Phenotypic Characterization and Sequence Analysis of pthA Homologs from Five Pathogenic Variant Groups of Xanthomonas citri




Copyright 2005 by Abdulwahid Al-Saadi


This dissertation is dedicated to H.E Ma hmood A. Makki for his continuous support, encouragement and belief in me. He passed aw ay last year without seeing me make it to the end and successfully complete my PhD. I am sure that he would have been very happy and appreciative for my accomplishment.


ACKNOWLEDGMENTS I would thank God for giving patience and blessing me with a lot of colleagues and friends who stood by my side when I needed them most. The completion of this dissertation would not have been possible without the help and support of many people both in Gainesville and back home in Oman. First I would like to express my gratitude to my advisor Dr. Dean W. Gabriel for his support, guidance and patience with me during my time in his lab. I would also like to thank him for providing me financial support towards the end my PhD. I would like to thank Dr. Jeff Jones for his support, encouragement, guidance, friendship and listening to me when I was feeling down and ready to give up. I would also like to thank my other committee members Dr. G. Moore and Dr. R. Lee for being on my committee, support and correcting this manuscript I would like to thank Dr. G. Wisler for her support and encouragement. I would like to give special thanks to Mr. Gary Marlow for his continued help, support, scientific discussions and just being a good friend that was there for me when I needed him both in and outside the lab. I want to also thank Dr. Joseph Ready and Dr. Young Duan for their help, discussions and advice in the lab. I would like to thanks other students in my lab especially Basma, Adriana and Asha for their help and support. I also thank all former members of the lab. I thank faculty, staff and students in the PMCB program and the Department of Plant Pathology who helped and encouraged me in many ways. I would like to thank everyone in the Department of Plant Industry (DPI) for providing help in iv


maintenance of citrus plants in the quarantine facility. Special thanks go to my friend Eduardo Carlos and his family for all their support and encouragement. I also want to thank my two study partners Mohamed Al-Khairy and Yousef Al-Dligan. I also thank Mohamed Al-Matar and Fahad Al-Saqqaf. I would like to recognize two people in the Diwan of Royal Court who have recently passed away. H.E Said Seif bin Hamed and H.E Mahmood Maki who supported me coming to the US to get my PhD. Without their support and encouragement I would have not been able to complete my degree. I would like to thank my advisor and mentor in Oman, Dr. Ahmed Hamooda, for continuously supporting and encouraging me throughout my time here. I thank him for being my advocate and believing in me even when many were ready to give up on me. I cannot say thank you enough to this man who took me under his wings and guided me through difficult times. I would like to thank Mr. Yahya Al-Zidjali for his support. Special thanks go to Dr. Yahya Al-Hinai for his support and friendship. I want to thank Mrs. Nihaya, Dr. Magdy, Dr. Deitz, Abdulrahman Al-Siyabi, Abduljalil Attiya, Ammer Al-Manthiri and everyone in the Diwan of Royal Court who helped and supported me. I thank my parents, Abubaker and Khadija, for unconditional support, love and encouragement. I also thank my brothers and sisters for their support and encouragement during my study here. I thank them for making me the person I am. I also like to thank Yasser Al-Ajmi, Mohamed Al-Balushi, Fida Al-Raissy, Aqeel Abdawani and all my friends in Oman. I thank and remember my twin brother Abdulrahman who passed away a few days after our birth. He has always been with me and provided me with strength, v


patience and hope. Finally I have to say special thanks to my wife May and son Muadh for being there for me as they waited patiently for me during my time here. vi


TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...............................................................................................................x LIST OF FIGURES...........................................................................................................xi ABSTRACT.....................................................................................................................xiii CHAPTER 1 INTRODUCTION........................................................................................................1 Citrus.............................................................................................................................1 Florida Citrus................................................................................................................2 Citrus Canker................................................................................................................3 Resistance to Citrus Canker..........................................................................................5 Controlling Citrus Canker.............................................................................................5 Objectives.....................................................................................................................6 2 USE OF TWO DIFFERENT CITRUS HOSTS TO DISTINGUISH ALL FORMS OF CITRUS CANKER DISEASE.............................................................................10 Introduction.................................................................................................................10 Material and Methods.................................................................................................11 Strains, Plasmids and Culture Media...................................................................11 Recombinant DNA Techniques...........................................................................11 Plant Inoculations................................................................................................12 In vitro Growth Kinetics......................................................................................12 In planta Growth Kinetics...................................................................................13 Results.........................................................................................................................13 Pathogenicity Phenotypes of X. citri Strains.......................................................13 In vitro Growth....................................................................................................14 Growth Kinetics in planta...................................................................................14 Discussion...................................................................................................................15 vii


3 IDENTIFICATION AND CHARACTERIZATION OF HOST RANGE FACTOR(S) IN CITRUS CANKER STRAINS........................................................24 Introduction.................................................................................................................24 Material and Methods.................................................................................................26 Bacterial Strains, Plasmids and Culture Media...................................................26 Recombinant DNA Techniques...........................................................................26 Vector Preparation...............................................................................................27 Packaging and Transfection................................................................................27 Plant Inoculations................................................................................................28 Triparental Matings.............................................................................................28 Results.........................................................................................................................29 Xanthomonas citri pv citri A 3213 Strain Genomic Library...............................29 Screening of 3213 Library in Xc270...................................................................29 Discussion...................................................................................................................29 4 SEQUENCE COMPARISON AND CHARACTERIZATION OF FIVE NEW pthA HOMOLOGS FROM FOUR DIFFERENT Xanthomonas citri STRAINS......35 Introduction.................................................................................................................35 Material and Methods.................................................................................................36 Bacterial Strains, Plasmids and Culture Media...................................................36 Recombinant DNA Techniques...........................................................................37 DNA Library Construction..................................................................................37 Plant Inoculations................................................................................................38 Southern Hybridization Analysis........................................................................38 Colony Hybridization..........................................................................................38 Triparental Matings.............................................................................................39 Sequence Analysis of pth Genes.........................................................................40 Results.........................................................................................................................41 Southern Blot Analysis........................................................................................41 Cloning, Characterization and Sequencing of pthA Homologs from X. citri A*, A w B and C Strains...................................................................................41 Inactivation and Complementation of Genes pthB and pthC in X. citri pv aurantifolii........................................................................................................43 None of the pthA Homologs from Group A Strain 3213 Increased the Host Range of Group A* Strain 270 to Include Grapefruit......................................44 Sequence Analysis of pthA Homologs from All Known X. citri Groups............44 Discussion...................................................................................................................45 5 SUMMARY AND CONCLUSION...........................................................................60 APPENDIX A SEQUENCE OF pthC.................................................................................................63 B SEQUENCE OF pthAW.............................................................................................66 viii


C SEQUENCE OF pthA*...............................................................................................70 D SEQUENCE OF pthA*-2...........................................................................................74 E ALIGNMENT OF PATHOGENECITY GENES FROM X. citri STRAINS............77 LIST OF REFERENCES...................................................................................................87 BIOGRAPHICAL SKETCH.............................................................................................95 ix


LIST OF TABLES Table page 2-1. Strains and plasmids used in this study....................................................................18 2-2. Phenotypic differences among X. citri strains..........................................................19 3-1. Strains and plasmids used in this study....................................................................31 4-1. Strains and plasmids used in this study....................................................................49 4-2. Phenotypic responses of X. citri strains in 2 citrus hosts.........................................51 4-3. Amino acid sequence identity between pathogenicity genes from X. citri strains...52 x


LIST OF FIGURES Figure page 1-1. World citrus production.............................................................................................7 1-2. Status of citrus canker disease in the state of Florida................................................8 1-3. Citrus canker symptoms in citrus...............................................................................9 2-1. Inoculation of strains of different citrus canker groups in grapefruit and Key lime...........................................................................................................................20 2-2. Inoculation of several different A* strains in Duncan grapefruit.............................21 2-3. Growth of X. citri strains in PYGM medium...........................................................22 2-4. in planta growth of X. citri strains in Mexican/Key lime and Duncan grapefruit...23 3-1. Scheme for cosmid vector preparation and DNA cloning.......................................32 3-2. DNA fractionation of X. citri 3213 genomic DNA..................................................33 3-3. Restriction profiles of random clones from X. citi 3213 genomic library................34 4-1. Southern Hybridization analysis of X. citri strains hybridized with the BamHI internal fragment of pthA.........................................................................................53 4-2. Colony Hybridization of E. coli with cloned X0053 A w plasmid DNA fragments using 32 P-labeled pthA..............................................................................................54 4-3. Complementation of A strain knockout B21.2 (pthA::Tn5) with pthA homologs from A w strain X0053 on citrus................................................................................55 4-4. Complementation of A strain knockout B21.2 (pthA::Tn5) with pthA homologs in citrus.....................................................................................................................56 4-5. Analysis of pthA and its three homologs in A* strain Xc270..................................57 xi


4-6. Neighbor-joining dengogram of members of avrBs3/pthA genes from different species and pathovars of Xanthomonas....................................................................58 4-7. Sequence alignment of the predicted amino acids encoded in the main variable portion of the repeat region of all 13 pthA homologs..............................................59 xii


Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PHENOTYPIC CHARACTERIZATION AND SEQUENCE ANALYSIS OF pthA HOMOLOGS FROM FIVE PATHOGENIC VARIANT GROUPS OF Xanthomonas citri By Abdulwahid Al-Saadi August 2005 Chair: Dean W. Gabriel Major Department: Plant Molecular and Cellular Biology Citrus canker is an economically important disease that is caused by five different groups of Xanthomonas citri strains: three from Asia (A, A* and A w ) and two from South America (B and C). In artificial inoculations of grapefruit, only strains of the A and B groups appear to be virulent; strains of the C and A w group elicit an hypersensitive response (HR) and the A* strains show various levels of reduced virulence. The tested A* and A w strains also grew to much lower concentrations in grapefruit compared to the A strain. The strains from all five citrus canker groups were virulent in Mexican lime, but the B and C strains elicited a distinctive canker lesion that was almost white in appearance. Strains from the Asiatic groups grew faster than South American B and C group strains in artificial media. Mexican lime and grapefruit can be used in artificial inoculations to readily distinguish all known strains causing citrus canker disease within 10 days without the need for other laboratory tests. Attempts to identify positive host xiii


range determinants from X. citri were unsuccessful suggesting the possibility of negative factors (avirulence) being involved in determining host range of X. citri. Every X. citri strain carries multiple DNA fragments that hybridize with pthA, a member of the avrBs3/pthA gene family from X. citri group A that is required for pathogenicity and growth of X. citri in citrus. Three new pthA homologs were cloned and sequenced from canker groups A w (pthAW) and A* (pthA* and pthA*-2), and compared with pthA, pthB and pthC. Homologs pthA, pthB, pthC pthAW and pthA* all have 17.5, nearly identical, direct tandem repeats of 34 amino acids and all complemented a pthA::Tn5 knockout mutation in an X. citri group A strain B21.2. Although grapefruit is a differential host and groups A* and A w are avirulent in grapefruit, none of the pthA homologs appeared responsible for the avirulence phenotype by cross complementation tests. Furthermore, none of the four pthA homologs from the wide host range group A strain 3213, including pthA, conferred an increase in host range of group A* or A w strains to include grapefruit. pthA*-2 carried only 15.5 repeats and did not confer either pathogenicity or avirulence to B21.2 in any citrus species tested. Phylogenetic studies separate pthA homologues into two groups, Asiatic and South American groups. Analysis of the predicted amino acid sequences of all sequenced pthA homologs from X. citri indicated that a specific set of amino acid residues in two variable regions of the 17 th direct tandem repeat may be required for pathogenicity in citrus. xiv


CHAPTER 1 INTRODUCTION Citrus Citrus is one of the major fruit crops in the world. It is thought to have originated in Southeast Asia and India. Citrus was introduced into the new world in the 16 th century by Spanish and Portuguese explorers (Allen, 2000). World production of citrus is estimated to be about one hundred million metric tons (FAOSTAT data, 2004, http://apps.fao.org ). World citrus production has seen a substantial increase over the last 40 years (Figure 1-1). Major citrus producing countries include the United States, Brazil, China, Argentina, Spain and Mexico (Figure 1-1b). Currently, citrus produced in North and South America account for the majority of citrus production worldwide. Although citrus is mainly grown for the fresh fruit market, large citrus-based juice industries have developed in many countries such as Brazil and the United States. Generally citrus is grown between 40 North and 40 South latitudes where minimum temperatures stay above 20 24 F (Timmer and Duncan, 1999). Citrus is a perennial evergreen with an expected economical production expectancy of about 50 years (Timmer and Duncan, 1999). Originally citrus was grown on its own root system, but now most citrus production plants are grafted onto various rootstocks. Rootstocks are selected for their inherent characteristics that affect production, cold hardiness, salinity tolerance, disease resistance and most importantly compatibility with scion tissue. 1


2 The majority of citrus varieties grown for commercial purposes are in the genus Citrus including grapefruit (Citrus paradisi Macfad), sweet orange (C. sinensis (L.) Osbeck), tangerine/mandarin (C. reticulata Blanco), lemon (C. limon Burm), lime (C. aurantifolia (Christm.) Swingle), pummelo (C. grandis Osbeck) and citron (C. medica L.). Other citrus relatives that are not in this genus are kumquats (Fortunella spp.) and trifoliate orange (Poncirus trifoliata). The latter is used only as a rootstock. Florida Citrus Total citrus production in the U.S. in 2004 is estimated at 16.2 million tons with an estimated value of $ 2.4 billion (USDA, 2004). States that produce citrus include Florida, California, Texas, Arizona, Alabama, Mississippi and Louisiana. Florida produces about 80% of the U.S. citrus, of which 20% 25% is sold for fresh fruit consumption. In 2004, Florida produced 242 million boxes of oranges and 40.9 million boxes of grapefruit (USDA, 2004). Citrus is an important economic crop for the state of Florida, as the worth of the commercial citrus industry in Florida is estimated to be more than $8.5 billion. Diseases play a critical role in limiting citrus production as citrus is mainly grown in the same tropical and subtropical areas that also favor the growth of microorganisms. This provides great challenges to citrus growers since they must balance cost of controlling diseases against lower projected profit margins. An example of a citrus disease that is a serious problem for citrus growers is citrus canker disease. Citrus canker has destroyed many citrus growing areas around the world. Florida authorities are putting major resources towards completely eradicating this disease. It is important to gain a better understanding of this disease because of the quarantine of citrus canker as a


3 pest. Citrus canker it is still spreading, despite $50 million spent between 1996 and 1999 in eradication efforts (Schubert et al., 2001). Citrus Canker Citrus canker is one of the major disease problems facing citrus producers in Florida and many areas of the world (Danos et al., 1981; Elgoorani, 1989; Gottwald et al., 2001). Citrus canker, also known as bacterial canker, has destroyed large areas of citrus production (Fegan et al., 2004; Schubert et al., 2001). The pathogen is thought to have originated in Southeast Asia, from where it has spread to other citrus producing areas. Asiatic citrus canker was introduced into the United States for the first time in 1912 from infected nursery material. It took approximately 20 years to eliminate this outbreak of citrus canker (Loucks and Florida. Division of Plant Industry., 1934). In 1986, citrus canker reappeared for the second time in both residential and commercial areas around Tampa, Florida. As a result of this outbreak a new citrus canker eradication program was initiated (Brown, 2001). Eight years later, Florida declared it had eradicated citrus canker at a cost of $27 million (Agrios, 1997). Citrus canker reappeared for the third time in Florida in 1995 in Dade County, and has resulted in the destruction of more than four million trees in both residential and commercial areas (FDACS data, 2005). Figure 1-2 shows the status of citrus canker disease in the state of Florida in 2004. Currently, citrus canker has been detected in 20 Florida counties. The total area under quarantine is estimated at 1,397.82 sq. miles (FDACS data, 2005, www.doacs.state.fl.us). Strong regulatory and quarantine measures were implemented in the latest effort to eradicate the disease. Healthy citrus trees anywhere within a radius of 1900 ft from infected trees are deemed exposed and are destroyed (Gottwald et al., 2002).


4 Citrus canker is caused by several pathogenic variants of Xanthomonas citri. In general, five different groups of pathogenic variants are recognized: A, B, C, A* and A w (Gabriel et al., 1989; Stall et al., 1982; Verniere et al., 1998). In the literature two other groups of citrus canker are described: D and E strains. Although there is a single extant D strain that was reported in Mexico, it is thought that the fungal pathogen Alternaria limicola was responsible for that disease outbreak (Schubert et al., 2001). The E strain group was found in grapefruit only in nurseries in Florida and was described as a new form of citrus canker. However, strains in this group do not cause hyperplasia and do not infect fruit or mature citrus in groves. The disease is now recognized as distinct from citrus canker and was named citrus bacterial leaf spot caused by Xanthomonas axonopodis pv. citrumelo Citrus canker symptoms appear after the pathogen enters the leaves through the stomata or wounds and multiplies in the intercellular spaces of the spongy mesophyll (Gottwald et al., 1988; 1989; Graham et al., 1992; Pruvost et al., 2002). The initial symptom is the formation of water-soaked tissue followed by growth of yellow halos on the infection margins. As the disease progresses, erumpent necrotic lesions are formed on leaves, stems and fruits (Figure 1-3). At advanced disease stages, plants defoliate and fruit can drop prematurely. At the microscopic level, infected cells divide (hyperplasia) and enlarge (hypertrophy); and the pustules rupture the surface of the leaf tissue and release bacteria that become a source of inoculum for further infections (Swarup et al., 1991). The citrus canker bacterium is transmitted by wind-blown rain, although machinery, animals and humans can also transmit it (Bock et al., 2005; Danos et al.,


5 1984). An important factor that contributed to the spread of citrus canker in this last infection in Florida was the Asian citrus leaf miner Phyllocnistis citrella (Cook, 1988). The leaf miner is probably not a vector for canker, but instead it provides wounds that allow entry of bacteria into citrus leaves (Belasque et al., 2005). Although citrus canker does not cause systemic damage, it results in reduced marketability of citrus fruit especially those produced for the fresh market. Resistance to Citrus Canker Citrus genotypes show differences in susceptibility to this disease. Grapefruit, sweet orange and Mexican lime are highly susceptible. Sour orange, lemon and tangelo are moderately susceptible, whereas mandarin, citron and kumquat are less susceptible (Schubert et al., 2001). It is not clear if resistance in citrus is a result of active defense responses or if it is due to physical characteristics of different citrus genotypes, e.g. number of stomata or thickness of the leaf tissue that may influence the number of bacterial particles entering citrus leaves (Goto, 1969; McLean and Lee, 1922). Controlling Citrus Canker The most effective control of citrus canker is application of strict regulatory and quarantine measures that will protect against the introduction of new infections (Graham et al., 2004). Most citrus producing areas put many resources into monitoring and regulating citrus canker. That is because it is so difficult to eliminate the bacteria once it has become established. Once the disease is established in an area, eradication of both infected and exposed trees and burning plant material are used to help eliminate and prevent spread of disease. Multiple applications of copper based compounds were found to help control the disease to some extent (Hwang, 1949). In some cases pruning infected branches is used to control and eliminate the source of infection. Since citrus canker


6 spreads by wind driven rain, wind brakes were found to be useful in controlling this disease (Gottwald and Timmer, 1995). Objectives The aim of this study was to identify host range determinants of canker causing strains. I was interested in identifying genes that are necessary for increasing the host range of canker causing strains of X. citri. These new strains that are limited in host range were used to screen for genes involved in host range determination. Further understanding of how host range is determined may provide important tools in developing control measures. The specific objectives of this work include the following: Objective 1. Characterizing canker causing Xanthomonas citri A* and A w group strains. Objective 2. Attempting to identify and characterize positive host range factor(s) in canker causing Xanthomonas citri. Objective 3. Isolating pathogenicity gene (pthA) homologs from A* and A w groups and characterize their role in host range determination.


7 19%13%12%6%6%4%4%3%3%2%2%2%2%2%1%1%1%1%14% Brazil USA China Mexico Spain India Iran Nigeria Italy Egypt Argentina Turkey Pakistan South Africa Japan Greece Morocco Thailand others 020406080100120Millions of tons 196119651970197519801985199019952000year A B Figure 1-1. World citrus production. A. world citrus production between 1961 2000 expressed in metric tons. B. Percent production by countries (FAOSTAT data, 2004, http://apps.fao.org ).


8 Figure 1-2. Status of citrus canker disease in the state of Florida. (FDACS data, 2005, www.doacs.state.fl.us)


9 Figure 1-3. Citrus canker symptoms in citrus. Citrus canker symptoms on leaves, fruit and stem. At advanced disease stages, plants defoliate and fruit can drop prematurely.


CHAPTER 2. USE OF TWO DIFFERENT CITRUS HOSTS TO DISTINGUISH ALL FORMS OF CITRUS CANKER DISEASE Introduction Citrus canker disease is caused by several different pathogenic variants of Xanthomonas citri (ex Hasse) (Brunings and Gabriel, 2003; Gabriel et al., 1989). Although the taxonomy of these strains is controversial (Gabriel et al., 1989; Vauterin et al., 1995), five groups of pathogenic variants are recognized, based primarily on field symptoms: A, B, C, A* and A W (Gabriel et al., 1989; Stall et al., 1982; Sun et al., 2004; Verniere et al., 1998). The Asiatic (A) group (X. citri pv citri A) is the most severe and widely spread throughout the world. The B and C groups (X. citri pv aurantifolii B and C), which are also known as cancrosis B and cancrosis C, respectively, have been found only in South America. These South American groups are phylogenetically distinct and grow more slowly on artificial media than strains from all other groups (Brunings and Gabriel, 2003; Goto, 1969; Stall et al., 1982). The B and C strains also have a reduced host range compared to the A group. In addition, the C strains elicit an hypersensitive response (HR) in grapefruit (Citrus paradisi) (Stall et al., 1982). Recently two new variants of the A group of citrus canker strains were identified and designated A* and A w (Sun et al., 2004; Verniere et al., 1998). Both new groups are limited in host range to Key/Mexican lime (C. aurantifolia); the A w strain causes an HR when inoculated in grapefruit at high concentrations (Sun et al., 2004). The A* and A w strains of X. citri are phylogenetically most closely related to the A group (Cubero and Graham, 2002) 10


11 Various diagnostic aids have been used to confirm citrus canker disease, including PCR (Cubero and Graham, 2002; Mavrodieva et al., 2004), antibodies (Alvarez et al., 1991) and microscopy. These tests can be critical if the disease appears in regions where it has not previously been seen or has not been recently observed. Indeed, a fungal disease was misdiagnosed as citrus canker disease in Mexico (Stapleton, 1986; Stapleton and Garza-lopez, 1988), and a bacterial leaf spot disease was misdiagnosed as citrus canker in Florida in 1984 (Schubert et al., 1996). Once confirmation of citrus canker disease has been made, only host range tests can be used to reliably determine the strain group or pathovar. Historically, these studies relied on sweet orange, mandarin orange, lemon, lime and grapefruit (Stall and Civerolo, 1991). In this study, we report the use of Duncan grapefruit and Mexican lime as differential hosts to differentiate strains from all variant groups of citrus canker disease. Material and Methods Strains, Plasmids and Culture Media Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are listed in Table 2-1 along with their relevant characteristics and source or reference. E. coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al. 1989). Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS) medium at 30 C as described by Gabriel et al. (1989). Antibiotics were used at the following final concentrations (g/ml): rifampin (Rif), 75; spectinomycin (Sp), 35. Recombinant DNA Techniques Xanthomonas total DNA was prepared as described by Gabriel and De Feyter (1992) and also using Amersham Biosciences DNA Isolation Kit as described by the


12 manufacturer. Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al., 1989) and Xanthomonas (Defeyter and Gabriel, 1991). QIAGENs QIAprep and plasmid midi kits were also used to isolate plasmid DNA from E. coli and Xanthomonas as described by the manufacturer. Southern hybridizations were performed using nylon membranes as described (Lazo and Gabriel, 1987). Plant Inoculations Duncan grapefruit and Mexican lime plants were grown and maintained under natural light in the quarantine greenhouse facility at the Division of Plant Industry, Florida Department of Agriculture, in Gainesville. Temperatures in this greenhouse ranged from 25 C to 35 C, with 50 % to 100 % relative humidity. All inoculations were carried out in this facility. Liquid cultures of the tested strains were grown in PYGM medium at 30 C for approximately 24 hr. Cultures were centrifuged @ 1000g for 3 min and cells resuspended in equal volumes of sterile tap water (saturated with CaCO 3 ) and infiltrated into the abaxial surface of young, freshly flushed partially expanded citrus leaves at two concentrations (10 5 cfu/ml for low and 10 8 cfu/ml for high levels) using the blunt end of tuberculin syringe as described (Gabriel et al., 1989). Observations were taken 5-10 days after inoculation. In vitro Growth Kinetics Liquid cultures of X. citri 3213, B69, Xc270 and X0053 were prepared in PYGM medium and grown at 37 C overnight with slow shaking. The following day, 100 ml of fresh PYGM was inoculated with 50 l of the starter culture. Optical density (OD 600 ) readings were taken at 0, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 and 38 hr. This experiment was repeated three times.


13 In planta Growth Kinetics For bacterial cell counts, whole leaves were infiltrated as described. For each strain, three leaves of each host were infiltrated. Bacterial cell counts from the inoculated leaves were taken at days 0, 1, 6, 10 and 14. A number 7 cork borer (about 1 cm 2 ) was used to cut one leaf disk from each inoculated leaf per time point. Each treatment, a leaf disk from each of the three inoculated leaves was placed in a mortar and pestle and macerated together (in 1 ml sterile tap water saturated with CaCO 3 ). Once homogeneity was obtained, ten-fold serial dilution were made ranging from 10 -1 to 10 -9 Ten microliters droplets of each dilution were spread on PYGM plates without antibiotics and allowed to grow for 48 hr at 28 C. Colonies were counted from the most readily scored dilution, and the number of cfu per cm 2 of leaf tissue was calculated. The experiments were repeated three times. Populations were expressed as log cfu/cm 2 of leaf tissue. Results Pathogenicity Phenotypes of X. citri Strains In addition to the previously described A (3213), B (B69) and C (Xc340) strains, newly described A* (Xc205, Xc270, Xc280, Xc290, Xc322 and Xc406) and A w (X0053) strains (Sun et al., 2004; Verniere et al., 1998) were inoculated on citrus. All strains tested caused hyperplastic lesions in Mexican lime that developed 59 days after inoculation (Figure 2-1). In Duncan grapefruit (Citrus paradisi) differential reactions were observed that distinguished each group. Strains from group A elicited typical canker symptoms in grapefruit within 6 days, but B strains elicited a whitish canker phenotype within 10 days. C and A w strains elicited a hypersensitive response (HR) in grapefruit. The A* strains, which were originally isolated from Southwest Asia, also gave distinct phenotypes in Duncan grapefruit (Figure 2-2). Strains Xc205 and Xc322


14 did not elicit canker symptoms at low concentration (10 4 cfu/ml). Strain Xc406 elicited a weak canker at low concentration, but when inoculated at high concentration, elicited typical canker lesions. Strains Xc270, Xc280 and Xc290 did not elicit canker in Duncan grapefruit at either low or high inoculum concentrations. A* strains could be subdivided into three groups; A*-1, A*-2 and A*-3 (Figure 2-2). Table 2-2 summarizes symptoms of different X. citri groups on grapefruit and lime. In vitro Growth In vitro growth of X. citri strains in liquid medium was measured by optical density (OD 600 ) changes recorded over time (Figure 2-3). Strains 3213 (A), X0053 (A w ) and Xc270 (A*) were very similar in their growth in PYGM medium. B69 (B) strain was significantly slower in its growth compared to A, A w and A* strains. On agar plates, the South American B and C strains grew similarly on a variety of media, and always slower than the A, A w and A* strains. Growth Kinetics in planta Growth kinetics of X. citri strains 3213 (A), 270 (A*) and X0053 (A w ) were studied in Duncan grapefruit and Mexican lime leaves. In Mexican lime, growth of all three strains was similar (Figure 2-4). However the growth kinetics of these strains was different in Duncan grapefruit (Figure 2-4). Growth of the A w strain X0053 was reduced by one order of magnitude as compared to A strain 3213. This reduction in growth was noticeable 6 days post-inoculation and continued through day 14 when the comparison ended. Growth of A* strain 270 was reduced by at least two orders of magnitude after 6 days post-inoculation as compared to strain 3213. Strain 270 did not continue to increase after 6 days growth in planta.


15 Discussion Inoculation of different X. citri strains on just two citrus host species allowed the differentiation of all known X. citri groups based on their symptoms. All tested strains of X. citri caused canker in Key/Mexican lime. Lime is a very susceptible host compared to other citrus species or types. The B and C strains elicited a characteristic whitish canker in key/Mexican lime that is readily distinguished from canker symptoms caused by other strains. This is probably due to the fact that both strains are phylogeneticlly very similar and likely share common pathogenicity factors. Indeed, the pathogenicity elicitors pthB and pthC from the B and C strains were found to be closely related to each other (98% similarity) at the amino acid level and different from pthA homologues from A, A* and A w strains. The latter were closely related to each other (Chapter 4). Strains from different groups of X. citri exhibited quite different phenotypic responses when inoculated in Duncan grapefruit leaves. Except for the A and B groups, which elicited typical canker symptoms, strains from all other groups appeared much less virulent. X0053 from the A w group elicited necrotic symptoms in grapefruit that took 5 to 10 days to appear. Unlike the A W strain, the C group strain C340 elicited a relatively fast HR reaction in grapefruit that took only 3 days to appear. In both cases, the necrosis and HR, potential avr gene function is indicated. The A* group showed the most within-group variation among strains in grapefruit; all A* strains were characterized by reduced virulence as compared to A and B strains and lacked any evidence of eliciting necrosis or an HR. Strains Xc205 and Xc322 were only capable of causing canker in Duncan grapefruit when inoculated at high concentrations (10 8 -10 9 cfu/ml). At (lower) concentrations that more closely resemble field conditions, no canker symptoms were observed with these strains. Strain Xc406 elicited a very weak canker phenotype when


16 inoculated at low concentration, but elicited normal canker symptoms when artificially inoculated at high concentrations. Strains Xc270, Xc280 and Xc290 were not able to elicit canker in grapefruit leaves at either concentration. All tested A* strains were unable to cause canker at low inoculum concentrations or an HR at high concentrations. In planta growth kinetics of strains representing the fast growing A, A* and A w groups showed interesting differences (Figure 2-4). All three strains appeared to grow similarly to each other in Mexican/Key lime. Asiatic strain 3213 inoculated in Duncan grapefruit grew to levels similar to those seen in lime. A w strain X0053, which elicits necrotic symptoms in grapefruit, grew to a final level that was only one log lower than strain 3213. A* strain Xc270, which does not cause canker or HR in grapefruit, was unable to grow well in grapefruit, increasing only 2 logs after inoculation and grew to a final level that was more than two logs lower compared to strain 3213. It is possible that A* strains carry an avr gene that specifically triggers grapefruit defenses, but without an HR. An HR is not always observed with gene-for-gene resistance (Bendahmane et al., 1999; Goulden and Baulcombe, 1993; Jurkowski et al., 2004; Lehnackers and Knogge, 1990; Ori et al., 1997; Schiffer et al., 1997; Yu et al., 2000). Indeed, a Xanthomonas avr gene that elicits host defense without an HR was recently reported (Castaneda, 2005). An alternative explanation is that this group is missing a factor or perhaps factors that are specifically required for growth in grapefruit, such as the extracellular polysaccharides (EPS) and lipopolysaccharides (LPS) that are needed by X. axonopodis pv. citrumelo for virulence on citrus (Kingsley et al., 1993). Only further experimental testing can distinguish between these explanations.


17 Although five different citrus host species have traditionally been used to distinguish pathovars of X. citri, all known groups can be readily distinguished by inoculation of only two host differentials, lime and grapefruit. Even if positive control cultures are not available, if low inoculations are used, then: 1) only the A strains elicit green cankers in both lime and grapefruit; 2) only the B strains elicit whitish cankers in lime and grapefruit; 3) only the C stains elicit whitish cankers in lime and an HR in grapefruit; 4) only the A* strains elicit green canker in lime and at best very weak cankers in grapefruit, and 5) only the A w strains elicit green cankers in lime and an HR in grapefruit.


18 Table 2-1. Bacterial strains and plasmids used in this study Strain or plasmid Relevant Characteristics Reference or source Escherichia coli DH5 F endA1, hsdR17(r k m k ), supE44, thi-1, recA1 Gibco-BRL Xanthomonas citri 3213 Group A, wild type Gabriel et al. 1989 3213Sp Spontaneous Sp r derivative of 3213, Sp r Gabriel et al. 1989 B21.2 pthA::Tn5-gusA, marker exchanged mutant of 3213Sp, Sp r Kn r Swarup et al. 1991 B69 Group B, wild type Stall et al. 1982 B69Sp Spontaneous Sp r derivative of B69, Sp r El Yacoubi, 2005 C340 Group C, wild type Stall et al. 1982 Xc205 Group A*, wild type Verniere et al. 1989 Xc205Rif Spontaneous Rif r derivative of Xc205, Rif r This study Xc270 Group A*, wild type Verniere et al. 1989 Xc270Rif Spontaneous Rif r derivative of Xc270, Rif r This study Xc280 Group A*, wild type Verniere et al. 1989 Xc290 Group A*, wild type Verniere et al. 1989 Xc322 Group A*, wild type Verniere et al. 1989 Xc406 Group A*, wild type Verniere et al. 1989 X0053 Group A w wild type Sun et al. 2004 X0053Rif Spontaneous Rif r derivative of X0053, Rif r This study


19 Table 2-2. Phenotypic differences among X. citri strains. Mexican Lime Grapefruit Strain Low (10 4 -10 5 ) cfu/ml High (10 8 -10 9 ) cfu/ml Low (10 4 -10 5 ) cfu/ml High (10 8 -10 9 ) cfu/ml A C a C C C B Wt C b Wt C Wt C Wt C C C C HR c HR A* -1 C C 0 d C A* -2 C C WC e C A* -3 C C 0 0 A w C C 0 HR a=canker, b= white canker, c=Hypersensitive response, d=no canker and e=weak canker


20 Figure 2-1. Inoculation of strains of different citrus canker groups in grapefruit and key lime. A and B strains are able to cause canker in both hosts. A* and A w strains can only cause canker in Key lime. Note the HR in grapefruit caused by A w


21 322 322 406 222290 fu/ml 10 8 -10 9 c 80 70 05 205 270 280 290 406 406 322 290 280 270 22223445fu/ml 10 -10 c 06 22 90 80 70 05 205 Figure 2-2. Inoculation of several different A* strains in Duncan grapefruit. High (left) and low (right) concentrations of bacteria were used for inoculation.

PAGE 36 (hr) 3213 B69 Xc270 X0053 22 Figure 2-3. Growth of X. citri strains in PYGM medium. A strain 3213, A* strain Xc270, A strain X0053 and B strain B69 were used in this comparison. w


23 012345678910061014Days after inoculation 3213-KL Xc270-KL X0053-KL 0123456789061014Days post inoculati o 3213-GF Xc270-G F X0053-G F B A Figure 2-4. in planta growth of X. citri strains in A) Mexican/Key lime and B) Duncan grapefruit. A strain 3213, A* strain Xc270 and A w strain X0053 were used.


