<%BANNER%>

Molecular Characterization of the Population Diversity of Selected Isolates and Subisolates of Citrus tristeza virus (CT...


PAGE 1

MOLECULAR CHARACTERIZATION OF THE POPULATION DIVERSITY OF SELECTED ISOLATES AND SUBISOLATES OF Citrus tristeza virus (CTV) FROM FLORIDA By AMANDEEP SINGH KAHLON A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Amandeep Singh Kahlon

PAGE 3

To my parents, family and friends.

PAGE 4

iv ACKNOWLEDGMENTS I would like to express my heart-felt appreciation to my advisor, Dr. Ronald H. Brlansky, for giving me the opportunity to jo in this graduate program and for the financial support throughout the program. I extend my appreciation to Dr. Richard Lee, Dr. Susan Webb and Dr. Manjunath Keremane members of my committee, for their valuable suggestions regarding my experiment s, during formal and informal discussions. I want to specially thank Dr. Manjunath Keremane for his encouragement and help throughout my research Further, I would specially like to thank Ms. Deborah Howd for taking care of the plants and for her help with the ELISA and aphid tranmissions. I am thankful to my friends and colleagues in our laboratory who have been supportive and always helpful during my entire program: Dr. Avijit Roy, Dr .Amer Fayad, Dr. Kajal Biswas, Abby, and Alana. I would like to thank Neil for helping me with the grafting and taking care of the plants. I am very thankful to my friends for thei r help and although the lis t of is too long to include them all here, I would like to men tion a few: Davinder, Chitvan, Hardev, Mandy, Nandha, JP, Ruby, Nagra, Gagan, Andy, Adriana, Alana, Aaron, Bo, Moyi, Jason, Myrian I am grateful to Si mran for her love and support. Finally I would like to thank my parent s for their continued encouragement and support. Above all, I would lik e to thank Waheguru for always helping me to achieve my goals.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES...........................................................................................................ix ABSTRACT....................................................................................................................... xi CHAPTER 1 LITERATURE REVIEW: Citrus tristeza virus ...........................................................1 Taxonomy.....................................................................................................................1 Morphological Characteristics......................................................................................2 Inclusion Bodies...........................................................................................................2 Historic Perspective and Economic Importance...........................................................2 Host Range....................................................................................................................4 Symptoms.....................................................................................................................4 Transmission.................................................................................................................5 Molecular Studies.........................................................................................................6 Genome Organization............................................................................................6 Replication of CTV...............................................................................................6 Defective RNAs Associated..................................................................................7 CTV Gene Expression Strategies.................................................................................7 Polyprotein Processing and Translational Frameshift...........................................7 Subgenomic RNAs................................................................................................8 Population Structure an d Genetic Diversity.................................................................8 Methods of Detection.................................................................................................11 Tristeza Disease Management....................................................................................14 2 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND SUBISOLATES BY USING MULT IPLE MOLECULAR MARKERS...................16 Introduction.................................................................................................................16 Material and Methods.................................................................................................19 Virus Isolates.......................................................................................................19 Genotyping of CTV Isolates................................................................................21

PAGE 6

vi RNA Isolation and Group Comple mentary DNA (cDNA) Synthesis.................21 Polymerase Chain Reaction (PCR).....................................................................22 Results........................................................................................................................ .22 Isolate: CL...........................................................................................................23 Isolate: M2A........................................................................................................24 Isolate: T68..........................................................................................................24 Discussion...................................................................................................................33 3 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND SUBISOLATES BY USING HETERO DUPLEX MOBILITY ASSAY...................37 Introduction.................................................................................................................37 Material and Methods.................................................................................................42 Virus Isolates.......................................................................................................42 RNA Isolation and Complementary DNA (cDNA) Synthesis............................43 Polymerase Chain Reaction (PCR).....................................................................44 DNA Purification, Cloning and Transformation.................................................44 Colony PCR and Heteroduplex Mobility Assay (HMA)....................................45 Sequencing and Sequence Analysis....................................................................47 Results........................................................................................................................ .47 Isolate: CL...........................................................................................................48 Isolate: M2A........................................................................................................50 Isolate: T68..........................................................................................................53 Discussion...................................................................................................................72 4 GENERAL CONCLUSIONS.....................................................................................75 LIST OF REFERENCES...................................................................................................77 BIOGRAPHICAL SKETCH.............................................................................................85

PAGE 7

vii LIST OF TABLES Table page 2.1 Sequence of genotype specific-oligonuc leotide primers (Hilf and Garnsey, 2000) and two universal primer pairs(*) used for the RT-PCR amplification of CTV Molecular Markers...................................................................................................26 2.2 Genotype profiles of Chiefland (CL) Mcn2a (M2A) and T68 isolate from Florida, created by RT-PCR amplificati on of three general and ten genotypespecific markers........................................................................................................27 2.2 Summary of the results of multiple molecular marker (MMM) of Chiefland (CL), Mcn2a (M2A) and T68 source isolates and the graft/aphid transmitted subisolates from Florida...........................................................................................33 3.1 The comparison of nucleotide sequence identities of the di fferent genotypes from the CL isolate, CL-G(GF) and CL-G(ML) subisolates, obtained after heteroduplex analysis (H MA) of the 403 bp amplicon from ORF 1a of CTV genome.....................................................................................................................57 3.2 The comparison of nucleotide sequence identities of the di fferent genotypes from the M2A isolate, M2A-G(ML) and M2A-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome............................................................................................................58 3.3 The comparison of nucleotide sequence identities of the di fferent genotypes from the T68 isolate, T68-G(GF), T 68-G(ML) and T68-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome...................................................................................................59 3.4 The comparison of nucleotide sequence identities of the di fferent genotypes from the T68 isolate, T68-A(GF), T 68-A(ML) and T68-A(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome...................................................................................................60 3.5 The summary of the different genotypes from the CL isolate, CL-G(GF), CLG(ML) and CL-G(SW) subisolates, obtai ned after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome...........................................69

PAGE 8

viii 3.6 The summary of the different genotypes from the M2A isolate, M2A-G(GF), M2A-G(ML) and M2A-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon fr om ORF 1a of CTV genome..............................69 3.7 The summary of the different genotypes from the T68 isolate, graft transmitted subisolates [T68-G(GF), T68-G(ML) and T68-G(SW)] and aphid transmitted subisolates [T68-A(GF) and T68-A(SW)]...............................................................70 3.8 The description of different genotyp es from the CL, M2A and T68 source isolates and the graft / aphid transmitted subisolates, obtained after heteroduplex analysis (HMA)........................................................................................................71

PAGE 9

ix LIST OF FIGURES Figure page 2.1 Schematic diagram of Citrus tristeza virus genome indica ting different ORFs and approximate portions of the genome amplified with genotype specific molecular markers by Hilf et al, 2000......................................................................28 2.2 Multiple molecular marker (MMM) profiles of Chiefland isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers........................................................................................................29 2.3 Multiple molecular marker (MMM) prof iles of Mcn2a isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers........................................................................................................30 2.4 Multiple molecular marker (MMM) profiles of T68 isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers........................................................................................................31 2.5 Multiple molecular marker (MMM) profiles of the T68 source isolate and aphid transmitted subisolates of T68, creat ed by PCR amplification by using sequencespecific primers........................................................................................32 3.1 Ethidium-bromide stained 10% polyacr ylamide gels showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate CL and CL-G(GF) and CL-G(ML) subisolates............................................61 3.2 Ethidium-bromide stained 10% polyacr ylamide gels showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate M2A and M2A-G(ML) and M2A-G(SW) subisolates.................................62 3.3 Ethidium-bromide stained 10% polyacr ylamide gels showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate T68 and T68-G(GF), T68-G( ML) and T68-G(SW) subisolates...................63

PAGE 10

x 3.4 Ethidium-bromide stained 10% polyacr ylamide gels showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate T68 and T68-A(GF) a nd T68-A(SW) subisolates........................................64 3.5 Phylogenetic tree showing genetic rela tionships of the genotypes of CL CTV isolate, CL-G(GF) and CL-G(ML) s ubisolates obtained after heteroduplex analysis (HMA)........................................................................................................65 3.6 Phylogenetic tree showing genetic rela tionships of the genotypes of M2A CTV isolate, M2A-G(ML) and M2A-G(SW) subi solates obtained after heteroduplex analysis (HMA)........................................................................................................66 3.7 Phylogenetic tree showing genetic rela tionships of the genotypes of T68 CTV isolate, T68-G(ML), T68-G(ML) and T68-G(SW) subisolates obtained after heteroduplex analysis (HMA)..................................................................................67 3.8 Phylogenetic tree showing genetic rela tionships of the genotypes of T68 CTV isolate, T68-A(ML), T68-A(ML) and T68-A(SW) subisolates obtained after heteroduplex analysis (HMA)..................................................................................68

PAGE 11

xi Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Master of Science MOLECULAR CHARACTERIZATION OF THE POPULATION DIVERSITY OF SELECTED ISOLATES AND SUBISOLATES OF CITRUS TRISTEZA VIRUS (CTV) FROM FLORIDA By Amandeep Singh Kahlon August 2005 Chair: Ronald Brlansky Major Department: Plant Pathology Citrus tristeza virus (CTV) is the most important vi rus affecting citrus worldwide. CTV symptoms range from symptomless or mild to death of trees on sour orange rootstock and/or stem pitting (SP) in citrus trees irrespective of rootstocks. Eradication of CTV is difficult especially in areas where the efficient vector, Toxoptera citricida (Kirkaldy), is already present. The estimation of the amount of genetic di versity for CTV has not yet been clearly understood. Field isolates of CT V contain mixtures of genotyp es which can be separated by aphid transmission and/or graf t transmission to different hosts In previous studies, the aphid-transmitted and the graft-transmitted subisolates have been reported to differ from the source isolate in their serological and biological properties. This study was undertaken to conduct the molecular characte rization of selected CTV isolates from Florida and to study the effect of graft and aphid transmission on the biology and population diversity.

PAGE 12

xii Three CTV isolates from Florida, Chie fland (CL), Mcn2a (M2A) and T68, were used as source isolates and were maintain ed in Madam vinous sweet orange. The grafttransmitted subisolates were obtained by bud graf ting each of the source isolates to three different hosts: grapefruit, Mexican lime and sweet orange. The aphid-transmitted subisolates were obtained from the T68 source isolate and the graft-transmitted subisolates using T. citricida (Kirkaldy) as the vector. The population diversity was analyzed by using multiple molecular marker analysis (MMM) and heteroduplex mobility assay (HMA). The MMM method is based on the RT-PCR am plification of sequence specific PCR products with sets of primers derived fr om the analogous site s within the genomes of T3, T30, T36 and VT isolates. Each of th e three source isolates and their graftand aphid-transmitted subisolates was found to be mixtures of different genotypes. Changes in the genotype profile were detected due to graft and the aphid transmission. The HMA is based on the reduced mobility of heteroduplexes formed as a result of denaturation and reannealing of non-identical but closely related viral sequences. A 400 bp region of the genome in ORF 1 was amplifie d using a pair of universal primers, and cloned. The HMA was then performed to det ect genotypes using a number of selected clones. Two to three different CTV genotypes we re detected in each of the three isolates, but only one genotype was dominant regardless of whether the isolate had been graftor aphid-transmitted. The HMA method provide d evidence that the population dynamics may change with the graft-transmission from the source isolate. Certain genotypes were detected only after the aphid transmissions, and these genotypes could not be detected from the source isolate or the graft-transmitted subisolates.

PAGE 13

1 CHAPTER 1 LITERATURE REVIEW: Citrus tristeza virus Taxonomy Tristeza disease of citrus, caused by Citrus tristeza virus (CTV), is one of the most destructive viral diseases of citrus. Epidemics of this disease have occured, killing millions of citrus trees on sour orange root stock in Brazil, Argentina, Venezuela, and Spain. CTV is a phloem-limited, aphid-borne virus, belonging to the family Closteroviridae, which is comprised of 30 plant viruses (Bar-Joseph et al., 1989). The Closteroviridae viruses are char acteristically flexuous filamentous rod-shaped virions that contain either mono-partite or bipartite pos itive-sense single-str anded RNA genomes. The Closteroviruses are found most consistent ly in the companion and parenchyma cells and hence are called phloem-associated (Esau, 1960). The co-evolution of Closteroviruses has been suggested on the basis of phylogenetic analysis of their replicative genes as well as the HSP 70 homolog (Karasev, 2000). Two conserved blocks of genes, ORF 1a & 1b and ORFs 3 to ORFs 7. have been identified in CTV which also are conserved in other closteroviruses. In the first gene block, ORF 1a contains two papain-like pr oteases, methyltransferase and helicase domains which are expressed through the pr oteolytic processing of a polyprotein. The ORF 1b encodes the RNA dependent RNA polymerase (RdRp) which is expressed by +1 ribosomal frameshift (Cevik, 2001; Cevik et al., 1999). The sec ond gene block consists of ORFs 3 to ORFs 7 which encodes a small 6-kDa hydrophobic protein, a 65-kDa homolog of cellular HSP 70 proteins, a 61-kDa prot ein and two structur al coat proteins.

PAGE 14

2 Morphological Characteristics Virions of CTV are encapsidated with tw o capsid proteins (CPs), the 25 kDa major CP, which encapsidates about 95% of the ge nome, and the 27 kDa minor CP which encapsidates the remaining 5% of the genome on the 5 end of the virion (Febres et al., 1996; Satyanarayana et al., 2004). CTV is reported to have an unusual rattlesnake like morphology because of a second structural protei n at the tip of the virion (Agranovsky et al., 1995; Febres et al., 1996). Inclusion Bodies Two types of inclusions are produced in the ca se of closteroviruses. The first type is cross-banded patterns of aggregated vi rus particles, whereas the second type is aggregates of fibril-contai ning vesicles surrounded by cyt oplasmic membranes (Brlansky, 1987; Garnsey et al., 1980). Inclusion bodies can be used as a method for rapid diagnosis of CTV (Brlansky and Lee, 1990). There is a positive relationship between the number of inclusions and strain severity of CTV and viru s titer in different hos t plants (Brlansky and Lee, 1990). Historic Perspective and Economic Importance Citrus is believed to have originated in southeast Asia and CTV was probably associated with the citrus cultivated in Ch ina and Japan since ancient times (Bar-Joseph et al., 1989). Initial spread of the disease is believed to have been through the infected propagated material as the virus is not seed-borne and thus most of the early establishments of the citrus, which were through seed, were free of CTV (McClean, 1957). Phytophthora root rot of the sweet orange trees was the main concern and caused huge losses during the nineteen th century. Thus the use of grafted trees on the Phytophthoratolerant sour orange rootst ock became popular (Klotz, 1978). Later,

PAGE 15

3 problems with sour orange as a rootstock were reported from Australi a, South Africa and Java. This failure was originally believed to be due to the varietal incompatibility and was later on suggested to be because of a pathogen (Toxopeus, 1937; Webber, 1925). Meneghini (1946) proved tristeza disease to be of viral origin by experimentally transmitting the disease using aphids (Bar-Joseph et al., 1989). The first report of decline of citrus trees grafted on sour orange rootstock was from Argentina in 1910 (Weber, 1943). The first seri ous epidemic of decline and death of citrus trees on sour orange rootstock was reported from Argentina in 1930 (Zeman, 1930). Within 15 years of this incidence, 10 m illion trees were lost in Argentina. Similar losses were reported in Brazil where 6 million trees were lost over a period of 12 years (Bar-Joseph, 1989). More than 10 million trees have been lost in Spain since 1956 (Cambra et al., 1988). A plant infected with the mild strain of a virus can be protected against the subsequent infection of severe strains of the same or cl osely related viruses. This phenomenon is known as cross protection (Fulto n, 1986). Mild strain cross protection for the control of CTV has been used in comme rcial citrus plantations in many countries such as Australia, Brazil, South Africa, Ja pan and India (Costa and Muller, 1980; Lee and Rocha-Pena, 1992). The breakdown of cross prot ection against decline inducing isolates of CTV in grapefruit trees has been reported due to the introduction and establishment of the Toxoptera citricida (Kirkaldy), commonl y known as brown citrus aphid (BCA), which is the most efficient vector of CTV, in Florida. The incide nce of decline inducing isolates of CTV increased from 13 % to 81 % in mild strain cross-protected plants, within five years of introduction of BCA in Florid a (Powell et al., 2003) An increase in the

PAGE 16

4 incidence of all strains of CTV has been reported in south Florida, following the introduction of brown citrus aphid in Florida. However the increase of severe strains were greater as compared to the mild strains (Halbert et al., 2004). Surveys from the major citrus producing re gions of CTV in Columbia, based on the reactivity of monoclonal antibody MCA 13, detect ed the presence of severe strains of CTV in 60% of the sampled trees (Penaranda et al., 1996). An epidemic from the Bog Walk Valley in Jamaica has been reported recently, where the entire valley was undergoing a severe decline epidemic (Lee et al., 2002). Recently, many incidences and outbreaks of CTV have been reported for the first time in many citrus growing regions of the world (Davino et al., 2003; Papic et al., 2005). Host Range The host range of CTV is limited to the genus Citrus and citrus relatives in family Rutaceae. Most of the species, varieties and hybrids of Citrus are infected by CTV (Muller and Garnsey, 1984). Some of the citrus relatives such as Poncirus trifoliata Swinglea glutinosa, Severinia buxolia (Poir.) Tenore, some pummelo ( C. grandis (L.) Osb.) and some of the hybrids between P. trifoliata and sweet orange or grapefruit are reported to be resistant to CTV infection (G arnsey et al., 1987a; Garnsey et al., 1997). Symptoms CTV causes different symptoms on different hosts. The most important symptoms caused by CTV can be grouped into five majo r groups, which include mild vein clearing, quick decline (QD), seedling ye llows (SY), stem pitting on sw eet orange (SPO) and stem pitting on grapefruit (SPG). M ild vein clearing symptoms are generally produced by the mild isolates of CTV and it includes vein clearing and flecking only on leaves of Mexican lime. The QD symptoms are more se vere and include decline and death of

PAGE 17

5 grapefruit, mandarin and sweet orange trees grafted onto sour ora nge rootstocks. The QD symptoms are produced as a result of virus-i nduced phloem necrosis in the bark of the rootstock, at the graft union (Garnsey et al., 1987b). The SY symptoms are mostly observed in the greenhouse and includes severe chlorosis and stunting of sour orange, lemon and grapefruit seedlings (Roistacher, 1982). The SP symptoms are the most severe symptoms of CTV which includes severe stun ting, chlorosis, vein necrosis, cupping of leaves, reduction in number and size of the fruit and pitting of scions especially grapefruit and sweet orange. Unlike QD, SP symptoms do not depend upon the rootstock used (Lee et al., 1994; Rocha-Pe na et al., 1995). Transmission Citrus is a host for several aphid specie s belonging to subfamily Aphidinae in the family Aphididae, many of these aphid spec ies are able to transmit CTV (Blackman and Eastop, 1984; Viggiani, 1988). The most importa nt species of aphids which can transmit CTV are Toxoptera citricida (Kirkaldy), T oxoptera aurantii (Boyer de Fonscolombe), Aphis gossypii Glover, Aphis spiraecola(= citricola) Patch; their composition and occurrence on citrus varies depending upon the country and regions (Ahlawat and Raychaudhuri, 1988). T. citricida, commonly known as brown ci trus aphid (BCA), is the most efficient vector of CTV, A. gossypii is the second most efficient vector, A. spiraecola reaches high populati ons at times and can be important in CTV spread and T. aurantii is a rare vector (H ermosa de Mendoza et al., 1984; Yokomi et al., 1994). CTV is semi-persistently transmitted by aphids w ith 30 minutes to 24 hrs. acquisition and inoculation feeding periods required by th e aphid to efficiently transmit CTV to a healthy plant (Sasaki, 1974).

PAGE 18

6 Molecular Studies Genome organization CTV is a single-stranded positive-sense RNA virus of about 19,296 to 19,302 nt, depending on the isolate, and has flexuous filamentous pa rticle (Karasev et al., 1995b; Mawassi et al., 1996; Suastik a et al., 2001; Vives et al ., 1999; Yang et al., 1999). The CTV genome encodes 12 ORFs which codes for 19 protein products (Karasev et al., 1995a). CTV genomic RNA has two untranslated regions (UTR) of 107 nt and 273 nt at 5 and 3 termini, respectively (Karasev et al., 1995b; Pappu et al., 1994). The 3 UTR is highly conserved among different CTV isolates with nucleotide identities as higher as 97% whereas the 5 UTR region is highly variable with nucle otide identities as low as 44%. Replication of CTV Replication of CTV, a positive-sense RNA virus, involves synthesis of negativestranded or complimentary RNA from the genom ic positive-sense RNA, then synthesis of positive-sense RNA progeny by using negative or complementary RNA as a template. Replication associated proteins such as RdRp, helicase, methyl transferase, are encoded by ORF 1a and ORF 1b of the CTV genome. From the infectious CTV clone an infectious replicon was constructed name d Delta Cla which infect protoplasts (Satyanarayana et al., 1999; Satyanarayana et al., 2002; Tatineni S. et al., 2002). The replicon contained the entire 5 replication complex (ORFs 1a and 1b) and a truncated 3 end lacking the translation pr oducts of all 3 ORFs, and replicated efficiently in Nicotiana benthamiana protoplasts, showing that ORF 1a & 1b are necessary for the replication process (Satyanarayana et al., 1999). This replicon pr ovides a model system for manipulation and studying repli cation in the protoplasts (Bar-Joseph et al., 2002).

PAGE 19

7 Cis-acting sequences, which are required for replication, are presen t at the 3 and 5 UTR of CTV genome. Reduced replication levels in Nicotiana benthamiana protoplasts has been reported in an engineered CTV RNA replicon of T36 isolate substituted with 5 UTR from the VT isolate, suggesting the in teraction of 5 UTR sequences with the replicase sequences of T36 isolate (Ayll on et al., 2001; Satyanarayana et al., 1999). Defective RNAs Associated CTV infected plants contains defect ive RNA (D-RNA) which contain both genomic RNA termini with extensive internal deletions of up to 17 kb (Ayllon et al., 1999a). These D-RNAs showed 99 % nucleotid e identity with th e corresponding regions of CTV genomic RNA and are thought to be created by the general recombination mechanisms: RNA breakage and ligation, rep licase-driven template switching and breakageinduced template switching (A yllon et al., 1999a; Na gy and Simon, 1997). DRNAs can reduce the accumulation of helper virus and may or may not modulate the symptom expression in the virus-infected pl ants. Yang et al (1997) demonstrated the involvement of CTV ORF 11 subgenomic RNA (sgRNA) as building blocks in the recombination process, leading to the ge neration of D-RNAs (Yang et al., 1997). CTV Gene Expression Strategies Polyprotein Processing and Translational Frameshift The 5 ORF 1a encodes a polyprotein of about 349 kDa which includes two papainlike proteases, a methyltranseferase and helicase domains. The 349 kD polyprotein is then proteolytically processed to produce two N-terminal leader prot eins of 54 kD and 55 kD and a 240 kDa C-terminal fragment contai ning the methyl transferase and helicase domains. ORF 1b encodes a RdRp of about 57 kD via a +1 ribosomal frame shift (Cevik, 2001; Karasev et al., 1995b).

PAGE 20

8 Subgenomic RNAs Various 3 co-terminal sgRNAs are presen t in the CTV infected plant, which are present as dsRNA in abundant quantities. The sgRNAs vary in their rate of expression in the infected plants. The p20 and p23 sgRNAs are expressed at higher rates, followed by the two CP gene sgRNAs (Hilf et al., 1995; Pappu et al., 1997). The 5 co-terminal sgRNAs, LMT (Low molecular tristeza) and La MT (Large molecular tristeza) of about 0.8 kb and 10 kb, respectively, have been characterized. The ma jor portion of CTV associated RNAs consist of LMT molecules which are composed of two modal lengths: 744-746 nt and 842-854 nt. These LMTs are produ ced as a result of the termination of genomic RNA The LaMT RNA has been found to be less abundant (Che et al., 2001). Population Structure and Genetic Diversity The estimation of the amount of genetic dive rsity for CTV is still being determined. Field isolates of CTV contai n mixtures of genotypes, wh ich can be separated due to aphid transmission or graft transmission to different hosts (Brlansky et al., 2003; Moreno et al., 1993a; Moreno et al., 1993b). The a phid-transmitted and the graft-transmitted subisolates differ from the sour ce isolate in their serological and biological properties and also in their dsRNA banding patterns upon el ectrophoresis (Brlansky et al., 2003; Cambra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b). Changes in the haplotype (sequence varian ts) distribution and frequency have been reported due to graft and aphid transmi ssions, based on single-strand conformation polymorphism (SSCP) analysis of two gene s, p18 and p21, from two different regions (Ayllon et al., 1999b). Predominant haplotype s have been reduced, and new haplotypes have arisen in the successive graft and aphid transmitted subisolates. Changes in the haplotype population were found to be more drastic for gene p20 as compared to gene

PAGE 21

9 p18, indicating different selecti on pressure for these two genes. Thus the differential selection pressure, of host and the aphid transmission, to different genes may be responsible in part for the wide biological serological and mol ecular variability among CTV isolates (Ayllon et al., 1999b). Based on the 5 UTR, various CTV isolat es have been classified into three sequence types: I, II and III represented by T 36 isolate from Florida, VT isolate from Israel and T317 isolate from Spain, respectiv ely (Lopez et al., 1998). An association of these 5 UTR types with the symptom expr ession has been suggested: CTV isolates having 5 UTR type III cause mild to moderate symptoms in Mexican lime, whereas stem pitting CTV isolates have 5 UTR type II (Ayl lon et al., 2001). Presence of more than one 5 UTR types have been detected in the CTV isolates from different regions, and the 5 UTR types were found to change after graft or aphid transmission to a new host (Ayllon et al., 2001; Moreno et al., 1993a; Moreno et al., 1993b). Field isolates of CTV often are mixtures of different populations and may contain multiple D-RNAs (Mawassi et al., 1995a; Mawa ssi et al., 1995b). From this mixture, strains of CTV having distinct properties can be selected, thus changing the mixture of viral strains in different proportions in infected plants (Hilf et al., 1999). The complete genomic sequence of several CTV isolates have been determined (Albiach et al., 2000; Karasev et al., 1995b; Mawassi et al ., 1996; Suastika et al., 2001; Vives et al., 1999; Yang et al., 1999). Between the Fl orida T36 isolate and the Israeli VT isolate, the nucleotide identities ranges fr om 30-40% in the 5 region of the genome to 90-97% in the 3 region of the genome (Kar asev et al., 1995b; Mawassi et al., 1996). The difference in the nucleotide sequence id entity in the 5 region of the genome,

PAGE 22

10 between these two isolates, wa s greater than expected, wher eas in the 3 region of the genome was within the normal expectations (Hilf et al., 1999; Mawa ssi et al., 1996). In an another study, based on the cDNA sequen ces, various CTV isolates have been classified into three groups (1, 2 & 3) with intra-group sequence identity of 88% and inter-group sequence identity as low as 44% Some isolates were reported to belong to more than one group (Lopez et al., 1998). There is an uneven distri bution of genomic RNA vari ants of CTV within an infected plant and the population of these genomic RNA variants changes upon aphid transmission. Different SSCP patterns have been obtained by analyzing tissue samples from different sites of same infected pl ant and from the single aphids feeding on the same infected leaf (d'Urso et al., 2000). Variation in haplotypes distribution of two genomic regions within the ORF1a of CTV, has been reported from Spain (D'Urso et al., 2003). Also, the difference in dsRNA patterns has been detected from the analysis of 125 randomly selected CTV infected citrus trees, suggesting the presence of genetic variation among CTV in the fiel d trees (Guerri et al., 1991). Florida CTV isolates can be broadly clas sified into two broad categories: mild isolate and severe isolates represented by T30 and T36 isol ates, respectively. However, origins of these two genotypes present in Florida remains unknown so far and is suggested to be the result of infected budwood importations (Hilf and Garnsey, 2002). It is suggested that, since the T30 is distri buted worldwide, so it could have had many origins, whereas, T36 genotype, because of its limited distribution may have specific origin (Hilf and Garnsey, 2000; Hilf and Garnsey, 2002).

PAGE 23

11 Methods of Detection Garnsey et al. in 1987 established a standardized ba ttery of five different indicator plants for the biological ch aracterization of CTV isolates (Garnsey et al., 1987a). Mexican lime is a universal indicator for CTV; sour orange is used for detection of SY; sweet orange grafted onto sour orange is us ed to detect QD strains of CTV. For the detection of more severe SP strains, Duncan grapefruit and Madame vinous sweet orange is used for GSP and OSP strains, resp ectively (Lee et al., 1996). It has been recommended that the biological indexing also should include locally important rootstock or scions from a particular area because some CTV isolates stem pit these hosts (Lee et al., 1996; Rocha-Pena et al., 1995). Polyclonal and monoclonal antisera have been produced against a wide range of CTV isolates for general detection of CT V infection. Most of these antisera do not provide information regarding the severity of an isolat e (Garnsey et al., 1981; Vela et al., 1986). A monoclonal antibody MCA 13 was raised against the T36 isolate of CTV, which differentiates between the mild and se vere (QD) isolates of CTV in Florida (Permar et al., 1990). MCA13 reacts only with QD strains (MCA13 positive) of CTV, but not with Florida mild stra ins (MCA13 negative) In the Florida bud wood certification program, trees which react with MCA 13 cannot be used for budwood. However, some CTV isolates have been reported which cause decline on sour orange and yet are MCA 13 negative (Hilf and Garnsey, 2002). Tissue print-ELISA with specific monoclona l antibodies has been reported to be reliable and simple and economical method for routine diagnosis of plant material (Cambra et al., 2002). The use of immunobl ot technique for the detection of mycoplasma-like pathogens and viruses, some of them were phloem limited has been

PAGE 24

12 described earlier (Lin et al., 1990; Rocha-Pe na et al., 1991a; RochaPena et al., 1991b). A reliable and sensitive direct tissue blot immunoassay (DTBIA) was tested for the detection of CTV. Also, stra in specific monoclonal antibody CTV-MCA13 can be used in conjunction with this technique in order fo r the detection of severe strains of CTV (Garnsey et al., 1993). BCA has been reported to separate th e mixtures of CTV genotypes that exist in many field isolates. By using BCA as a tool to separate mixtures of genotypes, the detection of severe subisolates hidden within the mild isolates has been reported from different CTV isolates. Both MCA 13 positiv e and negative subisolates were detected from MCA 13 negative parent isol ates (Brlansky et al., 2003). The dsRNA banding patterns upon electrophore tic separation have been used for the identification of indivi dual viruses and virus groups and also for the id entification of the virus strains. The number and intensity of the dsRNA banding patterns change with the change in the host species (Jarupat et al., 1988). However, dsRNA patterns are not always correlated with the pathogenic ch aracteristics of CTV isolates. The RT-PCR method for detection of CTV has successfully been used for the detection of CTV in single and groups of 3, 5 and 10 aphids from three different aphid species T. citricida, A. gossypii and M. persicae (Mehta et al., 1997). A multiple molecular marker (MMM) method was developed for the PCR-based differentiation of CTV genotypes. The MMM method is based on the amplification of the molecular markers using sequence spec ific RT-PCR primers designed from nonconserved regions of VT, T3, T30 and T 36 CTV isolates (Hilf and Garnsey, 2000). Unknown CTV isolates may be character ized based on the sequence specific

PAGE 25

13 amplification of RT-PCR produc ts, producing a profile designat ed as Isolate Genotype by the MMM method (Hilf and Garn sey, 2000; Hilf et al., 1999). The MMM method provides a rapid techniqu e for the detection of CTV genotypes and also provides an initial assessment of the molecular variability within the CTV population (Hilf and Garnsey, 2000). MMM also ha s been reported to be used for the assessment of genetic relatedness of individu al isolates from diffe rent citrus growing regions of the world. Based on the MMM anal ysis of over 400 accessions from Florida, T30 or/and T36 genotypes were the primary genotypes detected in commercial citrus in Florida, followed by the VT genotype, presen t in some Meyer lemon trees, whereas the T3 genotype was absent in commer cial trees (Hilf and Garnsey, 2002). The SSCP analysis is rapid and simple te chnique to detect th e presence of minor variations in the nucleotide sequence of DNA fragments (Rubio et al., 2000). The SSCP analysis is based on the difference in the mobility of ssDNA fragments on a polyacrylamide gels due to their conforma tion under the electrophorec tic conditions used, and this conformation inturn depends upon the nucleotide sequence. SSCP has been used to characterize population varian ts in CTV from different re gions of the genome (Rubio et al., 1996; Rubio et al., 2000). SSCP analysis along with the restriction digestion has been used differentiate CTV isolates base d on the CP gene sequences (Rubio et al., 1996). The heteroduplex mobility assay (HMA) was developed for the detection of unknown genotypes present in the mixed CTV in fections, which may not be detected by the PCR based detection methods (Manjunath et al 2002). HMA is rapid and simple method for the detection and estimation of the genotypic differences between viral

PAGE 26

14 strains. The DNA heteroduplexes are formed as a result of nucleotide differences between closely related sequences, upon dena turation and reannealing of the sequences (Delwart et al., 1993). The DNA heteroduplexes thus formed have a reduced mobility on a polyacrylamide gels and the reduction in mobility is proportional to the degree of divergence between the sequences (Delwart et al., 1993). Two new genotypes (T2K and T38K) have been detected from the severe GSP Florida isolate T3800 (Manjunath et al). HMA analysis has been used for the characte rization of number of human RNA viruses and plant RNA and DNA viruses (Berry and C., 2001; Cai et al., 1991; Delwart et al., 1993; Lin et al., 2000). Tristeza Disease Management CTV management strategies to minimi ze the economic losses depend upon the incidence of CTV in a part icular area (Bar-Joseph et al., 1989; Lee and Rocha-Pena, 1992). Strict quarantine measures includin g the clean rootstock and certification programs are useful in the areas where CTV is absent or the incidence of CTV is low. The use of CTV tolerant rootstocks and mild strain cross-protection are useful to extend the economic life of citrus trees in the areas of high inciden ce of CTV. However there is a risk of breakdown of mild stra in cross-protection either due to the new strains or the new severe strains of CTV (Lee et al., 1996). CTV tolerant rootstocks such as Citrus reticulate, Citrus volkameriana and Citrus jambhiri (Rangpur lime) are tolerant to QD isolates of CTV. Some other CTV tolerant hybrid rootstocks: Troyer and Carr izo citrange, obtained by crossing C.sinenesis (L.) Osb. X Poncirus trifoliata (L.) Raf. has been widely used in areas where QD strains of CTV are prevalent (Van Vuuren et al., 1993). Ho wever, a number of limiting factors such as susceptibility of some of these CTV resistant rootstocks to certain diseases (citrus

PAGE 27

15 blight, Phytophthora sp and viroids), some of the undesira ble horticultural characteristics combined with presence of stem pitting symptoms in scions regardless of the rootstocks used, greatly limits the use of these resistan t rootstocks (Bar-Joseph et al., 1989; Garnsey et al., 1987b). The pathogen derived resisi tance (PDR) has been shown to be effective and reproducible in transgenic Mexican lime plan ts carrying p25 CP gene of severe and mild isolates of CTV. However, varying degr ee of resistance has b een reported. 10-33% transgenic plants has been reported to be resistant to CTV graft and aphid inoculations, whereas other transgenic plants showed si gnificant delay in virus accumulation and symptom onset (Dominguez et al., 2002).

