structure or function, but the









caveat is that there has to be a structurally similar protein already in the database, which

can act as a backbone for the assembly of the protein structure. In addition, even if an

amino acid change does not affect structure significantly, it could be a key residue for

post-translational modifications such as phosphorylation or glycosylation.

Polymorphisms located within promoters may affect the structure of the promoter region,

which may have an effect on how accessible this region is to transcription factors. They

may directly affect binding affinity of these transcription factors or RNA polymerase to

the promoter. Intronic polymorphisms may also confer regulatory alterations to the

RNA, as splicing motifs may be altered as a result (Mendell and Dietz 2001). SNPs in

the untranslated region of the gene may affect RNA stability. Because finding genes

involved in pain is still in its relative infancy, association studies are paramount to the

progress in the pain field, to be followed by functional analysis.

In the association studies done to date, Quantitative Trait Locus (QTL) mapping

has suggested to the researchers that most SNPs involved in complex trait disease will be

in the regulatory regions of the gene (King and Wilson 1975; Mackay 2001) even though

most reported SNPs are in gene introns (Glazier et al. 2002). The Catechol-O-

Methyltransferase (COMT) gene, which has some SNPs in the promoter region of the

gene, has been comprehensively researched within the past few years and it has shed light

on pain sensitivity as it relates to genetics (Zubieta et al. 2003). Recently, this gene's

effect has been examined using different potential haplotypes that are based on five

common polymorphisms within the gene. Researchers identified three different

haplotypes that encompass 96% of the human population, and these haplotypes were able

to predict pain sensitivity as well as predict individuals at risk for developing a chronic









pain condition called myogenous temporomandibular disorder (Diatchenko et al. 2005).

Haplotypes can be more powerful than single SNPs for some analyses.

Silent coding-region SNPs have also been implicated in the pathogenesis of a

disease state, which may reflect a linkage to a nearby functional SNP, or a haplotype

effect, or an effect on RNA. For example, significant association was reported between a

silent mutation in the FAS coding region and papillary thyroid carcinoma (Basolo et al.

2004). Our laboratory examined the most plausible candidates involved in human pain

sensitivity and analgesic effect as determined from mouse data, and inferences from

literature. We assessed three different populations of participants: a healthy subset of

individuals, and two chronic pain groups who have either been diagnosed with

fibromyalgia (FMS) or irritable bowel syndrome (IBS) but not both.

As discussed in greater detail in chapters 4 and 5, we measured a number of

phenotypic variables in our subjects. This included obvious items such as gender, age,

ethnic background, and diagnosis. However we also attempted to gather data particularly

helpful relative to certain candidate genes (skin tone/hair color for MCIR), other clinical

parameters and experimental pain test results. Thus we had the possibility of finding

significant associations of certain SNPs with only some variables, which could help shed

some light on actual biochemical mechanisms.

Statistical Analysis

Two different types of analyses are commonly used in the interpretation of an

association study such as ours. These two statistical methodologies are quantitative trait

locus analysis (QTL) and analysis of variance (ANOVA). Although it is a characteristic

of statistics to make certain assumptions with different algorithms, these have been









considered and taken into account in our analyses. ANOVA and QTL are being used to

screen for relationships between the SNPs and the phenotypic data.

QTL

In order to perform QTL linkage of a marker to a disease state, one must have a

large experimental population. A QTL is the inferred location of a gene that affects a

trait measured on a linear scale. These traits may be complex traits, being affected by

more than one gene. This type of mapping has become commonplace due to the

commercialization of molecular markers, which are highly polymorphic and easily

genotyped, as well as the sequencing of the human and mouse genomes. QTL analysis is

actually just a specific model of regression and likelihood analysis (Henshall and

Goddard 1999). This allows one to compare marker genotype classes for different

phenotypes instead of having to look at the phenotype first. The regression model of

statistics makes the assumption that there is a linear relationship between the two

variables of interest.

ANOVA

The analysis of variance is designed to be used when one is comparing two or more

different groups and there are multiple variables being examined. This statistical method

is used to determine if the observed differences can be attributed to something other than

just chance variation in the population. When necessary, potential confounding variables

(e.g. age ethnicity) can be controlled for using analysis of co-variance (ANCOVA).

Usually from these statistics, a main effect is analyzed as well specific interactions in the

population under analysis. ANOVA is more intricate t-test and therefore has similar

assumptions in its usage, which are that the standard deviations in the different

populations are equal. This statistic also assumes that samples are randomly selected









from the population (http://www.ccnmtl.columbia.edu/projects/qmss/anovaabout.html).

If we accept that each statistic has its own short-coming, we can proceed with analysis

and lay a foundation for the unraveling of the complexity of the role of genetics in pain.

ANOVA can help determine which variables (such as genotype) account for what

percentage of the variation in each phenotype measured.

Negative Association Studies

We examined a total of six different genes encompassing fifteen different SNPs.

These 15 SNPs were genotyped in 347 healthy controls, 74 IBS patients and 97 FMS

patients. The positive associations found are described in the following two chapters but

here we will impart some of the negative results we have found, which can be almost as

important. The raw data of our three different groups have been compared to each other.

The OPRM1 SNPs do not have significantly different allele or genotype frequencies

between the IBS patients, the FMS patients and the healthy subjects. The p values for

C17T and Al 18G are 0.55 and 0.155 respectively, indicating that there is no significant

difference between these groups of participants. For OPRD1, the p value with respect to

the T80G polymorphism between the different groups is 0.64, again indicating no

significant difference between the three populations. 0.38 and 0.98 are the p values for

the OPRK1 polymorphisms G36T and A843G, however, the C846T polymorphism

appears to be significantly different between the three populations, but upon examining

the raw data, this significance seems to likely due to rare allele effects, which may violate

assumptions of our statistical test. The different genotypes are divided up into three

different groups; the homozygotes for the major allele (CC), the heterozygotes (CT), and

the homozygotes for the minor allele (TT). In the healthy population, as well as the FMS

patients, there are no individuals who are homozygous for the minor allele (TT), whereas,









3.3% of the IBS patients have this genotype. This actual number of patients is 2. This is

the only field where there is more than a 1% change in the allele frequency between

genotypes and between groups, so this significant p value, in fact is not likely clinically

significant and may be attributed still to chance.

The CALCA gene also showed in no convincingly positive results, as we found a p

value of 0.42 for P4 and again we had a false positive for P2 (which includes two linked

SNPs located 3 base pairs apart from each other) at 0.016. In this SNP analysis, we

found that 2 people had the TTCC genotype in the normal population (constituting 0.58%

of the group), and 3 individuals with IBS had this genotype (making up 4.1% of this

group). However, given the implication of calcium metabolism in gut function, we hope

additional subjects may strengthen this possible association. There were a total of 514

individuals genotyped in this analysis. MC1R was not analyzed in this case-control

manner as we have shown that the minor alleles in this gene are associated with fair

skinned people and this was not reported in the medical files of the chronic pain patients.

Our studies are ongoing, and due to the low number of chronic pain patients we have at

the moment, it may explain the lack of statistical significance we have found in our

populations. As our patient numbers grow, our results may change. In addition, further

phenotypic data are being gathered, such that we can perform association analyses within

each group to see if any clinical parameters relate to genotype. Such data could be very

helpful to understanding variability in phenotype (e.g. why some IBS patients have

diarrhea and others constipation). A novel QTL algorithm is being developed for us by

Dr. Rongling Wu (Dept. of Statistics) to help analyze our data using this method, which






40


will also screen for haplotype effects. Thus, the future may reveal additional discoveries

from our work, based on new statistical analysis and additional clinical data.














CHAPTER 4
THE MELANOCORTIN-1 RECEPTOR GENE MEDIATES SEX-SPECIFIC
MECHANISMS OF ANALGESIA IN HUMANS

MC1R

We decided to investigate the melanocortin-1 receptor gene because it has been

implicated in pain sensitivity by QTL mapping in mice, which localized to the region

where the MC1R gene is located (distal mouse chromosome 8). This was found to be

linked to stress induced analgesia in female mice but not male mice (Mogil et al. 1997).