CHAPTER 3 IDENTIFICATION AND CHARACTERIZATION OF HOST RANGE FACTOR(S) IN CITRUS CANKER STRAINS. Introduction Both positive and negative genetic factors have been found to affect the host range of phytopathogenic bacteria. For example, a given Rhizobium species can only nodulate a restricted number of hosts, and this specificity is determined by specific signal molecules that are exchanged between the bacteria and host plants (Fisher and Long, 1993; Kondorosi et al., 1991). Some of the host specific nodulation genes needed to actively condition the host range include NodD, NodZ, NodW, NolA and NodC (Kamst et al., 1997). Some negatively acting factors have also been found in some rhizobia and these have avirulence (avr) function in some hosts. For example, nodFE of R. leguminosarum bv trifolii, which is virulent in white and red clover, condition avirulence in pea (Djordjevic et al., 1987), and nodQ and nodH were found to confer avirulence to R. l. bv. trifolii and R. l. bv. viceae in their respective hosts, white clover and common vetch (Debelle et al., 1988; Faucher et al., 1989). Agrobacterium tumefaciens and A. rhizogenes generally have a wide host range that includes most dicotyledonous plants. Host range in A. tumefaciens is thought to be generally determined by positive factors; however some negative factors of host range determination have also been found (Keen, 1990). For example, certain virulence (vir) genes on the Ti plasmid condition host range. Progressive deletions of the 3 end of virE were found to progressively reduce the number of plant species on which crown galls are 24


25 formed. virG from supervirulent A. tumefaciens strain extends the host range of certain Agrobacterium strains (Chen et al., 1991; Hood et al., 1986). On the other hand virA and virC appear to act as negative regulators of host range in grapevine. virA is involved in detection of host specific phenolics compounds. virC was shown to act as an avr gene to trigger host defenses in incompatible interactions and thus limit the number of plants A. tumefaciens can infect (Yanofsky et al., 1985; Yanofsky and Nester, 1986). Strains of the genus Xanthomonas are always found associated with plants. Different xanthomonads attack a very wide range of plant species. However, individual species show limited host range (Gabriel, 1999b). Members of this genus are divided into species and pathovars, based on phylogeny, host range and disease symptom variation. The molecular basis of host range determination at the pathovar level is not well understood. Azad and Kado (1984) showed that elimination of the HR in tobacco to Erwinia rubrifaciens did not increase the host range of this pathogen to include tobacco. Similarly, Swarup et al (1992) showed that elimination of the nonhost HR did not extend the host range of X. citri. Factors that positively enhance the host range of Xanthomonas include the extracellular polysaccharide (EPS) and lipopolysaccharide (LPS); the opsX locus is involved in the biosynthesis of EPS and LPS, and is also needed by X. axonopodis pv. citrumelo for virulence in citrus (Kingsley et al., 1993). Other positive factors that could influence the host range of pathogens are suppressors of host defenses (Ponciano et al., 2003). For example, HopPtoD2, from Pseudomonas syringae, was found to suppress programmed cell death in plants resulting in infection (Bretz et al., 2003; Espinosa et al., 2003; Hauck et al., 2003). Similarly, Abramovitch et al. (2003) found that the P. syringae effector, AvrPtoB, induced plant


26 disease susceptibility by preventing a programmed cell death response from occurring in tobacco plants. These results suggest that bacterial host range is determined by positive and negative acting factors. This chapter describes attempts to identify host range determinants of X. citri. A virulence enhancement approach (Swarup et al., 1991) was used in an attempt to identify positive factor(s) required to increase host range of a narrow host range, A* strain Xc270, to include grapefruit. Material and Methods Bacterial Strains, Plasmids and Culture Media Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are listed in Table 3-1 along with their relevant characteristics, source and/or reference. E. coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al., 1989). Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS) medium at 30 C as described (Gabriel et al.1989). Antibiotics were used at the following final concentrations (g/ml): rifampin (Rif), 75; spectinomycin (Sp), 35; ampicillin (Ap), 100; gentamycin (Gm), 5. Recombinant DNA Techniques Xanthomonas total DNA was prepared as described by Gabriel and De Feyter (1992). Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al. 1989) and Xanthomonas (De Feyter and Gabriel 1991). Restriction enzyme digestion was performed as recommended by the manufacturers. Southern hybridization was performed by using nylon membranes as previously described (Lazo et al., 1987).


27 Vector Preparation To identify genes involved in determining the host range of X. citri pv citri, genomic DNA from the wide host range X. citri pv citri A strain 3213 was partially digested with MboI and size fractioned on a sucrose gradient. Cosmid vector pUFR43 was used to make a DNA library of 3213 DNA fragments. This cosmid vector (Defeyter et al., 1990) was split into two pools and cut with either EcoRI or SalI restriction enzyme to produce the two arms and then treated with shrimp alkaline phosphatase. To create common cloning ends the arms were then cut with BamHI and used for ligations to the 20 25kb 3213 DNA fraction (Figure 3-1 and 3-2). Packaging and Transfection The recombinant DNA was packaged using stratagene packaging mix (Gigapack III Gold Packaging Extract), and introduced into E. coli strain DH5(mcr) via transfection as described by the manufacturer protocol. Positive white plaques were then picked and placed onto LB plates containing the antibiotic Kanamycin (20 g/l). Using a 48 pin replicating fork, these colonies were transferred into 96 well microtiter plates containing liquid LB (with 14% glycerol) and stored at C. At the same time a replicate of each plate was made and maintained by replicating each plate once every month. DNA from eighteen randomly selected library clones was extracted and digested with BamHI and electrophoresed on agarose gels in order to estimate insert size and evaluate the quality of the library. The total number of cosmid clones required to cover the entire 3213 genome (N) was determined using the following formula (Clarke and Carbon, 1976):


28 N I n(1 0.99)In1insert sizeTotal genome size Plant Inoculations Duncan grapefruit and Mexican lime plants were grown and maintained under natural light in the quarantine greenhouse facility at the Division of Plant Industry, Florida Department of Agriculture, Gainesville, Fl. Temperatures in this greenhouse ranged from 25C to 35 C with 50% to 100% relative humidity. All inoculations were carried out in this facility. Liquid cultures of all tested strains were grown in PYGM medium at 30 C for approximately 24 hr. Cultures were centrifuged and resuspended in equal volumes of sterile tap water (saturated with CaCO 3 ) and pressure infiltrated at appropriate concentrations (10 5 for low and 10 8 cfu/ml for high) into the abaxial surface of citrus leaf using the blunt end of tuberculin syringes. Observations were taken 5-10 days after inoculation. For screening of large numbers of clones, colonies were streaked onto PYGM agar plates incubated at 30 C for approximately 24 hr, resuspended in sterile tap water (saturated with CaCO 3 ) and pressure infiltrated into citrus as described. Triparental Matings To transfer the 3213 library to the limited host range Xc270 (A*) strain, triparental matings were performed as described by Defeyter et al (1990). Strain pRK2073 was used as a helper strain. The recipient was concentrated 50 100 fold. Transconjugants were screened on PYGM plates containing Rif 75l g/ml and Gm 3l g/ml at 28 C and 2-3 days later colonies were transferred onto new selection plates.


29 Results Xanthomonas citri pv citri A 3213 Strain Genomic Library A genomic library of X. citri pv citri A, strain 3213, was made and 18 randomly picked clones were evaluated for insert size and pattern (Figure 3-3). All 18 clones gave different restriction patterns indicating random insertions in the vector. The average size of the inserts was 39 kb. Based on the Clark and Carbon formula (Clarke and Carbon, 1976), 610 clones were required to cover the whole X. citri 3213 genome with 99% probability. Seven hundred and fifty clones were maintained in E. coli strain DH5 and stored in 15% glycerol at -80 C. Screening of 3213 Library in Xc270 Five hundred and fifty clones were transferred from the 3213 library into X. citri pv. citri A*-3 strain Xc270 by triparental mating and transconjugants were individually screened for symptoms in Duncan grapefruit. No clones were identified that consistently increased the pathogenicity of Xc270. Discussion Attempts to identify positive host range determinants from X. citri were unsuccessful when a library from the wide host range group A strain 3213 was moved into the narrow host range group A* strain Xc270. Initially six clones (pAW377, pAW378, pAW380, pAW400, pAW413 and pAW419) seemed to elicit canker-like symptoms in Duncan grapefruit, but when those clones were re-conjugated into Xc270, the initial results were not confirmed. The in planta growth of Xc270 described in chapter 2 showed that the Xc270 grew poorly in Duncan grapefruit, suggesting that the only clones that would complement Xc270 and cause canker in grapefruit would be those that would increase growth. It is likely that in planta growth requires multiple effectors,


30 and that no individual cosmid would carry enough factors to reveal a strong difference. Another possibility is that Xc270 may carry avr genes that function in grapefruit and prevent Xc270 from growing. Avirulence is usually epistatic over virulence and therefore a screen for positive factors would fail if this were the case. Perhaps a better approach would be to construct a library of Xc270 DNA and screen in 3213 in order to identify any avirulence gene function.


31 Table 3-1. Strains and plasmids used in this study Strain or plasmid Relevant Characteristics Reference or source Escherichia coli DH5 F endA1, hsdR17(r k m k ), supE44, thi-1, recA1 Gibco-BRL Xanthomonas citri 3213 Group A, wild type Gabriel et al. 1989 3213Sp Spontaneous Sp r derivative 3213, Sp r Gabriel et al. 1989 B21.2 pthA::Tn5-gusA, marker exchanged mutant of 3213Sp, Sp r Kn r Swarup et al. 1991 Xc270 Group A*, wild type Verniere et al. 1989 Xc270Rif Spontaneous Rif r derivative of Xc270, Rif r This study Plasmid pRK2013 ColE1, Km r ,Tra + helper plasmid Figurski and Helinski, 1979 pRK2073 pRK2013 derivative,npt::Tn7, Km s Sp r ,Tra + helper plasmid Leong et al. 1982 pURF043 IncW, Mob + lacZ + Gm r Nm r cos, shuttle vector De Feyter and Gabriel, 1991 pAW377 Fragment from X. citri 3213 library cloned in pUFR43 This study pAW378 15 kb fragment from X. citri 3213 library cloned in pUFR43 This study pAW380 Fragment from X. citri 3213 library cloned in pUFR43 This study pAW400 Fragment from X. citri 3213 library cloned in pUFR43 This study pAW413 24 kb fragment from X. citri 3213 library cloned in pUFR43 This study pAW419 Fragment from X. citri 3213 library cloned in pUFR43 This study


32 E=EcoRIEEEEEB=BamHIEEBBBBBBEES=SalISBSSSSSSSScoscoscosSalIEcoRIPhosphotaseBamHImix******pUFR43Phosphotase E=EcoRIEEEEEB=BamHIEEBBBBBBEES=SalISBSSSSSSSScoscoscosSalIEcoRIPhosphotaseBamHImix******pUFR43Phosphotase headsTransfect E. coliEESSSS*EMboIEBBBB MboI***Ligase headsTransfect E. coliEESSSS*EMboIEBBBB MboI***Ligase + inserts Figure 3-1. Scheme for cosmid vector preparation and DNA cloning. 32


33 A 4.3kb 23kb 6.5kb 9.4kb 23kb B Figure 3-2. DNA fractionation. A). Partial digestion of X. citri 3213 genomic DNA (0.7% agarose gel). B) Size fractionation of MboI partial digest of 3213 DNA (0.7% agarose gel).


34 Figure 3-3. Restriction profiles of random clones from X. citi 3213 genomic library. DNA was digested with EcoRI. As a merker, DNA digested with HindIII (M). 2.0 kb 2.3 kb 4.3 kb 6.5 kb 9.4 kb 23 kb 1 3 2 5 M M 6 7 8 11 12 13 17 18 10 16 9 14 4 15


CHAPTER 4. SEQUENCE COMPARISON AND CHARACTERIZATION OF FIVE NEW pthA HOMOLOGS FROM FOUR DIFFERENT Xanthomonas citri STRAINS. Introduction All strains of Xanthomonas citri cause hyperplastic pustules in citrus that are dignostic of citrus canker disease (Gabriel, 2001). The Asiatic (A) group (X. citri pv citri A) has the widest host range and is widespread throughout the world. The B and C groups (X. citri pv aurantifolii B and C) have only been found in South America and have a reduced host range compared to the A groups (Stall and Seymour, 1983). New groups of X. citri pv citri (A w from Florida and A* from Southwest Asia) were more recently identified that are primarily restricted in host range to Mexican lime (Citrus aurantifolia) (Stall et al., 1982b; Sun et al., 2004). Grapefruit (C. paradisi) serves as a differential host that is resistant to the A*, A w and C strains; the A w and C strains elicit a strong hypersensitive response (HR) in grapefruit, while some A* strains show reduced growth in grapefruit (Chapter 2). The molecular basis for avirulence of the A*, A w and C strains in grapefruit and the wide host range of the A strains is unknown. Pathogenicity gene pthA encodes the primary causal effector of the citrus canker disease phenotype (Duan et al., 1999; Swarup et al., 1991; Swarup et al., 1992). All strains of X. citri tested carry pthA homologs (Cubero and Graham, 2002; Mavrodieva et al., 2004). pthA is capable of conferring ability to cause canker-like symptoms to strains that cannot otherwise cause canker, such as X. campestris pv citrumelo (Swarup et al., 1991) or even E. coli carrying a functional hrp system (Kanamori and Tsuyumu, 1998). 35


36 When pthA is transiently expressed in citrus using either Agrobacterium tumefaciens or particle bombardment, small canker-like lesions are elicited (Duan et al., 1999). pthA is the first member of the avrBs3/pthA gene family demonstrated to function for pathogenicity. The vast majority of cloned or described Xanthomonas avirulence genes belong to this family; many have demonstrated pathogenicity functions (Leach and White, 1996). Members of this gene family show very high levels of homology at the DNA sequence level (De Feyter et al., 1993; Hopkins et al., 1992; Leach and White, 1996; Yang et al., 2000). All members encode more than 11 nearly perfect, 34 amino acid, leucine rich, tandemly arranged, direct repeats. Swapping repeat regions between members of the gene family results in chimeric genes that confer the pathogenicity and/or avirulence phenotypes expected from the source genes (Herbers et al., 1992; Yang et al., 1994). Although pthA can confer avirulence to other xanthamonads (Swarup et al., 1992), no pthA homolog from X. citri is known to function for avirulence in citrus. Conversely, although the pthA homolog aplI from X. citri pv citri group A has been suggested as a suppressor of the tobaco defense response (Ponciano et al., 2003), no pthA homolog from X. citri is known to suppress citrus host defenses. The purpose of this study was to clone, isolate, sequence and characterize pthA homologs that function to determine pathogenicity from all known X. citri groups. A secondary purpose was to determine if any of these pthA homologs also determined avirulence in grapefruit or could increase the pathogenicity of an A* strain in grapefruit. Material and Methods Bacterial Strains, Plasmids and Culture Media Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are listed in Table 4-1 along with their relevant characteristics and source or reference. E.


37 coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al., 1989). Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS) medium at 30 C as described (Gabriel et al. 1989). Antibiotics were used at the following final concentrations (g/ml): rifampin (Rif), 75; spectinomycin (Sp), 35; chloramphenicol (Cm), 35; ampicillin (Ap), 100; gentamycin (Gm), 5; kanamycin (Kn), 25. Recombinant DNA Techniques Xanthomonas total DNA was prepared as described (Gabriel and De Feyter, 1992). Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al., 1989) and Xanthomonas (De Feyter and Gabriel, 1991). Southern hybridization was performed by using nylon membranes as described by Lazo and Gabriel (1987). DNA Library Construction Genomic DNA from the wide host range Xanthomonas citri pv citri group A strain 3213 was partially digested with MboI and size fractioned on a sucrose gradient. The cosmid vector pUFR43 was used to make a DNA library of 3213 DNA fragments. This cosmid vector was split into two pools and cut with either EcoRI or SalI restriction enzyme to produce the two arms and treated with shrimp alkaline phosphatase. To create common cloning ends, the arms were then cut with BamHI and used for ligations to the 20 25kb 3213 DNA fraction. Recombinant DNA was packaged using Stratagene packaging mix (Gigapack III Gold Packaging Extract), and introduced into E. coli strain DH5 via transfection as described by the manufacturer protocol. Positive white plaques were then picked and placed onto LB plates containing the antibiotic Kn (20 g/l). Colonies were transferred into 96 well micro titer plates containing liquid LB


38 (with 14% glycerol) and stored at C. DNA from eighteen randomly selected library clones was extracted, digested with BamHI and run on agarose gels in order to estimate insert size and evaluate the quality of the library. Plant Inoculations Duncan grapefruit and Mexican lime plants were grown, maintained and inoculated under natural light in the quarantine greenhouse facility at the Division of Plant Industry, Florida Department of Agriculture in Gainesville, Fl. Temperatures in this greenhouse ranged from 25C to 35 C with 50% to 100% relative humidity. Liquid cultures of tested Xanthomonas strains were grown in PYGM at 30 C for approximately 24 hr. Cultures were centrifuged @ 1000g for 3 min at room teperature, and resuspended in equal volumes of sterile tap water (saturated with CaCO 3 ) and pressure infiltrated at appropriate concentrations (10 5 for low and 10 8 cfu/ml for high) into the abaxial citrus leaf surface using the blunt end of a tuberculin syringe. Observations were taken 510 days after inoculation. Southern Hybridization Analysis Genomic DNA from all canker causing strains were isolated as described, digested with either EcoRI or BamHI restriction enzyme and the digested DNA was analysed by electrophoresis on 0.6% agarose gels. DNA was then transferred onto GeneScreen Plus (DuPont, Wilmington, Delaware) nylon membranes as described by the manufacturer. Membranes were hybridized with a 32 P-labeled BamHI internal fragment of pthA. Colony Hybridization Plasmid DNA from A W strain X0053 was digested with EcoRI and KpnI and ligated into shuttle vector pUFR047. Recombinant DNA was transformed into DH5 competent cells, and transformed clones were selected on Ap100 and X-Gal/IPTG in LB


39 agar. White colonies were transferred onto a registry plate and pZit45 was included at specific positions as a control. Plasmid DNA from A* strain Xc270 was digested with EcoRI and HindIII and ligated into shuttle vector pUFR71. Recombinant DNA was transformed into DH5 and selected on Cm35 LB and X-Gal/IPTG plates. White colonies were transferred from registry plates onto Colony/PlaqueScreen hybridization transfer nylon membranes and placed colony side up on plain LB plates and incubated for 24 hr at 37 C. DNA was fixed on membranes as described by the manufacturer and hybridized with a 32 P-labeled BamHI fragment of pthA. Group B strain B69 plasmid DNA was digested with EcoRI, and a 23 kb and a 4.3 kb fragment that hybridized with pthA were cloned in pUFR53 resulting in pQY93.3 and pQY22.1, respectively. A 14kb HindIII fragment within the pQY93.3 EcoRI fragment was subcloned in pUFR53, resulting in pQY96. Group C strain C340 plasmid DNA was digested with SalI, and a 20 kb and a 6 kb fragment that hybridized with pthA were cloned into pUFR53, resulting in pQYC2.1 and pQYC1.1, respectively. The 6 kb insert from pQYC1.1 fragment was cloned into the high copy vector pUC119 resulting in pQY103.5. Triparental Matings Clones that hybridized to pthA were conjugated into Xanthomonas strain B21.2 (pthA::Tn5) by triparental mating as described by Defeyter et al (De Feyter et al., 1990). Strain pRK2073 was used as a helper strain. The recipient strain was concentrated 50 100 fold for higher conjugation rate. 10 l of each recipient, donor and helper were mixed together on PYGM plate and allowed to grow for 6 hr to overnight at 28 C. Transconjugants were screened on PYGM plates containing Sp 35 l g/ml and Gm 5l g/ml at 28 C. Two to three days later colonies were transferred onto new selection


40 plates. Successful transconjugants were infiltrated into Duncan grapefruit and Mexican/Key lime. Southern blot analysis was used to further analyze clones. Marker Integration Mutagenesis The mutants BIM2 (pthB::pUFR004) of B69Sp and CIM1 (pthC::pUFR004) of C340 were created by the integration of pYY40.10 (2.0 kb internal StuI-HincII fragment of pthA in pUFR004), and Cm resistant colonies were selected. Sequence Analysis of pth Genes pthA homologs from A*, A w B and C strains were sequenced using primers based on the sequence of pthA (Swarup et al., 1992) and designed to cover the entire gene. Seven primers were used for sequencing reactions; DG8: gaggtggtcgttggtcaacgc, DG35: agttatctcgccctgatc, DP35: caggtcactgaagctgcccgc, DP36: gcgggcagcttcagtgacctg, DP37: ccgaaggttcgttcgaca, DP38:ctgtcgaacgaaccttcg, DP45: gcatggcgcaatgcactgac, and YP03: tagctccatcaaccatgc. Sequencing was done at the UF ICBR DNA Sequencing Core, Gainesville, FL. When necessary, fragments were cloned into high copy vectors such as pUC119 or pUC19 to obtain larger amounts of DNA. Sequence information of these genes was used to construct the full DNA sequence using Vector NTi software (Invitrogen, Carlsbad, California). Nucleotide and predicted amino acid sequence alignments were carried out with the program CLUSTAL W. Percent amino acid identity was calculated using the needle program in EMBOSS package which uses the Needleman-Wunsch algorithm to do global alignment of sequences. The DNA sequences of pthA1, pthA2, pthA3 and pthA4 (da Silva et al., 2002) were taken from GenBank Accessions # NC_003921, NC_003921, NC_003922 and NC_003922, respectively. The DNA sequences of apl1,apl2 and apl3 (Kanamori and


41 Tsuyumu, 1998) were taken from GenBank Accessions # AB021363, AB021364 and AB021365, respectively. Dendograms showing phylogenetic relationships of these genes were generated with TREECON (version 1.3b) (Van de Peer and De Wachter, 1994) using neighbor-joining algorithm with Poisson correction. RSc1815, an avrBs3/pthA gene from Ralstonia solanacearum was used as an outgroup for phylogenetic tree construction. The percentage of trees from 100 bootstrap resamples supporting the topology is indicated when the percentage is above 70. Results Southern Blot Analysis Southern blot analyses revealed that all tested X. citri strains have at least two BamHI DNA fragments that strongly hybridized to an internal BamHI fragment from pthA (Figure 4-1a; some data not shown). With the exception of group A strains, which had four BamHI fragments that hybridized with pthA, all other strains from all other groups, including the A*, A w B and C groups, had only two such BamH1 fragments. All strains tested appeared to share a 3.4 kb BamHI hybridizing fragment of a size similar or identical to that of pthA. Otherwise, each of the different phenotypic groups exhibited distinct and characteristic banding patterns. Based on the hybridization intensity of both BamHI and EcoRI digested DNA fragments and other results (not shown), the C and A w strains appeared to carry their two hybridizing DNA fragments on a single plasmid (Figure 4-1). Cloning, Characterization and Sequencing of pthA Homologs from X. citri A*, A w B and C Strains Using an internal fragment of pthA as a probe, colony hybridization of E. coli carrying cloned group A w strain X0053 plasmid DNA revealed eight colonies with


42 hybridizing inserts (Figure 4-2). The plasmids from these colonies were designated as pAW5.1 5.8, and all carried hybridizing inserts of identical size (Table 4-1). Four of these inserts were separately introduced into strain B21.2 (pthA::Tn5) and screened for pathogenicity. All four clones complemented the knockout phenotype of B21.2 and restored ability to cause canker in both Duncan grapefruit and Mexican lime (Figure 4-3; Table 4-2). The pthA homolog encoded on pAW5.2 was sequenced and designated pthAW. Similarly, colony hybridization of cloned group A* strain Xc270 plasmid DNA revealed three hybridizing clones, designated as pAW12.1 12.3. The inserts carried on pAW12.1 and 12.2 were identical in size; pAW12.3 was smaller. When transferred to B21.2, pAW12.1 complemented B21.2 and resulted in canker symptoms in both grapefruit and lime (Figure 4-4; Table 4-2). The pthA homolog encoded on pAW12.1 was sequenced and designated pthA*. pAW12.3 did not complement B21.2 in either host (Table 4-2). The pthA homolog from pAW12.3 was sequenced and designated pthA*-2. pthA*-2 carried only 15.5 internal repeats. To verify that the lack of evident activity of pthA*-2 was not due to a cloning artifact, the promoter region and Shine-Dalgarno (SD) sequence were verified to be present on pAW12.3. In addition, no premature stop codons or frame shifts were found in pthA*-2. Colony hybridization of cloned group B strain B69 plasmid DNA revealed several hybridizing clones of two different sizes. Representative clones of both sizes were selected for complementation tests. pQY93.3 (23 kb insert) and pQY22.1 (4.3 kb insert) were mobilized by conjugation into B21.2; only pQY93.3 was found to complement B21.2, resulting in canker symptoms in both grapefruit and lime (Table 4-2). The pthA


43 homolog was subcloned from pQY93.3 on pQY96, verified as functional in B21.2 designated as pthB and sequenced. Finally, colony hybridization of cloned group C strain C340 plasmid DNA revealed several hybridizing clones of two different sizes, and again representative clones of both sizes were selected for complementation tests. pQYC2.1 (20 kb insert) and pQYC1.1 (6 kb) were mobilized by conjugation into B21.2; only pQYC1.1 was found to complement B21.2, resulting in canker symptoms in both grapefruit and lime (Table 4-2). The pthA homolog encoded on pQYC1.1 was designated as pthC and sequenced. Even when inoculated at high concentrations, none of the pthA homologs (pthAW, pthA*, pthA*-2, pthB or pthC) in B21.2 elicited an HR in grapefruit. Inactivation and Complementation of Genes pthB and pthC in X. citri pv aurantifolii In order to determine the role of pthB in the pathogenicity of X. citri pv aurantifolii group B strain B69Sp in citrus, marker integration mutagenesis was carried out. Southern blot analysis showed that pthB had been interrupted in BIM2 (pthB::pUFR004). BIM2 was unable to cause canker (data not shown). BIM2 was fully complemented by pAB2.1, pZit45, pAB18.1 (all carrying pthA), pQY96 (carrying pthB) and pQYC1.1 (carrying pthC) to elicit wild type response in grapefruit and lime (data not shown). In order to determine the role of gene pthC in the pathogenicity of group C strain C340 in citrus, marker integration mutagenesis was carried out. Southern blot analysis showed that pthC had been interrupted in CIM1 (pthC::pUFR004). CIM1 was unable to cause typical canker symptom in lime, but elicited an HR in grapefruit that was as strong as the HR elicited by the wild type strain C340. CIM1 was fully complemented by pZit45 (pthA), pQY96 (pthB) and pQYC1.1 (pthC) to elicit a wild type response in lime (data not shown).


44 None of the pthA Homologs from Group A Strain 3213 Increased the Host Range of Group A* Strain 270 to Include Grapefruit All four pthA homologs from group A strain 3213 were isolated and cloned from the 3213 library by colony hybridization with an internal fragment of pthA: pAW20.2, pAW20.4, pAW20.7 and pAW20.11 carry pthA, pthA1, pthA2 and pthA3, respectively (Figure 4-5). None of these clones complemented B21.2. When these clones were conjugated into the A* strain Xc270, none extended the host range of the strain to include Duncan grapefruit. As with Xc270, all three transconjugants elicited cankers in Mexican lime. When pZit45, which carries pthA from 3213 and complements B21.2 (Swarup et al., 1992), and pAW20.2 were introduced into Xc270, they similarly did not extend the host range of Xc270 to include grapefruit (Figure 4-5). Sequence Analysis of pthA Homologs from All Known X. citri Groups The DNA sequences of all 13 available pthA homologs were analyzed and the predicted amino acid sequences were found to be >75% identical (Table 4-3). With the notable exception of Apl3, all seven other PthA homologs within X. citri pv citri group A (PthA, PthA1, PthA2, PthA3, PthA4, Apl1 and Apl2) were more closely related to each other (> 92% identical), than the active PthA homologs from all X. citri groups (PthA, PthB, PthC, PthAW and PthA*) which were >97% identical (Figure 4-6). Comparative analysis of the 34 aa direct repeat regions of all thirteen genes revealed three primary regions of variation within each repeat, at positions 3 and 4 (region 1), positions 11-13 (region 2) and positions 30-32 (region 3) (Figure 4-7). In region 1, no particular set of amino acids was universally conserved among any of the repeats of active pthA homologs. However, in regions 2 and 3, and only in repeat number 17 in each gene,


45 N(12)G(13) in region 2 and Q(31)A(32) in region 3 were correlated with active pathogenicity gene function. Discussion Southern hybridization analyses of a limited number of X. citri strains revealed a common 3.4 kb BamHI band shared by all strains examined in all five described groups of strains; all group A strains tested carried four hybridizing fragments, while all other strains examined carried only two. Among the 13 sequenced and functionally tested pthA homologs, including three tested by others [Apl1, Apl2 and Apl3; (Kanamori and Tsuyumu, 1998)] and the ten tested in this study, only the 3.4 kb fragment appeared to encode the active pathogenicity gene that is required for elicitation of citrus canker. This includes genes pthA*, pthAW, pthB and pthC from the A*, A w B and C strains, respectively, as well as pthA. All five of these genes were found to be fully isofunctional, and capable of eliciting the typical canker phenotype in grapefruit in B21.2, even though the source A*, A w and C strains were unable to elicit the canker phenotype in grapefruit. Furthermore, pthA*, pthAW and pthC did not elicit an avirulence phenotype of any type in B21.2, despite being members of an avr gene family, and despite the avirulence of the respective source strains in grapefruit. Indeed, the pthC knockout mutation in CIM1 eliminated pathogenicity in lime, but did not affect the HR in grapefruit, which remained as strong as that elicited by the wild type. The HR elicited by the wild type C group strain C340 is therefore independent of pthC. These results suggest that the A*, A w and C strains likely carry yet to be identified avr genes that prevent compatible phenotypes from developing in grapefruit. The C strain C340 and A* strain Xc270 fragments that hybridized with pthA did not complement B21.2 to pathogenicity in lime or grapefruit. The sequenced Xc270


46 homolog that failed to complement, pthA*-2, carried 15.5 repeats and appeared to have intact promoter, a SD region and an open reading frame. This gene was 97% identical to PthA2 and Apl2 (Table 4-3) and carried the same number of repeats. All three of these genes appear intact and yet also appear non-functional in terms of pathogenicity or avirulence. Although the C340 homolog (on pQYC2.1) that did not complement B21.2 was not sequenced, restriction enzyme analysis (not shown) of the 20 kb insert indicated that the promoter region was intact, making this homolog unlikely to be responsible for avirulence in grapefruit. The other three group A 3213 pthA homologs did not complement B21.2 and also appeared to be non-functional, confirming and extending the work of Kanamori and Tsuyumu (Kanamori and Tsuyumu, 1998) on group A strain L-9. However, the fact that all wide host range group A strains examined carry two additional pthA homologs that are not present in the more narrow host range B, C, A* and A w strains suggests a potential role in determining host range. Indeed, Ponciano et al (2003) reported that apl1, a pthA homolog that is functionally equivalent to pthA but found in a different group A strain, suppressed tobacco defense response and HR. However, when pthA or any of its 3213 homologs (pthA1, pthA2 or pthA3) were transferred into Xc270, no increase in host range of A* strain Xc270 to include grapefruit was observed (Figure 4-5). Although, additional pthA homologs in a given X. citri strain may contribute marginally to pathogenicity (Kanamori and Tsuyumu, 1998), the primary value of multiple copies of the gene family in a given strain may be to facilitate recombination and the potential for rapid adaptation to new hosts (Gabriel, 1999a; Yang and Gabriel, 1995).


47 All pthA homologs that are required for citrus canker disease from all five known X. citri groups carried exactly 17.5 repeats. All other homologs, even those nearly identical to pthA (e.g., from X. citri pv citri group A) were not required for canker and had a different number of repeats. Interestingly, deletion mutants of various repeats and numbers of repeats in pthA can result in a gene that confers a weak canker phenotype in citrus to B21.2 (Yang and Gabriel, 1995). In that study, however, repeat numbers 1-5 and 16,17 were not affected in deletion derivatives capable of conferring canker. This indicates that while the total number of repeats may be important, the number of repeats may be less important than the relative location of the specific repeats within the gene. Surprisingly, sequence variation among these active pthA genes (PthA, PthAW, PthA*, PthB and PthC) was greater than variation among the pthA homologs within the A group. Even the nonfunctional homologs were closer to the active genes within the A group than to active homologs from B and C groups. The relatively high level of variation within the active homologs from different phylogenetic groups allowed the possibility of identifying amino acids within the 34 aa direct repeat that might be critical for pathogenic specificity in citrus. Three somewhat variable regions were found in each of the repeats, at amino acid positions 3 and 4, 11-13, 30-32. The aligned repeat regions of all active genes revealed that only amino acids N(12)G(13) in the second and Q(31)A(32) in the third variable regions of the 17 th repeat were conserved. No such conservation of identical amino acids was found in any other repeat (Figure 4-6). Interestingly, only the 17 th repeat of the South American group B and C strains show a sequence identity to Asiatic strains in the third variable region. Q(31),A(32) is not seen in any other PthB repeat and in only two other PthC repeats,


48 which favor E(31)Q(32) at that position. In addition, the deletion mutants evaluated by Yang and Gabriel (Yang and Gabriel, 1995) never affected the 17 th repeat. These results suggest that the 17th repeat may be critical for pathogenicity of X. citri.


