<%BANNER%>

Effect of Ethylene Sensitivity on Development and Germination of Petunia x hybrida Seeds


PAGE 1

EFFECT OF ETHYLENE SENSITIVITY ON DEVELOPMENT AND GERMINATION OF Petunia x hybrida SEEDS By JENNIFER LYNN ROLL DAVIS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Jennifer L. Davis

PAGE 3

This document is dedicated to my mom, Lynn Roll.

PAGE 4

ACKNOWLEDGMENTS I would like to acknowledge the support and dedication of my family throughout my graduate research. I would like to thank my husband, Keith Davis, for listening to me throughout my trials and tribulations that were a result of the last four years. I would like to also thank my parents for their continual support and dedication for anything that I do in my life. I would like to thank my sister, Lisa, for being a constant companion throughout our lifetimes. I would like to acknowledge and thank my advisor, Dr. David Clark, who has directed and guided me for the past seven years. Additionally, I would like to thank my committee members, Dr. Harry Klee, Dr. Don McCarty and Dr. Rick Schoellhorn, for advice and direction regarding my research. I would like to thank my lab members that have continually given me advice and kept me sane: Dr. Kenichi Shibuya, Dr. Beverly Underwood, Dr. Kris Barry, Holly Loucas, Rick Dexter, Penny Nguyen and Jason Jandrew. I also would not have been as successful in my research without the advice of Dr. Denise Tieman and Dr. Joe Ciardi, who answered an endless number of questions. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF TABLES ............................................................................................................vii LIST OF FIGURES .........................................................................................................viii ABSTRACT .........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................4 Ethylene Biosynthesis, Action and Signaling...............................................................4 Seed Development........................................................................................................7 Maternal Plant Role in Seed Development...................................................................9 Ethylene in Fruit and Seed Development and Subsequent Germination....................11 Ethylene, ABA, and Sugar in Seed Development and Germination..........................15 Condensed Tannins.....................................................................................................17 Conclusion..................................................................................................................21 3 EFFECT OF REDUCED SENSITIVITY TO ETHYLENE ON SEED DEVELOPMENT, DORMANCY AND GERMINATION.......................................22 Introduction.................................................................................................................22 Research Objectives....................................................................................................28 Materials and Methods...............................................................................................29 Culture and Growth of Petunia x hybrida Plants................................................29 Seed Weight, Seed Size, and Seed Number of Petunia x hybrida Developing Seeds................................................................................................................30 Sucrose Analysis of Developing Seeds...............................................................31 CO 2 Analysis of Developing Seeds.....................................................................31 Seed Development Marker Analysis...................................................................32 Germination Assay..............................................................................................33 ABA Germination Sensitivity Assay...................................................................34 Results.........................................................................................................................34 Seed Characterization by Weight, Size, and Seed Number.................................35 v

PAGE 6

Developmental Delay of Seeds Reduced in Ethylene Sensitivity.......................36 The Effect of Ethylene Sensitivity on Seed Germination...................................42 ABA Sensitivity and Germination.......................................................................42 Discussion...................................................................................................................45 Conclusion..................................................................................................................51 4 MICROARRAY ANALYSIS AND CONDENSED TANNIN CONTENT OF PETUNIA SEEDS AFFECTED IN ETHYLENE SENSITIVITY............................53 Introduction.................................................................................................................53 Research Objectives....................................................................................................55 Material and Methods.................................................................................................55 Culture and Growth of Petunia x hybrida Plants................................................55 Petunia x hybrida cDNA Libraries......................................................................56 cDNA Microarray Fabrication............................................................................57 Microarray Hybridization....................................................................................58 RT-PCR Confirmation of Microarray Experiments............................................59 RT-PCR of Condensed Tannin Synthesis Genes................................................61 Vanillin Staining of Seeds...................................................................................62 Results.........................................................................................................................63 Microarray Analysis............................................................................................63 Condensed Tannin Analysis of Seeds Carrying The etr1-1 Transgene..............67 Discussion...................................................................................................................75 Microarray Analysis............................................................................................75 Condensed Tannin Analysis................................................................................82 Conclusion..................................................................................................................85 APPENDIX ABI3 ANALYSIS AND MICROARRAY DATA.......................................87 LIST OF REFERENCES.................................................................................................101 BIOGRAPHICAL SKETCH...........................................................................................115 vi

PAGE 7

LIST OF TABLES Table page 4-1 Highest ranked differentially expressed cDNAs of a microarray experiment of whole fruit tissue of ETR (44568) compared to MD at 25 days after pollination...68 4-2 Highest ranked differentially expressed spots of microarray experiment of maternal fruit tissue of ETR (44568) compared to MD at 25 days after pollination.................................................................................................................69 4-3 RT-PCR confirmation of microarray differentially regulated clones......................70 A-1 cDNA library clones included on microarray chip experiments..............................88 vii

PAGE 8

LIST OF FIGURES Figure page 2-1 Proanthocyanin Synthesis Pathway..........................................................................19 3-1 A picture series of fruit and seed development of all genotypes.............................37 3-2 Seed size of all genotypes of seeds through development.......................................38 3-3 Average weight of individual seeds of MD, MxE, ETR (44568) and ExM............38 3-4 CO 2 Accumulation throughout 3 hours of developing seeds of MD, ETR (44568), MxE and ExM...........................................................................................39 3-5 Average number of seeds per fruit of MD, MxE, ETR (44568) and ExM..............40 3-6 Sucrose content of seeds of all genotypes................................................................40 3-7 RT-PCR analysis of seed developmental markers...................................................43 3-8 Germination of seeds of all genotypes after various storage periods.......................44 3-9 ABA sensitivity of germinating 1 month old seeds of MD, ETR (44568), MxE and ExM...................................................................................................................46 4-1 Extended RT-PCR expression analysis of microarray differentially regulated clones........................................................................................................................73 4-2 Highlighted proanthocyanidin synthesis genes observed through RT-PCR expression analysis in all genotypes.........................................................................76 4-3 Seed pictures of 44568 and MD...............................................................................77 4-4 RT-PCR mRNA expression analysis of genes involved in the proanthocyanidin synthesis pathway.....................................................................................................78 4-5 Freshly harvested and 1 month old seeds of all genotypes stained with 1% vanillin......................................................................................................................79 A-1 RT-PCR analysis of PhABI3....................................................................................87 A-2 ABI3 Southern Analysis...........................................................................................87 viii

PAGE 9

A-3 Complete list of differentially regulated clones in 44568 and MD whole fruit microarray experiment at 25 DAP...........................................................................97 A-4 Complete list of differentially regulated clones in 44568 and MD maternal tissue microarray experiment at 25 DAP...........................................................................98 A-5 Complete list of differentially regulated clones in ein2 and MD whole fruit tissue microarray experiment at 25 DAP.................................................................99 A-6 Complete list of differentially regulated clones in ein2 and MD whole fruit tissue microarray experiment at 30 DAP...............................................................100 ix

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECT OF ETHYLENE SENSITIVITY ON DEVELOPMENT AND GERMINATION OF Petunia x hybrida SEEDS By Jennifer L. Davis December 2005 Chair: David G. Clark Major Department: Plant Molecular and Cellular Biology Past research has proven that several hormones play a role in different stages of development, dormancy, and the germination of seeds. Ethylene, a gaseous plant hormone, is involved throughout many plant processes including the development and germination of seeds, though the action of ethylene is not completely understood with respect to seeds. The goal of this research was to take a more detailed look at ethylenes role in Petunia x hybrida seed development and germination. It was observed in transgenic petunias (44568 CaMV35S::etr1-1) reduced in ethylene sensitivity that ethylene primarily acts by stimulating the developmental time-course and thereby increasing germination rates. The full time-course of seed development was delayed in homozygous 44568 seeds by approximately five days compared to wild-type Mitchell Diploid (MD) seeds. Also, when the two lines were reciprocally crossed, only seeds produced on the 44568 maternal plants displayed the phenotype of delayed seed development. When germination was assayed, both x

PAGE 11

hemizygous and homozygous seeds carrying the etr1-1 transgene had reduced germination, but both were able to recover to MD germination levels after six months of cold storage. All seeds carrying the etr1-1 transgene were also more sensitive than wild-type to exogenously applied ABA during an additional germination assay. Differences in gene expression between 44568 and MD were observed through microarray analysis. The results of the microarray experiments and the observation of a color difference of freshly harvested seeds altered in ethylene perception led to further analysis of proanthocyanidins, or condensed tannins. Expression analysis of genes involved in condensed tannin synthesis did not exhibit any major differences between the genotypes carrying the etr1-1 transgene versus MD. Overall, the primary findings of this research were that the ethylene sensitivity of the maternal parent had a significant role in the developmental timing of seeds. Conversely, the overall decreased sensitivity of the zygotic tissue to ethylene determined the stronger dormancy induction and heightened ABA germination sensitivity observed in all seeds carrying the etr1-1 transgene. xi

PAGE 12

CHAPTER 1 INTRODUCTION Angiosperm seed development is mediated by an assortment of genetic programs involving hormones, fatty acids, storage proteins, carbohydrates and many other components of plant growth and metabolism. The seed is composed of several tissues including the embryo, endosperm, and the testa or seed coat. The embryo contains the tissues that include the root and shoot meristems which develops into a seedling. The endosperm is comprised of an epidermal layer, an aleurone, and nourishing tissue surrounding the embryo. The seed coat provides a protective cover over the other tissues (Harada, 1997). A seed undergoes a complex course of development after fertilization until the point where it is considered a mature seed capable of germination. The development of the embryo after fertilization occurs in three general stages: differentiation of tissues, cell enlargement and maturation (Buchanan et al., 2000; Chaudhury and Berger, 2001). Some seeds enter dormancy after maturation, while other seeds immediately become ready for mobilization of stored reserves in preparation for germination to begin. There are two types of dormancy: primary and secondary. Dormancy is defined as the inability of mature seeds to germinate under favorable conditions (Bewley, 1997). Primary dormancy occurs in the freshly-harvested seed; it develops during seed development and maturation on the mother plant. The maintenance of primary dormancy is determined by environmental and genetic factors (Bewley, 1997; Gubler et al., 2005). This dormancy prevents the seed from germinating in unfavorable conditions and is 1

PAGE 13

2 imposed by the embryo itself or the seed coat. Embryo dormancy can be overcome by dry storage or stratification, and seed coat dormancy can be countered by removal of the seed coat (Kepczynski and Kepczynska, 1997). Secondary dormancy is initiated after the seed has been dispersed from the mother plant. This type of dormancy inhibits germination due to a lack of proper environmental cues such as temperature or light needed for the initiation of the germination processes (Foley, 2001). An overlap of hormone and carbohydrate signaling pathways is apparently integral in seed developmental processes. Currently, a good portion of the dicot seed research is being conducted on Arabidopsis due to the predictable patterns of cell division within the seed and the wide availability of mutants, including those that are insensitive or hypersensitive to many of the hormones (Buchanan et al., 2000). Seeds from different species have widely different proportions of carbohydrates, oils, and stored proteins; therefore, it is important to study seed development and germination in different species to determine where differences may occur (Ruuska et al., 2002). The species used in this research is Petunia x hybrida. Petunia seeds are similar to Arabidopsis in structure and components of metabolites; therefore, information gained from mutant analysis research conducted on Arabidopsis seeds may provide a basis for research conducted on seed action in petunia. Petunia, like Arabidopsis, is used as a model system, but petunia serves as a particularly useful model for studies on floriculture species. A short generation time and the ability to make abundant amounts of seeds are also characteristics of petunia that make it a good candidate for seed research. The hormone of interest in the following research is the gaseous plant hormone ethylene. Ethylene action in seeds is not significantly understood, and further research on

PAGE 14

3 ethylene may provide interesting evidence for interactions with other hormones. In research with petunia transgenic plants reduced in ethylene sensitivity, it was observed that fruit development is affected by ethylene, along with many other plant processes such as senescence, disease tolerance and root development (Wilkinson et al., 1997; Clevenger et al., 2004; Shibuya et al., 2004). In previous research conducted on the effects of altering ethylene synthesis and sensitivity in seeds, it was observed that other hormones such as gibberellic acid and abscisic acid were also impacted (Beaudoin et al., 2000; Ghassemian et al., 2000; Chiwocha et al., 2005). It is likely that interactions between ethylene and other plant hormones play a vital role in seed development (Kepczynski and Kepczynska, 1997). The purpose of this research is to use genetic, molecular, and physiological analyses to help define ethylenes role in seed development and subsequent seed germination, and to also characterize ethylenes interactions with other hormones in petunia seeds.

PAGE 15

CHAPTER 2 LITERATURE REVIEW Ethylene Biosynthesis, Action and Signaling The plant hormone ethylene is a simple hydrocarbon gas that has been studied for over a century (Abeles et al., 1992). It is involved in many different plant processes including floral and foliar senescence, vascular differentiation, stress response, fruit ripening, and adventitious root formation (as reviewed in Bleecker and Kende, 2000). The synthesis pathway starts with methionine being converted to S-adenosyl-L-methionine (SAM) by the enzyme SAM synthetase (Adams and Yang, 1979; Yang and Hoffman, 1984). Subsequently, SAM is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS), which is the first committed step in ethylene biosynthesis (Yu et al., 1979). The last step is the conversion of ACC to ethylene catalyzed by ACC oxidase (ACO) (Hamilton et al., 1991; Spanu et al., 1991). The genes that encode the enzymes of the ethylene biosynthesis pathway have been cloned and studied in-depth in many species (Sato and Theologis, 1989; Hamilton et al., 1990; Zarembinski and Theologis, 1994). The expression of these genes can be induced by many factors, and expression levels are generally correlated with ethylene production (Acaster and Kende, 1991; Kende, 1993). Ethylene itself in some cases induces expression of ACS and ACO resulting in autocatalytic ethylene synthesis (Abeles et al., 1992). Conversely, ethylene can be auto-inhibitory as well and restrict synthesis through regulating expression of enzymes involved in the synthesis pathway (Abeles et al., 1992). 4

PAGE 16

5 The previous case of positive feedback regulation of ethylene biosynthesis is known to be a characteristic feature of ripening fruits and senescing flowers (Kende, 1993). Components of ethylene perception and the subsequent initiation of signaling were able to be identified because of the extremely useful seedling triple response screen. The screen was developed through the phenotype of ethylene response that causes seedlings to grow short, stout and have an exaggerated apical hook in the presence of ethylene in the dark. Seedlings that did not exhibit this phenotype were defective in ethylene perception (Bleecker et al., 1988). The first component discovered in ethylene perception through this screen was a receptor, ETR1 (Bleecker et al., 1988). Four other receptors in Arabidopsis have also been identified since then: ETR2, ERS1, ERS2 and EIN4 (Hua et al., 1995, 1998; Sakai et al., 1998). Analysis of the receptors revealed that there is homology to bacterial two-component receptors. The first component consist of a sensor protein that receives signals through an input domain which autophosphorylates a histine residue. The second component is a response regulator protein that receives the phosphate and mediates responses through an output domain (Chang and Stewart, 1998). Mutant research focused on the receptors, especially ETR1, has provided information about the action and effects of ethylene perception. The first ethylene receptor mutant, etr1-1, was identified in Arabidopsis and was discovered to result in a strong decrease in ethylene sensitivity (Bleecker et al., 1988). Some of the results of the loss of ethylene perception were delayed floral and foliar senescense, decreased adventitious rooting, increased susceptibility to pathogens, decreased seed germination and delayed fruit ripening (Bleecker et al., 1988). Additionally, it was observed that the etr1-1 mutation

PAGE 17

6 from Arabidopsis could be transformed into heterologous species, such as petunia and tomato, and also confer the reduction in ethylene sensitivity (Wilkinson et al., 1997). The next component identified in the ethylene signaling cascade was CTR1. The loss of function mutant of CTR1 exhibited a constitutive ethylene response in absence of ethylene; therefore, it was deemed a negative regulator of ethylene signaling (Kieber et al., 1993). Double mutants between CTR1 and ETR1 had the phenotype of constitutive ethylene response, so it was concluded that CTR1 acts downstream of the receptors (Kieber et al., 1993; Hua et al., 1998; Sakai et al., 1998). Two other components downstream of CTR1 are EIN2 and EIN3. EIN2 is a membrane bound protein that positively regulates the downstream EIN3 transcription factor (Guzman and Ecker, 1990). The cloning of EIN2 revealed that it is a novel plant specific protein whose exact biochemical function is unknown (Alonso et al., 1999). EIN2 is also known to be a membrane protein with 12 membrane spanning regions, and the amino end of the sequence shows homology to a family of metal ion transporters but transport activity has not been shown to date (Alonso et., 1999). The downstream target of EIN2, EIN3, is another positive regulator of ethylene responses. EIN3 was discovered to belong to a small family of genes because mutant plants of EIN3 only showed partial reduced sensitivity of ethylene; therefore, it was concluded that it is part of a small family with some functional redundancy (Roman et al., 1995). One target of EIN3 is ERF1 (Solano et al., 1998). ERF1 is a member of a family of transcription factors that are known as ethylene-response-element binding-proteins (EREBPs), which initiate transcription of genes involved in the ethylene responses (Ohme-Takagi and Shinshi, 1995).

PAGE 18

7 An interesting aspect of the ethylene signaling cascade is that a mutant receptor is considered a gain of function mutant. This is because CTR1 is continuously repressing the downstream components of the signaling cascade until ethylene binds to a receptor and inactivates the repression. A mutant in one of the receptors is a gain of function mutant because the mutant receptors fail to turn off in the presence of ethylene (Bleecker and Kende, 2000). This gain of function characteristic results in ethylene insensitivity when only one of the five receptors are mutated. Seed Development The development of the angiosperm seed is first initiated at the point of fertilization. The process of double fertilization eventually leads to the development of the embryo and endosperm structures of the seed. One sperm cell fertilizes the haploid egg cell and develops into the zygotic embryo tissue. The other half of double fertilization occurs when a second sperm cell joins with a diploid central cell resulting in a triploid endosperm. These processes occur within maternal diploid tissue which eventually becomes the testa, or seed coat (as reviewed in Chadhury and Berger, 2001). Different ploidy tissue and different ratio representations of the maternal and paternal genomes make understanding the regulation of seed development extremely complex. The seed goes through three main chronological phases during development after fertilization: 1) cell division and differentiation of the cells; 2) cell enlargement through accumulation of assimilates and storage reserves; 3) maturation, acquisition of desiccation tolerance and preparation for dormancy (Chaudhury and Berger, 2001). After fertilization, the zygote undergoes a period of rapid cell division. The first two cells formed are the apical and basal cells. The apical cell gives rise to the main portion of the embryo which includes the shoot meristem, whereas the basal cell forms

PAGE 19

8 the root and suspensor (Mayer et al., 1993; Mayer and Jurgens, 1998). Following cellularization, the endosperm begins differentiation. The endosperm serves as the nourishing tissue for the developing embryo (Brink and Cooper, 1947). The endosperm also controls the osmotic potential around the embryo, mechanical support during early embryo growth and storage of reserves and hormones (Lopes and Larkins, 1993). Research also indicates the endosperm has a role in providing signals for early development to the developing embryo (van Hengel et al., 1998). Additionally, it is also thought that the maternal tissue and endosperm regulate the development of each other (Lopes and Larkin, 1993; Felker et al., 1985). During this stage carbohydrates begin to be imported into the developing tissue. Sucrose supplied by the endosperm is thought of as the main carbon and energy source of seed metabolism (Schwender and Ohlrogge, 2002). Sucrose is symplastically transported through the phloem of the maternal plant tissue into the seed coat, which is also maternally derived tissue (Weber et al., 1998). In the seed coat, the sucrose is cleaved into hexoses by invertases and transported passively into the endosperm and developing embryo (Weber et al., 1995). During the expansion phase, the cells begin to accumulate storage reserves. Stored reserves are usually accumulated in the endosperm and in the embryo in the form of proteins and carbohydrates, which break down and are used as carbon and energy sources during the germination process (Lara et al., 2003). This stage is also marked with high respiration rates due to the high levels of metabolic activity occurring during the assimilation process (Zaitseva et al., 2002). Seed storage proteins are specifically synthesized at certain periods of development and are tightly regulated. Certain seed

PAGE 20

9 storage proteins such as albumins and globulins are expressed more during the accumulation phase through the middle of the maturation phase. The last portion of seed development is the maturation and dessication phase. In this stage of development invertases are inactivated and sucrose is carried by a sucrose transporter protein into the seed coat. The sucrose is not cleaved at this point and is moved symplastically into the embryo through the plasmodesmata; this increase in sucrose concentration in the seed helps signify the end of development is nearing (Borisjuk et al., 2002). This increase in sucrose:hexose concentration helps control seed development and sends signals to the embryo to begin the maturation phase by inducing storage associated gene expression in the final stages of seed development (Smeekens, 2000). Late embryogenesis abundant (LEA) proteins are a class of storage proteins that are highly induced later in this maturation phase due to their role in acquisition of desiccation tolerance (Wobus et al., 1999; Hoekstra et al., 2001). Abscisic acid has also been shown to play a role in inducing genes such as seed storage and LEA proteins during these latter stages of seed development for protection of the seeds in the dessication process (Baker et al., 1988; Dure et al., 1989; Brocard et al., 2003). Direct interaction occurs between ABA signaling transcription factors, such as ABI3, and the transcription factors associated with seed storage proteins, which illustrates abscisic acids involvement in seed developmental processes (Luerssen et al., 1998; Stone et al., 2001; Lara et al., 2003). Maternal Plant Role in Seed Development Before fertilization, the maternal genome controls all aspects of the egg and central cell gene expression, but once fertilization occurs a zygotic mode of gene expression is induced and the paternally derived genes are thought to begin to be

PAGE 21

10 expressed (as reviewed in Chadhury and Berger, 2001). Yet, one study hypothesizes that paternal genes are still silenced during the very early stages of seed development; therefore, the maternal plant has primary control over early seed development. This was observed when 20 paternally inherited loci were not expressed during early seed development in Arabidopsis (Vielle-Calzada et al., 2000). The maternal plant can have an effect on various other seed developmental processes such as growth potential, the switch from mitotic growth to cell expansion, storage product accumulation, resource allocation, and seed structure (Weber et al., 2005). This area of research is not completely understood and may provide more detailed information about the genetic control of seed development (Chadhury and Berger, 2001). Microarray analysis was used to examine genes differentially expressed in maternal tissue in order to gain more understanding of possible roles of the maternal tissue (Sreenivasulu et al., 2002). It was observed that most of the genes found to be more highly expressed in the maternal tissue encoded enzymes involved in carbohydrate and lipid metabolism, which is expected for the maternal tissues role in providing a nutrient supply for the developing seed (Sreenivasulu et al., 2002). Several other genes were found to be highly expressed in the maternal tissue, of which the functions are unknown. These genes include a transcription factor related to FILAMENTOUS FLOWER and a methionine synthase that may play a role in transport of nutrients to the embryo (Sreenivasulu, 2002). Another study in petunia showed that normal endosperm development required expression of two MADS box genes, FBP7 and FBP11, in the maternal tissue; therefore, the maternal plant controlled formation of the seed structure (Colombo et al., 1997). Additionally, it was shown that the maternal plant is significant

PAGE 22

11 in the structure of the seed in barley, where a group of endosperm mutants that caused a phenotype of shrunken seeds also exhibited this phenotype irrespective of the paternal genotype (Felker et al., 1985). ABA influence on seed development originates from both the zygotic tissue and the maternal tissue. It has been shown that the ABA synthesized in the maternal tissue is involved in the switch to the maturation phase of seed development, whereas the zygotic tissue produces the ABA that is involved in the late seed development programs such as acquiring desiccation tolerance (Finkelstein et al., 2002; Frey et al., 2004). Additionally, through mutant studies defective in ABA synthesis in Nicotiana plumbagnifolia, it was shown that maternal ABA has critical roles in promoting early seed development, initiating seed coat pigmentation, and capsule dehiscense (Frey et al., 2004). These findings show that maternal tissue have tight developmental controls over the seed. Further investigations in genes expressed preferentially in maternal fruit tissue can provide potentially important information about seed development by revealing interactions between genes originating in maternal tissues and expression of genes controlling development in the zygotic seed tissues. Ethylene in Fruit and Seed Development and Subsequent Germination One of ethylenes main effects in fruit development is promotion of fruit maturation and abscission. It has been shown in climacteric fruit, tomato being one example, that ethylene is produced during fruit ripening which, in turn, causes a degradation of chlorophyll, leading to the change in color of fruit through maturation. At this point maturation related proteins increase and begin the conversion process of starches, organic acids and lipids into sugars (as reviewed in Giovannoni, 2001). Studies with mutants altered in ethylene sensitivity such as Never-ripe and transgenic

PAGE 23

12 CAMV35S-etr1-1 have a distinct delay in ripening and senescence which demonstrates that ethylene has a critical role in fruit maturation. These characteristics were also seen in a petunia line strongly reduced in ethylene sensitivity, 568 (Wilkinson et al., 1997). Another important role of ethylene throughout fruit development and seed germination is in the process of programmed cell death. Programmed cell death occurs in many different processes during normal progression of cellular maturation. In seeds, programmed cell death occurs in the endosperm in order to allow for the recycling of proteins during seed maturation (Young and Gallie, 2000). Ethylene acts by inducing genes that have a role in breaking down the endosperm tissue surrounding the embryo in the seeds. By using chemical blocking agents that prevented the synthesis of ethylene, programmed cell death in the endosperm was delayed (Kepczynski and Kepczynska, 1997). Ethylenes role in seed germination is still not completely known and remains a subject of controversy. Early studies suggested that ethylene is involved in breaking primary dormancy (Ketring and Morgan, 1971; van Staden et al., 1973), while others indicated that a rise in ethylene production is merely a consequence of breaking dormancy (Satoh et al., 1984; Kebczynski and Karssen, 1985). More recently it has been suggested that ethylene reduces ABA sensitivity, and therefore reduces ABA-induced seed dormancy and increases germination in Arabidopsis (Ghassemain et al., 2000). Many questions cannot be answered because the interactions between ethylene and other important hormones, such as abscisic acid, are not completely understood.

PAGE 24

13 Additional studies have led to hypotheses on how ethylene may regulate germination. One suggested mechanism developed from studies in cocklebur is that ethylene induces expression of -cyanoalanine synthase (CAS), an enzyme likely to be involved in cyanide metabolism in the action of seed germination (Hasegawa et al., 1995). These studies indicate that ethylene stimulates the action of the mitochondrial CAS, which down regulates the cyanide level and at the same time causes an increase in the amino acid pool during the pre-germination period (Hasegawa et al., 1995). This supports the idea that ethylene plays a role in a more conducive environment for germination by lowering toxic cyanide levels and allowing for essential amino acids needed in the germination process (Hasegawa et al., 1995; Maruyama et al., 1997). Another hypothesis is that ethylene promotes germination by stimulation of hydrolytic enzymes that break down the endosperm to provide an available nutrient supply for radicle emergence and subsequent germination. Ethylene was also shown to increase -1,3-glucanase induction in pea and tobacco (Petruzelli et al., 1995; Leubner-Metzger et al., 1998). The promoter region of this gene was mapped and was found to contain ethylene-response elements, which lead to the idea that the ethylene response element binding proteins are transcription factors necessary for ethylene dependent -1,3glucanase induction. The gene was also found to be positively regulated by ethylene and negatively regulated by ABA (Leubner-Metzger et al., 1998). This shows yet another incidence of interacting roles of these two hormones during seed germination. Bleecker et al. (1988) observed in Arabidopsis etr1-1 mutants that seed germination was significantly lower than wild-type seeds and that application of GA 3 overcame some of the germination deficiencies. Clevenger et al. (2004) conducted

PAGE 25

14 experiments on the transgenic line 44568, an ethylene-insensitive petunia line expressing CAMV35S-etr1-1. Seed production and germination rates were observed. Seed quality was quantified by seed weight. Homozygous 44568 seeds and seeds produced on 44568 maternal plants were slightly lower in seed weight than seeds produced on wild-type plants. Another phenotype observed in both homozygous 44568 and hemizygous seeds produced on a 44568 maternal plant was delayed fruit development. These experiments illustrate the point that the some of the phenotypes of the etr1-1 transgene are dependent upon the maternal plant (Clevenger et al., 2004). Seed germination was also observed by Clevenger et al. (2004). Seed germination from seeds produced in two different greenhouse temperatures was measured in homozygous Mitchell Diploid, etr1-1 and hemizygous seeds produced from reciprocal crosses. In the warmer temperature greenhouse, 29C, germination rates from a Mitchell or maternal Mitchell plant were about 95 percent, whereas seeds made on the 44568 maternal parent had a range of germination between 75 and 85 percent. The cool temperature greenhouse, 24C, produced seeds with lower germination rates. Mitchell Diploid and maternal Mitchell Diploid seeds had germination rates between 85 and 91 percent, while seeds produced on the maternal 44568 line had between 55 and 65 percent germination. A delay in the germination of seeds produced on 44568 was also seen in this experiment. MD seeds reached their maximum germination levels within the first five days of the study, whereas the seeds produced on the 44568 parent did not reach the maximum germination levels until ten to thirteen days after the seeds were placed in germination media. These experiments show an interesting trend, that the reduction in ethylene sensitivity is affecting something during the fruit or seed developmental

PAGE 26

15 processes on the maternal plant, which subsequently influences seed germination characteristics (Clevenger et al., 2004). Ethylene, ABA, and Sugar in Seed Development and Germination ABA has been known to have a direct role in seed development and germination. One major role of ABA in seed development is the promotion of storage protein accumulation (Brocard et al., 2003). ABA is also known to have a major role at the end of seed development by preventing vivipary, or precocious germination (Finkelstein et al, 2002). The transcription factors VP1, or the Arabidopsis homolog, ABI3, have been shown to have a regulatory role in early ovary development, late seed development, and the initiation of seed dormancy (Finkelstein and Somerville, 1990; McCarty et al., 1991 Giraudat et al., 1992; Nambara et al., 1992). This was shown through mutant analysis where the mutant plants of these B3 domain family members resulted in defects in late embryo development and germination and a reduction in storage protein levels (Hoecker et al., 1995; Suzuki et al., 2001). Also, null alleles of ABI3 and VP1 resulted in loss of ABA sensitivity, which caused vivipary in both species, Arabidopsis and maize (McCarty et al., 1989; Nambara et al., 1992). It was also shown that the repression function of VP1 does not require the B3 binding domain; therefore, it is possible that repression is also mediated by protein-protein interactions with other transcription factors (Hoecker et al., 1999). Thus the product of VP1 and ABI3 are likely key regulators in the seed maturation, developmental, and germination programs (McCarty, 1995). The mechanisms by which these genes exactly regulate seed development are still being studied (Ikeda et al., 2004; Lopez-Molina et al., 2002). Published data show that ethylene has a large role in programmed cell death during seed development. ABA has been shown to regulate this process as well. Plants treated

PAGE 27

16 to block ABA synthesis accelerated programmed cell death and increased ethylene production; this example indicates a possible antagonistic relationship between ethylene and ABA (Young and Gallie, 2000). Recent evidence has also shown that it is likely that ethylene is a negative regulator of ABA during ABA induced seed dormancy. Ethylene has been suggested to act by reducing the sensitivity of seeds to endogenous ABA levels (Ghassemain et al., 2000). The other hypothesis is that ethylene directly decreases ABA biosynthesis (Ghassemain et al., 2000). Another contributing factor to these interactions could be sugar responsive signals. Hexose signals have been implicated in regulating ABA biosynthesis and sensitivity. One specific study showed that glucose can induce expression of the ABI5 gene, a transcription factor that is differentially expressed during seed development (Cheng et al., 2002). ABI5 interacts with ABI3 to regulate ABA responsive element mediated transcription (Hobo et al., 1999). Ethylene may be countering this ABA effect by inhibiting these sugar signals (Koch, 2004). Relationships between sugars, ABA, and ethylene have been seen in many studies. The ethylene overproduction (eto1) and constitutive signaling (ctr1) ethylene mutants were found to be glucose insensitive due to the ability of seedlings to grow on levels of glucose that would normally inhibit development (Zhou et al., 1998). On the other hand, etr1, ein2, ein3 and ein6 plants, which all are affected in either ethylene perception or signaling, show glucose hypersensitivity and exhibited developmental arrest on lower than normal levels of glucose (Zhou et al., 1998). This relationship between ethylene and glucose may indicate that glucose signaling can inhibit ethylene action during seed germination (Zhou et al., 1998). Mutant analysis has provided information that shows that ethylene acts antagonistically to the glucose response, whereas ABA is a promoter.

PAGE 28

17 Double mutant analysis with gin1etr1 and gin1ein2 exhibited a resistance to developmental arrest of seedlings grown on higher levels of glucose, similar to the phenotype seen with double mutants of gin1/aba2. Because ABA and ethylene exhibit opposite roles when influencing glucose responses it is likely that ethylene affects glucose signaling through ABA to promote seed development and germination, but the molecular mechanisms of these interactions still remain unclear (Cheng et al., 2002). Conversely, another study has shown that glucose delays the seed germination process, yet this delay is not affected by ethylene sensitivity. Several transcription factors (ABI2, ABI4, and ABI5) were studied that have been deemed as ABA-responsive due to the fact one of their loss-of-function mutant phenotypes decreased ABA sensitivity in the seed. Hexokinase function, ABI2, ABI4, and ABI5 did not have a role in the glucose delay of germination; therefore, it was determined that there are other signaling cascades that involve glucose signals that could cause the delay in germination (Dekkers et al., 2004). Condensed Tannins Proanthocyanidins, condensed tannins, are colorless flavonoids that result from the condensation of flavan-3-ol units (Xie et al., 2003). These pigments are colorless and are found in the seed coat of Arabidopsis seeds but turn brown through a proposed oxidation process, though the genes controlling the oxidation have not been determined (Debeaujon et al., 2001). Additionally, Arabidopsis wild-type seeds also darken with time of storage. This occurs because the proanthocyanidins fill the large vacuole of the endothelium cells which cause the outward darker appearance of the seeds (Debeaujon et al., 2001). Though the exact function of the tannins has not been determined, it is thought that the tannins in the seed coat aid in protection against pathogens (Winkel-Shirley, 1998).

PAGE 29

18 It is also thought that the proanthocyanidins strengthen seed coat imposed dormancy and extend seed longevity by providing a stronger physical barrier structure and decreasing the permeability of the seed coat to water. (Debeaujon et al., 2000). The proanthocyanidin synthesis pathway diverges off of the anthocyanin biosynthesis pathway; therefore, many genes are common to both pathways including chalcone synthase, chalcone isomerase, flavonoid 3hydroxylase (F3H) and dihydroflavonol reductase (DFR) (Figure 2-1). Several classes of Arabidopsis mutants termed the transparent testa (tt1-tt19), transparent testa glabra (ttg1 and ttg2) and banyuls (ban) mutants are deficient in different areas of the anthocyanin and proanthocyanidin sythesis pathway (Abrahams et al., 2002). These mutants are altered in seed coat color and degree of seed dormancy (Debeaujon et al., 2003). BAN is one gene cloned in this pathway of particular importance because it is exclusive to the proanthocyanidin pathway. BAN encodes a dihydroflavonol reductase-like protein and it has been shown to function as an anthocyanidin reductase. BAN converts anthocyanidins to 2,3-cis-flavan-3-ols which condense into the colorless proanthocyanidins (Xie et al., 2003). In addition to the synthesis of condensed tannins, the regulation of the proanthocyanidin pathway has also become a focus of research. Several proteins in Arabidopsis have also been identified as regulators of proanthocyanidin biosynthesis. These include TT2, which is a MYB transcription factor, TT8, a MYC/bHLH transcripton factor, and TTG1, a WD40-repeat family protein. All positively influence BAN, and mutants in any of these genes results in a colorless seed coat devoid of proanthocyanidins, and the seeds exhibited reduced dormancy and were able to germinate

PAGE 30

19 at higher percentages than wild-type seeds (Debeaujon et al., 2000). Other regulators include TT1 and TT16, which regulate the proanthocyanidin biosynthesis in the seed body but not the chalaza/micropyle region. TT1 is a zinc finger protein, whereas TT16 is (Debeaujon et al., 2003) Figure 2-1 Proanthocyanin Synthesis Pathway the ARABIDOPSIS BSISTER MADS transcription factor, which is homologous to the FBP24 MADS protein in Petunia x hybrida (Nesi et al, 2002). tt16 mutants had a distorted shape of endothelial cells and prevented activation of the BAN promoter in the endothelium layer. Therefore, it was suggested that TT16/ABS is involved in endothelium development. A vanillin stain was used in order to study proanthocyanidin accumulation in developing seeds of tt16 mutants so that the colorless compounds could be seen by a dark red staining. Vanillin turns red upon binding to flavan-3,4-diols

PAGE 31

20 (leucoanthocyandins) and flavan-4-ols (catechins). Staining was not seen in the endothelial cells but was seen in the chalazal bulb and the micropyle (Nesi et al, 2002). Most mutants in the tt, ttg and ban classes all exhibited some degree of seed color and dormancy changes, but all of the mutants did not exhibit the same exact phenotype. The seed coat color varied from pale brown of tt10 and tt14, which had progressive browning during storage. Others mutants exhibited a pale yellow color like tt4, which is absent of flavonoids. (Debeaujon et al., 2000). ban mutants were unique in that they exhibited a grayish-green color. Another characteristic of most of these mutants was that many of the mutant seeds exhibited a reduction in seed weight and seed size, though the reason for this phenotype is not understood (Debeaujon et al., 2000). It has also been shown that the phenotypes of tt, ttg and ban mutants are all exclusive to the seed coat tissue; therefore, all phenotypes are determined by the maternal parent. Reciprocal crosses resulted in a F 1 generation with phenotypes of the maternal parent (Debeaujon et al., 2000). Most mutants exhibited increased germination over a shorter amount of storage time and are considered to have reduced dormancy (Debeaujon et al., 2000). These mutants include ttg1, which germinates at nearly 100 percent after two days in storage. The reduced dormancy is not evident in all testa mutants, though tt8, tt9, tt12 and to a lesser extent, ban, all did not germinate as well as wild-type after 27 days of storage (Debeaujon et al., 2000). Germination was also tested in reciprocal crosses and all F 1 progeny acted in a similar manner as their maternal parent (Debeaujon et al., 2000). Though there is not a direct correlation between seed color and the severity of seed coat imposed dormancy, it appears that there is some linkage seen in these mutants affected in proanthocyanidin synthesis. The most important determining factor over the color

PAGE 32

21 phenotype is the actual levels of proanthocyanidins present in the seed coat. It is believed that these colorless tannins are the barrier preventing germination (Debeaujon et al., 2000). Conclusion It is known that ethylene is involved in maturation processes of plant development. Ethylene has been widely studied in processes involved in fruit maturation (as reviewed in Giovannoni, 2001). Ethylenes impact on the development of the seed within the fruit has not been studied as extensively as fruit development. Additionally, it is not known whether ethylenes impact on seed development influences seed germination characteristics. The relationship between ethylene and other hormones, such as ABA, in specific seed developmental processes is even more difficult to determine due to the lack of research conducted in this area. Ethylene is thought to promote seed germination by acting as a negative regulator of ABA action, which is known to establish seed dormancy (Ghassemian et al., 2000). The proposed research will provide a more in-depth analysis of ethylenes action in seed development of Petunia x hybrida and the subsequent impact on seed germination. The maternal plant is thought to have a crucial role in early seed development; therefore, a focus on ethylene sensitivity of the maternal parent will be highlighted (Vielle-Calzada et al., 2000). The effect of reducing ethylene sensitivity and its result on sensitivity to ABA will also be determined to observe whether there is a relationship between these two hormones in petunia seeds.

PAGE 33

CHAPTER 3 EFFECT OF REDUCED SENSITIVITY TO ETHYLENE ON SEED DEVELOPMENT, DORMANCY AND GERMINATION Introduction Over the last 75 years seed research on several aspects of seed physiology has contributed to considerable increases in crop yield, and the understanding of seed biology continues to improve as the science of molecular biology advances. However, the seed is a complex structure and therefore, much needs to be learned about genetic interactions in order to completely understand seed development. The complex interactions that occur during seed development and dormancy have strict genetic and hormonal control (Holdworth et al., 2001). One of the hormones that significantly impacts seed development is ethylene which is also involved in many plant developmental processes including floral senescence, abscission, fruit ripening, and seed germination (as reviewed in Bleecker et al., 2000). The three main components of the angiosperm seed are the embryo, endosperm and the testa. The testa is the only part of the seed structure that is completely developed from the maternal parent; therefore, reciprocal crosses can be used as experimental tools to help determine if certain factors of seed development are more influenced by the maternally derived testa. The seed goes through three main chronological phases during development: 1. Cell division and differentiation 2. Cell enlargement through accumulation of assimilates and storage reserves and 3. Acquisition of desiccation tolerance and preparation for dormancy (Chaudhury and Berger, 2001). 22

PAGE 34

23 The first phase of seed development begins immediately after fertilization and is commonly a time of rapid cell division and differentiation. Rapid cell division typically will persist through the first half of seed development (Colombo et al., 1997). Genes involved in cell division and differentiation such as beta tubulin, and regulatory genes such as LEC1 (Lotan et al., 1998) are associated with these cell cycle processes and are highly expressed during this period of development. Once the majority of cell division is complete, the next developmental stage begins with an increase in cell expansion. In this stage seed storage proteins accumulate in the vacuole or as membrane bound protein bodies within the cell (Hoekstra et al., 2001). Lipids and starches are also produced during this phase of development (Norton et al., 1975; Wobus et al., 1999; Hoekstra et al., 2001). This assimilation and cell expansion stage is usually marked by higher expression of known seed storage genes, such as globulins and albumins, and regulatory genes, such as FUS3, that control the synthesis of these storage proteins (Kermode, 1995; Wobus and Weber, 1999). The accumulation of stored reserves continues into the last stage of development but slows down increasingly until the end of seed development. This stage is also marked with high respiration rates due to the high levels of metabolic activity occurring with the assimilation process (Zaitseva et al., 2002). The transport of assimilates in the embryonic tissue from the maternal parent plant can be used as a gauge to help determine the developmental progress of the seeds. Sucrose is generated from the maternal parent and unloaded into the maternal seed coat tissue from the fruit tissues where it is cleaved by cell wall invertases (Weber et al., 1995). The hexoses are released into the zygotic embryonic tissue by a passive, facilitated

PAGE 35

24 membrane-transport process (Buchanan et al., 2000; Borisiuk et al., 2002). The hexoses are readily taken up and used by the endosperm, cotyledons, and developing embryo during the highly energy taxing cell division phase (Weber et al., 1995). Sucrose import into the developing seed begins early in development and continues throughout the latter stages of maturation, where sucrose is cleaved less frequently than the earlier stages of development. Sucrose is transported directly into the embryonic tissue for seed storage purposes (Heim et al., 1993; Borisiuk et al., 2002). Desiccation and the acquisition of desiccation tolerance are the primary actions of the last stage of seed development (Finkelstein et al., 2002). The fruit and seeds slowly cease metabolic activity and begin to desiccate in preparation for dormancy or subsequent germination. Dehydrins are a class of genes that are highly expressed during this phase and are hypothesized to function in stabilizing membranes and protecting the cells for dehydration (Black et al., 1999). Abscisic acid has also been shown to have a role in this phase of development by inducing expression of genes, such as LEAs (late embryonic abundant), which are thought to be involved in maturation and desiccation tolerance (Bartels et al., 1988). Ethylene is known to have a role in many plant processes, either directly or through interactions with other hormonal and genetic factors. Ethylene is known to have some role in the breaking of seed dormancy of certain species (Ketring and Morgan, 1969; Globerson, 1977; Kepczynski et al., 2003), but it has not been extensively shown to have a role in the actual development of the seed (Kepczynski and Kepczynska, 1997). For example ACC content, ACC-synthase activity, ACC-oxidase in vitro activity and ethylene production were measured in chick-pea seeds. It was shown that all of these

PAGE 36

25 actions reached a maximum during the expansion phase of seed development and then slowly decreased until maturation was complete (Gallardo et al., 1999). The relationship between ethylene synthesis and development of the chick-pea seed suggests that there is a correlation between developmental progress and ethylene synthesis and action (Matilla, 2001). Seed dormancy is an important factor established during seed development due to its influence on subsequent germination. Seed dormancy is generally characterized as a state in which a viable seed will not germinate when placed in suitable temperature, moisture, and oxygen conditions which are normally considered to be adequate for germination (Roberts, 1972). There are two types of dormancy established within seeds, primary and secondary (Bewley, 1997). Primary dormancy occurs during development on the maternal plant and prevents the seed from germinating until conditions are favorable (Bewley, 1997). During primary dormancy germination is repressed until an after-ripening period is satisfied through cold storage (Leon-Kloosterziel et al., 1996). Secondary dormancy is initiated after the seed is released from the maternal plant and requires an environmental stimuli, such as light or temperature, to commence the germination processes (Foley, 2001) Seed dormancy can be induced by the embryo, endosperm, testa or a combination of these factors (Bewley, 1997). Dormancy and the subsequent germination processes are under hormonal control, and it is likely a complex interaction of several hormones. Extensive research has been conducted on abscisic acids role in maintaining seed dormancy (Zeevaart and Creelman, 1988). ABA is synthesized by the zygotic tissues in the mid to latter stages of seed development and is known to be involved in the switch from cell division and differentiation mechanisms to

PAGE 37

26 seed maturation mechanisms. ABA is known to induce a cyclin-dependent kinase inhibitor that leads to cell cycle arrest which ends the rapid growth phase and begins the maturation phase (Wang et al., 1998) Mutant analysis has also confirmed a role for ABA in maintaining seed dormancy. Mutant plants of ABI3, a B3 domain transcription factor involved in ABA signaling of Arabidopsis thaliana, produced seeds with extensively reduced seed dormancy (Koornneef et al., 1984; Nambara et al., 1992; Ooms et al., 1993). ABI3 is also orthologous to the maize Viviparous 1 protein, which when mutated also produced plants with precocious germination (McCarty et al., 1991). Over the past several years, the interactions between ethylene and ABA have been investigated more intensely. As a result, it is thought that there is an antagonistic relationship between the two hormones and that ethylene inhibits ABA signaling and aids in releasing seed dormancy (Beaudoin et al., 2000). Seed dormancy was investigated in Arabidopsis ethylene-insensitive ein2-45 seeds, which was discovered in a screen of mutated Arabidopsis seeds that suppressed the ABA resistant seed germination phenotype of abi1-1 (Beaudoin et al., 2000). EIN2, a membrane protein important to the ethylene signaling cascade, results in ethylene-insensitivity when it is mutated (Guzman and Ecker, 1990). ein2-45 seeds showed an increased sensitivity to ABA when germinated on various concentrations of ABA and had a significant reduction in seed germination of freshly harvested seeds. The ein2-45 seeds exhibited arrested germination under lower concentrations of ABA when compared to wild-type germination. It was also determined that these seed exhibited enhanced seed dormancy and were not able to germinate as well as wild-type without any post-harvest treatment (Beaudoin et al., 2000). The dormancy of ein2-45 seeds was broken after a cold stratification of 5 days

PAGE 38

27 and resulted in restoration of germination to levels comparable to wild-type seeds. Similar phenotypes of a more severe seed dormancy induction and enhanced sensitivity to ABA were also observed with etr1-1 Arabidopsis seeds (Bleecker et al., 1988; Beaudoin et al., 2000). This evidence demonstrated that there are direct interactions between ABA and ethylene in the regulation of seed dormancy and germination, and that EIN2 may act as a negative regulator of ABA sensitivity (Beaudoin et al., 2000). Seed germination occurs when a fully developed non-dormant seed is able to imbibe water, commence metabolic processes, and begin growth as a seedling (Debeaujon and Koorneef, 2000). Several parameters are known to affect the breaking of seed dormancy including gibberellic acid, chilling, and light. All of these dormancy breaking mechanisms are known to act through induction of seed germination associated gene expression (Koornneef and Karssen, 1994). It is likely that ethylene plays a major role in the control of gene expression associated with seed germination, but there is mixed results presented in past research as to whether ethylene is directly involved in the control of seed germination or indirectly through its influence on other factors. Many species appear to have increased germination with exogenous application of ethylene. For instance, studies on Trifolium subterraneum (Esashi and Leopold, 1969), Arachis hypogea (Ketring and Morgan, 1971) and Avena fatua (Adkins and Ross, 1981) all concluded that ethylene production during seed imbibition paralleled the breaking of seed dormancy. More recent research indicates that ethylene is likely to induce germination either by inducing ABA catabolism or reducing the seed tissue sensitivity to ABA (Ghassemian et al., 2000; Beaudoin et al., 2000) Another thought is that ethylene is produced as a result of programmed cell death in the endosperm tissue during

PAGE 39

28 germination (Matilla, 2001). In rice, ethylene action during germination is even more complex and seems to even be inhibitory. Since ethephon treatment of rice seeds enhanced seed dormancy, it is likely that the complex mechanisms underlying seed germination are greatly different between monocots and dicots (Southwick et al., 1986). Research Objectives The objective of this study was to characterize several physiological differences between MD and transgenic 44568 CaMV35S::etr1-1 petunia seeds with greatly reduced ethylene sensitivity. Seed development was examined in order to determine whether it was delayed in the 44568 seeds knowing that fruit maturation was visually delayed (Wilkinson et al., 1997; Clevenger et al., 2004). The physiological traits and development of seeds resulting from reciprocal and self pollinations between 44568 and MD were observed to determine if any of the seed characteristics were significantly influenced by ethylene sensitivity in the maternal parent. Physiological characterization was conducted through analysis of seed weight, and seed size measured throughout development, and seed number per fruit. Seeds produced from 44568, MD and the reciprocal crosses were analyzed for total sucrose content, and C0 2 evolution was measured from excised seeds through development as a means to characterize respiration. Molecular characterization of seed development was conducted by mRNA expression analysis of the known developmental seed markers including beta tubulin, seed storage proteins, and maturation associated genes. Another aim of this research was to investigate dormancy and germination of seeds produced from self pollinations of 44568, MD and reciprocal crosses by measuring germination rates of seeds held in cold stratification conditions over long periods of time. Previous research indicated that germination of seeds produced on female 44568 plants

PAGE 40

29 was reduced at one-month after harvest compared to MD (Clevenger et al., 2004). The degree of dormancy induction was investigated in MD, 44568 and the reciprocal crosses to determine whether the reduced germination would be overcome by a post-harvest chilling treatment. An ABA germination sensitivity assay was also used to determine if 44568 petunia seeds produced results like the ein2-45 ABA sensitivity seen in Arabidopsis seeds (Beaudoin et al., 2000). Investigation of reciprocal crosses helped to determine if ABA sensitivity is influenced exclusively by maternal tissues. Observations on germination of freshly harvested seeds and seeds held in cold storage through one year, and experiments on ABA sensitivity during germination helped determine the level of dormancy induced in all genotypes and whether ABA sensitivity was a factor in the induction and maintenance of dormancy. These results presented here shed more light on ethylenes involvement in seed development and germination. Materials and Methods Culture and Growth of Petunia x hybrida Plants Petunia x hybrida Mitchell Diploid (MD) and homozygous etr1-1-44568 (Wilkinson et al., 1997) plants were grown for seeds used in seed development studies. Seeds were germinated in trays with Fafard #2 soilless potting mix (Conrad Fafard, Inc., Agawam, MA) and placed in a misting house with an intermittent mist of 5 seconds every 2 hours. Approximately twenty-four hours later, a thin layer of vermiculite was applied to the seed trays. After three days in the mist house, the seed trays were placed in the greenhouse. All plants were grown in a year-round temperature controlled glass greenhouses with 24C/20C (+/2C) day/night temperatures. Plants were sprayed with a plant growth regulator, daminozide (Uniroyal Chemical Company, Middlebury, Conneticut) at a rate of 2500 ppm at two weeks after sowing to control excessive growth.

PAGE 41

30 Seedlings were transplanted after eight weeks into 1.5L plastic pots and drenched with four ppm of paclobutrazol (Uniroyal Chemical Company, Middlebury, Conneticut). All plants were fertilized 6 days a week (1 day a week water only) with 150 ppm of 20-4.8-16 Cal-Mg Peters soluble fertilizer (Scotts-Sierra Horticultural Products Co., Marysville OH). Seed Weight, Seed Size, and Seed Number of Petunia x hybrida Developing Seeds For determination of seed weight, seed size and seed number MD and 44568 plants were self-pollinated and reciprocally cross pollinated on the same plants. Genotypes are designated as MD, 44568, ExM (44568 x MD) and MxE (MD x 44568) (x ). Self-pollinations were conducted with flowers just before anthesis. Flowers used for reciprocal crosses were emasculated just before anthesis and pollinated the following day. No more than five fruit were allowed to develop on one plant at the same time. Fruit for seed size and seed weight experiments were collected at each time-point in development in 50 mL Falcon tubes (Fisher Scientific) and kept on ice. Seeds were extracted from the three fruit with a scalpel and forceps and combined into lots to reduce variability. Seeds from all genotypes were collected at 15, 20, 25, and 30 days after pollination (DAP). Immediately seeds were weighed in 25 seed lots so that loss of any water within the seeds would not contribute to any seed weight differences. Subsequently all 25 seeds were analyzed for seed size on a dissecting scope and slide with ruler gradations. Seed size was measured by height of the longest side of the seed and width of the opposing side. Thirty-five lots of 25 seeds were used to compute seed weight and seed number averages for all genotypes. Seed number was counted by hand and was obtained by averaging the number of seeds in 35 different fruit per cross collected from different plants. Averages

PAGE 42

31 and standard errors were computed using the mean function of data analysis statistics of Excel, Microsoft Office 2003. Sucrose Analysis of Developing Seeds Total sucrose levels of developing seeds were determined using the sucrose enzymatic assay kit (Boehringer Mannheim, Darmstadt, Germany). Seeds were collected at 15, 20, 25 and 30 days after pollination from MD, 44568, and reciprocal crosses. The company recommended protocol for tobacco leaves was used for the developing seeds and was reduced as per manufacturers recommendations to accommodate the small amount of seed tissue. Four replicates, from seeds collected at the same time, of 30 mg of lyophilized seeds per developmental time-point were used to obtain total sucrose means. The level of total sucrose was determined using a light spectrometer (SmartSpec 3000 BioRad, Hercules, CA). Results of the sucrose quantification are presented in two manners: based on sucrose content of total weight of seed lot tested (ng/g of dry weight) and then sucrose content of mature seeds adjusted to a per seed basis since ETR and ExM seeds are lighter in weight at full maturity. Averages and standard errors were computed using the mean function of data analysis statistics of Excel, Microsoft Office 2003. CO 2 Analysis of Developing Seeds CO 2 accumulation was measured by weighing out 0.2 grams of fresh MD, 44568, MxE, and ExM seeds from 3 different fruit from different plants. The seeds were collected at 15, 20, 25, and 30 DAP. 5 groupings of seeds were collected per time-point in each genotype for measurement after different amounts of accumulation time. The seeds were placed in a 12mmx32mm clear 1.5ml vial with an air-tight cap with septa (National Scientific Company, Duluth, GA). One sample of 0.5mL was removed per vial at the appropriate collection time, which included 15 minutes, 30 minutes, 1 hour, 2 hours

PAGE 43

32 and 3 hours and measured on a GOW-MAC gas chromatograph Series 580 (GOW-MAC Instrument Company, Bridgewater, NJ). The average respiration rate (measured as CO 2 evolution) of 4 separate groupings of 0.2 grams of seeds were measured for each time-point at each developmental stage. Averages and standard errors were computed using the mean function of data analysis statistics of Excel, Microsoft Office 2003. Seed Development Marker Analysis Whole fruit tissue of MD and 44568 was collected at 5, 10, 15, 20, 25 and 30 days after pollination and immediately placed in liquid nitrogen and subsequently a -80 Celsius freezer until used for RNA extraction. RNA was extracted using the phenol-chloroform method and lithium chloride precipitations (Ciardi et al., 2000). RNA was quantified by spectrophotometer readings (SmartSpec 3000 BioRad, Hercules, CA) and quality was checked by gel electrophoresis. RNA was then diluted with RNAse free water and frozen until RT-PCR analysis of the developmental markers. A set of primers was obtained for several seed development marker from Invitrogen Corporation (Carlsbad, California). GenBank Accession is designated as a CV number. Number of cycles of RT-PCR replication is in parenthesis: Beta tubulin YF-9-C01 CV300189 (29) primers: Forward-CCACATTTGTTGGCAATTCA; ReverseCAGCTCCCTCCTCGTCATAC. LEA-D29 RF-1-H08 CV300578 (22) Primers: ForwardAAGGACTTGGCTTTAAATCCAC, ReverseTCTGCTGCATATTGCCCAC; Seed maturation RF-5-C02 CV300863 primers (LEA4) (22) : ForwardGAGAAGGGGAGAAGATGACAAC, ReverseATAGTGTGTCCCAACCTGCC; 2S Albumin RF-5-G08 CV300914 (25) primers: Forward: GGTGACAGACGATGAAGAAAG, Reverse-ATACGGGGAAGGTAACGAG; 11S Globulin RF-5-G10 CV300916 (25) primers:

PAGE 44

33 Forward: TCGCCAAAAACTTCCCATC, Reverse-CCACACCACAAATTCAAATCC; Ubiquitin (22) Primers: ForwardAACATACAGAAGGAGTCAACAC, ReverseAGAAGTCACCACCACGAAG. RT-PCR analysis was conducted using the One-Step RT-PCR Analysis kit from Qiagen (Qiagen IncUSA, Valencia, California). Manufacturer protocol was followed. PCR was run with the following program: 50C for 30 minutes, 94C for 15 minutes; multiple cycles of 94C for 30 seconds, 55C for 30 seconds, and 72C for 1 minute; final incubation at 72C for ten minutes. The entire RT-PCR reaction was run out on a 1.5% acrylamide gel by electrophoresis. Pictures were taken on a Polaroid Fotodyne camera. (Polaroid Corporation, Pasadena, California). RT-PCR bands were analyzed visually. Germination Assay Seeds were tested for the ability (or inability) to germinate after various periods of 4 C cold storage, with dry desiccant to keep moisture to a minimal level. The same sets of seed of each genotype (MD, 44568 and reciprocal crosses) were tested for radicle emergence and cotyledon expansion on freshly harvested seeds and after one month, six months and 1 year of cold storage. Twenty-five seeds were placed on 100x15mm Petri plates (Fisher Corp) containing basal salt media (Jorgensen et al., 1996), which was modified slightly by removing sucrose, which can inhibit germination, and using half the concentration of MS basal salts. Eight replicate plates of each genotype, Mitchell Diploid, etr1-1, MD x etr1-1 and etr1-1 x MD were examined for each time-point after seed collection. The germination plates were grown in a temperature controlled Percival at 25 Celsius for 22 days in constant light. Radicle emergence and cotyledon expansion were recorded separately every 2 days for the entire duration of the 22 day experiment.

