<%BANNER%>

Genetic Determinants of Host Range Specificity of the Wellington Strain of Xanthomonas axonopodis pv. citri

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101124_AAAAAL INGEST_TIME 2010-11-24T08:14:05Z PACKAGE UFE0011522_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 20566 DFID F20101124_AAALKS ORIGIN DEPOSITOR PATH rybak_m_Page_34.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
7b956c304fdbb850d253a22e7fbae5bb
SHA-1
63d66e0c70483f2f5dad9db1eef49c44db0c9ff6
20658 F20101124_AAALFV rybak_m_Page_30.pro
a55f6ec0d6840ea3ea547fec56b06c19
3436ea32c2c988dae813c547392530343d92015b
7220 F20101124_AAAKYX rybak_m_Page_49thm.jpg
37346b383191eecb9b3ac8ff9eed052b
5518e5bceab417773ac1395530ad2d553ac40451
72825 F20101124_AAALAY rybak_m_Page_47.jpg
60ed95ae73d7ab50183ccdc728c89b91
9c8eeac0b547d7cddded6ea27955fc94523e589e
24102 F20101124_AAALKT rybak_m_Page_35.QC.jpg
0ab8dae089395f98ec51f8490b6b305c
b8d1e88546dec26975e59fc24126dc227bd56ede
28425 F20101124_AAALFW rybak_m_Page_31.pro
18d9a4291625de0523f678190f23460c
85d0b2d9602e736db35e0843ec75ecd57c63a5c4
1051969 F20101124_AAAKWA rybak_m_Page_55.jp2
52d2cbb727b33aa3bb646c2e996fcd78
92568a6d6672569d76386860512847c24f60c62e
1053954 F20101124_AAAKYY rybak_m_Page_67.tif
ace3b9c36289b35282d4724f39498eec
aec081e1d550085b1cebca2d99c8f4dc576984be
82494 F20101124_AAALAZ rybak_m_Page_49.jpg
eb365c75fbdc54bf886ed5232635fb74
fa79395f7d0642227da0f4c1db5bf74a5998a083
6799 F20101124_AAALKU rybak_m_Page_35thm.jpg
40437a7f28c76f8d851131c659033940
ba34ec40c972550ac51603419eb655071e869623
14356 F20101124_AAALFX rybak_m_Page_33.pro
eeeacf6fed736a4b7b9db03991b4e647
f4b32a44466e9fbb6b1731e1bd1075ef8eb2e0a9
6830 F20101124_AAAKWB rybak_m_Page_46thm.jpg
27bca9eaba29c10b69fd9085ec32458e
5b249bc61996e8920e677d642e6b0bab21b76b7c
41297 F20101124_AAAKYZ rybak_m_Page_20.pro
b3df28408336db3b84713decf3696c8f
40e3ee4e5f8f0aad241522da0e7fc55457c02433
25148 F20101124_AAALKV rybak_m_Page_36.QC.jpg
931a8c070375951cf81729bf2f929d64
9d4451e3ababb78d779225325f87feffa0aaf2cc
40971 F20101124_AAALFY rybak_m_Page_34.pro
65b87cba1b9cb8185a1228eb00698246
37d19a78e4e7bdfc2b29c81cbae560d621c5d910
F20101124_AAAKWC rybak_m_Page_13.tif
de84537f84c754a8b38749e34eef27ae
f88c4b59a37a7a0facbdd6ab6fba3de45747c27f
6926 F20101124_AAALKW rybak_m_Page_36thm.jpg
97a0b1a6e6013d0b2dd737bd29d2912c
859edeae2a95c0c412054cbf61c3b241e4e4646b
49479 F20101124_AAALFZ rybak_m_Page_35.pro
472dff5998c7ca33233997347ac260be
d00400a696c7d77ea342fd0b630d3818ed8cecd0
74019 F20101124_AAAKWD rybak_m_Page_62.jpg
c4fd80219360dcf2d0cf586adc84390b
db1194d2be435c91da973eb8e85a492115f734e8
543415 F20101124_AAALDA rybak_m_Page_57.jp2
dbb63622760759018f4275a225ae3506
d4860bd5832724cc3be6261a999f9d19de1b4a78
6488 F20101124_AAALKX rybak_m_Page_37thm.jpg
fdac88f2727dcb8daf31514940d61d8b
d1deba8e7c992e8e230cacb2284a6f7490409f90
64618 F20101124_AAAKWE rybak_m_Page_12.jpg
5beb4f921741557296246f8ecc96b2e9
ad302164de269daf65e5b9d13092ab4640a0f041
1051916 F20101124_AAALDB rybak_m_Page_59.jp2
4b7d2d17d1c1d5f5b1a16873b2ced969
6e21267faab3522f2490fcd0963e5d7b209e9440
6834 F20101124_AAALKY rybak_m_Page_38thm.jpg
23ea38eb0cead2bbf51dd45e91860024
8efb42e778b47e2d0c49f4134f5c4860de5c892f
40256 F20101124_AAAKWF rybak_m_Page_25.jpg
cabcfe9cf2c1bca958c88a1a33d3a218
d4e682a2b7c52c28334c478907b32f81df412e7c
1749 F20101124_AAALIA rybak_m_Page_34.txt
666dff560a8fc59452ae090b40c0eecb
7399b95258fb9c2d3d9754db45f179abc23bda12
1051929 F20101124_AAALDC rybak_m_Page_60.jp2
336356277a01f828a5a7f532352b90f4
3629444406481e66cd0c8cbebaee4523229d1e60
20376 F20101124_AAALKZ rybak_m_Page_39.QC.jpg
23b600f13da4124ee2a372e83ebe6e69
620812b80f16c22ccfaeb1d0cc9df8e16bd9fc79
1051983 F20101124_AAAKWG rybak_m_Page_09.jp2
8f22dda72284fbcd348cb4983fffa156
d60855c5d1e43322ce58de54530bbb9c7505d56d
1954 F20101124_AAALIB rybak_m_Page_35.txt
312631ff954212327f8e796a776a0cc2
cd762f01334e375a09f854a0de0a4a5ceb028239
97494 F20101124_AAALDD rybak_m_Page_61.jp2
22a16264a9f2b396812fc46479a061c8
d2f8edd132a65fb0f20dc8d7a5246e4a89ead80c
1838 F20101124_AAAKWH rybak_m_Page_13.txt
1b333387a1b58f577a52a38ea9c009bb
8d41181a68e47497a7b1b28d99103c581f80f9c6
2044 F20101124_AAALIC rybak_m_Page_36.txt
64c81b109389694f791217e1c4f3255d
6dbb03724a65a3cfbd20774707d0d34f747dcc7f
110597 F20101124_AAALDE rybak_m_Page_62.jp2
8f178d9a1b7d5dd04c91ed4d8272309d
3e405e532fcae216dad491d42f497c8279313b16
21596 F20101124_AAAKWI rybak_m_Page_14.QC.jpg
aed6697413384f18754ee0d69b90046c
0beac28d33d8e934eb8a0c9ee2cdb08baa4b8e74
124087 F20101124_AAALDF rybak_m_Page_65.jp2
885fb4730d5b4824d44f8d6463074ef3
f1c9556f5477f78a75163616fb904783e4b40fb9
F20101124_AAAKWJ rybak_m_Page_50.tif
663a7324d1ba349e11c80cee6cb7cd74
b05dd535f1a0d6068322143c60c88ae7ad2a940d
1985 F20101124_AAALID rybak_m_Page_38.txt
f19752ad17d4b1d49ce180ec877dcf9b
a5fbe027da4e113aa8ad9f3abcc15b5f873fd50b
132165 F20101124_AAALDG rybak_m_Page_67.jp2
0f5edc82d5bb825843712cc929c497d5
716b5ca0d6ad64be9f64e6d22fc688a1f0fff05d
1517 F20101124_AAALIE rybak_m_Page_39.txt
dc178e53bbdaf21534fb28d2be75955a
5192a93ecd80b5b29d8afc13c9c4834c5419edc8
124873 F20101124_AAALDH rybak_m_Page_68.jp2
45460ee6d2cb0e361bf1532afda94919
65f3c7da1827f5b9a7d8fe8d6fdbf210dc7850ee
6607 F20101124_AAAKWK rybak_m_Page_45thm.jpg
79ef2371a2d01291b4fb967d1bd75963
c616daf4ad87348adb2376a3e9d8e27be01c26fe
528 F20101124_AAALIF rybak_m_Page_40.txt
d27539b7f34da1181a7194ae57dd3e5e
5887ba195ead43cd6af5e40f5b0b050180c507e5
130122 F20101124_AAALDI rybak_m_Page_69.jp2
fdd5b44ebf40b69e90127abb0c07d272
7d4d12b50d079b0271717b8225490851cb3fae03
63149 F20101124_AAAKWL rybak_m_Page_33.jpg
4ff68fdd00741bae09dafc5b6f146d85
a83462ecc03746837209dcbc25b59c45853d823a
1817 F20101124_AAALIG rybak_m_Page_42.txt
abddd487d45f3e3a28e4061b4b1cc660
85a62dea96a9162465f27446dd5d93c1d3a3779c
122616 F20101124_AAALDJ rybak_m_Page_70.jp2
8aee021f9e8dd9095c326e465c769f3f
9d9f89fb8acf912feac3c3cf8aa23654451bf068
3479 F20101124_AAAKWM rybak_m_Page_09thm.jpg
2f63aca78cc0161f76b96f070f08156c
6c7bf6337b1ee7ced360e7af34a7a2fd4e2708dd
1841 F20101124_AAALIH rybak_m_Page_46.txt
9fe32696c9f8eb9043b6a2ca19801801
3801a68dfaaa1336a608e1a2b22a3d727059c21e
39349 F20101124_AAALDK rybak_m_Page_71.jp2
5a63b9b641926964e769e1253828d78b
39bfe20c4f641f3610715c0bdc3e70ed7ba11c7a
F20101124_AAAKWN rybak_m_Page_15.tif
25fcf88e95b1ac864ac5edadae85439e
7b1c5f17512bd9d907d81f8ee99d62a17411867b
1872 F20101124_AAALII rybak_m_Page_47.txt
50818ca5e42cd26a9b121891477b54c9
952db5a3225dfb84582aa8b92595be0e57824ff9
F20101124_AAALDL rybak_m_Page_02.tif
731ef7ad72da18498e45b795e4ccabc2
b8c6f57e9a67025f3bd78817730907971578e515
60952 F20101124_AAAKWO rybak_m_Page_20.jpg
5201b14b9ec593d4bd0fe7adcce77292
74498092908efbecc97a0bf48689b08e675756b1
2053 F20101124_AAALIJ rybak_m_Page_48.txt
894f9de91e3d327f4a184923cf2412a2
f9b71d5743ba01cc0e190e22abe7ed1542239969
F20101124_AAALDM rybak_m_Page_03.tif
65b490bccab47a0eb1e5beea9d7ae0fc
0b8a6145413631ae3696da95966dbd8f8ce40261
47442 F20101124_AAAKWP rybak_m_Page_28.pro
841f7f32e587a96eb8eaca276a3ec3c2
6f948603c5aa4bb52c9e782eadc557c50aca4769
1996 F20101124_AAALIK rybak_m_Page_49.txt
fde3afa3f7d981acdd6a191a3233094b
1f9108753202467dc1d44a68eb125c44af160dfc
F20101124_AAALDN rybak_m_Page_04.tif
d2bd014b57b35e5d5a38db00cb624ae8
06ccaa97fe3a3e253cfb67d1db3a42e0961ef524
1661 F20101124_AAAKWQ rybak_m_Page_04.txt
d69a74f30d3b57555d78436762341173
2bec55fe57ccc6289e3588dc93b1b89b62fe7c74
2079 F20101124_AAALIL rybak_m_Page_50.txt
3e275915eb5d7cfa6596f53e970f6197
7a8a606ab209446b0efcdd4dd2277f235762e8a6
25271604 F20101124_AAALDO rybak_m_Page_05.tif
ed3afa7ff35914047ebb9e429accf0a3
942580d15d813bbc0de5f194ed71e93a36a20caa
3988 F20101124_AAAKWR rybak_m_Page_07thm.jpg
9da743b37a45bbaff691f2189ed39049
5737b7e75f9b9c3e9ff8d7c5d4b1e3f5b6d1e92d
1574 F20101124_AAALIM rybak_m_Page_52.txt
f359ef8e5d0ef463c676e47f88dc4654
d35e9bc3f5880fa0004d7a5c4338705acdd7b87e
F20101124_AAALDP rybak_m_Page_06.tif
cab5127944c07b1431727e771da22c6f
9fe8c7784f33a3b23681c96790ab775d264eb014
295 F20101124_AAALIN rybak_m_Page_53.txt
c6a7e61e5bf47b371f6dd08504b1e9e3
846c3ad80c1cd399db0e955df850a2b51f101452
F20101124_AAALDQ rybak_m_Page_07.tif
157b9450e42fb2ed097075ac8367f0f7
26ca651e5f8ba0e479b31b388a43d41df386f3fb
72447 F20101124_AAAKWS rybak_m_Page_51.jpg
f1f3367b6c6cd384d78181866811bc97
2027a28021354c85b06149bf5a61140dea04fd9a
454 F20101124_AAALIO rybak_m_Page_54.txt
77b511fbd70629e14c38d043aac84991
4c56b29163e2f5494c952e950bd067ca36b2b476
F20101124_AAALDR rybak_m_Page_12.tif
0070023c57da2b3852a66512f695a066
394a02a0fa978f28d8d2d03118b55f443174f2ec
58494 F20101124_AAAKWT rybak_m_Page_65.pro
82b6ef8e9edd67a48175a7962f2f6466
5ac6817cec0f9907fd895824147e5da2349afaab
376 F20101124_AAALIP rybak_m_Page_55.txt
b22459e20376cb298dd767566dcab38c
989032d1731fdcba736e2f640ceb471c36f8ed1f
F20101124_AAALDS rybak_m_Page_14.tif
8837a0df841dc82aa8a7998d9fb5fb3b
861a8c3b37c5f41ed07f6bd9510f12e1f7def80c
45013 F20101124_AAAKWU rybak_m_Page_23.pro
6cd075d204632cf52d5a622a27ece0b7
90d82787cfefc0e49f52d4643ca8d13d10867c3a
692 F20101124_AAALIQ rybak_m_Page_56.txt
36c29010cb4cfaa9927d20bfbc6e3294
7b91d0fef84c54699c4d17dbe0608414b75973b2
F20101124_AAALDT rybak_m_Page_16.tif
1ddbb71b666faf71ee9310a905313de6
26f7927ea3f15b874a4836c43b1ee43d78c86f93
14875 F20101124_AAAKWV rybak_m_Page_07.QC.jpg
d9cded132bff7db8adec1c10577dd975
dbb0e4be8cfbe4b5b33f738416c8eb60ae7240ce
675 F20101124_AAALIR rybak_m_Page_57.txt
ccba93bb7859b133441c0d03512300a1
b6d76a72189f90757dadeb2ba3b15ff7c89eeb7c
F20101124_AAALDU rybak_m_Page_18.tif
6b7a4cda0a29041dc6099453a448bdd1
dc575bc69fb3f16848be6405763e8c9e5e7c114b
101038 F20101124_AAAKWW rybak_m_Page_63.jp2
7ee7b21ada36a1793e45c89f27bcd0c6
dc11910f2c37d222bff833eab2b2d056d246bbb2
2840 F20101124_AAALIS rybak_m_Page_58.txt
ce9175f1f6c876a2d1abafd484cd9356
56e0ce9f5d91b960f46e9dffe54907b5cda9f155
F20101124_AAALDV rybak_m_Page_19.tif
b7bf0a5e2805953abfbb7e75d82f5377
2029de739e974327ff3a269ea1b3aaa6f97c45b8
6075 F20101124_AAAKWX rybak_m_Page_61thm.jpg
6a64ae0499f59f221bc7a7d1486bf7aa
7a8a97f0e8b78238b70f5fc730a12863fc7c00a3
2832 F20101124_AAALIT rybak_m_Page_59.txt
53ff5cd727f8191c79d9acea8637bb8d
eb667bc03146949d203a2f3e3574e92ee7bed29d
F20101124_AAALDW rybak_m_Page_20.tif
f4dad405ddddba99b27593dad8e553f2
38568b8ff4b24307f9bc831f4204c5694dd56343
5794 F20101124_AAAKUA rybak_m_Page_04thm.jpg
5bbb5d6e749a1222544c93b17c6223bc
d6a08cf679823a29d9b121e82dfeda637a50f0c8
5898 F20101124_AAAKWY rybak_m_Page_72thm.jpg
f555a682a53b7c9f3b6827ffe0320ab8
3a21409a35e2361b00cb1aa52be9e068677cd8bf
F20101124_AAALIU rybak_m_Page_62.txt
fa5eccc154e0cb6b6c8387549f2f176b
4868ba8d591c4b2e273366424054945442e96306
F20101124_AAALDX rybak_m_Page_21.tif
7a4324e7e0db3d9bc14337664deeb313
34b0e95f2d066fa2b392704ea8ed8edce7ba40d4
65523 F20101124_AAAKUB rybak_m_Page_14.jpg
afadab4458062d0f4506d856a446b00c
f079144635fa85fa708ab8ea7441a779323ad67b
5930 F20101124_AAAKWZ rybak_m_Page_12thm.jpg
9dc303345aeb9334a6e1bfe88ac259cc
eefdba10c41ec01afcbee55c861969d2ad6e1e99
895 F20101124_AAALIV rybak_m_Page_64.txt
b0188bb05993b47b58f967a6a859197f
12837a10e4f6bdf67ecc7126f7770d06f371557a
F20101124_AAALDY rybak_m_Page_22.tif
a43ac3223b057e7b689f050d955ec436
3ced091eb0b9e399667926e948a962ae47bf8859
41734 F20101124_AAAKUC rybak_m_Page_54.jpg
66293e3005aba9eaa2ed58ee20bfee32
e2ae270a09a6fbef14f701f650316ec816f4e939
2377 F20101124_AAALIW rybak_m_Page_65.txt
08884a0ec95223e37906c3da1db73dca
d7387da72c7fdb84b5cc36516bf55b8f5fd96e08
1798 F20101124_AAAKZA rybak_m_Page_61.txt
e77ea64158e3611f17c76af8ec2082e6
6140f46d22abedeec28c245a4bd3c5dde6d7f18f
45720 F20101124_AAALBA rybak_m_Page_55.jpg
877357e663adda931bd6a636d42df2b3
191a41914147982a8d9c23bb0a42bc0ad2f9d436
F20101124_AAALDZ rybak_m_Page_24.tif
519fc1190b09ef4d72af244610a28a11
fda119717e7eb8ad23940721626bb28bd036063d
F20101124_AAAKUD rybak_m_Page_42.tif
ff727f49c2499824e08641b1a9cd4b21
09f90796650bb19cf9a037ff59c79fba6257e311
2676 F20101124_AAALIX rybak_m_Page_66.txt
ded7f87551fd3066f3fa33e89f69c12c
e6d1456ef1c8fa263c8e21de50fff35cd9b988ff
25359 F20101124_AAAKZB rybak_m_Page_48.QC.jpg
9aa9471a85bb13acc18b55e12194b3df
3fc067692cd7fea8a87528ced83a5d7083437b2f
48320 F20101124_AAALBB rybak_m_Page_56.jpg
51118d870db72a8b9c55100d05c8c5b5
08361867594eb40c1d1dc902c46fe0d9ebb7496f
1893 F20101124_AAAKUE rybak_m_Page_45.txt
398b41de7b17ee5472ce12f63d6b61fa
a5dd4fa146811e22a280ce3b9f91b1b2f23a056b
2582 F20101124_AAALIY rybak_m_Page_67.txt
282a57a6986d66b23579448a08e8da6c
8d3cac619cf265c34774da341adea26a2c18ccae
6057 F20101124_AAAKZC rybak_m_Page_14thm.jpg
4821c779feb81b6712641c8bcda285a3
99019a0e19443287220469505203954400bdc1bc
38249 F20101124_AAALBC rybak_m_Page_57.jpg
c38881fbb1c12bb45e3cc750a485561c
a5c8e1cc1f07aab8561e05d5a76e02064a86a92e
F20101124_AAAKUF rybak_m_Page_08.tif
51082d0981b34192594a358bad388bac
1a8d1839d5685bda3b9cb53fd53f03b81a9d9ec8
51938 F20101124_AAALGA rybak_m_Page_36.pro
6be3156a647103d2d1e09f2aca8259f8
d3e835943197d94f4aae5b3e2dc9af262d6d6d0a
2437 F20101124_AAALIZ rybak_m_Page_68.txt
5f8ea77f5f44a07dcf4304132eb1b66f
1cf82c7480cef1a080629e2512ced286735e638c
12025 F20101124_AAAKZD rybak_m_Page_25.QC.jpg
5dda641586228a9ac8f75f3c6823a803
78da7d2bcfceb6f4fa4e0dcb00d46ebd0bdda98a
85184 F20101124_AAALBD rybak_m_Page_59.jpg
bc4a98e4bb94f23ca4e05b98e4b38c30
c725cce7fb12ce9ace7d792b39305b8836a90be5
3246 F20101124_AAAKUG rybak_m_Page_26thm.jpg
2f49ac712ec0900802bd66b4cb235d59
8d5e1ddbc4ab40a06833f77b43ec8d1704162749
23978 F20101124_AAAKZE rybak_m_Page_38.QC.jpg
0de6541a8c4f169ed9deb6cb2c2b5bcf
670cb79df095510732944411ba7df0f3143020d0
71605 F20101124_AAALBE rybak_m_Page_60.jpg
bf37fe1821d952774929a39841d1338b
b99043dadb15564f96324de36f329a63aaab9dee
4203 F20101124_AAAKUH rybak_m_Page_24thm.jpg
2a1c2d33d65516a5b5d29eef543e99d8
e23b233dea130c7d21aa4623a29b9e9fc3c0132e
47416 F20101124_AAALGB rybak_m_Page_37.pro
ef2d46733d4f51e7a21e10913d2d5fe8
8a709e68cfb0f1301da780506fa2be3f9700a12d
3934 F20101124_AAALLA rybak_m_Page_41thm.jpg
cabdc9ba2b32430457a6f6ce9914c816
3e7ec86f22767e1f08a2a8ef2533c640ca6681ca
22943 F20101124_AAAKZF rybak_m_Page_45.QC.jpg
5f524d6d42e71df2d02db9276ed013ea
21ecfef1d81a9a0c4670c17468a4ad0d723c38ba
64551 F20101124_AAALBF rybak_m_Page_61.jpg
df5da4a2ec53bb3d9f0215cbcae460d1
2495c19f34f6a7af8838ae8610f1e54de62ab069
F20101124_AAAKUI rybak_m_Page_35.tif
2d8e258a6a84d92e158f84df2227000f
2c62804e76171eddb5fe6fdd3e4b509b330223e6
49681 F20101124_AAALGC rybak_m_Page_38.pro
05d4fe71634166f9bf25e683b20e3860
287025ff635ff3153d213c08b764e5059a23a0b4
19515 F20101124_AAALLB rybak_m_Page_42.QC.jpg
5a3e427bbb09e40c830d7ccfcbb19b0f
f5b4f75885160566aaf46ddbad11016f81c478f1
67314 F20101124_AAALBG rybak_m_Page_63.jpg
8ea8226381d47e87b5e02147afc7ebc5
d5697ff917a543b0b74a1b9439064e8177b352b3
F20101124_AAAKUJ rybak_m_Page_17.tif
919676e04f6fdf9b282b0e70c56104c1
f1b684b005cbd14179b4ba456c192f0c16467e77
36171 F20101124_AAALGD rybak_m_Page_39.pro
eaef3d92f4d81c0e8115e3f503b74a41
98c0b4d5e71779f571b6dd88098767007acca303
44524 F20101124_AAAKZG rybak_m_Page_43.jpg
3bc426aab6b1ab161c007ef712c3b394
12aeb23f1ba40329a36cac2b1c5b3a3084ee4c00
5483 F20101124_AAALLC rybak_m_Page_42thm.jpg
d02b6a584ec60309f7c1bd5f109ebe05
4a90ca516b1956c0aea64d45041c3059491349c1
84914 F20101124_AAALBH rybak_m_Page_65.jpg
7dba8e6aa784b8ba80af0a05e56de088
5b541bcca90c319e8ee6cec352d4d8bb957f6aed
1091 F20101124_AAAKUK rybak_m_Page_43.txt
c2abd8efb324a94764a0e45692ccb7ee
e3183a74905987d594af8eeebd0990c82fae35f7
11975 F20101124_AAALGE rybak_m_Page_40.pro
17ebcfeb39bebab71d52066cf62706a4
788c3f49a8803f20c6f4230635e6c1e157fec075
91118 F20101124_AAAKZH rybak_m_Page_27.jp2
c832554bd46ced8914afbd4bd383364b
852560cc7f3a796573b49926f466566d4e10a428
13542 F20101124_AAALLD rybak_m_Page_43.QC.jpg
e704ef81eb9a4c3d0e49bb24c9c1775d
42ca2320761e883f09ca54e08ea2ab6627c0deed
92636 F20101124_AAALBI rybak_m_Page_66.jpg
cc9bd48edaaba5176fd241ff2b7f9745
b28a3b45090e11c9cbb60556648898dbd598dff2
1051926 F20101124_AAAKUL rybak_m_Page_58.jp2
58378a20c360e2335bbbe4ae5bc088ab
ecaa2f8dd9a7f9d4369cc91009f025544e5516ba
25677 F20101124_AAALGF rybak_m_Page_43.pro
9b9fd4f1fb0d87de224380e7eeec17f4
3fb391ef3e76e0fe376a56747c132e33dfa6f3ef
F20101124_AAAKZI rybak_m_Page_52.tif
1c3daa2119ccb04720f8f69c4537e33a
9b31199d321b74bbf2d777a26d66f05abca00a1e
4120 F20101124_AAALLE rybak_m_Page_43thm.jpg
2b3a3ddbc88af3193c11b270af38444f
57ac8cb99632037fd8776c5ef44eacae0a967dde
90195 F20101124_AAALBJ rybak_m_Page_67.jpg
0716af1e9092f7a05f5d0a57a05625bc
fd455520468cf6ba4778a679559a95e1d38efa23
2430 F20101124_AAAKUM rybak_m_Page_70.txt
28850f0b768e48146654b59fa5abb3ed
ee84d937c179076c6d422bcb3168833876587307
40146 F20101124_AAALGG rybak_m_Page_44.pro
92cc7d8dd0e053f00372841a3c2c31bc
26880f24d8b4184e640850f782c37ef3671a2057
4607 F20101124_AAAKZJ rybak_m_Page_54thm.jpg
8b7274873e86729057ec9f6531b983f7
6ba84078f1f9cf5eb239b83a2196fd1a76acc164
19875 F20101124_AAALLF rybak_m_Page_44.QC.jpg
eb0e5c6e0508e17fa5a9bcb18d0c3695
91830a1c160bf8d9a77e0e33785c866d7c6a1a6e
83572 F20101124_AAALBK rybak_m_Page_68.jpg
717029f0ff2a683032236e5e43c2bc1f
52af0047ecef17cd26dcc114d37bba0e1b62f7cd
833796 F20101124_AAAKUN rybak_m_Page_26.jp2
ef295f3e5996ca86d35b6adefac2eba4
b8b4e49181cad4450608988c5fe998ba7a64ba84
47537 F20101124_AAALGH rybak_m_Page_45.pro
034d5b6a3b24a3251cb65b837f1cb093
52ce5eb23ab65a084ddcee74a07b1eb13994eeb5
F20101124_AAAKZK rybak_m_Page_26.tif
100bdb79517d7341cbcb619cc3708c9f
ea69727e1dae6470ba7ab86777bcb64762b1a311
84388 F20101124_AAALBL rybak_m_Page_69.jpg
d0fa55716235e20eab3d5a02b2024696
dd988ffe21a04e95897d0509a2cbe32895ef9e23
23803 F20101124_AAAKUO rybak_m_Page_51.QC.jpg
2c195d6e2ab2b4e191b247b41d073dbc
228144734fa7debae05c41014195090f281b3b14
46588 F20101124_AAALGI rybak_m_Page_46.pro
4379173da652b3d77daff6ebbb2a9fbe
1825676d6519512919b344ff529a8216a47a25f9
F20101124_AAAKZL rybak_m_Page_27.tif
0cad84720c1fc05a8eb18bc8ee301469
c79f6d636b7bb50a8e47f2d82a032f46c0ffbe42
23110 F20101124_AAALLG rybak_m_Page_46.QC.jpg
4c2d9be4070107a677f87548a948d330
f222739e8476be75906d94653b0a0174dfee9745
82138 F20101124_AAALBM rybak_m_Page_70.jpg
a0dd4b386d47849eca56746407f5ec0c
ffb6921855b2636bc3dd40ec7c00699bab135db3
114531 F20101124_AAAKUP rybak_m_Page_50.jp2
b87222040a7bca29464cddc9f03d27c8
48dacdcf71fe52b4081bfec599235ad64432f9cb
50685 F20101124_AAALGJ rybak_m_Page_49.pro
39ee4aef29882ed7b16c488bb5ba6537
18017bcb76a99e2264a27a4ad98c024fe965baef
44238 F20101124_AAAKZM rybak_m_Page_42.pro
41366eac414f7895a0e70b1b4ffb08b5
f63d1ce3df31b44d9c686a077e5518beb902d31b
6842 F20101124_AAALLH rybak_m_Page_47thm.jpg
7429e098c76094d9e8a4778f1ce55328
13192d54be91f237a4e980cd3f21e0c0ca20186f
51687 F20101124_AAALGK rybak_m_Page_50.pro
b96de55f8ed2d8272538492c2f275174
7171822ab51e5cffb4d5ac4966641466cea00f22
69624 F20101124_AAAKZN rybak_m_Page_28.jpg
b3c458417c4c237e099aef0fd4b55cc3
fb02d5e197d344be3ad9b486b280b786cc35d5cc
31521 F20101124_AAALBN rybak_m_Page_71.jpg
014bd56938417f5f79dc08cbe2815ebd
786766352b6e9d77d138e6ddb39dbed0ee4d4657
6955 F20101124_AAALLI rybak_m_Page_48thm.jpg
86bd73ad2e3080996b03ce3ddb7453b9
a404045d0acfff8c10354226b2035ede5f3f04e3
44277 F20101124_AAAKUQ rybak_m_Page_24.jpg
c41be9f63f7e8ecec0f1c41829b9fdf5
f6cb46495e8ee9151b24d942f8107bbd3328b4e3
49956 F20101124_AAALGL rybak_m_Page_51.pro
51c8446be7b5817a5fbec2afee93785c
e76d696ef36c5aeff47608732f82db95c2af62f5
109071 F20101124_AAAKZO UFE0011522_00001.xml FULL
55e80559b96c59b6253e269c6b9bccda
ecf7a3b25c3155ba680e7a2f044af4830a610dc4
60108 F20101124_AAALBO rybak_m_Page_72.jpg
38fe08332f9e0545ee926a1204568f45
d4294b50720ea9d289378906e5f1b6ddf139783a
26255 F20101124_AAALLJ rybak_m_Page_49.QC.jpg
9e9dceb40a69a6cd6f9d618df2b7e664
4c64f24546f3fa9469e36420a3f79bf27e4cad31
12880 F20101124_AAAKUR rybak_m_Page_41.QC.jpg
2eb2a472c7eafa73f7f57639df4ae3e3
5c756c28b5364681a926d4383222a727362d6204
39319 F20101124_AAALGM rybak_m_Page_52.pro
b0979b247f120373e001d76fcdb0f7e0
e97bc82d5c565ea364e465048f2eeb9afdbf5ef3
26459 F20101124_AAALBP rybak_m_Page_01.jp2
cccc767fdc867c36b6287164c1bcbf18
6118eb8756a649c491ccc309a998acd856fcfad1
25003 F20101124_AAALLK rybak_m_Page_50.QC.jpg
e50aa33739e6fadf8d2ea6e70a594ffe
312dc18ee8def3dba51429e8b144f3bc43a56a4b
51084 F20101124_AAAKUS rybak_m_Page_48.pro
07387673d86dc6284ba9f3940501aeea
84ac5f7f92e3241a2efa2a95c57b922a19816aa2
4490 F20101124_AAALGN rybak_m_Page_53.pro
c18e81637b5f265a9187d39efa0a7349
ddaa48cdc49f3611165c52132a0a89d9560198e1
6172 F20101124_AAALBQ rybak_m_Page_02.jp2
52270901c94a68ae9bb541ce8c8c2c4b
2033e94903d8343d83f8972335afd748972308ad
6629 F20101124_AAALLL rybak_m_Page_51thm.jpg
b72fd0ad15cfbae4ae9f8db5a79900ed
0a4158c45366186519d4dc6c5f164a675da41b73
104609 F20101124_AAAKUT rybak_m_Page_22.jp2
745a39e94c9b1cb3faa579e9691a5e23
da391ae10bf5d96d5bc9fd61b4abfd30db2afae4
9626 F20101124_AAALGO rybak_m_Page_54.pro
79412b70f73e4c22e13932baa4cd36fd
9a8686b17a3988c8874a642371109a01cb58ef19
23303 F20101124_AAAKZR rybak_m_Page_01.jpg
66830e3114786ee3b9fc0e51d72f58bd
f44578d5ab85a4fad3cb76d24196d5dae4c37961
5193 F20101124_AAALBR rybak_m_Page_03.jp2
4f3ee1385eed76e8415099637efca218
b04ad1208d87e1864b64fd76ca14fd18015995ff
19970 F20101124_AAALLM rybak_m_Page_52.QC.jpg
dbf80d548343a82368f26d21bfc93025
ed0bf48fa60b22d344d3481a6e6bb7f4029ea01c
F20101124_AAAKUU rybak_m_Page_23.tif
3967ead34aaf2815d57a92bf98663d74
f82bd2da29c7c02309a2ebb73633d59e7ad016dd
12899 F20101124_AAALGP rybak_m_Page_56.pro
2b4fe896e3dc77b7c1d2eac2f82b40d3
075cfee3317b2a05bb3f18e00d67f7a5304d2b31
10571 F20101124_AAAKZS rybak_m_Page_02.jpg
8ad0802340b6e8b5ba574040a023e213
6d51943203759973bcbef60fac1da7b8a2f178be
1051980 F20101124_AAALBS rybak_m_Page_05.jp2
a770a0741b82829fed86637e2a99b2dd
71c2e6bfa11f81bf03051437cc9045cc8d40e44f
5480 F20101124_AAALLN rybak_m_Page_52thm.jpg
d8f0057586e461b0c0be05df71cdf210
68f659b4f5c85421ace058344261e1a43fa9db6f
19958 F20101124_AAAKUV rybak_m_Page_20.QC.jpg
645772559421fa8a7790c7b81d475131
a39c90bd339c09d57e0f11e5dbeee1aa62054ef5
14688 F20101124_AAALGQ rybak_m_Page_57.pro
a8142ffc075673863a82d8ec2684adaa
e9c28ca11148d7f080e2b8639c6814c657dfc027
10059 F20101124_AAAKZT rybak_m_Page_03.jpg
15d32cb84ab70b89495f9649d80ac4e5
8a606160b16b313b27d7b229a6a2f9da14def7c3
379292 F20101124_AAALBT rybak_m_Page_06.jp2
2ad7b0091000ebbdb90338a577f84f9a
ac8ed242ceb640b12147561a2f6e471f252f363f
8849 F20101124_AAALLO rybak_m_Page_53.QC.jpg
6b07703b840e8dcf9a84f4a34214e7a7
dfcb5384b993688dba528daac78a34a2ae315248
F20101124_AAAKUW rybak_m_Page_11.tif
24949f0e488e02b03abe3a3eb50ee910
8299304d4ae969ec336013095debafdd7ab307e5
66152 F20101124_AAALGR rybak_m_Page_58.pro
3a565e8e6fba650f23e08d15d1436b08
cc115b68c88b815cfe8f2ca0d948d841ae3bfbc5
61364 F20101124_AAAKZU rybak_m_Page_04.jpg
373797e00e2150f9ce0e1c8fa2e86c8d
c2579c550f3123a89c9e525866a90cc0ba402e8c
1051975 F20101124_AAALBU rybak_m_Page_07.jp2
40741750c74b199c0c0902f8c5c3fac3
db030943ccb6c6d3c9c10f21dd73e09ccf5edc66
3174 F20101124_AAALLP rybak_m_Page_53thm.jpg
34f829bcfbb823e248444df6502014b5
0123c05edb198d37e12a0ca09187417bdea72a14
F20101124_AAAKUX rybak_m_Page_10.tif
d1c5263111b2a8409395fcb34bc54fd0
f686cdfb700f21258cf881426af78d3104dae19f
63247 F20101124_AAALGS rybak_m_Page_59.pro
15f9c5586efdea67e4a39459c9d28d6a
fa7c968df37ba26fa958ce5f6a0fd097979f87cd
1051966 F20101124_AAALBV rybak_m_Page_08.jp2
0783adbab748672e18b51ff5e30f3849
020f020850aa432981c55446c64e2f11f5ab5b0c
12862 F20101124_AAALLQ rybak_m_Page_55.QC.jpg
bc0917f7ac0249ed46a388dcd453a387
85c747ba4dcc00ae7b9afe4cb75a9615f02b6a30
9546 F20101124_AAAKUY rybak_m_Page_26.QC.jpg
e18f05cd05ba6810fd23356eb5f62a74
96185845f5793bca1d9aa62c92961bf0bfccd5cc
48613 F20101124_AAALGT rybak_m_Page_60.pro
51332c35df65b7e353808682eacdf535
8b0ceecd08a3ce79395b2069e932fbe4f79dd4f1
62470 F20101124_AAAKZV rybak_m_Page_05.jpg
9236e7495c1614df755234382f7ffb54
e765e7f79fda6fa9e8aac919abae92fe11550187
97240 F20101124_AAALBW rybak_m_Page_12.jp2
00d01e8a6f669faf5377422ee37c7a23
24d109f389e1f17b82c5f0c454095d0a38ef2c61
14542 F20101124_AAALLR rybak_m_Page_56.QC.jpg
a1ef27c932f798427bded5178f9f2f33
883eb885d044abbc9fd3381c42194dbb4fa3a408
774 F20101124_AAAKUZ rybak_m_Page_41.txt
3d2f570e6b4b6b83ab9d86ecf2fc476b
df4fb270b5c48dcbe84ca19e77fb3dd6c6941504
43527 F20101124_AAALGU rybak_m_Page_61.pro
339e65bc80fd426a45e961aafc9f8e66
4288e11c5e9c7c7b3b87acf6f02606c6709f6d53
21228 F20101124_AAAKZW rybak_m_Page_06.jpg
4db689ff80fd553c382571c454eb4f22
0a4e4dc53a254b085f85ac7748a8ccd9262b8f8c
101954 F20101124_AAALBX rybak_m_Page_13.jp2
b56299fae56e7e63be8cb62d1eaaa7b9
eff9d54e0dafdec07960eac9b0d3790ffc924fb3
11233 F20101124_AAALLS rybak_m_Page_57.QC.jpg
46b5443b14695e21b7c128b7ff3aaefc
89841cd0d7639753a7d88ba036e8a1a15278bc20
46382 F20101124_AAALGV rybak_m_Page_63.pro
0ecb2ca67b3854cfa4da5e9c50e6ba18
69d325a30ce5c65903083c0c3ebd93a0fe1175eb
52883 F20101124_AAAKZX rybak_m_Page_07.jpg
87cfb77a877d706b0924d07ff099792f
d4d695b3ae435a50c9a60159ac9ebc63a3f01c93
96648 F20101124_AAALBY rybak_m_Page_14.jp2
eb7cf132b4dbf4bf80a1cbf68f87630f
a0f029929ad4005b4c2011acee960549ad14b8e6
3509 F20101124_AAALLT rybak_m_Page_57thm.jpg
27108b550ebd0ee0c6c38c4dbc11d8c8
3ea9cfe15f69e34610d1aa6897317db016b316ea
22327 F20101124_AAALGW rybak_m_Page_64.pro
de542b89adaa18a8a813da29a5586ea8
b9d8fa307e86ae7b7912abc94ea2492d7154301c
89388 F20101124_AAAKXA rybak_m_Page_10.jp2
aab74a86456334b999b748ed65cacd0f
5713c858428689abbd18eedd060cc70b466ad700
78803 F20101124_AAAKZY rybak_m_Page_08.jpg
c9b9a1320fe1dcc479e0331c7ed6f6c5
7e44ab028b4cfa492e8a859e5ca0cf5253f49f44
101538 F20101124_AAALBZ rybak_m_Page_15.jp2
f7e93cc9db96f0ca572cc38bd5841e8c
d98dead037bf43c9a2365dae4160ffa6a2d7f2a3
19344 F20101124_AAALLU rybak_m_Page_58.QC.jpg
91ad096debe55ea861e77355b5800396
8f991e1a026d6008c4287a2e549f46ebc0103d71
66335 F20101124_AAALGX rybak_m_Page_66.pro
a9fa2997c948bf632e41387b69165bf8
9261afab18ba07572d2e32e719a7fcc1b9fb4646
1720 F20101124_AAAKXB rybak_m_Page_44.txt
7063e78e812494628f1b8095c0dc6917
cdbb81df7acbb2f49c8083e90b0cb2d52232a6de
44268 F20101124_AAAKZZ rybak_m_Page_09.jpg
489fcba12a27c4c29edaf77204fb15ce
1660ad84e8401fa343cd8f6aa8042952b46f4004
4589 F20101124_AAALLV rybak_m_Page_58thm.jpg
c92aaaf6bde1aa3bbacae1e872a0fa82
660ad2064ec7d8103908b4cf1438eb76760eb0f4
63566 F20101124_AAALGY rybak_m_Page_67.pro
3cf5c5f80a748138eeecffa6a21a1caa
5b8627b182ff5dd8f979a5a30d978cd871d1b7f2
72491 F20101124_AAAKXC rybak_m_Page_19.jpg
e483aa3345676a942681a3b0a765c591
d12f5cf8bef08738fc7d85e3441f8794358dd14c
21831 F20101124_AAALLW rybak_m_Page_59.QC.jpg
4e6803ec2d439fb539bed3a9b2682257
eef86e4b33b331971261cb1b101ccf898c00cc0b
F20101124_AAALEA rybak_m_Page_28.tif
87ed4e8ee7acc3b109378189abae035e
839ffb2a32b75a21233f7b9e8aef86f991ad1783
59896 F20101124_AAALGZ rybak_m_Page_68.pro
cbe6abfda938f8545f591c998a64af60
9ae6444937f75c7d99e00a010811caf5bb6afe70
8568 F20101124_AAAKXD rybak_m_Page_40.QC.jpg
62bd81cae562000b94df8b25797f855e
f315322a670250cbd129a197a5fcf68cf1bd0dd5
5248 F20101124_AAALLX rybak_m_Page_59thm.jpg
0cf5fde1e8acddbb7834ba26e3f208e4
48ec3b74871787aa846b958cd7c29fa21de12220
F20101124_AAALEB rybak_m_Page_30.tif
2b09082772d82da75810408ab9fe8a87
2896858b41411b11ceb8310d8964286da4f1a98f
1051840 F20101124_AAAKXE rybak_m_Page_33.jp2
352281f2068a903eaa83a6bfaffb696e
5d83ec2e8218424ce703c365539998cae34fd214
23894 F20101124_AAALLY rybak_m_Page_62.QC.jpg
a3e348c2128ff82c9aa68c3460f9a52c
248174ba8e7aee96b5ccba8be5ea2cfdff84f8ea
2554 F20101124_AAALJA rybak_m_Page_69.txt
96f139bef63d4043a775a23f7cc23b77
57d0f17bf78cbb37590ebb94973e38719e3cd595
F20101124_AAALEC rybak_m_Page_31.tif
a4a78c90a798adbbc42364ff0f5a5bb6
b8b783d50ddd5b485ff3a5a1a2b453b9f8e86ffa
1051978 F20101124_AAAKXF rybak_m_Page_18.jp2
d529360d92f5fec356d1bd56c2268ffd
37849f58548730dd06ee936da7132b97ac3cf274
6723 F20101124_AAALLZ rybak_m_Page_62thm.jpg
ff79961eb7b3545b1e4dcd60f4589da7
dc5dae001dd02da52f963fa4ad14e40bdfd48f6d
1587 F20101124_AAALJB rybak_m_Page_72.txt
038a95327fead9431b67d8d02c4300d5
896825037079543ea3aed4376c5d96d6212c52a6
F20101124_AAALED rybak_m_Page_32.tif
0650f269b71165ba9377b40d3b62c3ad
32010a148b21da71bc86580c7268902518ef41ce
F20101124_AAAKXG rybak_m_Page_65.tif
9238312f4bbedcb5f0a31235d567ff13
d248c546b9efbd5ee5ae35c27e4d3221d02fcbdc
2406 F20101124_AAALJC rybak_m_Page_01thm.jpg
1c0d6ef54ae59511e5cc3a13170ef9cc
0ed94b60eddcb815ae0f2cfd35a6ccf0fcd22df4
F20101124_AAALEE rybak_m_Page_34.tif
0f87a69d1e6b1016741ea2f7736b04c0
3cb5e688084f162e6fba88e27f9729bed31f6b7b
13094 F20101124_AAAKXH rybak_m_Page_54.QC.jpg
99229295c77104f3af2af5bbe62df0d9
023d8de68dbb133bc34f31d9b5eb64e74e9ba0c2
1036414 F20101124_AAALJD rybak_m.pdf
7b819153ba41abbf3ea670525e9cf238
1342678084bda6d052704d621790eadbb9890313
F20101124_AAALEF rybak_m_Page_36.tif
9025f4d4b07de95c08e5af4b098aa8d2
4b9a082680495afb6b86873d88e835af1e694640
37613 F20101124_AAAKXI rybak_m_Page_64.jpg
b2d5bc9c29d1a92260ff9b9823656f23
e36e912e2ac5fba9954fab9602628d5934925bd0
F20101124_AAALEG rybak_m_Page_37.tif
67c13d112138abc759b2a103264e9bdb
1542cde6c9c70673859e5c148bed88fbde577b05
23946 F20101124_AAAKXJ rybak_m_Page_29.QC.jpg
f13be376ef1b2474369a95e761e4cd94
42b2177c3ea0dc94f869f73b37af5524efa3d1d7
3402 F20101124_AAALJE rybak_m_Page_02.QC.jpg
0de11e6288afd8c856d1e78457271fe6
b4061c095899f8a742c5c03332215fe5c2d60168
F20101124_AAALEH rybak_m_Page_39.tif
274baa663418e931f1c0321ec7e4ed2d
f8f832271cb6eb2083580ae0b2aa6a71ffcd1afe
69891 F20101124_AAAKXK rybak_m_Page_22.jpg
26908585597af2ced2ec3a98c2274234
3211037766eab1385b43c3d56ef4426b47d7709b
1397 F20101124_AAALJF rybak_m_Page_02thm.jpg
7d13aeb7eba7176be4f67060e7b64bf5
c84a40fdebf59559838614bd29f44092f89b6225
F20101124_AAALEI rybak_m_Page_40.tif
ba2ee91276d34e00402b98d11944743d
4a0349db9755085927363b32da41e188e33a6c98
F20101124_AAAKXL rybak_m_Page_38.tif
4e28f45ce0bc3df202bdabee3edd188b
8a8ade5898d6acbc157cc479399fb59732510b4b
3075 F20101124_AAALJG rybak_m_Page_03.QC.jpg
ec68c475f08e43eb7d2aecd01d9e9766
b5b96f6f221de8d1e2d9ff2f3f61433663195561
89306 F20101124_AAAKXM rybak_m_Page_04.jp2