Although this gene has classically only been related to the formation of pigment (Sturm

et al. 1998), this QTL explained 17%-26% of the overall pain variance in stress-induced

analgesia-treated female mice. By embarking on a murine study, it was found that the

gene in this QTL responsible was, in fact, the Mclr gene. It was found that the mouse

strain with a recessive yellow mutation (Mclre e) (Cone et al. 1996; Tatro 1996), carries a

frameshift in the region encoding the second extracellular loop of the protein. This

frameshift leads to a completely non-functional receptor. When both sexes of these

mutant and heterozygous mice were tested for pain sensitivity by a 490C hot water tail

withdraw assay, both before and after the administration of U50,488, (a kappa opioid

receptor selective agonist) latencies were found to be significantly longer in males and

were blocked in males by the NMDA antagonist MK-801 (Mogil et al. 1993). This MK-

801 blocking action was obliterated in female mice with the Mclre e genotype. This

difference is related to cycling estrogen, as it was reversed by performing an ovariectomy

and reinstated by subsequent hormone replacement therapy. These data suggest that









Mclr functions in mediation of U50,488 analgesia. This was the basis for studying

effects of MC1R variants in human pain. This latter mouse research was done by our

collaborator Dr. Jeffrey S. Mogil, and published along with our subsequent human data,

led by Dr. Roger Fillingim and described below (Mogil, Wilson et al. 2003).

Results

Pentazocine Studies

Redhead humans are analagous to the Mclr e mice since most redheads are

compound heterozygotes or homozygotes for MC1R rare alleles, which in this context

will be called mutant alleles. Three majorMC1R variants have been identified in

association with red-headedness, which include the amino acid substitutions R151C,

R160W and D294H (Rees et al. 1999). Our lab examined additional polymorphisms in

the gene, which included V60L, V92M, and R163W. These variants have been shown to

cause a loss of the function of the protein (Schieoth et al. 1999; Scott et al. 2002). The

MC1R gene coding region was sequenced for these three mutations and other variants as

described in chapter 2. We tested 18 females and 24 males (all healthy) who had

different natural skin types as well as hair color (see figure 4-1). The people with type 1

or 2 skin (those who always burn when in the sun and who are usually red headed) were

found to have two MC1R variant alleles (5 females and 9 males), while participants with

a darker skin type (those less likely to burn upon exposure to sunlight) (13 females, 15

males) had one or no variant alleles. These participants were tested for thermal and

ischemic pain sensitivity and tolerance, both at baseline and after the intravenous bolus

administration of either 0.5mg/kg pentazocine or saline in a double blind randomized

fashion. The thermal pain testing consisted of the administration of short, repetitive

suprathreshold thermal stimuli to the right volar forearm, to assess temporal summation









of pain (Price et al. 1977). These pulses of heat were at 520C and each pulse lasted for

<1 second with a 2.5s interval between pulses, when the thermode returned to the

baseline temperature of 400C. The participants were asked to rate the pain on a scale of

0-100 and the assay was terminated when they rated the pain at 100 or asked that the

assay be stopped. Only the first five pulses were used in the analysis, since 28% of the

participants terminated the assay before all 10 intended pulses were administered. The

ischemic pain assay was conducted by the submaximal effort tourniquet procedure

(Moore et al. 1979). The left arm was exsanguinated by elevating the arm above the

heart for 30s. A standard blood pressure cuff was then inflated to 240mm of mercury.

Participants were then asked to perform 20 handgrip exercises, which were performed at

50% of their maximum grip strength. A pain threshold measurement was recorded (when

the subject first reported pain) as well as a pain tolerance measure (when the participant

asked for the assay to be terminated). The maximum assay length was 15 minutes and

subjects were asked also to rate the pain intensity and unpleasantness every minute. This

clinical pain testing was conducted by our clinical psychology collaborators under the

guidance of Dr. Roger B. Fillingim at the UF/Shands Clinical Research Center. At these

sessions, a vial of blood was collected for our genetic research.

As expected, ischemic pain thresholds and tolerances were found to be increased

after pentazocine administration, along with decreases in ratings of pain intensity and

unpleasantness at the same time. There was also a decrease in thermal pain intensity

ratings after the drug bolus, which was not seen after the control saline dispensation (all p

values <0.05 in relation to saline administration). These results suggest a strong

analgesic effect of this drug. For ischemic pain, ANOVA showed there was a significant









sex x genotype effect (P < 0.05) and this interaction approached significance in thermal

pain ratings (P = 0.056). In all the measures, the significant effects of genotype were

found in females but not males. In fact, males reported only modest analgesia at this

dose, while females with two of the MC1R mutant alleles (type I or II skin type and who

tended to be redheads) displayed robust analgesia against ischemic pain, and was the only

group to show any noteworthy analgesia against thermal pain (figure 4-2). It is clear

from our analyses that MC1R genotype was more reliable when considering skin type

than hair color. We found that lighter skinned people were much more likely have two or

more rarer alleles compared to the darker skinned subjects and this did not hold quite as

true for hair color. These results were mirrored in the mouse studies where female mice

with the D6/D6 genotype (which during the linkage studies had two copies of the non-

functional Mclr gene), had a higher analgesia rating as tested by tail withdrawal latency

from a 490C water bath at different time points post U50,488 injection. The mice also

demonstrated that this analgesic effect was mediated by the kappa opioid receptor as the

non-functional strain of Mclr mice was used for subsequent experiments on a B6

background. These Mcire e mice were given U50,488, then they were given either a

saline injection or MK-801, which is an NMDA receptor antagonist. The analgesic effect

was lost in male mice after antagonist injection irrespective of the genotype of the mouse,

but the wildtype females had no effect after MK-801 injection, which was lost in the

Mcre e mice. This experiment illustrated that the analgesic effect of the Mclr gene is

mediated by kappa opioid receptor activation. These data were published in 2003 (Mogil

et al. 2003).









M6G Data

Pentazocine is not used as commonly as it once was in the clinic. Thus, along with

another group of collaborators who did the mouse work, we decided to look at the effect

of M6G, a metabolite of morphine which acts mainly on the [i opioid receptor, and the

MCIR gene. This agonist was administered subcutaneously at a dose of 0.3mg/kg. The

pain testing was done slightly differently in this study at the laboratory of Dr. Albert

Dahan in the Netherlands. Here acute pain was induced by the application of electrical

current via two surface electrodes placed on the skin over the tibial bone (the shin) on the

left leg. Ten pulses of a 10Hz each were administered for a duration of 0. ms. The

intensity of the electrical current was increased in a stepwise fashion of 0.5mA/s from

OmA to a cut off current of 128mA. The participants (47 in all: 29 redheads and 18 non

redheads) were instructed to press a button when they could no longer handle an increase

in current and this measure became their pain tolerance measure and this also indicated

the end of the stimulus. Genotyping showed that all the redheads had two or more MC1R

mutant alleles, but none of the non-redheads. One of the redheads had an A insertion at

base 27 which caused a frameshift, instead of the previously described alleles.

Baseline pain tolerance differed significantly between genotypes, with greater

currents being tolerated by the participants with two MC1R mutant alleles (-20.9 (1.7

SEM) mA) compared to those subjects with zero or one mutant allele (-15.8 (1.2) mA)

(p= 0.018, see figure 4-3). There was no significant sex by genotype effect. The effect

of the M6G analgesic was significantly higher in participants with two mutant alleles

compared to those with 0-1 mutations. The area under the time effects curves (pain

tolerance relative to baseline) was 1.49 (0.09) mA and 1.18 (0.04) mA respectively with

p=0.003 (figure 4-6). These numbers suggest that there is an increase in tolerance due to









M6G administration of 18% (4mA) in 0-1 mutant allele people and 49% (10mA) in two

mutant allele people (figure 4-5). Again, this effect was not based on the sex of the

participant, only the genotype, unlike pentazocine. The genotypic differences seen in the

patients can be attributed to the pharmacodynamics of the M6G ligand acting on the [t-

opioid receptor, as the plasma M6G concentrations remained the same at different time

points post injection between the two genotypic groups (figure 4-7). Again, this human

study was a translational research project, and these results were mirrored in Dr. Mogil's

study of the Mciree mouse model. In these mouse studies, wildtype B6 mice were used

as controls and compared to their Mcre e littermates. These mice underwent a battery of

pain tests such as withdrawal latencies from water either at 470C or 490C, a hotplate test,

hot lamp test, binding clip test and a writhing test post 0.09% inter peritoneal acetic acid

injection. We published these data in 2005 (Mogil et al. 2005)

Discussion

Pentazocine Studies

After murine QTL mapping and functional studies tested a candidate gene

hypothesis, support for a female-specific role of Mclr in pain sensitivity was evident.