PAGE 45

34 Averages and standard errors were computed using the mean function of data analysis statistics of Excel, Microsoft Office 2003. ABA Germination Sensitivity Assay Seeds of MD, etr1-1, etr1-1 x MD and MD x etr1-1 were tested for the ability (or inability) to germinate on different concentrations of ABA in the germination media mixture. Seeds examined were 1 month old and had been stored in 4 C cold storage as described above which is the average time in storage needed to overcome typical after-ripening restrictions in petunia seeds. Germination media was the same as above, though the media was enhanced with ABA dissolved in 100% ethanol and added to the final concentrations of 0M, 0.01M, 0.1M, 1M, 2M and 10M. Ethanol was equalized between different concentrations. Eight plates of each concentration were used with 25 seeds per genotype described above. The germination plates were grown in a temperature controlled Percival at 25 Celsius in constant light for 14 days. Measurements were taken as described above. Averages and standard errors were computed using the mean function of data analysis statistics of Excel, Microsoft Office 2003. Results The fruit of 44568 plants show a distinct delay in development compared to MD. Wilkinson et al. (1997) first discovered the delay in fruit ripening in these plants. The 44568 fruit are slower to grow to full size and begin the browning processes during maturation later than in MD (Figure 3-1). Visually, when the seeds are excised from the fruit, they also appear to be slower to develop because browning of the seed coat due to oxidative processes begin later in 44568 than in MD (Figure 3-1). Additionally, reciprocally crossed fruit and seeds have visual characteristics like their corresponding

PAGE 46

35 maternal plants. A delay in development of the fruit may have significant impacts on the seed; therefore, further characterization of seeds of 44568, Mitchell Diploid, and the reciprocal crosses (44568 x MD (ExM) and MD x 44568 (MxE); x ) was conducted. Seed Characterization by Weight, Size, and Seed Number Several characteristics of 44568, MD, and reciprocal cross seeds were analyzed to determine if there were any major differences in physiological traits among genotypes. Seed size was measured in seeds through development of MD, 44568, and the reciprocal crosses and the average area of the seeds was computed (Figure 3-2). 44568 seed size was similar to MD throughout development, but once MD seeds reached maturity differences began to occur in the size of the seeds. Seed size increased in all genotypes until 25 days after pollination. The 44568 seeds continued development through a delayed ripening period for an additional five days (days 25-30) which resulted in a reduction in seed size. The reciprocal crosses had a similar result to the respective maternal parent. ExM seeds became reduced in size in the last five days of extended fruit development similar to seeds made by selfing 44568, whereas the MxE seeds did not exhibit any reduction in size and did not endure an extended maturation time-period. Next it was investigated whether the loss in seed size of 44568 and ExM seeds would also result in a difference in seed weight (Figure 3-3). Seed weight was measured in all genotypes of seeds at full maturity, and the 44568 and ExM seeds had reduced seed weight in comparison to MD and MxE. When water weight was eliminated the dry weight analysis revealed similar results, where 44568 and ExM had significantly less dry weight than MD and MxE seeds (Figure 3-3). Respiration (CO 2 evolution) was also measured to see if 44568 and ExM seeds continued to respire for an additional 5 days compared to MD and MxE (Figure 3-4). All genotypes had similar CO 2 levels and

PAGE 47

36 accumulation trends at 15 and 20 days after pollination throughout the three hour collection period. By 25 days after pollination, MD and MxE seeds produced levels of CO 2 that were extremely low or non-detectable. 44568 and ExM seeds still produced measurable levels of CO 2 at 25 days after pollination, yet did not have measurable levels of CO 2 by the time the seeds reached maturity at 30 days after pollination. Seed number was also quantified in order to observe whether a reduction in ethylene sensitivity had any effect on the number of seeds in each fruit since it was shown that the seeds produced on a maternal plant with reduced ethylene sensitivity were smaller in size and weight. There was no significant difference between any of the lines in seed number per fruit (Figure 3-5). Developmental Delay of Seeds Reduced in Ethylene Sensitivity Due to the delay in fruit maturation of 44568 and ExM plants, it was observed whether the seeds were also delayed throughout development. Through visual observation it did appear that the seeds were developmentally delayed because the oxidation process was slower and the seeds took longer to acquire brown color (Figure 3-1). A more specific approach was taken to confirm that there was a delay in development. Sucrose quantification was performed on developing seeds, and additionally adjusted to a per seed basis since ETR and ExM seeds are lighter in weight at full maturity (Figure 3-6). Sucrose content measured in the developing seeds indicated that homozygous and hemizygous seeds produced on a 44568 maternal plant were delayed in accumulating sucrose. Sucrose levels increased substantially between 20 and 25 days after pollination in seeds produced on the MD maternal plant. Conversely, the seeds produced on the 44568 maternal plant accumulated sucrose more slowly but eventually reached similar sucrose levels at 30 days after pollination. Sucrose levels of

PAGE 48

37 A. MD ETR MD ETR MxE ExM MxE ExM B. MD ETR MD ETR MxE ExM MxE ExM C. MD ETR MD ETR MxE ExM MxE ExM D. MD ETR MD ETR MxE ExM MxE ExM E. MD ETR MD ETR MxE ExM MxE ExM F. ETR ETR ExM ExM Figure 3-1 A picture series of fruit and seed development of all genotypes. Fruit are shown whole (column 1 and 3) and with longitudinal sections (column 2 and 4) to show developing seeds within fruit. A. 5 DAP B. 10 DAP C. 15 DAP D. 20 DAP E. 25 DAP F. 30 DAP.

PAGE 49

38 A. Seed Area0.2500.2700.2900.3100.3300.3500.3700.39015202530Days after pollinationSeed area (mm) MxE ETR MD ExM Figure 3-2 Seed size of all genotypes of seeds through development starting at 15 days after pollination through full maturity (25 days after pollination for MD and MxE and 30 days after pollination for 44568 and ExM). Seed size represented as area (height x width). A. Seed Fresh Weight00.020.040.060.080.10.120.14MDMxEETRExMGenotypeWeight per seed (mg) MD MxE ETR ExM B. Seed Dry Weight00.020.040.060.080.10.120.14MDMxEETRExMGenotypeWeight per seed (mg) MD MxE ETR ExM Figure 33 Average weight of individual seeds of MD, MxE, ETR (44568) and ExM A. Weight of seeds at fresh harvest B. Weight of seeds after moisture content is removed.

PAGE 50

39 A. CO2 Accumulation 15 DAP05101520153060120180Time of accumulation (minutes)Percent CO2 MxE ETR MD ExM B. CO2 Accumulation 20 DAP05101520153060120180Time accumulation (minutes)Percent CO2 MxE ETR MD ExM C. CO2 Accumulation 25 DAP05101520153060120180Time accumulation (minutes)Percent CO2 MxE ETR MD ExM D. CO2 Accumulation 30 DAP05101520153060120180Time Accumulation (minutes)Percent CO2 ETR ExM Figure 3-4 CO 2 Accumulation throughout 3 hours of developing seeds of MD, ETR (44568), MxE and ExM. A. CO 2 accumulation at 15 days after pollination. B. CO 2 accumulation at 20 days after pollination. C. CO 2 accumulation at 25 days after pollination. D. CO 2 accumulation at 30 days after pollination.

PAGE 51

40 Seed Number0100200300400500600700800900MD MxEETR ExMGenotypeAverage number of seeds per fruit Figure 3-5 Average number of seeds per fruit of MD, MxE, ETR (44568) and ExM. A. Sucrose Content of Developing Seeds01234515202530Days after pollinationsucrose content (ng/g dry weight) MD MxE ETR ExM B. Sucrose Content Per Mature Seed00.00050.0010.00150.0020.00250.00325 D MD25 D MxE30 D ETR 30 D ExMGenotype/TimepointSucrose Content(ng per seed) Figure 3-6. Sucrose content of seeds of all genotypes. A. Total sucrose content of developing seeds from 15 days after pollination through full maturity. (25 days after pollination for MD and MxE; 30 days after pollination for ETR (44568) and ExM). A. Sucrose content of mature seeds adjusted to a per seed basis.

PAGE 52

41 mature seeds adjusted to a per seed content indicated that 44568 and ExM seeds did not have a statistical difference in sucrose content at the end of development compared to MD and MxE. To further confirm that 44568 and ExM seeds were developmentally delayed, mRNA expression analysis of known developmental markers was conducted (Figure 3-7). Markers were chosen based on their differing expression patterns through development and their availability from sequenced petunia cDNA libraries. Beta tubulin, a cell-cycle related structural protein, is used as a seed developmental physiological marker in pepper since expression consistently decreased just before complete seed desiccation tolerance (Portis et al., 1999). The seed storage genes, 11S globulin and 2S albumin, are known to begin accumulation slightly later in seed development and continue through the final maturation phases (Norton and Harris, 1975; Pomeroy, 1991; Wobus et al., 1999; Hoekstra et al., 2001). 11S globulin and 2S albumin are predicted to be the most predominant storage proteins in petunia seeds as seen by the extreme redundancy in the petunia cDNA libraries (personal observations). LEA proteins also begin to accumulate in the mid to latter stages of seed development. In many cases, the timing of LEA mRNA and protein accumulation is correlated with the start of the seed-desiccation process and associated with elevated in vivo ABA levels. The products of these genes are thought to function in protecting cells from dehydration (Baker et al., 1988; Dure et al., 1989; Brocard et al., 2003). When expression of these markers was conducted it was observed that beta-tubulin mRNA expression continued later in 44568 fruit and seed tissues compared to MD. 11S Globulin mRNA expression was visible at 5 days after pollination in MD but was not observed in the 44568 line until 10 days after

PAGE 53

42 pollination. 2S albumin expression was also slightly delayed in 44568, a small amount of expression can be observed in MD at 5 days after pollination but is not seen in 44568. LEA4 and LEA D-29 mRNA expression did not have as much of a discrepancy between the two genotypes and the expression patterns appear to be induced in a similar manner. The Effect of Ethylene Sensitivity on Seed Germination Since it was observed that the seeds produced on a 44568 plant have delayed development, it was investigated whether this delay would also have any impact on dormancy and subsequent germination. Dormancy can be measured by observing germination percentages after specified periods of dry storage (Leon-Kloosterziel et al., 1996). Seeds produced from self-pollinated MD, 44568, and reciprocal crosses of the two were tested for germination at fresh harvest and after 1 month, 6 months, and 1 year of 4C storage (Figure 3-8). Seeds from both reciprocal crosses and 44568 had lower germination percentages than MD, with homozygous 44568 having the lowest germination rates at fresh harvest. After one month of storage in 4C, all seeds containing the etr1-1 transgene germinated at similar rates, and all had significantly lower germination than MD. After six months and one year of storage, all genotypes had similar germination rates, and seeds containing the etr1-1 transgene did not germinate differently from MD. ABA Sensitivity and Germination Since the after ripening requirement and dormancy were both impacted in all homozygous and hemizygous 44568 seeds, another germination assay was conducted to see if these genotypes were also altered in their sensitivity to exogenous ABA. Seed germination of all genotypes was tested on increasing concentrations of ABA (Figure 3-9). Homozygous and hemizygous 44568 seeds had similar levels of ABA sensitivity, and

PAGE 54

43 A. Beta tubulin 5 10 15 20 25 30 MD ETR B. Seed Maturation (LEA4) 5 10 15 20 25 30 MD ETR C. LEA Protein D-29 5 10 15 20 25 30 MD ETR D. 11S Globulin 5 10 15 20 25 30 MD ETR E. 2S Albumin 5 10 15 20 25 30 MD ETR F. Ubiquitin 5 10 15 20 25 30 MD ETR Figure 3-7 RT-PCR analysis of seed developmental markers of whole MD and ETR (44568) fruit tissue. Lanes are: ladder, MD 5, MD 10, MD 15, MD 20, MD 25, space, ETR 5, ETR 10, ETR 15, ETR 20, ETR 25, and ETR 30 days after pollination whole fruit. A. Beta tubulin. B. Seed Maturation (LEA4). C. Late Embryogenesis Abundant Protein D-29. D. 11S Globulin storage protein. E. 2S Albumin storage protein. F. Ubiquitinloading control all of these genotypes had increased sensitivity to ABA compared to MD. When observing MD germination as cotyledon expansion, the germination rates of MD were significantly higher at 0, 0.01, and 0.1 M of ABA when compared to 44568, ExM and MxE. Germination of all genotypes reduced dramatically at 1 and 2 M of ABA. When germination was observed as radicle emergence MD seeds had an even more dramatic tolerance to ABA than the other genotypes. MD radicles were able to emerge at all concentrations of ABA at significantly higher levels than 44568, ExM and MxE.

PAGE 55

44 A. Fresh Seed GerminationCotyledon Expansion020406080100246810121416182022Days after platingPercent Germination MxE ETR MD ExM B. Fresh Seed GerminationRadicle Emergence020406080100246810121416182022Days after platingPercent Emergence MxE ETR MD ExM C. 1 Month Old Seed GerminationCotyledon Expansion020406080100246810121416182022Days after platingPercent Germination MxE ETR MD ExM D. 1 Month Old Seed GerminationRadicle Emergence020406080100246810121416182022Days after PlatingPercent Emergence MxE ETR MD ExM E. 6 Month Old Seed GerminationCotyledon Expansion020406080100246810121416182022Days after platingPercent Germination MxE ETR MD ExM F. 6 Month Old Seed GerminationRadicle Emergence020406080100246810121416182022Days after platingPercent Emergence MxE ETR MD ExM Figure 3-8 Germination of seeds of all genotypes after various storage periods. Germination measured by cotyledon expansion and radicle emergence separately. A. and B. Germination of freshly harvested seeds.C. and D. Germination of seeds after one month of cold storage.E. and F. Germination of seeds after six months of cold storage. G. and H. Germination of seeds after 1 year of cold storage.

PAGE 56

45 Figure 3-8 Continued G. 1 Year Old Seed GerminationCotyledon Expansion020406080100246810121416182022Days after platingPercent Germination MxE ETR MD ExM H. 1 Year Old Seed GerminationRadicle Emergence020406080100246810121416182022Days after platingPercent emergence MxE ETR MD ExM Discussion The physiological characteristics of seeds altered in their sensitivity to ethylene were analyzed by seed size, weight, and number. It was observed that seed size and weight was only affected in seeds produced on a maternal parent carrying the etr1-1 transgene. The consequence of the reduction of ethylene sensitivity of the maternal parent resulted in delayed fruit and seed ripening, and subsequently a loss in seed size during the extended ripening time-period. Seeds with the extended ripening period were also lower in seed weight. This loss in seed weight occurs in the five days of extended development since the loss of seed size was observed during this period (Figure 3-2). An explanation for the loss in seed weight of the 44568 and ExM seeds is that these seeds had to endure an additional five days of metabolic activity since fruit ripening and seed dessication was not completed. This extended metabolic period used additional stored material which could include sugars, lipids or any other form of reserve, resulting in the loss of seed size. Metabolic activity in these samples was observed through CO 2 evolution throughout a developmental time-course in seeds of all the genotypes. 44568 and ExM seeds continued to respire throughout the additional five day extended ripening period. These results parallel physiological traits seen in other systems where, as the

PAGE 57

46 A. ABA GerminationCotyledon Expansion020406080100[0][0.01][0.1][1][2]ABA ConcentrationPercent Germination (at 14 Days) MxE ETR MD ExM B. ABA GerminationRadicle Emergence020406080100[0][0.01][0.1][1][2]ABA ConcentrationPercent Germination (at 14 Days) MxE ETR MD ExM Figure 3-9 ABA sensitivity of germinating 1 month old seeds of MD, ETR (44568), MxE and ExM. Measurement of germination by cotyledon expansion and radicle emergence separately. A. Germination measured based on cotyledon expansion 14 days after plating. B. Germination based on radicle emergence after 14 days after plating. development of the seed progresses, respiration decreases (Weber et al., 2005). Therefore, the CO 2 levels given off by the seeds are a good indication of the stage of development, indicating that 44568 and ExM seeds are delayed in development compared to MD and MxE.

PAGE 58

47 Analysis of sucrose levels was also conducted on developing seeds of all genotypes in order to determine the progress of development over time. Sucrose levels were slower to accumulate in seeds produced on a maternal plant carrying the etr1-1 transgene. From previous research conducted on sucrose levels through maize seed development it was shown that sucrose levels are lower at the beginning of seed development and then levels increase once the cell division phases slow. The higher sucrose levels generate embryonic sink strength and further embryo development (Weber et al., 1996; 2005). Sucrose likely has several roles in seed development, one to act as a nutrient sugar for the developing embryo and the other to act as one of the signaling molecules that induce storage assimilation gene expression (Koch, 2004). Sucrose accumulation may also be associated with stress tolerance during seed dessication (Hoekstra et al., 2001). The sucrose levels increase towards the end of seed development in order to aid in membrane protection during the drying down of the seeds (Hoekstra et al., 2001). Since sucrose levels were delayed in accumulating within the seeds of 44568 and ExM, it is likely that the developing embryo does not receive signals to begin storage protein accumulation and maturation until a later time-point in development. Lastly, developmental timing in seeds reduced in ethylene sensitivity was observed through mRNA expression analysis of known seed developmental markers. Beta tubulin expression in pepper seeds consistently decreased just before complete seed desiccation tolerance (Portis et al., 1999). Since higher expression of beta tubulin was extended in 44568 seed tissue through 25 DAP in comparison to MD, it can be inferred that seed desiccation tolerance may be acquired later in development in the 44568 seeds than it does in MD. mRNA for 11S globulin was slightly slower to accumulate in 44568

PAGE 59

48 compared to MD which indicates that the cell expansion/storage accumulation phases started slightly later in 44568 in comparison to MD. 11S Globulin expression was visible at 5 days after pollination in MD, but was not shown in the 44568 line until 10 days after pollination. This five day discrepancy between 44568 and MD developmental marker expression parallels the five day extended fruit ripening delay observed much later. These data, together with the sucrose and CO 2 results, clearly indicate that 44568 and ExM seeds are developmentally delayed compared to MD and MxE; thus the loss of ethylene sensitivity of the maternal plant is the most significant factor in causing this delay. Since development was delayed in seeds produced on a maternal plant carrying the etr1-1 transgene, the germination phenotype of all the genotypes was observed. The germination results revealed that all genotypes carrying the etr1-1 transgene were affected in germination characteristics. 44568 and reciprocally crossed seeds all had significantly reduced germination rates compared MD at fresh harvest and after one month of storage. Germination rates of 44568 and reciprocally crossed seeds all recovered after six months and one year of cold storage. These data provide two interesting observations. First, hemizygous and homozygous 44568 seeds have a longer after-ripening requirement than MD. Since after-ripening is a dormancy breaking agent, the greater after-ripening requirement of lines with reduced sensitivity to ethylene confirms that there is heightened primary dormancy (Koorneef and Karssen, 1994). Second, unlike previous findings with the maternal role in developmental delay, the maternal parent does not completely determine subsequent germination characteristics. The level of ethylene sensitivity of the seeds zygotic tissue also plays an important role on the impact of germination. Through previous research conducted on maternal tissue

PAGE 60

49 role in seed developmental processes, it has been shown that the maternal tissues play a significant role in early developmental processes (Vielle-Calzada et al., 2000). Additionally, studies with ABA have revealed that early ABA synthesis, which occurs at the end of the cell division phase, in maternal tissues is involved more in earlier seed developmental processes such as preventing early germination and aids in progression into the maturation phase of embryogenesis (Finkelstein et al., 2002). Conversely, latter ABA synthesis in zygotic tissues is involved in seed maturation programs such as acquiring dessication tolerance (Finkelstein et al., 2002; Frey et al., 2004). These observations help explain the results of this research, where the sensitivity of the maternal tissue had more of an affect than the overall ethylene sensitivity of the zygotic tissue on the developmental timing of the seeds. Yet, later processes in seed development, such as dormancy acquisition, were affected more by the ethylene sensitivity of the zygotic tissue. This would explain the longer after-ripening requirements of all genotypes reduced in ethylene sensitivity, regardless of the maternal parent genotype. Lastly, since seeds carrying the etr1-1 transgene exhibited enhanced seed dormancy, an additional germination assay was conducted to determine the sensitivity to exogenously applied ABA. The results of this assay were similar to the results of the standard germination test in that the overall ethylene sensitivity of the zygotic tissue played a major role in the phenotype. It was determined that all seeds carrying the etr1-1 transgene appeared to exhibit increased sensitivity to ABA. An important issue to consider about the results of this experiment is that endogenous levels of ABA may have an impact on the sensitivity assay. If levels of endogenous ABA are significantly higher in the transgenic lines compared to wild-type, then it would be difficult to determine that

PAGE 61

50 the transgenic seeds are hypersensitive to ABA compared to wild-type. Yet, when mature petunia etr1-1 seeds where measured for ABA content it did not appear to have significantly different levels of ABA than MD seeds (Barry, 2004). Hemizygous seeds did not exhibit different sensitivity to the ABA than the homozygous 44568 seeds; therefore, the genotype of the maternal plant does not play a major role in the ABA sensitivity phenotype. These data confirm results from previous research conducted on Arabidopsis seeds reduced in ethylene sensitivity, which also exhibited increased sensitivity to exogenous ABA during a germination assay (Beaudoin et al., 2000). This evidence demonstrates that there likely is a direct interaction between ABA and ethylene in the involvement of seed dormancy and germination in petunia seeds similar to Arabidopsis (Beaudoin et al., 2000). An item of interest that arises from the germination assays is that there still exists a percentage of seeds reduced in ethylene sensitivity that have the capability of germinating. For example, approximately 50-60% of seeds carrying the etr1-1 transgene still germinate at fresh harvest without any after-ripening time-period. Similarly, 50-60% of the seeds reduced in ethylene sensitivity are able to germinate with the lowest concentration of ABA, 0.01m, and approximately 20-50% at 0.1m of ABA. These observations lead to the question as to why some seeds do not exhibit as strong as a phenotype as other seeds when all of the seeds are reduced in ethylene sensitivity. One explanation for the phenomenon is the position of the seeds within the fruit. The petunia fruit is attached to the maternal plant at the base. Additionally, when fruit maturation begins the tip at the top of the fruit opens and begins to dry down from the top to the bottom. Therefore, seeds positioned at the top of the plant may be receiving less

PAGE 62

51 maternal resources. One of these resources could be the germination stimulatory hormone, gibberellic acid. A theory exists in which GA is also involved in an antagonistic relationship with ABA in order to break dormancy and induce germination (Karssen, 1995). It is also known that when homozygous etr1-1 petunia seeds are imbibed in GA 3 that germination levels increase dramatically (Bleecker et al., 1988). Therefore, some seeds may receive more resources, such as GA, from the maternal plant than others and this could contribute to the discrepancy in phenotype between the seeds reduced in ethylene sensitivity. Conclusion Ethylene has been shown to play a significant role in several aspects of plant development. However, there has been little conclusive evidence that it plays a major role in several aspects of seed development, germination and dormancy in a single plant species. The data presented here provide evidence that ethylene plays an important role in all of these developmental processes. Seed physiological characteristics that were altered by the reduction of ethylene sensitivity included a reduction in seed weight and size of seeds produced on a maternal plant carrying the etr1-1 transgene. Seed development is greatly influenced by a reduction in ethylene sensitivity of the maternal plant as seen through delayed sucrose accumulation and an extended time-period of respiration. Since maternal tissue has been shown to have some control of early seed development in petunia (Colombo et al., 1997), it is not surprising that the maternal tissues sensitivity to ethylene plays a major role in the developmental timing of the seeds. Conversely, the maternal plant does not completely determine the subsequent germination and ABA sensitivity phenotypes seen in the seeds reduced in ethylene

PAGE 63

52 sensitivity. Dormancy was extended in all seeds carry the etr1-1 transgene. ABA sensitivity during seed germination was also heightened in the homozygous and hemizygous 44568 genotypes compared to MD. These data confirmed the concept that hormone interactions in both maternal and zygotic tissues play a major role in the severity of dormancy and subsequent initiation of seed germination. All of the data presented in this research provided evidence that ethylene is indeed intricately involved in seed developmental timing and germination processes of petunia seeds, and it is likely through interactions with other hormones such as ABA. The extent of the maternal plants role on seed developmental processes varies. The maternal plant likely plays more of a major role in the beginning of seed development and less at the end of development when dormancy is induced.

PAGE 64

CHAPTER 4 MICROARRAY ANALYSIS AND CONDENSED TANNIN CONTENT OF PETUNIA SEEDS AFFECTED IN ETHYLENE SENSITIVITY Introduction Angiosperm fruit and seed development is mediated by an assortment of factors including hormones, storage proteins, fatty acid and carbohydrates; therefore, it has been exceedingly difficult to monitor all or even several of the genes involved in these processes at one point in development (Harada, 1997). It is also known that ethylene has diverse roles during growth and development of plants. Ethylene is especially integral to fruit development and ripening processes (Ecker, 1995; Giovannoni, 2001). Ethylenes substantial role in fruit ripening is illustrated in the delayed fruit ripening phenotype observed in ethylene perception mutants in various species including Arabidopsis, tomato and petunia (Bleecker et al., 1988). Since ethylene is involved in an array of plant responses, it is likely a complex interaction of gene regulation and expression occur during different plant processes. Identification of novel genes associated with ethylenes function in ripening fruit and seeds will help develop a more complete understanding of the physiological role of ethylene in late fruit and seed development. Microarray analysis is a powerful tool to examine the expression of hundreds of genes at the same time. This technology has tremendous advantage over traditional mRNA expression methods that usually analyze one gene at a time (Ekins and Chu, 1999). Microarray analysis has already been used to examine many plant growth and 53

PAGE 65

54 development processes including light regulation, wounding response, pathogen infection and hormone defense responses (Zhong and Burns, 2003). A cDNA microarray was developed to help screen for gene expression differences between MD and 44568 fruit and seeds at 25 days after pollination. A set of 384 cDNAs from sequenced petunia cDNA libraries made from fruit, seeds, and whole flowers were used to make the microarray. The focus of the study was to identify a subset of genes with high levels of differential expression between 44568 and MD. A goal was to also determine if the mRNA expression patterns of these genes paralleled the developmental delay seen in seeds with a maternal parent with reduced ethylene sensitivity or contribute to the stronger induction of dormancy in the homozygous 44568 and hemizygous seeds (Chapter 3). Additionally, the results of the microarray experiments led to further investigation into a pathway involved in secondary metabolism. Proanthocyanidins, or condensed tannins, are compounds found in the seed coat that turn brown upon oxidation (Debeaujon et al., 2000; Nesi et al., 2001). These tannins are known to help provide a protective barrier for the seed, but they are also thought to be involved in altering seed coat imposed dormancy by reducing the permeability of the seed coat (Debeaujon et al., 2000). To the best of our knowledge, there are no present published works that focus on any kind of ethylene involvement in the proanthocyanidin pathway. Several characteristics of the 44568 transgenic seeds suggest that there may be altered levels of proanthocyanidins. These include increased seed dormancy, visual differences in seed coat color at the end of development, and differential regulation of expression of genes

PAGE 66

55 encoding enzymes and transcriptional regulators of the anthocyanin/proanthocyanidin pathway. Research Objectives The main objective of this research was to isolate a set of genes with expression differences between 44568 and MD fruit and seeds at a late time-point in fruit and seed development through microarray analysis. The time-point chosen, 25 days after pollination, represents the point in fruit development where 44568 and MD are the most visually different, where MD is fully brown and ripe and 44568 fruit are just beginning the browning process. A smaller subset of genes chosen from the array results will be investigated in further detail through RT-PCR expression analysis in a seed developmental time series from 20 days after pollination to maturity. The last objective was to further examine expression of genes involved in the proanthocyanidin synthesis pathway to determine if this pathway is altered and could contribute to the stronger induction of dormancy in the 44568 and hemizygous lines resulting from reciprocal crosses with MD. Material and Methods Culture and Growth of Petunia x hybrida Plants Petunia x hybrida Mitchell Diploid (MD), etr1-1-44568 (Wilkinson et al., 1997), and ein2 RNAi (Shibuya et al., 2004) plants were grown for fruit and seeds used in the microarray experiments and the subsequent confirmation by RT-PCR. Seeds of the three lines were imbibed in 100 ppm of GA 3 overnight to promote uniform germination. Seeds were then sown in 72 cell trays with Fafard #2 soilless potting mix (Conrad Fafard, Inc., Agawam, MA) and placed in a misting house with an intermittent mist of 5 seconds every 2 hours. Approximately twenty-four hours later, a thin layer of vermiculite was applied

PAGE 67

56 to the seed trays. After three days in the mist house, the seed trays were placed in the greenhouse. All plants were grown in a year-round temperature controlled glass greenhouses with day/night temperatures of 24/20C (+/2C). Plants were sprayed with a plant growth regulator, daminozide (Uniroyal Chemical Company, Middlebury, Connecticut) at a rate of 2500 ppm at two weeks after sowing to control excessive elongation of seedlings. The seedlings were transplanted after eight weeks into six-inch plastic pots and drenched with four ppm of paclobutrazol (Uniroyal Chemical Company, Middlebury, Connecticut). Growth regulators were stopped after this point to allow for pollination of plants, so that the growth regulators did not have an effect on fruit or seed development. Plants were placed on greenhouse benches in a completely randomized design. All plants were fertilized 6 days a week (with 1 day/week water only) with 150 ppm of 20-4.8-16 Cal-Mg Peters soluble fertilizer (Scotts-Sierra Horticultural Products Co., Marysville OH). All lines were self-pollinated for whole fruit tissue (WF), maternal fruit tissue (MT) and seeds for all experiments. Additionally, 44568 and MD were reciprocally crossed for fruit and seed tissue: MxE and ExM (x ). Petunia x hybrida cDNA Libraries A subset of cDNA clones were selected from five different Petunia x hybrida libraries: Young Fruit (YF), Ripe Fruit (RF), Developmental Flower Stages (DevA), Ethylene Treated Whole Flowers (C2H4), and Post Pollination (PP) (Underwood, 2003). A list of the 384 cDNA clones and source libraries used for microarray analysis is outlined in Appendix A. The genes were selected based on their putative involvement in transcription, hormones, metabolism, stress response and seed development. Focus was placed on genes involved in transcription, such as MADS box transcription factors, 14-3-3 genes, bZip transcription factors and other unknown or putative transcription factors, to

PAGE 68

57 identify altered transcriptional control during seed development. Also, genes encoding enzymes of metabolic pathways were highlighted in the array list, such as enzymes involved in carotenoid synthesis, gibberellin synthesis, and jasmonic acid synthesis, to identify increases in metabolic substrates that could be affecting seed development and germination. cDNA Microarray Fabrication Clones chosen for microarray analysis were picked from glycerol stocks and grown in 96-well plates containing 150 L Luria Broth with Ampicillin (50 mg/mL). Cultures were grown overnight in a 37C incubator, without shaking or agitation. PCR was conducted to amplify the cDNA product by inoculating 49 l of PCR mix (containing T3/T7 primers, dNTPs and 10X PCR buffer) with 2 l of the bacterial culture. The PCR temperature cycling program used was: 95C for five minutes, followed by 35 cycles of 94C for one minute, 53C for one minute, and 72C for one minute, and a final step of 72C for seven minutes. PCR products were then analyzed by gel electrophoresis to verify the presence of intact PCR product. The PCR product was then stored in a -20C freezer until arraying. A portion of the PCR reaction, 22 L, was transferred to 384-well plates and mixed with a spotting solution of 20X SSC and 20% sarkosyl immediately before array construction. Microarray Gold Seal glass slides (Corning, Toledo, OH) were processed using a modified protocol of Eisen and Brown (1999). The following steps are the modified steps: slides were gently agitated in 100% ethanol for two hours using a metal slide rack and glass chamber (Shandon Lipshaw, Pittsburg, PA). Immediately after the ethanol rinse, the slides were quickly transferred to several glass chambers full of filter-sterilized double distilled water and rinsed with agitation for 30 seconds at room temperature. The

PAGE 69

58 slides were coated by placing them in a separate glass chamber of 10% poly-L-lysine/10%PBS (Sigma-Aldrich Corp, St. Louis, MO) for one hour. The slides were removed and placed on a table-top bench at room temperature and allowed to dry overnight, with a cover to prevent dust from settling on the freshly coated slides. cDNAs were arrayed onto poly-L-lysine coated slides using an Affymetrix 418 Robotic four-pin Arrayer (Santa Clara, CA). Each spot had a distance of 550m away from the neighboring spot, and the entire 384 well plate was replicated three times on one slide. Arrayed slides were stored in a dark black slide box within another plastic box containing Drie-Rite dessicant (Xenia, OH). Array slides were not stored for more than two weeks without use. Directly before array hybridization the slides were processed by waving them over hot steam for 10 seconds, followed by a 10 minute rinse with 0.2% SDS with agitation and several rinses in filter-sterilized double distilled water. Slides were placed in boiling water for denaturation for 10 minutes, and lastly slides were placed in a cold ethanol rinse for 30 seconds. Microarray Hybridization Whole fruit of 44568 and MD were collected at 25 days after pollination (DAP). Three whole fruit (WF) of each genotype were ground in liquid nitrogen with a mortar and pestle for RNA extraction and stored in a -80C freezer. For the maternal tissue array experiments, an additional five fruit were opened and the seeds were removed by scalpel, and the internal maternal pith tissue (MT) was frozen for RNA extraction and stored in a -80C freezer. Five fruit were combined to reduce variability between each fruit. 0.5 gram of each tissue was ground in a mortar and pestle and used for RNA extraction using the phenol-chloroform method and lithium chloride precipitations (Ciardi et al., 2000). RNA was cleaned using the Qiagen RNeasy kit and manufacturer

PAGE 70

59 protocol was followed (Qiagen Inc, Valencia, CA). RNA was quantified by spectrophotometer readings SmartSpec 3000 (BioRad, Hercules, CA) and quality was checked by gel electrophoresis. The array probes were labeled using an Array 900 labeling kit (Genisphere, Hatsfield, PA). 2.5g of total RNA from each sample was used for labeling each dye and the manufacturer protocol was followed. Two arrays slides each were used for the following experiments: 1. Probe 1MD 25 DAP WF vs. Probe 244568 25 DAP WF and 2. Probe 1MD 25 DAP MT vs. Probe 244568 25 DAP MT. Hybridized microarrays were scanned by an Agilent DNA Microarray scanner and dye signals were analyzed using Agilents Feature Extraction Software (Agilent Corp., Palo Alto, CA). Data were analyzed for the 44568 experiments as an average ratio of 5-6 spots. For the two slide 44568 experiments 5 to 6 spots had to show higher expression to be included as differentially regulated. Data in tables are presented as the average ratio. The fold difference in expression is computed as: 2 average ratio (2 to the power of the average ratio of spots). cDNAs with an average ratio of 1.0 or higher are considered differentially expressed, which would represent a 2 fold difference in expression. RT-PCR Confirmation of Microarray Experiments In order to verify the results of the microarray hybridizations, RT-PCR was conducted on several of the cDNA clones that showed putative differential expression in the array experiments. For this analysis total RNA was extracted from whole fruit tissue of MD 20 DAP, MD 25 DAP, 44568 20 DAP, 44568 25 DAP and 44568 30 DAP. RNA was quantified by using a SmartSpec 3000 spectrophotometer readings (BioRad, Hercules, CA) and quality was checked by gel electrophoresis. RT-PCR analysis was conducted following the manufacturer protocol of the One-Step RT-PCR Analysis kit from Qiagen (Qiagen IncUSA, Valencia, California). The entire RT-PCR reaction was

PAGE 71

60 electrophoresed on a 1.5% acrylamide gel. A set of custom primers was obtained for each individual cDNA from the Invitrogen Corporation (Carlsbad, CA). The number of thermal cycles of RT-PCR varied based on the amount of expression of each gene in the fruit tissue. Genes that were highly expressed in the fruit tissue required fewer cycles in order to visualize the RT-PCR band. The numbers of cycles used in the RT-PCR reaction are represented in parenthesis, and NCBI accession numbers are given following description of gene: Beta Xylosidase GV298846 (25 Cycles) Primers: ForwardTGTGGGTTGGTTATCCTGGT ReverseACTGGGCCCCTGTAAAATCT; FBP24 CV299636 (32 Cycles) Primers: ForwardGGGTATCTGGGCAGTGAAAC, ReverseTAAATCGGCCATAACCCAAA; Ent-Kaurene Oxidase CV299619 (25) YF-3R-F07: ForwardGGCTTGAAGTTGCAGTAGTTC, ReverseCGAATCCACATGATAAAGAGC; Dehydration Induced Protein CV300614 (27 Cycles) Primers: Forward-GAGGCCAGAAAATGGGAAAT ReverseTCAGGAAGGAAATGGCAAAC; 4-hydroxypheylpyruvate dioxygenase CV294459 (25) Primers: Forward GAAGATGTTGGCACTGCTGA, ReverseACATCCCCTGCCCTACTCTT; Glutathione-S-transferase CV299433 (28) Primers: ForwardCATAGCAGCAGCACAAGGAG, ReverseTTGCCTTTGCTGCAATTCTT; Beta carotene hydroxylase CV301281 (29) Primers: ForwardAACTGCCATCACTCCACTCC, ReverseTCATCCTCGAGAACAAAGCA; Pectinerase CV300751 (23) Primers: Forward: TGCAAGCAGTGAGTGTGTGA, ReverseTCTCGTTTGTGTCCCCTTTC; RPT2 CV298420 (29) Primers: ForwardGTGGACGGAAGAGCTATCCA, ReverseTCCCTGAGTGGTCACGTACA; Alcohol Dehydrogenase CV292993 (25) C2H4-5-A02

PAGE 72

61 Primers: ForwardATAGCAGGGGCTTCAAGGAT, ReverseAGCCATCATGGACACATTCA; Expansin CV300919 RF-5-H01 (25) PrimersForwardCTTGCTTCTACCTGCGCTTT, Reverse-CCACAACCAGCTCCATTCTT; Oxygen evolving enhancer protein CV299423 PP-4-E12 (30) Primers: ForwardGCAGCCAGGCTATCTTGTTC, ReverseGGCAAAGCTTTTCAACACCTC; Seed imbibition CV298461 PP-8-A11 (30) Primers: ForwardCCTGGTCGACCTACAAAGGA, ReverseACATCACTGCGCCTGACATA; Seed maturation CV300863 RF-5-C02 primers (LEA4) (21) : ForwardGAGAAGGGGAGAAGATGACAAC, ReverseATAGTGTGTCCCAACCTGCC; LEA-D29 CV300578 RF-1-H08 (21) Primers: ForwardAAGGACTTGGCTTTAAATCCAC, ReverseTCTGCTGCATATTGCCCAC Ubiquitin Primers: ForwardAACATACAGAAGGAGTCAACAC, ReverseAGAAGTCACCACCACGAAG. PCR was run with the following program: 50C for 30 minutes, 94C for 15 minutes; multiple cycles of 94C for 30 seconds, 55C for 30 seconds, and 72C for 1 minute; final incubation at 72C for ten minutes. The entire RT-PCR reaction was run out on a 1.5% acrylamide gel by electrophoresis. Pictures were taken on a Polaroid Fotodyne camera. (Polaroid Corporation, Pasadena, California). Data was analyzed visually. RT-PCR of Condensed Tannin Synthesis Genes RT-PCR was conducted on genes encoding enzymes involved in the condensed tannin synthesis pathway. RNA was extracted from seed tissue produced from self-pollinations and reciprocal crosses at: 20, 22, 24, 26, 28 and 30 days after pollination in 44568, MD, MxE and ExM. RNA was extracted using a phenol-chloroform method with lithium chloride precipitations (Ciardi et al., 2000). RNA was quantified by

PAGE 73

62 spectrophotometer readings SmartSpec 3000 (BioRad, Hercules, CA) and quality was checked by gel electrophoresis. RT-PCR analysis was conducted with a One-Step RT-PCR Analysis kit from (Qiagen IncUSA, Valencia, California). Manufacturers protocol was followed. The entire RT-PCR reaction was electrophoresed on a 1.5% acrylamide gel. A set of primers was obtained for each individual gene verified from Invitrogen Corporation (Carlsbad, CA) and the numbers of cycles in the RT-PCR reaction are designated in parenthesis: Dihydroflavonol reductase-like CV295572 (DFR-like-32) Petunia-3-C03 Primers: ForwardTTGATCAAGCGCCTTCTCTT; ReverseGGCAGTGTGGAAAACACCTT Dihydroflavonol reductase CV292934 (DFR-32) C2H4-4-D01: ForwardCTCGCCCCACTGTACTCTTC; ReverseGGCTCTGTTCGTTCATCCAT; FBP24 CV299636 (32 Cycles) Primers: ForwardGGGTATCTGGGCAGTGAAAC, ReverseTAAATCGGCCATAACCCAAA. PCR reactions were conducted with the following program: 50C for 30 minutes, 94C for 15 minutes; multiple cycles of 94C for 30 seconds, 55C for 30 seconds, and 72C for 1 minute; final incubation at 72C for ten minutes. The entire RT-PCR reaction was run out on a 1.5% acrylamide gel. Pictures were taken on a Polaroid Fotodyne camera. (Polaroid Corporation, Pasadena, California). Pictures were analyzed visually. Vanillin Staining of Seeds Vanillin stains red upon contact with condensed tannins. Fresh and 1-month old seeds of MD, 44568, MD x 44568 and 44568 x MD were imbibed in 1% vanillin in 6M HCl acid for 30 minutes (Aastrup et al., 1984). Afterward they were rinsed in distilled water and stored in a -20C freezer until pictures were taken. Pictures were taken with a Leica DC 300 (Leica Camera, Solms, Germany) digital camera fixed to a Wild

PAGE 74

63 Heerrbrugg microscope (Leica Geosystems, Heerrbrugg, Switzerland) and pictures were analyzed visually for red staining. Results Microarray Analysis A microarray experiment was conducted in order to determine gene expression differences between MD and 44568 fruit and seed tissue at 25 days after pollination. At this time-point MD fruit are brown, mature and dehiscing the fully developed seeds. Conversely, 44568 fruit are still green and continue to develop for another five days before complete maturity (Figure 3-1). There were two primary microarray experiments conducted, the first compared 44568 to MD whole fruit at 25 DAP, and the second compared maternal fruit tissue only (without seed tissue) of 44568 to MD at 25 DAP. The experiments were conducted on whole fruit and maternal fruit tissue for several reasons. Whole fruit tissue included the seeds and the results were expected to isolate genes involved in the developmental delay and the stronger induction of dormancy in the homozygous and hemizygous 44568 seeds. The maternal fruit tissue experiment included all fruit tissue except the seeds; therefore, only maternal plant tissue is represented. The maternal fruit tissue experiments were also expected to help delineate genes expression differences in the seeds since putative differentially regulated genes found in the whole fruit experiments but not the maternal experiments were likely seed expressed genes. Genes were considered differentially regulated if their corresponding microarray hybridized spot showed a Cy3:Cy5 ratio of 1.0 or higher (2-fold difference in expression after normalization). The most differentially expressed clones, with a spot ratio of approximately 2.0 or higher, are shown for each experiment (Table 4-1 and Table 4-2).

PAGE 75

64 Many of the cDNAs have not been studied in petunia; therefore, their exact function is not certain in petunia. The percent identity to genes in other species was used, the highest NCBI Blast matches are provided in the table along with the percent identity to the corresponding petunia cDNA. Full results of the all genes, not just the most differentially regulated genes, expressing at least a two-fold difference (spot ratio of 1.0) in expression in either tissue are presented in Appendix A. The differentially regulated genes in the microarray results are predicted to be involved in various cellular and metabolic processes including stress response, seed storage accumulation, and hormone biosynthesis and function. RT-PCR analysis of mRNA was conducted on a subset of genes with a whole-fruit time series in MD and 44568 (20 days after pollination through full maturation) to verify that genes that had differential expression in the microarray actually exhibited expression differences between 44568 and MD (Table 4-3). Out of the subset of 15 genes that were analyzed with RT-PCR, 14 confirmed that the results from the microarray experiments were valid. One gene, an alcohol dehydrogenase was shown to be more highly expressed in MD fruit tissue and was not confirmed by RT-PCR, but it is likely that human error may have factored into the results observed for this gene. Many of the same differentially regulated genes had the same results in both whole fruit and maternal tissue experiments. Genes that were expressed more in 44568 in the microarray experiments showed homology to an expansin, an oxygen evolving enhancer protein and ent-kaurene oxidase (Tables 4-1 and 4-2). Expansins are involved in cell wall loosening, which allows for cell expansion during fruit tissue growth (Cho and Kende, 1997; Chen et al., 2001). RT-PCR mRNA expression of the expansin gene were

PAGE 76

65 markedly higher in 44568 whole fruit tissue at 20 and 25 days after pollination. Expression of the expansin in MD and 44568 was not visible in mature fruit of both genotypes, 25 days after pollination and 30 days after pollination respectively (Table 4-3). The oxygen evolving enhancer protein is part of PSII and is involved in oxygen evolution during photosynthesis (Ko et al., 1990). When RT-PCR was conducted on this gene, it was observed that mRNA expression was slightly higher in 44568 whole fruit tissue compared to MD whole fruit tissue at 25 days after pollination (Table 4-3). Ent-kaurene oxidase is a gene that encodes an enzyme involved in the first committed step of GA biosynthesis (Hedden and Kamiya, 1997). It was expressed at higher levels at 25 DAP in 44568 than MD in the maternal tissue experiment. When expression was checked in whole fruit tissue, ent-kaurene oxidase mRNA was shown to be more predominant in the 44568 whole fruit tissue at 25 DAP also (Table 4-3). Other genes that exhibited clear differential regulation between the two genotypes were genes that showed homology to beta xylosidase, two genes encoding late embryonic abundant proteins, a seed imbibition gene, and a dehydration-induced gene. The microarray results showed that these genes were more highly expressed in the MD fruit tissue over 44568 fruit tissue at 25 days after pollination. Beta xylosidase is involved in the metabolism of the xyloglucans in the secondary cell wall (Goujon et al., 2003). When expression was observed by RT-PCR, mRNA levels were higher in MD at 25 days after pollination in whole fruit tissue compared to 44568. Expression of beta xylosidase in the 44568 tissue was delayed until 30 days after pollination when the fruit are fully ripe. Late embryonic abundant proteins accumulate in the embryos in the late stages of seed development at the time when seed dessication processes are conducted (Baker et al.,

PAGE 77

66 1988; Dure et al., 1989). mRNA expression of two LEA genes exhibited markedly higher expression in MD at 25 days after pollination in whole fruit tissue compared to 44568 fruit. Expression increased in the 44568 whole fruit tissue at 30 days after pollination but still did not appear to be as high as MD 25 day after pollination expression (Table 4-3). A smaller subset of genes was analyzed with RT-PCR in a more detailed late seed development time series in all genotypes. This was conducted to further verify the results of the array experiments and to examine expression in reciprocal cross genotypes to determine any maternally regulated expression differences (Figure 4-1). The genes examined showed homology to an expansin, a dehydration induced gene, seed imbibition gene and a LEA protein. The expression of these genes was examined in the latter stages of seed development, from 20 days after pollination until seed maturity (26 DAP for MD and MxE; 30 DAP for 44568 and ExM), in order to observe expression of these genes specifically in the seed just before and during the developmental time-point used in the microarray experiments. mRNA expression for the gene that shows homology to the expansin decreased as seed development progressed. 44568 and ExM mRNA expansin expression was higher at 20 DAP and decreased more slowly than MD and MxE seed mRNA expression (Figure 4-1). The gene that showed homology to the dehydration-induced protein exhibited similar mRNA expression between all genotypes except expression decreased slightly in 44568 and ExM seeds at maturity, but the decrease in expression was not observed in MD and MxE seeds (Figure 4-1). mRNA expression of the LEA gene increased over developmental progress. The increase in expression of the

PAGE 78

67 LEA gene in the seeds was delayed in the 44568 and ExM genotypes compared to MD and MxE (Figure 4-1). Condensed Tannin Analysis of Seeds Carrying The etr1-1 Transgene Two genes involved in the anthocyanin synthesis pathway were determined to be differentially regulated in the results of the microarray experiment. One of these genes showed homology to a gene that encodes a myb transcription factor. It was shown to be more highly expressed in 44568 fruit than MD at 25 days after pollination. Myb 305 activates transcription of the gene encoding the first enzyme of phenylpropanoid metabolism, phenylalanine ammonia-lyase (Jackson et al., 1991; Sablowski et al., 1994, 1995). The other differentially regulated gene from the array data that was more highly expressed in 44568 whole fruit tissue than in MD whole fruit tissue at 25 DAP was FBP24, a MADS box transcription factor involved in proanthocyanidin synthesis pathway (Nesi et al., 2002). Condensed tannins are thought to enhance seed coat imposed dormancy by decreasing permeability of the seed coat (Debeaujon et al., 2000). Further expression analysis of other genes (Figure 4-2) involved in the condensed tannin synthesis pathway was examined to determine if condensed tannins might be a contributing factor to the increased dormancy in the 44568 seeds. Additionally, a slight color difference was also observed in the 44568 and ExM seeds at fresh harvest and after one-month of cold storage compared to MD and MxE (Figure 4-3). Since condensed tannins greatly contribute to the brown color of Arabidopsis seeds (Debeaujon et al., 2000), it was thought that this pathway would be interesting to investigate. mRNA expression analysis of a late seed developmental time series was examined with flavonol 3hydroxylase (F3H), dihydroflavonol reductase (DFR), FBP24 (Nesi et al., 2002) and a

PAGE 79

68 Table 4-1 Highest ranked differentially expressed cDNAs of a microarray experiment of whole fruit tissue of ETR (44568) compared to MD at 25 days after pollination. A. Petunia cDNA library ID number B. NCBI Blast X match C. % identity of cDNA clone to Blast X match D. Average microarray spot ratio E. Description of function of cDNA. F. Comparison of results to other microarray experiments (Maternal44568 maternal fruit tissue vs. MD maternal fruit tissue at 25 DAP) Whole Fruit 25 DAP ETR vs MD D. Average Spot Ratio E. Description F. Is it same in: A. Library ID B. Blast-X Match C. % Identity 5-6 Spots Maternal Higher in 44568 RF-5-H01 expansin related protein023547 Arabidopsis 54 4.54 Cell Wall yes YF-1RCA-D11 oxygen evolving enhancer proteinZ11999 tomato 96 3 Photosynthesis yes YF-6-F03 floral defensin like proteinAAN64750 Petunia 100 2.87 Stress response no YF-5-C10 lipid transfer proteinAP000414 Arabidopsis 59 2.77 Seed Storage no YF-1RCA-E11 glutathione StransferaseAF288191 Arabidopsis 64 2.23 Stress response yes YF-3R-H03 FBP24 MADS box transcription factor 97 2.2 Seed Coat Tannins no Higher in MD C2H2-1-E06 GA-2 oxidaseBAD17855 tobacco 89 2.47 GA yes C2H2-11-D05 late embryogenesis protein 5AF053076 tobacco 71 2.1 Seed Storage yes PP-8-A11 raffinose synthase family protein din10NM122032 Arabidopsis 78 1.96 Stress Response yes

PAGE 80

69 Table 4-2 Highest ranked differentially expressed spots of microarray experiment of maternal fruit tissue of ETR (44568) compared to MD at 25 days after pollination. A. Petunia cDNA library ID number B. NCBI Blast X match C. % identitiy of cDNA clone to Blast X match D. Average microarray spot ratio E. Description of function of cDNA. F. Comparison of results to other microarry experiments (Whole fruit44568 whole fruit vs. MD whole fruit) MD 25 Maternal vs ETR 25 Maternal D. Average Spot Ratio E. Description F. Is it same in: A. Library ID B. Blast-X Match C. % Identity 5-6 Spots Whole Fruit? Higher in 44568 RF-5-H01 expansin related protein023547 Arabidopsis 54 6.07 Cell Wall yes YF-1RCA-E01 hypothetical proteinNM001003451 zebra fish 38 2.64 Misc no YF-1RCA-H02 probable lipoxygenaseX06405 potato 83 2.62 JA yes RF-4-H06 dehydrinBAD13500 tobacco 82 2.51 Stress Response yes YF-1RCA-E11 glutathione S-transferaseAF288191 Arabidopsis 64 2.27 Stress Response yes PP-9-E07 thiazole biosynthetic enzymeAAP03875 tobacco 87 2.13 Stress Response no YF-1RCA-D11 oxygen evolving enhancer proteinZ11999 tomato 96 2.1 Photosynthesis yes YF-3R-F07 ent-kaurene oxidaseAA023063-pea 46 2.04 GA no YF-3R-B07 betaine aldehyde dehydrogenaseAAC06242 tomato 83 1.94 Stress Response yes Higher in MD RF-8-G09 nectarin 1 precursor-Q95PVS tobacco 53 3.78 Nectary/Defense no PP-14-B10 lipoxygenaseCAA58859 tobacco 84 2.5 JA yes PP-13-B12 beta xylosidaseBAD98523 pear 60 2.38 Cell Wall yes C2H2-1-B09 late embryogenesis protein LEA5AAC06242 tobacco 70 2.28 Seed storage yes PP-18-H07 sucrose synthaseAAA97571 potato 97 2.08 Seed storage yes PP-19-F12 phi-1BAA33810 tobacco 92 2.01 Stress Response no

PAGE 81

Table 4-3 RT-PCR confirmation of microarray differentially regulated clones Whole fruit tissue is examined at 20 and 25 DAP in MD and 20, 25, and 30 DAP in 44568. Stars designate lanes that are compared in the array. Larger stars are the proposed higher expressed tissue from the microarray data. A short description is also given of the gene function. Higher in Array Data Lower in Array Data Higher in 44568 25 DAP vs. MD 25 DAP Ladder 20 25 20 25 30 Oxygen evolving enhancer protein (30) OEE1 : part of oxygen evolving complex of PSII mutant in Chlamydomonas is deficient in photosynthetic oxygen evolution; been shown to be involved in salt tolerance of Mangrove Expansin (25) Expansin-Related (AtEXPR1) different from family of four expansin genes in Arabidopsis, therefore deemed Expansin-related; expansins are involved in cell wall loosening-allowing for cell expansion (Chen et al., 2001). Glutathione S-transferase (28) glutathione S-transferase detox of herbicides; oxidative stress response; induced by Aluminum treatment; auxin responsive-binds auxin; involved in cell proliferation (Gronwald and Plaisance, 1998). Myb 305 (32) Myb 305 Myb305 is specifically expressed in flowers of Antirrhinum and can activate transcription from a conserved motif in the promoters of genes encoding the first enzyme of phenylpropanoid metabolism, phenylalanine ammonia-lyase (PAL) (Jackson et al., 1991; Sablowski et al., 1994, 1995). Ent-Kaurene Oxidase (25) Ent-Kaurene oxidase GA synthesis enzyme; first committed step of GA biosynthesis-catalyzes the three steps of gibberellin biosynthesis from ent-kaurene to ent-kaurenoic acid; can be a target of negative feedback inhibition (Hedden and Kamiya, 1997). FBP24 (32) FBP24 MADS Box transcription factor; Homologous to ABS in Arabidopsismutant results in colorless seed TT16/ABS is likely to be involved in the control of endothelium development; BANYULS is not activated in the mutant therefore proanthocyanidins do not accumulate in the endothelium (Nesi et al, 2002). 70

PAGE 82

Table 4-3 cont. Higher in 44568 30 DAP vs. MD 25 DAP Ladder 20 25 20 25 30 71 Beta-Carotene Hydroxylase (29) Beta Carotene hydroxylase oxygenated carotenoids (xanthophylls) with 2 hydroxylation steps by this enzyme convert beta-carotene to cryptoxanthin and then to zeaxanthin RPT2 (29) RPT2 light induciblerole in early phototropic signaling; necessary for root phototropism; part of NPH3 family (large family); involved in stomatal opening;encodes a novel protein with putative phosphorylation sites, a nuclear localization signal, a BTB/POZ domain, and a coiled-coil domain Higher in MD 25 DAP vs. ETR 25 DAP Ladder 20 25 20 25 30 Alcohol dehydrogenase (25) ADH3 Most research focuses on adh role in hypoxia because it carries out the terminal electron transfer in anaerobic glycolysis; might have other rolesexpressed in maternal anther tissues, stigma, petals, and hypoxic root in Petunia (Garabagi and Strommer, 2004). Seed Imbibition (30) Seed Imbibition din10 (dark-induced10) upregulation starts as early as 3 hours in dark; sugar suppress din genes expression by phosphorylation of hexose by hexokinasesimilar to what it seen with the glyoxylate cycle genes; transcripts also in imbibed seeds; has 37% identity with stachyose synthase and raffinose synthaseenzymes involved in metabolism of raffinose family oligosaccharidesRFO has a role in dessication tolerance, cold tolerance, C storage therefore din10 might play a role in the metabolism of RFO in sink leaves caused by cessation of photosynthesis (Fujiki et al., 2001).

PAGE 83

Table 4-3 cont. Seed Maturation (21) LEA4 -LEA proteins are highly accumulated in the embryos at the late stage of seed development; In many cases, the timing of LEA mRNA and protein accumulation is correlated with the seed-desiccation process and associated with elevated in vivo ABA levels. The products of these genes are thought to function in protecting cells from dehydration (Baker et al., 1988; Dure et al., 1989 Beta-Xylosidase (25) Beta Xylosidase secondary cell wall metabolism and plant development; metabolism of xyloglucans in the cellulose microfibril network is believed to be important for cell wall expansion; reduced expression of BXL1 resulted in smaller siliques with less seeds (Goujon et al, 2003). Late Embryonic Abundant Protein (21) RF-1-H08/LEA D-29 ; LEA proteins are highly accumulated in the embryos at the late stage of seed development; In many cases, the timing of LEA mRNA and protein accumulation is correlated with the seed-desiccation process and associated with elevated in vivo ABA levels. The products of these genes are thought to function in protecting cells from dehydration (Baker et al., 1988; Dure et al., 1989), 4-hydroxypheylpyruvate dioxygenase (25) 4-hydroxypheylpyruvate dioxygenase (25) catalyzes the formation of homogentisate (2,5-dihydroxyphenylacetate) from p-hydroxyphenylpyruvate and molecular oxygen; homogentisate, is the aromatic precursor of all plastoquinones and tocopherols, essential elements of the photosynthetic electron transport chain and of the antioxidative systems, respectively Higher in MD 25 DAP vs. ETR 30 DAP Ladder 20 25 20 25 30 72 Dehydration-Induced Protein (27) Dehydration Induced Protein (RD22 like) ABA induciblerd22 expression was blocked in srk2e mutant which is required to control induction of ABA responsive genes; also induced by salt stress but not temp stress; expression found in early and middle stages of seed development (Yu et al., 2004) Pectinerase-like Protein Pectinerase-like protein catalyse the demethylation of pectin therefore structural interactions among cell wall components during cell wall turnover and loosening are affected; several pectinerase genes have been found to be involved in fruit ripening and senescence; ethylene reduced EXP1 in strawberry Ubiquitin

PAGE 84

A. Expansin 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM B. Dehydration Induced Protein 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM B. Seed Imbibition 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM C. Seed Maturation (LEA) 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM D. Ubiquitin Control 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM Figure 4-1 Extended RT-PCR expression analysis of microarray differentially regulated clones. Seed tissue was analyzed at 20, 22, 24, 26, 28, and 30 days after pollination in all genotypes.