PAGE 28

16 CHAPTER 2 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND SUBISOLATES BY USING MULTIPLE MOLECULAR MARKERS Introduction Citrus tristeza virus (CTV) is the most destructive vi ral pathogen of citrus. CTV is a phloem-limited, aphid-borne virus belonging to the family Closteroviridae, which comprised of 30 plant viruses (Bar-Joseph et al., 1989). The Clostero viridae viruses are characteristically flexuous filamentous rod-sh aped virions that have either mono-partite or bipartite positive-sense single-strande d RNA genomes. Closteroviruses are found usually in the companion and parenchyma cells; hence they are called phloemassociated (Esau, 1960). The host range of CTV is limited to the genus Citrus in the family Rutaceae. Most of the species, varieties and hybrids of Citrus are infected by CTV (Muller and Garnsey, 1984). The CTV genome is encapsidated with tw o capsid proteins (CPs), the 25 kDa major CP which encapsidate s about 95% of the genome, and the 27 kDa minor CP which encapsidates the remaining 5% of the genome on the 5 end of the virion (Febres et al., 1996; Satyanarayana et al., 2004). CT V is a single-stranded positive-sense RNA virus of about 19,296 to 19,302 nt, depending on the isolate, and has flexuous filamentous particle (Karasev et al., 1995b; Mawassi et al ., 1996; Suastika et al., 2001; Vives et al., 1999; Yang et al., 1999). The CTV genome encodes 12 ORFs which codes for 19 protein products (Karasev et al., 1995a). There are two conserved blocks of genes in the CTV genome, ORF 1a & 1b and ORFs 3 to ORFs 7, which also are conserved in

PAGE 29

17 other closteroviruses. Inclusion bodies are pr oduced in CTV infected tissue, which can be used as a method of detection for rapid di agnosis of CTV (Brlan sky, 1987; Brlansky and Lee, 1990; Garnsey et al., 1980). Many of the aphid species are vector s of CTV (Blackman and Eastop, 1984; Viggiani, 1988) however, Toxoptera citricida (Kirkaldy), comm only known as Brown citrus aphid (BCA), is the mo st efficient vector of CTV. Aphis gossypii Glover is the second most efficient vector (Hermosa de Mendoza et al., 1984; Yokomi et al., 1994). Field isolates of CTV often contain a mixture of CTV genotypes, which are sometimes separated by aphid transmission or graft tran smission to different hosts (Brlansky et al., 2003; Moreno et al., 1993a; Moreno et al., 1993b). Aphid transmitted and the graft transmitted subisolates have been reported to differ from the source isolate in their serological and biological properties and also in their double-stranded (dsRNA) patterns (Brlansky et al., 2003; Cambra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b). The breakdown of cross protection agains t decline inducing is olates of CTV in grapefruit trees has been reported followi ng the introduction and es tablishment of the BCA in Florida (Powell et al., 2003). An increase in the inci dence of all strains of CTV has been reported in south Florida, fo llowing the introduction of BCA in Florida. However the increase of severe strains were greater as compared to the mild ones (Halbert et al., 2004). Various methods have been designed for th e differentiation of CTV isolates. One of the standard methods is biological characteri zation. Mexican lime is a universal indicator for CTV; sour orange is ofte n used for detection of seedli ng yellows (SY); sweet orange grafted onto sour orange is us ed to detect decline-inducing (QD) strains of CTV (Garnsey

PAGE 30

18 et al., 1987). The serological ch aracterization of CTV isolates have been reported with the use of the monoclonal antibody MCA 13, which reacts with most of QD strains (termed as MCA 13 positive) and do not reac t with the mild strains (termed as MCA 13 negative) from Florida. However, this anti body is not always useful as some of the isolates with T30 genotype (mild), have reacted positively with the MCA 13 monoclonal antibody. Also, in some mixed CTV infecti ons having both T30 and T36 genotypes did not react with MCA 13 monoclonal antibody (H ilf and Garnsey, 2002a). In the Florida budwood certification program, trees which r eact with MCA 13 cannot be used for budwood (Hilf and Garnsey, 2002a). RT-PCR detection method was designed and successfully used for the detection of CTV isolates in single and group of 3, 5 and 10 aphids from three different aphid species T. citricida, A. gossypii and Myzus persicae (Mehta et al., 1997). Molecular characterization of CTV isolat es by cloning and sequencing of the CP gene also has been reported (Pappu et al., 1993b ). However, characterization of different isolates and assessment of the population dive rsity of CTV based on the single gene or region of the genome may not be conclusive for the entire genome, because of the variability in the 5 and 3 region of CTV genome. Characterization of CTV isolates on the basis of full sequence comparison is not on ly difficult but also a very time consuming process. A multiple molecular marker (MMM) method was developed for the PCR-based differentiation of CTV genotypes. The MMM method is based on the amplification of the molecular markers using sequence spec ific RT-PCR primers designed from four different non-conserved regions of VT, T3, T30 and T36 CTV isolates (Hilf and Garnsey,

PAGE 31

19 2000a). Unknown CTV isolates may be charac terized based on the sequence specific amplification of RT-PCR produc ts, producing a profile designat ed as Isolate Genotype by the MMM method (Hilf and Garnsey, 2000a; Hilf et al., 1999). The MMM method provides a rapid technique for the detecti on of CTV genotypes and also provides an initial assessment of the molecular variab ility within the CT V population (Hilf and Garnsey, 2000a). MMM also has been used fo r the assessment of genetic relatedness of individual isolates from di fferent citrus growing regions of the world. Based on the MMM analysis of over 400 accessions from Florida, T30 or/and T36 genotypes were the primary genotypes detected in commercial citrus in Florida, followed by the VT genotype, present in some Meyer lemon trees, whereas the T3 genotype was absent in commercial trees (Hilf and Garnsey, 2002b). The present study was conducted in order to determine the population structure (presence of mixed infections) of the three Florida field isol ates of CTV and to determine the effect of grafting and aphid transmi ssion on the subisolates obtained. This was determined by using the MMM to track the changes in the population structure. Material and Methods Virus Isolates Three CTV isolates: Chiefland (CL), Mc n2a (M2A) and T68, were obtained from the University of Florida, Citrus Research and Education Centre (CREC) Lake Alfred, Florida, USA. The CL and M2A isolates are na tive to Florida whereas T68 is originally from Australia. These isolates were maintained on the sweet orange [ Citrus sinenesis (L.) Osbeck] in the greenhouse at CREC. The CL isolate is a MCA 13 negative isolate, collected from a Meyer lemon dooryard tree in Chiefland, Florida. M2A isolate is a MCA 13 positive Florida isolate originally collected from Meyer lemon plant from

PAGE 32

20 Mahon citrus nursery, Florida. T68 isolate is MCA 13 positive isolate collected from Ellendale mandrin plant from Winter Heaven, Florida. Each of the three isolates was bud grafted onto three different hos t species (3 plants each) of citrus: Grapefruit ( Citrus paradisi Macfad), Mexican lime ( Citrus aurantifolia Swingle) and Madam vi nous sweet orange ( Citrus sinenesis (L.) Osbeck). For each isolate, the graft transmitted subisolates are designated by the suffix G followed by the name of the host species in the parentheses. Thus three graft transmitted subisolates on Grapefruit (GF), Mexican lime (ML) and sw eet orange (SW) were obtained, for each isolate, with the designation ending with [-G(GF)], [-G(ML)] and [-G(SW)], respectively. Aphid transmissions were done from each of the graft transmitted subisolates of the T68 isolate, using BCA and Mexican lime as the receptor host. For acquisition, 70-100 aphids were fed on the new flushes of plants infected with each subisolate of CTV. An acquisition access period (AAP) of 24h was allowed for th e BCA to successfully acquire the virus from the CTV infected plants. After AAP, fifty aphids were gently picked using #00 Red sable brushes (Ted Pella Inc., Redding, CA) and placed five aphids per plant, on each of the ten virus-free Mexican lime s eedlings. Inoculation access period (IAP) of 24 h was used, followed by an insecticide spray (0.25% Malathion) for killing the aphids. The aphid transmitted subisolates are designated by the suffix A followed by the name of the host species, used for the acquisition of the virus, in the pare ntheses. Thus three aphid transmitted subisolates on Grapefruit (G F), Mexican lime (ML) and sweet orange (SW) were obtained, with the designation [T68-A(GF)], [T68-A(ML)] and [T68-A(SW)], respectively.

PAGE 33

21 Presence of the virus in the graft transmitted and aphid transmitted subisolates was confirmed by using double antibody sandw ich indirect (DAS)-ELISA. The rabbit polyclonal antibody 1052 (1/10,000) made ag ainst T36 isolate of CTV was used (Brlansky et al., 2003; Karasev et al., 1995b; Nikolaeva et al., 1995; Nikolaeva et al., 1996a; Nikolaeva et al., 1996b). Genotyping of CTV Isolates One universal and eleven pairs of group sp ecific primers (Table 2.1) (Hilf et al., 2000) were used for genotyping of both sour ce and graft transmitted CTV subisolates. These primers are designed from four diffe rent regions of the CTV genome (POL, K17, 5 and CP; Figure 2) of T3, T30, and T36 isol ates from Florida and VT isolates from Israel. Eleven pairs of genotype specific primer pairs designated as T36POL, T36 5, T36K17, T30POL, T30 5, T30K17, VT POL, VT5, VTK17, T3 K17 and T36CP were synthesized (Integrated DNA t echnologies Inc., Coralville, IA). The T36CP primers served as a positive control since all isolates of CTV are expected to amplify from these primers designed to amplify the less variable CP gene region of the viral genome. Two additional primers designated as CN 488491 and CN 487-489, designed from the 5 region of the CTV genome (Figure 2) were used as positive controls. RNA Isolation and Group Compleme ntary DNA (cDNA) Synthesis About 100 mg of CTV-infected tissue fr om bark and leaves was ground in liquid nitrogen using a mortar and pestle and the total RNA was extracted by using the RNeasy Plant Mini Kit (QIAGEN, Valencia, CA) acco rding to the manufacturers instructions. The RNA extraction was resuspended in 30 l of RNase-free water, and stored at -80 C. The first strand complimentary DNA (cDNA) wa s synthesized in two separate groups, using a mixture of antisense primers as s hown in Table 2.1. A mixture of six to seven

PAGE 34

22 antisense primers was prepared to a fina l concentration of 10 M each (Table 2.1). Reverse transcription was carried out using a final volume of 50 l using Superscript II (Invitrogen, Carlsbad, CA according to the manufacturer. Two separate reactions, each using a group of antisense primers, as indicated in Table 2.1, and 20 l of RNA extraction, were carried out for each sample Group 1 and 2 cDNAs were purified using a QIA quick PCR purification kit (QIAGEN, Va lencia, CA), and the final elution was made in 30 l of elution buffer (EB), according to manufacturers protocol. Polymerase Chain Reaction (PCR) Thirteen PCR amplifications were carried out from each sample in 50 l reaction volumes using 5 l of each of the purifie d group 1 and group 2 cDNAs, amplified in a 50 l reaction volume, separately for ea ch primer pair, using the 5 U of Taq DNA polymerase (Promega), 1X PCR reaction buffer, 1.5mM MgCl2, 200 M of each dNTPs, 200 nM of each primer. PCR was performed by using programmable thermal controller (Model HBPX 110, PCR Express, Hybaid Limited, Middlesex, UK). Amplification parameters were 94 C for 2 minutes, 30 cycl es of 94 C for 30 seconds, 56 C for 30 C seconds, 72 C for 45 seconds, followed by in cubation at 72 C for 10 minutes. RT-PCR products were analyzed by 1% agarose gels containing 200 ng of ethidium bromide per ml and BioRad Gel-Doc imaging system was used for visualization of DNA bands. Results A specific genotype profile was assigned to each isolate based on amplification of MMM. The profile of an isolat e thus created is referred to as an Isolate Genotype (Hilf and Garnsey, 2000b; H ilf and Garnsey, 2002a).

PAGE 35

23 Isolate: CL Isolate CL was analyzed using the MMM primer set designed by Hilf et al., 2000 and shown in the Table 2.1. The results of MM M analysis for CL isolate and subisolates are presented in the Table 2.2. CL source isol ate was found to be a mixture of T36 and VT genotypes as amplifications were obtained with the entire three markers (POL, 5 and K17) specific to T36 and VT isolates [Fi gure 2.2(A)]. As expected, PCR products were obtained with the three universal primers used as a positive control: T36 CP, CN 487-489 and CN488491. There were no products obtained with the markers spec ific to either T3 or T30 genotypes [Figure 2.2(A)]. All the graft transmitted subisolates [CL-G (GF), CL-G (ML) and CL-G (SW)] showed similar isolate genotype, as that of CL source isolate, except for the CL-G (ML) subisolate. CL-G (ML) subisolate did not amplifiy with the markers (T36 POL, T36 5 and T36 K17) specific for the T36 isolat e. However, it was amplifiied with the VT POL, VT 5 and VT K17 markers in additi on to the amplification with the general markers [Figure 2.2 (C)]. The CL-G (GF) subisolate was amplified with the T36 POL, VT POL, VT 5 and VT K17 molecular markers [Figure 2.2 (B)]. The CL-G (SW) subisolate was amplified with the T36 POL, VT POL and VT K17 markers [Figure 2.2 (D)]. The CL-G (GF) and CL-G (SW) subiso lates did not amplify with the T36 5 and T36 K17 markers [Figure 2.2 (A-D )]. All of the three graft tr ansmitted subisolates, CL-G (GF), CL-G (ML) and CL-G (SW), were amp lified with the genera l markers [Figure 2.2 (B-D)]. None of these isolates amplified with the T36 5, T36 K17, T30 POL, T30 5 and T3 K17 markers, however, CL source isolat e was amplified by the T36 5 and T36 K17 [Figure 2.2 (A-D)]. In comparison to CL sour ce and other two subi solates, CL-G (GF) and CL-G (ML), CL-G (SW) did not amplify w ith the VT 5 marker [Figure 2.3 (A-D)].

PAGE 36

24 Isolate: M2A Isolate M2A was analyzed using the MMM primer set designed by Hilf et al., 2000 and shown in the Table 2.1. The results of MMM analysis for M2A isolate and subisolates are presented in the Table 2.2. Th e M2A source isolate is a mixture of T36 and VT genotypes as it was amplified with all the three markers (T36 POL, T36 5 and T36 K17) specific to T36 and all the thr ee markers (VT POL, VT 5 and VT K17) specific to VT genotype [Fi gure 2.3 (A)]. It also was amp lified with the three general markers used as a positive contro l: T36 CP, CN 487-489 and CN488-491. No amplification was obtained with the T3K17 marker and two of the three markers (T30 POL, and T30 K17) specific for the T30 ge notype [Figure 2.3 (A)]. M2A source isolate also showed amplification of T30 5 marker, which can only be amplified from T30 genotype (Hilf and Garnsey, 2000b) [Figure 2.3 (A)]. All the graft transmitted subisolates [M2A-G (GF), M2A-G (ML) and M2A-G (SW)] showed similar isolate genotype profile s, as that of M2A source isolate [Figure 2.3 (A-D)]. These subisolates also were a mi xture of T36 and VT genotypes with positive amplifications with all the three markers (T36 POL, T36 5 and T36 K17) specific to T36 and of all the three markers (VT POL, VT 5 and VT K17) specific to VT isolate. The general markers used as positive control also amplified these isolates [Figure 2.3 (B-D)]. None of the three graft transmitted subisolates were amplifed with the T30 5primers, which amplified the M2A sour ce isolate [Figure 2.3 (A-D)]. Isolate: T68 The T68 isolate has previously been descri bed as a T3 genotype, where it has been reported to be amplified with the T3K17, VT POL and VT 5 primers in addition to the T36CP general marker (Hilf and Garnsey, 2000b). In the present study, the T68 source

PAGE 37

25 isolate was amplified with the T3K17 and VT POL markers in a ddition to the general markers (T36 CP, CN 487-489 and CN488-491) [Figure 2.4 (A)]. This confirms that it contains T3 genotype. The T68 source isolate failed to amplify with the VT 5marker. All of the graft transmitted subisolates: T68-G (GF), T68-G (ML) and T68-G (SW) showed similar isolate genotype profiles as that obtained for the T68 source isolate [Figure 2.4 (A-D)]. T68-G (GF), T68-G (ML) and T68-G (SW) subisolates may contain mixture of VT and T3 genotypes, as all the three subisolates showed amplification with the VT POL & T30K17 and T3k17 markers [Figure 2.4 (B-D)]. T68-A(GF) aphid transmitted subisolate was amplified with the T3K17, VT POL and T30K17 markers in addition to the general markers, T36CP a nd CN 488-491 [Figure 2.5 (B)] It did not show amplification with the VT 5 and VT K17 markers, however, it was amplified with the VT POL marker which is specific for VT genotype and T30 K17 marker which can be amplified from VT isolate (Hilf a nd Garnsey, 2000b). T68-A(SW) aphid transmitted subisolate was only amplified with the VT POL marker and the general markers. T68-A (SW) subisolate did not show amplificati on with the T3K17 marker [Figure 2.5 (C)].

PAGE 38

26 Table 2.1 Sequence of genotype specific-oli gonucleotide primers (Hilf and Garnsey, 2000) and two universal primer pairs(*) used for the RT-PCR amplification of CTV Molecular Markers. PRIMER POLARITY SIZE (bp) GROUP PRIMER SEQUENCE (5 3) T36CP SENSE 672 ATGGACGACGAA ACAAAGAAATTG ANTISENSE 1 TCAACGTGTGTTGAATTTCCCA T36POL SENSE 714 GATGCTAGCGATGGTCAAAT ANTISENSE 1 CTCAGCTCGCTTTCTCGCAT T36-5 SENSE 500 AATTTCACAAATTCAACCTG ANTISENSE 1 CTTTGCCTGACGGAGGGACC T36K17 SENSE 409 GTTTTCTCGTTTGAAGCGGAAA ANTISENSE 1 CAACACATCAAAAATAGCTAGT T30 POL SENSE 696 GATGCTAGCGATGGTCAAAT ANTISENSE 1 CTCAGCTCGCTTTCTCGCAT T30-5 SENSE 594 CGATTCAAATTCACCCGTATC ANTISENSE 1 TAGTTTCGCAACACGCCTGCG T30 K17 SENSE 409 GTTGTCGCGCCTAAAGTTCGGCA ANTISENSE 1 TATGACATCAAAAATAGCTGAA VTPOL SENSE 695 GACGCTAGCGATGGTCAAGC ANTISENSE 2 CTCGGCTCGCTTTCTTACGT VT-5 SENSE 492 AATTTCTCAAATTCACCCGTAC ANTISENSE 2 CTTCGCCTTGGCAATGGACTT VT K17 SENSE 409 GTTGTCGCGCTTTAAGTTCGGTA ANTISENSE 2 TACGACGTTAAAAATGGCTGAA T3 K17 SENSE 409 GTTATCACGCCTAAAGTTTGGT ANTISENSE 2 CATGACATCGAAGATAGCCGAA CN 487* SENSE 380 GCGTTGGATGATATCCTTCGCTGG CN 489* ANTISENSE 2 AATTRTTCCGCSCAGGACGGAACA CN 488* SENSE 404 TGTTCCGTCCTGSGCGGAAYAATT CN 491* ANTISENSE 2 GTGTARGTCCCRCGCATMGGAACC

PAGE 39

27 Table 2.2 Genotype profiles of Chiefland (C L), Mcn2a (M2A) and T68 isolate from Flor ida, created by RT-PCR amplification of three general and ten genotype-specific markers. Two general markers are T36 CP, CN 487-489 and CN 488-491. Ten genotype-specific markers are T36 POL, T36 5, T36 K17, T30 POL, T30 5, T30 K17, VT POL, VT 5, VT K17 and T3 K17. Graft transmitted sub-isolates are designated by G fo llowed by name of the host spec ies in parentheses. Aphid transmitted sub sub-isolates are designated by suffix A follo wed by the source plant used for acquisition of virus by the aphid. Isolate T36 CP T36 POL T36 5 T36 K17 T30 POL T30 5 T30 K17 VT POL VT 5 VT K17 T3 K17 CN487489 CN488491 CL (Source) + + + + + + + + + + CL-G (ML) + + + + + N.A + CL-G (SW) + + + + + + N.A + CL-G (GF) + + + + + N.A + M2A(Source) + + + + + + + + + + + M2A-G (ML) + + + + + + + + + + M2A-G (SW) + + + + + + + + + + M2A-G (GF) + + + + + + + + + + M2A-A + + + + + + + T68(Source) + + + + + + + T68-G (GF) + + + + + + T68-G (ML) + +/+ + + + + T68-G (SW) + + + + + + T68-A (GF) + + + + + + T68-A (SW) + + + + GF= Grapefruit; ML= Mexican lime; SW= Sweet orange. N.A = Not applicable.

PAGE 40

28 Figure 2.1 Schematic diagram of Citrus tristeza virus genome indi cating different ORFs and approx imate portions of the genome amplified with genotype specific mol ecular markers by Hilf et al, 2000. The se quence specific markers amplified are indicated by the shaded (black) blocks and the name of the amplified marker unde rneath in shaded boxes.

PAGE 41

29 B 400 bp G1345*678910G3M1 12 G134*5678910G3 M2 12G2 400 bp A 564 bp G146 7910 1 358G3M3 2 D M3 564 bp 564 bp G1 34 5* 678910G3M3 1* 2* C 564 bp M3 B 400 bp G1345*678910G3M1 12 B 400 bp G1345*678910G3M1 12 G134*5678910G3 M2 12G2 400 bp A G134*5678910G3 M2 12G2 400 bp A 564 bp G146 7910 1 358G3M3 2 D M3 564 bp 564 bp G146 7910 1 358G3M3 2 D M3 564 bp 564 bp G1 34 5* 678910G3M3 1* 2* C 564 bp M3 564 bp G1 34 5* 678910G3M3 1* 2* C 564 bp M3 Figure 2.2: Multiple molecular marker (MMM) pr ofiles of Chiefland isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers. Eight l of MMM-PCR product was loaded in lanes 110. Lanes 1-3 show amplification of T36 POL, T36 5 and T36 K17 markers, specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30 POL, T30 5 and T30 K17 markers, specifi c for mild T30 isolate from Florida. Lanes 7-9 show amplification of VT POL, VT 5 and VT K17 markers, specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker, specific for T3 isolate from Florida. Lanes G1, G2 and G3 show amplification of general markers: T36 CP, CN 487 -489 and CN 488-491, respectively. Lane M1, M2 and M3 were loaded with 0. 5 g of 100 bp DNA ladder (Invitrogen), 0.5 ng of 1 Kb DNA ladder (Promega) and 0.5 g of Hind III fragments of DNA (Invitrogen), respectively. Fig. A s hows isolate profile of Chiefland source isolate. Fig. B, C and D shows pr ofiles of sub-isolates of Chiefland isolate grafted onto Grapefruit (GF), Me xican lime (ML) and Sweet orange (SW) respectively. All the amplifications are specific as otherwise indicated by the symbol (*).

PAGE 42

30 G1345 6 78 9 10G3 M2 12G2 A 400 bp 400 bp 400 bp G1 34 56 78 910 G3 M1 12* G2 M1 C G1345 6 78 9 10G3 M2 12G2 400 bp B D G1 3 456 78 910 G3 M1 12 G2 M1 400 bp 400 bp G1345 6 78 9 10G3 M2 12G2 A 400 bp G1345 6 78 9 10G3 M2 12G2 A 400 bp 400 bp 400 bp G1 34 56 78 910 G3 M1 12* G2 M1 C 400 bp 400 bp G1 34 56 78 910 G3 M1 12* G2 M1 C G1345 6 78 9 10G3 M2 12G2 400 bp B G1345 6 78 9 10G3 M2 12G2 400 bp B D G1 3 456 78 910 G3 M1 12 G2 M1 400 bp 400 bp D G1 3 456 78 910 G3 M1 12 G2 M1 400 bp 400 bp Figure 2.3: Multiple molecular marker (MMM) profiles of Mcn2a isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers. Eight l of MMM-PCR product was loaded in lanes 110. Lanes 1-3 show amplification of T36 POL, T36 5 and T36 K17 markers, specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30 POL, T30 5 and T30 K17 markers, specifi c for mild T30 isolate from Florida. Lanes 7-9 show amplification of VT POL, VT 5 and VT K17 markers, specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker, specific for T3 isolate from Florida. Lanes G1, G2 and G3 show amplification of general markers: T36 CP, CN 487 -489 and CN 488-491, respectively. Lane M1, M2 and M3 were loaded with 0. 5 g of 100 bp DNA ladder (Invitrogen), 0.5 ng of 1 Kb DNA ladder (Promega) a nd 0.5 g of Hind III fragments of DNA (Invitrogen), respectively. Fig. A show s isolate profile of Mcn2a source isolate. Fig. B, C and D shows profiles of sub-isolates of Mcn2a isolate grafted onto Grapefruit (GF), Mexican lime (ML) and Sweet orange (SW) respectively. All the amplifications ar e specific as otherwise indicated by the symbol (*).

PAGE 43

31 G1 3 4* 5*6 7 8 9 10G3 M2 1 2*G2 A 400 bp B G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp C G13 4* 5*6 7 8* 9 10G3 M2 1 2*G2 400 bp D G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp G1 3 4* 5*6 7 8 9 10G3 M2 1 2*G2 A 400 bp G1 3 4* 5*6 7 8 9 10G3 M2 1 2*G2 A 400 bp B G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp B G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp C G13 4* 5*6 7 8* 9 10G3 M2 1 2*G2 400 bp C G13 4* 5*6 7 8* 9 10G3 M2 1 2*G2 400 bp D G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp D G1 3 4 56 7 8* 9 10G3 M2 1 2*G2 400 bp Figure 2.4: Multiple molecular marker (MMM ) profiles of T68 isolate and the graft transmitted sub-isolates created by PCR amplification by using sequence specific primers. Eight l of MMM-PCR product was loaded in lanes 110. Lanes 1-3 show amplification of T36 POL, T36 5 and T36 K17 markers, specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30 POL, T30 5 and T30 K17 markers, specifi c for mild T30 isolate from Florida. Lanes 7-9 show amplification of VT POL, VT 5 and VT K17 markers, specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker, specific for T3 isolate from Florida. Lanes G1, G2 and G3 show amplification of general markers: T36 CP, CN 487 -489 and CN 488-491, respectively. Lane M1, M2 and M3 were loaded with 0. 5 g of 100 bp DNA ladder (Invitrogen), 0.5 ng of 1 Kb DNA ladder (Promega) a nd 0.5 g of Hind III fragments of DNA (Invitrogen), respectively. Fig. A show s isolate profile of T68 source isolate. Fig. B, C and D shows profiles of sub-isolates of T68 isolate grafted onto Grapefruit (GF), Mexican lime (ML) and Sweet orange (SW) respectively. All the amplifications ar e specific as otherwise indicated by the symbol (*).

PAGE 44

32 G1 3 4* 5*6 7 8910G3 M2 12G2 A 400 bp 564 bp G13 4 5*6 7 8910 G3 M3 1 2* B 400 bp G1345* 6* 78910G3 M11*2*M1 C G1 3 4* 5*6 7 8910G3 M2 12G2 A 400 bp G1 3 4* 5*6 7 8910G3 M2 12G2 A 400 bp 564 bp G13 4 5*6 7 8910 G3 M3 1 2* B 564 bp G13 4 5*6 7 8910 G3 M3 1 2* B 400 bp G1345* 6* 78910G3 M11*2*M1 C 400 bp G1345* 6* 78910G3 M11*2*M1 C Figure 2.5: Multiple molecular marker (MMM ) profiles of the T68 source isolate and aphid transmitted subisolates of T68, cr eated by PCR amplification by using sequencespecific primers. Eight l of MMM-PCR product was loaded in lanes 110. Lanes 1-3 show amplifica tion of T36 POL, T36 5 and T36 K17 markers, specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30 POL, T30 5 and T30 K17 marker s, specific for mild T30 isolate from Florida. Lanes 7-9 show amplificatio n of VT POL, VT 5 and VT K17 markers, specific for VT Israeli isolat e. Lane 10 show amplification of T3 K17 marker, specific for T3 isolate from Florida. Lanes G1, G2 and G3 show amplification of general markers: T36 CP, CN 487-489 and CN 488-491, respectively. Lane M1, M2 and M3 we re loaded with 0.5 g of 100 bp DNA ladder (Invitrogen), 0.5 ng of 1 Kb D NA ladder (Promega) and 0.5 g of Hind III fragments of DNA (Invitrogen), re spectively. Fig. A shows isolate profile of T68 source isolate. Fig. B shows the profile of subisolate obtained through aphid transmission of CTV from Grapef ruit to Mexican lime, Fig. C shows the profile of subisolate obt ained through aphid transmission of CTV from sweet orange to Mexican lime.All the amplif ications are specific as otherwise indicated by the symbol (*).

PAGE 45

33 Table 2.2 Summary of the results of multip le molecular marker (MMM) of Chiefland (CL), Mcn2a (M2A) and T68 source isolates and the graft/aphid transmitted subisolates from Florida.The graft transmitted sub-isolates are designated by G followed by name of the host species in parentheses. Aphid transmitted sub sub-isolates are designate d by suffix A followed by the source plant used for acquisition of virus by the aphid. ISOLATE/ SUBISOLATE NUMBER OF GENOTYPES DETECTED NAME OF THE GENOTYPE CL 2 T36 and VT CL-G(GF) 2 T36 and VT CL-G(ML) 2 T36 and VT CL-G(SW) 2 T36 and VT M2A 2 T36 and VT M2A-G(GF) 2 T36 and VT M2A-G(ML) 1 VT M2A-G(SW) 2 T36 and VT T68 2 T3 and VT T68-G(GF) 2 T3 and VT T68-G(ML) 2 T3 and VT T68-G(SW) 2 T3 and VT T68-A(GF) 1 T3 T68-A(SW) Non-specific Discussion CTV is the most destructive viral disease of citrus and is distributed worldwide in most of the citrus growing regions of the world. Various studies have shown that field isolates of CTV contains mixture of genot ypes, which can be separated due to aphid transmission or graft transmission to differe nt hosts (Moreno et al., 1993a; Moreno et al., 1993b). The aphid transmitted and the graft transmitted subisolates have often been reported to differ from the source isolate in their serological and bi ological properties as well as in their double-stra nded RNA (dsRNA) patterns (Cam bra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b). Three Florida isolates were selected for the present study. CL isolate was found to be mixture of T36 and VT genotypes based on the amplifications from all the primers

PAGE 46

34 specific for these isolates. Amplification also was obtained with the T30K17 marker, but it has been reported that the T30 k17 marker can be amplified from certain VT isolates (Hilf and Garnsey, 2000b). However, change s in the genotype pr ofile due to graft transmission were detected in CL graft transmitted subisolates, as none of these subisolates showed amplification with the T 36 5 and T36 K17 markers, which amplified CL source isolate. The CL-G (ML) subisolate failed to amplify with any of the three markers (T36 POL, T36 5 and T36 K17) specifi c for T36 isolate even when repeated 3-4 times and thus may only contains VT genotype Being a supposedly mild isolate, based on MCA 13 monoclonal antibody reactivity, CL source isolate having T36 and VT genotypes is unexpected. M2A isolates was found to be mixture of T36 and VT genotypes. There were no changes in the isolate genotype due to graft transmission as all the graft transmitted subisolates [M2A-G (GF), M2A-G (ML) and M2A-G (SW)] were also found to be mixture of T36 and VT genotypes. However mi nor changes in the amplification of these isolates were obtained, where none of the three subisolates wa s amplifed with the T30 5 primers, which amplified the M2A source is olate [Figure 2.2 (A-D)]. Changes in the dsRNA patterns due to passage through differe nt hosts have been reported earlier. However, sequencing of the amplified T30 5 ma rker need to be done in order to confirm the presence of T30 genotype like sequences in M2A source isolate and its absence in the subsequent graft transmitted s ubisolates to different hosts. However, limited analysis done on aphi d transmissions of M2A isolate showed changes in the genotype profile of the aphi d transmitted subisolates. T36 genotype was not detected in any of the 15 aphid tran smitted subisolates analyzed. These results

PAGE 47

35 indicate low or non-aphid transmissibility of T36 genotype. Low transmission rates (1-2 %) of T36 genotype has been reported ear lier (R. H. Brlansky, unpublished data). T68 isolate contains T3 genotype but may also contain VT ge notype as a mixture with T3 genotype. The T68 source isolate showed amplification of T3K17 and VT POL markers in addition to the general markers (T36 CP, CN 487-489 and CN488-491) used as positive controls [Figure 2.3 (A)]. This confirms that it contains T3 genotype. According to the standard T3 genotype, T3k17, VT POL and VT 5 should be amplified (Hilf and Garnsey, 2000b). However, the T68 so urce isolate showed amplification of T3 K17 and VT POL markers but failed to amp lify VT 5 (reported earlier), which is contradictory to the earlier results. None of the T68 plants amplifie d VT 5 even after repeating several times. Inst ead it amplified T30K17 [Fi gure 2.3 (A)], which can be amplified from VT genotype (Hilf and Garn sey, 2000b). Since the T68 source isolate in the present study amplified VT POL and T30K17 markers, it indicates that it may also contain VT genotype. Thus, T68 isolate may be a mixture of VT and T3 genotypes. There was no change in the isolate genotype of the T68 graft transmitted subisolates. However, some changes were found due to the aphid transmission as T68-A (SW) subisolate was only amplified with the VT POL marker and did not show amplification with T3K17 marker. So it could not be assigned a particular genotype based only on the amplification with the VT POL marker and thus came out as a non standard genotype, according to Hilf et al 2000. However, sequencing of the amplified T3 K17 and VT POL markers needs to be done to confirm the presence of T3 and VT genotypes in T68 source isolate and presence/absence of these genotypes in graft and/or aphid transmitted subisolates.

PAGE 48

36 Previously it was found that severe QD isolates from Florida showing reactivity with MCA 13 monoclonal antibody were char acterized as having T36 genotype and isolates showing mild sympto ms and no MCA 13 reactivity we re characterized as having T30 genotype. Hilf and Garnsey, 2002 found that some isolates that were supposed to be mild based on the MCA 13 monoclonal an tibody reactivity, were found to contain the T36 genotype, and some of the isolates ch aracterized as T36 genotype or having mixed infections with T30 and T36 genotypes were reported to be showi ng negative reactivity with MCA 13 monoclonal antibody (Hilf and Garnsey, 2002a). In the further studies done by Brlansky et al, (2003), both MCA 13 positive and negative subisolates were reported from the MCA 13 parent isolate after the aphid tr ansmission and some of the MCA 13 negative subisolates were f ound to contain severe genotypes. Also, in the present study, th e CL isolate, which is supposed to be a mild isolate because of negative reactivity to the MCA 13 monoclonal antibody, was found to be a mixture of T36 and VT genotypes. T36 is a se vere decline isolate from Florida whereas VT is a seedling yellows isolate from Israel.

PAGE 49

37 CHAPTER 3 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND SUBISOLATES BY USING HETERODUPLEX MOBILITY ASSAY Introduction Tristeza disease, caused by Citrus tristeza virus (CTV), is one of the most destructive viral di seases of citrus. Epidemics of this disease have been reported in many citrus producing countries, killing millions of citrus trees on sour orange rootstock. CTV is a phloem-limited, aphid-borne virus, belonging to family Closteroviridae (Bar-Joseph et al 1989). It has flexuous filamentous rod shaped particles and is a mono-partite, positive-sense single-stranded RNA virus. CTV has a narrow host range which is limited mostly to the genus Citrus in family Rutaceae Two capsid proteins (CPs), the 25 kDa major CP and the 27 kDa minor CP, are pr esent which encapsidates about 95% and 5% (on the 5 end) of the genome of CTV, respectively (Febres et al 1996; Satyanarayana et al 2004). CTV causes different symptoms on different hosts. The most important symptoms caused by CTV can be grouped into five major groups, which include mild vein clearing on susceptible hosts, quick dec line on sour orange (QD), seedling yellow on lemons and grapefruit (SY), stem pitti ng on sweet orange(SPO) and stem pitting on grapefruit (SPG) (Garnsey et al 1987; Rocha-Pena et al 1995). The CTV genome encodes 12 ORFs which codes for 19 protein products (Karasev et al 1995a). Two conserved blocks of genes, ORF 1a & 1b and ORFs 3 to ORFs 7 have been identified in CTV which also are cons erved in other closteroviruses (Karasev, 2000). The first gene block, ORF 1a encodes two papain-like proteases,

PAGE 50

38 methyltransferase and helicase domains wh ich are expressed through the proteolytic processing of a polyprotein. The ORF 1b en codes the RNA dependent RNA polymerase (RdRp) which is expressed by +1 ribosomal frameshift (Cevik, 2001; Cevik et al., 1999). The second gene block, ORFs 3 to ORFs 7, encodes a small 6 kDa hydrophobic protein, a 65-kDa homolog of cellular HSP 70 proteins, a 61 kDa protein and two structural CPs. CTV genomic RNA also has two untranslated regions (UTR) of 107 nt and 273 nt at 5 and 3 termini, respectively (Karasev et al 1995b; Pappu et al., 1994). The 3 UTR is highly conserved among different CTV isolates with nucleotide identities as high as 97% whereas the 5 UTR region is hi ghly variable with nucleotid e identities as low as 44%. The most important species of aphids which can transmit CTV are Toxoptera citricida (Kirkaldy), Toxoptera aurantii, Aphis gossypii (Glover) Aphis spiraecola(= citricola) ; their composition and occurrence on c itrus varies depending upon the country and regions (Ahlawat and Raychaudhuri, 1988). The T. citricida (Kirkaldy), commonly known as the brown citrus aphid (BCA), is the most efficient vector of CTV (Hermosa de Mendoza et al., 1984; Yokomi et al 1994). Field isolates of CTV cont ain mixtures of genotypes, which can be separated due to aphid transmission or graft transmission to different hosts (Brlansky et al., 2003; Moreno et al., 1993a; Moreno et al., 1993b). The aphid-transmitted and the grafttransmitted subisolates may differ from the source isolate in their serological and biological properties and also in their dsRNA banding pa tterns upon elec trophoresis (Brlansky et al., 2003; Cambra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b). Various methods have been described for th e characterization of field isolates of CTV. For the biological characterization of CTV isolates, Mexican lime is a universal

PAGE 51

39 indicator for CTV; sour orange is used fo r detection of SY; sweet orange grafted onto sour orange is used to de tect QD strains of CTV (Lee et al 1996). Serological characterization can be d one by using polyclonal and monoclonal antisera produced against a wide range of CTV isolates. Most of these antisera do not provide information regarding the severity of an isolate (Garnsey et al., 1981; Vela et al 1986). However, monoclonal antibody MCA 13, raised against T36 isolate of CTV, differentiates between the mild and severe (QD) isolates of CTV in Florida (Permar et al 1990). MCA13 reacts only with QD strains (MCA13 positive) of CTV, but not with Florida mild strains (MCA13 negative). However, this condition is not always true as some of the isolates detected as ha ving T30 genotype, reacted with the MCA 13 monoclonal antibody. Also, in case of some mi xed CTV infections having both T30 and T36 genotypes showed no reaction w ith MCA 13 monoclonal antibody (Hilf and Garnsey, 2002a). The BCA has been reported to separate the mixtures of CTV genotypes that exist in many field isolates. By using BCA as a tool to separate mixtures of genotypes, the detection of severe subisolates hidden within the mild isolates has been reported from different CTV isolates. Both monocl onal antibody MCA 13 positive and negative subisolates were detected from MCA 13 negative parent isolates (Brlansky et al 2003). In the Florida bud wood certification program, trees which react with MCA 13 cannot be used for budwood. However, some CTV isolates have been reported which cause decline on sour orange and yet are MCA 13 negative (Hilf and Garnsey, 2002b). The dsRNA banding patterns upon electrophore tic separation have been used for the identification of individual viruses and vi rus groups and also for the identification of

PAGE 52

40 the virus strains. The number and intensity of the dsRNA banding patterns change with the change in the host species (Jarupat et al 1988). However, dsRNA patterns are not always correlated with the pathogenic ch aracteristics of CTV isolates. The RT-PCR method for detection of CTV has successfully been used for the detection of CTV in single and groups of 3, 5 and 10 aphids from three different aphid species T. citricida, A. gossypii and Myzus persicae (Mehta et al 1997). The Multiple Molecular Mark er (MMM) is a method for molecular characterization of the CTV isolates and identification of CTV genotypes. The MMM method is based on the amplification of selected regions of the CTV genome using CTV genotype specific primers, designed from non-conserved regions of VT, T3, T30 and T36 CTV isolates (Hilf and Garnsey, 2000). The method provides a rapid technique for the detection of CTV genotypes (Hilf and Garnsey, 2000), however the classification is limited to only four genotypes. The single-strand conformation polymorphism (SSCP) analysis is rapid and simple technique to detect the presen ce of minor variations in th e nucleotide sequence of DNA fragments (Rubio et a l. 2000). However, the fragments size should be small in order to get high sensitivity (Maynard and Upadhyaya 1998). This method will identify single base polymorphisms in the amplicons of upto 200 bp. The heteroduplex Mobility Assay (HMA ) was developed for the detection of unknown genotypes present in the mixed CTV in fections, which may not be detected by other PCR based detection me thods (Manjunath et al. 2002). HMA is rapid and simple method for the detection and estimation of the genotypic differences between viral strains. The DNA heteroduplexes are formed as a result of nucleotide differences

PAGE 53

41 between closely related sequences, upon dena turation and reannealing of the sequences (Delwart et al 1993). The DNA heteroduplexes, thus formed, have a reduced mobility on polyacrylamide gel electrophoresis and the re duction in mobility is proportional to the degree of divergence between the sequences (Delwart et al 1993). The sensitivity of HMA has been reported to be about 5 %, however sequence difference as low as 2.3 % has been reported (Berry and Rey, 2001). Two new genotypes (T2K and T38K) have been detected from the severe grapefruit stem pitting Florida isolate T3800 using HMA (Manjunath et al 2000). HMA analysis has been used for the characterization of number of human RNA viruses and plant RNA and DNA viruses (Berry and C., 2001; Cai et al 1991; Delwart et al., 1993; Lin et al 2000). The biological characterization of CTV isolates is time consuming as QD symptoms takes 12-15 months under ideal greenhouse conditions. However the molecular techniques for detection and char acterization of CTV genotypes in the field isolates though are rapid but limited by the amount of sequence information available for designing such experiments. The presen t study was conducted in order to better understand the population diversity of CTV (pre sence of sequence variants or genotypes) through detection and sequence comparis on of genotypes by using the HMA. The population complex of three Florida isolates of CTV and graft and aphid transmitted subisolatesfrom these isolates were an alyzed by using HMA method. Both MCA 13 positive and MCA 13 negative source isolates of CTV were used. The resultant sequence information generated which will be help ful in designing rapid and more efficient methods of detection of different strains of CTV in the future.