MC1R was tested and found to be the gene for this phenotypic effect as it is expressed in

the peripheral neurons as well as brain glial cells (Wikberg 1999) and neurons of the

ventral periacqueductal grey (Xia, Wikberg et al. 1995), a region of the brain which is

critical for the modulation of pain. The exact relevant endogenous ligand of MC1R is

unknown but one of the POMC gene splicing products is a-MSH (melanocyte

stimulating hormone), which is an endogenous ligand. It has been shown that a-MSH

acts as an antagonist in thermal nociception (Walker et al. 1980; Ohkubo et al. 1985) and









this ligand has also been revealed to have an anti-opioid role wherein it reduces tolerance

of opioid ligands (Gispen et al. 1976). The regulation of a-MSH release by K-opioid

receptors seems to be sexually dimorphic in humans (Manzanares et al. 1993), however

our group has not been able to reproduce this result in mice. A possible ligand for the

role of MC1R in this paradigm is the dynorphrin class, which are classically selective K

opioid receptor ligands, that bind the melanocortin receptors with nanomolar affinity

(Quillan and Sadee 1997). Our research set up the hypothesis that MC 1R activation

would cause an anti-opioid effect in females, which red heads (fair skinned females)

would lack. Pentazocine, which has activity at the K-opioid receptor site, also has an

affinity for the [i receptor as well. Our next study using M6G actually addresses this

point. These results suggest that there are qualitative sex differences in processing of

pain inhibition. From these data, we can conclude that females with two mutant alleles

need a lower dose of pentazocine for the same analgesic effect that females feel who have

zero or one mutations, and men. This was a ground breaking study, discovering that

MC1R accounted for kappa opioid mediated pain sensitivity in females. The NMDA

receptor has long been known to mediate pain response in males, but not females, and we

were able to fill this gap in knowledge.

M6G study

A problem with pain management is the variability between individuals in baseline

pain sensitivity and the effects of analgesics (Aubrun et al. 2003). In this study, we have

found a positive association between the MC1R gene and pain tolerance as well as a link

to the efficacy of M6G. We have determined that there is a greater M6G induced

analgesic responses in people who have two or more mutant MC1R alleles. We did not









observe a sex dependent result with this drug as we saw in the pentazocine study.

However, the decreased pain sensitivity in these people with non-functional MC1R as

well as the Mciree mutant mice (compared to the wild type people and mice) implies that

endogenous activation of MC1R may have an anti-analgesic effect. The reason we may

not see any differences in baseline pain sensitivity may be due to the different pain

modality that was used in this study (electrical pain vs. ischemic and thermal pain used in

our pentazocine study). Here, we have again demonstrated the power of direct mouse to

human translation in genetic studies of a complex trait.








49





Hair color* Skin type* MCIR genotype
TWo variant 0/1 variant
Sex RH NonRH I & II III a IV alleles alleles
Number of subjects Females 9 9 11 7 5 13
Males 12 12 15 9 9 15
Ischernic pain threshold Females 85.2 6.6 974 -35.0 116,6 18.7
(145.7) (139.2) (14A4) (97.8) (181.7) (124,5)
Males 17.4 98.3 20,2 120.6 8.6 87.3
(106.7) (164.3 (95.5) (186.1) (119.7) (149.3)
A Ischermic pain tolerance Females 237.0 62.0 2333 248 408.0 37.1
(268.3) (58,8) (2364) (61.1) (284.1) (82.8)
Males 62.3 84.6 84.6 59.6 464 841
(217.B) (137.4) (190.6) (155.1) (1493) (182.8)
SSum Ischemnc pain Intensityi Females 55,0 16.6 56** 0.3 84.8 16.9
(58.1) (42.1) (54.0) (26.6) (503) (41.9)
Males 20.9 40.3 254 39.3 1B.7 37.8
(37.2) (37.6) (35.1) (42.8) (36.2) (3B.3)
A Sum Ischenic pain unpleasantness- Females 46.1 11.1 54A** -11.9 79.6* 9,0
(60.0) (516,) (55.6) (31.9) (45.7) (49.6)
Males 26.4 33.0 26,9 343 24.2 33.0
(48.1) (44.4) (433) (51.1) (41.0) (49.0)
A Sum thermal pain Intensity" Females -1.4 -15.9 6.1 -31.9 2,04 -22.8
(56.1) (38.9) (46.9) (41.1) (46.9) (40.1)
Males 17,7 22.4 13,9 29.8 9.2 26,2
(48,8) (61.9) (46A) 66.6) (51.0) (5.55)
Values presented are means (ID appears in parentheses). For all measures greater values indicate more robust analgesia.
*Redhead (R H) includes auburn (two) and strawberry (three) hair coklrs NonRH includes blonde five), brcwn (fourteen) and black (two). As seen by others
previously (27), all subject with two variant alleles were RlH but only 12 of 21 (57%) I H subjects had two variant alleles.
1Based on Fitipatrickskin type classifications li burn nevertan; II: burn.then tan II l tan, sometimes burn; Itan, never bum, Al subjectswith twovariant alleles
had type I or type II skin.
'Of the 14 subjects (29%) with two variant alleles, three were homoxygous for R151C, one was honozygous for D294H, six were R151C/R160W compound
heterozygotes, twowere R151C/D294H compound heterozygotes, and onewas a V92M/R 160W compound heteroygote. Other than 92M, R151C, R160W,
and D294H, the only nonconsensus allele observed was R163Q in one non-RH female. Observed allelic frequencies were very similar to published data 27).
Kakulated as: (ostdrug pain threshold precrug pain threshold).
ICalculated as (postdrug pain tolerance predrug pain toerance).
ICalculated as! (sum of all predrug isdoernic pain intensity ratings sum of all postdrug ischernic pai intensity ratings).
-Calculated as: (sun of all predrug ichernm pain unpleasantness ratings sum of all postdrug ishernic pain unpleasantness ratings).
'tCakulated as: (urn of predrug thermal pain intensity ratingstrials 1-5 sum of post&ug pain thermal intensity ratings trials 1-5),
44Significantly higher than corresponding within-sex group, P < 005 (see text).





Figure 4-1 The measures of pentazocine analgesia in humans by sex, hair and skin
phenotypes, as well as MC]R genotypes. This is a comprehensive figure of
all experimental pain testing compared to people grouped with regard to their
hair color, skin type and MCiR genotype (Mogil et al. 2003).















a ootia ntdiPkSesEvartAvtai
B-.



4-






41


I I
t0












Femaes IMes







Figure 4-2 Change in pain ratings after pentazocine analgesia separated by sex and
genotype. a) is the results of the thermal pain testing while b) is the result of
ischemic pain testing. There was no difference between the groups in baseline
pain measurements or response to saline administration across sex or
genotype. The indicates a significant difference found in the sex between the
two different genotypic groups (p<0.05) (Mogil et al. 2003).