9ae90ed336f6ff3f4a0c9417552a82da
88f1cebc620489f456733cccd530f5ccc19729a6
F20101124_AAALEJ rybak_m_Page_41.tif
1abe947cea1c6b384f92b8430c2cf431
fd05aa5a0910814298e5e7ddea2963f3f93a947e
19999 F20101124_AAALJH rybak_m_Page_04.QC.jpg
429c2bfc188c48fa0ad01b6163c6c203
1f034113ced80f3e78b3947a03d627ad35344d6c
76501 F20101124_AAAKXN rybak_m_Page_50.jpg
06e366047a424818839a89b81575fd66
ba8fe7359d750ed578521c39fa0f8fa31c7e2494
F20101124_AAALEK rybak_m_Page_43.tif
24b5bd1ce84dc1001709452b41a3539e
64b0031a860e36f1c3cdafec09c8a36195d07725
18441 F20101124_AAALJI rybak_m_Page_05.QC.jpg
33745ed5f492689e7d98843443973258
100fe84060d8455b71d26f35eeb3823d5e4c6db9
2819 F20101124_AAAKXO rybak_m_Page_40thm.jpg
025b12abe51c352eca4aa0220d902833
08052858732a727c3c43fe963c0210237b9bc626
F20101124_AAALEL rybak_m_Page_44.tif
4d5651c34706300778780ba05ba1f4ae
7eaed15915d3c6e97426dd7d89bac462882527b5
4745 F20101124_AAALJJ rybak_m_Page_05thm.jpg
3a28378a3648b70f69e4c75843186014
dde07864d1a973aa98ca36e54f1d8596da5cc4f5
5859 F20101124_AAAKXP rybak_m_Page_34thm.jpg
fe73cc8c9a24bf983594a4757a045b6a
78e88170039cebf79f3f7c96f8f3a699012ffca5
F20101124_AAALEM rybak_m_Page_47.tif
65c0387539e9124ebd6166acfd8d373b
d5360d6f5ec51b8285f37a1250bb7c6252ef5245
F20101124_AAALJK rybak_m_Page_06.QC.jpg
97c74fbcdc5f08b688d9680e5629891b
4568a76861c7be7eab824e87410ec4ee842fb3cc
40402 F20101124_AAAKXQ rybak_m_Page_10.pro
7399631fc0a377d1e9a8f0c7997d3463
e38be3b4dd08742784915d453f3503c0f0456807
F20101124_AAALEN rybak_m_Page_48.tif
252faf77688178f711caa69cfaa31621
e4fb8556b95a2687b4cf9124ca857275317e5964
21966 F20101124_AAALJL rybak_m_Page_08.QC.jpg
f781bea90e5f948c7e1e5827701c1dc0
5e89f8340935a8b3c4f64f9a62c44bd21acb3fa0
1051943 F20101124_AAAKXR rybak_m_Page_49.jp2
4a96eb9148d1e7f3d1b7d47028b79137
bf6c82bd94e82c17ec365e3b358de1c8f8d17c1b
F20101124_AAALEO rybak_m_Page_51.tif
a0f622dd0ffcc01b677a0cd9a9ddef9a
330f13bbf2f2fe9cad51f4bdc32c92f6e5c3df80
19642 F20101124_AAALJM rybak_m_Page_10.QC.jpg
5bfc7a33621b5b0054bd92c2e1e71ffe
9b05f5f42a4283179127a6fcbd623d7629ad6a96
F20101124_AAAKXS rybak_m_Page_63.tif
3eceadde78c2e6a14bec2f851907f828
a0b2260563b59fea3ee23e09feecab07861633c8
F20101124_AAALEP rybak_m_Page_53.tif
dcbf8eba7281bff614e28a9436028f34
6b1b68439f571870b34b05c2fcfed3f1c4f8f77e
5475 F20101124_AAALJN rybak_m_Page_10thm.jpg
1d747af0b9ab4cae173a1263696ff086
766affe17767d0fdcaef32c27467e39ce291f341
F20101124_AAALEQ rybak_m_Page_54.tif
d8dc892c816ca50e5ef3fdfa4b0ec0d6
6167f6d7334ce5983b802cd39290cf24f4ce761d
12613 F20101124_AAALJO rybak_m_Page_11.QC.jpg
2540cba5712e347635aa0f5b2e25187f
1bb1f3616a6be220e50f262dadc1c599eec594f1
7164 F20101124_AAAKXT rybak_m_Page_69thm.jpg
443e7b592c98f019c58d0602e3c44ab8
cbc573008bf63b4d778c0d9456bdc99b971c1e1d
F20101124_AAALER rybak_m_Page_55.tif
d11131d771afa7afd6f89e4b4788350c
334948fd322b7a8fae4f2f8585cc05956acb0b0b
3877 F20101124_AAALJP rybak_m_Page_11thm.jpg
81e0ad8b0f01a1bb27860ca2166ac914
428492bc5f9bff90678dfca356e8fe6edb097274
12437 F20101124_AAAKXU rybak_m_Page_09.QC.jpg
1a756df570458d99d8410cd1af667ce5
05f399def9ef84bef1268f10838744255f1b9f0e
F20101124_AAALES rybak_m_Page_57.tif
8f8e8957945d890be44bfe73ad4d726b
4443d76a31485e019e944c593dbfe685098e26ab
21179 F20101124_AAALJQ rybak_m_Page_12.QC.jpg
570b6085feef894e311bc1b56fe717b9
950a2bd01c83cc8bb6a14a997c4aa2c2c0978b15
2069 F20101124_AAAKXV rybak_m_Page_60.txt
777a5bf404dc98df7ecb6d0beff62792
b0ef3da5fb6e1aced22531de4cecb90f4f0e1609
8423998 F20101124_AAALET rybak_m_Page_58.tif
afbf2217a1304161538f138d34060702
0714274128e91c1b61679556d443dabe61666e5d
22164 F20101124_AAALJR rybak_m_Page_13.QC.jpg
a1bfc476044b28ba268a7fe20be155a9
62c059f15a99fc3a8d40cc541050ec3df9441fee
1103 F20101124_AAAKXW rybak_m_Page_09.txt
f114fd38cc2801bbc8509340e1229666
e027513b14c2dca93925964da3a3f7ed26cd0aa5
108745 F20101124_AAAKSZ rybak_m_Page_51.jp2
dc036ae36b4aa22efdcc1d9f51824d68
9e4a08c444fbff76517b9b2f4ad07f5821fafb5d
F20101124_AAALEU rybak_m_Page_59.tif
64f20b0b25a12dbd49def855acc5f969
59585712e632cb10ec9496996245d2350ba74130
6654 F20101124_AAALJS rybak_m_Page_13thm.jpg
828c0bfeba5beb2200a31837d7bf31dd
72e32ddc5d0ad09fb40e77dc1865f776c1d65602
47265 F20101124_AAAKXX rybak_m_Page_47.pro
5c1c0225703501ebf11f2b55cb52d54b
9d3bbddabb2ac7bcb43055461f1f7ca142fa8dcc
F20101124_AAALEV rybak_m_Page_60.tif
3e735a80a9001f5dbfaa430663fe8d6b
ce01dbe037013aa35f243f54bb3bbd7960412720
22528 F20101124_AAALJT rybak_m_Page_15.QC.jpg
95c9a7fd8f31dfac0fe09d2dceedab49
78777af4219ce099cde0b8556fb83b3db4625de9
4117 F20101124_AAAKXY rybak_m_Page_55thm.jpg
06c17583595ad0575b4e9c8381584890
d206b8c7ab2adfdb19b8be0f11fdb2bdaab319fd
F20101124_AAALEW rybak_m_Page_62.tif
d068ffe78b571e5ce12ef0f1125a3486
96a59d37a182220943eddfff721dd489ad6ab98d
4154 F20101124_AAAKVA rybak_m_Page_31thm.jpg
fafa5ed89ab14bca2d51784565414547
0bffbc51195e3e5a99df89235aabab3d6a100953
6408 F20101124_AAALJU rybak_m_Page_15thm.jpg
90fdae8facef2f4ff887dfb0e165656e
3228cd7b7fda6d2d31421c08f4d9e06f1525f719
F20101124_AAAKXZ rybak_m_Page_46.tif
62d1c7c6f31296ecbbf5a82ffea81451
6bbf2a69acf2934862b7b510b47e014c8d9d9c82
F20101124_AAALEX rybak_m_Page_64.tif
ad7e458d78c70b2df7d055190880884f
9bea1af44e0c740b6444e80165093f2f9c143c41
8970 F20101124_AAAKVB rybak_m_Page_71.QC.jpg
8505bea8ca960616da9ac1edf6a9e665
106e0a52c11034992ad9a8a067b81979e1f3014b
6499 F20101124_AAALJV rybak_m_Page_16thm.jpg
cc28c32906a2641633f162aacf63e446
a7a4eb799b57f4b26921e8cfb5e05b6a1bb28241
F20101124_AAALEY rybak_m_Page_66.tif
18054e580148dfc0f766175a06e4d0ba
48a637dd3f482058bc30f20c5843fb1a501c6c12
22186 F20101124_AAAKVC rybak_m_Page_16.QC.jpg
8fe7506405ad5b997c024a99760972a9
764e0b3dcd4fb446df2beaedb9b80e410d03bfcb
23665 F20101124_AAALJW rybak_m_Page_17.QC.jpg
4d20f81c0400ca151196ee04c7d2ff6c
566262ef1deed25b0184216edcf51167d98c1c70
98904 F20101124_AAALCA rybak_m_Page_16.jp2
665c279af6955d0c653ca1a9c06580c1
c281ba0659fc563ee8729cd80a4fc67ceee59838
F20101124_AAALEZ rybak_m_Page_68.tif
225e408723bcf63edfff1b8365ab3586
770a05e75e3df9e4a0acfe636f7791a91ff2b309
99622 F20101124_AAAKVD rybak_m_Page_23.jp2
bce0881a0de305a5da3d4d6c8ca8001d
25be5ffa0a8c5014ef7caa9774f8d907b9398927
24948 F20101124_AAALJX rybak_m_Page_18.QC.jpg
279d0f9d17d05b25756f30a2fbcdc19b
99bf0ae1f594c556758bf6ecfcf1f0823290c8c3
109391 F20101124_AAALCB rybak_m_Page_17.jp2
04f7eaa73fb3f7237d9cbcf01edc0fcd
cf0e7ce8c58c4aa1bc0ffc8c491577fb483d4f31
5705 F20101124_AAAKVE rybak_m_Page_21thm.jpg
dd120d0a88232a42d0d80cc63d22a47c
6bfb64a5890de5a0ed8b9f9a979fc6b9aba64522
24189 F20101124_AAALJY rybak_m_Page_19.QC.jpg
ad11d9447ff13c2105f64d0db55b9071
5d9da66f97231accfc7b21d4ef2c32e57c87c89c
62648 F20101124_AAALHA rybak_m_Page_69.pro
2b1819fc56fcc2793c9e0f8358d3604a
5f30ddd9988101f1572cdecd8d7036978a166e81
110120 F20101124_AAALCC rybak_m_Page_19.jp2
8ddd0c98b7808c33b6263c49f2ebbd1d
896c4d7072f4c308589461e4ba60976166167ed6
F20101124_AAAKVF rybak_m_Page_49.tif
26f751f4a234bef8281f560d5a425027
fee9dcc7ddccbbeebab64ebacca573e430b40aba
6829 F20101124_AAALJZ rybak_m_Page_19thm.jpg
a92e3ec1374ab2bb2eba2d7c6feae4d2
30bf3d4d8874c945104706a6e46f1519caf9043a
59253 F20101124_AAALHB rybak_m_Page_70.pro
42ffa06c82cb3c5de013812ac0b6f722
ce2747d998dcd7645a579fd54d37228294f2239e
90596 F20101124_AAALCD rybak_m_Page_20.jp2
833aa6e0ac8a0206fc0a676f514c60da
7de01fa08179c7e666fb595bfce291888f478111
1917 F20101124_AAAKVG rybak_m_Page_15.txt
c95b962248d636aa95c3cf352f2c8549
740348a2bf6903e2ab7db89d933dfbb159c1276e
87343 F20101124_AAALCE rybak_m_Page_21.jp2
688f27acef63b5ed0654416bf31096ea
4633f58ba59921dbce972b1338221d27d0f9191d
38453 F20101124_AAAKVH rybak_m_Page_11.jpg
095122ff0b0b03065324e2905982596a
00250dab633f9674769f94cf334d9d40541f1905
21701 F20101124_AAALMA rybak_m_Page_63.QC.jpg
56445994a2471d6822dbb263b4ce7187
9f28716d7076bdd001280e59c1d7641579223c6b
474 F20101124_AAALHC rybak_m_Page_01.txt
9bacb4885953f25c6840d5fa4d2f0398
b5159f7b8b1247dbd37512c585360c57a74bc11e
50426 F20101124_AAALCF rybak_m_Page_25.jp2
f36964a3e1af2c0cf1b380fb5dbaef66
ebef04b40b3be098ef73f6b111dc0ab44f2812cd
6014 F20101124_AAAKVI rybak_m_Page_39thm.jpg
0202347d0c931dee6f10182fb56d3e47
50e43f8906582f0b744a81a4f125534d9a475528
6553 F20101124_AAALMB rybak_m_Page_63thm.jpg
ac3d7974cd31bb33293af8e360824ecf
72f9be2a092aa8c5ab2c88340b5a536c3ef3b327
121 F20101124_AAALHD rybak_m_Page_02.txt
7b5e151698c315ded3c117c15a2c04cc
654770ef4bf69e9a46f74b0455d454a27dad4788
104827 F20101124_AAALCG rybak_m_Page_28.jp2
641e08e313c6173e9ca02a0bb2cdb2ca
68d594cc50751daebe5067151da12c602b0d3592
47758 F20101124_AAAKVJ rybak_m_Page_22.pro
9ea3be720f5b13d6cac52fadb3588c61
687980a2ef749509ef4cd4a0b27c25bed10814ed
23867 F20101124_AAALMC rybak_m_Page_65.QC.jpg
291139a9c6a32309a86c7d01ff06d0db
4d9f7ebeec99eb273eb4d87ed3ee9506bb3fb1d5
80 F20101124_AAALHE rybak_m_Page_03.txt
9abc9b8360c232e8cd49e7cfcb9c0339
d97fa9884f7425b0ab95bb7f87c263306986f17e
107880 F20101124_AAALCH rybak_m_Page_29.jp2
927257d65c2e303ed39ef94d209c669f
070887e7d21e69d97286ddee73cfd6e93ebce2d3
38743 F20101124_AAAKVK rybak_m_Page_21.pro
e672078450569d6100b0993aa903b188
821e11c99b8f68a72f929b84904d0fdaa5e82305
6540 F20101124_AAALMD rybak_m_Page_65thm.jpg
572a9d40c8852e02c7f827ea18820c85
36ab87b85fb8d77d9fbe180caa46f8a8db423f14
47685 F20101124_AAALCI rybak_m_Page_30.jp2
1f70404e5d741d1bec6067420fa3aef2
f52c509d900a320d4cc2aeaf90cf8a8e8f686b6b
956 F20101124_AAAKVL rybak_m_Page_25.txt
8011cb5d1411b06a0de0defcc427038f
7deb682d4f4ae8eb3b14efee69bfcb1ddff0955f
2960 F20101124_AAALHF rybak_m_Page_05.txt
401ae954ffc576bf542b9589e81a7d27
df5ced2395886cc7bf16ae2d2448e8316796c90c
7320 F20101124_AAALME rybak_m_Page_66thm.jpg
10dcfaee16cb1146161668391b4367ed
a26d88cb2d6d2eedc5b89ff8c7255492383ed3a7
48942 F20101124_AAALCJ rybak_m_Page_32.jp2
2b9bdf5aa560462befb69653cf7778af
f9eabdae616865aabf405b6bd7d475f5db74ffa1
1909 F20101124_AAAKVM rybak_m_Page_06thm.jpg
2d08c2deb574a6bddb4575b0ed216306
4f1673011dbd84d6834218e26cc8d7c763390e0a
751 F20101124_AAALHG rybak_m_Page_06.txt
520a10a1d67ae8928a3ee4d8cb8c007c
a8c92ccb92d7a3ca25eea976c9d3d0b2e3c1e36a
25913 F20101124_AAALMF rybak_m_Page_67.QC.jpg
27ff482b3cba9881ae5f94b28f2c6adb
ad04734d295f3c000d3b1cd8e88d4afba69b94a6
91872 F20101124_AAALCK rybak_m_Page_34.jp2
229dd158c4c58e4b68e8bb8e4d39a7ef
b709c217ae6beebd2a3169b4abe4b248bf590d16
50301 F20101124_AAAKVN rybak_m_Page_62.pro
aff7aac8b8720ab35aad198595dbdb40
7b9f0f9c3903acb5ed41302938671f027e31f9e8
1465 F20101124_AAALHH rybak_m_Page_07.txt
833de086484828f73c498023bb39de00
a2fe3b000fd3ee799effc41e876af0d8673f452b
25170 F20101124_AAALMG rybak_m_Page_68.QC.jpg
25799bece219e06cfc22dced42edd203
8d086176e68b616ad3bb3b44b9f1f018b3fd06e5
115094 F20101124_AAALCL rybak_m_Page_36.jp2
526615f5b2620791d869236ee6f28513
c55ce20c7c57477e059e4bb60eee1f84cab34a16
40577 F20101124_AAAKVO rybak_m_Page_04.pro
2d61d5d9218d05f95ba4001823bea2e1
e7daa5c75fc9635fb8565446c4ddfe1399670464
2538 F20101124_AAALHI rybak_m_Page_08.txt
1408b8ab7019dd60bccc7c0a9859c224
758a63a44b4443ddc2c235f72b3e2903153d75f9
109764 F20101124_AAALCM rybak_m_Page_38.jp2
62259a22fe5f62fd2fed738f99fe5371
cb0a434eb58f0cc1a65f133970013f20c5dec800
59417 F20101124_AAAKVP rybak_m_Page_52.jpg
9e051e3e784b64680242e3e1f14a47da
cc5e114f10bd83c9ad611fc8e0676be63d9200e6
1764 F20101124_AAALHJ rybak_m_Page_10.txt
36c26c06a24426f6d774cef942538e43
f787fe8eebebb43cffa107ac4a0a5700c61d546a
6854 F20101124_AAALMH rybak_m_Page_68thm.jpg
654eb31d903f2b1939a70986f8f432b0
6bde4dcd1906ffbf3ddc1937d5fc66ce3db2d934
1051982 F20101124_AAALCN rybak_m_Page_39.jp2
3b736530b93f0ede541e24d60c4a2fb3
545bd575e97a1e5d4be830c12613aeed6955fdb1
F20101124_AAAKVQ rybak_m_Page_72.tif
8c0ec17514cfd3092214ab2d5809f631
089b261e9d70d7fb75bb7e6ea1018daf8bb8e5d5
918 F20101124_AAALHK rybak_m_Page_11.txt
dd6b00b3a28ce68e83b6116537d4f8c7
26e612db04f61a29f0e0ce10eec8b6520319a04d
25672 F20101124_AAALMI rybak_m_Page_69.QC.jpg
4c94abba93a834a2f5cf09cb9a41c92f
d10be6636c07769feda5565ab4174ab366dd293c
369473 F20101124_AAALCO rybak_m_Page_40.jp2
92e30e59b5fd0d8a267bf6e477163e16
3051ce1a8d74634d1040dd3d3a3d9f2927488c81
1742 F20101124_AAALHL rybak_m_Page_14.txt
06b29f37aa64bb50ca4ccc7b6cd3729c
19fe8538e613c912c306c30d31410bcddb6cc124
23664 F20101124_AAALMJ rybak_m_Page_70.QC.jpg
96bc0735facafad64b7f5265c29842e9
56c679601db03dab91a84a36c6ec4aac83054021
682959 F20101124_AAALCP rybak_m_Page_41.jp2
284c438bded8446441974b322478c8b9
cd9f904a44235e530c2aa2836e30384be5b5fed8
1839 F20101124_AAAKVR rybak_m_Page_63.txt
c9df59a45ae3360d09eaab8584f5870f
20bb518b918abba4f230b4e2c3bc0f9e38eb2587
1991 F20101124_AAALHM rybak_m_Page_17.txt
a87d6522e5d97a6216e6835419b136fc
5b075ccf7f986a235aa0e8b9a04a7aa13d8e3625
6554 F20101124_AAALMK rybak_m_Page_70thm.jpg
fc4d651bf1c7fe2ec76beb5cef7e3247
aed1ee847c34b868b65dd56925863ed89d53e06f
98891 F20101124_AAALCQ rybak_m_Page_42.jp2
f083d652fc86a850872b5420d3c18da1
bd63e1fad623da6d5810522fdd400096bff6c3f5
68256 F20101124_AAAKVS rybak_m_Page_23.jpg
79cc1d0b672ea13e974813a6fea2a43d
881adea3cc73d2b2f136cc598dab81b1b63a405c
1886 F20101124_AAALHN rybak_m_Page_18.txt
dd2e2034d1b2fdd66169567e5c0680af
83718be66ebe59a8657abbf469091bc27383e90f
2633 F20101124_AAALML rybak_m_Page_71thm.jpg
be19d0e7345141c7de62cf5c3c125c3e
0e1911bb308de23111ef1c872f03403cd903f1be
60755 F20101124_AAALCR rybak_m_Page_43.jp2
ca9935099fe8c819913486f189295aa7
f4090af0f827747f9ef5bb05ccd1554e7485694f
63618 F20101124_AAAKVT rybak_m_Page_24.jp2
0ac04946edc04b2c0fef1c7040283020
efc59e249b2742ff2f0cf2c5946fa01ea3d47be4
1981 F20101124_AAALHO rybak_m_Page_19.txt
ddf032e730d3391a38cada90ba95d4c9
2dfe1600d7fa5218cb940b9599924711adb76f31
19899 F20101124_AAALMM rybak_m_Page_72.QC.jpg
e7256764c53cf3bfc91af2d4b4446eea
93f9470410a736aea77e0d4ea9169629e9dd8616
89084 F20101124_AAALCS rybak_m_Page_44.jp2
f59a89933ac3a4dcb63e654374c51af1
266ac216de4cfb3b647006eada906d13f1dc8125
F20101124_AAAKVU rybak_m_Page_56.tif
c6e88f38079dd9bcf4cf105ce708fec1
622eaed64ea2617d9d2a120e945f27c0c554bca9
1644 F20101124_AAALHP rybak_m_Page_20.txt
d6a7aea20b9f0157495a15895be37306
cb189d0c57532b0bdb137a42fea5dba3d89a0d24
84569 F20101124_AAALMN UFE0011522_00001.mets
3d8fa47ca1a24dfbac8ff00d39cb54db
a7a3621edef48c01d912f8701828e63ef536bd8f
105141 F20101124_AAALCT rybak_m_Page_45.jp2
71bbd09b83ef8405111656d388cf94be
12d5da2bbacdadc996767a672eeb53da163dd1e8
50325 F20101124_AAAKVV rybak_m_Page_17.pro
4e280e40f49b9a822b056efdc49d370e
aef9a10982b4478b4887cb646f1a90f535fc4bb4
1684 F20101124_AAALHQ rybak_m_Page_21.txt
88ebddf16d4b9bfda972010d7ef5818b
ed591dba21c82dd75cb1281d6327bf8435581414
108449 F20101124_AAALCU rybak_m_Page_47.jp2
a7135549a233807bc22ba71c05c47ce2
c40ffb4c827be2ea8efd439d4e716786c0044e2b
F20101124_AAAKVW rybak_m_Page_33.tif
10ff75aebf7868027f077def83a4248e
ac5c308744b40fbf82c35b803e5bb4402b07add8
1888 F20101124_AAALHR rybak_m_Page_22.txt
79a49c6c0214f29952de8880f9c0d946
2174a143cd3c691ab2f7d224deb62f8d167d0229
112502 F20101124_AAALCV rybak_m_Page_48.jp2
6df99e418ad189e70ce919b900751aed
0d3036d54c3bc9e6c449726e9d123e984b3bf9c8
104940 F20101124_AAAKVX rybak_m_Page_46.jp2
9b046d71e43fbf9abe089b4ee88c5f44
48bd97cf8cf64d76d3a2f2248d189be82f4c02b2
1866 F20101124_AAALHS rybak_m_Page_23.txt
9e86a7c5f27965633e52093850949b4b
a0a1fab62c6c05e6e6296ae66a0d718906cfee82
87418 F20101124_AAALCW rybak_m_Page_52.jp2
00200127a2dca184965994ad7a393e4d
5865acba5dac06625bda1e0ad32b21d3e5edaebc
F20101124_AAAKTA rybak_m_Page_25.tif
f8c4b16e8dd6501b288d1aa82d4b585c
397558ffc4c9d802fa0804d5d758d5c55ed6a1a5
17682 F20101124_AAAKVY rybak_m_Page_33.QC.jpg
9c9a9481eb2871276d0965d34033a557
df8da61d9c13715b96b58793020e5667760e700f
1133 F20101124_AAALHT rybak_m_Page_24.txt
a476972b6bd6b21613df2c60f0fc18a0
d939c0e6cbe03c93fa83a5832ed1413614657d0c
688612 F20101124_AAALCX rybak_m_Page_53.jp2
cdb6475a1d4e353948f2f27ec8a3ce2c
1f2a0eaa9148a1aa07cf903ae623ddf96e58d623
770 F20101124_AAAKTB rybak_m_Page_71.txt
517bc127ea6095bdaa1ff9599f9d937a
51c011b8737222299c8a00d50107fc64cf859a34
1911 F20101124_AAAKVZ rybak_m_Page_28.txt
00ce31085abe58b76750599acec9e05f
dfe9ad73ae64b20023df0f33f827bd17e36b6a94
286 F20101124_AAALHU rybak_m_Page_26.txt
542f27d8d1757d4a0cc0777e0e2cd8b5
992e5d897a72fec4d1cb7dd7143fb929e7fa4ec5
860607 F20101124_AAALCY rybak_m_Page_54.jp2
68aff39809b9d957800652933cbf694b
8696c2836d98d85b6308a873929240a34e41c61f
12433 F20101124_AAAKTC rybak_m_Page_64.QC.jpg
779773c5c89595d3bfe911dc7ae0b979
8218797714e2b8bd608900fe079781483be58f70
1753 F20101124_AAALHV rybak_m_Page_27.txt
3fe800e7a8fa97e910f57896919da082
091454d310d9fc19383c8dd52823fc5b15f0bc47
600946 F20101124_AAALCZ rybak_m_Page_56.jp2
9e1649728de17ca20139b1fa539584dd
3a5957282c8e3e6120ab4205a3a9cd14283ab743
F20101124_AAAKTD rybak_m_Page_01.tif
e0bc817efa8db691be7ea349d0f2766b
fc003d9cd4268d86a5b4cb8548be075a71863a3e
2003 F20101124_AAALHW rybak_m_Page_29.txt
ca031f44f104692547da6b6ef862a618
30c74348183d03a9cf96ed8a22d3a9e206fc37f1
6567 F20101124_AAAKYA rybak_m_Page_29thm.jpg
9bb8c02d6839016b4528c1f91286af26
9bd21a7d8f4c5056b048916fd983476eb53cd7d1
61727 F20101124_AAALAA rybak_m_Page_10.jpg
f973ff3c06f76d68275c6eb6dda68b6b
f37ca5f5c6e7e8bb0f42e016f4fc63298b360f46
1922 F20101124_AAAKTE rybak_m_Page_37.txt
5b864d97bfce9af173c50b538237383c
0038203ede1cfde35faebd342f6bc20f18a51ecd
820 F20101124_AAALHX rybak_m_Page_30.txt
0dbd1ae230e48bb2033e690856534fbb
3ee0446612d31680b8409f2f0e81a1d019379779
1820 F20101124_AAAKYB rybak_m_Page_16.txt
095f29b0708bcbe4a7a0ba7697313b70
4211f1e017cbc2cff8a4c935be4dc6c7f34c80b0
68502 F20101124_AAALAB rybak_m_Page_13.jpg
ab28853d36423de2235f4d727779fd90
1abe38993d31e59745fd5c8381ac59ccb7e0c9c2
F20101124_AAAKTF rybak_m_Page_45.tif
b6f3f60a636e0aa70a83fdef11c6071c
0c8b99701bd7face15ffd8260e026cc803bc3c98
1335 F20101124_AAALHY rybak_m_Page_32.txt
5823d127f7760807c67846dfb1d595fe
8a3b7d848e5144193959fc1f4277147a34da750e
F20101124_AAAKYC rybak_m_Page_61.tif
48dd1b8af0c6d823826d5e7f4e1fc619
6d7cea9d74ee85bf141774ad2c279ff47f5eeb74
68472 F20101124_AAALAC rybak_m_Page_15.jpg
e832db25d9179b06631abed6494f6048
9a820e106e567bd8ab12fc6bcd5e9244232f2208
110281 F20101124_AAAKTG rybak_m_Page_35.jp2
b5f6012e504f855ebad64dd4ada71fa2
e60b7acdaf6e725c6513d901e930608ebae06be8
F20101124_AAALFA rybak_m_Page_69.tif
2ac46ad21a8661c284470b3f7c612189
b662b81330ec79ead21e1f7e9a361508b9e000a4
698 F20101124_AAALHZ rybak_m_Page_33.txt
0ffd65270f1d1cdcfcf519ddb2e10a12
c3b22084c67ab482bd765f9a34a25fc3c2a9ead3
38636 F20101124_AAAKYD rybak_m_Page_72.pro
88eb4b450d231509f459d4c9487d381f
85aac0be6782e915ef8dbc053a7811a5c12ce8e6
68026 F20101124_AAALAD rybak_m_Page_16.jpg
efab140c345cbc8ebd07880529fd00fc
f286ac4ff61caafc746e415feed199a1d9343055
1786 F20101124_AAAKTH rybak_m_Page_12.txt
d17e45b8a5d80da49923e32050afcc45
accd98b31c033151019aa41ee0d413f0c4a9876a
F20101124_AAALFB rybak_m_Page_70.tif
804b88497f5823a68625922f68a8d69c
ad502819336af67d95c5993e350cc27314728524
23517 F20101124_AAAKYE rybak_m_Page_37.QC.jpg
190c8727fd630a9a348b9b1a0d949e6f
9ba07e0fc4a13611c02513e7c0f0b66c2741b6d3
72000 F20101124_AAALAE rybak_m_Page_17.jpg
09accba2c722f73e733a2f9b142007d1
e28389cdec7763a4d9b88e80843a1a9fb6a16e72
5675 F20101124_AAALKA rybak_m_Page_20thm.jpg
72db81cf660e808b340f0c725abec97e
80bf0e6d15b434ddca1480a426b97fa2a67e9579
28326 F20101124_AAAKTI rybak_m_Page_24.pro
7f065ad9b337b31eafc8bae866b1ef02
d5afae0a901db2e5dd740ffaeef9e1ad534b288b
F20101124_AAALFC rybak_m_Page_71.tif
88fddf5ded9795574da40738f602dc4f
207b941d5fc7e51608284889f8324e229eba55d9
1967 F20101124_AAAKYF rybak_m_Page_51.txt
80cba38bbdf8fe5877d04fe1379a6341
9d74d053226987d844615b912e60707236ec1ba6
78472 F20101124_AAALAF rybak_m_Page_18.jpg
eac4177e471e054fcf84a3a4dc5fc5d0
c8921cf99a176ea7d0a7b67d3801f7c7f124d0a5
20107 F20101124_AAALKB rybak_m_Page_21.QC.jpg
2865d0e6403c72a893441a2fc5513b4f
7f6671ea4be141b59d51ab492c016c6b994ea416
136391 F20101124_AAAKTJ rybak_m_Page_66.jp2
fe7096e54bcd46fafe196ce1a362b3f5
f7d1c6ec8f793c42456a01bb0ecb482eba5f1ed1
9123 F20101124_AAALFD rybak_m_Page_01.pro
6f2a56294be37ff5534afefd8d5c190a
99b3f0a13859d0e7109479e0eae4764e5a7dfcfa
87485 F20101124_AAAKYG rybak_m_Page_72.jp2
19cf80e16ceb1458ef900976f8cd9508
8327952a82cc27096fefeb153a081c34fa613477
59819 F20101124_AAALAG rybak_m_Page_21.jpg
cd76232b57359c6b2a1351cdf60d92ed
373eb96019b3410e646921726ca1262c3ee06fba
22506 F20101124_AAALKC rybak_m_Page_22.QC.jpg
48d7dfd44a2d888cb31d1f1008edfc79
e4c72e4776257712999a4efa3cc3b3cfd4307f8a
8178 F20101124_AAAKTK rybak_m_Page_55.pro
24e4e3c0075149fe18610838ae07d541
304f5723f98dfc23c49d201ec11cff2e3d97933a
1302 F20101124_AAALFE rybak_m_Page_02.pro
c54a4a9a31c077872159fecd3553135b
d9e023a167aa80dd3fd526a0d21cd6306542c3d5
61710 F20101124_AAAKYH rybak_m_Page_31.jp2
738bd08712a3a0fa37bad9be6dc2eba6
00c3f903f404e8fbe10424109a2b9a447e9b19f6
33594 F20101124_AAALAH rybak_m_Page_26.jpg
f26cc908e5ce5ce8a08187e56303435d
ab1d8a53cc0a4f41cc5ca9aadeffb7775c992188
6617 F20101124_AAALKD rybak_m_Page_22thm.jpg
5f220279cab5c560cb737a9d21d5f15b
30cf12fa837a2701eb09a43a9b2217111146b693
3688 F20101124_AAAKTL rybak_m_Page_64thm.jpg
199e1a2456fdd4d57795554d07b90f6b
5838f96803d2cfd941626e34e9a041f1c9c1eee8
1038 F20101124_AAALFF rybak_m_Page_03.pro
a4df22fe5bfe2b9e195b15353e70a019
6ca2ff621a4ed7b1bf54b6b5856d37d3ffd5ebcb
51838 F20101124_AAAKYI rybak_m_Page_64.jp2
6046878ae9d1d51a37d09c017c1f929f
ff2b89a12fce7fac58b25c04184262dfc58959c0
62841 F20101124_AAALAI rybak_m_Page_27.jpg
bc1279d5a0d9c74fef8acaea439e1201
cb846d9430f9c479399f97b265795b16633ed1ff
22436 F20101124_AAALKE rybak_m_Page_23.QC.jpg
66237f0b0d06f3813856e3d432ccb5cd
e9ec0a38c0a46b3783bd2685e0a1083596f5d840
7045 F20101124_AAAKTM rybak_m_Page_50thm.jpg
f18bc6c00ae625afcd3a82ab6815e021
8f547d895c1f4432f6007785090d15e04a049acf
18511 F20101124_AAALFG rybak_m_Page_06.pro
c22dbf7cb6a0505e3e0b1c3ca4caab00
2611a7ed16e2f7681e1e1304fe3b08d34b102fa0
5817 F20101124_AAAKYJ rybak_m_Page_08thm.jpg
1ce31d24431342c50647cabfefd28359
0552dc637826e91bc67a57a864524abe1c30cd40
72021 F20101124_AAALAJ rybak_m_Page_29.jpg
707e95a49be77822ab5db1a6753fc32a
79ae61d1cd46dd65db0ba6b817a17d9e88484aaf
53537 F20101124_AAAKTN rybak_m_Page_11.jp2
ededd801b47eb6c1036f8f5dd4100d53
72b310163ffa56295a03b68854848c49b835fb51
35155 F20101124_AAALFH rybak_m_Page_07.pro
6bf72fad26f1128b045815ba7ff4d0fd
ad8ccb2b183eea16463cbc253438e818128c750d
17502 F20101124_AAAKYK rybak_m_Page_41.pro
32acaa74cc258c73aba6a9f6cb2c3f5a
aaf83485f2e09940c813cd005d863e031a814c2f
34686 F20101124_AAALAK rybak_m_Page_30.jpg
964aa573b36849ecf10185deee8dfcb8
e08a8b86d3391fc62a5ac319e94e4f70f7025833
6327 F20101124_AAALKF rybak_m_Page_23thm.jpg
a8ee9cf131af0df9f67af7e2df67b98a
fde2e23d73b8e09f16dc455523d2de59d5186f51
62185 F20101124_AAALFI rybak_m_Page_08.pro
ec29187632dbaf02f2ed0737a063967e
e138ecb1c438ca8babc1f20ccfd7af8b2f6af504
6962 F20101124_AAAKYL rybak_m_Page_18thm.jpg
cf9e8ad4f33ec9a915e53a5686435bda
2c2ea6c4b13e4cccf8dd48f7080b8faa22b5196d
43044 F20101124_AAALAL rybak_m_Page_31.jpg
4e739a6fac538b221e2a6dbd774f9f99
71b6910cfd7acdce6cb9c1715959611fede531e4
7161 F20101124_AAAKTO rybak_m_Page_01.QC.jpg
3967b201a3abb95a78dc286e87a4721b
0d58d4e775b77b64fef02b507b38f2aeae937372
14381 F20101124_AAALKG rybak_m_Page_24.QC.jpg
93451079fdafc835f72a4ec5d466f7bc
f9ebb215dbc81bc51a6e44d5da16a526c882e05c
27278 F20101124_AAALFJ rybak_m_Page_09.pro
f3395f00debb72452cd71e602e6d0c59
fc6e68c169d8da9716e84f7b3c55298df6778233
F20101124_AAAKYM rybak_m_Page_29.tif
74e9e034545e153e476323ba610d9608
4be6fb6c9dab6260d9c361a470c9ea94503cf520
38022 F20101124_AAALAM rybak_m_Page_32.jpg
6dac920739014b7976959d1b8b3503b6
b80a0ed5b33e774b15d2cec2d8679964418e1fb8
3980 F20101124_AAALKH rybak_m_Page_25thm.jpg
b36f485b5f0d1e37227b40158dd5345a
db99264742d7ef92d133a0d7043bffdb5a8b7a33
43294 F20101124_AAALFK rybak_m_Page_12.pro
2b4c46a718f765a910f5523db8efb799
2902e23970fb909d21d9730cd47314540029ad56
1331 F20101124_AAAKYN rybak_m_Page_03thm.jpg
5c64f625bbd5cd3119caa6b60c4d1f27
862bae2b6affa13e1f875bc881791901baa3e456
63540 F20101124_AAALAN rybak_m_Page_34.jpg
c90680deefefb7e28676db954203f1a6
3abac62c771021bbf8d0fb15cee1d5b559e0d05a
6621 F20101124_AAAKTP rybak_m_Page_17thm.jpg
fff55065e5d22b985d1eeabb78768b5a
511225691e781a69e0614908eb6177fdfd4e4c7c
21136 F20101124_AAALKI rybak_m_Page_27.QC.jpg
390cb88babfbb72bbd0346a34781d252
4b1c3895378d1f0e6d9b6e56fc7b6a93964c6112
46334 F20101124_AAALFL rybak_m_Page_13.pro
2e963e57ed5c84e87d4482d78bc44b50
5fb7407ccb8bee0687fbb724d79204db17d132be
86807 F20101124_AAAKYO rybak_m_Page_58.jpg
cc6c119f14df962734a9a0bea327c4fe
0e5f0cb0d692144e160773ce41132efe4cd4314e
72977 F20101124_AAALAO rybak_m_Page_35.jpg
33715a3da52d6377e735790e5457289e
b5f4ee824179b51632a374d85fba20bbb7192123
21756 F20101124_AAAKTQ rybak_m_Page_32.pro
75158f8b856694096a0ff7523a26297a
e44c42940af46d678ebf35a4f9d1c096547b224f
5928 F20101124_AAALKJ rybak_m_Page_27thm.jpg
369638292c7a7066f44fa7bb20e89398
2ea4512db7e45af2043504d91e004bb01f45e9ec
43755 F20101124_AAALFM rybak_m_Page_14.pro
39c7caa50228f20b26534c5fc621f0a1
0aa03575ba263a6268b377745569e6ed03939c80
26941 F20101124_AAAKYP rybak_m_Page_66.QC.jpg
76809621c2e94c30615de2e7a3765352
864eaf3f239daf42f40b030b67b417c07537df07
76214 F20101124_AAALAP rybak_m_Page_36.jpg
b2befa48d5ddd3e564f40b6bce9d590d
72b013f3064b3b7cba4f3b5160f337b978a5a254
1194 F20101124_AAAKTR rybak_m_Page_31.txt
112de259ac4943f1ad14c9bd294f15f2
6793a08ec854e8adf7d420891095805fe87baf72
23537 F20101124_AAALKK rybak_m_Page_28.QC.jpg
400a65a2364a9d777195eed25c2c080e
ca6d17f303a3d19a7deb25a093d59b39f8e85030
47076 F20101124_AAALFN rybak_m_Page_15.pro
187c6e28c3af893a62d8c93e26eebab1
a87259babf8d9b08c463b35ed6ae1f7d48eac654
4376 F20101124_AAAKYQ rybak_m_Page_56thm.jpg
dcf27fc6fc9013dbe8a46f9079c4b482
da97c3290c47073e194e8f647e852d49019e1a3d
70287 F20101124_AAALAQ rybak_m_Page_37.jpg
1c0adf9ed6cfc1150713f5e6f81e3481
c3a6ef28dead452d5f53d46df18aa2808df9479a
17859 F20101124_AAAKTS rybak_m_Page_71.pro
3d1f9cb1f9834f9d190433ec2529f5a6
6dcd72f2a6365b6ad08eb507c84a0df22900a160
6595 F20101124_AAALKL rybak_m_Page_28thm.jpg
76b269badc2425e5d57f10d7ccdaec12
57e19acd7e087e0002e1df3a8571340e72f236fc
45897 F20101124_AAALFO rybak_m_Page_16.pro
a2796d33db6104ce9699f4ed8d257d0d
2b9a0be33844a217f727d9e0ec0e84723c2749f2
21451 F20101124_AAAKYR rybak_m_Page_61.QC.jpg
0eb0ba9b43eaed7b5befd90304f8ff5b
c7da7bed24132a97ca81f2c03b900eb724b362db
73163 F20101124_AAALAR rybak_m_Page_38.jpg
c9adee136ef73dde8ffcc878717eccc1
01aeb6ee8a461255567100bc0a10574087bb8916
44863 F20101124_AAAKTT rybak_m_Page_41.jpg
8778d119512d9d33e01de01d48be03fc
ff91bb60cf058994b8d080db2f7359f825e535e2
11218 F20101124_AAALKM rybak_m_Page_30.QC.jpg
7c8aeb17c92d590ad0a639d7050f8fe3
62575f6812f52aefcf414a127e8914ea2a3e6e84
47550 F20101124_AAALFP rybak_m_Page_18.pro
f5c643eda679c381d981b20a4db1a1bc
66a6f27a1e969b0620289523454ff2baadbad9bf
24321 F20101124_AAAKYS rybak_m_Page_47.QC.jpg
828a2574d7a4056b7e600ba2b2617674
9e978d428668655c813e4580ed2448d75bf72e7a
68823 F20101124_AAALAS rybak_m_Page_39.jpg
e96c1579e28e605d8606b506456fc393
252bea6b91395bba64fefb18f57ada7f174090fb
27582 F20101124_AAAKTU rybak_m_Page_53.jpg
b9dc952e0a8a4b7db9c824fbf2dcef83
d889551f9cd936b18b213f0638c5bc1b234bd1b5
3560 F20101124_AAALKN rybak_m_Page_30thm.jpg
9718f9c1c75c532dbad0f283648954c2
22d893bdc6c4f703db1d7a054b80a9bf3d37a1bf
50274 F20101124_AAALFQ rybak_m_Page_19.pro
45f71940589c26ebfd7afa33db9ba057
21bbefa822a1d3e5aa59370e2539b606e8afcbcc
18916 F20101124_AAAKYT rybak_m_Page_60.QC.jpg
d201d3df41841c218149d071f297ebed
83bd65d6773bea5e53d09e81dfe0be0d7051a8a9
29629 F20101124_AAALAT rybak_m_Page_40.jpg
564c5ea7b7eb81e14f749dca2c075b73
ad70a97b994f685ec901b1f3d2d69a9d927e0524
7066 F20101124_AAAKTV rybak_m_Page_67thm.jpg
04e4ccf6489fe16fe5ac11fd4c03ae31
3a62be98f28d15af94c1374ec20cbc7e381b8f6b
13342 F20101124_AAALKO rybak_m_Page_31.QC.jpg
62061e09d2919a49cd3c7722d05b26b0
d01d9944779468443a8745f09503ca058f753c00
18989 F20101124_AAALFR rybak_m_Page_25.pro
1435845c1f5a9138d173058bff58e039
f579275d7e7c439a7cf47d4a2629be13dfd00248
67832 F20101124_AAALAU rybak_m_Page_42.jpg
8ae99f24ddc5f9e96a62e3257bbcc5d6
b3d39a9424a4edf7cce64a0110873b3b9ac3287a
71759 F20101124_AAAKTW rybak_m_Page_05.pro
1eb86cedd536c14f30eb96c6239d8e14
b34387a0e897506a7f279c59e95fc520d3363102
12717 F20101124_AAALKP rybak_m_Page_32.QC.jpg
726285dbc44a2cf8afe7c2ccbf170b8a
ab7a2786b251920618aa3aa31813104ddf3e1d54
5488 F20101124_AAALFS rybak_m_Page_26.pro
5754097b5c8a83afba2ec56a1dfb8eab
819c7e7b35b149a0e28a33d6abe29838c3a1f5eb
5711 F20101124_AAAKYU rybak_m_Page_44thm.jpg
aeb26221962572c608acaa6dde358d65
1193b99b2c0130b383300e0e401456d1cb65a0cc
62072 F20101124_AAALAV rybak_m_Page_44.jpg
d1345fe86b589c6761e83b28f7cf4f67
7a2fadf5e10b1f496863e46f614eae73633930f7
74979 F20101124_AAAKTX rybak_m_Page_48.jpg
2089918c6e836c15494f5194e03cb67b
ca2b0a3d522364499df9b493840c5414f78fb6fb
4041 F20101124_AAALKQ rybak_m_Page_32thm.jpg
852965b8592cbc99c916dd11c9d5266e
3ce99388739f6e79e39c7d4e2d0141ae1fb94569
41151 F20101124_AAALFT rybak_m_Page_27.pro
c639629727d2c11c2f050d479087981f
c14d4be8bdba30125866e4d2cf03d85f6b1e4911
23081 F20101124_AAAKYV rybak_m_Page_11.pro
36564347ac57ff9871135e8ede639b89
14d9b48177482f8094ab400508437f827b6a51e6
70268 F20101124_AAALAW rybak_m_Page_45.jpg
26d23b6da688b3302e7f16105123d0c9
ef9e559cdc137da3bc5b2ed8d0bbd51fcda802bc
105310 F20101124_AAAKTY rybak_m_Page_37.jp2
d4364366f40f3df132afb3557725501a
846dd502c28e0d0922cf09c6748163e876bcf9b0
5242 F20101124_AAALKR rybak_m_Page_33thm.jpg
f31c0b4b1b4a5c7271643e685cec22a4
e79f33b2f01f382ed3f5e676dc57e390eb024107
49719 F20101124_AAALFU rybak_m_Page_29.pro
e6f31ea3cf43e3ddd50ea87ac68dc635
321de890c89e376b3e760a9b0023477194a6de3e
F20101124_AAAKYW rybak_m_Page_09.tif
2327d252023d1e2472325b24c7309bee
7913b473ae3ce11ff27c2b8452ffec34062ed489
71420 F20101124_AAALAX rybak_m_Page_46.jpg
c3e88c10572d31c3b9d1400d7c2f4688
4886ec326fb86b10829eb54779f9baa973cead7f
4897 F20101124_AAAKTZ rybak_m_Page_60thm.jpg
7b0297d01b492eb6a3df374041686a84
7694ecdc193c2db90151633ecc54622b2a10da5d