PAGE 54

42 Material and Methods Virus Isolates Three CTV isolates from Florida: Chie fland (CL), Mcn2a (M2A) and T68, were obtained from University of Florida, Citrus Research and Education Center (CREC) Lake Alfred, Florida, USA. The CL and M2A isol ates are native to Fl orida whereas T68 was imported to Florida in an ill egal budwood from Australia, but since the isolates was present in the field for several years; it is considered a Florida isolate. These source isolates were maintained on the sweet orange plants ( Citrus sinenesis (L.) Osbeck) in the greenhouse at CREC. CL isolate was, collected from a Meyer le mon tree in Chiefland, Florida. It does not react with the monoclonal antibody, MCA 13 which has been report ed to discriminate between mild and severe isolates in Florida (Permar et al., 1990). T68 isolate is MCA 13 positive isolate collected from Ellendale mandrin plant from Dundee, Florida. Each of the three isolates was bud grafted onto three differe nt host species (3 plants each) of citrus: Grapefruit ( Citrus paradisi Macfad), Mexican lime ( Citrus aurantifolia Swingle) and sweet orange ( Citrus sinenesis (L.) Osbeck) cv. Madam Vinous. The graft transmitted subisolates are designated by the suffix G followed by the abbreviation for the name of the host species in the parentheses. Thus three graft transmitted subisolates on Grapefruit (GF), Me xican lime (ML) and sweet orange (SW) were obtained, for each isolate, with the de signation ending with [-G(GF)], [-G(ML)] and [-G(SW)], respectively. Aphid transmissions were done using BCA from each of the graft transmitted subisolates of the T68 isolat e, onto Mexican lime as th e receptor host. About 70-100 aphids were fed on the new fl ushes plants inoculated with each subisolate. After an

PAGE 55

43 acquisition access period (AAP) of 24h, aphids were gently picked by using #00 Red sable brushes (Ted Pella Inc., Redding, CA) a nd placed five aphids per plant, on each of the ten virus-free Mexican lime seedlings. In oculation access period (IAP) of 24 h. was used. Then the aphids were killed by sprayi ng with an insecticid e (0.25% Malathion). The aphid transmitted subisolates are designated by the suffix A followed by the abbreviation for name of the host species, used for the acquisition of the virus, in the parentheses. Thus three aphid transmitted s ubisolates on Grapefruit (GF), Mexican lime (ML) and sweet orange (SW) were obtai ned, with the designation [T68-A(GF)], [T68A(ML)] and [T68-A(SW)], respectively. Presence of the virus in the graft transmitted and aphid transmitted subisolates was confirmed by using double antibody sandwich indirect (DAS)-ELISA as described earlier (Brlan sky et al., 2003; Nikolaeva et al., 1995; Nikolaeva et al., 1996a; Nikolaeva et al., 1996b). RNA Isolation and Complement ary DNA (cDNA) Synthesis About 100 mg of CTV-infected tissue fr om bark and leaves was pulverized in liquid nitrogen using a mortar and pestle and the total R NA was extracted by using the RNeasy Plant Mini Kit (QIAGEN, Valenc ia, CA) according to the manufacturers instructions. The final total RNA extraction was resuspended in 30 l of RNase-free water, and stored at -80 C. For the fi rst strand complimentary DNA (cDNA) synthesis, 10 l of total extracted RNA was mixe d separately with 200 nM of CN 491 (5GTGTARGTCCCRCGCATMGGAACC3) antisen se primer (Table 2.1), centrifuged at 10,000 rpm for 10 s, then incubated at 70 C for 10 min and transferred to ice for 5 min. A reaction mixture was prepared by adding 5X first strand buffer [ 250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM MgCl2], 0.1 M dith iothreiotol (DTT), 200 M of each dNTPs (Promega, Madison, WI) and sterile distilled water. This reaction mixture was incubated

PAGE 56

44 at 42 C for 2 min. and then kept at room te mperature for 10 min. Twenty U of Superscript II RNase H-Reverse transcriptase (Invitrogen, Carlsbad, CA) and 40 U of RNasin (Promega, Madison, WI) was added to the reaction mixture and centrifuged at 10, 000 rpm for 10 s. Nine l of this cocktail reaction mixture was ad ded to each tube containing the RNA preparations. Twenty l of the tota l content was incubated at 50 C for 1h, 72 C for 15 min. and then transferred to ice. Polymerase Chain Reaction (PCR) About 400 bp region of the CTV genome (n t 1084-1484) in the protease (L1) domain of ORF 1a was amplified from 5 l of the cDNA in a 50 l reaction volume, using the 5 U of Taq DNA polymerase (Promega, Madison, WI), 1X PCR reaction buffer, 2.5 mM MgCl2, 200 M of each dNTPs, 200 nM of each of CN 488 (5TGTTCCGTCCTGSGCGGAAYAATT3) and CN 491 (5GTGTARGTCCCRCGCATMGGAACC3) primer pair. PCR was performed by using Biometra UNO (1984) Thermoblock temperature thermocycler. Amplification parameters were 94 C for 2 minutes, 30 cycles of 94 C for 30 seconds, 62 C for 45 seconds, 72 C for 45 seconds, followed by incubation at 72 C for 10 minutes. RT-PCR products were analyzed by electrophoresis on 1% agarose gels in 1X TAE buffer (40 mM Tris-Acetate and 1 mM EDTA, pH 8.0) at 100 volts fo r 40 45 minutes, containing 200 ng of ethidium bromide per ml. A Biorad Gel-Doc imaging system was used for visualization of DNA bands. DNA Purification, Cloning and Transformation The 400 bp PCR product from the agarose ge l was excised using a sterilized razor blade, and purified by using Qiagen Ge l Purification kit (Qiagen, Valencia, CA) according to the manufacturers protocol. Final elution was made in 50 l of the elution

PAGE 57

45 buffer. The gel purified PCR products were then ligated into pCR-2.1 TOPO plasmid vector using the 5 min ligation protocol according to the manufacturer (Invitrogen, Carlsbad, CA). Briefly, two l of the gel pur ified PCR product was mixed with 1 l of the salt solution (200 mM NaCl + 10 mM MgCl2), 1 l of the TOPO vector and 2 l of sterile water. The ligation reaction was perfor med at the room temperature for 5 min and then the ligation reaction mixtur e was transferred to ice. Two l of the ligation reaction mixture wa s then added to the 50 l of the DH-5 E. coli competent cells, which were then incu bated on ice for 30 min. The cells were heat-shocked at 42 C for 30 sec, transferre d to ice and 600 l of Luria-Bertani (LB) media was added to the mixture. The cells were grown at 37 C and 200 rpm for 1 h and about 50-100 l cells were plated on LB agar plates containing 50 g/ml of kanamycin and 80 ng/ml of X-gal. and grown overnight at 37 C. A master plate with putative recombinant white colonies was prepared by subculture on a fresh LB agar plate supplemented with kanamycin. Colony PCR and Heteroduplex Mobility Assay (HMA) The bacterial colonies were scre ened by colony PCR by extraction of individual colonies in an extraction buffe r (1 % Triton X, 20mM Tris HCl, pH 8.0 and 2mM EDTA, pH 8.0). The extracts were heated at 95 C for 10 min. Five l of the extract was used for PCR in a 50 l reaction volume, using 200 nM each of CN 488 and CN 491 primers and 5 U of Taq DNA polymerase (Promega) according to the manufacturer. PCR amplification parame ters were 94 C for 2 minutes; 30 cycles of 94 C for 30 seconds, 62 C for 45 s econds, 72 C for 45 seconds; followed by incubation at 72 C for 10 minutes. The PCR products were analyzed

PAGE 58

46 electrophoretically us ing 1% agarose gels and visu alized on a Biorad Gel-Doc imaging system. About 25-50 clones from each of the three source isolates (M2A, CL and T68) and each of the graft and aphid transmitted sub-isolates were analyzed by HMA. For each isolate and subisolate, one of the amplified clones was selected for use as the reference clone and the rest of the clones (test clones) were scr eened against the reference clone. For the formation of heteroduplexes, 4.5 l of the colony PCR product from the reference clone was mixed with the 4.5 l of the test clone and 1 l of 10X annealing buffer (1.0 M NaCl, 100 mM Tris-HCl pH 7.8 and 20 mM ED TA). The DNA mixture was denatured at 95 C for 10 min, then slowly annealed at 68 C for 1 h and then held at 0 C for 10 min. The mixture was then electrophoresced on 10 % Criterion precast polyacrylamide gel (Biorad) in Tris-borate EDTA (TBE) bu ffer (0.088 M tris-borate, 0.089 M boric acid, 0.002 M EDTA) at 140 volts for 3 h at 4 C in a Criterion cell (B iorad). The gel was then stained in 1X TBE buffer containing 200 ng/ml of ethidium bromide. A Biorad GelDoc imaging system was used for visualization of DNA heteroduplex bands. All the clones that showed heteroduplex formation w ith the selected refe rence clone during the first screening were selected for the second HMA screening by using one of these clones as a new reference clone. Thus the total number of clones from each isolate and subisolate were narrowed down to 2-4 di fferent groups (genotypes), based on the nucleotide sequence differences, after 2-3 HMA screenings. The different genotypes identified after HMA (Table 3.8) from the source isolates are designated by the suffix S0, whereas the genotypes obtained from the graft/aphid transmitted subisolates were designated by the suffix G/A, followed by the host species

PAGE 59

47 such as GF (1), ML (2) and SO (3). This is followed by the name of the genotype (A, B, C and D) at the end, where genotype A re fers to the most abundant genotype and genotype D refers to the least of the genotype s analyzed. For example, the most abundant genotype obtained from the T68 graft transmitted subisolate on sweet orange [T68-G (SW)] will be designated as T68G3A and the most abundant genotype from the CL source isolate will be designated as CLS0A. Sequencing and Sequence Analysis About 2-3 clones from each genotype obt ained during HMA from each isolate and subisolates were sequenced by the dideoxynucle otide chain termination method using the M13 forward primer following standard protocol at the DNA Sequencing Core Laboratory at University of Flor ida, Gainesville, Fl (Sambrook et al 1989). A single representative clone from each genotype was selected for the further analysis. Sequence analysis was done by using CLUSTAL X (Thompson et al 1997) and Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997). The phylogenetic relationship of the sequences of the region amplified by primer pair CN 488 and CN 491 from the CL, M2A and T68 isolates with some of the exotic and Florida CTV isolates (Roy and Brlansky, 2004) were determined using program CLUS TAL X and the dendograms were visualized using the program TreeView version 1.6.6. Results The cloned DNA fragments from three Flor ida CTV source isolates: CL, M2A and T68 and their graft transmitted subisolates we re analyzed by HMA for understanding the population diversity of CTV in these plants. The heteroduplex (HD) bands representing the presence of the divergent viral RNA populat ions (genotypes) within a given isolate or subisolate were observed in most cases (Fi gure 3.1-3.4). The clones representing different

PAGE 60

48 genotypes were sequenced and the nucleotide sequence was compared for homology with the other related CTV isolates from different citrus growing regions. Isolate: CL The result of the nucleotide sequence co mparison of the genotypes obtained after HMA for the source isolate CL and graft tr ansmitted subisolates [CL-G (GF), CL-G (ML) and CL-G (SW)] are shown in Table 3.1 an d the summary of results is presented in Table 3.5. Based on HMA of 25 clones, the CL source isolate was found to contain at least three different genotypes designated CL S0A (47 % of the clones), CLS0B (39 % of the clones) and CLS0C (18 % of the clones) (Table 3.5). Sequences of representative clones from each genotype showed that the sequences differed from one another by 916% (Table 3.1). The % number of clones, out of the total nu mber of clones screened, for each isolate or subisolate will be used in pa rentheses along with the name of the genotype throughout this chapter. When the cloned DNA fragments from CL source isolate and the graft transmitted subisolates [CL-G (GF), CL-G (ML) and CL -G (SW)] were analyzed, heteroduplexes were observed in all of them [Figure 3.1 (A -C)]. As expected, heteroduplex formation was present in positive control [Lane 1, Figur e 3.1 (A-D)] where PCR products from two clones with known sequence diversity were used but not in lane C1 (Figure 3.1) which contained PCR product from the reference clone alone. CL source isolate is a mixture of thre e genotypes [Figure 3.1 (A)]. The genotypes from the isolate CL [CLS0A (47 %), CLS0 B (39 %), and CLS0C(18 %)], subisolate CLG(GF) [CLG1A (48 %), CLG1B (32 %) and CLG1C(20 %)], subisolate CL-G(ML) [CLG2A (56 %), CLG2B (36 %) and CLG2C (8 %)] and subisolate CL-G(SW) [CLG3A (52 %), CLG3B (30 %) and CLG3C (18 %)] were obtained (Table 3.5).

PAGE 61

49 The genotypes CLS0A CLS0B, CLS0 B CLS0C and CLS0A CLS0C share 84%, 91% and 92% sequence homology, respecti vely. The CLS0A genotype is similar (98% sequence homology) to the Indian CT V isolates B225 and B219. It also showed 94% and 96% sequence homology with VT and SY 568 CTV isolat es, respectively. According to the phylogenetic tree analysis, CLS0A genotype was included in the genotype specific group (group) VI along with the B225 and B219 CTV isolates (Figure 3.5). The sequence homology of CLS0A genotype with the other CTV Florida isolates such as T36, T30 and T3 was 81%, 90% and 92%, respectively. The CLS0B genotype showed a sequence homology of 95% with the BAN-2 CTV isolate from India. It also has sequence homology of 92% w ith the T36 CTV isolate from Florida. Genotype CLS0B was thus placed in group 1b along with BAN-2 isolate and was not included in group 1a in the phyloge netic tree with T36 and QAHA CTV isolates (Figure 3.5). However as compared with th e other two Florida isolates, T30 and T3, it showed only 84% and 83% sequence homo logy. The third genotype, CLS0C showed only 92% and 91% nucleotide sequence homol ogy with the B225 and B219 Indian CTV isolates and is 91% similar to the SY568 CTV isolate from California. CLS0C was placed in a separate group IIa. It showed onl y 86-87% similarity with the other Florida CTV isolates. CL-G (GF), CL-G (ML) and CL-G (SW) subisolates also were mixture of genotypes [Figure 3.1 (B-D)]. Three different genotypes were obtained from CL-G (GF), CL-G (ML) and CL-G (SW) subisolates. The CLG1A, CLG2A and CLG3A genotypes showed high sequence homology of 98% with the Indian CTV isolates B225 and B219 and 94% and 96% sequence homology with VT and SY 568 CTV isolates, respectively.

PAGE 62

50 Thus the CLG1A, CLG2A and CLG3A genot ypes were placed in group VI in the phylogenetic tree along with the B219, B225 CTV isolates from India (Figure 3.5) However, it showed low sequence homology of 81%, 90% and 92% with the other CTV Florida isolates such as T 36, T30 and T3, respectively. The CLG1B, CLG2B and CLGG3B genot ypes showed high sequence homology (94-95%) with the BAN-2 CTV isolate from I ndia and is 92% similar with the T36 CTV isolate from Florida. Due to the highest homology with BAN-2 CTV isolate CLG1B, CLG2B and CLG3B genotypes were included in the group I along with BAN-2 and T2K CTV isolates (Figure 3.5). However as compar ed with the other two Florida isolates (T30 and T3), CLG1B, CLG2B and CLG2B ge notypes showed only 81% 84% sequence homology. The CLG1C genotype is most similar to B 165 isolate from India and Nartia isolate from South Africa with 94% and 93% nuc leotide sequence homology, whereas the CLG2C and CLG3C genotypes are similar to B225 and B219 isolates from India (93% & 92% homology) and only shares 82% to 84% homology with the B165 and Nartia isolates. Due to the low homology with any of the isolate, CLG2C and CLG3C genotypes were grouped in separate group IIa, whereas CLG1C genotype was included in the group IIb (Figure 3.5). Isolate: M2A The result of the nucleotide sequence co mparison of the genotypes obtained after HMA for the source isolate M2A and graft transmitted subisolates [M2A-G (GF), M2AG (ML) and M2A-G (SW)] are shown in Ta ble 3.2 and the summary of results is presented in Table 3.6. When the cloned DNA fragments from M2A source isolate and the graft transmitted subisolates [M2A-G (GF), M2A-G (ML) and M2A-G (SW)] were

PAGE 63

51 analyzed, heteroduplexes were observed in al l of them [Figure 3.2 (A-D)] indicating the presence of mixture of genotypes. As exp ected, heteroduplex formation was present in positive control [Lane C, Figure 3.2 (A-D)] where PCR products from two clones with known sequence diversity were used, but not in lane M1 (Figure 3.2) which contained PCR product from the reference clone alone. [Lane M1, Figure 3.2 (A-D)]. M2A isolate is a mixture of three ge notypes [Figure 3.2 (A-D)]. The genotypes from the isolate M2A [M2AS0A (84 %), M2AS0B (8 %), and M2AS0C (8 %)], subisolate M2A-G(GF) [M2AG1A (82 %), M2AG1B (10 %) and M2AG1C (8 %)], subisolate M2A-G(ML) [M2AG2A (85 %), M2AG2B (10 %) and M2AG2C (5 %)] and one genotype from subisolate M2A-G(SW) [M2AG3A (100 %)] were obtained (Table 3.6). The genotypes M2AS0A M2AS0B, M2AS0B M2AS0C and M2AS0A M2AS0C share 84%, 82% and 84% sequen ce homology, respectively. The M2AS0A genotype showed highest sequence homology of 98% and 99% with the Indian CTV isolates B225 and B219, respectively. It also showed 97% and 95% sequence homology with VT and SY 568 CTV isolates, respect ively. According to the phylogenetic tree analysis, M2AS0A genotype was included in the genotype specific group VI (group) along with the B225 and B219 CTV isolat es. The sequence homology of M2AS0A genotype with the other CTV Florida isolat es such as T36, T30 and T3 was 81%, 92% and 90%, respectively and these were included in separate groups (Figure 3.6, groups Ia, III and IV). The M2AS0B genotype showed sequence homology of 94% with the BAN-2 CTV isolate and also showed 92% nt homology w ith the T36 CTV isolate from Florida.

PAGE 64

52 Genotype M2AS0B was thus placed in gr oup 1b along with BAN-2 isolate and was not included in group 1a in the phylogenetic tree with T36 and QAHA CTV isolates. However the other two Florida isolates, T 30 and T3 showed only 84% and 83% sequence homology and were placed in separate groups (Figure 3.6). The third genotype, M2AS0C is similar to the T38K isolate showing 99% similarity (group II) and is completely different from the other Florida CTV isolat es (only 80-84% similarity; Figure 3.6, groups Ia, III and IV). The M2A-G(GF), M2A-G(ML) and M2A-G(SW ) subisolates also showed mixture of genotypes [Figure 3.2 (B-D)]. The M2AG1A, M2AG2A and M2AG3A genotypes showed high sequence homology of 98 99% with the Indian CTV isolates B225 and B219 and 95% 97% sequence homology with VT and SY 568 CTV isolates, respectively. However, it showed low se quence homology of 81%, 92% and 90% with the other CTV Florida isolates such as T36, T30 and T3, respectively. Thus the M2AG1A, M2AG2A and M2AG3A genotypes we re placed in group VI in the phylogenetic tree along with the B219, B225 CT V isolates from I ndia (Figure 3.6). The M2AG2B genotype showed sequence homology of 96% with the T36 CTV isolate from Florida and sequence homology 92% with the BAN-2 CTV isolate from India. Because of its high nt sequence homology with the T36 CTV isolate than the B165 isolate, M2AG2B genotype was placed in sub group Ia along with the T36 and QAHA isolates, whereas BAN-2 isolate was placed in the s ub group Ib (Figure 3.6). However it showed low nt sequence homology (only 82% 84%) with T30 and T3 Florida CTV isolates (Figure 3.6, groups III and IV). The M2AG1 B genotype showed sequence homology of 93% with the BAN-2 CTV isolate and also showed 92% nt homology with the T36 CTV

PAGE 65

53 isolate from Florida. Genotype M2AG1B wa s thus placed in group 1b along with BAN-2 isolate and was not included in group 1a in the phylogenetic tree with T36 and QAHA CTV isolates (Figure 3.6). The genotype M2AG2C from is similar to T38K isolate with 99% nucleotide sequence homology (Figure 3.6, group II). Isolate: T68 The result of the nucleotide sequence co mparison of the genotypes obtained after HMA for the source isolate T68 and the graft and aphid transmitted subisolates are presented in the Table 3.3 and Table 3.4. The summary of the results is shown in Table 3.7. When the cloned DNA fragments from T68 source isolate and the graft transmitted subisolates [T68-G (GF), T68-G (ML) and T 68-G (SW)] were analyzed, heteroduplexes were observed in all of them [Figure 3.3 (A -D]. Different HD banding patterns were also observed when the aphid transmitted subiso lates [T68-A (GF), T68-A (ML) and T68-A (SW)] were analyzed by using HMA [Figur e 3.4 (A-C)]. As expected, heteroduplex formation was present in positive control (Lane C, Figure 3.3 and 3.4) where PCR products from two clones with known sequence di versity were used, but not in lane T1 and Ta1 which contained PCR pr oduct from the reference cl one alone. (Lane T1, Figure 3.3and Lane Ta1, Figure 3.4). Two genotypes from the isolate T68 [T68S0A (68 %) and T68S0B (32 %)], subisolate T68-G (GF) [T68G1A (80 %) and T68G1B (20 %)], subisolate T68-G (ML) [T68G2A (68 %) and T68G2B (32 %)] subi solate T68-G (SW) [T68G3A (76 %) and T68G3B (24 %)], four genotypes from subiso late T68-A (GF) [T68A1A (64 %), T68A1B (20 %), T68A1C (8 %) and T68A1D (8 %)] three genotypes from subisolate T68-A (SW) [T68A3A (92 %), T68A3B (4 %) and T6 8A3C (4 %)] were obtained (Table 3.7).

PAGE 66

54 T68 source isolate is a mixture of more than one genotype (Figure 3.3 and 3.4) as different HD bands were obs erved in HMA. Genotype T6 8S0A and genotype T68S0B shared only 85% sequence homology. The T 68S0A genotype is similar to B165 CTV isolate with 99% nucleotide sequence homol ogy and was placed in the group II along with the Nartia mild isolate and B165 CTV isolate (Figure 3.7). However it showed very low sequence homology of 80% 86% with the other Florida CTV isolates (T36, T30 and T3, respectively), which were placed in sepa rate groups (Figure 3.7, gr oup I, III and IV). The T68S0B genotype showed sequen ce homology of 93% with the T30 CTV isolate from Florida; however it also s howed sequence homology of 92% with the B225 CTV isolate from India and SY568 CTV isolat e from California. It showed only 80% and 89% sequence homology with the T36 and T3 CT V isolates from Florida. Because of the intermediate homology with T30 and SY568/VT isolates and low homology with the T36 and T3, it was placed in separate group VI which is in between group III (T30) and group V (SY568 and VT). The T68-G(GF), T68-G(ML) and T68-G(SW) subisolates also showed mixture of two different genotypes [Figure 3.3 (B-D )]. The genotypes T68G1A, T68G2A and T68G3A showed high sequence homology rang ing from 96% to 99% with the Indian CTV isolates B165 and were placed in the group II along with the B165 and Nartia isolate of CTV (Figure 3.7). However, it s howed low sequence homology of (80% 86% ) with the other CTV Florida isolates such as T36, T30 and T3, which belonged to separate group in the phylogenetic tree (Fi gure 3.7, groups I, III a nd IV). The T68G1B, T68G2B and T68G3B genotypes were 92% si milar with the B225 CTV isolate from India and SY568 isolate from California a nd 93% nucleotide sequence homology with

PAGE 67

55 the T30 Florida CTV isolate and showed low sequence homology (80% 89%) with T36 and T3 isolates. These genotypes were pla ced in group VI along with the T68S0B genotype from the T68 source isolate. Aphid transmitted subisolates [T68-A (GF) and T68-A (SW)] were also analyzed for the detection and characterization of population diversity, by using HMA. The HD banding patterns for the aphid transmitted subisolates were strikingly different from the T68 isolate and the graft transmitted subi solates (Figure 3.4). The T68A1A, T68A1B, T68A1C and T68A1D share only 82 93% sequence homology among them. T68A3A, T68A3B and T68A3C genotypes shared 85% 90% nt sequence homology among them. The T68A1A and T68A3A genotypes are very similar to the B165 Indian isolate (98 99% homology) and are more distantly related to the T36, T30 and T3 Florida CTV isolates (80 86% homology). In the phylogenetic tree T 68A1A and T68A3A genotypes were included separately in the group II along with the T68S0A, B165 and Nartia CTV isolates. T68A1B genotype is more closely related to the B225, T30 and SY568 isolates with 92 93% nucleotide sequence homo logy (Figure 3.8). Two new genotypes: T68A1C (97% homology with T2K CTV isol ate) and T68A1D (99% homology with T30 CTV isolate) were detected only after aphi d transmissions and are placed in the group I (along with T36 isolate) and group III (along with T30 CTV is olate), respectively (Figure 3.8). T68A1C and T68A1D were neither detect ed from the T68 source isolate nor from the graft transmitted subisolates. T68A3B genotype is similar to the B225 Indian CTV isolate with 99% sequence homology and also showed 96% and 94% nt sequence similarity with the SY568 and VT CTV isol ates. Thus it was included in the group VI with B225.1 and B219 Indian CTV isolates. T68A3C genotype however is a relatively

PAGE 68

56 new genotype with less than 90% seque nce homology with the other known CTV isolates.

PAGE 69

57Table 3.1. The comparison of nucleotide sequence identities of the different genotypes from the CL isolate, CL-G(GF) and CL-G(M L) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon fr om ORF 1a of CTV genome, with the already sequenced CTV isolates a nd some of the other isolates( ) as described earlier (R oy and Brlansky, 2004) and retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al. 1997) and Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997). CLAS0B CLAS0C CLG1B CLG1A CLG1C CLG2A CLG2B CLG2C CLG3A CLG3B CLG3C B225.1 B219 B165 BAN-2 T36 T30 T3-2 SY568 VT Narita248 T2K CLAS0A 84 92 84 99 88 99 83 93 98 84 91 98 98 86 82 81 92 90 96 94 85 84 CLAS0B 91 99 84 82 84 98 90 83 99 92 85 84 82 95 92 84 82 85 83 81 98 CLAS0C 91 92 85 92 90 98 92 91 99 92 91 84 88 86 87 86 91 89 82 90 CLG1B 84 82 84 98 90 99 84 92 84 84 82 95 92 84 82 84 83 81 98 CLG1A 89 99 84 93 84 99 91 98 98 86 82 81 92 89 97 94 85 84 CLG1C 89 81 85 88 81 84 88 87 94 80 80 87 85 87 85 93 82 CLG2A 83 93 99 82 92 99 98 86 82 81 92 89 97 94 85 83 CLG2B 89 83 98 90 83 83 81 94 92 83 81 84 82 80 97 CLG2C 92 90 98 93 92 84 87 86 87 87 92 90 82 89 CLG3A 84 91 98 99 86 82 80 91 90 96 92 84 84 CLG3B 92 84 85 82 95 93 82 83 84 85 81 98 CLG3C 91 92 84 88 87 86 85 90 87 82 91 B225.1 98 86 82 81 92 90 97 95 85 84 B219 85 81 80 92 89 97 95 84 83 B165 80 80 86 83 85 83 97 83 BAN-2 90 82 80 82 80 81 95 T36 82 81 82 80 79 92 T30 89 92 90 84 83 T3-2* 90 87 82 82 SY568 95 84 84 VT 82 82 These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL. The nucleotide sequences were retrieved fr om Genbank database [Accession number U16304 (T36), AF260651 (T30), AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).

PAGE 70

58Table 3.2. The comparison of nucleotide sequence identities of th e different genotypes from the M2 A isolate, M2A-G(ML) and M2AG(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already sequenced CTV isolat es and some of the other isolates( ) as described earlier (Roy and Brlansky, 2004) and retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) and Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997). M2AS0B M2AS0C M2AG1A M2AG1B M2AG1C M2AG2A M2AG2B M2AG2C M2AG3A B225.1 B219 B165 BAN-2 T30 T3C5 T38K SY568 VT T36 Narita-248 QAHA M2AS0A 84 84 99 85 83 98 84 83 99 99 98 85 82 92 90 84 97 95 81 85 79 M2AS0B 82 85 99 83 84 94 82 85 85 84 83 94 84 83 82 85 83 92 81 90 M2AS0C 84 83 98 83 82 99 84 84 83 90 81 84 84 99 83 81 80 89 79 M2AG1A 85 84 99 83 83 99 98 97 86 80 90 90 84 96 94 81 84 78 M2AG1B 82 84 93 83 99 86 84 84 93 83 83 82 85 84 92 81 91 M2AG1C 85 82 89 86 85 82 91 82 84 84 99 82 81 80 87 79 M2AG2A 83 83 99 99 98 85 82 92 91 84 97 95 81 84 79 M2AG2B 82 84 83 83 82 92 84 83 82 85 82 96 81 94 M2AG2C 84 83 83 89 80 83 84 99 83 81 80 89 78 M2AG3A 99 99 86 82 92 91 84 97 95 81 85 79 B225.1 98 86 82 92 91 84 97 95 81 85 79 B219 85 81 92 90 83 97 95 80 84 78 B165 80 86 84 89 85 83 80 97 78 BAN-2 82 81 80 82 80 89 81 88 T30 90 84 92 90 81 84 80 T3C5* 84 90 88 81 82 79 T38K* 83 82 80 89 78 SY568 95 82 84 80 VT 80 82 78 T36 79 98 Narita-248* 77 These nucleotide sequences were kindly provi ded by Dr. Avijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL. The nucleotide sequences were retrieved fr om Genbank database [Accession number U16304 (T36), AF260651 (T30), AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).

PAGE 71

59Table 3.3. The comparison of nucleotide sequence identities of the different genotypes from the T68 isolate, T68-G(GF), T68-G(M L) and T68-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already se quenced CTV isolates and so me of the other isolates( ) as described earlier (Roy and Brlansky, 2004) and retrieved from Genbank. Sequence analys is was done by using CLUSTAL X (Thompson et al. 1997) and Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997). T68S0B T68G1A T68G1B T68G2A T68G2B T68G3A T68G3B B225.1 B165 T36 T30 T3C5 T38K T2K SY568 VT QAHA Narita248* T68S0A 85 97 86 99 85 99 85 86 99 80 86 84 89 82 86 83 78 97 T68S0B 87 98 85 98 85 99 92 85 80 93 89 82 82 92 89 78 84 T68G1A 87 96 87 96 87 86 96 79 86 83 87 81 85 83 77 94 T68G1B 85 98 85 98 93 85 80 93 90 83 82 92 90 78 84 T68G2A 85 99 85 85 98 80 85 83 89 82 85 83 78 97 T68G2B 86 98 92 85 81 93 90 83 83 91 89 79 84 T68G3A 85 85 99 80 85 83 89 83 85 83 78 97 T68G3B 92 85 81 93 90 83 83 91 89 79 84 B225.1 86 81 92 91 84 84 97 95 79 85 B165 80 86 84 89 83 85 83 78 97 T36 82 82 80 92 82 80 98 79 T30 90 84 83 92 90 80 84 T3C5* 84 82 90 88 80 82 T38K* 83 83 82 79 89 T2K* 84 82 90 81 SY568 95 80 84 VT 78 82 QAHA 77 These nucleotide sequences were kindly provided by Dr. Av ijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL. The nucleotide sequences were retrieved from Ge nbank database [Accession number U16304 (T36), AF260651 (T30), AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).

PAGE 72

60Table 3.4. The comparison of nucleotide sequence identities of the different genotypes from the T68 isolate, T68-A(GF), T68-A(M L) and T68-A(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already se quenced CTV isolates and so me of the other isolates( ) as described earlier (Roy and Brlansky, 2004) and retrieved from Genbank. Sequence analys is was done by using CLUSTAL X (Thompson et al. 1997) and Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997). T68S00B T68A12A T68A1B T68A1C T68A1D T68A3A T68A3B T68A3C B165 B225.1 T36 T30 T3C5 T38K T2K SY568 VT QAHA Narita248 T68S0A 85 99 86 82 86 99 85 90 99 86 80 86 84 89 82 86 83 78 97 T68S0B 85 97 82 92 86 92 93 85 92 80 93 89 82 82 92 89 78 84 T68A1A 85 82 85 98 84 90 99 85 80 86 83 89 82 86 83 78 97 T68A1B 82 93 85 91 94 85 92 80 93 90 83 82 92 89 79 84 T68A1C 83 82 84 84 82 84 91 84 82 82 97 84 83 89 81 T68A1D 85 91 89 86 92 82 99 89 84 83 91 89 80 84 T68A3A 85 90 98 86 80 86 84 89 82 85 83 78 97 T68A3B 90 85 99 81 91 90 84 83 96 94 79 84 T68A3C 90 90 82 90 88 86 84 90 88 80 89 B165 86 80 86 84 89 83 85 83 78 97 B225.1 81 92 91 84 84 97 95 79 85 T36 82 82 80 92 82 80 98 79 T30 90 84 83 92 90 80 84 T3C5* 84 82 90 88 80 82 T38K* 83 83 82 79 89 T2K* 84 82 90 81 SY568 95 80 84 VT 78 82 QAHA 77 These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath,CREC, Lake Afred, FL. The nucleotide sequences were retrieved from Genbank database [Accession number U16304 (T36), AF260651 (T30), AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).

PAGE 73

61 Figure 3.1: Ethidium-bromide stained 10% polyacrylamide ge ls showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate CL and CL-G(GF), CL-G(ML) and CL-G(SW) subisolates. Each lane represents the HD formed between the reference clone and each of the test clones. Lane C represents the pos itive control. Fig. A, B, C and D shows the formation of HD from the CL sour ce isolate, CL-G(GF), CL-G(ML) and CL-G(SW) subisolates, respectively. For each figure (A, B, C and D) separately; Lane C1 shows the Clone # 1(C1) was used as a reference clone and shows the homoduplex band. Lane C2-C 24 represents the clones used as test clones (C2-C24) show ing either homoduplex or heteroduplex formations.

PAGE 74

62 Figure 3.2: Ethidium-bromide stained 10% polyacrylamide ge ls showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV source isolate M2A, M2A-G( GF), M2A-G(ML) and M2A-G(SW) subisolates. Each lane represents the HD or homoduplex (HmD) formed between the reference clone and each of the test clones. Lane C represents the positive control. Fig. A, B C and D shows the formation of HD from the M2A source isolate, M2A-G(GF), M2A-G( ML) and M2A-G(SW) subisolates, respectively. For each figure (A, B, C and D) separately; Lane M1 shows the Clone # 1(M1) was used as a referenc e clone and shows the HmD band. Lane M2-M24 represents the clones used as te st clones (M2-M25) showing either homoduplex or heteroduplex formations.

PAGE 75

63 Figure 3.3: Ethidium-bromide stained 10% polyacrylamide ge ls showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate T68 and T68-G(GF), T68G(ML) and T68-G(SW) subisolates. Each lane represents the HD or ho moduplex (HmD) formed between the reference clone and each of the test cl ones. Lane C represents the positive control. Fig. A, B, C and D shows th e formation of HD from the T68 source isolate, T68-G(GF) and T68-G(ML) subiso lates, respectively. For each figure (A, B, C and D) separately; Lane T1 shows the Clone # 1(T1) was used as a reference clone and shows the HmD ba nd. Lane T2-T24 represents the clones used as test clones (T2-T25) show ing either HmD or HD formations.

PAGE 76

64 Figure 3.4: Ethidium-bromide stained 10% polyacrylamide ge ls showing the retarded mobility of heteroduplexes (HD) form ed due to the nucleotide sequence differences in the RT-PCR amplified cloned 403 bp region of ORF 1a, of CTV isolate T68 and T68-A(GF) and T 68-A(SW) subisolates. Each lane represents the HD or homoduplex (HmD) formed between the reference clone and each of the test clones. Lane C represents the positive control. Fig. A, B and C shows the formation of HD from the T68 source isolate, T68-A(GF) and T68-A(SW) subisolates, respecti vely. For each figure (A, B and C) separately; Lane Ta1 shows the Clone # 1(Ta1) was us ed as a reference clone and shows the HmD band. Lane Ta2Ta24 represents the clones used as test clones (Ta2Ta25) showing either HmD or HD formations.

PAGE 77

65 Figure 3.5: Phylogenetic tree s howing genetic relationships of the genotypes of CL CTV isolate, CL-G(GF) and CL-G(ML) s ubisolates obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already sequenced CTV isolates a nd some of the other isolates as described earlier (Roy and Brlansky, 2004). Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic relationship of the sequences were generated usi ng the program TreeView version 1.6.6.