Genotype n (%)t


+/+ (consensus sequence)
V60L/+
V92M/+
R151C/+
R 160W/+
V601/V60L
V60L/V92M
V60L/D294H
V92M/D294H
R151C/R163Q
R 160W/R163Q
ins29/ins29
R151C/R151C
R151C/R 160W
R151C/D294H
R160W/R160W
R151C/R151C and R160W/+


Totals


0/1:25
2+: 22


10 (21%)
2 (4%)
1 (2%1
3 16%)
3 (6%)
1(2%)
1 2%)
1(2%)
1 2%)
1 2%)
112%)
1 (2%)
3 (6%)
12(26%)
1 (2%)
4 (9%)
1 (2%)

47


All non-redhead
Both non-redhead
Non-redhead
1 Non-redhead; 2 redheads
2 Non-redheads; 1 redhead
Non-redhead
Non-redhead
Redhead
Redhead
Redhead
Redhead
Redhead
All redheads
All redheads
Redhead
All redheads
Redhead

Non-redheads: 18
Redheads: 29


*Experiments in transfected cell lines have determined that the following MCIR variants are unable to induce cyclic
AMP production when stimulated by a-melanacyte stimulating hormone (i-MSH) or a long lasting analogue,
NDP(Nle, D-Phe71-MSH (see Schaffer and Bolognia"): R142H (Arg142Hs), R151C (Arg151Cys), R160W
(Argl60Trp). D294H (Asp294His), and the insertion mutations ins29 and Ins179. The R142H and insertion
mutations are very rare (< I % allele frequency), and were not seen in this study except for one subject homozygous
for ins29. Subjects with two (or in one case, three) total variants at ins29, R151C, R160W, and/or D294H (all
redheads) were thus classified in the non-functional MC1R genotype group ("2+"). The V60L (Val6OLeu) and
V92M (Val92Met) are somewhat common mutations, but do not lead to MC R loss of function, and thus subjects
with these MCIR variants were classed with the functional MC1R genotype group ("0/1"). RI63Q (Arg 63Gln)
has not yet been tested for cAMP stimulation; we conservatively dassified this variant as not affecting MCI R
function. It should be noted ihat the genotypic effect on both baseline sensitivity and M6G analgesia is significant a
the p<0.05 level regardless of the classification of R163Q containing subjects. We also assayed for the K65N
(Lys65Asn) and D84E (Asp84Glu) variants, but found none.
tPercentages do not add up to 100% due to rounding. Allele frequencies in these subjecs were: +/+ (wildtype):
31%; ins29: 2%; V60L 6%; V92M: 3%; R51C: 27%; R160W: 26%; R163Q: 2%; D294H 3%. These values agree
well with those previously reported in the literature.
*Subjects classified as "redheads" had red hair ranging from orange to aubum, fair (type 1/11) skin, and blue or
green eyes. Twenty two of the 29 redheads 176%) possessed two or more MC R inactivating variants, also in
excellent agreement with the existing literature.


Figure 4-3 The grouping of subjects by the location of the SNP in the MC1R gene and a
description of their phenotypic characteristics (Mogil et al. 2005).


No. of
variants


Phe-otypet









24

22


E



2
-R


C6-


Electrical current (humans)

m 7 0/1 variant
M 2+ variants


20


18

16

14

12


10L1


-1-


Figure 4-4 Effects of MC1R functionality on baseline nociceptive and pain sensitivity in
humans. These data are separated by genotype only as significant effects of
genotypes were observed in both sexes (* p<0.05) (Mogil et al. 2005).










-- 0/1 variant
- 2+ variants


0 60 120 180 240 300 360
Time post-injection (min)


Figure 4-5 The change in pain tolerance over time after the administration of M6G at a
dose of 0.3mg/kg. Here we have charted the different genotypes of our
participants and see a functional difference in tolerance over time depending
on the grouping (Mogil et al. 2005).








1.6


-E] 0/1 variant
UI1.5
LU 2+ variants


S1.3

O 1.2

1.1

1.0

Figure 4-6 M6G analgesia expressed as the area under the time effect curve. This is a
significant measure (p<0.05) (Mogil et al. 2005).


10000


1000




100


-o-- 0/1 variant
-a- 2+ variants


60 120
Time post-injection (min)


180


Figure 4-7 Concentrations of M6G plasma levels in participants at time points after M6G
administration at a dose of 0.03mg/kg (Mogil et al. 2005).


j














CHAPTER 5
THE Al 18G SINGLE NUCLEOTIDE POLYMORPHISM IN THE [t-OPIOID
RECEPTOR GENE IS ASSOCIATED WITH PRESSURE PAIN SENSITIVITY

Introduction

In 1999, Uhl et al. suggested that the [t-opioid receptor gene (OPRM1) may be a

likely candidate to be involved in pain sensitivity in humans. It is located on

chromosome 6 at band q24-q25. There is a SNP located at nucleotide number 118 which

changes the sequence from an A nucleotide (major allele) to a G (minor allele). When

this change occurs, it causes an amino acid change from a polar amino acid asparagine to

the acidic amino acid aspartate (N40D). The G allele occurs in the general population at

a frequency of 20%-30% (Bond et al. 1998; Grosch et al. 2001; Szeto et al. 2001). Until

our study, no reports of associations with the OPRM1 gene and baseline pain sensitivity

in humans had been published. In the past, pressure pain threshold had been assessed in

monozygotic and dizygotic twins and the results suggested a 10% heritability, but these

data may be skewed since the twins were in the same room at the time of testing

(MacGregor et al. 1997). Another group of investigators (Kim et al. 2004) found

heritability of 22%-46% across three pain modalities in healthy individuals. Several

genetic association studies have been done in analgesic response. The [t-opioid agonist

M6G has been demonstrated to reduce pupil constriction in subjects with a rarer OPRM1

allele (Lotsch et al. 2002), and the rarer G allele was associated with lower M6G

potencies (Romberg et al. 2003). OPRM1 polymorphisms have been associated with

opioid addiction and abuse in various studies in a case-control experimental design (Bond









et al. 1998; Hoehe et al. 2000; Szeto et al. 2001; Tan et al. 2003), but there are almost as

many studies that have failed to replicate these results (Compton et al. 2003; Crowley et

al. 2003; Franke et al. 2003). On the evidence of previous findings that aspartate in

position 40 of the protein increased the binding affinity of this receptor's endogenous

ligand (Bond et al. 1998), we hypothesized that people with one or more of the G alleles

would have diminished sensitivity to experimental pain. This was tested on a set of

healthy individuals from Dr. Fillingim (n= 167).

Results

Genotyping disclosed that 24% of females and 17% of males had one or two G

alleles (24 and 12 individuals respectively). In all, 96 females and 71 males were

genotyped and their demographic information recorded (figure 5-1). Because AG/GG

individuals were older that those with the AA genotype (p < 0.05) and women were

slightly younger than the male participants (p = 0.07), age was controlled for in all of our

analyses. Our participants underwent the same ischemic and thermal testing as described

in the previous chapter. These data are represented in figure 5-1. Women had

significantly lower heat pain thresholds (HPTh p<0.05) and heat pain tolerances (HPTo

p<0.001) compared to men, but there was no effect due to genotype (P>0.05).

Individuals in this study additionally underwent pressure pain testing in which an

algometer was used to apply pressure with a 1cm2 size probe at a rate of 1kg/sec.

Pressure was applied to the masseter (approximately halfway between the ear opening

and the corer of the mouth), the center of the right upper trapezius (posterior to the

clavicle) as well as the right ulna (on the dorsal forearm, about 8cm distal to the elbow),

with this measure taken at three different times. For this measure, subjects were asked to

report when the pressure first became painful (pressure pain threshold (PPT)). The









results from the pressure pain testing are presented in figure 5-3 and show that there was

a significant main effect of genotype that emerged for pressure pain threshold (PPT) at all

three measured sites. (trapezuis p = 0.002; masseter p = 0.023; ulna p = 0.049). At all

three sites, individuals with at least one minor allele at this locus displayed higher PPTs

than those with two of the more major alleles. Women reported lower PPTs at all three

sites compared to their male counterparts (p < 0.001). Women also described

significantly higher heat pain ratings during temporal summation of pain at both

temperatures (490C and 520C, p< 0.001), but there was no overall genetic effect (p >

0.10). There was, however, a sex by genotype effect for pain ratings at 490C (p <0.05).

No significant associations between the Al 18G SNP and ischemic pain threshold (IPTh)

or ischemic pain tolerance (IPTo) emerged from these data (p > 0.10).

Discussion

In this study, we examined a large group of young adults and we found an Al 18G

SNP allele frequency similar to those reported previously (Bond et al. 1998; Grosch et al.