49 Table 4-1. Strains and plasmids used in this study Strain or plasmid Relevant Characteristics Reference or source Escherichia coli DH5 F endA1, hsdR17(r k m k ), supE44, thi-1, recA1 Gibco-BRL Xanthomonas citri 3213 Group A, wild type Gabriel et al. 1989 3213Sp Spontaneous Sp r derivative 3213, Sp r Gabriel et al. 1989 B21.2 pthA::Tn5-gusA, marker exchanged mutant of 3213Sp, Sp r Kn r Swarup et al. 1991 B69 Group B, wild type Stall et al. 1982 B69Sp Spontaneous Sp r derivative of B69, Sp r C340 Group C, wild type Stall et al. 1982 Xc205 Group A*, wild type Verniere et al. 1989 Xc205 Spontaneous Rif r derivative of Xc205, Rif r This study Xc270 Group A*, wild type Verniere et al. 1989 Xc270Rif Spontaneous Rif r derivative of Xc270, Rif r This study Xc280 Group A*, wild type Verniere et al. 1989 Xc290 Group A*, wild type Verniere et al. 1989 Xc322 Group A*, wild type Verniere et al. 1989 Xc406 Group A*, wild type Verniere et al. 1989 X0053 Group A w wild type Sun et al. 2004 X0053Rif Spontaneous Rif r derivative of X0053, Rif r This study BIM2 pthB::pUFR004, marker integrated mutant of B69Sp El-Yacoobi, 2005 CIM1 pthC::pUFR004, marker integrated mutant of C340 This study Plasmids pRK2013 ColE1, Km r ,Tra + helper plasmid Figurski and Helinski 1979 pRK2073 pRK2013 derivative, npt::Tn7, Km s Sp r Tra + helper plasmid Leong et al. 1982 pUC119 ColE1, M13 lg, Ap r lacZ + Vieira and Messing, 1987 pUFR004 ColE1, Mob + Cm r lacZ + De Feyter et al. 1990 pUFR043 IncW, Mob + lacZ + Gm r Nm r cos, shuttle vector De Feyter and Gabriel, 1991 pUFR047 IncW, Mob + lacZ + Par + Gm r Ap r De Feyter et al. 1993


50 Table 4-1. Continued. Strain or plasmid Relevant Characteristics Reference or source pUFR053 IncW, Gm r ,Cm r Mob + mob(P), lacZ + Par + El-Yacoobi, 2005 pUFR071 IncW, Mob + Cm r Gm r lacZ + Par + Castaneda, 2005 pYD9.3 pthA in pUC118, Ap r Duan et al. 1999 pZit45 4.5Kb fragment containing pthA from 3213 cloned in pUFR47, Ap r Swarup et al. 1992 pAB2.1 EcoRI/HindIII fragment of pZit45, containing pthA, in pLAFR3 This study pAB18.1 EcoRI/HindIII fragment of pYD9.3, containing pthA, in pUFR47 This study pQY93.3 23 kb EcoRI fragment containing pthB in pUFR53 This study pQY22.1 4.3 kb EcoRI fragment containing pthB 0 (non-functional) in pUFR53 This study pQY99.3 8.8 Kb SalI fragment containing pthB from B69 was cloned in pUC119 This study pQY96 14 kb HindIII fragment containing pthB cloned in pUFR53 This study pQY103.5 5 Kb SalI fragment containing pthC from C340 cloned in pUC119 This study pQYC1.1 6 kb SalI fragment containing pthC cloned in pUFR47 This study pQYC2.1 20 kb SalI fragment containing pthC 0 (non-functional) cloned in pUFR47 This study pAW5.15.8 5Kb EcoRI-KpnI fragment containing pthAW from X0053 cloned in pUFR47 This study pAW12.1-12.2 22 kb EcoRI/HindIII fragment containing pthA* from A* group strain Xc270 cloned in pUFR71 This study pAW12.3 6 kb EcoRI/HindIII fragment containing pthA*-2 from A* group strain Xc270 cloned in pUFR71 This study pAW20.2 36 kb MboI fragment containing pthA from 3213 cloned in pUFR43 This study pAW20.4 17 kb MboI fragment containing pthA1 homolog from 3213 cloned in pUFR43 This study pAW20.7 32 kb MboI fragment containing pthA2 homolog from 3213 cloned in pUFR43 This study pAW20.11 40 kb MboI fragment containing pthA3 homolog from 3213 cloned in pUFR43 This study


51 Table 4-2. Phenotypic responses of X. citri strains in 2 citrus hosts Mexican Lime Grapefruit Strains/Plasmid Low a High b Low High 3213 + c + + + B21.2 0 d 0 0 0 B21.2/pZit45( pthA) + + + + B21.2/pQY96( pthB ) + + + + B21.2/pQYC1.1( pthC ) + + + + B21.2/pAW5.2( pthAW ) + + + + B21.2/ pAW12.1( pthA*) + + + + B21.2/ pAW12.3( pthA*2) 0 0 0 0 a=10 4 -10 5 cfu/ml, b=10 8 -10 9 cfu/ml, c= canker, d= no canker,


52 Table 4-3. Amino acid sequence identity between pathogenicity genes from X. citri strains PthA PthA4 Apl1 PthAW PthA* PthA*-2 PthA1 PthA2 PthA3 Apl2 Apl3 PthB PthC PthA 100 100 100 99 98 92 95 93 92 94 84 87 87 PthA4 100 100 99 98 92 95 93 92 94 84 87 87 Apl1 100 99 98 92 95 93 92 94 84 87 87 PthAW 100 97 92 95 93 92 93 84 87 87 PthA* 100 92 95 93 92 93 84 87 87 PthA*-2 100 95 97 97 97 79 82 83 PthA1 100 95 95 95 81 84 85 PthA2 100 98 99 79 82 82 PthA3 100 98 79 82 82 Apl2 100 80 82 82 Apl3 100 75 75 PthB 100 98 PthC 100


53 Figure 4-1. Southern Hybridization analysis of X. citri strains hybridized with the BamHI internal fragment of pthA. A). BamHI restriction digested genomic DNA from X. citri strains. B). EcoRI restriction digested genomic DNA.


54 + control Hybridizing colonies Figure 4-2. Colony Hybridization of E. coli with cloned X0053 A w plasmid DNA fragments using 32 P-labeled pthA. pZit45 (pthA) was used as a positive control.


55 3213 B21.2/ pAW5.2 B21.2/ pAW5.4 B21.2/ pAW5.5B21.2/ pAW5.8B21.2B21.2B21.2/ pAW5.5B21.2/ pAW5.83213B21.2/ pAW5.2B21.2/ pAW5.4GF KL Figure 4-3. Complementation of A strain knockout B21.2 (pthA::Tn5) with pthA homologs from A w strain X0053 in citrus. pAW5.2, pAW5.4, pAW5.5 and pAW5.8 carry fragments that hybridized with pthA in grapefruit (left) and Key lime (right).


56 Figure 4-4. Complementation of A strain knockout B21.2 (pthA::Tn5) with pthA homologs in citrus. pthAW (pAW5.2), pthA* (pAW12.1) and pthA*-2 (pAW12.3) in B21.2 and pthA (3213) in grapefruit (left) and Key lime (right).


57 Figure 4-5. Analysis of pthA and its three homologs in A* strain Xc270. Key lime (left) and grapefruit (right)


58 Figure 4-6. Neighbor-joining dengogram depicting phylogenetic relastionship based on pairwise comparison of neucleotide sequences of members of avrBs3/pthA genes from different species and pathovars of Xanthomonas. Numbers at the nodes represent bootstrap values (based on 100 replicates). GenBank Accesions numbers are presented to the right of the gene for genes not mentioned in material and methods.




CHAPTER 5 SUMMARY AND CONCLUSION The main objective of this dissertation was to study host range determination factors among all described Xanthomonas citri groups that are known world-wide. Five variant groups of X. citri have been described in the literature, and all are known from field observations to differ in host range and/or pathogenicity. In this study, all known groups were studied together in lime, grapefruit and sweet orange. All groups were readily distinguished by inoculation of only two host differentials, lime and grapefruit. The in planta growth of strains from two different groups that did not elicit an obvious defense response in grapefruit was found to be poor. This indicated that either these strains carry negative acting (avirulence) factors that limited growth in grapefruit, or that they are missing positive acting (pathogenicity) factors that are present in strains from groups that can attack grapefruit. The lack of a grapefruit defense response that is typical of bacterial infections limited by avirulence factors led to an attempt to identify positive pathogenicity factors. A DNA library of an X. citri strain able to attack grapefruit was moved into one of the strains unable to attack grapefruit in an attempt to identify one or more positive acting host range factors. Despite using a DNA library that theoretically covered the wide host range X. citri genome with 99% probability, no pathogenicity factors were found, despite multiple screens of all library clones. It is possible that in planta growth requires multiple effectors, and that no individual cosmid would carry enough factors to reveal a strong difference. Another possibility is that Xc270 may carry avr genes that function in 60


61 grapefruit and prevent Xc270 from growing. Avirulence is usually epistatic over virulence and therefore a screen for positive factors would fail if this were the case. In addition to the DNA library screen, particular attention was paid to the pthA homologs from all five X. citri strain groups, since pthA is known to be required by at least three strain groups for citrus canker disease. In this study, pthA was demonstrated to be required by the remaining strain groups. The fact that all wide host range group A strains examined carried two additional pthA homologs that were not present in the narrow host range B, C, A* and A w strain groups suggested a potential role for these additional homologs in determining host range. However, when pthA or any of its group A homologs (pthA1, pthA2 or pthA3) were transferred into a narrow host range group (A*) strain, no increase in host range to include grapefruit was observed. Three new pthA homologs were cloned, isolated and sequenced from strains of group A* (pthA* and pthA*-2) and A w (pthAW) and functionally compared with pthA homologs previously isolated from strains of the three remaining groups: A (pthA), B (pthB) and C (pthC). pthA*, pthAW, pthB and pthC were found to be fully isofunctional with pthA, and capable of eliciting the typical canker phenotype in grapefruit in complementation tests using an X. citri group A pthAmutant strain (B21.2), even though the source A*, A w and C strains were unable to elicit the canker phenotype in grapefruit. Furthermore, pthA*, pthAW pthA* and pthC did not elicit an avirulence phenotype of any type in B21.2, despite the fact that pthA homologs are all members of an avirulence gene family, and despite the avirulence of the respective source strains in grapefruit. DNA sequence comparisons of the three new pthA homologs cloned, sequenced and characterized in this study with ten previously sequenced pthA homologs revealed


62 that all functional pthA homologs (i.e., those that are required for citrus canker disease in their respective strains) from all five known X. citri groups carried exactly 17.5, 102bp direct tandem repeats. All other homologs that are not functional for citrus canker pathogenicity carried a different number of repeats. Phylogenetic comparisons of the DNA and predicted protein sequences of the thirteen available pthA homologs revealed the same phylogenetic distinctions that are found by more general phylogenetic studies. In addition, comparisons of the five functional pthA homologs from each group against those that were nonfunctional revealed that amino acids N(12)G(13) in the second and Q(31)A(32) in the third variable regions of the 17 th direct tandem repeat were only conserved in functional genes. These results suggest that the 17th repeat plays a critical role in citrus canker pathogenicity and may help explain the origination of new citrus canker strains.


APPENDIX A SEQUENCE OF pthC DNA sequence of pthC: atggatcccattcgtccgcgcacgtcaagtcctgcccacgaacttttggccggaccccagccggatagggttcagccgcagccgactgcagatcgtgggggggctccgcctgctggcagccccctggatggcttgcccgctcgacggacgatgtcccgaacccgtctcccgtctccccctgcccccttgcctgcgttctcagcgggcagtttcagcgatctgctctgtcagttcgatccgttgcttcttgacacattgctttttgattcgatgtctgccttcggcgctcctcatacagaggctgccccaggagaggcggatgaagtgcaatcgggtctgcgtgcagtcgatgacccgcaccccaccgtgcacgtcgctgtgacggccgcgcgaccgccgcgcgccaagccggcgccgcgacggcgtgctgcgcacacctctgacgcttcgccggccgggcaggttgatctatgcacgctcggctacagccagcagcagcaagacgagatcaaaccgaaggcgcgtgcgacagtggcgcagcaccaccaggcactgatgggccatgggtttacacgtgcgcacatcgttgcgctcagccaacacccggcagccttggggaccgtcgctgtcaagtaccaggccatgatcgcggcgttgccggaggcgacacacgaagacatcgttggcgtcggcaaacagtggtccggcgcacgcgccctggaagcattgctcacggtgtcgggagagttgagaggtccaccgttacagttggacacaggtcaacttctcaagattgcaaaacgtggcggcgtgaccgcggtggaggcagtgcatgcatggcgcaatgcactgacgggcgctcccctgaacctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcgg 63


64 ctgttgccggtgctgtgcgagcaacatggcctgaccccggcgcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggaaacggtgcagcagctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcacatggcctgaccccggaccaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggttgccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgcgccaggcacatggcctgaccccggcgcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgcgagcaacatggcctgaccccggaccaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgcgccaggcacatggcctgaccccggcgcaggtggtggccatcgccagcaatggcggcggcaggccggcactggagagcatttttgcccagttatctcgccctgatcaggcgttggccgcgttgaccaacgaccacctcgtcgccttggcctgcctcggcgggcgtcctgcgctggaggcagtgaaaaagggattgccgcacgcgccgaccttgatcaaaagaaccaatcgccgtcttcccgaacgcacgtcccatcgcgttgccgaccacgcgcaagtggctcgcgtgctgggttttttccagtgccactcccacccagcgcaagcatttgatgaagccatgacgcagttcgggatgagcaggcacgggttgttacagctatttcgcagagtgggcgtcaccgaactcgaggcccgcggtggaacgctccccccagccccgcagcgttggcaccgtatcctccaggcatcagggatgaaaagggccgaaccgtccggtgcttcggctcaaacgccggaccaggcgtctttgcatgcattcgccgatgcgctggagcgtgagctggatgcgcccagcccaatagaccaagcaggccaggcgctggcaagcagcagccgtaaacggtcccgatcggagagttctgtcaccggctccttcgcacagcaagctgtcgaggtgcgcgttcccgaacagcgcgatgcgctgcatttaccccccctcagctggggtgtaaaacgcccgcgtaccaggatcgggggcgg




APPENDIX B SEQUENCE OF pthAW DNA sequence of pthAW: atggatcccattcgttcgcgcacaccaagtcctgcccgcgagcttctgcccggcccccaaccggatagggttcagccgactgcagatcgtggggtgtctccgcctgccggcggccccctggatggcttgcccgctcggcggacgatgtcccggacccggctgccatctccccctgccccctcacctgcgttctcggcgggcagcttcagtgacctgttacgtcagttcgatccgtcactttttaatacatcgctttttgattcattgcctcccttcggcgctcaccatacagaggctgccacaggcgagtgggatgaggtgcaatcgggtctgcgggcagccgacgcccccccacccaccatgcgcgtggctgtcactgccgcgcggccgccgcgcgccaagccggcgccgcgacgacgtgctgcgcaaccctccgacgcttcgccggccgcgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgctctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaaacgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaacctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcaggcgctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccctggaccaggtcgtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatagcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgtt 66


67 gccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatagcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagcaatgcgggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaattgcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccctggaccaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatagcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgcctgcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaggccggcgctggagagcattgttgcccagttatctcgccctgatccggcgttggccgcgttgaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccgaccacgcgcaagtggttcgcgtgctgggttttttccagtgccactcccacccagcgcaagcatttgatgacgccatgacgcagttcgggatgagcaggcacgggttgttacagctctttcgcagagtgggcgtcaccgaactcgaagcccgcagtggaacgctccccccagcctcgcagcgttgggaccgtatcctccaggcatcagggatgaaaagggccaaaccgtcccctacttcaactcaaacgccggaccaggcgtctttgcatgcattcgccgattcgctggagcgtgaccttgatgcgcccagcccaacgcacgagggagatcagaggcgggcaagcagccgtaaacggtcccgatcggatcgtgctgtcaccggtccctccgcacagcaatcgttcgaggtgcgcgttcccgaacagcgcgatgcgctgcatttgcccctcagttggagggtaaaacgcccgcgtaccagtatcgggggcggcctcccggatcctgg






APPENDIX C SEQUENCE OF pthA* DNA sequence of pthA* atgcggcctcggaagctatgtaggaaccacagaccgctagtctggaggcgaccatgtaaagaggtatgcctgatggatcccattcgttcgcgcacaccaagtcctgcccgcgagcttctgcccggaccccaacccgatggggttcagccgactgcagatcgtggggtgtctccgcctgccggcggccccctggatggcttgcccgctcggcggacgatgtcccggacccggctgccatctccccctgccccctcacctgcgttctcggcgggcagcttcagtgacctgttacgtcagttcgatccgtcactttttaatacatcgctttttgattcattgcctcccttcggcgctcaccatacagaggctgccacaggcgagtgggatgaggtgcaatcgggtctgcgggcagccgacgcccccccacccaccatgcgcgtggctgtcactgccgcgcggccgccgcgcgccaagccggcgccgcgacgacgtgctgcgcaaccctccgacgcttcgccggccgcgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgccctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaaacgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaacctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccgcagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggcacaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccg 70


71 gaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccgcagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccctggaccaggtcgtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatagcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggaccaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatagcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgcctgcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaggccggcgctggagagcattgttgcccagttatctcgccctgatccggcgttggccgcgttgaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccgaccacgcgcaagtggttcgcgtgctgggttttttccagtgccactcccacccagcgcaagcatttgatgacgccatgatgcagttcgggatgagcaggcacgggttgttacagctctttcgcagagtgggcgtcaccgaactcgaagcccgcagtggaacgctccccccagcctcgcagcgttgggaccgtatcctccaggcatcagggatgaaaagggccaaaccgtcccctacttcaactcaaacgccggaccaggcgtctttgcatgcattcgccgattcgctggagcgtgaccttgatgcgcccagcccaacgcacgagggagatcagaggcgggcaagcagccgtaaacggtcccgatcggatcgtgctgtcaccggtccctccgcacagcaatcgttcgaggtgcgcgttcccgaacagcgcgatgcgctgcatttgcccctcagttggagggtaaaacgcccgcgtaccagtatcgggggcggcctcccggatcctggtacgcccacgg






APPENDIX D SEQUENCE OF pthA*-2 DNA sequence of pthA*-2 atgcggcctcggaagctatgtaggaaccacagaccgctagtctggaggcgaccatgtaaagaggtatgcctgatggatcccattcgttcgcgcacaccaagtcctgcccgcgagcttctgcccggcccccaaccggatagggttcagccgactgcagatcgtggggtgtctccgcctgccggcggccccctggatggcttgcccgctcggcggacgatgtcccggacccggctgccatctccccctgcacccttgcctgcgttctcggcgggcagcttcagtgacctgttacgtcagttcgatccgtcactttttaatacatcgctttttgattcattgcctcccttcggcgctcaccatacagaggctgccacaggcgagtgggatgaggtgcaatcgggtctgcgggcagccgacgcccccccacccaccatgcgcgtggctgtcactgccgcgcggccgccgcgcgccaagccggcgccgcgacgacgtgctgcgcaaccctccgacgcttcgccggccgcgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgccctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaaacgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaacctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgcacccgggacaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagcaatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggcacaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggcacaggtggtggccatcgccagcaatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggt 74


75 cgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggcacaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggcacaggtcgtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaggccggcgctggagagcattgttgcccagttatctcgccctgatccggcgttggccgcgttgaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccgaccacgcgcaagtggttcgcgtgctgggttttttccagtgccactcccacccagcgcaagcatttgatgacgccatgacgcagttcgggatgagcaggcacgggttgttacagctctttcgcagagtgggcgtcaccgaactcgaagcccgcagtggaacgctccccccagcctcgcagcgttgggaccgtatcctccaggcatcagggatgaaaagggccaaaccgtcccctacttcaactcaaacgccggaccaggcgtctttgcatgcattcgccgattcgctggagcgtgaccttgatgcgcccagcccaacgcacgagggagatcagaggcgggcaagcagccgtaaacggtcccgatcggatcgtgctgtcaccggtccctccgcacagcaatcgttcgaggtgcgcgttcccgaacagcgcgatgcgctgcatttgcccctcagttggagggtaaaacgcccgcgtaccagtatcgggggcggcctcccggatcctggtacgcccacggctgccgacctggcagcgtccagcaccgtgatgcgggaacaagatgaggaccccttcgcaggggcagcggatgatttcccggcattcaacgaagaggagctcgcatggttgatggagctattgcctcagtga
















83 901 950 PthA (763) GLTPDQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIAS---PthA4 (763) GLTPDQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIAS---Apl1 (763) GLTPDQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIAS---PthAW (764) GLTPDQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIAS---PthA* (832) G------------------------------------------------PthA*-2 (762) G------------------------------------------------PthA1 (760) GLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHG--------------PthA2 (764) G------------------------------------------------PthA3 (764) G------------------------------------------------Apl3 (899) GLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIASNGGG Apl2 (763) G------------------------------------------------PthB (766) GLTPDQVVAIASHDGGKQALETVQRLLPVLCEQHGLTPDQVVAIAS---PthC (766) GLTPAQVVAIASHDGGKQALETVQRLLPVLCEQHGLTPDQVVAIAS---Consensus (901) GLTPDQVVAIASHDGGKQALETVQRLLPVLC HGLTPEQVVAIAS 951 1000 PthA (809) -------------------------------------------------PthA4 (809) -------------------------------------------------Apl1 (809) -------------------------------------------------PthAW (810) -------------------------------------------------PthA* (833) -------------------------------------------------PthA*-2 (763) -------------------------------------------------PthA1 (795) -------------------------------------------------PthA2 (765) -------------------------------------------------PthA3 (765) -------------------------------------------------Apl3 (949) KQALETVQRLLPVLCQAHGLTPEQVVAIASNIGGKQALETVQRLLPVLCQ Apl2 (764) -------------------------------------------------PthB (812) -------------------------------------------------PthC (812) -------------------------------------------------Consensus (951) 1001 1050 PthA (809) --------------HDGGKQALETVQRLLPVLCQAHGLTPEQVVAIACNG PthA4 (809) --------------HDGGKQALETVQRLLPVLCQAHGLTPEQVVAIACNG Apl1 (809) --------------HDGGKQALETVQRLLPVLCQAHGLTPEQVVAIACNG PthAW (810) --------------HDGGKQALETVQRLLPVLCQAHGLTPEQVVAIACNG PthA* (833) -------------------------------------LTPEQVVAIASNG PthA*-2 (763) -------------------------------------LTPAQVVAIASHD PthA1 (795) -------------------------------------LTPEQVVAIASHD PthA2 (765) -------------------------------------LTPEQVVAIASNI PthA3 (765) -------------------------------------LTPEQVVAIASHD Apl3 (999) AHGLTPEQVVAIASHDGGKQALETVQRLLPVLCQAHGLTPEQVVAIACNG Apl2 (764) -------------------------------------LTPEQVVAIASHD PthB (812) --------------NGGGKQALETVQRLLPVLCEQHGLTPDQVVAIASNG PthC (812) --------------NGGGKQALETVQRLLPVLCEQHGLTPDQVVAIASNG Consensus (1001) GGKQALETVQRLLPVLC HGLTPEQVVAIASNG





PAGE 100


PAGE 101

LIST OF REFERENCES Abramovitch, R.B., Kim, Y.J., Chen, S.R., Dickman, M.B. and Martin, G.B. (2003) Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition of host programmed cell death. Embo Journal, 22, 60-69. Agrios, G.N. (1997) Plant pathology. 5 th Edition, Academic Press, New York, NY. Allen, M. (2000) A seed is planted. In: The history of Florida citrus. Florida Grower, Mid-August edition, 10-13. Alvarez, A.M., Benedict, A.A., Mizumoto, C.Y., Pollard, L.W. and Civerolo, E.L. (1991) Analysis of Xanthomonas campestris pv citri and X.c.citrumelo with monoclonal-antibodies. Phytopathology, 81, 857-865. Azad, H.R. and Kado, C.I. (1984) Relation of Tobacco Hypersensitivity to Pathogenicity of Erwinia rubrifaciens. Phytopathology, 74, 61-64. Belasque, J., Parra-Pedrazzoli, A.L., Neto, J.R., Yamamoto, P.T., Chagas, M.C.M., Parra, J.R.P., Vinyard, B.T. and Hartung, J.S. (2005) Adult citrus leafminers (Phyllocnistis citrella) are not efficient vectors for Xanthomonas axonopodis pv. citri. Plant Disease, 89, 590-594. Bendahmane, A., Kanyuka, K. and Baulcombe, D.C. (1999) The Rx gene from potato controls separate virus resistance and cell death responses. Plant Cell, 11, 781-791. Bock, C.H., Parker, P.E. and Gottwald, T.R. (2005) Effect of simulated wind-driven rain on duration and distance of dispersal of Xanthomonas axonopodis pv. citri from canker-infected citrus trees. Plant Disease, 89, 71-80. Bretz, J.R., Mock, N.M., Charity, J.C., Zeyad, S., Baker, C.J. and Hutcheson, S.W. (2003) A translocated protein tyrosine phosphatase of Pseudomonas syringae pv. tomato DC3000 modulates plant defence response to infection. Molecular Microbiology, 49, 389--400. Brown, K. (2001) Florida fights to stop citrus canker. Science, 292, 2275-2276. Brunings, A.M. and Gabriel, D.W. (2003) Xanthomonas citri: breaking the surface. Molecular Plant Pathology, 4, 141-157. Castaneda, A. (2005) Identification and characterization of genes unique to systemic Xanthomonas pathogens. PhD Dissertation. University of Florida. Gainesville. 87

PAGE 102

88 Chen, C.Y., Wang, L. and Winans, S.C. (1991) Characterization of the supervirulent virG gene of the Agrobacterium tumefaciens plasmid pTiBo542. Molecular & General Genetics, 230, 302-309. Clarke, L. and Carbon, J. (1976) Colony bank containing synthetic Col El hybrid plasmids representative of entire Escherichia coli genome. Cell, 9, 91-99. Cook, A.A. (1988) Association of citrus canker pustules with leaf miner tunnels in North-Yemen. Plant Disease, 72, 546-546. Cubero, J. and Graham, J.H. (2002) Genetic relationship among worldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their identification by PCR. Applied And Environmental Microbiology, 68, 1257-1264. da Silva, A.C.R., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., Monteiro-Vitorello, C.B., Van Sluys, M.A., Almeida, N.F., Alves, L.M.C., do Amaral, A.M., Bertolini, M.C., Camargo, L.E.A., Camarotte, G., Cannavan, F., Cardozo, J., Chambergo, F., Clapina, L.P., Cicarelli, R.M.B., Coutinho, L.L., Cursino-Santos, J.R., El-Dorry, H., Faria, J.B., Ferreira, A.J.S., Ferreira, R.C.C., Ferro, M.I.T., Formighieri, E.F., Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi, L.T., Leite, R.P., Lemos, E.G.M., Lemos, M.V.F., Locali, E.C., Machado, M.A., Madeira, A., Martinez-Rossi, N.M., Martins, E.C., Meidanis, J., Menck, C.F.M., Miyaki, C.Y., Moon, D.H., Moreira, L.M., Novo, M.T.M., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereira, H.A., Rossi, A., Sena, J.A.D., Silva, C., de Souza, R.F., Spinola, L.A.F., Takita, M.A., Tamura, R.E., Teixeira, E.C., Tezza, R.I.D., dos Santos, M.T., Truffi, D., Tsai, S.M., White, F.F., Setubal, J.C. and Kitajima, J.P. (2002) Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature, 417, 459-463. Danos, E., Berger, R.D. and Stall, R.E. (1984) Temporal and spatial spread of citrus canker within groves. Phytopathology, 74, 904-908. Danos, E., Bonazzola, R., Berger, R.D., Stall, R.E. and Miller, J.W. (1981) Progress of citrus canker on some species and combinations in Argentina. Proceedings of The Florida State Horticultural Society, 94, 15-18. De Feyter, R. and Gabriel, D.W. (1991) At least six avirulence genes are clustered on a 90-kilobase plasmid in Xanthomonas campestris pv. malvacearum. Mol. Plant-Microbe Interact., 4, 423-432. De Feyter, R., Kado, C.I. and Gabriel, D.W. (1990) Small stable shuttle vectors for use in Xanthomonas. Gene, 88, 65-72. De Feyter, R., Yang, Y. and Gabriel, D.W. (1993) Gene-for-genes interactions between cotton R genes and Xanthomonas campestris pv. malvacearum avr genes. Mol. Plant-Microbe Interact., 6, 225-237.

PAGE 103

89 Debelle, F., Maillet, F., Vasse, J., Rosenberg, C., Debilly, F., Truchet, G., Denarie, J. and Ausubel, F.M. (1988) Interference between Rhizobium meliloti and Rhizobium-trifolii nodulation genes genetic basis of R meliloti Dominance. Journal of Bacteriology, 170, 5718-5727. Djordjevic, M.A., Gabriel, D.W. and Rolfe, B.G. (1987) Rhizobium the refined parasite of legumes. Annual Review of Phytopathology, 25, 145-168. Duan, Y.P., Castaneda, A., Zhao, G., Erdos, G. and Gabriel, D.W. (1999) Expression of a single, host-specific, bacterial pathogenicity gene in plant cells elicits division, enlargement, and cell death. Molecular Plant-Microbe Interactions, 12, 556-560. Elgoorani, M.A. (1989) The occurrence of citrus canker disease in United Arab Emirates (UAE). Journal Of Phytopathology-Phytopathologische Zeitschrift, 125, 257-264. El Yacoubi, B. (2005) Bacterial citrus canker: Molecular aspects of a compatible plant-microbe interaction. PhD Dissertation. University of Florida, Gainesville. Espinosa, A., Guo, M., Tam, V.C., Qing Fu, Z. and Alfano, J.R. (2003) The Pseudomonas syringae type III-secreted protein HopPtoD2 possesses protein tyrosine phosphatase activity and suppresses programmed cell death in plants. Molecular Microbiology, 49, 377-387. FAOSTAT (2005) FAO Statistical Databases. www.faostat.fao.org Last accessed June 20, 2005. Faucher, C., Camut, S., Denarie, J. and Truchet, G. (1989) The Nodh and Nodq host range enes of Rhizobium meliloti behave as avirulence genes in R. leguminosarum bv viciae and determine changes in the production of plant-specific extracellular signals. Molecular Plant-Microbe Interactions, 2, 291-300. FDACS data. (2005) Citrus canker. www.doacs.state.fl.us/pi/canke, Last accessed July 4, 2005. Fegan, R.M., Olexa, M.T. and McGovern, R.J. (2004) Protecting agriculture: The legal basis of regulatory action in Florida. Plant Disease, 88, 1040-1043. Figurski, D.H. and Helinski, D.R. (1979) Replication of an origin-containing derivatives of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76. 1648-1652. Fisher, R.F. and Long, S.R. (1993) Interactions of NodD at the Nod Box NodD binds to 2 distinct sites on the same face of the helix and induces a bend in the DNA. Journal of Molecular Biology, 233, 336-348.

PAGE 104

90 Gabriel, D.W. (1999a) Why do pathogens carry avirulence genes? Physiological And Molecular Plant Pathology, 55, 205-214. Gabriel, D. W. (1999b) The Xanthomonas avr/pth Gene Family. In Stacey, G. and Keen, N.T. (eds.), Plant-Microbe Interactions. APS Press, St. Paul, Minnesota, Vol. 4, pp. 39-55. Gabriel, D.W. (2001) Citrus Canker. In Maloy, O.C. and Murray, T.D. (eds.), Encyclopedia if Plant Pathology. John Wiley and Sons, New York, pp. 215-217. Gabriel, D.W. and De Feyter, R. (1992) RFLP analyses and gene tagging for bacterial identification and taxonomy. In Gurr, S.J., McPherson, M.J. and Bowles, D.J. (eds.), Molecular Plant Pathology: A Practical Approach. IRL Press, Oxford, Vol. 1, pp. 51-66. Gabriel, D.W., Kingsley, M., Hunter, J.E. and Gottwald, T.R. (1989) Reinstatement of Xanthomonas citri (ex Hasse) and X. phaseoli (ex Smith) and reclassification of all X. campestris pv. citri strains. Int. J. Syst. Bacteriol., 39, 14-22. Goto, M. (1969) Studies on citrus canker in Japan. Proc. First Int. Citrus Symp., 3, 1251-1252. Gottwald, T.R., Hughes, G., Graham, J.H., Sun, X. and Riley, T. (2001) The citrus canker epidemic in Florida: The scientific basis of regulatory eradication policy for an invasive species. Phytopathology, 91, 30-34. Gottwald, T.R., McGuire, R.G. and Garran, S. (1988) Asiatic citrus canker spatial and temporal spread in simulated new planting situations in Argentina. Phytopathology, 78, 739-745. Gottwald, T.R., Sun, X., Riley, T., Graham, J.H., Ferrandino, F. and Taylor, E.L. (2002) Geo-referenced spatiotemporal analysis of the urban citrus canker epidemic in Florida. Phytopathology, 92, 361-377. Gottwald, T.R. and Timmer, L.W. (1995) The efficacy of windbreaks in reducing the spread of citrus canker caused by Xanthomonas campestris pv citri. Tropical Agriculture, 72, 194-201. Gottwald, T.R., Timmer, L.W. and McGuire, R.G. (1989) Analysis of disease progress of citrus canker in nurseries in Argentina. Phytopathology, 79, 1276-1283. Goulden, M.G. and Baulcombe, D.C. (1993) Functionally homologous host components recognize potato virus X in Gomphrena globosa and potato. Plant Cell, 5, 921-930. Graham, J.H., Gottwald, T.R., Cubero, J. and Achor, D.S. (2004) Xanthomonas axonopodis pv. citri: factors affecting successful eradication of citrus canker. Molecular Plant Pathology, 5, 1-15.

PAGE 105

91 Graham, J.H., Gottwald, T.R., Riley, T.D. and Achor, D. (1992) Penetration through Leaf Stomata and Growth of Strains of Xanthomonas campestris in citrus cultivars varying in susceptibility to bacterial diseases. Phytopathology, 82, 1319-1325. Hauck, P., Thilmony, R. and Yang He, S. (2003) A Pseudomonas syringae type III effector suppresses cell wall-based extracellular defense in susceptible Arabidopsis. PNAS, 100, 8577-8582. Herbers, K., Conradsstrauch, J. and Bonas, U. (1992) Race-specificity of plant-resistance to bacterial spot disease determined by repetitive motifs in a bacterial avirulence protein. Nature, 356, 172-174. Hood, E.E., Helmer, G.L., Fraley, R.T. and Chilton, M.D. (1986) The hypervirulence of Agrobacterium tumefaciens A281 Is encoded in a region of pTiBo542 outside of transfer DNA. Journal of Bacteriology, 168, 1291-1301. Hopkins, C.M., White, F.F., Choi, S.-H. and Leach, J.E. (1992) Identification of a family of avirulence Genes from Xanthomonas oryzae pv. oryzae. Mol. Plant-Microbe Interact., 5, 451-459. Hwang, L. (1949) Spraying experiments to control citrus canker. Phytopathology, 39, 177-181. Jurkowski, G.I., Smith, R.K., Yu, I.C., Ham, J.H., Sharma, S.B., Klessig, D.F., Fengler, K.A. and Bent, A.F. (2004) Arabidopsis DND2, a second cyclic nucleotide-gated ion channel gene for which mutation causes the "defense, no death" phenotype. Molecular Plant-Microbe Interactions, 17, 511-520. Kamst, E., Pilling, J., Raamsdonk, L.M., Lugtenberg, B.J.J. and Spaink, H.P. (1997) Rhizobium nodulation protein NodC is an important determinant of chitin oligosaccharide chain length in nod factor biosynthesis. Journal of Bacteriology, 179, 2103-2108. Kanamori, H. and Tsuyumu, S. (1998) Comparison of nucleotide sequences of canker-forming and non-canker-forming pthA homologues in Xanthomonas campestris pv. citri. Ann. Phytopathol. Soc. Jpn., 64, 462-470. Keen, N.T. (1990) Gene-for-gene complementarity in plant-pathogen interactions. Annual Review of Genetics, 24, 447-463. Kingsley, M.T., Gabriel, D.W., Marlow, G.C. and Roberts, P. (1993) The opsX Locus of Xanthomonas campestris affects host range and biosynthesis of lipopolysaccharide and Extracellular polysaccharide. J. Bacteriol., 175, 5839-5850. Kondorosi, E., Pierre, M., Cren, M., Haumann, U., Buire, M., Hoffmann, B., Schell, J. and Kondorosi, A. (1991) Identification of NolR, a negative transacting factor controlling the Nod regulon in Rhizobium meliloti. Journal of Molecular Biology, 222, 885-896.