PAGE 85

74 dihydroflavonol reductase-like gene (DFR-like) (Xie et al., 2003) (Figure 4-4). Expression analysis of genes encoding the more upstream enzymes, flavonol 3 hydroxlase and dihydroflavonol reductase, was conducted for all genotypes. Flavonol 3hydroxylase did not exhibit many differences in expression between the genotypes except for a slight delay in induction in the 44568 and ExM genotypes. Expression of flavonol 3hydroxylase was lower in 44568 and ExM seed tissue at 20 days after pollination and increased at 22 days after pollination through 30 days after pollination. Expression was consistently high in MD and MxE seed tissue from 20 days through 26 days after pollination (Figure 4-4 A). DFR expression was slightly different than the rest of the results because expression decreased in 44568 and ExM genotypes compared to the other two genotypes. mRNA expression was very low at 20 days after pollination in 44568 and ExM seed tissue. Expression slowly increased in these two genotypes until 24 days after pollination but decreased dramatically after 24 days after pollination until seed maturity at 30 days after pollination. Expression of DFR was consistent in MD and MxE seed tissue from 20 days after pollination through seed maturity at 26 days after pollination (Figure 4-4 B). Examination of RT-PCR analysis of seed tissue from 44568, MD, and the reciprocal crosses was also conducted on genes involved in the downstream portion of the condensed tannin pathway, DFR-like and FBP24. mRNA expression of FBP24 appeared to be similar in all genotypes throughout the seed developmental series. mRNA expression appeared to decrease slightly in MD and MxE at 26 days after pollination compared to expression in 44568 and ExM (Figure 4-4 C). This decrease in not significant; therefore, it is not definitive whether there are expression differences between

PAGE 86

75 any of genotypes. There did not appear to be any major differences in mRNA expression of the DFR-like gene in any of the genotypes. Expression remained constant from 20 days after pollination through seed maturity in all genotypes (Figure 4-4 D). An experiment was conducted to stain for condensed tannins in all genotypes of seeds with vanillin, which under acidic conditions, turns red upon binding to flavan-3,4-diols (leucoanthocyanidins) and flavan-3-ol (catechins), which are present as monomers or as terminal subunits of proanthocyanidins (Aastrup et al., 1984; Deshpande et al., 1986). (Figure 4-5). Seeds of all genotypes were stained at fresh harvest and after 1-month of after ripening, the time-points when seed color differences were observed in 44568 and ExM compared to MD and MxE. This is also the time period when most of the major differences in germination between the genotypes occurred in previous experiments focused on germination after different storage periods (Figure 3-8). After staining with 1% vanillin, the seeds in all genotypes were still dark brown in color. No dramatic red staining was seen in any of the genotypes at fresh harvest or after one month of storage (Figure 4-5). Discussion Microarray Analysis Microarray analysis was used in this research as a tool to screen for differentially regulated genes between MD and 44568 fruit and seed tissue at 25 days after pollination, the time-point when these two tissues are visually dramatically different. MD fruit at this time-point are fully ripened, completely brown, and dehiscing the mature seeds. Conversely, 44568 fruit are still completely green at this time-point in development and do not ripen fully until 30 days after pollination. Additionally, at 25 days after

PAGE 87

76 pollination the seeds of MD are mature and viable, whereas 44568 seeds are still immature and are not capable of germination. Several of the differentially regulated genes from the results of the whole fruit and maternal tissue microarray experiments are likely related to the developmental delay of 44568 fruit and seed tissue (Chapter 3). For example, the gene with the highest expression in 44568 whole fruit compared to MD whole fruit at 25 DAP was an expansin. Expansins are involved in the extension of cell walls during the time of rapid growth by disrupting non-covalent linkages (Chen et al., 2000). Several expansins in tomato have been shown to be expressed during both fruit and seed development (Brummell et al., 1999). One tomato expansin, LeEXP10, was shown to have expression during the earlier (Debeaujon et al., 2003) Figure 4-2 Highlighted proa nthocyanidin synthesis gene s observed through RT-PCR expression analysis in all genotypes.

PAGE 88

77 A. B. C. Figure 4-3 Seed pictures of 44568 and MD. (44568 left; MD right) A. Fresh seed B. 1-month old seed C. 1 year old seed stages of seed development and decreased expression during the maturation and dry-down phase of seed development (Chen et al., 2000). It is likely that the 44568 tissue had higher expression of the expansin gene due to the fact that at 25 DAP the 44568 fruit and seeds are still developing and have not reached the maturation phase; therefore, the cells are continuing to expand in 44568 tissue, whereas the MD fruit and seed tissue are in the maturation and desiccation phase of development. A more detailed expression analysis, with all genotypes including reciprocal crosses, was conducted in a late seed developmental time series to see if seed tissue alone had altered expansin gene expression and also to see if any maternal regulation was apparent in the seed tissue gene expression (Figure 4-1). Indeed, the seeds at the beginning of the 44568 and ExM time-course series had higher expansin mRNA expression levels than wild-type and MxE. The latter two genotypes continued through development more rapidly; therefore, expression of expansin mRNA had already declined by 20 days after pollination. The 44568 and ExM seeds were less developed; therefore, expansin mRNA expression did not begin to decline in these tissues until 24 days after pollination (Figure 4-1 A).

PAGE 89

78 A. F3H 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM B. DFR 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM C. FBP 24 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM D. DFR-like 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM E. Ubiquitin Control 20 22 24 26 28 30 20 22 24 26 28 30 MD/MxE ETR/ExM Figure 4-4 RT-PCR mRNA expression analysis of genes involved in the proanthocyanidin synthesis pathway. Seed tissue was analyzed at 20, 22, 24, and 26 days after pollination (mature seeds) in MD and MxE and 20, 22, 24, 26, 28, and 30 days after pollination (mature seeds) in ETR and ExM.

PAGE 90

79 FRESH SEED 1 MONTH OLD SEED MD ETR MxE ExM Figure 4-5 Freshly harvested and 1 month old seeds of all genotypes stained with 1% vanillin to detect presence of flavan-3,4-diols (leucoanthocyanidins) and flavan-3-ol (catechins).

PAGE 91

80 A gene that was more highly expressed in MD tissue than in 44568 at 25 DAP in the array experiments encodes a seed maturation protein, known as a late embryonic abundant protein (LEA). Accumulation of these proteins occurs at late stages of seed development in Arabidopsis (Baker et al., 1988). These genes are known to be expressed during the desiccation phase of seed development and are thought to help protect the seed from extreme dehydration, though their exact mechanism of action is not known (Dure et al., 1989; Koorneef et al., 2002; Brocard et al., 2003). One explanation for this gene being expressed more in MD tissue than 44568 tissue at 25 DAP is that the MD seeds are at the last phase of development when desiccation is occurring, and the LEA proteins are thought to protect the seeds from further damage from the dehydration. 44568 seeds are not at this point in development at 25 DAP, so expression of these genes is at significantly lower levels than MD (Figure 4-1). The expression was similar in 44568 and ExM (x ) genotypes which are the two genotypes with delayed seed development. This expression difference further confirms the developmental delay of the fruit and seed tissue in 44568 and ExM genotypes (Chapter 3). Another gene with differential regulation discovered in the microarray results was a gene that showed homology to beta-xylosidase. mRNA expression was confirmed to be higher in MD fruit tissue at 25 days after pollination compared to 44568 tissue through RT-PCR analysis (Table 4-3). Beta-xylosidase is involved in the metabolism of xyloglucans within the secondary cell wall in plant tissue (Goujon et al., 2003). MD fruit tissue is completely ripe at this time-point in development; therefore, expression of this gene may be higher because of breakdown of fruit tissue during the ripening process.

PAGE 92

81 Expression would be expected to be lower in 44568 fruit tissue since the ripening processes have not begun at this time-point in development. A seed imbibition gene was also more highly expressed in MD whole fruit tissue than 44568 at 25 days after pollination in the array results. The Arabidopsis seed imbibition gene is known as din10 (dark-induced 10) and was given the name seed imbibition because expression was found in imbibed seeds (Fujiki et al., 2001). din10 mRNA is up-regulated in the dark, but this dark-induced expression is suppressed by sucrose application. These genes have some identity (37%) to genes that encode enzymes involved in the metabolism of the raffinose family oligosaccharides, which play a role in protecting plant tissue during desiccation and cold tolerance (Fujiki et al., 2001). Although this gene has only been minimally studied in seed development, it is possible that, since it shows homology to the enzymes involved in the metabolism of raffinose oligosaccharides, it is induced during the latter stages of development to help protect the seeds from stress during the desiccation process. The fact that MD seeds begin to desiccate before 44568 seeds would explain the differential regulation of this gene at 25 days after pollination. The last gene that was studied in the detailed mRNA expression analysis was a gene that showed homology to a dehydration induced protein. When expression was examined in the 44568, MD and reciprocal cross late seed tissue series, the results determined that mRNA expression decreased in 44568 and ExM seeds at 30 DAP (Figure 4-1). This decrease in expression was not seen at seed maturity, 26 days after pollination, in MD and MxE seed tissue. The dehydration induced gene was initially isolated in Arabidopsis as a result of observations of increased expression in drought conditions

PAGE 93

82 (Yamaguchi-Shinozaki and Shinozaki, 1993). If this gene was discovered due to induction of expression in tissues in dry conditions, it may be induced during dessication phases of seed development. Expression may be affected in 44568 and ExM seeds if the seeds of these two genotypes do not dry down properly. Improper dessication of these seeds may be affecting the severity of the dormancy induction within these seeds, which would help explain the reduced germination seen in freshly harvested 44568 seeds (Chapter 3). Several other genes involved in various plant processes were discovered to have differential regulation of expression between 44568 and MD fruit tissue from the microarray experiment results. A gene that showed homology to an ent-kaurene oxidase gene, involved in the first committed step of gibberellin biosynthesis (Hedden and Kamiya, 1997), was differentially regulated in maternal tissue experiments. Expression was checked in whole fruit tissue, and ent-kaurene oxidase mRNA was shown to be more predominant in the 44568 tissue at 25 DAP (Table 4-3). This gene has been shown to be involved in an important step in the production of active gibberellins (Sun and Kamiya, 1994; Yamaguchi et al., 1998). In experiments with etr1-2 seeds in Arabidopsis elevated levels of gibberellins were observed, possibly to compensate for the increased sensitivity and/or elevated levels of ABA (Chiwocha et al., 2005). Therefore, it is likely that levels of gibberellins are also increased in petunia etr1-1 seeds, which would account for the higher expression in the 44568 tissue. Condensed Tannin Analysis Two genes that exhibited differential regulation in the microarray experiments were both involved in a secondary metabolism pathway involving anthocyanins. The first gene discovered in the microarray experiments showed homology to a myb transcription

PAGE 94

83 factor that has been shown to activate transcription of a gene encoding phenylalanine lyase, an enzyme involved in the phenylpropanoid metabolism (Sablowski et al., 1994, 1995). mRNA expression was more highly expressed in 44568 tissue at 25 days after pollination (Table 4-3). The other gene with differential expression in the array results was FBP24, a transcription factor involved in proanthocyanidin synthesis (Nesi et al., 2002). FBP24 had higher expression in 44568 whole fruit tissue compared to MD whole fruit tissue. Additionally, seed color was altered in seeds freshly harvested from the 44568 and ExM genotypes. This visual difference and the discovery of expression differences from the microarray results, it was thought that the presence of the etr1-1 transgene may be affecting the levels of condensed tannins in these genes. RT-PCR analysis of genes encoding enzymes involved in the condensed tannin synthesis pathway produced various results. Expression of genes involved in the upstream portions of the synthesis pathway exhibited more dramatic differences than genes more downstream in the synthesis pathway. Expression of dihydroflavonol reductase exhibited the most dramatic differences between the genotypes. Expression of DFR was reduced in the genotypes produced on the 44568 maternal plants but stayed constant in MD and MxE. A delay of induction of mRNA expression of flavonol 3hydroxylase was also observed in the genotypes produced on the 44568 maternal parent. A delay in induction may be attributed to the delay in seed development of these two genotypes. Expression of the genes involved in the latter portions of the condensed tannin synthesis pathway, dihydroflavonol reductase-like and FBP24, did not exhibit considerable differences in expression between any of the genotypes. These expression differences observed in genes involved in the proanthocyanin synthesis pathway illustrate

PAGE 95

84 that it is possible that the reduction in ethylene sensitivity of seeds produced on a 44568 maternal parent may have impact on proanthocyanidin levels in the seeds, especially since color differences are seen in these seeds, although it is difficult to determine whether levels are increased or decreased in these seeds without quantitative measurements. Another approach was taken in order to determine if condensed tannin levels were altered in any of the genotypes containing the etr1-1 transgene. A vanillin stain was used due to the fact that the vanillin turns red upon binding to flavan-3,4-diols (leucoanthocyanidins) and flavan-3-ol (catechins). This assay is used commonly with transparent testa mutants of Arabidopsis, which are reduced in levels of condensed tannins (Debeaujon et al., 2000, 2001; Nesi et al., 2002). Red staining was not observed in any of the genotypes of seeds at fresh harvest or after one month of storage. The dark brown nature of petunia seeds may not make it possible to stain with vanillin, since this stain is typically used on colorless mutant seeds (Debeaujon et al., 2000, 2001). Another possible explanation of the color differences seen in the 44568 seeds compared to MD seeds is that the levels of condensed tannins are not altered but the rate of oxidation of the tannins is affected due to the reduction in ethylene sensitivity. The oxidation of the tannins contributes to the brown color in Arabidopsis seeds (Debeaujon et al., 2001); therefore, this could account for the color differences seen in 44568 and ExM seeds if levels of condensed tannin are not different from MD and MxE. 44568 seeds are lighter in color at fresh harvest compared to MD seeds, but they do become darker in color through storage. Additionally, seeds at fresh harvest have reduced germination, whereas the darker seeds germinate at higher rates after increased storage

PAGE 96

85 periods (Chapter 3). The oxidation of tannins may help increase the permeability of the seed coat and allow for imbibition of water, initiating the germination processes. If 44568 seeds are slow to oxidize the tannins, the permeability of the seed coat may be decreased for a longer period of time, contributing to the delayed germination capability. Conclusion Several of the differentially regulated genes isolated through microarray analysis exhibited mRNA expression pattern differences between 44568 and MD due to the developmental delay of 44568 seeds. Genes involved in cell structure and expansion, such as expansins were expressed more in 44568 tissue over MD at 25 DAP. Genes involved in seed storage protein accumulation, such as LEA proteins, were more abundantly expressed in MD tissue than 44568 tissue at 25 DAP. These gene expression differences further confirm that 44568 fruit and seed tissue are developmentally delayed compared to MD at 25 DAP. Also, some potentially interesting genes, such as the gene that encodes a dehydration induced protein, were identified which may further explain ethylenes role in the late maturation and desiccation phase of seed development and the subsequent initiation of seed dormancy. The putative dehydration-induced gene had reduced expression in 44568 seeds at maturity compared to MD seeds, which could lead to the conclusion that the 44568 seeds do not dry down properly. This might affect the switch from developmental processes to germination signals; therefore, affecting the strength of dormancy that is induced in the 44568 seeds. The experiments that were developed around condensed tannins, due to FBP24 and a myb transcription factor being expressed more in 44568 fruit than MD fruit in the microarray experiments, did not definitively confirm that tannin content was altered in

PAGE 97

86 the seed coats of 44568 compared to MD seeds. One gene involved in the synthesis pathway, dihydrol-flavonol reductase (DFR) showed a reduction in expression in the 44568 and ExM compared to MD and MxE. A reduction in seed coat tannins would parallel the lighter seed coat tissue seen in 44568 seeds at fresh harvest, but would not explain the stronger induction of dormancy in these seeds since condensed tannins are thought to contribute to increased dormancy. The rate of oxidation of the condensed tannins in these seeds could be affected due to the fact the seeds become darker in color over time. Further investigation into this pathway in petunia, such as identifying the genes involved in the oxidation process, and the resulting quantitative levels of tannins would need to be conducted in order to come to any final conclusions on whether tannin content is affected in the phenotypes reduced in ethylene sensitivity.

PAGE 98

APPENDIX ABI3 ANALYSIS AND MICROARRAY DATA MD ETR A. 5 10 15 20 25 30 5 10 15 20 25 30 35 B. Figure A-1. RT-PCR analysis of PhABI3. Lanes are following: Ladder, MD 5, MD 10, MD 15, MD 20, MD 25, MD 30, ETR 5, ETR 10, ETR 15, ETR 20, ETR 25, ETR 30, ETR 35 Whole Fruit tissue. A. Expression of PhABI3 B. Ubiquitin-Control Figure A-2. ABI3 Southern Analysis. Single distinct banding pattern of genomic DNA probed with PhABI3 illustrates that ABI3 is a single copy gene in Petunia x hybrida. Lanes are in following order: ladder, BamHI, EcoRI, HindIV, empty lane, BamHI, EcoRI, HindIV (repeat of first three enzyme lanes). 87

PAGE 99

88 Table A-1. cDNA library clones included on microarray chip experiments. YF= Young Fruit library, RF= Ripe Fruit library, PP= Post Pollination library, C2H4= Ethylene Treated Flowers library. Petunia Plate Description Accession # YF-1RCA A07 polymorphic antigen p450 CV299386 A08 aquaporin TIP7 CV299387 B04 F-actin binding protein CV299394 B09 NEC1 CV299399 C10 MAR-binding protein CV299411 D09 40S ribosomal protein CV299421 D10 60S ribosomal protein CV299422 D11 oxygen evolving enhancer protein CV299423 E01 probable phenylalanyl tRNAs CV299424 E11 glutathione S-transferase CV299425 G10 glucose-6-phosphate CV299452 H02 probable lipoxygenase CV299456 YF-2 A10 myb-related protein 305 CV299475 C10 glucose acyltransferase CV299498 D01 S locus F box S2 ligase CV299500 D03 putative glucosyltransferase CV299502 D05 beta-alanine synthase CV299504 D12 annexin CV299511 E03 Superoxide dismutase CV299514 E09 cytosolic aconitase CV299520 F02 ripening related protein CV299524 F12 eIF4E CV299533 G07 Gip1-like protein CV299540 H04 ferritin CV299547 H11 NT4 CV299554 H12 Myb oncoprotein homolog CV299555 YF-3R A02 glutamine synthetase CV299557 B07 betaine-aldehyde dehydrogenase CV299574 B11 extensin-tomato CV299578 C05 PKF1 CV299583 E01 Glyceradlehyde 3-phosphate CV299602 E06 MADS box transcription factor CV299607 F02 Bax inhibitor 1 CV299614 F07 ent-kaurene oxidase CV299619 G01 NTGP1 CV299624 H03 MADS box transcription factor CV299636 YF-4R A05 GDSL-motif lipase/hydroxylase CV299727 B01 Glyceradlehyde 3-phosphate CV299734 B06 MADS box transcription factor CV299739 B10 cysteine protease CV299743

PAGE 100

89 Table A-1. Continued B12 polygalacturonase inhibitor CV299744 C06 Ca2+ dependent lipid binding proteins CV299750 C12 cell division cycle protein CV299756 G10 caffeoyl CoA O methyltransferase CV299800 H05 ABC transporter CV299805 H06 ferritin CV299806 YF-5 A06 alcohol dehydrogenase class CV299649 B01 receptor histidine kinase CV299654 B04 Pyruvate kinase isozyme CV299657 C05 IAA amidohydrolase CV299666 C10 lipid transfer protein CV299671 D04 1,4 benzoquinone reductase CV299675 D06 ACC carboxylase CV299677 E05 putative isoamylase CV299687 E11 J1P CV299691 H03 lycopene cyclase CV299715 H06 alcohol dehydrogenase like CV299718 YF-5A A11 beta cyanoalanine synthase CV299821 C12 HR7 CV299841 F06 carotenoid 9,109', 10' cleavage dioxygenase CV299869 G03 putative transcription factor CV299877 H03 transcription factor like CV299889 H07 putative lipoxygenase CV299892 YF-6 C06 ubiquitin conjugating enzyme CV299925 D01 14-3-3 protein CV299929 E03 AERNicotiana CV299942 E05 bifunctional dihydrofolate CV299944 E09 glutamate decarboxylase CV299947 F02 peroxidase CV299952 F03 floral defensin like protein CV299953 H10 14-3-3 protein CV299983 B11 putative UDP-glucose CV299918 YF-7 D04 Aminoacylase-1 CV300021 E08 putative beta alanine pyruvate CV300036 F11 putative cytochrome p450 CV300051 G04 putative bHLH transcription factor CV300055 G08 14-3-3 isoform CV300059 YF-8 A08 ethylene response factor 3 CV300081 D10 transcription factor B3 family CV300118 D11 light inducible protein CV300119 D12 UTP: alpha-D-glucose-1-phosphate CV300120 E03 glycine hydroxymethyltransferase CV300123 F01 bZIP transcription factor CV300132

PAGE 101

90 Table A-1. Continued G01 TAF-3 CV300144 G09 TAF-2 CV300152 G11 beta-amylase CV300154 G12 glucose-6-phosphate 1-dehydrogenase CV300155 YF-9 E12 cationic peroxidase CV300222 D05 putative F-box CV300204 D09 TIR-NBS disease resistance CV300208 D12 putative AP2 domain CV300211 F05 GH3-like protein CV300227 G06 putative two component histidine kinase CV300240 G09 floral binding protein number CV300243 H11 Putative 60S ribosomal protein CV300256 H12 Putative ATP synthase CV300257 RF-1 A02 lipid body associated membrane protein CV300498 A10 7S globulin CV300504 B04 11S globulin like precursor CV300509 B05 11S globulin precursor CV300510 B06 2S albumin CV300511 B08 NADPH cytochrome p450 oxidoreductase CV300513 C03 putative cytochrome p450 CV300520 D03 albumin seed storage protein CV300531 E02 transcription factor JERF1 CV300541 E04 2S seed albumin-1 large CV300543 G01 geraniol 10-hydroxylase CV300560 G02 Non-specific lipid CV300561 G04 putative seed maturation CV300562 G11 S-adenosylmethionine decarboxylase CV300569 H08 LEA CV300578 H09 maturase CV300579 RF-2 B03 lipid body associated membrane protein CV300596 C07 PGPS/NH21 CV300612 C09 dehydration induced protein CV300614 C11 oleosin-like protein salt CV300616 D01 similar to dehydrogenases CV300618 D11 embryogenic potential marker CV300628 D12 similar to caltrin like protein CV300629 H02 cyc07 CV300662 H05 caleosin CV300665 RF-3 C12 probable isocitrate dehydrogenase CV300787 E05 maturation protein PM3 CV300801 E10 2S albumin1 large CV300806 F12 malate dehydrogenase CV300817 G02 putative t-SNARE SED5 CV300818 H04 malate dehydrogenase CV300829 RF-4

PAGE 102

91 Table A-1. Continued A07 11S globulin seed storage CV300678 B01 2S albumin CV300684 D05 glutamate synthase CV300706 E08 glutamine synthetase CV300719 E10 sugar transporter like protein CV300721 F10 steroleosin CV300731 G11 P21 CV300742 H06 dehydrin homolog CV300748 H08 Cu2+ transporting ATPase CV300750 H09 pectinesterase like protein CV300751 RF-5 A10 ethylene responsive element CV300847 B04 PGPS/NH21 CV300853 B08 Gigantea like protein CV300857 C02 seed maturation protein CV300863 C05 ent-kaurene oxidase CV300866 C06 LON protease homologue CV300867 F01 putative (1,4) beta mannase CV300897 G04 translation initiation factor CV300911 G12 senescense associated cysteine protease CV300918 H01 expansin related protein 1 CV300919 H05 vicilin like protein precursor CV300923 RF-6 A07 LEA CV300935 B02 seed storage protein Lec2SA CV301284 B10 cinnamoyl-CoA reductase family CV300948 C02 seed storage protein Lec2SA CV300952 E12 Glutamate dehydrogenase B CV300984 F03 S-adenosylmetionine: 2-demethy CV300986 F07 seed maturation protein PM3 CV300990 G01 ovate protein CV300996 G07 senescense associated protein CV301002 RF-7 B01 desiccation-related protein CV301027 C09 oleosin CV301046 E01 SUMO protein CV301061 D05 maturase CV301053 D07 ent-kaurenoic acid oxidase CV301055 E11 2-oxoglutarate-dependent dioxygen. CV301070 F09 ent-kaurenoic acid oxidase CV301079 H02 coenzyme Q CV301095 RF-8 A01 gamma response 1 protein CV301106 A03 napin CV301108 B11 isopentenyle diphosphate isomerase CV301126 C01 secretory peroxidase CV301128 G09 Nectarin 1 precursor CV301180 H01 transcription factor JERF1 CV301184 H04 MtN30 CV301187

PAGE 103

92 Table A-1. Continued H09 delta-8 sphingolipid desaturase CV301192 RF-9 B09 adenylate kinase related protein CV301214 C08 dessication related protein CV301223 D07 coat protein 3 CV301234 E07 cell division cycle protein CV301245 F08 glyoxalase II CV301256 F12 2-oxoglutarate-dependent dioxygenase CV301260 H02 hydrolase CV301274 H03 glyoxylase family protein CV301275 H10 beta carotene hydroxylase CV301281 H11 putative argininosuccinate CV301282 C2H4-1 B08 jasmonic acid 2 CV292654 B09 late embryogenesis protein 1 CV292655 C10 giberellin 2-oxidase CV292668 E06 dioxygenase CV292683 F01 ethylene forming enzyme CV292689 C2H4-3 A03 cellulose synthase CV292807 B03 nectarin CV292818 B08 nodulin CV292822 C04 P18 protein CV292831 E08 glutaredoxin CV292858 H09 calmodulin 7 CV292894 C2H4-5 A02 alcohol dehydrogenase CV292993 B08 phosphoenolpyruvate CV293009 B11 putative arabinose CV293012 C10 MRP-like ABC transporter CV293022 E07 dioxygenase CV293043 F02 sterol-C5(6) desaturase CV293050 F09 Bax inhibitor 1 CV293057 C2H4-10 A04 S-adenosylmethionine synthetase CV293274 B02 lipase/hydrolase CV293282 B04 NAD-malate dehydrogenase CV293283 C2H4-10D C11 Brassinosteroid regulated protein CV293982 D12 ethylene receptor CV293993 C2H4-11 B08 late embryogenesis protein 1 CV293786 D05 late embryogenesis protein 1 CV293804 C2H4-14G50 A06 ABA inducible protein CV293342 C12 EEF53 CV293368 D07 myb related protein CV293375 D11 beta-glucosidase CV293379 H12 ABA inducible protein CV293420

PAGE 104

93 Table A-1. Continued C2H2-15 B03 bZip DNA binding protein CV293869 C2H4-25 B10 prohibitin CV294866 C09 seed imbitition CV294877 G10 dehydration induced protein CV294 G12 cytochrome p450 CV294923 H10 ORF270/2 CV294933 C2H4-26 A09 drought induced protein CV294943 D07 alcohol dehydrogenase CV294975 H07 floral homeotic protein CV295020 C2H4-31 E05 heat shock cognate protein CV295366 E12 RAD23 protein CV295370 F12 beta keto acyl reductase CV295380 C2H4-32 B11 sucrose transport protein CV295407 D07 alpha glucan phosphorylase CV295421 PP-3 A11 AP2 domain containing CV298007 C08 F box protein CV298027 C11 MADS box FBP23 CV298029 C12 Ser/Thr specific phosphatase CV298030 PP-4 B10 4-hydroxyphenylpyruvate dioxygen. CV298108 C06 sucrose phosphate CV298115 E12 oxygen evolving enhancer protein CV298142 F01 pectin methyl esterase CV298143 G12 floral homeotic protein FBP CV298165 PP-5 B06 JAB CV298193 C10 glucan 1,3 beta gucosidase CV298209 C11 transcription factor CV298210 H06 probable isocitrate dehydrogenase CV298263 PP-6 A03 hydroxymethyltransferase CV298271 C10 malate dehydrogenase CV298301 D03 AIM1 protein CV298305 D09 PGPS/D4 CV298310 F08 beta fructofuranosidase CV298332 F12 putative beta galactosidase CV298335 PP-7 A06 malate dehydrogenase CV298363 A08 myb related tf CV298365 E05 caffeic acid OCV298408 F05 RPT2 CV298420 G09 Initiation factor 5A CV298436 H06 P18 protein CV298445

PAGE 105

94 Table A-1. Continued H11 myb related tf CV298450 PP-8 A09 squalene monoxygenase CV298460 A11 seed imbitition CV298461 D06 myb related tf CV298490 F09 beta mannosidase CV298517 G02 P18 protein CV298522 PP-9 B11 Initiation factor 5A CV298562 E07 thiazole biosynthetic enzyme CV298585 H01 DEAD box CV298606 H02 4-nitrophenylphosphate CV298607 PP-10 A12 beta 1,3 glucanase CV298623 C04 FUSCA6 CV298631 B04 cationic peroxidase CV298625 C05 glutamate decarboxylase CV298632 C07 PGPS/D3 CV298634 E10 putative beta alanine synthase CV298651 PP-11 D07 isoflavone reductase CV298714 D12 phenylalanine ammonia lyase CV298719 E09 expansin-tomato CV298725 F11 malate dehydrogenasemitochondria CV298737 H11 delta-12 fatty acid CV298757 PP-12 A03 alcohol dehydrogenase CV298761 C04 MADS box tf FBP23 CV298782 PP-13 B07 putative ripening CV298843 B12 beta-xylosidase CV298846 F11 early light induced protein CV298878 PP-14 A02 pollen specific protein NTP3 CV298895 B01 cytokinin binding protein CV298900 B10 lipoxygenase CV298907 D07 MADs box FBP5 CV298919 PP-15 D09 myb related tf CV298996 G05 3-glucanase CV299020 PP-16 A09 carotenoid 9,10 CV299044 C05 fatty acid hydroxylase CV299063 G08 sucrose synthase CV299110 G10 anther specific LAT52 protein CV299112 PP-17 A07 P21petunia CV299130 C07 myb tf CV299154 D07 P70 CV299165

PAGE 106

95 Table A-1. Continued D09 putative MAP kinase CV299167 G08 floral homeotic protein CV299202 G09 invertase CV299203 G10 invertase CV299204 H09 P18 CV299213 PP-18 A05 nucloid DNA binding protein CV299218 A06 12-oxophytodienoate CV299219 A07 DNA binding protein 2 CV299220 A10 2,3 bisphosphoglycerate-independent phosphoglycerate mutase CV299223 A11 6,7 dimethyl-8-ribityllumazine synthase precursor CV299224 B05 serine hydroxymethyletransferase CV299228 C11 shaggy protein kinase CV299244 D10 senescense related protein CV299251 D12 fibrillin CV299253 E12 negative transcription regulator CV299263 G08 invertase CV299279 H07 sucrose synthase CV299288 PP-19 F05 water stress inducible protein CV299354 F12 phi-1 CV299361 G12 ascorbate peroxidase CV299371 H12 sucrose synthase CV299380 UNKNOWNS YF-1RCA A04 unknown CV299383 A10 unknown CV299389 E07 unknown CV299430 G11 unknown CV299453 H09 unknown CV299462 YF-2 A01 unknown CV299466 A04 unknown CV299469 A05 unknown CV299470 B06 unknown CV299482 C01 unknown CV299489 E10 unknown CV299521 E11 unknown CV299522 F02 ripening related protein CV299524 F08 unknown CV299529 F12 eIF4E CV299533 PP-16-A09 carotenoid 9,10 CV299044 H12 unknown CV299125 YF-3R B03 unknown CV299570 B04 unknown CV299571 B05 unknown CV299572 C10 unknown CV299588

PAGE 107

96 Table A-1. Continued D09 lipid transfer protein CV299598 D10 unknown CV299599 E06 MADS box gene CV299607 F02 Bax inhibitor 1 CV299614 F04 unknown CV299616 G08 unknown CV299630 G10 unknown CV299632 H03 MADS box gene CV299636 H10 unknown CV299642 H11 unknown CV299643 H02 unknown CV299635 G06 unknown CV299628

PAGE 108

97 Whole Fruit 25 DAP ETR vs MD Average Spot Ratio Description Is it same in: Ethylene down-regulated 5-6 Spots EIN2 25 Maternal RF-5-H01 expansin related protein 4.54 Cell Wall yes yes YF-1RCAD11 oxygen evolving enhancer protein 3 Photosynthesis yes yes YF-6-F03 floral defensin like protein 2.87 Stress response yes no YF-5-C10 lipid transfer protein/seed storage/protease inhibitor 2.77 Seed Storage no no YF-1RCAE11 glutathione S-transferase 2.23 Stress response yes yes YF-3R-H03 FBP24 MADS box transcription factor 2.2 Seed Coat Tannins no no YF-1RCAG10 glucose-6 phosphate 1.82 Seed Storage no no YF-3R-B07 betaine-aldehyde dehyrogenase 1.42 Stress response yes yes YF-1RCAH02 probable lipoxygenase 1.3 JA yes yes RF-4-H06 dehydrin homolog 0.97 Stress response yes yes RF-4-E10 sugar transporter like protein 0.93 Seed Storage yes yes YF-5-H03 lycopene cyclase 1 Carotenoids yes no YF-6-F03 floral defensin like protein 2.87 Stress response yes no Ethylene Up-regulated C2H2-1-E06 dioxygenase (GA) 2.47 GA no yes C2H2-11D05 late embryogenesis protein1 2.1 Seed Storage no yes PP-8-A11 seed imbibition-like protein 1.96 Stress Response yes yes PP-16-G08 sucrose synthase 1.42 Seed Storage yes no PP-14-B10 lipoxygenase 1.38 JA no yes PP-4-B10 4-hydroxyphenylpyruvate dioxygenase 1.38 Photosynthesis yes yes C2H4-5-A02 alcohol dehydrogenase 1.25 Misc. no no PP-13-B12 beta-xylosidase 0.87 Cell Wall yes yes PP-17-G10 invertase 0.65 Seed Storage yes no Figure A-3. Complete list of differentially regulated clones in 44568 and MD whole fruit microarray experiment at 25 DAP.

PAGE 109

98 MD 25 Maternal vs ETR 25 Maternal Avg spot ratio Description Is it the same in: Ethylene Down-Regulated 5-6 spots Whole Fruit? EIN2? RF-5-H01 expansin 6.07 Cell Wall yes yes YF-1RCAE01 probably phenylalnyl tRNAs 2.64 Protein synthesis no no YF-1RCAH02 probable lipoxygenase 2.62 JA yes yes RF-4-H06 dehydrin homolog 2.51 Stress Response yes yes YF-1RCAE11 glutathione S-transferase 2.27 Stress Response yes yes PP-9-E07 thiazole biosynthetic enzyme 2.13 Stress Response no no YF-1RCAD11 oxygen evolving enhancer protein 2.1 Photosynthesis yes yes YF-3R-F07 ent-kaurene oxidase 2.04 GA no yes YF-3R-B07 betaine aldehyde dehydrogenase 1.94 Stress Response yes yes C2H2-26A09 drought induced protein 1.8 Stress Response no no RF-7-D07 ent-kaurenoic acid oxidase 1.53 GA no yes RF-1-B04 11S globulin like precursor 1.46 storage protein no yes YF-7-E08 putative beta alanine pyruvate 1.38 Stress Response no no RF-5-B08 gigantea like protein 1.34 Photosynthesis/Light no yes C2H4-31E05 heat shock cognate protein 1.29 Stress Response yes yes RF-4-E10 sugar transporter like protein 1.23 Seed Storage yes yes RF-7-E11 2-oxoglutarate-dependent dioxygenase 1.12 Flavonols no yes Avg spot ratio Description Is it the same in: Ethylene Up-Regulated 5-6 spots Whole Fruit? EIN2? RF-8-G09 nectarin 1precursor 3.78 Nectary/Defense no no PP-14-B10 lipoxygenase 2.5 JA yes no PP-13-B12 beta xylosidase 2.38 cell wall yes yes C2H2-1-B09 late embryogenesis protein 1LEA5 2.28 Seed Storage yes yes PP-18-H07 sucrose synthase 2.08 Seed Storage yes yes PP-19-F12 phi-1 2.01 Stress Response no no C2H2-1-B7 dioxygenase 1.97 Misc. yes no PP-18-G08 invertase 1.93 Seed Storage yes yes PP-4-B10 4-hydroxypheylpyruvate dioxygenase 1.88 Photosynthesis yes yes C2H2-1-B08 jasmonic acid 2 1.7 JA no no C2H2-1-B03 nectarin 1.62 Nectary/Defense no yes C2H4-25C05 seed imbibition 1.6 Stress Response yes yes RF-1-G02 non specific lipid 1.34 Seed Storage no no RF-5-C02 seed maturation proteinLEA4 1.23 Seed Storage yes yes Figure A-4. Complete list of differentially regulated clones in 44568 and MD maternal tissue microarray experiment at 25 DAP.

PAGE 110

99 MD 25 vs EIN2 25 Whole Fruit Average Spot Ratio Description Is is the same in: Ethylene Down-Regulated 2-3 spots ETR? ETR Maternal? YF-1RCAH02 probable lipoxygenase 2.95 JA yes yes RF-7-E11 2-oxoglutarate-dependent dioxygenase 2.9 Flavonols no yes YF-6-F03 floral defensin like protein 2.87 Stress Response yes yes YF-3R-F07 ent-kaurene oxidase 2.27 GA no yes RF-5-B08 gigantea like protein 2.15 Photosynthesis/Light no yes YF-1RCA-B09 NEC1 2.1 Nectary no no RF-4-H06 dehydrin homolog 1.93 Stress Response yes yes PP-8-A09 Squalene monoxygenase 1.73 Isoprenoids/Stress no no YF-1RCAD11 oxygen evolving enhancer protein 1.6 Photosynthesis/Light yes yes RF-7-D07 ent-kaurenoic acid oxidase 1.53 GA no yes YF-3R-B07 betaine-aldehyde dehydrogenase 1.5 Stress Response yes yes YF-5-H03 lycopene cyclase 1.4 Carotenoids yes no RF-6-C02 seed storage protein Lec2Sa 1.33 Seed Storage no no RF-1-A04 2S albumin 1.3 Seed Storage no no YF-8-D11 light inducible protein 1.25 Photosynthesis/Light no no RF-8-C01 secretory peroxidase 1.25 Stress Response no no YF-2-C10 glucose acyltransferase 1.25 Metabolism no no RF-4-E10 sugar transporter like protein 1.25 Metabolism yes yes RF-1-B05 11S globulin 1.23 Seed Storage no yes YF-1RCA-E11 glutathione S-transferase 1.13 Stress Response yes yes RF-9-F08 glyoxalase II 1 Stress Response no no PP-17-D07 P70 1 Cell Structural no no Ethylene Up-Regulated C2H2-1-B09 late embryogenesis protein 2.3 Seed Storage yes yes PP-8-A11 seed imbibition 2.17 Stress Response yes yes YF-2-D12 annexin 2 Stress Response no no PP-19-H07 sucrose synthase 1.8 Metabolism yes yes C2H2-14G50H12 ABA inducible protein 1.47 ABA induced no C2H4-3-B03 nectarin 1.45 Nectary no yes PP-4-B10 4-hydroxypheylpyruvate dioxygenase 1.4 Photosynthesis yes yes PP-16-G08 sucrose synthase 1.35 Metabolism yes yes YF-5A-C12 HR7 1.35 Stress Response no no YF-9-F05 GH3 like protein 1.35 Misc no no PP-13-B12 beta-xylosidase 1.33 Cell Wall yes yes YF-1RCA-A08 aquaporin TIP7 1.3 Cell Wall no no C2H4-5-B08 phosphoenolpyruvate 1.3 Misc no PP-17-G10 invertase 1.1 Metabolism yes yes RF-5-C02 seed maturation proteinLEA4 1.07 Seed Storage yes yes Figure A-5. Complete list of differentially regulated clones in ein2 and MD whole fruit tissue microarray experiment at 25 DAP.

PAGE 111

100 Whole Fruit EIN 30 DAP vs MD 25 DAP Average Spot Ratio Description Is is the same in: Ethylene Down-Regulated 5-6 Spots ETR 25? PP-8-A11 seed imbibition 2.26 Stress Response no PP-7-F05 RPT2 2.15 Photosynthesis/Light no RF-9-H10 beta carotene hydroxylase 1.05 Carotenoids no Ethylene Up-Regulated RF-2-C09 dehydration induced protein 1.82 Stress Response no RF-4-H09 pectinerase like protein 1.3 Ripening no RF-2-D01 similar to dehydrogenases 1.25 Misc no RF-2-D12 unknown protein 1.14 Unknown no Figure A-6. Complete list of differentially regulated clones in ein2 and MD whole fruit tissue microarray experiment at 30 DAP.

PAGE 112

LIST OF REFERENCES Aastrup S, Outtrup H, Erdal K 1984. Location of the proanthocyanidins in the barley grain. Carlsberg Res. Commun. 49: 105 Abeles FB, Morgan PW, Saltveit ME 1992. Ethylene in Plant Biology. San Diego, CA: Academic. pp 414 Abrahams S, Tanner GJ, Larkin PJ, Ashton AR 2002. Identification and biochemical characterization of mutants in the proanthocyanidin pathway in Arabidopsis. Plant Physiology 130: 561 Acaster MA, Kende H 1983. Properties and partial purification of 1aminocyclopropane-1-carboxylate synthase. Plant Physiol 72: 139-145 Adams DO, Yang SF 1979. Ethylene biosynthesis: identification of 1aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of methionine to ethylene. PNAS 76: 170-174 Adkins SW, Ross JD 1981. Studies in wild oat seed dormancy. 1. The role of ethylene in dormancy breakage and germination of wild oat seeds (Avena fatua L.). Plant Physiology 67: 358 Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR 1999. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284: 2148-2152 Barry, KG 2004. Characterization of transgenic ethylene insensitive Petunia x Hybrida plants with a focus on seed development. PhD thesis. University of Florida, Gainesville, Florida Baker J, Steele C, Dure L 1988. Sequence and characterization of 6 Lea proteins and their genes from cotton. Plant Molecular Biology 11: 277-291 Bartels D, Singh M, Salamini F 1988. Onset of desiccation tolerance during development of the barley embryo. Planta 175: 485-492 Beaudoin N, Serizet C, Gosti F, Giraudat J 2000. Interactions between abscisic acid and ethylene signaling cascades. Plant Cell 12: 1103-1115 Bewley JD 1997. Seed germination and dormancy. Plant Cell 9: 1055-1066 101

PAGE 113

102 Black M, Corbineau F, Gee H, Come D 1999. Water content, raffinose and dehydrins in the induction of desiccation tolerance in immature wheat embryos. Plant Physiology 120: 463-472 Bleecker AB, Estelle MA, Somerville C, Kende H 1988. Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science 241: 1086-1089 Bleecker AB, Kende H 2000. Ethylene: A Gaseous Signal Molecule in Plants. Annual Review Cell Developmental Biology 16: 1 Borisjuk L, Walenta S, Rolletschek H, Mueller-Klieser W, Wobus U 2002. Spatial analysis of plant development: sucrose imaging within Vicia faba cotyledons reveals specific developmental patterns. Plant Journal 29: 521 Brink RA, Cooper DC 1947. The endosperm in seed development. Bot. Rev. 13: 423 Brocard-Giffard IM, Lynch TJ, Finkelstein RR 2003. Regulatory networks in seeds integrating developmental, abscisic acid, sugar, and light signaling. Plant Physiology 131: 78-92 Brocard-Giffard IM, Lynch TJ, Garcia ME, Malhotra B, Finkelstein RR 2004. The Arabidopsis thaliana ABSCISIC ACID-INSENSITVE8 locus encodes a novel protein mediating abscisic acid and sugar responses essential for growth. Plant Cell 16 (2): 406-421 Brummell DA, Harpster MH, Dunsmuir P 1999. Differential expression of expansin gene family members during growth and ripening of tomato fruit. Plant Molecular Biology 39: 161 Buchanan B, Gruissem W, Jones RL 2000. Biochemistry and Molecular Biology of Plants. Rockville, MD: American Society of Plant Physiologists. pp 890-891, 1083 Chaudhury AM, Berger F 2001. Control of early seed development. Annual Review of Cell Developmental Biology 17: 677-699 Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P, Nambara E, Asami T, Seo M, Koshiba T, Sheen J 2002. A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant Cell 14: 2723-2743

PAGE 114

103 Chiwocha S, Cutler AC, Abrams SR, Ambrose SJ, Yang J, Ross A, Kermode AR 2005. The etr1-2 mutation in Arabidopsis thaliana affects the abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during maintenance of seed dormancy, moist chilling and germination. Plant Journal 42: 35-48 Ciardi J, Tieman DM, Lund ST, Jones JB, Stall RE, Klee HJ 2000. Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiology 123: 81-92 Chang C, Stewart RC 1998. The two-component system: regulation of diverse signaling pathways in prokaryotes and eukaryotes. Plant Physiology 117: 723 Chen QG, Bleecker AB 1995. Analysis of ethylene signal transduction kinetics associated with seedling-growth response and chitinase induction in wild-type and mutant Arabidopsis. Plant Physiology 108: 597 Chen F, Bradford KJ 2000. Expression of an expansin is associated with endosperm weakening during tomato seed germination. Plant Physiology 124: 1265 Chen F, Dahal P, Bradford KJ 2001. Two tomato expansin genes show divergent expression and localization in embryos during seed development. Plant Physiology 127: 928-936 Chiwocha SDS, Cutler AJ, Abrams SR, Ambrose SJ, Yang J, Ross ARS, Kermode AR 2005. The etr1-2 mutation in Arabidopsis thaliana affects the abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during maintenance of seed dormancy, moist-chilling and germination. Plant Journal 42: 35-48 Church GM, Gilbert W 1984. Genomic sequencing. PNAS 81: 1991-1995 Cho HT, Kende H 1997. Expression of expansin genes is correlated with growth in deep water rice. Plant Cell 9: 1661-1671 Clark GB, Roux SJ 1995. Annexins of plant cells. Plant Physiology 109: 1133-1139 Clevenger DJ, Barrett JE, Klee HJ, Clark DG 2004. Factors affecting seed production in transgenic ethylene-insensitive petunias. Journal of American Society of Horticultural Sciences 129: 401-406 Colombo L, Franken J, Van der Krol A,Witich P, Dons HJM, Angenent GC 1997. Down-regulation of ovule-specific MADS box genes from petunia results in maternally controlled defects in seed development. Plant Cell 9: 703 Colombo LG, Angenent G 1998. MADS box genes controlling ovule and seed development in Petunia. In: Advances in Plant Reproduction Research Springer Verlag 24: 351-360

PAGE 115

104 Debeaujon I, Koornneef M 2000. Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid. Plant Physiology 122: 415 Debeaujon I, Leon-Kloosterziel KM, Koornneef M 2000. Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiology 122: 403 Debeaujon I, Peeters AJM, Leon-Kloosterziel KM, Koornneef M 2001. The TRANSPARENT TESTA12 gene of Arabidopsis encodes a multi-drug secondary transporter-like protein required for flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13: 853-871 Debeaujon I, Nesi N, Perez P, Devic M, Grandjean O, Caboche M, Lepiniec L 2003. Proanthocyanidin-accumulating cells in Arabidopsis testa: regulation of differentiation and role in seed development. Plant Cell 15: 2514-2531 Dekkers BW, Schuurmans JJ, Smeekens SM 2004. Glucose delays seed germination in Arabidopsis thaliana. Planta 218 (4): 579-588 Deshpande SS, Cheryan M, Salunkhe DK 1986. Tannin analysis of food products. CRC Crit. Rev. Food Sci. Nutr. 24: 401 Dixon, RA, Xie D-Y, Sharma SB 2005. Tansley Review. Proanthocyanidinsa final frontier in flavonoid research. New Phytologist 165: 9-28 Dure L, Crouch M, Harada J, Ho TD, Mundy J, Quatrano R, Thomas T, Sung ZR 1989. Common amino acid sequence domains among the LEA proteins of higher plants. Plant Mol Biol. 12: 475-486 Ekins R, Chu FW 1999. Microarrays: their origins and applications. Trends in Biotechnology 17: 877-892 Esashi Y, Leopold AC 1970. Dormancy regulation in subterranean clover seeds by ethylene. Plant Physiology 44: 1470-1472 Felker FC, Peterson DM, Nelson OE 1985. Anatomy of immature grains of eight maternal effect shrunken endosperm barley mutants. Am. J. Bot. 72:248 Finkelstein R, Somerville C 1990. Three classes of abscisic acid (ABA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses. Plant Physiology 94: 1172. Finkelstein RR, Gampala SS, Rock CD 2002. ABA signaling in seeds and seedlings. Plant Cell 13: S15-S45

PAGE 116

105 Foley ME 2001. Seed dormancy: An update on technology, physiological genetics, and quantitative trait loci regulating germinability. Weed Science 49: 305-317 Frey A, Godin B, Bonnet M, Sotta B, Marion-Poll A 2004. Maternal synthesis of abscisic acid controls seed development and number in Nicotiana plumbaginifolia. Planta 218: 958-964 Fujiki Y, Yoshikawa Y, Sato T, Inada N, Ito M, Nishida I, Watanabe A 2001. Dark-inducible genes from Arabidopsis thaliana are associated with leaf senescence and repressed by sugars. Physiologia Plantarum 111: 345-352 Gallardo M, Gomez-Jimenex M, Matilla A 1999. Involvement of calcium in ACCoxidase activity from Cicer arietinum seed embryonic axes. Phytochemistry 50: 373-376 Garabagi F, Strommer J 2004. Distinct genes produce the alcohol dehydrogenases of pollen and maternal tissue in Petunia hybrida. Biochemical Genetics 42: 199-208 Ge Y, Angenent G, Wittich P, Peters J, Franken J, Busscher M, Zhang L, Dahlhaus E, Kater M, Wullems G, Molenaar T 2000. NEC1, a novel gene, highly expressed in nectary tissue of Petunia hybrida. Plant Journal 24 (6): 725-734 Ghassemian M, Nambara E, Cutler S, Kawaide H, Kamiya Y, McCourt P 2000. Regulation of abscisic acid signaling by the ethylene response pathway in Arabidopsis. Plant Cell 12: 1117-1126 Giovannoni JJ 2001. Molecular regulation of fruit ripening. Annual Review Plant Physiology Plant Molecular Biology 52: 725 Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM 1992. Isolation of the Arabidopsis ABI3 Gene by Positional Cloning. Plant Cell 4: 1251-1261 Girke T, Ruuska S, White J, Benning C, Ohlrogge J 2000. Microarray analysis of developing Arabidopsis seeds. Plant Physiology 124: 1570-1581 Globerson D 1977. Germination and dormancy breaking by ethephon in mature and immature seeds of Medicago truncatula and Trifolium subterraneum. Australian Journal of Agriculture Resources 29: 43-49 Goujon T, Minic Z, El Amranil A, Lerouxel O, Alettil E, Lapierre C, Joseleau JP, Jouanin L 2003. AtBXL1, a novel higher plant (Arabidopsis thaliana) putative beta-xylosidase gene, is involved in secondary cell wall metabolism and plant development. Plant Journal 33: 677-690 Gronwald JW, Plaisance KL 1998. Isolation and characterization of glutathione s-transferase isozymes from Sorghum. Plant Physiology 117: 877-892

PAGE 117

106 Gubler F, Millar A, Jackobsen J 2005. Dormancy release, ABA, and pre-harvest sprouting. Current Opinion in Plant Biology 8: 183-187 Guzman P, Ecker JR 1990. Exploiting the triple response of Arabidopsis to identify ethylene related mutants. Plant Cell 2: 513 Hamilton AJ, Lycett GW, Grierson D 1990. Anti-sense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346: 284-287 Hamilton AJ, Bouzayen M, Grierson D 1991. Identification of a tomato gene for the ethylene-forming-enzyme by expression in yeast. Proc. Natl. Acad. Sci. U.S.A. 88: 7434-7437 Harada JJ 1997. Seed maturation and control of germination. In: Cellular and Molecular Biology of Plant Seed Development, Editors: BA Larkins and IK Vasil, Kluwer Academic Publishers, Dordrecht pp 545 Hasegawa R, Maruyama A, Nakaya M, Tsuda S, Esashi Y 1995. The presence of two types of b-cyanoalanine synthase in germinating seeds and their responses to ethylene. Physiologia Plantarum 93: 713-718 Hedden P, Kamiya Y 1997 Gibberellin biosynthesis: enzymes, genes and their regulation. Annual Review Plant Physiology and Plant Molecular Biology 48: 431-460 Heim U,Weber H, Baumlein H,Wobus U 1993. A sucrose-synthase gene of V. faba L.: expression pattern in developing seeds in relation to starch synthesis and metabolic regulation. Planta 191: 394 Hobo T, Kowyama Y, Hattori T 1999. A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription. Proc. Natl. Acad. Sci. U.S.A. 96: 15348 Hoecker U, Vasil IK, McCarty DR 1995. Integrated control of seed maturation and germination programs by activator and repressor function of Viviparous-1 of maize. Genes and Development 9: 2459-2469 Hoekstra FA, Golovina EA, Buitink J 2001. Mechanisms of plant desiccation tolerance. Trends in Plant Science 6: 431-438 Holdworth M, Lenton J, Flintham J, Gale M, Kurup S, McKibbin R, Bailey P, Larner V, Russel L 2001. Genetic control mechanisms regulating the initiation of germination. Journal of Plant Physiology 158 (4): 439-445 Hua J, Chang C, Sun Q, Meyerowitz EM 1995. Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269: 1712-1714

PAGE 118

107 Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10: 1321 Ikeda M, Satoh S, Kamada H 2004. Identification of ABI3 promoter cis-element which regulates the embryo-specific expression. Plant and Cell Physiology 45: S106-S106 Karssen C, Brinkhorst-van der Swan D, Breekland A, Koornneef M 1983. Induction of dormancy during seed development by endogenous abscisic acid: studies of abscisic acid deficient genotypes of Arabidopsis thaliana (L.) Heynh. Planta 157: 158 Karssen C 1995. Seed Development and Germination. Marcel Dekker, Inc., New York, NY, pp 333 Kende H 1993. Ethylene biosynthesis. Annual Review of Plant Molecular Biology 44: 283-307 Kepczynski J, Karssen C 1985. Requirement for the action of endogenous ethylene during germination of non-dormant seeds of Amaranthus caudatus. Physiologia Plantarum 63: 49-52 Kepczynski J, Kepczynska K 1997. Ethylene in seed dormancy and germination. Physiologia Plantarum 101: 720-726 Kepczynski J, Bihum M, Kepczynska E 2003. The release of secondary dormancy by ethylene in Amaranthus caudatus L. seeds. Seed Science Research 13(1): 69-74 Kermode, AR 1995. Regulatory mechanisms in the transition from seed development to germination: Interactions between the embryo and the seed environment. In: Seed Development and Germination. Galili, G., and Kigel, J., eds., Marcel Dekker, Inc., New York, pp 273-332 Ketring DL, Morgan PW 1969. Ethylene as a component of the emanations from germinating peanut seeds and its effect on dormant Virginia-type seeds. Plant Physiology 44 (3): 326-330 Ketring DL, Morgan PW 1971. Physiology of oil seeds. II. Dormancy release in Virginia-type peanut seeds by plant growth regulators. Plant Physiology 47: 488492 Khan MA, Ungar IA 1999. Seed germination and recovery of Triglochin maritima from salt stress under different thermoperiods. Great Basin Nat. 59: 144

PAGE 119

108 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR 1993. CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72: 427-441 Ko K, Granell A, Bennett J, Cashmore AR 1990. Isolation and characterization of cDNAs from Lycopersicon esculentum and Arabidopsis thaliana encoding the 33kDa protein of the photosystem II-associated oxygen evolving complex. Plant Molecular Biology 14: 217-227 Koch KE 1996. Carbohydrate-modulated gene expression in plants. Annual Review Plant Physiology Plant Molelcular Biology 47: 509 40 Koch KE 2004. Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Current Opinion in Plant Biology 7 (3): 235-246 Koornneef M, Reuling G, Karssen C 1984. The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiol. Plant. 61: 377 Koornneef M, Karssen CM 1994. Seed dormancy and germination. In EM Meyerowitz, CR Somerville, eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY pp 313 Koornneef M, Bentsink L, Hilhorst H 2002. Seed dormancy and germination. Current Opinion in Plant Biology 5 (1): 33-36 Kovacs I, Ferhan A, Oberschall A, Ipacs I, Bottka S, Pongor S, Dudits D, Toth EC 1998. Immunolocalization of a novel annexin-like protein encoded by a stress and abscisic acid responsive gene in alfalfa. Plant Journal 15 (2): 185-197 Lara P, Onate-Sanchez L, Abraham Z, Ferrandiz C, Diaz I, Carbonero P, VicenteCarbajosa J 2003. Synergistic activation of seed storage protein gene expression in Arabidopsis by ABI3 and two bZips related to OPAQUE2. The Journal of Biological Chemistry 278: 21003-21011 Lazarova G, Zeng Y, Kermode AR 2002. Cloning and expression of an abscisic acidinsensitive 3 (ABI3) gene homologue of yellow cedar (Chamaecyparis nootkatensis). Journal of Experimental Botany 53 (371): 1219-1221 Leon-Kloosterziel KM, Gil MA, Rujis GJ, Jacobsen SE, Olszewski NE, Schwartz SH, Zeevart JA, Koornneef M 1996. Isolation and characterization of abscisic acid-deficient Arabidopsis mutants at two new loci. Plant Journal 10: 655-661

PAGE 120

109 Leubner-Metzger, Petruzzelli L, Waldvogel R, Vogeli-Lange R, Meinz F 1998. Ethylene-responsive element binding protein expression and the transcriptional regulation of class I B-1,3-glucanase during tobacco seed germination. Plant Molecular Biology 38: 785-795 Lopes MA, Larkins BA 1993. Endosperm origin, development, and function. Plant Cell 5: 1383 Lopez-Molina L, Mongrand B, McLachlin DT, Chait BT, Chua NH 2002. ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant Journal 32 (3): 317-328 Lotan T, Ohto M, Yee KM, West MA, Lo R, Kwont R 1998. Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93: 1195-1205 Luerssen H, Kirik V, Herrmann P, Misera S 1998. FUSCA3 encodes a protein with a conserved VP1/ABI3-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana. Plant Journal 15: 755 Maruyama A, Yoshiyama, M, Adachi Y, Nanba H, Hasegawa R, Esashi Y 1997. Possible participation in of b-cyanoalanine synthase in increasing the amino acid pool of cocklebur seeds in response to ethylene during the pre-germination period. Australian Journal of Plant Physiology 24: 751-757 Matilla AJ 2000. Ethylene in seed formation and germination. Seed Science Research 10: 111-126 Mayer U, Buttner G, Jurgens G 1993. Apica lbasal pattern-formation in the Arabidopsis embryostudies on the role of the GNOM gene. Development 117: 149 Mayer U, Jurgens G 1998. Pattern formation in plant embryogenesis: a reassessment. Sem. Cell. Dev. Biol 9: 187 McCarty DR, Carson CB, Stinad PS, Robertson DS 1989. Molecular analysis of viviparous-1: an abscisic acid-insensitive mutant maize. Plant Cell 1: 523-532. McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil I 1991. The Viviparous1 developmental gene of maize encodes a novel transcriptional activator. Cell 66: 895 McCarty DR 1995. Genetic control and integration of maturation and germination pathways in seed development. Annual Review Plant Physiology and Plant Molecular Biology 46: 71

PAGE 121

110 Monke G, Altschmied L, Tewes A, Reidt W, Mock HP, Baumlein H, Conrad U 2004. Seed-specific transcription factors ABI3 and FUS3 molecular interactions with DNA. Planta 219 (1): 158-166 Moss SE 1997. Annexins. Trends in Cell Biology 7: 87-89 Nambara E, Naito S, and McCourt P 1992. A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 allele. Plant Journal 2: 435 Nambara E, Hayama R, Tsuchiya Y, Nishimura M, Kawaide H, Kamiya Y, Naito S 2000. The role of ABI3 and FUS3 loci in Arabidopsis thaliana on phase transition from late embryo development to germination. Developmental Biology 220: 412-423 Nesi N, Debeaujon I, Jond C, Stewart AJ, Jenkins GI, Caboche M, Lepiniec L 2002. The TRANSPARENT TESTA16 locus encodes the ARABIDOPSIS BSISTER MADS domain protein and is required for proper development and pigmentation of the seed coat. Plant Cell 14: 2463 Norton G, Harris JF 1975. Compositional changes in developing rape seed. Planta 123: 163-174 Ohme-Takagi M, Shinshi H 1995. Ethylene inducible DNA binding proteins that interact with an ethyleneresponsive element. Plant Cell 7: 371 Ooms JJ, Leon-Kloosterziel K, Bartels D, Koornneef M, Karssen CM 1993. Acquisition of desiccation tolerance and longevity in seeds of Arabidopsis thaliana. Plant Physiology 102: 1185-1191 Portis E, Marzachi C, Quagliotti L, Lanteri S 1999. Molecular and physiological markers during seed development of peppers (Capsicum annuum L.): DNA replication and b-tubulin synthesis. Seed Science Research 9: 85-90 Petruzelli L, Harren F, Perrone C, Reuss J 1995. On the role of ethylene in seed germination and early root growth of Pisum sativum. Journal of Plant Physiology 145: 83-86 Petruzelli L, Muller K, Hermann K, Leubner-Metzger G 2003. Distinct expression of B-1,3-glucanases and chitinases during the germination of Solanaceous seeds. Seed Science Research 13: 139-153 Pomeroy MK, Kramer JG, Hunt DJ, Keller WA 1991. Fatty acid changes during development of zygotic and microspore-derived embryos of Brassica napus. Physiol Plant 81: 447 Roberts, EH 1972. Dormancy: a factor affecting seed survival in the soil. In: E.H. Roberts (Ed.), Viability of Seeds. Chapman and Hall, London, pp 321.