2001; Szeto et al. 2001). The results indicate that having one or more OPRM1 G allele is

associated with a lower sensitivity to pressure pain than having the AA genotype. A sex

by genotype interaction was observed for heat pain ratings at 490C, suggesting that the G

allele was associated with lower pain ratings among men and but a higher rating among

women with the same genotype. A similar trend was seen in heat pain tolerance but it

was not statistically significant (p = 0.08). As previously reported (Fillingim and

Maixner 1995; Berkley 1997; Riley et al. 1998), women communicated lower heat pain

tolerance, higher heat pain ratings and lower pressure pain threshold compared to the men

in our study. A possible explanation of the association between the OPRM1









polymorphism and mechanical pain sensitivity is the observation that there is a greater

binding affinity for 3-endorphin to the aspartate at amino acid 40 (Bond et al. 1998),

which may allow for a more robust effect of endogenous opioid analgesia. This SNP

may also be in linkage disequilibrium with other OPRM1 polymorphisms that contribute

to this effect (Hoehe et al. 2000). There was a varying pattern of associations across

different pain assays, between genotype and pain perception. This may be explained by

the fact that previous findings have only shown low to moderate associations between

genotype and responses to different pain assays, which suggests distinct factors may be

the culprit for the variability observed in the different pain measures (Janal et al. 1994;

Fillingim et al. 1999). Parallel studies conducted in mice supported the genetic

association found in our study (Lariviere et al. 2002). The mechanism underlying our

association findings may be modulation of mechanical pain, either exclusively or

preferentially. There is evidence suggesting that descending opioid systems inhibit deep

pain more efficiently than cutaneous pain (Yu et al. 1991), which would explain the

association we found to mechanical pain and the lack of association to thermal pain.

There may be underlying associations with pain modalities other than mechanical pain,

but due to the relatively low frequency of the G allele and the size of our sample group,

we may not have enough power to reach significance. This could explain why we found

a marginal significance in heat pain tolerance (p = 0.08) and the significant association

found in heat pain ratings at 490C (p < 0.05) when examining the sex by genotype

interaction of this SNP. These results reflect a marginally higher heat pain sensitivity

among the G allele female group compared with the AA genotype females. Also, by

analyzing the different means and effect sizes, the association of the G allele and









mechanical pain appears to be stronger in men than women. These data advocate the

continuing research of genetic contributions of candidate genes in pain sensitivity with

special emphasis to be given to sex differences and the relative strengths of associations

as it pertains to gender. Since our study has the potential to have been underpowered, we

cannot rule out the possibility of an association of OPRMI variants with heat or ischemic

pain. As there are large variations in allele frequencies in different ethnic groups, this

may affect studies conducted with mixed groups (Crowley et al. 2003), although race was

controlled in our study. Our study is the first to find such Al 18G associations in these

measures. If these data are reproduced in another group of participants, it would be

worthy to investigate possible underlying mechanisms.












MALE FEtWE

A AA AG/GG AA AG/GG

No 59 12 74 24
Age (y[SD)* 25.0 (5.6) 27.2 (7.3) 22.8 (4.3) 25.3 (6.6)
White (%) 75 83 75 63
African-American (%) 7 0 6 5
Hispanic (%) 12 8 14 13
Other ethnicity (%) 7 8 6 21
Oral contraceptive (%) NA NA 50 46

Abbreviatlon NA, not applicate.
"Genotype difference, P < OS.




MALE FEMALE

AG OR GG AG OR GG
B AA (n 59) (n 12) EFFECrS1T AA (n 72) (n 24) EFFCTrS2E

Heat pain threshold 40.6(2.7) 41.2(2.8) 0.23 40.2(2.8) 39.9(3.2) -0.10
Heat pain tolerance 46.8 (2.4) 48.0(1.8) 0.52 45.7 (2.5) 454 (2.8) -0.12
Pain ratings at 490C (0100)+ 41.1 (21.5) 34.0(13.4) 0.35 53 (24.9) 65.3 (27.6) -0.47
Pain ratings at 520 C (0- 68.8 (23.5) 61.5 (22.7) 0.31 82.9(18.1) 84.0 (22.3) -0.06
100)t
Ischemic pain threshold 206.9(196.1) 214.3(151) 0.04 167.9(151) 201,8 (162.4) 0.24
Ischemic pain tolerance 620.1 (245.4) 674.6(185.8) 0.23 583.6 (281.3) 609.4 (277.1) 0.09

'Effect size is C.:rir. D r-pit -rTin' Ih initiylrur.w- i rJl drl't-r,<.-r t r- n i r ImeAA nr] AlG U::IJU. %pat.-r for men and women. Positive values ndlcate
greater pain sensdivlty in the AA group, ,.r r,j,-,s r ].i!he lhJe' ipre-r.i 'jie!w .r.; ..1 rr if. In ,tI5 _rlrUC.
t Main effect of sex, P< .05.


Figure 5-1 This figure illustrated the details of the subjects in this study. A)
Represents the demographic information by genotype and sex. B) Shows heat
pain and ischemic pain measures for male and female participants divided into
OPRM1 Al 18G genotype (Fillingim et al. 2005).









Trapezius (p=.002)


=- AGWGG
AA


Masseter (p=.023)

Th


Ulna (p=.049)


Male Female


Figure 5-2 Pressure pain threshold at all three sites tested (trapezius at the top, masseter
in the middle and ulna at the bottom). Men are depicted on the left and
women on the right. Effect sizes (Cohen D) for the genotype effects are:
trapezius, men=0.89, women=0.38, masseter, men=0.65, women=0.14 and
ulna, men=0.61, women=0.11. Significance is presented on figure represents
overall genotype effect for each site (Fillingim et al. 2005).


1














CHAPTER 6
FUNCTIONAL ANALYSIS OF SINGLE NUCLEOTIDE POLYMORPHISMS

Introduction

While our association studies have correlated pain phenotypes with

polymorphisms, it would be clinically useful to elucidate the mechanisms underlying

these associations. Functional studies are a logical method to assess the biochemical

manner in which the polymorphism may affect the phenotype. Comprehensive studies

have been performed on mouse models of Mclr receptors rendered non-functional by the

minor alleles (Cone et al. 1996; Tatro 1996). The mu opioid receptor has already been

the subject of these kinds of studies, which showed that the minor allele at position 118

reduces receptor function (Bond et al. 1998). Thus, we decided to examine the effects of

the different alleles of the delta and kappa opioid receptor. Discussed below is the

rationale behind the studies, and our results.

The Delta Opioid Receptor and T80G (F27C)

The T allele at base number 80 is the more common allele at this position, while the

G allele has been observed in this position at a frequency of 0.09 (Gelernter and Kranzler

2000) to 0.12 (Kim et al. 2004). This allele frequency implies that one in ten alleles will

be a G, and as we each have two alleles, this means about one in five people will have

one or two G alleles. The T to G change in the nucleotide sequence converts the amino

acid residue from a phenylalanine to a cysteine (F27C). Phenylalanine is an aromatic

amino acid that is hydrophobic, while cysteine is polar and, because of its sulfhydryl side

chain, has the ability to form disulphide bonds and make a sulphur bridge. This is









involved in proteins forming their tertiary and quaternary structure, which confers

functionality to the protein. With Dr. Mavis Agbandje-McKenna, we have modeled this

non-conservative change in the amino acid sequence using another G-protein coupled

receptor (GPCR) as a basis. The GPCR used in the computer modeling of the delta

opioid receptor is the bovine rhodopsin receptor. There is a 19% identity in the amino

acid sequence and a further 33% similarity (ClustalW alignment). The phenylalanine in

position 27 is conserved between the two GPCRs (see figure 6-1) (and in fact this residue

is conserved in OPRD1 of rodents as well). In the computer model, we changed residue

27 to a cysteine (figure 6-2) and have illustrated the potential difference in the local

environment between the phenylalanine and cysteine in this position. In the past,

research has focused on cloning this gene and functional analysis independent of

naturally occurring SNPs (Evans et al. 1992). A mutation study was performed on the

delta opioid receptor where all the cysteines were replaced one by one with either a serine

or an alanine, and testing of the expressed mutant protein suggested that the replacement

of either extracellular cysteine resulted in a receptor lacking delta agonist or antagonist

binding activity (Ehrlich et al. 1998). Thus the fact that the F27C SNP adds a cysteine in

the extracellular region of the protein is an interesting aspect of our study. This natural

allele variant has the potential for an alternate disulphide bridge formation.

Recent studies have found positive associations of the delta opioid receptor F27C

SNP and alterations in pain sensitivity (heat pain intensity) in a sex-dependent manner

(Kim et al. 2004). These findings were consistent with mouse studies, which suggested a

sex-specific QTL on chromosome 4 (where murine Oprd] is located), that mediates

thermal nociception measured with a hot plate (Mogil et al. 1997). Hot plate sensitivity









differences have been noted between knock out mice and their wildtype counterparts

(Zhu et al. 1999). These data suggest that genetic variants do affect the function of the

protein. It has been our undertaking to elucidate possible functional differences of the

delta opioid receptor protein variant F27C.