PAGE 1

GENETIC DETERMINANTS OF HOST RANGE SPECIFICITY OF THE WELLINGTON STRAIN OF Xanthomonas axonopodis pv citri By MYRIAN ASUCENA RYBAK A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Myrian Asucena Rybak

PAGE 3

To God my guide and fortitude

PAGE 4

iv ACKNOWLEDGMENTS I wish to express my thanks and compliments to the chairman of my supervisory committee, Dr. Jeffrey B. Jones, for his enco uragement and guidance. I also want for to thank the members of my committee, Dr. Jame s Graham and Dr. Gloria Moore for their critical reading of the manuscript and for their helpful suggestions My most considerable debt is to Dr. R obert E. Stall who was generous with his time and expertise in this research. His knowledge, patience and constant support were equally important to the completion of this manuscript. My appreci ation and gratitude go to him now and always. Special thanks go to Mr. Jerry Minsavage fo r his indispensable help; he generously donated many hours of his valuable time with his technical assistance. I owe gratitude to the Plant Pathology Depa rtment at the University of Florida; especially I want to thank the members of our laboratory that I met between 2001-2005. Sincere gratitude is extended to the faculty staff members and other people in Fifield Hall for their assistance and friendship. I would like to thank friends and relatives in Argentina, especially Dr. Nelly Canteros; her guidance and useful a dvice will be alwa ys appreciated. My family helped and their faith kept me going though some pretty hard times. I would particularly like to acknowledge Ra quel, my dear sister and friend, and my wonderful mother Veronica, my sisters and brothers, nieces and nephews and thanks go to the memory of my father for his example and integrity.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT....................................................................................................................... ..x CHAPTER 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................4 3 EVIDENCE FOR HYPERSENSI TIVITY REACTION IN XAC-AW STRAIN IN GRAPEFRUIT............................................................................................................10 Introduction.................................................................................................................10 Materials and Methods...............................................................................................10 Results........................................................................................................................ .12 Discussion...................................................................................................................12 4 CHANGE OF HOST RANGE BY MUTATION......................................................16 Introduction.................................................................................................................16 Materials and Methods...............................................................................................16 Results........................................................................................................................ .17 Discussion...................................................................................................................18 5 CHANGE OF HOST RANGE BY CONJUGATION................................................23 Introduction.................................................................................................................23 Materials and Methods...............................................................................................23 Results........................................................................................................................ .26 Discussion...................................................................................................................27 6 CLONING AN AVR GENE FROM THE XAC-AW STRAIN...................................33 Introduction.................................................................................................................33

PAGE 6

vi Materials and Methods...............................................................................................33 Results........................................................................................................................ .37 Discussion...................................................................................................................39 7 DISCUSSION.............................................................................................................50 LIST OF REFERENCES...................................................................................................54 BIOGRAPHICAL SKETCH.............................................................................................61

PAGE 7

vii LIST OF TABLES Table page 4-1 Effect in vitro of NTG mutagenesis on development of white colonies and streptomycin resistant colonies of Xac-Aw strain.....................................................20 4-2 Total area of inoculated Key lime and grapefruit leaves in all experiments............21 4-3 Number of lesions per cm2 that were produced in Key lime and grapefruit leaves inoculated with 103 cfu/ml of Xac-Aw.....................................................................21 5-1 List of bacterial stra in used in chapter 5..................................................................31 5-2 Frequency of transfer of copper resistance genes among Xanthomonas axonopodis pv citri (Xac-A) after conjugati on in a liquid medium........................31 5-3 Frequency of transfer of coppe r resistance genes among strains of Xanthomonas axonopodis pv. citri (Xac-A) after conjugati on in a liquid medium........................32 5-4 Frequency of transfer of copper resistant genes from Xanthomonas campestris pv. vesicatoria (Xcv) to copper se nsitive strains of Xanthomonas axonopo dis pv. citri by conjugation on a solid medium....................................................................32 6-1 List of bacterial strains used in chapter 6.................................................................49

PAGE 8

viii LIST OF FIGURES Figure page 3-1 Electrolyte leakage in grapefru it leaves inoculated with Xac-Aw and Xac-A strains at a concentration of 5x108 cells per milliliter..............................................14 3-2 Internal bacterial populations in gr apefruit leaves inoc ulated with Xac-Aw and Xac-A strains at various times after inoculation......................................................14 3-3 Symptoms of Xac-Aw (left side of leaf) and XacA (right side of leaf) in old (left) and young leaves (right) of grapefruit.............................................................15 4-1 Symptoms of Xanthomonas axonopodis pv. citri strain Xac-Aw in grapefruit leaf after infiltration with 103 cfu/ml bacterial concentration..................................22 4-2 Symptoms of Xanthmonas axonopodi s pv. citri strain Xac-Aw in Key lime leaf after infiltration with 103 cfu/ml bacterial concentration.........................................22 5-1 Agarose gel stained with ethidium bromide. Lanes contain plasmid extractions from different strains................................................................................................28 5-2 Agarose gel stained with ethidium bromide. Lanes contain plasmid extractions from different strains:1= Xac-A (16, Cur), 2= Xac-A (26, Cur), 3= Xac-A (1874, Cus)................................................................................................................29 5-3 Agarose gel stained with ethidium brom ide. Lanes contained plasmid extractions from different strains: 1= Xcv 75-3 (Cur) 2= Xac-A 20 (1874, GFP+, Cus), 3= Xcv 75-x Xac-A 20).................................................................................................30 6-1 Symptoms caused by Xac-A (left) and Xac-Aw (right) strains in tobacco, tomato, and pepper leaves.....................................................................................................42 6-2 Symptoms in grapefruit leaves after infiltration with the bacterial suspensions.....43 6 -3 Symptoms in Key lime leaves after infiltration with different bacterial suspensions...............................................................................................................43 6-4 Symptoms in grapefruit following inoculation with Xac-A 40 strain (A), Xac-Aw 12879 strain (Aw) and Xac-Aw (3)........................................................................44

PAGE 9

ix 6-5 Symptoms in grapefruit after inoc ulation by needle pricks with Xac-Aw strain 12879 (right top), Xac-Aw (bottom left), and Xac-A 40 (bottom right)...............44 6-6 Bacterial populations in grapefruit leaves infilt rated with Xac-A 40; Xac-Aw ; Xac-Aw 12879;Xac-A 40 (pU799-3), Xac-Aw (pU799-3)....................................45 6-7 Electrolyte leakage in grapefruit leav es infiltrated with of Xac-A 40, XacAw Xac-Aw 12879, Xac-A 40 (pU799-3), Xac-Aw (pU799-3)....................................45 6-8 Hybridization of the subclone pU799-3 fragment in avrGf 1 to total genomic DNA of Xanthomonas strains digested whith Hind II..............................................46 6-9 Nucleotide sequence of the 2.3 kb fragment of DNA from Xac-Aw containing avrGf1 nucleotide sequencing (bold letters)............................................................47 6-10 Alignment between the complete sequence of XCC3600 from Xanthomonas campestris pv. campestris and the avrGf1 ...............................................................48

PAGE 10

x Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC DETERMINANTS OF HOST RANGE SPECIFICITY OF THE WELLINGTON STRAIN OF Xanthomonas axonopodis pv. citri By Myrian Asucena Rybak August 2005 Chair: Jeffrey B. Jones Major Department: Plant Pathology A new strain of the citrus canker bacterium ( Xanthomonas axonopodis pv. citri ) was detected in Florida. It was significant in that it was primarily pathogenic on Key lime trees, but not on grapefruit trees. This st rain has been designated as Xac-Aw. This strain has caused concern among regulator s with regard to how to tr eat this bacterium in the eradication program. Of major c oncern was the stability of the bacterium in regard to host specificity of the strain; for example, could the strain mutate to attack grapefruit and other citrus plants. We invest igated the frequency of the development of mutants, the transfer of genes by conjugati on, and the presence of an avirul ence gene to grapefruit in the genome. We never were able to find a muta nt, either natural or induced, that changed host range. In conjugation studies, transfer of marker genes on the chromosome to and from the Xac-Aw strain by conjugation was not succ essful. In an attempt to locate possible avirulence genes, a genetic library of Xac-Aw DNA was made using the pLAFR vector and transformed into Escherichia coli This library was tran sferred to strain 91-

PAGE 11

xi 118 of X. perforans which is pathogenic to tomat o, but causes a null reaction in grapefruit leaves. The transconjugants were screened for HR in grapefruit leaves. The inoculated leaves were observed for developmen t of an HR in the infiltrated area. In the screening of the Xac-Aw genomic library we found an avirulence gene in the genome of Xac-Aw that interacts with grapefru it leaves to cause an HR. This is the first report of an avirulence gene in the genome of a citrus ca nker bacterium that interacts with a citrus species. This gene was designated as avrGf1 was sequenced, and then was characterized. The possibility of a second avr gene exists in the Xac-Aw strain, because the Xac-Aw lacking a functional avrGf1 did not cause exactly the same symptoms and develop the same population as the wild-type Xac-A strain when it was inoculated into grapefruit leaves.

PAGE 12

1 CHAPTER 1 INTRODUCTION Citrus production in Florid a contributes greatly to the economy of the state. Production for the 2003-04 seasons totaled 16.4 million tons from 679,000 acres of trees. Florida accounted for 79 percent of the total U.S. citrus production, followed by California with 18 percent; and Texas and Ar izona which accounted for the remaining 3 percent. The value of the 2003-04 U.S. citrus crop was up 4 percent from the previous season to $2.35 billion (pack inghouse-door equivalent) as published by the USDA, Statistical Service (2004). Citrus plants are susceptible to diseases caused by bacteria. One of these diseases, citrus canker, is caused by two pathovars of Xanthomonas axonopodis Pathovars of this bacterium have been distinguished based on phenotypic reactions on di fferent hosts, i.e., Xanthomonas axonopodis pv. citri (Xac) and Xanthomonas axonopodis pv. aurantifoii (Xaa). The most destructive bacterium is Xanthomonas axonopodis pv. citri which causes Asiatic citrus canker (Xac-A). Asiatic citrus canker was discovered in North America in 1912 and was distributed throughout the Gulf states (Loucks, 1934; Dopson, 1964). Eradication of the disease began in 1915 and the disease was eradicat ed in 1947. This disease was rediscovered again in 1986 in Manatee County, Florida, a nd declared eradicated in 1994 (Schubert et al., 1996). A new focus of this disease appe ared in Miami in 1995 (Gottwald et al., 1997a; Schubert et al., 2001), and a current er adication program exis ts. This disease was also successfully eradicated from the Unite d States, South Africa, Australia, and New

PAGE 13

2 Zealand, but a new focus of citrus canker a ppeared in Australia in 2004 (Hibberd, A., personal communication). An erad ication program currently exis ts in Brazil. The disease is endemic to Argentina, Paraguay, and Uruguay. It is also endemic to all countries in eastern Asia. The symptoms of the disease are erum pent lesions on fruit, foliage, and young stems of susceptible citrus cultivars (Sc hubert et al., 2001 and Go ttwald et al., 2002a). The occurrence of citrus canker lesions on the fruit rind decreases the commercial quality and infected fruit is not accepted by the most important markets. The warm spring and summer conditions of Florida, together with rains with strong winds that occasionally occur, offer ideal conditions for the spread of Xac. Optimum temperatures for infection range between 20 and 30C (Koizumi, 1985). The introduction of the leafminer, Phyllocnistis citrella Stainton, in Florida in 1993, has increased citrus canker severity due to wounds cause d by the insect that expose leaf mesophyll tissues to splashed inoculum thus increasing the pr obability of ingress by Xac (Gottwald et al., 1997a). The leafminer a dults, however, are not efficient vectors of the pathogen (Belas que et al., 2005). Changes have recently occurred in the eradication protocols performed by the Division of Plant Industry (Gottwald et al., 2002b). The increased disease severity associated with the leafminer has resulted in increased areas of tree disposal around a focus of infection (Schubert et al., 2001 and Gottwald et al., 2002a). In addition, tornados and hurricanes during the summer months have caused dissemination of Xac-A much greater distances than previously thought possi ble. Legal questions about eradications, in

PAGE 14

3 general, have hindered eradi cation (Gottwald et al., 2002b). Citrus canker has spread rapidly in Florida despit e changes in eradication protocols (McEver, 2005). Schubert et al. (2001) descri bed at least two separate introductions of Xac-A in Florida since 1985. In one of the introductions a strain of Xac that is pathogenic to Key lime and alemow plants, but not to grapefru it and orange was f ound. This strain (Xac-Aw) was characterized by Sun et al. (2004) and found to be related genetically to Xac-A rather than Xaa-B or Xaa-C, which have more sim ilar host ranges. Regulations and eradication protocols adopted for this strain were diffe rent from those adopted for Asiatic citrus canker. For the Xac-Aw only Key lime and alemow plants were destroyed. Because of the relationship of Xac-Aw to Xac-A, questions as to whether Xac-Aw could revert to an XacA strain exist. If this occurred, a new focu s of Xac-A could occur with the eradication program that was adopted. The purpose of this work was to investigate the stability of the Xac-Aw strain in terms of host specificity. The Xac-Aw strain causes a hypersensitive reaction in grapefruit. Such a reaction is usually the resu lt of an avirulence ge ne interacting with a resistance gene in the host (Minsavage et al., 1990b). If re sistance in grap efruit to the Xac-Aw strain is the result of the presence of a single gene in the bacterium, then the stability of the host specificity of the Xac-Aw may be low. The change to virulence in grapefruit of the Xac-Aw strain was studied by mutagenesi s of the strain, by conjugations of strains, and by isolation of avir ulence genes in the genome of Xac-Aw.

PAGE 15

4 CHAPTER 2 LITERATURE REVIEW Many reviews have been published on the citrus canker disease (Locks, 1934; Garnsey et al., 1979; Schoulties et al., 1987; Graham and Gottwald, 1991; Stall and Civerolo, 1991; Schubert et al., 2001 Gottwal d et al., 2002a; Graham et al., 2004). An excellent early review is an unpublished manuscr ipt that was written by K. W. Loucks in 1934. The review is located in the library of the Division of Pl ant Industry, Florida Department of Agriculture, Gainesville. It is a review of resear ch on regulation and eradication of this disease from the appearan ce of citrus canker dise ase in Florida until eradication of citrus canker was declared in 1933. This manuscript c ontains a history and geographical distribution of citr us canker in the world, United States, and Florida. Hosts reported to be susceptible and the economic importance of ci trus canker were included. A description of citrus canker sy mptoms of leaves, twigs, thor ns, branches and fruits is given. The general appearance on an infected tree with citrus ca nker was described. The morphology, physiology, cultural characteristics and taxonomy of the causal organism at that time were described in this review. The viability and longevity of the pathogen were described; including describing the ability of the bacterium to enter the host tissue and remain quiescent until higher temperatures occurred. The means of dissemination, methods of infection, and the incubation period involved w ith the disease cycle were reviewed. The histology of the disease was described. Humidity and temperature relationships for disease development, as well the seasonal development of the host and disease, were included. Progre ss on the eradication and cont rol of citrus canker and the

PAGE 16

5 epidemiological situation at the time that this review was written were discussed. The last issue that Louck considered in his review was the future danger of the disease to citrus in Florida. An analytical bibliography of research publications relating to citrus canker was annotated by Rossetti et al. (1981). This huge effort contains abstracts of scientific papers, reviews, extension reports and notes from 1912 though 1981. There are 1246 abstracts included from all over the world. Before the reintroduction of citrus canker in Florida in 1985 there were concerns about the reintroduction of c itrus canker after it was decl ared eradicated in 1933 from Florida and in 1947 from the USA (Stall and Seymour, 1983). Those concerns were based on importation of citrus fruits into the United States from Japan, where citrus canker is endemic; an epidemic of canke r occurring in South America, and the interception of citrus can ker at ports of entry. This articl e described the causal agent, the disease, the history of citr us canker, information about losses due to th is disease, measures of control and finally the outlook ab out the real risks of the reintroduction of citrus canker in the USA. A bacterial disease of citrus was observ ed in Florida in 1984. This disease was referred to as the nursery form of citrus can ker, or sometimes as canker E (Schoulties et al., 1987). In this review they described the nursery form of the disease, diagnosis, symptoms, distribution, host ra nge, eradication and regulator y program. The review also discussed the introduction of the Asiatic form of the disease in Florida in 1985 and the eradication policies regarding the reintroduction of Asiatic citrus canke r. The article also

PAGE 17

6 mentioned the costs of the eradications a nd regulatory programs which were $25 million from September 1984 to July 1986. Stall and Civerolo (1991) described Asiatic canker and ongoing research with both types of diseases of citrus in Florida. They reviewed the history of the disease in Florida, and the efforts on eradication, th e different forms of citrus canker, and the localization of citrus canker in the USA. Research relate d to regulation, and eradication problems included the comparisons between the citrus canker and the bacter ial spot disease. Isozyme analyses, serological studies, and DNA analyses of different strains involved in the two diseases were included in the comparison of the strains. Two recent reviews pertain mostly to the introduction of Asiatic citrus canker in Florida in 1995 (Schubert et al ., 2001 and Gottwald et al., 20 02a). These reviews provide a history of the disease in Flor ida and describe a citrus canke r disease cycle. Both reviews describe the host range of the citrus canke r disease, although Gottwald et al. (2002a) provide a more expansive list. Schubert et al. ( 2001) list three separate introductions of the Asiatic citrus canker from 1910 until now and describe a fourth introduction in 2000. The pathogen associated with the 2000 introduction has a limited host range and was designated as the Wellington strain. Both revi ews treated the problems of regulation and eradication of citrus canker in Florida. Gottw ald et al. (2002b) disc uss the epidemiology of the disease in the urban setting which wa s not considered prev iously. Both reviews discuss the role of the Asian citrus leafminer ( Phyllocnistis citrella Stainton) damage in the epidemiology of the disease. From the above reviews it is apparent th at different xanthom onads are pathogenic to various citrus species. Only those that caus e a lesion that is erumpe nt or pustule-like in

PAGE 18

7 the early stages of symptoms on leaves ar e now included in the citrus canker disease (Graham and Gottwald, 1990). These lesions become crateriform as they increase in size. The bacteria that do not cause such lesions are not presently cla ssed as causing citrus canker, and this includes the xa nthomonad that cause s the citrus bacterial spot disease. The nomenclature of the bacterial strain s that cause citrus canker has evolved. Gabriel et al. (1989) proposed that Xanthomonas citri be restored for the name of the Xac-A group. They also proposed that the Xaa-B and Xaa-C strains be named Xanthomonas campestris pv. aurantifolii. Their primary evidence for this nomenclature was based on restriction fragment length polymorphism (RFLP) using DNA probes hybridizing to total DNA of the strains. Th e change in nomenclature based on this technique was criticized by Young et al. (1991) and Vauterin et al. (1990). Vauterin et al. (1991) studied the xanthomonads that cause the citrus canker disease using DNA-DNA hybridization and other techniqu es and concluded that they should be divided into two groups. Vauterin et al. (1995) revised the nomenclature of the genus Xanthomonas and placed the bacteria that cause citrus canker into X axonopodis that also included many other plant disease-causing xanthomonads. The A group was given pathovar status and named X. axonopodis pv. citri. The B and C strains were placed into the pathovar aurantifolii as was proposed by Gabriel et al. (1989) previously. This nomenclature seems to be the most accepted at present for the bacteria that cause the citrus canker disease. Two groups of strains that are placed in X. axonopodis pv. citri cause citrus canker can be distinguished, based on DNA and other genetic aspects (Verniere, 1998). The first

PAGE 19

8 group is the most important group and consists of X. axonopodis pv. citri strain A (XacA) that causes Asiatic citrus canker. Se veral subgroups have been identified. One subgroup is referred to as A* because strains are genetically similar to the Xac-A strains (Hartung and Civerolo, 1989; Cubero and Gr aham, 2004), but have different host specificities and a few physiological differen ces from typical Xac-A strains (Sun et al. 2004). This subgroup of strains occurs in southeastern Asia Iran and possibly India. Another subgroup of strains was recently f ound in Florida and is referred to as Xac-Aw strains (Sun et al., 2004). These strains ar e pathogenic on Key lime and alemow plants, but not on grapefruit or orange plants. The Xac-Aw strains are also closely related genetically to the Xac-A and Xac-A* strains, but have some physiological differences from the latter strains. Another group consists of strains that cause citrus canker and are significantly different genetically from the Xac-A strain s.The members within this group are closely related genetically (V auterin et al; in 1991). The strain s that cause canker B and C, X. axonopodis pv. aurantifolii, are in this group. This group can be subdivided based on pathogenicity and a few physiological tests. Both subgroups are not pathogenic on grapefruit and oranges, but are pathogeni c on Key lime. The B subgroup (Xaa-B) of strains is pathogenic on lemon trees also. Afte r the introduction of Xac-A in Argentina in 1973 the B subgroup was not isolated from the field any more and is only present in pathogen collections (Nelly Canteros, pers onal communication). Th e Xaa-C strain was isolated in Brazil, but does not occur in nature at this time. Some work has been done regarding the host specificities of the strains of bacteria that cause citrus canker. In L oucks review it was pointed out that some species of citrus

PAGE 20

9 are more susceptible than others. Levels of resistance, or susceptibility, of the citrus species and cultivars were recorded duri ng evaluations in the field. The extreme susceptibility of grapefruit to th e Xac-A strains was attributed to the larger stomatal pores compared to the mandarins which are more re sistant and have smaller stomatal pores (Mc Lean, 1921). This may be a factor, but Stall et al. (1982a) demonstrated that many more lesions developed in grapefruit leaves also after infiltration with a low level of inoculum. The infiltration technique of inoculation was used to evaluate a few cultivars of orange and grapefruit plants in the field. There was good correlation of dis ease and susc eptibility in the field results. Viloria et al. (2004) us ed this technique to evaluate many citrus genotypes under greenhouse conditions. There seem ed to be a continuum of resistance or susceptibility levels in the genotypes tested. Hypersensitivity in citrus to Xac-A st rains has not been reported. However, a hypersensitivity reaction was suggested as oc curring after inocula tions of grapefruit leaves with a strain of the canker C (Xaa-C) from Brazi l (Stall et al., 1982b). This was suggested because a rapid necrosis occurred in young grapefruit leav es inoculated with high concentrations of cells (108 cfu/ ml). The rapid necrosis was compared to relatively slow necrosis in grapefruit caused by the Xa c-A strain and a strain of canker B (Xaa-B). Further documentation of the hypersensitive re action in grapefruit ca used by the C strain has not been reported.