PAGE 122

111 Roland F, Moore B, Sheen J 2002. Sugar Sensing and Signaling in Plants. Plant Cell 14: S185-S205 Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR 1995. Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. Genetics 139: 1393-1409 Ruuska SA, Girke T, Benning C, Ohlrogge JB 2002. Contrapunctal networks of gene expression during Arabidopsis seed filling. Plant Cell 14: 1191-1206 Sablowski RW, Moyano E, Culanez-Macia FA, Schuch W, Martin C, Beyan M 1994. A flower specific myb protein activates transcription of phenlypropanoid biosynthethic genes. EMBO J. 13(1): 128-137 Sablowski RM, Baulcombe DC, Bevan M 1995. Expression of a flower-specific myb protein in leaf cells using a viral vector causes ectopic activation of a target promoter. Proc. Natl Acad Sci. USA 92: 6901-6905 Sakai H, Hua J, Chen QG, Chang C, Medrano LJ 1998. ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis Proc. Natl Acad Sci. USA 95: 5812-5817 Sato T, Theologis A 1989. Cloning the mRNA encoding 1-aminocyclopropane-1carboxylate synthase, the key enzyme for ethylene biosynthesis in plants. Proc. Natl. Acad. Sci. U.S.A 86: 6621-6625 Satoh S, Takeda Y, Esashi Y 1984. Dormancy and impotency of cocklebur seeds. Changes in ACC-ethylene conversion activity and ACC content of dormant and non dormant seeds during soaking. Journal of Experimental Botany 35: 1515-1524 Schwender J, Ohlrogge JB 2002. Probing in vivo metabolism by stable isotope labeling of storage lipid and proteins in developing Brassica napus embryos. Plant Physiology 130: 347-361 Shibuya K, Barry KG, Ciardi J, Loucas HM, Underwood B, Nourizadeh S, Ecker J, Klee HJ, Clark DG 2004. The Central Role of PhEIN2 in ethylene responses throughout plant development in petunia. Plant Physiology 136: 2900-2912 Smeekens S 2000. Sugar-induced signal transduction in plants. Annual Review Plant Physiology and Plant Molecular Biology 51:49 81 Solano R, Stepanova A, Chao QM, Ecker JR 1998. Nuclear events in ethylene signaling: a transduction cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE RESPONSE-FACTOR1. Genes Devel. 12: 3703

PAGE 123

112 Southwick KL, Lamb N, Storey R, Mansfield DH 1986. Effects of ethephon and its decomposition products on germination of rice and watergrass. Crop Science 26: 761-767 Spanu P, Reinhardt D, Boller T 1991. Analysis and cloning of the ethylene forming enzyme from tomato by functional expression of its messenger RNA in Xenopus laevis oocytes. EMBO J 10: 2007-2013 Sreenivasulu N, Altschmied L, Panitz R, Hahnel U, Michalek W, Weschke W, Wobus U 2002. Identification of genes specifically expressed in maternal and filial tissues of barley caryopses: a cDNA array analysis. Molecular Genetics Genomics 266: 758-767 Stone SL, Kwong LW, Yee KM, Pelletier J, Lepiniec L, Fischer RL, Goldberg RB, Harada JA 2001. LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. PNAS 98: 11806 Sun T, Kamiya Y 1994. The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. Plant Cell 6: 1509-1518 Suzuki M, Kao CY, Cocciolone S, McCarty DR 2001. Maize VP1 complements Arabidopsis abi3 and confers a novel ABA/auxin interation in roots. Plant Journal 28: 409-418. Underwood B 2003. Effects of ethylene on floral frangrance of Petunia x Hybrida Mitchell Diploid. PhD thesis. University of Florida, Gainesville, Florida van Hengel AJ, Guzzo F, van Kammen A, de Vries SC 1998. Expression pattern of the carrot EP3 endochitinase genes in suspension cultures and in developing seeds. Plant Physiology 117: 43 Van Staden J, Olatoye ST, Hall MA 1973. Effect of light and ethylene upon cytokinin levels in seed of Spergula arvensis. Journal of Experimental Botany 24: 662-671 Van Zhong G, Burns JK 2003. Profiling ethylene-regulated gene expression in Arabidopsis thaliana by microarray analysis. Plant Molecular Biology 53: 117-131 Vielle-Calzada JP, Baskar Grossniklaus U 2000. Delayed activation of the paternal genome during seed development. Nature 404: 91-94 Wang H, Qi Q, Schorr P, Cutler AJ, Crosby WL 1998. ICK1, a cyclin-dependent protein kinase inhibitor from Arabidopsis thaliana interacts with both Cdc2a and CycD3, and its expression is induced by abscisic acid. Plant Journal 15: 501

PAGE 124

113 Wang, KL-C, Li H, Ecker JR 2002. Ethylene biosynthesis and signaling networks. The Plant Cell 14: S131-S151 Weber H, Borisjuk L, Heim U, Buchner P,Wobus U 1995. Seed coat associated invertases of Fava bean control both unloading and storage functions: cloning of cDNAs and cell type-specific expression. Plant Cell 7: 1835 Weber H, Buchner P, Borisjuk L, Wobus U 1996. Sucrose metabolism during cotyledon development of Vicia faba L. is controlled by the concerted action of both sucrose-phosphate synthase and sucrose synthase: expression patterns, metabolic regulation and implications on seed development. Plant Journal 9: 841 Weber H, Heim U, Golombek S, Borisjuk L, Wobus U 1998. Assimilate uptake and the regulation of seed development. Seed Science Research 8: 331 Weber H, Borisjuk L, Wobus U 2005. Molecular physiology of legume seed development. Annual Review of Plant Biology 56: 253-279 Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ 1997. A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants Nature Biotechnology 15: 444-447 Winkel-Shirley B 1998. Flavonoids in seeds and grains: Physiological function, agronomic importance and the genetics of biosynthesis. Seed Science Research 8 : 415-422 Wobus U, Weber H 1999. Sugars as signal molecules in plant seed development. Biol. Chem. 380: 937 Wobus U, Weber H 1999. Seed maturation: genetic programs and control signals. Current Opinion Plant Biology 2: 33-38 Xie D-Y, Sharma SB, Paiva NL, Ferreira D, Dixon RA 2003. Role of anthocyanidin reductase, encoded by BANYULS in plant flavonoid biosynthesis. Science 299: 396 Yamaguchi-Shinozaki K, Shinozaki K 1993. The plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. Molecular Gen. Genet. 238: 97-105 Yamaguchi S, Smith MW, Brown RGS, Kamiya Y, Sun T 2001. Distinct cell specific expression patterns of early and late gibberellin biosynthetic genes during Arabidopsis seed germination. Plant Journal 28(4): 443-453

PAGE 125

114 Yang SF, Hoffman NE 1984. Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology 35: 155-189 Young, Gallie 2000. Regulation of programmed cell death in maize endosperm by abscisic acid. Plant Molecular Biology 42: 397-414 Yu Y, Adams DO, Yang S 1979. 1-Aminocyclopropane-1-carboxylate synthase, as key enzyme in ethylene biosynthesis. Arch. Biochem. Biophys. 198: 280-286 Yu S, Zhanga L, Zuoa K, Lia Z, Tanga K 2004. Isolation and characterization of a BURP domain-containing gene BnBDC1 from Brassica napus involved in abiotic and biotic stress. Physiologia Plantarum 122: 210-218 Zaitseva MG, Kasumova IV, Kasumov EA, Borisova MA, Ilchishina NV 2002. Respiration of mitochondria in developing sunflower seeds. Biology Bulletin 29 (6): 555-558 Zarembinski T, Theologis A 1994. Ethylene biosynthesis and action: a case of conservation. Plant Molecular Biology 26: 1579-1597 Zeevaart JAD, Creelman RA 1988. Metabolism and physiology of abscisic acid. Annu. Rev. Plant Physiol. Plant Mol. Biol. 39: 439 Zhou L, Jang JC, Jones TL, Sheen J 1998. Glucose and ethylene signal transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc. Natl. Acad. Sci. U.S.A. 95: 10294-10299

PAGE 126

BIOGRAPHICAL SKETCH Jennifer Davis was born in Denver, Colorado. Her family moved to New Port Richey, Florida, when she was six, and she lived there until the beginning of her undergraduate studies at the University of Florida in the fall of 1997. During her undergraduate work she completed a research project with Drs. Harry Klee and Joe Ciardi through the Undergraduate Research Scholars Program. She also completed an undergraduate internship in flower breeding with Goldsmith Seeds. Jennifer graduated with a Bachelor of Science degree with honors from the University of Florida in spring of 2001. Her major was environmental horticulture with a minor in plant molecular and cellular biology. She will graduate in December of 2005, with a Doctor of Philosophy in plant molecular and cellular biology. Jennifer is married to Keith Davis; their first child, Kyle Michael, was born in October 2005. 115