The Kappa Opioid Receptor and G36T

The delta opioid receptor is known to heterodimerize with the kappa opioid

receptor and thus, modulate the function of each other (Jordan and Devi 1999). The

heterodimer has a distinct function, with its own set of selective agonists. For this reason,

we decided to examine the effects of the synonymous G36T polymorphism in the kappa

opioid receptor, the most common SNP, since there are no known non-synonymous

SNPs. Silent polymorphisms have been implicated in functional consequences in other

systems. For example, a silent polymorphism in the delta opioid receptor (T307C), has

been associated with biobehavioral phenotypes in heat pain intensities in humans (Kim,

et al. 2004). This effect may be mediated through epigenetic mechanisms related to the

nucleotide substitution (Dennis 2003). There is also evidence for synonymous SNPs

having functional consequences as part of a haplotype, where compound heterozygotes

have a different functional consequence from each isolated polymorphism effect (Duan et

al. 2003). The kappa opioid receptor has been implicated in visceral pain sensitivity

(Simonin et al. 1998). That study found that kappa opioid receptor knock out mice

displayed increased visceral writhing in response to an agent, compared to their wildtype

littermates. Thus OPRK1 is a very interesting receptor to study in chronic pain

conditions such as irritable bowel syndrome, and to study functionally with respect to

natural variants. Thus, while the prior expectation is that there will be nonfunctional









differences between the two alleles, there is justification to test this scientifically

especially given the heterodimerization system with OPRD1.

Results

After unsuccessful attempts to clone the delta opioid receptor myself by RT-PCR

(probably due to multiple amplicons from delta opioid receptor type 2) and low level of

expression in leukocytes, we received the full-length receptor OPRD1 cDNA in pcDNAl

(Invitrogen) from the laboratory of Dr. Brigitte Kieffer at the Louis Pasteur Institute in

Paris, France. At the same time we requested the cloned kappa opioid receptor gene from

Temple University in Philadelphia from the laboratory of Dr Liu-Chen. This cloned

cDNA was in the pcDNA3 vector (Invitrogen). After I performed site directed

mutagenesis and sequencing to attain the desired alleles, the vectors (cDNA inserts in

pcDNA3.1 with C-terminal tags) were transfected into HEK 293 cells (which have no

endogenous opioid receptors) and underwent stable selection using Geneticin (Gibco).

Positive pooled colonies were used initially in functional analysis. However, these

showed a negative western blot analysis using a tagged antibody to detect the His tag at

the carboxy terminus and were negative for immunocytochemistry. Thus, we proceeded

with making clonal populations of transfected cells. Activation assays were also

performed on the pooled stable cell lines, which were frozen down in different aliquots

due to having to split the cells before initial selection. These data suggested that the

protein was not being expressed (figure6-3), as there was no dose response curve. After

clonal selection, the clones were frozen and protein and RNA extracted. The clones were

screened for expression by northern blot (figure 6-4), and 1-3 clones were chosen from

each allele: a low expressing cell line, a medium expressing cell line and a high

expressing cell line. Three clones were not always available for each allele, as high









expressing clones tended to die before we could freeze down the colony. The surviving

clones underwent western blotting to test for protein expression. Two different

antibodies were used for this purpose: an alkaline phosphatase (AP) conjugated anti-

histidine antibody (Invitrogen), and a polyclonal anti-histidine antibody (Covance), with

an AP secondary antibody. Two different methods were used for detection as well: AP

development using NBT and BCIP as well as an chemiluminescent (ECL) method

(Pierce). A positive control protein consisted of a his-tagged protein, which was 40.8kDa

in size. The ECL method produced the clearest results, which were negative for opioid

receptors but positive for the control protein (figure 6-5). Immunofluorescent analysis of

the colonies (immunocytochemistry) revealed only background fluorescence in the cells,

and binding assays showed no dose response curve. Together these data suggest that

there is little or no expressed recombinant protein in the clones.

As a secondary test, the vectors were transfected into COS-7 cells, using the

Fugene reagent (Roche) in a 3:2 ratio. A total of four 10cm2 plates were transfected with

each vector, and a P-galactosidase reporter gene was cotransfected into two of the four

plates. These two plates were subsequently used in binding assays two days later, while

in the same time frame, one of the two remaining plates was harvested in Laemli buffer

(Bio-Rad) with 5% beta-mercaptoethanol (BME, Sigma). The last plate was split 24

hours post transfection onto 4-well chamber slides, grown overnight and then fixed,

permeabalized and immunostained with the anti-his antibodies. This

immunocytochemistry revealed no signal above background, while there was a total lack

of a dose response curve in the binding assays and yet another negative western blot

(figure 6-6). In a separate experiment to analyze possible quantitative or splicing effects









of OPRK1 G36T by itself, RT-PCR of a portion of the cDNA (and GAPDH as a control)

was done using leukocyte RNA from individuals who had genotypes GG and GT. There

was no difference in expression levels by RT in the GG sample compared to the

heterozygote in the kappa RNA, nor any aberrant bands (data not shown). This indicates

that the minor allele does not obviously affect expression of the gene.

Discussion

The vector sequence is normal and in frame, including the his tag, prior to the stop

codon. Planning of the construct included removing as much of the multiple cloning site

(MCS) as possible as to remove the most extraneous material out of the finished product.

In fact, the whole MCS was removed (see figure 2-1 chapter 2), from the first restriction

site (HindIII) to the Sful site in the case of the delta opioid receptor alleles, and the Agel

site in the kappa opioid receptor vectors. A Kozak sequence was added 5' the translation

start site to aid in expression of the gene.

The mRNA was about 1.2kb, which is the expected size, and this was confirmed

via both northern blot analysis and RT PCR. We could even visualize the difference in

expression levels of each of the single clones via RT PCR (figure 6-7). There were three

different bands in the northern blot analysis of the receptor RNAs, using a full-length

cDNA probe. The three-band pattern has been reported before, which was explained to

be the hybridization of the probe to related receptor mRNA, but may represent residual

non-specific hybridization in our case as well (Evans et al. 1992).

The lack of stable expressed protein in our clones could be due to multiple reasons.

The vector might not be as conducive to mammalian expression as we had hoped in these

cells. Also, protein expression may be below detectable levels, however the binding

assays indicate absolutely no expression, and ECL is a sensitive system. The binding









assays should have shown a dose response curve in response to the addition of receptor

agonist during stimulation. These experiments have been performed before, with a

slightly different experimental design (Evans et al. 1992; Jordan and Devi 1999;

Decaillot et al. 2003), by the addition of forskolin to the agonist. We also added a

varying amount of forskolin to the agonist and planned to observe the change in

inhibition depending on the amount of agonist added to the well. We did not observe this

difference as others had, which may be explained by lack of protein. The background

seen in the immunocytochemistry showed a faint signal around the nucleus, which

suggests that the recombinant protein may be expressed but retained in the endoplasmic

reticulum (ER). There is evidence from other groups that the majority of an expressed

delta opioid receptor does not make it out of the ER and is subsequently degraded due to

protein misfolding or problems in post-translational modifications (Petaja-Repo et al.

2000; Petaja-Repo et al. 2001). There may also be a confounding effect of a low level of

expression of the vector and post-translational problems that may account for the lack of

functional protein. It is interesting that the high expressing (RNA) clones tended to die

quickly, suggesting that expression of the protein is occurring but causing cell death in

those clones, possibly due to a cytotoxic effect in the maturation of the protein. These

experiments proved to be a starting point for our functional analyses and will need further

troubleshooting in the future.



































Figure 6-1 Model of the delta opioid receptor (B), based on the bovine rhodopsin receptor
as a homology template (A) with the ball representing the conserved
phenylalanine residue. C is both receptor models superimposed on top of
each other to illustrate the similarities between these models.