PAGE 106

92 Lazo, G.R. and Gabriel, D.W. (1987) Conservation of plasmid DNA sequences and pathovar identification of strains of Xanthomonas campestris. Phytopathology, 77, 448-453. Lazo, G.R., Roffey, R. and Gabriel, D.W. (1987) Pathovars of Xanthomonas campestris are distinguishable by restriction fragment length polymorphisms. Int. J. Syst. Bacteriol., 37, 214-221. Leach, J.E. and White, F.F. (1996) Bacterial avirulence genes. Annual Review Of Phytopathology, 34, 153-179. Lehnackers, H. and Knogge, W. (1990) Cytological studies on the infection of Barley cultivars with known resistance genotypes by Rhynchosporium secalis. Canadian Journal Of Botany-Revue Canadienne De Botanique, 68, 1953-1961. Leong, S.A., Ditta, G.S. and Helinski, D.R. (1982) Heme biosynthesis in Rhizobium. Identification of a cloned gene coding for -amino-levulinic acid synthetase from Rhizobium melilotai. J. Biol. Chem. 257. 8724-8730. Loucks, K.W. and Florida. Division of Plant Industry. (1934) Citrus canker and its eradication in Florida. Mavrodieva, V., Levy, L. and Gabriel, D.W. (2004) Improved sampling methods for real-time polymerase chain reaction diagnosis of citrus canker from field samples. Phytopathology, 94, 61-68. McLean, F. and Lee, A. (1922) The resistance of citrus canker to Citrus nobilis and a suggestion as to the production of resistant varieties on other species. Phytopathol., 11, 109-115. Ori, N., Eshed, Y., Paran, I., Presting, G., Aviv, D., Tanksley, S., Zamir, D. and Fluhr, R. (1997) The I2C family from the wilt disease resistance locus I2 belongs to the nucleotide binding, leucine-rich repeat superfamily of plant resistance genes. Plant Cell, 9, 521-532. Ponciano, G., Ishihara, H., Tsuyumu, S. and Leach, J. (2003) Bacterial effectors in plant disease and defense: keys to durable resistance? Plant Disease, 87, 1272-1282. Pruvost, O., Boher, B., Brocherieux, C., Nicole, M. and Chiroleu, F. (2002) Survival of Xanthomonas axonopodis pv. citri in leaf lesions under tropical environmental conditions and simulated splash dispersal of inoculum. Phytopathology, 92, 336-346. Rybak, M. (2005) Genetic determination of host range specificity of the Wellington strin of Xanthomonas axonopodis pv. citri. PhD Dissertation. University of Florida. Gainesville.

PAGE 107

93 Sambrook, J., Fritsch, E.F. and Maniatis, T.A. (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor, New York, NY. Schiffer, R., Gorg, R., Jarosch, B., Beckhove, U., Bahrenberg, G., Kogel, K.H. and SchulzeLefert, P. (1997) Tissue dependence and differential cordycepin sensitivity of race-specific resistance responses in the barley powdery mildew interaction. Molecular Plant-Microbe Interactions, 10, 830-839. Schubert, T.S., Miller, J.W. and Gabriel, D.W. (1996) Another outbreak of bacterial canker on citrus in Florida. Plant Disease, 80, 1208-1208. Schubert, T.S., Rizvi, S.A., Sun, X., Gottwald, T.R., Graham, J.H. and Dixon, W.N. (2001) Meeting the challenge of eradicating citrus canker in Florida again. Plant Disease, 85, 340-356. Stall, R.E. and Civerolo, E.L. (1991) Research relating to the recent outbreak of citrus canker in Florida. Annual Review of Phytopathology, 29, 399-420. Stall, R.E., Miller, J.W., Marco, G.M. and Canteros de Echenique, B.I. (1982) Pathogenicity of three strains of citrus canker organism on grapefruit. In Lozano, J.C. and Gwin, P. (eds.), Proceedings of the fifth International Conference on Plant Pathogenic Bacteria, August 16-23, 1981 at CIAT, Cali, Colombia. Centro Internacional de Agricultura Tropical, Cali, Colombia, pp. 334-340. Stall, R.E. and Seymour, C.P. (1983) Canker, a threat to citrus in the Gulf-Coast states. Plant Disease, 67, 581-585. Stapleton, J.J. (1986) Immunological and electrophoretic comparison of citrus canker and a citrus leaf-spot disease in Mexico. Phytopathology, 76, 847-847. Stapleton, J.J. and Garza-lopez, J.G. (1988) Epidemiology of citrus leaf spot disease in Colima, Mexico. Phtopathology, 78, 440-443. Sun, X.A., Stall, R.E., Jones, J.B., Cubero, J., Gottwald, T.R., Graham, J.H., Dixon, W.N., Schubert, T.S., Chaloux, P.H., Stromberg, V.K., Lacy, G.H. and Sutton, B.D. (2004) Detection and characterization of a new strain of citrus canker bacteria from key Mexican lime and Alemow in South Florida. Plant Disease, 88, 1179-1188. Swarup, S., De Feyter, R., Brlansky, R.H. and Gabriel, D.W. (1991) A Pathogenicity Locus from Xanthomonas citri Enables Strains from Several pathovars of X. campestris to elicit cankerlike lesions on citrus. Phytopathol., 81, 802-809. Swarup, S., Yang, Y., Kingsley, M.T. and Gabriel, D.W. (1992) A Xanthomonas citri pathogenicity gene, pthA, pleiotropically encodes gratuitous avirulence on nonhosts. Mol. Plant-Microbe Interact., 5, 204-213.

PAGE 108

94 Timmer, L.W. and Duncan, L.W. (1999) Citrus health management. APS press. St. Paul. MN. USDA, NASS (2004) Citrus fruits 2004 summary. www.usda.gov/agency/nass/aggraphs/citrus.htm last accessed on June 15, 2005. Van de Peer, Y. and De Wachter, R. (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for Microsoft Windows environment. Comput Appl Biosci, 10, 569-570. Vauterin, L., Hoste, B., Kersters, K. and Swings, J. (1995) Reclassification of Xanthomonas. International Journal of Systematic Bacteriology, 45, 472-489. Verniere, C., Hartung, J.S., Pruvost, O.P., Civerolo, E.L., Alvarez, A.M., Maestri, P. and Luisetti, J. (1998) Characterization of phenotypically distinct strains of Xanthomonas axonopodis pv. citri from Southwest Asia. Europ. J. Plant Pathol., 104, 477-487. Yang, B., Zhu, W.G., Johnson, L.B. and White, F.F. (2000) The virulence factor avrXa7 of Xanthomonas oryzae pv, oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein. Proceedings Of The National Academy of Sciences of the United States of America, 97, 9807-9812. Yang, Y.N., Defeyter, R. and Gabriel, D.W. (1994) Host-specific symptoms and increased release of Xanthomonas citri and Xanthomonas campestris pv malvacearum from leaves are determined by the 102-Bp tandem repeats of pthA and avrb6, respectively. Molecular Plant-Microbe Interactions, 7, 345-355. Yang, Y.O. and Gabriel, D.W. (1995) Intragenic recombination of a single plant pathogen gene provides a mechanism for the evolution of new host specificities. Journal of Bacteriology, 177, 4963-4968. Yanofsky, M., Montoya, A., Knauf, V., Lowe, B., Gordon, M. and Nester, E. (1985) Limited-host-range plasmid of Agrobacterium tumefaciens : Molecular and genetic analyses of transferred DNA. Journal of Bacteriology, 163, 341-348. Yanofsky, M.F. and Nester, E.W. (1986) Molecular Characterization of a Host-Range-determining locus from Agrobacterium tumefaciens. Journal of Bacteriology, 168, 244-250. Yu, I.C., Fengler, K.A., Clough, S.J. and Bent, A.F. (2000) Identification of arabidopsis mutants exhibiting an altered hypersensitive response in gene-for-gene disease resistance. Molecular Plant-Microbe Interactions, 13, 277-286.

PAGE 109

BIOGRAPHICAL SKETCH Abdulwahid Al-Saadi was born January 25th, 1971, in Mombasa, Kenya. His family moved back to Oman in 1978. He obtained his primary and secondary education in Oman. He earned his Bachelor of Science degree in agriculture at Sultan Qaboos University (S.Q.U) in Oman in October of 1995. After graduating S.Q.U. he worked for the Diwan of Royal court. In 1997 he got a scholarship by the Diwan of Royal Court to pursue the Doctor of Philosophy degree in the field of plant molecular and cellular biology at the University of Florida. After graduating from University of Florida, Abdulwahid will go back to Oman and continue working for the Diwan of Royal Court. 95