PAGE 21

10 CHAPTER 3 EVIDENCE FOR HYPERSENSI TIV REACTION IN XAC-AW STRAIN IN GRAPEFRUIT Introduction Xanthomonas axonopodis pv. citri strain Aw (Xac-Aw) was compared with Xac-A (strain that causes Asiatic citrus canker) in Duncan grapefruit and Key lime (Sun et al., 2004). Even though rapid necrosis occurs wh en high concentrations of the Xac-Aw bacterium are infiltrated into grapefruit leaves, data for the development of a hypersensitive reaction (HR) in grapefruit were not reported. In this chapter we present experiments on electrolyte leakage and bacter ial growth after inoculations with high concentrations of Xac-A and Xac-Aw strains into grapefruit leaves to determine if a typical HR occurs in grapefruit leaves. Materials and Methods Plants. Plants of grapefruit ( Citrus paradi Macf.), cultivar Duncan, were kept in a quarantine greenhouse at the Division Plant Indus try at 20 to 35 C and used in this experiment. Before inoculation the plants were pruned to stimulate new growth. Leaves on the newly developed shoots were inoculated ca. 10 da ys after new shoots began growth. The leaves chosen for inoculations were fully expanded, but soft to the touch, and not as fully green as mature leaves. By us ing this procedure all the inoculated leaves were in a similar developmental stage. Bacterial strains and preparation of inoculum. Two Xac strains were used. Suspensions of strains Xac-Aw 12879 and Xac-A 40 (Corrientes, Argentina) were each

PAGE 22

11 transferred to nutrient agar medium (NA) fr om culture stored at -80C and isolated colonies were obtained. Several colonies of each strain were transferred to nutrient broth. After the cultures were shaken overnight, the bacterial suspensions were centrifuged and the cells were resuspended in sterile tap-water, and standardized to an absorbance of 0.3 at a light wavelength of 600 nm in a Spectr onic 20 spectrophotomer. This optical density corresponds to a bacteria l concentration of 5x108 cfu /ml. Electrolyte leakage. Leaves of grapefruit we re inoculated with 5x108 cfu/ml of Xac-Aw or Xac-A strains (15 leaves each). The inoculations were made by infiltrating leaves with 10 ml syringe and 27 g nettle (Klement, 1963). After 2 h and 2, 4, 6, and 8 days electrolyte leakage was measured from three leaves infiltrated with each strain. Electrolyte leakage was determined as an in crease in electrical conductivity over a 2 h period of 3 ml of de-ioni zed water containing six 0.5 cm2 leaf disks of each inoculated area (Cook and Stall, 1968; Hibberd et al., 1987) The mean of the three determinations was used as the conductivity at each time, but each determination was used to determine the experimental error. Bacterial populations. The populations of the Xac-Aw and Xac-A strains in grapefruit leaves were determined in the sa me leaves and the same times as electrolyte leakage determinations. From each inoculated leaf 0.5 cm2 of leaf area was taken and triturated in one ml of sterile tap-water, a nd after appropriate ten-fold dilutions, 50 l were plated on NA medium. The colonies we re counted 3 days later (Cook and Stall, 1968; Hibberd et al., 1987). Three replicates were included at each time period. The experiment with population and electrolyte leakage was repeat ed three times.

PAGE 23

12 Results The appearance of rapid necrosis in grapefruit leaves occurred only on young leaves of grapefruit plants (Figure 3-3). Ther efore, the inoculation of leaves in a young stage of development is essential for consis tent results. The inocul ation of new growth that resulted from pruning of shoots of grap efruit plants gave consistent reactions. Electrolyte leakage of grapefruit leaves. The conductivity of water containing leaf disks inoculated with the Xac-Aw strain was very high at day four compared to conductivity of water containing leaf disks inoculated w ith the Xac-A strain (Figure 3-1). Conductivity of water containing leaf disks inoculated with the Xac-A strain was highest at day eight. Thus, the Xac-Aw strain caused more rapid electrolyte leakage from grapefruit leaves than the Xac-A strain. Growth of Xac-Aw and Xac-A strains The populations of the Xac-A strain were significantly higher than the Xac-Aw strain in grapefruit leaves at day four and day six. The populations reached 109 cfu/cm2 of leaf tissue with the Xac-A strain, but the populations of the Xac-Aw strain were slightly lower and reached only 108 cfu/cm2 (Figure 3-2). Discussion The populations obtained in leaves inoculated with Xac-Aw were very similar to the results obtained by Sun et al. (2004). Growth was slower in leaves inoculated with the Xac-Aw strain than growth in leaves inoculat ed with Xac-A strain. In both studies the Xac-Aw populations were nearly ten-fold less than the Xac-A strain. Comparisons of growth after infiltration in Key lime leaves we re not determined in this study, because we were only interested in determination of HR in grapefruit leaves of the Xac-Aw strain.

PAGE 24

13 However, Sun et al. (2004) found no differe nces in growth of Xac-A and Xac-Aw in leaves of Key lime. To determine if necrosis occurs more rapi dly in leaves inoculated with strain XacAw compared with Xac-A, electrolyte leakag e was monitored in grapefruit leaves after infiltration with these strains. Leakage of el ectrolytes from citrus leaf tissue infected by Xac-A was determined previously (Goto, et al., 1979). In this work necrosis caused by Xac-Aw occurred more rapidly compared with Xac-A strain (Figur e 3-1). Electrolyte leakage reflects the extent of n ecrosis in leaves. A rapid necr osis in plant tissue and lower populations in leaves compared to a sus ceptible reaction are i ndications of a HR. Therefore, it is reasonable to assume that Xac-Aw causes an HR in grapefruit leaves based on this work. HR is the result of an avirulence ( avr ) gene interacting with a resistance gene (Flor, 1955; Ellingboe, 1976; Klement, 1982; Staskawicz et al. 1984; Crute, 1985; Gabriel et al. 1986). In future work we will determine if an avr gene is involved in this reaction.

PAGE 25

14 0 50 100 150 200 250 300 350 400 02468Time (days)Conductivity (umhos) Xac-AwXac-A Figure 3-1. Electrolyte leakage in grap efruit leaves inoculated with Xac-Aw and Xac-A strains at a concentration of 5x108 cells per milliliter at various times after inoculation. The leaves inoculated with Xac-Aw abscised 6 days after inoculation. Vertical bars represent standard error. 0 2 4 6 8 10 02468 Time (days)Log10 cfu/cm2 Xac-A Xac-Aw Figure 3-2. Internal bacterial populations in grapef ruit leaves inoculated with Xac-Aw and Xac-A strains at various times after i noculation. The leaves inoculated with Xac-Aw abscised 6 days after inoculation. Vertical bars represent standard error.

PAGE 26

15 Figure 3-3: Symptoms of Xac-Aw (left side of leaf) and XacA (right side of leaf) in old (left) and young leaves (ri ght) of grapefruit on the abax ial face of the leaves (Four days after inoculation).

PAGE 27

16 CHAPTER 4 CHANGE OF HOST RANGE BY MUTATION. Introduction Xanthomonas axonopodis pv. citri strain Aw (Xac-Aw) causes a hypersensitive response (HR) in grapefruit leaves. The HR is correlated with the gene-for-gene relationship in many plants. In such gene -for-gene interactions an avirulence ( avr ) gene in the pathogen interacts with a corresponding resistance ( R ) gene in the plant (Minsavage et al., 1990b ). Mutation of an avr gene often leads to a susceptible reaction. Such mutations can occur in high frequency in some strains of Xanthomonas (Dahlbeck and Stall, 1979). The purpose of th is chapter is to determine if a mutation in a postulated avr gene would change the host specificity of the Xac-Aw strain after treatment with a mutagen and if so, to determine the frequency of the mutation. Materials and Methods Inoculum. The Xac-Aw 12879 strain was used because it causes an HR in grapefruit leaves and a suscep tible reaction in leaves of Key lime. The preparation of inoculum was the same as described in Chapter 3. Mutation in vitro The Xac-Aw cells were treated with N-methyl-nitro-Nnitrosoguanidine (NTG), whic h is a strong mutagen (Gerha rdt et al., 1981). A stock solution of NTG containing 1 g/ml in deioni zed water was made and 100 l of stock NTG were added to 900 l of a suspension of 5 x 108 cfu/ml of Xac-Aw cells in sterile tap-water. After 1 h at 28 C the suspension wa s diluted serially ten-fold, and 200 l of a 5 x 103 cfu/ml bacterial suspension were spread onto the surface of nutrient agar in Petri

PAGE 28

17 plates. In previous work (unpublished) the NTG treatment killed ca. 50 % of bacterial cells. After 3 days the colonies were counted to determine the actual concentration of viable cells following treatment with NTG a nd to observe for development of mutant white colonies from the typical yellow col onies. In addition 200 l of a suspension consisting of the 105 cfu/ ml were spread onto nutrient agar containing 200 g/ml streptomycin sulfate to check for growth of colonies resistant to streptomycin. About 30 young grapefruit leaves were comp letely infiltrated with a suspension consisting of 5 X 103 cfu/ml of mutagenized cells. At the same time ten leaves of Key lime were infiltrated with the same inoculum as a control. The leaves used in these experiments were at the same stage of development as described in Chapter 3. The technique used by Klement (1963) was used to infiltrate each leaf w ith inoculum. Lesions in both Key lime and grapefruit were counted and were calculated as lesions per cm2 of inoculated leaf area (Table 4-3). The leaf ar ea of tissue infiltrated was determined using the dot-counting method (Marshall, 1968). Th e mutagenesis experiment was repeated eleven times. Results Mutagenesis. The numbers of Xac-Aw cells remaining after NTG treatment ranged from 0.5 to 3.0 x 108 cfu/ml in the eleven experiments. White colonies developed in five of the experiments in which 103 cfu/ml were spread on NA. Streptomycin-resistant colonies formed in which 105 cfu/ml were spread on NA cont aining streptomycin in only one experiment (Table 4-1). No white colonies of Xac-Aw or streptomycin resistant colonies developed with non-treated suspensi ons. These results were evidence that NTG did cause mutations in the population of Xac-Aw cells used for inoculum.

PAGE 29

18 Change of host range. The Xac-Aw strain caused fleck lesions in grapefruit leaves (Figure 4-1) and typical citrus canker lesions in Key lime (Figure 4-2). Each lesion was probably caused by a single cell of the bacter ium, because of the low inoculum level used. Over the eleven experiments an average of 10.1 canker lesions per cm2 occurred in Key lime and 2.7 fleck lesions per cm2 occurred in grapefruit leaves. Assuming the intercellular spaces on grapefruit and Key lim e leaves were similar, only 27 % of the Xac-Aw cells in grapefruit actually caused a visible fleck lesion. The total area of grapefruit leaves infiltrated with inoculum in the eleven experiments was 20,827 cm2 (Table 4-2). Using the estimate of 10.0 lesions/cm2 based on what occurred in Key lime leaves (Table-4-3), approximately 2.0 x 105 cells of Xac-Aw were infiltrated into grapefruit leaves in th e eleven experiments. Typical citrus canker lesions were never observed in grapefruit leaves receiving the mutagenized cells of XacAw Discussion Cells of Xac-Aw were treated with NTG, a powerful mutagenic agent, to increase the frequency of mutation. The number of wh ite colonies and streptomycin resistant colonies after NTG treatment reflected th e development of mutants in culture. The frequency to streptomycin resist ance in non-mutagenized cultures of X campestris pv. vesicatoria was around 1.9 x 10-9 per cell per divi sion (Dahlbeck and Stall, 1979). In this work, st reptomycin resistant colonies occurred rarely after NTG treatment but did occur in one test and was determined to be approximately one per 105 cells. The frequency of mutation for white co lonies was higher than for streptomycin resistance. At least seven ge nes are involved in the develo pment of the yellow pigment (Poplawsky and Chun, 1997). Mutation in any of them will result in lo ss of pigmentation.

PAGE 30

19 Thus, one would expect a higher frequency of white colonies than streptomycin resistant colonies after NTG treatment. As resistance to streptomycin is encoded by a single gene, the frequency of streptomycin resist ance probably corresponds better to an avr gene mutation, if the change of the host range depends only on a single avr gene. Thus, one would not expect a change of host range of the Xac-Aw strain unless nearly 105 cfu were infiltrated into the leaves of grapefruit. We inoculated grapefruit leaves with 2 x 105 cells and, thus, one would have expected a single av irulence gene to be mutated and detected in our work. However, this did not occur. Therefore, possibly more than one gene is involved in the incompatibility of th e grapefruit leaves to the Xac-Aw strain.

PAGE 31

20 Table 4-1. Effect in vitro of NTG mutagene sis on development of white colonies and streptomycin resistant colonies of Xac-Aw strain ________________________________________________________________________ Expeiment no. Yellow a White b Streptomycin c colonies colonies resistant colonies ________________________________________________________________________ x 108 cfu x 103 x 105 1 3.00 0.00 0.00 2 0.90 0.00 0.00 3 0.68 0.00 0.00 4 1.70 2.00 1.80 5 1.31 0.00 0.00 6 1.99 0.00 0.00 7 2.11 0.00 0.00 8 0.85 3.80 0.00 9 1.75 2.00 0.00 10 0.50 2.00 0.00 11 0.76 0.20 0.00 Average 1.41 0.91 0.16 ________________________________________________________________________ a These values were based on the colonies that developed on nutrient ag ar after dilution to 103 cfu/ml. The values are based on three replicates per experiment. b These values are number of colonies that de veloped on nutrient agar after dilution to 103 cfu/ml. A suspension of 200 l were spread on the plate. Average of three replicates per experiment c There values are number of colonies that developed on nutrient agar containing 200 g of streptomycin per liter. A suspension of 200 l of 105 cfu/ml were spread on the plate. Average of three replicates per experiment.

PAGE 32

21 Table 4-2. Total area of inoculated Key lime and grapefruit leaves in all experiments ________________________________________________________________________ Experiment No Key lime Grapefruit cm2 cm2 ________________________________________________________________________ 1 34.5 711.50 2 60.0 2122.5 3 40.6 1632.6 4 39.5 1136.5 5 379 1853.8 6 246 3115.0 7 32.8 1597.0 8 60.8 1653.3 9 25.6 1263.0 10 51.0 3093.8 11 56.0 2647.5 Total 1025.8 20826.5 ________________________________________________________________________ Table 4-3. Number of lesions per cm2 that were produced in Key lime and grapefruit leaves inoculated with 103 cfu/ml of Xac-Aw ________________________________________________________________________ Numbers of lesion per cm2 Experiment No Key lime a Grapefruitb ________________________________________________________________________ 1 12.5 4.4 2 7.1 1.7 3 3.5 0.9 4 19.6 5.2 5 4.8 2.4 6 11.5 1.1 7 18.2 1.7 8 1.3 0.5 9 15.3 0.4 10 4.5 2.4 11 12.2 8.4 Average 10.1 2.7 a Lesions were typical of citrus canker b Lesions were sunken and very sma ll (typical fleck lesion caused by HR)

PAGE 33

22 Figure 4-1. Symptoms of Xanthomonas axonopodis pv. citri strain Xac-Aw in grapefruit leaf after infiltration with 103 cfu/ml bacterial con centration. Fleck lesions occur on upper half of leaf (30 days after inoculation). Figure 4-2. Symptoms of Xanthmonas axonopodi s pv. citri strain Xac-Aw in Key lime leaf after infiltration with 103 cfu/ml bacterial concen tration. Typical pustule type lesions occur on upper half of leaf (21 days after inoculation).

PAGE 34

23 CHAPTER 5 CHANGE OF HOST RANGE BY CONJUGATION Introduction More than one avr gene may be involved in the h ypersensitive reaction (HR) by the Xac-Aw strain in grapefruit leaves. If that is true, the host specificity of the Xac-Aw strain would not change by simple mutation. However, the factor for host specificity of the Xac-Aw strain might cause the Xac-A strain to ch ange after conjugation of the strains, because large amounts of DNA transfer during conjugation. Conjugation is a process in which the DNA of a donor bacterium moves to a recipient bacterium. Plasmid or chromosomal DNA can move to recipient cells in conjugation. Conjugation requires cell to cell contact and the presence of tran sfer genes in the DNA of the donor. Many avirulence genes involved in host and cultivar specificities (Leyns et al., 1984; Hayward, 1993), and the genes for resistance to copper (Stall et al., 1986) and streptomycin are located on plasmids (Minsavage et al., 1990 a). However, some avirulence genes are located on the chromosome (Ronald and St askawicz, 1988; Tamaki et al., 1988; 1988; Minsavage et al., 1990b; Jenner et al., 1991; Mans field et al., 1994; Whalen et al., 1993; Lorang and Keen, 1995). Horizont al transfer of chromoso mal genes among strains of X. axonopodis pv. vesicatoria was confirmed by Basim et al (1999), but the frequency of transfer of plasmid DNA is usually higher than for chromosomal DNA. Materials and Methods Bacterial strains. All bacterial strains, relevant char acteristics, and origin are listed in Table 5-1.

PAGE 35

24 Change of host range by conjugation. To test for conjugation among strains, genetic markers were incorporated into both Xac-Aw and Xac-A so that each could be used as a donor or recipient. Some strains were marked with fluorescent proteins by G.V. Minsavage (Plant Pathology, Department of University of Florida) using the pMODTM2 vector that carries 19-bp mosaic e nd sequence flanking restriction sites. The antibiotic cassette used in this experime nt was excised from pKRP11 plasmid (KmR) and pKRP13 (SmR SpR). A KmR clone was marked with the EY FP gene with lacZ promoter from pEYFP and a clone that carried the SmR SpR was marked with the ECFP gene with the lacZ promoter from pECFP. The fluorescent-marked strains were obtained by electroporation using EZ::TN transposase enzy me and Biorad Gene Pulser (for more details contact G.V. Minsavage). Strains with antibiotic resistance were se lected after plating 200 l of a culture containing 108-109 cfu/ml onto nutrient agar containing the selective antibiotic. Colonies that developed on the selective medium we re purified by single-c olony selection on the antibiotic medium. Strain s of Xac-A and Xac-Aw containing the GFP in the chromosome or non-pigmented strains obtained in Chapter 4 were sometimes used for selection of antibiotic resistance. Strains were stored at -80 C. The antibiotics used and final concentrations were: rifamicyn (80 g/ml), nalidixic acid (50 g/ml), kanamycin (50 g/ml), streptomycin (50 g/ml), and spectinomycin (50 g/ml). For conjugation on a solid medium, donor a nd recipient strains were grown in nutrient broth (NB) overnight on a rotary shaker at 28 C, after which 100 l of culture was added to 900 l of sterile tap-water and centrifuged. The pellets obtained were resuspended in 100 l of sterile tap-water an d donor and recipient st rains were mixed in

PAGE 36

25 different proportions (10 or 200 l of donor wa s added to 100 l of recipient). Then 10 l of each mixture was plated on nutrient-yeas t-glycerol agar (NYGA), (Daniels, et al., 1984). The same suspensions sometimes were inoc ulated into leaves of grapefruit or Key lime for conjugation. After 48 h each mixture was resuspended in 800 l of sterile tapwater and 400 l was transferred to each of tw o plates of an antibiotic selective medium. For conjugation in liquid medium, bact eria were grown during shaking at 28 C overnight in 4 ml of NB, then donor and reci pient strains were mixe d, and incubated with very gentle shaking for 5 h. Afterward 200 l of the mixture were plated on appropriate selective medium and incubated at 28C fo r 2-3 days until conjugants developed. Sometimes colonies grew on media containing two antibiotics. To test whether the colonies were mutants or conjugants, cells we re observed for the presence of GFP using a UV microscope was performed and PCR with the primers specific for GFP (G.V. insavage). Sometimes they were inoculated into grapefruit leaves for strain identification. To determine if Xac-Aw and Xac-A could act as donors, or recipients in conjugation, experiments were designed for tran sfer of Cu resistance genes which were known to be transferred by conjugation (Basim et al, 1999). Two strains of X. campestris pv vesicatoria (one contained Cu resistance on a plasmid, the other on a chromosome) were mated with Xac-Aw and Xac-A recipient strains and sc reened for transfer of copperresistance genes (Cur). In addition, four Cur Xac-A strains (plasmid-borne Cur) from Argentina and a strain of X. axonopodis pv. citrumelo that was copper resistant were mated with an Xac-A copper sensitive (Cus) strain from Florida. The conjugations using only the strains from Florida were made on solid NYGA medium and the conjugations among strains from Argentina and Florida were made using liquid medium. Copper

PAGE 37

26 resistance was determined by growth on nutri ent agar supplemented with copper sulfate (200 g/ml). The frequency of Cur transfer during conjugati ons was determined from dilution plating of bacteria after matings. Plasmid DNA isolatio n Plasmid DNA was extracted by a modification of the method of Kado and Liu (1981). Detection of plasmids was perfor med by electrophoresis of the plasmid extraction as described pr eviously (Stall et al., 1986). Donors and recipients could be identified by plas mid profiles (Figure 5-1, Lanes 2 and 4). Results Selected Xac-Aw strains were mated with Xac-A strains in all combinations of the donor and recipient. In addition, the Xac-Aw strain was mated with itself and the A strain was also mated with itself. In these tests a marker gene on a chromosome was never transferred by conjugation. Puta tive transconjugants that gr ew on antibiotic media all were negative for transfer of chromosomal genes. The copper resistance genes on a plasmid in Xcv 75-3 were transferred to Xac-A in vitro and in planta in all tests performed; however, thes e copper resistan t genes were transferred to the Xac-Aw strain only one time, and that o ccurred in planta (Figure 5-1). No transfer to either Xac-A or Xac-Aw of the chromosomal Cu genes was observed. Conjugal transfer of Cur genes from copper resistant Xac-A strain from Argentina to copper sensitive Xac-A strain from Flor ida also occurred (F igure 5-2). The copper resistance genes in Xac-A were found to be plasmid-borne (Figure 5-3). The frequency of transfer of the Cur plasmid (per donor cell) was va riable depending on the donor and recipient combination (Table 5-2). The same variability of transfer frequency was observed when the conjugation was made with the Cur and Cus strains from Argentina

PAGE 38

27 (Table 5-3). It is interesting that in this combination, the Xac-A 16 Cur strain was the best donor and had the highest frequency of transfer with the Xac-A 40 Cus strain. However, no transfer was observed with the Xac-A 45 Cur strain used as the donor and with any recipient strain (Table 5-3). When Xcv 75-3 Cur was used as a plasmid donor, the frequency of transfer of Cur genes to Xac-A Cus strains was very high (Table 5-4). When the copper resistant donor, X. axonopodis pv. citrumelo strain (2a, Cur), was mated with Xac-A 20, (Cus), the Cu plasmid was transferred fr om the donor to the Xac-A recipient strain (Lane 12 of the Figure 5-3). Discussion The marker genes developed in these expe riments were probably inserted in the chromosome. The genes for yellow pigmen t had been determined to be in the chromosome (Poplawsky and Chun, 1997). The ma rkers were developed to primarily see if chromosomal movement occurs in Xac-A and Xac-Aw by conjugation. The experiments were designed to have two mark ers in the donor strain, but only one marker was included in the recipient strain. The de velopment of some colonies on selective media after mating was due to mutation for th e donor selective marker in the recipient. The mutants could be detected by the lack of movement of the other chromosomal genes, such as the GFP or pigment genes. Apparently chromosomal movement between strains of Xac is not a significant factor in change of host speci ficities in nature. However, conjugal movement of plasmids between strains of Xac does o ccur. Movement of plasmids among strains of Xac can be particularly significant for the movement of copper resistance genes between strains. Copper is used in the field to control citr us canker and the devel opment of resistance among strains would hinder control. The first re port of copper resistance in strains of Xac

PAGE 39

28 was by Canteros et al. (2004). In the present work we found that the copper resistance genes in strains from Argentina were plas mid borne, which had not been demonstrated previously. Copper resistance among strains of Xac in Florida was not detected when over 100 random strains were screened for resi stance. However, copper resistance was detected in a strain of X. axonopodis pv. citrumelo from Florida (R.E. Stall, personal communication) and the resistance was determ ined to be plasmid-borne and could be transferred by conjugation to an Xac-A Cus strain. Since X. axonopodis pv. citrumelo and Xac-A both cause disease of citrus it is expe cted that cell to cell contact of the two pathovars can occur in nature. If citrus canker were to beco me widespread in Florida and copper is used for control, it would be exp ected that copper resistance strains of Xac-A would be selected quickly in the field. 1 2 3 4 5 Figure 5-1. Agarose gel stained with et hidium bromide. Lanes contain plasmid extractions from different strains: 1= Xcv 75-3 (Cur), 2= Xac-A (1874, GFP+, Cus), 3= Xcv 75-3 x Xac-A (conjugant), 4= Xac-Aw (GFP+ Cus), and 5= Xcv x Xac-Aw (conjugant).Strains in lanes 1, 3, and 5 were resistant to copper and contained a large plasmid (arrow). Th e large plasmid was transferred by conjugation to copper sensitive strains.

PAGE 40

29 1 2 3 4 5 Figure 5-2. Agarose gel stained with et hidium bromide. Lanes contain plasmid extractions from different strains:1= Xac-A (16, Cur), 2= Xac-A (26, Cur), 3= Xac-A (1874, Cus), 4= Xac-A (16) x Xac-A ( 1874) conjugant, and 5= XacA (26) x Xac-A (1874) conjugant. Strain s in lanes 1, 2, 4 and 5 were copper resistant and contained a large plasmid (arrow). The large plasmid from strains 16 and 26 were transf erred to 1874 by conjugation.

PAGE 41

30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Figure 5-3. Agarose gel stained with ethi dium bromide. Lanes contained plasmid extractions from different strains: 1= Xcv 75-3 (Cur) 2= Xac-A 20 (1874, GFP+, Cus), 3= Xcv 75-x Xac-A 20) conjugant, 4=Xac-Aw (GFP+ Cus), 5=Xcv x Xac-Aw ,conjugant, 6=Xac-A (16 Cur), 7Xac=A (26 Cur ), 8= XacA 16 (Cur) x Xac-A 20 (Cus) conjugant 9= Xac-A 26 x Xac-A 20, conjugant, 10= Xac-E (104, Cus), 11= Xac-E (2a, Cur),12= Xac-E (2a x Xac-A 20 ), conjugant, 13= Xac-E (1c Cur), 14= Xac-E (9 a Cur). Strains in lanes 1, 3, 5, 6, 7, 8, 9, 11, 12, 13 and 14 were copper resistant and contained a large plasmid (arrow).

PAGE 42

31 Table 5-1. List of bacterial strain used in chapter 5 ________________________________________________________________________ Designation Relevant characteristics Source ________________________________________________________________________ Xanthomonas axonopodis pv. citri Xac-Aw (12879) GFP+; Kanr Fl. Xac-A 20 (1874 GFP+; Strepr; Rifr;White Fl. Xac-A 20 (1874 GFP-; Rifr ; Specr Fl. Xac-Aw (12879 GFP-; Specr; Rifr Fl. Xac-A 16 (Xc02-1443) Cur Ctes. Xac-A 26 (Xc01-1394-1) Cur Ctes. Xac-A 44 (Xcc03-1338-1-1) Cur Ctes. Xac-A 45 (Xcc03-1639-1-4) Cur Ctes. Xac-A 40 (Xcc03-1633-1) Cus Ctes. Xac-A 40 (Xcc03-1634) Cus Ctes. Xac-A 42 (Xcc03) Cus Ctes. Xanthomonas axonopodis pv. citrumelo Xac-E (104) Cus Ctes. Xac-E (2a) Cur Ctes. Xac-E (1c) Cur Ctes. Xac-E (9) Cur Ctes. Xanthomonas campestris pv. vesicatoria Xcv (75-3) GFP-; Cur (plasmid) Fl. Xcv (XVP26) GFP-; Cur (chromosomal) Fl. ________________________________________________________________________ Xanthomonas axonopodis pv. citri (Xac), Xanthomonas campestris pv. vesicatoria (Xcv), Fl, Florida, provided by Robe rt Stall from DPI Gainesville Fl. collection and Ctes, Corrientes, provided by Nelly Ca nteros from INTA, Bella Vist a, Corrientes, Argentina, Kanamycin resistant (Kanr ), Streptomicyn resistant (Strepr ) Rifamycin resistant (Rifr ), Spectinomycin resistant (Specr ), Copper resistance (Cur); Copper sensitive (Cus). Table 5-2. Frequency of transfer of copper resistance genes among Xanthomonas axonopodis pv citri (Xac-A) after conjugati on in a liquid medium __________________________________________________________________ Donor strain Recipi ent strain Range of frequency of transfer (per donor cell)a ___________________________________________________________________ Xac-A 16 Xac-A 20 3.9 x 10-6 to 1.25 x 10-5 Xac-A 26 Xac-A 20 0 to 1.12 x 10-6 Xac-A 44 Xac-A 20 0 to 8.66 x 10-6 Xac-A 45 Xac-A 20 0 to 4 x 10-7 ________________________________________________________________ a Based on four determinations per donor x recipient combinations.

PAGE 43

32 Table 5-3.Frequency of transfer of c opper resistance genes among strains of Xanthomonas axonopodis pv. citri (Xac-A) after conjugation in a liquid medium ___________________________________________________________________ Donor strain Recipien t strain Range of frequency of transfer (per donor cell)a ___________________________________________________________________ Xac-A 16 Xac-A 40 0 to 2.4 x 10-4 Xac-A 16 Xac-A 41 0 to 5 x 10-5 Xac-A 16 Xac-A 42 0 to 1.82 x 10-9 Xac-A 26 Xac-A 40 0 Xac-A 26 Xac-A 41 0 to 9.09 x 10-9 Xac-A 26 Xac-A 42 0 to 1.3 x 10-5 Xac-A 45 Xac-A 40 0 Xac-A 45 Xac-A 41 0 Xac-A 45 Xac-A 42 0 ________________________________________________________________________ a Based on four tests of conjugation. Table 5-4. Frequency of transfer of copper resistant genes from Xanthomonas campestris pv. vesicatoria (Xcv) to copper sensitive strains of Xanthomonas axonopo dis pv. citri by conjugation on a solid medium ________________________________________________________________________ Donor strain Recipient strain Range of frequency of transfer (per donor cell)a ________________________________________________________________________ Xcv 75-3 Xac-A 40 0 to 2 x 10-4 Xcv 75-3 Xac-A 41 0 to 1.33 x 10-6 Xcv 75-3 Xac-A 42 0 to 1.33 x 10-6 _______________________________________________________________________ a Based on four tests of conjugation.

PAGE 44

33 CHAPTER 6 CLONING AN AVR GENE FROM THE XAC-AW STRAIN Introduction Previously we found no eviden ce for a genetic basis for th e host specific ity of XacAw strains compared to the Xac-A strains. In many cases, however, hypersensitivity of a strain in a particular host is the basis for and is the result of the interaction of an avr gene in the pathogen and a resistance gene in a host. The purpose of this chapter is to provide results of screening a DNA library of Xac-Aw for the presence of avr genes in Xac-Aw that cause a hypersensitivity in grapefruit leaves. Materials and Methods Bacterial strains and media Strains used in this study are listed in Table 6-1. All strains were maintained at -80 C and subc ultured, when needed, on nutrient agar (NA). Rifamycin-resistant strains were obtained by plating 500 l of Xac-Aw strain 12879 at 109 colony-forming units (cfu) /ml onto nutrient agar supplemented with 80 g/ml of rifamycin. Escherichia coli (Ec) strains were cultured on Luria-Bertani medium (Maniatis et. al., 1982). Conj ugations were performed on nut rient-yeast-glycerol agar (NYGA, Daniels et. al., 1984). The antibiotics and concentration used in media were: rifamycin, 75 g/ml; tetracycline, 12.5 g/ml; and kanamycin 5 g/ml. Growth of plants and inoculum preparation Growth of plants and inoculum preparation were the same as described in Chapter 3. Electrolyte leakage determinations. Electrolyte-leakage determinations were made in the same way as described in Chapter 3.

PAGE 45

34 Bacterial growth curves. Bacterial growth curves were obtained in the same way as described in Chapter 3. Recombinant DNA techniques Techniques used for cosmid cloning, enzyme digestion, ligation, Southern transfer, plasmid alkalin e lysis, and agarose gel electrophoresis were describe d by Maniatis et al. (1982). A genomic library of Xac-Aw strain 12879 was constructe d in the vector pLAFR3 as previously described (M etz et al., 2005) and supplied by G. V. Minsavage (Plant Pathology Dept., University of Florida). Indi vidual clones were maintained in Ec DH5 (BRL) and maintained on Luria-Bertani medi um. The helper plasmid pRK2013 in Ec HB 101 was used in conjugations i nvolving tripar ental matings. Individual clones of an Xac-Aw genomic library in Ec DH5 were conjugated into strain 91-118 of X. perforans (Jones et al., 2004). Transconjuga nts were infiltrated into a 1 cm2 area of leaf tissue with a syringe and needle. The recipi ent bacterium is pathogenic to tomato, but causes a null reaction in grap efruit leaves. A clone that caused an HR reaction in both grapef ruit and tomato leaves was det ected by rapid necrosis in the infiltrated area of the leaf. Tomato leaves we re inoculated as a c ontrol, because the XacAw strain also elicits an HR in tomato leaves (Figure 6-1). Grapefruit leaves and tomato leaves were inoculated with ca. 300 transc onjugants individually. Each clone contained approximately a 25-kb fragment of Xac-Aw DNA. Subcloning. A clone, pL799-1 with HR activity in grapefruit, but not tomato was obtained and consisted of about a 25-kb insert of Xac-Aw DNA. This clone was subcloned to contain only DNA necessary for HR activity. In this subcloning, to identify the exact location of the gene in pL799-1, th e transposon pHoGus was used to knock out

PAGE 46

35 the gene responsible for HR activity by the procedure described by Huguet and Bonas, 1997. About 160 kanamycin resistant clones, which contained pHoGus inserts were screened for the lack of HR in grap efruit after they were transferred to X. perforans Three clones were selected for lack of an HR and one clone (pL799-1) was selected from the three for further work. The clone pL7991 was restricted with each of several enzymes to find a fragment that contained the Tn3 insert. A Hin dIII restriction fragment, contained the Tn3 insert and about 3.0 kb of DNA. This fragment was ligated into pBluescript II KS and labeled pBs3.0. A portion of the 3.0 kb insert in pBs3.0 was then sequenced using forward and reverse prim ers from the cloning vector. Custom oligonucleotide primers were designed to complete the sequen cing of the intact Hin dIII fragment. An open reading frame (ORF) was identified in the sequence of the intact Hin dIII fragment. However, the ORF was at the end of the fragment and was not complete. When the intact Hin dIII fragment was ligated into pL AFR6 (pL799-2) and conjugated into X perforans no HR occurred in grapefruit leaves Then primers were selected for sequencing beyond the end of the Hind III fragment in the original clone to obtain the sequence of the complete ORF. Primers were selected from the sequence to amplify by PCR a 2.3-kb fragment containing the comple te ORF, which was then ligated into pGEMT Easy Vector (Promega, Madison, Wisc onsin). The 2.3 kb insert was removed from pGEMT Easy Vector with Eco RI enzyme and then ligated into the vector pUFR043, and designated pU799-3. The pUFR043 co smid was used as a vector because DNA inserts in this vector could be conjugated into strains of Xac-Aw, whereas pLAFR

PAGE 47

36 derivatives could not be tran sferred to strains of Xac-Aw. The pU799-3 in X. perforans caused an HR in grapefruit leaves. The open reading frame was labeled avrGf1. Mutation of avrGfl in Xac-Aw. The avrGf1 gene in Xac-Aw was mutated to investigate the role of the gene in the hos t specificity of the bacterium. Mutation in avrGf1 in pGEMT Easy Vector occurred by inserting an Omega cassette into the gene by the procedure described by Huguet et al., (1998). The inactive gene was exchanged into the Xac-Aw strain by using the suicide vector pOK1. Eventually an Xac-Aw strain with the mutated avr gene was obtained. This strain was labeled Xac-Aw DNA sequence analysis Sequencing of pBluescript cl one pBs3.0 was initiated at the sequencing facility (Unive rsity of Florida, Gainesville, Fl, USA) with the Applied Biosystems model 373 system (Foster City, CA, U.S.A.). To complete sequencing of both strands of DNA, custom primers were sy nthesized at the ICBR facility with an Applied Biosystem model 394 DNA synthesi zer. The computer program SeqAid II version 3.81 was used to analy ze nucleotide sequence data an d predicted protein products of the 2.3 kb region that contained avrGf1 A search for nucleotide and amino acid sequence homology was conducted with th e BLASTN and BLASTP 2.2.11 programs (Altschul et al. 1997). PCR procedure. Based on DNA sequence analysis of the avirulence gene identified in Xac-Aw custom primers were designed to amplify a fragment from the avirulence gene from DNA of xanthomonads that cause di sease in citrus plants. The primers used were forward 5-CGCCG GTTTCTGTCCTGCACTTG-3 and reverse 5GCCGCCTTTGCCATCGACCAG-3. The final product was 199 bp. PCR reactions were performed in a thermocycler (M.J. Research, Watertown, MA, U.S.A.).