PAGE 78

66 Figure 3.6: Phylogenetic tree showing genetic relationships of the genotypes of M2A CTV isolate, M2A-G(ML) and M2A-G( SW) subisolates obtained after heteroduplex analysis (H MA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already sequenced CTV isolates and some of the other isolates as described earlier (Roy an d Brlansky, 2004). Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic relationship of the sequences were ge nerated using the program TreeView version 1.6.6.

PAGE 79

67 Figure 3.7: Phylogenetic tree s howing genetic relationships of the genotypes of T68 CTV isolate, T68-G(ML), T68-G(ML) and T68-G(SW) subisolates obtained after heteroduplex analysis (H MA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already sequenced CTV isolates and some of the other isolates as described earlier (Roy an d Brlansky, 2004). Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic relationship of the sequences were ge nerated using the program TreeView version 1.6.6.

PAGE 80

68 Figure 3.8: Phylogenetic tree s howing genetic relationships of the genotypes of T68 CTV isolate, T68-A(ML), T68-A(ML) and T68-A(SW) subisolates obtained after heteroduplex analysis (H MA) of the 403 bp amplicon from ORF 1a of CTV genome, with the already sequenced CTV isolates and some of the other isolates as described earlier (Roy an d Brlansky, 2004). Sequence analysis was done by using CLUSTAL X (Thompson et al. 1997) the phylogenetic relationship of the sequences were ge nerated using the program TreeView version 1.6.6.

PAGE 81

69 Table 3.5. The summary of the different genotyp es from the CL isolate, CL-G(GF), CLG(ML) and CL-G(SW) subisolates, obt ained after heteroduplex analysis (HMA) of the 403 bp amplicon from OR F 1a of CTV genome The value (%) in the parentheses represents th e %age number of clones belonging to genotype A/B/C, out of the total number of clones screened from an isolate or subisolate. ISOLATE/ SUBISOLATE NUMBER OF GENOTYPES DETECTED GENOTYPES DETECETD / (%) CLOSELY RELATED GENOTYPES CL 3 CLS0A (47) VT, B225 CLS0B (35) T2K, BAN-2 CLS0C (18) NEW CL-G(GF) 3 CLG1A (48) VT, B225 CLG1B (32) T2K, BAN-2 CLG1C (20) NEW CL-G(ML) 3 CLG2A (56) VT, B225 CLG2B (36) T2K, BAN-2 CLG2C (8) NEW CL-G(SW) 3 CLG3A (52) VT, B225 CLG3B (30) T2K, BAN-2 CLG3C (18) NEW Table 3.6. The summary of the different genot ypes from the M2A isolate, M2A-G(GF), M2A-G(ML) and M2A-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome The value (%) in the parentheses repr esents the %age number of clones belonging to genotype A/B/C, out of the total number of cl ones screened from an isolate or subisolate. ISOLATE/ SUBISOLATE NUMBER OF GENOTYPES DETECTED NAME OF THE GENOTYPE / (%) CLOSELY RELATED GENOTYPES M2A 3 M2AS0A (84) VT, B225 M2AS0B (8) BAN-2 M2AS0C (8) T38K M2A-G(GF) 3 M2AG1A (82) VT, B225 M2AG1B (10) T2K, BAN-2 M2AG1C (8) T38K M2A-G(ML) 3 M2AG2A (85) VT, B225 M2AG2B (10) T36 M2AG2C (5) T38K M2A-G(SW) 1 M2AG3A (100) VT, B225

PAGE 82

70 Table 3.7. The summary of the different genotypes from the T68 isolate, graft transmitted subisolates [T68-G(GF), T68-G(ML) and T68-G(SW)] and aphid transmitted subisolates [T68-A(GF) and T68-A(SW)], obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF 1a of CTV genome The value (%) in the parentheses repr esents the %age number of clones belonging to genotype A/B/C, out of the total number of cl ones screened from an isolate or subisolate. ISOLATE/ SUBISOLATE NUMBER OF GENOTYPES DETECTED NAME OF THE GENOTYPE / (%) CLOSELY RELATED GENOTYPES T68 2 T68S0A (68) B165 T68S0B (32) NEW T68-G(GF) 2 T68G1A (80) B165 T68G1B (20) NEW T68-G(ML) 2 T68G2A (68) B165 T68G2B (32) NEW T68-G(SW) 2 T68G3A (76) B165 T68G3B (24) NEW T68-A(GF) 4 T68A1A (64) B165 T68A1B (20) NEW T68A1C (8) T2K T68A1D (8) T30, T385 T68-A(SW) 3 T68A3A (92) B165 T68A3B (4) SY568 T68A3C (4) NEW

PAGE 83

71 Table 3.8. The description of different ge notypes from the CL, M2A and T68 source isolates and the graft / aphid transmitted subisolates, obtained after heteroduplex analysis (H MA) of the 403 bp amplicon from ORF 1a of CTV genome Genotype Description CLAS0A Genotype A obtained from the CL source isolate CLAS0B Genotype B obtained from the CL source isolate CLAS0C Genotype C obtained from the CL source isolate CLG1A Genotype A obtained from the CL-G(GF) graft transmitted subisolate CLG1B Genotype B obtained from the CL-G(GF) graft transmitted subisolate CLG1C Genotype C obtained from the CL-G(GF) graft transmitted subisolate CLG2A Genotype A obtained from the CL-G(ML) graft transmitted subisolate CLG2B Genotype B obtained from the CL-G(ML) graft transmitted subisolate CLG2C Genotype C obtained from the CL-G(ML) graft transmitted subisolate CLG3A Genotype A obtained from the CL-G(SW) graft transmitted subisolate CLG3B Genotype B obtained from the CL-G(SW) graft transmitted subisolate CLG3C Genotype C obtained from the CL-G(SW) graft transmitted subisolate M2AS0A Genotype A obtained from the M2A source isolate M2AS0B Genotype B obtained from the M2A source isolate M2AS0C Genotype C obtained from the M2A source isolate M2AG1A Genotype A obtained from the M2A-G(GF) graft transmitted subisolate M2AG1B Genotype B obtained from the M2A-G(GF) graft transmitted subisolate M2AG1C Genotype C obtained from the M2A-G(GF) graft transmitted subisolate M2AG2A Genotype A obtained from the M2A-G(ML) graft transmitted subisolate M2AG2B Genotype B obtained from the M2A-G(ML) graft transmitted subisolate M2AG2C Genotype C obtained from the M2A-G(ML) graft transmitted subisolate M2AG3A Genotype A obtained from the M2A-G(SW) graft transmitted subisolate T68S0A Genotype A obtained from the T68 source isolate T68S0B Genotype B obtained from the T68 source isolate T68G1A Genotype A obtained from the T68-G(GF) graft transmitted subisolate T68G1B Genotype B obtained from the T68-G(GF) graft transmitted subisolate T68G2A Genotype A obtained from the T68-G(ML) graft transmitted subisolate T68G2B Genotype B obtained from the T68-G(ML) graft transmitted subisolate T68G3A Genotype A obtained from the T68-G(SW) graft transmitted subisolate T68G3B Genotype B obtained from the T68-G(SW) graft transmitted subisolate T68A1A Genotype A obtained from the T68-A(GF) aphid transmitted subisolate T68A1B Genotype B obtained from the T68-A(GF) aphid transmitted subisolate T68A1C Genotype C obtained from the T68-A(GF) aphid transmitted subisolate T68A1D Genotype D obtained from the T68-A(GF) aphid transmitted subisolate T68A3A Genotype A obtained from the T68-A(SW) aphid transmitted subisolate T68A3B Genotype B obtained from the T68-A(SW) aphid transmitted subisolate T68A3C Genotype C obtained from the T68-A(SW) aphid transmitted subisolate

PAGE 84

72 Discussion Three Florida CTV isolates: CL, M2A and T68 were selected for the present study. The analysis of 403 nt region amplified from the ORF 1a of CTV genome by primer pair CN 488 and CN 491 using HMA showed the pr esence of mixture of more than one genotypes in each of the source and the graft and aphid transmitted subisolates. All the source isolates and the graft and/or aphid transmitted subisolates contained one major genotype and the one or more minor genotypes, based on the number of clones in each genotype. Minor genotypes were found to be co-dominating in some cases. A good relationship was found between the HMA patte rns and the subsequent sequencing and phylogenetic results. Field isolates of CTV often are mixtures of different genotypes (Mawassi et al., 1995a; Mawassi et al., 1995b). In the presen t study, three genotypes from the source isolate CL (CLS0A, CLS0B a nd CLS0C), source isolate M2A (M2AS0A, M2AS0B and M2AS0C) and two genotypes from the source isolate T68 (T68S0A and T68S0B) were obtained. From the mixture of genotypes, stra ins of CTV having dist inct properties can be selected thus changing the mixture of vira l strains in different proportions in infected plants (Hilf et al., 1999). The population diversity of CTV may cha nge upon graft or aphid transmission which may eventually lead to the formation of new genotypes. The present study also indicates the changes in the population stru cture of CTV due to the graft and aphid transmissions. The changes were only found in the minor genotypes; however, the major genotypes did not change. The changes in the genotype may also suggest the selection pressure of host and the aphid transmissi ons on the viral sequences. The differential

PAGE 85

73 selection pressure, of host and the aphid transmission, to different genes has been reported, which may be responsible in part for the wide biologi cal, serological and molecular variability among CTV isolates (Ayl lon et al., 1999). Such kind of studies will be helpful in understanding the mechanis m of variability in the CTV genome. Mixtures of genotypes, present in the fiel d isolates of CTV, can be separated due to aphid transmission and the aphid-transmitted subisolates differ from the source isolate in their serological and biologi cal properties (Brlansky et al ., 2003; Moreno et al., 1993a; Moreno et al., 1993b). In the pr esent study, both mild and seve re genotypes have been detected only after the aphid transmissions. These genotypes could not be detected from the source isolate or the graf t transmitted subisolates. This may suggests the specific association of BCA with certain genotypes. Si nce BCA is the most efficient vector of CTV and an increase in the incidence of all st rains of CTV has been reported due to the introduction of brown citrus aphid in Florid a (Halbert et al., 2004; Hermosa de Mendoza et al., 1984). Understanding the association of the viral sequences with the BCA will be helpful in predicting future m odels for the spread of CTV. The CTV has been recently detected from several new areas for the first time (Davino et al., 2003; Papi c et al., 2005). The isolates of CTV detected in these areas may or may not resemble one of the already know n genotypes. Most of the molecular methods for detection of CTV are limited by the se quence information available and better molecular tools are required for the efficien t and rapid detection of new genotypes. The sequence information generated as part of this study will be helpful in designing rapid and efficient detection methods of CTV in future.

PAGE 86

74 The symptomatology of CTV isolates ma y change upon graft transmission to a different host species or aphi d transmissions. In this study it was found that all the isolates are mixture of 2-3 genotypes and th e changes, after the graft and/or aphid transmissions, occured only in the minor ge notypes. This suggests the presence of more than one genotype (major and minor ge notype) and their presence in different combinations could cause a synergistic effect on the severity of symptoms caused by the major genotype.

PAGE 87

75 CHAPTER 4 GENERAL CONCLUSIONS Tristeza disease, caused by Citrus tristeza virus (CTV), is a very destructive disease of Citrus, and has killed millions of citrus trees grafted on sour orange rootstock in the past couple of decades. The field trees infected with CTV often contains mixture of different genotypes. An estimation of the am ount of genetic diversity for CTV is still being determined. Several molecular techni ques are available for the detection and characterization of mixed vi ral infections; each having its own merits and demerits. Multiple molecular markers (MMM) and hetero duplex mobility assay (HMA) were used to characterize the three Florida isolates [Chiefland (CL), Mc n2a (M2A) and T68]. All the three isolates showed presen ce of mixed infections. The population structure of each isolate was found to cons ist of one major genotype and 2-3 minor genotypes. Based on the MMM, CTV isolates CL and M2A were found to contain T36 and VT genotypes. Isolate T68 contains the T3 genotype, but may also contain the VT genotype. However sequencing of the amplified markers from theses isolates is required in order to confirm the presence of T36 and/or VT and T3 genotypes. The HMA of about 403 bp region amplified from the ORF 1a of the isolates suggests the presence of both severe and mild isolates. One major genotype (genotype A) and two minor genotypes (genotype B and C), based on the number of clones in each genotype, were detected from CL and M2A is olates. Genotype A was found to be closely related to the B225 and B219 I ndian CTV isolates. These Indi an isolates belong to VT genotype. Genotype B is closely related to th e T36 severe decline CTV isolates from

PAGE 88

76 Florida and BAN-2 severe stem pitting isol ates from India. Genotype C from the CL isolates is related to the CTV isolates B165 (causes severe lime reaction) and Nartia from India and South Africa, respectively. Whereas the genotype C from M2A isolates showed high sequence homology to the T38K CTV isolat e which is one of the subisolates from T3800 stem pitting CTV isolate from Florida. The T68 isolate was found to be mixture of two genotypes. The major genotype (Genotype A) was genetically related to B165 CTV isolate from India. The minor genotype (Ge notype B) however did not show nucleotide homology to any of the known CTV isolates and is a new genotype. The HMA from the aphid transmitted subiso lates of the T68 CTV isolate suggest that the genotype diversity is altered due to the aphid transmissions. The changes were only found in the minor genotypes; however, the major genotypes did not change. Brown citrus aphid (BCA), used for aphid transmissi ons, has the ability to single out both mild and severe genotypes from the CTV complex. Several mild and severe genotypes were detected only after aphid transmissions. The HMA from the graft transmitted subisolates of the selected isolates sugge st that the genotype diversity sometimes may change with the graft transmissions, however changes we re found only in the minor genotypes with no change in the major genotype of each isolate. All the three Florida CTV isolates in th is study, showed intra isolate genotype diversity ranging from 9 18% and some of the genotypes are more genetically similar to those of other CTV isolates than to the ot her genotypes from the same isolate. These results clearly suggest that the mixed infec tions obtained from all the three selected Florida isolates should not be confused with the presence of quasispecies.

PAGE 89

77 LIST OF REFERENCES Agranovsky, A. A., Lesemann, D. E., Maiss, E., Hull, R., and Atabekov, J. G. (1995). "Rattlesnake" structure of a filament ous plant RNA virus built of two capsid proteins. Proc Natl Acad Sci U S A. 92, 2470-2473. Ahlawat, Y. S., and Raychaudhuri, S. P. ( 1988). Status of Citrus tristeza and dieback diseases in India and their detection. Citriculture: Proceedings of the Sixth International Citrus Congress. Middle-East Tel Aviv, Israel 871-879. Albiach, M., Mawassi, M., Gowda, S., Satyanaray an, T., Hilf, M. E., Shanker, S., Almira, E. C., Vives, M. C., Lopez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S. M., and Dawson, W. O. (2000). Sequences of Citrus tristeza virus seperated in time and space are essentially identical. Journal of Virology. 74, 6856-6865. Ayllon, M. A., Lopez, C., Navas-Castillo, J., Garnsey, S. M., Guerri, J., Flores, R., and Moreno, P. (2001). Polymorphism of the 5' terminal region of Citrus tristeza virus (CTV) RNA: incidence of three sequence type s in isolates of di fferent origin and pathogenicity. Archives of Virology. 146 (1) 27-40. Ayllon, M. A., Lopez, C., Navas-Castillo, J., Mawassi, M., Dawson, W. O., Guerri, J., Flores, R., and Moreno, P. (1999a ). New defective RNAs from Citrus tristeza virus : evidence for a replicase-driven template switching mechanism in their generation. J. Gen. Virol. 80 (3) 817-821. Ayllon, M. A., Rubio, L., Moya, A., Guerri J., and Moreno, P. (1999b). The haplotype distribution of two genes of Citrus tristeza virus is altered after host change or aphid transmission. Virology. 255 (1) 32-39. Bar-Joseph, M., Che, X., Mawassi, M., Gowda, S., Satyanarayana, T., Ayllon, M. A., Albiach, M., Garnsey, S. M., and Dawson, W. O. (2002). The c ontinuous challenge of Citrus tristeza virus molecular reseach. In: 15th Conf. Int. Organ. Citrus Virol. Riverside, CA 1-7. Bar-Joseph, M., Marcus, R., and Lee, R. F. (1989). The continuous challenge of Citrus tristeza virus control. Ann. Rev. Phytopathol. 27, 291-316. Berry, S., and C., R. M. E. (2001). Differe ntiation of cassava-inf ecting begomoviruses using heteroduplex mobility assays. J. Virol. Methods. 92, 151-163. Blackman, R. L., and Eastop, V. F. (1984). Aphids on world crops. John Wiley & Sons Chichester, United Kingdom. pp 466.

PAGE 90

78 Brlansky, R. H. (1987). Inclusion bodies produced in citrus by Citrus tristeza virus Phytophylactica. 19, 211-213. Brlansky, R. H., Damsteegt, V. D., Roy, A., and Howd, D. S. (2003). Molecular Analyses of Citrus tristeza virus subisolates seperated by aphid transmissions. Plant Disease. 87, 397-401. Brlansky, R. H., and Lee, R. F. (1990). Numb ers of inclusion bodies produced by mild and severe strains of Citrus tristeza virus in seven citrus hosts. Plant Disease. 74 (4) 297-299. Cai, S. P., Eng, B., Kan, Y. W., and Chui D. H. K. (1991). A rapid and simple electrophoretic method for de tection of mutations invol ving small insertions and deletions: applications to -thalassemia. Hum. Genet. 87, 720-728. Cambra, M., Camarasa, E., Gorris, M. T., Garn sey, S. M., Gumpf, D. J., and Tsai, M. C. (1993). Epitope diversity of Citrus tristeza virus (CTV) isolates in Spain. In: 12th Conf. Int. Organ. Citrus Virol. Riverside, CA. pp 33-38. Cambra, M., Gorris, M. T., Olmos, A., Mar tinez, M. C., Roman, M. P., Bertolini, E., Lopez, A., and Carbonell, E. A. ( 2002). European diagnostic protocols (DIAGPRO) for Citrus tristeza virus in adult trees. In: 15th Conf. Int. Organ. Citrus Virol. Riverside, CA. pp 69-78. Cambra, M., Serra, J., Vilalba, D., and Moreno, P. (1988). Present situation of Citrus tristeza virus in the Valencian community. In: 10th Proc. Conf. Int. Org. Citrus Virol. Riverside, CA. pp 17. Cevik, B. (2001). Characterization of the RNA-dependent RNA polymerase gene of citrus tristeza closterovirus. PhD Dissertation University of Florida, Gainesville. Cevik, B., Chandrika, R., Manjunath, K. L., Lee, R. F., and Niblett, C. L. (1999). Characterization of the ribosomal +1 frameshift in the RNA-dependent RNA polymerase gene of citrus tristeza closterovirus. Phytopathology. 89, 13. Che, X., Piestun, D., Mawassi, M., Yang, G., Satyanarayana, T., Gowda, S., Dawson, W. O., and Bar-Joseph, M. (2001). 5' Coterminal subgenomic RNAs in Citrus tristeza virus infected cells. Virology. 283 (2) 374-381. Costa, A. S., and Muller, G. W. (1980). Tr isteza control by cross protection: a US-Brazil cooperative success, virus disease. Plant Disease. 64, 538-541. d'Urso, F., Ayllon, M. A., Rubio, L., Sambade, A., Hermosa de Mendoza, A., Guerri, J., and Moreno, P. (2000). Contribution of uneven distribution of genomic RNA variants of Citrus tristeza virus (CTV) within the plant to changes in the viral population following aphid transmission. Plant Pathology. 49 (2) 288-294.

PAGE 91

79 D'Urso, F., Sambade, A., Moya, A., Guerri J., and Moreno, P. (2003). Variation of haplotype distributions of two genomic regions of Citrus tristeza virus populations from eastern Spain. Molecular Ecology. 12 (2) 517-526. Davino, S., Davino, M., Sambade, A., Guar do, M., and Caruso, A. (2003). The First Citrus tristeza virus outbreak found in a relevant citrus producing area of Sicily, Italy. Plant Disease. 87, 314. Delwart, L. E., Shpaer, G. E., Louwagie, J., McCutchan, E. F., Grez, M., RubsamenWaigmann, H., and Millins, J. I. (1993) Genetic relationships determined by a DNA heteroduplex mobility assa y: Analysis of HIV-1 env genes. Science. 262, 1257-1261. Dominguez, A., Hermoso de Mendoza, A., Guerri, J., Cambra, M., Navarro, L., Moreno, P., and Pena, L. (2002). Pat hogen derived resistance to Citrus tristeza virus (CTV) in transgenic Mexican lime ( Citrus aurantifolia (Christ.) Swing.) plants expressing its p25 coat protein gene. Molecular Breeding: New strategies in plant improvement. 10, 1-10. Esau, K. (1960). Cytological and hist ological symptoms of beet yellows. Virology. 10, 73-85. Febres, V. J., Ashoulin, L., Mawassi, M., Fr ank, A., Bar-Joseph, M., Manjunath, K. L., Lee, R. F., and Niblett, C. L. (1996). The p27 protein is pres ent at one end of Citrus tristeza virus particles. Phytopathology. 86 (12) 1331-1335. Fulton, R. W. (1986). Practices and precautions in the use of cross protection for plant virus disease control. Annu. Rev. Phytopathology. 67, 965-968. Garnsey, S. M., Bar-Joseph, M., and Lee, R. F. (1981). Applications of serological indexing to develop co ntrol strategies for Citrus tristeza virus Proceedings of the International Society of Citriculture. 1, 448-452. Garnsey, S. M., Barrett, H. C., and Hutc hison, D. J. (1987a). Identification of Citrus tristeza virus resistance citrus relative s and its potential applications. Phytophylactica. 19 (2) 187-191. Garnsey, S. M., Gumpf, D. J., Roistacher, C. N., Civerolo, E. L., Lee, R. F., Yokomi, R. K., and Bar-Joseph, M. (1987b). Toward a st andard evaluation of the biologically properties of Citrus tristeza virus Phytophylactica. 19, 151-157. Garnsey, S. M., Permar, T. A., Cambra, M ., and Henderson, C. T. (1993). Direct tissue blot Immunoassay (DTBIA) for detection of Citrus tristeza virus (CTV). In: 12th Conf. Int. Organ. Citrus Virol. Riverside, CA. 39-50. Garnsey, S. M., Su, H. J., and Tsai, M. C. (1997). Differential susceptibility of pummelo and Swingle citrumelo to isolates of Citrus tristeza virus In: 13th Conf. Int. Organ. Citrus Virol. Riverside, CA. 138-146.

PAGE 92

80 Guerri, J., Moreno, P., Munoz, N., and Mart inez, M. E. (1991). Variability among Spanish Citrus tristeza virus isolates revealed by doubl e-stranded RNA analysis. Plant Pathology. 40, 38-44. Halbert, S. E., Genc, H., Ce vik, B., Brown, L. G., Rosales, I. M., Manjunath, K. L., Pomerinke, M., Davison, D. A ., Lee, R. F., and Niblett, C. L. (2004). Distribution and characterization of Citrus tristeza virus in South Florida following establishment of Toxoptera citricida Plant Disease 88 935-941. Hermosa de Mendoza, A., Ballester-Olmos, J. F., and Pina-Lorca, J. A. (1984). Transmission of Citrus tristeza virus by aphids ( Homoptera, Aphididae ) in spain. In: 9th Conf. Int. Organ. Citrus Virol. Riverside, CA. 68-70. Hilf, M. E., and Garnsey, S. M. (2000). Characterization and classification of Citrus tristeza virus isolates by amplification of multiple molecular markers. In: 14th Conf. Int. Organ. Citrus Virol. Riverside, CA. 18-27. Hilf, M. E., and Garnsey, S. M. (2002). Citrus tristeza virus in Florida: A synthesis of historical and contempor ary biological, serological and genetic data. In: 15th Conf. Int. Organ. Citrus Virol. Riverside, CA. 13-20. Hilf, M. E., Karasev, A., Maria, R., Albi ach, M., Dawson, W. O., and Garnsey, S. M. (1999). Two paths of seuence divergence in the Citrus tristeza virus complex. Phytopathology. 89, 336-342. Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., and Garnsey, S. M. (1995). Characterization of Citrus tristeza virus subgenomic RNAs in infected tissue. Virology. 208 (2) 576-582. Jarupat, T., Dodds, J. A., and Roistacher, C. N. (1988). Effect of host passage on dsRNAs of two strains of Citrus tristeza virus In: 15th Conf. Int. Organ. Citrus Virol. Riverside, CA. 39-44. Karasev, A. V. (2000). Genetic diversit y, and evolution of closteroviruses. Phytopathology. 38, 293-324. Karasev, A. V., Boyko, V. P., Gowida, S., Nikol aeva, O. V., Hilf, M. E., Koonin, E. V., Niblett, C. L., Cline, K., Bumpf, D. J ., and Lee, R. F. (1995b). Complete sequence of the Citrus tristeza virus RNA genome. Virology. 208 (2) 511-520. Lee, R. F., Derrick, K. S., McClure, P., E llis, L., and Rucks, P. (1994). Occurrence of severe strains of C itrus tristeza virus and citrus blight in re gistered scion groves in the Indian River. Proceedings of the annual meet ing of the Florida State Horticultural Society, Miami beach, Florida 106 94-99. Lee, R. F., McConnell, p., Manjunath, K. L., Cevik, B., Nikolaeva, O. V., Dekkers, M. G. H., and Niblett, C. L. (2002). The citrus tristeza virus epidemic in Bog Walk valley, Jamaica. In: 15th Conf. Int. Organ. Citrus Virol. Riverside, CA. 95-101.

PAGE 93

81 Lee, R. F., Pappu, H. R., Pappu, S. S., RochaPena, M. A., Febres, V. J., Manjunath, K. L., Nikolaeva, O. V., Karasev, A., Cevik, B., Akbulut, M., Bencher, D., Anderson, E. J., Price, M., Ochoa-Corona, F. M., and Niblett, C. L. (1996). Progress on strain differentiation of Citrus tristeza virus Phytopathology. 14 (2) 79-87. Lee, R. F., and Rocha-Pena, M. A. (1992) Citrus tristeza virus. Pages 226-249 in: Kumar, J., Chaube, H. S., Singh, U. S. and Mukhopadhyay. A. N (eds). Plant disease of international importance. Disease of Fruit Crops. Prentice Hall, Englewood Cliffs, NJ. Vol. III, 456 pp. Lin, N. S., Hsu, Y. H., and Hsu, H. T. (1990) Immunological detecti on of plant viruses and mycoplasma like organism by direct tissue blottingon nitrocellulose membranes. Phytopathology. 80, 824-828. Lin, S. S., Hou, R. F., and Yeh, S. D. (2000). Heteroduplex Mobility and Sequence Analyses for assessment of variability of Zucchini yellow mosaic virus. Phytopathology. 90, 228-235. Lopez, C., Ayllon, M. A., Navas-Castillo, J., Guerri, J., Moreno, P., and Flores, R. (1998). Molecular variability of the 5' and 3' terminal regions of Citrus tristeza virus RNA. Phytopathology. 88 (7) 685-691. Mawassi, M., Karasev, A., Mietkiewska, E., Gafny, R., Lee, R. F., Dawson, W. O., and Bar-Joseph, M. (1995a). Defective RNA molecules associated with Citrus tristeza virus Virology. 208 (1) 383-387. Mawassi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar-Joseph, M. (1996). Unusual sequence relationships between two isolates of Citrus tristeza virus J. Gen. Virol. 77, 2359-2364. Mawassi, M., Mietkiewska, E., Hilf, M. E., Ashoulin, L., Karasev, A. V., Gafny, R., Lee, R. F., Garnsey, S. M., Dawson, W. O ., and Bar-Joseph, M. (1995b). Multiple species of defective RNAs in plants infected with Citrus tristeza virus Virology. 214 (1) 264-268. McClean, A. P. D. (1957). Tristeza virus of citrus; Evidence for absence of seed transmission. Plant. Disease. Rep. 41, 821. Mehta, P., Brlansky, R. H., Gowda, S., and Yokomi, R. K. (1997). Reverse transcription polymerase chain reaction detection of Citrus tristeza virus in aphids. Plant Disease. 81 (9) 1066-1069. Moreno, P., Guerri, J., Ballester-Olmos, J. F ., Albiach, R., and Martinez, M. E. (1993a). Seperation and interferen ce of strains from a Citrus tristeza virus isolate evidenced by biological activityand double st randed RNA (dsRNA) analysis. Plant Pathology. 42, 35-41.

PAGE 94

82 Moreno, P., Guerri, J., Ballester-Olmos, J. F., Fuertes-Polo, C., Albiach, R., and Martinez, M. E. (1993b). Variations in pathogenocity and double stranded (dsRNA) patterns of Citrus tristeza virus isolates induced by host passage. In: 12th Conf. Int. Organ. Citrus Virol. Riverside, CA. 8-15. Muller, G. W., and Garnsey, S. M. (1984). Suscep tibility of citrus varities, species, citrus relatives, and non-rutecous plants to slash-cut machanical inoculation with Citrus tristeza virus Garnsey, S. M. Timmer, L. V. And Dodds, J. A. (eds). In: 8th Conf. Int. Organ. Citrus Virol. Riverside, CA. 62-65. Nagy, P. D., and Simon, A. E. (1997). New insights into the mechanisms of RNA recombination. Virology. 235, 1-9. Papic, T., Santos, C., and Nolasco, G. (2005). First report of Citrus tristeza virus in the State Union of Serbia and Montenegro. Plant Disease. 89, 434. Pappu, H. R., Karasev, A., Anderson, E. J., Pa ppu, S. S., Hilf, M. E., Febres, V. J., Eckloff RMJ, McCaffery, M., Boyko, V. P ., Gowda, S., Dolja, V., Koonin, E. V., Gumpf, D. J., Cline, K., Garnsey, S. M., Da wson, W. O., Lee, R. F., and Niblett, C. L. (1994). Nucleotide sequence and organisa tion of 3' open reading frames of cirus tristeza closterovirus genome. Virology. 199, 35-46. Pappu, S. S., Febres, V. J., Pappu, H. R., Lee, R. F., and Civerolo, E. L. (1997). Characterization of the 3' proximal gene of citrus tristeza closterovirus genome. Virus Res. 47, 51-57. Penaranda, J., Acosta, O., Guzman-Barney, M ., Alegria, A., Pappu, H. R., Pappu, S. S., Manjunath, K. L., Febres, V. J., Lee, R. F ., and Niblett, C. L. (1996). Incidence and characterization of mild and severe isolates of Citrus tristeza virus from Columbia. In: 8th Conf. Int. Organ. Citrus Virol. Riverside, CA. 71-77. Permar, T. A., Garnsey, S. M., Gumpf, D. J., and Lee, R. F. (1990). A monoclonal antibody that discriminates strains of Citrus tristeza virus Phytopathology. 80 (3) 224-228. Powell, C. A., Pelosi, R. R., Rundell, P. A., and Cohen, H. (2003). Breakdown of crossprotection of grapefruit from decline-inducing isolates of Citrus tristeza virus following introduction of brown citrus aphid. Plant Disease. 87, 1116-1118. Rocha-Pena, M. A., Lee, R. F., Lastra, R., Ni blett, C. L., Ochoa-Corona, F. M., Garnsey, S. M., and Yokomi, R. K. (1995). Citrus tristeza virus and its aphid vector Toxoptera citricida : threats to citrus production in the Caribbean and Central and North America. Plant Disease. 79 (5) 437-445. Rocha-Pena, M. A., Lee, R. F., and Niblett, C. L. (1991a). Development of a dotimmunobinding assay for detection of Citrus tristeza virus J. Virol. Methods. 34 (3) 297-309.

PAGE 95

83 Rocha-Pena, M. A., Lee, R. F., Permar, T. A., Yokomi, R. K., and Garnsey, S. M. (1991b). Use of enzyme linked immunos orbent and dot-immunobinding assay to evaluate two mild strain cr oss protection experiments afte r challenge with a severe strain Citrus tristeza virus isolate. In: 11th Conf. Int. Organ. Citrus Virol. Riverside, CA. 93-102. Roistacher, C. N. (1982). A bl ueprint of disaster I: The history of seedling yellows disease. California Citrograph. 67, 48-53. Rubio, L., Ayllon, M. A., Guerri, J., Pappu, H. R., Niblett, C. L., and Moreno, P. (1996). Differentiation of citrus tristeza closte rovirus (CTV) isolates by single-strand conformation polymorphism analysis of coat protein gene. Ann. Appl. Biol. 129, 479-489. Rubio, L., Guerri, J., and Moreno, P. (2000). Characterization of Citrus tristeza virus isolates by single-strand conformatio n polymorphism analysis of DNA complemetary to their RNA population. In: 14th Proc. Conf. Int. Org. Citrus Virol. Riverside, CA. 12-17. Sasaki, A. (1974). Studies on hasaku dwarf. Special bulletin of fruit tree experimental station of hiroshima prefecture. No. 2, 106 pp. Satyanarayana, T., Gowda, S., Ayllon, M. A., and Dawson, W. O. (2004). Closterovirus bipolar virion: Evidence for initiation of assembly by minor coat protein and its restriction to the ge nomic RNA 5' region. Proc Natl Acad Sci U S A. 101, 799-804. Satyanarayana, T., Gowda, S., Boyko, V. P ., Albiach-Marti, M. R., Mawassi, M., NavasCastillo, J., Karasev, A. V., Dolja, V., H ilf, M. E., and Lewandowski, D. J. (1999). An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication. Proc Natl Acad Sci U S A. 96 (13) 7433-7438. Satyanarayana, T., Siddarame Gowda, Mar a A. Aylln, Albiach-Mart, M. R. and Dawson, W. O. (2002). The p23 Protein of Citrus tristeza virus controls asymmetrical RNA accumulation. Journal of Virology. 76 (2) 473-483. Suastika, G., Natsuaki, T., Terui, H., Kano, T., Ieki, H., and Okuda, S. (2001). Nucleotide sequence of Citrus tristeza virus seedling yellows isolate. J. Gen. Plant Pathol. 67, 73-77. Toxopeus, H. J. (1937). Stock-action in-com patibility in citrus and its cause. J. Pomol. Hortic. Sci. 14, 360-67. Van Vuuren, S. P., Collins, R. P., and Da Graca, J. V. (1993). Evaluation of Citrus tristeza virus isolates for cross protection of grapefruit in South Africa. Plant Disease. 77 (1) 24-28.

PAGE 96

84 Vela, C., Cambra, M., Cortes, E., Moreno, P., Miguet, J. G., and Sanz, A. (1986). Production and characterization of monoclonal antibodies specific for Citrus tristeza virus and their use of diagnosis. J. Gen. Virol. 67, 91-96. Viggiani, G. (1988). Citrus pe sts in mediterranean basin. In: 6th Conf. Int. Organ. Citrus Virol. Riverside, CA. 1067-1073. Vives, M. C., Rubio, L., Lopez, C., Navas-Cast illo, J., Albiach-Marti, M. R., Dawson, W. O., Guerri, J., Flores, R., and Moreno, P. (1999). The complete genome sequence of the major component of a mild Citrus tristeza virus isolate. J. Gen. Virol. 80, 811-816. Webber, H. J. (1925). A comparative study of citrus industry in South Africa. Union S. Afr. Dept. Agric. Bull. 6, pp 106. Weber, H. J. (1943). The “Tristeza” disease of sour-orange rootstock. Proc. Am. Soc. Hort. Science. 43, 360-364. Yang, G., Mawassi, M., Gofman, R., Gafny, R ., and Bar-Joseph, M. (1997). Involvement of a subgenomic mRNA in the generation of a variable population of defective Citrus tristeza virus molecules. Journal of Virology. 71 (12) 9800-9802. Yang, Z. N., Mathews, D. M., Dodds, J. A., and Mirkov, T. E. (1999). Molecular characterization of an isolate of Citrus tristeza virus that causes severe symptoms in sweet orange. Virus Genes. 19, 131-142. Yokomi, R. K., Lastra, R., Stoe tzel, M. B., Damsteegt, V. D., Lee, R. F., Garnsey, S. M., Gottwald, T. R., Rocha-Pena, M. A., and Nibl ett, C. L. (1994). Establishment of the brown citrus aphid (Homoptera: Aphididae) in Central America and the Caribbean Basin and transmission of Citrus tristeza virus Journal of Economic Entomology 87 (4) 1078-1085. Zeman, V. (1930). Una enfermada nueva en los naranjales de Corrientes. Physis. 19, 410411.

PAGE 97

85 BIOGRAPHICAL SKETCH Amandeep S. Kahlon was born and raised in Punjab state in I ndia. He completed his high school diploma from Khalsa College, Amritsar. He then joined Punjab Agricultural University (PAU), Ludhiana, India, for his BS degree in agricultural sciences with specialization in plant protection. Mr. Amande ep Kahlon completed his BS in 2002 and joined University of Fl orida in Fall 2003 for his MS degree.


Permanent Link: http://ufdc.ufl.edu/UFE0011870/00001

Material Information

Title: Molecular Characterization of the Population Diversity of Selected Isolates and Subisolates of Citrus tristeza virus (CTV) from Florida
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011870:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011870/00001

Material Information

Title: Molecular Characterization of the Population Diversity of Selected Isolates and Subisolates of Citrus tristeza virus (CTV) from Florida
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011870:00001


This item has the following downloads:


Full Text












MOLECULAR CHARACTERIZATION OF THE POPULATION DIVERSITY OF
SELECTED ISOLATES AND SUBISOLATES OF Citrus tristeza virus (CTV) FROM
FLORIDA















By

AMANDEEP SINGH KAHLON


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA
2005

































Copyright 2005

by

Amandeep Singh Kahlon

































To my parents, family and friends.















ACKNOWLEDGMENTS

I would like to express my heart-felt appreciation to my advisor, Dr. Ronald H.

Brlansky, for giving me the opportunity to join this graduate program and for the

financial support throughout the program. I extend my appreciation to Dr. Richard Lee,

Dr. Susan Webb and Dr. Manjunath Keremane, members of my committee, for their

valuable suggestions regarding my experiments, during formal and informal discussions.

I want to specially thank Dr. Manjunath Keremane for his encouragement and help

throughout my research

Further, I would specially like to thank Ms. Deborah Howd for taking care of the

plants and for her help with the ELISA and aphid transmissions. I am thankful to my

friends and colleagues in our laboratory who have been supportive and always helpful

during my entire program: Dr. Avijit Roy, Dr.Amer Fayad, Dr. Kajal Biswas, Abby, and

Alana. I would like to thank Neil for helping me with the grafting and taking care of the

plants.