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101123_AAAAER INGEST_TIME 2010-11-24T02:41:16Z PACKAGE UFE0011580_00001
21713 F20101123_AADCJK alsaadi_a_Page_063.QC.jpg
6157 F20101123_AADCIW alsaadi_a_Page_049thm.jpg
12233 F20101123_AADCJL alsaadi_a_Page_067.QC.jpg
6798 F20101123_AADCIX alsaadi_a_Page_107thm.jpg
7431 F20101123_AADCKA alsaadi_a_Page_072.QC.jpg
5649 F20101123_AADCJM alsaadi_a_Page_091thm.jpg
5143 F20101123_AADCIY alsaadi_a_Page_013thm.jpg
23172 F20101123_AADCKB alsaadi_a_Page_101.QC.jpg
13592 F20101123_AADCJN alsaadi_a_Page_020.QC.jpg
8364 F20101123_AADCIZ alsaadi_a_Page_033.QC.jpg
23924 F20101123_AADCKC alsaadi_a_Page_058.QC.jpg
20759 F20101123_AADCJO alsaadi_a_Page_038.QC.jpg
21055 F20101123_AADCKD alsaadi_a_Page_041.QC.jpg
6791 F20101123_AADCKE alsaadi_a_Page_050thm.jpg
24323 F20101123_AADCJP alsaadi_a_Page_050.QC.jpg
6521 F20101123_AADCKF alsaadi_a_Page_100.QC.jpg
25574 F20101123_AADCJQ alsaadi_a_Page_085.QC.jpg
24835 F20101123_AADCKG alsaadi_a_Page_090.QC.jpg
16674 F20101123_AADCJR alsaadi_a_Page_045.QC.jpg
22935 F20101123_AADCKH alsaadi_a_Page_018.QC.jpg
3319 F20101123_AADCJS alsaadi_a_Page_069thm.jpg
3097 F20101123_AADCKI alsaadi_a_Page_065thm.jpg
22649 F20101123_AADCJT alsaadi_a_Page_025.QC.jpg
21640 F20101123_AADCKJ alsaadi_a_Page_095.QC.jpg
23534 F20101123_AADCJU alsaadi_a_Page_019.QC.jpg
2739 F20101123_AADCKK alsaadi_a_Page_010thm.jpg
26045 F20101123_AADCJV alsaadi_a_Page_107.QC.jpg
7004 F20101123_AADCKL alsaadi_a_Page_102thm.jpg
22668 F20101123_AADCJW alsaadi_a_Page_094.QC.jpg
2956 F20101123_AADCLA alsaadi_a_Page_068thm.jpg
8204 F20101123_AADCKM alsaadi_a_Page_073.QC.jpg
23517 F20101123_AADCJX alsaadi_a_Page_056.QC.jpg
10390 F20101123_AADCLB alsaadi_a_Page_048.QC.jpg
19156 F20101123_AADCKN alsaadi_a_Page_097.QC.jpg
13988 F20101123_AADCJY alsaadi_a_Page_034.QC.jpg
6127 F20101123_AADCLC alsaadi_a_Page_009.QC.jpg
6128 F20101123_AADCKO alsaadi_a_Page_026thm.jpg
23855 F20101123_AADCJZ alsaadi_a_Page_059.QC.jpg
9862 F20101123_AADCLD alsaadi_a_Page_069.QC.jpg
6005 F20101123_AADCKP alsaadi_a_Page_038thm.jpg
7145 F20101123_AADCLE alsaadi_a_Page_082thm.jpg
20339 F20101123_AADCLF alsaadi_a_Page_040.QC.jpg
4748 F20101123_AADCKQ alsaadi_a_Page_097thm.jpg
13786 F20101123_AADCLG alsaadi_a_Page_076.QC.jpg
22423 F20101123_AADCKR alsaadi_a_Page_055.QC.jpg
6493 F20101123_AADCLH alsaadi_a_Page_017thm.jpg
2153 F20101123_AADCKS alsaadi_a_Page_009thm.jpg
12119 F20101123_AADCLI alsaadi_a_Page_035.QC.jpg
10963 F20101123_AADCKT alsaadi_a_Page_109.QC.jpg
27449 F20101123_AADCLJ alsaadi_a_Page_102.QC.jpg
21603 F20101123_AADCKU alsaadi_a_Page_026.QC.jpg
22638 F20101123_AADCLK alsaadi_a_Page_005.QC.jpg
21430 F20101123_AADCKV alsaadi_a_Page_043.QC.jpg
3415 F20101123_AADCLL alsaadi_a_Page_048thm.jpg
6419 F20101123_AADCKW alsaadi_a_Page_030thm.jpg
2519 F20101123_AADCLM alsaadi_a_Page_073thm.jpg
20629 F20101123_AADCKX alsaadi_a_Page_014.QC.jpg
6553 F20101123_AADCMA alsaadi_a_Page_039thm.jpg
3195 F20101123_AADCLN alsaadi_a_Page_031thm.jpg
3962 F20101123_AADCKY alsaadi_a_Page_032thm.jpg
3369 F20101123_AADCMB alsaadi_a_Page_002.QC.jpg
24455 F20101123_AADCLO alsaadi_a_Page_081.QC.jpg
21844 F20101123_AADCKZ alsaadi_a_Page_088.QC.jpg
8775 F20101123_AADCMC alsaadi_a_Page_010.QC.jpg
1392 F20101123_AADCLP alsaadi_a_Page_002thm.jpg
4923 F20101123_AADCMD alsaadi_a_Page_093thm.jpg
6180 F20101123_AADCLQ alsaadi_a_Page_008thm.jpg
5955 F20101123_AADCME alsaadi_a_Page_080thm.jpg
21796 F20101123_AADCMF alsaadi_a_Page_084.QC.jpg
24034 F20101123_AADCLR alsaadi_a_Page_061.QC.jpg
4154 F20101123_AADCMG alsaadi_a_Page_035thm.jpg
12813 F20101123_AADCLS alsaadi_a_Page_021.QC.jpg
6508 F20101123_AADCMH alsaadi_a_Page_005thm.jpg
4494 F20101123_AADCLT alsaadi_a_Page_071thm.jpg
4251 F20101123_AADCMI alsaadi_a_Page_007thm.jpg
7126 F20101123_AADCLU alsaadi_a_Page_105thm.jpg
6003 F20101123_AADCMJ alsaadi_a_Page_041thm.jpg
5007 F20101123_AADCLV alsaadi_a_Page_095thm.jpg
7435 F20101123_AADCMK alsaadi_a_Page_036.QC.jpg
6559 F20101123_AADCLW alsaadi_a_Page_019thm.jpg
6184 F20101123_AADCML alsaadi_a_Page_101thm.jpg
6423 F20101123_AADCNA alsaadi_a_Page_060thm.jpg
7566 F20101123_AADCMM alsaadi_a_Page_047.QC.jpg
22939 F20101123_AADCLX alsaadi_a_Page_092.QC.jpg
6444 F20101123_AADCNB alsaadi_a_Page_027thm.jpg
5225 F20101123_AADCMN alsaadi_a_Page_011thm.jpg
23004 F20101123_AADCLY alsaadi_a_Page_060.QC.jpg
6331 F20101123_AADCNC alsaadi_a_Page_056thm.jpg
19355 F20101123_AADCMO alsaadi_a_Page_011.QC.jpg
2393 F20101123_AADCLZ alsaadi_a_Page_072thm.jpg
23553 F20101123_AADCND alsaadi_a_Page_096.QC.jpg
22146 F20101123_AADCMP alsaadi_a_Page_051.QC.jpg
4779 F20101123_AADCNE alsaadi_a_Page_045thm.jpg
4432 F20101123_AADCMQ alsaadi_a_Page_067thm.jpg
5454 F20101123_AADCNF alsaadi_a_Page_003.QC.jpg
5977 F20101123_AADCMR alsaadi_a_Page_004thm.jpg
5534 F20101123_AADCNG alsaadi_a_Page_023thm.jpg
11762 F20101123_AADCNH alsaadi_a_Page_037.QC.jpg
4034 F20101123_AADCMS alsaadi_a_Page_070thm.jpg
6190 F20101123_AADCNI alsaadi_a_Page_064thm.jpg
8192 F20101123_AADCMT alsaadi_a_Page_066.QC.jpg
6814 F20101123_AADCNJ alsaadi_a_Page_090thm.jpg
5965 F20101123_AADCMU alsaadi_a_Page_084thm.jpg
6189 F20101123_AADCNK alsaadi_a_Page_025thm.jpg
5240 F20101123_AADCMV alsaadi_a_Page_098thm.jpg
5992 F20101123_AADCNL alsaadi_a_Page_074thm.jpg
6741 F20101123_AADCMW alsaadi_a_Page_053thm.jpg
164785 F20101123_AADCNM UFE0011580_00001.xml FULL
26353 F20101123_AADCMX alsaadi_a_Page_108.QC.jpg
5953 F20101123_AADCOA alsaadi_a_Page_088thm.jpg
4915 F20101123_AADCNN alsaadi_a_Page_006.QC.jpg
1862 F20101123_AADCMY alsaadi_a_Page_003thm.jpg
22906 F20101123_AADCOB alsaadi_a_Page_098.QC.jpg
18613 F20101123_AADCNO alsaadi_a_Page_013.QC.jpg
24143 F20101123_AADCMZ alsaadi_a_Page_099.QC.jpg
6616 F20101123_AADBLA alsaadi_a_Page_058thm.jpg
6848 F20101123_AADCOC alsaadi_a_Page_108thm.jpg
5692 F20101123_AADCNP alsaadi_a_Page_014thm.jpg
1053954 F20101123_AADBLB alsaadi_a_Page_002.tif
3302 F20101123_AADCOD alsaadi_a_Page_109thm.jpg
22208 F20101123_AADCNQ alsaadi_a_Page_022.QC.jpg
1895 F20101123_AADBLC alsaadi_a_Page_056.txt
13904 F20101123_AADCNR alsaadi_a_Page_032.QC.jpg
6822 F20101123_AADBLD alsaadi_a_Page_085thm.jpg
22777 F20101123_AADBKQ alsaadi_a_Page_030.QC.jpg
2734 F20101123_AADCNS alsaadi_a_Page_033thm.jpg
97368 F20101123_AADBLE alsaadi_a_Page_008.jpg
71273 F20101123_AADBLF alsaadi_a_Page_030.jpg
25271604 F20101123_AADBKR alsaadi_a_Page_096.tif
20068 F20101123_AADCNT alsaadi_a_Page_042.QC.jpg
F20101123_AADBLG alsaadi_a_Page_083.tif
60608 F20101123_AADBKS alsaadi_a_Page_020.jp2
9783 F20101123_AADCNU alsaadi_a_Page_046.QC.jpg
5972 F20101123_AADBLH alsaadi_a_Page_040thm.jpg
F20101123_AADBKT alsaadi_a_Page_064.tif
6329 F20101123_AADCNV alsaadi_a_Page_055thm.jpg
F20101123_AADBLI alsaadi_a_Page_106.tif
F20101123_AADBKU alsaadi_a_Page_009.tif
6669 F20101123_AADCNW alsaadi_a_Page_059thm.jpg
30919 F20101123_AADBLJ alsaadi_a_Page_090.pro
21645 F20101123_AADBKV alsaadi_a_Page_049.QC.jpg
22306 F20101123_AADCNX alsaadi_a_Page_064.QC.jpg
25455 F20101123_AADBLK alsaadi_a_Page_008.QC.jpg
F20101123_AADBKW alsaadi_a_Page_026.tif
6635 F20101123_AADCNY alsaadi_a_Page_075thm.jpg
44850 F20101123_AADBLL alsaadi_a_Page_049.pro
68276 F20101123_AADBKX alsaadi_a_Page_093.pro
1720 F20101123_AADCNZ alsaadi_a_Page_087thm.jpg
1051986 F20101123_AADBMA alsaadi_a_Page_011.jp2
44887 F20101123_AADBLM alsaadi_a_Page_055.pro
83921 F20101123_AADBKY alsaadi_a_Page_093.jpg
F20101123_AADBMB alsaadi_a_Page_012.tif
98833 F20101123_AADBLN alsaadi_a_Page_098.jpg
5650 F20101123_AADBKZ alsaadi_a_Page_079thm.jpg
6770 F20101123_AADBMC alsaadi_a_Page_029thm.jpg
5579 F20101123_AADBLO alsaadi_a_Page_015thm.jpg
413604 F20101123_AADBMD alsaadi_a_Page_012.jp2
2063 F20101123_AADBLP alsaadi_a_Page_062thm.jpg
5899 F20101123_AADBME alsaadi_a_Page_062.QC.jpg
82860 F20101123_AADBLQ alsaadi_a_Page_091.pro
39123 F20101123_AADBMF alsaadi_a_Page_015.pro
14632 F20101123_AADBLR alsaadi_a_Page_087.jpg
29214 F20101123_AADBMG alsaadi_a_Page_046.jpg
5937 F20101123_AADBMH alsaadi_a_Page_077thm.jpg
26500 F20101123_AADBLS alsaadi_a_Page_103.QC.jpg
92749 F20101123_AADBMI alsaadi_a_Page_105.jpg
6436 F20101123_AADBLT alsaadi_a_Page_051thm.jpg
F20101123_AADBMJ alsaadi_a_Page_052.tif
4134 F20101123_AADBLU alsaadi_a_Page_008.txt
F20101123_AADBMK alsaadi_a_Page_043.tif
1786 F20101123_AADBLV alsaadi_a_Page_054.txt
190 F20101123_AADBML alsaadi_a_Page_071.txt
26924 F20101123_AADBLW alsaadi_a_Page_082.QC.jpg
685606 F20101123_AADBNA alsaadi_a_Page_070.jp2
7929 F20101123_AADBMM alsaadi_a_Page_044.QC.jpg
132439 F20101123_AADBLX alsaadi_a_Page_104.jp2
7042 F20101123_AADBNB alsaadi_a_Page_086thm.jpg
180 F20101123_AADBMN alsaadi_a_Page_006.txt
1360 F20101123_AADBLY alsaadi_a_Page_045.txt
F20101123_AADBNC alsaadi_a_Page_078.tif
9579 F20101123_AADBMO alsaadi_a_Page_001.pro
F20101123_AADBLZ alsaadi_a_Page_039.tif
2741 F20101123_AADBND alsaadi_a_Page_066thm.jpg
21871 F20101123_AADBMP alsaadi_a_Page_080.QC.jpg
372436 F20101123_AADBNE alsaadi_a_Page_047.jp2
6417 F20101123_AADBMQ alsaadi_a_Page_054thm.jpg
F20101123_AADBNF alsaadi_a_Page_101.tif
73412 F20101123_AADBMR alsaadi_a_Page_058.jpg
28750 F20101123_AADBNG alsaadi_a_Page_068.jpg
49569 F20101123_AADBMS alsaadi_a_Page_057.pro
9114 F20101123_AADBNH alsaadi_a_Page_068.QC.jpg
1051924 F20101123_AADBNI alsaadi_a_Page_022.jp2
45326 F20101123_AADBMT alsaadi_a_Page_043.pro
48068 F20101123_AADBNJ alsaadi_a_Page_056.pro
559 F20101123_AADBMU alsaadi_a_Page_009.txt
6536 F20101123_AADBMV alsaadi_a_Page_052thm.jpg
6001 F20101123_AADBNK alsaadi_a_Page_024thm.jpg
F20101123_AADBMW alsaadi_a_Page_044.tif
5273 F20101123_AADBNL alsaadi_a_Page_092thm.jpg
4003 F20101123_AADBMX alsaadi_a_Page_076thm.jpg
93169 F20101123_AADBOA alsaadi_a_Page_004.jp2
F20101123_AADBNM alsaadi_a_Page_008.tif
134607 F20101123_AADBMY alsaadi_a_Page_088.jp2
F20101123_AADBOB alsaadi_a_Page_018.tif
F20101123_AADBNN alsaadi_a_Page_088.tif
F20101123_AADBMZ alsaadi_a_Page_041.tif
17121 F20101123_AADBOC alsaadi_a_Page_062.jpg
30235 F20101123_AADBNO alsaadi_a_Page_044.jp2
72783 F20101123_AADBOD alsaadi_a_Page_027.jpg
10227 F20101123_AADBNP alsaadi_a_Page_031.QC.jpg
3128 F20101123_AADBOE alsaadi_a_Page_095.txt
451269 F20101123_AADBNQ alsaadi_a_Page_072.jp2
51707 F20101123_AADBOF alsaadi_a_Page_089.pro
5780 F20101123_AADBNR alsaadi_a_Page_042thm.jpg
6286 F20101123_AADBOG alsaadi_a_Page_012.QC.jpg
105958 F20101123_AADBNS alsaadi_a_Page_016.jp2
854 F20101123_AADBOH alsaadi_a_Page_100.txt
3787 F20101123_AADBNT alsaadi_a_Page_091.txt
1737 F20101123_AADBOI alsaadi_a_Page_083thm.jpg
127324 F20101123_AADBOJ UFE0011580_00001.mets
103150 F20101123_AADBNU alsaadi_a_Page_079.jp2
F20101123_AADBNV alsaadi_a_Page_085.tif
10855 F20101123_AADBNW alsaadi_a_Page_067.pro
68540 F20101123_AADBPA alsaadi_a_Page_016.jpg
25612 F20101123_AADBOM alsaadi_a_Page_001.jpg
F20101123_AADBNX alsaadi_a_Page_024.tif
71005 F20101123_AADBPB alsaadi_a_Page_017.jpg
10496 F20101123_AADBON alsaadi_a_Page_002.jpg
22321 F20101123_AADBNY alsaadi_a_Page_036.jpg
69861 F20101123_AADBPC alsaadi_a_Page_018.jpg
18679 F20101123_AADBOO alsaadi_a_Page_003.jpg
15864 F20101123_AADBNZ alsaadi_a_Page_007.QC.jpg
71876 F20101123_AADBPD alsaadi_a_Page_019.jpg
64455 F20101123_AADBOP alsaadi_a_Page_004.jpg
41154 F20101123_AADBPE alsaadi_a_Page_020.jpg
69346 F20101123_AADBOQ alsaadi_a_Page_005.jpg
37308 F20101123_AADBPF alsaadi_a_Page_021.jpg
14218 F20101123_AADBOR alsaadi_a_Page_006.jpg
79486 F20101123_AADBPG alsaadi_a_Page_022.jpg
62032 F20101123_AADBOS alsaadi_a_Page_007.jpg
60428 F20101123_AADBPH alsaadi_a_Page_023.jpg
21012 F20101123_AADBOT alsaadi_a_Page_009.jpg
66215 F20101123_AADBPI alsaadi_a_Page_024.jpg
27627 F20101123_AADBOU alsaadi_a_Page_010.jpg
67882 F20101123_AADBPJ alsaadi_a_Page_025.jpg
67073 F20101123_AADBPK alsaadi_a_Page_026.jpg
64697 F20101123_AADBOV alsaadi_a_Page_011.jpg
66364 F20101123_AADBPL alsaadi_a_Page_028.jpg
F20101123_AADBOW alsaadi_a_Page_012.jpg
76069 F20101123_AADBPM alsaadi_a_Page_029.jpg
59875 F20101123_AADBOX alsaadi_a_Page_013.jpg
53155 F20101123_AADBQA alsaadi_a_Page_045.jpg
31371 F20101123_AADBPN alsaadi_a_Page_031.jpg
62680 F20101123_AADBOY alsaadi_a_Page_014.jpg
24757 F20101123_AADBQB alsaadi_a_Page_047.jpg
47645 F20101123_AADBPO alsaadi_a_Page_032.jpg
64428 F20101123_AADBOZ alsaadi_a_Page_015.jpg
34120 F20101123_AADBQC alsaadi_a_Page_048.jpg
23915 F20101123_AADBPP alsaadi_a_Page_033.jpg
66637 F20101123_AADBQD alsaadi_a_Page_049.jpg
39760 F20101123_AADBPQ alsaadi_a_Page_034.jpg
73290 F20101123_AADBQE alsaadi_a_Page_050.jpg
35246 F20101123_AADBPR alsaadi_a_Page_035.jpg
68279 F20101123_AADBQF alsaadi_a_Page_051.jpg
34969 F20101123_AADBPS alsaadi_a_Page_037.jpg
68512 F20101123_AADBQG alsaadi_a_Page_052.jpg
64162 F20101123_AADBPT alsaadi_a_Page_038.jpg
74192 F20101123_AADBQH alsaadi_a_Page_053.jpg
73835 F20101123_AADBPU alsaadi_a_Page_039.jpg
69516 F20101123_AADBQI alsaadi_a_Page_054.jpg
60683 F20101123_AADBPV alsaadi_a_Page_040.jpg
67567 F20101123_AADBQJ alsaadi_a_Page_055.jpg
72000 F20101123_AADBQK alsaadi_a_Page_056.jpg
64720 F20101123_AADBPW alsaadi_a_Page_041.jpg
75089 F20101123_AADBQL alsaadi_a_Page_057.jpg
62007 F20101123_AADBPX alsaadi_a_Page_042.jpg
73884 F20101123_AADBRA alsaadi_a_Page_075.jpg
72777 F20101123_AADBQM alsaadi_a_Page_059.jpg
66933 F20101123_AADBPY alsaadi_a_Page_043.jpg
40995 F20101123_AADBRB alsaadi_a_Page_076.jpg
70101 F20101123_AADBQN alsaadi_a_Page_060.jpg
23871 F20101123_AADBPZ alsaadi_a_Page_044.jpg
72733 F20101123_AADBRC alsaadi_a_Page_077.jpg
73560 F20101123_AADBQO alsaadi_a_Page_061.jpg
79617 F20101123_AADBRD alsaadi_a_Page_078.jpg
67878 F20101123_AADBQP alsaadi_a_Page_063.jpg
73461 F20101123_AADBRE alsaadi_a_Page_079.jpg
74637 F20101123_AADBQQ alsaadi_a_Page_064.jpg
72646 F20101123_AADBRF alsaadi_a_Page_080.jpg
25644 F20101123_AADBQR alsaadi_a_Page_065.jpg
79467 F20101123_AADBRG alsaadi_a_Page_081.jpg
23897 F20101123_AADBQS alsaadi_a_Page_066.jpg
82349 F20101123_AADBRH alsaadi_a_Page_082.jpg
35429 F20101123_AADBQT alsaadi_a_Page_067.jpg
14518 F20101123_AADBRI alsaadi_a_Page_083.jpg
33139 F20101123_AADBQU alsaadi_a_Page_069.jpg
72245 F20101123_AADBRJ alsaadi_a_Page_084.jpg
35088 F20101123_AADBQV alsaadi_a_Page_070.jpg
82520 F20101123_AADBRK alsaadi_a_Page_085.jpg
36701 F20101123_AADBQW alsaadi_a_Page_071.jpg
81739 F20101123_AADBRL alsaadi_a_Page_086.jpg
85290 F20101123_AADBSA alsaadi_a_Page_104.jpg
72348 F20101123_AADBRM alsaadi_a_Page_088.jpg
25604 F20101123_AADBQX alsaadi_a_Page_072.jpg
87548 F20101123_AADBSB alsaadi_a_Page_106.jpg
79229 F20101123_AADBRN alsaadi_a_Page_089.jpg
28760 F20101123_AADBQY alsaadi_a_Page_073.jpg
92190 F20101123_AADBSC alsaadi_a_Page_107.jpg
78054 F20101123_AADBRO alsaadi_a_Page_090.jpg
66478 F20101123_AADBQZ alsaadi_a_Page_074.jpg
97087 F20101123_AADBSD alsaadi_a_Page_108.jpg
101151 F20101123_AADBRP alsaadi_a_Page_091.jpg
32924 F20101123_AADBSE alsaadi_a_Page_109.jpg
98281 F20101123_AADBRQ alsaadi_a_Page_092.jpg
27931 F20101123_AADBSF alsaadi_a_Page_001.jp2
94321 F20101123_AADBRR alsaadi_a_Page_094.jpg
6050 F20101123_AADBSG alsaadi_a_Page_002.jp2
87748 F20101123_AADBRS alsaadi_a_Page_095.jpg
100424 F20101123_AADBRT alsaadi_a_Page_096.jpg
19139 F20101123_AADBSH alsaadi_a_Page_003.jp2
76227 F20101123_AADBRU alsaadi_a_Page_097.jpg
101062 F20101123_AADBSI alsaadi_a_Page_005.jp2
102085 F20101123_AADBRV alsaadi_a_Page_099.jpg
12848 F20101123_AADBSJ alsaadi_a_Page_006.jp2
25658 F20101123_AADBRW alsaadi_a_Page_100.jpg
1051983 F20101123_AADBSK alsaadi_a_Page_007.jp2
75753 F20101123_AADBRX alsaadi_a_Page_101.jpg
1051969 F20101123_AADBSL alsaadi_a_Page_008.jp2
101335 F20101123_AADBTA alsaadi_a_Page_028.jp2
411239 F20101123_AADBSM alsaadi_a_Page_009.jp2
95627 F20101123_AADBRY alsaadi_a_Page_102.jpg
114863 F20101123_AADBTB alsaadi_a_Page_029.jp2
591053 F20101123_AADBSN alsaadi_a_Page_010.jp2
96514 F20101123_AADBRZ alsaadi_a_Page_103.jpg
107888 F20101123_AADBTC alsaadi_a_Page_030.jp2
85825 F20101123_AADBSO alsaadi_a_Page_013.jp2
42076 F20101123_AADBTD alsaadi_a_Page_031.jp2
94275 F20101123_AADBSP alsaadi_a_Page_014.jp2
68737 F20101123_AADBTE alsaadi_a_Page_032.jp2
888279 F20101123_AADBSQ alsaadi_a_Page_015.jp2
26566 F20101123_AADBTF alsaadi_a_Page_033.jp2
107207 F20101123_AADBSR alsaadi_a_Page_017.jp2
799748 F20101123_AADBTG alsaadi_a_Page_034.jp2
105839 F20101123_AADBSS alsaadi_a_Page_018.jp2
662215 F20101123_AADBTH alsaadi_a_Page_035.jp2
109965 F20101123_AADBST alsaadi_a_Page_019.jp2
491340 F20101123_AADBTI alsaadi_a_Page_036.jp2
531819 F20101123_AADBSU alsaadi_a_Page_021.jp2
435008 F20101123_AADBTJ alsaadi_a_Page_037.jp2
1051981 F20101123_AADBSV alsaadi_a_Page_023.jp2
96259 F20101123_AADBTK alsaadi_a_Page_038.jp2
97147 F20101123_AADBSW alsaadi_a_Page_024.jp2
113552 F20101123_AADBTL alsaadi_a_Page_039.jp2
103492 F20101123_AADBSX alsaadi_a_Page_025.jp2
107933 F20101123_AADBUA alsaadi_a_Page_056.jp2
92306 F20101123_AADBTM alsaadi_a_Page_040.jp2
100951 F20101123_AADBSY alsaadi_a_Page_026.jp2
111402 F20101123_AADBUB alsaadi_a_Page_057.jp2
97076 F20101123_AADBTN alsaadi_a_Page_041.jp2
108113 F20101123_AADBUC alsaadi_a_Page_058.jp2
90761 F20101123_AADBTO alsaadi_a_Page_042.jp2
109158 F20101123_AADBSZ alsaadi_a_Page_027.jp2
109380 F20101123_AADBUD alsaadi_a_Page_059.jp2
101058 F20101123_AADBTP alsaadi_a_Page_043.jp2
106188 F20101123_AADBUE alsaadi_a_Page_060.jp2
75023 F20101123_AADBTQ alsaadi_a_Page_045.jp2
111552 F20101123_AADBUF alsaadi_a_Page_061.jp2
281804 F20101123_AADBTR alsaadi_a_Page_046.jp2
26081 F20101123_AADCAA alsaadi_a_Page_021.pro
18276 F20101123_AADBUG alsaadi_a_Page_062.jp2
639847 F20101123_AADBTS alsaadi_a_Page_048.jp2
84634 F20101123_AADCAB alsaadi_a_Page_022.pro
98805 F20101123_AADBUH alsaadi_a_Page_063.jp2
99150 F20101123_AADBTT alsaadi_a_Page_049.jp2
5049 F20101123_AADCAC alsaadi_a_Page_023.pro
106533 F20101123_AADBUI alsaadi_a_Page_064.jp2
112035 F20101123_AADBTU alsaadi_a_Page_050.jp2
44416 F20101123_AADCAD alsaadi_a_Page_024.pro
29482 F20101123_AADBUJ alsaadi_a_Page_065.jp2
103034 F20101123_AADBTV alsaadi_a_Page_051.jp2
46316 F20101123_AADCAE alsaadi_a_Page_025.pro
41612 F20101123_AADBUK alsaadi_a_Page_066.jp2
104292 F20101123_AADBTW alsaadi_a_Page_052.jp2
45555 F20101123_AADCAF alsaadi_a_Page_026.pro
648734 F20101123_AADBUL alsaadi_a_Page_067.jp2
109586 F20101123_AADBTX alsaadi_a_Page_053.jp2
664190 F20101123_AADBUM alsaadi_a_Page_068.jp2
107907 F20101123_AADBTY alsaadi_a_Page_054.jp2
49970 F20101123_AADCAG alsaadi_a_Page_027.pro
157811 F20101123_AADBVA alsaadi_a_Page_085.jp2
607707 F20101123_AADBUN alsaadi_a_Page_069.jp2
102428 F20101123_AADBTZ alsaadi_a_Page_055.jp2
45108 F20101123_AADCAH alsaadi_a_Page_028.pro
112681 F20101123_AADBVB alsaadi_a_Page_086.jp2
750566 F20101123_AADBUO alsaadi_a_Page_071.jp2
53149 F20101123_AADCAI alsaadi_a_Page_029.pro
11740 F20101123_AADBVC alsaadi_a_Page_087.jp2
65379 F20101123_AADBUP alsaadi_a_Page_073.jp2
49487 F20101123_AADCAJ alsaadi_a_Page_030.pro
150531 F20101123_AADBVD alsaadi_a_Page_089.jp2
99996 F20101123_AADBUQ alsaadi_a_Page_074.jp2
18789 F20101123_AADCAK alsaadi_a_Page_031.pro
103376 F20101123_AADBVE alsaadi_a_Page_090.jp2
113173 F20101123_AADBUR alsaadi_a_Page_075.jp2
7293 F20101123_AADCBA alsaadi_a_Page_048.pro
29605 F20101123_AADCAL alsaadi_a_Page_032.pro
1051965 F20101123_AADBVF alsaadi_a_Page_091.jp2
58724 F20101123_AADBUS alsaadi_a_Page_076.jp2
50908 F20101123_AADCBB alsaadi_a_Page_050.pro
15711 F20101123_AADCAM alsaadi_a_Page_033.pro
1051976 F20101123_AADBVG alsaadi_a_Page_092.jp2
134665 F20101123_AADBUT alsaadi_a_Page_077.jp2
45283 F20101123_AADCBC alsaadi_a_Page_051.pro
6676 F20101123_AADCAN alsaadi_a_Page_034.pro
F20101123_AADBVH alsaadi_a_Page_093.jp2
151278 F20101123_AADBUU alsaadi_a_Page_078.jp2
46130 F20101123_AADCBD alsaadi_a_Page_052.pro
8767 F20101123_AADCAO alsaadi_a_Page_035.pro
1051985 F20101123_AADBVI alsaadi_a_Page_094.jp2
134825 F20101123_AADBUV alsaadi_a_Page_080.jp2
48679 F20101123_AADCBE alsaadi_a_Page_053.pro
6952 F20101123_AADCAP alsaadi_a_Page_036.pro
1051963 F20101123_AADBVJ alsaadi_a_Page_095.jp2
151063 F20101123_AADBUW alsaadi_a_Page_081.jp2
45207 F20101123_AADCBF alsaadi_a_Page_054.pro
16952 F20101123_AADCAQ alsaadi_a_Page_037.pro
1051970 F20101123_AADBVK alsaadi_a_Page_096.jp2
113896 F20101123_AADBUX alsaadi_a_Page_082.jp2
48723 F20101123_AADCBG alsaadi_a_Page_058.pro
43190 F20101123_AADCAR alsaadi_a_Page_038.pro
1051947 F20101123_AADBVL alsaadi_a_Page_097.jp2
11628 F20101123_AADBUY alsaadi_a_Page_083.jp2
F20101123_AADBWA alsaadi_a_Page_005.tif
51750 F20101123_AADCAS alsaadi_a_Page_039.pro
1051973 F20101123_AADBVM alsaadi_a_Page_098.jp2
134236 F20101123_AADBUZ alsaadi_a_Page_084.jp2
50048 F20101123_AADCBH alsaadi_a_Page_059.pro
F20101123_AADBWB alsaadi_a_Page_006.tif
40433 F20101123_AADCAT alsaadi_a_Page_040.pro
1051977 F20101123_AADBVN alsaadi_a_Page_099.jp2
47661 F20101123_AADCBI alsaadi_a_Page_060.pro
F20101123_AADBWC alsaadi_a_Page_007.tif
43249 F20101123_AADCAU alsaadi_a_Page_041.pro
518898 F20101123_AADBVO alsaadi_a_Page_100.jp2
51933 F20101123_AADCBJ alsaadi_a_Page_061.pro
F20101123_AADBWD alsaadi_a_Page_010.tif
40840 F20101123_AADCAV alsaadi_a_Page_042.pro
117820 F20101123_AADBVP alsaadi_a_Page_101.jp2
6901 F20101123_AADCBK alsaadi_a_Page_062.pro
F20101123_AADBWE alsaadi_a_Page_011.tif
12590 F20101123_AADCAW alsaadi_a_Page_044.pro
144524 F20101123_AADBVQ alsaadi_a_Page_102.jp2
44300 F20101123_AADCBL alsaadi_a_Page_063.pro
F20101123_AADBWF alsaadi_a_Page_013.tif
32861 F20101123_AADCAX alsaadi_a_Page_045.pro
1051971 F20101123_AADBVR alsaadi_a_Page_103.jp2
36874 F20101123_AADCCA alsaadi_a_Page_079.pro
47836 F20101123_AADCBM alsaadi_a_Page_064.pro
F20101123_AADBWG alsaadi_a_Page_014.tif
10854 F20101123_AADCAY alsaadi_a_Page_046.pro
140978 F20101123_AADBVS alsaadi_a_Page_105.jp2
46560 F20101123_AADCCB alsaadi_a_Page_080.pro
15450 F20101123_AADCBN alsaadi_a_Page_065.pro
F20101123_AADBWH alsaadi_a_Page_015.tif
F20101123_AADCAZ alsaadi_a_Page_047.pro
128957 F20101123_AADBVT alsaadi_a_Page_106.jp2
51749 F20101123_AADCCC alsaadi_a_Page_081.pro
18818 F20101123_AADCBO alsaadi_a_Page_066.pro
F20101123_AADBWI alsaadi_a_Page_016.tif
137711 F20101123_AADBVU alsaadi_a_Page_107.jp2
34594 F20101123_AADCCD alsaadi_a_Page_082.pro
4708 F20101123_AADCBP alsaadi_a_Page_068.pro
F20101123_AADBWJ alsaadi_a_Page_017.tif
1051873 F20101123_AADBVV alsaadi_a_Page_108.jp2
2649 F20101123_AADCCE alsaadi_a_Page_083.pro
10186 F20101123_AADCBQ alsaadi_a_Page_069.pro
F20101123_AADBWK alsaadi_a_Page_019.tif
43492 F20101123_AADBVW alsaadi_a_Page_109.jp2
43440 F20101123_AADCCF alsaadi_a_Page_084.pro
6011 F20101123_AADCBR alsaadi_a_Page_070.pro
F20101123_AADBWL alsaadi_a_Page_020.tif
F20101123_AADBVX alsaadi_a_Page_001.tif
54364 F20101123_AADCCG alsaadi_a_Page_085.pro
F20101123_AADBXA alsaadi_a_Page_037.tif
3136 F20101123_AADCBS alsaadi_a_Page_071.pro
F20101123_AADBWM alsaadi_a_Page_021.tif
F20101123_AADBVY alsaadi_a_Page_003.tif
33946 F20101123_AADCCH alsaadi_a_Page_086.pro
F20101123_AADBXB alsaadi_a_Page_038.tif
17646 F20101123_AADCBT alsaadi_a_Page_072.pro
F20101123_AADBWN alsaadi_a_Page_022.tif
F20101123_AADBVZ alsaadi_a_Page_004.tif
F20101123_AADBXC alsaadi_a_Page_040.tif
39561 F20101123_AADCBU alsaadi_a_Page_073.pro
F20101123_AADBWO alsaadi_a_Page_023.tif
2731 F20101123_AADCCI alsaadi_a_Page_087.pro
F20101123_AADBXD alsaadi_a_Page_042.tif
46406 F20101123_AADCBV alsaadi_a_Page_074.pro
F20101123_AADBWP alsaadi_a_Page_025.tif
46904 F20101123_AADCCJ alsaadi_a_Page_088.pro
51572 F20101123_AADCBW alsaadi_a_Page_075.pro
F20101123_AADBWQ alsaadi_a_Page_027.tif
80318 F20101123_AADCCK alsaadi_a_Page_092.pro
F20101123_AADBXE alsaadi_a_Page_045.tif
25749 F20101123_AADCBX alsaadi_a_Page_076.pro
F20101123_AADBWR alsaadi_a_Page_028.tif
18009 F20101123_AADCDA alsaadi_a_Page_109.pro
83761 F20101123_AADCCL alsaadi_a_Page_094.pro
F20101123_AADBXF alsaadi_a_Page_046.tif
46546 F20101123_AADCBY alsaadi_a_Page_077.pro
F20101123_AADBWS alsaadi_a_Page_029.tif
517 F20101123_AADCDB alsaadi_a_Page_001.txt
70322 F20101123_AADCCM alsaadi_a_Page_095.pro
F20101123_AADBXG alsaadi_a_Page_047.tif
51719 F20101123_AADCBZ alsaadi_a_Page_078.pro
F20101123_AADBWT alsaadi_a_Page_030.tif
119 F20101123_AADCDC alsaadi_a_Page_002.txt
84670 F20101123_AADCCN alsaadi_a_Page_096.pro
8423998 F20101123_AADBXH alsaadi_a_Page_048.tif
F20101123_AADBWU alsaadi_a_Page_031.tif
385 F20101123_AADCDD alsaadi_a_Page_003.txt
49807 F20101123_AADCCO alsaadi_a_Page_097.pro
F20101123_AADBXI alsaadi_a_Page_049.tif
F20101123_AADBWV alsaadi_a_Page_032.tif
1750 F20101123_AADCDE alsaadi_a_Page_004.txt
64300 F20101123_AADCCP alsaadi_a_Page_098.pro
F20101123_AADBXJ alsaadi_a_Page_050.tif
F20101123_AADBWW alsaadi_a_Page_033.tif
1825 F20101123_AADCDF alsaadi_a_Page_005.txt
98973 F20101123_AADCCQ alsaadi_a_Page_099.pro
F20101123_AADBXK alsaadi_a_Page_051.tif
F20101123_AADBWX alsaadi_a_Page_034.tif
2994 F20101123_AADCDG alsaadi_a_Page_007.txt
18850 F20101123_AADCCR alsaadi_a_Page_100.pro
F20101123_AADBXL alsaadi_a_Page_053.tif
F20101123_AADBWY alsaadi_a_Page_035.tif
774 F20101123_AADCDH alsaadi_a_Page_010.txt
F20101123_AADBYA alsaadi_a_Page_069.tif
55338 F20101123_AADCCS alsaadi_a_Page_101.pro
F20101123_AADBXM alsaadi_a_Page_054.tif
25265604 F20101123_AADBWZ alsaadi_a_Page_036.tif
2168 F20101123_AADCDI alsaadi_a_Page_011.txt
F20101123_AADBYB alsaadi_a_Page_070.tif
71195 F20101123_AADCCT alsaadi_a_Page_102.pro
F20101123_AADBXN alsaadi_a_Page_055.tif
F20101123_AADBYC alsaadi_a_Page_071.tif
61312 F20101123_AADCCU alsaadi_a_Page_103.pro
F20101123_AADBXO alsaadi_a_Page_056.tif
383 F20101123_AADCDJ alsaadi_a_Page_012.txt
F20101123_AADBYD alsaadi_a_Page_072.tif
62380 F20101123_AADCCV alsaadi_a_Page_104.pro
F20101123_AADBXP alsaadi_a_Page_057.tif
1734 F20101123_AADCDK alsaadi_a_Page_013.txt
1054428 F20101123_AADBYE alsaadi_a_Page_073.tif
66755 F20101123_AADCCW alsaadi_a_Page_105.pro
F20101123_AADBXQ alsaadi_a_Page_058.tif
2124 F20101123_AADCEA alsaadi_a_Page_029.txt
1657 F20101123_AADCDL alsaadi_a_Page_014.txt
F20101123_AADBYF alsaadi_a_Page_074.tif
60246 F20101123_AADCCX alsaadi_a_Page_106.pro
F20101123_AADBXR alsaadi_a_Page_059.tif
1953 F20101123_AADCEB alsaadi_a_Page_030.txt
1667 F20101123_AADCDM alsaadi_a_Page_015.txt
F20101123_AADBYG alsaadi_a_Page_075.tif
65895 F20101123_AADCCY alsaadi_a_Page_107.pro
F20101123_AADBXS alsaadi_a_Page_060.tif
1964 F20101123_AADCDN alsaadi_a_Page_016.txt
F20101123_AADBYH alsaadi_a_Page_076.tif
60123 F20101123_AADCCZ alsaadi_a_Page_108.pro
F20101123_AADBXT alsaadi_a_Page_061.tif
754 F20101123_AADCEC alsaadi_a_Page_031.txt
2003 F20101123_AADCDO alsaadi_a_Page_017.txt
F20101123_AADBYI alsaadi_a_Page_077.tif
F20101123_AADBXU alsaadi_a_Page_062.tif
1234 F20101123_AADCED alsaadi_a_Page_032.txt
1952 F20101123_AADCDP alsaadi_a_Page_018.txt
F20101123_AADBYJ alsaadi_a_Page_079.tif
F20101123_AADBXV alsaadi_a_Page_063.tif
850 F20101123_AADCEE alsaadi_a_Page_033.txt
2081 F20101123_AADCDQ alsaadi_a_Page_019.txt
F20101123_AADBYK alsaadi_a_Page_080.tif
F20101123_AADBXW alsaadi_a_Page_065.tif
351 F20101123_AADCEF alsaadi_a_Page_034.txt
1083 F20101123_AADCDR alsaadi_a_Page_020.txt
F20101123_AADBYL alsaadi_a_Page_081.tif
F20101123_AADBXX alsaadi_a_Page_066.tif
457 F20101123_AADCEG alsaadi_a_Page_035.txt
F20101123_AADBZA alsaadi_a_Page_100.tif
2442 F20101123_AADCDS alsaadi_a_Page_021.txt
F20101123_AADBYM alsaadi_a_Page_082.tif
F20101123_AADBXY alsaadi_a_Page_067.tif
434 F20101123_AADCEH alsaadi_a_Page_036.txt
F20101123_AADBZB alsaadi_a_Page_102.tif
3550 F20101123_AADCDT alsaadi_a_Page_022.txt
F20101123_AADBYN alsaadi_a_Page_084.tif
F20101123_AADBXZ alsaadi_a_Page_068.tif
1195 F20101123_AADCEI alsaadi_a_Page_037.txt
F20101123_AADBZC alsaadi_a_Page_103.tif
249 F20101123_AADCDU alsaadi_a_Page_023.txt
F20101123_AADBYO alsaadi_a_Page_086.tif
1802 F20101123_AADCEJ alsaadi_a_Page_038.txt
F20101123_AADBZD alsaadi_a_Page_104.tif
1849 F20101123_AADCDV alsaadi_a_Page_024.txt
F20101123_AADBYP alsaadi_a_Page_087.tif
F20101123_AADBZE alsaadi_a_Page_105.tif
1871 F20101123_AADCDW alsaadi_a_Page_025.txt
F20101123_AADBYQ alsaadi_a_Page_089.tif
2036 F20101123_AADCEK alsaadi_a_Page_039.txt
F20101123_AADBZF alsaadi_a_Page_107.tif
1805 F20101123_AADCDX alsaadi_a_Page_026.txt
F20101123_AADBYR alsaadi_a_Page_090.tif
1925 F20101123_AADCFA alsaadi_a_Page_058.txt
1646 F20101123_AADCEL alsaadi_a_Page_040.txt
F20101123_AADBZG alsaadi_a_Page_108.tif
2006 F20101123_AADCDY alsaadi_a_Page_027.txt
F20101123_AADBYS alsaadi_a_Page_091.tif
2009 F20101123_AADCFB alsaadi_a_Page_059.txt
1721 F20101123_AADCEM alsaadi_a_Page_041.txt
F20101123_AADBZH alsaadi_a_Page_109.tif
F20101123_AADCDZ alsaadi_a_Page_028.txt
F20101123_AADBYT alsaadi_a_Page_092.tif
1879 F20101123_AADCFC alsaadi_a_Page_060.txt
1709 F20101123_AADCEN alsaadi_a_Page_042.txt
1279 F20101123_AADBZI alsaadi_a_Page_002.pro
F20101123_AADBYU alsaadi_a_Page_093.tif
2043 F20101123_AADCFD alsaadi_a_Page_061.txt
1867 F20101123_AADCEO alsaadi_a_Page_043.txt
8002 F20101123_AADBZJ alsaadi_a_Page_003.pro
F20101123_AADBYV alsaadi_a_Page_094.tif
316 F20101123_AADCFE alsaadi_a_Page_062.txt
542 F20101123_AADCEP alsaadi_a_Page_044.txt
43476 F20101123_AADBZK alsaadi_a_Page_004.pro
F20101123_AADBYW alsaadi_a_Page_095.tif
1781 F20101123_AADCFF alsaadi_a_Page_063.txt
715 F20101123_AADCEQ alsaadi_a_Page_046.txt
46170 F20101123_AADBZL alsaadi_a_Page_005.pro
F20101123_AADBYX alsaadi_a_Page_097.tif
1948 F20101123_AADCFG alsaadi_a_Page_064.txt
462 F20101123_AADCER alsaadi_a_Page_047.txt
4462 F20101123_AADBZM alsaadi_a_Page_006.pro
F20101123_AADBYY alsaadi_a_Page_098.tif
841 F20101123_AADCFH alsaadi_a_Page_065.txt
332 F20101123_AADCES alsaadi_a_Page_048.txt
71939 F20101123_AADBZN alsaadi_a_Page_007.pro
F20101123_AADBYZ alsaadi_a_Page_099.tif
1632 F20101123_AADCFI alsaadi_a_Page_066.txt
F20101123_AADCET alsaadi_a_Page_049.txt
99108 F20101123_AADBZO alsaadi_a_Page_008.pro
567 F20101123_AADCFJ alsaadi_a_Page_067.txt
2042 F20101123_AADCEU alsaadi_a_Page_050.txt
14361 F20101123_AADBZP alsaadi_a_Page_009.pro
306 F20101123_AADCFK alsaadi_a_Page_068.txt
1791 F20101123_AADCEV alsaadi_a_Page_051.txt
18223 F20101123_AADBZQ alsaadi_a_Page_010.pro
1839 F20101123_AADCEW alsaadi_a_Page_052.txt
53538 F20101123_AADBZR alsaadi_a_Page_011.pro
1983 F20101123_AADCGA alsaadi_a_Page_085.txt
501 F20101123_AADCFL alsaadi_a_Page_069.txt
1914 F20101123_AADCEX alsaadi_a_Page_053.txt
9394 F20101123_AADBZS alsaadi_a_Page_012.pro
1354 F20101123_AADCGB alsaadi_a_Page_086.txt
308 F20101123_AADCFM alsaadi_a_Page_070.txt
1818 F20101123_AADCEY alsaadi_a_Page_055.txt
38956 F20101123_AADBZT alsaadi_a_Page_013.pro
139 F20101123_AADCGC alsaadi_a_Page_087.txt
2083 F20101123_AADCFN alsaadi_a_Page_072.txt
1961 F20101123_AADCEZ alsaadi_a_Page_057.txt
41636 F20101123_AADBZU alsaadi_a_Page_014.pro
1795 F20101123_AADCGD alsaadi_a_Page_088.txt
2214 F20101123_AADCFO alsaadi_a_Page_073.txt
48834 F20101123_AADBZV alsaadi_a_Page_016.pro
1893 F20101123_AADCGE alsaadi_a_Page_089.txt
F20101123_AADCFP alsaadi_a_Page_074.txt
50076 F20101123_AADBZW alsaadi_a_Page_017.pro
1242 F20101123_AADCGF alsaadi_a_Page_090.txt
F20101123_AADCFQ alsaadi_a_Page_075.txt
49233 F20101123_AADBZX alsaadi_a_Page_018.pro
3608 F20101123_AADCGG alsaadi_a_Page_092.txt
1029 F20101123_AADCFR alsaadi_a_Page_076.txt
51497 F20101123_AADBZY alsaadi_a_Page_019.pro
3088 F20101123_AADCGH alsaadi_a_Page_093.txt
1783 F20101123_AADCFS alsaadi_a_Page_077.txt
25937 F20101123_AADBZZ alsaadi_a_Page_020.pro
3709 F20101123_AADCGI alsaadi_a_Page_094.txt
1890 F20101123_AADCFT alsaadi_a_Page_078.txt
3836 F20101123_AADCGJ alsaadi_a_Page_096.txt
1469 F20101123_AADCFU alsaadi_a_Page_079.txt
2338 F20101123_AADCGK alsaadi_a_Page_097.txt
1784 F20101123_AADCFV alsaadi_a_Page_080.txt
3028 F20101123_AADCGL alsaadi_a_Page_098.txt
1894 F20101123_AADCFW alsaadi_a_Page_081.txt
1368 F20101123_AADCFX alsaadi_a_Page_082.txt
6586 F20101123_AADCHA alsaadi_a_Page_081thm.jpg
4302 F20101123_AADCGM alsaadi_a_Page_099.txt
136 F20101123_AADCFY alsaadi_a_Page_083.txt
4891 F20101123_AADCHB alsaadi_a_Page_034thm.jpg
2238 F20101123_AADCGN alsaadi_a_Page_101.txt
F20101123_AADCFZ alsaadi_a_Page_084.txt
3587 F20101123_AADCHC alsaadi_a_Page_046thm.jpg
2888 F20101123_AADCGO alsaadi_a_Page_102.txt
24519 F20101123_AADCHD alsaadi_a_Page_057.QC.jpg
2494 F20101123_AADCGP alsaadi_a_Page_103.txt
5622 F20101123_AADCHE alsaadi_a_Page_099thm.jpg
2524 F20101123_AADCGQ alsaadi_a_Page_104.txt
2369 F20101123_AADCHF alsaadi_a_Page_036thm.jpg
2701 F20101123_AADCGR alsaadi_a_Page_105.txt
22520 F20101123_AADCHG alsaadi_a_Page_016.QC.jpg
2470 F20101123_AADCGS alsaadi_a_Page_106.txt
24494 F20101123_AADCHH alsaadi_a_Page_078.QC.jpg
2660 F20101123_AADCGT alsaadi_a_Page_107.txt
20388 F20101123_AADCHI alsaadi_a_Page_015.QC.jpg
2444 F20101123_AADCGU alsaadi_a_Page_108.txt
23473 F20101123_AADCHJ alsaadi_a_Page_027.QC.jpg
762 F20101123_AADCGV alsaadi_a_Page_109.txt
4331 F20101123_AADCHK alsaadi_a_Page_020thm.jpg
2608 F20101123_AADCGW alsaadi_a_Page_001thm.jpg
24621 F20101123_AADCHL alsaadi_a_Page_029.QC.jpg
3602580 F20101123_AADCGX alsaadi_a.pdf
5409 F20101123_AADCIA alsaadi_a_Page_094thm.jpg
26285 F20101123_AADCHM alsaadi_a_Page_105.QC.jpg
2600 F20101123_AADCGY alsaadi_a_Page_047thm.jpg
6599 F20101123_AADCIB alsaadi_a_Page_078thm.jpg
21461 F20101123_AADCGZ alsaadi_a_Page_024.QC.jpg
23616 F20101123_AADCIC alsaadi_a_Page_053.QC.jpg
6557 F20101123_AADCHN alsaadi_a_Page_057thm.jpg
18042 F20101123_AADCID alsaadi_a_Page_023.QC.jpg
5927 F20101123_AADCHO alsaadi_a_Page_022thm.jpg
4406 F20101123_AADCIE alsaadi_a_Page_021thm.jpg
7131 F20101123_AADCHP alsaadi_a_Page_103thm.jpg
21009 F20101123_AADCIF alsaadi_a_Page_004.QC.jpg
24105 F20101123_AADCHQ alsaadi_a_Page_075.QC.jpg
21708 F20101123_AADCIG alsaadi_a_Page_028.QC.jpg
2103 F20101123_AADCHR alsaadi_a_Page_100thm.jpg
24389 F20101123_AADCIH alsaadi_a_Page_089.QC.jpg
7919 F20101123_AADCHS alsaadi_a_Page_001.QC.jpg
26704 F20101123_AADCII alsaadi_a_Page_086.QC.jpg
6562 F20101123_AADCHT alsaadi_a_Page_061thm.jpg
6585 F20101123_AADCIJ alsaadi_a_Page_089thm.jpg
25538 F20101123_AADCHU alsaadi_a_Page_104.QC.jpg
2128 F20101123_AADCIK alsaadi_a_Page_012thm.jpg
20714 F20101123_AADCHV alsaadi_a_Page_093.QC.jpg
23426 F20101123_AADCIL alsaadi_a_Page_017.QC.jpg
24263 F20101123_AADCHW alsaadi_a_Page_039.QC.jpg
21874 F20101123_AADCIM alsaadi_a_Page_077.QC.jpg
6137 F20101123_AADCHX alsaadi_a_Page_028thm.jpg
5931 F20101123_AADCJA alsaadi_a_Page_063thm.jpg
3652 F20101123_AADCIN alsaadi_a_Page_037thm.jpg
F20101123_AADCHY alsaadi_a_Page_018thm.jpg
5071 F20101123_AADCJB alsaadi_a_Page_083.QC.jpg
6254 F20101123_AADCHZ alsaadi_a_Page_043thm.jpg
11522 F20101123_AADCJC alsaadi_a_Page_070.QC.jpg
1763 F20101123_AADCIO alsaadi_a_Page_006thm.jpg
6652 F20101123_AADCJD alsaadi_a_Page_106thm.jpg
23058 F20101123_AADCIP alsaadi_a_Page_079.QC.jpg
7075 F20101123_AADCJE alsaadi_a_Page_104thm.jpg
5129 F20101123_AADCIQ alsaadi_a_Page_087.QC.jpg
6195 F20101123_AADCJF alsaadi_a_Page_016thm.jpg
5520 F20101123_AADCIR alsaadi_a_Page_096thm.jpg
23655 F20101123_AADCJG alsaadi_a_Page_052.QC.jpg
12818 F20101123_AADCIS alsaadi_a_Page_071.QC.jpg
24775 F20101123_AADCJH alsaadi_a_Page_091.QC.jpg
2451 F20101123_AADCIT alsaadi_a_Page_044thm.jpg
24784 F20101123_AADCJI alsaadi_a_Page_106.QC.jpg
21334 F20101123_AADCIU alsaadi_a_Page_074.QC.jpg
22996 F20101123_AADCJJ alsaadi_a_Page_054.QC.jpg

Permanent Link: http://ufdc.ufl.edu/UFE0011580/00001

Material Information

Title: Phenotypic Characterization and Sequence Analysis of pthA Homologs from Five Pathogenic Variant Groups of Xanthomonas citri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011580:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011580/00001

Material Information

Title: Phenotypic Characterization and Sequence Analysis of pthA Homologs from Five Pathogenic Variant Groups of Xanthomonas citri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011580:00001

This item has the following downloads:

Full Text







Copyright 2005


Abdulwahid Al-Saadi

This dissertation is dedicated to H.E Mahmood A. Makki for his continuous support,
encouragement and belief in me. He passed away last year without seeing me make it to
the end and successfully complete my PhD. I am sure that he would have been very
happy and appreciative for my accomplishment.


I would thank God for giving patience and blessing me with a lot of colleagues and

friends who stood by my side when I needed them most. The completion of this

dissertation would not have been possible without the help and support of many people

both in Gainesville and back home in Oman. First I would like to express my gratitude to

my advisor Dr. Dean W. Gabriel for his support, guidance and patience with me during

my time in his lab. I would also like to thank him for providing me financial support

towards the end my PhD. I would like to thank Dr. Jeff Jones for his support,

encouragement, guidance, friendship and listening to me when I was feeling down and

ready to give up. I would also like to thank my other committee members Dr. G. Moore

and Dr. R. Lee for being on my committee, support and correcting this manuscript

I would like to thank Dr. G. Wisler for her support and encouragement. I would

like to give special thanks to Mr. Gary Marlow for his continued help, support, scientific

discussions and just being a good friend that was there for me when I needed him both in

and outside the lab. I want to also thank Dr. Joseph Ready and Dr. Young Duan for their

help, discussions and advice in the lab. I would like to thanks other students in my lab

especially Basma, Adriana and Asha for their help and support. I also thank all former

members of the lab. I thank faculty, staff and students in the PMCB program and the

Department of Plant Pathology who helped and encouraged me in many ways. I would

like to thank everyone in the Department of Plant Industry (DPI) for providing help in

maintenance of citrus plants in the quarantine facility. Special thanks go to my friend

Eduardo Carlos and his family for all their support and encouragement. I also want to

thank my two study partners Mohamed Al-Khairy and Yousef Al-Dligan. I also thank

Mohamed Al-Matar and Fahad Al-Saqqaf.

I would like to recognize two people in the Diwan of Royal Court who have

recently passed away. H.E Said Seif bin Hamed and H.E Mahmood Maki who supported

me coming to the US to get my PhD. Without their support and encouragement I would

have not been able to complete my degree. I would like to thank my advisor and mentor

in Oman, Dr. Ahmed Hamooda, for continuously supporting and encouraging me

throughout my time here. I thank him for being my advocate and believing in me even

when many were ready to give up on me. I cannot say thank you enough to this man who

took me under his wings and guided me through difficult times. I would like to thank

Mr. Yahya Al-Zidjali for his support. Special thanks go to Dr. Yahya Al-Hinai for his

support and friendship. I want to thank Mrs. Nihaya, Dr. Magdy, Dr. Deitz,

Abdulrahman Al-Siyabi, Abduljalil Attiya, Ammer Al-Manthiri and everyone in the

Diwan of Royal Court who helped and supported me.

I thank my parents, Abubaker and Khadija, for unconditional support, love and

encouragement. I also thank my brothers and sisters for their support and encouragement

during my study here. I thank them for making me the person I am. I also like to thank

Yasser Al-Ajmi, Mohamed Al-Balushi, Fida Al-Raissy, Aqeel Abdawani and all my

friends in Oman. I thank and remember my twin brother Abdulrahman who passed away

a few days after our birth. He has always been with me and provided me with strength,

patience and hope. Finally I have to say special thanks to my wife May and son Muadh

for being there for me as they waited patiently for me during my time here.



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .............. ......... ... ................. ...................... ..