PAGE 48

37 Southern hybridization. All hybridization experiments were performed on nitrocellulose membranes using the GENIUS nonradioactive DNA labeling and detection kit according to the manufact urers instructions (Boeheri nger Mannheim Biochemicals, Indianapolis, IN, U.S.A). Genomic D NA extractions were made using the GenomicPrepTM Cells and Tissue DNA Isolat ion Kit (Amersham Pharmacia Biotech, Inc. 800 Centennial Avenue, PO Box 1327 Piscataway, NJ 08855, USA). Plasmid extraction from Xac-A and Xac-Aw strains was as described in Chapter 5. Results Selection of avirulence gene. Three clones were selected that caused rapid necrosis in grapefruit leaves but not in toma to leaves, and three other clones caused rapid necrosis in tomato leaves, but not in grapef ruit. The first three clones were designated pL799-1, pL22, and pL622. All three clones were successfully transferred from E. coli by conjugation into a strain that causes Asia tic citrus canker (Xac-A) in grapefruit and Key lime. Only one of the three clones, pL 799-1, caused an HR in grapefruit leaves when expressed in the Xac-A strain (Figure 6-2). The pL799-1 clone in the Xac-A strain did not cause an HR in Key lime leaves, whic h is typical of the host range of the wild Xac-Aw strain (Figure 6-3). This clone wa s further characterized in this work. To obtain more information about the significance of th e avirulence gene in the host range of Xac-Aw, primer sequences were obtained for amplification of a portion of avirulence genes by PCR from the sequence of the 2.3 fragment in pU799-3. DNA from three Xac-A strains and four Xac-Aw strains was extracted and tested for the presence of the avirulence gene by amplification of DNA with those primer sequences. Amplification of a product of the expected size occurred with all of the Xac-Aw strains, but no amplification of a fragment of the expected size occurred with any Xac-A strain. Using

PAGE 49

38 Southern hybridization with the pU799-3 clone as a probe, the avirulence gene was determined to be present in the Xac-Aw strains but not in the X ac-A strains. In addition, the avirulence gene was not present in strains of the B and C groups of X. axonopodis pv. a urantifolii or in strains of the Xac-A* strains of the Xac gr oup, or in strains of X axonopodis pv. citrumelo (Figure 6-8). The B strain and strains of X. axonopodis pv. citrumelo did not cause rapid necrosis in grapefruit leaves but the C strain did. Also, at least some of the Xac-A* strains also caused ra pid necrosis in grapefruit leaves (Data not presented). Apparently, other avirulence genes may exist in those strains. The avirulence gene ( avrGf1 ) hybridized with Xanthomonas campestris pv. campestris strain 8004 but the restriction pattern was di fferent. Strain 8004 causes ra pid necrosis in grapefruit leaves. The avirulence gene ( avrGf1 ) was located in the chromosome because the plasmid DNA did not hybridize with the avrGf1 probe (Figure 6-8). Comparison of mutated Xac-Aw with the Xac-A and Xac-Aw. The strain XacAw with the mutated avirulence gene was compared with the Xac-A and Xac-Aw strains in inoculation tests in grapefruit leaves. Visually, the symptoms caused by the mutant strain of Xac-Aw were more like the wild-type XacA strain than the wild-type Xac-Aw strain (Figure 6-4 and 6-5). However, the symptoms of the mutated strain were not identical to Xac-A strain. Nevertheless, in activation of the avir ulence gene in Xac-Aw did alter the disease reaction in grapefruit leaves. Growth of the strains in grapefruit leaves was compared. In addition, electrolyte leakage from the leaves inoculated with the strains was determined to differentiate the time to necrosis after inocul ations. In these experiments cultures, of Xac-A 40, Xac-Aw 12879, Xac-A 40 (pU799-3), Xac-Aw and Xac-Aw (pU799-3) were compared.

PAGE 50

39 Illustrations of the results are included in Figures 6-6 and 6-7. Growth of all strains was about equal for the first four days after inoculation. Howeve r, at day six the populations of the strains were different. At day te n the population of the Xac-A strain was the greatest. The population of the Xac-Aw strain was about 1.5 log units lower than the XacA strain. The Xac-Aw strain reached a population inte rmediate between the Xac-A and the Xac-Aw The strains with the pU799-3 cl one had the lowest populations. In electrolyte leakage determinations the Xac-Aw strain and the Xac-A strains with the clone pU799-3 began to increase at day f our compared to that caused by Xac-A and Xac-Aw strains. At day eight the strains with the avirulence gene had significantly greater electrolyte leakage than the strains th at did not contain the avirulence gene. This data confirmed the visual observations of necrosis caused by those strains. DNA sequencing analysis. Sequence analysis of the 2.3 kb fragment in pU799-3 was determined. A 1599 bp nucleotide open reading frame (ORF) was found that was sufficient for avrGf1 activity. The complete sequence of the 2.3 kb, the avrGf1 gene and the primers used to amplify the avrGf1 are shown in the Figure 6-9. The upstream regions of this ORF do not contain a hrp box but do contain an imperfect PIP box TTCGT-N10TTCGC 80 bp upstream of the start codon (Huguet and Bonas, 1997). The GenBank search identified significant homol ogy with a gene in the genome of Xanthomonas campestris pv. campestris (Xcc) str. 8004 (84 % identical). When an alignment was done between the completely se quenced Xcc3600 gene and avrGf1 using the clustal W (1.82) multiple sequence alignment 84.99 % identity was found (Figure 6-10). Discussion A genomic library of an Xac-Aw strain was successfully produced and incorporated into E. coli DH5 For successful screening of the lib rary for avirulence genes one would

PAGE 51

40 normally transfer each clone into a strain that was pathogenic on the plant in question; in this case into a strain of Xac-A. However, in previous experiments the transfer of clones in pLAFR3 cosmid to strains of Xac-A di d not occur at high frequency by triparental matings (G. V. Minsavage, Plant Pathology Dept ., University of Florida, Gainesville). To circumvent this problem the Xac-Aw library was transferred from E. coli to strain 91-118 of X. perforans by triparental conjugations and n early 100 % of the matings were successful. The X. perforans strain contains the hrp genes (Bonas et al., 1991) necessary for transfer of avirulence gene proteins into host cells, so it was thought that an avirulence gene in the genome of Xac-Aw to grapefruit could be found by this procedure. In fact, an avirulence gene in the Xac-Aw library was found. This procedure could possibly be used to locate othe r avirulence genes when transf er of clones to a pathogen occurs very infrequently dur ing triparental matings with E. coli. Three clones from the Xac-Aw library were obtained that produced an HR in grapefruit leaves when expressed in X. perforans When the three clones were transferred to the Xac-A strain only one caused an HR in grapefruit leaves. The two clones that did not cause an HR probably have similar DNA sequences based on restriction enzyme digestion (data not given). On e of the clones, pL22, is bei ng investigated further to determine the reason that no HR occurred in grapefruit when expressed in the Xac-A strain. The clone that was expressed in Xac-A and that caused an HR in grapefruit leaves did not cause an HR in leaves of Key lime. This is the same reaction as the Xac-Aw strain in the two hosts. The importance of the avir ulence gene in determination of the host specificity of the Xac-Aw strain was further investigated by determining the presence of

PAGE 52

41 the gene in other bacterial st rains pathogenic to citrus. This gene was only found in XacAw strains by PCR and Southern hybridization techniques. When the gene was mutated in an Xac-Aw strain the symptoms caused by the mutated strain were similar to those caused by the Xac-A strains. However, the symptoms were not quite the same. In addition the growth of the mutated strain in grapefruit l eaves was significantly greater than the wildtype Xac-Aw strain but lower than the Xac-A st rain. Therefore, the avirulence gene avrGf1 seems to be important in delimiting the pathogenic specificity of the Xac-Aw strain. An assumption could be made that another avr gene exists in the wild type of XacAw that prevents the symptoms of the mutated strain to be equal to as the wild-type XacA strain and also prevents the populations of the two strains from being the same. There could be another avr gene in the genomic library that was not identified because we only screened 300 clones. More clones should be screened to search for another avr gene or host range limiting factor. Clones causing an HR in tomato, but not in grapefruit were also found in the genomic library of Xac-Aw. Wild-type strains of Xac-A and Xac-Aw cause an HR in tomato, but not in leaves of tobacco or pepp er (Figure 6-1). Very little was done with these clones in this work. It would be intere sting to determine if those clones contain an avirulence gene that provides the differential reactions in the three plants.

PAGE 53

42 Figure 6-1. Symptoms caused by Xac-A (left) and Xac-Aw (right) strains in tobacco, tomato, and pepper leaves.

PAGE 54

43 Figure 6-2. Symptoms in grapefruit leaves after infiltration with the following bacterial suspensions: 1= Xac-A 40; 2= Xac-A 40 (pL799-1); 3= Xac-A 40 (pL22); 4= Xac-A 40 (pL622). Figure 6 -3. Symptoms in Key lime leaves after infiltration with different bacterial suspensions: 1= Xac-A 40; 2= Xac-A 40 (pL799-1); 3= Xac-A 40 (pL22); 4= Xac-A 40 (pL622).

PAGE 55

44 Figure 6-4. Symptoms in grapef ruit following inoculation with Xac-A 40 strain (A), XacAw 12879 strain (Aw) and Xac-Aw (3). Figure 6-5. Symptoms in grapefruit after i noculation by needle pricks with Xac-Aw strain 12879 (right top), Xac-Aw (bottom left), and Xac-A 40 (bottom right).

PAGE 56

45 0 1 2 3 4 5 6 7 8 9 10 0246810 Time (Days)Log10 cfu/cm2 leaf Xac-A 40 Xac-Aw Xac-Aw 12879 Xac-A 40 (pU799-3) Xac-Aw (pU799-3) Figure 6-6. Bacterial populations in grapefruit leaves infi ltrated with Xac-A 40; Xac-Aw ; Xac-Aw 12879;Xac-A 40 (pU799-3), Xac-Aw (pU799-3) at various times after inoculation. 0 50 100 150 200 250 300 350 400 450 500 0246810 Time (Days)Conductivity (umhos) Xac-A 40 Xac-Aw Xac-Aw 12879 Xac-A 40 (pU799-3) Xac-Aw (pU799-3)w Figure 6-7. Electrolyte leakage in grapefruit leaves infiltrated with of Xac-A 40, XacAw Xac-Aw 12879, Xac-A 40 (pU799-3), Xac-Aw (pU799-3) at a concentration of 5x108 cells (cfu/ml).

PAGE 57

46 1 2 3 4 5 6 .7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11 1213 14 Figure 6-8. Hybridization of the subclone pU799-3 fragment in avrGf 1 to total genomic DNA of Xanthomonas strains digested whith Hind III. Lanes 1= Xac-Aw; 2= Xac-Aw ; 3= Xac-A 40; 4= Xac-A 306; 5=XacA* 1574; 6=Xac-A* 1575; 7= Xaa-B; 8=Xaa-C; 9= XacE 1887; 10= Xcc 8004; 11= Xac-Aw 12879; 12= plasmid Xac-Aw; 13= Plasmid Xac-A 40; 14= Marker digested with Hind III. Ethidium bromide stained gel on the left Southern blot of gel on the right.

PAGE 58

47 GATCGGCGCCAGGAAGGGCCTGCCATG TCACAACCTGATTCATCTGTGCCAAGACCACCTCGCACCGCGT GCGCGCATGGTGTACTCCGCGTCTCCAAAGAAAGCTGCATCGCCATCTTCCGATTCGGCTCAGTGTGTCTT TTTTGCAAGCGTCTGATGGGGGTTGGAGTTATTCAAGCCTCCCGAGTCAACGTGATGC GGACACGCTTAC ACCAAACCGAAATGCATCGGTCCGCCTGGTGCGATCGCCGAGCTTTCGCACAGCCACTCGTTTGTGACAT CGCTTTTTCGCATTCGAGATGCAGACAGCTCAGGCCTTCAGGAAAAATAGGTCGTCAATCCGGTAGCAGT GAAATACACGGCGTTATATGCACATTTACGTCTTGTCATCCCGATGGCTTGTCGCTCCGGATCGCTGGTAA CTCACCACGGTCGATGAGTGCCGCCAGCCCAGG CACGCACAGTCAACACGGCCTCGCCGCGGACTGATA GCAATCTTCCATGTGATACCCGCAGAGTGGATCGATATGTCGTCGGTAGCGCGCGGCCATGCTTTTCATA GTCCCTATTCCATTCGTCCATCAGCACTTCGCCTAGTCAACAAGCTCCGATGGCTCCGAGCATGCATTCGG CGGCGTCGCCGGTTTCTGTCCTGCACTTGAGAGATACATCC ATGGCTCCGAGCATGCATTCGGCGGCG TCGCCGGTTTC TGTCCTGCACTTGAGAGATACATCCAT GCGCACCAAAGCCCAACTCCCATTGACT GCCATTCAACGGTTTCTTGCCCATGATGCAGCGT CAACGCAGGCCCCCTCTGCATCGGCATCCACA TCGCTCCACAAAAATGAGACCGCAGGCTTGCTGGC AGCCTTGCCAGCGCGAAACGCCAGGCAAGG AGCGCAGAGGAAGTCCGGCGAAAAAGAAG GCGCACGCCAAAACAACGGGGGCCGGGGCGGACAA TGGGCA TCTCGGGCGGCCAAGTACGCCCTGGGAATCGCCGGTGCTGGCTATGTTGCAGACAATTT CGTTCTGTCCACGACATCGCTGGTCGATGGCAAAGG CGGCTTTACCAGTAATGATCGTTTGGATAA AGCATGCGCAAAGGCCGAGACGTATTACGCCCGGTACCACAGTGCCACTGAGGATGAGCGTGCAT CCCATAGCCGCCCCTTTGTACCGATCAGAACGT GCGGTTCCAACCAGTTCGCCACCATGACCGACT ACCGCGCGGCGACCAAGGTCCATGTCGGTCATC TTTTCGACAGCCAAGCCGCGCGCGAATCGCTC GTCACCAACCTCGCCTGCCTCAAGGGCGAGCGGATCAAGCAGGAGTGCATCATCAGGTATGCGCC TGCGCAGGTGCCAGCGGATCCGGACCTAAGCA AGAGCGAGCTGTACGACAGGAAAAACAAGTACT CGTTGGTTGGCATGCCCAACGCCCAAACCGGAGCAAGTGGATATACCTCACGCTCGATCAC CCAGC CCTTCATCAACCGCGGCATGGAGCATTTCAG ACAGGCTTCACAGAGCGACAAGGCACTGTCCCTGA GGCAGTGCATGCAATCGCTTGAACGGGCACTGCAGGACACTGACAAGCTTGGCAAGCAAGCACAG CACGCCGCCGGCCAGGCAATCCT GAATTTCCGGCAGGTCTATGCGGCCGACGAGCATTGGGGTCA CCCGGAGAAAGTCATCATGAAAACCCTGATCGCCAACGGACTGCTATCGCAAGAA CAAACCGACA GGATCGATGCGACCCTGATGTTCGAAGATCCCT CCATCAGTGTCCTGAAAAGAAATACCAGCATCG CCGGACCGTTACTGCAAAAACTGGAAACGAAGATTC AGTCAAAACGTCTGCAGGATCAACCTGAAA CGCTTGCAGACTTCATGGAAATGGCTAAGCAG AAGAACATGGAAGGCCTGCCGATCGCGCACTTC AAACTCAACGCCGAAGGCACCGGTTTTGAAGACTGCTCTGGCCTGGGCG ACTCGTTTACTAGTGCA AATGCCGTTGCATGCATCAACCATGCACGCTTG ATGAGCGGAGAGCCGCGCCTTTCGAAAGAGGA TGTCGGTGTCGTGGTTGCCTGCCTCAATGCTG TATACGACGATGCCAGCAGCATCCGGCACTCGCT TCATGAAATCGCACGCGGATGCTTCGTAGGTG CCGGCTATACAACGGAAGATGCCGATGCGTTCTA TGAGCAGATTTGCAAGGATG CTGCACGGGCATTCTATGCAGG AAAGTCAATGACCAGCAGCGACT AA TCGCCCCCTTCCCACCTCATTGCG CTGACGCAACTTGGCGCCCGGTTGAGG Figure 6-9. Nucleotide sequence of the 2.3 kb fragment of DNA from Xac-Aw containing avrGf1 nucleotide sequencing ( bold letters).The primer sequences used to amplify a fragment of avrGf1 by PCR are underlined. Imperfect PIP-box is shaded in gray.

PAGE 59

48 seq_1 ------------------------------CTGATTTCCGTCCTGCACTCTAGGAGACCC seq_2 ATGGCTCCGAGCATGCATTCGGCGGCGTCGCCGGTTTCTGTCCTGCACT-TGAGAGATAC * **** ********** **** seq_1 ATC-ATGCGAACAAAAACCTCACTGCCGTTGGCCACCGTCCAGCGGCTACTGACCCCTGG seq_2 ATCCATGCGCACCAAAGCCCAACTCCCATTGACTGCCATTCAACGGTTTCTTGCCCATGA *** ***** ** *** ** *** ** *** ** ** *** ** *** ** seq_1 CACCTCCACCGGGTTATCCACCCCCGCGTCGGCGTCAGCCACTCCCTGTGCAGAAACGAC seq_2 TGCAGCGTCAACGCAGGCCCCCTCTGCATCGGCATCCACATCGCTCCACAAAAATGAGAC * * ** ** ** ***** ** * * * *** seq_1 GGCAGGCTTACTGGGAGCGTTGCCAACTCGAAAGAACAAGCAAAAACAGCAAAGCCAGCG seq_2 CGCAGGCTTGCTGGCAGCCTTGCCAGCGCGAAACGCCAGGCAAGGAGCGCAGAG--GAAG ******** **** *** ****** ***** ** **** *** ** seq_1 TCCACCCAATACGCAGGACGGTACACCAAAGAATGGCAGAGACCATGGCGGACAGTGGGC seq_2 TCCGGCGAAAAAGAAGGC--GCACGCCAAA--ACAACGGGGGCCGGGGCGGACAATGGGC *** ** * *** ** ***** * * ** ******** ***** seq_1 AACACGAGCTGCCAAGTACGCTCTTGGCATTGCTGGCGCAGGCTATGTGGCAGACAACTT seq_2 ATCTCGGGCGGCCAAGTACGCCCTGGGAATCGCCGGTGCTGGCTATGTTGCAGACAATTT * ** ** *********** ** ** ** ** ** ** ******** ******** ** seq_1 CTTTCTTTCAACGACCTCGCTCCGCGACGGCAAGGCCGGATTTAGCAGCAATGATCGGCT seq_2 CGTTCTGTCCACGACATCGCTGGTCGATGGCAAAGGCGGCTTTACCAGTAATGATCGTTT **** ** ***** ***** *** ***** *** **** *** ******** seq_1 TGAGAAAGCATGCGTGAAAGCGGAGAGCTATCACGCGCGGTATCACAGCGCTACCGAAGG seq_2 GGATAAAGCATGCGCAAAGGCCGAGACGTATTACGCCCGGTACCACAGTGCCACTGAGGA ** ********** ** ** **** *** **** ***** ***** ** ** ** seq_1 AGAACGCGCATCGCACAGCCGTCCCTTCGTACCGATCAGAACGTGCGGGTCCAACCAGTT seq_2 TGAGCGTGCATCCCATAGCCGCCCCTTTGTACCGATCAGAACGTGCGGTTCCAACCAGTT ** ** ***** ** ***** ***** ******************** *********** seq_1 CGCCACCATGAGCGACTACCGTGCGGCGACCAAGGTTCATATCGGCCACCTCTTCGACAG seq_2 CGCCACCATGACCGACTACCGCGCGGCGACCAAGGTCCATGTCGGTCATCTTTTCGACAG *********** ********* ************** *** **** ** ** ******** seq_1 CCAGCACGCACGGCAATCGCTGCTCACCAACCTTGCCTGCCTCAAGGGCGAGCGCATCAG seq_2 CCAAGCCGCGCGCGAATCGCTCGTCACCAACCTCGCCTGCCTCAAGGGCGAGCGGATCAA *** *** ** ******* ********** ******************** **** seq_1 GGACGAGTGCATTGCCCAGTACGCCCCTACGCATGTCCCGGCCAATCCGGACCTGAGTAG seq_2 GCAGGAGTGCATCATCAGGTATGCGCCTGCGCAGGTGCCAGCGGATCCGGACCTAAGCAA * ******** *** ** *** **** ** ** ** ********** ** seq_1 AAGCCCGCTCTACGAAACCAAGAACAAGTACTCTCTGACCGGCGTACCCAATGCTCAGAC seq_2 GAGCGAGCTGTACGACAGGAAAAACAAGTACTCGTTGGTTGGCATGCCCAACGCCCAAAC *** *** ***** ** *********** ** *** ***** ** ** ** seq_1 CGGTGCAAGCGGATATACCTCACGATCAATCACCCAGCCCTTCATCAATCGCGGCATGCA seq_2 CGGAGCAAGTGGATATACCTCACGCTCGATCACCCAGCCCTTCATCAACCGCGGCATGGA *** ***** ************** ** ******************** ********* Figure 6-10. A lignment between the complete sequence of XCC3600 from Xanthomonas campestris pv. campestris and the avrGf1 using the clustal W (1.82) multiple sequence alignment ( seq_1 xc3600 and seq_2 avrGF1 ). The Xcc 3600 gene and avrGf1 are 84.99 % similar.

PAGE 60

49 seq_1 GCATTTCAAGCAGGATTCCCAGAGCGACAGAGCGTTGTCGCTCAAACAGTGCATGGAATT seq_2 GCATTTCAGACAGGCTTCACAGAGCGACAAGGCACTGTCCCTGAGGCAGTGCATGCAATC ******** **** *** ********** ** **** ** ********* *** seq_1 GCTTGAACGTACACTGGAGGGCGACGACAAACTTGGCAAGCAGGCACAACACGCTGCCGG seq_2 GCTTGAACGGGCACTGCAGGACACTGACAAGCTTGGCAAGCAAGCACAGCACGCCGCCGG ********* ***** *** ***** *********** ***** ***** ***** seq_1 CCAAGCGATCCTGAATTTCCGTCAGGTGTATGCCGCCGACGAGCATTGGGGCCACCCCGA seq_2 CCAGGCAATCCTGAATTTCCGGCAGGTCTATGCGGCCGACGAGCATTGGGGTCACCCGGA *** ** ************** ***** ***** ***************** ***** ** seq_1 AAAAGTCATCATGAAAACGCTGATCGCCAACGGGCTGCTATCGCAGGAGCAAACGGACAG seq_2 GAAAGTCATCATGAAAACCCTGATCGCCAACGGACTGCTATCGCAAGAACAAACCGACAG ***************** ************** *********** ** ***** ***** seq_1 GATCGATGCGACCCTGATGTTCGAAGATCCGTCCATCAGCGTATTGAAAAAAAACACCAG seq_2 GATCGATGCGACCCTGATGTTCGAAGATCCCTCCATCAGTGTCCTGAAAAGAAATACCAG ****************************** ******** ** ****** *** ***** Figure 6-10---continued. Table 6-1. List of bacterial strains used in chapter 6 Bacterium Abbreviation Original strain number Origin X. perforans J.B Jones 91-118 (pL799-1) This work 91-118 (PL799-2) This work 91-118 (pL22) This work 91-118 (pL622) This work Xa pv. citri Xac-A 40 (Xcc03-1633-1) Ctes. Xac-A 40 (pL799-1) This work Xac-A 40 (PL799-2) This work Xac-A 40 (pL22) This work Xac-A 40 (pL622) This work Xa pv. citri Xac-Aw 12879 DPI Xac-Aw (pU799-3) This work Xac-Aw This work Xac-Aw (pU799-3) This work Xa pv. citri Xac-A 306 2422 DPI Xa pv. citri Xac-A* 1974 DPI Xa pv. citri Xac-A* 1975 DPI Xa pv. aurantifolii Xaa-B 1622 DPI Xa pv. aurantifolii Xaa-C 5979 DPI Xa pv. citrumelo Xac-E 1887 DPI Xc pv. campestris Xcc 8004 DPI Xanthomonas axonopodis pv. citri (Xac), Xanthomonas campestris pv. vesicatoria (Xcv), Fl, Florida, provided by Robe rt Stall from DPI Gainesv ille Fl. Collection and Ctes, Corrientes, provided by Nelly Ca nteros from INTA, Bella Vist a, Corrientes, Argentina.

PAGE 61

50 CHAPTER 7 DISCUSSION Many pathogenically different strains of the causal agent of citrus canker ( Xanthomonas axonopodis pv citri and X. axonopodis pv aurantifolii) have been described. These strains sometimes differ ge netically and pathologically. The variation within the strains involved in citrus canke r disease is not unusual. For example, the xanthomonads that cause the bacterial spot di sease of tomato and pepper consist of many strains and some have significant genetic di fferences, resulting in different species of Xanthomonas (Jones et al., 2004). The Xac-Aw strain that was characterized by S un et al. (2004) was found to be a close relative of Xac-A even though they had pathogenic differences (Cubero and Graham, 2002). Contrary to the xanthomonads that cause the bacter ial spot disease of pepper and tomato, there were no reports of a hypersensitive reaction (possible exception Xac-C strain) responsible for host range di fferences. The characte rization of the HR caused by Xac-Aw in grapefruit leaves is new. The Xac-Aw strains presented a problem for th e eradication and regulation program of the Division of Plant Industr y (DPI) for citrus canker (Sun et al., 2004). After careful consideration, DPI decided to destroy only Key lime and alemow plants in a 1900 ft radius, and not other citrus plants, near the focus of disease caused by the Xac-Aw strain. One of the considerations in establishing th e program was the lack of knowledge of the stability of the pathogenicity of the Xac-Aw strain. To obtain information on this problem, we chose three avenues of resear ch. We investigated the frequency of

PAGE 62

51 development of mutants for hos t specificity of the Xac-Aw strain, the transfer of genes by conjugation, and the search of the genome of the Xac-Aw strain for an avirulence gene. We never were able to find a mutant of the Xac-Aw strain that was pathogenic on grapefruit after treatment with the mutage n NTG. However, streptomycin and pigment production mutants of the Xac-Aw strain developed in vitro. The methods used to find mutants pathogenic to grapefruit were used previously with X. campestris pv. vesicatoria to find mutants for virulence on pepper plants with a plant resistance gene (Dahlbeck and Stall, 1979). Mutants for change of race 2 to race 1, which occurred very frequently in X. campestris pv. vesicatoria was due to an insertion element that inactivated an avirulence gene (Kearney et al ., 1990). In addition, inactivation of the avrBs2 gene in X. campestris pv. vesicatoria by several ways makes the pathogen susceptible to plants with the Bs2 gene for resistance. This has occurred freque ntly in the field (Gassmann et al., 2000). Chromosomal genes were also transf erred from donor to recipient in X. campestris pv. vesicatoria by conjugation (Basim, 1999). The hrp genes, which are involved in pathogenicity and hypersensitivity in bacter ia, were transferred in that work. The hrp gene cluster contains ca. 25 kb of DNA. However, it is no t known if the hos t specificity genes in Xac-Aw are in the chromosome or in a plasmid. We did determine that a plasmid can move by conjugation between strains of Xac and this was demonstrated by using copper (Cu) resistant strains. It was determined that Cu resistance genes occur on a plasmid in Xac-A from Argentina and in X. axonopodis pv. citrumelo strains from Florida. The Cu resistance genes from both pa thogens were transferred to Cu sensitive strains. Copper resistance wa s not found in strains of XacA from Florida (R.E. Stall,

PAGE 63

52 personal communication). Copper resistance wa s associated with transfer of a large plasmid. The most important part of this work was that we found an avirulence gene, avrGf1 in the genome of Xac-Aw that interacts with grapefru it leaves to cause an HR. The avr gene was found to be located in the ch romosome. This is the first report of an avirulence gene in the genome of the citrus canker bacterium that functions in citrus. The HR depends on a gene for resistance in gr apefruit, based on the gene-for-gene hypothesis (Minsavage, 1990b). The evidence for a resistance gene in the grapefruit genome will be very difficult to obtain, because crossing be tween susceptible and resistant plants is usually required. Genetic analysis of characteris tics in citrus is difficult (Novelli et al., 2000). Identification of the Xac-Aw strain by the division of plant industry is currently done by inoculation of citrus plants. In addition, the Xac-Aw strain can be identified by serological means in an ELISA test (Sun et al., 2004). The primers selected in the avirulence gene ( avrGf1 ) can also be used to identify the Xac-Aw strain by PCR. The avirulence gene was not found in other stra ins of xanthomonads pathogenic to citrus. The regulation and eradication procedures of the Division of Plant Industry were probably correct for the Xac-Aw strain. The factors for host specificity of the Xac-Aw strain seem to be quite stable based on this work. Even if the single avrGf1 gene is responsible for host specificity, inac tivation of the gene in the Xac-Aw genome does not appear to be of a high frequency as occurs with avr genes in X. campestris pv. vesicatoria (Dahlbeck and Stall, 1979) One should note, however, that the frequency of inactivation

PAGE 64

53 of avrGf1 could change with the in troduction of an insertion sequence (Kearney et al., 1990). The stability of the host specificity of the Xac-Aw strain could be the result of the presence of a second avr gene in wild Xac-Aw. The fact that we did not obtain mutants that were pathogenic to grapefruit when the cells of Xac-Aw were treated with the mutagen NTG (Chapter 4) would support this If only one gene was present, mutants should have been found. If two genes were present in Xac-Aw, each of which was important in susceptibility to grapefruit, one would not expect to find pathogenic mutants after treatment with a mutage n. Other evidence for another avr gene in Xac-Aw was that there were differences in populations and symp toms for the Xac-A strain with the mutant lacking a functional avrGf1 in comparison with the wild-type Xac-A.

PAGE 65

54 LIST OF REFERENCES Altschul, S.F., Madden, T.L., Schffer, A. A., Zhang,J., Zhang,Z., Miller,W. and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389. Basim, H., Stall, R.E., Minsavage, G.V ., and Jones, J.B. 1999. Chromosomal gene transfer by conjugation in the plant pathogen Xanthomonas axonopodis pv. vesicatoria Phytopathology 89: 1044-1049. Belasque, J., Jr., Parra-Pedrazzoli, A.L., Rodr igues Neto, J., Yamamoto, P.T., Chagas, M. C.M., Parra, J. R.P., Vinyard, B.T., and Ha rtung, J. S. 2005. Adult citrus leafminers (Phillocnitis citrella ) are not efficient vectors for Xanthomonas axonopodis pv. citri. Plant Dis. 89: 590-594. Bonas, U., Schulte, R., Fenselau, D., Minsav age, G.V, Staskawicz, B. and Stall, R.E 1991. Isolation of a cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypers ensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4: 81-85. Canteros, B.I., Rybak, M., Naranj o, M., Gochez, A.; Minsavage, G.; Jones, J., and Stall, R.E. 2004. Caracterizacin molecular de la resistenci a al cobre en Xanthomonas axonopodis pv. citri CD Resmenes de los trabaj os presentados. XV Reunin de Comunicaciones Cientficas y Tcnicas. Corrientes, 4-6 Agosto 2004 FCA UNNE. Resumen P020. Cook, A.A., and Stall, R.E. 1968. Effect of Xanthomonas vesicatoria in loss of electrolytes from leaves of Capsicum annuum Phytopathology 58: 617-619. Crute, I.R. 1985. Mechanisms of Resistance to Plant Diseases, ed, Fraser R, S.S. (Nijhoff & Junk, Dordrecht, The Netherlands), pp. 80-142. Cubero, J., and Graham, J. H. 2002. Genetic relationship among wo rldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their identification by PCR. Appl. E nviron. Microbiol. 68:1257-1264. Cubero, J., and Graham J.H. 2004. The le ucine-responsive regulatory protein ( Irp ) gene for characterization of the relationship among Xanthomonas species. Int. J. Syst. Evol. Microbiol. 54: 429-437. Dahlbeck, D., and R.E. Stall 1979. Mutati ons for change of race in cultures of Xanthomonas vesicatoria. Phytopathology 69: 634-636.

PAGE 66

55 Daniels, M.J., Barber, C.E., Turner, D.C., Cleary, W.G., and Sa wzyc, M. 1984. Isolation of mutants of Xanthomonas campestris showing altered pat hogenicity. J. Gen. Microbiol. 130: 2447-2455. Dopson, R.N. 1964. The eradication of citrus canker. Plant Dis. 48:30-31. Ellingboe, A.H. 1976 Genetics of host-parasite intera ctions. In Physiological Plant Pathology (Encyclopedia of Plant P hysiology, New Series, vol. 4), pp. 761. Edited by R. Heitefuss & P. H.Williams. Berlin: Springer. Flor, H.H. 1955. Host-parasite in teraction in flax rust-its ge netics and other implications. Phytopathololy 45: 680-685. Gabriel, D.W., Burges, A., and Lazo, G.R. 1986. Gene-for-gene recognition of five cloned avirulence genes from Xanthomonas campestris pv. malvacearum by specific resistance genes in cotton. Proc. Natl. Acad. Sci. USA 83: 6415. Gabriel, D.W., Kingsley, M.T., Hunter, J.E ., and Gottwald, T., 1989. Reinstatement of Xanthomonas citri ( ex Hasse) and X phaseoli ( ex Smith) to species and reclassification of all X campestris pv. citri strains. Int. J. Syst. Bacteriol. 39: 1422. Garnsey S.M., DuCharme, E.P., Lightfield J. W., Seymour, C.P., and Griffiths J.T. 1979. Citrus canker. Preventive action to protect the U.S. citrus industry. The Citrus Industry. pp. 5-14. Gassmann, W., Dahlbeck, D., Chesnokova, O., Mins avage, G.V., Jones, J. B., Staskawicz B.J. 2000. Molecular evolution of viru lence in natural field strains of Xanthomonas campestris pv. vesicatoria J. Bacteriol. 182: 7053. Gerhardt, P., Murray, R.G.E., Costilow, R.N ., Nester, E.W., Wood, W.A., Krieg, N.R. and Phillips, G.B., Editors, 1981. Manual of Methods for Gene ral Bacteriology. American Society for Microbio logy. Washington, DC pp. 226. Goto, M., Takemura, I., and Yamanaka K. 1979. Leakage of electrolytes and amino acids from susceptible and resistant ci trus leaf tissues infected by Xanthomonas citri Ann. Phytopath. Soc. Japan 45: 625-634. Gottwald, T.R., Graham, J.H., and Schubert, T. S. 1997a. An epidemiological analysis of the spread of citrus canker in urban Miami, Florida, and synergistic interaction with the Asian citrus leafmi ner. Fruits 52: 371-378. Gottwald, T.R., Graham, J.H., and Schubert, T.S. 1997b. Citrus canker in urban Miami: An analysis of spread and prognosis for the future. Citrus Industry 78: 72-78. Gottwald, T.R., Graham, J.H., and Schubert, T. S. 2002a. Citrus canker: The pathogen and its impact. Online. Plant Health Progress doi:10.1094/PHP-2002-0812-01-RV.

PAGE 67

56 Gottwald, T. R., Sun, X, Riley, T., Graham, J. H., Ferrandino, F., and Taylor, E.L. 2002b. Geo-referenced spatiotemporal analysis of the urban citrus canker epidemic in Florida. Phytopathology. 92: 361-377. Graham, J.H., and Gottwald, T.R. 1990. Variation in aggressiveness of Xanthomonas campestris pv. citrumelo associated with citrus bact erial spot in Florida citrus nurseries. Phytopathology: 80: 190-196. Graham, J.H., and Gottwald, T.R. 1991. Research perspectives on eradication of citrus bacterial disease in Florida. Plant Dis. 75: 1193-1200. Graham, J. H., Gottwald, T. R., C ubero, J. and Achor, D. S. 2004. Xanthomonas axonopodis pv. citri : factors affecting successful eradication of citrus canker. Molecular Plant Pathology. 5: 1-15 Hartung J. S., and Civerolo, E. L. 1989. Re striction fragment length polymorphims distinguish Xanthomonas campestris strains isolated from Florid a citrus nurseries from Xanthomonas campestris pv. citri. Pa ges 503-508 in: Proc 7th Int. Conf. Plant Path. Bacteria, Akademiai Kiado, Budapest, Hungary. Hayward A. C. 1993. The hosts of Xanthomonas Pages 1-19 in Xanthomonas J. G. Swings and E.L. Civerolo, eds. Chapman & Hall, London. Hibberd, A. M., Stall, R. E., and Bassett, M. J. 1987. Different phenotypes associated with incompatible races and resistance gene s in bacterial spot disease of pepper. Plant Dis. 71: 1075-1078. Huguet, E. and Bonas, U. 1997. hrpF of Xanthomonas campestris pv. vesicatoria encodes an 87-kDa protein wi th homology to NolX of Rhizobium fredii. Mol. Plant Microbe Interact. 10: 488-498. Huguet, E, Hahn, K, Wengelnik, K., and U. Bonas U. 1998. hpaA mutants of Xanthomonas ampestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensi tive reaction. Molecu lar Microbiology 29:1379-1390. Jenner, C., Hitchin, E., Mansfi eld, J., Walters, K., Betteridge, P., Teverson, D. Taylor, J. (1991). Gene-for-gene in teractions between Pseudomonas syringae pv. phaseolicola and Phaseolus. Mol PlantMicrobe Interact. 4: 553-562. Jones, B.J., Lacy, G.H., Bouzar, H., Stall, R.E., and Schaad, N.W. 2004. Reclassification of the xanthomonads associated with bact erial spot disease of tomato and pepper. System. Appl. Micr obiol., 27: 755-762. Kado, C.I., and Liu, S.T. 1981. Rapid procedure for detection and isol ation of large and small plasmids. J. Bacteriol. 145: 1365-1373.