C11 -
INAA

01 C18

; ^ 7 A *


E118


.110


Ell


L110


S25


Figure 6-2 The local environment of the hydrophobic pocket where the phenylalanine is
located. (A) is the conserved region in the bovine rhodopsin receptor while
(B) is the region in the delta opioid receptor. (C) illustrates the possible
change in the region when replaced by a cysteine residue.













hDOR G4C4


hDOR T2C5


0.8


06
o
06
S1

04


0.2


00


S DPDEB endorpbmn
.: ,,A . ,
------ Average Basal



-10 -9 -8 -7 -6 -5 -4




Dilution Factor


hKOR G1C5


A--.., _-._.-A- A-. -.-A- .-...A,-.,- -A-- -a


---D--- ynorphrin A
o Dyn A + forskolin
------ U69593 +forskolin
--- Averageforskoln
-a Average basal


-.-- .- .--,
U- -5 U


-9 -8 -7 -6 -5


Dilution Factor


Figure 6-3 Activation assay results show that there was no dose response in the activation
of the stably transfected cell lines. The forskolin (10mM concentration) is the
maximum activation possible as this allows for the cAMP accumulation (or in
our case, decrease) without having to signal through the receptor. In theory,
we should see a dose response curve with a decrease in activation as the
amount of agonist added increases.


------ -------
-A



B-endorphin
-o DPDPE
-- -- TA67
-A- -. B-end-forskolin
Average Forskilin
--o-- Average basal


-10 -9 -8 -7 -6 -5 -4

Dilution Factor


- -... .... -. .
u-- ----w-- -- -I-


13 -12 -11 -10









hDOR

4l^ 4,3


hDOR

O o


28S 4.



18S .
1.2kb -






5S

beta actin I


-1.2kb


Figure 6-4 Northern blot analysis of the human delta- and kappa opioid receptor stably
transfected cell lines. The 293 cells are untransfected and since the hKOR
G1A4 cell colony produced no mRNA, it was used as a mock transfected cell
line. There seemed to be substantial non-specific hybridization of the full-
length cDNA probe, although the 1.2kb mRNA can be observed clearly.









hKOR














1.2kb






v.A
.... F"i


ago*


beta actin













hDOR hKOR
^AO: A<^ ^- 0
1\1


hDOR hKOR
d 6,,P : (:- cl (


Figure 6-5 The western blot comassie stained is on the left and the ECL blot is on the
right. The positive control protein is 40.8KD, which is about the expected
size of our protein. There is no difference in the banding pattern between the
untransfected 293 cells and the stable colonies. 2[g of the positive control
was loaded on the gel along with 15[tl of total cell lysate of each of the cell
lines.





















*r



r











Figure 6-6 Western blot of COS-7 transiently transfected cells, 48 hours after transfection
using the Fugene transfection kit. There is no difference in protein expression
between the mock transfected cells, which received empty vector, and the
vectors containing the cDNA of the four different alleles. The left picture is
of the ECL autograph of the different cell lines. There is no difference in the
protein expression profiles between the transfected cell lines and the mock
transfected cell line indicating that there is no OPR protein being expressed.
On the right is a duplicate comassie stained blot.









hDOR

,e C


Figure 6-7 RT-PCR of the OPRD1 cDNA from stably transfected colonies after 25
extension cycles. GAPDH expression was equivilant in all the samples.
These data illustrate the differences of expression levels between the different
single colony cell lines used for our analyses, and that the clones are
producing RNA from the plasmid, consistent with the northern analysis.














CHAPTER 7
CONCLUSIONS AND FUTURE DIRECTIONS

Conclusions

MC1R

Although our functional studies proved inconclusive due to the lack of protein

expression, we have found some associations between candidate genes in pain sensitivity

and pain responses at baseline and after the administration of analgesics. We were the

first group to elucidate a genetic link between fair skinned females and the response to

pentazocine analgesia, where fairer skinned females have a greater analgesic response

after the intravenous administration of a kappa opioid selective analgesic. This finding

has far reaching implications as it had been anecdotally reported by the anesthesiology

field that red head females need less anesthetic than the general population. Our findings

have proposed a mechanism for their observations. This association is mediated through

the MC1R gene, which is widely known in its role in the formation of skin pigment.

Because pentazocine is not widely prescribed clinically anymore, we are currently

conducting a study with morphine and examining baseline pain sensitivity and analgesic

effect in a similar population. We have proposed that there is, in fact, a difference

between fair-skinned individuals compared to darker skinned individuals when

examining effects of morphine-6-glucoronide (M6G), a morphine metabolite in which we

found that fairer skinned people had a higher analgesic effect via electrical stimulation

compared to their darker skinned counterparts. M6G, although slower in its analgesic

action, has less of an effect on respiration depression and it seems to have a smaller









sedative effect (http://www.medicalnewstoday.com/medicalnews.php?newsid=22657)

than morphine, and may possibly be a better option for clinical use in the future.

OPRM1

One of the other candidate genes thus far found to have a positive association with

baseline pain sensitivity, is the mu opioid receptor (OPRM1). It is the classic pain

receptor in the nociceptive response and most analgesics are either directed either

selectively or indirectly for this receptor. Our study into the baseline pressure pain

sensitivity in different OPRM1 genotypes was the first of its kind. We have linked the

mu opioid receptor with mechanical pain sensitivity and the Al 18G polymorphism,

which has been previously associated with other phenotypes such as the feeling of

intoxication and family history of alcohol abuse (Ray and Hutchison 2004). The Al 18G

polymorphism has also been associated with heroin dependence in Asian populations

(Tan et al. 2003) and the minor allele in this polymorphism has also been shown to elicit

an enhanced cortisol response to naloxone and reduced agonist effect of M6G

(Hernandez-Avila et al. 2003).

The mu opioid receptor Al 18G polymorphism is also interesting, because it has

been observed that the major allele is more highly expressed in post-mortem human

brains compared to the G allele. In order to explain this finding, transfections of each

allele were made in Chinese Hamster Ovary (CHO) cells and it was found that the A

allele expressed more protein than the G allele. This research suggests an allelic

consequence, which implicates a defect in transcription or mRNA maturation/stability of

the minor allele (Zhang et al. 2005). There is also evidence that the Al 18G

polymorphism is in linkage disequilibrium with the silent C17T polymorphism in the part

of the gene encoding the extracellular region (Tan et al. 2003).









OPRD1

Although ANOVA analysis failed to find an association with pain sensitivity in our

population of participants with the delta opioid receptor and pain sensitivity, another

group recently found an association (Kim et al. 2004). Due to the gross amino acid

change in the protein sequence and the environmental difference within the protein that is

caused by this change, there is still a possibility of a functional implication of this

polymorphism. Our lab has only performed three different pain modalities on our

subjects, and we may be missing a pain modality associated with pain sensitivity or

analgesic effect of this allelic variation. We are also pursuing QTL analysis of our data,

which may be more sensitive to an underlying association, and enrolling more subjects.

Clinical Testing

Different clinical pain testing modalities were used in the different populations in

the clinic. This makes it somewhat difficult to compare results obtained from these

distinct populations. Our consortium of researchers and clinicians have started to use the

same tests and facilities, which will make comprehensive conclusions more plausible in

the continuing studies. For example, the IBS patients are now undergoing the same

experimental pain testing as our healthy subjects. This could be a very interesting

comparison.

Future Directions

Association Studies

Our research can be continued in the future by expanding our profile of candidate

genes to analyze. We are currently starting to examine the adenosine receptors in our

fibromyalgia patients in collaboration with a group in New York. After genotyping the

polymorphism in this receptor, we have found that there is a higher frequency of the









minor allele in the FM patients (17%) compared to 1.5% in normal controls. This

frequency difference warrants further validation and research into the exact mechanism

of the adenosine receptor in the perception of pain and its role in the pathogenesis of a

chronic pain syndrome. Also, we should examine the IBS chronic pain population and

see if there is a difference of allele frequencies in this population compared to the FM

patients and the normal controls. The 3-2 adrenergic receptor is on our list of future

candidate genes as it has been implicated in nociception in the mouse (Bastia et al. 2002).

This genotyping is currently being undertaken in collaboration with the Belfer group at

the NIH as well as our own facilities. In our collaboration, we are also examining the

interleukins (IL), which are a large group of cytokines and are involved in the

inflammatory response. The interleukins under examination are ILla, IL13, IL2, IL10

and IL13. As calcium levels have been found to be elevated in chronic pain patients (Ai

et al. 1998), it is interesting to learn that IL1 is implicated also in the modulation of

extracellular fluid calcium homeostasis (Sabatini et al. 1988). Both ILc and IL3 are

released as a result of cell injury independent of the insult (Hogquist et al. 1991). IL13 is

the major molecule responsible for the induction of cyclooxygenase 2 (COX2), which

leads to the release of prostanoids. Prostanoids then invoke peripheral sensitization of

nociceptors and causes localized pain hypersensitivity (hyperalgesia) (Samad et al. 2001).