I am very thankful to my friends for their help and although the list of is too long to

include them all here, I would like to mention a few: Davinder, Chitvan, Hardev, Mandy,

Nandha, JP, Ruby, Nagra, Gagan, Andy, Adriana, Alana, Aaron, Bo, Moyi, Jason,

Myrian I am grateful to Simran for her love and support.

Finally I would like to thank my parents for their continued encouragement and

support. Above all, I would like to thank "Waheguru" for always helping me to achieve

my goals.


















TABLE OF CONTENTS



ACKNOW LEDGM ENTS ........................................ iv

LIST OF TABLES ......... ... .......................... ........ vii

LIST OF FIGURES ..................................... ix

ABSTRACT.................. .................. xi

CHAPTER

1 LITERATURE REVIEW: Citrus tristeza virus ........................................1

Taxonomy ...................................... ..... .................. ...............1
M orphological Characteristics...................... .......... ...............2
Inclusion Bodies ................................ .... ..................2
Historic Perspective and Economic Importance.....................................................2
Host Range...................................... .................. ..................4
Symptoms ...................................................... .........4
Transmission........................................5
M molecular Studies..................................................6
Genome Organization........................ ..................6
Replication of CTV ................................................... ........6
Defective RNAs Associated ............................................................. .... .... 7
CTV Gene Expression Strategies .............. ......................... ...... ........7
Polyprotein Processing and Translational Frameshift ................... .................. .7
Subgenomic RNAs........................................... .......
Population Structure and Genetic Diversity ...................................................8
M methods of Detection ............................................................................11
Tristeza Disease Management ............................. ............................... 14

2 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND
SUBISOLATES BY USING MULTIPLE MOLECULAR MARKERS ....................16

Introduction ............. ......... ................ ............................ 16
Material and Methods .................. ........ ............... 19
Virus Isolates ...................... ......... .........................19
Genotyping of CTV Isolates.................. ................................... ...21




v









RNA Isolation and Group Complementary DNA (cDNA) Synthesis..............21
Polym erase Chain Reaction (PCR) ............................................ ........22
R results ...................................... ................................................ 22
Isolate: CL ........................... ...........................23
Isolate: M 2A ...................................... ............................... ......... 24
Isolate: T68 ................ .... ................. ......... 24
Discussion ................... ... ......... ........ ......... 33

3 CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND
SUBISOLATES BY USING HETERODUPLEX MOBILITY ASSAY............ 37

Introduction...................................... ................................. ........ 37
M material and M methods ............................................................................ 42
V irus Isolates .................. .................................. .. ... ...........42
RNA Isolation and Complementary DNA (cDNA) Synthesis............................43
Polym erase Chain Reaction (PCR) ............................................ .......44
DNA Purification, Cloning and Transformation ................................................44
Colony PCR and Heteroduplex Mobility Assay (HMA) ..................................45
Sequencing and Sequence A analysis ........................................ ............... 47
R results ...................................... ................................................47
Isolate: CL ......................................................48
Isolate: M 2A ............... ................... .............. .50
Isolate: T68 ...................................... ...... ........... .53
D discussion ...................................... ................................... ........ 72

4 GENERAL CONCLUSIONS............................................................... .............75

L IST O F R E FE R E N C E S ............................................................................. 77

BIOGRAPHICAL SKETCH .................................................. ............... 85


..................... ................ 75

L IST O F R E FE R E N C E S ............................................................................. .............. 77

B IO G R A PH IC A L SK E TCH ..................................................................... ..................85















LIST OF TABLES


Table page

2.1 Sequence of genotype specific-oligonucleotide primers (Hilf and Garnsey, 2000)
and two universal primer pairs(*) used for the RT-PCR amplification of CTV
M molecular M arkers. ...................................................................... ....................26

2.2 Genotype profiles of Chiefland (CL), Mcn2a (M2A) and T68 isolate from
Florida, created by RT-PCR amplification of three general and ten genotype-
specific m arkers........... .................................................................. ...... .. ........ 27

2.2 Summary of the results of multiple molecular marker (MMM) of Chiefland
(CL), Mcn2a (M2A) and T68 source isolates and the graft/aphid transmitted
subisolates from Florida................................................ ............................... 33

3.1 The comparison of nucleotide sequence identities of the different genotypes
from the CL isolate, CL-G(GF) and CL-G(ML) subisolates, obtained after
heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
g e n o m e ........................................................................... 5 7

3.2 The comparison of nucleotide sequence identities of the different genotypes
from the M2A isolate, M2A-G(ML) and M2A-G(SW) subisolates, obtained
after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of
C T V genom e .........................................................................58

3.3 The comparison of nucleotide sequence identities of the different genotypes
from the T68 isolate, T68-G(GF), T68-G(ML) and T68-G(SW) subisolates,
obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF
la of C TV genom e ...................... .................... .. .... ......... ......... 59

3.4 The comparison of nucleotide sequence identities of the different genotypes
from the T68 isolate, T68-A(GF), T68-A(ML) and T68-A(SW) subisolates,
obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF
la of C T V genom e ...................... ...................... ................... .. ......60

3.5 The summary of the different genotypes from the CL isolate, CL-G(GF), CL-
G(ML) and CL-G(SW) subisolates, obtained after heteroduplex analysis (HMA)
of the 403 bp amplicon from ORF la of CTV genome ............................. .....69









3.6 The summary of the different genotypes from the M2A isolate, M2A-G(GF),
M2A-G(ML) and M2A-G(SW) subisolates, obtained after heteroduplex analysis
(HMA) of the 403 bp amplicon from ORF la of CTV genome .............................69

3.7 The summary of the different genotypes from the T68 isolate, graft transmitted
subisolates [T68-G(GF), T68-G(ML) and T68-G(SW)] and aphid transmitted
subisolates [T68-A(GF) and T68-A(SW )] .................................... ............... 70

3.8 The description of different genotypes from the CL, M2A and T68 source
isolates and the graft / aphid transmitted subisolates, obtained after heteroduplex
analysis (HM A) .................................... ............................... ........71















LIST OF FIGURES


Figure page

2.1 Schematic diagram of Citrus tristeza virus genome indicating different ORFs
and approximate portions of the genome amplified with genotype specific
m olecular m arkers by H ilf et al, 2000 .............. ................................. ............... 28

2.2 Multiple molecular marker (MMM) profiles of Chiefland isolate and the graft
transmitted sub-isolates created by PCR amplification by using sequence-
specific prim ers. .................................................... ................. 29

2.3 Multiple molecular marker (MMM) profiles of Mcn2a isolate and the graft
transmitted sub-isolates created by PCR amplification by using sequence -
specific prim ers. .................................................... ................. 30

2.4 Multiple molecular marker (MMM) profiles of T68 isolate and the graft
transmitted sub-isolates created by PCR amplification by using sequence -
specific prim ers.. ...................................................................... 3 1

2.5 Multiple molecular marker (MMM) profiles of the T68 source isolate and aphid
transmitted subisolates of T68, created by PCR amplification by using
sequence- specific prim ers............................................................. .....................32

3.1 Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of CTV
isolate CL and CL-G(GF) and CL-G(ML) subisolates. ........................................61

3.2 Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of CTV
isolate M2A and M2A-G(ML) and M2A-G(SW) subisolates. ..............................62

3.3 Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of CTV
isolate T68 and T68-G(GF), T68-G(ML) and T68-G(SW) subisolates...................63









3.4 Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of CTV
isolate T68 and T68-A(GF) and T68-A(SW) subisolates. .....................................64

3.5 Phylogenetic tree showing genetic relationships of the genotypes of CL CTV
isolate, CL-G(GF) and CL-G(ML) subisolates obtained after heteroduplex
an aly sis (H M A ) ................................................................... ................ 6 5

3.6 Phylogenetic tree showing genetic relationships of the genotypes of M2A CTV
isolate, M2A-G(ML) and M2A-G(SW) subisolates obtained after heteroduplex
an aly sis (H M A ) ................................................................... ................ 66

3.7 Phylogenetic tree showing genetic relationships of the genotypes of T68 CTV
isolate, T68-G(ML), T68-G(ML) and T68-G(SW) subisolates obtained after
heteroduplex analysis (HM A). ........................................................................... 67

3.8 Phylogenetic tree showing genetic relationships of the genotypes of T68 CTV
isolate, T68-A(ML), T68-A(ML) and T68-A(SW) subisolates obtained after
heteroduplex analysis (H M A ) ............................................................................ 68















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Master of Science

MOLECULAR CHARACTERIZATION OF THE POPULATION DIVERSITY OF
SELECTED ISOLATES AND SUBISOLATES OF CITRUS TRISTEZA VIRUS (CTV)
FROM FLORIDA

By

Amandeep Singh Kahlon

August 2005

Chair: Ronald Brlansky
Major Department: Plant Pathology

Citrus tristeza virus (CTV) is the most important virus affecting citrus worldwide.

CTV symptoms range from symptomless or mild to death of trees on sour orange

rootstock and/or stem pitting (SP) in citrus trees irrespective of rootstocks. Eradication of

CTV is difficult especially in areas where the efficient vector, Toxoptera citricida

(Kirkaldy), is already present.

The estimation of the amount of genetic diversity for CTV has not yet been clearly

understood. Field isolates of CTV contain mixtures of genotypes which can be separated

by aphid transmission and/or graft transmission to different hosts. In previous studies, the

aphid-transmitted and the graft-transmitted subisolates have been reported to differ from

the source isolate in their serological and biological properties. This study was

undertaken to conduct the molecular characterization of selected CTV isolates from

Florida and to study the effect of graft and aphid transmission on the biology and

population diversity.










Three CTV isolates from Florida, Chiefland (CL), Mcn2a (M2A) and T68, were

used as source isolates and were maintained in Madam vinous sweet orange. The graft-

transmitted subisolates were obtained by bud grafting each of the source isolates to three

different hosts: grapefruit, Mexican lime and sweet orange. The aphid-transmitted

subisolates were obtained from the T68 source isolate and the graft-transmitted

subisolates using T. citricida (Kirkaldy) as the vector. The population diversity was

analyzed by using multiple molecular marker analysis (MMM) and heteroduplex mobility

assay (HMA).

The MMM method is based on the RT-PCR amplification of sequence specific

PCR products with sets of primers derived from the analogous sites within the genomes

of T3, T30, T36 and VT isolates. Each of the three source isolates and their graft- and

aphid-transmitted subisolates was found to be mixtures of different genotypes. Changes

in the genotype profile were detected due to graft and the aphid transmission.

The HMA is based on the reduced mobility of heteroduplexes formed as a result of

denaturation and reannealing of non-identical but closely related viral sequences. A 400

bp region of the genome in ORF 1 was amplified using a pair of universal primers, and

cloned. The HMA was then performed to detect genotypes using a number of selected

clones. Two to three different CTV genotypes were detected in each of the three isolates,

but only one genotype was dominant regardless of whether the isolate had been graft- or

aphid-transmitted. The HMA method provided evidence that the population dynamics

may change with the graft-transmission from the source isolate. Certain genotypes were

detected only after the aphid transmissions, and these genotypes could not be detected

from the source isolate or the graft-transmitted subisolates.














CHAPTER 1
LITERATURE REVIEW: Citrus tristeza virus

Taxonomy

Tristeza disease of citrus, caused by Citrus tristeza virus (CTV), is one of the most

destructive viral diseases of citrus. Epidemics of this disease have occurred, killing

millions of citrus trees on sour orange rootstock in Brazil, Argentina, Venezuela, and

Spain. CTV is a phloem-limited, aphid-borne virus, belonging to the family

Closteroviridae, which is comprised of 30 plant viruses (Bar-Joseph et al., 1989). The

Closteroviridae viruses are characteristically flexuous filamentous rod-shaped virions that

contain either mono-partite or bipartite positive-sense single-stranded RNA genomes.

The Closteroviruses are found most consistently in the companion and parenchyma cells

and hence are called "phloem-associated" (Esau, 1960).

The co-evolution of Closteroviruses has been suggested on the basis of

phylogenetic analysis of their replicative genes as well as the HSP 70 homolog (Karasev,

2000). Two conserved blocks of genes, ORF la & lb and ORFs 3 to ORFs 7. have been

identified in CTV which also are conserved in other closteroviruses. In the first gene

block, ORF la contains two papain-like proteases, methyltransferase and helicase

domains which are expressed through the proteolytic processing of a polyprotein. The

ORF lb encodes the RNA dependent RNA polymerase (RdRp) which is expressed by +1

ribosomal frameshift (Cevik, 2001; Cevik et al., 1999). The second gene block consists of

ORFs 3 to ORFs 7 which encodes a small 6-kDa hydrophobic protein, a 65-kDa homolog

of cellular HSP 70 proteins, a 61-kDa protein and two structural coat proteins.









Morphological Characteristics

Virions of CTV are encapsidated with two capsid proteins (CPs), the 25 kDa major

CP, which encapsidates about 95% of the genome, and the 27 kDa minor CP which

encapsidates the remaining 5% of the genome on the 5' end of the virion (Febres et al.,

1996; Satyanarayana et al., 2004). CTV is reported to have an unusual "rattlesnake" like

morphology because of a second structural protein at the tip of the virion (Agranovsky et

al., 1995; Febres et al., 1996).

Inclusion Bodies

Two types of inclusions are produced in the case of closteroviruses. The first type

is cross-banded patterns of aggregated virus particles, whereas the second type is

aggregates of fibril-containing vesicles surrounded by cytoplasmic membranes (Brlansky,

1987; Garnsey et al., 1980). Inclusion bodies can be used as a method for rapid diagnosis

of CTV (Brlansky and Lee, 1990). There is a positive relationship between the number of

inclusions and strain severity of CTV and virus titer in different host plants (Brlansky and

Lee, 1990).

Historic Perspective and Economic Importance

Citrus is believed to have originated in southeast Asia and CTV was probably

associated with the citrus cultivated in China and Japan since ancient times (Bar-Joseph

et al., 1989). Initial spread of the disease is believed to have been through the infected

propagated material as the virus is not seed-borne and thus most of the early

establishments of the citrus, which were through seed, were free of CTV (McClean,

1957). Phytophthora root rot of the sweet orange trees was the main concern and caused

huge losses during the nineteenth century. Thus the use of grafted trees on the

Phytophthora-tolerant sour orange rootstock became popular (Klotz, 1978). Later,









problems with sour orange as a rootstock were reported from Australia, South Africa and

Java. This failure was originally believed to be due to the varietal incompatibility and

was later on suggested to be because of a pathogen (Toxopeus, 1937; Webber, 1925).

Meneghini (1946) proved tristeza disease to be of viral origin by experimentally

transmitting the disease using aphids (Bar-Joseph et al., 1989).

The first report of decline of citrus trees grafted on sour orange rootstock was from

Argentina in 1910 (Weber, 1943). The first serious epidemic of decline and death of

citrus trees on sour orange rootstock was reported from Argentina in 1930 (Zeman,

1930). Within 15 years of this incidence, 10 million trees were lost in Argentina. Similar

losses were reported in Brazil where 6 million trees were lost over a period of 12 years

(Bar-Joseph, 1989). More than 10 million trees have been lost in Spain since 1956

(Cambra et al., 1988).

A plant infected with the mild strain of a virus can be protected against the

subsequent infection of severe strains of the same or closely related viruses. This

phenomenon is known as cross protection (Fulton, 1986). Mild strain cross protection for

the control of CTV has been used in commercial citrus plantations in many countries

such as Australia, Brazil, South Africa, Japan and India (Costa and Muller, 1980; Lee and

Rocha-Pena, 1992). The breakdown of cross protection against decline inducing isolates

of CTV in grapefruit trees has been reported due to the introduction and establishment of

the Toxoptera citricida (Kirkaldy), commonly known as brown citrus aphid (BCA),

which is the most efficient vector of CTV, in Florida. The incidence of decline inducing

isolates of CTV increased from 13 % to 81 % in mild strain cross-protected plants, within

five years of introduction of BCA in Florida (Powell et al., 2003). An increase in the









incidence of all strains of CTV has been reported in south Florida, following the

introduction of brown citrus aphid in Florida. However the increase of severe strains were

greater as compared to the mild strains (Halbert et al., 2004).

Surveys from the major citrus producing regions of CTV in Columbia, based on the

reactivity of monoclonal antibody MCA 13, detected the presence of severe strains of

CTV in 60% of the sampled trees (Penaranda et al., 1996). An epidemic from the Bog

Walk Valley in Jamaica has been reported recently, where the entire valley was

undergoing a severe decline epidemic (Lee et al., 2002). Recently, many incidences and

outbreaks of CTV have been reported for the first time in many citrus growing regions of

the world (Davino et al., 2003; Papic et al., 2005).

Host Range

The host range of CTV is limited to the genus Citrus and citrus relatives in family

Rutaceae. Most of the species, varieties and hybrids of Citrus are infected by CTV

(Muller and Garnsey, 1984). Some of the citrus relatives such as Poncirus trifoliata,

Swinglea glutinosa, Severinia buxolia (Poir.) Tenore, some pummelo (C. grandis (L.)

Osb.) and some of the hybrids between P. trifoliata and sweet orange or grapefruit are

reported to be resistant to CTV infection (Garnsey et al., 1987a; Garnsey et al., 1997).

Symptoms

CTV causes different symptoms on different hosts. The most important symptoms

caused by CTV can be grouped into five major groups, which include mild vein clearing,

quick decline (QD), seedling yellows (SY), stem pitting on sweet orange (SPO) and stem

pitting on grapefruit (SPG). Mild vein clearing symptoms are generally produced by the

mild isolates of CTV and it includes vein clearing and flecking only on leaves of

Mexican lime. The QD symptoms are more severe and include decline and death of









grapefruit, mandarin and sweet orange trees grafted onto sour orange rootstocks. The QD

symptoms are produced as a result of virus-induced phloem necrosis in the bark of the

rootstock, at the graft union (Garnsey et al., 1987b). The SY symptoms are mostly

observed in the greenhouse and includes severe chlorosis and stunting of sour orange,

lemon and grapefruit seedlings (Roistacher, 1982). The SP symptoms are the most severe

symptoms of CTV which includes severe stunting, chlorosis, vein necrosis, cupping of

leaves, reduction in number and size of the fruit and pitting of scions especially grapefruit

and sweet orange. Unlike QD, SP symptoms do not depend upon the rootstock used (Lee

et al., 1994; Rocha-Pena et al., 1995).

Transmission

Citrus is a host for several aphid species belonging to subfamily Aphidinae in the

family Aphididae, many of these aphid species are able to transmit CTV (Blackman and

Eastop, 1984; Viggiani, 1988). The most important species of aphids which can transmit

CTV are Toxoptera citricida (Kirkaldy), Toxoptera aurantii (Boyer de Fonscolombe),

Aphis gossypii Glover, Aphis spiraecola(= citricola) Patch; their composition and

occurrence on citrus varies depending upon the country and regions (Ahlawat and

Raychaudhuri, 1988). T. citricida, commonly known as brown citrus aphid (BCA), is the

most efficient vector of CTV, A. gossypii is the second most efficient vector, A.

spiraecola reaches high populations at times and can be important in CTV spread and T.

aurantii is a rare vector (Hermosa de Mendoza et al., 1984; Yokomi et al., 1994). CTV is

semi-persistently transmitted by aphids with 30 minutes to 24 hrs. acquisition and

inoculation feeding periods required by the aphid to efficiently transmit CTV to a

healthy plant (Sasaki, 1974).









Molecular Studies

Genome organization

CTV is a single-stranded positive-sense RNA virus of about 19,296 to 19,302 nt,

depending on the isolate, and has flexuous filamentous particle (Karasev et al., 1995b;

Mawassi et al., 1996; Suastika et al., 2001; Vives et al., 1999; Yang et al., 1999). The

CTV genome encodes 12 ORFs which codes for 19 protein products (Karasev et al.,

1995a). CTV genomic RNA has two untranslated regions (UTR) of 107 nt and 273 nt at

5' and 3' termini, respectively (Karasev et al., 1995b; Pappu et al., 1994). The 3' UTR is

highly conserved among different CTV isolates with nucleotide identities as higher as

97% whereas the 5' UTR region is highly variable with nucleotide identities as low as

44%.

Replication of CTV

Replication of CTV, a positive-sense RNA virus, involves synthesis of negative-

stranded or complimentary RNA from the genomic positive-sense RNA, then synthesis of

positive-sense RNA progeny by using negative or complementary RNA as a template.

Replication associated proteins, such as RdRp, helicase, methyl transferase, are encoded

by ORF la and ORF lb of the CTV genome. From the infectious CTV clone an

infectious "replicon" was constructed named "Delta Cla" which infect protoplasts

(Satyanarayana et al., 1999; Satyanarayana et al., 2002; Tatineni S. et al., 2002). The

replicon contained the entire 5' replication complex (ORFs la and lb) and a truncated 3'

end lacking the translation products of all 3' ORFs, and replicated efficiently in Nicotiana

benthamiana protoplasts, showing that ORF la & lb are necessary for the replication

process (Satyanarayana et al., 1999). This replicon provides a model system for

manipulation and studying replication in the protoplasts (Bar-Joseph et al., 2002).









Cis-acting sequences, which are required for replication, are present at the 3' and 5'

UTR of CTV genome. Reduced replication levels in Nicotiana benthamiana protoplasts

has been reported in an engineered CTV RNA replicon of T36 isolate substituted with 5'

UTR from the VT isolate, suggesting the interaction of 5' UTR sequences with the

replicase sequences of T36 isolate (Ayllon et al., 2001; Satyanarayana et al., 1999).

Defective RNAs Associated

CTV infected plants contains defective RNA (D-RNA) which contain both

genomic RNA termini with extensive internal deletions of up to 17 kb (Ayllon et al.,

1999a). These D-RNAs showed 99 % nucleotide identity with the corresponding regions

of CTV genomic RNA and are thought to be created by the general recombination

mechanisms: RNA breakage and ligation, replicase-driven template switching and

breakage- induced template switching (Ayllon et al., 1999a; Nagy and Simon, 1997). D-

RNAs can reduce the accumulation of helper virus and may or may not modulate the

symptom expression in the virus-infected plants. Yang et al (1997) demonstrated the

involvement of CTV ORF 11 subgenomic RNA (sgRNA) as building blocks in the

recombination process, leading to the generation of D-RNAs (Yang et al., 1997).

CTV Gene Expression Strategies

Polyprotein Processing and Translational Frameshift

The 5' ORF la encodes a polyprotein of about 349 kDa which includes two papain-

like proteases, a methyltranseferase and helicase domains. The 349 kD polyprotein is

then proteolytically processed to produce two N-terminal leader proteins of 54 kD and 55

kD and a 240 kDa C-terminal fragment containing the methyl transferase and helicase

domains. ORF lb encodes a RdRp of about 57 kD via a +1 ribosomal frame shift (Cevik,

2001; Karasev et al., 1995b).









Subgenomic RNAs

Various 3' co-terminal sgRNAs are present in the CTV infected plant, which are

present as dsRNA in abundant quantities. The sgRNAs vary in their rate of expression in

the infected plants. The p20 and p23 sgRNAs are expressed at higher rates, followed by

the two CP gene sgRNAs (Hilf et al., 1995; Pappu et al., 1997). The 5' co-terminal

sgRNAs, LMT (Low molecular tristeza) and LaMT (Large molecular tristeza) of about

0.8 kb and 10 kb, respectively, have been characterized. The major portion of CTV

associated RNAs consist of LMT molecules which are composed of two modal lengths:

744-746 nt and 842-854 nt. These LMTs are produced as a result of the termination of

genomic RNA The LaMT RNA has been found to be less abundant (Che et al., 2001).

Population Structure and Genetic Diversity

The estimation of the amount of genetic diversity for CTV is still being determined.

Field isolates of CTV contain mixtures of genotypes, which can be separated due to

aphid transmission or graft transmission to different hosts (Brlansky et al., 2003; Moreno

et al., 1993a; Moreno et al., 1993b). The aphid-transmitted and the graft-transmitted

subisolates differ from the source isolate in their serological and biological properties and

also in their dsRNA banding patterns upon electrophoresis (Brlansky et al., 2003; Cambra

et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b).

Changes in the haplotype (sequence variants) distribution and frequency have been

reported due to graft and aphid transmissions, based on single-strand conformation

polymorphism (SSCP) analysis of two genes, p18 and p21, from two different regions

(Ayllon et al., 1999b). Predominant haplotypes have been reduced, and new haplotypes

have arisen in the successive graft and aphid transmitted subisolates. Changes in the

haplotype population were found to be more drastic for gene p20 as compared to gene









p18, indicating different selection pressure for these two genes. Thus the differential

selection pressure, of host and the aphid transmission, to different genes may be

responsible in part for the wide biological, serological and molecular variability among

CTV isolates (Ayllon et al., 1999b).

Based on the 5' UTR, various CTV isolates have been classified into three

sequence types: I, II and III represented by T36 isolate from Florida, VT isolate from

Israel and T317 isolate from Spain, respectively (Lopez et al., 1998). An association of

these 5' UTR types with the symptom expression has been suggested: CTV isolates

having 5' UTR type III cause mild to moderate symptoms in Mexican lime, whereas stem

pitting CTV isolates have 5' UTR type II (Ayllon et al., 2001). Presence of more than one

5' UTR types have been detected in the CTV isolates from different regions, and the 5'

UTR types were found to change after graft or aphid transmission to a new host (Ayllon

et al., 2001; Moreno et al., 1993a; Moreno et al., 1993b).

Field isolates of CTV often are mixtures of different populations and may contain

multiple D-RNAs (Mawassi et al., 1995a; Mawassi et al., 1995b). From this mixture,

strains of CTV having distinct properties can be selected, thus changing the mixture of

viral strains in different proportions in infected plants (Hilf et al., 1999).

The complete genomic sequence of several CTV isolates have been determined

(Albiach et al., 2000; Karasev et al., 1995b; Mawassi et al., 1996; Suastika et al., 2001;

Vives et al., 1999; Yang et al., 1999). Between the Florida T36 isolate and the Israeli VT

isolate, the nucleotide identities ranges from 30-40% in the 5' region of the genome to

90-97% in the 3' region of the genome (Karasev et al., 1995b; Mawassi et al., 1996).

The difference in the nucleotide sequence identity in the 5' region of the genome,









between these two isolates, was greater than expected, whereas in the 3' region of the

genome was within the normal expectations (Hilf et al., 1999; Mawassi et al., 1996). In

an another study, based on the cDNA sequences, various CTV isolates have been

classified into three groups (1, 2 & 3) with intra-group sequence identity of 88% and

inter-group sequence identity as low as 44% Some isolates were reported to belong to

more than one group (Lopez et al., 1998).

There is an uneven distribution of genomic RNA variants of CTV within an

infected plant and the population of these genomic RNA variants changes upon aphid

transmission. Different SSCP patterns have been obtained by analyzing tissue samples

from different sites of same infected plant and from the single aphids feeding on the

same infected leaf (d'Urso et al., 2000). Variation in haplotypes distribution of two

genomic regions within the ORF a of CTV, has been reported from Spain (D'Urso et

al., 2003). Also, the difference in dsRNA patterns has been detected from the analysis of

125 randomly selected CTV infected citrus trees, suggesting the presence of genetic

variation among CTV in the field trees (Guerri et al., 1991).

Florida CTV isolates can be broadly classified into two broad categories: mild

isolate and severe isolates represented by T30 and T36 isolates, respectively. However,

origins of these two genotypes present in Florida remains unknown so far and is

suggested to be the result of infected budwood importations (Hilf and Garnsey, 2002). It

is suggested that, since the T30 is distributed worldwide, so it could have had many

origins, whereas, T36 genotype, because of its limited distribution may have specific

origin (Hilf and Garnsey, 2000; Hilf and Garnsey, 2002).










Methods of Detection

Garnsey et al. in 1987 established a standardized battery of five different indicator

plants for the biological characterization of CTV isolates (Garnsey et al., 1987a).

Mexican lime is a universal indicator for CTV; sour orange is used for detection of SY;

sweet orange grafted onto sour orange is used to detect QD strains of CTV. For the

detection of more severe SP strains, Duncan grapefruit and Madame vinous sweet orange

is used for GSP and OSP strains, respectively (Lee et al., 1996). It has been

recommended that the biological indexing also should include locally important rootstock

or scions from a particular area because some CTV isolates stem pit these hosts (Lee et

al., 1996; Rocha-Pena et al., 1995).

Polyclonal and monoclonal antisera have been produced against a wide range of

CTV isolates for general detection of CTV infection. Most of these antisera do not

provide information regarding the severity of an isolate (Garnsey et al., 1981; Vela et al.,

1986). A monoclonal antibody MCA 13 was raised against the T36 isolate of CTV,

which differentiates between the mild and severe (QD) isolates of CTV in Florida

(Permar et al., 1990). MCA13 reacts only with QD strains (MCA13 positive) of CTV, but

not with Florida mild strains (MCA13 negative). In the Florida bud wood certification

program, trees which react with MCA 13 cannot be used for budwood. However, some

CTV isolates have been reported which cause decline on sour orange and yet are MCA

13 negative (Hilf and Garnsey, 2002).

Tissue print-ELISA with specific monoclonal antibodies has been reported to be

reliable and simple and economical method for routine diagnosis of plant material

(Cambra et al., 2002). The use of immunoblot technique for the detection of

mycoplasma-like pathogens and viruses, some of them were phloem limited has been









described earlier (Lin et al., 1990; Rocha-Pena et al., 1991a; Rocha-Pena et al., 1991b). A

reliable and sensitive direct tissue blot immunoassay (DTBIA) was tested for the

detection of CTV. Also, strain specific monoclonal antibody CTV-MCA13 can be used in

conjunction with this technique in order for the detection of severe strains of CTV

(Garnsey et al., 1993).

BCA has been reported to separate the mixtures of CTV genotypes that exist in

many field isolates. By using BCA as a tool to separate mixtures of genotypes, the

detection of severe subisolates hidden within the mild isolates has been reported from

different CTV isolates. Both MCA 13 positive and negative subisolates were detected

from MCA 13 negative parent isolates (Brlansky et al., 2003).

The dsRNA banding patterns upon electrophoretic separation have been used for

the identification of individual viruses and virus groups and also for the identification of

the virus strains. The number and intensity of the dsRNA banding patterns change with

the change in the host species (Jarupat et al., 1988). However, dsRNA patterns are not

always correlated with the pathogenic characteristics of CTV isolates. The RT-PCR

method for detection of CTV has successfully been used for the detection of CTV in

single and groups of 3, 5 and 10 aphids from three different aphid species T citricida,

A. gossypii andM. persicae (Mehta et al., 1997).

A multiple molecular marker (MMM) method was developed for the PCR-based

differentiation of CTV genotypes. The MMM method is based on the amplification of

the molecular markers using sequence specific RT-PCR primers designed from non-

conserved regions of VT, T3, T30 and T36 CTV isolates (Hilf and Garnsey, 2000).

Unknown CTV isolates may be characterized based on the sequence specific









amplification of RT-PCR products, producing a profile designated as "Isolate Genotype"

by the MMM method (Hilf and Garnsey, 2000; Hilf et al., 1999).

The MMM method provides a rapid technique for the detection of CTV genotypes

and also provides an initial assessment of the molecular variability within the CTV

population (Hilf and Garnsey, 2000). MMM also has been reported to be used for the

assessment of genetic relatedness of individual isolates from different citrus growing

regions of the world. Based on the MMM analysis of over 400 accessions from Florida,

T30 or/and T36 genotypes were the primary genotypes detected in commercial citrus in

Florida, followed by the VT genotype, present in some Meyer lemon trees, whereas the

T3 genotype was absent in commercial trees (Hilf and Garnsey, 2002).

The SSCP analysis is rapid and simple technique to detect the presence of minor

variations in the nucleotide sequence of DNA fragments (Rubio et al., 2000). The SSCP

analysis is based on the difference in the mobility of ssDNA fragments on a

polyacrylamide gels due to their conformation under the electrophorectic conditions used,

and this conformation inturn depends upon the nucleotide sequence. SSCP has been used

to characterize population variants in CTV from different regions of the genome (Rubio

et al., 1996; Rubio et al., 2000). SSCP analysis along with the restriction digestion has

been used differentiate CTV isolates based on the CP gene sequences (Rubio et al.,

1996).

The heteroduplex mobility assay (HMA) was developed for the detection of

unknown genotypes present in the mixed CTV infections, which may not be detected by

the PCR based detection methods (Manjunath et al 2002). HMA is rapid and simple

method for the detection and estimation of the genotypic differences between viral









strains. The DNA heteroduplexes are formed as a result of nucleotide differences

between closely related sequences, upon denaturation and reannealing of the sequences

(Delwart et al., 1993). The DNA heteroduplexes thus formed have a reduced mobility on

a polyacrylamide gels and the reduction in mobility is proportional to the degree of

divergence between the sequences (Delwart et al., 1993). Two new genotypes (T2K and

T38K) have been detected from the severe GSP Florida isolate T3800 (Manjunath et al).

HMA analysis has been used for the characterization of number of human RNA viruses

and plant RNA and DNA viruses (Berry and C., 2001; Cai et al., 1991; Delwart et al.,

1993; Lin et al., 2000).

Tristeza Disease Management

CTV management strategies to minimize the economic losses depend upon the

incidence of CTV in a particular area (Bar-Joseph et al., 1989; Lee and Rocha-Pena,

1992). Strict quarantine measures including the clean rootstock and certification

programs are useful in the areas where CTV is absent or the incidence of CTV is low.

The use of CTV tolerant rootstocks and mild strain cross-protection are useful to extend

the economic life of citrus trees in the areas of high incidence of CTV. However there is a

risk of breakdown of mild strain cross-protection either due to the new strains or the new

severe strains of CTV (Lee et al., 1996).

CTV tolerant rootstocks such as Citrus reticulate, Citrus volkameriana and Citrus

jambhiri (Rangpur lime) are tolerant to QD isolates of CTV. Some other CTV tolerant

hybrid rootstocks: Troyer and Carrizo citrange, obtained by crossing C.sinenesis (L.)

Osb. X Poncirus trifoliata (L.) Raf has been widely used in areas where QD strains of

CTV are prevalent (Van Vuuren et al., 1993). However, a number of limiting factors such

as susceptibility of some of these CTV resistant rootstocks to certain diseases (citrus









blight, Phytophthora sp. and viroids), some of the undesirable horticultural characteristics

combined with presence of stem pitting symptoms in scions regardless of the rootstocks

used, greatly limits the use of these resistant rootstocks (Bar-Joseph et al., 1989; Garnsey

et al., 1987b).

The pathogen derived resistance (PDR) has been shown to be effective and

reproducible in transgenic Mexican lime plants carrying p25 CP gene of severe and mild

isolates of CTV. However, varying degree of resistance has been reported. 10-33%

transgenic plants has been reported to be resistant to CTV graft and aphid inoculations,

whereas other transgenic plants showed significant delay in virus accumulation and

symptom onset (Dominguez et al., 2002).














CHAPTER 2
CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND
SUBISOLATES BY USING MULTIPLE MOLECULAR MARKERS

Introduction

Citrus tristeza virus (CTV) is the most destructive viral pathogen of citrus. CTV is

a phloem-limited, aphid-borne virus belonging to the family Closteroviridae, which

comprised of 30 plant viruses (Bar-Joseph et al., 1989). The Closteroviridae viruses are

characteristically flexuous filamentous rod-shaped virions that have either mono-partite

or bipartite positive-sense single-stranded RNA genomes. Closteroviruses are found

usually in the companion and parenchyma cells; hence they are called "phloem-

associated" (Esau, 1960). The host range of CTV is limited to the genus Citrus in the

family Rutaceae. Most of the species, varieties and hybrids of Citrus are infected by CTV

(Muller and Garnsey, 1984).

The CTV genome is encapsidated with two capsid proteins (CPs), the 25 kDa

major CP which encapsidates about 95% of the genome, and the 27 kDa minor CP

which encapsidates the remaining 5% of the genome on the 5' end of the virion (Febres

et al., 1996; Satyanarayana et al., 2004). CTV is a single-stranded positive-sense RNA

virus of about 19,296 to 19,302 nt, depending on the isolate, and has flexuous

filamentous particle (Karasev et al., 1995b; Mawassi et al., 1996; Suastika et al., 2001;

Vives et al., 1999; Yang et al., 1999). The CTV genome encodes 12 ORFs which codes

for 19 protein products (Karasev et al., 1995a).There are two conserved blocks of genes

in the CTV genome, ORF la & lb and ORFs 3 to ORFs 7, which also are conserved in









other closteroviruses. Inclusion bodies are produced in CTV infected tissue, which can be

used as a method of detection for rapid diagnosis of CTV (Brlansky, 1987; Brlansky and

Lee, 1990; Garnsey et al., 1980).

Many of the aphid species are vectors of CTV (Blackman and Eastop, 1984;

Viggiani, 1988) however, Toxoptera citricida (Kirkaldy), commonly known as Brown

citrus aphid (BCA), is the most efficient vector of CTV. Aphis gossypii Glover is the

second most efficient vector (Hermosa de Mendoza et al., 1984; Yokomi et al., 1994).

Field isolates of CTV often contain a mixture of CTV genotypes, which are sometimes

separated by aphid transmission or graft transmission to different hosts (Brlansky et al.,

2003; Moreno et al., 1993a; Moreno et al., 1993b). Aphid transmitted and the graft

transmitted subisolates have been reported to differ from the source isolate in their

serological and biological properties and also in their double-stranded (dsRNA) patterns

(Brlansky et al., 2003; Cambra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b).

The breakdown of cross protection against decline inducing isolates of CTV in

grapefruit trees has been reported following the introduction and establishment of the

BCA in Florida (Powell et al., 2003). An increase in the incidence of all strains of CTV

has been reported in south Florida, following the introduction of BCA in Florida.

However the increase of severe strains were greater as compared to the mild ones

(Halbert et al., 2004).