PAGE 68

57 Kearney, B., and B.J. Staskawicz 1990. Characterization of IS416 and its role in bacterial spot disease of pepper and toma to. J. Bacteriol. 172: 143-148. Klement, Z. 1963. Rapid detection of the pathogenicity of phytopathogenic pseudomonads. Nature 199: 299-300. Klement, Z. 1982. Hypersensitivity. In Phytopathogenic Prokaryotes vol. 2, pp. 149 177. Edited by M. S. Mount & G. H. Lacy. New York: Academic Press. Koizumi, M. 1985. Citrus canker: The world si tuation. Pages 2-7 in: Citrus Canker: An International Perspective. L. W. Timmer, ed. Citrus Research & Education Center, University of Florida, Lake Alfred. Leyns, F., DeCleene, M., Swings, J.G., a nd De Ley, J. 1984. The host range of genus Xanthomonas Bot. Rev. 50: 308-356. Lorang, J.M., and Keen, N.T. 1995. Characterization of avrE from Pseudomonas syringae pv. tomato : a hrp -linked avirulence locus consisting of at least two transcriptional units. Mol. Pl ant-Microbe Interact. 8: 49-57. Loucks, K.W. 1934. Citrus canker and its eradication in Florida. (Unpublished manuscript. Original copy in the files of the Division of Plant Industry, Florida Department of Agriculture, Gainesville). Mansfield, J., Jenner, C., Hockenhull, R., Bennett, M.A., and Stewart, R. 1994. Characterization of avrPphE, a gene for cultivar-specific avirulence from Pseudomonas syringae pv. phaseolicola which is physically linked to hrpY, a new hrp gene identified in the halo-blight bacter ium. Mol. Plant-Microbe Interact. 7: 726-739. Maniatis, T., Fritsch, E.F., and Sambr ook, J. 1982. Molecular cloning: A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 545 pp. Marshall, J.K. 1968. Methods for leaf area meas urement of large and small leaf samples. Phytosynthetica 2: 41-47. McEver, K. 2005. Canker eradication costl y, but effective. Citrus & Vegetable Magazine. pp. 13. McLean, F.T. 1921. A study of the stomata of two species of citrus in relation to citrus canker. Bul. Torr. Bot. Club 48: 101-106. Metz, M., Dahlbeck, D., Morales, C., Al Sady, B., Clark, E., and Staskawicz, B. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthamiana The Plant Journal 41: 801-814.

PAGE 69

58 Minsavage, G.V., Canteros, B. I. and Stall, R. E. 1990a. Plasmid-mediated resistance to streptomycin in Xanthomonas campestris pv. vesicatoria Phytopathology 80: 719723. Minsavage, G.V., Dahlbeck, D., Whalen, M.C ., Kearney, B., Bonas, U., Staskawicz, B.J. and Stall, R.E. 1990b. Gene-for-gene relations hips specifying disease resistance in Xanthomonas campestris pv. vesicatoria -pepper interactions. Mol. PlantMicrobe Interact. 3: 41-47. Novelli, V.M., Machado, M.A., and Lopes, C.R. 2000. Isoenzymatic polymorphism in Citrus spp. and Poncirus tr ifoliata (L.) Raf. (Rutaceae). Genet. Mol. Biol.23:163168. Poplawsky, A.R and Chun W., 1997. pigB determines a diffusible factor needed for extracellular polysaccharide slime and xanthomonadin production in Xanthomonas campestris pv. campestris J. Bacteriol. 179: 439-444. Ronald, P.C., and Staskawicz B. 1988.The avirulence gene avrBs1 from Xanthomonas campestris pv. v esicatoria encodes a 50-kD protein. Mol. PlantMicrobe Interact 1: 191. Rossetti, V.E. Feichtenberger, and M.L. Silveira 1982. Citrus Canker: An analytical bibliography. Instituto Biologico, Sao Paulo. 230 p. Schoulties, C.L., Civerolo, E.L, Miller, J.W. Stall, R.E., Krass, C.J., Poe, S.R and DuCharme,. E.P. 1987. Citrus canker in Florida. Plant Dis. 71: 388-395. Schubert, T. S., Miller, J. W., and Gabrie l, D.W. 1996. Another outbreak of bacterial canker on citrus in Florida. Plant Dis. 80:1208. Schubert, T. S., Rizvi, S. A., Sun, X. A., Gottwald, T.R., Graham, J. H, and Dixon,. W. N. 2001. Meeting the challenge of eradicat ing citrus canker in Florida-again. Plant Dis. 85: 340-356. Stall, R.E. and E. L. Civerolo 1991. Research relating to the recent outbreak of citrus canker in Florida. Annu. Rev. Phytopathology 29: 399-420. Stall, R.E., Loschke, D.C., and Jones, J. B. 1986. Linkage of copper resistance and avirulence loci on self-transmissible plasmid in Xanthomonas campestris pv. vesicatoria Phythopathology 76: 240-243. Stall, R.E., Marco, G.M., and Canteros de Echenique, B. I. 1982a. Importance of mesophyll in mature-leaf resistance to citrus canker. Phytopathology 72: 10971100. Stall, R.E., Miller, J.W., Marco, G.M., and Canteros, B.I. 1982b. Pathogenicity of three strains of the citrus canker organism on grapefruit. Fifth Int. Conf. Plant Path. Bacteria Proc. CIAT. Cali, Colombia pp 334-340.

PAGE 70

59 Stall, R.E. and C.P. Seymour. 1983. Canker, a threat to citrus in the Gulf-Coast States. Plant Dis. 67: 581-585. Staskawicz, B.J., Dahlbeck, D., and Keen, N.T. 1984. Cloned avirulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max (L.) Merr. Proc. Natl. Acad. Sci. USA 81: 6024-6028. Sun, X., Stall, R.E., Jones, J.B., Cubero, J., Gottwald, T.R., Graham, J.H., Dixon, W.N., Schubert, T.S., Chaloux, P.H., Stromberg, V. K., Lacy, G.H. and Sutton, B.D. 2004. Detection and characterizati on of a new strain of citr us canker bacteria from Key/Mexican lime and Alemow in Sout h Florida. Plant Dis. 88: 1179-1188. Tamaki, S., Dahlbeck, D., Staskawicz, B.J. and Keen, N.T. 1988. Characterization and expression of two avirulence genes cloned from Pseudomonas syringae pv. glycinea J Bacteriol 170, 4846-4854. USDA, Statistical Service, 2004. United States Department of Agriculture. National Agricultural Statistics Service. Citrus Fr uits 2004 Summary Agri cultural Statistics Board September 2004 1 NASS, USDA. Vauterin, L., Hoste, B., Kersters, K., and Swings, J. 1995. Re classification of Xanthomonas Int. J. Syst. Bacteriol. 45: 472-489. Vauterin, L., Swings, J., Kersters, K., Gilli s, M., Mew, T.W., Schroth, M.N., Palleroni, N.J., Hildebrand, D.C., Stead, D.E., Civero lo, E.L., Hayward, A.C., Maraite, H., Stall, R.E., Vidaver, A.K. and Br adbury, J.F. 1990. Towards an improved taxonomy of Xanthomonas Int. J. Syst. Bact eriol. 40: 312-316. Vauterin L., Yang P., Hoste B., Vancanneyt M., Civerolo E.L., Swings J. and Kersters K. 1991. Differentiation of Xanthomonas campestris pv. citri strains by sodium dodecyl sulfate-polyacry lamide gel electrophoresis of proteins, fatty acid analysis, and DNA-DNA hybridization. Int. J. of Syst. Bacteriol. 41: 535. Verniere, C., Hartung, O.P. Pruvost, E.L., Civerolo, A.M. Alvarez, P. Maestri, and Luisetti, J. 1998. Characte rization of phenotypically distinct strains of Xanthomonas axonopodis pv. citri from Southwest Asia. European Journal of Plant Pathology. 104: 477-487. Viloria, Z., Drouillard, D.L., Graham, J.H, and Grosser J.W. 2004. Screening triploid hybrids of Lakeland limequat for resistance to citrus canker. Plant Dis. 88: 1056-1060.

PAGE 71

60 Whalen, M.C., Wang, J.F., Carland, F.M., He iskell, M.E., Dahlbeck, D., Minsavage, G.V., Jones, J.B., Scott, J.W., Stall, R.E., and Staskawicz, B.J. 1993. Avirulence gene avrRxv from Xanthomonas campestris pv. vesicatoria specifies resistance on tomato lines Hawaii 7998. Mol. Plan t-Microbe Intera ct. 6: 616-627. Young, J.M., Bradbury, J.F., Gardan, L., Gvozdy ak R.I., Stead, D.E., Takikawa, Y., and Vidaver, A.K., 1991. Comment on the reinstatement of Xanthomonas citri ( ex Hasse 1915) Gabriel et al 1989 and X phaseoli ( ex Smith 1897) Gabriel et al 1989: indication of the need for minimal standards for the genus Xanthomonas Int. J. Syst. Bacteriol. 41: 172-177.

PAGE 72

61 BIOGRAPHICAL SKETCH Myrian Rybak was born in Leandro N. Al em, Misiones, Republic a Argentina, on June 29, 1967. She is the daughter of Veronica Kuyesen and Jose Rybak. Myrian graduated from the Nacional Univ ersity of the Northeast in Corrientes, Argentina, in 1992 with the Agricultural Engi neer degree. In 1993 sh e began to work in the National Institute of Agricultural T echnology (INTA). In April-May of 1995 Myrian was awarded a fellowship of Rotary Inte rnational, Exchange Study Groups (IGE), Mexico. In 1998 she was awar ded a fellowship to pursue graduate studies in the University of La Plata, La Plata, Buenos Aires, Argentina. She graduated with the masters degree in 2000. In 2001 she was awarded a fellowship from INTA-FULBRIGHT to pursue graduate studies in the United States. Myrian enrolled at the Univer sity of Florida in Fall 2001 with Dr. Jeffrey Jones as her adviser. She is currently a candidate fo r the degree of Doctor in Philosophy. At the end of her studies she will resume her position in INTA, Argentina. Myrian was awarded the Francis Aloysius Wood Memorial Award in recognition of outstanding graduate student research in p lant pathology at the College of Agricultural and Life Sciences, on March, 2005. Myrian is a member of Argentinean Society of Horticulture (ASHAO), International Society of Citriculture (ISC), Professional Council of Agricultural Engineer s (CPIA) and American Phytopathological Society (APS)


Permanent Link: http://ufdc.ufl.edu/UFE0011522/00001

Material Information

Title: Genetic Determinants of Host Range Specificity of the Wellington Strain of Xanthomonas axonopodis pv. citri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011522:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011522/00001

Material Information

Title: Genetic Determinants of Host Range Specificity of the Wellington Strain of Xanthomonas axonopodis pv. citri
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011522:00001


This item has the following downloads:


Full Text











GENETIC DETERMINANTS OF HOST RANGE SPECIFICITY OF THE
WELLINGTON STRAIN OF Xanthomonas axonopodis pv. citri
















By

MYRIAN ASUCENA RYBAK


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Myrian Asucena Rybak


























To God my guide and fortitude















ACKNOWLEDGMENTS

I wish to express my thanks and compliments to the chairman of my supervisory

committee, Dr. Jeffrey B. Jones, for his encouragement and guidance. I also want for to

thank the members of my committee, Dr. James Graham and Dr. Gloria Moore for their

critical reading of the manuscript and for their helpful suggestions

My most considerable debt is to Dr. Robert E. Stall who was generous with his

time and expertise in this research. His knowledge, patience and constant support were

equally important to the completion of this manuscript. My appreciation and gratitude go

to him now and always.

Special thanks go to Mr. Jerry Minsavage for his indispensable help; he generously

donated many hours of his valuable time with his technical assistance.

I owe gratitude to the Plant Pathology Department at the University of Florida;

especially I want to thank the members of our laboratory that I met between 2001-2005.

Sincere gratitude is extended to the faculty staff members and other people in Fifield Hall

for their assistance and friendship.

I would like to thank friends and relatives in Argentina, especially Dr. Nelly

Canteros; her guidance and useful advice will be always appreciated.

My family helped and their faith kept me going though some pretty hard times. I

would particularly like to acknowledge Raquel, my dear sister and friend, and my

wonderful mother Veronica, my sisters and brothers, nieces and nephews and thanks go

to the memory of my father for his example and integrity.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .................. .................. .................. ........... .............. vii

LIST OF FIGU RE S ................ ............................ ............ ........... .......... viii

ABSTRAC T ................. .............. ........................................ .................. x

CHAPTER

1 IN TR O D U C TIO N ......................................................................... .... .. ........

2 L IT E R A TU R E R E V IE W .................................................................... ....................4

3 EVIDENCE FOR HYPERSENSITIVITY REACTION IN XAC-Aw STRAIN IN
G R A PEFR U IT ........................................................................... .. 10

In tro d u ctio n ...................................... ................................................ 10
M materials and M methods ........................................................................ .................. 10
R e su lts ...........................................................................................1 2
D isc u ssio n .............................................................................................................. 1 2

4 CHANGE OF HOST RANGE BY MUTATION. ................................................ 16

In tro d u ctio n ............................................................................................................ 1 6
M materials and M methods ........................................................................ .................. 16
R e su lts ...........................................................................................1 7
D isc u ssio n .............................................................................................................. 1 8

5 CHANGE OF HOST RANGE BY CONJUGATION....................................23

Intro du action ...................................... ................................................ 2 3
M materials and M methods ........................................................................ ..................23
R e su lts ...........................................................................................2 6
D isc u ssio n .............................................................................................................. 2 7

6 CLONING AN A VR GENE FROM THE XAC-Aw STRAIN...............................33

Introduction............................................................... 33


v









M materials and M methods ........................................................................ ..................33
R e su lts ...........................................................................................3 7
D isc u ssio n .............................................................................................................. 3 9

7 D IS C U S S IO N .............. ..... ............ ................. ............................................ 5 0

LIST OF REFERENCES .......................... ..................54

B IO G R A PH IC A L SK E T C H ........................................................................................ 61
















LIST OF TABLES


Table pge

4-1 Effect in vitro of NTG mutagenesis on development of white colonies and
streptomycin resistant colonies of Xac-A" strain................. ................ ............20

4-2 Total area of inoculated Key lime and grapefruit leaves in all experiments...........21

4-3 Number of lesions per cm2 that were produced in Key lime and grapefruit leaves
inoculated with 103 cfu/m l of Xac-A" ................................. .. ....... ...............21

5-1 List of bacterial strain used in chapter 5 ...................................... ............... 31

5-2 Frequency of transfer of copper resistance genes among Xanthomonas
axonopodis pv. citri (Xac-A) after conjugation in a liquid medium........................31

5-3 Frequency of transfer of copper resistance genes among strains of Xanthomonas
axonopodis pv. citri (Xac-A) after conjugation in a liquid medium........................32

5-4 Frequency of transfer of copper resistant genes from Xanthomonas campestris
pv. vesicatoria (Xcv) to copper sensitive strains of Xanthomonas axonopodis pv.
citri by conjugation on a solid medium ...................................... ...............32

6-1 List of bacterial strains used in chapter 6 ..... ......... ........................................ 49















LIST OF FIGURES


Figure pge

3-1 Electrolyte leakage in grapefruit leaves inoculated with Xac-Aw and Xac-A
strains at a concentration of 5x108 cells per milliliter..............................................14

3-2 Internal bacterial populations in grapefruit leaves inoculated with Xac-Aw and
Xac-A strains at various times after inoculation. ............................................ 14

3-3 Symptoms of Xac-Aw (left side of leaf) and Xac-A (right side of leaf) in old
(left) and young leaves (right) of grapefruit ........................................................15

4-1 Symptoms of Xanthomonas axonopodis pv. citri strain Xac-Aw in grapefruit
leaf after infiltration with 103 cfu/ml bacterial concentration ...............................22

4-2 Symptoms ofXanthmonas axonopodis pv. citri strain Xac-Aw in Key lime leaf
after infiltration with 103 cfu/ml bacterial concentration.........................................22

5-1 Agarose gel stained with ethidium bromide. Lanes contain plasmid extractions
from different strains .............................................................. .. ........ ........ 28

5-2 Agarose gel stained with ethidium bromide. Lanes contain plasmid extractions
from different strains:1= Xac-A (16, Cur), 2= Xac-A (26, Cur), 3= Xac-A
( 1 8 7 4 C u s)...................................................................... 2 9

5-3 Agarose gel stained with ethidium bromide. Lanes contained plasmid extractions
from different strains: 1= Xcv 75-3 (Cur) 2= Xac-A 20 (1874, GFP+, Cus), 3=
X cv 75-x X ac-A 20) ................................................................... ........ ......30

6-1 Symptoms caused by Xac-A (left) and Xac-Aw (right) strains in tobacco, tomato,
and pepper leaves. ........................ .... .................. .. .... ..... .. ............42

6-2 Symptoms in grapefruit leaves after infiltration with the bacterial suspensions.....43

6 -3 Symptoms in Key lime leaves after infiltration with different bacterial
suspensions..................................................... .......................... 43

6-4 Symptoms in grapefruit following inoculation with Xac-A 40 strain (A), Xac-Aw
12879 strain (A") and X ac-Aw Q (3)..................................... ....................... 44









6-5 Symptoms in grapefruit after inoculation by needle pricks with Xac-Aw strain
12879 (right top), Xac-Aw Q (bottom left), and Xac-A 40 (bottom right) ..............44

6-6 Bacterial populations in grapefruit leaves infiltrated with Xac-A 40; Xac-A" 0;
Xac-Aw 12879;Xac-A 40 (pU799-3), Xac-A" 0 (pU799-3)...............................45

6-7 Electrolyte leakage in grapefruit leaves infiltrated with of Xac-A 40, Xac- A"O,
Xac-Aw 12879, Xac-A 40 (pU799-3), Xac-Aw" (pU799-3) ...................................45

6-8 Hybridization of the subclone pU799-3 fragment in avrGfl to total genomic
DNA of Xanthomonas strains digested with HindI ...........................................46

6-9 Nucleotide sequence of the 2.3 kb fragment of DNA from Xac-AW containing
avrGfl nucleotide sequencing (bold letters) ................................. ................47

6-10 Alignment between the complete sequence of XCC3600 from Xanthomonas
campestris pv. campestris and the avrGfl .................................... ............... 48















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

GENETIC DETERMINANTS OF HOST RANGE SPECIFICITY OF THE
WELLINGTON STRAIN OF Xanthomonas axonopodis pv. citri

By

Myrian Asucena Rybak

August 2005

Chair: Jeffrey B. Jones
Major Department: Plant Pathology

A new strain of the citrus canker bacterium (Xanthomonas axonopodis pv. citri)

was detected in Florida. It was significant in that it was primarily pathogenic on Key lime

trees, but not on grapefruit trees. This strain has been designated as Xac-A". This strain

has caused concern among regulators with regard to how to treat this bacterium in the

eradication program. Of major concern was the stability of the bacterium in regard to host

specificity of the strain; for example, could the strain mutate to attack grapefruit and

other citrus plants. We investigated the frequency of the development of mutants, the

transfer of genes by conjugation, and the presence of an avirulence gene to grapefruit in

the genome. We never were able to find a mutant, either natural or induced, that changed

host range. In conjugation studies, transfer of marker genes on the chromosome to and

from the Xac-Aw strain by conjugation was not successful. In an attempt to locate

possible avirulence genes, a genetic library of Xac-Aw DNA was made using the pLAFR

vector and transformed into Escherichia coli. This library was transferred to strain 91-









118 of X perforans, which is pathogenic to tomato, but causes a null reaction in

grapefruit leaves. The transconjugants were screened for HR in grapefruit leaves. The

inoculated leaves were observed for development of an HR in the infiltrated area. In the

screening of the Xac-Aw genomic library we found an avirulence gene in the genome of

Xac-Aw that interacts with grapefruit leaves to cause an HR. This is the first report of an

avirulence gene in the genome of a citrus canker bacterium that interacts with a citrus

species. This gene was designated as avrGfl, was sequenced, and then was characterized.

The possibility of a second avr gene exists in the Xac-Aw strain, because the Xac-A"w

lacking a functional avrGfl did not cause exactly the same symptoms and develop the

same population as the wild-type Xac-A strain when it was inoculated into grapefruit

leaves.














CHAPTER 1
INTRODUCTION

Citrus production in Florida contributes greatly to the economy of the state.

Production for the 2003-04 seasons totaled 16.4 million tons from 679,000 acres of trees.

Florida accounted for 79 percent of the total U.S. citrus production, followed by

California with 18 percent; and Texas and Arizona which accounted for the remaining 3

percent. The value of the 2003-04 U.S. citrus crop was up 4 percent from the previous

season to $2.35 billion (packinghouse-door equivalent) as published by the USDA,

Statistical Service (2004).

Citrus plants are susceptible to diseases caused by bacteria. One of these diseases,

citrus canker, is caused by two pathovars of Xanthomonas axonopodis. Pathovars of this

bacterium have been distinguished based on phenotypic reactions on different hosts, i.e.,

Xanthomonas axonopodis pv. citri (Xac) and Xanthomonas axonopodis pv. aurantifoii

(Xaa). The most destructive bacterium is Xanthomonas axonopodis pv. citri which causes

Asiatic citrus canker (Xac-A).

Asiatic citrus canker was discovered in North America in 1912 and was distributed

throughout the Gulf states (Loucks, 1934; Dopson, 1964). Eradication of the disease

began in 1915 and the disease was eradicated in 1947. This disease was rediscovered

again in 1986 in Manatee County, Florida, and declared eradicated in 1994 (Schubert et

al., 1996). A new focus of this disease appeared in Miami in 1995 (Gottwald et al.,

1997a; Schubert et al., 2001), and a current eradication program exists. This disease was

also successfully eradicated from the United States, South Africa, Australia, and New









Zealand, but a new focus of citrus canker appeared in Australia in 2004 (Hibberd, A.,

personal communication). An eradication program currently exists in Brazil. The disease

is endemic to Argentina, Paraguay, and Uruguay. It is also endemic to all countries in

eastern Asia.

The symptoms of the disease are erumpent lesions on fruit, foliage, and young

stems of susceptible citrus cultivars (Schubert et al., 2001 and Gottwald et al., 2002a).

The occurrence of citrus canker lesions on the fruit rind decreases the commercial quality

and infected fruit is not accepted by the most important markets. The warm spring and

summer conditions of Florida, together with rains with strong winds that occasionally

occur, offer ideal conditions for the spread of Xac. Optimum temperatures for infection

range between 20 and 300C (Koizumi, 1985).

The introduction of the leafminer, Phyllocnistis citrella Stainton, in Florida in

1993, has increased citrus canker severity due to wounds caused by the insect that expose

leaf mesophyll tissues to splashed inoculum, thus increasing the probability of ingress by

Xac (Gottwald et al., 1997a). The leafminer adults, however, are not efficient vectors of

the pathogen (Belasque et al., 2005).

Changes have recently occurred in the eradication protocols performed by the

Division of Plant Industry (Gottwald et al., 2002b). The increased disease severity

associated with the leafminer has resulted in increased areas of tree disposal around a

focus of infection (Schubert et al., 2001 and Gottwald et al., 2002a). In addition, tornados

and hurricanes during the summer months have caused dissemination of Xac-A much

greater distances than previously thought possible. Legal questions about eradications, in









general, have hindered eradication (Gottwald et al., 2002b). Citrus canker has spread

rapidly in Florida despite changes in eradication protocols (McEver, 2005).

Schubert et al. (2001) described at least two separate introductions of Xac-A in

Florida since 1985. In one of the introductions a strain of Xac that is pathogenic to Key

lime and alemow plants, but not to grapefruit and orange was found. This strain (Xac-A")

was characterized by Sun et al. (2004) and found to be related genetically to Xac-A rather

than Xaa-B or Xaa-C, which have more similar host ranges. Regulations and eradication

protocols adopted for this strain were different from those adopted for Asiatic citrus

canker. For the Xac-Aw only Key lime and alemow plants were destroyed. Because of the

relationship of Xac-Aw to Xac-A, questions as to whether Xac-Aw could revert to an Xac-

A strain exist. If this occurred, a new focus of Xac-A could occur with the eradication

program that was adopted.

The purpose of this work was to investigate the stability of the Xac-Aw strain in

terms of host specificity. The Xac-Aw strain causes a hypersensitive reaction in

grapefruit. Such a reaction is usually the result of an avirulence gene interacting with a

resistance gene in the host (Minsavage et al., 1990b). If resistance in grapefruit to the

Xac-Aw strain is the result of the presence of a single gene in the bacterium, then the

stability of the host specificity of the Xac-Aw may be low. The change to virulence in

grapefruit of the Xac-Aw strain was studied by mutagenesis of the strain, by conjugations

of strains, and by isolation of avirulence genes in the genome of Xac-Aw.














CHAPTER 2
LITERATURE REVIEW

Many reviews have been published on the citrus canker disease (Locks, 1934;

Garnsey et al., 1979; Schoulties et al., 1987; Graham and Gottwald, 1991; Stall and

Civerolo, 1991; Schubert et al., 2001 Gottwald et al., 2002a; Graham et al., 2004). An

excellent early review is an unpublished manuscript that was written by K. W. Loucks in

1934. The review is located in the library of the Division of Plant Industry, Florida

Department of Agriculture, Gainesville. It is a review of research on regulation and

eradication of this disease from the appearance of citrus canker disease in Florida until

eradication of citrus canker was declared in 1933. This manuscript contains a history and

geographical distribution of citrus canker in the world, United States, and Florida. Hosts

reported to be susceptible and the economic importance of citrus canker were included. A

description of citrus canker symptoms of leaves, twigs, thorns, branches and fruits is

given. The general appearance on an infected tree with citrus canker was described. The

morphology, physiology, cultural characteristics and taxonomy of the causal organism at

that time were described in this review. The viability and longevity of the pathogen were

described; including describing the ability of the bacterium to enter the host tissue and

remain quiescent until higher temperatures occurred. The means of dissemination,

methods of infection, and the incubation period involved with the disease cycle were

reviewed. The histology of the disease was described. Humidity and temperature

relationships for disease development, as well the seasonal development of the host and

disease, were included. Progress on the eradication and control of citrus canker and the









epidemiological situation at the time that this review was written were discussed. The last

issue that Louck considered in his review was the future danger of the disease to citrus in

Florida.

An analytical bibliography of research publications relating to citrus canker was

annotated by Rossetti et al. (1981). This huge effort contains abstracts of scientific

papers, reviews, extension reports and notes from 1912 though 1981. There are 1246

abstracts included from all over the world.

Before the reintroduction of citrus canker in Florida in 1985 there were concerns

about the reintroduction of citrus canker after it was declared eradicated in 1933 from

Florida and in 1947 from the USA (Stall and Seymour, 1983). Those concerns were

based on importation of citrus fruits into the United States from Japan, where citrus

canker is endemic; an epidemic of canker occurring in South America, and the

interception of citrus canker at ports of entry. This article described the causal agent, the

disease, the history of citrus canker, information about losses due to this disease,

measures of control and finally the outlook about the real risks of the reintroduction of

citrus canker in the USA.

A bacterial disease of citrus was observed in Florida in 1984. This disease was

referred to as the nursery form of citrus canker, or sometimes as canker E (Schoulties et

al., 1987). In this review they described the nursery form of the disease, diagnosis,

symptoms, distribution, host range, eradication and regulatory program. The review also

discussed the introduction of the Asiatic form of the disease in Florida in 1985 and the

eradication policies regarding the reintroduction of Asiatic citrus canker. The article also









mentioned the costs of the eradications and regulatory programs which were $25 million

from September 1984 to July 1986.

Stall and Civerolo (1991) described Asiatic canker and ongoing research with both

types of diseases of citrus in Florida. They reviewed the history of the disease in Florida,

and the efforts on eradication, the different forms of citrus canker, and the localization of

citrus canker in the USA. Research related to regulation, and eradication problems

included the comparisons between the citrus canker and the bacterial spot disease.

Isozyme analyses, serological studies, and DNA analyses of different strains involved in

the two diseases were included in the comparison of the strains.

Two recent reviews pertain mostly to the introduction of Asiatic citrus canker in

Florida in 1995 (Schubert et al., 2001 and Gottwald et al., 2002a). These reviews provide

a history of the disease in Florida and describe a citrus canker disease cycle. Both reviews

describe the host range of the citrus canker disease, although Gottwald et al. (2002a)

provide a more expansive list. Schubert et al. (2001) list three separate introductions of

the Asiatic citrus canker from 1910 until now and describe a fourth introduction in 2000.

The pathogen associated with the 2000 introduction has a limited host range and was

designated as the Wellington strain. Both reviews treated the problems of regulation and

eradication of citrus canker in Florida. Gottwald et al. (2002b) discuss the epidemiology

of the disease in the urban setting which was not considered previously. Both reviews

discuss the role of the Asian citrus leafminer (Phyllocnistis citrella Stainton) damage in

the epidemiology of the disease.

From the above reviews it is apparent that different xanthomonads are pathogenic

to various citrus species. Only those that cause a lesion that is erumpent or pustule-like in









the early stages of symptoms on leaves are now included in the citrus canker disease

(Graham and Gottwald, 1990). These lesions become crateriform as they increase in size.

The bacteria that do not cause such lesions are not presently classed as causing citrus

canker, and this includes the xanthomonad that causes the citrus bacterial spot disease.

The nomenclature of the bacterial strains that cause citrus canker has evolved.

Gabriel et al. (1989) proposed that Xanthomonas citri be restored for the name of the

Xac-A group. They also proposed that the Xaa-B and Xaa-C strains be named

Xanthomonas campestris pv. aurantifolii. Their primary evidence for this nomenclature

was based on restriction fragment length polymorphism (RFLP) using DNA probes

hybridizing to total DNA of the strains. The change in nomenclature based on this

technique was criticized by Young et al. (1991) and Vauterin et al. (1990). Vauterin et al.

(1991) studied the xanthomonads that cause the citrus canker disease using DNA-DNA

hybridization and other techniques and concluded that they should be divided into two

groups.

Vauterin et al. (1995) revised the nomenclature of the genus Xanthomonas and

placed the bacteria that cause citrus canker into X. axonopodis that also included many

other plant disease-causing xanthomonads. The A group was given pathovar status and

named X axonopodis pv. citri. The B and C strains were placed into the pathovar

aurantifolii as was proposed by Gabriel et al. (1989) previously. This nomenclature

seems to be the most accepted at present for the bacteria that cause the citrus canker

disease.

Two groups of strains that are placed in X axonopodis pv. citri cause citrus canker

can be distinguished, based on DNA and other genetic aspects (Vemiere, 1998). The first









group is the most important group and consists of X. axonopodis pv. citri strain A (Xac-

A) that causes Asiatic citrus canker. Several subgroups have been identified. One

subgroup is referred to as A* because strains are genetically similar to the Xac-A strains

(Hartung and Civerolo, 1989; Cubero and Graham, 2004), but have different host

specificities and a few physiological differences from typical Xac-A strains (Sun et al.

2004). This subgroup of strains occurs in southeastern Asia, Iran and possibly India.

Another subgroup of strains was recently found in Florida and is referred to as Xac-Aw

strains (Sun et al., 2004). These strains are pathogenic on Key lime and alemow plants,

but not on grapefruit or orange plants. The Xac-Aw strains are also closely related

genetically to the Xac-A and Xac-A* strains, but have some physiological differences

from the latter strains.

Another group consists of strains that cause citrus canker and are significantly

different genetically from the Xac-A strains.The members within this group are closely

related genetically (Vauterin et al; in 1991). The strains that cause canker B and C, X

axonopodis pv. aurantifolii, are in this group. This group can be subdivided based on

pathogenicity and a few physiological tests. Both subgroups are not pathogenic on

grapefruit and oranges, but are pathogenic on Key lime. The B subgroup (Xaa-B) of

strains is pathogenic on lemon trees also. After the introduction of Xac-A in Argentina in

1973 the B subgroup was not isolated from the field any more and is only present in

pathogen collections (Nelly Canteros, personal communication). The Xaa-C strain was

isolated in Brazil, but does not occur in nature at this time.

Some work has been done regarding the host specificities of the strains of bacteria

that cause citrus canker. In Loucks review it was pointed out that some species of citrus









are more susceptible than others. Levels of resistance, or susceptibility, of the citrus

species and cultivars were recorded during evaluations in the field. The extreme

susceptibility of grapefruit to the Xac-A strains was attributed to the larger stomatal pores

compared to the mandarins which are more resistant and have smaller stomatal pores (Mc

Lean, 1921). This may be a factor, but Stall et al. (1982a) demonstrated that many more

lesions developed in grapefruit leaves also after infiltration with a low level of inoculum.

The infiltration technique of inoculation was used to evaluate a few cultivars of orange

and grapefruit plants in the field. There was good correlation of disease and susceptibility

in the field results. Viloria et al. (2004) used this technique to evaluate many citrus

genotypes under greenhouse conditions. There seemed to be a continuum of resistance or

susceptibility levels in the genotypes tested.

Hypersensitivity in citrus to Xac-A strains has not been reported. However, a

hypersensitivity reaction was suggested as occurring after inoculations of grapefruit

leaves with a strain of the canker C (Xaa-C) from Brazil (Stall et al., 1982b). This was

suggested because a rapid necrosis occurred in young grapefruit leaves inoculated with

high concentrations of cells (108 cfu/ ml). The rapid necrosis was compared to relatively

slow necrosis in grapefruit caused by the Xac-A strain and a strain of canker B (Xaa-B).

Further documentation of the hypersensitive reaction in grapefruit caused by the C strain

has not been reported.














CHAPTER 3
EVIDENCE FOR HYPERSENSITIV REACTION IN XAC-Aw STRAIN IN
GRAPEFRUIT

Introduction

Xanthomonas axonopodis pv. citri strain AW (Xac-Aw) was compared with Xac-A

(strain that causes Asiatic citrus canker) in Duncan grapefruit and Key lime (Sun et al.,

2004). Even though rapid necrosis occurs when high concentrations of the Xac-Aw

bacterium are infiltrated into grapefruit leaves, data for the development of a

hypersensitive reaction (HR) in grapefruit were not reported. In this chapter we present

experiments on electrolyte leakage and bacterial growth after inoculations with high

concentrations of Xac-A and Xac-Aw strains into grapefruit leaves to determine if a

typical HR occurs in grapefruit leaves.

Materials and Methods

Plants. Plants of grapefruit (Citrus paradi Macf), cultivar Duncan, were kept in a

quarantine greenhouse at the Division Plant Industry at 200 to 350 C and used in this

experiment. Before inoculation the plants were pruned to stimulate new growth. Leaves

on the newly developed shoots were inoculated ca. 10 days after new shoots began

growth. The leaves chosen for inoculations were fully expanded, but soft to the touch,

and not as fully green as mature leaves. By using this procedure all the inoculated leaves

were in a similar developmental stage.

Bacterial strains and preparation of inoculum. Two Xac strains were used.

Suspensions of strains Xac-Aw 12879 and Xac-A 40 (Corrientes, Argentina) were each









transferred to nutrient agar medium (NA) from culture stored at -800C and isolated

colonies were obtained. Several colonies of each strain were transferred to nutrient broth.

After the cultures were shaken overnight, the bacterial suspensions were centrifuged and

the cells were resuspended in sterile tap-water, and standardized to an absorbance of 0.3

at a light wavelength of 600 nm in a Spectronic 20 spectrophotomer. This optical density

corresponds to a bacterial concentration of 5x108 cfu /ml.

Electrolyte leakage. Leaves of grapefruit were inoculated with 5x108 cfu/ml of

Xac-Aw or Xac-A strains (15 leaves each). The inoculations were made by infiltrating

leaves with 10 ml syringe and 27 g nettle (Klement, 1963). After 2 h and 2, 4, 6, and 8

days electrolyte leakage was measured from three leaves infiltrated with each strain.

Electrolyte leakage was determined as an increase in electrical conductivity over a 2 h

period of 3 ml of de-ionized water containing six 0.5 cm2 leaf disks of each inoculated

area (Cook and Stall, 1968; Hibberd et al., 1987). The mean of the three determinations

was used as the conductivity at each time, but each determination was used to determine

the experimental error.

Bacterial populations. The populations of the Xac-Aw and Xac-A strains in

grapefruit leaves were determined in the same leaves and the same times as electrolyte

leakage determinations. From each inoculated leaf 0.5 cm2 of leaf area was taken and

triturated in one ml of sterile tap-water, and after appropriate ten-fold dilutions, 50 il

were plated on NA medium. The colonies were counted 3 days later (Cook and Stall,

1968; Hibberd et al., 1987). Three replicates were included at each time period. The

experiment with population and electrolyte leakage was repeated three times.









Results

The appearance of rapid necrosis in grapefruit leaves occurred only on young

leaves of grapefruit plants (Figure 3-3). Therefore, the inoculation of leaves in a young

stage of development is essential for consistent results. The inoculation of new growth

that resulted from pruning of shoots of grapefruit plants gave consistent reactions.

Electrolyte leakage of grapefruit leaves. The conductivity of water containing

leaf disks inoculated with the Xac-Aw strain was very high at day four compared to

conductivity of water containing leaf disks inoculated with the Xac-A strain (Figure 3-1).

Conductivity of water containing leaf disks inoculated with the Xac-A strain was highest

at day eight. Thus, the Xac-Aw strain caused more rapid electrolyte leakage from

grapefruit leaves than the Xac-A strain.

Growth of Xac-Aw and Xac-A strains. The populations of the Xac-A strain were

significantly higher than the Xac-Aw strain in grapefruit leaves at day four and day six.

The populations reached 109 cfu/cm2 of leaf tissue with the Xac-A strain, but the

populations of the Xac-Aw strain were slightly lower and reached only 108 cfu/cm2

(Figure 3-2).

Discussion

The populations obtained in leaves inoculated with Xac-Aw were very similar to the

results obtained by Sun et al. (2004). Growth was slower in leaves inoculated with the

Xac-Aw strain than growth in leaves inoculated with Xac-A strain. In both studies the

Xac-Aw populations were nearly ten-fold less than the Xac-A strain. Comparisons of

growth after infiltration in Key lime leaves were not determined in this study, because we

were only interested in determination of HR in grapefruit leaves of the Xac-Aw strain.









However, Sun et al. (2004) found no differences in growth of Xac-A and Xac-Aw in

leaves of Key lime.

To determine if necrosis occurs more rapidly in leaves inoculated with strain Xac-

A" compared with Xac-A, electrolyte leakage was monitored in grapefruit leaves after

infiltration with these strains. Leakage of electrolytes from citrus leaf tissue infected by

Xac-A was determined previously (Goto, et al., 1979). In this work necrosis caused by

Xac-Aw occurred more rapidly compared with Xac-A strain (Figure 3-1). Electrolyte

leakage reflects the extent of necrosis in leaves. A rapid necrosis in plant tissue and lower

populations in leaves compared to a susceptible reaction are indications of a HR.

Therefore, it is reasonable to assume that Xac-Aw causes an HR in grapefruit leaves based

on this work. HR is the result of an avirulence (avr) gene interacting with a resistance

gene (Flor, 1955; Ellingboe, 1976; Klement, 1982; Staskawicz et al. 1984; Crute, 1985;

Gabriel et al. 1986). In future work we will determine if an avr gene is involved in this

reaction.












400
350
S300
S250
200
150
100
50-- Xac-A
0
0 2 4 6 8
Time (days)
Figure 3-1. Electrolyte leakage in grapefruit leaves inoculated with Xac-Aw and Xac-A
strains at a concentration of 5x108 cells per milliliter at various times after
inoculation. The leaves inoculated with Xac-Aw abscised 6 days after
inoculation. Vertical bars represent standard error.


-2- Xac-A
-e- Xac-Aw


Time (days)


Figure 3-2. Internal bacterial populations in grapefruit leaves inoculated with Xac-Aw and
Xac-A strains at various times after inoculation. The leaves inoculated with
Xac-Aw abscised 6 days after inoculation. Vertical bars represent standard
error.