LIST OF FIGURES ......... ....... .................... .......... ....... ............ xi

A B S T R A C T .............................................. ..........................................x iii


1 IN TR O D U C T IO N ............................................................. .. ......... ...... .....

C itru s.......... .......................... .................................................. .
Florida Citrus ................................... ................................. ......... 2
C itru s C a n k e r ................... .................................................... ................ .. 3
R resistance to C itrus C anker............................................................... ....................5
C controlling C itrus C anker............................................................................ ....... ...... 5
O objectives ............................................................... ..... ...... ......... 6

OF CITRU S CANKER DISEA SE .................................... ............................. ....... 10

Introduction................................... .................................. ........... 10
M material and M methods .................. .................... ............................ .. .............. 11
Strains, Plasm ids and Culture M edia.......................... ......... ...................11
Recombinant DNA Techniques.............................. ........ .......................11
Plant Inoculations ............... .... .... .... .. ..................................... .. 12
In vitro G row th K inetics............................................... ............................. 12
Inplanta Grow th K inetics ........................................................................13
R e su lts .......................... ... .. ...... ................ ................. ................ 13
Pathogenicity Phenotypes of X citri Strains ............................... .................... 13
In v itro G ro w th ............................................................................................... 14
Growth Kinetics in plant .. ............................................................. 14
D isc u ssio n .................................................... ................... ................ 1 5

FACTOR(S) IN CITRUS CANKER STRAINS. ............... .................. ............24

Introdu action ...................................... ................................................. 24
M material and M methods ............................................................... .. ............... 26
Bacterial Strains, Plasmids and Culture Media............................................26
Recombinant DN A Techniques...................................... ......................... 26
V sector Preparation................................................ ............ ..27
Packaging and Transfection ........................................ .......................... 27
Plant Inoculations ......................................... ................... ........ 28
T riparental M atings ......................... .. .................... .. ...... ........... 28
R results ........................... .... ............. ...... ................ ..... ........................... 29
Xanthomonas citri pv citri A 3213 Strain Genomic Library .............................29
Screening of 3213 Library in Xc270 ..........................................................29
D discussion ..................................... .................................. ......... 29


Introduction ............ .. ........ ............. ......... ............ .......... 35
M material and M methods ........... .. ........... ..............................................................36
Bacterial Strains, Plasmids and Culture M edia....... .... ................................... 36
Recombinant DN A Techniques...................................... ......................... 37
DNA Library Construction.................... ....... ........................... 37
P lant Inoculations ........................... .................... .. ......... .......... 38
Southern Hybridization Analysis ............................................. ............... 38
Colony Hybridization .............................. .. .. ........ .... .. ................. 38
T riparental M atings ......................... .. .................... .. ...... ........... 39
Sequence A analysis ofpth G enes ........................................ ...... ............... 40
R e su lts .................. ......... .. .. ......................................................................................... 4 1
Southern B lot A nalysis..................... ............................................4 1
Cloning, Characterization and Sequencing ofpthA Homologs from X citri
A *, A ", B and C Strain s ...................... ....... ..... ....... ...... .........................4 1
Inactivation and Complementation of Genes pthB and pthC in X citri pv
aurantifolii ............... ............. .......... .. ............. ......................... 43
None of the pthA Homologs from Group A Strain 3213 Increased the Host
Range of Group A* Strain 270 to Include Grapefruit................................... 44
Sequence Analysis ofpthA Homologs from All Known X citri Groups............44
D isc u ssio n ............... .................................. .................... ................ 4 5

5 SUMMARY AND CONCLUSION .......... ............................................... 60


A SEQUEN CE OF pthC ................................................................. ............... 63

B SEQUEN CE OF pthAW ........ .............................. ............................ ............... 66

C SEQUENCE OF pthA* .......................... ......................................... 70

D SE Q U EN C E O F p thA *-2 ................................................................ ..................... 74


L IST O F R EFER EN CE S ......... ..... .... ........... ................................................87

B IO G R A PH IC A L SK E TCH ..................................................................... ..................95


Table p

2-1. Strains and plasm ids used in this study .......................................... ................... 18

2-2. Phenotypic differences among X citri strains................................................. 19

3-1. Strains and plasmids used in this study...................................................... 31

4-1. Strains and plasmids used in this study .......................................... ...............49

4-2. Phenotypic responses of X citri strains in 2 citrus hosts ......................................51

4-3. Amino acid sequence identity between pathogenicity genes from X citri strains...52


Figure p

1-1. W world citrus production. ............................................................ ....................... 7

1-2. Status of citrus canker disease in the state of Florida. ................... ...............8

1-3. Citrus canker sym ptom s in citrus. ........................................................................9

2-1. Inoculation of strains of different citrus canker groups in grapefruit and Key
lim e .......................................................................................... . 2 0

2-2. Inoculation of several different A* strains in Duncan grapefruit.............................21

2-3. Growth of X citri strains in PYGM medium. ................... .................22

2-4. inplanta growth of X. citri strains in Mexican/Key lime and Duncan grapefruit. ..23

3-1. Scheme for cosmid vector preparation and DNA cloning. .....................................32

3-2. DNA fractionation of X citri 3213 genomic DNA ............................................33

3-3. Restriction profiles of random clones from X citi 3213 genomic library ...............34

4-1. Southern Hybridization analysis ofX. citri strains hybridized with the BamHI
internal fragm ent ofp thA ............................................................. .....................53

4-2. Colony Hybridization of E. coli with cloned X0053 A" plasmid DNA fragments
using 32P-labeledp thA .............. .......................... ........................ ............... 54

4-3. Complementation of A strain knockout B21.2 (pthA::Tn5) with pthA homologs
from A strain X 0053 on citrus........................................ ............. ............... 55

4-4. Complementation of A strain knockout B21.2 (pthA::Tn5) withpthA homologs
in citru s ...............................................................................56

4-5. Analysis ofpthA and its three homologs in A* strain Xc270................................57

4-6. Neighbor-joining dengogram of members of avrBs3/pthA genes from different
species and pathovars of Xanthomonas....................... ........ ..... .......... 58

4-7. Sequence alignment of the predicted amino acids encoded in the main variable
portion of the repeat region of all 13 pthA homologs. ..........................................59

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



Abdulwahid Al-Saadi

August 2005

Chair: Dean W. Gabriel
Major Department: Plant Molecular and Cellular Biology

Citrus canker is an economically important disease that is caused by five different

groups ofXanthomonas citri strains: three from Asia (A, A* and A") and two from South

America (B and C). In artificial inoculations of grapefruit, only strains of the A and B

groups appear to be virulent; strains of the C and A" group elicit an hypersensitive

response (HR) and the A* strains show various levels of reduced virulence. The tested

A* and A" strains also grew to much lower concentrations in grapefruit compared to the

A strain. The strains from all five citrus canker groups were virulent in Mexican lime,

but the B and C strains elicited a distinctive canker lesion that was almost white in

appearance. Strains from the Asiatic groups grew faster than South American B and C

group strains in artificial media. Mexican lime and grapefruit can be used in artificial

inoculations to readily distinguish all known strains causing citrus canker disease within

10 days without the need for other laboratory tests. Attempts to identify positive host

range determinants from X citri were unsuccessful suggesting the possibility of negative

factors (avirulence) being involved in determining host range ofX. citri.

Every X citri strain carries multiple DNA fragments that hybridize with pthA, a

member of the avrBs3/pthA gene family from X citri group A that is required for

pathogenicity and growth of X. citri in citrus. Three newpthA homologs were cloned and

sequenced from canker groups A" (pthA W) and A* (pthA andpthA *-2), and compared

with pthA, pthB and pthC. Homologs pthA, pthB, pthC pthAWand pthA* all have 17.5,

nearly identical, direct tandem repeats of 34 amino acids and all complemented a

pthA::Tn5 knockout mutation in an X citri group A strain B21.2. Although grapefruit is

a differential host and groups A* and A" are avirulent in grapefruit, none of the pthA

homologs appeared responsible for the avirulence phenotype by cross complementation

tests. Furthermore, none of the fourpthA homologs from the wide host range group A

strain 3213, includingpthA, conferred an increase in host range of group A* or A" strains

to include grapefruit. pthA*-2 carried only 15.5 repeats and did not confer either

pathogenicity or avirulence to B21.2 in any citrus species tested. Phylogenetic studies

separate pthA homologues into two groups, Asiatic and South American groups.

Analysis of the predicted amino acid sequences of all sequenced pthA homologs from X

citri indicated that a specific set of amino acid residues in two variable regions of the 17th

direct tandem repeat may be required for pathogenicity in citrus.



Citrus is one of the major fruit crops in the world. It is thought to have originated

in Southeast Asia and India. Citrus was introduced into the new world in the 16th century

by Spanish and Portuguese explorers (Allen, 2000). World production of citrus is

estimated to be about one hundred million metric tons (FAOSTAT data, 2004,

http://apps.fao.org ). World citrus production has seen a substantial increase over the last

40 years (Figure 1-1). Major citrus producing countries include the United States, Brazil,

China, Argentina, Spain and Mexico (Figure 1-1b). Currently, citrus produced in North

and South America account for the majority of citrus production worldwide. Although

citrus is mainly grown for the fresh fruit market, large citrus-based juice industries have

developed in many countries such as Brazil and the United States. Generally citrus is

grown between 400 North and 400 South latitudes where minimum temperatures stay

above 200 240 F (Timmer and Duncan, 1999).

Citrus is a perennial evergreen with an expected economical production expectancy

of about 50 years (Timmer and Duncan, 1999). Originally citrus was grown on its own

root system, but now most citrus production plants are grafted onto various rootstocks.

Rootstocks are selected for their inherent characteristics that affect production, cold

hardiness, salinity tolerance, disease resistance and most importantly compatibility with

scion tissue.

The majority of citrus varieties grown for commercial purposes are in the genus

Citrus including grapefruit (Citrus paradisi Macfad), sweet orange (C. sinensis (L.)

Osbeck), tangerine/mandarin (C. reticulata Blanco), lemon (C. limon Burm), lime (C.

aurantifolia (Christm.) Swingle), pummelo (C. grandis Osbeck) and citron (C. medical

L.). Other citrus relatives that are not in this genus are kumquats (Fortunella spp.) and

trifoliate orange (Poncirus trifoliata). The latter is used only as a rootstock.

Florida Citrus

Total citrus production in the U.S. in 2004 is estimated at 16.2 million tons with an

estimated value of $ 2.4 billion (USDA, 2004). States that produce citrus include Florida,

California, Texas, Arizona, Alabama, Mississippi and Louisiana. Florida produces about

80% of the U.S. citrus, of which 20% 25% is sold for fresh fruit consumption. In 2004,

Florida produced 242 million boxes of oranges and 40.9 million boxes of grapefruit

(USDA, 2004). Citrus is an important economic crop for the state of Florida, as the

worth of the commercial citrus industry in Florida is estimated to be more than $8.5


Diseases play a critical role in limiting citrus production as citrus is mainly grown

in the same tropical and subtropical areas that also favor the growth of microorganisms.

This provides great challenges to citrus growers since they must balance cost of

controlling diseases against lower projected profit margins. An example of a citrus

disease that is a serious problem for citrus growers is citrus canker disease. Citrus canker

has destroyed many citrus growing areas around the world. Florida authorities are

putting major resources towards completely eradicating this disease. It is important to

gain a better understanding of this disease because of the quarantine of citrus canker as a

pest. Citrus canker it is still spreading, despite $50 million spent between 1996 and 1999

in eradication efforts (Schubert et al., 2001).

Citrus Canker

Citrus canker is one of the major disease problems facing citrus producers in

Florida and many areas of the world (Danos et al., 1981; Elgoorani, 1989; Gottwald et al.,

2001). Citrus canker, also known as bacterial canker, has destroyed large areas of citrus

production (Fegan et al., 2004; Schubert et al., 2001). The pathogen is thought to have

originated in Southeast Asia, from where it has spread to other citrus producing areas.

Asiatic citrus canker was introduced into the United States for the first time in 1912 from

infected nursery material. It took approximately 20 years to eliminate this outbreak of

citrus canker (Loucks and Florida. Division of Plant Industry., 1934). In 1986, citrus

canker reappeared for the second time in both residential and commercial areas around

Tampa, Florida. As a result of this outbreak a new citrus canker eradication program was

initiated (Brown, 2001). Eight years later, Florida declared it had eradicated citrus canker

at a cost of $27 million (Agrios, 1997). Citrus canker reappeared for the third time in

Florida in 1995 in Dade County, and has resulted in the destruction of more than four

million trees in both residential and commercial areas (FDACS data, 2005). Figure 1-2

shows the status of citrus canker disease in the state of Florida in 2004. Currently, citrus

canker has been detected in 20 Florida counties. The total area under quarantine is

estimated at 1,397.82 sq. miles (FDACS data, 2005, www.doacs.state.fl.us). Strong

regulatory and quarantine measures were implemented in the latest effort to eradicate the

disease. Healthy citrus trees anywhere within a radius of 1900 ft from infected trees are

deemed exposed and are destroyed (Gottwald et al., 2002).

Citrus canker is caused by several pathogenic variants of Xanthomonas citri. In

general, five different groups of pathogenic variants are recognized: A, B, C, A* and A"

(Gabriel et al., 1989; Stall et al., 1982; Vemiere et al., 1998). In the literature two other

groups of citrus canker are described: "D" and "E" strains. Although there is a single

extant "D" strain that was reported in Mexico, it is thought that the fungal pathogen

Alternaria limicola was responsible for that disease outbreak (Schubert et al., 2001). The

"E" strain group was found in grapefruit only in nurseries in Florida and was described as

a new "form" of citrus canker. However, strains in this group do not cause hyperplasia

and do not infect fruit or mature citrus in groves. The disease is now recognized as

distinct from citrus canker and was named citrus bacterial leaf spot caused by

Xanthomonas axonopodis pv. citrumelo .

Citrus canker symptoms appear after the pathogen enters the leaves through the

stomata or wounds and multiplies in the intercellular spaces of the spongy mesophyll

(Gottwald et al., 1988; 1989; Graham et al., 1992; Pruvost et al., 2002). The initial

symptom is the formation of water-soaked tissue followed by growth of yellow halos on

the infection margins. As the disease progresses, erumpent necrotic lesions are formed

on leaves, stems and fruits (Figure 1-3). At advanced disease stages, plants defoliate and

fruit can drop prematurely. At the microscopic level, infected cells divide (hyperplasia)

and enlarge (hypertrophy); and the pustules rupture the surface of the leaf tissue and

release bacteria that become a source of inoculum for further infections (Swarup et al.,


The citrus canker bacterium is transmitted by wind-blown rain, although

machinery, animals and humans can also transmit it (Bock et al., 2005; Danos et al.,

1984). An important factor that contributed to the spread of citrus canker in this last

infection in Florida was the Asian citrus leaf miner Phyllocnistis citrella (Cook, 1988).

The leaf miner is probably not a vector for canker, but instead it provides wounds that

allow entry of bacteria into citrus leaves (Belasque et al., 2005). Although citrus canker

does not cause systemic damage, it results in reduced marketability of citrus fruit

especially those produced for the fresh market.

Resistance to Citrus Canker

Citrus genotypes show differences in susceptibility to this disease. Grapefruit,

sweet orange and Mexican lime are highly susceptible. Sour orange, lemon and tangelo

are moderately susceptible, whereas mandarin, citron and kumquat are less susceptible

(Schubert et al., 2001). It is not clear if resistance in citrus is a result of active defense

responses or if it is due to physical characteristics of different citrus genotypes, e.g.

number of stomata or thickness of the leaf tissue that may influence the number of

bacterial particles entering citrus leaves (Goto, 1969; McLean and Lee, 1922).

Controlling Citrus Canker

The most effective control of citrus canker is application of strict regulatory and

quarantine measures that will protect against the introduction of new infections (Graham

et al., 2004). Most citrus producing areas put many resources into monitoring and

regulating citrus canker. That is because it is so difficult to eliminate the bacteria once it

has become established. Once the disease is established in an area, eradication of both

infected and exposed trees and burning plant material are used to help eliminate and

prevent spread of disease. Multiple applications of copper based compounds were found

to help control the disease to some extent (Hwang, 1949). In some cases pruning infected

branches is used to control and eliminate the source of infection. Since citrus canker

spreads by wind driven rain, wind brakes were found to be useful in controlling this

disease (Gottwald and Timmer, 1995).


The aim of this study was to identify host range determinants of canker causing

strains. I was interested in identifying genes that are necessary for increasing the host

range of canker causing strains ofX. citri. These new strains that are limited in host

range were used to screen for genes involved in host range determination. Further

understanding of how host range is determined may provide important tools in

developing control measures. The specific objectives of this work include the following:

Objective 1. Characterizing canker causing Xanthomonas citri A* and A" group strains.

Objective 2. Attempting to identify and characterize positive host range factors) in

canker causing Xanthomonas citri.

Objective 3. Isolating pathogenicity gene (pthA) homologs from A* and A" groups and

characterize their role in host range determination.





S 61-



1961 1965 1970 1975 1980 1985 1990 1995 2000

1% 14'oL Brazil
1% U USA
1%- China
1% Mexico
2%- Spain
2% 1 India
0 Iran
2% HINigeria
2% 13% Turkey
2% Pakistan
3 South Africa
3 l Japan
3% Greece
4 Morocco
4% 12% Thailand
4% others
6% 6%


Figure 1-1. World citrus production. A. world citrus production between 1961 2000

expressed in metric tons. B. Percent production by countries (FAOSTAT data,

2004, http://apps.fao.org).

FBrst detected: May 2005
COaranine area: none
Grrve Itree deCsanyh:TBD
Dooryard vrs destroyed: none

Firit leected:Mae 2005 a
Quarantine ama: none '
Grove iqel ded~:yefTBD :
Dooryard trees destirye: none

First detected: December 201
Quarantine areas none
Grove lreesd dlMrnyl 1 ,2U566
DOearav res ideoBd: 3,fi37 3 ',3

FIrst detecteMa 1997
Quarantine areas: one
Grov iwees destroyed:106.582
Domyard trees destroyed: 6379

First detecred Ocltobe 2002
Quarantine area 4 sq, mi.
GonWe tree destroyed; none
Firt detected; October 2001
Quoarantie a :rea D Sot (26-5 sQ-ile, /
Ven s (19.75 sq. mles)
Grove trees destroyed431,44 /
D -tryrd r" sdstroyed* 1.4A5,

First detected October M04
Oiearantine wh : Farab ee Grade (11.5 so. mi.: /
Hurrnti Sre (q.25 i4Qiilei
Grve trees destroyed: 14454
DEoyard treesdestroved: t. /b

Firsu tler. Atr,IMc i'W 12
Qluarantine rea; CpeCp r 6.l (35 sqmi,.t
Plne llard (1.5sq. iles~
Groae trees destroyed:6 t62 /
Doosyardtrees- ivei-erl. 5,0 5

First detectedtJune 1998
Quarantinei wrea:4$q. miles
Gove trees destroyed: 299949
loorvard trees destroyed: 309

,/ ,/ I,
/ t Fest detected: February 1999
ii Quarantiise areas Seaws (2 sQmil; \
I W: e rt llli rGr (;. q qi h ii *
I CIollle(4sq.miles)
Grove treesdestroyedt&85,346

First tf Octt obM 2002
I QLurairwieareaincne
SGrove trees destroyed: none
I Dooryard trees destroyed:

First detected; May2O?2
Quarmli ne are& HNaranja (18 sq. milesi,
Venus 119.75 smniles)
Grove trees destroyed: 71 3,
Doryard trees deirpwd: none

First detete d:July 2002
Quaramine areas: SW Orlando
14 sq.nrrns
Groe trees destroyed: 9232
Doorwyard trees destroyed: 35,563

First detected: Nowemner 2004
Quarairtin area: none
Gi6,e trees distroed: 0
Dooryard trees desoyed: 1,611

First detected:January 202. Feb 200
Qtarmwaiie aree-r nfn
S GMroe trees t.dstr d: tn
I Dooryard trees destroyed: 1,0l

First detected: Deember 204
l QuaramIinre ar+w: Indrip Road
I 120I q. nile
SGrowe trees destroyed: 2,146
I Dooryard trees destroyed:936

First detected: Decemerw2004
SQuBapari e areas: ldria Road
12os sq. mites),
A Rllapattah,.' I .,q 1iIes
SGrve trees destroyed:13.,625
Dooryaird tre estroyed:5,665
First detected: September 001l
Quaratine areas: none
Grove tree destroyed: 101,000
I Dooryard rees destroyed: none

First detected:October 1995
I Qutirts reapp1, 1149 V q milw
I Darydl trees desiryed:669,425
SGrove trees destroyed: 724651

First detected: Big Pine Key-June 20iS
Marathon ey- Jauary2004
Quararire area: KI(t (119 sqrni.
DBoryard trees deslroyed:515
Growe trees destroyed: none

Figure 1-2. Status of citrus canker disease in the state of Florida. (FDACS data, 2005,

Figure 1-3. Citrus canker symptoms in citrus. Citrus canker symptoms on leaves, fruit
and stem. At advanced disease stages, plants defoliate and fruit can drop




Citrus canker disease is caused by several different pathogenic variants of

Xanthomonas citri (ex Hasse) (Brunings and Gabriel, 2003; Gabriel et al., 1989).

Although the taxonomy of these strains is controversial (Gabriel et al., 1989; Vauterin et

al., 1995), five groups of pathogenic variants are recognized, based primarily on field

symptoms: A, B, C, A* and Aw (Gabriel et al., 1989; Stall et al., 1982; Sun et al., 2004;

Verniere et al., 1998). The Asiatic (A) group (X. citri pv citri A) is the most severe and

widely spread throughout the world. The B and C groups (X. citri pv aurantifolii B and

C), which are also known as cancrosis B and cancrosis C, respectively, have been found

only in South America. These South American groups are phylogenetically distinct and

grow more slowly on artificial media than strains from all other groups (Brunings and

Gabriel, 2003; Goto, 1969; Stall et al., 1982). The B and C strains also have a reduced

host range compared to the A group. In addition, the C strains elicit an hypersensitive

response (HR) in grapefruit (Citrus paradise) (Stall et al., 1982). Recently two new

variants of the A group of citrus canker strains were identified and designated A* and A"

(Sun et al., 2004; Vemiere et al., 1998). Both new groups are limited in host range to

Key/Mexican lime (C. aurantifolia); the A" strain causes an HR when inoculated in

grapefruit at high concentrations (Sun et al., 2004). The A* and A" strains ofX. citri are

phylogenetically most closely related to the A group (Cubero and Graham, 2002)

Various diagnostic aids have been used to confirm citrus canker disease, including

PCR (Cubero and Graham, 2002; Mavrodieva et al., 2004), antibodies (Alvarez et al.,

1991) and microscopy. These tests can be critical if the disease appears in regions where

it has not previously been seen or has not been recently observed. Indeed, a fungal

disease was misdiagnosed as citrus canker disease in Mexico (Stapleton, 1986; Stapleton

and Garza-lopez, 1988), and a bacterial leaf spot disease was misdiagnosed as citrus

canker in Florida in 1984 (Schubert et al., 1996). Once confirmation of citrus canker

disease has been made, only host range tests can be used to reliably determine the strain

group or pathovar. Historically, these studies relied on sweet orange, mandarin orange,

lemon, lime and grapefruit (Stall and Civerolo, 1991). In this study, we report the use of

Duncan grapefruit and Mexican lime as differential hosts to differentiate strains from all

variant groups of citrus canker disease.

Material and Methods

Strains, Plasmids and Culture Media

Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are

listed in Table 2-1 along with their relevant characteristics and source or reference. E.

coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al. 1989).

Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS)

medium at 30 C as described by Gabriel et al. (1989). Antibiotics were used at the

following final concentrations ([tg/ml): rifampin (Rif), 75; spectinomycin (Sp), 35.

Recombinant DNA Techniques

Xanthomonas total DNA was prepared as described by Gabriel and De Feyter

(1992) and also using Amersham Biosciences DNA Isolation Kit as described by the

manufacturer. Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al.,

1989) and Xanthomonas (Defeyter and Gabriel, 1991). QIAGEN's QIAprep and plasmid

midi kits were also used to isolate plasmid DNA from E. coli and Xanthomonas as

described by the manufacturer. Southern hybridizations were performed using nylon

membranes as described (Lazo and Gabriel, 1987).

Plant Inoculations

Duncan grapefruit and Mexican lime plants were grown and maintained under

natural light in the quarantine greenhouse facility at the Division of Plant Industry,

Florida Department of Agriculture, in Gainesville. Temperatures in this greenhouse

ranged from 250 C to 350 C, with 50 % to 100 % relative humidity. All inoculations were

carried out in this facility.

Liquid cultures of the tested strains were grown in PYGM medium at 300 C for

approximately 24 hr. Cultures were centrifuged @ 1000g for 3 min and cells resuspended

in equal volumes of sterile tap water (saturated with CaCO3) and infiltrated into the

abaxial surface of young, freshly flushed partially expanded citrus leaves at two

concentrations (105 cfu/ml for "low" and 108 cfu/ml for "high" levels) using the blunt end

of tuberculin syringe as described (Gabriel et al., 1989). Observations were taken 5-10

days after inoculation.

In vitro Growth Kinetics

Liquid cultures ofX. citri 3213, B69, Xc270 and X0053 were prepared in PYGM

medium and grown at 370 C overnight with slow shaking. The following day, 100 ml of

fresh PYGM was inoculated with 50 [tl of the starter culture. Optical density (OD600)

readings were taken at 0, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 and 38 hr.

This experiment was repeated three times.

In plant Growth Kinetics

For bacterial cell counts, whole leaves were infiltrated as described. For each

strain, three leaves of each host were infiltrated. Bacterial cell counts from the inoculated

leaves were taken at days 0, 1, 6, 10 and 14. A number 7 cork borer (about 1 cm2) was

used to cut one leaf disk from each inoculated leaf per time point. Each treatment, a leaf

disk from each of the three inoculated leaves was placed in a mortar and pestle and

macerated together (in 1 ml sterile tap water saturated with CaCO3). Once homogeneity

was obtained, ten-fold serial dilution were made ranging from 10-1 to 10-9. Ten

microliters droplets of each dilution were spread on PYGM plates without antibiotics and

allowed to grow for 48 hr at 28 C. Colonies were counted from the most readily scored

dilution, and the number of cfu per cm2 of leaf tissue was calculated. The experiments

were repeated three times. Populations were expressed as log cfu/cm2 of leaf tissue.


Pathogenicity Phenotypes of X citri Strains

In addition to the previously described A (3213), B (B69) and C (Xc340) strains,

newly described A* (Xc205, Xc270, Xc280, Xc290, Xc322 and Xc406) and A" (X0053)

strains (Sun et al., 2004; Verniere et al., 1998) were inoculated on citrus. All strains

tested caused hyperplastic lesions in Mexican lime that developed 5- 9 days after

inoculation (Figure 2-1). In Duncan grapefruit (Citrus paradisi) differential reactions

were observed that distinguished each group. Strains from group A elicited typical

canker symptoms in grapefruit within 6 days, but B strains elicited a whitish canker

phenotype within 10 days. C and A" strains elicited a hypersensitive response (HR) in

grapefruit. The A* strains, which were originally isolated from Southwest Asia, also

gave distinct phenotypes in Duncan grapefruit (Figure 2-2). Strains Xc205 and Xc322

did not elicit canker symptoms at low concentration (104 cfu/ml). Strain Xc406 elicited a

weak canker at low concentration, but when inoculated at high concentration, elicited

typical canker lesions. Strains Xc270, Xc280 and Xc290 did not elicit canker in Duncan

grapefruit at either low or high inoculum concentrations. A* strains could be subdivided

into three groups; A*-I, A*-2 and A*-3 (Figure 2-2). Table 2-2 summarizes symptoms

of different X citri groups on grapefruit and lime.

In vitro Growth

In vitro growth of X citri strains in liquid medium was measured by optical density

(OD600) changes recorded over time (Figure 2-3). Strains 3213 (A), X0053 (A") and

Xc270 (A*) were very similar in their growth in PYGM medium. B69 (B) strain was

significantly slower in its growth compared to A, AW and A* strains. On agar plates, the

South American B and C strains grew similarly on a variety of media, and always slower

than the A, A" and A* strains.

Growth Kinetics in plant

Growth kinetics of X. citri strains 3213 (A), 270 (A*) and X0053 (A") were studied

in Duncan grapefruit and Mexican lime leaves. In Mexican lime, growth of all three

strains was similar (Figure 2-4). However the growth kinetics of these strains was

different in Duncan grapefruit (Figure 2-4). Growth of the A" strain X0053 was reduced

by one order of magnitude as compared to A strain 3213. This reduction in growth was

noticeable 6 days post-inoculation and continued through day 14 when the comparison

ended. Growth of A* strain 270 was reduced by at least two orders of magnitude after 6

days post-inoculation as compared to strain 3213. Strain 270 did not continue to increase

after 6 days growth inplanta.


Inoculation of different X citri strains on just two citrus host species allowed the

differentiation of all known X citri groups based on their symptoms. All tested strains of

X citri caused canker in Key/Mexican lime. Lime is a very susceptible host compared to

other citrus species or types. The B and C strains elicited a characteristic whitish canker

in key/Mexican lime that is readily distinguished from canker symptoms caused by other

strains. This is probably due to the fact that both strains are phylogeneticlly very similar

and likely share common pathogenicity factors. Indeed, the pathogenicity elicitorspthB

and pthC from the B and C strains were found to be closely related to each other (98%

similarity) at the amino acid level and different from pthA homologues from A, A* and

A" strains. The latter were closely related to each other (Chapter 4).

Strains from different groups ofX. citri exhibited quite different phenotypic

responses when inoculated in Duncan grapefruit leaves. Except for the A and B groups,

which elicited typical canker symptoms, strains from all other groups appeared much less

virulent. X0053 from the A" group elicited necrotic symptoms in grapefruit that took 5

to 10 days to appear. Unlike the Aw strain, the C group strain C340 elicited a relatively

fast HR reaction in grapefruit that took only 3 days to appear. In both cases, the necrosis

and HR, potential avr gene function is indicated. The A* group showed the most within-

group variation among strains in grapefruit; all A* strains were characterized by reduced

virulence as compared to A and B strains and lacked any evidence of eliciting necrosis or

an HR. Strains Xc205 and Xc322 were only capable of causing canker in Duncan

grapefruit when inoculated at high concentrations (108-109 cfu/ml). At (lower)

concentrations that more closely resemble field conditions, no canker symptoms were

observed with these strains. Strain Xc406 elicited a very weak canker phenotype when

inoculated at low concentration, but elicited normal canker symptoms when artificially

inoculated at high concentrations. Strains Xc270, Xc280 and Xc290 were not able to

elicit canker in grapefruit leaves at either concentration. All tested A* strains were

unable to cause canker at low inoculum concentrations or an HR at high concentrations.

Inplanta growth kinetics of strains representing the fast growing A, A* and A"

groups showed interesting differences (Figure 2-4). All three strains appeared to grow

similarly to each other in Mexican/Key lime. Asiatic strain 3213 inoculated in Duncan

grapefruit grew to levels similar to those seen in lime. A" strain X0053, which elicits

necrotic symptoms in grapefruit, grew to a final level that was only one log lower than

strain 3213. A* strain Xc270, which does not cause canker or HR in grapefruit, was

unable to grow well in grapefruit, increasing only 2 logs after inoculation and grew to a

final level that was more than two logs lower compared to strain 3213.

It is possible that A* strains carry an avr gene that specifically triggers grapefruit

defenses, but without an HR. An HR is not always observed with gene-for-gene

resistance (Bendahmane et al., 1999; Goulden and Baulcombe, 1993; Jurkowski et al.,

2004; Lehnackers and Knogge, 1990; Ori et al., 1997; Schiffer et al., 1997; Yu et al.,

2000). Indeed, a Xanthomonas avr gene that elicits host defense without an HR was

recently reported (Castaneda, 2005). An alternative explanation is that this group is

missing a factor or perhaps factors that are specifically required for growth in grapefruit,

such as the extracellular polysaccharides (EPS) and lipopolysaccharides (LPS) that are

needed by X axonopodis pv. citrumelo for virulence on citrus (Kingsley et al., 1993).

Only further experimental testing can distinguish between these explanations.

Although five different citrus host species have traditionally been used to

distinguish pathovars of X citri, all known groups can be readily distinguished by

inoculation of only two host differentials, lime and grapefruit. Even if positive control

cultures are not available, if low inoculations are used, then: 1) only the A strains elicit

green cankers in both lime and grapefruit; 2) only the B strains elicit whitish cankers in

lime and grapefruit; 3) only the C stains elicit whitish cankers in lime and an HR in

grapefruit; 4) only the A* strains elicit green canker in lime and at best very weak

cankers in grapefruit, and 5) only the A" strains elicit green cankers in lime and an HR in


Table 2-1. Bacterial strains and plasmids used in this study
Strain or plasmid Relevant Characteristics Reference or source
Escherichia coli
DH5a F-, endAl, hsdR17(rkmk-), Gibco-BRL
supE44, thi-1, recAl

Xanthomonas citri






Group A, wild type
Spontaneous Spr derivative of
3213, Spr
pthA::Tn5-gusA, marker
exchanged mutant of 3213 Sp,
Group B, wild type
Spontaneous Spr derivative of
B69, Spr
Group C, wild type
Group A*, wild type
Spontaneous Rif derivative of
Xc205, Rif
Group A*, wild type
Spontaneous Rif derivative of
Xc270, Rif
Group A*, wild type
Group A*, wild type
Group A*, wild type
Group A*, wild type
Group A", wild type
Spontaneous Rif derivative of
X0053, Rif

Gabriel et al. 1989
Gabriel et al. 1989

Swamp et al. 1991

Stall et al. 1982
El Yacoubi, 2005

Stall et al. 1982
Verniere et al. 1989
This study

Verniere et al. 1989
This study

Verniere et al. 1989
Verniere et al. 1989
Verniere et al. 1989
Verniere et al. 1989
Sun et al. 2004
This study

Table 2-2. Phenotypic differences among X citri strains.
Mexican Lime Grapefruit
Low High Low High
Strain (104-10O) cfu/ml (10-109) cfu/ml (104-10) cfu/ml (10-109) cfu/ml
A Ca C C C
B Wt Cb Wt C Wt C Wt C
A* -1 C C 0O C
A* -2 C C WCe C
A* -3 C C 0 0
A" C C 0 HR
a=canker, b= white canker, c=Hypersensitive response, d=no canker and e=weak canker

Figure 2-1. Inoculation of strains of different citrus canker groups in grapefruit and key
lime. A and B strains are able to cause canker in both hosts. A* and A"
strains can only cause canker in Key lime. Note the HR in grapefruit caused
by A"
























10o-109 cfu/ml

Figure 2-2. Inoculation of several different A* strains in Duncan grapefruit. High (left)
and low (right) concentrations of bacteria were used for inoculation.

104 -105 cfu/ml

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42
Time (hr)

Figure 2-3. Growth of X citri strains in PYGM medium. A strain 3213, A* strain Xc270, A" strain X0053 and B strain B69 were
used in this comparison.


-9 -3213-KL

8t- X0053-KL .-,,, -O--


0 -----------------------------------------
4 ,

2 -

1 X

0 6 10 14
Days after inoculation


grapefruit. A strain 3213, A strain Xc270 and A strain X0053 were used.
5-- ------ -7)7-- ----------------




0 6 10 14
Days post inoculatic

Figure 2-4. inplanta growth of X citri strains in A) Mexican/Key lime and B) Duncan
grapefruit. A strain 3213, A* strain Xc270 and Aw strain X0053 were used.



Both positive and negative genetic factors have been found to affect the host range

of phytopathogenic bacteria. For example, a given Rhizobium species can only nodulate

a restricted number of hosts, and this specificity is determined by specific signal

molecules that are exchanged between the bacteria and host plants (Fisher and Long,

1993; Kondorosi et al., 1991). Some of the host specific nodulation genes needed to

actively condition the host range include NodD, NodZ, NodW, NolA and NodC (Kamst

et al., 1997). Some negatively acting factors have also been found in some rhizobia and

these have avirulence (avr) function in some hosts. For example, nodFE of R.

leguminosarum by trifolii, which is virulent in white and red clover, condition avirulence

in pea (Djordjevic et al., 1987), and nodQ and nodH were found to confer avirulence to

R. 1. bv. trifolii and R. 1. bv. viceae in their respective hosts, white clover and common

vetch (Debelle et al., 1988; Faucher et al., 1989).

Agrobacterium tumefaciens and A. rhizogenes generally have a wide host range

that includes most dicotyledonous plants. Host range in A. tumefaciens is thought to be

generally determined by positive factors; however some negative factors of host range

determination have also been found (Keen, 1990). For example, certain virulence (vir)

genes on the Ti plasmid condition host range. Progressive deletions of the 3' end of virE

were found to progressively reduce the number of plant species on which crown galls are

formed. virG from supervirulent A. tumefaciens strain extends the host range of certain

Agrobacterium strains (Chen et al., 1991; Hood et al., 1986). On the other hand virA and

virC appear to act as negative regulators of host range in grapevine. virA is involved in

detection of host specific phenolics compounds. virC was shown to act as an avr gene to

trigger host defenses in incompatible interactions and thus limit the number of plants A.

tumefaciens can infect (Yanofsky et al., 1985; Yanofsky and Nester, 1986).

Strains of the genus Xanthomonas are always found associated with plants.

Different xanthomonads attack a very wide range of plant species. However, individual

species show limited host range (Gabriel, 1999b). Members of this genus are divided

into species and pathovars, based on phylogeny, host range and disease symptom

variation. The molecular basis of host range determination at the pathovar level is not

well understood. Azad and Kado (1984) showed that elimination of the HR in tobacco to

Erwinia rubrifaciens did not increase the host range of this pathogen to include tobacco.

Similarly, Swarup et al (1992) showed that elimination of the nonhost HR did not extend

the host range of X. citri. Factors that positively enhance the host range of Xanthomonas

include the extracellular polysaccharide (EPS) and lipopolysaccharide (LPS); the opsX

locus is involved in the biosynthesis of EPS and LPS, and is also needed by X

axonopodis pv. citrumelo for virulence in citrus (Kingsley et al., 1993).