Various methods have been designed for the differentiation of CTV isolates. One of

the standard methods is biological characterization. Mexican lime is a universal indicator

for CTV; sour orange is often used for detection of seedling yellows (SY); sweet orange

grafted onto sour orange is used to detect decline-inducing (QD) strains of CTV (Garnsey









et al., 1987). The serological characterization of CTV isolates have been reported with

the use of the monoclonal antibody MCA 13, which reacts with most of QD strains

(termed as MCA 13 positive) and do not react with the mild strains (termed as MCA 13

negative) from Florida. However, this antibody is not always useful as some of the

isolates with T30 genotype (mild), have reacted positively with the MCA 13 monoclonal

antibody. Also, in some mixed CTV infections having both T30 and T36 genotypes did

not react with MCA 13 monoclonal antibody (Hilf and Garnsey, 2002a). In the Florida

budwood certification program, trees which react with MCA 13 cannot be used for

budwood (Hilf and Garnsey, 2002a). RT-PCR detection method was designed and

successfully used for the detection of CTV isolates in single and group of 3, 5 and 10

aphids from three different aphid species T. citricida, A. gossypii and Myzus persicae

(Mehta et al., 1997).

Molecular characterization of CTV isolates by cloning and sequencing of the CP

gene also has been reported (Pappu et al., 1993b). However, characterization of different

isolates and assessment of the population diversity of CTV based on the single gene or

region of the genome may not be conclusive for the entire genome, because of the

variability in the 5' and 3' region of CTV genome. Characterization of CTV isolates on

the basis of full sequence comparison is not only difficult but also a very time consuming

process.

A multiple molecular marker (MMM) method was developed for the PCR-based

differentiation of CTV genotypes. The MMM method is based on the amplification of

the molecular markers using sequence specific RT-PCR primers designed from four

different non-conserved regions of VT, T3, T30 and T36 CTV isolates (Hilf and Garnsey,









2000a). Unknown CTV isolates may be characterized based on the sequence specific

amplification of RT-PCR products, producing a profile designated as "Isolate Genotype"

by the MMM method (Hilf and Garnsey, 2000a; Hilf et al., 1999). The MMM method

provides a rapid technique for the detection of CTV genotypes and also provides an

initial assessment of the molecular variability within the CTV population (Hilf and

Garnsey, 2000a). MMM also has been used for the assessment of genetic relatedness of

individual isolates from different citrus growing regions of the world. Based on the

MMM analysis of over 400 accessions from Florida, T30 or/and T36 genotypes were the

primary genotypes detected in commercial citrus in Florida, followed by the VT

genotype, present in some Meyer lemon trees, whereas the T3 genotype was absent in

commercial trees (Hilf and Garnsey, 2002b).

The present study was conducted in order to determine the population structure

(presence of mixed infections) of the three Florida field isolates of CTV and to determine

the effect of grafting and aphid transmission on the subisolates obtained. This was

determined by using the MMM to track the changes in the population structure.

Material and Methods

Virus Isolates

Three CTV isolates: Chiefland (CL), Mcn2a (M2A) and T68, were obtained from

the University of Florida, Citrus Research and Education Centre (CREC) Lake Alfred,

Florida, USA. The CL and M2A isolates are native to Florida whereas T68 is originally

from Australia. These isolates were maintained on the sweet orange [Citrus sinenesis (L.)

Osbeck] in the greenhouse at CREC. The CL isolate is a MCA 13 negative isolate,

collected from a Meyer lemon dooryard tree in Chiefland, Florida. M2A isolate is a

MCA 13 positive Florida isolate originally collected from Meyer lemon plant from









Mahon citrus nursery, Florida. T68 isolate is MCA 13 positive isolate collected from

Ellendale mandrin plant from Winter Heaven, Florida.

Each of the three isolates was bud grafted onto three different host species (3 plants

each) of citrus: Grapefruit (Citrusparadisi Macfad), Mexican lime (Citrus aurantifolia

Swingle) and Madam vinous sweet orange (Citrus sinenesis (L.) Osbeck). For each

isolate, the graft transmitted subisolates are designated by the suffix -G followed by the

name of the host species in the parentheses. Thus three graft transmitted subisolates on

Grapefruit (GF), Mexican lime (ML) and sweet orange (SW) were obtained, for each

isolate, with the designation ending with [-G(GF)], [-G(ML)] and [-G(SW)], respectively.

Aphid transmissions were done from each of the graft transmitted subisolates of the

T68 isolate, using BCA and Mexican lime as the receptor host. For acquisition, 70-100

aphids were fed on the new flushes of plants infected with each subisolate of CTV. An

acquisition access period (AAP) of 24h was allowed for the BCA to successfully acquire

the virus from the CTV infected plants. After AAP, fifty aphids were gently picked using

#00 Red sable brushes (Ted Pella Inc., Redding, CA) and placed five aphids per plant, on

each of the ten virus-free Mexican lime seedlings. Inoculation access period (IAP) of 24

h was used, followed by an insecticide spray (0.25% Malathion) for killing the aphids.

The aphid transmitted subisolates are designated by the suffix -A followed by the name

of the host species, used for the acquisition of the virus, in the parentheses. Thus three

aphid transmitted subisolates on Grapefruit (GF), Mexican lime (ML) and sweet orange

(SW) were obtained, with the designation [T68-A(GF)], [T68-A(ML)] and [T68-A(SW)],

respectively.










Presence of the virus in the graft transmitted and aphid transmitted subisolates was

confirmed by using double antibody sandwich indirect (DAS)-ELISA. The rabbit

polyclonal antibody 1052 (1/10,000) made against T36 isolate of CTV was used

(Brlansky et al., 2003; Karasev et al., 1995b; Nikolaeva et al., 1995; Nikolaeva et al.,

1996a; Nikolaeva et al., 1996b).

Genotyping of CTV Isolates

One universal and eleven pairs of group specific primers (Table 2.1) (Hilf et al.,

2000) were used for genotyping of both source and graft transmitted CTV subisolates.

These primers are designed from four different regions of the CTV genome (POL, K17,

5' and CP; Figure 2) of T3, T30, and T36 isolates from Florida and VT isolates from

Israel. Eleven pairs of genotype specific primer pairs designated as T36POL, T36 5',

T36K17, T30POL, T30 5', T30K17, VT POL, VT5', VTK17, T3 K17 and T36CP were

synthesized (Integrated DNA technologies Inc., Coralville, IA). The T36CP primers

served as a positive control since all isolates of CTV are expected to amplify from these

primers designed to amplify the less variable CP gene region of the viral genome. Two

additional primers designated as CN 488- 491 and CN 487-489, designed from the 5'

region of the CTV genome (Figure 2), were used as positive controls.

RNA Isolation and Group Complementary DNA (cDNA) Synthesis

About 100 mg of CTV-infected tissue from bark and leaves was ground in liquid

nitrogen using a mortar and pestle and the total RNA was extracted by using the RNeasy

Plant Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.

The RNA extraction was resuspended in 30 [l of RNase-free water, and stored at -80o C.

The first strand complimentary DNA (cDNA) was synthesized in two separate groups,

using a mixture of antisense primers as shown in Table 2.1. A mixture of six to seven









antisense primers was prepared to a final concentration of 10 [iM each (Table 2.1).

Reverse transcription was carried out using a final volume of 50 il using Superscript II

(Invitrogen, Carlsbad, CA according to the manufacturer. Two separate reactions, each

using a group of antisense primers, as indicated in Table 2.1, and 20 [l of RNA

extraction, were carried out for each sample. Group 1 and 2 cDNAs were purified using a

QIA quick PCR purification kit (QIAGEN, Valencia, CA), and the final elution was

made in 30 il of elution buffer (EB), according to manufacturer's protocol.

Polymerase Chain Reaction (PCR)

Thirteen PCR amplifications were carried out from each sample in 50 .il reaction

volumes using 5 [il of each of the purified group 1 and group 2 cDNAs, amplified in a 50

1.l reaction volume, separately for each primer pair, using the 5 U of Taq DNA

polymerase (Promega), IX PCR reaction buffer, 1.5mM MgCl2, 200 LM of each dNTPs,

200 nM of each primer. PCR was performed by using programmable thermal controller

(Model HBPX 110, PCR Express, Hybaid Limited, Middlesex, UK). Amplification

parameters were 940 C for 2 minutes, 30 cycles of 940 C for 30 seconds, 560 C for 300 C

seconds, 720 C for 45 seconds, followed by incubation at 720 C for 10 minutes. RT-PCR

products were analyzed by 1% agarose gels containing 200 ng of ethidium bromide per

ml and BioRad Gel-Doc imaging system was used for visualization of DNA bands.

Results

A specific genotype profile was assigned to each isolate based on amplification of

MMM. The profile of an isolate thus created is referred to as an Isolate Genotype"

(Hilf and Garnsey, 2000b; Hilf and Garnsey, 2002a).









Isolate: CL

Isolate CL was analyzed using the MMM primer set designed by Hilf et al., 2000

and shown in the Table 2.1. The results of MMM analysis for CL isolate and subisolates

are presented in the Table 2.2. CL source isolate was found to be a mixture of T36 and

VT genotypes as amplifications were obtained with the entire three markers (POL, 5' and

K17) specific to T36 and VT isolates [Figure 2.2(A)]. As expected, PCR products were

obtained with the three universal primers used as a positive control: T36 CP, CN 487-489

and CN488- 491. There were no products obtained with the markers specific to either T3

or T30 genotypes [Figure 2.2(A)].

All the graft transmitted subisolates [CL-G (GF), CL-G (ML) and CL-G (SW)]

showed similar "isolate genotype", as that of CL source isolate, except for the CL-G

(ML) subisolate. CL-G (ML) subisolate did not amplifiy with the markers (T36 POL,

T36 5' and T36 K17) specific for the T36 isolate. However, it was amplifiied with the VT

POL, VT 5' and VT K17 markers in addition to the amplification with the general

markers [Figure 2.2 (C)]. The CL-G (GF) subisolate was amplified with the T36 POL,

VT POL, VT 5' and VT K17 molecular markers [Figure 2.2 (B)]. The CL-G (SW)

subisolate was amplified with the T36 POL, VT POL and VT K17 markers [Figure 2.2

(D)]. The CL-G (GF) and CL-G (SW) subisolates did not amplify with the T36 5' and

T36 K17 markers [Figure 2.2 (A-D)]. All of the three graft transmitted subisolates, CL-G

(GF), CL-G (ML) and CL-G (SW), were amplified with the general markers [Figure 2.2

(B-D)]. None of these isolates amplified with the T36 5', T36 K17, T30 POL, T30 5' and

T3 K17 markers, however, CL source isolate was amplified by the T36 5' and T36 K17

[Figure 2.2 (A-D)]. In comparison to CL source and other two subisolates, CL-G (GF)

and CL-G (ML), CL-G (SW) did not amplify with the VT 5' marker [Figure 2.3 (A-D)].









Isolate: M2A

Isolate M2A was analyzed using the MMM primer set designed by Hilf et al., 2000

and shown in the Table 2.1. The results of MMM analysis for M2A isolate and

subisolates are presented in the Table 2.2. The M2A source isolate is a mixture of T36

and VT genotypes as it was amplified with all the three markers (T36 POL, T36 5' and

T36 K17) specific to T36 and all the three markers (VT POL, VT 5' and VT K17)

specific to VT genotype [Figure 2.3 (A)]. It also was amplified with the three general

markers used as a positive control: T36 CP, CN 487-489 and CN488-491. No

amplification was obtained with the T3K17 marker and two of the three markers (T30

POL, and T30 K17) specific for the T30 genotype [Figure 2.3 (A)]. M2A source isolate

also showed amplification of T30 5' marker, which can only be amplified from T30

genotype (Hilf and Garnsey, 2000b) [Figure 2.3 (A)].

All the graft transmitted subisolates [M2A-G (GF), M2A-G (ML) and M2A-G

(SW)] showed similar "isolate genotype profiles", as that of M2A source isolate [Figure

2.3 (A-D)]. These subisolates also were a mixture of T36 and VT genotypes with positive

amplifications with all the three markers (T36 POL, T36 5' and T36 K17) specific to T36

and of all the three markers (VT POL, VT 5' and VT K17) specific to VT isolate. The

general markers used as positive control also amplified these isolates [Figure 2.3 (B-D)].

None of the three graft transmitted subisolates were amplifed with the T30 5'primers,

which amplified the M2A source isolate [Figure 2.3 (A-D)].

Isolate: T68

The T68 isolate has previously been described as a T3 genotype, where it has been

reported to be amplified with the T3K17, VT POL and VT 5' primers in addition to the

T36CP general marker (Hilf and Garnsey, 2000b). In the present study, the T68 source









isolate was amplified with the T3K17 and VT POL markers in addition to the general

markers (T36 CP, CN 487-489 and CN488-491) [Figure 2.4 (A)]. This confirms that it

contains T3 genotype. The T68 source isolate failed to amplify with the VT 5'marker.

All of the graft transmitted subisolates: T68-G (GF), T68-G (ML) and T68-G (SW)

showed similar isolate genotype profiles as that obtained for the T68 source isolate

[Figure 2.4 (A-D)]. T68-G (GF), T68-G (ML) and T68-G (SW) subisolates may contain

mixture of VT and T3 genotypes, as all the three subisolates showed amplification with

the VT POL & T30K17 and T3k17 markers [Figure 2.4 (B-D)]. T68-A(GF) aphid

transmitted subisolate was amplified with the T3K17, VT POL and T30K17 markers in

addition to the general markers, T36CP and CN 488-491 [Figure 2.5 (B)] It did not

show amplification with the VT 5' and VT K17 markers, however, it was amplified with

the VT POL marker which is specific for VT genotype and T30 K17 marker which can

be amplified from VT isolate (Hilf and Garnsey, 2000b). T68-A(SW) aphid transmitted

subisolate was only amplified with the VT POL marker and the general markers. T68-A

(SW) subisolate did not show amplification with the T3K17 marker [Figure 2.5 (C)].









Table 2.1 Sequence of genotype specific-oligonucleotide primers (Hilf and Garnsey,
2000) and two universal primer pairs(*) used for the RT-PCR amplification of
CTV Molecular Markers.


PRIMER


POLARITY


T36CP SENSE
ANTISENSE
T36POL SENSE
ANTISENSE
T36-5' SENSE
ANTISENSE
T36K17 SENSE
ANTISENSE
T30 POL SENSE
ANTISENSE
T30-5' SENSE
ANTISENSE
T30K17 SENSE
ANTISENSE
VTPOL SENSE
ANTISENSE
VT-5' SENSE
ANTISENSE
VT K17 SENSE
ANTISENSE
T3 K17 SENSE
ANTISENSE
CN 487* SENSE
CN 489* ANTISENSE
CN 488* SENSE
CN 491* ANTISENSE


SIZE (bp)
672

714


500

409

696

594

409

695

492

409

409

380

404


GROUPt PRIMER SEQUENCE (5'-3')
ATGGACGACGAAACAAAGAAATTG
1 TCAACGTGTGTTGAATTTCCCA
GATGCTAGCGATGGTCAAAT
1 CTCAGCTCGCTTTCTCGCAT
AATTTCACAAATTCAACCTG
1 CTTTGCCTGACGGAGGGACC
GTTTTCTCGTTTGAAGCGGAAA
1 CAACACATCAAAAATAGCTAGT
GATGCTAGCGATGGTCAAAT
1 CTCAGCTCGCTTTCTCGCAT
CGATTCAAATTCACCCGTATC
1 TAGTTTCGCAACACGCCTGCG
GTTGTCGCGCCTAAAGTTCGGCA
1 TATGACATCAAAAATAGCTGAA
GACGCTAGCGATGGTCAAGC
2 CTCGGCTCGCTTTCTTACGT
AATTTCTCAAATTCACCCGTAC
2 CTTCGCCTTGGCAATGGACTT
GTTGTCGCGCTTTAAGTTCGGTA
2 TACGACGTTAAAAATGGCTGAA
GTTATCACGCCTAAAGTTTGGT
2 CATGACATCGAAGATAGCCGAA
GCGTTGGATGATATCCTTCGCTGG
2 AATTRTTCCGCSCAGGACGGAACA
TGTTCCGTCCTGSGCGGAAYAATT
2 GTGTARGTCCCRCGCATMGGAACC









Table 2.2 Genotype profiles of Chiefland (CL), Mcn2a (M2A) and T68 isolate from Florida, created by RT-PCR amplification of
three general and ten genotype-specific markers. Two general markers are T36 CP, CN 487-489 and CN 488-491. Ten
genotype-specific markers are T36 POL, T36 5', T36 K17, T30 POL, T30 5', T30 K17, VT POL, VT 5', VT K17 and T3
K17. Graft transmitted sub-isolates are designated by -G followed by name of the host species in parentheses. Aphid
transmitted sub sub-isolates are designated by suffix -A followed by the source plant used for acquisition of virus by the


GF= Grapefruit; ML= Mexican lime;


p


I I I I I















ORFla p6
P-PRO p349 p33 p65 p27 p18 p20
5' p56 f p61 p25 3'
p25
HEL HSP70h
I I CPm p13 p23

6' K17 POL




Fiemae 2.1 Schematic diagram of Citrus tristeza virus genome indicating different ORFs and approximate portions of the genome
amplified with genotype specific molecular markers by Hilf et al, 2000. The sequence specific markers amplified are
indicated by the shaded (black) blocks and the name of the amplified marker underneath in shaded boxes.














Pl 1 I I A* ; 1l/r 47 Q o i C11 rCi


400 bp


G1 1 2 3 4 5* 6 7 8 9 10 G3 M1





3Gl* 2* 3 45* bp





M3 G1 1 2 3 4 5 6 7 8 9 10 G3 M3
564 bp 564 bp









Figure 2.2: Multiple molecular marker (MMM) profiles of Chiefland isolate and the graft
transmitted sub-isolates created by PCR amplification by using sequence-
specific primers. Eight pl of MMM-PCR product was loaded in lanes 1- 10.
Lanes 1-3 show amplification of T36 POL, T36 5' and T36 K17 markers,
specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30
POL, T30 5' and T30 K17 markers, specific for mild T30 isolate from Florida.
Lanes 7-9 show amplification of VT POL, VT 5' and VT K17 markers,
specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker,
specific for T3 isolate from Florida. Lanes GI, G2 and G3 show amplification
of general markers: T36 CP, CN 487-489 and CN 488-491, respectively. Lane
Ml, M2 and M3 were loaded with 0.5 C[g of 100 bp DNA ladder (Invitrogen),
0.5 ng of 1 Kb DNA ladder (Promega) and 0.5 [g of Hind III fragments of X
DNA (Invitrogen), respectively. Fig. A shows isolate profile of Chiefland
source isolate. Fig. B, C and D shows profiles of sub-isolates of Chiefland
isolate grafted onto Grapefruit (GF), Mexican lime (ML) and Sweet orange
(SW) respectively. All the amplifications are specific as otherwise indicated
by the symbol (*).














400 bp


G1 1 2 3 4 5 6 M2 7 8 9 10 G2 G3



S400 bp

M1 G1 1 2* 3 4 5 6 7 8 9 10 3 M1


400 bp 400 bp


M1G1 1 2 3 4 5 6 7 8 9 10 G2 G3 M1



400 bp 400 bp


Figure 2.3: Multiple molecular marker (MMM) profiles of Mcn2a isolate and the graft
transmitted sub-isolates created by PCR amplification by using sequence -
specific primers. Eight pl of MMM-PCR product was loaded in lanes 1- 10.
Lanes 1-3 show amplification of T36 POL, T36 5' and T36 K17 markers,
specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30
POL, T30 5' and T30 K17 markers, specific for mild T30 isolate from Florida.
Lanes 7-9 show amplification ofVT POL, VT 5' and VT K17 markers,
specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker,
specific for T3 isolate from Florida. Lanes G1, G2 and G3 show amplification
of general markers: T36 CP, CN 487-489 and CN 488-491, respectively. Lane
Ml, M2 and M3 were loaded with 0.5 [g of 100 bp DNA ladder (Invitrogen),
0.5 ng of 1 Kb DNA ladder (Promega) and 0.5 [g of Hind III fragments of X
DNA (Invitrogen), respectively. Fig. A shows isolate profile of Mcn2a source
isolate. Fig. B, C and D shows profiles of sub-isolates of Mcn2a isolate
grafted onto Grapefruit (GF), Mexican lime (ML) and Sweet orange (SW)
respectively. All the amplifications are specific as otherwise indicated by the
symbol (*).















I 400 bp


G1 1 2* 3 4 5 6 M2 7 8* 9 10 G2 G3





G1 1 2* 3 4* 5* 6 M2 7 8* 9 10 G2 G3


400 bp


G1 1 2* 3 4 5 6 M2 7 8* 9 10 G2 G3


400 bp



Figure 2.4: Multiple molecular marker (MMM) profiles of T68 isolate and the graft
transmitted sub-isolates created by PCR amplification amplsing sequence -
specific primers. Eight pl of MMM-PCR product was loaded in lanes 1- 10.
Lanes 1-3 show amplification of T36 POL, T36 5' and T36 K17 markers,
specific for T36 isolate from Florida. Lanes 4-6 show amplification of T30
POL, T30 5' and T30 K17 markers, specific for mild T30 isolate from Florida.
Lanes 7-9 show amplification of VT POL, VT 5' and VT K17 markers,
specific for VT Israeli isolate. Lane 10 show amplification of T3 K17 marker,
specific for T3 isolate from Florida. Lanes GI, G2 and G3 show amplification
of general markers: T36 CP, CN 487-489 and CN 488-491, respectively. Lane
Ml, M2 and M3 were loaded with 0.5 C[g of 100 bp DNA ladder (Invitrogen),
0.5 ng of 1 Kb DNA ladder (Promega) and 0.5 [g of Hind III fragments of X
DNA (Invitrogen), respectively. Fig. A shows isolate profile of T68 source
isolate. Fig. B, C and D shows profiles of sub-isolates of T68 isolate grafted
onto Grapefruit (GF), Mexican lime (ML) and Sweet orange (SW)
respectively. All the amplifications are specific as otherwise indicated by the
symbol (*).
















1 1Y 4400 bp


G1 1 2 3 4 5* 6 7 8 9 10 M3 G3



564 bp






400 bp



Figure 2.5: Multiple molecular marker (MMM) profiles of the T68 source isolate and
aphid transmitted subisolates of T68, created by PCR amplification by using
sequence-specific primers. Eight pl of MMM-PCR product was loaded in
lanes 1- 10. Lanes 1-3 show amplification of T36 POL, T36 5' and T36 K17
markers, specific for T36 isolate from Florida. Lanes 4-6 show amplification
of T30 POL, T30 5' and T30 K17 markers, specific for mild T30 isolate from
Florida. Lanes 7-9 show amplification of VT POL, VT 5' and VT K17
markers, specific for VT Israeli isolate. Lane 10 show amplification of T3
K17 marker, specific for T3 isolate from Florida. Lanes GI, G2 and G3 show
amplification of general markers: T36 CP, CN 487-489 and CN 488-491,
respectively. Lane Ml, M2 and M3 were loaded with 0.5 C[g of 100 bp DNA
ladder (Invitrogen), 0.5 ng of 1 Kb DNA ladder (Promega) and 0.5 [g of Hind
III fragments of X DNA (Invitrogen), respectively. Fig. A shows isolate profile
of T68 source isolate. Fig. B shows the profile of subisolate obtained through
aphid transmission of CTV from Grapefruit to Mexican lime, Fig. C shows the
profile of subisolate obtained through aphid transmission of CTV from sweet
orange to Mexican lime.All the amplifications are specific as otherwise
indicated by the symbol (*).









Table 2.2 Summary of the results of multiple molecular marker (MMM) of Chiefland
(CL), Mcn2a (M2A) and T68 source isolates and the graft/aphid transmitted
subisolates from Florida.The graft transmitted sub-isolates are designated by -
G followed by name of the host species in parentheses. Aphid transmitted sub
sub-isolates are designated by suffix -A followed by the source plant used for
acquisition of virus by the aphid.
ISOLATE/ NUMBER OF NAME OF THE
SUBISOLATE GENOTYPES GENOTYPE
DETECTED
CL 2 T36 and VT
CL-G(GF) 2 T36 and VT
CL-G(ML) 2 T36 and VT
CL-G(SW) 2 T36 and VT
M2A 2 T36 and VT
M2A-G(GF) 2 T36 and VT
M2A-G(ML) 1 VT
M2A-G(SW) 2 T36 and VT
T68 2 T3 and VT
T68-G(GF) 2 T3 and VT
T68-G(ML) 2 T3 and VT
T68-G(SW) 2 T3 and VT
T68-A(GF) 1 T3
T68-A(SW) I I Non-specific


Discussion

CTV is the most destructive viral disease of citrus and is distributed worldwide in

most of the citrus growing regions of the world. Various studies have shown that field

isolates of CTV contains mixture of genotypes, which can be separated due to aphid

transmission or graft transmission to different hosts (Moreno et al., 1993a; Moreno et al.,

1993b). The aphid transmitted and the graft transmitted subisolates have often been

reported to differ from the source isolate in their serological and biological properties as

well as in their double-stranded RNA (dsRNA) patterns (Cambra et al., 1993; Moreno et

al., 1993a; Moreno et al., 1993b).

Three Florida isolates were selected for the present study. CL isolate was found to

be mixture of T36 and VT genotypes based on the amplifications from all the primers









specific for these isolates. Amplification also was obtained with the T30K17 marker, but

it has been reported that the T30 k17 marker can be amplified from certain VT isolates

(Hilf and Garnsey, 2000b). However, changes in the genotype profile due to graft

transmission were detected in CL graft transmitted subisolates, as none of these

subisolates showed amplification with the T36 5' and T36 K17 markers, which amplified

CL source isolate. The CL-G (ML) subisolate failed to amplify with any of the three

markers (T36 POL, T36 5' and T36 K17) specific for T36 isolate even when repeated 3-4

times and thus may only contains VT genotype. Being a supposedly mild isolate, based

on MCA 13 monoclonal antibody reactivity, CL source isolate having T36 and VT

genotypes is unexpected.

M2A isolates was found to be mixture of T36 and VT genotypes. There were no

changes in the isolate genotype due to graft transmission as all the graft transmitted

subisolates [M2A-G (GF), M2A-G (ML) and M2A-G (SW)] were also found to be

mixture of T36 and VT genotypes. However minor changes in the amplification of these

isolates were obtained, where none of the three subisolates was amplifed with the T30 5'

primers, which amplified the M2A source isolate [Figure 2.2 (A-D)]. Changes in the

dsRNA patterns due to passage through different hosts have been reported earlier.

However, sequencing of the amplified T30 5' marker need to be done in order to confirm

the presence of T30 genotype like sequences in M2A source isolate and its absence in the

subsequent graft transmitted subisolates to different hosts.

However, limited analysis done on aphid transmissions of M2A isolate showed

changes in the genotype profile of the aphid transmitted subisolates. T36 genotype was

not detected in any of the 15 aphid transmitted subisolates analyzed. These results









indicate low or non-aphid transmissibility of T36 genotype. Low transmission rates (1-2

%) of T36 genotype has been reported earlier (R. H. Brlansky, unpublished data).

T68 isolate contains T3 genotype but may also contain VT genotype as a mixture

with T3 genotype. The T68 source isolate showed amplification of T3K17 and VT POL

markers in addition to the general markers (T36 CP, CN 487-489 and CN488-491) used

as positive controls [Figure 2.3 (A)]. This confirms that it contains T3 genotype.

According to the standard T3 genotype, T3kl7, VT POL and VT 5' should be amplified

(Hilf and Garnsey, 2000b). However, the T68 source isolate showed amplification of T3

K17 and VT POL markers but failed to amplify VT 5' (reported earlier), which is

contradictory to the earlier results. None of the T68 plants amplified VT 5' even after

repeating several times. Instead it amplified T30K17 [Figure 2.3 (A)], which can be

amplified from VT genotype (Hilf and Garnsey, 2000b). Since the T68 source isolate in

the present study amplified VT POL and T30K17 markers, it indicates that it may also

contain VT genotype. Thus, T68 isolate may be a mixture of VT and T3 genotypes.

There was no change in the isolate genotype of the T68 graft transmitted

subisolates. However, some changes were found due to the aphid transmission as T68-A

(SW) subisolate was only amplified with the VT POL marker and did not show

amplification with T3K17 marker. So it could not be assigned a particular genotype based

only on the amplification with the VT POL marker and thus came out as a non standard

genotype, according to Hilf et al 2000. However, sequencing of the amplified T3 K17

and VT POL markers needs to be done to confirm the presence of T3 and VT genotypes

in T68 source isolate and presence/absence of these genotypes in graft and/or aphid

transmitted subisolates.









Previously it was found that severe QD isolates from Florida showing reactivity

with MCA 13 monoclonal antibody were characterized as having T36 genotype and

isolates showing mild symptoms and no MCA 13 reactivity were characterized as having

T30 genotype. Hilf and Garnsey, 2002 found that some isolates that were supposed to

be mild based on the MCA 13 monoclonal antibody reactivity, were found to contain the

T36 genotype, and some of the isolates characterized as T36 genotype or having mixed

infections with T30 and T36 genotypes were reported to be showing negative reactivity

with MCA 13 monoclonal antibody (Hilf and Garnsey, 2002a). In the further studies

done by Brlansky et al, (2003), both MCA 13 positive and negative subisolates were

reported from the MCA 13 parent isolate after the aphid transmission and some of the

MCA 13 negative subisolates were found to contain severe genotypes.

Also, in the present study, the CL isolate, which is supposed to be a mild isolate

because of negative reactivity to the MCA 13 monoclonal antibody, was found to be a

mixture of T36 and VT genotypes. T36 is a severe decline isolate from Florida whereas

VT is a seedling yellows isolate from Israel.














CHAPTER 3
CHARACTERIZATION OF Citrus tristeza virus (CTV) ISOLATES AND
SUBISOLATES BY USING HETERODUPLEX MOBILITY ASSAY

Introduction

Tristeza disease, caused by Citrus tristeza virus (CTV), is one of the most

destructive viral diseases of citrus. Epidemics of this disease have been reported in many

citrus producing countries, killing millions of citrus trees on sour orange rootstock. CTV

is a phloem-limited, aphid-borne virus, belonging to family Closteroviridae (Bar-Joseph

et al., 1989). It has flexuous filamentous rod shaped particles and is a mono-partite,

positive-sense single-stranded RNA virus. CTV has a narrow host range which is limited

mostly to the genus Citrus in family Rutaceae. Two capsid proteins (CPs), the 25 kDa

major CP and the 27 kDa minor CP, are present which encapsidates about 95% and 5%

(on the 5' end) of the genome of CTV, respectively (Febres et al., 1996; Satyanarayana et

al., 2004). CTV causes different symptoms on different hosts. The most important

symptoms caused by CTV can be grouped into five major groups, which include mild

vein clearing on susceptible hosts, quick decline on sour orange (QD), seedling yellow on

lemons and grapefruit (SY), stem pitting on sweet orange(SPO) and stem pitting on

grapefruit (SPG) (Garnsey et al., 1987; Rocha-Pena et al., 1995).

The CTV genome encodes 12 ORFs which codes for 19 protein products (Karasev

et al., 1995a). Two conserved blocks of genes, ORF la & lb and ORFs 3 to ORFs 7 have

been identified in CTV which also are conserved in other closteroviruses (Karasev,

2000). The first gene block, ORF la encodes two papain-like proteases,









methyltransferase and helicase domains which are expressed through the proteolytic

processing of a polyprotein. The ORF lb encodes the RNA dependent RNA polymerase

(RdRp) which is expressed by +1 ribosomal frameshift (Cevik, 2001; Cevik et al., 1999).

The second gene block, ORFs 3 to ORFs 7, encodes a small 6 kDa hydrophobic protein, a

65-kDa homolog of cellular HSP 70 proteins, a 61 kDa protein and two structural CPs.

CTV genomic RNA also has two untranslated regions (UTR) of 107 nt and 273 nt at 5'

and 3' termini, respectively (Karasev et al., 1995b; Pappu et al., 1994). The 3' UTR is

highly conserved among different CTV isolates with nucleotide identities as high as 97%

whereas the 5' UTR region is highly variable with nucleotide identities as low as 44%.

The most important species of aphids which can transmit CTV are Toxoptera

citricida (Kirkaldy), Toxoptera aurantii, Aphis gossypii (Glover), Aphis spiraecola(

citricola); their composition and occurrence on citrus varies depending upon the country

and regions (Ahlawat and Raychaudhuri, 1988). The T. citricida (Kirkaldy), commonly

known as the brown citrus aphid (BCA), is the most efficient vector of CTV (Hermosa de

Mendoza et al., 1984; Yokomi et al., 1994).

Field isolates of CTV contain mixtures of genotypes, which can be separated due

to aphid transmission or graft transmission to different hosts (Brlansky et al., 2003;

Moreno et al., 1993a; Moreno et al., 1993b). The aphid-transmitted and the graft-

transmitted subisolates may differ from the source isolate in their serological and

biological properties and also in their dsRNA banding patterns upon electrophoresis

(Brlansky et al., 2003; Cambra et al., 1993; Moreno et al., 1993a; Moreno et al., 1993b).

Various methods have been described for the characterization of field isolates of

CTV. For the biological characterization of CTV isolates, Mexican lime is a universal










indicator for CTV; sour orange is used for detection of SY; sweet orange grafted onto

sour orange is used to detect QD strains of CTV (Lee et al., 1996).

Serological characterization can be done by using polyclonal and monoclonal

antisera produced against a wide range of CTV isolates. Most of these antisera do not

provide information regarding the severity of an isolate (Garnsey et al., 1981; Vela et al.,

1986). However, monoclonal antibody MCA 13, raised against T36 isolate of CTV,

differentiates between the mild and severe (QD) isolates of CTV in Florida (Permar et al.,

1990). MCA13 reacts only with QD strains (MCA13 positive) of CTV, but not with

Florida mild strains (MCA13 negative). However, this condition is not always true as

some of the isolates detected as having T30 genotype, reacted with the MCA 13

monoclonal antibody. Also, in case of some mixed CTV infections having both T30 and

T36 genotypes showed no reaction with MCA 13 monoclonal antibody (Hilf and

Garnsey, 2002a).

The BCA has been reported to separate the mixtures of CTV genotypes that exist

in many field isolates. By using BCA as a tool to separate mixtures of genotypes, the

detection of severe subisolates hidden within the mild isolates has been reported from

different CTV isolates. Both monoclonal antibody MCA 13 positive and negative

subisolates were detected from MCA 13 negative parent isolates (Brlansky et al., 2003).

In the Florida bud wood certification program, trees which react with MCA 13 cannot be

used for budwood. However, some CTV isolates have been reported which cause decline

on sour orange and yet are MCA 13 negative (Hilf and Garnsey, 2002b).

The dsRNA banding patterns upon electrophoretic separation have been used for

the identification of individual viruses and virus groups and also for the identification of









the virus strains. The number and intensity of the dsRNA banding patterns change with

the change in the host species (Jarupat et al., 1988). However, dsRNA patterns are not

always correlated with the pathogenic characteristics of CTV isolates. The RT-PCR

method for detection of CTV has successfully been used for the detection of CTV in

single and groups of 3, 5 and 10 aphids from three different aphid species T. citricida,

A. gossypii andMyzuspersicae (Mehta et al., 1997).

The Multiple Molecular Marker (MMM) is a method for molecular characterization

of the CTV isolates and identification of CTV genotypes. The MMM method is based on

the amplification of selected regions of the CTV genome using CTV genotype specific

primers, designed from non-conserved regions of VT, T3, T30 and T36 CTV isolates

(Hilf and Garnsey, 2000). The method provides a rapid technique for the detection of

CTV genotypes (Hilf and Garnsey, 2000), however the classification is limited to only

four genotypes.

The single-strand conformation polymorphism (SSCP) analysis is rapid and simple

technique to detect the presence of minor variations in the nucleotide sequence of DNA

fragments (Rubio et al., 2000). However, the fragments size should be small in order to

get high sensitivity (Maynard and Upadhyaya, 1998). This method will identify single

base polymorphisms in the amplicons of upto 200 bp.

The heteroduplex Mobility Assay (HMA) was developed for the detection of

unknown genotypes present in the mixed CTV infections, which may not be detected by

other PCR based detection methods (Manjunath et al., 2002). HMA is rapid and simple

method for the detection and estimation of the genotypic differences between viral

strains. The DNA heteroduplexes are formed as a result of nucleotide differences










between closely related sequences, upon denaturation and reannealing of the sequences

(Delwart et al., 1993). The DNA heteroduplexes, thus formed, have a reduced mobility

on polyacrylamide gel electrophoresis and the reduction in mobility is proportional to the

degree of divergence between the sequences (Delwart et al., 1993). The sensitivity of

HMA has been reported to be about 5 %, however sequence difference as low as 2.3 %

has been reported (Berry and Rey, 2001). Two new genotypes (T2K and T38K) have

been detected from the severe grapefruit stem pitting Florida isolate T3800 using HMA

(Manjunath et al., 2000). HMA analysis has been used for the characterization of number

of human RNA viruses and plant RNA and DNA viruses (Berry and C., 2001; Cai et al.,

1991; Delwart et al., 1993; Lin et al., 2000).

The biological characterization of CTV isolates is time consuming as QD

symptoms takes 12-15 months under ideal greenhouse conditions. However the

molecular techniques for detection and characterization of CTV genotypes in the field

isolates though are rapid but limited by the amount of sequence information available for

designing such experiments. The present study was conducted in order to better

understand the population diversity of CTV (presence of sequence variants or genotypes)

through detection and sequence comparison of genotypes by using the HMA. The

population complex of three Florida isolates of CTV and graft and aphid transmitted

subisolatesfrom these isolates were analyzed by using HMA method. Both MCA 13

positive and MCA 13 negative source isolates of CTV were used. The resultant sequence

information generated which will be helpful in designing rapid and more efficient

methods of detection of different strains of CTV in the future.









Material and Methods

Virus Isolates

Three CTV isolates from Florida: Chiefland (CL), Mcn2a (M2A) and T68, were

obtained from University of Florida, Citrus Research and Education Center (CREC) Lake

Alfred, Florida, USA. The CL and M2A isolates are native to Florida whereas T68 was

imported to Florida in an illegal budwood from Australia, but since the isolates was

present in the field for several years; it is considered a Florida isolate. These source

isolates were maintained on the sweet orange plants (Citrus sinenesis (L.) Osbeck) in the

greenhouse at CREC.