(^]

































Figure 3-3: Symptoms of Xac-Aw (left side of leaf) and Xac-A (right side of leaf) in old
(left) and young leaves (right) of grapefruit on the abaxial face of the leaves
(Four days after inoculation).














CHAPTER 4
CHANGE OF HOST RANGE BY MUTATION.

Introduction

Xanthomonas axonopodis pv. citri strain AW (Xac-Aw) causes a hypersensitive

response (HR) in grapefruit leaves. The HR is correlated with the gene-for-gene

relationship in many plants. In such gene-for-gene interactions an avirulence (avr) gene

in the pathogen interacts with a corresponding resistance (R) gene in the plant

(Minsavage et al., 1990b). Mutation of an avr gene often leads to a susceptible reaction.

Such mutations can occur in high frequency in some strains of Xanthomonas (Dahlbeck

and Stall, 1979). The purpose of this chapter is to determine if a mutation in a postulated

avr gene would change the host specificity of the Xac-Aw strain after treatment with a

mutagen and if so, to determine the frequency of the mutation.

Materials and Methods

Inoculum. The Xac-Aw 12879 strain was used because it causes an HR in

grapefruit leaves and a susceptible reaction in leaves of Key lime. The preparation of

inoculum was the same as described in Chapter 3.

Mutation in vitro. The Xac-Aw cells were treated with N-methyl-nitro-N-

nitrosoguanidine (NTG), which is a strong mutagen (Gerhardt et al., 1981). A stock

solution of NTG containing 1 pg/ml in deionized water was made and 100 pl of stock

NTG were added to 900 tl of a suspension of 5 x 108 cfu/ml of Xac-Aw cells in sterile

tap-water. After 1 h at 28 C the suspension was diluted serially ten-fold, and 200 tl of a

5 x 103 cfu/ml bacterial suspension were spread onto the surface of nutrient agar in Petri









plates. In previous work (unpublished) the NTG treatment killed ca. 50 % of bacterial

cells. After 3 days the colonies were counted to determine the actual concentration of

viable cells following treatment with NTG and to observe for development of mutant

white colonies from the typical yellow colonies. In addition 200 pl of a suspension

consisting of the 105 cfu/ ml were spread onto nutrient agar containing 200 tg/ml

streptomycin sulfate to check for growth of colonies resistant to streptomycin.

About 30 young grapefruit leaves were completely infiltrated with a suspension

consisting of 5 X 103 cfu/ml of mutagenized cells. At the same time ten leaves of Key

lime were infiltrated with the same inoculum as a control. The leaves used in these

experiments were at the same stage of development as described in Chapter 3. The

technique used by Klement (1963) was used to infiltrate each leaf with inoculum. Lesions

in both Key lime and grapefruit were counted and were calculated as lesions per cm2 of

inoculated leaf area (Table 4-3). The leaf area of tissue infiltrated was determined using

the dot-counting method (Marshall, 1968). The mutagenesis experiment was repeated

eleven times.

Results

Mutagenesis. The numbers of Xac-Aw cells remaining after NTG treatment ranged

from 0.5 to 3.0 x 108 cfu/ml in the eleven experiments. White colonies developed in five

of the experiments in which 103 cfu/ml were spread on NA. Streptomycin-resistant

colonies formed in which 105 cfu/ml were spread on NA containing streptomycin in only

one experiment (Table 4-1). No white colonies of Xac-Aw or streptomycin resistant

colonies developed with non-treated suspensions. These results were evidence that NTG

did cause mutations in the population of Xac-Aw cells used for inoculum.









Change of host range. The Xac-A" strain caused fleck lesions in grapefruit leaves

(Figure 4-1) and typical citrus canker lesions in Key lime (Figure 4-2). Each lesion was

probably caused by a single cell of the bacterium, because of the low inoculum level

used. Over the eleven experiments an average of 10.1 canker lesions per cm2 occurred in

Key lime and 2.7 fleck lesions per cm2 occurred in grapefruit leaves. Assuming the

intercellular spaces on grapefruit and Key lime leaves were similar, only 27 % of the

Xac-A" cells in grapefruit actually caused a visible fleck lesion.

The total area of grapefruit leaves infiltrated with inoculum in the eleven

experiments was 20,827 cm2 (Table 4-2). Using the estimate of 10.0 lesions/cm2 based on

what occurred in Key lime leaves (Table-4-3), approximately 2.0 x 105 cells of Xac-A"

were infiltrated into grapefruit leaves in the eleven experiments. Typical citrus canker

lesions were never observed in grapefruit leaves receiving the mutagenized cells of Xac-

A".

Discussion

Cells of Xac-A" were treated with NTG, a powerful mutagenic agent, to increase

the frequency of mutation. The number of white colonies and streptomycin resistant

colonies after NTG treatment reflected the development of mutants in culture.

The frequency to streptomycin resistance in non-mutagenized cultures of X.

campestris pv. vesicatoria was around 1.9 x 10-9 per cell per division (Dahlbeck and

Stall, 1979). In this work, streptomycin resistant colonies occurred rarely after NTG

treatment but did occur in one test and was determined to be approximately one per 105

cells. The frequency of mutation for white colonies was higher than for streptomycin

resistance. At least seven genes are involved in the development of the yellow pigment

(Poplawsky and Chun, 1997). Mutation in any of them will result in loss of pigmentation.









Thus, one would expect a higher frequency of white colonies than streptomycin resistant

colonies after NTG treatment. As resistance to streptomycin is encoded by a single gene,

the frequency of streptomycin resistance probably corresponds better to an avr gene

mutation, if the change of the host range depends only on a single avr gene. Thus, one

would not expect a change of host range of the Xac-Aw strain unless nearly 105 cfu were

infiltrated into the leaves of grapefruit. We inoculated grapefruit leaves with 2 x 105 cells

and, thus, one would have expected a single avirulence gene to be mutated and detected

in our work. However, this did not occur. Therefore, possibly more than one gene is

involved in the incompatibility of the grapefruit leaves to the Xac-Aw strain.










Table 4-1. Effect in vitro of NTG mutagenesis on development of white colonies and
streptomycin resistant colonies of Xac-Aw strain


Expeiment no.


Yellow a
colonies


x 108 cfu


1
2
3
4
5
6
7
8
9
10
11
Average


3.00
0.90
0.68
1.70
1.31
1.99
2.11
0.85
1.75
0.50
0.76
1.41


White b
colonies

x 103

0.00
0.00
0.00
2.00
0.00
0.00
0.00
3.80
2.00
2.00
0.20
0.91


Streptomycin '
resistant colonies

x 105

0.00
0.00
0.00
1.80
0.00
0.00
0.00
0.00
0.00
0.00
0.00
0.16


a These values were based on the colonies that developed on nutrient agar after dilution to
103 cfu/ml. The values are based on three replicates per experiment.

b These values are number of colonies that developed on nutrient agar after dilution to 103
cfu/ml. A suspension of 200 ul were spread on the plate. Average of three replicates per
experiment

' There values are number of colonies that developed on nutrient agar containing 200 Ltg
of streptomycin per liter. A suspension of 200 ul of 105 cfu/ml were spread on the plate.
Average of three replicates per experiment.










Table 4-2. Total area of inoculated Key lime and grapefruit leaves in all experiments


Experiment No


1
2
3
4
5
6
7
8
9
10
11
Total


Key lime
2
cm

34.5
60.0
40.6
39.5
379
246
32.8
60.8
25.6
51.0
56.0
1025.8


Grapefruit
2
cm

711.50
2122.5
1632.6
1136.5
1853.8
3115.0
1597.0
1653.3
1263.0
3093.8
2647.5
20826.5


Table 4-3. Number of lesions per cm2 that were produced in Key lime and grapefruit
leaves inoculated with 103 cfu/ml of Xac-Aw


Numbers of lesion per cm


Experiment No


Key lime a


Grapefruitb


1 12.5
2 7.1
3 3.5
4 19.6
5 4.8
6 11.5
7 18.2
8 1.3
9 15.3
10 4.5
11 12.2
Average 10.1
a Lesions were typical of citrus canker


b Lesions were sunken and very small (typical fleck lesion caused by HR)













w, .


r -"y r 1~.
F~4~_ ~ r "ll~
LI


4,1,
. ..r*


Figure 4-1. Symptoms ofXanthomonas axonopodis pv. citri strain Xac-AW in grapefruit
leaf after infiltration with 103 cfu/ml bacterial concentration. Fleck lesions
occur on upper half of leaf (30 days after inoculation).


Figure 4-2. Symptoms ofXanthmonas axonopodis pv. citri strain Xac-AW in Key lime
leaf after infiltration with 103 cfu/ml bacterial concentration. Typical pustule
type lesions occur on upper half of leaf (21 days after inoculation).














CHAPTER 5
CHANGE OF HOST RANGE BY CONJUGATION

Introduction

More than one avr gene may be involved in the hypersensitive reaction (HR) by the

Xac-Aw strain in grapefruit leaves. If that is true, the host specificity of the Xac-Aw strain

would not change by simple mutation. However, the factor for host specificity of the

Xac-Aw strain might cause the Xac-A strain to change after conjugation of the strains,

because large amounts of DNA transfer during conjugation. Conjugation is a process in

which the DNA of a donor bacterium moves to a recipient bacterium. Plasmid or

chromosomal DNA can move to recipient cells in conjugation. Conjugation requires cell

to cell contact and the presence of transfer genes in the DNA of the donor. Many

avirulence genes involved in host and cultivar specificities (Leyns et al., 1984; Hayward,

1993), and the genes for resistance to copper (Stall et al., 1986) and streptomycin are

located on plasmids (Minsavage et al., 1990a). However, some avirulence genes are

located on the chromosome (Ronald and Staskawicz, 1988; Tamaki et al., 1988; 1988;

Minsavage et al., 1990b; Jenner et al., 1991; Mansfield et al., 1994; Whalen et al., 1993;

Lorang and Keen, 1995). Horizontal transfer of chromosomal genes among strains of X

axonopodis pv. vesicatoria was confirmed by Basim et al. (1999), but the frequency of

transfer of plasmid DNA is usually higher than for chromosomal DNA.

Materials and Methods

Bacterial strains. All bacterial strains, relevant characteristics, and origin are listed

in Table 5-1.









Change of host range by conjugation. To test for conjugation among strains,

genetic markers were incorporated into both Xac-Aw and Xac-A so that each could be

used as a donor or recipient. Some strains were marked with fluorescent proteins by G.V.

Minsavage (Plant Pathology, Department of University of Florida) using the pMODTM

2 vector that carries 19-bp mosaic end sequence flanking restriction sites. The

antibiotic cassette used in this experiment was excised from pKRP11 plasmid (KmR) and

pKRP13 (SmR SpR). A KmR clone was marked with the EYFP gene with lacZ promoter

from pEYFP and a clone that carried the SmR SpR was marked with the ECFP gene with

the lacZ promoter from pECFP. The fluorescent-marked strains were obtained by

electroporation using EZ::TN transposase enzyme and Biorad Gene Pulser (for more

details contact G.V. Minsavage).

Strains with antibiotic resistance were selected after plating 200 pl of a culture

containing 108-109 cfu/ml onto nutrient agar containing the selective antibiotic. Colonies

that developed on the selective medium were purified by single-colony selection on the

antibiotic medium. Strains of Xac-A and Xac-Aw containing the GFP in the chromosome

or non-pigmented strains obtained in Chapter 4 were sometimes used for selection of

antibiotic resistance. Strains were stored at -800 C. The antibiotics used and final

concentrations were: rifamicyn (80 ig/ml), nalidixic acid (50 ig/ml), kanamycin (50

ig/ml), streptomycin (50 ig/ml), and spectinomycin (50 ig/ml).

For conjugation on a solid medium, donor and recipient strains were grown in

nutrient broth (NB) overnight on a rotary shaker at 280 C, after which 100 il of culture

was added to 900 il of sterile tap-water and centrifuged. The pellets obtained were

resuspended in 100 ul of sterile tap-water and donor and recipient strains were mixed in









different proportions (10 or 200 tl of donor was added to 100 tl of recipient). Then 10 tl

of each mixture was plated on nutrient-yeast-glycerol agar (NYGA), (Daniels, et al.,

1984). The same suspensions sometimes were inoculated into leaves of grapefruit or Key

lime for conjugation. After 48 h each mixture was resuspended in 800 pl of sterile tap-

water and 400 tl was transferred to each of two plates of an antibiotic selective medium.

For conjugation in liquid medium, bacteria were grown during shaking at 280 C

overnight in 4 ml of NB, then donor and recipient strains were mixed, and incubated with

very gentle shaking for 5 h. Afterward 200 ul of the mixture were plated on appropriate

selective medium and incubated at 280C for 2-3 days until conjugants developed.

Sometimes colonies grew on media containing two antibiotics. To test whether the

colonies were mutants or conjugants, cells were observed for the presence of GFP using a

UV microscope was performed and PCR with the primers specific for GFP (G.V.

insavage). Sometimes they were inoculated into grapefruit leaves for strain identification.

To determine if Xac-A" and Xac-A could act as donors, or recipients in

conjugation, experiments were designed for transfer of Cu resistance genes which were

known to be transferred by conjugation (Basim et al, 1999). Two strains ofX. campestris

pv. vesicatoria (one contained Cu resistance on a plasmid, the other on a chromosome)

were mated with Xac-A" and Xac-A recipient strains and screened for transfer of copper-

resistance genes (Cur). In addition, four Cur Xac-A strains (plasmid-borne Cur) from

Argentina and a strain of X axonopodis pv. citrumelo that was copper resistant were

mated with an Xac-A copper sensitive (Cu') strain from Florida. The conjugations using

only the strains from Florida were made on solid NYGA medium and the conjugations

among strains from Argentina and Florida were made using liquid medium. Copper









resistance was determined by growth on nutrient agar supplemented with copper sulfate

(200 [tg/ml). The frequency of Cur transfer during conjugations was determined from

dilution plating of bacteria after matings.

Plasmid DNA isolation. Plasmid DNA was extracted by a modification of the

method of Kado and Liu (1981). Detection of plasmids was performed by electrophoresis

of the plasmid extraction as described previously (Stall et al., 1986). Donors and

recipients could be identified by plasmid profiles (Figure 5-1, Lanes 2 and 4).

Results

Selected Xac-Aw strains were mated with Xac-A strains in all combinations of the

donor and recipient. In addition, the Xac-Aw strain was mated with itself and the A strain

was also mated with itself. In these tests a marker gene on a chromosome was never

transferred by conjugation. Putative transconjugants that grew on antibiotic media all

were negative for transfer of chromosomal genes.

The copper resistance genes on a plasmid in Xcv 75-3 were transferred to Xac-A in

vitro and in plant in all tests performed; however, these copper resistant genes were

transferred to the Xac-Aw strain only one time, and that occurred in plant (Figure 5-1).

No transfer to either Xac-A or Xac-Aw of the chromosomal Cu genes was observed.

Conjugal transfer of Cur genes from copper resistant Xac-A strain from Argentina

to copper sensitive Xac-A strain from Florida also occurred (Figure 5-2). The copper

resistance genes in Xac-A were found to be plasmid-bome (Figure 5-3). The frequency

of transfer of the Cur plasmid (per donor cell) was variable depending on the donor and

recipient combination (Table 5-2). The same variability of transfer frequency was

observed when the conjugation was made with the Cur and Cus strains from Argentina









(Table 5-3). It is interesting that in this combination, the Xac-A 16 Cur strain was the best

donor and had the highest frequency of transfer with the Xac-A 40 Cus strain. However,

no transfer was observed with the Xac-A 45 Cur strain used as the donor and with any

recipient strain (Table 5-3). When Xcv 75-3 Cur was used as a plasmid donor, the

frequency of transfer of Cur genes to Xac-A Cus strains was very high (Table 5-4). When

the copper resistant donor, X axonopodis pv. citrumelo strain (2a, Cur), was mated with

Xac-A 20, (Cus), the Cu plasmid was transferred from the donor to the Xac-A recipient

strain (Lane 12 of the Figure 5-3).

Discussion

The marker genes developed in these experiments were probably inserted in the

chromosome. The genes for yellow pigment had been determined to be in the

chromosome (Poplawsky and Chun, 1997). The markers were developed to primarily see

if chromosomal movement occurs in Xac-A and Xac-A" by conjugation. The

experiments were designed to have two markers in the donor strain, but only one marker

was included in the recipient strain. The development of some colonies on selective

media after mating was due to mutation for the donor selective marker in the recipient.

The mutants could be detected by the lack of movement of the other chromosomal genes,

such as the GFP or pigment genes.

Apparently chromosomal movement between strains of Xac is not a significant

factor in change of host specificities in nature. However, conjugal movement of plasmids

between strains of Xac does occur. Movement of plasmids among strains of Xac can be

particularly significant for the movement of copper resistance genes between strains.

Copper is used in the field to control citrus canker and the development of resistance

among strains would hinder control. The first report of copper resistance in strains of Xac









was by Canteros et al. (2004). In the present work we found that the copper resistance

genes in strains from Argentina were plasmid borne, which had not been demonstrated

previously. Copper resistance among strains of Xac in Florida was not detected when

over 100 random strains were screened for resistance. However, copper resistance was

detected in a strain of X axonopodis pv. citrumelo from Florida (R.E. Stall, personal

communication) and the resistance was determined to be plasmid-borne and could be

transferred by conjugation to an Xac-A Cus strain. Since X axonopodis pv. citrumelo and

Xac-A both cause disease of citrus it is expected that cell to cell contact of the two

pathovars can occur in nature. If citrus canker were to become widespread in Florida and

copper is used for control, it would be expected that copper resistance strains of Xac-A

would be selected quickly in the field.

1 2 3 4 5


















Figure 5-1. Agarose gel stained with ethidium bromide. Lanes contain plasmid
extractions from different strains: 1= Xcv 75-3 (Cur), 2= Xac-A (1874, GFP+,
Cus), 3= Xcv 75-3 x Xac-A conjugantt), 4= Xac-Aw (GFP+ Cus), and 5= Xcv
x Xac-Aw conjugantt). Strains in lanes 1, 3, and 5 were resistant to copper and
contained a large plasmid (arrow). The large plasmid was transferred by
conjugation to copper sensitive strains.









I I A A


Figure 5-2. Agarose gel stained with ethidium bromide. Lanes contain plasmid
extractions from different strains: 1= Xac-A (16, Cur), 2= Xac-A (26, Cur), 3=
Xac-A (1874, Cus), 4= Xac-A (16) x Xac-A (1874) conjugant, and 5= Xac-
A (26) x Xac-A (1874) conjugant. Strains in lanes 1, 2, 4 and 5 were copper
resistant and contained a large plasmid (arrow). The large plasmid from
strains 16 and 26 were transferred to 1874 by conjugation.









1 2 3 4 5 6 7 8 9 10 11 12 13 14


-101


Figure 5-3. Agarose gel stained with ethidium bromide. Lanes contained plasmid
extractions from different strains: 1= Xcv 75-3 (Cur) 2= Xac-A 20 (1874,
GFP+, CuS), 3= Xcv 75-x Xac-A 20) conjugant, 4=Xac-Aw (GFP+ Cus),
5=Xcv x Xac-A" conjugantt, 6=Xac-A (16 Cur), 7- Xac=A (26 Cur ), 8= Xac-
A 16 (Cur) x Xac-A 20 (Cus) conjugant, 9= Xac-A 26 x Xac-A 20, conjugant,
10= Xac-E (104, Cu'), 11= Xac-E (2a, Cur),12= Xac-E (2a x Xac-A 20 ),
conjugant, 13= Xac-E (lc Cur), 14= Xac-E (9 a Cur). Strains in lanes 1, 3, 5,
6, 7, 8, 9, 11, 12, 13 and 14 were copper resistant and contained a large
plasmid (arrow).









Table 5-1. List of bacterial strain used in chapter 5


Relevant characteristics


Xanthomonas axonopodis pv. citri
Xac-Aw (12879)
Xac-A 20 (1874
Xac-A 20 (1874
Xac-A" (12879
Xac-A 16 (Xc02-1443)
Xac-A 26 (Xc01-1394-1)
Xac-A 44 (Xcc03-1338-1-1)
Xac-A 45 (Xcc03-1639-1-4)
Xac-A 40 (Xcc03-1633-1)
Xac-A 40 (Xcc03-1634)
Xac-A 42 (Xcc03)
Xanthomonas axonopodis pv. citrumelo
Xac-E (104)
Xac-E (2a)
Xac-E (Ic)
Xac-E (9a)
Xanthomonas campestris pv. vesicatoria
Xcv (75-3)
Xcv (XVP26)


GFP+;
GFP+;
GFP-;
GFP-;
Cur
Cur
Cur
Cur
Cus
Cus
Cus


GFP-;
GFP-;


Kanr
Strepr; Rif;White
Rif ; Specr
Specr; Rif


Cur plasmidd)
Cur (chromosomal)


Xanthomonas axonopodis pv. citri (Xac), Xanthomonas campestris pv. vesicatoria (Xcv),
Fl, Florida, provided by Robert Stall from DPI Gainesville Fl. collection and Ctes,
Corrientes, provided by Nelly Canteros from INTA, Bella Vista, Corrientes, Argentina,
Kanamycin resistant (Kanr), Streptomicyn resistant (Strepr) Rifamycin resistant (Rif ),
Spectinomycin resistant (Specr ), Copper resistance (Cur); Copper sensitive (Cus).


Table 5-2. Frequency of transfer of copper resistance genes among Xanthomonas
axonopodis pv. citri (Xac-A) after conjugation in a liquid medium


Donor strain


Xac-A 16
Xac-A 26
Xac-A 44
Xac-A 45


Recipient strain


Xac-A 20
Xac-A 20
Xac-A 20
Xac-A 20


Range of frequency of transfer
(per donor cell)a


3.9 x 10-6 to 1.25 x 10-
0 to 1.12 x 10-6
0 to 8.66 x 10-6
0 to 4 x 10-7


a Based on four determinations per donor x recipient combinations.


Designation


Source


Fl.
Fl.
Fl.
Fl.
Ctes.
Ctes.
Ctes.
Ctes.
Ctes.
Ctes.
Ctes.

Ctes.
Ctes.
Ctes.
Ctes.

Fl.
Fl.









Table 5-3.Frequency of transfer of copper resistance genes among strains of
Xanthomonas axonopodis pv. citri (Xac-A) after conjugation in a liquid
medium


Donor strain


Recipient strain


Range of frequency of transfer
(per donor cell)a


0 to 2.4 x 10-4
0 to 5 x 105
0 to 1.82 x 10-9
0
0 to 9.09 x 10-9
Oto 1.3 x 105
0
0
0


a Based on four tests of conjugation.


Table 5-4. Frequency of transfer of copper resistant genes from Xanthomonas campestris
pv. vesicatoria (Xcv) to copper sensitive strains of Xanthomonas axonopodis
pv. citri by conjugation on a solid medium


Donor strain Recipient strain


Xcv 75-3
Xcv 75-3
Xcv 75-3


Range of frequency of transfer
(per donor cell)a


Xac-A 40
Xac-A 41
Xac-A 42


0 to 2 x 10-4
Oto 1.33 x 10-6
Oto 1.33 x 10-6


a Based on four tests of conjugation.


Xac-A
Xac-A
Xac-A
Xac-A
Xac-A
Xac-A
Xac-A
Xac-A
Xac-A


Xac-A 40
Xac-A 41
Xac-A 42
Xac-A 40
Xac-A 41
Xac-A 42
Xac-A 40
Xac-A 41
Xac-A 42














CHAPTER 6
CLONING ANA VR GENE FROM THE XAC-Aw STRAIN

Introduction

Previously we found no evidence for a genetic basis for the host specificity of Xac-

A" strains compared to the Xac-A strains. In many cases, however, hypersensitivity of a

strain in a particular host is the basis for and is the result of the interaction of an avr gene

in the pathogen and a resistance gene in a host. The purpose of this chapter is to provide

results of screening a DNA library of Xac-Aw for the presence of avr genes in Xac-Aw

that cause a hypersensitivity in grapefruit leaves.

Materials and Methods

Bacterial strains and media. Strains used in this study are listed in Table 6-1. All

strains were maintained at -800 C and subcultured, when needed, on nutrient agar (NA).

Rifamycin-resistant strains were obtained by plating 500 .il of Xac-Aw strain 12879 at

109 colony-forming units (cfu) /ml onto nutrient agar supplemented with 80 tg/ml of

rifamycin. Escherichia coli (Ec) strains were cultured on Luria-Bertani medium

(Maniatis et. al., 1982). Conjugations were performed on nutrient-yeast-glycerol agar

(NYGA, Daniels et. al., 1984). The antibiotics and concentration used in media were:

rifamycin, 75 [tg/ml; tetracycline, 12.5 [tg/ml; and kanamycin 5 [tg/ml.

Growth of plants and inoculum preparation. Growth of plants and inoculum

preparation were the same as described in Chapter 3.

Electrolyte leakage determinations. Electrolyte-leakage determinations were

made in the same way as described in Chapter 3.









Bacterial growth curves. Bacterial growth curves were obtained in the same way

as described in Chapter 3.

Recombinant DNA techniques. Techniques used for cosmid cloning, enzyme

digestion, ligation, Southern transfer, plasmid alkaline lysis, and agarose gel

electrophoresis were described by Maniatis et al. (1982).

A genomic library of Xac-A" strain 12879 was constructed in the vector pLAFR3

as previously described (Metz et al., 2005) and supplied by G. V. Minsavage (Plant

Pathology Dept., University of Florida). Individual clones were maintained in Ec DH5a

(BRL) and maintained on Luria-Bertani medium. The helper plasmid pRK2013 in Ec HB

101 was used in conjugations involving triparental matings.

Individual clones of an Xac-A" genomic library in Ec DH5a were conjugated into

strain 91-118 of X perforans (Jones et al., 2004). Transconjugants were infiltrated into a

1 cm2 area of leaf tissue with a syringe and needle. The recipient bacterium is pathogenic

to tomato, but causes a null reaction in grapefruit leaves. A clone that caused an HR

reaction in both grapefruit and tomato leaves was detected by rapid necrosis in the

infiltrated area of the leaf. Tomato leaves were inoculated as a control, because the Xac-

A" strain also elicits an HR in tomato leaves (Figure 6-1). Grapefruit leaves and tomato

leaves were inoculated with ca. 300 transconjugants individually. Each clone contained

approximately a 25-kb fragment of Xac-A" DNA.

Subcloning. A clone, pL799-1 with HR activity in grapefruit, but not tomato was

obtained and consisted of about a 25-kb insert of Xac-A" DNA. This clone was

subcloned to contain only DNA necessary for HR activity. In this subcloning, to identify

the exact location of the gene in pL799-1, the transposon pHoGus was used to knock out









the gene responsible for HR activity by the procedure described by Huguet and Bonas,

1997. About 160 kanamycin resistant clones, which contained pHoGus inserts were

screened for the lack of HR in grapefruit after they were transferred to X perforans.

Three clones were selected for lack of an HR and one clone (pL799-1) was selected from

the three for further work. The clone pL799-1 was restricted with each of several

enzymes to find a fragment that contained the Tn3 insert. A HindIII restriction fragment,

contained the Tn3 insert and about 3.0 kb of DNA. This fragment was ligated into

pBluescript II KS and labeled pBs3.0. A portion of the 3.0 kb insert in pBs3.0 was then

sequenced using forward and reverse primers from the cloning vector. Custom

oligonucleotide primers were designed to complete the sequencing of the intact HindIII

fragment.

An open reading frame (ORF) was identified in the sequence of the intact HindIII

fragment. However, the ORF was at the end of the fragment and was not complete. When

the intact HindIII fragment was ligated into pLAFR6 (pL799-2) and conjugated into X.

perforans, no HR occurred in grapefruit leaves. Then primers were selected for

sequencing beyond the end of the HindIII fragment in the original clone to obtain the

sequence of the complete ORF. Primers were selected from the sequence to amplify by

PCR a 2.3-kb fragment containing the complete ORF, which was then ligated into

pGEMT Easy Vector (Promega, Madison, Wisconsin). The 2.3 kb insert was removed

from pGEMT Easy Vector with EcoRI enzyme and then ligated into the vector

pUFR043, and designated pU799-3. The pUFR043 cosmid was used as a vector because

DNA inserts in this vector could be conjugated into strains of Xac-A", whereas pLAFR









derivatives could not be transferred to strains of Xac-A". The pU799-3 in X perforans

caused an HR in grapefruit leaves. The open reading frame was labeled avrGfl.

Mutation of avrGfl in Xac-A". The avrGfl gene in Xac-Aw was mutated to

investigate the role of the gene in the host specificity of the bacterium. Mutation in

avrGfl in pGEMT Easy Vector occurred by inserting an Omega cassette into the gene

by the procedure described by Huguet et al., (1998). The inactive gene was exchanged

into the Xac-Aw strain by using the suicide vector pOK1. Eventually an Xac-Aw strain

with the mutated avr gene was obtained. This strain was labeled Xac-Aw Q.

DNA sequence analysis. Sequencing of pBluescript clone pBs3.0 was initiated at

the sequencing facility (University of Florida, Gainesville, Fl, USA) with the Applied

Biosystems model 373 system (Foster City, CA, U.S.A.). To complete sequencing of

both strands of DNA, custom primers were synthesized at the ICBR facility with an

Applied Biosystem model 394 DNA synthesizer. The computer program SeqAid II

version 3.81 was used to analyze nucleotide sequence data and predicted protein products

of the 2.3 kb region that contained avrGfl. A search for nucleotide and amino acid

sequence homology was conducted with the BLASTN and BLASTP 2.2.11 programs

(Altschul et al. 1997).

PCR procedure. Based on DNA sequence analysis of the avirulence gene

identified in Xac-A custom primers were designed to amplify a fragment from the

avirulence gene from DNA of xanthomonads that cause disease in citrus plants. The

primers used were forward 5-'CGCCGGTTTCTGTCCTGCACTTG-3' and reverse 5'-

GCCGCCTTTGCCATCGACCAG-3'. The final product was 199 bp. PCR reactions were

performed in a thermocycler (M.J. Research, Watertown, MA, U.S.A.).









Southern hybridization. All hybridization experiments were performed on

nitrocellulose membranes using the GENIUS nonradioactive DNA labeling and detection

kit according to the manufacturers instructions (Boeheringer Mannheim Biochemicals,

Indianapolis, IN, U.S.A). Genomic DNA extractions were made using the

GenomicPrepTM Cells and Tissue DNA Isolation Kit (Amersham Pharmacia Biotech,

Inc. 800 Centennial Avenue, PO Box 1327 Piscataway, NJ 08855, USA). Plasmid

extraction from Xac-A and Xac-Aw strains was as described in Chapter 5.

Results

Selection of avirulence gene. Three clones were selected that caused rapid

necrosis in grapefruit leaves but not in tomato leaves, and three other clones caused rapid

necrosis in tomato leaves, but not in grapefruit. The first three clones were designated

pL799-1, pL22, and pL622. All three clones were successfully transferred from E. coli

by conjugation into a strain that causes Asiatic citrus canker (Xac-A) in grapefruit and

Key lime. Only one of the three clones, pL799-1, caused an HR in grapefruit leaves

when expressed in the Xac-A strain (Figure 6-2). The pL799-1 clone in the Xac-A strain

did not cause an HR in Key lime leaves, which is typical of the host range of the wild

Xac-Aw strain (Figure 6-3). This clone was further characterized in this work.

To obtain more information about the significance of the avirulence gene in the

host range of Xac-A", primer sequences were obtained for amplification of a portion of

avirulence genes by PCR from the sequence of the 2.3 fragment in pU799-3. DNA from

three Xac-A strains and four Xac-Aw strains was extracted and tested for the presence of

the avirulence gene by amplification of DNA with those primer sequences. Amplification

of a product of the expected size occurred with all of the Xac-Aw strains, but no

amplification of a fragment of the expected size occurred with any Xac-A strain. Using









Southern hybridization with the pU799-3 clone as a probe, the avirulence gene was

determined to be present in the Xac-Aw strains but not in the Xac-A strains. In addition,

the avirulence gene was not present in strains of the B and C groups of X. axonopodis pv.

aurantifolii, or in strains of the Xac-A* strains of the Xac group, or in strains of X.

axonopodis pv. citrumelo (Figure 6-8). The B strain and strains of X axonopodis pv.

citrumelo did not cause rapid necrosis in grapefruit leaves but the C strain did. Also, at

least some of the Xac-A* strains also caused rapid necrosis in grapefruit leaves (Data not

presented). Apparently, other avirulence genes may exist in those strains. The avirulence

gene (avrGfl) hybridized with Xanthomonas campestris pv. campestris strain 8004 but

the restriction pattern was different. Strain 8004 causes rapid necrosis in grapefruit

leaves. The avirulence gene (avrGfl) was located in the chromosome because the

plasmid DNA did not hybridize with the avrGfl probe (Figure 6-8).

Comparison of mutated Xac-Aw with the Xac-A and Xac-A". The strain Xac-

A" with the mutated avirulence gene was compared with the Xac-A and Xac-Aw strains

in inoculation tests in grapefruit leaves. Visually, the symptoms caused by the mutant

strain of Xac-Aw were more like the wild-type Xac-A strain than the wild-type Xac-Aw

strain (Figure 6-4 and 6-5). However, the symptoms of the mutated strain were not

identical to Xac-A strain. Nevertheless, inactivation of the avirulence gene in Xac-Aw did

alter the disease reaction in grapefruit leaves.

Growth of the strains in grapefruit leaves was compared. In addition, electrolyte

leakage from the leaves inoculated with the strains was determined to differentiate the

time to necrosis after inoculations. In these experiments cultures, of Xac-A 40, Xac-Aw

12879, Xac-A 40 (pU799-3), Xac-AwQ, and Xac-Awf (pU799-3) were compared.









Illustrations of the results are included in Figures 6-6 and 6-7. Growth of all strains was

about equal for the first four days after inoculation. However, at day six the populations

of the strains were different. At day ten the population of the Xac-A strain was the

greatest. The population of the Xac-Aw strain was about 1.5 log units lower than the Xac-

A strain. The Xac-AwQ strain reached a population intermediate between the Xac-A and

the Xac-A". The strains with the pU799-3 clone had the lowest populations.

In electrolyte leakage determinations the Xac-Aw strain and the Xac-A strains with

the clone pU799-3 began to increase at day four compared to that caused by Xac-A and

Xac-AwQ strains. At day eight the strains with the avirulence gene had significantly

greater electrolyte leakage than the strains that did not contain the avirulence gene. This

data confirmed the visual observations of necrosis caused by those strains.

DNA sequencing analysis. Sequence analysis of the 2.3 kb fragment in pU799-3

was determined. A 1599 bp nucleotide open reading frame (ORF) was found that was

sufficient for avrGfl activity. The complete sequence of the 2.3 kb, the avrGfl gene and

the primers used to amplify the avrGfl are shown in the Figure 6-9. The upstream regions

of this ORF do not contain a hrp box but do contain an imperfect PIP box TTCGT-N10-

TTCGC 80 bp upstream of the start codon (Huguet and Bonas, 1997). The GenBank

search identified significant homology with a gene in the genome of Xanthomonas

campestris pv. campestris (Xcc) str. 8004 (84 % identical). When an alignment was done

between the completely sequenced Xcc3600 gene and avrGfl using the clustal W (1.82)

multiple sequence alignment 84.99 % identity was found (Figure 6-10).

Discussion

A genomic library of an Xac-Aw strain was successfully produced and incorporated

into E. coli DH5a. For successful screening of the library for avirulence genes one would









normally transfer each clone into a strain that was pathogenic on the plant in question; in

this case into a strain of Xac-A. However, in previous experiments the transfer of clones

in pLAFR3 cosmid to strains of Xac-A did not occur at high frequency by triparental

matings (G. V. Minsavage, Plant Pathology Dept., University of Florida, Gainesville). To

circumvent this problem the Xac-Aw library was transferred from E. coli to strain 91-118

of X perforans by triparental conjugations and nearly 100 % of the matings were

successful. The X perforans strain contains the hrp genes (Bonas et al., 1991) necessary

for transfer of avirulence gene proteins into host cells, so it was thought that an

avirulence gene in the genome of Xac-Aw to grapefruit could be found by this procedure.

In fact, an avirulence gene in the Xac-Aw library was found. This procedure could

possibly be used to locate other avirulence genes when transfer of clones to a pathogen

occurs very infrequently during triparental matings with E. coli.

Three clones from the Xac-Aw library were obtained that produced an HR in

grapefruit leaves when expressed in X perforans. When the three clones were transferred

to the Xac-A strain only one caused an HR in grapefruit leaves. The two clones that did

not cause an HR probably have similar DNA sequences based on restriction enzyme

digestion (data not given). One of the clones, pL22, is being investigated further to

determine the reason that no HR occurred in grapefruit when expressed in the Xac-A

strain.

The clone that was expressed in Xac-A and that caused an HR in grapefruit leaves

did not cause an HR in leaves of Key lime. This is the same reaction as the Xac-Aw strain

in the two hosts. The importance of the avirulence gene in determination of the host

specificity of the Xac-Aw strain was further investigated by determining the presence of









the gene in other bacterial strains pathogenic to citrus. This gene was only found in Xac-

A" strains by PCR and Southern hybridization techniques. When the gene was mutated in

an Xac-Aw strain the symptoms caused by the mutated strain were similar to those caused

by the Xac-A strains. However, the symptoms were not quite the same. In addition the

growth of the mutated strain in grapefruit leaves was significantly greater than the wild-

type Xac-Aw strain but lower than the Xac-A strain. Therefore, the avirulence gene

avrGfl seems to be important in delimiting the pathogenic specificity of the Xac-Aw

strain.

An assumption could be made that another avr gene exists in the wild type of Xac-

Aw that prevents the symptoms of the mutated strain to be equal to as the wild-type Xac-

A strain and also prevents the populations of the two strains from being the same. There

could be another avr gene in the genomic library that was not identified because we only

screened 300 clones. More clones should be screened to search for another avr gene or

host range limiting factor.

Clones causing an HR in tomato, but not in grapefruit were also found in the

genomic library of Xac-A". Wild-type strains of Xac-A and Xac-Aw cause an HR in

tomato, but not in leaves of tobacco or pepper (Figure 6-1). Very little was done with

these clones in this work. It would be interesting to determine if those clones contain an

avirulence gene that provides the differential reactions in the three plants.














































Figure 6-1. Symptoms caused by Xac-A (left) and Xac-Aw (right) strains in tobacco,
tomato, and pepper leaves.


"" i, '* !" .*
.:v :
"


Ab
/
,


























Figure 6-2. Symptoms in grapefruit leaves after infiltration with the following bacterial
suspensions: 1= Xac-A 40; 2= Xac-A 40 (pL799-1); 3= Xac-A 40 (pL22); 4=
Xac-A 40 (pL622).