Other positive factors that could influence the host range of pathogens are

suppressors of host defenses (Ponciano et al., 2003). For example, HopPtoD2, from

Pseudomonas syringae, was found to suppress programmed cell death in plants resulting

in infection (Bretz et al., 2003; Espinosa et al., 2003; Hauck et al., 2003). Similarly,

Abramovitch et al. (2003) found that the P. syringae effector, AvrPtoB, induced plant

disease susceptibility by preventing a programmed cell death response from occurring in

tobacco plants. These results suggest that bacterial host range is determined by positive

and negative acting factors.

This chapter describes attempts to identify host range determinants of X citri. A

virulence enhancement approach (Swarup et al., 1991) was used in an attempt to identify

positive factors) required to increase host range of a narrow host range, A* strain Xc270,

to include grapefruit.

Material and Methods

Bacterial Strains, Plasmids and Culture Media

Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are

listed in Table 3-1 along with their relevant characteristics, source and/or reference. E.

coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al., 1989).

Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS)

medium at 30 C as described (Gabriel et al. 1989). Antibiotics were used at the

following final concentrations ([tg/ml): rifampin (Rif), 75; spectinomycin (Sp), 35;

ampicillin (Ap), 100; gentamycin (Gm), 5.

Recombinant DNA Techniques

Xanthomonas total DNA was prepared as described by Gabriel and De Feyter

(1992). Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al. 1989) and

Xanthomonas (De Feyter and Gabriel 1991). Restriction enzyme digestion was

performed as recommended by the manufacturers. Southern hybridization was

performed by using nylon membranes as previously described (Lazo et al., 1987).

Vector Preparation

To identify genes involved in determining the host range of X citri pv citri,

genomic DNA from the wide host range X citri pv citri A strain 3213 was partially

digested with MboI and size fractioned on a sucrose gradient. Cosmid vector pUFR43

was used to make a DNA library of 3213 DNA fragments. This cosmid vector (Defeyter

et al., 1990) was split into two pools and cut with either EcoRI or Sal restriction enzyme

to produce the two arms and then treated with shrimp alkaline phosphatase. To create

common cloning ends the arms were then cut with BamHI and used for ligations to the 20

- 25kb 3213 DNA fraction (Figure 3-1 and 3-2).

Packaging and Transfection

The recombinant DNA was packaged using stratagene packaging mix

(Gigapack III Gold Packaging Extract), and introduced into E. coli strain DH5 *(mcr)

via transfection as described by the manufacturer protocol. Positive white plaques were

then picked and placed onto LB plates containing the antibiotic Kanamycin (20 [tg/[tl).

Using a 48 pin replicating fork, these colonies were transferred into 96 well microtiter

plates containing liquid LB (with 14% glycerol) and stored at -800 C. At the same time a

replicate of each plate was made and maintained by replicating each plate once every

month. DNA from eighteen randomly selected library clones was extracted and digested

with BamHI and electrophoresed on agarose gels in order to estimate insert size and

evaluate the quality of the library. The total number of cosmid clones required to cover

the entire 3213 genome (N) was determined using the following formula (Clarke and

Carbon, 1976):

N In(1- 0.99)
insert size
STotal genome size)j
Plant Inoculations

Duncan grapefruit and Mexican lime plants were grown and maintained under

natural light in the quarantine greenhouse facility at the Division of Plant Industry,

Florida Department of Agriculture, Gainesville, Fl. Temperatures in this greenhouse

ranged from 25C to 350 C with 50% to 100% relative humidity. All inoculations were

carried out in this facility.

Liquid cultures of all tested strains were grown in PYGM medium at 300 C for

approximately 24 hr. Cultures were centrifuged and resuspended in equal volumes of

sterile tap water (saturated with CaCO3) and pressure infiltrated at appropriate

concentrations (105 for low and 108 cfu/ml for high) into the abaxial surface of citrus leaf

using the blunt end of tuberculin syringes. Observations were taken 5-10 days after

inoculation. For screening of large numbers of clones, colonies were streaked onto

PYGM agar plates incubated at 300 C for approximately 24 hr, resuspended in sterile tap

water (saturated with CaCO3) and pressure infiltrated into citrus as described.

Triparental Matings

To transfer the 3213 library to the limited host range Xc270 (A*) strain, triparental

matings were performed as described by Defeyter et al (1990). Strain pRK2073 was used

as a helper strain. The recipient was concentrated 50 100 fold. Transconjugants were

screened on PYGM plates containing Rif 75[tl g/ml and Gm 3[tl g/ml at 280 C and 2-3

days later colonies were transferred onto new selection plates.


Xanthomonas citri pv citri A 3213 Strain Genomic Library

A genomic library of X citri pv citri A, strain 3213, was made and 18 randomly

picked clones were evaluated for insert size and pattern (Figure 3-3). All 18 clones gave

different restriction patterns indicating random insertions in the vector. The average size

of the inserts was 39 kb. Based on the Clark and Carbon formula (Clarke and Carbon,

1976), 610 clones were required to cover the whole X citri 3213 genome with 99%

probability. Seven hundred and fifty clones were maintained in E. coli strain DH5ca and

stored in 15% glycerol at -800 C.

Screening of 3213 Library in Xc270

Five hundred and fifty clones were transferred from the 3213 library into X citri

pv. citri A*-3 strain Xc270 by triparental mating and transconjugants were individually

screened for symptoms in Duncan grapefruit. No clones were identified that consistently

increased the pathogenicity of Xc270.


Attempts to identify positive host range determinants from X citri were

unsuccessful when a library from the wide host range group A strain 3213 was moved

into the narrow host range group A* strain Xc270. Initially six clones (pAW377,

pAW378, pAW380, pAW400, pAW413 and pAW419) seemed to elicit canker-like

symptoms in Duncan grapefruit, but when those clones were re-conjugated into Xc270,

the initial results were not confirmed. The inplanta growth of Xc270 described in

chapter 2 showed that the Xc270 grew poorly in Duncan grapefruit, suggesting that the

only clones that would complement Xc270 and cause canker in grapefruit would be those

that would increase growth. It is likely that inplanta growth requires multiple effectors,


and that no individual cosmid would carry enough factors to reveal a strong difference.

Another possibility is that Xc270 may carry avr genes that function in grapefruit and

prevent Xc270 from growing. Avirulence is usually epistatic over virulence and

therefore a screen for positive factors would fail if this were the case. Perhaps a better

approach would be to construct a library of Xc270 DNA and screen in 3213 in order to

identify any avirulence gene function.

Table 3-1. Strains and plasmids used in this study
Strain or plasmid Relevant Characteristics
Escherichia coli
DH5a F-, endAl, hsdR17(rk-mk-), st













Reference or source

pE44, thi-1,

Group A, wild type
Spontaneous Spr derivative 3213, Spr
pthA::Tn5-gusA, marker exchanged
mutant of 3213 Sp, SprKnr
Group A*, wild type
Spontaneous Rif derivative of Xc270,

ColEl, Kmr,Tra helper plasmid

pRK2013 derivative,npt::Tn7,
KmsSpr,Tra+, helper plasmid
IncW, Mob+, lacZa+, Gmr, Nmr, cos,
shuttle vector
Fragment from X citri 3213 library
cloned in pUFR43
15 kb fragment from X citri 3213 library
cloned in pUFR43
Fragment from X citri 3213 library
cloned in pUFR43
Fragment from X citri 3213 library
cloned in pUFR43
24 kb fragment from X citri 3213 library
cloned in pUFR43
Fragment from X citri 3213 library
cloned in pUFR43


Gabriel et al. 1989
Gabriel et al. 1989
Swamp et al. 1991

Verniere et al. 1989
This study

Figurski and Helinski,
Leong et al. 1982

De Feyter and Gabriel,
This study

This study

This study

This study

This study

This study



S Eos B S


1 1 V...


11 1

E coRI

I '



+ inserts
S E B M MbolBS

I Ligase



Transfect E. coli
Transfect E. coil

Figure 3-1. Scheme for cosmid vector preparation and DNA cloning.








23kb V---"'- R`" "


Figure 3-2. DNA fractionation. A). Partial digestion of X. citri 3213 genomic DNA (0.7%
agarose gel). B) Size fractionation of Mbol partial digest of 3213 DNA (0.7%
agarose gel).

1A 1 9 3 4A A 7 R Q 1i 11 19 13 14 15 16 17 1R 1A

-23 kb

-9.4 kb

-6.5 kb

-4.3 kb

-2.3 kb
-2.0 kb

Figure 3-3. Restriction profiles of random clones from X citi 3213 genomic library. DNA
was digested with EcoRI. As a merker, X DNA digested with HindIII (M).



All strains of Xanthomonas citri cause hyperplastic pustules in citrus that are

dignostic of citrus canker disease (Gabriel, 2001). The Asiatic (A) group (X citri pv citri

A) has the widest host range and is widespread throughout the world. The B and C

groups (X citri pv aurantifolii B and C) have only been found in South America and have

a reduced host range compared to the A groups (Stall and Seymour, 1983). New groups

of X citri pv citri (Aw from Florida and A* from Southwest Asia) were more recently

identified that are primarily restricted in host range to Mexican lime (Citrus aurantifolia)

(Stall et al., 1982b; Sun et al., 2004). Grapefruit (C. paradisi) serves as a differential host

that is resistant to the A*, A" and C strains; the A" and C strains elicit a strong

hypersensitive response (HR) in grapefruit, while some A* strains show reduced growth

in grapefruit (Chapter 2). The molecular basis for avirulence of the A*, A" and C strains

in grapefruit and the wide host range of the A strains is unknown.

Pathogenicity gene pthA encodes the primary causal effector of the citrus canker

disease phenotype (Duan et al., 1999; Swarup et al., 1991; Swamp et al., 1992). All

strains of X citri tested carry pthA homologs (Cubero and Graham, 2002; Mavrodieva et

al., 2004). pthA is capable of conferring ability to cause canker-like symptoms to strains

that cannot otherwise cause canker, such as X campestris pv citrumelo (Swarup et al.,

1991) or even E. coli carrying a functional hrp system (Kanamori and Tsuyumu, 1998).

When pthA is transiently expressed in citrus using either Agrobacterium tumefaciens or

particle bombardment, small canker-like lesions are elicited (Duan et al., 1999).

pthA is the first member of the avrBs3/pthA gene family demonstrated to function

for pathogenicity. The vast majority of cloned or described Xanthomonas avirulence

genes belong to this family; many have demonstrated pathogenicity functions (Leach and

White, 1996). Members of this gene family show very high levels of homology at the

DNA sequence level (De Feyter et al., 1993; Hopkins et al., 1992; Leach and White,

1996; Yang et al., 2000). All members encode more than 11 nearly perfect, 34 amino

acid, leucine rich, tandemly arranged, direct repeats. Swapping repeat regions between

members of the gene family results in chimeric genes that confer the pathogenicity and/or

avirulence phenotypes expected from the source genes (Herbers et al., 1992; Yang et al.,

1994). Although pthA can confer avirulence to other xanthamonads (Swarup et al.,

1992), nopthA homolog from X citri is known to function for avirulence in citrus.

Conversely, although the pthA homolog aplI from X citri pv citri group A has been

suggested as a suppressor of the tobacco defense response (Ponciano et al., 2003), no pthA

homolog from X citri is known to suppress citrus host defenses.

The purpose of this study was to clone, isolate, sequence and characterize pthA

homologs that function to determine pathogenicity from all known X citri groups. A

secondary purpose was to determine if any of these pthA homologs also determined

avirulence in grapefruit or could increase the pathogenicity of an A* strain in grapefruit.

Material and Methods

Bacterial Strains, Plasmids and Culture Media

Strains of Escherichia coli, Xanthomonas spp. and plasmids used in this study are

listed in Table 4-1 along with their relevant characteristics and source or reference. E.

coli strains were grown in Luria-Broth (LB) medium at 37 C (Sambrook et al., 1989).

Xanthomonas spp. were grown in PYGM (peptone yeast extract-glycerol-MOPS)

medium at 30 C as described (Gabriel et al. 1989). Antibiotics were used at the

following final concentrations (tlg/ml): rifampin (Rif), 75; spectinomycin (Sp), 35;

chloramphenicol (Cm), 35; ampicillin (Ap), 100; gentamycin (Gm), 5; kanamycin (Kn),


Recombinant DNA Techniques

Xanthomonas total DNA was prepared as described (Gabriel and De Feyter, 1992).

Plasmids were isolated by alkaline lysis from E. coli (Sambrook et al., 1989) and

Xanthomonas (De Feyter and Gabriel, 1991). Southern hybridization was performed by

using nylon membranes as described by Lazo and Gabriel (1987).

DNA Library Construction

Genomic DNA from the wide host range Xanthomonas citri pv citri group A strain

3213 was partially digested with MboI and size fractioned on a sucrose gradient. The

cosmid vector pUFR43 was used to make a DNA library of 3213 DNA fragments. This

cosmid vector was split into two pools and cut with either EcoRI or Sal restriction

enzyme to produce the two arms and treated with shrimp alkaline phosphatase. To create

common cloning ends, the arms were then cut with BamHI and used for ligations to the

20 25kb 3213 DNA fraction. Recombinant DNA was packaged using Stratagene *

packaging mix (Gigapack III Gold Packaging Extract), and introduced into E. coli

strain DH5 via transfection as described by the manufacturer protocol. Positive white

plaques were then picked and placed onto LB plates containing the antibiotic Kn (20

[tg/[tl). Colonies were transferred into 96 well micro titer plates containing liquid LB

(with 14% glycerol) and stored at -800 C. DNA from eighteen randomly selected library

clones was extracted, digested with BamHI and run on agarose gels in order to estimate

insert size and evaluate the quality of the library.

Plant Inoculations

Duncan grapefruit and Mexican lime plants were grown, maintained and inoculated

under natural light in the quarantine greenhouse facility at the Division of Plant Industry,

Florida Department of Agriculture in Gainesville, Fl. Temperatures in this greenhouse

ranged from 25C to 350 C with 50% to 100% relative humidity.

Liquid cultures of tested Xanthomonas strains were grown in PYGM at 30 oC for

approximately 24 hr. Cultures were centrifuged @ 1000g for 3 min at room temperature,

and resuspended in equal volumes of sterile tap water (saturated with CaCO3) and

pressure infiltrated at appropriate concentrations (105 for low and 108 cfu/ml for high)

into the abaxial citrus leaf surface using the blunt end of a tuberculin syringe.

Observations were taken 5- 10 days after inoculation.

Southern Hybridization Analysis

Genomic DNA from all canker causing strains were isolated as described, digested

with either EcoRI or BamHI restriction enzyme and the digested DNA was analysed by

electrophoresis on 0.6% agarose gels. DNA was then transferred onto GeneScreen Plus

(DuPont, Wilmington, Delaware) nylon membranes as described by the manufacturer.

Membranes were hybridized with a 32P-labeled BamHI internal fragment ofpthA.

Colony Hybridization

Plasmid DNA from Aw strain X0053 was digested with EcoRI andKpnI and

ligated into shuttle vector pUFR047. Recombinant DNA was transformed into DH5

competent cells, and transformed clones were selected on Apl00 and X-Gal/IPTG in LB

agar. White colonies were transferred onto a registry plate and pZit45 was included at

specific positions as a control. Plasmid DNA from A* strain Xc270 was digested with

EcoRI and HindlII and ligated into shuttle vector pUFR71. Recombinant DNA was

transformed into DH5ca and selected on Cm35 LB and X-Gal/IPTG plates. White

colonies were transferred from registry plates onto Colony/PlaqueScreenTM hybridization

transfer nylon membranes and placed colony side up on plain LB plates and incubated for

2- 4 hr at 37 C. DNA was fixed on membranes as described by the manufacturer and

hybridized with a 32P-labeled BamHI fragment ofpthA. Group B strain B69 plasmid

DNA was digested with EcoRI, and a 23 kb and a 4.3 kb fragment that hybridized with

pthA were cloned in pUFR53 resulting in pQY93.3 and pQY22.1, respectively. A 14kb

HindIII fragment within the pQY93.3 EcoRI fragment was subcloned in pUFR53,

resulting in pQY96. Group C strain C340 plasmid DNA was digested with Sal, and a 20

kb and a 6 kb fragment that hybridized withpthA were cloned into pUFR53, resulting in

pQYC2.1 and pQYC 1.1, respectively. The 6 kb insert from pQYC1.1 fragment was

cloned into the high copy vector pUC 19 resulting in pQY103.5.

Triparental Matings

Clones that hybridized topthA were conjugated into Xanthomonas strain B21.2

(pthA::Tn5) by triparental mating as described by Defeyter et al (De Feyter et al., 1990).

Strain pRK2073 was used as a helper strain. The recipient strain was concentrated 50 -

100 fold for higher conjugation rate. 10 [tl of each recipient, donor and helper were

mixed together on PYGM plate and allowed to grow for 6 hr to overnight at 280 C.

Transconjugants were screened on PYGM plates containing Sp 35 [tl g/ml and Gm 5[tl

g/ml at 280 C. Two to three days later colonies were transferred onto new selection

plates. Successful transconjugants were infiltrated into Duncan grapefruit and

Mexican/Key lime. Southern blot analysis was used to further analyze clones.

Marker Integration Mutagenesis

The mutants BIM2 (pthB::pUFR004) of B69Sp and CIM1 (pthC::pUFR004) of C340

were created by the integration of pYY40.10 (2.0 kb internal Stul-HincII fragment of

pthA in pUFR004), and Cm resistant colonies were selected.

Sequence Analysis ofpth Genes

pthA homologs from A*, A", B and C strains were sequenced using primers based

on the sequence ofpthA (Swamp et al., 1992) and designed to cover the entire gene.

Seven primers were used for sequencing reactions; DG8: gaggtggtcgttggtcaacgc, DG35:

agttatctcgccctgatc, DP35: caggtcactgaagctgcccgc, DP36: gcgggcagcttcagtgacctg, DP37:

ccgaaggttcgttcgaca, DP38:ctgtcgaacgaaccttcg, DP45: gcatggcgcaatgcactgac, and YP03:

tagctccatcaaccatgc. Sequencing was done at the UF ICBR DNA Sequencing Core,

Gainesville, FL. When necessary, fragments were cloned into high copy vectors such as

pUC 119 or pUC19 to obtain larger amounts of DNA.

Sequence information of these genes was used to construct the full DNA sequence

using Vector NTi software (Invitrogen, Carlsbad, California). Nucleotide and predicted

amino acid sequence alignments were carried out with the program CLUSTAL W.

Percent amino acid identity was calculated using the needle program in EMBOSS

package which uses the Needleman-Wunsch algorithm to do global alignment of

sequences. The DNA sequences ofpthA1, pthA2, pthA3 andpthA4 (da Silva et al., 2002)

were taken from GenBank Accessions # NC 003921, NC 003921, NC 003922 and

NC_003922, respectively. The DNA sequences of apll,apl2 and apl3 (Kanamori and

Tsuyumu, 1998) were taken from GenBank Accessions # AB021363, AB021364 and

AB021365, respectively. Dendograms showing phylogenetic relationships of these genes

were generated with TREECON (version 1.3b) (Van de Peer and De Wachter, 1994)

using neighbor-joining algorithm with Poisson correction. RSc1815, an avrBs3/pthA

gene from Ralstonia solanacearum was used as an outgroup for phylogenetic tree

construction. The percentage of trees from 100 bootstrap resamples supporting the

topology is indicated when the percentage is above 70.


Southern Blot Analysis

Southern blot analyses revealed that all tested X citri strains have at least two

BamHI DNA fragments that strongly hybridized to an internal BamHI fragment from

pthA (Figure 4-la; some data not shown). With the exception of group A strains, which

had four BamHI fragments that hybridized withpthA, all other strains from all other

groups, including the A*, A", B and C groups, had only two such BamH1 fragments. All

strains tested appeared to share a 3.4 kb BamHI hybridizing fragment of a size similar or

identical to that ofpthA. Otherwise, each of the different phenotypic groups exhibited

distinct and characteristic banding patterns. Based on the hybridization intensity of both

BamHI and EcoRI digested DNA fragments and other results (not shown), the C and A"

strains appeared to carry their two hybridizing DNA fragments on a single plasmid

(Figure 4-1).

Cloning, Characterization and Sequencing ofpthA Homologs from X. citri A*, AW, B
and C Strains

Using an internal fragment ofpthA as a probe, colony hybridization of E. coli

carrying cloned group A" strain X0053 plasmid DNA revealed eight colonies with

hybridizing inserts (Figure 4-2). The plasmids from these colonies were designated as

pAW5.1 5.8, and all carried hybridizing inserts of identical size (Table 4-1). Four of

these inserts were separately introduced into strain B21.2 (pthA::Tn5) and screened for

pathogenicity. All four clones complemented the knockout phenotype of B21.2 and

restored ability to cause canker in both Duncan grapefruit and Mexican lime (Figure 4-3;

Table 4-2). The pthA homolog encoded on pAW5.2 was sequenced and designated


Similarly, colony hybridization of cloned group A* strain Xc270 plasmid DNA

revealed three hybridizing clones, designated as pAW12.1 12.3. The inserts carried on

pAW12.1 and 12.2 were identical in size; pAW12.3 was smaller. When transferred to

B21.2, pAW12.1 complemented B21.2 and resulted in canker symptoms in both

grapefruit and lime (Figure 4-4; Table 4-2). ThepthA homolog encoded on pAW12.1

was sequenced and designatedpthA *. pAW12.3 did not complement B21.2 in either host

(Table 4-2). The pthA homolog from pAW12.3 was sequenced and designated pthA*-2.

pthA *-2 carried only 15.5 internal repeats. To verify that the lack of evident activity of

pthA *-2 was not due to a cloning artifact, the promoter region and Shine-Dalgarno (SD)

sequence were verified to be present on pAW12.3. In addition, no premature stop codons

or frame shifts were found inpthA *-2.

Colony hybridization of cloned group B strain B69 plasmid DNA revealed several

hybridizing clones of two different sizes. Representative clones of both sizes were

selected for complementation tests. pQY93.3 (23 kb insert) and pQY22.1 (4.3 kb insert)

were mobilized by conjugation into B21.2; only pQY93.3 was found to complement

B21.2, resulting in canker symptoms in both grapefruit and lime (Table 4-2). The pthA

homolog was subcloned from pQY93.3 on pQY96, verified as functional in B21.2

designated as pthB and sequenced.

Finally, colony hybridization of cloned group C strain C340 plasmid DNA revealed

several hybridizing clones of two different sizes, and again representative clones of both

sizes were selected for complementation tests. pQYC2.1 (20 kb insert) and pQYC 1.1 (6

kb) were mobilized by conjugation into B21.2; only pQYC1.1 was found to complement

B21.2, resulting in canker symptoms in both grapefruit and lime (Table 4-2). The pthA

homolog encoded on pQYC 1.1 was designated as pthC and sequenced.

Even when inoculated at high concentrations, none of the pthA homologs (pthA W,

pthA *, pthA *-2, pthB orpthC) in B21.2 elicited an HR in grapefruit.

Inactivation and Complementation of Genes pthB and pthC in X. citri pv aurantifolii

In order to determine the role ofpthB in the pathogenicity of X citri pv aurantifolii

group B strain B69Sp in citrus, marker integration mutagenesis was carried out.

Southern blot analysis showed thatpthB had been interrupted in BIM2 (pthB::pUFR004).

BIM2 was unable to cause canker (data not shown). BIM2 was fully complemented by

pAB2.1, pZit45, pAB18.1 (all carryingpthA), pQY96 (carryingpthB) and pQYC1.1

(carrying pthC) to elicit wild type response in grapefruit and lime (data not shown). In

order to determine the role of gene pthC in the pathogenicity of group C strain C340 in

citrus, marker integration mutagenesis was carried out. Southern blot analysis showed

thatpthC had been interrupted in CIM1 (pthC::pUFR004). CIM1 was unable to cause

typical canker symptom in lime, but elicited an HR in grapefruit that was as strong as the

HR elicited by the wild type strain C340. CIM1 was fully complemented by pZit45

(pthA), pQY96 (pthB) and pQYC1.1 (pthC) to elicit a wild type response in lime (data

not shown).

None of the pthA Homologs from Group A Strain 3213 Increased the Host Range of
Group A* Strain 270 to Include Grapefruit

All fourpthA homologs from group A strain 3213 were isolated and cloned from

the 3213 library by colony hybridization with an internal fragment ofpthA: pAW20.2,

pAW20.4, pAW20.7 and pAW20.11 carry pthA, pthAl, pthA2 and pthA3, respectively

(Figure 4-5). None of these clones complemented B21.2. When these clones were

conjugated into the A* strain Xc270, none extended the host range of the strain to include

Duncan grapefruit. As with Xc270, all three transconjugants elicited cankers in Mexican

lime. When pZit45, which carriespthA from 3213 and complements B21.2 (Swarup et

al., 1992), and pAW20.2 were introduced into Xc270, they similarly did not extend the

host range of Xc270 to include grapefruit (Figure 4-5).

Sequence Analysis ofpthA Homologs from All Known X. citri Groups

The DNA sequences of all 13 available pthA homologs were analyzed and the

predicted amino acid sequences were found to be >75% identical (Table 4-3). With the

notable exception of Apl3, all seven other PthA homologs within X citri pv citri group A

(PthA, PthAl, PthA2, PthA3, PthA4, Apll and Apl2) were more closely related to each

other (> 92% identical), than the active PthA homologs from all X citri groups (PthA,

PthB, PthC, PthAW and PthA*) which were >97% identical (Figure 4-6). Comparative

analysis of the 34 aa direct repeat regions of all thirteen genes revealed three primary

regions of variation within each repeat, at positions 3 and 4 (region 1), positions 11-13

(region 2) and positions 30-32 (region 3) (Figure 4-7). In region 1, no particular set of

amino acids was universally conserved among any of the repeats of activepthA

homologs. However, in regions 2 and 3, and only in repeat number 17 in each gene,

N(12)G(13) in region 2 and Q(31)A(32) in region 3 were correlated with active

pathogenicity gene function.


Southern hybridization analyses of a limited number ofX. citri strains revealed a

common 3.4 kb BamHI band shared by all strains examined in all five described groups

of strains; all group A strains tested carried four hybridizing fragments, while all other

strains examined carried only two. Among the 13 sequenced and functionally tested pthA

homologs, including three tested by others [Apl1, Apl2 and Apl3; (Kanamori and

Tsuyumu, 1998)] and the ten tested in this study, only the 3.4 kb fragment appeared to

encode the active pathogenicity gene that is required for elicitation of citrus canker. This

includes genes pthA *, pthA W, pthB and pthC from the A*, A", B and C strains,

respectively, as well aspthA. All five of these genes were found to be fully isofunctional,

and capable of eliciting the typical canker phenotype in grapefruit in B21.2, even though

the source A*, A" and C strains were unable to elicit the canker phenotype in grapefruit.

Furthermore, pthA *, pthA W and pthC did not elicit an avirulence phenotype of any type

in B21.2, despite being members of an avr gene family, and despite the avirulence of the

respective source strains in grapefruit. Indeed, thepthC knockout mutation in CIM1

eliminated pathogenicity in lime, but did not affect the HR in grapefruit, which remained

as strong as that elicited by the wild type. The HR elicited by the wild type C group

strain C340 is therefore independent ofpthC. These results suggest that the A*, A" and

C strains likely carry yet to be identified avr genes that prevent compatible phenotypes

from developing in grapefruit.

The C strain C340 and A* strain Xc270 fragments that hybridized with pthA did

not complement B21.2 to pathogenicity in lime or grapefruit. The sequenced Xc270

homolog that failed to complement, pthA *-2, carried 15.5 repeats and appeared to have

intact promoter, a SD region and an open reading frame. This gene was 97% identical to

PthA2 and Apl2 (Table 4-3) and carried the same number of repeats. All three of these

genes appear intact and yet also appear non-functional in terms of pathogenicity or

avirulence. Although the C340 homolog (on pQYC2.1) that did not complement B21.2

was not sequenced, restriction enzyme analysis (not shown) of the 20 kb insert indicated

that the promoter region was intact, making this homolog unlikely to be responsible for

avirulence in grapefruit.

The other three group A 3213 pthA homologs did not complement B21.2 and also

appeared to be non-functional, confirming and extending the work of Kanamori and

Tsuyumu (Kanamori and Tsuyumu, 1998) on group A strain L-9. However, the fact that

all wide host range group A strains examined carry two additional pthA homologs that are

not present in the more narrow host range B, C, A* and A" strains suggests a potential

role in determining host range. Indeed, Ponciano et al (2003) reported that apll, apthA

homolog that is functionally equivalent topthA but found in a different group A strain,

suppressed tobacco defense response and HR. However, whenpthA or any of its 3213

homologs (pthA1, pthA2 orpthA3) were transferred into Xc270, no increase in host range

of A* strain Xc270 to include grapefruit was observed (Figure 4-5). Although, additional

pthA homologs in a given X citri strain may contribute marginally to pathogenicity

(Kanamori and Tsuyumu, 1998), the primary value of multiple copies of the gene family

in a given strain may be to facilitate recombination and the potential for rapid adaptation

to new hosts (Gabriel, 1999a; Yang and Gabriel, 1995).

All pthA homologs that are required for citrus canker disease from all five known

X citri groups carried exactly 17.5 repeats. All other homologs, even those nearly

identical topthA (e.g., from X citri pv citri group A) were not required for canker and

had a different number of repeats. Interestingly, deletion mutants of various repeats and

numbers of repeats in pthA can result in a gene that confers a weak canker phenotype in

citrus to B21.2 (Yang and Gabriel, 1995). In that study, however, repeat numbers 1-5

and 16,17 were not affected in deletion derivatives capable of conferring canker. This

indicates that while the total number of repeats may be important, the number of repeats

may be less important than the relative location of the specific repeats within the gene.

Surprisingly, sequence variation among these activepthA genes (PthA, PthAW, PthA*,

PthB and PthC) was greater than variation among the pthA homologs within the A group.

Even the nonfunctional homologs were closer to the active genes within the A group than

to active homologs from B and C groups.

The relatively high level of variation within the active homologs from different

phylogenetic groups allowed the possibility of identifying amino acids within the 34 aa

direct repeat that might be critical for pathogenic specificity in citrus. Three somewhat

variable regions were found in each of the repeats, at amino acid positions 3 and 4, 11-13,

30-32. The aligned repeat regions of all active genes revealed that only amino acids

N(12)G(13) in the second and Q(31)A(32) in the third variable regions of the 17th repeat

were conserved. No such conservation of identical amino acids was found in any other

repeat (Figure 4-6). Interestingly, only the 17th repeat of the South American group B

and C strains show a sequence identity to Asiatic strains in the third variable region.

Q(31),A(32) is not seen in any other PthB repeat and in only two other PthC repeats,


which favor E(31)Q(32) at that position. In addition, the deletion mutants evaluated by

Yang and Gabriel (Yang and Gabriel, 1995) never affected the 17th repeat. These results

suggest that the 17th repeat may be critical for pathogenicity of X citri.

Table 4-1. Strains and plasmids used in this study






Relevant Characteristics

F-, endAl, hsdR17(rk-mk-), supE44, thi-1,

Strain or
Escherichia coli







Reference or source


Gabriel et al. 1989
Gabriel et al. 1989
Swamp et al. 1991

Stall et al. 1982

Stall et al. 1982
Verniere et al. 1989
This study

Verniere et al. 1989
This study

Verniere et al. 1989
Verniere et al. 1989
Verniere et al. 1989
Verniere et al. 1989
Sun et al. 2004
This study

El-Yacoobi, 2005

This study

Group A, wild type
Spontaneous Spr derivative 3213, Spr
pthA::Tn5-gusA, marker exchanged
mutant of 3213 Sp, SprKnr
Group B, wild type
Spontaneous Spr derivative of B69, Spr
Group C, wild type
Group A*, wild type
Spontaneous Rif derivative of Xc205,
Group A*, wild type
Spontaneous Rif derivative of Xc270,
Group A*, wild type
Group A*, wild type
Group A*, wild type
Group A*, wild type
Group A", wild type
Spontaneous Rif derivative of X0053,
pthB::pUFR004, marker integrated mutant
pthC::pUFR004, marker integrated mutant
of C340

ColEl, Kmr,Tra helper plasmid

pRK2013 derivative, npt::Tn7, KmsSpr,
Tra+, helper plasmid
ColE1, M13 Ig, Apr, lacZo

ColE1, Mob+, Cmr, lacZ+
IncW, Mob+, lacZa+, Gmr, Nmr, cos,
shuttle vector
IncW, Mob+, lacZa+, Par+, GmrApr

Figurski and Helinski
Leong et al. 1982

Vieira and Messing,
De Feyter et al. 1990
De Feyter and Gabriel,
De Feyter et al. 1993

Table 4-1. Continued.

Table 4-1. Continued.

Relevant Characteristics

Strain or









pQYC 1.1


pAW5.1- 5.8







Reference or source

IncW, Gmr,Cmr, Mob+, mob(P), lacZo+,
IncW, Mob+, Cmr, Gmr, lacZ Par+
pthA in pUC118, Apr
4.5Kb fragment containing pthA from
3213 cloned in pUFR47, Apr
EcoRI/HindIII fragment of pZit45,
containing pthA, in pLAFR3
EcoRI/HindIIl fragment of pYD9.3,
containing pthA, in pUFR47
23 kb EcoRI fragment containing pthB in
4.3 kb EcoRI fragment containing pthBo
(non-functional) in pUFR53
8.8 Kb Sal fragment containing pthB
from B69 was cloned in pUC 119
14 kb HindIII fragment containing pthB
cloned in pUFR53
5 Kb Sal fragment containing pthC from
C340 cloned in pUC119
6 kb Sal fragment containing pthC cloned
in pUFR47
20 kb Sal fragment containing pthCo
(non-functional) cloned in pUFR47
5Kb EcoRI-KpnI fragment containing
pthA Wfrom X0053 cloned in pUFR47
22 kb EcoRI/HindIII fragment containing
pthA from A* group strain Xc270 cloned
in pUFR71
6 kb EcoRI/HindIII fragment containing
pthA *-2 from A* group strain Xc270
cloned in pUFR71
36 kb MboI fragment containing pthA
from 3213 cloned in pUFR43
17 kb MboI fragment containing pthA 1
homolog from 3213 cloned in pUFR43
32 kb MboI fragment containingpthA2
homolog from 3213 cloned in pUFR43
40 kb MboI fragment containingpthA3
homolog from 3213 cloned in pUFR43

El-Yacoobi, 2005

Castaneda, 2005
Duan et al. 1999
Swamp et al. 1992

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

Table 4-2. Phenotypic responses of X citri strains in 2 citrus hosts
Mexican Lime Grapefruit
Lowa Highb Low High
3213 +C + + +

B21.2 Od 0 0 0

B21.2/pZit45(pthA) + + + +

B21.2/pQY96(pthB) + + + +

B21.2/pQYC1.1(pthC) + + + +

B21.2/pAW5.2(pthA W) + + + +

B21.2/pAW12.1(pthA*) + + + +

B21.2/pAW12.3(pthA *2) 0 0 0 0
a= 104-10cfu/ml, b=108-109cfu/ml, c= canker, d= no canker,

Table 4-3. Amino acid sequence identity between pathogenicity genes from X citri strains

PthA PthA4 Apll PthAW PthA* PthA*-2 PthAl PthA2 PthA3 Apl2 Apl3 PthB PthC
100 100 100 99 98 92 95 93 92 94 84 87 87
100 100 99 98 92 95 93 92 94 84 87 87
100 99 98 92 95 93 92 94 84 87 87
100 97 92 95 93 92 93 84 87 87
100 92 95 93 92 93 84 87 87
100 95 97 97 97 79 82 83
100 95 95 95 81 84 85
100 98 99 79 82 82
100 98 79 82 82
100 80 82 82
100 75 75
100 98

internal fragment of pthA. A). BamHI restriction digested genomic DNA
from ciri strains. B). EcoRI restriction digested genomic DNA.
-- urn-y

Figure 4-1. Southern Hybridization analysis of X citri strains hybridized with the BamHJ
internal fragment of pthA. A). BamHI restriction digested genomic DNA
from X citri strains. B). EcoRI restriction digested genomic DNA.