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101122_AAAABR INGEST_TIME 2010-11-23T02:53:28Z PACKAGE UFE0012020_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 6512 DFID F20101122_AAAVYI ORIGIN DEPOSITOR PATH davis_j_Page_016thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
f9f0ff34cf053e2f0b302be97be4f9da
SHA-1
5df65245a27f16c304d9e6a3e25e4992fc00dcce
25244 F20101122_AAAVXU davis_j_Page_071.QC.jpg
44cdd49ac5beb92c0a62e69fffa2df4a
15331c045e4ccf80cb692612a12f251803174703
23678 F20101122_AAAWED davis_j_Page_035.QC.jpg
10acaa9920f6dc8c6e3725b64b0da72f
1075f7357a640e4937857d30b618501071b1c09a
12597 F20101122_AAAWDP davis_j_Page_098.QC.jpg
4a9c24652118075bdc0bd5ee418092a7
b42e19fbd095840719661447612034eff40a490e
24010 F20101122_AAAVYJ davis_j_Page_039.QC.jpg
494fe343ef13ebe224d1f34d4fe9ca39
e734feffed9ed147ad0ad314027eabd97f47bb4b
4104 F20101122_AAAVXV davis_j_Page_014thm.jpg
bd6cd0ed584681a1bdedbdda30ff8e6c
3fcee7d7796be9989454599684b6680335d30ab9
6557 F20101122_AAAWEE davis_j_Page_035thm.jpg
2bd3c4ea5c30e50f380fa16aae99d63f
a40b68e346a13ce324677f6f6fd05e85278a99ca
6469 F20101122_AAAWDQ davis_j_Page_045thm.jpg
917df66b30854867547fca8d41d5ceb4
5446e6415d7c726beb074a30b93bb06b2eb517d8
24569 F20101122_AAAVYK davis_j_Page_027.QC.jpg
ac2963e9716a56376262e57489c62ecb
0e46ecc97563e2b9ee57bbbbd9d76e790fa29834
18449 F20101122_AAAVXW davis_j_Page_105.QC.jpg
8f56229db55087555450c86e6b288601
d78564810a05d41edb84027379db56588a158b25
6510 F20101122_AAAWEF davis_j_Page_036thm.jpg
7f5a86eda6588cd486f00e527f15600b
f5ff8b0da4594d49aea3a2258f86fdeaaadce91c
1382 F20101122_AAAVYL davis_j_Page_003thm.jpg
a84cf03667f2e95958e32d464d1dc543
0e1cefbc265fc491e056064fa66f3447a0c2eb77
6752 F20101122_AAAVXX davis_j_Page_110thm.jpg
b0bc924a1216c55beda5bf01faf3d5ec
677f7079b851d60f522072c994138206d48143e0
25725 F20101122_AAAWEG davis_j_Page_043.QC.jpg
4205ddfbba7ad978a7c6e891933fe9df
9e29d40b6c45cc1dff40f31eb57d03d1e534ffcb
4893 F20101122_AAAVZA davis_j_Page_104thm.jpg
56bdd9c2453fd30929a820950f7e2808
21feeca72b05cc4df7bbe0c67193c84f19d98df2
4784 F20101122_AAAWDR davis_j_Page_101thm.jpg
c534cc4e1228e5d8a05659064747b4b0
2be7e99c69c2f21afe97889457ed282361453442
6550 F20101122_AAAVYM davis_j_Page_109thm.jpg
6714b54fd9dd6266805a131bc0d23472
2abdf80c5a2aecae046fc72b800329317849ab8a
2249 F20101122_AAAVXY davis_j_Page_107thm.jpg
6dd13791a75bfaec811a04b8de225867
40e803566ea0ef26a8547463c5e849c77d66357a
25531 F20101122_AAAWEH davis_j_Page_046.QC.jpg
36dbf4704536823a36ab6242c1822d41
c7d022ab9aef05b01f4c587380eb625223b9a46f
21899 F20101122_AAAVZB davis_j_Page_080.QC.jpg
14fb491eebbc0730145ff4de0ff1d034
2a035441506cf77f84388cf093310e09636cc5c5
8941 F20101122_AAAWDS davis_j_Page_009.QC.jpg
5f3364496ca864d017755f6cee632264
d6464108c3fcb7c42832d45447e20ac73118482b
6671 F20101122_AAAVYN davis_j_Page_060thm.jpg
5a7f3b778d07d489a4466185a6242a32
b317a0bd690b7388225600df19f40c7a225fc762
6539 F20101122_AAAVXZ davis_j_Page_091thm.jpg
53bab68cb5a1cb616804abebdd3b7a2b
0c4b224c84e8403c0a961f224394e7ae4029101b
24323 F20101122_AAAWEI davis_j_Page_047.QC.jpg
7808ef2d290186f399278cad6ef265d1
489c781771601445fc48a23a0a6f519a70f1b7f5
6619 F20101122_AAAVZC davis_j_Page_058thm.jpg
ff6068d569fd71207f2cfd3242f047b6
2261eacafd8f2abe0eea9b673b5ff9ae910d4c8f
26206 F20101122_AAAWDT davis_j_Page_122.QC.jpg
96ae4e22b1cf23decbfe5f215864e250
87c1f717638468f20b4e05727d066e37778a0381
24270 F20101122_AAAVYO davis_j_Page_058.QC.jpg
e15beb238d2172766926fdf6d2574cb9
f6f09b859ac1c23db0576df8271c25d057789ff5
7689 F20101122_AAAWEJ davis_j_Page_048thm.jpg
ca0de731bd4e5c5806cad2c327163c6a
963e3439776db5795dcc23f6b05471f8f787265a
6639 F20101122_AAAVZD davis_j_Page_038thm.jpg
9561eda14fb8e33306a54360c73ffc26
f274c16316db56bc609433c78af526a0e5d425e7
24351 F20101122_AAAWDU davis_j_Page_076.QC.jpg
be89ae27038bac66c3f7fea49fcf8a88
2ed04518dbc39ba4ca9bb6fcf072c6f3661b451c
6536 F20101122_AAAVYP davis_j_Page_053thm.jpg
5f46b0f514618905de238d0807462d50
d994e625aa128e5595ac0ef1cda10fa7ed21e11d
5135 F20101122_AAAWEK davis_j_Page_051thm.jpg
a54df13563d58ae0fca70d62515a28c1
a494dc3dc369c39bc9e545687c81b7c245adf0ff
2701 F20101122_AAAVZE davis_j_Page_009thm.jpg
cb0f7fc16da1513323e363ca56e14735
0e6862c14256a95f3be8c4844435ad7744e34035
162012 F20101122_AAAWDV UFE0012020_00001.xml FULL
757000f578a94a769733243cffc5e2a5
d1537ba49562a88bad2a0559f504596ededaa4af
24295 F20101122_AAAVYQ davis_j_Page_037.QC.jpg
c3fd7ad1e39937813a6f88c8518abddd
a24d9ea4af5b91456180625bfc93ce217c2adadf
23686 F20101122_AAAWEL davis_j_Page_053.QC.jpg
724926161e4a8a4db5db67c6274279ab
4258157ea4a720a00a04b5e02b59f2ea0cdd5757
14260 F20101122_AAAVZF davis_j_Page_049.QC.jpg
7629fd9c8b96a03566f8df4cbf6bdcc9
fccdef19d13afc122ba3930eb9aa9cd01ba56cf9
4680 F20101122_AAAWDW davis_j_Page_006thm.jpg
bd2e5fb20d1def5b3f24022bc7cd0b00
5c133c7b1753046e8fa5664235ef3e5f1dca6bef
5910 F20101122_AAAVYR davis_j_Page_012thm.jpg
f2fe1e016edfc32963e56bd3b6d29f0e
cbba7a3eac47c78fe08ce5ded08d88e2c45ae01c
18896 F20101122_AAAWFA davis_j_Page_102.QC.jpg
b7f9a2d4c8593d3aec77597900991711
c57679dddba3729af0b2667bc9e0650deee11b43
22291 F20101122_AAAWEM davis_j_Page_055.QC.jpg
2c7001a667deaf1d830994ed52c9cc3d
9aeb24b7b84945a9784c8783dd7742cd03f27cb4
25825 F20101122_AAAVZG davis_j_Page_116.QC.jpg
d8c56c387f52b70c593dc53e38bc2277
38cd21e1421cfe1eebcd2971e9d3b3b851be956a
20705 F20101122_AAAWDX davis_j_Page_015.QC.jpg
507b25e12d83c4a02523ec7cbf0d7310
a6ea11629704bf4ddccf954d66643217315436e1
6932 F20101122_AAAVYS davis_j_Page_054thm.jpg
e503c4e4e90023907c9190afe10bdaea
3e8d0030d61c8ad9f5cac1b684c9be57a3d1ae04
18834 F20101122_AAAWFB davis_j_Page_103.QC.jpg
b7cee62a03cdc80e55bbc8957a23bedc
2468a9794ea2f079835e3ea733c50327891c3d59
24196 F20101122_AAAWEN davis_j_Page_059.QC.jpg
ce497f5725a8f3bff664f0ed3d1e9c97
6c87525dba8289b24a0c771d6047784e4487449f
23269 F20101122_AAAVZH davis_j_Page_061.QC.jpg
8e698a731db2b24af5d80555ef2df4a8
dd944dba47657a39283a40837035396448e4bb04
5783 F20101122_AAAWDY davis_j_Page_015thm.jpg
39779f595e34b7a9e6b94ebf218e3617
925e02505ef8c2c64c0a18adbe72ba4185ec6993
24065 F20101122_AAAVYT davis_j_Page_054.QC.jpg
126119759a1950f3139bff77f4bd1106
922e6b0013371740fc06f90c93afe9dd088f2041
5716 F20101122_AAAVCA davis_j_Page_064thm.jpg
d87ec0d873b7f8be657fe976ef5292a6
8e5f824201baf9c983100a494054acf96790a073
18599 F20101122_AAAWFC davis_j_Page_104.QC.jpg
01db602d223d7d6d0cde34e1b466150f
d9c9fd3e3d1bf8cd707085c2cf52df93b54c94a8
6669 F20101122_AAAWEO davis_j_Page_059thm.jpg
387ead05b7424d42a9b5b4880c33207a
6863e52d8281f15b6c3ea14dd85bf5a42ff678f2
23055 F20101122_AAAWDZ davis_j_Page_017.QC.jpg
a2b23b2cc51434bfed8de1f54ec292df
3d39278a9a6acb66581ae2f33950c4b9d5e31d71
18611 F20101122_AAAVYU davis_j_Page_101.QC.jpg
e02f3d8ce794fc060f0d67d20cdbd4f1
9c43baad4ca96c8617ccd11afb504815949ab0a4
74224 F20101122_AAAVCB davis_j_Page_094.jpg
611a2fd8e2976ea33a5452974759e51e
d6d13358a0469b19196edac03967882c9e90d8ab
20239 F20101122_AAAWFD davis_j_Page_108.QC.jpg
1b77a706d7697bc57df5c772c2bd98dd
6533c0c75d595cdd38d412498f004eca2a311332
23954 F20101122_AAAWEP davis_j_Page_060.QC.jpg
16f867eb1a1f5a2b57c35f436c44fd94
3ae3f218e7f3fa15a3ef15c6cebd6f31a901d2fc
3303 F20101122_AAAVZI davis_j_Page_002.QC.jpg
fabf660e8d4ce66bf628306f4221d347
5c97ba5d2ec5f89aa709c4981fe4886f0217cb4c
6390 F20101122_AAAVYV davis_j_Page_055thm.jpg
eed75880aca1a395e01b8e5f8ec60fd7
dbcc08d1724792843b7386271bde93ec88060246
23966 F20101122_AAAVCC davis_j_Page_021.QC.jpg
b41383e035930a58cacace4eb55ca84c
3e825de8600cfec1ec7ffd6ac97a040642b7962c
21878 F20101122_AAAWFE davis_j_Page_113.QC.jpg
0b191cdac528ac14febeaf4cc20888df
cc1f2174eb84525ee82b819f779c541174b961e4
6532 F20101122_AAAWEQ davis_j_Page_062thm.jpg
f0024183fac6a390bbba43b7f7456e2b
4e02464b3c789e7a7f9b437bf31c80a92832bdf1
5278 F20101122_AAAVZJ davis_j_Page_084thm.jpg
56e26d9ddd58d97848fb6f900de9d53b
efbb332ab3da926115302b1c095bd28cbe7ce016
1053954 F20101122_AAAVCD davis_j_Page_029.tif
c8e312c997fadd8a8bebbbf7c3fbfaf5
762c273638915f99caa090904da4f6c547119403
22377 F20101122_AAAWFF davis_j_Page_118.QC.jpg
29354c71182ed53a1440b8bc90a70e54
9fb73046098a91f9d5fc2d0f8e33e2e695f0d5c4
20688 F20101122_AAAWER davis_j_Page_064.QC.jpg
d04ecad3111622d98c92a2bfe6172b4e
cfb403db8b0b7eec866ed287825a17444c37f5fd
6497 F20101122_AAAVZK davis_j_Page_092thm.jpg
5006632daff7d94e2481ab9f9950ef53
89c74ba295f6a92548409fa166217615e69c0325
6465 F20101122_AAAVYW davis_j_Page_017thm.jpg
569790f3408ace62ed99c913b0dc0f4b
c70f8e1a8acbd56cdc0b69670b347969712e8e9c
6653 F20101122_AAAVCE davis_j_Page_028thm.jpg
66ffda6195a451a267e1d9daea2e98cc
f9f3df0d1a980a85309064e9dea6b1b4d7f590ba
6694 F20101122_AAAWFG davis_j_Page_123thm.jpg
1bf50833a24742c87ec64290e1b13f89
793571d1ec79b37185300a10c83c982b10d36954
22010 F20101122_AAAVZL davis_j_Page_088.QC.jpg
56418056da69841deaba778aa0629f70
6dd978e767ffd8e9ee21226aba33dfcc2e9ddaae
5302 F20101122_AAAVYX davis_j_Page_057thm.jpg
48611d57ed5e9d999a01ede127b2bf9c
c0ca22a39b1ca59eaaa3299779e1cd096a5f74bf
25334 F20101122_AAAVCF davis_j_Page_018.QC.jpg
9a9222a49501e30fa29572a24715d6b3
458050bd6f09b932537840d776beb955afd39940
22092 F20101122_AAAWES davis_j_Page_066.QC.jpg
0502c2122d786b96a65867100bb30ee1
06fb9f491d93f59d60be9bae9608e9dfbfa6efc3
9876 F20101122_AAAVZM davis_j_Page_111.QC.jpg
35228134b0269317a026de4bd36c0013
66138927cb3cb4bd5c0d8204ebbb72d7ef45ce20
5291 F20101122_AAAVYY davis_j_Page_087thm.jpg
b903351b756cfdc0b71f4744c4def46e
e8b2a1e21c65695fe6cf072f6cecda9c36f4a0b2
17898 F20101122_AAAVCG davis_j_Page_106.QC.jpg
156a0bcea3a0ea9bc8df21466713ffd4
d140c8ea87d41d948d960873a79fed86b99f14df
6356 F20101122_AAAWET davis_j_Page_066thm.jpg
d5ab472834f0af63cd1f9853baa7bc7f
4511ca71df406a503f461c206e9bea0ae36ced79
6599 F20101122_AAAVZN davis_j_Page_037thm.jpg
77cf9e01c285fa30869c00106ca3561d
3978652589ac4471f6c7fc5f75eb25bf7f5fee15
4341 F20101122_AAAVYZ davis_j_Page_125thm.jpg
17928c9b23a5ff4ee7848c2a93e05e2e
08d0e8e2827e7e52d3a52c102e3ed9979f0c7db5
102442 F20101122_AAAVCH davis_j_Page_066.jp2
0b90d5db5408adefe9c7be0cf625da5d
3b5e2465a3880711b685be6ce14608130f483850
25305 F20101122_AAAWEU davis_j_Page_073.QC.jpg
c71d94b929278600364836618058a1c2
3990293ccab0d71b813f132dcbfdc0ff3edd4ee9
6526 F20101122_AAAVZO davis_j_Page_020thm.jpg
f9de2723f9df04f3a39082df130e59b4
65fcd33f00970ad2b999d1413d13d2922bf6d556
73865 F20101122_AAAVCI davis_j_Page_039.jpg
ece7b385042eba06ddcc7e6912b7cd5f
0b019f6ecf7ae21c5cfbabe5a93150e7fcf2a8a9
13821 F20101122_AAAWEV davis_j_Page_081.QC.jpg
135d326647c2c3d5e53f33ef6e354e85
79ca6a9f5e8ab5b7840fb19399194d9d6080c342
12556 F20101122_AAAVZP davis_j_Page_063.QC.jpg
bdb878405e1848a5c065f6d6401625ee
b12edeb8832a78758ce16a3f66f280f4673923a8
6499 F20101122_AAAWEW davis_j_Page_085thm.jpg
65999e9237deb3d5b983b9bb1c97371d
b373dafcd356150a8c0e07c79ebb813099611b32
6770 F20101122_AAAVZQ davis_j_Page_039thm.jpg
2cca69714b278b552ce412a6db660e13
3860a8f35a626b82dcc38e1add217d3f49e9d869
73936 F20101122_AAAVCJ davis_j_Page_060.jpg
aceeee335097ebbed41910f0980ad306
4c66fd83ddd7981783a2b33b040de68a3b4aabbb
6309 F20101122_AAAWEX davis_j_Page_086thm.jpg
ba5fec1b8155fd0379b08ec4a7a9a662
4fe9c85737ed4e63465122eab83718af9f2e78ea
22570 F20101122_AAAVZR davis_j_Page_074.QC.jpg
0d30b002ede582d99440449e311f332c
058d1eaa33ee4610c29ae311c271bc0715ddb42a
68722 F20101122_AAAVCK davis_j_Page_074.jpg
07596819e4b175a6aa060b66f2d3b419
5a281e46740b13cfe2eefba3ab7123eeaad56716
6457 F20101122_AAAWEY davis_j_Page_095thm.jpg
650afb4c80d7c5644caef6f2cd643c7f
07ed054d4fdcedb2d826ddead8de89f9e96c9811
6910 F20101122_AAAVZS davis_j_Page_018thm.jpg
5bea677d0b41cd9f4a936f451af6eec7
d02ab657d43a83a688d66bcdf1f99649e8ea003f
25516 F20101122_AAAVCL davis_j_Page_070.QC.jpg
491f5f31dedded1f1296388716dc4add
db9a3e2101e867cef5212b91c26ef1f5a3b2a90f
18769 F20101122_AAAWEZ davis_j_Page_100.QC.jpg
63d03861a2acc825583b5d1ba8f11327
ae3afa0dd6f8f533ff1ff8e46722906bd919529c
5168 F20101122_AAAVZT davis_j_Page_010thm.jpg
57d425f392f74e4c22ec3b62c1896e3f
419549251667309d8b99eb1a349b13ecc70ce3f9
1903 F20101122_AAAVDA davis_j_Page_029.txt
442f59e807f401aafb5f06ee03641d2c
14777dab2472d71fafeb91a60a343d9a80ee80ee
6527 F20101122_AAAVCM davis_j_Page_093thm.jpg
e225ffe39e5bf2e46d7856985ba8fe7e
73d67bde6f2faa86769a295e0f1adf049ac6a822
23240 F20101122_AAAVZU davis_j_Page_096.QC.jpg
32dfe4c3ac2d39d50e24c7d7404694bc
c59482788da444ae89477299a85fdcd90789a599
24236 F20101122_AAAVDB davis_j_Page_040.QC.jpg
98a8f33f81e4c98d8d42e6980732d73f
d3237f9070f49cdfd998fc95f60a523f5132be74
689933 F20101122_AAAVCN davis_j_Page_050.jp2
f7be5c390d7ce4a11e2b724ebecbab2a
8d1a38c818bf34497c37d1d03ca892b5b0f6a581
24052 F20101122_AAAVZV davis_j_Page_038.QC.jpg
2af437caadb865569efcbfc8a36f478c
19dc64181fb335d226c6f58c489aa56345befa02
18075 F20101122_AAAVDC davis_j_Page_079.QC.jpg
4b0f2f0638af65c84445b6fd04ae9463
2ba5614d0145eb4aea9162fc49c1288bd3994c7d
23024 F20101122_AAAVCO davis_j_Page_091.QC.jpg
7ad4079c2ba91b5c245c55da4d8139f7
642e415d0d67651fdd3129b60b0a89f5e6f3b0eb
5741 F20101122_AAAVZW davis_j_Page_032thm.jpg
5a2600635cda3e3052f4a5ab18c5903b
f7c74e4c30b052d89bc6d1da8af1b17f0d9d31c9
389118 F20101122_AAAVDD davis_j_Page_111.jp2
e0a140ad205281d883e4a1e7ff4ae923
99897a9d0c19e82ff349e78d8b19acef440a1420
3215 F20101122_AAAVCP davis_j_Page_102.txt
2d50108d6868d8a820420b19ba5bad57
cbfbf7a07c4fb3495df34303c2ecd41c7596106f
26098 F20101122_AAAVZX davis_j_Page_114.QC.jpg
93bc772ed7066023ca9d16e096bb6473
45a050e7e6c3bdca90a48b93aacfabb53e35fdbe
15733 F20101122_AAAVDE davis_j_Page_051.QC.jpg
c6b0a28a71237cd07d1ed38e1c90f8b7
803e7883833190ec6646df13f87eb9ea2c036a9a
6549 F20101122_AAAVCQ davis_j_Page_013thm.jpg
41be7b961d08697bcdba33538127a577
dca65305ec456afa4f282c1f726da2b4254ae06f
6995 F20101122_AAAVZY davis_j_Page_046thm.jpg
59a1b1bafeb837848d67f5bec06bd3ad
969c59a1c6c09e2e3b175cc26aab7e4d2d5cd418
3254 F20101122_AAAVDF davis_j_Page_003.QC.jpg
acd14a1a6bda199fdbc973315fc0e05e
17ca713547154bc79e9514098f3a278def8c1f03
23077 F20101122_AAAVZZ davis_j_Page_092.QC.jpg
8a63d22bc39e1711a2a7c634f3949c37
e8f972a1afc7937053fb6ebebbc40883770ef672
25271604 F20101122_AAAVDG davis_j_Page_109.tif
4d80f0dd1059827a52200a4a1837e7b4
319dbee9647af11f8b61c9cd869ffad3024c0841
6674 F20101122_AAAVCR davis_j_Page_027thm.jpg
1c6c104daf5f1b53baa5caa478b61cf0
843edbe358caded2ce5c120a00866014249112b3
19585 F20101122_AAAVDH davis_j_Page_099.QC.jpg
e45b81539c05c912b1a05dc5af73a061
95c22ef0a5dc34f239e5e5902bd4cbaa6f46b6f2
50963 F20101122_AAAVCS davis_j_Page_050.jpg
24b0982579725f23f6b2d298ca9bf919
d7ec1dfc43f9da3e1fbfc645040d63ce5b7c8aa3
778 F20101122_AAAVDI davis_j_Page_007.txt
7538d893654b2d68e1fb54555349643f
8c86cbbb2005cc091dc11392b6d90320335075c1
6573 F20101122_AAAVCT davis_j_Page_052thm.jpg
70cd2252f46ad04a4d62a8bf91cfdf9e
8532f433ddc79f97672cc65db3b329447cb44ef9
1751 F20101122_AAAVDJ davis_j_Page_033.txt
d9b3bc20c324a02eac188be5cda60694
023dc76fb2163a27b236553d6b95e41b099f2a5b
68801 F20101122_AAAVCU davis_j_Page_102.jpg
31dbbc8e6dc301f5b48c533acca33c62
5dac55dbc2547406cfbeb81b33f756c9da2f4708
18482 F20101122_AAAVDK davis_j_Page_010.QC.jpg
1bd2d32da407aa7cd08113dab3854199
a22623763840b82cda7fe4b7f15354b5a9af0962
24880 F20101122_AAAVCV davis_j_Page_123.QC.jpg
09d1716ca1e8a640b1fe712c78e13e88
ac46679314166c99704380d65b32b9faba74542b
6953 F20101122_AAAVDL davis_j_Page_121thm.jpg
351ef3fc9b60c428b1312088bb2bd7c1
9a5ea5ee9386c2d3371b10b8118a06a345dff54f
2445 F20101122_AAAVCW davis_j_Page_008.txt
27a33d7f90a209c7c4bbcf567873728c
5db91d030d554ed4443beaed702630f26ea18028
71600 F20101122_AAAVEA davis_j_Page_091.jpg
dbaded58cf984199ad33de40eeb2f0c4
2068d291fa7d1020426f68efb41d7680341c3e26
1878 F20101122_AAAVDM davis_j_Page_044.txt
14be6ccfcd00b60b4d9ccc4a185eff87
21ab52f1a226faf4d2d8b41984cae9b4bb02cd53
55694 F20101122_AAAVCX davis_j_Page_097.jp2
d96ac8b5c30e4f24188fd503691a2da1
6cdaebc2690753273f8f0c6c22715ce062345658
67538 F20101122_AAAVEB davis_j_Page_066.jpg
08fbaba8de4b384ef274fffa83615988
2b70f9e438e467097e6f49d64d422589ccbd0f97
99861 F20101122_AAAVDN davis_j_Page_023.jp2
07dcf7c9a2a61802395fdd50fc03ee9f
6cea19bca8083ecd83b92708458e1e6e8d597ba2
21532 F20101122_AAAVCY davis_j_Page_065.QC.jpg
976e2822582b365cd00b91ddbdafc03d
4e975114088bb0cfca06fc30f36d052915ac9b1d
F20101122_AAAVEC davis_j_Page_106.tif
470621a1dc5410991eb8761bcda09046
2d24a1e5e6371e7874656491864af0c135d422fa
6656 F20101122_AAAVDO davis_j_Page_076thm.jpg
224a1933025b4460823a171242c24725
9233469f123dec43e880d3e126e490870934ca5d
1860 F20101122_AAAVCZ davis_j_Page_030.txt
a59f8e7108f245f78f2d27e55d78622d
827baa4ca1ccac4a6cbebe5a78162db27cd2d2fc
4926 F20101122_AAAVED davis_j_Page_103thm.jpg
bde781d217b5f091cdeed7b04d540681
5e91a6e92e1a6ab904532487eabd48ed387e39d7
73256 F20101122_AAAVDP davis_j_Page_021.jpg
f5714fe3e87fc1471271b296f8dd7b04
b98a940ab40f82104746e59124056be80484737a
71779 F20101122_AAAVEE davis_j_Page_072.jpg
05275a2a87485b16ed2aad777c83de96
639c64a5901e3998c12e7a8a734df83be6fe72f6
F20101122_AAAVDQ davis_j_Page_031.tif
02e8632e4cc310b4ecd754dc4e40869a
3d42b76c31097f9f3bf1def5059799e1624af209
13238 F20101122_AAAVEF davis_j_Page_126.QC.jpg
34215683fc0374abd59d203213b71e3c
cb8a200260485b831f6c71c51ea16644623748bf
2055 F20101122_AAAVDR davis_j_Page_027.txt
675707cc9a9a098c66b900045fe25ea4
1637d27308e80c5ab724adedb876d89c7c694d4a
5704 F20101122_AAAVEG davis_j_Page_033thm.jpg
246519b7fdf88ce05b91fd6304819a88
8178f54426457aab46f3c034f47c8eba38f31547
72523 F20101122_AAAVEH davis_j_Page_035.jpg
1d2e6a2d36a440de1114b94733e1eb70
4d08e540c4562309d136e345844518010ff403f1
1998 F20101122_AAAVDS davis_j_Page_079.txt
322ba70099cd598832d6e3b82b09bb7f
2111a5bc7fb37eb75785ada0e3c990118793b323
72227 F20101122_AAAVEI davis_j_Page_080.jpg
2cce8aeb6b35366b24af4965e0207a17
923f76adedc9cd9375ac1a4c35d6dbec7b678bf2
F20101122_AAAVDT davis_j_Page_027.tif
0b3c87ef7e3aa0a2cf790785b70d6f12
ac14b87f5eb0cbdc35a605ad4c9404cb2d22fc66
56489 F20101122_AAAVEJ davis_j_Page_057.jpg
2e2044b929b67702948c3f5d03f49813
ec5983bc0fa53f14833220132e38b6788b5aabc5
F20101122_AAAVDU davis_j_Page_028.tif
e670a8b65283cf7997779b2d11188cf8
77818e14d07a7b89e28124eb90715d72a9aa71fc
1955 F20101122_AAAVEK davis_j_Page_092.txt
7ac49d8feac21f9c8798666e8668c603
e970e9e056a1bd3d0acf249415e3b7ed8d6ec0d4
17642 F20101122_AAAVDV davis_j_Page_087.QC.jpg
8831e85538d3410da3fc010f58ae4767
8f9acdd57cbf0da127fdbe2ef3cdf4df7c721907
1003709 F20101122_AAAVEL davis_j_Page_079.jp2
5e27349472cda84de57e0b5d1720634b
111c97af55daf2e1c69259b58242e73118a2584d
24035 F20101122_AAAVDW davis_j_Page_085.QC.jpg
0b77d07de9ae735c98ffefebaa4d0617
2a3a23375ee98b514d6f2b0fe6630e57488fac8b
4238 F20101122_AAAVEM davis_j_Page_081thm.jpg
3eee00ba36b496c4e4f7f373ac59cb99
c8008586e98de3b7020408e27f6c4ed537bb2a39
1051980 F20101122_AAAVDX davis_j_Page_119.jp2
7e595efbbcacbb5a45cf92decdec4788
459d97baa0d49b6be45fc7464b0548260540918a
F20101122_AAAVFA davis_j_Page_037.tif
44cabaab191d2844d8f03eb8341cb49c
d3009379ce4fad1f0d7944047131fea66124e89d
541772 F20101122_AAAVEN davis_j_Page_098.jp2
f8b2288f1235ddcb7788406a1449fa1b
6101e03a78ffb4e8f2c9a5fae2350e4169bb1ea0
88641 F20101122_AAAVDY davis_j_Page_109.jpg
92866ac46a8f49898f1e1975c9c4a64c
b56fc52b8b94436ced6fdaba68713a278cbca013
23508 F20101122_AAAVFB davis_j_Page_020.QC.jpg
41458d0002507e80b62a40d49c8e9a61
865fba04c0f727531f9090099dcf730f8fbcd161
2376 F20101122_AAAVEO davis_j_Page_117.txt
d5ed0ee6bba97b3f65e8d4a4942edb15
2b6098bc4d7f1a752805d4eae80b89c015661dbd
F20101122_AAAVDZ davis_j_Page_096.tif
dbc520753f585680062d22d15afa10c1
a99d6d2c53cfd7c08510831789c049a71b53925b
1925 F20101122_AAAVFC davis_j_Page_017.txt
32f5404748cb93eec27d862c01c359cc
3f668c6b1d9c774d57f8eb47d86268ae193f9cf6
23890 F20101122_AAAVEP davis_j_Page_025.QC.jpg
a33f8af2cc02eb79501a0ab915513d27
130bd5b1b4a5276fe4982086aa41799289462dfc
71262 F20101122_AAAVFD davis_j_Page_096.jpg
4b7fde9d16b3e0a7bf5a12aab62b982a
5821f9798cd739d74d11534433124818426b4bde
5552 F20101122_AAAVEQ davis_j_Page_030thm.jpg
d3dc29108503bea6de6ffd6af368ce23
e7f8aede76b10fd8f9f79d17cf108bf5fb6911a6
F20101122_AAAVFE davis_j_Page_055.jp2
0b5424a5cfc4e0b631e7dbacb854951f
9083724e98d9c84466b2d3e2cb3b6ff271a47176
6893 F20101122_AAAVER davis_j_Page_073thm.jpg
4f34c909b2ef0aa04579edf58959dea7
be58daa06e67784e76f0395db9ab78f2032c82ad
814066 F20101122_AAAVFF davis_j_Page_087.jp2
9d815e98ce0e859ac14bf907b33cabdc
682fd82f5d0c99d1414b55af69b0916bd715db35
F20101122_AAAVES davis_j_Page_078.tif
19104c0cab9bee0ce7c293877e714d19
64532a156cf2c8ebdfc69cd476659e8669949931
2034 F20101122_AAAVFG davis_j_Page_022.txt
2bd7661b71f99113bfbe5b4fef64bbd2
50408ba49179614778ebc9620ac7706e4073a492
1989 F20101122_AAAVFH davis_j_Page_096.txt
ef20046774a2856dd826dae213004a46
3d3fede8bc8531a13eb4b7ce2b30321016e837ba
106665 F20101122_AAAVET davis_j_Page_017.jp2
8d1b711bcc9986965cfe0c90efbd0847
9f766e327f66672cf89a23be3ab7680bebc3a7f3
15169 F20101122_AAAVFI davis_j_Page_089.QC.jpg
2cc529d1ace280be7a733a5f17a03940
14597aee12b1ca64d21b011d43e916399559519c
24124 F20101122_AAAVEU davis_j_Page_022.QC.jpg
e59d4be38fad592086105fcf35d661df
8de39de9e8bd7952c70afa017e4d1fa265a4f1a4
58600 F20101122_AAAVFJ davis_j_Page_010.jpg
6ee7855836bb9f52cf5616a2dd00496a
c6fa124057f577f89f3868eb2ee29bf2f0e3ecf9
14398 F20101122_AAAVEV davis_j_Page_014.QC.jpg
338cf392a4ff4153a873a119170c5fb0
0ebb3e09b9a103f1bf172457402861d03d8a478d
13122 F20101122_AAAVFK davis_j_Page_097.QC.jpg
21d166847dbff70138f7e619c21d7866
52f3b9ce1edb87a479aac447c74bc75d160910b4
3826 F20101122_AAAVEW davis_j_Page_097thm.jpg
0973047ff71f06cb7dda02845db4f8a6
bbeaf5aa36ccc6aa1ff283db51091bdbc2265778
19472 F20101122_AAAVFL davis_j_Page_090.QC.jpg
ac0eb00c41f54eaffd1306e1cce2ae30
04c59d6b577e98f04b8c276b23335593e79b5c38
2546 F20101122_AAAVEX davis_j_Page_001thm.jpg
5e183bb3aabd584ca926651128b8fd14
b9566bc866e20d8dbe81353e044d81e5e1577c71
2042 F20101122_AAAVGA davis_j_Page_070.txt
a73de5efe1e87f6d612abd064cd310d3
3eca0de907b0a2bbe7dc7f64d146e5c97645c637
23325 F20101122_AAAVFM davis_j_Page_107.jpg
c01673f265692b29af4330d2bae9594c
7138322bb5e7cd9a964742ccb77c05e4e4b674c7
113895 F20101122_AAAVEY davis_j_Page_094.jp2
aaf8fd4673f379fb331cb3fe48600564
c2c616bf6bdf656601342ca74c383d36c8f9e1f4
88712 F20101122_AAAVGB davis_j_Page_116.jpg
67de390160e08fd0de4c8c5daaa9748d
364ac04af9fcb0e8d0098b408ad981470431de1c
F20101122_AAAVFN davis_j_Page_093.tif
2b13f8b4450b9f524cedfb50ecc26e64
d17c5c4a6f2648e73aa426c0b3506397eb8045d7
19326 F20101122_AAAVEZ davis_j_Page_030.QC.jpg
1966719a552e4beb626809a033cc6d17
0f751be3d3ae5286924d8c5f6d4262bb566d3a0f
F20101122_AAAVGC davis_j_Page_071.tif
ca288df6444ae6ac97e11a80cc6c5896
2a3763d987de72e732ba56a2fc7a995f4d3e9dc2
2012 F20101122_AAAVFO davis_j_Page_087.txt
5843a5f09604724698bbda3d75c70f74
c2702938d68a2f7234ceb614f602402ff83709fe
94506 F20101122_AAAVGD davis_j_Page_015.jp2
8845c53e7fae857cbd3a980f3be1a18b
b8f252239a664f421893f6956a890c52ec4d4715
6460 F20101122_AAAVFP davis_j_Page_078thm.jpg
27ea1c2c37d338a687bf2862425ab6ef
cc3f10af34e716ffd348a0cc6ae3477604df1bbe
23748 F20101122_AAAVGE davis_j_Page_013.QC.jpg
1deae6c3f48b45fc06108dc4e368e21b
070ed30a7b37a68ac15e1ce18687cc9f1aadb606
22968 F20101122_AAAVFQ davis_j_Page_029.QC.jpg
038d1e1f12525703c03d36c55171f530
4e545e80c8d1c2073b06d01d4d7981f27268f5ce
118332 F20101122_AAAVGF davis_j_Page_118.jp2
c90e29e471a74ae8afd14e91f28f9dbe
e11137560999e22e2c95f65dd2c88a175674506a
25085 F20101122_AAAVFR davis_j_Page_121.QC.jpg
2061c467ccf8c646b30205a306feb685
d738e9d9aef71c8c0645235a15371d7ab16377dd
6163 F20101122_AAAVGG davis_j_Page_090thm.jpg
559491ec841c957dcfa17a53329a6cf6
7e469dd0716e11978263b19f56560377049bb1a2
4749 F20101122_AAAVFS davis_j_Page_004thm.jpg
fc50522be91f12c4f9e795fe8250a5b0
f38d3e2bed93c267534bea3fe93b3bb0cab9b1a6
109256 F20101122_AAAVGH davis_j_Page_034.jp2
cb141d5202245c6644ecb8d6ce68cec2
1677ac8d5383eb968cc45c96e97507a3c56631b1
104534 F20101122_AAAVFT davis_j_Page_112.jp2
6b2b19ef57bfc77fb8eb47d3185982ea
fd526858285791b5e294969488f0980f1c521970
4235 F20101122_AAAVGI davis_j_Page_083thm.jpg
83e457396fa985556f97515e08e07e02
f55be23e98ef324f67f5348e06afded71169abce
F20101122_AAAVGJ davis_j_Page_052.tif
9f9d425d656a08dc956c68bdf3a97417
49bd119b90ef9bf21d61cd8416cf4545669b5939
96196 F20101122_AAAVFU davis_j_Page_119.jpg
eb40474d6d13215f39950379376ddcfe
7d57926bf8a0859c9d7791201fa80b20acb79a0e
56992 F20101122_AAAVGK davis_j_Page_087.jpg
f31ddabb3b85ad91aee9b98c0f06955c
9bf77b124ba7915f9ea2b3cd8388fb8fb83fa174
113244 F20101122_AAAVFV davis_j_Page_076.jp2
86d306f838fac206af9de6540f4eca77
a377be6e237d29b5dd67a8d4b7f1788c333c197c
2067 F20101122_AAAVGL davis_j_Page_067.txt
49e299f54f5c8f6a1e82ad0f92019980
9394141469e4ef79426c933aa637668c11c4a856
6991 F20101122_AAAVFW davis_j_Page_116thm.jpg
d076f1f4ff9bb2ef03a070ac57a3b0d8
a965abfc4a15781f4fc6d15aa99f47f9bc015e81
6633 F20101122_AAAVHA davis_j_Page_040thm.jpg
c6f4a5a163147dfe7670166c21503eaa
35280c926e423c05544f89fb2c0ed132641d06d6
46754 F20101122_AAAVGM davis_j_Page_084.jpg
d6d578cac58d5d68786f08ca397b60f0
d4a6db61fd699ed753fc7217d203ff91011bb9e7
130515 F20101122_AAAVFX davis_j_Page_121.jp2
f2b7a3ba5fc96e3ff61f9da4a1516bf3
7fc2eaf6ebe966ce460872bc2e74f3db189b5514
6478 F20101122_AAAVHB davis_j_Page_115thm.jpg
4973a01c761e8a682a3bed829298b3b3
36d3b42b5499f4496bbdbf245135b425768d6c4c
1987 F20101122_AAAVGN davis_j_Page_025.txt
f120715f458b1a4cbddc11f69ea66105
e3be51cbd248fa1e30e29caf9c7966ae85e7f985
F20101122_AAAVFY davis_j_Page_013.tif
e94352200367ed354f88cb920d30d6da
fba3db058aa19b5faa9a128f802a1614417c3c59
1360 F20101122_AAAVHC davis_j_Page_125.txt
e4b3d8cc6d418be6054e028b462f3fa5
f453908f6da9f8d239394b05a3bd414fca578d0b
20537 F20101122_AAAVGO davis_j_Page_112.QC.jpg
2cca47792f143dece99bae162417327b
09f0c9ea02b4f36ec7daaacc86166409029ac01f
1051912 F20101122_AAAVFZ davis_j_Page_109.jp2
75e334d9776ad4dfab4f86bc354a6ad5
7c34c27f3366898454d7a3f38c150da2e64ce5f9
F20101122_AAAVHD davis_j_Page_047thm.jpg
5912d0958f826f6932d25d878501d87c
c2a776bde3babf5b8a6723f3f4a207ff1962b1d8
84197 F20101122_AAAVGP davis_j_Page_117.jpg
0960a3e952f71df5ff06ac072633d820
4bcf6a23184edb88f7f7110b73c2111b617aa75a
119108 F20101122_AAAVHE UFE0012020_00001.mets
a0786fe7d38991478e3de7451b9d060b
2084016254897fd0431bad5558e477eeba7dc21b
41739 F20101122_AAAVGQ davis_j_Page_098.jpg
00766a45200e9f2a2b03a0eb79190574
fe789f86b8314055dfb3d2aedec42431bb0db98f
24964 F20101122_AAAVGR davis_j_Page_067.QC.jpg
d3adbc8add5a83cd7f96db1e48a3459d
f58969195fd681190b4117ea14dafb0eb2e0958a
6347 F20101122_AAAVGS davis_j_Page_034thm.jpg
d1326a069d89ab25c0bedacf805db992
f4577e602d0c5001c1d800526c2b50097f16be3c
1051971 F20101122_AAAVGT davis_j_Page_071.jp2
b2f316a4307b363a88cc267471975cb2
9d78e02fc1cc964323c98635ee5c24b880ec2409
24637 F20101122_AAAVHH davis_j_Page_001.jpg
486606cc68897ce190115bca47b61fa9
f51cb8c25c9a86008ddb352157c7ec4a2d8b3b10
73462 F20101122_AAAVGU davis_j_Page_024.jpg
335ff2a2cc656148c8f9ca7ab3c5d2ab
0d773ca7fd22eba07a2fc2f8f924693ec38a5c90
10283 F20101122_AAAVHI davis_j_Page_002.jpg
e9a2b2ff924f66684c28e894d015135b
8319a1803363ca1fe962ddf238d4e8e9d32c96e0
10782 F20101122_AAAVHJ davis_j_Page_003.jpg
d0843dca9ef389afe94ffed0ee6d2a68
95da63a6da70ad8bddedc62ff0e7a8eea44a4a09
F20101122_AAAVGV davis_j_Page_039.tif
60114b0f2c142a7d93e88f158f45e8e6
4621be1f5ba0b2a86f5095604e5380a2d9e1fe15
47918 F20101122_AAAVHK davis_j_Page_004.jpg
d6af48188f7a166cd78af15efbc3af37
e9b61497f82fcbe0234d9d1742246909cfc3c622
F20101122_AAAVGW davis_j_Page_045.tif
290ac25d93d805ea5a30623ff6e59254
5bb3c68b66365418c3936bb229a575c139762d96
74673 F20101122_AAAVHL davis_j_Page_005.jpg
1fa99997d70df329cfb5e2d9efb0e5d6
3837999da12d1db1bcab3e51ad54254c33febedd
2854 F20101122_AAAVGX davis_j_Page_111thm.jpg
d4503da7126ef479a38a0d7e75fb0459
1b03d13827e7a0159cba46ce0aacf9bd822e7dae
72900 F20101122_AAAVIA davis_j_Page_022.jpg
1fcd0d65f5bf048604a2e32d5692c642
2c86ca019b1c7979812cb1b63f5f09560e7f5137
69456 F20101122_AAAVHM davis_j_Page_006.jpg
28aed2f25844e8966ff828ab0cb7430d
f2e473d561532485c7d2fc5ff03e62c007819da2
6157 F20101122_AAAVGY davis_j_Page_113thm.jpg
38457f64edf100432c47a130a0c9fd31
b375cda238f04f851529d25997c53e99f39a8630
65909 F20101122_AAAVIB davis_j_Page_023.jpg
af5c3b964febe7cc1c1e09a2ed72814c
080a9b5caa77b429adf23f4bfe4d353ebb7e1816
31233 F20101122_AAAVHN davis_j_Page_007.jpg
37690967f259eb6da395d585d08df27b
d4a2dcd2fd9af66578f76188dd2c041b9bb883aa
106429 F20101122_AAAVGZ davis_j_Page_077.jp2
de70cf8b92145759f2cd52504cd8bd99
71f339289e0bd4b88002d85724dbeae767173d19
73554 F20101122_AAAVIC davis_j_Page_025.jpg
d30871aa1be756810f871344654841c0
7b2032d6cd55ed08d7ae8a45587d6c482f30d05c
72258 F20101122_AAAVHO davis_j_Page_008.jpg
96998bd9f3636b5da1626c76051b6b83
ae67a2f7588b489ac17faab43f73f6117955ed75
74377 F20101122_AAAVID davis_j_Page_026.jpg
06081a75bef68e5cd56d49e998a9fc6d
d10c4ae0867da3b55dfe530774ab3711d56525b0
30448 F20101122_AAAVHP davis_j_Page_009.jpg
7652f58e5c03277fe9ceaebd0968dc0e
c2108bea59a5e89f681e3b1376151ab2a7ba2360
74951 F20101122_AAAVIE davis_j_Page_027.jpg
4850b32ec87ee0f3072aafb9356d5318
f5726e361cbfd1db156a3f6ebf99d1bf2f09c2e3
48069 F20101122_AAAVHQ davis_j_Page_011.jpg
9e21645e78470b6d0fa61880d4f8f7e8
ed74bf5b10f865a1109050db3b5891bfb5a380a2
73190 F20101122_AAAVIF davis_j_Page_028.jpg
b91736cc40ba5ebbe23064f6ab0c148f
0e6b363f4f56671ee7f1595b8d0d45b364386568
63558 F20101122_AAAVHR davis_j_Page_012.jpg
e1f398f027c81342adc4c51b2a96f7e9
be716d68414090d64429c0aadd1c8b6e888c7b5e
70029 F20101122_AAAVIG davis_j_Page_029.jpg
7e694d6fedebb1918dcc6df4eacd75e0
eb8f9be962464045900b2f20c29582e29c7befcc
73134 F20101122_AAAVHS davis_j_Page_013.jpg
f70147d1436c8360ab45f07c7afb6044
429144fba0d47dfda3389d43fdeba77957544ffd
57969 F20101122_AAAVIH davis_j_Page_030.jpg
cc27b711fc242844db193e30a2fc1b1f
be9e9d066f7dba5ec224832191eb63e812af821a
44131 F20101122_AAAVHT davis_j_Page_014.jpg
73d4bf5c0b9aad2ff06844783156702c
f8ad17a858e645b353ff72e77811d68fdcfa7ec6
74567 F20101122_AAAVII davis_j_Page_031.jpg
fa6a3ccc709313fdd5f526327a689c05
68b4b32dc7d0a81b22abd83f6d7841a1ea779490
63276 F20101122_AAAVHU davis_j_Page_015.jpg
7e939b69e3192d5f115bb0f0eb22a45c
302a31729eea9cc6a1fabbbdf78f957002203b9d
61067 F20101122_AAAVIJ davis_j_Page_032.jpg
bb9b3dd8be823d60a924ca7d99f4b3fe
0b16a660ba11b339d8fe0bf52f1eed1307911359
72504 F20101122_AAAVHV davis_j_Page_016.jpg
25f93e54d5f27fa4d19fdde78e6a57a2
98a964d3e3a184085a6a21d3d94bd5fe986e58a2
63624 F20101122_AAAVIK davis_j_Page_033.jpg
11b1693078443f7bcb6e62b3b0707cda
3960f8cb1a4bb7d95702b4a01bf2ea50e318a7d4
71415 F20101122_AAAVIL davis_j_Page_034.jpg
51999c50c62ac4d1dd42443f1e23ed95
32b4139bab04721685fd2afe896c36699386a0c4
71310 F20101122_AAAVHW davis_j_Page_017.jpg
5077160605c057fdb61ef4768b104c40
5faf90017484283e4924a24f47526ae280f1ebe0
72350 F20101122_AAAVJA davis_j_Page_052.jpg
557d22bc9aebbf244401c2e66083ebad
40da7867fe4ca9a130bb6fee73b1a8854853d9dd
72140 F20101122_AAAVIM davis_j_Page_036.jpg
05d03816a295700984151bfbb4fe0537
cab69435aee9540e5e0a95287adb86e6fe8614d3
80184 F20101122_AAAVHX davis_j_Page_018.jpg
e16ca72d6aa30de5f3ae5921a5df63f6
1b42593262acae9d5ad0f07750ea27c3870fed71
72704 F20101122_AAAVJB davis_j_Page_053.jpg
e682dd324af915d23dec1b10ebade3f9
93c39d4f399c6e4461da879d2eeeec7afc270e07
74451 F20101122_AAAVIN davis_j_Page_037.jpg
369c673fd24ebf18655abec9d83f478f
a2a06c75a6c9ec81f2d1aaa3795c1d3480b46e12
71182 F20101122_AAAVHY davis_j_Page_019.jpg
72c941137140c38edf1c3f94e1435591
3e93e6cfe975dbcfd5f2e7d2dc3a3414d004ebcf
75652 F20101122_AAAVJC davis_j_Page_054.jpg
9edf370c23d1749a2e6ac12bb0f3a844
d36072098d4cc5cc982ac0905ea09066b9544519
73688 F20101122_AAAVIO davis_j_Page_038.jpg
6fceb0b7492085dc3e04ce3c492e1c98
f63a3fb49b0c714f81c4165b9a21151824c375b2
72224 F20101122_AAAVHZ davis_j_Page_020.jpg
372616ffb0710174f17403b717e519e1
dc2c9f9c11f2e545d528fb83cca11c9d68688212
73504 F20101122_AAAVJD davis_j_Page_055.jpg
67719557b237bda527345fbf42891a50
bc5dc3372ab7b099361ccf988f17103a8202e28a
73761 F20101122_AAAVIP davis_j_Page_040.jpg
57aa48eddca0e2317572afd500e59df5
7e1d0b56ade6fc0c5cd9bd21a46fd3725099505e
77478 F20101122_AAAVJE davis_j_Page_056.jpg
a1021b943638922e7a3894ff8b2c8161
97d1a5f79cc263bacb7b2dac69f3c5575950e3d6
74217 F20101122_AAAVIQ davis_j_Page_041.jpg
37e68da8b3d599c2b493df961dcaed88
888a40066271dbcf800f9bcd7552766cfd5ca0ab
74097 F20101122_AAAVJF davis_j_Page_058.jpg
452d486d23d230f45821830ccc8af509
d808b37d99cbaae10c6df9aa0cc7901647d54902
73336 F20101122_AAAVIR davis_j_Page_042.jpg
9afe017846bb46bdd4ad72bd90856a0e
9b2d14ffe29494b4a4fe578d6f55a7756d65b8b7
74448 F20101122_AAAVJG davis_j_Page_059.jpg
f637240a31695c9bc90c47c4be6e714e
07ee6b9a2537e920186a61c84879bd116488827b
81738 F20101122_AAAVIS davis_j_Page_043.jpg
27a41bcf50ea8831dc6a51b57c5ea68c
a87a2c27dffe2d7d38a1928d7c3d5bc362a89a9a
72312 F20101122_AAAVJH davis_j_Page_061.jpg
46db954636a288bfd8a881e9c3a64c58
f5054cc64e6dcec78d276fb90834d1fa8f7d1933
80498 F20101122_AAAVIT davis_j_Page_044.jpg
739b560eb2aff0c1453137440cfe58cc
14da1193aad7b55b14675e1839178eda903a4434
69695 F20101122_AAAVJI davis_j_Page_062.jpg
80cf211beb008f5f1b2398a24e2be1ca
cc6fbcd8aa9b86b0fe8d067586302c403e506b4e
68499 F20101122_AAAVIU davis_j_Page_045.jpg
e1109d7c43905b87fab395a4b74552a8
95d9834fe3b35141f7f69b4cc3eb523007ebd263
38334 F20101122_AAAVJJ davis_j_Page_063.jpg
c127a16e7f0c1ab03480d3b5996495bf
dfca0d781f9aa14322f15dd4259293debd7f4455
77332 F20101122_AAAVIV davis_j_Page_046.jpg
a1c3da81f3fd0b44e4069c7d4c861448
fc79d179337e8704da452a8558510ab373dcc1ed
63065 F20101122_AAAVJK davis_j_Page_064.jpg
8b33dbae1251353b81124cc23224a53b
e9c42e2b7e4ce2be805f446429583a4e8c143f92
75155 F20101122_AAAVIW davis_j_Page_047.jpg
d9d24584559a8d3d6474bec36822bc44
6d32f88f05748f6092b6f641a38f771070c77294
68077 F20101122_AAAVJL davis_j_Page_065.jpg
e904598ecace83f5d1a94442f1fd394b
cc8d1e7c64362c041c379fec8fd72443339d5c90
75935 F20101122_AAAVJM davis_j_Page_067.jpg
598d0314acabaaefc35dc97d62548305
eeed037deaecc12e215d2bb903f82efa4c31a982
76043 F20101122_AAAVIX davis_j_Page_048.jpg
223f17ab0e71dcca33c63025e441249a
a03d7938fb292b462aa139396f2df4559ec01479
73426 F20101122_AAAVKA davis_j_Page_085.jpg
bc3296be0bfbbd0f937d287cc0a27f49
83725783655332618e4f2073bad8ad0a38cbda32
72444 F20101122_AAAVJN davis_j_Page_068.jpg
1a80af83c8c5674d622876068146d4b0
db9f04de89d39f47af29b9d52e3bbd3eb6f5eedb
48853 F20101122_AAAVIY davis_j_Page_049.jpg
dc0650543d09f498c2e97041d4e06cb9
70c59e923c31774398c4881e4d81edff303d181d
67876 F20101122_AAAVKB davis_j_Page_086.jpg
8c79f0f2c37365c5fb229a4ece264b5c
5486eb34ef5a18da3704901fa2422773534984ce
73391 F20101122_AAAVJO davis_j_Page_069.jpg
faeef18f62ab94936c5c48e3e8381602
8f5b8a51f22c423dd333c1bd823a77be8e0cad86
49391 F20101122_AAAVIZ davis_j_Page_051.jpg
28136ffab801c0c9c04a3e395f1c9042
16065c53520034d5bec51e5fbf1150cbfe0b78b0
69176 F20101122_AAAVKC davis_j_Page_088.jpg
55ff03a6b3c73f96f136f006c832c0cf
7832b47fcd302db1c5cae2b934ec502485e893cb
76864 F20101122_AAAVJP davis_j_Page_070.jpg
4e8ce0ecbc636b36a91920e4f76b1a19
5f7b71013895252f576ccd55d655677c80ea2afb
48410 F20101122_AAAVKD davis_j_Page_089.jpg
4d26c11810d49ea30dfb88e636fcf68a
1c47713716bb54d68e1e51b821bb92b5534fc52b
80762 F20101122_AAAVJQ davis_j_Page_071.jpg
5dad914c52c9447e7d0b60118bd6a7ce
a3c340b9387f2550faa803de3f27be1a1eea58ea
60309 F20101122_AAAVKE davis_j_Page_090.jpg
4ef2414cb88a656846a8a17a54123e1e
5c36f47e24e4a383351d1e9190556d71241b6a51
80946 F20101122_AAAVJR davis_j_Page_073.jpg
475f493b1db94ea0ca25bef877caa411
9b6ea005390e38e69734801b30a638c80a668b56
71587 F20101122_AAAVKF davis_j_Page_092.jpg
2ddd4936bfda366e701615df86d1a388
c38a2ad59bd1cbd8113558098ea1024e3dde331d
72537 F20101122_AAAVJS davis_j_Page_075.jpg
bd516f979f0f89231c588a4b49f691bd
6a5d2b087e0d9e8f56337a90769d3eb2fe17d58c
72872 F20101122_AAAVKG davis_j_Page_093.jpg
bf0fa2d3dc544c637e3c8b5ed3e156f0
c3599bffaaaade4ac8902ab3f58ac324238c5681
74931 F20101122_AAAVJT davis_j_Page_076.jpg
365a8d6207a13e17159f5b764efb7344
c73c2c7bd00f997c8d933e139a0202daed282d07
71267 F20101122_AAAVKH davis_j_Page_095.jpg
6254a152459713fdfb377fcb86af8b4c
ca076060dd59f2c0b040c5d2d252566ddb6e1ab3
71260 F20101122_AAAVJU davis_j_Page_077.jpg
b2dd6ce6fc909bca30e49c434702d3f1
12be5cc80d34c655fa578e4b9c53c9634d294564
39915 F20101122_AAAVKI davis_j_Page_097.jpg
6c20d39f92d07f4da7a5543592fe3ed1
048a7ab01950e888957de6dab7e035f707257708
72565 F20101122_AAAVJV davis_j_Page_078.jpg
a17a41c1d66ecaeacf4b75863b07abc5
e4c1147faca8de135e466d57910be6cef4946dff
70619 F20101122_AAAVKJ davis_j_Page_099.jpg
acc470ccf8751be915754bfabadad4a4
90ecfb6bb1f21a38abf3285d41c7de32a4673de3
60905 F20101122_AAAVJW davis_j_Page_079.jpg
933ebccb83f18797ce8d3e261f644bb0
e2ce1b84b26c478ac1b6498486a466710a21d09d
69072 F20101122_AAAVKK davis_j_Page_100.jpg
b6bf5b9b57361029f994afa6d63eb0f9
39ca81dd23c34a294e5a7c585c78ff3cdf8a456a
47183 F20101122_AAAVJX davis_j_Page_081.jpg
a3f14e4f619cc7ff31b04ef5ba2cbe43
c464bf989bbb3e032e67d2c8e43f3eff5cbb94c8
68834 F20101122_AAAVKL davis_j_Page_101.jpg
86d182eaa59d18818b708c2e4634f829
2335c5c235b1980a8fb7ce45f7ad008e30b89c7b
92309 F20101122_AAAVLA davis_j_Page_122.jpg
0067fb0def9d5b8f7ae7649cfa02c5d2
1822a37bad42aeee0b8cdb6670b468b13366add2
67285 F20101122_AAAVKM davis_j_Page_103.jpg
0b33d8b4a5731f8c9e6e4f9a5bfc4189
099a9b1a7c9d49a0fc9d3e66b645cd120cf7fa78
35080 F20101122_AAAVJY davis_j_Page_082.jpg
e91a70af07f0fab6844a2fb8340aa7b9
9fe7229646cee0ee5f219b4d2aa75dd4e602ef35
87479 F20101122_AAAVLB davis_j_Page_123.jpg
acb17277ff0084de5dbcea81926a50e3
34d9da743e7bb7151d477275aa37484456ecb2a7
65806 F20101122_AAAVKN davis_j_Page_104.jpg
5dfa1ef6309df5a85c55dc4ee27f2626
29e089aad98cbc58d789e92da755fedcd77d9d0b
46301 F20101122_AAAVJZ davis_j_Page_083.jpg
e9863b0c6bece504b0c7108f65708e9b
73c96d843b58154034589613b0d37786db85cc3b
92999 F20101122_AAAVLC davis_j_Page_124.jpg
1bd39f6d4102b10971457f5fcec551d7
19d21b093fb6e89d3d77e4fb8fdba7de69de6446
65147 F20101122_AAAVKO davis_j_Page_105.jpg
7330c2852b327264b2627658c96729be
6e6334d42bdb5e9b2710453447e10375ce1f47f7
52599 F20101122_AAAVLD davis_j_Page_125.jpg
aaa0045d7fd428da3e669a8b99f8c0ad
d1e06f2fc8606abb9596aa686cf47c7e8ee2347e
64251 F20101122_AAAVKP davis_j_Page_106.jpg
4e8e98f761f2e7b776e4ccf3ce34d4b4
830d2147387ad0f97945c43f6751e848022f9481
40199 F20101122_AAAVLE davis_j_Page_126.jpg
88a4fa7efd6ebdad11ea654f96567b24
368b3ffc0e8f4f96a9840f17022a7a01f424bf75
65536 F20101122_AAAVKQ davis_j_Page_108.jpg
43d3905e2647cde6384e8dfc85a0132c
b73c96ef0365753e782cacc8f5225c7c3bfd152e
25043 F20101122_AAAVLF davis_j_Page_001.jp2
fdb585ec1037b0a5e06ff4975f305fb7
f0321b1a85e97bd869081e001032b6ee2fbcebff
91574 F20101122_AAAVKR davis_j_Page_110.jpg
68bca3ca52ac1b83ab2186fc4ac7dfdf
51df0f992d3f79fa7f8183be08274080466714c7
5535 F20101122_AAAVLG davis_j_Page_002.jp2
b7b2b9332a58662ecff5b96e39182f11
8d1631a3960d6ab1f5d96cba712cfd1e84de0176
33803 F20101122_AAAVKS davis_j_Page_111.jpg
ef8d5bb71b59233b7df0f9e80ac10093
189c5f9d6eae752f9796c2aea495cf39dcd89e2d
6338 F20101122_AAAVLH davis_j_Page_003.jp2
c6ac584b7b9c014c4c729fa659e43aaf
d1684b0932c9d09066a90adb2f5071f85c152ec6
71247 F20101122_AAAVKT davis_j_Page_112.jpg
603a5d523d9f8c00e1c47abe4e58d40d
d8bb8310b4e5919647be0c5e0fe8f0b4e13b3fa3
67587 F20101122_AAAVLI davis_j_Page_004.jp2
236d524a628a53ce5d0aa9327351c5f4
ec782389608431c1a1f435149ba4831524e25cad
74128 F20101122_AAAVKU davis_j_Page_113.jpg
529204f5a2a9bf6a756182fbdf4d2d21
2ad02571f1655669245c57327b0f6b9497c4db50
1051972 F20101122_AAAVLJ davis_j_Page_005.jp2
d90e864a62d323d59aa4ec243375f9e8
964a679d50ee6868dd13ec9c32d0e185605febde
90027 F20101122_AAAVKV davis_j_Page_114.jpg
242235b860dbc7222c6d0cfeaec3decd
c8e3984af192c790d2472b28ad339b3f3656fdef
1051973 F20101122_AAAVLK davis_j_Page_006.jp2
9384f580a815167fb44f8e6a8911a6af
d840c575af3ab5238f2465c3a35c9e9c90965e3c
82856 F20101122_AAAVKW davis_j_Page_115.jpg
c4d00a50728acb9b131663d6c5a588a3
4a1407a6e91cd7fedddb45188bdd414407fa4c7a
722421 F20101122_AAAVLL davis_j_Page_007.jp2
87fd7f7fbd4cff7bf5f9968ffe0111b3
2de8c523697314f85ec9ca0c7c1df61e0d0dda49
75739 F20101122_AAAVKX davis_j_Page_118.jpg
95f92b5848b60a7f531d26cf718724b7
b929b6e62ecb89b09e1dbd45da902e7dd341d412
113119 F20101122_AAAVMA davis_j_Page_025.jp2
faf0171e83bba760be72867139097912
2815da7b04d23118a4586df65ba8527e5b26f17b
1051976 F20101122_AAAVLM davis_j_Page_008.jp2
13de6b4e11f5cd7759311bb039669678
17c7e58fdf606472bc448d4fa8b77e07b5a2a9af
80524 F20101122_AAAVKY davis_j_Page_120.jpg
93846d70817504332e8f9bd71b0340bf
ee4edc5e7af6271a2f293355e488d612f4436453
112225 F20101122_AAAVMB davis_j_Page_026.jp2
9f12753e631ad9b746980543708394b2
03b2145eb992a4770c984270aa9d6dd5af2c97a1
751450 F20101122_AAAVLN davis_j_Page_009.jp2
7c53cef6792f8f51e44da8a94f3f6ff7
c1af2e3fe81b3e5da10f5fb6fadf866c3f2eb21b
115596 F20101122_AAAVMC davis_j_Page_027.jp2
d6c1e8521744ddd3148eff764355eb39
89c389587de0c161e20abbce600f3b9cb8d203bf
85460 F20101122_AAAVLO davis_j_Page_010.jp2
ff513a8dc3f10bc2c413522bc4ccc69d
c264fa870858b48471d25ed3352000e836a52a92
85360 F20101122_AAAVKZ davis_j_Page_121.jpg
1e10d5dde71036de5cd27abfae8ac100
3148fc47c418796d9deb59fef5f8066646767e09
71232 F20101122_AAAVLP davis_j_Page_011.jp2
e0372d35409475067557e86d7c0a9a9e
4ae9d9f9d3b940d5d24f3661aca39cc84627377b
111687 F20101122_AAAVMD davis_j_Page_028.jp2
c6bdfc0723f57af96228ff3eb14e470c
ca7384688e37b062846951ab6c3faad3cae77af5
96245 F20101122_AAAVLQ davis_j_Page_012.jp2
40a7af4f845ecf538909f5534e79e320
83f0febaefef47fb6a8cfb1b6f18fb290c35e0fc
107935 F20101122_AAAVME davis_j_Page_029.jp2
01473c75bbd9b4b5c9c2d9fb0cdf3402
87674cc9ad4c3e480555a5c3abedfe8c656d3e73
111765 F20101122_AAAVLR davis_j_Page_013.jp2
7f09a08631e0671cf7f4cbf41858f9e5
fcc51cbb3ab32bd063d3cbd83001df58c9abda00
782787 F20101122_AAAVMF davis_j_Page_030.jp2
4836f4baedea6b1b9d343f7a57d24d58
5fa4052d9b0f56d2251799a35bbf565f9cb782f1
63956 F20101122_AAAVLS davis_j_Page_014.jp2
baa141eff9c0dd6b175a5d0fd45fb469
2962e26fb83b049c12da44efdb03973cdb1807d5
113643 F20101122_AAAVMG davis_j_Page_031.jp2
98c3013e147c690569861705776615f0
53091a6aed43c50a6fb1cf867ea9e970635a1b6e
110415 F20101122_AAAVLT davis_j_Page_016.jp2
46d74aebd7219f2270a5b11bd5e4205f
f77b7c346f6bfb838ffc3aedcdb6097cec8e898f
90647 F20101122_AAAVMH davis_j_Page_032.jp2
d00643fb309d5d69951f273cf50d4640
80be1fe3bac2d0945cc9a1350f59e25e32c56997
1051943 F20101122_AAAVLU davis_j_Page_018.jp2
02d923588a3e63892b0aaa509e966272
44d0e5621aa3ea49261f4884ad7111fb4011999f
93356 F20101122_AAAVMI davis_j_Page_033.jp2
f1bd236288151e5e8fd448d0a4282d64
7043f86ed57e5c90fb66769aaf3d4d240c4b0008
108347 F20101122_AAAVLV davis_j_Page_019.jp2
735ee823388e77b38c84eb542e277256
9e88fee58de1233f895542948b8a1643a254cbc1
110626 F20101122_AAAVMJ davis_j_Page_035.jp2
46946648d7b4d61dcbd252135a3c2788
77ef989414e91cf81cb746482d322f2de165a35c
110506 F20101122_AAAVLW davis_j_Page_020.jp2
f42f3f7c51c7242d0c53c7967b1eff4f
71f77e8e12404acc90488bd3470efa861b831d2e
110735 F20101122_AAAVMK davis_j_Page_036.jp2
06b902a5f7adfdf5b7a9acea7de2ba31
62c4641e04f8d83665f31bbbfbd47b211c3f9db0
110818 F20101122_AAAVLX davis_j_Page_021.jp2
167bbd5ec70abcbe47e4583edbb85458
fed55a0c5c7f3193a316b7a8ca1fd2076825c4f2
113539 F20101122_AAAVML davis_j_Page_037.jp2
50336022765544ee274e732a76f9f5b5
d939710b1bedc5b37d7b4dc7f1308cf318f48c6a
111016 F20101122_AAAVLY davis_j_Page_022.jp2
2bff11821fef1a618e037cbd89b242d7
2d61aa6adc62f1def5b6c39049519209408117fc
111206 F20101122_AAAVNA davis_j_Page_053.jp2
9985befccddbd810ca12605a23106045
9d1676a3dcd1b1b6a3ba32d5d0ecb47662a012f2
113375 F20101122_AAAVMM davis_j_Page_038.jp2
75961b6a5e9604f20e3d0d011ec42961
bf2a73fa092756d189ffc0614fe57bacd5b28bed
111391 F20101122_AAAVLZ davis_j_Page_024.jp2
29259fd41f64262f1dbbfbcafe3944b1
e3a306d004bcd9de1714211d917e9c5b9d0b8b56
1051926 F20101122_AAAVNB davis_j_Page_054.jp2
a36959ed292e8e4850c00714e04d79aa
3949d65668e9944d37a3077ce933f73f310f563e
114235 F20101122_AAAVMN davis_j_Page_039.jp2
cd8ec93766ac228dad0836f93bcc1be7
6facf105be84bab202dc88ac087cc7c6be2796f8
F20101122_AAAVNC davis_j_Page_056.jp2
96b310735adef2c8b533e7fa8703373b
145055d31f2021695d7652ebec5fdf710dbde4b7
112875 F20101122_AAAVMO davis_j_Page_040.jp2
33b4de7a335b32a3b13f661a854a0ec5
a33499cf6a44d283d0cb76ff5fa8afa93c23a0a9
814071 F20101122_AAAVND davis_j_Page_057.jp2
32a0a63768888def37be487d4c57351d
17aef4b253de8ad700d1d54a1ffa4f45466c569b
112782 F20101122_AAAVMP davis_j_Page_041.jp2
218afc7ba2a2a0143f9a82965a4330b2
c1ae01dc8a9c81f49f97e89860b0b70fd39ec39b
113257 F20101122_AAAVNE davis_j_Page_058.jp2
724d98bf8ea0957afa12d789b8f2bae5
af6300ce38df19807440b6c767a8c6cb4b8f815b
111841 F20101122_AAAVMQ davis_j_Page_042.jp2
4a382428b0acaaf16447e5ddac98c9ba
42d5cba1022fb163fded64d3985c23f3e99529a9
114570 F20101122_AAAVNF davis_j_Page_059.jp2
93a0b24ec66672faef1b26d782e1d439
f642443de5d7421909e278ad1103c9240d545783
1051949 F20101122_AAAVMR davis_j_Page_043.jp2
4bf9d0142119da4adb13032cd66b9068
289a21a40df285cf5f6198cb231b213029e3b959
113337 F20101122_AAAVNG davis_j_Page_060.jp2
b394d1f9e6c437f0c82fbf11c02731d1
0365477df8011c05126d6979c3387068b14dddbd
1051947 F20101122_AAAVMS davis_j_Page_044.jp2
faee17bfaa4b17fb45d98bc12f6bb753
237986c3e8a2cac1758b6f9cf0e76668b458c772
110593 F20101122_AAAVNH davis_j_Page_061.jp2
c23cbf01a8dfba4b10d88e94cecc3e73
9aed90a0a94f81465e5d90df7521ed4af28cbf67
104760 F20101122_AAAVMT davis_j_Page_045.jp2
ba8020fd91ee50c1471472533ada79e0
d0bb5cbd4e6bae9d32beb0da0f11bf9e34cbc132
105718 F20101122_AAAVNI davis_j_Page_062.jp2
5904ddb62ab76cb6df52599d4f4f5315
2b1e19e17d8de4e61861b1dc9bd926e7eb00f2b7
118610 F20101122_AAAVMU davis_j_Page_046.jp2
408b00e75b5ff47d679bd7b9e68a297e
e0bf2358a9c9292274580b663d202964bfb0367c
53204 F20101122_AAAVNJ davis_j_Page_063.jp2
6419a35cc181fa92428279dca1ac9a38
95bc0c7b6d05dc25814ec5fc5cd0e03e56256ec7
112593 F20101122_AAAVMV davis_j_Page_047.jp2
cc0d3fe15fe2663ed5f1ed7689d7ae03
2d29843757628a1502c5656739d1be98f5978ce1
92987 F20101122_AAAVNK davis_j_Page_064.jp2
69814d8884a2f5c9dcc77be0e0a6c0e2
99cc185f68bf45b7b2e1a883a659da57c4ba2ab7
1051982 F20101122_AAAVMW davis_j_Page_048.jp2
90675495370979aa59332746bfa13f9c
f0eee7b39afad1ef5e9a776eaab041c38a44f541
104679 F20101122_AAAVNL davis_j_Page_065.jp2
0b2a1ef5626fa8862e0921d996a7f0b2
9d1456b7339eeaef1de32b723dcb507626cd044b
637414 F20101122_AAAVMX davis_j_Page_049.jp2
0c47f35c6b6d37b55ab5249d343b848c
c02d096f76b3d69c71a58369a5f134beb80ca384
111406 F20101122_AAAVOA davis_j_Page_085.jp2
ac2b082ccdf6f52ae6e4f63c5b3ab7cb
ed5fd4624ab8d9a86e87d2175304b8ef54a2362d
115248 F20101122_AAAVNM davis_j_Page_067.jp2
414b9db42d15a854a03cc8f99ea939f3
34344f335c9d4dafa6ad7ae943ae99a5266e8dfe
640726 F20101122_AAAVMY davis_j_Page_051.jp2
1a411764235cc0559316b23b79b4633a
1c974ae42866392bf35fc41ba0669400baa6982a
102424 F20101122_AAAVOB davis_j_Page_086.jp2
23b63207ea5139536fd348b5f22eb20f
62a78a7969234b93d8400239e4ec4faa7fa9f29a
110043 F20101122_AAAVNN davis_j_Page_068.jp2
cfa0676ab4ec6ca1ffcf813a0deadaf4
3b83440528b4c03ff68713f7dc88acce51e0fdb7
109713 F20101122_AAAVMZ davis_j_Page_052.jp2
3602aebd5953e02dabea57d1225a6eef
4c5932cdda5ecbec839359f94adc8faaf02cf1e0
1027981 F20101122_AAAVOC davis_j_Page_088.jp2
d6e3f7ac0a6fb70a20aee0ff76d9d514
264c0e7744d4f7fb8a9ed3a13cbcfa699f6b4c55
111834 F20101122_AAAVNO davis_j_Page_069.jp2
2200d7a12463e26dba754230a2999cdf
09ee8834c635c5c2a568b14838e20d91df5f83ef
1015013 F20101122_AAAVOD davis_j_Page_089.jp2
72b952e291733dd2141a2a599e980b04
38c979fd3d2b1dbc4723be7ceeba52098980971c
116941 F20101122_AAAVNP davis_j_Page_070.jp2
0385c9c9a9e42caa06dc8d45a0026f38
68182b9750c2a9184b958467741ff7100e76e1b1
1051964 F20101122_AAAVOE davis_j_Page_090.jp2
a0102043a1984cff557b55a6162426a2
42148c1471cb5d969580a559c31e5262536689bb
105286 F20101122_AAAVNQ davis_j_Page_072.jp2
090264db2c99eea977fd34b5ed809320
3ea2cfe10194cb1b3fb7c625d16181080d8f2b80
108238 F20101122_AAAVOF davis_j_Page_091.jp2
69a149f2c408eb812c40700ccc5a75c0
ce8d34abcf238cdcf93e15e8a140ec192e5f7321
1051967 F20101122_AAAVNR davis_j_Page_073.jp2
c0783096b2502ae219ab7cc6d48125b4
ea4a4cd1447bcbbfceca249ae19ce42737d97ce5
109298 F20101122_AAAVOG davis_j_Page_092.jp2
f86ff26e5128ad157f62ef8bceceab59
90b0f70785f0662f89599853e3fb72496d586552
104453 F20101122_AAAVNS davis_j_Page_074.jp2
652e84b289812e76bf07a66cd000d5cf
9ffb58d57dc05d87ae2c9009af9ed46f42885a07
110412 F20101122_AAAVOH davis_j_Page_093.jp2
2615c3057138e4644e7135af6aa2bfcd
1ecab85bc8797eae1979afd97fae8dfa35268cd7
109333 F20101122_AAAVNT davis_j_Page_075.jp2
3a3092b5974b7bc11cab68389c1a7c95
a7525683859133623b15466ceb2e214b34d3aca5
109020 F20101122_AAAVOI davis_j_Page_095.jp2
057e767f11d05900e348d6fd6d5c68e6
b6704f24906e6af07b254b56e3aa47774e0c5a9d
110898 F20101122_AAAVNU davis_j_Page_078.jp2
da4e8e3a1350808342c54ab1e5826f39
22c31988beb3203ab75918b848686d2f0de2beb8
109317 F20101122_AAAVOJ davis_j_Page_096.jp2
aff2717bc595bbc1860080be90e54b68
1a9acb319cdd92b471017d75e45370e177f48b5a
F20101122_AAAVNV davis_j_Page_080.jp2
cbf1906934a5d7493741fc48fb490074
bb063dbf856c2c706b84cb64860ac913d744c340
89287 F20101122_AAAVOK davis_j_Page_099.jp2
65481e33ecc798f625e1f746d71b9c49
958319fb047ed1c569e72cd83ed35d0799c7ae69
F20101122_AAAVNW davis_j_Page_081.jp2
86b44d9cd1c54809d1365098b0f73715
47c65a1a0bff33761f74a7c2b525944698ad8046
87568 F20101122_AAAVOL davis_j_Page_100.jp2
9db817054c493b4a6cd539d8dde5ab3b
c240ca1ae54d2653eebe4c7dfecfc917dbf2f55a
749789 F20101122_AAAVNX davis_j_Page_082.jp2
c6f8339f72419cb7d77cb25e6886e30f
5bd8e1687517cda00bda1e3541cc7321d1cccc4b
87671 F20101122_AAAVOM davis_j_Page_101.jp2
04fbd10778f15aea9d2e84a6ff027387
965a8ddde71c8a9689ebba20e67cb81f488feead
F20101122_AAAVNY davis_j_Page_083.jp2
b44cf806f553a6e42a20cd4b34a875ce
30aeb96f1d7661fd2ae75d58a011bfd9c5bd1b4d
122216 F20101122_AAAVPA davis_j_Page_120.jp2
aed44b99debab3329029fa2b0f10d0a3
f456cfb3cd3892c8e09544eb9c7a10d0424dffba
87328 F20101122_AAAVON davis_j_Page_102.jp2
584f70d01d08589d2a2b1e2210066efd
f4a7695814009cc8dd1c113de32bcac60b08b8a9
929739 F20101122_AAAVNZ davis_j_Page_084.jp2
d2efcaef145f6066bd6f88911f5db1f6
32cfefe78f55790b906248413e67e679f9fd3edb
1051978 F20101122_AAAVPB davis_j_Page_122.jp2
a13e332dfe782549fbddc5ecd6f89b77
bdadf43e1fd0454e95b026b374577f3132b94a47
83246 F20101122_AAAVOO davis_j_Page_103.jp2
1e4cfce64c9848836d9a0fd0b5f3da1b
3c7aceb687dcb7ba0c1fca4fa880ca1c1a8c674c
126111 F20101122_AAAVPC davis_j_Page_123.jp2
927d5143504dac345da48773f04dbf3b
2961e473bacc59a4888329affe59c91fe7bac0d0
79840 F20101122_AAAVOP davis_j_Page_104.jp2
d174b1f99ace1409bf82545f058bf4d8
fe3c488fdf181272f34e345d31ce5249c64ab901
1051986 F20101122_AAAVPD davis_j_Page_124.jp2
8666cc03861268c28dbc5fb8ec386518
2838cf8179bda7c24678b70deac0c2ea0b55fecc
75976 F20101122_AAAVOQ davis_j_Page_105.jp2
2c3ee2255d9b3a93e7a38f98dbe418b0
4ca90132175b579fc7ea2424071e3ac9bf65bc76
75754 F20101122_AAAVPE davis_j_Page_125.jp2
79f9f6f765e5c20998fe18b7093b6866
ef11c24b74aa7a40f93c4700e9cd86ad10af87b1
74791 F20101122_AAAVOR davis_j_Page_106.jp2
c42bd399a170ab2525da14f035902f27
17d473e26baa3b7ea2688f29091488898d72767d
54543 F20101122_AAAVPF davis_j_Page_126.jp2
bb4eb252f76ed1241a9b4c6749f9174c
4d6a503dbfd8a8e6cd861bc02063f89543cc976e
21746 F20101122_AAAVOS davis_j_Page_107.jp2
0f494a36644441fac31b62189a39b131
3241b995718a96a9db5c07350a57d9737ab57841
F20101122_AAAVPG davis_j_Page_001.tif
bfe7c368a56ce7cb80c4b12a871523ac
3e498cfe50349374bcb94cc076acd2ad7e7468d0
1051960 F20101122_AAAVOT davis_j_Page_108.jp2
71b07cfe1a32aed2831f8cebca27e45a
ddaf30ad1ea8e280b8cd4c8327642b8c13735730
F20101122_AAAVPH davis_j_Page_002.tif
103b3f110e98c61a5346f43ca74a766a
a8a33d9686c44380a2af5e1a6b4a306fd1446051
F20101122_AAAVOU davis_j_Page_110.jp2
5dc9e7b23bf7e935fde9e3853e0595e6
5f18df5389acad846756626570a806fba05f89bf
F20101122_AAAVPI davis_j_Page_003.tif
35eb02edd0a8ba8a07caf4e06d8a1b71
877d6bb095e32bfc95b65e706bdc4f7936c2f5c6
114218 F20101122_AAAVOV davis_j_Page_113.jp2
0eab66414c7327cefff38b23b9be859f
eac9fab1bcde2bbfe7306e15bb6e52d45fd29d57
F20101122_AAAVPJ davis_j_Page_004.tif
9adfe5553d02de89dcaf9a69e23592de
694f87575d252eeed665d2ea2d04a22aeb858229
136869 F20101122_AAAVOW davis_j_Page_114.jp2
f352ebb2338e4aa50386f999e653f694
22c2ecc0064c984d4b6143bdaf258fa2046fe297
F20101122_AAAVPK davis_j_Page_005.tif
de5788ad9cfa10aa34d92c6919ad4dfe
77b4014f7ce9e8877889b76f207b116c6650b160
122487 F20101122_AAAVOX davis_j_Page_115.jp2
1fec00e7fee2d802ba907432218740ff
01d9f8eef8b5fa47c8db29e753171b230d1b08c2
F20101122_AAAVPL davis_j_Page_006.tif
049a7501cd0c558e3c12242272e09e14
a31ef2ce0ab9fa1a51384d5895194cc5e53d8a04
135777 F20101122_AAAVOY davis_j_Page_116.jp2
6f8cdad8b320812e33c569592a189761
47780863b2f968418018d0fa1bc82cf88b420da0
F20101122_AAAVQA davis_j_Page_022.tif
4af7d86cb42e14b6734cfddb5e808363
834bf245e653e8411ac87ad121ebf062ef9bdcfb
F20101122_AAAVPM davis_j_Page_007.tif
4d09c4d179a7fee7a0a5f3ac8c8eb457
5c0abac6c61e781ff56a8a52a38e556a42be368d
126221 F20101122_AAAVOZ davis_j_Page_117.jp2
46698111acf0f83b0387aede3b31d65c
441609a5a9c2838cade0be27173d6b190a3e76ab
F20101122_AAAVQB davis_j_Page_023.tif
dd9ca8232156c1b0a698ac690d518fe3
9272efdbe0d52600c3535429c563bf7fb9070386
F20101122_AAAVPN davis_j_Page_008.tif
9f0130073a3c73f70d61c6e61f961655
653f82ee8ab525e02602ce6fe6e638696e1aed31
F20101122_AAAVQC davis_j_Page_024.tif
9e3c7e3c76c0497612f36fc2c307966b
442ba00b66540c88d5aa63581ecb1f171c024276
F20101122_AAAVPO davis_j_Page_009.tif
25ad805427bef893de44684952b2b711
c53aa323e3cef7c74feec4da4b3e2b9b7d807580
F20101122_AAAVQD davis_j_Page_025.tif
9f4ffff57be3192693bd8b9a754bf3ff
46800f866887ae4cb97818aae5936f434f4b6aca
F20101122_AAAVPP davis_j_Page_010.tif
26c462a6a192760018c07d595ce2dc8f
5232d9c208bd15092bbe1dd1cbac39869a865c25
F20101122_AAAVQE davis_j_Page_026.tif
92c7de778902a2db0aec666d7fa84af3
5f3ebd42da38d28b001a7b88ce4218f3c6134506
F20101122_AAAVPQ davis_j_Page_011.tif
2aad6e7da5c4151825a2adffc92fa77e
c0fc345b73bcc5ab6e325dadf5cbea2c39b07579
F20101122_AAAVQF davis_j_Page_030.tif
fb570c17753f28a25516f051a11344a4
1a455a0cfa412241d4e6c9123a764fe187b7a103
F20101122_AAAVPR davis_j_Page_012.tif
296a09312f2eb34c3e005ad26b4685ad
933a00940575893f75796d14e64eccde6e8b2a6c
F20101122_AAAVQG davis_j_Page_032.tif
cc9d3f16e6023086afbd020c4b342a1c
9a16403df46b4d8df9919728986b025ad6932360
F20101122_AAAVPS davis_j_Page_014.tif
85004b75ea67a11273384ef3ef6b0901
f3b1d9e8b09ef694b04057e3e0390a05a03bc5eb
F20101122_AAAVQH davis_j_Page_033.tif
72ad8afaf4d064966c0d16fd656a24a6
25d933d50a67077750d917f4147678b40bae43a0
F20101122_AAAVPT davis_j_Page_015.tif
b70790e1a5935e2d0742b3e154d3bed6
ac6cfd691606067a6cf010054249832924dd693d
F20101122_AAAVQI davis_j_Page_034.tif
964de9026513888a8c266dc5762eea2c
5d83fee1baa4d9c54de642251d0af5fc9c51a338
F20101122_AAAVPU davis_j_Page_016.tif
cd93d82cf40a2bfc7f90405bbcffb0fb
3478e5e918681076c04ded1e5e7c3c28c3f6fbcc
F20101122_AAAVQJ davis_j_Page_035.tif
267df7973fdaddd91f547d7ace233506
da8e9cbbe62fce38eec317345be109b5cff33825
F20101122_AAAVPV davis_j_Page_017.tif
f297b2504a8b5560ef7454338875a969
f533421b61ea81f52c260a41254aafe3e7a39ce3
F20101122_AAAVQK davis_j_Page_036.tif
6055ce187eeabef7a79f31df0948f50c
b0494cb9eea1e5890a95d4c24debc35c393b3636
F20101122_AAAVPW davis_j_Page_018.tif
a6f219d8a0c45d67037b2300bfe298f4
50b7903212326782bdf08cfb89fd7891508fce81
F20101122_AAAVQL davis_j_Page_038.tif
943fb7d1c6bbeb6f0a58b657c0c7f593
456f82e51ba45faeda47b9271def131402c570da
F20101122_AAAVPX davis_j_Page_019.tif
8eaf6ac2a57c9438995d99f8fec91955
386df473550da07853dc2661ebde7fadb1a73d82
F20101122_AAAVQM davis_j_Page_040.tif
0dccfd8ee7be248d2a3964956dfa42ad
c2d5c986b8ed3f5610caa850e0c4cda08cb4870c
F20101122_AAAVPY davis_j_Page_020.tif
9236c92b7092371ef6ad22cbbb01aa2b
a11175cdb259d5bf5b722895d4db99b4d736f773
F20101122_AAAVRA davis_j_Page_056.tif
d85353e33d20978d246b0cf4c4de31d2
80b3a282e867ea776ab1426e03c54f02334227d7
F20101122_AAAVQN davis_j_Page_041.tif
b3d69172dbe5654b632efa605bcef0a6
698cf5cdaedf4a85aed7cbf9ed5fc759396b2a5d
F20101122_AAAVPZ davis_j_Page_021.tif
938a3f1eb1f614a633271914875395c1
92245294aee585d6e0e6c125a40436de12f50228
F20101122_AAAVRB davis_j_Page_057.tif
41a24128491ae94d655a5338fd3da77e
9c7388d6cff7ec72241a8cbe15dc311a292b3dfd
F20101122_AAAVQO davis_j_Page_042.tif
95ede49172b1687826f99df14a57a69f
9f6572aaae690f5b9d964b797c6e856dafdafad8
F20101122_AAAVRC davis_j_Page_058.tif
aee4bc644569cbd743c9f21b2d0f0399
0e89145f10e863af2549c8a5fe113e095c2d7920
F20101122_AAAVQP davis_j_Page_043.tif
2566493b841513a518df63c35926ba7f
567241914492376ab55d5fdc8a8164b47a812713
F20101122_AAAVRD davis_j_Page_059.tif
486a4c221de8b7da73942f5c40e78a08
b6717579d7eed274761bdc63f73c9af5ab4c926b
F20101122_AAAVQQ davis_j_Page_044.tif
ffe44c14203c4886be93962e44eb8957
83aef7d398ade6794934df8bb4158a28e6a060c1
F20101122_AAAVRE davis_j_Page_060.tif
26f1ce088808232c729a527451d1719c
118df4ef66cf9d027d05f2944e502a467ad16b77
F20101122_AAAVQR davis_j_Page_046.tif
2bcb0b897f6948a8c8464454835214e7
4c141498c60e92606ce00238db69b15937237501
F20101122_AAAVRF davis_j_Page_061.tif
cb952e8ac46edd6093ccfd924338b6cf
3f8b08074ceb18d67d9911296f208bfc64ed5f9d
F20101122_AAAVQS davis_j_Page_047.tif
c4e76e44a58b65755bdf7834b10243cf
c7e487723dff8defa3f375d92332c21c17cce13c
F20101122_AAAVRG davis_j_Page_062.tif
45642f820f7a1ae10a6e5f359f83d702
8daff3f61d5e7f35cdd53b3332c5f7077d15cd9e
F20101122_AAAVQT davis_j_Page_048.tif
f34125146a294bff93a8bb0be668c2a0
3a8a073b03f2c405e6b27f801a9f0a400c5fa0f5
F20101122_AAAVRH davis_j_Page_063.tif
35022c2303a2186869d7134ed11ed1d9
cff9e397b9a8f28ce58e97ec6dc201a19b771b19
F20101122_AAAVQU davis_j_Page_049.tif
e069403dabb0e682433fb4d81cd70d58
e18221d90ff83a7a8a17abbddb9592d97287b9df
F20101122_AAAVRI davis_j_Page_064.tif
98150b35309136cc9ef15ff311bf1364
d660efd640270d326e5c78975aa571f0c8ac68bc
F20101122_AAAVQV davis_j_Page_050.tif
75d485fdf82e713c91cd08ca1297b36e
7c1d508c7a17c319db039d43b359e3206f8e0aa9
F20101122_AAAVRJ davis_j_Page_065.tif
664625b47ea7364023e9ed6998568b49
28153f8210c6ac6d15630b0c50dcb871d3f639e7
F20101122_AAAVQW davis_j_Page_051.tif
a14f1834b8b2abceca3498d889e4e862
f75269bd87da6710eb2996b0bf6c6ecd070f6c39
F20101122_AAAVRK davis_j_Page_066.tif
6971e6c59d60a38b759fb95cd226cb26
bc3a441831afd34fbaa7090558340208f560032e
F20101122_AAAVQX davis_j_Page_053.tif
901c4e518ffbb891dc1ea2f848d3c909
ab26412b5c759d17665af1b219eb9d3f35c1fb45
F20101122_AAAVSA davis_j_Page_084.tif
4093369777b24e3524755feb18755d48
be9d2ee4c3d3ac60bf03a1cceecda300d2d9f71a
F20101122_AAAVRL davis_j_Page_067.tif
5c0df98eca49c47fec06f13b1171b236
f7a10f9354566c62485ddccfe43c75805f1e08ad
F20101122_AAAVQY davis_j_Page_054.tif
5c52433474dd41777f30293dbb500c77
6cdab631cb6ecb0a6af4c9864d1abacf6dd07306
F20101122_AAAVRM davis_j_Page_068.tif
58b879f6ec15ad52415bfe48c494cf95
431e23a9708ed43e4d8b921900f7d0acef4abee7
F20101122_AAAVQZ davis_j_Page_055.tif
1ae1e31fe2fcc694f8f18c3d4a854499
f6daf2ec424b97c63d17231fe50b118d1286895c
F20101122_AAAVSB davis_j_Page_085.tif
c2ca2297102e36b41c92f25b680de0d0
3ed261e43526cc33c11b960609c96cb4566016d0
F20101122_AAAVRN davis_j_Page_069.tif
47e4a0ed8a9c436fc50cbba2032b9112
fb72497104385ac6f376bb14dede8e8c1d7a43f0
F20101122_AAAVSC davis_j_Page_086.tif
086021f12e63ee45590820630a64134a
56efffb5c872124b15fb31a0915445e080c001d2
F20101122_AAAVRO davis_j_Page_070.tif
0ac1dc3efe64e41248620eb312e9318b
2d0b52f4d231a12301aaadd3d276d28d57d089a2
F20101122_AAAVSD davis_j_Page_087.tif
c2d46728410efbdc9a1e4a1256d1e071
7465eb6882dd97e29a1538f09c65055771cb6553
F20101122_AAAVRP davis_j_Page_072.tif
3ad054398d0241f85f080feb62a42713
72558866792ca24dde8b7e06ca4ccf214852ea93
F20101122_AAAVSE davis_j_Page_088.tif
f3db8cd4612fd26439d2ba176784add5
c4c017a0a22b37f8776500dcd2c0a2d49b651da5
F20101122_AAAVRQ davis_j_Page_073.tif
933db0d418076429480b461fa5317ba6
5f1855b193b8810569f34f848d976051453ba60e
F20101122_AAAVSF davis_j_Page_089.tif
d5212bf578d99dfc6ebf88f7fb06d7b4
590bbd879fa8a93fdab7dbf7f12dac7bc7a9c3c8
F20101122_AAAVRR davis_j_Page_074.tif
d329ef7c4ae3c0f55fbaec5ed44405a1
f4fc2a3cca587a6b44b8ab0d53892024832affef
F20101122_AAAVSG davis_j_Page_090.tif
4dc4d9bb7cfaa34c412bc843a7d43e06
d3dcb4057eec01b069d25ef94991a8a4eafc1c98
F20101122_AAAVRS davis_j_Page_075.tif
92666a46d848f6db4064c21520cb19ae
490d9854f417fe6cd3c316a690d408d0048337e1
F20101122_AAAVSH davis_j_Page_091.tif
2e0be0126dcc05fe9b88c07b5233e9a0
de040b7b32acabb2b9397cb0feb97983e86e178f
F20101122_AAAVRT davis_j_Page_076.tif
5f3bcf246d81788fa748598a8c031421
a394e833c505ce5b15b447bbde9fe7983cc2559c
F20101122_AAAVSI davis_j_Page_092.tif
78aca686f8adbc3e89b21f11e1cefc0f
942a779902a48d2a1d2d1cbf6ebbd561e7e9ac9b
F20101122_AAAVRU davis_j_Page_077.tif
2328fb8b754a4446c23488bee2eb61ad
d5f207e599e77fd73ee6755fa5218765319b9257
F20101122_AAAVSJ davis_j_Page_094.tif
474b32bddcb73338c4280be572b19fee
ffc7904074076e870afb4e6cc49a3e4391449dcb
F20101122_AAAVRV davis_j_Page_079.tif
e714a107d35cf4f07c74fdd4c703b630
74e1f08ea5e3fdbde1a42340d8f03839a99bd3a9
F20101122_AAAVSK davis_j_Page_095.tif
46e68ad9f34edae6313c9659f1369aaf
e28456bca996e47f7693380e270c85bcdc60bb3f
F20101122_AAAVRW davis_j_Page_080.tif
3226a0d82f0d9aeb9e124b9399df93d6
0d589e8b01583838e5118d8dce5b880edb914595
F20101122_AAAVTA davis_j_Page_114.tif
3016fbc6d1737e7f2049cbb731828ccc
09dd0974b67fefee2584852f8a8060454cc2a8c9
F20101122_AAAVSL davis_j_Page_097.tif
6d127d8a1573ded09368a7a5699d38c8
bf297dbf122b22b24c1ac994a2b52dcc23c418af
25265604 F20101122_AAAVRX davis_j_Page_081.tif
d027962c880ed76971272c14ada3f32f
5e499a6829be256a36aa3981efbe73dba6825446
F20101122_AAAVTB davis_j_Page_115.tif
e0fcf46310b86f0e2692e356cb51ef7a
bd9917c500e1a50b4d21bf0165679290998735cf
F20101122_AAAVSM davis_j_Page_098.tif
9995df29bddf8aa91d3d62723ad6c46a
5598470b554d900a1520da3607eb5da6336b19bd
F20101122_AAAVRY davis_j_Page_082.tif
d06833ae98052b022fbddb7d76f220cc
9e2e915f328bef84008c458f2d69bf727df6f677
F20101122_AAAVSN davis_j_Page_099.tif
3d97e91c986778dae0c84943d703ec75
aee3d56c1982539ab86215d6b9f47191024bfb69
F20101122_AAAVRZ davis_j_Page_083.tif
1df86f36b2734bc4a59f2f9d2ea3bc2b
5431a9ebe54f7652dab799afe094fd7812f5d780
F20101122_AAAVTC davis_j_Page_116.tif
2781ad296277a30e489499cd01e16a74
a1a2b3b6f6e323fc9cae512503f52de002003fe4
F20101122_AAAVSO davis_j_Page_100.tif
9f7eb1efd83c6c3b00dc7e198dc5a31d
f144124aab02dce6e89ff461de6a8a0a4a41796b
F20101122_AAAVTD davis_j_Page_117.tif
ce297cafe1c810996ae9af2fa76d032b
bf1acd414535000f3bd45fbc5d008e99ad2678c6
F20101122_AAAVSP davis_j_Page_101.tif
799af8e296787fa3a5dcb3729cf4295e
7301c5cccf4ca028ad893f3c56f38aca07da2256
F20101122_AAAVTE davis_j_Page_118.tif
87f28c7fef22a7e14b6f1fda413789e6
720928c0a73ce972575e821a2d0a508038566311
F20101122_AAAVSQ davis_j_Page_102.tif
aaa3476370ef5feaf71c2a9450d72796
73299324373ecb574023b3c88f58f2129dbba210
F20101122_AAAVTF davis_j_Page_119.tif
2a57eb878476d6636cee1fa2bd3daebe
67a74c1f0764b8a0515c7c3c0da21383796b52bc
F20101122_AAAVSR davis_j_Page_103.tif
944e5f6805bc7b75fd5893da78029562
0d5ce0a486533c7beb45be4712efe948e859612b
F20101122_AAAVTG davis_j_Page_120.tif
04a8149800a782f8d983692f49228b9a
0d95f8f199e8c66b8458968afed67e83710cc843
F20101122_AAAVSS davis_j_Page_104.tif
deeb5cf2b267d4e583f4b94bb658b94e
25104a7e4939652ee13b71efa6ead5b6191fcfc7
F20101122_AAAVTH davis_j_Page_121.tif
d63a5454443d5e9306394fa3aa32745a
dbcf890c378dc1e02ee23d84eacdbdc683f993fe
F20101122_AAAVST davis_j_Page_105.tif
6efbbacd7c5e0feb73343ff94248704e
427fcc790ef09ad01a901ba00e44ba37a4fbb858
F20101122_AAAVTI davis_j_Page_122.tif
47d361a41da35526dbe3bc38671de525
3932b4efd53532886780a0f3b3b8eac4f9dff08b
F20101122_AAAVSU davis_j_Page_107.tif
18d436446784795af6aacf2dba185d6b
c1a191b8b791b97cceefa660fadb4d14a1b1412f
F20101122_AAAVTJ davis_j_Page_123.tif
cb3e50c2bac8ba6f1744210c0f3dc091
a23b84006e5a0df4ddddfaec91fac6335ab1e19c
F20101122_AAAVSV davis_j_Page_108.tif
28c9f38df7c6ca96491781f2cbcb7c11
82f414f3b21676c6cc586b63141893acabb16b69
F20101122_AAAVTK davis_j_Page_124.tif
4cf1b18a220462eeace55bab5eee443f
86d881094578c63dcae5528f76862ddff3ee5c72
F20101122_AAAVSW davis_j_Page_110.tif
497b9b0f783034e837f6664c62a9780c
07d077c171262db70d31773375f6f1bc2e2dcc14
F20101122_AAAVTL davis_j_Page_125.tif
c8d3c40f7c92ea854d37b5434ef8dd91
b5cfebef8ed9e19186b7679d46bdd530f687705b
F20101122_AAAVSX davis_j_Page_111.tif
b30d0aa337c13299096472ab8e182600
6568b352d7cf06709efb15bf6e865db4aec14ac3
1991 F20101122_AAAVUA davis_j_Page_016.txt
5fd11f6d348b27e591ab67f14df96b20
925794ec357be2ce6ce7db8c3ff8b9f864570dce
F20101122_AAAVTM davis_j_Page_126.tif
4098413004166644bb306bd163f304b6
dd3072eebcb77c1439a66b04fe513f902302ec99
F20101122_AAAVSY davis_j_Page_112.tif
6566c8af30cfb12414e8337d340dc1e7
51a753d8dbe237d401e735394cb67ecdd4e00b54
2087 F20101122_AAAVUB davis_j_Page_018.txt
8783297c5ee4e7c92d8daabc87405027
974355a80d6696255e470ba14b874c86fbbcc6ca
461 F20101122_AAAVTN davis_j_Page_001.txt
fd354c537371f0b1faed2b2b38ced97a
f4f686d0c38d2a4c5d3f7d2d2c202cea9a08fa3c
F20101122_AAAVSZ davis_j_Page_113.tif
e2bfad8573754b026ae1f2cc60e73f45
e4fc060f0aa53d196c5662cb277911381f2aa9fa
1938 F20101122_AAAVUC davis_j_Page_019.txt
f71b0f83ab84e146a877ea98de530451
f512ab55cd19e7f1d56e38f37108d0fae13a5c82
112 F20101122_AAAVTO davis_j_Page_002.txt
58ebaaa0dacf89af5f3d10058d60d840
977a1286cb1bcd8eafd9ff90758c766a36ec4237
113 F20101122_AAAVTP davis_j_Page_003.txt
d38a57c54f7b8441f8414e27b23edb33
50b972baec3a4fa68f697ed59a4a472f81d3eb01
2032 F20101122_AAAVUD davis_j_Page_020.txt
d016a697671c8db7f3fbd56ba5182977
d4e1a3e0ebabe09204b94d8fcfd38b27e1bd7bc5
1254 F20101122_AAAVTQ davis_j_Page_004.txt
5fa8cdbb17eed1a61ba592bdf1184621
3ea2894eb243b0adb8f3ebc131583619f6ffbd5c
2003 F20101122_AAAVUE davis_j_Page_021.txt
9f2c766f75782c906091d35b4e282fae
dac43acef133a01552cdd306d28ebb68444ac55d
3162 F20101122_AAAVTR davis_j_Page_005.txt
02c4ece36a490be8ae6319a771a68191
b2f94c5966bc9e6cdaac667c5d3d1c79a8fd9e0b
23434 F20101122_AAAWAA davis_j_Page_036.QC.jpg
ea2a6bc5f94ba6fb223c8eafc9856d69
c0ff7975601bb4f691e18f745d210cffb4d08d4e
1777 F20101122_AAAVUF davis_j_Page_023.txt
8ffce0e2d48240a24ca573266b3d7d59
9e613defc6ca2df4655b0bea9510630c726a21c0
2917 F20101122_AAAVTS davis_j_Page_006.txt
5efc42564b42249f2c1b9a49d9e9fe1e
c35e363745ded389887a0200445451270f6f38fa
5141 F20101122_AAAWAB davis_j_Page_005thm.jpg
a5c3e1c088401312de910c16eed3adbd
72832ba611e46f310d6643db5f3cae3588e4aecc
2002 F20101122_AAAVUG davis_j_Page_024.txt
14d09fb2d533844af68ecb68e17967af
04d5e12f1ce6b452aca7f1b4dc9a6865975b1794
F20101122_AAAVTT davis_j_Page_009.txt
b946eed5db13b7781438d0e94d141287
e795b6afa2197082698de6cf7d204e1acf14915f
22678 F20101122_AAAWAC davis_j_Page_045.QC.jpg
16cf210e45e1981793eb0bb156ea1e99
0c818cc48644c83e161432bf57fef85d598e97bd
2043 F20101122_AAAVUH davis_j_Page_026.txt
1f9f413b4ecc293da3faf1f9dad57aed
e6eb693ee89196f2d583c10145fdd4a0e85f4971
1677 F20101122_AAAVTU davis_j_Page_010.txt
620792afb4c7551b6375090524a5155d
c9e3a14d51b4891d64254c1f2ef092fdd0493cc7
23332 F20101122_AAAWAD davis_j_Page_034.QC.jpg
f01a9077ff5347e15a90191fa71f0379
4de4f3d2d2fbe9a3585e18d16acf1ab4cb35c9cd
2049 F20101122_AAAVUI davis_j_Page_028.txt
a82b6d04e22507c1268fac2009b4514b
719fd5280d832e3b8f48a640da457d8cc45f7eca
1244 F20101122_AAAVTV davis_j_Page_011.txt
c0cc523d66e19b600ce464c08ef63ef8
1908d8a71bd4214d5814e05396415218d9c3d3ce
F20101122_AAAWAE davis_j_Page_108thm.jpg
ae15d71bbb1b5ef0c4d89764770d9d5c
085b22ff129e42e69dab6bed1726a86be2fd7d3b
2081 F20101122_AAAVUJ davis_j_Page_031.txt
ed872fed91abf4366841d80b351376c8
469c487472272a1da5bed3dea4f1ad81e562aed7
1789 F20101122_AAAVTW davis_j_Page_012.txt
14dc593ac9789e178e5dc8571370c25c
31a8b26e77437f20dbc286a18ca49c1391080be5
15660 F20101122_AAAWAF davis_j_Page_084.QC.jpg
9e79995387933951bef55ec0ffaa86c4
6f262bd88d409a91cc1f10643f187afdbc5c8d1e
1675 F20101122_AAAVUK davis_j_Page_032.txt
9f18464f254a971108c3267239c6677b
8c900d7dcf56a0e0134a27199e7b69626be31af9
2028 F20101122_AAAVTX davis_j_Page_013.txt
37f93882cbbc62c8a2cbf5bebbfb57f9
7033667ebb8b5e89e9f028a549f6d661fa0d5d21
20393 F20101122_AAAWAG davis_j_Page_033.QC.jpg
d6c55d2ccc12d4ad6dc576ec80c4de63
8953b7800379cc897123459041eeaad17f18c224
1596 F20101122_AAAVVA davis_j_Page_050.txt
376060ae5c27866a1c12a3c9196c41c5
a218529b9d2c509ff54523b9fa7d631606e9175b
F20101122_AAAVUL davis_j_Page_034.txt
2405d4e6239873ef90c987bddec128f7
936a2e551a37cb92291c305d89f62d089748d83f
1118 F20101122_AAAVTY davis_j_Page_014.txt
a1f65ca908d31fe22bc7a6b1ec1498ad
275fa31b0b15b4418f6dbb393c620b48cb4c9685
17403 F20101122_AAAWAH davis_j_Page_006.QC.jpg
d306f9e074b6b7010a4cd26f3669e218
103b8c91e841cedc1c5c74db03ca474188b23500
880 F20101122_AAAVVB davis_j_Page_051.txt
1b5d22eaae48d2594e38b0a5d9b403db
3c6a91273b4cb837b0ccb61135e13692e56de6bd
1983 F20101122_AAAVUM davis_j_Page_035.txt
6a02326cc6fc70250c59882c8f6e4394
f91106131c8f9d12f00cfe80724e258a1d393b3b
7085 F20101122_AAAWAI davis_j_Page_124thm.jpg
862975af36f6bde2c3b4ab4511a30764
1085f882b7e5aa83751f71dae9907a0ef6f9c7ed
1963 F20101122_AAAVVC davis_j_Page_052.txt
67354dfdd79a6f4870c319ac3e1ff9cc
dfd3b96c9cf3027db055c17034e1fb3be88d4f04
1961 F20101122_AAAVUN davis_j_Page_036.txt
8debce125715a7d37e319dad92e5c7b4
ad0889d1cb2a105d49c859a69726ce762597d498
1760 F20101122_AAAVTZ davis_j_Page_015.txt
e1e0979505d8bfc9d01009e0e9a7e63b
75e7202d48c9399a9857b926c784b716c1bf1ef5
6667 F20101122_AAAWAJ davis_j_Page_022thm.jpg
dab85c49f36da89dc41bf99f4d62e30e
f3e05c934bd13b660b1e183d9f6a9570a5725e7b
1957 F20101122_AAAVVD davis_j_Page_053.txt
eb2e9bbd138320a3110920ff3e7acb42
34495b33efd3c51124678c7f18b1a47b4a1c17a7
2017 F20101122_AAAVUO davis_j_Page_037.txt
3c63a7d8ef5dd48cf1e4f483a8d96227
54483bddac07eafe28f212bdead73f370ec8a8e0
4850 F20101122_AAAWAK davis_j_Page_105thm.jpg
b6e1cdad168d98e20360030c4c630761
5326b9d16be40fb2cfea02cf719c25ab70c1de68
2018 F20101122_AAAVUP davis_j_Page_038.txt
cdf5855938b583f9c74fab22a526d207
0a8f7be22d1154ba761a723be1d4d50dc897d043
6603 F20101122_AAAWAL davis_j_Page_068thm.jpg
8629ecd0306d1fa4bd2b579ac22ca737
a0faede740207c51a1bd1f169508f1705fdfbfc7
1738 F20101122_AAAVVE davis_j_Page_054.txt
19b5185c2b572859acd1cf3dee2ad1a2
89d538d121abf3a4dfb548238b8a003a0504dfb0
2037 F20101122_AAAVUQ davis_j_Page_039.txt
5d83c2b1707c8c10508fb10046a428d7
3c79da8879b8ec9c6eabbce14e715b92407d31fe
6135 F20101122_AAAWAM davis_j_Page_023thm.jpg
d0268b57f0c9ae6a4c17ebd8425e5ad5
37e88a589d79c78929aedf4c6e2d1b1e4678906b
F20101122_AAAVVF davis_j_Page_055.txt
d1751c1e339c58d66452855657ff9b69
14f440a450c94685a32a0e3259013585ce00f8ac
F20101122_AAAVUR davis_j_Page_040.txt
4a9a749c8e35ce78dacc3df5d263b296
68b13b78704855c2e8c153495c9e0dc0c0a25224
20653 F20101122_AAAWBA davis_j_Page_012.QC.jpg
3bfa299259b01b08f1e2d901e05384f7
eb70f4d27e8d484f69547f28647dc75447d601ca
23288 F20101122_AAAWAN davis_j_Page_120.QC.jpg
256f192ec92e31fc5b0e3f37f5d74b39
09a6a045e803254bb63a3224f2cc200979d4f2a1
2451 F20101122_AAAVVG davis_j_Page_056.txt
1ca5a7410d9c2c19e4b307321e8f0131
93f4bdb5372afc173c5b261502d10916c91274db
F20101122_AAAVUS davis_j_Page_041.txt
cb3c521845e48c571e42ebd49d3e5888
0b4d8e1faec905591092e7be14316bb35486a209
23089 F20101122_AAAWBB davis_j_Page_095.QC.jpg
e2334df509e63249ad69a51d60d36a16
5df63fdcef08dbe19e498a0f235b34940077a2ad
1698 F20101122_AAAVVH davis_j_Page_057.txt
4c0ea175e3d40f045d0d9e7f80e5435f
215505b7c379bb7d2e644c05c150cc53058b8028
1977 F20101122_AAAVUT davis_j_Page_042.txt
c38061ce74c1c38d859aa389e380102c
b332b11506a7bd7fc339dae3f3c1bfdca7860c1a
24023 F20101122_AAAWBC davis_j_Page_024.QC.jpg
9817f05cec2577c45813df526df3da35
8b4f1a3d8be81e23de1601eb60b2b97d41aa42fa
7533 F20101122_AAAWAO davis_j_Page_001.QC.jpg
4d528eacc733bfc7470c1da764cd4293
b97ad29c69e18cdf31fd622b2e45acff26d937a4
2031 F20101122_AAAVVI davis_j_Page_058.txt
19811f84cb20de5b7c3ba6579d1560ba
5f1f5575e3ca5f80e3f8805fac71c6ce7f8643cf
1806 F20101122_AAAVUU davis_j_Page_043.txt
f47dc3145315bffca9ca6f1cf3eb7f81
1099fa03dc7c538aee17abeab76c036998de622f
4885 F20101122_AAAWBD davis_j_Page_102thm.jpg
2da6f6e9dfc8af6336e4de29444cfc72
5eddff4436939fe37bca623672cc29ac4a9870e1
23450 F20101122_AAAWAP davis_j_Page_068.QC.jpg
2e8161ea8a33b15702c71cd95cd455bd
aaa23f3c5159d27887cf15418c456d5ca57a1e27
2041 F20101122_AAAVVJ davis_j_Page_059.txt
e6ec37c048d305bb59067472a65eaca1
c88fabdcecc81d2e5bbc376a846be9a3c2130500
1907 F20101122_AAAVUV davis_j_Page_045.txt
063f7823cc98a6636229f2ef46d16cd2
0836e21e15cf557dafed2b35656069aab84ed361
6855 F20101122_AAAWBE davis_j_Page_067thm.jpg
0ae0cc74c7efd552254ab53df8c0c541
e12474e2cb34792f079c75c3c5d7f5c087e64d68
5790 F20101122_AAAWAQ davis_j_Page_008thm.jpg
d3fe563b968420910c802c8baea4905a
bd30097351f092305b264ce183521ce7555bd3c9
2074 F20101122_AAAVVK davis_j_Page_060.txt
c33611411e3d5468238ffbcf09973d8d
f3dec319ed10a99b1976131bcd03401b5268c107
F20101122_AAAVUW davis_j_Page_046.txt
bf4a110aecdc70dc7ec548d92c367f09
f8c12bb797ee10330b8200354fa98615408e1597
6877 F20101122_AAAWBF davis_j_Page_114thm.jpg
8ccf70fea7ea360f78a2254e90532853
48c271bf9210115fa6151a2082471d3d9cafdae0
6984 F20101122_AAAWAR davis_j_Page_043thm.jpg
e34fe7579751e2a44a1fd99f3301dada
83c03cb8ea6eb1fa574b343ee97ecfa7b578331b
1992 F20101122_AAAVVL davis_j_Page_061.txt
e948679c3735ee433adea51ab44cf9d7
f443ed00724bec66e2c181afaa9219cca8173aef
2023 F20101122_AAAVUX davis_j_Page_047.txt
6364378a38ae1356f31ac07934bb7b5c
63a0c93ad5712d48bcdbdda3dfa5fa83544b0502
5056 F20101122_AAAWBG davis_j_Page_099thm.jpg
006acf7fa500b1afc888706bc618bb10
8b614367abd11ea0157dcfd233b93f580cd7b4fe
1940 F20101122_AAAVWA davis_j_Page_078.txt
88203f64cbbf630b2e240a4bc411bbb5
88ccde0f82e8a77c04530a798dc2cd600c47465e
15901 F20101122_AAAWAS davis_j_Page_011.QC.jpg
cb6a25a74a38412ca2e4c53d7e744161
6bae383865ed2ec041db644f9e3a9637e1f37e64
1949 F20101122_AAAVVM davis_j_Page_062.txt
5a5aabc04a1d4f87117b96ae6440a70a
a1b2a291f22fffd5caefb1723b31e0f66fd36e06
563 F20101122_AAAVUY davis_j_Page_048.txt
71338ab0cad4720dd1429addf5e18a64
c503cbed4f6b6caec07916539168b3e11d2f5cd6
6801 F20101122_AAAWBH davis_j_Page_026thm.jpg
d825f4c0feb1a5c2b0de5481346d92b5
2f5731245d3d7375d6c5d95ac87ab241ee2e6648
2753 F20101122_AAAVWB davis_j_Page_080.txt
46ffcb941137a42a18ef3d4aed3b5f40
2aa3381d56ef53e6396924527cdecc94300dced7
24169 F20101122_AAAWAT davis_j_Page_094.QC.jpg
f219ec7af810e3e9bdeb73d246a19fdb
0b3909f4bca41ef7048f65d81f8d5d01339c288c
924 F20101122_AAAVVN davis_j_Page_063.txt
cda4744bce7e9ed86083340915d685c9
746f9847349209fb12ded1f48fc3688d9c5dcb72
1102 F20101122_AAAVUZ davis_j_Page_049.txt
5613a6203053d9f71c44f8abd20b6a17
aed7266387d37f0a16c67a6fc4eb942157a2fa91
4856 F20101122_AAAWBI davis_j_Page_049thm.jpg
abf6b8e0011fbe339f1a8ad8e6444373
2bf72228757a51e48cdb23924b970178c29e5b0a
3668 F20101122_AAAVWC davis_j_Page_081.txt
3cbf674512d68fa52c412d47060d7a8b
05c56eff7a03d32f9bd210c77170eef4e1fd696f
6562 F20101122_AAAWAU davis_j_Page_096thm.jpg
0addeea7a700b035cd7d4b8146f2c7dc
81ef564bfcfc83116aec7fafc75c421863871799
1744 F20101122_AAAVVO davis_j_Page_064.txt
0db33b52c4409c0f822d1a0e9c004fd9
52c00e264f9673d0c5d268fc5e7cdb6682a8f44b
14796 F20101122_AAAWBJ davis_j_Page_050.QC.jpg
f359659916e647d800f5b6b81174b9a8
42ca47741b424775fb4492d90e0557c121ff8d38
3196 F20101122_AAAVWD davis_j_Page_082.txt
18f3936b4c1910932dd4867df556b6b6
44c81b12938cb9a9bd4784472b0c58005f978ac4
1374 F20101122_AAAWAV davis_j_Page_002thm.jpg
96b566480ebfa74292a735e6bf4f1010
ff414bc0c0f204bcdc1c1c8284864935befe7ba2
1864 F20101122_AAAVVP davis_j_Page_065.txt
44463cbdd7e5802308a8737f688a5208
5f43466dba3799cd30c767947c12516ddd30c488
5904 F20101122_AAAWBK davis_j_Page_080thm.jpg
04a659b5cf116628d6969d813a60f0bc
ed9ddcb74af3311369a2764e2b3aa5dbfaf3c849
3550 F20101122_AAAVWE davis_j_Page_083.txt
56766c1e547e07fc3e1335cdd520026e
c9a5b6671fecc9241cbaf06732e4a1e133dbf6ad
1887 F20101122_AAAVVQ davis_j_Page_066.txt
570c02c19a1f721232cbfeeb1aa1ce5d
9b1e5dbf878bb5e183866ebc158c6eb5d9276b4f
6966 F20101122_AAAWBL davis_j_Page_070thm.jpg
703231d8bb3ca6b685d747177e086d49
3413d922ed3afb406d5cb14382cacbd273636c78
2852 F20101122_AAAWAW davis_j_Page_007thm.jpg
00bca853d155fb77a9c70e37bbaa6526
ef0e8d589d3fd669e4fb96cf9d54388914d182d9
1968 F20101122_AAAVVR davis_j_Page_068.txt
7b9c9a6e0fe25b5eadd94aea7b7bbb97
adb554003ba69b3ab1dd3d840aa5e9e470428ba8
6400 F20101122_AAAWCA davis_j_Page_065thm.jpg
16710fbd2047988c7a11d0e3204ee5f7
41f98cbe078ce0d866eed01d02ebf54ad0172126
24115 F20101122_AAAWBM davis_j_Page_056.QC.jpg
52b9d6ff7cc521d31e3d4b6b8c34e492
3189481faef657738a13eed6e4e99cc12a6a7450
753 F20101122_AAAVWF davis_j_Page_084.txt
aa0a3b92060ad3bc97cbed1819354d5d
191b951cf3266e9c050331f02f88a1f5a3d35852
3771 F20101122_AAAWAX davis_j_Page_063thm.jpg
c0fee8c53064f1c6444c42643aa49614
6337258ab1bd25e61f06aa66deccac0827b9c0f2
2020 F20101122_AAAVVS davis_j_Page_069.txt
c1c23355e201c0005d11cb82a6c12dee
9cdcba4592864cc3bfb45e549344ea84ac1cd20e
10459 F20101122_AAAWCB davis_j_Page_082.QC.jpg
b5c1cdabc61455de0ca2de1611033fd2
b341d01096b525d9f85d133cabcf330a5934e076
8926 F20101122_AAAWBN davis_j_Page_007.QC.jpg
4669f8d2ede62937dec438e93c04d608
64774786c2918d3f6c6572741bf5f0d4960ea774
F20101122_AAAVWG davis_j_Page_085.txt
4c93ff871427612d4be446688c6b6507
5e549edeaeff5dd9b4526b34d7f789ac3cce6d11
23978 F20101122_AAAWAY davis_j_Page_075.QC.jpg
b52e8dd4d56cc0a8425b562ac6aee03c
3c232fd9c24f2e543c609d1d8bfa5e3f0709bc80
1619 F20101122_AAAVVT davis_j_Page_071.txt
9cf7f25d589c518e08026f790a3835ef
8c665c70c9717b2d088fe01a75bd17515b5ed0c3
4595 F20101122_AAAWCC davis_j_Page_106thm.jpg
3d7e065c54677edb6259cb5729c57a64
9c85bb98bf1ac3a193437c0c4537407efb4d8322
24016 F20101122_AAAWBO davis_j_Page_115.QC.jpg
b1f172ed7217e31267bec72a12caaac7
ae7fa1c8f3584da602e1743934d75e6fd5910486
1891 F20101122_AAAVWH davis_j_Page_086.txt
f9f9eb5997a3859bebff98ec96009b51
7fe46a429138bc0cf10716844c72e4ca87554aef
22838 F20101122_AAAWAZ davis_j_Page_019.QC.jpg
833901cdf37d1a56fa1e5b056220a489
193a2824ae4590bb6379fa4dd7aacbdeba728306
1671 F20101122_AAAVVU davis_j_Page_072.txt
0b7cbd6c5f706f81da81eac412b51ad9
36b221e5a480f5a808e83357a61a435a735e46a1
21008 F20101122_AAAWCD davis_j_Page_008.QC.jpg
96d00f0a50a1a9dc635a4c4f9d3a3724
b5a88e602d8dd596b5319f0dfaddb63a94fe9b16
1502 F20101122_AAAVWI davis_j_Page_088.txt
a340e8282dff3727e074e09f260b0860
acee8f7b9990958e8ecea90fa1a946831175dbf1
1829 F20101122_AAAVVV davis_j_Page_073.txt
2c081bb9828193d8bd754b1ccebea365
aa493a4ac697441dc6357f39775c464f096dd679
6493 F20101122_AAAWCE davis_j_Page_120thm.jpg
a52f11b74314faecdffa43490cac47c8
8ea0bdb414dada173433e1309a4b72ab33b73772
6862 F20101122_AAAWBP davis_j_Page_044thm.jpg
9bd02138607d3d32736f3ba0dbd78abe
857ad4f2b96d9ae651dfbc21e3ac303fa1019c7a
682 F20101122_AAAVWJ davis_j_Page_089.txt
0e5de823759925dd3aaabcc22a46bb44
c09571448fc037e0fc725aeb6b642b94bd4db941
1909 F20101122_AAAVVW davis_j_Page_074.txt
65f352f6580e20060f50765397a508ab
388909c94bd054a87565340bf75be76a4dec2d28
6670 F20101122_AAAWCF davis_j_Page_025thm.jpg
5de86c5ed6d05bb4e64afd756e58dfb2
3d599082310d7567c0ffa25942008e5f542bf648
6360 F20101122_AAAWBQ davis_j_Page_074thm.jpg
6253ddf9455f66cbb99ebf5a64a0681f
c00139a7ffdca507894f862c0d1b004a7d4c8098
408 F20101122_AAAVWK davis_j_Page_090.txt
85d6bae768b23d1060502527c6490435
1fbcaba40590a0120f2d0d4827cf21116f7ef3b0
1981 F20101122_AAAVVX davis_j_Page_075.txt
df688ced788318e57a9c0db7bf3e9f83
ee2d43ec83372fc5f7c1fccc140c6eec0c041a4b
6712 F20101122_AAAWCG davis_j_Page_056thm.jpg
0ca1d1de3ca8b4737e937ca4d6204e93
a3cfe438bffc05be9a42b39ebaf53ab5dded548e
3853 F20101122_AAAVXA davis_j_Page_109.txt
76ac9bfc685adcfb66991ab647211017
4e8a1abd43174a29925e9c8f6a8c9afe090728a9
6474 F20101122_AAAWBR davis_j_Page_019thm.jpg
8eb6c01e3bc92c5b0ddaf20ad07edc8f
8f007cc88e77416712d2d92a191de4d036420484
1936 F20101122_AAAVWL davis_j_Page_091.txt
9d17e082b7db2836cb2938cb5a33ad6d
3d3b8d16e8a7bcf3ce2a561fccbf2789d9f3d2b2
2026 F20101122_AAAVVY davis_j_Page_076.txt
6b3e8371dde90da977151210513a7f27
e118e09528a8a620a128e05c4b459f6b901d6d92
6857 F20101122_AAAWCH davis_j_Page_071thm.jpg
aac8c8dcd5af3b4a906f9b6776bf06d6
35829da63c6c89184647f6c146e3bd74733353b7
3899 F20101122_AAAVXB davis_j_Page_110.txt
8e0dea8dac85df1c49d6a4f79755aba6
57346fc10a95766a0cdc2fe418f03290e8b11681
17439 F20101122_AAAWBS davis_j_Page_057.QC.jpg
30864ef1c5a49788f2adb4e134a5d0fc
b0db5cf8883af84da00288fec51300ab734fea27
F20101122_AAAVWM davis_j_Page_093.txt
ccd1b378be0e8e4d692491c2f2646026
fc168f788a87680ba99710a014f3824523ca920f
1859 F20101122_AAAVVZ davis_j_Page_077.txt
93aee61ab808396a56a4af42cbce7d68
07fb8bce53bdf8c2505692e9a5367351004db338
6675 F20101122_AAAWCI davis_j_Page_069thm.jpg
138ab7ce3f3ba869fc41187eb5b5609a
a7367a8852f9eab9682a2a8ccc42ef775a552aba
1376 F20101122_AAAVXC davis_j_Page_111.txt
c728cb009ad28aeb15167eac0d999dc6
a60a03953f2f30165043624b76ed300cdfd0f109
4886 F20101122_AAAWBT davis_j_Page_089thm.jpg
5d37204274efe3f26c53b28ffa7ad267
d17ee3258d6ec968652792c20028b722ce5bd296
2011 F20101122_AAAVWN davis_j_Page_094.txt
22f4520b89630e136ca2dccfb6408c8f
1590ac2b966a0064dfb6e73a8ef87e1113052a42
24903 F20101122_AAAWCJ davis_j_Page_109.QC.jpg
171114aa0d239c312963972a2a0caa93
5706006ad57df57d0f5b542ac22e2b358fc4a2f5
1967 F20101122_AAAVXD davis_j_Page_112.txt
58e5fc4559c5c42d947ac684646d8ca8
b32c1c9d87a337bcf2aa56a6f18179d650d2c7a4
25099 F20101122_AAAWBU davis_j_Page_124.QC.jpg
e0483ed16ffbf7bbf0ea51ed0b367b94
0ecf98d9d31079688a77203337c5a0e05359171f
F20101122_AAAVWO davis_j_Page_095.txt
d2fc44d083acf8b185f15754a0647400
684fafbd3667241ce3acab4a4fa373e77ad04cf8
4557 F20101122_AAAWCK davis_j_Page_050thm.jpg
380b9d7095cf68c429b7466919b54c0e
8a88718447aad3812f2a209930c9239efe0078f8
2116 F20101122_AAAVXE davis_j_Page_113.txt
2bceaf77c6db907bd9847f9efe50456f
9fff7a8cb632e5447390737865d166e41d68ff53
6542 F20101122_AAAWBV davis_j_Page_077thm.jpg
75c5d5fdc778878f08e715dd6e67d94c
84f39f2e48dbbf0a2804822c26104e04bc6d752c
972 F20101122_AAAVWP davis_j_Page_097.txt
e91c617c795b009cc09304226b24b158
8a3b8ef4f4002e140bdc0338e8ba263fc3e12eca
F20101122_AAAWCL davis_j_Page_041thm.jpg
1048b9a1adbc04cbf3fb1113f163bea6
7b60dbbf80e0f6cfc3d5ceff003d3c1573e9de82
2566 F20101122_AAAVXF davis_j_Page_114.txt
90f8c4a6735074025d5f71a30e75f26e
da206d7d4ca55416eed07e23beeaf4851a93621e
4315 F20101122_AAAWBW davis_j_Page_098thm.jpg
c8077a63db0ff3bb34e5ef40d5f149b1
234ee6587b7232a05164e01092928d297a9af961
786 F20101122_AAAVWQ davis_j_Page_098.txt
44198b12268069c5a422f742288c4028
a4ae09933f322d5b4be906fc663ba999f4fd2e3f
5823 F20101122_AAAWCM davis_j_Page_112thm.jpg
1ef26f38c8c9c0387b25601d4dd5c4b4
abb29185b6bbf1b013c4100bbd7e5fd4bd4d7cd9
22431 F20101122_AAAWBX davis_j_Page_086.QC.jpg
4ba31176be8f9ee07c5434fff1c06502
3cfa978efb90f6e6bd9e810188e9b50cd039e0c2
3020 F20101122_AAAVWR davis_j_Page_099.txt
4d89b54d87b512208eb1ca18c84e79c9
ea4979550fda12ba97939ea55b75c7413a79ea51
25448 F20101122_AAAWDA davis_j_Page_048.QC.jpg
1bc76959ba51dcd5ff532891a76f2b63
26008b67106171a98fb29081d064a025bccd6975
3969 F20101122_AAAWCN davis_j_Page_126thm.jpg
6d966a63adaa7df3b9208b133b13c881
fcd0453735c84534ae7e19168e09eb3763d4b972
2303 F20101122_AAAVXG davis_j_Page_115.txt
2fac0bc19585e2fd53aabfc6009daa20
6b06d39c0586cd9dfb24afae4e0c80a8841a73ad
23950 F20101122_AAAWBY davis_j_Page_042.QC.jpg
cb93150e9e0f549e10b929df4b52f39a
375ce009400d9494271fb28fe640ce5172426b2c
3128 F20101122_AAAVWS davis_j_Page_100.txt
f10570cff19d57d9b3d29bea651b27ba
c5506f302863f461e817539fba2bf07f312cf5b8
24430 F20101122_AAAWDB davis_j_Page_117.QC.jpg
91a78ef150c10d5b3df7285b8e5e269b
6503d0c366cba747451a09f89bf813c0a8daab8b
6762 F20101122_AAAWCO davis_j_Page_042thm.jpg
e1d4592634f02a52573437197f5265ab
3ec84ac54cf333b3178be88e4ec552abb63196e5
F20101122_AAAVXH davis_j_Page_116.txt
8e7346fba02859fbe9b98f4cd3d61eee
a13d9534f427d5ce046b58032b0e5144c7027a99
3324 F20101122_AAAWBZ davis_j_Page_082thm.jpg
4f8ed82e482394b8414ed3fe3d65fa34
41aadfc45704e1a963815423db8e4b4a497b0035
3107 F20101122_AAAVWT davis_j_Page_101.txt
cda84c09c2c49835731560bf03d1a746
fb721e7fd6461f0ae73dfd0f7638baea2dbdc07d
6361 F20101122_AAAWDC davis_j_Page_118thm.jpg
62e2feb412dadb07ce6847bf15968beb
89ceb737d3562fb84e9acf786738cc4eb8c8fee1
22772 F20101122_AAAWCP davis_j_Page_077.QC.jpg
d13e1c296122b4761afc224620aae64e
af9f8b61bf2e500562f6016bf789481f116568f0
2181 F20101122_AAAVXI davis_j_Page_118.txt
9d4072430dcb4cc4aa8a45a7770f6521
aab1e4d5bfb7517f4ffd4b083de53559bd044f4f
2981 F20101122_AAAVWU davis_j_Page_103.txt
7d8884b242987a6f57625d2894b3e4d7
4a0697f43d3f62561a34e333e560cefd2dfa0d87
4581 F20101122_AAAWDD davis_j_Page_011thm.jpg
506d910de2624b81ba79fd717cd1d09c
20d89f7238cbd1780b5f2824aed8813041afc8f8
2390 F20101122_AAAVXJ davis_j_Page_119.txt
88f82adb281defa4d3d038ec3de0adf2
afd6ec457f950cb50b04f8288ed7d6bb43833da9
2804 F20101122_AAAVWV davis_j_Page_104.txt
5873090ae66c91b818a266d85ae1e54b
efc2c6c0d883e3eca5dcea79ef24b6bf6af06c41
15458 F20101122_AAAWDE davis_j_Page_125.QC.jpg
5827e951044536b71b8b9425a57ad10f
1af34785119232fa48dcbeaddc5fdd40f9be19dc
22477 F20101122_AAAWCQ davis_j_Page_062.QC.jpg
917c4f9a1bfc0d0c090ca75382b26baf
3bf8b17dbc6594828be54c9167f4bc412f009929
2318 F20101122_AAAVXK davis_j_Page_120.txt
88e056d662be2dc6ae467554dfd232ad
c15251542eaf75d7e0f42ace09931abef9ee39b2
2761 F20101122_AAAVWW davis_j_Page_105.txt
eb92b67017a05eec08c1def13cf5a52d
f7a400d444b4b8fde2d8097452aa03863268f209
6401 F20101122_AAAWDF davis_j_Page_072thm.jpg
0019cd6706eeb9c71d5206ae7b9d3eef
6d99a4e977cc8b75d30773d57baca55ea04831ac
6684 F20101122_AAAVYA davis_j_Page_117thm.jpg
bcfbd1495ec6d61cb06a6cc5e13b9191
e551ff3b61f665a0ee070e0e3d97a8501bb216e1
20360 F20101122_AAAWCR davis_j_Page_032.QC.jpg
eeb84d1c89e41e3a0e5051c748f1e867
27867c8e26cf651085a44611cf10d4e5631af18b
2480 F20101122_AAAVXL davis_j_Page_121.txt
4881823756eaff44c35b7145f57d2530
c55e0c32f1bd49320e3127e4cb7e32b74e598e5a
3018 F20101122_AAAVWX davis_j_Page_106.txt
0d8a0c85bb5c1791e0a4b53cd3286015
2a8d2216eb51f24841c2e47fbb28c9fc4e3e8e92
13136 F20101122_AAAWDG davis_j_Page_083.QC.jpg
d5d9cb562004ae1f7f7031bcf2847a9a
169aeff5a255a221dbabd80f5d735acfc85c806a
16186 F20101122_AAAVYB davis_j_Page_004.QC.jpg
86e1c39dff331fdb5da38c9f3047cf25
47ef60e1658f4aeb586e4fbd58e1906f992d8c60
4878 F20101122_AAAWCS davis_j_Page_100thm.jpg
b8c37a4e5782e7d0f902928a88a898c4
4011be74a90f32fd0a458a8aa1e8404cad784b3f
2412 F20101122_AAAVXM davis_j_Page_122.txt
b99e017f5048dce9e714e5d35c86feef
65a85dd34cf9d22ef3ccc81e263d697f30cc5f04
797 F20101122_AAAVWY davis_j_Page_107.txt
704278c329af24bb9f503d6b2101383b
030becc87eef19e6d61723aeace2482bcdf90b19
6605 F20101122_AAAWDH davis_j_Page_094thm.jpg
1990ba2ba44960aea3f6f316c082ebe5
72d56fcd1c4dfbdc3229d80f8360b6e60b2abce6
23854 F20101122_AAAVYC davis_j_Page_078.QC.jpg
20f188c508de8aeeca6d52237ad877d8
2f2667eb0adc436df34ef7ac2a667086367da145
6578 F20101122_AAAWCT davis_j_Page_061thm.jpg
ef6d7b42a774b22588190d0d301bec4e
709372a11e3511cec8f59c332765a280f427fae4
2388 F20101122_AAAVXN davis_j_Page_123.txt
940658155aa572a24a00fd68a34d2c89
4f882aa88eb81e6d96db1a057852315e00ed2b44
2647 F20101122_AAAVWZ davis_j_Page_108.txt
651b9611b79f167db41726964314ae6e
f4c93f0585c1d6650e9387c6ba6cf7ec3c2069e4
6285 F20101122_AAAWDI davis_j_Page_088thm.jpg
37b364a215a4f155732e1cfcdd7d6682
5ceaec5390bb37d2c11533e037dbd04530cd5197
6983 F20101122_AAAVYD davis_j_Page_122thm.jpg
514c434105dfec25baf294edf10510ce
ce001cfbcb2e29664eb1b23d41da303203a68e83
24182 F20101122_AAAWCU davis_j_Page_093.QC.jpg
987ce1d5dc3c78c23223b79d56501436
14b94d12455a80c810f6d91fe8cd716fc1acd237
2361 F20101122_AAAVXO davis_j_Page_124.txt
cb228adda5e55f35d49d7bfe0b86ae61
55785239b11854705e8faa080c0b60ceb0c42bdc
24544 F20101122_AAAWDJ davis_j_Page_041.QC.jpg
e8b6ef153735fd73c184bf0b87b34d6b
c64f25b965df2f4250790edb03a1cd29b2f56a1b
24790 F20101122_AAAVYE davis_j_Page_110.QC.jpg
83dc5416d337414e991c63b0ee847623
19999d3f4e20cce67cc6d6977a4364cc6e0eb355
23524 F20101122_AAAWCV davis_j_Page_052.QC.jpg
816dd8888d9fff3e8f44df4944b13cd5
eac34f29eccceb41807a438cb89f491ea16ad3e4
995 F20101122_AAAVXP davis_j_Page_126.txt
d909a6848bd2fa91b324939653c2c864
574681aca01754423378ad764c47c86b03e5cd94
24970 F20101122_AAAWDK davis_j_Page_044.QC.jpg
6ed7134d03718cedbf1276232ba5f053
f3ae72dc55e289d3dff8e05d6edce57d4e390e4c
24192 F20101122_AAAVYF davis_j_Page_069.QC.jpg
d6f7d871bbdee51b45aee940ec403d3e
e885da733a11b8f77ca5cb74fe4b64319cf20961
24387 F20101122_AAAWCW davis_j_Page_031.QC.jpg
6ffc48335677c4ec32f0b2b60f711c14
6e615e207147d58e42f60581e3ea62766e19687a
1868813 F20101122_AAAVXQ davis_j.pdf
8805c06aa6bff83010f7849acb72340a
bcdd13dd4dcd0ff2bc57ac5c809dcb223f17b1fb
23260 F20101122_AAAWDL davis_j_Page_016.QC.jpg
fc2be89313c87b8615706ae0cce2f9a9
28201992c8ff3c531d1b7311f91d163b95655346
7007 F20101122_AAAVYG davis_j_Page_107.QC.jpg
f8b753df900fc8a8752b0aef51219ac9
84fe1529573ca196ae1cb73681eb4f79edc087c3
6495 F20101122_AAAWCX davis_j_Page_021thm.jpg
fc12a8ad2ca2644c9798a301c7ede656
f2dd30483f978b34fff3a135c97d0fd5b4cedc9f
24311 F20101122_AAAVXR davis_j_Page_026.QC.jpg
d4ada766ff401633ba47be446f1ef146
341531208a0655ff405edd00b147ad9ac00aa0be
6437 F20101122_AAAWEA davis_j_Page_024thm.jpg
4f893920622ae205c0794f2d7eea57ad
056169782403b46800ee565b3f89d7bd2f369a3f
6697 F20101122_AAAWDM davis_j_Page_119thm.jpg
d4df90f77328e9ad25f316688917aad8
d7837c762c69c38d9e8ea7cae01a0f57f43b3b29
23566 F20101122_AAAWCY davis_j_Page_072.QC.jpg
ae369666e8cc8f522b5840e7743a13e2
041215fde23791f3755b9db068a22fb4d558bc6c
6613 F20101122_AAAVXS davis_j_Page_075thm.jpg
2afd5cf0299fb180dfce9bce492dd51a
7d91dac3e0317431b684b9b670d3a079368959ae
6413 F20101122_AAAWEB davis_j_Page_029thm.jpg
fee9bea7903d41c0b89b294df33556ac
038d86665dd9444be48022dcf135661abfe1a259
19734 F20101122_AAAWDN davis_j_Page_005.QC.jpg
fe9dcd6ec86c82447a6d8bcf9361da00
b4c5c66496561f2448d541833d42144f495b9d87
5046 F20101122_AAAVYH davis_j_Page_079thm.jpg
a13e4140dd71b74d321eaacb1ef2bea5
c75f849672cb46155fb13437380c3f874fdeaf1e
F20101122_AAAWCZ davis_j_Page_028.QC.jpg
60e3a580e90ec6a553f53e25cc91617e
596683644e86200c281338f1328d9f70d9c7d84f
21724 F20101122_AAAVXT davis_j_Page_023.QC.jpg
795c688f0cc4a41c1098ca2b73d7343c
d1253c5dc901c851c7886e76a3edb81504835006
6631 F20101122_AAAWEC davis_j_Page_031thm.jpg
8591341b792fd2d23f14412d0005dda5
0e6b5c009d8d5529f3ec03032158c112eacc23bf
25908 F20101122_AAAWDO davis_j_Page_119.QC.jpg
d92b914d3c6d8cea28af0324b449a091
d31ff609ef1297e1a34faae41f2e4c8859a1c4ab