Figure 6 -3. Symptoms in Key lime leaves after infiltration with different bacterial
suspensions: 1= Xac-A 40; 2= Xac-A 40 (pL799-1); 3= Xac-A 40 (pL22); 4=
Xac-A 40 (pL622).































Figure 6-4. Symptoms in grapefruit following inoculation with Xac-A 40 strain (A), Xac-
A" 12879 strain (A") and Xac-Aw Q (3).


Figure 6-5. Symptoms in grapefruit after inoculation by needle pricks with Xac-A" strain
12879 (right top), Xac-Aw Q (bottom left), and Xac-A 40 (bottom right).


























2 4 6 8


Time (Days)

Figure 6-6. Bacterial populations in grapefruit leaves infiltrated with Xac-A 40; Xac-Aw
0; Xac-Aw 12879;Xac-A 40 (pU799-3), Xac-A" 0 (pU799-3) at various times
after inoculation.


0 2 4 6 8 10
Time (Days)

Figure 6-7. Electrolyte leakage in grapefruit leaves infiltrated with of Xac-A 40, Xac-
A"W, Xac-Aw 12879, Xac-A 40 (pU799-3), Xac-Aw O(pU799-3) at a
concentration of 5x108 cells (cfu/ml).









1 2 3 4 5 6 .7 8 91011 12 13 14 1 2 3 4 5 6 7 8 9 1011 1213 14


... ....... .... .. ...... -. i
Figure 6-8. Hybridization of the subclone pU799-3 fragment in avrGfl to total genomic
DNA of Xanthomonas strains digested with HindIII. Lanes 1= Xac-A"; 2=
Xac-Aw" ; 3= Xac-A 40; 4= Xac-A 306; 5=Xac- A* 1574; 6=Xac-A* 1575;
7= Xaa-B; 8=Xaa-C; 9= Xac-E 1887; 10= Xcc 8004; 11= Xac-Aw 12879; 12=
plasmid Xac-A"; 13= Plasmid Xac-A 40; 14= X Marker digested with HindIII.
Ethidium bromide stained gel on the left. Southern blot of gel on the right.








47



GATCGGCGCCAGGAAGGGCCTGCCATGTCACAACCTGATTCATCTGTGCCAAGACCACCTCGCACCGCGT
GCGCGCATGGTGTACTCCGCGTCTCCAAAGAAAGCTGCATCGCCATCTTCCGATTCGGCTCAGTGTGTCTT
TTTTGCAAGCGTCTGATGGGGGTTGGAGTTATTCAAGCCTCCCGAGTCAACGTGATGCGGACACGCTTAC
ACCAAACCGAAATGCATCGGTCCGCCTGGTGCGATCGCCGAGCTTTCGCACAGCCACTCGTTTGTGACAT
CGCTTTTTCGCATTCGAGATGCAGACAGCTCAGGCCTTCAGGAAAAATAGGTCGTCAATCCGGTAGCAGT
GAAATACACGGCGTTATATGCACATTTACGTCTTGTCATCCCGATGGCTTGTCGCTCCGGATCGCTGGTAA
CTCACCACGGTCGATGAGTGCCGCCAGCCCAGGCACGCACAGTCAACACGGCCTCGCCGCGGACTGATA
GCAATCTTCCATGTGATACCCGCAGAGTGGATCGATATGTCGTCGGTAGCGCGCGGCCATGCTTTTCATA
GTCCCTATTCCA CCATCAGCAC CTAGTCAACAAGCTCCGATGGCTCCGAGCATGCATTCGG
CGGCGTCGCCGGTTTCTGTCCTGCACTTGAGAGATACATCCATGGCTCCGAGCATGCATTCGGCGGCG
TCGCCGGTTTCTGTCCTGCACTTGAGAGATACATCCATGCGCACCAAAGCCCAACTCCCATTGACT
GCCATTCAACGGTTTCTTGCCCATGATGCAGCGTCAACGCAGGCCCCCTCTGCATCGGCATCCACA
TCGCTCCACAAAAATGAGACCGCAGGCTTGCTGGCAGCCTTGCCAGCGCGAAACGCCAGGCAAGG
AGCGCAGAGGAAGTCCGGCGAAAAAGAAGGCGCACGCCAAAACAACGGGGGCCGGGGCGGACAA
TGGGCATCTCGGGCGGCCAAGTACGCCCTGGGAATCGCCGGTGCTGGCTATGTTGCAGACAATTT
CGTTCTGTCCACGACATCGCTGGTCGATGGCAAAGGCGGCTTTACCAGTAATGATCGTTTGGATAA
AGCATGCGCAAAGGCCGAGACGTATTACGCCCGGTACCACAGTGCCACTGAGGATGAGCGTGCAT
CCCATAGCCGCCCCTTTGTACCGATCAGAACGTGCGGTTCCAACCAGTTCGCCACCATGACCGACT
ACCGCGCGGCGACCAAGGTCCATGTCGGTCATCTTTTCGACAGCCAAGCCGCGCGCGAATCGCTC
GTCACCAACCTCGCCTGCCTCAAGGGCGAGCGGATCAAGCAGGAGTGCATCATCAGGTATGCGCC
TGCGCAGGTGCCAGCGGATCCGGACCTAAGCAAGAGCGAGCTGTACGACAGGAAAAACAAGTACT
CGTTGGTTGGCATGCCCAACGCCCAAACCGGAGCAAGTGGATATACCTCACGCTCGATCACCCAGC
CCTTCATCAACCGCGGCATGGAGCATTTCAGACAGGCTTCACAGAGCGACAAGGCACTGTCCCTGA
GGCAGTGCATGCAATCGCTTGAACGGGCACTGCAGGACACTGACAAGCTTGGCAAGCAAGCACAG
CACGCCGCCGGCCAGGCAATCCTGAATTTCCGGCAGGTCTATGCGGCCGACGAGCATTGGGGTCA
CCCGGAGAAAGTCATCATGAAAACCCTGATCGCCAACGGACTGCTATCGCAAGAACAAACCGACA
GGATCGATGCGACCCTGATGTTCGAAGATCCCTCCATCAGTGTCCTGAAAAGAAATACCAGCATCG
CCGGACCGTTACTGCAAAAACTGGAAACGAAGATTCAGTCAAAACGTCTGCAGGATCAACCTGAAA
CGCTTGCAGACTTCATGGAAATGGCTAAGCAGAAGAACATGGAAGGCCTGCCGATCGCGCACTTC
AAACTCAACGCCGAAGGCACCGGTTTTGAAGACTGCTCTGGCCTGGGCGACTCGTTTACTAGTGCA
AATGCCGTTGCATGCATCAACCATGCACGCTTGATGAGCGGAGAGCCGCGCCTTTCGAAAGAGGA
TGTCGGTGTCGTGGTTGCCTGCCTCAATGCTGTATACGACGATGCCAGCAGCATCCGGCACTCGCT
TCATGAAATCGCACGCGGATGCTTCGTAGGTGCCGGCTATACAACGGAAGATGCCGATGCGTTCTA
TGAGCAGATTTGCAAGGATGCTGCACGGGCATTCTATGCAGGAAAGTCAATGACCAGCAGCGACT
AATCGCCCCCTTCCCACCTCATTGCGCTGACGCAACTTGGCGCCCGGTTGAGG



Figure 6-9. Nucleotide sequence of the 2.3 kb fragment of DNA from Xac-AW containing
avrGfl nucleotide sequencing (bold letters).The primer sequences used to
amplify a fragment of avrGfl by PCR are underlined. Imperfect PIP-box is
shaded in gray.








48



seq ------------------------------CTGATTTCCGTCCTGCACTCTAGGAGACCC
seq 2 ATGGCTCCGAGCATGCATTCGGCGGCGTCGCCGGTTTCTGTCCTGCACT-TGAGAGATAC
**** ********** **** *


seq 1 ATC-ATGCGAACAAAAACCTCACTGCCGTTGGCCACCGTCCAGCGGCTACTGACCCCTGG
seq 2 ATCCATGCGCACCAAAGCCCAACTCCCATTGACTGCCATTCAACGGTTTCTTGCCCATGA


seq 1 CACCTCCACCGGGTTATCCACCCCCGCGTCGGCGTCAGCCACTCCCTGTGCAGAAACGAC
seq 2 TGCAGCGTCAACGCAGGCCCCCTCTGCATCGGCATCCACATCGCTCCACAAAAATGAGAC



seq 1 GGCAGGCTTACTGGGAGCGTTGCCAACTCGAAAGAACAAGCAAAAACAGCAAAGCCAGCG
seq 2 CGCAGGCTTGCTGGCAGCCTTGCCAGCGCGAAACGCCAGGCAAGGAGCGCAGAG--GAAG



seq 1 TCCACCCAATACGCAGGACGGTACACCAAAGAATGGCAGAGACCATGGCGGACAGTGGGC
seq 2 TCCGGCGAAAAAGAAGGC--GCACGCCAAA--ACAACGGGGGCCGGGGCGGACAATGGGC


seq 1 AACACGAGCTGCCAAGTACGCTCTTGGCATTGCTGGCGCAGGCTATGTGGCAGACAACTT
seq 2 ATCTCGGGCGGCCAAGTACGCCCTGGGAATCGCCGGTGCTGGCTATGTTGCAGACAATTT


seq 1 CTTTCTTTCAACGACCTCGCTCCGCGACGGCAAGGCCGGATTTAGCAGCAATGATCGGCT
seq 2 CGTTCTGTCCACGACATCGCTGGTCGATGGCAAAGGCGGCTTTACCAGTAATGATCGTTT


seq 1 TGAGAAAGCATGCGTGAAAGCGGAGAGCTATCACGCGCGGTATCACAGCGCTACCGAAGG
seq 2 GGATAAAGCATGCGCAAAGGCCGAGACGTATTACGCCCGGTACCACAGTGCCACTGAGGA

seq AGAACGCGCATCGCACAGCCGTCCCTTCGTACCGATCAGAACGTGCGGGTCCAACCAGTT

seq 2 AGAGCGGCATCCATAGCCGCCCCTTCGTACCGATCAGAACGTGCGGTTCCAACCAGTT
seq 2 TGAGCGTGCATCCCATAGCCGCCCCTTTGTACCGATCAGAACGTGCGGTTCCAACCAGTT


seq 1 CGCCACCATGAGCGACTACCGTGCGGCGACCAAGGTTCATATCGGCCACCTCTTCGACAG
seq 2 CGCCACCATGACCGACTACCGCGCGGCGACCAAGGTCCATGTCGGTCATCTTTTCGACAG


seq 1 CCAGCACGCACGGCAATCGCTGCTCACCAACCTTGCCTGCCTCAAGGGCGAGCGCATCAG
seq 2 CCAAGCCGCCGCGGAATCGCTCGTCACCAACCTCGCCTGCCTCAAGGGCGAGCGGATCAA



seq 1 GGACGAGTGCATTGCCCAGTACGCCCCTACGCATGTCCCGGCCAATCCGGACCTGAGTAG
seq 2 GCAGGAGTGCATCATCAGGTATGCGCCTGCGCAGGTGCCAGCGGATCCGGACCTAAGCAA


seq 1 AAGCCCGCTCTACGAAACCAAGAACAAGTACTCTCTGACCGGCGTACCCAATGCTCAGAC
seq 2 GAGCGAGCTGTACGACAGGAAAAACAAGTACTCGTTGGTTGGCATGCCCAACGCCCAAAC


seq 1 CGGTGCAAGCGGATATACCTCACGATCAATCACCCAGCCCTTCATCAATCGCGGCATGCA
seq 2 CGGAGCAAGTGGATATACCTCACGCTCGATCACCCAGCCCTTCATCAACCGCGGCATGGA
*** ***** ************** ** ******************** ********* *

Figure 6-10. Alignment between the complete sequence of XCC3600 from Xanthomonas
campestris pv. campestris and the avrGfl using the clustal W (1.82) multiple
sequence alignment (seq_l xc3600 and seq_2 avrGFI). The Xcc 3600 gene
and avrGfl are 84.99 % similar.










seq 1
seq 2


seq 1
seq 2


seq 1
seq 2


seq 1
seq 2


seq 1
seq 2


Figure 6-10---continued.


Table 6-1. List of bacterial strains used in chapter 6


Bacterium
X perforans
91-118 (pL799-1)
91-118 (PL799-2)
91-118 (pL22)
91-118 (pL622)
Xa pv. citri
Xac-A 40 (pL799-1)
Xac-A 40 (PL799-2)
Xac-A 40 (pL22)
Xac-A 40 (pL622)
Xa pv. citri
Xac-Aw (pU799-3)
Xac-A" f
Xac-AWQ(pU799-3)
Xa pv. citri
Xa pv.citri
Xa pv.citri
Xa pv.aurantifolii
Xa pv. aurantifolii
Xa pv.citrumelo
Xc pv. campestris


Abbreviation


Original strain number Origin
J.B Jones
This work
This work
This work


Xac-A 40 (Xcc03-1633-1)


Xac-Aw




Xac-A 306
Xac-A*
Xac-A*
Xaa-B
Xaa-C
Xac-E
Xcc


12879




2422
1974
1975
1622
5979
1887
8004


This work
Ctes.
This work
This work
This work
This work
DPI
This work
This work
This work
DPI
DPI
DPI
DPI
DPI
DPI
DPI


Xanthomonas axonopodis pv. citri (Xac), Xanthomonas campestris pv. vesicatoria (Xcv),
Fl, Florida, provided by Robert Stall from DPI Gainesville Fl. Collection and Ctes,
Corrientes, provided by Nelly Canteros from INTA, Bella Vista, Corrientes, Argentina.


GCATTTCAAGCAGGATTCCCAGAGCGACAGAGCGTTGTCGCTCAAACAGTGCATGGAATT
GCATTTCAGACAGGCTTCACAGAGCGACAAGGCACTGTCCCTGAGGCAGTGCATGCAATC
GCTTGAACGTACACTGGAGGGCGACGACAAACTTGGCAAGCAGGCACAACACGCTGCCGG
GCTTGAACGGGCACTGGAGGACACTGACAAGCTTGGCAAGCAAGCACAGCACGCCGCCGG
GCTTGAACGGGCACTGCAGGACACTGACAAGCTTGGCAAGCAAGCACAGCACGCCGCCGG


CCAAGCGATCCTGAATTTCCGTCAGGTGTATGCCGCCGACGAGCATTGGGGACACCCCGA
CCAGGCAATCCTGAATTTCCGGCAGGTCTATGCGGCCGACGAGCATTGGGGTCACCCGGA

AAAAGTCATCATGAAAACGCTGATCGCCAACGGGCTGCTATCGCAGGAGCAAACGGACAG
GAAAGTCATCATGAAAACCCTGATCGCCAACGGACTGCTATCGCAAGAACAAACCGACAG


GATCGATGCGACCCTGATGTTCGAAGATCCGTCCATCAGCGTATTGAAAAAAAACACCAG
GATCGATGCGACCCTGATGTTCGAAGATCCCTCCATCAGTGTCCTGAAAAGAAATACCAG
****************************** ******** ** ****** *** *****














CHAPTER 7
DISCUSSION

Many pathogenically different strains of the causal agent of citrus canker

(Xanthomonas axonopodis pv. citri and X axonopodis pv. aurantifoli) have been

described. These strains sometimes differ genetically and pathologically. The variation

within the strains involved in citrus canker disease is not unusual. For example, the

xanthomonads that cause the bacterial spot disease of tomato and pepper consist of many

strains and some have significant genetic differences, resulting in different species of

Xanthomonas (Jones et al., 2004).

The Xac-Aw strain that was characterized by Sun et al. (2004) was found to be a

close relative of Xac-A even though they had pathogenic differences (Cubero and

Graham, 2002). Contrary to the xanthomonads that cause the bacterial spot disease of

pepper and tomato, there were no reports of a hypersensitive reaction (possible exception

Xac-C strain) responsible for host range differences. The characterization of the HR

caused by Xac-Aw in grapefruit leaves is new.

The Xac-Aw strains presented a problem for the eradication and regulation program

of the Division of Plant Industry (DPI) for citrus canker (Sun et al., 2004). After careful

consideration, DPI decided to destroy only Key lime and alemow plants in a 1900 ft

radius, and not other citrus plants, near the focus of disease caused by the Xac-Aw strain.

One of the considerations in establishing the program was the lack of knowledge of the

stability of the pathogenicity of the Xac-Aw strain. To obtain information on this

problem, we chose three avenues of research. We investigated the frequency of









development of mutants for host specificity of the Xac-Aw strain, the transfer of genes by

conjugation, and the search of the genome of the Xac-Aw strain for an avirulence gene.

We never were able to find a mutant of the Xac-Aw strain that was pathogenic on

grapefruit after treatment with the mutagen NTG. However, streptomycin and pigment

production mutants of the Xac-Aw strain developed in vitro. The methods used to find

mutants pathogenic to grapefruit were used previously with X campestris pv. vesicatoria

to find mutants for virulence on pepper plants with a plant resistance gene (Dahlbeck and

Stall, 1979). Mutants for change of race 2 to race 1, which occurred very frequently in X

campestris pv. vesicatoria, was due to an insertion element that inactivated an avirulence

gene (Kearney et al., 1990). In addition, inactivation of the avrBs2 gene in X campestris

pv. vesicatoria by several ways makes the pathogen susceptible to plants with the Bs2

gene for resistance. This has occurred frequently in the field (Gassmann et al., 2000).

Chromosomal genes were also transferred from donor to recipient in X campestris

pv. vesicatoria by conjugation (Basim, 1999). The hrp genes, which are involved in

pathogenicity and hypersensitivity in bacteria, were transferred in that work. The hrp

gene cluster contains ca. 25 kb of DNA. However, it is not known if the host specificity

genes in Xac-Aw are in the chromosome or in a plasmid. We did determine that a plasmid

can move by conjugation between strains of Xac and this was demonstrated by using

copper (Cu) resistant strains. It was determined that Cu resistance genes occur on a

plasmid in Xac-A from Argentina and in X axonopodis pv. citrumelo strains from

Florida. The Cu resistance genes from both pathogens were transferred to Cu sensitive

strains. Copper resistance was not found in strains of Xac-A from Florida (R.E. Stall,









personal communication). Copper resistance was associated with transfer of a large

plasmid.

The most important part of this work was that we found an avirulence gene,

avrGfl, in the genome of Xac-Aw that interacts with grapefruit leaves to cause an HR.

The avr gene was found to be located in the chromosome. This is the first report of an

avirulence gene in the genome of the citrus canker bacterium that functions in citrus. The

HR depends on a gene for resistance in grapefruit, based on the gene-for-gene hypothesis

(Minsavage, 1990b). The evidence for a resistance gene in the grapefruit genome will be

very difficult to obtain, because crossing between susceptible and resistant plants is

usually required. Genetic analysis of characteristics in citrus is difficult (Novelli et al.,

2000).

Identification of the Xac-Aw strain by the division of plant industry is currently

done by inoculation of citrus plants. In addition, the Xac-Aw strain can be identified by

serological means in an ELISA test (Sun et al., 2004). The primers selected in the

avirulence gene (avrGfl) can also be used to identify the Xac-Aw strain by PCR. The

avirulence gene was not found in other strains of xanthomonads pathogenic to citrus.

The regulation and eradication procedures of the Division of Plant Industry were

probably correct for the Xac-Aw strain. The factors for host specificity of the Xac-Aw

strain seem to be quite stable based on this work. Even if the single avrGfl gene is

responsible for host specificity, inactivation of the gene in the Xac-Aw genome does not

appear to be of a high frequency as occurs with avr genes in X campestris pv. vesicatoria

(Dahlbeck and Stall, 1979). One should note, however, that the frequency of inactivation









of avrGfl could change with the introduction of an insertion sequence (Kearney et al.,

1990).

The stability of the host specificity of the Xac-Aw strain could be the result of the

presence of a second avr gene in wild Xac-A". The fact that we did not obtain mutants

that were pathogenic to grapefruit when the cells of Xac-Aw were treated with the

mutagen NTG (Chapter 4) would support this. If only one gene was present, mutants

should have been found. If two genes were present in Xac-A", each of which was

important in susceptibility to grapefruit, one would not expect to find pathogenic mutants

after treatment with a mutagen. Other evidence for another avr gene in Xac-Aw was that

there were differences in populations and symptoms for the Xac-A strain with the mutant

lacking a functional avrGfl in comparison with the wild-type Xac-A.
















LIST OF REFERENCES


Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang,J., Zhang,Z., Miller,W. and Lipman,
D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res. 25: 3389-3402.

Basim, H., Stall, R.E., Minsavage, G.V., and Jones, J.B. 1999. Chromosomal gene
transfer by conjugation in the plant pathogen Xanthomonas axonopodis pv.
vesicatoria. Phytopathology 89: 1044-1049.

Belasque, J., Jr., Parra-Pedrazzoli, A.L., Rodrigues Neto, J., Yamamoto, P.T., Chagas, M.
C.M., Parra, J. R.P., Vinyard, B.T., and Hartung, J. S. 2005. Adult citrus leafminers
(Phillocnitis citrella) are not efficient vectors for Xanthomonas axonopodis pv.
citri. Plant Dis. 89: 590-594.

Bonas, U., Schulte, R., Fenselau, D., Minsavage, G.V, Staskawicz, B. and Stall, R.E
1991. Isolation of a cluster from Xanthomonas campestris pv. vesicatoria that
determines pathogenicity and the hypersensitive response on pepper and tomato.
Mol. Plant-Microbe Interact. 4: 81-85.

Canteros, B.I., Rybak, M., Naranjo, M., Gochez, A.; Minsavage, G.; Jones, J., and Stall,
R.E. 2004. Caracterizaci6n molecular de la resistencia al cobre en Xanthomonas
axonopodis pv. citri. CD Resumenes de los trabajos presentados. XV0 Reuni6n de
Comunicaciones Cientificas y Tecnicas. Corrientes, 4-6 Agosto 2004 FCA UNNE.
Resumen P020.

Cook, A.A., and Stall, R.E. 1968. Effect of Xanthomonas vesicatoria in loss of
electrolytes from leaves of Capsicum annuum. Phytopathology 58: 617-619.

Crute, I.R. 1985. Mechanisms of Resistance to Plant Diseases, ed, Fraser R, S.S. (Nijhoff
& Junk, Dordrecht, The Netherlands), pp. 80-142.

Cubero, J., and Graham, J. H. 2002. Genetic relationship among worldwide strains of
Xanthomonas causing canker in citrus species and design of new primers for their
identification by PCR. Appl. Environ. Microbiol. 68:1257-1264.

Cubero, J., and Graham J.H. 2004. The leucine-responsive regulatory protein (Irp) gene
for characterization of the relationship among Xanthomonas species. Int. J. Syst.
Evol. Microbiol. 54: 429-437.

Dahlbeck, D., and R.E. Stall 1979. Mutations for change of race in cultures of
Xanthomonas vesicatoria. Phytopathology 69: 634-636.









Daniels, M.J., Barber, C.E., Turner, D.C., Cleary, W.G., and Sawzyc, M. 1984. Isolation
of mutants of Xanthomonas campestris showing altered pathogenicity. J. Gen.
Microbiol. 130: 2447-2455.

Dopson, R.N. 1964. The eradication of citrus canker. Plant Dis. 48:30-31.

Ellingboe, A.H. 1976. Genetics of host-parasite interactions. In Physiological Plant
Pathology (Encyclopedia of Plant Physiology, New Series, vol. 4), pp. 761-778.
Edited by R. Heitefuss & P. H.Williams. Berlin: Springer.

Flor, H.H. 1955. Host-parasite interaction in flax rust-its genetics and other implications.
Phytopathololy 45: 680-685.

Gabriel, D.W., Burges, A., and Lazo, G.R. 1986. Gene-for-gene recognition of five
cloned avirulence genes from Xanthomonas campestris pv. malvacearum by
specific resistance genes in cotton. Proc. Natl. Acad. Sci. USA 83: 6415-6419.

Gabriel, D.W., Kingsley, M.T., Hunter, J.E., and Gottwald, T., 1989. Reinstatement of
Xanthomonas citri (ex Hasse) and X phaseoli (ex Smith) to species and
reclassification of all X. campestris pv. citri strains. Int. J. Syst. Bacteriol. 39: 14-
22.

Garnsey S.M., DuCharme, E.P., Lightfield J. W., Seymour, C.P., and Griffiths J.T.
1979. Citrus canker. Preventive action to protect the U.S. citrus industry. The
Citrus Industry. pp. 5-14.

Gassmann, W., Dahlbeck, D., Chesnokova, O., Minsavage, G.V., Jones, J. B., Staskawicz
B.J. 2000. Molecular evolution of virulence in natural field strains of Xanthomonas
campestris pv. vesicatoria. J. Bacteriol. 182: 7053-7059.

Gerhardt, P., Murray, R.G.E., Costilow, R.N., Nester, E.W., Wood, W.A., Krieg, N.R.
and Phillips, G.B., Editors, 1981. Manual of Methods for General Bacteriology.
American Society for Microbiology. Washington, DC pp. 226.

Goto, M., Takemura, I., and Yamanaka K. 1979. Leakage of electrolytes and amino acids
from susceptible and resistant citrus leaf tissues infected by Xanthomonas citri.
Ann. Phytopath. Soc. Japan 45: 625-634.

Gottwald, T.R., Graham, J.H., and Schubert, T.S. 1997a. An epidemiological analysis of
the spread of citrus canker in urban Miami, Florida, and synergistic interaction with
the Asian citrus leafminer. Fruits 52: 371-378.

Gottwald, T.R., Graham, J.H., and Schubert, T.S. 1997b. Citrus canker in urban Miami:
An analysis of spread and prognosis for the future. Citrus Industry 78: 72-78.

Gottwald, T.R., Graham, J.H., and Schubert, T.S. 2002a. Citrus canker: The pathogen and
its impact. Online. Plant Health Progress doi:10.1094/PHP-2002-0812-01-RV.









Gottwald, T. R., Sun, X, Riley, T., Graham, J.H., Ferrandino, F., and Taylor, E.L. 2002b.
Geo-referenced spatiotemporal analysis of the urban citrus canker epidemic in
Florida. Phytopathology. 92: 361-377.

Graham, J.H., and Gottwald, T.R. 1990. Variation in aggressiveness of Xanthomonas
campestris pv. citrumelo associated with citrus bacterial spot in Florida citrus
nurseries. Phytopathology: 80: 190-196.

Graham, J.H., and Gottwald, T.R. 1991. Research perspectives on eradication of citrus
bacterial disease in Florida. Plant Dis. 75: 1193-1200.

Graham, J. H., Gottwald, T. R., Cubero, J. and Achor, D. S. 2004. Xanthomonas
axonopodis pv. citri: factors affecting successful eradication of citrus canker.
Molecular Plant Pathology. 5: 1-15

Hartung J. S., and Civerolo, E. L. 1989. Restriction fragment length polymorphims
distinguish Xanthomonas campestris strains isolated from Florida citrus nurseries
from Xanthomonas campestris pv. citri. Pages 503-508 in: Proc. 7th Int. Conf.
Plant Path. Bacteria, Akademiai Kiado, Budapest, Hungary.

Hayward A. C. 1993. The hosts of Xanthomonas. Pages 1-19 in Xanthomonas. J. G.
Swings and E.L. Civerolo, eds. Chapman & Hall, London.

Hibberd, A. M., Stall, R. E., and Bassett, M. J. 1987. Different phenotypes associated
with incompatible races and resistance genes in bacterial spot disease of pepper.
Plant Dis. 71: 1075-1078.

Huguet, E. and Bonas, U. 1997. hrpF of Xanthomonas campestris pv. vesicatoria
encodes an 87-kDa protein with homology to NolX of Rhizobiumfredii. Mol. Plant
Microbe Interact. 10: 488-498.

Huguet, E, Hahn, K, Wengelnik, K., and U. Bonas U. 1998. hpaA mutants of
Xanthomonas ampestris pv. vesicatoria are affected in pathogenicity but retain the
ability to induce host-specific hypersensitive reaction. Molecular Microbiology
29:1379-1390.

Jenner, C., Hitchin, E., Mansfield, J., Walters, K., Betteridge, P., Teverson, D. Taylor, J.
(1991). Gene-for-gene interactions between Pseudomonas syringae pv.
phaseolicola and Phaseolus. Mol Plant-Microbe Interact. 4: 553-562.

Jones, B.J., Lacy, G.H., Bouzar, H., Stall, R.E., and Schaad, N.W. 2004. Reclassification
of the xanthomonads associated with bacterial spot disease of tomato and pepper.
System. Appl. Microbiol., 27: 755-762.

Kado, C.I., and Liu, S.T. 1981. Rapid procedure for detection and isolation of large and
small plasmids. J. Bacteriol. 145: 1365-1373.









Kearney, B., and B.J. Staskawicz 1990. Characterization of IS416 and its role in bacterial
spot disease of pepper and tomato. J. Bacteriol. 172: 143-148.

Klement, Z. 1963. Rapid detection of the pathogenicity of phytopathogenic
pseudomonads. Nature 199: 299-300.

Klement, Z. 1982. Hypersensitivity. In Phytopathogenic Prokaryotes, vol. 2, pp. 149-
177. Edited by M. S. Mount & G. H. Lacy. New York: Academic Press.

Koizumi, M. 1985. Citrus canker: The world situation. Pages 2-7 in: Citrus Canker: An
International Perspective. L. W. Timmer, ed. Citrus Research & Education Center,
University of Florida, Lake Alfred.

Leyns, F., DeCleene, M., Swings, J.G., and De Ley, J. 1984. The host range of genus
Xanthomonas. Bot. Rev. 50: 308-356.

Lorang, J.M., and Keen, N.T. 1995. Characterization of avrE from Pseudomonas
syringae pv. tomato: a hrp-linked avirulence locus consisting of at least two
transcriptional units. Mol. Plant-Microbe Interact. 8: 49-57.

Loucks, K.W. 1934. Citrus canker and its eradication in Florida. (Unpublished
manuscript. Original copy in the files of the Division of Plant Industry, Florida
Department of Agriculture, Gainesville).

Mansfield, J., Jenner, C., Hockenhull, R., Bennett, M.A., and Stewart, R. 1994.
Characterization of avrPphE, a gene for cultivar-specific avirulence from
Pseudomonas syringae pv. phaseolicola which is physically linked to hrpY, a new
hrp gene identified in the halo-blight bacterium. Mol. Plant-Microbe Interact. 7:
726-739.

Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Molecular cloning: A laboratory
Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 545 pp.

Marshall, J.K. 1968. Methods for leaf area measurement of large and small leaf samples.
Phytosynthetica 2: 41-47.

McEver, K. 2005. Canker eradication costly, but effective. Citrus & Vegetable
Magazine. pp. 13.

McLean, F.T. 1921. A study of the stomata of two species of citrus in relation to citrus
canker. Bul. Torr. Bot. Club 48: 101-106.

Metz, M., Dahlbeck, D., Morales, C., Al Sady, B., Clark, E., and Staskawicz, B. 2005.
The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a
virulence factor and suppresses host defense in Nicotiana benthamiana. The Plant
Journal 41: 801-814.









Minsavage, G.V., Canteros, B. I. and Stall, R. E. 1990a. Plasmid-mediated resistance to
streptomycin in Xanthomonas campestris pv. vesicatoria. Phytopathology 80: 719-
723.

Minsavage, G.V., Dahlbeck, D., Whalen, M.C., Keamey, B., Bonas, U., Staskawicz, B.J.
and Stall, R.E. 1990b. Gene-for-gene relationships specifying disease resistance in
Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe
Interact. 3: 41-47.

Novelli, V.M., Machado, M.A., and Lopes, C.R. 2000. Isoenzymatic polymorphism in
Citrus spp. and Poncirus trifoliata (L.) Raf (Rutaceae). Genet. Mol. Biol.23:163-
168.

Poplawsky, A.R and Chun W., 1997. pigB determines a diffusible factor needed for
extracellular polysaccharide slime and xanthomonadin production in Xanthomonas
campestris pv. campestris. J. Bacteriol. 179: 439-444.

Ronald, P.C., and Staskawicz B. 1988.The avirulence gene avrBs] from Xanthomonas
campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant-Microbe Interact 1:
191-198.

Rossetti, V.E. Feichtenberger, and M.L. Silveira 1982. Citrus Canker: An analytical
bibliography. Institute Biologico, Sao Paulo. 230 p.

Schoulties, C.L., Civerolo, E.L, Miller, J.W., Stall, R.E., Krass, C.J., Poe, S.R and
DuCharme,. E.P. 1987. Citrus canker in Florida. Plant Dis. 71: 388-395.

Schubert, T. S., Miller, J. W., and Gabriel, D.W. 1996. Another outbreak of bacterial
canker on citrus in Florida. Plant Dis. 80:1208.

Schubert, T. S., Rizvi, S. A., Sun, X. A., Gottwald, T.R., Graham, J. H, and Dixon,. W.
N. 2001. Meeting the challenge of eradicating citrus canker in Florida-again. Plant
Dis. 85: 340-356.

Stall, R.E. and E. L. Civerolo 1991. Research relating to the recent outbreak of citrus
canker in Florida. Annu. Rev. Phytopathology 29: 399-420.

Stall, R.E., Loschke, D.C., and Jones, J.B. 1986. Linkage of copper resistance and
avirulence loci on self-transmissible plasmid in Xanthomonas campestris pv.
vesicatoria. Phythopathology 76: 240-243.

Stall, R.E., Marco, G.M., and Canteros de Echenique, B. I. 1982a. Importance of
mesophyll in mature-leaf resistance to citrus canker. Phytopathology 72: 1097-
1100.

Stall, R.E., Miller, J.W., Marco, G.M., and Canteros, B.I. 1982b. Pathogenicity of three
strains of the citrus canker organism on grapefruit. Fifth Int. Conf. Plant Path.
Bacteria Proc. CIAT. Cali, Colombia pp 334-340.









Stall, R.E. and C.P. Seymour. 1983. Canker, a threat to citrus in the Gulf-Coast States.
Plant Dis. 67: 581-585.

Staskawicz, B.J., Dahlbeck, D., and Keen, N.T. 1984. Cloned avirulence gene of
Pseudomonas syringae pv. glycinea determines race-specific incompatibility on
Glycine max (L.) Merr. Proc. Natl. Acad. Sci. USA 81: 6024-6028.

Sun, X., Stall, R.E., Jones, J.B., Cubero, J., Gottwald, T.R., Graham, J.H., Dixon, W.N.,
Schubert, T.S., Chaloux, P.H., Stromberg, V.K., Lacy, G.H. and Sutton, B.D. 2004.
Detection and characterization of a new strain of citrus canker bacteria from
Key/Mexican lime and Alemow in South Florida. Plant Dis. 88: 1179-1188.

Tamaki, S., Dahlbeck, D., Staskawicz, B.J. and Keen, N.T. 1988. Characterization and
expression of two avirulence genes cloned from Pseudomonas syringae pv.
glycinea. JBacteriol 170, 4846-4854.

USDA, Statistical Service, 2004. United States Department of Agriculture. National
Agricultural Statistics Service. Citrus Fruits 2004 Summary Agricultural Statistics
Board September 2004 1 NASS, USDA.

Vauterin, L., Hoste, B., Kersters, K., and Swings, J. 1995. Reclassification of
Xanthomonas. Int. J. Syst. Bacteriol. 45: 472-489.

Vauterin, L., Swings, J., Kersters, K., Gillis, M., Mew, T.W., Schroth, M.N., Palleroni,
N.J., Hildebrand, D.C., Stead, D.E., Civerolo, E.L., Hayward, A.C., Maraite, H.,
Stall, R.E., Vidaver, A.K. and Bradbury, J.F. 1990. Towards an improved
taxonomy of Xanthomonas. Int. J. Syst. Bacteriol. 40: 312-316.

Vauterin L., Yang P., Hoste B., Vancanneyt M., Civerolo E.L., Swings J. and Kersters K.
1991. Differentiation of Xanthomonas campestris pv. citri strains by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis of proteins, fatty acid analysis,
and DNA-DNA hybridization. Int. J. of Syst. Bacteriol. 41: 535-542.

Verniere, C., Hartung, O.P. Pruvost, E.L., Civerolo, A.M. Alvarez, P. Maestri, and
Luisetti, J. 1998. Characterization of phenotypically distinct strains of
Xanthomonas axonopodis pv. citri from Southwest Asia. European Journal of Plant
Pathology. 104: 477-487.

Viloria, Z., Drouillard, D.L., Graham, J.H, and Grosser J.W. 2004. Screening triploid
hybrids of 'Lakeland' limequat for resistance to citrus canker. Plant Dis. 88: 1056-
-1060.






60


Whalen, M.C., Wang, J.F., Carland, F.M., Heiskell, M.E., Dahlbeck, D., Minsavage,
G.V., Jones, J.B., Scott, J.W., Stall, R.E., and Staskawicz, B.J. 1993. Avirulence
gene avrRxv from Xanthomonas campestris pv. vesicatoria specifies resistance on
tomato lines Hawaii 7998. Mol. Plant-Microbe Interact. 6: 616-627.

Young, J.M., Bradbury, J.F., Gardan, L., Gvozdyak, R.I., Stead, D.E., Takikawa, Y., and
Vidaver, A.K., 1991. Comment on the reinstatement of Xanthomonas citri (ex
Hasse 1915) Gabriel et al. 1989 and X phaseoli (ex Smith 1897) Gabriel et al.
1989: indication of the need for minimal standards for the genus Xanthomonas. Int.
J. Syst. Bacteriol. 41: 172-177.















BIOGRAPHICAL SKETCH

Myrian Rybak was born in Leandro N. Alem, Misiones, Republica Argentina, on

June 29, 1967. She is the daughter of Veronica Kuyesen and Jose Rybak.

Myrian graduated from the Nacional University of the Northeast in Corrientes,

Argentina, in 1992 with the Agricultural Engineer degree. In 1993 she began to work in

the National Institute of Agricultural Technology (INTA). In April-May of 1995 Myrian

was awarded a fellowship of Rotary International, Exchange Study Groups (IGE),

Mexico. In 1998 she was awarded a fellowship to pursue graduate studies in the

University of La Plata, La Plata, Buenos Aires, Argentina. She graduated with the

master's degree in 2000.

In 2001 she was awarded a fellowship from INTA-FULBRIGHT to pursue

graduate studies in the United States.

Myrian enrolled at the University of Florida in Fall 2001 with Dr. Jeffrey Jones as

her adviser. She is currently a candidate for the degree of Doctor in Philosophy. At the

end of her studies she will resume her position in INTA, Argentina.

Myrian was awarded the Francis Aloysius Wood Memorial Award in recognition

of outstanding graduate student research in plant pathology at the College of Agricultural

and Life Sciences, on March, 2005.

Myrian is a member of Argentinean Society of Horticulture (ASHAO),

International Society of Citriculture (ISC), Professional Council of Agricultural Engineers

(CPIA) and American Phytopathological Society (APS)