+ control

Figure 4-2. Colony Hybridization of E. coli with cloned X0053 A" plasmid DNA
fragments using 32P-labeledpthA. pZit45 (pthA) was used as a positive

2 3213

B21.2/ B21.2/
pAW5.5 pAW5.2





p \V% 5.8


Figure 4-3. Complementation of A strain knockout B21.2 (pthA::Tn5) withpthA
homologs from AW strain X0053 in citrus. pAW5.2, pAW5.4, pAW5.5 and
pAW5.8 carry fragments that hybridized withpthA in grapefruit (left) and
Key lime (right).

Figure 4-4. Complementation of A strain knockout B21.2 (pthA::Tn5) withpthA
homologs in citrus. pthA W (pAW5.2), pthA (pAW12.1) and pthA *-2
(pAW12.3) in B21.2 andpthA (3213) in grapefruit (left) and Key lime (right).

Figure 4-5. Analysis ofpthA and its three homologs in A* strain Xc270. Key lime (left)
and grapefruit (right)

0.1 sutbtitutionsite


170 pMr.4

-prhA W M

MV ITpl2 M7

Mrw8 (XD6861)}
rf L vr(d l627 I Q1)
1a-vrfslr 4x1697E1

.pthN AF2i 6.11
--- rp A 2.4r

aX-- a7 Af26I933B

avzij&13 (A-rl571 I)
pIkB-Xcm (An 23125)

-- c II IqNCOpL 2S5)

Figure 4-6. Neighbor-joining dengogram depicting phylogenetic relationship based on pairwise comparison of neucleotide sequences
of members of avrBs3/pthA genes from different species and pathovars ofXanthomonas. Numbers at the nodes represent
bootstrap values (based on 100 replicates). GenBank Accesions numbers are presented to the right of the gene for genes
not mentioned in material and methods.

Repeat 1 2 3 4
Verable region I PthB PD PA PD PA
PthA* -2 PE PG PE PA

Verable region II PthC SHD SNG SHD SHD

Verable region III PthC CEO CEO CEO CEO

Figure 4-7. Sequence alignment of the predicted amino acids encoded in the main variable portion of the repeat region of all 13 pthA

homologs. Boxed areas indicate the regions in the 17th repeat that are conserved among all pthA homologs with

experimental evidence of active pathogenic function.

6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23


The main objective of this dissertation was to study host range determination

factors among all described Xanthomonas citri groups that are known world-wide. Five

variant groups ofX. citri have been described in the literature, and all are known from

field observations to differ in host range and/or pathogenicity. In this study, all known

groups were studied together in lime, grapefruit and sweet orange. All groups were

readily distinguished by inoculation of only two host differentials, lime and grapefruit.

The in plant growth of strains from two different groups that did not elicit an obvious

defense response in grapefruit was found to be poor. This indicated that either these

strains carry negative acting (avirulence) factors that limited growth in grapefruit, or that

they are missing positive acting pathogenicityy) factors that are present in strains from

groups that can attack grapefruit. The lack of a grapefruit defense response that is typical

of bacterial infections limited by avirulence factors led to an attempt to identify positive

pathogenicity factors.

A DNA library of an X citri strain able to attack grapefruit was moved into one of

the strains unable to attack grapefruit in an attempt to identify one or more positive acting

host range factors. Despite using a DNA library that theoretically covered the wide host

range X citri genome with 99% probability, no pathogenicity factors were found, despite

multiple screens of all library clones. It is possible that inplanta growth requires

multiple effectors, and that no individual cosmid would carry enough factors to reveal a

strong difference. Another possibility is that Xc270 may carry avr genes that function in

grapefruit and prevent Xc270 from growing. Avirulence is usually epistatic over

virulence and therefore a screen for positive factors would fail if this were the case.

In addition to the DNA library screen, particular attention was paid to the pthA

homologs from all five X citri strain groups, since pthA is known to be required by at

least three strain groups for citrus canker disease. In this study, pthA was demonstrated

to be required by the remaining strain groups. The fact that all wide host range group A

strains examined carried two additional pthA homologs that were not present in the

narrow host range B, C, A* and A" strain groups suggested a potential role for these

additional homologs in determining host range. However, when pthA or any of its group

A homologs (pthA1, pthA2 orpthA3) were transferred into a narrow host range group

(A*) strain, no increase in host range to include grapefruit was observed.

Three newpthA homologs were cloned, isolated and sequenced from strains of

group A* (pthA and pthA *-2) and A" (pthA W) and functionally compared with pthA

homologs previously isolated from strains of the three remaining groups: A (pthA), B

(pthB) and C (pthC). pthA *, pthA W, pthB and pthC were found to be fully isofunctional

with pthA, and capable of eliciting the typical canker phenotype in grapefruit in

complementation tests using an X citri group ApthA- mutant strain (B21.2), even though

the source A*, A" and C strains were unable to elicit the canker phenotype in grapefruit.

Furthermore, pthA *, pthA W, pthA and pthC did not elicit an avirulence phenotype of

any type in B21.2, despite the fact thatpthA homologs are all members of an avirulence

gene family, and despite the avirulence of the respective source strains in grapefruit.

DNA sequence comparisons of the three newpthA homologs cloned, sequenced

and characterized in this study with ten previously sequenced pthA homologs revealed

that all functional pthA homologs (i.e., those that are required for citrus canker disease in

their respective strains) from all five known X citri groups carried exactly 17.5, 102bp

direct tandem repeats. All other homologs that are not functional for citrus canker

pathogenicity carried a different number of repeats.

Phylogenetic comparisons of the DNA and predicted protein sequences of the

thirteen available pthA homologs revealed the same phylogenetic distinctions that are

found by more general phylogenetic studies. In addition, comparisons of the five

functional pthA homologs from each group against those that were nonfunctional

revealed that amino acids N(12)G(13) in the second and Q(31)A(32) in the third variable

regions of the 17th direct tandem repeat were only conserved in functional genes. These

results suggest that the 17th repeat plays a critical role in citrus canker pathogenicity and

may help explain the origination of new citrus canker strains.


DNA sequence ofpthC:












































Predicted amino acid sequence ofpthC:





















DNA sequence ofpthA W:





















ggagacggtgcagcgg tgccggttgtgccaggcccatggcctgaccccggagcaggtcgtggccatcgccagcca























Predicted amino acid sequence of PthAW:

























DNA sequence ofpthA *













































Predicted amino acid sequence of PthA*

























DNA sequence of pthA *-2




































cgctccccccagcctcgcagcgttgggaccgtatcctccaggcatcagggatgaagggggccaaacctc tacttcaact

caaacgccggaccaggcgtctttgcatgc attcgccgattcgctggagcgtgacttggcgcccagcccaacgcacgaggg





Predicted amino acid sequence of PthA*-2
























L .-.F- LL I' L- 'L L"-
F .-. FELLL-~E:. L 'EL-
I ..F EL '*L E E L"-

I .-.F ELL -' EL' L"E F


I .-. FELL-'I E E:'L -
S I .F ELL.-1 I ,i I -
S.-. FELL-L E E'L-
.I .F ELLF-' ''L L"
F.=.F ELL.:.-FF L",-
F H F1. .' '.'F -F 'F-
L -i-LELL' *L 'L* L

F -

' --

S- -

F -


'F F
''F F

'2 -'2 -

-T.-LF, -.-

I T.-.L'I- '

- I .-.L'I- '_,

I T.-.LF-'

- I .-.L'I- '_,
TI .-.LFI-'

T .-.LFI- :

F lE.-.';'.
F F.-.-I

F F.-.I -
F L .-.'1.

F F.-.I -

F F.-.I .

F L .-.'1'

SF ..'
FL '- .-. :


F -- ,I ,- I.F .



L LL"-LF,.






''LF. E E I

L'LL F' L'FF :

L'LLT -. L'F :

1,L1 F E _- E 1
L'LL F' E L'E :

.L L.F'' F F -

T .i .' F F

LFli il LLE '
.LFiT i LF,~

LFlilT i: LF 1
LFliTii LFi
LEli i LFL',

LFli'l LF ,I'

T.T I 1T T I.Fr r


F,.-.H HTE


.F'-. HTE



101 150

-. Ll I L'L
_-.T Ei i, E

I .T i iLE'
--.T,-Eii E ,
_-.T LUi LL
_-.T,' Ei iLE

S: '- LI--

'1' : '_- LI-
: LI-

'LI' : '_- LI-

-- 'Li ILIL ', : '-LI-

_- .T -EiiLE ,l.-LF-

_-. -E-- L '[E '-LF-
-. F L- .- .LF-
_- I L- LIL I-- P_

.L'.-.E L- LT!
. I I.-. I Ti F
L'.-.F F F l IF

.'.-.E I T [ F

L'.-.E I T! [F
.L'.-.LE I T!!
.L,.-.E E 'T! F
. .- F F FTrl IF
.L'.-. F F T !!

-.F F F.

-.F F F.


-F E F.

-F F F.
F .F F F.

-F F F.
-.F E F.

.1 E.-.E F FF.
.1 L- .-. L 1-.

I L- I--F I-
-.1 L-. F F.
.I E..E F F F.
.1 L -.L F F .

.I E.-.E F F F.

.i F-..F F F F.
.I I.-. FF F.

i 1'_.1 F F F.

-_-.' :L'.-

-_-.' :L'.
_-.'' :L'.
.-... I [
-_-' :L'.-
. I- l -
-_ ''I :L'.-
_-.'' :L'.-

_-.'' :L'.

- HT.[I .
-.HT L':


il[ IF i
II l. F ;
illrIr IF -
ill IF i
ill IF I F F
i IL. IF I



F T F L. F

F lm 1.1-



F .-.'_

F .-.,-
F: .-.'_
F: .-.'_
F .f-.-

F : .-.'_
F .f-.-
. :.-.'_,
. .-.'_-
.F .-.,-

E 1.-.*-
.F .-.,

LLl- 1 L- L 1 I l H

I1.LT F .T '"- ""' i 1I F -I
E'LLF TL'- i' 'Eli iF i

*LIL IL.- I .L I II II -l I
LLF TL'.- i' "-j'"i" I iEl
1-1.F TII i-.1 '" "' F iI 1F i
I_-LF .TL' i EL II iF i

LE, L _- I '" "" i I ElI
LE 1L'- i II El

*L TL -*El 1 l F

* 1I-1- HI

-. I l-HHL
-.'-IH HL

-.' l-H L
-.'I-H l-
.- E. H I
.- E- H
.-- H E H
.- E. H
.-- H E H
.- -, H I

-.H t I IH.
Hl- t- I I-.
I H.- t I Ih-
H'-- i- FT H.

'-H'-- FT H.

I.-1l t I H.





-.L, -T

-_.L, -T


-.L, -T


-_ .L1-T



/' 'l. II.

' *' ll II

'-L'I II.
'dI ll l
''Ill l

.: .'i II.
'I ill l

'I 'ill

:' L.'i II
'*: J II

l'':-'. 1 i

-.L L-.I-HL-.I
- .LF F-.THF i--
-.LL- IHL- .I
_-.L L--.IHL-.I
-.LF L- THF --.


'.1''i ~i

, 'aii


, 'aii

, 'aii

I I.F- 1...T
F.--.LL-L L I
- I.F L-.L LT
I I.F 1.-.-T'
.F- .LL-.L L

.F-.L L-.L LT I
F I. F 1.- .T
.F-.L--. LLT

F I. F 1.- .T

F I. F 1.- .T
.F -L. LLT
-.F- -.L L-.LLT

F-..- .
F-..- .
F-..- .
F-..- .
F-..- .
F-..- .



F' IF- I- L.'_'LL' ILL. I .-.1I I -
F,- IF I.' .1 1'.I.L1 1 F
F-F FL' LLI'T' LLI I.- -.
F L-F L 'ILLI.'I. 'I ILLI 1.-.I 1-I -11'

F EL'- L'LT LLI I. F'-.'.
F-' F- .L' LL.I LLI .-.I 1- ''
F-- IF I.'' I.'1 -I 1. .-.1 1 '
F'- LE '_' LT'I L l .-.I F'-.-'
F-' F F- .L'LL.I '-' LLI. I 1.-.I 1- ''
F'- LE '_' LT'I L l .-.I F'-.-'
F-' F L' 'I.1 1LLI. .-. I 1- '
F-. L 'F L.' T'_.-'L' .--.1 I -''
F-'_l EE' L I' '-'ELLI I F.- -'_

FL-- H.i iFI IFi
FL-- H.i iFI IFi
L- H.-i i F l i
E I- .i li.

EL-. H.-i iF
E- H.-.ii F i
E-. H-.iiFi.
EL-- -H.-i iF

-. I.-.i F i.
EL-. H.-i iF

E- H.-.ii F i
EL--. -H.-iiF
L--. H..i iF .
L I- i F l i

.LT' -. IILTEiL'
.LT I.-. LliLT- L' I-

.LT I.-. LliLT- L' I-

.LTI-.-.F LliLTF1 L'I

F.LT' -. LliLT F LI-
.LT' FLiiLT '-I '

.LTI-.-.- LliLTIF- L"1


.i HH 1.:. HIH IET F HI
H H -T. I ,--H FTH F HT




. .-I : [ I I i .-. LI F L

.I.-. Il l.-. L 'F L L

P 1'' H-..-1' T F i E L''

P------------- i '
P 1 -- .-... _-1 T E C F

-------- -..LLI
-------- .LET'
------- -.LLET
-------- ..LET
.I.-. [I-T ''.-.LET'
--------- -.LETlI
-------- -..LET
--------- .L-ET

.I.-. : [i -.L L 'I

l- LLL-
F'' LL,
'F LL.
F'' LL,
'.-.L L

LL z .-11J, L L- L ..
L '.-H,- L- F .-

L,' '.-H,-L L .-.

L'_ :'.- LT L-E .-.
LD_ z-H, L, I:
L .-_ H-- !.LT E I -- .

L, -H1 -L : L ,, -

..LLI I- LL E L' L iL LI .
-.LET F LLE L El H,-LTE1.-1
-..LETl F LLF L lEi-,HLT F[L -


i -. I I '

S.-. H ii .1

I.-. Hi.
i -. -

I '- .-.L. T
! II.-.LET'
1 '.-.LET'
I I.-.LET'
1 .-. L -E T
! *L'.-.LET'
! ''.-.LET'
! ''.-.LET'
I ,.-.LET
! '.-. LET
! -''.-.LET'
I ,.-.LET

F1. T. F
Il- LLI-
F1. T. F
'F LL. F

F .LL. F
''F LL
'.F LL.

.F LL. F
i EEL:



' I
*L .

'L E'

--H LT L''r
--H' LTF F'
-H' LT EI'
-_ I-L T E .-.' '
--H. LTE E
-H' LT .- .'
--H'.LT EL '

H-'LT E L'
--H, LT El '
H- LT I ''

i1 -i'ELT L L'

-.. I iI y- -- ELI.-i '-'F
.-.I.-..[ii _,I 1 .-.iLET- I F

-. -. i ----.-I .LET' -F
*.-.i.-. H. *i I .-.LET F
.-. I.-.: [ i1 I -_1 .-.1 I '' F
-. I.-..r i- ,I_-I L.-.LET 'I' F
.-. .-..[i ~II .-.LET I '~' F
- I- il iI --I ,.-iI-.L T ,-,F
.-.i 1.-.: [1/ ,I 1 .LET ''F
-.I.-. .[i I,-- ,- .-.iLET F
i ily ELLI 'I-
-. 1.-.. [i 1 .-.LET F F
- I 1- T, -I -1.-iIT ,-F
I.-..-. HL- l L 1 .-.LETI 'F
'-i H.' L,,I; i 'J L L I' '' F






Ir l- -

1.r L -

1 I IG -T
I ll- -
i ii I -

i ii I -

H[i -1 1





.L1 T I!- LLI F L H I.-.I- L T Fi

.LL LL- I- LI -. HI L I- I- -
- - -- - I I- -

LLL L' l .-I-'-*-LI L- L'
L. T.F l- I -IH LTF F-

LL I F .-- i' T F FL '
LL- L' 'lH- LTF [ L'

LL..F I.' I'.-- ILT F F.-.
LLI L' '1-H- LT .-1 '

LL..F I .-- i LT F L'F-
LLF L, L F L''
L.L.F I l ..-- H-I.T F F---
LLI L, H- LT .-1'F

TI.TI.F I. F I.T r ..-

.-.I.-.. i iI[ I r'I ll 1.-.L IT
.-.I.-..[i iI,-,7li ,.-.LLT
S-.I -. l-.I -- .LET

.I.-. i I L _I ,.-.LET

-..-... i-l I'-l- I.-.LET

_.-I.-.. H I .-.LL ETI
.-.i .-.. H ii ll'l< i I .Ly ETI

.-.I.-. [L I ,,-.LET I
.I... I l-l l LT
.-.I -.: ii L lll 1..L IET
.-.I.-.. il--ll i :.LET

'1- LLL-
lF- LL-
I'F LL -
F1- LL
i. .LL F
ll LL l
" i .l m l
Fi .1. 1
IF 1.1.

LI l.--l-i'; L I L.--
L '_ --H LT -.-- "
L '--H LT .-'

L' l L--H -LT L-
bL L.-_H': bT E- L'
L, L I L
I. .H I-' LTi-i.-.'

L',l -- L LT L-

L .-'i LT I LE'I '
L' l. L L L- TF '
TL I-I'- T F Il."'
E' *i-F l El ~ r ill "



.-.I.-..i -- .-. LET
i. 11 TI I I I .I

".-.I. i.. l i II l-.LET

..I... [7 l I'' 1..LET
.-.I.-..[i I i ll 'l l '.-.LET

.I. li 1 L.e'T

.-.I.-..iI ill I l ..LET

..I... [1i T I'I l .L T

.-.I.-..[i illl .L. 'ET''

'F .LL.
' bF LL

-.i [ill- l 'I F- LLL

L, l.l-H LTF E lI
L'_'.- lLT E''
L, z-.H1 LTE I L

L ll:l.--lH l T F' 1 'l
L' '.-'LTEIL ''
L' z-1H, LT F E'L
L'_ Il.-_i' LTFL"1
Ll z-.Hl LT F El L

L L .-I' iLTi EI ''
LL 1'' -i'-LTE F "1

i [ I.. LL
-.i -.. [ U-l-ll--li "lll-l E T' "

-.il H L l I ll.l.LET I
-.I. 1-..i l I'' .L

I H Fll I 1" m
.i1 [ ll l ll "ll. LET'

..I. -..i L I l .LET I
-.I. -..i i -- -I .-.LET

..i -. [ ll .llyl E ll.l.L I '


F E l.1- E .1-- I I y- I
F El. E .1-- Il- I
'- LLL L, z.H-1 L I L L',

S'1- LL. L' .- L*- I. L- ,
'F LL L' '.--H-LT F"l--'
iF1.1. EE E 1-lEIL
' 1.1. I'- L,' .- 11-. LTI- L
'F! LLI- L'I .-I -I-.LT I- L'

* F1.1.1 I': 1- .1T F iii
S1.1.F EL' 1-- .LI L L,
'F 'LLE L,': 'lHi -LTIE_ L"

.-.I .-..H FL i ----------------------
.-.I .-..H L i ----------------------
I--.:H --7-i --

I -..-..HL --* --

.-.I.-.. Hi ,* I -
I 7 *- -1-i i
IL i-iL --
I H .-..i 1 ---I -
I-. i H L"II I I-.-.L E L'' .-. F
.-.I.-.. H F i -------------------- -
-.. 1 -.. ---------------------


I. I''- -- .LET" --F LL F






(508) -
(508) -
(508) -
(509) -
(577) -
(507) -
(507) -
(509) -
(509) -
(599) Q
(508) -

---- .-.LET
---- -LE T
---- E '?F

---- -.LET

[ i,-, i '': L ET
- --- -.LET
---- -..LET
---- -..LET


651 700
'F LL L''.- LT .-.I.-. -- '.-.L T F LL L''.- LT b
F LL L .H LTE E .I-. i -''- .LET' 'F LL L''- -I' H.LT
'FLL L''.-. LT '' .-.I.-. -- '.-.L T 'FLLE L''.-. LT b
,_:F LL .-.H.LTE E I .I-. i .- LETi F LL L I-. 'LT
S'FL LL '_''.-.H. LTF E'-' T-I I -- LET' 'F LLF- I ,-.H. LT
'FLLE L' 1.-'LTIE'' -.I.-.H '.-.LET 'FLLE L' ''.-. LT
''F LL L'' .-.H' .LT' FE' "-.- -. I i- .: '.LET LkL *_.-.H' H LT
'FLL L'''.- LT "' .-.I.-. '.-.L T ''FLLb L''.-i LT b
F LL L' ..H.LT [' -I i r-' .LET' IF LL L'' -H. LT
"IF LL- .H LT E' I i I ''-LET F LL L .-.H. i- LT
'FLL L'' L.- LT .-.I.-. -'- '.-.LET FLLE L'' H.-.'LT
F LLE- L,' L',H.LT .-. H- i -l'' .Li"T" LL -L', E'H.LTF
,F LL, 'L E H'-LT .-.'' .-.I.-. ,H -,-_,j -.LETL '" LL, 'L E H'-LT

701 750
E' -. I-. HL- I .LET' F LL L ..H.:LTF E .I i-:- l'' I.
' I-.1. H L -I .LET' F LL L ..H.:LTE E .I-. I i -l'' .L
'' -.i -. L".' .LET 'FLL L' 'L'.-.-LT -.I.-. H '..L
' I-.1. HL -I'' LET' F LLF L ..H.:LTE E .I-.' i.:-.l''
'' .-. -. [ '.-.LET FLL L' '.-. LL"T L -.I.-. '.-.L
E' -.T- [i._: -l' F.LET F* LL, Lk ..H.:LTE.,: -' .I.-.}[iI: -,',.
.- -. -. [iI- '.LET" FLL L ..H.:LT E: I -. .-.HL -.L
'' -. -. L"-'I '.LET 'FLL L'' H.- LT E E -. -. 1' '..L
[,,, T1 [i,--,-, :-- .L ET, F L L, L ,-.H LT, F,,-, -.-...}[i.- :-l,_ T.-.T
E''' -. i -. H L" '- '- ..L '' L L'k .-.'-' H LT E '' -.i .-.: HI L"-'-I''..L
E'' -.1I-. H L--I F:..LET :F LL' L .-.H.: LT E': -. i.'- i-:- i .:
[', -I .-. HL-,-I'' :..LET :F L''k -Lk E','H.:LTF'E .-.I.-. i :- '' .:
L"' I -. 1 -.: [i 'l.- .LETI ''FLL L' ''.-.H'.LI L "'' -.i.-. 1 i l-1' '.' -.L






1- L"--'- --1 -.-.L l 1- L .-.H 1 11-1- '-

LI I-.H.iL t I- L'
L: : .-.H .:LT E E'i '
I.' ''.-.H :LTF H'i'k
L, I-IH, LI E -I'
L. ,.-.Hi l.LT F E':

L, l :.-.H, LIE L -:
L: ,:'.-.H .:LT 1F ''
L' '-.-.H. :LT F E''
LI I.-.H L I Lli:l
L. .-.H. : LT F ''

L,: I,-H._L I L-I ''
I.- HI-L'T F Fl"'



[i I I I- I I I= I

[ I -- I I -[I .
[i I I I I I I I I II

ii I 'I I I

i i LII'I I'I'II

[ i' I I III] I 'I

ii I I-I I III
[ i I I I[I I





[ill i Ii


I11 I

SI I_ iI
I-I I i I i i i i
[ i I I I I I

F'- LL
'*:F LLF
'*:F LLF

-F LL. F
'I-I l k II

'II I lkIiiI

'II I lkIiiI

'II I ilk

L, H-.H- LL I


TL i _-. Hi- iT FI -I

I H'12 F' F'-
MLI IIII.-.i I_ "'LILLii
I_ ':'.-.H : LT 1 E':'
*L'.-':'.-.H.l: L'T F F-":'
MLII=.-.Il LI LL"'
I* I-':'H' 2T F- I"I'

.L ''e LLE L'- I' I- L L' L II-


L-' .-.H -LT E El
LI:I:I.-.H._LTF E L:
L,_ ,,.-.Hi--.LT E':'
*LC: :-.H.?LTE E :

L,_ ,,.-.H.:LT F E':'
L' ''.-.H.' LTF.- :

L,_ ,,.-.H.:LT F E'_'

L,_ ,,.-.H.:LT F E''



. [i I :- l:-LE IT

. I : Il- I '.--.L ET
. [i ;-:- l .LET
' [I I- I L
. H --I' LE
. [iI_ ,: l : ..L E'T
. [il '-', .-.LET

. [iI_ ,: l : ..L E'T
. :[ '-'_' I .-.L E T

. [iII -'' ET
. H --1-''.LET

I_'+ LLb

*ilF LL
- .-F LLF
i--F LLF

i-lF I.F
i-lF I.F
F.iF l.F
"-F LL. F



- .

i .

iT.*' F
L_ i i
* l_,i_ i i
*LI- i i
* l_,i_ i i
*LI- i i
* l_,i_ i i
I_,I- IlI

.- LLE L.I-.-.H



'I'F LL,

':'F LLF

I' LLb
-F 1.i. F
-F 1.i. F
-F 1.i. F
'F 1. F
-F 1.i. F
F 1.i. F
''F LL.F
-F .i F

L '.-.HI-H L
Ii -.H' iL
Ii-i-.H i-L
L' '-.H- L
* i -.H L
L' '-.H' L

IT.- F -H --L.
L' '.L-.H' L

IiI- i-.H iL

L'_ L'.-.i' -*L
i': I-' 'Hi L

F'T'l --IF IT.I. i- 'T. F. H I'T .T F r-'

i-irI --.. T.F T'I ITI T.II F il T. I' F .H -T.



I L F L"'
'T F F,-:-


T'r FI-I




iI 'II I'

i"--' i,

HI. L"' ''1
Ii -,-

HL-* :



F'i LLb
'*:F LLF
'*:F LLF
'*:F LLF
'*:F LLF

l--.F LLF
:l lk_
l'i ilk'


I-I I .
H -I I-

'I- I -
L' I I
'' F I
'I I I


-I I- F


,iTI-II 'I
I I-

i-I' I -I I

i.H -L L- L'F'
.H'-L T L EL''
.H'_LT L-L'T '
.H'_-LT E L''

I.'.. M-I'

.ii' ,.





I. L 'T I- L I_ I_' I -. _'I./'L I'F- TI- ,--
I- 1 -- I '.-.LL 'F LLE I' I-.H 'LTE 'F .I.-
- -.L - LL- - -.H'LTE .I.-. ,-i.
ML"_-"1_-! .-.LLT '"ELLLE I _' I.-. I_-/'LT/E '' TI-.- [i'-

- - - - - - -. E: .I.-. [i.
-- LT E iE i- !i,

- - - - - - -LT E : -.I.-. H
_ __-- - - - L T EL I -.I.- i
L ET__ T 1__-_-_ LT E --1 .T HFI

-- F 1l --- -- LT E l -T.I.-. HP
-[il l -ll' l- I LL ETI l I LL I : L I H ,l L lE:l -.I.-. ii
l l 'I LLETI IE LLl i l L H' LTEl -I .. I i

I _'-I.-.iH I I- LF

I' I-F 'H -I I I I, '

H.-.I: HL"- '- I.-.LL/ 'F1- LLI-

I.-. HL-l ''l- ..LLET ,F LLE

I_.-.;HL- 'I.-.LL/T ..E LLE
T I : -..-.- I -LE T -I F I I-
- - --- --*- l 1-- -
I H I I- I F I I I-
I i I I I F I I- I-







A H' L- I I'


T .F'T



,, LLb
-- I- 1. F
OF 11. F
'*'F LLF

O F 1.. F

iF LL. F

'-:'F LLF

iF LL. F
'--F LL F
'-F T.1.

.H.FLT' El
.H.,LT E
.H'.LT EE -
.iHK-'LT F E-_
.H.FLT' El
.H--.LT EE

.H-'1LT F E'

H.'1.1 F E1
H.H'-T F .'

[il ,-- --F

iI-,_-, F

[i, ,-- --F
[il-, F
ii, '_' F

[i,--- F
[ii '-F
[ii' '-F
[I'-'.-' F


L'.-. L--.LITIL-'HL L-.L .' F '- F F E.-.LL-. I LEH-.E

_-.LTI -iL -H L
_-.L'I il I-H
_ -. I 1il-l H -I
- .LT il'I-iLH
--.LTI -i'HL
-.LT I il'H -iL

- Eli H T-
--.LTI -'IHL
- .LT, i H -iL
:-.LTI il-1-iL

-' -F

L'_- F

L'_-,i- F

L'_l'_ F
L':_,':_ F

I '-L. H -.I

S'1. F i--.F
-IE --_.E

S'1.F H_-.F
i' l-I H -.

S'1.F i--.F

i' -IF H-.
S'1. F H_-.F
_I l- H_-.
' -LE 1--.


.-.Li I
.-.L 1
.-.LI ,.

T 1 1





I E I- T
I F- F T
I F- F T

I E F- T
I E L- I
I F Fl-



F,,, H
F-,-, H
F'-I- H

F-_-_ H

F,-,I H

F'-I- H

F-,-,,- H

F H. --L.': F F- -.
F H 1.1. : L F F- T
F H -LL.':'LEF F I
F H .LL '.L F- '_F I
F H'-LL'_LEF F ':- I'

F H. 1.L.L .EF F IT
F H,-1.T I.- .TF F F I
F H,-1.I.-_- E F F 'T
F H,-1.I.-_- E F F 'T
FM-EiL 'L FLl- '-i I














F i i' l-I L'.-. il F 1-. F E I

: F i i I ,F I 1.-.. I F -i F E. I

'F iMF IL L'.-.-I -1 F L F I

'F i il-F I -1.. I F1 F E I
'F i iLF I L' I'.-. II F-. F I
,-F i i LF I -L, -. .- 11i F -. F ET
F: i iLF I L ,L .-..,-! I F_-.i E ET
*:'F'i- iL'FI/ L 'l'.-.. '- l I F-_-.i F .- : T
: F i i L,!F I ,2.-..:,-! i 'F_-.J E E T

I'T E [ .-. : LH.-.E.-.L L' L
T :TFL" LH-E-.* L
T T'I F -. I H.-. .-. I
T 'IT F I '-. i H.-. .-.L' L
IT E L":'. LH.-.-. L L
T'I F [.-. I H-. F-. I L

T :TE "'.:-. LH.-._.-.L' L
I ''I F .-. I.H.-. F.-. I' i.
T:TE "'.-. LH-.E-. L L
TI'I F .'-. LH.--.F.-.L' L
T ITL":' L- L. LHE. L
T 'T F [ -. i .- '-.L' :
-'' F L".-. LH.-. F-.E .L
-,-,'T'F -r .l I.H F- -I'- T.





- F i[ FF [I : -. TI- E .- L*. l EE F--.F E'F [ -I .

-F F F F i'F
F i'F : F : L'F
-F iF F i -F
F F F .f F

-F F .F .r ,F

F iF F
* F iF :F : 1

'I .-- -

"T. --

' '-I F
T.:- F


T -. F

TI,' !-

I I- I I -

.F I' 'F L -
F I F- F -

F- I' F- L,-

I- I EI I -

F Fl -

'F 'F
EFE'F L.-.


i F F '-I- F I _
1 'I-'-I-L LE 'T TI.-_

i ---L F F -' F I _

I, -L F LEF '--' F T.I

I'-i-L ElE T.--_

I '-I-I-L F 1,F '- F I._

I .'.'.L F ,'F '- F

I -, L F F ,-' F i LL-
l' ',:L P- L'1', P T !L F.-.

T l IF E'_'L' LI IE.-i.-
TI l F ''L' L I'FE.-.-
IT l IF E'I_'LIL LI 'F I I -.* I

T IF FE'l L',F E-.- -
TI I F E 'ILL L'F I F -,--.-

T -1 IF E L'L'lF E .-

TI l F F L' L IE .- .- .-
T 1 F El L L' L'''- I -.I .
T 1 IF ''L'lE F E .-' -

_T I IF EL''L'L L'L L -,--
T IF F E' F E, IF -I .
T -I F E L ,L L, -
I i riF ', ,- I, I. .
TI 11 iE- .-' L'[: .- .-
T 1 F1i E- [ 1.[ E_



ELE -.F -
EL E--.F
F -.F-.F
E L E-. F
LF --.F
L T-.F-F
E L -. F
F T. F-F

F I.F ',

' ILE L.-
' L.FF.-
'TLE E.-.
'T' FF.-
'TLE E..
I' L P I-.
'Ti FF.-


ETHI E -I*1F F F- :-.

F T HEI- FF -F F_-.':
E TH EF -L*,F F--.T

F T H E-, F .F F -..:

F Ti-iE H. : F F -.':

E TH -E ,L* ITF --.
F T H E- F. F F -..T
F T H E -.*,F F--.T
F Ti iEH. FFF F '-.':

F i ["T '- .-,L' :
I T I F--- --

ELF L[LL'[.-.
EF F iT. .-.F
ELF L'LL' .-.
EF L. ..-.F
EF IL.L ..-.F
EFL LLL' .-.
EF F .T. -. F
EF F .T. -. F
EF T...-. F


E-F EL L'..



.HL.F- .1 iiF
.H1.F- .1 iiF
LHL -L iiF
.H1.F- .r iiF
L.H1.F- L.iiF
L.H1.F- L.iiF
LHL -iL iiF
L.H1.F- iiF
LHL -L iiF
L.H1.F- .1iiF
I.HL.F F L. ii,
LHLE F L ii'

I I- L- I- T

iF FFT':
iF F FT'



1 I F T F-

T .F F.-. F :Fii- HF I L .-..HI IIIF--. E
_TL' F .-. :F i i F I I L:. I-..- !i F-.E
,_-' F [ -:IE l- H I l 'I -. l -! i F_-





-.LL[E L ---.FliELLL-.iiLi IELL L
-IF.L I I.FF-.TFIIFFF i L.- iI. I F.
.-.L*L.EF.-.I I -EEL.iL EI LFT.T F
.-. E T..F- IiEEE i-.ii Li i LL 'E,
.-.LLFF L.-.FIIFF F L..i- L F IFLL-. F-
.-. LF- -. iEEIi L.I-.ii L IiLL F -
.-.LL -FF-.-.FlIF FF ..i-i i.IFLL. F-'
.-.,FE---.FliEE Ei L.-.ii Li iELLL,
.-.LL -FF-.-.FlIF FF ..i-i i.IFLL. F-'
.--. ,~-E -..E iEE EL.-.iiL Li iELL ,-
.-.LL L--.-.FlIFF -F .i L IFLL -FF;