Permanent Link: http://ufdc.ufl.edu/UFE0012020/00001

Material Information

Title: Effect of Ethylene Sensitivity on Development and Germination of Petunia x hybrida Seeds
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012020:00001

Permanent Link: http://ufdc.ufl.edu/UFE0012020/00001

Material Information

Title: Effect of Ethylene Sensitivity on Development and Germination of Petunia x hybrida Seeds
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0012020:00001


This item has the following downloads:


Full Text












EFFECT OF ETHYLENE SENSITIVITY ON DEVELOPMENT AND
GERMINATION OF Petunia x hybrida SEEDS















By

JENNIFER LYNN ROLL DAVIS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Jennifer L. Davis

































This document is dedicated to my mom, Lynn Roll.















ACKNOWLEDGMENTS

I would like to acknowledge the support and dedication of my family throughout

my graduate research. I would like to thank my husband, Keith Davis, for listening to

me throughout my trials and tribulations that were a result of the last four years. I would

like to also thank my parents for their continual support and dedication for anything that I

do in my life. I would like to thank my sister, Lisa, for being a constant companion

throughout our lifetimes.

I would like to acknowledge and thank my advisor, Dr. David Clark, who has

directed and guided me for the past seven years. Additionally, I would like to thank my

committee members, Dr. Harry Klee, Dr. Don McCarty and Dr. Rick Schoellhorn, for

advice and direction regarding my research.

I would like to thank my lab members that have continually given me advice and

kept me sane: Dr. Kenichi Shibuya, Dr. Beverly Underwood, Dr. Kris Barry, Holly

Loucas, Rick Dexter, Penny Nguyen and Jason Jandrew. I also would not have been as

successful in my research without the advice of Dr. Denise Tieman and Dr. Joe Ciardi,

who answered an endless number of questions.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ......... .................................................................................... iv

LIST OF TABLES ............. ..... ......................... .......... ............. vii

LIST OF FIGURES ............. ................... ............ .......... ............... .. viii

A B ST R A C T .......... ..... ...................................................................................... x

CHAPTER

1 IN TRODU CTION ................................................. ...... .................

2 LITER A TU R E REV IEW ............................................................. ....................... 4

Ethylene Biosynthesis, A action and Signaling.................................... .....................4
Seed D evelopm ent .............. ..... ......................................................... .. ...... ... 7
Maternal Plant Role in Seed Development...................... ...............9
Ethylene in Fruit and Seed Development and Subsequent Germination ..................11
Ethylene, ABA, and Sugar in Seed Development and Germination ..........................15
C ondensed T annins............ ................................................................ ........ .. ... 17
C conclusion ....................................................... ...........................2 1

3 EFFECT OF REDUCED SENSITIVITY TO ETHYLENE ON SEED
DEVELOPMENT, DORMANCY AND GERMINATION............. ............ 22

Intro du action .................................................................................................... 2 2
R research O bjectives.......... ................................................................. ......... ....... 28
M materials and M methods ........................................................................ ............... 29
Culture and Growth of Petunia x hybrida Plants ................................... 29
Seed Weight, Seed Size, and Seed Number of Petunia x hybrida Developing
S e e d s ........................ .................................................... 3 0
Sucrose Analysis of Developing Seeds ............................. ... .............. 31
CO2 Analysis of Developing Seeds...... ..................... ...............31
Seed Development Marker Analysis...................................... .............32
G erm nation A ssay ............................ .. .... .............................. .... .......... 33
ABA Germ nation Sensitivity Assay........................................ ............... 34
R results ........................... ..... ...... .... ...... .. ........................................ ..... 34
Seed Characterization by Weight, Size, and Seed Number..............................35


v









Developmental Delay of Seeds Reduced in Ethylene Sensitivity .....................36
The Effect of Ethylene Sensitivity on Seed Germination ..............................42
ABA Sensitivity and Germination............. ....... .................42
D isc u ssio n ............................................................................................................. 4 5
C conclusion ...................................................................................................... ....... 51

4 MICROARRAY ANALYSIS AND CONDENSED TANNIN CONTENT OF
PETUNIA SEEDS AFFECTED IN ETHYLENE SENSITIVITY ............................53

Introduction .......................... ..............................53
R research O bjectiv es.......... ................................................................. ......... ....... 55
M material and M ethods ...................................... ......................... .... ............... 55
Culture and Growth of Petunia x hybrida Plants .........................................55
Petunia x hybrida cDNA Libraries.................................. ........................ 56
cDN A M icroarray Fabrication ........................................ ........................ 57
Microarray Hybridization ........................... ....................... 58
RT-PCR Confirmation of Microarray Experiments........................... .........59
RT-PCR of Condensed Tannin Synthesis Genes .........................................61
V anillin Staining of Seeds ...................... .. ............................... ............... 62
R e su lts ................. ..... .. ............. .. .....................................................6 3
M icroarray A analysis ................................................. ......... ..... ............. 63
Condensed Tannin Analysis of Seeds Carrying The etrl-1 Transgene .............67
D isc u ssio n ............................................................................................................. 7 5
M icroarray A naly sis ............................ ...................... ............ .... ..... ...... 75
Condensed Tannin A analysis ...................................................... ..... .......... 82
C conclusion ...................................................................................................... ....... 85


APPENDIX ABI3 ANALYSIS AND MICROARRAY DATA ............. ...............87

LIST OF REFEREN CES .................................................................. ............... 101

B IO G R A PH ICA L SK ETCH .................................... ........... ................. .....................115















LIST OF TABLES


Table p

4-1 Highest ranked differentially expressed cDNAs of a microarray experiment of
whole fruit tissue of ETR (44568) compared to MD at 25 days after pollination ...68

4-2 Highest ranked differentially expressed spots of microarray experiment of
maternal fruit tissue of ETR (44568) compared to MD at 25 days after
p o llin a tio n ............. ......... .. .. ........... ... .. ..................... ................ 6 9

4-3 RT-PCR confirmation of microarray differentially regulated clones. .....................70

A-1 cDNA library clones included on microarray chip experiments............................88
















LIST OF FIGURES


Figure p

2-1 Proanthocyanin Synthesis Pathw ay.................................. ..................................... 19

3-1 A picture series of fruit and seed development of all genotypes ............................37

3-2 Seed size of all genotypes of seeds through development....................................38

3-3 Average weight of individual seeds of MD, MxE, ETR (44568) and ExM ............38

3-4 CO2 Accumulation throughout 3 hours of developing seeds of MD, ETR
(44 568), M xE and E xM ........................................ .............................................39

3-5 Average number of seeds per fruit of MD, MxE, ETR (44568) and ExM. .............40

3-6 Sucrose content of seeds of all genotypes ...... ......... ...................................... 40

3-7 RT-PCR analysis of seed developmental markers ....................................... 43

3-8 Germination of seeds of all genotypes after various storage periods.....................44

3-9 ABA sensitivity of germinating 1 month old seeds of MD, ETR (44568), MxE
and ExM ...................................... .................................. ........... 46

4-1 Extended RT-PCR expression analysis of microarray differentially regulated
clo n e s ..............................................................................................7 3

4-2 Highlighted proanthocyanidin synthesis genes observed through RT-PCR
expression analysis in all genotypes................................... .......................... 76

4-3 Seed pictures of 44568 and MD ........... ........... ............... 77

4-4 RT-PCR mRNA expression analysis of genes involved in the proanthocyanidin
synthesis pathw ay .................. ....................................... .. ........ .... 78

4-5 Freshly harvested and 1 month old seeds of all genotypes stained with 1%
v a n illin ............................. ............................................................... ............... 7 9

A -i R T-PC R analysis of PhA B I3........................................................................ .. .... 87

A -2 A B I3 Southern A nalysis................................................. .............................. 87









A-3 Complete list of differentially regulated clones in 44568 and MD whole fruit
m icroarray experim ent at 25 D AP. ............................................... .....................97

A-4 Complete list of differentially regulated clones in 44568 and MD maternal tissue
microarray experiment at 25 DAP. ........................................ ....... ............... 98

A-5 Complete list of differentially regulated clones in ein2 and MD whole fruit
tissue microarray experiment at 25 DAP. ..................................... ............... 99

A-6 Complete list of differentially regulated clones in ein2 and MD whole fruit
tissue microarray experiment at 30 DAP. ................................... ............... 100















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EFFECT OF ETHYLENE SENSITIVITY ON DEVELOPMENT AND
GERMINATION OF Petunia x hybrida SEEDS
By

Jennifer L. Davis

December 2005

Chair: David G. Clark
Major Department: Plant Molecular and Cellular Biology

Past research has proven that several hormones play a role in different stages of

development, dormancy, and the germination of seeds. Ethylene, a gaseous plant

hormone, is involved throughout many plant processes including the development and

germination of seeds, though the action of ethylene is not completely understood with

respect to seeds. The goal of this research was to take a more detailed look at ethylene's

role in Petunia x hybrida seed development and germination.

It was observed in transgenic petunias (44568 CaMV35S::etrl-1) reduced in

ethylene sensitivity that ethylene primarily acts by stimulating the developmental time-

course and thereby increasing germination rates. The full time-course of seed

development was delayed in homozygous 44568 seeds by approximately five days

compared to wild-type Mitchell Diploid (MD) seeds. Also, when the two lines were

reciprocally crossed, only seeds produced on the 44568 maternal plants displayed the

phenotype of delayed seed development. When germination was assayed, both









hemizygous and homozygous seeds carrying the etrl-1 transgene had reduced

germination, but both were able to recover to MD germination levels after six months of

cold storage. All seeds carrying the etri-1 transgene were also more sensitive than wild-

type to exogenously applied ABA during an additional germination assay.

Differences in gene expression between 44568 and MD were observed through

microarray analysis. The results of the microarray experiments and the observation of a

color difference of freshly harvested seeds altered in ethylene perception led to further

analysis of proanthocyanidins, or condensed tannins. Expression analysis of genes

involved in condensed tannin synthesis did not exhibit any major differences between the

genotypes carrying the etri-1 transgene versus MD. Overall, the primary findings of this

research were that the ethylene sensitivity of the maternal parent had a significant role in

the developmental timing of seeds. Conversely, the overall decreased sensitivity of the

zygotic tissue to ethylene determined the stronger dormancy induction and heightened

ABA germination sensitivity observed in all seeds carrying the etrl-1 transgene.














CHAPTER 1
INTRODUCTION

Angiosperm seed development is mediated by an assortment of genetic programs

involving hormones, fatty acids, storage proteins, carbohydrates and many other

components of plant growth and metabolism. The seed is composed of several tissues

including the embryo, endosperm, and the testa or seed coat. The embryo contains the

tissues that include the root and shoot meristems which develops into a seedling. The

endosperm is comprised of an epidermal layer, an aleurone, and nourishing tissue

surrounding the embryo. The seed coat provides a protective cover over the other tissues

(Harada, 1997). A seed undergoes a complex course of development after fertilization

until the point where it is considered a mature seed capable of germination. The

development of the embryo after fertilization occurs in three general stages:

differentiation of tissues, cell enlargement and maturation (Buchanan et al., 2000;

Chaudhury and Berger, 2001).

Some seeds enter dormancy after maturation, while other seeds immediately

become ready for mobilization of stored reserves in preparation for germination to begin.

There are two types of dormancy: primary and secondary. Dormancy is defined as the

inability of mature seeds to germinate under favorable conditions (Bewley, 1997).

Primary dormancy occurs in the freshly-harvested seed; it develops during seed

development and maturation on the mother plant. The maintenance of primary dormancy

is determined by environmental and genetic factors (Bewley, 1997; Gubler et al., 2005).

This dormancy prevents the seed from germinating in unfavorable conditions and is









imposed by the embryo itself or the seed coat. Embryo dormancy can be overcome by

dry storage or stratification, and seed coat dormancy can be countered by removal of the

seed coat (Kepczynski and Kepczynska, 1997). Secondary dormancy is initiated after the

seed has been dispersed from the mother plant. This type of dormancy inhibits

germination due to a lack of proper environmental cues such as temperature or light

needed for the initiation of the germination processes (Foley, 2001).

An overlap of hormone and carbohydrate signaling pathways is apparently

integral in seed developmental processes. Currently, a good portion of the dicot seed

research is being conducted on Arabidopsis due to the predictable patterns of cell division

within the seed and the wide availability of mutants, including those that are insensitive

or hypersensitive to many of the hormones (Buchanan et al., 2000). Seeds from different

species have widely different proportions of carbohydrates, oils, and stored proteins;

therefore, it is important to study seed development and germination in different species

to determine where differences may occur (Ruuska et al., 2002). The species used in this

research is Petunia x hybrida. Petunia seeds are similar to Arabidopsis in structure and

components of metabolites; therefore, information gained from mutant analysis research

conducted on Arabidopsis seeds may provide a basis for research conducted on seed

action in petunia. Petunia, like Arabidopsis, is used as a model system, but petunia

serves as a particularly useful model for studies on floriculture species. A short

generation time and the ability to make abundant amounts of seeds are also

characteristics of petunia that make it a good candidate for seed research.

The hormone of interest in the following research is the gaseous plant hormone

ethylene. Ethylene action in seeds is not significantly understood, and further research on









ethylene may provide interesting evidence for interactions with other hormones. In

research with petunia transgenic plants reduced in ethylene sensitivity, it was observed

that fruit development is affected by ethylene, along with many other plant processes

such as senescence, disease tolerance and root development (Wilkinson et al., 1997;

Clevenger et al., 2004; Shibuya et al., 2004). In previous research conducted on the

effects of altering ethylene synthesis and sensitivity in seeds, it was observed that other

hormones such as gibberellic acid and abscisic acid were also impacted (Beaudoin et al.,

2000; Ghassemian et al., 2000; Chiwocha et al., 2005). It is likely that interactions

between ethylene and other plant hormones play a vital role in seed development

(Kepczynski and Kepczynska, 1997). The purpose of this research is to use genetic,

molecular, and physiological analyses to help define ethylene's role in seed development

and subsequent seed germination, and to also characterize ethylene's interactions with

other hormones in petunia seeds.














CHAPTER 2
LITERATURE REVIEW

Ethylene Biosynthesis, Action and Signaling

The plant hormone ethylene is a simple hydrocarbon gas that has been studied for

over a century (Abeles et al., 1992). It is involved in many different plant processes

including floral and foliar senescence, vascular differentiation, stress response, fruit

ripening, and adventitious root formation (as reviewed in Bleecker and Kende, 2000).

The synthesis pathway starts with methionine being converted to S-adenosyl-L-

methionine (SAM) by the enzyme SAM synthetase (Adams and Yang, 1979; Yang and

Hoffman, 1984). Subsequently, SAM is converted to 1-aminocyclopropane- -carboxylic

acid (ACC) by ACC synthase (ACS), which is the first committed step in ethylene

biosynthesis (Yu et al., 1979). The last step is the conversion of ACC to ethylene

catalyzed by ACC oxidase (ACO) (Hamilton et al., 1991; Spanu et al., 1991).

The genes that encode the enzymes of the ethylene biosynthesis pathway have been

cloned and studied in-depth in many species (Sato and Theologis, 1989; Hamilton et al.,

1990; Zarembinski and Theologis, 1994). The expression of these genes can be induced

by many factors, and expression levels are generally correlated with ethylene production

(Acaster and Kende, 1991; Kende, 1993). Ethylene itself in some cases induces

expression of ACS and ACO resulting in autocatalytic ethylene synthesis (Abeles et al.,

1992). Conversely, ethylene can be auto-inhibitory as well and restrict synthesis through

regulating expression of enzymes involved in the synthesis pathway (Abeles et al., 1992).









The previous case of positive feedback regulation of ethylene biosynthesis is known to be

a characteristic feature of ripening fruits and senescing flowers (Kende, 1993).

Components of ethylene perception and the subsequent initiation of signaling were

able to be identified because of the extremely useful seedling triple response screen. The

screen was developed through the phenotype of ethylene response that causes seedlings

to grow short, stout and have an exaggerated apical hook in the presence of ethylene in

the dark. Seedlings that did not exhibit this phenotype were defective in ethylene

perception (Bleecker et al., 1988). The first component discovered in ethylene perception

through this screen was a receptor, ETR1 (Bleecker et al., 1988). Four other receptors in

Arabidopsis have also been identified since then: ETR2, ERS1, ERS2 and EIN4 (Hua et

al., 1995, 1998; Sakai et al., 1998). Analysis of the receptors revealed that there is

homology to bacterial two-component receptors. The first component consist of a sensor

protein that receives signals through an input domain which autophosphorylates a histine

residue. The second component is a response regulator protein that receives the

phosphate and mediates responses through an output domain (Chang and Stewart, 1998).

Mutant research focused on the receptors, especially ETR1, has provided information

about the action and effects of ethylene perception. The first ethylene receptor mutant,

etrl-1, was identified in Arabidopsis and was discovered to result in a strong decrease in

ethylene sensitivity (Bleecker et al., 1988). Some of the results of the loss of ethylene

perception were delayed floral and foliar senescense, decreased adventitious rooting,

increased susceptibility to pathogens, decreased seed germination and delayed fruit

ripening (Bleecker et al., 1988). Additionally, it was observed that the etrl-1 mutation









from Arabidopsis could be transformed into heterologous species, such as petunia and

tomato, and also confer the reduction in ethylene sensitivity (Wilkinson et al., 1997).

The next component identified in the ethylene signaling cascade was CTR1. The

loss of function mutant of CTR1 exhibited a constitutive ethylene response in absence of

ethylene; therefore, it was deemed a negative regulator of ethylene signaling (Kieber et

al., 1993). Double mutants between CTR1 and ETR1 had the phenotype of constitutive

ethylene response, so it was concluded that CTR1 acts downstream of the receptors

(Kieber et al., 1993; Hua et al., 1998; Sakai et al., 1998). Two other components

downstream of CTR1 are EIN2 and EIN3. EIN2 is a membrane bound protein that

positively regulates the downstream EIN3 transcription factor (Guzman and Ecker,

1990). The cloning of EIN2 revealed that it is a novel plant specific protein whose exact

biochemical function is unknown (Alonso et al., 1999). EIN2 is also known to be a

membrane protein with 12 membrane spanning regions, and the amino end of the

sequence shows homology to a family of metal ion transporters but transport activity has

not been shown to date (Alonso et., 1999). The downstream target of EIN2, EIN3, is

another positive regulator of ethylene responses. EIN3 was discovered to belong to a

small family of genes because mutant plants of EIN3 only showed partial reduced

sensitivity of ethylene; therefore, it was concluded that it is part of a small family with

some functional redundancy (Roman et al., 1995). One target of EIN3 is ERF1 (Solano

et al., 1998). ERF1 is a member of a family of transcription factors that are known as

ethylene-response-element binding-proteins (EREBPs), which initiate transcription of

genes involved in the ethylene responses (Ohme-Takagi and Shinshi, 1995).









An interesting aspect of the ethylene signaling cascade is that a mutant receptor is

considered a gain of function mutant. This is because CTR1 is continuously repressing

the downstream components of the signaling cascade until ethylene binds to a receptor

and inactivates the repression. A mutant in one of the receptors is a gain of function

mutant because the mutant receptors fail to turn off in the presence of ethylene (Bleecker

and Kende, 2000). This gain of function characteristic results in ethylene insensitivity

when only one of the five receptors are mutated.

Seed Development

The development of the angiosperm seed is first initiated at the point of

fertilization. The process of double fertilization eventually leads to the development of

the embryo and endosperm structures of the seed. One sperm cell fertilizes the haploid

egg cell and develops into the zygotic embryo tissue. The other half of double

fertilization occurs when a second sperm cell joins with a diploid central cell resulting in

a triploid endosperm. These processes occur within maternal diploid tissue which

eventually becomes the testa, or seed coat (as reviewed in Chadhury and Berger, 2001).

Different ploidy tissue and different ratio representations of the maternal and paternal

genomes make understanding the regulation of seed development extremely complex.

The seed goes through three main chronological phases during development after

fertilization: 1) cell division and differentiation of the cells; 2) cell enlargement through

accumulation of assimilates and storage reserves; 3) maturation, acquisition of

desiccation tolerance and preparation for dormancy (Chaudhury and Berger, 2001).

After fertilization, the zygote undergoes a period of rapid cell division. The first

two cells formed are the apical and basal cells. The apical cell gives rise to the main

portion of the embryo which includes the shoot meristem, whereas the basal cell forms









the root and suspensor (Mayer et al., 1993; Mayer and Jurgens, 1998). Following

cellularization, the endosperm begins differentiation. The endosperm serves as the

nourishing tissue for the developing embryo (Brink and Cooper, 1947). The endosperm

also controls the osmotic potential around the embryo, mechanical support during early

embryo growth and storage of reserves and hormones (Lopes and Larkins, 1993).

Research also indicates the endosperm has a role in providing signals for early

development to the developing embryo (van Hengel et al., 1998). Additionally, it is also

thought that the maternal tissue and endosperm regulate the development of each other

(Lopes and Larkin, 1993; Felker et al., 1985). During this stage carbohydrates begin to

be imported into the developing tissue. Sucrose supplied by the endosperm is thought of

as the main carbon and energy source of seed metabolism (Schwender and Ohlrogge,

2002). Sucrose is symplastically transported through the phloem of the maternal plant

tissue into the seed coat, which is also maternally derived tissue (Weber et al., 1998). In

the seed coat, the sucrose is cleaved into hexoses by invertases and transported passively

into the endosperm and developing embryo (Weber et al., 1995).

During the expansion phase, the cells begin to accumulate storage reserves.

Stored reserves are usually accumulated in the endosperm and in the embryo in the form

of proteins and carbohydrates, which break down and are used as carbon and energy

sources during the germination process (Lara et al., 2003). This stage is also marked with

high respiration rates due to the high levels of metabolic activity occurring during the

assimilation process (Zaitseva et al., 2002). Seed storage proteins are specifically

synthesized at certain periods of development and are tightly regulated. Certain seed









storage proteins such as albumins and globulins are expressed more during the

accumulation phase through the middle of the maturation phase.

The last portion of seed development is the maturation and dessication phase. In

this stage of development invertases are inactivated and sucrose is carried by a sucrose

transporter protein into the seed coat. The sucrose is not cleaved at this point and is

moved symplastically into the embryo through the plasmodesmata; this increase in

sucrose concentration in the seed helps signify the end of development is nearing

(Borisjuk et al., 2002). This increase in sucrose:hexose concentration helps control seed

development and sends signals to the embryo to begin the maturation phase by inducing

storage associated gene expression in the final stages of seed development (Smeekens,

2000). Late embryogenesis abundant (LEA) proteins are a class of storage proteins that

are highly induced later in this maturation phase due to their role in acquisition of

desiccation tolerance (Wobus et al., 1999; Hoekstra et al., 2001). Abscisic acid has also

been shown to play a role in inducing genes such as seed storage and LEA proteins

during these latter stages of seed development for protection of the seeds in the

dessication process (Baker et al., 1988; Dure et al., 1989; Brocard et al., 2003). Direct

interaction occurs between ABA signaling transcription factors, such as ABI3, and the

transcription factors associated with seed storage proteins, which illustrates abscisic

acid's involvement in seed developmental processes (Luerssen et al., 1998; Stone et al.,

2001; Lara et al., 2003).

Maternal Plant Role in Seed Development

Before fertilization, the maternal genome controls all aspects of the egg and

central cell gene expression, but once fertilization occurs a zygotic mode of gene

expression is induced and the paternally derived genes are thought to begin to be









expressed (as reviewed in Chadhury and Berger, 2001). Yet, one study hypothesizes that

paternal genes are still silenced during the very early stages of seed development;

therefore, the maternal plant has primary control over early seed development. This was

observed when 20 paternally inherited loci were not expressed during early seed

development in Arabidopsis (Vielle-Calzada et al., 2000).

The maternal plant can have an effect on various other seed developmental

processes such as growth potential, the switch from mitotic growth to cell expansion,

storage product accumulation, resource allocation, and seed structure (Weber et al.,

2005). This area of research is not completely understood and may provide more detailed

information about the genetic control of seed development (Chadhury and Berger, 2001).

Microarray analysis was used to examine genes differentially expressed in maternal

tissue in order to gain more understanding of possible roles of the maternal tissue

(Sreenivasulu et al., 2002). It was observed that most of the genes found to be more

highly expressed in the maternal tissue encoded enzymes involved in carbohydrate and

lipid metabolism, which is expected for the maternal tissue's role in providing a nutrient

supply for the developing seed (Sreenivasulu et al., 2002). Several other genes were

found to be highly expressed in the maternal tissue, of which the functions are unknown.

These genes include a transcription factor related to FILAMENTOUS FLOWER and a

methionine synthase that may play a role in transport of nutrients to the embryo

(Sreenivasulu, 2002). Another study in petunia showed that normal endosperm

development required expression of two MADS box genes, FBP7 and FBP1 1, in the

maternal tissue; therefore, the maternal plant controlled formation of the seed structure

(Colombo et al., 1997). Additionally, it was shown that the maternal plant is significant









in the structure of the seed in barley, where a group of endosperm mutants that caused a

phenotype of shrunken seeds also exhibited this phenotype irrespective of the paternal

genotype (Felker et al., 1985).

ABA influence on seed development originates from both the zygotic tissue and

the maternal tissue. It has been shown that the ABA synthesized in the maternal tissue is

involved in the switch to the maturation phase of seed development, whereas the zygotic

tissue produces the ABA that is involved in the late seed development programs such as

acquiring desiccation tolerance (Finkelstein et al., 2002; Frey et al., 2004). Additionally,

through mutant studies defective in ABA synthesis in Nicotianaplumbagnifolia, it was

shown that maternal ABA has critical roles in promoting early seed development,

initiating seed coat pigmentation, and capsule dehiscense (Frey et al., 2004). These

findings show that maternal tissue have tight developmental controls over the seed.