CL isolate was, collected from a Meyer lemon tree in Chiefland, Florida. It does

not react with the monoclonal antibody, MCA 13 which has been reported to discriminate

between mild and severe isolates in Florida (Permar et al., 1990). T68 isolate is MCA 13

positive isolate collected from Ellendale mandrin plant from Dundee, Florida. Each of the

three isolates was bud grafted onto three different host species (3 plants each) of citrus:

Grapefruit (Citrus paradisi Macfad), Mexican lime (Citrus aurantifolia Swingle) and

sweet orange (Citrus sinenesis (L.) Osbeck) cv. Madam Vinous.

The graft transmitted subisolates are designated by the suffix -G followed by the

abbreviation for the name of the host species in the parentheses. Thus three graft

transmitted subisolates on Grapefruit (GF), Mexican lime (ML) and sweet orange (SW)

were obtained, for each isolate, with the designation ending with [-G(GF)], [-G(ML)] and

[-G(SW)], respectively.

Aphid transmissions were done using BCA from each of the graft transmitted

subisolates of the T68 isolate, onto Mexican lime as the receptor host. About 70-100

aphids were fed on the new flushes plants inoculated with each subisolate. After an









acquisition access period (AAP) of 24h, aphids were gently picked by using #00 Red

sable brushes (Ted Pella Inc., Redding, CA) and placed five aphids per plant, on each of

the ten virus-free Mexican lime seedlings. Inoculation access period (IAP) of 24 h. was

used. Then the aphids were killed by spraying with an insecticide (0.25% Malathion).

The aphid transmitted subisolates are designated by the suffix -A followed by the

abbreviation for name of the host species, used for the acquisition of the virus, in the

parentheses. Thus three aphid transmitted subisolates on Grapefruit (GF), Mexican lime

(ML) and sweet orange (SW) were obtained, with the designation [T68-A(GF)], [T68-

A(ML)] and [T68-A(SW)], respectively. Presence of the virus in the graft transmitted and

aphid transmitted subisolates was confirmed by using double antibody sandwich indirect

(DAS)-ELISA as described earlier (Brlansky et al., 2003; Nikolaeva et al., 1995;

Nikolaeva et al., 1996a; Nikolaeva et al., 1996b).

RNA Isolation and Complementary DNA (cDNA) Synthesis

About 100 mg of CTV-infected tissue from bark and leaves was pulverized in

liquid nitrogen using a mortar and pestle and the total RNA was extracted by using the

RNeasy Plant Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's

instructions. The final total RNA extraction was resuspended in 30 itl of RNase-free

water, and stored at -80o C. For the first strand complimentary DNA (cDNA) synthesis,

10 [l of total extracted RNA was mixed separately with 200 nM of CN 491

(5'GTGTARGTCCCRCGCATMGGAACC3') antisense primer (Table 2.1), centrifuged

at 10,000 rpm for 10 s, then incubated at 70 C for 10 min and transferred to ice for 5 min.

A reaction mixture was prepared by adding 5X first strand buffer [250 mM Tris-HCl (pH

8.3), 375 mM KC1, 15 mM MgC12], 0.1 M dithiothreiotol (DTT), 200 [M of each dNTPs

(Promega, Madison, WI) and sterile distilled water. This reaction mixture was incubated










at 42 C for 2 min. and then kept at room temperature for 10 min. Twenty U of Superscript

II RNase H-Reverse transcriptase (Invitrogen, Carlsbad, CA) and 40 U of RNasin

(Promega, Madison, WI) was added to the reaction mixture and centrifuged at 10, 000

rpm for 10 s. Nine [l of this cocktail reaction mixture was added to each tube containing

the RNA preparations. Twenty pl of the total content was incubated at 50 C for lh, 72 C

for 15 min. and then transferred to ice.

Polymerase Chain Reaction (PCR)

About 400 bp region of the CTV genome (nt 1084-1484) in the protease (L1)

domain of ORF la was amplified from 5 l of the cDNA in a 50 pl reaction volume,

using the 5 U of Taq DNA polymerase (Promega, Madison, WI), IX PCR reaction

buffer, 2.5 mM MgCl2, 200 |M of each dNTPs, 200 nM of each of CN 488

(5'TGTTCCGTCCTGSGCGGAAYAATT3') and CN 491

(5'GTGTARGTCCCRCGCATMGGAACC3') primer pair. PCR was performed by using

Biometra UNO (1984) Thermoblock temperature thermocycler. Amplification parameters

were 94 C for 2 minutes, 30 cycles of 94 C for 30 seconds, 62 C for 45 seconds, 72 C

for 45 seconds, followed by incubation at 72 C for 10 minutes. RT-PCR products were

analyzed by electrophoresis on 1% agarose gels in IX TAE buffer (40 mM Tris-Acetate

and 1 mM EDTA, pH 8.0) at 100 volts for 40 45 minutes, containing 200 ng of

ethidium bromide per ml. A Biorad Gel-Doc imaging system was used for visualization

of DNA bands.

DNA Purification, Cloning and Transformation

The 400 bp PCR product from the agarose gel was excised using a sterilized razor

blade, and purified by using Qiagen Gel Purification kit (Qiagen, Valencia, CA)

according to the manufacturer's protocol. Final elution was made in 50 pl of the elution










buffer. The gel purified PCR products were then ligated into pCR-2.1 TOPO plasmid

vector using the 5 min ligation protocol according to the manufacturer (Invitrogen,

Carlsbad, CA). Briefly, two pl of the gel purified PCR product was mixed with 1 pl of

the salt solution (200 mM NaCl + 10 mM MgCl2), 1 pl1 of the TOPO vector and 2 pl of

sterile water. The ligation reaction was performed at the room temperature for 5 min and

then the ligation reaction mixture was transferred to ice.

Two pl of the ligation reaction mixture was then added to the 50 pl of the DH-5a

E. coli competent cells, which were then incubated on ice for 30 min. The cells were

heat-shocked at 420 C for 30 sec, transferred to ice and 600 [il of Luria-Bertani (LB)

media was added to the mixture. The cells were grown at 37 'C and 200 rpm for 1 h and

about 50-100 pl cells were plated on LB agar plates containing 50 [g/ml of kanamycin

and 80 ng/ml of X-gal. and grown overnight at 37 'C. A master plate with putative

recombinant white colonies was prepared by subculture on a fresh LB agar plate

supplemented with kanamycin.

Colony PCR and Heteroduplex Mobility Assay (HMA)

The bacterial colonies were screened by colony PCR by extraction of

individual colonies in an extraction buffer (1 % Triton X, 20mM Tris HC1, pH 8.0

and 2mM EDTA, pH 8.0). The extracts were heated at 95 oC for 10 min. Five [l of

the extract was used for PCR in a 50 pl reaction volume, using 200 nM each of CN

488 and CN 491 primers and 5 U of Taq DNA polymerase (Promega) according to

the manufacturer. PCR amplification parameters were 940 C for 2 minutes; 30 cycles

of 94' C for 30 seconds, 62' C for 45 seconds, 72' C for 45 seconds; followed by

incubation at 720 C for 10 minutes. The PCR products were analyzed









electrophoretically using 1% agarose gels and visualized on a Biorad Gel-Doc

imaging system.

About 25-50 clones from each of the three source isolates (M2A, CL and T68) and

each of the graft and aphid transmitted sub-isolates were analyzed by HMA. For each

isolate and subisolate, one of the amplified clones was selected for use as the reference

clone and the rest of the clones (test clones) were screened against the reference clone.

For the formation of heteroduplexes, 4.5 [l of the colony PCR product from the reference

clone was mixed with the 4.5 [l of the test clone and 1 [l of 10X annealing buffer (1.0 M

NaC1, 100 mM Tris-HCl pH 7.8 and 20 mM EDTA). The DNA mixture was denatured at

95 C for 10 min, then slowly annealed at 68 C for 1 h and then held at 0 C for 10 min.

The mixture was then electrophoresced on 10 % CriterionTM precast polyacrylamide gel

(Biorad) in Tris-borate EDTA (TBE) buffer (0.088 M tris-borate, 0.089 M boric acid,

0.002 M EDTA) at 140 volts for 3 h at 40 C in a CriterionTM cell (Biorad). The gel was

then stained in IX TBE buffer containing 200 ng/ml of ethidium bromide. A Biorad Gel-

Doc imaging system was used for visualization of DNA heteroduplex bands. All the

clones that showed heteroduplex formation with the selected reference clone during the

first screening were selected for the second HMA screening by using one of these clones

as a new reference clone. Thus the total number of clones from each isolate and

subisolate were narrowed down to 2-4 different groups genotypess), based on the

nucleotide sequence differences, after 2-3 HMA screenings.

The different genotypes identified after HMA (Table 3.8) from the source isolates

are designated by the suffix SO, whereas the genotypes obtained from the graft/aphid

transmitted subisolates were designated by the suffix G/A, followed by the host species










such as GF (1), ML (2) and SO (3). This is followed by the name of the genotype (A, B,

C and D) at the end, where genotype A refers to the most abundant genotype and

genotype D refers to the least of the genotypes analyzed. For example, the most abundant

genotype obtained from the T68 graft transmitted subisolate on sweet orange [T68-G

(SW)] will be designated as T68G3A and the most abundant genotype from the CL

source isolate will be designated as CLSOA.

Sequencing and Sequence Analysis

About 2-3 clones from each genotype obtained during HMA from each isolate and

subisolates were sequenced by the dideoxynucleotide chain termination method using the

M13 forward primer following standard protocol at the DNA Sequencing Core

Laboratory at University of Florida, Gainesville, Fl (Sambrook et al., 1989). A single

representative clone from each genotype was selected for the further analysis. Sequence

analysis was done by using CLUSTAL X (Thompson et al., 1997) and Genedoc version

2.6.002 programs (Nicholas and Nicholas, 1997). The phylogenetic relationship of the

sequences of the region amplified by primer pair CN 488 and CN 491 from the CL, M2A

and T68 isolates with some of the exotic and Florida CTV isolates (Roy and Brlansky,

2004) were determined using program CLUSTAL X and the dendograms were visualized

using the program TreeView version 1.6.6.

Results

The cloned DNA fragments from three Florida CTV source isolates: CL, M2A and

T68 and their graft transmitted subisolates were analyzed by HMA for understanding the

population diversity of CTV in these plants. The heteroduplex (HD) bands representing

the presence of the divergent viral RNA populations genotypess) within a given isolate or

subisolate were observed in most cases (Figure 3.1-3.4). The clones representing different









genotypes were sequenced and the nucleotide sequence was compared for homology with

the other related CTV isolates from different citrus growing regions.

Isolate: CL

The result of the nucleotide sequence comparison of the genotypes obtained after

HMA for the source isolate CL and graft transmitted subisolates [CL-G (GF), CL-G

(ML) and CL-G (SW)] are shown in Table 3.1 and the summary of results is presented in

Table 3.5. Based on HMA of 25 clones, the CL source isolate was found to contain at

least three different genotypes designated CLSOA (47 % of the clones), CLSOB (39 % of

the clones) and CLSOC (18 % of the clones) (Table 3.5). Sequences of representative

clones from each genotype showed that the sequences differed from one another by 9-

16% (Table 3.1). The % number of clones, out of the total number of clones screened, for

each isolate or subisolate will be used in parentheses along with the name of the genotype

throughout this chapter.

When the cloned DNA fragments from CL source isolate and the graft transmitted

subisolates [CL-G (GF), CL-G (ML) and CL-G (SW)] were analyzed, heteroduplexes

were observed in all of them [Figure 3.1 (A-C)]. As expected, heteroduplex formation

was present in positive control [Lane 1, Figure 3.1 (A-D)] where PCR products from two

clones with known sequence diversity were used, but not in lane Cl (Figure 3.1) which

contained PCR product from the reference clone alone.

CL source isolate is a mixture of three genotypes [Figure 3.1 (A)]. The genotypes

from the isolate CL [CLSOA (47 %), CLSOB (39 %), and CLSOC(18 %)], subisolate CL-

G(GF) [CLG1A (48 %), CLG1B (32 %) and CLG1C(20 %)], subisolate CL-G(ML)

[CLG2A (56 %), CLG2B (36 %) and CLG2C (8 %)] and subisolate CL-G(SW) [CLG3A

(52 %), CLG3B (30 %) and CLG3C (18 %)] were obtained (Table 3.5).









The genotypes CLSOA CLSOB, CLSOB CLSOC and CLSOA CLSOC share

84%, 91% and 92% sequence homology, respectively. The CLSOA genotype is similar

(98% sequence homology) to the Indian CTV isolates B225 and B219. It also showed

94% and 96% sequence homology with VT and SY 568 CTV isolates, respectively.

According to the phylogenetic tree analysis, CLSOA genotype was included in the

genotype specific group (group) VI along with the B225 and B219 CTV isolates (Figure

3.5). The sequence homology of CLSOA genotype with the other CTV Florida isolates

such as T36, T30 and T3 was 81%, 90% and 92%, respectively.

The CLSOB genotype showed a sequence homology of 95% with the BAN-2 CTV

isolate from India. It also has sequence homology of 92% with the T36 CTV isolate from

Florida. Genotype CLSOB was thus placed in group lb along with BAN-2 isolate and

was not included in group la in the phylogenetic tree with T36 and QAHA CTV isolates

(Figure 3.5). However as compared with the other two Florida isolates, T30 and T3, it

showed only 84% and 83% sequence homology. The third genotype, CLSOC showed

only 92% and 91% nucleotide sequence homology with the B225 and B219 Indian CTV

isolates and is 91% similar to the SY568 CTV isolate from California. CLSOC was

placed in a separate group IIa. It showed only 86-87% similarity with the other Florida

CTV isolates.

CL-G (GF), CL-G (ML) and CL-G (SW) subisolates also were mixture of

genotypes [Figure 3.1 (B-D)]. Three different genotypes were obtained from CL-G (GF),

CL-G (ML) and CL-G (SW) subisolates. The CLG1A, CLG2A and CLG3A genotypes

showed high sequence homology of 98% with the Indian CTV isolates B225 and B219

and 94% and 96% sequence homology with VT and SY 568 CTV isolates, respectively.









Thus the CLG1A, CLG2A and CLG3A genotypes were placed in group VI in the

phylogenetic tree along with the B219, B225 CTV isolates from India (Figure 3.5)

However, it showed low sequence homology of 81%, 90% and 92% with the other CTV

Florida isolates such as T36, T30 and T3, respectively.

The CLG1B, CLG2B and CLGG3B genotypes showed high sequence homology

(94-95%) with the BAN-2 CTV isolate from India and is 92% similar with the T36 CTV

isolate from Florida. Due to the highest homology with BAN-2 CTV isolate CLG1B,

CLG2B and CLG3B genotypes were included in the group I along with BAN-2 and T2K

CTV isolates (Figure 3.5). However as compared with the other two Florida isolates (T30

and T3), CLG1B, CLG2B and CLG2B genotypes showed only 81% 84% sequence

homology.

The CLG1C genotype is most similar to B165 isolate from India and Nartia isolate

from South Africa with 94% and 93% nucleotide sequence homology, whereas the

CLG2C and CLG3C genotypes are similar to B225 and B219 isolates from India (93% &

92% homology) and only shares 82% to 84% homology with the B165 and Nartia

isolates. Due to the low homology with any of the isolate, CLG2C and CLG3C genotypes

were grouped in separate group IIa, whereas CLG1C genotype was included in the group

lib (Figure 3.5).

Isolate: M2A

The result of the nucleotide sequence comparison of the genotypes obtained after

HMA for the source isolate M2A and graft transmitted subisolates [M2A-G (GF), M2A-

G (ML) and M2A-G (SW)] are shown in Table 3.2 and the summary of results is

presented in Table 3.6. When the cloned DNA fragments from M2A source isolate and

the graft transmitted subisolates [M2A-G (GF), M2A-G (ML) and M2A-G (SW)] were









analyzed, heteroduplexes were observed in all of them [Figure 3.2 (A-D)] indicating the

presence of mixture of genotypes. As expected, heteroduplex formation was present in

positive control [Lane C, Figure 3.2 (A-D)] where PCR products from two clones with

known sequence diversity were used, but not in lane Ml (Figure 3.2) which contained

PCR product from the reference clone alone. [Lane Ml, Figure 3.2 (A-D)].

M2A isolate is a mixture of three genotypes [Figure 3.2 (A-D)]. The genotypes

from the isolate M2A [M2ASOA (84 %), M2ASOB (8 %), and M2ASOC (8 %)],

subisolate M2A-G(GF) [M2AG1A (82 %), M2AG1B (10 %) and M2AG1C (8 %)],

subisolate M2A-G(ML) [M2AG2A (85 %), M2AG2B (10 %) and M2AG2C (5 %)] and

one genotype from subisolate M2A-G(SW) [M2AG3A (100 %)] were obtained (Table

3.6).

The genotypes M2ASOA M2ASOB, M2ASOB M2ASOC and M2ASOA -

M2ASOC share 84%, 82% and 84% sequence homology, respectively. The M2ASOA

genotype showed highest sequence homology of 98% and 99% with the Indian CTV

isolates B225 and B219, respectively. It also showed 97% and 95% sequence homology

with VT and SY 568 CTV isolates, respectively. According to the phylogenetic tree

analysis, M2ASOA genotype was included in the genotype specific group VI (group)

along with the B225 and B219 CTV isolates. The sequence homology of M2ASOA

genotype with the other CTV Florida isolates such as T36, T30 and T3 was 81%, 92%

and 90%, respectively and these were included in separate groups (Figure 3.6, groups la,

III and IV).

The M2ASOB genotype showed sequence homology of 94% with the BAN-2 CTV

isolate and also showed 92% nt homology with the T36 CTV isolate from Florida.









Genotype M2ASOB was thus placed in group lb along with BAN-2 isolate and was not

included in group la in the phylogenetic tree with T36 and QAHA CTV isolates.

However the other two Florida isolates, T30 and T3 showed only 84% and 83% sequence

homology and were placed in separate groups (Figure 3.6). The third genotype, M2ASOC

is similar to the T38K isolate showing 99% similarity (group II) and is completely

different from the other Florida CTV isolates (only 80-84% similarity; Figure 3.6, groups

la, III and IV).

The M2A-G(GF), M2A-G(ML) and M2A-G(SW) subisolates also showed mixture

of genotypes [Figure 3.2 (B-D)]. The M2AG1A, M2AG2A and M2AG3A genotypes

showed high sequence homology of 98 99% with the Indian CTV isolates B225 and

B219 and 95% 97% sequence homology with VT and SY 568 CTV isolates,

respectively. However, it showed low sequence homology of 81%, 92% and 90% with

the other CTV Florida isolates such as T36, T30 and T3, respectively. Thus the

M2AG1A, M2AG2A and M2AG3A genotypes were placed in group VI in the

phylogenetic tree along with the B219, B225 CTV isolates from India (Figure 3.6). The

M2AG2B genotype showed sequence homology of 96% with the T36 CTV isolate from

Florida and sequence homology 92% with the BAN-2 CTV isolate from India. Because

of its high nt sequence homology with the T36 CTV isolate than the B165 isolate,

M2AG2B genotype was placed in sub group Ia along with the T36 and QAHA isolates,

whereas BAN-2 isolate was placed in the sub group Ib (Figure 3.6). However it showed

low nt sequence homology (only 82% 84%) with T30 and T3 Florida CTV isolates

(Figure 3.6, groups III and IV). The M2AG1B genotype showed sequence homology of

93% with the BAN-2 CTV isolate and also showed 92% nt homology with the T36 CTV









isolate from Florida. Genotype M2AG1B was thus placed in group lb along with BAN-2

isolate and was not included in group la in the phylogenetic tree with T36 and QAHA

CTV isolates (Figure 3.6). The genotype M2AG2C from is similar to T38K isolate with

99% nucleotide sequence homology (Figure 3.6, group II).

Isolate: T68

The result of the nucleotide sequence comparison of the genotypes obtained after

HMA for the source isolate T68 and the graft and aphid transmitted subisolates are

presented in the Table 3.3 and Table 3.4. The summary of the results is shown in Table

3.7. When the cloned DNA fragments from T68 source isolate and the graft transmitted

subisolates [T68-G (GF), T68-G (ML) and T68-G (SW)] were analyzed, heteroduplexes

were observed in all of them [Figure 3.3 (A-D]. Different HD banding patterns were also

observed when the aphid transmitted subisolates [T68-A (GF), T68-A (ML) and T68-A

(SW)] were analyzed by using HMA [Figure 3.4 (A-C)]. As expected, heteroduplex

formation was present in positive control (Lane C, Figure 3.3 and 3.4) where PCR

products from two clones with known sequence diversity were used, but not in lane T1

and Tal which contained PCR product from the reference clone alone. (Lane T1, Figure

3.3and Lane Tal, Figure 3.4).

Two genotypes from the isolate T68 [T68SOA (68 %) and T68SOB (32 %)],

subisolate T68-G (GF) [T68G1A (80 %) and T68G1B (20 %)], subisolate T68-G (ML)

[T68G2A (68 %) and T68G2B (32 %)] subisolate T68-G (SW) [T68G3A (76 %) and

T68G3B (24 %)], four genotypes from subisolate T68-A (GF) [T68A1A (64 %), T68A1B

(20 %), T68A1C (8 %) and T68A1D (8 %)], three genotypes from subisolate T68-A

(SW) [T68A3A (92 %), T68A3B (4 %) and T68A3C (4 %)] were obtained (Table 3.7).









T68 source isolate is a mixture of more than one genotype (Figure 3.3 and 3.4) as

different HD bands were observed in HMA. Genotype T68SOA and genotype T68SOB

shared only 85% sequence homology. The T68SOA genotype is similar to B165 CTV

isolate with 99% nucleotide sequence homology and was placed in the group II along

with the Nartia mild isolate and B165 CTV isolate (Figure 3.7). However it showed very

low sequence homology of 80% 86% with the other Florida CTV isolates (T36, T30 and

T3, respectively), which were placed in separate groups (Figure 3.7, group I, III and IV).

The T68SOB genotype showed sequence homology of 93% with the T30 CTV

isolate from Florida; however it also showed sequence homology of 92% with the B225

CTV isolate from India and SY568 CTV isolate from California. It showed only 80% and

89% sequence homology with the T36 and T3 CTV isolates from Florida. Because of the

intermediate homology with T30 and SY568/VT isolates and low homology with the T36

and T3, it was placed in separate group VI which is in between group III (T30) and group

V (SY568 and VT).

The T68-G(GF), T68-G(ML) and T68-G(SW) subisolates also showed mixture of

two different genotypes [Figure 3.3 (B-D)]. The genotypes T68G1A, T68G2A and

T68G3A showed high sequence homology ranging from 96% to 99% with the Indian

CTV isolates B165 and were placed in the group II along with the B165 and Nartia

isolate of CTV (Figure 3.7). However, it showed low sequence homology of (80% 86%

) with the other CTV Florida isolates such as T36, T30 and T3, which belonged to

separate group in the phylogenetic tree (Figure 3.7, groups I, III and IV). The T68G1B,

T68G2B and T68G3B genotypes were 92% similar with the B225 CTV isolate from

India and SY568 isolate from California and 93% nucleotide sequence homology with









the T30 Florida CTV isolate and showed low sequence homology (80% 89%) with T36

and T3 isolates. These genotypes were placed in group VI along with the T68SOB

genotype from the T68 source isolate.

Aphid transmitted subisolates [T68-A (GF) and T68-A (SW)] were also analyzed

for the detection and characterization of population diversity, by using HMA. The HD

banding patterns for the aphid transmitted subisolates were strikingly different from the

T68 isolate and the graft transmitted subisolates (Figure 3.4). The T68A1A, T68A1B,

T68A1C and T68A1D share only 82 93% sequence homology among them. T68A3A,

T68A3B and T68A3C genotypes shared 85% 90% nt sequence homology among them.

The T68A1A and T68A3A genotypes are very similar to the B165 Indian isolate

(98 99% homology) and are more distantly related to the T36, T30 and T3 Florida CTV

isolates (80 86% homology). In the phylogenetic tree T68A1A and T68A3A genotypes

were included separately in the group II along with the T68SOA, B165 and Nartia CTV

isolates. T68A1B genotype is more closely related to the B225, T30 and SY568 isolates

with 92 93% nucleotide sequence homology (Figure 3.8). Two new genotypes:

T68A1C (97% homology with T2K CTV isolate) and T68A1D (99% homology with T30

CTV isolate) were detected only after aphid transmissions and are placed in the group I

(along with T36 isolate) and group III (along with T30 CTV isolate), respectively (Figure

3.8). T68A1C and T68A1D were neither detected from the T68 source isolate nor from

the graft transmitted subisolates. T68A3B genotype is similar to the B225 Indian CTV

isolate with 99% sequence homology and also showed 96% and 94% nt sequence

similarity with the SY568 and VT CTV isolates. Thus it was included in the group VI

with B225.1 and B219 Indian CTV isolates. T68A3C genotype however is a relatively






56


new genotype with less than 90% sequence homology with the other known CTV

isolates.













Table 3.1. The comparison of nucleotide sequence identities of the different genotypes from the CL isolate, CL-G(GF) and CL-G(ML)
subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV genome, with the
already sequenced CTV isolates and some of the other isolates(-) as described earlier (Roy and Brlansky, 2004) and
retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) and Genedoc version
2.6.002 programs (Nicholas and Nicholas, 1997).




CLASOA 84 92 84 99 88 99 83 93 98 84 91 98 98 86 82 81 92 90 96 94 85 84
CLASOB 91 99 84 82 84 98 90 83 99 92 85 84 82 95 92 84 82 85 83 81 98
CLASOC 91 92 85 92 90 98 92 91 99 92 91 84 88 86 87 86 91 89 82 90
CLG1B 84 82 84 98 90 99 84 92 84 84 82 95 92 84 82 84 83 81 98
CLG1A 89 99 84 93 84 99 91 98 98 86 82 81 92 89 97 94 85 84
CLG1C 89 81 85 88 81 84 88 87 94 80 80 87 85 87 85 93 82
CLG2A 83 93 99 82 92 99 98 86 82 81 92 89 97 94 85 83
CLG2B 89 83 98 90 83 83 81 94 92 83 81 84 82 80 97
CLG2C 92 90 98 93 92 84 87 86 87 87 92 90 82 89
CLG3A 84 91 98 99 86 82 80 91 90 96 92 84 84
CLG3B 92 84 85 82 95 93 82 83 84 85 81 98
CLG3C 91 92 84 88 87 86 85 90 87 82 91
B225.1* 98 86 82 81 92 90 97 95 85 84
B219* 85 81 80 92 89 97 95 84 83
B165* 80 80 86 83 85 83 97 83
BAN-2. 90 82 80 82 80 81 95
T36f 82 81 82 80 79 92
T30f 89 92 90 84 83
T3-2* 90 87 82 82
SY568t 95 84 84
VTf _82 82

These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL.
t The nucleotide sequences were retrieved from Genbank database [Accession number U16304 (T36), AF260651 (T30),
AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).













Table 3.2. The comparison of nucleotide sequence identities of the different genotypes from the M2A isolate, M2A-G(ML) and M2A-
G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV genome,
with the already sequenced CTV isolates and some of the other isolates(-) as described earlier (Roy and Brlansky, 2004)
and retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) and Genedoc
version 2.6.002 programs (Nicholas and Nicholas, 1997).




M2ASOA 84 84 99 85 83 98 84 83 99 99 98 85 82 92 90 84 97 95 81 85 79
M2ASOB 82 85 99 83 84 94 82 85 85 84 83 94 84 83 82 85 83 92 81 90
M2ASOC 84 83 98 83 82 99 84 84 83 90 81 84 84 99 83 81 80 89 79
M2AG1A 85 84 99 83 83 99 98 97 86 80 90 90 84 96 94 81 84 78
M2AG1B 82 84 93 83 99 86 84 84 93 83 83 82 85 84 92 81 91
M2AG1C 85 82 89 86 85 82 91 82 84 84 99 82 81 80 87 79
M2AG2A 83 83 99 99 98 85 82 92 91 84 97 95 81 84 79
M2AG2B 82 84 83 83 82 92 84 83 82 85 82 96 81 94
M2AG2C 84 83 83 89 80 83 84 99 83 81 80 89 78
M2AG3A 99 99 86 82 92 91 84 97 95 81 85 79
B225.1* 98 86 82 92 91 84 97 95 81 85 79
B219m 85 81 92 90 83 97 95 80 84 78
B165m 80 86 84 89 85 83 80 97 78
BAN-2C 82 81 80 82 80 89 81 88
T30t 90 84 92 90 81 84 80
T3C5* 84 90 88 81 82 79
T38K* 83 82 80 89 78
SY568t 95 82 84 80
VTt 80 82 78
T36t 79 98
Narita-248* 77

These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL.
f The nucleotide sequences were retrieved from Genbank database [Accession number U16304 (T36), AF260651 (T30),
AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).













Table 3.3. The comparison of nucleotide sequence identities of the different genotypes from the T68 isolate, T68-G(GF), T68-G(ML)
and T68-G(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome, with the already sequenced CTV isolates and some of the other isolates(-) as described earlier (Roy and Brlansky,
2004) and retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) and
Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997).


Q Qo QO o C 00 kn


T68SOB 87 98 85 98 85 99 92 85 80 93 89 82 82 92 89 78 84
T68G1A 87 96 87 96 87 86 96 79 86 83 87 81 85 83 77 94
T68G1B 85 98 85 98 93 85 80 93 90 83 82 92 90 78 84
T68G2A 85 99 85 85 98 80 85 83 89 82 85 83 78 97
T68G2B 86 98 92 85 81 93 90 83 83 91 89 79 84
T68G3A 85 85 99 80 85 83 89 83 85 83 78 97
T68G3B 92 85 81 93 90 83 83 91 89 79 84
B225.1 86 81 92 91 84 84 97 95 79 85
B165m 80 86 84 89 83 85 83 78 97
T36t 82 82 80 92 82 80 98 79
T30t 90 84 83 92 90 80 84
T3C5* 84 82 90 88 80 82
T38K* 83 83 82 79 89
T2K* 84 82 90 81
SY568t 95 80 84
VTt 78 82
QAHAt 77
These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath, CREC, Lake Afred, FL.
f The nucleotide sequences were retrieved from Genbank database [Accession number U16304 (T36), AF260651 (T30),
AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).













Table 3.4. The comparison of nucleotide sequence identities of the different genotypes from the T68 isolate, T68-A(GF), T68-A(ML)
and T68-A(SW) subisolates, obtained after heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome, with the already sequenced CTV isolates and some of the other isolates(-) as described earlier (Roy and Brlansky,
2004) and retrieved from Genbank. Sequence analysis was done by using CLUSTAL X (Thompson et al., 1997) and
Genedoc version 2.6.002 programs (Nicholas and Nicholas, 1997).


00 00 00 00 00 00 00 00 C g0 0o 0

T68SOA 85 99 86 82 86 99 85 90 99 86 80 86 84 89 82 86 83 78 97
T68SOB 85 97 82 92 86 92 93 85 92 80 93 89 82 82 92 89 78 84
T68A1A 85 82 85 98 84 90 99 85 80 86 83 89 82 86 83 78 97
T68A1B 82 93 85 91 94 85 92 80 93 90 83 82 92 89 79 84
T68A1C 83 82 84 84 82 84 91 84 82 82 97 84 83 89 81
T68A1D 85 91 89 86 92 82 99 89 84 83 91 89 80 84
T68A3A 85 90 98 86 80 86 84 89 82 85 83 78 97
T68A3B 90 85 99 81 91 90 84 83 96 94 79 84
T68A3C 90 90 82 90 88 86 84 90 88 80 89
B165m 86 80 86 84 89 83 85 83 78 97
B225.1. 81 92 91 84 84 97 95 79 85
T36f 82 82 80 92 82 80 98 79
T30t 90 84 83 92 90 80 84
T3C5* 84 82 90 88 80 82
T38K* 83 83 82 79 89
T2K* 84 82 90 81
SY568t 95 80 84
VTt 78 82
QAHAt 77
These nucleotide sequences were kindly provided by Dr. Avijit Roy and Dr. K. L. Manjunath,CREC, Lake Afred, FL.
f The nucleotide sequences were retrieved from Genbank database [Accession number U16304 (T36), AF260651 (T30),
AF001623 (SY568), U569902 (VT) and AY340974 (QAHA).













Co ,- oa c r "n 'O '- M L o c' I n-ri
Cuuuuuuuuuuuu uOO\ 'lUUUU uu






Mo .- oa en Cr n ro r- cc o- CQ Q rie Cr







M c'i en 'r to r- co4D O- M C (q Cfl V



Co M U UU U -J ccU- -C e


Figure 3.1: Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of
CTV isolate CL and CL-G(GF), CL-G(ML) and CL-G(SW) subisolates. Each
lane represents the HD formed between the reference clone and each of the
test clones. Lane C represents the positive control. Fig. A, B, C and D shows
the formation of HD from the CL source isolate, CL-G(GF), CL-G(ML) and
CL-G(SW) subisolates, respectively. For each figure (A, B, C and D)
separately; Lane Cl shows the Clone # 1(C1) was used as a reference clone
and shows the homoduplex band. Lane C2-C24 represents the clones used as
test clones (C2-C24) showing either homoduplex or heteroduplex formations.














M~ ~ ~ -T oan D 0fl ". N en OXIC I C. oD en S-Ti







o -Zj C'] enD M k0 o n C C' C" en
C' ] L0 r_ 0 M-- 3 0' =1 C] Mn -:I V,






o C" en 4D kh '. r- O cO cl C\-3







^ en i n N en c C~ '-' ^ '- l -' ' C' ]^ C^] c
c r^ S ^ ^





O m- CM (^T| 4^ ^o r~ ood o -r]'iq
r\] # ~ ~ ~ ~ ~~ # m^y o[^ol'1 '1-' -IMTM(\ ~' ~]"

cg^^g^^^^^S^^aa^~


Figure 3.2: Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of
CTV source isolate M2A, M2A-G(GF), M2A-G(ML) and M2A-G(SW)
subisolates. Each lane represents the HD or homoduplex (HmD) formed
between the reference clone and each of the test clones. Lane C represents the
positive control. Fig. A, B C and D shows the formation of HD from the M2A
source isolate, M2A-G(GF), M2A-G(ML) and M2A-G(SW) subisolates,
respectively. For each figure (A, B, C and D) separately; Lane Ml shows the
Clone # 1(M1) was used as a reference clone and shows the HmD band. Lane
M2-M24 represents the clones used as test clones (M2-M25) showing either
homoduplex or heteroduplex formations.













iN fln 0 r r- M o. o "a M 3
M l ----- iN (] (~] M0 CC]
C EiE-i E-i E-' E-A E-i E-i E-' Eli E-i P- E-1 Eli Eli P- Eli P- P E-' E-' E-' E-i E-4 E-'
CH HH HH HHHH HH HHHHH I



o i en r) tz (-- oN o% m~ C3 Ln
C\- 3 m Tr- rCc D r- o 2- C\3 C\3






C c'i e r u ic N oc c0 .- ni R N iN C'3 0 "03
C E i F-Ei Fi Fi E-q H- E-q E-q H- H- H-E- P E-i HE-iE- FEiE E-i I- E-i i iEi


N C\Msn V rn w 0N a% CD O en(
,-- rsri-i'-m ^o oo oi '- (o o r~ ^r '






-\ rM Cr'n v qri(-1 0 c CO '- ~C\ (CN N i C' '
CE-i E-i HH F, F, F i F, El F' F'E-i H-E-i HE-i E-H H- 4 E-,HHH E-H EH HH


Figure 3.3: Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of
CTV isolate T68 and T68-G(GF), T68-G(ML) and T68-G(SW) subisolates.
Each lane represents the HD or homoduplex (HmD) formed between the
reference clone and each of the test clones. Lane C represents the positive
control. Fig. A, B, C and D shows the formation of HD from the T68 source
isolate, T68-G(GF) and T68-G(ML) subisolates, respectively. For each figure
(A, B, C and D) separately; Lane TI shows the Clone # 1(T1) was used as a
reference clone and shows the HmD band. Lane T2-T24 represents the clones
used as test clones (T2-T25) showing either HmD or HD formations.












enN DO C <1 (N en Vr kO r- ON O C\ 0 CM en 4







(N en ) Wi k N 00 a en q C N m 1 0 CQl C
'M]^ im ^ o o<7 oz^ ^- elT ez el-~is elM d dd eid(d ( M M M M ed


,-l C'] r(o 1 oo No Ci








C- M] ;1- 41) k^o 0 0 % 2 -4 M- TL 2 T- 1- ,- Cqq ^] C~l ^]C' CM
SiM (1 (d d el Q1 M a d (d K i B a d aM (d e l
C -iE- EiE- Ei Ei BiE- Ei H -iE- Ei^- Ei H ^- EiE- Ei -

----MM1~~~~~~d~~


Figure 3.4: Ethidium-bromide stained 10% polyacrylamide gels showing the retarded
mobility of heteroduplexes (HD) formed due to the nucleotide sequence
differences in the RT-PCR amplified cloned 403 bp region of ORF la, of
CTV isolate T68 and T68-A(GF) and T68-A(SW) subisolates. Each lane
represents the HD or homoduplex (HmD) formed between the reference clone
and each of the test clones. Lane C represents the positive control. Fig. A, B
and C shows the formation of HD from the T68 source isolate, T68-A(GF)
and T68-A(SW) subisolates, respectively. For each figure (A, B and C)
separately; Lane Tal shows the Clone # 1(Tal) was used as a reference clone
and shows the HmD band. Lane Ta2- Ta24 represents the clones used as test
clones (Ta2- Ta25) showing either HmD or HD formations.




























SCLG3B Group I
CLG1B
T36
CLSOC QAHA
CLG3C Group II a
CLG2C
T38K
CLG1C
SGroup IIb
Narita-248
B165

T3C5T3-2 Group IV

T385 Group III
CTV-P '
B224
167 Group V
B194
SY568
VT


0.1



Figure 3.5: Phylogenetic tree showing genetic relationships of the genotypes of CL CTV
isolate, CL-G(GF) and CL-G(ML) subisolates obtained after heteroduplex
analysis (HMA) of the 403 bp amplicon from ORF la of CTV genome, with
the already sequenced CTV isolates and some of the other isolates as
described earlier (Roy and Brlansky, 2004). Sequence analysis was done by
using CLUSTAL X (Thompson et al., 1997) the phylogenetic relationship of
the sequences were generated using the program TreeView version 1.6.6.


