IL2, formerly known as T-cell growth factor, is an immunoregulatory molecule produced

by lectin- or antigen- activated T cells. IL10 is also known as cytokine synthesis

inhibitory factor, and is suggested to possibly arrest and reverse the chronic inflammatory

response in atherosclerosis (Terkeltaub 1999). It has also been shown that IL10 works

synergistically with glucocorticoids (Franchimont et al. 1999). Mice homozygous for a









disrupted IL10 gene seem to have an altered regulation of an immune response to enteric

flora are more prone to inflammatory bowel disease (Kuhn et al. 1993). IL10 has also

been connected to cytokine deficiency-induced colitis by QTL analysis (Farmer et al.

2001). IL13 is involved in the inhibition of inflammatory cytokine production, induced

by lipopolysaccharides in blood monocytes (Minty et al. 1993). In fact, the c-terminal

tail of IL13 (which dimerizes with IL4) interacts with the tyrosine kinases of the Janus

kinase family (JAK), which interact in turn with STAT6 and regulate gene expression by

binding to promoters of genes that are regulated by IL13 (and IL4). Differences in the

gene sequence due to polymorphisms have been linked to differences in IL signaling

(Kelly-Welch et al. 2003). Over-expression of IL13 in the lung of the mouse has been

shown to cause inflammation and an accumulation of adenosine, as well as a decrease of

adenosine deaminase activity with the simultaneous increase of various adenosine

receptors (Blackburn et al. 2003).

We are also in the process of collaboratively genotyping polymorphisms in the

cannabinoid receptor 2, which are involved in response to tetrahydrocannabinol (THC),

which is used in some states as a pain reliever and an anti anxiety medication. Another

potential candidate gene is the a-1-antitrypsin gene, which is known to modulate

inflammation and has been shown to control fibromyalgia symptoms upon infusion

(Blanco et al. 2005). Once these receptors have been genotyped, we can test their

potential role in pain sensitivity and analgesic responsiveness. We could also use our

samples that we have collected and replicate results found in other studies examining the

vallanoid receptor subtype 1 gene (TRPV1) and its association with its increase in cold

withdrawal times (Kim et al. 2004). I think that we should also focus our attention on the









NMDA receptor as this receptor is more involved in anti-nociception in males. We have

also genotyped all our samples for all the COMT SNPs and are awaiting analyses, as we

are also working on this aspect of the project in a collaborative fashion. Ultimately,

strong reproducible associations can lead to improved pain management based on

genetics, and shed light on biochemical systems involved in pain for future research.

Functional Analysis

If we do not find a positive association in our on-going studies of pain sensitivity

with the delta and kappa opioid receptors, it may be difficult to justify future functional

analyses of these polymorphisms. Our strategy needs troubleshooting if it is repeated in

the future. For example, it may be helpful to first test this vector expressing a lacZ gene

in HEK 293 cells before the effort is made to redo the stable cell lines. Also, others have

used HEK cells that grow in suspension instead of our subpopulation of the HEK-S cells

that grow adherently (Decaillot et al. 2003). The 5'UTR may be needed for proper

translation of the protein, so next attempt, this region of the gene should maybe included

in the vector. I think that the first experiment that should be attempted is the expression

of the original vectors that were sent to us in a COS 7 cell system to see if we were

actually sent cDNA that is translatable. I performed a quick transient co-transfection of

the original vectors with 3-galactosidase (figure 7-1) and it seems as though the kappa

opioid vctor produces a functional protein. This experiment no only needs to be repeated,

but mRNA and western blot analysis should be performed. The vectors can be expressed

transiently, but we would have to then co-transfect a reporter vector to establish

transfection efficiency, and we should be careful to make sure how different transient cell

transfections express our receptor. It would also be important once we have protein, to









conduct binding assays to examine whether there is a difference in ligand affinity for the

receptor based on the polymorphism located near the start of the gene, which translates

into the extracellular region of the protein. This can be done using radiolabeled ligand

and unlabelled ligand and analyze the competitive binding of the receptor. It would be

worthwhile to look at the affects of the heterodimerization states of the opioid proteins.

The polymorphisms in the genes of OPRDI and OPRM1 confer amino acid substitutions

in the encoded protein. The mu opioid receptor Al 18G polymorphism in the gene has

already displayed altered function in the protein, but this has not been studied in a

heterodimer state.

General

Our collaborations and studies are ongoing in this long-term project. We are

currently looking at how differences in ethnic backgrounds affect pain sensitivity. We

have started to standardize the testing amongst our three different populations and we

plan to examine the evolution of the genetics of pain in the future. Our lab has expanded

its collaborations since the inception of this described project and we are now studying

patients with rotator cuff pain as well. This project was just the start of our lab's entry

into the pain genetics field and, after four years, we are still one of the few laboratories in

the country studying human pain sensitivity in the paradigm of genetics.













hDOR pcDNA1


S.. ., -"
.,o
'0




-----. B-endorphIn
o Bend+forskoin
---T--- Aevrage forskolin
--. A average basal
1 -- ---- -


-10 -9 -8 -7 -6 -5 -4


Dilution Factor


hKOR pcDNA3


y_---+--._-t-, ---- +---- V
------ Dynorphrm A
o- ynA+Forskohn
o ---_-- Average Fors-ohn
Average Basal



2 1 17 0

A- --- -- --- -A- -A




-12 -11 -10 -9 -8 -7 -6


Dilution Factor


Figure 7-1 A transient transfecion with the original vectors received from collaborators.

The hOPRD1 protein had no receptor activity in the activation assay, while

the hOPRK1 protein seem to be expressed as we have a dose response in the

cells where forskolin and agonist were added.














APPENDIX A
GENOTYPING RESULTS

Object A-1. Excel spreadsheet containing the list of genotype results in all
polymorphisms studied. (objectl.xls, 118KB)

Object A-2. Comma separated variable (CSV) version of the list of genotype results in
all polymorphisms studied. (object2.csv, 28 KB)















APPENDIX B
GENOTYPE FREQUENCIES












Genotype frequencies of the different gene polymorphisms between three different pain populations. The actual headcount is
followed by the represented genotype frequency in the population in parentheses. The between group value ids represented under the
polymorphism name.

population OPRM1 C17T OPRM1 OPRD1 OPRK1
(n=511) A118G T80G G36T
p=0.55 (n=506) (n=507) (n=482)
p=0.155 p=0.64 p=0.376
CC CT TT AA AG GG TT TG GG GG GT TT

Healthy 320 18 2 263 67 8 265 64 9 257 51 9
Subjects (94.12) (5.29) (0.59) (77.81) (19.82) (2.37) (78.4) (18.94) (2.66) (81.07) (16.09) (2.84)
IBS 68 2 1 54 13 4 57 11 1 61 10 0
patients (95.77) (2.82) (1.0) (76.06) (18.31) (5.63) (82.61) (15.94) (1.45) (85.92) (14.08) (0)
FMS 97 2 1 73 24 0 78 20 2 82 11 1
patients (97.0) (2.0) (1.41) (75.26) (24.74) (0) (78.0) (20.0) (2.0) (87.23) (11.70) (1.06)

population OPRK1 OPRK1 CALCA CALCA
A843G C846T P1/P2 TC/CG P4 TC
(n=410) (n=405) (n=514) (n=460)
p=0.98 p=0.021 p=0.0167 p=0.422
AA AG GG CC CT TT TTCC TCCG CCGG TT CT CC

Healthy 172 78 9 231 27 0 169 131 42 280 9 1
Subjects (66.41) (30.1) (3.47) (89.53) (10.47) (0) (49.4) (38.3) (12.3) (96.5) (3.1) (0.34)
IBS 41 18 3 55 5 2 38 30 4 67 5 0
patients (66.13) (29.03) (4.84) (88.71) (8.06) (3.2) (52.8) (41.7) (5.56) (93.1) (6.9) (0)
FMS 61 25 3 75 10 0 42 48 10 96 2 0
patients (68.54) (28.09) (3.37) (88.24) (11.76) (0) (42.0) (48.0) (10) (97.9) (2.04) (0)