Further investigations in genes expressed preferentially in maternal fruit tissue can

provide potentially important information about seed development by revealing

interactions between genes originating in maternal tissues and expression of genes

controlling development in the zygotic seed tissues.

Ethylene in Fruit and Seed Development and Subsequent Germination

One of ethylene's main effects in fruit development is promotion of fruit

maturation and abscission. It has been shown in climacteric fruit, tomato being one

example, that ethylene is produced during fruit ripening which, in turn, causes a

degradation of chlorophyll, leading to the change in color of fruit through maturation. At

this point maturation related proteins increase and begin the conversion process of

starches, organic acids and lipids into sugars (as reviewed in Giovannoni, 2001). Studies

with mutants altered in ethylene sensitivity such as Never-ripe and transgenic









CAMV35S-etrJl- have a distinct delay in ripening and senescence which demonstrates

that ethylene has a critical role in fruit maturation. These characteristics were also seen

in a petunia line strongly reduced in ethylene sensitivity, "44568" (Wilkinson et al.,

1997).

Another important role of ethylene throughout fruit development and seed

germination is in the process of programmed cell death. Programmed cell death occurs in

many different processes during normal progression of cellular maturation. In seeds,

programmed cell death occurs in the endosperm in order to allow for the recycling of

proteins during seed maturation (Young and Gallie, 2000). Ethylene acts by inducing

genes that have a role in breaking down the endosperm tissue surrounding the embryo in

the seeds. By using chemical blocking agents that prevented the synthesis of ethylene,

programmed cell death in the endosperm was delayed (Kepczynski and Kepczynska,

1997).

Ethylene's role in seed germination is still not completely known and remains a

subject of controversy. Early studies suggested that ethylene is involved in breaking

primary dormancy (Ketring and Morgan, 1971; van Staden et al., 1973), while others

indicated that a rise in ethylene production is merely a consequence of breaking

dormancy (Satoh et al., 1984; Kebczynski and Karssen, 1985). More recently it has been

suggested that ethylene reduces ABA sensitivity, and therefore reduces ABA-induced

seed dormancy and increases germination in Arabidopsis (Ghassemain et al., 2000).

Many questions cannot be answered because the interactions between ethylene and other

important hormones, such as abscisic acid, are not completely understood.









Additional studies have led to hypotheses on how ethylene may regulate

germination. One suggested mechanism developed from studies in cocklebur is that

ethylene induces expression of P-cyanoalanine synthase (CAS), an enzyme likely to be

involved in cyanide metabolism in the action of seed germination (Hasegawa et al.,

1995). These studies indicate that ethylene stimulates the action of the mitochondrial

CAS, which down regulates the cyanide level and at the same time causes an increase in

the amino acid pool during the pre-germination period (Hasegawa et al., 1995). This

supports the idea that ethylene plays a role in a more conducive environment for

germination by lowering toxic cyanide levels and allowing for essential amino acids

needed in the germination process (Hasegawa et al., 1995; Maruyama et al., 1997).

Another hypothesis is that ethylene promotes germination by stimulation of

hydrolytic enzymes that break down the endosperm to provide an available nutrient

supply for radicle emergence and subsequent germination. Ethylene was also shown to

increase 0-1,3-glucanase induction in pea and tobacco (Petruzelli et al., 1995; Leubner-

Metzger et al., 1998). The promoter region of this gene was mapped and was found to

contain ethylene-response elements, which lead to the idea that the ethylene response

element binding proteins are transcription factors necessary for ethylene dependent P-1,3-

glucanase induction. The gene was also found to be positively regulated by ethylene and

negatively regulated by ABA (Leubner-Metzger et al., 1998). This shows yet another

incidence of interacting roles of these two hormones during seed germination.

Bleecker et al. (1988) observed in Arabidopsis etrl-1 mutants that seed

germination was significantly lower than wild-type seeds and that application of GA3

overcame some of the germination deficiencies. Clevenger et al. (2004) conducted









experiments on the transgenic line 44568, an ethylene-insensitive petunia line expressing

CAMV35S-etr1-1. Seed production and germination rates were observed. Seed quality

was quantified by seed weight. Homozygous 44568 seeds and seeds produced on 44568

maternal plants were slightly lower in seed weight than seeds produced on wild-type

plants. Another phenotype observed in both homozygous 44568 and hemizygous seeds

produced on a 44568 maternal plant was delayed fruit development. These experiments

illustrate the point that the some of the phenotypes of the etrl-1 transgene are dependent

upon the maternal plant (Clevenger et al., 2004).

Seed germination was also observed by Clevenger et al. (2004). Seed germination

from seeds produced in two different greenhouse temperatures was measured in

homozygous Mitchell Diploid, etrl-1 and hemizygous seeds produced from reciprocal

crosses. In the warmer temperature greenhouse, 290C, germination rates from a Mitchell

or maternal Mitchell plant were about 95 percent, whereas seeds made on the 44568

maternal parent had a range of germination between 75 and 85 percent. The cool

temperature greenhouse, 24C, produced seeds with lower germination rates. Mitchell

Diploid and maternal Mitchell Diploid seeds had germination rates between 85 and 91

percent, while seeds produced on the maternal 44568 line had between 55 and 65 percent

germination. A delay in the germination of seeds produced on 44568 was also seen in

this experiment. MD seeds reached their maximum germination levels within the first

five days of the study, whereas the seeds produced on the 44568 parent did not reach the

maximum germination levels until ten to thirteen days after the seeds were placed in

germination media. These experiments show an interesting trend, that the reduction in

ethylene sensitivity is affecting something during the fruit or seed developmental









processes on the maternal plant, which subsequently influences seed germination

characteristics (Clevenger et al., 2004).

Ethylene, ABA, and Sugar in Seed Development and Germination

ABA has been known to have a direct role in seed development and germination.

One major role of ABA in seed development is the promotion of storage protein

accumulation (Brocard et al., 2003). ABA is also known to have a major role at the end

of seed development by preventing vivipary, or precocious germination (Finkelstein et al,

2002). The transcription factors VP1, or the Arabidopsis homolog, ABI3, have been

shown to have a regulatory role in early ovary development, late seed development, and

the initiation of seed dormancy (Finkelstein and Somerville, 1990; McCarty et al., 1991

Giraudat et al., 1992; Nambara et al., 1992). This was shown through mutant analysis

where the mutant plants of these B3 domain family members resulted in defects in late

embryo development and germination and a reduction in storage protein levels (Hoecker

et al., 1995; Suzuki et al., 2001). Also, null alleles of ABI3 and VP1 resulted in loss of

ABA sensitivity, which caused vivipary in both species, Arabidopsis and maize (McCarty

et al., 1989; Nambara et al., 1992). It was also shown that the repression function of VP1

does not require the B3 binding domain; therefore, it is possible that repression is also

mediated by protein-protein interactions with other transcription factors (Hoecker et al.,

1999). Thus the product of VP1 and ABI3 are likely key regulators in the seed

maturation, developmental, and germination programs (McCarty, 1995). The

mechanisms by which these genes exactly regulate seed development are still being

studied (Ikeda et al., 2004; Lopez-Molina et al., 2002).

Published data show that ethylene has a large role in programmed cell death during

seed development. ABA has been shown to regulate this process as well. Plants treated









to block ABA synthesis accelerated programmed cell death and increased ethylene

production; this example indicates a possible antagonistic relationship between ethylene

and ABA (Young and Gallie, 2000). Recent evidence has also shown that it is likely that

ethylene is a negative regulator of ABA during ABA induced seed dormancy. Ethylene

has been suggested to act by reducing the sensitivity of seeds to endogenous ABA levels

(Ghassemain et al., 2000). The other hypothesis is that ethylene directly decreases ABA

biosynthesis (Ghassemain et al., 2000). Another contributing factor to these interactions

could be sugar responsive signals. Hexose signals have been implicated in regulating

ABA biosynthesis and sensitivity. One specific study showed that glucose can induce

expression of the ABI5 gene, a transcription factor that is differentially expressed during

seed development (Cheng et al., 2002). ABI5 interacts with ABI3 to regulate ABA

responsive element mediated transcription (Hobo et al., 1999). Ethylene may be

countering this ABA effect by inhibiting these sugar signals (Koch, 2004).

Relationships between sugars, ABA, and ethylene have been seen in many studies.

The ethylene overproduction (etol) and constitutive signaling (ctrl) ethylene mutants

were found to be glucose insensitive due to the ability of seedlings to grow on levels of

glucose that would normally inhibit development (Zhou et al., 1998). On the other hand,

etrl, ein2, ein3 and ein6 plants, which all are affected in either ethylene perception or

signaling, show glucose hypersensitivity and exhibited developmental arrest on lower

than normal levels of glucose (Zhou et al., 1998). This relationship between ethylene and

glucose may indicate that glucose signaling can inhibit ethylene action during seed

germination (Zhou et al., 1998). Mutant analysis has provided information that shows

that ethylene acts antagonistically to the glucose response, whereas ABA is a promoter.









Double mutant analysis with ginletrl and ginlein2 exhibited a resistance to

developmental arrest of seedlings grown on higher levels of glucose, similar to the

phenotype seen with double mutants of ginlaba2. Because ABA and ethylene exhibit

opposite roles when influencing glucose responses it is likely that ethylene affects

glucose signaling through ABA to promote seed development and germination, but the

molecular mechanisms of these interactions still remain unclear (Cheng et al., 2002).

Conversely, another study has shown that glucose delays the seed germination

process, yet this delay is not affected by ethylene sensitivity. Several transcription

factors (ABI2, ABI4, and ABI5) were studied that have been deemed as ABA-responsive

due to the fact one of their loss-of-function mutant phenotypes decreased ABA sensitivity

in the seed. Hexokinase function, ABI2, ABI4, and ABI5 did not have a role in the

glucose delay of germination; therefore, it was determined that there are other signaling

cascades that involve glucose signals that could cause the delay in germination (Dekkers

et al., 2004).

Condensed Tannins

Proanthocyanidins, condensed tannins, are colorless flavonoids that result from the

condensation of flavan-3-ol units (Xie et al., 2003). These pigments are colorless and are

found in the seed coat of Arabidopsis seeds but turn brown through a proposed oxidation

process, though the genes controlling the oxidation have not been determined (Debeaujon

et al., 2001). Additionally, Arabidopsis wild-type seeds also darken with time of storage.

This occurs because the proanthocyanidins fill the large vacuole of the endothelium cells

which cause the outward darker appearance of the seeds (Debeaujon et al., 2001).

Though the exact function of the tannins has not been determined, it is thought that

the tannins in the seed coat aid in protection against pathogens (Winkel-Shirley, 1998).









It is also thought that the proanthocyanidins strengthen seed coat imposed dormancy and

extend seed longevity by providing a stronger physical barrier structure and decreasing

the permeability of the seed coat to water. (Debeaujon et al., 2000).

The proanthocyanidin synthesis pathway diverges off of the anthocyanin

biosynthesis pathway; therefore, many genes are common to both pathways including

chalcone synthase, chalcone isomerase, flavonoid 3'hydroxylase (F3'H) and

dihydroflavonol reductase (DFR) (Figure 2-1). Several classes of Arabidopsis mutants

termed the transparent test (tt]-tt]9), transparent test glabra (ttgl and ttg2) and

banyuls (ban) mutants are deficient in different areas of the anthocyanin and

proanthocyanidin sythesis pathway (Abrahams et al., 2002). These mutants are altered in

seed coat color and degree of seed dormancy (Debeaujon et al., 2003). BAN is one gene

cloned in this pathway of particular importance because it is exclusive to the

proanthocyanidin pathway. BAN encodes a dihydroflavonol reductase-like protein and it

has been shown to function as an anthocyanidin reductase. BAN converts anthocyanidins

to 2,3-cis-flavan-3-ols which condense into the colorless proanthocyanidins (Xie et al.,

2003).

In addition to the synthesis of condensed tannins, the regulation of the

proanthocyanidin pathway has also become a focus of research. Several proteins in

Arabidopsis have also been identified as regulators of proanthocyanidin biosynthesis.

These include TT2, which is a MYB transcription factor, TT8, a MYC/bHLH

transcripton factor, and TTG1, a WD40-repeat family protein. All positively influence

BAN, and mutants in any of these genes results in a colorless seed coat devoid of

proanthocyanidins, and the seeds exhibited reduced dormancy and were able to germinate










at higher percentages than wild-type seeds (Debeaujon et al., 2000). Other regulators

include TT1 and TT16, which regulate the proanthocyanidin biosynthesis in the seed

body but not the chalaza/micropyle region. TT1 is a zinc finger protein, whereas TT16 is

CHS CHI
4-
3 X malonyl-CoA F3H ff
F3'H VI7

FLSI
Flavonols -- Dihydrolavonols
DFR ( t3

LAR 7
2,3-tans-"avarn-3-ols -........... Leuomanthocyanldlns
-. L f2,li
"L,,. .(? LD OtX

ANR
2.3-cis-flavarn-3-3s g Anlocyanidlrns

(V2,, fl g)rfl2 (ff2.t6t, Gf,( \)
MATE ImPnrpcL er ArtOcyanins
vacuolar ?
CE

(cotlslmas)



Proanthcyandlln dervatves
(brown) (Debeaujon et al., 2003)

Figure 2-1 Proanthocyanin Synthesis Pathway

the ARABIDOPSIS BSISTER MADS transcription factor, which is homologous to the

FBP24 MADS protein in Petunia x hybrida (Nesi et al, 2002). tt16 mutants had a

distorted shape of endothelial cells and prevented activation of the BAN promoter in the

endothelium layer. Therefore, it was suggested that TT16/ABS is involved in

endothelium development. A vanillin stain was used in order to study proanthocyanidin

accumulation in developing seeds of tt16 mutants so that the colorless compounds could

be seen by a dark red staining. Vanillin turns red upon binding to flavan-3,4-diols









(leucoanthocyandins) and flavan-4-ols (catechins). Staining was not seen in the

endothelial cells but was seen in the chalazal bulb and the micropyle (Nesi et al, 2002).

Most mutants in the tt, ttg and ban classes all exhibited some degree of seed color

and dormancy changes, but all of the mutants did not exhibit the same exact phenotype.

The seed coat color varied from pale brown of ttlO and ttl4, which had progressive

browning during storage. Others mutants exhibited a pale yellow color like tt4, which is

absent of flavonoids. (Debeaujon et al., 2000). ban mutants were unique in that they

exhibited a grayish-green color. Another characteristic of most of these mutants was that

many of the mutant seeds exhibited a reduction in seed weight and seed size, though the

reason for this phenotype is not understood (Debeaujon et al., 2000). It has also been

shown that the phenotypes of tt, ttg and ban mutants are all exclusive to the seed coat

tissue; therefore, all phenotypes are determined by the maternal parent. Reciprocal

crosses resulted in a F1 generation with phenotypes of the maternal parent (Debeaujon et

al., 2000). Most mutants exhibited increased germination over a shorter amount of

storage time and are considered to have reduced dormancy (Debeaujon et al., 2000).

These mutants include ttgl, which germinates at nearly 100 percent after two days in

storage. The reduced dormancy is not evident in all testa mutants, though tt8, tt9, ttl2

and to a lesser extent, ban, all did not germinate as well as wild-type after 27 days of

storage (Debeaujon et al., 2000). Germination was also tested in reciprocal crosses and

all Fi progeny acted in a similar manner as their maternal parent (Debeaujon et al., 2000).

Though there is not a direct correlation between seed color and the severity of seed coat

imposed dormancy, it appears that there is some linkage seen in these mutants affected in

proanthocyanidin synthesis. The most important determining factor over the color









phenotype is the actual levels of proanthocyanidins present in the seed coat. It is believed

that these colorless tannins are the barrier preventing germination (Debeaujon et al.,

2000).

Conclusion

It is known that ethylene is involved in maturation processes of plant

development. Ethylene has been widely studied in processes involved in fruit maturation

(as reviewed in Giovannoni, 2001). Ethylene's impact on the development of the seed

within the fruit has not been studied as extensively as fruit development. Additionally, it

is not known whether ethylene's impact on seed development influences seed

germination characteristics. The relationship between ethylene and other hormones, such

as ABA, in specific seed developmental processes is even more difficult to determine due

to the lack of research conducted in this area. Ethylene is thought to promote seed

germination by acting as a negative regulator of ABA action, which is known to establish

seed dormancy (Ghassemian et al., 2000). The proposed research will provide a more in-

depth analysis of ethylene's action in seed development of Petunia x hybrida and the

subsequent impact on seed germination. The maternal plant is thought to have a crucial

role in early seed development; therefore, a focus on ethylene sensitivity of the maternal

parent will be highlighted (Vielle-Calzada et al., 2000). The effect of reducing ethylene

sensitivity and its result on sensitivity to ABA will also be determined to observe whether

there is a relationship between these two hormones in petunia seeds.














CHAPTER 3
EFFECT OF REDUCED SENSITIVITY TO ETHYLENE ON SEED DEVELOPMENT,
DORMANCY AND GERMINATION


Introduction

Over the last 75 years seed research on several aspects of seed physiology has

contributed to considerable increases in crop yield, and the understanding of seed biology

continues to improve as the science of molecular biology advances. However, the seed is

a complex structure and therefore, much needs to be learned about genetic interactions in

order to completely understand seed development. The complex interactions that occur

during seed development and dormancy have strict genetic and hormonal control

(Holdworth et al., 2001). One of the hormones that significantly impacts seed

development is ethylene which is also involved in many plant developmental processes

including floral senescence, abscission, fruit ripening, and seed germination (as reviewed

in Bleecker et al., 2000).

The three main components of the angiosperm seed are the embryo, endosperm and

the testa. The testa is the only part of the seed structure that is completely developed

from the maternal parent; therefore, reciprocal crosses can be used as experimental tools

to help determine if certain factors of seed development are more influenced by the

maternally derived testa. The seed goes through three main chronological phases during

development: 1. Cell division and differentiation 2. Cell enlargement through

accumulation of assimilates and storage reserves and 3. Acquisition of desiccation

tolerance and preparation for dormancy (Chaudhury and Berger, 2001).









The first phase of seed development begins immediately after fertilization and is

commonly a time of rapid cell division and differentiation. Rapid cell division typically

will persist through the first half of seed development (Colombo et al., 1997). Genes

involved in cell division and differentiation such as beta tubulin, and regulatory genes

such as LEC1 (Lotan et al., 1998) are associated with these cell cycle processes and are

highly expressed during this period of development.

Once the majority of cell division is complete, the next developmental stage begins

with an increase in cell expansion. In this stage seed storage proteins accumulate in the

vacuole or as membrane bound protein bodies within the cell (Hoekstra et al., 2001).

Lipids and starches are also produced during this phase of development (Norton et al.,

1975; Wobus et al., 1999; Hoekstra et al., 2001). This assimilation and cell expansion

stage is usually marked by higher expression of known seed storage genes, such as

globulins and albumins, and regulatory genes, such as FUS3, that control the synthesis of

these storage proteins (Kermode, 1995; Wobus and Weber, 1999). The accumulation of

stored reserves continues into the last stage of development but slows down increasingly

until the end of seed development. This stage is also marked with high respiration rates

due to the high levels of metabolic activity occurring with the assimilation process

(Zaitseva et al., 2002).

The transport of assimilates in the embryonic tissue from the maternal parent plant

can be used as a gauge to help determine the developmental progress of the seeds.

Sucrose is generated from the maternal parent and unloaded into the maternal seed coat

tissue from the fruit tissues where it is cleaved by cell wall invertases (Weber et al.,

1995). The hexoses are released into the zygotic embryonic tissue by a passive, facilitated









membrane-transport process (Buchanan et al., 2000; Borisiuk et al., 2002). The hexoses

are readily taken up and used by the endosperm, cotyledons, and developing embryo

during the highly energy taxing cell division phase (Weber et al., 1995). Sucrose import

into the developing seed begins early in development and continues throughout the latter

stages of maturation, where sucrose is cleaved less frequently than the earlier stages of

development. Sucrose is transported directly into the embryonic tissue for seed storage

purposes (Heim et al., 1993; Borisiuk et al., 2002).

Desiccation and the acquisition of desiccation tolerance are the primary actions of

the last stage of seed development (Finkelstein et al., 2002). The fruit and seeds slowly

cease metabolic activity and begin to desiccate in preparation for dormancy or subsequent

germination. Dehydrins are a class of genes that are highly expressed during this phase

and are hypothesized to function in stabilizing membranes and protecting the cells for

dehydration (Black et al., 1999). Abscisic acid has also been shown to have a role in this

phase of development by inducing expression of genes, such as LEAs (late embryonic

abundant), which are thought to be involved in maturation and desiccation tolerance

(Bartels et al., 1988).

Ethylene is known to have a role in many plant processes, either directly or through

interactions with other hormonal and genetic factors. Ethylene is known to have some

role in the breaking of seed dormancy of certain species (Ketring and Morgan, 1969;

Globerson, 1977; Kepczynski et al., 2003), but it has not been extensively shown to have

a role in the actual development of the seed (Kepczynski and Kepczynska, 1997). For

example ACC content, ACC-synthase activity, ACC-oxidase in vitro activity and

ethylene production were measured in chick-pea seeds. It was shown that all of these









actions reached a maximum during the expansion phase of seed development and then

slowly decreased until maturation was complete (Gallardo et al., 1999). The relationship

between ethylene synthesis and development of the chick-pea seed suggests that there is a

correlation between developmental progress and ethylene synthesis and action (Matilla,

2001).

Seed dormancy is an important factor established during seed development due to

its influence on subsequent germination. Seed dormancy is generally characterized as a

state in which a viable seed will not germinate when placed in suitable temperature,

moisture, and oxygen conditions which are normally considered to be adequate for

germination (Roberts, 1972). There are two types of dormancy established within seeds,

primary and secondary (Bewley, 1997). Primary dormancy occurs during development

on the maternal plant and prevents the seed from germinating until conditions are

favorable (Bewley, 1997). During primary dormancy germination is repressed until an

after-ripening period is satisfied through cold storage (Leon-Kloosterziel et al., 1996).

Secondary dormancy is initiated after the seed is released from the maternal plant and

requires an environmental stimuli, such as light or temperature, to commence the

germination processes (Foley, 2001) Seed dormancy can be induced by the embryo,

endosperm, testa or a combination of these factors (Bewley, 1997). Dormancy and the

subsequent germination processes are under hormonal control, and it is likely a complex

interaction of several hormones. Extensive research has been conducted on abscisic

acid's role in maintaining seed dormancy (Zeevaart and Creelman, 1988). ABA is

synthesized by the zygotic tissues in the mid to latter stages of seed development and is

known to be involved in the switch from cell division and differentiation mechanisms to









seed maturation mechanisms. ABA is known to induce a cyclin-dependent kinase

inhibitor that leads to cell cycle arrest which ends the rapid growth phase and begins the

maturation phase (Wang et al., 1998) Mutant analysis has also confirmed a role for

ABA in maintaining seed dormancy. Mutant plants of ABI3, a B3 domain transcription

factor involved in ABA signaling of Arabidopsis thaliana, produced seeds with

extensively reduced seed dormancy (Koornneef et al., 1984; Nambara et al., 1992; Ooms

et al., 1993). ABI3 is also orthologous to the maize Viviparous 1 protein, which when

mutated also produced plants with precocious germination (McCarty et al., 1991).

Over the past several years, the interactions between ethylene and ABA have been

investigated more intensely. As a result, it is thought that there is an antagonistic

relationship between the two hormones and that ethylene inhibits ABA signaling and aids

in releasing seed dormancy (Beaudoin et al., 2000). Seed dormancy was investigated in

Arabidopsis ethylene-insensitive ein2-45 seeds, which was discovered in a screen of

mutated Arabidopsis seeds that suppressed the ABA resistant seed germination

phenotype ofabil-1 (Beaudoin et al., 2000). EIN2, a membrane protein important to the

ethylene signaling cascade, results in ethylene-insensitivity when it is mutated (Guzman

and Ecker, 1990). ein2-45 seeds showed an increased sensitivity to ABA when

germinated on various concentrations of ABA and had a significant reduction in seed

germination of freshly harvested seeds. The ein2-45 seeds exhibited arrested germination

under lower concentrations of ABA when compared to wild-type germination. It was

also determined that these seed exhibited enhanced seed dormancy and were not able to

germinate as well as wild-type without any post-harvest treatment (Beaudoin et al.,

2000). The dormancy of ein2-45 seeds was broken after a cold stratification of 5 days









and resulted in restoration of germination to levels comparable to wild-type seeds.

Similar phenotypes of a more severe seed dormancy induction and enhanced sensitivity

to ABA were also observed with etrl-1 Arabidopsis seeds (Bleecker et al., 1988;

Beaudoin et al., 2000). This evidence demonstrated that there are direct interactions

between ABA and ethylene in the regulation of seed dormancy and germination, and that

EIN2 may act as a negative regulator of ABA sensitivity (Beaudoin et al., 2000).

Seed germination occurs when a fully developed non-dormant seed is able to

imbibe water, commence metabolic processes, and begin growth as a seedling

(Debeaujon and Koorneef, 2000). Several parameters are known to affect the breaking of

seed dormancy including gibberellic acid, chilling, and light. All of these dormancy

breaking mechanisms are known to act through induction of seed germination associated

gene expression (Koornneef and Karssen, 1994). It is likely that ethylene plays a major

role in the control of gene expression associated with seed germination, but there is

mixed results presented in past research as to whether ethylene is directly involved in the

control of seed germination or indirectly through its influence on other factors. Many

species appear to have increased germination with exogenous application of ethylene. For

instance, studies on Trifolium subterraneum (Esashi and Leopold, 1969), Arachis

hypogea (Ketring and Morgan, 1971) and Avenafatua (Adkins and Ross, 1981) all

concluded that ethylene production during seed imbibition paralleled the breaking of seed

dormancy. More recent research indicates that ethylene is likely to induce germination

either by inducing ABA catabolism or reducing the seed tissue sensitivity to ABA

(Ghassemian et al., 2000; Beaudoin et al., 2000) Another thought is that ethylene is

produced as a result of programmed cell death in the endosperm tissue during









germination (Matilla, 2001). In rice, ethylene action during germination is even more

complex and seems to even be inhibitory. Since ethephon treatment of rice seeds

enhanced seed dormancy, it is likely that the complex mechanisms underlying seed

germination are greatly different between monocots and dicots (Southwick et al., 1986).

Research Objectives

The objective of this study was to characterize several physiological differences

between MD and transgenic 44568 CaMV35S::etrl-1 petunia seeds with greatly reduced

ethylene sensitivity. Seed development was examined in order to determine whether it

was delayed in the 44568 seeds knowing that fruit maturation was visually delayed

(Wilkinson et al., 1997; Clevenger et al., 2004). The physiological traits and

development of seeds resulting from reciprocal and self pollinations between 44568 and

MD were observed to determine if any of the seed characteristics were significantly

influenced by ethylene sensitivity in the maternal parent. Physiological characterization

was conducted through analysis of seed weight, and seed size measured throughout

development, and seed number per fruit. Seeds produced from 44568, MD and the

reciprocal crosses were analyzed for total sucrose content, and CO2 evolution was

measured from excised seeds through development as a means to characterize respiration.

Molecular characterization of seed development was conducted by mRNA expression

analysis of the known developmental seed markers including beta tubulin, seed storage

proteins, and maturation associated genes.

Another aim of this research was to investigate dormancy and germination of

seeds produced from self pollinations of 44568, MD and reciprocal crosses by measuring

germination rates of seeds held in cold stratification conditions over long periods of time.

Previous research indicated that germination of seeds produced on female 44568 plants









was reduced at one-month after harvest compared to MD (Clevenger et al., 2004). The

degree of dormancy induction was investigated in MD, 44568 and the reciprocal crosses

to determine whether the reduced germination would be overcome by a post-harvest

chilling treatment. An ABA germination sensitivity assay was also used to determine if

44568 petunia seeds produced results like the ein2-45 ABA sensitivity seen in

Arabidopsis seeds (Beaudoin et al., 2000). Investigation of reciprocal crosses helped to

determine if ABA sensitivity is influenced exclusively by maternal tissues. Observations

on germination of freshly harvested seeds and seeds held in cold storage through one

year, and experiments on ABA sensitivity during germination helped determine the level

of dormancy induced in all genotypes and whether ABA sensitivity was a factor in the

induction and maintenance of dormancy. These results presented here shed more light on

ethylene's involvement in seed development and germination.

Materials and Methods

Culture and Growth of Petunia x hybrida Plants

Petunia x hybrida "Mitchell Diploid" (MD) and homozygous etrl-1-44568

(Wilkinson et al., 1997) plants were grown for seeds used in seed development studies.

Seeds were germinated in trays with Fafard #2 soilless potting mix (Conrad Fafard, Inc.,

Agawam, MA) and placed in a misting house with an intermittent mist of 5 seconds every

2 hours. Approximately twenty-four hours later, a thin layer of vermiculite was applied

to the seed trays. After three days in the mist house, the seed trays were placed in the

greenhouse. All plants were grown in a year-round temperature controlled glass

greenhouses with 240C/200C (+/- 20C) day/night temperatures. Plants were sprayed with

a plant growth regulator, daminozide (Uniroyal Chemical Company, Middlebury,

Conneticut) at a rate of 2500 ppm at two weeks after sowing to control excessive growth.









Seedlings were transplanted after eight weeks into 1.5L plastic pots and drenched with

four ppm of paclobutrazol (Uniroyal Chemical Company, Middlebury, Conneticut). All

plants were fertilized 6 days a week (1 day a week water only) with 150 ppm of 20-4.8-

16 Cal-Mg Peter's soluble fertilizer (Scotts-Sierra Horticultural Products Co., Marysville

OH).

Seed Weight, Seed Size, and Seed Number of Petunia x hybrida Developing Seeds

For determination of seed weight, seed size and seed number MD and 44568 plants

were self-pollinated and reciprocally cross pollinated on the same plants. Genotypes are

designated as MD, 44568, ExM (44568 x MD) and MxE (MD x 44568) ( x 0). Self-

pollinations were conducted with flowers just before anthesis. Flowers used for

reciprocal crosses were emasculated just before anthesis and pollinated the following day.

No more than five fruit were allowed to develop on one plant at the same time. Fruit for

seed size and seed weight experiments were collected at each time-point in development

in 50 mL Falcon tubes (Fisher Scientific) and kept on ice. Seeds were extracted from the

three fruit with a scalpel and forceps and combined into lots to reduce variability. Seeds

from all genotypes were collected at 15, 20, 25, and 30 days after pollination (DAP).

Immediately seeds were weighed in 25 seed lots so that loss of any water within the seeds

would not contribute to any seed weight differences. Subsequently all 25 seeds were

analyzed for seed size on a dissecting scope and slide with ruler gradations. Seed size

was measured by height of the longest side of the seed and width of the opposing side.

Thirty-five lots of 25 seeds were used to compute seed weight and seed number averages

for all genotypes. Seed number was counted by hand and was obtained by averaging the

number of seeds in 35 different fruit per cross collected from different plants. Averages









and standard errors were computed using the mean function of data analysis statistics of

Excel, Microsoft Office 2003.

Sucrose Analysis of Developing Seeds

Total sucrose levels of developing seeds were determined using the sucrose

enzymatic assay kit (Boehringer Mannheim, Darmstadt, Germany). Seeds were collected

at 15, 20, 25 and 30 days after pollination from MD, 44568, and reciprocal crosses. The

company recommended protocol for tobacco leaves was used for the developing seeds

and was reduced as per manufacturer's recommendations to accommodate the small

amount of seed tissue. Four replicates, from seeds collected at the same time, of 30 mg

of lyophilized seeds per developmental time-point were used to obtain total sucrose

means. The level of total sucrose was determined using a light spectrometer (SmartSpec

3000 BioRad, Hercules, CA). Results of the sucrose quantification are presented in two

manners: based on sucrose content of total weight of seed lot tested (ng/g of dry weight)

and then sucrose content of mature seeds adjusted to a per seed basis since ETR and ExM

seeds are lighter in weight at full maturity. Averages and standard errors were computed

using the mean function of data analysis statistics of Excel, Microsoft Office 2003.

CO2 Analysis of Developing Seeds

CO2 accumulation was measured by weighing out 0.2 grams of fresh MD, 44568,

MxE, and ExM seeds from 3 different fruit from different plants. The seeds were

collected at 15, 20, 25, and 30 DAP. 5 groupings of seeds were collected per time-point

in each genotype for measurement after different amounts of accumulation time. The

seeds were placed in a 12mmx32mm clear 1.5ml vial with an air-tight cap with septa

(National Scientific Company, Duluth, GA). One sample of 0.5mL was removed per vial

at the appropriate collection time, which included 15 minutes, 30 minutes, 1 hour, 2 hours









and 3 hours and measured on a GOW-MAC gas chromatograph Series 580 (GOW-MAC

Instrument Company, Bridgewater, NJ). The average respiration rate (measured as CO2

evolution) of 4 separate groupings of 0.2 grams of seeds were measured for each time-

point at each developmental stage. Averages and standard errors were computed using

the mean function of data analysis statistics of Excel, Microsoft Office 2003.

Seed Development Marker Analysis

Whole fruit tissue of MD and 44568 was collected at 5, 10, 15, 20, 25 and 30 days

after pollination and immediately placed in liquid nitrogen and subsequently a -80

Celsius freezer until used for RNA extraction. RNA was extracted using the phenol-

chloroform method and lithium chloride precipitations (Ciardi et al., 2000). RNA was

quantified by spectrophotometer readings (SmartSpec 3000 BioRad, Hercules, CA) and

quality was checked by gel electrophoresis. RNA was then diluted with RNAse free

water and frozen until RT-PCR analysis of the developmental markers. A set of primers

was obtained for several seed development marker from Invitrogen Corporation

(Carlsbad, California). GenBank Accession is designated as a "CV" number. Number of

cycles of RT-PCR replication is in parenthesis: Beta tubulin YF-9-C01 CV300189 (29)

primers: Forward-CCACATTTGTTGGCAATTCA; Reverse-

CAGCTCCCTCCTCGTCATAC. LEA-D29 RF-1-H08 CV300578 (22) Primers:

Forward- AAGGACTTGGCTTTAAATCCAC, Reverse-

TCTGCTGCATATTGCCCAC; Seed maturation RF-5-C02 CV300863 primers (LEA4)

(22): Forward- GAGAAGGGGAGAAGATGACAAC, Reverse-

ATAGTGTGTCCCAACCTGCC; 2S Albumin RF-5-G08 CV300914 (25) primers:

Forward: GGTGACAGACGATGAAGAAAG, Reverse-

ATACGGGGAAGGTAACGAG; 11S Globulin RF-5-G10 CV300916 (25) primers:









Forward: TCGCCAAAAACTTCCCATC, Reverse-CCACACCACAAATTCAAATCC;

Ubiquitin (22) Primers: Forward- AACATACAGAAGGAGTCAACAC, Reverse-

AGAAGTCACCACCACGAAG. RT-PCR analysis was conducted using the One-Step

RT-PCR Analysis kit from Qiagen (Qiagen Inc- USA, Valencia, California).

Manufacturer protocol was followed. PCR was run with the following program: 50C

for 30 minutes, 940C for 15 minutes; multiple cycles of 940C for 30 seconds, 550C for 30

seconds, and 720C for 1 minute; final incubation at 720C for ten minutes. The entire RT-

PCR reaction was run out on a 1.5% acrylamide gel by electrophoresis. Pictures were

taken on a Polaroid Fotodyne camera. (Polaroid Corporation, Pasadena, California). RT-

PCR bands were analyzed visually.

Germination Assay

Seeds were tested for the ability (or inability) to germinate after various periods of

4 C cold storage, with dry desiccant to keep moisture to a minimal level. The same sets

of seed of each genotype (MD, 44568 and reciprocal crosses) were tested for radicle

emergence and cotyledon expansion on freshly harvested seeds and after one month, six

months and 1 year of cold storage. Twenty-five seeds were placed on 100x15mm Petri

plates (Fisher Corp) containing basal salt media (Jorgensen et al., 1996), which was

modified slightly by removing sucrose, which can inhibit germination, and using half the

concentration of MS basal salts. Eight replicate plates of each genotype, Mitchell

Diploid, etri-1, MD x etri-1 and etri-1 x MD were examined for each time-point after

seed collection. The germination plates were grown in a temperature controlled Percival

at 250 Celsius for 22 days in constant light. Radicle emergence and cotyledon expansion

were recorded separately every 2 days for the entire duration of the 22 day experiment.









Averages and standard errors were computed using the mean function of data analysis

statistics of Excel, Microsoft Office 2003.

ABA Germination Sensitivity Assay

Seeds of MD, etrl-1, etrl-1 x MD and MD x etrl-1 were tested for the ability (or

inability) to germinate on different concentrations of ABA in the germination media

mixture. Seeds examined were 1 month old and had been stored in 4 C cold storage as

described above which is the average time in storage needed to overcome typical after-

ripening restrictions in petunia seeds. Germination media was the same as above, though

the media was enhanced with ABA dissolved in 100% ethanol and added to the final

concentrations of OM, 0.01 iM, 0.1 riM, 1 M, 2iM and 10lM. Ethanol was equalized

between different concentrations. Eight plates of each concentration were used with 25

seeds per genotype described above. The germination plates were grown in a

temperature controlled Percival at 250 Celsius in constant light for 14 days.

Measurements were taken as described above. Averages and standard errors were

computed using the mean function of data analysis statistics of Excel, Microsoft Office

2003.

Results

The fruit of 44568 plants show a distinct delay in development compared to MD.

Wilkinson et al. (1997) first discovered the delay in fruit ripening in these plants. The

44568 fruit are slower to grow to full size and begin the browning processes during

maturation later than in MD (Figure 3-1). Visually, when the seeds are excised from the

fruit, they also appear to be slower to develop because browning of the seed coat due to

oxidative processes begin later in 44568 than in MD (Figure 3-1). Additionally,

reciprocally crossed fruit and seeds have visual characteristics like their corresponding









maternal plants. A delay in development of the fruit may have significant impacts on the

seed; therefore, further characterization of seeds of 44568, Mitchell Diploid, and the

reciprocal crosses (44568 x MD (ExM) and MD x 44568 (MxE); Yx o) was conducted.

Seed Characterization by Weight, Size, and Seed Number

Several characteristics of 44568, MD, and reciprocal cross seeds were analyzed to

determine if there were any major differences in physiological traits among genotypes.

Seed size was measured in seeds through development of MD, 44568, and the reciprocal

crosses and the average area of the seeds was computed (Figure 3-2). 44568 seed size

was similar to MD throughout development, but once MD seeds reached maturity

differences began to occur in the size of the seeds. Seed size increased in all genotypes

until 25 days after pollination. The 44568 seeds continued development through a

delayed ripening period for an additional five days (days 25-30) which resulted in a

reduction in seed size. The reciprocal crosses had a similar result to the respective

maternal parent. ExM seeds became reduced in size in the last five days of extended fruit

development similar to seeds made by selling 44568, whereas the MxE seeds did not

exhibit any reduction in size and did not endure an extended maturation time-period.

Next it was investigated whether the loss in seed size of 44568 and ExM seeds

would also result in a difference in seed weight (Figure 3-3). Seed weight was measured

in all genotypes of seeds at full maturity, and the 44568 and ExM seeds had reduced seed

weight in comparison to MD and MxE. When water weight was eliminated the dry

weight analysis revealed similar results, where 44568 and ExM had significantly less dry

weight than MD and MxE seeds (Figure 3-3). Respiration (CO2 evolution) was also

measured to see if 44568 and ExM seeds continued to respire for an additional 5 days

compared to MD and MxE (Figure 3-4). All genotypes had similar CO2 levels and









accumulation trends at 15 and 20 days after pollination throughout the three hour

collection period. By 25 days after pollination, MD and MxE seeds produced levels of

CO2 that were extremely low or non-detectable. 44568 and ExM seeds still produced

measurable levels of CO2 at 25 days after pollination, yet did not have measurable levels

of CO2 by the time the seeds reached maturity at 30 days after pollination.

Seed number was also quantified in order to observe whether a reduction in

ethylene sensitivity had any effect on the number of seeds in each fruit since it was

shown that the seeds produced on a maternal plant with reduced ethylene sensitivity were

smaller in size and weight. There was no significant difference between any of the lines

in seed number per fruit (Figure 3-5).

Developmental Delay of Seeds Reduced in Ethylene Sensitivity

Due to the delay in fruit maturation of 44568 and ExM plants, it was observed

whether the seeds were also delayed throughout development. Through visual

observation it did appear that the seeds were developmentally delayed because the

oxidation process was slower and the seeds took longer to acquire brown color (Figure 3-

1). A more specific approach was taken to confirm that there was a delay in

development. Sucrose quantification was performed on developing seeds, and

additionally adjusted to a per seed basis since ETR and ExM seeds are lighter in weight at

full maturity (Figure 3-6). Sucrose content measured in the developing seeds indicated

that homozygous and hemizygous seeds produced on a 44568 maternal plant were

delayed in accumulating sucrose. Sucrose levels increased substantially between 20 and

25 days after pollination in seeds produced on the MD maternal plant. Conversely, the

seeds produced on the 44568 maternal plant accumulated sucrose more slowly but

eventually reached similar sucrose levels at 30 days after pollination. Sucrose levels of





















R MD FTR I


C. MD ETR I MD ETR


- -- I


F FTR


I ETR


MxE ExM MxE ExM


1,rMV


I Ei l


Figure 3-1 A picture series of fruit and seed development of all genotypes. Fruit are
shown whole (column 1 and 3) and with longitudinal sections (column 2 and
4) to show developing seeds within fruit. A. 5 DAP B. 10 DAP C. 15 DAP
D. 20 DAP E. 25 DAP F. 30 DAP.


MV rF FVTM I


MD FT TR


MYrF FTiYM


- -- I -- -














Seed Area


0.390
" 0.370
E 0.350
g 0.330
m 0.310
g 0.290
0.270
0.250


- 4-- MxE
ETR
MD
--- ExM


15 20 25 30
Days after pollination


Figure 3-2 Seed size of all genotypes of seeds through development starting at 15 days
after pollination through full maturity (25 days after pollination for MD and
MxE and 30 days after pollination for 44568 and ExM). Seed size represented
as area (height x width).


A.


Seed Fresh Weight


S0.14
0.12
S0.1
0.08
t0.06
S0.04
. 0.02
0


DMD
* MxE
* ETR
* ExM


MD MxE ETR ExM
Genotype


Seed Dry Weight


0.14
0.12
S0.1
0.08
S0.06
S0.04
.' 0.02
0


OMD
* MxE
* ETR
* ExM


MD MxE ETR ExM
Genotype


Figure 3- 3 Average weight of individual seeds of MD, MxE, ETR (44568) and ExM A.
Weight of seeds at fresh harvest B. Weight of seeds after moisture content is
removed.


..- ..











A.

CO2 Accumulation 15 DAP
20
O 15 -- MxE
S--ETR
a 10
a 5-
0. --- ExM

15 30 60 120 180
Time of accumulation (minutes)

B.

CO2 Accumulation 20 DAP
20
20- MxE
o 15 -
10 ETR
S5 MD
S0 -- ExM
15 30 60 120 180
Time accumulation (minutes)

C.

CO2 Accumulation 25 DAP
20
S15 --- MxE
0 15
S--- ETR
10
MD
5 X ExM


15 30 60 120 180
Time accumulation (minutes)

D.

CO2 Accumulation 30 DAP
S2 0 -------------I
20
0 15
a 10 ---ETR
2 5 ExM
n 0 -- E -
15 30 60 120 180
Time Accumulation (minutes)


Figure 3-4 CO2 Accumulation throughout 3 hours of developing seeds of MD, ETR
(44568), MxE and ExM. A. CO2 accumulation at 15 days after pollination.
B. CO2 accumulation at 20 days after pollination. C. CO2 accumulation at 25
days after pollination. D. CO2 accumulation at 30 days after pollination.














Seed Number


MD MxE ETR ExM
Genotype


Figure 3-5 Average number of seeds per fruit of MD, MxE, ETR (44568) and ExM.

A.


Sucrose Content of Developing Seeds


MD
- -- MxE
--ETR
X ExM


15 20 25 30
Days after pollination


Sucrose Content Per Mature Seed


0.003
0.0025
0.002
0.0015
0.001
0.0005
0


25 D MD 25 D MxE 30 D ETR 30 D ExM


Genotype/Timepoint


Figure 3-6. Sucrose content of seeds of all genotypes. A. Total sucrose content of
developing seeds from 15 days after pollination through full maturity. (25
days after pollination for MD and MxE; 30 days after pollination for ETR
(44568) and ExM). A. Sucrose content of mature seeds adjusted to a per seed
basis.


o I









mature seeds adjusted to a per seed content indicated that 44568 and ExM seeds did not

have a statistical difference in sucrose content at the end of development compared to

MD and MxE.

To further confirm that 44568 and ExM seeds were developmentally delayed,

mRNA expression analysis of known developmental markers was conducted (Figure 3-

7). Markers were chosen based on their differing expression patterns through

development and their availability from sequenced petunia cDNA libraries. Beta tubulin,

a cell-cycle related structural protein, is used as a seed developmental physiological

marker in pepper since expression consistently decreased just before complete seed

desiccation tolerance (Portis et al., 1999). The seed storage genes, 11S globulin and 2S

albumin, are known to begin accumulation slightly later in seed development and

continue through the final maturation phases (Norton and Harris, 1975; Pomeroy, 1991;

Wobus et al., 1999; Hoekstra et al., 2001). 11S globulin and 2S albumin are predicted to

be the most predominant storage proteins in petunia seeds as seen by the extreme

redundancy in the petunia cDNA libraries (personal observations). LEA proteins also

begin to accumulate in the mid to latter stages of seed development. In many cases, the

timing of LEA mRNA and protein accumulation is correlated with the start of the seed-

desiccation process and associated with elevated in vivo ABA levels. The products of

these genes are thought to function in protecting cells from dehydration (Baker et al.,

1988; Dure et al., 1989; Brocard et al., 2003). When expression of these markers was

conducted it was observed that beta-tubulin mRNA expression continued later in 44568

fruit and seed tissues compared to MD. 11S Globulin mRNA expression was visible at 5

days after pollination in MD but was not observed in the 44568 line until 10 days after









pollination. 2S albumin expression was also slightly delayed in 44568, a small amount of

expression can be observed in MD at 5 days after pollination but is not seen in 44568.

LEA4 and LEA D-29 mRNA expression did not have as much of a discrepancy between

the two genotypes and the expression patterns appear to be induced in a similar manner.

The Effect of Ethylene Sensitivity on Seed Germination

Since it was observed that the seeds produced on a 44568 plant have delayed

development, it was investigated whether this delay would also have any impact on

dormancy and subsequent germination. Dormancy can be measured by observing

germination percentages after specified periods of dry storage (Leon-Kloosterziel et al.,

1996). Seeds produced from self-pollinated MD, 44568, and reciprocal crosses of the

two were tested for germination at fresh harvest and after 1 month, 6 months, and 1 year

of 40C storage (Figure 3-8). Seeds from both reciprocal crosses and 44568 had lower

germination percentages than MD, with homozygous 44568 having the lowest

germination rates at fresh harvest. After one month of storage in 40C, all seeds

containing the etrl-1 transgene germinated at similar rates, and all had significantly

lower germination than MD. After six months and one year of storage, all genotypes had

similar germination rates, and seeds containing the etrl-1 transgene did not germinate

differently from MD.

ABA Sensitivity and Germination

Since the after ripening requirement and dormancy were both impacted in all

homozygous and hemizygous 44568 seeds, another germination assay was conducted to

see if these genotypes were also altered in their sensitivity to exogenous ABA. Seed

germination of all genotypes was tested on increasing concentrations of ABA (Figure 3-

9). Homozygous and hemizygous 44568 seeds had similar levels of ABA sensitivity, and









A. Beta tubulin B. Seed Maturation (LEA4)
5 10 15 20 25 30 5 10 15 20 25 30


MD MD


ETR ETR

C. LEA Protein D-29 D. 11S Globulin
5 10 15 20 25 30 5 10 15 20 25 30


MD MD


ETR ETR

E. 2S Albumin F. Ubiquitin
5 10 15 20 25 30 5 10 15 20 25 30


MD MD


ETR ETR

Figure 3-7 RT-PCR analysis of seed developmental markers of whole MD and ETR
(44568) fruit tissue. Lanes are: ladder, MD 5, MD 10, MD 15, MD 20,
MD 25, space, ETR 5, ETR 10, ETR 15, ETR 20, ETR 25, and ETR 30 days
after pollination whole fruit. A. Beta tubulin. B. Seed Maturation (LEA4).
C. Late Embryogenesis Abundant Protein D-29. D. 11S Globulin storage
protein. E. 2S Albumin storage protein. F. Ubiquitin- loading control


all of these genotypes had increased sensitivity to ABA compared to MD. When

observing MD germination as cotyledon expansion, the germination rates of MD were

significantly higher at 0, 0.01, and 0.1 [M of ABA when compared to 44568, ExM and

MxE. Germination of all genotypes reduced dramatically at 1 and 2 [M of ABA. When

germination was observed as radicle emergence MD seeds had an even more dramatic

tolerance to ABA than the other genotypes. MD radicles were able to emerge at all

concentrations of ABA at significantly higher levels than 44568, ExM and MxE.











A.

Fresh Seed Germination-Cotyledon Expansion


2 4 6 8 10 12 14 16 18 20 22
Days after plating


E.

6 Month Old Seed Germination- Cotyledon
Expansion


2 4 6 8 10 12 14 16 18 20 22
Days after plating


B.

Fresh Seed Germination- Radicle Emergence


T






2 4 6 8 10 12 14 16 18 20 22
Days after plating


6 Month Old Seed Germination- Radicle
Emergence





)0 tD
30 ,
60 -1 ETP

40 ., r,1 D
-)--- Esr,1


2 4 6 8 10 12 14 16 18 20 22
Days after plating


Figure 3-8 Germination of seeds of all genotypes after various storage periods.
Germination measured by cotyledon expansion and radicle emergence
separately. A. and B. Germination of freshly harvested seeds.C. and D.
Germination of seeds after one month of cold storage.E. and F. Germination
of seeds after six months of cold storage. G. and H. Germination of seeds
after 1 year of cold storage.


--M--xE
--ETR
MD
-x-- ExM


1 Month Old Seed Germination-Cotyledon
Expansion
100 .. .
80
*Z 80 T
m T T
E 60- I
S-- ETP
040- D

| 20- --- E,1

0 :
2 4 6 8 10 12 14 16 18 20 22
Days after plating


1 Month Old Seed Germination- Radicle
Emergence
100
80
rj 60 --
E ETP
w 40

S20 E 11D
0 0-
2 4 6 8 10 12 14 16 18 20 22
Days after Plating


4tn









G. H.
1 Year Old Seed Germination-Cotyledon 1 Year Old Seed Germination- Radicle
Expansion Emergence
100

_: 80-
60 -1 80 -'-M x
Si-- l 60 -- ETR
0 40 E i
Sil: e 40 MD
8 20 / I- -E 1 20 ExM
0 0O
S1:1 1 I I I: ": : 2 4 6 8 10 12 14 16 18 20 22
D3v.i after pilt.ng Days after plating

Figure 3-8 Continued

Discussion

The physiological characteristics of seeds altered in their sensitivity to ethylene

were analyzed by seed size, weight, and number. It was observed that seed size and

weight was only affected in seeds produced on a maternal parent carrying the etrl-1

transgene. The consequence of the reduction of ethylene sensitivity of the maternal

parent resulted in delayed fruit and seed ripening, and subsequently a loss in seed size

during the extended ripening time-period. Seeds with the extended ripening period were

also lower in seed weight. This loss in seed weight occurs in the five days of extended

development since the loss of seed size was observed during this period (Figure 3-2). An

explanation for the loss in seed weight of the 44568 and ExM seeds is that these seeds

had to endure an additional five days of metabolic activity since fruit ripening and seed

dessication was not completed. This extended metabolic period used additional stored

material which could include sugars, lipids or any other form of reserve, resulting in the

loss of seed size. Metabolic activity in these samples was observed through CO2

evolution throughout a developmental time-course in seeds of all the genotypes. 44568

and ExM seeds continued to respire throughout the additional five day extended ripening

period. These results parallel physiological traits seen in other systems where, as the







46



A.

ABA Germination- Cotyledon Expansion

100
ST
o
S80 ---- MxE
o -I -4- MxE
E' 60 ETR

40 MD
S- ExM
U 20
0 0
0
[0] [0.01] [0.1] [1] [2]
ABA Concentration

B.

ABA Germination- Radicle Emergence

S 100

.2 80 1
--*- MxE
S60 T _-ETR

S 40 1 T MD
S40 /ExM
( 20

0
[0] [0.01] [0.1] [1] [2]
ABA Concentration

Figure 3-9 ABA sensitivity of germinating 1 month old seeds of MD, ETR (44568), MxE
and ExM. Measurement of germination by cotyledon expansion and radicle
emergence separately. A. Germination measured based on cotyledon
expansion 14 days after plating. B. Germination based on radicle emergence
after 14 days after plating.

development of the seed progresses, respiration decreases (Weber et al., 2005).

Therefore, the CO2 levels given off by the seeds are a good indication of the stage of

development, indicating that 44568 and ExM seeds are delayed in development compared


to MD and MxE.









Analysis of sucrose levels was also conducted on developing seeds of all

genotypes in order to determine the progress of development over time. Sucrose levels

were slower to accumulate in seeds produced on a maternal plant carrying the etrl-1

transgene. From previous research conducted on sucrose levels through maize seed

development it was shown that sucrose levels are lower at the beginning of seed

development and then levels increase once the cell division phases slow. The higher

sucrose levels generate embryonic sink strength and further embryo development (Weber

et al., 1996; 2005). Sucrose likely has several roles in seed development, one to act as a

nutrient sugar for the developing embryo and the other to act as one of the signaling

molecules that induce storage assimilation gene expression (Koch, 2004). Sucrose

accumulation may also be associated with stress tolerance during seed dessication

(Hoekstra et al., 2001). The sucrose levels increase towards the end of seed development

in order to aid in membrane protection during the drying down of the seeds (Hoekstra et

al., 2001). Since sucrose levels were delayed in accumulating within the seeds of 44568

and ExM, it is likely that the developing embryo does not receive signals to begin storage

protein accumulation and maturation until a later time-point in development.

Lastly, developmental timing in seeds reduced in ethylene sensitivity was observed

through mRNA expression analysis of known seed developmental markers. Beta tubulin

expression in pepper seeds consistently decreased just before complete seed desiccation

tolerance (Portis et al., 1999). Since higher expression of beta tubulin was extended in

44568 seed tissue through 25 DAP in comparison to MD, it can be inferred that seed

desiccation tolerance may be acquired later in development in the 44568 seeds than it

does in MD. mRNA for 11S globulin was slightly slower to accumulate in 44568









compared to MD which indicates that the cell expansion/storage accumulation phases

started slightly later in 44568 in comparison to MD. 11S Globulin expression was visible

at 5 days after pollination in MD, but was not shown in the 44568 line until 10 days after

pollination. This five day discrepancy between 44568 and MD developmental marker

expression parallels the five day extended fruit ripening delay observed much later. These

data, together with the sucrose and CO2 results, clearly indicate that 44568 and ExM

seeds are developmentally delayed compared to MD and MxE; thus the loss of ethylene

sensitivity of the maternal plant is the most significant factor in causing this delay.

Since development was delayed in seeds produced on a maternal plant carrying the

etri-1 transgene, the germination phenotype of all the genotypes was observed. The

germination results revealed that all genotypes carrying the etri-1 transgene were

affected in germination characteristics. 44568 and reciprocally crossed seeds all had

significantly reduced germination rates compared MD at fresh harvest and after one

month of storage. Germination rates of 44568 and reciprocally crossed seeds all

recovered after six months and one year of cold storage. These data provide two

interesting observations. First, hemizygous and homozygous 44568 seeds have a longer

after-ripening requirement than MD. Since after-ripening is a dormancy breaking agent,

the greater after-ripening requirement of lines with reduced sensitivity to ethylene

confirms that there is heightened primary dormancy (Koorneef and Karssen, 1994).

Second, unlike previous findings with the maternal role in developmental delay, the

maternal parent does not completely determine subsequent germination characteristics.

The level of ethylene sensitivity of the seed's zygotic tissue also plays an important role

on the impact of germination. Through previous research conducted on maternal tissue









role in seed developmental processes, it has been shown that the maternal tissues play a

significant role in early developmental processes (Vielle-Calzada et al., 2000).

Additionally, studies with ABA have revealed that early ABA synthesis, which occurs at

the end of the cell division phase, in maternal tissues is involved more in earlier seed

developmental processes such as preventing early germination and aids in progression

into the maturation phase of embryogenesis (Finkelstein et al., 2002). Conversely, latter

ABA synthesis in zygotic tissues is involved in seed maturation programs such as

acquiring dessication tolerance (Finkelstein et al., 2002; Frey et al., 2004). These

observations help explain the results of this research, where the sensitivity of the maternal

tissue had more of an affect than the overall ethylene sensitivity of the zygotic tissue on

the developmental timing of the seeds. Yet, later processes in seed development, such as

dormancy acquisition, were affected more by the ethylene sensitivity of the zygotic

tissue. This would explain the longer after-ripening requirements of all genotypes

reduced in ethylene sensitivity, regardless of the maternal parent genotype.

Lastly, since seeds carrying the etrl-1 transgene exhibited enhanced seed

dormancy, an additional germination assay was conducted to determine the sensitivity to

exogenously applied ABA. The results of this assay were similar to the results of the

standard germination test in that the overall ethylene sensitivity of the zygotic tissue

played a major role in the phenotype. It was determined that all seeds carrying the etrl-1

transgene appeared to exhibit increased sensitivity to ABA. An important issue to

consider about the results of this experiment is that endogenous levels of ABA may have

an impact on the sensitivity assay. If levels of endogenous ABA are significantly higher

in the transgenic lines compared to wild-type, then it would be difficult to determine that









the transgenic seeds are hypersensitive to ABA compared to wild-type. Yet, when

mature petunia etri-1 seeds where measured for ABA content it did not appear to have

significantly different levels of ABA than MD seeds (Barry, 2004). Hemizygous seeds

did not exhibit different sensitivity to the ABA than the homozygous 44568 seeds;

therefore, the genotype of the maternal plant does not play a major role in the ABA

sensitivity phenotype. These data confirm results from previous research conducted on

Arabidopsis seeds reduced in ethylene sensitivity, which also exhibited increased

sensitivity to exogenous ABA during a germination assay (Beaudoin et al., 2000). This

evidence demonstrates that there likely is a direct interaction between ABA and ethylene

in the involvement of seed dormancy and germination in petunia seeds similar to

Arabidopsis (Beaudoin et al., 2000).