M2AG2B
-6 Group I a
T Q A6 H A

S M2ASOB Group Ib
V L2AG1B
---T2K
T38K
-M2AG2C
]ASOC Group II
I'2AGIC
Narita-248
B165 ,
ST3C5
--T3_2 Group IV
T3-2
rT30
T30 Group III
T385
CTV-P
B224
B167
167 Group V
B194
SY568
VT
M2AG3A V
1I2ASOA
II2AG1A Group VI
B219
0.1



Figure 3.6: Phylogenetic tree showing genetic relationships of the genotypes of M2A
CTV isolate, M2A-G(ML) and M2A-G(SW) subisolates obtained after
heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome, with the already sequenced CTV isolates and some of the other
isolates as described earlier (Roy and Brlansky, 2004). Sequence analysis was
done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic
relationship of the sequences were generated using the program TreeView
version 1.6.6.



















Group II
B165
T68SOA
T68G2A
T68G3A S
IT136

2K I QAHA jGroup I
T2K
BAN-2
LT3C5 1
T3-2 Group IV
T68G1B
T68G2B
TMB Group IMb
T68SOB
T68G3B
T130
T385 Group IIIa
SB219
B225.1


SY568


B224
B167
B194

0.1




Figure 3.7: Phylogenetic tree showing genetic relationships of the genotypes of T68 CTV
isolate, T68-G(ML), T68-G(ML) and T68-G(SW) subisolates obtained after
heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome, with the already sequenced CTV isolates and some of the other
isolates as described earlier (Roy and Brlansky, 2004). Sequence analysis was
done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic
relationship of the sequences were generated using the program TreeView
version 1.6.6.


ylogenetic
relationship of the sequences were generated using the program TreeView
version 1.6.6.













CTV-P
-- CTV-B


T38K
Narita-248
T68A3A Group II
T68SOA
T68A1A
B165
BAN-2
T68A1C
T2K
136
--QAHA
T68A3B *
- T68SOB Group IIIa
T68A1B
7T385
T68A1D Group IIIb
T130
T3C5
T3-2 J Group IV



V Group V

-BAN-1


Group I


- B167
B194


Figure 3.8: Phylogenetic tree showing genetic relationships of the genotypes of T68 CTV
isolate, T68-A(ML), T68-A(ML) and T68-A(SW) subisolates obtained after
heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome, with the already sequenced CTV isolates and some of the other
isolates as described earlier (Roy and Brlansky, 2004). Sequence analysis was
done by using CLUSTAL X (Thompson et al., 1997) the phylogenetic
relationship of the sequences were generated using the program TreeView
version 1.6.6.









Table 3.5.


The summary of the different genotypes from the CL isolate, CL-G(GF), CL-
G(ML) and CL-G(SW) subisolates, obtained after heteroduplex analysis
(HMA) of the 403 bp amplicon from ORF la of CTV genome The value
(%)t in the parentheses represents the %age number of clones belonging to
genotype A/B/C, out of the total number of clones screened from an isolate or
subisolate.


ISOLATE/ NUMBER OF GENOTYPES CLOSELY
SUBISOLATE GENOTYPES DETECETD / RELATED
DETECTED (%)f GENOTYPES
CL 3 CLSOA (47)t VT, B225
CLSOB (35) T2K, BAN-2
CLSOC (18) NEW
CL-G(GF) 3 CLG1A (48) VT, B225
CLG1B (32) T2K, BAN-2
CLG1C (20) NEW
CL-G(ML) 3 CLG2A (56) VT, B225
CLG2B (36) T2K, BAN-2
CLG2C (8) NEW
CL-G(SW) 3 CLG3A (52) VT, B225
CLG3B (30) T2K, BAN-2
CLG3C (18) NEW


Table 3.6.


The summary of the different genotypes from the M2A isolate, M2A-G(GF),
M2A-G(ML) and M2A-G(SW) subisolates, obtained after heteroduplex
analysis (HMA) of the 403 bp amplicon from ORF la of CTV genome The
value (%)f in the parentheses represents the %age number of clones
belonging to genotype A/B/C, out of the total number of clones screened from
an isolate or subisolate.


ISOLATE/ NUMBER OF NAME OF THE CLOSELY
SUBISOLATE GENOTYPES GENOTYPE/ RELATED
DETECTED (%) GENOTYPES
M2A 3 M2ASOA (84) VT, B225
M2ASOB (8) BAN-2
M2ASOC (8) T38K
M2A-G(GF) 3 M2AG1A (82) VT, B225
M2AG1B (10) T2K, BAN-2
M2AG1C (8) T38K
M2A-G(ML) 3 M2AG2A (85) VT, B225
M2AG2B (10) T36
M2AG2C (5) T38K
M2A-G(SW) 1 M2AG3A (100) VT, B225











Table 3.7.


The summary of the different genotypes from the T68 isolate, graft transmitted
subisolates [T68-G(GF), T68-G(ML) and T68-G(SW)] and aphid transmitted
subisolates [T68-A(GF) and T68-A(SW)], obtained after heteroduplex
analysis (HMA) of the 403 bp amplicon from ORF la of CTV genome The
value (%)t in the parentheses represents the %age number of clones
belonging to genotype A/B/C, out of the total number of clones screened from
an isolate or subhisolate


ISOLATE/ NUMBER OF NAME OF THE CLOSELY
SUBISOLATE GENOTYPES GENOTYPE/ RELATED
DETECTED (%) GENOTYPES
T68 2 T68SOA (68) B165
T68SOB (32) NEW
T68-G(GF) 2 T68G1A (80) B165
T68G1B (20) NEW
T68-G(ML) 2 T68G2A (68) B165
T68G2B (32) NEW
T68-G(SW) 2 T68G3A (76) B165
T68G3B (24) NEW
T68-A(GF) 4 T68A1A (64) B165
T68A1B (20) NEW
T68A1C (8) T2K
T68A1D (8) T30, T385
T68-A(SW) 3 T68A3A (92) B165
T68A3B (4) SY568
T68A3C (4) NEW









Table 3.8. The description of different genotypes from the CL, M2A and T68 source
isolates and the graft / aphid transmitted subisolates, obtained after
heteroduplex analysis (HMA) of the 403 bp amplicon from ORF la of CTV
genome
Genotype Description
CLASOA Genotype A obtained from the CL source isolate
CLASOB Genotype B obtained from the CL source isolate
CLASOC Genotype C obtained from the CL source isolate
CLG1A Genotype A obtained from the CL-G(GF) graft transmitted subisolate
CLG1B Genotype B obtained from the CL-G(GF) graft transmitted subisolate
CLG1C Genotype C obtained from the CL-G(GF) graft transmitted subisolate
CLG2A Genotype A obtained from the CL-G(ML) graft transmitted subisolate
CLG2B Genotype B obtained from the CL-G(ML) graft transmitted subisolate
CLG2C Genotype C obtained from the CL-G(ML) graft transmitted subisolate
CLG3A Genotype A obtained from the CL-G(SW) graft transmitted subisolate
CLG3B Genotype B obtained from the CL-G(SW) graft transmitted subisolate
CLG3C Genotype C obtained from the CL-G(SW) graft transmitted subisolate
M2ASOA Genotype A obtained from the M2A source isolate
M2ASOB Genotype B obtained from the M2A source isolate
M2ASOC Genotype C obtained from the M2A source isolate
M2AG1A Genotype A obtained from the M2A-G(GF) graft transmitted subisolate
M2AG1B Genotype B obtained from the M2A-G(GF) graft transmitted subisolate
M2AG1C Genotype C obtained from the M2A-G(GF) graft transmitted subisolate
M2AG2A Genotype A obtained from the M2A-G(ML) graft transmitted subisolate
M2AG2B Genotype B obtained from the M2A-G(ML) graft transmitted subisolate
M2AG2C Genotype C obtained from the M2A-G(ML) graft transmitted subisolate
M2AG3A Genotype A obtained from the M2A-G(SW) graft transmitted subisolate
T68SOA Genotype A obtained from the T68 source isolate
T68SOB Genotype B obtained from the T68 source isolate
T68G1A Genotype A obtained from the T68-G(GF) graft transmitted subisolate
T68G1B Genotype B obtained from the T68-G(GF) graft transmitted subisolate
T68G2A Genotype A obtained from the T68-G(ML) graft transmitted subisolate
T68G2B Genotype B obtained from the T68-G(ML) graft transmitted subisolate
T68G3A Genotype A obtained from the T68-G(SW) graft transmitted subisolate
T68G3B Genotype B obtained from the T68-G(SW) graft transmitted subisolate
T68A1A Genotype A obtained from the T68-A(GF) aphid transmitted subisolate
T68A1 B Genotype B obtained from the T68-A(GF) aphid transmitted subisolate
T68A1C Genotype C obtained from the T68-A(GF) aphid transmitted subisolate
T68A1 D Genotype D obtained from the T68-A(GF) aphid transmitted subisolate
T68A3A Genotype A obtained from the T68-A(SW) aphid transmitted subisolate
T68A3B Genotype B obtained from the T68-A(SW) aphid transmitted subisolate
T68A3C Genotype C obtained from the T68-A(SW) aphid transmitted subisolate











Discussion

Three Florida CTV isolates: CL, M2A and T68 were selected for the present study.

The analysis of 403 nt region amplified from the ORF la of CTV genome by primer pair

CN 488 and CN 491 using HMA showed the presence of mixture of more than one

genotypes in each of the source and the graft and aphid transmitted subisolates. All the

source isolates and the graft and/or aphid transmitted subisolates contained one major

genotype and the one or more minor genotypes, based on the number of clones in each

genotype. Minor genotypes were found to be co-dominating in some cases. A good

relationship was found between the HMA patterns and the subsequent sequencing and

phylogenetic results.

Field isolates of CTV often are mixtures of different genotypes (Mawassi et al.,

1995a; Mawassi et al., 1995b). In the present study, three genotypes from the source

isolate CL (CLSOA, CLSOB and CLSOC), source isolate M2A (M2ASOA, M2ASOB and

M2ASOC) and two genotypes from the source isolate T68 (T68SOA and T68SOB) were

obtained. From the mixture of genotypes, strains of CTV having distinct properties can

be selected thus changing the mixture of viral strains in different proportions in infected

plants (Hilf et al., 1999).

The population diversity of CTV may change upon graft or aphid transmission

which may eventually lead to the formation of new genotypes. The present study also

indicates the changes in the population structure of CTV due to the graft and aphid

transmissions. The changes were only found in the minor genotypes; however, the major

genotypes did not change. The changes in the genotype may also suggest the selection

pressure of host and the aphid transmissions on the viral sequences. The differential









selection pressure, of host and the aphid transmission, to different genes has been

reported, which may be responsible in part for the wide biological, serological and

molecular variability among CTV isolates (Ayllon et al., 1999). Such kind of studies will

be helpful in understanding the mechanism of variability in the CTV genome.

Mixtures of genotypes, present in the field isolates of CTV, can be separated due

to aphid transmission and the aphid-transmitted subisolates differ from the source isolate

in their serological and biological properties (Brlansky et al., 2003; Moreno et al., 1993a;

Moreno et al., 1993b). In the present study, both mild and severe genotypes have been

detected only after the aphid transmissions. These genotypes could not be detected from

the source isolate or the graft transmitted subisolates. This may suggests the specific

association of BCA with certain genotypes. Since BCA is the most efficient vector of

CTV and an increase in the incidence of all strains of CTV has been reported due to the

introduction of brown citrus aphid in Florida (Halbert et al., 2004; Hermosa de Mendoza

et al., 1984). Understanding the association of the viral sequences with the BCA will be

helpful in predicting future models for the spread of CTV.

The CTV has been recently detected from several new areas for the first time

(Davino et al., 2003; Papic et al., 2005). The isolates of CTV detected in these areas may

or may not resemble one of the already known genotypes. Most of the molecular methods

for detection of CTV are limited by the sequence information available and better

molecular tools are required for the efficient and rapid detection of new genotypes. The

sequence information generated as part of this study will be helpful in designing rapid

and efficient detection methods of CTV in future.






74


The symptomatology of CTV isolates may change upon graft transmission to a

different host species or aphid transmissions. In this study it was found that all the

isolates are mixture of 2-3 genotypes and the changes, after the graft and/or aphid

transmissions, occurred only in the minor genotypes. This suggests the presence of more

than one genotype (major and minor genotype) and their presence in different

combinations could cause a synergistic effect on the severity of symptoms caused by the

major genotype.














CHAPTER 4
GENERAL CONCLUSIONS

Tristeza disease, caused by Citrus tristeza virus (CTV), is a very destructive

disease of Citrus, and has killed millions of citrus trees grafted on sour orange rootstock

in the past couple of decades. The field trees infected with CTV often contains mixture of

different genotypes. An estimation of the amount of genetic diversity for CTV is still

being determined. Several molecular techniques are available for the detection and

characterization of mixed viral infections; each having its own merits and demerits.

Multiple molecular markers (MMM) and heteroduplex mobility assay (HMA) were used

to characterize the three Florida isolates [Chiefland (CL), Mcn2a (M2A) and T68].

All the three isolates showed presence of mixed infections. The population

structure of each isolate was found to consist of one major genotype and 2-3 minor

genotypes. Based on the MMM, CTV isolates CL and M2A were found to contain T36

and VT genotypes. Isolate T68 contains the T3 genotype, but may also contain the VT

genotype. However sequencing of the amplified markers from theses isolates is required

in order to confirm the presence of T36 and/or VT and T3 genotypes.

The HMA of about 403 bp region amplified from the ORF la of the isolates

suggests the presence of both severe and mild isolates. One major genotype (genotype A)

and two minor genotypes (genotype B and C), based on the number of clones in each

genotype, were detected from CL and M2A isolates. Genotype A was found to be closely

related to the B225 and B219 Indian CTV isolates. These Indian isolates belong to VT

genotype. Genotype B is closely related to the T36 severe decline CTV isolates from









Florida and BAN-2 severe stem pitting isolates from India. Genotype C from the CL

isolates is related to the CTV isolates B165 (causes severe lime reaction) and Nartia from

India and South Africa, respectively. Whereas the genotype C from M2A isolates showed

high sequence homology to the T38K CTV isolate which is one of the subisolates from

T3800 stem pitting CTV isolate from Florida. The T68 isolate was found to be mixture of

two genotypes. The major genotype (Genotype A) was genetically related to B165 CTV

isolate from India. The minor genotype (Genotype B) however did not show nucleotide

homology to any of the known CTV isolates and is a new genotype.

The HMA from the aphid transmitted subisolates of the T68 CTV isolate suggest

that the genotype diversity is altered due to the aphid transmissions. The changes were

only found in the minor genotypes; however, the major genotypes did not change. Brown

citrus aphid (BCA), used for aphid transmissions, has the ability to single out both mild

and severe genotypes from the CTV complex. Several mild and severe genotypes were

detected only after aphid transmissions. The HMA from the graft transmitted subisolates

of the selected isolates suggest that the genotype diversity sometimes may change with

the graft transmissions, however changes were found only in the minor genotypes with no

change in the major genotype of each isolate.

All the three Florida CTV isolates in this study, showed intra isolate genotype

diversity ranging from 9 18% and some of the genotypes are more genetically similar to

those of other CTV isolates than to the other genotypes from the same isolate. These

results clearly suggest that the mixed infections obtained from all the three selected

Florida isolates should not be confused with the presence of quasispecies.
















LIST OF REFERENCES


Agranovsky, A. A., Lesemann, D. E., Maiss, E., Hull, R., and Atabekov, J. G. (1995).
"Rattlesnake" structure of a filamentous plant RNA virus built of two capsid
proteins. Proc Natl Acad Sci USA. 92, 2470-2473.

Ahlawat, Y. S., and Raychaudhuri, S. P. (1988). Status of Citrus tristeza and dieback
diseases in India and their detection. Citriculture: Proceedings of the Six\ ii
International Citrus Congress. Middle-East, Tel Aviv, Israel. 871-879.

AlbiacM, M., Mawassi, M., Gowda, S., Satyanarayan, T., Hilf, M. E., Shanker, S., Almira,
E. C., Vives, M. C., Lopez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S. M.,
and Dawson, W. 0. (2000). Sequences of Citrus tristeza virus separated in time and
space are essentially identical. Journal of Virology. 74, 6856-6865.

Ayllon, M. A., Lopez, C., Navas-Castillo, J., Garnsey, S. M., Guerri, J., Flores, R., and
Moreno, P. (2001). Polymorphism of the 5' terminal region of Citrus tristeza virus
(CTV) RNA: incidence of three sequence types in isolates of different origin and
pathogenicity. Archives of Virology. 146(1), 27-40.

Ayllon, M. A., Lopez, C., Navas-Castillo, J., Mawassi, M., Dawson, W. 0., Guerri, J.,
Flores, R., and Moreno, P. (1999a). New defective RNAs from Citrus tristeza
virus: evidence for a replicase-driven template switching mechanism in their
generation. J. Gen. Virol. 80(3), 817-821.

Ayllon, M. A., Rubio, L., Moya, A., Guerri, J., and Moreno, P. (1999b). The haplotype
distribution of two genes of Citrus tristeza virus is altered after host change or
aphid transmission. Virology. 255(1), 32-39.

Bar-Joseph, M., Che, X., Mawassi, M., Gowda, S., Satyanarayana, T., Ayllon, M. A.,
Albiach, M., Garnsey, S. M., and Dawson, W. 0. (2002). The continuous challenge
of Citrus tristeza virus molecular research. In: 15th Conf. Int. Organ. Citrus
Virol.,Riverside, CA 1-7.

Bar-Joseph, M., Marcus, R., and Lee, R. F. (1989). The continuous challenge of Citrus
tristeza virus control. Ann. Rev. Phytopathol. 27, 291-316.

Berry, S., and C., R. M. E. (2001). Differentiation of cassava-infecting begomoviruses
using heteroduplex mobility assays. J. Virol. Methods. 92, 151-163.

Blackman, R. L., and Eastop, V. F. (1984). Aphids on world crops. John Wiley & Sons
Chichester, United Kingdom., pp 466.









Brlansky, R. H. (1987). Inclusion bodies produced in citrus by Citrus tristeza virus.
Phytophylactica. 19, 211-213.

Brlansky, R. H., Damsteegt, V. D., Roy, A., and Howd, D. S. (2003). Molecular Analyses
of Citrus tristeza virus subisolates separated by aphid transmissions. Plant Disease.
87, 397-401.

Brlansky, R. H., and Lee, R. F. (1990). Numbers of inclusion bodies produced by mild
and severe strains of Citrus tristeza virus in seven citrus hosts. Plant Disease.
74(4), 297-299.

Cai, S. P., Eng, B., Kan, Y. W., and Chui, D. H. K. (1991). A rapid and simple
electrophoretic method for detection of mutations involving small insertions and
deletions: applications to P-thalassemia. Hum. Genet. 87, 720-728.

Cambra, M., Camarasa, E., Gorris, M. T., Gamsey, S. M., Gumpf, D. J., and Tsai, M. C.
(1993). Epitope diversity of Citrus tristeza virus (CTV) isolates in Spain. In: 12th
Conf. Int. Organ. Citrus Virol., Riverside, CA. pp 33-38.

Cambra, M., Gorris, M. T., Olmos, A., Martinez, M. C., Roman, M. P., Bertolini, E.,
Lopez, A., and Carbonell, E. A. (2002). European diagnostic protocols
(DIAGPRO) for Citrus tristeza virus in adult trees. In: 15th Conf. Int. Organ.
Citrus Virol., Riverside, CA. pp 69-78.

Cambra, M., Serra, J., Vilalba, D., and Moreno, P. (1988). Present situation of Citrus
tristeza virus in the Valencian community. In: 10th Proc. Conf. Int. Org. Citrus
Virol., Riverside, CA. pp 1- 7.

Cevik, B. (2001). Characterization of the RNA-dependent RNA polymerase gene of
citrus tristeza closterovirus. PhD Dissertation. University of Florida, Gainesville.

Cevik, B., Chandrika, R., Manjunath, K. L., Lee, R. F., and Niblett, C. L. (1999).
Characterization of the ribosomal +1 frameshift in the RNA-dependent RNA
polymerase gene of citrus tristeza closterovirus. Phytopathology. 89, 13.

Che, X., Piestun, D., Mawassi, M., Yang, G., Satyanarayana, T., Gowda, S., Dawson, W.
0., and Bar-Joseph, M. (2001). 5' Coterminal subgenomic RNAs in Citrus tristeza
virus infected cells. Virology. 283(2), 374-381.

Costa, A. S., and Muller, G. W. (1980). Tristeza control by cross protection: a US-Brazil
cooperative success, virus disease. Plant Disease. 64, 538-541.

d'Urso, F., Ayllon, M. A., Rubio, L., Sambade, A., Hermosa de Mendoza, A., Guerri, J.,
and Moreno, P. (2000). Contribution of uneven distribution of genomic RNA
variants of Citrus tristeza virus (CTV) within the plant to changes in the viral
population following aphid transmission. Plant Pathology. 49(2), 288-294.









D'Urso, F., Sambade, A., Moya, A., Guerri, J., and Moreno, P. (2003). Variation of
haplotype distributions of two genomic regions of Citrus tristeza virus populations
from eastern Spain. Molecular Ecology. 12(2), 517-526.

Davino, S., Davino, M., Sambade, A., Guardo, M., and Caruso, A. (2003). The First
Citrus tristeza virus outbreak found in a relevant citrus producing area of Sicily,
Italy. Plant Disease. 87, 314.

Delwart, L. E., Shpaer, G. E., Louwagie, J., McCutchan, E. F., Grez, M., Rubsamen-
Waigmann, H., and Millins, J. I. (1993). Genetic relationships determined by a
DNA heteroduplex mobility assay: Analysis of HIV-1 env genes. Science. 262,
1257-1261.

Dominguez, A., Hermoso de Mendoza, A., Guerri, J., Cambra, M., Navarro, L., Moreno,
P., and Pena, L. (2002). Pathogen derived resistance to Citrus tristeza virus (CTV)
in transgenic Mexican lime (Citrus aurantifolia (Christ.) Swing.) plants expressing
its p25 coat protein gene. Molecular Breeding: New strategies in plant
improvement. 10, 1-10.

Esau, K. (1960). Cytological and histological symptoms of beet yellows. Virology. 10,
73-85.

Febres, V. J., Ashoulin, L., Mawassi, M., Frank, A., Bar-Joseph, M., Manjunath, K. L.,
Lee, R. F., and Niblett, C. L. (1996). The p27 protein is present at one end of Citrus
tristeza virus particles. Phytopathology. 86(12), 1331-1335.

Fulton, R. W. (1986). Practices and precautions in the use of cross protection for plant
virus disease control. Annu. Rev. Phytopathology. 67, 965-968.

Garnsey, S. M., Bar-Joseph, M., and Lee, R. F. (1981). Applications of serological
indexing to develop control strategies for Citrus tristeza virus. Proceedings of the
International Society of Citriculture. 1, 448-452.

Garnsey, S. M., Barrett, H. C., and Hutchison, D. J. (1987a). Identification of Citrus
tristeza virus resistance citrus relatives and its potential applications.
Phytophylactica. 19(2), 187-191.

Garnsey, S. M., Gumpf, D. J., Roistacher, C. N., Civerolo, E. L., Lee, R. F., Yokomi, R.
K., and Bar-Joseph, M. (1987b). Toward a standard evaluation of the biologically
properties of Citrus tristeza virus. Phytophylactica. 19, 151-157.

Garnsey, S. M., Permar, T. A., Cambra, M., and Henderson, C. T. (1993). Direct tissue
blot Immunoassay (DTBIA) for detection of Citrus tristeza virus (CTV). In: 12th
Conf. Int. Organ. Citrus Virol., Riverside, CA. 39-50.

Garnsey, S. M., Su, H. J., and Tsai, M. C. (1997). Differential susceptibility of pummelo
and Swingle citrumelo to isolates of Citrus tristeza virus. In: 13th Conf. Int. Organ.
Citrus Virol., Riverside, CA. 138-146.










Guerri, J., Moreno, P., Munoz, N., and Martinez, M. E. (1991). Variability among
Spanish Citrus tristeza virus isolates revealed by double-stranded RNA analysis.
Plant Pathology. 40, 38-44.

Halbert, S. E., Gene, H., Cevik, B., Brown, L. G., Rosales, I. M., Manjunath, K. L.,
Pomerinke, M., Davison, D. A., Lee, R. F., and Niblett, C. L. (2004). Distribution
and characterization of Citrus tristeza virus in South Florida following
establishment of Toxoptera citricida. Plant Disease. 88, 935-941.

Hermosa de Mendoza, A., Ballester-Olmos, J. F., and Pina-Lorca, J. A. (1984).
Transmission of Citrus tristeza virus by aphids (Homoptera, Aphididae) in spain.
In: 9th Con. Int. Organ. Citrus Virol., Riverside, CA. 68-70.

Hilf, M. E., and Garnsey, S. M. (2000). Characterization and classification of Citrus
tristeza virus isolates by amplification of multiple molecular markers. In: 14 Conf.
Int. Organ. Citrus Virol., Riverside, CA. 18-27.

Hilf, M. E., and Garnsey, S. M. (2002). Citrus tristeza virus in Florida: A synthesis of
historical and contemporary biological, serological and genetic data. In: 15th Conf
Int. Organ. Citrus Virol., Riverside, CA. 13-20.

Hilf, M. E., Karasev, A., Maria, R., Albiach, M., Dawson, W. 0., and Garnsey, S. M.
(1999). Two paths of sequence divergence in the Citrus tristeza virus complex.
Phytopathology. 89, 336-342.

Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., and Garnsey, S.
M. (1995). Characterization of Citrus tristeza virus subgenomic RNAs in infected
tissue. Virology. 208(2), 576-582.

Jarupat, T., Dodds, J. A., and Roistacher, C. N. (1988). Effect of host passage on dsRNAs
of two strains of Citrus tristeza virus. In: 15th Conf. Int. Organ. Citrus Virol.,
Riverside, CA. 39-44.

Karasev, A. V. (2000). Genetic diversity, and evolution of closteroviruses.
Phytopathology. 38, 293-324.

Karasev, A. V., Boyko, V. P., Gowida, S., Nikolaeva, 0. V., Hilf, M. E., Koonin, E. V.,
Niblett, C. L., Cline, K., Bumpf, D. J., and Lee, R. F. (1995b). Complete sequence
of the Citrus tristeza virus RNA genome. Virology. 208(2), 511-520.

Lee, R. F., Derrick, K. S., McClure, P., Ellis, L., and Rucks, P. (1994). Occurrence of
severe strains of Citrus tristeza virus and citrus blight in registered scion groves in
the Indian River. Proceedings of the annual meeting of the Florida State
Horticultural Society, Miami beach, Florida. 106, 94-99.

Lee, R. F., McConnell, p., Manjunath, K. L., Cevik, B., Nikolaeva, 0. V., Dekkers, M. G.
H., and Niblett, C. L. (2002). The citrus tristeza virus epidemic in Bog Walk valley,
Jamaica. In: 15th Conf. Int. Organ. Citrus Virol., Riverside, CA. 95-101.









Lee, R. F., Pappu, H. R., Pappu, S. S., Rocha-Pena, M. A., Febres, V. J., Manjunath, K.
L., Nikolaeva, O. V., Karasev, A., Cevik, B., Akbulut, M., Bencher, D., Anderson,
E. J., Price, M., Ochoa-Corona, F. M., and Niblett, C. L. (1996). Progress on strain
differentiation of Citrus tristeza virus. Phytopathology. 14(2), 79-87.

Lee, R. F., and Rocha-Pena, M. A. (1992). Citrus tristeza virus. Pages 226-249 in:
Kumar, J., Chaube, H. S., Singh, U. S. and Mukhopadhyay. A. N (eds). Plant
disease of international importance. Disease of Fruit Crops. Prentice Hall,
Englewood Cliffs, NJ. Vol. III, 456 pp.

Lin, N. S., Hsu, Y. H., and Hsu, H. T. (1990). Immunological detection of plant viruses
and mycoplasma like organism by direct tissue blottingon nitrocellulose
membranes. Phytopathology. 80, 824-828.

Lin, S. S., Hou, R. F., and Yeh, S. D. (2000). Heteroduplex Mobility and Sequence
Analyses for assessment of variability of Zucchini yellow mosaic virus.
Phytopathology. 90, 228-235.

Lopez, C., Ayllon, M. A., Navas-Castillo, J., Guerri, J., Moreno, P., and Flores, R.
(1998). Molecular variability of the 5' and 3' terminal regions of Citrus tristeza
virus RNA. Phytopathology. 88(7), 685-691.

Mawassi, M., Karasev, A., Mietkiewska, E., Gafny, R., Lee, R. F., Dawson, W. 0., and
Bar-Joseph, M. (1995a). Defective RNA molecules associated with Citrus tristeza
virus. Virology. 208(1), 383-387.

Mawassi, M., Mietkiewska, E., Gofman, R., Yang, G., and Bar-Joseph, M. (1996).
Unusual sequence relationships between two isolates of Citrus tristeza virus. J.
Gen. Virol. 77, 2359-2364.

Mawassi, M., Mietkiewska, E., Hilf, M. E., Ashoulin, L., Karasev, A. V., Gafny, R., Lee,
R. F., Garnsey, S. M., Dawson, W. 0., and Bar-Joseph, M. (1995b). Multiple
species of defective RNAs in plants infected with Citrus tristeza virus. Virology.
214(1), 264-268.

McClean, A. P. D. (1957). Tristeza virus of citrus; Evidence for absence of seed
transmission. Plant. Disease. Rep. 41, 821.

Mehta, P., Brlansky, R. H., Gowda, S., and Yokomi, R. K. (1997). Reverse transcription
polymerase chain reaction detection of Citrus tristeza virus in aphids. Plant
Disease. 81(9), 1066-1069.

Moreno, P., Guerri, J., Ballester-Olmos, J. F., Albiach, R., and Martinez, M. E. (1993a).
Seperation and interference of strains from a Citrus tristeza virus isolate evidenced
by biological activityand double stranded RNA (dsRNA) analysis. Plant Pathology.
42, 35-41.









Moreno, P., Guerri, J., Ballester-Olmos, J. F., Fuertes-Polo, C., Albiach, R., and
Martinez, M. E. (1993b). Variations in pathogenocity and double stranded
(dsRNA) patterns of Citrus tristeza virus isolates induced by host passage. In: 12th
Conf. Int. Organ. Citrus Virol., Riverside, CA. 8-15.

Muller, G. W., and Garnsey, S. M. (1984). Susceptibility of citrus varieties, species, citrus
relatives, and non-rutecous plants to slash-cut mechanical inoculation with Citrus
tristeza virus. Garnsey, S. M. Timmer, L. V. And Dodds, J. A. (eds). In: 8th Conf
Int. Organ. Citrus Virol., Riverside, CA. 62-65.

Nagy, P. D., and Simon, A. E. (1997). New insights into the mechanisms of RNA
recombination. Virology. 235, 1-9.

Papic, T., Santos, C., and Nolasco, G. (2005). First report of Citrus tristeza virus in the
State Union of Serbia and Montenegro. Plant Disease. 89, 434.

Pappu, H. R., Karasev, A., Anderson, E. J., Pappu, S. S., Hilf, M. E., Febres, V. J.,
EckloffRMJ, McCaffery, M., Boyko, V. P., Gowda, S., Dolja, V., Koonin, E. V.,
Gumpf, D. J., Cline, K., Garnsey, S. M., Dawson, W. O., Lee, R. F., and Niblett, C.
L. (1994). Nucleotide sequence and organisation of 3' open reading frames of cirus
tristeza closterovirus genome. Virology. 199, 35-46.

Pappu, S. S., Febres, V. J., Pappu, H. R., Lee, R. F., and Civerolo, E. L. (1997).
Characterization of the 3' proximal gene of citrus tristeza closterovirus genome.
Virus Res. 47, 51-57.

Penaranda, J., Acosta, O., Guzman-Barney, M., Alegria, A., Pappu, H. R., Pappu, S. S.,
Manjunath, K. L., Febres, V. J., Lee, R. F., and Niblett, C. L. (1996). Incidence and
characterization of mild and severe isolates of Citrus tristeza virus from Columbia.
In: 8th Conf Int. Organ. Citrus Virol., Riverside, CA. 71-77.

Permar, T. A., Garnsey, S. M., Gumpf, D. J., and Lee, R. F. (1990). A monoclonal
antibody that discriminates strains of Citrus tristeza virus. Phytopathology. 80(3),
224-228.

Powell, C. A., Pelosi, R. R., Rundell, P. A., and Cohen, H. (2003). Breakdown of cross-
protection of grapefruit from decline-inducing isolates of Citrus tristeza virus
following introduction of brown citrus aphid. Plant Disease. 87, 1116-1118.

Rocha-Pena, M. A., Lee, R. F., Lastra, R., Niblett, C. L., Ochoa-Corona, F. M., Garnsey,
S. M., and Yokomi, R. K. (1995). Citrus tristeza virus and its aphid vector
Toxoptera citricida: threats to citrus production in the Caribbean and Central and
North America. Plant Disease. 79(5), 437-445.

Rocha-Pena, M. A., Lee, R. F., and Niblett, C. L. (1991a). Development of a dot-
immunobinding assay for detection of Citrus tristeza virus. J. Virol. Methods.
34(3), 297-309.









Rocha-Pena, M. A., Lee, R. F., Permar, T. A., Yokomi, R. K., and Garnsey, S. M.
(1991b). Use of enzyme linked immunosorbent and dot-immunobinding assay to
evaluate two mild strain cross protection experiments after challenge with a severe
strain Citrus tristeza virus isolate. In: 11th Conf. Int. Organ. Citrus Virol.,
Riverside, CA. 93-102.

Roistacher, C. N. (1982). A blueprint of disaster I: The history of seedling yellows
disease. California Citrograph. 67, 48-53.

Rubio, L., Ayllon, M. A., Guerri, J., Pappu, H. R., Niblett, C. L., and Moreno, P. (1996).
Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand
conformation polymorphism analysis of coat protein gene. Ann. Appl. Biol. 129,
479-489.

Rubio, L., Guerri, J., and Moreno, P. (2000). Characterization of Citrus tristeza virus
isolates by single-strand conformation polymorphism analysis of DNA
complementary to their RNA population. In: 14 Proc. Conf. Int. Org. Citrus Virol.,
Riverside, CA. 12-17.

Sasaki, A. (1974). Studies on hasaku dwarf. Special bulletin offruit tree experimental
station of hiroshima prefecture. No. 2, 106 pp.

Satyanarayana, T., Gowda, S., Ayllon, M. A., and Dawson, W. 0. (2004). Closterovirus
bipolar virion: Evidence for initiation of assembly by minor coat protein and its
restriction to the genomic RNA 5' region. Proc NatlAcadSci USA. 101, 799-804.

Satyanarayana, T., Gowda, S., Boyko, V. P., Albiach-Marti, M. R., Mawassi, M., Navas-
Castillo, J., Karasev, A. V., Dolja, V., Hilf, M. E., and Lewandowski, D. J. (1999).
An engineered closterovirus RNA replicon and analysis of heterologous terminal
sequences for replication. Proc NatlAcadSci USA. 96(13), 7433-7438.

Satyanarayana, T., Siddarame Gowda, Maria A. Ayll6n, Albiach-Marti, M. R. and
Dawson, W. 0. (2002). The p23 Protein of Citrus tristeza virus controls
asymmetrical RNA accumulation. Journal of Virology. 76(2), 473-483.

Suastika, G., Natsuaki, T., Terui, H., Kano, T., leki, H., and Okuda, S. (2001). Nucleotide
sequence of Citrus tristeza virus seedling yellows isolate. J. Gen. Plant Pathol. 67,
73-77.

Toxopeus, H. J. (1937). Stock-action in-compatibility in citrus and its cause. J. Pomol.
Hortic. Sci. 14, 360-67.

Van Vuuren, S. P., Collins, R. P., and Da Graca, J. V. (1993). Evaluation of Citrus
tristeza virus isolates for cross protection of grapefruit in South Africa. Plant
Disease. 77(1), 24-28.









Vela, C., Cambra, M., Cortes, E., Moreno, P., Miguet, J. G., and Sanz, A. (1986).
Production and characterization of monoclonal antibodies specific for Citrus
tristeza virus and their use of diagnosis. J. Gen. Virol. 67, 91-96.

Viggiani, G. (1988). Citrus pests in mediterranean basin. In: 6th Conf. Int. Organ. Citrus
Virol., Riverside, CA. 1067-1073.

Vives, M. C., Rubio, L., Lopez, C., Navas-Castillo, J., Albiach-Marti, M. R., Dawson, W.
0., Guerri, J., Flores, R., and Moreno, P. (1999). The complete genome sequence
of the major component of a mild Citrus tristeza virus isolate. J. Gen. Virol. 80,
811-816.

Webber, H. J. (1925). A comparative study of citrus industry in South Africa. Union S.
Afr. Dept. Agric. Bull. 6, pp 106.

Weber, H. J. (1943). The "Tristeza" disease of sour-orange rootstock. Proc. Am. Soc.
Hort. Science. 43, 360-364.

Yang, G., Mawassi, M., Gofman, R., Gafny, R., and Bar-Joseph, M. (1997). Involvement
of a subgenomic mRNA in the generation of a variable population of defective
Citrus tristeza virus molecules. Journal of Virology. 71(12), 9800-9802.

Yang, Z. N., Mathews, D. M., Dodds, J. A., and Mirkov, T. E. (1999). Molecular
characterization of an isolate of Citrus tristeza virus that causes severe symptoms
in sweet orange. Virus Genes. 19, 131-142.

Yokomi, R. K., Lastra, R., Stoetzel, M. B., Damsteegt, V. D., Lee, R. F., Garnsey, S. M.,
Gottwald, T. R., Rocha-Pena, M. A., and Niblett, C. L. (1994). Establishment of the
brown citrus aphid (Homoptera: Aphididae) in Central America and the Caribbean
Basin and transmission of Citrus tristeza virus. Journal of Economic Entomology
87(4), 1078-1085.

Zeman, V. (1930). Una enfermada nueva en los naranjales de Corrientes. Physis. 19, 410-
411.















BIOGRAPHICAL SKETCH

Amandeep S. Kahlon was born and raised in Punjab state in India. He completed

his high school diploma from Khalsa College, Amritsar. He then joined Punjab

Agricultural University (PAU), Ludhiana, India, for his BS degree in agricultural

sciences with specialization in plant protection. Mr. Amandeep Kahlon completed his BS

in 2002 and joined University of Florida in Fall 2003 for his MS degree.