An item of interest that arises from the germination assays is that there still exists a

percentage of seeds reduced in ethylene sensitivity that have the capability of

germinating. For example, approximately 50-60% of seeds carrying the etri-1 transgene

still germinate at fresh harvest without any after-ripening time-period. Similarly, 50-60%

of the seeds reduced in ethylene sensitivity are able to germinate with the lowest

concentration of ABA, 0.01 m, and approximately 20-50% at 0.1lm of ABA. These

observations lead to the question as to why some seeds do not exhibit as strong as a

phenotype as other seeds when all of the seeds are reduced in ethylene sensitivity. One

explanation for the phenomenon is the position of the seeds within the fruit. The petunia

fruit is attached to the maternal plant at the base. Additionally, when fruit maturation

begins the tip at the top of the fruit opens and begins to dry down from the top to the

bottom. Therefore, seeds positioned at the top of the plant may be receiving less









maternal resources. One of these resources could be the germination stimulatory

hormone, gibberellic acid. A theory exists in which GA is also involved in an

antagonistic relationship with ABA in order to break dormancy and induce germination

(Karssen, 1995). It is also known that when homozygous etrl-1 petunia seeds are

imbibed in GA3 that germination levels increase dramatically (Bleecker et al., 1988).

Therefore, some seeds may receive more resources, such as GA, from the maternal plant

than others and this could contribute to the discrepancy in phenotype between the seeds

reduced in ethylene sensitivity.

Conclusion

Ethylene has been shown to play a significant role in several aspects of plant

development. However, there has been little conclusive evidence that it plays a major

role in several aspects of seed development, germination and dormancy in a single plant

species. The data presented here provide evidence that ethylene plays an important role

in all of these developmental processes. Seed physiological characteristics that were

altered by the reduction of ethylene sensitivity included a reduction in seed weight and

size of seeds produced on a maternal plant carrying the etrl-1 transgene. Seed

development is greatly influenced by a reduction in ethylene sensitivity of the maternal

plant as seen through delayed sucrose accumulation and an extended time-period of

respiration. Since maternal tissue has been shown to have some control of early seed

development in petunia (Colombo et al., 1997), it is not surprising that the maternal

tissue's sensitivity to ethylene plays a major role in the developmental timing of the

seeds.

Conversely, the maternal plant does not completely determine the subsequent

germination and ABA sensitivity phenotypes seen in the seeds reduced in ethylene









sensitivity. Dormancy was extended in all seeds carry the etrl-1 transgene. ABA

sensitivity during seed germination was also heightened in the homozygous and

hemizygous 44568 genotypes compared to MD. These data confirmed the concept that

hormone interactions in both maternal and zygotic tissues play a major role in the

severity of dormancy and subsequent initiation of seed germination.

All of the data presented in this research provided evidence that ethylene is indeed

intricately involved in seed developmental timing and germination processes of petunia

seeds, and it is likely through interactions with other hormones such as ABA. The extent

of the maternal plant's role on seed developmental processes varies. The maternal plant

likely plays more of a major role in the beginning of seed development and less at the end

of development when dormancy is induced.














CHAPTER 4
MICROARRAY ANALYSIS AND CONDENSED TANNIN CONTENT OF PETUNIA
SEEDS AFFECTED IN ETHYLENE SENSITIVITY

Introduction


Angiosperm fruit and seed development is mediated by an assortment of factors

including hormones, storage proteins, fatty acid and carbohydrates; therefore, it has been

exceedingly difficult to monitor all or even several of the genes involved in these

processes at one point in development (Harada, 1997). It is also known that ethylene has

diverse roles during growth and development of plants. Ethylene is especially integral to

fruit development and ripening processes (Ecker, 1995; Giovannoni, 2001). Ethylene's

substantial role in fruit ripening is illustrated in the delayed fruit ripening phenotype

observed in ethylene perception mutants in various species including Arabidopsis, tomato

and petunia (Bleecker et al., 1988). Since ethylene is involved in an array of plant

responses, it is likely a complex interaction of gene regulation and expression occur

during different plant processes. Identification of novel genes associated with ethylene's

function in ripening fruit and seeds will help develop a more complete understanding of

the physiological role of ethylene in late fruit and seed development.

Microarray analysis is a powerful tool to examine the expression of hundreds of

genes at the same time. This technology has tremendous advantage over traditional

mRNA expression methods that usually analyze one gene at a time (Ekins and Chu,

1999). Microarray analysis has already been used to examine many plant growth and









development processes including light regulation, wounding response, pathogen infection

and hormone defense responses (Zhong and Burns, 2003).

A cDNA microarray was developed to help screen for gene expression differences

between MD and 44568 fruit and seeds at 25 days after pollination. A set of 384 cDNAs

from sequenced petunia cDNA libraries made from fruit, seeds, and whole flowers were

used to make the microarray. The focus of the study was to identify a subset of genes

with high levels of differential expression between 44568 and MD. A goal was to also

determine if the mRNA expression patterns of these genes paralleled the developmental

delay seen in seeds with a maternal parent with reduced ethylene sensitivity or contribute

to the stronger induction of dormancy in the homozygous 44568 and hemizygous seeds

(Chapter 3).

Additionally, the results of the microarray experiments led to further investigation

into a pathway involved in secondary metabolism. Proanthocyanidins, or condensed

tannins, are compounds found in the seed coat that turn brown upon oxidation

(Debeaujon et al., 2000; Nesi et al., 2001). These tannins are known to help provide a

protective barrier for the seed, but they are also thought to be involved in altering seed

coat imposed dormancy by reducing the permeability of the seed coat (Debeaujon et al.,

2000). To the best of our knowledge, there are no present published works that focus on

any kind of ethylene involvement in the proanthocyanidin pathway. Several

characteristics of the 44568 transgenic seeds suggest that there may be altered levels of

proanthocyanidins. These include increased seed dormancy, visual differences in seed

coat color at the end of development, and differential regulation of expression of genes









encoding enzymes and transcriptional regulators of the anthocyanin/proanthocyanidin

pathway.

Research Objectives

The main objective of this research was to isolate a set of genes with expression

differences between 44568 and MD fruit and seeds at a late time-point in fruit and seed

development through microarray analysis. The time-point chosen, 25 days after

pollination, represents the point in fruit development where 44568 and MD are the most

visually different, where MD is fully brown and ripe and 44568 fruit are just beginning

the browning process. A smaller subset of genes chosen from the array results will be

investigated in further detail through RT-PCR expression analysis in a seed

developmental time series from 20 days after pollination to maturity. The last objective

was to further examine expression of genes involved in the proanthocyanidin synthesis

pathway to determine if this pathway is altered and could contribute to the stronger

induction of dormancy in the 44568 and hemizygous lines resulting from reciprocal

crosses with MD.

Material and Methods

Culture and Growth of Petunia x hybrida Plants

Petunia x hybrida "Mitchell Diploid" (MD), etrl-1-44568 (Wilkinson et al., 1997),

and ein2 RNAi (Shibuya et al., 2004) plants were grown for fruit and seeds used in the

microarray experiments and the subsequent confirmation by RT-PCR. Seeds of the three

lines were imbibed in 100 ppm of GA3 overnight to promote uniform germination. Seeds

were then sown in 72 cell trays with Fafard #2 soilless potting mix (Conrad Fafard, Inc.,

Agawam, MA) and placed in a misting house with an intermittent mist of 5 seconds every

2 hours. Approximately twenty-four hours later, a thin layer of vermiculite was applied









to the seed trays. After three days in the mist house, the seed trays were placed in the

greenhouse. All plants were grown in a year-round temperature controlled glass

greenhouses with day/night temperatures of 24/200C (+/- 20C). Plants were sprayed with

a plant growth regulator, daminozide (Uniroyal Chemical Company, Middlebury,

Connecticut) at a rate of 2500 ppm at two weeks after sowing to control excessive

elongation of seedlings. The seedlings were transplanted after eight weeks into six-inch

plastic pots and drenched with four ppm of paclobutrazol (Uniroyal Chemical Company,

Middlebury, Connecticut). Growth regulators were stopped after this point to allow for

pollination of plants, so that the growth regulators did not have an effect on fruit or seed

development. Plants were placed on greenhouse benches in a completely randomized

design. All plants were fertilized 6 days a week (with 1 day/week water only) with 150

ppm of 20-4.8-16 Cal-Mg Peter's soluble fertilizer (Scotts-Sierra Horticultural Products

Co., Marysville OH). All lines were self-pollinated for whole fruit tissue (WF), maternal

fruit tissue (MT) and seeds for all experiments. Additionally, 44568 and MD were

reciprocally crossed for fruit and seed tissue: MxE and ExM ( x o).

Petunia x hybrida cDNA Libraries

A subset of cDNA clones were selected from five different Petunia x hybrida

libraries: Young Fruit (YF), Ripe Fruit (RF), Developmental Flower Stages (DevA),

Ethylene Treated Whole Flowers (C2H4), and Post Pollination (PP) (Underwood, 2003).

A list of the 384 cDNA clones and source libraries used for microarray analysis is

outlined in Appendix A. The genes were selected based on their putative involvement in

transcription, hormones, metabolism, stress response and seed development. Focus was

placed on genes involved in transcription, such as MADS box transcription factors, 14-3-

3 genes, bZip transcription factors and other unknown or putative transcription factors, to









identify altered transcriptional control during seed development. Also, genes encoding

enzymes of metabolic pathways were highlighted in the array list, such as enzymes

involved in carotenoid synthesis, gibberellin synthesis, and jasmonic acid synthesis, to

identify increases in metabolic substrates that could be affecting seed development and

germination.

cDNA Microarray Fabrication

Clones chosen for microarray analysis were picked from glycerol stocks and

grown in 96-well plates containing 150 tL Luria Broth with Ampicillin (50 mg/mL).

Cultures were grown overnight in a 370C incubator, without shaking or agitation. PCR

was conducted to amplify the cDNA product by inoculating 49 [l of PCR mix

(containing T3/T7 primers, dNTP's and 10X PCR buffer) with 2 pl of the bacterial

culture. The PCR temperature cycling program used was: 95C for five minutes,

followed by 35 cycles of 94C for one minute, 53C for one minute, and 72C for one

minute, and a final step of 72C for seven minutes. PCR products were then analyzed by

gel electrophoresis to verify the presence of intact PCR product. The PCR product was

then stored in a -200C freezer until arraying. A portion of the PCR reaction, 22 [tL, was

transferred to 384-well plates and mixed with a spotting solution of 20X SSC and 20%

sarkosyl immediately before array construction.

Microarray Gold Seal glass slides (Corning, Toledo, OH) were processed using a

modified protocol of Eisen and Brown (1999). The following steps are the modified

steps: slides were gently agitated in 100% ethanol for two hours using a metal slide rack

and glass chamber (Shandon Lipshaw, Pittsburg, PA). Immediately after the ethanol

rinse, the slides were quickly transferred to several glass chambers full of filter-sterilized

double distilled water and rinsed with agitation for 30 seconds at room temperature. The









slides were coated by placing them in a separate glass chamber of 10% poly-L-

lysine/10%PBS (Sigma-Aldrich Corp, St. Louis, MO) for one hour. The slides were

removed and placed on a table-top bench at room temperature and allowed to dry

overnight, with a cover to prevent dust from settling on the freshly coated slides.

cDNAs were arrayed onto poly-L-lysine coated slides using an Affymetrix 418

Robotic four-pin Arrayer (Santa Clara, CA). Each spot had a distance of 550pm away

from the neighboring spot, and the entire 384 well plate was replicated three times on one

slide. Arrayed slides were stored in a dark black slide box within another plastic box

containing Drie-Rite dessicant (Xenia, OH). Array slides were not stored for more than

two weeks without use. Directly before array hybridization the slides were processed by

waving them over hot steam for 10 seconds, followed by a 10 minute rinse with 0.2%

SDS with agitation and several rinses in filter-sterilized double distilled water. Slides

were placed in boiling water for denaturation for 10 minutes, and lastly slides were

placed in a cold ethanol rinse for 30 seconds.

Microarray Hybridization

Whole fruit of 44568 and MD were collected at 25 days after pollination (DAP).

Three whole fruit (WF) of each genotype were ground in liquid nitrogen with a mortar

and pestle for RNA extraction and stored in a -800C freezer. For the maternal tissue

array experiments, an additional five fruit were opened and the seeds were removed by

scalpel, and the internal maternal pith tissue (MT) was frozen for RNA extraction and

stored in a -800C freezer. Five fruit were combined to reduce variability between each

fruit. 0.5 gram of each tissue was ground in a mortar and pestle and used for RNA

extraction using the phenol-chloroform method and lithium chloride precipitations

(Ciardi et al., 2000). RNA was cleaned using the Qiagen RNeasy kit and manufacturer









protocol was followed (Qiagen Inc, Valencia, CA). RNA was quantified by

spectrophotometer readings SmartSpec 3000 (BioRad, Hercules, CA) and quality was

checked by gel electrophoresis. The array probes were labeled using an Array 900

labeling kit (Genisphere, Hatsfield, PA). 2.5[tg of total RNA from each sample was used

for labeling each dye and the manufacturer protocol was followed. Two arrays slides

each were used for the following experiments: 1. Probe 1- MD 25 DAP WF vs. Probe

2- 44568 25 DAP WF and 2. Probe 1- MD 25 DAP MT vs. Probe 2- 44568 25 DAP

MT. Hybridized microarrays were scanned by an Agilent DNA Microarray scanner and

dye signals were analyzed using Agilent's Feature Extraction Software (Agilent Corp.,

Palo Alto, CA). Data were analyzed for the 44568 experiments as an average ratio of 5-6

spots. For the two slide 44568 experiments 5 to 6 spots had to show higher expression to

be included as differentially regulated. Data in tables are presented as the average ratio.

The fold difference in expression is computed as: average ratio (2 to the power of the

average ratio of spots). cDNAs with an average ratio of 1.0 or higher are considered

differentially expressed, which would represent a 2 fold difference in expression.

RT-PCR Confirmation of Microarray Experiments

In order to verify the results of the microarray hybridizations, RT-PCR was

conducted on several of the cDNA clones that showed putative differential expression in

the array experiments. For this analysis total RNA was extracted from whole fruit tissue

of MD 20 DAP, MD 25 DAP, 44568 20 DAP, 44568 25 DAP and 44568 30 DAP. RNA

was quantified by using a SmartSpec 3000 spectrophotometer readings (BioRad,

Hercules, CA) and quality was checked by gel electrophoresis. RT-PCR analysis was

conducted following the manufacturer protocol of the One-Step RT-PCR Analysis kit

from Qiagen (Qiagen Inc- USA, Valencia, California). The entire RT-PCR reaction was









electrophoresed on a 1.5% acrylamide gel. A set of custom primers was obtained for

each individual cDNA from the Invitrogen Corporation (Carlsbad, CA). The number of

thermal cycles of RT-PCR varied based on the amount of expression of each gene in the

fruit tissue. Genes that were highly expressed in the fruit tissue required fewer cycles in

order to visualize the RT-PCR band. The numbers of cycles used in the RT-PCR reaction

are represented in parenthesis, and NCBI accession numbers are given following

description of gene: Beta Xylosidase GV298846 (25 Cycles) Primers: Forward-

TGTGGGTTGGTTATCCTGGT Reverse- ACTGGGCCCCTGTAAAATCT; FBP24

CV299636 (32 Cycles) Primers: Forward- GGGTATCTGGGCAGTGAAAC, Reverse-

TAAATCGGCCATAACCCAAA; Ent-Kaurene Oxidase CV299619 (25) YF-3R-F07:

Forward- GGCTTGAAGTTGCAGTAGTTC, Reverse-

CGAATCCACATGATAAAGAGC; Dehydration Induced Protein CV300614 (27

Cycles) Primers: Forward-GAGGCCAGAAAATGGGAAAT Reverse-

TCAGGAAGGAAATGGCAAAC; 4-hydroxypheylpyruvate dioxygenase CV294459

(25) Primers: Forward GAAGATGTTGGCACTGCTGA, Reverse-

ACATCCCCTGCCCTACTCTT; Glutathione-S-transferase CV299433 (28) Primers:

Forward- CATAGCAGCAGCACAAGGAG, Reverse-

TTGCCTTTGCTGCAATTCTT; Beta carotene hydroxylase CV301281 (29) Primers:

Forward- AACTGCCATCACTCCACTCC, Reverse-

TCATCCTCGAGAACAAAGCA; Pectinerase CV300751 (23) Primers: Forward:

TGCAAGCAGTGAGTGTGTGA, Reverse- TCTCGTTTGTGTCCCCTTTC; RPT2

CV298420 (29) Primers: Forward- GTGGACGGAAGAGCTATCCA, Reverse-

TCCCTGAGTGGTCACGTACA; Alcohol Dehydrogenase CV292993 (25) C2H4-5-A02









Primers: Forward- ATAGCAGGGGCTTCAAGGAT, Reverse-

AGCCATCATGGACACATTCA; Expansin CV300919 RF-5-H01 (25) Primers-

Forward- CTTGCTTCTACCTGCGCTTT, Reverse-CCACAACCAGCTCCATTCTT;

Oxygen evolving enhancer protein CV299423 PP-4-E12 (30) Primers: Forward-

GCAGCCAGGCTATCTTGTTC, Reverse- GGCAAAGCTTTTCAACACCTC; Seed

imbibition CV298461 PP-8-A11 (30) Primers: Forward-

CCTGGTCGACCTACAAAGGA, Reverse- ACATCACTGCGCCTGACATA; Seed

maturation CV300863 RF-5-C02 primers (LEA4) (21) : Forward-

GAGAAGGGGAGAAGATGACAAC, Reverse- ATAGTGTGTCCCAACCTGCC;

LEA-D29 CV300578 RF-1-H08 (21) Primers: Forward-

AAGGACTTGGCTTTAAATCCAC, Reverse- TCTGCTGCATATTGCCCAC

Ubiquitin Primers: Forward- AACATACAGAAGGAGTCAACAC, Reverse-

AGAAGTCACCACCACGAAG. PCR was run with the following program: 500C for

30 minutes, 940C for 15 minutes; multiple cycles of 940C for 30 seconds, 55C for 30

seconds, and 720C for 1 minute; final incubation at 720C for ten minutes. The entire RT-

PCR reaction was run out on a 1.5% acrylamide gel by electrophoresis. Pictures were

taken on a Polaroid Fotodyne camera. (Polaroid Corporation, Pasadena, California).

Data was analyzed visually.

RT-PCR of Condensed Tannin Synthesis Genes

RT-PCR was conducted on genes encoding enzymes involved in the condensed

tannin synthesis pathway. RNA was extracted from seed tissue produced from self-

pollinations and reciprocal crosses at: 20, 22, 24, 26, 28 and 30 days after pollination in

44568, MD, MxE and ExM. RNA was extracted using a phenol-chloroform method with

lithium chloride precipitations (Ciardi et al., 2000). RNA was quantified by









spectrophotometer readings SmartSpec 3000 (BioRad, Hercules, CA) and quality was

checked by gel electrophoresis. RT-PCR analysis was conducted with a One-Step RT-

PCR Analysis kit from (Qiagen Inc- USA, Valencia, California). Manufacturer's

protocol was followed. The entire RT-PCR reaction was electrophoresed on a 1.5%

acrylamide gel. A set of primers was obtained for each individual gene verified from

Invitrogen Corporation (Carlsbad, CA) and the numbers of cycles in the RT-PCR

reaction are designated in parenthesis: Dihydroflavonol reductase-like CV295572 (DFR-

like-32) Petunia-3-C03 Primers: Forward- TTGATCAAGCGCCTTCTCTT; Reverse-

GGCAGTGTGGAAAACACCTT Dihydroflavonol reductase CV292934 (DFR-32)

C2H4-4-D01: Forward- CTCGCCCCACTGTACTCTTC; Reverse-

GGCTCTGTTCGTTCATCCAT; FBP24 CV299636 (32 Cycles) Primers: Forward-

GGGTATCTGGGCAGTGAAAC, Reverse- TAAATCGGCCATAACCCAAA. PCR

reactions were conducted with the following program: 500C for 30 minutes, 940C for 15

minutes; multiple cycles of 940C for 30 seconds, 55C for 30 seconds, and 720C for 1

minute; final incubation at 720C for ten minutes. The entire RT-PCR reaction was run

out on a 1.5% acrylamide gel. Pictures were taken on a Polaroid Fotodyne camera.

(Polaroid Corporation, Pasadena, California). Pictures were analyzed visually.

Vanillin Staining of Seeds

Vanillin stains red upon contact with condensed tannins. Fresh and 1-month old

seeds of MD, 44568, MD x 44568 and 44568 x MD were imbibed in 1% vanillin in 6M

HC1 acid for 30 minutes (Aastrup et al., 1984). Afterward they were rinsed in distilled

water and stored in a -20C freezer until pictures were taken. Pictures were taken with a

Leica DC 300 (Leica Camera, Solms, Germany) digital camera fixed to a Wild









Heerrbrugg microscope (Leica Geosystems, Heerrbrugg, Switzerland) and pictures were

analyzed visually for red staining.

Results

Microarray Analysis

A microarray experiment was conducted in order to determine gene expression

differences between MD and 44568 fruit and seed tissue at 25 days after pollination. At

this time-point MD fruit are brown, mature and dehiscing the fully developed seeds.

Conversely, 44568 fruit are still green and continue to develop for another five days

before complete maturity (Figure 3-1). There were two primary microarray experiments

conducted, the first compared 44568 to MD whole fruit at 25 DAP, and the second

compared maternal fruit tissue only (without seed tissue) of 44568 to MD at 25 DAP.

The experiments were conducted on whole fruit and maternal fruit tissue for several

reasons. Whole fruit tissue included the seeds and the results were expected to isolate

genes involved in the developmental delay and the stronger induction of dormancy in the

homozygous and hemizygous 44568 seeds. The maternal fruit tissue experiment

included all fruit tissue except the seeds; therefore, only maternal plant tissue is

represented. The maternal fruit tissue experiments were also expected to help delineate

genes expression differences in the seeds since putative differentially regulated genes

found in the whole fruit experiments but not the maternal experiments were likely seed

expressed genes.

Genes were considered differentially regulated if their corresponding microarray

hybridized spot showed a Cy3:Cy5 ratio of 1.0 or higher (2-fold difference in expression

after normalization). The most differentially expressed clones, with a spot ratio of

approximately 2.0 or higher, are shown for each experiment (Table 4-1 and Table 4-2).









Many of the cDNAs have not been studied in petunia; therefore, their exact function is

not certain in petunia. The percent identity to genes in other species was used, the

highest NCBI Blast matches are provided in the table along with the percent identity to

the corresponding petunia cDNA. Full results of the all genes, not just the most

differentially regulated genes, expressing at least a two-fold difference (spot ratio of 1.0)

in expression in either tissue are presented in Appendix A. The differentially regulated

genes in the microarray results are predicted to be involved in various cellular and

metabolic processes including stress response, seed storage accumulation, and hormone

biosynthesis and function.

RT-PCR analysis of mRNA was conducted on a subset of genes with a whole-fruit

time series in MD and 44568 (20 days after pollination through full maturation) to verify

that genes that had differential expression in the microarray actually exhibited expression

differences between 44568 and MD (Table 4-3). Out of the subset of 15 genes that were

analyzed with RT-PCR, 14 confirmed that the results from the microarray experiments

were valid. One gene, an alcohol dehydrogenase was shown to be more highly expressed

in MD fruit tissue and was not confirmed by RT-PCR, but it is likely that human error

may have factored into the results observed for this gene.

Many of the same differentially regulated genes had the same results in both whole

fruit and maternal tissue experiments. Genes that were expressed more in 44568 in the

microarray experiments showed homology to an expansion, an oxygen evolving enhancer

protein and ent-kaurene oxidase (Tables 4-1 and 4-2). Expansins are involved in cell

wall loosening, which allows for cell expansion during fruit tissue growth (Cho and

Kende, 1997; Chen et al., 2001). RT-PCR mRNA expression of the expansion gene were









markedly higher in 44568 whole fruit tissue at 20 and 25 days after pollination.

Expression of the expansion in MD and 44568 was not visible in mature fruit of both

genotypes, 25 days after pollination and 30 days after pollination respectively (Table 4-

3). The oxygen evolving enhancer protein is part of PSII and is involved in oxygen

evolution during photosynthesis (Ko et al., 1990). When RT-PCR was conducted on this

gene, it was observed that mRNA expression was slightly higher in 44568 whole fruit

tissue compared to MD whole fruit tissue at 25 days after pollination (Table 4-3). Ent-

kaurene oxidase is a gene that encodes an enzyme involved in the first committed step of

GA biosynthesis (Hedden and Kamiya, 1997). It was expressed at higher levels at 25

DAP in 44568 than MD in the maternal tissue experiment. When expression was

checked in whole fruit tissue, ent-kaurene oxidase mRNA was shown to be more

predominant in the 44568 whole fruit tissue at 25 DAP also (Table 4-3).

Other genes that exhibited clear differential regulation between the two genotypes

were genes that showed homology to beta xylosidase, two genes encoding late embryonic

abundant proteins, a seed imbibition gene, and a dehydration-induced gene. The

microarray results showed that these genes were more highly expressed in the MD fruit

tissue over 44568 fruit tissue at 25 days after pollination. Beta xylosidase is involved in

the metabolism of the xyloglucans in the secondary cell wall (Goujon et al., 2003). When

expression was observed by RT-PCR, mRNA levels were higher in MD at 25 days after

pollination in whole fruit tissue compared to 44568. Expression of beta xylosidase in the

44568 tissue was delayed until 30 days after pollination when the fruit are fully ripe.

Late embryonic abundant proteins accumulate in the embryos in the late stages of seed

development at the time when seed dessication processes are conducted (Baker et al.,









1988; Dure et al., 1989). mRNA expression of two LEA genes exhibited markedly

higher expression in MD at 25 days after pollination in whole fruit tissue compared to

44568 fruit. Expression increased in the 44568 whole fruit tissue at 30 days after

pollination but still did not appear to be as high as MD 25 day after pollination expression

(Table 4-3).

A smaller subset of genes was analyzed with RT-PCR in a more detailed late seed

development time series in all genotypes. This was conducted to further verify the results

of the array experiments and to examine expression in reciprocal cross genotypes to

determine any maternally regulated expression differences (Figure 4-1). The genes

examined showed homology to an expansion, a dehydration induced gene, seed imbibition

gene and a LEA protein. The expression of these genes was examined in the latter stages

of seed development, from 20 days after pollination until seed maturity (26 DAP for MD

and MxE; 30 DAP for 44568 and ExM), in order to observe expression of these genes

specifically in the seed just before and during the developmental time-point used in the

microarray experiments. mRNA expression for the gene that shows homology to the

expansion decreased as seed development progressed. 44568 and ExM mRNA expansion

expression was higher at 20 DAP and decreased more slowly than MD and MxE seed

mRNA expression (Figure 4-1). The gene that showed homology to the dehydration-

induced protein exhibited similar mRNA expression between all genotypes except

expression decreased slightly in 44568 and ExM seeds at maturity, but the decrease in

expression was not observed in MD and MxE seeds (Figure 4-1). mRNA expression of

the LEA gene increased over developmental progress. The increase in expression of the









LEA gene in the seeds was delayed in the 44568 and ExM genotypes compared to MD

and MxE (Figure 4-1).

Condensed Tannin Analysis of Seeds Carrying The etrl-1 Transgene

Two genes involved in the anthocyanin synthesis pathway were determined to be

differentially regulated in the results of the microarray experiment. One of these genes

showed homology to a gene that encodes a myb transcription factor. It was shown to be

more highly expressed in 44568 fruit than MD at 25 days after pollination. Myb 305

activates transcription of the gene encoding the first enzyme of phenylpropanoid

metabolism, phenylalanine ammonia-lyase (Jackson et al., 1991; Sablowski et al., 1994,

1995). The other differentially regulated gene from the array data that was more highly

expressed in 44568 whole fruit tissue than in MD whole fruit tissue at 25 DAP was

FBP24, a MADS box transcription factor involved in proanthocyanidin synthesis

pathway (Nesi et al., 2002). Condensed tannins are thought to enhance seed coat

imposed dormancy by decreasing permeability of the seed coat (Debeaujon et al., 2000).

Further expression analysis of other genes (Figure 4-2) involved in the condensed tannin

synthesis pathway was examined to determine if condensed tannins might be a

contributing factor to the increased dormancy in the 44568 seeds. Additionally, a slight

color difference was also observed in the 44568 and ExM seeds at fresh harvest and after

one-month of cold storage compared to MD and MxE (Figure 4-3). Since condensed

tannins greatly contribute to the brown color of Arabidopsis seeds (Debeaujon et al.,

2000), it was thought that this pathway would be interesting to investigate. mRNA

expression analysis of a late seed developmental time series was examined with flavonol

3'hydroxylase (F3'H), dihydroflavonol reductase (DFR), FBP24 (Nesi et al., 2002) and a














Table 4-1 Highest ranked differentially expressed cDNAs of a microarray experiment of
whole fruit tissue of ETR (44568) compared to MD at 25 days after
pollination. A. Petunia cDNA library ID number B. NCBI Blast X match C.
% identity of cDNA clone to Blast X match D. Average microarray spot ratio
E. Description of function of cDNA. F. Comparison of results to other
microarray experiments (Maternal- 44568 maternal fruit tissue vs. MD
maternal fruit tissue at 25 DAP)

D.
Average
Spot F. Is it
Whole Fruit 25 DAP ETR vs MD Ratio E. Description same in:
C. % 5-6
A. Library ID B. Blast-X Match Identity Spots Maternal
Higher in 44568


4.54 Cell Wall yes


3 Photosynthesis yes


2.87 Stress response no

2.77 Seed Storage no




Seed Coat
2.2 Tannins no


Higher in MD
GA-2 oxidase-
C2H2-1 -E06 BAD17855 tobacco 89 2.47 GA yes
late embryogenesis
protein 5- AF053076
C2H2-11 -D05 tobacco 71 2.1 Seed Storage yes
raffinose synthase
family protein din10-
PP-8-A11 NM122032 Arabidopsis 78 1.96 Stress Response yes











Table 4-2 Highest ranked differentially expressed spots of microarray experiment of
maternal fruit tissue of ETR (44568) compared to MD at 25 days after
pollination. A. Petunia cDNA library ID number B. NCBI Blast X match C.
% identity of cDNA clone to Blast X match D. Average microarray spot ratio
E. Description of function of cDNA. F. Comparison of results to other
microarry experiments (Whole fruit- 44568 whole fruit vs. MD whole fruit)


D.
Average F. Is it
Spot same
MD 25 Maternal vs ETR 25 Maternal Ratio E. Description in:

C. % 5-6 Whole
A. Library ID B. Blast-X Match Identity Spots Fruit?
Hi her in 44568

6.07 Cell Wall yes

2.64 Misc no

2.62 JA yes
Stress
2.51 Response yes
Stress
2.27 Response yes
Stress
2.13 Response no

2.1 Photosynthesis yes

2.04 GA no

Stress
1.94 Response yes


Higher in MD
nectarin 1 precursor-Q95PVS
RF-8-G09 tobacco 53 3.78 Nectary/Defense no
lipoxygenase- CAA58859
PP-14-B10 tobacco 84 2.5 JA yes
PP-13-B12 beta xylosidase- BAD98523 pear 60 2.38 Cell Wall yes
late embryogenesis protein
C2H2-1-B09 LEA5- AAC06242 tobacco 70 2.28 Seed storage yes
sucrose synthase- AAA97571
PP-18-H07 potato 97 2.08 Seed storage yes
Stress
PP-19-F12 phi-1- BAA33810 tobacco 92 2.01 Response no















Table 4-3 RT-PCR confirmation of microarray differentially regulated clones. Whole fruit tissue is examined at 20 and 25 DAP in
MD and 20, 25, and 30 DAP in 44568. Stars designate lanes that are compared in the array. Larger stars are the proposed
higher expressed tissue from the microarray data. A short description is also given of the gene function.



Higher in Array Data-
Lower in Array Data X

Higher in 44568 25 DAP
vs. MD 25 DAP Ladder 20 25 20 25 30


OEE1: part of oxygen evolving complex of PSII mutant in Chlamydomonas is
Oxygen evolving enhancer deficient in photosynthetic oxygen evolution; been shown to be involved in salt
protein (30) tolerance of Mangrove

Expansin-Related (AtEXPR1)- different from family of four expansion genes in
Arabidopsis, therefore deemed Expansin-related; expansins are involved in cell wall
Expansin (25) loosening-allowing for cell expansion (Chen et al., 2001).


glutathione S-transferase- detox ofherbicides; oxidative stress response;
Glutathione S-transferase induced by Aluminum treatment; auxin responsive-binds auxin; involved in cell
(28) proliferation (Gronwald and Plaisance, 1998).

Myb 305 Myb305 is specifically expressed in flowers of Antirrhinum and can
activate transcription from a conserved motif in the promoters of genes encoding the
first enzyme of phenylpropanoid metabolism, phenylalanine ammonia-lyase (PAL)
Myb 305 (32) (Jackson et al., 1991; Sablowski et al., 1994, 1995).

Ent-Kaurene oxidase- GA synthesis enzyme; first committed step of GA
biosynthesis-catalyzes the three steps of gibberellin biosynthesis from ent-
kaurene to ent-kaurenoic acid; can be a target of negative feedback inhibition
Ent-Kaurene Oxidase (25) 1 (Hedden and Kami"- 107


FBP24 (32)


FBP24- MADS Box transcription factor; Homologous to ABS in Arabidopsis-
mutant results in colorless seed TT16/ABS is likely to be involved in the control of
endothelium development; BANYULS is not activated in the mutant therefore
proanthocyanidins do not accumulate in the endothelium (Nesi et al, 2002).















Table 4-3 cont.
Higher in 44568 30 DAP
vs. MD 25 DAP Ladder 20 25 20 25 30



Beta Carotene hydroxvlase- oxygenated carotenoids (xanthophylls) with 2
Beta-Carotene Hydroxylase hydroxylation steps by this enzyme convert beta-carotene to cryptoxanthin and then
(29) to zeaxanthin


RPT2- light inducible- role in early phototropic signaling; necessary for root
phototropism; part of NPH3 family (large family); involved in stomatal
opening;encodes a novel protein with putative phosphorylation sites, a nuclear
RPT2 (29) localization signal, a BTB/POZ domain, and a coiled-coil domain
Higher in MD 25 DAP vs. Ladder 20 25 20 25 30
ETR 25 DAP


ADH3- Most research focuses on adh role in hypoxia because it carries out the
terminal electron transfer in anaerobic glycolysis; might have other roles- expressed
Alcohol dehydrogenase in maternal anther tissues, stigma, petals, and hypoxic root in Petunia (Garabagi and
(25) Strommer, 2004).
Seed Imbibition- dinl0 (dark-inducedlO) upregulation starts as early as 3 hours in

hexokinase- similar to what it seen with the glyoxylate cycle genes; transcripts also in
imbibed seeds; has 37% identity with stachyose synthase and raffinose synthase-
enzymes involved in metabolism of raffinose family oligosaccharides- RFO has a
role in dessication tolerance, cold tolerance, C storage therefore dinl0 might play a
role in the metabolism of RFO in sink leaves caused by cessation of photosynthesis
Seed Imbibition (30) (Fujiki et al., 2001).















Table 4-3 cont.


Seed Maturation (21)


LEA4-LEA proteins are highly accumulated in the embryos at the late stage of seed
development; In many cases, the timing of LEA mRNA and protein accumulation is
correlated with the seed-desiccation process and associated with elevated in vivo
ABA levels. The products of these genes are thought to function in protecting cells
from dehydration (Baker et al., 1988; Dure et al., 1989


Beta Xylosidase- secondary cell wall metabolism and plant development;
metabolism of xyloglucans in the cellulose microfibril network is believed to be
important for cell wall expansion; reduced expression of BXL1 resulted in smaller
Beta-Xylosidase (25) RMsiliques with less seeds (Goujon et al, 2003).
RF-1-H08/LEA D-29; LEA proteins are highly accumulated in the embryos at the
late stage of seed development; In many cases, the timing of LEA mRNA and protein
accumulation is correlated with the seed-desiccation process and associated with
Late Embryonic Abundant elevated in vivo ABA levels. The products of these genes are thought to function in
Protein (21) protecting cells from dehydration (Baker et al., 1988; Dure et al., 1989),
4-hydroxypheylpyruvate dioxygenase (25) catalyzes the formation of
homogentisate (2,5-dihydroxyphenylacetate) from p-hydroxyphenylpyruvate and
molecular oxygen; homogentisate, is the aromatic precursor of all plastoquinones and
4-hydroxypheylpyruvate tocopherols, essential elements of the photosynthetic electron transport chain and of
dioxygenase (25) the antioxidative systems, respectively
Higher in MD 25 DAP vs.
ETR30 DAP Ladder 20 25 20 25 30


Dehydration-Induced
Protein (27) 1I


Ubiauitin


Dehydration Induced Protein (RD22 like) ABA inducible- rd22 expression was
blocked in srk2e mutant which is required to control induction of ABA responsive
genes; also induced by salt stress but not temp stress; expression found in early and
middle stages of seed development (Yu et al., 2004)

Pectinerase-like protein- catalyse the demethylation of pectin therefore structural
interactions among cell wall components during cell wall turnover and loosening are
affected; several pectinerase genes have been found to be involved in fruit ripening
and senescence; ethylene reduced EXP1 in strawberry


Pectinerase-like Protein












B. Dehydration Induced Protein


MD/MxE


MD/MxEI
- /U-,: ~n


B. Seed Imbibition C. Seed Maturation (LEA)
20 22 24 26 28 30 20 22 24 26 28 30 20 22 24 26 28 30 20 22 24 26 28 30




MD/MxE MD/MxE
ETR/ExM




ETR/ExM



D. Ubiquitin Control
20 22 24 26 28 30 20 22 24 26 28 30



MD/MxE




ETR/ExM


Figure 4-1 Extended RT-PCR expression analysis of microarray differentially regulated
clones. Seed tissue was analyzed at 20, 22, 24, 26, 28, and 30 days after
pollination in all genotypes.


A. Expansin









dihydroflavonol reductase-like gene (DFR-like) (Xie et al., 2003) (Figure 4-4).

Expression analysis of genes encoding the more upstream enzymes, flavonol 3'

hydroxlase and dihydroflavonol reductase, was conducted for all genotypes. Flavonol

3'hydroxylase did not exhibit many differences in expression between the genotypes

except for a slight delay in induction in the 44568 and ExM genotypes. Expression of

flavonol 3'hydroxylase was lower in 44568 and ExM seed tissue at 20 days after

pollination and increased at 22 days after pollination through 30 days after pollination.

Expression was consistently high in MD and MxE seed tissue from 20 days through 26

days after pollination (Figure 4-4 A). DFR expression was slightly different than the rest

of the results because expression decreased in 44568 and ExM genotypes compared to

the other two genotypes. mRNA expression was very low at 20 days after pollination in

44568 and ExM seed tissue. Expression slowly increased in these two genotypes until 24

days after pollination but decreased dramatically after 24 days after pollination until seed

maturity at 30 days after pollination. Expression of DFR was consistent in MD and MxE

seed tissue from 20 days after pollination through seed maturity at 26 days after

pollination (Figure 4-4 B).

Examination of RT-PCR analysis of seed tissue from 44568, MD, and the

reciprocal crosses was also conducted on genes involved in the downstream portion of

the condensed tannin pathway, DFR-like and FBP24. mRNA expression of FBP24

appeared to be similar in all genotypes throughout the seed developmental series. mRNA

expression appeared to decrease slightly in MD and MxE at 26 days after pollination

compared to expression in 44568 and ExM (Figure 4-4 C). This decrease in not

significant; therefore, it is not definitive whether there are expression differences between









any of genotypes. There did not appear to be any major differences in mRNA expression

of the DFR-like gene in any of the genotypes. Expression remained constant from 20

days after pollination through seed maturity in all genotypes (Figure 4-4 D).

An experiment was conducted to stain for condensed tannins in all genotypes of

seeds with vanillin, which under acidic conditions, turns red upon binding to flavan-3,4-

diols (leucoanthocyanidins) and flavan-3-ol (catechins), which are present as monomers

or as terminal subunits of proanthocyanidins (Aastrup et al., 1984; Deshpande et al.,

1986). (Figure 4-5). Seeds of all genotypes were stained at fresh harvest and after 1-

month of after ripening, the time-points when seed color differences were observed in

44568 and ExM compared to MD and MxE. This is also the time period when most of

the major differences in germination between the genotypes occurred in previous

experiments focused on germination after different storage periods (Figure 3-8). After

staining with 1% vanillin, the seeds in all genotypes were still dark brown in color. No

dramatic red staining was seen in any of the genotypes at fresh harvest or after one month

of storage (Figure 4-5).

Discussion

Microarray Analysis

Microarray analysis was used in this research as a tool to screen for differentially

regulated genes between MD and 44568 fruit and seed tissue at 25 days after pollination,

the time-point when these two tissues are visually dramatically different. MD fruit at this

time-point are fully ripened, completely brown, and dehiscing the mature seeds.

Conversely, 44568 fruit are still completely green at this time-point in development and

do not ripen fully until 30 days after pollination. Additionally, at 25 days after










pollination the seeds of MD are mature and viable, whereas 44568 seeds are still

immature and are not capable of germination.

Several of the differentially regulated genes from the results of the whole fruit and

maternal tissue microarray experiments are likely related to the developmental delay of

44568 fruit and seed tissue (Chapter 3). For example, the gene with the highest

expression in 44568 whole fruit compared to MD whole fruit at 25 DAP was an expansion.

Expansins are involved in the extension of cell walls during the time of rapid growth by

disrupting non-covalent linkages (Chen et al., 2000). Several expansins in tomato have

been shown to be expressed during both fruit and seed development (Brummell et al.,

1999). One tomato expansion, LeEXP10, was shown to have expression during the earlier

CHS CHI
4-coumatay-CA A Narngesnn -I Ningenln
F M chalonel m
3Xmalknyl-aA F3H 6


FLS1
Flan ols -- DIhydraflavonols

(W 92, aS. tI)
LAR ?
2,3-tranr- ivan-3-oel -..... Leucanrthocyanldlns
r ... LDOX| I8


.3-0ts-flravmap-3ss AnitocyandlIns
ban
(#, rreng alp (ff2, 1B Ntg1, ffiB)
MATE lbariportir Ar'hcyanlns
vacuoar ?
CE

(cotorleae)
FPO? I daons
POD?
Prothocyankdln dert1vatuve
(bron) (Debeaujon et al., 2003)

Figure 4-2 Highlighted proanthocyanidin synthesis genes observed through RT-PCR
expression analysis in all genotypes.



















Figure 4-3 Seed pictures of 44568 and MD. (44568 left; MD right) A. Fresh seed B.
1-month old seed C. 1 year old seed

stages of seed development and decreased expression during the maturation and dry-

down phase of seed development (Chen et al., 2000). It is likely that the 44568 tissue had

higher expression of the expansion gene due to the fact that at 25 DAP the 44568 fruit and

seeds are still developing and have not reached the maturation phase; therefore, the cells

are continuing to expand in 44568 tissue, whereas the MD fruit and seed tissue are in the

maturation and desiccation phase of development.

A more detailed expression analysis, with all genotypes including reciprocal

crosses, was conducted in a late seed developmental time series to see if seed tissue alone

had altered expansion gene expression and also to see if any maternal regulation was

apparent in the seed tissue gene expression (Figure 4-1). Indeed, the seeds at the

beginning of the 44568 and ExM time-course series had higher expansion mRNA

expression levels than wild-type and MxE. The latter two genotypes continued through

development more rapidly; therefore, expression of expansion mRNA had already

declined by 20 days after pollination. The 44568 and ExM seeds were less developed;

therefore, expansion mRNA expression did not begin to decline in these tissues until 24

days after pollination (Figure 4-1 A).












A. F3' B. DF


MD/MxE




ETR/ExI\


MD/MxE


C. FBP24 D. DFR-like
20 22 24 26 28 30 20 22 24 26 28 30 20 22 24 262830 2022 2426 2830










E. Ubiuitin Control
E. Ubiquitin Control


MD/MxE




ETR/ExM


Figure 4-4 RT-PCR mRNA expression analysis of genes involved in the
proanthocyanidin synthesis pathway. Seed tissue was analyzed at 20, 22, 24,
and 26 days after pollination (mature seeds) in MD and MxE and 20, 22, 24,
26, 28, and 30 days after pollination (mature seeds) in ETR and ExM.


A. F3'H


B. DFR












FRESH SEED 1 MONTH OLD SEED










MD










ETR










MxE










ExM
Figure 4-5 Freshly harvested and 1 month old seeds of all genotypes stained with 1%
vanillin to detect presence of flavan-3,4-diols (leucoanthocyanidins) and
flavan-3-ol (catechins).









A gene that was more highly expressed in MD tissue than in 44568 at 25 DAP in

the array experiments encodes a seed maturation protein, known as a late embryonic

abundant protein (LEA). Accumulation of these proteins occurs at late stages of seed

development in Arabidopsis (Baker et al., 1988). These genes are known to be expressed

during the desiccation phase of seed development and are thought to help protect the seed

from extreme dehydration, though their exact mechanism of action is not known (Dure et

al., 1989; Koorneef et al., 2002; Brocard et al., 2003). One explanation for this gene

being expressed more in MD tissue than 44568 tissue at 25 DAP is that the MD seeds are

at the last phase of development when desiccation is occurring, and the LEA proteins are

thought to protect the seeds from further damage from the dehydration. 44568 seeds are

not at this point in development at 25 DAP, so expression of these genes is at

significantly lower levels than MD (Figure 4-1). The expression was similar in 44568

and ExM ( x o) genotypes which are the two genotypes with delayed seed development.

This expression difference further confirms the developmental delay of the fruit and seed

tissue in 44568 and ExM genotypes (Chapter 3).

Another gene with differential regulation discovered in the microarray results was a

gene that showed homology to beta-xylosidase. mRNA expression was confirmed to be

higher in MD fruit tissue at 25 days after pollination compared to 44568 tissue through

RT-PCR analysis (Table 4-3). Beta-xylosidase is involved in the metabolism of

xyloglucans within the secondary cell wall in plant tissue (Goujon et al., 2003). MD fruit

tissue is completely ripe at this time-point in development; therefore, expression of this

gene may be higher because of breakdown of fruit tissue during the ripening process.









Expression would be expected to be lower in 44568 fruit tissue since the ripening

processes have not begun at this time-point in development.

A seed imbibition gene was also more highly expressed in MD whole fruit tissue

than 44568 at 25 days after pollination in the array results. The Arabidopsis seed

imbibition gene is known as dinl0 (dark-induced 10) and was given the name seed

imbibition because expression was found in imbibed seeds (Fujiki et al., 2001). dinIO

mRNA is up-regulated in the dark, but this dark-induced expression is suppressed by

sucrose application. These genes have some identity (37%) to genes that encode

enzymes involved in the metabolism of the raffinose family oligosaccharides, which play

a role in protecting plant tissue during desiccation and cold tolerance (Fujiki et al., 2001).

Although this gene has only been minimally studied in seed development, it is possible

that, since it shows homology to the enzymes involved in the metabolism of raffinose

oligosaccharides, it is induced during the latter stages of development to help protect the

seeds from stress during the desiccation process. The fact that MD seeds begin to

desiccate before 44568 seeds would explain the differential regulation of this gene at 25

days after pollination.

The last gene that was studied in the detailed mRNA expression analysis was a

gene that showed homology to a dehydration induced protein. When expression was

examined in the 44568, MD and reciprocal cross late seed tissue series, the results

determined that mRNA expression decreased in 44568 and ExM seeds at 30 DAP (Figure

4-1). This decrease in expression was not seen at seed maturity, 26 days after pollination,

in MD and MxE seed tissue. The dehydration induced gene was initially isolated in

Arabidopsis as a result of observations of increased expression in drought conditions









(Yamaguchi-Shinozaki and Shinozaki, 1993). If this gene was discovered due to

induction of expression in tissues in dry conditions, it may be induced during dessication

phases of seed development. Expression may be affected in 44568 and ExM seeds if the

seeds of these two genotypes do not dry down properly. Improper dessication of these

seeds may be affecting the severity of the dormancy induction within these seeds, which

would help explain the reduced germination seen in freshly harvested 44568 seeds

(Chapter 3).

Several other genes involved in various plant processes were discovered to have

differential regulation of expression between 44568 and MD fruit tissue from the

microarray experiment results. A gene that showed homology to an ent-kaurene oxidase

gene, involved in the first committed step of gibberellin biosynthesis (Hedden and

Kamiya, 1997), was differentially regulated in maternal tissue experiments. Expression

was checked in whole fruit tissue, and ent-kaurene oxidase mRNA was shown to be more

predominant in the 44568 tissue at 25 DAP (Table 4-3). This gene has been shown to be

involved in an important step in the production of active gibberellins (Sun and Kamiya,

1994; Yamaguchi et al., 1998). In experiments with etrl-2 seeds in Arabidopsis elevated

levels of gibberellins were observed, possibly to compensate for the increased sensitivity

and/or elevated levels ofABA (Chiwocha et al., 2005). Therefore, it is likely that levels

of gibberellins are also increased in petunia etrl-1 seeds, which would account for the

higher expression in the 44568 tissue.

Condensed Tannin Analysis

Two genes that exhibited differential regulation in the microarray experiments were

both involved in a secondary metabolism pathway involving anthocyanins. The first

gene discovered in the microarray experiments showed homology to a myb transcription









factor that has been shown to activate transcription of a gene encoding phenylalanine

lyase, an enzyme involved in the phenylpropanoid metabolism (Sablowski et al., 1994,

1995). mRNA expression was more highly expressed in 44568 tissue at 25 days after

pollination (Table 4-3). The other gene with differential expression in the array results

was FBP24, a transcription factor involved in proanthocyanidin synthesis (Nesi et al.,

2002). FBP24 had higher expression in 44568 whole fruit tissue compared to MD whole

fruit tissue. Additionally, seed color was altered in seeds freshly harvested from the

44568 and ExM genotypes. This visual difference and the discovery of expression

differences from the microarray results, it was thought that the presence of the etri-1

transgene may be affecting the levels of condensed tannins in these genes.

RT-PCR analysis of genes encoding enzymes involved in the condensed tannin

synthesis pathway produced various results. Expression of genes involved in the

upstream portions of the synthesis pathway exhibited more dramatic differences than

genes more downstream in the synthesis pathway. Expression of dihydroflavonol

reductase exhibited the most dramatic differences between the genotypes. Expression of

DFR was reduced in the genotypes produced on the 44568 maternal plants but stayed

constant in MD and MxE. A delay of induction of mRNA expression of flavonol

3'hydroxylase was also observed in the genotypes produced on the 44568 maternal

parent. A delay in induction may be attributed to the delay in seed development of these

two genotypes. Expression of the genes involved in the latter portions of the condensed

tannin synthesis pathway, dihydroflavonol reductase-like and FBP24, did not exhibit

considerable differences in expression between any of the genotypes. These expression

differences observed in genes involved in the proanthocyanin synthesis pathway illustrate









that it is possible that the reduction in ethylene sensitivity of seeds produced on a 44568

maternal parent may have impact on proanthocyanidin levels in the seeds, especially

since color differences are seen in these seeds, although it is difficult to determine

whether levels are increased or decreased in these seeds without quantitative

measurements.

Another approach was taken in order to determine if condensed tannin levels were

altered in any of the genotypes containing the etrl-1 transgene. A vanillin stain was used

due to the fact that the vanillin turns red upon binding to flavan-3,4-diols

(leucoanthocyanidins) and flavan-3-ol (catechins). This assay is used commonly with

transparent test mutants of Arabidopsis, which are reduced in levels of condensed

tannins (Debeaujon et al., 2000, 2001; Nesi et al., 2002). Red staining was not observed

in any of the genotypes of seeds at fresh harvest or after one month of storage. The dark

brown nature of petunia seeds may not make it possible to stain with vanillin, since this

stain is typically used on colorless mutant seeds (Debeaujon et al., 2000, 2001).

Another possible explanation of the color differences seen in the 44568 seeds

compared to MD seeds is that the levels of condensed tannins are not altered but the rate

of oxidation of the tannins is affected due to the reduction in ethylene sensitivity. The

oxidation of the tannins contributes to the brown color in Arabidopsis seeds (Debeaujon

et al., 2001); therefore, this could account for the color differences seen in 44568 and

ExM seeds if levels of condensed tannin are not different from MD and MxE. 44568

seeds are lighter in color at fresh harvest compared to MD seeds, but they do become

darker in color through storage. Additionally, seeds at fresh harvest have reduced

germination, whereas the darker seeds germinate at higher rates after increased storage









periods (Chapter 3). The oxidation of tannins may help increase the permeability of the

seed coat and allow for imbibition of water, initiating the germination processes. If

44568 seeds are slow to oxidize the tannins, the permeability of the seed coat may be

decreased for a longer period of time, contributing to the delayed germination capability.

Conclusion

Several of the differentially regulated genes isolated through microarray analysis

exhibited mRNA expression pattern differences between 44568 and MD due to the

developmental delay of 44568 seeds. Genes involved in cell structure and expansion,

such as expansins were expressed more in 44568 tissue over MD at 25 DAP. Genes

involved in seed storage protein accumulation, such as LEA proteins, were more

abundantly expressed in MD tissue than 44568 tissue at 25 DAP. These gene expression

differences further confirm that 44568 fruit and seed tissue are developmentally delayed

compared to MD at 25 DAP.

Also, some potentially interesting genes, such as the gene that encodes a

dehydration induced protein, were identified which may further explain ethylene's role in

the late maturation and desiccation phase of seed development and the subsequent

initiation of seed dormancy. The putative dehydration-induced gene had reduced

expression in 44568 seeds at maturity compared to MD seeds, which could lead to the

conclusion that the 44568 seeds do not dry down properly. This might affect the switch

from developmental processes to germination signals; therefore, affecting the strength of

dormancy that is induced in the 44568 seeds.

The experiments that were developed around condensed tannins, due to FBP24

and a myb transcription factor being expressed more in 44568 fruit than MD fruit in the

microarray experiments, did not definitively confirm that tannin content was altered in









the seed coats of 44568 compared to MD seeds. One gene involved in the synthesis

pathway, dihydrol-flavonol reductase (DFR) showed a reduction in expression in the

44568 and ExM compared to MD and MxE. A reduction in seed coat tannins would

parallel the lighter seed coat tissue seen in 44568 seeds at fresh harvest, but would not

explain the stronger induction of dormancy in these seeds since condensed tannins are

thought to contribute to increased dormancy. The rate of oxidation of the condensed

tannins in these seeds could be affected due to the fact the seeds become darker in color

over time. Further investigation into this pathway in petunia, such as identifying the

genes involved in the oxidation process, and the resulting quantitative levels of tannins

would need to be conducted in order to come to any final conclusions on whether tannin

content is affected in the phenotypes reduced in ethylene sensitivity.




















MD
A. 5 10 15 20


APPENDIX
ABI3 ANALYSIS AND MICROARRAY DATA


ETR


K


Figure A-1. RT-PCR analysis of PhABI3. Lanes are following: Ladder, MD 5, MD 10,
MD 15, MD 20, MD 25, MD 30, ETR 5, ETR 10, ETR 15, ETR 20, ETR 25,
ETR 30, ETR 35 Whole Fruit tissue. A. Expression of PhABI3 B.
Ubiquitin-Control
















Figure A-2. ABI3 Southern Analysis. Single distinct banding pattern of genomic DNA
probed with PhABI3 illustrates that ABI3 is a single copy gene in Petunia x
hybrida. Lanes are in following order: ladder, BamHI, EcoRI, HindIV,
empty lane, BamHI, EcoRI, HindIV (repeat of first three enzyme lanes).











Table A-1. cDNA library clones included on microarray chip experiments. YF= Young
Fruit library, RF= Ripe Fruit library, PP= Post Pollination library, C2H4=
Ethylene Treated Flowers library.


Petunia Plate Description Accession #
YF-1RCA
A07 polymorphic antigen p450 CV299386
A08 aquaporin TIP7 CV299387
B04 F-actin binding protein CV299394
B09 NEC1 CV299399
C10 MAR-binding protein CV299411
D09 40S ribosomal protein CV299421
D10 60S ribosomal protein CV299422
D11 oxygen evolving enhancer protein CV299423
E01 probable phenylalanyl tRNAs CV299424
Ell glutathione S-transferase CV299425
G10 glucose-6-phosphate CV299452
H02 probable lipoxygenase CV299456
YF-2
A10 myb-related protein 305 CV299475
C10 glucose acyltransferase CV299498
D01 S locus F box S2 ligase CV299500
D03 putative glucosyltransferase CV299502
D05 beta-alanine synthase CV299504
D12 annexin CV299511
E03 Superoxide dismutase CV299514
E09 cytosolic aconitase CV299520
F02 ripening related protein CV299524
F12 eIF4E CV299533
G07 Gipl-like protein CV299540
H04 ferritin CV299547
H11 NT4 CV299554
H12 Myb oncoprotein homolog CV299555
YF-3R
A02 glutamine synthetase CV299557
B07 betaine-aldehyde dehydrogenase CV299574
Bll extensin-tomato CV299578
C05 PKF1 CV299583
E01 Glyceradlehyde 3-phosphate CV299602
E06 MADS box transcription factor CV299607
F02 Bax inhibitor 1 CV299614
F07 ent-kaurene oxidase CV299619
G01 NTGP1 CV299624
H03 MADS box transcription factor CV299636
YF-4R
A05 GDSL-motif lipase/hydroxylase CV299727
B01 Glyceradlehyde 3-phosphate CV299734
B06 MADS box transcription factor CV299739
B10 cysteine protease CV299743











Table A-1. Continued
B12 polygalacturonase inhibitor CV299744
C06 Ca2+ dependent lipid binding proteins CV299750
C12 cell division cycle protein CV299756
G10 caffeoyl CoA 0 methyltransferase CV299800
H05 ABC transporter CV299805
H06 ferritin CV299806
YF-5
A06 alcohol dehydrogenase class CV299649
B01 receptor histidine kinase CV299654
B04 Pyruvate kinase isozyme CV299657
C05 IAA amidohydrolase CV299666
C10 lipid transfer protein CV299671
D04 1,4 benzoquinone reductase CV299675
D06 ACC carboxylase CV299677
E05 putative isoamylase CV299687
Ell J1P CV299691
H03 lycopene cyclase CV299715
H06 alcohol dehydrogenase like CV299718
YF-5A
All beta cyanoalanine synthase CV299821
C12 HR7 CV299841
F06 carotenoid 9,10- 9', 10' cleavage dioxygenase CV299869
G03 putative transcription factor CV299877
H03 transcription factor like CV299889
H07 putative lipoxygenase CV299892
YF-6
C06 ubiquitin conjugating enzyme CV299925
D01 14-3-3 protein CV299929
E03 AER- Nicotiana CV299942
E05 bifunctional dihydrofolate CV299944
E09 glutamate decarboxylase CV299947
F02 peroxidase CV299952
F03 floral defensin like protein CV299953
H10 14-3-3 protein CV299983
Bl1 putative UDP-glucose CV299918
YF-7
D04 Aminoacylase-1 CV300021
E08 putative beta alanine pyruvate CV300036
Fll putative cytochrome p450 CV300051
G04 putative bHLH transcription factor CV300055
G08 14-3-3 isoform CV300059
YF-8
A08 ethylene response factor 3 CV300081
D10 transcription factor B3 family CV300118
D11 light inducible protein CV300119
D12 UTP: alpha-D-glucose-1-phosphate CV300120
E03 glycine hydroxymethyltransferase CV300123
F01 bZIP transcription factor CV300132